_id stringlengths 64 64 | repository stringlengths 6 84 | name stringlengths 4 110 | content stringlengths 0 248k | license null | download_url stringlengths 89 454 | language stringclasses 7
values | comments stringlengths 0 74.6k | code stringlengths 0 248k |
|---|---|---|---|---|---|---|---|---|
6f3e9152d7d1f9a0a09554077cbd4661259c0e72b04c787a4bfb6d09c668965b | haskell-mafia/mismi | Data.hs | # LANGUAGE NoImplicitPrelude #
{-# LANGUAGE OverloadedStrings #-}
module Mismi.IAM.Core.Data (
IamRole (..)
) where
import P
newtype IamRole =
IamRole {
iamRole :: Text
} deriving (Eq, Show, Ord)
| null | https://raw.githubusercontent.com/haskell-mafia/mismi/f6df07a52c6c8b1cf195b58d20ef109e390be014/mismi-iam-core/src/Mismi/IAM/Core/Data.hs | haskell | # LANGUAGE OverloadedStrings # | # LANGUAGE NoImplicitPrelude #
module Mismi.IAM.Core.Data (
IamRole (..)
) where
import P
newtype IamRole =
IamRole {
iamRole :: Text
} deriving (Eq, Show, Ord)
|
408aea0f07f58a268e0f34e1f0dd81bf00d0704915b45a97d35dda4c23a34cc8 | haskell-compat/base-compat | Compat.hs | # LANGUAGE CPP , NoImplicitPrelude #
module Control.Monad.Compat (
module Base
, Monad
#if MIN_VERSION_base(4,9,0)
, MonadFail
#endif
, fail
, MonadPlus(..)
#if !(MIN_VERSION_base(4,8,0))
, foldM
, foldM_
, forM
, forM_
, guard
, mapM
, mapM_
, msum
, sequence
, sequence_
, unless
, when
, (<$!>)
#endif
#if !(MIN_VERSION_base(4,9,0))
, forever
, filterM
, mapAndUnzipM
, zipWithM
, zipWithM_
, replicateM
, replicateM_
#endif
) where
#if MIN_VERSION_base(4,9,0)
import Control.Monad as Base hiding (fail)
import Control.Monad.Fail as Base
#else
import Control.Monad as Base hiding (
forever
, filterM
, mapAndUnzipM
, zipWithM
, zipWithM_
, replicateM
, replicateM_
# if !(MIN_VERSION_base(4,8,0))
, foldM
, foldM_
, forM
, forM_
, guard
, mapM
, mapM_
, msum
, sequence
, sequence_
, unless
, when
# endif
)
import Control.Applicative
import Data.Foldable.Compat
import Data.Traversable
import Prelude.Compat
#endif
#if !(MIN_VERSION_base(4,8,0))
-- | Conditional execution of 'Applicative' expressions. For example,
--
> when debug ( putStrLn " Debugging " )
--
will output the string @Debugging@ if the Boolean value @debug@
-- is 'True', and otherwise do nothing.
when :: (Applicative f) => Bool -> f () -> f ()
# INLINEABLE when #
{-# SPECIALISE when :: Bool -> IO () -> IO () #-}
{-# SPECIALISE when :: Bool -> Maybe () -> Maybe () #-}
when p s = if p then s else pure ()
| @'guard ' b@ is @'pure ' ( ) @ if is ' True ' ,
and ' empty ' if is ' False ' .
guard :: (Alternative f) => Bool -> f ()
guard True = pure ()
guard False = empty
-- | The reverse of 'when'.
unless :: (Applicative f) => Bool -> f () -> f ()
# INLINEABLE unless #
{-# SPECIALISE unless :: Bool -> IO () -> IO () #-}
{-# SPECIALISE unless :: Bool -> Maybe () -> Maybe () #-}
unless p s = if p then pure () else s
| The ' foldM ' function is analogous to ' foldl ' , except that its result is
encapsulated in a monad . Note that ' foldM ' works from left - to - right over
the list arguments . This could be an issue where @('>>')@ and the ` folded
function ' are not commutative .
> foldM f a1 [ x1 , x2 , ... , xm ]
= =
> do
> a2 < - f a1 x1
> a3 < - f a2 x2
> ...
> f am xm
If right - to - left evaluation is required , the input list should be reversed .
Note : ' foldM ' is the same as ' foldlM '
encapsulated in a monad. Note that 'foldM' works from left-to-right over
the list arguments. This could be an issue where @('>>')@ and the `folded
function' are not commutative.
> foldM f a1 [x1, x2, ..., xm]
==
> do
> a2 <- f a1 x1
> a3 <- f a2 x2
> ...
> f am xm
If right-to-left evaluation is required, the input list should be reversed.
Note: 'foldM' is the same as 'foldlM'
-}
foldM :: (Foldable t, Monad m) => (b -> a -> m b) -> b -> t a -> m b
{-# INLINEABLE foldM #-}
# SPECIALISE foldM : : ( a - > b - > IO a ) - > a - > [ b ] - > IO a #
# SPECIALISE foldM : : ( a - > b - > Maybe a ) - > a - > [ b ] - > Maybe a #
foldM = foldlM
-- | Like 'foldM', but discards the result.
foldM_ :: (Foldable t, Monad m) => (b -> a -> m b) -> b -> t a -> m ()
{-# INLINEABLE foldM_ #-}
{-# SPECIALISE foldM_ :: (a -> b -> IO a) -> a -> [b] -> IO () #-}
{-# SPECIALISE foldM_ :: (a -> b -> Maybe a) -> a -> [b] -> Maybe () #-}
foldM_ f a xs = foldlM f a xs >> return ()
infixl 4 <$!>
-- | Strict version of 'Data.Functor.<$>'.
--
/Since : 4.8.0.0/
(<$!>) :: Monad m => (a -> b) -> m a -> m b
{-# INLINE (<$!>) #-}
f <$!> m = do
x <- m
let z = f x
z `seq` return z
#endif
#if !(MIN_VERSION_base(4,9,0))
-- | @'forever' act@ repeats the action infinitely.
forever :: (Applicative f) => f a -> f b
# INLINE forever #
forever a = let a' = a *> a' in a'
-- Use explicit sharing here, as it is prevents a space leak regardless of
-- optimizations.
-- | This generalizes the list-based 'filter' function.
# INLINE filterM #
filterM :: (Applicative m) => (a -> m Bool) -> [a] -> m [a]
filterM p = foldr (\ x -> liftA2 (\ flg -> if flg then (x:) else id) (p x)) (pure [])
| The ' mapAndUnzipM ' function maps its first argument over a list , returning
-- the result as a pair of lists. This function is mainly used with complicated
-- data structures or a state-transforming monad.
mapAndUnzipM :: (Applicative m) => (a -> m (b,c)) -> [a] -> m ([b], [c])
# INLINE mapAndUnzipM #
mapAndUnzipM f xs = unzip <$> traverse f xs
-- | The 'zipWithM' function generalizes 'zipWith' to arbitrary applicative functors.
zipWithM :: (Applicative m) => (a -> b -> m c) -> [a] -> [b] -> m [c]
# INLINE zipWithM #
zipWithM f xs ys = sequenceA (zipWith f xs ys)
-- | 'zipWithM_' is the extension of 'zipWithM' which ignores the final result.
zipWithM_ :: (Applicative m) => (a -> b -> m c) -> [a] -> [b] -> m ()
# INLINE zipWithM _ #
zipWithM_ f xs ys = sequenceA_ (zipWith f xs ys)
| @'replicateM ' n act@ performs the action @n@ times ,
-- gathering the results.
replicateM :: (Applicative m) => Int -> m a -> m [a]
# INLINEABLE replicateM #
# SPECIALISE replicateM : : Int - > IO a - > IO [ a ] #
# SPECIALISE replicateM : : Int - > Maybe a - > Maybe [ a ] #
replicateM cnt0 f =
loop cnt0
where
loop cnt
| cnt <= 0 = pure []
| otherwise = liftA2 (:) f (loop (cnt - 1))
-- | Like 'replicateM', but discards the result.
replicateM_ :: (Applicative m) => Int -> m a -> m ()
# INLINEABLE replicateM _ #
# replicateM _ : : Int - > IO a - > IO ( ) #
# replicateM _ : : Int - > Maybe a - > Maybe ( ) #
replicateM_ cnt0 f =
loop cnt0
where
loop cnt
| cnt <= 0 = pure ()
| otherwise = f *> loop (cnt - 1)
#endif
| null | https://raw.githubusercontent.com/haskell-compat/base-compat/847aa35c4142f529525ffc645cd035ddb23ce8ee/base-compat/src/Control/Monad/Compat.hs | haskell | | Conditional execution of 'Applicative' expressions. For example,
is 'True', and otherwise do nothing.
# SPECIALISE when :: Bool -> IO () -> IO () #
# SPECIALISE when :: Bool -> Maybe () -> Maybe () #
| The reverse of 'when'.
# SPECIALISE unless :: Bool -> IO () -> IO () #
# SPECIALISE unless :: Bool -> Maybe () -> Maybe () #
# INLINEABLE foldM #
| Like 'foldM', but discards the result.
# INLINEABLE foldM_ #
# SPECIALISE foldM_ :: (a -> b -> IO a) -> a -> [b] -> IO () #
# SPECIALISE foldM_ :: (a -> b -> Maybe a) -> a -> [b] -> Maybe () #
| Strict version of 'Data.Functor.<$>'.
# INLINE (<$!>) #
| @'forever' act@ repeats the action infinitely.
Use explicit sharing here, as it is prevents a space leak regardless of
optimizations.
| This generalizes the list-based 'filter' function.
the result as a pair of lists. This function is mainly used with complicated
data structures or a state-transforming monad.
| The 'zipWithM' function generalizes 'zipWith' to arbitrary applicative functors.
| 'zipWithM_' is the extension of 'zipWithM' which ignores the final result.
gathering the results.
| Like 'replicateM', but discards the result. | # LANGUAGE CPP , NoImplicitPrelude #
module Control.Monad.Compat (
module Base
, Monad
#if MIN_VERSION_base(4,9,0)
, MonadFail
#endif
, fail
, MonadPlus(..)
#if !(MIN_VERSION_base(4,8,0))
, foldM
, foldM_
, forM
, forM_
, guard
, mapM
, mapM_
, msum
, sequence
, sequence_
, unless
, when
, (<$!>)
#endif
#if !(MIN_VERSION_base(4,9,0))
, forever
, filterM
, mapAndUnzipM
, zipWithM
, zipWithM_
, replicateM
, replicateM_
#endif
) where
#if MIN_VERSION_base(4,9,0)
import Control.Monad as Base hiding (fail)
import Control.Monad.Fail as Base
#else
import Control.Monad as Base hiding (
forever
, filterM
, mapAndUnzipM
, zipWithM
, zipWithM_
, replicateM
, replicateM_
# if !(MIN_VERSION_base(4,8,0))
, foldM
, foldM_
, forM
, forM_
, guard
, mapM
, mapM_
, msum
, sequence
, sequence_
, unless
, when
# endif
)
import Control.Applicative
import Data.Foldable.Compat
import Data.Traversable
import Prelude.Compat
#endif
#if !(MIN_VERSION_base(4,8,0))
> when debug ( putStrLn " Debugging " )
will output the string @Debugging@ if the Boolean value @debug@
when :: (Applicative f) => Bool -> f () -> f ()
# INLINEABLE when #
when p s = if p then s else pure ()
| @'guard ' b@ is @'pure ' ( ) @ if is ' True ' ,
and ' empty ' if is ' False ' .
guard :: (Alternative f) => Bool -> f ()
guard True = pure ()
guard False = empty
unless :: (Applicative f) => Bool -> f () -> f ()
# INLINEABLE unless #
unless p s = if p then pure () else s
| The ' foldM ' function is analogous to ' foldl ' , except that its result is
encapsulated in a monad . Note that ' foldM ' works from left - to - right over
the list arguments . This could be an issue where @('>>')@ and the ` folded
function ' are not commutative .
> foldM f a1 [ x1 , x2 , ... , xm ]
= =
> do
> a2 < - f a1 x1
> a3 < - f a2 x2
> ...
> f am xm
If right - to - left evaluation is required , the input list should be reversed .
Note : ' foldM ' is the same as ' foldlM '
encapsulated in a monad. Note that 'foldM' works from left-to-right over
the list arguments. This could be an issue where @('>>')@ and the `folded
function' are not commutative.
> foldM f a1 [x1, x2, ..., xm]
==
> do
> a2 <- f a1 x1
> a3 <- f a2 x2
> ...
> f am xm
If right-to-left evaluation is required, the input list should be reversed.
Note: 'foldM' is the same as 'foldlM'
-}
foldM :: (Foldable t, Monad m) => (b -> a -> m b) -> b -> t a -> m b
# SPECIALISE foldM : : ( a - > b - > IO a ) - > a - > [ b ] - > IO a #
# SPECIALISE foldM : : ( a - > b - > Maybe a ) - > a - > [ b ] - > Maybe a #
foldM = foldlM
foldM_ :: (Foldable t, Monad m) => (b -> a -> m b) -> b -> t a -> m ()
foldM_ f a xs = foldlM f a xs >> return ()
infixl 4 <$!>
/Since : 4.8.0.0/
(<$!>) :: Monad m => (a -> b) -> m a -> m b
f <$!> m = do
x <- m
let z = f x
z `seq` return z
#endif
#if !(MIN_VERSION_base(4,9,0))
forever :: (Applicative f) => f a -> f b
# INLINE forever #
forever a = let a' = a *> a' in a'
# INLINE filterM #
filterM :: (Applicative m) => (a -> m Bool) -> [a] -> m [a]
filterM p = foldr (\ x -> liftA2 (\ flg -> if flg then (x:) else id) (p x)) (pure [])
| The ' mapAndUnzipM ' function maps its first argument over a list , returning
mapAndUnzipM :: (Applicative m) => (a -> m (b,c)) -> [a] -> m ([b], [c])
# INLINE mapAndUnzipM #
mapAndUnzipM f xs = unzip <$> traverse f xs
zipWithM :: (Applicative m) => (a -> b -> m c) -> [a] -> [b] -> m [c]
# INLINE zipWithM #
zipWithM f xs ys = sequenceA (zipWith f xs ys)
zipWithM_ :: (Applicative m) => (a -> b -> m c) -> [a] -> [b] -> m ()
# INLINE zipWithM _ #
zipWithM_ f xs ys = sequenceA_ (zipWith f xs ys)
| @'replicateM ' n act@ performs the action @n@ times ,
replicateM :: (Applicative m) => Int -> m a -> m [a]
# INLINEABLE replicateM #
# SPECIALISE replicateM : : Int - > IO a - > IO [ a ] #
# SPECIALISE replicateM : : Int - > Maybe a - > Maybe [ a ] #
replicateM cnt0 f =
loop cnt0
where
loop cnt
| cnt <= 0 = pure []
| otherwise = liftA2 (:) f (loop (cnt - 1))
replicateM_ :: (Applicative m) => Int -> m a -> m ()
# INLINEABLE replicateM _ #
# replicateM _ : : Int - > IO a - > IO ( ) #
# replicateM _ : : Int - > Maybe a - > Maybe ( ) #
replicateM_ cnt0 f =
loop cnt0
where
loop cnt
| cnt <= 0 = pure ()
| otherwise = f *> loop (cnt - 1)
#endif
|
f2420b23b1f288af7c91489100e9bd9eeb3d4575a42d13b9083c3415385441bf | awolven/VkTk | imgui-package.lisp | Copyright 2019 < >
;;
;; Permission is hereby granted, free of charge, to any person obtaining
;; a copy of this software and associated documentation files (the
" Software " ) , to deal in the Software without restriction , including
;; without limitation the rights to use, copy, modify, merge, publish,
distribute , sublicense , and/or sell copies of the Software , and to
permit persons to whom the Software is furnished to do so , subject to
;; the following conditions:
;;
;; The above copyright notice and this permission notice shall be
included in all copies or substantial portions of the Software .
;;
THE SOFTWARE IS PROVIDED " AS IS " , WITHOUT WARRANTY OF ANY KIND ,
;; EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
;; MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
;; NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE
LIABLE FOR ANY CLAIM , DAMAGES OR OTHER LIABILITY , WHETHER IN AN ACTION
;; OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION
;; WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
(in-package :cl-user)
(defpackage :imgui
(:nicknames :ig)
(:use :cl :cffi)
(:shadow)
(:export #:bullet-text
#:show-demo-window
#:begin
#:end
#:set-next-window-pos
#:set-next-window-size
#:set-cursor-screen-pos
#:text
#:push-item-width
#:pop-item-width
#:calc-item-width
#:push-text-wrap-pos
#:push-allow-keyboard-focus
#:pop-allow-keyboard-focus
#:push-button-repeat
#:pop-button-repeat
#:separator
#:same-line
#:new-line
#:spacing
#:dummy
#:indent
#:unindent
#:begin-group
#:end-group
#:imgui-get-cursor-pos
#:get-cursor-pos-x
#:get-cursor-pos-y
#:get-cursor-start-pos
#:get-cursor-screen-pos
#:align-text-to-frame-padding
#:get-text-line-height
#:get-frame-height-with-spacing
#:push-id
#:pop-id
#:get-id
#:text-unformatted
#:text-colored
#:text-disabled
#:text-wrapped
#:label-text
#:button
#:small-button
#:invisible-button
#:arrow-button
;;#:image
#:image-button
#:checkbox
#:checkbox-flags
#:radio-button
#:progress-bar
#:bullet
#:begin-combo
#:end-combo
#:combo
#:drag-float
#:drag-float2
#:drag-float3
#:drag-float4
#:drag-float-range2
#:drag-int
#:drag-int2
#:drag-int3
#:drag-int-range2
#:drag-scalar
#:drag-scalar-n
#:slider-float
#:slider-float2
#:slider-float3
#:slider-float4
#:slider-angle
#:slider-int
#:slider-int2
#:slider-int3
#:slider-int4
#:slider-scalar
#:slider-scalar-n
#:input-text
#:input-text-multiline
#:input-float
#:input-float2
#:input-float3
#:input-float4
#:input-int
#:input-int2
#:input-int3
#:input-int4
#:input-double
#:input-scalar
#:input-scalar-n
#:color-edit
#:color-edit3
#:color-edit4
#:color-picker3
#:color-picker4
#:color-button
#:set-color-edit-options
#:tree-node
#:tree-node-ex
#:tree-push
#:tree-pop
#:tree-advance-to-label-pos
#:get-tree-node-to-label-spacing
#:set-next-tree-node-open
#:collapsing-header
#:selectable
#:list-box
#:list-box-header
#:list-box-footer
#:plot-lines
#:plot-histogram
#:begin-main-menu-bar
#:end-main-menu-bar
#:begin-menu-bar
#:end-menu-bar
#:end-menu
#:begin-tooltip
#:end-tooltip
#:set-tooltip
#:open-popup
#:begin-popup
#:begin-popep-context-item
#:begin-popup-context-window
#:begin-popup-context-void
#:begin-popup-modal
#:end-popup
#:begin-child
#:bool-receptor
#:flags-receptor
#:get-receptor-value
#:log-finish
#:log-text
#:log-to-clipboard
#:key-pressed-p
#:menu-item
#:begin-menu
#:ImVec2_Simple
#:ImVec2_ImVec2
#:ImVec2_destroy
#:ImVec2_ImVec2Float
#:ImVec4_ImVec4
#:ImVec4_destroy
#:ImVec4_ImVec4Float
#:ImGuiWindowFlags_NoTitleBar
#:ImGuiWindowFlags_NoResize
#:ImGuiWindowFlags_NoMove
#:ImGuiWindowFlags_NoScrollbar
#:ImGuiWindowFlags_NoScrollWithMouse
#:ImGuiWindowFlags_NoCollapse
#:ImGuiWindowFlags_AlwaysAutoResize
#:ImGuiWindowFlags_NoBackground
#:ImGuiWindowFlags_NoMouseInputs
#:ImGuiWindowFlags_NoSavedSettings
#:ImGuiWindowFlags_NoInputs
#:ImGuiWindowFlags_MenuBar
#:ImGuiWindowFlags_HorizontalScrollbar
#:ImGuiWindowFlags_NoFocusOnAppearing
#:ImGuiWindowFlags_NoBringToFrontOnFocus
#:ImGuiWindowFlags_AlwaysVerticalScrollbar
#:ImGuiWindowFlags_AlwaysHorizontalScrollbar
#:ImGuiWindowFlags_AlwaysUseWindowPadding
#:ImGuiWindowFlags_ResizeFromAnySide
#:ImGuiWindowFlags_NoNavInputs
#:ImGuiWindowFlags_NoNavFocus
#:ImGuiWindowFlags_UnsavedDocument
#:ImGuiWindowFlags_NoNav
#:ImGuiWindowFlags_NoDecoration
#:ImGuiWindowFlags_NavFlattened
#:ImGuiWindowFlags_ChildWindow
#:ImGuiWindowFlags_Tooltip
#:ImGuiWindowFlags_Popup
#:ImGuiWindowFlags_Modal
#:ImGuiWindowFlags_ChildMenu
#:ImGuiInputTextFlags_CharsDecimal
#:ImGuiInputTextFlags_CharsHexadecimal
#:ImGuiInputTextFlags_CharsUppercase
#:ImGuiInputTextFlags_CharsNoBlank
#:ImGuiInputTextFlags_AutoSelectAll
#:ImGuiInputTextFlags_EnterReturnsTrue
#:ImGuiInputTextFlags_CallbackCompletion
#:ImGuiInputTextFlags_CallbackHistory
#:ImGuiInputTextFlags_CallbackAlways
#:ImGuiInputTextFlags_CallbackCharFilter
#:ImGuiInputTextFlags_AllowTabInput
#:ImGuiInputTextFlags_CtrlEnterForNewLine
#:ImGuiInputTextFlags_NoHorizontalScroll
#:ImGuiInputTextFlags_AlwaysInsertMode
#:ImGuiInputTextFlags_ReadOnly
#:ImGuiInputTextFlags_Password
#:ImGuiInputTextFlags_NoUndoRedo
#:ImGuiTreeNodeFlags_Selected
#:ImGuiTreeNodeFlags_Framed
#:ImGuiTreeNodeFlags_AllowItemOverlap
#:ImGuiTreeNodeFlags_NoTreePushOnOpen
#:ImGuiTreeNodeFlags_NoAutoOpenOnLog
#:ImGuiTreeNodeFlags_DefaultOpen
#:ImGuiTreeNodeFlags_OpenOnDoubleClick
#:ImGuiTreeNodeFlags_OpenOnArrow
#:ImGuiTreeNodeFlags_Leaf
#:ImGuiTreeNodeFlags_Bullet
#:ImGuiTreeNodeFlags_FramePadding
#:ImGuiTreeNodeFlags_NavLeftJumpsBackHere
#:ImGuiTreeNodeFlags_CollapsingHeader
#:ImGuiSelectableFlags_DontClosePopups
#:ImGuiSelectableFlags_SpanAllColumns
#:ImGuiSelectableFlags_AllowDoubleClick
#:ImGuiComboFlags_PopupAlignLeft
#:ImGuiComboFlags_HeightSmall
#:ImGuiComboFlags_HeightRegular
#:ImGuiComboFlags_HeightLarge
#:ImGuiComboFlags_HeightLargest
#:ImGuiComboFlags_HeightMask_
#:ImGuiFocusedFlags_ChildWindows
#:ImGuiFocusedFlags_RootWindow
#:ImGuiFocusedFlags_RootAndChildWindows
#:ImGuiHoveredFlags_ChildWindows
#:ImGuiHoveredFlags_RootWindow
#:ImGuiHoveredFlags_AllowWhenBlockedByPopup
#:ImGuiHoveredFlags_AllowWhenBlockedByActiveItem
#:ImGuiHoveredFlags_AllowWhenOverlapped
#:ImGuiHoveredFlags_RectOnly
#:ImGuiHoveredFlags_RootAndChildWindows
#:ImGuiDragDropFlags_SourceNoPreviewTooltip
#:ImGuiDragDropFlags_SourceNoDisableHover
#:ImGuiDragDropFlags_SourceNoHoldToOpenOthers
#:ImGuiDragDropFlags_SourceAllowNullID
#:ImGuiDragDropFlags_SourceExtern
#:ImGuiDragDropFlags_AcceptBeforeDelivery
#:ImGuiDragDropFlags_AcceptNoDrawDefaultRect
#:ImGuiDragDropFlags_AcceptPeekOnly
#:ImGuiKey_Tab
#:ImGuiKey_LeftArrow
#:ImGuiKey_RightArrow
#:ImGuiKey_UpArrow
#:ImGuiKey_DownArrow
#:ImGuiKey_PageUp
#:ImGuiKey_PageDown
#:ImGuiKey_Home
#:ImGuiKey_End
#:ImGuiKey_Delete
#:ImGuiKey_Backspace
#:ImGuiKey_Enter
#:ImGuiKey_Escape
#:ImGuiKey_A
#:ImGuiKey_C
#:ImGuiKey_V
#:ImGuiKey_X
#:ImGuiKey_Y
#:ImGuiKey_Z
#:ImGuiKey_COUNT
#:ImGuiCol_Text
#:ImGuiCol_TextDisabled
#:ImGuiCol_WindowBg
#:ImGuiCol_ChildBg
#:ImGuiCol_PopupBg
#:ImGuiCol_Border
#:ImGuiCol_BorderShadow
#:ImGuiCol_FrameBg
#:ImGuiCol_FrameBgHovered
#:ImGuiCol_FrameBgActive
#:ImGuiCol_TitleBg
#:ImGuiCol_TitleBgActive
#:ImGuiCol_TitleBgCollapsed
#:ImGuiCol_MenuBarBg
#:ImGuiCol_ScrollbarBg
#:ImGuiCol_ScrollbarGrab
#:ImGuiCol_ScrollbarGrabHovered
#:ImGuiCol_ScrollbarGrabActive
#:ImGuiCol_CheckMark
#:ImGuiCol_SliderGrab
#:ImGuiCol_SliderGrabActive
#:ImGuiCol_Button
#:ImGuiCol_ButtonHovered
#:ImGuiCol_ButtonActive
#:ImGuiCol_Header
#:ImGuiCol_HeaderHovered
#:ImGuiCol_HeaderActive
#:ImGuiCol_Separator
#:ImGuiCol_SeparatorHovered
#:ImGuiCol_SeparatorActive
#:ImGuiCol_ResizeGrip
#:ImGuiCol_ResizeGripHovered
#:ImGuiCol_ResizeGripActive
#:ImGuiCol_CloseButton
#:ImGuiCol_CloseButtonHovered
#:ImGuiCol_CloseButtonActive
#:ImGuiCol_PlotLines
#:ImGuiCol_PlotLinesHovered
#:ImGuiCol_PlotHistogram
#:ImGuiCol_PlotHistogramHovered
#:ImGuiCol_TextSelectedBg
#:ImGuiCol_ModalWindowDarkening
#:ImGuiCol_DragDropTarget
#:ImGuiCol_COUNT
#:ImGuiStyleVar_Alpha
#:ImGuiStyleVar_WindowPadding
#:ImGuiStyleVar_WindowRounding
#:ImGuiStyleVar_WindowBorderSize
#:ImGuiStyleVar_WindowMinSize
#:ImGuiStyleVar_ChildRounding
#:ImGuiStyleVar_ChildBorderSize
#:ImGuiStyleVar_PopupRounding
#:ImGuiStyleVar_PopupBorderSize
#:ImGuiStyleVar_FramePadding
#:ImGuiStyleVar_FrameRounding
#:ImGuiStyleVar_FrameBorderSize
#:ImGuiStyleVar_ItemSpacing
#:ImGuiStyleVar_ItemInnerSpacing
#:ImGuiStyleVar_IndentSpacing
#:ImGuiStyleVar_GrabMinSize
#:ImGuiStyleVar_ButtonTextAlign
#:ImGuiStyleVar_Count_
#:ImGuiColorEditFlags_NoAlpha
#:ImGuiColorEditFlags_NoPicker
#:ImGuiColorEditFlags_NoOptions
#:ImGuiColorEditFlags_NoSmallPreview
#:ImGuiColorEditFlags_NoInputs
#:ImGuiColorEditFlags_NoTooltip
#:ImGuiColorEditFlags_NoLabel
#:ImGuiColorEditFlags_NoSidePreview
#:ImGuiColorEditFlags_NoDragDrop
#:ImGuiColorEditFlags_AlphaBar
#:ImGuiColorEditFlags_AlphaPreview
#:ImGuiColorEditFlags_AlphaPreviewHalf
#:ImGuiColorEditFlags_HDR
#:ImGuiColorEditFlags_RGB
#:ImGuiColorEditFlags_HSV
#:ImGuiColorEditFlags_HEX
#:ImGuiColorEditFlags_Uint8
#:ImGuiColorEditFlags_Float
#:ImGuiColorEditFlags_PickerHueBar
#:ImGuiColorEditFlags_PickerHueWheel
#:ImGuiMouseCursor_None
#:ImGuiMouseCursor_Arrow
#:ImGuiMouseCursor_TextInput
#:ImGuiMouseCursor_Move
#:ImGuiMouseCursor_ResizeNS
#:ImGuiMouseCursor_ResizeEW
#:ImGuiMouseCursor_ResizeNESW
#:ImGuiMouseCursor_ResizeNWSE
#:ImGuiMouseCursor_Count_
#:ImGuiCond_Always
#:ImGuiCond_Once
#:ImGuiCond_FirstUseEver
#:ImGuiCond_Appearing
#:ImDrawCornerFlags_TopLeft
#:ImDrawCornerFlags_TopRight
#:ImDrawCornerFlags_BotLeft
#:ImDrawCornerFlags_BotRight
#:ImDrawCornerFlags_Top
#:ImDrawCornerFlags_Bot
#:ImDrawCornerFlags_Left
#:ImDrawCornerFlags_Right
#:ImDrawCornerFlags_All
#:ImDrawListFlags_AntiAliasedLines
#:ImDrawListFlags_AntiAliasedFill
#:igCreateContext
#:igDestroyContext
#:igGetCurrentContext
#:igSetCurrentContext
#:igDebugCheckVersionAndDataLayout
#:igGetIO
#:igGetStyle
#:igNewFrame
#:igEndFrame
#:igRender
#:igGetDrawData
#:igShowDemoWindow
#:igShowAboutWindow
#:igShowMetricsWindow
#:igShowStyleEditor
#:igShowStyleSelector
#:igShowFontSelector
#:igShowUserGuide
#:igGetVersion
#:igStyleColorsDark
#:igStyleColorsClassic
#:igStyleColorsLight
#:igBegin
#:igEnd
#:igBeginChildID
#:igEndChild
#:igIsWindowAppearing
#:igIsWindowCollapsed
#:igIsWindowFocused
#:igIsWindowHovered
#:igGetWindowDrawList
#:igGetWindowPos
#:igGetWindowSize
#:igGetWindowWidth
#:igGetWindowHeight
#:igGetContentRegionMax
#:igGetContentRegionAvail
#:igGetContentRegionAvailWidth
#:igGetWindowContentRegionMin
#:igGetWindowContentRegionMax
#:igGetWindowContentRegionWidth
#:igSetNextWindowCollapsed
#:igSetNextWindowFocus
#:igSetNextWindowBgAlpha
#:igSetWindowCollapsedBool
#:igSetWindowFocus
#:igSetWindowFontScale
#:igSetWindowCollapsedStr
#:igSetWindowFocusStr
#:igGetScrollX
#:igGetScrollY
#:igGetScrollMaxX
#:igGetScrollMaxY
#:igSetScrollX
#:igSetScrollY
#:igSetScrollHereY
#:igSetScrollFromPosY
#:igPushFont
#:igPopFont
#:igPushStyleColorU32
#:igPopStyleColor
#:igPushStyleVarFloat
#:igPopStyleVar
#:igGetStyleColorVec4
#:igGetFont
#:igGetFontSize
#:igGetFontTexUvWhitePixel
#:igGetColorU32
#:igGetColorU32Vec4
#:igGetColorU32U32
#:igPushItemWidth
#:igPopItemWidth
#:igCalcItemWidth
#:igPushTextWrapPos
#:igPopTextWrapPos
#:igPushAllowKeyboardFocus
#:igPopAllowKeyboardFocus
#:igPushButtonRepeat
#:igPopButtonRepeat
#:igSeparator
#:igSameLine
#:igNewLine
#:igSpacing
#:igDummy
#:igIndent
#:igUnindent
#:igBeginGroup
#:igEndGroup
#:igGetCursorPos
#:igGetCursorPosX
#:igGetCursorPosY
#:igSetCursorPosX
#:igSetCursorPosY
#:igGetCursorStartPos
#:igGetCursorScreenPos
#:igAlignTextToFramePadding
#:igGetTextLineHeight
#:igGetTextLineHeightWithSpacing
#:igGetFrameHeight
#:igGetFrameHeightWithSpacing
#:igPushIDStr
#:igPushIDRange
#:igPushIDPtr
#:igPushIDInt
#:igPopID
#:igGetIDStr
#:igGetIDRange
#:igGetIDPtr
#:igTextUnformatted
#:igText
#:igTextV
#:igTextDisabled
#:igTextDisabledV
#:igTextWrapped
#:igTextWrappedV
#:igLabelText
#:igLabelTextV
#:igBulletText
#:igBulletTextV
#:igSmallButton
#:igArrowButton
#:igCheckbox
#:igCheckboxFlags
#:igRadioButtonBool
#:igRadioButtonIntPtr
#:igProgressBar
#:igBullet
#:igBeginCombo
#:igEndCombo
#:igCombo
#:igComboStr
#:igComboFnPtr
#:igDragFloat
#:igDragFloat2
#:igDragFloat3
#:igDragFloat4
#:igDragFloatRange2
#:igDragInt
#:igDragInt2
#:igDragInt3
#:igDragInt4
#:igDragIntRange2
#:igDragScalar
#:igDragScalarN
#:igSliderFloat
#:igSliderFloat2
#:igSliderFloat3
#:igSliderFloat4
#:igSliderAngle
#:igSliderInt
#:igSliderInt2
#:igSliderInt3
#:igSliderInt4
#:igSliderScalar
#:igSliderScalarN
#:igVSliderFloat
#:igVSliderInt
#:igVSliderScalar
#:igInputText
#:igInputTextMultiline
#:igInputFloat
#:igInputFloat2
#:igInputFloat3
#:igInputFloat4
#:igInputInt
#:igInputInt2
#:igInputInt3
#:igInputInt4
#:igInputDouble
#:igInputScalar
#:igInputScalarN
#:igColorEdit3
#:igColorEdit4
#:igColorPicker3
#:igColorPicker4
#:igColorButton
#:igSetColorEditOptions
#:igTreeNodeStr
#:igTreeNodeStrStr
#:igTreeNodePtr
#:igTreeNodeVStr
#:igTreeNodeVPtr
#:igTreeNodeExStr
#:igTreeNodeExStrStr
#:igTreeNodeExPtr
#:igTreeNodeExVStr
#:igTreeNodeExVPtr
#:igTreePushStr
#:igTreePushPtr
#:igTreePop
#:igTreeAdvanceToLabelPos
#:igGetTreeNodeToLabelSpacing
#:igSetNextTreeNodeOpen
#:igCollapsingHeader
#:igCollapsingHeaderBoolPtr
#:igSelectable
#:igSelectableBoolPtr
#:igListBoxStr_arr
#:igListBoxFnPtr
#:igListBoxHeaderVec2
#:igListBoxHeaderInt
#:igListBoxFooter
#:igValueBool
#:igValueInt
#:igValueUint
#:igValueFloat
#:igBeginMainMenuBar
#:igEndMainMenuBar
#:igBeginMenuBar
#:igEndMenuBar
#:igBeginMenu
#:igEndMenu
#:igMenuItemBool
#:igMenuItemBoolPtr
#:igBeginTooltip
#:igEndTooltip
#:igSetTooltip
#:igSetTooltipV
#:igOpenPopup
#:igBeginPopup
#:igBeginPopupContextItem
#:igBeginPopupContextWindow
#:igBeginPopupContextVoid
#:igBeginPopupModal
#:igEndPopup
#:igOpenPopupOnItemClick
#:igIsPopupOpen
#:igCloseCurrentPopup
#:igColumns
#:igNextColumn
#:igGetColumnIndex
#:igGetColumnWidth
#:igSetColumnWidth
#:igGetColumnOffset
#:igSetColumnOffset
#:igGetColumnsCount
#:igBeginTabBar
#:igEndTabBar
#:igBeginTabItem
#:igEndTabItem
#:igSetTabItemClosed
#:igLogToTTY
#:igLogToFile
#:igLogToClipboard
#:igLogFinish
#:igLogButtons
#:igBeginDragDropSource
#:igSetDragDropPayload
#:igEndDragDropSource
#:igBeginDragDropTarget
#:igAcceptDragDropPayload
#:igEndDragDropTarget
#:igGetDragDropPayload
#:igPushClipRect
#:igPopClipRect
#:igSetItemDefaultFocus
#:igSetKeyboardFocusHere
#:igIsItemHovered
#:igIsItemActive
#:igIsItemFocused
#:igIsItemClicked
#:igIsItemVisible
#:igIsItemEdited
#:igIsItemActivated
#:igIsItemDeactivated
#:igIsItemDeactivatedAfterEdit
#:igIsAnyItemHovered
#:igIsAnyItemActive
#:igIsAnyItemFocused
#:igGetItemRectMin
#:igGetItemRectMax
#:igGetItemRectSize
#:igSetItemAllowOverlap
#:igIsRectVisible
#:igIsRectVisibleVec2
#:igGetTime
#:igGetFrameCount
#:igGetOverlayDrawList
#:igGetDrawListSharedData
#:igGetStyleColorName
#:igSetStateStorage
#:igGetStateStorage
#:igCalcTextSize
#:igCalcListClipping
#:igBeginChildFrame
#:igEndChildFrame
#:igColorConvertU32ToFloat4
#:igColorConvertFloat4ToU32
#:igGetKeyIndex
#:igIsKeyDown
#:igIsKeyPressed
#:igIsKeyReleased
#:igGetKeyPressedAmount
#:igIsMouseDown
#:igIsAnyMouseDown
#:igIsMouseClicked
#:igIsMouseDoubleClicked
#:igIsMouseReleased
#:igIsMouseDragging
#:igIsMouseHoveringRect
#:igIsMousePosValid
#:igGetMousePos
#:igGetMousePosOnOpeningCurrentPopup
#:igGetMouseDragDelta
#:igResetMouseDragDelta
#:igGetMouseCursor
#:igSetMouseCursor
#:igCaptureKeyboardFromApp
#:igCaptureMouseFromApp
#:igGetClipboardText
#:igSetClipboardText
#:igLoadIniSettingsFromDisk
#:igLoadIniSettingsFromMemory
#:igSaveIniSettingsToDisk
#:igSaveIniSettingsToMemory
#:igSetAllocatorFunctions
#:igMemAlloc
#:igMemFree
#:ImGuiStyle_ImGuiStyle
#:ImGuiStyle_destroy
#:ImGuiStyle_ScaleAllSizes
#:ImGuiIO_AddInputCharacter
#:ImGuiIO_AddInputCharactersUTF8
#:ImGuiIO_ClearInputCharacters
#:ImGuiIO_ImGuiIO
#:ImGuiIO_destroy
#:ImGuiInputTextCallbackData_ImGuiInputTextCallbackData
#:ImGuiInputTextCallbackData_destroy
#:ImGuiInputTextCallbackData_DeleteChars
#:ImGuiInputTextCallbackData_InsertChars
#:ImGuiInputTextCallbackData_HasSelection
#:ImGuiPayload_ImGuiPayload
#:ImGuiPayload_destroy
#:ImGuiPayload_Clear
#:ImGuiPayload_IsDataType
#:ImGuiPayload_IsPreview
#:ImGuiPayload_IsDelivery
#:ImGuiOnceUponAFrame_ImGuiOnceUponAFrame
#:ImGuiOnceUponAFrame_destroy
#:ImGuiTextFilter_ImGuiTextFilter
#:ImGuiTextFilter_destroy
#:ImGuiTextFilter_Draw
#:ImGuiTextFilter_PassFilter
#:ImGuiTextFilter_Build
#:ImGuiTextFilter_Clear
#:ImGuiTextFilter_IsActive
#:TextRange_TextRange
#:TextRange_destroy
#:TextRange_TextRangeStr
#:TextRange_begin
#:TextRange_end
#:TextRange_empty
#:TextRange_split
#:ImGuiTextBuffer_ImGuiTextBuffer
#:ImGuiTextBuffer_destroy
#:ImGuiTextBuffer_begin
#:ImGuiTextBuffer_end
#:ImGuiTextBuffer_size
#:ImGuiTextBuffer_empty
#:ImGuiTextBuffer_clear
#:ImGuiTextBuffer_reserve
#:ImGuiTextBuffer_c_str
#:ImGuiTextBuffer_append
#:ImGuiTextBuffer_appendfv
#:Pair_PairInt
#:Pair_destroy
#:Pair_PairFloat
#:Pair_PairPtr
#:ImGuiStorage_Clear
#:ImGuiStorage_GetInt
#:ImGuiStorage_SetInt
#:ImGuiStorage_GetBool
#:ImGuiStorage_SetBool
#:ImGuiStorage_GetFloat
#:ImGuiStorage_SetFloat
#:ImGuiStorage_GetVoidPtr
#:ImGuiStorage_SetVoidPtr
#:ImGuiStorage_GetIntRef
#:ImGuiStorage_GetBoolRef
#:ImGuiStorage_GetFloatRef
#:ImGuiStorage_GetVoidPtrRef
#:ImGuiStorage_SetAllInt
#:ImGuiStorage_BuildSortByKey
#:ImGuiListClipper_ImGuiListClipper
#:ImGuiListClipper_destroy
#:ImGuiListClipper_Step
#:ImGuiListClipper_Begin
#:ImGuiListClipper_End
#:ImColor_ImColor
#:ImColor_destroy
#:ImColor_ImColorInt
#:ImColor_ImColorU32
#:ImColor_ImColorFloat
#:ImColor_ImColorVec4
#:ImColor_SetHSV
#:ImColor_HSV
#:ImDrawCmd_ImDrawCmd
#:ImDrawCmd_destroy
#:ImDrawList_ImDrawList
#:ImDrawList_destroy
#:ImDrawList_PushClipRect
#:ImDrawList_PushClipRectFullScreen
#:ImDrawList_PopClipRect
#:ImDrawList_PushTextureID
#:ImDrawList_PopTextureID
#:ImDrawList_GetClipRectMin
#:ImDrawList_GetClipRectMax
#:ImDrawList_AddLine
#:ImDrawList_AddRect
#:ImDrawList_AddRectFilled
#:ImDrawList_AddRectFilledMultiColor
#:ImDrawList_AddQuad
#:ImDrawList_AddQuadFilled
#:ImDrawList_AddTriangle
#:ImDrawList_AddTriangleFilled
#:ImDrawList_AddCircle
#:ImDrawList_AddCircleFilled
#:ImDrawList_AddText
#:ImDrawList_AddTextFontPtr
#:ImDrawList_AddImage
#:ImDrawList_AddImageQuad
#:ImDrawList_AddImageRounded
#:ImDrawList_AddPolyline
#:ImDrawList_AddConvexPolyFilled
#:ImDrawList_AddBezierCurve
#:ImDrawList_PathClear
#:ImDrawList_PathLineTo
#:ImDrawList_PathLineToMergeDuplicate
#:ImDrawList_PathFillConvex
#:ImDrawList_PathStroke
#:ImDrawList_PathArcTo
#:ImDrawList_PathArcToFast
#:ImDrawList_PathBezierCurveTo
#:ImDrawList_PathRect
#:ImDrawList_ChannelsSplit
#:ImDrawList_ChannelsMerge
#:ImDrawList_ChannelsSetCurrent
#:ImDrawList_AddCallback
#:ImDrawList_AddDrawCmd
#:ImDrawList_CloneOutput
#:ImDrawList_Clear
#:ImDrawList_ClearFreeMemory
#:ImDrawList_PrimReserve
#:ImDrawList_PrimRect
#:ImDrawList_PrimRectUV
#:ImDrawList_PrimQuadUV
#:ImDrawList_PrimWriteVtx
#:ImDrawList_PrimWriteIdx
#:ImDrawList_PrimVtx
#:ImDrawList_UpdateClipRect
#:ImDrawList_UpdateTextureID
#:ImDrawData_ImDrawData
#:ImDrawData_destroy
#:ImDrawData_Clear
#:ImDrawData_DeIndexAllBuffers
#:ImDrawData_ScaleClipRects
#:ImFontConfig_ImFontConfig
#:ImFontConfig_destroy
#:ImFontGlyphRangesBuilder_ImFontGlyphRangesBuilder
#:ImFontGlyphRangesBuilder_destroy
#:ImFontGlyphRangesBuilder_GetBit
#:ImFontGlyphRangesBuilder_SetBit
#:ImFontGlyphRangesBuilder_AddChar
#:ImFontGlyphRangesBuilder_AddText
#:ImFontGlyphRangesBuilder_AddRanges
#:ImFontGlyphRangesBuilder_BuildRanges
#:ImFontAtlas_ImFontAtlas
#:ImFontAtlas_destroy
#:ImFontAtlas_AddFont
#:ImFontAtlas_AddFontDefault
#:ImFontAtlas_AddFontFromFileTTF
#:ImFontAtlas_AddFontFromMemoryTTF
#:ImFontAtlas_AddFontFromMemoryCompressedTTF
#:ImFontAtlas_AddFontFromMemoryCompressedBase85TTF
#:ImFontAtlas_ClearInputData
#:ImFontAtlas_ClearTexData
#:ImFontAtlas_ClearFonts
#:ImFontAtlas_Clear
#:ImFontAtlas_Build
#:ImFontAtlas_GetTexDataAsAlpha8
#:ImFontAtlas_GetTexDataAsRGBA32
#:ImFontAtlas_IsBuilt
#:ImFontAtlas_SetTexID
#:ImFontAtlas_GetGlyphRangesDefault
#:ImFontAtlas_GetGlyphRangesKorean
#:ImFontAtlas_GetGlyphRangesJapanese
#:ImFontAtlas_GetGlyphRangesChineseFull
#:ImFontAtlas_GetGlyphRangesChineseSimplifiedCommon
#:ImFontAtlas_GetGlyphRangesCyrillic
#:ImFontAtlas_GetGlyphRangesThai
#:CustomRect_CustomRect
#:CustomRect_destroy
#:CustomRect_IsPacked
#:ImFontAtlas_AddCustomRectRegular
#:ImFontAtlas_AddCustomRectFontGlyph
#:ImFontAtlas_GetCustomRectByIndex
#:ImFontAtlas_CalcCustomRectUV
#:ImFontAtlas_GetMouseCursorTexData
#:ImFont_ImFont
#:ImFont_destroy
#:ImFont_FindGlyph
#:ImFont_FindGlyphNoFallback
#:ImFont_GetCharAdvance
#:ImFont_IsLoaded
#:ImFont_GetDebugName
#:ImFont_CalcTextSizeA
#:ImFont_CalcWordWrapPositionA
#:ImFont_RenderChar
#:ImFont_RenderText
#:ImFont_BuildLookupTable
#:ImFont_ClearOutputData
#:ImFont_GrowIndex
#:ImFont_AddGlyph
#:ImFont_AddRemapChar
#:ImFont_SetFallbackChar
#:igGetWindowPos_nonUDT
#:igGetWindowSize_nonUDT
#:igGetContentRegionMax_nonUDT
#:igGetContentRegionAvail_nonUDT
#:igGetWindowContentRegionMin_nonUDT
#:igGetWindowContentRegionMax_nonUDT
#:igGetFontTexUvWhitePixel_nonUDT
#:igGetCursorPos_nonUDT
#:igGetCursorStartPos_nonUDT
#:igGetCursorScreenPos_nonUDT
#:igGetItemRectMin_nonUDT
#:igGetItemRectMax_nonUDT
#:igGetItemRectSize_nonUDT
#:igCalcTextSize_nonUDT
#:igColorConvertU32ToFloat4_nonUDT
#:igGetMousePos_nonUDT
#:igGetMousePosOnOpeningCurrentPopup_nonUDT
#:igGetMouseDragDelta_nonUDT
#:ImColor_HSV_nonUDT
#:ImDrawList_GetClipRectMin_nonUDT
#:ImDrawList_GetClipRectMax_nonUDT
#:ImFont_CalcTextSizeA_nonUDT
#:ImVector_float_ImVector_float
#:ImVector_float_destroy
#:ImVector_ImWchar_ImVector_ImWchar
#:ImVector_ImWchar_destroy
#:ImVector_ImFontConfig_ImVector_ImFontConfig
#:ImVector_ImFontConfig_destroy
#:ImVector_ImFontGlyph_ImVector_ImFontGlyph
#:ImVector_ImFontGlyph_destroy
#:ImVector_TextRange_ImVector_TextRange
#:ImVector_TextRange_destroy
#:ImVector_CustomRect_ImVector_CustomRect
#:ImVector_CustomRect_destroy
#:ImVector_ImDrawChannel_ImVector_ImDrawChannel
#:ImVector_ImDrawChannel_destroy
#:ImVector_char_ImVector_char
#:ImVector_char_destroy
#:ImVector_ImTextureID_ImVector_ImTextureID
#:ImVector_ImTextureID_destroy
#:ImVector_ImDrawVert_ImVector_ImDrawVert
#:ImVector_ImDrawVert_destroy
#:ImVector_int_ImVector_int
#:ImVector_int_destroy
#:ImVector_Pair_ImVector_Pair
#:ImVector_Pair_destroy
#:ImVector_ImFontPtr_ImVector_ImFontPtr
#:ImVector_ImFontPtr_destroy
#:ImVector_ImVec4_ImVector_ImVec4
#:ImVector_ImVec4_destroy
#:ImVector_ImDrawCmd_ImVector_ImDrawCmd
#:ImVector_ImDrawCmd_destroy
#:ImVector_ImDrawIdx_ImVector_ImDrawIdx
#:ImVector_ImDrawIdx_destroy
#:ImVector_ImVec2_ImVector_ImVec2
#:ImVector_ImVec2_destroy
#:ImVector_float_ImVector_floatVector
#:ImVector_ImWchar_ImVector_ImWcharVector
#:ImVector_ImFontConfig_ImVector_ImFontConfigVector
#:ImVector_ImFontGlyph_ImVector_ImFontGlyphVector
#:ImVector_TextRange_ImVector_TextRangeVector
#:ImVector_CustomRect_ImVector_CustomRectVector
#:ImVector_ImDrawChannel_ImVector_ImDrawChannelVector
#:ImVector_char_ImVector_charVector
#:ImVector_ImTextureID_ImVector_ImTextureIDVector
#:ImVector_ImDrawVert_ImVector_ImDrawVertVector
#:ImVector_int_ImVector_intVector
#:ImVector_Pair_ImVector_PairVector
#:ImVector_ImFontPtr_ImVector_ImFontPtrVector
#:ImVector_ImVec4_ImVector_ImVec4Vector
#:ImVector_ImDrawCmd_ImVector_ImDrawCmdVector
#:ImVector_ImDrawIdx_ImVector_ImDrawIdxVector
#:ImVector_ImVec2_ImVector_ImVec2Vector
#:ImVector_float_empty
#:ImVector_ImWchar_empty
#:ImVector_ImFontConfig_empty
#:ImVector_ImFontGlyph_empty
#:ImVector_TextRange_empty
#:ImVector_CustomRect_empty
#:ImVector_ImDrawChannel_empty
#:ImVector_char_empty
#:ImVector_ImTextureID_empty
#:ImVector_ImDrawVert_empty
#:ImVector_int_empty
#:ImVector_Pair_empty
#:ImVector_ImFontPtr_empty
#:ImVector_ImVec4_empty
#:ImVector_ImDrawCmd_empty
#:ImVector_ImDrawIdx_empty
#:ImVector_ImVec2_empty
#:ImVector_float_size
#:ImVector_ImWchar_size
#:ImVector_ImFontConfig_size
#:ImVector_ImFontGlyph_size
#:ImVector_TextRange_size
#:ImVector_CustomRect_size
#:ImVector_ImDrawChannel_size
#:ImVector_char_size
#:ImVector_ImTextureID_size
#:ImVector_ImDrawVert_size
#:ImVector_int_size
#:ImVector_Pair_size
#:ImVector_ImFontPtr_size
#:ImVector_ImVec4_size
#:ImVector_ImDrawCmd_size
#:ImVector_ImDrawIdx_size
#:ImVector_ImVec2_size
#:ImVector_float_size_in_bytes
#:ImVector_ImWchar_size_in_bytes
#:ImVector_ImFontConfig_size_in_bytes
#:ImVector_ImFontGlyph_size_in_bytes
#:ImVector_TextRange_size_in_bytes
#:ImVector_CustomRect_size_in_bytes
#:ImVector_ImDrawChannel_size_in_bytes
#:ImVector_char_size_in_bytes
#:ImVector_ImTextureID_size_in_bytes
#:ImVector_ImDrawVert_size_in_bytes
#:ImVector_int_size_in_bytes
#:ImVector_Pair_size_in_bytes
#:ImVector_ImFontPtr_size_in_bytes
#:ImVector_ImVec4_size_in_bytes
#:ImVector_ImDrawCmd_size_in_bytes
#:ImVector_ImDrawIdx_size_in_bytes
#:ImVector_ImVec2_size_in_bytes
#:ImVector_float_capacity
#:ImVector_ImWchar_capacity
#:ImVector_ImFontConfig_capacity
#:ImVector_ImFontGlyph_capacity
#:ImVector_TextRange_capacity
#:ImVector_CustomRect_capacity
#:ImVector_ImDrawChannel_capacity
#:ImVector_char_capacity
#:ImVector_ImTextureID_capacity
#:ImVector_ImDrawVert_capacity
#:ImVector_int_capacity
#:ImVector_Pair_capacity
#:ImVector_ImFontPtr_capacity
#:ImVector_ImVec4_capacity
#:ImVector_ImDrawCmd_capacity
#:ImVector_ImDrawIdx_capacity
#:ImVector_ImVec2_capacity
#:ImVector_float_clear
#:ImVector_ImWchar_clear
#:ImVector_ImFontConfig_clear
#:ImVector_ImFontGlyph_clear
#:ImVector_TextRange_clear
#:ImVector_CustomRect_clear
#:ImVector_ImDrawChannel_clear
#:ImVector_char_clear
#:ImVector_ImTextureID_clear
#:ImVector_ImDrawVert_clear
#:ImVector_int_clear
#:ImVector_Pair_clear
#:ImVector_ImFontPtr_clear
#:ImVector_ImVec4_clear
#:ImVector_ImDrawCmd_clear
#:ImVector_ImDrawIdx_clear
#:ImVector_ImVec2_clear
#:ImVector_float_begin
#:ImVector_ImWchar_begin
#:ImVector_ImFontConfig_begin
#:ImVector_ImFontGlyph_begin
#:ImVector_TextRange_begin
#:ImVector_CustomRect_begin
#:ImVector_ImDrawChannel_begin
#:ImVector_char_begin
#:ImVector_ImTextureID_begin
#:ImVector_ImDrawVert_begin
#:ImVector_int_begin
#:ImVector_Pair_begin
#:ImVector_ImFontPtr_begin
#:ImVector_ImVec4_begin
#:ImVector_ImDrawCmd_begin
#:ImVector_ImDrawIdx_begin
#:ImVector_ImVec2_begin
#:ImVector_float_begin_const
#:ImVector_ImWchar_begin_const
#:ImVector_ImFontConfig_begin_const
#:ImVector_ImFontGlyph_begin_const
#:ImVector_TextRange_begin_const
#:ImVector_CustomRect_begin_const
#:ImVector_ImDrawChannel_begin_const
#:ImVector_char_begin_const
#:ImVector_ImTextureID_begin_const
#:ImVector_ImDrawVert_begin_const
#:ImVector_int_begin_const
#:ImVector_Pair_begin_const
#:ImVector_ImFontPtr_begin_const
#:ImVector_ImVec4_begin_const
#:ImVector_ImDrawCmd_begin_const
#:ImVector_ImDrawIdx_begin_const
#:ImVector_ImVec2_begin_const
#:ImVector_float_end
#:ImVector_ImWchar_end
#:ImVector_ImFontConfig_end
#:ImVector_ImFontGlyph_end
#:ImVector_TextRange_end
#:ImVector_CustomRect_end
#:ImVector_ImDrawChannel_end
#:ImVector_char_end
#:ImVector_ImTextureID_end
#:ImVector_ImDrawVert_end
#:ImVector_int_end
#:ImVector_Pair_end
#:ImVector_ImFontPtr_end
#:ImVector_ImVec4_end
#:ImVector_ImDrawCmd_end
#:ImVector_ImDrawIdx_end
#:ImVector_ImVec2_end
#:ImVector_float_end_const
#:ImVector_ImWchar_end_const
#:ImVector_ImFontConfig_end_const
#:ImVector_ImFontGlyph_end_const
#:ImVector_TextRange_end_const
#:ImVector_CustomRect_end_const
#:ImVector_ImDrawChannel_end_const
#:ImVector_char_end_const
#:ImVector_ImTextureID_end_const
#:ImVector_ImDrawVert_end_const
#:ImVector_int_end_const
#:ImVector_Pair_end_const
#:ImVector_ImFontPtr_end_const
#:ImVector_ImVec4_end_const
#:ImVector_ImDrawCmd_end_const
#:ImVector_ImDrawIdx_end_const
#:ImVector_ImVec2_end_const
#:ImVector_float_front
#:ImVector_ImWchar_front
#:ImVector_ImFontConfig_front
#:ImVector_ImFontGlyph_front
#:ImVector_TextRange_front
#:ImVector_CustomRect_front
#:ImVector_ImDrawChannel_front
#:ImVector_char_front
#:ImVector_ImTextureID_front
#:ImVector_ImDrawVert_front
#:ImVector_int_front
#:ImVector_Pair_front
#:ImVector_ImFontPtr_front
#:ImVector_ImVec4_front
#:ImVector_ImDrawCmd_front
#:ImVector_ImDrawIdx_front
#:ImVector_ImVec2_front
#:ImVector_float_front_const
#:ImVector_ImWchar_front_const
#:ImVector_ImFontConfig_front_const
#:ImVector_ImFontGlyph_front_const
#:ImVector_TextRange_front_const
#:ImVector_CustomRect_front_const
#:ImVector_ImDrawChannel_front_const
#:ImVector_char_front_const
#:ImVector_ImTextureID_front_const
#:ImVector_ImDrawVert_front_const
#:ImVector_int_front_const
#:ImVector_Pair_front_const
#:ImVector_ImFontPtr_front_const
#:ImVector_ImVec4_front_const
#:ImVector_ImDrawCmd_front_const
#:ImVector_ImDrawIdx_front_const
#:ImVector_ImVec2_front_const
#:ImVector_float_back
#:ImVector_ImWchar_back
#:ImVector_ImFontConfig_back
#:ImVector_ImFontGlyph_back
#:ImVector_TextRange_back
#:ImVector_CustomRect_back
#:ImVector_ImDrawChannel_back
#:ImVector_char_back
#:ImVector_ImTextureID_back
#:ImVector_ImDrawVert_back
#:ImVector_int_back
#:ImVector_Pair_back
#:ImVector_ImFontPtr_back
#:ImVector_ImVec4_back
#:ImVector_ImDrawCmd_back
#:ImVector_ImDrawIdx_back
#:ImVector_ImVec2_back
#:ImVector_float_back_const
#:ImVector_ImWchar_back_const
#:ImVector_ImFontConfig_back_const
#:ImVector_ImFontGlyph_back_const
#:ImVector_TextRange_back_const
#:ImVector_CustomRect_back_const
#:ImVector_ImDrawChannel_back_const
#:ImVector_char_back_const
#:ImVector_ImTextureID_back_const
#:ImVector_ImDrawVert_back_const
#:ImVector_int_back_const
#:ImVector_Pair_back_const
#:ImVector_ImFontPtr_back_const
#:ImVector_ImVec4_back_const
#:ImVector_ImDrawCmd_back_const
#:ImVector_ImDrawIdx_back_const
#:ImVector_ImVec2_back_const
#:ImVector_float_swap
#:ImVector_ImWchar_swap
#:ImVector_ImFontConfig_swap
#:ImVector_ImFontGlyph_swap
#:ImVector_TextRange_swap
#:ImVector_CustomRect_swap
#:ImVector_ImDrawChannel_swap
#:ImVector_char_swap
#:ImVector_ImTextureID_swap
#:ImVector_ImDrawVert_swap
#:ImVector_int_swap
#:ImVector_Pair_swap
#:ImVector_ImFontPtr_swap
#:ImVector_ImVec4_swap
#:ImVector_ImDrawCmd_swap
#:ImVector_ImDrawIdx_swap
#:ImVector_ImVec2_swap
#:ImVector_float__grow_capacity
#:ImVector_ImWchar__grow_capacity
#:ImVector_ImFontConfig__grow_capacity
#:ImVector_ImFontGlyph__grow_capacity
#:ImVector_TextRange__grow_capacity
#:ImVector_CustomRect__grow_capacity
#:ImVector_ImDrawChannel__grow_capacity
#:ImVector_char__grow_capacity
#:ImVector_ImTextureID__grow_capacity
#:ImVector_ImDrawVert__grow_capacity
#:ImVector_int__grow_capacity
#:ImVector_Pair__grow_capacity
#:ImVector_ImFontPtr__grow_capacity
#:ImVector_ImVec4__grow_capacity
#:ImVector_ImDrawCmd__grow_capacity
#:ImVector_ImDrawIdx__grow_capacity
#:ImVector_ImVec2__grow_capacity
#:ImVector_float_resize
#:ImVector_ImWchar_resize
#:ImVector_ImFontConfig_resize
#:ImVector_ImFontGlyph_resize
#:ImVector_TextRange_resize
#:ImVector_CustomRect_resize
#:ImVector_ImDrawChannel_resize
#:ImVector_char_resize
#:ImVector_ImTextureID_resize
#:ImVector_ImDrawVert_resize
#:ImVector_int_resize
#:ImVector_Pair_resize
#:ImVector_ImFontPtr_resize
#:ImVector_ImVec4_resize
#:ImVector_ImDrawCmd_resize
#:ImVector_ImDrawIdx_resize
#:ImVector_ImVec2_resize
#:ImVector_float_resizeT
#:ImVector_ImWchar_resizeT
#:ImVector_ImFontConfig_resizeT
#:ImVector_ImFontGlyph_resizeT
#:ImVector_TextRange_resizeT
#:ImVector_CustomRect_resizeT
#:ImVector_ImDrawChannel_resizeT
#:ImVector_char_resizeT
#:ImVector_ImTextureID_resizeT
#:ImVector_ImDrawVert_resizeT
#:ImVector_int_resizeT
#:ImVector_Pair_resizeT
#:ImVector_ImFontPtr_resizeT
#:ImVector_ImVec4_resizeT
#:ImVector_ImDrawCmd_resizeT
#:ImVector_ImDrawIdx_resizeT
#:ImVector_ImVec2_resizeT
#:ImVector_float_reserve
#:ImVector_ImWchar_reserve
#:ImVector_ImFontConfig_reserve
#:ImVector_ImFontGlyph_reserve
#:ImVector_TextRange_reserve
#:ImVector_CustomRect_reserve
#:ImVector_ImDrawChannel_reserve
#:ImVector_char_reserve
#:ImVector_ImTextureID_reserve
#:ImVector_ImDrawVert_reserve
#:ImVector_int_reserve
#:ImVector_Pair_reserve
#:ImVector_ImFontPtr_reserve
#:ImVector_ImVec4_reserve
#:ImVector_ImDrawCmd_reserve
#:ImVector_ImDrawIdx_reserve
#:ImVector_ImVec2_reserve
#:ImVector_float_push_back
#:ImVector_ImWchar_push_back
#:ImVector_ImFontConfig_push_back
#:ImVector_ImFontGlyph_push_back
#:ImVector_TextRange_push_back
#:ImVector_CustomRect_push_back
#:ImVector_ImDrawChannel_push_back
#:ImVector_char_push_back
#:ImVector_ImTextureID_push_back
#:ImVector_ImDrawVert_push_back
#:ImVector_int_push_back
#:ImVector_Pair_push_back
#:ImVector_ImFontPtr_push_back
#:ImVector_ImVec4_push_back
#:ImVector_ImDrawCmd_push_back
#:ImVector_ImDrawIdx_push_back
#:ImVector_ImVec2_push_back
#:ImVector_float_pop_back
#:ImVector_ImWchar_pop_back
#:ImVector_ImFontConfig_pop_back
#:ImVector_ImFontGlyph_pop_back
#:ImVector_TextRange_pop_back
#:ImVector_CustomRect_pop_back
#:ImVector_ImDrawChannel_pop_back
#:ImVector_char_pop_back
#:ImVector_ImTextureID_pop_back
#:ImVector_ImDrawVert_pop_back
#:ImVector_int_pop_back
#:ImVector_Pair_pop_back
#:ImVector_ImFontPtr_pop_back
#:ImVector_ImVec4_pop_back
#:ImVector_ImDrawCmd_pop_back
#:ImVector_ImDrawIdx_pop_back
#:ImVector_ImVec2_pop_back
#:ImVector_float_push_front
#:ImVector_ImWchar_push_front
#:ImVector_ImFontConfig_push_front
#:ImVector_ImFontGlyph_push_front
#:ImVector_TextRange_push_front
#:ImVector_CustomRect_push_front
#:ImVector_ImDrawChannel_push_front
#:ImVector_char_push_front
#:ImVector_ImTextureID_push_front
#:ImVector_ImDrawVert_push_front
#:ImVector_int_push_front
#:ImVector_Pair_push_front
#:ImVector_ImFontPtr_push_front
#:ImVector_ImVec4_push_front
#:ImVector_ImDrawCmd_push_front
#:ImVector_ImDrawIdx_push_front
#:ImVector_ImVec2_push_front
#:ImVector_float_erase
#:ImVector_ImWchar_erase
#:ImVector_ImFontConfig_erase
#:ImVector_ImFontGlyph_erase
#:ImVector_TextRange_erase
#:ImVector_CustomRect_erase
#:ImVector_ImDrawChannel_erase
#:ImVector_char_erase
#:ImVector_ImTextureID_erase
#:ImVector_ImDrawVert_erase
#:ImVector_int_erase
#:ImVector_Pair_erase
#:ImVector_ImFontPtr_erase
#:ImVector_ImVec4_erase
#:ImVector_ImDrawCmd_erase
#:ImVector_ImDrawIdx_erase
#:ImVector_ImVec2_erase
#:ImVector_float_eraseTPtr
#:ImVector_ImWchar_eraseTPtr
#:ImVector_ImFontConfig_eraseTPtr
#:ImVector_ImFontGlyph_eraseTPtr
#:ImVector_TextRange_eraseTPtr
#:ImVector_CustomRect_eraseTPtr
#:ImVector_ImDrawChannel_eraseTPtr
#:ImVector_char_eraseTPtr
#:ImVector_ImTextureID_eraseTPtr
#:ImVector_ImDrawVert_eraseTPtr
#:ImVector_int_eraseTPtr
#:ImVector_Pair_eraseTPtr
#:ImVector_ImFontPtr_eraseTPtr
#:ImVector_ImVec4_eraseTPtr
#:ImVector_ImDrawCmd_eraseTPtr
#:ImVector_ImDrawIdx_eraseTPtr
#:ImVector_ImVec2_eraseTPtr
#:ImVector_float_erase_unsorted
#:ImVector_ImWchar_erase_unsorted
#:ImVector_ImFontConfig_erase_unsorted
#:ImVector_ImFontGlyph_erase_unsorted
#:ImVector_TextRange_erase_unsorted
#:ImVector_CustomRect_erase_unsorted
#:ImVector_ImDrawChannel_erase_unsorted
#:ImVector_char_erase_unsorted
#:ImVector_ImTextureID_erase_unsorted
#:ImVector_ImDrawVert_erase_unsorted
#:ImVector_int_erase_unsorted
#:ImVector_Pair_erase_unsorted
#:ImVector_ImFontPtr_erase_unsorted
#:ImVector_ImVec4_erase_unsorted
#:ImVector_ImDrawCmd_erase_unsorted
#:ImVector_ImDrawIdx_erase_unsorted
#:ImVector_ImVec2_erase_unsorted
#:ImVector_float_insert
#:ImVector_ImWchar_insert
#:ImVector_ImFontConfig_insert
#:ImVector_ImFontGlyph_insert
#:ImVector_TextRange_insert
#:ImVector_CustomRect_insert
#:ImVector_ImDrawChannel_insert
#:ImVector_char_insert
#:ImVector_ImTextureID_insert
#:ImVector_ImDrawVert_insert
#:ImVector_int_insert
#:ImVector_Pair_insert
#:ImVector_ImFontPtr_insert
#:ImVector_ImVec4_insert
#:ImVector_ImDrawCmd_insert
#:ImVector_ImDrawIdx_insert
#:ImVector_ImVec2_insert
#:ImVector_float_contains
#:ImVector_ImWchar_contains
#:ImVector_char_contains
#:ImVector_int_contains
#:ImVector_float_index_from_ptr
#:ImVector_ImWchar_index_from_ptr
#:ImVector_ImFontConfig_index_from_ptr
#:ImVector_ImFontGlyph_index_from_ptr
#:ImVector_TextRange_index_from_ptr
#:ImVector_CustomRect_index_from_ptr
#:ImVector_ImDrawChannel_index_from_ptr
#:ImVector_char_index_from_ptr
#:ImVector_ImTextureID_index_from_ptr
#:ImVector_ImDrawVert_index_from_ptr
#:ImVector_int_index_from_ptr
#:ImVector_Pair_index_from_ptr
#:ImVector_ImFontPtr_index_from_ptr
#:ImVector_ImVec4_index_from_ptr
#:ImVector_ImDrawCmd_index_from_ptr
#:ImVector_ImDrawIdx_index_from_ptr
#:ImVector_ImVec2_index_from_ptr
#:igLogText
#:ImGuiTextBuffer_appendf
#:igGET_FLT_MAX
#:igColorConvertRGBtoHSV
#:igColorConvertHSVtoRGB
#:ImVector_ImWchar_create
#:ImVector_ImWchar_Init
#:ImVector_ImWchar_UnInit
#:igBeginChild
#:igSetNextWindowPos
#:igSetNextWindowSize
#:igSetNextWindowSizeConstraints
#:igSetNextWindowContentSize
#:igSetWindowPosVec2
#:igSetWindowSizeVec2
#:igSetWindowPosStr
#:igSetWindowSizeStr
#:igPushStyleColor
#:igPushStyleVarVec2
#:igSetCursorPos
#:igSetCursorScreenPos
#:igTextColored
#:igTextColoredV
#:igButton
#:igInvisibleButton
#:igImage
#:igImageButton
#:igPlotLines
#:igPlotLinesFnPtr
#:igPlotHistogramFloatPtr
#:igPlotHistogramFnPtr
#:igInputTextMultiline
#:igVSliderFloat
#:igVSliderInt
#:igColorButton
#:igSelectable
#:igSelectableBoolPtr
#:igListBoxHeaderVec2
#:igPushClipRect
#:igIsRectVisible
#:igBeginChildFrame
#:igColorConvertFloat4ToU32
#:igIsMouseHoveringRect
#:ImDrawList_PushClipRect
#:ImDrawList_AddLine
#:ImDrawList_AddRect
#:ImDrawList_AddRectFilled
#:ImDrawList_AddRectFilledMultiColor
#:ImDrawList_AddQuad
#:ImDrawList_AddQuadFilled
#:ImDrawList_AddTriangle
#:ImDrawList_AddTriangleFilled
#:ImDrawList_AddCircle
#:ImDrawList_AddCircleFilled
#:ImDrawList_AddText
#:ImDrawList_AddTextFontPtr
#:ImDrawList_AddImage
#:ImDrawList_AddImageQuad
#:ImDrawList_AddImageRounded
#:ImDrawList_PathLineTo
#:ImDrawList_PathLineToMergeDuplicate
#:ImDrawList_PathArcTo
#:ImDrawList_PathArcToFast
#:ImDrawList_PathBezierCurveTo
#:ImDrawList_PathRect
#:ImDrawList_PrimRect
#:ImDrawList_PrimRectUV
#:ImDrawList_PrimQuadUV
#:ImDrawList_PrimWriteVtx
#:ImDrawList_PrimVtx
#:ImDrawData_ScaleClipRects
#:igGetWindowPos
#:igGetWindowSize
#:igGetContentRegionMax
#:igGetContentRegionAvail
#:igGetWindowContentRegionMin
#:igGetWindowContentRegionMax
#:igGetFontTexUvWhitePixel
#:igGetCursorPos
#:igGetCursorStartPos
#:igGetCursorScreenPos
#:igGetItemRectMin
#:igGetItemRectMax
#:igGetItemRectSize
#:igCalcTextSize
#:igColorConvertU32ToFloat4
#:igGetMousePos
#:igGetMousePosOnOpeningCurrentPopup
#:igGetMouseDragDelta
#:ImColor_HSV
#:ImDrawList_GetClipRectMin
#:ImDrawList_GetClipRectMax
#:ImFont_CalcTextSizeA
#:igGetWindowPos_nonUDT2
#:igGetWindowSize_nonUDT2
#:igGetContentRegionMax_nonUDT2
#:igGetContentRegionAvail_nonUDT2
#:igGetWindowContentRegionMin_nonUDT2
#:igGetWindowContentRegionMax_nonUDT2
#:igGetFontTexUvWhitePixel_nonUDT2
#:igGetCursorPos_nonUDT2
#:igGetCursorStartPos_nonUDT2
#:igGetCursorScreenPos_nonUDT2
#:igGetItemRectMin_nonUDT2
#:igGetItemRectMax_nonUDT2
#:igCalcTextSize_nonUDT2
#:igColorConvertU32ToFloat4_nonUDT2
#:igGetMousePos_nonUDT2
#:igGetMousePosOnOpeningCurrentPopup_nonUDT2
#:igGetMouseDragDelta_nonUDT2
#:ImColor_HSV_nonUDT2
#:ImDrawList_GetClipRectMin_nonUDT2
#:ImDrawList_GetClipRectMax_nonUDT2
#:ImFont_CalcTextSizeA_nonUDT2))
| null | https://raw.githubusercontent.com/awolven/VkTk/fa5d320dd09a03fb2f3aa2fa096401882212144d/ifc/cimgui/imgui-package.lisp | lisp |
Permission is hereby granted, free of charge, to any person obtaining
a copy of this software and associated documentation files (the
without limitation the rights to use, copy, modify, merge, publish,
the following conditions:
The above copyright notice and this permission notice shall be
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE
OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION
WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
#:image
| Copyright 2019 < >
" Software " ) , to deal in the Software without restriction , including
distribute , sublicense , and/or sell copies of the Software , and to
permit persons to whom the Software is furnished to do so , subject to
included in all copies or substantial portions of the Software .
THE SOFTWARE IS PROVIDED " AS IS " , WITHOUT WARRANTY OF ANY KIND ,
LIABLE FOR ANY CLAIM , DAMAGES OR OTHER LIABILITY , WHETHER IN AN ACTION
(in-package :cl-user)
(defpackage :imgui
(:nicknames :ig)
(:use :cl :cffi)
(:shadow)
(:export #:bullet-text
#:show-demo-window
#:begin
#:end
#:set-next-window-pos
#:set-next-window-size
#:set-cursor-screen-pos
#:text
#:push-item-width
#:pop-item-width
#:calc-item-width
#:push-text-wrap-pos
#:push-allow-keyboard-focus
#:pop-allow-keyboard-focus
#:push-button-repeat
#:pop-button-repeat
#:separator
#:same-line
#:new-line
#:spacing
#:dummy
#:indent
#:unindent
#:begin-group
#:end-group
#:imgui-get-cursor-pos
#:get-cursor-pos-x
#:get-cursor-pos-y
#:get-cursor-start-pos
#:get-cursor-screen-pos
#:align-text-to-frame-padding
#:get-text-line-height
#:get-frame-height-with-spacing
#:push-id
#:pop-id
#:get-id
#:text-unformatted
#:text-colored
#:text-disabled
#:text-wrapped
#:label-text
#:button
#:small-button
#:invisible-button
#:arrow-button
#:image-button
#:checkbox
#:checkbox-flags
#:radio-button
#:progress-bar
#:bullet
#:begin-combo
#:end-combo
#:combo
#:drag-float
#:drag-float2
#:drag-float3
#:drag-float4
#:drag-float-range2
#:drag-int
#:drag-int2
#:drag-int3
#:drag-int-range2
#:drag-scalar
#:drag-scalar-n
#:slider-float
#:slider-float2
#:slider-float3
#:slider-float4
#:slider-angle
#:slider-int
#:slider-int2
#:slider-int3
#:slider-int4
#:slider-scalar
#:slider-scalar-n
#:input-text
#:input-text-multiline
#:input-float
#:input-float2
#:input-float3
#:input-float4
#:input-int
#:input-int2
#:input-int3
#:input-int4
#:input-double
#:input-scalar
#:input-scalar-n
#:color-edit
#:color-edit3
#:color-edit4
#:color-picker3
#:color-picker4
#:color-button
#:set-color-edit-options
#:tree-node
#:tree-node-ex
#:tree-push
#:tree-pop
#:tree-advance-to-label-pos
#:get-tree-node-to-label-spacing
#:set-next-tree-node-open
#:collapsing-header
#:selectable
#:list-box
#:list-box-header
#:list-box-footer
#:plot-lines
#:plot-histogram
#:begin-main-menu-bar
#:end-main-menu-bar
#:begin-menu-bar
#:end-menu-bar
#:end-menu
#:begin-tooltip
#:end-tooltip
#:set-tooltip
#:open-popup
#:begin-popup
#:begin-popep-context-item
#:begin-popup-context-window
#:begin-popup-context-void
#:begin-popup-modal
#:end-popup
#:begin-child
#:bool-receptor
#:flags-receptor
#:get-receptor-value
#:log-finish
#:log-text
#:log-to-clipboard
#:key-pressed-p
#:menu-item
#:begin-menu
#:ImVec2_Simple
#:ImVec2_ImVec2
#:ImVec2_destroy
#:ImVec2_ImVec2Float
#:ImVec4_ImVec4
#:ImVec4_destroy
#:ImVec4_ImVec4Float
#:ImGuiWindowFlags_NoTitleBar
#:ImGuiWindowFlags_NoResize
#:ImGuiWindowFlags_NoMove
#:ImGuiWindowFlags_NoScrollbar
#:ImGuiWindowFlags_NoScrollWithMouse
#:ImGuiWindowFlags_NoCollapse
#:ImGuiWindowFlags_AlwaysAutoResize
#:ImGuiWindowFlags_NoBackground
#:ImGuiWindowFlags_NoMouseInputs
#:ImGuiWindowFlags_NoSavedSettings
#:ImGuiWindowFlags_NoInputs
#:ImGuiWindowFlags_MenuBar
#:ImGuiWindowFlags_HorizontalScrollbar
#:ImGuiWindowFlags_NoFocusOnAppearing
#:ImGuiWindowFlags_NoBringToFrontOnFocus
#:ImGuiWindowFlags_AlwaysVerticalScrollbar
#:ImGuiWindowFlags_AlwaysHorizontalScrollbar
#:ImGuiWindowFlags_AlwaysUseWindowPadding
#:ImGuiWindowFlags_ResizeFromAnySide
#:ImGuiWindowFlags_NoNavInputs
#:ImGuiWindowFlags_NoNavFocus
#:ImGuiWindowFlags_UnsavedDocument
#:ImGuiWindowFlags_NoNav
#:ImGuiWindowFlags_NoDecoration
#:ImGuiWindowFlags_NavFlattened
#:ImGuiWindowFlags_ChildWindow
#:ImGuiWindowFlags_Tooltip
#:ImGuiWindowFlags_Popup
#:ImGuiWindowFlags_Modal
#:ImGuiWindowFlags_ChildMenu
#:ImGuiInputTextFlags_CharsDecimal
#:ImGuiInputTextFlags_CharsHexadecimal
#:ImGuiInputTextFlags_CharsUppercase
#:ImGuiInputTextFlags_CharsNoBlank
#:ImGuiInputTextFlags_AutoSelectAll
#:ImGuiInputTextFlags_EnterReturnsTrue
#:ImGuiInputTextFlags_CallbackCompletion
#:ImGuiInputTextFlags_CallbackHistory
#:ImGuiInputTextFlags_CallbackAlways
#:ImGuiInputTextFlags_CallbackCharFilter
#:ImGuiInputTextFlags_AllowTabInput
#:ImGuiInputTextFlags_CtrlEnterForNewLine
#:ImGuiInputTextFlags_NoHorizontalScroll
#:ImGuiInputTextFlags_AlwaysInsertMode
#:ImGuiInputTextFlags_ReadOnly
#:ImGuiInputTextFlags_Password
#:ImGuiInputTextFlags_NoUndoRedo
#:ImGuiTreeNodeFlags_Selected
#:ImGuiTreeNodeFlags_Framed
#:ImGuiTreeNodeFlags_AllowItemOverlap
#:ImGuiTreeNodeFlags_NoTreePushOnOpen
#:ImGuiTreeNodeFlags_NoAutoOpenOnLog
#:ImGuiTreeNodeFlags_DefaultOpen
#:ImGuiTreeNodeFlags_OpenOnDoubleClick
#:ImGuiTreeNodeFlags_OpenOnArrow
#:ImGuiTreeNodeFlags_Leaf
#:ImGuiTreeNodeFlags_Bullet
#:ImGuiTreeNodeFlags_FramePadding
#:ImGuiTreeNodeFlags_NavLeftJumpsBackHere
#:ImGuiTreeNodeFlags_CollapsingHeader
#:ImGuiSelectableFlags_DontClosePopups
#:ImGuiSelectableFlags_SpanAllColumns
#:ImGuiSelectableFlags_AllowDoubleClick
#:ImGuiComboFlags_PopupAlignLeft
#:ImGuiComboFlags_HeightSmall
#:ImGuiComboFlags_HeightRegular
#:ImGuiComboFlags_HeightLarge
#:ImGuiComboFlags_HeightLargest
#:ImGuiComboFlags_HeightMask_
#:ImGuiFocusedFlags_ChildWindows
#:ImGuiFocusedFlags_RootWindow
#:ImGuiFocusedFlags_RootAndChildWindows
#:ImGuiHoveredFlags_ChildWindows
#:ImGuiHoveredFlags_RootWindow
#:ImGuiHoveredFlags_AllowWhenBlockedByPopup
#:ImGuiHoveredFlags_AllowWhenBlockedByActiveItem
#:ImGuiHoveredFlags_AllowWhenOverlapped
#:ImGuiHoveredFlags_RectOnly
#:ImGuiHoveredFlags_RootAndChildWindows
#:ImGuiDragDropFlags_SourceNoPreviewTooltip
#:ImGuiDragDropFlags_SourceNoDisableHover
#:ImGuiDragDropFlags_SourceNoHoldToOpenOthers
#:ImGuiDragDropFlags_SourceAllowNullID
#:ImGuiDragDropFlags_SourceExtern
#:ImGuiDragDropFlags_AcceptBeforeDelivery
#:ImGuiDragDropFlags_AcceptNoDrawDefaultRect
#:ImGuiDragDropFlags_AcceptPeekOnly
#:ImGuiKey_Tab
#:ImGuiKey_LeftArrow
#:ImGuiKey_RightArrow
#:ImGuiKey_UpArrow
#:ImGuiKey_DownArrow
#:ImGuiKey_PageUp
#:ImGuiKey_PageDown
#:ImGuiKey_Home
#:ImGuiKey_End
#:ImGuiKey_Delete
#:ImGuiKey_Backspace
#:ImGuiKey_Enter
#:ImGuiKey_Escape
#:ImGuiKey_A
#:ImGuiKey_C
#:ImGuiKey_V
#:ImGuiKey_X
#:ImGuiKey_Y
#:ImGuiKey_Z
#:ImGuiKey_COUNT
#:ImGuiCol_Text
#:ImGuiCol_TextDisabled
#:ImGuiCol_WindowBg
#:ImGuiCol_ChildBg
#:ImGuiCol_PopupBg
#:ImGuiCol_Border
#:ImGuiCol_BorderShadow
#:ImGuiCol_FrameBg
#:ImGuiCol_FrameBgHovered
#:ImGuiCol_FrameBgActive
#:ImGuiCol_TitleBg
#:ImGuiCol_TitleBgActive
#:ImGuiCol_TitleBgCollapsed
#:ImGuiCol_MenuBarBg
#:ImGuiCol_ScrollbarBg
#:ImGuiCol_ScrollbarGrab
#:ImGuiCol_ScrollbarGrabHovered
#:ImGuiCol_ScrollbarGrabActive
#:ImGuiCol_CheckMark
#:ImGuiCol_SliderGrab
#:ImGuiCol_SliderGrabActive
#:ImGuiCol_Button
#:ImGuiCol_ButtonHovered
#:ImGuiCol_ButtonActive
#:ImGuiCol_Header
#:ImGuiCol_HeaderHovered
#:ImGuiCol_HeaderActive
#:ImGuiCol_Separator
#:ImGuiCol_SeparatorHovered
#:ImGuiCol_SeparatorActive
#:ImGuiCol_ResizeGrip
#:ImGuiCol_ResizeGripHovered
#:ImGuiCol_ResizeGripActive
#:ImGuiCol_CloseButton
#:ImGuiCol_CloseButtonHovered
#:ImGuiCol_CloseButtonActive
#:ImGuiCol_PlotLines
#:ImGuiCol_PlotLinesHovered
#:ImGuiCol_PlotHistogram
#:ImGuiCol_PlotHistogramHovered
#:ImGuiCol_TextSelectedBg
#:ImGuiCol_ModalWindowDarkening
#:ImGuiCol_DragDropTarget
#:ImGuiCol_COUNT
#:ImGuiStyleVar_Alpha
#:ImGuiStyleVar_WindowPadding
#:ImGuiStyleVar_WindowRounding
#:ImGuiStyleVar_WindowBorderSize
#:ImGuiStyleVar_WindowMinSize
#:ImGuiStyleVar_ChildRounding
#:ImGuiStyleVar_ChildBorderSize
#:ImGuiStyleVar_PopupRounding
#:ImGuiStyleVar_PopupBorderSize
#:ImGuiStyleVar_FramePadding
#:ImGuiStyleVar_FrameRounding
#:ImGuiStyleVar_FrameBorderSize
#:ImGuiStyleVar_ItemSpacing
#:ImGuiStyleVar_ItemInnerSpacing
#:ImGuiStyleVar_IndentSpacing
#:ImGuiStyleVar_GrabMinSize
#:ImGuiStyleVar_ButtonTextAlign
#:ImGuiStyleVar_Count_
#:ImGuiColorEditFlags_NoAlpha
#:ImGuiColorEditFlags_NoPicker
#:ImGuiColorEditFlags_NoOptions
#:ImGuiColorEditFlags_NoSmallPreview
#:ImGuiColorEditFlags_NoInputs
#:ImGuiColorEditFlags_NoTooltip
#:ImGuiColorEditFlags_NoLabel
#:ImGuiColorEditFlags_NoSidePreview
#:ImGuiColorEditFlags_NoDragDrop
#:ImGuiColorEditFlags_AlphaBar
#:ImGuiColorEditFlags_AlphaPreview
#:ImGuiColorEditFlags_AlphaPreviewHalf
#:ImGuiColorEditFlags_HDR
#:ImGuiColorEditFlags_RGB
#:ImGuiColorEditFlags_HSV
#:ImGuiColorEditFlags_HEX
#:ImGuiColorEditFlags_Uint8
#:ImGuiColorEditFlags_Float
#:ImGuiColorEditFlags_PickerHueBar
#:ImGuiColorEditFlags_PickerHueWheel
#:ImGuiMouseCursor_None
#:ImGuiMouseCursor_Arrow
#:ImGuiMouseCursor_TextInput
#:ImGuiMouseCursor_Move
#:ImGuiMouseCursor_ResizeNS
#:ImGuiMouseCursor_ResizeEW
#:ImGuiMouseCursor_ResizeNESW
#:ImGuiMouseCursor_ResizeNWSE
#:ImGuiMouseCursor_Count_
#:ImGuiCond_Always
#:ImGuiCond_Once
#:ImGuiCond_FirstUseEver
#:ImGuiCond_Appearing
#:ImDrawCornerFlags_TopLeft
#:ImDrawCornerFlags_TopRight
#:ImDrawCornerFlags_BotLeft
#:ImDrawCornerFlags_BotRight
#:ImDrawCornerFlags_Top
#:ImDrawCornerFlags_Bot
#:ImDrawCornerFlags_Left
#:ImDrawCornerFlags_Right
#:ImDrawCornerFlags_All
#:ImDrawListFlags_AntiAliasedLines
#:ImDrawListFlags_AntiAliasedFill
#:igCreateContext
#:igDestroyContext
#:igGetCurrentContext
#:igSetCurrentContext
#:igDebugCheckVersionAndDataLayout
#:igGetIO
#:igGetStyle
#:igNewFrame
#:igEndFrame
#:igRender
#:igGetDrawData
#:igShowDemoWindow
#:igShowAboutWindow
#:igShowMetricsWindow
#:igShowStyleEditor
#:igShowStyleSelector
#:igShowFontSelector
#:igShowUserGuide
#:igGetVersion
#:igStyleColorsDark
#:igStyleColorsClassic
#:igStyleColorsLight
#:igBegin
#:igEnd
#:igBeginChildID
#:igEndChild
#:igIsWindowAppearing
#:igIsWindowCollapsed
#:igIsWindowFocused
#:igIsWindowHovered
#:igGetWindowDrawList
#:igGetWindowPos
#:igGetWindowSize
#:igGetWindowWidth
#:igGetWindowHeight
#:igGetContentRegionMax
#:igGetContentRegionAvail
#:igGetContentRegionAvailWidth
#:igGetWindowContentRegionMin
#:igGetWindowContentRegionMax
#:igGetWindowContentRegionWidth
#:igSetNextWindowCollapsed
#:igSetNextWindowFocus
#:igSetNextWindowBgAlpha
#:igSetWindowCollapsedBool
#:igSetWindowFocus
#:igSetWindowFontScale
#:igSetWindowCollapsedStr
#:igSetWindowFocusStr
#:igGetScrollX
#:igGetScrollY
#:igGetScrollMaxX
#:igGetScrollMaxY
#:igSetScrollX
#:igSetScrollY
#:igSetScrollHereY
#:igSetScrollFromPosY
#:igPushFont
#:igPopFont
#:igPushStyleColorU32
#:igPopStyleColor
#:igPushStyleVarFloat
#:igPopStyleVar
#:igGetStyleColorVec4
#:igGetFont
#:igGetFontSize
#:igGetFontTexUvWhitePixel
#:igGetColorU32
#:igGetColorU32Vec4
#:igGetColorU32U32
#:igPushItemWidth
#:igPopItemWidth
#:igCalcItemWidth
#:igPushTextWrapPos
#:igPopTextWrapPos
#:igPushAllowKeyboardFocus
#:igPopAllowKeyboardFocus
#:igPushButtonRepeat
#:igPopButtonRepeat
#:igSeparator
#:igSameLine
#:igNewLine
#:igSpacing
#:igDummy
#:igIndent
#:igUnindent
#:igBeginGroup
#:igEndGroup
#:igGetCursorPos
#:igGetCursorPosX
#:igGetCursorPosY
#:igSetCursorPosX
#:igSetCursorPosY
#:igGetCursorStartPos
#:igGetCursorScreenPos
#:igAlignTextToFramePadding
#:igGetTextLineHeight
#:igGetTextLineHeightWithSpacing
#:igGetFrameHeight
#:igGetFrameHeightWithSpacing
#:igPushIDStr
#:igPushIDRange
#:igPushIDPtr
#:igPushIDInt
#:igPopID
#:igGetIDStr
#:igGetIDRange
#:igGetIDPtr
#:igTextUnformatted
#:igText
#:igTextV
#:igTextDisabled
#:igTextDisabledV
#:igTextWrapped
#:igTextWrappedV
#:igLabelText
#:igLabelTextV
#:igBulletText
#:igBulletTextV
#:igSmallButton
#:igArrowButton
#:igCheckbox
#:igCheckboxFlags
#:igRadioButtonBool
#:igRadioButtonIntPtr
#:igProgressBar
#:igBullet
#:igBeginCombo
#:igEndCombo
#:igCombo
#:igComboStr
#:igComboFnPtr
#:igDragFloat
#:igDragFloat2
#:igDragFloat3
#:igDragFloat4
#:igDragFloatRange2
#:igDragInt
#:igDragInt2
#:igDragInt3
#:igDragInt4
#:igDragIntRange2
#:igDragScalar
#:igDragScalarN
#:igSliderFloat
#:igSliderFloat2
#:igSliderFloat3
#:igSliderFloat4
#:igSliderAngle
#:igSliderInt
#:igSliderInt2
#:igSliderInt3
#:igSliderInt4
#:igSliderScalar
#:igSliderScalarN
#:igVSliderFloat
#:igVSliderInt
#:igVSliderScalar
#:igInputText
#:igInputTextMultiline
#:igInputFloat
#:igInputFloat2
#:igInputFloat3
#:igInputFloat4
#:igInputInt
#:igInputInt2
#:igInputInt3
#:igInputInt4
#:igInputDouble
#:igInputScalar
#:igInputScalarN
#:igColorEdit3
#:igColorEdit4
#:igColorPicker3
#:igColorPicker4
#:igColorButton
#:igSetColorEditOptions
#:igTreeNodeStr
#:igTreeNodeStrStr
#:igTreeNodePtr
#:igTreeNodeVStr
#:igTreeNodeVPtr
#:igTreeNodeExStr
#:igTreeNodeExStrStr
#:igTreeNodeExPtr
#:igTreeNodeExVStr
#:igTreeNodeExVPtr
#:igTreePushStr
#:igTreePushPtr
#:igTreePop
#:igTreeAdvanceToLabelPos
#:igGetTreeNodeToLabelSpacing
#:igSetNextTreeNodeOpen
#:igCollapsingHeader
#:igCollapsingHeaderBoolPtr
#:igSelectable
#:igSelectableBoolPtr
#:igListBoxStr_arr
#:igListBoxFnPtr
#:igListBoxHeaderVec2
#:igListBoxHeaderInt
#:igListBoxFooter
#:igValueBool
#:igValueInt
#:igValueUint
#:igValueFloat
#:igBeginMainMenuBar
#:igEndMainMenuBar
#:igBeginMenuBar
#:igEndMenuBar
#:igBeginMenu
#:igEndMenu
#:igMenuItemBool
#:igMenuItemBoolPtr
#:igBeginTooltip
#:igEndTooltip
#:igSetTooltip
#:igSetTooltipV
#:igOpenPopup
#:igBeginPopup
#:igBeginPopupContextItem
#:igBeginPopupContextWindow
#:igBeginPopupContextVoid
#:igBeginPopupModal
#:igEndPopup
#:igOpenPopupOnItemClick
#:igIsPopupOpen
#:igCloseCurrentPopup
#:igColumns
#:igNextColumn
#:igGetColumnIndex
#:igGetColumnWidth
#:igSetColumnWidth
#:igGetColumnOffset
#:igSetColumnOffset
#:igGetColumnsCount
#:igBeginTabBar
#:igEndTabBar
#:igBeginTabItem
#:igEndTabItem
#:igSetTabItemClosed
#:igLogToTTY
#:igLogToFile
#:igLogToClipboard
#:igLogFinish
#:igLogButtons
#:igBeginDragDropSource
#:igSetDragDropPayload
#:igEndDragDropSource
#:igBeginDragDropTarget
#:igAcceptDragDropPayload
#:igEndDragDropTarget
#:igGetDragDropPayload
#:igPushClipRect
#:igPopClipRect
#:igSetItemDefaultFocus
#:igSetKeyboardFocusHere
#:igIsItemHovered
#:igIsItemActive
#:igIsItemFocused
#:igIsItemClicked
#:igIsItemVisible
#:igIsItemEdited
#:igIsItemActivated
#:igIsItemDeactivated
#:igIsItemDeactivatedAfterEdit
#:igIsAnyItemHovered
#:igIsAnyItemActive
#:igIsAnyItemFocused
#:igGetItemRectMin
#:igGetItemRectMax
#:igGetItemRectSize
#:igSetItemAllowOverlap
#:igIsRectVisible
#:igIsRectVisibleVec2
#:igGetTime
#:igGetFrameCount
#:igGetOverlayDrawList
#:igGetDrawListSharedData
#:igGetStyleColorName
#:igSetStateStorage
#:igGetStateStorage
#:igCalcTextSize
#:igCalcListClipping
#:igBeginChildFrame
#:igEndChildFrame
#:igColorConvertU32ToFloat4
#:igColorConvertFloat4ToU32
#:igGetKeyIndex
#:igIsKeyDown
#:igIsKeyPressed
#:igIsKeyReleased
#:igGetKeyPressedAmount
#:igIsMouseDown
#:igIsAnyMouseDown
#:igIsMouseClicked
#:igIsMouseDoubleClicked
#:igIsMouseReleased
#:igIsMouseDragging
#:igIsMouseHoveringRect
#:igIsMousePosValid
#:igGetMousePos
#:igGetMousePosOnOpeningCurrentPopup
#:igGetMouseDragDelta
#:igResetMouseDragDelta
#:igGetMouseCursor
#:igSetMouseCursor
#:igCaptureKeyboardFromApp
#:igCaptureMouseFromApp
#:igGetClipboardText
#:igSetClipboardText
#:igLoadIniSettingsFromDisk
#:igLoadIniSettingsFromMemory
#:igSaveIniSettingsToDisk
#:igSaveIniSettingsToMemory
#:igSetAllocatorFunctions
#:igMemAlloc
#:igMemFree
#:ImGuiStyle_ImGuiStyle
#:ImGuiStyle_destroy
#:ImGuiStyle_ScaleAllSizes
#:ImGuiIO_AddInputCharacter
#:ImGuiIO_AddInputCharactersUTF8
#:ImGuiIO_ClearInputCharacters
#:ImGuiIO_ImGuiIO
#:ImGuiIO_destroy
#:ImGuiInputTextCallbackData_ImGuiInputTextCallbackData
#:ImGuiInputTextCallbackData_destroy
#:ImGuiInputTextCallbackData_DeleteChars
#:ImGuiInputTextCallbackData_InsertChars
#:ImGuiInputTextCallbackData_HasSelection
#:ImGuiPayload_ImGuiPayload
#:ImGuiPayload_destroy
#:ImGuiPayload_Clear
#:ImGuiPayload_IsDataType
#:ImGuiPayload_IsPreview
#:ImGuiPayload_IsDelivery
#:ImGuiOnceUponAFrame_ImGuiOnceUponAFrame
#:ImGuiOnceUponAFrame_destroy
#:ImGuiTextFilter_ImGuiTextFilter
#:ImGuiTextFilter_destroy
#:ImGuiTextFilter_Draw
#:ImGuiTextFilter_PassFilter
#:ImGuiTextFilter_Build
#:ImGuiTextFilter_Clear
#:ImGuiTextFilter_IsActive
#:TextRange_TextRange
#:TextRange_destroy
#:TextRange_TextRangeStr
#:TextRange_begin
#:TextRange_end
#:TextRange_empty
#:TextRange_split
#:ImGuiTextBuffer_ImGuiTextBuffer
#:ImGuiTextBuffer_destroy
#:ImGuiTextBuffer_begin
#:ImGuiTextBuffer_end
#:ImGuiTextBuffer_size
#:ImGuiTextBuffer_empty
#:ImGuiTextBuffer_clear
#:ImGuiTextBuffer_reserve
#:ImGuiTextBuffer_c_str
#:ImGuiTextBuffer_append
#:ImGuiTextBuffer_appendfv
#:Pair_PairInt
#:Pair_destroy
#:Pair_PairFloat
#:Pair_PairPtr
#:ImGuiStorage_Clear
#:ImGuiStorage_GetInt
#:ImGuiStorage_SetInt
#:ImGuiStorage_GetBool
#:ImGuiStorage_SetBool
#:ImGuiStorage_GetFloat
#:ImGuiStorage_SetFloat
#:ImGuiStorage_GetVoidPtr
#:ImGuiStorage_SetVoidPtr
#:ImGuiStorage_GetIntRef
#:ImGuiStorage_GetBoolRef
#:ImGuiStorage_GetFloatRef
#:ImGuiStorage_GetVoidPtrRef
#:ImGuiStorage_SetAllInt
#:ImGuiStorage_BuildSortByKey
#:ImGuiListClipper_ImGuiListClipper
#:ImGuiListClipper_destroy
#:ImGuiListClipper_Step
#:ImGuiListClipper_Begin
#:ImGuiListClipper_End
#:ImColor_ImColor
#:ImColor_destroy
#:ImColor_ImColorInt
#:ImColor_ImColorU32
#:ImColor_ImColorFloat
#:ImColor_ImColorVec4
#:ImColor_SetHSV
#:ImColor_HSV
#:ImDrawCmd_ImDrawCmd
#:ImDrawCmd_destroy
#:ImDrawList_ImDrawList
#:ImDrawList_destroy
#:ImDrawList_PushClipRect
#:ImDrawList_PushClipRectFullScreen
#:ImDrawList_PopClipRect
#:ImDrawList_PushTextureID
#:ImDrawList_PopTextureID
#:ImDrawList_GetClipRectMin
#:ImDrawList_GetClipRectMax
#:ImDrawList_AddLine
#:ImDrawList_AddRect
#:ImDrawList_AddRectFilled
#:ImDrawList_AddRectFilledMultiColor
#:ImDrawList_AddQuad
#:ImDrawList_AddQuadFilled
#:ImDrawList_AddTriangle
#:ImDrawList_AddTriangleFilled
#:ImDrawList_AddCircle
#:ImDrawList_AddCircleFilled
#:ImDrawList_AddText
#:ImDrawList_AddTextFontPtr
#:ImDrawList_AddImage
#:ImDrawList_AddImageQuad
#:ImDrawList_AddImageRounded
#:ImDrawList_AddPolyline
#:ImDrawList_AddConvexPolyFilled
#:ImDrawList_AddBezierCurve
#:ImDrawList_PathClear
#:ImDrawList_PathLineTo
#:ImDrawList_PathLineToMergeDuplicate
#:ImDrawList_PathFillConvex
#:ImDrawList_PathStroke
#:ImDrawList_PathArcTo
#:ImDrawList_PathArcToFast
#:ImDrawList_PathBezierCurveTo
#:ImDrawList_PathRect
#:ImDrawList_ChannelsSplit
#:ImDrawList_ChannelsMerge
#:ImDrawList_ChannelsSetCurrent
#:ImDrawList_AddCallback
#:ImDrawList_AddDrawCmd
#:ImDrawList_CloneOutput
#:ImDrawList_Clear
#:ImDrawList_ClearFreeMemory
#:ImDrawList_PrimReserve
#:ImDrawList_PrimRect
#:ImDrawList_PrimRectUV
#:ImDrawList_PrimQuadUV
#:ImDrawList_PrimWriteVtx
#:ImDrawList_PrimWriteIdx
#:ImDrawList_PrimVtx
#:ImDrawList_UpdateClipRect
#:ImDrawList_UpdateTextureID
#:ImDrawData_ImDrawData
#:ImDrawData_destroy
#:ImDrawData_Clear
#:ImDrawData_DeIndexAllBuffers
#:ImDrawData_ScaleClipRects
#:ImFontConfig_ImFontConfig
#:ImFontConfig_destroy
#:ImFontGlyphRangesBuilder_ImFontGlyphRangesBuilder
#:ImFontGlyphRangesBuilder_destroy
#:ImFontGlyphRangesBuilder_GetBit
#:ImFontGlyphRangesBuilder_SetBit
#:ImFontGlyphRangesBuilder_AddChar
#:ImFontGlyphRangesBuilder_AddText
#:ImFontGlyphRangesBuilder_AddRanges
#:ImFontGlyphRangesBuilder_BuildRanges
#:ImFontAtlas_ImFontAtlas
#:ImFontAtlas_destroy
#:ImFontAtlas_AddFont
#:ImFontAtlas_AddFontDefault
#:ImFontAtlas_AddFontFromFileTTF
#:ImFontAtlas_AddFontFromMemoryTTF
#:ImFontAtlas_AddFontFromMemoryCompressedTTF
#:ImFontAtlas_AddFontFromMemoryCompressedBase85TTF
#:ImFontAtlas_ClearInputData
#:ImFontAtlas_ClearTexData
#:ImFontAtlas_ClearFonts
#:ImFontAtlas_Clear
#:ImFontAtlas_Build
#:ImFontAtlas_GetTexDataAsAlpha8
#:ImFontAtlas_GetTexDataAsRGBA32
#:ImFontAtlas_IsBuilt
#:ImFontAtlas_SetTexID
#:ImFontAtlas_GetGlyphRangesDefault
#:ImFontAtlas_GetGlyphRangesKorean
#:ImFontAtlas_GetGlyphRangesJapanese
#:ImFontAtlas_GetGlyphRangesChineseFull
#:ImFontAtlas_GetGlyphRangesChineseSimplifiedCommon
#:ImFontAtlas_GetGlyphRangesCyrillic
#:ImFontAtlas_GetGlyphRangesThai
#:CustomRect_CustomRect
#:CustomRect_destroy
#:CustomRect_IsPacked
#:ImFontAtlas_AddCustomRectRegular
#:ImFontAtlas_AddCustomRectFontGlyph
#:ImFontAtlas_GetCustomRectByIndex
#:ImFontAtlas_CalcCustomRectUV
#:ImFontAtlas_GetMouseCursorTexData
#:ImFont_ImFont
#:ImFont_destroy
#:ImFont_FindGlyph
#:ImFont_FindGlyphNoFallback
#:ImFont_GetCharAdvance
#:ImFont_IsLoaded
#:ImFont_GetDebugName
#:ImFont_CalcTextSizeA
#:ImFont_CalcWordWrapPositionA
#:ImFont_RenderChar
#:ImFont_RenderText
#:ImFont_BuildLookupTable
#:ImFont_ClearOutputData
#:ImFont_GrowIndex
#:ImFont_AddGlyph
#:ImFont_AddRemapChar
#:ImFont_SetFallbackChar
#:igGetWindowPos_nonUDT
#:igGetWindowSize_nonUDT
#:igGetContentRegionMax_nonUDT
#:igGetContentRegionAvail_nonUDT
#:igGetWindowContentRegionMin_nonUDT
#:igGetWindowContentRegionMax_nonUDT
#:igGetFontTexUvWhitePixel_nonUDT
#:igGetCursorPos_nonUDT
#:igGetCursorStartPos_nonUDT
#:igGetCursorScreenPos_nonUDT
#:igGetItemRectMin_nonUDT
#:igGetItemRectMax_nonUDT
#:igGetItemRectSize_nonUDT
#:igCalcTextSize_nonUDT
#:igColorConvertU32ToFloat4_nonUDT
#:igGetMousePos_nonUDT
#:igGetMousePosOnOpeningCurrentPopup_nonUDT
#:igGetMouseDragDelta_nonUDT
#:ImColor_HSV_nonUDT
#:ImDrawList_GetClipRectMin_nonUDT
#:ImDrawList_GetClipRectMax_nonUDT
#:ImFont_CalcTextSizeA_nonUDT
#:ImVector_float_ImVector_float
#:ImVector_float_destroy
#:ImVector_ImWchar_ImVector_ImWchar
#:ImVector_ImWchar_destroy
#:ImVector_ImFontConfig_ImVector_ImFontConfig
#:ImVector_ImFontConfig_destroy
#:ImVector_ImFontGlyph_ImVector_ImFontGlyph
#:ImVector_ImFontGlyph_destroy
#:ImVector_TextRange_ImVector_TextRange
#:ImVector_TextRange_destroy
#:ImVector_CustomRect_ImVector_CustomRect
#:ImVector_CustomRect_destroy
#:ImVector_ImDrawChannel_ImVector_ImDrawChannel
#:ImVector_ImDrawChannel_destroy
#:ImVector_char_ImVector_char
#:ImVector_char_destroy
#:ImVector_ImTextureID_ImVector_ImTextureID
#:ImVector_ImTextureID_destroy
#:ImVector_ImDrawVert_ImVector_ImDrawVert
#:ImVector_ImDrawVert_destroy
#:ImVector_int_ImVector_int
#:ImVector_int_destroy
#:ImVector_Pair_ImVector_Pair
#:ImVector_Pair_destroy
#:ImVector_ImFontPtr_ImVector_ImFontPtr
#:ImVector_ImFontPtr_destroy
#:ImVector_ImVec4_ImVector_ImVec4
#:ImVector_ImVec4_destroy
#:ImVector_ImDrawCmd_ImVector_ImDrawCmd
#:ImVector_ImDrawCmd_destroy
#:ImVector_ImDrawIdx_ImVector_ImDrawIdx
#:ImVector_ImDrawIdx_destroy
#:ImVector_ImVec2_ImVector_ImVec2
#:ImVector_ImVec2_destroy
#:ImVector_float_ImVector_floatVector
#:ImVector_ImWchar_ImVector_ImWcharVector
#:ImVector_ImFontConfig_ImVector_ImFontConfigVector
#:ImVector_ImFontGlyph_ImVector_ImFontGlyphVector
#:ImVector_TextRange_ImVector_TextRangeVector
#:ImVector_CustomRect_ImVector_CustomRectVector
#:ImVector_ImDrawChannel_ImVector_ImDrawChannelVector
#:ImVector_char_ImVector_charVector
#:ImVector_ImTextureID_ImVector_ImTextureIDVector
#:ImVector_ImDrawVert_ImVector_ImDrawVertVector
#:ImVector_int_ImVector_intVector
#:ImVector_Pair_ImVector_PairVector
#:ImVector_ImFontPtr_ImVector_ImFontPtrVector
#:ImVector_ImVec4_ImVector_ImVec4Vector
#:ImVector_ImDrawCmd_ImVector_ImDrawCmdVector
#:ImVector_ImDrawIdx_ImVector_ImDrawIdxVector
#:ImVector_ImVec2_ImVector_ImVec2Vector
#:ImVector_float_empty
#:ImVector_ImWchar_empty
#:ImVector_ImFontConfig_empty
#:ImVector_ImFontGlyph_empty
#:ImVector_TextRange_empty
#:ImVector_CustomRect_empty
#:ImVector_ImDrawChannel_empty
#:ImVector_char_empty
#:ImVector_ImTextureID_empty
#:ImVector_ImDrawVert_empty
#:ImVector_int_empty
#:ImVector_Pair_empty
#:ImVector_ImFontPtr_empty
#:ImVector_ImVec4_empty
#:ImVector_ImDrawCmd_empty
#:ImVector_ImDrawIdx_empty
#:ImVector_ImVec2_empty
#:ImVector_float_size
#:ImVector_ImWchar_size
#:ImVector_ImFontConfig_size
#:ImVector_ImFontGlyph_size
#:ImVector_TextRange_size
#:ImVector_CustomRect_size
#:ImVector_ImDrawChannel_size
#:ImVector_char_size
#:ImVector_ImTextureID_size
#:ImVector_ImDrawVert_size
#:ImVector_int_size
#:ImVector_Pair_size
#:ImVector_ImFontPtr_size
#:ImVector_ImVec4_size
#:ImVector_ImDrawCmd_size
#:ImVector_ImDrawIdx_size
#:ImVector_ImVec2_size
#:ImVector_float_size_in_bytes
#:ImVector_ImWchar_size_in_bytes
#:ImVector_ImFontConfig_size_in_bytes
#:ImVector_ImFontGlyph_size_in_bytes
#:ImVector_TextRange_size_in_bytes
#:ImVector_CustomRect_size_in_bytes
#:ImVector_ImDrawChannel_size_in_bytes
#:ImVector_char_size_in_bytes
#:ImVector_ImTextureID_size_in_bytes
#:ImVector_ImDrawVert_size_in_bytes
#:ImVector_int_size_in_bytes
#:ImVector_Pair_size_in_bytes
#:ImVector_ImFontPtr_size_in_bytes
#:ImVector_ImVec4_size_in_bytes
#:ImVector_ImDrawCmd_size_in_bytes
#:ImVector_ImDrawIdx_size_in_bytes
#:ImVector_ImVec2_size_in_bytes
#:ImVector_float_capacity
#:ImVector_ImWchar_capacity
#:ImVector_ImFontConfig_capacity
#:ImVector_ImFontGlyph_capacity
#:ImVector_TextRange_capacity
#:ImVector_CustomRect_capacity
#:ImVector_ImDrawChannel_capacity
#:ImVector_char_capacity
#:ImVector_ImTextureID_capacity
#:ImVector_ImDrawVert_capacity
#:ImVector_int_capacity
#:ImVector_Pair_capacity
#:ImVector_ImFontPtr_capacity
#:ImVector_ImVec4_capacity
#:ImVector_ImDrawCmd_capacity
#:ImVector_ImDrawIdx_capacity
#:ImVector_ImVec2_capacity
#:ImVector_float_clear
#:ImVector_ImWchar_clear
#:ImVector_ImFontConfig_clear
#:ImVector_ImFontGlyph_clear
#:ImVector_TextRange_clear
#:ImVector_CustomRect_clear
#:ImVector_ImDrawChannel_clear
#:ImVector_char_clear
#:ImVector_ImTextureID_clear
#:ImVector_ImDrawVert_clear
#:ImVector_int_clear
#:ImVector_Pair_clear
#:ImVector_ImFontPtr_clear
#:ImVector_ImVec4_clear
#:ImVector_ImDrawCmd_clear
#:ImVector_ImDrawIdx_clear
#:ImVector_ImVec2_clear
#:ImVector_float_begin
#:ImVector_ImWchar_begin
#:ImVector_ImFontConfig_begin
#:ImVector_ImFontGlyph_begin
#:ImVector_TextRange_begin
#:ImVector_CustomRect_begin
#:ImVector_ImDrawChannel_begin
#:ImVector_char_begin
#:ImVector_ImTextureID_begin
#:ImVector_ImDrawVert_begin
#:ImVector_int_begin
#:ImVector_Pair_begin
#:ImVector_ImFontPtr_begin
#:ImVector_ImVec4_begin
#:ImVector_ImDrawCmd_begin
#:ImVector_ImDrawIdx_begin
#:ImVector_ImVec2_begin
#:ImVector_float_begin_const
#:ImVector_ImWchar_begin_const
#:ImVector_ImFontConfig_begin_const
#:ImVector_ImFontGlyph_begin_const
#:ImVector_TextRange_begin_const
#:ImVector_CustomRect_begin_const
#:ImVector_ImDrawChannel_begin_const
#:ImVector_char_begin_const
#:ImVector_ImTextureID_begin_const
#:ImVector_ImDrawVert_begin_const
#:ImVector_int_begin_const
#:ImVector_Pair_begin_const
#:ImVector_ImFontPtr_begin_const
#:ImVector_ImVec4_begin_const
#:ImVector_ImDrawCmd_begin_const
#:ImVector_ImDrawIdx_begin_const
#:ImVector_ImVec2_begin_const
#:ImVector_float_end
#:ImVector_ImWchar_end
#:ImVector_ImFontConfig_end
#:ImVector_ImFontGlyph_end
#:ImVector_TextRange_end
#:ImVector_CustomRect_end
#:ImVector_ImDrawChannel_end
#:ImVector_char_end
#:ImVector_ImTextureID_end
#:ImVector_ImDrawVert_end
#:ImVector_int_end
#:ImVector_Pair_end
#:ImVector_ImFontPtr_end
#:ImVector_ImVec4_end
#:ImVector_ImDrawCmd_end
#:ImVector_ImDrawIdx_end
#:ImVector_ImVec2_end
#:ImVector_float_end_const
#:ImVector_ImWchar_end_const
#:ImVector_ImFontConfig_end_const
#:ImVector_ImFontGlyph_end_const
#:ImVector_TextRange_end_const
#:ImVector_CustomRect_end_const
#:ImVector_ImDrawChannel_end_const
#:ImVector_char_end_const
#:ImVector_ImTextureID_end_const
#:ImVector_ImDrawVert_end_const
#:ImVector_int_end_const
#:ImVector_Pair_end_const
#:ImVector_ImFontPtr_end_const
#:ImVector_ImVec4_end_const
#:ImVector_ImDrawCmd_end_const
#:ImVector_ImDrawIdx_end_const
#:ImVector_ImVec2_end_const
#:ImVector_float_front
#:ImVector_ImWchar_front
#:ImVector_ImFontConfig_front
#:ImVector_ImFontGlyph_front
#:ImVector_TextRange_front
#:ImVector_CustomRect_front
#:ImVector_ImDrawChannel_front
#:ImVector_char_front
#:ImVector_ImTextureID_front
#:ImVector_ImDrawVert_front
#:ImVector_int_front
#:ImVector_Pair_front
#:ImVector_ImFontPtr_front
#:ImVector_ImVec4_front
#:ImVector_ImDrawCmd_front
#:ImVector_ImDrawIdx_front
#:ImVector_ImVec2_front
#:ImVector_float_front_const
#:ImVector_ImWchar_front_const
#:ImVector_ImFontConfig_front_const
#:ImVector_ImFontGlyph_front_const
#:ImVector_TextRange_front_const
#:ImVector_CustomRect_front_const
#:ImVector_ImDrawChannel_front_const
#:ImVector_char_front_const
#:ImVector_ImTextureID_front_const
#:ImVector_ImDrawVert_front_const
#:ImVector_int_front_const
#:ImVector_Pair_front_const
#:ImVector_ImFontPtr_front_const
#:ImVector_ImVec4_front_const
#:ImVector_ImDrawCmd_front_const
#:ImVector_ImDrawIdx_front_const
#:ImVector_ImVec2_front_const
#:ImVector_float_back
#:ImVector_ImWchar_back
#:ImVector_ImFontConfig_back
#:ImVector_ImFontGlyph_back
#:ImVector_TextRange_back
#:ImVector_CustomRect_back
#:ImVector_ImDrawChannel_back
#:ImVector_char_back
#:ImVector_ImTextureID_back
#:ImVector_ImDrawVert_back
#:ImVector_int_back
#:ImVector_Pair_back
#:ImVector_ImFontPtr_back
#:ImVector_ImVec4_back
#:ImVector_ImDrawCmd_back
#:ImVector_ImDrawIdx_back
#:ImVector_ImVec2_back
#:ImVector_float_back_const
#:ImVector_ImWchar_back_const
#:ImVector_ImFontConfig_back_const
#:ImVector_ImFontGlyph_back_const
#:ImVector_TextRange_back_const
#:ImVector_CustomRect_back_const
#:ImVector_ImDrawChannel_back_const
#:ImVector_char_back_const
#:ImVector_ImTextureID_back_const
#:ImVector_ImDrawVert_back_const
#:ImVector_int_back_const
#:ImVector_Pair_back_const
#:ImVector_ImFontPtr_back_const
#:ImVector_ImVec4_back_const
#:ImVector_ImDrawCmd_back_const
#:ImVector_ImDrawIdx_back_const
#:ImVector_ImVec2_back_const
#:ImVector_float_swap
#:ImVector_ImWchar_swap
#:ImVector_ImFontConfig_swap
#:ImVector_ImFontGlyph_swap
#:ImVector_TextRange_swap
#:ImVector_CustomRect_swap
#:ImVector_ImDrawChannel_swap
#:ImVector_char_swap
#:ImVector_ImTextureID_swap
#:ImVector_ImDrawVert_swap
#:ImVector_int_swap
#:ImVector_Pair_swap
#:ImVector_ImFontPtr_swap
#:ImVector_ImVec4_swap
#:ImVector_ImDrawCmd_swap
#:ImVector_ImDrawIdx_swap
#:ImVector_ImVec2_swap
#:ImVector_float__grow_capacity
#:ImVector_ImWchar__grow_capacity
#:ImVector_ImFontConfig__grow_capacity
#:ImVector_ImFontGlyph__grow_capacity
#:ImVector_TextRange__grow_capacity
#:ImVector_CustomRect__grow_capacity
#:ImVector_ImDrawChannel__grow_capacity
#:ImVector_char__grow_capacity
#:ImVector_ImTextureID__grow_capacity
#:ImVector_ImDrawVert__grow_capacity
#:ImVector_int__grow_capacity
#:ImVector_Pair__grow_capacity
#:ImVector_ImFontPtr__grow_capacity
#:ImVector_ImVec4__grow_capacity
#:ImVector_ImDrawCmd__grow_capacity
#:ImVector_ImDrawIdx__grow_capacity
#:ImVector_ImVec2__grow_capacity
#:ImVector_float_resize
#:ImVector_ImWchar_resize
#:ImVector_ImFontConfig_resize
#:ImVector_ImFontGlyph_resize
#:ImVector_TextRange_resize
#:ImVector_CustomRect_resize
#:ImVector_ImDrawChannel_resize
#:ImVector_char_resize
#:ImVector_ImTextureID_resize
#:ImVector_ImDrawVert_resize
#:ImVector_int_resize
#:ImVector_Pair_resize
#:ImVector_ImFontPtr_resize
#:ImVector_ImVec4_resize
#:ImVector_ImDrawCmd_resize
#:ImVector_ImDrawIdx_resize
#:ImVector_ImVec2_resize
#:ImVector_float_resizeT
#:ImVector_ImWchar_resizeT
#:ImVector_ImFontConfig_resizeT
#:ImVector_ImFontGlyph_resizeT
#:ImVector_TextRange_resizeT
#:ImVector_CustomRect_resizeT
#:ImVector_ImDrawChannel_resizeT
#:ImVector_char_resizeT
#:ImVector_ImTextureID_resizeT
#:ImVector_ImDrawVert_resizeT
#:ImVector_int_resizeT
#:ImVector_Pair_resizeT
#:ImVector_ImFontPtr_resizeT
#:ImVector_ImVec4_resizeT
#:ImVector_ImDrawCmd_resizeT
#:ImVector_ImDrawIdx_resizeT
#:ImVector_ImVec2_resizeT
#:ImVector_float_reserve
#:ImVector_ImWchar_reserve
#:ImVector_ImFontConfig_reserve
#:ImVector_ImFontGlyph_reserve
#:ImVector_TextRange_reserve
#:ImVector_CustomRect_reserve
#:ImVector_ImDrawChannel_reserve
#:ImVector_char_reserve
#:ImVector_ImTextureID_reserve
#:ImVector_ImDrawVert_reserve
#:ImVector_int_reserve
#:ImVector_Pair_reserve
#:ImVector_ImFontPtr_reserve
#:ImVector_ImVec4_reserve
#:ImVector_ImDrawCmd_reserve
#:ImVector_ImDrawIdx_reserve
#:ImVector_ImVec2_reserve
#:ImVector_float_push_back
#:ImVector_ImWchar_push_back
#:ImVector_ImFontConfig_push_back
#:ImVector_ImFontGlyph_push_back
#:ImVector_TextRange_push_back
#:ImVector_CustomRect_push_back
#:ImVector_ImDrawChannel_push_back
#:ImVector_char_push_back
#:ImVector_ImTextureID_push_back
#:ImVector_ImDrawVert_push_back
#:ImVector_int_push_back
#:ImVector_Pair_push_back
#:ImVector_ImFontPtr_push_back
#:ImVector_ImVec4_push_back
#:ImVector_ImDrawCmd_push_back
#:ImVector_ImDrawIdx_push_back
#:ImVector_ImVec2_push_back
#:ImVector_float_pop_back
#:ImVector_ImWchar_pop_back
#:ImVector_ImFontConfig_pop_back
#:ImVector_ImFontGlyph_pop_back
#:ImVector_TextRange_pop_back
#:ImVector_CustomRect_pop_back
#:ImVector_ImDrawChannel_pop_back
#:ImVector_char_pop_back
#:ImVector_ImTextureID_pop_back
#:ImVector_ImDrawVert_pop_back
#:ImVector_int_pop_back
#:ImVector_Pair_pop_back
#:ImVector_ImFontPtr_pop_back
#:ImVector_ImVec4_pop_back
#:ImVector_ImDrawCmd_pop_back
#:ImVector_ImDrawIdx_pop_back
#:ImVector_ImVec2_pop_back
#:ImVector_float_push_front
#:ImVector_ImWchar_push_front
#:ImVector_ImFontConfig_push_front
#:ImVector_ImFontGlyph_push_front
#:ImVector_TextRange_push_front
#:ImVector_CustomRect_push_front
#:ImVector_ImDrawChannel_push_front
#:ImVector_char_push_front
#:ImVector_ImTextureID_push_front
#:ImVector_ImDrawVert_push_front
#:ImVector_int_push_front
#:ImVector_Pair_push_front
#:ImVector_ImFontPtr_push_front
#:ImVector_ImVec4_push_front
#:ImVector_ImDrawCmd_push_front
#:ImVector_ImDrawIdx_push_front
#:ImVector_ImVec2_push_front
#:ImVector_float_erase
#:ImVector_ImWchar_erase
#:ImVector_ImFontConfig_erase
#:ImVector_ImFontGlyph_erase
#:ImVector_TextRange_erase
#:ImVector_CustomRect_erase
#:ImVector_ImDrawChannel_erase
#:ImVector_char_erase
#:ImVector_ImTextureID_erase
#:ImVector_ImDrawVert_erase
#:ImVector_int_erase
#:ImVector_Pair_erase
#:ImVector_ImFontPtr_erase
#:ImVector_ImVec4_erase
#:ImVector_ImDrawCmd_erase
#:ImVector_ImDrawIdx_erase
#:ImVector_ImVec2_erase
#:ImVector_float_eraseTPtr
#:ImVector_ImWchar_eraseTPtr
#:ImVector_ImFontConfig_eraseTPtr
#:ImVector_ImFontGlyph_eraseTPtr
#:ImVector_TextRange_eraseTPtr
#:ImVector_CustomRect_eraseTPtr
#:ImVector_ImDrawChannel_eraseTPtr
#:ImVector_char_eraseTPtr
#:ImVector_ImTextureID_eraseTPtr
#:ImVector_ImDrawVert_eraseTPtr
#:ImVector_int_eraseTPtr
#:ImVector_Pair_eraseTPtr
#:ImVector_ImFontPtr_eraseTPtr
#:ImVector_ImVec4_eraseTPtr
#:ImVector_ImDrawCmd_eraseTPtr
#:ImVector_ImDrawIdx_eraseTPtr
#:ImVector_ImVec2_eraseTPtr
#:ImVector_float_erase_unsorted
#:ImVector_ImWchar_erase_unsorted
#:ImVector_ImFontConfig_erase_unsorted
#:ImVector_ImFontGlyph_erase_unsorted
#:ImVector_TextRange_erase_unsorted
#:ImVector_CustomRect_erase_unsorted
#:ImVector_ImDrawChannel_erase_unsorted
#:ImVector_char_erase_unsorted
#:ImVector_ImTextureID_erase_unsorted
#:ImVector_ImDrawVert_erase_unsorted
#:ImVector_int_erase_unsorted
#:ImVector_Pair_erase_unsorted
#:ImVector_ImFontPtr_erase_unsorted
#:ImVector_ImVec4_erase_unsorted
#:ImVector_ImDrawCmd_erase_unsorted
#:ImVector_ImDrawIdx_erase_unsorted
#:ImVector_ImVec2_erase_unsorted
#:ImVector_float_insert
#:ImVector_ImWchar_insert
#:ImVector_ImFontConfig_insert
#:ImVector_ImFontGlyph_insert
#:ImVector_TextRange_insert
#:ImVector_CustomRect_insert
#:ImVector_ImDrawChannel_insert
#:ImVector_char_insert
#:ImVector_ImTextureID_insert
#:ImVector_ImDrawVert_insert
#:ImVector_int_insert
#:ImVector_Pair_insert
#:ImVector_ImFontPtr_insert
#:ImVector_ImVec4_insert
#:ImVector_ImDrawCmd_insert
#:ImVector_ImDrawIdx_insert
#:ImVector_ImVec2_insert
#:ImVector_float_contains
#:ImVector_ImWchar_contains
#:ImVector_char_contains
#:ImVector_int_contains
#:ImVector_float_index_from_ptr
#:ImVector_ImWchar_index_from_ptr
#:ImVector_ImFontConfig_index_from_ptr
#:ImVector_ImFontGlyph_index_from_ptr
#:ImVector_TextRange_index_from_ptr
#:ImVector_CustomRect_index_from_ptr
#:ImVector_ImDrawChannel_index_from_ptr
#:ImVector_char_index_from_ptr
#:ImVector_ImTextureID_index_from_ptr
#:ImVector_ImDrawVert_index_from_ptr
#:ImVector_int_index_from_ptr
#:ImVector_Pair_index_from_ptr
#:ImVector_ImFontPtr_index_from_ptr
#:ImVector_ImVec4_index_from_ptr
#:ImVector_ImDrawCmd_index_from_ptr
#:ImVector_ImDrawIdx_index_from_ptr
#:ImVector_ImVec2_index_from_ptr
#:igLogText
#:ImGuiTextBuffer_appendf
#:igGET_FLT_MAX
#:igColorConvertRGBtoHSV
#:igColorConvertHSVtoRGB
#:ImVector_ImWchar_create
#:ImVector_ImWchar_Init
#:ImVector_ImWchar_UnInit
#:igBeginChild
#:igSetNextWindowPos
#:igSetNextWindowSize
#:igSetNextWindowSizeConstraints
#:igSetNextWindowContentSize
#:igSetWindowPosVec2
#:igSetWindowSizeVec2
#:igSetWindowPosStr
#:igSetWindowSizeStr
#:igPushStyleColor
#:igPushStyleVarVec2
#:igSetCursorPos
#:igSetCursorScreenPos
#:igTextColored
#:igTextColoredV
#:igButton
#:igInvisibleButton
#:igImage
#:igImageButton
#:igPlotLines
#:igPlotLinesFnPtr
#:igPlotHistogramFloatPtr
#:igPlotHistogramFnPtr
#:igInputTextMultiline
#:igVSliderFloat
#:igVSliderInt
#:igColorButton
#:igSelectable
#:igSelectableBoolPtr
#:igListBoxHeaderVec2
#:igPushClipRect
#:igIsRectVisible
#:igBeginChildFrame
#:igColorConvertFloat4ToU32
#:igIsMouseHoveringRect
#:ImDrawList_PushClipRect
#:ImDrawList_AddLine
#:ImDrawList_AddRect
#:ImDrawList_AddRectFilled
#:ImDrawList_AddRectFilledMultiColor
#:ImDrawList_AddQuad
#:ImDrawList_AddQuadFilled
#:ImDrawList_AddTriangle
#:ImDrawList_AddTriangleFilled
#:ImDrawList_AddCircle
#:ImDrawList_AddCircleFilled
#:ImDrawList_AddText
#:ImDrawList_AddTextFontPtr
#:ImDrawList_AddImage
#:ImDrawList_AddImageQuad
#:ImDrawList_AddImageRounded
#:ImDrawList_PathLineTo
#:ImDrawList_PathLineToMergeDuplicate
#:ImDrawList_PathArcTo
#:ImDrawList_PathArcToFast
#:ImDrawList_PathBezierCurveTo
#:ImDrawList_PathRect
#:ImDrawList_PrimRect
#:ImDrawList_PrimRectUV
#:ImDrawList_PrimQuadUV
#:ImDrawList_PrimWriteVtx
#:ImDrawList_PrimVtx
#:ImDrawData_ScaleClipRects
#:igGetWindowPos
#:igGetWindowSize
#:igGetContentRegionMax
#:igGetContentRegionAvail
#:igGetWindowContentRegionMin
#:igGetWindowContentRegionMax
#:igGetFontTexUvWhitePixel
#:igGetCursorPos
#:igGetCursorStartPos
#:igGetCursorScreenPos
#:igGetItemRectMin
#:igGetItemRectMax
#:igGetItemRectSize
#:igCalcTextSize
#:igColorConvertU32ToFloat4
#:igGetMousePos
#:igGetMousePosOnOpeningCurrentPopup
#:igGetMouseDragDelta
#:ImColor_HSV
#:ImDrawList_GetClipRectMin
#:ImDrawList_GetClipRectMax
#:ImFont_CalcTextSizeA
#:igGetWindowPos_nonUDT2
#:igGetWindowSize_nonUDT2
#:igGetContentRegionMax_nonUDT2
#:igGetContentRegionAvail_nonUDT2
#:igGetWindowContentRegionMin_nonUDT2
#:igGetWindowContentRegionMax_nonUDT2
#:igGetFontTexUvWhitePixel_nonUDT2
#:igGetCursorPos_nonUDT2
#:igGetCursorStartPos_nonUDT2
#:igGetCursorScreenPos_nonUDT2
#:igGetItemRectMin_nonUDT2
#:igGetItemRectMax_nonUDT2
#:igCalcTextSize_nonUDT2
#:igColorConvertU32ToFloat4_nonUDT2
#:igGetMousePos_nonUDT2
#:igGetMousePosOnOpeningCurrentPopup_nonUDT2
#:igGetMouseDragDelta_nonUDT2
#:ImColor_HSV_nonUDT2
#:ImDrawList_GetClipRectMin_nonUDT2
#:ImDrawList_GetClipRectMax_nonUDT2
#:ImFont_CalcTextSizeA_nonUDT2))
|
a2ff17370622d22c4e0543a74a1f11b029bb5ad6de6db212cd372dea491159f1 | lispnik/cl-http | mcl-mop-package.lisp | (defpackage "MCL-MOP"
(:use :cl #+:mcl :ccl)
#+:mcl (:nicknames :mop)
(:shadow "METAOBJECT")
(:export
Readers for Class
; "CLASS-DEFAULT-INITARGS"
; "CLASS-DIRECT-DEFAULT-INITARGS"
"CLASS-DIRECT-SLOTS"
"CLASS-DIRECT-SUBCLASSES"
"CLASS-DIRECT-SUPERCLASSES"
; "CLASS-FINALIZED-P"
; "CLASS-NAME"
"CLASS-PRECEDENCE-LIST"
"CLASS-PROTOTYPE"
"CLASS-SLOTS"
"ENSURE-CLASS"
"ENSURE-CLASS-USING-CLASS"
;; Readers for Generic Function Metaobjects
; "GENERIC-FUNCTION-ARGUMENT-PRECEDENCE-ORDER"
; "GENERIC-FUNCTION-DECLARATIONS"
; "GENERIC-FUNCTION-LAMBDA-LIST"
; "GENERIC-FUNCTION-METHOD-CLASS"
; "GENERIC-FUNCTION-METHOD-COMBINATION"
; "GENERIC-FUNCTION-METHODS"
; "GENERIC-FUNCTION-NAME"
;; Readers for Method Metaobjects
;; Readers for Slot Definition Metaobjects
"SLOT-DEFINITION-ALLOCATION"
"SLOT-DEFINITION-INITARGS"
"SLOT-DEFINITION-INITFORM"
"SLOT-DEFINITION-INITFUNCTION"
"SLOT-DEFINITION-NAME"
"SLOT-DEFINITION-TYPE"
"SLOT-DEFINITION-READERS"
; "SLOT-DEFINITION-LOCATION"
"SLOT-DEFINITION-WRITERS"
;; nicht im Standard-MOP
"MOP-STANDARD-CLASS"
"CANONICALIZE-DEFCLASS-OPTION"
"CANONICALIZE-DEFCLASS-OPTIONS"
"EFFECTIVE-SLOT-DEFINITION-CLASS"
"DIRECT-SLOT-DEFINITION-CLASS"
"STANDARD-EFFECTIVE-SLOT-DEFINITION"
"STANDARD-DIRECT-SLOT-DEFINITION"))
| null | https://raw.githubusercontent.com/lispnik/cl-http/84391892d88c505aed705762a153eb65befb6409/contrib/janderson/xml-1998-02-27/mcl-mop-package.lisp | lisp | "CLASS-DEFAULT-INITARGS"
"CLASS-DIRECT-DEFAULT-INITARGS"
"CLASS-FINALIZED-P"
"CLASS-NAME"
Readers for Generic Function Metaobjects
"GENERIC-FUNCTION-ARGUMENT-PRECEDENCE-ORDER"
"GENERIC-FUNCTION-DECLARATIONS"
"GENERIC-FUNCTION-LAMBDA-LIST"
"GENERIC-FUNCTION-METHOD-CLASS"
"GENERIC-FUNCTION-METHOD-COMBINATION"
"GENERIC-FUNCTION-METHODS"
"GENERIC-FUNCTION-NAME"
Readers for Method Metaobjects
Readers for Slot Definition Metaobjects
"SLOT-DEFINITION-LOCATION"
nicht im Standard-MOP | (defpackage "MCL-MOP"
(:use :cl #+:mcl :ccl)
#+:mcl (:nicknames :mop)
(:shadow "METAOBJECT")
(:export
Readers for Class
"CLASS-DIRECT-SLOTS"
"CLASS-DIRECT-SUBCLASSES"
"CLASS-DIRECT-SUPERCLASSES"
"CLASS-PRECEDENCE-LIST"
"CLASS-PROTOTYPE"
"CLASS-SLOTS"
"ENSURE-CLASS"
"ENSURE-CLASS-USING-CLASS"
"SLOT-DEFINITION-ALLOCATION"
"SLOT-DEFINITION-INITARGS"
"SLOT-DEFINITION-INITFORM"
"SLOT-DEFINITION-INITFUNCTION"
"SLOT-DEFINITION-NAME"
"SLOT-DEFINITION-TYPE"
"SLOT-DEFINITION-READERS"
"SLOT-DEFINITION-WRITERS"
"MOP-STANDARD-CLASS"
"CANONICALIZE-DEFCLASS-OPTION"
"CANONICALIZE-DEFCLASS-OPTIONS"
"EFFECTIVE-SLOT-DEFINITION-CLASS"
"DIRECT-SLOT-DEFINITION-CLASS"
"STANDARD-EFFECTIVE-SLOT-DEFINITION"
"STANDARD-DIRECT-SLOT-DEFINITION"))
|
0b4c3f924da174d433594719453013a343e11cafca5a71dc7e15f2bea3b9990e | VERIMAG-Polyhedra/VPL | QNoneItv.ml | open NumC
open Qcanon
open Itv
open DomainInterfaces
module QN = struct
type t = coq_Qc option
let add qn1 qn2 =
match qn1, qn2 with
| Some q1, Some q2 -> Some (QNum.add q1 q2)
| _,_ -> None
(** val opp : t -> t **)
let opp = function
| Some q -> Some (QNum.opp q)
| None -> None
let max : coq_Qc -> coq_Qc -> coq_Qc
= fun q1 q2 ->
if coq_Qclt_le_dec q1 q2
then q2
else q1
let min : coq_Qc -> coq_Qc -> coq_Qc
= fun q1 q2 ->
if coq_Qclt_le_dec q1 q2
then q1
else q2
* join : t - > t - > t *
let join qn1 qn2 =
match qn1, qn2 with
| Some q1, Some q2 -> Some (max q1 q2)
| _,_ -> None
let mul qn1 qn2 =
match qn1, qn2 with
| Some q1, Some q2 -> Some (QNum.mul q1 q2)
| _,_ -> None
(** val meet : t -> t -> t **)
let meet qn1 qn2 =
match qn1, qn2 with
| Some q1, Some q2 -> Some (min q1 q2)
| _,_ -> None
end
module QNItv = struct
type itv = { low : QN.t; up : QN.t }
(** val low : itv -> QN.t **)
let low x = x.low
(** val up : itv -> QN.t **)
let up x = x.up
type t = itv
* top : itv *
let top =
{ low = None; up = None }
let fromBndT = function
| QItv.Infty -> None
| QItv.Open n | QItv.Closed n -> Some n
let oppMode = function
| BOTH -> BOTH
| UP -> LOW
| LOW -> UP
let fromQItv i =
{ low = (fromBndT i.QItv.lower); up = (fromBndT i.QItv.upper) }
(** val single : coq_Z -> itv **)
let single z =
let zn = Some z in { low = zn; up = zn }
* add : mode - > itv - > itv - > itv *
let add m i1 i2 =
match m with
| BOTH -> { low = QN.add i1.low i2.low; up = QN.add i1.up i2.up }
| UP -> { low = None; up = QN.add i1.up i2.up }
| LOW -> { low = QN.add i1.low i2.low; up = None}
* val opp : itv - > itv *
let opp i = { low = QN.opp i.low ; up = QN.opp i.up }
mul ( l1,u1 ) ( l2,u2 ) = min ( l1*l2 , l1*u12 , u1 * l2 , u1 * u2 ) , ...
let mul m i1 i2 =
match m with
| BOTH -> let max = QN.join
(QN.join
(QN.join
(QN.mul i1.low i2.low)
(QN.mul i1.low i2.up))
(QN.mul i1.up i2.low))
(QN.mul i1.up i2.up)
in
let min = QN.meet
(QN.meet
(QN.meet
(QN.mul i1.low i2.low)
(QN.mul i1.low i2.up))
(QN.mul i1.up i2.low))
(QN.mul i1.up i2.up)
in
{ low = min ; up = max }
| UP -> let max = QN.join
(QN.join
(QN.join
(QN.mul i1.low i2.low)
(QN.mul i1.low i2.up))
(QN.mul i1.up i2.low))
(QN.mul i1.up i2.up)
in
{ low = None; up = max }
| LOW -> let min = QN.meet
(QN.meet
(QN.meet
(QN.mul i1.low i2.low)
(QN.mul i1.low i2.up))
(QN.mul i1.up i2.low))
(QN.mul i1.up i2.up)
in
{ low = min ; up = None }
* join : mode - > itv - > itv - > itv *
let join m i1 i2 =
match m with
| BOTH -> { low = (QN.meet i1.low i2.low); up = (QN.join i1.up i2.up) }
| UP -> { low = None; up = (QN.join i1.up i2.up) }
| LOW -> { low = (QN.meet i1.low i2.low); up = None }
end
| null | https://raw.githubusercontent.com/VERIMAG-Polyhedra/VPL/cd78d6e7d120508fd5a694bdb01300477e5646f8/ocaml/lin/oracle/QNoneItv.ml | ocaml | * val opp : t -> t *
* val meet : t -> t -> t *
* val low : itv -> QN.t *
* val up : itv -> QN.t *
* val single : coq_Z -> itv * | open NumC
open Qcanon
open Itv
open DomainInterfaces
module QN = struct
type t = coq_Qc option
let add qn1 qn2 =
match qn1, qn2 with
| Some q1, Some q2 -> Some (QNum.add q1 q2)
| _,_ -> None
let opp = function
| Some q -> Some (QNum.opp q)
| None -> None
let max : coq_Qc -> coq_Qc -> coq_Qc
= fun q1 q2 ->
if coq_Qclt_le_dec q1 q2
then q2
else q1
let min : coq_Qc -> coq_Qc -> coq_Qc
= fun q1 q2 ->
if coq_Qclt_le_dec q1 q2
then q1
else q2
* join : t - > t - > t *
let join qn1 qn2 =
match qn1, qn2 with
| Some q1, Some q2 -> Some (max q1 q2)
| _,_ -> None
let mul qn1 qn2 =
match qn1, qn2 with
| Some q1, Some q2 -> Some (QNum.mul q1 q2)
| _,_ -> None
let meet qn1 qn2 =
match qn1, qn2 with
| Some q1, Some q2 -> Some (min q1 q2)
| _,_ -> None
end
module QNItv = struct
type itv = { low : QN.t; up : QN.t }
let low x = x.low
let up x = x.up
type t = itv
* top : itv *
let top =
{ low = None; up = None }
let fromBndT = function
| QItv.Infty -> None
| QItv.Open n | QItv.Closed n -> Some n
let oppMode = function
| BOTH -> BOTH
| UP -> LOW
| LOW -> UP
let fromQItv i =
{ low = (fromBndT i.QItv.lower); up = (fromBndT i.QItv.upper) }
let single z =
let zn = Some z in { low = zn; up = zn }
* add : mode - > itv - > itv - > itv *
let add m i1 i2 =
match m with
| BOTH -> { low = QN.add i1.low i2.low; up = QN.add i1.up i2.up }
| UP -> { low = None; up = QN.add i1.up i2.up }
| LOW -> { low = QN.add i1.low i2.low; up = None}
* val opp : itv - > itv *
let opp i = { low = QN.opp i.low ; up = QN.opp i.up }
mul ( l1,u1 ) ( l2,u2 ) = min ( l1*l2 , l1*u12 , u1 * l2 , u1 * u2 ) , ...
let mul m i1 i2 =
match m with
| BOTH -> let max = QN.join
(QN.join
(QN.join
(QN.mul i1.low i2.low)
(QN.mul i1.low i2.up))
(QN.mul i1.up i2.low))
(QN.mul i1.up i2.up)
in
let min = QN.meet
(QN.meet
(QN.meet
(QN.mul i1.low i2.low)
(QN.mul i1.low i2.up))
(QN.mul i1.up i2.low))
(QN.mul i1.up i2.up)
in
{ low = min ; up = max }
| UP -> let max = QN.join
(QN.join
(QN.join
(QN.mul i1.low i2.low)
(QN.mul i1.low i2.up))
(QN.mul i1.up i2.low))
(QN.mul i1.up i2.up)
in
{ low = None; up = max }
| LOW -> let min = QN.meet
(QN.meet
(QN.meet
(QN.mul i1.low i2.low)
(QN.mul i1.low i2.up))
(QN.mul i1.up i2.low))
(QN.mul i1.up i2.up)
in
{ low = min ; up = None }
* join : mode - > itv - > itv - > itv *
let join m i1 i2 =
match m with
| BOTH -> { low = (QN.meet i1.low i2.low); up = (QN.join i1.up i2.up) }
| UP -> { low = None; up = (QN.join i1.up i2.up) }
| LOW -> { low = (QN.meet i1.low i2.low); up = None }
end
|
667b37f6a835c517ca5bbec3eed9ccb5400c3d9ea90447f62adb4650b6f375e9 | patrickt/scraps | lookandsay.hs | -- -and-say_sequence
Implementation of the look - and - say sequence in 15 lines of code .
Arrows are a very nice way to represent sequenced , chainable functions
in Haskell . For more info , check the wonderful Wikibooks tutorial at
--
import Control.Arrow
import Data.List (group)
-- `say` produces a new integer by reading out the digits in its argument.
-- The >>> operator sequences functions together.
say :: Integer -> Integer
say = digits >>> encode >>> glue
-- digits splits a number up into its component digits.
digits :: Integer -> [Integer]
digits = fmap read . fmap return . show
-- encode performs run-length encoding on its arguments.
We get rid of nasty tuple manipulation with the & & & combinator .
encode :: (Eq a) => [a] -> [(Int, a)]
encode = fmap (length &&& head) . group
-- glue assembles the new number out of a list of encoded tuples
glue :: [(Int, Integer)] -> Integer
glue = read . concatMap show' where show' (a,b) = show a ++ show b
-- The iterate method builds an infinite list out of a starting value and method.
lookAndSaySequence :: [Integer]
lookAndSaySequence = iterate say 1
-- Proof that it works.
main :: IO ()
main = print $ take 15 lookAndSaySequence | null | https://raw.githubusercontent.com/patrickt/scraps/517c8f913000b9d7b886338cf06adf5d9e239d31/lookandsay.hs | haskell | -and-say_sequence
`say` produces a new integer by reading out the digits in its argument.
The >>> operator sequences functions together.
digits splits a number up into its component digits.
encode performs run-length encoding on its arguments.
glue assembles the new number out of a list of encoded tuples
The iterate method builds an infinite list out of a starting value and method.
Proof that it works. | Implementation of the look - and - say sequence in 15 lines of code .
Arrows are a very nice way to represent sequenced , chainable functions
in Haskell . For more info , check the wonderful Wikibooks tutorial at
import Control.Arrow
import Data.List (group)
say :: Integer -> Integer
say = digits >>> encode >>> glue
digits :: Integer -> [Integer]
digits = fmap read . fmap return . show
We get rid of nasty tuple manipulation with the & & & combinator .
encode :: (Eq a) => [a] -> [(Int, a)]
encode = fmap (length &&& head) . group
glue :: [(Int, Integer)] -> Integer
glue = read . concatMap show' where show' (a,b) = show a ++ show b
lookAndSaySequence :: [Integer]
lookAndSaySequence = iterate say 1
main :: IO ()
main = print $ take 15 lookAndSaySequence |
637577dafd49588eafa27b87e44ffccdcbcd87d9b1c260bae433bf9e9d243a9a | hatemogi/misaeng | 집합.clj | (ns 미생.집합
(:use [clojure.set]
[미생.기본]))
(정의*
합집합 union
차집합 difference
교집합 intersection
부분집합? subset?
확대집합? superset?)
| null | https://raw.githubusercontent.com/hatemogi/misaeng/7b097d9d9ae497606cf54be586fe7a0f50bb7ffc/src/%EB%AF%B8%EC%83%9D/%EC%A7%91%ED%95%A9.clj | clojure | (ns 미생.집합
(:use [clojure.set]
[미생.기본]))
(정의*
합집합 union
차집합 difference
교집합 intersection
부분집합? subset?
확대집합? superset?)
| |
036aaf19a469651dfd1d120f768532db6178fc04e431faaaa6da2ad4c9b33787 | cedlemo/OCaml-GI-ctypes-bindings-generator | Target_list.mli | open Ctypes
type t
val t_typ : t structure typ
(*Not implemented gtk_target_list_new type C Array type for Types.Array tag not implemented*)
val add :
t structure ptr -> Atom.t structure ptr -> Unsigned.uint32 -> Unsigned.uint32 -> unit
val add_image_targets :
t structure ptr -> Unsigned.uint32 -> bool -> unit
val add_rich_text_targets :
t structure ptr -> Unsigned.uint32 -> bool -> Text_buffer.t ptr -> unit
(*Not implemented gtk_target_list_add_table type C Array type for Types.Array tag not implemented*)
val add_text_targets :
t structure ptr -> Unsigned.uint32 -> unit
val add_uri_targets :
t structure ptr -> Unsigned.uint32 -> unit
val find :
t structure ptr -> Atom.t structure ptr -> (bool * Unsigned.uint32)
val incr_ref :
t structure ptr -> t structure ptr
val remove :
t structure ptr -> Atom.t structure ptr -> unit
val unref :
t structure ptr -> unit
| null | https://raw.githubusercontent.com/cedlemo/OCaml-GI-ctypes-bindings-generator/21a4d449f9dbd6785131979b91aa76877bad2615/tools/Gtk3/Target_list.mli | ocaml | Not implemented gtk_target_list_new type C Array type for Types.Array tag not implemented
Not implemented gtk_target_list_add_table type C Array type for Types.Array tag not implemented | open Ctypes
type t
val t_typ : t structure typ
val add :
t structure ptr -> Atom.t structure ptr -> Unsigned.uint32 -> Unsigned.uint32 -> unit
val add_image_targets :
t structure ptr -> Unsigned.uint32 -> bool -> unit
val add_rich_text_targets :
t structure ptr -> Unsigned.uint32 -> bool -> Text_buffer.t ptr -> unit
val add_text_targets :
t structure ptr -> Unsigned.uint32 -> unit
val add_uri_targets :
t structure ptr -> Unsigned.uint32 -> unit
val find :
t structure ptr -> Atom.t structure ptr -> (bool * Unsigned.uint32)
val incr_ref :
t structure ptr -> t structure ptr
val remove :
t structure ptr -> Atom.t structure ptr -> unit
val unref :
t structure ptr -> unit
|
f6e0a3b8111c1686ee1f3c1640eebb16b964a6489875d9ccaecd8f2a7a1b5e0e | GregoryTravis/holfenstein | FPS.hs | module FPS
( fps
, frBufferEmpty
) where
import Data.Time.Clock.POSIX (getPOSIXTime)
frBufferLen = 20
data FRBuffer = FRBuffer [Double] Double Int
frBufferEmpty = FRBuffer [] 0 0
frBufferAvg (FRBuffer _ _ 0) = 0
frBufferAvg (FRBuffer es tot num) = tot / (fromIntegral num)
frBufferAdd (FRBuffer es tot num) e | num == frBufferLen = FRBuffer [e] e 1
| otherwise = FRBuffer (e : es) (tot + e) (num + 1)
frBufferUpdate :: FRBuffer -> Double -> (Double, FRBuffer)
frBufferUpdate frBuf e = (frBufferAvg frBuf, frBufferAdd frBuf e)
fps lastNow frBuf = do
now <- getPOSIXTime
let instantFPS :: Double
instantFPS = 1.0 / (realToFrac (now - lastNow))
let (fps, newFRBuf) = frBufferUpdate frBuf instantFPS
return (now, fps, newFRBuf)
| null | https://raw.githubusercontent.com/GregoryTravis/holfenstein/fcb8743351700c701757dc13fb6defcde53be306/FPS.hs | haskell | module FPS
( fps
, frBufferEmpty
) where
import Data.Time.Clock.POSIX (getPOSIXTime)
frBufferLen = 20
data FRBuffer = FRBuffer [Double] Double Int
frBufferEmpty = FRBuffer [] 0 0
frBufferAvg (FRBuffer _ _ 0) = 0
frBufferAvg (FRBuffer es tot num) = tot / (fromIntegral num)
frBufferAdd (FRBuffer es tot num) e | num == frBufferLen = FRBuffer [e] e 1
| otherwise = FRBuffer (e : es) (tot + e) (num + 1)
frBufferUpdate :: FRBuffer -> Double -> (Double, FRBuffer)
frBufferUpdate frBuf e = (frBufferAvg frBuf, frBufferAdd frBuf e)
fps lastNow frBuf = do
now <- getPOSIXTime
let instantFPS :: Double
instantFPS = 1.0 / (realToFrac (now - lastNow))
let (fps, newFRBuf) = frBufferUpdate frBuf instantFPS
return (now, fps, newFRBuf)
| |
2c3f3c7a5541355e365fa38d4c958b84e5e3d1a4a4ced148e4eb9924f2eedf5f | f-me/carma-public | DeliveryType.hs | module Carma.Model.DeliveryType where
import Data.Text
import Data.Typeable
import Data.Model
import Data.Model.View
import Carma.Model.Types()
import Carma.Model.PgTypes()
data DeliveryType = DeliveryType
{ ident
:: PK Int DeliveryType "Тип доставки"
, label
:: F Text "label" "Тип"
} deriving Typeable
instance Model DeliveryType where
type TableName DeliveryType = "DeliveryType"
modelInfo = mkModelInfo DeliveryType ident
modelView = \case
"" -> Just defaultView
_ -> Nothing
| null | https://raw.githubusercontent.com/f-me/carma-public/82a9f44f7d919e54daa4114aa08dfec58b01009b/carma-models/src/Carma/Model/DeliveryType.hs | haskell | module Carma.Model.DeliveryType where
import Data.Text
import Data.Typeable
import Data.Model
import Data.Model.View
import Carma.Model.Types()
import Carma.Model.PgTypes()
data DeliveryType = DeliveryType
{ ident
:: PK Int DeliveryType "Тип доставки"
, label
:: F Text "label" "Тип"
} deriving Typeable
instance Model DeliveryType where
type TableName DeliveryType = "DeliveryType"
modelInfo = mkModelInfo DeliveryType ident
modelView = \case
"" -> Just defaultView
_ -> Nothing
| |
e0894357ca543ea6befa354cbfb3972e24c6306d856161f2d20d2f4f131163e8 | shayne-fletcher/zen | ml_longident.mli | type t =
| Lident of string
| Ldot of t * string
| Lapply of t * t
val flatten : t -> string list
val last : t -> string
val parse : string -> t
| null | https://raw.githubusercontent.com/shayne-fletcher/zen/10a1d0b9bf261bb133918dd62fb1593c3d4d21cb/ocaml/cos/src/parsing/ml_longident.mli | ocaml | type t =
| Lident of string
| Ldot of t * string
| Lapply of t * t
val flatten : t -> string list
val last : t -> string
val parse : string -> t
| |
c02564b552a86432e463baccd5efde800849075f2e1658d017de1ffe4ecc9f2a | clojure-link/link | http2.clj | (ns link.http.http2
(:require [link.core :refer :all]
[link.http.common :refer :all]
[clojure.string :as string]
[clojure.tools.logging :as logging])
(:import [java.net InetSocketAddress]
[io.netty.buffer ByteBufInputStream]
[io.netty.channel ChannelFuture SimpleChannelInboundHandler]
[io.netty.handler.codec.http HttpResponseStatus
HttpServerUpgradeHandler$UpgradeCodecFactory]
[io.netty.handler.codec.http2 Http2FrameCodecBuilder
Http2HeadersFrame Http2DataFrame Http2Headers Http2Headers$PseudoHeaderName
DefaultHttp2Headers DefaultHttp2HeadersFrame DefaultHttp2DataFrame
Http2CodecUtil Http2ServerUpgradeCodec]
[io.netty.util.concurrent GenericFutureListener]))
(defn from-header-iterator
"extract ring headers from http2headers"
[http2headers-iterator]
(as-header-map (iterator-seq http2headers-iterator)))
(defn ring-data-from-header [ch ^Http2HeadersFrame frame]
(let [server-addr (channel-addr ch)
http2headers (.headers frame)
uri (str (.path http2headers))
header-map (from-header-iterator (.iterator http2headers))]
{:scheme (keyword (str (.scheme http2headers)))
:protocol "h2c"
:request-method (-> (.method http2headers) (string/lower-case) (keyword))
:uri (find-request-uri uri)
:query-string (find-query-string uri)
:headers header-map
:server-name (.getHostString ^InetSocketAddress server-addr)
:server-port (.getPort ^InetSocketAddress server-addr)
:remote-addr (.getHostString ^InetSocketAddress (remote-addr ch))}))
(defn ring-response-to-http2 [resp alloc]
(let [resp (if (map? resp) resp {:body resp})
{status :status headers :headers body :body} resp
status (or status 200)
content (content-from-ring-body body alloc)
http2headers (doto (DefaultHttp2Headers.)
(.status (.codeAsText (HttpResponseStatus/valueOf status))))]
;; set headers
(doseq [header (or headers {})]
(.set ^DefaultHttp2Headers http2headers ^String (key header) ^Object (val header)))
(if content
[(DefaultHttp2HeadersFrame. http2headers)
(DefaultHttp2DataFrame. content true)]
[(DefaultHttp2HeadersFrame. http2headers true)])))
(defn http2-on-error [ch exc debug]
(let [resp-frames (ring-response-to-http2 {:status 500
:body (if debug
(str (.getStackTrace exc))
"Internal Error")}
(.alloc ch))]
;; TODO: which stream?
(doseq [f resp-frames]
(send! ch f))))
(def ^:const http2-data-key "HTTP_DATA")
(defn- handle-full-request [ch msg ring-fn async? debug?]
(when (.isEndStream msg)
(let [ring-req (channel-attr-get ch http2-data-key)
stream (.stream msg)]
(if-not async?
;; sync
(let [ring-resp (ring-fn ring-req)
resp-frames (ring-response-to-http2 ring-resp (.alloc ch))]
(doseq [f resp-frames]
(send! ch (.stream f stream))))
;; async
(let [send-fn (fn [resp]
(doseq [f (ring-response-to-http2 resp (.alloc ch))]
(send! ch (.stream f stream))))
raise-fn (fn [error]
(http2-on-error ch error debug?))]
(ring-fn ring-req send-fn raise-fn))))))
(defn http2-stream-handler [ring-fn async? debug?]
(create-handler
(on-message [ch msg]
(println msg)
(cond
(instance? Http2HeadersFrame msg)
(let [ring-data (ring-data-from-header ch msg)]
(channel-attr-set! ch http2-data-key ring-data)
(handle-full-request ch msg ring-fn async? debug?))
(instance? Http2DataFrame msg)
(let [body-in (ByteBufInputStream. (.content ^Http2DataFrame msg))
ring-data (channel-attr-get http2-data-key)]
(when (> (.available ^ByteBufInputStream body-in) 0)
(channel-attr-set! ch http2-data-key
(assoc ring-data :body body-in)))
(handle-full-request ch msg ring-fn async? debug?)))
)
(on-error [ch exc]
(logging/warn exc "Uncaught exception")
(http2-on-error ch exc debug?))))
(defn http2-frame-handler []
(.build (Http2FrameCodecBuilder/forServer)))
;; for h2c
(defn http2-upgrade-handler [ring-fn async? debug?]
(reify HttpServerUpgradeHandler$UpgradeCodecFactory
(newUpgradeCodec [this protocol]
(when (= protocol Http2CodecUtil/HTTP_UPGRADE_PROTOCOL_NAME)
(Http2ServerUpgradeCodec.
(http2-frame-handler)
(http2-stream-handler ring-fn async? debug?))))))
| null | https://raw.githubusercontent.com/clojure-link/link/2b6f6abe70edfade738c7391d38c5b509c798a40/src/link/http/http2.clj | clojure | set headers
TODO: which stream?
sync
async
for h2c | (ns link.http.http2
(:require [link.core :refer :all]
[link.http.common :refer :all]
[clojure.string :as string]
[clojure.tools.logging :as logging])
(:import [java.net InetSocketAddress]
[io.netty.buffer ByteBufInputStream]
[io.netty.channel ChannelFuture SimpleChannelInboundHandler]
[io.netty.handler.codec.http HttpResponseStatus
HttpServerUpgradeHandler$UpgradeCodecFactory]
[io.netty.handler.codec.http2 Http2FrameCodecBuilder
Http2HeadersFrame Http2DataFrame Http2Headers Http2Headers$PseudoHeaderName
DefaultHttp2Headers DefaultHttp2HeadersFrame DefaultHttp2DataFrame
Http2CodecUtil Http2ServerUpgradeCodec]
[io.netty.util.concurrent GenericFutureListener]))
(defn from-header-iterator
"extract ring headers from http2headers"
[http2headers-iterator]
(as-header-map (iterator-seq http2headers-iterator)))
(defn ring-data-from-header [ch ^Http2HeadersFrame frame]
(let [server-addr (channel-addr ch)
http2headers (.headers frame)
uri (str (.path http2headers))
header-map (from-header-iterator (.iterator http2headers))]
{:scheme (keyword (str (.scheme http2headers)))
:protocol "h2c"
:request-method (-> (.method http2headers) (string/lower-case) (keyword))
:uri (find-request-uri uri)
:query-string (find-query-string uri)
:headers header-map
:server-name (.getHostString ^InetSocketAddress server-addr)
:server-port (.getPort ^InetSocketAddress server-addr)
:remote-addr (.getHostString ^InetSocketAddress (remote-addr ch))}))
(defn ring-response-to-http2 [resp alloc]
(let [resp (if (map? resp) resp {:body resp})
{status :status headers :headers body :body} resp
status (or status 200)
content (content-from-ring-body body alloc)
http2headers (doto (DefaultHttp2Headers.)
(.status (.codeAsText (HttpResponseStatus/valueOf status))))]
(doseq [header (or headers {})]
(.set ^DefaultHttp2Headers http2headers ^String (key header) ^Object (val header)))
(if content
[(DefaultHttp2HeadersFrame. http2headers)
(DefaultHttp2DataFrame. content true)]
[(DefaultHttp2HeadersFrame. http2headers true)])))
(defn http2-on-error [ch exc debug]
(let [resp-frames (ring-response-to-http2 {:status 500
:body (if debug
(str (.getStackTrace exc))
"Internal Error")}
(.alloc ch))]
(doseq [f resp-frames]
(send! ch f))))
(def ^:const http2-data-key "HTTP_DATA")
(defn- handle-full-request [ch msg ring-fn async? debug?]
(when (.isEndStream msg)
(let [ring-req (channel-attr-get ch http2-data-key)
stream (.stream msg)]
(if-not async?
(let [ring-resp (ring-fn ring-req)
resp-frames (ring-response-to-http2 ring-resp (.alloc ch))]
(doseq [f resp-frames]
(send! ch (.stream f stream))))
(let [send-fn (fn [resp]
(doseq [f (ring-response-to-http2 resp (.alloc ch))]
(send! ch (.stream f stream))))
raise-fn (fn [error]
(http2-on-error ch error debug?))]
(ring-fn ring-req send-fn raise-fn))))))
(defn http2-stream-handler [ring-fn async? debug?]
(create-handler
(on-message [ch msg]
(println msg)
(cond
(instance? Http2HeadersFrame msg)
(let [ring-data (ring-data-from-header ch msg)]
(channel-attr-set! ch http2-data-key ring-data)
(handle-full-request ch msg ring-fn async? debug?))
(instance? Http2DataFrame msg)
(let [body-in (ByteBufInputStream. (.content ^Http2DataFrame msg))
ring-data (channel-attr-get http2-data-key)]
(when (> (.available ^ByteBufInputStream body-in) 0)
(channel-attr-set! ch http2-data-key
(assoc ring-data :body body-in)))
(handle-full-request ch msg ring-fn async? debug?)))
)
(on-error [ch exc]
(logging/warn exc "Uncaught exception")
(http2-on-error ch exc debug?))))
(defn http2-frame-handler []
(.build (Http2FrameCodecBuilder/forServer)))
(defn http2-upgrade-handler [ring-fn async? debug?]
(reify HttpServerUpgradeHandler$UpgradeCodecFactory
(newUpgradeCodec [this protocol]
(when (= protocol Http2CodecUtil/HTTP_UPGRADE_PROTOCOL_NAME)
(Http2ServerUpgradeCodec.
(http2-frame-handler)
(http2-stream-handler ring-fn async? debug?))))))
|
cd96943a6452ba4d80161221a24299e0d329e2bc463d387b74a45716361c0d8c | jacekschae/learn-re-frame-course-files | recipe_card.cljs | (ns app.recipes.views.recipe-card
(:require [app.router :as router]
["@smooth-ui/core-sc" :refer [Button Box Typography]]
["styled-icons/fa-solid/Heart" :refer [Heart]]
["styled-icons/fa-regular/Clock" :refer [Clock]]))
(defn recipe-card
[{:keys [name saved-count prep-time img id]}]
[:> Box {:as "a"
:href (router/path-for :recipes)
:class "recipe-card"}
[:> Box {:class "img-card"
:background-image (str "url(" (or img "/img/placeholder.jpg") ")")
:background-size "cover"
:min-height "280px"
:alt name}]
[:> Box {:p 2}
[:> Typography {:variant "h6"
:font-weight 700}
name]]
[:> Box {:pl 2
:pb 2
:display "flex"}
[:> Box {:display "flex"
:align-items "center"}
[:> Heart {:size 16}]
[:> Box {:pl 10}
saved-count]]
[:> Box {:display "flex"
:align-items "center"
:pl 5}
[:> Clock {:size 16}]
[:> Box {:pl 10}
prep-time " min"]]]])
| null | https://raw.githubusercontent.com/jacekschae/learn-re-frame-course-files/a86e6f14b89c595b4389b03459539a9544af4e1d/increments/27-recipe-route/src/app/recipes/views/recipe_card.cljs | clojure | (ns app.recipes.views.recipe-card
(:require [app.router :as router]
["@smooth-ui/core-sc" :refer [Button Box Typography]]
["styled-icons/fa-solid/Heart" :refer [Heart]]
["styled-icons/fa-regular/Clock" :refer [Clock]]))
(defn recipe-card
[{:keys [name saved-count prep-time img id]}]
[:> Box {:as "a"
:href (router/path-for :recipes)
:class "recipe-card"}
[:> Box {:class "img-card"
:background-image (str "url(" (or img "/img/placeholder.jpg") ")")
:background-size "cover"
:min-height "280px"
:alt name}]
[:> Box {:p 2}
[:> Typography {:variant "h6"
:font-weight 700}
name]]
[:> Box {:pl 2
:pb 2
:display "flex"}
[:> Box {:display "flex"
:align-items "center"}
[:> Heart {:size 16}]
[:> Box {:pl 10}
saved-count]]
[:> Box {:display "flex"
:align-items "center"
:pl 5}
[:> Clock {:size 16}]
[:> Box {:pl 10}
prep-time " min"]]]])
| |
a02a733c03fd42a3209220a0004683de5ea27d439694e703503bbdecc04279fa | GlideAngle/flare-timing | CompInput.hs | module Flight.CompInput
( readComp, writeComp
, readTask, writeTask
, readCompAndTasks, readCompAndTasksQuietly, writeCompAndTasks
, readCompTracks, readCompTracksQuietly
) where
import System.FilePath (takeDirectory)
import System.Directory (createDirectoryIfMissing)
import Control.Exception.Safe (MonadThrow)
import Control.Monad.Except (MonadIO, liftIO)
import qualified Data.ByteString as BS
import Data.Yaml (decodeThrow)
import qualified Data.Yaml.Pretty as Y
import Control.Concurrent.ParallelIO (parallel, parallel_)
import Flight.Field (FieldOrdering(..))
import Flight.Comp
( ScoringInputFiles, CompInputFile(..), TaskInputFile(..)
, CompSettings(..), TaskSettings(..)
, PilotTrackLogFile(..), TaskFolder(..)
)
readComp :: (MonadThrow m, MonadIO m) => CompInputFile -> m (CompSettings k)
readComp (CompInputFile path) = liftIO $ BS.readFile path >>= decodeThrow
writeComp :: CompInputFile -> CompSettings k -> IO ()
writeComp (CompInputFile path) compInput = do
let cfg = Y.setConfCompare (fieldOrder compInput) Y.defConfig
let yaml = Y.encodePretty cfg compInput
BS.writeFile path yaml
readTask :: (MonadThrow m, MonadIO m) => TaskInputFile -> m (TaskSettings k)
readTask (TaskInputFile path) = liftIO $ BS.readFile path >>= decodeThrow
writeTask :: TaskInputFile -> TaskSettings k -> IO ()
writeTask (TaskInputFile path) taskInput = do
let cfg = Y.setConfCompare (fieldOrder taskInput) Y.defConfig
let yaml = Y.encodePretty cfg taskInput
createDirectoryIfMissing True $ takeDirectory path
BS.writeFile path yaml
readCompTracksQuietly
:: (MonadIO m, MonadThrow m)
=> ScoringInputFiles
-> m ((CompSettings k, [TaskSettings k]), ([[PilotTrackLogFile]], [TaskFolder]))
readCompTracksQuietly files = do
settings@(_, tss) <- readCompAndTasksQuietly files
return (settings, ([pilots | TaskSettings{pilots} <- tss], taskFolder <$> tss))
readCompTracks
:: ScoringInputFiles
-> IO ((CompSettings k, [TaskSettings k]), ([[PilotTrackLogFile]], [TaskFolder]))
readCompTracks files = do
settings@(_, tss) <- readCompAndTasks files
return (settings, ([pilots | TaskSettings{pilots} <- tss], taskFolder <$> tss))
readCompAndTasksQuietly
:: (MonadIO m, MonadThrow m)
=> ScoringInputFiles
-> m (CompSettings k, [TaskSettings k])
readCompAndTasksQuietly (compFile, taskFiles) = do
settingsComp <- readComp compFile
settingsTasks <- sequence [readTask taskFile | taskFile <- taskFiles ]
return (settingsComp, settingsTasks)
readCompAndTasks :: ScoringInputFiles -> IO (CompSettings k, [TaskSettings k])
readCompAndTasks (compFile, taskFiles) = do
putStrLn $ "Reading comp inputs from " ++ show compFile
settingsComp <- readComp compFile
putStrLn "Reading task inputs from:"
settingsTasks <-
parallel
[ do
putStrLn $ "\t" ++ show taskFile
readTask taskFile
| taskFile <- taskFiles
]
return (settingsComp, settingsTasks)
writeCompAndTasks :: ScoringInputFiles -> (CompSettings k, [TaskSettings k]) -> IO ()
writeCompAndTasks (compFile, taskFiles) (comp, tasks) = do
putStrLn $ "Writing comp inputs to " ++ show compFile
writeComp compFile comp
putStrLn "Writing task inputs to:"
parallel_
[ do
putStrLn $ "\t" ++ show taskFile
writeTask taskFile taskSetting
| taskSetting <- tasks
| taskFile <- taskFiles
]
| null | https://raw.githubusercontent.com/GlideAngle/flare-timing/27bd34c1943496987382091441a1c2516c169263/lang-haskell/scribe/library/Flight/CompInput.hs | haskell | module Flight.CompInput
( readComp, writeComp
, readTask, writeTask
, readCompAndTasks, readCompAndTasksQuietly, writeCompAndTasks
, readCompTracks, readCompTracksQuietly
) where
import System.FilePath (takeDirectory)
import System.Directory (createDirectoryIfMissing)
import Control.Exception.Safe (MonadThrow)
import Control.Monad.Except (MonadIO, liftIO)
import qualified Data.ByteString as BS
import Data.Yaml (decodeThrow)
import qualified Data.Yaml.Pretty as Y
import Control.Concurrent.ParallelIO (parallel, parallel_)
import Flight.Field (FieldOrdering(..))
import Flight.Comp
( ScoringInputFiles, CompInputFile(..), TaskInputFile(..)
, CompSettings(..), TaskSettings(..)
, PilotTrackLogFile(..), TaskFolder(..)
)
readComp :: (MonadThrow m, MonadIO m) => CompInputFile -> m (CompSettings k)
readComp (CompInputFile path) = liftIO $ BS.readFile path >>= decodeThrow
writeComp :: CompInputFile -> CompSettings k -> IO ()
writeComp (CompInputFile path) compInput = do
let cfg = Y.setConfCompare (fieldOrder compInput) Y.defConfig
let yaml = Y.encodePretty cfg compInput
BS.writeFile path yaml
readTask :: (MonadThrow m, MonadIO m) => TaskInputFile -> m (TaskSettings k)
readTask (TaskInputFile path) = liftIO $ BS.readFile path >>= decodeThrow
writeTask :: TaskInputFile -> TaskSettings k -> IO ()
writeTask (TaskInputFile path) taskInput = do
let cfg = Y.setConfCompare (fieldOrder taskInput) Y.defConfig
let yaml = Y.encodePretty cfg taskInput
createDirectoryIfMissing True $ takeDirectory path
BS.writeFile path yaml
readCompTracksQuietly
:: (MonadIO m, MonadThrow m)
=> ScoringInputFiles
-> m ((CompSettings k, [TaskSettings k]), ([[PilotTrackLogFile]], [TaskFolder]))
readCompTracksQuietly files = do
settings@(_, tss) <- readCompAndTasksQuietly files
return (settings, ([pilots | TaskSettings{pilots} <- tss], taskFolder <$> tss))
readCompTracks
:: ScoringInputFiles
-> IO ((CompSettings k, [TaskSettings k]), ([[PilotTrackLogFile]], [TaskFolder]))
readCompTracks files = do
settings@(_, tss) <- readCompAndTasks files
return (settings, ([pilots | TaskSettings{pilots} <- tss], taskFolder <$> tss))
readCompAndTasksQuietly
:: (MonadIO m, MonadThrow m)
=> ScoringInputFiles
-> m (CompSettings k, [TaskSettings k])
readCompAndTasksQuietly (compFile, taskFiles) = do
settingsComp <- readComp compFile
settingsTasks <- sequence [readTask taskFile | taskFile <- taskFiles ]
return (settingsComp, settingsTasks)
readCompAndTasks :: ScoringInputFiles -> IO (CompSettings k, [TaskSettings k])
readCompAndTasks (compFile, taskFiles) = do
putStrLn $ "Reading comp inputs from " ++ show compFile
settingsComp <- readComp compFile
putStrLn "Reading task inputs from:"
settingsTasks <-
parallel
[ do
putStrLn $ "\t" ++ show taskFile
readTask taskFile
| taskFile <- taskFiles
]
return (settingsComp, settingsTasks)
writeCompAndTasks :: ScoringInputFiles -> (CompSettings k, [TaskSettings k]) -> IO ()
writeCompAndTasks (compFile, taskFiles) (comp, tasks) = do
putStrLn $ "Writing comp inputs to " ++ show compFile
writeComp compFile comp
putStrLn "Writing task inputs to:"
parallel_
[ do
putStrLn $ "\t" ++ show taskFile
writeTask taskFile taskSetting
| taskSetting <- tasks
| taskFile <- taskFiles
]
| |
78955169a2c5550adb8f0b65fc9cc7c04c0b4cc8f82500be5e6164323e99a4e0 | bmeurer/ocaml-experimental | bigarray.mli | (***********************************************************************)
(* *)
(* Objective Caml *)
(* *)
and , INRIA Rocquencourt
(* *)
Copyright 2000 Institut National de Recherche en Informatique et
en Automatique . All rights reserved . This file is distributed
under the terms of the GNU Library General Public License , with
(* the special exception on linking described in file ../../LICENSE. *)
(* *)
(***********************************************************************)
$ Id$
* Large , multi - dimensional , numerical arrays .
This module implements multi - dimensional arrays of integers and
floating - point numbers , thereafter referred to as ` ` big arrays '' .
The implementation allows efficient sharing of large numerical
arrays between code and C or Fortran numerical libraries .
Concerning the naming conventions , users of this module are encouraged
to do [ open Bigarray ] in their source , then refer to array types and
operations via short dot notation , e.g. [ Array1.t ] or [ Array2.sub ] .
Big arrays support all the ad - hoc polymorphic operations :
- comparisons ( [ =] , [ < > ] , [ < =] , etc , as well as { ! Pervasives.compare } ) ;
- hashing ( module [ Hash ] ) ;
- and structured input - output ( { ! Pervasives.output_value }
and { ! Pervasives.input_value } , as well as the functions from the
{ ! Marshal } module ) .
This module implements multi-dimensional arrays of integers and
floating-point numbers, thereafter referred to as ``big arrays''.
The implementation allows efficient sharing of large numerical
arrays between Caml code and C or Fortran numerical libraries.
Concerning the naming conventions, users of this module are encouraged
to do [open Bigarray] in their source, then refer to array types and
operations via short dot notation, e.g. [Array1.t] or [Array2.sub].
Big arrays support all the Caml ad-hoc polymorphic operations:
- comparisons ([=], [<>], [<=], etc, as well as {!Pervasives.compare});
- hashing (module [Hash]);
- and structured input-output ({!Pervasives.output_value}
and {!Pervasives.input_value}, as well as the functions from the
{!Marshal} module).
*)
* { 6 Element kinds }
* Big arrays can contain elements of the following kinds :
- IEEE single precision ( 32 bits ) floating - point numbers
( { ! Bigarray.float32_elt } ) ,
- IEEE double precision ( 64 bits ) floating - point numbers
( { ! Bigarray.float64_elt } ) ,
- IEEE single precision ( 2 * 32 bits ) floating - point complex numbers
( { ! Bigarray.complex32_elt } ) ,
- IEEE double precision ( 2 * 64 bits ) floating - point complex numbers
( { ! Bigarray.complex64_elt } ) ,
- 8 - bit integers ( signed or unsigned )
( { ! Bigarray.int8_signed_elt } or { ! Bigarray.int8_unsigned_elt } ) ,
- 16 - bit integers ( signed or unsigned )
( { ! Bigarray.int16_signed_elt } or { ! Bigarray.int16_unsigned_elt } ) ,
- Caml integers ( signed , 31 bits on 32 - bit architectures ,
63 bits on 64 - bit architectures ) ( { ! } ) ,
- 32 - bit signed integer ( { ! Bigarray.int32_elt } ) ,
- 64 - bit signed integers ( { ! Bigarray.int64_elt } ) ,
- platform - native signed integers ( 32 bits on 32 - bit architectures ,
64 bits on 64 - bit architectures ) ( { ! Bigarray.nativeint_elt } ) .
Each element kind is represented at the type level by one
of the abstract types defined below .
- IEEE single precision (32 bits) floating-point numbers
({!Bigarray.float32_elt}),
- IEEE double precision (64 bits) floating-point numbers
({!Bigarray.float64_elt}),
- IEEE single precision (2 * 32 bits) floating-point complex numbers
({!Bigarray.complex32_elt}),
- IEEE double precision (2 * 64 bits) floating-point complex numbers
({!Bigarray.complex64_elt}),
- 8-bit integers (signed or unsigned)
({!Bigarray.int8_signed_elt} or {!Bigarray.int8_unsigned_elt}),
- 16-bit integers (signed or unsigned)
({!Bigarray.int16_signed_elt} or {!Bigarray.int16_unsigned_elt}),
- Caml integers (signed, 31 bits on 32-bit architectures,
63 bits on 64-bit architectures) ({!Bigarray.int_elt}),
- 32-bit signed integer ({!Bigarray.int32_elt}),
- 64-bit signed integers ({!Bigarray.int64_elt}),
- platform-native signed integers (32 bits on 32-bit architectures,
64 bits on 64-bit architectures) ({!Bigarray.nativeint_elt}).
Each element kind is represented at the type level by one
of the abstract types defined below.
*)
type float32_elt
type float64_elt
type complex32_elt
type complex64_elt
type int8_signed_elt
type int8_unsigned_elt
type int16_signed_elt
type int16_unsigned_elt
type int_elt
type int32_elt
type int64_elt
type nativeint_elt
type ('a, 'b) kind
* To each element kind is associated a type , which is
the type of values that can be stored in the big array
or read back from it . This type is not necessarily the same
as the type of the array elements proper : for instance ,
a big array whose elements are of kind [ float32_elt ] contains
32 - bit single precision floats , but reading or writing one of
its elements from uses the type [ float ] , which is
64 - bit double precision floats .
The abstract type [ ( ' a , ' b ) kind ] captures this association
of a type [ ' a ] for values read or written in the big array ,
and of an element kind [ ' b ] which represents the actual contents
of the big array . The following predefined values of type
[ kind ] list all possible associations of types with
element kinds :
the type of Caml values that can be stored in the big array
or read back from it. This type is not necessarily the same
as the type of the array elements proper: for instance,
a big array whose elements are of kind [float32_elt] contains
32-bit single precision floats, but reading or writing one of
its elements from Caml uses the Caml type [float], which is
64-bit double precision floats.
The abstract type [('a, 'b) kind] captures this association
of a Caml type ['a] for values read or written in the big array,
and of an element kind ['b] which represents the actual contents
of the big array. The following predefined values of type
[kind] list all possible associations of Caml types with
element kinds: *)
val float32 : (float, float32_elt) kind
(** See {!Bigarray.char}. *)
val float64 : (float, float64_elt) kind
(** See {!Bigarray.char}. *)
val complex32 : (Complex.t, complex32_elt) kind
(** See {!Bigarray.char}. *)
val complex64 : (Complex.t, complex64_elt) kind
(** See {!Bigarray.char}. *)
val int8_signed : (int, int8_signed_elt) kind
(** See {!Bigarray.char}. *)
val int8_unsigned : (int, int8_unsigned_elt) kind
(** See {!Bigarray.char}. *)
val int16_signed : (int, int16_signed_elt) kind
(** See {!Bigarray.char}. *)
val int16_unsigned : (int, int16_unsigned_elt) kind
(** See {!Bigarray.char}. *)
val int : (int, int_elt) kind
(** See {!Bigarray.char}. *)
val int32 : (int32, int32_elt) kind
(** See {!Bigarray.char}. *)
val int64 : (int64, int64_elt) kind
(** See {!Bigarray.char}. *)
val nativeint : (nativeint, nativeint_elt) kind
(** See {!Bigarray.char}. *)
val char : (char, int8_unsigned_elt) kind
* As shown by the types of the values above ,
big arrays of kind [ float32_elt ] and [ float64_elt ] are
accessed using the type [ float ] . Big arrays of complex kinds
[ complex32_elt ] , [ complex64_elt ] are accessed with the type
{ ! Complex.t } . Big arrays of
integer kinds are accessed using the smallest integer
type large enough to represent the array elements :
[ int ] for 8- and 16 - bit integer bigarrays , as well as Caml - integer
bigarrays ; [ int32 ] for 32 - bit integer bigarrays ; [ int64 ]
for 64 - bit integer bigarrays ; and [ nativeint ] for
platform - native integer bigarrays . Finally , big arrays of
kind [ int8_unsigned_elt ] can also be accessed as arrays of
characters instead of arrays of small integers , by using
the kind value [ char ] instead of [ int8_unsigned ] .
big arrays of kind [float32_elt] and [float64_elt] are
accessed using the Caml type [float]. Big arrays of complex kinds
[complex32_elt], [complex64_elt] are accessed with the Caml type
{!Complex.t}. Big arrays of
integer kinds are accessed using the smallest Caml integer
type large enough to represent the array elements:
[int] for 8- and 16-bit integer bigarrays, as well as Caml-integer
bigarrays; [int32] for 32-bit integer bigarrays; [int64]
for 64-bit integer bigarrays; and [nativeint] for
platform-native integer bigarrays. Finally, big arrays of
kind [int8_unsigned_elt] can also be accessed as arrays of
characters instead of arrays of small integers, by using
the kind value [char] instead of [int8_unsigned]. *)
* { 6 Array layouts }
type c_layout
* See { ! } .
type fortran_layout
* To facilitate interoperability with existing C and Fortran code ,
this library supports two different memory layouts for big arrays ,
one compatible with the C conventions ,
the other compatible with the Fortran conventions .
In the C - style layout , array indices start at 0 , and
multi - dimensional arrays are laid out in row - major format .
That is , for a two - dimensional array , all elements of
row 0 are contiguous in memory , followed by all elements of
row 1 , etc . In other terms , the array elements at [ ( x , y ) ]
and [ ( x , y+1 ) ] are adjacent in memory .
In the Fortran - style layout , array indices start at 1 , and
multi - dimensional arrays are laid out in column - major format .
That is , for a two - dimensional array , all elements of
column 0 are contiguous in memory , followed by all elements of
column 1 , etc . In other terms , the array elements at [ ( x , y ) ]
and [ ( x+1 , y ) ] are adjacent in memory .
Each layout style is identified at the type level by the
abstract types { ! Bigarray.c_layout } and [ fortran_layout ] respectively .
this library supports two different memory layouts for big arrays,
one compatible with the C conventions,
the other compatible with the Fortran conventions.
In the C-style layout, array indices start at 0, and
multi-dimensional arrays are laid out in row-major format.
That is, for a two-dimensional array, all elements of
row 0 are contiguous in memory, followed by all elements of
row 1, etc. In other terms, the array elements at [(x,y)]
and [(x, y+1)] are adjacent in memory.
In the Fortran-style layout, array indices start at 1, and
multi-dimensional arrays are laid out in column-major format.
That is, for a two-dimensional array, all elements of
column 0 are contiguous in memory, followed by all elements of
column 1, etc. In other terms, the array elements at [(x,y)]
and [(x+1, y)] are adjacent in memory.
Each layout style is identified at the type level by the
abstract types {!Bigarray.c_layout} and [fortran_layout] respectively. *)
type 'a layout
* The type [ ' a layout ] represents one of the two supported
memory layouts : C - style if [ ' a ] is { ! Bigarray.c_layout } , Fortran - style
if [ ' a ] is { ! } .
memory layouts: C-style if ['a] is {!Bigarray.c_layout}, Fortran-style
if ['a] is {!Bigarray.fortran_layout}. *)
* { 7 Supported layouts }
The abstract values [ c_layout ] and [ fortran_layout ] represent
the two supported layouts at the level of values .
The abstract values [c_layout] and [fortran_layout] represent
the two supported layouts at the level of values.
*)
val c_layout : c_layout layout
val fortran_layout : fortran_layout layout
* { 6 Generic arrays ( of arbitrarily many dimensions ) }
module Genarray :
sig
type ('a, 'b, 'c) t
* The type [ Genarray.t ] is the type of big arrays with variable
numbers of dimensions . Any number of dimensions between 1 and 16
is supported .
The three type parameters to [ Genarray.t ] identify the array element
kind and layout , as follows :
- the first parameter , [ ' a ] , is the type for accessing array
elements ( [ float ] , [ int ] , [ int32 ] , [ int64 ] , [ nativeint ] ) ;
- the second parameter , [ ' b ] , is the actual kind of array elements
( [ float32_elt ] , [ float64_elt ] , [ int8_signed_elt ] , [ int8_unsigned_elt ] ,
etc ) ;
- the third parameter , [ ' c ] , identifies the array layout
( [ c_layout ] or [ fortran_layout ] ) .
For instance , [ ( float , float32_elt , fortran_layout ) Genarray.t ]
is the type of generic big arrays containing 32 - bit floats
in Fortran layout ; reads and writes in this array use the
Caml type [ float ] .
numbers of dimensions. Any number of dimensions between 1 and 16
is supported.
The three type parameters to [Genarray.t] identify the array element
kind and layout, as follows:
- the first parameter, ['a], is the Caml type for accessing array
elements ([float], [int], [int32], [int64], [nativeint]);
- the second parameter, ['b], is the actual kind of array elements
([float32_elt], [float64_elt], [int8_signed_elt], [int8_unsigned_elt],
etc);
- the third parameter, ['c], identifies the array layout
([c_layout] or [fortran_layout]).
For instance, [(float, float32_elt, fortran_layout) Genarray.t]
is the type of generic big arrays containing 32-bit floats
in Fortran layout; reads and writes in this array use the
Caml type [float]. *)
external create: ('a, 'b) kind -> 'c layout -> int array -> ('a, 'b, 'c) t
= "caml_ba_create"
* [ Genarray.create kind layout dimensions ] returns a new big array
whose element kind is determined by the parameter [ kind ] ( one of
[ float32 ] , [ float64 ] , [ int8_signed ] , etc ) and whose layout is
determined by the parameter [ layout ] ( one of [ c_layout ] or
[ fortran_layout ] ) . The [ dimensions ] parameter is an array of
integers that indicate the size of the big array in each dimension .
The length of [ dimensions ] determines the number of dimensions
of the bigarray .
For instance , [ Genarray.create int32 c_layout [ |4;6;8| ] ]
returns a fresh big array of 32 - bit integers , in C layout ,
having three dimensions , the three dimensions being 4 , 6 and 8
respectively .
Big arrays returned by [ Genarray.create ] are not initialized :
the initial values of array elements is unspecified .
[ Genarray.create ] raises [ Invalid_argument ] if the number of dimensions
is not in the range 1 to 16 inclusive , or if one of the dimensions
is negative .
whose element kind is determined by the parameter [kind] (one of
[float32], [float64], [int8_signed], etc) and whose layout is
determined by the parameter [layout] (one of [c_layout] or
[fortran_layout]). The [dimensions] parameter is an array of
integers that indicate the size of the big array in each dimension.
The length of [dimensions] determines the number of dimensions
of the bigarray.
For instance, [Genarray.create int32 c_layout [|4;6;8|]]
returns a fresh big array of 32-bit integers, in C layout,
having three dimensions, the three dimensions being 4, 6 and 8
respectively.
Big arrays returned by [Genarray.create] are not initialized:
the initial values of array elements is unspecified.
[Genarray.create] raises [Invalid_argument] if the number of dimensions
is not in the range 1 to 16 inclusive, or if one of the dimensions
is negative. *)
external num_dims: ('a, 'b, 'c) t -> int = "caml_ba_num_dims"
(** Return the number of dimensions of the given big array. *)
val dims : ('a, 'b, 'c) t -> int array
(** [Genarray.dims a] returns all dimensions of the big array [a],
as an array of integers of length [Genarray.num_dims a]. *)
external nth_dim: ('a, 'b, 'c) t -> int -> int = "caml_ba_dim"
* [ Genarray.nth_dim a n ] returns the [ n]-th dimension of the
big array [ a ] . The first dimension corresponds to [ n = 0 ] ;
the second dimension corresponds to [ n = 1 ] ; the last dimension ,
to [ n = Genarray.num_dims a - 1 ] .
Raise [ Invalid_argument ] if [ n ] is less than 0 or greater or equal than
[ Genarray.num_dims a ] .
big array [a]. The first dimension corresponds to [n = 0];
the second dimension corresponds to [n = 1]; the last dimension,
to [n = Genarray.num_dims a - 1].
Raise [Invalid_argument] if [n] is less than 0 or greater or equal than
[Genarray.num_dims a]. *)
external kind: ('a, 'b, 'c) t -> ('a, 'b) kind = "caml_ba_kind"
(** Return the kind of the given big array. *)
external layout: ('a, 'b, 'c) t -> 'c layout = "caml_ba_layout"
(** Return the layout of the given big array. *)
external get: ('a, 'b, 'c) t -> int array -> 'a = "caml_ba_get_generic"
* Read an element of a generic big array .
[ Genarray.get a [ |i1 ; ... ; iN| ] ] returns the element of [ a ]
whose coordinates are [ i1 ] in the first dimension , [ i2 ] in
the second dimension , ... , [ iN ] in the [ N]-th dimension .
If [ a ] has C layout , the coordinates must be greater or equal than 0
and strictly less than the corresponding dimensions of [ a ] .
If [ a ] has Fortran layout , the coordinates must be greater or equal
than 1 and less or equal than the corresponding dimensions of [ a ] .
Raise [ Invalid_argument ] if the array [ a ] does not have exactly [ N ]
dimensions , or if the coordinates are outside the array bounds .
If [ N > 3 ] , alternate syntax is provided : you can write
[ a.{i1 , i2 , ... , iN } ] instead of [ Genarray.get a [ |i1 ; ... ; iN| ] ] .
( The syntax [ a. { ... } ] with one , two or three coordinates is
reserved for accessing one- , two- and three - dimensional arrays
as described below . )
[Genarray.get a [|i1; ...; iN|]] returns the element of [a]
whose coordinates are [i1] in the first dimension, [i2] in
the second dimension, ..., [iN] in the [N]-th dimension.
If [a] has C layout, the coordinates must be greater or equal than 0
and strictly less than the corresponding dimensions of [a].
If [a] has Fortran layout, the coordinates must be greater or equal
than 1 and less or equal than the corresponding dimensions of [a].
Raise [Invalid_argument] if the array [a] does not have exactly [N]
dimensions, or if the coordinates are outside the array bounds.
If [N > 3], alternate syntax is provided: you can write
[a.{i1, i2, ..., iN}] instead of [Genarray.get a [|i1; ...; iN|]].
(The syntax [a.{...}] with one, two or three coordinates is
reserved for accessing one-, two- and three-dimensional arrays
as described below.) *)
external set: ('a, 'b, 'c) t -> int array -> 'a -> unit
= "caml_ba_set_generic"
* Assign an element of a generic big array .
[ Genarray.set a [ |i1 ; ... ; iN| ] v ] stores the value [ v ] in the
element of [ a ] whose coordinates are [ i1 ] in the first dimension ,
[ i2 ] in the second dimension , ... , [ iN ] in the [ N]-th dimension .
The array [ a ] must have exactly [ N ] dimensions , and all coordinates
must lie inside the array bounds , as described for [ Genarray.get ] ;
otherwise , [ Invalid_argument ] is raised .
If [ N > 3 ] , alternate syntax is provided : you can write
[ a.{i1 , i2 , ... , iN } < - v ] instead of
[ Genarray.set a [ |i1 ; ... ; iN| ] v ] .
( The syntax [ a. { ... } < - v ] with one , two or three coordinates is
reserved for updating one- , two- and three - dimensional arrays
as described below . )
[Genarray.set a [|i1; ...; iN|] v] stores the value [v] in the
element of [a] whose coordinates are [i1] in the first dimension,
[i2] in the second dimension, ..., [iN] in the [N]-th dimension.
The array [a] must have exactly [N] dimensions, and all coordinates
must lie inside the array bounds, as described for [Genarray.get];
otherwise, [Invalid_argument] is raised.
If [N > 3], alternate syntax is provided: you can write
[a.{i1, i2, ..., iN} <- v] instead of
[Genarray.set a [|i1; ...; iN|] v].
(The syntax [a.{...} <- v] with one, two or three coordinates is
reserved for updating one-, two- and three-dimensional arrays
as described below.) *)
external sub_left: ('a, 'b, c_layout) t -> int -> int -> ('a, 'b, c_layout) t
= "caml_ba_sub"
* Extract a sub - array of the given big array by restricting the
first ( left - most ) dimension . [ Genarray.sub_left a ofs len ]
returns a big array with the same number of dimensions as [ a ] ,
and the same dimensions as [ a ] , except the first dimension ,
which corresponds to the interval [ [ ofs ... ofs + len - 1 ] ]
of the first dimension of [ a ] . No copying of elements is
involved : the sub - array and the original array share the same
storage space . In other terms , the element at coordinates
[ [ |i1 ; ... ; iN| ] ] of the sub - array is identical to the
element at coordinates [ [ |i1+ofs ; ... ; iN| ] ] of the original
array [ a ] .
[ Genarray.sub_left ] applies only to big arrays in C layout .
Raise [ Invalid_argument ] if [ ofs ] and [ len ] do not designate
a valid sub - array of [ a ] , that is , if [ ofs < 0 ] , or [ len < 0 ] ,
or > Genarray.nth_dim a 0 ] .
first (left-most) dimension. [Genarray.sub_left a ofs len]
returns a big array with the same number of dimensions as [a],
and the same dimensions as [a], except the first dimension,
which corresponds to the interval [[ofs ... ofs + len - 1]]
of the first dimension of [a]. No copying of elements is
involved: the sub-array and the original array share the same
storage space. In other terms, the element at coordinates
[[|i1; ...; iN|]] of the sub-array is identical to the
element at coordinates [[|i1+ofs; ...; iN|]] of the original
array [a].
[Genarray.sub_left] applies only to big arrays in C layout.
Raise [Invalid_argument] if [ofs] and [len] do not designate
a valid sub-array of [a], that is, if [ofs < 0], or [len < 0],
or [ofs + len > Genarray.nth_dim a 0]. *)
external sub_right:
('a, 'b, fortran_layout) t -> int -> int -> ('a, 'b, fortran_layout) t
= "caml_ba_sub"
* Extract a sub - array of the given big array by restricting the
last ( right - most ) dimension . [ Genarray.sub_right a ofs len ]
returns a big array with the same number of dimensions as [ a ] ,
and the same dimensions as [ a ] , except the last dimension ,
which corresponds to the interval [ [ ofs ... ofs + len - 1 ] ]
of the last dimension of [ a ] . No copying of elements is
involved : the sub - array and the original array share the same
storage space . In other terms , the element at coordinates
[ [ |i1 ; ... ; iN| ] ] of the sub - array is identical to the
element at coordinates [ [ |i1 ; ... ; iN+ofs| ] ] of the original
array [ a ] .
[ Genarray.sub_right ] applies only to big arrays in Fortran layout .
Raise [ Invalid_argument ] if [ ofs ] and [ len ] do not designate
a valid sub - array of [ a ] , that is , if [ ofs < 1 ] , or [ len < 0 ] ,
or > Genarray.nth_dim a ( Genarray.num_dims a - 1 ) ] .
last (right-most) dimension. [Genarray.sub_right a ofs len]
returns a big array with the same number of dimensions as [a],
and the same dimensions as [a], except the last dimension,
which corresponds to the interval [[ofs ... ofs + len - 1]]
of the last dimension of [a]. No copying of elements is
involved: the sub-array and the original array share the same
storage space. In other terms, the element at coordinates
[[|i1; ...; iN|]] of the sub-array is identical to the
element at coordinates [[|i1; ...; iN+ofs|]] of the original
array [a].
[Genarray.sub_right] applies only to big arrays in Fortran layout.
Raise [Invalid_argument] if [ofs] and [len] do not designate
a valid sub-array of [a], that is, if [ofs < 1], or [len < 0],
or [ofs + len > Genarray.nth_dim a (Genarray.num_dims a - 1)]. *)
external slice_left:
('a, 'b, c_layout) t -> int array -> ('a, 'b, c_layout) t
= "caml_ba_slice"
* Extract a sub - array of lower dimension from the given big array
by fixing one or several of the first ( left - most ) coordinates .
[ a [ |i1 ; ... ; iM| ] ] returns the ` ` slice ''
of [ a ] obtained by setting the first [ M ] coordinates to
[ i1 ] , ... , [ iM ] . If [ a ] has [ N ] dimensions , the slice has
dimension [ N - M ] , and the element at coordinates
[ [ |j1 ; ... ; ] ] in the slice is identical to the element
at coordinates [ [ |i1 ; ... ; iM ; j1 ; ... ; ] ] in the original
array [ a ] . No copying of elements is involved : the slice and
the original array share the same storage space .
[ ] applies only to big arrays in C layout .
Raise [ Invalid_argument ] if [ M > = N ] , or if [ [ |i1 ; ... ; iM| ] ]
is outside the bounds of [ a ] .
by fixing one or several of the first (left-most) coordinates.
[Genarray.slice_left a [|i1; ... ; iM|]] returns the ``slice''
of [a] obtained by setting the first [M] coordinates to
[i1], ..., [iM]. If [a] has [N] dimensions, the slice has
dimension [N - M], and the element at coordinates
[[|j1; ...; j(N-M)|]] in the slice is identical to the element
at coordinates [[|i1; ...; iM; j1; ...; j(N-M)|]] in the original
array [a]. No copying of elements is involved: the slice and
the original array share the same storage space.
[Genarray.slice_left] applies only to big arrays in C layout.
Raise [Invalid_argument] if [M >= N], or if [[|i1; ... ; iM|]]
is outside the bounds of [a]. *)
external slice_right:
('a, 'b, fortran_layout) t -> int array -> ('a, 'b, fortran_layout) t
= "caml_ba_slice"
* Extract a sub - array of lower dimension from the given big array
by fixing one or several of the last ( right - most ) coordinates .
[ Genarray.slice_right a [ |i1 ; ... ; iM| ] ] returns the ` ` slice ''
of [ a ] obtained by setting the last [ M ] coordinates to
[ i1 ] , ... , [ iM ] . If [ a ] has [ N ] dimensions , the slice has
dimension [ N - M ] , and the element at coordinates
[ [ |j1 ; ... ; ] ] in the slice is identical to the element
at coordinates [ [ |j1 ; ... ; ) ; i1 ; ... ; iM| ] ] in the original
array [ a ] . No copying of elements is involved : the slice and
the original array share the same storage space .
[ Genarray.slice_right ] applies only to big arrays in Fortran layout .
Raise [ Invalid_argument ] if [ M > = N ] , or if [ [ |i1 ; ... ; iM| ] ]
is outside the bounds of [ a ] .
by fixing one or several of the last (right-most) coordinates.
[Genarray.slice_right a [|i1; ... ; iM|]] returns the ``slice''
of [a] obtained by setting the last [M] coordinates to
[i1], ..., [iM]. If [a] has [N] dimensions, the slice has
dimension [N - M], and the element at coordinates
[[|j1; ...; j(N-M)|]] in the slice is identical to the element
at coordinates [[|j1; ...; j(N-M); i1; ...; iM|]] in the original
array [a]. No copying of elements is involved: the slice and
the original array share the same storage space.
[Genarray.slice_right] applies only to big arrays in Fortran layout.
Raise [Invalid_argument] if [M >= N], or if [[|i1; ... ; iM|]]
is outside the bounds of [a]. *)
external blit: ('a, 'b, 'c) t -> ('a, 'b, 'c) t -> unit
= "caml_ba_blit"
* Copy all elements of a big array in another big array .
[ Genarray.blit ] copies all elements of [ src ] into
[ dst ] . Both arrays [ src ] and [ dst ] must have the same number of
dimensions and equal dimensions . Copying a sub - array of [ src ]
to a sub - array of [ dst ] can be achieved by applying [ Genarray.blit ]
to sub - array or slices of [ src ] and [ dst ] .
[Genarray.blit src dst] copies all elements of [src] into
[dst]. Both arrays [src] and [dst] must have the same number of
dimensions and equal dimensions. Copying a sub-array of [src]
to a sub-array of [dst] can be achieved by applying [Genarray.blit]
to sub-array or slices of [src] and [dst]. *)
external fill: ('a, 'b, 'c) t -> 'a -> unit = "caml_ba_fill"
(** Set all elements of a big array to a given value.
[Genarray.fill a v] stores the value [v] in all elements of
the big array [a]. Setting only some elements of [a] to [v]
can be achieved by applying [Genarray.fill] to a sub-array
or a slice of [a]. *)
val map_file:
Unix.file_descr -> ?pos:int64 -> ('a, 'b) kind -> 'c layout ->
bool -> int array -> ('a, 'b, 'c) t
* Memory mapping of a file as a big array .
[ Genarray.map_file fd kind layout shared dims ]
returns a big array of kind [ kind ] , layout [ layout ] ,
and dimensions as specified in [ dims ] . The data contained in
this big array are the contents of the file referred to by
the file descriptor [ fd ] ( as opened previously with
[ Unix.openfile ] , for example ) . The optional [ pos ] parameter
is the byte offset in the file of the data being mapped ;
it defaults to 0 ( map from the beginning of the file ) .
If [ shared ] is [ true ] , all modifications performed on the array
are reflected in the file . This requires that [ fd ] be opened
with write permissions . If [ shared ] is [ false ] , modifications
performed on the array are done in memory only , using
copy - on - write of the modified pages ; the underlying file is not
affected .
[ Genarray.map_file ] is much more efficient than reading
the whole file in a big array , modifying that big array ,
and writing it afterwards .
To adjust automatically the dimensions of the big array to
the actual size of the file , the major dimension ( that is ,
the first dimension for an array with C layout , and the last
dimension for an array with Fortran layout ) can be given as
[ -1 ] . [ Genarray.map_file ] then determines the major dimension
from the size of the file . The file must contain an integral
number of sub - arrays as determined by the non - major dimensions ,
otherwise [ Failure ] is raised .
If all dimensions of the big array are given , the file size is
matched against the size of the big array . If the file is larger
than the big array , only the initial portion of the file is
mapped to the big array . If the file is smaller than the big
array , the file is automatically grown to the size of the big array .
This requires write permissions on [ fd ] .
[Genarray.map_file fd kind layout shared dims]
returns a big array of kind [kind], layout [layout],
and dimensions as specified in [dims]. The data contained in
this big array are the contents of the file referred to by
the file descriptor [fd] (as opened previously with
[Unix.openfile], for example). The optional [pos] parameter
is the byte offset in the file of the data being mapped;
it defaults to 0 (map from the beginning of the file).
If [shared] is [true], all modifications performed on the array
are reflected in the file. This requires that [fd] be opened
with write permissions. If [shared] is [false], modifications
performed on the array are done in memory only, using
copy-on-write of the modified pages; the underlying file is not
affected.
[Genarray.map_file] is much more efficient than reading
the whole file in a big array, modifying that big array,
and writing it afterwards.
To adjust automatically the dimensions of the big array to
the actual size of the file, the major dimension (that is,
the first dimension for an array with C layout, and the last
dimension for an array with Fortran layout) can be given as
[-1]. [Genarray.map_file] then determines the major dimension
from the size of the file. The file must contain an integral
number of sub-arrays as determined by the non-major dimensions,
otherwise [Failure] is raised.
If all dimensions of the big array are given, the file size is
matched against the size of the big array. If the file is larger
than the big array, only the initial portion of the file is
mapped to the big array. If the file is smaller than the big
array, the file is automatically grown to the size of the big array.
This requires write permissions on [fd]. *)
end
* { 6 One - dimensional arrays }
* One - dimensional arrays . The [ Array1 ] structure provides operations
similar to those of
{ ! . Genarray } , but specialized to the case of one - dimensional arrays .
( The [ Array2 ] and [ Array3 ] structures below provide operations
specialized for two- and three - dimensional arrays . )
Statically knowing the number of dimensions of the array allows
faster operations , and more precise static type - checking .
similar to those of
{!Bigarray.Genarray}, but specialized to the case of one-dimensional arrays.
(The [Array2] and [Array3] structures below provide operations
specialized for two- and three-dimensional arrays.)
Statically knowing the number of dimensions of the array allows
faster operations, and more precise static type-checking. *)
module Array1 : sig
type ('a, 'b, 'c) t
* The type of one - dimensional big arrays whose elements have
type [ ' a ] , representation kind [ ' b ] , and memory layout [ ' c ] .
Caml type ['a], representation kind ['b], and memory layout ['c]. *)
val create: ('a, 'b) kind -> 'c layout -> int -> ('a, 'b, 'c) t
* [ Array1.create kind layout dim ] returns a new bigarray of
one dimension , whose size is [ dim ] . [ kind ] and [ layout ]
determine the array element kind and the array layout
as described for [ Genarray.create ] .
one dimension, whose size is [dim]. [kind] and [layout]
determine the array element kind and the array layout
as described for [Genarray.create]. *)
val dim: ('a, 'b, 'c) t -> int
* Return the size ( dimension ) of the given one - dimensional
big array .
big array. *)
external kind: ('a, 'b, 'c) t -> ('a, 'b) kind = "caml_ba_kind"
(** Return the kind of the given big array. *)
external layout: ('a, 'b, 'c) t -> 'c layout = "caml_ba_layout"
(** Return the layout of the given big array. *)
external get: ('a, 'b, 'c) t -> int -> 'a = "%caml_ba_ref_1"
* [ Array1.get a x ] , or alternatively [ a.{x } ] ,
returns the element of [ a ] at index [ x ] .
[ x ] must be greater or equal than [ 0 ] and strictly less than
[ Array1.dim a ] if [ a ] has C layout . If [ a ] has Fortran layout ,
[ x ] must be greater or equal than [ 1 ] and less or equal than
[ Array1.dim a ] . Otherwise , [ Invalid_argument ] is raised .
returns the element of [a] at index [x].
[x] must be greater or equal than [0] and strictly less than
[Array1.dim a] if [a] has C layout. If [a] has Fortran layout,
[x] must be greater or equal than [1] and less or equal than
[Array1.dim a]. Otherwise, [Invalid_argument] is raised. *)
external set: ('a, 'b, 'c) t -> int -> 'a -> unit = "%caml_ba_set_1"
(** [Array1.set a x v], also written [a.{x} <- v],
stores the value [v] at index [x] in [a].
[x] must be inside the bounds of [a] as described in
{!Bigarray.Array1.get};
otherwise, [Invalid_argument] is raised. *)
external sub: ('a, 'b, 'c) t -> int -> int -> ('a, 'b, 'c) t
= "caml_ba_sub"
* Extract a sub - array of the given one - dimensional big array .
See [ Genarray.sub_left ] for more details .
See [Genarray.sub_left] for more details. *)
external blit: ('a, 'b, 'c) t -> ('a, 'b, 'c) t -> unit
= "caml_ba_blit"
* Copy the first big array to the second big array .
See [ Genarray.blit ] for more details .
See [Genarray.blit] for more details. *)
external fill: ('a, 'b, 'c) t -> 'a -> unit = "caml_ba_fill"
(** Fill the given big array with the given value.
See [Genarray.fill] for more details. *)
val of_array: ('a, 'b) kind -> 'c layout -> 'a array -> ('a, 'b, 'c) t
* Build a one - dimensional big array initialized from the
given array .
given array. *)
val map_file: Unix.file_descr -> ?pos:int64 -> ('a, 'b) kind -> 'c layout ->
bool -> int -> ('a, 'b, 'c) t
* Memory mapping of a file as a one - dimensional big array .
See { ! . Genarray.map_file } for more details .
See {!Bigarray.Genarray.map_file} for more details. *)
external unsafe_get: ('a, 'b, 'c) t -> int -> 'a = "%caml_ba_unsafe_ref_1"
(** Like {!Bigarray.Array1.get}, but bounds checking is not always performed.
Use with caution and only when the program logic guarantees that
the access is within bounds. *)
external unsafe_set: ('a, 'b, 'c) t -> int -> 'a -> unit
= "%caml_ba_unsafe_set_1"
(** Like {!Bigarray.Array1.set}, but bounds checking is not always performed.
Use with caution and only when the program logic guarantees that
the access is within bounds. *)
end
* { 6 Two - dimensional arrays }
* Two - dimensional arrays . The [ Array2 ] structure provides operations
similar to those of { ! . Genarray } , but specialized to the
case of two - dimensional arrays .
similar to those of {!Bigarray.Genarray}, but specialized to the
case of two-dimensional arrays. *)
module Array2 :
sig
type ('a, 'b, 'c) t
* The type of two - dimensional big arrays whose elements have
type [ ' a ] , representation kind [ ' b ] , and memory layout [ ' c ] .
Caml type ['a], representation kind ['b], and memory layout ['c]. *)
val create: ('a, 'b) kind -> 'c layout -> int -> int -> ('a, 'b, 'c) t
* [ Array2.create kind layout dim1 dim2 ] returns a new bigarray of
two dimension , whose size is [ dim1 ] in the first dimension
and [ dim2 ] in the second dimension . [ kind ] and [ layout ]
determine the array element kind and the array layout
as described for { ! Bigarray.Genarray.create } .
two dimension, whose size is [dim1] in the first dimension
and [dim2] in the second dimension. [kind] and [layout]
determine the array element kind and the array layout
as described for {!Bigarray.Genarray.create}. *)
val dim1: ('a, 'b, 'c) t -> int
* Return the first dimension of the given two - dimensional big array .
val dim2: ('a, 'b, 'c) t -> int
* Return the second dimension of the given two - dimensional big array .
external kind: ('a, 'b, 'c) t -> ('a, 'b) kind = "caml_ba_kind"
(** Return the kind of the given big array. *)
external layout: ('a, 'b, 'c) t -> 'c layout = "caml_ba_layout"
(** Return the layout of the given big array. *)
external get: ('a, 'b, 'c) t -> int -> int -> 'a = "%caml_ba_ref_2"
(** [Array2.get a x y], also written [a.{x,y}],
returns the element of [a] at coordinates ([x], [y]).
[x] and [y] must be within the bounds
of [a], as described for {!Bigarray.Genarray.get};
otherwise, [Invalid_argument] is raised. *)
external set: ('a, 'b, 'c) t -> int -> int -> 'a -> unit = "%caml_ba_set_2"
* [ Array2.set a x y v ] , or alternatively [ a.{x , y } < - v ] ,
stores the value [ v ] at coordinates ( [ x ] , [ y ] ) in [ a ] .
[ x ] and [ y ] must be within the bounds of [ a ] ,
as described for { ! Bigarray.Genarray.set } ;
otherwise , [ Invalid_argument ] is raised .
stores the value [v] at coordinates ([x], [y]) in [a].
[x] and [y] must be within the bounds of [a],
as described for {!Bigarray.Genarray.set};
otherwise, [Invalid_argument] is raised. *)
external sub_left: ('a, 'b, c_layout) t -> int -> int -> ('a, 'b, c_layout) t
= "caml_ba_sub"
* Extract a two - dimensional sub - array of the given two - dimensional
big array by restricting the first dimension .
See { ! . Genarray.sub_left } for more details .
[ ] applies only to arrays with C layout .
big array by restricting the first dimension.
See {!Bigarray.Genarray.sub_left} for more details.
[Array2.sub_left] applies only to arrays with C layout. *)
external sub_right:
('a, 'b, fortran_layout) t -> int -> int -> ('a, 'b, fortran_layout) t
= "caml_ba_sub"
* Extract a two - dimensional sub - array of the given two - dimensional
big array by restricting the second dimension .
See { ! Bigarray . } for more details .
[ Array2.sub_right ] applies only to arrays with Fortran layout .
big array by restricting the second dimension.
See {!Bigarray.Genarray.sub_right} for more details.
[Array2.sub_right] applies only to arrays with Fortran layout. *)
val slice_left: ('a, 'b, c_layout) t -> int -> ('a, 'b, c_layout) Array1.t
* Extract a row ( one - dimensional slice ) of the given two - dimensional
big array . The integer parameter is the index of the row to
extract . See { ! . } for more details .
[ Array2.slice_left ] applies only to arrays with C layout .
big array. The integer parameter is the index of the row to
extract. See {!Bigarray.Genarray.slice_left} for more details.
[Array2.slice_left] applies only to arrays with C layout. *)
val slice_right:
('a, 'b, fortran_layout) t -> int -> ('a, 'b, fortran_layout) Array1.t
* Extract a column ( one - dimensional slice ) of the given
two - dimensional big array . The integer parameter is the
index of the column to extract . See { ! . Genarray.slice_right }
for more details . [ Array2.slice_right ] applies only to arrays
with Fortran layout .
two-dimensional big array. The integer parameter is the
index of the column to extract. See {!Bigarray.Genarray.slice_right}
for more details. [Array2.slice_right] applies only to arrays
with Fortran layout. *)
external blit: ('a, 'b, 'c) t -> ('a, 'b, 'c) t -> unit
= "caml_ba_blit"
* Copy the first big array to the second big array .
See { ! } for more details .
See {!Bigarray.Genarray.blit} for more details. *)
external fill: ('a, 'b, 'c) t -> 'a -> unit = "caml_ba_fill"
* Fill the given big array with the given value .
See { ! } for more details .
See {!Bigarray.Genarray.fill} for more details. *)
val of_array: ('a, 'b) kind -> 'c layout -> 'a array array -> ('a, 'b, 'c) t
* Build a two - dimensional big array initialized from the
given array of arrays .
given array of arrays. *)
val map_file: Unix.file_descr -> ?pos:int64 -> ('a, 'b) kind -> 'c layout ->
bool -> int -> int -> ('a, 'b, 'c) t
* Memory mapping of a file as a two - dimensional big array .
See { ! . Genarray.map_file } for more details .
See {!Bigarray.Genarray.map_file} for more details. *)
external unsafe_get: ('a, 'b, 'c) t -> int -> int -> 'a
= "%caml_ba_unsafe_ref_2"
(** Like {!Bigarray.Array2.get}, but bounds checking is not always
performed. *)
external unsafe_set: ('a, 'b, 'c) t -> int -> int -> 'a -> unit
= "%caml_ba_unsafe_set_2"
(** Like {!Bigarray.Array2.set}, but bounds checking is not always
performed. *)
end
* { 6 Three - dimensional arrays }
* Three - dimensional arrays . The [ Array3 ] structure provides operations
similar to those of { ! . Genarray } , but specialized to the case
of three - dimensional arrays .
similar to those of {!Bigarray.Genarray}, but specialized to the case
of three-dimensional arrays. *)
module Array3 :
sig
type ('a, 'b, 'c) t
* The type of three - dimensional big arrays whose elements have
type [ ' a ] , representation kind [ ' b ] , and memory layout [ ' c ] .
Caml type ['a], representation kind ['b], and memory layout ['c]. *)
val create: ('a, 'b) kind -> 'c layout -> int -> int -> int -> ('a, 'b, 'c) t
* [ Array3.create kind layout dim1 dim2 dim3 ] returns a new bigarray of
three dimension , whose size is [ dim1 ] in the first dimension ,
[ dim2 ] in the second dimension , and [ dim3 ] in the third .
[ kind ] and [ layout ] determine the array element kind and
the array layout as described for { ! Bigarray.Genarray.create } .
three dimension, whose size is [dim1] in the first dimension,
[dim2] in the second dimension, and [dim3] in the third.
[kind] and [layout] determine the array element kind and
the array layout as described for {!Bigarray.Genarray.create}. *)
val dim1: ('a, 'b, 'c) t -> int
* Return the first dimension of the given three - dimensional big array .
val dim2: ('a, 'b, 'c) t -> int
* Return the second dimension of the given three - dimensional big array .
val dim3: ('a, 'b, 'c) t -> int
* Return the third dimension of the given three - dimensional big array .
external kind: ('a, 'b, 'c) t -> ('a, 'b) kind = "caml_ba_kind"
(** Return the kind of the given big array. *)
external layout: ('a, 'b, 'c) t -> 'c layout = "caml_ba_layout"
(** Return the layout of the given big array. *)
external get: ('a, 'b, 'c) t -> int -> int -> int -> 'a = "%caml_ba_ref_3"
(** [Array3.get a x y z], also written [a.{x,y,z}],
returns the element of [a] at coordinates ([x], [y], [z]).
[x], [y] and [z] must be within the bounds of [a],
as described for {!Bigarray.Genarray.get};
otherwise, [Invalid_argument] is raised. *)
external set: ('a, 'b, 'c) t -> int -> int -> int -> 'a -> unit
= "%caml_ba_set_3"
(** [Array3.set a x y v], or alternatively [a.{x,y,z} <- v],
stores the value [v] at coordinates ([x], [y], [z]) in [a].
[x], [y] and [z] must be within the bounds of [a],
as described for {!Bigarray.Genarray.set};
otherwise, [Invalid_argument] is raised. *)
external sub_left: ('a, 'b, c_layout) t -> int -> int -> ('a, 'b, c_layout) t
= "caml_ba_sub"
* Extract a three - dimensional sub - array of the given
three - dimensional big array by restricting the first dimension .
See { ! . Genarray.sub_left } for more details . [ Array3.sub_left ]
applies only to arrays with C layout .
three-dimensional big array by restricting the first dimension.
See {!Bigarray.Genarray.sub_left} for more details. [Array3.sub_left]
applies only to arrays with C layout. *)
external sub_right:
('a, 'b, fortran_layout) t -> int -> int -> ('a, 'b, fortran_layout) t
= "caml_ba_sub"
* Extract a three - dimensional sub - array of the given
three - dimensional big array by restricting the second dimension .
See { ! Bigarray . } for more details . [ Array3.sub_right ]
applies only to arrays with Fortran layout .
three-dimensional big array by restricting the second dimension.
See {!Bigarray.Genarray.sub_right} for more details. [Array3.sub_right]
applies only to arrays with Fortran layout. *)
val slice_left_1:
('a, 'b, c_layout) t -> int -> int -> ('a, 'b, c_layout) Array1.t
* Extract a one - dimensional slice of the given three - dimensional
big array by fixing the first two coordinates .
The integer parameters are the coordinates of the slice to
extract . See { ! . } for more details .
[ Array3.slice_left_1 ] applies only to arrays with C layout .
big array by fixing the first two coordinates.
The integer parameters are the coordinates of the slice to
extract. See {!Bigarray.Genarray.slice_left} for more details.
[Array3.slice_left_1] applies only to arrays with C layout. *)
val slice_right_1:
('a, 'b, fortran_layout) t ->
int -> int -> ('a, 'b, fortran_layout) Array1.t
* Extract a one - dimensional slice of the given three - dimensional
big array by fixing the last two coordinates .
The integer parameters are the coordinates of the slice to
extract . See { ! . Genarray.slice_right } for more details .
[ Array3.slice_right_1 ] applies only to arrays with Fortran
layout .
big array by fixing the last two coordinates.
The integer parameters are the coordinates of the slice to
extract. See {!Bigarray.Genarray.slice_right} for more details.
[Array3.slice_right_1] applies only to arrays with Fortran
layout. *)
val slice_left_2: ('a, 'b, c_layout) t -> int -> ('a, 'b, c_layout) Array2.t
* Extract a two - dimensional slice of the given three - dimensional
big array by fixing the first coordinate .
The integer parameter is the first coordinate of the slice to
extract . See { ! . } for more details .
[ Array3.slice_left_2 ] applies only to arrays with C layout .
big array by fixing the first coordinate.
The integer parameter is the first coordinate of the slice to
extract. See {!Bigarray.Genarray.slice_left} for more details.
[Array3.slice_left_2] applies only to arrays with C layout. *)
val slice_right_2:
('a, 'b, fortran_layout) t -> int -> ('a, 'b, fortran_layout) Array2.t
* Extract a two - dimensional slice of the given
three - dimensional big array by fixing the last coordinate .
The integer parameter is the coordinate of the slice
to extract . See { ! . Genarray.slice_right } for more details .
[ Array3.slice_right_2 ] applies only to arrays with Fortran
layout .
three-dimensional big array by fixing the last coordinate.
The integer parameter is the coordinate of the slice
to extract. See {!Bigarray.Genarray.slice_right} for more details.
[Array3.slice_right_2] applies only to arrays with Fortran
layout. *)
external blit: ('a, 'b, 'c) t -> ('a, 'b, 'c) t -> unit
= "caml_ba_blit"
* Copy the first big array to the second big array .
See { ! } for more details .
See {!Bigarray.Genarray.blit} for more details. *)
external fill: ('a, 'b, 'c) t -> 'a -> unit = "caml_ba_fill"
* Fill the given big array with the given value .
See { ! } for more details .
See {!Bigarray.Genarray.fill} for more details. *)
val of_array:
('a, 'b) kind -> 'c layout -> 'a array array array -> ('a, 'b, 'c) t
* Build a three - dimensional big array initialized from the
given array of arrays of arrays .
given array of arrays of arrays. *)
val map_file: Unix.file_descr -> ?pos:int64 -> ('a, 'b) kind -> 'c layout ->
bool -> int -> int -> int -> ('a, 'b, 'c) t
* Memory mapping of a file as a three - dimensional big array .
See { ! . Genarray.map_file } for more details .
See {!Bigarray.Genarray.map_file} for more details. *)
external unsafe_get: ('a, 'b, 'c) t -> int -> int -> int -> 'a
= "%caml_ba_unsafe_ref_3"
(** Like {!Bigarray.Array3.get}, but bounds checking is not always
performed. *)
external unsafe_set: ('a, 'b, 'c) t -> int -> int -> int -> 'a -> unit
= "%caml_ba_unsafe_set_3"
(** Like {!Bigarray.Array3.set}, but bounds checking is not always
performed. *)
end
* { 6 Coercions between generic big arrays and fixed - dimension big arrays }
external genarray_of_array1 :
('a, 'b, 'c) Array1.t -> ('a, 'b, 'c) Genarray.t = "%identity"
* Return the generic big array corresponding to the given one - dimensional
big array .
big array. *)
external genarray_of_array2 :
('a, 'b, 'c) Array2.t -> ('a, 'b, 'c) Genarray.t = "%identity"
* Return the generic big array corresponding to the given two - dimensional
big array .
big array. *)
external genarray_of_array3 :
('a, 'b, 'c) Array3.t -> ('a, 'b, 'c) Genarray.t = "%identity"
* Return the generic big array corresponding to the given three - dimensional
big array .
big array. *)
val array1_of_genarray : ('a, 'b, 'c) Genarray.t -> ('a, 'b, 'c) Array1.t
* Return the one - dimensional big array corresponding to the given
generic big array . Raise [ Invalid_argument ] if the generic big array
does not have exactly one dimension .
generic big array. Raise [Invalid_argument] if the generic big array
does not have exactly one dimension. *)
val array2_of_genarray : ('a, 'b, 'c) Genarray.t -> ('a, 'b, 'c) Array2.t
* Return the two - dimensional big array corresponding to the given
generic big array . Raise [ Invalid_argument ] if the generic big array
does not have exactly two dimensions .
generic big array. Raise [Invalid_argument] if the generic big array
does not have exactly two dimensions. *)
val array3_of_genarray : ('a, 'b, 'c) Genarray.t -> ('a, 'b, 'c) Array3.t
* Return the three - dimensional big array corresponding to the given
generic big array . Raise [ Invalid_argument ] if the generic big array
does not have exactly three dimensions .
generic big array. Raise [Invalid_argument] if the generic big array
does not have exactly three dimensions. *)
* { 6 Re - shaping big arrays }
val reshape : ('a, 'b, 'c) Genarray.t -> int array -> ('a, 'b, 'c) Genarray.t
* [ reshape b [ |d1; ... ;dN| ] ] converts the big array [ b ] to a
[ N]-dimensional array of dimensions [ d1] ... [dN ] . The returned
array and the original array [ b ] share their data
and have the same layout . For instance , assuming that [ b ]
is a one - dimensional array of dimension 12 , [ reshape b [ |3;4| ] ]
returns a two - dimensional array [ b ' ] of dimensions 3 and 4 .
If [ b ] has C layout , the element [ ( x , y ) ] of [ b ' ] corresponds
to the element [ x * 3 + y ] of [ b ] . If [ b ] has Fortran layout ,
the element [ ( x , y ) ] of [ b ' ] corresponds to the element
[ x + ( y - 1 ) * 4 ] of [ b ] .
The returned big array must have exactly the same number of
elements as the original big array [ b ] . That is , the product
of the dimensions of [ b ] must be equal to [ i1 * ... * iN ] .
Otherwise , [ Invalid_argument ] is raised .
[N]-dimensional array of dimensions [d1]...[dN]. The returned
array and the original array [b] share their data
and have the same layout. For instance, assuming that [b]
is a one-dimensional array of dimension 12, [reshape b [|3;4|]]
returns a two-dimensional array [b'] of dimensions 3 and 4.
If [b] has C layout, the element [(x,y)] of [b'] corresponds
to the element [x * 3 + y] of [b]. If [b] has Fortran layout,
the element [(x,y)] of [b'] corresponds to the element
[x + (y - 1) * 4] of [b].
The returned big array must have exactly the same number of
elements as the original big array [b]. That is, the product
of the dimensions of [b] must be equal to [i1 * ... * iN].
Otherwise, [Invalid_argument] is raised. *)
val reshape_1 : ('a, 'b, 'c) Genarray.t -> int -> ('a, 'b, 'c) Array1.t
* Specialized version of { ! Bigarray.reshape } for reshaping to
one - dimensional arrays .
one-dimensional arrays. *)
val reshape_2 : ('a, 'b, 'c) Genarray.t -> int -> int -> ('a, 'b, 'c) Array2.t
* Specialized version of { ! Bigarray.reshape } for reshaping to
two - dimensional arrays .
two-dimensional arrays. *)
val reshape_3 :
('a, 'b, 'c) Genarray.t -> int -> int -> int -> ('a, 'b, 'c) Array3.t
* Specialized version of { ! Bigarray.reshape } for reshaping to
three - dimensional arrays .
three-dimensional arrays. *)
| null | https://raw.githubusercontent.com/bmeurer/ocaml-experimental/fe5c10cdb0499e43af4b08f35a3248e5c1a8b541/otherlibs/bigarray/bigarray.mli | ocaml | *********************************************************************
Objective Caml
the special exception on linking described in file ../../LICENSE.
*********************************************************************
* See {!Bigarray.char}.
* See {!Bigarray.char}.
* See {!Bigarray.char}.
* See {!Bigarray.char}.
* See {!Bigarray.char}.
* See {!Bigarray.char}.
* See {!Bigarray.char}.
* See {!Bigarray.char}.
* See {!Bigarray.char}.
* See {!Bigarray.char}.
* See {!Bigarray.char}.
* See {!Bigarray.char}.
* Return the number of dimensions of the given big array.
* [Genarray.dims a] returns all dimensions of the big array [a],
as an array of integers of length [Genarray.num_dims a].
* Return the kind of the given big array.
* Return the layout of the given big array.
* Set all elements of a big array to a given value.
[Genarray.fill a v] stores the value [v] in all elements of
the big array [a]. Setting only some elements of [a] to [v]
can be achieved by applying [Genarray.fill] to a sub-array
or a slice of [a].
* Return the kind of the given big array.
* Return the layout of the given big array.
* [Array1.set a x v], also written [a.{x} <- v],
stores the value [v] at index [x] in [a].
[x] must be inside the bounds of [a] as described in
{!Bigarray.Array1.get};
otherwise, [Invalid_argument] is raised.
* Fill the given big array with the given value.
See [Genarray.fill] for more details.
* Like {!Bigarray.Array1.get}, but bounds checking is not always performed.
Use with caution and only when the program logic guarantees that
the access is within bounds.
* Like {!Bigarray.Array1.set}, but bounds checking is not always performed.
Use with caution and only when the program logic guarantees that
the access is within bounds.
* Return the kind of the given big array.
* Return the layout of the given big array.
* [Array2.get a x y], also written [a.{x,y}],
returns the element of [a] at coordinates ([x], [y]).
[x] and [y] must be within the bounds
of [a], as described for {!Bigarray.Genarray.get};
otherwise, [Invalid_argument] is raised.
* Like {!Bigarray.Array2.get}, but bounds checking is not always
performed.
* Like {!Bigarray.Array2.set}, but bounds checking is not always
performed.
* Return the kind of the given big array.
* Return the layout of the given big array.
* [Array3.get a x y z], also written [a.{x,y,z}],
returns the element of [a] at coordinates ([x], [y], [z]).
[x], [y] and [z] must be within the bounds of [a],
as described for {!Bigarray.Genarray.get};
otherwise, [Invalid_argument] is raised.
* [Array3.set a x y v], or alternatively [a.{x,y,z} <- v],
stores the value [v] at coordinates ([x], [y], [z]) in [a].
[x], [y] and [z] must be within the bounds of [a],
as described for {!Bigarray.Genarray.set};
otherwise, [Invalid_argument] is raised.
* Like {!Bigarray.Array3.get}, but bounds checking is not always
performed.
* Like {!Bigarray.Array3.set}, but bounds checking is not always
performed. | and , INRIA Rocquencourt
Copyright 2000 Institut National de Recherche en Informatique et
en Automatique . All rights reserved . This file is distributed
under the terms of the GNU Library General Public License , with
$ Id$
* Large , multi - dimensional , numerical arrays .
This module implements multi - dimensional arrays of integers and
floating - point numbers , thereafter referred to as ` ` big arrays '' .
The implementation allows efficient sharing of large numerical
arrays between code and C or Fortran numerical libraries .
Concerning the naming conventions , users of this module are encouraged
to do [ open Bigarray ] in their source , then refer to array types and
operations via short dot notation , e.g. [ Array1.t ] or [ Array2.sub ] .
Big arrays support all the ad - hoc polymorphic operations :
- comparisons ( [ =] , [ < > ] , [ < =] , etc , as well as { ! Pervasives.compare } ) ;
- hashing ( module [ Hash ] ) ;
- and structured input - output ( { ! Pervasives.output_value }
and { ! Pervasives.input_value } , as well as the functions from the
{ ! Marshal } module ) .
This module implements multi-dimensional arrays of integers and
floating-point numbers, thereafter referred to as ``big arrays''.
The implementation allows efficient sharing of large numerical
arrays between Caml code and C or Fortran numerical libraries.
Concerning the naming conventions, users of this module are encouraged
to do [open Bigarray] in their source, then refer to array types and
operations via short dot notation, e.g. [Array1.t] or [Array2.sub].
Big arrays support all the Caml ad-hoc polymorphic operations:
- comparisons ([=], [<>], [<=], etc, as well as {!Pervasives.compare});
- hashing (module [Hash]);
- and structured input-output ({!Pervasives.output_value}
and {!Pervasives.input_value}, as well as the functions from the
{!Marshal} module).
*)
* { 6 Element kinds }
* Big arrays can contain elements of the following kinds :
- IEEE single precision ( 32 bits ) floating - point numbers
( { ! Bigarray.float32_elt } ) ,
- IEEE double precision ( 64 bits ) floating - point numbers
( { ! Bigarray.float64_elt } ) ,
- IEEE single precision ( 2 * 32 bits ) floating - point complex numbers
( { ! Bigarray.complex32_elt } ) ,
- IEEE double precision ( 2 * 64 bits ) floating - point complex numbers
( { ! Bigarray.complex64_elt } ) ,
- 8 - bit integers ( signed or unsigned )
( { ! Bigarray.int8_signed_elt } or { ! Bigarray.int8_unsigned_elt } ) ,
- 16 - bit integers ( signed or unsigned )
( { ! Bigarray.int16_signed_elt } or { ! Bigarray.int16_unsigned_elt } ) ,
- Caml integers ( signed , 31 bits on 32 - bit architectures ,
63 bits on 64 - bit architectures ) ( { ! } ) ,
- 32 - bit signed integer ( { ! Bigarray.int32_elt } ) ,
- 64 - bit signed integers ( { ! Bigarray.int64_elt } ) ,
- platform - native signed integers ( 32 bits on 32 - bit architectures ,
64 bits on 64 - bit architectures ) ( { ! Bigarray.nativeint_elt } ) .
Each element kind is represented at the type level by one
of the abstract types defined below .
- IEEE single precision (32 bits) floating-point numbers
({!Bigarray.float32_elt}),
- IEEE double precision (64 bits) floating-point numbers
({!Bigarray.float64_elt}),
- IEEE single precision (2 * 32 bits) floating-point complex numbers
({!Bigarray.complex32_elt}),
- IEEE double precision (2 * 64 bits) floating-point complex numbers
({!Bigarray.complex64_elt}),
- 8-bit integers (signed or unsigned)
({!Bigarray.int8_signed_elt} or {!Bigarray.int8_unsigned_elt}),
- 16-bit integers (signed or unsigned)
({!Bigarray.int16_signed_elt} or {!Bigarray.int16_unsigned_elt}),
- Caml integers (signed, 31 bits on 32-bit architectures,
63 bits on 64-bit architectures) ({!Bigarray.int_elt}),
- 32-bit signed integer ({!Bigarray.int32_elt}),
- 64-bit signed integers ({!Bigarray.int64_elt}),
- platform-native signed integers (32 bits on 32-bit architectures,
64 bits on 64-bit architectures) ({!Bigarray.nativeint_elt}).
Each element kind is represented at the type level by one
of the abstract types defined below.
*)
type float32_elt
type float64_elt
type complex32_elt
type complex64_elt
type int8_signed_elt
type int8_unsigned_elt
type int16_signed_elt
type int16_unsigned_elt
type int_elt
type int32_elt
type int64_elt
type nativeint_elt
type ('a, 'b) kind
* To each element kind is associated a type , which is
the type of values that can be stored in the big array
or read back from it . This type is not necessarily the same
as the type of the array elements proper : for instance ,
a big array whose elements are of kind [ float32_elt ] contains
32 - bit single precision floats , but reading or writing one of
its elements from uses the type [ float ] , which is
64 - bit double precision floats .
The abstract type [ ( ' a , ' b ) kind ] captures this association
of a type [ ' a ] for values read or written in the big array ,
and of an element kind [ ' b ] which represents the actual contents
of the big array . The following predefined values of type
[ kind ] list all possible associations of types with
element kinds :
the type of Caml values that can be stored in the big array
or read back from it. This type is not necessarily the same
as the type of the array elements proper: for instance,
a big array whose elements are of kind [float32_elt] contains
32-bit single precision floats, but reading or writing one of
its elements from Caml uses the Caml type [float], which is
64-bit double precision floats.
The abstract type [('a, 'b) kind] captures this association
of a Caml type ['a] for values read or written in the big array,
and of an element kind ['b] which represents the actual contents
of the big array. The following predefined values of type
[kind] list all possible associations of Caml types with
element kinds: *)
val float32 : (float, float32_elt) kind
val float64 : (float, float64_elt) kind
val complex32 : (Complex.t, complex32_elt) kind
val complex64 : (Complex.t, complex64_elt) kind
val int8_signed : (int, int8_signed_elt) kind
val int8_unsigned : (int, int8_unsigned_elt) kind
val int16_signed : (int, int16_signed_elt) kind
val int16_unsigned : (int, int16_unsigned_elt) kind
val int : (int, int_elt) kind
val int32 : (int32, int32_elt) kind
val int64 : (int64, int64_elt) kind
val nativeint : (nativeint, nativeint_elt) kind
val char : (char, int8_unsigned_elt) kind
* As shown by the types of the values above ,
big arrays of kind [ float32_elt ] and [ float64_elt ] are
accessed using the type [ float ] . Big arrays of complex kinds
[ complex32_elt ] , [ complex64_elt ] are accessed with the type
{ ! Complex.t } . Big arrays of
integer kinds are accessed using the smallest integer
type large enough to represent the array elements :
[ int ] for 8- and 16 - bit integer bigarrays , as well as Caml - integer
bigarrays ; [ int32 ] for 32 - bit integer bigarrays ; [ int64 ]
for 64 - bit integer bigarrays ; and [ nativeint ] for
platform - native integer bigarrays . Finally , big arrays of
kind [ int8_unsigned_elt ] can also be accessed as arrays of
characters instead of arrays of small integers , by using
the kind value [ char ] instead of [ int8_unsigned ] .
big arrays of kind [float32_elt] and [float64_elt] are
accessed using the Caml type [float]. Big arrays of complex kinds
[complex32_elt], [complex64_elt] are accessed with the Caml type
{!Complex.t}. Big arrays of
integer kinds are accessed using the smallest Caml integer
type large enough to represent the array elements:
[int] for 8- and 16-bit integer bigarrays, as well as Caml-integer
bigarrays; [int32] for 32-bit integer bigarrays; [int64]
for 64-bit integer bigarrays; and [nativeint] for
platform-native integer bigarrays. Finally, big arrays of
kind [int8_unsigned_elt] can also be accessed as arrays of
characters instead of arrays of small integers, by using
the kind value [char] instead of [int8_unsigned]. *)
* { 6 Array layouts }
type c_layout
* See { ! } .
type fortran_layout
* To facilitate interoperability with existing C and Fortran code ,
this library supports two different memory layouts for big arrays ,
one compatible with the C conventions ,
the other compatible with the Fortran conventions .
In the C - style layout , array indices start at 0 , and
multi - dimensional arrays are laid out in row - major format .
That is , for a two - dimensional array , all elements of
row 0 are contiguous in memory , followed by all elements of
row 1 , etc . In other terms , the array elements at [ ( x , y ) ]
and [ ( x , y+1 ) ] are adjacent in memory .
In the Fortran - style layout , array indices start at 1 , and
multi - dimensional arrays are laid out in column - major format .
That is , for a two - dimensional array , all elements of
column 0 are contiguous in memory , followed by all elements of
column 1 , etc . In other terms , the array elements at [ ( x , y ) ]
and [ ( x+1 , y ) ] are adjacent in memory .
Each layout style is identified at the type level by the
abstract types { ! Bigarray.c_layout } and [ fortran_layout ] respectively .
this library supports two different memory layouts for big arrays,
one compatible with the C conventions,
the other compatible with the Fortran conventions.
In the C-style layout, array indices start at 0, and
multi-dimensional arrays are laid out in row-major format.
That is, for a two-dimensional array, all elements of
row 0 are contiguous in memory, followed by all elements of
row 1, etc. In other terms, the array elements at [(x,y)]
and [(x, y+1)] are adjacent in memory.
In the Fortran-style layout, array indices start at 1, and
multi-dimensional arrays are laid out in column-major format.
That is, for a two-dimensional array, all elements of
column 0 are contiguous in memory, followed by all elements of
column 1, etc. In other terms, the array elements at [(x,y)]
and [(x+1, y)] are adjacent in memory.
Each layout style is identified at the type level by the
abstract types {!Bigarray.c_layout} and [fortran_layout] respectively. *)
type 'a layout
* The type [ ' a layout ] represents one of the two supported
memory layouts : C - style if [ ' a ] is { ! Bigarray.c_layout } , Fortran - style
if [ ' a ] is { ! } .
memory layouts: C-style if ['a] is {!Bigarray.c_layout}, Fortran-style
if ['a] is {!Bigarray.fortran_layout}. *)
* { 7 Supported layouts }
The abstract values [ c_layout ] and [ fortran_layout ] represent
the two supported layouts at the level of values .
The abstract values [c_layout] and [fortran_layout] represent
the two supported layouts at the level of values.
*)
val c_layout : c_layout layout
val fortran_layout : fortran_layout layout
* { 6 Generic arrays ( of arbitrarily many dimensions ) }
module Genarray :
sig
type ('a, 'b, 'c) t
* The type [ Genarray.t ] is the type of big arrays with variable
numbers of dimensions . Any number of dimensions between 1 and 16
is supported .
The three type parameters to [ Genarray.t ] identify the array element
kind and layout , as follows :
- the first parameter , [ ' a ] , is the type for accessing array
elements ( [ float ] , [ int ] , [ int32 ] , [ int64 ] , [ nativeint ] ) ;
- the second parameter , [ ' b ] , is the actual kind of array elements
( [ float32_elt ] , [ float64_elt ] , [ int8_signed_elt ] , [ int8_unsigned_elt ] ,
etc ) ;
- the third parameter , [ ' c ] , identifies the array layout
( [ c_layout ] or [ fortran_layout ] ) .
For instance , [ ( float , float32_elt , fortran_layout ) Genarray.t ]
is the type of generic big arrays containing 32 - bit floats
in Fortran layout ; reads and writes in this array use the
Caml type [ float ] .
numbers of dimensions. Any number of dimensions between 1 and 16
is supported.
The three type parameters to [Genarray.t] identify the array element
kind and layout, as follows:
- the first parameter, ['a], is the Caml type for accessing array
elements ([float], [int], [int32], [int64], [nativeint]);
- the second parameter, ['b], is the actual kind of array elements
([float32_elt], [float64_elt], [int8_signed_elt], [int8_unsigned_elt],
etc);
- the third parameter, ['c], identifies the array layout
([c_layout] or [fortran_layout]).
For instance, [(float, float32_elt, fortran_layout) Genarray.t]
is the type of generic big arrays containing 32-bit floats
in Fortran layout; reads and writes in this array use the
Caml type [float]. *)
external create: ('a, 'b) kind -> 'c layout -> int array -> ('a, 'b, 'c) t
= "caml_ba_create"
* [ Genarray.create kind layout dimensions ] returns a new big array
whose element kind is determined by the parameter [ kind ] ( one of
[ float32 ] , [ float64 ] , [ int8_signed ] , etc ) and whose layout is
determined by the parameter [ layout ] ( one of [ c_layout ] or
[ fortran_layout ] ) . The [ dimensions ] parameter is an array of
integers that indicate the size of the big array in each dimension .
The length of [ dimensions ] determines the number of dimensions
of the bigarray .
For instance , [ Genarray.create int32 c_layout [ |4;6;8| ] ]
returns a fresh big array of 32 - bit integers , in C layout ,
having three dimensions , the three dimensions being 4 , 6 and 8
respectively .
Big arrays returned by [ Genarray.create ] are not initialized :
the initial values of array elements is unspecified .
[ Genarray.create ] raises [ Invalid_argument ] if the number of dimensions
is not in the range 1 to 16 inclusive , or if one of the dimensions
is negative .
whose element kind is determined by the parameter [kind] (one of
[float32], [float64], [int8_signed], etc) and whose layout is
determined by the parameter [layout] (one of [c_layout] or
[fortran_layout]). The [dimensions] parameter is an array of
integers that indicate the size of the big array in each dimension.
The length of [dimensions] determines the number of dimensions
of the bigarray.
For instance, [Genarray.create int32 c_layout [|4;6;8|]]
returns a fresh big array of 32-bit integers, in C layout,
having three dimensions, the three dimensions being 4, 6 and 8
respectively.
Big arrays returned by [Genarray.create] are not initialized:
the initial values of array elements is unspecified.
[Genarray.create] raises [Invalid_argument] if the number of dimensions
is not in the range 1 to 16 inclusive, or if one of the dimensions
is negative. *)
external num_dims: ('a, 'b, 'c) t -> int = "caml_ba_num_dims"
val dims : ('a, 'b, 'c) t -> int array
external nth_dim: ('a, 'b, 'c) t -> int -> int = "caml_ba_dim"
* [ Genarray.nth_dim a n ] returns the [ n]-th dimension of the
big array [ a ] . The first dimension corresponds to [ n = 0 ] ;
the second dimension corresponds to [ n = 1 ] ; the last dimension ,
to [ n = Genarray.num_dims a - 1 ] .
Raise [ Invalid_argument ] if [ n ] is less than 0 or greater or equal than
[ Genarray.num_dims a ] .
big array [a]. The first dimension corresponds to [n = 0];
the second dimension corresponds to [n = 1]; the last dimension,
to [n = Genarray.num_dims a - 1].
Raise [Invalid_argument] if [n] is less than 0 or greater or equal than
[Genarray.num_dims a]. *)
external kind: ('a, 'b, 'c) t -> ('a, 'b) kind = "caml_ba_kind"
external layout: ('a, 'b, 'c) t -> 'c layout = "caml_ba_layout"
external get: ('a, 'b, 'c) t -> int array -> 'a = "caml_ba_get_generic"
* Read an element of a generic big array .
[ Genarray.get a [ |i1 ; ... ; iN| ] ] returns the element of [ a ]
whose coordinates are [ i1 ] in the first dimension , [ i2 ] in
the second dimension , ... , [ iN ] in the [ N]-th dimension .
If [ a ] has C layout , the coordinates must be greater or equal than 0
and strictly less than the corresponding dimensions of [ a ] .
If [ a ] has Fortran layout , the coordinates must be greater or equal
than 1 and less or equal than the corresponding dimensions of [ a ] .
Raise [ Invalid_argument ] if the array [ a ] does not have exactly [ N ]
dimensions , or if the coordinates are outside the array bounds .
If [ N > 3 ] , alternate syntax is provided : you can write
[ a.{i1 , i2 , ... , iN } ] instead of [ Genarray.get a [ |i1 ; ... ; iN| ] ] .
( The syntax [ a. { ... } ] with one , two or three coordinates is
reserved for accessing one- , two- and three - dimensional arrays
as described below . )
[Genarray.get a [|i1; ...; iN|]] returns the element of [a]
whose coordinates are [i1] in the first dimension, [i2] in
the second dimension, ..., [iN] in the [N]-th dimension.
If [a] has C layout, the coordinates must be greater or equal than 0
and strictly less than the corresponding dimensions of [a].
If [a] has Fortran layout, the coordinates must be greater or equal
than 1 and less or equal than the corresponding dimensions of [a].
Raise [Invalid_argument] if the array [a] does not have exactly [N]
dimensions, or if the coordinates are outside the array bounds.
If [N > 3], alternate syntax is provided: you can write
[a.{i1, i2, ..., iN}] instead of [Genarray.get a [|i1; ...; iN|]].
(The syntax [a.{...}] with one, two or three coordinates is
reserved for accessing one-, two- and three-dimensional arrays
as described below.) *)
external set: ('a, 'b, 'c) t -> int array -> 'a -> unit
= "caml_ba_set_generic"
* Assign an element of a generic big array .
[ Genarray.set a [ |i1 ; ... ; iN| ] v ] stores the value [ v ] in the
element of [ a ] whose coordinates are [ i1 ] in the first dimension ,
[ i2 ] in the second dimension , ... , [ iN ] in the [ N]-th dimension .
The array [ a ] must have exactly [ N ] dimensions , and all coordinates
must lie inside the array bounds , as described for [ Genarray.get ] ;
otherwise , [ Invalid_argument ] is raised .
If [ N > 3 ] , alternate syntax is provided : you can write
[ a.{i1 , i2 , ... , iN } < - v ] instead of
[ Genarray.set a [ |i1 ; ... ; iN| ] v ] .
( The syntax [ a. { ... } < - v ] with one , two or three coordinates is
reserved for updating one- , two- and three - dimensional arrays
as described below . )
[Genarray.set a [|i1; ...; iN|] v] stores the value [v] in the
element of [a] whose coordinates are [i1] in the first dimension,
[i2] in the second dimension, ..., [iN] in the [N]-th dimension.
The array [a] must have exactly [N] dimensions, and all coordinates
must lie inside the array bounds, as described for [Genarray.get];
otherwise, [Invalid_argument] is raised.
If [N > 3], alternate syntax is provided: you can write
[a.{i1, i2, ..., iN} <- v] instead of
[Genarray.set a [|i1; ...; iN|] v].
(The syntax [a.{...} <- v] with one, two or three coordinates is
reserved for updating one-, two- and three-dimensional arrays
as described below.) *)
external sub_left: ('a, 'b, c_layout) t -> int -> int -> ('a, 'b, c_layout) t
= "caml_ba_sub"
* Extract a sub - array of the given big array by restricting the
first ( left - most ) dimension . [ Genarray.sub_left a ofs len ]
returns a big array with the same number of dimensions as [ a ] ,
and the same dimensions as [ a ] , except the first dimension ,
which corresponds to the interval [ [ ofs ... ofs + len - 1 ] ]
of the first dimension of [ a ] . No copying of elements is
involved : the sub - array and the original array share the same
storage space . In other terms , the element at coordinates
[ [ |i1 ; ... ; iN| ] ] of the sub - array is identical to the
element at coordinates [ [ |i1+ofs ; ... ; iN| ] ] of the original
array [ a ] .
[ Genarray.sub_left ] applies only to big arrays in C layout .
Raise [ Invalid_argument ] if [ ofs ] and [ len ] do not designate
a valid sub - array of [ a ] , that is , if [ ofs < 0 ] , or [ len < 0 ] ,
or > Genarray.nth_dim a 0 ] .
first (left-most) dimension. [Genarray.sub_left a ofs len]
returns a big array with the same number of dimensions as [a],
and the same dimensions as [a], except the first dimension,
which corresponds to the interval [[ofs ... ofs + len - 1]]
of the first dimension of [a]. No copying of elements is
involved: the sub-array and the original array share the same
storage space. In other terms, the element at coordinates
[[|i1; ...; iN|]] of the sub-array is identical to the
element at coordinates [[|i1+ofs; ...; iN|]] of the original
array [a].
[Genarray.sub_left] applies only to big arrays in C layout.
Raise [Invalid_argument] if [ofs] and [len] do not designate
a valid sub-array of [a], that is, if [ofs < 0], or [len < 0],
or [ofs + len > Genarray.nth_dim a 0]. *)
external sub_right:
('a, 'b, fortran_layout) t -> int -> int -> ('a, 'b, fortran_layout) t
= "caml_ba_sub"
* Extract a sub - array of the given big array by restricting the
last ( right - most ) dimension . [ Genarray.sub_right a ofs len ]
returns a big array with the same number of dimensions as [ a ] ,
and the same dimensions as [ a ] , except the last dimension ,
which corresponds to the interval [ [ ofs ... ofs + len - 1 ] ]
of the last dimension of [ a ] . No copying of elements is
involved : the sub - array and the original array share the same
storage space . In other terms , the element at coordinates
[ [ |i1 ; ... ; iN| ] ] of the sub - array is identical to the
element at coordinates [ [ |i1 ; ... ; iN+ofs| ] ] of the original
array [ a ] .
[ Genarray.sub_right ] applies only to big arrays in Fortran layout .
Raise [ Invalid_argument ] if [ ofs ] and [ len ] do not designate
a valid sub - array of [ a ] , that is , if [ ofs < 1 ] , or [ len < 0 ] ,
or > Genarray.nth_dim a ( Genarray.num_dims a - 1 ) ] .
last (right-most) dimension. [Genarray.sub_right a ofs len]
returns a big array with the same number of dimensions as [a],
and the same dimensions as [a], except the last dimension,
which corresponds to the interval [[ofs ... ofs + len - 1]]
of the last dimension of [a]. No copying of elements is
involved: the sub-array and the original array share the same
storage space. In other terms, the element at coordinates
[[|i1; ...; iN|]] of the sub-array is identical to the
element at coordinates [[|i1; ...; iN+ofs|]] of the original
array [a].
[Genarray.sub_right] applies only to big arrays in Fortran layout.
Raise [Invalid_argument] if [ofs] and [len] do not designate
a valid sub-array of [a], that is, if [ofs < 1], or [len < 0],
or [ofs + len > Genarray.nth_dim a (Genarray.num_dims a - 1)]. *)
external slice_left:
('a, 'b, c_layout) t -> int array -> ('a, 'b, c_layout) t
= "caml_ba_slice"
* Extract a sub - array of lower dimension from the given big array
by fixing one or several of the first ( left - most ) coordinates .
[ a [ |i1 ; ... ; iM| ] ] returns the ` ` slice ''
of [ a ] obtained by setting the first [ M ] coordinates to
[ i1 ] , ... , [ iM ] . If [ a ] has [ N ] dimensions , the slice has
dimension [ N - M ] , and the element at coordinates
[ [ |j1 ; ... ; ] ] in the slice is identical to the element
at coordinates [ [ |i1 ; ... ; iM ; j1 ; ... ; ] ] in the original
array [ a ] . No copying of elements is involved : the slice and
the original array share the same storage space .
[ ] applies only to big arrays in C layout .
Raise [ Invalid_argument ] if [ M > = N ] , or if [ [ |i1 ; ... ; iM| ] ]
is outside the bounds of [ a ] .
by fixing one or several of the first (left-most) coordinates.
[Genarray.slice_left a [|i1; ... ; iM|]] returns the ``slice''
of [a] obtained by setting the first [M] coordinates to
[i1], ..., [iM]. If [a] has [N] dimensions, the slice has
dimension [N - M], and the element at coordinates
[[|j1; ...; j(N-M)|]] in the slice is identical to the element
at coordinates [[|i1; ...; iM; j1; ...; j(N-M)|]] in the original
array [a]. No copying of elements is involved: the slice and
the original array share the same storage space.
[Genarray.slice_left] applies only to big arrays in C layout.
Raise [Invalid_argument] if [M >= N], or if [[|i1; ... ; iM|]]
is outside the bounds of [a]. *)
external slice_right:
('a, 'b, fortran_layout) t -> int array -> ('a, 'b, fortran_layout) t
= "caml_ba_slice"
* Extract a sub - array of lower dimension from the given big array
by fixing one or several of the last ( right - most ) coordinates .
[ Genarray.slice_right a [ |i1 ; ... ; iM| ] ] returns the ` ` slice ''
of [ a ] obtained by setting the last [ M ] coordinates to
[ i1 ] , ... , [ iM ] . If [ a ] has [ N ] dimensions , the slice has
dimension [ N - M ] , and the element at coordinates
[ [ |j1 ; ... ; ] ] in the slice is identical to the element
at coordinates [ [ |j1 ; ... ; ) ; i1 ; ... ; iM| ] ] in the original
array [ a ] . No copying of elements is involved : the slice and
the original array share the same storage space .
[ Genarray.slice_right ] applies only to big arrays in Fortran layout .
Raise [ Invalid_argument ] if [ M > = N ] , or if [ [ |i1 ; ... ; iM| ] ]
is outside the bounds of [ a ] .
by fixing one or several of the last (right-most) coordinates.
[Genarray.slice_right a [|i1; ... ; iM|]] returns the ``slice''
of [a] obtained by setting the last [M] coordinates to
[i1], ..., [iM]. If [a] has [N] dimensions, the slice has
dimension [N - M], and the element at coordinates
[[|j1; ...; j(N-M)|]] in the slice is identical to the element
at coordinates [[|j1; ...; j(N-M); i1; ...; iM|]] in the original
array [a]. No copying of elements is involved: the slice and
the original array share the same storage space.
[Genarray.slice_right] applies only to big arrays in Fortran layout.
Raise [Invalid_argument] if [M >= N], or if [[|i1; ... ; iM|]]
is outside the bounds of [a]. *)
external blit: ('a, 'b, 'c) t -> ('a, 'b, 'c) t -> unit
= "caml_ba_blit"
* Copy all elements of a big array in another big array .
[ Genarray.blit ] copies all elements of [ src ] into
[ dst ] . Both arrays [ src ] and [ dst ] must have the same number of
dimensions and equal dimensions . Copying a sub - array of [ src ]
to a sub - array of [ dst ] can be achieved by applying [ Genarray.blit ]
to sub - array or slices of [ src ] and [ dst ] .
[Genarray.blit src dst] copies all elements of [src] into
[dst]. Both arrays [src] and [dst] must have the same number of
dimensions and equal dimensions. Copying a sub-array of [src]
to a sub-array of [dst] can be achieved by applying [Genarray.blit]
to sub-array or slices of [src] and [dst]. *)
external fill: ('a, 'b, 'c) t -> 'a -> unit = "caml_ba_fill"
val map_file:
Unix.file_descr -> ?pos:int64 -> ('a, 'b) kind -> 'c layout ->
bool -> int array -> ('a, 'b, 'c) t
* Memory mapping of a file as a big array .
[ Genarray.map_file fd kind layout shared dims ]
returns a big array of kind [ kind ] , layout [ layout ] ,
and dimensions as specified in [ dims ] . The data contained in
this big array are the contents of the file referred to by
the file descriptor [ fd ] ( as opened previously with
[ Unix.openfile ] , for example ) . The optional [ pos ] parameter
is the byte offset in the file of the data being mapped ;
it defaults to 0 ( map from the beginning of the file ) .
If [ shared ] is [ true ] , all modifications performed on the array
are reflected in the file . This requires that [ fd ] be opened
with write permissions . If [ shared ] is [ false ] , modifications
performed on the array are done in memory only , using
copy - on - write of the modified pages ; the underlying file is not
affected .
[ Genarray.map_file ] is much more efficient than reading
the whole file in a big array , modifying that big array ,
and writing it afterwards .
To adjust automatically the dimensions of the big array to
the actual size of the file , the major dimension ( that is ,
the first dimension for an array with C layout , and the last
dimension for an array with Fortran layout ) can be given as
[ -1 ] . [ Genarray.map_file ] then determines the major dimension
from the size of the file . The file must contain an integral
number of sub - arrays as determined by the non - major dimensions ,
otherwise [ Failure ] is raised .
If all dimensions of the big array are given , the file size is
matched against the size of the big array . If the file is larger
than the big array , only the initial portion of the file is
mapped to the big array . If the file is smaller than the big
array , the file is automatically grown to the size of the big array .
This requires write permissions on [ fd ] .
[Genarray.map_file fd kind layout shared dims]
returns a big array of kind [kind], layout [layout],
and dimensions as specified in [dims]. The data contained in
this big array are the contents of the file referred to by
the file descriptor [fd] (as opened previously with
[Unix.openfile], for example). The optional [pos] parameter
is the byte offset in the file of the data being mapped;
it defaults to 0 (map from the beginning of the file).
If [shared] is [true], all modifications performed on the array
are reflected in the file. This requires that [fd] be opened
with write permissions. If [shared] is [false], modifications
performed on the array are done in memory only, using
copy-on-write of the modified pages; the underlying file is not
affected.
[Genarray.map_file] is much more efficient than reading
the whole file in a big array, modifying that big array,
and writing it afterwards.
To adjust automatically the dimensions of the big array to
the actual size of the file, the major dimension (that is,
the first dimension for an array with C layout, and the last
dimension for an array with Fortran layout) can be given as
[-1]. [Genarray.map_file] then determines the major dimension
from the size of the file. The file must contain an integral
number of sub-arrays as determined by the non-major dimensions,
otherwise [Failure] is raised.
If all dimensions of the big array are given, the file size is
matched against the size of the big array. If the file is larger
than the big array, only the initial portion of the file is
mapped to the big array. If the file is smaller than the big
array, the file is automatically grown to the size of the big array.
This requires write permissions on [fd]. *)
end
* { 6 One - dimensional arrays }
* One - dimensional arrays . The [ Array1 ] structure provides operations
similar to those of
{ ! . Genarray } , but specialized to the case of one - dimensional arrays .
( The [ Array2 ] and [ Array3 ] structures below provide operations
specialized for two- and three - dimensional arrays . )
Statically knowing the number of dimensions of the array allows
faster operations , and more precise static type - checking .
similar to those of
{!Bigarray.Genarray}, but specialized to the case of one-dimensional arrays.
(The [Array2] and [Array3] structures below provide operations
specialized for two- and three-dimensional arrays.)
Statically knowing the number of dimensions of the array allows
faster operations, and more precise static type-checking. *)
module Array1 : sig
type ('a, 'b, 'c) t
* The type of one - dimensional big arrays whose elements have
type [ ' a ] , representation kind [ ' b ] , and memory layout [ ' c ] .
Caml type ['a], representation kind ['b], and memory layout ['c]. *)
val create: ('a, 'b) kind -> 'c layout -> int -> ('a, 'b, 'c) t
* [ Array1.create kind layout dim ] returns a new bigarray of
one dimension , whose size is [ dim ] . [ kind ] and [ layout ]
determine the array element kind and the array layout
as described for [ Genarray.create ] .
one dimension, whose size is [dim]. [kind] and [layout]
determine the array element kind and the array layout
as described for [Genarray.create]. *)
val dim: ('a, 'b, 'c) t -> int
* Return the size ( dimension ) of the given one - dimensional
big array .
big array. *)
external kind: ('a, 'b, 'c) t -> ('a, 'b) kind = "caml_ba_kind"
external layout: ('a, 'b, 'c) t -> 'c layout = "caml_ba_layout"
external get: ('a, 'b, 'c) t -> int -> 'a = "%caml_ba_ref_1"
* [ Array1.get a x ] , or alternatively [ a.{x } ] ,
returns the element of [ a ] at index [ x ] .
[ x ] must be greater or equal than [ 0 ] and strictly less than
[ Array1.dim a ] if [ a ] has C layout . If [ a ] has Fortran layout ,
[ x ] must be greater or equal than [ 1 ] and less or equal than
[ Array1.dim a ] . Otherwise , [ Invalid_argument ] is raised .
returns the element of [a] at index [x].
[x] must be greater or equal than [0] and strictly less than
[Array1.dim a] if [a] has C layout. If [a] has Fortran layout,
[x] must be greater or equal than [1] and less or equal than
[Array1.dim a]. Otherwise, [Invalid_argument] is raised. *)
external set: ('a, 'b, 'c) t -> int -> 'a -> unit = "%caml_ba_set_1"
external sub: ('a, 'b, 'c) t -> int -> int -> ('a, 'b, 'c) t
= "caml_ba_sub"
* Extract a sub - array of the given one - dimensional big array .
See [ Genarray.sub_left ] for more details .
See [Genarray.sub_left] for more details. *)
external blit: ('a, 'b, 'c) t -> ('a, 'b, 'c) t -> unit
= "caml_ba_blit"
* Copy the first big array to the second big array .
See [ Genarray.blit ] for more details .
See [Genarray.blit] for more details. *)
external fill: ('a, 'b, 'c) t -> 'a -> unit = "caml_ba_fill"
val of_array: ('a, 'b) kind -> 'c layout -> 'a array -> ('a, 'b, 'c) t
* Build a one - dimensional big array initialized from the
given array .
given array. *)
val map_file: Unix.file_descr -> ?pos:int64 -> ('a, 'b) kind -> 'c layout ->
bool -> int -> ('a, 'b, 'c) t
* Memory mapping of a file as a one - dimensional big array .
See { ! . Genarray.map_file } for more details .
See {!Bigarray.Genarray.map_file} for more details. *)
external unsafe_get: ('a, 'b, 'c) t -> int -> 'a = "%caml_ba_unsafe_ref_1"
external unsafe_set: ('a, 'b, 'c) t -> int -> 'a -> unit
= "%caml_ba_unsafe_set_1"
end
* { 6 Two - dimensional arrays }
* Two - dimensional arrays . The [ Array2 ] structure provides operations
similar to those of { ! . Genarray } , but specialized to the
case of two - dimensional arrays .
similar to those of {!Bigarray.Genarray}, but specialized to the
case of two-dimensional arrays. *)
module Array2 :
sig
type ('a, 'b, 'c) t
* The type of two - dimensional big arrays whose elements have
type [ ' a ] , representation kind [ ' b ] , and memory layout [ ' c ] .
Caml type ['a], representation kind ['b], and memory layout ['c]. *)
val create: ('a, 'b) kind -> 'c layout -> int -> int -> ('a, 'b, 'c) t
* [ Array2.create kind layout dim1 dim2 ] returns a new bigarray of
two dimension , whose size is [ dim1 ] in the first dimension
and [ dim2 ] in the second dimension . [ kind ] and [ layout ]
determine the array element kind and the array layout
as described for { ! Bigarray.Genarray.create } .
two dimension, whose size is [dim1] in the first dimension
and [dim2] in the second dimension. [kind] and [layout]
determine the array element kind and the array layout
as described for {!Bigarray.Genarray.create}. *)
val dim1: ('a, 'b, 'c) t -> int
* Return the first dimension of the given two - dimensional big array .
val dim2: ('a, 'b, 'c) t -> int
* Return the second dimension of the given two - dimensional big array .
external kind: ('a, 'b, 'c) t -> ('a, 'b) kind = "caml_ba_kind"
external layout: ('a, 'b, 'c) t -> 'c layout = "caml_ba_layout"
external get: ('a, 'b, 'c) t -> int -> int -> 'a = "%caml_ba_ref_2"
external set: ('a, 'b, 'c) t -> int -> int -> 'a -> unit = "%caml_ba_set_2"
* [ Array2.set a x y v ] , or alternatively [ a.{x , y } < - v ] ,
stores the value [ v ] at coordinates ( [ x ] , [ y ] ) in [ a ] .
[ x ] and [ y ] must be within the bounds of [ a ] ,
as described for { ! Bigarray.Genarray.set } ;
otherwise , [ Invalid_argument ] is raised .
stores the value [v] at coordinates ([x], [y]) in [a].
[x] and [y] must be within the bounds of [a],
as described for {!Bigarray.Genarray.set};
otherwise, [Invalid_argument] is raised. *)
external sub_left: ('a, 'b, c_layout) t -> int -> int -> ('a, 'b, c_layout) t
= "caml_ba_sub"
* Extract a two - dimensional sub - array of the given two - dimensional
big array by restricting the first dimension .
See { ! . Genarray.sub_left } for more details .
[ ] applies only to arrays with C layout .
big array by restricting the first dimension.
See {!Bigarray.Genarray.sub_left} for more details.
[Array2.sub_left] applies only to arrays with C layout. *)
external sub_right:
('a, 'b, fortran_layout) t -> int -> int -> ('a, 'b, fortran_layout) t
= "caml_ba_sub"
* Extract a two - dimensional sub - array of the given two - dimensional
big array by restricting the second dimension .
See { ! Bigarray . } for more details .
[ Array2.sub_right ] applies only to arrays with Fortran layout .
big array by restricting the second dimension.
See {!Bigarray.Genarray.sub_right} for more details.
[Array2.sub_right] applies only to arrays with Fortran layout. *)
val slice_left: ('a, 'b, c_layout) t -> int -> ('a, 'b, c_layout) Array1.t
* Extract a row ( one - dimensional slice ) of the given two - dimensional
big array . The integer parameter is the index of the row to
extract . See { ! . } for more details .
[ Array2.slice_left ] applies only to arrays with C layout .
big array. The integer parameter is the index of the row to
extract. See {!Bigarray.Genarray.slice_left} for more details.
[Array2.slice_left] applies only to arrays with C layout. *)
val slice_right:
('a, 'b, fortran_layout) t -> int -> ('a, 'b, fortran_layout) Array1.t
* Extract a column ( one - dimensional slice ) of the given
two - dimensional big array . The integer parameter is the
index of the column to extract . See { ! . Genarray.slice_right }
for more details . [ Array2.slice_right ] applies only to arrays
with Fortran layout .
two-dimensional big array. The integer parameter is the
index of the column to extract. See {!Bigarray.Genarray.slice_right}
for more details. [Array2.slice_right] applies only to arrays
with Fortran layout. *)
external blit: ('a, 'b, 'c) t -> ('a, 'b, 'c) t -> unit
= "caml_ba_blit"
* Copy the first big array to the second big array .
See { ! } for more details .
See {!Bigarray.Genarray.blit} for more details. *)
external fill: ('a, 'b, 'c) t -> 'a -> unit = "caml_ba_fill"
* Fill the given big array with the given value .
See { ! } for more details .
See {!Bigarray.Genarray.fill} for more details. *)
val of_array: ('a, 'b) kind -> 'c layout -> 'a array array -> ('a, 'b, 'c) t
* Build a two - dimensional big array initialized from the
given array of arrays .
given array of arrays. *)
val map_file: Unix.file_descr -> ?pos:int64 -> ('a, 'b) kind -> 'c layout ->
bool -> int -> int -> ('a, 'b, 'c) t
* Memory mapping of a file as a two - dimensional big array .
See { ! . Genarray.map_file } for more details .
See {!Bigarray.Genarray.map_file} for more details. *)
external unsafe_get: ('a, 'b, 'c) t -> int -> int -> 'a
= "%caml_ba_unsafe_ref_2"
external unsafe_set: ('a, 'b, 'c) t -> int -> int -> 'a -> unit
= "%caml_ba_unsafe_set_2"
end
* { 6 Three - dimensional arrays }
* Three - dimensional arrays . The [ Array3 ] structure provides operations
similar to those of { ! . Genarray } , but specialized to the case
of three - dimensional arrays .
similar to those of {!Bigarray.Genarray}, but specialized to the case
of three-dimensional arrays. *)
module Array3 :
sig
type ('a, 'b, 'c) t
* The type of three - dimensional big arrays whose elements have
type [ ' a ] , representation kind [ ' b ] , and memory layout [ ' c ] .
Caml type ['a], representation kind ['b], and memory layout ['c]. *)
val create: ('a, 'b) kind -> 'c layout -> int -> int -> int -> ('a, 'b, 'c) t
* [ Array3.create kind layout dim1 dim2 dim3 ] returns a new bigarray of
three dimension , whose size is [ dim1 ] in the first dimension ,
[ dim2 ] in the second dimension , and [ dim3 ] in the third .
[ kind ] and [ layout ] determine the array element kind and
the array layout as described for { ! Bigarray.Genarray.create } .
three dimension, whose size is [dim1] in the first dimension,
[dim2] in the second dimension, and [dim3] in the third.
[kind] and [layout] determine the array element kind and
the array layout as described for {!Bigarray.Genarray.create}. *)
val dim1: ('a, 'b, 'c) t -> int
* Return the first dimension of the given three - dimensional big array .
val dim2: ('a, 'b, 'c) t -> int
* Return the second dimension of the given three - dimensional big array .
val dim3: ('a, 'b, 'c) t -> int
* Return the third dimension of the given three - dimensional big array .
external kind: ('a, 'b, 'c) t -> ('a, 'b) kind = "caml_ba_kind"
external layout: ('a, 'b, 'c) t -> 'c layout = "caml_ba_layout"
external get: ('a, 'b, 'c) t -> int -> int -> int -> 'a = "%caml_ba_ref_3"
external set: ('a, 'b, 'c) t -> int -> int -> int -> 'a -> unit
= "%caml_ba_set_3"
external sub_left: ('a, 'b, c_layout) t -> int -> int -> ('a, 'b, c_layout) t
= "caml_ba_sub"
* Extract a three - dimensional sub - array of the given
three - dimensional big array by restricting the first dimension .
See { ! . Genarray.sub_left } for more details . [ Array3.sub_left ]
applies only to arrays with C layout .
three-dimensional big array by restricting the first dimension.
See {!Bigarray.Genarray.sub_left} for more details. [Array3.sub_left]
applies only to arrays with C layout. *)
external sub_right:
('a, 'b, fortran_layout) t -> int -> int -> ('a, 'b, fortran_layout) t
= "caml_ba_sub"
* Extract a three - dimensional sub - array of the given
three - dimensional big array by restricting the second dimension .
See { ! Bigarray . } for more details . [ Array3.sub_right ]
applies only to arrays with Fortran layout .
three-dimensional big array by restricting the second dimension.
See {!Bigarray.Genarray.sub_right} for more details. [Array3.sub_right]
applies only to arrays with Fortran layout. *)
val slice_left_1:
('a, 'b, c_layout) t -> int -> int -> ('a, 'b, c_layout) Array1.t
* Extract a one - dimensional slice of the given three - dimensional
big array by fixing the first two coordinates .
The integer parameters are the coordinates of the slice to
extract . See { ! . } for more details .
[ Array3.slice_left_1 ] applies only to arrays with C layout .
big array by fixing the first two coordinates.
The integer parameters are the coordinates of the slice to
extract. See {!Bigarray.Genarray.slice_left} for more details.
[Array3.slice_left_1] applies only to arrays with C layout. *)
val slice_right_1:
('a, 'b, fortran_layout) t ->
int -> int -> ('a, 'b, fortran_layout) Array1.t
* Extract a one - dimensional slice of the given three - dimensional
big array by fixing the last two coordinates .
The integer parameters are the coordinates of the slice to
extract . See { ! . Genarray.slice_right } for more details .
[ Array3.slice_right_1 ] applies only to arrays with Fortran
layout .
big array by fixing the last two coordinates.
The integer parameters are the coordinates of the slice to
extract. See {!Bigarray.Genarray.slice_right} for more details.
[Array3.slice_right_1] applies only to arrays with Fortran
layout. *)
val slice_left_2: ('a, 'b, c_layout) t -> int -> ('a, 'b, c_layout) Array2.t
* Extract a two - dimensional slice of the given three - dimensional
big array by fixing the first coordinate .
The integer parameter is the first coordinate of the slice to
extract . See { ! . } for more details .
[ Array3.slice_left_2 ] applies only to arrays with C layout .
big array by fixing the first coordinate.
The integer parameter is the first coordinate of the slice to
extract. See {!Bigarray.Genarray.slice_left} for more details.
[Array3.slice_left_2] applies only to arrays with C layout. *)
val slice_right_2:
('a, 'b, fortran_layout) t -> int -> ('a, 'b, fortran_layout) Array2.t
* Extract a two - dimensional slice of the given
three - dimensional big array by fixing the last coordinate .
The integer parameter is the coordinate of the slice
to extract . See { ! . Genarray.slice_right } for more details .
[ Array3.slice_right_2 ] applies only to arrays with Fortran
layout .
three-dimensional big array by fixing the last coordinate.
The integer parameter is the coordinate of the slice
to extract. See {!Bigarray.Genarray.slice_right} for more details.
[Array3.slice_right_2] applies only to arrays with Fortran
layout. *)
external blit: ('a, 'b, 'c) t -> ('a, 'b, 'c) t -> unit
= "caml_ba_blit"
* Copy the first big array to the second big array .
See { ! } for more details .
See {!Bigarray.Genarray.blit} for more details. *)
external fill: ('a, 'b, 'c) t -> 'a -> unit = "caml_ba_fill"
* Fill the given big array with the given value .
See { ! } for more details .
See {!Bigarray.Genarray.fill} for more details. *)
val of_array:
('a, 'b) kind -> 'c layout -> 'a array array array -> ('a, 'b, 'c) t
* Build a three - dimensional big array initialized from the
given array of arrays of arrays .
given array of arrays of arrays. *)
val map_file: Unix.file_descr -> ?pos:int64 -> ('a, 'b) kind -> 'c layout ->
bool -> int -> int -> int -> ('a, 'b, 'c) t
* Memory mapping of a file as a three - dimensional big array .
See { ! . Genarray.map_file } for more details .
See {!Bigarray.Genarray.map_file} for more details. *)
external unsafe_get: ('a, 'b, 'c) t -> int -> int -> int -> 'a
= "%caml_ba_unsafe_ref_3"
external unsafe_set: ('a, 'b, 'c) t -> int -> int -> int -> 'a -> unit
= "%caml_ba_unsafe_set_3"
end
* { 6 Coercions between generic big arrays and fixed - dimension big arrays }
external genarray_of_array1 :
('a, 'b, 'c) Array1.t -> ('a, 'b, 'c) Genarray.t = "%identity"
* Return the generic big array corresponding to the given one - dimensional
big array .
big array. *)
external genarray_of_array2 :
('a, 'b, 'c) Array2.t -> ('a, 'b, 'c) Genarray.t = "%identity"
* Return the generic big array corresponding to the given two - dimensional
big array .
big array. *)
external genarray_of_array3 :
('a, 'b, 'c) Array3.t -> ('a, 'b, 'c) Genarray.t = "%identity"
* Return the generic big array corresponding to the given three - dimensional
big array .
big array. *)
val array1_of_genarray : ('a, 'b, 'c) Genarray.t -> ('a, 'b, 'c) Array1.t
* Return the one - dimensional big array corresponding to the given
generic big array . Raise [ Invalid_argument ] if the generic big array
does not have exactly one dimension .
generic big array. Raise [Invalid_argument] if the generic big array
does not have exactly one dimension. *)
val array2_of_genarray : ('a, 'b, 'c) Genarray.t -> ('a, 'b, 'c) Array2.t
* Return the two - dimensional big array corresponding to the given
generic big array . Raise [ Invalid_argument ] if the generic big array
does not have exactly two dimensions .
generic big array. Raise [Invalid_argument] if the generic big array
does not have exactly two dimensions. *)
val array3_of_genarray : ('a, 'b, 'c) Genarray.t -> ('a, 'b, 'c) Array3.t
* Return the three - dimensional big array corresponding to the given
generic big array . Raise [ Invalid_argument ] if the generic big array
does not have exactly three dimensions .
generic big array. Raise [Invalid_argument] if the generic big array
does not have exactly three dimensions. *)
* { 6 Re - shaping big arrays }
val reshape : ('a, 'b, 'c) Genarray.t -> int array -> ('a, 'b, 'c) Genarray.t
* [ reshape b [ |d1; ... ;dN| ] ] converts the big array [ b ] to a
[ N]-dimensional array of dimensions [ d1] ... [dN ] . The returned
array and the original array [ b ] share their data
and have the same layout . For instance , assuming that [ b ]
is a one - dimensional array of dimension 12 , [ reshape b [ |3;4| ] ]
returns a two - dimensional array [ b ' ] of dimensions 3 and 4 .
If [ b ] has C layout , the element [ ( x , y ) ] of [ b ' ] corresponds
to the element [ x * 3 + y ] of [ b ] . If [ b ] has Fortran layout ,
the element [ ( x , y ) ] of [ b ' ] corresponds to the element
[ x + ( y - 1 ) * 4 ] of [ b ] .
The returned big array must have exactly the same number of
elements as the original big array [ b ] . That is , the product
of the dimensions of [ b ] must be equal to [ i1 * ... * iN ] .
Otherwise , [ Invalid_argument ] is raised .
[N]-dimensional array of dimensions [d1]...[dN]. The returned
array and the original array [b] share their data
and have the same layout. For instance, assuming that [b]
is a one-dimensional array of dimension 12, [reshape b [|3;4|]]
returns a two-dimensional array [b'] of dimensions 3 and 4.
If [b] has C layout, the element [(x,y)] of [b'] corresponds
to the element [x * 3 + y] of [b]. If [b] has Fortran layout,
the element [(x,y)] of [b'] corresponds to the element
[x + (y - 1) * 4] of [b].
The returned big array must have exactly the same number of
elements as the original big array [b]. That is, the product
of the dimensions of [b] must be equal to [i1 * ... * iN].
Otherwise, [Invalid_argument] is raised. *)
val reshape_1 : ('a, 'b, 'c) Genarray.t -> int -> ('a, 'b, 'c) Array1.t
* Specialized version of { ! Bigarray.reshape } for reshaping to
one - dimensional arrays .
one-dimensional arrays. *)
val reshape_2 : ('a, 'b, 'c) Genarray.t -> int -> int -> ('a, 'b, 'c) Array2.t
* Specialized version of { ! Bigarray.reshape } for reshaping to
two - dimensional arrays .
two-dimensional arrays. *)
val reshape_3 :
('a, 'b, 'c) Genarray.t -> int -> int -> int -> ('a, 'b, 'c) Array3.t
* Specialized version of { ! Bigarray.reshape } for reshaping to
three - dimensional arrays .
three-dimensional arrays. *)
|
43c58b343f8cdd3945dfa3221f12a8bb6e41e7722803d0d98af558497d5c7027 | mojombo/ernie | ernie_server.erl | -module(ernie_server).
-behaviour(gen_server).
-include_lib("ernie.hrl").
%% api
-export([start_link/1, start/1, process/1, enqueue_request/1, kick/0, fin/0]).
%% gen_server callbacks
-export([init/1, handle_call/3, handle_cast/2, handle_info/2,
terminate/2, code_change/3]).
%%====================================================================
%% API
%%====================================================================
start_link(Args) ->
gen_server:start_link({local, ?MODULE}, ?MODULE, Args, []).
start(Args) ->
gen_server:start({local, ?MODULE}, ?MODULE, Args, []).
process(Sock) ->
gen_server:cast(?MODULE, {process, Sock}).
enqueue_request(Request) ->
gen_server:call(?MODULE, {enqueue_request, Request}).
kick() ->
gen_server:cast(?MODULE, kick).
fin() ->
gen_server:cast(?MODULE, fin).
%%====================================================================
%% gen_server callbacks
%%====================================================================
%%--------------------------------------------------------------------
%% Function: init(Args) -> {ok, State} |
{ ok , State , Timeout } |
%% ignore |
%% {stop, Reason}
%% Description: Initiates the server
%%--------------------------------------------------------------------
init([Port, Configs]) ->
process_flag(trap_exit, true),
error_logger:info_msg("~p starting~n", [?MODULE]),
{ok, LSock} = try_listen(Port, 500),
spawn(fun() -> loop(LSock) end),
Map = init_map(Configs),
io:format("pidmap = ~p~n", [Map]),
{ok, #state{lsock = LSock, map = Map}}.
%%--------------------------------------------------------------------
Function : % % handle_call(Request , From , State ) - > { reply , Reply , State } |
{ reply , Reply , State , Timeout } |
{ noreply , State } |
{ noreply , State , Timeout } |
%% {stop, Reason, Reply, State} |
%% {stop, Reason, State}
%% Description: Handling call messages
%%--------------------------------------------------------------------
handle_call({enqueue_request, Request}, _From, State) ->
case Request#request.priority of
high ->
Hq2 = queue:in(Request, State#state.hq),
Lq2 = State#state.lq;
low ->
Hq2 = State#state.hq,
Lq2 = queue:in(Request, State#state.lq)
end,
{reply, ok, State#state{hq = Hq2, lq = Lq2}};
handle_call(_Request, _From, State) ->
{reply, ok, State}.
%%--------------------------------------------------------------------
Function : handle_cast(Msg , State ) - > { noreply , State } |
{ noreply , State , Timeout } |
%% {stop, Reason, State}
%% Description: Handling cast messages
%%--------------------------------------------------------------------
handle_cast({process, Sock}, State) ->
Log = #log{hq = queue:len(State#state.hq),
lq = queue:len(State#state.lq),
taccept = erlang:now()},
Request = #request{sock = Sock, log = Log},
spawn(fun() -> receive_term(Request, State) end),
logger:debug("Spawned receiver~n", []),
{noreply, State};
handle_cast(kick, State) ->
case queue:out(State#state.hq) of
{{value, Request}, Hq2} ->
State2 = process_request(Request, hq, Hq2, State),
{noreply, State2};
{empty, _Hq} ->
case queue:out(State#state.lq) of
{{value, Request}, Lq2} ->
State2 = process_request(Request, lq, Lq2, State),
{noreply, State2};
{empty, _Lq} ->
{noreply, State}
end
end;
handle_cast(fin, State) ->
Listen = State#state.listen,
Count = State#state.count,
ZCount = State#state.zcount + 1,
logger:debug("Fin; Listen = ~p (~p/~p)~n", [Listen, Count, ZCount]),
case Listen =:= false andalso ZCount =:= Count of
true -> halt();
false -> {noreply, State#state{zcount = ZCount}}
end;
handle_cast(_Msg, State) -> {noreply, State}.
handle_info(Msg, State) ->
error_logger:error_msg("Unexpected message: ~p~n", [Msg]),
{noreply, State}.
terminate(_Reason, _State) -> ok.
code_change(_OldVersion, State, _Extra) -> {ok, State}.
%%====================================================================
Internal
%%====================================================================
%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
% Module mapping
init_map(Configs) ->
lists:map((fun extract_mapping/1), Configs).
extract_mapping(Config) ->
Id = proplists:get_value(id, Config),
Mod = proplists:get_value(module, Config),
{Mod, Id}.
%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
% Listen and loop
try_listen(Port, 0) ->
error_logger:error_msg("Could not listen on port ~p~n", [Port]),
{error, "Could not listen on port"};
try_listen(Port, Times) ->
Res = gen_tcp:listen(Port, [binary, {packet, 4}, {active, false}, {reuseaddr, true}, {backlog, 128}]),
case Res of
{ok, LSock} ->
error_logger:info_msg("Listening on port ~p~n", [Port]),
% gen_tcp:controlling_process(LSock, ernie_server),
{ok, LSock};
{error, Reason} ->
error_logger:info_msg("Could not listen on port ~p: ~p~n", [Port, Reason]),
timer:sleep(5000),
try_listen(Port, Times - 1)
end.
loop(LSock) ->
case gen_tcp:accept(LSock) of
{error, closed} ->
logger:debug("Listen socket closed~n", []),
timer:sleep(infinity);
{error, Error} ->
logger:debug("Connection accept error: ~p~n", [Error]),
loop(LSock);
{ok, Sock} ->
logger:debug("Accepted socket: ~p~n", [Sock]),
ernie_server:process(Sock),
loop(LSock)
end.
%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
% Receive and process
receive_term(Request, State) ->
Sock = Request#request.sock,
case gen_tcp:recv(Sock, 0) of
{ok, BinaryTerm} ->
logger:debug("Got binary term: ~p~n", [BinaryTerm]),
Term = binary_to_term(BinaryTerm),
logger:info("Got term: ~p~n", [Term]),
case Term of
{call, '__admin__', Fun, Args} ->
ernie_admin:process(Sock, Fun, Args, State);
{info, Command, Args} ->
Infos = Request#request.infos,
Infos2 = [BinaryTerm | Infos],
Request2 = Request#request{infos = Infos2},
Request3 = process_info(Request2, Command, Args),
receive_term(Request3, State);
_Any ->
Request2 = Request#request{action = BinaryTerm},
close_if_cast(Term, Request2),
ernie_server:enqueue_request(Request2),
ernie_server:kick()
end;
{error, closed} ->
ok = gen_tcp:close(Sock)
end.
process_info(Request, priority, [Priority]) ->
Request#request{priority = Priority};
process_info(Request, _Command, _Args) ->
Request.
process_request(Request, Priority, Q2, State) ->
ActionTerm = bert:decode(Request#request.action),
{_Type, Mod, _Fun, _Args} = ActionTerm,
Specs = lists:filter(fun({X, _Id}) -> Mod =:= X end, State#state.map),
case Specs of
[] -> no_module(Mod, Request, Priority, Q2, State);
_Else -> process_module(ActionTerm, Specs, Request, Priority, Q2, State)
end.
no_module(Mod, Request, Priority, Q2, State) ->
logger:debug("No such module ~p~n", [Mod]),
Sock = Request#request.sock,
Class = <<"ServerError">>,
Message = list_to_binary(io_lib:format("No such module '~p'", [Mod])),
gen_tcp:send(Sock, term_to_binary({error, [server, 0, Class, Message, []]})),
ok = gen_tcp:close(Sock),
finish(Priority, Q2, State).
process_module(ActionTerm, [], Request, Priority, Q2, State) ->
{_Type, Mod, Fun, _Args} = ActionTerm,
logger:debug("No such function ~p:~p~n", [Mod, Fun]),
Sock = Request#request.sock,
Class = <<"ServerError">>,
Message = list_to_binary(io_lib:format("No such function '~p:~p'", [Mod, Fun])),
gen_tcp:send(Sock, term_to_binary({error, [server, 0, Class, Message, []]})),
ok = gen_tcp:close(Sock),
finish(Priority, Q2, State);
process_module(ActionTerm, Specs, Request, Priority, Q2, State) ->
[{_Mod, Id} | OtherSpecs] = Specs,
case Id of
native ->
logger:debug("Dispatching to native module~n", []),
{_Type, Mod, Fun, Args} = ActionTerm,
case erlang:function_exported(Mod, Fun, length(Args)) of
false ->
logger:debug("Not found in native module ~p~n", [Mod]),
process_module(ActionTerm, OtherSpecs, Request, Priority, Q2, State);
true ->
PredFun = list_to_atom(atom_to_list(Fun) ++ "_pred"),
logger:debug("Checking ~p:~p(~p) for selection.~n", [Mod, PredFun, Args]),
case erlang:function_exported(Mod, PredFun, length(Args)) of
false ->
logger:debug("No such predicate function ~p:~p(~p).~n", [Mod, PredFun, Args]),
process_native_request(ActionTerm, Request, Priority, Q2, State);
true ->
case apply(Mod, PredFun, Args) of
false ->
logger:debug("Predicate ~p:~p(~p) returned false.~n", [Mod, PredFun, Args]),
process_module(ActionTerm, OtherSpecs, Request, Priority, Q2, State);
true ->
logger:debug("Predicate ~p:~p(~p) returned true.~n", [Mod, PredFun, Args]),
process_native_request(ActionTerm, Request, Priority, Q2, State)
end
end
end;
ValidPid when is_pid(ValidPid) ->
logger:debug("Found external pid ~p~n", [ValidPid]),
process_external_request(ValidPid, Request, Priority, Q2, State)
end.
close_if_cast(ActionTerm, Request) ->
case ActionTerm of
{cast, _Mod, _Fun, _Args} ->
Sock = Request#request.sock,
gen_tcp:send(Sock, term_to_binary({noreply})),
ok = gen_tcp:close(Sock),
logger:debug("Closed cast.~n", []);
_Any ->
ok
end.
finish(Priority, Q2, State) ->
case Priority of
hq -> State#state{hq = Q2};
lq -> State#state{lq = Q2}
end.
%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
Native
process_native_request(ActionTerm, Request, Priority, Q2, State) ->
Count = State#state.count,
State2 = State#state{count = Count + 1},
logger:debug("Count = ~p~n", [Count + 1]),
Log = Request#request.log,
Log2 = Log#log{type = native, tprocess = erlang:now()},
Request2 = Request#request{log = Log2},
spawn(fun() -> ernie_native:process(ActionTerm, Request2) end),
finish(Priority, Q2, State2).
%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
% External
process_external_request(Pid, Request, Priority, Q2, State) ->
Count = State#state.count,
State2 = State#state{count = Count + 1},
logger:debug("Count = ~p~n", [Count + 1]),
case asset_pool:lease(Pid) of
{ok, Asset} ->
logger:debug("Leased asset for pool ~p~n", [Pid]),
Log = Request#request.log,
Log2 = Log#log{type = external, tprocess = erlang:now()},
Request2 = Request#request{log = Log2},
spawn(fun() -> process_now(Pid, Request2, Asset) end),
finish(Priority, Q2, State2);
empty ->
State
end.
process_now(Pid, Request, Asset) ->
try unsafe_process_now(Request, Asset) of
_AnyResponse ->
Log = Request#request.log,
Log2 = Log#log{tdone = erlang:now()},
Request2 = Request#request{log = Log2},
ernie_access_logger:acc(Request2)
catch
AnyClass:AnyError ->
Log = Request#request.log,
Log2 = Log#log{tdone = erlang:now()},
Request2 = Request#request{log = Log2},
ernie_access_logger:err(Request2, "External process error ~w: ~w", [AnyClass, AnyError])
after
asset_pool:return(Pid, Asset),
ernie_server:fin(),
ernie_server:kick(),
logger:debug("Returned asset ~p~n", [Asset]),
gen_tcp:close(Request#request.sock),
logger:debug("Closed socket ~p~n", [Request#request.sock])
end.
unsafe_process_now(Request, Asset) ->
BinaryTerm = Request#request.action,
Term = binary_to_term(BinaryTerm),
case Term of
{call, Mod, Fun, Args} ->
logger:debug("Calling ~p:~p(~p)~n", [Mod, Fun, Args]),
Sock = Request#request.sock,
{asset, Port, Token} = Asset,
logger:debug("Asset: ~p ~p~n", [Port, Token]),
{ok, Data} = port_wrapper:rpc(Port, BinaryTerm),
ok = gen_tcp:send(Sock, Data);
{cast, Mod, Fun, Args} ->
logger:debug("Casting ~p:~p(~p)~n", [Mod, Fun, Args]),
{asset, Port, Token} = Asset,
logger:debug("Asset: ~p ~p~n", [Port, Token]),
{ok, _Data} = port_wrapper:rpc(Port, BinaryTerm)
end. | null | https://raw.githubusercontent.com/mojombo/ernie/a21664e668038291bdbe42684d46cb112242aa7b/elib/ernie_server.erl | erlang | api
gen_server callbacks
====================================================================
API
====================================================================
====================================================================
gen_server callbacks
====================================================================
--------------------------------------------------------------------
Function: init(Args) -> {ok, State} |
ignore |
{stop, Reason}
Description: Initiates the server
--------------------------------------------------------------------
--------------------------------------------------------------------
% handle_call(Request , From , State ) - > { reply , Reply , State } |
{stop, Reason, Reply, State} |
{stop, Reason, State}
Description: Handling call messages
--------------------------------------------------------------------
--------------------------------------------------------------------
{stop, Reason, State}
Description: Handling cast messages
--------------------------------------------------------------------
====================================================================
====================================================================
Module mapping
Listen and loop
gen_tcp:controlling_process(LSock, ernie_server),
Receive and process
External | -module(ernie_server).
-behaviour(gen_server).
-include_lib("ernie.hrl").
-export([start_link/1, start/1, process/1, enqueue_request/1, kick/0, fin/0]).
-export([init/1, handle_call/3, handle_cast/2, handle_info/2,
terminate/2, code_change/3]).
start_link(Args) ->
gen_server:start_link({local, ?MODULE}, ?MODULE, Args, []).
start(Args) ->
gen_server:start({local, ?MODULE}, ?MODULE, Args, []).
process(Sock) ->
gen_server:cast(?MODULE, {process, Sock}).
enqueue_request(Request) ->
gen_server:call(?MODULE, {enqueue_request, Request}).
kick() ->
gen_server:cast(?MODULE, kick).
fin() ->
gen_server:cast(?MODULE, fin).
{ ok , State , Timeout } |
init([Port, Configs]) ->
process_flag(trap_exit, true),
error_logger:info_msg("~p starting~n", [?MODULE]),
{ok, LSock} = try_listen(Port, 500),
spawn(fun() -> loop(LSock) end),
Map = init_map(Configs),
io:format("pidmap = ~p~n", [Map]),
{ok, #state{lsock = LSock, map = Map}}.
{ reply , Reply , State , Timeout } |
{ noreply , State } |
{ noreply , State , Timeout } |
handle_call({enqueue_request, Request}, _From, State) ->
case Request#request.priority of
high ->
Hq2 = queue:in(Request, State#state.hq),
Lq2 = State#state.lq;
low ->
Hq2 = State#state.hq,
Lq2 = queue:in(Request, State#state.lq)
end,
{reply, ok, State#state{hq = Hq2, lq = Lq2}};
handle_call(_Request, _From, State) ->
{reply, ok, State}.
Function : handle_cast(Msg , State ) - > { noreply , State } |
{ noreply , State , Timeout } |
handle_cast({process, Sock}, State) ->
Log = #log{hq = queue:len(State#state.hq),
lq = queue:len(State#state.lq),
taccept = erlang:now()},
Request = #request{sock = Sock, log = Log},
spawn(fun() -> receive_term(Request, State) end),
logger:debug("Spawned receiver~n", []),
{noreply, State};
handle_cast(kick, State) ->
case queue:out(State#state.hq) of
{{value, Request}, Hq2} ->
State2 = process_request(Request, hq, Hq2, State),
{noreply, State2};
{empty, _Hq} ->
case queue:out(State#state.lq) of
{{value, Request}, Lq2} ->
State2 = process_request(Request, lq, Lq2, State),
{noreply, State2};
{empty, _Lq} ->
{noreply, State}
end
end;
handle_cast(fin, State) ->
Listen = State#state.listen,
Count = State#state.count,
ZCount = State#state.zcount + 1,
logger:debug("Fin; Listen = ~p (~p/~p)~n", [Listen, Count, ZCount]),
case Listen =:= false andalso ZCount =:= Count of
true -> halt();
false -> {noreply, State#state{zcount = ZCount}}
end;
handle_cast(_Msg, State) -> {noreply, State}.
handle_info(Msg, State) ->
error_logger:error_msg("Unexpected message: ~p~n", [Msg]),
{noreply, State}.
terminate(_Reason, _State) -> ok.
code_change(_OldVersion, State, _Extra) -> {ok, State}.
Internal
init_map(Configs) ->
lists:map((fun extract_mapping/1), Configs).
extract_mapping(Config) ->
Id = proplists:get_value(id, Config),
Mod = proplists:get_value(module, Config),
{Mod, Id}.
try_listen(Port, 0) ->
error_logger:error_msg("Could not listen on port ~p~n", [Port]),
{error, "Could not listen on port"};
try_listen(Port, Times) ->
Res = gen_tcp:listen(Port, [binary, {packet, 4}, {active, false}, {reuseaddr, true}, {backlog, 128}]),
case Res of
{ok, LSock} ->
error_logger:info_msg("Listening on port ~p~n", [Port]),
{ok, LSock};
{error, Reason} ->
error_logger:info_msg("Could not listen on port ~p: ~p~n", [Port, Reason]),
timer:sleep(5000),
try_listen(Port, Times - 1)
end.
loop(LSock) ->
case gen_tcp:accept(LSock) of
{error, closed} ->
logger:debug("Listen socket closed~n", []),
timer:sleep(infinity);
{error, Error} ->
logger:debug("Connection accept error: ~p~n", [Error]),
loop(LSock);
{ok, Sock} ->
logger:debug("Accepted socket: ~p~n", [Sock]),
ernie_server:process(Sock),
loop(LSock)
end.
receive_term(Request, State) ->
Sock = Request#request.sock,
case gen_tcp:recv(Sock, 0) of
{ok, BinaryTerm} ->
logger:debug("Got binary term: ~p~n", [BinaryTerm]),
Term = binary_to_term(BinaryTerm),
logger:info("Got term: ~p~n", [Term]),
case Term of
{call, '__admin__', Fun, Args} ->
ernie_admin:process(Sock, Fun, Args, State);
{info, Command, Args} ->
Infos = Request#request.infos,
Infos2 = [BinaryTerm | Infos],
Request2 = Request#request{infos = Infos2},
Request3 = process_info(Request2, Command, Args),
receive_term(Request3, State);
_Any ->
Request2 = Request#request{action = BinaryTerm},
close_if_cast(Term, Request2),
ernie_server:enqueue_request(Request2),
ernie_server:kick()
end;
{error, closed} ->
ok = gen_tcp:close(Sock)
end.
process_info(Request, priority, [Priority]) ->
Request#request{priority = Priority};
process_info(Request, _Command, _Args) ->
Request.
process_request(Request, Priority, Q2, State) ->
ActionTerm = bert:decode(Request#request.action),
{_Type, Mod, _Fun, _Args} = ActionTerm,
Specs = lists:filter(fun({X, _Id}) -> Mod =:= X end, State#state.map),
case Specs of
[] -> no_module(Mod, Request, Priority, Q2, State);
_Else -> process_module(ActionTerm, Specs, Request, Priority, Q2, State)
end.
no_module(Mod, Request, Priority, Q2, State) ->
logger:debug("No such module ~p~n", [Mod]),
Sock = Request#request.sock,
Class = <<"ServerError">>,
Message = list_to_binary(io_lib:format("No such module '~p'", [Mod])),
gen_tcp:send(Sock, term_to_binary({error, [server, 0, Class, Message, []]})),
ok = gen_tcp:close(Sock),
finish(Priority, Q2, State).
process_module(ActionTerm, [], Request, Priority, Q2, State) ->
{_Type, Mod, Fun, _Args} = ActionTerm,
logger:debug("No such function ~p:~p~n", [Mod, Fun]),
Sock = Request#request.sock,
Class = <<"ServerError">>,
Message = list_to_binary(io_lib:format("No such function '~p:~p'", [Mod, Fun])),
gen_tcp:send(Sock, term_to_binary({error, [server, 0, Class, Message, []]})),
ok = gen_tcp:close(Sock),
finish(Priority, Q2, State);
process_module(ActionTerm, Specs, Request, Priority, Q2, State) ->
[{_Mod, Id} | OtherSpecs] = Specs,
case Id of
native ->
logger:debug("Dispatching to native module~n", []),
{_Type, Mod, Fun, Args} = ActionTerm,
case erlang:function_exported(Mod, Fun, length(Args)) of
false ->
logger:debug("Not found in native module ~p~n", [Mod]),
process_module(ActionTerm, OtherSpecs, Request, Priority, Q2, State);
true ->
PredFun = list_to_atom(atom_to_list(Fun) ++ "_pred"),
logger:debug("Checking ~p:~p(~p) for selection.~n", [Mod, PredFun, Args]),
case erlang:function_exported(Mod, PredFun, length(Args)) of
false ->
logger:debug("No such predicate function ~p:~p(~p).~n", [Mod, PredFun, Args]),
process_native_request(ActionTerm, Request, Priority, Q2, State);
true ->
case apply(Mod, PredFun, Args) of
false ->
logger:debug("Predicate ~p:~p(~p) returned false.~n", [Mod, PredFun, Args]),
process_module(ActionTerm, OtherSpecs, Request, Priority, Q2, State);
true ->
logger:debug("Predicate ~p:~p(~p) returned true.~n", [Mod, PredFun, Args]),
process_native_request(ActionTerm, Request, Priority, Q2, State)
end
end
end;
ValidPid when is_pid(ValidPid) ->
logger:debug("Found external pid ~p~n", [ValidPid]),
process_external_request(ValidPid, Request, Priority, Q2, State)
end.
close_if_cast(ActionTerm, Request) ->
case ActionTerm of
{cast, _Mod, _Fun, _Args} ->
Sock = Request#request.sock,
gen_tcp:send(Sock, term_to_binary({noreply})),
ok = gen_tcp:close(Sock),
logger:debug("Closed cast.~n", []);
_Any ->
ok
end.
finish(Priority, Q2, State) ->
case Priority of
hq -> State#state{hq = Q2};
lq -> State#state{lq = Q2}
end.
Native
process_native_request(ActionTerm, Request, Priority, Q2, State) ->
Count = State#state.count,
State2 = State#state{count = Count + 1},
logger:debug("Count = ~p~n", [Count + 1]),
Log = Request#request.log,
Log2 = Log#log{type = native, tprocess = erlang:now()},
Request2 = Request#request{log = Log2},
spawn(fun() -> ernie_native:process(ActionTerm, Request2) end),
finish(Priority, Q2, State2).
process_external_request(Pid, Request, Priority, Q2, State) ->
Count = State#state.count,
State2 = State#state{count = Count + 1},
logger:debug("Count = ~p~n", [Count + 1]),
case asset_pool:lease(Pid) of
{ok, Asset} ->
logger:debug("Leased asset for pool ~p~n", [Pid]),
Log = Request#request.log,
Log2 = Log#log{type = external, tprocess = erlang:now()},
Request2 = Request#request{log = Log2},
spawn(fun() -> process_now(Pid, Request2, Asset) end),
finish(Priority, Q2, State2);
empty ->
State
end.
process_now(Pid, Request, Asset) ->
try unsafe_process_now(Request, Asset) of
_AnyResponse ->
Log = Request#request.log,
Log2 = Log#log{tdone = erlang:now()},
Request2 = Request#request{log = Log2},
ernie_access_logger:acc(Request2)
catch
AnyClass:AnyError ->
Log = Request#request.log,
Log2 = Log#log{tdone = erlang:now()},
Request2 = Request#request{log = Log2},
ernie_access_logger:err(Request2, "External process error ~w: ~w", [AnyClass, AnyError])
after
asset_pool:return(Pid, Asset),
ernie_server:fin(),
ernie_server:kick(),
logger:debug("Returned asset ~p~n", [Asset]),
gen_tcp:close(Request#request.sock),
logger:debug("Closed socket ~p~n", [Request#request.sock])
end.
unsafe_process_now(Request, Asset) ->
BinaryTerm = Request#request.action,
Term = binary_to_term(BinaryTerm),
case Term of
{call, Mod, Fun, Args} ->
logger:debug("Calling ~p:~p(~p)~n", [Mod, Fun, Args]),
Sock = Request#request.sock,
{asset, Port, Token} = Asset,
logger:debug("Asset: ~p ~p~n", [Port, Token]),
{ok, Data} = port_wrapper:rpc(Port, BinaryTerm),
ok = gen_tcp:send(Sock, Data);
{cast, Mod, Fun, Args} ->
logger:debug("Casting ~p:~p(~p)~n", [Mod, Fun, Args]),
{asset, Port, Token} = Asset,
logger:debug("Asset: ~p ~p~n", [Port, Token]),
{ok, _Data} = port_wrapper:rpc(Port, BinaryTerm)
end. |
4ce09ad2fc362c450eee0f2ee509ccb27725893be807cd066af896af51f75479 | degree9/uikit-hl | background.cljs | (ns uikit-hl.background
(:require [hoplon.core :as h]))
(defn- format-background [background]
(str "uk-background-" background))
(defmethod h/do! ::default
[elem kw v]
(h/do! elem :class {(format-background (name kw)) v}))
| null | https://raw.githubusercontent.com/degree9/uikit-hl/b226b1429ea50f8e9a6c1d12c082a3be504dda33/src/uikit_hl/background.cljs | clojure | (ns uikit-hl.background
(:require [hoplon.core :as h]))
(defn- format-background [background]
(str "uk-background-" background))
(defmethod h/do! ::default
[elem kw v]
(h/do! elem :class {(format-background (name kw)) v}))
| |
0377187a6be46f6ddd623e881c42f3cb25213744c8730300062c1edf158a04b0 | FranklinChen/learn-you-some-erlang | multiproc_tests.erl | -module(multiproc_tests).
-include_lib("eunit/include/eunit.hrl").
%% sleep's implementation is copy/pasted from the timer module.
%% not much to test to be safe.
sleep_test_() ->
[?_assertEqual(ok, multiproc:sleep(10))].
flush_test_() ->
{spawn,
[fun() ->
self() ! a,
self() ! b,
ok = multiproc:flush(),
self() ! c,
[?assertEqual(receive M -> M end, c)]
end]}.
priority_test_() ->
{spawn,
[fun() ->
self() ! {15, high},
self() ! {7, low},
self() ! {1, low},
self() ! {17, high},
[?assertEqual([high, high, low, low],
multiproc:important())]
end]}.
| null | https://raw.githubusercontent.com/FranklinChen/learn-you-some-erlang/878c8bc2011a12862fe72dd7fdc6c921348c79d6/tests/multiproc_tests.erl | erlang | sleep's implementation is copy/pasted from the timer module.
not much to test to be safe. | -module(multiproc_tests).
-include_lib("eunit/include/eunit.hrl").
sleep_test_() ->
[?_assertEqual(ok, multiproc:sleep(10))].
flush_test_() ->
{spawn,
[fun() ->
self() ! a,
self() ! b,
ok = multiproc:flush(),
self() ! c,
[?assertEqual(receive M -> M end, c)]
end]}.
priority_test_() ->
{spawn,
[fun() ->
self() ! {15, high},
self() ! {7, low},
self() ! {1, low},
self() ! {17, high},
[?assertEqual([high, high, low, low],
multiproc:important())]
end]}.
|
edbfd43a7e0f12ec46fadc4c5de725ee553bcba5aec7c73abb547c3747cfa45e | mhwombat/grid | Hexagonal.hs | ------------------------------------------------------------------------
-- |
Module : Math . Geometry . HexGrid
Copyright : ( c ) 2012 - 2022
-- License : BSD-style
-- Maintainer :
-- Stability : experimental
-- Portability : portable
--
-- A regular arrangement of hexagonal tiles.
-- The userguide, with illustrations, is available at
-- <>.
-- Also see @Math.Geometry.Grid@ for examples of how to use this class.
--
------------------------------------------------------------------------
# LANGUAGE FlexibleInstances #
# LANGUAGE MultiParamTypeClasses #
module Math.Geometry.Grid.Hexagonal
(
-- * Unbounded grid with hexagonal tiles
UnboundedHexGrid(..),
-- * Hexagonal grid with hexagonal tiles
HexHexGrid(..),
hexHexGrid,
-- * Parallelogram-shaped grid with hexagonal tiles
ParaHexGrid(..),
paraHexGrid
) where
import Math.Geometry.Grid.HexagonalInternal
| null | https://raw.githubusercontent.com/mhwombat/grid/b8c4a928733494f4a410127d6ae007857de921f9/src/Math/Geometry/Grid/Hexagonal.hs | haskell | ----------------------------------------------------------------------
|
License : BSD-style
Maintainer :
Stability : experimental
Portability : portable
A regular arrangement of hexagonal tiles.
The userguide, with illustrations, is available at
<>.
Also see @Math.Geometry.Grid@ for examples of how to use this class.
----------------------------------------------------------------------
* Unbounded grid with hexagonal tiles
* Hexagonal grid with hexagonal tiles
* Parallelogram-shaped grid with hexagonal tiles | Module : Math . Geometry . HexGrid
Copyright : ( c ) 2012 - 2022
# LANGUAGE FlexibleInstances #
# LANGUAGE MultiParamTypeClasses #
module Math.Geometry.Grid.Hexagonal
(
UnboundedHexGrid(..),
HexHexGrid(..),
hexHexGrid,
ParaHexGrid(..),
paraHexGrid
) where
import Math.Geometry.Grid.HexagonalInternal
|
4050e552e643a35cd9cfbaff2456febc360bb3246f8fdcb2d2ea0bf59a82a9d1 | sadiqj/ocaml-esp32 | untypeast.mli | (**************************************************************************)
(* *)
(* OCaml *)
(* *)
( OCamlPro ) , ( INRIA Saclay )
(* *)
Copyright 2007 Institut National de Recherche en Informatique et
(* en Automatique. *)
(* *)
(* All rights reserved. This file is distributed under the terms of *)
the GNU Lesser General Public License version 2.1 , with the
(* special exception on linking described in the file LICENSE. *)
(* *)
(**************************************************************************)
open Parsetree
val lident_of_path : Path.t -> Longident.t
type mapper = {
attribute: mapper -> Typedtree.attribute -> attribute;
attributes: mapper -> Typedtree.attribute list -> attribute list;
case: mapper -> Typedtree.case -> case;
cases: mapper -> Typedtree.case list -> case list;
class_declaration: mapper -> Typedtree.class_declaration -> class_declaration;
class_description: mapper -> Typedtree.class_description -> class_description;
class_expr: mapper -> Typedtree.class_expr -> class_expr;
class_field: mapper -> Typedtree.class_field -> class_field;
class_signature: mapper -> Typedtree.class_signature -> class_signature;
class_structure: mapper -> Typedtree.class_structure -> class_structure;
class_type: mapper -> Typedtree.class_type -> class_type;
class_type_declaration: mapper -> Typedtree.class_type_declaration
-> class_type_declaration;
class_type_field: mapper -> Typedtree.class_type_field -> class_type_field;
constructor_declaration: mapper -> Typedtree.constructor_declaration
-> constructor_declaration;
expr: mapper -> Typedtree.expression -> expression;
extension_constructor: mapper -> Typedtree.extension_constructor
-> extension_constructor;
include_declaration:
mapper -> Typedtree.include_declaration -> include_declaration;
include_description:
mapper -> Typedtree.include_description -> include_description;
label_declaration:
mapper -> Typedtree.label_declaration -> label_declaration;
location: mapper -> Location.t -> Location.t;
module_binding: mapper -> Typedtree.module_binding -> module_binding;
module_declaration:
mapper -> Typedtree.module_declaration -> module_declaration;
module_expr: mapper -> Typedtree.module_expr -> module_expr;
module_type: mapper -> Typedtree.module_type -> module_type;
module_type_declaration:
mapper -> Typedtree.module_type_declaration -> module_type_declaration;
package_type: mapper -> Typedtree.package_type -> package_type;
open_description: mapper -> Typedtree.open_description -> open_description;
pat: mapper -> Typedtree.pattern -> pattern;
row_field: mapper -> Typedtree.row_field -> row_field;
object_field: mapper -> Typedtree.object_field -> object_field;
signature: mapper -> Typedtree.signature -> signature;
signature_item: mapper -> Typedtree.signature_item -> signature_item;
structure: mapper -> Typedtree.structure -> structure;
structure_item: mapper -> Typedtree.structure_item -> structure_item;
typ: mapper -> Typedtree.core_type -> core_type;
type_declaration: mapper -> Typedtree.type_declaration -> type_declaration;
type_extension: mapper -> Typedtree.type_extension -> type_extension;
type_kind: mapper -> Typedtree.type_kind -> type_kind;
value_binding: mapper -> Typedtree.value_binding -> value_binding;
value_description: mapper -> Typedtree.value_description -> value_description;
with_constraint:
mapper -> (Path.t * Longident.t Location.loc * Typedtree.with_constraint)
-> with_constraint;
}
val default_mapper : mapper
val untype_structure : ?mapper:mapper -> Typedtree.structure -> structure
val untype_signature : ?mapper:mapper -> Typedtree.signature -> signature
val constant : Asttypes.constant -> Parsetree.constant
| null | https://raw.githubusercontent.com/sadiqj/ocaml-esp32/33aad4ca2becb9701eb90d779c1b1183aefeb578/typing/untypeast.mli | ocaml | ************************************************************************
OCaml
en Automatique.
All rights reserved. This file is distributed under the terms of
special exception on linking described in the file LICENSE.
************************************************************************ | ( OCamlPro ) , ( INRIA Saclay )
Copyright 2007 Institut National de Recherche en Informatique et
the GNU Lesser General Public License version 2.1 , with the
open Parsetree
val lident_of_path : Path.t -> Longident.t
type mapper = {
attribute: mapper -> Typedtree.attribute -> attribute;
attributes: mapper -> Typedtree.attribute list -> attribute list;
case: mapper -> Typedtree.case -> case;
cases: mapper -> Typedtree.case list -> case list;
class_declaration: mapper -> Typedtree.class_declaration -> class_declaration;
class_description: mapper -> Typedtree.class_description -> class_description;
class_expr: mapper -> Typedtree.class_expr -> class_expr;
class_field: mapper -> Typedtree.class_field -> class_field;
class_signature: mapper -> Typedtree.class_signature -> class_signature;
class_structure: mapper -> Typedtree.class_structure -> class_structure;
class_type: mapper -> Typedtree.class_type -> class_type;
class_type_declaration: mapper -> Typedtree.class_type_declaration
-> class_type_declaration;
class_type_field: mapper -> Typedtree.class_type_field -> class_type_field;
constructor_declaration: mapper -> Typedtree.constructor_declaration
-> constructor_declaration;
expr: mapper -> Typedtree.expression -> expression;
extension_constructor: mapper -> Typedtree.extension_constructor
-> extension_constructor;
include_declaration:
mapper -> Typedtree.include_declaration -> include_declaration;
include_description:
mapper -> Typedtree.include_description -> include_description;
label_declaration:
mapper -> Typedtree.label_declaration -> label_declaration;
location: mapper -> Location.t -> Location.t;
module_binding: mapper -> Typedtree.module_binding -> module_binding;
module_declaration:
mapper -> Typedtree.module_declaration -> module_declaration;
module_expr: mapper -> Typedtree.module_expr -> module_expr;
module_type: mapper -> Typedtree.module_type -> module_type;
module_type_declaration:
mapper -> Typedtree.module_type_declaration -> module_type_declaration;
package_type: mapper -> Typedtree.package_type -> package_type;
open_description: mapper -> Typedtree.open_description -> open_description;
pat: mapper -> Typedtree.pattern -> pattern;
row_field: mapper -> Typedtree.row_field -> row_field;
object_field: mapper -> Typedtree.object_field -> object_field;
signature: mapper -> Typedtree.signature -> signature;
signature_item: mapper -> Typedtree.signature_item -> signature_item;
structure: mapper -> Typedtree.structure -> structure;
structure_item: mapper -> Typedtree.structure_item -> structure_item;
typ: mapper -> Typedtree.core_type -> core_type;
type_declaration: mapper -> Typedtree.type_declaration -> type_declaration;
type_extension: mapper -> Typedtree.type_extension -> type_extension;
type_kind: mapper -> Typedtree.type_kind -> type_kind;
value_binding: mapper -> Typedtree.value_binding -> value_binding;
value_description: mapper -> Typedtree.value_description -> value_description;
with_constraint:
mapper -> (Path.t * Longident.t Location.loc * Typedtree.with_constraint)
-> with_constraint;
}
val default_mapper : mapper
val untype_structure : ?mapper:mapper -> Typedtree.structure -> structure
val untype_signature : ?mapper:mapper -> Typedtree.signature -> signature
val constant : Asttypes.constant -> Parsetree.constant
|
684b8f1ec4ccc89d0abb5b658dc9b2e51aa4cdf8bbb25d62edd275386bf524da | DSiSc/why3 | unix_scheduler.mli | (********************************************************************)
(* *)
The Why3 Verification Platform / The Why3 Development Team
Copyright 2010 - 2018 -- Inria - CNRS - Paris - Sud University
(* *)
(* This software is distributed under the terms of the GNU Lesser *)
General Public License version 2.1 , with the special exception
(* on linking described in file LICENSE. *)
(* *)
(********************************************************************)
module Unix_scheduler : sig
val blocking: bool
val multiplier: int
val timeout: ms:int -> (unit -> bool) -> unit
* [ timeout ~ms f ] registers the function [ f ] as a function to be
called every [ ms ] milliseconds . The function is called repeatedly
until it returns false . the [ ms ] delay is not strictly guaranteed :
it is only a minimum delay between the end of the last call and
the beginning of the next call . Several functions can be
registered at the same time .
called every [ms] milliseconds. The function is called repeatedly
until it returns false. the [ms] delay is not strictly guaranteed:
it is only a minimum delay between the end of the last call and
the beginning of the next call. Several functions can be
registered at the same time. *)
val idle: prio:int -> (unit -> bool) -> unit
* [ idle f ] registers the function [ f ] as a function to be
called whenever there is nothing else to do . Several functions can
be registered at the same time . Several functions can be
registered at the same time . Functions registered with higher
priority will be called first .
called whenever there is nothing else to do. Several functions can
be registered at the same time. Several functions can be
registered at the same time. Functions registered with higher
priority will be called first. *)
val main_loop: ?prompt:string -> (string -> 'a) -> unit
end
| null | https://raw.githubusercontent.com/DSiSc/why3/8ba9c2287224b53075adc51544bc377bc8ea5c75/src/tools/unix_scheduler.mli | ocaml | ******************************************************************
This software is distributed under the terms of the GNU Lesser
on linking described in file LICENSE.
****************************************************************** | The Why3 Verification Platform / The Why3 Development Team
Copyright 2010 - 2018 -- Inria - CNRS - Paris - Sud University
General Public License version 2.1 , with the special exception
module Unix_scheduler : sig
val blocking: bool
val multiplier: int
val timeout: ms:int -> (unit -> bool) -> unit
* [ timeout ~ms f ] registers the function [ f ] as a function to be
called every [ ms ] milliseconds . The function is called repeatedly
until it returns false . the [ ms ] delay is not strictly guaranteed :
it is only a minimum delay between the end of the last call and
the beginning of the next call . Several functions can be
registered at the same time .
called every [ms] milliseconds. The function is called repeatedly
until it returns false. the [ms] delay is not strictly guaranteed:
it is only a minimum delay between the end of the last call and
the beginning of the next call. Several functions can be
registered at the same time. *)
val idle: prio:int -> (unit -> bool) -> unit
* [ idle f ] registers the function [ f ] as a function to be
called whenever there is nothing else to do . Several functions can
be registered at the same time . Several functions can be
registered at the same time . Functions registered with higher
priority will be called first .
called whenever there is nothing else to do. Several functions can
be registered at the same time. Several functions can be
registered at the same time. Functions registered with higher
priority will be called first. *)
val main_loop: ?prompt:string -> (string -> 'a) -> unit
end
|
31801a77eff31128fc51a376e7b3ceab3d7d62c390066cdcfb925f2e422be38e | otabat/couchbase-clj | util.clj | (ns couchbase-clj.util
(:require [clojure.data.json :as json]))
(defn read-json
"Reads a JSON value from input String.
If data is nil, then nil is returned.
If data is a empty string, then empty string is returned."
[data]
(when-not (nil? data) (json/read-json data true false "")))
(def ^{:doc "Wrapper of clojure.data.json/json-str. Just for convenience."}
write-json json/json-str)
| null | https://raw.githubusercontent.com/otabat/couchbase-clj/5f975dc85d0eec554034eefa9d97f1ee7ad9e84a/src/couchbase_clj/util.clj | clojure | (ns couchbase-clj.util
(:require [clojure.data.json :as json]))
(defn read-json
"Reads a JSON value from input String.
If data is nil, then nil is returned.
If data is a empty string, then empty string is returned."
[data]
(when-not (nil? data) (json/read-json data true false "")))
(def ^{:doc "Wrapper of clojure.data.json/json-str. Just for convenience."}
write-json json/json-str)
| |
6078b9228dffb6722c2b4a50cd02635b37492104fd9923e4188a946f0e22d7f5 | levex/wacc | CallingConvention.hs | module WACC.CodeGen.ARM.CallingConvention where
import WACC.CodeGen.Types
generateCallingConvention :: [Instruction] -> [Instruction]
generateCallingConvention
= undefined
| null | https://raw.githubusercontent.com/levex/wacc/c77164f0c9aeb53d3d13a0370fdedc448b6009a3/src/WACC/CodeGen/ARM/CallingConvention.hs | haskell | module WACC.CodeGen.ARM.CallingConvention where
import WACC.CodeGen.Types
generateCallingConvention :: [Instruction] -> [Instruction]
generateCallingConvention
= undefined
| |
07e761ebdcbf1c81e4fc452ad98dbfedc9063960e052e20b2114e862f846b610 | semerdzhiev/fp-2020-21 | tasks.rkt | #lang racket
Задача 0 : Да се дефинира функция ( sum - divisors n a b ) , резултат сумата на числата в затворения интервал [ a , b ] , които са делители на n
(define (div x y) (= (remainder x y) 0))
(define (sum-divisors n a b)
(
if (> a b)
0
(+ (sum-divisors n (+ a 1) b) (if (div n a) a 0))
)
)
Задача 0 * : Да се дефинира функция ( sum - squares a b ) , резултат сумата от квадратите на числата в затворения интервал [ a , b ]
(define (sum-squares a b)
(
if (> a b)
0
(+ (* a a) (sum-squares (+ a 1) b))
)
)
Задача 1 * : Да се дефинира функция ( apply f x ) , резултат функцията f приложена x
(define (apply f x)
(f x)
)
за използване на ф - я от по - висок ред
(define (square x) (* x x))
( apply square 5 ) - прилага square на аргумент 5
Задача 1 : Да се дефинира функция ( sum - mapped f a b ) , резултат сумата на резултата на изпълнението на функцията f върху [ a , b ]
; [a, b] -> SUM(f(x)), x <- [a, b]
(define (sum-mapped f a b)
(
if (> a b)
0
(+ (f a) (sum-mapped f (+ a 1) b))
)
)
Lambda функции : ( lambda ( arg1 arg2 ... argn ) ( ф - ята > ) )
( sum - mapped square 1 5 ) < = > ( sum - mapped ( lambda ( x ) ( * x x ) ) 1 5 )
Задача 2 : Да се дефинира функция , която връща като резултат произведението на всички четни числа в интервала [ a , b ]
1 :
(define (product-mapped f a b)
(
if (> a b)
1
(* (f a) (product-mapped f (+ a 1) b))
)
)
(define (product-even a b)
(product-mapped (lambda (x) (if (div x 2) x 1)) a b)
)
2 :
(define (operation-mapped f a b operation neutral)
(
if (> a b)
neutral
(operation (f a) (operation-mapped f (+ a 1) b operation neutral))
)
)
(define (product-even-2 a b)
(operation-mapped (lambda (x) (if (div x 2) x 1)) a b * 1)
)
Задача 3 : Да се дефинира функция , която връща като резултат броя на квадрати [ a , b ]
; floor(sqrt(x))^2 == x OR floor(sqrt(x)) == sqrt(x)
(define (num-squares a b)
(operation-mapped
(lambda (x) (if (= (floor (sqrt x)) (sqrt x)) 1 0))
a b + 0)
)
Задача 4 : Да се дефинира функция , дали в интервала [ a , b ] , за което функцията f да връща # t
NB : find - elem не е много име ; (
NB2 ! : or е специална форма , дефинираме си ( lambda ( x y ) ( or x y ) ) , която го замества
(define (find-elem f a b)
(operation-mapped f a b (lambda (x y) (or x y)) #f)
)
обща форма на : ( define ( accumulate f a b op n ) )
accumulate : извиква функция ( f ) ( [ a , b ] ) и акумулира резултат посредством някаква операция ( op ) с неутрален елемент ( n )
* : Да се дефинира функция ( bind f x ) , резултат функция , изпълнението на която е същото като изпълнението на ( f x )
(define (bind f x) (lambda () (f x)))
NB : f , са функции с 1 аргумент
Задача 5 : Да се дефинира функция ( compose f g ) , резултат композицията на функциите f и g
(define (compose f g) (lambda (x) (f (g x))))
Задача 6 : Да се дефинира функция ( repeat f n ) , резултат функция , еквивалентна на прилагането пъти
; (repeat f n) <=> f ( f ( f ( f ( ... ( f x ) ... ) ) => n пъти
(define (id x) x)
(define (repeat f n)
(
if (= n 0)
id
(lambda (x) (f ((repeat f (- n 1)) x)))
)
)
| null | https://raw.githubusercontent.com/semerdzhiev/fp-2020-21/64fa00c4f940f75a28cc5980275b124ca21244bc/group-c/week02/tasks.rkt | racket | [a, b] -> SUM(f(x)), x <- [a, b]
floor(sqrt(x))^2 == x OR floor(sqrt(x)) == sqrt(x)
(
(repeat f n) <=> f ( f ( f ( f ( ... ( f x ) ... ) ) => n пъти | #lang racket
Задача 0 : Да се дефинира функция ( sum - divisors n a b ) , резултат сумата на числата в затворения интервал [ a , b ] , които са делители на n
(define (div x y) (= (remainder x y) 0))
(define (sum-divisors n a b)
(
if (> a b)
0
(+ (sum-divisors n (+ a 1) b) (if (div n a) a 0))
)
)
Задача 0 * : Да се дефинира функция ( sum - squares a b ) , резултат сумата от квадратите на числата в затворения интервал [ a , b ]
(define (sum-squares a b)
(
if (> a b)
0
(+ (* a a) (sum-squares (+ a 1) b))
)
)
Задача 1 * : Да се дефинира функция ( apply f x ) , резултат функцията f приложена x
(define (apply f x)
(f x)
)
за използване на ф - я от по - висок ред
(define (square x) (* x x))
( apply square 5 ) - прилага square на аргумент 5
Задача 1 : Да се дефинира функция ( sum - mapped f a b ) , резултат сумата на резултата на изпълнението на функцията f върху [ a , b ]
(define (sum-mapped f a b)
(
if (> a b)
0
(+ (f a) (sum-mapped f (+ a 1) b))
)
)
Lambda функции : ( lambda ( arg1 arg2 ... argn ) ( ф - ята > ) )
( sum - mapped square 1 5 ) < = > ( sum - mapped ( lambda ( x ) ( * x x ) ) 1 5 )
Задача 2 : Да се дефинира функция , която връща като резултат произведението на всички четни числа в интервала [ a , b ]
1 :
(define (product-mapped f a b)
(
if (> a b)
1
(* (f a) (product-mapped f (+ a 1) b))
)
)
(define (product-even a b)
(product-mapped (lambda (x) (if (div x 2) x 1)) a b)
)
2 :
(define (operation-mapped f a b operation neutral)
(
if (> a b)
neutral
(operation (f a) (operation-mapped f (+ a 1) b operation neutral))
)
)
(define (product-even-2 a b)
(operation-mapped (lambda (x) (if (div x 2) x 1)) a b * 1)
)
Задача 3 : Да се дефинира функция , която връща като резултат броя на квадрати [ a , b ]
(define (num-squares a b)
(operation-mapped
(lambda (x) (if (= (floor (sqrt x)) (sqrt x)) 1 0))
a b + 0)
)
Задача 4 : Да се дефинира функция , дали в интервала [ a , b ] , за което функцията f да връща # t
NB2 ! : or е специална форма , дефинираме си ( lambda ( x y ) ( or x y ) ) , която го замества
(define (find-elem f a b)
(operation-mapped f a b (lambda (x y) (or x y)) #f)
)
обща форма на : ( define ( accumulate f a b op n ) )
accumulate : извиква функция ( f ) ( [ a , b ] ) и акумулира резултат посредством някаква операция ( op ) с неутрален елемент ( n )
* : Да се дефинира функция ( bind f x ) , резултат функция , изпълнението на която е същото като изпълнението на ( f x )
(define (bind f x) (lambda () (f x)))
NB : f , са функции с 1 аргумент
Задача 5 : Да се дефинира функция ( compose f g ) , резултат композицията на функциите f и g
(define (compose f g) (lambda (x) (f (g x))))
Задача 6 : Да се дефинира функция ( repeat f n ) , резултат функция , еквивалентна на прилагането пъти
(define (id x) x)
(define (repeat f n)
(
if (= n 0)
id
(lambda (x) (f ((repeat f (- n 1)) x)))
)
)
|
76e4373f7d6c7d092d44db9dc21241a01e798ed79e4dd151a82fa6c2fe75e332 | russmatney/ralphie | doctor.clj | (ns ralphie.doctor)
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;; Doctor log
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
(defn log [& args]
(apply print (concat "\n" args "\n")))
(comment
(log "Hello" "World"))
| null | https://raw.githubusercontent.com/russmatney/ralphie/3b7af4a9ec2dc2b9e59036d67a66f365691f171d/src/ralphie/doctor.clj | clojure |
Doctor log
| (ns ralphie.doctor)
(defn log [& args]
(apply print (concat "\n" args "\n")))
(comment
(log "Hello" "World"))
|
9b2d904c6ef20a40a9b62e8a73ce127ba4e5abdf64699853049e5cf7949f059b | weblocks-framework/weblocks | excerpt.lisp |
(in-package :weblocks)
(export '(*text-data-cutoff-threshold* excerpt excerpt-presentation
excerpt-presentation-cutoff-threshold))
(defparameter *text-data-cutoff-threshold* 15
"In the excerpt mode, the number of characters to be rendered
before the text is cut off and an ellipsis is inserted.")
(defclass excerpt-presentation (text-presentation)
((cutoff-threshold :initform *text-data-cutoff-threshold*
:accessor excerpt-presentation-cutoff-threshold
:initarg :cutoff-threshold
:documentation "Number of characters before the
text is cut off."))
(:documentation "Presents a large amount of text as an HTML
paragraph."))
(defmethod render-view-field-value (value (presentation excerpt-presentation)
field view widget obj &rest args
&key highlight &allow-other-keys)
(if (null value)
(call-next-method)
(let* ((orig-item (apply #'print-view-field-value
value (make-instance 'text-presentation) field view widget obj args))
(item (apply #'print-view-field-value value presentation field view widget obj args))
(lit-item (if highlight
(highlight-regex-matches item highlight presentation)
(escape-for-html item))))
(with-html
(:span :class "value"
(str lit-item)
(unless (<= (length orig-item)
(excerpt-presentation-cutoff-threshold presentation))
(htm (:span :class "ellipsis" "..."))))))))
(defmethod print-view-field-value (value (presentation excerpt-presentation)
field view widget obj &rest args)
(declare (ignore obj view field args))
(let ((threshold (excerpt-presentation-cutoff-threshold presentation))
(item (call-next-method)))
(if (<= (length item) threshold)
item
(subseq item 0 threshold))))
| null | https://raw.githubusercontent.com/weblocks-framework/weblocks/fe96152458c8eb54d74751b3201db42dafe1708b/src/views/types/presentations/excerpt.lisp | lisp |
(in-package :weblocks)
(export '(*text-data-cutoff-threshold* excerpt excerpt-presentation
excerpt-presentation-cutoff-threshold))
(defparameter *text-data-cutoff-threshold* 15
"In the excerpt mode, the number of characters to be rendered
before the text is cut off and an ellipsis is inserted.")
(defclass excerpt-presentation (text-presentation)
((cutoff-threshold :initform *text-data-cutoff-threshold*
:accessor excerpt-presentation-cutoff-threshold
:initarg :cutoff-threshold
:documentation "Number of characters before the
text is cut off."))
(:documentation "Presents a large amount of text as an HTML
paragraph."))
(defmethod render-view-field-value (value (presentation excerpt-presentation)
field view widget obj &rest args
&key highlight &allow-other-keys)
(if (null value)
(call-next-method)
(let* ((orig-item (apply #'print-view-field-value
value (make-instance 'text-presentation) field view widget obj args))
(item (apply #'print-view-field-value value presentation field view widget obj args))
(lit-item (if highlight
(highlight-regex-matches item highlight presentation)
(escape-for-html item))))
(with-html
(:span :class "value"
(str lit-item)
(unless (<= (length orig-item)
(excerpt-presentation-cutoff-threshold presentation))
(htm (:span :class "ellipsis" "..."))))))))
(defmethod print-view-field-value (value (presentation excerpt-presentation)
field view widget obj &rest args)
(declare (ignore obj view field args))
(let ((threshold (excerpt-presentation-cutoff-threshold presentation))
(item (call-next-method)))
(if (<= (length item) threshold)
item
(subseq item 0 threshold))))
| |
a00aafc994c1e4ccc663604edcc2e3510c309d003d008a69bddbba0f55a1cd2b | input-output-hk/marlowe-cardano | Channel.hs |
# LANGUAGE DataKinds #
# LANGUAGE NamedFieldPuns #
{-# LANGUAGE OverloadedStrings #-}
# LANGUAGE RecordWildCards #
# LANGUAGE ScopedTypeVariables #
module Language.Marlowe.Runtime.App.Channel
( LastSeen(..)
, runContractAction
, runDetection
, runDiscovery
) where
import Control.Concurrent (forkIO, threadDelay)
import Control.Concurrent.STM (atomically)
import Control.Concurrent.STM.TChan (TChan, newTChanIO, readTChan, writeTChan)
import Control.Monad (forever, unless, void)
import Control.Monad.IO.Class (liftIO)
import Data.Aeson (object, (.=))
import Data.Text (Text)
import Language.Marlowe.Core.V1.Semantics.Types (Contract)
import Language.Marlowe.Runtime.App.Run (runClientWithConfig)
import Language.Marlowe.Runtime.App.Stream
(ContractStream(..), contractFromStream, streamAllContractIds, streamContractSteps, transactionIdFromStream)
import Language.Marlowe.Runtime.App.Types (Config)
import Language.Marlowe.Runtime.ChainSync.Api (TxId)
import Language.Marlowe.Runtime.Core.Api (ContractId, MarloweVersionTag(V1))
import Language.Marlowe.Runtime.History.Api (ContractStep, CreateStep)
import Observe.Event (Event, EventBackend, addField, withEvent)
import Observe.Event.Backend (hoistEventBackend)
import Observe.Event.Dynamic (DynamicEventSelector(..), DynamicField)
import Observe.Event.Syntax ((≔))
import qualified Data.Map.Strict as M (Map, adjust, delete, insert, lookup)
import qualified Data.Set as S (Set, insert, member)
runDiscovery
:: EventBackend IO r DynamicEventSelector
-> Config
-> Int
-> IO (TChan ContractId)
runDiscovery eventBackend config pollingFrequency =
do
channel <- newTChanIO
void . forkIO
. withEvent (hoistEventBackend liftIO eventBackend) (DynamicEventSelector "DiscoveryProcess")
$ \event ->
addField event
. either (("failure" :: Text) ≔) (const $ ("success" :: Text) ≔ True)
=<< runClientWithConfig config (streamAllContractIds eventBackend pollingFrequency channel)
pure channel
runDetection
:: (Either (CreateStep 'V1) (ContractStep 'V1) -> Bool)
-> EventBackend IO r DynamicEventSelector
-> Config
-> Int
-> TChan ContractId
-> IO (TChan (ContractStream 'V1))
runDetection accept eventBackend config pollingFrequency inChannel =
do
outChannel <- newTChanIO
void . forkIO
. forever
. runClientWithConfig config
FIXME : If ` MarloweSyncClient ` were a ` Monad ` , then we could run
-- multiple actions sequentially in a single connection.
. withEvent (hoistEventBackend liftIO eventBackend) (DynamicEventSelector "DetectionProcess")
$ \event ->
do
contractId <- liftIO . atomically $ readTChan inChannel
addField event $ ("contractId" :: Text) ≔ contractId
-- FIXME: If there were concurrency combinators for `MarloweSyncClient`, then we
-- could follow multiple contracts in parallel using the same connection.
let
finishOnClose = True
finishOnWait = True
streamContractSteps eventBackend pollingFrequency finishOnClose finishOnWait accept contractId outChannel
pure outChannel
data LastSeen =
LastSeen
{
thisContractId :: ContractId
, lastContract :: Contract
, lastTxId :: TxId
, ignoredTxIds :: S.Set TxId
}
deriving (Show)
runContractAction
:: forall r
. Text
-> EventBackend IO r DynamicEventSelector
-> (Event IO r DynamicEventSelector DynamicField -> LastSeen -> IO ())
-> Int
-> TChan (ContractStream 'V1)
-> TChan ContractId
-> IO ()
runContractAction selectorName eventBackend runInput pollingFrequency inChannel outChannel =
let
-- Nothing needs updating.
rollback :: ContractStream 'V1 -> M.Map ContractId LastSeen -> M.Map ContractId LastSeen
rollback = const id
-- Remove the contract from tracking.
delete :: ContractId -> M.Map ContractId LastSeen -> M.Map ContractId LastSeen
delete = M.delete
-- Update the contract and its latest transaction.
update :: Event IO r DynamicEventSelector DynamicField -> ContractStream 'V1 -> M.Map ContractId LastSeen -> IO (M.Map ContractId LastSeen)
update event cs lastSeen =
let
contractId = csContractId cs
in
case (contractId `M.lookup` lastSeen, contractFromStream cs, transactionIdFromStream cs) of
(Nothing , Just contract, Just txId) -> pure $ M.insert contractId (LastSeen contractId contract txId mempty) lastSeen
(Just seen, Just contract, Just txId) -> pure $ M.insert contractId (seen {lastContract = contract, lastTxId = txId}) lastSeen
(Just _ , Nothing , Just _ ) -> pure $ M.delete contractId lastSeen
(seen , _ , _ ) -> do -- FIXME: Diagnose and remedy situations if this ever occurs.
addField event
$ ("invalidContractStream" :: Text) ≔
object
[
"lastContract" .= fmap lastContract seen
, "lastTxId" .= fmap lastTxId seen
, "contractStream" .= cs
]
pure lastSeen
-- Ignore the transaction in the future.
ignore :: ContractId -> TxId -> M.Map ContractId LastSeen -> M.Map ContractId LastSeen
ignore contractId txId lastSeen =
M.adjust (\seen -> seen {ignoredTxIds = txId `S.insert` ignoredTxIds seen}) contractId lastSeen
-- Revisit a contract later.
revisit :: ContractId -> IO ()
revisit contractId =
-- FIXME: This is a workaround for contract discovery not tailing past the tip of the blockchain.
void . forkIO
$ threadDelay pollingFrequency
>> atomically (writeTChan outChannel contractId)
go :: M.Map ContractId LastSeen -> IO ()
go lastSeen =
do
lastSeen' <-
withEvent eventBackend (DynamicEventSelector selectorName)
$ \event ->
do
cs <- liftIO . atomically $ readTChan inChannel
addField event $ ("contractId" :: Text) ≔ csContractId cs
case cs of
ContractStreamStart{} -> do
addField event $ ("action" :: Text) ≔ ("start" :: String)
update event cs lastSeen
ContractStreamContinued{} -> do
addField event $ ("action" :: Text) ≔ ("continued" :: String)
update event cs lastSeen
ContractStreamRolledBack{} -> do
addField event $ ("action" :: Text) ≔ ("rollback" :: String)
pure $ rollback cs lastSeen
ContractStreamWait{..} -> do
addField event $ ("action" :: Text) ≔ ("wait" :: String)
case csContractId `M.lookup` lastSeen of
Just seen@LastSeen{lastTxId} ->
do
unless (lastTxId `S.member` ignoredTxIds seen)
$ runInput event seen
revisit csContractId
pure $ ignore csContractId lastTxId lastSeen
_ ->
do -- FIXME: Diagnose and remedy situations if this ever occurs.
addField event
$ ("invalidContractStream" :: Text) ≔
object ["contractStream" .= cs]
pure lastSeen
ContractStreamFinish{..} -> do
addField event $ ("action" :: Text) ≔ ("finish" :: String)
pure $ delete csContractId lastSeen
go lastSeen'
in
go mempty
| null | https://raw.githubusercontent.com/input-output-hk/marlowe-cardano/3c65414ea55ac58d12ea974fa40c4f0deb4cc0a6/marlowe-apps/src/Language/Marlowe/Runtime/App/Channel.hs | haskell | # LANGUAGE OverloadedStrings #
multiple actions sequentially in a single connection.
FIXME: If there were concurrency combinators for `MarloweSyncClient`, then we
could follow multiple contracts in parallel using the same connection.
Nothing needs updating.
Remove the contract from tracking.
Update the contract and its latest transaction.
FIXME: Diagnose and remedy situations if this ever occurs.
Ignore the transaction in the future.
Revisit a contract later.
FIXME: This is a workaround for contract discovery not tailing past the tip of the blockchain.
FIXME: Diagnose and remedy situations if this ever occurs. |
# LANGUAGE DataKinds #
# LANGUAGE NamedFieldPuns #
# LANGUAGE RecordWildCards #
# LANGUAGE ScopedTypeVariables #
module Language.Marlowe.Runtime.App.Channel
( LastSeen(..)
, runContractAction
, runDetection
, runDiscovery
) where
import Control.Concurrent (forkIO, threadDelay)
import Control.Concurrent.STM (atomically)
import Control.Concurrent.STM.TChan (TChan, newTChanIO, readTChan, writeTChan)
import Control.Monad (forever, unless, void)
import Control.Monad.IO.Class (liftIO)
import Data.Aeson (object, (.=))
import Data.Text (Text)
import Language.Marlowe.Core.V1.Semantics.Types (Contract)
import Language.Marlowe.Runtime.App.Run (runClientWithConfig)
import Language.Marlowe.Runtime.App.Stream
(ContractStream(..), contractFromStream, streamAllContractIds, streamContractSteps, transactionIdFromStream)
import Language.Marlowe.Runtime.App.Types (Config)
import Language.Marlowe.Runtime.ChainSync.Api (TxId)
import Language.Marlowe.Runtime.Core.Api (ContractId, MarloweVersionTag(V1))
import Language.Marlowe.Runtime.History.Api (ContractStep, CreateStep)
import Observe.Event (Event, EventBackend, addField, withEvent)
import Observe.Event.Backend (hoistEventBackend)
import Observe.Event.Dynamic (DynamicEventSelector(..), DynamicField)
import Observe.Event.Syntax ((≔))
import qualified Data.Map.Strict as M (Map, adjust, delete, insert, lookup)
import qualified Data.Set as S (Set, insert, member)
runDiscovery
:: EventBackend IO r DynamicEventSelector
-> Config
-> Int
-> IO (TChan ContractId)
runDiscovery eventBackend config pollingFrequency =
do
channel <- newTChanIO
void . forkIO
. withEvent (hoistEventBackend liftIO eventBackend) (DynamicEventSelector "DiscoveryProcess")
$ \event ->
addField event
. either (("failure" :: Text) ≔) (const $ ("success" :: Text) ≔ True)
=<< runClientWithConfig config (streamAllContractIds eventBackend pollingFrequency channel)
pure channel
runDetection
:: (Either (CreateStep 'V1) (ContractStep 'V1) -> Bool)
-> EventBackend IO r DynamicEventSelector
-> Config
-> Int
-> TChan ContractId
-> IO (TChan (ContractStream 'V1))
runDetection accept eventBackend config pollingFrequency inChannel =
do
outChannel <- newTChanIO
void . forkIO
. forever
. runClientWithConfig config
FIXME : If ` MarloweSyncClient ` were a ` Monad ` , then we could run
. withEvent (hoistEventBackend liftIO eventBackend) (DynamicEventSelector "DetectionProcess")
$ \event ->
do
contractId <- liftIO . atomically $ readTChan inChannel
addField event $ ("contractId" :: Text) ≔ contractId
let
finishOnClose = True
finishOnWait = True
streamContractSteps eventBackend pollingFrequency finishOnClose finishOnWait accept contractId outChannel
pure outChannel
data LastSeen =
LastSeen
{
thisContractId :: ContractId
, lastContract :: Contract
, lastTxId :: TxId
, ignoredTxIds :: S.Set TxId
}
deriving (Show)
runContractAction
:: forall r
. Text
-> EventBackend IO r DynamicEventSelector
-> (Event IO r DynamicEventSelector DynamicField -> LastSeen -> IO ())
-> Int
-> TChan (ContractStream 'V1)
-> TChan ContractId
-> IO ()
runContractAction selectorName eventBackend runInput pollingFrequency inChannel outChannel =
let
rollback :: ContractStream 'V1 -> M.Map ContractId LastSeen -> M.Map ContractId LastSeen
rollback = const id
delete :: ContractId -> M.Map ContractId LastSeen -> M.Map ContractId LastSeen
delete = M.delete
update :: Event IO r DynamicEventSelector DynamicField -> ContractStream 'V1 -> M.Map ContractId LastSeen -> IO (M.Map ContractId LastSeen)
update event cs lastSeen =
let
contractId = csContractId cs
in
case (contractId `M.lookup` lastSeen, contractFromStream cs, transactionIdFromStream cs) of
(Nothing , Just contract, Just txId) -> pure $ M.insert contractId (LastSeen contractId contract txId mempty) lastSeen
(Just seen, Just contract, Just txId) -> pure $ M.insert contractId (seen {lastContract = contract, lastTxId = txId}) lastSeen
(Just _ , Nothing , Just _ ) -> pure $ M.delete contractId lastSeen
addField event
$ ("invalidContractStream" :: Text) ≔
object
[
"lastContract" .= fmap lastContract seen
, "lastTxId" .= fmap lastTxId seen
, "contractStream" .= cs
]
pure lastSeen
ignore :: ContractId -> TxId -> M.Map ContractId LastSeen -> M.Map ContractId LastSeen
ignore contractId txId lastSeen =
M.adjust (\seen -> seen {ignoredTxIds = txId `S.insert` ignoredTxIds seen}) contractId lastSeen
revisit :: ContractId -> IO ()
revisit contractId =
void . forkIO
$ threadDelay pollingFrequency
>> atomically (writeTChan outChannel contractId)
go :: M.Map ContractId LastSeen -> IO ()
go lastSeen =
do
lastSeen' <-
withEvent eventBackend (DynamicEventSelector selectorName)
$ \event ->
do
cs <- liftIO . atomically $ readTChan inChannel
addField event $ ("contractId" :: Text) ≔ csContractId cs
case cs of
ContractStreamStart{} -> do
addField event $ ("action" :: Text) ≔ ("start" :: String)
update event cs lastSeen
ContractStreamContinued{} -> do
addField event $ ("action" :: Text) ≔ ("continued" :: String)
update event cs lastSeen
ContractStreamRolledBack{} -> do
addField event $ ("action" :: Text) ≔ ("rollback" :: String)
pure $ rollback cs lastSeen
ContractStreamWait{..} -> do
addField event $ ("action" :: Text) ≔ ("wait" :: String)
case csContractId `M.lookup` lastSeen of
Just seen@LastSeen{lastTxId} ->
do
unless (lastTxId `S.member` ignoredTxIds seen)
$ runInput event seen
revisit csContractId
pure $ ignore csContractId lastTxId lastSeen
_ ->
addField event
$ ("invalidContractStream" :: Text) ≔
object ["contractStream" .= cs]
pure lastSeen
ContractStreamFinish{..} -> do
addField event $ ("action" :: Text) ≔ ("finish" :: String)
pure $ delete csContractId lastSeen
go lastSeen'
in
go mempty
|
9521df02794f3bfee8c53f9c2565dd8de2c87f585edc4003438fb9cbfbf18736 | gfngfn/SATySFi | lineBreakDataMap.mli |
open MyUtil
open CharBasis
val set_from_file : abs_path -> unit
val find : Uchar.t -> line_break_class
val append_break_opportunity : Uchar.t list -> break_opportunity -> break_opportunity * line_break_element list
| null | https://raw.githubusercontent.com/gfngfn/SATySFi/9dbd61df0ab05943b3394830c371e927df45251a/src/chardecoder/lineBreakDataMap.mli | ocaml |
open MyUtil
open CharBasis
val set_from_file : abs_path -> unit
val find : Uchar.t -> line_break_class
val append_break_opportunity : Uchar.t list -> break_opportunity -> break_opportunity * line_break_element list
| |
d3930d70eab345484e0e9c277bb4a426161dec1b4534fe5590f2cf6881559adb | discus-lang/salt | StripAnnot.hs |
module Salt.Core.Transform.StripAnnot where
import Salt.Core.Exp.Module
import Salt.Core.Exp.Type
import Salt.Core.Exp.Term
import qualified Data.Map as Map
---------------------------------------------------------------------------------------------------
class StripAnnot c where
stripAnnot :: c a -> c ()
---------------------------------------------------------------------------------------------------
instance StripAnnot Module where
stripAnnot mm
= Module
{ moduleDecls = map stripAnnot $ moduleDecls mm}
---------------------------------------------------------------------------------------------------
instance StripAnnot Decl where
stripAnnot dd
= case dd of
DType d -> DType (stripAnnot d)
DTerm d -> DTerm (stripAnnot d)
DTest d -> DTest (stripAnnot d)
DEmit d -> DEmit (stripAnnot d)
instance StripAnnot DeclType where
stripAnnot (DeclType _ n tps kResult tBody)
= DeclType () n (map stripAnnot tps) (stripAnnot kResult) (stripAnnot tBody)
instance StripAnnot DeclTerm where
stripAnnot (DeclTerm _ mode n mps tsResult mBody)
= DeclTerm () mode n (map stripAnnot mps) (map stripAnnot tsResult) (stripAnnot mBody)
instance StripAnnot DeclTest where
stripAnnot dd
= case dd of
DeclTestKind _ w mn t -> DeclTestKind () w mn (stripAnnot t)
DeclTestType _ w mn m -> DeclTestType () w mn (stripAnnot m)
DeclTestEvalType _ w mn t -> DeclTestEvalType () w mn (stripAnnot t)
DeclTestEvalTerm _ w mn m -> DeclTestEvalTerm () w mn (stripAnnot m)
DeclTestExec _ w mn m -> DeclTestExec () w mn (stripAnnot m)
DeclTestAssert _ w mn m -> DeclTestAssert () w mn (stripAnnot m)
instance StripAnnot DeclEmit where
stripAnnot dd
= case dd of
DeclEmit _ mn m -> DeclEmit () mn (stripAnnot m)
---------------------------------------------------------------------------------------------------
instance StripAnnot Type where
stripAnnot tt
= case tt of
TAnn _ t -> stripAnnot t
TRef r -> TRef (stripAnnot r)
TVar u -> TVar u
TAbs p t -> TAbs (stripAnnot p) (stripAnnot t)
TKey k ts -> TKey k (map stripAnnot ts)
instance StripAnnot TypeRef where
stripAnnot tr
= case tr of
TRPrm n -> TRPrm n
TRCon n -> TRCon n
TRClo clo -> TRClo (stripAnnot clo)
instance StripAnnot TypeParams where
stripAnnot tps
= case tps of
TPAnn _ tps' -> stripAnnot tps'
TPTypes bts -> TPTypes [(b, stripAnnot t) | (b, t) <- bts]
instance StripAnnot TypeArgs where
stripAnnot tgs
= case tgs of
TGAnn _ tgs' -> stripAnnot tgs'
TGTypes ts -> TGTypes (map stripAnnot ts)
instance StripAnnot TypeClosure where
stripAnnot (TypeClosure env tps t)
= TypeClosure (stripAnnot env) (stripAnnot tps) (stripAnnot t)
instance StripAnnot TypeEnv where
stripAnnot (TypeEnv bs)
= TypeEnv (map stripAnnot bs)
instance StripAnnot TypeEnvBinds where
stripAnnot eb
= case eb of
TypeEnvTypes ts -> TypeEnvTypes (Map.map stripAnnot ts)
---------------------------------------------------------------------------------------------------
instance StripAnnot Term where
stripAnnot tt
= case tt of
MAnn _ m -> stripAnnot m
MRef r -> MRef (stripAnnot r)
MVar u -> MVar u
MAbs p m -> MAbs (stripAnnot p) (stripAnnot m)
MRec bms m -> MRec (map stripAnnot bms) (stripAnnot m)
MKey k ms -> MKey k (map stripAnnot ms)
instance StripAnnot TermBind where
stripAnnot (MBind b mpss ts m)
= MBind b (map stripAnnot mpss) (map stripAnnot ts) (stripAnnot m)
instance StripAnnot TermRef where
stripAnnot tr
= case tr of
MRVal v -> MRVal (stripAnnot v)
MRPrm n -> MRCon n
MRCon c -> MRCon c
instance StripAnnot TermParams where
stripAnnot mps
= case mps of
MPAnn _ m -> stripAnnot m
MPTerms bms -> MPTerms [(b, stripAnnot m) | (b, m) <- bms]
MPTypes bts -> MPTypes [(b, stripAnnot t) | (b, t) <- bts]
instance StripAnnot TermArgs where
stripAnnot mgs
= case mgs of
MGAnn _ mgs' -> stripAnnot mgs'
MGTerm m -> MGTerm (stripAnnot m)
MGTerms ms -> MGTerms (map stripAnnot ms)
MGTypes ts -> MGTypes (map stripAnnot ts)
instance StripAnnot Value where
stripAnnot vv
= case vv of
VUnit -> VUnit
VSymbol n -> VSymbol n
VText t -> VText t
VBool b -> VBool b
VNat n -> VNat n
VInt i -> VInt i
VWord i -> VWord i
VInt8 i -> VInt8 i
VInt16 i -> VInt16 i
VInt32 i -> VInt32 i
VInt64 i -> VInt64 i
VWord8 i -> VWord8 i
VWord16 i -> VWord16 i
VWord32 i -> VWord32 i
VWord64 i -> VWord64 i
VData n ts vs -> VData n (map stripAnnot ts) (map stripAnnot vs)
VRecord nvss -> VRecord [ (n, map stripAnnot vs) | (n, vs) <- nvss ]
VVariant n t vs -> VVariant n (stripAnnot t) (map stripAnnot vs)
VList t vs -> VList (stripAnnot t) (map stripAnnot vs)
VSet t vs -> VSet (stripAnnot t) vs
VMap tk tv kvs -> VMap (stripAnnot tk) (stripAnnot tv) (Map.map stripAnnot kvs)
VClosure clo -> VClosure (stripAnnot clo)
VBundle bb -> VBundle (stripAnnot bb)
VLoc t i -> VLoc (stripAnnot t) i
VAddr a -> VAddr a
VPtr r t a -> VPtr (stripAnnot r) (stripAnnot t) a
VExtPair v ts a -> VExtPair (stripAnnot v) (map stripAnnot ts) (stripAnnot a)
instance StripAnnot TermClosure where
stripAnnot (TermClosure env mps m)
= TermClosure (stripAnnot env) (stripAnnot mps) (stripAnnot m)
instance StripAnnot TermEnv where
stripAnnot (TermEnv bs)
= TermEnv (map stripAnnot bs)
instance StripAnnot TermEnvBinds where
stripAnnot eb
= case eb of
TermEnvTypes ts -> TermEnvTypes (Map.map stripAnnot ts)
TermEnvValues vs -> TermEnvValues (Map.map stripAnnot vs)
TermEnvValuesRec vs -> TermEnvValuesRec (Map.map stripAnnot vs)
instance StripAnnot Bundle where
stripAnnot (Bundle nts nms)
= Bundle (Map.map stripAnnot nts)
(Map.map stripAnnot nms)
instance StripAnnot BundleType where
stripAnnot (BundleType _a n tps k t)
= BundleType () n (map stripAnnot tps) (stripAnnot k) (stripAnnot t)
instance StripAnnot BundleTerm where
stripAnnot (BundleTerm _a n tgs ts m)
= BundleTerm () n (map stripAnnot tgs) (map stripAnnot ts) (stripAnnot m)
| null | https://raw.githubusercontent.com/discus-lang/salt/33c14414ac7e238fdbd8161971b8b8ac67fff569/src/salt/Salt/Core/Transform/StripAnnot.hs | haskell | -------------------------------------------------------------------------------------------------
-------------------------------------------------------------------------------------------------
-------------------------------------------------------------------------------------------------
-------------------------------------------------------------------------------------------------
------------------------------------------------------------------------------------------------- |
module Salt.Core.Transform.StripAnnot where
import Salt.Core.Exp.Module
import Salt.Core.Exp.Type
import Salt.Core.Exp.Term
import qualified Data.Map as Map
class StripAnnot c where
stripAnnot :: c a -> c ()
instance StripAnnot Module where
stripAnnot mm
= Module
{ moduleDecls = map stripAnnot $ moduleDecls mm}
instance StripAnnot Decl where
stripAnnot dd
= case dd of
DType d -> DType (stripAnnot d)
DTerm d -> DTerm (stripAnnot d)
DTest d -> DTest (stripAnnot d)
DEmit d -> DEmit (stripAnnot d)
instance StripAnnot DeclType where
stripAnnot (DeclType _ n tps kResult tBody)
= DeclType () n (map stripAnnot tps) (stripAnnot kResult) (stripAnnot tBody)
instance StripAnnot DeclTerm where
stripAnnot (DeclTerm _ mode n mps tsResult mBody)
= DeclTerm () mode n (map stripAnnot mps) (map stripAnnot tsResult) (stripAnnot mBody)
instance StripAnnot DeclTest where
stripAnnot dd
= case dd of
DeclTestKind _ w mn t -> DeclTestKind () w mn (stripAnnot t)
DeclTestType _ w mn m -> DeclTestType () w mn (stripAnnot m)
DeclTestEvalType _ w mn t -> DeclTestEvalType () w mn (stripAnnot t)
DeclTestEvalTerm _ w mn m -> DeclTestEvalTerm () w mn (stripAnnot m)
DeclTestExec _ w mn m -> DeclTestExec () w mn (stripAnnot m)
DeclTestAssert _ w mn m -> DeclTestAssert () w mn (stripAnnot m)
instance StripAnnot DeclEmit where
stripAnnot dd
= case dd of
DeclEmit _ mn m -> DeclEmit () mn (stripAnnot m)
instance StripAnnot Type where
stripAnnot tt
= case tt of
TAnn _ t -> stripAnnot t
TRef r -> TRef (stripAnnot r)
TVar u -> TVar u
TAbs p t -> TAbs (stripAnnot p) (stripAnnot t)
TKey k ts -> TKey k (map stripAnnot ts)
instance StripAnnot TypeRef where
stripAnnot tr
= case tr of
TRPrm n -> TRPrm n
TRCon n -> TRCon n
TRClo clo -> TRClo (stripAnnot clo)
instance StripAnnot TypeParams where
stripAnnot tps
= case tps of
TPAnn _ tps' -> stripAnnot tps'
TPTypes bts -> TPTypes [(b, stripAnnot t) | (b, t) <- bts]
instance StripAnnot TypeArgs where
stripAnnot tgs
= case tgs of
TGAnn _ tgs' -> stripAnnot tgs'
TGTypes ts -> TGTypes (map stripAnnot ts)
instance StripAnnot TypeClosure where
stripAnnot (TypeClosure env tps t)
= TypeClosure (stripAnnot env) (stripAnnot tps) (stripAnnot t)
instance StripAnnot TypeEnv where
stripAnnot (TypeEnv bs)
= TypeEnv (map stripAnnot bs)
instance StripAnnot TypeEnvBinds where
stripAnnot eb
= case eb of
TypeEnvTypes ts -> TypeEnvTypes (Map.map stripAnnot ts)
instance StripAnnot Term where
stripAnnot tt
= case tt of
MAnn _ m -> stripAnnot m
MRef r -> MRef (stripAnnot r)
MVar u -> MVar u
MAbs p m -> MAbs (stripAnnot p) (stripAnnot m)
MRec bms m -> MRec (map stripAnnot bms) (stripAnnot m)
MKey k ms -> MKey k (map stripAnnot ms)
instance StripAnnot TermBind where
stripAnnot (MBind b mpss ts m)
= MBind b (map stripAnnot mpss) (map stripAnnot ts) (stripAnnot m)
instance StripAnnot TermRef where
stripAnnot tr
= case tr of
MRVal v -> MRVal (stripAnnot v)
MRPrm n -> MRCon n
MRCon c -> MRCon c
instance StripAnnot TermParams where
stripAnnot mps
= case mps of
MPAnn _ m -> stripAnnot m
MPTerms bms -> MPTerms [(b, stripAnnot m) | (b, m) <- bms]
MPTypes bts -> MPTypes [(b, stripAnnot t) | (b, t) <- bts]
instance StripAnnot TermArgs where
stripAnnot mgs
= case mgs of
MGAnn _ mgs' -> stripAnnot mgs'
MGTerm m -> MGTerm (stripAnnot m)
MGTerms ms -> MGTerms (map stripAnnot ms)
MGTypes ts -> MGTypes (map stripAnnot ts)
instance StripAnnot Value where
stripAnnot vv
= case vv of
VUnit -> VUnit
VSymbol n -> VSymbol n
VText t -> VText t
VBool b -> VBool b
VNat n -> VNat n
VInt i -> VInt i
VWord i -> VWord i
VInt8 i -> VInt8 i
VInt16 i -> VInt16 i
VInt32 i -> VInt32 i
VInt64 i -> VInt64 i
VWord8 i -> VWord8 i
VWord16 i -> VWord16 i
VWord32 i -> VWord32 i
VWord64 i -> VWord64 i
VData n ts vs -> VData n (map stripAnnot ts) (map stripAnnot vs)
VRecord nvss -> VRecord [ (n, map stripAnnot vs) | (n, vs) <- nvss ]
VVariant n t vs -> VVariant n (stripAnnot t) (map stripAnnot vs)
VList t vs -> VList (stripAnnot t) (map stripAnnot vs)
VSet t vs -> VSet (stripAnnot t) vs
VMap tk tv kvs -> VMap (stripAnnot tk) (stripAnnot tv) (Map.map stripAnnot kvs)
VClosure clo -> VClosure (stripAnnot clo)
VBundle bb -> VBundle (stripAnnot bb)
VLoc t i -> VLoc (stripAnnot t) i
VAddr a -> VAddr a
VPtr r t a -> VPtr (stripAnnot r) (stripAnnot t) a
VExtPair v ts a -> VExtPair (stripAnnot v) (map stripAnnot ts) (stripAnnot a)
instance StripAnnot TermClosure where
stripAnnot (TermClosure env mps m)
= TermClosure (stripAnnot env) (stripAnnot mps) (stripAnnot m)
instance StripAnnot TermEnv where
stripAnnot (TermEnv bs)
= TermEnv (map stripAnnot bs)
instance StripAnnot TermEnvBinds where
stripAnnot eb
= case eb of
TermEnvTypes ts -> TermEnvTypes (Map.map stripAnnot ts)
TermEnvValues vs -> TermEnvValues (Map.map stripAnnot vs)
TermEnvValuesRec vs -> TermEnvValuesRec (Map.map stripAnnot vs)
instance StripAnnot Bundle where
stripAnnot (Bundle nts nms)
= Bundle (Map.map stripAnnot nts)
(Map.map stripAnnot nms)
instance StripAnnot BundleType where
stripAnnot (BundleType _a n tps k t)
= BundleType () n (map stripAnnot tps) (stripAnnot k) (stripAnnot t)
instance StripAnnot BundleTerm where
stripAnnot (BundleTerm _a n tgs ts m)
= BundleTerm () n (map stripAnnot tgs) (map stripAnnot ts) (stripAnnot m)
|
0b2366629d7cea78532f6905ef4d3c7473bad2b9cea6b9e454b47e8c5ade3a30 | DSiSc/why3 | loc.ml | (********************************************************************)
(* *)
The Why3 Verification Platform / The Why3 Development Team
Copyright 2010 - 2018 -- Inria - CNRS - Paris - Sud University
(* *)
(* This software is distributed under the terms of the GNU Lesser *)
General Public License version 2.1 , with the special exception
(* on linking described in file LICENSE. *)
(* *)
(********************************************************************)
type lexing_loc = Lexing.position * Lexing.position
type lexing_loc = Lexing.position * Lexing.position
*)
open Lexing
let current_offset = ref 0
let reloc p = { p with pos_cnum = p.pos_cnum + !current_offset }
let set_file file lb =
lb.Lexing.lex_curr_p <-
{ lb.Lexing.lex_curr_p with Lexing.pos_fname = file }
let transfer_loc lb_from lb_to =
lb_to.lex_start_p <- lb_from.lex_start_p;
lb_to.lex_curr_p <- lb_from.lex_curr_p
(*s Error locations. *)
(* dead code
let finally ff f x =
let y = try f x with e -> ff (); raise e in ff (); y
*)
open Format
s Line number
let report_line fmt l = fmt " % s:%d : " l.pos_fname l.pos_lnum
let report_line fmt l = fprintf fmt "%s:%d:" l.pos_fname l.pos_lnum
*)
type position = string * int * int * int
let user_position fname lnum cnum1 cnum2 = (fname,lnum,cnum1,cnum2)
let get loc = loc
let dummy_position = ("",0,0,0)
let join (f1,l1,b1,e1) (f2,_,b2,e2) =
assert (f1 = f2); (f1,l1,b1,e1+e2-b2)
let extract (b,e) =
let f = b.pos_fname in
let l = b.pos_lnum in
let fc = b.pos_cnum - b.pos_bol in
let lc = e.pos_cnum - b.pos_bol in
(f,l,fc,lc)
let compare = Pervasives.compare
let equal = Pervasives.(=)
let hash = Hashtbl.hash
let gen_report_position fmt (f,l,b,e) =
fprintf fmt "File \"%s\", line %d, characters %d-%d" f l b e
let report_position fmt = fprintf fmt "%a:@\n" gen_report_position
(* located exceptions *)
exception Located of position * exn
let error ?loc e = match loc with
| Some loc -> raise (Located (loc, e))
| None -> raise e
let try1 ?loc f x =
if Debug.test_flag Debug.stack_trace then f x else
try f x with Located _ as e -> raise e | e -> error ?loc e
let try2 ?loc f x y =
if Debug.test_flag Debug.stack_trace then f x y else
try f x y with Located _ as e -> raise e | e -> error ?loc e
let try3 ?loc f x y z =
if Debug.test_flag Debug.stack_trace then f x y z else
try f x y z with Located _ as e -> raise e | e -> error ?loc e
let try4 ?loc f x y z t =
if Debug.test_flag Debug.stack_trace then f x y z t else
try f x y z t with Located _ as e -> raise e | e -> error ?loc e
let try5 ?loc f x y z t u =
if Debug.test_flag Debug.stack_trace then f x y z t u else
try f x y z t u with Located _ as e -> raise e | e -> error ?loc e
let try6 ?loc f x y z t u v =
if Debug.test_flag Debug.stack_trace then f x y z t u v else
try f x y z t u v with Located _ as e -> raise e | e -> error ?loc e
let try7 ?loc f x y z t u v w =
if Debug.test_flag Debug.stack_trace then f x y z t u v w else
try f x y z t u v w with Located _ as e -> raise e | e -> error ?loc e
(* located messages *)
exception Message of string
let errorm ?loc f =
let buf = Buffer.create 512 in
let fmt = Format.formatter_of_buffer buf in
Format.kfprintf
(fun _ ->
Format.pp_print_flush fmt ();
let s = Buffer.contents buf in
Buffer.clear buf;
error ?loc (Message s))
fmt ("@[" ^^ f ^^ "@]")
let () = Exn_printer.register
(fun fmt exn -> match exn with
| Located (loc,e) ->
fprintf fmt "%a%a" report_position loc Exn_printer.exn_printer e
| Message s ->
fprintf fmt "%s" s
| _ ->
raise exn)
let loc lb = extract (Lexing.lexeme_start_p lb, Lexing.lexeme_end_p lb)
let with_location f lb =
if Debug.test_flag Debug.stack_trace then f lb else
try f lb with
| Located _ as e -> raise e
| e -> raise (Located (loc lb, e))
| null | https://raw.githubusercontent.com/DSiSc/why3/8ba9c2287224b53075adc51544bc377bc8ea5c75/src/util/loc.ml | ocaml | ******************************************************************
This software is distributed under the terms of the GNU Lesser
on linking described in file LICENSE.
******************************************************************
s Error locations.
dead code
let finally ff f x =
let y = try f x with e -> ff (); raise e in ff (); y
located exceptions
located messages | The Why3 Verification Platform / The Why3 Development Team
Copyright 2010 - 2018 -- Inria - CNRS - Paris - Sud University
General Public License version 2.1 , with the special exception
type lexing_loc = Lexing.position * Lexing.position
type lexing_loc = Lexing.position * Lexing.position
*)
open Lexing
let current_offset = ref 0
let reloc p = { p with pos_cnum = p.pos_cnum + !current_offset }
let set_file file lb =
lb.Lexing.lex_curr_p <-
{ lb.Lexing.lex_curr_p with Lexing.pos_fname = file }
let transfer_loc lb_from lb_to =
lb_to.lex_start_p <- lb_from.lex_start_p;
lb_to.lex_curr_p <- lb_from.lex_curr_p
open Format
s Line number
let report_line fmt l = fmt " % s:%d : " l.pos_fname l.pos_lnum
let report_line fmt l = fprintf fmt "%s:%d:" l.pos_fname l.pos_lnum
*)
type position = string * int * int * int
let user_position fname lnum cnum1 cnum2 = (fname,lnum,cnum1,cnum2)
let get loc = loc
let dummy_position = ("",0,0,0)
let join (f1,l1,b1,e1) (f2,_,b2,e2) =
assert (f1 = f2); (f1,l1,b1,e1+e2-b2)
let extract (b,e) =
let f = b.pos_fname in
let l = b.pos_lnum in
let fc = b.pos_cnum - b.pos_bol in
let lc = e.pos_cnum - b.pos_bol in
(f,l,fc,lc)
let compare = Pervasives.compare
let equal = Pervasives.(=)
let hash = Hashtbl.hash
let gen_report_position fmt (f,l,b,e) =
fprintf fmt "File \"%s\", line %d, characters %d-%d" f l b e
let report_position fmt = fprintf fmt "%a:@\n" gen_report_position
exception Located of position * exn
let error ?loc e = match loc with
| Some loc -> raise (Located (loc, e))
| None -> raise e
let try1 ?loc f x =
if Debug.test_flag Debug.stack_trace then f x else
try f x with Located _ as e -> raise e | e -> error ?loc e
let try2 ?loc f x y =
if Debug.test_flag Debug.stack_trace then f x y else
try f x y with Located _ as e -> raise e | e -> error ?loc e
let try3 ?loc f x y z =
if Debug.test_flag Debug.stack_trace then f x y z else
try f x y z with Located _ as e -> raise e | e -> error ?loc e
let try4 ?loc f x y z t =
if Debug.test_flag Debug.stack_trace then f x y z t else
try f x y z t with Located _ as e -> raise e | e -> error ?loc e
let try5 ?loc f x y z t u =
if Debug.test_flag Debug.stack_trace then f x y z t u else
try f x y z t u with Located _ as e -> raise e | e -> error ?loc e
let try6 ?loc f x y z t u v =
if Debug.test_flag Debug.stack_trace then f x y z t u v else
try f x y z t u v with Located _ as e -> raise e | e -> error ?loc e
let try7 ?loc f x y z t u v w =
if Debug.test_flag Debug.stack_trace then f x y z t u v w else
try f x y z t u v w with Located _ as e -> raise e | e -> error ?loc e
exception Message of string
let errorm ?loc f =
let buf = Buffer.create 512 in
let fmt = Format.formatter_of_buffer buf in
Format.kfprintf
(fun _ ->
Format.pp_print_flush fmt ();
let s = Buffer.contents buf in
Buffer.clear buf;
error ?loc (Message s))
fmt ("@[" ^^ f ^^ "@]")
let () = Exn_printer.register
(fun fmt exn -> match exn with
| Located (loc,e) ->
fprintf fmt "%a%a" report_position loc Exn_printer.exn_printer e
| Message s ->
fprintf fmt "%s" s
| _ ->
raise exn)
let loc lb = extract (Lexing.lexeme_start_p lb, Lexing.lexeme_end_p lb)
let with_location f lb =
if Debug.test_flag Debug.stack_trace then f lb else
try f lb with
| Located _ as e -> raise e
| e -> raise (Located (loc lb, e))
|
055bff9cbc5cc8006b0c15d4eae2e722a9f028a31ee44accf0fd560c70c52e1b | robrix/starlight | Text.hs | # LANGUAGE DataKinds #
# LANGUAGE DeriveGeneric #
# LANGUAGE DerivingVia #
# LANGUAGE FlexibleInstances #
# LANGUAGE NamedFieldPuns #
# LANGUAGE StandaloneDeriving #
# LANGUAGE TypeApplications #
module UI.Label.Text
( shader
, U(..)
, sampler_
, colour_
, V(..)
, Frag(..)
) where
import Control.Lens (Lens')
import Data.Coerce
import Data.Functor.I
import Data.Generics.Product.Fields
import Foreign.Storable (Storable)
import GHC.Generics (Generic)
import GL.Shader.DSL
shader :: Shader shader => shader U V Frag
shader
= vertex (\ _ V{ pos } IF{ uv } -> main $ do
uv .= (pos * xy 1 (-1)) * 0.5 + 0.5
gl_Position .= coerce (ext4 (ext3 (pos * xy 1 (-1)) 0) 1))
>>> fragment (\ U{ sampler, colour } IF{ uv } Frag{ fragColour } -> main $ do
-- Get samples for -2/3 and -1/3
valueL <- let' "valueL" $ texture sampler (xy (uv^._x + dFdx (uv^._x)) (uv^._y))^._yz * 255
lowerL <- let' "lowerL" $ mod' valueL 16
upperL <- let' "upperL" $ (valueL - lowerL) / 16
alphaL <- let' "alphaL" $ min' (abs (upperL - lowerL)) 2
Get samples for 0 , +1/3 , and +2/3
valueR <- let' "valueR" $ texture sampler uv ^. _xyz * 255
lowerR <- let' "lowerR" $ mod' valueR 16
upperR <- let' "upperR" $ (valueR - lowerR) / 16
alphaR <- let' "alphaR" $ min' (abs (upperR - lowerR)) 2
-- Average the energy over the pixels on either side
rgba <- let' "rgba" $ xyzw
((alphaR ^. _x + alphaR ^. _y + alphaR ^. _z) / 6)
((alphaL ^. _y + alphaR ^. _x + alphaR ^. _y) / 6)
((alphaL ^. _x + alphaL ^. _y + alphaR ^. _x) / 6)
0
iff (colour ^. _x `eq` 0)
(fragColour .= 1 - rgba)
(fragColour .= colour * rgba))
data U v = U
{ sampler :: v TextureUnit
, colour :: v (Colour Float)
}
deriving (Generic)
instance Vars U
sampler_ :: Lens' (U v) (v TextureUnit)
sampler_ = field @"sampler"
colour_ :: Lens' (U v) (v (Colour Float))
colour_ = field @"colour"
newtype V v = V { pos :: v (V2 Float) }
deriving (Generic)
instance Vars V
deriving via Fields V instance Storable (V I)
newtype IF v = IF { uv :: v (V2 Float) }
deriving (Generic)
instance Vars IF
| null | https://raw.githubusercontent.com/robrix/starlight/ad80ab74dc2eedbb52a75ac8ce507661d32f488e/src/UI/Label/Text.hs | haskell | Get samples for -2/3 and -1/3
Average the energy over the pixels on either side | # LANGUAGE DataKinds #
# LANGUAGE DeriveGeneric #
# LANGUAGE DerivingVia #
# LANGUAGE FlexibleInstances #
# LANGUAGE NamedFieldPuns #
# LANGUAGE StandaloneDeriving #
# LANGUAGE TypeApplications #
module UI.Label.Text
( shader
, U(..)
, sampler_
, colour_
, V(..)
, Frag(..)
) where
import Control.Lens (Lens')
import Data.Coerce
import Data.Functor.I
import Data.Generics.Product.Fields
import Foreign.Storable (Storable)
import GHC.Generics (Generic)
import GL.Shader.DSL
shader :: Shader shader => shader U V Frag
shader
= vertex (\ _ V{ pos } IF{ uv } -> main $ do
uv .= (pos * xy 1 (-1)) * 0.5 + 0.5
gl_Position .= coerce (ext4 (ext3 (pos * xy 1 (-1)) 0) 1))
>>> fragment (\ U{ sampler, colour } IF{ uv } Frag{ fragColour } -> main $ do
valueL <- let' "valueL" $ texture sampler (xy (uv^._x + dFdx (uv^._x)) (uv^._y))^._yz * 255
lowerL <- let' "lowerL" $ mod' valueL 16
upperL <- let' "upperL" $ (valueL - lowerL) / 16
alphaL <- let' "alphaL" $ min' (abs (upperL - lowerL)) 2
Get samples for 0 , +1/3 , and +2/3
valueR <- let' "valueR" $ texture sampler uv ^. _xyz * 255
lowerR <- let' "lowerR" $ mod' valueR 16
upperR <- let' "upperR" $ (valueR - lowerR) / 16
alphaR <- let' "alphaR" $ min' (abs (upperR - lowerR)) 2
rgba <- let' "rgba" $ xyzw
((alphaR ^. _x + alphaR ^. _y + alphaR ^. _z) / 6)
((alphaL ^. _y + alphaR ^. _x + alphaR ^. _y) / 6)
((alphaL ^. _x + alphaL ^. _y + alphaR ^. _x) / 6)
0
iff (colour ^. _x `eq` 0)
(fragColour .= 1 - rgba)
(fragColour .= colour * rgba))
data U v = U
{ sampler :: v TextureUnit
, colour :: v (Colour Float)
}
deriving (Generic)
instance Vars U
sampler_ :: Lens' (U v) (v TextureUnit)
sampler_ = field @"sampler"
colour_ :: Lens' (U v) (v (Colour Float))
colour_ = field @"colour"
newtype V v = V { pos :: v (V2 Float) }
deriving (Generic)
instance Vars V
deriving via Fields V instance Storable (V I)
newtype IF v = IF { uv :: v (V2 Float) }
deriving (Generic)
instance Vars IF
|
21880b55fb53a77ef7557d03c5da88ab922079c8dde3f9851dcda29cc0f8badc | haskell-opengl/OpenGLRaw | VertexAttribInteger64Bit.hs | # LANGUAGE PatternSynonyms #
--------------------------------------------------------------------------------
-- |
-- Module : Graphics.GL.NV.VertexAttribInteger64Bit
Copyright : ( c ) 2019
-- License : BSD3
--
Maintainer : < >
-- Stability : stable
-- Portability : portable
--
--------------------------------------------------------------------------------
module Graphics.GL.NV.VertexAttribInteger64Bit (
-- * Extension Support
glGetNVVertexAttribInteger64Bit,
gl_NV_vertex_attrib_integer_64bit,
-- * Enums
pattern GL_INT64_NV,
pattern GL_UNSIGNED_INT64_NV,
-- * Functions
glGetVertexAttribLi64vNV,
glGetVertexAttribLui64vNV,
glVertexAttribL1i64NV,
glVertexAttribL1i64vNV,
glVertexAttribL1ui64NV,
glVertexAttribL1ui64vNV,
glVertexAttribL2i64NV,
glVertexAttribL2i64vNV,
glVertexAttribL2ui64NV,
glVertexAttribL2ui64vNV,
glVertexAttribL3i64NV,
glVertexAttribL3i64vNV,
glVertexAttribL3ui64NV,
glVertexAttribL3ui64vNV,
glVertexAttribL4i64NV,
glVertexAttribL4i64vNV,
glVertexAttribL4ui64NV,
glVertexAttribL4ui64vNV,
glVertexAttribLFormatNV
) where
import Graphics.GL.ExtensionPredicates
import Graphics.GL.Tokens
import Graphics.GL.Functions
| null | https://raw.githubusercontent.com/haskell-opengl/OpenGLRaw/57e50c9d28dfa62d6a87ae9b561af28f64ce32a0/src/Graphics/GL/NV/VertexAttribInteger64Bit.hs | haskell | ------------------------------------------------------------------------------
|
Module : Graphics.GL.NV.VertexAttribInteger64Bit
License : BSD3
Stability : stable
Portability : portable
------------------------------------------------------------------------------
* Extension Support
* Enums
* Functions | # LANGUAGE PatternSynonyms #
Copyright : ( c ) 2019
Maintainer : < >
module Graphics.GL.NV.VertexAttribInteger64Bit (
glGetNVVertexAttribInteger64Bit,
gl_NV_vertex_attrib_integer_64bit,
pattern GL_INT64_NV,
pattern GL_UNSIGNED_INT64_NV,
glGetVertexAttribLi64vNV,
glGetVertexAttribLui64vNV,
glVertexAttribL1i64NV,
glVertexAttribL1i64vNV,
glVertexAttribL1ui64NV,
glVertexAttribL1ui64vNV,
glVertexAttribL2i64NV,
glVertexAttribL2i64vNV,
glVertexAttribL2ui64NV,
glVertexAttribL2ui64vNV,
glVertexAttribL3i64NV,
glVertexAttribL3i64vNV,
glVertexAttribL3ui64NV,
glVertexAttribL3ui64vNV,
glVertexAttribL4i64NV,
glVertexAttribL4i64vNV,
glVertexAttribL4ui64NV,
glVertexAttribL4ui64vNV,
glVertexAttribLFormatNV
) where
import Graphics.GL.ExtensionPredicates
import Graphics.GL.Tokens
import Graphics.GL.Functions
|
9587d483cd8ae3e1ba9761d98949a862c17fdb7d78b9cc19932b5609e07d2cf0 | onedata/op-worker | opt_datasets.erl | %%%-------------------------------------------------------------------
@author
( C ) 2021 ACK CYFRONET AGH
This software is released under the MIT license
cited in ' LICENSE.txt ' .
%%% @end
%%%-------------------------------------------------------------------
%%% @doc
%%% Utility functions for manipulating datasets in CT tests.
%%% @end
%%%-------------------------------------------------------------------
-module(opt_datasets).
-author("Bartosz Walkowicz").
-include("modules/fslogic/acl.hrl").
-include("modules/dataset/dataset.hrl").
-export([
list_top_datasets/5,
list_children_datasets/4,
establish/3, establish/4,
get_info/3,
reattach_dataset/3,
detach_dataset/3,
update/6,
remove/3,
get_file_eff_summary/3
]).
-define(CALL(NodeSelector, Args),
try opw_test_rpc:insecure_call(NodeSelector, mi_datasets, ?FUNCTION_NAME, Args) of
ok -> ok;
__RESULT -> {ok, __RESULT}
catch throw:__ERROR ->
__ERROR
end
).
%%%===================================================================
%%% API
%%%===================================================================
-spec list_top_datasets(
oct_background:node_selector(),
session:id(),
od_space:id(),
dataset:state(),
dataset_api:listing_opts()
) ->
{ok, {dataset_api:entries(), boolean()}} | errors:error().
list_top_datasets(NodeSelector, SessionId, SpaceId, State, Opts) ->
?CALL(NodeSelector, [SessionId, SpaceId, State, Opts, undefined]).
-spec list_children_datasets(
oct_background:node_selector(),
session:id(),
dataset:id(),
dataset_api:listing_opts()
) ->
{ok, {dataset_api:entries(), boolean()}} | errors:error().
list_children_datasets(NodeSelector, SessionId, DatasetId, Opts) ->
?CALL(NodeSelector, [SessionId, DatasetId, Opts, undefined]).
-spec establish(oct_background:node_selector(), session:id(), lfm:file_key()) ->
{ok, dataset:id()} | errors:error().
establish(NodeSelector, SessionId, FileKey) ->
establish(NodeSelector, SessionId, FileKey, 0).
-spec establish(
oct_background:node_selector(),
session:id(),
lfm:file_key(),
data_access_control:bitmask()
) ->
{ok, dataset:id()} | errors:error().
establish(NodeSelector, SessionId, FileKey, ProtectionFlags) ->
?CALL(NodeSelector, [SessionId, FileKey, ProtectionFlags]).
-spec get_info(oct_background:node_selector(), session:id(), dataset:id()) ->
{ok, dataset_api:info()} | errors:error().
get_info(NodeSelector, SessionId, DatasetId) ->
?CALL(NodeSelector, [SessionId, DatasetId]).
-spec reattach_dataset(oct_background:node_selector(), session:id(), dataset:id()) ->
ok | errors:error().
reattach_dataset(NodeSelector, SessionId, DatasetId) ->
update(NodeSelector, SessionId, DatasetId, ?ATTACHED_DATASET, ?no_flags_mask, ?no_flags_mask).
-spec detach_dataset(oct_background:node_selector(), session:id(), dataset:id()) ->
ok | errors:error().
detach_dataset(NodeSelector, SessionId, DatasetId) ->
update(NodeSelector, SessionId, DatasetId, ?DETACHED_DATASET, ?no_flags_mask, ?no_flags_mask).
-spec update(
oct_background:node_selector(),
session:id(),
dataset:id(),
undefined | dataset:state(),
data_access_control:bitmask(),
data_access_control:bitmask()
) ->
ok | errors:error().
update(NodeSelector, SessionId, DatasetId, NewState, FlagsToSet, FlagsToUnset) ->
?CALL(NodeSelector, [SessionId, DatasetId, NewState, FlagsToSet, FlagsToUnset]).
-spec remove(oct_background:node_selector(), session:id(), dataset:id()) ->
ok | errors:error().
remove(NodeSelector, SessionId, DatasetId) ->
?CALL(NodeSelector, [SessionId, DatasetId]).
-spec get_file_eff_summary(oct_background:node_selector(), session:id(), lfm:file_key()) ->
{ok, dataset_api:file_eff_summary()} | errors:error().
get_file_eff_summary(NodeSelector, SessionId, FileKey) ->
?CALL(NodeSelector, [SessionId, FileKey]).
| null | https://raw.githubusercontent.com/onedata/op-worker/c874e554c5cef4d4099b8a68b28d3441a885b82d/test_distributed/utils/opt/opt_datasets.erl | erlang | -------------------------------------------------------------------
@end
-------------------------------------------------------------------
@doc
Utility functions for manipulating datasets in CT tests.
@end
-------------------------------------------------------------------
===================================================================
API
=================================================================== | @author
( C ) 2021 ACK CYFRONET AGH
This software is released under the MIT license
cited in ' LICENSE.txt ' .
-module(opt_datasets).
-author("Bartosz Walkowicz").
-include("modules/fslogic/acl.hrl").
-include("modules/dataset/dataset.hrl").
-export([
list_top_datasets/5,
list_children_datasets/4,
establish/3, establish/4,
get_info/3,
reattach_dataset/3,
detach_dataset/3,
update/6,
remove/3,
get_file_eff_summary/3
]).
-define(CALL(NodeSelector, Args),
try opw_test_rpc:insecure_call(NodeSelector, mi_datasets, ?FUNCTION_NAME, Args) of
ok -> ok;
__RESULT -> {ok, __RESULT}
catch throw:__ERROR ->
__ERROR
end
).
-spec list_top_datasets(
oct_background:node_selector(),
session:id(),
od_space:id(),
dataset:state(),
dataset_api:listing_opts()
) ->
{ok, {dataset_api:entries(), boolean()}} | errors:error().
list_top_datasets(NodeSelector, SessionId, SpaceId, State, Opts) ->
?CALL(NodeSelector, [SessionId, SpaceId, State, Opts, undefined]).
-spec list_children_datasets(
oct_background:node_selector(),
session:id(),
dataset:id(),
dataset_api:listing_opts()
) ->
{ok, {dataset_api:entries(), boolean()}} | errors:error().
list_children_datasets(NodeSelector, SessionId, DatasetId, Opts) ->
?CALL(NodeSelector, [SessionId, DatasetId, Opts, undefined]).
-spec establish(oct_background:node_selector(), session:id(), lfm:file_key()) ->
{ok, dataset:id()} | errors:error().
establish(NodeSelector, SessionId, FileKey) ->
establish(NodeSelector, SessionId, FileKey, 0).
-spec establish(
oct_background:node_selector(),
session:id(),
lfm:file_key(),
data_access_control:bitmask()
) ->
{ok, dataset:id()} | errors:error().
establish(NodeSelector, SessionId, FileKey, ProtectionFlags) ->
?CALL(NodeSelector, [SessionId, FileKey, ProtectionFlags]).
-spec get_info(oct_background:node_selector(), session:id(), dataset:id()) ->
{ok, dataset_api:info()} | errors:error().
get_info(NodeSelector, SessionId, DatasetId) ->
?CALL(NodeSelector, [SessionId, DatasetId]).
-spec reattach_dataset(oct_background:node_selector(), session:id(), dataset:id()) ->
ok | errors:error().
reattach_dataset(NodeSelector, SessionId, DatasetId) ->
update(NodeSelector, SessionId, DatasetId, ?ATTACHED_DATASET, ?no_flags_mask, ?no_flags_mask).
-spec detach_dataset(oct_background:node_selector(), session:id(), dataset:id()) ->
ok | errors:error().
detach_dataset(NodeSelector, SessionId, DatasetId) ->
update(NodeSelector, SessionId, DatasetId, ?DETACHED_DATASET, ?no_flags_mask, ?no_flags_mask).
-spec update(
oct_background:node_selector(),
session:id(),
dataset:id(),
undefined | dataset:state(),
data_access_control:bitmask(),
data_access_control:bitmask()
) ->
ok | errors:error().
update(NodeSelector, SessionId, DatasetId, NewState, FlagsToSet, FlagsToUnset) ->
?CALL(NodeSelector, [SessionId, DatasetId, NewState, FlagsToSet, FlagsToUnset]).
-spec remove(oct_background:node_selector(), session:id(), dataset:id()) ->
ok | errors:error().
remove(NodeSelector, SessionId, DatasetId) ->
?CALL(NodeSelector, [SessionId, DatasetId]).
-spec get_file_eff_summary(oct_background:node_selector(), session:id(), lfm:file_key()) ->
{ok, dataset_api:file_eff_summary()} | errors:error().
get_file_eff_summary(NodeSelector, SessionId, FileKey) ->
?CALL(NodeSelector, [SessionId, FileKey]).
|
6a7118c092e0f971f230e48d23c26a030d9ced8981090b6ce12de321050f1774 | Bogdanp/racket-kafka | 99-publish-consume-for-a-while.rkt | #lang racket/base
(require kafka
kafka/consumer
kafka/producer
racket/format
rackunit
rackunit/text-ui)
(define N 10000)
(define P 8)
(define t "99-publish-consume-for-a-while")
(run-tests
(test-suite
"publish-consume-for-a-while"
#:before
(lambda ()
(define k (make-client))
(delete-topics k t)
(create-topics k (make-CreateTopic
#:name t
#:partitions P))
(disconnect-all k))
#:after
(lambda ()
(define k (make-client))
(delete-topics k t)
(disconnect-all k))
(let ()
(define msgs null)
(define msg-ch (make-channel))
(define g "publish-consume-for-a-while-group")
(define consumer-ch (make-channel))
(define consumer-thds
(for/list ([i (in-range P)])
(thread
(lambda ()
(let join-loop ()
(with-handlers ([exn:fail:kafka:server?
(lambda (e)
(define code (exn:fail:kafka:server-code e))
(case (error-code-symbol code)
[(coordinator-not-available rebalance-in-progress)
(join-loop)]
[else
(raise e)]))])
(define k (make-client #:id (~a "consumer-" i)))
(define c (make-consumer k g t))
(let loop ()
(sync
(handle-evt
consumer-ch
(lambda (_)
(consumer-stop c)
(disconnect-all k)))
(handle-evt
(consume-evt c)
(lambda (type data)
(case type
[(records)
(consumer-commit c)
(for ([r (in-vector data)])
(channel-put msg-ch (record-value r)))
(loop)]
[else
(loop)])))))))))))
(define producer-ch (make-channel))
(define producer-thd
(thread
(lambda ()
(define k (make-client #:id "producer"))
(define p (make-producer k #:flush-interval 500))
(let loop ([n 0] [evts null])
(cond
[(= (length evts) 500)
(time (for-each sync evts))
(printf "published 500~n")
(loop n null)]
[(< n N)
(define produce-evt
(produce p t #"k" #"v" #:partition (modulo n 8)))
(sleep (/ (random 5) 1000.0))
(loop (add1 n) (cons produce-evt evts))]
[else
(time (for-each sync evts))
(printf "publish done~n")
(sync producer-ch)
(disconnect-all k)])))))
(let loop ([n 0])
(when (zero? (modulo n 100))
(printf "received ~s~n" n))
(unless (= n N)
(set! msgs (cons (channel-get msg-ch) msgs))
(loop (add1 n))))
(channel-put producer-ch '(stop))
(thread-wait producer-thd)
(for ([_ (in-range P)])
(channel-put consumer-ch '(stop)))
(for-each thread-wait consumer-thds))))
| null | https://raw.githubusercontent.com/Bogdanp/racket-kafka/3b1fef63c05449150759d5ee22805c4673ae1d4d/tests/99-publish-consume-for-a-while.rkt | racket | #lang racket/base
(require kafka
kafka/consumer
kafka/producer
racket/format
rackunit
rackunit/text-ui)
(define N 10000)
(define P 8)
(define t "99-publish-consume-for-a-while")
(run-tests
(test-suite
"publish-consume-for-a-while"
#:before
(lambda ()
(define k (make-client))
(delete-topics k t)
(create-topics k (make-CreateTopic
#:name t
#:partitions P))
(disconnect-all k))
#:after
(lambda ()
(define k (make-client))
(delete-topics k t)
(disconnect-all k))
(let ()
(define msgs null)
(define msg-ch (make-channel))
(define g "publish-consume-for-a-while-group")
(define consumer-ch (make-channel))
(define consumer-thds
(for/list ([i (in-range P)])
(thread
(lambda ()
(let join-loop ()
(with-handlers ([exn:fail:kafka:server?
(lambda (e)
(define code (exn:fail:kafka:server-code e))
(case (error-code-symbol code)
[(coordinator-not-available rebalance-in-progress)
(join-loop)]
[else
(raise e)]))])
(define k (make-client #:id (~a "consumer-" i)))
(define c (make-consumer k g t))
(let loop ()
(sync
(handle-evt
consumer-ch
(lambda (_)
(consumer-stop c)
(disconnect-all k)))
(handle-evt
(consume-evt c)
(lambda (type data)
(case type
[(records)
(consumer-commit c)
(for ([r (in-vector data)])
(channel-put msg-ch (record-value r)))
(loop)]
[else
(loop)])))))))))))
(define producer-ch (make-channel))
(define producer-thd
(thread
(lambda ()
(define k (make-client #:id "producer"))
(define p (make-producer k #:flush-interval 500))
(let loop ([n 0] [evts null])
(cond
[(= (length evts) 500)
(time (for-each sync evts))
(printf "published 500~n")
(loop n null)]
[(< n N)
(define produce-evt
(produce p t #"k" #"v" #:partition (modulo n 8)))
(sleep (/ (random 5) 1000.0))
(loop (add1 n) (cons produce-evt evts))]
[else
(time (for-each sync evts))
(printf "publish done~n")
(sync producer-ch)
(disconnect-all k)])))))
(let loop ([n 0])
(when (zero? (modulo n 100))
(printf "received ~s~n" n))
(unless (= n N)
(set! msgs (cons (channel-get msg-ch) msgs))
(loop (add1 n))))
(channel-put producer-ch '(stop))
(thread-wait producer-thd)
(for ([_ (in-range P)])
(channel-put consumer-ch '(stop)))
(for-each thread-wait consumer-thds))))
| |
68e769e4da957d79615c3d21bf0ec7575a68dfc77e4ab7e93121701270dcfc05 | LightAndLight/qtt | Main.hs | # language LambdaCase #
# language TypeApplications #
module Main where
import Test.Hspec
import Test.Pretty
import Test.Typecheck
import Test.Unify
main :: IO ()
main =
hspec $ do
prettySpec
typecheckSpec
unifySpec | null | https://raw.githubusercontent.com/LightAndLight/qtt/08a3ee8361178ad13bba659af4751b55c91081b7/test/Main.hs | haskell | # language LambdaCase #
# language TypeApplications #
module Main where
import Test.Hspec
import Test.Pretty
import Test.Typecheck
import Test.Unify
main :: IO ()
main =
hspec $ do
prettySpec
typecheckSpec
unifySpec | |
1c3ac528c9da90ac60834015d8fb81abf8fb81ec6fbb514920be61b6f3eafddf | jeffshrager/biobike | sbbio.lisp | (require 'asdf)
(in-package :sb-impl)
(defun string-hash (str)
(sxhash (string-upcase str)))
(define-hash-table-test 'string-equal #'string-equal #'string-hash)
(defun in-biodir (path)
(format nil "~A/~A" (posix-getenv "BIODIR") path))
(let ((biodir (posix-getenv "BIODIR")))
(push (in-biodir "uffi/") asdf:*central-registry*)
(push (in-biodir "clsql/") asdf:*central-registry*))
(asdf:operate 'asdf:load-op :uffi)
(asdf:operate 'asdf:load-op :clsql)
( asdf : operate ' asdf : load - op : clsql - mysql )
(load (in-biodir "clinit.cl"))
(load (in-biodir "portableaserve/INSTALL.lisp"))
(load (in-biodir "clocc/load-xml.lisp"))
| null | https://raw.githubusercontent.com/jeffshrager/biobike/5313ec1fe8e82c21430d645e848ecc0386436f57/BioLisp/Portability/sbbio.lisp | lisp | (require 'asdf)
(in-package :sb-impl)
(defun string-hash (str)
(sxhash (string-upcase str)))
(define-hash-table-test 'string-equal #'string-equal #'string-hash)
(defun in-biodir (path)
(format nil "~A/~A" (posix-getenv "BIODIR") path))
(let ((biodir (posix-getenv "BIODIR")))
(push (in-biodir "uffi/") asdf:*central-registry*)
(push (in-biodir "clsql/") asdf:*central-registry*))
(asdf:operate 'asdf:load-op :uffi)
(asdf:operate 'asdf:load-op :clsql)
( asdf : operate ' asdf : load - op : clsql - mysql )
(load (in-biodir "clinit.cl"))
(load (in-biodir "portableaserve/INSTALL.lisp"))
(load (in-biodir "clocc/load-xml.lisp"))
| |
162983982915c2b072f8cf9a19e31a34e1760fe441b95e436029e048ab90c638 | thosmos/riverdb | mutations.cljs | (ns riverdb.api.mutations
(:require
[com.fulcrologic.fulcro.algorithms.data-targeting :as dt :refer [process-target]]
[com.fulcrologic.fulcro.algorithms.normalize :as norm]
[com.fulcrologic.fulcro.algorithms.normalized-state :refer [remove-ident]]
[com.fulcrologic.fulcro.application :as fapp]
[com.fulcrologic.fulcro.mutations :refer [defmutation]]
[com.fulcrologic.semantic-ui.collections.message.ui-message :refer [ui-message]]
[com.fulcrologic.fulcro.components :as comp :refer [defsc]]
[com.fulcrologic.fulcro.networking.http-remote :as http-remote]
[theta.log :as log :refer [debug]]
[riverdb.application :refer [SPA]]
[riverdb.ui.lookups :as looks]
[riverdb.util :as util :refer [sort-maps-by]]
[com.fulcrologic.fulcro.algorithms.merge :as merge]
[com.fulcrologic.fulcro.algorithms.form-state :as fs]
[com.fulcrologic.fulcro.mutations :as fm]
[com.fulcrologic.fulcro.algorithms.data-targeting :as targeting]
[com.fulcrologic.fulcro.dom :as dom :refer [div]]
[com.fulcrologic.fulcro.algorithms.tempid :as tempid]
[com.fulcrologic.rad.routing :as rroute]
[com.fulcrologic.rad.routing.history :as hist]
[com.fulcrologic.rad.routing.html5-history :as hist5 :refer [url->route apply-route!]]
[riverdb.ui.routes :as routes]
[com.rpl.specter :as sp]
[com.fulcrologic.fulcro.routing.dynamic-routing :as dr]
[edn-query-language.core :as eql]))
;;; CLIENT
(defn set-root-key* [state key value]
(assoc state key value))
(defmutation set-root-key
"generic mutation to set a root key"
[{:keys [key value]}]
(action [{:keys [state]}]
(do
(debug "SET ROOT KEY" key value)
(swap! state set-root-key* key value))))
(defn set-root-key! [k v]
(comp/transact! SPA `[(set-root-key {:key ~k :value ~v})]))
(defmutation merge-ident [{:keys [ident props]}]
(action [{:keys [state]}]
(swap! state merge/merge-ident ident props)))
(defn merge-ident! [ident props]
(comp/transact! SPA `[(merge-ident {:ident ~ident :props ~props})]))
(defn merge-idents* [state ident-k ident-v coll & targets]
(debug "MERGE IDENT" ident-k ident-v targets)
(reduce
(fn [st m]
(let [ident [ident-k (get m ident-v)]
st (merge/merge-ident st ident m)
st' (if targets
(apply dt/integrate-ident* st ident targets)
st)]
st'))
state coll))
(defmutation merge-idents
"merge a collection of maps that conform to the ident of the comp c"
[{:keys [ident-k ident-v coll targets]}]
(action [{:keys [state]}]
(debug "MERGE IDENTS" ident-k ident-v targets)
(swap! state (fn [st]
(reduce
(fn [st m]
(let [ident [ident-k (get m ident-v)]
st (merge/merge-ident st ident m)
st' (if targets
(apply dt/integrate-ident* st ident targets)
st)]
st'))
st coll)))))
(defn merge-idents! [ident-k ident-v coll & targets]
(comp/transact! SPA `[(merge-idents {:ident-k ~ident-k :ident-v ~ident-v :coll ~coll :targets ~targets})]))
;(defmutation attempt-login
; "Fulcro mutation: Attempt to log in the user. Triggers a server interaction to see if there is already a cookie."
; [{:keys [uid]}]
; (action [{:keys [state]}]
; (swap! state assoc
; :current-user {:id uid :name ""}
; :server-down false))
; (remote [env] true))
;(defmutation server-down
; "Fulcro mutation: Called if the server does not respond so we can show an error."
; [p]
; (action [{:keys [state]}] (swap! state assoc :server-down true)))
(defmutation hide-server-error
""
[p]
(action [{:keys [state]}]
(swap! state dissoc :fulcro/server-error)))
(defmutation clear-new-user
"Fulcro mutation: Used for returning to the sign-in page from the login link. Clears the form."
[ignored]
(action [{:keys [state]}]
(let [uid (util/uuid)
new-user {:uid uid :name "" :password "" :password2 ""}
user-ident [:user/by-id uid]]
(swap! state (fn [s]
(-> s
(assoc :user/by-id {}) ; clear all users
(assoc-in user-ident new-user)
(assoc-in [:new-user :page :form] user-ident)))))))
(def get-year-fn (fn [ui-year years]
(if (some #{ui-year} years)
ui-year
(when-let [year (first years)]
year))))
(defsc Agency [_ _]
{:ident [:org.riverdb.db.agencylookup/gid :db/id]
:query [:db/id]})
(defsc Project [_ _]
{:ident [:org.riverdb.db.projectslookup/gid :db/id],
:query [:db/id
:riverdb.entity/ns
:projectslookup/Active
:projectslookup/ProjectID
:projectslookup/Name
{:projectslookup/AgencyRef (comp/get-query Agency)}]})
(defmutation process-project-years [{:keys [desired-route proj-k]}]
(action [{:keys [state]}]
(debug (clojure.string/upper-case "process-project-years"))
(let [agency-project-years (get-in @state [:component/id :proj-years :agency-project-years])
_ (debug "agency-project-years" agency-project-years)
current-project (get @state :ui.riverdb/current-project)
current-year (get @state :ui.riverdb/current-year)
proj-k (or proj-k
(if current-project
(keyword (:projectslookup/ProjectID current-project))
(ffirst agency-project-years)))
project (when proj-k
(get-in agency-project-years [proj-k :project]))
sites (when proj-k
(get-in agency-project-years [proj-k :sites]))
years (when proj-k
(get-in agency-project-years [proj-k :years]))
year (when years
(get-year-fn current-year years))]
(swap! state
(fn [st]
(cond-> st
project
(merge/merge-component Project project :replace [:ui.riverdb/current-project])
sites
(->
(set-root-key* :ui.riverdb/current-project-sites [])
(merge-idents* :org.riverdb.db.stationlookup/gid :db/id sites
:append [:ui.riverdb/current-project-sites]))
year
(set-root-key* :ui.riverdb/current-year year))))
(when desired-route
(debug "ROUTE TO desired-route" desired-route)
(let [params (:params desired-route)
rad? (:_rp_ params)]
(if rad?
(do
(log/debug "RAD ROUTE" desired-route)
(hist5/apply-route! SPA desired-route))
(do
(log/debug "NON-RAD ROUTE" desired-route)
(dr/change-route! SPA (:route desired-route))
(hist/replace-route! SPA (:route desired-route) (:params desired-route)))))))))
(defmutation process-tac-report
"TAC Report post process"
[p]
(action [{:keys [state]}]
(do
(debug "TAC POST PROCESS" p)
(swap! state update-in [:tac-report-data :no-results-rs] sort-maps-by [:site :date]))))
;(swap! state update-in [:tac-report-data :results-rs] sort-maps-by [:date :site])
;(swap! state update-in [:tac-report-page :page :field-count] inc)
(defmutation clear-tac-report
"clear :tac-report-data from local state"
[p]
(action [{:keys [state]}]
(do
(debug "CLEAR TAC DATA")
(swap! state dissoc :tac-report-data))))
(defmutation set-current-agency
""
[{:keys [agency key]}]
(action [{:keys [state]}]
(do
(debug "SET CURRENT AGENCY" key agency)
(swap! state assoc key agency))))
(defmutation clear-agency-project-years
""
[{:keys [ident]}]
(action [{:keys [state]}]
(do
(debug "CLEAR AGENCY PROJECT YEARS")
(swap! state update-in ident (fn [st] (-> st
(dissoc :agency-project-years)
(dissoc :ui/project-code)
(dissoc :ui/proj-year)))))))
(defmutation process-all-years
"All Years post process"
[p]
(action [{:keys [state]}]
(do
(debug "POST PROCESS ALL YEARS" p)
(swap! state update :all-years-data sort-maps-by [:date]))))
(defmutation sort-years
[p]
(action [{:keys [state]}]
(do
(debug "SORT YEARS")
(swap! state update :all-sitevisit-years (partial sort >)))))
(defmutation set-project
[p]
(action [{:keys [state]}]
(let [prj (:ui/project-code p)]
(debug "MUTATION set-project" prj)
(swap! state assoc-in [:myvals :project] prj))))
(defmutation process-agency-project-years
[p]
(action [{:keys [state]}]
(debug "process-agency-project-years")
(swap! state update :agency-project-years
(fn [prjs]
(reduce-kv
(fn [prjs k v]
(assoc-in prjs [k :years] (vec (sort > (:years v)))))
prjs
prjs)))))
(defmutation refresh
[p]
(action [_]
(debug "NOP just to refresh the current component")))
(defmutation update-report-year [p]
(action [{:keys [state]}]
(let [year (:year p)
year (if-not (= year "") (js/parseInt year) year)]
(debug "MUTATE REPORT YEAR" year)
(swap! state assoc-in [:tac-report-page :page :ui/year] year))))
(defn sort-ident-list-by*
"Sort the idents in the list path by the indicated field. Returns the new app-state."
([state path sort-fn]
(sort-ident-list-by* state path sort-fn nil))
([state path sort-fn ident-key]
(let [idents (get-in state path [])
ident-key (or ident-key (ffirst idents))
items (map (fn [ident] (get-in state ident)) idents)
sorted-items (sort-by sort-fn items)
new-idents (mapv (fn [item] [ident-key (:db/id item)]) sorted-items)]
;(debug "SORTED" new-idents)
(assoc-in state path new-idents))))
(defmutation sort-ident-list-by
"sorts a seq of maps at target location by running sort-fn on the maps"
[{:keys [idents-path sort-fn ident-key]}]
(action [{:keys [state]}]
(debug "SORTING SITES")
(swap! state sort-ident-list-by* idents-path sort-fn ident-key)))
(defmutation save-project [{:keys [id diff]}]
(action [{:keys [state]}]
(swap! state (fn [s]
(-> s
; update the pristine state
(fs/entity->pristine* [:org.riverdb.db.projectslookup/gid id])))))
(remote [env] true))
(defmutation reset-form [{:keys [ident]}]
(action [{:keys [state]}]
(debug "RESET FORM" ident "DIRTY" (get-in @state ident) "PRISTINE" (-> @state
(fs/pristine->entity* ident)
(get-in ident)))
(swap! state fs/pristine->entity* ident)))
(defmutation cancel-new-form! [{:keys [ident]}]
(action [{:keys [state]}]
(debug "MUTATION cancel-new-form!" ident)))
(defmutation set-enum [{:keys [key value]}]
(action [{:keys [state component]}]
(let [comp-ident (comp/get-ident component)]
(debug "set-enum" comp-ident key value)
(if (eql/ident? value)
(swap! state
#(-> %
(assoc-in (conj comp-ident key) value)
(fs/mark-complete* comp-ident key)))
(log/error "set-enum requires an ident as a value")))))
(defn set-enum! [this key value]
(comp/transact! this [(set-enum {:key key :value value})]))
(defn clear-tx-result* [state]
;(debug "CLEAR TX RESULT")
(assoc state :root/tx-result {}))
(defmutation clear-tx-result [{:keys [] :as params}]
(action [{:keys [state]}]
(swap! state clear-tx-result*)))
(defn clear-tx-result! []
(comp/transact! SPA `[(clear-tx-result)]))
(defn show-tx-result* [state result]
( debug " SHOW TX RESULT " )
(when-not (:error result)
(js/setTimeout clear-tx-result! 2000))
(assoc state :root/tx-result result))
(defmutation show-tx-result [result]
(action [{:keys [state]}]
(swap! state (fn [s] (assoc-in s [:root/tx-result] result)))))
(defn show-tx-result! [result]
(comp/transact! SPA `[(show-tx-result ~result)]))
(defn set-create* [state ident creating]
(assoc-in state (conj ident :ui/create) creating))
(defn set-saving* [state ident busy]
(assoc-in state (conj ident :ui/saving) busy))
(defmutation set-saving [{:keys [ident busy]}]
(action [{:keys [state]}]
(swap! state set-saving* ident busy)))
(defn set-saving! [ident busy]
(comp/transact! SPA `[(set-saving {:ident ~ident :busy ~busy})]))
(comp/defsc TxResult [this {:keys [result msgs error com.wsscode.pathom.core/reader-error]}]
{:query [:result
:msgs
:error
:com.wsscode.pathom.core/reader-error
:sticky]
:initial-state {:result nil
:msgs nil
:error nil
:com.wsscode.pathom.core/reader-error nil
:sticky false}
:componentDidMount (fn [this]
(let [props (comp/props this)]
;(debug "DID MOUNT TxResult" "props" props)
(when (and
(not (:error props))
(not (:sticky props)))
(js/setTimeout clear-tx-result! 2000))))}
(let [error (or error reader-error)]
( debug " " " error " error " result " result )
(div {:style {:position "fixed" :top "50px" :left 0 :right 0 :maxWidth 500 :margin "auto" :zIndex 1000}}
(if error
(ui-message {:error true}
(div :.content {}
(div :.ui.right.floated.negative.button
{:onClick clear-tx-result!}
"OK")
(div :.header {} "Error")
(div :.horizontal.items
(div :.item error))
(when msgs
(map-indexed
(fn [i msg]
(dom/p {:key i} msg))
msgs))))
(ui-message {:success true :onDismiss clear-tx-result!}
(div :.content {}
(div :.header {} "Success")
(dom/p {} result)
(when msgs
(map-indexed
(fn [i msg]
(dom/p {:key i} msg))
msgs))))))))
(def ui-tx-result (comp/factory TxResult))
(defn remove-ident*
"Removes an ident, if it exists, from a list of idents in app state. This
function is safe to use within mutations."
[state-map ident path-to-idents]
{:pre [(map? state-map)]}
(let [new-list (fn [old-list]
(vec (filter #(not= ident %) old-list)))]
(update-in state-map path-to-idents new-list)))
(fm/defmutation delete-sample [{:keys [sv-ident sa-ident]}]
(action [{:keys [state]}]
(debug "MUTATION delete sample" sv-ident sa-ident)
(swap! state
(fn [s]
(let [sas-path (conj sv-ident :sitevisit/Samples)
_ (debug "samples BEFORE" (get-in s sas-path))
res (-> s
(remove-ident* sa-ident sas-path)
(fs/mark-complete* sv-ident :sitevisit/Samples))
_ (debug "samples AFTER" (get-in res sas-path))]
res)))))
(defn del-sample [sv-ident sa-ident]
(comp/transact! SPA `[(delete-sample ~{:sv-ident sv-ident :sa-ident sa-ident})]))
(defmutation set-pristine
"changes a form's current state to pristine"
[{:keys [ident]}]
(action [{:keys [state]}]
(swap! state fs/entity->pristine* ident)))
(defn set-pristine! [ident]
(comp/transact! SPA `[(set-pristine {:ident ~ident})]))
(defn get-new-ident [env ident]
(if-let [new-ident-v (get-in env [:tempid->realid (second ident)])]
[(first ident) new-ident-v]
ident))
(defmutation save-entity
"saves an entity diff to the backend Datomic DB"
[{:keys [ident diff delete] :as params}]
(action [{:keys [state]}]
(if delete
(debug "DELETE ENTITY" ident)
(debug "SAVE ENTITY" ident))
(swap! state set-saving* ident true))
(remote [{:keys [state] :as env}]
(debug "SAVE ENTITY REMOTE" (:ui.riverdb/current-agency @state))
(-> env
(update-in [:ast :params] #(-> %
(dissoc :post-mutation)
(dissoc :post-params)
(dissoc :success-msg)
(assoc :agency (get-in @state [:ui.riverdb/current-agency 1]))))
;; remove reverse keys
(update-in [:ast :params :diff]
(fn [diff]
(let [new-diff (sp/transform
[sp/ALL sp/LAST sp/ALL]
#(when (not (and (keyword? (first %)) (= "_" (first (name (first %)))))) %)
diff)]
(debug "DIFF" new-diff)
new-diff)))
(fm/returning TxResult)
(fm/with-target [:root/tx-result])))
(ok-action [{:keys [state result] :as env}]
(debug "OK ACTION" "IDENT" ident "REF" (:ref env) "result" result "(comp/get-ident (:component env))" (comp/get-ident (:component env)))
(debug ":tempid->realid" (:tempid->realid env))
(debug "TRANSACTED AST" (:transacted-ast env))
(if-let [ok-err (get-in result [:body `save-entity :error])]
(do
(debug "OK ERROR" ok-err)
(swap! state
(fn [s]
(-> s
(set-saving* ident false)))))
(try
(let [{:keys [post-mutation post-params success-msg delete]} (get-in env [:transacted-ast :params])
ident (get-new-ident env ident)]
(if delete
(swap! state (fn [s] (-> s
(show-tx-result* {:result (or success-msg "Delete Succeeded")})
(set-saving* ident false)
(dissoc ident))))
(swap! state
(fn [s]
(-> s
(fs/entity->pristine* ident)
(show-tx-result* {:result (or success-msg "Save Succeeded")})
(set-saving* ident false)
(set-create* ident false)))))
(when post-mutation
(let [tempid (get-in env [:transacted-ast :params :ident 1])
new-id (get-in env [:tempid->realid tempid])
params (if new-id
(assoc post-params :new-id new-id)
params)
txd `[(~post-mutation ~params)]]
(comp/transact! SPA txd))))
(catch js/Object ex (let [ident (get-new-ident env ident)]
(log/error "OK Action handler failed: " ex)
(swap! state
(fn [st]
(-> st
(set-saving* ident false)
(assoc-in [:root/tx-result :error] (str "TX Result Handler failed: " ex))))))))))
(error-action [{:keys [app ref result state] :as env}]
(log/info "Mutation Error Result " ident diff result)
(swap! state
(fn [s]
(-> s
(set-saving* ident false)
(#(if-let [err (get-in result [:error-text])]
(assoc-in % [:root/tx-result :error] err)
%)))))))
(defsc UploadResult [this props]
{:query [:errors :msgs]}
(debug "UploadResult" props))
(defmutation upload-files [{:keys [config progress-target] :as params}]
(action [{:keys [state]}]
(debug "UPLOAD FILES" config))
(remote [env]
(-> env
(fm/returning UploadResult)))
(progress-action [{:keys [progress state] :as env}]
;(debug "PROGRESS" progress)
(swap! state assoc-in progress-target (http-remote/overall-progress env)))
(ok-action [{:keys [state result] :as env}]
(let [ident (comp/get-ident (:component env))
{:keys [tempids errors msgs] :as res} (get-in result [:body `upload-files])]
(debug "UPLOAD OK" ident res result)
(if (seq errors)
(do
(log/error "OK ERROR" (first errors))
(swap! state
(fn [s]
(-> s
(assoc-in [:root/tx-result :error] (str
(if (= (count errors) 1)
(first errors)
errors)))
(assoc-in (conj ident :ui/import-error?) true)
(cond->
(seq msgs)
(assoc-in [:root/tx-result :msgs] msgs))))))
(swap! state
(fn [s]
(-> s
(assoc-in [:root/tx-result :result] "Import completed")
(cond->
(seq msgs)
(->
(assoc-in [:root/tx-result :msgs] msgs)
(assoc-in [:root/tx-result :sticky] true)))))))))
(error-action [{:keys [app ref result state] :as env}]
(let [ident (comp/get-ident (:component env))
reader-error (get-in result [:body `upload-files :com.wsscode.pathom.core/reader-error])
error-text (get-in result [:error-text])]
(log/error "UPLOAD FILES ERROR" ident result)
(when (or reader-error error-text)
(swap! state
(fn [s]
(-> s
(assoc-in [:root/tx-result :error] (or reader-error error-text))
(assoc-in (conj ident :ui/import-error?) true)
(cond->))))))))
| null | https://raw.githubusercontent.com/thosmos/riverdb/9c8dd8d73405e703475e6b78bfdfb943dee27df3/src/main/riverdb/api/mutations.cljs | clojure | CLIENT
(defmutation attempt-login
"Fulcro mutation: Attempt to log in the user. Triggers a server interaction to see if there is already a cookie."
[{:keys [uid]}]
(action [{:keys [state]}]
(swap! state assoc
:current-user {:id uid :name ""}
:server-down false))
(remote [env] true))
(defmutation server-down
"Fulcro mutation: Called if the server does not respond so we can show an error."
[p]
(action [{:keys [state]}] (swap! state assoc :server-down true)))
clear all users
(swap! state update-in [:tac-report-data :results-rs] sort-maps-by [:date :site])
(swap! state update-in [:tac-report-page :page :field-count] inc)
(debug "SORTED" new-idents)
update the pristine state
(debug "CLEAR TX RESULT")
(debug "DID MOUNT TxResult" "props" props)
remove reverse keys
(debug "PROGRESS" progress) | (ns riverdb.api.mutations
(:require
[com.fulcrologic.fulcro.algorithms.data-targeting :as dt :refer [process-target]]
[com.fulcrologic.fulcro.algorithms.normalize :as norm]
[com.fulcrologic.fulcro.algorithms.normalized-state :refer [remove-ident]]
[com.fulcrologic.fulcro.application :as fapp]
[com.fulcrologic.fulcro.mutations :refer [defmutation]]
[com.fulcrologic.semantic-ui.collections.message.ui-message :refer [ui-message]]
[com.fulcrologic.fulcro.components :as comp :refer [defsc]]
[com.fulcrologic.fulcro.networking.http-remote :as http-remote]
[theta.log :as log :refer [debug]]
[riverdb.application :refer [SPA]]
[riverdb.ui.lookups :as looks]
[riverdb.util :as util :refer [sort-maps-by]]
[com.fulcrologic.fulcro.algorithms.merge :as merge]
[com.fulcrologic.fulcro.algorithms.form-state :as fs]
[com.fulcrologic.fulcro.mutations :as fm]
[com.fulcrologic.fulcro.algorithms.data-targeting :as targeting]
[com.fulcrologic.fulcro.dom :as dom :refer [div]]
[com.fulcrologic.fulcro.algorithms.tempid :as tempid]
[com.fulcrologic.rad.routing :as rroute]
[com.fulcrologic.rad.routing.history :as hist]
[com.fulcrologic.rad.routing.html5-history :as hist5 :refer [url->route apply-route!]]
[riverdb.ui.routes :as routes]
[com.rpl.specter :as sp]
[com.fulcrologic.fulcro.routing.dynamic-routing :as dr]
[edn-query-language.core :as eql]))
(defn set-root-key* [state key value]
(assoc state key value))
(defmutation set-root-key
"generic mutation to set a root key"
[{:keys [key value]}]
(action [{:keys [state]}]
(do
(debug "SET ROOT KEY" key value)
(swap! state set-root-key* key value))))
(defn set-root-key! [k v]
(comp/transact! SPA `[(set-root-key {:key ~k :value ~v})]))
(defmutation merge-ident [{:keys [ident props]}]
(action [{:keys [state]}]
(swap! state merge/merge-ident ident props)))
(defn merge-ident! [ident props]
(comp/transact! SPA `[(merge-ident {:ident ~ident :props ~props})]))
(defn merge-idents* [state ident-k ident-v coll & targets]
(debug "MERGE IDENT" ident-k ident-v targets)
(reduce
(fn [st m]
(let [ident [ident-k (get m ident-v)]
st (merge/merge-ident st ident m)
st' (if targets
(apply dt/integrate-ident* st ident targets)
st)]
st'))
state coll))
(defmutation merge-idents
"merge a collection of maps that conform to the ident of the comp c"
[{:keys [ident-k ident-v coll targets]}]
(action [{:keys [state]}]
(debug "MERGE IDENTS" ident-k ident-v targets)
(swap! state (fn [st]
(reduce
(fn [st m]
(let [ident [ident-k (get m ident-v)]
st (merge/merge-ident st ident m)
st' (if targets
(apply dt/integrate-ident* st ident targets)
st)]
st'))
st coll)))))
(defn merge-idents! [ident-k ident-v coll & targets]
(comp/transact! SPA `[(merge-idents {:ident-k ~ident-k :ident-v ~ident-v :coll ~coll :targets ~targets})]))
(defmutation hide-server-error
""
[p]
(action [{:keys [state]}]
(swap! state dissoc :fulcro/server-error)))
(defmutation clear-new-user
"Fulcro mutation: Used for returning to the sign-in page from the login link. Clears the form."
[ignored]
(action [{:keys [state]}]
(let [uid (util/uuid)
new-user {:uid uid :name "" :password "" :password2 ""}
user-ident [:user/by-id uid]]
(swap! state (fn [s]
(-> s
(assoc-in user-ident new-user)
(assoc-in [:new-user :page :form] user-ident)))))))
(def get-year-fn (fn [ui-year years]
(if (some #{ui-year} years)
ui-year
(when-let [year (first years)]
year))))
(defsc Agency [_ _]
{:ident [:org.riverdb.db.agencylookup/gid :db/id]
:query [:db/id]})
(defsc Project [_ _]
{:ident [:org.riverdb.db.projectslookup/gid :db/id],
:query [:db/id
:riverdb.entity/ns
:projectslookup/Active
:projectslookup/ProjectID
:projectslookup/Name
{:projectslookup/AgencyRef (comp/get-query Agency)}]})
(defmutation process-project-years [{:keys [desired-route proj-k]}]
(action [{:keys [state]}]
(debug (clojure.string/upper-case "process-project-years"))
(let [agency-project-years (get-in @state [:component/id :proj-years :agency-project-years])
_ (debug "agency-project-years" agency-project-years)
current-project (get @state :ui.riverdb/current-project)
current-year (get @state :ui.riverdb/current-year)
proj-k (or proj-k
(if current-project
(keyword (:projectslookup/ProjectID current-project))
(ffirst agency-project-years)))
project (when proj-k
(get-in agency-project-years [proj-k :project]))
sites (when proj-k
(get-in agency-project-years [proj-k :sites]))
years (when proj-k
(get-in agency-project-years [proj-k :years]))
year (when years
(get-year-fn current-year years))]
(swap! state
(fn [st]
(cond-> st
project
(merge/merge-component Project project :replace [:ui.riverdb/current-project])
sites
(->
(set-root-key* :ui.riverdb/current-project-sites [])
(merge-idents* :org.riverdb.db.stationlookup/gid :db/id sites
:append [:ui.riverdb/current-project-sites]))
year
(set-root-key* :ui.riverdb/current-year year))))
(when desired-route
(debug "ROUTE TO desired-route" desired-route)
(let [params (:params desired-route)
rad? (:_rp_ params)]
(if rad?
(do
(log/debug "RAD ROUTE" desired-route)
(hist5/apply-route! SPA desired-route))
(do
(log/debug "NON-RAD ROUTE" desired-route)
(dr/change-route! SPA (:route desired-route))
(hist/replace-route! SPA (:route desired-route) (:params desired-route)))))))))
(defmutation process-tac-report
"TAC Report post process"
[p]
(action [{:keys [state]}]
(do
(debug "TAC POST PROCESS" p)
(swap! state update-in [:tac-report-data :no-results-rs] sort-maps-by [:site :date]))))
(defmutation clear-tac-report
"clear :tac-report-data from local state"
[p]
(action [{:keys [state]}]
(do
(debug "CLEAR TAC DATA")
(swap! state dissoc :tac-report-data))))
(defmutation set-current-agency
""
[{:keys [agency key]}]
(action [{:keys [state]}]
(do
(debug "SET CURRENT AGENCY" key agency)
(swap! state assoc key agency))))
(defmutation clear-agency-project-years
""
[{:keys [ident]}]
(action [{:keys [state]}]
(do
(debug "CLEAR AGENCY PROJECT YEARS")
(swap! state update-in ident (fn [st] (-> st
(dissoc :agency-project-years)
(dissoc :ui/project-code)
(dissoc :ui/proj-year)))))))
(defmutation process-all-years
"All Years post process"
[p]
(action [{:keys [state]}]
(do
(debug "POST PROCESS ALL YEARS" p)
(swap! state update :all-years-data sort-maps-by [:date]))))
(defmutation sort-years
[p]
(action [{:keys [state]}]
(do
(debug "SORT YEARS")
(swap! state update :all-sitevisit-years (partial sort >)))))
(defmutation set-project
[p]
(action [{:keys [state]}]
(let [prj (:ui/project-code p)]
(debug "MUTATION set-project" prj)
(swap! state assoc-in [:myvals :project] prj))))
(defmutation process-agency-project-years
[p]
(action [{:keys [state]}]
(debug "process-agency-project-years")
(swap! state update :agency-project-years
(fn [prjs]
(reduce-kv
(fn [prjs k v]
(assoc-in prjs [k :years] (vec (sort > (:years v)))))
prjs
prjs)))))
(defmutation refresh
[p]
(action [_]
(debug "NOP just to refresh the current component")))
(defmutation update-report-year [p]
(action [{:keys [state]}]
(let [year (:year p)
year (if-not (= year "") (js/parseInt year) year)]
(debug "MUTATE REPORT YEAR" year)
(swap! state assoc-in [:tac-report-page :page :ui/year] year))))
(defn sort-ident-list-by*
"Sort the idents in the list path by the indicated field. Returns the new app-state."
([state path sort-fn]
(sort-ident-list-by* state path sort-fn nil))
([state path sort-fn ident-key]
(let [idents (get-in state path [])
ident-key (or ident-key (ffirst idents))
items (map (fn [ident] (get-in state ident)) idents)
sorted-items (sort-by sort-fn items)
new-idents (mapv (fn [item] [ident-key (:db/id item)]) sorted-items)]
(assoc-in state path new-idents))))
(defmutation sort-ident-list-by
"sorts a seq of maps at target location by running sort-fn on the maps"
[{:keys [idents-path sort-fn ident-key]}]
(action [{:keys [state]}]
(debug "SORTING SITES")
(swap! state sort-ident-list-by* idents-path sort-fn ident-key)))
(defmutation save-project [{:keys [id diff]}]
(action [{:keys [state]}]
(swap! state (fn [s]
(-> s
(fs/entity->pristine* [:org.riverdb.db.projectslookup/gid id])))))
(remote [env] true))
(defmutation reset-form [{:keys [ident]}]
(action [{:keys [state]}]
(debug "RESET FORM" ident "DIRTY" (get-in @state ident) "PRISTINE" (-> @state
(fs/pristine->entity* ident)
(get-in ident)))
(swap! state fs/pristine->entity* ident)))
(defmutation cancel-new-form! [{:keys [ident]}]
(action [{:keys [state]}]
(debug "MUTATION cancel-new-form!" ident)))
(defmutation set-enum [{:keys [key value]}]
(action [{:keys [state component]}]
(let [comp-ident (comp/get-ident component)]
(debug "set-enum" comp-ident key value)
(if (eql/ident? value)
(swap! state
#(-> %
(assoc-in (conj comp-ident key) value)
(fs/mark-complete* comp-ident key)))
(log/error "set-enum requires an ident as a value")))))
(defn set-enum! [this key value]
(comp/transact! this [(set-enum {:key key :value value})]))
(defn clear-tx-result* [state]
(assoc state :root/tx-result {}))
(defmutation clear-tx-result [{:keys [] :as params}]
(action [{:keys [state]}]
(swap! state clear-tx-result*)))
(defn clear-tx-result! []
(comp/transact! SPA `[(clear-tx-result)]))
(defn show-tx-result* [state result]
( debug " SHOW TX RESULT " )
(when-not (:error result)
(js/setTimeout clear-tx-result! 2000))
(assoc state :root/tx-result result))
(defmutation show-tx-result [result]
(action [{:keys [state]}]
(swap! state (fn [s] (assoc-in s [:root/tx-result] result)))))
(defn show-tx-result! [result]
(comp/transact! SPA `[(show-tx-result ~result)]))
(defn set-create* [state ident creating]
(assoc-in state (conj ident :ui/create) creating))
(defn set-saving* [state ident busy]
(assoc-in state (conj ident :ui/saving) busy))
(defmutation set-saving [{:keys [ident busy]}]
(action [{:keys [state]}]
(swap! state set-saving* ident busy)))
(defn set-saving! [ident busy]
(comp/transact! SPA `[(set-saving {:ident ~ident :busy ~busy})]))
(comp/defsc TxResult [this {:keys [result msgs error com.wsscode.pathom.core/reader-error]}]
{:query [:result
:msgs
:error
:com.wsscode.pathom.core/reader-error
:sticky]
:initial-state {:result nil
:msgs nil
:error nil
:com.wsscode.pathom.core/reader-error nil
:sticky false}
:componentDidMount (fn [this]
(let [props (comp/props this)]
(when (and
(not (:error props))
(not (:sticky props)))
(js/setTimeout clear-tx-result! 2000))))}
(let [error (or error reader-error)]
( debug " " " error " error " result " result )
(div {:style {:position "fixed" :top "50px" :left 0 :right 0 :maxWidth 500 :margin "auto" :zIndex 1000}}
(if error
(ui-message {:error true}
(div :.content {}
(div :.ui.right.floated.negative.button
{:onClick clear-tx-result!}
"OK")
(div :.header {} "Error")
(div :.horizontal.items
(div :.item error))
(when msgs
(map-indexed
(fn [i msg]
(dom/p {:key i} msg))
msgs))))
(ui-message {:success true :onDismiss clear-tx-result!}
(div :.content {}
(div :.header {} "Success")
(dom/p {} result)
(when msgs
(map-indexed
(fn [i msg]
(dom/p {:key i} msg))
msgs))))))))
(def ui-tx-result (comp/factory TxResult))
(defn remove-ident*
"Removes an ident, if it exists, from a list of idents in app state. This
function is safe to use within mutations."
[state-map ident path-to-idents]
{:pre [(map? state-map)]}
(let [new-list (fn [old-list]
(vec (filter #(not= ident %) old-list)))]
(update-in state-map path-to-idents new-list)))
(fm/defmutation delete-sample [{:keys [sv-ident sa-ident]}]
(action [{:keys [state]}]
(debug "MUTATION delete sample" sv-ident sa-ident)
(swap! state
(fn [s]
(let [sas-path (conj sv-ident :sitevisit/Samples)
_ (debug "samples BEFORE" (get-in s sas-path))
res (-> s
(remove-ident* sa-ident sas-path)
(fs/mark-complete* sv-ident :sitevisit/Samples))
_ (debug "samples AFTER" (get-in res sas-path))]
res)))))
(defn del-sample [sv-ident sa-ident]
(comp/transact! SPA `[(delete-sample ~{:sv-ident sv-ident :sa-ident sa-ident})]))
(defmutation set-pristine
"changes a form's current state to pristine"
[{:keys [ident]}]
(action [{:keys [state]}]
(swap! state fs/entity->pristine* ident)))
(defn set-pristine! [ident]
(comp/transact! SPA `[(set-pristine {:ident ~ident})]))
(defn get-new-ident [env ident]
(if-let [new-ident-v (get-in env [:tempid->realid (second ident)])]
[(first ident) new-ident-v]
ident))
(defmutation save-entity
"saves an entity diff to the backend Datomic DB"
[{:keys [ident diff delete] :as params}]
(action [{:keys [state]}]
(if delete
(debug "DELETE ENTITY" ident)
(debug "SAVE ENTITY" ident))
(swap! state set-saving* ident true))
(remote [{:keys [state] :as env}]
(debug "SAVE ENTITY REMOTE" (:ui.riverdb/current-agency @state))
(-> env
(update-in [:ast :params] #(-> %
(dissoc :post-mutation)
(dissoc :post-params)
(dissoc :success-msg)
(assoc :agency (get-in @state [:ui.riverdb/current-agency 1]))))
(update-in [:ast :params :diff]
(fn [diff]
(let [new-diff (sp/transform
[sp/ALL sp/LAST sp/ALL]
#(when (not (and (keyword? (first %)) (= "_" (first (name (first %)))))) %)
diff)]
(debug "DIFF" new-diff)
new-diff)))
(fm/returning TxResult)
(fm/with-target [:root/tx-result])))
(ok-action [{:keys [state result] :as env}]
(debug "OK ACTION" "IDENT" ident "REF" (:ref env) "result" result "(comp/get-ident (:component env))" (comp/get-ident (:component env)))
(debug ":tempid->realid" (:tempid->realid env))
(debug "TRANSACTED AST" (:transacted-ast env))
(if-let [ok-err (get-in result [:body `save-entity :error])]
(do
(debug "OK ERROR" ok-err)
(swap! state
(fn [s]
(-> s
(set-saving* ident false)))))
(try
(let [{:keys [post-mutation post-params success-msg delete]} (get-in env [:transacted-ast :params])
ident (get-new-ident env ident)]
(if delete
(swap! state (fn [s] (-> s
(show-tx-result* {:result (or success-msg "Delete Succeeded")})
(set-saving* ident false)
(dissoc ident))))
(swap! state
(fn [s]
(-> s
(fs/entity->pristine* ident)
(show-tx-result* {:result (or success-msg "Save Succeeded")})
(set-saving* ident false)
(set-create* ident false)))))
(when post-mutation
(let [tempid (get-in env [:transacted-ast :params :ident 1])
new-id (get-in env [:tempid->realid tempid])
params (if new-id
(assoc post-params :new-id new-id)
params)
txd `[(~post-mutation ~params)]]
(comp/transact! SPA txd))))
(catch js/Object ex (let [ident (get-new-ident env ident)]
(log/error "OK Action handler failed: " ex)
(swap! state
(fn [st]
(-> st
(set-saving* ident false)
(assoc-in [:root/tx-result :error] (str "TX Result Handler failed: " ex))))))))))
(error-action [{:keys [app ref result state] :as env}]
(log/info "Mutation Error Result " ident diff result)
(swap! state
(fn [s]
(-> s
(set-saving* ident false)
(#(if-let [err (get-in result [:error-text])]
(assoc-in % [:root/tx-result :error] err)
%)))))))
(defsc UploadResult [this props]
{:query [:errors :msgs]}
(debug "UploadResult" props))
(defmutation upload-files [{:keys [config progress-target] :as params}]
(action [{:keys [state]}]
(debug "UPLOAD FILES" config))
(remote [env]
(-> env
(fm/returning UploadResult)))
(progress-action [{:keys [progress state] :as env}]
(swap! state assoc-in progress-target (http-remote/overall-progress env)))
(ok-action [{:keys [state result] :as env}]
(let [ident (comp/get-ident (:component env))
{:keys [tempids errors msgs] :as res} (get-in result [:body `upload-files])]
(debug "UPLOAD OK" ident res result)
(if (seq errors)
(do
(log/error "OK ERROR" (first errors))
(swap! state
(fn [s]
(-> s
(assoc-in [:root/tx-result :error] (str
(if (= (count errors) 1)
(first errors)
errors)))
(assoc-in (conj ident :ui/import-error?) true)
(cond->
(seq msgs)
(assoc-in [:root/tx-result :msgs] msgs))))))
(swap! state
(fn [s]
(-> s
(assoc-in [:root/tx-result :result] "Import completed")
(cond->
(seq msgs)
(->
(assoc-in [:root/tx-result :msgs] msgs)
(assoc-in [:root/tx-result :sticky] true)))))))))
(error-action [{:keys [app ref result state] :as env}]
(let [ident (comp/get-ident (:component env))
reader-error (get-in result [:body `upload-files :com.wsscode.pathom.core/reader-error])
error-text (get-in result [:error-text])]
(log/error "UPLOAD FILES ERROR" ident result)
(when (or reader-error error-text)
(swap! state
(fn [s]
(-> s
(assoc-in [:root/tx-result :error] (or reader-error error-text))
(assoc-in (conj ident :ui/import-error?) true)
(cond->))))))))
|
a931f56f86f22519ed2c1c0ad44cc61150aa07edd2fbff26a6e90b1e1a85306d | mpickering/apply-refact | Extensions0.hs | {-# LANGUAGE Arrows #-}
f = id | null | https://raw.githubusercontent.com/mpickering/apply-refact/a4343ea0f4f9d8c2e16d6b16b9068f321ba4f272/tests/examples/Extensions0.hs | haskell | # LANGUAGE Arrows # | f = id |
a4e8a1e2ec1ed267fd395c73b3cd0f3ba340bdbe00ad32dfe7e7a1a2634c90fa | GaloisInc/surveyor | Debugging.hs | {-# LANGUAGE GADTs #-}
{-# LANGUAGE RankNTypes #-}
# LANGUAGE ScopedTypeVariables #
module Surveyor.Core.Handlers.Debugging ( handleDebuggingEvent ) where
import Control.Lens ( (^.), (^?), _Just )
import qualified Control.Lens as L
import Control.Monad.IO.Class ( MonadIO, liftIO )
import qualified Data.IORef as IOR
import Data.Parameterized.Some ( Some(..) )
import qualified Data.Sequence as Seq
import qualified Data.Text as T
import GHC.Stack ( HasCallStack )
import qualified Lang.Crucible.Simulator.ExecutionTree as LCSET
import qualified Prettyprinter as PP
import qualified Surveyor.Core.Architecture as SCA
import qualified Surveyor.Core.Events as SCE
import qualified Surveyor.Core.HandlerMonad as SCH
import qualified Surveyor.Core.Logging as SCL
import qualified Surveyor.Core.State as SCS
import qualified Surveyor.Core.SymbolicExecution as SymEx
import qualified Surveyor.Core.SymbolicExecution.ExecutionFeature as SCEF
noSessionFor :: (MonadIO m) => SCS.S e u arch s -> SymEx.SessionID s -> m ()
noSessionFor s0 sessionID = do
let msg = SCL.msgWithContext { SCL.logText = [ PP.pretty "No session for SessionID " <> PP.pretty sessionID
]
, SCL.logSource = SCL.EventHandler (T.pack "Debug")
, SCL.logLevel = SCL.Warn
}
liftIO $ SCS.logMessage s0 msg
sessionStateUnexpected :: (MonadIO m) => SCS.S e u arch s -> SymEx.SessionID s -> String -> m ()
sessionStateUnexpected s0 sessionID expectedState = do
let msg = SCL.msgWithContext { SCL.logText = [ PP.pretty "Symbolic execution session is not " <> PP.pretty expectedState <> PP.pretty ": " <> PP.pretty sessionID
]
, SCL.logSource = SCL.EventHandler (T.pack "Debug")
, SCL.logLevel = SCL.Warn
}
liftIO $ SCS.logMessage s0 msg
handleDebuggingEvent :: ( SCA.Architecture arch s
, SCA.CrucibleExtension arch
, MonadIO m
, HasCallStack
)
=> SCS.S e u arch s
-> SCE.DebuggingEvent s (SCS.S e u)
-> SCH.HandlerT (SCS.State e u s) m (SCS.State e u s)
handleDebuggingEvent s0 evt =
case evt of
SCE.StepExecution sessionID -> do
symExSt <- SCH.expectValue (s0 ^? SCS.lArchState . _Just . SCS.symExStateL)
Some symEx <- SCH.expectValueWith (SymEx.lookupSessionState symExSt sessionID) $ do
noSessionFor s0 sessionID
SCH.withFailAction (sessionStateUnexpected s0 sessionID "Suspended") $ do
SymEx.Suspended _symNonce suspSt <- return symEx
let msg = SCL.msgWith { SCL.logText = [ PP.pretty "Stepping session " <> PP.pretty sessionID
]
}
liftIO $ SCS.logMessage s0 msg
-- To single step, we set the debug execution feature into its
-- monitoring mode, which will cause it to stop at every state and
-- send it to surveyor.
--
-- We then resume execution to restart the process
let execFeatureStateRef = SymEx.suspendedDebugFeatureConfig suspSt
liftIO $ SCEF.modifyDebuggerState execFeatureStateRef (setDebugState SCEF.Monitoring)
liftIO $ SymEx.suspendedResumeUnmodified suspSt
Switch the symbolic execution UI to the executing state
switchToExecutingState s0 symEx
return $! SCS.State s0
SCE.StepOutExecution sessionID -> do
symExSt <- SCH.expectValue (s0 ^? SCS.lArchState . _Just . SCS.symExStateL)
Some symEx <- SCH.expectValueWith (SymEx.lookupSessionState symExSt sessionID) $ do
noSessionFor s0 sessionID
SCH.withFailAction (sessionStateUnexpected s0 sessionID "Suspended") $ do
SymEx.Suspended _symNonce suspSt <- return symEx
let execFeatureStateRef = SymEx.suspendedDebugFeatureConfig suspSt
stackDepthRef <- liftIO $ IOR.newIORef 0
liftIO $ SCEF.modifyDebuggerState execFeatureStateRef (setDebugState (SCEF.InactiveUntil (stepOutP stackDepthRef)))
liftIO $ SymEx.suspendedResumeUnmodified suspSt
switchToExecutingState s0 symEx
return $! SCS.State s0
SCE.ContinueExecution sessionID -> do
symExSt <- SCH.expectValue (s0 ^? SCS.lArchState . _Just . SCS.symExStateL)
Some symEx <- SCH.expectValueWith (SymEx.lookupSessionState symExSt sessionID) $ do
noSessionFor s0 sessionID
SCH.withFailAction (sessionStateUnexpected s0 sessionID "Suspended") $ do
SymEx.Suspended _symNonce suspSt <- return symEx
let msg = SCL.msgWith { SCL.logText = [ PP.pretty "Stepping session " <> PP.pretty sessionID
]
}
liftIO $ SCS.logMessage s0 msg
let execFeatureStateRef = SymEx.suspendedDebugFeatureConfig suspSt
liftIO $ SCEF.modifyDebuggerState execFeatureStateRef (setDebugState SCEF.Inactive)
liftIO $ SymEx.suspendedResumeUnmodified suspSt
switchToExecutingState s0 symEx
return $! SCS.State s0
SCE.InterruptExecution sessionID -> do
symExSt <- SCH.expectValue (s0 ^? SCS.lArchState . _Just . SCS.symExStateL)
Some symEx <- SCH.expectValueWith (SymEx.lookupSessionState symExSt sessionID) $ do
noSessionFor s0 sessionID
SCH.withFailAction (sessionStateUnexpected s0 sessionID "Executing") $ do
SymEx.Executing progress <- return symEx
-- Interrupt execution by switching the monitor on. The monitor will
-- send an event at its next opportunity. That event will trigger a
-- state change to the suspended execution viewer.
let execFeatureStateRef = SymEx.executionInterrupt progress
liftIO $ SCEF.modifyDebuggerState execFeatureStateRef (setDebugState SCEF.Monitoring)
return $! SCS.State s0
SCE.EnableRecording sessionID -> do
symExSt <- SCH.expectValue (s0 ^? SCS.lArchState . _Just . SCS.symExStateL)
Some symEx <- SCH.expectValueWith (SymEx.lookupSessionState symExSt sessionID) $ do
noSessionFor s0 sessionID
SCH.withFailAction (sessionStateUnexpected s0 sessionID "Suspended") $ do
SymEx.Suspended _ suspSt <- return symEx
traceRef <- liftIO $ IOR.newIORef mempty
_actualRef <- liftIO $ SCEF.modifyDebuggerState (SymEx.suspendedDebugFeatureConfig suspSt) (enableRecording traceRef)
return $! SCS.State s0
SCE.DisableRecording sessionID -> do
symExSt <- SCH.expectValue (s0 ^? SCS.lArchState . _Just . SCS.symExStateL)
Some symEx <- SCH.expectValueWith (SymEx.lookupSessionState symExSt sessionID) $ do
noSessionFor s0 sessionID
SCH.withFailAction (sessionStateUnexpected s0 sessionID "Suspended") $ do
SymEx.Suspended symNonce suspSt <- return symEx
let stateRef = SymEx.suspendedDebugFeatureConfig suspSt
liftIO $ SCEF.modifyDebuggerState stateRef disableRecording
-- If there are any states that have been recorded, save them into the
-- state for review
liftIO $ SCEF.withRecordedStates stateRef $ \mstates -> do
case mstates of
Nothing -> return ()
Just recordedStates -> do
let suspSt1 = suspSt { SymEx.suspendedHistory = Just (SymEx.RecordedStateLog 0 recordedStates) }
liftIO $ SCS.sEmitEvent s0 (SCE.UpdateSymbolicExecutionState (s0 ^. SCS.lNonce) (SymEx.Suspended symNonce suspSt1))
return $! SCS.State s0
enableRecording :: IOR.IORef (Seq.Seq (Some (LCSET.ExecState p sym ext)))
-> Some (SCEF.DebuggerFeatureState p sym ext)
-> (Some (SCEF.DebuggerFeatureState p sym ext), IOR.IORef (Seq.Seq (Some (LCSET.ExecState p sym ext))))
enableRecording newRef (Some r) =
case r of
SCEF.Recording currentRef _nestedState -> (Some r, currentRef)
SCEF.Monitoring -> (Some (SCEF.Recording newRef r), newRef)
SCEF.Inactive -> (Some (SCEF.Recording newRef r), newRef)
SCEF.InactiveUntil {} -> (Some (SCEF.Recording newRef r), newRef)
disableRecording :: Some (SCEF.DebuggerFeatureState p sym ext)
-> (Some (SCEF.DebuggerFeatureState p sym ext), ())
disableRecording (Some r) =
case r of
SCEF.Recording _currentRef nestedState -> (Some nestedState, ())
SCEF.Monitoring -> (Some r, ())
SCEF.Inactive -> (Some r, ())
SCEF.InactiveUntil {} -> (Some r, ())
-- | Set the debugger state to the given value, while keeping the current state
-- recording configuration
setDebugState :: SCEF.DebuggerFeatureState p sym ext SCEF.Normal
-> Some (SCEF.DebuggerFeatureState p sym ext)
-> (Some (SCEF.DebuggerFeatureState p sym ext), ())
setDebugState newState (Some s) =
case s of
SCEF.Recording ref _ -> (Some (SCEF.Recording ref newState), ())
SCEF.Monitoring -> (Some newState, ())
SCEF.Inactive -> (Some newState, ())
SCEF.InactiveUntil {} -> (Some newState, ())
-- | Return True once execution returns from the current function
--
-- Operationally, increment the stack depth on every call, decrement it on every
-- return. If we see a return when the depth is 0, we can return.
stepOutP :: IOR.IORef Int -> LCSET.ExecState p sym ext rtp -> IO Bool
stepOutP callDepthRef st =
case st of
LCSET.CallState {} -> do
IOR.atomicModifyIORef' callDepthRef (\d -> (d + 1, ()))
return False
LCSET.TailCallState {} -> do
IOR.atomicModifyIORef' callDepthRef (\d -> (d + 1, ()))
return False
LCSET.ReturnState {} -> do
depth <- IOR.readIORef callDepthRef
case depth of
0 -> return True
_ -> do
IOR.atomicModifyIORef' callDepthRef (\d -> (d - 1, ()))
return False
_ -> return False
-- | Construct an 'SymEx.Executing' state (from the suspended state) and switch
-- to it by sending an event
--
NOTE : This currently sets the metrics to zero ( the previous metrics could be
-- stashed in the suspended state, potentially)
switchToExecutingState :: (MonadIO m)
=> SCS.S e u arch s
-> SymEx.SymbolicExecutionState arch s SymEx.Suspend
-> m ()
switchToExecutingState s0 symEx@(SymEx.Suspended _nonce suspSt) = do
let symConf = SymEx.symbolicExecutionConfig symEx
let hdl = suspSt ^. L.to SymEx.suspendedSimState . LCSET.stateContext . L.to LCSET.printHandle
let exProgress = SymEx.ExecutionProgress { SymEx.executionMetrics = SymEx.emptyMetrics
, SymEx.executionOutputHandle = hdl
, SymEx.executionConfig = symConf
, SymEx.executionInterrupt = SymEx.suspendedDebugFeatureConfig suspSt
, SymEx.executionResume = SymEx.suspendedResumeUnmodified suspSt
}
let exState = SymEx.Executing exProgress
liftIO $ SCS.sEmitEvent s0 (SCE.UpdateSymbolicExecutionState (s0 ^. SCS.lNonce) exState)
| null | https://raw.githubusercontent.com/GaloisInc/surveyor/96b6748d811bc2ab9ef330307a324bd00e04819f/surveyor-core/src/Surveyor/Core/Handlers/Debugging.hs | haskell | # LANGUAGE GADTs #
# LANGUAGE RankNTypes #
To single step, we set the debug execution feature into its
monitoring mode, which will cause it to stop at every state and
send it to surveyor.
We then resume execution to restart the process
Interrupt execution by switching the monitor on. The monitor will
send an event at its next opportunity. That event will trigger a
state change to the suspended execution viewer.
If there are any states that have been recorded, save them into the
state for review
| Set the debugger state to the given value, while keeping the current state
recording configuration
| Return True once execution returns from the current function
Operationally, increment the stack depth on every call, decrement it on every
return. If we see a return when the depth is 0, we can return.
| Construct an 'SymEx.Executing' state (from the suspended state) and switch
to it by sending an event
stashed in the suspended state, potentially) | # LANGUAGE ScopedTypeVariables #
module Surveyor.Core.Handlers.Debugging ( handleDebuggingEvent ) where
import Control.Lens ( (^.), (^?), _Just )
import qualified Control.Lens as L
import Control.Monad.IO.Class ( MonadIO, liftIO )
import qualified Data.IORef as IOR
import Data.Parameterized.Some ( Some(..) )
import qualified Data.Sequence as Seq
import qualified Data.Text as T
import GHC.Stack ( HasCallStack )
import qualified Lang.Crucible.Simulator.ExecutionTree as LCSET
import qualified Prettyprinter as PP
import qualified Surveyor.Core.Architecture as SCA
import qualified Surveyor.Core.Events as SCE
import qualified Surveyor.Core.HandlerMonad as SCH
import qualified Surveyor.Core.Logging as SCL
import qualified Surveyor.Core.State as SCS
import qualified Surveyor.Core.SymbolicExecution as SymEx
import qualified Surveyor.Core.SymbolicExecution.ExecutionFeature as SCEF
noSessionFor :: (MonadIO m) => SCS.S e u arch s -> SymEx.SessionID s -> m ()
noSessionFor s0 sessionID = do
let msg = SCL.msgWithContext { SCL.logText = [ PP.pretty "No session for SessionID " <> PP.pretty sessionID
]
, SCL.logSource = SCL.EventHandler (T.pack "Debug")
, SCL.logLevel = SCL.Warn
}
liftIO $ SCS.logMessage s0 msg
sessionStateUnexpected :: (MonadIO m) => SCS.S e u arch s -> SymEx.SessionID s -> String -> m ()
sessionStateUnexpected s0 sessionID expectedState = do
let msg = SCL.msgWithContext { SCL.logText = [ PP.pretty "Symbolic execution session is not " <> PP.pretty expectedState <> PP.pretty ": " <> PP.pretty sessionID
]
, SCL.logSource = SCL.EventHandler (T.pack "Debug")
, SCL.logLevel = SCL.Warn
}
liftIO $ SCS.logMessage s0 msg
handleDebuggingEvent :: ( SCA.Architecture arch s
, SCA.CrucibleExtension arch
, MonadIO m
, HasCallStack
)
=> SCS.S e u arch s
-> SCE.DebuggingEvent s (SCS.S e u)
-> SCH.HandlerT (SCS.State e u s) m (SCS.State e u s)
handleDebuggingEvent s0 evt =
case evt of
SCE.StepExecution sessionID -> do
symExSt <- SCH.expectValue (s0 ^? SCS.lArchState . _Just . SCS.symExStateL)
Some symEx <- SCH.expectValueWith (SymEx.lookupSessionState symExSt sessionID) $ do
noSessionFor s0 sessionID
SCH.withFailAction (sessionStateUnexpected s0 sessionID "Suspended") $ do
SymEx.Suspended _symNonce suspSt <- return symEx
let msg = SCL.msgWith { SCL.logText = [ PP.pretty "Stepping session " <> PP.pretty sessionID
]
}
liftIO $ SCS.logMessage s0 msg
let execFeatureStateRef = SymEx.suspendedDebugFeatureConfig suspSt
liftIO $ SCEF.modifyDebuggerState execFeatureStateRef (setDebugState SCEF.Monitoring)
liftIO $ SymEx.suspendedResumeUnmodified suspSt
Switch the symbolic execution UI to the executing state
switchToExecutingState s0 symEx
return $! SCS.State s0
SCE.StepOutExecution sessionID -> do
symExSt <- SCH.expectValue (s0 ^? SCS.lArchState . _Just . SCS.symExStateL)
Some symEx <- SCH.expectValueWith (SymEx.lookupSessionState symExSt sessionID) $ do
noSessionFor s0 sessionID
SCH.withFailAction (sessionStateUnexpected s0 sessionID "Suspended") $ do
SymEx.Suspended _symNonce suspSt <- return symEx
let execFeatureStateRef = SymEx.suspendedDebugFeatureConfig suspSt
stackDepthRef <- liftIO $ IOR.newIORef 0
liftIO $ SCEF.modifyDebuggerState execFeatureStateRef (setDebugState (SCEF.InactiveUntil (stepOutP stackDepthRef)))
liftIO $ SymEx.suspendedResumeUnmodified suspSt
switchToExecutingState s0 symEx
return $! SCS.State s0
SCE.ContinueExecution sessionID -> do
symExSt <- SCH.expectValue (s0 ^? SCS.lArchState . _Just . SCS.symExStateL)
Some symEx <- SCH.expectValueWith (SymEx.lookupSessionState symExSt sessionID) $ do
noSessionFor s0 sessionID
SCH.withFailAction (sessionStateUnexpected s0 sessionID "Suspended") $ do
SymEx.Suspended _symNonce suspSt <- return symEx
let msg = SCL.msgWith { SCL.logText = [ PP.pretty "Stepping session " <> PP.pretty sessionID
]
}
liftIO $ SCS.logMessage s0 msg
let execFeatureStateRef = SymEx.suspendedDebugFeatureConfig suspSt
liftIO $ SCEF.modifyDebuggerState execFeatureStateRef (setDebugState SCEF.Inactive)
liftIO $ SymEx.suspendedResumeUnmodified suspSt
switchToExecutingState s0 symEx
return $! SCS.State s0
SCE.InterruptExecution sessionID -> do
symExSt <- SCH.expectValue (s0 ^? SCS.lArchState . _Just . SCS.symExStateL)
Some symEx <- SCH.expectValueWith (SymEx.lookupSessionState symExSt sessionID) $ do
noSessionFor s0 sessionID
SCH.withFailAction (sessionStateUnexpected s0 sessionID "Executing") $ do
SymEx.Executing progress <- return symEx
let execFeatureStateRef = SymEx.executionInterrupt progress
liftIO $ SCEF.modifyDebuggerState execFeatureStateRef (setDebugState SCEF.Monitoring)
return $! SCS.State s0
SCE.EnableRecording sessionID -> do
symExSt <- SCH.expectValue (s0 ^? SCS.lArchState . _Just . SCS.symExStateL)
Some symEx <- SCH.expectValueWith (SymEx.lookupSessionState symExSt sessionID) $ do
noSessionFor s0 sessionID
SCH.withFailAction (sessionStateUnexpected s0 sessionID "Suspended") $ do
SymEx.Suspended _ suspSt <- return symEx
traceRef <- liftIO $ IOR.newIORef mempty
_actualRef <- liftIO $ SCEF.modifyDebuggerState (SymEx.suspendedDebugFeatureConfig suspSt) (enableRecording traceRef)
return $! SCS.State s0
SCE.DisableRecording sessionID -> do
symExSt <- SCH.expectValue (s0 ^? SCS.lArchState . _Just . SCS.symExStateL)
Some symEx <- SCH.expectValueWith (SymEx.lookupSessionState symExSt sessionID) $ do
noSessionFor s0 sessionID
SCH.withFailAction (sessionStateUnexpected s0 sessionID "Suspended") $ do
SymEx.Suspended symNonce suspSt <- return symEx
let stateRef = SymEx.suspendedDebugFeatureConfig suspSt
liftIO $ SCEF.modifyDebuggerState stateRef disableRecording
liftIO $ SCEF.withRecordedStates stateRef $ \mstates -> do
case mstates of
Nothing -> return ()
Just recordedStates -> do
let suspSt1 = suspSt { SymEx.suspendedHistory = Just (SymEx.RecordedStateLog 0 recordedStates) }
liftIO $ SCS.sEmitEvent s0 (SCE.UpdateSymbolicExecutionState (s0 ^. SCS.lNonce) (SymEx.Suspended symNonce suspSt1))
return $! SCS.State s0
enableRecording :: IOR.IORef (Seq.Seq (Some (LCSET.ExecState p sym ext)))
-> Some (SCEF.DebuggerFeatureState p sym ext)
-> (Some (SCEF.DebuggerFeatureState p sym ext), IOR.IORef (Seq.Seq (Some (LCSET.ExecState p sym ext))))
enableRecording newRef (Some r) =
case r of
SCEF.Recording currentRef _nestedState -> (Some r, currentRef)
SCEF.Monitoring -> (Some (SCEF.Recording newRef r), newRef)
SCEF.Inactive -> (Some (SCEF.Recording newRef r), newRef)
SCEF.InactiveUntil {} -> (Some (SCEF.Recording newRef r), newRef)
disableRecording :: Some (SCEF.DebuggerFeatureState p sym ext)
-> (Some (SCEF.DebuggerFeatureState p sym ext), ())
disableRecording (Some r) =
case r of
SCEF.Recording _currentRef nestedState -> (Some nestedState, ())
SCEF.Monitoring -> (Some r, ())
SCEF.Inactive -> (Some r, ())
SCEF.InactiveUntil {} -> (Some r, ())
setDebugState :: SCEF.DebuggerFeatureState p sym ext SCEF.Normal
-> Some (SCEF.DebuggerFeatureState p sym ext)
-> (Some (SCEF.DebuggerFeatureState p sym ext), ())
setDebugState newState (Some s) =
case s of
SCEF.Recording ref _ -> (Some (SCEF.Recording ref newState), ())
SCEF.Monitoring -> (Some newState, ())
SCEF.Inactive -> (Some newState, ())
SCEF.InactiveUntil {} -> (Some newState, ())
stepOutP :: IOR.IORef Int -> LCSET.ExecState p sym ext rtp -> IO Bool
stepOutP callDepthRef st =
case st of
LCSET.CallState {} -> do
IOR.atomicModifyIORef' callDepthRef (\d -> (d + 1, ()))
return False
LCSET.TailCallState {} -> do
IOR.atomicModifyIORef' callDepthRef (\d -> (d + 1, ()))
return False
LCSET.ReturnState {} -> do
depth <- IOR.readIORef callDepthRef
case depth of
0 -> return True
_ -> do
IOR.atomicModifyIORef' callDepthRef (\d -> (d - 1, ()))
return False
_ -> return False
NOTE : This currently sets the metrics to zero ( the previous metrics could be
switchToExecutingState :: (MonadIO m)
=> SCS.S e u arch s
-> SymEx.SymbolicExecutionState arch s SymEx.Suspend
-> m ()
switchToExecutingState s0 symEx@(SymEx.Suspended _nonce suspSt) = do
let symConf = SymEx.symbolicExecutionConfig symEx
let hdl = suspSt ^. L.to SymEx.suspendedSimState . LCSET.stateContext . L.to LCSET.printHandle
let exProgress = SymEx.ExecutionProgress { SymEx.executionMetrics = SymEx.emptyMetrics
, SymEx.executionOutputHandle = hdl
, SymEx.executionConfig = symConf
, SymEx.executionInterrupt = SymEx.suspendedDebugFeatureConfig suspSt
, SymEx.executionResume = SymEx.suspendedResumeUnmodified suspSt
}
let exState = SymEx.Executing exProgress
liftIO $ SCS.sEmitEvent s0 (SCE.UpdateSymbolicExecutionState (s0 ^. SCS.lNonce) exState)
|
df8406311b828d2bd51ff0bdc8966e5e942fcb0be896c3f07f5bc3e8c639b1aa | brendanhay/terrafomo | Settings.hs | -- This module is auto-generated.
# LANGUAGE NoImplicitPrelude #
# LANGUAGE RecordWildCards #
# LANGUAGE StrictData #
# LANGUAGE UndecidableInstances #
# OPTIONS_GHC -fno - warn - unused - imports #
-- |
Module : . . Settings
Copyright : ( c ) 2017 - 2018
License : Mozilla Public License , v. 2.0 .
Maintainer : < brendan.g.hay+ >
-- Stability : auto-generated
Portability : non - portable ( GHC extensions )
--
module Terrafomo.Rancher.Settings
(
-- * EnvironmentMember
EnvironmentMember (..)
) where
import Data.Functor ((<$>))
import Data.Semigroup ((<>))
import GHC.Base (Proxy#, proxy#, ($))
import qualified Data.Functor.Const as P
import qualified Data.List.NonEmpty as P
import qualified Data.Map.Strict as P
import qualified Data.Maybe as P
import qualified Data.Text.Lazy as P
import qualified Prelude as P
import qualified Terrafomo.Encode as Encode
import qualified Terrafomo.HCL as TF
import qualified Terrafomo.HIL as TF
import qualified Terrafomo.Lens as Lens
import qualified Terrafomo.Rancher.Types as P
import qualified Terrafomo.Schema as TF
-- | The @member@ nested settings definition.
data EnvironmentMember s = EnvironmentMember
{ external_id :: TF.Expr s TF.Id
-- ^ @external_id@
-- - (Required)
, external_id_type :: TF.Expr s P.Text
-- ^ @external_id_type@
-- - (Required)
, role :: TF.Expr s P.Text
-- ^ @role@
-- - (Required)
} deriving (P.Show)
instance Lens.HasField "external_id" f (EnvironmentMember s) (TF.Expr s TF.Id) where
field = Lens.lens'
(external_id :: EnvironmentMember s -> TF.Expr s TF.Id)
(\s a -> s { external_id = a } :: EnvironmentMember s)
instance Lens.HasField "external_id_type" f (EnvironmentMember s) (TF.Expr s P.Text) where
field = Lens.lens'
(external_id_type :: EnvironmentMember s -> TF.Expr s P.Text)
(\s a -> s { external_id_type = a } :: EnvironmentMember s)
instance Lens.HasField "role" f (EnvironmentMember s) (TF.Expr s P.Text) where
field = Lens.lens'
(role :: EnvironmentMember s -> TF.Expr s P.Text)
(\s a -> s { role = a } :: EnvironmentMember s)
instance Lens.HasField "external_id" (P.Const r) (TF.Ref EnvironmentMember s) (TF.Expr s TF.Id) where
field = Lens.to (TF.unsafeComputed Encode.attribute (proxy# :: Proxy# "external_id"))
instance Lens.HasField "external_id_type" (P.Const r) (TF.Ref EnvironmentMember s) (TF.Expr s P.Text) where
field = Lens.to (TF.unsafeComputed Encode.attribute (proxy# :: Proxy# "external_id_type"))
instance Lens.HasField "role" (P.Const r) (TF.Ref EnvironmentMember s) (TF.Expr s P.Text) where
field = Lens.to (TF.unsafeComputed Encode.attribute (proxy# :: Proxy# "role"))
instance TF.ToHCL (EnvironmentMember s) where
toHCL EnvironmentMember{..} = TF.pairs $
P.mempty
<> TF.pair "external_id" external_id
<> TF.pair "external_id_type" external_id_type
<> TF.pair "role" role
| null | https://raw.githubusercontent.com/brendanhay/terrafomo/387a0e9341fb9cd5543ef8332dea126f50f1070e/provider/terrafomo-rancher/gen/Terrafomo/Rancher/Settings.hs | haskell | This module is auto-generated.
|
Stability : auto-generated
* EnvironmentMember
| The @member@ nested settings definition.
^ @external_id@
- (Required)
^ @external_id_type@
- (Required)
^ @role@
- (Required) |
# LANGUAGE NoImplicitPrelude #
# LANGUAGE RecordWildCards #
# LANGUAGE StrictData #
# LANGUAGE UndecidableInstances #
# OPTIONS_GHC -fno - warn - unused - imports #
Module : . . Settings
Copyright : ( c ) 2017 - 2018
License : Mozilla Public License , v. 2.0 .
Maintainer : < brendan.g.hay+ >
Portability : non - portable ( GHC extensions )
module Terrafomo.Rancher.Settings
(
EnvironmentMember (..)
) where
import Data.Functor ((<$>))
import Data.Semigroup ((<>))
import GHC.Base (Proxy#, proxy#, ($))
import qualified Data.Functor.Const as P
import qualified Data.List.NonEmpty as P
import qualified Data.Map.Strict as P
import qualified Data.Maybe as P
import qualified Data.Text.Lazy as P
import qualified Prelude as P
import qualified Terrafomo.Encode as Encode
import qualified Terrafomo.HCL as TF
import qualified Terrafomo.HIL as TF
import qualified Terrafomo.Lens as Lens
import qualified Terrafomo.Rancher.Types as P
import qualified Terrafomo.Schema as TF
data EnvironmentMember s = EnvironmentMember
{ external_id :: TF.Expr s TF.Id
, external_id_type :: TF.Expr s P.Text
, role :: TF.Expr s P.Text
} deriving (P.Show)
instance Lens.HasField "external_id" f (EnvironmentMember s) (TF.Expr s TF.Id) where
field = Lens.lens'
(external_id :: EnvironmentMember s -> TF.Expr s TF.Id)
(\s a -> s { external_id = a } :: EnvironmentMember s)
instance Lens.HasField "external_id_type" f (EnvironmentMember s) (TF.Expr s P.Text) where
field = Lens.lens'
(external_id_type :: EnvironmentMember s -> TF.Expr s P.Text)
(\s a -> s { external_id_type = a } :: EnvironmentMember s)
instance Lens.HasField "role" f (EnvironmentMember s) (TF.Expr s P.Text) where
field = Lens.lens'
(role :: EnvironmentMember s -> TF.Expr s P.Text)
(\s a -> s { role = a } :: EnvironmentMember s)
instance Lens.HasField "external_id" (P.Const r) (TF.Ref EnvironmentMember s) (TF.Expr s TF.Id) where
field = Lens.to (TF.unsafeComputed Encode.attribute (proxy# :: Proxy# "external_id"))
instance Lens.HasField "external_id_type" (P.Const r) (TF.Ref EnvironmentMember s) (TF.Expr s P.Text) where
field = Lens.to (TF.unsafeComputed Encode.attribute (proxy# :: Proxy# "external_id_type"))
instance Lens.HasField "role" (P.Const r) (TF.Ref EnvironmentMember s) (TF.Expr s P.Text) where
field = Lens.to (TF.unsafeComputed Encode.attribute (proxy# :: Proxy# "role"))
instance TF.ToHCL (EnvironmentMember s) where
toHCL EnvironmentMember{..} = TF.pairs $
P.mempty
<> TF.pair "external_id" external_id
<> TF.pair "external_id_type" external_id_type
<> TF.pair "role" role
|
6ebb2ea834efb6ec19a8ddd9c10762734978b0ae0a077fa24fdfe1c3f913244f | dyzsr/ocaml-selectml | typeplan.ml | (**************************************************************************)
(* *)
(* OCaml *)
(* *)
(* *)
Copyright 2022
(* *)
(* All rights reserved. This file is distributed under the terms of *)
the GNU Lesser General Public License version 2.1 , with the
(* special exception on linking described in the file LICENSE. *)
(* *)
(**************************************************************************)
(* Typing for query plans *)
open Longident
open Asttypes
open Parsetree
open Ast_helper
open Types
open Typedtree
open Ctype
let scope_check scopes exp =
let super = Tast_iterator.default_iterator in
let current_scope = List.hd scopes in
let outer_scopes = List.tl scopes in
let current = ref false in
let outer = ref false in
let expr self exp =
match exp.exp_desc with
| Texp_ident (Path.Pident id, _, _) ->
let scope = Ident.scope id in
if scope = current_scope then
current := true
else if List.mem scope outer_scopes then
outer := true
| _ -> super.expr self exp
in
let iterator = {super with expr} in
iterator.expr iterator exp;
!current || not !outer
let rec check_aggregate ~scopes env exp action =
let super = Tast_iterator.default_iterator in
let expr self exp =
match exp.exp_desc with
| Texp_aggregate (f, e) when scope_check scopes e ->
action exp;
check_no_aggregate ~scopes env f;
check_no_aggregate ~scopes env e;
super.expr self f
| _ -> super.expr self exp
in
let iterator = {super with expr} in
iterator.expr iterator exp
and check_no_aggregate ~scopes env exp =
check_aggregate ~scopes env exp
(fun _ -> raise (Typecore.Error (
exp.exp_loc, env, Invalid_use_of_aggregate)))
let col_gen = ref 0
let incr_col () = col_gen := !col_gen + 1
let col_of_exp exp =
let loc = exp.exp_loc in
let name = match exp.exp_desc with
| Texp_ident (_, lid, _) ->
"__col_" ^ String.concat "_" (flatten lid.txt)
| _ ->
incr_col();
"__col_" ^ string_of_int !col_gen
in
let pat = Pat.var (mkloc name loc) in
let exp =
{ exp with
exp_desc =
Texp_ident
(Path.Pident (Ident.create_local name),
mkloc (Lident name) loc,
{val_type = exp.exp_type; val_kind = Val_reg;
val_loc = loc; val_attributes = [];
val_uid = Types.Uid.mk ~current_unit:(Env.get_unit_name ());
})
} in
(pat, exp)
let expand_product exp =
match exp.exp_desc with
| Texp_tuple es ->
let pats, cols = List.split (List.map col_of_exp es) in
(es, cols, pats, { exp with exp_desc = Texp_tuple cols })
| Texp_record { fields; representation; extended_expression } ->
let exps = ref [] in
let cols = ref [] in
let pats = ref [] in
let fields = Array.map (function
| label, Kept t -> label, Kept t
| label, Overridden (lid, exp) ->
let pat, col = col_of_exp exp in
exps := exp :: !exps;
cols := col :: !cols;
pats := pat :: !pats;
label, Overridden (lid, col))
fields
in
List.rev !exps, List.rev !cols, List.rev !pats,
{ exp with exp_desc =
Texp_record {fields; representation; extended_expression}
}
| _ ->
let pat, col = col_of_exp exp in
([exp], [col], [pat], col)
let expand_aggregate ~scopes exp =
let current_scope = List.hd scopes in
let super = Tast_mapper.default in
let aggs = ref [] in
let expr self exp =
match exp.exp_desc with
| Texp_aggregate (func, arg)
when scope_check scopes arg ->
let argpat, argcol = col_of_exp arg in
let retpat, retcol = col_of_exp exp in
aggs := (arg, argcol, argpat, Some func, retcol, retpat) :: !aggs;
retcol
| Texp_ident (Path.Pident id, _, _)
when Ident.scope id = current_scope ->
let pat, col = col_of_exp exp in
aggs := (exp, col, pat, None, col, pat) :: !aggs;
col
| _ -> super.expr self exp
in
let mapper = {super with expr} in
let exp = mapper.expr mapper exp in
let aggs = List.rev !aggs in
let funcs = List.map (fun (func, _, _, _, _, _) -> func) aggs in
let arglist = List.map (fun (_, arg, _, _, _, _) -> arg) aggs in
let argcols = List.map (fun (_, _, col, _, _, _) -> col) aggs in
let argpats = List.map (fun (_, _, _, pat, _, _) -> pat) aggs in
let retcols = List.map (fun (_, _, _, _, col, _) -> col) aggs in
let retpats = List.map (fun (_, _, _, _, _, pat) -> pat) aggs in
(funcs, arglist, argcols, argpats, retcols, retpats, exp)
let build_plan ~loc env se =
let old_env = env in
let scope = create_scope () in
let child =
ref { plan_desc = Tplan_null;
plan_loc = loc;
plan_env = env;
plan_vars = Ident.empty;
plan_cardinality = One;
plan_patterns =
[Pat.construct ~loc
(mkloc (Lident "()") loc) None];
} in
let handle_from se_from =
let vars = Hashtbl.create 31 in
let rec aux srcexpr =
match srcexpr.psrc_desc with
| Psrc_exp (e, s) ->
List.iter
(fun {txt=v; loc} ->
if Hashtbl.mem vars v then
raise Typecore.(Error (loc, env, Multiply_bound_variable v));
Hashtbl.add vars v ())
s;
let tys = List.map (fun _ -> newvar ()) s in
let ty_src =
let lid = Ldot (Lident "SelectML", "src") in
let path, decl = Env.lookup_type ~loc:e.pexp_loc lid env in
assert (List.length decl.type_params = 1);
let ty = match tys with
| [ty] -> ty
| tys -> newty (Ttuple tys)
in
newconstr path [ty]
in
(* accumulate value bindings *)
let vbs = List.map2
(fun v ty ->
let id = Ident.create_scoped ~scope v.txt in
let desc =
{ val_type = ty; val_kind = Val_reg;
val_attributes = []; val_loc = v.loc;
val_uid = Uid.mk ~current_unit:(Env.get_unit_name ());
} in
id, desc)
s tys in
let exp =
Typecore.type_expect old_env e (Typecore.mk_expected ty_src) in
let env = List.fold_left
(fun env (id, desc) -> Env.add_value id desc env) env vbs in
let vars = List.fold_left
(fun vars (id, _) -> Ident.add id () vars) Ident.empty vbs in
let plan =
{ plan_loc = srcexpr.psrc_loc;
plan_desc = Tplan_source exp;
plan_env = env;
plan_vars = vars;
plan_cardinality = Many;
plan_patterns =
List.map (fun s -> Pat.var ~loc:srcexpr.psrc_loc s) s;
} in
plan, vbs
| Psrc_product (s1, s2) ->
let pl1, vbs1 = aux s1 in
let pl2, vbs2 = aux s2 in
let vbs = vbs1 @ vbs2 in
let env = List.fold_left
(fun env (id, desc) -> Env.add_value id desc env) env vbs in
let vars = List.fold_left
(fun vars (id, _) -> Ident.add id () vars) pl1.plan_vars vbs2 in
let plan =
{ plan_loc = srcexpr.psrc_loc;
plan_desc = Tplan_product (pl1, pl2);
plan_env = env;
plan_vars = vars;
plan_cardinality = Many;
plan_patterns = pl1.plan_patterns @ pl2.plan_patterns;
} in
plan, vbs1 @ vbs2
| Psrc_join (s1, s2, e) ->
let pl1, vbs1 = aux s1 in
let pl2, vbs2 = aux s2 in
let vbs = vbs1 @ vbs2 in
let joinenv = List.fold_left
(fun env (id, desc) -> Env.add_value id desc env) env vbs in
let vars = List.fold_left
(fun vars (id, _) -> Ident.add id () vars) pl1.plan_vars vbs2 in
let exp = Typecore.type_expect joinenv e
(Typecore.mk_expected Predef.type_bool) in
let plan =
{ plan_loc = srcexpr.psrc_loc;
plan_desc = Tplan_join (pl1, pl2, exp);
plan_env = joinenv;
plan_vars = vars;
plan_cardinality = Many;
plan_patterns = pl1.plan_patterns @ pl2.plan_patterns;
} in
plan, vbs
in
aux se_from
in
(* handle FROM clause *)
let env = match se.se_from with
| None -> env
| Some se_from ->
let plan, vbs = handle_from se_from in
child := plan;
List.fold_left
(fun env (id, desc) -> Env.add_value id desc env) env vbs
in
begin_se_scope scope;
let scopes = se_scopes () in
(* handle WHERE clause *)
begin match se.se_where with
| None -> ()
| Some se_where ->
let exp = Typecore.type_exp env se_where in
check_no_aggregate ~scopes env exp;
child :=
{ plan_loc = exp.exp_loc;
plan_desc = Tplan_filter (!child, exp);
plan_env = !child.plan_env;
plan_vars = !child.plan_vars;
plan_cardinality =
(match !child.plan_cardinality with
| Zero | One -> Zero | Many -> Many);
plan_patterns = !child.plan_patterns
}
end;
(* handle SELECT clause *)
let no_aggregate = ref true in
let no_extra_project = ref true in
let sel_exp =
let exp = Typecore.type_exp env se.se_select in
check_aggregate ~scopes env exp
(fun _ -> no_aggregate := false);
exp
in
if Option.is_some se.se_groupby then
no_aggregate := false;
if Option.is_some se.se_having then
no_extra_project := false;
if List.length se.se_orderby > 0 then
no_extra_project := false;
let aux sexp =
let exp = Typecore.type_exp env sexp in
check_aggregate ~scopes env exp
(fun _ -> no_aggregate := false);
exp
in
let hav_exp = match se.se_having with
| Some sexp when !no_aggregate -> Some (aux sexp)
| _ -> None
in
let ord_exps = match se.se_orderby with
| _ :: _ when !no_aggregate ->
List.map (fun (sexp, _) -> aux sexp) se.se_orderby
| _ -> []
in
let ord_dirs =
List.map
(function
| _, PAscending -> TAscending
| _, PDescending -> TDescending
| _, PUsing sexp -> TUsing (Typecore.type_exp old_env sexp))
se.se_orderby
in
let module TastOrd = struct
type t = expression
let compare t1 t2 = Stdlib.compare t1 t2
end in
let module AstOrd = struct
type t = Parsetree.expression
let compare t1 t2 = Stdlib.compare t1 t2
end in
let module TastMap = Map.Make (TastOrd) in
let untype_rmloc e =
let rmloc =
{ Ast_mapper.default_mapper with
location = (fun _self _loc -> Location.none)
} in
rmloc.expr rmloc (Untypeast.untype_expression e)
in
(* Find identical expressions *)
let find_identical (type a)
(module Ord : Map.OrderedType with type t = a)
(xs : a list) (cols : expression list)
: bool array * expression TastMap.t =
let module M = Map.Make (Ord) in
let m = ref M.empty in
let colmap = ref TastMap.empty in
let mask = List.map2
(fun x p -> match M.find_opt x !m with
| None ->
m := M.add x p !m;
colmap := TastMap.add p p !colmap;
true
| Some q ->
colmap := TastMap.add p q !colmap;
false)
xs cols
in
Array.of_list mask, !colmap
in
let filter ~mask xs =
List.filteri (fun i _ -> mask.(i)) xs
in
let substitute_columns colmap exp =
let rename exp =
let super = Tast_mapper.default in
let expr self exp =
match TastMap.find_opt exp colmap with
| None -> super.expr self exp
| Some col -> col
in
let mapper = { super with expr } in
mapper.expr mapper exp
in
rename exp
in
(* handle aggregation *)
let sel_exp, hav_exp, ord_exps =
if !no_aggregate then sel_exp, hav_exp, ord_exps else
let arglist, argcols, argpats, funcs, retcols, retpats, sel_exp =
expand_aggregate ~scopes sel_exp in
let prj_list = ref arglist in
let prj_cols = ref argcols in
let prj_pats = ref argpats in
let agg_funcs = ref funcs in
let agg_list = ref argcols in
let agg_cols = ref retcols in
let agg_pats = ref retpats in
let aux exp =
let arglist, argcols, argpats, funcs, retcols, retpats, exp =
expand_aggregate ~scopes exp in
prj_list := !prj_list @ arglist;
prj_cols := !prj_cols @ argcols;
prj_pats := !prj_pats @ argpats;
agg_funcs := !agg_funcs @ funcs;
agg_list := !agg_list @ argcols;
agg_cols := !agg_cols @ retcols;
agg_pats := !agg_pats @ retpats;
exp
in
let hav_exp =
Option.map aux
(match se.se_having, hav_exp with
| None, _ -> None
| Some sexp, None -> Some (Typecore.type_exp env sexp)
| Some _, Some exp -> Some exp)
in
let ord_exps =
List.map aux
(match se.se_orderby, ord_exps with
| [], _ -> []
| sexps, [] ->
List.map (fun (sexp, _) -> Typecore.type_exp env sexp) sexps
| _, exps -> exps)
in
(* handle GROUP BY clause *)
let grp_exp =
Option.map
(fun sexp ->
let exp = Typecore.type_exp env sexp in
check_no_aggregate ~scopes env exp;
let list, cols, pats, exp = expand_product exp in
prj_list := !prj_list @ list;
prj_cols := !prj_cols @ cols;
prj_pats := !prj_pats @ pats;
exp)
se.se_groupby
in
(* merge identical columns *)
let mask, colmap =
let xs = List.map untype_rmloc !prj_list in
find_identical (module AstOrd) xs !prj_cols
in
prj_list := filter ~mask !prj_list;
prj_cols := filter ~mask !prj_cols;
prj_pats := filter ~mask !prj_pats;
let grp_exp = Option.map (substitute_columns colmap) grp_exp in
agg_list := List.map (substitute_columns colmap) !agg_list;
agg_funcs := List.map (Option.map (substitute_columns colmap)) !agg_funcs;
(* build an auxiliary project before grouping *)
child :=
{ plan_loc = loc;
plan_desc = Tplan_project (!child, !prj_list);
plan_env = !child.plan_env;
plan_vars = !child.plan_vars;
plan_cardinality = !child.plan_cardinality;
plan_patterns = !prj_pats;
};
(* build aggregation *)
let module Ord = struct
type t = Parsetree.expression option * Parsetree.expression
let compare = Stdlib.compare
end in
let mask, colmap =
let xs = List.map2
(fun f e -> Option.map untype_rmloc f, untype_rmloc e)
!agg_funcs !agg_list in
find_identical (module Ord) xs !agg_cols
in
agg_funcs := filter ~mask !agg_funcs;
agg_list := filter ~mask !agg_list;
agg_pats := filter ~mask !agg_pats;
let sel_exp = substitute_columns colmap sel_exp in
let hav_exp = Option.map (substitute_columns colmap) hav_exp in
let ord_exps = List.map (substitute_columns colmap) ord_exps in
begin match grp_exp with
| None ->
child :=
{ plan_loc = loc;
plan_desc =
Tplan_aggregate_all (!child, !agg_funcs, !agg_list);
plan_env = !child.plan_env;
plan_vars = !child.plan_vars;
plan_cardinality = One;
plan_patterns = !agg_pats;
}
| Some grp_exp ->
let plan_loc = grp_exp.exp_loc in
child :=
{ plan_loc;
plan_desc =
Tplan_aggregate (!child, grp_exp, !agg_funcs, !agg_list);
plan_env = !child.plan_env;
plan_vars = !child.plan_vars;
plan_cardinality = !child.plan_cardinality;
plan_patterns = !agg_pats;
}
end;
(sel_exp, hav_exp, ord_exps)
in
(* handle HAVING and ORDER BY clauses *)
let sel_exp =
if !no_extra_project then sel_exp else
let sel_list, sel_cols, sel_pats, sel_exp =
expand_product sel_exp in
let prj_list = ref sel_list in
let prj_cols = ref sel_cols in
let prj_pats = ref sel_pats in
let aux = fun exp ->
let list, cols, pats, exp = expand_product exp in
prj_list := !prj_list @ list;
prj_cols := !prj_cols @ cols;
prj_pats := !prj_pats @ pats;
exp
in
let hav_exp = Option.map aux hav_exp in
let ord_exps = List.map aux ord_exps in
(* merge identical columns *)
let mask, colmap =
let xs = List.map untype_rmloc !prj_list in
find_identical (module AstOrd) xs !prj_cols
in
prj_list := filter ~mask !prj_list;
prj_pats := filter ~mask !prj_pats;
let sel_exp = substitute_columns colmap sel_exp in
let hav_exp = Option.map (substitute_columns colmap) hav_exp in
let ord_exps = List.map (substitute_columns colmap) ord_exps in
(* build an auxiliary project *)
child :=
{ plan_loc = loc;
plan_desc = Tplan_project (!child, !prj_list);
plan_env = !child.plan_env;
plan_vars = !child.plan_vars;
plan_cardinality = !child.plan_cardinality;
plan_patterns = !prj_pats;
};
Option.iter (fun exp ->
child :=
{ plan_loc = exp.exp_loc;
plan_desc = Tplan_filter (!child, exp);
plan_env = !child.plan_env;
plan_vars = !child.plan_vars;
plan_cardinality =
(match !child.plan_cardinality with
| Zero | One -> Zero | Many -> Many);
plan_patterns = !prj_pats;
})
hav_exp;
begin match !child.plan_cardinality with
| Zero | One -> ()
| Many ->
if List.length ord_exps > 0 then
child :=
{ plan_loc = se.se_orderby_loc;
plan_desc = Tplan_sort (!child, ord_exps, ord_dirs);
plan_env = !child.plan_env;
plan_vars = !child.plan_vars;
plan_cardinality = !child.plan_cardinality;
plan_patterns = !child.plan_patterns;
}
end;
sel_exp
in
(* build the final project *)
child :=
{ plan_loc = sel_exp.exp_loc;
plan_desc = Tplan_project (!child, [sel_exp]);
plan_env = !child.plan_env;
plan_vars = !child.plan_vars;
plan_cardinality = !child.plan_cardinality;
plan_patterns = [];
};
if se.se_distinct.txt then
child :=
{ plan_loc = se.se_distinct.loc;
plan_desc = Tplan_unique !child;
plan_env = !child.plan_env;
plan_vars = !child.plan_vars;
plan_cardinality = !child.plan_cardinality;
plan_patterns = [];
};
end_se_scope ();
!child
let type_aggregate env sfunct sarg =
let lid = Ldot (Lident "Stdlib", "agg") in
let path, decl = Env.lookup_type ~loc:sfunct.pexp_loc lid env in
let vars = Ctype.instance_list decl.type_params in
let ty_arg, ty_ret =
match vars with
| [arg; ret] -> arg, ret
| _ -> failwith "type_aggregate"
in
let ty_funct = newconstr path vars in
let funct = Typecore.type_expect env sfunct
(Typecore.mk_expected ty_funct) in
let arg = Typecore.type_expect env sarg
(Typecore.mk_expected ty_arg) in
funct, arg, ty_ret
let transl env plan =
let open Untypeast in
let open Location in
let loc = plan.plan_loc in
let lident ?(loc=loc) txt =
let strs = String.split_on_char '.' (String.trim txt) in
let lid = match unflatten strs with
| None -> failwith "transl"
| Some lid -> lid
in
mkloc lid loc
in
let lunit = lident "()" in
let punit = Pat.construct lunit None in
let pvar s = Pat.var (mkloc s loc) in
let pint n = Pat.constant (Const.int n) in
let ptup = function
| [] -> punit
| [p] -> p
| pats -> Pat.tuple pats
in
let pconstr lid params =
match params with
| [] -> Pat.construct lid None
| ps -> Pat.construct lid (Some ([], ptup ps))
in
let eunit = Exp.construct lunit None in
let eid txt = Exp.ident (lident ~loc txt) in
let eint n = Exp.constant (Const.int n) in
let etup = function
| [] -> eunit
| [e] -> e
| exps -> Exp.tuple exps
in
let fun_ pats exp =
List.fold_right
(fun pat exp -> Exp.fun_ ~loc Nolabel None pat exp)
pats exp
in
let ($) func arg = Exp.apply func [Nolabel, arg] in
let rec exp_of_pat pat =
let loc = pat.Parsetree.ppat_loc in
match pat.Parsetree.ppat_desc with
| Ppat_var s -> Exp.ident ~loc (mkloc (Lident s.txt) loc)
| Ppat_construct ({txt=Lident "()"; _}, None) -> eunit
| Ppat_tuple l -> etup (List.map exp_of_pat l)
| _ -> assert false
in
let (||>) a b = b $ a in
let cmp = eid "Stdlib.compare" in
let firstrow = eid "Stdlib.firstrow" in
let cagg = lident "Stdlib.Agg" in
let csome = lident "Stdlib.Option.Some" in
let cnone = lident "Stdlib.Option.None" in
let input = eid "SelectML.input" in
let output = eid "SelectML.output" in
let one = eid "SelectML.one" in
let singleton = eid "SelectML.singleton" in
let product = eid "SelectML.product" in
let join = eid "SelectML.join" in
let equijoin = eid "SelectML.equijoin" in
let map = eid "SelectML.map" in
let filter = eid "SelectML.filter" in
let sort = eid "SelectML.sort" in
let unique = eid "SelectML.unique" in
let group_all = eid "SelectML.group_all" in
let group = eid "SelectML.group" in
let mkagg pat fs es =
let accpat = ptup
(List.mapi (fun i _ -> pvar ("__tmp_acc" ^ string_of_int i)) fs) in
let accexps =
List.mapi (fun i _ -> eid ("__tmp_acc" ^ string_of_int i)) fs in
let exps = List.combine accexps es in
let vbs, fs = List.mapi
(fun i f ->
let n = string_of_int i in
let acc = "__tmp_accum" ^ n in
let iter = "__tmp_iter" ^ n in
let res = "__tmp_result" ^ n in
match f with
| None ->
Vb.mk (pconstr cagg [pvar acc; pvar iter; pvar res]) firstrow,
(eid acc, eid iter, eid res)
| Some f ->
Vb.mk (pconstr cagg [pvar acc; pvar iter; pvar res]) f,
(eid acc, eid iter, eid res))
fs
|> List.split
in
let accum = etup (List.map (fun (acc, _, _) -> acc) fs) in
let iter = fun_ [accpat; pat] @@ etup
(List.map2 (fun (_, iter, _) (acc, e) -> iter $ acc $ e) fs exps)
in
let res = fun_ [accpat] @@ etup
(List.map2 (fun (_, _, res) acc -> res $ acc) fs accexps)
in
List.fold_right
(fun vb exp -> Exp.let_ Nonrecursive [vb] exp)
vbs
(Exp.construct cagg @@ Some (etup [accum; iter; res]))
in
(* check SelectML module *)
let () =
let check_exp =
eid "ignore" $ Exp.constraint_
(Exp.pack (Mod.ident (lident "SelectML")))
(Typ.package (lident "Stdlib.SelectMLType") [])
in
ignore (Typecore.type_exp env check_exp)
in
let rec aux plan =
match plan.plan_desc with
| Tplan_null -> singleton $ eunit
| Tplan_source e -> input $ untype_expression e
| Tplan_product (pl1, pl2) ->
let pat1 = ptup pl1.plan_patterns in
let pat2 = ptup pl2.plan_patterns in
let exp = etup @@
List.map exp_of_pat (pl1.plan_patterns @ pl2.plan_patterns) in
product $ fun_ [pat1; pat2] exp $ aux pl1 $ aux pl2
| Tplan_join (pl1, pl2, e) ->
let pat1 = ptup pl1.plan_patterns in
let pat2 = ptup pl2.plan_patterns in
let exp = etup @@
List.map exp_of_pat (pl1.plan_patterns @ pl2.plan_patterns) in
let cond = untype_expression e in
join $ fun_ [pat1; pat2]
(Exp.ifthenelse cond
(Exp.construct csome (Some exp))
(Some (Exp.construct cnone None)))
$ aux pl1 $ aux pl2
| Tplan_equijoin (pl1, e1, pl2, e2) ->
let pat1 = ptup pl1.plan_patterns in
let pat2 = ptup pl2.plan_patterns in
let exp = etup @@
List.map exp_of_pat (pl1.plan_patterns @ pl2.plan_patterns) in
let key1 = untype_expression e1 in
let key2 = untype_expression e2 in
equijoin $ fun_ [pat1; pat2] exp
$ aux pl1 $ fun_ [pat1] key1
$ aux pl2 $ fun_ [pat2] key2
| Tplan_project (pl, es) ->
let pat = ptup pl.plan_patterns in
let exp = etup (List.map untype_expression es) in
aux pl ||> (map $ fun_ [pat] exp)
| Tplan_filter (pl, e) ->
let pat = ptup pl.plan_patterns in
let exp = untype_expression e in
aux pl ||> (filter $ fun_ [pat] exp)
| Tplan_sort (pl, es, os) ->
let pat = ptup pl.plan_patterns in
let exp = etup (List.map untype_expression es) in
let cmpfunc =
let args = [pvar "__tmp_key"; pvar "__tmp_a"; pvar "__tmp_b"] in
let body =
let p1 = ptup
(List.mapi (fun i _ -> pvar ("__tmp_a" ^ string_of_int i)) os) in
let p2 = ptup
(List.mapi (fun i _ -> pvar ("__tmp_b" ^ string_of_int i)) os) in
let rec loop i os =
let aux o =
let a = eid ("__tmp_a" ^ string_of_int i) in
let b = eid ("__tmp_b" ^ string_of_int i) in
match o with
| TAscending -> cmp $ a $ b
| TDescending -> cmp $ b $ a
| TUsing e -> untype_expression e $ a $ b
in
match os with
| [] -> eint 0
| o :: os ->
Exp.match_ (aux o)
[Exp.case (pint 0) (loop (i+1) os);
Exp.case (pvar "__tmp_res") (eid "__tmp_res")]
in
Exp.let_ Nonrecursive
[Vb.mk p1 (eid "__tmp_key" $ eid "__tmp_a");
Vb.mk p2 (eid "__tmp_key" $ eid "__tmp_b")]
(loop 0 os)
in
fun_ args body
in
let func =
Exp.let_ Nonrecursive
[Vb.mk (pvar "__tmp_key") (fun_ [pat] exp);
Vb.mk (pvar "__tmp_cmp") cmpfunc]
(sort $ (eid "__tmp_cmp" $ eid "__tmp_key"))
in
aux pl ||> func
| Tplan_aggregate_all (pl, fs, es) ->
let pat = ptup pl.plan_patterns in
let fs = List.map (Option.map untype_expression) fs in
let es = List.map untype_expression es in
aux pl ||> (group_all $ mkagg pat fs es) ||> singleton
| Tplan_aggregate (pl, e, fs, es) ->
let pat = ptup pl.plan_patterns in
let exp = untype_expression e in
let fs = List.map (Option.map untype_expression) fs in
let es = List.map untype_expression es in
let key = fun_ [pat] exp in
aux pl ||> (group $ key $ mkagg pat fs es)
| Tplan_unique pl -> aux pl ||> unique
in
let ast = aux plan in
match plan.plan_cardinality with
| One -> one $ ast
| Zero | Many -> output $ ast
let type_select ~loc env se ty_expected_explained =
let plan = build_plan ~loc env se in
let transl pl =
Typecore.type_expect env (transl env pl) ty_expected_explained in
plan, transl
let () =
Typecore.type_select := type_select;
Typecore.type_aggregate := type_aggregate
(* Query plan optimization *)
let pushdown_predicates plan =
let open Either in
let is_and : Types.value_description -> bool = function
| { val_kind =
Val_prim { Primitive.prim_name = "%sequand";
prim_arity = 2 } } ->
true
| _ -> false
in
let is_eq : Types.value_description -> bool = function
| { val_kind =
Val_prim { Primitive.prim_name = "%equal";
prim_arity = 2 } } ->
true
| _ -> false
in
let is_related_to pl pred =
let result = ref false in
let super = Tast_iterator.default_iterator in
let expr self pred =
match pred.exp_desc with
| Texp_ident (Path.Pident id, _, _) ->
begin try
ignore (Ident.find_same id pl.plan_vars);
result := true;
with Not_found -> ()
end
| _ -> super.expr self pred
in
let iterator = { super with expr } in
iterator.expr iterator pred;
!result
in
let extract_related_preds pred pl =
let rec split_ands acc pred =
match pred.exp_desc with
| Texp_apply ({exp_desc = Texp_ident (_, _, vd)},
[Nolabel, Some e1; Nolabel, Some e2])
when is_and vd ->
split_ands (split_ands acc e1) e2
| _ ->
pred :: acc
in
List.partition (is_related_to pl) (split_ands [] pred)
in
let extract_eq_keys pred pl1 pl2 =
match pred.exp_desc with
| Texp_apply ({exp_desc = Texp_ident (_, _, vd)},
[Nolabel, Some e1; Nolabel, Some e2])
when is_eq vd ->
begin match
is_related_to pl1 e1, is_related_to pl2 e1,
is_related_to pl1 e2, is_related_to pl2 e2
with
| true, false, false, true ->
Left (Left (e1, e2))
| false, true, true, false ->
Left (Left (e2, e1))
| true, false, _, false | _, false, true, false ->
Right (Left pred)
| false, true, false, _ | false, _, false, true ->
Right (Right pred)
| _ ->
Left (Right pred)
end
| _ ->
begin match is_related_to pl1 pred, is_related_to pl2 pred with
| true, false ->
Right (Left pred)
| false, true ->
Right (Right pred)
| _ ->
Left (Right pred)
end
in
let rec aux plan related_preds =
let loc = plan.plan_loc in
let env = plan.plan_env in
let make_pred = function
| [] -> assert false
| hd :: tl ->
let lid = Ldot (Lident "Stdlib", "&&") in
let path, desc = Env.lookup_value ~loc lid env in
List.fold_left
(fun acc pred ->
{ exp_desc = Texp_apply (
{ exp_desc = Texp_ident (path, mkloc lid loc, desc);
exp_loc = loc;
exp_type = desc.val_type;
exp_env = env;
exp_extra = [];
exp_attributes = [];
},
[ Nolabel, Some acc;
Nolabel, Some pred ]
);
exp_loc = loc;
exp_type = Predef.type_bool;
exp_env = env;
exp_extra = [];
exp_attributes = [];
})
hd tl
in
let make_key = function
| [] -> assert false
| key :: [] -> key
| keys ->
{ exp_desc = Texp_tuple keys;
exp_loc = loc;
exp_type = newty (Ttuple (List.map (fun e -> e.exp_type) keys));
exp_env = env;
exp_extra = [];
exp_attributes = [];
}
in
match plan.plan_desc with
| Tplan_filter (pl, pred) ->
let related, unrelated = extract_related_preds pred pl in
let pl, unrelated_preds = aux pl (related @ related_preds) in
begin match unrelated @ unrelated_preds with
| [] -> pl
| preds ->
{ plan with plan_desc = Tplan_filter (pl, make_pred preds) }
end, []
| Tplan_source _ ->
begin match related_preds with
| [] -> plan
| preds ->
{ plan with plan_desc = Tplan_filter (plan, make_pred preds) }
end, []
| Tplan_product (pl1, pl2) ->
let keys1, keys2, general_preds, pl1_preds, pl2_preds =
List.fold_left
(fun (keys1, keys2, general_preds, pl1_preds, pl2_preds) pred ->
match extract_eq_keys pred pl1 pl2 with
| Left (Left (key1, key2)) ->
key1 :: keys1, key2 :: keys2,
general_preds, pl1_preds, pl2_preds
| Left (Right pred) ->
keys1, keys2, pred :: general_preds, pl1_preds, pl2_preds
| Right (Left pred) ->
keys1, keys2, general_preds, pred :: pl1_preds, pl2_preds
| Right (Right pred) ->
keys1, keys2, general_preds, pl1_preds, pred :: pl2_preds)
([], [], [], [], [])
related_preds
in
begin match keys1, keys2, general_preds with
| [], [], [] ->
{ plan with plan_desc =
Tplan_product (
fst (aux pl1 pl1_preds),
fst (aux pl2 pl2_preds))
}
| [], [], join_preds ->
{ plan with plan_desc =
Tplan_join (
fst (aux pl1 pl1_preds),
fst (aux pl2 pl2_preds),
make_pred join_preds)
}
| (_ :: _), (_ :: _), [] ->
{ plan with plan_desc =
Tplan_equijoin (
fst (aux pl1 pl1_preds), make_key keys1,
fst (aux pl2 pl2_preds), make_key keys2)
}
| (_ :: _), (_ :: _), preds ->
{ plan with plan_desc =
Tplan_filter (
{ plan with plan_desc =
Tplan_equijoin (
fst (aux pl1 pl1_preds), make_key keys1,
fst (aux pl2 pl2_preds), make_key keys2)
},
make_pred preds)
}
| _, _, _ -> assert false
end, []
| Tplan_join (pl1, pl2, pred) ->
aux { plan with plan_desc =
Tplan_filter (
{ plan with plan_desc = Tplan_product (pl1, pl2) },
pred)
}
related_preds
| Tplan_project (pl, es) ->
{plan with plan_desc = Tplan_project (fst (aux pl []), es)},
related_preds
| Tplan_sort (pl, es, os) ->
{plan with plan_desc = Tplan_sort (fst (aux pl []), es, os)},
related_preds
| Tplan_aggregate_all (pl, fs, es) ->
{plan with plan_desc = Tplan_aggregate_all (fst (aux pl []), fs, es)},
related_preds
| Tplan_aggregate (pl, e, fs, es) ->
{plan with plan_desc = Tplan_aggregate (fst (aux pl []), e, fs, es)},
related_preds
| Tplan_unique pl ->
{plan with plan_desc = Tplan_unique (fst (aux pl []))},
related_preds
| _ ->
plan, related_preds
in
fst (aux plan [])
let optimize pl = pushdown_predicates pl
| null | https://raw.githubusercontent.com/dyzsr/ocaml-selectml/4b5777d28ad5d26ec091898c90a997821258ddb5/typing/typeplan.ml | ocaml | ************************************************************************
OCaml
All rights reserved. This file is distributed under the terms of
special exception on linking described in the file LICENSE.
************************************************************************
Typing for query plans
accumulate value bindings
handle FROM clause
handle WHERE clause
handle SELECT clause
Find identical expressions
handle aggregation
handle GROUP BY clause
merge identical columns
build an auxiliary project before grouping
build aggregation
handle HAVING and ORDER BY clauses
merge identical columns
build an auxiliary project
build the final project
check SelectML module
Query plan optimization |
Copyright 2022
the GNU Lesser General Public License version 2.1 , with the
open Longident
open Asttypes
open Parsetree
open Ast_helper
open Types
open Typedtree
open Ctype
let scope_check scopes exp =
let super = Tast_iterator.default_iterator in
let current_scope = List.hd scopes in
let outer_scopes = List.tl scopes in
let current = ref false in
let outer = ref false in
let expr self exp =
match exp.exp_desc with
| Texp_ident (Path.Pident id, _, _) ->
let scope = Ident.scope id in
if scope = current_scope then
current := true
else if List.mem scope outer_scopes then
outer := true
| _ -> super.expr self exp
in
let iterator = {super with expr} in
iterator.expr iterator exp;
!current || not !outer
let rec check_aggregate ~scopes env exp action =
let super = Tast_iterator.default_iterator in
let expr self exp =
match exp.exp_desc with
| Texp_aggregate (f, e) when scope_check scopes e ->
action exp;
check_no_aggregate ~scopes env f;
check_no_aggregate ~scopes env e;
super.expr self f
| _ -> super.expr self exp
in
let iterator = {super with expr} in
iterator.expr iterator exp
and check_no_aggregate ~scopes env exp =
check_aggregate ~scopes env exp
(fun _ -> raise (Typecore.Error (
exp.exp_loc, env, Invalid_use_of_aggregate)))
let col_gen = ref 0
let incr_col () = col_gen := !col_gen + 1
let col_of_exp exp =
let loc = exp.exp_loc in
let name = match exp.exp_desc with
| Texp_ident (_, lid, _) ->
"__col_" ^ String.concat "_" (flatten lid.txt)
| _ ->
incr_col();
"__col_" ^ string_of_int !col_gen
in
let pat = Pat.var (mkloc name loc) in
let exp =
{ exp with
exp_desc =
Texp_ident
(Path.Pident (Ident.create_local name),
mkloc (Lident name) loc,
{val_type = exp.exp_type; val_kind = Val_reg;
val_loc = loc; val_attributes = [];
val_uid = Types.Uid.mk ~current_unit:(Env.get_unit_name ());
})
} in
(pat, exp)
let expand_product exp =
match exp.exp_desc with
| Texp_tuple es ->
let pats, cols = List.split (List.map col_of_exp es) in
(es, cols, pats, { exp with exp_desc = Texp_tuple cols })
| Texp_record { fields; representation; extended_expression } ->
let exps = ref [] in
let cols = ref [] in
let pats = ref [] in
let fields = Array.map (function
| label, Kept t -> label, Kept t
| label, Overridden (lid, exp) ->
let pat, col = col_of_exp exp in
exps := exp :: !exps;
cols := col :: !cols;
pats := pat :: !pats;
label, Overridden (lid, col))
fields
in
List.rev !exps, List.rev !cols, List.rev !pats,
{ exp with exp_desc =
Texp_record {fields; representation; extended_expression}
}
| _ ->
let pat, col = col_of_exp exp in
([exp], [col], [pat], col)
let expand_aggregate ~scopes exp =
let current_scope = List.hd scopes in
let super = Tast_mapper.default in
let aggs = ref [] in
let expr self exp =
match exp.exp_desc with
| Texp_aggregate (func, arg)
when scope_check scopes arg ->
let argpat, argcol = col_of_exp arg in
let retpat, retcol = col_of_exp exp in
aggs := (arg, argcol, argpat, Some func, retcol, retpat) :: !aggs;
retcol
| Texp_ident (Path.Pident id, _, _)
when Ident.scope id = current_scope ->
let pat, col = col_of_exp exp in
aggs := (exp, col, pat, None, col, pat) :: !aggs;
col
| _ -> super.expr self exp
in
let mapper = {super with expr} in
let exp = mapper.expr mapper exp in
let aggs = List.rev !aggs in
let funcs = List.map (fun (func, _, _, _, _, _) -> func) aggs in
let arglist = List.map (fun (_, arg, _, _, _, _) -> arg) aggs in
let argcols = List.map (fun (_, _, col, _, _, _) -> col) aggs in
let argpats = List.map (fun (_, _, _, pat, _, _) -> pat) aggs in
let retcols = List.map (fun (_, _, _, _, col, _) -> col) aggs in
let retpats = List.map (fun (_, _, _, _, _, pat) -> pat) aggs in
(funcs, arglist, argcols, argpats, retcols, retpats, exp)
let build_plan ~loc env se =
let old_env = env in
let scope = create_scope () in
let child =
ref { plan_desc = Tplan_null;
plan_loc = loc;
plan_env = env;
plan_vars = Ident.empty;
plan_cardinality = One;
plan_patterns =
[Pat.construct ~loc
(mkloc (Lident "()") loc) None];
} in
let handle_from se_from =
let vars = Hashtbl.create 31 in
let rec aux srcexpr =
match srcexpr.psrc_desc with
| Psrc_exp (e, s) ->
List.iter
(fun {txt=v; loc} ->
if Hashtbl.mem vars v then
raise Typecore.(Error (loc, env, Multiply_bound_variable v));
Hashtbl.add vars v ())
s;
let tys = List.map (fun _ -> newvar ()) s in
let ty_src =
let lid = Ldot (Lident "SelectML", "src") in
let path, decl = Env.lookup_type ~loc:e.pexp_loc lid env in
assert (List.length decl.type_params = 1);
let ty = match tys with
| [ty] -> ty
| tys -> newty (Ttuple tys)
in
newconstr path [ty]
in
let vbs = List.map2
(fun v ty ->
let id = Ident.create_scoped ~scope v.txt in
let desc =
{ val_type = ty; val_kind = Val_reg;
val_attributes = []; val_loc = v.loc;
val_uid = Uid.mk ~current_unit:(Env.get_unit_name ());
} in
id, desc)
s tys in
let exp =
Typecore.type_expect old_env e (Typecore.mk_expected ty_src) in
let env = List.fold_left
(fun env (id, desc) -> Env.add_value id desc env) env vbs in
let vars = List.fold_left
(fun vars (id, _) -> Ident.add id () vars) Ident.empty vbs in
let plan =
{ plan_loc = srcexpr.psrc_loc;
plan_desc = Tplan_source exp;
plan_env = env;
plan_vars = vars;
plan_cardinality = Many;
plan_patterns =
List.map (fun s -> Pat.var ~loc:srcexpr.psrc_loc s) s;
} in
plan, vbs
| Psrc_product (s1, s2) ->
let pl1, vbs1 = aux s1 in
let pl2, vbs2 = aux s2 in
let vbs = vbs1 @ vbs2 in
let env = List.fold_left
(fun env (id, desc) -> Env.add_value id desc env) env vbs in
let vars = List.fold_left
(fun vars (id, _) -> Ident.add id () vars) pl1.plan_vars vbs2 in
let plan =
{ plan_loc = srcexpr.psrc_loc;
plan_desc = Tplan_product (pl1, pl2);
plan_env = env;
plan_vars = vars;
plan_cardinality = Many;
plan_patterns = pl1.plan_patterns @ pl2.plan_patterns;
} in
plan, vbs1 @ vbs2
| Psrc_join (s1, s2, e) ->
let pl1, vbs1 = aux s1 in
let pl2, vbs2 = aux s2 in
let vbs = vbs1 @ vbs2 in
let joinenv = List.fold_left
(fun env (id, desc) -> Env.add_value id desc env) env vbs in
let vars = List.fold_left
(fun vars (id, _) -> Ident.add id () vars) pl1.plan_vars vbs2 in
let exp = Typecore.type_expect joinenv e
(Typecore.mk_expected Predef.type_bool) in
let plan =
{ plan_loc = srcexpr.psrc_loc;
plan_desc = Tplan_join (pl1, pl2, exp);
plan_env = joinenv;
plan_vars = vars;
plan_cardinality = Many;
plan_patterns = pl1.plan_patterns @ pl2.plan_patterns;
} in
plan, vbs
in
aux se_from
in
let env = match se.se_from with
| None -> env
| Some se_from ->
let plan, vbs = handle_from se_from in
child := plan;
List.fold_left
(fun env (id, desc) -> Env.add_value id desc env) env vbs
in
begin_se_scope scope;
let scopes = se_scopes () in
begin match se.se_where with
| None -> ()
| Some se_where ->
let exp = Typecore.type_exp env se_where in
check_no_aggregate ~scopes env exp;
child :=
{ plan_loc = exp.exp_loc;
plan_desc = Tplan_filter (!child, exp);
plan_env = !child.plan_env;
plan_vars = !child.plan_vars;
plan_cardinality =
(match !child.plan_cardinality with
| Zero | One -> Zero | Many -> Many);
plan_patterns = !child.plan_patterns
}
end;
let no_aggregate = ref true in
let no_extra_project = ref true in
let sel_exp =
let exp = Typecore.type_exp env se.se_select in
check_aggregate ~scopes env exp
(fun _ -> no_aggregate := false);
exp
in
if Option.is_some se.se_groupby then
no_aggregate := false;
if Option.is_some se.se_having then
no_extra_project := false;
if List.length se.se_orderby > 0 then
no_extra_project := false;
let aux sexp =
let exp = Typecore.type_exp env sexp in
check_aggregate ~scopes env exp
(fun _ -> no_aggregate := false);
exp
in
let hav_exp = match se.se_having with
| Some sexp when !no_aggregate -> Some (aux sexp)
| _ -> None
in
let ord_exps = match se.se_orderby with
| _ :: _ when !no_aggregate ->
List.map (fun (sexp, _) -> aux sexp) se.se_orderby
| _ -> []
in
let ord_dirs =
List.map
(function
| _, PAscending -> TAscending
| _, PDescending -> TDescending
| _, PUsing sexp -> TUsing (Typecore.type_exp old_env sexp))
se.se_orderby
in
let module TastOrd = struct
type t = expression
let compare t1 t2 = Stdlib.compare t1 t2
end in
let module AstOrd = struct
type t = Parsetree.expression
let compare t1 t2 = Stdlib.compare t1 t2
end in
let module TastMap = Map.Make (TastOrd) in
let untype_rmloc e =
let rmloc =
{ Ast_mapper.default_mapper with
location = (fun _self _loc -> Location.none)
} in
rmloc.expr rmloc (Untypeast.untype_expression e)
in
let find_identical (type a)
(module Ord : Map.OrderedType with type t = a)
(xs : a list) (cols : expression list)
: bool array * expression TastMap.t =
let module M = Map.Make (Ord) in
let m = ref M.empty in
let colmap = ref TastMap.empty in
let mask = List.map2
(fun x p -> match M.find_opt x !m with
| None ->
m := M.add x p !m;
colmap := TastMap.add p p !colmap;
true
| Some q ->
colmap := TastMap.add p q !colmap;
false)
xs cols
in
Array.of_list mask, !colmap
in
let filter ~mask xs =
List.filteri (fun i _ -> mask.(i)) xs
in
let substitute_columns colmap exp =
let rename exp =
let super = Tast_mapper.default in
let expr self exp =
match TastMap.find_opt exp colmap with
| None -> super.expr self exp
| Some col -> col
in
let mapper = { super with expr } in
mapper.expr mapper exp
in
rename exp
in
let sel_exp, hav_exp, ord_exps =
if !no_aggregate then sel_exp, hav_exp, ord_exps else
let arglist, argcols, argpats, funcs, retcols, retpats, sel_exp =
expand_aggregate ~scopes sel_exp in
let prj_list = ref arglist in
let prj_cols = ref argcols in
let prj_pats = ref argpats in
let agg_funcs = ref funcs in
let agg_list = ref argcols in
let agg_cols = ref retcols in
let agg_pats = ref retpats in
let aux exp =
let arglist, argcols, argpats, funcs, retcols, retpats, exp =
expand_aggregate ~scopes exp in
prj_list := !prj_list @ arglist;
prj_cols := !prj_cols @ argcols;
prj_pats := !prj_pats @ argpats;
agg_funcs := !agg_funcs @ funcs;
agg_list := !agg_list @ argcols;
agg_cols := !agg_cols @ retcols;
agg_pats := !agg_pats @ retpats;
exp
in
let hav_exp =
Option.map aux
(match se.se_having, hav_exp with
| None, _ -> None
| Some sexp, None -> Some (Typecore.type_exp env sexp)
| Some _, Some exp -> Some exp)
in
let ord_exps =
List.map aux
(match se.se_orderby, ord_exps with
| [], _ -> []
| sexps, [] ->
List.map (fun (sexp, _) -> Typecore.type_exp env sexp) sexps
| _, exps -> exps)
in
let grp_exp =
Option.map
(fun sexp ->
let exp = Typecore.type_exp env sexp in
check_no_aggregate ~scopes env exp;
let list, cols, pats, exp = expand_product exp in
prj_list := !prj_list @ list;
prj_cols := !prj_cols @ cols;
prj_pats := !prj_pats @ pats;
exp)
se.se_groupby
in
let mask, colmap =
let xs = List.map untype_rmloc !prj_list in
find_identical (module AstOrd) xs !prj_cols
in
prj_list := filter ~mask !prj_list;
prj_cols := filter ~mask !prj_cols;
prj_pats := filter ~mask !prj_pats;
let grp_exp = Option.map (substitute_columns colmap) grp_exp in
agg_list := List.map (substitute_columns colmap) !agg_list;
agg_funcs := List.map (Option.map (substitute_columns colmap)) !agg_funcs;
child :=
{ plan_loc = loc;
plan_desc = Tplan_project (!child, !prj_list);
plan_env = !child.plan_env;
plan_vars = !child.plan_vars;
plan_cardinality = !child.plan_cardinality;
plan_patterns = !prj_pats;
};
let module Ord = struct
type t = Parsetree.expression option * Parsetree.expression
let compare = Stdlib.compare
end in
let mask, colmap =
let xs = List.map2
(fun f e -> Option.map untype_rmloc f, untype_rmloc e)
!agg_funcs !agg_list in
find_identical (module Ord) xs !agg_cols
in
agg_funcs := filter ~mask !agg_funcs;
agg_list := filter ~mask !agg_list;
agg_pats := filter ~mask !agg_pats;
let sel_exp = substitute_columns colmap sel_exp in
let hav_exp = Option.map (substitute_columns colmap) hav_exp in
let ord_exps = List.map (substitute_columns colmap) ord_exps in
begin match grp_exp with
| None ->
child :=
{ plan_loc = loc;
plan_desc =
Tplan_aggregate_all (!child, !agg_funcs, !agg_list);
plan_env = !child.plan_env;
plan_vars = !child.plan_vars;
plan_cardinality = One;
plan_patterns = !agg_pats;
}
| Some grp_exp ->
let plan_loc = grp_exp.exp_loc in
child :=
{ plan_loc;
plan_desc =
Tplan_aggregate (!child, grp_exp, !agg_funcs, !agg_list);
plan_env = !child.plan_env;
plan_vars = !child.plan_vars;
plan_cardinality = !child.plan_cardinality;
plan_patterns = !agg_pats;
}
end;
(sel_exp, hav_exp, ord_exps)
in
let sel_exp =
if !no_extra_project then sel_exp else
let sel_list, sel_cols, sel_pats, sel_exp =
expand_product sel_exp in
let prj_list = ref sel_list in
let prj_cols = ref sel_cols in
let prj_pats = ref sel_pats in
let aux = fun exp ->
let list, cols, pats, exp = expand_product exp in
prj_list := !prj_list @ list;
prj_cols := !prj_cols @ cols;
prj_pats := !prj_pats @ pats;
exp
in
let hav_exp = Option.map aux hav_exp in
let ord_exps = List.map aux ord_exps in
let mask, colmap =
let xs = List.map untype_rmloc !prj_list in
find_identical (module AstOrd) xs !prj_cols
in
prj_list := filter ~mask !prj_list;
prj_pats := filter ~mask !prj_pats;
let sel_exp = substitute_columns colmap sel_exp in
let hav_exp = Option.map (substitute_columns colmap) hav_exp in
let ord_exps = List.map (substitute_columns colmap) ord_exps in
child :=
{ plan_loc = loc;
plan_desc = Tplan_project (!child, !prj_list);
plan_env = !child.plan_env;
plan_vars = !child.plan_vars;
plan_cardinality = !child.plan_cardinality;
plan_patterns = !prj_pats;
};
Option.iter (fun exp ->
child :=
{ plan_loc = exp.exp_loc;
plan_desc = Tplan_filter (!child, exp);
plan_env = !child.plan_env;
plan_vars = !child.plan_vars;
plan_cardinality =
(match !child.plan_cardinality with
| Zero | One -> Zero | Many -> Many);
plan_patterns = !prj_pats;
})
hav_exp;
begin match !child.plan_cardinality with
| Zero | One -> ()
| Many ->
if List.length ord_exps > 0 then
child :=
{ plan_loc = se.se_orderby_loc;
plan_desc = Tplan_sort (!child, ord_exps, ord_dirs);
plan_env = !child.plan_env;
plan_vars = !child.plan_vars;
plan_cardinality = !child.plan_cardinality;
plan_patterns = !child.plan_patterns;
}
end;
sel_exp
in
child :=
{ plan_loc = sel_exp.exp_loc;
plan_desc = Tplan_project (!child, [sel_exp]);
plan_env = !child.plan_env;
plan_vars = !child.plan_vars;
plan_cardinality = !child.plan_cardinality;
plan_patterns = [];
};
if se.se_distinct.txt then
child :=
{ plan_loc = se.se_distinct.loc;
plan_desc = Tplan_unique !child;
plan_env = !child.plan_env;
plan_vars = !child.plan_vars;
plan_cardinality = !child.plan_cardinality;
plan_patterns = [];
};
end_se_scope ();
!child
let type_aggregate env sfunct sarg =
let lid = Ldot (Lident "Stdlib", "agg") in
let path, decl = Env.lookup_type ~loc:sfunct.pexp_loc lid env in
let vars = Ctype.instance_list decl.type_params in
let ty_arg, ty_ret =
match vars with
| [arg; ret] -> arg, ret
| _ -> failwith "type_aggregate"
in
let ty_funct = newconstr path vars in
let funct = Typecore.type_expect env sfunct
(Typecore.mk_expected ty_funct) in
let arg = Typecore.type_expect env sarg
(Typecore.mk_expected ty_arg) in
funct, arg, ty_ret
let transl env plan =
let open Untypeast in
let open Location in
let loc = plan.plan_loc in
let lident ?(loc=loc) txt =
let strs = String.split_on_char '.' (String.trim txt) in
let lid = match unflatten strs with
| None -> failwith "transl"
| Some lid -> lid
in
mkloc lid loc
in
let lunit = lident "()" in
let punit = Pat.construct lunit None in
let pvar s = Pat.var (mkloc s loc) in
let pint n = Pat.constant (Const.int n) in
let ptup = function
| [] -> punit
| [p] -> p
| pats -> Pat.tuple pats
in
let pconstr lid params =
match params with
| [] -> Pat.construct lid None
| ps -> Pat.construct lid (Some ([], ptup ps))
in
let eunit = Exp.construct lunit None in
let eid txt = Exp.ident (lident ~loc txt) in
let eint n = Exp.constant (Const.int n) in
let etup = function
| [] -> eunit
| [e] -> e
| exps -> Exp.tuple exps
in
let fun_ pats exp =
List.fold_right
(fun pat exp -> Exp.fun_ ~loc Nolabel None pat exp)
pats exp
in
let ($) func arg = Exp.apply func [Nolabel, arg] in
let rec exp_of_pat pat =
let loc = pat.Parsetree.ppat_loc in
match pat.Parsetree.ppat_desc with
| Ppat_var s -> Exp.ident ~loc (mkloc (Lident s.txt) loc)
| Ppat_construct ({txt=Lident "()"; _}, None) -> eunit
| Ppat_tuple l -> etup (List.map exp_of_pat l)
| _ -> assert false
in
let (||>) a b = b $ a in
let cmp = eid "Stdlib.compare" in
let firstrow = eid "Stdlib.firstrow" in
let cagg = lident "Stdlib.Agg" in
let csome = lident "Stdlib.Option.Some" in
let cnone = lident "Stdlib.Option.None" in
let input = eid "SelectML.input" in
let output = eid "SelectML.output" in
let one = eid "SelectML.one" in
let singleton = eid "SelectML.singleton" in
let product = eid "SelectML.product" in
let join = eid "SelectML.join" in
let equijoin = eid "SelectML.equijoin" in
let map = eid "SelectML.map" in
let filter = eid "SelectML.filter" in
let sort = eid "SelectML.sort" in
let unique = eid "SelectML.unique" in
let group_all = eid "SelectML.group_all" in
let group = eid "SelectML.group" in
let mkagg pat fs es =
let accpat = ptup
(List.mapi (fun i _ -> pvar ("__tmp_acc" ^ string_of_int i)) fs) in
let accexps =
List.mapi (fun i _ -> eid ("__tmp_acc" ^ string_of_int i)) fs in
let exps = List.combine accexps es in
let vbs, fs = List.mapi
(fun i f ->
let n = string_of_int i in
let acc = "__tmp_accum" ^ n in
let iter = "__tmp_iter" ^ n in
let res = "__tmp_result" ^ n in
match f with
| None ->
Vb.mk (pconstr cagg [pvar acc; pvar iter; pvar res]) firstrow,
(eid acc, eid iter, eid res)
| Some f ->
Vb.mk (pconstr cagg [pvar acc; pvar iter; pvar res]) f,
(eid acc, eid iter, eid res))
fs
|> List.split
in
let accum = etup (List.map (fun (acc, _, _) -> acc) fs) in
let iter = fun_ [accpat; pat] @@ etup
(List.map2 (fun (_, iter, _) (acc, e) -> iter $ acc $ e) fs exps)
in
let res = fun_ [accpat] @@ etup
(List.map2 (fun (_, _, res) acc -> res $ acc) fs accexps)
in
List.fold_right
(fun vb exp -> Exp.let_ Nonrecursive [vb] exp)
vbs
(Exp.construct cagg @@ Some (etup [accum; iter; res]))
in
let () =
let check_exp =
eid "ignore" $ Exp.constraint_
(Exp.pack (Mod.ident (lident "SelectML")))
(Typ.package (lident "Stdlib.SelectMLType") [])
in
ignore (Typecore.type_exp env check_exp)
in
let rec aux plan =
match plan.plan_desc with
| Tplan_null -> singleton $ eunit
| Tplan_source e -> input $ untype_expression e
| Tplan_product (pl1, pl2) ->
let pat1 = ptup pl1.plan_patterns in
let pat2 = ptup pl2.plan_patterns in
let exp = etup @@
List.map exp_of_pat (pl1.plan_patterns @ pl2.plan_patterns) in
product $ fun_ [pat1; pat2] exp $ aux pl1 $ aux pl2
| Tplan_join (pl1, pl2, e) ->
let pat1 = ptup pl1.plan_patterns in
let pat2 = ptup pl2.plan_patterns in
let exp = etup @@
List.map exp_of_pat (pl1.plan_patterns @ pl2.plan_patterns) in
let cond = untype_expression e in
join $ fun_ [pat1; pat2]
(Exp.ifthenelse cond
(Exp.construct csome (Some exp))
(Some (Exp.construct cnone None)))
$ aux pl1 $ aux pl2
| Tplan_equijoin (pl1, e1, pl2, e2) ->
let pat1 = ptup pl1.plan_patterns in
let pat2 = ptup pl2.plan_patterns in
let exp = etup @@
List.map exp_of_pat (pl1.plan_patterns @ pl2.plan_patterns) in
let key1 = untype_expression e1 in
let key2 = untype_expression e2 in
equijoin $ fun_ [pat1; pat2] exp
$ aux pl1 $ fun_ [pat1] key1
$ aux pl2 $ fun_ [pat2] key2
| Tplan_project (pl, es) ->
let pat = ptup pl.plan_patterns in
let exp = etup (List.map untype_expression es) in
aux pl ||> (map $ fun_ [pat] exp)
| Tplan_filter (pl, e) ->
let pat = ptup pl.plan_patterns in
let exp = untype_expression e in
aux pl ||> (filter $ fun_ [pat] exp)
| Tplan_sort (pl, es, os) ->
let pat = ptup pl.plan_patterns in
let exp = etup (List.map untype_expression es) in
let cmpfunc =
let args = [pvar "__tmp_key"; pvar "__tmp_a"; pvar "__tmp_b"] in
let body =
let p1 = ptup
(List.mapi (fun i _ -> pvar ("__tmp_a" ^ string_of_int i)) os) in
let p2 = ptup
(List.mapi (fun i _ -> pvar ("__tmp_b" ^ string_of_int i)) os) in
let rec loop i os =
let aux o =
let a = eid ("__tmp_a" ^ string_of_int i) in
let b = eid ("__tmp_b" ^ string_of_int i) in
match o with
| TAscending -> cmp $ a $ b
| TDescending -> cmp $ b $ a
| TUsing e -> untype_expression e $ a $ b
in
match os with
| [] -> eint 0
| o :: os ->
Exp.match_ (aux o)
[Exp.case (pint 0) (loop (i+1) os);
Exp.case (pvar "__tmp_res") (eid "__tmp_res")]
in
Exp.let_ Nonrecursive
[Vb.mk p1 (eid "__tmp_key" $ eid "__tmp_a");
Vb.mk p2 (eid "__tmp_key" $ eid "__tmp_b")]
(loop 0 os)
in
fun_ args body
in
let func =
Exp.let_ Nonrecursive
[Vb.mk (pvar "__tmp_key") (fun_ [pat] exp);
Vb.mk (pvar "__tmp_cmp") cmpfunc]
(sort $ (eid "__tmp_cmp" $ eid "__tmp_key"))
in
aux pl ||> func
| Tplan_aggregate_all (pl, fs, es) ->
let pat = ptup pl.plan_patterns in
let fs = List.map (Option.map untype_expression) fs in
let es = List.map untype_expression es in
aux pl ||> (group_all $ mkagg pat fs es) ||> singleton
| Tplan_aggregate (pl, e, fs, es) ->
let pat = ptup pl.plan_patterns in
let exp = untype_expression e in
let fs = List.map (Option.map untype_expression) fs in
let es = List.map untype_expression es in
let key = fun_ [pat] exp in
aux pl ||> (group $ key $ mkagg pat fs es)
| Tplan_unique pl -> aux pl ||> unique
in
let ast = aux plan in
match plan.plan_cardinality with
| One -> one $ ast
| Zero | Many -> output $ ast
let type_select ~loc env se ty_expected_explained =
let plan = build_plan ~loc env se in
let transl pl =
Typecore.type_expect env (transl env pl) ty_expected_explained in
plan, transl
let () =
Typecore.type_select := type_select;
Typecore.type_aggregate := type_aggregate
let pushdown_predicates plan =
let open Either in
let is_and : Types.value_description -> bool = function
| { val_kind =
Val_prim { Primitive.prim_name = "%sequand";
prim_arity = 2 } } ->
true
| _ -> false
in
let is_eq : Types.value_description -> bool = function
| { val_kind =
Val_prim { Primitive.prim_name = "%equal";
prim_arity = 2 } } ->
true
| _ -> false
in
let is_related_to pl pred =
let result = ref false in
let super = Tast_iterator.default_iterator in
let expr self pred =
match pred.exp_desc with
| Texp_ident (Path.Pident id, _, _) ->
begin try
ignore (Ident.find_same id pl.plan_vars);
result := true;
with Not_found -> ()
end
| _ -> super.expr self pred
in
let iterator = { super with expr } in
iterator.expr iterator pred;
!result
in
let extract_related_preds pred pl =
let rec split_ands acc pred =
match pred.exp_desc with
| Texp_apply ({exp_desc = Texp_ident (_, _, vd)},
[Nolabel, Some e1; Nolabel, Some e2])
when is_and vd ->
split_ands (split_ands acc e1) e2
| _ ->
pred :: acc
in
List.partition (is_related_to pl) (split_ands [] pred)
in
let extract_eq_keys pred pl1 pl2 =
match pred.exp_desc with
| Texp_apply ({exp_desc = Texp_ident (_, _, vd)},
[Nolabel, Some e1; Nolabel, Some e2])
when is_eq vd ->
begin match
is_related_to pl1 e1, is_related_to pl2 e1,
is_related_to pl1 e2, is_related_to pl2 e2
with
| true, false, false, true ->
Left (Left (e1, e2))
| false, true, true, false ->
Left (Left (e2, e1))
| true, false, _, false | _, false, true, false ->
Right (Left pred)
| false, true, false, _ | false, _, false, true ->
Right (Right pred)
| _ ->
Left (Right pred)
end
| _ ->
begin match is_related_to pl1 pred, is_related_to pl2 pred with
| true, false ->
Right (Left pred)
| false, true ->
Right (Right pred)
| _ ->
Left (Right pred)
end
in
let rec aux plan related_preds =
let loc = plan.plan_loc in
let env = plan.plan_env in
let make_pred = function
| [] -> assert false
| hd :: tl ->
let lid = Ldot (Lident "Stdlib", "&&") in
let path, desc = Env.lookup_value ~loc lid env in
List.fold_left
(fun acc pred ->
{ exp_desc = Texp_apply (
{ exp_desc = Texp_ident (path, mkloc lid loc, desc);
exp_loc = loc;
exp_type = desc.val_type;
exp_env = env;
exp_extra = [];
exp_attributes = [];
},
[ Nolabel, Some acc;
Nolabel, Some pred ]
);
exp_loc = loc;
exp_type = Predef.type_bool;
exp_env = env;
exp_extra = [];
exp_attributes = [];
})
hd tl
in
let make_key = function
| [] -> assert false
| key :: [] -> key
| keys ->
{ exp_desc = Texp_tuple keys;
exp_loc = loc;
exp_type = newty (Ttuple (List.map (fun e -> e.exp_type) keys));
exp_env = env;
exp_extra = [];
exp_attributes = [];
}
in
match plan.plan_desc with
| Tplan_filter (pl, pred) ->
let related, unrelated = extract_related_preds pred pl in
let pl, unrelated_preds = aux pl (related @ related_preds) in
begin match unrelated @ unrelated_preds with
| [] -> pl
| preds ->
{ plan with plan_desc = Tplan_filter (pl, make_pred preds) }
end, []
| Tplan_source _ ->
begin match related_preds with
| [] -> plan
| preds ->
{ plan with plan_desc = Tplan_filter (plan, make_pred preds) }
end, []
| Tplan_product (pl1, pl2) ->
let keys1, keys2, general_preds, pl1_preds, pl2_preds =
List.fold_left
(fun (keys1, keys2, general_preds, pl1_preds, pl2_preds) pred ->
match extract_eq_keys pred pl1 pl2 with
| Left (Left (key1, key2)) ->
key1 :: keys1, key2 :: keys2,
general_preds, pl1_preds, pl2_preds
| Left (Right pred) ->
keys1, keys2, pred :: general_preds, pl1_preds, pl2_preds
| Right (Left pred) ->
keys1, keys2, general_preds, pred :: pl1_preds, pl2_preds
| Right (Right pred) ->
keys1, keys2, general_preds, pl1_preds, pred :: pl2_preds)
([], [], [], [], [])
related_preds
in
begin match keys1, keys2, general_preds with
| [], [], [] ->
{ plan with plan_desc =
Tplan_product (
fst (aux pl1 pl1_preds),
fst (aux pl2 pl2_preds))
}
| [], [], join_preds ->
{ plan with plan_desc =
Tplan_join (
fst (aux pl1 pl1_preds),
fst (aux pl2 pl2_preds),
make_pred join_preds)
}
| (_ :: _), (_ :: _), [] ->
{ plan with plan_desc =
Tplan_equijoin (
fst (aux pl1 pl1_preds), make_key keys1,
fst (aux pl2 pl2_preds), make_key keys2)
}
| (_ :: _), (_ :: _), preds ->
{ plan with plan_desc =
Tplan_filter (
{ plan with plan_desc =
Tplan_equijoin (
fst (aux pl1 pl1_preds), make_key keys1,
fst (aux pl2 pl2_preds), make_key keys2)
},
make_pred preds)
}
| _, _, _ -> assert false
end, []
| Tplan_join (pl1, pl2, pred) ->
aux { plan with plan_desc =
Tplan_filter (
{ plan with plan_desc = Tplan_product (pl1, pl2) },
pred)
}
related_preds
| Tplan_project (pl, es) ->
{plan with plan_desc = Tplan_project (fst (aux pl []), es)},
related_preds
| Tplan_sort (pl, es, os) ->
{plan with plan_desc = Tplan_sort (fst (aux pl []), es, os)},
related_preds
| Tplan_aggregate_all (pl, fs, es) ->
{plan with plan_desc = Tplan_aggregate_all (fst (aux pl []), fs, es)},
related_preds
| Tplan_aggregate (pl, e, fs, es) ->
{plan with plan_desc = Tplan_aggregate (fst (aux pl []), e, fs, es)},
related_preds
| Tplan_unique pl ->
{plan with plan_desc = Tplan_unique (fst (aux pl []))},
related_preds
| _ ->
plan, related_preds
in
fst (aux plan [])
let optimize pl = pushdown_predicates pl
|
df43a5ea432c9243485a4daa137a26430b446704ff65e20a18db5cc983e4107f | jeromesimeon/Galax | datatypes_util.mli | (***********************************************************************)
(* *)
(* GALAX *)
(* XQuery Engine *)
(* *)
Copyright 2001 - 2007 .
(* Distributed only by permission. *)
(* *)
(***********************************************************************)
$ I d : datatypes_util.mli , v 1.26 2007/07/05 08:35:53 simeon Exp $
Module Datatypes_util
Description :
This module contains basic operations on atomic values and atomic
types , at the level .
Description:
This module contains basic operations on atomic values and atomic
types, at the Caml level.
*)
open Decimal
open AnyURI
open DateTime
open Datatypes
(*******************************)
(* Parsing from text to values *)
(*******************************)
val ncname_of_untyped : xs_untyped -> xs_ncname
val string_of_untyped : xs_untyped -> xs_string
val boolean_of_untyped : xs_untyped -> xs_boolean
val decimal_of_untyped : xs_untyped -> xs_decimal
val float_of_untyped : xs_untyped -> xs_float
val double_of_untyped : xs_untyped -> xs_double
val dateTime_of_untyped : xs_untyped -> xs_dateTime
val time_of_untyped : xs_untyped -> xs_time
val date_of_untyped : xs_untyped -> xs_date
val gYearMonth_of_untyped : xs_untyped -> xs_gYearMonth
val gYear_of_untyped : xs_untyped -> xs_gYear
val gMonthDay_of_untyped : xs_untyped -> xs_gMonthDay
val gDay_of_untyped : xs_untyped -> xs_gDay
val gMonth_of_untyped : xs_untyped -> xs_gMonth
val hexBinary_of_untyped : xs_untyped -> xs_hexBinary
val base64Binary_of_untyped : xs_untyped -> xs_base64Binary
val anyURI_of_untyped : xs_untyped -> xs_anyURI
val qname_of_untyped : Namespace_context.nsenv -> xs_untyped -> xs_QName
val notation_of_untyped : xs_untyped -> xs_NOTATION
val integer_of_untyped : Namespace_symbols.rtype_symbol -> xs_untyped -> xs_integer
val duration_of_untyped : xs_untyped -> xs_duration
val yearMonthDuration_of_untyped : xs_untyped -> xs_yearMonthDuration
val dayTimeDuration_of_untyped : xs_untyped -> xs_dayTimeDuration
val normalize_pi_test : xs_untyped -> xs_ncname
(***************)
(* Comparisons *)
(***************)
val string_equal : xs_string -> xs_string -> bool
val string_lteq : xs_string -> xs_string -> bool
val string_lt : xs_string -> xs_string -> bool
val string_gteq : xs_string -> xs_string -> bool
val string_gt : xs_string -> xs_string -> bool
val bool_equal : xs_boolean -> xs_boolean -> bool
val bool_lteq : xs_boolean -> xs_boolean -> bool
val bool_lt : xs_boolean -> xs_boolean -> bool
val bool_gteq : xs_boolean -> xs_boolean -> bool
val bool_gt : xs_boolean -> xs_boolean -> bool
val float_equal : xs_float -> xs_float -> bool
val float_lteq : xs_float -> xs_float -> bool
val float_lt : xs_float -> xs_float -> bool
val float_gteq : xs_float -> xs_float -> bool
val float_gt : xs_float -> xs_float -> bool
val double_equal : xs_double -> xs_double -> bool
val double_lteq : xs_double -> xs_double -> bool
val double_lt : xs_double -> xs_double -> bool
val double_gteq : xs_double -> xs_double -> bool
val double_gt : xs_double -> xs_double -> bool
val duration_equal : xs_duration -> xs_duration -> bool
val duration_lteq : xs_duration -> xs_duration -> bool
val duration_lt : xs_duration -> xs_duration -> bool
val duration_gteq : xs_duration -> xs_duration -> bool
val duration_gt : xs_duration -> xs_duration -> bool
val dateTime_equal : xs_dayTimeDuration option -> xs_dateTime -> xs_dateTime -> bool
val dateTime_lteq : xs_dayTimeDuration option -> xs_dateTime -> xs_dateTime -> bool
val dateTime_lt : xs_dayTimeDuration option -> xs_dateTime -> xs_dateTime -> bool
val dateTime_gteq : xs_dayTimeDuration option -> xs_dateTime -> xs_dateTime -> bool
val dateTime_gt : xs_dayTimeDuration option -> xs_dateTime -> xs_dateTime -> bool
val time_equal : xs_dayTimeDuration option -> xs_time -> xs_time -> bool
val time_lteq : xs_dayTimeDuration option -> xs_time -> xs_time -> bool
val time_lt : xs_dayTimeDuration option -> xs_time -> xs_time -> bool
val time_gteq : xs_dayTimeDuration option -> xs_time -> xs_time -> bool
val time_gt : xs_dayTimeDuration option -> xs_time -> xs_time -> bool
val date_equal : xs_dayTimeDuration option -> xs_date -> xs_date -> bool
val date_lteq : xs_dayTimeDuration option -> xs_date -> xs_date -> bool
val date_lt : xs_dayTimeDuration option -> xs_date -> xs_date -> bool
val date_gteq : xs_dayTimeDuration option -> xs_date -> xs_date -> bool
val date_gt : xs_dayTimeDuration option -> xs_date -> xs_date -> bool
val gYearMonth_equal : xs_dayTimeDuration option -> xs_gYearMonth -> xs_gYearMonth -> bool
val gYearMonth_lteq : xs_dayTimeDuration option -> xs_gYearMonth -> xs_gYearMonth -> bool
val gYearMonth_lt : xs_dayTimeDuration option -> xs_gYearMonth -> xs_gYearMonth -> bool
val gYearMonth_gteq : xs_dayTimeDuration option -> xs_gYearMonth -> xs_gYearMonth -> bool
val gYearMonth_gt : xs_dayTimeDuration option -> xs_gYearMonth -> xs_gYearMonth -> bool
val gYear_equal : xs_dayTimeDuration option -> xs_gYear -> xs_gYear -> bool
val gYear_lteq : xs_dayTimeDuration option -> xs_gYear -> xs_gYear -> bool
val gYear_lt : xs_dayTimeDuration option -> xs_gYear -> xs_gYear -> bool
val gYear_gteq : xs_dayTimeDuration option -> xs_gYear -> xs_gYear -> bool
val gYear_gt : xs_dayTimeDuration option -> xs_gYear -> xs_gYear -> bool
val gMonthDay_equal : xs_dayTimeDuration option -> xs_gMonthDay -> xs_gMonthDay -> bool
val gMonthDay_lteq : xs_dayTimeDuration option -> xs_gMonthDay -> xs_gMonthDay -> bool
val gMonthDay_lt : xs_dayTimeDuration option -> xs_gMonthDay -> xs_gMonthDay -> bool
val gMonthDay_gteq : xs_dayTimeDuration option -> xs_gMonthDay -> xs_gMonthDay -> bool
val gMonthDay_gt : xs_dayTimeDuration option -> xs_gMonthDay -> xs_gMonthDay -> bool
val gMonth_equal : xs_dayTimeDuration option -> xs_gMonth -> xs_gMonth -> bool
val gMonth_lteq : xs_dayTimeDuration option -> xs_gMonth -> xs_gMonth -> bool
val gMonth_lt : xs_dayTimeDuration option -> xs_gMonth -> xs_gMonth -> bool
val gMonth_gteq : xs_dayTimeDuration option -> xs_gMonth -> xs_gMonth -> bool
val gMonth_gt : xs_dayTimeDuration option -> xs_gMonth -> xs_gMonth -> bool
val gDay_equal : xs_dayTimeDuration option -> xs_gDay -> xs_gDay -> bool
val gDay_lteq : xs_dayTimeDuration option -> xs_gDay -> xs_gDay -> bool
val gDay_lt : xs_dayTimeDuration option -> xs_gDay -> xs_gDay -> bool
val gDay_gteq : xs_dayTimeDuration option -> xs_gDay -> xs_gDay -> bool
val gDay_gt : xs_dayTimeDuration option -> xs_gDay -> xs_gDay -> bool
val hexBinary_equal : xs_hexBinary -> xs_hexBinary -> bool
val hexBinary_lteq : xs_hexBinary -> xs_hexBinary -> bool
val hexBinary_lt : xs_hexBinary -> xs_hexBinary -> bool
val hexBinary_gteq : xs_hexBinary -> xs_hexBinary -> bool
val hexBinary_gt : xs_hexBinary -> xs_hexBinary -> bool
val base64Binary_equal : xs_base64Binary -> xs_base64Binary -> bool
val base64Binary_lteq : xs_base64Binary -> xs_base64Binary -> bool
val base64Binary_lt : xs_base64Binary -> xs_base64Binary -> bool
val base64Binary_gteq : xs_base64Binary -> xs_base64Binary -> bool
val base64Binary_gt : xs_base64Binary -> xs_base64Binary -> bool
val anyURI_equal : xs_anyURI -> xs_anyURI -> bool
val qname_equal : xs_QName -> xs_QName -> bool
val qname_lteq : xs_QName -> xs_QName -> bool
val qname_lt : xs_QName -> xs_QName -> bool
val qname_gteq : xs_QName -> xs_QName -> bool
val qname_gt : xs_QName -> xs_QName -> bool
val notation_equal : xs_NOTATION -> xs_NOTATION -> bool
val notation_lteq : xs_NOTATION -> xs_NOTATION -> bool
val notation_lt : xs_NOTATION -> xs_NOTATION -> bool
val notation_gteq : xs_NOTATION -> xs_NOTATION -> bool
val notation_gt : xs_NOTATION -> xs_NOTATION -> bool
val yearMonthDuration_equal : xs_yearMonthDuration -> xs_yearMonthDuration -> bool
val yearMonthDuration_lteq : xs_yearMonthDuration -> xs_yearMonthDuration -> bool
val yearMonthDuration_lt : xs_yearMonthDuration -> xs_yearMonthDuration -> bool
val yearMonthDuration_gteq : xs_yearMonthDuration -> xs_yearMonthDuration -> bool
val yearMonthDuration_gt : xs_yearMonthDuration -> xs_yearMonthDuration -> bool
val dayTimeDuration_equal : xs_dayTimeDuration -> xs_dayTimeDuration -> bool
val dayTimeDuration_lteq : xs_dayTimeDuration -> xs_dayTimeDuration -> bool
val dayTimeDuration_lt : xs_dayTimeDuration -> xs_dayTimeDuration -> bool
val dayTimeDuration_gteq : xs_dayTimeDuration -> xs_dayTimeDuration -> bool
val dayTimeDuration_gt : xs_dayTimeDuration -> xs_dayTimeDuration -> bool
val untyped_equal : xs_untyped -> xs_untyped -> bool
val untyped_lteq : xs_untyped -> xs_untyped -> bool
val untyped_lt : xs_untyped -> xs_untyped -> bool
val untyped_gteq : xs_untyped -> xs_untyped -> bool
val untyped_gt : xs_untyped -> xs_untyped -> bool
(*******************************)
Operations on atomic values
(*******************************)
val serialize_float : xs_float -> string
val serialize_double : xs_double -> string
val serialize_base64Binary : xs_base64Binary -> string
val serialize_hexBinary : xs_hexBinary -> string
(******************************)
Operations on atomic types
(******************************)
val atomic_is_numeric : atomic_type -> bool
val atomic_is_anyURI : atomic_type -> bool
val atomic_is_anystring : atomic_type -> bool
val atomic_type_subsumes : atomic_type -> atomic_type -> bool
val untyped_atomic_type : atomic_type
val lookup_bltin_type : Namespace_symbols.rtype_symbol -> atomic_type
val symbol_of_primitive_type : atomic_type -> Namespace_symbols.rtype_symbol
val unit_symbol_of_base_type : atomic_type -> Namespace_symbols.rtype_symbol
val can_be_promoted_to : atomic_type -> atomic_type list
val bt_can_be_promoted_to : atomic_type -> atomic_type -> (bool * bool)
val string_of_atomic_type : Datatypes.atomic_type -> string
val compare_types : Datatypes.atomic_type -> Datatypes.atomic_type -> int
val base64_of_hex : xs_base64Binary -> xs_hexBinary
val hex_of_base64 : xs_hexBinary -> xs_base64Binary
| null | https://raw.githubusercontent.com/jeromesimeon/Galax/bc565acf782c140291911d08c1c784c9ac09b432/datatypes/datatypes_util.mli | ocaml | *********************************************************************
GALAX
XQuery Engine
Distributed only by permission.
*********************************************************************
*****************************
Parsing from text to values
*****************************
*************
Comparisons
*************
*****************************
*****************************
****************************
**************************** | Copyright 2001 - 2007 .
$ I d : datatypes_util.mli , v 1.26 2007/07/05 08:35:53 simeon Exp $
Module Datatypes_util
Description :
This module contains basic operations on atomic values and atomic
types , at the level .
Description:
This module contains basic operations on atomic values and atomic
types, at the Caml level.
*)
open Decimal
open AnyURI
open DateTime
open Datatypes
val ncname_of_untyped : xs_untyped -> xs_ncname
val string_of_untyped : xs_untyped -> xs_string
val boolean_of_untyped : xs_untyped -> xs_boolean
val decimal_of_untyped : xs_untyped -> xs_decimal
val float_of_untyped : xs_untyped -> xs_float
val double_of_untyped : xs_untyped -> xs_double
val dateTime_of_untyped : xs_untyped -> xs_dateTime
val time_of_untyped : xs_untyped -> xs_time
val date_of_untyped : xs_untyped -> xs_date
val gYearMonth_of_untyped : xs_untyped -> xs_gYearMonth
val gYear_of_untyped : xs_untyped -> xs_gYear
val gMonthDay_of_untyped : xs_untyped -> xs_gMonthDay
val gDay_of_untyped : xs_untyped -> xs_gDay
val gMonth_of_untyped : xs_untyped -> xs_gMonth
val hexBinary_of_untyped : xs_untyped -> xs_hexBinary
val base64Binary_of_untyped : xs_untyped -> xs_base64Binary
val anyURI_of_untyped : xs_untyped -> xs_anyURI
val qname_of_untyped : Namespace_context.nsenv -> xs_untyped -> xs_QName
val notation_of_untyped : xs_untyped -> xs_NOTATION
val integer_of_untyped : Namespace_symbols.rtype_symbol -> xs_untyped -> xs_integer
val duration_of_untyped : xs_untyped -> xs_duration
val yearMonthDuration_of_untyped : xs_untyped -> xs_yearMonthDuration
val dayTimeDuration_of_untyped : xs_untyped -> xs_dayTimeDuration
val normalize_pi_test : xs_untyped -> xs_ncname
val string_equal : xs_string -> xs_string -> bool
val string_lteq : xs_string -> xs_string -> bool
val string_lt : xs_string -> xs_string -> bool
val string_gteq : xs_string -> xs_string -> bool
val string_gt : xs_string -> xs_string -> bool
val bool_equal : xs_boolean -> xs_boolean -> bool
val bool_lteq : xs_boolean -> xs_boolean -> bool
val bool_lt : xs_boolean -> xs_boolean -> bool
val bool_gteq : xs_boolean -> xs_boolean -> bool
val bool_gt : xs_boolean -> xs_boolean -> bool
val float_equal : xs_float -> xs_float -> bool
val float_lteq : xs_float -> xs_float -> bool
val float_lt : xs_float -> xs_float -> bool
val float_gteq : xs_float -> xs_float -> bool
val float_gt : xs_float -> xs_float -> bool
val double_equal : xs_double -> xs_double -> bool
val double_lteq : xs_double -> xs_double -> bool
val double_lt : xs_double -> xs_double -> bool
val double_gteq : xs_double -> xs_double -> bool
val double_gt : xs_double -> xs_double -> bool
val duration_equal : xs_duration -> xs_duration -> bool
val duration_lteq : xs_duration -> xs_duration -> bool
val duration_lt : xs_duration -> xs_duration -> bool
val duration_gteq : xs_duration -> xs_duration -> bool
val duration_gt : xs_duration -> xs_duration -> bool
val dateTime_equal : xs_dayTimeDuration option -> xs_dateTime -> xs_dateTime -> bool
val dateTime_lteq : xs_dayTimeDuration option -> xs_dateTime -> xs_dateTime -> bool
val dateTime_lt : xs_dayTimeDuration option -> xs_dateTime -> xs_dateTime -> bool
val dateTime_gteq : xs_dayTimeDuration option -> xs_dateTime -> xs_dateTime -> bool
val dateTime_gt : xs_dayTimeDuration option -> xs_dateTime -> xs_dateTime -> bool
val time_equal : xs_dayTimeDuration option -> xs_time -> xs_time -> bool
val time_lteq : xs_dayTimeDuration option -> xs_time -> xs_time -> bool
val time_lt : xs_dayTimeDuration option -> xs_time -> xs_time -> bool
val time_gteq : xs_dayTimeDuration option -> xs_time -> xs_time -> bool
val time_gt : xs_dayTimeDuration option -> xs_time -> xs_time -> bool
val date_equal : xs_dayTimeDuration option -> xs_date -> xs_date -> bool
val date_lteq : xs_dayTimeDuration option -> xs_date -> xs_date -> bool
val date_lt : xs_dayTimeDuration option -> xs_date -> xs_date -> bool
val date_gteq : xs_dayTimeDuration option -> xs_date -> xs_date -> bool
val date_gt : xs_dayTimeDuration option -> xs_date -> xs_date -> bool
val gYearMonth_equal : xs_dayTimeDuration option -> xs_gYearMonth -> xs_gYearMonth -> bool
val gYearMonth_lteq : xs_dayTimeDuration option -> xs_gYearMonth -> xs_gYearMonth -> bool
val gYearMonth_lt : xs_dayTimeDuration option -> xs_gYearMonth -> xs_gYearMonth -> bool
val gYearMonth_gteq : xs_dayTimeDuration option -> xs_gYearMonth -> xs_gYearMonth -> bool
val gYearMonth_gt : xs_dayTimeDuration option -> xs_gYearMonth -> xs_gYearMonth -> bool
val gYear_equal : xs_dayTimeDuration option -> xs_gYear -> xs_gYear -> bool
val gYear_lteq : xs_dayTimeDuration option -> xs_gYear -> xs_gYear -> bool
val gYear_lt : xs_dayTimeDuration option -> xs_gYear -> xs_gYear -> bool
val gYear_gteq : xs_dayTimeDuration option -> xs_gYear -> xs_gYear -> bool
val gYear_gt : xs_dayTimeDuration option -> xs_gYear -> xs_gYear -> bool
val gMonthDay_equal : xs_dayTimeDuration option -> xs_gMonthDay -> xs_gMonthDay -> bool
val gMonthDay_lteq : xs_dayTimeDuration option -> xs_gMonthDay -> xs_gMonthDay -> bool
val gMonthDay_lt : xs_dayTimeDuration option -> xs_gMonthDay -> xs_gMonthDay -> bool
val gMonthDay_gteq : xs_dayTimeDuration option -> xs_gMonthDay -> xs_gMonthDay -> bool
val gMonthDay_gt : xs_dayTimeDuration option -> xs_gMonthDay -> xs_gMonthDay -> bool
val gMonth_equal : xs_dayTimeDuration option -> xs_gMonth -> xs_gMonth -> bool
val gMonth_lteq : xs_dayTimeDuration option -> xs_gMonth -> xs_gMonth -> bool
val gMonth_lt : xs_dayTimeDuration option -> xs_gMonth -> xs_gMonth -> bool
val gMonth_gteq : xs_dayTimeDuration option -> xs_gMonth -> xs_gMonth -> bool
val gMonth_gt : xs_dayTimeDuration option -> xs_gMonth -> xs_gMonth -> bool
val gDay_equal : xs_dayTimeDuration option -> xs_gDay -> xs_gDay -> bool
val gDay_lteq : xs_dayTimeDuration option -> xs_gDay -> xs_gDay -> bool
val gDay_lt : xs_dayTimeDuration option -> xs_gDay -> xs_gDay -> bool
val gDay_gteq : xs_dayTimeDuration option -> xs_gDay -> xs_gDay -> bool
val gDay_gt : xs_dayTimeDuration option -> xs_gDay -> xs_gDay -> bool
val hexBinary_equal : xs_hexBinary -> xs_hexBinary -> bool
val hexBinary_lteq : xs_hexBinary -> xs_hexBinary -> bool
val hexBinary_lt : xs_hexBinary -> xs_hexBinary -> bool
val hexBinary_gteq : xs_hexBinary -> xs_hexBinary -> bool
val hexBinary_gt : xs_hexBinary -> xs_hexBinary -> bool
val base64Binary_equal : xs_base64Binary -> xs_base64Binary -> bool
val base64Binary_lteq : xs_base64Binary -> xs_base64Binary -> bool
val base64Binary_lt : xs_base64Binary -> xs_base64Binary -> bool
val base64Binary_gteq : xs_base64Binary -> xs_base64Binary -> bool
val base64Binary_gt : xs_base64Binary -> xs_base64Binary -> bool
val anyURI_equal : xs_anyURI -> xs_anyURI -> bool
val qname_equal : xs_QName -> xs_QName -> bool
val qname_lteq : xs_QName -> xs_QName -> bool
val qname_lt : xs_QName -> xs_QName -> bool
val qname_gteq : xs_QName -> xs_QName -> bool
val qname_gt : xs_QName -> xs_QName -> bool
val notation_equal : xs_NOTATION -> xs_NOTATION -> bool
val notation_lteq : xs_NOTATION -> xs_NOTATION -> bool
val notation_lt : xs_NOTATION -> xs_NOTATION -> bool
val notation_gteq : xs_NOTATION -> xs_NOTATION -> bool
val notation_gt : xs_NOTATION -> xs_NOTATION -> bool
val yearMonthDuration_equal : xs_yearMonthDuration -> xs_yearMonthDuration -> bool
val yearMonthDuration_lteq : xs_yearMonthDuration -> xs_yearMonthDuration -> bool
val yearMonthDuration_lt : xs_yearMonthDuration -> xs_yearMonthDuration -> bool
val yearMonthDuration_gteq : xs_yearMonthDuration -> xs_yearMonthDuration -> bool
val yearMonthDuration_gt : xs_yearMonthDuration -> xs_yearMonthDuration -> bool
val dayTimeDuration_equal : xs_dayTimeDuration -> xs_dayTimeDuration -> bool
val dayTimeDuration_lteq : xs_dayTimeDuration -> xs_dayTimeDuration -> bool
val dayTimeDuration_lt : xs_dayTimeDuration -> xs_dayTimeDuration -> bool
val dayTimeDuration_gteq : xs_dayTimeDuration -> xs_dayTimeDuration -> bool
val dayTimeDuration_gt : xs_dayTimeDuration -> xs_dayTimeDuration -> bool
val untyped_equal : xs_untyped -> xs_untyped -> bool
val untyped_lteq : xs_untyped -> xs_untyped -> bool
val untyped_lt : xs_untyped -> xs_untyped -> bool
val untyped_gteq : xs_untyped -> xs_untyped -> bool
val untyped_gt : xs_untyped -> xs_untyped -> bool
Operations on atomic values
val serialize_float : xs_float -> string
val serialize_double : xs_double -> string
val serialize_base64Binary : xs_base64Binary -> string
val serialize_hexBinary : xs_hexBinary -> string
Operations on atomic types
val atomic_is_numeric : atomic_type -> bool
val atomic_is_anyURI : atomic_type -> bool
val atomic_is_anystring : atomic_type -> bool
val atomic_type_subsumes : atomic_type -> atomic_type -> bool
val untyped_atomic_type : atomic_type
val lookup_bltin_type : Namespace_symbols.rtype_symbol -> atomic_type
val symbol_of_primitive_type : atomic_type -> Namespace_symbols.rtype_symbol
val unit_symbol_of_base_type : atomic_type -> Namespace_symbols.rtype_symbol
val can_be_promoted_to : atomic_type -> atomic_type list
val bt_can_be_promoted_to : atomic_type -> atomic_type -> (bool * bool)
val string_of_atomic_type : Datatypes.atomic_type -> string
val compare_types : Datatypes.atomic_type -> Datatypes.atomic_type -> int
val base64_of_hex : xs_base64Binary -> xs_hexBinary
val hex_of_base64 : xs_hexBinary -> xs_base64Binary
|
47f39e13cb12a57fa7f78cd36fbd7c5f0f658cb594fe187d03af405774d85a6d | TokTok/hs-toxcore | Stamped.hs | {-# LANGUAGE Safe #-}
{-# LANGUAGE StrictData #-}
module Network.Tox.DHT.Stamped where
import qualified Data.Foldable as F
import Data.List ((\\))
import Data.Map (Map)
import qualified Data.Map as Map
import Network.Tox.Time (Timestamp)
{-------------------------------------------------------------------------------
-
- :: Implementation.
-
------------------------------------------------------------------------------}
-- | a collection of objects associated with a timestamp.
type Stamped a = Map Timestamp [a]
empty :: Stamped a
empty = Map.empty
-- | add a timestamped object. There is no requirement that the stamp be later
-- than that of previously added objects.
add :: Timestamp -> a -> Stamped a -> Stamped a
add time x = Map.insertWith (++) time [x]
delete :: Eq a => Timestamp -> a -> Stamped a -> Stamped a
delete time x = Map.adjust (\\ [x]) time
findStamps :: (a -> Bool) -> Stamped a -> [Timestamp]
findStamps p = Map.keys . Map.filter (any p)
dropOlder :: Timestamp -> Stamped a -> Stamped a
dropOlder time = Map.mapMaybeWithKey $
\t x -> if t < time then Nothing else Just x
getList :: Stamped a -> [a]
getList = F.concat
popFirst :: Stamped a -> (Maybe (Timestamp, a), Stamped a)
popFirst stamped =
case Map.toAscList stamped of
[] -> (Nothing, stamped)
assoc:assocs -> case assoc of
(_, []) -> popFirst $ Map.fromAscList assocs
(stamp, [a]) -> (Just (stamp, a), Map.fromAscList assocs)
(stamp, a:as) -> (Just (stamp, a), Map.fromAscList $ (stamp, as):assocs)
{-------------------------------------------------------------------------------
-
- :: Tests.
-
------------------------------------------------------------------------------}
| null | https://raw.githubusercontent.com/TokTok/hs-toxcore/3ceab5974c36c4c5dbf7518ba733ec2b6084ce5d/src/Network/Tox/DHT/Stamped.hs | haskell | # LANGUAGE Safe #
# LANGUAGE StrictData #
------------------------------------------------------------------------------
-
- :: Implementation.
-
-----------------------------------------------------------------------------
| a collection of objects associated with a timestamp.
| add a timestamped object. There is no requirement that the stamp be later
than that of previously added objects.
------------------------------------------------------------------------------
-
- :: Tests.
-
----------------------------------------------------------------------------- | module Network.Tox.DHT.Stamped where
import qualified Data.Foldable as F
import Data.List ((\\))
import Data.Map (Map)
import qualified Data.Map as Map
import Network.Tox.Time (Timestamp)
type Stamped a = Map Timestamp [a]
empty :: Stamped a
empty = Map.empty
add :: Timestamp -> a -> Stamped a -> Stamped a
add time x = Map.insertWith (++) time [x]
delete :: Eq a => Timestamp -> a -> Stamped a -> Stamped a
delete time x = Map.adjust (\\ [x]) time
findStamps :: (a -> Bool) -> Stamped a -> [Timestamp]
findStamps p = Map.keys . Map.filter (any p)
dropOlder :: Timestamp -> Stamped a -> Stamped a
dropOlder time = Map.mapMaybeWithKey $
\t x -> if t < time then Nothing else Just x
getList :: Stamped a -> [a]
getList = F.concat
popFirst :: Stamped a -> (Maybe (Timestamp, a), Stamped a)
popFirst stamped =
case Map.toAscList stamped of
[] -> (Nothing, stamped)
assoc:assocs -> case assoc of
(_, []) -> popFirst $ Map.fromAscList assocs
(stamp, [a]) -> (Just (stamp, a), Map.fromAscList assocs)
(stamp, a:as) -> (Just (stamp, a), Map.fromAscList $ (stamp, as):assocs)
|
60b6bcbd4e3ed5ba473cdd0c4f4680079a4c841f624865b794ca3ba33e052be0 | inconvergent/cl-veq | mat.lisp |
(in-package #:veq-tests)
(plan 1)
(subtest "mat"
(veq:fvprogn
(is (veq:lst (veq:f3mtv (veq:f_ `(1f0 2f0 4f0 3f0 3f0 5f0 4f0 3f0 3f0))
(veq:f3+ 1f0 2f0 4f0 1f0 2f0 4f0)))
'(46f0 40f0 52f0))
(is (veq:lst (veq:f3mv (veq:f_ `(1f0 2f0 4f0 3f0 3f0 5f0 4f0 3f0 3f0))
(veq:f3+ 1f0 2f0 4f0 1f0 2f0 4f0)))
'(42f0 58f0 44f0))
(is (veq:lst (veq:f2mv (veq:f_ `(1f0 2f0 3f0 3f0))
(veq:f2- 1f0 2f0 2f0 4f0)))
'(-5f0 -9f0))
(is (veq:lst (veq:f4mv (veq:f_ `(1f0 2f0 4f0 6f0 3f0 3f0 5f0 9f0
4f0 3f0 3f0 6f0 -1f0 3f0 -3f0 8f0))
(veq:f4* 1f0 2f0 -4f0 1f0 2f0 4f0 8f0 1f0)))
'(-104f0 -121f0 -58f0 126f0))
(is (veq:lst (veq:f4mv (veq:f4meye)
(veq:f4* 1f0 2f0 -4f0 1f0 2f0 4f0 8f0 1f0)))
'(2f0 8f0 -32f0 1f0))
(is (veq:lst (veq:f4mv (veq:f4meye 3f0)
(veq:f4* 1f0 2f0 -4f0 1f0 2f0 4f0 8f0 1f0)))
'(6f0 24f0 -96f0 3f0))
(is (veq:f4mt! (veq:f_ `(1f0 2f0 4f0 6f0 3f0 3f0 5f0 9f0
4f0 3f0 3f0 6f0 -1f0 3f0 -3f0 8f0)))
#(1f0 3f0 4f0 -1f0 2f0 3f0 3f0 3f0
4f0 5f0 3f0 -3f0 6f0 9f0 6f0 8f0)
:test #'equalp)
(is (veq:f3mm (veq:f_ `(1f0 2f0 4f0 2f0 2f0 3f0 3f0 3f0 4f0))
(veq:f_ `(3f0 2f0 4f0 3f0 1f0 2f0 3f0 3f0 1f0)))
#(21f0 16f0 12f0 21f0 15f0 15f0 30f0 21f0 22f0)
:test #'equalp)
(is (veq:f3mtm (veq:f_ `(1f0 2f0 4f0 2f0 2f0 3f0 3f0 3f0 4f0))
(veq:f_ `(3f0 2f0 4f0 3f0 1f0 2f0 3f0 3f0 1f0)))
#(18f0 13f0 11f0 21f0 15f0 15f0 33f0 23f0 26f0)
:test #'equalp)
(is (veq:f3mmt (veq:f_ `(1f0 2f0 4f0 2f0 2f0 3f0 3f0 3f0 4f0))
(veq:f_ `(3f0 2f0 4f0 3f0 1f0 2f0 3f0 3f0 1f0)))
#(23f0 13f0 13f0 22f0 14f0 15f0 31f0 20f0 22f0)
:test #'equalp)
(is (veq:f3mtmt (veq:f_ `(1f0 2f0 4f0 2f0 2f0 3f0 3f0 3f0 4f0))
(veq:f_ `(3f0 2f0 4f0 3f0 1f0 2f0 3f0 3f0 1f0)))
#(19f0 11f0 12f0 22f0 14f0 15f0 34f0 23f0 25f0)
:test #'equalp)
(is (veq:f3mrot* 26.0 (veq:f3norm 0.3 0.4 -2.3))
#(0.6526553 0.752802 0.08561626 -0.73750615
0.6571166 -0.15582836 -0.17356777 0.038559683 0.9840667)
:test #'equalp)
(is (veq:f3mrot 26.0 (veq:f3norm 0.3 0.4 -2.3))
#(0.6526553 0.752802 0.08561626 0.0 -0.73750615 0.6571166 -0.15582836 0.0
-0.17356777 0.038559683 0.9840667 0.0 0.0 0.0 0.0 1.0)
:test #'equalp)
(is (veq:d2minv (veq:d_ '(1d0 2d0 3d0 31d0)))
#(1.24d00 -0.08d0 -0.12d0 0.04d0 )
:test #'equalp)
(is (veq:d3minv (veq:d_ '(1d0 2d0 77d0 3d0 3d0 21d0 -1.2d0 7d0 2d0)))
#(-0.08339247693399575d0 0.3164182635438846d0 -0.11178140525195175d0
-0.018452803406671398d0 0.05583155902531346d0 0.1242015613910575d0
0.01454932576295245d0 -0.0055594984622663835d0 -0.00177430801987225d0)
:test #'equalp)
(is (veq:f4minv (veq:f_ '(1f0 2f0 77f0 7f0 3f0 3f0 21f0 -1f0
-1.2 7f0 2f0 3f0 0f0 1f0 -1f0 -10.1f0)))
#(-0.08739566 0.32386506 -0.096500464 -0.12130059 -0.017844949 0.05470082
0.121881254 0.018418644 0.014880082 -0.006174776 -0.00303687 0.01002225
-0.0032401022 0.006027287 0.012368131 -0.09817857)
:test #'equalp)))
(unless (finalize) (error "error mat tests"))
| null | https://raw.githubusercontent.com/inconvergent/cl-veq/433cd43ceb086a95cfe010b1f1b4469164e60d07/test/mat.lisp | lisp |
(in-package #:veq-tests)
(plan 1)
(subtest "mat"
(veq:fvprogn
(is (veq:lst (veq:f3mtv (veq:f_ `(1f0 2f0 4f0 3f0 3f0 5f0 4f0 3f0 3f0))
(veq:f3+ 1f0 2f0 4f0 1f0 2f0 4f0)))
'(46f0 40f0 52f0))
(is (veq:lst (veq:f3mv (veq:f_ `(1f0 2f0 4f0 3f0 3f0 5f0 4f0 3f0 3f0))
(veq:f3+ 1f0 2f0 4f0 1f0 2f0 4f0)))
'(42f0 58f0 44f0))
(is (veq:lst (veq:f2mv (veq:f_ `(1f0 2f0 3f0 3f0))
(veq:f2- 1f0 2f0 2f0 4f0)))
'(-5f0 -9f0))
(is (veq:lst (veq:f4mv (veq:f_ `(1f0 2f0 4f0 6f0 3f0 3f0 5f0 9f0
4f0 3f0 3f0 6f0 -1f0 3f0 -3f0 8f0))
(veq:f4* 1f0 2f0 -4f0 1f0 2f0 4f0 8f0 1f0)))
'(-104f0 -121f0 -58f0 126f0))
(is (veq:lst (veq:f4mv (veq:f4meye)
(veq:f4* 1f0 2f0 -4f0 1f0 2f0 4f0 8f0 1f0)))
'(2f0 8f0 -32f0 1f0))
(is (veq:lst (veq:f4mv (veq:f4meye 3f0)
(veq:f4* 1f0 2f0 -4f0 1f0 2f0 4f0 8f0 1f0)))
'(6f0 24f0 -96f0 3f0))
(is (veq:f4mt! (veq:f_ `(1f0 2f0 4f0 6f0 3f0 3f0 5f0 9f0
4f0 3f0 3f0 6f0 -1f0 3f0 -3f0 8f0)))
#(1f0 3f0 4f0 -1f0 2f0 3f0 3f0 3f0
4f0 5f0 3f0 -3f0 6f0 9f0 6f0 8f0)
:test #'equalp)
(is (veq:f3mm (veq:f_ `(1f0 2f0 4f0 2f0 2f0 3f0 3f0 3f0 4f0))
(veq:f_ `(3f0 2f0 4f0 3f0 1f0 2f0 3f0 3f0 1f0)))
#(21f0 16f0 12f0 21f0 15f0 15f0 30f0 21f0 22f0)
:test #'equalp)
(is (veq:f3mtm (veq:f_ `(1f0 2f0 4f0 2f0 2f0 3f0 3f0 3f0 4f0))
(veq:f_ `(3f0 2f0 4f0 3f0 1f0 2f0 3f0 3f0 1f0)))
#(18f0 13f0 11f0 21f0 15f0 15f0 33f0 23f0 26f0)
:test #'equalp)
(is (veq:f3mmt (veq:f_ `(1f0 2f0 4f0 2f0 2f0 3f0 3f0 3f0 4f0))
(veq:f_ `(3f0 2f0 4f0 3f0 1f0 2f0 3f0 3f0 1f0)))
#(23f0 13f0 13f0 22f0 14f0 15f0 31f0 20f0 22f0)
:test #'equalp)
(is (veq:f3mtmt (veq:f_ `(1f0 2f0 4f0 2f0 2f0 3f0 3f0 3f0 4f0))
(veq:f_ `(3f0 2f0 4f0 3f0 1f0 2f0 3f0 3f0 1f0)))
#(19f0 11f0 12f0 22f0 14f0 15f0 34f0 23f0 25f0)
:test #'equalp)
(is (veq:f3mrot* 26.0 (veq:f3norm 0.3 0.4 -2.3))
#(0.6526553 0.752802 0.08561626 -0.73750615
0.6571166 -0.15582836 -0.17356777 0.038559683 0.9840667)
:test #'equalp)
(is (veq:f3mrot 26.0 (veq:f3norm 0.3 0.4 -2.3))
#(0.6526553 0.752802 0.08561626 0.0 -0.73750615 0.6571166 -0.15582836 0.0
-0.17356777 0.038559683 0.9840667 0.0 0.0 0.0 0.0 1.0)
:test #'equalp)
(is (veq:d2minv (veq:d_ '(1d0 2d0 3d0 31d0)))
#(1.24d00 -0.08d0 -0.12d0 0.04d0 )
:test #'equalp)
(is (veq:d3minv (veq:d_ '(1d0 2d0 77d0 3d0 3d0 21d0 -1.2d0 7d0 2d0)))
#(-0.08339247693399575d0 0.3164182635438846d0 -0.11178140525195175d0
-0.018452803406671398d0 0.05583155902531346d0 0.1242015613910575d0
0.01454932576295245d0 -0.0055594984622663835d0 -0.00177430801987225d0)
:test #'equalp)
(is (veq:f4minv (veq:f_ '(1f0 2f0 77f0 7f0 3f0 3f0 21f0 -1f0
-1.2 7f0 2f0 3f0 0f0 1f0 -1f0 -10.1f0)))
#(-0.08739566 0.32386506 -0.096500464 -0.12130059 -0.017844949 0.05470082
0.121881254 0.018418644 0.014880082 -0.006174776 -0.00303687 0.01002225
-0.0032401022 0.006027287 0.012368131 -0.09817857)
:test #'equalp)))
(unless (finalize) (error "error mat tests"))
| |
c2fd0507ae2c43c3498c0c0b6be1974ab4db2badef22d2bbf5379ef34a573eb0 | andorp/mini-grin | Exercise02.hs | {-# OPTIONS_GHC -Wno-unused-matches #-}
# LANGUAGE GeneralizedNewtypeDeriving , LambdaCase , ConstraintKinds #
module Tutorial.Chapter01.Exercise02 where
import Data.Int
import Data.Word
import Data.Maybe
import Grin.Exp (Exp(..), Program, Alt, BPat(..), CPat(..), programToDefs)
import Control.Monad.Fail
import Control.Monad.Reader
import Control.Monad.State
import Control.Monad.Trans.RWS.Strict (RWST(..))
import Grin.Interpreter.Env (Env)
import qualified Grin.Interpreter.Env as Env
import Grin.Interpreter.Store (Store)
import qualified Grin.Interpreter.Store as Store
import qualified Grin.Value as Grin
import qualified Data.Map.Strict as Map
import Lens.Micro.Platform
Motivation :
To give a language meaning one could write an interpreter .
Using the interpreter we can define the operational semantics
of a language . The interpreter can also be regarded as a state
transition system over a given abstract domain .
This approach is called the DEFINITIONAL INTERPRETER .
Our domain consist of
* an Environment , which associates variables with values , AND
-- NOTE : consider renamind Store - > ( Abstract ) Heap [ to avoid confusion about store operation ]
* a Store ( Heap ) which represents the memory of the machine . The
store associates heap locations ( Addresses ) with values .
Exercise : Read the Grin . Interpreter . Env module
Exercise : Read the Grin . Interpreter . Store module
During the interpretation
* The environment associates variables with values
which can be of three kinds :
* Primitive ( SValue )
* Node
* Unit
Values of type Unit can be created by an Update operation ,
or an effectful external operation .
* The store can only hold Node values ( similar to C - style structs )
Note :
programs are in Static Single Assignment form ,
which means rebinding a variable is illegal .
Exercise : Read the definition of Value , and SValue types below . These types represent
values in a running interpreter .
Motivation:
To give a language meaning one could write an interpreter.
Using the interpreter we can define the operational semantics
of a language. The interpreter can also be regarded as a state
transition system over a given abstract domain.
This approach is called the DEFINITIONAL INTERPRETER.
Our domain consist of
* an Environment, which associates variables with values, AND
-- NOTE: consider renamind Store -> (Abstract) Heap [to avoid confusion about store operation]
* a Store (Heap) which represents the memory of the machine. The
store associates heap locations (Addresses) with values.
Exercise: Read the Grin.Interpreter.Env module
Exercise: Read the Grin.Interpreter.Store module
During the interpretation
* The environment associates variables with values
which can be of three kinds:
* Primitive (SValue)
* Node
* Unit
Values of type Unit can be created by an Update operation,
or an effectful external operation.
* The store can only hold Node values (similar to C-style structs)
Note:
GRIN programs are in Static Single Assignment form,
which means rebinding a variable is illegal.
Exercise: Read the definition of Value, Node and SValue types below. These types represent
values in a running interpreter.
-}
data Value -- A runtime value can be:
= Prim SValue -- A primitive value as simple value
| Node Node -- A node value which represents a node in the graph
The UNIT value , which represents no information at all . Like ( ) in Haskell .
deriving (Eq, Show)
data Node = N { tag :: Grin.Tag, args :: [SValue] }
deriving (Eq, Show)
data SValue
= SInt64 Int64
| SWord64 Word64
| SFloat Float
| SBool Bool
| SChar Char
| SLoc Address
deriving (Eq, Ord, Show)
| For simplicity 's sake , we will represent addresses using Ints .
type Address = Int
The structure of the interpreter can be represented as a Monad Transformer , which
operates on a given Monad ' m ' , which can run arbitrary IO computations .
The Env represents the frame , which holds values for variables . The MonadReader abstraction
fits well with the frame abstraction .
The associates Addresses with Node values , during the execution of the program ,
contents of the heap location associated with the given address may change .
* Store : A new address is allocated using the Store operation , which creates a new heap
location , saves the value of which was given to the Store operation via a variable
those value must be looked up from the Env .
The store operation returns the newly created address .
* Fetch : The content of a given address can be retrieved using the Fetch operation . The
parameter of the operation is a variable which holds an address value .
* Update : The content of an address can be overwritten using the Update operation .
The structure of the interpreter can be represented as a Monad Transformer, which
operates on a given Monad 'm', which can run arbitrary IO computations.
The Env represents the frame, which holds values for variables. The MonadReader abstraction
fits well with the frame abstraction.
The Heap associates Addresses with Node values, during the execution of the program,
contents of the heap location associated with the given address may change.
* Store: A new address is allocated using the Store operation, which creates a new heap
location, saves the value of which was given to the Store operation via a variable
those value must be looked up from the Env.
The store operation returns the newly created address.
* Fetch: The content of a given address can be retrieved using the Fetch operation. The
parameter of the operation is a variable which holds an address value.
* Update: The content of an address can be overwritten using the Update operation.
-}
-- | How to interpret External names in the interpreter.
type InterpretExternal = Map.Map Grin.Name ([Value] -> IO Value)
data Functions = Functions
^ Functions defined within the program
^ Externals used within the program
}
newtype Definitional m a =
Definitional
Reader Writer State
(Functions, Env Value) -- Reader on the Functions and the variable value mapping
() -- Empty writer: No logging happens at all
State is the Store which can be change during the interpretation
m
a
)
deriving
( Functor
, Applicative
, Monad
, MonadIO
, MonadReader (Functions, Env Value)
, MonadState (Store Address Node)
, MonadFail
)
-- | Collection of the needed constraints.
type DC m = (Monad m, MonadIO m, MonadFail m)
During the execution of a GRIN program , the interpeter
needs a context to interpret function calls .
Firstly , it needs to know all the functions defined in the program .
Furthermore , it needs to know how to call external functions ( system / OS functions ) .
This is accomplished by ` externalCall ` . This function will be used to interpret
external function calls ( in SApp ) . Given an external function 's name , and the
actual arguments to the call , it calls the corresponding system / OS function .
During the execution of a GRIN program, the interpeter
needs a context to interpret function calls.
Firstly, it needs to know all the functions defined in the GRIN program.
Furthermore, it needs to know how to call external functions (system/OS functions).
This is accomplished by `externalCall`. This function will be used to interpret
external function calls (in SApp). Given an external function's name, and the
actual arguments to the call, it calls the corresponding system/OS function.
-}
-- The interpreter function gets how to interpret the external functions,
-- a program to interpret, and returns a computed value.
--
-- It collects the function definitions from the program,
-- loads the body of the main function and starts to evaluate that expression.
interpreter :: InterpretExternal -> Program -> IO Value
interpreter iext prog =
fst <$> runInterpreter (eval (SApp "main" []))
where
runInterpreter :: (Monad m, MonadIO m, MonadFail m) => Definitional m a -> m (a, Store Address Node)
runInterpreter (Definitional r) = do
let funs = Functions (programToDefs prog) iext
(a,store,()) <- runRWST r (funs, Env.empty) Store.empty
pure (a,store)
-- * Implementation details
-- | Turns a Simple Value from a syntax to a simple value of the semantics.
simpleValue :: Grin.SimpleValue -> SValue
simpleValue = \case
Grin.SInt64 s -> SInt64 s
Grin.SWord64 s -> SWord64 s
Grin.SFloat s -> SFloat s
Grin.SBool s -> SBool s
Grin.SChar s -> SChar s
-- | Looks up a name from the active frame/environment and returns its value.
valueOf :: (DC m) => Grin.Name -> Definitional m Value
valueOf name = asks ((`Env.lookup` name) . snd)
-- | Looks up a name from the active frame/environment and returns its value, expecting a simple value.
svalueOf :: (DC m) => Grin.Name -> Definitional m SValue
svalueOf name = do
(Prim sv) <- valueOf name
pure sv
| Creates a new location that can be used in the Store operation .
-- The size of the underlying Map will be always the last created location +1,
-- which serves the purpose of a new address.
alloc :: (DC m) => Definitional m Address
alloc = gets Store.size
The Eval function , that operates on the Expression part of the GRIN AST .
eval :: (DC m) => Exp -> Definitional m Value
eval = \case
-- Evaluates the given value, assigning a semantical value to a syntactical one.
SPure (Grin.Val l) -> value l
-- Looks up a variable form the active environment
SPure (Grin.Var n) -> do
p <- askEnv
pure $ Env.lookup p n
Calls a function , external or defined internal .
SApp fn ps -> do
p <- askEnv
vs <- pure $ map (Env.lookup p) ps
ext <- isExternal fn
(if ext then external else funCall eval) fn vs
-- Fetches a value from the heap.
SFetch n -> do
p <- askEnv
let v = Env.lookup p n
fetchStore v
-- Updates the given location with the given value.
SUpdate nl nn -> do
p <- askEnv
let vl = Env.lookup p nl
let vn = Env.lookup p nn
extStore vl vn
unit
Matches the given value with one of the alternatives .
ECase n alts -> do
p <- askEnv
v <- pure $ Env.lookup p n
-- Select the alternative and continue the evaluation
evalCase eval v alts
-- Handling stores are differen. Create a new location, saves the given node value
to the location , and assignes the created location value to the variable in the pattern .
EBind (SStore n) (BVar l) rhs -> do
p <- askEnv
let v = Env.lookup p n
a <- allocStore l
extStore a v
let p' = Env.insert l a p
localEnv p' $ eval rhs
-- Evaluates the left expression, than binds its return value to the variable
-- extending the environment, run the right epxression with the extended
-- environemnt and returns its value.
EBind lhs (BVar n) rhs -> do
v <- eval lhs
p <- askEnv
let p' = Env.insert n v p
localEnv p' (eval rhs)
-- Evaluates the left expression, than binds its return value to the variables
-- in the bind pattern if the tag of the computed value matches,
-- extending the environment, run the right epxression with the extended
-- environemnt and returns its value.
EBind lhs (BNodePat n t@(Grin.Tag{}) vs) rhs -> do
v <- eval lhs
p <- askEnv
p' <- flip Env.inserts p <$> bindPattern v (t,vs)
let p'' = Env.insert n v p'
localEnv p'' (eval rhs)
-- After the Case selected the Alternative it just needs to evaluate its body.
Alt _n _pat body -> do
eval body
overGenerative -> error $ show overGenerative
-- | How to turn a source defined value to a runtime value
value :: (DC m) => Grin.Value -> Definitional m Value
value = \case
Grin.VPrim sval -> pure $ Prim $ simpleValue sval
-- Exercise: Node can refer to names, lookup the names from
the environment and create a runtime Node value from
-- the value that was defined in the source.
Grin.VNode vnode -> undefined vnode
-- | Convert a runtime value to an address value
val2addr :: (DC m) => Value -> Definitional m Address
val2addr v = do
(Prim (SLoc addr)) <- pure v
pure addr
-- | Convert an address value to a runtime value.
addr2val :: (DC m) => Address -> Definitional m Value
addr2val addr = pure (Prim (SLoc addr))
-- | Convert a heap value, which is a node to a runtime value
heapVal2val :: (DC m) => Node -> Definitional m Value
heapVal2val node = pure (Node node)
-- | Convert a runtime value to a Node value
val2heapVal :: (DC m) => Value -> Definitional m Node
val2heapVal val = do
(Node node) <- pure val
pure node
-- | Creates the Unit value, which is only created when the Update operation runs.
unit :: (DC m) => Definitional m Value
unit = pure Unit
-- | Creates a list of Name and runtime value pairs which extends the environment for the
-- right hand side of the bind.
See in lazyAdd or in sumSimple
bindPattern :: (DC m) => Value -> (Grin.Tag, [Grin.Name]) -> Definitional m [(Grin.Name, Value)]
bindPattern val tags =
Exercise : The val should be a Node value , if the tag of the node matches , with the given
tag , than the args argument from the Node value must be paired with the names in the
-- given pattern.
-- TODO: Add reference to the examples.
undefined
-- | Return the environment, which associates names with values
askEnv :: (DC m) => Definitional m (Env Value)
askEnv = asks snd
-- | Sets the environment to the given one, this is for binds, function calls,
-- and alternatives.
localEnv :: (DC m) => Env (Value) -> Definitional m Value -> Definitional m Value
localEnv env = local (set _2 env)
-- | Lookup a function by its name. It should return the Def constructor which contains
-- the parameters and the body of the function.
lookupFun :: (DC m) => Grin.Name -> Definitional m Exp
lookupFun funName = fromJust <$> view (_1 . to functions . at funName)
-- | Checks if the given name refers to an external function.
isExternal :: (DC m) => Grin.Name -> Definitional m Bool
isExternal extName =
-- Exercise: Use MonadReader to retrieve the Context and lookup the
-- the extName in the context
undefined
-- | Run the given external with the parameters
external :: (DC m) => Grin.Name -> [Value] -> Definitional m Value
external =
-- Exercise: Use the MonadReader to retrieve the Context and lookup
-- the function and apply the parameters to it
undefined
funCall
:: (DC m)
=> (Exp -> Definitional m Value)
-> Grin.Name -> [Value] -> Definitional m Value
funCall ev funName values =
-- Exercise:
-- Lookup the function by the given name
-- Retrieve its (Def params body)
-- Create an empty env and bind the function parameters to the given values
-- Run the eval function on the created new local env and body
undefined
evalCase
:: (DC m)
=> (Exp -> Definitional m Value)
-> Value -> [Alt] -> Definitional m Value
evalCase ev =
-- Exercise:
Find the first Alt that matches the given value .
If the Alt has a Node pattern , the must be a Node
In that case bind the values to the names defined in the pattern
-- create a new local environment and evaluate the body of the alt in it.
-- Note that the name in the Alt must bind the value in the environment.
undefined
| Creates a location for a given name . This is particular for the store structure ,
where the Store operation must be part of a Bind , thus there will be always a name to
-- bind to, which should hold the address of the created location.
--
In this Definitional interpreter for every Store operation that the interpreter evaluates
-- it must creates a new location.
allocStore :: (DC m) => Grin.Name -> Definitional m Value
allocStore _name = do
addr <- alloc
pure $ Prim $ SLoc addr
-- | Loads the content from the store addressed by the given value
fetchStore :: (DC m) => Value -> Definitional m Value
fetchStore addr = do
s <- get
a <- undefined addr
heapVal2val $ Store.lookup a s
-- | Extends the store with the given value.
extStore :: (DC m) => Value -> Value -> Definitional m ()
extStore addr val = do
a <- undefined addr
n <- val2heapVal val
modify (Store.insert a n)
-- * The externals that the interpreter can understand
knownExternals :: Map.Map Grin.Name ([Value] -> IO Value)
knownExternals = Map.fromList
[ ("prim_int_eq", \[Prim (SInt64 a), Prim (SInt64 b)] -> pure $ Prim (SBool (a == b)))
, ("prim_int_gt", \[Prim (SInt64 a), Prim (SInt64 b)] -> pure $ Prim (SBool (a > b)))
, ("prim_int_add", \[Prim (SInt64 a), Prim (SInt64 b)] -> pure $ Prim (SInt64 (a + b)))
, ("prim_int_sub", \[Prim (SInt64 a), Prim (SInt64 b)] -> pure $ Prim (SInt64 (a - b)))
, ("prim_int_mul", \[Prim (SInt64 a), Prim (SInt64 b)] -> pure $ Prim (SInt64 (a * b)))
, ("prim_int_print", \[(Prim (SInt64 a))] -> Unit <$ print a)
]
| null | https://raw.githubusercontent.com/andorp/mini-grin/99913efa0f81cb2a76893d3e48c6d025df9c40c9/grin/src/Tutorial/Chapter01/Exercise02.hs | haskell | # OPTIONS_GHC -Wno-unused-matches #
NOTE : consider renamind Store - > ( Abstract ) Heap [ to avoid confusion about store operation ]
NOTE: consider renamind Store -> (Abstract) Heap [to avoid confusion about store operation]
A runtime value can be:
A primitive value as simple value
A node value which represents a node in the graph
| How to interpret External names in the interpreter.
Reader on the Functions and the variable value mapping
Empty writer: No logging happens at all
| Collection of the needed constraints.
The interpreter function gets how to interpret the external functions,
a program to interpret, and returns a computed value.
It collects the function definitions from the program,
loads the body of the main function and starts to evaluate that expression.
* Implementation details
| Turns a Simple Value from a syntax to a simple value of the semantics.
| Looks up a name from the active frame/environment and returns its value.
| Looks up a name from the active frame/environment and returns its value, expecting a simple value.
The size of the underlying Map will be always the last created location +1,
which serves the purpose of a new address.
Evaluates the given value, assigning a semantical value to a syntactical one.
Looks up a variable form the active environment
Fetches a value from the heap.
Updates the given location with the given value.
Select the alternative and continue the evaluation
Handling stores are differen. Create a new location, saves the given node value
Evaluates the left expression, than binds its return value to the variable
extending the environment, run the right epxression with the extended
environemnt and returns its value.
Evaluates the left expression, than binds its return value to the variables
in the bind pattern if the tag of the computed value matches,
extending the environment, run the right epxression with the extended
environemnt and returns its value.
After the Case selected the Alternative it just needs to evaluate its body.
| How to turn a source defined value to a runtime value
Exercise: Node can refer to names, lookup the names from
the value that was defined in the source.
| Convert a runtime value to an address value
| Convert an address value to a runtime value.
| Convert a heap value, which is a node to a runtime value
| Convert a runtime value to a Node value
| Creates the Unit value, which is only created when the Update operation runs.
| Creates a list of Name and runtime value pairs which extends the environment for the
right hand side of the bind.
given pattern.
TODO: Add reference to the examples.
| Return the environment, which associates names with values
| Sets the environment to the given one, this is for binds, function calls,
and alternatives.
| Lookup a function by its name. It should return the Def constructor which contains
the parameters and the body of the function.
| Checks if the given name refers to an external function.
Exercise: Use MonadReader to retrieve the Context and lookup the
the extName in the context
| Run the given external with the parameters
Exercise: Use the MonadReader to retrieve the Context and lookup
the function and apply the parameters to it
Exercise:
Lookup the function by the given name
Retrieve its (Def params body)
Create an empty env and bind the function parameters to the given values
Run the eval function on the created new local env and body
Exercise:
create a new local environment and evaluate the body of the alt in it.
Note that the name in the Alt must bind the value in the environment.
bind to, which should hold the address of the created location.
it must creates a new location.
| Loads the content from the store addressed by the given value
| Extends the store with the given value.
* The externals that the interpreter can understand | # LANGUAGE GeneralizedNewtypeDeriving , LambdaCase , ConstraintKinds #
module Tutorial.Chapter01.Exercise02 where
import Data.Int
import Data.Word
import Data.Maybe
import Grin.Exp (Exp(..), Program, Alt, BPat(..), CPat(..), programToDefs)
import Control.Monad.Fail
import Control.Monad.Reader
import Control.Monad.State
import Control.Monad.Trans.RWS.Strict (RWST(..))
import Grin.Interpreter.Env (Env)
import qualified Grin.Interpreter.Env as Env
import Grin.Interpreter.Store (Store)
import qualified Grin.Interpreter.Store as Store
import qualified Grin.Value as Grin
import qualified Data.Map.Strict as Map
import Lens.Micro.Platform
Motivation :
To give a language meaning one could write an interpreter .
Using the interpreter we can define the operational semantics
of a language . The interpreter can also be regarded as a state
transition system over a given abstract domain .
This approach is called the DEFINITIONAL INTERPRETER .
Our domain consist of
* an Environment , which associates variables with values , AND
* a Store ( Heap ) which represents the memory of the machine . The
store associates heap locations ( Addresses ) with values .
Exercise : Read the Grin . Interpreter . Env module
Exercise : Read the Grin . Interpreter . Store module
During the interpretation
* The environment associates variables with values
which can be of three kinds :
* Primitive ( SValue )
* Node
* Unit
Values of type Unit can be created by an Update operation ,
or an effectful external operation .
* The store can only hold Node values ( similar to C - style structs )
Note :
programs are in Static Single Assignment form ,
which means rebinding a variable is illegal .
Exercise : Read the definition of Value , and SValue types below . These types represent
values in a running interpreter .
Motivation:
To give a language meaning one could write an interpreter.
Using the interpreter we can define the operational semantics
of a language. The interpreter can also be regarded as a state
transition system over a given abstract domain.
This approach is called the DEFINITIONAL INTERPRETER.
Our domain consist of
* an Environment, which associates variables with values, AND
* a Store (Heap) which represents the memory of the machine. The
store associates heap locations (Addresses) with values.
Exercise: Read the Grin.Interpreter.Env module
Exercise: Read the Grin.Interpreter.Store module
During the interpretation
* The environment associates variables with values
which can be of three kinds:
* Primitive (SValue)
* Node
* Unit
Values of type Unit can be created by an Update operation,
or an effectful external operation.
* The store can only hold Node values (similar to C-style structs)
Note:
GRIN programs are in Static Single Assignment form,
which means rebinding a variable is illegal.
Exercise: Read the definition of Value, Node and SValue types below. These types represent
values in a running interpreter.
-}
The UNIT value , which represents no information at all . Like ( ) in Haskell .
deriving (Eq, Show)
data Node = N { tag :: Grin.Tag, args :: [SValue] }
deriving (Eq, Show)
data SValue
= SInt64 Int64
| SWord64 Word64
| SFloat Float
| SBool Bool
| SChar Char
| SLoc Address
deriving (Eq, Ord, Show)
| For simplicity 's sake , we will represent addresses using Ints .
type Address = Int
The structure of the interpreter can be represented as a Monad Transformer , which
operates on a given Monad ' m ' , which can run arbitrary IO computations .
The Env represents the frame , which holds values for variables . The MonadReader abstraction
fits well with the frame abstraction .
The associates Addresses with Node values , during the execution of the program ,
contents of the heap location associated with the given address may change .
* Store : A new address is allocated using the Store operation , which creates a new heap
location , saves the value of which was given to the Store operation via a variable
those value must be looked up from the Env .
The store operation returns the newly created address .
* Fetch : The content of a given address can be retrieved using the Fetch operation . The
parameter of the operation is a variable which holds an address value .
* Update : The content of an address can be overwritten using the Update operation .
The structure of the interpreter can be represented as a Monad Transformer, which
operates on a given Monad 'm', which can run arbitrary IO computations.
The Env represents the frame, which holds values for variables. The MonadReader abstraction
fits well with the frame abstraction.
The Heap associates Addresses with Node values, during the execution of the program,
contents of the heap location associated with the given address may change.
* Store: A new address is allocated using the Store operation, which creates a new heap
location, saves the value of which was given to the Store operation via a variable
those value must be looked up from the Env.
The store operation returns the newly created address.
* Fetch: The content of a given address can be retrieved using the Fetch operation. The
parameter of the operation is a variable which holds an address value.
* Update: The content of an address can be overwritten using the Update operation.
-}
type InterpretExternal = Map.Map Grin.Name ([Value] -> IO Value)
data Functions = Functions
^ Functions defined within the program
^ Externals used within the program
}
newtype Definitional m a =
Definitional
Reader Writer State
State is the Store which can be change during the interpretation
m
a
)
deriving
( Functor
, Applicative
, Monad
, MonadIO
, MonadReader (Functions, Env Value)
, MonadState (Store Address Node)
, MonadFail
)
type DC m = (Monad m, MonadIO m, MonadFail m)
During the execution of a GRIN program , the interpeter
needs a context to interpret function calls .
Firstly , it needs to know all the functions defined in the program .
Furthermore , it needs to know how to call external functions ( system / OS functions ) .
This is accomplished by ` externalCall ` . This function will be used to interpret
external function calls ( in SApp ) . Given an external function 's name , and the
actual arguments to the call , it calls the corresponding system / OS function .
During the execution of a GRIN program, the interpeter
needs a context to interpret function calls.
Firstly, it needs to know all the functions defined in the GRIN program.
Furthermore, it needs to know how to call external functions (system/OS functions).
This is accomplished by `externalCall`. This function will be used to interpret
external function calls (in SApp). Given an external function's name, and the
actual arguments to the call, it calls the corresponding system/OS function.
-}
interpreter :: InterpretExternal -> Program -> IO Value
interpreter iext prog =
fst <$> runInterpreter (eval (SApp "main" []))
where
runInterpreter :: (Monad m, MonadIO m, MonadFail m) => Definitional m a -> m (a, Store Address Node)
runInterpreter (Definitional r) = do
let funs = Functions (programToDefs prog) iext
(a,store,()) <- runRWST r (funs, Env.empty) Store.empty
pure (a,store)
simpleValue :: Grin.SimpleValue -> SValue
simpleValue = \case
Grin.SInt64 s -> SInt64 s
Grin.SWord64 s -> SWord64 s
Grin.SFloat s -> SFloat s
Grin.SBool s -> SBool s
Grin.SChar s -> SChar s
valueOf :: (DC m) => Grin.Name -> Definitional m Value
valueOf name = asks ((`Env.lookup` name) . snd)
svalueOf :: (DC m) => Grin.Name -> Definitional m SValue
svalueOf name = do
(Prim sv) <- valueOf name
pure sv
| Creates a new location that can be used in the Store operation .
alloc :: (DC m) => Definitional m Address
alloc = gets Store.size
The Eval function , that operates on the Expression part of the GRIN AST .
eval :: (DC m) => Exp -> Definitional m Value
eval = \case
SPure (Grin.Val l) -> value l
SPure (Grin.Var n) -> do
p <- askEnv
pure $ Env.lookup p n
Calls a function , external or defined internal .
SApp fn ps -> do
p <- askEnv
vs <- pure $ map (Env.lookup p) ps
ext <- isExternal fn
(if ext then external else funCall eval) fn vs
SFetch n -> do
p <- askEnv
let v = Env.lookup p n
fetchStore v
SUpdate nl nn -> do
p <- askEnv
let vl = Env.lookup p nl
let vn = Env.lookup p nn
extStore vl vn
unit
Matches the given value with one of the alternatives .
ECase n alts -> do
p <- askEnv
v <- pure $ Env.lookup p n
evalCase eval v alts
to the location , and assignes the created location value to the variable in the pattern .
EBind (SStore n) (BVar l) rhs -> do
p <- askEnv
let v = Env.lookup p n
a <- allocStore l
extStore a v
let p' = Env.insert l a p
localEnv p' $ eval rhs
EBind lhs (BVar n) rhs -> do
v <- eval lhs
p <- askEnv
let p' = Env.insert n v p
localEnv p' (eval rhs)
EBind lhs (BNodePat n t@(Grin.Tag{}) vs) rhs -> do
v <- eval lhs
p <- askEnv
p' <- flip Env.inserts p <$> bindPattern v (t,vs)
let p'' = Env.insert n v p'
localEnv p'' (eval rhs)
Alt _n _pat body -> do
eval body
overGenerative -> error $ show overGenerative
value :: (DC m) => Grin.Value -> Definitional m Value
value = \case
Grin.VPrim sval -> pure $ Prim $ simpleValue sval
the environment and create a runtime Node value from
Grin.VNode vnode -> undefined vnode
val2addr :: (DC m) => Value -> Definitional m Address
val2addr v = do
(Prim (SLoc addr)) <- pure v
pure addr
addr2val :: (DC m) => Address -> Definitional m Value
addr2val addr = pure (Prim (SLoc addr))
heapVal2val :: (DC m) => Node -> Definitional m Value
heapVal2val node = pure (Node node)
val2heapVal :: (DC m) => Value -> Definitional m Node
val2heapVal val = do
(Node node) <- pure val
pure node
unit :: (DC m) => Definitional m Value
unit = pure Unit
See in lazyAdd or in sumSimple
bindPattern :: (DC m) => Value -> (Grin.Tag, [Grin.Name]) -> Definitional m [(Grin.Name, Value)]
bindPattern val tags =
Exercise : The val should be a Node value , if the tag of the node matches , with the given
tag , than the args argument from the Node value must be paired with the names in the
undefined
askEnv :: (DC m) => Definitional m (Env Value)
askEnv = asks snd
localEnv :: (DC m) => Env (Value) -> Definitional m Value -> Definitional m Value
localEnv env = local (set _2 env)
lookupFun :: (DC m) => Grin.Name -> Definitional m Exp
lookupFun funName = fromJust <$> view (_1 . to functions . at funName)
isExternal :: (DC m) => Grin.Name -> Definitional m Bool
isExternal extName =
undefined
external :: (DC m) => Grin.Name -> [Value] -> Definitional m Value
external =
undefined
funCall
:: (DC m)
=> (Exp -> Definitional m Value)
-> Grin.Name -> [Value] -> Definitional m Value
funCall ev funName values =
undefined
evalCase
:: (DC m)
=> (Exp -> Definitional m Value)
-> Value -> [Alt] -> Definitional m Value
evalCase ev =
Find the first Alt that matches the given value .
If the Alt has a Node pattern , the must be a Node
In that case bind the values to the names defined in the pattern
undefined
| Creates a location for a given name . This is particular for the store structure ,
where the Store operation must be part of a Bind , thus there will be always a name to
In this Definitional interpreter for every Store operation that the interpreter evaluates
allocStore :: (DC m) => Grin.Name -> Definitional m Value
allocStore _name = do
addr <- alloc
pure $ Prim $ SLoc addr
fetchStore :: (DC m) => Value -> Definitional m Value
fetchStore addr = do
s <- get
a <- undefined addr
heapVal2val $ Store.lookup a s
extStore :: (DC m) => Value -> Value -> Definitional m ()
extStore addr val = do
a <- undefined addr
n <- val2heapVal val
modify (Store.insert a n)
knownExternals :: Map.Map Grin.Name ([Value] -> IO Value)
knownExternals = Map.fromList
[ ("prim_int_eq", \[Prim (SInt64 a), Prim (SInt64 b)] -> pure $ Prim (SBool (a == b)))
, ("prim_int_gt", \[Prim (SInt64 a), Prim (SInt64 b)] -> pure $ Prim (SBool (a > b)))
, ("prim_int_add", \[Prim (SInt64 a), Prim (SInt64 b)] -> pure $ Prim (SInt64 (a + b)))
, ("prim_int_sub", \[Prim (SInt64 a), Prim (SInt64 b)] -> pure $ Prim (SInt64 (a - b)))
, ("prim_int_mul", \[Prim (SInt64 a), Prim (SInt64 b)] -> pure $ Prim (SInt64 (a * b)))
, ("prim_int_print", \[(Prim (SInt64 a))] -> Unit <$ print a)
]
|
0e302f540a5cd73ddc37c4cd91357fe5e63884562082afa40c56532866a5484a | PLSysSec/FaCT | pos.ml | open Lexing
type pos = { file:string; line:int; lpos:int; rpos:int }
[@@deriving show]
let fake_pos = { file=""; line=0; lpos=0; rpos=0 }
type 'a pos_ast = { pos:pos; data:'a }
[@@deriving show]
let pp_pos_ast pp_data fmt { data } = pp_data fmt data
let to_pos ?buf:(b=None)
{ pos_fname=f; pos_lnum=l; pos_bol=lbl; pos_cnum=lc }
{ pos_cnum=rc } =
match b with
| None -> { file=f; line=l; lpos=lc-lbl+1; rpos=rc-lbl }
| Some lb ->
let start = (lexeme_start lb) - lb.lex_curr_p.pos_bol in
let ends = (lexeme_end lb) - lb.lex_curr_p.pos_bol in
{ file=f; line=l; lpos=start+1; rpos=ends+1 }
let make_pos startpos endpos data = { pos=(to_pos startpos endpos); data=data }
let make_ast pos data = { pos=pos; data=data }
let pos_string { file=f; line=l; lpos=lp; rpos=rp } =
f ^ ":" ^ string_of_int(l) ^
":" ^ string_of_int(lp) ^ "-" ^ string_of_int(rp)
let unpack fn {data} = fn data
let posmap fn = fun pa -> { pa with data=(fn pa.data) }
let wrap f pa = { pa with data=f pa.pos pa.data }
let xwrap f pa = f pa.pos pa.data
let rebind f pa = { pa with data=f pa }
let ( @> ) p ast = make_ast p ast
let ( << ) s p = pos_string p ^ ": " ^ s
| null | https://raw.githubusercontent.com/PLSysSec/FaCT/c08b2e00751b28e1f25d031c3afafc544acfb892/src/pos.ml | ocaml | open Lexing
type pos = { file:string; line:int; lpos:int; rpos:int }
[@@deriving show]
let fake_pos = { file=""; line=0; lpos=0; rpos=0 }
type 'a pos_ast = { pos:pos; data:'a }
[@@deriving show]
let pp_pos_ast pp_data fmt { data } = pp_data fmt data
let to_pos ?buf:(b=None)
{ pos_fname=f; pos_lnum=l; pos_bol=lbl; pos_cnum=lc }
{ pos_cnum=rc } =
match b with
| None -> { file=f; line=l; lpos=lc-lbl+1; rpos=rc-lbl }
| Some lb ->
let start = (lexeme_start lb) - lb.lex_curr_p.pos_bol in
let ends = (lexeme_end lb) - lb.lex_curr_p.pos_bol in
{ file=f; line=l; lpos=start+1; rpos=ends+1 }
let make_pos startpos endpos data = { pos=(to_pos startpos endpos); data=data }
let make_ast pos data = { pos=pos; data=data }
let pos_string { file=f; line=l; lpos=lp; rpos=rp } =
f ^ ":" ^ string_of_int(l) ^
":" ^ string_of_int(lp) ^ "-" ^ string_of_int(rp)
let unpack fn {data} = fn data
let posmap fn = fun pa -> { pa with data=(fn pa.data) }
let wrap f pa = { pa with data=f pa.pos pa.data }
let xwrap f pa = f pa.pos pa.data
let rebind f pa = { pa with data=f pa }
let ( @> ) p ast = make_ast p ast
let ( << ) s p = pos_string p ^ ": " ^ s
| |
eb5fe07d99886d638ce6ed4fd5b616493985034cc1f0a6ead6c34c1f9c4f46f2 | hasktorch/hasktorch | Dimname.hs |
# LANGUAGE DataKinds #
# LANGUAGE PolyKinds #
# LANGUAGE TemplateHaskell #
# LANGUAGE QuasiQuotes #
# LANGUAGE ScopedTypeVariables #
{-# LANGUAGE OverloadedStrings #-}
# LANGUAGE TypeFamilies #
# LANGUAGE FlexibleInstances #
module Torch.Internal.Unmanaged.Type.Dimname where
import qualified Language.C.Inline.Cpp as C
import qualified Language.C.Inline.Cpp.Unsafe as C
import qualified Language.C.Inline.Context as C
import qualified Language.C.Types as C
import qualified Data.Map as Map
import Foreign.C.String
import Foreign.C.Types
import Foreign
import Torch.Internal.Type
C.context $ C.cppCtx <> mempty { C.ctxTypesTable = typeTable }
C.include "<ATen/core/Dimname.h>"
C.include "<vector>"
newDimname_n
:: Ptr Dimname
-> IO (Ptr Dimname)
newDimname_n _x =
[C.throwBlock| at::Dimname* { return new at::Dimname(
*$(at::Dimname* _x));
}|]
dimname_symbol
:: Ptr Dimname
-> IO (Ptr Symbol)
dimname_symbol _obj =
[C.throwBlock| at::Symbol* { return new at::Symbol((*$(at::Dimname* _obj)).symbol(
));
}|]
dimname_isBasic
:: Ptr Dimname
-> IO (CBool)
dimname_isBasic _obj =
[C.throwBlock| bool { return (*$(at::Dimname* _obj)).isBasic(
);
}|]
dimname_isWildcard
:: Ptr Dimname
-> IO (CBool)
dimname_isWildcard _obj =
[C.throwBlock| bool { return (*$(at::Dimname* _obj)).isWildcard(
);
}|]
dimname_matches_n
:: Ptr Dimname
-> Ptr Dimname
-> IO (CBool)
dimname_matches_n _obj _other =
[C.throwBlock| bool { return (*$(at::Dimname* _obj)).matches(
*$(at::Dimname* _other));
}|]
fromSymbol_s
:: Ptr Symbol
-> IO (Ptr Dimname)
fromSymbol_s _name =
[C.throwBlock| at::Dimname* { return new at::Dimname(at::Dimname::fromSymbol(
*$(at::Symbol* _name)));
}|]
wildcard
:: IO (Ptr Dimname)
wildcard =
[C.throwBlock| at::Dimname* { return new at::Dimname(at::Dimname::wildcard(
));
}|]
isValidName_s
:: Ptr StdString
-> IO (CBool)
isValidName_s _name =
[C.throwBlock| bool { return (at::Dimname::isValidName(
*$(std::string* _name)));
}|]
| null | https://raw.githubusercontent.com/hasktorch/hasktorch/6233c173e1dd9fd7218fd13b104da15fc457f67e/libtorch-ffi/src/Torch/Internal/Unmanaged/Type/Dimname.hs | haskell | # LANGUAGE OverloadedStrings # |
# LANGUAGE DataKinds #
# LANGUAGE PolyKinds #
# LANGUAGE TemplateHaskell #
# LANGUAGE QuasiQuotes #
# LANGUAGE ScopedTypeVariables #
# LANGUAGE TypeFamilies #
# LANGUAGE FlexibleInstances #
module Torch.Internal.Unmanaged.Type.Dimname where
import qualified Language.C.Inline.Cpp as C
import qualified Language.C.Inline.Cpp.Unsafe as C
import qualified Language.C.Inline.Context as C
import qualified Language.C.Types as C
import qualified Data.Map as Map
import Foreign.C.String
import Foreign.C.Types
import Foreign
import Torch.Internal.Type
C.context $ C.cppCtx <> mempty { C.ctxTypesTable = typeTable }
C.include "<ATen/core/Dimname.h>"
C.include "<vector>"
newDimname_n
:: Ptr Dimname
-> IO (Ptr Dimname)
newDimname_n _x =
[C.throwBlock| at::Dimname* { return new at::Dimname(
*$(at::Dimname* _x));
}|]
dimname_symbol
:: Ptr Dimname
-> IO (Ptr Symbol)
dimname_symbol _obj =
[C.throwBlock| at::Symbol* { return new at::Symbol((*$(at::Dimname* _obj)).symbol(
));
}|]
dimname_isBasic
:: Ptr Dimname
-> IO (CBool)
dimname_isBasic _obj =
[C.throwBlock| bool { return (*$(at::Dimname* _obj)).isBasic(
);
}|]
dimname_isWildcard
:: Ptr Dimname
-> IO (CBool)
dimname_isWildcard _obj =
[C.throwBlock| bool { return (*$(at::Dimname* _obj)).isWildcard(
);
}|]
dimname_matches_n
:: Ptr Dimname
-> Ptr Dimname
-> IO (CBool)
dimname_matches_n _obj _other =
[C.throwBlock| bool { return (*$(at::Dimname* _obj)).matches(
*$(at::Dimname* _other));
}|]
fromSymbol_s
:: Ptr Symbol
-> IO (Ptr Dimname)
fromSymbol_s _name =
[C.throwBlock| at::Dimname* { return new at::Dimname(at::Dimname::fromSymbol(
*$(at::Symbol* _name)));
}|]
wildcard
:: IO (Ptr Dimname)
wildcard =
[C.throwBlock| at::Dimname* { return new at::Dimname(at::Dimname::wildcard(
));
}|]
isValidName_s
:: Ptr StdString
-> IO (CBool)
isValidName_s _name =
[C.throwBlock| bool { return (at::Dimname::isValidName(
*$(std::string* _name)));
}|]
|
19356ad54d1e69653fc26e859be80a36cb572f8b315214c4f3f7fcc0ef3a018b | gethop-dev/object-storage.s3 | project.clj | (defproject dev.gethop/object-storage.s3 "0.6.11-SNAPSHOT"
:description "A Duct library for managing AWS S3 objects"
:url "-dev/object-storage.s3"
:license {:name "Mozilla Public Licence 2.0"
:url "-US/MPL/2.0/"}
:min-lein-version "2.9.8"
:dependencies [[org.clojure/clojure "1.10.0"]
[amazonica "0.3.143" :exclusions [com.amazonaws/aws-java-sdk
com.amazonaws/amazon-kinesis-client
com.amazonaws/dynamodb-streams-kinesis-adapter]]
[com.amazonaws/aws-java-sdk-core "1.11.586"]
[com.amazonaws/aws-java-sdk-s3 "1.11.586"]
[integrant "0.7.0"]
[dev.gethop/object-storage.core "0.1.4"]]
:deploy-repositories [["snapshots" {:url ""
:username :env/CLOJARS_USERNAME
:password :env/CLOJARS_PASSWORD
:sign-releases false}]
["releases" {:url ""
:username :env/CLOJARS_USERNAME
:password :env/CLOJARS_PASSWORD
:sign-releases false}]]
:profiles
{:dev [:project/dev :profiles/dev]
:repl {:repl-options {:host "0.0.0.0"
:port 4001}}
:profiles/dev {}
:project/dev {:dependencies [[digest "1.4.8"]
[http-kit "2.5.3"]]
:plugins [[jonase/eastwood "1.2.3"]
[lein-cljfmt "0.8.0"]]
:eastwood {:linters [:all]
:ignored-faults {:unused-namespaces {dev.gethop.object-storage.s3-test true}
:keyword-typos {dev.gethop.object-storage.s3 true}}
:debug [:progress :time]}}})
| null | https://raw.githubusercontent.com/gethop-dev/object-storage.s3/9576a790291f94a699bfc2f5b02edb619b45520e/project.clj | clojure | (defproject dev.gethop/object-storage.s3 "0.6.11-SNAPSHOT"
:description "A Duct library for managing AWS S3 objects"
:url "-dev/object-storage.s3"
:license {:name "Mozilla Public Licence 2.0"
:url "-US/MPL/2.0/"}
:min-lein-version "2.9.8"
:dependencies [[org.clojure/clojure "1.10.0"]
[amazonica "0.3.143" :exclusions [com.amazonaws/aws-java-sdk
com.amazonaws/amazon-kinesis-client
com.amazonaws/dynamodb-streams-kinesis-adapter]]
[com.amazonaws/aws-java-sdk-core "1.11.586"]
[com.amazonaws/aws-java-sdk-s3 "1.11.586"]
[integrant "0.7.0"]
[dev.gethop/object-storage.core "0.1.4"]]
:deploy-repositories [["snapshots" {:url ""
:username :env/CLOJARS_USERNAME
:password :env/CLOJARS_PASSWORD
:sign-releases false}]
["releases" {:url ""
:username :env/CLOJARS_USERNAME
:password :env/CLOJARS_PASSWORD
:sign-releases false}]]
:profiles
{:dev [:project/dev :profiles/dev]
:repl {:repl-options {:host "0.0.0.0"
:port 4001}}
:profiles/dev {}
:project/dev {:dependencies [[digest "1.4.8"]
[http-kit "2.5.3"]]
:plugins [[jonase/eastwood "1.2.3"]
[lein-cljfmt "0.8.0"]]
:eastwood {:linters [:all]
:ignored-faults {:unused-namespaces {dev.gethop.object-storage.s3-test true}
:keyword-typos {dev.gethop.object-storage.s3 true}}
:debug [:progress :time]}}})
| |
38b37b636c1559851df7d788283b04794465c3713525916581d01aead39be0e4 | spurious/sagittarius-scheme-mirror | base.sps | #!r6rs
(import (tests r6rs base)
(tests r6rs test)
(rnrs io simple))
(display "Running tests for (rnrs base)\n")
(run-base-tests)
(report-test-results)
| null | https://raw.githubusercontent.com/spurious/sagittarius-scheme-mirror/53f104188934109227c01b1e9a9af5312f9ce997/test/r6rs-test-suite/tests/r6rs/run/base.sps | scheme | #!r6rs
(import (tests r6rs base)
(tests r6rs test)
(rnrs io simple))
(display "Running tests for (rnrs base)\n")
(run-base-tests)
(report-test-results)
| |
7046d40ceb69fa9cba06d2819738b968cdeaee7cda07c6737022a68922ee2d3d | manuel-serrano/bigloo | prof_emit.scm | ;*=====================================================================*/
* serrano / prgm / project / bigloo / comptime / Prof / prof_emit.scm * /
;* ------------------------------------------------------------- */
* Author : * /
* Creation : We d Apr 8 17:32:59 1998 * /
* Last change : Thu Nov 3 14:28:38 2011 ( serrano ) * /
* Copyright : 1998 - 2011 , see LICENSE file * /
;* ------------------------------------------------------------- */
;* The emission of the Bdb identifier translation table. */
;*=====================================================================*/
;*---------------------------------------------------------------------*/
;* The module */
;*---------------------------------------------------------------------*/
(module prof_emit
(include "Ast/node.sch"
"Ast/unit.sch"
"Tools/location.sch")
(import tools_shape
tools_error
tools_misc
type_env
type_cache
object_class
object_slots
ast_sexp
ast_env
ast_ident
ast_unit
module_module
module_include
engine_param
backend_c_prototype
backend_cplib)
(export (emit-prof-info globals ::output-port)))
;*---------------------------------------------------------------------*/
;* emit-prof-info ... */
;*---------------------------------------------------------------------*/
(define (emit-prof-info globals port)
(define (emit-global! global)
(let ((sfun (global-value global)))
(set-variable-name! global)
(let ((id (global-id global))
(c-name (global-name global))
(is-alloc (and (sfun? sfun) (memq 'allocator (sfun-property sfun))))
(loc (and (sfun? sfun) (sfun-loc sfun))))
(if (location? loc)
(fprint port
" fputs( \"((\\\""
id "\\\" "
"\\\"" (location-fname loc) "\\\" "
(location-pos loc)
") \\\""
c-name
"\\\""
(if is-alloc " allocator" "")
")\\n\", (FILE *)bprof_port );")
(fprint port
" fputs( \"(\\\""
id "\\\" \\\""
c-name
"\\\""
(if is-alloc " allocator" "")
")\\n\", (FILE *)bprof_port );")))))
;; the declaration of the association table
(newline port)
(newline port)
;; prof demangling table
(fprint port "/* prof association table */")
(fprint port "static obj_t write_bprof_table() {")
(fprint port " extern obj_t bprof_port;")
(fprint port " if( bprof_port == BUNSPEC ) bprof_port = (obj_t)fopen( \""
*prof-table-name* "\", \"w\" );")
(fprint port " if( bprof_port ) {")
;; the library functions dump
(for-each-global! (lambda (g)
(when (and (or (>fx (global-occurrence g) 0)
(eq? (global-module g) 'foreign))
(global-library g)
(global-user? g))
(emit-global! g))))
;; and then the non function global variables.
(for-each (lambda (global)
(when (global-user? global)
(emit-global! global)))
globals)
in addition we write that is CONS and some
;; other builtins
(for-each (lambda (scm-c)
(let ((scm (car scm-c))
(c (cdr scm-c)))
(fprint port
" fputs( \"(\\\""
scm "\\\" \\\""
c
"\\\""
")\\n\", (FILE *)bprof_port );")))
*builtin-allocators*)
(fprint port " }")
(fprint port " return BUNSPEC;")
(fprint port #"}\n"))
| null | https://raw.githubusercontent.com/manuel-serrano/bigloo/eb650ed4429155f795a32465e009706bbf1b8d74/comptime/Prof/prof_emit.scm | scheme | *=====================================================================*/
* ------------------------------------------------------------- */
* ------------------------------------------------------------- */
* The emission of the Bdb identifier translation table. */
*=====================================================================*/
*---------------------------------------------------------------------*/
* The module */
*---------------------------------------------------------------------*/
*---------------------------------------------------------------------*/
* emit-prof-info ... */
*---------------------------------------------------------------------*/
")
")))))
the declaration of the association table
prof demangling table
")
the library functions dump
and then the non function global variables.
other builtins
"))) | * serrano / prgm / project / bigloo / comptime / Prof / prof_emit.scm * /
* Author : * /
* Creation : We d Apr 8 17:32:59 1998 * /
* Last change : Thu Nov 3 14:28:38 2011 ( serrano ) * /
* Copyright : 1998 - 2011 , see LICENSE file * /
(module prof_emit
(include "Ast/node.sch"
"Ast/unit.sch"
"Tools/location.sch")
(import tools_shape
tools_error
tools_misc
type_env
type_cache
object_class
object_slots
ast_sexp
ast_env
ast_ident
ast_unit
module_module
module_include
engine_param
backend_c_prototype
backend_cplib)
(export (emit-prof-info globals ::output-port)))
(define (emit-prof-info globals port)
(define (emit-global! global)
(let ((sfun (global-value global)))
(set-variable-name! global)
(let ((id (global-id global))
(c-name (global-name global))
(is-alloc (and (sfun? sfun) (memq 'allocator (sfun-property sfun))))
(loc (and (sfun? sfun) (sfun-loc sfun))))
(if (location? loc)
(fprint port
" fputs( \"((\\\""
id "\\\" "
"\\\"" (location-fname loc) "\\\" "
(location-pos loc)
") \\\""
c-name
"\\\""
(if is-alloc " allocator" "")
(fprint port
" fputs( \"(\\\""
id "\\\" \\\""
c-name
"\\\""
(if is-alloc " allocator" "")
(newline port)
(newline port)
(fprint port "/* prof association table */")
(fprint port "static obj_t write_bprof_table() {")
(fprint port " extern obj_t bprof_port;")
(fprint port " if( bprof_port == BUNSPEC ) bprof_port = (obj_t)fopen( \""
(fprint port " if( bprof_port ) {")
(for-each-global! (lambda (g)
(when (and (or (>fx (global-occurrence g) 0)
(eq? (global-module g) 'foreign))
(global-library g)
(global-user? g))
(emit-global! g))))
(for-each (lambda (global)
(when (global-user? global)
(emit-global! global)))
globals)
in addition we write that is CONS and some
(for-each (lambda (scm-c)
(let ((scm (car scm-c))
(c (cdr scm-c)))
(fprint port
" fputs( \"(\\\""
scm "\\\" \\\""
c
"\\\""
*builtin-allocators*)
(fprint port " }")
(fprint port " return BUNSPEC;")
(fprint port #"}\n"))
|
a0693dffcbe66f3f3e8bb569007621c0111cfbeaba88ea3e3c02b8317617b62d | ogri-la/strongbox-comrades | main.cljs | (ns strongbox-comrades.main
(:require
[strongbox-comrades.core :as core]
[strongbox-comrades.utils :as utils]
[strongbox-comrades.ui :as ui]))
(enable-console-print!)
(defn start
[]
(core/start)
(ui/start "app"))
(defn on-js-reload
[]
;; unmount root component?
(utils/info "reloading")
(start))
;; bootstrap
;; starts the app once but never again.
hot reloading during development is handled by figwheel calling ` on - js - reload `
(defonce _ (do (on-js-reload) true))
| null | https://raw.githubusercontent.com/ogri-la/strongbox-comrades/bd51a4eb3818bbc6780781ef9e21bd0a449f8d2a/src/strongbox_comrades/main.cljs | clojure | unmount root component?
bootstrap
starts the app once but never again. | (ns strongbox-comrades.main
(:require
[strongbox-comrades.core :as core]
[strongbox-comrades.utils :as utils]
[strongbox-comrades.ui :as ui]))
(enable-console-print!)
(defn start
[]
(core/start)
(ui/start "app"))
(defn on-js-reload
[]
(utils/info "reloading")
(start))
hot reloading during development is handled by figwheel calling ` on - js - reload `
(defonce _ (do (on-js-reload) true))
|
dab9b631dddb1fca82454d255ed8fdc02ff0433dd5b4ee966fde3649ae067fad | Bodigrim/arithmoi | Coprimes.hs | -- |
Module : Math . . Euclidean . Coprimes
Copyright : ( c ) 2017 - 2018
Licence : MIT
Maintainer : < >
--
Container for pairwise coprime numbers .
# LANGUAGE ScopedTypeVariables #
# LANGUAGE TupleSections #
module Math.NumberTheory.Euclidean.Coprimes
( splitIntoCoprimes
, Coprimes
, unCoprimes
, singleton
, insert
) where
import Prelude hiding (gcd, quot, rem)
import Data.Coerce
import Data.Euclidean
import Data.List (tails)
import Data.Maybe
import Data.Semiring (Semiring(..), isZero)
import Data.Traversable
-- | A list of pairwise coprime numbers
-- with their multiplicities.
newtype Coprimes a b = Coprimes {
unCoprimes :: [(a, b)] -- ^ Unwrap.
}
deriving (Eq, Show)
unsafeDivide :: GcdDomain a => a -> a -> a
unsafeDivide x y = case x `divide` y of
Nothing -> error "violated prerequisite of unsafeDivide"
Just z -> z
-- | Check whether an element is a unit of the ring.
isUnit :: (Eq a, GcdDomain a) => a -> Bool
isUnit x = not (isZero x) && isJust (one `divide` x)
doPair :: (Eq a, GcdDomain a, Eq b, Num b) => a -> b -> a -> b -> (a, a, [(a, b)])
doPair x xm y ym
| isUnit g = (x, y, [])
| otherwise = (x', y', concat rests)
where
g = gcd x y
(x', g', xgs) = doPair (x `unsafeDivide` g) xm g (xm + ym)
xgs' = if isUnit g' then xgs else (g', xm + ym) : xgs
(y', rests) = mapAccumL go (y `unsafeDivide` g) xgs'
go w (t, tm) = (w', if isUnit t' || tm == 0 then acc else (t', tm) : acc)
where
(w', t', acc) = doPair w ym t tm
_propDoPair :: (Eq a, Num a, GcdDomain a, Integral b) => a -> b -> a -> b -> Bool
_propDoPair x xm y ym
= isJust (x `divide` x')
&& isJust (y `divide` y')
&& coprime x' y'
&& all (coprime x' . fst) rest
&& all (coprime y' . fst) rest
&& not (any (isUnit . fst) rest)
&& and [ coprime s t | (s, _) : ts <- tails rest, (t, _) <- ts ]
&& abs ((x ^ xm) * (y ^ ym)) == abs ((x' ^ xm) * (y' ^ ym) * product (map (uncurry (^)) rest))
where
(x', y', rest) = doPair x xm y ym
insertInternal
:: forall a b.
(Eq a, GcdDomain a, Eq b, Num b)
=> a
-> b
-> Coprimes a b
-> (Coprimes a b, Coprimes a b)
insertInternal xx xm
| isZero xx && xm == 0 = (, Coprimes [])
| isZero xx = const (Coprimes [(zero, 1)], Coprimes [])
| otherwise = coerce (go ([], []) xx)
where
go :: ([(a, b)], [(a, b)]) -> a -> [(a, b)] -> ([(a, b)], [(a, b)])
go (old, new) x rest
| isUnit x = (rest ++ old, new)
go (old, new) x [] = (old, (x, xm) : new)
go _ _ ((x, _) : _)
| isZero x = ([(zero, 1)], [])
go (old, new) x ((y, ym) : rest)
| isUnit y' = go (old, xys ++ new) x' rest
| otherwise = go ((y', ym) : old, xys ++ new) x' rest
where
(x', y', xys) = doPair x xm y ym
| Wrap a non - zero number with its multiplicity into ' Coprimes ' .
--
> > > singleton 210 1
Coprimes { unCoprimes = [ ( 210,1 ) ] }
singleton :: (Eq a, GcdDomain a, Eq b, Num b) => a -> b -> Coprimes a b
singleton a b
| isZero a && b == 0 = Coprimes []
| isUnit a = Coprimes []
| otherwise = Coprimes [(a, b)]
| Add a non - zero number with its multiplicity to ' Coprimes ' .
--
> > > insert 360 1 ( singleton 210 1 )
Coprimes { unCoprimes = [ ( 7,1),(5,2),(3,3),(2,4 ) ] }
> > > insert 2 4 ( insert 7 1 ( insert 5 2 ( singleton 4 3 ) ) )
Coprimes { unCoprimes = [ ( 7,1),(5,2),(2,10 ) ] }
insert :: (Eq a, GcdDomain a, Eq b, Num b) => a -> b -> Coprimes a b -> Coprimes a b
insert x xm ys = Coprimes $ unCoprimes zs <> unCoprimes ws
where
(zs, ws) = insertInternal x xm ys
instance (Eq a, GcdDomain a, Eq b, Num b) => Semigroup (Coprimes a b) where
(Coprimes xs) <> ys = Coprimes $ unCoprimes zs <> foldMap unCoprimes wss
where
(zs, wss) = mapAccumL (\vs (x, xm) -> insertInternal x xm vs) ys xs
instance (Eq a, GcdDomain a, Eq b, Num b) => Monoid (Coprimes a b) where
mempty = Coprimes []
mappend = (<>)
-- | The input list is assumed to be a factorisation of some number
into a list of powers of ( possibly , composite ) non - zero factors . The output
-- list is a factorisation of the same number such that all factors
-- are coprime. Such transformation is crucial to continue factorisation
-- (lazily, in parallel or concurrent fashion) without
having to merge multiplicities of primes , which occurs more than in one
-- composite factor.
--
> > > splitIntoCoprimes [ ( 140 , 1 ) , ( 165 , 1 ) ]
Coprimes { unCoprimes = [ ( 28,1),(33,1),(5,2 ) ] }
> > > splitIntoCoprimes [ ( 360 , 1 ) , ( 210 , 1 ) ]
Coprimes { unCoprimes = [ ( 7,1),(5,2),(3,3),(2,4 ) ] }
splitIntoCoprimes :: (Eq a, GcdDomain a, Eq b, Num b) => [(a, b)] -> Coprimes a b
splitIntoCoprimes = foldl (\acc (x, xm) -> insert x xm acc) mempty
| null | https://raw.githubusercontent.com/Bodigrim/arithmoi/c72a1017450c2f1f05a959943dec265678b1cbc3/Math/NumberTheory/Euclidean/Coprimes.hs | haskell | |
| A list of pairwise coprime numbers
with their multiplicities.
^ Unwrap.
| Check whether an element is a unit of the ring.
| The input list is assumed to be a factorisation of some number
list is a factorisation of the same number such that all factors
are coprime. Such transformation is crucial to continue factorisation
(lazily, in parallel or concurrent fashion) without
composite factor.
| Module : Math . . Euclidean . Coprimes
Copyright : ( c ) 2017 - 2018
Licence : MIT
Maintainer : < >
Container for pairwise coprime numbers .
# LANGUAGE ScopedTypeVariables #
# LANGUAGE TupleSections #
module Math.NumberTheory.Euclidean.Coprimes
( splitIntoCoprimes
, Coprimes
, unCoprimes
, singleton
, insert
) where
import Prelude hiding (gcd, quot, rem)
import Data.Coerce
import Data.Euclidean
import Data.List (tails)
import Data.Maybe
import Data.Semiring (Semiring(..), isZero)
import Data.Traversable
newtype Coprimes a b = Coprimes {
}
deriving (Eq, Show)
unsafeDivide :: GcdDomain a => a -> a -> a
unsafeDivide x y = case x `divide` y of
Nothing -> error "violated prerequisite of unsafeDivide"
Just z -> z
isUnit :: (Eq a, GcdDomain a) => a -> Bool
isUnit x = not (isZero x) && isJust (one `divide` x)
doPair :: (Eq a, GcdDomain a, Eq b, Num b) => a -> b -> a -> b -> (a, a, [(a, b)])
doPair x xm y ym
| isUnit g = (x, y, [])
| otherwise = (x', y', concat rests)
where
g = gcd x y
(x', g', xgs) = doPair (x `unsafeDivide` g) xm g (xm + ym)
xgs' = if isUnit g' then xgs else (g', xm + ym) : xgs
(y', rests) = mapAccumL go (y `unsafeDivide` g) xgs'
go w (t, tm) = (w', if isUnit t' || tm == 0 then acc else (t', tm) : acc)
where
(w', t', acc) = doPair w ym t tm
_propDoPair :: (Eq a, Num a, GcdDomain a, Integral b) => a -> b -> a -> b -> Bool
_propDoPair x xm y ym
= isJust (x `divide` x')
&& isJust (y `divide` y')
&& coprime x' y'
&& all (coprime x' . fst) rest
&& all (coprime y' . fst) rest
&& not (any (isUnit . fst) rest)
&& and [ coprime s t | (s, _) : ts <- tails rest, (t, _) <- ts ]
&& abs ((x ^ xm) * (y ^ ym)) == abs ((x' ^ xm) * (y' ^ ym) * product (map (uncurry (^)) rest))
where
(x', y', rest) = doPair x xm y ym
insertInternal
:: forall a b.
(Eq a, GcdDomain a, Eq b, Num b)
=> a
-> b
-> Coprimes a b
-> (Coprimes a b, Coprimes a b)
insertInternal xx xm
| isZero xx && xm == 0 = (, Coprimes [])
| isZero xx = const (Coprimes [(zero, 1)], Coprimes [])
| otherwise = coerce (go ([], []) xx)
where
go :: ([(a, b)], [(a, b)]) -> a -> [(a, b)] -> ([(a, b)], [(a, b)])
go (old, new) x rest
| isUnit x = (rest ++ old, new)
go (old, new) x [] = (old, (x, xm) : new)
go _ _ ((x, _) : _)
| isZero x = ([(zero, 1)], [])
go (old, new) x ((y, ym) : rest)
| isUnit y' = go (old, xys ++ new) x' rest
| otherwise = go ((y', ym) : old, xys ++ new) x' rest
where
(x', y', xys) = doPair x xm y ym
| Wrap a non - zero number with its multiplicity into ' Coprimes ' .
> > > singleton 210 1
Coprimes { unCoprimes = [ ( 210,1 ) ] }
singleton :: (Eq a, GcdDomain a, Eq b, Num b) => a -> b -> Coprimes a b
singleton a b
| isZero a && b == 0 = Coprimes []
| isUnit a = Coprimes []
| otherwise = Coprimes [(a, b)]
| Add a non - zero number with its multiplicity to ' Coprimes ' .
> > > insert 360 1 ( singleton 210 1 )
Coprimes { unCoprimes = [ ( 7,1),(5,2),(3,3),(2,4 ) ] }
> > > insert 2 4 ( insert 7 1 ( insert 5 2 ( singleton 4 3 ) ) )
Coprimes { unCoprimes = [ ( 7,1),(5,2),(2,10 ) ] }
insert :: (Eq a, GcdDomain a, Eq b, Num b) => a -> b -> Coprimes a b -> Coprimes a b
insert x xm ys = Coprimes $ unCoprimes zs <> unCoprimes ws
where
(zs, ws) = insertInternal x xm ys
instance (Eq a, GcdDomain a, Eq b, Num b) => Semigroup (Coprimes a b) where
(Coprimes xs) <> ys = Coprimes $ unCoprimes zs <> foldMap unCoprimes wss
where
(zs, wss) = mapAccumL (\vs (x, xm) -> insertInternal x xm vs) ys xs
instance (Eq a, GcdDomain a, Eq b, Num b) => Monoid (Coprimes a b) where
mempty = Coprimes []
mappend = (<>)
into a list of powers of ( possibly , composite ) non - zero factors . The output
having to merge multiplicities of primes , which occurs more than in one
> > > splitIntoCoprimes [ ( 140 , 1 ) , ( 165 , 1 ) ]
Coprimes { unCoprimes = [ ( 28,1),(33,1),(5,2 ) ] }
> > > splitIntoCoprimes [ ( 360 , 1 ) , ( 210 , 1 ) ]
Coprimes { unCoprimes = [ ( 7,1),(5,2),(3,3),(2,4 ) ] }
splitIntoCoprimes :: (Eq a, GcdDomain a, Eq b, Num b) => [(a, b)] -> Coprimes a b
splitIntoCoprimes = foldl (\acc (x, xm) -> insert x xm acc) mempty
|
593ba91596e5d9262322e40e92e56ebbd61600f5f368acd19ea292da495c52ac | CSVdB/pinky | Zip.hs | module Utils.Zip where
import Import
(><) :: [a] -> [b] -> Either String [(a, b)]
(x:xs) >< (y:ys) = fmap ((x, y) :) $ xs >< ys
[] >< [] = Right []
[] >< _ = Left "The lists do not have the same length"
_ >< [] = Left "The lists do not have the same length"
| null | https://raw.githubusercontent.com/CSVdB/pinky/e77a4c0812ceb4b8548c41a7652fb247c2ab39e0/pinky-integration-test/src/Utils/Zip.hs | haskell | module Utils.Zip where
import Import
(><) :: [a] -> [b] -> Either String [(a, b)]
(x:xs) >< (y:ys) = fmap ((x, y) :) $ xs >< ys
[] >< [] = Right []
[] >< _ = Left "The lists do not have the same length"
_ >< [] = Left "The lists do not have the same length"
| |
0b38eaece0b098ff7e73217c462ed0eaa28bbab19f408e4142b9fc9f4a472f76 | lathe/punctaffy-for-racket | main.rkt | #lang parendown/slash racket/base
punctaffy
;
Bindings that every program that uses Punctaffy - based DSLs should
; have at hand. Namely, the notations for the hyperbrackets
; themselves.
Copyright 2021 , 2022 The Lathe Authors
;
Licensed under the Apache License , Version 2.0 ( the " License " ) ;
; you may not use this file except in compliance with the License.
; You may obtain a copy of the License at
;
; -2.0
;
; Unless required by applicable law or agreed to in writing,
software distributed under the License is distributed on an
" AS IS " BASIS , WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND ,
; either express or implied. See the License for the specific
; language governing permissions and limitations under the License.
(require /for-syntax racket/base)
(require /for-syntax /only-in syntax/parse attribute syntax-parse)
(require /for-syntax /only-in lathe-comforts fn)
(require /for-syntax /only-in punctaffy/private/util
datum->syntax-with-everything)
(require /for-syntax /only-in punctaffy/syntax-object/token-of-syntax
list->token-of-syntax syntax->token-of-syntax
token-of-syntax-beginning-with-assert-singular
token-of-syntax-beginning-with-list*
token-of-syntax-beginning-with-splicing-free-var
token-of-syntax-beginning-with-syntax)
(require /for-syntax /only-in punctaffy/taffy-notation
makeshift-taffy-notation-akin-to-^<>d)
(provide
^<d
^>d
^<
^>)
(define-for-syntax (replace-body stx new-body)
(syntax-parse stx / (macro-name . _)
/datum->syntax stx `(,#'macro-name ,@new-body) stx stx))
(define-for-syntax (parse-^<>d direction stx)
(syntax-parse stx / (op degree contents ...)
/hash
'lexical-context (datum->syntax stx '#%lexical-context)
'direction direction
'degree #'degree
'contents (attribute contents)
'token-of-syntax
(token-of-syntax-beginning-with-syntax
(datum->syntax-with-everything stx '())
(token-of-syntax-beginning-with-list*
(list->token-of-syntax /list
(syntax->token-of-syntax #'op)
(token-of-syntax-beginning-with-assert-singular
(token-of-syntax-beginning-with-splicing-free-var
'degree))
(token-of-syntax-beginning-with-splicing-free-var
'contents))
(syntax->token-of-syntax /list)))))
(define-syntax ^<d /makeshift-taffy-notation-akin-to-^<>d /fn stx
(parse-^<>d '< stx))
(define-syntax ^>d /makeshift-taffy-notation-akin-to-^<>d /fn stx
(parse-^<>d '> stx))
(define-for-syntax (parse-^<> direction degree stx)
(syntax-parse stx / (op contents ...)
/hash
'lexical-context (datum->syntax stx '#%lexical-context)
'direction direction
'degree degree
'contents (attribute contents)
'token-of-syntax
(token-of-syntax-beginning-with-syntax
(datum->syntax-with-everything stx '())
(token-of-syntax-beginning-with-list*
(list->token-of-syntax /list
(syntax->token-of-syntax #'op)
(token-of-syntax-beginning-with-splicing-free-var
'contents))
(syntax->token-of-syntax /list)))))
(define-syntax ^< /makeshift-taffy-notation-akin-to-^<>d /fn stx
(parse-^<> '< #'2 stx))
(define-syntax ^> /makeshift-taffy-notation-akin-to-^<>d /fn stx
(parse-^<> '> #'1 stx))
| null | https://raw.githubusercontent.com/lathe/punctaffy-for-racket/9643122784404562e0f5d6186381f5bc1ba4adcf/punctaffy-lib/main.rkt | racket |
have at hand. Namely, the notations for the hyperbrackets
themselves.
you may not use this file except in compliance with the License.
You may obtain a copy of the License at
-2.0
Unless required by applicable law or agreed to in writing,
either express or implied. See the License for the specific
language governing permissions and limitations under the License. | #lang parendown/slash racket/base
punctaffy
Bindings that every program that uses Punctaffy - based DSLs should
Copyright 2021 , 2022 The Lathe Authors
software distributed under the License is distributed on an
" AS IS " BASIS , WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND ,
(require /for-syntax racket/base)
(require /for-syntax /only-in syntax/parse attribute syntax-parse)
(require /for-syntax /only-in lathe-comforts fn)
(require /for-syntax /only-in punctaffy/private/util
datum->syntax-with-everything)
(require /for-syntax /only-in punctaffy/syntax-object/token-of-syntax
list->token-of-syntax syntax->token-of-syntax
token-of-syntax-beginning-with-assert-singular
token-of-syntax-beginning-with-list*
token-of-syntax-beginning-with-splicing-free-var
token-of-syntax-beginning-with-syntax)
(require /for-syntax /only-in punctaffy/taffy-notation
makeshift-taffy-notation-akin-to-^<>d)
(provide
^<d
^>d
^<
^>)
(define-for-syntax (replace-body stx new-body)
(syntax-parse stx / (macro-name . _)
/datum->syntax stx `(,#'macro-name ,@new-body) stx stx))
(define-for-syntax (parse-^<>d direction stx)
(syntax-parse stx / (op degree contents ...)
/hash
'lexical-context (datum->syntax stx '#%lexical-context)
'direction direction
'degree #'degree
'contents (attribute contents)
'token-of-syntax
(token-of-syntax-beginning-with-syntax
(datum->syntax-with-everything stx '())
(token-of-syntax-beginning-with-list*
(list->token-of-syntax /list
(syntax->token-of-syntax #'op)
(token-of-syntax-beginning-with-assert-singular
(token-of-syntax-beginning-with-splicing-free-var
'degree))
(token-of-syntax-beginning-with-splicing-free-var
'contents))
(syntax->token-of-syntax /list)))))
(define-syntax ^<d /makeshift-taffy-notation-akin-to-^<>d /fn stx
(parse-^<>d '< stx))
(define-syntax ^>d /makeshift-taffy-notation-akin-to-^<>d /fn stx
(parse-^<>d '> stx))
(define-for-syntax (parse-^<> direction degree stx)
(syntax-parse stx / (op contents ...)
/hash
'lexical-context (datum->syntax stx '#%lexical-context)
'direction direction
'degree degree
'contents (attribute contents)
'token-of-syntax
(token-of-syntax-beginning-with-syntax
(datum->syntax-with-everything stx '())
(token-of-syntax-beginning-with-list*
(list->token-of-syntax /list
(syntax->token-of-syntax #'op)
(token-of-syntax-beginning-with-splicing-free-var
'contents))
(syntax->token-of-syntax /list)))))
(define-syntax ^< /makeshift-taffy-notation-akin-to-^<>d /fn stx
(parse-^<> '< #'2 stx))
(define-syntax ^> /makeshift-taffy-notation-akin-to-^<>d /fn stx
(parse-^<> '> #'1 stx))
|
344dab025eddef3f4e68319fa012aae549c313ddcd42f068b9694da49724d748 | darrenldl/ocaml-SeqBox | misc_utils.ml | open Stdint
type required_len_and_seek_to = { required_len : int64
; seek_to : int64
}
exception Invalid_range
let pad_bytes ? ( filler : uint8 = Uint8.of_int 0x00 ) ( old_bytes : bytes ) ( new_len : int ) : bytes =
let buf = Bytes.create 1 in
Uint8.to_bytes_big_endian filler buf 0 ;
let buf 0 in
let old_len = Bytes.length old_bytes in
if old_len < new_len then
let new_bytes = Bytes.make new_len filler_char in
Bytes.blit old_bytes 0 new_bytes 0 old_len ;
new_bytes
else
old_bytes
; ;
let buf = Bytes.create 1 in
Uint8.to_bytes_big_endian filler buf 0;
let filler_char = Bytes.get buf 0 in
let old_len = Bytes.length old_bytes in
if old_len < new_len then
let new_bytes = Bytes.make new_len filler_char in
Bytes.blit old_bytes 0 new_bytes 0 old_len;
new_bytes
else
old_bytes
;;*)
let get_sub_string (chunk:string) ~(pos:int) ~(len:int) : string =
let chunk_size = String.length chunk in
if pos < 0 || pos >= chunk_size then
raise Invalid_range
else if len < 0 then
raise Invalid_range
else if pos + (len - 1) >= chunk_size then
raise Invalid_range
else
String.sub chunk pos len
;;
let get_sub_string_inc_range (chunk:string) ~(start_at:int) ~(end_at:int) : string =
get_sub_string chunk ~pos:start_at ~len:(end_at - start_at + 1)
;;
let get_sub_string_exc_range (chunk:string) ~(start_at:int) ~(end_before:int) : string =
get_sub_string chunk ~pos:start_at ~len:(end_before - start_at)
;;
let list_find_option (pred:('a -> bool)) (lst:'a list) : 'a option =
try
Some (List.find pred lst)
with
| Not_found -> None
;;
let make_path (path_parts:string list) : string =
let strip_slash str =
let str_len = String.length str in
match str_len with
| 0 -> str
| 1 ->
begin
if (String.get str 0) = '/' then "" else str
end
| _ ->
begin
let char_last = String.get str (str_len - 1) in
let char_2nd_last = String.get str (str_len - 2) in
if char_last = '/' && char_2nd_last <> '\\' then
get_sub_string str ~pos:0 ~len:(str_len - 1)
else
str
end in
let lst = List.map strip_slash path_parts in
String.concat "/" lst
;;
let char_list_to_string (lst:char list) : string =
String.concat "" (List.map (fun c -> String.make 1 c) lst)
;;
let path_to_list (path:string) : string list =
let open Angstrom in
let sep : unit Angstrom.t =
string "/" *> return () in
let escaped_sep : char list Angstrom.t =
string "\\/" *> return ['\\'; '/'] in
let not_sep : char list Angstrom.t =
not_char '/' >>| (fun c -> [c]) in
let single_parser : string Angstrom.t =
many (choice [ escaped_sep
; not_sep
])
>>| List.concat
>>| char_list_to_string
in
let path_parser : string list Angstrom.t =
sep_by sep single_parser in
match Angstrom.parse_string path_parser path with
| Ok lst -> lst
| Error _ -> assert false
;;
let path_to_file (path:string) : string =
List.hd (List.rev (path_to_list path))
;;
let get_option_ref_init_if_none (eval:(unit -> 'a)) (opt_ref:'a option ref) : 'a =
match !opt_ref with
| Some x -> x
| None ->
let x = eval () in
opt_ref := Some x;
x
;;
let pad_string ?(filler:char = '\x00') (input:string) (len:int) : string =
let input_len = String.length input in
let pad_len = len - input_len in
let padding =
if pad_len > 0 then
String.make pad_len filler
else
"" in
String.concat "" [input; padding]
;;
let round_down_to_multiple_int64 ~(multiple_of:int64) (x:int64) : int64 =
let (</>) = Int64.div in
let (<*>) = Int64.mul in
(x </> multiple_of) <*> multiple_of
;;
let round_down_to_multiple ~(multiple_of:int) (x:int) : int =
(x / multiple_of) * multiple_of
;;
let round_up_to_multiple_int64 ~(multiple_of:int64) (x:int64) : int64 =
let (</>) = Int64.div in
let (<*>) = Int64.mul in
let (<+>) = Int64.add in
((x <+> (Int64.pred multiple_of)) </> multiple_of) <*> multiple_of
;;
let round_up_to_multiple ~(multiple_of:int) (x:int) : int =
((x + (pred multiple_of)) / multiple_of) * multiple_of
;;
let ensure_at_least (type a) ~(at_least:a) (x:a) =
max at_least x
;;
let ensure_at_most (type a) ~(at_most:a) (x:a) =
min at_most x
;;
let calc_required_len_and_seek_to_from_byte_range ~(from_byte:int64 option) ~(to_byte:int64 option) ~(force_misalign:bool) ~(bytes_so_far:int64) ~(last_possible_pos:int64) : required_len_and_seek_to =
let open Int64_ops in
let multiple_of = Int64.of_int Param.Common.block_scan_alignment in
let align : int64 -> int64 =
if force_misalign then
(fun x -> x)
else
round_down_to_multiple_int64 ~multiple_of in
let from_byte =
match from_byte with
| None -> 0L
| Some n -> n
|> ensure_at_least ~at_least:0L
|> ensure_at_most ~at_most:last_possible_pos
|> align in
let to_byte =
match to_byte with
| None -> last_possible_pos
| Some n -> n
|> ensure_at_least ~at_least:from_byte
|> ensure_at_most ~at_most:last_possible_pos in
bytes_so_far only affects
{ required_len = to_byte <-> from_byte <+> 1L
; seek_to = align (from_byte <+> bytes_so_far)
}
;;
| null | https://raw.githubusercontent.com/darrenldl/ocaml-SeqBox/658c623db8745ae1d804c75880b29fb53435860f/src/misc_utils.ml | ocaml | open Stdint
type required_len_and_seek_to = { required_len : int64
; seek_to : int64
}
exception Invalid_range
let pad_bytes ? ( filler : uint8 = Uint8.of_int 0x00 ) ( old_bytes : bytes ) ( new_len : int ) : bytes =
let buf = Bytes.create 1 in
Uint8.to_bytes_big_endian filler buf 0 ;
let buf 0 in
let old_len = Bytes.length old_bytes in
if old_len < new_len then
let new_bytes = Bytes.make new_len filler_char in
Bytes.blit old_bytes 0 new_bytes 0 old_len ;
new_bytes
else
old_bytes
; ;
let buf = Bytes.create 1 in
Uint8.to_bytes_big_endian filler buf 0;
let filler_char = Bytes.get buf 0 in
let old_len = Bytes.length old_bytes in
if old_len < new_len then
let new_bytes = Bytes.make new_len filler_char in
Bytes.blit old_bytes 0 new_bytes 0 old_len;
new_bytes
else
old_bytes
;;*)
let get_sub_string (chunk:string) ~(pos:int) ~(len:int) : string =
let chunk_size = String.length chunk in
if pos < 0 || pos >= chunk_size then
raise Invalid_range
else if len < 0 then
raise Invalid_range
else if pos + (len - 1) >= chunk_size then
raise Invalid_range
else
String.sub chunk pos len
;;
let get_sub_string_inc_range (chunk:string) ~(start_at:int) ~(end_at:int) : string =
get_sub_string chunk ~pos:start_at ~len:(end_at - start_at + 1)
;;
let get_sub_string_exc_range (chunk:string) ~(start_at:int) ~(end_before:int) : string =
get_sub_string chunk ~pos:start_at ~len:(end_before - start_at)
;;
let list_find_option (pred:('a -> bool)) (lst:'a list) : 'a option =
try
Some (List.find pred lst)
with
| Not_found -> None
;;
let make_path (path_parts:string list) : string =
let strip_slash str =
let str_len = String.length str in
match str_len with
| 0 -> str
| 1 ->
begin
if (String.get str 0) = '/' then "" else str
end
| _ ->
begin
let char_last = String.get str (str_len - 1) in
let char_2nd_last = String.get str (str_len - 2) in
if char_last = '/' && char_2nd_last <> '\\' then
get_sub_string str ~pos:0 ~len:(str_len - 1)
else
str
end in
let lst = List.map strip_slash path_parts in
String.concat "/" lst
;;
let char_list_to_string (lst:char list) : string =
String.concat "" (List.map (fun c -> String.make 1 c) lst)
;;
let path_to_list (path:string) : string list =
let open Angstrom in
let sep : unit Angstrom.t =
string "/" *> return () in
let escaped_sep : char list Angstrom.t =
string "\\/" *> return ['\\'; '/'] in
let not_sep : char list Angstrom.t =
not_char '/' >>| (fun c -> [c]) in
let single_parser : string Angstrom.t =
many (choice [ escaped_sep
; not_sep
])
>>| List.concat
>>| char_list_to_string
in
let path_parser : string list Angstrom.t =
sep_by sep single_parser in
match Angstrom.parse_string path_parser path with
| Ok lst -> lst
| Error _ -> assert false
;;
let path_to_file (path:string) : string =
List.hd (List.rev (path_to_list path))
;;
let get_option_ref_init_if_none (eval:(unit -> 'a)) (opt_ref:'a option ref) : 'a =
match !opt_ref with
| Some x -> x
| None ->
let x = eval () in
opt_ref := Some x;
x
;;
let pad_string ?(filler:char = '\x00') (input:string) (len:int) : string =
let input_len = String.length input in
let pad_len = len - input_len in
let padding =
if pad_len > 0 then
String.make pad_len filler
else
"" in
String.concat "" [input; padding]
;;
let round_down_to_multiple_int64 ~(multiple_of:int64) (x:int64) : int64 =
let (</>) = Int64.div in
let (<*>) = Int64.mul in
(x </> multiple_of) <*> multiple_of
;;
let round_down_to_multiple ~(multiple_of:int) (x:int) : int =
(x / multiple_of) * multiple_of
;;
let round_up_to_multiple_int64 ~(multiple_of:int64) (x:int64) : int64 =
let (</>) = Int64.div in
let (<*>) = Int64.mul in
let (<+>) = Int64.add in
((x <+> (Int64.pred multiple_of)) </> multiple_of) <*> multiple_of
;;
let round_up_to_multiple ~(multiple_of:int) (x:int) : int =
((x + (pred multiple_of)) / multiple_of) * multiple_of
;;
let ensure_at_least (type a) ~(at_least:a) (x:a) =
max at_least x
;;
let ensure_at_most (type a) ~(at_most:a) (x:a) =
min at_most x
;;
let calc_required_len_and_seek_to_from_byte_range ~(from_byte:int64 option) ~(to_byte:int64 option) ~(force_misalign:bool) ~(bytes_so_far:int64) ~(last_possible_pos:int64) : required_len_and_seek_to =
let open Int64_ops in
let multiple_of = Int64.of_int Param.Common.block_scan_alignment in
let align : int64 -> int64 =
if force_misalign then
(fun x -> x)
else
round_down_to_multiple_int64 ~multiple_of in
let from_byte =
match from_byte with
| None -> 0L
| Some n -> n
|> ensure_at_least ~at_least:0L
|> ensure_at_most ~at_most:last_possible_pos
|> align in
let to_byte =
match to_byte with
| None -> last_possible_pos
| Some n -> n
|> ensure_at_least ~at_least:from_byte
|> ensure_at_most ~at_most:last_possible_pos in
bytes_so_far only affects
{ required_len = to_byte <-> from_byte <+> 1L
; seek_to = align (from_byte <+> bytes_so_far)
}
;;
| |
7e866ab34daf062f9a58bf33ef1040c20f9bb763a2ce0f4d664122a4ad77c48d | markostanimirovic/re-action | core_test.clj | (ns re-action.core-test
(:require [clojure.test :refer :all]
[re-action.core :refer :all]))
(deftest a-test
(testing "FIXME, I fail."
(is (= 0 1))))
| null | https://raw.githubusercontent.com/markostanimirovic/re-action/d6cb33d9ac73bedeac4f09996c2c741d21bda7ba/test/re_action/core_test.clj | clojure | (ns re-action.core-test
(:require [clojure.test :refer :all]
[re-action.core :refer :all]))
(deftest a-test
(testing "FIXME, I fail."
(is (= 0 1))))
| |
2ba58305c8efa19a828bf54f7177ab38d9c7fea67dcee280fa050840dd5fc619 | datacrypt-project/hitchhiker-tree | bench.clj | (ns hitchhiker.bench
(:require [clojure.pprint :as pp]
[clojure.string :as str]
[clojure.tools.cli :refer [parse-opts]]
[excel-templates.build :as excel]
[hitchhiker.redis :as redis]
[hitchhiker.tree.core :refer [<?? <? go-try] :as core]
[hitchhiker.tree.messaging :as msg])
(:import [java.io File FileWriter]))
(defn generate-test-datasets
"Returns a list of datasets"
[]
[{:name "in-order" :data (range)}
{:name "random" :data (repeatedly rand)}])
(defn core-b-tree
"Returns a b-tree with core insert"
[b backend]
{:structure (<?? (core/b-tree (core/->Config b b 0)))
:insert core/insert
:delete core/delete
:flush (fn [x] (<?? (core/flush-tree x backend)))})
(defn msg-b-tree
"Returns a b-tree with msg insert"
[b backend]
(let [sqrt-b (long (Math/sqrt b))]
{:structure (<?? (core/b-tree(core/->Config sqrt-b b (- b sqrt-b))))
:insert msg/insert
:delete msg/delete
:flush (fn [x] (<?? (core/flush-tree x backend)))}))
(defn sorted-set-repr
"Returns a sorted set"
[]
{:structure (sorted-map)
:insert (fn [m k v] (go-try (assoc m k v)))
:delete (fn [m k] (go-try (dissoc m k)))
:flush (fn [set]
{:tree set
:stats (atom {})})})
(defn create-output-dir
[dir aux]
(let [my-dir (File. dir aux)]
(when (.exists my-dir)
(throw (ex-info (str "Output dir already exists: " dir) {})))
(.mkdirs my-dir)
(spit (File. my-dir "time") (str (java.util.Date.)))
(let [speed-csv (FileWriter. (File. my-dir (str "speed_" aux ".csv")))
flush - csv ( FileWriter . ( File . my - dir ( str " flush_iops _ " aux " .csv " ) ) )
]
{:speed speed-csv
;:flush flush-csv
})))
(defn benchmark
"n is the total number of samples
dataset is the test dataset
flush-freq is the number of keys per flush
datastruct is the test data structure
out is the stream to write the results to (as well as stdout)"
[n dataset flush-freq datastruct out delete-xform]
(let [{:keys [structure delete insert flush]} datastruct
dataset (take n (:data dataset))]
(<?? (go-try
(loop [[x & data] dataset
t 0
tree structure
last-flush nil
i 0
inserting? true
outputs []]
(let [i' (inc i)
{flushed-tree :tree
stats :stats} (when (zero? (mod i' flush-freq))
(flush tree))
before (System/nanoTime)
tree' (if inserting?
(<? (insert (or flushed-tree tree) x x))
(<? (delete (or flushed-tree tree) x)))
after (System/nanoTime)
log-inserts (zero? (mod i' (quot n 100)))
updated-outputs (atom outputs)]
1000 pieces
(binding [*out* (:speed out)]
(let [ks (sort (keys last-flush))
avg-ns (float (/ t (quot n 100)))]
(when (zero? i)
(println (str "elements,op,insert_took_avg_ns,"
(str/join "," ks))))
(println (str i' "," (if inserting? "insert" "delete") "," avg-ns
"," (str/join "," (map #(get last-flush %) ks))))
(swap! updated-outputs conj (-> (into {} last-flush)
(assoc :ins-avg-ns avg-ns
(if inserting?
:insert
:delete) true
:n i'))))))
(cond
(seq data)
(recur data
(if log-inserts
0
(+ t (- after before)))
tree'
(if stats (merge-with + last-flush @stats) last-flush)
i'
inserting?
@updated-outputs)
inserting?
(recur (delete-xform dataset)
0
tree'
nil
i'
false
@updated-outputs)
:else
@updated-outputs)))))))
(def options
[["-n" "--num-operations NUM_OPS" "The number of elements that will be applied to the data structure"
:default 100000
:parse-fn #(Long. %)
:validate [pos? "n must be positive"]]
[nil "--data-structure STRUCT" "Which data structure to run the test on"
:default "fractal"
:validate [#(#{"fractal" "b-tree" "sorted-set"} %) "Data structure must be fractal, b-tree, or sorted set"]]
[nil "--backend testing" "Runs the benchmark with the specified backend"
:default "testing"
:validate [#(#{"redis" "testing"} %) "Backend must be redis or testing"]]
["-d" "--delete-pattern PATTERN" "Specifies how the operations will be reordered on delete"
:default "forward"
:validate [#(#{"forward" "reverse" "shuffle" "zero"} %) "Incorrect delete pattern"]
]
[nil "--sorted-set" "Runs the benchmarks on a sorted set"]
["-b" "--tree-width WIDTH" "Determines the width of the trees. Fractal trees use sqrt(b) child pointers; the rest is for messages."
:default 300
:parse-fn #(Long. %)
:validate [pos? "b must be positive"]]
["-f" "--flush-freq FREQ" "After how many operations should the tree get flushed?"
:default 1000
:parse-fn #(Long. %)
:validate [pos? "flush frequency must be positive"]]
["-h" "--help" "Prints this help"]])
(defn exit
[status msg]
(println msg)
(System/exit status))
(defn error-msg
[errors]
(str "The following errors occurred while parsing your command:\n\n"
(str/join \newline errors)))
(defn usage
[options-summary]
(str/join \newline
["Usage: bench output-dir [options] [-- [other-options]]*"
""
"Options:"
options-summary
""
"Delete patterns:"
"forward: we delete the elements in the order they were inserted"
"reverse: we delete the elements in the reverse order they were inserted"
"shuffle: we delete the elements in a random order"
"zero: we repeatedly attempt to delete 0, thus never actually deleting"
""
"Backends:"
"testing: this backend serializes nothing, just using an extra indirection"
"redis: this backend uses a local redis server"]))
(defn make-template-for-one-tree-freq-combo
[list-of-benchmark-results filter-by]
;(clojure.pprint/pprint list-of-benchmark-results)
(assert (= 2 (count list-of-benchmark-results)) "Should be random and ordered")
(let [indexed (group-by :ds list-of-benchmark-results)]
(map #(vector (:n %1) (:ins-avg-ns %1) (:writes %1) (:ins-avg-ns %2) (:writes %2))
(filter filter-by (:results (first (get indexed "in-order"))))
(filter filter-by (:results (first (get indexed "random")))))))
(defn template-one-sheet
[pair-of-results-for-one-ds-config]
(let [{:keys [tree ds freq n b results delete-pattern]}
(first pair-of-results-for-one-ds-config)
x {0 [["Data Structure" (name tree) "" "n" n "" "Data Set" ds]]
1 [["Flush Frequency" freq "" "b" b "" "delete pattern" delete-pattern]]
[5 18] (make-template-for-one-tree-freq-combo pair-of-results-for-one-ds-config :insert)
[22 35] (make-template-for-one-tree-freq-combo pair-of-results-for-one-ds-config :delete)}]
x))
(defn -main
[& [root & args]]
(let [outputs (atom [])]
(doseq [args (or (->> args
(partition-by #(= % "--"))
(map-indexed vector)
(filter (comp even? first))
(map second)
(seq))
always do one iteration
(let [{:keys [options arguments errors summary]} (parse-opts args options)
tree-to-test (atom {})
results (atom [])]
(cond
(or (= "-h" root)
(= "--help" root)
(nil? root)
(:help options)) (exit 0 (usage summary))
(not= (count arguments) 0) (exit 1 (usage summary))
errors (exit 1 (error-msg errors)))
(let [backend (case (:backend options)
"testing" (core/->TestingBackend)
"redis" (do (redis/start-expiry-thread!)
(redis/->RedisBackend)))
delete-xform (case (:delete-pattern options)
"forward" identity
"reverse" reverse
"shuffle" shuffle
"zero" #(repeat (count %) 0.0))
[tree-name structure]
(case (:data-structure options)
"b-tree" ["b-tree" (core-b-tree (:tree-width options) backend)]
"fractal" ["fractal" (msg-b-tree (:tree-width options) backend)]
"sorted-set" ["sorted-set" (sorted-set-repr)])
flush-freq (:flush-freq options)
codename (str tree-name
"__flush_"
flush-freq
"__b_"
(:tree-width options)
"__"
(:backend options)
"__n_"
(:num-operations options)
"__del_"
(:delete-pattern options))]
(doseq [ds (generate-test-datasets)
:let [codename (str codename
"_"
(:name ds))
out (create-output-dir
root
codename)
_ (println "Doing" codename)
bench-res (benchmark (:num-operations options) ds flush-freq structure out delete-xform)]]
(swap! results conj
{:tree tree-name
:ds (:name ds)
:freq flush-freq
:n (:num-operations options)
:b (:tree-width options)
:delete-pattern (:delete-pattern options)
:results bench-res}))
;(println "results")
( clojure.pprint/pprint )
(swap! outputs conj (template-one-sheet @results)))))
(excel/render-to-file
"template_benchmark.xlsx"
(.getPath (File. root "analysis.xlsx"))
{"SingleDS"
(map-indexed (fn [i s]
(assoc s :sheet-name (str "Trial " (inc i))))
@outputs)})))
| null | https://raw.githubusercontent.com/datacrypt-project/hitchhiker-tree/f7d0f926541d7cb31fac11c2d2245c5bac451b86/env/profiling/hitchhiker/bench.clj | clojure | :flush flush-csv
(clojure.pprint/pprint list-of-benchmark-results)
(println "results") | (ns hitchhiker.bench
(:require [clojure.pprint :as pp]
[clojure.string :as str]
[clojure.tools.cli :refer [parse-opts]]
[excel-templates.build :as excel]
[hitchhiker.redis :as redis]
[hitchhiker.tree.core :refer [<?? <? go-try] :as core]
[hitchhiker.tree.messaging :as msg])
(:import [java.io File FileWriter]))
(defn generate-test-datasets
"Returns a list of datasets"
[]
[{:name "in-order" :data (range)}
{:name "random" :data (repeatedly rand)}])
(defn core-b-tree
"Returns a b-tree with core insert"
[b backend]
{:structure (<?? (core/b-tree (core/->Config b b 0)))
:insert core/insert
:delete core/delete
:flush (fn [x] (<?? (core/flush-tree x backend)))})
(defn msg-b-tree
"Returns a b-tree with msg insert"
[b backend]
(let [sqrt-b (long (Math/sqrt b))]
{:structure (<?? (core/b-tree(core/->Config sqrt-b b (- b sqrt-b))))
:insert msg/insert
:delete msg/delete
:flush (fn [x] (<?? (core/flush-tree x backend)))}))
(defn sorted-set-repr
"Returns a sorted set"
[]
{:structure (sorted-map)
:insert (fn [m k v] (go-try (assoc m k v)))
:delete (fn [m k] (go-try (dissoc m k)))
:flush (fn [set]
{:tree set
:stats (atom {})})})
(defn create-output-dir
[dir aux]
(let [my-dir (File. dir aux)]
(when (.exists my-dir)
(throw (ex-info (str "Output dir already exists: " dir) {})))
(.mkdirs my-dir)
(spit (File. my-dir "time") (str (java.util.Date.)))
(let [speed-csv (FileWriter. (File. my-dir (str "speed_" aux ".csv")))
flush - csv ( FileWriter . ( File . my - dir ( str " flush_iops _ " aux " .csv " ) ) )
]
{:speed speed-csv
})))
(defn benchmark
"n is the total number of samples
dataset is the test dataset
flush-freq is the number of keys per flush
datastruct is the test data structure
out is the stream to write the results to (as well as stdout)"
[n dataset flush-freq datastruct out delete-xform]
(let [{:keys [structure delete insert flush]} datastruct
dataset (take n (:data dataset))]
(<?? (go-try
(loop [[x & data] dataset
t 0
tree structure
last-flush nil
i 0
inserting? true
outputs []]
(let [i' (inc i)
{flushed-tree :tree
stats :stats} (when (zero? (mod i' flush-freq))
(flush tree))
before (System/nanoTime)
tree' (if inserting?
(<? (insert (or flushed-tree tree) x x))
(<? (delete (or flushed-tree tree) x)))
after (System/nanoTime)
log-inserts (zero? (mod i' (quot n 100)))
updated-outputs (atom outputs)]
1000 pieces
(binding [*out* (:speed out)]
(let [ks (sort (keys last-flush))
avg-ns (float (/ t (quot n 100)))]
(when (zero? i)
(println (str "elements,op,insert_took_avg_ns,"
(str/join "," ks))))
(println (str i' "," (if inserting? "insert" "delete") "," avg-ns
"," (str/join "," (map #(get last-flush %) ks))))
(swap! updated-outputs conj (-> (into {} last-flush)
(assoc :ins-avg-ns avg-ns
(if inserting?
:insert
:delete) true
:n i'))))))
(cond
(seq data)
(recur data
(if log-inserts
0
(+ t (- after before)))
tree'
(if stats (merge-with + last-flush @stats) last-flush)
i'
inserting?
@updated-outputs)
inserting?
(recur (delete-xform dataset)
0
tree'
nil
i'
false
@updated-outputs)
:else
@updated-outputs)))))))
(def options
[["-n" "--num-operations NUM_OPS" "The number of elements that will be applied to the data structure"
:default 100000
:parse-fn #(Long. %)
:validate [pos? "n must be positive"]]
[nil "--data-structure STRUCT" "Which data structure to run the test on"
:default "fractal"
:validate [#(#{"fractal" "b-tree" "sorted-set"} %) "Data structure must be fractal, b-tree, or sorted set"]]
[nil "--backend testing" "Runs the benchmark with the specified backend"
:default "testing"
:validate [#(#{"redis" "testing"} %) "Backend must be redis or testing"]]
["-d" "--delete-pattern PATTERN" "Specifies how the operations will be reordered on delete"
:default "forward"
:validate [#(#{"forward" "reverse" "shuffle" "zero"} %) "Incorrect delete pattern"]
]
[nil "--sorted-set" "Runs the benchmarks on a sorted set"]
["-b" "--tree-width WIDTH" "Determines the width of the trees. Fractal trees use sqrt(b) child pointers; the rest is for messages."
:default 300
:parse-fn #(Long. %)
:validate [pos? "b must be positive"]]
["-f" "--flush-freq FREQ" "After how many operations should the tree get flushed?"
:default 1000
:parse-fn #(Long. %)
:validate [pos? "flush frequency must be positive"]]
["-h" "--help" "Prints this help"]])
(defn exit
[status msg]
(println msg)
(System/exit status))
(defn error-msg
[errors]
(str "The following errors occurred while parsing your command:\n\n"
(str/join \newline errors)))
(defn usage
[options-summary]
(str/join \newline
["Usage: bench output-dir [options] [-- [other-options]]*"
""
"Options:"
options-summary
""
"Delete patterns:"
"forward: we delete the elements in the order they were inserted"
"reverse: we delete the elements in the reverse order they were inserted"
"shuffle: we delete the elements in a random order"
"zero: we repeatedly attempt to delete 0, thus never actually deleting"
""
"Backends:"
"testing: this backend serializes nothing, just using an extra indirection"
"redis: this backend uses a local redis server"]))
(defn make-template-for-one-tree-freq-combo
[list-of-benchmark-results filter-by]
(assert (= 2 (count list-of-benchmark-results)) "Should be random and ordered")
(let [indexed (group-by :ds list-of-benchmark-results)]
(map #(vector (:n %1) (:ins-avg-ns %1) (:writes %1) (:ins-avg-ns %2) (:writes %2))
(filter filter-by (:results (first (get indexed "in-order"))))
(filter filter-by (:results (first (get indexed "random")))))))
(defn template-one-sheet
[pair-of-results-for-one-ds-config]
(let [{:keys [tree ds freq n b results delete-pattern]}
(first pair-of-results-for-one-ds-config)
x {0 [["Data Structure" (name tree) "" "n" n "" "Data Set" ds]]
1 [["Flush Frequency" freq "" "b" b "" "delete pattern" delete-pattern]]
[5 18] (make-template-for-one-tree-freq-combo pair-of-results-for-one-ds-config :insert)
[22 35] (make-template-for-one-tree-freq-combo pair-of-results-for-one-ds-config :delete)}]
x))
(defn -main
[& [root & args]]
(let [outputs (atom [])]
(doseq [args (or (->> args
(partition-by #(= % "--"))
(map-indexed vector)
(filter (comp even? first))
(map second)
(seq))
always do one iteration
(let [{:keys [options arguments errors summary]} (parse-opts args options)
tree-to-test (atom {})
results (atom [])]
(cond
(or (= "-h" root)
(= "--help" root)
(nil? root)
(:help options)) (exit 0 (usage summary))
(not= (count arguments) 0) (exit 1 (usage summary))
errors (exit 1 (error-msg errors)))
(let [backend (case (:backend options)
"testing" (core/->TestingBackend)
"redis" (do (redis/start-expiry-thread!)
(redis/->RedisBackend)))
delete-xform (case (:delete-pattern options)
"forward" identity
"reverse" reverse
"shuffle" shuffle
"zero" #(repeat (count %) 0.0))
[tree-name structure]
(case (:data-structure options)
"b-tree" ["b-tree" (core-b-tree (:tree-width options) backend)]
"fractal" ["fractal" (msg-b-tree (:tree-width options) backend)]
"sorted-set" ["sorted-set" (sorted-set-repr)])
flush-freq (:flush-freq options)
codename (str tree-name
"__flush_"
flush-freq
"__b_"
(:tree-width options)
"__"
(:backend options)
"__n_"
(:num-operations options)
"__del_"
(:delete-pattern options))]
(doseq [ds (generate-test-datasets)
:let [codename (str codename
"_"
(:name ds))
out (create-output-dir
root
codename)
_ (println "Doing" codename)
bench-res (benchmark (:num-operations options) ds flush-freq structure out delete-xform)]]
(swap! results conj
{:tree tree-name
:ds (:name ds)
:freq flush-freq
:n (:num-operations options)
:b (:tree-width options)
:delete-pattern (:delete-pattern options)
:results bench-res}))
( clojure.pprint/pprint )
(swap! outputs conj (template-one-sheet @results)))))
(excel/render-to-file
"template_benchmark.xlsx"
(.getPath (File. root "analysis.xlsx"))
{"SingleDS"
(map-indexed (fn [i s]
(assoc s :sheet-name (str "Trial " (inc i))))
@outputs)})))
|
192e418ee48d617b6e655c9fbbc83082190f01d8e73dfcbeb74701de15e70021 | Suikaba/SelingerQuantumLambdaCalculus | intuitionistic_typed.ml | open Core
open Syntax
open Unify
exception ITypeError
type ityped_term =
IConst of constant * itype
| IVar of id * itype
| ITuple0 of itype
| IAbst of id * ityped_term * itype
| IApp of ityped_term * ityped_term * itype
| IPair of ityped_term * ityped_term * itype
| ILet of id * id * ityped_term * ityped_term * itype
| IInjL of ityped_term * itype
| IInjR of ityped_term * itype
| IMatch of ityped_term * (id * ityped_term) * (id * ityped_term) * itype
| ILetRec of id * ityped_term * ityped_term * itype
let fresh_tyvar =
let counter = ref 0 in
let body () = counter := !counter + 1; !counter in
body
let rec string_of_iterm = function
| IConst (c, ty) -> Printf.sprintf "(%s : %s)" (string_of_const c) (string_of_itype ty)
| IVar (id, ty) -> Printf.sprintf "(%s : %s)" id (string_of_itype ty)
| ITuple0 ty -> Printf.sprintf "(* : %s)" (string_of_itype ty)
| IAbst (id, t, ty) -> Printf.sprintf "((lam %s . %s) : %s)" id (string_of_iterm t) (string_of_itype ty)
| IApp (t1, t2, ty) -> Printf.sprintf "(%s %s : %s)" (string_of_iterm t1) (string_of_iterm t2) (string_of_itype ty)
| IPair (t1, t2, ty) -> Printf.sprintf "(<%s, %s> : %s)" (string_of_iterm t1) (string_of_iterm t2) (string_of_itype ty)
| ILet (x, y, t1, t2, ty) ->
Printf.sprintf "(let <%s, %s> = %s in %s) : %s" x y (string_of_iterm t1) (string_of_iterm t2) (string_of_itype ty)
| IInjL (t, ty) ->
(match t with
| ITuple0 _ -> Printf.sprintf "(1 : %s)" (string_of_itype ty)
| t -> Printf.sprintf "(injl(%s) : %s)" (string_of_iterm t) (string_of_itype ty))
| IInjR (t, ty) ->
(match t with
| ITuple0 _ -> Printf.sprintf "(0 : %s)" (string_of_itype ty)
| t -> Printf.sprintf "(injr(%s) : %s)" (string_of_iterm t) (string_of_itype ty))
| IMatch (t1, (x, t2), (y, t3), ty) ->
Printf.sprintf "(match %s with %s -> %s | %s -> %s) : %s"
(string_of_iterm t1) x (string_of_iterm t2) y (string_of_iterm t3) (string_of_itype ty)
| ILetRec (f, t1, t2, ty) ->
Printf.sprintf "(let rec %s = %s in %s) : %s"
f (string_of_iterm t1) (string_of_iterm t2) (string_of_itype ty)
(* type inference *)
let ity_const = function
| New -> ITyFun (itybit, ITyQbit)
| Meas -> ITyFun (ITyQbit, itybit)
| H -> ITyFun (ITyQbit, ITyQbit) (* todo *)
| _ -> failwith "Not implemented"
let rec ity_infer tyenv = function
| Const c -> empty_subst, ity_const c, IConst (c, ity_const c)
| Var id -> empty_subst, Environment.lookup tyenv id, IVar (id, Environment.lookup tyenv id)
| Tuple0 -> empty_subst, ITySingleton, ITuple0 ITySingleton
| Abst (id, body) ->
let tyarg = ITyVar (fresh_tyvar ()) in
let tyenv = Environment.extend tyenv id tyarg in
let s, tybody, ibody = ity_infer tyenv body in
let ty = ITyFun (subst_type s tyarg, tybody) in
s, ty, IAbst (id, ibody, ty)
| App (t1, t2) ->
let s1, tyf, it1 = ity_infer tyenv t1 in
let s2, tyarg, it2 = ity_infer tyenv t2 in
let tybody = ITyVar (fresh_tyvar ()) in
let s = unify (merge_subst s1 s2) [tyf, ITyFun (tyarg, tybody)] in
let ty = subst_type s tybody in
s, ty, IApp (it1, it2, ty)
| Pair (t1, t2) ->
let s1, ty1, it1 = ity_infer tyenv t1 in
let s2, ty2, it2 = ity_infer tyenv t2 in
merge_subst s1 s2, ITyProd (ty1, ty2), IPair (it1, it2, ITyProd (ty1, ty2))
| Let (x, y, t1, t2) ->
let s1, ty1, it1 = ity_infer tyenv t1 in
(match ty1 with
| ITyVar a ->
let fst = ITyVar (fresh_tyvar ()) in
let snd = ITyVar (fresh_tyvar ()) in
let tyenv = Environment.extend (Environment.extend tyenv x fst) y snd in
let s2, ty2, it2 = ity_infer tyenv t2 in
let s = unify (merge_subst s1 s2) [ITyVar a, ITyProd (fst, snd)] in
s, subst_type s ty2, ILet (x, y, it1, it2, subst_type s ty2)
| ITyProd (ty1', ty2') ->
let tyenv = Environment.extend tyenv x ty1' in
let tyenv = Environment.extend tyenv y ty2' in
let s2, ty2, it2 = ity_infer tyenv t2 in
let s = merge_subst s1 s2 in
s, subst_type s ty2, ILet (x, y, it1, it2, subst_type s ty2)
| _ -> raise ITypeError)
| InjL t ->
let s, ty, it = ity_infer tyenv t in
let ty = ITySum (ty, ITyVar (fresh_tyvar ())) in
s, ty, IInjL (it, ty)
| InjR t ->
let s, ty, it = ity_infer tyenv t in
let ty = ITySum (ITyVar (fresh_tyvar ()), ty) in
s, ty, IInjR (it, ty)
| Match (t1, (x, t2), (y, t3)) ->
let s1, ty1, it1 = ity_infer tyenv t1 in
let s1, xty, yty = (match ty1 with
| ITySum (xty, yty) -> s1, xty, yty
| ITyVar a ->
let xty = ITyVar (fresh_tyvar ()) in
let yty = ITyVar (fresh_tyvar ()) in
unify s1 [ITyVar a, ITySum (xty, yty)], xty, yty
| _ -> raise ITypeError)
in
let s2, ty2, it2 = ity_infer (Environment.extend tyenv x xty) t2 in
let s3, ty3, it3 = ity_infer (Environment.extend tyenv y yty) t3 in
let s = unify (merge_subst s1 (merge_subst s2 s3)) [ty2, ty3] in
s, subst_type s ty2, IMatch (it1, (x, it2), (y, it3), subst_type s ty2)
| LetRec (f, t1, t2) ->
let tyenv = Environment.extend tyenv f (ITyVar (fresh_tyvar ())) in
let s1, tyf, it1 = ity_infer tyenv t1 in
let s2, ty2, it2 = ity_infer tyenv t2 in
let s = unify (merge_subst s1 s2) [tyf, Environment.lookup tyenv f] in
s, subst_type s ty2, ILetRec (f, it1, it2, subst_type s ty2)
(* create intuitionistic typed term *)
let ity_term tyenv t =
let s, _, it = ity_infer tyenv t in
let rec fix_with_singleton = (function
| ITyVar _ -> ITySingleton (* replace with singleton *)
| ITyQbit -> ITyQbit
| ITySingleton -> ITySingleton
| ITyFun (ty1, ty2) -> ITyFun (fix_with_singleton ty1, fix_with_singleton ty2)
| ITyProd (ty1, ty2) -> ITyProd (fix_with_singleton ty1, fix_with_singleton ty2)
| ITySum (ty1, ty2) -> ITySum (fix_with_singleton ty1, fix_with_singleton ty2))
in
let rec correct_type = (function
| IConst (c, ty) -> IConst (c, fix_with_singleton (subst_type s ty))
| IVar (id, ty) -> IVar (id, fix_with_singleton (subst_type s ty))
| ITuple0 ty -> ITuple0 ty
| IAbst (id, t, ty) -> IAbst (id, correct_type t, fix_with_singleton (subst_type s ty))
| IApp (t1, t2, ty) -> IApp (correct_type t1, correct_type t2, fix_with_singleton (subst_type s ty))
| IPair (t1, t2, ty) -> IPair (correct_type t1, correct_type t2, fix_with_singleton (subst_type s ty))
| ILet (x, y, t1, t2, ty) -> ILet (x, y, correct_type t1, correct_type t2, fix_with_singleton (subst_type s ty))
| IInjL (t, ty) -> IInjL (correct_type t, fix_with_singleton (subst_type s ty))
| IInjR (t, ty) -> IInjR (correct_type t, fix_with_singleton (subst_type s ty))
| IMatch (t1, (x, t2), (y, t3), ty) -> IMatch (correct_type t1, (x, correct_type t2), (y, correct_type t3), fix_with_singleton (subst_type s ty))
| ILetRec (f, t1, t2, ty) -> ILetRec (f, correct_type t1, correct_type t2, fix_with_singleton (subst_type s ty)))
in
correct_type it
| null | https://raw.githubusercontent.com/Suikaba/SelingerQuantumLambdaCalculus/6a5160d38ad0333278a3f1c068284e3028068a0a/src/intuitionistic_typed.ml | ocaml | type inference
todo
create intuitionistic typed term
replace with singleton | open Core
open Syntax
open Unify
exception ITypeError
type ityped_term =
IConst of constant * itype
| IVar of id * itype
| ITuple0 of itype
| IAbst of id * ityped_term * itype
| IApp of ityped_term * ityped_term * itype
| IPair of ityped_term * ityped_term * itype
| ILet of id * id * ityped_term * ityped_term * itype
| IInjL of ityped_term * itype
| IInjR of ityped_term * itype
| IMatch of ityped_term * (id * ityped_term) * (id * ityped_term) * itype
| ILetRec of id * ityped_term * ityped_term * itype
let fresh_tyvar =
let counter = ref 0 in
let body () = counter := !counter + 1; !counter in
body
let rec string_of_iterm = function
| IConst (c, ty) -> Printf.sprintf "(%s : %s)" (string_of_const c) (string_of_itype ty)
| IVar (id, ty) -> Printf.sprintf "(%s : %s)" id (string_of_itype ty)
| ITuple0 ty -> Printf.sprintf "(* : %s)" (string_of_itype ty)
| IAbst (id, t, ty) -> Printf.sprintf "((lam %s . %s) : %s)" id (string_of_iterm t) (string_of_itype ty)
| IApp (t1, t2, ty) -> Printf.sprintf "(%s %s : %s)" (string_of_iterm t1) (string_of_iterm t2) (string_of_itype ty)
| IPair (t1, t2, ty) -> Printf.sprintf "(<%s, %s> : %s)" (string_of_iterm t1) (string_of_iterm t2) (string_of_itype ty)
| ILet (x, y, t1, t2, ty) ->
Printf.sprintf "(let <%s, %s> = %s in %s) : %s" x y (string_of_iterm t1) (string_of_iterm t2) (string_of_itype ty)
| IInjL (t, ty) ->
(match t with
| ITuple0 _ -> Printf.sprintf "(1 : %s)" (string_of_itype ty)
| t -> Printf.sprintf "(injl(%s) : %s)" (string_of_iterm t) (string_of_itype ty))
| IInjR (t, ty) ->
(match t with
| ITuple0 _ -> Printf.sprintf "(0 : %s)" (string_of_itype ty)
| t -> Printf.sprintf "(injr(%s) : %s)" (string_of_iterm t) (string_of_itype ty))
| IMatch (t1, (x, t2), (y, t3), ty) ->
Printf.sprintf "(match %s with %s -> %s | %s -> %s) : %s"
(string_of_iterm t1) x (string_of_iterm t2) y (string_of_iterm t3) (string_of_itype ty)
| ILetRec (f, t1, t2, ty) ->
Printf.sprintf "(let rec %s = %s in %s) : %s"
f (string_of_iterm t1) (string_of_iterm t2) (string_of_itype ty)
let ity_const = function
| New -> ITyFun (itybit, ITyQbit)
| Meas -> ITyFun (ITyQbit, itybit)
| _ -> failwith "Not implemented"
let rec ity_infer tyenv = function
| Const c -> empty_subst, ity_const c, IConst (c, ity_const c)
| Var id -> empty_subst, Environment.lookup tyenv id, IVar (id, Environment.lookup tyenv id)
| Tuple0 -> empty_subst, ITySingleton, ITuple0 ITySingleton
| Abst (id, body) ->
let tyarg = ITyVar (fresh_tyvar ()) in
let tyenv = Environment.extend tyenv id tyarg in
let s, tybody, ibody = ity_infer tyenv body in
let ty = ITyFun (subst_type s tyarg, tybody) in
s, ty, IAbst (id, ibody, ty)
| App (t1, t2) ->
let s1, tyf, it1 = ity_infer tyenv t1 in
let s2, tyarg, it2 = ity_infer tyenv t2 in
let tybody = ITyVar (fresh_tyvar ()) in
let s = unify (merge_subst s1 s2) [tyf, ITyFun (tyarg, tybody)] in
let ty = subst_type s tybody in
s, ty, IApp (it1, it2, ty)
| Pair (t1, t2) ->
let s1, ty1, it1 = ity_infer tyenv t1 in
let s2, ty2, it2 = ity_infer tyenv t2 in
merge_subst s1 s2, ITyProd (ty1, ty2), IPair (it1, it2, ITyProd (ty1, ty2))
| Let (x, y, t1, t2) ->
let s1, ty1, it1 = ity_infer tyenv t1 in
(match ty1 with
| ITyVar a ->
let fst = ITyVar (fresh_tyvar ()) in
let snd = ITyVar (fresh_tyvar ()) in
let tyenv = Environment.extend (Environment.extend tyenv x fst) y snd in
let s2, ty2, it2 = ity_infer tyenv t2 in
let s = unify (merge_subst s1 s2) [ITyVar a, ITyProd (fst, snd)] in
s, subst_type s ty2, ILet (x, y, it1, it2, subst_type s ty2)
| ITyProd (ty1', ty2') ->
let tyenv = Environment.extend tyenv x ty1' in
let tyenv = Environment.extend tyenv y ty2' in
let s2, ty2, it2 = ity_infer tyenv t2 in
let s = merge_subst s1 s2 in
s, subst_type s ty2, ILet (x, y, it1, it2, subst_type s ty2)
| _ -> raise ITypeError)
| InjL t ->
let s, ty, it = ity_infer tyenv t in
let ty = ITySum (ty, ITyVar (fresh_tyvar ())) in
s, ty, IInjL (it, ty)
| InjR t ->
let s, ty, it = ity_infer tyenv t in
let ty = ITySum (ITyVar (fresh_tyvar ()), ty) in
s, ty, IInjR (it, ty)
| Match (t1, (x, t2), (y, t3)) ->
let s1, ty1, it1 = ity_infer tyenv t1 in
let s1, xty, yty = (match ty1 with
| ITySum (xty, yty) -> s1, xty, yty
| ITyVar a ->
let xty = ITyVar (fresh_tyvar ()) in
let yty = ITyVar (fresh_tyvar ()) in
unify s1 [ITyVar a, ITySum (xty, yty)], xty, yty
| _ -> raise ITypeError)
in
let s2, ty2, it2 = ity_infer (Environment.extend tyenv x xty) t2 in
let s3, ty3, it3 = ity_infer (Environment.extend tyenv y yty) t3 in
let s = unify (merge_subst s1 (merge_subst s2 s3)) [ty2, ty3] in
s, subst_type s ty2, IMatch (it1, (x, it2), (y, it3), subst_type s ty2)
| LetRec (f, t1, t2) ->
let tyenv = Environment.extend tyenv f (ITyVar (fresh_tyvar ())) in
let s1, tyf, it1 = ity_infer tyenv t1 in
let s2, ty2, it2 = ity_infer tyenv t2 in
let s = unify (merge_subst s1 s2) [tyf, Environment.lookup tyenv f] in
s, subst_type s ty2, ILetRec (f, it1, it2, subst_type s ty2)
let ity_term tyenv t =
let s, _, it = ity_infer tyenv t in
let rec fix_with_singleton = (function
| ITyQbit -> ITyQbit
| ITySingleton -> ITySingleton
| ITyFun (ty1, ty2) -> ITyFun (fix_with_singleton ty1, fix_with_singleton ty2)
| ITyProd (ty1, ty2) -> ITyProd (fix_with_singleton ty1, fix_with_singleton ty2)
| ITySum (ty1, ty2) -> ITySum (fix_with_singleton ty1, fix_with_singleton ty2))
in
let rec correct_type = (function
| IConst (c, ty) -> IConst (c, fix_with_singleton (subst_type s ty))
| IVar (id, ty) -> IVar (id, fix_with_singleton (subst_type s ty))
| ITuple0 ty -> ITuple0 ty
| IAbst (id, t, ty) -> IAbst (id, correct_type t, fix_with_singleton (subst_type s ty))
| IApp (t1, t2, ty) -> IApp (correct_type t1, correct_type t2, fix_with_singleton (subst_type s ty))
| IPair (t1, t2, ty) -> IPair (correct_type t1, correct_type t2, fix_with_singleton (subst_type s ty))
| ILet (x, y, t1, t2, ty) -> ILet (x, y, correct_type t1, correct_type t2, fix_with_singleton (subst_type s ty))
| IInjL (t, ty) -> IInjL (correct_type t, fix_with_singleton (subst_type s ty))
| IInjR (t, ty) -> IInjR (correct_type t, fix_with_singleton (subst_type s ty))
| IMatch (t1, (x, t2), (y, t3), ty) -> IMatch (correct_type t1, (x, correct_type t2), (y, correct_type t3), fix_with_singleton (subst_type s ty))
| ILetRec (f, t1, t2, ty) -> ILetRec (f, correct_type t1, correct_type t2, fix_with_singleton (subst_type s ty)))
in
correct_type it
|
c7e690ab27a36aa46b350f7c5219d4bd06c45a36457c6d10dc09fda7577939f3 | Timothy-G-Griffin/cc_cl_cam_ac_uk | interp_2.ml | * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *
Compiler Construction 2016
Computer Laboratory
University of Cambridge
( )
* * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *
Compiler Construction 2016
Computer Laboratory
University of Cambridge
Timothy G. Griffin ()
*****************************************)
(* Interpreter 2.
A high-level stack-oriented abstract machine with compiler.
What do I mean by "high-level"?
---Code is still tree-structured.
---Complex values are pushed onto value stack.
---Slang state (heap) used only for references.
---Code is maintained on a code stack.
---Program variables contained in code.
*)
open Ast
let complain = Errors.complain
type address = int
type var = string
type value =
| REF of address
| INT of int
| BOOL of bool
| UNIT
| PAIR of value * value
| INL of value
| INR of value
| CLOSURE of closure
| REC_CLOSURE of code
and closure = code * env
and instruction =
| PUSH of value
| LOOKUP of var
| UNARY of unary_oper
| OPER of oper
| ASSIGN
| SWAP
| POP
| BIND of var
| FST
| SND
| DEREF
| APPLY
| MK_PAIR
| MK_INL
| MK_INR
| MK_REF
| MK_CLOSURE of code
| MK_REC of var * code
| TEST of code * code
| CASE of code * code
| WHILE of code * code
and code = instruction list
and binding = var * value
and env = binding list
type env_or_value = EV of env | V of value
type env_value_stack = env_or_value list
(* This is the the slang program state --- that is, values for references *)
(* It is an array of referenced values together with next unallocated address *)
type state = (value array) * int
type interp_state = code * env_value_stack * state
(* Printing *)
let string_of_list sep f l =
let rec aux f = function
| [] -> ""
| [t] -> (f t)
| t :: rest -> (f t) ^ sep ^ (aux f rest)
in "[" ^ (aux f l) ^ "]"
let rec string_of_value = function
| REF a -> "REF(" ^ (string_of_int a) ^ ")"
| BOOL b -> string_of_bool b
| INT n -> string_of_int n
| UNIT -> "UNIT"
| PAIR(v1, v2) -> "(" ^ (string_of_value v1) ^ ", " ^ (string_of_value v2) ^ ")"
| INL v -> "inl(" ^ (string_of_value v) ^ ")"
| INR v -> "inr(" ^ (string_of_value v) ^ ")"
| CLOSURE(cl) -> "CLOSURE(" ^ (string_of_closure cl) ^ ")"
| REC_CLOSURE(c) -> "REC_CLOSURE(" ^ (string_of_code c) ^ ")"
and string_of_closure (c, env) =
"(" ^ (string_of_code c) ^ ", " ^ (string_of_env env) ^ ")"
and string_of_env env = string_of_list ",\n " string_of_binding env
and string_of_binding (x, v) = "(" ^ x ^ ", " ^ (string_of_value v) ^ ")"
and string_of_instruction = function
| UNARY op -> "UNARY " ^ (string_of_uop op)
| OPER op -> "OPER " ^ (string_of_bop op)
| MK_PAIR -> "MK_PAIR"
| FST -> "FST"
| SND -> "SND"
| MK_INL -> "MK_INL"
| MK_INR -> "MK_INR"
| MK_REF -> "MK_REF"
| PUSH v -> "PUSH " ^ (string_of_value v)
| LOOKUP x -> "LOOKUP " ^ x
| TEST(c1, c2) -> "TEST(" ^ (string_of_code c1) ^ ", " ^ (string_of_code c2) ^ ")"
| CASE(c1, c2) -> "CASE(" ^ (string_of_code c1) ^ ", " ^ (string_of_code c2) ^ ")"
| WHILE(c1, c2) -> "WHILE(" ^ (string_of_code c1) ^ ", " ^ (string_of_code c2) ^ ")"
| APPLY -> "APPLY"
| BIND x -> "BIND " ^ x
| SWAP -> "SWAP"
| POP -> "POP"
| DEREF -> "DEREF"
| ASSIGN -> "ASSIGN"
| MK_CLOSURE c -> "MK_CLOSURE(" ^ (string_of_code c) ^ ")"
| MK_REC(f, c) -> "MK_REC(" ^ f ^ ", " ^ (string_of_code c) ^ ")"
and string_of_code c = string_of_list ";\n " string_of_instruction c
let string_of_env_or_value = function
| EV env -> "EV " ^ (string_of_env env)
| V v -> "V " ^ (string_of_value v)
let string_of_env_value_stack = string_of_list ";\n " string_of_env_or_value
let string_of_state (heap, i) =
let rec aux k =
if i < k
then ""
else (string_of_int k) ^ " -> " ^ (string_of_value (heap.(k))) ^ "\n" ^ (aux (k+1))
in if i = 0
then ""
else "\nHeap = \n" ^ (aux 0)
let string_of_interp_state (c, evs, s) =
"\nCode Stack = \n" ^ (string_of_code c)
^ "\nEnv/Value Stack = \n" ^ (string_of_env_value_stack evs)
^ (string_of_state(s))
(* The "MACHINE" *)
(* allocate a new location in the heap
and give it value v
*)
let allocate (heap, i) v =
if i < Option.heap_max
then let _ = heap.(i) <- v
in (i, (heap, i+1))
else complain "runtime error: heap kaput"
let deref (heap, _) a = heap.(a)
let assign (heap, i) a v =
let _ = heap.(a) <- v
in (heap, i)
(* update : (env * binding) -> env *)
let update(env, (x, v)) = (x, v) :: env
let mk_fun(c, env) = CLOSURE(c, env)
let mk_rec(f, c, env) = CLOSURE(c, (f, REC_CLOSURE(c))::env)
in interp_0 :
interpret(LetRecFun(f , ( x , body ) , e ) , env ) =
let rec =
if g = f then FUN ( fun v - > interpret(body , update(new_env , ( x , v ) ) ) ) else env g
in interpret(e , new_env , store )
= env x
( fun v - > interpret(body , update(new_env , ( x , v ) ) ) )
lookup ( env1 @ [ ( f , cl1 ) ] @ evn2 , f ) =
CLOSURE ( false , ( x , body , ( f , cl2 ) : : env2 ) )
in interp_0:
interpret(LetRecFun(f, (x, body), e), env) =
let rec new_env g =
if g = f then FUN (fun v -> interpret(body, update(new_env, (x, v)))) else env g
in interpret(e, new_env, store)
new_env x = env x
new_env f = FUN (fun v -> interpret(body, update(new_env, (x, v))))
lookup (env1 @ [(f, cl1)] @ evn2, f) =
CLOSURE (false, (x, body, (f, cl2) :: env2))
*)
let lookup_opt (env, x) =
let rec aux = function
| [] -> None
| (y, v) :: rest ->
if x = y
then Some(match v with
| REC_CLOSURE(body) -> mk_rec(x, body, rest)
| _ -> v)
else aux rest
in aux env
let rec search (evs, x) =
match evs with
| [] -> complain (x ^ " is not defined!\n")
| (V _) :: rest -> search (rest, x)
| (EV env) :: rest ->
(match lookup_opt(env, x) with
| None -> search (rest, x)
| Some v -> v
)
let rec evs_to_env = function
| [] -> []
| (V _) :: rest -> evs_to_env rest
| (EV env) :: rest -> env @ (evs_to_env rest)
let readint () = let _ = print_string "input> " in read_int()
let do_unary = function
| (NOT, BOOL m) -> BOOL (not m)
| (NEG, INT m) -> INT (-m)
| (READ, UNIT) -> INT (readint())
| (op, _) -> complain ("malformed unary operator: " ^ (string_of_unary_oper op))
let do_oper = function
| (AND, BOOL m, BOOL n) -> BOOL (m && n)
| (OR, BOOL m, BOOL n) -> BOOL (m || n)
| (EQB, BOOL m, BOOL n) -> BOOL (m = n)
| (LT, INT m, INT n) -> BOOL (m < n)
| (EQI, INT m, INT n) -> BOOL (m = n)
| (ADD, INT m, INT n) -> INT (m + n)
| (SUB, INT m, INT n) -> INT (m - n)
| (MUL, INT m, INT n) -> INT (m * n)
| (DIV, INT m, INT n) -> INT (m / n)
| (op, _, _) -> complain ("malformed binary operator: " ^ (string_of_oper op))
(*
val step : interp_state -> interp_state
= (code * env_value_stack * state) -> (code * env_value_stack * state)
*)
let step = function
(* (code stack, value/env stack, state) -> (code stack, value/env stack, state) *)
| ((PUSH v) :: ds, evs, s) -> (ds, (V v) :: evs, s)
| (POP :: ds, e :: evs, s) -> (ds, evs, s)
| (SWAP :: ds, e1 :: e2 :: evs, s) -> (ds, e2 :: e1 :: evs, s)
| ((BIND x) :: ds, (V v) :: evs, s) -> (ds, EV([(x, v)]) :: evs, s)
| ((LOOKUP x) :: ds, evs, s) -> (ds, V(search(evs, x)) :: evs, s)
| ((UNARY op) :: ds, (V v) :: evs, s) -> (ds, V(do_unary(op, v)) :: evs, s)
| ((OPER op) :: ds, (V v2) :: (V v1) :: evs, s) -> (ds, V(do_oper(op, v1, v2)) :: evs, s)
| (MK_PAIR :: ds, (V v2) :: (V v1) :: evs, s) -> (ds, V(PAIR(v1, v2)) :: evs, s)
| (FST :: ds, V(PAIR (v, _)) :: evs, s) -> (ds, (V v) :: evs, s)
| (SND :: ds, V(PAIR (_, v)) :: evs, s) -> (ds, (V v) :: evs, s)
| (MK_INL :: ds, (V v) :: evs, s) -> (ds, V(INL v) :: evs, s)
| (MK_INR :: ds, (V v) :: evs, s) -> (ds, V(INR v) :: evs, s)
| (CASE (c1, _) :: ds, V(INL v)::evs, s) -> (c1 @ ds, (V v) :: evs, s)
| (CASE ( _, c2) :: ds, V(INR v)::evs, s) -> (c2 @ ds, (V v) :: evs, s)
| ((TEST(c1, c2)) :: ds, V(BOOL true) :: evs, s) -> (c1 @ ds, evs, s)
| ((TEST(c1, c2)) :: ds, V(BOOL false) :: evs, s) -> (c2 @ ds, evs, s)
| (ASSIGN :: ds, (V v) :: (V (REF a)) :: evs, s) -> (ds, V(UNIT) :: evs, assign s a v)
| (DEREF :: ds, (V (REF a)) :: evs, s) -> (ds, V(deref s a) :: evs, s)
| (MK_REF :: ds, (V v) :: evs, s) -> let (a, s') = allocate s v in (ds, V(REF a) :: evs, s')
| ((WHILE(c1, c2)) :: ds,V(BOOL false) :: evs, s) -> (ds, V(UNIT) :: evs, s)
| ((WHILE(c1, c2)) :: ds, V(BOOL true) :: evs, s) -> (c2 @ [POP] @ c1 @ [WHILE(c1, c2)] @ ds, evs, s)
| ((MK_CLOSURE c) :: ds, evs, s) -> (ds, V(mk_fun(c, evs_to_env evs)) :: evs, s)
| (MK_REC(f, c) :: ds, evs, s) -> (ds, V(mk_rec(f, c, evs_to_env evs)) :: evs, s)
| (APPLY :: ds, V(CLOSURE (c, env)) :: (V v) :: evs, s)
-> (c @ ds, (V v) :: (EV env) :: evs, s)
| state -> complain ("step : bad state = " ^ (string_of_interp_state state) ^ "\n")
let rec driver n state =
let _ = if Option.verbose
then print_string ("\nState " ^ (string_of_int n)
^ " : " ^ (string_of_interp_state state) ^ "\n")
else ()
in match state with
| ([], [V v], s) -> (v, s)
| _ -> driver (n + 1) (step state)
A BIND will leave an env on stack .
This gets rid of it .
This gets rid of it. *)
let leave_scope = [SWAP; POP]
(*
val compile : expr -> code
*)
let rec compile = function
| Unit -> [PUSH UNIT]
| Integer n -> [PUSH (INT n)]
| Boolean b -> [PUSH (BOOL b)]
| Var x -> [LOOKUP x]
| UnaryOp(op, e) -> (compile e) @ [UNARY op]
| Op(e1, op, e2) -> (compile e1) @ (compile e2) @ [OPER op]
| Pair(e1, e2) -> (compile e1) @ (compile e2) @ [MK_PAIR]
| Fst e -> (compile e) @ [FST]
| Snd e -> (compile e) @ [SND]
| Inl e -> (compile e) @ [MK_INL]
| Inr e -> (compile e) @ [MK_INR]
| Case(e, (x1, e1), (x2, e2)) ->
(compile e)
@ [CASE((BIND x1) :: (compile e1) @ leave_scope,
(BIND x2) :: (compile e2) @ leave_scope)]
| If(e1, e2, e3) -> (compile e1) @ [TEST(compile e2, compile e3)]
| Seq [] -> []
| Seq [e] -> compile e
| Seq (e ::rest) -> (compile e) @ [POP] @ (compile (Seq rest))
| Ref e -> (compile e) @ [MK_REF]
| Deref e -> (compile e) @ [DEREF]
| While(e1, e2) -> let cl = compile e1 in cl @ [WHILE(cl, compile e2)]
| Assign(e1, e2) -> (compile e1) @ (compile e2) @ [ASSIGN]
I chose to evaluate arg first
@ (compile e1)
@ [APPLY;
SWAP; POP] (* get rid of env left on stack *)
| Lambda(x, e) -> [MK_CLOSURE((BIND x) :: (compile e) @ leave_scope)]
| LetFun(f, (x, body), e) ->
(MK_CLOSURE((BIND x) :: (compile body) @ leave_scope)) ::
(BIND f) ::
(compile e) @ leave_scope
| LetRecFun(f, (x, body), e) ->
(MK_REC(f, (BIND x) :: (compile body) @ leave_scope)) ::
(BIND f) ::
(compile e) @ leave_scope
The initial Slang state is the Slang state : all locations contain 0
let initial_state = (Array.make Option.heap_max (INT 0), 0)
let initial_env = []
(* interpret : expr -> (value * state) *)
let interpret e =
let c = compile e in
let _ = if Option.verbose
then print_string("Compile code =\n" ^ (string_of_code c) ^ "\n")
else ()
in driver 1 (c, initial_env, initial_state)
| null | https://raw.githubusercontent.com/Timothy-G-Griffin/cc_cl_cam_ac_uk/aabaf64c997301ea69060a1b69e915b9d1031573/slang/interp_2.ml | ocaml | Interpreter 2.
A high-level stack-oriented abstract machine with compiler.
What do I mean by "high-level"?
---Code is still tree-structured.
---Complex values are pushed onto value stack.
---Slang state (heap) used only for references.
---Code is maintained on a code stack.
---Program variables contained in code.
This is the the slang program state --- that is, values for references
It is an array of referenced values together with next unallocated address
Printing
The "MACHINE"
allocate a new location in the heap
and give it value v
update : (env * binding) -> env
val step : interp_state -> interp_state
= (code * env_value_stack * state) -> (code * env_value_stack * state)
(code stack, value/env stack, state) -> (code stack, value/env stack, state)
val compile : expr -> code
get rid of env left on stack
interpret : expr -> (value * state) | * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *
Compiler Construction 2016
Computer Laboratory
University of Cambridge
( )
* * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *
Compiler Construction 2016
Computer Laboratory
University of Cambridge
Timothy G. Griffin ()
*****************************************)
open Ast
let complain = Errors.complain
type address = int
type var = string
type value =
| REF of address
| INT of int
| BOOL of bool
| UNIT
| PAIR of value * value
| INL of value
| INR of value
| CLOSURE of closure
| REC_CLOSURE of code
and closure = code * env
and instruction =
| PUSH of value
| LOOKUP of var
| UNARY of unary_oper
| OPER of oper
| ASSIGN
| SWAP
| POP
| BIND of var
| FST
| SND
| DEREF
| APPLY
| MK_PAIR
| MK_INL
| MK_INR
| MK_REF
| MK_CLOSURE of code
| MK_REC of var * code
| TEST of code * code
| CASE of code * code
| WHILE of code * code
and code = instruction list
and binding = var * value
and env = binding list
type env_or_value = EV of env | V of value
type env_value_stack = env_or_value list
type state = (value array) * int
type interp_state = code * env_value_stack * state
let string_of_list sep f l =
let rec aux f = function
| [] -> ""
| [t] -> (f t)
| t :: rest -> (f t) ^ sep ^ (aux f rest)
in "[" ^ (aux f l) ^ "]"
let rec string_of_value = function
| REF a -> "REF(" ^ (string_of_int a) ^ ")"
| BOOL b -> string_of_bool b
| INT n -> string_of_int n
| UNIT -> "UNIT"
| PAIR(v1, v2) -> "(" ^ (string_of_value v1) ^ ", " ^ (string_of_value v2) ^ ")"
| INL v -> "inl(" ^ (string_of_value v) ^ ")"
| INR v -> "inr(" ^ (string_of_value v) ^ ")"
| CLOSURE(cl) -> "CLOSURE(" ^ (string_of_closure cl) ^ ")"
| REC_CLOSURE(c) -> "REC_CLOSURE(" ^ (string_of_code c) ^ ")"
and string_of_closure (c, env) =
"(" ^ (string_of_code c) ^ ", " ^ (string_of_env env) ^ ")"
and string_of_env env = string_of_list ",\n " string_of_binding env
and string_of_binding (x, v) = "(" ^ x ^ ", " ^ (string_of_value v) ^ ")"
and string_of_instruction = function
| UNARY op -> "UNARY " ^ (string_of_uop op)
| OPER op -> "OPER " ^ (string_of_bop op)
| MK_PAIR -> "MK_PAIR"
| FST -> "FST"
| SND -> "SND"
| MK_INL -> "MK_INL"
| MK_INR -> "MK_INR"
| MK_REF -> "MK_REF"
| PUSH v -> "PUSH " ^ (string_of_value v)
| LOOKUP x -> "LOOKUP " ^ x
| TEST(c1, c2) -> "TEST(" ^ (string_of_code c1) ^ ", " ^ (string_of_code c2) ^ ")"
| CASE(c1, c2) -> "CASE(" ^ (string_of_code c1) ^ ", " ^ (string_of_code c2) ^ ")"
| WHILE(c1, c2) -> "WHILE(" ^ (string_of_code c1) ^ ", " ^ (string_of_code c2) ^ ")"
| APPLY -> "APPLY"
| BIND x -> "BIND " ^ x
| SWAP -> "SWAP"
| POP -> "POP"
| DEREF -> "DEREF"
| ASSIGN -> "ASSIGN"
| MK_CLOSURE c -> "MK_CLOSURE(" ^ (string_of_code c) ^ ")"
| MK_REC(f, c) -> "MK_REC(" ^ f ^ ", " ^ (string_of_code c) ^ ")"
and string_of_code c = string_of_list ";\n " string_of_instruction c
let string_of_env_or_value = function
| EV env -> "EV " ^ (string_of_env env)
| V v -> "V " ^ (string_of_value v)
let string_of_env_value_stack = string_of_list ";\n " string_of_env_or_value
let string_of_state (heap, i) =
let rec aux k =
if i < k
then ""
else (string_of_int k) ^ " -> " ^ (string_of_value (heap.(k))) ^ "\n" ^ (aux (k+1))
in if i = 0
then ""
else "\nHeap = \n" ^ (aux 0)
let string_of_interp_state (c, evs, s) =
"\nCode Stack = \n" ^ (string_of_code c)
^ "\nEnv/Value Stack = \n" ^ (string_of_env_value_stack evs)
^ (string_of_state(s))
let allocate (heap, i) v =
if i < Option.heap_max
then let _ = heap.(i) <- v
in (i, (heap, i+1))
else complain "runtime error: heap kaput"
let deref (heap, _) a = heap.(a)
let assign (heap, i) a v =
let _ = heap.(a) <- v
in (heap, i)
let update(env, (x, v)) = (x, v) :: env
let mk_fun(c, env) = CLOSURE(c, env)
let mk_rec(f, c, env) = CLOSURE(c, (f, REC_CLOSURE(c))::env)
in interp_0 :
interpret(LetRecFun(f , ( x , body ) , e ) , env ) =
let rec =
if g = f then FUN ( fun v - > interpret(body , update(new_env , ( x , v ) ) ) ) else env g
in interpret(e , new_env , store )
= env x
( fun v - > interpret(body , update(new_env , ( x , v ) ) ) )
lookup ( env1 @ [ ( f , cl1 ) ] @ evn2 , f ) =
CLOSURE ( false , ( x , body , ( f , cl2 ) : : env2 ) )
in interp_0:
interpret(LetRecFun(f, (x, body), e), env) =
let rec new_env g =
if g = f then FUN (fun v -> interpret(body, update(new_env, (x, v)))) else env g
in interpret(e, new_env, store)
new_env x = env x
new_env f = FUN (fun v -> interpret(body, update(new_env, (x, v))))
lookup (env1 @ [(f, cl1)] @ evn2, f) =
CLOSURE (false, (x, body, (f, cl2) :: env2))
*)
let lookup_opt (env, x) =
let rec aux = function
| [] -> None
| (y, v) :: rest ->
if x = y
then Some(match v with
| REC_CLOSURE(body) -> mk_rec(x, body, rest)
| _ -> v)
else aux rest
in aux env
let rec search (evs, x) =
match evs with
| [] -> complain (x ^ " is not defined!\n")
| (V _) :: rest -> search (rest, x)
| (EV env) :: rest ->
(match lookup_opt(env, x) with
| None -> search (rest, x)
| Some v -> v
)
let rec evs_to_env = function
| [] -> []
| (V _) :: rest -> evs_to_env rest
| (EV env) :: rest -> env @ (evs_to_env rest)
let readint () = let _ = print_string "input> " in read_int()
let do_unary = function
| (NOT, BOOL m) -> BOOL (not m)
| (NEG, INT m) -> INT (-m)
| (READ, UNIT) -> INT (readint())
| (op, _) -> complain ("malformed unary operator: " ^ (string_of_unary_oper op))
let do_oper = function
| (AND, BOOL m, BOOL n) -> BOOL (m && n)
| (OR, BOOL m, BOOL n) -> BOOL (m || n)
| (EQB, BOOL m, BOOL n) -> BOOL (m = n)
| (LT, INT m, INT n) -> BOOL (m < n)
| (EQI, INT m, INT n) -> BOOL (m = n)
| (ADD, INT m, INT n) -> INT (m + n)
| (SUB, INT m, INT n) -> INT (m - n)
| (MUL, INT m, INT n) -> INT (m * n)
| (DIV, INT m, INT n) -> INT (m / n)
| (op, _, _) -> complain ("malformed binary operator: " ^ (string_of_oper op))
let step = function
| ((PUSH v) :: ds, evs, s) -> (ds, (V v) :: evs, s)
| (POP :: ds, e :: evs, s) -> (ds, evs, s)
| (SWAP :: ds, e1 :: e2 :: evs, s) -> (ds, e2 :: e1 :: evs, s)
| ((BIND x) :: ds, (V v) :: evs, s) -> (ds, EV([(x, v)]) :: evs, s)
| ((LOOKUP x) :: ds, evs, s) -> (ds, V(search(evs, x)) :: evs, s)
| ((UNARY op) :: ds, (V v) :: evs, s) -> (ds, V(do_unary(op, v)) :: evs, s)
| ((OPER op) :: ds, (V v2) :: (V v1) :: evs, s) -> (ds, V(do_oper(op, v1, v2)) :: evs, s)
| (MK_PAIR :: ds, (V v2) :: (V v1) :: evs, s) -> (ds, V(PAIR(v1, v2)) :: evs, s)
| (FST :: ds, V(PAIR (v, _)) :: evs, s) -> (ds, (V v) :: evs, s)
| (SND :: ds, V(PAIR (_, v)) :: evs, s) -> (ds, (V v) :: evs, s)
| (MK_INL :: ds, (V v) :: evs, s) -> (ds, V(INL v) :: evs, s)
| (MK_INR :: ds, (V v) :: evs, s) -> (ds, V(INR v) :: evs, s)
| (CASE (c1, _) :: ds, V(INL v)::evs, s) -> (c1 @ ds, (V v) :: evs, s)
| (CASE ( _, c2) :: ds, V(INR v)::evs, s) -> (c2 @ ds, (V v) :: evs, s)
| ((TEST(c1, c2)) :: ds, V(BOOL true) :: evs, s) -> (c1 @ ds, evs, s)
| ((TEST(c1, c2)) :: ds, V(BOOL false) :: evs, s) -> (c2 @ ds, evs, s)
| (ASSIGN :: ds, (V v) :: (V (REF a)) :: evs, s) -> (ds, V(UNIT) :: evs, assign s a v)
| (DEREF :: ds, (V (REF a)) :: evs, s) -> (ds, V(deref s a) :: evs, s)
| (MK_REF :: ds, (V v) :: evs, s) -> let (a, s') = allocate s v in (ds, V(REF a) :: evs, s')
| ((WHILE(c1, c2)) :: ds,V(BOOL false) :: evs, s) -> (ds, V(UNIT) :: evs, s)
| ((WHILE(c1, c2)) :: ds, V(BOOL true) :: evs, s) -> (c2 @ [POP] @ c1 @ [WHILE(c1, c2)] @ ds, evs, s)
| ((MK_CLOSURE c) :: ds, evs, s) -> (ds, V(mk_fun(c, evs_to_env evs)) :: evs, s)
| (MK_REC(f, c) :: ds, evs, s) -> (ds, V(mk_rec(f, c, evs_to_env evs)) :: evs, s)
| (APPLY :: ds, V(CLOSURE (c, env)) :: (V v) :: evs, s)
-> (c @ ds, (V v) :: (EV env) :: evs, s)
| state -> complain ("step : bad state = " ^ (string_of_interp_state state) ^ "\n")
let rec driver n state =
let _ = if Option.verbose
then print_string ("\nState " ^ (string_of_int n)
^ " : " ^ (string_of_interp_state state) ^ "\n")
else ()
in match state with
| ([], [V v], s) -> (v, s)
| _ -> driver (n + 1) (step state)
A BIND will leave an env on stack .
This gets rid of it .
This gets rid of it. *)
let leave_scope = [SWAP; POP]
let rec compile = function
| Unit -> [PUSH UNIT]
| Integer n -> [PUSH (INT n)]
| Boolean b -> [PUSH (BOOL b)]
| Var x -> [LOOKUP x]
| UnaryOp(op, e) -> (compile e) @ [UNARY op]
| Op(e1, op, e2) -> (compile e1) @ (compile e2) @ [OPER op]
| Pair(e1, e2) -> (compile e1) @ (compile e2) @ [MK_PAIR]
| Fst e -> (compile e) @ [FST]
| Snd e -> (compile e) @ [SND]
| Inl e -> (compile e) @ [MK_INL]
| Inr e -> (compile e) @ [MK_INR]
| Case(e, (x1, e1), (x2, e2)) ->
(compile e)
@ [CASE((BIND x1) :: (compile e1) @ leave_scope,
(BIND x2) :: (compile e2) @ leave_scope)]
| If(e1, e2, e3) -> (compile e1) @ [TEST(compile e2, compile e3)]
| Seq [] -> []
| Seq [e] -> compile e
| Seq (e ::rest) -> (compile e) @ [POP] @ (compile (Seq rest))
| Ref e -> (compile e) @ [MK_REF]
| Deref e -> (compile e) @ [DEREF]
| While(e1, e2) -> let cl = compile e1 in cl @ [WHILE(cl, compile e2)]
| Assign(e1, e2) -> (compile e1) @ (compile e2) @ [ASSIGN]
I chose to evaluate arg first
@ (compile e1)
@ [APPLY;
| Lambda(x, e) -> [MK_CLOSURE((BIND x) :: (compile e) @ leave_scope)]
| LetFun(f, (x, body), e) ->
(MK_CLOSURE((BIND x) :: (compile body) @ leave_scope)) ::
(BIND f) ::
(compile e) @ leave_scope
| LetRecFun(f, (x, body), e) ->
(MK_REC(f, (BIND x) :: (compile body) @ leave_scope)) ::
(BIND f) ::
(compile e) @ leave_scope
The initial Slang state is the Slang state : all locations contain 0
let initial_state = (Array.make Option.heap_max (INT 0), 0)
let initial_env = []
let interpret e =
let c = compile e in
let _ = if Option.verbose
then print_string("Compile code =\n" ^ (string_of_code c) ^ "\n")
else ()
in driver 1 (c, initial_env, initial_state)
|
d1e14efbefdce5efc30408511e339f05fcf5ad1e693477e1ec8f53690f3bfa25 | mitchellwrosen/boston-haskell-arcade | BlimpBoy.hs | # LANGUAGE TemplateHaskell #
module Bha.Game.Impl.BlimpBoy
( game
) where
import Bha.Elm.Prelude
import qualified Data.Set as Set
-- TODO Blimp boy - enemies that fire upwards
-- TODO Blimp boy - enemy blimps that fire downwards
-- TODO Blimp boy - levels
--------------------------------------------------------------------------------
Model
--------------------------------------------------------------------------------
blimpx = 35 :: X
blimprow = 5 :: Row
blimpvel = 3 :: Vel
castlecol = 40 :: Col
enemycol = 0 :: X
enemyrow = 20 :: Row
enemyvel = 7 :: Vel
pebblevel = 24 :: Vel
pebbletimer = 1.0 :: Seconds
bombvel = 18 :: Vel
bombtimer = 3.0 :: Seconds
type Row = Int
type Col = Int
type X = Double
type Y = Double
type Vel = Double
data Model
= Model
{ blimp :: X
, blimpVel :: Vel
, enemies :: (Set X)
, pebble :: (Set (X, Y))
, numPebbles :: Int
, maxNumPebbles :: Int
, nextPebble :: Seconds
, bombs :: (Set (X, Y))
, numBombs :: Int
, maxNumBombs :: Int
, nextBomb :: Seconds
, health :: Int
, money :: Int
} deriving stock (Generic, Show)
init :: Int -> Int -> Init Void Model
init _ _ =
pure Model
{ blimp = blimpx
, blimpVel = -blimpvel
, enemies = mempty
, pebble = mempty
, numPebbles = 1
, maxNumPebbles = 2
, nextPebble = pebbletimer
, bombs = mempty
, numBombs = 1
, maxNumBombs = 2
, nextBomb = bombtimer
, health = 50
, money = 0
}
--------------------------------------------------------------------------------
-- Update
--------------------------------------------------------------------------------
update :: Input Void -> Update Model Void ()
update = \case
Tick dt ->
tickUpdate dt
Key KeyArrowLeft ->
#blimpVel %= negate . abs
Key KeyArrowRight ->
#blimpVel %= abs
Key (KeyChar 'p') -> do
money <- use #money
maxNumPebbles <- use #maxNumPebbles
when (money >= 1 && maxNumPebbles < 5) $ do
#money %= subtract 1
#maxNumPebbles %= (+1)
Key (KeyChar 'b') -> do
money <- use #money
maxNumBombs <- use #maxNumBombs
when (money >= 3 && maxNumBombs < 5) $ do
#money %= subtract 3
#maxNumBombs %= (+1)
Key KeySpace -> do
supply <- use #numPebbles
blimpcol <- use #blimp
#pebble %=
if supply >= 1
then
Set.insert (blimpcol + 0.5, fromIntegral blimprow + 0.5)
else
id
#numPebbles %=
(max 0 . subtract 1)
Key (KeyChar '1') -> do
supply <- use #numBombs
blimpcol <- use #blimp
#bombs %=
if supply >= 1
then
Set.insert (blimpcol + 0.5, fromIntegral blimprow + 0.5)
else
id
#numBombs %=
(max 0 . subtract 1)
Key KeyEsc ->
empty
_ ->
pure ()
tickUpdate :: Seconds -> Update Model Void ()
tickUpdate dt = do
isCastleAlive
blimpDrifts dt
enemiesAdvance dt
stuffFallsDownward dt
removePebbledEnemies
removeBombedEnemies
enemiesHitCastle
possiblySpawnNewEnemy
updatePebbleSupply dt
updateBombSupply dt
isCastleAlive :: Update Model Void ()
isCastleAlive = do
health <- use #health
guard (health > 0)
blimpDrifts :: Seconds -> Update Model Void ()
blimpDrifts dt = do
blimpVel <- use #blimpVel
#blimp %= max 1 . min 55 . \x -> x + blimpVel * realToFrac dt
enemiesAdvance :: Seconds -> Update Model Void ()
enemiesAdvance dt =
#enemies %= Set.map (\x -> x + enemyvel * realToFrac dt)
stuffFallsDownward :: Seconds -> Update Model Void ()
stuffFallsDownward dt = do
#pebble %=
Set.filter ((\y -> y <= fromIntegral enemyrow + 1) . snd) .
Set.map (over _2 (\y -> y + pebblevel * realToFrac dt))
#bombs %=
Set.filter ((\y -> y <= fromIntegral enemyrow + 1) . snd) .
Set.map (over _2 (\y -> y + bombvel * realToFrac dt))
removePebbledEnemies :: Update Model Void ()
removePebbledEnemies = do
pebbles <- use #pebble
for_ pebbles $ \(pebblex, pebbley) -> do
when (floor pebbley == enemyrow) $ do
enemies <- use #enemies
let
(dead, alive) =
Set.partition
(\x -> x >= pebblex - 0.5 && x <= pebblex + 0.5)
enemies
#money %= (+ length dead)
#enemies .= alive
removeBombedEnemies :: Update Model Void ()
removeBombedEnemies = do
bombs <- use #bombs
for_ bombs $ \(bombx, bomby) -> do
when (floor bomby == enemyrow) $ do
enemies <- use #enemies
let
(dead, alive) =
Set.partition (\x -> x >= bombx - 1.5 && x <= bombx + 1.5) enemies
#enemies .= alive
#money %= (+ length dead)
enemiesHitCastle :: Update Model Void ()
enemiesHitCastle = do
enemies <- use #enemies
let
(splat, walking) =
Set.partition (\x -> floor x >= castlecol) enemies
#enemies .= walking
#health %= subtract (length splat)
possiblySpawnNewEnemy :: Update Model Void ()
possiblySpawnNewEnemy = do
pct <- randomPct
when (pct > 0.99) (#enemies %= Set.insert enemycol)
updatePebbleSupply :: Seconds -> Update Model Void ()
updatePebbleSupply dt = do
nextPebbleTimer <- use #nextPebble
maxNumPebbles <- use #maxNumPebbles
#numPebbles %=
if nextPebbleTimer <= 0
then min maxNumPebbles . (+1)
else id
#nextPebble %=
\timer ->
if timer <= 0
then timer - dt + pebbletimer
else timer - dt
updateBombSupply :: Seconds -> Update Model Void ()
updateBombSupply dt = do
nextBombTimer <- use #nextBomb
maxNumBombs <- use #maxNumBombs
#numBombs %=
if nextBombTimer <= 0
then min maxNumBombs . (+1)
else id
#nextBomb %=
\timer ->
if timer <= 0
then timer - dt + bombtimer
else timer - dt
--------------------------------------------------------------------------------
-- View
--------------------------------------------------------------------------------
view :: Model -> Scene
view model =
Scene cells NoCursor
where
cells :: Cells
cells =
mconcat
[ renderSky
, renderGround
, renderCastle
, renderBlimp (model ^. #blimp)
, renderPebbles (model ^. #pebble)
, renderBombs (model ^. #bombs)
, renderEnemies (model ^. #enemies)
, renderMoney (model ^. #money)
, renderNumPebbles (model ^. #numPebbles)
, renderNumBombs (model ^. #numBombs)
, renderHealth (model ^. #health)
]
renderSky = rect 0 0 60 (enemyrow+1) blue
renderGround = rect 0 (enemyrow+1) 60 10 green
renderCastle = rect castlecol 5 10 (enemyrow - 5 + 1) 253
renderBlimp :: X -> Cells
renderBlimp (round -> col) =
rect (col-1) (blimprow-1) 3 2 yellow
renderPebbles :: Set (X, Y) -> Cells
renderPebbles =
foldMap (\(floor -> c, floor -> r) -> set c r (Cell '‧' black blue)) .
Set.toList
renderBombs :: Set (X, Y) -> Cells
renderBombs =
foldMap render . Set.toList
where
render :: (X, Y) -> Cells
render (floor -> c, floor -> r) =
if r == enemyrow
then
rect (c-1) r 3 1 red
else
set c r (Cell '•' black blue)
renderEnemies :: Set X -> Cells
renderEnemies =
foldMap (\c -> set (round c) enemyrow (Cell '∞' black blue)) . Set.toList
renderMoney :: Int -> Cells
renderMoney money =
text 0 (enemyrow+11) white black ("Money: " ++ show money)
renderNumPebbles :: Int -> Cells
renderNumPebbles pebbles =
text 0 (enemyrow+12) white black ("Pebbles: " ++ replicate pebbles '‧')
renderNumBombs :: Int -> Cells
renderNumBombs bombs =
text 0 (enemyrow+13) white black ("Bombs: " ++ replicate bombs '•')
renderHealth :: Int -> Cells
renderHealth health =
text 0 (enemyrow+14) white black ("Health: " ++ show health)
--------------------------------------------------------------------------------
-- Tick
--------------------------------------------------------------------------------
tickEvery :: Model -> Maybe Seconds
tickEvery _ =
Just (1/30)
--------------------------------------------------------------------------------
-- Subscribe
--------------------------------------------------------------------------------
subscribe :: Model -> HashSet Text
subscribe _ =
mempty
--------------------------------------------------------------------------------
-- Game
--------------------------------------------------------------------------------
game :: ElmGame Model Void
game =
ElmGame init update view tickEvery subscribe
| null | https://raw.githubusercontent.com/mitchellwrosen/boston-haskell-arcade/2e85fbc4ddd18bad520c7544572f7205ef02015f/src/Bha/Game/Impl/BlimpBoy.hs | haskell | TODO Blimp boy - enemies that fire upwards
TODO Blimp boy - enemy blimps that fire downwards
TODO Blimp boy - levels
------------------------------------------------------------------------------
------------------------------------------------------------------------------
------------------------------------------------------------------------------
Update
------------------------------------------------------------------------------
------------------------------------------------------------------------------
View
------------------------------------------------------------------------------
------------------------------------------------------------------------------
Tick
------------------------------------------------------------------------------
------------------------------------------------------------------------------
Subscribe
------------------------------------------------------------------------------
------------------------------------------------------------------------------
Game
------------------------------------------------------------------------------ | # LANGUAGE TemplateHaskell #
module Bha.Game.Impl.BlimpBoy
( game
) where
import Bha.Elm.Prelude
import qualified Data.Set as Set
Model
blimpx = 35 :: X
blimprow = 5 :: Row
blimpvel = 3 :: Vel
castlecol = 40 :: Col
enemycol = 0 :: X
enemyrow = 20 :: Row
enemyvel = 7 :: Vel
pebblevel = 24 :: Vel
pebbletimer = 1.0 :: Seconds
bombvel = 18 :: Vel
bombtimer = 3.0 :: Seconds
type Row = Int
type Col = Int
type X = Double
type Y = Double
type Vel = Double
data Model
= Model
{ blimp :: X
, blimpVel :: Vel
, enemies :: (Set X)
, pebble :: (Set (X, Y))
, numPebbles :: Int
, maxNumPebbles :: Int
, nextPebble :: Seconds
, bombs :: (Set (X, Y))
, numBombs :: Int
, maxNumBombs :: Int
, nextBomb :: Seconds
, health :: Int
, money :: Int
} deriving stock (Generic, Show)
init :: Int -> Int -> Init Void Model
init _ _ =
pure Model
{ blimp = blimpx
, blimpVel = -blimpvel
, enemies = mempty
, pebble = mempty
, numPebbles = 1
, maxNumPebbles = 2
, nextPebble = pebbletimer
, bombs = mempty
, numBombs = 1
, maxNumBombs = 2
, nextBomb = bombtimer
, health = 50
, money = 0
}
update :: Input Void -> Update Model Void ()
update = \case
Tick dt ->
tickUpdate dt
Key KeyArrowLeft ->
#blimpVel %= negate . abs
Key KeyArrowRight ->
#blimpVel %= abs
Key (KeyChar 'p') -> do
money <- use #money
maxNumPebbles <- use #maxNumPebbles
when (money >= 1 && maxNumPebbles < 5) $ do
#money %= subtract 1
#maxNumPebbles %= (+1)
Key (KeyChar 'b') -> do
money <- use #money
maxNumBombs <- use #maxNumBombs
when (money >= 3 && maxNumBombs < 5) $ do
#money %= subtract 3
#maxNumBombs %= (+1)
Key KeySpace -> do
supply <- use #numPebbles
blimpcol <- use #blimp
#pebble %=
if supply >= 1
then
Set.insert (blimpcol + 0.5, fromIntegral blimprow + 0.5)
else
id
#numPebbles %=
(max 0 . subtract 1)
Key (KeyChar '1') -> do
supply <- use #numBombs
blimpcol <- use #blimp
#bombs %=
if supply >= 1
then
Set.insert (blimpcol + 0.5, fromIntegral blimprow + 0.5)
else
id
#numBombs %=
(max 0 . subtract 1)
Key KeyEsc ->
empty
_ ->
pure ()
tickUpdate :: Seconds -> Update Model Void ()
tickUpdate dt = do
isCastleAlive
blimpDrifts dt
enemiesAdvance dt
stuffFallsDownward dt
removePebbledEnemies
removeBombedEnemies
enemiesHitCastle
possiblySpawnNewEnemy
updatePebbleSupply dt
updateBombSupply dt
isCastleAlive :: Update Model Void ()
isCastleAlive = do
health <- use #health
guard (health > 0)
blimpDrifts :: Seconds -> Update Model Void ()
blimpDrifts dt = do
blimpVel <- use #blimpVel
#blimp %= max 1 . min 55 . \x -> x + blimpVel * realToFrac dt
enemiesAdvance :: Seconds -> Update Model Void ()
enemiesAdvance dt =
#enemies %= Set.map (\x -> x + enemyvel * realToFrac dt)
stuffFallsDownward :: Seconds -> Update Model Void ()
stuffFallsDownward dt = do
#pebble %=
Set.filter ((\y -> y <= fromIntegral enemyrow + 1) . snd) .
Set.map (over _2 (\y -> y + pebblevel * realToFrac dt))
#bombs %=
Set.filter ((\y -> y <= fromIntegral enemyrow + 1) . snd) .
Set.map (over _2 (\y -> y + bombvel * realToFrac dt))
removePebbledEnemies :: Update Model Void ()
removePebbledEnemies = do
pebbles <- use #pebble
for_ pebbles $ \(pebblex, pebbley) -> do
when (floor pebbley == enemyrow) $ do
enemies <- use #enemies
let
(dead, alive) =
Set.partition
(\x -> x >= pebblex - 0.5 && x <= pebblex + 0.5)
enemies
#money %= (+ length dead)
#enemies .= alive
removeBombedEnemies :: Update Model Void ()
removeBombedEnemies = do
bombs <- use #bombs
for_ bombs $ \(bombx, bomby) -> do
when (floor bomby == enemyrow) $ do
enemies <- use #enemies
let
(dead, alive) =
Set.partition (\x -> x >= bombx - 1.5 && x <= bombx + 1.5) enemies
#enemies .= alive
#money %= (+ length dead)
enemiesHitCastle :: Update Model Void ()
enemiesHitCastle = do
enemies <- use #enemies
let
(splat, walking) =
Set.partition (\x -> floor x >= castlecol) enemies
#enemies .= walking
#health %= subtract (length splat)
possiblySpawnNewEnemy :: Update Model Void ()
possiblySpawnNewEnemy = do
pct <- randomPct
when (pct > 0.99) (#enemies %= Set.insert enemycol)
updatePebbleSupply :: Seconds -> Update Model Void ()
updatePebbleSupply dt = do
nextPebbleTimer <- use #nextPebble
maxNumPebbles <- use #maxNumPebbles
#numPebbles %=
if nextPebbleTimer <= 0
then min maxNumPebbles . (+1)
else id
#nextPebble %=
\timer ->
if timer <= 0
then timer - dt + pebbletimer
else timer - dt
updateBombSupply :: Seconds -> Update Model Void ()
updateBombSupply dt = do
nextBombTimer <- use #nextBomb
maxNumBombs <- use #maxNumBombs
#numBombs %=
if nextBombTimer <= 0
then min maxNumBombs . (+1)
else id
#nextBomb %=
\timer ->
if timer <= 0
then timer - dt + bombtimer
else timer - dt
view :: Model -> Scene
view model =
Scene cells NoCursor
where
cells :: Cells
cells =
mconcat
[ renderSky
, renderGround
, renderCastle
, renderBlimp (model ^. #blimp)
, renderPebbles (model ^. #pebble)
, renderBombs (model ^. #bombs)
, renderEnemies (model ^. #enemies)
, renderMoney (model ^. #money)
, renderNumPebbles (model ^. #numPebbles)
, renderNumBombs (model ^. #numBombs)
, renderHealth (model ^. #health)
]
renderSky = rect 0 0 60 (enemyrow+1) blue
renderGround = rect 0 (enemyrow+1) 60 10 green
renderCastle = rect castlecol 5 10 (enemyrow - 5 + 1) 253
renderBlimp :: X -> Cells
renderBlimp (round -> col) =
rect (col-1) (blimprow-1) 3 2 yellow
renderPebbles :: Set (X, Y) -> Cells
renderPebbles =
foldMap (\(floor -> c, floor -> r) -> set c r (Cell '‧' black blue)) .
Set.toList
renderBombs :: Set (X, Y) -> Cells
renderBombs =
foldMap render . Set.toList
where
render :: (X, Y) -> Cells
render (floor -> c, floor -> r) =
if r == enemyrow
then
rect (c-1) r 3 1 red
else
set c r (Cell '•' black blue)
renderEnemies :: Set X -> Cells
renderEnemies =
foldMap (\c -> set (round c) enemyrow (Cell '∞' black blue)) . Set.toList
renderMoney :: Int -> Cells
renderMoney money =
text 0 (enemyrow+11) white black ("Money: " ++ show money)
renderNumPebbles :: Int -> Cells
renderNumPebbles pebbles =
text 0 (enemyrow+12) white black ("Pebbles: " ++ replicate pebbles '‧')
renderNumBombs :: Int -> Cells
renderNumBombs bombs =
text 0 (enemyrow+13) white black ("Bombs: " ++ replicate bombs '•')
renderHealth :: Int -> Cells
renderHealth health =
text 0 (enemyrow+14) white black ("Health: " ++ show health)
tickEvery :: Model -> Maybe Seconds
tickEvery _ =
Just (1/30)
subscribe :: Model -> HashSet Text
subscribe _ =
mempty
game :: ElmGame Model Void
game =
ElmGame init update view tickEvery subscribe
|
cda861a412f1083ae15061fc5ebbf89c5d702d3dce46762c0d7654982cecfb1a | sacerdot/CovidMonitoring | server.erl | %%%---------------------------------------------------------------------
@doc Modulo server per il progetto del corso di .
%%% @end
%%%---------------------------------------------------------------------
-module(server).
-export([start/0]).
%%%-------------------------------------------------------------------
%%% @doc PROTOCOLLO DI INIZIALIZZAZIONE:
all'avvio si registra .
%%% @end
%%%-------------------------------------------------------------------
start() ->
global:register_name(server,self()),
io:format("Io sono il server~n",[]),
process_flag(trap_exit, true),
update_places([]).
%%%----------------------------------------------------------------------------
%%% @doc PROTOCOLLO DI MANTENIMENTO DELLA TOPOLOGIA:
1 ) Mantiene una lista dei luoghi attivi .
2 ) i , eliminandoli dalla lista questi muoiono
3 ) Risponde alle richieste ( degli utenti ) .
%%% @end
%%%----------------------------------------------------------------------------
update_places(PidList) ->
receive
{new_place, PidPlace} ->
update_places([PidPlace | PidList]);
{get_places, Pid} ->
Pid ! {places, PidList},
update_places(PidList);
{'EXIT', Pid, normal} ->
io:format("Sto per rimuovere ~p dalla lista dei luoghi~n", [Pid]),
update_places(PidList -- [Pid]);
{'EXIT', Pid, positive} ->
io:format("~p: esce perche' positivo al test~n", [Pid]),
update_places(PidList);
{'EXIT', Pid, quarantena} ->
io:format("~p: esce perche' va in quarantena~n", [Pid]),
update_places(PidList);
{'EXIT', Pid, Reason} ->
io:format("~p exit because ~p~n", [Pid, Reason]),
update_places(PidList -- [Pid]);
Other ->
io:format("Messaggio inaspettato: ~p~n", [Other]),
update_places(PidList)
end.
| null | https://raw.githubusercontent.com/sacerdot/CovidMonitoring/fe969cd51869bbe6479da509c9a6ab21d43e6d11/FabbrettiGrossi/src/server.erl | erlang | ---------------------------------------------------------------------
@end
---------------------------------------------------------------------
-------------------------------------------------------------------
@doc PROTOCOLLO DI INIZIALIZZAZIONE:
@end
-------------------------------------------------------------------
----------------------------------------------------------------------------
@doc PROTOCOLLO DI MANTENIMENTO DELLA TOPOLOGIA:
@end
---------------------------------------------------------------------------- | @doc Modulo server per il progetto del corso di .
-module(server).
-export([start/0]).
all'avvio si registra .
start() ->
global:register_name(server,self()),
io:format("Io sono il server~n",[]),
process_flag(trap_exit, true),
update_places([]).
1 ) Mantiene una lista dei luoghi attivi .
2 ) i , eliminandoli dalla lista questi muoiono
3 ) Risponde alle richieste ( degli utenti ) .
update_places(PidList) ->
receive
{new_place, PidPlace} ->
update_places([PidPlace | PidList]);
{get_places, Pid} ->
Pid ! {places, PidList},
update_places(PidList);
{'EXIT', Pid, normal} ->
io:format("Sto per rimuovere ~p dalla lista dei luoghi~n", [Pid]),
update_places(PidList -- [Pid]);
{'EXIT', Pid, positive} ->
io:format("~p: esce perche' positivo al test~n", [Pid]),
update_places(PidList);
{'EXIT', Pid, quarantena} ->
io:format("~p: esce perche' va in quarantena~n", [Pid]),
update_places(PidList);
{'EXIT', Pid, Reason} ->
io:format("~p exit because ~p~n", [Pid, Reason]),
update_places(PidList -- [Pid]);
Other ->
io:format("Messaggio inaspettato: ~p~n", [Other]),
update_places(PidList)
end.
|
c80f5ebf4a28139f4c8693183ed60aca28a44261f7d43670aa37c80c70ed885c | haskell/cabal | Hpc.hs | # LANGUAGE FlexibleContexts #
{-# LANGUAGE RankNTypes #-}
-----------------------------------------------------------------------------
-- |
-- Module : Distribution.Simple.Hpc
-- Copyright : Thomas Tuegel 2011
-- License : BSD3
--
-- Maintainer :
-- Portability : portable
--
This module provides functions for locating various HPC - related paths and
-- a function for adding the necessary options to a PackageDescription to
build test suites with HPC enabled .
module Distribution.Simple.Hpc
( Way(..), guessWay
, htmlDir
, mixDir
, tixDir
, tixFilePath
, markupPackage
, markupTest
) where
import Prelude ()
import Distribution.Compat.Prelude
import Distribution.Types.UnqualComponentName
import Distribution.ModuleName ( main )
import qualified Distribution.PackageDescription as PD
import Distribution.PackageDescription
( Library(..)
, TestSuite(..)
, testModules
)
import Distribution.Pretty
import Distribution.Simple.LocalBuildInfo ( LocalBuildInfo(..) )
import Distribution.Simple.Program
( hpcProgram
, requireProgramVersion
)
import Distribution.Simple.Program.Hpc ( markup, union )
import Distribution.Simple.Utils ( notice )
import Distribution.Version ( anyVersion )
import Distribution.Verbosity ( Verbosity() )
import System.Directory ( createDirectoryIfMissing, doesFileExist )
import System.FilePath
-- -------------------------------------------------------------------------
-- Haskell Program Coverage
data Way = Vanilla | Prof | Dyn
deriving (Bounded, Enum, Eq, Read, Show)
hpcDir :: FilePath -- ^ \"dist/\" prefix
-> Way
^ Directory containing component 's HPC .mix files
hpcDir distPref way = distPref </> "hpc" </> wayDir
where
wayDir = case way of
Vanilla -> "vanilla"
Prof -> "prof"
Dyn -> "dyn"
mixDir :: FilePath -- ^ \"dist/\" prefix
-> Way
-> FilePath -- ^ Component name
^ Directory containing test suite 's .mix files
mixDir distPref way name = hpcDir distPrefBuild way </> "mix" </> name
where
This is a hack for HPC over test suites , needed to match the directory
where HPC saves and reads .mix files when the main library of the same
package is being processed , perhaps in a previous cabal run ( # 5213 ) .
E.g. , may be
-- @./dist-newstyle/build/x86_64-linux/ghc-9.0.1/cabal-gh5213-0.1/t/tests@
but the path where library mix files reside has two less components
at the end ( @t / tests@ ) and this reduced path needs to be passed to
both and @ghc@. For non - default optimization levels , the path
suffix is one element longer and the extra path element needs
-- to be preserved.
distPrefElements = splitDirectories distPref
distPrefBuild = case drop (length distPrefElements - 3) distPrefElements of
["t", _, "noopt"] ->
joinPath $ take (length distPrefElements - 3) distPrefElements
++ ["noopt"]
["t", _, "opt"] ->
joinPath $ take (length distPrefElements - 3) distPrefElements
++ ["opt"]
[_, "t", _] ->
joinPath $ take (length distPrefElements - 2) distPrefElements
_ -> distPref
tixDir :: FilePath -- ^ \"dist/\" prefix
-> Way
-> FilePath -- ^ Component name
-> FilePath -- ^ Directory containing test suite's .tix files
tixDir distPref way name = hpcDir distPref way </> "tix" </> name
-- | Path to the .tix file containing a test suite's sum statistics.
tixFilePath :: FilePath -- ^ \"dist/\" prefix
-> Way
-> FilePath -- ^ Component name
-> FilePath -- ^ Path to test suite's .tix file
tixFilePath distPref way name = tixDir distPref way name </> name <.> "tix"
htmlDir :: FilePath -- ^ \"dist/\" prefix
-> Way
-> FilePath -- ^ Component name
-> FilePath -- ^ Path to test suite's HTML markup directory
htmlDir distPref way name = hpcDir distPref way </> "html" </> name
-- | Attempt to guess the way the test suites in this package were compiled
-- and linked with the library so the correct module interfaces are found.
guessWay :: LocalBuildInfo -> Way
guessWay lbi
| withProfExe lbi = Prof
| withDynExe lbi = Dyn
| otherwise = Vanilla
-- | Generate the HTML markup for a test suite.
markupTest :: Verbosity
-> LocalBuildInfo
-> FilePath -- ^ \"dist/\" prefix
-> String -- ^ Library name
-> TestSuite
-> Library
-> IO ()
markupTest verbosity lbi distPref libraryName suite library = do
tixFileExists <- doesFileExist $ tixFilePath distPref way $ testName'
when tixFileExists $ do
-- behaviour of 'markup' depends on version, so we need *a* version
-- but no particular one
(hpc, hpcVer, _) <- requireProgramVersion verbosity
hpcProgram anyVersion (withPrograms lbi)
let htmlDir_ = htmlDir distPref way testName'
markup hpc hpcVer verbosity
(tixFilePath distPref way testName') mixDirs
htmlDir_
(exposedModules library)
notice verbosity $ "Test coverage report written to "
++ htmlDir_ </> "hpc_index" <.> "html"
where
way = guessWay lbi
testName' = unUnqualComponentName $ testName suite
mixDirs = map (mixDir distPref way) [ testName', libraryName ]
-- | Generate the HTML markup for all of a package's test suites.
markupPackage :: Verbosity
-> LocalBuildInfo
-> FilePath -- ^ \"dist/\" prefix
-> PD.PackageDescription
-> [TestSuite]
-> IO ()
markupPackage verbosity lbi distPref pkg_descr suites = do
let tixFiles = map (tixFilePath distPref way) testNames
tixFilesExist <- traverse doesFileExist tixFiles
when (and tixFilesExist) $ do
-- behaviour of 'markup' depends on version, so we need *a* version
-- but no particular one
(hpc, hpcVer, _) <- requireProgramVersion verbosity
hpcProgram anyVersion (withPrograms lbi)
let outFile = tixFilePath distPref way libraryName
htmlDir' = htmlDir distPref way libraryName
excluded = concatMap testModules suites ++ [ main ]
createDirectoryIfMissing True $ takeDirectory outFile
union hpc verbosity tixFiles outFile excluded
markup hpc hpcVer verbosity outFile mixDirs htmlDir' included
notice verbosity $ "Package coverage report written to "
++ htmlDir' </> "hpc_index.html"
where
way = guessWay lbi
testNames = fmap (unUnqualComponentName . testName) suites
mixDirs = map (mixDir distPref way) $ libraryName : testNames
included = concatMap (exposedModules) $ PD.allLibraries pkg_descr
libraryName = prettyShow $ PD.package pkg_descr
| null | https://raw.githubusercontent.com/haskell/cabal/496d6fcc26779e754523a6cc7576aea49ef8056e/Cabal/src/Distribution/Simple/Hpc.hs | haskell | # LANGUAGE RankNTypes #
---------------------------------------------------------------------------
|
Module : Distribution.Simple.Hpc
Copyright : Thomas Tuegel 2011
License : BSD3
Maintainer :
Portability : portable
a function for adding the necessary options to a PackageDescription to
-------------------------------------------------------------------------
Haskell Program Coverage
^ \"dist/\" prefix
^ \"dist/\" prefix
^ Component name
@./dist-newstyle/build/x86_64-linux/ghc-9.0.1/cabal-gh5213-0.1/t/tests@
to be preserved.
^ \"dist/\" prefix
^ Component name
^ Directory containing test suite's .tix files
| Path to the .tix file containing a test suite's sum statistics.
^ \"dist/\" prefix
^ Component name
^ Path to test suite's .tix file
^ \"dist/\" prefix
^ Component name
^ Path to test suite's HTML markup directory
| Attempt to guess the way the test suites in this package were compiled
and linked with the library so the correct module interfaces are found.
| Generate the HTML markup for a test suite.
^ \"dist/\" prefix
^ Library name
behaviour of 'markup' depends on version, so we need *a* version
but no particular one
| Generate the HTML markup for all of a package's test suites.
^ \"dist/\" prefix
behaviour of 'markup' depends on version, so we need *a* version
but no particular one | # LANGUAGE FlexibleContexts #
This module provides functions for locating various HPC - related paths and
build test suites with HPC enabled .
module Distribution.Simple.Hpc
( Way(..), guessWay
, htmlDir
, mixDir
, tixDir
, tixFilePath
, markupPackage
, markupTest
) where
import Prelude ()
import Distribution.Compat.Prelude
import Distribution.Types.UnqualComponentName
import Distribution.ModuleName ( main )
import qualified Distribution.PackageDescription as PD
import Distribution.PackageDescription
( Library(..)
, TestSuite(..)
, testModules
)
import Distribution.Pretty
import Distribution.Simple.LocalBuildInfo ( LocalBuildInfo(..) )
import Distribution.Simple.Program
( hpcProgram
, requireProgramVersion
)
import Distribution.Simple.Program.Hpc ( markup, union )
import Distribution.Simple.Utils ( notice )
import Distribution.Version ( anyVersion )
import Distribution.Verbosity ( Verbosity() )
import System.Directory ( createDirectoryIfMissing, doesFileExist )
import System.FilePath
data Way = Vanilla | Prof | Dyn
deriving (Bounded, Enum, Eq, Read, Show)
-> Way
^ Directory containing component 's HPC .mix files
hpcDir distPref way = distPref </> "hpc" </> wayDir
where
wayDir = case way of
Vanilla -> "vanilla"
Prof -> "prof"
Dyn -> "dyn"
-> Way
^ Directory containing test suite 's .mix files
mixDir distPref way name = hpcDir distPrefBuild way </> "mix" </> name
where
This is a hack for HPC over test suites , needed to match the directory
where HPC saves and reads .mix files when the main library of the same
package is being processed , perhaps in a previous cabal run ( # 5213 ) .
E.g. , may be
but the path where library mix files reside has two less components
at the end ( @t / tests@ ) and this reduced path needs to be passed to
both and @ghc@. For non - default optimization levels , the path
suffix is one element longer and the extra path element needs
distPrefElements = splitDirectories distPref
distPrefBuild = case drop (length distPrefElements - 3) distPrefElements of
["t", _, "noopt"] ->
joinPath $ take (length distPrefElements - 3) distPrefElements
++ ["noopt"]
["t", _, "opt"] ->
joinPath $ take (length distPrefElements - 3) distPrefElements
++ ["opt"]
[_, "t", _] ->
joinPath $ take (length distPrefElements - 2) distPrefElements
_ -> distPref
-> Way
tixDir distPref way name = hpcDir distPref way </> "tix" </> name
-> Way
tixFilePath distPref way name = tixDir distPref way name </> name <.> "tix"
-> Way
htmlDir distPref way name = hpcDir distPref way </> "html" </> name
guessWay :: LocalBuildInfo -> Way
guessWay lbi
| withProfExe lbi = Prof
| withDynExe lbi = Dyn
| otherwise = Vanilla
markupTest :: Verbosity
-> LocalBuildInfo
-> TestSuite
-> Library
-> IO ()
markupTest verbosity lbi distPref libraryName suite library = do
tixFileExists <- doesFileExist $ tixFilePath distPref way $ testName'
when tixFileExists $ do
(hpc, hpcVer, _) <- requireProgramVersion verbosity
hpcProgram anyVersion (withPrograms lbi)
let htmlDir_ = htmlDir distPref way testName'
markup hpc hpcVer verbosity
(tixFilePath distPref way testName') mixDirs
htmlDir_
(exposedModules library)
notice verbosity $ "Test coverage report written to "
++ htmlDir_ </> "hpc_index" <.> "html"
where
way = guessWay lbi
testName' = unUnqualComponentName $ testName suite
mixDirs = map (mixDir distPref way) [ testName', libraryName ]
markupPackage :: Verbosity
-> LocalBuildInfo
-> PD.PackageDescription
-> [TestSuite]
-> IO ()
markupPackage verbosity lbi distPref pkg_descr suites = do
let tixFiles = map (tixFilePath distPref way) testNames
tixFilesExist <- traverse doesFileExist tixFiles
when (and tixFilesExist) $ do
(hpc, hpcVer, _) <- requireProgramVersion verbosity
hpcProgram anyVersion (withPrograms lbi)
let outFile = tixFilePath distPref way libraryName
htmlDir' = htmlDir distPref way libraryName
excluded = concatMap testModules suites ++ [ main ]
createDirectoryIfMissing True $ takeDirectory outFile
union hpc verbosity tixFiles outFile excluded
markup hpc hpcVer verbosity outFile mixDirs htmlDir' included
notice verbosity $ "Package coverage report written to "
++ htmlDir' </> "hpc_index.html"
where
way = guessWay lbi
testNames = fmap (unUnqualComponentName . testName) suites
mixDirs = map (mixDir distPref way) $ libraryName : testNames
included = concatMap (exposedModules) $ PD.allLibraries pkg_descr
libraryName = prettyShow $ PD.package pkg_descr
|
d90d949c40dd59cc019a3e575eb3cadf2d423d56a11346c6f458902fc25dbefc | brick-lang/kiln | frontend.ml |
module Lexer = Lexer
module ParseTree = ParseTree
module Parser = struct
include Parser
module Error = ParserError
end
| null | https://raw.githubusercontent.com/brick-lang/kiln/21ec6fe8dfd2a807e514c9a794abbf48a7836ab3/frontend/frontend.ml | ocaml |
module Lexer = Lexer
module ParseTree = ParseTree
module Parser = struct
include Parser
module Error = ParserError
end
| |
37daa7caf6f752a7ca88a097debd667986f1185b098313530babfc0dd311ad44 | janestreet/core | time_ns_intf.ml | open! Import
module type Span = sig
* [ t ] is immediate on 64bit boxes and so plays nicely with the GC write barrier .
type t = private Int63.t [@@deriving hash]
include Span_intf.S with type underlying = Int63.t and type t := t
val of_sec_with_microsecond_precision : float -> t
val of_int_us : int -> t
val of_int_ms : int -> t
val to_int_us : t -> int
val to_int_ms : t -> int
val to_int_sec : t -> int
(** The minimum representable time span. *)
val min_value_representable : t
(** The maximum representable time span. *)
val max_value_representable : t
* The minimum span that rounds to a [ Time . ] with microsecond precision .
val min_value_for_1us_rounding : t
* The maximum span that rounds to a [ Time . ] with microsecond precision .
val max_value_for_1us_rounding : t
(** An alias for [min_value_for_1us_rounding]. *)
val min_value : t
[@@deprecated
"[since 2019-02] use [min_value_representable] or [min_value_for_1us_rounding] \
instead"]
(** An alias for [max_value_for_1us_rounding]. *)
val max_value : t
[@@deprecated
"[since 2019-02] use [max_value_representable] or [max_value_for_1us_rounding] \
instead"]
(** overflows silently *)
val scale_int : t -> int -> t
(** overflows silently *)
val scale_int63 : t -> Int63.t -> t
(** Rounds down, and raises unless denominator is positive. *)
val div : t -> t -> Int63.t
(** Fast, implemented as the identity function. *)
val to_int63_ns : t -> Int63.t
(** Fast, implemented as the identity function. *)
val of_int63_ns : Int63.t -> t
* Will raise on 32 - bit platforms . Consider [ ] instead .
val to_int_ns : t -> int
val of_int_ns : int -> t
val since_unix_epoch : unit -> t
val random : ?state:Random.State.t -> unit -> t
* WARNING ! ! ! [ to_span ] and [ of_span ] both round to the nearest 1us .
Around 135y magnitudes [ to_span ] and [ of_span ] raise .
Around 135y magnitudes [to_span] and [of_span] raise.
*)
val to_span : t -> Span_float.t
[@@deprecated
"[since 2019-01] use [to_span_float_round_nearest] or \
[to_span_float_round_nearest_microsecond]"]
val of_span : Span_float.t -> t
[@@deprecated
"[since 2019-01] use [of_span_float_round_nearest] or \
[of_span_float_round_nearest_microsecond]"]
(** [*_round_nearest] vs [*_round_nearest_microsecond]: If you don't know that you need
microsecond precision, use the [*_round_nearest] version.
[*_round_nearest_microsecond] is for historical purposes. *)
val to_span_float_round_nearest : t -> Span_float.t
val to_span_float_round_nearest_microsecond : t -> Span_float.t
val of_span_float_round_nearest : Span_float.t -> t
val of_span_float_round_nearest_microsecond : Span_float.t -> t
(** Note that we expose a sexp format that is not the one exposed in [Core]. *)
module Alternate_sexp : sig
type nonrec t = t [@@deriving sexp, sexp_grammar]
end
[@@deprecated "[since 2018-04] use [Span.sexp_of_t] and [Span.t_of_sexp] instead"]
val arg_type : t Command.Arg_type.t
* [ Span . ] is like [ option ] , except that the value is immediate on
architectures where [ Int63.t ] is immediate . This module should mainly be used to
avoid allocations .
architectures where [Int63.t] is immediate. This module should mainly be used to
avoid allocations. *)
module Option : sig
include Immediate_option.S_int63 with type value := t
include Identifiable.S with type t := t
include Quickcheck.S with type t := t
module Stable : sig
module V1 : Stable_int63able.With_stable_witness.S with type t = t
module V2 : Stable_int63able.With_stable_witness.S with type t = t
end
end
module Stable : sig
module V1 : sig
type nonrec t = t [@@deriving hash, equal]
include Stable_int63able.With_stable_witness.S with type t := t
end
module V2 : sig
type nonrec t = t [@@deriving hash, equal, sexp_grammar]
type nonrec comparator_witness = comparator_witness
include
Stable_int63able.With_stable_witness.S
with type t := t
with type comparator_witness := comparator_witness
include
Comparable.Stable.V1.With_stable_witness.S
with type comparable := t
with type comparator_witness := comparator_witness
include Stringable.S with type t := t
end
end
(*_ See the Jane Street Style Guide for an explanation of [Private] submodules:
/#private-submodules *)
module Private : sig
val of_parts : Parts.t -> t
val to_parts : t -> Parts.t
end
end
module type Ofday = sig
module Span : Span
* [ t ] is immediate on 64bit boxes and so plays nicely with the GC write barrier .
type t = private Int63.t
* String and sexp output takes the form ' HH : MM : SS.sssssssss ' ; see
{ ! Core . Ofday_intf } for accepted input . If input includes more than 9 decimal
places in seconds , rounds to the nearest nanosecond , with the midpoint rounded up .
Allows 60[.sss ... ] seconds for leap seconds but treats it as exactly 60s regardless
of fractional part .
{!Core.Ofday_intf} for accepted input. If input includes more than 9 decimal
places in seconds, rounds to the nearest nanosecond, with the midpoint rounded up.
Allows 60[.sss...] seconds for leap seconds but treats it as exactly 60s regardless
of fractional part. *)
include
Ofday_intf.S with type underlying = Int63.t and type t := t and module Span := Span
* The largest representable value below [ start_of_next_day ] , i.e. one nanosecond
before midnight .
before midnight. *)
val approximate_end_of_day : t
_ This is already exported from [ Ofday_intf . S ] , but we re - declare it to add
documentation .
documentation. *)
* [ add_exn t span ] shifts the time of day [ t ] by [ span ] . It raises if the result is
not in the same 24 - hour day . Daylight savings shifts are not accounted for .
not in the same 24-hour day. Daylight savings shifts are not accounted for. *)
val add_exn : t -> Span.t -> t
* [ sub_exn t span ] shifts the time of day [ t ] back by [ span ] . It raises if the result
is not in the same 24 - hour day . Daylight savings shifts are not accounted for .
is not in the same 24-hour day. Daylight savings shifts are not accounted for. *)
val sub_exn : t -> Span.t -> t
* [ every span ~start ~stop ] returns a sorted list of all [ t]s that can be expressed as
[ start + ( i * span ) ] without overflow , and satisfying [ t > = start & & t < = stop ] .
If [ span < = Span.zero || start > stop ] , returns an Error .
The result never crosses the midnight boundary . Constructing a list crossing
midnight , e.g. every hour from 10 pm to 2 am , requires multiple calls to [ every ] .
[start + (i * span)] without overflow, and satisfying [t >= start && t <= stop].
If [span <= Span.zero || start > stop], returns an Error.
The result never crosses the midnight boundary. Constructing a list crossing
midnight, e.g. every hour from 10pm to 2am, requires multiple calls to [every]. *)
val every : Span.t -> start:t -> stop:t -> t list Or_error.t
val to_microsecond_string : t -> string
val arg_type : [ `Use_Time_ns_unix ] [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val now : [ `Use_Time_ns_unix ] [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val of_ofday_float_round_nearest : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val of_ofday_float_round_nearest_microsecond : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val to_ofday_float_round_nearest : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val to_ofday_float_round_nearest_microsecond : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
module Option : sig end [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
module Zoned : sig end [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
end
* Time represented as an [ Int63.t ] number of nanoseconds since the epoch .
See { ! Time_ns_unix } for important user documentation .
Internally , arithmetic is not overflow - checked . Instead , overflows are silently
ignored as for [ int ] arithmetic , unless specifically documented otherwise . Conversions
may ( or may not ) raise if prior arithmetic operations overflowed .
See {!Time_ns_unix} for important user documentation.
Internally, arithmetic is not overflow-checked. Instead, overflows are silently
ignored as for [int] arithmetic, unless specifically documented otherwise. Conversions
may (or may not) raise if prior arithmetic operations overflowed. *)
module type Time_ns = sig
module Span : Span
module Ofday : Ofday with module Span := Span
type t = private Int63.t [@@deriving hash, typerep, bin_io]
include Comparisons.S with type t := t
(** Note that we expose a sexp format that is not the one exposed in [Core]. *)
module Alternate_sexp : sig
type nonrec t = t [@@deriving compare, equal, hash, sexp, sexp_grammar]
include Comparable.S with type t := t
end
include
Time_intf.Shared with type t := t with module Span := Span with module Ofday := Ofday
val of_string : string -> t
[@@deprecated
"[since 2021-04] Use [of_string_with_utc_offset] or [Time_ns_unix.of_string]"]
* [ of_string_with_utc_offset ] requires its input to have an explicit
UTC offset , e.g. [ 2000 - 01 - 01 12:34:56.789012 - 23 ] , or use the UTC zone , " Z " ,
e.g. [ 2000 - 01 - 01 12:34:56.789012Z ] .
UTC offset, e.g. [2000-01-01 12:34:56.789012-23], or use the UTC zone, "Z",
e.g. [2000-01-01 12:34:56.789012Z]. *)
val of_string_with_utc_offset : string -> t
val to_string : t -> string
[@@deprecated "[since 2021-04] Use [to_string_utc] or [Time_ns_unix.to_string]"]
* [ to_string_utc ] generates a time string with the UTC zone , " Z " , e.g. [ 2000 - 01 - 01
12:34:56.789012Z ] .
12:34:56.789012Z]. *)
val to_string_utc : t -> string
* Unix epoch ( 1970 - 01 - 01 00:00:00 UTC )
val epoch : t
(** The minimum representable time. *)
val min_value_representable : t
(** The maximum representable time. *)
val max_value_representable : t
(** The minimum time that rounds to a [Time.t] with microsecond precision. *)
val min_value_for_1us_rounding : t
(** The maximum time that rounds to a [Time.t] with microsecond precision. *)
val max_value_for_1us_rounding : t
(** An alias for [min_value_for_1us_rounding]. *)
val min_value : t
[@@deprecated
"[since 2019-02] use [min_value_representable] or [min_value_for_1us_rounding] \
instead"]
(** An alias for [max_value_for_1us_rounding]. *)
val max_value : t
[@@deprecated
"[since 2019-02] use [max_value_representable] or [max_value_for_1us_rounding] \
instead"]
(** The current time. *)
val now : unit -> t
(** overflows silently *)
val add : t -> Span.t -> t
(** As [add]; rather than over/underflowing, clamps the result to the closed interval
between [min_value_representable] and [max_value_representable]. *)
val add_saturating : t -> Span.t -> t
(** As [sub]; rather than over/underflowing, clamps the result to the closed interval
between [min_value_representable] and [max_value_representable]. *)
val sub_saturating : t -> Span.t -> t
(** overflows silently *)
val sub : t -> Span.t -> t
(** overflows silently *)
val next : t -> t
(** overflows silently *)
val prev : t -> t
(** overflows silently *)
val diff : t -> t -> Span.t
(** overflows silently *)
val abs_diff : t -> t -> Span.t
val to_span_since_epoch : t -> Span.t
val of_span_since_epoch : Span.t -> t
val to_int63_ns_since_epoch : t -> Int63.t
val of_int63_ns_since_epoch : Int63.t -> t
* Will raise on 32 - bit platforms . Consider [ to_int63_ns_since_epoch ] instead .
val to_int_ns_since_epoch : t -> int
val of_int_ns_since_epoch : int -> t
(** [next_multiple ~base ~after ~interval] returns the smallest [time] of the form:
{[
time = base + k * interval
]}
where [k >= 0] and [time > after]. It is an error if [interval <= 0].
Supplying [~can_equal_after:true] allows the result to satisfy [time >= after].
Overflows silently. *)
val next_multiple
: ?can_equal_after:bool (** default is [false] *)
-> base:t
-> after:t
-> interval:Span.t
-> unit
-> t
* [ ~before ~interval ] returns the largest [ time ] of the form :
{ [
time = base + k * interval
] }
where [ k > = 0 ] and [ time < before ] . It is an error if [ interval < = 0 ] .
Supplying [ ~can_equal_before : true ] allows the result to satisfy [ time < = before ] .
{[
time = base + k * interval
]}
where [k >= 0] and [time < before]. It is an error if [interval <= 0].
Supplying [~can_equal_before:true] allows the result to satisfy [time <= before].
*)
val prev_multiple
: ?can_equal_before:bool (** default is [false] *)
-> base:t
-> before:t
-> interval:Span.t
-> unit
-> t
val random : ?state:Random.State.t -> unit -> t
val of_time : Time_float.t -> t
[@@deprecated
"[since 2019-01] use [of_time_float_round_nearest] or \
[of_time_float_round_nearest_microsecond]"]
val to_time : t -> Time_float.t
[@@deprecated
"[since 2019-01] use [to_time_float_round_nearest] or \
[to_time_float_round_nearest_microsecond]"]
(** [*_round_nearest] vs [*_round_nearest_microsecond]: If you don't know that you need
microsecond precision, use the [*_round_nearest] version.
[*_round_nearest_microsecond] is for historical purposes. *)
val to_time_float_round_nearest : t -> Time_float.t
val to_time_float_round_nearest_microsecond : t -> Time_float.t
val of_time_float_round_nearest : Time_float.t -> t
val of_time_float_round_nearest_microsecond : Time_float.t -> t
module Utc : sig
* [ to_date_and_span_since_start_of_day ] computes the date and intraday - offset of a
time in UTC . It may be slower than [ Core . Time_ns.to_date_ofday ] , as this
function does not cache partial results while the latter does .
time in UTC. It may be slower than [Core.Time_ns.to_date_ofday], as this
function does not cache partial results while the latter does. *)
val to_date_and_span_since_start_of_day : t -> Date0.t * Span.t
(** The inverse of [to_date_and_span_since_start_of_day]. *)
val of_date_and_span_since_start_of_day : Date0.t -> Span.t -> t
end
module Stable : sig
module V1 : sig end
[@@deprecated "[since 2021-03] Use [Time_ns_unix] or [Time_ns.Alternate_sexp]"]
module Option : sig end [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
module Alternate_sexp : sig
module V1 : sig
type t = Alternate_sexp.t
[@@deriving bin_io, compare, hash, sexp, sexp_grammar, stable_witness]
include
Comparator.Stable.V1.S
with type t := t
and type comparator_witness = Alternate_sexp.comparator_witness
include
Comparable.Stable.V1.With_stable_witness.S
with type comparable := t
with type comparator_witness := comparator_witness
end
end
module Span : sig
module V1 : sig
type nonrec t = Span.t [@@deriving hash, equal]
include Stable_int63able.With_stable_witness.S with type t := t
end
module Option : sig end [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
module V2 : sig
type t = Span.t [@@deriving hash, equal, sexp_grammar]
type nonrec comparator_witness = Span.comparator_witness
include
Stable_int63able.With_stable_witness.S
with type t := t
with type comparator_witness := comparator_witness
include
Comparable.Stable.V1.With_stable_witness.S
with type comparable := t
with type comparator_witness := comparator_witness
include Stringable.S with type t := t
end
end
module Ofday : sig
module V1 :
Stable_int63able.With_stable_witness.S
with type t = Ofday.t
and type comparator_witness = Ofday.comparator_witness
module Option : sig end [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
module Zoned : sig end [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
end
end
module Hash_queue : sig end [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
module Hash_set : sig end [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
module Map : sig end [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
module Option : sig end [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
module Replace_polymorphic_compare : sig end
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
module Set : sig end [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
module Table : sig end [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
module Zone : sig end [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val arg_type : [ `Use_Time_ns_unix ] [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val comparator : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val get_sexp_zone : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val interruptible_pause : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val of_date_ofday_zoned : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val of_string_abs : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val of_string_fix_proto : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val pause : [ `Use_Time_ns_unix ] [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val pause_forever : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val pp : [ `Use_Time_ns_unix ] [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val set_sexp_zone : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val sexp_of_t : [ `Use_Time_ns_unix_or_Time_ns_alternate_sexp ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix] or [Time_ns.Alternate_sexp]"]
val sexp_of_t_abs : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val t_of_sexp : [ `Use_Time_ns_unix_or_Time_ns_alternate_sexp ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix] or [Time_ns.Alternate_sexp]"]
val t_of_sexp_abs : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val to_date_ofday_zoned : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val to_ofday_zoned : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val to_string_fix_proto : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val validate_bound : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val validate_lbound : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val validate_ubound : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
end
| null | https://raw.githubusercontent.com/janestreet/core/f382131ccdcb4a8cd21ebf9a49fa42dcf8183de6/core/src/time_ns_intf.ml | ocaml | * The minimum representable time span.
* The maximum representable time span.
* An alias for [min_value_for_1us_rounding].
* An alias for [max_value_for_1us_rounding].
* overflows silently
* overflows silently
* Rounds down, and raises unless denominator is positive.
* Fast, implemented as the identity function.
* Fast, implemented as the identity function.
* [*_round_nearest] vs [*_round_nearest_microsecond]: If you don't know that you need
microsecond precision, use the [*_round_nearest] version.
[*_round_nearest_microsecond] is for historical purposes.
* Note that we expose a sexp format that is not the one exposed in [Core].
_ See the Jane Street Style Guide for an explanation of [Private] submodules:
/#private-submodules
* Note that we expose a sexp format that is not the one exposed in [Core].
* The minimum representable time.
* The maximum representable time.
* The minimum time that rounds to a [Time.t] with microsecond precision.
* The maximum time that rounds to a [Time.t] with microsecond precision.
* An alias for [min_value_for_1us_rounding].
* An alias for [max_value_for_1us_rounding].
* The current time.
* overflows silently
* As [add]; rather than over/underflowing, clamps the result to the closed interval
between [min_value_representable] and [max_value_representable].
* As [sub]; rather than over/underflowing, clamps the result to the closed interval
between [min_value_representable] and [max_value_representable].
* overflows silently
* overflows silently
* overflows silently
* overflows silently
* overflows silently
* [next_multiple ~base ~after ~interval] returns the smallest [time] of the form:
{[
time = base + k * interval
]}
where [k >= 0] and [time > after]. It is an error if [interval <= 0].
Supplying [~can_equal_after:true] allows the result to satisfy [time >= after].
Overflows silently.
* default is [false]
* default is [false]
* [*_round_nearest] vs [*_round_nearest_microsecond]: If you don't know that you need
microsecond precision, use the [*_round_nearest] version.
[*_round_nearest_microsecond] is for historical purposes.
* The inverse of [to_date_and_span_since_start_of_day]. | open! Import
module type Span = sig
* [ t ] is immediate on 64bit boxes and so plays nicely with the GC write barrier .
type t = private Int63.t [@@deriving hash]
include Span_intf.S with type underlying = Int63.t and type t := t
val of_sec_with_microsecond_precision : float -> t
val of_int_us : int -> t
val of_int_ms : int -> t
val to_int_us : t -> int
val to_int_ms : t -> int
val to_int_sec : t -> int
val min_value_representable : t
val max_value_representable : t
* The minimum span that rounds to a [ Time . ] with microsecond precision .
val min_value_for_1us_rounding : t
* The maximum span that rounds to a [ Time . ] with microsecond precision .
val max_value_for_1us_rounding : t
val min_value : t
[@@deprecated
"[since 2019-02] use [min_value_representable] or [min_value_for_1us_rounding] \
instead"]
val max_value : t
[@@deprecated
"[since 2019-02] use [max_value_representable] or [max_value_for_1us_rounding] \
instead"]
val scale_int : t -> int -> t
val scale_int63 : t -> Int63.t -> t
val div : t -> t -> Int63.t
val to_int63_ns : t -> Int63.t
val of_int63_ns : Int63.t -> t
* Will raise on 32 - bit platforms . Consider [ ] instead .
val to_int_ns : t -> int
val of_int_ns : int -> t
val since_unix_epoch : unit -> t
val random : ?state:Random.State.t -> unit -> t
* WARNING ! ! ! [ to_span ] and [ of_span ] both round to the nearest 1us .
Around 135y magnitudes [ to_span ] and [ of_span ] raise .
Around 135y magnitudes [to_span] and [of_span] raise.
*)
val to_span : t -> Span_float.t
[@@deprecated
"[since 2019-01] use [to_span_float_round_nearest] or \
[to_span_float_round_nearest_microsecond]"]
val of_span : Span_float.t -> t
[@@deprecated
"[since 2019-01] use [of_span_float_round_nearest] or \
[of_span_float_round_nearest_microsecond]"]
val to_span_float_round_nearest : t -> Span_float.t
val to_span_float_round_nearest_microsecond : t -> Span_float.t
val of_span_float_round_nearest : Span_float.t -> t
val of_span_float_round_nearest_microsecond : Span_float.t -> t
module Alternate_sexp : sig
type nonrec t = t [@@deriving sexp, sexp_grammar]
end
[@@deprecated "[since 2018-04] use [Span.sexp_of_t] and [Span.t_of_sexp] instead"]
val arg_type : t Command.Arg_type.t
* [ Span . ] is like [ option ] , except that the value is immediate on
architectures where [ Int63.t ] is immediate . This module should mainly be used to
avoid allocations .
architectures where [Int63.t] is immediate. This module should mainly be used to
avoid allocations. *)
module Option : sig
include Immediate_option.S_int63 with type value := t
include Identifiable.S with type t := t
include Quickcheck.S with type t := t
module Stable : sig
module V1 : Stable_int63able.With_stable_witness.S with type t = t
module V2 : Stable_int63able.With_stable_witness.S with type t = t
end
end
module Stable : sig
module V1 : sig
type nonrec t = t [@@deriving hash, equal]
include Stable_int63able.With_stable_witness.S with type t := t
end
module V2 : sig
type nonrec t = t [@@deriving hash, equal, sexp_grammar]
type nonrec comparator_witness = comparator_witness
include
Stable_int63able.With_stable_witness.S
with type t := t
with type comparator_witness := comparator_witness
include
Comparable.Stable.V1.With_stable_witness.S
with type comparable := t
with type comparator_witness := comparator_witness
include Stringable.S with type t := t
end
end
module Private : sig
val of_parts : Parts.t -> t
val to_parts : t -> Parts.t
end
end
module type Ofday = sig
module Span : Span
* [ t ] is immediate on 64bit boxes and so plays nicely with the GC write barrier .
type t = private Int63.t
* String and sexp output takes the form ' HH : MM : SS.sssssssss ' ; see
{ ! Core . Ofday_intf } for accepted input . If input includes more than 9 decimal
places in seconds , rounds to the nearest nanosecond , with the midpoint rounded up .
Allows 60[.sss ... ] seconds for leap seconds but treats it as exactly 60s regardless
of fractional part .
{!Core.Ofday_intf} for accepted input. If input includes more than 9 decimal
places in seconds, rounds to the nearest nanosecond, with the midpoint rounded up.
Allows 60[.sss...] seconds for leap seconds but treats it as exactly 60s regardless
of fractional part. *)
include
Ofday_intf.S with type underlying = Int63.t and type t := t and module Span := Span
* The largest representable value below [ start_of_next_day ] , i.e. one nanosecond
before midnight .
before midnight. *)
val approximate_end_of_day : t
_ This is already exported from [ Ofday_intf . S ] , but we re - declare it to add
documentation .
documentation. *)
* [ add_exn t span ] shifts the time of day [ t ] by [ span ] . It raises if the result is
not in the same 24 - hour day . Daylight savings shifts are not accounted for .
not in the same 24-hour day. Daylight savings shifts are not accounted for. *)
val add_exn : t -> Span.t -> t
* [ sub_exn t span ] shifts the time of day [ t ] back by [ span ] . It raises if the result
is not in the same 24 - hour day . Daylight savings shifts are not accounted for .
is not in the same 24-hour day. Daylight savings shifts are not accounted for. *)
val sub_exn : t -> Span.t -> t
* [ every span ~start ~stop ] returns a sorted list of all [ t]s that can be expressed as
[ start + ( i * span ) ] without overflow , and satisfying [ t > = start & & t < = stop ] .
If [ span < = Span.zero || start > stop ] , returns an Error .
The result never crosses the midnight boundary . Constructing a list crossing
midnight , e.g. every hour from 10 pm to 2 am , requires multiple calls to [ every ] .
[start + (i * span)] without overflow, and satisfying [t >= start && t <= stop].
If [span <= Span.zero || start > stop], returns an Error.
The result never crosses the midnight boundary. Constructing a list crossing
midnight, e.g. every hour from 10pm to 2am, requires multiple calls to [every]. *)
val every : Span.t -> start:t -> stop:t -> t list Or_error.t
val to_microsecond_string : t -> string
val arg_type : [ `Use_Time_ns_unix ] [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val now : [ `Use_Time_ns_unix ] [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val of_ofday_float_round_nearest : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val of_ofday_float_round_nearest_microsecond : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val to_ofday_float_round_nearest : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val to_ofday_float_round_nearest_microsecond : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
module Option : sig end [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
module Zoned : sig end [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
end
* Time represented as an [ Int63.t ] number of nanoseconds since the epoch .
See { ! Time_ns_unix } for important user documentation .
Internally , arithmetic is not overflow - checked . Instead , overflows are silently
ignored as for [ int ] arithmetic , unless specifically documented otherwise . Conversions
may ( or may not ) raise if prior arithmetic operations overflowed .
See {!Time_ns_unix} for important user documentation.
Internally, arithmetic is not overflow-checked. Instead, overflows are silently
ignored as for [int] arithmetic, unless specifically documented otherwise. Conversions
may (or may not) raise if prior arithmetic operations overflowed. *)
module type Time_ns = sig
module Span : Span
module Ofday : Ofday with module Span := Span
type t = private Int63.t [@@deriving hash, typerep, bin_io]
include Comparisons.S with type t := t
module Alternate_sexp : sig
type nonrec t = t [@@deriving compare, equal, hash, sexp, sexp_grammar]
include Comparable.S with type t := t
end
include
Time_intf.Shared with type t := t with module Span := Span with module Ofday := Ofday
val of_string : string -> t
[@@deprecated
"[since 2021-04] Use [of_string_with_utc_offset] or [Time_ns_unix.of_string]"]
* [ of_string_with_utc_offset ] requires its input to have an explicit
UTC offset , e.g. [ 2000 - 01 - 01 12:34:56.789012 - 23 ] , or use the UTC zone , " Z " ,
e.g. [ 2000 - 01 - 01 12:34:56.789012Z ] .
UTC offset, e.g. [2000-01-01 12:34:56.789012-23], or use the UTC zone, "Z",
e.g. [2000-01-01 12:34:56.789012Z]. *)
val of_string_with_utc_offset : string -> t
val to_string : t -> string
[@@deprecated "[since 2021-04] Use [to_string_utc] or [Time_ns_unix.to_string]"]
* [ to_string_utc ] generates a time string with the UTC zone , " Z " , e.g. [ 2000 - 01 - 01
12:34:56.789012Z ] .
12:34:56.789012Z]. *)
val to_string_utc : t -> string
* Unix epoch ( 1970 - 01 - 01 00:00:00 UTC )
val epoch : t
val min_value_representable : t
val max_value_representable : t
val min_value_for_1us_rounding : t
val max_value_for_1us_rounding : t
val min_value : t
[@@deprecated
"[since 2019-02] use [min_value_representable] or [min_value_for_1us_rounding] \
instead"]
val max_value : t
[@@deprecated
"[since 2019-02] use [max_value_representable] or [max_value_for_1us_rounding] \
instead"]
val now : unit -> t
val add : t -> Span.t -> t
val add_saturating : t -> Span.t -> t
val sub_saturating : t -> Span.t -> t
val sub : t -> Span.t -> t
val next : t -> t
val prev : t -> t
val diff : t -> t -> Span.t
val abs_diff : t -> t -> Span.t
val to_span_since_epoch : t -> Span.t
val of_span_since_epoch : Span.t -> t
val to_int63_ns_since_epoch : t -> Int63.t
val of_int63_ns_since_epoch : Int63.t -> t
* Will raise on 32 - bit platforms . Consider [ to_int63_ns_since_epoch ] instead .
val to_int_ns_since_epoch : t -> int
val of_int_ns_since_epoch : int -> t
val next_multiple
-> base:t
-> after:t
-> interval:Span.t
-> unit
-> t
* [ ~before ~interval ] returns the largest [ time ] of the form :
{ [
time = base + k * interval
] }
where [ k > = 0 ] and [ time < before ] . It is an error if [ interval < = 0 ] .
Supplying [ ~can_equal_before : true ] allows the result to satisfy [ time < = before ] .
{[
time = base + k * interval
]}
where [k >= 0] and [time < before]. It is an error if [interval <= 0].
Supplying [~can_equal_before:true] allows the result to satisfy [time <= before].
*)
val prev_multiple
-> base:t
-> before:t
-> interval:Span.t
-> unit
-> t
val random : ?state:Random.State.t -> unit -> t
val of_time : Time_float.t -> t
[@@deprecated
"[since 2019-01] use [of_time_float_round_nearest] or \
[of_time_float_round_nearest_microsecond]"]
val to_time : t -> Time_float.t
[@@deprecated
"[since 2019-01] use [to_time_float_round_nearest] or \
[to_time_float_round_nearest_microsecond]"]
val to_time_float_round_nearest : t -> Time_float.t
val to_time_float_round_nearest_microsecond : t -> Time_float.t
val of_time_float_round_nearest : Time_float.t -> t
val of_time_float_round_nearest_microsecond : Time_float.t -> t
module Utc : sig
* [ to_date_and_span_since_start_of_day ] computes the date and intraday - offset of a
time in UTC . It may be slower than [ Core . Time_ns.to_date_ofday ] , as this
function does not cache partial results while the latter does .
time in UTC. It may be slower than [Core.Time_ns.to_date_ofday], as this
function does not cache partial results while the latter does. *)
val to_date_and_span_since_start_of_day : t -> Date0.t * Span.t
val of_date_and_span_since_start_of_day : Date0.t -> Span.t -> t
end
module Stable : sig
module V1 : sig end
[@@deprecated "[since 2021-03] Use [Time_ns_unix] or [Time_ns.Alternate_sexp]"]
module Option : sig end [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
module Alternate_sexp : sig
module V1 : sig
type t = Alternate_sexp.t
[@@deriving bin_io, compare, hash, sexp, sexp_grammar, stable_witness]
include
Comparator.Stable.V1.S
with type t := t
and type comparator_witness = Alternate_sexp.comparator_witness
include
Comparable.Stable.V1.With_stable_witness.S
with type comparable := t
with type comparator_witness := comparator_witness
end
end
module Span : sig
module V1 : sig
type nonrec t = Span.t [@@deriving hash, equal]
include Stable_int63able.With_stable_witness.S with type t := t
end
module Option : sig end [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
module V2 : sig
type t = Span.t [@@deriving hash, equal, sexp_grammar]
type nonrec comparator_witness = Span.comparator_witness
include
Stable_int63able.With_stable_witness.S
with type t := t
with type comparator_witness := comparator_witness
include
Comparable.Stable.V1.With_stable_witness.S
with type comparable := t
with type comparator_witness := comparator_witness
include Stringable.S with type t := t
end
end
module Ofday : sig
module V1 :
Stable_int63able.With_stable_witness.S
with type t = Ofday.t
and type comparator_witness = Ofday.comparator_witness
module Option : sig end [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
module Zoned : sig end [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
end
end
module Hash_queue : sig end [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
module Hash_set : sig end [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
module Map : sig end [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
module Option : sig end [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
module Replace_polymorphic_compare : sig end
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
module Set : sig end [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
module Table : sig end [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
module Zone : sig end [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val arg_type : [ `Use_Time_ns_unix ] [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val comparator : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val get_sexp_zone : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val interruptible_pause : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val of_date_ofday_zoned : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val of_string_abs : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val of_string_fix_proto : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val pause : [ `Use_Time_ns_unix ] [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val pause_forever : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val pp : [ `Use_Time_ns_unix ] [@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val set_sexp_zone : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val sexp_of_t : [ `Use_Time_ns_unix_or_Time_ns_alternate_sexp ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix] or [Time_ns.Alternate_sexp]"]
val sexp_of_t_abs : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val t_of_sexp : [ `Use_Time_ns_unix_or_Time_ns_alternate_sexp ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix] or [Time_ns.Alternate_sexp]"]
val t_of_sexp_abs : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val to_date_ofday_zoned : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val to_ofday_zoned : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val to_string_fix_proto : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val validate_bound : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val validate_lbound : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
val validate_ubound : [ `Use_Time_ns_unix ]
[@@deprecated "[since 2021-03] Use [Time_ns_unix]"]
end
|
ff2ef25122053ff0b24cef97b8723682f54df86d0995b639bf28411268e3afb0 | larcenists/larceny | puzzle.scm | PUZZLE -- Forest Baskett 's Puzzle benchmark , originally written in .
(import (scheme base)
(scheme read)
(scheme write)
(scheme time))
(define (my-iota n)
(do ((n n (- n 1))
(list '() (cons (- n 1) list)))
((zero? n) list)))
(define size 511)
(define classmax 3)
(define typemax 12)
(define *iii* 0)
(define *kount* 0)
(define *d* 8)
(define *piececount* (make-vector (+ classmax 1) 0))
(define *class* (make-vector (+ typemax 1) 0))
(define *piecemax* (make-vector (+ typemax 1) 0))
(define *puzzle* (make-vector (+ size 1)))
(define *p* (make-vector (+ typemax 1)))
(define (fit i j)
(let ((end (vector-ref *piecemax* i)))
(do ((k 0 (+ k 1)))
((or (> k end)
(and (vector-ref (vector-ref *p* i) k)
(vector-ref *puzzle* (+ j k))))
(if (> k end) #t #f)))))
(define (place i j)
(let ((end (vector-ref *piecemax* i)))
(do ((k 0 (+ k 1)))
((> k end))
(cond ((vector-ref (vector-ref *p* i) k)
(vector-set! *puzzle* (+ j k) #t)
#t)))
(vector-set! *piececount*
(vector-ref *class* i)
(- (vector-ref *piececount* (vector-ref *class* i)) 1))
(do ((k j (+ k 1)))
((or (> k size) (not (vector-ref *puzzle* k)))
(if (> k size) 0 k)))))
(define (puzzle-remove i j)
(let ((end (vector-ref *piecemax* i)))
(do ((k 0 (+ k 1)))
((> k end))
(cond ((vector-ref (vector-ref *p* i) k)
(vector-set! *puzzle* (+ j k) #f)
#f)))
(vector-set! *piececount*
(vector-ref *class* i)
(+ (vector-ref *piececount* (vector-ref *class* i)) 1))))
(define (trial j)
(let ((k 0))
(call-with-current-continuation
(lambda (return)
(do ((i 0 (+ i 1)))
((> i typemax) (set! *kount* (+ *kount* 1)) #f)
(cond
((not
(zero?
(vector-ref *piececount* (vector-ref *class* i))))
(cond
((fit i j)
(set! k (place i j))
(cond
((or (trial k) (zero? k))
(set! *kount* (+ *kount* 1))
(return #t))
(else (puzzle-remove i j))))))))))))
(define (definePiece iclass ii jj kk)
(let ((index 0))
(do ((i 0 (+ i 1)))
((> i ii))
(do ((j 0 (+ j 1)))
((> j jj))
(do ((k 0 (+ k 1)))
((> k kk))
(set! index (+ i (* *d* (+ j (* *d* k)))))
(vector-set! (vector-ref *p* *iii*) index #t))))
(vector-set! *class* *iii* iclass)
(vector-set! *piecemax* *iii* index)
(cond ((not (= *iii* typemax))
(set! *iii* (+ *iii* 1))))))
(define (start size)
(set! *kount* 0)
(do ((m 0 (+ m 1)))
((> m size))
(vector-set! *puzzle* m #t))
(do ((i 1 (+ i 1)))
((> i 5))
(do ((j 1 (+ j 1)))
((> j 5))
(do ((k 1 (+ k 1)))
((> k 5))
(vector-set! *puzzle* (+ i (* *d* (+ j (* *d* k)))) #f))))
(do ((i 0 (+ i 1)))
((> i typemax))
(do ((m 0 (+ m 1)))
((> m size))
(vector-set! (vector-ref *p* i) m #f)))
(set! *iii* 0)
(definePiece 0 3 1 0)
(definePiece 0 1 0 3)
(definePiece 0 0 3 1)
(definePiece 0 1 3 0)
(definePiece 0 3 0 1)
(definePiece 0 0 1 3)
(definePiece 1 2 0 0)
(definePiece 1 0 2 0)
(definePiece 1 0 0 2)
(definePiece 2 1 1 0)
(definePiece 2 1 0 1)
(definePiece 2 0 1 1)
(definePiece 3 1 1 1)
(vector-set! *piececount* 0 13)
(vector-set! *piececount* 1 3)
(vector-set! *piececount* 2 1)
(vector-set! *piececount* 3 1)
(let ((m (+ (* *d* (+ *d* 1)) 1))
(n 0))
(cond ((fit 0 m) (set! n (place 0 m)))
(else (begin (newline) (display "Error."))))
(if (trial n)
*kount*
#f)))
(define (main)
(let* ((count (read))
(input1 (read))
(output (read))
(s2 (number->string count))
(s1 input1)
(name "puzzle"))
(run-r7rs-benchmark
(string-append name ":" s2)
count
(lambda () (start (hide count input1)))
(lambda (result) (equal? result output)))))
(for-each (lambda (i) (vector-set! *p* i (make-vector (+ size 1))))
(my-iota (+ typemax 1)))
| null | https://raw.githubusercontent.com/larcenists/larceny/fef550c7d3923deb7a5a1ccd5a628e54cf231c75/test/Benchmarking/R7RS/src/puzzle.scm | scheme | PUZZLE -- Forest Baskett 's Puzzle benchmark , originally written in .
(import (scheme base)
(scheme read)
(scheme write)
(scheme time))
(define (my-iota n)
(do ((n n (- n 1))
(list '() (cons (- n 1) list)))
((zero? n) list)))
(define size 511)
(define classmax 3)
(define typemax 12)
(define *iii* 0)
(define *kount* 0)
(define *d* 8)
(define *piececount* (make-vector (+ classmax 1) 0))
(define *class* (make-vector (+ typemax 1) 0))
(define *piecemax* (make-vector (+ typemax 1) 0))
(define *puzzle* (make-vector (+ size 1)))
(define *p* (make-vector (+ typemax 1)))
(define (fit i j)
(let ((end (vector-ref *piecemax* i)))
(do ((k 0 (+ k 1)))
((or (> k end)
(and (vector-ref (vector-ref *p* i) k)
(vector-ref *puzzle* (+ j k))))
(if (> k end) #t #f)))))
(define (place i j)
(let ((end (vector-ref *piecemax* i)))
(do ((k 0 (+ k 1)))
((> k end))
(cond ((vector-ref (vector-ref *p* i) k)
(vector-set! *puzzle* (+ j k) #t)
#t)))
(vector-set! *piececount*
(vector-ref *class* i)
(- (vector-ref *piececount* (vector-ref *class* i)) 1))
(do ((k j (+ k 1)))
((or (> k size) (not (vector-ref *puzzle* k)))
(if (> k size) 0 k)))))
(define (puzzle-remove i j)
(let ((end (vector-ref *piecemax* i)))
(do ((k 0 (+ k 1)))
((> k end))
(cond ((vector-ref (vector-ref *p* i) k)
(vector-set! *puzzle* (+ j k) #f)
#f)))
(vector-set! *piececount*
(vector-ref *class* i)
(+ (vector-ref *piececount* (vector-ref *class* i)) 1))))
(define (trial j)
(let ((k 0))
(call-with-current-continuation
(lambda (return)
(do ((i 0 (+ i 1)))
((> i typemax) (set! *kount* (+ *kount* 1)) #f)
(cond
((not
(zero?
(vector-ref *piececount* (vector-ref *class* i))))
(cond
((fit i j)
(set! k (place i j))
(cond
((or (trial k) (zero? k))
(set! *kount* (+ *kount* 1))
(return #t))
(else (puzzle-remove i j))))))))))))
(define (definePiece iclass ii jj kk)
(let ((index 0))
(do ((i 0 (+ i 1)))
((> i ii))
(do ((j 0 (+ j 1)))
((> j jj))
(do ((k 0 (+ k 1)))
((> k kk))
(set! index (+ i (* *d* (+ j (* *d* k)))))
(vector-set! (vector-ref *p* *iii*) index #t))))
(vector-set! *class* *iii* iclass)
(vector-set! *piecemax* *iii* index)
(cond ((not (= *iii* typemax))
(set! *iii* (+ *iii* 1))))))
(define (start size)
(set! *kount* 0)
(do ((m 0 (+ m 1)))
((> m size))
(vector-set! *puzzle* m #t))
(do ((i 1 (+ i 1)))
((> i 5))
(do ((j 1 (+ j 1)))
((> j 5))
(do ((k 1 (+ k 1)))
((> k 5))
(vector-set! *puzzle* (+ i (* *d* (+ j (* *d* k)))) #f))))
(do ((i 0 (+ i 1)))
((> i typemax))
(do ((m 0 (+ m 1)))
((> m size))
(vector-set! (vector-ref *p* i) m #f)))
(set! *iii* 0)
(definePiece 0 3 1 0)
(definePiece 0 1 0 3)
(definePiece 0 0 3 1)
(definePiece 0 1 3 0)
(definePiece 0 3 0 1)
(definePiece 0 0 1 3)
(definePiece 1 2 0 0)
(definePiece 1 0 2 0)
(definePiece 1 0 0 2)
(definePiece 2 1 1 0)
(definePiece 2 1 0 1)
(definePiece 2 0 1 1)
(definePiece 3 1 1 1)
(vector-set! *piececount* 0 13)
(vector-set! *piececount* 1 3)
(vector-set! *piececount* 2 1)
(vector-set! *piececount* 3 1)
(let ((m (+ (* *d* (+ *d* 1)) 1))
(n 0))
(cond ((fit 0 m) (set! n (place 0 m)))
(else (begin (newline) (display "Error."))))
(if (trial n)
*kount*
#f)))
(define (main)
(let* ((count (read))
(input1 (read))
(output (read))
(s2 (number->string count))
(s1 input1)
(name "puzzle"))
(run-r7rs-benchmark
(string-append name ":" s2)
count
(lambda () (start (hide count input1)))
(lambda (result) (equal? result output)))))
(for-each (lambda (i) (vector-set! *p* i (make-vector (+ size 1))))
(my-iota (+ typemax 1)))
| |
d9da911b905a6508f73e2db6f47e2edd403cbb59dec5de6e6dc82e93d99fd243 | TrustInSoft/tis-interpreter | print_subexps.mli | Modified by TrustInSoft
(**************************************************************************)
(* *)
This file is part of TrustInSoft Analyzer .
(* *)
(**************************************************************************)
(** Printing all subexpression of an expression (including or excluding the
top expression itself). *)
val pp_all_subexps :
?include_top_exp:bool ->
(Cil_types.exp -> Cvalue.V.t) ->
Format.formatter -> Cil_types.exp -> unit
* [ ? ( include_top_exp = false ) eval_exp fmt exp ] is a pretty
printer that prints a list of sub - expressions of a given expression [ exp ]
with their values .
If [ include_top_exp ] is [ true ] , then it also prints the top expression
itself , otherwise it only prints its strict sub - expressions . Attention :
this should be always [ false ] when the value of the top expression can not
be evaluated .
[ eval_exp exp ] should be a function that takes an expression [ exp ] and that
evaluates it and returns its value .
Usually [ Eval_exprs.eval_expr ~with_alarms state ] ( with appropriate
[ ~with_alarms ] and [ state ] parameters ) should be given here ; it is not used
by default mainly because of a forward reference issue .
printer that prints a list of sub-expressions of a given expression [exp]
with their values.
If [include_top_exp] is [true], then it also prints the top expression
itself, otherwise it only prints its strict sub-expressions. Attention:
this should be always [false] when the value of the top expression cannot
be evaluated.
[eval_exp exp] should be a function that takes an expression [exp] and that
evaluates it and returns its value.
Usually [Eval_exprs.eval_expr ~with_alarms state] (with appropriate
[~with_alarms] and [state] parameters) should be given here; it is not used
by default mainly because of a forward reference issue.
*)
val abstract_print_subexps :
?include_top_exp:bool ->
(Cil_types.exp -> Cvalue.V.t) ->
Format.formatter ->
(string * Cil_types.exp) -> unit
* [ abstract_print_subexps ? ( include_top_exp = false ) eval_exp fmt ( descr , exp ) ]
is a version of the pretty printer which is used in the corresponding
built - in [ tis_print_subexps ] . It simply adds a nice header before printing
the sub - expressions of the expression [ exp ] , [ descr ] should be a string
describing the expression and it will be included literally in the header .
is a version of the pretty printer which is used in the corresponding
built-in [tis_print_subexps]. It simply adds a nice header before printing
the sub-expressions of the expression [exp], [descr] should be a string
describing the expression and it will be included literally in the header. *)
| null | https://raw.githubusercontent.com/TrustInSoft/tis-interpreter/33132ce4a825494ea48bf2dd6fd03a56b62cc5c3/src/plugins/value/utils/print_subexps.mli | ocaml | ************************************************************************
************************************************************************
* Printing all subexpression of an expression (including or excluding the
top expression itself). | Modified by TrustInSoft
This file is part of TrustInSoft Analyzer .
val pp_all_subexps :
?include_top_exp:bool ->
(Cil_types.exp -> Cvalue.V.t) ->
Format.formatter -> Cil_types.exp -> unit
* [ ? ( include_top_exp = false ) eval_exp fmt exp ] is a pretty
printer that prints a list of sub - expressions of a given expression [ exp ]
with their values .
If [ include_top_exp ] is [ true ] , then it also prints the top expression
itself , otherwise it only prints its strict sub - expressions . Attention :
this should be always [ false ] when the value of the top expression can not
be evaluated .
[ eval_exp exp ] should be a function that takes an expression [ exp ] and that
evaluates it and returns its value .
Usually [ Eval_exprs.eval_expr ~with_alarms state ] ( with appropriate
[ ~with_alarms ] and [ state ] parameters ) should be given here ; it is not used
by default mainly because of a forward reference issue .
printer that prints a list of sub-expressions of a given expression [exp]
with their values.
If [include_top_exp] is [true], then it also prints the top expression
itself, otherwise it only prints its strict sub-expressions. Attention:
this should be always [false] when the value of the top expression cannot
be evaluated.
[eval_exp exp] should be a function that takes an expression [exp] and that
evaluates it and returns its value.
Usually [Eval_exprs.eval_expr ~with_alarms state] (with appropriate
[~with_alarms] and [state] parameters) should be given here; it is not used
by default mainly because of a forward reference issue.
*)
val abstract_print_subexps :
?include_top_exp:bool ->
(Cil_types.exp -> Cvalue.V.t) ->
Format.formatter ->
(string * Cil_types.exp) -> unit
* [ abstract_print_subexps ? ( include_top_exp = false ) eval_exp fmt ( descr , exp ) ]
is a version of the pretty printer which is used in the corresponding
built - in [ tis_print_subexps ] . It simply adds a nice header before printing
the sub - expressions of the expression [ exp ] , [ descr ] should be a string
describing the expression and it will be included literally in the header .
is a version of the pretty printer which is used in the corresponding
built-in [tis_print_subexps]. It simply adds a nice header before printing
the sub-expressions of the expression [exp], [descr] should be a string
describing the expression and it will be included literally in the header. *)
|
70d6d25fdced13f006bb6b7f3a8e6e03fa2c00a1f9a7ea2404a3d8cfa58d14c3 | larcenists/larceny | 124.body.scm | Copyright ( C ) ( 2015 ) . All Rights Reserved .
;;;
;;; Permission is hereby granted, free of charge, to any person
;;; obtaining a copy of this software and associated documentation
files ( the " Software " ) , to deal in the Software without
;;; restriction, including without limitation the rights to use,
;;; copy, modify, merge, publish, distribute, sublicense, and/or
sell copies of the Software , and to permit persons to whom the
;;; Software is furnished to do so, subject to the following
;;; conditions:
;;;
;;; The above copyright notice and this permission notice shall be
included in all copies or substantial portions of the Software .
;;;
THE SOFTWARE IS PROVIDED " AS IS " , WITHOUT WARRANTY OF ANY KIND ,
;;; EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
;;; OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
;;; NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
;;; HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
;;; WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
;;; FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
;;; OTHER DEALINGS IN THE SOFTWARE.
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;
reference implementation has been modified by
making all three fields of the record into mutable fields .
;;; The mutators are not exported, so they can only be used by
;;; this file.
;;;
;;; The exported procedures have also been modified to detect
;;; major garbage collections.
;;;
;;; Finally, ephemerons whose key and datum are eq? have been
;;; special-cased.
;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
(define same-as-key (list 'same-as-key))
(define-record-type <ephemeron>
(%make-ephemeron key datum broken?)
ephemeron?
(key %ephemeron-key %ephemeron-key!)
(datum %ephemeron-datum %ephemeron-datum!)
(broken? %ephemeron-broken? %ephemeron-broken!))
(define (make-ephemeron key datum)
(if (> (major-gc-counter) next-breaking)
(break-ephemera!))
(if (eq? key datum)
(%make-ephemeron key same-as-key #f)
(%make-ephemeron key datum #f)))
(define (ephemeron-key x)
(if (> (major-gc-counter) next-breaking)
(break-ephemera!))
(%ephemeron-key x))
(define (ephemeron-datum x)
(if (> (major-gc-counter) next-breaking)
(break-ephemera!))
(let ((result (%ephemeron-datum x)))
(if (eq? result same-as-key)
(%ephemeron-key x)
result)))
(define (ephemeron-broken? x)
(if (> (major-gc-counter) next-breaking)
(break-ephemera!))
(%ephemeron-broken? x))
The specification of reference - barrier in SRFI 124 makes no
;;; sense at all, and the only implementation given is this one.
(define (reference-barrier key) #t)
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;
End of reference implementation , as modified
for Larceny .
;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
Breaking ephemerons is expensive in Larceny , on the order of
;;; several major garbage collections. To reduce that overhead
;;; to a fraction of runtime at most 1/N, ephemerons are broken
;;; only after N major garbage collections have been performed.
;;; Furthermore the overhead is avoided altogether in programs
that do n't import ( srfi 124 ) .
(define gcs-between-breaking 10)
(define next-breaking
(+ (major-gc-counter)
gcs-between-breaking))
(define (break-ephemera!)
(define (break-ephemeron! e)
(%ephemeron-broken! e #t)
(%ephemeron-key! e #f)
(%ephemeron-datum! e #f))
(let* ((v1 (sro 1 -1 1))
(v3 (sro 3 -1 1))
(v5 (sro 5 -1 1))
(rl (sro 3 5 -1))
(ht (make-eq-hashtable)))
(define (walk-singly-referenced! x)
(if (hashtable-contains? ht x)
(break-ephemeron! (hashtable-ref ht x #f))))
;; ht will contain all ephemerons indexed by key
(vector-for-each (lambda (x)
(if (ephemeron? x)
(hashtable-set! ht (%ephemeron-key x) x)))
;; all record-like objects
rl)
(vector-for-each walk-singly-referenced! v1)
(vector-for-each walk-singly-referenced! v3)
(vector-for-each walk-singly-referenced! v5))
(set! next-breaking
(+ (major-gc-counter)
gcs-between-breaking)))
| null | https://raw.githubusercontent.com/larcenists/larceny/fef550c7d3923deb7a5a1ccd5a628e54cf231c75/lib/SRFI/srfi/124.body.scm | scheme |
Permission is hereby granted, free of charge, to any person
obtaining a copy of this software and associated documentation
restriction, including without limitation the rights to use,
copy, modify, merge, publish, distribute, sublicense, and/or
Software is furnished to do so, subject to the following
conditions:
The above copyright notice and this permission notice shall be
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
OTHER DEALINGS IN THE SOFTWARE.
The mutators are not exported, so they can only be used by
this file.
The exported procedures have also been modified to detect
major garbage collections.
Finally, ephemerons whose key and datum are eq? have been
special-cased.
sense at all, and the only implementation given is this one.
several major garbage collections. To reduce that overhead
to a fraction of runtime at most 1/N, ephemerons are broken
only after N major garbage collections have been performed.
Furthermore the overhead is avoided altogether in programs
ht will contain all ephemerons indexed by key
all record-like objects | Copyright ( C ) ( 2015 ) . All Rights Reserved .
files ( the " Software " ) , to deal in the Software without
sell copies of the Software , and to permit persons to whom the
included in all copies or substantial portions of the Software .
THE SOFTWARE IS PROVIDED " AS IS " , WITHOUT WARRANTY OF ANY KIND ,
reference implementation has been modified by
making all three fields of the record into mutable fields .
(define same-as-key (list 'same-as-key))
(define-record-type <ephemeron>
(%make-ephemeron key datum broken?)
ephemeron?
(key %ephemeron-key %ephemeron-key!)
(datum %ephemeron-datum %ephemeron-datum!)
(broken? %ephemeron-broken? %ephemeron-broken!))
(define (make-ephemeron key datum)
(if (> (major-gc-counter) next-breaking)
(break-ephemera!))
(if (eq? key datum)
(%make-ephemeron key same-as-key #f)
(%make-ephemeron key datum #f)))
(define (ephemeron-key x)
(if (> (major-gc-counter) next-breaking)
(break-ephemera!))
(%ephemeron-key x))
(define (ephemeron-datum x)
(if (> (major-gc-counter) next-breaking)
(break-ephemera!))
(let ((result (%ephemeron-datum x)))
(if (eq? result same-as-key)
(%ephemeron-key x)
result)))
(define (ephemeron-broken? x)
(if (> (major-gc-counter) next-breaking)
(break-ephemera!))
(%ephemeron-broken? x))
The specification of reference - barrier in SRFI 124 makes no
(define (reference-barrier key) #t)
End of reference implementation , as modified
for Larceny .
Breaking ephemerons is expensive in Larceny , on the order of
that do n't import ( srfi 124 ) .
(define gcs-between-breaking 10)
(define next-breaking
(+ (major-gc-counter)
gcs-between-breaking))
(define (break-ephemera!)
(define (break-ephemeron! e)
(%ephemeron-broken! e #t)
(%ephemeron-key! e #f)
(%ephemeron-datum! e #f))
(let* ((v1 (sro 1 -1 1))
(v3 (sro 3 -1 1))
(v5 (sro 5 -1 1))
(rl (sro 3 5 -1))
(ht (make-eq-hashtable)))
(define (walk-singly-referenced! x)
(if (hashtable-contains? ht x)
(break-ephemeron! (hashtable-ref ht x #f))))
(vector-for-each (lambda (x)
(if (ephemeron? x)
(hashtable-set! ht (%ephemeron-key x) x)))
rl)
(vector-for-each walk-singly-referenced! v1)
(vector-for-each walk-singly-referenced! v3)
(vector-for-each walk-singly-referenced! v5))
(set! next-breaking
(+ (major-gc-counter)
gcs-between-breaking)))
|
aba32d7988eccea43b234175766302559ce0363184afa44fae1cf3fddd06e10b | facebookarchive/pfff | source_tree.ml | open Common
type subsystem = SubSystem of string
type dir = Dir of string
let string_of_subsystem (SubSystem s) = s
let string_of_dir (Dir s) = s
type tree_reorganization = (subsystem * dir list) list
let dir_to_dirfinal (Dir s) =
Str.global_replace (Str.regexp "/") "___" s
let dirfinal_of_dir s =
Dir ( Str.global_replace ( Str.regexp " _ _ _ " ) " / " s )
let dirfinal_of_dir s =
Dir (Str.global_replace (Str.regexp "___") "/" s)
*)
let all_subsystem reorg =
reorg +> List.map fst +> List.map string_of_subsystem
let all_dirs reorg =
reorg +> List.map snd +> List.concat +> List.map string_of_dir
let reverse_index reorg =
let res = ref [] in
reorg +> List.iter (fun (SubSystem s1, dirs) ->
dirs +> List.iter (fun (Dir s2) ->
push (Dir s2, SubSystem s1) res;
);
);
List.rev !res
let (load_tree_reorganization : Common.filename -> tree_reorganization) =
fun file ->
let xs = Simple_format.title_colon_elems_space_separated file in
xs +> List.map (fun (title, elems) ->
SubSystem title, elems +> List.map (fun s -> Dir s)
)
let debug_source_tree = false
let change_organization_dirs_to_subsystems reorg basedir =
let cmd s =
if debug_source_tree
then pr2 s
else Common.command2 s
in
reorg +> List.iter (fun (SubSystem sub, dirs) ->
if not debug_source_tree
then Common2.mkdir (spf "%s/%s" basedir sub);
dirs +> List.iter (fun (Dir dir) ->
let dir' = dir_to_dirfinal (Dir dir) in
cmd (spf "mv %s/%s %s/%s/%s" basedir dir basedir sub dir')
);
);
()
let change_organization_subsystems_to_dirs reorg basedir =
let cmd s =
if debug_source_tree
then pr2 s
else Common.command2 s
in
reorg +> List.iter (fun (SubSystem sub, dirs) ->
dirs +> List.iter (fun (Dir dir) ->
let dir' = dir_to_dirfinal (Dir dir) in
cmd (spf "mv %s/%s/%s %s/%s" basedir sub dir' basedir dir)
);
if not debug_source_tree
then Unix.rmdir (spf "%s/%s" basedir sub);
);
()
let (change_organization:
tree_reorganization -> Common.filename (* dir *) -> unit) =
fun reorg dir ->
pr2_gen reorg;
pr2_gen dir;
let subsystem_bools =
all_subsystem reorg
+> List.map (fun s -> (Sys.file_exists (Filename.concat dir s)))
in
let dirs_bools =
all_dirs reorg
+> List.map (fun s -> (Sys.file_exists (Filename.concat dir s)))
in
match () with
| _ when Common2.and_list subsystem_bools ->
assert (not (Common2.or_list dirs_bools));
change_organization_subsystems_to_dirs reorg dir;
| _ when Common2.and_list dirs_bools ->
assert (not (Common2.or_list subsystem_bools));
change_organization_dirs_to_subsystems reorg dir;
| _ -> failwith "have a mix of subsystem and dirs, wierd"
let subsystem_of_dir2 (Dir dir) reorg =
let index = reverse_index reorg in
let dirsplit = Common.split "/" dir in
let index =
index +> List.map (fun (Dir d, sub) -> Common.split "/" d, sub)
in
try
index +> List.find (fun (dirsplit2, _sub) ->
let len = List.length dirsplit2 in
Common2.take_safe len dirsplit = dirsplit2
) +> snd
with Not_found ->
pr2 (spf "Cant find %s in reorganization information" dir);
raise Not_found
let subsystem_of_dir a b =
Common.profile_code "subsystem_of_dir" (fun () -> subsystem_of_dir2 a b)
| null | https://raw.githubusercontent.com/facebookarchive/pfff/ec21095ab7d445559576513a63314e794378c367/h_files-format/source_tree.ml | ocaml | dir | open Common
type subsystem = SubSystem of string
type dir = Dir of string
let string_of_subsystem (SubSystem s) = s
let string_of_dir (Dir s) = s
type tree_reorganization = (subsystem * dir list) list
let dir_to_dirfinal (Dir s) =
Str.global_replace (Str.regexp "/") "___" s
let dirfinal_of_dir s =
Dir ( Str.global_replace ( Str.regexp " _ _ _ " ) " / " s )
let dirfinal_of_dir s =
Dir (Str.global_replace (Str.regexp "___") "/" s)
*)
let all_subsystem reorg =
reorg +> List.map fst +> List.map string_of_subsystem
let all_dirs reorg =
reorg +> List.map snd +> List.concat +> List.map string_of_dir
let reverse_index reorg =
let res = ref [] in
reorg +> List.iter (fun (SubSystem s1, dirs) ->
dirs +> List.iter (fun (Dir s2) ->
push (Dir s2, SubSystem s1) res;
);
);
List.rev !res
let (load_tree_reorganization : Common.filename -> tree_reorganization) =
fun file ->
let xs = Simple_format.title_colon_elems_space_separated file in
xs +> List.map (fun (title, elems) ->
SubSystem title, elems +> List.map (fun s -> Dir s)
)
let debug_source_tree = false
let change_organization_dirs_to_subsystems reorg basedir =
let cmd s =
if debug_source_tree
then pr2 s
else Common.command2 s
in
reorg +> List.iter (fun (SubSystem sub, dirs) ->
if not debug_source_tree
then Common2.mkdir (spf "%s/%s" basedir sub);
dirs +> List.iter (fun (Dir dir) ->
let dir' = dir_to_dirfinal (Dir dir) in
cmd (spf "mv %s/%s %s/%s/%s" basedir dir basedir sub dir')
);
);
()
let change_organization_subsystems_to_dirs reorg basedir =
let cmd s =
if debug_source_tree
then pr2 s
else Common.command2 s
in
reorg +> List.iter (fun (SubSystem sub, dirs) ->
dirs +> List.iter (fun (Dir dir) ->
let dir' = dir_to_dirfinal (Dir dir) in
cmd (spf "mv %s/%s/%s %s/%s" basedir sub dir' basedir dir)
);
if not debug_source_tree
then Unix.rmdir (spf "%s/%s" basedir sub);
);
()
let (change_organization:
fun reorg dir ->
pr2_gen reorg;
pr2_gen dir;
let subsystem_bools =
all_subsystem reorg
+> List.map (fun s -> (Sys.file_exists (Filename.concat dir s)))
in
let dirs_bools =
all_dirs reorg
+> List.map (fun s -> (Sys.file_exists (Filename.concat dir s)))
in
match () with
| _ when Common2.and_list subsystem_bools ->
assert (not (Common2.or_list dirs_bools));
change_organization_subsystems_to_dirs reorg dir;
| _ when Common2.and_list dirs_bools ->
assert (not (Common2.or_list subsystem_bools));
change_organization_dirs_to_subsystems reorg dir;
| _ -> failwith "have a mix of subsystem and dirs, wierd"
let subsystem_of_dir2 (Dir dir) reorg =
let index = reverse_index reorg in
let dirsplit = Common.split "/" dir in
let index =
index +> List.map (fun (Dir d, sub) -> Common.split "/" d, sub)
in
try
index +> List.find (fun (dirsplit2, _sub) ->
let len = List.length dirsplit2 in
Common2.take_safe len dirsplit = dirsplit2
) +> snd
with Not_found ->
pr2 (spf "Cant find %s in reorganization information" dir);
raise Not_found
let subsystem_of_dir a b =
Common.profile_code "subsystem_of_dir" (fun () -> subsystem_of_dir2 a b)
|
4f118de2982c642a5b9a7c53b515fe1fc1c8a432e48b938ee691040b0666f2f1 | ocaml/ocamlbuild | glob_lexer.mli | (***********************************************************************)
(* *)
(* ocamlbuild *)
(* *)
, , projet Gallium , INRIA Rocquencourt
(* *)
Copyright 2007 Institut National de Recherche en Informatique et
en Automatique . All rights reserved . This file is distributed
under the terms of the GNU Library General Public License , with
(* the special exception on linking described in file ../LICENSE. *)
(* *)
(***********************************************************************)
Original author :
open Glob_ast
type token =
| ATOM of pattern atom
| AND
| OR
| NOT
| LPAR
| RPAR
| TRUE
| FALSE
| EOF
val token : Lexing.lexbuf -> token
| null | https://raw.githubusercontent.com/ocaml/ocamlbuild/792b7c8abdbc712c98ed7e69469ed354b87e125b/src/glob_lexer.mli | ocaml | *********************************************************************
ocamlbuild
the special exception on linking described in file ../LICENSE.
********************************************************************* | , , projet Gallium , INRIA Rocquencourt
Copyright 2007 Institut National de Recherche en Informatique et
en Automatique . All rights reserved . This file is distributed
under the terms of the GNU Library General Public License , with
Original author :
open Glob_ast
type token =
| ATOM of pattern atom
| AND
| OR
| NOT
| LPAR
| RPAR
| TRUE
| FALSE
| EOF
val token : Lexing.lexbuf -> token
|
6935aaa6c4979811fd96204639e8a5e5f524f7d766a75f56cd8b9a89a5ed3b94 | expipiplus1/vulkan | XR_FB_color_space.hs | {-# language CPP #-}
-- | = Name
--
-- XR_FB_color_space - instance extension
--
-- = Specification
--
-- See
-- <#XR_FB_color_space XR_FB_color_space>
-- in the main specification for complete information.
--
-- = Registered Extension Number
--
109
--
-- = Revision
--
1
--
-- = Extension and Version Dependencies
--
- Requires OpenXR 1.0
--
-- = See Also
--
-- 'ColorSpaceFB', 'SystemColorSpacePropertiesFB',
-- 'enumerateColorSpacesFB', 'setColorSpaceFB'
--
-- = Document Notes
--
-- For more information, see the
-- <#XR_FB_color_space OpenXR Specification>
--
-- This page is a generated document. Fixes and changes should be made to
-- the generator scripts, not directly.
module OpenXR.Extensions.XR_FB_color_space ( enumerateColorSpacesFB
, setColorSpaceFB
, SystemColorSpacePropertiesFB(..)
, ColorSpaceFB( COLOR_SPACE_UNMANAGED_FB
, COLOR_SPACE_REC2020_FB
, COLOR_SPACE_REC709_FB
, COLOR_SPACE_RIFT_CV1_FB
, COLOR_SPACE_RIFT_S_FB
, COLOR_SPACE_QUEST_FB
, COLOR_SPACE_P3_FB
, COLOR_SPACE_ADOBE_RGB_FB
, ..
)
, FB_color_space_SPEC_VERSION
, pattern FB_color_space_SPEC_VERSION
, FB_COLOR_SPACE_EXTENSION_NAME
, pattern FB_COLOR_SPACE_EXTENSION_NAME
) where
import OpenXR.Internal.Utils (enumReadPrec)
import OpenXR.Internal.Utils (enumShowsPrec)
import OpenXR.Internal.Utils (traceAroundEvent)
import Control.Exception.Base (bracket)
import Control.Monad (unless)
import Control.Monad.IO.Class (liftIO)
import Foreign.Marshal.Alloc (allocaBytes)
import Foreign.Marshal.Alloc (callocBytes)
import Foreign.Marshal.Alloc (free)
import GHC.Base (when)
import GHC.IO (throwIO)
import GHC.Ptr (nullFunPtr)
import Foreign.Ptr (nullPtr)
import Foreign.Ptr (plusPtr)
import GHC.Show (showsPrec)
import Control.Monad.Trans.Class (lift)
import Control.Monad.Trans.Cont (evalContT)
import Data.Vector (generateM)
import OpenXR.CStruct (FromCStruct)
import OpenXR.CStruct (FromCStruct(..))
import OpenXR.CStruct (ToCStruct)
import OpenXR.CStruct (ToCStruct(..))
import OpenXR.Zero (Zero)
import OpenXR.Zero (Zero(..))
import Control.Monad.IO.Class (MonadIO)
import Data.String (IsString)
import Data.Typeable (Typeable)
import Foreign.Storable (Storable)
import Foreign.Storable (Storable(peek))
import Foreign.Storable (Storable(poke))
import qualified Foreign.Storable (Storable(..))
import GHC.Generics (Generic)
import GHC.IO.Exception (IOErrorType(..))
import GHC.IO.Exception (IOException(..))
import Data.Int (Int32)
import Foreign.Ptr (FunPtr)
import Foreign.Ptr (Ptr)
import GHC.Read (Read(readPrec))
import GHC.Show (Show(showsPrec))
import Data.Word (Word32)
import Data.Kind (Type)
import Control.Monad.Trans.Cont (ContT(..))
import Data.Vector (Vector)
import OpenXR.CStruct.Utils (advancePtrBytes)
import OpenXR.NamedType ((:::))
import OpenXR.Dynamic (InstanceCmds(pXrEnumerateColorSpacesFB))
import OpenXR.Dynamic (InstanceCmds(pXrSetColorSpaceFB))
import OpenXR.Exception (OpenXrException(..))
import OpenXR.Core10.Enums.Result (Result)
import OpenXR.Core10.Enums.Result (Result(..))
import OpenXR.Core10.Handles (Session)
import OpenXR.Core10.Handles (Session(..))
import OpenXR.Core10.Handles (Session(Session))
import OpenXR.Core10.Handles (Session_T)
import OpenXR.Core10.Enums.StructureType (StructureType)
import OpenXR.Core10.Enums.Result (Result(SUCCESS))
import OpenXR.Core10.Enums.StructureType (StructureType(TYPE_SYSTEM_COLOR_SPACE_PROPERTIES_FB))
foreign import ccall
#if !defined(SAFE_FOREIGN_CALLS)
unsafe
#endif
"dynamic" mkXrEnumerateColorSpacesFB
:: FunPtr (Ptr Session_T -> Word32 -> Ptr Word32 -> Ptr ColorSpaceFB -> IO Result) -> Ptr Session_T -> Word32 -> Ptr Word32 -> Ptr ColorSpaceFB -> IO Result
| xrEnumerateColorSpacesFB - Enumerates color spaces
--
-- == Parameter Descriptions
--
-- - @session@ is the session that enumerates the supported color spaces.
--
- @colorSpaceCapacityInput@ is the capacity of the @colorSpaces@
-- array, or 0 to retrieve the required capacity.
--
-- - @colorSpaceCountOutput@ is a pointer to the count of 'ColorSpaceFB'
-- @colorSpaces@ written, or a pointer to the required capacity in the
case that @colorSpaceCapacityInput@ is @0@.
--
-- - @colorSpaces@ is a pointer to an array of 'ColorSpaceFB' color
spaces , but be @NULL@ if @colorSpaceCapacityInput@ is @0@.
--
-- - See
-- <#buffer-size-parameters Buffer Size Parameters>
-- chapter for a detailed description of retrieving the required
-- @colorSpaces@ size.
--
-- = Description
--
-- 'enumerateColorSpacesFB' enumerates the color spaces supported by the
current session . Runtimes /must/ always return identical buffer contents
-- from this enumeration for the lifetime of the session.
--
-- == Valid Usage (Implicit)
--
- # VUID - xrEnumerateColorSpacesFB - extension - notenabled # The
-- @XR_FB_color_space@ extension /must/ be enabled prior to calling
-- 'enumerateColorSpacesFB'
--
- # VUID - xrEnumerateColorSpacesFB - session - parameter # @session@ /must/
-- be a valid 'OpenXR.Core10.Handles.Session' handle
--
- # VUID - xrEnumerateColorSpacesFB - colorSpaceCountOutput - parameter #
@colorSpaceCountOutput@ /must/ be a pointer to a @uint32_t@ value
--
- # VUID - xrEnumerateColorSpacesFB - colorSpaces - parameter # If
@colorSpaceCapacityInput@ is not @0@ , @colorSpaces@ /must/ be a
pointer to an array of @colorSpaceCapacityInput@ ' ColorSpaceFB '
-- values
--
-- == Return Codes
--
-- [<#fundamentals-successcodes Success>]
--
- ' OpenXR.Core10.Enums . Result . SUCCESS '
--
-- - 'OpenXR.Core10.Enums.Result.SESSION_LOSS_PENDING'
--
-- [<#fundamentals-errorcodes Failure>]
--
-- - 'OpenXR.Core10.Enums.Result.ERROR_INSTANCE_LOST'
--
- ' OpenXR.Core10.Enums . Result . '
--
-- - 'OpenXR.Core10.Enums.Result.ERROR_RUNTIME_FAILURE'
--
-- - 'OpenXR.Core10.Enums.Result.ERROR_HANDLE_INVALID'
--
- ' OpenXR.Core10.Enums . Result . ERROR_SIZE_INSUFFICIENT '
--
-- - 'OpenXR.Core10.Enums.Result.ERROR_FUNCTION_UNSUPPORTED'
--
-- - 'OpenXR.Core10.Enums.Result.ERROR_VALIDATION_FAILURE'
--
-- = See Also
--
-- 'ColorSpaceFB', 'OpenXR.Core10.Handles.Session', 'setColorSpaceFB'
enumerateColorSpacesFB :: forall io
. (MonadIO io)
=> -- No documentation found for Nested "xrEnumerateColorSpacesFB" "session"
Session
-> io (Result, ("colorSpaces" ::: Vector ColorSpaceFB))
enumerateColorSpacesFB session = liftIO . evalContT $ do
let xrEnumerateColorSpacesFBPtr = pXrEnumerateColorSpacesFB (case session of Session{instanceCmds} -> instanceCmds)
lift $ unless (xrEnumerateColorSpacesFBPtr /= nullFunPtr) $
throwIO $ IOError Nothing InvalidArgument "" "The function pointer for xrEnumerateColorSpacesFB is null" Nothing Nothing
let xrEnumerateColorSpacesFB' = mkXrEnumerateColorSpacesFB xrEnumerateColorSpacesFBPtr
let session' = sessionHandle (session)
pColorSpaceCountOutput <- ContT $ bracket (callocBytes @Word32 4) free
r <- lift $ traceAroundEvent "xrEnumerateColorSpacesFB" (xrEnumerateColorSpacesFB'
session'
(0)
(pColorSpaceCountOutput)
(nullPtr))
lift $ when (r < SUCCESS) (throwIO (OpenXrException r))
colorSpaceCountOutput <- lift $ peek @Word32 pColorSpaceCountOutput
pColorSpaces <- ContT $ bracket (callocBytes @ColorSpaceFB ((fromIntegral (colorSpaceCountOutput)) * 4)) free
r' <- lift $ traceAroundEvent "xrEnumerateColorSpacesFB" (xrEnumerateColorSpacesFB'
session'
((colorSpaceCountOutput))
(pColorSpaceCountOutput)
(pColorSpaces))
lift $ when (r' < SUCCESS) (throwIO (OpenXrException r'))
colorSpaceCountOutput' <- lift $ peek @Word32 pColorSpaceCountOutput
colorSpaces' <- lift $ generateM (fromIntegral (colorSpaceCountOutput')) (\i -> peek @ColorSpaceFB ((pColorSpaces `advancePtrBytes` (4 * (i)) :: Ptr ColorSpaceFB)))
pure $ ((r'), colorSpaces')
foreign import ccall
#if !defined(SAFE_FOREIGN_CALLS)
unsafe
#endif
"dynamic" mkXrSetColorSpaceFB
:: FunPtr (Ptr Session_T -> ColorSpaceFB -> IO Result) -> Ptr Session_T -> ColorSpaceFB -> IO Result
-- | xrSetColorSpaceFB - Set a color space
--
-- == Parameter Descriptions
--
-- = Description
--
-- 'setColorSpaceFB' provides a mechanism for an application to specify the
-- color space used in the final rendered frame. If this function is not
-- called, the session will use the color space deemed appropriate by the
runtime . Facebook HMDs for both PC and Mobile product lines default to
' COLOR_SPACE_RIFT_CV1_FB ' . The runtime /must/ return
-- 'OpenXR.Core10.Enums.Result.ERROR_COLOR_SPACE_UNSUPPORTED_FB' if
-- @colorSpace@ is not one of the values enumerated by
-- 'enumerateColorSpacesFB'.
--
-- == Valid Usage (Implicit)
--
-- - #VUID-xrSetColorSpaceFB-extension-notenabled# The
-- @XR_FB_color_space@ extension /must/ be enabled prior to calling
-- 'setColorSpaceFB'
--
-- - #VUID-xrSetColorSpaceFB-session-parameter# @session@ /must/ be a
-- valid 'OpenXR.Core10.Handles.Session' handle
--
-- - #VUID-xrSetColorSpaceFB-colorspace-parameter# @colorspace@ /must/ be
-- a valid 'ColorSpaceFB' value
--
-- == Return Codes
--
-- [<#fundamentals-successcodes Success>]
--
- ' OpenXR.Core10.Enums . Result . SUCCESS '
--
-- - 'OpenXR.Core10.Enums.Result.SESSION_LOSS_PENDING'
--
-- [<#fundamentals-errorcodes Failure>]
--
-- - 'OpenXR.Core10.Enums.Result.ERROR_INSTANCE_LOST'
--
- ' OpenXR.Core10.Enums . Result . '
--
-- - 'OpenXR.Core10.Enums.Result.ERROR_RUNTIME_FAILURE'
--
-- - 'OpenXR.Core10.Enums.Result.ERROR_HANDLE_INVALID'
--
-- - 'OpenXR.Core10.Enums.Result.ERROR_COLOR_SPACE_UNSUPPORTED_FB'
--
-- - 'OpenXR.Core10.Enums.Result.ERROR_FEATURE_UNSUPPORTED'
--
-- - 'OpenXR.Core10.Enums.Result.ERROR_FUNCTION_UNSUPPORTED'
--
-- - 'OpenXR.Core10.Enums.Result.ERROR_VALIDATION_FAILURE'
--
-- = See Also
--
-- 'ColorSpaceFB', 'OpenXR.Core10.Handles.Session',
-- 'enumerateColorSpacesFB'
setColorSpaceFB :: forall io
. (MonadIO io)
=> -- | @session@ is a valid 'OpenXR.Core10.Handles.Session' handle.
Session
No documentation found for Nested " xrSetColorSpaceFB " " colorspace "
ColorSpaceFB
-> io (Result)
setColorSpaceFB session colorspace = liftIO $ do
let xrSetColorSpaceFBPtr = pXrSetColorSpaceFB (case session of Session{instanceCmds} -> instanceCmds)
unless (xrSetColorSpaceFBPtr /= nullFunPtr) $
throwIO $ IOError Nothing InvalidArgument "" "The function pointer for xrSetColorSpaceFB is null" Nothing Nothing
let xrSetColorSpaceFB' = mkXrSetColorSpaceFB xrSetColorSpaceFBPtr
r <- traceAroundEvent "xrSetColorSpaceFB" (xrSetColorSpaceFB'
(sessionHandle (session))
(colorspace))
when (r < SUCCESS) (throwIO (OpenXrException r))
pure $ (r)
-- | XrSystemColorSpacePropertiesFB - System property for color space
--
-- == Valid Usage (Implicit)
--
-- - #VUID-XrSystemColorSpacePropertiesFB-extension-notenabled# The
-- @XR_FB_color_space@ extension /must/ be enabled prior to using
-- 'SystemColorSpacePropertiesFB'
--
-- - #VUID-XrSystemColorSpacePropertiesFB-type-type# @type@ /must/ be
' OpenXR.Core10.Enums . StructureType . TYPE_SYSTEM_COLOR_SPACE_PROPERTIES_FB '
--
-- - #VUID-XrSystemColorSpacePropertiesFB-next-next# @next@ /must/ be
-- @NULL@ or a valid pointer to the
-- <#valid-usage-for-structure-pointer-chains next structure in a structure chain>
--
-- - #VUID-XrSystemColorSpacePropertiesFB-colorSpace-parameter#
-- @colorSpace@ /must/ be a valid 'ColorSpaceFB' value
--
-- = See Also
--
' ColorSpaceFB ' , ' OpenXR.Core10.Enums . StructureType . StructureType '
data SystemColorSpacePropertiesFB = SystemColorSpacePropertiesFB
| @colorSpace@ is the native color space of the XR device .
colorSpace :: ColorSpaceFB }
deriving (Typeable, Eq)
#if defined(GENERIC_INSTANCES)
deriving instance Generic (SystemColorSpacePropertiesFB)
#endif
deriving instance Show SystemColorSpacePropertiesFB
instance ToCStruct SystemColorSpacePropertiesFB where
withCStruct x f = allocaBytes 24 $ \p -> pokeCStruct p x (f p)
pokeCStruct p SystemColorSpacePropertiesFB{..} f = do
poke ((p `plusPtr` 0 :: Ptr StructureType)) (TYPE_SYSTEM_COLOR_SPACE_PROPERTIES_FB)
poke ((p `plusPtr` 8 :: Ptr (Ptr ()))) (nullPtr)
poke ((p `plusPtr` 16 :: Ptr ColorSpaceFB)) (colorSpace)
f
cStructSize = 24
cStructAlignment = 8
pokeZeroCStruct p f = do
poke ((p `plusPtr` 0 :: Ptr StructureType)) (TYPE_SYSTEM_COLOR_SPACE_PROPERTIES_FB)
poke ((p `plusPtr` 8 :: Ptr (Ptr ()))) (nullPtr)
poke ((p `plusPtr` 16 :: Ptr ColorSpaceFB)) (zero)
f
instance FromCStruct SystemColorSpacePropertiesFB where
peekCStruct p = do
colorSpace <- peek @ColorSpaceFB ((p `plusPtr` 16 :: Ptr ColorSpaceFB))
pure $ SystemColorSpacePropertiesFB
colorSpace
instance Storable SystemColorSpacePropertiesFB where
sizeOf ~_ = 24
alignment ~_ = 8
peek = peekCStruct
poke ptr poked = pokeCStruct ptr poked (pure ())
instance Zero SystemColorSpacePropertiesFB where
zero = SystemColorSpacePropertiesFB
zero
-- | XrColorSpaceFB - Color Space Type
--
= =
--
-- = See Also
--
-- 'SystemColorSpacePropertiesFB', 'enumerateColorSpacesFB',
-- 'setColorSpaceFB'
newtype ColorSpaceFB = ColorSpaceFB Int32
deriving newtype (Eq, Ord, Storable, Zero)
-- | 'COLOR_SPACE_UNMANAGED_FB'. No color correction, not recommended for
-- production use.
pattern COLOR_SPACE_UNMANAGED_FB = ColorSpaceFB 0
| ' ' . Standard Rec . 2020 chromacities . This is the
preferred color space for standardized color across all Oculus HMDs with
-- D65 white point.
pattern COLOR_SPACE_REC2020_FB = ColorSpaceFB 1
| ' COLOR_SPACE_REC709_FB ' . Standard Rec . 709 chromaticities , similar to
-- sRGB.
pattern COLOR_SPACE_REC709_FB = ColorSpaceFB 2
| ' COLOR_SPACE_RIFT_CV1_FB ' . Unique color space , between P3 and Adobe RGB
using D75 white point .
--
Color Space Details with Chromacity Primaries in CIE 1931 xy :
--
- Red : ( 0.666 , 0.334 )
--
- Green : ( 0.238 , 0.714 )
--
- Blue : ( 0.139 , 0.053 )
--
- White : ( 0.298 , 0.318 )
pattern COLOR_SPACE_RIFT_CV1_FB = ColorSpaceFB 3
| ' COLOR_SPACE_RIFT_S_FB ' . Unique color space . Similar to Rec 709 using
D75 .
--
Color Space Details with Chromacity Primaries in CIE 1931 xy :
--
- Red : ( 0.640 , 0.330 )
--
- Green : ( 0.292 , 0.586 )
--
- Blue : ( 0.156 , 0.058 )
--
- White : ( 0.298 , 0.318 )
pattern COLOR_SPACE_RIFT_S_FB = ColorSpaceFB 4
| ' COLOR_SPACE_QUEST_FB ' . Unique color space . Similar to Rift CV1 using
D75 white point
--
Color Space Details with Chromacity Primaries in CIE 1931 xy :
--
- Red : ( 0.661 , 0.338 )
--
- Green : ( 0.228 , 0.718 )
--
- Blue : ( 0.142 , 0.042 )
--
- White : ( 0.298 , 0.318 )
pattern COLOR_SPACE_QUEST_FB = ColorSpaceFB 5
| ' COLOR_SPACE_P3_FB ' . Similar to DCI - P3 , but uses D65 white point
-- instead.
--
Color Space Details with Chromacity Primaries in CIE 1931 xy :
--
- Red : ( 0.680 , 0.320 )
--
- Green : ( 0.265 , 0.690 )
--
- Blue : ( 0.150 , 0.060 )
--
- White : ( 0.313 , 0.329 )
pattern COLOR_SPACE_P3_FB = ColorSpaceFB 6
| ' COLOR_SPACE_ADOBE_RGB_FB ' . Standard Adobe chromacities .
pattern COLOR_SPACE_ADOBE_RGB_FB = ColorSpaceFB 7
# COMPLETE
COLOR_SPACE_UNMANAGED_FB
, , COLOR_SPACE_REC709_FB
, COLOR_SPACE_RIFT_CV1_FB
, COLOR_SPACE_RIFT_S_FB
, COLOR_SPACE_QUEST_FB
, COLOR_SPACE_P3_FB
, COLOR_SPACE_ADOBE_RGB_FB : :
ColorSpaceFB
#
COLOR_SPACE_UNMANAGED_FB
, COLOR_SPACE_REC2020_FB
, COLOR_SPACE_REC709_FB
, COLOR_SPACE_RIFT_CV1_FB
, COLOR_SPACE_RIFT_S_FB
, COLOR_SPACE_QUEST_FB
, COLOR_SPACE_P3_FB
, COLOR_SPACE_ADOBE_RGB_FB ::
ColorSpaceFB
#-}
conNameColorSpaceFB :: String
conNameColorSpaceFB = "ColorSpaceFB"
enumPrefixColorSpaceFB :: String
enumPrefixColorSpaceFB = "COLOR_SPACE_"
showTableColorSpaceFB :: [(ColorSpaceFB, String)]
showTableColorSpaceFB =
[ (COLOR_SPACE_UNMANAGED_FB, "UNMANAGED_FB")
, (COLOR_SPACE_REC2020_FB, "REC2020_FB")
, (COLOR_SPACE_REC709_FB, "REC709_FB")
, (COLOR_SPACE_RIFT_CV1_FB, "RIFT_CV1_FB")
, (COLOR_SPACE_RIFT_S_FB, "RIFT_S_FB")
, (COLOR_SPACE_QUEST_FB, "QUEST_FB")
, (COLOR_SPACE_P3_FB, "P3_FB")
, (COLOR_SPACE_ADOBE_RGB_FB, "ADOBE_RGB_FB")
]
instance Show ColorSpaceFB where
showsPrec =
enumShowsPrec
enumPrefixColorSpaceFB
showTableColorSpaceFB
conNameColorSpaceFB
(\(ColorSpaceFB x) -> x)
(showsPrec 11)
instance Read ColorSpaceFB where
readPrec =
enumReadPrec
enumPrefixColorSpaceFB
showTableColorSpaceFB
conNameColorSpaceFB
ColorSpaceFB
type FB_color_space_SPEC_VERSION = 1
No documentation found for TopLevel " XR_FB_color_space_SPEC_VERSION "
pattern FB_color_space_SPEC_VERSION :: forall a . Integral a => a
pattern FB_color_space_SPEC_VERSION = 1
type FB_COLOR_SPACE_EXTENSION_NAME = "XR_FB_color_space"
No documentation found for TopLevel " "
pattern FB_COLOR_SPACE_EXTENSION_NAME :: forall a . (Eq a, IsString a) => a
pattern FB_COLOR_SPACE_EXTENSION_NAME = "XR_FB_color_space"
| null | https://raw.githubusercontent.com/expipiplus1/vulkan/ebc0dde0bcd9cf251f18538de6524eb4f2ab3e9d/openxr/src/OpenXR/Extensions/XR_FB_color_space.hs | haskell | # language CPP #
| = Name
XR_FB_color_space - instance extension
= Specification
See
<#XR_FB_color_space XR_FB_color_space>
in the main specification for complete information.
= Registered Extension Number
= Revision
= Extension and Version Dependencies
= See Also
'ColorSpaceFB', 'SystemColorSpacePropertiesFB',
'enumerateColorSpacesFB', 'setColorSpaceFB'
= Document Notes
For more information, see the
<#XR_FB_color_space OpenXR Specification>
This page is a generated document. Fixes and changes should be made to
the generator scripts, not directly.
== Parameter Descriptions
- @session@ is the session that enumerates the supported color spaces.
array, or 0 to retrieve the required capacity.
- @colorSpaceCountOutput@ is a pointer to the count of 'ColorSpaceFB'
@colorSpaces@ written, or a pointer to the required capacity in the
- @colorSpaces@ is a pointer to an array of 'ColorSpaceFB' color
- See
<#buffer-size-parameters Buffer Size Parameters>
chapter for a detailed description of retrieving the required
@colorSpaces@ size.
= Description
'enumerateColorSpacesFB' enumerates the color spaces supported by the
from this enumeration for the lifetime of the session.
== Valid Usage (Implicit)
@XR_FB_color_space@ extension /must/ be enabled prior to calling
'enumerateColorSpacesFB'
be a valid 'OpenXR.Core10.Handles.Session' handle
values
== Return Codes
[<#fundamentals-successcodes Success>]
- 'OpenXR.Core10.Enums.Result.SESSION_LOSS_PENDING'
[<#fundamentals-errorcodes Failure>]
- 'OpenXR.Core10.Enums.Result.ERROR_INSTANCE_LOST'
- 'OpenXR.Core10.Enums.Result.ERROR_RUNTIME_FAILURE'
- 'OpenXR.Core10.Enums.Result.ERROR_HANDLE_INVALID'
- 'OpenXR.Core10.Enums.Result.ERROR_FUNCTION_UNSUPPORTED'
- 'OpenXR.Core10.Enums.Result.ERROR_VALIDATION_FAILURE'
= See Also
'ColorSpaceFB', 'OpenXR.Core10.Handles.Session', 'setColorSpaceFB'
No documentation found for Nested "xrEnumerateColorSpacesFB" "session"
| xrSetColorSpaceFB - Set a color space
== Parameter Descriptions
= Description
'setColorSpaceFB' provides a mechanism for an application to specify the
color space used in the final rendered frame. If this function is not
called, the session will use the color space deemed appropriate by the
'OpenXR.Core10.Enums.Result.ERROR_COLOR_SPACE_UNSUPPORTED_FB' if
@colorSpace@ is not one of the values enumerated by
'enumerateColorSpacesFB'.
== Valid Usage (Implicit)
- #VUID-xrSetColorSpaceFB-extension-notenabled# The
@XR_FB_color_space@ extension /must/ be enabled prior to calling
'setColorSpaceFB'
- #VUID-xrSetColorSpaceFB-session-parameter# @session@ /must/ be a
valid 'OpenXR.Core10.Handles.Session' handle
- #VUID-xrSetColorSpaceFB-colorspace-parameter# @colorspace@ /must/ be
a valid 'ColorSpaceFB' value
== Return Codes
[<#fundamentals-successcodes Success>]
- 'OpenXR.Core10.Enums.Result.SESSION_LOSS_PENDING'
[<#fundamentals-errorcodes Failure>]
- 'OpenXR.Core10.Enums.Result.ERROR_INSTANCE_LOST'
- 'OpenXR.Core10.Enums.Result.ERROR_RUNTIME_FAILURE'
- 'OpenXR.Core10.Enums.Result.ERROR_HANDLE_INVALID'
- 'OpenXR.Core10.Enums.Result.ERROR_COLOR_SPACE_UNSUPPORTED_FB'
- 'OpenXR.Core10.Enums.Result.ERROR_FEATURE_UNSUPPORTED'
- 'OpenXR.Core10.Enums.Result.ERROR_FUNCTION_UNSUPPORTED'
- 'OpenXR.Core10.Enums.Result.ERROR_VALIDATION_FAILURE'
= See Also
'ColorSpaceFB', 'OpenXR.Core10.Handles.Session',
'enumerateColorSpacesFB'
| @session@ is a valid 'OpenXR.Core10.Handles.Session' handle.
| XrSystemColorSpacePropertiesFB - System property for color space
== Valid Usage (Implicit)
- #VUID-XrSystemColorSpacePropertiesFB-extension-notenabled# The
@XR_FB_color_space@ extension /must/ be enabled prior to using
'SystemColorSpacePropertiesFB'
- #VUID-XrSystemColorSpacePropertiesFB-type-type# @type@ /must/ be
- #VUID-XrSystemColorSpacePropertiesFB-next-next# @next@ /must/ be
@NULL@ or a valid pointer to the
<#valid-usage-for-structure-pointer-chains next structure in a structure chain>
- #VUID-XrSystemColorSpacePropertiesFB-colorSpace-parameter#
@colorSpace@ /must/ be a valid 'ColorSpaceFB' value
= See Also
| XrColorSpaceFB - Color Space Type
= See Also
'SystemColorSpacePropertiesFB', 'enumerateColorSpacesFB',
'setColorSpaceFB'
| 'COLOR_SPACE_UNMANAGED_FB'. No color correction, not recommended for
production use.
D65 white point.
sRGB.
instead.
| 109
1
- Requires OpenXR 1.0
module OpenXR.Extensions.XR_FB_color_space ( enumerateColorSpacesFB
, setColorSpaceFB
, SystemColorSpacePropertiesFB(..)
, ColorSpaceFB( COLOR_SPACE_UNMANAGED_FB
, COLOR_SPACE_REC2020_FB
, COLOR_SPACE_REC709_FB
, COLOR_SPACE_RIFT_CV1_FB
, COLOR_SPACE_RIFT_S_FB
, COLOR_SPACE_QUEST_FB
, COLOR_SPACE_P3_FB
, COLOR_SPACE_ADOBE_RGB_FB
, ..
)
, FB_color_space_SPEC_VERSION
, pattern FB_color_space_SPEC_VERSION
, FB_COLOR_SPACE_EXTENSION_NAME
, pattern FB_COLOR_SPACE_EXTENSION_NAME
) where
import OpenXR.Internal.Utils (enumReadPrec)
import OpenXR.Internal.Utils (enumShowsPrec)
import OpenXR.Internal.Utils (traceAroundEvent)
import Control.Exception.Base (bracket)
import Control.Monad (unless)
import Control.Monad.IO.Class (liftIO)
import Foreign.Marshal.Alloc (allocaBytes)
import Foreign.Marshal.Alloc (callocBytes)
import Foreign.Marshal.Alloc (free)
import GHC.Base (when)
import GHC.IO (throwIO)
import GHC.Ptr (nullFunPtr)
import Foreign.Ptr (nullPtr)
import Foreign.Ptr (plusPtr)
import GHC.Show (showsPrec)
import Control.Monad.Trans.Class (lift)
import Control.Monad.Trans.Cont (evalContT)
import Data.Vector (generateM)
import OpenXR.CStruct (FromCStruct)
import OpenXR.CStruct (FromCStruct(..))
import OpenXR.CStruct (ToCStruct)
import OpenXR.CStruct (ToCStruct(..))
import OpenXR.Zero (Zero)
import OpenXR.Zero (Zero(..))
import Control.Monad.IO.Class (MonadIO)
import Data.String (IsString)
import Data.Typeable (Typeable)
import Foreign.Storable (Storable)
import Foreign.Storable (Storable(peek))
import Foreign.Storable (Storable(poke))
import qualified Foreign.Storable (Storable(..))
import GHC.Generics (Generic)
import GHC.IO.Exception (IOErrorType(..))
import GHC.IO.Exception (IOException(..))
import Data.Int (Int32)
import Foreign.Ptr (FunPtr)
import Foreign.Ptr (Ptr)
import GHC.Read (Read(readPrec))
import GHC.Show (Show(showsPrec))
import Data.Word (Word32)
import Data.Kind (Type)
import Control.Monad.Trans.Cont (ContT(..))
import Data.Vector (Vector)
import OpenXR.CStruct.Utils (advancePtrBytes)
import OpenXR.NamedType ((:::))
import OpenXR.Dynamic (InstanceCmds(pXrEnumerateColorSpacesFB))
import OpenXR.Dynamic (InstanceCmds(pXrSetColorSpaceFB))
import OpenXR.Exception (OpenXrException(..))
import OpenXR.Core10.Enums.Result (Result)
import OpenXR.Core10.Enums.Result (Result(..))
import OpenXR.Core10.Handles (Session)
import OpenXR.Core10.Handles (Session(..))
import OpenXR.Core10.Handles (Session(Session))
import OpenXR.Core10.Handles (Session_T)
import OpenXR.Core10.Enums.StructureType (StructureType)
import OpenXR.Core10.Enums.Result (Result(SUCCESS))
import OpenXR.Core10.Enums.StructureType (StructureType(TYPE_SYSTEM_COLOR_SPACE_PROPERTIES_FB))
foreign import ccall
#if !defined(SAFE_FOREIGN_CALLS)
unsafe
#endif
"dynamic" mkXrEnumerateColorSpacesFB
:: FunPtr (Ptr Session_T -> Word32 -> Ptr Word32 -> Ptr ColorSpaceFB -> IO Result) -> Ptr Session_T -> Word32 -> Ptr Word32 -> Ptr ColorSpaceFB -> IO Result
| xrEnumerateColorSpacesFB - Enumerates color spaces
- @colorSpaceCapacityInput@ is the capacity of the @colorSpaces@
case that @colorSpaceCapacityInput@ is @0@.
spaces , but be @NULL@ if @colorSpaceCapacityInput@ is @0@.
current session . Runtimes /must/ always return identical buffer contents
- # VUID - xrEnumerateColorSpacesFB - extension - notenabled # The
- # VUID - xrEnumerateColorSpacesFB - session - parameter # @session@ /must/
- # VUID - xrEnumerateColorSpacesFB - colorSpaceCountOutput - parameter #
@colorSpaceCountOutput@ /must/ be a pointer to a @uint32_t@ value
- # VUID - xrEnumerateColorSpacesFB - colorSpaces - parameter # If
@colorSpaceCapacityInput@ is not @0@ , @colorSpaces@ /must/ be a
pointer to an array of @colorSpaceCapacityInput@ ' ColorSpaceFB '
- ' OpenXR.Core10.Enums . Result . SUCCESS '
- ' OpenXR.Core10.Enums . Result . '
- ' OpenXR.Core10.Enums . Result . ERROR_SIZE_INSUFFICIENT '
enumerateColorSpacesFB :: forall io
. (MonadIO io)
Session
-> io (Result, ("colorSpaces" ::: Vector ColorSpaceFB))
enumerateColorSpacesFB session = liftIO . evalContT $ do
let xrEnumerateColorSpacesFBPtr = pXrEnumerateColorSpacesFB (case session of Session{instanceCmds} -> instanceCmds)
lift $ unless (xrEnumerateColorSpacesFBPtr /= nullFunPtr) $
throwIO $ IOError Nothing InvalidArgument "" "The function pointer for xrEnumerateColorSpacesFB is null" Nothing Nothing
let xrEnumerateColorSpacesFB' = mkXrEnumerateColorSpacesFB xrEnumerateColorSpacesFBPtr
let session' = sessionHandle (session)
pColorSpaceCountOutput <- ContT $ bracket (callocBytes @Word32 4) free
r <- lift $ traceAroundEvent "xrEnumerateColorSpacesFB" (xrEnumerateColorSpacesFB'
session'
(0)
(pColorSpaceCountOutput)
(nullPtr))
lift $ when (r < SUCCESS) (throwIO (OpenXrException r))
colorSpaceCountOutput <- lift $ peek @Word32 pColorSpaceCountOutput
pColorSpaces <- ContT $ bracket (callocBytes @ColorSpaceFB ((fromIntegral (colorSpaceCountOutput)) * 4)) free
r' <- lift $ traceAroundEvent "xrEnumerateColorSpacesFB" (xrEnumerateColorSpacesFB'
session'
((colorSpaceCountOutput))
(pColorSpaceCountOutput)
(pColorSpaces))
lift $ when (r' < SUCCESS) (throwIO (OpenXrException r'))
colorSpaceCountOutput' <- lift $ peek @Word32 pColorSpaceCountOutput
colorSpaces' <- lift $ generateM (fromIntegral (colorSpaceCountOutput')) (\i -> peek @ColorSpaceFB ((pColorSpaces `advancePtrBytes` (4 * (i)) :: Ptr ColorSpaceFB)))
pure $ ((r'), colorSpaces')
foreign import ccall
#if !defined(SAFE_FOREIGN_CALLS)
unsafe
#endif
"dynamic" mkXrSetColorSpaceFB
:: FunPtr (Ptr Session_T -> ColorSpaceFB -> IO Result) -> Ptr Session_T -> ColorSpaceFB -> IO Result
runtime . Facebook HMDs for both PC and Mobile product lines default to
' COLOR_SPACE_RIFT_CV1_FB ' . The runtime /must/ return
- ' OpenXR.Core10.Enums . Result . SUCCESS '
- ' OpenXR.Core10.Enums . Result . '
setColorSpaceFB :: forall io
. (MonadIO io)
Session
No documentation found for Nested " xrSetColorSpaceFB " " colorspace "
ColorSpaceFB
-> io (Result)
setColorSpaceFB session colorspace = liftIO $ do
let xrSetColorSpaceFBPtr = pXrSetColorSpaceFB (case session of Session{instanceCmds} -> instanceCmds)
unless (xrSetColorSpaceFBPtr /= nullFunPtr) $
throwIO $ IOError Nothing InvalidArgument "" "The function pointer for xrSetColorSpaceFB is null" Nothing Nothing
let xrSetColorSpaceFB' = mkXrSetColorSpaceFB xrSetColorSpaceFBPtr
r <- traceAroundEvent "xrSetColorSpaceFB" (xrSetColorSpaceFB'
(sessionHandle (session))
(colorspace))
when (r < SUCCESS) (throwIO (OpenXrException r))
pure $ (r)
' OpenXR.Core10.Enums . StructureType . TYPE_SYSTEM_COLOR_SPACE_PROPERTIES_FB '
' ColorSpaceFB ' , ' OpenXR.Core10.Enums . StructureType . StructureType '
data SystemColorSpacePropertiesFB = SystemColorSpacePropertiesFB
| @colorSpace@ is the native color space of the XR device .
colorSpace :: ColorSpaceFB }
deriving (Typeable, Eq)
#if defined(GENERIC_INSTANCES)
deriving instance Generic (SystemColorSpacePropertiesFB)
#endif
deriving instance Show SystemColorSpacePropertiesFB
instance ToCStruct SystemColorSpacePropertiesFB where
withCStruct x f = allocaBytes 24 $ \p -> pokeCStruct p x (f p)
pokeCStruct p SystemColorSpacePropertiesFB{..} f = do
poke ((p `plusPtr` 0 :: Ptr StructureType)) (TYPE_SYSTEM_COLOR_SPACE_PROPERTIES_FB)
poke ((p `plusPtr` 8 :: Ptr (Ptr ()))) (nullPtr)
poke ((p `plusPtr` 16 :: Ptr ColorSpaceFB)) (colorSpace)
f
cStructSize = 24
cStructAlignment = 8
pokeZeroCStruct p f = do
poke ((p `plusPtr` 0 :: Ptr StructureType)) (TYPE_SYSTEM_COLOR_SPACE_PROPERTIES_FB)
poke ((p `plusPtr` 8 :: Ptr (Ptr ()))) (nullPtr)
poke ((p `plusPtr` 16 :: Ptr ColorSpaceFB)) (zero)
f
instance FromCStruct SystemColorSpacePropertiesFB where
peekCStruct p = do
colorSpace <- peek @ColorSpaceFB ((p `plusPtr` 16 :: Ptr ColorSpaceFB))
pure $ SystemColorSpacePropertiesFB
colorSpace
instance Storable SystemColorSpacePropertiesFB where
sizeOf ~_ = 24
alignment ~_ = 8
peek = peekCStruct
poke ptr poked = pokeCStruct ptr poked (pure ())
instance Zero SystemColorSpacePropertiesFB where
zero = SystemColorSpacePropertiesFB
zero
= =
newtype ColorSpaceFB = ColorSpaceFB Int32
deriving newtype (Eq, Ord, Storable, Zero)
pattern COLOR_SPACE_UNMANAGED_FB = ColorSpaceFB 0
| ' ' . Standard Rec . 2020 chromacities . This is the
preferred color space for standardized color across all Oculus HMDs with
pattern COLOR_SPACE_REC2020_FB = ColorSpaceFB 1
| ' COLOR_SPACE_REC709_FB ' . Standard Rec . 709 chromaticities , similar to
pattern COLOR_SPACE_REC709_FB = ColorSpaceFB 2
| ' COLOR_SPACE_RIFT_CV1_FB ' . Unique color space , between P3 and Adobe RGB
using D75 white point .
Color Space Details with Chromacity Primaries in CIE 1931 xy :
- Red : ( 0.666 , 0.334 )
- Green : ( 0.238 , 0.714 )
- Blue : ( 0.139 , 0.053 )
- White : ( 0.298 , 0.318 )
pattern COLOR_SPACE_RIFT_CV1_FB = ColorSpaceFB 3
| ' COLOR_SPACE_RIFT_S_FB ' . Unique color space . Similar to Rec 709 using
D75 .
Color Space Details with Chromacity Primaries in CIE 1931 xy :
- Red : ( 0.640 , 0.330 )
- Green : ( 0.292 , 0.586 )
- Blue : ( 0.156 , 0.058 )
- White : ( 0.298 , 0.318 )
pattern COLOR_SPACE_RIFT_S_FB = ColorSpaceFB 4
| ' COLOR_SPACE_QUEST_FB ' . Unique color space . Similar to Rift CV1 using
D75 white point
Color Space Details with Chromacity Primaries in CIE 1931 xy :
- Red : ( 0.661 , 0.338 )
- Green : ( 0.228 , 0.718 )
- Blue : ( 0.142 , 0.042 )
- White : ( 0.298 , 0.318 )
pattern COLOR_SPACE_QUEST_FB = ColorSpaceFB 5
| ' COLOR_SPACE_P3_FB ' . Similar to DCI - P3 , but uses D65 white point
Color Space Details with Chromacity Primaries in CIE 1931 xy :
- Red : ( 0.680 , 0.320 )
- Green : ( 0.265 , 0.690 )
- Blue : ( 0.150 , 0.060 )
- White : ( 0.313 , 0.329 )
pattern COLOR_SPACE_P3_FB = ColorSpaceFB 6
| ' COLOR_SPACE_ADOBE_RGB_FB ' . Standard Adobe chromacities .
pattern COLOR_SPACE_ADOBE_RGB_FB = ColorSpaceFB 7
# COMPLETE
COLOR_SPACE_UNMANAGED_FB
, , COLOR_SPACE_REC709_FB
, COLOR_SPACE_RIFT_CV1_FB
, COLOR_SPACE_RIFT_S_FB
, COLOR_SPACE_QUEST_FB
, COLOR_SPACE_P3_FB
, COLOR_SPACE_ADOBE_RGB_FB : :
ColorSpaceFB
#
COLOR_SPACE_UNMANAGED_FB
, COLOR_SPACE_REC2020_FB
, COLOR_SPACE_REC709_FB
, COLOR_SPACE_RIFT_CV1_FB
, COLOR_SPACE_RIFT_S_FB
, COLOR_SPACE_QUEST_FB
, COLOR_SPACE_P3_FB
, COLOR_SPACE_ADOBE_RGB_FB ::
ColorSpaceFB
#-}
conNameColorSpaceFB :: String
conNameColorSpaceFB = "ColorSpaceFB"
enumPrefixColorSpaceFB :: String
enumPrefixColorSpaceFB = "COLOR_SPACE_"
showTableColorSpaceFB :: [(ColorSpaceFB, String)]
showTableColorSpaceFB =
[ (COLOR_SPACE_UNMANAGED_FB, "UNMANAGED_FB")
, (COLOR_SPACE_REC2020_FB, "REC2020_FB")
, (COLOR_SPACE_REC709_FB, "REC709_FB")
, (COLOR_SPACE_RIFT_CV1_FB, "RIFT_CV1_FB")
, (COLOR_SPACE_RIFT_S_FB, "RIFT_S_FB")
, (COLOR_SPACE_QUEST_FB, "QUEST_FB")
, (COLOR_SPACE_P3_FB, "P3_FB")
, (COLOR_SPACE_ADOBE_RGB_FB, "ADOBE_RGB_FB")
]
instance Show ColorSpaceFB where
showsPrec =
enumShowsPrec
enumPrefixColorSpaceFB
showTableColorSpaceFB
conNameColorSpaceFB
(\(ColorSpaceFB x) -> x)
(showsPrec 11)
instance Read ColorSpaceFB where
readPrec =
enumReadPrec
enumPrefixColorSpaceFB
showTableColorSpaceFB
conNameColorSpaceFB
ColorSpaceFB
type FB_color_space_SPEC_VERSION = 1
No documentation found for TopLevel " XR_FB_color_space_SPEC_VERSION "
pattern FB_color_space_SPEC_VERSION :: forall a . Integral a => a
pattern FB_color_space_SPEC_VERSION = 1
type FB_COLOR_SPACE_EXTENSION_NAME = "XR_FB_color_space"
No documentation found for TopLevel " "
pattern FB_COLOR_SPACE_EXTENSION_NAME :: forall a . (Eq a, IsString a) => a
pattern FB_COLOR_SPACE_EXTENSION_NAME = "XR_FB_color_space"
|
932f3b9528e2bb6606bbaadcd1b3b6d03d4dffa65bc644c4352c62c6176a28a4 | MaskRay/99-problems-ocaml | 19.ml | let split xs n =
let rec go acc n = function
| [] -> List.rev acc, []
| h::t as a -> if n == 0 then List.rev acc, a else go (h::acc) (n-1) t
in go [] n xs
let rotate xs n =
if xs = []
then []
else begin
let len = List.length xs in
let (a,b) = split xs (n mod len) in
b @ a
end
| null | https://raw.githubusercontent.com/MaskRay/99-problems-ocaml/652604f13ba7a73eee06d359b4db549b49ec9bb3/11-20/19.ml | ocaml | let split xs n =
let rec go acc n = function
| [] -> List.rev acc, []
| h::t as a -> if n == 0 then List.rev acc, a else go (h::acc) (n-1) t
in go [] n xs
let rotate xs n =
if xs = []
then []
else begin
let len = List.length xs in
let (a,b) = split xs (n mod len) in
b @ a
end
| |
67459e334ba355a2a457e304f63a2d78ae9541799687f7db36b985abfa0e49e0 | rudymatela/express | TH.hs | # LANGUAGE TemplateHaskell , CPP #
-- |
-- Module : Data.Express.Name.Derive
Copyright : ( c ) 2019 - 2021
License : 3 - Clause BSD ( see the file LICENSE )
Maintainer : < >
--
Template Haskell utilities .
module Data.Express.Utils.TH
( reallyDeriveCascading
, deriveWhenNeeded
, deriveWhenNeededOrWarn
, typeConArgs
, typeConArgsThat
, typeConCascadingArgsThat
, normalizeType
, normalizeTypeUnits
, isInstanceOf
, isntInstanceOf
, typeArity
, typeConstructors
, isTypeSynonym
, typeSynonymType
, mergeIFns
, mergeI
, lookupValN
, showJustName
, typeConstructorsArgNames
, (|=>|)
, (|++|)
, whereI
, unboundVars
, toBounded
, toBoundedQ
, module Language.Haskell.TH
)
where
import Control.Monad
import Data.List
import Language.Haskell.TH
import Language.Haskell.TH.Lib
deriveWhenNeeded :: Name -> (Name -> DecsQ) -> Name -> DecsQ
deriveWhenNeeded = deriveWhenNeededX False
deriveWhenNeededOrWarn :: Name -> (Name -> DecsQ) -> Name -> DecsQ
deriveWhenNeededOrWarn = deriveWhenNeededX True
deriveWhenNeededX :: Bool -> Name -> (Name -> DecsQ) -> Name -> DecsQ
deriveWhenNeededX warnExisting cls reallyDerive t = do
is <- t `isInstanceOf` cls
if is
then do
unless (not warnExisting)
(reportWarning $ "Instance " ++ showJustName cls ++ " " ++ showJustName t
++ " already exists, skipping derivation")
return []
else
reallyDerive t
-- |
Encodes a ' Name ' as a ' String ' .
-- This is useful when generating error messages.
--
-- > > showJustName ''Int
-- > "Int"
--
-- > > showJustName ''String
-- > "String"
--
-- > > showJustName ''Maybe
-- > "Maybe"
showJustName :: Name -> String
showJustName = reverse . takeWhile (/= '.') . reverse . show
reallyDeriveCascading :: Name -> (Name -> DecsQ) -> Name -> DecsQ
reallyDeriveCascading cls reallyDerive t =
return . concat
=<< mapM reallyDerive
=<< filterM (liftM not . isTypeSynonym)
=<< return . (t:) . delete t
=<< t `typeConCascadingArgsThat` (`isntInstanceOf` cls)
typeConArgs :: Name -> Q [Name]
typeConArgs t = do
is <- isTypeSynonym t
if is
then liftM typeConTs $ typeSynonymType t
else liftM (nubMerges . map typeConTs . concat . map snd) $ typeConstructors t
where
typeConTs :: Type -> [Name]
typeConTs (AppT t1 t2) = typeConTs t1 `nubMerge` typeConTs t2
typeConTs (SigT t _) = typeConTs t
typeConTs (VarT _) = []
typeConTs (ConT n) = [n]
#if __GLASGOW_HASKELL__ >= 800
-- typeConTs (PromotedT n) = [n] ?
typeConTs (InfixT t1 n t2) = typeConTs t1 `nubMerge` typeConTs t2
typeConTs (UInfixT t1 n t2) = typeConTs t1 `nubMerge` typeConTs t2
typeConTs (ParensT t) = typeConTs t
#endif
typeConTs _ = []
typeConArgsThat :: Name -> (Name -> Q Bool) -> Q [Name]
typeConArgsThat t p = do
targs <- typeConArgs t
tbs <- mapM (\t' -> do is <- p t'; return (t',is)) targs
return [t' | (t',p) <- tbs, p]
typeConCascadingArgsThat :: Name -> (Name -> Q Bool) -> Q [Name]
t `typeConCascadingArgsThat` p = do
ts <- t `typeConArgsThat` p
let p' t' = do is <- p t'; return $ t' `notElem` (t:ts) && is
tss <- mapM (`typeConCascadingArgsThat` p') ts
return $ nubMerges (ts:tss)
-- |
Normalizes a type by applying it to necessary type variables
making it accept zero type parameters .
-- The normalized type is paired with a list of necessary type variables.
--
-- > > putStrLn $(stringE . show =<< normalizeType ''Int)
-- > (ConT ''Int, [])
--
-- > > putStrLn $(stringE . show =<< normalizeType ''Maybe)
> ( AppT ( ConT '' Maybe ) ( VarT '' a),[VarT '' a ] )
--
-- > > putStrLn $(stringE . show =<< normalizeType ''Either)
-- > (AppT (AppT (ConT ''Either) (VarT ''a)) (VarT ''b),[VarT ''a,VarT ''b])
--
-- > > putStrLn $(stringE . show =<< normalizeType ''[])
> ( AppT ( ConT '' [ ] ) ( VarT a),[VarT a ] )
normalizeType :: Name -> Q (Type, [Type])
normalizeType t = do
ar <- typeArity t
vs <- newVarTs ar
return (foldl AppT (ConT t) vs, vs)
where
newNames :: [String] -> Q [Name]
newNames = mapM newName
newVarTs :: Int -> Q [Type]
newVarTs n = liftM (map VarT)
$ newNames (take n . map (:[]) $ cycle ['a'..'z'])
-- |
Normalizes a type by applying it to units to make it star - kinded .
-- (cf. 'normalizeType')
normalizeTypeUnits :: Name -> Q Type
normalizeTypeUnits t = do
ar <- typeArity t
return (foldl AppT (ConT t) (replicate ar (TupleT 0)))
-- |
-- Given a type name and a class name,
-- returns whether the type is an instance of that class.
-- The given type must be star-kinded (@ * @)
-- and the given class double-star-kinded (@ * -> * @.
--
> > putStrLn $ ( stringE . show = < < '' Int ` isInstanceOf ` '' )
-- > True
--
-- > > putStrLn $(stringE . show =<< ''Int `isInstanceOf` ''Fractional)
-- > False
isInstanceOf :: Name -> Name -> Q Bool
isInstanceOf tn cl = do
ty <- normalizeTypeUnits tn
isInstance cl [ty]
-- |
-- The negation of 'isInstanceOf'.
isntInstanceOf :: Name -> Name -> Q Bool
isntInstanceOf tn cl = liftM not (isInstanceOf tn cl)
-- | Given a type name, return the number of arguments taken by that type.
Examples in partially broken TH :
--
-- > > putStrLn $(stringE . show =<< typeArity ''Int)
-- > 0
--
-- > > putStrLn $(stringE . show =<< typeArity ''Maybe)
> 1
--
-- > > putStrLn $(stringE . show =<< typeArity ''Either)
> 2
--
-- > > putStrLn $(stringE . show =<< typeArity ''[])
> 1
--
-- > > putStrLn $(stringE . show =<< typeArity ''(,))
> 2
--
-- > > putStrLn $(stringE . show =<< typeArity ''(,,))
> 3
--
-- > > putStrLn $(stringE . show =<< typeArity ''String)
-- > 0
--
This works for Data 's and Newtype 's and it is useful when generating
-- typeclass instances.
typeArity :: Name -> Q Int
typeArity t = do
ti <- reify t
return . length $ case ti of
#if __GLASGOW_HASKELL__ < 800
TyConI (DataD _ _ ks _ _) -> ks
TyConI (NewtypeD _ _ ks _ _) -> ks
#else
TyConI (DataD _ _ ks _ _ _) -> ks
TyConI (NewtypeD _ _ ks _ _ _) -> ks
#endif
TyConI (TySynD _ ks _) -> ks
_ -> error $ "error (typeArity): symbol " ++ show t
++ " is not a newtype, data or type synonym"
-- |
-- Given a type 'Name',
-- returns a list of its type constructor 'Name's
-- paired with the type arguments they take.
-- the type arguments they take.
--
> > putStrLn $ ( stringE . show = < < typeConstructors '' )
-- > [ ('False, [])
-- > , ('True, [])
-- > ]
--
-- > > putStrLn $(stringE . show =<< typeConstructors ''[])
-- > [ ('[], [])
-- > , ('(:), [VarT ''a, AppT ListT (VarT ''a)])
-- > ]
--
-- > > putStrLn $(stringE . show =<< typeConstructors ''(,))
-- > [('(,), [VarT (mkName "a"), VarT (mkName "b")])]
--
-- > > data Point = Pt Int Int
-- > > putStrLn $(stringE . show =<< typeConstructors ''Point)
-- > [('Pt,[ConT ''Int, ConT ''Int])]
typeConstructors :: Name -> Q [(Name,[Type])]
typeConstructors t = do
ti <- reify t
return . map simplify $ case ti of
#if __GLASGOW_HASKELL__ < 800
TyConI (DataD _ _ _ cs _) -> cs
TyConI (NewtypeD _ _ _ c _) -> [c]
#else
TyConI (DataD _ _ _ _ cs _) -> cs
TyConI (NewtypeD _ _ _ _ c _) -> [c]
#endif
_ -> error $ "error (typeConstructors): symbol " ++ show t
++ " is neither newtype nor data"
where
simplify (NormalC n ts) = (n,map snd ts)
simplify (RecC n ts) = (n,map trd ts)
simplify (InfixC t1 n t2) = (n,[snd t1,snd t2])
trd (x,y,z) = z
-- |
-- Is the given 'Name' a type synonym?
--
-- > > putStrLn $(stringE . show =<< isTypeSynonym 'show)
-- > False
--
> > putStrLn $ ( stringE . show = < < isTypeSynonym '' )
-- > False
--
-- > > putStrLn $(stringE . show =<< isTypeSynonym ''String)
-- > True
isTypeSynonym :: Name -> Q Bool
isTypeSynonym t = do
ti <- reify t
return $ case ti of
TyConI (TySynD _ _ _) -> True
_ -> False
-- |
Resolves a type synonym .
--
-- > > putStrLn $(stringE . show =<< typeSynonymType ''String)
> AppT ListT ( ConT '' )
typeSynonymType :: Name -> Q Type
typeSynonymType t = do
ti <- reify t
return $ case ti of
TyConI (TySynD _ _ t') -> t'
_ -> error $ "error (typeSynonymType): symbol " ++ show t
++ " is not a type synonym"
-- Append to instance contexts in a declaration.
--
-- > sequence [[|Eq b|],[|Eq c|]] |=>| [t|instance Eq a => Cl (Ty a) where f=g|]
> = = [ t| instance ( Eq a , Eq b , Eq c ) = > Cl ( Ty a ) where f = g | ]
(|=>|) :: Cxt -> DecsQ -> DecsQ
c |=>| qds = do ds <- qds
return $ map (`ac` c) ds
#if __GLASGOW_HASKELL__ < 800
where ac (InstanceD c ts ds) c' = InstanceD (c++c') ts ds
ac d _ = d
#else
where ac (InstanceD o c ts ds) c' = InstanceD o (c++c') ts ds
ac d _ = d
#endif
(|++|) :: DecsQ -> DecsQ -> DecsQ
(|++|) = liftM2 (++)
mergeIFns :: DecsQ -> DecsQ
mergeIFns qds = do ds <- qds
return $ map m' ds
where
#if __GLASGOW_HASKELL__ < 800
m' (InstanceD c ts ds) = InstanceD c ts [foldr1 m ds]
#else
m' (InstanceD o c ts ds) = InstanceD o c ts [foldr1 m ds]
#endif
FunD n cs1 `m` FunD _ cs2 = FunD n (cs1 ++ cs2)
mergeI :: DecsQ -> DecsQ -> DecsQ
qds1 `mergeI` qds2 = do ds1 <- qds1
ds2 <- qds2
return $ ds1 `m` ds2
where
#if __GLASGOW_HASKELL__ < 800
[InstanceD c ts ds1] `m` [InstanceD _ _ ds2] = [InstanceD c ts (ds1 ++ ds2)]
#else
[InstanceD o c ts ds1] `m` [InstanceD _ _ _ ds2] = [InstanceD o c ts (ds1 ++ ds2)]
#endif
whereI :: DecsQ -> [Dec] -> DecsQ
qds `whereI` w = do ds <- qds
return $ map (`aw` w) ds
#if __GLASGOW_HASKELL__ < 800
where aw (InstanceD c ts ds) w' = InstanceD c ts (ds++w')
aw d _ = d
#else
where aw (InstanceD o c ts ds) w' = InstanceD o c ts (ds++w')
aw d _ = d
#endif
-- > nubMerge xs ys == nub (merge xs ys)
-- > nubMerge xs ys == nub (sort (xs ++ ys))
nubMerge :: Ord a => [a] -> [a] -> [a]
nubMerge [] ys = ys
nubMerge xs [] = xs
nubMerge (x:xs) (y:ys) | x < y = x : xs `nubMerge` (y:ys)
| x > y = y : (x:xs) `nubMerge` ys
| otherwise = x : xs `nubMerge` ys
nubMerges :: Ord a => [[a]] -> [a]
nubMerges = foldr nubMerge []
typeConstructorsArgNames :: Name -> Q [(Name,[Name])]
typeConstructorsArgNames t = do
cs <- typeConstructors t
sequence [ do ns <- sequence [newName "x" | _ <- ts]
return (c,ns)
| (c,ts) <- cs ]
-- | Lookups the name of a value
-- throwing an error when it is not found.
--
-- > > putStrLn $(stringE . show =<< lookupValN "show")
-- > 'show
lookupValN :: String -> Q Name
lookupValN s = do
mn <- lookupValueName s
case mn of
Just n -> return n
Nothing -> fail $ "lookupValN: cannot find " ++ s
-- | Lists all unbound variables in a type.
-- This intentionally excludes the 'ForallT' constructor.
unboundVars :: Type -> [Name]
unboundVars (VarT n) = [n]
unboundVars (AppT t1 t2) = nubMerge (unboundVars t1) (unboundVars t2)
unboundVars (SigT t _) = unboundVars t
unboundVars (ForallT vs _ t) = unboundVars t \\ map nm vs
where
#if __GLASGOW_HASKELL__ < 900
nm (PlainTV n) = n
nm (KindedTV n _) = n
#else
nm (PlainTV n _) = n
nm (KindedTV n _ _) = n
#endif
unboundVars _ = []
-- | Binds all unbound variables using a 'ForallT' constructor.
-- (cf. 'unboundVars')
toBounded :: Type -> Type
#if __GLASGOW_HASKELL__ < 900
toBounded t = ForallT [PlainTV n | n <- unboundVars t] [] t
#else
toBounded t = ForallT [PlainTV n SpecifiedSpec | n <- unboundVars t] [] t
#endif
-- | Same as toBounded but lifted over 'Q'
toBoundedQ :: TypeQ -> TypeQ
toBoundedQ = liftM toBounded
| null | https://raw.githubusercontent.com/rudymatela/express/936212c3cbe441f8144bcced502da023e8b2412d/src/Data/Express/Utils/TH.hs | haskell | |
Module : Data.Express.Name.Derive
|
This is useful when generating error messages.
> > showJustName ''Int
> "Int"
> > showJustName ''String
> "String"
> > showJustName ''Maybe
> "Maybe"
typeConTs (PromotedT n) = [n] ?
|
The normalized type is paired with a list of necessary type variables.
> > putStrLn $(stringE . show =<< normalizeType ''Int)
> (ConT ''Int, [])
> > putStrLn $(stringE . show =<< normalizeType ''Maybe)
> > putStrLn $(stringE . show =<< normalizeType ''Either)
> (AppT (AppT (ConT ''Either) (VarT ''a)) (VarT ''b),[VarT ''a,VarT ''b])
> > putStrLn $(stringE . show =<< normalizeType ''[])
|
(cf. 'normalizeType')
|
Given a type name and a class name,
returns whether the type is an instance of that class.
The given type must be star-kinded (@ * @)
and the given class double-star-kinded (@ * -> * @.
> True
> > putStrLn $(stringE . show =<< ''Int `isInstanceOf` ''Fractional)
> False
|
The negation of 'isInstanceOf'.
| Given a type name, return the number of arguments taken by that type.
> > putStrLn $(stringE . show =<< typeArity ''Int)
> 0
> > putStrLn $(stringE . show =<< typeArity ''Maybe)
> > putStrLn $(stringE . show =<< typeArity ''Either)
> > putStrLn $(stringE . show =<< typeArity ''[])
> > putStrLn $(stringE . show =<< typeArity ''(,))
> > putStrLn $(stringE . show =<< typeArity ''(,,))
> > putStrLn $(stringE . show =<< typeArity ''String)
> 0
typeclass instances.
|
Given a type 'Name',
returns a list of its type constructor 'Name's
paired with the type arguments they take.
the type arguments they take.
> [ ('False, [])
> , ('True, [])
> ]
> > putStrLn $(stringE . show =<< typeConstructors ''[])
> [ ('[], [])
> , ('(:), [VarT ''a, AppT ListT (VarT ''a)])
> ]
> > putStrLn $(stringE . show =<< typeConstructors ''(,))
> [('(,), [VarT (mkName "a"), VarT (mkName "b")])]
> > data Point = Pt Int Int
> > putStrLn $(stringE . show =<< typeConstructors ''Point)
> [('Pt,[ConT ''Int, ConT ''Int])]
|
Is the given 'Name' a type synonym?
> > putStrLn $(stringE . show =<< isTypeSynonym 'show)
> False
> False
> > putStrLn $(stringE . show =<< isTypeSynonym ''String)
> True
|
> > putStrLn $(stringE . show =<< typeSynonymType ''String)
Append to instance contexts in a declaration.
> sequence [[|Eq b|],[|Eq c|]] |=>| [t|instance Eq a => Cl (Ty a) where f=g|]
> nubMerge xs ys == nub (merge xs ys)
> nubMerge xs ys == nub (sort (xs ++ ys))
| Lookups the name of a value
throwing an error when it is not found.
> > putStrLn $(stringE . show =<< lookupValN "show")
> 'show
| Lists all unbound variables in a type.
This intentionally excludes the 'ForallT' constructor.
| Binds all unbound variables using a 'ForallT' constructor.
(cf. 'unboundVars')
| Same as toBounded but lifted over 'Q' | # LANGUAGE TemplateHaskell , CPP #
Copyright : ( c ) 2019 - 2021
License : 3 - Clause BSD ( see the file LICENSE )
Maintainer : < >
Template Haskell utilities .
module Data.Express.Utils.TH
( reallyDeriveCascading
, deriveWhenNeeded
, deriveWhenNeededOrWarn
, typeConArgs
, typeConArgsThat
, typeConCascadingArgsThat
, normalizeType
, normalizeTypeUnits
, isInstanceOf
, isntInstanceOf
, typeArity
, typeConstructors
, isTypeSynonym
, typeSynonymType
, mergeIFns
, mergeI
, lookupValN
, showJustName
, typeConstructorsArgNames
, (|=>|)
, (|++|)
, whereI
, unboundVars
, toBounded
, toBoundedQ
, module Language.Haskell.TH
)
where
import Control.Monad
import Data.List
import Language.Haskell.TH
import Language.Haskell.TH.Lib
deriveWhenNeeded :: Name -> (Name -> DecsQ) -> Name -> DecsQ
deriveWhenNeeded = deriveWhenNeededX False
deriveWhenNeededOrWarn :: Name -> (Name -> DecsQ) -> Name -> DecsQ
deriveWhenNeededOrWarn = deriveWhenNeededX True
deriveWhenNeededX :: Bool -> Name -> (Name -> DecsQ) -> Name -> DecsQ
deriveWhenNeededX warnExisting cls reallyDerive t = do
is <- t `isInstanceOf` cls
if is
then do
unless (not warnExisting)
(reportWarning $ "Instance " ++ showJustName cls ++ " " ++ showJustName t
++ " already exists, skipping derivation")
return []
else
reallyDerive t
Encodes a ' Name ' as a ' String ' .
showJustName :: Name -> String
showJustName = reverse . takeWhile (/= '.') . reverse . show
reallyDeriveCascading :: Name -> (Name -> DecsQ) -> Name -> DecsQ
reallyDeriveCascading cls reallyDerive t =
return . concat
=<< mapM reallyDerive
=<< filterM (liftM not . isTypeSynonym)
=<< return . (t:) . delete t
=<< t `typeConCascadingArgsThat` (`isntInstanceOf` cls)
typeConArgs :: Name -> Q [Name]
typeConArgs t = do
is <- isTypeSynonym t
if is
then liftM typeConTs $ typeSynonymType t
else liftM (nubMerges . map typeConTs . concat . map snd) $ typeConstructors t
where
typeConTs :: Type -> [Name]
typeConTs (AppT t1 t2) = typeConTs t1 `nubMerge` typeConTs t2
typeConTs (SigT t _) = typeConTs t
typeConTs (VarT _) = []
typeConTs (ConT n) = [n]
#if __GLASGOW_HASKELL__ >= 800
typeConTs (InfixT t1 n t2) = typeConTs t1 `nubMerge` typeConTs t2
typeConTs (UInfixT t1 n t2) = typeConTs t1 `nubMerge` typeConTs t2
typeConTs (ParensT t) = typeConTs t
#endif
typeConTs _ = []
typeConArgsThat :: Name -> (Name -> Q Bool) -> Q [Name]
typeConArgsThat t p = do
targs <- typeConArgs t
tbs <- mapM (\t' -> do is <- p t'; return (t',is)) targs
return [t' | (t',p) <- tbs, p]
typeConCascadingArgsThat :: Name -> (Name -> Q Bool) -> Q [Name]
t `typeConCascadingArgsThat` p = do
ts <- t `typeConArgsThat` p
let p' t' = do is <- p t'; return $ t' `notElem` (t:ts) && is
tss <- mapM (`typeConCascadingArgsThat` p') ts
return $ nubMerges (ts:tss)
Normalizes a type by applying it to necessary type variables
making it accept zero type parameters .
> ( AppT ( ConT '' Maybe ) ( VarT '' a),[VarT '' a ] )
> ( AppT ( ConT '' [ ] ) ( VarT a),[VarT a ] )
normalizeType :: Name -> Q (Type, [Type])
normalizeType t = do
ar <- typeArity t
vs <- newVarTs ar
return (foldl AppT (ConT t) vs, vs)
where
newNames :: [String] -> Q [Name]
newNames = mapM newName
newVarTs :: Int -> Q [Type]
newVarTs n = liftM (map VarT)
$ newNames (take n . map (:[]) $ cycle ['a'..'z'])
Normalizes a type by applying it to units to make it star - kinded .
normalizeTypeUnits :: Name -> Q Type
normalizeTypeUnits t = do
ar <- typeArity t
return (foldl AppT (ConT t) (replicate ar (TupleT 0)))
> > putStrLn $ ( stringE . show = < < '' Int ` isInstanceOf ` '' )
isInstanceOf :: Name -> Name -> Q Bool
isInstanceOf tn cl = do
ty <- normalizeTypeUnits tn
isInstance cl [ty]
isntInstanceOf :: Name -> Name -> Q Bool
isntInstanceOf tn cl = liftM not (isInstanceOf tn cl)
Examples in partially broken TH :
> 1
> 2
> 1
> 2
> 3
This works for Data 's and Newtype 's and it is useful when generating
typeArity :: Name -> Q Int
typeArity t = do
ti <- reify t
return . length $ case ti of
#if __GLASGOW_HASKELL__ < 800
TyConI (DataD _ _ ks _ _) -> ks
TyConI (NewtypeD _ _ ks _ _) -> ks
#else
TyConI (DataD _ _ ks _ _ _) -> ks
TyConI (NewtypeD _ _ ks _ _ _) -> ks
#endif
TyConI (TySynD _ ks _) -> ks
_ -> error $ "error (typeArity): symbol " ++ show t
++ " is not a newtype, data or type synonym"
> > putStrLn $ ( stringE . show = < < typeConstructors '' )
typeConstructors :: Name -> Q [(Name,[Type])]
typeConstructors t = do
ti <- reify t
return . map simplify $ case ti of
#if __GLASGOW_HASKELL__ < 800
TyConI (DataD _ _ _ cs _) -> cs
TyConI (NewtypeD _ _ _ c _) -> [c]
#else
TyConI (DataD _ _ _ _ cs _) -> cs
TyConI (NewtypeD _ _ _ _ c _) -> [c]
#endif
_ -> error $ "error (typeConstructors): symbol " ++ show t
++ " is neither newtype nor data"
where
simplify (NormalC n ts) = (n,map snd ts)
simplify (RecC n ts) = (n,map trd ts)
simplify (InfixC t1 n t2) = (n,[snd t1,snd t2])
trd (x,y,z) = z
> > putStrLn $ ( stringE . show = < < isTypeSynonym '' )
isTypeSynonym :: Name -> Q Bool
isTypeSynonym t = do
ti <- reify t
return $ case ti of
TyConI (TySynD _ _ _) -> True
_ -> False
Resolves a type synonym .
> AppT ListT ( ConT '' )
typeSynonymType :: Name -> Q Type
typeSynonymType t = do
ti <- reify t
return $ case ti of
TyConI (TySynD _ _ t') -> t'
_ -> error $ "error (typeSynonymType): symbol " ++ show t
++ " is not a type synonym"
> = = [ t| instance ( Eq a , Eq b , Eq c ) = > Cl ( Ty a ) where f = g | ]
(|=>|) :: Cxt -> DecsQ -> DecsQ
c |=>| qds = do ds <- qds
return $ map (`ac` c) ds
#if __GLASGOW_HASKELL__ < 800
where ac (InstanceD c ts ds) c' = InstanceD (c++c') ts ds
ac d _ = d
#else
where ac (InstanceD o c ts ds) c' = InstanceD o (c++c') ts ds
ac d _ = d
#endif
(|++|) :: DecsQ -> DecsQ -> DecsQ
(|++|) = liftM2 (++)
mergeIFns :: DecsQ -> DecsQ
mergeIFns qds = do ds <- qds
return $ map m' ds
where
#if __GLASGOW_HASKELL__ < 800
m' (InstanceD c ts ds) = InstanceD c ts [foldr1 m ds]
#else
m' (InstanceD o c ts ds) = InstanceD o c ts [foldr1 m ds]
#endif
FunD n cs1 `m` FunD _ cs2 = FunD n (cs1 ++ cs2)
mergeI :: DecsQ -> DecsQ -> DecsQ
qds1 `mergeI` qds2 = do ds1 <- qds1
ds2 <- qds2
return $ ds1 `m` ds2
where
#if __GLASGOW_HASKELL__ < 800
[InstanceD c ts ds1] `m` [InstanceD _ _ ds2] = [InstanceD c ts (ds1 ++ ds2)]
#else
[InstanceD o c ts ds1] `m` [InstanceD _ _ _ ds2] = [InstanceD o c ts (ds1 ++ ds2)]
#endif
whereI :: DecsQ -> [Dec] -> DecsQ
qds `whereI` w = do ds <- qds
return $ map (`aw` w) ds
#if __GLASGOW_HASKELL__ < 800
where aw (InstanceD c ts ds) w' = InstanceD c ts (ds++w')
aw d _ = d
#else
where aw (InstanceD o c ts ds) w' = InstanceD o c ts (ds++w')
aw d _ = d
#endif
nubMerge :: Ord a => [a] -> [a] -> [a]
nubMerge [] ys = ys
nubMerge xs [] = xs
nubMerge (x:xs) (y:ys) | x < y = x : xs `nubMerge` (y:ys)
| x > y = y : (x:xs) `nubMerge` ys
| otherwise = x : xs `nubMerge` ys
nubMerges :: Ord a => [[a]] -> [a]
nubMerges = foldr nubMerge []
typeConstructorsArgNames :: Name -> Q [(Name,[Name])]
typeConstructorsArgNames t = do
cs <- typeConstructors t
sequence [ do ns <- sequence [newName "x" | _ <- ts]
return (c,ns)
| (c,ts) <- cs ]
lookupValN :: String -> Q Name
lookupValN s = do
mn <- lookupValueName s
case mn of
Just n -> return n
Nothing -> fail $ "lookupValN: cannot find " ++ s
unboundVars :: Type -> [Name]
unboundVars (VarT n) = [n]
unboundVars (AppT t1 t2) = nubMerge (unboundVars t1) (unboundVars t2)
unboundVars (SigT t _) = unboundVars t
unboundVars (ForallT vs _ t) = unboundVars t \\ map nm vs
where
#if __GLASGOW_HASKELL__ < 900
nm (PlainTV n) = n
nm (KindedTV n _) = n
#else
nm (PlainTV n _) = n
nm (KindedTV n _ _) = n
#endif
unboundVars _ = []
toBounded :: Type -> Type
#if __GLASGOW_HASKELL__ < 900
toBounded t = ForallT [PlainTV n | n <- unboundVars t] [] t
#else
toBounded t = ForallT [PlainTV n SpecifiedSpec | n <- unboundVars t] [] t
#endif
toBoundedQ :: TypeQ -> TypeQ
toBoundedQ = liftM toBounded
|
0ab24e618a887d3a0a757a08c04d63381e046531460f0867ebfbb791397267ab | dbuenzli/stdlib-utf | utf_uchar.ml | (**************************************************************************)
(* *)
(* OCaml *)
(* *)
(* The OCaml programmers *)
(* *)
Copyright 2021 Institut National de Recherche en Informatique et
(* en Automatique. *)
(* *)
(* All rights reserved. This file is distributed under the terms of *)
the GNU Lesser General Public License version 2.1 , with the
(* special exception on linking described in the file LICENSE. *)
(* *)
(**************************************************************************)
include Uchar
UTF codecs tools
type utf_decode = int
This is an int [ 0xDUUUUUU ] decomposed as follows :
- [ D ] is four bits for decode information , the highest bit is set if the
decode is valid . The three lower bits indicate the number of elements
from the source that were consumed by the decode .
- [ UUUUUU ] is the decoded Unicode character or the Unicode replacement
character U+FFFD if for invalid decodes .
- [D] is four bits for decode information, the highest bit is set if the
decode is valid. The three lower bits indicate the number of elements
from the source that were consumed by the decode.
- [UUUUUU] is the decoded Unicode character or the Unicode replacement
character U+FFFD if for invalid decodes. *)
let valid_bit = 27
let decode_bits = 24
let[@inline] utf_decode_is_valid d = (d lsr valid_bit) = 1
let[@inline] utf_decode_length d = (d lsr decode_bits) land 0b111
let[@inline] utf_decode_uchar d = Uchar.unsafe_of_int (d land 0xFFFFFF)
let[@inline] utf_decode n u = ((8 lor n) lsl decode_bits) lor (Uchar.to_int u)
let[@inline] utf_decode_invalid n = (n lsl decode_bits) lor 0xFFFD (* rep *)
let utf_8_byte_length u = match to_int u with
| u when u < 0 -> assert false
| u when u <= 0x007F -> 1
| u when u <= 0x07FF -> 2
| u when u <= 0xFFFF -> 3
| u when u <= 0x10FFFF -> 4
| _ -> assert false
let utf_16_byte_length u = match to_int u with
| u when u < 0 -> assert false
| u when u <= 0xFFFF -> 2
| u when u <= 0x10FFFF -> 4
| _ -> assert false
| null | https://raw.githubusercontent.com/dbuenzli/stdlib-utf/9e931944697ff6b48a54a10b425a9acdbd4ccb40/utf_uchar.ml | ocaml | ************************************************************************
OCaml
The OCaml programmers
en Automatique.
All rights reserved. This file is distributed under the terms of
special exception on linking described in the file LICENSE.
************************************************************************
rep | Copyright 2021 Institut National de Recherche en Informatique et
the GNU Lesser General Public License version 2.1 , with the
include Uchar
UTF codecs tools
type utf_decode = int
This is an int [ 0xDUUUUUU ] decomposed as follows :
- [ D ] is four bits for decode information , the highest bit is set if the
decode is valid . The three lower bits indicate the number of elements
from the source that were consumed by the decode .
- [ UUUUUU ] is the decoded Unicode character or the Unicode replacement
character U+FFFD if for invalid decodes .
- [D] is four bits for decode information, the highest bit is set if the
decode is valid. The three lower bits indicate the number of elements
from the source that were consumed by the decode.
- [UUUUUU] is the decoded Unicode character or the Unicode replacement
character U+FFFD if for invalid decodes. *)
let valid_bit = 27
let decode_bits = 24
let[@inline] utf_decode_is_valid d = (d lsr valid_bit) = 1
let[@inline] utf_decode_length d = (d lsr decode_bits) land 0b111
let[@inline] utf_decode_uchar d = Uchar.unsafe_of_int (d land 0xFFFFFF)
let[@inline] utf_decode n u = ((8 lor n) lsl decode_bits) lor (Uchar.to_int u)
let utf_8_byte_length u = match to_int u with
| u when u < 0 -> assert false
| u when u <= 0x007F -> 1
| u when u <= 0x07FF -> 2
| u when u <= 0xFFFF -> 3
| u when u <= 0x10FFFF -> 4
| _ -> assert false
let utf_16_byte_length u = match to_int u with
| u when u < 0 -> assert false
| u when u <= 0xFFFF -> 2
| u when u <= 0x10FFFF -> 4
| _ -> assert false
|
0ffdf91f3da92520c9a618649ef1adbeafdc5fbec46f0bf4206ded23ccda5757 | racket/expeditor | port.rkt | #lang racket/base
(provide open-input-string/count
input-port-position)
(define (open-input-string/count s)
(define p (open-input-string s))
(port-count-lines! p)
p)
(define (input-port-position s)
(define-values (lin col pos) (port-next-location s))
(sub1 pos))
| null | https://raw.githubusercontent.com/racket/expeditor/f4967d687c690ff1e44d376260bd2d11f9331b00/expeditor-lib/private/port.rkt | racket | #lang racket/base
(provide open-input-string/count
input-port-position)
(define (open-input-string/count s)
(define p (open-input-string s))
(port-count-lines! p)
p)
(define (input-port-position s)
(define-values (lin col pos) (port-next-location s))
(sub1 pos))
| |
14dcb557d05a88cc788d1cc043a5aac1b610a49179b23b6a0153f6c1a8dcb147 | amnh/ocamion | simplex.mli | * { 1 Simplex Method }
The simplex uses an n+1 dimensional figure to move , like an amoeba , around
the surface . The extremities of the object are evaluated , the maximal values
are modified , while the others are progressed through improvements . The four
moves that can be done on the simplex are : reflection , expansion ,
contraction , and shrinkage . The degree to which these are done is modified
by the strategy used .
{ b References }
+
+
The simplex uses an n+1 dimensional figure to move, like an amoeba, around
the surface. The extremities of the object are evaluated, the maximal values
are modified, while the others are progressed through improvements. The four
moves that can be done on the simplex are: reflection, expansion,
contraction, and shrinkage. The degree to which these are done is modified
by the strategy used.
{b References}
+
+
*)
(** {2 Types} *)
(** Define a simplex as a collection of points with attached data *)
type 'a simplex =
(float array * ('a * float)) array
(** Simplex strategy defines how to expand, contract, and reflect a simplex *)
type simplex_strategy =
{ alpha : float; (** The Reflection factor *)
beta : float; (** The Contraction factor *)
gamma : float; (** The Expansion factor *)
delta : float; (** The Shrinkage (Massive Contraction) factor *)
}
* { 2 Default Strategy }
* Default Simplex Strategy defined by NMS .
[ { alpha = 1.0 ; beta = 0.5 ; gamma = 2.0 ; delta = 0.5 ; } ]
[{alpha = 1.0; beta = 0.5; gamma = 2.0; delta = 0.5;}] *)
val default_simplex : simplex_strategy
* { 2 Given Termination Functions }
(** termination is done through the standard deviation of the elements of the simplex. *)
val simplex_termination_stddev : float -> 'a simplex -> bool
* Simplex termination test defined by , Murray and . This method
looks to see that the points are in a stationary position . This is more
appropriate for optimizing smooth functions . It can also be used for noisy
functions , but would be equivalent to convergence of the simplex .
looks to see that the points are in a stationary position. This is more
appropriate for optimizing smooth functions. It can also be used for noisy
functions, but would be equivalent to convergence of the simplex. *)
val simplex_termination_stationary : float -> 'a simplex -> bool
* { 2 Given Initialization Functions }
(** Set up the initial simplex by randomly selecting points *)
val random_simplex :
(float array -> 'a * float) -> float array * ('a * float) -> float array option -> 'a simplex
(** Set up the initial simplex from a point and a step size *)
val initial_simplex :
(float array -> 'a * float) -> float array * ('a * float) -> float array option -> 'a simplex
* { 2 Optimization Routines }
(** [optimize ?termination_test ?tol ?simplex_strategy ?max_iter ?step f i]
*)
val optimize :
?termination_test:(float -> 'a simplex -> bool) -> ?tol:float ->
?simplex_strategy:simplex_strategy -> ?max_iter:int ->
?step:float array option -> f:(float array -> 'a * float) ->
float array * ('a * float) -> float array * ('a * float)
| null | https://raw.githubusercontent.com/amnh/ocamion/699c2471b7fdac12f061cf24b588f9eef5bf5cb8/lib/simplex.mli | ocaml | * {2 Types}
* Define a simplex as a collection of points with attached data
* Simplex strategy defines how to expand, contract, and reflect a simplex
* The Reflection factor
* The Contraction factor
* The Expansion factor
* The Shrinkage (Massive Contraction) factor
* termination is done through the standard deviation of the elements of the simplex.
* Set up the initial simplex by randomly selecting points
* Set up the initial simplex from a point and a step size
* [optimize ?termination_test ?tol ?simplex_strategy ?max_iter ?step f i]
| * { 1 Simplex Method }
The simplex uses an n+1 dimensional figure to move , like an amoeba , around
the surface . The extremities of the object are evaluated , the maximal values
are modified , while the others are progressed through improvements . The four
moves that can be done on the simplex are : reflection , expansion ,
contraction , and shrinkage . The degree to which these are done is modified
by the strategy used .
{ b References }
+
+
The simplex uses an n+1 dimensional figure to move, like an amoeba, around
the surface. The extremities of the object are evaluated, the maximal values
are modified, while the others are progressed through improvements. The four
moves that can be done on the simplex are: reflection, expansion,
contraction, and shrinkage. The degree to which these are done is modified
by the strategy used.
{b References}
+
+
*)
type 'a simplex =
(float array * ('a * float)) array
type simplex_strategy =
}
* { 2 Default Strategy }
* Default Simplex Strategy defined by NMS .
[ { alpha = 1.0 ; beta = 0.5 ; gamma = 2.0 ; delta = 0.5 ; } ]
[{alpha = 1.0; beta = 0.5; gamma = 2.0; delta = 0.5;}] *)
val default_simplex : simplex_strategy
* { 2 Given Termination Functions }
val simplex_termination_stddev : float -> 'a simplex -> bool
* Simplex termination test defined by , Murray and . This method
looks to see that the points are in a stationary position . This is more
appropriate for optimizing smooth functions . It can also be used for noisy
functions , but would be equivalent to convergence of the simplex .
looks to see that the points are in a stationary position. This is more
appropriate for optimizing smooth functions. It can also be used for noisy
functions, but would be equivalent to convergence of the simplex. *)
val simplex_termination_stationary : float -> 'a simplex -> bool
* { 2 Given Initialization Functions }
val random_simplex :
(float array -> 'a * float) -> float array * ('a * float) -> float array option -> 'a simplex
val initial_simplex :
(float array -> 'a * float) -> float array * ('a * float) -> float array option -> 'a simplex
* { 2 Optimization Routines }
val optimize :
?termination_test:(float -> 'a simplex -> bool) -> ?tol:float ->
?simplex_strategy:simplex_strategy -> ?max_iter:int ->
?step:float array option -> f:(float array -> 'a * float) ->
float array * ('a * float) -> float array * ('a * float)
|
082448a4294bdf93b9ed26e3ab1e516768d37e52141dfd441ba160cd9bb1081a | bsaleil/lc | fftrad4.scm.scm | ;;------------------------------------------------------------------------------
Macros
(##define-macro (def-macro form . body)
`(##define-macro ,form (let () ,@body)))
(def-macro (FLOATvector-const . lst) `',(list->vector lst))
(def-macro (FLOATvector? x) `(vector? ,x))
(def-macro (FLOATvector . lst) `(vector ,@lst))
(def-macro (FLOATmake-vector n . init) `(make-vector ,n ,@init))
(def-macro (FLOATvector-ref v i) `(vector-ref ,v ,i))
(def-macro (FLOATvector-set! v i x) `(vector-set! ,v ,i ,x))
(def-macro (FLOATvector-length v) `(vector-length ,v))
(def-macro (nuc-const . lst)
`',(list->vector lst))
(def-macro (FLOAT+ . lst) `(+ ,@lst))
(def-macro (FLOAT- . lst) `(- ,@lst))
(def-macro (FLOAT* . lst) `(* ,@lst))
(def-macro (FLOAT/ . lst) `(/ ,@lst))
(def-macro (FLOAT= . lst) `(= ,@lst))
(def-macro (FLOAT< . lst) `(< ,@lst))
(def-macro (FLOAT<= . lst) `(<= ,@lst))
(def-macro (FLOAT> . lst) `(> ,@lst))
(def-macro (FLOAT>= . lst) `(>= ,@lst))
(def-macro (FLOATnegative? . lst) `(negative? ,@lst))
(def-macro (FLOATpositive? . lst) `(positive? ,@lst))
(def-macro (FLOATzero? . lst) `(zero? ,@lst))
(def-macro (FLOATabs . lst) `(abs ,@lst))
(def-macro (FLOATsin . lst) `(sin ,@lst))
(def-macro (FLOATcos . lst) `(cos ,@lst))
(def-macro (FLOATatan . lst) `(atan ,@lst))
(def-macro (FLOATsqrt . lst) `(sqrt ,@lst))
(def-macro (FLOATmin . lst) `(min ,@lst))
(def-macro (FLOATmax . lst) `(max ,@lst))
(def-macro (FLOATround . lst) `(round ,@lst))
(def-macro (FLOATinexact->exact . lst) `(inexact->exact ,@lst))
(def-macro (GENERIC+ . lst) `(+ ,@lst))
(def-macro (GENERIC- . lst) `(- ,@lst))
(def-macro (GENERIC* . lst) `(* ,@lst))
(def-macro (GENERIC/ . lst) `(/ ,@lst))
(def-macro (GENERICquotient . lst) `(quotient ,@lst))
(def-macro (GENERICremainder . lst) `(remainder ,@lst))
(def-macro (GENERICmodulo . lst) `(modulo ,@lst))
(def-macro (GENERIC= . lst) `(= ,@lst))
(def-macro (GENERIC< . lst) `(< ,@lst))
(def-macro (GENERIC<= . lst) `(<= ,@lst))
(def-macro (GENERIC> . lst) `(> ,@lst))
(def-macro (GENERIC>= . lst) `(>= ,@lst))
(def-macro (GENERICexpt . lst) `(expt ,@lst))
;;------------------------------------------------------------------------------
Functions used by LC to get time info
(def-macro (##lc-time expr)
(let ((sym (gensym)))
`(let ((r (##lc-exec-stats (lambda () ,expr))))
(##print-perm-string "CPU time: ")
(##print-double (+ (cdr (assoc "User time" (cdr r)))
(cdr (assoc "Sys time" (cdr r)))))
(##print-perm-string "\n")
(##print-perm-string "GC CPU time: ")
(##print-double (+ (cdr (assoc "GC user time" (cdr r)))
(cdr (assoc "GC sys time" (cdr r)))))
(##print-perm-string "\n")
(map (lambda (el)
(##print-perm-string (car el))
(##print-perm-string ": ")
(##print-double (cdr el))
(##print-perm-string "\n"))
(cdr r))
r)))
(define (##lc-exec-stats thunk)
(let* ((at-start (##process-statistics))
(result (thunk))
(at-end (##process-statistics)))
(define (get-info msg idx)
(cons msg
(- (f64vector-ref at-end idx)
(f64vector-ref at-start idx))))
(list
result
(get-info "User time" 0)
(get-info "Sys time" 1)
(get-info "Real time" 2)
(get-info "GC user time" 3)
(get-info "GC sys time" 4)
(get-info "GC real time" 5)
(get-info "Nb gcs" 6))))
;;------------------------------------------------------------------------------
(define (run-bench name count ok? run)
(let loop ((i count) (result '(undefined)))
(if (< 0 i)
(loop (- i 1) (run))
result)))
(define (run-benchmark name count ok? run-maker . args)
(let ((run (apply run-maker args)))
(let ((result (car (##lc-time (run-bench name count ok? run)))))
(if (not (ok? result))
(begin
(display "*** wrong result ***")
(newline)
(display "*** got: ")
(write result)
(newline))))))
; Gabriel benchmarks
(define boyer-iters 20)
(define browse-iters 600)
(define cpstak-iters 1000)
(define ctak-iters 100)
(define dderiv-iters 2000000)
(define deriv-iters 2000000)
(define destruc-iters 500)
(define diviter-iters 1000000)
(define divrec-iters 1000000)
(define puzzle-iters 100)
(define tak-iters 2000)
(define takl-iters 300)
(define trav1-iters 100)
(define trav2-iters 20)
(define triangl-iters 10)
and benchmarks
(define ack-iters 10)
(define array1-iters 1)
(define cat-iters 1)
(define string-iters 10)
(define sum1-iters 10)
(define sumloop-iters 10)
(define tail-iters 1)
(define wc-iters 1)
; C benchmarks
(define fft-iters 2000)
(define fib-iters 5)
(define fibfp-iters 2)
(define mbrot-iters 100)
(define nucleic-iters 5)
(define pnpoly-iters 100000)
(define sum-iters 20000)
(define sumfp-iters 20000)
(define tfib-iters 20)
; Other benchmarks
(define conform-iters 40)
(define dynamic-iters 20)
(define earley-iters 200)
(define fibc-iters 500)
(define graphs-iters 300)
(define lattice-iters 1)
(define matrix-iters 400)
(define maze-iters 4000)
(define mazefun-iters 1000)
(define nqueens-iters 2000)
(define paraffins-iters 1000)
(define peval-iters 200)
(define pi-iters 2)
(define primes-iters 100000)
(define ray-iters 5)
(define scheme-iters 20000)
(define simplex-iters 100000)
(define slatex-iters 20)
(define perm9-iters 10)
(define nboyer-iters 100)
(define sboyer-iters 100)
(define gcbench-iters 1)
(define compiler-iters 300)
(define nbody-iters 1)
(define fftrad4-iters 4)
Copyright 2018 ,
;;; Permission is hereby granted, free of charge, to any person obtaining
;;; a copy of this software and associated documentation files (the "Software"),
to deal in the Software without restriction , including without limitation
;;; the rights to use, copy, modify, merge, publish, distribute, sublicense,
and/or sell copies of the Software , and to permit persons to whom the
;;; Software is furnished to do so, subject to the following conditions:
;;;
;;; The above copyright notice and this permission notice shall be included
in all copies or substantial portions of the Software .
;;;
THE SOFTWARE IS PROVIDED " AS IS " , WITHOUT WARRANTY OF ANY KIND , EXPRESS
;;; OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
MERCHANTABILITY , FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT .
;;; IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY
CLAIM , DAMAGES OR OTHER LIABILITY , WHETHER IN AN ACTION OF CONTRACT ,
;;; TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE
;;; SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
;;;
This software calculates radix 4 direct and inverse Fast Fourier Transforms .
;;; The direct transform takes in-order input and produces out-of-order output.
;;; The inverse transform takes out-of-order input and produces in-order output.
;;;
;;; This particular code has guaranteed error bounds, see in particular
;;; the commentary at
;;;
;;; #L6395
(define lut-table-size 512)
(define lut-table-size^2 262144)
(define lut-table-size^3 134217728)
(define log-lut-table-size 9)
(define low-lut
(FLOATvector-const
1. 0.
.7071067811865476 .7071067811865476
.9238795325112867 .3826834323650898
.3826834323650898 .9238795325112867
.9807852804032304 .19509032201612828
.5555702330196022 .8314696123025452
.8314696123025452 .5555702330196022
.19509032201612828 .9807852804032304
.9951847266721969 .0980171403295606
.6343932841636455 .773010453362737
.881921264348355 .47139673682599764
.2902846772544624 .9569403357322088
.9569403357322088 .2902846772544624
.47139673682599764 .881921264348355
.773010453362737 .6343932841636455
.0980171403295606 .9951847266721969
.9987954562051724 .049067674327418015
.6715589548470184 .7409511253549591
.9039892931234433 .4275550934302821
.33688985339222005 .9415440651830208
.970031253194544 .2429801799032639
.5141027441932218 .8577286100002721
.8032075314806449 .5956993044924334
.14673047445536175 .989176509964781
.989176509964781 .14673047445536175
.5956993044924334 .8032075314806449
.8577286100002721 .5141027441932218
.2429801799032639 .970031253194544
.9415440651830208 .33688985339222005
.4275550934302821 .9039892931234433
.7409511253549591 .6715589548470184
.049067674327418015 .9987954562051724
.9996988186962042 .024541228522912288
.6895405447370669 .7242470829514669
.9142097557035307 .40524131400498986
.35989503653498817 .9329927988347388
.9757021300385286 .2191012401568698
.5349976198870973 .8448535652497071
.8175848131515837 .5758081914178453
.17096188876030122 .9852776423889412
.99247953459871 .1224106751992162
.6152315905806268 .7883464276266062
.8700869911087115 .49289819222978404
.26671275747489837 .9637760657954398
.9495281805930367 .31368174039889146
.4496113296546066 .8932243011955153
.7572088465064846 .6531728429537768
.07356456359966743 .9972904566786902
.9972904566786902 .07356456359966743
.6531728429537768 .7572088465064846
.8932243011955153 .4496113296546066
.31368174039889146 .9495281805930367
.9637760657954398 .26671275747489837
.49289819222978404 .8700869911087115
.7883464276266062 .6152315905806268
.1224106751992162 .99247953459871
.9852776423889412 .17096188876030122
.5758081914178453 .8175848131515837
.8448535652497071 .5349976198870973
.2191012401568698 .9757021300385286
.9329927988347388 .35989503653498817
.40524131400498986 .9142097557035307
.7242470829514669 .6895405447370669
.024541228522912288 .9996988186962042
.9999247018391445 .012271538285719925
.6983762494089728 .7157308252838187
.9191138516900578 .3939920400610481
.37131719395183754 .9285060804732156
.9783173707196277 .20711137619221856
.5453249884220465 .8382247055548381
.8245893027850253 .5657318107836132
.18303988795514095 .9831054874312163
.9939069700023561 .11022220729388306
.6248594881423863 .7807372285720945
.8760700941954066 .4821837720791228
.2785196893850531 .9604305194155658
.9533060403541939 .3020059493192281
.46053871095824 .8876396204028539
.765167265622459 .6438315428897915
.0857973123444399 .996312612182778
.9981181129001492 .06132073630220858
.6624157775901718 .7491363945234594
.8986744656939538 .43861623853852766
.3253102921622629 .9456073253805213
.9669764710448521 .25486565960451457
.5035383837257176 .8639728561215867
.7958369046088836 .6055110414043255
.1345807085071262 .99090263542778
.9873014181578584 .15885814333386145
.5857978574564389 .8104571982525948
.8513551931052652 .524589682678469
.2310581082806711 .9729399522055602
.937339011912575 .34841868024943456
.4164295600976372 .9091679830905224
.7326542716724128 .680600997795453
.03680722294135883 .9993223845883495
.9993223845883495 .03680722294135883
.680600997795453 .7326542716724128
.9091679830905224 .4164295600976372
.34841868024943456 .937339011912575
.9729399522055602 .2310581082806711
.524589682678469 .8513551931052652
.8104571982525948 .5857978574564389
.15885814333386145 .9873014181578584
.99090263542778 .1345807085071262
.6055110414043255 .7958369046088836
.8639728561215867 .5035383837257176
.25486565960451457 .9669764710448521
.9456073253805213 .3253102921622629
.43861623853852766 .8986744656939538
.7491363945234594 .6624157775901718
.06132073630220858 .9981181129001492
.996312612182778 .0857973123444399
.6438315428897915 .765167265622459
.8876396204028539 .46053871095824
.3020059493192281 .9533060403541939
.9604305194155658 .2785196893850531
.4821837720791228 .8760700941954066
.7807372285720945 .6248594881423863
.11022220729388306 .9939069700023561
.9831054874312163 .18303988795514095
.5657318107836132 .8245893027850253
.8382247055548381 .5453249884220465
.20711137619221856 .9783173707196277
.9285060804732156 .37131719395183754
.3939920400610481 .9191138516900578
.7157308252838187 .6983762494089728
.012271538285719925 .9999247018391445
.9999811752826011 .006135884649154475
.7027547444572253 .7114321957452164
.9215140393420419 .3883450466988263
.37700741021641826 .9262102421383114
.9795697656854405 .2011046348420919
.5504579729366048 .83486287498638
.8280450452577558 .560661576197336
.18906866414980622 .9819638691095552
.9945645707342554 .10412163387205457
.629638238914927 .7768884656732324
.8790122264286335 .47679923006332214
.2844075372112718 .9587034748958716
.9551411683057707 .29615088824362384
.4659764957679662 .8847970984309378
.7691033376455796 .6391244448637757
.09190895649713272 .9957674144676598
.9984755805732948 .05519524434968994
.6669999223036375 .745057785441466
.901348847046022 .43309381885315196
.33110630575987643 .9435934581619604
.9685220942744173 .24892760574572018
.508830142543107 .8608669386377673
.799537269107905 .600616479383869
.14065823933284924 .9900582102622971
.9882575677307495 .15279718525844344
.5907597018588743 .8068475535437992
.8545579883654005 .5193559901655896
.2370236059943672 .9715038909862518
.9394592236021899 .3426607173119944
.4220002707997997 .9065957045149153
.7368165688773699 .6760927035753159
.04293825693494082 .9990777277526454
.9995294175010931 .030674803176636626
.6850836677727004 .7284643904482252
.9117060320054299 .41084317105790397
.3541635254204904 .9351835099389476
.9743393827855759 .22508391135979283
.5298036246862947 .8481203448032972
.8140363297059484 .5808139580957645
.16491312048996992 .9863080972445987
.9917097536690995 .12849811079379317
.6103828062763095 .7921065773002124
.8670462455156926 .49822766697278187
.2607941179152755 .9653944416976894
.9475855910177411 .3195020308160157
.44412214457042926 .8959662497561851
.7531867990436125 .6578066932970786
.06744391956366406 .9977230666441916
.9968202992911657 .07968243797143013
.6485144010221124 .7612023854842618
.8904487232447579 .45508358712634384
.30784964004153487 .9514350209690083
.9621214042690416 .272621355449949
.48755016014843594 .8730949784182901
.7845565971555752 .6200572117632892
.11631863091190477 .9932119492347945
.984210092386929 .17700422041214875
.5707807458869673 .8211025149911046
.8415549774368984 .5401714727298929
.21311031991609136 .9770281426577544
.9307669610789837 .36561299780477385
.39962419984564684 .9166790599210427
.7200025079613817 .693971460889654
.01840672990580482 .9998305817958234
.9998305817958234 .01840672990580482
.693971460889654 .7200025079613817
.9166790599210427 .39962419984564684
.36561299780477385 .9307669610789837
.9770281426577544 .21311031991609136
.5401714727298929 .8415549774368984
.8211025149911046 .5707807458869673
.17700422041214875 .984210092386929
.9932119492347945 .11631863091190477
.6200572117632892 .7845565971555752
.8730949784182901 .48755016014843594
.272621355449949 .9621214042690416
.9514350209690083 .30784964004153487
.45508358712634384 .8904487232447579
.7612023854842618 .6485144010221124
.07968243797143013 .9968202992911657
.9977230666441916 .06744391956366406
.6578066932970786 .7531867990436125
.8959662497561851 .44412214457042926
.3195020308160157 .9475855910177411
.9653944416976894 .2607941179152755
.49822766697278187 .8670462455156926
.7921065773002124 .6103828062763095
.12849811079379317 .9917097536690995
.9863080972445987 .16491312048996992
.5808139580957645 .8140363297059484
.8481203448032972 .5298036246862947
.22508391135979283 .9743393827855759
.9351835099389476 .3541635254204904
.41084317105790397 .9117060320054299
.7284643904482252 .6850836677727004
.030674803176636626 .9995294175010931
.9990777277526454 .04293825693494082
.6760927035753159 .7368165688773699
.9065957045149153 .4220002707997997
.3426607173119944 .9394592236021899
.9715038909862518 .2370236059943672
.5193559901655896 .8545579883654005
.8068475535437992 .5907597018588743
.15279718525844344 .9882575677307495
.9900582102622971 .14065823933284924
.600616479383869 .799537269107905
.8608669386377673 .508830142543107
.24892760574572018 .9685220942744173
.9435934581619604 .33110630575987643
.43309381885315196 .901348847046022
.745057785441466 .6669999223036375
.05519524434968994 .9984755805732948
.9957674144676598 .09190895649713272
.6391244448637757 .7691033376455796
.8847970984309378 .4659764957679662
.29615088824362384 .9551411683057707
.9587034748958716 .2844075372112718
.47679923006332214 .8790122264286335
.7768884656732324 .629638238914927
.10412163387205457 .9945645707342554
.9819638691095552 .18906866414980622
.560661576197336 .8280450452577558
.83486287498638 .5504579729366048
.2011046348420919 .9795697656854405
.9262102421383114 .37700741021641826
.3883450466988263 .9215140393420419
.7114321957452164 .7027547444572253
.006135884649154475 .9999811752826011
.9999952938095762 .003067956762965976
.7049340803759049 .7092728264388657
.9227011283338785 .38551605384391885
.37984720892405116 .9250492407826776
.9801821359681174 .1980984107179536
.5530167055800276 .8331701647019132
.829761233794523 .5581185312205561
.19208039704989244 .9813791933137546
.9948793307948056 .10106986275482782
.6320187359398091 .7749531065948739
.8804708890521608 .47410021465055
.2873474595447295 .9578264130275329
.9560452513499964 .29321916269425863
.46868882203582796 .8833633386657316
.7710605242618138 .6367618612362842
.094963495329639 .9954807554919269
.9986402181802653 .052131704680283324
.6692825883466361 .7430079521351217
.9026733182372588 .4303264813400826
.3339996514420094 .9425731976014469
.9692812353565485 .24595505033579462
.5114688504379704 .8593018183570084
.8013761717231402 .5981607069963423
.14369503315029444 .9896220174632009
.9887216919603238 .1497645346773215
.5932322950397998 .8050313311429635
.8561473283751945 .5167317990176499
.2400030224487415 .9707721407289504
.9405060705932683 .33977688440682685
.4247796812091088 .9052967593181188
.7388873244606151 .673829000378756
.04600318213091463 .9989412931868569
.9996188224951786 .027608145778965743
.6873153408917592 .726359155084346
.9129621904283982 .4080441628649787
.35703096123343003 .9340925504042589
.9750253450669941 .22209362097320354
.532403127877198 .8464909387740521
.8158144108067338 .5783137964116556
.16793829497473117 .9857975091675675
.9920993131421918 .12545498341154623
.6128100824294097 .79023022143731
.8685707059713409 .49556526182577254
.2637546789748314 .9645897932898128
.9485613499157303 .31659337555616585
.4468688401623742 .8945994856313827
.7552013768965365 .6554928529996153
.07050457338961387 .9975114561403035
.997060070339483 .07662386139203149
.6508466849963809 .7592091889783881
.8918407093923427 .4523495872337709
.3107671527496115 .9504860739494817
.9629532668736839 .2696683255729151
.49022648328829116 .8715950866559511
.7864552135990858 .617647307937804
.11936521481099137 .9928504144598651
.9847485018019042 .17398387338746382
.5732971666980422 .819347520076797
.8432082396418454 .5375870762956455
.21610679707621952 .9763697313300211
.9318842655816681 .3627557243673972
.40243465085941843 .9154487160882678
.7221281939292153 .6917592583641577
.021474080275469508 .9997694053512153
.9998823474542126 .015339206284988102
.696177131491463 .7178700450557317
.9179007756213905 .3968099874167103
.3684668299533723 .9296408958431812
.9776773578245099 .2101118368804696
.5427507848645159 .8398937941959995
.8228497813758263 .5682589526701316
.18002290140569951 .9836624192117303
.9935641355205953 .11327095217756435
.62246127937415 .7826505961665757
.8745866522781761 .4848692480007911
.27557181931095814 .9612804858113206
.9523750127197659 .30492922973540243
.45781330359887723 .8890483558546646
.7631884172633813 .6461760129833164
.08274026454937569 .9965711457905548
.997925286198596 .06438263092985747
.6601143420674205 .7511651319096864
.8973245807054183 .44137126873171667
.32240767880106985 .9466009130832835
.9661900034454125 .257831102162159
.5008853826112408 .8655136240905691
.7939754775543372 .6079497849677736
.13154002870288312 .9913108598461154
.9868094018141855 .16188639378011183
.5833086529376983 .8122505865852039
.8497417680008524 .5271991347819014
.22807208317088573 .973644249650812
.9362656671702783 .35129275608556715
.41363831223843456 .9104412922580672
.7305627692278276 .6828455463852481
.03374117185137759 .9994306045554617
.9992047586183639 .03987292758773981
.6783500431298615 .7347388780959635
.9078861164876663 .41921688836322396
.34554132496398904 .9384035340631081
.9722264970789363 .23404195858354343
.5219752929371544 .8529606049303636
.808656181588175 .5882815482226453
.15582839765426523 .9877841416445722
.9904850842564571 .13762012158648604
.6030665985403482 .7976908409433912
.8624239561110405 .5061866453451553
.25189781815421697 .9677538370934755
.9446048372614803 .32820984357909255
.4358570799222555 .9000158920161603
.7471006059801801 .6647109782033449
.05825826450043576 .9983015449338929
.996044700901252 .0888535525825246
.6414810128085832 .7671389119358204
.8862225301488806 .4632597835518602
.2990798263080405 .9542280951091057
.9595715130819845 .281464937925758
.479493757660153 .8775452902072612
.778816512381476 .6272518154951441
.10717242495680884 .9942404494531879
.9825393022874412 .18605515166344666
.5631993440138341 .8263210628456635
.836547727223512 .5478940591731002
.20410896609281687 .9789481753190622
.9273625256504011 .374164062971458
.39117038430225387 .9203182767091106
.7135848687807936 .7005687939432483
.00920375478205982 .9999576445519639
.9999576445519639 .00920375478205982
.7005687939432483 .7135848687807936
.9203182767091106 .39117038430225387
.374164062971458 .9273625256504011
.9789481753190622 .20410896609281687
.5478940591731002 .836547727223512
.8263210628456635 .5631993440138341
.18605515166344666 .9825393022874412
.9942404494531879 .10717242495680884
.6272518154951441 .778816512381476
.8775452902072612 .479493757660153
.281464937925758 .9595715130819845
.9542280951091057 .2990798263080405
.4632597835518602 .8862225301488806
.7671389119358204 .6414810128085832
.0888535525825246 .996044700901252
.9983015449338929 .05825826450043576
.6647109782033449 .7471006059801801
.9000158920161603 .4358570799222555
.32820984357909255 .9446048372614803
.9677538370934755 .25189781815421697
.5061866453451553 .8624239561110405
.7976908409433912 .6030665985403482
.13762012158648604 .9904850842564571
.9877841416445722 .15582839765426523
.5882815482226453 .808656181588175
.8529606049303636 .5219752929371544
.23404195858354343 .9722264970789363
.9384035340631081 .34554132496398904
.41921688836322396 .9078861164876663
.7347388780959635 .6783500431298615
.03987292758773981 .9992047586183639
.9994306045554617 .03374117185137759
.6828455463852481 .7305627692278276
.9104412922580672 .41363831223843456
.35129275608556715 .9362656671702783
.973644249650812 .22807208317088573
.5271991347819014 .8497417680008524
.8122505865852039 .5833086529376983
.16188639378011183 .9868094018141855
.9913108598461154 .13154002870288312
.6079497849677736 .7939754775543372
.8655136240905691 .5008853826112408
.257831102162159 .9661900034454125
.9466009130832835 .32240767880106985
.44137126873171667 .8973245807054183
.7511651319096864 .6601143420674205
.06438263092985747 .997925286198596
.9965711457905548 .08274026454937569
.6461760129833164 .7631884172633813
.8890483558546646 .45781330359887723
.30492922973540243 .9523750127197659
.9612804858113206 .27557181931095814
.4848692480007911 .8745866522781761
.7826505961665757 .62246127937415
.11327095217756435 .9935641355205953
.9836624192117303 .18002290140569951
.5682589526701316 .8228497813758263
.8398937941959995 .5427507848645159
.2101118368804696 .9776773578245099
.9296408958431812 .3684668299533723
.3968099874167103 .9179007756213905
.7178700450557317 .696177131491463
.015339206284988102 .9998823474542126
.9997694053512153 .021474080275469508
.6917592583641577 .7221281939292153
.9154487160882678 .40243465085941843
.3627557243673972 .9318842655816681
.9763697313300211 .21610679707621952
.5375870762956455 .8432082396418454
.819347520076797 .5732971666980422
.17398387338746382 .9847485018019042
.9928504144598651 .11936521481099137
.617647307937804 .7864552135990858
.8715950866559511 .49022648328829116
.2696683255729151 .9629532668736839
.9504860739494817 .3107671527496115
.4523495872337709 .8918407093923427
.7592091889783881 .6508466849963809
.07662386139203149 .997060070339483
.9975114561403035 .07050457338961387
.6554928529996153 .7552013768965365
.8945994856313827 .4468688401623742
.31659337555616585 .9485613499157303
.9645897932898128 .2637546789748314
.49556526182577254 .8685707059713409
.79023022143731 .6128100824294097
.12545498341154623 .9920993131421918
.9857975091675675 .16793829497473117
.5783137964116556 .8158144108067338
.8464909387740521 .532403127877198
.22209362097320354 .9750253450669941
.9340925504042589 .35703096123343003
.4080441628649787 .9129621904283982
.726359155084346 .6873153408917592
.027608145778965743 .9996188224951786
.9989412931868569 .04600318213091463
.673829000378756 .7388873244606151
.9052967593181188 .4247796812091088
.33977688440682685 .9405060705932683
.9707721407289504 .2400030224487415
.5167317990176499 .8561473283751945
.8050313311429635 .5932322950397998
.1497645346773215 .9887216919603238
.9896220174632009 .14369503315029444
.5981607069963423 .8013761717231402
.8593018183570084 .5114688504379704
.24595505033579462 .9692812353565485
.9425731976014469 .3339996514420094
.4303264813400826 .9026733182372588
.7430079521351217 .6692825883466361
.052131704680283324 .9986402181802653
.9954807554919269 .094963495329639
.6367618612362842 .7710605242618138
.8833633386657316 .46868882203582796
.29321916269425863 .9560452513499964
.9578264130275329 .2873474595447295
.47410021465055 .8804708890521608
.7749531065948739 .6320187359398091
.10106986275482782 .9948793307948056
.9813791933137546 .19208039704989244
.5581185312205561 .829761233794523
.8331701647019132 .5530167055800276
.1980984107179536 .9801821359681174
.9250492407826776 .37984720892405116
.38551605384391885 .9227011283338785
.7092728264388657 .7049340803759049
.003067956762965976 .9999952938095762
))
(define med-lut
(FLOATvector-const
1. 0.
.9999999999820472 5.9921124526424275e-6
.9999999999281892 1.1984224905069707e-5
.9999999998384257 1.7976337357066685e-5
.9999999997127567 2.396844980841822e-5
.9999999995511824 2.9960562258909154e-5
.9999999993537025 3.5952674708324344e-5
.9999999991203175 4.1944787156448635e-5
.9999999988510269 4.793689960306688e-5
.9999999985458309 5.3929012047963936e-5
.9999999982047294 5.992112449092465e-5
.9999999978277226 6.591323693173387e-5
.9999999974148104 7.190534937017645e-5
.9999999969659927 7.789746180603723e-5
.9999999964812697 8.388957423910108e-5
.9999999959606412 8.988168666915283e-5
.9999999954041073 9.587379909597734e-5
.999999994811668 1.0186591151935948e-4
.9999999941833233 1.0785802393908407e-4
.9999999935190732 1.1385013635493597e-4
.9999999928189177 1.1984224876670004e-4
.9999999920828567 1.2583436117416112e-4
.9999999913108903 1.3182647357710405e-4
.9999999905030187 1.3781858597531374e-4
.9999999896592414 1.4381069836857496e-4
.9999999887795589 1.498028107566726e-4
.9999999878639709 1.5579492313939151e-4
.9999999869124775 1.6178703551651655e-4
.9999999859250787 1.6777914788783258e-4
.9999999849017744 1.737712602531244e-4
.9999999838425648 1.797633726121769e-4
.9999999827474497 1.8575548496477492e-4
.9999999816164293 1.9174759731070332e-4
.9999999804495034 1.9773970964974692e-4
.9999999792466722 2.037318219816906e-4
.9999999780079355 2.0972393430631923e-4
.9999999767332933 2.1571604662341763e-4
.9999999754227459 2.2170815893277063e-4
.9999999740762929 2.2770027123416315e-4
.9999999726939346 2.3369238352737996e-4
.9999999712756709 2.3968449581220595e-4
.9999999698215016 2.45676608088426e-4
.9999999683314271 2.5166872035582493e-4
.9999999668054471 2.5766083261418755e-4
.9999999652435617 2.636529448632988e-4
.9999999636457709 2.696450571029434e-4
.9999999620120748 2.756371693329064e-4
.9999999603424731 2.8162928155297243e-4
.9999999586369661 2.876213937629265e-4
.9999999568955537 2.936135059625534e-4
.9999999551182358 2.99605618151638e-4
.9999999533050126 3.055977303299651e-4
.9999999514558838 3.115898424973196e-4
.9999999495708498 3.1758195465348636e-4
.9999999476499103 3.235740667982502e-4
.9999999456930654 3.2956617893139595e-4
.9999999437003151 3.3555829105270853e-4
.9999999416716594 3.4155040316197275e-4
.9999999396070982 3.475425152589734e-4
.9999999375066316 3.535346273434955e-4
.9999999353702598 3.595267394153237e-4
.9999999331979824 3.6551885147424295e-4
.9999999309897996 3.7151096352003814e-4
.9999999287457114 3.7750307555249406e-4
.9999999264657179 3.8349518757139556e-4
.9999999241498189 3.8948729957652753e-4
.9999999217980144 3.954794115676748e-4
.9999999194103046 4.0147152354462224e-4
.9999999169866894 4.0746363550715466e-4
.9999999145271687 4.134557474550569e-4
.9999999120317428 4.194478593881139e-4
.9999999095004113 4.2543997130611036e-4
.9999999069331744 4.314320832088313e-4
.9999999043300322 4.3742419509606144e-4
.9999999016909845 4.4341630696758576e-4
.9999998990160315 4.4940841882318896e-4
.9999998963051729 4.55400530662656e-4
.999999893558409 4.613926424857717e-4
.9999998907757398 4.673847542923209e-4
.9999998879571651 4.7337686608208844e-4
.9999998851026849 4.793689778548592e-4
.9999998822122994 4.8536108961041806e-4
.9999998792860085 4.913532013485497e-4
.9999998763238122 4.973453130690393e-4
.9999998733257104 5.033374247716714e-4
.9999998702917032 5.09329536456231e-4
.9999998672217907 5.153216481225028e-4
.9999998641159727 5.213137597702719e-4
.9999998609742493 5.27305871399323e-4
.9999998577966206 5.332979830094408e-4
.9999998545830864 5.392900946004105e-4
.9999998513336468 5.452822061720168e-4
.9999998480483018 5.512743177240444e-4
.9999998447270514 5.572664292562783e-4
.9999998413698955 5.632585407685033e-4
.9999998379768343 5.692506522605043e-4
.9999998345478677 5.752427637320661e-4
.9999998310829956 5.812348751829735e-4
.9999998275822183 5.872269866130116e-4
.9999998240455354 5.93219098021965e-4
.9999998204729471 5.992112094096185e-4
.9999998168644535 6.052033207757572e-4
.9999998132200545 6.111954321201659e-4
.99999980953975 6.171875434426292e-4
.9999998058235401 6.231796547429323e-4
.9999998020714248 6.291717660208597e-4
.9999997982834041 6.351638772761965e-4
.9999997944594781 6.411559885087275e-4
.9999997905996466 6.471480997182375e-4
.9999997867039097 6.531402109045114e-4
.9999997827722674 6.591323220673341e-4
.9999997788047197 6.651244332064902e-4
.9999997748012666 6.711165443217649e-4
.9999997707619082 6.771086554129428e-4
.9999997666866443 6.83100766479809e-4
.9999997625754748 6.89092877522148e-4
.9999997584284002 6.950849885397449e-4
.9999997542454201 7.010770995323844e-4
.9999997500265345 7.070692104998515e-4
.9999997457717437 7.130613214419311e-4
.9999997414810473 7.190534323584079e-4
.9999997371544456 7.250455432490666e-4
.9999997327919384 7.310376541136925e-4
.9999997283935259 7.3702976495207e-4
.999999723959208 7.430218757639842e-4
.9999997194889846 7.490139865492199e-4
.9999997149828559 7.55006097307562e-4
.9999997104408218 7.609982080387952e-4
.9999997058628822 7.669903187427045e-4
.9999997012490373 7.729824294190747e-4
.9999996965992869 7.789745400676906e-4
.9999996919136313 7.849666506883372e-4
.99999968719207 7.909587612807992e-4
.9999996824346035 7.969508718448614e-4
.9999996776412315 8.029429823803089e-4
.9999996728119542 8.089350928869263e-4
.9999996679467715 8.149272033644986e-4
.9999996630456833 8.209193138128106e-4
.9999996581086897 8.269114242316472e-4
.9999996531357909 8.329035346207931e-4
.9999996481269865 8.388956449800333e-4
.9999996430822767 8.448877553091527e-4
.9999996380016616 8.508798656079359e-4
.999999632885141 8.56871975876168e-4
.9999996277327151 8.628640861136338e-4
.9999996225443838 8.68856196320118e-4
.9999996173201471 8.748483064954056e-4
.999999612060005 8.808404166392814e-4
.9999996067639574 8.868325267515304e-4
.9999996014320045 8.928246368319371e-4
.9999995960641462 8.988167468802867e-4
.9999995906603825 9.048088568963639e-4
.9999995852207133 9.108009668799535e-4
.9999995797451389 9.167930768308405e-4
.9999995742336589 9.227851867488095e-4
.9999995686862736 9.287772966336457e-4
.9999995631029829 9.347694064851338e-4
.9999995574837868 9.407615163030585e-4
.9999995518286853 9.467536260872047e-4
.9999995461376784 9.527457358373575e-4
.9999995404107661 9.587378455533015e-4
.9999995346479484 9.647299552348216e-4
.9999995288492254 9.707220648817027e-4
.9999995230145969 9.767141744937296e-4
.9999995171440631 9.827062840706872e-4
.9999995112376238 9.886983936123602e-4
.9999995052952791 9.946905031185337e-4
.9999994993170291 .0010006826125889925
.9999994933028736 .0010066747220235214
.9999994872528128 .001012666831421905
.9999994811668466 .0010186589407839286
.999999475044975 .0010246510501093766
.9999994688871979 .0010306431593980344
.9999994626935156 .0010366352686496862
.9999994564639277 .0010426273778641173
.9999994501984345 .0010486194870411127
.999999443897036 .0010546115961804568
.999999437559732 .0010606037052819344
.9999994311865227 .0010665958143453308
.9999994247774079 .0010725879233704307
.9999994183323877 .0010785800323570187
.9999994118514622 .0010845721413048801
.9999994053346313 .0010905642502137994
.9999993987818949 .0010965563590835613
.9999993921932533 .0011025484679139511
.9999993855687062 .0011085405767047535
.9999993789082536 .0011145326854557532
.9999993722118957 .001120524794166735
.9999993654796325 .0011265169028374842
.9999993587114638 .0011325090114677853
.9999993519073898 .001138501120057423
.9999993450674104 .0011444932286061825
.9999993381915255 .0011504853371138485
.9999993312797354 .0011564774455802057
.9999993243320398 .0011624695540050393
.9999993173484387 .001168461662388134
.9999993103289324 .0011744537707292742
.9999993032735206 .0011804458790282454
.9999992961822035 .0011864379872848323
.9999992890549809 .0011924300954988195
.999999281891853 .001198422203669992
.9999992746928197 .0012044143117981348
.999999267457881 .0012104064198830327
.999999260187037 .0012163985279244702
.9999992528802875 .0012223906359222325
.9999992455376326 .0012283827438761045
.9999992381590724 .0012343748517858707
.9999992307446068 .0012403669596513162
.9999992232942359 .001246359067472226
.9999992158079595 .0012523511752483847
.9999992082857777 .001258343282979577
.9999992007276906 .001264335390665588
.999999193133698 .0012703274983062026
.9999991855038001 .0012763196059012057
.9999991778379967 .001282311713450382
.9999991701362881 .0012883038209535163
.999999162398674 .0012942959284103935
.9999991546251547 .0013002880358207985
.9999991468157298 .001306280143184516
.9999991389703996 .001312272250501331
.999999131089164 .0013182643577710285
.999999123172023 .0013242564649933932
.9999991152189767 .0013302485721682098
.9999991072300249 .001336240679295263
.9999990992051678 .0013422327863743383
.9999990911444054 .0013482248934052201
.9999990830477375 .0013542170003876934
.9999990749151643 .001360209107321543
.9999990667466857 .0013662012142065536
.9999990585423016 .0013721933210425101
.9999990503020123 .0013781854278291975
.9999990420258176 .0013841775345664006
.9999990337137175 .0013901696412539043
.999999025365712 .0013961617478914935
.999999016981801 .0014021538544789526
.9999990085619848 .001408145961016067
.9999990001062631 .0014141380675026214
.9999989916146361 .0014201301739384005
.9999989830871038 .0014261222803231893
.9999989745236659 .0014321143866567725
.9999989659243228 .001438106492938935
.9999989572890743 .0014440985991694619
.9999989486179204 .0014500907053481378
.9999989399108612 .0014560828114747475
.9999989311678965 .0014620749175490758
.9999989223890265 .001468067023570908
.9999989135742512 .0014740591295400284
.9999989047235704 .0014800512354562223
.9999988958369843 .0014860433413192743
.9999988869144928 .0014920354471289693
.9999988779560959 .0014980275528850922
.9999988689617937 .0015040196585874275
.9999988599315861 .0015100117642357607
.999998850865473 .0015160038698298762
.9999988417634548 .001521995975369559
.999998832625531 .0015279880808545937
.9999988234517019 .0015339801862847657
.9999988142419675 .0015399722916598592
.9999988049963277 .0015459643969796596
.9999987957147825 .0015519565022439512
.9999987863973319 .0015579486074525195
.9999987770439759 .001563940712605149
.9999987676547146 .0015699328177016243
.999998758229548 .0015759249227417307
.9999987487684759 .0015819170277252528
.9999987392714985 .0015879091326519755
.9999987297386157 .0015939012375216837
.9999987201698276 .0015998933423341623
.9999987105651341 .001605885447089196
.9999987009245352 .0016118775517865696
.999998691248031 .0016178696564260683
.9999986815356214 .0016238617610074765
.9999986717873064 .0016298538655305794
.9999986620030861 .0016358459699951618
.9999986521829605 .0016418380744010084
.9999986423269294 .0016478301787479041
.999998632434993 .0016538222830356339
.9999986225071512 .0016598143872639823
.999998612543404 .0016658064914327345
.9999986025437515 .0016717985955416754
.9999985925081937 .0016777906995905894
.9999985824367305 .0016837828035792617
.9999985723293618 .0016897749075074774
.999998562186088 .0016957670113750207
.9999985520069086 .0017017591151816769
.9999985417918239 .0017077512189272307
.999998531540834 .001713743322611467
.9999985212539385 .0017197354262341706
.9999985109311378 .0017257275297951264
.9999985005724317 .0017317196332941192
.9999984901778203 .0017377117367309341
.9999984797473034 .0017437038401053556
.9999984692808812 .0017496959434171687
.9999984587785538 .0017556880466661582
.9999984482403208 .001761680149852109
.9999984376661826 .0017676722529748061
.999998427056139 .0017736643560340342
.99999841641019 .001779656459029578
.9999984057283358 .0017856485619612225
.9999983950105761 .0017916406648287528
.999998384256911 .0017976327676319532
.9999983734673407 .001803624870370609
.9999983626418649 .0018096169730445048
.9999983517804839 .0018156090756534257
.9999983408831975 .0018216011781971562
.9999983299500057 .0018275932806754815
.9999983189809085 .0018335853830881864
.999998307975906 .0018395774854350557
.9999982969349982 .001845569587715874
.9999982858581851 .0018515616899304264
.9999982747454665 .001857553792078498
.9999982635968426 .001863545894159873
.9999982524123134 .0018695379961743367
.9999982411918789 .001875530098121674
.9999982299355389 .0018815222000016696
.9999982186432936 .0018875143018141083
.999998207315143 .0018935064035587748
.999998195951087 .0018994985052354545
.9999981845511257 .0019054906068439318
.9999981731152591 .0019114827083839918
.999998161643487 .001917474809855419
.9999981501358096 .0019234669112579987
.999998138592227 .0019294590125915154
.9999981270127389 .0019354511138557542
.9999981153973455 .0019414432150504997
.9999981037460468 .0019474353161755369
.9999980920588427 .001953427417230651
.9999980803357332 .001959419518215626
.9999980685767185 .0019654116191302473
.9999980567817984 .0019714037199743
.9999980449509729 .0019773958207475683
.9999980330842422 .0019833879214498375
.999998021181606 .001989380022080892
.9999980092430646 .0019953721226405176
.9999979972686177 .002001364223128498
.9999979852582656 .002007356323544619
.9999979732120081 .002013348423888665
.9999979611298453 .002019340524160421
.9999979490117771 .0020253326243596715
.9999979368578036 .0020313247244862017
.9999979246679247 .002037316824539796
.9999979124421405 .00204330892452024
.999997900180451 .002049301024427318
.9999978878828562 .0020552931242608153
.9999978755493559 .002061285224020516
.9999978631799504 .0020672773237062057
.9999978507746395 .002073269423317669
.9999978383334234 .0020792615228546903
.9999978258563018 .002085253622317055
.999997813343275 .0020912457217045484
.9999978007943428 .002097237821016954
.9999977882095052 .0021032299202540577
.9999977755887623 .0021092220194156444
.9999977629321142 .0021152141185014984
.9999977502395607 .0021212062175114043
.9999977375111019 .002127198316445148
.9999977247467376 .0021331904153025134
.9999977119464681 .002139182514083286
.9999976991102932 .0021451746127872503
.9999976862382131 .002151166711414191
.9999976733302276 .0021571588099638934
.9999976603863368 .0021631509084361423
.9999976474065406 .002169143006830722
.9999976343908391 .002175135105147418
.9999976213392323 .0021811272033860148
.9999976082517201 .002187119301546297
.9999975951283027 .00219311139962805
.9999975819689799 .0021991034976310588
.9999975687737518 .0022050955955551076
.9999975555426184 .0022110876933999816
.9999975422755796 .0022170797911654654
.9999975289726355 .002223071888851344
.9999975156337861 .0022290639864574026
.9999975022590314 .0022350560839834253
.9999974888483714 .002241048181429198
.999997475401806 .0022470402787945045
.9999974619193353 .00225303237607913
.9999974484009593 .0022590244732828596
.9999974348466779 .0022650165704054784
.9999974212564913 .0022710086674467703
.9999974076303992 .002277000764406521
.9999973939684019 .002282992861284515
.9999973802704993 .0022889849580805368
.9999973665366915 .0022949770547943723
.9999973527669782 .0023009691514258054
.9999973389613596 .002306961247974621
.9999973251198357 .0023129533444406045
.9999973112424065 .0023189454408235406
.999997297329072 .0023249375371232135
.9999972833798322 .002330929633339409
.999997269394687 .0023369217294719113
.9999972553736366 .0023429138255205055
.9999972413166809 .0023489059214849765
.9999972272238198 .002354898017365109
.9999972130950534 .0023608901131606883
.9999971989303816 .0023668822088714985
.9999971847298047 .0023728743044973246
.9999971704933224 .0023788664000379523
.9999971562209347 .0023848584954931653
.9999971419126418 .0023908505908627493
.9999971275684435 .0023968426861464883
.99999711318834 .002402834781344168
.9999970987723311 .0024088268764555732
.9999970843204169 .002414818971480488
.9999970698325974 .002420811066418698
.9999970553088726 .0024268031612699878
.9999970407492426 .002432795256034142
.9999970261537071 .002438787350710946
.9999970115222664 .002444779445300184
.9999969968549204 .0024507715398016418
.9999969821516691 .002456763634215103
.9999969674125124 .002462755728540353
.9999969526374506 .0024687478227771774
.9999969378264834 .00247473991692536
.9999969229796108 .002480732010984686
.999996908096833 .0024867241049549406
.9999968931781499 .002492716198835908
.9999968782235614 .0024987082926273734
.9999968632330677 .002504700386329122
.9999968482066687 .002510692479940938
.9999968331443644 .0025166845734626068
.9999968180461547 .0025226766668939127
.9999968029120399 .002528668760234641
.9999967877420196 .002534660853484576
.9999967725360941 .0025406529466435036
.9999967572942633 .002546645039711208
.9999967420165272 .002552637132687474
.9999967267028858 .002558629225572086
.9999967113533391 .0025646213183648297
.9999966959678871 .0025706134110654896
.9999966805465298 .002576605503673851
.9999966650892672 .0025825975961896977
.9999966495960994 .0025885896886128153
.9999966340670262 .0025945817809429885
.9999966185020478 .0026005738731800024
.9999966029011641 .0026065659653236417
.999996587264375 .002612558057373691
.9999965715916808 .002618550149329935
.9999965558830811 .0026245422411921592
.9999965401385762 .002630534332960148
.9999965243581661 .002636526424633687
.9999965085418506 .0026425185162125596
.9999964926896299 .0026485106076965517
.9999964768015038 .0026545026990854484
.9999964608774725 .0026604947903790337
.9999964449175359 .0026664868815770926
.999996428921694 .0026724789726794104
.9999964128899468 .002678471063685772
.9999963968222944 .0026844631545959617
.9999963807187366 .002690455245409765
.9999963645792737 .002696447336126966
.9999963484039053 .00270243942674735
.9999963321926317 .002708431517270702
.9999963159454529 .0027144236076968066
.9999962996623687 .0027204156980254485
.9999962833433793 .002726407788256413
.9999962669884847 .002732399878389485
.9999962505976846 .0027383919684244484
.9999962341709794 .002744384058361089
.9999962177083689 .0027503761481991913
.999996201209853 .0027563682379385403
.9999961846754319 .0027623603275789207
.9999961681051056 .0027683524171201175
.999996151498874 .002774344506561915
.9999961348567371 .002780336595904099
.9999961181786949 .0027863286851464537
.9999961014647475 .0027923207742887642
.9999960847148948 .0027983128633308155
.9999960679291368 .002804304952272392
.9999960511074735 .002810297041113279
.9999960342499049 .0028162891298532606
.9999960173564312 .0028222812184921227
.9999960004270521 .002828273307029649
.9999959834617678 .002834265395465626
.9999959664605781 .0028402574837998367
.9999959494234832 .002846249572032067
.9999959323504831 .0028522416601621014
.9999959152415777 .002858233748189725
.999995898096767 .002864225836114723
.9999958809160512 .0028702179239368793
.9999958636994299 .0028762100116559793
.9999958464469034 .0028822020992718077
.9999958291584717 .0028881941867841495
.9999958118341348 .0028941862741927895
.9999957944738925 .0029001783614975127
.999995777077745 .002906170448698104
.9999957596456922 .0029121625357943475
.9999957421777342 .002918154622786029
.999995724673871 .0029241467096729327
.9999957071341024 .002930138796454844
.9999956895584287 .0029361308831315474
.9999956719468496 .0029421229697028273
.9999956542993652 .0029481150561684695
.9999956366159757 .0029541071425282584
.9999956188966809 .002960099228781979
.9999956011414808 .002966091314929416
.9999955833503754 .002972083400970354
.9999955655233649 .0029780754869045785
.9999955476604491 .0029840675727318736
.999995529761628 .002990059658452025
.9999955118269016 .0029960517440648163
.99999549385627 .0030020438295700336
.9999954758497331 .0030080359149674612
.999995457807291 .003014028000256884
.9999954397289438 .003020020085438087
.9999954216146911 .0030260121705108552
.9999954034645333 .003032004255474973
.9999953852784702 .003037996340330225
.9999953670565019 .003043988425076397
.9999953487986284 .003049980509713273
.9999953305048496 .0030559725942406386
.9999953121751655 .003061964678658278
))
(define high-lut
(FLOATvector-const
1. 0.
.9999999999999999 1.1703344634137277e-8
.9999999999999998 2.3406689268274554e-8
.9999999999999993 3.5110033902411824e-8
.9999999999999989 4.6813378536549095e-8
.9999999999999983 5.851672317068635e-8
.9999999999999976 7.022006780482361e-8
.9999999999999967 8.192341243896085e-8
.9999999999999957 9.362675707309808e-8
.9999999999999944 1.0533010170723531e-7
.9999999999999931 1.170334463413725e-7
.9999999999999917 1.287367909755097e-7
.9999999999999901 1.4044013560964687e-7
.9999999999999885 1.5214348024378403e-7
.9999999999999866 1.6384682487792116e-7
.9999999999999846 1.7555016951205827e-7
.9999999999999825 1.8725351414619535e-7
.9999999999999802 1.989568587803324e-7
.9999999999999778 2.1066020341446942e-7
.9999999999999752 2.2236354804860645e-7
.9999999999999726 2.3406689268274342e-7
.9999999999999698 2.4577023731688034e-7
.9999999999999668 2.5747358195101726e-7
.9999999999999638 2.6917692658515413e-7
.9999999999999606 2.8088027121929094e-7
.9999999999999571 2.9258361585342776e-7
.9999999999999537 3.042869604875645e-7
.99999999999995 3.159903051217012e-7
.9999999999999463 3.276936497558379e-7
.9999999999999424 3.3939699438997453e-7
.9999999999999384 3.5110033902411114e-7
.9999999999999342 3.6280368365824763e-7
.9999999999999298 3.7450702829238413e-7
.9999999999999254 3.8621037292652057e-7
.9999999999999208 3.979137175606569e-7
.9999999999999161 4.0961706219479325e-7
.9999999999999113 4.2132040682892953e-7
.9999999999999063 4.330237514630657e-7
.9999999999999011 4.447270960972019e-7
.9999999999998959 4.5643044073133796e-7
.9999999999998904 4.68133785365474e-7
.9999999999998849 4.7983712999961e-7
.9999999999998792 4.915404746337459e-7
.9999999999998733 5.032438192678817e-7
.9999999999998674 5.149471639020175e-7
.9999999999998613 5.266505085361531e-7
.9999999999998551 5.383538531702888e-7
.9999999999998487 5.500571978044243e-7
.9999999999998422 5.617605424385598e-7
.9999999999998356 5.734638870726952e-7
.9999999999998288 5.851672317068305e-7
.9999999999998219 5.968705763409657e-7
.9999999999998148 6.085739209751009e-7
.9999999999998076 6.202772656092359e-7
.9999999999998003 6.319806102433709e-7
.9999999999997928 6.436839548775058e-7
.9999999999997853 6.553872995116406e-7
.9999999999997775 6.670906441457753e-7
.9999999999997696 6.7879398877991e-7
.9999999999997616 6.904973334140445e-7
.9999999999997534 7.02200678048179e-7
.9999999999997452 7.139040226823132e-7
.9999999999997368 7.256073673164475e-7
.9999999999997282 7.373107119505817e-7
.9999999999997194 7.490140565847157e-7
.9999999999997107 7.607174012188497e-7
.9999999999997017 7.724207458529835e-7
.9999999999996926 7.841240904871172e-7
.9999999999996834 7.958274351212508e-7
.9999999999996739 8.075307797553844e-7
.9999999999996644 8.192341243895178e-7
.9999999999996547 8.309374690236511e-7
.999999999999645 8.426408136577842e-7
.9999999999996351 8.543441582919173e-7
.999999999999625 8.660475029260503e-7
.9999999999996148 8.777508475601831e-7
.9999999999996044 8.894541921943158e-7
.999999999999594 9.011575368284484e-7
.9999999999995833 9.128608814625808e-7
.9999999999995726 9.245642260967132e-7
.9999999999995617 9.362675707308454e-7
.9999999999995507 9.479709153649775e-7
.9999999999995395 9.596742599991095e-7
.9999999999995283 9.713776046332412e-7
.9999999999995168 9.83080949267373e-7
.9999999999995052 9.947842939015044e-7
.9999999999994935 1.006487638535636e-6
.9999999999994816 1.0181909831697673e-6
.9999999999994696 1.0298943278038984e-6
.9999999999994575 1.0415976724380293e-6
.9999999999994453 1.0533010170721601e-6
.9999999999994329 1.065004361706291e-6
.9999999999994204 1.0767077063404215e-6
.9999999999994077 1.088411050974552e-6
.9999999999993949 1.1001143956086822e-6
.9999999999993819 1.1118177402428122e-6
.9999999999993688 1.1235210848769423e-6
.9999999999993556 1.135224429511072e-6
.9999999999993423 1.1469277741452017e-6
.9999999999993288 1.1586311187793313e-6
.9999999999993151 1.1703344634134605e-6
.9999999999993014 1.1820378080475897e-6
.9999999999992875 1.1937411526817187e-6
.9999999999992735 1.2054444973158477e-6
.9999999999992593 1.2171478419499764e-6
.9999999999992449 1.2288511865841048e-6
.9999999999992305 1.2405545312182331e-6
.999999999999216 1.2522578758523615e-6
.9999999999992012 1.2639612204864894e-6
.9999999999991863 1.2756645651206173e-6
.9999999999991713 1.287367909754745e-6
.9999999999991562 1.2990712543888725e-6
.9999999999991409 1.3107745990229998e-6
.9999999999991255 1.3224779436571269e-6
.9999999999991099 1.3341812882912537e-6
.9999999999990943 1.3458846329253806e-6
.9999999999990785 1.3575879775595072e-6
.9999999999990625 1.3692913221936337e-6
.9999999999990464 1.3809946668277597e-6
.9999999999990302 1.3926980114618857e-6
.9999999999990138 1.4044013560960117e-6
.9999999999989974 1.4161047007301373e-6
.9999999999989807 1.4278080453642627e-6
.9999999999989639 1.439511389998388e-6
.999999999998947 1.451214734632513e-6
.99999999999893 1.462918079266638e-6
.9999999999989128 1.4746214239007625e-6
.9999999999988954 1.486324768534887e-6
.999999999998878 1.4980281131690111e-6
.9999999999988604 1.5097314578031353e-6
.9999999999988426 1.5214348024372591e-6
.9999999999988247 1.5331381470713828e-6
.9999999999988067 1.544841491705506e-6
.9999999999987886 1.5565448363396294e-6
.9999999999987703 1.5682481809737524e-6
.9999999999987519 1.579951525607875e-6
.9999999999987333 1.5916548702419977e-6
.9999999999987146 1.60335821487612e-6
.9999999999986958 1.615061559510242e-6
.9999999999986768 1.626764904144364e-6
.9999999999986577 1.6384682487784858e-6
.9999999999986384 1.6501715934126072e-6
.9999999999986191 1.6618749380467283e-6
.9999999999985996 1.6735782826808495e-6
.9999999999985799 1.6852816273149702e-6
.9999999999985602 1.6969849719490907e-6
.9999999999985402 1.708688316583211e-6
.9999999999985201 1.720391661217331e-6
.9999999999985 1.732095005851451e-6
.9999999999984795 1.7437983504855706e-6
.9999999999984591 1.7555016951196899e-6
.9999999999984385 1.767205039753809e-6
.9999999999984177 1.778908384387928e-6
.9999999999983968 1.7906117290220465e-6
.9999999999983759 1.802315073656165e-6
.9999999999983546 1.814018418290283e-6
.9999999999983333 1.825721762924401e-6
.9999999999983119 1.8374251075585186e-6
.9999999999982904 1.8491284521926361e-6
.9999999999982686 1.8608317968267533e-6
.9999999999982468 1.8725351414608702e-6
.9999999999982249 1.8842384860949866e-6
.9999999999982027 1.8959418307291031e-6
.9999999999981805 1.9076451753632194e-6
.999999999998158 1.919348519997335e-6
.9999999999981355 1.9310518646314507e-6
.9999999999981128 1.942755209265566e-6
.9999999999980901 1.954458553899681e-6
.9999999999980671 1.966161898533796e-6
.999999999998044 1.9778652431679103e-6
.9999999999980208 1.9895685878020246e-6
.9999999999979975 2.0012719324361386e-6
.999999999997974 2.012975277070252e-6
.9999999999979503 2.0246786217043656e-6
.9999999999979265 2.0363819663384787e-6
.9999999999979027 2.048085310972592e-6
.9999999999978786 2.0597886556067045e-6
.9999999999978545 2.0714920002408167e-6
.9999999999978302 2.0831953448749286e-6
.9999999999978058 2.0948986895090404e-6
.9999999999977811 2.106602034143152e-6
.9999999999977564 2.118305378777263e-6
.9999999999977315 2.1300087234113738e-6
.9999999999977065 2.1417120680454843e-6
.9999999999976814 2.153415412679595e-6
.9999999999976561 2.1651187573137046e-6
.9999999999976307 2.1768221019478143e-6
.9999999999976051 2.188525446581924e-6
.9999999999975795 2.200228791216033e-6
.9999999999975536 2.2119321358501417e-6
.9999999999975278 2.22363548048425e-6
.9999999999975017 2.2353388251183586e-6
.9999999999974754 2.247042169752466e-6
.999999999997449 2.2587455143865738e-6
.9999999999974225 2.2704488590206814e-6
.9999999999973959 2.282152203654788e-6
.9999999999973691 2.293855548288895e-6
.9999999999973422 2.305558892923001e-6
.9999999999973151 2.317262237557107e-6
.999999999997288 2.328965582191213e-6
.9999999999972606 2.340668926825318e-6
.9999999999972332 2.352372271459423e-6
.9999999999972056 2.364075616093528e-6
.9999999999971778 2.3757789607276323e-6
.99999999999715 2.3874823053617365e-6
.999999999997122 2.3991856499958403e-6
.9999999999970938 2.4108889946299437e-6
.9999999999970656 2.4225923392640466e-6
.9999999999970371 2.4342956838981495e-6
.9999999999970085 2.445999028532252e-6
.9999999999969799 2.457702373166354e-6
.999999999996951 2.4694057178004558e-6
.999999999996922 2.4811090624345574e-6
.9999999999968929 2.4928124070686583e-6
.9999999999968637 2.504515751702759e-6
.9999999999968343 2.5162190963368595e-6
.9999999999968048 2.5279224409709594e-6
.9999999999967751 2.5396257856050594e-6
.9999999999967454 2.5513291302391585e-6
.9999999999967154 2.5630324748732576e-6
.9999999999966853 2.5747358195073563e-6
.9999999999966551 2.5864391641414546e-6
.9999999999966248 2.5981425087755525e-6
.9999999999965944 2.6098458534096503e-6
.9999999999965637 2.6215491980437473e-6
.999999999996533 2.6332525426778443e-6
.9999999999965021 2.644955887311941e-6
.999999999996471 2.656659231946037e-6
.99999999999644 2.6683625765801328e-6
.9999999999964087 2.680065921214228e-6
.9999999999963772 2.6917692658483234e-6
.9999999999963456 2.703472610482418e-6
.999999999996314 2.7151759551165123e-6
.9999999999962821 2.7268792997506064e-6
.9999999999962501 2.7385826443846996e-6
.9999999999962179 2.750285989018793e-6
.9999999999961857 2.761989333652886e-6
.9999999999961533 2.7736926782869783e-6
.9999999999961208 2.78539602292107e-6
.9999999999960881 2.797099367555162e-6
.9999999999960553 2.808802712189253e-6
.9999999999960224 2.8205060568233443e-6
.9999999999959893 2.832209401457435e-6
.9999999999959561 2.8439127460915247e-6
.9999999999959227 2.8556160907256145e-6
.9999999999958893 2.867319435359704e-6
.9999999999958556 2.879022779993793e-6
.9999999999958219 2.8907261246278814e-6
.9999999999957879 2.90242946926197e-6
.999999999995754 2.9141328138960576e-6
.9999999999957198 2.925836158530145e-6
.9999999999956855 2.9375395031642317e-6
.999999999995651 2.9492428477983186e-6
.9999999999956164 2.9609461924324046e-6
.9999999999955816 2.9726495370664905e-6
.9999999999955468 2.9843528817005757e-6
.9999999999955118 2.996056226334661e-6
.9999999999954767 3.007759570968745e-6
.9999999999954414 3.0194629156028294e-6
.999999999995406 3.0311662602369133e-6
.9999999999953705 3.0428696048709963e-6
.9999999999953348 3.0545729495050794e-6
.999999999995299 3.066276294139162e-6
.999999999995263 3.0779796387732437e-6
.9999999999952269 3.0896829834073255e-6
.9999999999951907 3.101386328041407e-6
.9999999999951543 3.1130896726754873e-6
.9999999999951178 3.1247930173095678e-6
.9999999999950812 3.136496361943648e-6
.9999999999950444 3.148199706577727e-6
.9999999999950075 3.1599030512118063e-6
.9999999999949705 3.171606395845885e-6
.9999999999949333 3.183309740479963e-6
.999999999994896 3.195013085114041e-6
.9999999999948584 3.206716429748118e-6
.9999999999948209 3.218419774382195e-6
.9999999999947832 3.2301231190162714e-6
.9999999999947453 3.2418264636503477e-6
.9999999999947072 3.253529808284423e-6
.9999999999946692 3.265233152918498e-6
.9999999999946309 3.276936497552573e-6
.9999999999945924 3.288639842186647e-6
.9999999999945539 3.300343186820721e-6
.9999999999945152 3.312046531454794e-6
.9999999999944763 3.323749876088867e-6
.9999999999944373 3.3354532207229395e-6
.9999999999943983 3.3471565653570115e-6
.9999999999943591 3.358859909991083e-6
.9999999999943197 3.370563254625154e-6
.9999999999942801 3.3822665992592245e-6
.9999999999942405 3.3939699438932944e-6
.9999999999942008 3.4056732885273643e-6
.9999999999941608 3.4173766331614334e-6
.9999999999941207 3.429079977795502e-6
.9999999999940805 3.4407833224295702e-6
.9999999999940402 3.452486667063638e-6
.9999999999939997 3.4641900116977054e-6
.999999999993959 3.4758933563317723e-6
.9999999999939183 3.4875967009658384e-6
.9999999999938775 3.4993000455999045e-6
.9999999999938364 3.5110033902339697e-6
.9999999999937953 3.5227067348680345e-6
.999999999993754 3.534410079502099e-6
.9999999999937126 3.546113424136163e-6
.999999999993671 3.5578167687702264e-6
.9999999999936293 3.5695201134042896e-6
.9999999999935875 3.581223458038352e-6
.9999999999935454 3.592926802672414e-6
.9999999999935033 3.6046301473064755e-6
.9999999999934611 3.6163334919405365e-6
.9999999999934187 3.628036836574597e-6
.9999999999933762 3.639740181208657e-6
.9999999999933334 3.6514435258427166e-6
.9999999999932907 3.6631468704767755e-6
.9999999999932477 3.674850215110834e-6
.9999999999932047 3.686553559744892e-6
.9999999999931615 3.6982569043789496e-6
.9999999999931181 3.7099602490130064e-6
.9999999999930747 3.7216635936470627e-6
.999999999993031 3.733366938281119e-6
.9999999999929873 3.745070282915174e-6
.9999999999929433 3.756773627549229e-6
.9999999999928992 3.768476972183284e-6
.9999999999928552 3.7801803168173377e-6
.9999999999928109 3.791883661451391e-6
.9999999999927663 3.803587006085444e-6
.9999999999927218 3.8152903507194965e-6
.9999999999926771 3.826993695353548e-6
.9999999999926322 3.838697039987599e-6
.9999999999925873 3.85040038462165e-6
.9999999999925421 3.862103729255701e-6
.9999999999924968 3.87380707388975e-6
.9999999999924514 3.885510418523799e-6
.9999999999924059 3.897213763157848e-6
.9999999999923602 3.9089171077918965e-6
.9999999999923144 3.9206204524259435e-6
.9999999999922684 3.9323237970599905e-6
.9999999999922223 3.9440271416940376e-6
.9999999999921761 3.955730486328084e-6
.9999999999921297 3.967433830962129e-6
.9999999999920832 3.9791371755961736e-6
.9999999999920366 3.990840520230218e-6
.9999999999919899 4.002543864864262e-6
.9999999999919429 4.014247209498305e-6
.9999999999918958 4.025950554132348e-6
.9999999999918486 4.03765389876639e-6
.9999999999918013 4.049357243400431e-6
.9999999999917539 4.061060588034472e-6
.9999999999917063 4.072763932668513e-6
.9999999999916586 4.084467277302553e-6
.9999999999916107 4.096170621936592e-6
.9999999999915626 4.107873966570632e-6
.9999999999915146 4.119577311204669e-6
.9999999999914663 4.131280655838707e-6
.9999999999914179 4.142984000472745e-6
.9999999999913692 4.154687345106781e-6
.9999999999913206 4.166390689740817e-6
.9999999999912718 4.178094034374852e-6
.9999999999912228 4.189797379008887e-6
.9999999999911737 4.201500723642921e-6
.9999999999911244 4.213204068276955e-6
.999999999991075 4.224907412910988e-6
.9999999999910255 4.236610757545021e-6
.9999999999909759 4.248314102179053e-6
.9999999999909261 4.260017446813084e-6
.9999999999908762 4.271720791447115e-6
.9999999999908261 4.283424136081145e-6
.9999999999907759 4.295127480715175e-6
.9999999999907256 4.306830825349204e-6
.9999999999906751 4.3185341699832325e-6
.9999999999906245 4.33023751461726e-6
.9999999999905738 4.3419408592512875e-6
.9999999999905229 4.353644203885314e-6
.9999999999904718 4.36534754851934e-6
.9999999999904207 4.377050893153365e-6
.9999999999903694 4.38875423778739e-6
.999999999990318 4.400457582421414e-6
.9999999999902665 4.4121609270554384e-6
.9999999999902147 4.423864271689461e-6
.9999999999901629 4.435567616323483e-6
.9999999999901109 4.447270960957506e-6
.9999999999900587 4.458974305591527e-6
.9999999999900065 4.470677650225547e-6
.9999999999899541 4.482380994859567e-6
.9999999999899016 4.494084339493587e-6
.9999999999898489 4.5057876841276054e-6
.9999999999897962 4.517491028761624e-6
.9999999999897432 4.529194373395641e-6
.9999999999896901 4.5408977180296584e-6
.999999999989637 4.552601062663675e-6
.9999999999895836 4.564304407297691e-6
.99999999998953 4.5760077519317055e-6
.9999999999894764 4.5877110965657195e-6
.9999999999894227 4.5994144411997335e-6
.9999999999893688 4.611117785833747e-6
.9999999999893148 4.622821130467759e-6
.9999999999892606 4.634524475101771e-6
.9999999999892063 4.646227819735783e-6
.9999999999891518 4.657931164369793e-6
.9999999999890973 4.669634509003803e-6
.9999999999890425 4.681337853637813e-6
.9999999999889877 4.693041198271821e-6
.9999999999889327 4.704744542905829e-6
.9999999999888776 4.716447887539837e-6
.9999999999888223 4.728151232173843e-6
.9999999999887669 4.73985457680785e-6
.9999999999887114 4.751557921441855e-6
.9999999999886556 4.76326126607586e-6
.9999999999885999 4.774964610709864e-6
.9999999999885439 4.786667955343868e-6
.9999999999884878 4.798371299977871e-6
.9999999999884316 4.810074644611873e-6
.9999999999883752 4.821777989245874e-6
.9999999999883187 4.833481333879875e-6
.9999999999882621 4.845184678513876e-6
.9999999999882053 4.856888023147875e-6
.9999999999881484 4.868591367781874e-6
.9999999999880914 4.880294712415872e-6
.9999999999880341 4.89199805704987e-6
.9999999999879768 4.903701401683867e-6
.9999999999879194 4.915404746317863e-6
.9999999999878618 4.9271080909518585e-6
.9999999999878041 4.938811435585853e-6
.9999999999877462 4.9505147802198475e-6
.9999999999876882 4.962218124853841e-6
.99999999998763 4.973921469487834e-6
.9999999999875717 4.985624814121826e-6
.9999999999875133 4.997328158755817e-6
.9999999999874548 5.009031503389808e-6
.9999999999873961 5.0207348480237985e-6
.9999999999873372 5.032438192657788e-6
.9999999999872783 5.0441415372917765e-6
.9999999999872192 5.055844881925764e-6
.9999999999871599 5.067548226559752e-6
.9999999999871007 5.079251571193739e-6
.9999999999870411 5.090954915827725e-6
.9999999999869814 5.10265826046171e-6
.9999999999869217 5.1143616050956945e-6
.9999999999868617 5.126064949729678e-6
.9999999999868017 5.1377682943636615e-6
.9999999999867415 5.149471638997644e-6
.9999999999866811 5.161174983631626e-6
.9999999999866207 5.172878328265607e-6
.9999999999865601 5.184581672899587e-6
.9999999999864994 5.196285017533567e-6
.9999999999864384 5.2079883621675455e-6
.9999999999863775 5.219691706801524e-6
.9999999999863163 5.2313950514355015e-6
.999999999986255 5.243098396069478e-6
.9999999999861935 5.254801740703454e-6
.999999999986132 5.266505085337429e-6
.9999999999860703 5.278208429971404e-6
.9999999999860084 5.289911774605378e-6
.9999999999859465 5.301615119239351e-6
.9999999999858843 5.313318463873323e-6
.9999999999858221 5.325021808507295e-6
.9999999999857597 5.336725153141267e-6
.9999999999856971 5.3484284977752366e-6
.9999999999856345 5.360131842409206e-6
.9999999999855717 5.371835187043175e-6
.9999999999855087 5.383538531677143e-6
.9999999999854456 5.3952418763111104e-6
.9999999999853825 5.406945220945077e-6
.9999999999853191 5.418648565579043e-6
.9999999999852557 5.4303519102130076e-6
.9999999999851921 5.4420552548469724e-6
.9999999999851282 5.453758599480936e-6
.9999999999850644 5.465461944114899e-6
.9999999999850003 5.47716528874886e-6
.9999999999849362 5.488868633382822e-6
.9999999999848719 5.500571978016782e-6
.9999999999848074 5.512275322650742e-6
.9999999999847429 5.523978667284702e-6
.9999999999846781 5.53568201191866e-6
.9999999999846133 5.547385356552617e-6
.9999999999845482 5.5590887011865745e-6
.9999999999844832 5.57079204582053e-6
.9999999999844179 5.582495390454486e-6
.9999999999843525 5.59419873508844e-6
.9999999999842869 5.605902079722394e-6
.9999999999842213 5.617605424356347e-6
.9999999999841555 5.629308768990299e-6
.9999999999840895 5.641012113624251e-6
.9999999999840234 5.652715458258201e-6
.9999999999839572 5.664418802892152e-6
.9999999999838908 5.6761221475261e-6
.9999999999838243 5.687825492160048e-6
.9999999999837577 5.699528836793996e-6
.9999999999836909 5.711232181427943e-6
.999999999983624 5.722935526061889e-6
.9999999999835569 5.734638870695834e-6
.9999999999834898 5.746342215329779e-6
.9999999999834225 5.758045559963722e-6
.999999999983355 5.769748904597665e-6
.9999999999832874 5.781452249231607e-6
.9999999999832196 5.793155593865548e-6
.9999999999831518 5.804858938499489e-6
.9999999999830838 5.816562283133429e-6
.9999999999830157 5.8282656277673675e-6
.9999999999829474 5.839968972401306e-6
.9999999999828789 5.851672317035243e-6
.9999999999828104 5.86337566166918e-6
.9999999999827417 5.875079006303115e-6
.9999999999826729 5.88678235093705e-6
.9999999999826039 5.898485695570985e-6
.9999999999825349 5.910189040204917e-6
.9999999999824656 5.92189238483885e-6
.9999999999823962 5.933595729472782e-6
.9999999999823267 5.945299074106713e-6
.9999999999822571 5.957002418740643e-6
.9999999999821872 5.9687057633745715e-6
.9999999999821173 5.9804091080085e-6
))
(define (make-w log-n)
(let* ((n (expt 2 log-n)) ;; number of complexes
(result (FLOATmake-vector (* 2 n))))
(define (copy-low-lut)
(do ((i 0 (+ i 1)))
((= i lut-table-size))
(let ((index (* i 2)))
(FLOATvector-set!
result
index
(FLOATvector-ref low-lut index))
(FLOATvector-set!
result
(+ index 1)
(FLOATvector-ref low-lut (+ index 1))))))
(define (extend-lut multiplier-lut
bit-reverse-size
bit-reverse-multiplier
start
end)
(define (bit-reverse x n)
(do ((i 0 (+ i 1))
(x x (arithmetic-shift x -1))
(result 0 (+ (* result 2)
(bitwise-and x 1))))
((= i n) result)))
(let loop ((i start)
(j 1))
(if (< i end)
(let* ((multiplier-index
(* 2
(* (bit-reverse j bit-reverse-size)
bit-reverse-multiplier)))
(multiplier-real
(FLOATvector-ref multiplier-lut multiplier-index))
(multiplier-imag
(FLOATvector-ref multiplier-lut (+ multiplier-index 1))))
(let inner ((i i)
(k 0))
;; we copy complex multiples of all entries below
;; start to entries starting at start
(if (< k start)
(let* ((index
(* k 2))
(real
(FLOATvector-ref result index))
(imag
(FLOATvector-ref result (+ index 1)))
(result-real
(FLOAT- (FLOAT* multiplier-real real)
(FLOAT* multiplier-imag imag)))
(result-imag
(FLOAT+ (FLOAT* multiplier-real imag)
(FLOAT* multiplier-imag real)))
(result-index (* i 2)))
(FLOATvector-set! result result-index result-real)
(FLOATvector-set! result (+ result-index 1) result-imag)
(inner (+ i 1)
(+ k 1)))
(loop i
(+ j 1)))))
result)))
(cond ((<= n lut-table-size)
low-lut)
((<= n lut-table-size^2)
(copy-low-lut)
(extend-lut med-lut
(- log-n log-lut-table-size)
(arithmetic-shift 1 (- (* 2 log-lut-table-size) log-n))
lut-table-size
n))
((<= n lut-table-size^3)
(copy-low-lut)
(extend-lut med-lut
log-lut-table-size
1
lut-table-size
lut-table-size^2)
(extend-lut high-lut
(- log-n (* 2 log-lut-table-size))
(arithmetic-shift 1 (- (* 3 log-lut-table-size) log-n))
lut-table-size^2
n))
(else
(error "asking for too large a table")))))
(define (direct-fft-recursive-4 a W-table)
;; This is a direcct complex fft, using a decimation-in-time
;; algorithm with inputs in natural order and outputs in
;; bit-reversed order. The table of "twiddle" factors is in
;; bit-reversed order.
this is from page 66 of and , except that we have
;; combined passes in pairs to cut the number of passes through
;; the vector a
(let ((W (FLOATvector 0. 0. 0. 0.)))
(define (main-loop M N K SizeOfGroup)
(let inner-loop ((K K)
(JFirst M))
(if (< JFirst N)
(let* ((JLast (+ JFirst SizeOfGroup)))
(if (even? K)
(begin
(FLOATvector-set! W 0 (FLOATvector-ref W-table K))
(FLOATvector-set! W 1 (FLOATvector-ref W-table (+ K 1))))
(begin
(FLOATvector-set! W 0 (FLOAT- 0. (FLOATvector-ref W-table K)))
(FLOATvector-set! W 1 (FLOATvector-ref W-table (- K 1)))))
we know the that the next two complex roots of
unity have index 2 K and 2K+1 so that the 2K+1
index root can be gotten from the 2 K index root
in the same way that we get W_0 and W_1 from the
;; table depending on whether K is even or not
(FLOATvector-set! W 2 (FLOATvector-ref W-table (* K 2)))
(FLOATvector-set! W 3 (FLOATvector-ref W-table (+ (* K 2) 1)))
(let J-loop ((J0 JFirst))
(if (< J0 JLast)
(let* ((J0 J0)
(J1 (+ J0 1))
(J2 (+ J0 SizeOfGroup))
(J3 (+ J2 1))
(J4 (+ J2 SizeOfGroup))
(J5 (+ J4 1))
(J6 (+ J4 SizeOfGroup))
(J7 (+ J6 1)))
(let ((W_0 (FLOATvector-ref W 0))
(W_1 (FLOATvector-ref W 1))
(W_2 (FLOATvector-ref W 2))
(W_3 (FLOATvector-ref W 3))
(a_J0 (FLOATvector-ref a J0))
(a_J1 (FLOATvector-ref a J1))
(a_J2 (FLOATvector-ref a J2))
(a_J3 (FLOATvector-ref a J3))
(a_J4 (FLOATvector-ref a J4))
(a_J5 (FLOATvector-ref a J5))
(a_J6 (FLOATvector-ref a J6))
(a_J7 (FLOATvector-ref a J7)))
;; first we do the (overlapping) pairs of
butterflies with entries 2*SizeOfGroup
;; apart.
(let ((Temp_0 (FLOAT- (FLOAT* W_0 a_J4)
(FLOAT* W_1 a_J5)))
(Temp_1 (FLOAT+ (FLOAT* W_0 a_J5)
(FLOAT* W_1 a_J4)))
(Temp_2 (FLOAT- (FLOAT* W_0 a_J6)
(FLOAT* W_1 a_J7)))
(Temp_3 (FLOAT+ (FLOAT* W_0 a_J7)
(FLOAT* W_1 a_J6))))
(let ((a_J0 (FLOAT+ a_J0 Temp_0))
(a_J1 (FLOAT+ a_J1 Temp_1))
(a_J2 (FLOAT+ a_J2 Temp_2))
(a_J3 (FLOAT+ a_J3 Temp_3))
(a_J4 (FLOAT- a_J0 Temp_0))
(a_J5 (FLOAT- a_J1 Temp_1))
(a_J6 (FLOAT- a_J2 Temp_2))
(a_J7 (FLOAT- a_J3 Temp_3)))
now we do the two ( disjoint ) pairs
;; of butterflies distance SizeOfGroup
apart , the first pair with ,
the second with -W3+W2i
;; we rewrite the multipliers so I
;; don't hurt my head too much when
;; thinking about them.
(let ((W_0 W_2)
(W_1 W_3)
(W_2 (FLOAT- 0. W_3))
(W_3 W_2))
(let ((Temp_0
(FLOAT- (FLOAT* W_0 a_J2)
(FLOAT* W_1 a_J3)))
(Temp_1
(FLOAT+ (FLOAT* W_0 a_J3)
(FLOAT* W_1 a_J2)))
(Temp_2
(FLOAT- (FLOAT* W_2 a_J6)
(FLOAT* W_3 a_J7)))
(Temp_3
(FLOAT+ (FLOAT* W_2 a_J7)
(FLOAT* W_3 a_J6))))
(let ((a_J0 (FLOAT+ a_J0 Temp_0))
(a_J1 (FLOAT+ a_J1 Temp_1))
(a_J2 (FLOAT- a_J0 Temp_0))
(a_J3 (FLOAT- a_J1 Temp_1))
(a_J4 (FLOAT+ a_J4 Temp_2))
(a_J5 (FLOAT+ a_J5 Temp_3))
(a_J6 (FLOAT- a_J4 Temp_2))
(a_J7 (FLOAT- a_J5 Temp_3)))
(FLOATvector-set! a J0 a_J0)
(FLOATvector-set! a J1 a_J1)
(FLOATvector-set! a J2 a_J2)
(FLOATvector-set! a J3 a_J3)
(FLOATvector-set! a J4 a_J4)
(FLOATvector-set! a J5 a_J5)
(FLOATvector-set! a J6 a_J6)
(FLOATvector-set! a J7 a_J7)
(J-loop (+ J0 2)))))))))
(inner-loop (+ K 1)
(+ JFirst (* SizeOfGroup 4)))))))))
(define (recursive-bit M N K SizeOfGroup)
(if (<= 2 SizeOfGroup)
(begin
(main-loop M N K SizeOfGroup)
(if (< 2048 (- N M))
(let ((new-size (arithmetic-shift (- N M) -2)))
(recursive-bit M
(+ M new-size)
(* K 4)
(arithmetic-shift SizeOfGroup -2))
(recursive-bit (+ M new-size)
(+ M (* new-size 2))
(+ (* K 4) 1)
(arithmetic-shift SizeOfGroup -2))
(recursive-bit (+ M (* new-size 2))
(+ M (* new-size 3))
(+ (* K 4) 2)
(arithmetic-shift SizeOfGroup -2))
(recursive-bit (+ M (* new-size 3))
N
(+ (* K 4) 3)
(arithmetic-shift SizeOfGroup -2)))
(recursive-bit M
N
(* K 4)
(arithmetic-shift SizeOfGroup -2))))))
(define (radix-2-pass a)
;; If we're here, the size of our (conceptually complex)
array is not a power of 4 , so we need to do a basic radix
two pass with w=1 ( so W[0]=1.0 and W[1 ] = 0 . ) and then
call recursive - bit appropriately on the two half arrays .
(let ((SizeOfGroup
(arithmetic-shift (FLOATvector-length a) -1)))
(let loop ((J0 0))
(if (< J0 SizeOfGroup)
(let ((J0 J0)
(J2 (+ J0 SizeOfGroup)))
(let ((J1 (+ J0 1))
(J3 (+ J2 1)))
(let ((a_J0 (FLOATvector-ref a J0))
(a_J1 (FLOATvector-ref a J1))
(a_J2 (FLOATvector-ref a J2))
(a_J3 (FLOATvector-ref a J3)))
(let ((a_J0 (FLOAT+ a_J0 a_J2))
(a_J1 (FLOAT+ a_J1 a_J3))
(a_J2 (FLOAT- a_J0 a_J2))
(a_J3 (FLOAT- a_J1 a_J3)))
(FLOATvector-set! a J0 a_J0)
(FLOATvector-set! a J1 a_J1)
(FLOATvector-set! a J2 a_J2)
(FLOATvector-set! a J3 a_J3)
(loop (+ J0 2))))))))))
(let* ((n (FLOATvector-length a))
(log_n (two^p>=m n)))
there are n/2 complex entries in a ; if is not a power
of 4 , then do a single radix-2 pass and do the rest of
;; the passes as radix-4 passes
(if (odd? log_n)
(recursive-bit 0 n 0 (arithmetic-shift n -2))
(let ((n/2 (arithmetic-shift n -1))
(n/8 (arithmetic-shift n -3)))
(radix-2-pass a)
(recursive-bit 0 n/2 0 n/8)
(recursive-bit n/2 n 1 n/8))))))
(define (inverse-fft-recursive-4 a W-table)
;; This is an complex fft, using a decimation-in-frequency algorithm
;; with inputs in bit-reversed order and outputs in natural order.
;; The organization of the algorithm has little to do with the the
associated algorithm on page 41 of and ,
;; I just reversed the operations of the direct algorithm given
above ( without dividing by 2 each time , so that this has to
be " normalized " by dividing by N/2 at the end .
;; The table of "twiddle" factors is in bit-reversed order.
(let ((W (FLOATvector 0. 0. 0. 0.)))
(define (main-loop M N K SizeOfGroup)
(let inner-loop ((K K)
(JFirst M))
(if (< JFirst N)
(let* ((JLast (+ JFirst SizeOfGroup)))
(if (even? K)
(begin
(FLOATvector-set! W 0 (FLOATvector-ref W-table K))
(FLOATvector-set! W 1 (FLOATvector-ref W-table (+ K 1))))
(begin
(FLOATvector-set! W 0 (FLOAT- 0. (FLOATvector-ref W-table K)))
(FLOATvector-set! W 1 (FLOATvector-ref W-table (- K 1)))))
(FLOATvector-set! W 2 (FLOATvector-ref W-table (* K 2)))
(FLOATvector-set! W 3 (FLOATvector-ref W-table (+ (* K 2) 1)))
(let J-loop ((J0 JFirst))
(if (< J0 JLast)
(let* ((J0 J0)
(J1 (+ J0 1))
(J2 (+ J0 SizeOfGroup))
(J3 (+ J2 1))
(J4 (+ J2 SizeOfGroup))
(J5 (+ J4 1))
(J6 (+ J4 SizeOfGroup))
(J7 (+ J6 1)))
(let ((W_0 (FLOATvector-ref W 0))
(W_1 (FLOATvector-ref W 1))
(W_2 (FLOATvector-ref W 2))
(W_3 (FLOATvector-ref W 3))
(a_J0 (FLOATvector-ref a J0))
(a_J1 (FLOATvector-ref a J1))
(a_J2 (FLOATvector-ref a J2))
(a_J3 (FLOATvector-ref a J3))
(a_J4 (FLOATvector-ref a J4))
(a_J5 (FLOATvector-ref a J5))
(a_J6 (FLOATvector-ref a J6))
(a_J7 (FLOATvector-ref a J7)))
(let ((W_00 W_2)
(W_01 W_3)
(W_02 (FLOAT- 0. W_3))
(W_03 W_2))
(let ((Temp_0 (FLOAT- a_J0 a_J2))
(Temp_1 (FLOAT- a_J1 a_J3))
(Temp_2 (FLOAT- a_J4 a_J6))
(Temp_3 (FLOAT- a_J5 a_J7)))
(let ((a_J0 (FLOAT+ a_J0 a_J2))
(a_J1 (FLOAT+ a_J1 a_J3))
(a_J4 (FLOAT+ a_J4 a_J6))
(a_J5 (FLOAT+ a_J5 a_J7))
(a_J2 (FLOAT+ (FLOAT* W_00 Temp_0)
(FLOAT* W_01 Temp_1)))
(a_J3 (FLOAT- (FLOAT* W_00 Temp_1)
(FLOAT* W_01 Temp_0)))
(a_J6 (FLOAT+ (FLOAT* W_02 Temp_2)
(FLOAT* W_03 Temp_3)))
(a_J7 (FLOAT- (FLOAT* W_02 Temp_3)
(FLOAT* W_03 Temp_2))))
(let ((Temp_0 (FLOAT- a_J0 a_J4))
(Temp_1 (FLOAT- a_J1 a_J5))
(Temp_2 (FLOAT- a_J2 a_J6))
(Temp_3 (FLOAT- a_J3 a_J7)))
(let ((a_J0 (FLOAT+ a_J0 a_J4))
(a_J1 (FLOAT+ a_J1 a_J5))
(a_J2 (FLOAT+ a_J2 a_J6))
(a_J3 (FLOAT+ a_J3 a_J7))
(a_J4 (FLOAT+ (FLOAT* W_0 Temp_0)
(FLOAT* W_1 Temp_1)))
(a_J5 (FLOAT- (FLOAT* W_0 Temp_1)
(FLOAT* W_1 Temp_0)))
(a_J6 (FLOAT+ (FLOAT* W_0 Temp_2)
(FLOAT* W_1 Temp_3)))
(a_J7 (FLOAT- (FLOAT* W_0 Temp_3)
(FLOAT* W_1 Temp_2))))
(FLOATvector-set! a J0 a_J0)
(FLOATvector-set! a J1 a_J1)
(FLOATvector-set! a J2 a_J2)
(FLOATvector-set! a J3 a_J3)
(FLOATvector-set! a J4 a_J4)
(FLOATvector-set! a J5 a_J5)
(FLOATvector-set! a J6 a_J6)
(FLOATvector-set! a J7 a_J7)
(J-loop (+ J0 2)))))))))
(inner-loop (+ K 1)
(+ JFirst (* SizeOfGroup 4)))))))))
(define (recursive-bit M N K SizeOfGroup)
(if (<= 2 SizeOfGroup)
(begin
(if (< 2048 (- N M))
(let ((new-size (arithmetic-shift (- N M) -2)))
(recursive-bit M
(+ M new-size)
(* K 4)
(arithmetic-shift SizeOfGroup -2))
(recursive-bit (+ M new-size)
(+ M (* new-size 2))
(+ (* K 4) 1)
(arithmetic-shift SizeOfGroup -2))
(recursive-bit (+ M (* new-size 2))
(+ M (* new-size 3))
(+ (* K 4) 2)
(arithmetic-shift SizeOfGroup -2))
(recursive-bit (+ M (* new-size 3))
N
(+ (* K 4) 3)
(arithmetic-shift SizeOfGroup -2)))
(recursive-bit M
N
(* K 4)
(arithmetic-shift SizeOfGroup -2)))
(main-loop M N K SizeOfGroup))))
(define (radix-2-pass a)
(let ((SizeOfGroup
(arithmetic-shift (FLOATvector-length a) -1)))
(let loop ((J0 0))
(if (< J0 SizeOfGroup)
(let ((J0 J0)
(J2 (+ J0 SizeOfGroup)))
(let ((J1 (+ J0 1))
(J3 (+ J2 1)))
(let ((a_J0 (FLOATvector-ref a J0))
(a_J1 (FLOATvector-ref a J1))
(a_J2 (FLOATvector-ref a J2))
(a_J3 (FLOATvector-ref a J3)))
(let ((a_J0 (FLOAT+ a_J0 a_J2))
(a_J1 (FLOAT+ a_J1 a_J3))
(a_J2 (FLOAT- a_J0 a_J2))
(a_J3 (FLOAT- a_J1 a_J3)))
(FLOATvector-set! a J0 a_J0)
(FLOATvector-set! a J1 a_J1)
(FLOATvector-set! a J2 a_J2)
(FLOATvector-set! a J3 a_J3)
(loop (+ J0 2))))))))))
(let* ((n (FLOATvector-length a))
(log_n (two^p>=m n)))
(if (odd? log_n)
(recursive-bit 0 n 0 (arithmetic-shift n -2))
(let ((n/2 (arithmetic-shift n -1))
(n/8 (arithmetic-shift n -3)))
(recursive-bit 0 n/2 0 n/8)
(recursive-bit n/2 n 1 n/8)
(radix-2-pass a))))))
(define (two^p>=m m)
returns smallest p , assumes fixnum m > = 0
(do ((p 0 (+ p 1))
(two^p 1 (* two^p 2)))
((<= m two^p) p)))
Works on 2^n complex doubles .
(define two^n+1 (expt 2 (+ n 1)))
(define inexact-two^-n (FLOAT/ (exact->inexact (expt 2 n))))
(define data
;; A float vector with data[i]=i
(let ((result (FLOATmake-vector two^n+1)))
(do ((i 0 (+ i 1)))
((= i two^n+1) result)
(FLOATvector-set! result i (exact->inexact i)))))
(define (run data)
(let ((table (make-w (- n 1))))
(direct-fft-recursive-4 data table)
(inverse-fft-recursive-4 data table)
(do ((j 0 (+ j 1)))
((= j two^n+1))
(FLOATvector-set! data j (FLOAT* (FLOATvector-ref data j) inexact-two^-n)))
(FLOATvector-ref data 3)))
(define (main . args)
(run-benchmark
"fftrad4"
fftrad4-iters
(lambda (result) (FLOAT<= (FLOATabs (FLOAT- result 3.0)) 1e-4))
(lambda (data) (lambda () (run data)))
data))
(main)
| null | https://raw.githubusercontent.com/bsaleil/lc/ee7867fd2bdbbe88924300e10b14ea717ee6434b/tools/benchtimes/resultVMIL-lc-gsc-lc/LC5/fftrad4.scm.scm | scheme | ------------------------------------------------------------------------------
------------------------------------------------------------------------------
------------------------------------------------------------------------------
Gabriel benchmarks
C benchmarks
Other benchmarks
Permission is hereby granted, free of charge, to any person obtaining
a copy of this software and associated documentation files (the "Software"),
the rights to use, copy, modify, merge, publish, distribute, sublicense,
Software is furnished to do so, subject to the following conditions:
The above copyright notice and this permission notice shall be included
OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY
TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE
SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
The direct transform takes in-order input and produces out-of-order output.
The inverse transform takes out-of-order input and produces in-order output.
This particular code has guaranteed error bounds, see in particular
the commentary at
#L6395
number of complexes
we copy complex multiples of all entries below
start to entries starting at start
This is a direcct complex fft, using a decimation-in-time
algorithm with inputs in natural order and outputs in
bit-reversed order. The table of "twiddle" factors is in
bit-reversed order.
combined passes in pairs to cut the number of passes through
the vector a
table depending on whether K is even or not
first we do the (overlapping) pairs of
apart.
of butterflies distance SizeOfGroup
we rewrite the multipliers so I
don't hurt my head too much when
thinking about them.
If we're here, the size of our (conceptually complex)
if is not a power
the passes as radix-4 passes
This is an complex fft, using a decimation-in-frequency algorithm
with inputs in bit-reversed order and outputs in natural order.
The organization of the algorithm has little to do with the the
I just reversed the operations of the direct algorithm given
The table of "twiddle" factors is in bit-reversed order.
A float vector with data[i]=i | Macros
(##define-macro (def-macro form . body)
`(##define-macro ,form (let () ,@body)))
(def-macro (FLOATvector-const . lst) `',(list->vector lst))
(def-macro (FLOATvector? x) `(vector? ,x))
(def-macro (FLOATvector . lst) `(vector ,@lst))
(def-macro (FLOATmake-vector n . init) `(make-vector ,n ,@init))
(def-macro (FLOATvector-ref v i) `(vector-ref ,v ,i))
(def-macro (FLOATvector-set! v i x) `(vector-set! ,v ,i ,x))
(def-macro (FLOATvector-length v) `(vector-length ,v))
(def-macro (nuc-const . lst)
`',(list->vector lst))
(def-macro (FLOAT+ . lst) `(+ ,@lst))
(def-macro (FLOAT- . lst) `(- ,@lst))
(def-macro (FLOAT* . lst) `(* ,@lst))
(def-macro (FLOAT/ . lst) `(/ ,@lst))
(def-macro (FLOAT= . lst) `(= ,@lst))
(def-macro (FLOAT< . lst) `(< ,@lst))
(def-macro (FLOAT<= . lst) `(<= ,@lst))
(def-macro (FLOAT> . lst) `(> ,@lst))
(def-macro (FLOAT>= . lst) `(>= ,@lst))
(def-macro (FLOATnegative? . lst) `(negative? ,@lst))
(def-macro (FLOATpositive? . lst) `(positive? ,@lst))
(def-macro (FLOATzero? . lst) `(zero? ,@lst))
(def-macro (FLOATabs . lst) `(abs ,@lst))
(def-macro (FLOATsin . lst) `(sin ,@lst))
(def-macro (FLOATcos . lst) `(cos ,@lst))
(def-macro (FLOATatan . lst) `(atan ,@lst))
(def-macro (FLOATsqrt . lst) `(sqrt ,@lst))
(def-macro (FLOATmin . lst) `(min ,@lst))
(def-macro (FLOATmax . lst) `(max ,@lst))
(def-macro (FLOATround . lst) `(round ,@lst))
(def-macro (FLOATinexact->exact . lst) `(inexact->exact ,@lst))
(def-macro (GENERIC+ . lst) `(+ ,@lst))
(def-macro (GENERIC- . lst) `(- ,@lst))
(def-macro (GENERIC* . lst) `(* ,@lst))
(def-macro (GENERIC/ . lst) `(/ ,@lst))
(def-macro (GENERICquotient . lst) `(quotient ,@lst))
(def-macro (GENERICremainder . lst) `(remainder ,@lst))
(def-macro (GENERICmodulo . lst) `(modulo ,@lst))
(def-macro (GENERIC= . lst) `(= ,@lst))
(def-macro (GENERIC< . lst) `(< ,@lst))
(def-macro (GENERIC<= . lst) `(<= ,@lst))
(def-macro (GENERIC> . lst) `(> ,@lst))
(def-macro (GENERIC>= . lst) `(>= ,@lst))
(def-macro (GENERICexpt . lst) `(expt ,@lst))
Functions used by LC to get time info
(def-macro (##lc-time expr)
(let ((sym (gensym)))
`(let ((r (##lc-exec-stats (lambda () ,expr))))
(##print-perm-string "CPU time: ")
(##print-double (+ (cdr (assoc "User time" (cdr r)))
(cdr (assoc "Sys time" (cdr r)))))
(##print-perm-string "\n")
(##print-perm-string "GC CPU time: ")
(##print-double (+ (cdr (assoc "GC user time" (cdr r)))
(cdr (assoc "GC sys time" (cdr r)))))
(##print-perm-string "\n")
(map (lambda (el)
(##print-perm-string (car el))
(##print-perm-string ": ")
(##print-double (cdr el))
(##print-perm-string "\n"))
(cdr r))
r)))
(define (##lc-exec-stats thunk)
(let* ((at-start (##process-statistics))
(result (thunk))
(at-end (##process-statistics)))
(define (get-info msg idx)
(cons msg
(- (f64vector-ref at-end idx)
(f64vector-ref at-start idx))))
(list
result
(get-info "User time" 0)
(get-info "Sys time" 1)
(get-info "Real time" 2)
(get-info "GC user time" 3)
(get-info "GC sys time" 4)
(get-info "GC real time" 5)
(get-info "Nb gcs" 6))))
(define (run-bench name count ok? run)
(let loop ((i count) (result '(undefined)))
(if (< 0 i)
(loop (- i 1) (run))
result)))
(define (run-benchmark name count ok? run-maker . args)
(let ((run (apply run-maker args)))
(let ((result (car (##lc-time (run-bench name count ok? run)))))
(if (not (ok? result))
(begin
(display "*** wrong result ***")
(newline)
(display "*** got: ")
(write result)
(newline))))))
(define boyer-iters 20)
(define browse-iters 600)
(define cpstak-iters 1000)
(define ctak-iters 100)
(define dderiv-iters 2000000)
(define deriv-iters 2000000)
(define destruc-iters 500)
(define diviter-iters 1000000)
(define divrec-iters 1000000)
(define puzzle-iters 100)
(define tak-iters 2000)
(define takl-iters 300)
(define trav1-iters 100)
(define trav2-iters 20)
(define triangl-iters 10)
and benchmarks
(define ack-iters 10)
(define array1-iters 1)
(define cat-iters 1)
(define string-iters 10)
(define sum1-iters 10)
(define sumloop-iters 10)
(define tail-iters 1)
(define wc-iters 1)
(define fft-iters 2000)
(define fib-iters 5)
(define fibfp-iters 2)
(define mbrot-iters 100)
(define nucleic-iters 5)
(define pnpoly-iters 100000)
(define sum-iters 20000)
(define sumfp-iters 20000)
(define tfib-iters 20)
(define conform-iters 40)
(define dynamic-iters 20)
(define earley-iters 200)
(define fibc-iters 500)
(define graphs-iters 300)
(define lattice-iters 1)
(define matrix-iters 400)
(define maze-iters 4000)
(define mazefun-iters 1000)
(define nqueens-iters 2000)
(define paraffins-iters 1000)
(define peval-iters 200)
(define pi-iters 2)
(define primes-iters 100000)
(define ray-iters 5)
(define scheme-iters 20000)
(define simplex-iters 100000)
(define slatex-iters 20)
(define perm9-iters 10)
(define nboyer-iters 100)
(define sboyer-iters 100)
(define gcbench-iters 1)
(define compiler-iters 300)
(define nbody-iters 1)
(define fftrad4-iters 4)
Copyright 2018 ,
to deal in the Software without restriction , including without limitation
and/or sell copies of the Software , and to permit persons to whom the
in all copies or substantial portions of the Software .
THE SOFTWARE IS PROVIDED " AS IS " , WITHOUT WARRANTY OF ANY KIND , EXPRESS
MERCHANTABILITY , FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT .
CLAIM , DAMAGES OR OTHER LIABILITY , WHETHER IN AN ACTION OF CONTRACT ,
This software calculates radix 4 direct and inverse Fast Fourier Transforms .
(define lut-table-size 512)
(define lut-table-size^2 262144)
(define lut-table-size^3 134217728)
(define log-lut-table-size 9)
(define low-lut
(FLOATvector-const
1. 0.
.7071067811865476 .7071067811865476
.9238795325112867 .3826834323650898
.3826834323650898 .9238795325112867
.9807852804032304 .19509032201612828
.5555702330196022 .8314696123025452
.8314696123025452 .5555702330196022
.19509032201612828 .9807852804032304
.9951847266721969 .0980171403295606
.6343932841636455 .773010453362737
.881921264348355 .47139673682599764
.2902846772544624 .9569403357322088
.9569403357322088 .2902846772544624
.47139673682599764 .881921264348355
.773010453362737 .6343932841636455
.0980171403295606 .9951847266721969
.9987954562051724 .049067674327418015
.6715589548470184 .7409511253549591
.9039892931234433 .4275550934302821
.33688985339222005 .9415440651830208
.970031253194544 .2429801799032639
.5141027441932218 .8577286100002721
.8032075314806449 .5956993044924334
.14673047445536175 .989176509964781
.989176509964781 .14673047445536175
.5956993044924334 .8032075314806449
.8577286100002721 .5141027441932218
.2429801799032639 .970031253194544
.9415440651830208 .33688985339222005
.4275550934302821 .9039892931234433
.7409511253549591 .6715589548470184
.049067674327418015 .9987954562051724
.9996988186962042 .024541228522912288
.6895405447370669 .7242470829514669
.9142097557035307 .40524131400498986
.35989503653498817 .9329927988347388
.9757021300385286 .2191012401568698
.5349976198870973 .8448535652497071
.8175848131515837 .5758081914178453
.17096188876030122 .9852776423889412
.99247953459871 .1224106751992162
.6152315905806268 .7883464276266062
.8700869911087115 .49289819222978404
.26671275747489837 .9637760657954398
.9495281805930367 .31368174039889146
.4496113296546066 .8932243011955153
.7572088465064846 .6531728429537768
.07356456359966743 .9972904566786902
.9972904566786902 .07356456359966743
.6531728429537768 .7572088465064846
.8932243011955153 .4496113296546066
.31368174039889146 .9495281805930367
.9637760657954398 .26671275747489837
.49289819222978404 .8700869911087115
.7883464276266062 .6152315905806268
.1224106751992162 .99247953459871
.9852776423889412 .17096188876030122
.5758081914178453 .8175848131515837
.8448535652497071 .5349976198870973
.2191012401568698 .9757021300385286
.9329927988347388 .35989503653498817
.40524131400498986 .9142097557035307
.7242470829514669 .6895405447370669
.024541228522912288 .9996988186962042
.9999247018391445 .012271538285719925
.6983762494089728 .7157308252838187
.9191138516900578 .3939920400610481
.37131719395183754 .9285060804732156
.9783173707196277 .20711137619221856
.5453249884220465 .8382247055548381
.8245893027850253 .5657318107836132
.18303988795514095 .9831054874312163
.9939069700023561 .11022220729388306
.6248594881423863 .7807372285720945
.8760700941954066 .4821837720791228
.2785196893850531 .9604305194155658
.9533060403541939 .3020059493192281
.46053871095824 .8876396204028539
.765167265622459 .6438315428897915
.0857973123444399 .996312612182778
.9981181129001492 .06132073630220858
.6624157775901718 .7491363945234594
.8986744656939538 .43861623853852766
.3253102921622629 .9456073253805213
.9669764710448521 .25486565960451457
.5035383837257176 .8639728561215867
.7958369046088836 .6055110414043255
.1345807085071262 .99090263542778
.9873014181578584 .15885814333386145
.5857978574564389 .8104571982525948
.8513551931052652 .524589682678469
.2310581082806711 .9729399522055602
.937339011912575 .34841868024943456
.4164295600976372 .9091679830905224
.7326542716724128 .680600997795453
.03680722294135883 .9993223845883495
.9993223845883495 .03680722294135883
.680600997795453 .7326542716724128
.9091679830905224 .4164295600976372
.34841868024943456 .937339011912575
.9729399522055602 .2310581082806711
.524589682678469 .8513551931052652
.8104571982525948 .5857978574564389
.15885814333386145 .9873014181578584
.99090263542778 .1345807085071262
.6055110414043255 .7958369046088836
.8639728561215867 .5035383837257176
.25486565960451457 .9669764710448521
.9456073253805213 .3253102921622629
.43861623853852766 .8986744656939538
.7491363945234594 .6624157775901718
.06132073630220858 .9981181129001492
.996312612182778 .0857973123444399
.6438315428897915 .765167265622459
.8876396204028539 .46053871095824
.3020059493192281 .9533060403541939
.9604305194155658 .2785196893850531
.4821837720791228 .8760700941954066
.7807372285720945 .6248594881423863
.11022220729388306 .9939069700023561
.9831054874312163 .18303988795514095
.5657318107836132 .8245893027850253
.8382247055548381 .5453249884220465
.20711137619221856 .9783173707196277
.9285060804732156 .37131719395183754
.3939920400610481 .9191138516900578
.7157308252838187 .6983762494089728
.012271538285719925 .9999247018391445
.9999811752826011 .006135884649154475
.7027547444572253 .7114321957452164
.9215140393420419 .3883450466988263
.37700741021641826 .9262102421383114
.9795697656854405 .2011046348420919
.5504579729366048 .83486287498638
.8280450452577558 .560661576197336
.18906866414980622 .9819638691095552
.9945645707342554 .10412163387205457
.629638238914927 .7768884656732324
.8790122264286335 .47679923006332214
.2844075372112718 .9587034748958716
.9551411683057707 .29615088824362384
.4659764957679662 .8847970984309378
.7691033376455796 .6391244448637757
.09190895649713272 .9957674144676598
.9984755805732948 .05519524434968994
.6669999223036375 .745057785441466
.901348847046022 .43309381885315196
.33110630575987643 .9435934581619604
.9685220942744173 .24892760574572018
.508830142543107 .8608669386377673
.799537269107905 .600616479383869
.14065823933284924 .9900582102622971
.9882575677307495 .15279718525844344
.5907597018588743 .8068475535437992
.8545579883654005 .5193559901655896
.2370236059943672 .9715038909862518
.9394592236021899 .3426607173119944
.4220002707997997 .9065957045149153
.7368165688773699 .6760927035753159
.04293825693494082 .9990777277526454
.9995294175010931 .030674803176636626
.6850836677727004 .7284643904482252
.9117060320054299 .41084317105790397
.3541635254204904 .9351835099389476
.9743393827855759 .22508391135979283
.5298036246862947 .8481203448032972
.8140363297059484 .5808139580957645
.16491312048996992 .9863080972445987
.9917097536690995 .12849811079379317
.6103828062763095 .7921065773002124
.8670462455156926 .49822766697278187
.2607941179152755 .9653944416976894
.9475855910177411 .3195020308160157
.44412214457042926 .8959662497561851
.7531867990436125 .6578066932970786
.06744391956366406 .9977230666441916
.9968202992911657 .07968243797143013
.6485144010221124 .7612023854842618
.8904487232447579 .45508358712634384
.30784964004153487 .9514350209690083
.9621214042690416 .272621355449949
.48755016014843594 .8730949784182901
.7845565971555752 .6200572117632892
.11631863091190477 .9932119492347945
.984210092386929 .17700422041214875
.5707807458869673 .8211025149911046
.8415549774368984 .5401714727298929
.21311031991609136 .9770281426577544
.9307669610789837 .36561299780477385
.39962419984564684 .9166790599210427
.7200025079613817 .693971460889654
.01840672990580482 .9998305817958234
.9998305817958234 .01840672990580482
.693971460889654 .7200025079613817
.9166790599210427 .39962419984564684
.36561299780477385 .9307669610789837
.9770281426577544 .21311031991609136
.5401714727298929 .8415549774368984
.8211025149911046 .5707807458869673
.17700422041214875 .984210092386929
.9932119492347945 .11631863091190477
.6200572117632892 .7845565971555752
.8730949784182901 .48755016014843594
.272621355449949 .9621214042690416
.9514350209690083 .30784964004153487
.45508358712634384 .8904487232447579
.7612023854842618 .6485144010221124
.07968243797143013 .9968202992911657
.9977230666441916 .06744391956366406
.6578066932970786 .7531867990436125
.8959662497561851 .44412214457042926
.3195020308160157 .9475855910177411
.9653944416976894 .2607941179152755
.49822766697278187 .8670462455156926
.7921065773002124 .6103828062763095
.12849811079379317 .9917097536690995
.9863080972445987 .16491312048996992
.5808139580957645 .8140363297059484
.8481203448032972 .5298036246862947
.22508391135979283 .9743393827855759
.9351835099389476 .3541635254204904
.41084317105790397 .9117060320054299
.7284643904482252 .6850836677727004
.030674803176636626 .9995294175010931
.9990777277526454 .04293825693494082
.6760927035753159 .7368165688773699
.9065957045149153 .4220002707997997
.3426607173119944 .9394592236021899
.9715038909862518 .2370236059943672
.5193559901655896 .8545579883654005
.8068475535437992 .5907597018588743
.15279718525844344 .9882575677307495
.9900582102622971 .14065823933284924
.600616479383869 .799537269107905
.8608669386377673 .508830142543107
.24892760574572018 .9685220942744173
.9435934581619604 .33110630575987643
.43309381885315196 .901348847046022
.745057785441466 .6669999223036375
.05519524434968994 .9984755805732948
.9957674144676598 .09190895649713272
.6391244448637757 .7691033376455796
.8847970984309378 .4659764957679662
.29615088824362384 .9551411683057707
.9587034748958716 .2844075372112718
.47679923006332214 .8790122264286335
.7768884656732324 .629638238914927
.10412163387205457 .9945645707342554
.9819638691095552 .18906866414980622
.560661576197336 .8280450452577558
.83486287498638 .5504579729366048
.2011046348420919 .9795697656854405
.9262102421383114 .37700741021641826
.3883450466988263 .9215140393420419
.7114321957452164 .7027547444572253
.006135884649154475 .9999811752826011
.9999952938095762 .003067956762965976
.7049340803759049 .7092728264388657
.9227011283338785 .38551605384391885
.37984720892405116 .9250492407826776
.9801821359681174 .1980984107179536
.5530167055800276 .8331701647019132
.829761233794523 .5581185312205561
.19208039704989244 .9813791933137546
.9948793307948056 .10106986275482782
.6320187359398091 .7749531065948739
.8804708890521608 .47410021465055
.2873474595447295 .9578264130275329
.9560452513499964 .29321916269425863
.46868882203582796 .8833633386657316
.7710605242618138 .6367618612362842
.094963495329639 .9954807554919269
.9986402181802653 .052131704680283324
.6692825883466361 .7430079521351217
.9026733182372588 .4303264813400826
.3339996514420094 .9425731976014469
.9692812353565485 .24595505033579462
.5114688504379704 .8593018183570084
.8013761717231402 .5981607069963423
.14369503315029444 .9896220174632009
.9887216919603238 .1497645346773215
.5932322950397998 .8050313311429635
.8561473283751945 .5167317990176499
.2400030224487415 .9707721407289504
.9405060705932683 .33977688440682685
.4247796812091088 .9052967593181188
.7388873244606151 .673829000378756
.04600318213091463 .9989412931868569
.9996188224951786 .027608145778965743
.6873153408917592 .726359155084346
.9129621904283982 .4080441628649787
.35703096123343003 .9340925504042589
.9750253450669941 .22209362097320354
.532403127877198 .8464909387740521
.8158144108067338 .5783137964116556
.16793829497473117 .9857975091675675
.9920993131421918 .12545498341154623
.6128100824294097 .79023022143731
.8685707059713409 .49556526182577254
.2637546789748314 .9645897932898128
.9485613499157303 .31659337555616585
.4468688401623742 .8945994856313827
.7552013768965365 .6554928529996153
.07050457338961387 .9975114561403035
.997060070339483 .07662386139203149
.6508466849963809 .7592091889783881
.8918407093923427 .4523495872337709
.3107671527496115 .9504860739494817
.9629532668736839 .2696683255729151
.49022648328829116 .8715950866559511
.7864552135990858 .617647307937804
.11936521481099137 .9928504144598651
.9847485018019042 .17398387338746382
.5732971666980422 .819347520076797
.8432082396418454 .5375870762956455
.21610679707621952 .9763697313300211
.9318842655816681 .3627557243673972
.40243465085941843 .9154487160882678
.7221281939292153 .6917592583641577
.021474080275469508 .9997694053512153
.9998823474542126 .015339206284988102
.696177131491463 .7178700450557317
.9179007756213905 .3968099874167103
.3684668299533723 .9296408958431812
.9776773578245099 .2101118368804696
.5427507848645159 .8398937941959995
.8228497813758263 .5682589526701316
.18002290140569951 .9836624192117303
.9935641355205953 .11327095217756435
.62246127937415 .7826505961665757
.8745866522781761 .4848692480007911
.27557181931095814 .9612804858113206
.9523750127197659 .30492922973540243
.45781330359887723 .8890483558546646
.7631884172633813 .6461760129833164
.08274026454937569 .9965711457905548
.997925286198596 .06438263092985747
.6601143420674205 .7511651319096864
.8973245807054183 .44137126873171667
.32240767880106985 .9466009130832835
.9661900034454125 .257831102162159
.5008853826112408 .8655136240905691
.7939754775543372 .6079497849677736
.13154002870288312 .9913108598461154
.9868094018141855 .16188639378011183
.5833086529376983 .8122505865852039
.8497417680008524 .5271991347819014
.22807208317088573 .973644249650812
.9362656671702783 .35129275608556715
.41363831223843456 .9104412922580672
.7305627692278276 .6828455463852481
.03374117185137759 .9994306045554617
.9992047586183639 .03987292758773981
.6783500431298615 .7347388780959635
.9078861164876663 .41921688836322396
.34554132496398904 .9384035340631081
.9722264970789363 .23404195858354343
.5219752929371544 .8529606049303636
.808656181588175 .5882815482226453
.15582839765426523 .9877841416445722
.9904850842564571 .13762012158648604
.6030665985403482 .7976908409433912
.8624239561110405 .5061866453451553
.25189781815421697 .9677538370934755
.9446048372614803 .32820984357909255
.4358570799222555 .9000158920161603
.7471006059801801 .6647109782033449
.05825826450043576 .9983015449338929
.996044700901252 .0888535525825246
.6414810128085832 .7671389119358204
.8862225301488806 .4632597835518602
.2990798263080405 .9542280951091057
.9595715130819845 .281464937925758
.479493757660153 .8775452902072612
.778816512381476 .6272518154951441
.10717242495680884 .9942404494531879
.9825393022874412 .18605515166344666
.5631993440138341 .8263210628456635
.836547727223512 .5478940591731002
.20410896609281687 .9789481753190622
.9273625256504011 .374164062971458
.39117038430225387 .9203182767091106
.7135848687807936 .7005687939432483
.00920375478205982 .9999576445519639
.9999576445519639 .00920375478205982
.7005687939432483 .7135848687807936
.9203182767091106 .39117038430225387
.374164062971458 .9273625256504011
.9789481753190622 .20410896609281687
.5478940591731002 .836547727223512
.8263210628456635 .5631993440138341
.18605515166344666 .9825393022874412
.9942404494531879 .10717242495680884
.6272518154951441 .778816512381476
.8775452902072612 .479493757660153
.281464937925758 .9595715130819845
.9542280951091057 .2990798263080405
.4632597835518602 .8862225301488806
.7671389119358204 .6414810128085832
.0888535525825246 .996044700901252
.9983015449338929 .05825826450043576
.6647109782033449 .7471006059801801
.9000158920161603 .4358570799222555
.32820984357909255 .9446048372614803
.9677538370934755 .25189781815421697
.5061866453451553 .8624239561110405
.7976908409433912 .6030665985403482
.13762012158648604 .9904850842564571
.9877841416445722 .15582839765426523
.5882815482226453 .808656181588175
.8529606049303636 .5219752929371544
.23404195858354343 .9722264970789363
.9384035340631081 .34554132496398904
.41921688836322396 .9078861164876663
.7347388780959635 .6783500431298615
.03987292758773981 .9992047586183639
.9994306045554617 .03374117185137759
.6828455463852481 .7305627692278276
.9104412922580672 .41363831223843456
.35129275608556715 .9362656671702783
.973644249650812 .22807208317088573
.5271991347819014 .8497417680008524
.8122505865852039 .5833086529376983
.16188639378011183 .9868094018141855
.9913108598461154 .13154002870288312
.6079497849677736 .7939754775543372
.8655136240905691 .5008853826112408
.257831102162159 .9661900034454125
.9466009130832835 .32240767880106985
.44137126873171667 .8973245807054183
.7511651319096864 .6601143420674205
.06438263092985747 .997925286198596
.9965711457905548 .08274026454937569
.6461760129833164 .7631884172633813
.8890483558546646 .45781330359887723
.30492922973540243 .9523750127197659
.9612804858113206 .27557181931095814
.4848692480007911 .8745866522781761
.7826505961665757 .62246127937415
.11327095217756435 .9935641355205953
.9836624192117303 .18002290140569951
.5682589526701316 .8228497813758263
.8398937941959995 .5427507848645159
.2101118368804696 .9776773578245099
.9296408958431812 .3684668299533723
.3968099874167103 .9179007756213905
.7178700450557317 .696177131491463
.015339206284988102 .9998823474542126
.9997694053512153 .021474080275469508
.6917592583641577 .7221281939292153
.9154487160882678 .40243465085941843
.3627557243673972 .9318842655816681
.9763697313300211 .21610679707621952
.5375870762956455 .8432082396418454
.819347520076797 .5732971666980422
.17398387338746382 .9847485018019042
.9928504144598651 .11936521481099137
.617647307937804 .7864552135990858
.8715950866559511 .49022648328829116
.2696683255729151 .9629532668736839
.9504860739494817 .3107671527496115
.4523495872337709 .8918407093923427
.7592091889783881 .6508466849963809
.07662386139203149 .997060070339483
.9975114561403035 .07050457338961387
.6554928529996153 .7552013768965365
.8945994856313827 .4468688401623742
.31659337555616585 .9485613499157303
.9645897932898128 .2637546789748314
.49556526182577254 .8685707059713409
.79023022143731 .6128100824294097
.12545498341154623 .9920993131421918
.9857975091675675 .16793829497473117
.5783137964116556 .8158144108067338
.8464909387740521 .532403127877198
.22209362097320354 .9750253450669941
.9340925504042589 .35703096123343003
.4080441628649787 .9129621904283982
.726359155084346 .6873153408917592
.027608145778965743 .9996188224951786
.9989412931868569 .04600318213091463
.673829000378756 .7388873244606151
.9052967593181188 .4247796812091088
.33977688440682685 .9405060705932683
.9707721407289504 .2400030224487415
.5167317990176499 .8561473283751945
.8050313311429635 .5932322950397998
.1497645346773215 .9887216919603238
.9896220174632009 .14369503315029444
.5981607069963423 .8013761717231402
.8593018183570084 .5114688504379704
.24595505033579462 .9692812353565485
.9425731976014469 .3339996514420094
.4303264813400826 .9026733182372588
.7430079521351217 .6692825883466361
.052131704680283324 .9986402181802653
.9954807554919269 .094963495329639
.6367618612362842 .7710605242618138
.8833633386657316 .46868882203582796
.29321916269425863 .9560452513499964
.9578264130275329 .2873474595447295
.47410021465055 .8804708890521608
.7749531065948739 .6320187359398091
.10106986275482782 .9948793307948056
.9813791933137546 .19208039704989244
.5581185312205561 .829761233794523
.8331701647019132 .5530167055800276
.1980984107179536 .9801821359681174
.9250492407826776 .37984720892405116
.38551605384391885 .9227011283338785
.7092728264388657 .7049340803759049
.003067956762965976 .9999952938095762
))
(define med-lut
(FLOATvector-const
1. 0.
.9999999999820472 5.9921124526424275e-6
.9999999999281892 1.1984224905069707e-5
.9999999998384257 1.7976337357066685e-5
.9999999997127567 2.396844980841822e-5
.9999999995511824 2.9960562258909154e-5
.9999999993537025 3.5952674708324344e-5
.9999999991203175 4.1944787156448635e-5
.9999999988510269 4.793689960306688e-5
.9999999985458309 5.3929012047963936e-5
.9999999982047294 5.992112449092465e-5
.9999999978277226 6.591323693173387e-5
.9999999974148104 7.190534937017645e-5
.9999999969659927 7.789746180603723e-5
.9999999964812697 8.388957423910108e-5
.9999999959606412 8.988168666915283e-5
.9999999954041073 9.587379909597734e-5
.999999994811668 1.0186591151935948e-4
.9999999941833233 1.0785802393908407e-4
.9999999935190732 1.1385013635493597e-4
.9999999928189177 1.1984224876670004e-4
.9999999920828567 1.2583436117416112e-4
.9999999913108903 1.3182647357710405e-4
.9999999905030187 1.3781858597531374e-4
.9999999896592414 1.4381069836857496e-4
.9999999887795589 1.498028107566726e-4
.9999999878639709 1.5579492313939151e-4
.9999999869124775 1.6178703551651655e-4
.9999999859250787 1.6777914788783258e-4
.9999999849017744 1.737712602531244e-4
.9999999838425648 1.797633726121769e-4
.9999999827474497 1.8575548496477492e-4
.9999999816164293 1.9174759731070332e-4
.9999999804495034 1.9773970964974692e-4
.9999999792466722 2.037318219816906e-4
.9999999780079355 2.0972393430631923e-4
.9999999767332933 2.1571604662341763e-4
.9999999754227459 2.2170815893277063e-4
.9999999740762929 2.2770027123416315e-4
.9999999726939346 2.3369238352737996e-4
.9999999712756709 2.3968449581220595e-4
.9999999698215016 2.45676608088426e-4
.9999999683314271 2.5166872035582493e-4
.9999999668054471 2.5766083261418755e-4
.9999999652435617 2.636529448632988e-4
.9999999636457709 2.696450571029434e-4
.9999999620120748 2.756371693329064e-4
.9999999603424731 2.8162928155297243e-4
.9999999586369661 2.876213937629265e-4
.9999999568955537 2.936135059625534e-4
.9999999551182358 2.99605618151638e-4
.9999999533050126 3.055977303299651e-4
.9999999514558838 3.115898424973196e-4
.9999999495708498 3.1758195465348636e-4
.9999999476499103 3.235740667982502e-4
.9999999456930654 3.2956617893139595e-4
.9999999437003151 3.3555829105270853e-4
.9999999416716594 3.4155040316197275e-4
.9999999396070982 3.475425152589734e-4
.9999999375066316 3.535346273434955e-4
.9999999353702598 3.595267394153237e-4
.9999999331979824 3.6551885147424295e-4
.9999999309897996 3.7151096352003814e-4
.9999999287457114 3.7750307555249406e-4
.9999999264657179 3.8349518757139556e-4
.9999999241498189 3.8948729957652753e-4
.9999999217980144 3.954794115676748e-4
.9999999194103046 4.0147152354462224e-4
.9999999169866894 4.0746363550715466e-4
.9999999145271687 4.134557474550569e-4
.9999999120317428 4.194478593881139e-4
.9999999095004113 4.2543997130611036e-4
.9999999069331744 4.314320832088313e-4
.9999999043300322 4.3742419509606144e-4
.9999999016909845 4.4341630696758576e-4
.9999998990160315 4.4940841882318896e-4
.9999998963051729 4.55400530662656e-4
.999999893558409 4.613926424857717e-4
.9999998907757398 4.673847542923209e-4
.9999998879571651 4.7337686608208844e-4
.9999998851026849 4.793689778548592e-4
.9999998822122994 4.8536108961041806e-4
.9999998792860085 4.913532013485497e-4
.9999998763238122 4.973453130690393e-4
.9999998733257104 5.033374247716714e-4
.9999998702917032 5.09329536456231e-4
.9999998672217907 5.153216481225028e-4
.9999998641159727 5.213137597702719e-4
.9999998609742493 5.27305871399323e-4
.9999998577966206 5.332979830094408e-4
.9999998545830864 5.392900946004105e-4
.9999998513336468 5.452822061720168e-4
.9999998480483018 5.512743177240444e-4
.9999998447270514 5.572664292562783e-4
.9999998413698955 5.632585407685033e-4
.9999998379768343 5.692506522605043e-4
.9999998345478677 5.752427637320661e-4
.9999998310829956 5.812348751829735e-4
.9999998275822183 5.872269866130116e-4
.9999998240455354 5.93219098021965e-4
.9999998204729471 5.992112094096185e-4
.9999998168644535 6.052033207757572e-4
.9999998132200545 6.111954321201659e-4
.99999980953975 6.171875434426292e-4
.9999998058235401 6.231796547429323e-4
.9999998020714248 6.291717660208597e-4
.9999997982834041 6.351638772761965e-4
.9999997944594781 6.411559885087275e-4
.9999997905996466 6.471480997182375e-4
.9999997867039097 6.531402109045114e-4
.9999997827722674 6.591323220673341e-4
.9999997788047197 6.651244332064902e-4
.9999997748012666 6.711165443217649e-4
.9999997707619082 6.771086554129428e-4
.9999997666866443 6.83100766479809e-4
.9999997625754748 6.89092877522148e-4
.9999997584284002 6.950849885397449e-4
.9999997542454201 7.010770995323844e-4
.9999997500265345 7.070692104998515e-4
.9999997457717437 7.130613214419311e-4
.9999997414810473 7.190534323584079e-4
.9999997371544456 7.250455432490666e-4
.9999997327919384 7.310376541136925e-4
.9999997283935259 7.3702976495207e-4
.999999723959208 7.430218757639842e-4
.9999997194889846 7.490139865492199e-4
.9999997149828559 7.55006097307562e-4
.9999997104408218 7.609982080387952e-4
.9999997058628822 7.669903187427045e-4
.9999997012490373 7.729824294190747e-4
.9999996965992869 7.789745400676906e-4
.9999996919136313 7.849666506883372e-4
.99999968719207 7.909587612807992e-4
.9999996824346035 7.969508718448614e-4
.9999996776412315 8.029429823803089e-4
.9999996728119542 8.089350928869263e-4
.9999996679467715 8.149272033644986e-4
.9999996630456833 8.209193138128106e-4
.9999996581086897 8.269114242316472e-4
.9999996531357909 8.329035346207931e-4
.9999996481269865 8.388956449800333e-4
.9999996430822767 8.448877553091527e-4
.9999996380016616 8.508798656079359e-4
.999999632885141 8.56871975876168e-4
.9999996277327151 8.628640861136338e-4
.9999996225443838 8.68856196320118e-4
.9999996173201471 8.748483064954056e-4
.999999612060005 8.808404166392814e-4
.9999996067639574 8.868325267515304e-4
.9999996014320045 8.928246368319371e-4
.9999995960641462 8.988167468802867e-4
.9999995906603825 9.048088568963639e-4
.9999995852207133 9.108009668799535e-4
.9999995797451389 9.167930768308405e-4
.9999995742336589 9.227851867488095e-4
.9999995686862736 9.287772966336457e-4
.9999995631029829 9.347694064851338e-4
.9999995574837868 9.407615163030585e-4
.9999995518286853 9.467536260872047e-4
.9999995461376784 9.527457358373575e-4
.9999995404107661 9.587378455533015e-4
.9999995346479484 9.647299552348216e-4
.9999995288492254 9.707220648817027e-4
.9999995230145969 9.767141744937296e-4
.9999995171440631 9.827062840706872e-4
.9999995112376238 9.886983936123602e-4
.9999995052952791 9.946905031185337e-4
.9999994993170291 .0010006826125889925
.9999994933028736 .0010066747220235214
.9999994872528128 .001012666831421905
.9999994811668466 .0010186589407839286
.999999475044975 .0010246510501093766
.9999994688871979 .0010306431593980344
.9999994626935156 .0010366352686496862
.9999994564639277 .0010426273778641173
.9999994501984345 .0010486194870411127
.999999443897036 .0010546115961804568
.999999437559732 .0010606037052819344
.9999994311865227 .0010665958143453308
.9999994247774079 .0010725879233704307
.9999994183323877 .0010785800323570187
.9999994118514622 .0010845721413048801
.9999994053346313 .0010905642502137994
.9999993987818949 .0010965563590835613
.9999993921932533 .0011025484679139511
.9999993855687062 .0011085405767047535
.9999993789082536 .0011145326854557532
.9999993722118957 .001120524794166735
.9999993654796325 .0011265169028374842
.9999993587114638 .0011325090114677853
.9999993519073898 .001138501120057423
.9999993450674104 .0011444932286061825
.9999993381915255 .0011504853371138485
.9999993312797354 .0011564774455802057
.9999993243320398 .0011624695540050393
.9999993173484387 .001168461662388134
.9999993103289324 .0011744537707292742
.9999993032735206 .0011804458790282454
.9999992961822035 .0011864379872848323
.9999992890549809 .0011924300954988195
.999999281891853 .001198422203669992
.9999992746928197 .0012044143117981348
.999999267457881 .0012104064198830327
.999999260187037 .0012163985279244702
.9999992528802875 .0012223906359222325
.9999992455376326 .0012283827438761045
.9999992381590724 .0012343748517858707
.9999992307446068 .0012403669596513162
.9999992232942359 .001246359067472226
.9999992158079595 .0012523511752483847
.9999992082857777 .001258343282979577
.9999992007276906 .001264335390665588
.999999193133698 .0012703274983062026
.9999991855038001 .0012763196059012057
.9999991778379967 .001282311713450382
.9999991701362881 .0012883038209535163
.999999162398674 .0012942959284103935
.9999991546251547 .0013002880358207985
.9999991468157298 .001306280143184516
.9999991389703996 .001312272250501331
.999999131089164 .0013182643577710285
.999999123172023 .0013242564649933932
.9999991152189767 .0013302485721682098
.9999991072300249 .001336240679295263
.9999990992051678 .0013422327863743383
.9999990911444054 .0013482248934052201
.9999990830477375 .0013542170003876934
.9999990749151643 .001360209107321543
.9999990667466857 .0013662012142065536
.9999990585423016 .0013721933210425101
.9999990503020123 .0013781854278291975
.9999990420258176 .0013841775345664006
.9999990337137175 .0013901696412539043
.999999025365712 .0013961617478914935
.999999016981801 .0014021538544789526
.9999990085619848 .001408145961016067
.9999990001062631 .0014141380675026214
.9999989916146361 .0014201301739384005
.9999989830871038 .0014261222803231893
.9999989745236659 .0014321143866567725
.9999989659243228 .001438106492938935
.9999989572890743 .0014440985991694619
.9999989486179204 .0014500907053481378
.9999989399108612 .0014560828114747475
.9999989311678965 .0014620749175490758
.9999989223890265 .001468067023570908
.9999989135742512 .0014740591295400284
.9999989047235704 .0014800512354562223
.9999988958369843 .0014860433413192743
.9999988869144928 .0014920354471289693
.9999988779560959 .0014980275528850922
.9999988689617937 .0015040196585874275
.9999988599315861 .0015100117642357607
.999998850865473 .0015160038698298762
.9999988417634548 .001521995975369559
.999998832625531 .0015279880808545937
.9999988234517019 .0015339801862847657
.9999988142419675 .0015399722916598592
.9999988049963277 .0015459643969796596
.9999987957147825 .0015519565022439512
.9999987863973319 .0015579486074525195
.9999987770439759 .001563940712605149
.9999987676547146 .0015699328177016243
.999998758229548 .0015759249227417307
.9999987487684759 .0015819170277252528
.9999987392714985 .0015879091326519755
.9999987297386157 .0015939012375216837
.9999987201698276 .0015998933423341623
.9999987105651341 .001605885447089196
.9999987009245352 .0016118775517865696
.999998691248031 .0016178696564260683
.9999986815356214 .0016238617610074765
.9999986717873064 .0016298538655305794
.9999986620030861 .0016358459699951618
.9999986521829605 .0016418380744010084
.9999986423269294 .0016478301787479041
.999998632434993 .0016538222830356339
.9999986225071512 .0016598143872639823
.999998612543404 .0016658064914327345
.9999986025437515 .0016717985955416754
.9999985925081937 .0016777906995905894
.9999985824367305 .0016837828035792617
.9999985723293618 .0016897749075074774
.999998562186088 .0016957670113750207
.9999985520069086 .0017017591151816769
.9999985417918239 .0017077512189272307
.999998531540834 .001713743322611467
.9999985212539385 .0017197354262341706
.9999985109311378 .0017257275297951264
.9999985005724317 .0017317196332941192
.9999984901778203 .0017377117367309341
.9999984797473034 .0017437038401053556
.9999984692808812 .0017496959434171687
.9999984587785538 .0017556880466661582
.9999984482403208 .001761680149852109
.9999984376661826 .0017676722529748061
.999998427056139 .0017736643560340342
.99999841641019 .001779656459029578
.9999984057283358 .0017856485619612225
.9999983950105761 .0017916406648287528
.999998384256911 .0017976327676319532
.9999983734673407 .001803624870370609
.9999983626418649 .0018096169730445048
.9999983517804839 .0018156090756534257
.9999983408831975 .0018216011781971562
.9999983299500057 .0018275932806754815
.9999983189809085 .0018335853830881864
.999998307975906 .0018395774854350557
.9999982969349982 .001845569587715874
.9999982858581851 .0018515616899304264
.9999982747454665 .001857553792078498
.9999982635968426 .001863545894159873
.9999982524123134 .0018695379961743367
.9999982411918789 .001875530098121674
.9999982299355389 .0018815222000016696
.9999982186432936 .0018875143018141083
.999998207315143 .0018935064035587748
.999998195951087 .0018994985052354545
.9999981845511257 .0019054906068439318
.9999981731152591 .0019114827083839918
.999998161643487 .001917474809855419
.9999981501358096 .0019234669112579987
.999998138592227 .0019294590125915154
.9999981270127389 .0019354511138557542
.9999981153973455 .0019414432150504997
.9999981037460468 .0019474353161755369
.9999980920588427 .001953427417230651
.9999980803357332 .001959419518215626
.9999980685767185 .0019654116191302473
.9999980567817984 .0019714037199743
.9999980449509729 .0019773958207475683
.9999980330842422 .0019833879214498375
.999998021181606 .001989380022080892
.9999980092430646 .0019953721226405176
.9999979972686177 .002001364223128498
.9999979852582656 .002007356323544619
.9999979732120081 .002013348423888665
.9999979611298453 .002019340524160421
.9999979490117771 .0020253326243596715
.9999979368578036 .0020313247244862017
.9999979246679247 .002037316824539796
.9999979124421405 .00204330892452024
.999997900180451 .002049301024427318
.9999978878828562 .0020552931242608153
.9999978755493559 .002061285224020516
.9999978631799504 .0020672773237062057
.9999978507746395 .002073269423317669
.9999978383334234 .0020792615228546903
.9999978258563018 .002085253622317055
.999997813343275 .0020912457217045484
.9999978007943428 .002097237821016954
.9999977882095052 .0021032299202540577
.9999977755887623 .0021092220194156444
.9999977629321142 .0021152141185014984
.9999977502395607 .0021212062175114043
.9999977375111019 .002127198316445148
.9999977247467376 .0021331904153025134
.9999977119464681 .002139182514083286
.9999976991102932 .0021451746127872503
.9999976862382131 .002151166711414191
.9999976733302276 .0021571588099638934
.9999976603863368 .0021631509084361423
.9999976474065406 .002169143006830722
.9999976343908391 .002175135105147418
.9999976213392323 .0021811272033860148
.9999976082517201 .002187119301546297
.9999975951283027 .00219311139962805
.9999975819689799 .0021991034976310588
.9999975687737518 .0022050955955551076
.9999975555426184 .0022110876933999816
.9999975422755796 .0022170797911654654
.9999975289726355 .002223071888851344
.9999975156337861 .0022290639864574026
.9999975022590314 .0022350560839834253
.9999974888483714 .002241048181429198
.999997475401806 .0022470402787945045
.9999974619193353 .00225303237607913
.9999974484009593 .0022590244732828596
.9999974348466779 .0022650165704054784
.9999974212564913 .0022710086674467703
.9999974076303992 .002277000764406521
.9999973939684019 .002282992861284515
.9999973802704993 .0022889849580805368
.9999973665366915 .0022949770547943723
.9999973527669782 .0023009691514258054
.9999973389613596 .002306961247974621
.9999973251198357 .0023129533444406045
.9999973112424065 .0023189454408235406
.999997297329072 .0023249375371232135
.9999972833798322 .002330929633339409
.999997269394687 .0023369217294719113
.9999972553736366 .0023429138255205055
.9999972413166809 .0023489059214849765
.9999972272238198 .002354898017365109
.9999972130950534 .0023608901131606883
.9999971989303816 .0023668822088714985
.9999971847298047 .0023728743044973246
.9999971704933224 .0023788664000379523
.9999971562209347 .0023848584954931653
.9999971419126418 .0023908505908627493
.9999971275684435 .0023968426861464883
.99999711318834 .002402834781344168
.9999970987723311 .0024088268764555732
.9999970843204169 .002414818971480488
.9999970698325974 .002420811066418698
.9999970553088726 .0024268031612699878
.9999970407492426 .002432795256034142
.9999970261537071 .002438787350710946
.9999970115222664 .002444779445300184
.9999969968549204 .0024507715398016418
.9999969821516691 .002456763634215103
.9999969674125124 .002462755728540353
.9999969526374506 .0024687478227771774
.9999969378264834 .00247473991692536
.9999969229796108 .002480732010984686
.999996908096833 .0024867241049549406
.9999968931781499 .002492716198835908
.9999968782235614 .0024987082926273734
.9999968632330677 .002504700386329122
.9999968482066687 .002510692479940938
.9999968331443644 .0025166845734626068
.9999968180461547 .0025226766668939127
.9999968029120399 .002528668760234641
.9999967877420196 .002534660853484576
.9999967725360941 .0025406529466435036
.9999967572942633 .002546645039711208
.9999967420165272 .002552637132687474
.9999967267028858 .002558629225572086
.9999967113533391 .0025646213183648297
.9999966959678871 .0025706134110654896
.9999966805465298 .002576605503673851
.9999966650892672 .0025825975961896977
.9999966495960994 .0025885896886128153
.9999966340670262 .0025945817809429885
.9999966185020478 .0026005738731800024
.9999966029011641 .0026065659653236417
.999996587264375 .002612558057373691
.9999965715916808 .002618550149329935
.9999965558830811 .0026245422411921592
.9999965401385762 .002630534332960148
.9999965243581661 .002636526424633687
.9999965085418506 .0026425185162125596
.9999964926896299 .0026485106076965517
.9999964768015038 .0026545026990854484
.9999964608774725 .0026604947903790337
.9999964449175359 .0026664868815770926
.999996428921694 .0026724789726794104
.9999964128899468 .002678471063685772
.9999963968222944 .0026844631545959617
.9999963807187366 .002690455245409765
.9999963645792737 .002696447336126966
.9999963484039053 .00270243942674735
.9999963321926317 .002708431517270702
.9999963159454529 .0027144236076968066
.9999962996623687 .0027204156980254485
.9999962833433793 .002726407788256413
.9999962669884847 .002732399878389485
.9999962505976846 .0027383919684244484
.9999962341709794 .002744384058361089
.9999962177083689 .0027503761481991913
.999996201209853 .0027563682379385403
.9999961846754319 .0027623603275789207
.9999961681051056 .0027683524171201175
.999996151498874 .002774344506561915
.9999961348567371 .002780336595904099
.9999961181786949 .0027863286851464537
.9999961014647475 .0027923207742887642
.9999960847148948 .0027983128633308155
.9999960679291368 .002804304952272392
.9999960511074735 .002810297041113279
.9999960342499049 .0028162891298532606
.9999960173564312 .0028222812184921227
.9999960004270521 .002828273307029649
.9999959834617678 .002834265395465626
.9999959664605781 .0028402574837998367
.9999959494234832 .002846249572032067
.9999959323504831 .0028522416601621014
.9999959152415777 .002858233748189725
.999995898096767 .002864225836114723
.9999958809160512 .0028702179239368793
.9999958636994299 .0028762100116559793
.9999958464469034 .0028822020992718077
.9999958291584717 .0028881941867841495
.9999958118341348 .0028941862741927895
.9999957944738925 .0029001783614975127
.999995777077745 .002906170448698104
.9999957596456922 .0029121625357943475
.9999957421777342 .002918154622786029
.999995724673871 .0029241467096729327
.9999957071341024 .002930138796454844
.9999956895584287 .0029361308831315474
.9999956719468496 .0029421229697028273
.9999956542993652 .0029481150561684695
.9999956366159757 .0029541071425282584
.9999956188966809 .002960099228781979
.9999956011414808 .002966091314929416
.9999955833503754 .002972083400970354
.9999955655233649 .0029780754869045785
.9999955476604491 .0029840675727318736
.999995529761628 .002990059658452025
.9999955118269016 .0029960517440648163
.99999549385627 .0030020438295700336
.9999954758497331 .0030080359149674612
.999995457807291 .003014028000256884
.9999954397289438 .003020020085438087
.9999954216146911 .0030260121705108552
.9999954034645333 .003032004255474973
.9999953852784702 .003037996340330225
.9999953670565019 .003043988425076397
.9999953487986284 .003049980509713273
.9999953305048496 .0030559725942406386
.9999953121751655 .003061964678658278
))
(define high-lut
(FLOATvector-const
1. 0.
.9999999999999999 1.1703344634137277e-8
.9999999999999998 2.3406689268274554e-8
.9999999999999993 3.5110033902411824e-8
.9999999999999989 4.6813378536549095e-8
.9999999999999983 5.851672317068635e-8
.9999999999999976 7.022006780482361e-8
.9999999999999967 8.192341243896085e-8
.9999999999999957 9.362675707309808e-8
.9999999999999944 1.0533010170723531e-7
.9999999999999931 1.170334463413725e-7
.9999999999999917 1.287367909755097e-7
.9999999999999901 1.4044013560964687e-7
.9999999999999885 1.5214348024378403e-7
.9999999999999866 1.6384682487792116e-7
.9999999999999846 1.7555016951205827e-7
.9999999999999825 1.8725351414619535e-7
.9999999999999802 1.989568587803324e-7
.9999999999999778 2.1066020341446942e-7
.9999999999999752 2.2236354804860645e-7
.9999999999999726 2.3406689268274342e-7
.9999999999999698 2.4577023731688034e-7
.9999999999999668 2.5747358195101726e-7
.9999999999999638 2.6917692658515413e-7
.9999999999999606 2.8088027121929094e-7
.9999999999999571 2.9258361585342776e-7
.9999999999999537 3.042869604875645e-7
.99999999999995 3.159903051217012e-7
.9999999999999463 3.276936497558379e-7
.9999999999999424 3.3939699438997453e-7
.9999999999999384 3.5110033902411114e-7
.9999999999999342 3.6280368365824763e-7
.9999999999999298 3.7450702829238413e-7
.9999999999999254 3.8621037292652057e-7
.9999999999999208 3.979137175606569e-7
.9999999999999161 4.0961706219479325e-7
.9999999999999113 4.2132040682892953e-7
.9999999999999063 4.330237514630657e-7
.9999999999999011 4.447270960972019e-7
.9999999999998959 4.5643044073133796e-7
.9999999999998904 4.68133785365474e-7
.9999999999998849 4.7983712999961e-7
.9999999999998792 4.915404746337459e-7
.9999999999998733 5.032438192678817e-7
.9999999999998674 5.149471639020175e-7
.9999999999998613 5.266505085361531e-7
.9999999999998551 5.383538531702888e-7
.9999999999998487 5.500571978044243e-7
.9999999999998422 5.617605424385598e-7
.9999999999998356 5.734638870726952e-7
.9999999999998288 5.851672317068305e-7
.9999999999998219 5.968705763409657e-7
.9999999999998148 6.085739209751009e-7
.9999999999998076 6.202772656092359e-7
.9999999999998003 6.319806102433709e-7
.9999999999997928 6.436839548775058e-7
.9999999999997853 6.553872995116406e-7
.9999999999997775 6.670906441457753e-7
.9999999999997696 6.7879398877991e-7
.9999999999997616 6.904973334140445e-7
.9999999999997534 7.02200678048179e-7
.9999999999997452 7.139040226823132e-7
.9999999999997368 7.256073673164475e-7
.9999999999997282 7.373107119505817e-7
.9999999999997194 7.490140565847157e-7
.9999999999997107 7.607174012188497e-7
.9999999999997017 7.724207458529835e-7
.9999999999996926 7.841240904871172e-7
.9999999999996834 7.958274351212508e-7
.9999999999996739 8.075307797553844e-7
.9999999999996644 8.192341243895178e-7
.9999999999996547 8.309374690236511e-7
.999999999999645 8.426408136577842e-7
.9999999999996351 8.543441582919173e-7
.999999999999625 8.660475029260503e-7
.9999999999996148 8.777508475601831e-7
.9999999999996044 8.894541921943158e-7
.999999999999594 9.011575368284484e-7
.9999999999995833 9.128608814625808e-7
.9999999999995726 9.245642260967132e-7
.9999999999995617 9.362675707308454e-7
.9999999999995507 9.479709153649775e-7
.9999999999995395 9.596742599991095e-7
.9999999999995283 9.713776046332412e-7
.9999999999995168 9.83080949267373e-7
.9999999999995052 9.947842939015044e-7
.9999999999994935 1.006487638535636e-6
.9999999999994816 1.0181909831697673e-6
.9999999999994696 1.0298943278038984e-6
.9999999999994575 1.0415976724380293e-6
.9999999999994453 1.0533010170721601e-6
.9999999999994329 1.065004361706291e-6
.9999999999994204 1.0767077063404215e-6
.9999999999994077 1.088411050974552e-6
.9999999999993949 1.1001143956086822e-6
.9999999999993819 1.1118177402428122e-6
.9999999999993688 1.1235210848769423e-6
.9999999999993556 1.135224429511072e-6
.9999999999993423 1.1469277741452017e-6
.9999999999993288 1.1586311187793313e-6
.9999999999993151 1.1703344634134605e-6
.9999999999993014 1.1820378080475897e-6
.9999999999992875 1.1937411526817187e-6
.9999999999992735 1.2054444973158477e-6
.9999999999992593 1.2171478419499764e-6
.9999999999992449 1.2288511865841048e-6
.9999999999992305 1.2405545312182331e-6
.999999999999216 1.2522578758523615e-6
.9999999999992012 1.2639612204864894e-6
.9999999999991863 1.2756645651206173e-6
.9999999999991713 1.287367909754745e-6
.9999999999991562 1.2990712543888725e-6
.9999999999991409 1.3107745990229998e-6
.9999999999991255 1.3224779436571269e-6
.9999999999991099 1.3341812882912537e-6
.9999999999990943 1.3458846329253806e-6
.9999999999990785 1.3575879775595072e-6
.9999999999990625 1.3692913221936337e-6
.9999999999990464 1.3809946668277597e-6
.9999999999990302 1.3926980114618857e-6
.9999999999990138 1.4044013560960117e-6
.9999999999989974 1.4161047007301373e-6
.9999999999989807 1.4278080453642627e-6
.9999999999989639 1.439511389998388e-6
.999999999998947 1.451214734632513e-6
.99999999999893 1.462918079266638e-6
.9999999999989128 1.4746214239007625e-6
.9999999999988954 1.486324768534887e-6
.999999999998878 1.4980281131690111e-6
.9999999999988604 1.5097314578031353e-6
.9999999999988426 1.5214348024372591e-6
.9999999999988247 1.5331381470713828e-6
.9999999999988067 1.544841491705506e-6
.9999999999987886 1.5565448363396294e-6
.9999999999987703 1.5682481809737524e-6
.9999999999987519 1.579951525607875e-6
.9999999999987333 1.5916548702419977e-6
.9999999999987146 1.60335821487612e-6
.9999999999986958 1.615061559510242e-6
.9999999999986768 1.626764904144364e-6
.9999999999986577 1.6384682487784858e-6
.9999999999986384 1.6501715934126072e-6
.9999999999986191 1.6618749380467283e-6
.9999999999985996 1.6735782826808495e-6
.9999999999985799 1.6852816273149702e-6
.9999999999985602 1.6969849719490907e-6
.9999999999985402 1.708688316583211e-6
.9999999999985201 1.720391661217331e-6
.9999999999985 1.732095005851451e-6
.9999999999984795 1.7437983504855706e-6
.9999999999984591 1.7555016951196899e-6
.9999999999984385 1.767205039753809e-6
.9999999999984177 1.778908384387928e-6
.9999999999983968 1.7906117290220465e-6
.9999999999983759 1.802315073656165e-6
.9999999999983546 1.814018418290283e-6
.9999999999983333 1.825721762924401e-6
.9999999999983119 1.8374251075585186e-6
.9999999999982904 1.8491284521926361e-6
.9999999999982686 1.8608317968267533e-6
.9999999999982468 1.8725351414608702e-6
.9999999999982249 1.8842384860949866e-6
.9999999999982027 1.8959418307291031e-6
.9999999999981805 1.9076451753632194e-6
.999999999998158 1.919348519997335e-6
.9999999999981355 1.9310518646314507e-6
.9999999999981128 1.942755209265566e-6
.9999999999980901 1.954458553899681e-6
.9999999999980671 1.966161898533796e-6
.999999999998044 1.9778652431679103e-6
.9999999999980208 1.9895685878020246e-6
.9999999999979975 2.0012719324361386e-6
.999999999997974 2.012975277070252e-6
.9999999999979503 2.0246786217043656e-6
.9999999999979265 2.0363819663384787e-6
.9999999999979027 2.048085310972592e-6
.9999999999978786 2.0597886556067045e-6
.9999999999978545 2.0714920002408167e-6
.9999999999978302 2.0831953448749286e-6
.9999999999978058 2.0948986895090404e-6
.9999999999977811 2.106602034143152e-6
.9999999999977564 2.118305378777263e-6
.9999999999977315 2.1300087234113738e-6
.9999999999977065 2.1417120680454843e-6
.9999999999976814 2.153415412679595e-6
.9999999999976561 2.1651187573137046e-6
.9999999999976307 2.1768221019478143e-6
.9999999999976051 2.188525446581924e-6
.9999999999975795 2.200228791216033e-6
.9999999999975536 2.2119321358501417e-6
.9999999999975278 2.22363548048425e-6
.9999999999975017 2.2353388251183586e-6
.9999999999974754 2.247042169752466e-6
.999999999997449 2.2587455143865738e-6
.9999999999974225 2.2704488590206814e-6
.9999999999973959 2.282152203654788e-6
.9999999999973691 2.293855548288895e-6
.9999999999973422 2.305558892923001e-6
.9999999999973151 2.317262237557107e-6
.999999999997288 2.328965582191213e-6
.9999999999972606 2.340668926825318e-6
.9999999999972332 2.352372271459423e-6
.9999999999972056 2.364075616093528e-6
.9999999999971778 2.3757789607276323e-6
.99999999999715 2.3874823053617365e-6
.999999999997122 2.3991856499958403e-6
.9999999999970938 2.4108889946299437e-6
.9999999999970656 2.4225923392640466e-6
.9999999999970371 2.4342956838981495e-6
.9999999999970085 2.445999028532252e-6
.9999999999969799 2.457702373166354e-6
.999999999996951 2.4694057178004558e-6
.999999999996922 2.4811090624345574e-6
.9999999999968929 2.4928124070686583e-6
.9999999999968637 2.504515751702759e-6
.9999999999968343 2.5162190963368595e-6
.9999999999968048 2.5279224409709594e-6
.9999999999967751 2.5396257856050594e-6
.9999999999967454 2.5513291302391585e-6
.9999999999967154 2.5630324748732576e-6
.9999999999966853 2.5747358195073563e-6
.9999999999966551 2.5864391641414546e-6
.9999999999966248 2.5981425087755525e-6
.9999999999965944 2.6098458534096503e-6
.9999999999965637 2.6215491980437473e-6
.999999999996533 2.6332525426778443e-6
.9999999999965021 2.644955887311941e-6
.999999999996471 2.656659231946037e-6
.99999999999644 2.6683625765801328e-6
.9999999999964087 2.680065921214228e-6
.9999999999963772 2.6917692658483234e-6
.9999999999963456 2.703472610482418e-6
.999999999996314 2.7151759551165123e-6
.9999999999962821 2.7268792997506064e-6
.9999999999962501 2.7385826443846996e-6
.9999999999962179 2.750285989018793e-6
.9999999999961857 2.761989333652886e-6
.9999999999961533 2.7736926782869783e-6
.9999999999961208 2.78539602292107e-6
.9999999999960881 2.797099367555162e-6
.9999999999960553 2.808802712189253e-6
.9999999999960224 2.8205060568233443e-6
.9999999999959893 2.832209401457435e-6
.9999999999959561 2.8439127460915247e-6
.9999999999959227 2.8556160907256145e-6
.9999999999958893 2.867319435359704e-6
.9999999999958556 2.879022779993793e-6
.9999999999958219 2.8907261246278814e-6
.9999999999957879 2.90242946926197e-6
.999999999995754 2.9141328138960576e-6
.9999999999957198 2.925836158530145e-6
.9999999999956855 2.9375395031642317e-6
.999999999995651 2.9492428477983186e-6
.9999999999956164 2.9609461924324046e-6
.9999999999955816 2.9726495370664905e-6
.9999999999955468 2.9843528817005757e-6
.9999999999955118 2.996056226334661e-6
.9999999999954767 3.007759570968745e-6
.9999999999954414 3.0194629156028294e-6
.999999999995406 3.0311662602369133e-6
.9999999999953705 3.0428696048709963e-6
.9999999999953348 3.0545729495050794e-6
.999999999995299 3.066276294139162e-6
.999999999995263 3.0779796387732437e-6
.9999999999952269 3.0896829834073255e-6
.9999999999951907 3.101386328041407e-6
.9999999999951543 3.1130896726754873e-6
.9999999999951178 3.1247930173095678e-6
.9999999999950812 3.136496361943648e-6
.9999999999950444 3.148199706577727e-6
.9999999999950075 3.1599030512118063e-6
.9999999999949705 3.171606395845885e-6
.9999999999949333 3.183309740479963e-6
.999999999994896 3.195013085114041e-6
.9999999999948584 3.206716429748118e-6
.9999999999948209 3.218419774382195e-6
.9999999999947832 3.2301231190162714e-6
.9999999999947453 3.2418264636503477e-6
.9999999999947072 3.253529808284423e-6
.9999999999946692 3.265233152918498e-6
.9999999999946309 3.276936497552573e-6
.9999999999945924 3.288639842186647e-6
.9999999999945539 3.300343186820721e-6
.9999999999945152 3.312046531454794e-6
.9999999999944763 3.323749876088867e-6
.9999999999944373 3.3354532207229395e-6
.9999999999943983 3.3471565653570115e-6
.9999999999943591 3.358859909991083e-6
.9999999999943197 3.370563254625154e-6
.9999999999942801 3.3822665992592245e-6
.9999999999942405 3.3939699438932944e-6
.9999999999942008 3.4056732885273643e-6
.9999999999941608 3.4173766331614334e-6
.9999999999941207 3.429079977795502e-6
.9999999999940805 3.4407833224295702e-6
.9999999999940402 3.452486667063638e-6
.9999999999939997 3.4641900116977054e-6
.999999999993959 3.4758933563317723e-6
.9999999999939183 3.4875967009658384e-6
.9999999999938775 3.4993000455999045e-6
.9999999999938364 3.5110033902339697e-6
.9999999999937953 3.5227067348680345e-6
.999999999993754 3.534410079502099e-6
.9999999999937126 3.546113424136163e-6
.999999999993671 3.5578167687702264e-6
.9999999999936293 3.5695201134042896e-6
.9999999999935875 3.581223458038352e-6
.9999999999935454 3.592926802672414e-6
.9999999999935033 3.6046301473064755e-6
.9999999999934611 3.6163334919405365e-6
.9999999999934187 3.628036836574597e-6
.9999999999933762 3.639740181208657e-6
.9999999999933334 3.6514435258427166e-6
.9999999999932907 3.6631468704767755e-6
.9999999999932477 3.674850215110834e-6
.9999999999932047 3.686553559744892e-6
.9999999999931615 3.6982569043789496e-6
.9999999999931181 3.7099602490130064e-6
.9999999999930747 3.7216635936470627e-6
.999999999993031 3.733366938281119e-6
.9999999999929873 3.745070282915174e-6
.9999999999929433 3.756773627549229e-6
.9999999999928992 3.768476972183284e-6
.9999999999928552 3.7801803168173377e-6
.9999999999928109 3.791883661451391e-6
.9999999999927663 3.803587006085444e-6
.9999999999927218 3.8152903507194965e-6
.9999999999926771 3.826993695353548e-6
.9999999999926322 3.838697039987599e-6
.9999999999925873 3.85040038462165e-6
.9999999999925421 3.862103729255701e-6
.9999999999924968 3.87380707388975e-6
.9999999999924514 3.885510418523799e-6
.9999999999924059 3.897213763157848e-6
.9999999999923602 3.9089171077918965e-6
.9999999999923144 3.9206204524259435e-6
.9999999999922684 3.9323237970599905e-6
.9999999999922223 3.9440271416940376e-6
.9999999999921761 3.955730486328084e-6
.9999999999921297 3.967433830962129e-6
.9999999999920832 3.9791371755961736e-6
.9999999999920366 3.990840520230218e-6
.9999999999919899 4.002543864864262e-6
.9999999999919429 4.014247209498305e-6
.9999999999918958 4.025950554132348e-6
.9999999999918486 4.03765389876639e-6
.9999999999918013 4.049357243400431e-6
.9999999999917539 4.061060588034472e-6
.9999999999917063 4.072763932668513e-6
.9999999999916586 4.084467277302553e-6
.9999999999916107 4.096170621936592e-6
.9999999999915626 4.107873966570632e-6
.9999999999915146 4.119577311204669e-6
.9999999999914663 4.131280655838707e-6
.9999999999914179 4.142984000472745e-6
.9999999999913692 4.154687345106781e-6
.9999999999913206 4.166390689740817e-6
.9999999999912718 4.178094034374852e-6
.9999999999912228 4.189797379008887e-6
.9999999999911737 4.201500723642921e-6
.9999999999911244 4.213204068276955e-6
.999999999991075 4.224907412910988e-6
.9999999999910255 4.236610757545021e-6
.9999999999909759 4.248314102179053e-6
.9999999999909261 4.260017446813084e-6
.9999999999908762 4.271720791447115e-6
.9999999999908261 4.283424136081145e-6
.9999999999907759 4.295127480715175e-6
.9999999999907256 4.306830825349204e-6
.9999999999906751 4.3185341699832325e-6
.9999999999906245 4.33023751461726e-6
.9999999999905738 4.3419408592512875e-6
.9999999999905229 4.353644203885314e-6
.9999999999904718 4.36534754851934e-6
.9999999999904207 4.377050893153365e-6
.9999999999903694 4.38875423778739e-6
.999999999990318 4.400457582421414e-6
.9999999999902665 4.4121609270554384e-6
.9999999999902147 4.423864271689461e-6
.9999999999901629 4.435567616323483e-6
.9999999999901109 4.447270960957506e-6
.9999999999900587 4.458974305591527e-6
.9999999999900065 4.470677650225547e-6
.9999999999899541 4.482380994859567e-6
.9999999999899016 4.494084339493587e-6
.9999999999898489 4.5057876841276054e-6
.9999999999897962 4.517491028761624e-6
.9999999999897432 4.529194373395641e-6
.9999999999896901 4.5408977180296584e-6
.999999999989637 4.552601062663675e-6
.9999999999895836 4.564304407297691e-6
.99999999998953 4.5760077519317055e-6
.9999999999894764 4.5877110965657195e-6
.9999999999894227 4.5994144411997335e-6
.9999999999893688 4.611117785833747e-6
.9999999999893148 4.622821130467759e-6
.9999999999892606 4.634524475101771e-6
.9999999999892063 4.646227819735783e-6
.9999999999891518 4.657931164369793e-6
.9999999999890973 4.669634509003803e-6
.9999999999890425 4.681337853637813e-6
.9999999999889877 4.693041198271821e-6
.9999999999889327 4.704744542905829e-6
.9999999999888776 4.716447887539837e-6
.9999999999888223 4.728151232173843e-6
.9999999999887669 4.73985457680785e-6
.9999999999887114 4.751557921441855e-6
.9999999999886556 4.76326126607586e-6
.9999999999885999 4.774964610709864e-6
.9999999999885439 4.786667955343868e-6
.9999999999884878 4.798371299977871e-6
.9999999999884316 4.810074644611873e-6
.9999999999883752 4.821777989245874e-6
.9999999999883187 4.833481333879875e-6
.9999999999882621 4.845184678513876e-6
.9999999999882053 4.856888023147875e-6
.9999999999881484 4.868591367781874e-6
.9999999999880914 4.880294712415872e-6
.9999999999880341 4.89199805704987e-6
.9999999999879768 4.903701401683867e-6
.9999999999879194 4.915404746317863e-6
.9999999999878618 4.9271080909518585e-6
.9999999999878041 4.938811435585853e-6
.9999999999877462 4.9505147802198475e-6
.9999999999876882 4.962218124853841e-6
.99999999998763 4.973921469487834e-6
.9999999999875717 4.985624814121826e-6
.9999999999875133 4.997328158755817e-6
.9999999999874548 5.009031503389808e-6
.9999999999873961 5.0207348480237985e-6
.9999999999873372 5.032438192657788e-6
.9999999999872783 5.0441415372917765e-6
.9999999999872192 5.055844881925764e-6
.9999999999871599 5.067548226559752e-6
.9999999999871007 5.079251571193739e-6
.9999999999870411 5.090954915827725e-6
.9999999999869814 5.10265826046171e-6
.9999999999869217 5.1143616050956945e-6
.9999999999868617 5.126064949729678e-6
.9999999999868017 5.1377682943636615e-6
.9999999999867415 5.149471638997644e-6
.9999999999866811 5.161174983631626e-6
.9999999999866207 5.172878328265607e-6
.9999999999865601 5.184581672899587e-6
.9999999999864994 5.196285017533567e-6
.9999999999864384 5.2079883621675455e-6
.9999999999863775 5.219691706801524e-6
.9999999999863163 5.2313950514355015e-6
.999999999986255 5.243098396069478e-6
.9999999999861935 5.254801740703454e-6
.999999999986132 5.266505085337429e-6
.9999999999860703 5.278208429971404e-6
.9999999999860084 5.289911774605378e-6
.9999999999859465 5.301615119239351e-6
.9999999999858843 5.313318463873323e-6
.9999999999858221 5.325021808507295e-6
.9999999999857597 5.336725153141267e-6
.9999999999856971 5.3484284977752366e-6
.9999999999856345 5.360131842409206e-6
.9999999999855717 5.371835187043175e-6
.9999999999855087 5.383538531677143e-6
.9999999999854456 5.3952418763111104e-6
.9999999999853825 5.406945220945077e-6
.9999999999853191 5.418648565579043e-6
.9999999999852557 5.4303519102130076e-6
.9999999999851921 5.4420552548469724e-6
.9999999999851282 5.453758599480936e-6
.9999999999850644 5.465461944114899e-6
.9999999999850003 5.47716528874886e-6
.9999999999849362 5.488868633382822e-6
.9999999999848719 5.500571978016782e-6
.9999999999848074 5.512275322650742e-6
.9999999999847429 5.523978667284702e-6
.9999999999846781 5.53568201191866e-6
.9999999999846133 5.547385356552617e-6
.9999999999845482 5.5590887011865745e-6
.9999999999844832 5.57079204582053e-6
.9999999999844179 5.582495390454486e-6
.9999999999843525 5.59419873508844e-6
.9999999999842869 5.605902079722394e-6
.9999999999842213 5.617605424356347e-6
.9999999999841555 5.629308768990299e-6
.9999999999840895 5.641012113624251e-6
.9999999999840234 5.652715458258201e-6
.9999999999839572 5.664418802892152e-6
.9999999999838908 5.6761221475261e-6
.9999999999838243 5.687825492160048e-6
.9999999999837577 5.699528836793996e-6
.9999999999836909 5.711232181427943e-6
.999999999983624 5.722935526061889e-6
.9999999999835569 5.734638870695834e-6
.9999999999834898 5.746342215329779e-6
.9999999999834225 5.758045559963722e-6
.999999999983355 5.769748904597665e-6
.9999999999832874 5.781452249231607e-6
.9999999999832196 5.793155593865548e-6
.9999999999831518 5.804858938499489e-6
.9999999999830838 5.816562283133429e-6
.9999999999830157 5.8282656277673675e-6
.9999999999829474 5.839968972401306e-6
.9999999999828789 5.851672317035243e-6
.9999999999828104 5.86337566166918e-6
.9999999999827417 5.875079006303115e-6
.9999999999826729 5.88678235093705e-6
.9999999999826039 5.898485695570985e-6
.9999999999825349 5.910189040204917e-6
.9999999999824656 5.92189238483885e-6
.9999999999823962 5.933595729472782e-6
.9999999999823267 5.945299074106713e-6
.9999999999822571 5.957002418740643e-6
.9999999999821872 5.9687057633745715e-6
.9999999999821173 5.9804091080085e-6
))
(define (make-w log-n)
(result (FLOATmake-vector (* 2 n))))
(define (copy-low-lut)
(do ((i 0 (+ i 1)))
((= i lut-table-size))
(let ((index (* i 2)))
(FLOATvector-set!
result
index
(FLOATvector-ref low-lut index))
(FLOATvector-set!
result
(+ index 1)
(FLOATvector-ref low-lut (+ index 1))))))
(define (extend-lut multiplier-lut
bit-reverse-size
bit-reverse-multiplier
start
end)
(define (bit-reverse x n)
(do ((i 0 (+ i 1))
(x x (arithmetic-shift x -1))
(result 0 (+ (* result 2)
(bitwise-and x 1))))
((= i n) result)))
(let loop ((i start)
(j 1))
(if (< i end)
(let* ((multiplier-index
(* 2
(* (bit-reverse j bit-reverse-size)
bit-reverse-multiplier)))
(multiplier-real
(FLOATvector-ref multiplier-lut multiplier-index))
(multiplier-imag
(FLOATvector-ref multiplier-lut (+ multiplier-index 1))))
(let inner ((i i)
(k 0))
(if (< k start)
(let* ((index
(* k 2))
(real
(FLOATvector-ref result index))
(imag
(FLOATvector-ref result (+ index 1)))
(result-real
(FLOAT- (FLOAT* multiplier-real real)
(FLOAT* multiplier-imag imag)))
(result-imag
(FLOAT+ (FLOAT* multiplier-real imag)
(FLOAT* multiplier-imag real)))
(result-index (* i 2)))
(FLOATvector-set! result result-index result-real)
(FLOATvector-set! result (+ result-index 1) result-imag)
(inner (+ i 1)
(+ k 1)))
(loop i
(+ j 1)))))
result)))
(cond ((<= n lut-table-size)
low-lut)
((<= n lut-table-size^2)
(copy-low-lut)
(extend-lut med-lut
(- log-n log-lut-table-size)
(arithmetic-shift 1 (- (* 2 log-lut-table-size) log-n))
lut-table-size
n))
((<= n lut-table-size^3)
(copy-low-lut)
(extend-lut med-lut
log-lut-table-size
1
lut-table-size
lut-table-size^2)
(extend-lut high-lut
(- log-n (* 2 log-lut-table-size))
(arithmetic-shift 1 (- (* 3 log-lut-table-size) log-n))
lut-table-size^2
n))
(else
(error "asking for too large a table")))))
(define (direct-fft-recursive-4 a W-table)
this is from page 66 of and , except that we have
(let ((W (FLOATvector 0. 0. 0. 0.)))
(define (main-loop M N K SizeOfGroup)
(let inner-loop ((K K)
(JFirst M))
(if (< JFirst N)
(let* ((JLast (+ JFirst SizeOfGroup)))
(if (even? K)
(begin
(FLOATvector-set! W 0 (FLOATvector-ref W-table K))
(FLOATvector-set! W 1 (FLOATvector-ref W-table (+ K 1))))
(begin
(FLOATvector-set! W 0 (FLOAT- 0. (FLOATvector-ref W-table K)))
(FLOATvector-set! W 1 (FLOATvector-ref W-table (- K 1)))))
we know the that the next two complex roots of
unity have index 2 K and 2K+1 so that the 2K+1
index root can be gotten from the 2 K index root
in the same way that we get W_0 and W_1 from the
(FLOATvector-set! W 2 (FLOATvector-ref W-table (* K 2)))
(FLOATvector-set! W 3 (FLOATvector-ref W-table (+ (* K 2) 1)))
(let J-loop ((J0 JFirst))
(if (< J0 JLast)
(let* ((J0 J0)
(J1 (+ J0 1))
(J2 (+ J0 SizeOfGroup))
(J3 (+ J2 1))
(J4 (+ J2 SizeOfGroup))
(J5 (+ J4 1))
(J6 (+ J4 SizeOfGroup))
(J7 (+ J6 1)))
(let ((W_0 (FLOATvector-ref W 0))
(W_1 (FLOATvector-ref W 1))
(W_2 (FLOATvector-ref W 2))
(W_3 (FLOATvector-ref W 3))
(a_J0 (FLOATvector-ref a J0))
(a_J1 (FLOATvector-ref a J1))
(a_J2 (FLOATvector-ref a J2))
(a_J3 (FLOATvector-ref a J3))
(a_J4 (FLOATvector-ref a J4))
(a_J5 (FLOATvector-ref a J5))
(a_J6 (FLOATvector-ref a J6))
(a_J7 (FLOATvector-ref a J7)))
butterflies with entries 2*SizeOfGroup
(let ((Temp_0 (FLOAT- (FLOAT* W_0 a_J4)
(FLOAT* W_1 a_J5)))
(Temp_1 (FLOAT+ (FLOAT* W_0 a_J5)
(FLOAT* W_1 a_J4)))
(Temp_2 (FLOAT- (FLOAT* W_0 a_J6)
(FLOAT* W_1 a_J7)))
(Temp_3 (FLOAT+ (FLOAT* W_0 a_J7)
(FLOAT* W_1 a_J6))))
(let ((a_J0 (FLOAT+ a_J0 Temp_0))
(a_J1 (FLOAT+ a_J1 Temp_1))
(a_J2 (FLOAT+ a_J2 Temp_2))
(a_J3 (FLOAT+ a_J3 Temp_3))
(a_J4 (FLOAT- a_J0 Temp_0))
(a_J5 (FLOAT- a_J1 Temp_1))
(a_J6 (FLOAT- a_J2 Temp_2))
(a_J7 (FLOAT- a_J3 Temp_3)))
now we do the two ( disjoint ) pairs
apart , the first pair with ,
the second with -W3+W2i
(let ((W_0 W_2)
(W_1 W_3)
(W_2 (FLOAT- 0. W_3))
(W_3 W_2))
(let ((Temp_0
(FLOAT- (FLOAT* W_0 a_J2)
(FLOAT* W_1 a_J3)))
(Temp_1
(FLOAT+ (FLOAT* W_0 a_J3)
(FLOAT* W_1 a_J2)))
(Temp_2
(FLOAT- (FLOAT* W_2 a_J6)
(FLOAT* W_3 a_J7)))
(Temp_3
(FLOAT+ (FLOAT* W_2 a_J7)
(FLOAT* W_3 a_J6))))
(let ((a_J0 (FLOAT+ a_J0 Temp_0))
(a_J1 (FLOAT+ a_J1 Temp_1))
(a_J2 (FLOAT- a_J0 Temp_0))
(a_J3 (FLOAT- a_J1 Temp_1))
(a_J4 (FLOAT+ a_J4 Temp_2))
(a_J5 (FLOAT+ a_J5 Temp_3))
(a_J6 (FLOAT- a_J4 Temp_2))
(a_J7 (FLOAT- a_J5 Temp_3)))
(FLOATvector-set! a J0 a_J0)
(FLOATvector-set! a J1 a_J1)
(FLOATvector-set! a J2 a_J2)
(FLOATvector-set! a J3 a_J3)
(FLOATvector-set! a J4 a_J4)
(FLOATvector-set! a J5 a_J5)
(FLOATvector-set! a J6 a_J6)
(FLOATvector-set! a J7 a_J7)
(J-loop (+ J0 2)))))))))
(inner-loop (+ K 1)
(+ JFirst (* SizeOfGroup 4)))))))))
(define (recursive-bit M N K SizeOfGroup)
(if (<= 2 SizeOfGroup)
(begin
(main-loop M N K SizeOfGroup)
(if (< 2048 (- N M))
(let ((new-size (arithmetic-shift (- N M) -2)))
(recursive-bit M
(+ M new-size)
(* K 4)
(arithmetic-shift SizeOfGroup -2))
(recursive-bit (+ M new-size)
(+ M (* new-size 2))
(+ (* K 4) 1)
(arithmetic-shift SizeOfGroup -2))
(recursive-bit (+ M (* new-size 2))
(+ M (* new-size 3))
(+ (* K 4) 2)
(arithmetic-shift SizeOfGroup -2))
(recursive-bit (+ M (* new-size 3))
N
(+ (* K 4) 3)
(arithmetic-shift SizeOfGroup -2)))
(recursive-bit M
N
(* K 4)
(arithmetic-shift SizeOfGroup -2))))))
(define (radix-2-pass a)
array is not a power of 4 , so we need to do a basic radix
two pass with w=1 ( so W[0]=1.0 and W[1 ] = 0 . ) and then
call recursive - bit appropriately on the two half arrays .
(let ((SizeOfGroup
(arithmetic-shift (FLOATvector-length a) -1)))
(let loop ((J0 0))
(if (< J0 SizeOfGroup)
(let ((J0 J0)
(J2 (+ J0 SizeOfGroup)))
(let ((J1 (+ J0 1))
(J3 (+ J2 1)))
(let ((a_J0 (FLOATvector-ref a J0))
(a_J1 (FLOATvector-ref a J1))
(a_J2 (FLOATvector-ref a J2))
(a_J3 (FLOATvector-ref a J3)))
(let ((a_J0 (FLOAT+ a_J0 a_J2))
(a_J1 (FLOAT+ a_J1 a_J3))
(a_J2 (FLOAT- a_J0 a_J2))
(a_J3 (FLOAT- a_J1 a_J3)))
(FLOATvector-set! a J0 a_J0)
(FLOATvector-set! a J1 a_J1)
(FLOATvector-set! a J2 a_J2)
(FLOATvector-set! a J3 a_J3)
(loop (+ J0 2))))))))))
(let* ((n (FLOATvector-length a))
(log_n (two^p>=m n)))
of 4 , then do a single radix-2 pass and do the rest of
(if (odd? log_n)
(recursive-bit 0 n 0 (arithmetic-shift n -2))
(let ((n/2 (arithmetic-shift n -1))
(n/8 (arithmetic-shift n -3)))
(radix-2-pass a)
(recursive-bit 0 n/2 0 n/8)
(recursive-bit n/2 n 1 n/8))))))
(define (inverse-fft-recursive-4 a W-table)
associated algorithm on page 41 of and ,
above ( without dividing by 2 each time , so that this has to
be " normalized " by dividing by N/2 at the end .
(let ((W (FLOATvector 0. 0. 0. 0.)))
(define (main-loop M N K SizeOfGroup)
(let inner-loop ((K K)
(JFirst M))
(if (< JFirst N)
(let* ((JLast (+ JFirst SizeOfGroup)))
(if (even? K)
(begin
(FLOATvector-set! W 0 (FLOATvector-ref W-table K))
(FLOATvector-set! W 1 (FLOATvector-ref W-table (+ K 1))))
(begin
(FLOATvector-set! W 0 (FLOAT- 0. (FLOATvector-ref W-table K)))
(FLOATvector-set! W 1 (FLOATvector-ref W-table (- K 1)))))
(FLOATvector-set! W 2 (FLOATvector-ref W-table (* K 2)))
(FLOATvector-set! W 3 (FLOATvector-ref W-table (+ (* K 2) 1)))
(let J-loop ((J0 JFirst))
(if (< J0 JLast)
(let* ((J0 J0)
(J1 (+ J0 1))
(J2 (+ J0 SizeOfGroup))
(J3 (+ J2 1))
(J4 (+ J2 SizeOfGroup))
(J5 (+ J4 1))
(J6 (+ J4 SizeOfGroup))
(J7 (+ J6 1)))
(let ((W_0 (FLOATvector-ref W 0))
(W_1 (FLOATvector-ref W 1))
(W_2 (FLOATvector-ref W 2))
(W_3 (FLOATvector-ref W 3))
(a_J0 (FLOATvector-ref a J0))
(a_J1 (FLOATvector-ref a J1))
(a_J2 (FLOATvector-ref a J2))
(a_J3 (FLOATvector-ref a J3))
(a_J4 (FLOATvector-ref a J4))
(a_J5 (FLOATvector-ref a J5))
(a_J6 (FLOATvector-ref a J6))
(a_J7 (FLOATvector-ref a J7)))
(let ((W_00 W_2)
(W_01 W_3)
(W_02 (FLOAT- 0. W_3))
(W_03 W_2))
(let ((Temp_0 (FLOAT- a_J0 a_J2))
(Temp_1 (FLOAT- a_J1 a_J3))
(Temp_2 (FLOAT- a_J4 a_J6))
(Temp_3 (FLOAT- a_J5 a_J7)))
(let ((a_J0 (FLOAT+ a_J0 a_J2))
(a_J1 (FLOAT+ a_J1 a_J3))
(a_J4 (FLOAT+ a_J4 a_J6))
(a_J5 (FLOAT+ a_J5 a_J7))
(a_J2 (FLOAT+ (FLOAT* W_00 Temp_0)
(FLOAT* W_01 Temp_1)))
(a_J3 (FLOAT- (FLOAT* W_00 Temp_1)
(FLOAT* W_01 Temp_0)))
(a_J6 (FLOAT+ (FLOAT* W_02 Temp_2)
(FLOAT* W_03 Temp_3)))
(a_J7 (FLOAT- (FLOAT* W_02 Temp_3)
(FLOAT* W_03 Temp_2))))
(let ((Temp_0 (FLOAT- a_J0 a_J4))
(Temp_1 (FLOAT- a_J1 a_J5))
(Temp_2 (FLOAT- a_J2 a_J6))
(Temp_3 (FLOAT- a_J3 a_J7)))
(let ((a_J0 (FLOAT+ a_J0 a_J4))
(a_J1 (FLOAT+ a_J1 a_J5))
(a_J2 (FLOAT+ a_J2 a_J6))
(a_J3 (FLOAT+ a_J3 a_J7))
(a_J4 (FLOAT+ (FLOAT* W_0 Temp_0)
(FLOAT* W_1 Temp_1)))
(a_J5 (FLOAT- (FLOAT* W_0 Temp_1)
(FLOAT* W_1 Temp_0)))
(a_J6 (FLOAT+ (FLOAT* W_0 Temp_2)
(FLOAT* W_1 Temp_3)))
(a_J7 (FLOAT- (FLOAT* W_0 Temp_3)
(FLOAT* W_1 Temp_2))))
(FLOATvector-set! a J0 a_J0)
(FLOATvector-set! a J1 a_J1)
(FLOATvector-set! a J2 a_J2)
(FLOATvector-set! a J3 a_J3)
(FLOATvector-set! a J4 a_J4)
(FLOATvector-set! a J5 a_J5)
(FLOATvector-set! a J6 a_J6)
(FLOATvector-set! a J7 a_J7)
(J-loop (+ J0 2)))))))))
(inner-loop (+ K 1)
(+ JFirst (* SizeOfGroup 4)))))))))
(define (recursive-bit M N K SizeOfGroup)
(if (<= 2 SizeOfGroup)
(begin
(if (< 2048 (- N M))
(let ((new-size (arithmetic-shift (- N M) -2)))
(recursive-bit M
(+ M new-size)
(* K 4)
(arithmetic-shift SizeOfGroup -2))
(recursive-bit (+ M new-size)
(+ M (* new-size 2))
(+ (* K 4) 1)
(arithmetic-shift SizeOfGroup -2))
(recursive-bit (+ M (* new-size 2))
(+ M (* new-size 3))
(+ (* K 4) 2)
(arithmetic-shift SizeOfGroup -2))
(recursive-bit (+ M (* new-size 3))
N
(+ (* K 4) 3)
(arithmetic-shift SizeOfGroup -2)))
(recursive-bit M
N
(* K 4)
(arithmetic-shift SizeOfGroup -2)))
(main-loop M N K SizeOfGroup))))
(define (radix-2-pass a)
(let ((SizeOfGroup
(arithmetic-shift (FLOATvector-length a) -1)))
(let loop ((J0 0))
(if (< J0 SizeOfGroup)
(let ((J0 J0)
(J2 (+ J0 SizeOfGroup)))
(let ((J1 (+ J0 1))
(J3 (+ J2 1)))
(let ((a_J0 (FLOATvector-ref a J0))
(a_J1 (FLOATvector-ref a J1))
(a_J2 (FLOATvector-ref a J2))
(a_J3 (FLOATvector-ref a J3)))
(let ((a_J0 (FLOAT+ a_J0 a_J2))
(a_J1 (FLOAT+ a_J1 a_J3))
(a_J2 (FLOAT- a_J0 a_J2))
(a_J3 (FLOAT- a_J1 a_J3)))
(FLOATvector-set! a J0 a_J0)
(FLOATvector-set! a J1 a_J1)
(FLOATvector-set! a J2 a_J2)
(FLOATvector-set! a J3 a_J3)
(loop (+ J0 2))))))))))
(let* ((n (FLOATvector-length a))
(log_n (two^p>=m n)))
(if (odd? log_n)
(recursive-bit 0 n 0 (arithmetic-shift n -2))
(let ((n/2 (arithmetic-shift n -1))
(n/8 (arithmetic-shift n -3)))
(recursive-bit 0 n/2 0 n/8)
(recursive-bit n/2 n 1 n/8)
(radix-2-pass a))))))
(define (two^p>=m m)
returns smallest p , assumes fixnum m > = 0
(do ((p 0 (+ p 1))
(two^p 1 (* two^p 2)))
((<= m two^p) p)))
Works on 2^n complex doubles .
(define two^n+1 (expt 2 (+ n 1)))
(define inexact-two^-n (FLOAT/ (exact->inexact (expt 2 n))))
(define data
(let ((result (FLOATmake-vector two^n+1)))
(do ((i 0 (+ i 1)))
((= i two^n+1) result)
(FLOATvector-set! result i (exact->inexact i)))))
(define (run data)
(let ((table (make-w (- n 1))))
(direct-fft-recursive-4 data table)
(inverse-fft-recursive-4 data table)
(do ((j 0 (+ j 1)))
((= j two^n+1))
(FLOATvector-set! data j (FLOAT* (FLOATvector-ref data j) inexact-two^-n)))
(FLOATvector-ref data 3)))
(define (main . args)
(run-benchmark
"fftrad4"
fftrad4-iters
(lambda (result) (FLOAT<= (FLOATabs (FLOAT- result 3.0)) 1e-4))
(lambda (data) (lambda () (run data)))
data))
(main)
|
7610ed1170427859beb86639beb0c673215e3a2e92b451f4aac5c388df344028 | karlhof26/gimp-scheme | torres-analogize.scm | ;;
; The GIMP -- an image manipulation program
Copyright ( C ) 1995 and
;
Analogize script for GIMP 2.4 and Gimp 2.10.24
Copyright ( C ) 2005 < >
;
; Tags: photo, old
;
; Author statement:
A script - fu for the GIMP that makes any picture look as if it had
;; been taken using an old analog camera. Exaggerates contrast and
;; saturation and creates a bright and a dark overlay randomly
placed . Think of it as kind of a Lomo Kompakt or Kodak instantmatic
;; faking effect. However it still can't make anything to emulate the
peculiar chromatism usually achieved using the real thing .
;;
Check / for more information .
;
;
; --------------------------------------------------------------------
Distributed by Gimp FX Foundry project
; --------------------------------------------------------------------
; - Changelog -
;
; --------------------------------------------------------------------
;
; This program is free software: you can redistribute it and/or modify
it under the terms of the GNU General Public License as published by
the Free Software Foundation , either version 3 of the License , or
; (at your option) any later version.
;
; This program is distributed in the hope that it will be useful,
; but WITHOUT ANY WARRANTY; without even the implied warranty of
; MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
; GNU General Public License for more details.
;
You should have received a copy of the GNU General Public License
; along with this program. If not, see </>.
;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
(define (script-fu-analogize img
drawable
contrast
saturation
bright-opacity
shadow-opacity
duplicate-shadow
flatten
copy)
(let* (
(image 0)
(layer 0)
(image-width 0)
(image-height 0)
(half-image-width 0)
(half-image-height 0)
(center-x 0)
(center-y 0)
(bright-layer 0)
(shadow-layer 0)
(shadow-layer2 0)
(width-factor 0)
(height-factor 0)
)
(set! image (if (= copy TRUE)
(car (gimp-image-duplicate img))
img))
(gimp-image-undo-group-start image)
(set! layer (car (gimp-image-flatten image)))
(set! image-width (car (gimp-image-width image)))
(set! image-height (car (gimp-image-height image)))
(set! half-image-width (/ image-width 2))
(set! half-image-height (/ image-height 2))
(set! width-factor (/ (- 85 (rand 170)) 100))
(set! height-factor (/ (- 85 (rand 170)) 100))
(set! center-x (+ half-image-width (* half-image-width width-factor)))
(set! center-y (+ half-image-height (* half-image-height height-factor)))
(gimp-drawable-brightness-contrast layer 0.01 (/ contrast 255))
(gimp-hue-saturation layer 0 0 0 saturation)
(set! bright-layer (car (gimp-layer-new image
image-width
image-height
1 "Brillo" bright-opacity 5)))
(gimp-image-insert-layer image bright-layer 0 0)
(gimp-edit-clear bright-layer)
(gimp-context-set-foreground '(255 255 255))
(gimp-edit-blend bright-layer 2 0 2 100 0 0 FALSE FALSE 1 3 TRUE
center-x center-y
(+ half-image-width center-x) 0)
(set! shadow-layer (car (gimp-layer-new image
image-width
image-height
1 "Sombra" shadow-opacity 5)))
(gimp-image-insert-layer image shadow-layer 0 0)
(gimp-edit-clear shadow-layer)
(gimp-context-set-foreground '(0 0 0))
(if (= (rand 2) 1)
(begin
;(gimp-message "rand is 1")
( gimp - message ( number->string ( rand 2 ) ) )
( gimp - message ( number->string ( rand 2 ) ) )
(gimp-edit-blend shadow-layer 2 0 0 100 0 0 FALSE FALSE 1 4 TRUE
0 0
center-x center-y)
(gimp-edit-blend shadow-layer 2 0 0 100 0 0 FALSE FALSE 1 4 TRUE
image-width image-height
center-x center-y)
)
(begin
( gimp - message " rand is not 1 " )
( gimp - message ( number->string ( rand 2 ) ) )
(gimp-edit-blend shadow-layer 2 0 0 100 0 0 FALSE FALSE 0 0 TRUE
image-width 0
center-x center-y)
(gimp-edit-blend shadow-layer BLEND-FG-TRANSPARENT LAYER-MODE-NORMAL-LEGACY GRADIENT-LINEAR 100 0 REPEAT-NONE FALSE FALSE 1 4 TRUE
0 image-height
center-x center-y)
)
)
(cond ((= duplicate-shadow TRUE)
(set! shadow-layer2 (car (gimp-layer-copy shadow-layer 0)))
(gimp-image-insert-layer image shadow-layer2 0 -1)); was 0 0
)
(cond ((= flatten TRUE)
(gimp-image-flatten image))
)
(cond ((= copy TRUE)
(gimp-display-new image))
)
(gimp-image-undo-group-end image)
(gimp-displays-flush)
)
)
(script-fu-register "script-fu-analogize"
"Analogize..."
"A simple analog camera faking effect A script-fu for the GIMP that makes any picture look as if it had
been taken using an old analog camera. Exaggerates contrast and
saturation and creates a bright and a dark overlay randomly
placed. Think of it as kind of a Lomo Kompakt or Kodak instantmatic
faking effect. However it still can't make anything to emulate the
peculiar chromatism usually achieved using the real thing. \nfile:torres-analogize.scm"
"Ismael Valladolid Torres <>"
"Ismael Valladolid Torres"
"2005"
"RGB*"
SF-IMAGE "The image" 0
SF-DRAWABLE "The layer" 0
SF-ADJUSTMENT "Contrast" '(20 0 126 1 5 0 0)
SF-ADJUSTMENT "Saturation" '(20 0 60 1 5 0 0)
SF-ADJUSTMENT "Bright layer opacity" '(80 0 100 1 10 0 0)
SF-ADJUSTMENT "Shadow layer opacity" '(100 0 100 1 10 0 0)
SF-TOGGLE "Duplicate the shadow layer" TRUE
SF-TOGGLE "Flatten image after processing" FALSE
SF-TOGGLE "Work on copy" TRUE
)
(script-fu-menu-register "script-fu-analogize"
"<Image>/Script-Fu/Toolbox/Artistic")
; end of script | null | https://raw.githubusercontent.com/karlhof26/gimp-scheme/8e00194f318281ef9e7808b96d44ecff7cffd413/torres-analogize.scm | scheme |
The GIMP -- an image manipulation program
Tags: photo, old
Author statement:
been taken using an old analog camera. Exaggerates contrast and
saturation and creates a bright and a dark overlay randomly
faking effect. However it still can't make anything to emulate the
--------------------------------------------------------------------
--------------------------------------------------------------------
- Changelog -
--------------------------------------------------------------------
This program is free software: you can redistribute it and/or modify
(at your option) any later version.
This program is distributed in the hope that it will be useful,
but WITHOUT ANY WARRANTY; without even the implied warranty of
MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
GNU General Public License for more details.
along with this program. If not, see </>.
(gimp-message "rand is 1")
was 0 0
end of script | Copyright ( C ) 1995 and
Analogize script for GIMP 2.4 and Gimp 2.10.24
Copyright ( C ) 2005 < >
A script - fu for the GIMP that makes any picture look as if it had
placed . Think of it as kind of a Lomo Kompakt or Kodak instantmatic
peculiar chromatism usually achieved using the real thing .
Check / for more information .
Distributed by Gimp FX Foundry project
it under the terms of the GNU General Public License as published by
the Free Software Foundation , either version 3 of the License , or
You should have received a copy of the GNU General Public License
(define (script-fu-analogize img
drawable
contrast
saturation
bright-opacity
shadow-opacity
duplicate-shadow
flatten
copy)
(let* (
(image 0)
(layer 0)
(image-width 0)
(image-height 0)
(half-image-width 0)
(half-image-height 0)
(center-x 0)
(center-y 0)
(bright-layer 0)
(shadow-layer 0)
(shadow-layer2 0)
(width-factor 0)
(height-factor 0)
)
(set! image (if (= copy TRUE)
(car (gimp-image-duplicate img))
img))
(gimp-image-undo-group-start image)
(set! layer (car (gimp-image-flatten image)))
(set! image-width (car (gimp-image-width image)))
(set! image-height (car (gimp-image-height image)))
(set! half-image-width (/ image-width 2))
(set! half-image-height (/ image-height 2))
(set! width-factor (/ (- 85 (rand 170)) 100))
(set! height-factor (/ (- 85 (rand 170)) 100))
(set! center-x (+ half-image-width (* half-image-width width-factor)))
(set! center-y (+ half-image-height (* half-image-height height-factor)))
(gimp-drawable-brightness-contrast layer 0.01 (/ contrast 255))
(gimp-hue-saturation layer 0 0 0 saturation)
(set! bright-layer (car (gimp-layer-new image
image-width
image-height
1 "Brillo" bright-opacity 5)))
(gimp-image-insert-layer image bright-layer 0 0)
(gimp-edit-clear bright-layer)
(gimp-context-set-foreground '(255 255 255))
(gimp-edit-blend bright-layer 2 0 2 100 0 0 FALSE FALSE 1 3 TRUE
center-x center-y
(+ half-image-width center-x) 0)
(set! shadow-layer (car (gimp-layer-new image
image-width
image-height
1 "Sombra" shadow-opacity 5)))
(gimp-image-insert-layer image shadow-layer 0 0)
(gimp-edit-clear shadow-layer)
(gimp-context-set-foreground '(0 0 0))
(if (= (rand 2) 1)
(begin
( gimp - message ( number->string ( rand 2 ) ) )
( gimp - message ( number->string ( rand 2 ) ) )
(gimp-edit-blend shadow-layer 2 0 0 100 0 0 FALSE FALSE 1 4 TRUE
0 0
center-x center-y)
(gimp-edit-blend shadow-layer 2 0 0 100 0 0 FALSE FALSE 1 4 TRUE
image-width image-height
center-x center-y)
)
(begin
( gimp - message " rand is not 1 " )
( gimp - message ( number->string ( rand 2 ) ) )
(gimp-edit-blend shadow-layer 2 0 0 100 0 0 FALSE FALSE 0 0 TRUE
image-width 0
center-x center-y)
(gimp-edit-blend shadow-layer BLEND-FG-TRANSPARENT LAYER-MODE-NORMAL-LEGACY GRADIENT-LINEAR 100 0 REPEAT-NONE FALSE FALSE 1 4 TRUE
0 image-height
center-x center-y)
)
)
(cond ((= duplicate-shadow TRUE)
(set! shadow-layer2 (car (gimp-layer-copy shadow-layer 0)))
)
(cond ((= flatten TRUE)
(gimp-image-flatten image))
)
(cond ((= copy TRUE)
(gimp-display-new image))
)
(gimp-image-undo-group-end image)
(gimp-displays-flush)
)
)
(script-fu-register "script-fu-analogize"
"Analogize..."
"A simple analog camera faking effect A script-fu for the GIMP that makes any picture look as if it had
been taken using an old analog camera. Exaggerates contrast and
saturation and creates a bright and a dark overlay randomly
placed. Think of it as kind of a Lomo Kompakt or Kodak instantmatic
faking effect. However it still can't make anything to emulate the
peculiar chromatism usually achieved using the real thing. \nfile:torres-analogize.scm"
"Ismael Valladolid Torres <>"
"Ismael Valladolid Torres"
"2005"
"RGB*"
SF-IMAGE "The image" 0
SF-DRAWABLE "The layer" 0
SF-ADJUSTMENT "Contrast" '(20 0 126 1 5 0 0)
SF-ADJUSTMENT "Saturation" '(20 0 60 1 5 0 0)
SF-ADJUSTMENT "Bright layer opacity" '(80 0 100 1 10 0 0)
SF-ADJUSTMENT "Shadow layer opacity" '(100 0 100 1 10 0 0)
SF-TOGGLE "Duplicate the shadow layer" TRUE
SF-TOGGLE "Flatten image after processing" FALSE
SF-TOGGLE "Work on copy" TRUE
)
(script-fu-menu-register "script-fu-analogize"
"<Image>/Script-Fu/Toolbox/Artistic")
|
c53d77c195383f54da5b7b38849ae52a88fdf4db7bf801232c38eaef0b646258 | paurkedal/ocaml-radixmap | ip_radixmap.mli | Copyright ( C ) 2017 - -2022 Petter A. Urkedal < >
*
* This library is free software ; you can redistribute it and/or modify it
* under the terms of the GNU Lesser General Public License as published by
* the Free Software Foundation , either version 3 of the License , or ( at your
* option ) any later version , with the LGPL-3.0 Linking Exception .
*
* This library is distributed in the hope that it will be useful , but WITHOUT
* ANY WARRANTY ; without even the implied warranty of MERCHANTABILITY or
* FITNESS FOR A PARTICULAR PURPOSE . See the GNU Lesser General Public
* License for more details .
*
* You should have received a copy of the GNU Lesser General Public License
* and the LGPL-3.0 Linking Exception along with this library . If not , see
* < / > and < > , respectively .
*
* This library is free software; you can redistribute it and/or modify it
* under the terms of the GNU Lesser General Public License as published by
* the Free Software Foundation, either version 3 of the License, or (at your
* option) any later version, with the LGPL-3.0 Linking Exception.
*
* This library is distributed in the hope that it will be useful, but WITHOUT
* ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
* FITNESS FOR A PARTICULAR PURPOSE. See the GNU Lesser General Public
* License for more details.
*
* You should have received a copy of the GNU Lesser General Public License
* and the LGPL-3.0 Linking Exception along with this library. If not, see
* </> and <>, respectively.
*)
(** Radix map over IP networks. *)
module Poly_v4 : sig
type ('a, 'id) t
end
module Poly_v6 : sig
type ('a, 'id) t
end
module Make_v4 (Cod : Bitword_radixmap_sig.EQUAL) : Ip_radixmap_sig.S
with type address = Ipaddr.V4.t
and type network = Ipaddr.V4.Prefix.t
and type cod = Cod.t
and type ('a, 'id) poly = ('a, 'id) Poly_v4.t
module Make_v6 (Cod : Bitword_radixmap_sig.EQUAL) : Ip_radixmap_sig.S
with type address = Ipaddr.V6.t
and type network = Ipaddr.V6.Prefix.t
and type cod = Cod.t
and type ('a, 'id) poly = ('a, 'id) Poly_v6.t
| null | https://raw.githubusercontent.com/paurkedal/ocaml-radixmap/93d0df62ac1da91c42dfdbac579e0e55a2dbdd5e/lib/ip_radixmap.mli | ocaml | * Radix map over IP networks. | Copyright ( C ) 2017 - -2022 Petter A. Urkedal < >
*
* This library is free software ; you can redistribute it and/or modify it
* under the terms of the GNU Lesser General Public License as published by
* the Free Software Foundation , either version 3 of the License , or ( at your
* option ) any later version , with the LGPL-3.0 Linking Exception .
*
* This library is distributed in the hope that it will be useful , but WITHOUT
* ANY WARRANTY ; without even the implied warranty of MERCHANTABILITY or
* FITNESS FOR A PARTICULAR PURPOSE . See the GNU Lesser General Public
* License for more details .
*
* You should have received a copy of the GNU Lesser General Public License
* and the LGPL-3.0 Linking Exception along with this library . If not , see
* < / > and < > , respectively .
*
* This library is free software; you can redistribute it and/or modify it
* under the terms of the GNU Lesser General Public License as published by
* the Free Software Foundation, either version 3 of the License, or (at your
* option) any later version, with the LGPL-3.0 Linking Exception.
*
* This library is distributed in the hope that it will be useful, but WITHOUT
* ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
* FITNESS FOR A PARTICULAR PURPOSE. See the GNU Lesser General Public
* License for more details.
*
* You should have received a copy of the GNU Lesser General Public License
* and the LGPL-3.0 Linking Exception along with this library. If not, see
* </> and <>, respectively.
*)
module Poly_v4 : sig
type ('a, 'id) t
end
module Poly_v6 : sig
type ('a, 'id) t
end
module Make_v4 (Cod : Bitword_radixmap_sig.EQUAL) : Ip_radixmap_sig.S
with type address = Ipaddr.V4.t
and type network = Ipaddr.V4.Prefix.t
and type cod = Cod.t
and type ('a, 'id) poly = ('a, 'id) Poly_v4.t
module Make_v6 (Cod : Bitword_radixmap_sig.EQUAL) : Ip_radixmap_sig.S
with type address = Ipaddr.V6.t
and type network = Ipaddr.V6.Prefix.t
and type cod = Cod.t
and type ('a, 'id) poly = ('a, 'id) Poly_v6.t
|
4e2c048660e472971bae87937020f718e89ea7a2997e09369a2ebfb4320a6ff7 | wavewave/hoodle | Simple.hs | {-# LANGUAGE BangPatterns #-}
# LANGUAGE FlexibleContexts #
# LANGUAGE FlexibleInstances #
{-# LANGUAGE OverloadedStrings #-}
# LANGUAGE RecordWildCards #
# LANGUAGE ScopedTypeVariables #
# LANGUAGE TemplateHaskell #
# LANGUAGE TypeFamilies #
# LANGUAGE TypeOperators #
# OPTIONS_GHC -fno - warn - orphans #
module Data.Hoodle.Simple where
import Data.Aeson.TH (defaultOptions, deriveJSON, fieldLabelModifier)
import Data.Aeson.Types
( FromJSON (..),
ToJSON (..),
Value (..),
object,
(.:),
(.=),
)
import Data.ByteString.Char8 (ByteString, pack)
import Data.Hoodle.Util (fst3, snd3)
import qualified Data.Serialize as SE
import Data.Strict.Tuple (Pair (..))
import qualified Data.Text as T
import qualified Data.Text.Encoding as TE
import Data.UUID.V4 (nextRandom)
import Lens.Micro (Lens', lens, set)
import Prelude hiding (curry, fst, putStrLn, snd, uncurry)
-- |
type Title = ByteString
| Orphan instance for ByteString
-- __TODO__: Remove this
instance ToJSON ByteString where
toJSON = String . TE.decodeUtf8
| Orphan instance for ByteString
-- __TODO__: Remove this
instance FromJSON ByteString where
parseJSON v = TE.encodeUtf8 <$> parseJSON v
-- | Orphan instance for Pair
instance (SE.Serialize a, SE.Serialize b) => SE.Serialize (Pair a b) where
put (x :!: y) =
SE.put x
>> SE.put y
get = (:!:) <$> SE.get <*> SE.get
-- |
data Dimension = Dim {dim_width :: !Double, dim_height :: !Double}
deriving (Show, Eq, Ord)
$(deriveJSON defaultOptions {fieldLabelModifier = drop 4} ''Dimension)
-- |
instance SE.Serialize Dimension where
put (Dim w h) = SE.put w >> SE.put h
get = Dim <$> SE.get <*> SE.get
-- | Pen stroke item
data Stroke
= Stroke
{ stroke_tool :: !ByteString,
stroke_color :: !ByteString,
stroke_width :: !Double,
stroke_data :: ![Pair Double Double]
}
| VWStroke
{ stroke_tool :: ByteString,
stroke_color :: ByteString,
stroke_vwdata :: [(Double, Double, Double)]
}
deriving (Show, Eq, Ord)
$(deriveJSON defaultOptions {fieldLabelModifier = drop 7} ''Stroke)
instance SE.Serialize Stroke where
put Stroke {..} =
SE.putWord8 0
>> SE.put stroke_tool
>> SE.put stroke_color
>> SE.put stroke_width
>> SE.put stroke_data
put VWStroke {..} =
SE.putWord8 1
>> SE.put stroke_tool
>> SE.put stroke_color
>> SE.put stroke_vwdata
get = do
tag <- SE.getWord8
case tag of
0 -> Stroke <$> SE.get <*> SE.get <*> SE.get <*> SE.get
1 -> VWStroke <$> SE.get <*> SE.get <*> SE.get
_ -> fail "err in Stroke parsing"
-- | Image item
data Image = Image
{ img_src :: ByteString,
img_pos :: (Double, Double),
img_dim :: !Dimension
}
deriving (Show, Eq, Ord)
instance ToJSON Image where
toJSON Image {..} =
object
[ "pos" .= toJSON img_pos,
"dim" .= toJSON img_dim
]
instance FromJSON Image where
parseJSON (Object v) = Image "" <$> v .: "pos" <*> v .: "dim"
parseJSON _ = fail "error in parsing Image"
$ ( deriveJSON defaultOptions { fieldLabelModifier = drop 4 } '' Image )
instance SE.Serialize Image where
put Image {..} =
SE.put img_src
>> SE.put img_pos
>> SE.put img_dim
get = Image <$> SE.get <*> SE.get <*> SE.get
data SVG = SVG
{ svg_text :: Maybe ByteString,
svg_command :: Maybe ByteString,
svg_render :: ByteString,
svg_pos :: (Double, Double),
svg_dim :: !Dimension
}
deriving (Show, Eq, Ord)
$ ( deriveJSON defaultOptions { fieldLabelModifier = drop 4 } '' SVG )
instance ToJSON SVG where
toJSON SVG {..} =
object
[ "pos" .= toJSON svg_pos,
"dim" .= toJSON svg_dim
]
instance FromJSON SVG where
parseJSON (Object v) = SVG Nothing Nothing "" <$> v .: "pos" <*> v .: "dim"
parseJSON _ = fail "error in parsing SVG"
-- |
instance SE.Serialize SVG where
put SVG {..} =
SE.put svg_text
>> SE.put svg_command
>> SE.put svg_render
>> SE.put svg_pos
>> SE.put svg_dim
get = SVG <$> SE.get <*> SE.get <*> SE.get <*> SE.get <*> SE.get
-- |
data Link
= Link
{ link_id :: ByteString,
link_type :: ByteString,
link_location :: ByteString,
link_text :: Maybe ByteString,
link_command :: Maybe ByteString,
link_render :: ByteString,
link_pos :: (Double, Double),
link_dim :: !Dimension
}
| LinkDocID
{ link_id :: ByteString,
link_linkeddocid :: ByteString,
link_location :: ByteString,
link_text :: Maybe ByteString,
link_command :: Maybe ByteString,
link_render :: ByteString,
link_pos :: (Double, Double),
link_dim :: !Dimension
}
| LinkAnchor
{ link_id :: ByteString,
link_linkeddocid :: ByteString,
link_location :: ByteString,
link_anchorid :: ByteString,
link_render :: ByteString,
link_pos :: (Double, Double),
link_dim :: !Dimension
}
deriving (Show, Eq, Ord)
instance ToJSON Link where
toJSON Link {..} =
object
[ "tag" .= String "Link",
"id" .= toJSON link_id,
"type" .= toJSON link_type,
"location" .= toJSON link_location,
"pos" .= toJSON link_pos,
"dim" .= toJSON link_dim
]
toJSON LinkDocID {..} =
object
[ "tag" .= String "LinkDocID",
"id" .= toJSON link_id,
"linkeddocid" .= toJSON link_linkeddocid,
"location" .= toJSON link_location,
"pos" .= toJSON link_pos,
"dim" .= toJSON link_dim
]
toJSON LinkAnchor {..} =
object
[ "tag" .= String "LinkAnchor",
"id" .= toJSON link_id,
"linkeddocid" .= toJSON link_linkeddocid,
"location" .= toJSON link_location,
"anchorid" .= toJSON link_anchorid,
"pos" .= toJSON link_pos,
"dim" .= toJSON link_dim
]
instance FromJSON Link where
parseJSON (Object v) = do
tag :: T.Text <- v .: "tag"
case tag of
"Link" ->
Link <$> v .: "id" <*> v .: "type" <*> v .: "location"
<*> pure Nothing
<*> pure Nothing
<*> pure ""
<*> v
.: "pos"
<*> v
.: "dim"
"LinkDocID" ->
LinkDocID <$> v .: "id" <*> v .: "linkeddocid"
<*> v
.: "location"
<*> pure Nothing
<*> pure Nothing
<*> pure ""
<*> v
.: "pos"
<*> v
.: "dim"
"LinkAnchor" ->
LinkAnchor <$> v .: "id" <*> v .: "linkeddocid"
<*> v
.: "location"
<*> v
.: "anchorid"
<*> pure ""
<*> v
.: "pos"
<*> v
.: "dim"
_ -> fail "error in parsing Link"
parseJSON _ = fail "error in parsing Link"
$ ( deriveJSON defaultOptions { fieldLabelModifier = drop 5 } '' Link )
instance SE.Serialize Link where
put Link {..} =
SE.putWord8 0
>> SE.put link_id
>> SE.put link_type
>> SE.put link_location
>> SE.put link_text
>> SE.put link_command
>> SE.put link_render
>> SE.put link_pos
>> SE.put link_dim
put LinkDocID {..} =
SE.putWord8 1
>> SE.put link_id
>> SE.put link_linkeddocid
>> SE.put link_location
>> SE.put link_text
>> SE.put link_command
>> SE.put link_render
>> SE.put link_pos
>> SE.put link_dim
put LinkAnchor {..} =
SE.putWord8 2
>> SE.put link_id
>> SE.put link_linkeddocid
>> SE.put link_location
>> SE.put link_anchorid
>> SE.put link_render
>> SE.put link_pos
>> SE.put link_dim
get = do
tag <- SE.getWord8
case tag of
0 ->
Link <$> SE.get <*> SE.get <*> SE.get <*> SE.get
<*> SE.get
<*> SE.get
<*> SE.get
<*> SE.get
1 ->
LinkDocID <$> SE.get <*> SE.get <*> SE.get <*> SE.get
<*> SE.get
<*> SE.get
<*> SE.get
<*> SE.get
2 ->
LinkAnchor <$> SE.get <*> SE.get <*> SE.get <*> SE.get
<*> SE.get
<*> SE.get
<*> SE.get
_ -> fail "err in Link parsing"
data Anchor = Anchor
{ anchor_id :: ByteString,
anchor_render :: ByteString,
anchor_pos :: (Double, Double),
anchor_dim :: !Dimension
}
deriving (Show, Eq, Ord)
$(deriveJSON defaultOptions {fieldLabelModifier = drop 7} ''Anchor)
instance SE.Serialize Anchor where
put Anchor {..} =
SE.put anchor_id
>> SE.put anchor_render
>> SE.put anchor_pos
>> SE.put anchor_dim
get = Anchor <$> SE.get <*> SE.get <*> SE.get <*> SE.get
-- | wrapper of object embeddable in Layer
data Item
= ItemStroke Stroke
| ItemImage Image
| ItemSVG SVG
| ItemLink Link
| ItemAnchor Anchor
deriving (Show, Eq, Ord)
$(deriveJSON defaultOptions ''Item)
-- |
instance SE.Serialize Item where
put (ItemStroke str) =
SE.putWord8 0
>> SE.put str
put (ItemImage img) =
SE.putWord8 1
>> SE.put img
put (ItemSVG svg) =
SE.putWord8 2
>> SE.put svg
put (ItemLink lnk) =
SE.putWord8 3
>> SE.put lnk
put (ItemAnchor anc) =
SE.putWord8 4
>> SE.put anc
get = do
tag <- SE.getWord8
case tag of
0 -> ItemStroke <$> SE.get
1 -> ItemImage <$> SE.get
2 -> ItemSVG <$> SE.get
3 -> ItemLink <$> SE.get
4 -> ItemAnchor <$> SE.get
_ -> fail "err in Item parsing"
-- |
data Background
= Background
{ bkg_type :: !ByteString,
bkg_color :: !ByteString,
bkg_style :: !ByteString
}
| BackgroundPdf
{ bkg_type :: ByteString,
bkg_domain :: Maybe ByteString,
bkg_filename :: Maybe ByteString,
bkg_pageno :: Int
}
| BackgroundEmbedPdf
{ bkg_type :: ByteString,
bkg_pageno :: Int
}
deriving (Show)
$(deriveJSON defaultOptions {fieldLabelModifier = drop 4} ''Background)
-- |
data Revision
= Revision
{ _revmd5 :: !ByteString,
_revtxt :: !ByteString
}
| RevisionInk
{ _revmd5 :: !ByteString,
_revink :: [Stroke]
}
deriving (Show)
$(deriveJSON defaultOptions {fieldLabelModifier = drop 1} ''Revision)
-- |
newtype Layer = Layer {layer_items :: [Item]}
deriving (Show)
$(deriveJSON defaultOptions {fieldLabelModifier = drop 6} ''Layer)
-- |
data Page = Page
{ page_dim :: !Dimension,
page_bkg :: !Background,
page_layers :: ![Layer]
}
deriving (Show)
$(deriveJSON defaultOptions {fieldLabelModifier = drop 5} ''Page)
-- |
data Hoodle = Hoodle
{ hoodle_id :: ByteString,
hoodle_title :: !Title,
hoodle_revisions :: [Revision],
hoodle_embeddedpdf :: Maybe ByteString,
hoodle_embeddedtext :: Maybe T.Text,
hoodle_pages :: ![Page]
}
deriving (Show)
$(deriveJSON defaultOptions {fieldLabelModifier = drop 7} ''Hoodle)
-- |
getXYtuples :: Stroke -> [(Double, Double)]
getXYtuples (Stroke _t _c _w d) = map (\(x :!: y) -> (x, y)) d
getXYtuples (VWStroke _t _c d) = map ((,) <$> fst3 <*> snd3) d
----------------------------
-- Lenses
----------------------------
-- |
tool :: Lens' Stroke ByteString
tool = lens stroke_tool (\f a -> f {stroke_tool = a})
-- |
color :: Lens' Stroke ByteString
color = lens stroke_color (\f a -> f {stroke_color = a})
-- |
hoodleID :: Lens' Hoodle ByteString
hoodleID = lens hoodle_id (\f a -> f {hoodle_id = a})
-- |
title :: Lens' Hoodle Title
title = lens hoodle_title (\f a -> f {hoodle_title = a})
-- |
revisions :: Lens' Hoodle [Revision]
revisions = lens hoodle_revisions (\f a -> f {hoodle_revisions = a})
-- |
revmd5 :: Lens' Revision ByteString
revmd5 = lens _revmd5 (\f a -> f {_revmd5 = a})
-- |
embeddedPdf :: Lens' Hoodle (Maybe ByteString)
embeddedPdf = lens hoodle_embeddedpdf (\f a -> f {hoodle_embeddedpdf = a})
-- |
embeddedText :: Lens' Hoodle (Maybe T.Text)
embeddedText = lens hoodle_embeddedtext (\f a -> f {hoodle_embeddedtext = a})
-- |
pages :: Lens' Hoodle [Page]
pages = lens hoodle_pages (\f a -> f {hoodle_pages = a})
-- |
dimension :: Lens' Page Dimension
dimension = lens page_dim (\f a -> f {page_dim = a})
-- |
background :: Lens' Page Background
background = lens page_bkg (\f a -> f {page_bkg = a})
-- |
layers :: Lens' Page [Layer]
layers = lens page_layers (\f a -> f {page_layers = a})
-- |
items :: Lens' Layer [Item]
items = lens layer_items (\f a -> f {layer_items = a})
--------------------------
-- empty objects
--------------------------
-- |
emptyHoodle :: IO Hoodle
emptyHoodle = do
uuid <- nextRandom
return $ Hoodle ((pack . show) uuid) "" [] Nothing Nothing []
-- |
emptyLayer :: Layer
emptyLayer = Layer {layer_items = []}
-- |
emptyStroke :: Stroke
emptyStroke = Stroke "pen" "black" 1.4 []
-- |
defaultBackground :: Background
defaultBackground =
Background
{ bkg_type = "solid",
bkg_color = "white",
bkg_style = "lined"
}
-- |
defaultPage :: Page
defaultPage =
Page
{ page_dim = Dim 612.0 792.0,
page_bkg = defaultBackground,
page_layers = [emptyLayer]
}
-- |
defaultHoodle :: IO Hoodle
defaultHoodle =
set title "untitled" . set embeddedPdf Nothing . set pages [defaultPage]
<$> emptyHoodle
-- |
newPageFromOld :: Page -> Page
newPageFromOld page =
Page
{ page_dim = page_dim page,
page_bkg = page_bkg page,
page_layers = [emptyLayer]
}
| null | https://raw.githubusercontent.com/wavewave/hoodle/fa7481d14a53733b2f6ae9debc95357d904a943c/types/src/Data/Hoodle/Simple.hs | haskell | # LANGUAGE BangPatterns #
# LANGUAGE OverloadedStrings #
|
__TODO__: Remove this
__TODO__: Remove this
| Orphan instance for Pair
|
|
| Pen stroke item
| Image item
|
|
| wrapper of object embeddable in Layer
|
|
|
|
|
|
|
--------------------------
Lenses
--------------------------
|
|
|
|
|
|
|
|
|
|
|
|
|
------------------------
empty objects
------------------------
|
|
|
|
|
|
| | # LANGUAGE FlexibleContexts #
# LANGUAGE FlexibleInstances #
# LANGUAGE RecordWildCards #
# LANGUAGE ScopedTypeVariables #
# LANGUAGE TemplateHaskell #
# LANGUAGE TypeFamilies #
# LANGUAGE TypeOperators #
# OPTIONS_GHC -fno - warn - orphans #
module Data.Hoodle.Simple where
import Data.Aeson.TH (defaultOptions, deriveJSON, fieldLabelModifier)
import Data.Aeson.Types
( FromJSON (..),
ToJSON (..),
Value (..),
object,
(.:),
(.=),
)
import Data.ByteString.Char8 (ByteString, pack)
import Data.Hoodle.Util (fst3, snd3)
import qualified Data.Serialize as SE
import Data.Strict.Tuple (Pair (..))
import qualified Data.Text as T
import qualified Data.Text.Encoding as TE
import Data.UUID.V4 (nextRandom)
import Lens.Micro (Lens', lens, set)
import Prelude hiding (curry, fst, putStrLn, snd, uncurry)
type Title = ByteString
| Orphan instance for ByteString
instance ToJSON ByteString where
toJSON = String . TE.decodeUtf8
| Orphan instance for ByteString
instance FromJSON ByteString where
parseJSON v = TE.encodeUtf8 <$> parseJSON v
instance (SE.Serialize a, SE.Serialize b) => SE.Serialize (Pair a b) where
put (x :!: y) =
SE.put x
>> SE.put y
get = (:!:) <$> SE.get <*> SE.get
data Dimension = Dim {dim_width :: !Double, dim_height :: !Double}
deriving (Show, Eq, Ord)
$(deriveJSON defaultOptions {fieldLabelModifier = drop 4} ''Dimension)
instance SE.Serialize Dimension where
put (Dim w h) = SE.put w >> SE.put h
get = Dim <$> SE.get <*> SE.get
data Stroke
= Stroke
{ stroke_tool :: !ByteString,
stroke_color :: !ByteString,
stroke_width :: !Double,
stroke_data :: ![Pair Double Double]
}
| VWStroke
{ stroke_tool :: ByteString,
stroke_color :: ByteString,
stroke_vwdata :: [(Double, Double, Double)]
}
deriving (Show, Eq, Ord)
$(deriveJSON defaultOptions {fieldLabelModifier = drop 7} ''Stroke)
instance SE.Serialize Stroke where
put Stroke {..} =
SE.putWord8 0
>> SE.put stroke_tool
>> SE.put stroke_color
>> SE.put stroke_width
>> SE.put stroke_data
put VWStroke {..} =
SE.putWord8 1
>> SE.put stroke_tool
>> SE.put stroke_color
>> SE.put stroke_vwdata
get = do
tag <- SE.getWord8
case tag of
0 -> Stroke <$> SE.get <*> SE.get <*> SE.get <*> SE.get
1 -> VWStroke <$> SE.get <*> SE.get <*> SE.get
_ -> fail "err in Stroke parsing"
data Image = Image
{ img_src :: ByteString,
img_pos :: (Double, Double),
img_dim :: !Dimension
}
deriving (Show, Eq, Ord)
instance ToJSON Image where
toJSON Image {..} =
object
[ "pos" .= toJSON img_pos,
"dim" .= toJSON img_dim
]
instance FromJSON Image where
parseJSON (Object v) = Image "" <$> v .: "pos" <*> v .: "dim"
parseJSON _ = fail "error in parsing Image"
$ ( deriveJSON defaultOptions { fieldLabelModifier = drop 4 } '' Image )
instance SE.Serialize Image where
put Image {..} =
SE.put img_src
>> SE.put img_pos
>> SE.put img_dim
get = Image <$> SE.get <*> SE.get <*> SE.get
data SVG = SVG
{ svg_text :: Maybe ByteString,
svg_command :: Maybe ByteString,
svg_render :: ByteString,
svg_pos :: (Double, Double),
svg_dim :: !Dimension
}
deriving (Show, Eq, Ord)
$ ( deriveJSON defaultOptions { fieldLabelModifier = drop 4 } '' SVG )
instance ToJSON SVG where
toJSON SVG {..} =
object
[ "pos" .= toJSON svg_pos,
"dim" .= toJSON svg_dim
]
instance FromJSON SVG where
parseJSON (Object v) = SVG Nothing Nothing "" <$> v .: "pos" <*> v .: "dim"
parseJSON _ = fail "error in parsing SVG"
instance SE.Serialize SVG where
put SVG {..} =
SE.put svg_text
>> SE.put svg_command
>> SE.put svg_render
>> SE.put svg_pos
>> SE.put svg_dim
get = SVG <$> SE.get <*> SE.get <*> SE.get <*> SE.get <*> SE.get
data Link
= Link
{ link_id :: ByteString,
link_type :: ByteString,
link_location :: ByteString,
link_text :: Maybe ByteString,
link_command :: Maybe ByteString,
link_render :: ByteString,
link_pos :: (Double, Double),
link_dim :: !Dimension
}
| LinkDocID
{ link_id :: ByteString,
link_linkeddocid :: ByteString,
link_location :: ByteString,
link_text :: Maybe ByteString,
link_command :: Maybe ByteString,
link_render :: ByteString,
link_pos :: (Double, Double),
link_dim :: !Dimension
}
| LinkAnchor
{ link_id :: ByteString,
link_linkeddocid :: ByteString,
link_location :: ByteString,
link_anchorid :: ByteString,
link_render :: ByteString,
link_pos :: (Double, Double),
link_dim :: !Dimension
}
deriving (Show, Eq, Ord)
instance ToJSON Link where
toJSON Link {..} =
object
[ "tag" .= String "Link",
"id" .= toJSON link_id,
"type" .= toJSON link_type,
"location" .= toJSON link_location,
"pos" .= toJSON link_pos,
"dim" .= toJSON link_dim
]
toJSON LinkDocID {..} =
object
[ "tag" .= String "LinkDocID",
"id" .= toJSON link_id,
"linkeddocid" .= toJSON link_linkeddocid,
"location" .= toJSON link_location,
"pos" .= toJSON link_pos,
"dim" .= toJSON link_dim
]
toJSON LinkAnchor {..} =
object
[ "tag" .= String "LinkAnchor",
"id" .= toJSON link_id,
"linkeddocid" .= toJSON link_linkeddocid,
"location" .= toJSON link_location,
"anchorid" .= toJSON link_anchorid,
"pos" .= toJSON link_pos,
"dim" .= toJSON link_dim
]
instance FromJSON Link where
parseJSON (Object v) = do
tag :: T.Text <- v .: "tag"
case tag of
"Link" ->
Link <$> v .: "id" <*> v .: "type" <*> v .: "location"
<*> pure Nothing
<*> pure Nothing
<*> pure ""
<*> v
.: "pos"
<*> v
.: "dim"
"LinkDocID" ->
LinkDocID <$> v .: "id" <*> v .: "linkeddocid"
<*> v
.: "location"
<*> pure Nothing
<*> pure Nothing
<*> pure ""
<*> v
.: "pos"
<*> v
.: "dim"
"LinkAnchor" ->
LinkAnchor <$> v .: "id" <*> v .: "linkeddocid"
<*> v
.: "location"
<*> v
.: "anchorid"
<*> pure ""
<*> v
.: "pos"
<*> v
.: "dim"
_ -> fail "error in parsing Link"
parseJSON _ = fail "error in parsing Link"
$ ( deriveJSON defaultOptions { fieldLabelModifier = drop 5 } '' Link )
instance SE.Serialize Link where
put Link {..} =
SE.putWord8 0
>> SE.put link_id
>> SE.put link_type
>> SE.put link_location
>> SE.put link_text
>> SE.put link_command
>> SE.put link_render
>> SE.put link_pos
>> SE.put link_dim
put LinkDocID {..} =
SE.putWord8 1
>> SE.put link_id
>> SE.put link_linkeddocid
>> SE.put link_location
>> SE.put link_text
>> SE.put link_command
>> SE.put link_render
>> SE.put link_pos
>> SE.put link_dim
put LinkAnchor {..} =
SE.putWord8 2
>> SE.put link_id
>> SE.put link_linkeddocid
>> SE.put link_location
>> SE.put link_anchorid
>> SE.put link_render
>> SE.put link_pos
>> SE.put link_dim
get = do
tag <- SE.getWord8
case tag of
0 ->
Link <$> SE.get <*> SE.get <*> SE.get <*> SE.get
<*> SE.get
<*> SE.get
<*> SE.get
<*> SE.get
1 ->
LinkDocID <$> SE.get <*> SE.get <*> SE.get <*> SE.get
<*> SE.get
<*> SE.get
<*> SE.get
<*> SE.get
2 ->
LinkAnchor <$> SE.get <*> SE.get <*> SE.get <*> SE.get
<*> SE.get
<*> SE.get
<*> SE.get
_ -> fail "err in Link parsing"
data Anchor = Anchor
{ anchor_id :: ByteString,
anchor_render :: ByteString,
anchor_pos :: (Double, Double),
anchor_dim :: !Dimension
}
deriving (Show, Eq, Ord)
$(deriveJSON defaultOptions {fieldLabelModifier = drop 7} ''Anchor)
instance SE.Serialize Anchor where
put Anchor {..} =
SE.put anchor_id
>> SE.put anchor_render
>> SE.put anchor_pos
>> SE.put anchor_dim
get = Anchor <$> SE.get <*> SE.get <*> SE.get <*> SE.get
data Item
= ItemStroke Stroke
| ItemImage Image
| ItemSVG SVG
| ItemLink Link
| ItemAnchor Anchor
deriving (Show, Eq, Ord)
$(deriveJSON defaultOptions ''Item)
instance SE.Serialize Item where
put (ItemStroke str) =
SE.putWord8 0
>> SE.put str
put (ItemImage img) =
SE.putWord8 1
>> SE.put img
put (ItemSVG svg) =
SE.putWord8 2
>> SE.put svg
put (ItemLink lnk) =
SE.putWord8 3
>> SE.put lnk
put (ItemAnchor anc) =
SE.putWord8 4
>> SE.put anc
get = do
tag <- SE.getWord8
case tag of
0 -> ItemStroke <$> SE.get
1 -> ItemImage <$> SE.get
2 -> ItemSVG <$> SE.get
3 -> ItemLink <$> SE.get
4 -> ItemAnchor <$> SE.get
_ -> fail "err in Item parsing"
data Background
= Background
{ bkg_type :: !ByteString,
bkg_color :: !ByteString,
bkg_style :: !ByteString
}
| BackgroundPdf
{ bkg_type :: ByteString,
bkg_domain :: Maybe ByteString,
bkg_filename :: Maybe ByteString,
bkg_pageno :: Int
}
| BackgroundEmbedPdf
{ bkg_type :: ByteString,
bkg_pageno :: Int
}
deriving (Show)
$(deriveJSON defaultOptions {fieldLabelModifier = drop 4} ''Background)
data Revision
= Revision
{ _revmd5 :: !ByteString,
_revtxt :: !ByteString
}
| RevisionInk
{ _revmd5 :: !ByteString,
_revink :: [Stroke]
}
deriving (Show)
$(deriveJSON defaultOptions {fieldLabelModifier = drop 1} ''Revision)
newtype Layer = Layer {layer_items :: [Item]}
deriving (Show)
$(deriveJSON defaultOptions {fieldLabelModifier = drop 6} ''Layer)
data Page = Page
{ page_dim :: !Dimension,
page_bkg :: !Background,
page_layers :: ![Layer]
}
deriving (Show)
$(deriveJSON defaultOptions {fieldLabelModifier = drop 5} ''Page)
data Hoodle = Hoodle
{ hoodle_id :: ByteString,
hoodle_title :: !Title,
hoodle_revisions :: [Revision],
hoodle_embeddedpdf :: Maybe ByteString,
hoodle_embeddedtext :: Maybe T.Text,
hoodle_pages :: ![Page]
}
deriving (Show)
$(deriveJSON defaultOptions {fieldLabelModifier = drop 7} ''Hoodle)
getXYtuples :: Stroke -> [(Double, Double)]
getXYtuples (Stroke _t _c _w d) = map (\(x :!: y) -> (x, y)) d
getXYtuples (VWStroke _t _c d) = map ((,) <$> fst3 <*> snd3) d
tool :: Lens' Stroke ByteString
tool = lens stroke_tool (\f a -> f {stroke_tool = a})
color :: Lens' Stroke ByteString
color = lens stroke_color (\f a -> f {stroke_color = a})
hoodleID :: Lens' Hoodle ByteString
hoodleID = lens hoodle_id (\f a -> f {hoodle_id = a})
title :: Lens' Hoodle Title
title = lens hoodle_title (\f a -> f {hoodle_title = a})
revisions :: Lens' Hoodle [Revision]
revisions = lens hoodle_revisions (\f a -> f {hoodle_revisions = a})
revmd5 :: Lens' Revision ByteString
revmd5 = lens _revmd5 (\f a -> f {_revmd5 = a})
embeddedPdf :: Lens' Hoodle (Maybe ByteString)
embeddedPdf = lens hoodle_embeddedpdf (\f a -> f {hoodle_embeddedpdf = a})
embeddedText :: Lens' Hoodle (Maybe T.Text)
embeddedText = lens hoodle_embeddedtext (\f a -> f {hoodle_embeddedtext = a})
pages :: Lens' Hoodle [Page]
pages = lens hoodle_pages (\f a -> f {hoodle_pages = a})
dimension :: Lens' Page Dimension
dimension = lens page_dim (\f a -> f {page_dim = a})
background :: Lens' Page Background
background = lens page_bkg (\f a -> f {page_bkg = a})
layers :: Lens' Page [Layer]
layers = lens page_layers (\f a -> f {page_layers = a})
items :: Lens' Layer [Item]
items = lens layer_items (\f a -> f {layer_items = a})
emptyHoodle :: IO Hoodle
emptyHoodle = do
uuid <- nextRandom
return $ Hoodle ((pack . show) uuid) "" [] Nothing Nothing []
emptyLayer :: Layer
emptyLayer = Layer {layer_items = []}
emptyStroke :: Stroke
emptyStroke = Stroke "pen" "black" 1.4 []
defaultBackground :: Background
defaultBackground =
Background
{ bkg_type = "solid",
bkg_color = "white",
bkg_style = "lined"
}
defaultPage :: Page
defaultPage =
Page
{ page_dim = Dim 612.0 792.0,
page_bkg = defaultBackground,
page_layers = [emptyLayer]
}
defaultHoodle :: IO Hoodle
defaultHoodle =
set title "untitled" . set embeddedPdf Nothing . set pages [defaultPage]
<$> emptyHoodle
newPageFromOld :: Page -> Page
newPageFromOld page =
Page
{ page_dim = page_dim page,
page_bkg = page_bkg page,
page_layers = [emptyLayer]
}
|
30cd97eabac5158b78e546a263efc7d63c9d42f185efda0d2ccac2dec81f7567 | schemedoc/implementation-metadata | pixie.scm | (short-title "Pixie")
(title "Pixie Scheme")
(homepage-url "")
(person "Jay Reynolds Freeman")
(features)
| null | https://raw.githubusercontent.com/schemedoc/implementation-metadata/6280d9c4c73833dc5bd1c9bef9b45be6ea5beb68/schemes/pixie.scm | scheme | (short-title "Pixie")
(title "Pixie Scheme")
(homepage-url "")
(person "Jay Reynolds Freeman")
(features)
| |
b535e3759b2451c3bf711dea3d6006c115de5206a8288ca976a27de4ec289815 | con-kitty/categorifier-c | RandomExpressions.hs | # LANGUAGE ApplicativeDo #
{-# LANGUAGE OverloadedStrings #-}
# LANGUAGE QuasiQuotes #
# LANGUAGE RecordWildCards #
- Regular tests :
( " test_codegen_small_exprs " , " -t 50 -i 1000 -m 1 " )
( " test_codegen_little_exprs " , " -t 50 -i 1000 -m 2 " )
( " test_codegen_medium_exprs " , " -t 40 -i 500 -m 6 " )
( " test_codegen_large_exprs " , " -t 35 -i 500 -m 16 " )
( " test_codegen_huge_exprs " , " -t 30 -i 500 -m 64 " )
- Long tests :
( " test_codegen_long_small_exprs " , " -t 1000 -i 10000 -m 1 " )
( " test_codegen_long_little_exprs " , " -t 500 -i 10000 -m 2 " )
( " test_codegen_long_medium_exprs " , " -t 100 -i 10000 -m 6 " )
( " test_codegen_long_large_exprs " , " -t 50 -i 100000 -m 16 " )
- Regular tests:
("test_codegen_small_exprs", "-t 50 -i 1000 -m 1")
("test_codegen_little_exprs", "-t 50 -i 1000 -m 2")
("test_codegen_medium_exprs", "-t 40 -i 500 -m 6")
("test_codegen_large_exprs", "-t 35 -i 500 -m 16")
("test_codegen_huge_exprs", "-t 30 -i 500 -m 64")
- Long tests:
("test_codegen_long_small_exprs", "-t 1000 -i 10000 -m 1")
("test_codegen_long_little_exprs", "-t 500 -i 10000 -m 2")
("test_codegen_long_medium_exprs", "-t 100 -i 10000 -m 6")
("test_codegen_long_large_exprs", "-t 50 -i 100000 -m 16")
-}
module Main
( main,
)
where
import qualified Categorifier.C.Hedgehog.Options as Options
import qualified Categorifier.C.Hedgehog.Paths as Paths
import qualified Categorifier.C.KGenGenerate.Test.Plugin as Plugin
import Control.Applicative ((<**>))
import Control.Monad.Extra (join, when, whenJust)
import Data.IORef (modifyIORef', newIORef, readIORef)
import GHC.IO.Encoding (setLocaleEncoding, utf8)
import qualified Hedgehog as H
import Options.Applicative
( Parser,
ParserInfo,
auto,
execParser,
flag,
fullDesc,
header,
help,
helper,
info,
long,
metavar,
option,
progDesc,
short,
value,
)
import PyF (fmt)
import System.Exit (exitFailure, exitSuccess)
import System.IO (IO)
import System.Time.Extra (offsetTime)
data Options = Options
{ optionsMaxIOPerType :: Int,
optionsNumInputRuns :: Int,
optionsSubprocess :: Plugin.SubprocessConfig,
optionsVerbose :: Plugin.QuietConfig,
-- | If set, print progress after @x@ test cases.
optionsShowProgress :: Maybe Int,
optionsHedgehog :: Options.HedgehogOptions,
optionsTestTmpDir :: Paths.TestTmpDirOptions
}
deriving (Eq, Ord, Show)
parseOptions :: Parser Options
parseOptions = do
optionsMaxIOPerType <-
option auto $
mconcat
[ long "max-ios-per-type",
short 'm',
metavar "NUM",
help "Maximum number of expression inputs and outputs of each type"
]
optionsNumInputRuns <-
option auto $
mconcat
[ long "num-input-runs",
short 'i',
metavar "NUM",
help "Number of input points to test for each expression"
]
optionsSubprocess <-
flag Plugin.OneProcess Plugin.Subprocess $
mconcat
[ long "use-subprocess",
short 'p',
help "Run generated C code in a subprocess to allow shrinking on fatal errors"
]
optionsVerbose <-
flag Plugin.Quiet Plugin.Noisy $
mconcat
[ long "verbose",
short 'v',
help "Print a lot of output along the way"
]
optionsShowProgress <-
option (Just <$> auto) $
mconcat
[ long "show-progress",
value Nothing,
help "Show progress after x test cases"
]
optionsHedgehog <- Options.parseHedgehogOptions
optionsTestTmpDir <- Paths.parseTestTmpDirOptions
pure Options {..}
opts0 :: ParserInfo Options
opts0 =
info
(parseOptions <**> helper)
( fullDesc
<> progDesc desc
<> header "hedgehog-plugin: randomized testing for the test code-generation system"
)
where
desc =
[fmt|
This program tests the code-generation system by generating random
expressions, code-generating the corresponding C code, running inputs through
both the C and the original Haskell and comparing the results. The randomized
generation is done in a way that allows the expressions to be shrunk to
minimal reproducible failure cases.
The limiting factor for this program is basically peak memory consumption. As
hedgehog generates larger and larger expressions, you're more likely to
encounter an out-of-memory failure. All three input parameters correlate with
increased memory consumption, so your best bet is probably to run some tests
with many small expressions, some tests with only a few huge expressions and
some tests with a few small expressions but many inputs.
If you encounter a fatal error like SIGFPE, please re-run the test using the
'--use-subprocess' flag to run generated C code in a subprocess whose failure
can be analyzed.
|]
main :: IO ()
main = do
setLocaleEncoding utf8
flags .
opts <- execParser opts0
path <- Paths.computeTestTmpDir $ optionsTestTmpDir opts
-- Run the tests.
result <- testn opts path
if result
then exitSuccess
else exitFailure
where
testn
Options {optionsHedgehog = {..}, ..}
pth = do
putStrLn
[fmt|
Running {show optionsNumTestExprs} plugin-based tests on randomized expressions.
Each expression will be run on {show optionsNumInputRuns} input points.
Each expression may have up to {show optionsMaxIOPerType} input and output variables.
|]
counter <- newIORef 0
timeElapsed <- offsetTime
testcaseCount <- newIORef @Int 0
let config =
Plugin.PluginTestConfig
{ pluginTestQuiet = optionsVerbose,
pluginTestSubprocess = optionsSubprocess,
pluginTestTopDir = pth
}
afterTestCase = whenJust optionsShowProgress $ \x -> do
cnt <- modifyIORef' testcaseCount (+ 1) *> readIORef testcaseCount
when (cnt `mod` x == 0) $ do
elapsed <- timeElapsed
putStrLn
[fmt|Finished {show cnt} out of {show optionsNumTestExprs} test cases.
Time elapsed: {show elapsed}s|]
property =
H.withTests (fromIntegral optionsNumTestExprs)
. H.withShrinks (fromIntegral optionsMaxShrinks)
$ Plugin.pluginTest
config
counter
optionsNumInputRuns
optionsMaxIOPerType
afterTestCase
Options.checkRNG "Codegen test" hedgeopt property
| null | https://raw.githubusercontent.com/con-kitty/categorifier-c/a34ff2603529b4da7ad6ffe681dad095f102d1b9/tests/random_expressions/RandomExpressions.hs | haskell | # LANGUAGE OverloadedStrings #
| If set, print progress after @x@ test cases.
use-subprocess' flag to run generated C code in a subprocess whose failure
Run the tests. | # LANGUAGE ApplicativeDo #
# LANGUAGE QuasiQuotes #
# LANGUAGE RecordWildCards #
- Regular tests :
( " test_codegen_small_exprs " , " -t 50 -i 1000 -m 1 " )
( " test_codegen_little_exprs " , " -t 50 -i 1000 -m 2 " )
( " test_codegen_medium_exprs " , " -t 40 -i 500 -m 6 " )
( " test_codegen_large_exprs " , " -t 35 -i 500 -m 16 " )
( " test_codegen_huge_exprs " , " -t 30 -i 500 -m 64 " )
- Long tests :
( " test_codegen_long_small_exprs " , " -t 1000 -i 10000 -m 1 " )
( " test_codegen_long_little_exprs " , " -t 500 -i 10000 -m 2 " )
( " test_codegen_long_medium_exprs " , " -t 100 -i 10000 -m 6 " )
( " test_codegen_long_large_exprs " , " -t 50 -i 100000 -m 16 " )
- Regular tests:
("test_codegen_small_exprs", "-t 50 -i 1000 -m 1")
("test_codegen_little_exprs", "-t 50 -i 1000 -m 2")
("test_codegen_medium_exprs", "-t 40 -i 500 -m 6")
("test_codegen_large_exprs", "-t 35 -i 500 -m 16")
("test_codegen_huge_exprs", "-t 30 -i 500 -m 64")
- Long tests:
("test_codegen_long_small_exprs", "-t 1000 -i 10000 -m 1")
("test_codegen_long_little_exprs", "-t 500 -i 10000 -m 2")
("test_codegen_long_medium_exprs", "-t 100 -i 10000 -m 6")
("test_codegen_long_large_exprs", "-t 50 -i 100000 -m 16")
-}
module Main
( main,
)
where
import qualified Categorifier.C.Hedgehog.Options as Options
import qualified Categorifier.C.Hedgehog.Paths as Paths
import qualified Categorifier.C.KGenGenerate.Test.Plugin as Plugin
import Control.Applicative ((<**>))
import Control.Monad.Extra (join, when, whenJust)
import Data.IORef (modifyIORef', newIORef, readIORef)
import GHC.IO.Encoding (setLocaleEncoding, utf8)
import qualified Hedgehog as H
import Options.Applicative
( Parser,
ParserInfo,
auto,
execParser,
flag,
fullDesc,
header,
help,
helper,
info,
long,
metavar,
option,
progDesc,
short,
value,
)
import PyF (fmt)
import System.Exit (exitFailure, exitSuccess)
import System.IO (IO)
import System.Time.Extra (offsetTime)
data Options = Options
{ optionsMaxIOPerType :: Int,
optionsNumInputRuns :: Int,
optionsSubprocess :: Plugin.SubprocessConfig,
optionsVerbose :: Plugin.QuietConfig,
optionsShowProgress :: Maybe Int,
optionsHedgehog :: Options.HedgehogOptions,
optionsTestTmpDir :: Paths.TestTmpDirOptions
}
deriving (Eq, Ord, Show)
parseOptions :: Parser Options
parseOptions = do
optionsMaxIOPerType <-
option auto $
mconcat
[ long "max-ios-per-type",
short 'm',
metavar "NUM",
help "Maximum number of expression inputs and outputs of each type"
]
optionsNumInputRuns <-
option auto $
mconcat
[ long "num-input-runs",
short 'i',
metavar "NUM",
help "Number of input points to test for each expression"
]
optionsSubprocess <-
flag Plugin.OneProcess Plugin.Subprocess $
mconcat
[ long "use-subprocess",
short 'p',
help "Run generated C code in a subprocess to allow shrinking on fatal errors"
]
optionsVerbose <-
flag Plugin.Quiet Plugin.Noisy $
mconcat
[ long "verbose",
short 'v',
help "Print a lot of output along the way"
]
optionsShowProgress <-
option (Just <$> auto) $
mconcat
[ long "show-progress",
value Nothing,
help "Show progress after x test cases"
]
optionsHedgehog <- Options.parseHedgehogOptions
optionsTestTmpDir <- Paths.parseTestTmpDirOptions
pure Options {..}
opts0 :: ParserInfo Options
opts0 =
info
(parseOptions <**> helper)
( fullDesc
<> progDesc desc
<> header "hedgehog-plugin: randomized testing for the test code-generation system"
)
where
desc =
[fmt|
This program tests the code-generation system by generating random
expressions, code-generating the corresponding C code, running inputs through
both the C and the original Haskell and comparing the results. The randomized
generation is done in a way that allows the expressions to be shrunk to
minimal reproducible failure cases.
The limiting factor for this program is basically peak memory consumption. As
hedgehog generates larger and larger expressions, you're more likely to
encounter an out-of-memory failure. All three input parameters correlate with
increased memory consumption, so your best bet is probably to run some tests
with many small expressions, some tests with only a few huge expressions and
some tests with a few small expressions but many inputs.
If you encounter a fatal error like SIGFPE, please re-run the test using the
can be analyzed.
|]
main :: IO ()
main = do
setLocaleEncoding utf8
flags .
opts <- execParser opts0
path <- Paths.computeTestTmpDir $ optionsTestTmpDir opts
result <- testn opts path
if result
then exitSuccess
else exitFailure
where
testn
Options {optionsHedgehog = {..}, ..}
pth = do
putStrLn
[fmt|
Running {show optionsNumTestExprs} plugin-based tests on randomized expressions.
Each expression will be run on {show optionsNumInputRuns} input points.
Each expression may have up to {show optionsMaxIOPerType} input and output variables.
|]
counter <- newIORef 0
timeElapsed <- offsetTime
testcaseCount <- newIORef @Int 0
let config =
Plugin.PluginTestConfig
{ pluginTestQuiet = optionsVerbose,
pluginTestSubprocess = optionsSubprocess,
pluginTestTopDir = pth
}
afterTestCase = whenJust optionsShowProgress $ \x -> do
cnt <- modifyIORef' testcaseCount (+ 1) *> readIORef testcaseCount
when (cnt `mod` x == 0) $ do
elapsed <- timeElapsed
putStrLn
[fmt|Finished {show cnt} out of {show optionsNumTestExprs} test cases.
Time elapsed: {show elapsed}s|]
property =
H.withTests (fromIntegral optionsNumTestExprs)
. H.withShrinks (fromIntegral optionsMaxShrinks)
$ Plugin.pluginTest
config
counter
optionsNumInputRuns
optionsMaxIOPerType
afterTestCase
Options.checkRNG "Codegen test" hedgeopt property
|
7f105f0820bf7864d6268d56fadf493f5fcddeba9709965c47dc64960f427c93 | conal/functor-combo | MemoTrie.hs | # LANGUAGE TypeOperators , TypeFamilies , UndecidableInstances , CPP
#
#-}
# OPTIONS_GHC -Wall #
# OPTIONS_GHC -fno - warn - unused - binds -fno - warn - unused - imports #
----------------------------------------------------------------------
-- |
Module : FunctorCombo . MemoTrie
Copyright : ( c ) Conal Elliott 2010
-- License : BSD3
--
-- Maintainer :
-- Stability : experimental
--
-- Functor-based memo tries
--
----------------------------------------------------------------------
module FunctorCombo.MemoTrie
(
HasTrie(..),memo,memo2,memo3
) where
I think this module has split into StrictMemo and NonstrictMemo
#define NonstrictMemo
import Control.Arrow (first)
import Control.Applicative ((<$>))
import qualified Data.IntTrie as IT -- data-inttrie
import Data.Tree
TypeCompose
#ifdef NonstrictMemo
import Data.Lub
#endif
import FunctorCombo.Functor
import FunctorCombo.Regular
{--------------------------------------------------------------------
Misc
--------------------------------------------------------------------}
type Unop a = a -> a
bool :: a -> a -> Bool -> a
bool t e b = if b then t else e
{--------------------------------------------------------------------
Class
--------------------------------------------------------------------}
infixr 0 :->:
#ifdef NonstrictMemo
data Trie k v = Trie v (STrie k v)
type k :->: v = Trie k v
-- Bottom
bottom :: a
bottom = error "MemoTrie: evaluated bottom. Oops!"
-- | Create the trie for the entire domain of a function
trie :: HasLub(v) => HasTrie k => (k -> v) -> (k :->: v)
trie f = Trie (f bottom) (sTrie f)
-- | Convert k trie to k function, i.e., access k field of the trie
untrie :: HasLub(v) => HasTrie k => (k :->: v) -> (k -> v)
untrie (Trie b t) = const b `lub` sUntrie t
#else
type Trie k = STrie k
type k :->: v = k :-> v
-- Bogus HasLub constraint
#define HasLub(v) ()
trie :: HasTrie k => (k -> v) -> (k :->: v)
trie = sTrie
untrie :: HasTrie k => (k :->: v) -> (k -> v)
untrie = sUntrie
#endif
-- | Memo trie from k to v
type k :-> v = STrie k v
-- | Domain types with associated memo tries
class HasTrie k where
-- | Representation of trie with domain type @a@
type STrie k :: * -> *
-- | Create the trie for the entire domain of a function
sTrie :: HasLub(v) => (k -> v) -> (k :-> v)
-- | Convert k trie to k function, i.e., access k field of the trie
sUntrie :: HasLub(v) => (k :-> v) -> (k -> v)
-- -- | List the trie elements. Order of keys (@:: k@) is always the same.
-- enumerate :: HasLub(v) => (k :-> v) -> [(k,v)]
-- -- | Domain elements of a trie
-- domain :: HasTrie a => [a]
domain = map ( enumerate ( trie ( const oops ) ) )
-- where
-- oops = error "Data.MemoTrie.domain: range element evaluated."
-- TODO: what about enumerate and strict/nonstrict?
{--------------------------------------------------------------------
Memo functions
--------------------------------------------------------------------}
-- | Trie-based function memoizer
memo :: HasLub(v) => HasTrie k => Unop (k -> v)
memo = untrie . trie
| Memoize a binary function , on its first argument and then on its
second . Take care to exploit any partial evaluation .
memo2 :: HasLub(a) => (HasTrie s,HasTrie t) => Unop (s -> t -> a)
-- | Memoize a ternary function on successive arguments. Take care to
-- exploit any partial evaluation.
memo3 :: HasLub(a) => (HasTrie r,HasTrie s,HasTrie t) => Unop (r -> s -> t -> a)
| Lift a memoizer to work with one more argument .
mup :: HasLub(c) => HasTrie t => (b -> c) -> (t -> b) -> (t -> c)
mup mem f = memo (mem . f)
memo2 = mup memo
memo3 = mup memo2
{--------------------------------------------------------------------
Instances
--------------------------------------------------------------------}
instance HasTrie () where
type STrie () = Id
sTrie f = Id (f ())
sUntrie (Id v) = const v
-- enumerate (Id a) = [((),a)]
instance (HasTrie a, HasTrie b) => HasTrie (Either a b) where
type STrie (Either a b) = Trie a :*: Trie b
sTrie f = trie (f . Left) :*: trie (f . Right)
sUntrie (ta :*: tb) = untrie ta `either` untrie tb
-- enumerate (ta :*: tb) = enum' Left ta `weave` enum' Right tb
-- enum' :: HasLub(b) => HasTrie a => (a -> a') -> (a :->: b) -> [(a', b)]
-- enum' f = (fmap.first) f . enumerate
-- weave :: [a] -> [a] -> [a]
-- [] `weave` as = as
-- as `weave` [] = as
-- (a:as) `weave` bs = a : (bs `weave` as)
-- To do: rethink enumerate and come back to it. How might enumeration
work in the presence of nonstrict memo tries ? Maybe lub the
-- approximation into each of the values enumerated from the strict memo tries.
-- Would it help any??
instance (HasTrie a, HasTrie b) => HasTrie (a , b) where
type STrie (a , b) = Trie a :. Trie b
sTrie f = O (trie (trie . curry f))
sUntrie (O tt) = uncurry (untrie . untrie tt)
-- enumerate (O tt) =
-- [ ((a,b),x) | (a,t) <- enumerate tt , (b,x) <- enumerate t ]
-- Oops:
--
Could not deduce ( HasLub ( Trie b v ) ) from the context ( HasLub v )
-- arising from a use of `trie'
--
Could not deduce ( HasLub ( Trie b v ) ) from the context ( HasLub v )
-- arising from a use of `untrie'
-- Eep. How to fix this one?
# define HasTrieIsomorph(Context , Type , , toIso , fromIso ) \
instance Context = > HasTrie ( Type ) where { \
type ( Type ) = Trie ( ) ; \
sTrie f = ( f . ( fromIso ) ) ; \
sUntrie t = sUntrie t . ( toIso ) ; \
enumerate = ( result.fmap.first ) ( fromIso ) enumerate ; \
}
HasTrieIsomorph ( ( ) , , Either ( ) ( )
, bool ( Left ( ) ) ( Right ( ) )
, either ( \ ( ) - > True ) ( \ ( ) - > False ) )
HasTrieIsomorph((HasTrie a , HasTrie b , HasTrie c ) , ( a , b , c ) , ( ( a , b),c )
, \ ( a , b , c ) - > ( ( a , b),c ) , \ ( ( a , b),c ) - > ( a , b , c ) )
HasTrieIsomorph((HasTrie a , HasTrie b , HasTrie c , HasTrie d )
, ( a , b , c , d ) , ( ( a , b , c),d )
, \ ( a , b , c , d ) - > ( ( a , b , c),d ) , \ ( ( a , b , c),d ) - > ( a , b , c , d ) )
-- As well as the functor combinators themselves
HasTrieIsomorph ( , Const x a , x , , Const )
HasTrieIsomorph ( HasTrie a , I d a , a , unId , I d )
HasTrieIsomorph ( ( HasTrie ( f a ) , HasTrie ( g a ) )
, ( f :* : g ) a , ( f a , g a )
, \ ( fa :* : ) - > ( fa , ) , \ ( fa , ) - > ( fa :* : ) )
HasTrieIsomorph ( ( HasTrie ( f a ) , HasTrie ( g a ) )
, ( f : + : g ) a , Either ( f a ) ( g a )
, eitherF Left Right , either )
HasTrieIsomorph ( HasTrie ( g ( f a ) )
, ( g : . f ) a , g ( f a ) , unO , O )
-- newtype a v = ListTrie ( PF [ a ] [ a ] :-> v )
-- instance HasTrie a = > HasTrie [ a ] where
-- type [ a ] = ListTrie a
-- f = ( trie ( f . wrap ) )
-- sUntrie ( ListTrie t ) = sUntrie t . unwrap
-- enumerate ( ListTrie t ) = ( result.fmap.first ) wrap enumerate $ t
-- HasTrieIsomorph ( HasTrie ( PF ( [ a ] ) ( [ a ] ) :-> : v )
-- , a v , PF ( [ a ] ) ( [ a ] ) :-> : v
-- , \ ( ListTrie w ) - > w , )
-- Works . Now abstract into a macro
# define HasTrieRegular(Context , Type , TrieType , TrieCon ) \
newtype TrieType v = TrieCon ( PF ( Type ) ( Type ) :-> : v ) ; \
instance Context = > HasTrie ( Type ) where { \
type ( Type ) = TrieType ; \
sTrie f = TrieCon ( ( f . wrap ) ) ; \
sUntrie ( TrieCon t ) = sUntrie t . unwrap ; \
enumerate ( TrieCon t ) = ( result.fmap.first ) wrap enumerate t ; \
} ; \
HasTrieIsomorph ( HasTrie ( PF ( Type ) ( Type ) :-> : v ) \
, TrieType v , PF ( Type ) ( Type ) :-> : v \
, \ ( TrieCon w ) - > w , TrieCon )
-- For instance ,
-- HasTrieRegular(HasTrie a , [ a ] , ListTrie a , ListTrie )
-- HasTrieRegular(HasTrie a , Tree a , TreeTrie a , )
-- Simplify a bit with a macro for unary regular types .
-- Make similar defs for binary etc as needed .
# define HasTrieRegular1(TypeCon , TrieCon ) \
HasTrieRegular(HasTrie a , a , TrieCon a , TrieCon )
( [ ] , ListTrie )
HasTrieRegular1(Tree , TreeTrie )
-- HasTrieIsomorph(Context , Type , , toIso , fromIso )
-- HasTrieIsomorph ( HasTrie ( PF [ a ] [ a ] :-> : v )
-- , a v , PF [ a ] [ a ] :-> : v
-- , \ ( ListTrie w ) - > w , )
enumerateEnum : : ( , , ) = > ( k :-> : v ) - > [ ( k , v ) ]
enumerateEnum t = [ ( k , f k ) | k < - [ 0 .. ] ` weave ` [ -1 , -2 .. ] ]
where
f = untrie t
# define HasTrieIntegral(Type ) \
instance HasTrie Type where { \
type STrie Type = IT.IntTrie ; \
= ( < $ > IT.identity ) ; \
sUntrie = IT.apply ; \
enumerate = enumerateEnum ; \
}
HasTrieIntegral(Int )
HasTrieIntegral(Integer )
-- higher - order functions
HasTrieIsomorph((HasTrie a , ( a :-> : b ) ) , a - > b , a :-> : b , trie , )
{ -
{ --------------------------------------------------------------------
Testing
-------------------------------------------------------------------
#define HasTrieIsomorph(Context,Type,IsoType,toIso,fromIso) \
instance Context => HasTrie (Type) where { \
type STrie (Type) = Trie (IsoType); \
sTrie f = sTrie (f . (fromIso)); \
sUntrie t = sUntrie t . (toIso); \
enumerate = (result.fmap.first) (fromIso) enumerate; \
}
HasTrieIsomorph( (), Bool, Either () ()
, bool (Left ()) (Right ())
, either (\ () -> True) (\ () -> False))
HasTrieIsomorph((HasTrie a, HasTrie b, HasTrie c), (a,b,c), ((a,b),c)
, \ (a,b,c) -> ((a,b),c), \ ((a,b),c) -> (a,b,c))
HasTrieIsomorph((HasTrie a, HasTrie b, HasTrie c, HasTrie d)
, (a,b,c,d), ((a,b,c),d)
, \ (a,b,c,d) -> ((a,b,c),d), \ ((a,b,c),d) -> (a,b,c,d))
-- As well as the functor combinators themselves
HasTrieIsomorph( HasTrie x, Const x a, x, getConst, Const )
HasTrieIsomorph( HasTrie a, Id a, a, unId, Id )
HasTrieIsomorph( (HasTrie (f a), HasTrie (g a))
, (f :*: g) a, (f a,g a)
, \ (fa :*: ga) -> (fa,ga), \ (fa,ga) -> (fa :*: ga) )
HasTrieIsomorph( (HasTrie (f a), HasTrie (g a))
, (f :+: g) a, Either (f a) (g a)
, eitherF Left Right, either InL InR )
HasTrieIsomorph( HasTrie (g (f a))
, (g :. f) a, g (f a) , unO, O )
-- newtype ListTrie a v = ListTrie (PF [a] [a] :-> v)
-- instance HasTrie a => HasTrie [a] where
-- type STrie [a] = ListTrie a
-- sTrie f = ListTrie (trie (f . wrap))
-- sUntrie (ListTrie t) = sUntrie t . unwrap
-- enumerate (ListTrie t) = (result.fmap.first) wrap enumerate $ t
-- HasTrieIsomorph( HasTrie (PF ([a]) ([a]) :->: v)
-- , ListTrie a v, PF ([a]) ([a]) :->: v
-- , \ (ListTrie w) -> w, ListTrie )
-- Works. Now abstract into a macro
#define HasTrieRegular(Context,Type,TrieType,TrieCon) \
newtype TrieType v = TrieCon (PF (Type) (Type) :->: v); \
instance Context => HasTrie (Type) where { \
type STrie (Type) = TrieType; \
sTrie f = TrieCon (sTrie (f . wrap)); \
sUntrie (TrieCon t) = sUntrie t . unwrap; \
enumerate (TrieCon t) = (result.fmap.first) wrap enumerate t; \
}; \
HasTrieIsomorph( HasTrie (PF (Type) (Type) :->: v) \
, TrieType v, PF (Type) (Type) :->: v \
, \ (TrieCon w) -> w, TrieCon )
-- For instance,
-- HasTrieRegular(HasTrie a, [a] , ListTrie a, ListTrie)
-- HasTrieRegular(HasTrie a, Tree a, TreeTrie a, TreeTrie)
-- Simplify a bit with a macro for unary regular types.
-- Make similar defs for binary etc as needed.
#define HasTrieRegular1(TypeCon,TrieCon) \
HasTrieRegular(HasTrie a, TypeCon a, TrieCon a, TrieCon)
HasTrieRegular1([] , ListTrie)
HasTrieRegular1(Tree, TreeTrie)
-- HasTrieIsomorph(Context,Type,IsoType,toIso,fromIso)
-- HasTrieIsomorph( HasTrie (PF [a] [a] :->: v)
-- , ListTrie a v, PF [a] [a] :->: v
-- , \ (ListTrie w) -> w, ListTrie )
enumerateEnum :: (Enum k, Num k, HasTrie k) => (k :->: v) -> [(k,v)]
enumerateEnum t = [(k, f k) | k <- [0 ..] `weave` [-1, -2 ..]]
where
f = untrie t
#define HasTrieIntegral(Type) \
instance HasTrie Type where { \
type STrie Type = IT.IntTrie; \
sTrie = (<$> IT.identity); \
sUntrie = IT.apply; \
enumerate = enumerateEnum; \
}
HasTrieIntegral(Int)
HasTrieIntegral(Integer)
-- Memoizing higher-order functions
HasTrieIsomorph((HasTrie a, HasTrie (a :->: b)), a -> b, a :->: b, trie, untrie)
{-
{--------------------------------------------------------------------
Testing
--------------------------------------------------------------------}
fib :: Integer -> Integer
fib m = mfib m
where
mfib = memo fib'
fib' 0 = 0
fib' 1 = 1
fib' n = mfib (n-1) + mfib (n-2)
The eta - redex in fib is important to prevent a CAF .
-}
ft1 :: (Bool -> a) -> [a]
ft1 f = [f False, f True]
f1 :: Bool -> Int
f1 False = 0
f1 True = 1
trie1a :: HasTrie a => (Bool -> a) :->: [a]
trie1a = trie ft1
trie1b :: HasTrie a => (Bool :->: a) :->: [a]
trie1b = trie1a
trie1c :: HasTrie a => (Either () () :->: a) :->: [a]
trie1c = trie1a
trie1d :: HasTrie a => ((Trie () :*: Trie ()) a) :->: [a]
trie1d = trie1a
trie1e :: HasTrie a => (Trie () a, Trie () a) :->: [a]
trie1e = trie1a
trie1f :: HasTrie a => (() :->: a, () :->: a) :->: [a]
trie1f = trie1a
trie1g :: HasTrie a => (a, a) :->: [a]
trie1g = trie1a
trie1h :: HasTrie a => (Trie a :. Trie a) [a]
trie1h = trie1a
trie1i :: HasTrie a => a :->: a :->: [a]
trie1i = unO trie1a
ft2 :: ([Bool] -> Int) -> Int
ft2 f = f (alts 15)
alts :: Int -> [Bool]
alts n = take n (cycle [True,False])
f2 :: [Bool] -> Int
f2 = length . filter id
Memoization fails :
* FunctorCombo . ft2 f2
8
* FunctorCombo . MemoTrie > memo ft2 f2
-- ... (hang forever) ...
-- Would nonstrict memoization work? <-memoization/>
f3 :: Bool -> Integer
f3 = const 3
* FunctorCombo . f3 undefined
3
* FunctorCombo . MemoTrie > memo f3 undefined
-- *** Exception: Prelude.undefined
f4 :: () -> Integer
f4 = const 4
* FunctorCombo . f4 undefined
4
* FunctorCombo . MemoTrie > memo f4 undefined
4
f5 :: ((),()) -> Integer
f5 = const 5
* FunctorCombo . f5 undefined
5
* FunctorCombo . MemoTrie > memo f5 undefined
5
f6 :: Either () () -> Integer
f6 = const 6
* FunctorCombo . f6 undefined
6
* FunctorCombo . MemoTrie > memo f6 undefined
-- *** Exception: Prelude.undefined
-- Aha!
t6 :: Either () () :-> Integer
t6 = trie f6
* FunctorCombo . MemoTrie > t6
-- Id 6 :*: Id 6
-}
| null | https://raw.githubusercontent.com/conal/functor-combo/e83af37cc2cc3b9a88dae032e19c731cf7b7b63d/src/FunctorCombo/MemoTrie.hs | haskell | --------------------------------------------------------------------
|
License : BSD3
Maintainer :
Stability : experimental
Functor-based memo tries
--------------------------------------------------------------------
data-inttrie
-------------------------------------------------------------------
Misc
-------------------------------------------------------------------
-------------------------------------------------------------------
Class
-------------------------------------------------------------------
Bottom
| Create the trie for the entire domain of a function
| Convert k trie to k function, i.e., access k field of the trie
Bogus HasLub constraint
| Memo trie from k to v
| Domain types with associated memo tries
| Representation of trie with domain type @a@
| Create the trie for the entire domain of a function
| Convert k trie to k function, i.e., access k field of the trie
-- | List the trie elements. Order of keys (@:: k@) is always the same.
enumerate :: HasLub(v) => (k :-> v) -> [(k,v)]
-- | Domain elements of a trie
domain :: HasTrie a => [a]
where
oops = error "Data.MemoTrie.domain: range element evaluated."
TODO: what about enumerate and strict/nonstrict?
-------------------------------------------------------------------
Memo functions
-------------------------------------------------------------------
| Trie-based function memoizer
| Memoize a ternary function on successive arguments. Take care to
exploit any partial evaluation.
-------------------------------------------------------------------
Instances
-------------------------------------------------------------------
enumerate (Id a) = [((),a)]
enumerate (ta :*: tb) = enum' Left ta `weave` enum' Right tb
enum' :: HasLub(b) => HasTrie a => (a -> a') -> (a :->: b) -> [(a', b)]
enum' f = (fmap.first) f . enumerate
weave :: [a] -> [a] -> [a]
[] `weave` as = as
as `weave` [] = as
(a:as) `weave` bs = a : (bs `weave` as)
To do: rethink enumerate and come back to it. How might enumeration
approximation into each of the values enumerated from the strict memo tries.
Would it help any??
enumerate (O tt) =
[ ((a,b),x) | (a,t) <- enumerate tt , (b,x) <- enumerate t ]
Oops:
arising from a use of `trie'
arising from a use of `untrie'
Eep. How to fix this one?
As well as the functor combinators themselves
newtype a v = ListTrie ( PF [ a ] [ a ] :-> v )
instance HasTrie a = > HasTrie [ a ] where
type [ a ] = ListTrie a
f = ( trie ( f . wrap ) )
sUntrie ( ListTrie t ) = sUntrie t . unwrap
enumerate ( ListTrie t ) = ( result.fmap.first ) wrap enumerate $ t
HasTrieIsomorph ( HasTrie ( PF ( [ a ] ) ( [ a ] ) :-> : v )
, a v , PF ( [ a ] ) ( [ a ] ) :-> : v
, \ ( ListTrie w ) - > w , )
Works . Now abstract into a macro
For instance ,
HasTrieRegular(HasTrie a , [ a ] , ListTrie a , ListTrie )
HasTrieRegular(HasTrie a , Tree a , TreeTrie a , )
Simplify a bit with a macro for unary regular types .
Make similar defs for binary etc as needed .
HasTrieIsomorph(Context , Type , , toIso , fromIso )
HasTrieIsomorph ( HasTrie ( PF [ a ] [ a ] :-> : v )
, a v , PF [ a ] [ a ] :-> : v
, \ ( ListTrie w ) - > w , )
higher - order functions
------------------------------------------------------------------
-----------------------------------------------------------------
As well as the functor combinators themselves
newtype ListTrie a v = ListTrie (PF [a] [a] :-> v)
instance HasTrie a => HasTrie [a] where
type STrie [a] = ListTrie a
sTrie f = ListTrie (trie (f . wrap))
sUntrie (ListTrie t) = sUntrie t . unwrap
enumerate (ListTrie t) = (result.fmap.first) wrap enumerate $ t
HasTrieIsomorph( HasTrie (PF ([a]) ([a]) :->: v)
, ListTrie a v, PF ([a]) ([a]) :->: v
, \ (ListTrie w) -> w, ListTrie )
Works. Now abstract into a macro
For instance,
HasTrieRegular(HasTrie a, [a] , ListTrie a, ListTrie)
HasTrieRegular(HasTrie a, Tree a, TreeTrie a, TreeTrie)
Simplify a bit with a macro for unary regular types.
Make similar defs for binary etc as needed.
HasTrieIsomorph(Context,Type,IsoType,toIso,fromIso)
HasTrieIsomorph( HasTrie (PF [a] [a] :->: v)
, ListTrie a v, PF [a] [a] :->: v
, \ (ListTrie w) -> w, ListTrie )
Memoizing higher-order functions
{--------------------------------------------------------------------
Testing
-------------------------------------------------------------------
... (hang forever) ...
Would nonstrict memoization work? <-memoization/>
*** Exception: Prelude.undefined
*** Exception: Prelude.undefined
Aha!
Id 6 :*: Id 6 | # LANGUAGE TypeOperators , TypeFamilies , UndecidableInstances , CPP
#
#-}
# OPTIONS_GHC -Wall #
# OPTIONS_GHC -fno - warn - unused - binds -fno - warn - unused - imports #
Module : FunctorCombo . MemoTrie
Copyright : ( c ) Conal Elliott 2010
module FunctorCombo.MemoTrie
(
HasTrie(..),memo,memo2,memo3
) where
I think this module has split into StrictMemo and NonstrictMemo
#define NonstrictMemo
import Control.Arrow (first)
import Control.Applicative ((<$>))
import Data.Tree
TypeCompose
#ifdef NonstrictMemo
import Data.Lub
#endif
import FunctorCombo.Functor
import FunctorCombo.Regular
type Unop a = a -> a
bool :: a -> a -> Bool -> a
bool t e b = if b then t else e
infixr 0 :->:
#ifdef NonstrictMemo
data Trie k v = Trie v (STrie k v)
type k :->: v = Trie k v
bottom :: a
bottom = error "MemoTrie: evaluated bottom. Oops!"
trie :: HasLub(v) => HasTrie k => (k -> v) -> (k :->: v)
trie f = Trie (f bottom) (sTrie f)
untrie :: HasLub(v) => HasTrie k => (k :->: v) -> (k -> v)
untrie (Trie b t) = const b `lub` sUntrie t
#else
type Trie k = STrie k
type k :->: v = k :-> v
#define HasLub(v) ()
trie :: HasTrie k => (k -> v) -> (k :->: v)
trie = sTrie
untrie :: HasTrie k => (k :->: v) -> (k -> v)
untrie = sUntrie
#endif
type k :-> v = STrie k v
class HasTrie k where
type STrie k :: * -> *
sTrie :: HasLub(v) => (k -> v) -> (k :-> v)
sUntrie :: HasLub(v) => (k :-> v) -> (k -> v)
domain = map ( enumerate ( trie ( const oops ) ) )
memo :: HasLub(v) => HasTrie k => Unop (k -> v)
memo = untrie . trie
| Memoize a binary function , on its first argument and then on its
second . Take care to exploit any partial evaluation .
memo2 :: HasLub(a) => (HasTrie s,HasTrie t) => Unop (s -> t -> a)
memo3 :: HasLub(a) => (HasTrie r,HasTrie s,HasTrie t) => Unop (r -> s -> t -> a)
| Lift a memoizer to work with one more argument .
mup :: HasLub(c) => HasTrie t => (b -> c) -> (t -> b) -> (t -> c)
mup mem f = memo (mem . f)
memo2 = mup memo
memo3 = mup memo2
instance HasTrie () where
type STrie () = Id
sTrie f = Id (f ())
sUntrie (Id v) = const v
instance (HasTrie a, HasTrie b) => HasTrie (Either a b) where
type STrie (Either a b) = Trie a :*: Trie b
sTrie f = trie (f . Left) :*: trie (f . Right)
sUntrie (ta :*: tb) = untrie ta `either` untrie tb
work in the presence of nonstrict memo tries ? Maybe lub the
instance (HasTrie a, HasTrie b) => HasTrie (a , b) where
type STrie (a , b) = Trie a :. Trie b
sTrie f = O (trie (trie . curry f))
sUntrie (O tt) = uncurry (untrie . untrie tt)
Could not deduce ( HasLub ( Trie b v ) ) from the context ( HasLub v )
Could not deduce ( HasLub ( Trie b v ) ) from the context ( HasLub v )
# define HasTrieIsomorph(Context , Type , , toIso , fromIso ) \
instance Context = > HasTrie ( Type ) where { \
type ( Type ) = Trie ( ) ; \
sTrie f = ( f . ( fromIso ) ) ; \
sUntrie t = sUntrie t . ( toIso ) ; \
enumerate = ( result.fmap.first ) ( fromIso ) enumerate ; \
}
HasTrieIsomorph ( ( ) , , Either ( ) ( )
, bool ( Left ( ) ) ( Right ( ) )
, either ( \ ( ) - > True ) ( \ ( ) - > False ) )
HasTrieIsomorph((HasTrie a , HasTrie b , HasTrie c ) , ( a , b , c ) , ( ( a , b),c )
, \ ( a , b , c ) - > ( ( a , b),c ) , \ ( ( a , b),c ) - > ( a , b , c ) )
HasTrieIsomorph((HasTrie a , HasTrie b , HasTrie c , HasTrie d )
, ( a , b , c , d ) , ( ( a , b , c),d )
, \ ( a , b , c , d ) - > ( ( a , b , c),d ) , \ ( ( a , b , c),d ) - > ( a , b , c , d ) )
HasTrieIsomorph ( , Const x a , x , , Const )
HasTrieIsomorph ( HasTrie a , I d a , a , unId , I d )
HasTrieIsomorph ( ( HasTrie ( f a ) , HasTrie ( g a ) )
, ( f :* : g ) a , ( f a , g a )
, \ ( fa :* : ) - > ( fa , ) , \ ( fa , ) - > ( fa :* : ) )
HasTrieIsomorph ( ( HasTrie ( f a ) , HasTrie ( g a ) )
, ( f : + : g ) a , Either ( f a ) ( g a )
, eitherF Left Right , either )
HasTrieIsomorph ( HasTrie ( g ( f a ) )
, ( g : . f ) a , g ( f a ) , unO , O )
# define HasTrieRegular(Context , Type , TrieType , TrieCon ) \
newtype TrieType v = TrieCon ( PF ( Type ) ( Type ) :-> : v ) ; \
instance Context = > HasTrie ( Type ) where { \
type ( Type ) = TrieType ; \
sTrie f = TrieCon ( ( f . wrap ) ) ; \
sUntrie ( TrieCon t ) = sUntrie t . unwrap ; \
enumerate ( TrieCon t ) = ( result.fmap.first ) wrap enumerate t ; \
} ; \
HasTrieIsomorph ( HasTrie ( PF ( Type ) ( Type ) :-> : v ) \
, TrieType v , PF ( Type ) ( Type ) :-> : v \
, \ ( TrieCon w ) - > w , TrieCon )
# define HasTrieRegular1(TypeCon , TrieCon ) \
HasTrieRegular(HasTrie a , a , TrieCon a , TrieCon )
( [ ] , ListTrie )
HasTrieRegular1(Tree , TreeTrie )
enumerateEnum : : ( , , ) = > ( k :-> : v ) - > [ ( k , v ) ]
enumerateEnum t = [ ( k , f k ) | k < - [ 0 .. ] ` weave ` [ -1 , -2 .. ] ]
where
f = untrie t
# define HasTrieIntegral(Type ) \
instance HasTrie Type where { \
type STrie Type = IT.IntTrie ; \
= ( < $ > IT.identity ) ; \
sUntrie = IT.apply ; \
enumerate = enumerateEnum ; \
}
HasTrieIntegral(Int )
HasTrieIntegral(Integer )
HasTrieIsomorph((HasTrie a , ( a :-> : b ) ) , a - > b , a :-> : b , trie , )
{ -
Testing
#define HasTrieIsomorph(Context,Type,IsoType,toIso,fromIso) \
instance Context => HasTrie (Type) where { \
type STrie (Type) = Trie (IsoType); \
sTrie f = sTrie (f . (fromIso)); \
sUntrie t = sUntrie t . (toIso); \
enumerate = (result.fmap.first) (fromIso) enumerate; \
}
HasTrieIsomorph( (), Bool, Either () ()
, bool (Left ()) (Right ())
, either (\ () -> True) (\ () -> False))
HasTrieIsomorph((HasTrie a, HasTrie b, HasTrie c), (a,b,c), ((a,b),c)
, \ (a,b,c) -> ((a,b),c), \ ((a,b),c) -> (a,b,c))
HasTrieIsomorph((HasTrie a, HasTrie b, HasTrie c, HasTrie d)
, (a,b,c,d), ((a,b,c),d)
, \ (a,b,c,d) -> ((a,b,c),d), \ ((a,b,c),d) -> (a,b,c,d))
HasTrieIsomorph( HasTrie x, Const x a, x, getConst, Const )
HasTrieIsomorph( HasTrie a, Id a, a, unId, Id )
HasTrieIsomorph( (HasTrie (f a), HasTrie (g a))
, (f :*: g) a, (f a,g a)
, \ (fa :*: ga) -> (fa,ga), \ (fa,ga) -> (fa :*: ga) )
HasTrieIsomorph( (HasTrie (f a), HasTrie (g a))
, (f :+: g) a, Either (f a) (g a)
, eitherF Left Right, either InL InR )
HasTrieIsomorph( HasTrie (g (f a))
, (g :. f) a, g (f a) , unO, O )
#define HasTrieRegular(Context,Type,TrieType,TrieCon) \
newtype TrieType v = TrieCon (PF (Type) (Type) :->: v); \
instance Context => HasTrie (Type) where { \
type STrie (Type) = TrieType; \
sTrie f = TrieCon (sTrie (f . wrap)); \
sUntrie (TrieCon t) = sUntrie t . unwrap; \
enumerate (TrieCon t) = (result.fmap.first) wrap enumerate t; \
}; \
HasTrieIsomorph( HasTrie (PF (Type) (Type) :->: v) \
, TrieType v, PF (Type) (Type) :->: v \
, \ (TrieCon w) -> w, TrieCon )
#define HasTrieRegular1(TypeCon,TrieCon) \
HasTrieRegular(HasTrie a, TypeCon a, TrieCon a, TrieCon)
HasTrieRegular1([] , ListTrie)
HasTrieRegular1(Tree, TreeTrie)
enumerateEnum :: (Enum k, Num k, HasTrie k) => (k :->: v) -> [(k,v)]
enumerateEnum t = [(k, f k) | k <- [0 ..] `weave` [-1, -2 ..]]
where
f = untrie t
#define HasTrieIntegral(Type) \
instance HasTrie Type where { \
type STrie Type = IT.IntTrie; \
sTrie = (<$> IT.identity); \
sUntrie = IT.apply; \
enumerate = enumerateEnum; \
}
HasTrieIntegral(Int)
HasTrieIntegral(Integer)
HasTrieIsomorph((HasTrie a, HasTrie (a :->: b)), a -> b, a :->: b, trie, untrie)
fib :: Integer -> Integer
fib m = mfib m
where
mfib = memo fib'
fib' 0 = 0
fib' 1 = 1
fib' n = mfib (n-1) + mfib (n-2)
The eta - redex in fib is important to prevent a CAF .
-}
ft1 :: (Bool -> a) -> [a]
ft1 f = [f False, f True]
f1 :: Bool -> Int
f1 False = 0
f1 True = 1
trie1a :: HasTrie a => (Bool -> a) :->: [a]
trie1a = trie ft1
trie1b :: HasTrie a => (Bool :->: a) :->: [a]
trie1b = trie1a
trie1c :: HasTrie a => (Either () () :->: a) :->: [a]
trie1c = trie1a
trie1d :: HasTrie a => ((Trie () :*: Trie ()) a) :->: [a]
trie1d = trie1a
trie1e :: HasTrie a => (Trie () a, Trie () a) :->: [a]
trie1e = trie1a
trie1f :: HasTrie a => (() :->: a, () :->: a) :->: [a]
trie1f = trie1a
trie1g :: HasTrie a => (a, a) :->: [a]
trie1g = trie1a
trie1h :: HasTrie a => (Trie a :. Trie a) [a]
trie1h = trie1a
trie1i :: HasTrie a => a :->: a :->: [a]
trie1i = unO trie1a
ft2 :: ([Bool] -> Int) -> Int
ft2 f = f (alts 15)
alts :: Int -> [Bool]
alts n = take n (cycle [True,False])
f2 :: [Bool] -> Int
f2 = length . filter id
Memoization fails :
* FunctorCombo . ft2 f2
8
* FunctorCombo . MemoTrie > memo ft2 f2
f3 :: Bool -> Integer
f3 = const 3
* FunctorCombo . f3 undefined
3
* FunctorCombo . MemoTrie > memo f3 undefined
f4 :: () -> Integer
f4 = const 4
* FunctorCombo . f4 undefined
4
* FunctorCombo . MemoTrie > memo f4 undefined
4
f5 :: ((),()) -> Integer
f5 = const 5
* FunctorCombo . f5 undefined
5
* FunctorCombo . MemoTrie > memo f5 undefined
5
f6 :: Either () () -> Integer
f6 = const 6
* FunctorCombo . f6 undefined
6
* FunctorCombo . MemoTrie > memo f6 undefined
t6 :: Either () () :-> Integer
t6 = trie f6
* FunctorCombo . MemoTrie > t6
-}
|
42a8c4c77c3a179a24b6a2de9452d5acc9b7d7340e0c3c0c4cfd9f806f70acdc | graninas/Hydra | Interpreter.hs | module Hydra.Core.SqlDB.Interpreter where
import Hydra.Prelude
import qualified Hydra.Core.SqlDB.Language as L
import qualified Hydra.Core.Domain as D
interpretSqlDBMethod
:: D.NativeSqlConn
-> (String -> IO ())
-> L.SqlDBMethodF beM a
-> IO a
interpretSqlDBMethod nativeConn logger (L.SqlDBMethod runner next) =
next <$> runner nativeConn logger
runSqlDBL :: D.NativeSqlConn -> (String -> IO ()) -> L.SqlDBL beM a -> IO a
runSqlDBL nativeConn logger = foldFree (interpretSqlDBMethod nativeConn logger)
| null | https://raw.githubusercontent.com/graninas/Hydra/60d591b1300528f5ffd93efa205012eebdd0286c/lib/hydra-free/src/Hydra/Core/SqlDB/Interpreter.hs | haskell | module Hydra.Core.SqlDB.Interpreter where
import Hydra.Prelude
import qualified Hydra.Core.SqlDB.Language as L
import qualified Hydra.Core.Domain as D
interpretSqlDBMethod
:: D.NativeSqlConn
-> (String -> IO ())
-> L.SqlDBMethodF beM a
-> IO a
interpretSqlDBMethod nativeConn logger (L.SqlDBMethod runner next) =
next <$> runner nativeConn logger
runSqlDBL :: D.NativeSqlConn -> (String -> IO ()) -> L.SqlDBL beM a -> IO a
runSqlDBL nativeConn logger = foldFree (interpretSqlDBMethod nativeConn logger)
| |
0b4df8bdf3f1c09b9989494d6e13180b7fbbb873f968bd4a89e026755227c1c2 | ibabushkin/hapstone | StorableSpec.hs | module Internal.Arm64.StorableSpec where
import Foreign
import Foreign.C.Types
import Test.Hspec
import Test.QuickCheck
import Hapstone.Internal.Arm64
import Internal.Arm64.Default
-- | main spec
spec :: Spec
spec = describe "Hapstone.Internal.Arm64" $ do
arm64OpMemStructSpec
csArm64OpSpec
csArm64Spec
getArm64OpMemStruct :: IO Arm64OpMemStruct
getArm64OpMemStruct = do
ptr <- mallocArray (sizeOf arm64OpMemStruct) :: IO (Ptr Word8)
poke (castPtr ptr) (fromIntegral $ fromEnum Arm64RegB4 :: Word32)
poke (plusPtr ptr 4) (fromIntegral $ fromEnum Arm64RegB16 :: Word32)
poke (plusPtr ptr 8) (0x03152746 :: Int32)
peek (castPtr ptr) <* free ptr
arm64OpMemStruct :: Arm64OpMemStruct
arm64OpMemStruct = Arm64OpMemStruct Arm64RegB4 Arm64RegB16 0x03152746
-- | Arm64OpMemStruct spec
arm64OpMemStructSpec :: Spec
arm64OpMemStructSpec = describe "Storable Arm64OpMemStruct" $ do
it "is a packed struct" $
sizeOf (undefined :: Arm64OpMemStruct) ==
sizeOf (0 :: CUInt) * 2 + sizeOf (0 :: Word32)
it "has matching peek- and poke-implementations" $ property $
\s@Arm64OpMemStruct{} ->
alloca (\p -> poke p s >> peek p) `shouldReturn` s
it "parses correctly" $ getArm64OpMemStruct `shouldReturn` arm64OpMemStruct
getCsArm64Op :: IO CsArm64Op
getCsArm64Op = do
ptr <- mallocArray (sizeOf csArm64Op) :: IO (Ptr Word8)
poke (castPtr ptr) (0x01234567 :: Word32)
poke (plusPtr ptr 4) (fromIntegral $ fromEnum Arm64Vas8b :: Int32)
poke (plusPtr ptr 8) (fromIntegral $ fromEnum Arm64VessB :: Int32)
poke (plusPtr ptr 12) (fromIntegral $ fromEnum Arm64SftMsl :: Int32)
poke (plusPtr ptr 16) (0x01234567 :: Word32)
poke (plusPtr ptr 20) (fromIntegral $ fromEnum Arm64ExtUxtb :: Int32)
poke (plusPtr ptr 24) (fromIntegral $ fromEnum Arm64OpImm :: Int32)
poke (plusPtr ptr 32) (0x0123456789abcdef :: Int64)
poke (plusPtr ptr 44) (0x1 :: Word8)
peek (castPtr ptr) <* free ptr
csArm64Op :: CsArm64Op
csArm64Op = CsArm64Op 0x01234567 Arm64Vas8b Arm64VessB
(Arm64SftMsl, 0x01234567) Arm64ExtUxtb (Imm 0x0123456789abcdef) 0x1
csArm64OpSpec :: Spec
csArm64OpSpec = describe "Storable CsArm64Op" $ do
it "has a memory-layout we can handle" $
sizeOf (undefined :: CsArm64Op) == 7*4 + 4 + 12 + 1 + 3
it "has matching peek- and poke-implementations" $ property $
\s@CsArm64Op{} ->
alloca (\p -> poke p s >> peek p) `shouldReturn` s
it "parses correctly" $ getCsArm64Op `shouldReturn` csArm64Op
getCsArm64 :: IO CsArm64
getCsArm64 = do
ptr <- mallocArray (sizeOf csArm64) :: IO (Ptr Word8)
poke (castPtr ptr) (fromIntegral $ fromEnum Arm64CcEq :: Int32)
poke (plusPtr ptr 4) (0x1 :: Word8)
poke (plusPtr ptr 5) (0x0 :: Word8)
poke (plusPtr ptr 6) (0x1 :: Word8)
poke (plusPtr ptr 8) csArm64Op
peek (castPtr ptr) <* free ptr
csArm64 :: CsArm64
csArm64 = CsArm64 Arm64CcEq True False [csArm64Op]
csArm64Spec :: Spec
csArm64Spec = describe "Storable CsArm64" $ do
it "has a memory-layout we can handle" $
sizeOf (undefined :: CsArm64) == 4 + 3 + 1 + 8*48
it "has matching peek- and poke-implementations" $ property $
\s@CsArm64{} ->
alloca (\p -> poke p s >> peek p) `shouldReturn` s
it "parses correctly" $ getCsArm64 `shouldReturn` csArm64
| null | https://raw.githubusercontent.com/ibabushkin/hapstone/4ac11f0a1e23e5a0f23351149c70bd541ddf5344/test/Internal/Arm64/StorableSpec.hs | haskell | | main spec
| Arm64OpMemStruct spec | module Internal.Arm64.StorableSpec where
import Foreign
import Foreign.C.Types
import Test.Hspec
import Test.QuickCheck
import Hapstone.Internal.Arm64
import Internal.Arm64.Default
spec :: Spec
spec = describe "Hapstone.Internal.Arm64" $ do
arm64OpMemStructSpec
csArm64OpSpec
csArm64Spec
getArm64OpMemStruct :: IO Arm64OpMemStruct
getArm64OpMemStruct = do
ptr <- mallocArray (sizeOf arm64OpMemStruct) :: IO (Ptr Word8)
poke (castPtr ptr) (fromIntegral $ fromEnum Arm64RegB4 :: Word32)
poke (plusPtr ptr 4) (fromIntegral $ fromEnum Arm64RegB16 :: Word32)
poke (plusPtr ptr 8) (0x03152746 :: Int32)
peek (castPtr ptr) <* free ptr
arm64OpMemStruct :: Arm64OpMemStruct
arm64OpMemStruct = Arm64OpMemStruct Arm64RegB4 Arm64RegB16 0x03152746
arm64OpMemStructSpec :: Spec
arm64OpMemStructSpec = describe "Storable Arm64OpMemStruct" $ do
it "is a packed struct" $
sizeOf (undefined :: Arm64OpMemStruct) ==
sizeOf (0 :: CUInt) * 2 + sizeOf (0 :: Word32)
it "has matching peek- and poke-implementations" $ property $
\s@Arm64OpMemStruct{} ->
alloca (\p -> poke p s >> peek p) `shouldReturn` s
it "parses correctly" $ getArm64OpMemStruct `shouldReturn` arm64OpMemStruct
getCsArm64Op :: IO CsArm64Op
getCsArm64Op = do
ptr <- mallocArray (sizeOf csArm64Op) :: IO (Ptr Word8)
poke (castPtr ptr) (0x01234567 :: Word32)
poke (plusPtr ptr 4) (fromIntegral $ fromEnum Arm64Vas8b :: Int32)
poke (plusPtr ptr 8) (fromIntegral $ fromEnum Arm64VessB :: Int32)
poke (plusPtr ptr 12) (fromIntegral $ fromEnum Arm64SftMsl :: Int32)
poke (plusPtr ptr 16) (0x01234567 :: Word32)
poke (plusPtr ptr 20) (fromIntegral $ fromEnum Arm64ExtUxtb :: Int32)
poke (plusPtr ptr 24) (fromIntegral $ fromEnum Arm64OpImm :: Int32)
poke (plusPtr ptr 32) (0x0123456789abcdef :: Int64)
poke (plusPtr ptr 44) (0x1 :: Word8)
peek (castPtr ptr) <* free ptr
csArm64Op :: CsArm64Op
csArm64Op = CsArm64Op 0x01234567 Arm64Vas8b Arm64VessB
(Arm64SftMsl, 0x01234567) Arm64ExtUxtb (Imm 0x0123456789abcdef) 0x1
csArm64OpSpec :: Spec
csArm64OpSpec = describe "Storable CsArm64Op" $ do
it "has a memory-layout we can handle" $
sizeOf (undefined :: CsArm64Op) == 7*4 + 4 + 12 + 1 + 3
it "has matching peek- and poke-implementations" $ property $
\s@CsArm64Op{} ->
alloca (\p -> poke p s >> peek p) `shouldReturn` s
it "parses correctly" $ getCsArm64Op `shouldReturn` csArm64Op
getCsArm64 :: IO CsArm64
getCsArm64 = do
ptr <- mallocArray (sizeOf csArm64) :: IO (Ptr Word8)
poke (castPtr ptr) (fromIntegral $ fromEnum Arm64CcEq :: Int32)
poke (plusPtr ptr 4) (0x1 :: Word8)
poke (plusPtr ptr 5) (0x0 :: Word8)
poke (plusPtr ptr 6) (0x1 :: Word8)
poke (plusPtr ptr 8) csArm64Op
peek (castPtr ptr) <* free ptr
csArm64 :: CsArm64
csArm64 = CsArm64 Arm64CcEq True False [csArm64Op]
csArm64Spec :: Spec
csArm64Spec = describe "Storable CsArm64" $ do
it "has a memory-layout we can handle" $
sizeOf (undefined :: CsArm64) == 4 + 3 + 1 + 8*48
it "has matching peek- and poke-implementations" $ property $
\s@CsArm64{} ->
alloca (\p -> poke p s >> peek p) `shouldReturn` s
it "parses correctly" $ getCsArm64 `shouldReturn` csArm64
|
3d752aef8d7e452de216d1a643de5a61a57bfd8af10073d30a47335c4c4b9a1c | hstreamdb/hstream | StatsSpecUtils.hs | module HStream.StatsSpecUtils where
import Control.Concurrent (threadDelay)
import Data.Int (Int64)
import qualified Data.Map.Strict as Map
import Data.Maybe (fromJust)
import Test.Hspec
import Z.Data.CBytes (CBytes)
import HStream.Stats (StatsHolder, resetStatsHolder)
# ANN module ( " HLint : ignore Use head " : : String ) #
mkTimeSeriesTest
:: StatsHolder
-> [Int]
-> CBytes
-> (StatsHolder -> CBytes -> Int64 -> IO ())
-> (StatsHolder -> CBytes -> CBytes -> [Int] -> IO (Maybe [Double]))
-> (StatsHolder -> CBytes -> [Int] -> IO (Either String (Map.Map CBytes [Double])))
-> Expectation
mkTimeSeriesTest h intervals stats_name stats_add stats_get stats_getall = do
stats_add h "key_1" 1000
stats_add h "key_2" 10000
NOTE : we choose to sleep 1s so that we can assume the speed of key_1
wo n't be faster than 2000B / s
threadDelay 1000000
stats_add h "key_1" 1000
stats_add h "key_2" 10000
stats_get h stats_name "non-existed-key" intervals
`shouldReturn` Nothing
Just [rate1_p5s, rate1_p10s] <- stats_get h stats_name "key_1" intervals
rate1_p5s `shouldSatisfy` (\s -> s > 0 && s <= 2000)
rate1_p10s `shouldSatisfy` (\s -> s > 0 && s <= 2000)
Just [rate2_p5s, rate2_p10s] <- stats_get h stats_name "key_2" intervals
NOTE : There is a possibility that the speed is less than 2000 . However , in
-- typical cases, it shouldn't.
rate2_p5s `shouldSatisfy` (\s -> s > 2000 && s <= 20000)
rate2_p10s `shouldSatisfy` (\s -> s > 2000 && s <= 20000)
Right m <- stats_getall h stats_name intervals
Map.lookup "key_1" m `shouldSatisfy` ((\s -> s!!0 > 0 && s!!0 <= 2000) . fromJust)
Map.lookup "key_2" m `shouldSatisfy` ((\s -> s!!1 > 2000 && s!!1 <= 20000) . fromJust)
resetStatsHolder h
stats_getall h stats_name intervals `shouldReturn` Right Map.empty
| null | https://raw.githubusercontent.com/hstreamdb/hstream/36f5a8be4c786dfeb3d24cf1253fb6a6dad3c38c/common/stats/test/HStream/StatsSpecUtils.hs | haskell | typical cases, it shouldn't. | module HStream.StatsSpecUtils where
import Control.Concurrent (threadDelay)
import Data.Int (Int64)
import qualified Data.Map.Strict as Map
import Data.Maybe (fromJust)
import Test.Hspec
import Z.Data.CBytes (CBytes)
import HStream.Stats (StatsHolder, resetStatsHolder)
# ANN module ( " HLint : ignore Use head " : : String ) #
mkTimeSeriesTest
:: StatsHolder
-> [Int]
-> CBytes
-> (StatsHolder -> CBytes -> Int64 -> IO ())
-> (StatsHolder -> CBytes -> CBytes -> [Int] -> IO (Maybe [Double]))
-> (StatsHolder -> CBytes -> [Int] -> IO (Either String (Map.Map CBytes [Double])))
-> Expectation
mkTimeSeriesTest h intervals stats_name stats_add stats_get stats_getall = do
stats_add h "key_1" 1000
stats_add h "key_2" 10000
NOTE : we choose to sleep 1s so that we can assume the speed of key_1
wo n't be faster than 2000B / s
threadDelay 1000000
stats_add h "key_1" 1000
stats_add h "key_2" 10000
stats_get h stats_name "non-existed-key" intervals
`shouldReturn` Nothing
Just [rate1_p5s, rate1_p10s] <- stats_get h stats_name "key_1" intervals
rate1_p5s `shouldSatisfy` (\s -> s > 0 && s <= 2000)
rate1_p10s `shouldSatisfy` (\s -> s > 0 && s <= 2000)
Just [rate2_p5s, rate2_p10s] <- stats_get h stats_name "key_2" intervals
NOTE : There is a possibility that the speed is less than 2000 . However , in
rate2_p5s `shouldSatisfy` (\s -> s > 2000 && s <= 20000)
rate2_p10s `shouldSatisfy` (\s -> s > 2000 && s <= 20000)
Right m <- stats_getall h stats_name intervals
Map.lookup "key_1" m `shouldSatisfy` ((\s -> s!!0 > 0 && s!!0 <= 2000) . fromJust)
Map.lookup "key_2" m `shouldSatisfy` ((\s -> s!!1 > 2000 && s!!1 <= 20000) . fromJust)
resetStatsHolder h
stats_getall h stats_name intervals `shouldReturn` Right Map.empty
|
b42a0efe4b666037173827afd01c2829685a2b94247eb6e50f8377c50e93ebf9 | intermine/bluegenes-old | core.cljs | (ns bluegenes.tools.runtemplate.core
(:require-macros [cljs.core.async.macros :refer [go]])
(:require [re-frame.core :as re-frame]
[cljs.core.async :refer [put! chan <! >! timeout close!]]
[reagent.core :as reagent]
[reagent.impl.util :as impl :refer [extract-props]]
[clojure.string :as str]
[intermine.imjs :as imjs]))
(defn template-matches-pathtype? [path template]
"True if a template has a constraint with a cerain type"
(if (some (fn [constraint]
(= (get constraint "path") path))
(get (second template) "where"))
template))
(defn filter-templates-for-type [path templates]
"Filter a collection of templates for a certain path type"
(filter #(template-matches-pathtype? path %) templates))
(defn filter-input-constraints [templates type]
"Get templates that can use our input type"
(filter-templates-for-type type templates))
(defn constraint []
(fn [con update-fn]
[:div
[:form
[:div.form-group
[:label (get con "path")]
[:div.input-group
[:span.input-group-addon (get con "op")]
[:input.form-control {:type "text"
:value (if (nil? (get con "value"))
(get con "values")
(get con "value"))
:disabled (if (= true (get con "fixed")) "true")
:on-change (fn [e]
(update-fn con {"value" (.. e -target -value)}))}]]]]]))
(defn path-end [path]
(last (clojure.string/split path #"\.")))
(defn constraints [cons]
"Renders a list of constraints ignoring any constraints on id."
[:div
(for [con cons :when (not (get con "hide"))]
^{:key (get con "path")} [constraint con])])
(defn run-button-handler [state emit]
"Emit the data."
(emit {:service {:root "www.flymine.org/query"}
:data {:format "query"
:type "Gene"
:value (js->clj (-> @state))}}))
(defn run-button [state emit]
[:button.btn.btn-info.btn-raised {:on-click (fn [e] (run-button-handler state emit)) } "Run"])
(defn convert-input-to-constraint [input]
(cond
(= (get-in input [:data :format]) "list")
(do
{"path" (str (get-in input [:data :type]) "")
"op" "IN"
"value" (get-in input [:data :name])
"hide" true
"fixed" true})
(= (get-in input [:data :format]) "ids")
{"path" (str (get-in input [:data :type]) ".id")
"op" "ONE OF"
"hide" true
"values" (get-in input [:data :value])
"fixed" true}))
(defn replace-input-constraint [input template]
(update-in template ["where"] #(map (fn [con]
(if (true? (= (get con "path") (get-in input [:data :type])))
(merge (dissoc con "value" "values") (convert-input-to-constraint input))
con)) %)))
(defn fetch-templates-chan []
"Fetch templates from Intermine and return them over a channel"
(let [templates-chan (chan)]
(-> (js/imjs.Service. #js {:root "www.flymine.org/query"})
(.fetchTemplates)
(.then (fn [response]
(go (>! templates-chan (js->clj response))))))
templates-chan))
(defn fetch-templates [local-state]
"Store Intermine's templates in our local state atom"
(-> (js/imjs.Service. #js {:root "www.flymine.org/query"})
(.fetchTemplates)
(.then (fn [response]
(swap! local-state assoc :all-templates (js->clj response))))))
(defn updater [comp]
(let [{:keys [upstream-data]} (reagent/props comp)]
(println "new upstream data" upstream-data)))
(defn drop-down []
"Render a drop down that only shows our valid templates"
(fn [{:keys [templates on-change-handler selected]}]
[:select.form-control
{:on-change on-change-handler
:value selected}
(doall
(for [[name values] templates]
^{:key name} [:option {:value name} (get values "title")]))]))
(defn store-filtered-templates
"Filter known templates for a given type (ex. Gene) and associate them
to an atom."
[local-state template-type all-templates]
(swap!
local-state
assoc :filtered-templates
(filter-input-constraints all-templates template-type)))
(defn on-select [templates api e]
(let [template-name (-> e .-target .-value)]
(-> {:query (get templates template-name)}
((:append-state api)))))
(defn default-button [e]
(fn []
[:div.btn.btn-raised "Defaults"]))
(defn save-query [api templates e]
(-> {:query (get templates (.. e -target -value))}
((:append-state api))))
(defn template-has-tag? [[name details] tag]
(some (fn [t] (= t (str "im:aspect:" tag))) (get details "tags")))
(defn get-row-count
"Reset an atom with the row count of an imjs query."
[query]
(let [c (chan)]
(-> (js/imjs.Service. (clj->js #js{:root "www.flymine.org/query"}))
(.query (clj->js query))
(.then (fn [q] (.count q)))
(.then (fn [ct]
(go (>! c ct)))))
c))
(defn filter-single-constraints
"Returns templates that only have a single constraint."
[templates]
(filter (fn [[name details]]
(< (count (get details "where") 2))) templates))
(defn ^:export preview []
(let [local-state (reagent/atom {:template-counts {}
:category nil
:all-templates nil
:single-constraint-templates {}
:filtered-templates nil})]
(reagent/create-class
{:component-will-update (fn [this new-props]
(swap! local-state assoc
:category (:category (extract-props new-props))))
:component-did-mount (fn [this]
(go
(let [templates (<! (fetch-templates-chan))
filtered-templates (filter-input-constraints templates "Gene")
ip (reagent/props this)
single-constraint-templates (into {} (filter-single-constraints filtered-templates))
adjusted-input-templates (reduce (fn [m [t-name t]]
( println " SEES T " t )
(assoc m t-name (replace-input-constraint ip t)))
{}
single-constraint-templates)
; adjusted (into {} (map (fn [[n t]] (replace-input-constraint ip t)) single-constraint-templates))
]
(println "IP" adjusted-input-templates)
; (println "adjusted" single-constraint-templates)
(println "done")
; Update our state our initial, filtered template data
(swap! local-state merge
{:all-templates templates
:single-constraint-templates single-constraint-templates
:adjusted-input-templates adjusted-input-templates
:filtered-templates filtered-templates})
(doall
(for [[name template] adjusted-input-templates]
(go
(let [count (<! (get-row-count template))]
(swap! local-state assoc-in
[:adjusted-input-templates name :count] count))))))))
:reagent-render (fn []
[:div
[:div.heading "Popular Queries"]
(doall (for [[name data] (take 5 (filter
(fn [t] (template-has-tag? t (:category @local-state)))
(:adjusted-input-templates @local-state)))]
(let [t (get-in @local-state [:all-templates name "title"])
adjusted-title (clojure.string/join " " (rest (clojure.string/split t #"-->")))]
^{:key name} [:div.indented (str
adjusted-title
" (" (:count data) " rows)")])))
[:div.indented.highlighted "More..."]])})))
(defn replace-constraints [query cons replace]
(swap! query update-in ["where"] (fn [constraints]
(doall
(map
(fn [constraint]
(if (= constraint cons)
(merge constraint replace)
constraint))
constraints)))))
(defn ^:export main [props]
(let [query (reagent.core/atom {})
local-state (reagent.core/atom {:all-templates nil
:filtered-templates nil})]
(reagent/create-class
{:should-component-update
(fn [this o n]
(println "run template param diff"
(nth (clojure.data/diff (extract-props o)
(extract-props n)) 1)))
:component-did-mount
(fn [e]
(fetch-templates local-state))
:component-will-receive-props
(fn [this comp]
(let [old-props (reagent/props this)
new-props (extract-props comp)]
(->> (:query (:state new-props))
(replace-input-constraint (:upstream-data new-props))
(reset! query))))
:reagent-render
(fn [{:keys [api]}]
[:div
[drop-down {:templates (:all-templates @local-state)
:on-change-handler (partial save-query
api
(:all-templates @local-state))}]
Build our constraints DIV
(into [:div]
(map (fn [where]
[constraint where (partial replace-constraints query)])
(get @query "where")))
; [:div.btn.btn-primary.btn-raised
; {:on-click (fn [e] (println query))}
; "run"]
[run-button query (:has-something api)]
[default-button]])})))
| null | https://raw.githubusercontent.com/intermine/bluegenes-old/5b719c7ac83a7340e0ff65790cf42413c15fb7e9/src/cljs/bluegenes/tools/runtemplate/core.cljs | clojure | adjusted (into {} (map (fn [[n t]] (replace-input-constraint ip t)) single-constraint-templates))
(println "adjusted" single-constraint-templates)
Update our state our initial, filtered template data
[:div.btn.btn-primary.btn-raised
{:on-click (fn [e] (println query))}
"run"] | (ns bluegenes.tools.runtemplate.core
(:require-macros [cljs.core.async.macros :refer [go]])
(:require [re-frame.core :as re-frame]
[cljs.core.async :refer [put! chan <! >! timeout close!]]
[reagent.core :as reagent]
[reagent.impl.util :as impl :refer [extract-props]]
[clojure.string :as str]
[intermine.imjs :as imjs]))
(defn template-matches-pathtype? [path template]
"True if a template has a constraint with a cerain type"
(if (some (fn [constraint]
(= (get constraint "path") path))
(get (second template) "where"))
template))
(defn filter-templates-for-type [path templates]
"Filter a collection of templates for a certain path type"
(filter #(template-matches-pathtype? path %) templates))
(defn filter-input-constraints [templates type]
"Get templates that can use our input type"
(filter-templates-for-type type templates))
(defn constraint []
(fn [con update-fn]
[:div
[:form
[:div.form-group
[:label (get con "path")]
[:div.input-group
[:span.input-group-addon (get con "op")]
[:input.form-control {:type "text"
:value (if (nil? (get con "value"))
(get con "values")
(get con "value"))
:disabled (if (= true (get con "fixed")) "true")
:on-change (fn [e]
(update-fn con {"value" (.. e -target -value)}))}]]]]]))
(defn path-end [path]
(last (clojure.string/split path #"\.")))
(defn constraints [cons]
"Renders a list of constraints ignoring any constraints on id."
[:div
(for [con cons :when (not (get con "hide"))]
^{:key (get con "path")} [constraint con])])
(defn run-button-handler [state emit]
"Emit the data."
(emit {:service {:root "www.flymine.org/query"}
:data {:format "query"
:type "Gene"
:value (js->clj (-> @state))}}))
(defn run-button [state emit]
[:button.btn.btn-info.btn-raised {:on-click (fn [e] (run-button-handler state emit)) } "Run"])
(defn convert-input-to-constraint [input]
(cond
(= (get-in input [:data :format]) "list")
(do
{"path" (str (get-in input [:data :type]) "")
"op" "IN"
"value" (get-in input [:data :name])
"hide" true
"fixed" true})
(= (get-in input [:data :format]) "ids")
{"path" (str (get-in input [:data :type]) ".id")
"op" "ONE OF"
"hide" true
"values" (get-in input [:data :value])
"fixed" true}))
(defn replace-input-constraint [input template]
(update-in template ["where"] #(map (fn [con]
(if (true? (= (get con "path") (get-in input [:data :type])))
(merge (dissoc con "value" "values") (convert-input-to-constraint input))
con)) %)))
(defn fetch-templates-chan []
"Fetch templates from Intermine and return them over a channel"
(let [templates-chan (chan)]
(-> (js/imjs.Service. #js {:root "www.flymine.org/query"})
(.fetchTemplates)
(.then (fn [response]
(go (>! templates-chan (js->clj response))))))
templates-chan))
(defn fetch-templates [local-state]
"Store Intermine's templates in our local state atom"
(-> (js/imjs.Service. #js {:root "www.flymine.org/query"})
(.fetchTemplates)
(.then (fn [response]
(swap! local-state assoc :all-templates (js->clj response))))))
(defn updater [comp]
(let [{:keys [upstream-data]} (reagent/props comp)]
(println "new upstream data" upstream-data)))
(defn drop-down []
"Render a drop down that only shows our valid templates"
(fn [{:keys [templates on-change-handler selected]}]
[:select.form-control
{:on-change on-change-handler
:value selected}
(doall
(for [[name values] templates]
^{:key name} [:option {:value name} (get values "title")]))]))
(defn store-filtered-templates
"Filter known templates for a given type (ex. Gene) and associate them
to an atom."
[local-state template-type all-templates]
(swap!
local-state
assoc :filtered-templates
(filter-input-constraints all-templates template-type)))
(defn on-select [templates api e]
(let [template-name (-> e .-target .-value)]
(-> {:query (get templates template-name)}
((:append-state api)))))
(defn default-button [e]
(fn []
[:div.btn.btn-raised "Defaults"]))
(defn save-query [api templates e]
(-> {:query (get templates (.. e -target -value))}
((:append-state api))))
(defn template-has-tag? [[name details] tag]
(some (fn [t] (= t (str "im:aspect:" tag))) (get details "tags")))
(defn get-row-count
"Reset an atom with the row count of an imjs query."
[query]
(let [c (chan)]
(-> (js/imjs.Service. (clj->js #js{:root "www.flymine.org/query"}))
(.query (clj->js query))
(.then (fn [q] (.count q)))
(.then (fn [ct]
(go (>! c ct)))))
c))
(defn filter-single-constraints
"Returns templates that only have a single constraint."
[templates]
(filter (fn [[name details]]
(< (count (get details "where") 2))) templates))
(defn ^:export preview []
(let [local-state (reagent/atom {:template-counts {}
:category nil
:all-templates nil
:single-constraint-templates {}
:filtered-templates nil})]
(reagent/create-class
{:component-will-update (fn [this new-props]
(swap! local-state assoc
:category (:category (extract-props new-props))))
:component-did-mount (fn [this]
(go
(let [templates (<! (fetch-templates-chan))
filtered-templates (filter-input-constraints templates "Gene")
ip (reagent/props this)
single-constraint-templates (into {} (filter-single-constraints filtered-templates))
adjusted-input-templates (reduce (fn [m [t-name t]]
( println " SEES T " t )
(assoc m t-name (replace-input-constraint ip t)))
{}
single-constraint-templates)
]
(println "IP" adjusted-input-templates)
(println "done")
(swap! local-state merge
{:all-templates templates
:single-constraint-templates single-constraint-templates
:adjusted-input-templates adjusted-input-templates
:filtered-templates filtered-templates})
(doall
(for [[name template] adjusted-input-templates]
(go
(let [count (<! (get-row-count template))]
(swap! local-state assoc-in
[:adjusted-input-templates name :count] count))))))))
:reagent-render (fn []
[:div
[:div.heading "Popular Queries"]
(doall (for [[name data] (take 5 (filter
(fn [t] (template-has-tag? t (:category @local-state)))
(:adjusted-input-templates @local-state)))]
(let [t (get-in @local-state [:all-templates name "title"])
adjusted-title (clojure.string/join " " (rest (clojure.string/split t #"-->")))]
^{:key name} [:div.indented (str
adjusted-title
" (" (:count data) " rows)")])))
[:div.indented.highlighted "More..."]])})))
(defn replace-constraints [query cons replace]
(swap! query update-in ["where"] (fn [constraints]
(doall
(map
(fn [constraint]
(if (= constraint cons)
(merge constraint replace)
constraint))
constraints)))))
(defn ^:export main [props]
(let [query (reagent.core/atom {})
local-state (reagent.core/atom {:all-templates nil
:filtered-templates nil})]
(reagent/create-class
{:should-component-update
(fn [this o n]
(println "run template param diff"
(nth (clojure.data/diff (extract-props o)
(extract-props n)) 1)))
:component-did-mount
(fn [e]
(fetch-templates local-state))
:component-will-receive-props
(fn [this comp]
(let [old-props (reagent/props this)
new-props (extract-props comp)]
(->> (:query (:state new-props))
(replace-input-constraint (:upstream-data new-props))
(reset! query))))
:reagent-render
(fn [{:keys [api]}]
[:div
[drop-down {:templates (:all-templates @local-state)
:on-change-handler (partial save-query
api
(:all-templates @local-state))}]
Build our constraints DIV
(into [:div]
(map (fn [where]
[constraint where (partial replace-constraints query)])
(get @query "where")))
[run-button query (:has-something api)]
[default-button]])})))
|
a8bb0545abc7e50357a419f24441717bda61aa570e6a2466eb5dd86399e41fbf | exercism/racket | hamming-test.rkt | #lang racket/base
(require "hamming.rkt")
(module+ test
(require rackunit rackunit/text-ui)
(define suite
(test-suite
"point mutations tests"
(test-eqv? "no difference between empty strands"
(hamming-distance "" "")
0)
(test-eqv? "no difference between identical strands"
(hamming-distance "GATTACA" "GATTACA")
0)
(test-eqv? "complete hamming distance in small strand"
(hamming-distance "ACT" "GGA")
3)
(test-eqv? "small hamming distance in middle somewhere"
(hamming-distance "GGACG" "GGTCG")
1)
(test-eqv? "larger difference"
(hamming-distance "ACCAGGG" "ACTATGG")
2)
(test-exn "String length mismatch." exn:fail?
(lambda ()
(hamming-distance "AGACAACAGCCAGCCGCCGGATT" "AGGCAA")))))
(run-tests suite))
| null | https://raw.githubusercontent.com/exercism/racket/4110268ed331b1b4dac8888550f05d0dacb1865b/exercises/practice/hamming/hamming-test.rkt | racket | #lang racket/base
(require "hamming.rkt")
(module+ test
(require rackunit rackunit/text-ui)
(define suite
(test-suite
"point mutations tests"
(test-eqv? "no difference between empty strands"
(hamming-distance "" "")
0)
(test-eqv? "no difference between identical strands"
(hamming-distance "GATTACA" "GATTACA")
0)
(test-eqv? "complete hamming distance in small strand"
(hamming-distance "ACT" "GGA")
3)
(test-eqv? "small hamming distance in middle somewhere"
(hamming-distance "GGACG" "GGTCG")
1)
(test-eqv? "larger difference"
(hamming-distance "ACCAGGG" "ACTATGG")
2)
(test-exn "String length mismatch." exn:fail?
(lambda ()
(hamming-distance "AGACAACAGCCAGCCGCCGGATT" "AGGCAA")))))
(run-tests suite))
| |
36c990701497d60c7dd1f8fa220fb3e2d43ed1a11de2f836cad5c7a45a343844 | lambdabot/lambdabot | Common.hs | module Lambdabot.Plugin.Haskell.Pl.Common (
Fixity(..), Expr(..), Pattern(..), Decl(..), TopLevel(..),
bt, sizeExpr, mapTopLevel, getExpr,
operators, opchars, reservedOps, lookupOp, lookupFix, minPrec, maxPrec,
comp, flip', id', const', scomb, cons, nil, fix', if',
makeList, getList, readM,
Assoc(..),
module Data.Maybe,
module Control.Arrow,
module Data.List,
module Control.Monad,
module GHC.Base
) where
import Data.Maybe (isJust, fromJust)
import Data.List (intersperse, minimumBy)
import qualified Data.Map as M
import Control.Applicative
import Control.Monad
import Control.Arrow (first, second, (***), (&&&), (|||), (+++))
import Text.ParserCombinators.Parsec.Expr (Assoc(..))
import GHC.Base (assert)
-- The rewrite rules can be found at the end of the file Rules.hs
-- Not sure if passing the information if it was used as infix or prefix
-- is worth threading through the whole thing is worth the effort,
-- but it stays that way until the prettyprinting algorithm gets more
-- sophisticated.
data Fixity = Pref | Inf deriving Show
instance Eq Fixity where
_ == _ = True
instance Ord Fixity where
compare _ _ = EQ
data Expr
= Var Fixity String
| Lambda Pattern Expr
| App Expr Expr
| Let [Decl] Expr
deriving (Eq, Ord)
data Pattern
= PVar String
| PCons Pattern Pattern
| PTuple Pattern Pattern
deriving (Eq, Ord)
data Decl = Define {
declName :: String,
declExpr :: Expr
} deriving (Eq, Ord)
data TopLevel = TLD Bool Decl | TLE Expr deriving (Eq, Ord)
mapTopLevel :: (Expr -> Expr) -> TopLevel -> TopLevel
mapTopLevel f tl = case getExpr tl of (e, c) -> c $ f e
getExpr :: TopLevel -> (Expr, Expr -> TopLevel)
getExpr (TLD True (Define foo e)) = (Let [Define foo e] (Var Pref foo),
\e' -> TLD False $ Define foo e')
getExpr (TLD False (Define foo e)) = (e, \e' -> TLD False $ Define foo e')
getExpr (TLE e) = (e, TLE)
sizeExpr :: Expr -> Int
sizeExpr (Var _ _) = 1
sizeExpr (App e1 e2) = sizeExpr e1 + sizeExpr e2 + 1
sizeExpr (Lambda _ e) = 1 + sizeExpr e
sizeExpr (Let ds e) = 1 + sum (map sizeDecl ds) + sizeExpr e where
sizeDecl (Define _ e') = 1 + sizeExpr e'
comp, flip', id', const', scomb, cons, nil, fix', if' :: Expr
comp = Var Inf "."
flip' = Var Pref "flip"
id' = Var Pref "id"
const' = Var Pref "const"
scomb = Var Pref "ap"
cons = Var Inf ":"
nil = Var Pref "[]"
fix' = Var Pref "fix"
if' = Var Pref "if'"
makeList :: [Expr] -> Expr
makeList = foldr (\e1 e2 -> cons `App` e1 `App` e2) nil
-- Modularity is a drag
getList :: Expr -> ([Expr], Expr)
getList (c `App` x `App` tl) | c == cons = first (x:) $ getList tl
getList e = ([],e)
bt :: a
bt = undefined
shift, minPrec, maxPrec :: Int
shift = 0
maxPrec = shift + 10
minPrec = 0
-- operator precedences are needed both for parsing and prettyprinting
operators :: [[(String, (Assoc, Int))]]
operators = (map . map . second . second $ (+shift))
[[inf "." AssocRight 9, inf "!!" AssocLeft 9],
[inf name AssocRight 8 | name <- ["^", "^^", "**"]],
[inf name AssocLeft 7
| name <- ["*", "/", "`quot`", "`rem`", "`div`", "`mod`", ":%", "%"]],
[inf name AssocLeft 6 | name <- ["+", "-"]],
[inf name AssocRight 5 | name <- [":", "++", "<+>"]],
[inf name AssocNone 4
| name <- ["==", "/=", "<", "<=", ">=", ">", "`elem`", "`notElem`"]] ++[inf name AssocLeft 4 | name <- ["<*","*>","<$>","<$","<**>"]],
[inf "&&" AssocRight 3, inf "***" AssocRight 3, inf "&&&" AssocRight 3, inf "<|>" AssocLeft 3],
[inf "||" AssocRight 2, inf "+++" AssocRight 2, inf "|||" AssocRight 2],
[inf ">>" AssocLeft 1, inf ">>=" AssocLeft 1, inf "=<<" AssocRight 1, inf ">>>" AssocRight 1, inf "^>>" AssocRight 1, inf "^<<" AssocRight 1],
[inf name AssocRight 0 | name <- ["$", "$!", "`seq`"]]
] where
inf name assoc fx = (name, (assoc, fx))
opchars :: [Char]
opchars = "!@#$%^*./|=-+:?<>&"
reservedOps :: [String]
reservedOps = ["->", "..", "="]
opFM :: M.Map String (Assoc, Int)
opFM = (M.fromList $ concat operators)
lookupOp :: String -> Maybe (Assoc, Int)
lookupOp k = M.lookup k opFM
lookupFix :: String -> (Assoc, Int)
lookupFix str = case lookupOp $ str of
Nothing -> (AssocLeft, 9 + shift)
Just x -> x
readM :: (Read a, Alternative m) => String -> m a
readM str = case reads str of
[(x, "")] -> pure x
_ -> empty
| null | https://raw.githubusercontent.com/lambdabot/lambdabot/de01f362c7a8fc6f85c37e604168dcccb1283a0e/lambdabot-haskell-plugins/src/Lambdabot/Plugin/Haskell/Pl/Common.hs | haskell | The rewrite rules can be found at the end of the file Rules.hs
Not sure if passing the information if it was used as infix or prefix
is worth threading through the whole thing is worth the effort,
but it stays that way until the prettyprinting algorithm gets more
sophisticated.
Modularity is a drag
operator precedences are needed both for parsing and prettyprinting | module Lambdabot.Plugin.Haskell.Pl.Common (
Fixity(..), Expr(..), Pattern(..), Decl(..), TopLevel(..),
bt, sizeExpr, mapTopLevel, getExpr,
operators, opchars, reservedOps, lookupOp, lookupFix, minPrec, maxPrec,
comp, flip', id', const', scomb, cons, nil, fix', if',
makeList, getList, readM,
Assoc(..),
module Data.Maybe,
module Control.Arrow,
module Data.List,
module Control.Monad,
module GHC.Base
) where
import Data.Maybe (isJust, fromJust)
import Data.List (intersperse, minimumBy)
import qualified Data.Map as M
import Control.Applicative
import Control.Monad
import Control.Arrow (first, second, (***), (&&&), (|||), (+++))
import Text.ParserCombinators.Parsec.Expr (Assoc(..))
import GHC.Base (assert)
data Fixity = Pref | Inf deriving Show
instance Eq Fixity where
_ == _ = True
instance Ord Fixity where
compare _ _ = EQ
data Expr
= Var Fixity String
| Lambda Pattern Expr
| App Expr Expr
| Let [Decl] Expr
deriving (Eq, Ord)
data Pattern
= PVar String
| PCons Pattern Pattern
| PTuple Pattern Pattern
deriving (Eq, Ord)
data Decl = Define {
declName :: String,
declExpr :: Expr
} deriving (Eq, Ord)
data TopLevel = TLD Bool Decl | TLE Expr deriving (Eq, Ord)
mapTopLevel :: (Expr -> Expr) -> TopLevel -> TopLevel
mapTopLevel f tl = case getExpr tl of (e, c) -> c $ f e
getExpr :: TopLevel -> (Expr, Expr -> TopLevel)
getExpr (TLD True (Define foo e)) = (Let [Define foo e] (Var Pref foo),
\e' -> TLD False $ Define foo e')
getExpr (TLD False (Define foo e)) = (e, \e' -> TLD False $ Define foo e')
getExpr (TLE e) = (e, TLE)
sizeExpr :: Expr -> Int
sizeExpr (Var _ _) = 1
sizeExpr (App e1 e2) = sizeExpr e1 + sizeExpr e2 + 1
sizeExpr (Lambda _ e) = 1 + sizeExpr e
sizeExpr (Let ds e) = 1 + sum (map sizeDecl ds) + sizeExpr e where
sizeDecl (Define _ e') = 1 + sizeExpr e'
comp, flip', id', const', scomb, cons, nil, fix', if' :: Expr
comp = Var Inf "."
flip' = Var Pref "flip"
id' = Var Pref "id"
const' = Var Pref "const"
scomb = Var Pref "ap"
cons = Var Inf ":"
nil = Var Pref "[]"
fix' = Var Pref "fix"
if' = Var Pref "if'"
makeList :: [Expr] -> Expr
makeList = foldr (\e1 e2 -> cons `App` e1 `App` e2) nil
getList :: Expr -> ([Expr], Expr)
getList (c `App` x `App` tl) | c == cons = first (x:) $ getList tl
getList e = ([],e)
bt :: a
bt = undefined
shift, minPrec, maxPrec :: Int
shift = 0
maxPrec = shift + 10
minPrec = 0
operators :: [[(String, (Assoc, Int))]]
operators = (map . map . second . second $ (+shift))
[[inf "." AssocRight 9, inf "!!" AssocLeft 9],
[inf name AssocRight 8 | name <- ["^", "^^", "**"]],
[inf name AssocLeft 7
| name <- ["*", "/", "`quot`", "`rem`", "`div`", "`mod`", ":%", "%"]],
[inf name AssocLeft 6 | name <- ["+", "-"]],
[inf name AssocRight 5 | name <- [":", "++", "<+>"]],
[inf name AssocNone 4
| name <- ["==", "/=", "<", "<=", ">=", ">", "`elem`", "`notElem`"]] ++[inf name AssocLeft 4 | name <- ["<*","*>","<$>","<$","<**>"]],
[inf "&&" AssocRight 3, inf "***" AssocRight 3, inf "&&&" AssocRight 3, inf "<|>" AssocLeft 3],
[inf "||" AssocRight 2, inf "+++" AssocRight 2, inf "|||" AssocRight 2],
[inf ">>" AssocLeft 1, inf ">>=" AssocLeft 1, inf "=<<" AssocRight 1, inf ">>>" AssocRight 1, inf "^>>" AssocRight 1, inf "^<<" AssocRight 1],
[inf name AssocRight 0 | name <- ["$", "$!", "`seq`"]]
] where
inf name assoc fx = (name, (assoc, fx))
opchars :: [Char]
opchars = "!@#$%^*./|=-+:?<>&"
reservedOps :: [String]
reservedOps = ["->", "..", "="]
opFM :: M.Map String (Assoc, Int)
opFM = (M.fromList $ concat operators)
lookupOp :: String -> Maybe (Assoc, Int)
lookupOp k = M.lookup k opFM
lookupFix :: String -> (Assoc, Int)
lookupFix str = case lookupOp $ str of
Nothing -> (AssocLeft, 9 + shift)
Just x -> x
readM :: (Read a, Alternative m) => String -> m a
readM str = case reads str of
[(x, "")] -> pure x
_ -> empty
|
5c6d73b275948ee504bf8950b47051a5dd5857941345620326e5e7330179d1d2 | Nutr1t07/wl-bot | Telegram.hs | {-# LANGUAGE OverloadedStrings #-}
module Core.Data.Telegram where
import Control.Lens ( (^.) )
import Core.Type.Telegram.Request as TR
( SendMsg(SendMsg) )
import Core.Type.Telegram.Update as TU
( Message
, Update
, edited_message
, message
)
import Core.Type.Unity.Request as UR
import Data.Maybe ( fromJust
, isJust
, isNothing
)
import Data.Text ( pack )
import Data.Text.Lazy ( toStrict )
import Data.Text.Lazy.Builder ( toLazyText )
import HTMLEntities.Decoder ( htmlEncodedText )
import Network.Wreq ( Part
, partFile
, partText
)
| Get Telegram Message ( Message or EditedMessage ) from Telegram Update
getMessageFromUpdate :: TU.Update -> (Int, Maybe Message)
getMessageFromUpdate tgUpdate = (msg_type, msg)
where
msg = if msg_type > 1 then Nothing else msgs !! msg_type
msgs = [message, edited_message] <*> pure tgUpdate
msg_type = Prelude.length $ Prelude.takeWhile isNothing msgs
-- | Transform SendMsg into [Part] when local image upload is required.
transMsg :: UR.SendMsg -> Either [Part] TR.SendMsg
transMsg msg
| isJust $ msg ^. imgPath = Left
[ partText "chat_id" (pack . show $ msg ^. UR.chat_id)
, partText "reply_to_message_id" (pack . show $ msg ^. UR.reply_id)
, partFile "photo" (fromJust $ ("images/" <>) <$> msg ^. imgPath)
]
| isJust $ msg ^. imgUrl = Right $ TR.SendMsg (msg ^. UR.chat_id)
Nothing
(msg ^. imgUrl)
(msg ^. UR.text)
"HTML"
(msg ^. reply_id)
True
| otherwise = Right $ TR.SendMsg (msg ^. UR.chat_id)
(decodeHtml <$> msg ^. UR.text)
Nothing
Nothing
"HTML"
(msg ^. reply_id)
True
where decodeHtml = toStrict . toLazyText . htmlEncodedText
| null | https://raw.githubusercontent.com/Nutr1t07/wl-bot/4d9db61613a3819d0addbc7e04d77bb2f57892f0/src/Core/Data/Telegram.hs | haskell | # LANGUAGE OverloadedStrings #
| Transform SendMsg into [Part] when local image upload is required. |
module Core.Data.Telegram where
import Control.Lens ( (^.) )
import Core.Type.Telegram.Request as TR
( SendMsg(SendMsg) )
import Core.Type.Telegram.Update as TU
( Message
, Update
, edited_message
, message
)
import Core.Type.Unity.Request as UR
import Data.Maybe ( fromJust
, isJust
, isNothing
)
import Data.Text ( pack )
import Data.Text.Lazy ( toStrict )
import Data.Text.Lazy.Builder ( toLazyText )
import HTMLEntities.Decoder ( htmlEncodedText )
import Network.Wreq ( Part
, partFile
, partText
)
| Get Telegram Message ( Message or EditedMessage ) from Telegram Update
getMessageFromUpdate :: TU.Update -> (Int, Maybe Message)
getMessageFromUpdate tgUpdate = (msg_type, msg)
where
msg = if msg_type > 1 then Nothing else msgs !! msg_type
msgs = [message, edited_message] <*> pure tgUpdate
msg_type = Prelude.length $ Prelude.takeWhile isNothing msgs
transMsg :: UR.SendMsg -> Either [Part] TR.SendMsg
transMsg msg
| isJust $ msg ^. imgPath = Left
[ partText "chat_id" (pack . show $ msg ^. UR.chat_id)
, partText "reply_to_message_id" (pack . show $ msg ^. UR.reply_id)
, partFile "photo" (fromJust $ ("images/" <>) <$> msg ^. imgPath)
]
| isJust $ msg ^. imgUrl = Right $ TR.SendMsg (msg ^. UR.chat_id)
Nothing
(msg ^. imgUrl)
(msg ^. UR.text)
"HTML"
(msg ^. reply_id)
True
| otherwise = Right $ TR.SendMsg (msg ^. UR.chat_id)
(decodeHtml <$> msg ^. UR.text)
Nothing
Nothing
"HTML"
(msg ^. reply_id)
True
where decodeHtml = toStrict . toLazyText . htmlEncodedText
|
eef7f121b57eea751e00206ba8129e4c115e73c0fc7e3c2feade428024b76626 | Kalimehtar/gtk-cffi | ex6.lisp | 424
(asdf:oos 'asdf:load-op :gtk-cffi)
(defpackage #:test
(:use #:common-lisp #:gdk-cffi #:gtk-cffi #:g-object-cffi)
(:shadowing-import-from #:gtk-cffi #:image #:window))
(in-package #:test)
(gtk-init)
(defvar window)
(defvar vbox)
(defvar title)
(defvar hbox)
(defvar vbox-right)
(setf window (make-instance 'window))
(setf (gsignal window :destroy) :gtk-main-quit
(size-request window) '(600 240))
(add window (setf vbox (make-instance 'v-box)))
(let ((title (make-instance 'label :text
" Place a background image in GtkEventBox\n
Part 2 - using GdkDrawable::draw_pixbuf()")))
(setf (font title) "Times New Roman Italic 10"
(color title) "#0000ff"
(size-request title) '(-1 40))
(pack* vbox title
((make-instance 'label))
((setf hbox (make-instance 'h-box :homogeneous t))
:expand t :fill t)))
(defun expose-event (widget context &optional (img "none"))
(format t "~a ~a ~a~%" widget context img)
(let* ((pixbuf (make-instance 'pixbuf :file img))
(w (width pixbuf))
(dest-x (- (width (allocation widget)) w))
(dest-y 0))
(format t "~a~%" pixbuf)
(cl-cairo2:with-context ((make-instance 'cl-cairo2:context
:pointer context))
(unless (cffi:null-pointer-p (cffi-objects:pointer pixbuf))
(cairo-set-source-pixbuf pixbuf dest-x dest-y)
(cl-cairo2:paint))
(let ((ch (child widget)))
(when ch (propagate-draw widget ch)))))
t)
; (draw-pixbuf (gdk-window widget)
; (style-field widget :bg-gc) pixbuf 0 0 dest-x dest-y)
;(let ((ch (child widget)))
; (when ch
; (propagate- widget ch event)))
(let ((eventbox-left (make-instance 'event-box))
(vbox-left (make-instance 'v-box :homogeneous t)))
(pack hbox eventbox-left :expand t :fill t)
(add eventbox-left vbox-left)
(pack* vbox-left
((make-instance 'label :text "This is left eventbox."))
((make-instance 'label :text "The green ball is the bg image."))
((make-instance 'label :text "Note that this eventbox"))
((make-instance 'label :text "uses the default gray backgd color.")))
(setf (gsignal eventbox-left :draw :data "ball_green3.png")
#'expose-event))
(let ((eventbox-right (make-instance 'event-box)))
(pack hbox eventbox-right :expand t :fill t)
(add eventbox-right (setf vbox-right (make-instance 'v-box :homogeneous t)))
(pack* vbox-right
((make-instance 'label :text "This is right eventbox."))
((make-instance 'label :text "The blue ball is the bg image."))
((make-instance 'label :text "Note that you can also set"))
((make-instance 'label :text "backgd color for the eventbox!")))
(setf (color eventbox-right :type :bg) "#BAFFB3")
(setf (gsignal eventbox-right :draw :data "ball_blue3.png")
#'expose-event))
(show window :all t)
(gtk-main)
| null | https://raw.githubusercontent.com/Kalimehtar/gtk-cffi/fbd8a40a2bbda29f81b1a95ed2530debfe2afe9b/examples/ex6.lisp | lisp | (draw-pixbuf (gdk-window widget)
(style-field widget :bg-gc) pixbuf 0 0 dest-x dest-y)
(let ((ch (child widget)))
(when ch
(propagate- widget ch event))) | 424
(asdf:oos 'asdf:load-op :gtk-cffi)
(defpackage #:test
(:use #:common-lisp #:gdk-cffi #:gtk-cffi #:g-object-cffi)
(:shadowing-import-from #:gtk-cffi #:image #:window))
(in-package #:test)
(gtk-init)
(defvar window)
(defvar vbox)
(defvar title)
(defvar hbox)
(defvar vbox-right)
(setf window (make-instance 'window))
(setf (gsignal window :destroy) :gtk-main-quit
(size-request window) '(600 240))
(add window (setf vbox (make-instance 'v-box)))
(let ((title (make-instance 'label :text
" Place a background image in GtkEventBox\n
Part 2 - using GdkDrawable::draw_pixbuf()")))
(setf (font title) "Times New Roman Italic 10"
(color title) "#0000ff"
(size-request title) '(-1 40))
(pack* vbox title
((make-instance 'label))
((setf hbox (make-instance 'h-box :homogeneous t))
:expand t :fill t)))
(defun expose-event (widget context &optional (img "none"))
(format t "~a ~a ~a~%" widget context img)
(let* ((pixbuf (make-instance 'pixbuf :file img))
(w (width pixbuf))
(dest-x (- (width (allocation widget)) w))
(dest-y 0))
(format t "~a~%" pixbuf)
(cl-cairo2:with-context ((make-instance 'cl-cairo2:context
:pointer context))
(unless (cffi:null-pointer-p (cffi-objects:pointer pixbuf))
(cairo-set-source-pixbuf pixbuf dest-x dest-y)
(cl-cairo2:paint))
(let ((ch (child widget)))
(when ch (propagate-draw widget ch)))))
t)
(let ((eventbox-left (make-instance 'event-box))
(vbox-left (make-instance 'v-box :homogeneous t)))
(pack hbox eventbox-left :expand t :fill t)
(add eventbox-left vbox-left)
(pack* vbox-left
((make-instance 'label :text "This is left eventbox."))
((make-instance 'label :text "The green ball is the bg image."))
((make-instance 'label :text "Note that this eventbox"))
((make-instance 'label :text "uses the default gray backgd color.")))
(setf (gsignal eventbox-left :draw :data "ball_green3.png")
#'expose-event))
(let ((eventbox-right (make-instance 'event-box)))
(pack hbox eventbox-right :expand t :fill t)
(add eventbox-right (setf vbox-right (make-instance 'v-box :homogeneous t)))
(pack* vbox-right
((make-instance 'label :text "This is right eventbox."))
((make-instance 'label :text "The blue ball is the bg image."))
((make-instance 'label :text "Note that you can also set"))
((make-instance 'label :text "backgd color for the eventbox!")))
(setf (color eventbox-right :type :bg) "#BAFFB3")
(setf (gsignal eventbox-right :draw :data "ball_blue3.png")
#'expose-event))
(show window :all t)
(gtk-main)
|
c460644e8674cc9febe822298eb187f58fffcceed38f350bad825ceea834321e | acieroid/scala-am | fPerm-2.scm | (letrec ((f (lambda (x) (+ (* x x) (* x x)))))
(let ((f5 (f 5)))
(let ((f3 (f 3)))
(let ((f1 (f 1)))
(let ((f4 (f 4)))
(f 2))))))
| null | https://raw.githubusercontent.com/acieroid/scala-am/13ef3befbfc664b77f31f56847c30d60f4ee7dfe/test/changesBenevolPaper/fPerm-2.scm | scheme | (letrec ((f (lambda (x) (+ (* x x) (* x x)))))
(let ((f5 (f 5)))
(let ((f3 (f 3)))
(let ((f1 (f 1)))
(let ((f4 (f 4)))
(f 2))))))
| |
f347c5be963981b657d0aacdab41bf7bf8e3fed8ad07f4214fe4bba34ecfa46c | lilactown/lilac.town | org.clj | (ns clj-org.org
(:require [clj-org.util :refer [vec* selective-walk]]
[clojure.string :as str]
[clojure.zip :as zip]
[hiccup.util :refer [escape-html]]))
(defn header-value-for [field txt]
(->> txt
(re-seq (->> field
(format "\\#\\+%s: (.+?)\n")
re-pattern))
(map second)
last))
(defn get-title [txt] (header-value-for "TITLE" txt))
(defn get-draft [txt]
(->> txt (header-value-for "DRAFT") Boolean/valueOf))
(defn get-tags [txt] (header-value-for "TAGS" txt))
(defn strip-raw-html-tags-for-now [txt]
(-> txt
(clojure.string/replace #"#\+(?:HTML|ATTR_HTML):.+?\n" "")
(clojure.string/replace #"(?sx)
\#\+BEGIN_HTML\s*
.*?
\#\+END_HTML\s*" "")))
(defn ^:private descend? [el]
(and (coll? el)
(not (string? el))
(not (map? el))
(not= :pre (first el))
(not= :code (first el))))
(defn apply-fn-to-strings
"
Walk tree, applying f to each string. If multiple terms result, put
them inside a :span tag.
"
[f tree]
(let [f (fn [el]
(let [[r0 & rs :as r] (f el)]
(cond
(string? r) r
rs (vec* :span r)
:else r0)))]
(selective-walk f descend? string? tree)))
(defn split-headers-and-body [txt]
(let [[_ & rs]
(re-find #"(?x)
(\n* # Pick up trailing newlines
(?:\# # Anything starting w/ '#'
(?: # Not starting with:
(?!\+(?:HTML:|CAPTION|BEGIN|ATTR_HTML))
# Swallow all lines that match
.)+\n*)*)
# Swallow everything else as group 2
((?s)(?:.+)*)"
txt)]
rs))
(defn convert-body-to-sections [body]
(let [matches
(re-seq #"(?x)
(?:
(?:
(\*+)
\s+
(.+)
\n
)|
(
(?:
(?!\*+\s+)
.*\n
)*
)
)"
body)]
(->> (for [[_ stars hdr body] matches]
(if stars
[(-> stars
count
((partial str "h"))
keyword)
[:a {:id (str/lower-case hdr)
:href (str/lower-case
(str "#"
(str/replace hdr " " "-")))} hdr]]
body))
(remove #{""})
(vec* :div))))
(defn find-paragraphs [s]
(->> s
(re-seq #"(?x)
((?:.+\n?)+)
|
(?:\n{2,})")
(map (comp (partial vec* :p) rest))))
(defn captionify [s]
(->> s
(re-seq #"(?sx)
(
(?:
(?!\[\[)
.
)+
)?
(?:
\[\[
(.+?)
\]\]
)?")
(remove (partial every? empty?))
(mapcat (fn [[_ before img]]
(cond
(not before) [[:a {:href img} [:img {:src img
:class "caption"}]]]
(not img) [before]
:else [before [:a {:href img}
[:img {:src img
:class "caption"}]]])))))
(defn linkify [s]
(->> s
(re-seq #"(?sx)
(
(?:
(?!
\[\[.+?\]\[.+?\]\]
)
.
)+
)?
(?:
\[\[
(.+?)
\]\[
(.+?)
\]\]
)?")
(remove (partial every? empty?))
(mapcat (fn [[_ before lnk body]]
(cond
(not before) [[:a {:href lnk
:target "_blank"} body]]
(not lnk) [before]
:else [before [:a {:href lnk
:target "_blank"} body]])))))
(defn boldify [s]
(->> s
(re-seq #"(?sx)
(
(?:
(?!\*)
.
)+
)?
(?:
\*
(
(?:
(?!\*)
.
)+?
)
\*
)?")
(remove (partial every? empty?))
(mapcat (fn [[_ before strong]]
(cond
(not before) [[:strong strong]]
(not strong) [before]
:else [before [:strong strong]])))))
(defn emify [s]
(->> s
(re-seq #"(?xs)
(
(?:
(?!
(?:
(?<=\s|^|\")
\/
([^\/]+)
\/
)
)
.
)+
)?
(?:
(?<=\s|^|\")
\/
([^\/]+)
\/
)?")
(remove (partial every? empty?))
(mapcat (fn [[_ before em]]
(cond
(not before) [[:em em]]
(not em) [before]
:else [before [:em em]])))))
(defn code-ify [s]
(->> s
(re-seq #"(?sx)
(
(?:
(?!
=
(.+?)
=
)
.
)+
)?
(?:
=
(.+?)
=
)?")
(remove (partial every? empty?))
(mapcat (fn [[_ before code]]
(cond
(not before) [[:code code]]
(not code) [before]
:else [before [:code code]])))))
(defn strike-ify [s]
(->> s
(re-seq #"(?sx)
(
(?:
(?!
\+
(?!\s+)
(.+?)
(?!\s+)
\+
)
.
)+
)?
(?:
\+
(?!\s+)
(.+?)
(?!\s+)
\+
)?")
(remove (partial every? empty?))
(mapcat (fn [[_ before strike]]
(cond
(not before) [[:strike strike]]
(not strike) [before]
:else [before [:strike strike]])))))
(defn hr-ify [s]
(->> s
(re-seq #"(?sx)
(
(?:
(?!
(?<=^|\n)
-{5,}
)
.
)+
)?
(
(?<=^|\n)
-{5,}
)?")
(remove (partial every? empty?))
(mapcat (fn [[_ before hr]]
(cond
(not before) [[:hr]]
(not hr) [before]
:else [before [:hr]])))))
(defn srcify [txt]
(->> txt
(re-seq #"(?xs)
(
(?:
(?!
\#\+BEGIN_SRC\s+
\S+
\n
.+?
\#\+END_SRC\n
)
.
)+
)?
(?:
\#\+BEGIN_SRC\s+
(\S+)
\n
(.+?)
\#\+END_SRC\n
)?")
(remove (partial every? empty?))
(mapcat (fn [[_ before lang block]]
(cond
(not before) [[:pre [:code {:class (str "lang-" lang)} block]]]
(not block) [before]
:else [before [:pre [:code {:class (str "lang-" lang)} block]]])))))
(defn quotify [txt]
(->> txt
(re-seq #"(?xs)
(
(?:
(?!
\#\+BEGIN_QUOTE\n
.+?
\#\+END_QUOTE\n
)
.
)+
)?
(?:
\#\+BEGIN_QUOTE\n
(.+?)
\#\+END_QUOTE\n
)?")
(remove (partial every? empty?))
(mapcat (fn [[_ before block]]
(cond
(not before) [[:blockquote block]]
(not block) [before]
:else [before [:blockquote block]])))))
(defn example-ify [txt]
(->> txt
(re-seq #"(?xs)
(
(?:
(?!
\#\+BEGIN_EXAMPLE\n
.+?
\#\+END_EXAMPLE\n
)
.
)+
)?
(?:
\#\+BEGIN_EXAMPLE\n
(.+?)
\#\+END_EXAMPLE\n
)?")
(remove (partial every? empty?))
(mapcat (fn [[_ before block]]
(cond
(not before) [[:pre (escape-html block)]]
(not block) [before]
:else [before [:pre (escape-html block)]])))))
(defn dashify [txt]
(-> txt
(clojure.string/replace #"---" "—")
(clojure.string/replace #"--" "–")))
(defn get-plain-lists
"
Get plain lists and surrounding content out of txt. Defer actual
parsing of plain lists.
"
[txt]
(->> txt
(re-seq #"(?xs)
(
(?:
(?!
(?<=\n|^)
\ *
-
\ +
[^\n]
+\n
(?:
(?<=\n)
(?:\ *-\ +|\ +)
[^\n]+
\n
)*
)
.
)+
)?
(
(?<=\n|^)
\ *
-
\ +
[^\n]+
\n
(?:
(?<=\n)
(?:\ *-\ +|\ +)
[^\n]+
\n
)*
)?")
(map rest)
(remove (partial every? empty?))))
(defn items-seq-to-tree
"
Convert seq of [level, content] pairs into a tree using zippers.
Assumes deltas are a whole multiple of two for now.
"
[s]
(loop [[[level x] & more] s
prev 0
ret (-> [:ul] zip/vector-zip zip/down)]
(if-not x
(zip/root ret) ;; We're done.
;; ... otherwise, figure out where in tree to insert node:
(recur more level
(let [delta (/ (- prev level) 2)]
(cond
(> level prev) (-> ret
(zip/insert-right [:ul])
zip/right
zip/down
(zip/insert-right [:li x])
zip/right)
(< level prev) (-> ret
(#(last (take (inc delta)
(iterate zip/up %))))
(zip/insert-right [:li x])
zip/right)
:else ;; Simple case -- same level:
(-> ret
(zip/insert-right [:li x])
zip/right)))))))
(defn strip-leading-spaces
"
Strip leading spaces from every line in input.
"
[txt]
(let [txt-lines (clojure.string/split txt #"\n")
spaces-to-strip (->> txt-lines
(map (partial re-find #"^( *)"))
(map (comp count second))
(apply min))]
(apply str
(interleave
(map (comp (partial apply str)
(partial drop spaces-to-strip))
txt-lines)
(repeat \newline)))))
(defn parse-plain-list [txt]
(->> txt
strip-leading-spaces
(re-seq #"(?xs)
(?<=\n|^)
(\ *)-\ +
(
(?:
(?!(?<=\n|^)\ *-\ )
.
)+
)")
(map rest)
(map (juxt (comp count first) second))
items-seq-to-tree))
(defn plain-listify [txt]
(->> txt
get-plain-lists
(mapcat (fn [[before-txt list-txt]]
(cond
(not before-txt) [(parse-plain-list list-txt)]
(not list-txt) [before-txt]
:else [before-txt (parse-plain-list list-txt)])))))
(defn tree-linkify [tree] (apply-fn-to-strings linkify tree))
(defn tree-captionify [tree] (apply-fn-to-strings captionify tree))
(defn tree-boldify [tree] (apply-fn-to-strings boldify tree))
(defn tree-emify [tree] (apply-fn-to-strings emify tree))
(defn tree-code-ify [tree] (apply-fn-to-strings code-ify tree))
(defn tree-strike-ify [tree] (apply-fn-to-strings strike-ify tree))
(defn tree-hr-ify [tree] (apply-fn-to-strings hr-ify tree))
(defn tree-srcify [tree] (apply-fn-to-strings srcify tree))
(defn tree-example-ify [tree] (apply-fn-to-strings example-ify tree))
(defn tree-pars [tree] (apply-fn-to-strings find-paragraphs tree))
(defn tree-dashify [tree] (apply-fn-to-strings dashify tree))
(defn tree-listify [tree] (apply-fn-to-strings plain-listify tree))
(defn tree-quotify [tree] (apply-fn-to-strings quotify tree))
(defn ^:private txt->lines [txt]
(clojure.string/split txt #"\n"))
(defn parse-org [txt]
(let [title (get-title txt)
[hdrs body] (split-headers-and-body txt)
slurped-lines (-> txt escape-html txt->lines)
content (-> body
strip-raw-html-tags-for-now
convert-body-to-sections
tree-srcify
tree-example-ify
tree-quotify
tree-listify
tree-pars
tree-code-ify
tree-linkify
tree-captionify
tree-boldify
tree-emify
tree-strike-ify
tree-hr-ify
tree-dashify)]
{:title title
:headers hdrs
:content content}))
(comment
(parse-org "
Asdf =*foo*= jkl
")
(parse-org "
* testing 123
#+BEGIN_SRC clojure
Foo bar baz *1234* 123
#+END_SRC
")
(parse-org "#+TITLE: This is an Org Mode file.
* This is the outer section
** This is an inner section
Inner section body -- /with italic text/! And *bold text* too.
- Plain List Item 1
- Plain List Item 2
[[][A link to a Web site]]
")
;;=>
{:title "This is an Org Mode file.",
:headers "\n#+TITLE: This is an Org Mode file.\n\n",
:content
[:div
[:h1 [:p "This is the outer section"]]
[:h2 [:p "This is an inner section"]]
[:span
[:p
[:span
[:span
"Inner section body – "
[:em "with italic text"]
"! And "]
[:strong "bold text"]
" too.\n"]]
[:ul
[:li [:p "Plain List Item 1\n"]]
[:li [:p "Plain List Item 2\n"]]]
[:p
[:span
[:a {:href ""} "A link to a Web site"]
"\n"]]]]})
| null | https://raw.githubusercontent.com/lilactown/lilac.town/295669e4511e79877da14232457dea26f098acd8/src/clj_org/org.clj | clojure | We're done.
... otherwise, figure out where in tree to insert node:
Simple case -- same level:
=> | (ns clj-org.org
(:require [clj-org.util :refer [vec* selective-walk]]
[clojure.string :as str]
[clojure.zip :as zip]
[hiccup.util :refer [escape-html]]))
(defn header-value-for [field txt]
(->> txt
(re-seq (->> field
(format "\\#\\+%s: (.+?)\n")
re-pattern))
(map second)
last))
(defn get-title [txt] (header-value-for "TITLE" txt))
(defn get-draft [txt]
(->> txt (header-value-for "DRAFT") Boolean/valueOf))
(defn get-tags [txt] (header-value-for "TAGS" txt))
(defn strip-raw-html-tags-for-now [txt]
(-> txt
(clojure.string/replace #"#\+(?:HTML|ATTR_HTML):.+?\n" "")
(clojure.string/replace #"(?sx)
\#\+BEGIN_HTML\s*
.*?
\#\+END_HTML\s*" "")))
(defn ^:private descend? [el]
(and (coll? el)
(not (string? el))
(not (map? el))
(not= :pre (first el))
(not= :code (first el))))
(defn apply-fn-to-strings
"
Walk tree, applying f to each string. If multiple terms result, put
them inside a :span tag.
"
[f tree]
(let [f (fn [el]
(let [[r0 & rs :as r] (f el)]
(cond
(string? r) r
rs (vec* :span r)
:else r0)))]
(selective-walk f descend? string? tree)))
(defn split-headers-and-body [txt]
(let [[_ & rs]
(re-find #"(?x)
(\n* # Pick up trailing newlines
(?:\# # Anything starting w/ '#'
(?: # Not starting with:
(?!\+(?:HTML:|CAPTION|BEGIN|ATTR_HTML))
# Swallow all lines that match
.)+\n*)*)
# Swallow everything else as group 2
((?s)(?:.+)*)"
txt)]
rs))
(defn convert-body-to-sections [body]
(let [matches
(re-seq #"(?x)
(?:
(?:
(\*+)
\s+
(.+)
\n
)|
(
(?:
(?!\*+\s+)
.*\n
)*
)
)"
body)]
(->> (for [[_ stars hdr body] matches]
(if stars
[(-> stars
count
((partial str "h"))
keyword)
[:a {:id (str/lower-case hdr)
:href (str/lower-case
(str "#"
(str/replace hdr " " "-")))} hdr]]
body))
(remove #{""})
(vec* :div))))
(defn find-paragraphs [s]
(->> s
(re-seq #"(?x)
((?:.+\n?)+)
|
(?:\n{2,})")
(map (comp (partial vec* :p) rest))))
(defn captionify [s]
(->> s
(re-seq #"(?sx)
(
(?:
(?!\[\[)
.
)+
)?
(?:
\[\[
(.+?)
\]\]
)?")
(remove (partial every? empty?))
(mapcat (fn [[_ before img]]
(cond
(not before) [[:a {:href img} [:img {:src img
:class "caption"}]]]
(not img) [before]
:else [before [:a {:href img}
[:img {:src img
:class "caption"}]]])))))
(defn linkify [s]
(->> s
(re-seq #"(?sx)
(
(?:
(?!
\[\[.+?\]\[.+?\]\]
)
.
)+
)?
(?:
\[\[
(.+?)
\]\[
(.+?)
\]\]
)?")
(remove (partial every? empty?))
(mapcat (fn [[_ before lnk body]]
(cond
(not before) [[:a {:href lnk
:target "_blank"} body]]
(not lnk) [before]
:else [before [:a {:href lnk
:target "_blank"} body]])))))
(defn boldify [s]
(->> s
(re-seq #"(?sx)
(
(?:
(?!\*)
.
)+
)?
(?:
\*
(
(?:
(?!\*)
.
)+?
)
\*
)?")
(remove (partial every? empty?))
(mapcat (fn [[_ before strong]]
(cond
(not before) [[:strong strong]]
(not strong) [before]
:else [before [:strong strong]])))))
(defn emify [s]
(->> s
(re-seq #"(?xs)
(
(?:
(?!
(?:
(?<=\s|^|\")
\/
([^\/]+)
\/
)
)
.
)+
)?
(?:
(?<=\s|^|\")
\/
([^\/]+)
\/
)?")
(remove (partial every? empty?))
(mapcat (fn [[_ before em]]
(cond
(not before) [[:em em]]
(not em) [before]
:else [before [:em em]])))))
(defn code-ify [s]
(->> s
(re-seq #"(?sx)
(
(?:
(?!
=
(.+?)
=
)
.
)+
)?
(?:
=
(.+?)
=
)?")
(remove (partial every? empty?))
(mapcat (fn [[_ before code]]
(cond
(not before) [[:code code]]
(not code) [before]
:else [before [:code code]])))))
(defn strike-ify [s]
(->> s
(re-seq #"(?sx)
(
(?:
(?!
\+
(?!\s+)
(.+?)
(?!\s+)
\+
)
.
)+
)?
(?:
\+
(?!\s+)
(.+?)
(?!\s+)
\+
)?")
(remove (partial every? empty?))
(mapcat (fn [[_ before strike]]
(cond
(not before) [[:strike strike]]
(not strike) [before]
:else [before [:strike strike]])))))
(defn hr-ify [s]
(->> s
(re-seq #"(?sx)
(
(?:
(?!
(?<=^|\n)
-{5,}
)
.
)+
)?
(
(?<=^|\n)
-{5,}
)?")
(remove (partial every? empty?))
(mapcat (fn [[_ before hr]]
(cond
(not before) [[:hr]]
(not hr) [before]
:else [before [:hr]])))))
(defn srcify [txt]
(->> txt
(re-seq #"(?xs)
(
(?:
(?!
\#\+BEGIN_SRC\s+
\S+
\n
.+?
\#\+END_SRC\n
)
.
)+
)?
(?:
\#\+BEGIN_SRC\s+
(\S+)
\n
(.+?)
\#\+END_SRC\n
)?")
(remove (partial every? empty?))
(mapcat (fn [[_ before lang block]]
(cond
(not before) [[:pre [:code {:class (str "lang-" lang)} block]]]
(not block) [before]
:else [before [:pre [:code {:class (str "lang-" lang)} block]]])))))
(defn quotify [txt]
(->> txt
(re-seq #"(?xs)
(
(?:
(?!
\#\+BEGIN_QUOTE\n
.+?
\#\+END_QUOTE\n
)
.
)+
)?
(?:
\#\+BEGIN_QUOTE\n
(.+?)
\#\+END_QUOTE\n
)?")
(remove (partial every? empty?))
(mapcat (fn [[_ before block]]
(cond
(not before) [[:blockquote block]]
(not block) [before]
:else [before [:blockquote block]])))))
(defn example-ify [txt]
(->> txt
(re-seq #"(?xs)
(
(?:
(?!
\#\+BEGIN_EXAMPLE\n
.+?
\#\+END_EXAMPLE\n
)
.
)+
)?
(?:
\#\+BEGIN_EXAMPLE\n
(.+?)
\#\+END_EXAMPLE\n
)?")
(remove (partial every? empty?))
(mapcat (fn [[_ before block]]
(cond
(not before) [[:pre (escape-html block)]]
(not block) [before]
:else [before [:pre (escape-html block)]])))))
(defn dashify [txt]
(-> txt
(clojure.string/replace #"---" "—")
(clojure.string/replace #"--" "–")))
(defn get-plain-lists
"
Get plain lists and surrounding content out of txt. Defer actual
parsing of plain lists.
"
[txt]
(->> txt
(re-seq #"(?xs)
(
(?:
(?!
(?<=\n|^)
\ *
-
\ +
[^\n]
+\n
(?:
(?<=\n)
(?:\ *-\ +|\ +)
[^\n]+
\n
)*
)
.
)+
)?
(
(?<=\n|^)
\ *
-
\ +
[^\n]+
\n
(?:
(?<=\n)
(?:\ *-\ +|\ +)
[^\n]+
\n
)*
)?")
(map rest)
(remove (partial every? empty?))))
(defn items-seq-to-tree
"
Convert seq of [level, content] pairs into a tree using zippers.
Assumes deltas are a whole multiple of two for now.
"
[s]
(loop [[[level x] & more] s
prev 0
ret (-> [:ul] zip/vector-zip zip/down)]
(if-not x
(recur more level
(let [delta (/ (- prev level) 2)]
(cond
(> level prev) (-> ret
(zip/insert-right [:ul])
zip/right
zip/down
(zip/insert-right [:li x])
zip/right)
(< level prev) (-> ret
(#(last (take (inc delta)
(iterate zip/up %))))
(zip/insert-right [:li x])
zip/right)
(-> ret
(zip/insert-right [:li x])
zip/right)))))))
(defn strip-leading-spaces
"
Strip leading spaces from every line in input.
"
[txt]
(let [txt-lines (clojure.string/split txt #"\n")
spaces-to-strip (->> txt-lines
(map (partial re-find #"^( *)"))
(map (comp count second))
(apply min))]
(apply str
(interleave
(map (comp (partial apply str)
(partial drop spaces-to-strip))
txt-lines)
(repeat \newline)))))
(defn parse-plain-list [txt]
(->> txt
strip-leading-spaces
(re-seq #"(?xs)
(?<=\n|^)
(\ *)-\ +
(
(?:
(?!(?<=\n|^)\ *-\ )
.
)+
)")
(map rest)
(map (juxt (comp count first) second))
items-seq-to-tree))
(defn plain-listify [txt]
(->> txt
get-plain-lists
(mapcat (fn [[before-txt list-txt]]
(cond
(not before-txt) [(parse-plain-list list-txt)]
(not list-txt) [before-txt]
:else [before-txt (parse-plain-list list-txt)])))))
(defn tree-linkify [tree] (apply-fn-to-strings linkify tree))
(defn tree-captionify [tree] (apply-fn-to-strings captionify tree))
(defn tree-boldify [tree] (apply-fn-to-strings boldify tree))
(defn tree-emify [tree] (apply-fn-to-strings emify tree))
(defn tree-code-ify [tree] (apply-fn-to-strings code-ify tree))
(defn tree-strike-ify [tree] (apply-fn-to-strings strike-ify tree))
(defn tree-hr-ify [tree] (apply-fn-to-strings hr-ify tree))
(defn tree-srcify [tree] (apply-fn-to-strings srcify tree))
(defn tree-example-ify [tree] (apply-fn-to-strings example-ify tree))
(defn tree-pars [tree] (apply-fn-to-strings find-paragraphs tree))
(defn tree-dashify [tree] (apply-fn-to-strings dashify tree))
(defn tree-listify [tree] (apply-fn-to-strings plain-listify tree))
(defn tree-quotify [tree] (apply-fn-to-strings quotify tree))
(defn ^:private txt->lines [txt]
(clojure.string/split txt #"\n"))
(defn parse-org [txt]
(let [title (get-title txt)
[hdrs body] (split-headers-and-body txt)
slurped-lines (-> txt escape-html txt->lines)
content (-> body
strip-raw-html-tags-for-now
convert-body-to-sections
tree-srcify
tree-example-ify
tree-quotify
tree-listify
tree-pars
tree-code-ify
tree-linkify
tree-captionify
tree-boldify
tree-emify
tree-strike-ify
tree-hr-ify
tree-dashify)]
{:title title
:headers hdrs
:content content}))
(comment
(parse-org "
Asdf =*foo*= jkl
")
(parse-org "
* testing 123
#+BEGIN_SRC clojure
Foo bar baz *1234* 123
#+END_SRC
")
(parse-org "#+TITLE: This is an Org Mode file.
* This is the outer section
** This is an inner section
Inner section body -- /with italic text/! And *bold text* too.
- Plain List Item 1
- Plain List Item 2
[[][A link to a Web site]]
")
{:title "This is an Org Mode file.",
:headers "\n#+TITLE: This is an Org Mode file.\n\n",
:content
[:div
[:h1 [:p "This is the outer section"]]
[:h2 [:p "This is an inner section"]]
[:span
[:p
[:span
[:span
"Inner section body – "
[:em "with italic text"]
"! And "]
[:strong "bold text"]
" too.\n"]]
[:ul
[:li [:p "Plain List Item 1\n"]]
[:li [:p "Plain List Item 2\n"]]]
[:p
[:span
[:a {:href ""} "A link to a Web site"]
"\n"]]]]})
|
5407f57c1558f88d99c9e27b7ab109019071664130d6defa477940aa8a2b176d | lixiangqi/medic | src2-medic.rkt | #lang medic
(layer layer1
(in #:module "src2.rkt"
match two instances of ( inc - counter )
[at (inc-counter) [on-entry @log{[1] in @function-name : int-counter}]]
match two instances of ( + x 1 )
[at (+ x 1) #:before (inc-counter) [on-entry @log{[2]in @function-name : (+ x 1)}]]
only match ( + x 1 ) in g function
[at (+ x 1) #:before (begin (define x (inc 4)) _)
[on-entry @log{[3]in @function-name : (+ x 1)}]]
[(g) [at (+ x 1) [on-entry @log{[4]in @function-name : (+ x 1)}]]]
; only match (inc-counter) in function g
[at (inc-counter) #:before (define x (inc 4)) #:after (+ x 1)
(on-entry @log{[5]in @function-name : (inc-counter)})]
[at (inc-counter) #:before (define x (inc _)) #:after (+ x 1)
(on-entry @log{[6]in @function-name : (inc-counter)})]))
| null | https://raw.githubusercontent.com/lixiangqi/medic/0920090d3c77d6873b8481841622a5f2d13a732c/demos/demo2/src2-medic.rkt | racket | only match (inc-counter) in function g | #lang medic
(layer layer1
(in #:module "src2.rkt"
match two instances of ( inc - counter )
[at (inc-counter) [on-entry @log{[1] in @function-name : int-counter}]]
match two instances of ( + x 1 )
[at (+ x 1) #:before (inc-counter) [on-entry @log{[2]in @function-name : (+ x 1)}]]
only match ( + x 1 ) in g function
[at (+ x 1) #:before (begin (define x (inc 4)) _)
[on-entry @log{[3]in @function-name : (+ x 1)}]]
[(g) [at (+ x 1) [on-entry @log{[4]in @function-name : (+ x 1)}]]]
[at (inc-counter) #:before (define x (inc 4)) #:after (+ x 1)
(on-entry @log{[5]in @function-name : (inc-counter)})]
[at (inc-counter) #:before (define x (inc _)) #:after (+ x 1)
(on-entry @log{[6]in @function-name : (inc-counter)})]))
|
7b17f7d378989c88e8d36ab720d576d5063eb6e9d7395795d2e6d483e0734ee1 | hspec/hspec | Sort.hs | -- |
-- /NOTE:/ This module is not meant for public consumption. For user
documentation look at -discover.html .
module Test.Hspec.Discover.Sort (
sortNaturallyBy
, NaturalSortKey
, naturalSortKey
) where
import Control.Arrow
import Data.Char
import Data.List
import Data.Ord
sortNaturallyBy :: (a -> (String, Int)) -> [a] -> [a]
sortNaturallyBy f = sortBy (comparing ((\ (k, t) -> (naturalSortKey k, t)) . f))
newtype NaturalSortKey = NaturalSortKey [Chunk]
deriving (Eq, Ord)
data Chunk = Numeric Integer Int | Textual [(Char, Char)]
deriving (Eq, Ord)
naturalSortKey :: String -> NaturalSortKey
naturalSortKey = NaturalSortKey . chunks
where
chunks [] = []
chunks s@(c:_)
| isDigit c = Numeric (read num) (length num) : chunks afterNum
| otherwise = Textual (map (toLower &&& id) str) : chunks afterStr
where
(num, afterNum) = span isDigit s
(str, afterStr) = break isDigit s
| null | https://raw.githubusercontent.com/hspec/hspec/5029c7c2acaf743f17120619279fc76a0fb97e7a/hspec-discover/src/Test/Hspec/Discover/Sort.hs | haskell | |
/NOTE:/ This module is not meant for public consumption. For user | documentation look at -discover.html .
module Test.Hspec.Discover.Sort (
sortNaturallyBy
, NaturalSortKey
, naturalSortKey
) where
import Control.Arrow
import Data.Char
import Data.List
import Data.Ord
sortNaturallyBy :: (a -> (String, Int)) -> [a] -> [a]
sortNaturallyBy f = sortBy (comparing ((\ (k, t) -> (naturalSortKey k, t)) . f))
newtype NaturalSortKey = NaturalSortKey [Chunk]
deriving (Eq, Ord)
data Chunk = Numeric Integer Int | Textual [(Char, Char)]
deriving (Eq, Ord)
naturalSortKey :: String -> NaturalSortKey
naturalSortKey = NaturalSortKey . chunks
where
chunks [] = []
chunks s@(c:_)
| isDigit c = Numeric (read num) (length num) : chunks afterNum
| otherwise = Textual (map (toLower &&& id) str) : chunks afterStr
where
(num, afterNum) = span isDigit s
(str, afterStr) = break isDigit s
|
c14a8f4f709695ede3f77348728a25b3f3ded420da60f3f8de3944b7eae98a49 | pixlsus/registry.gimp.org_static | Lightning.scm | ;;------ Lightning -------------------------
; Create a lightning effect using the plasma plug-in
(define (script-fu-lightning width height hue sat turbulence desat)
; Create an img and a layer. width <-> height so we can rotate later
(let* ((img (car (gimp-image-new height width 0)))
(mainLayer (car (gimp-layer-new img height width 0 "Lightning" 100 0)))
(secondLayer (car (gimp-layer-new img height width 0 "Plasma Layer" 100 6)))
)
(gimp-image-undo-disable img)
(gimp-image-add-layer img mainLayer 0)
(gimp-image-add-layer img secondLayer -1)
( gimp - context - set - gradient " FG to BG ( RGB ) " ) -- set in gimp - edit - blend
(gimp-context-set-foreground '(0 0 0))
(gimp-context-set-background '(191 191 191))
(gimp-edit-blend mainLayer 0 0 0 100 0 0 FALSE FALSE 1 0.0 TRUE 0 0 0 height)
(plug-in-plasma 1 img secondLayer (rand) turbulence)
(gimp-desaturate-full secondLayer desat)
Merge the second with the first and assign the resulting layer back to the first
(set! mainLayer (car (gimp-image-merge-down img secondLayer 0)))
(gimp-invert mainLayer)
(gimp-levels mainLayer 0 127 255 0.1 0 255)
TODO - convert RGB to HSV and use SF - COLOR
(gimp-image-rotate img 0) ; Rotate so the lightning bolt is vertical
(gimp-display-new img)
(gimp-image-undo-enable img)
))
(script-fu-register "script-fu-lightning"
"<Toolbox>/Xtns/Patterns/Lightning"
"Creates lightning"
"David Hari"
"Taken from tomcat's lightning tutorial - /"
"2008"
""
SF-VALUE "Width" "256"
SF-VALUE "Height" "256"
SF-ADJUSTMENT "Hue" '(250 0 360 1 5 0 0)
SF-ADJUSTMENT "Saturation" '(100 0 100 1 10 0 0)
SF-ADJUSTMENT "Turbulence" '(0.4 0.1 2.0 0.1 0.1 1 0)
SF-OPTION "Desaturation method" '("Lightness" "Luminosity")
)
;;------ Lightning Animation ---------------
; Renders the lightning effect as an animation.
(define (script-fu-anim-lightning width height hue sat frames
turbStart turbEnd randMovement desat)
Create the img . height so we can rotate later
(let* ((img (car (gimp-image-new height width 0)))
(randNum (rand))
(turbVal turbStart)
(i 0)
)
(gimp-image-undo-disable img)
(gimp-context-set-foreground '(0 0 0))
(gimp-context-set-background '(191 191 191))
(while (< i frames) ;; TODO - put frame no. in string
(let* ((mainLayer (car (gimp-layer-new img height width 0 "Frame" 100 0)))
(secondLayer (car (gimp-layer-new img height width 0 "Plasma Layer" 100 6)))
)
(gimp-image-add-layer img mainLayer -1)
(gimp-image-add-layer img secondLayer -1)
(gimp-edit-blend mainLayer 0 0 0 100 0 0 FALSE FALSE 1 0.0 TRUE 0 0 0 height)
; Increment the turbulence to reach the end value
(set! turbVal (+ turbVal (/ (- turbEnd turbStart) frames)))
(plug-in-plasma 1 img secondLayer randNum turbVal)
(gimp-desaturate-full secondLayer desat)
Merge the second with the first and assign the resulting layer back to the first
(set! mainLayer (car (gimp-image-merge-down img secondLayer 0)))
(gimp-invert mainLayer)
(gimp-levels mainLayer 0 127 255 0.1 0 255)
TODO - convert RGB to HSV
(if (= randMovement TRUE)
(set! randNum (rand)) ; Pick a new random number
'()
)
(set! i (+ i 1))
)
)
(gimp-image-rotate img 0) ; Rotate so the lightning bolt is vertical
(gimp-display-new img)
(gimp-image-undo-enable img)
))
(script-fu-register "script-fu-anim-lightning"
"<Toolbox>/Xtns/Anim/Lightning"
"Creates the lightning effect as an animation."
"David Hari"
""
"2008"
""
SF-VALUE "Width" "256"
SF-VALUE "Height" "256"
SF-ADJUSTMENT "Hue" '(250 0 360 1 5 0 0)
SF-ADJUSTMENT "Saturation" '(100 0 100 1 10 0 0)
SF-ADJUSTMENT "No. of frames" '(10 1 100 1 5 0 1)
SF-ADJUSTMENT "Turbulence start" '(0.4 0.1 2.0 0.1 0.1 1 0)
SF-ADJUSTMENT "Turbulence end" '(1.0 0.1 2.0 0.1 0.1 1 0)
SF-TOGGLE "Random movement" TRUE
SF-OPTION "Desaturation method" '("Lightness" "Luminosity")
)
| null | https://raw.githubusercontent.com/pixlsus/registry.gimp.org_static/ffcde7400f402728373ff6579947c6ffe87d1a5e/registry.gimp.org/files/Lightning.scm | scheme | ------ Lightning -------------------------
Create a lightning effect using the plasma plug-in
Create an img and a layer. width <-> height so we can rotate later
Rotate so the lightning bolt is vertical
------ Lightning Animation ---------------
Renders the lightning effect as an animation.
TODO - put frame no. in string
Increment the turbulence to reach the end value
Pick a new random number
Rotate so the lightning bolt is vertical
|
(define (script-fu-lightning width height hue sat turbulence desat)
(let* ((img (car (gimp-image-new height width 0)))
(mainLayer (car (gimp-layer-new img height width 0 "Lightning" 100 0)))
(secondLayer (car (gimp-layer-new img height width 0 "Plasma Layer" 100 6)))
)
(gimp-image-undo-disable img)
(gimp-image-add-layer img mainLayer 0)
(gimp-image-add-layer img secondLayer -1)
( gimp - context - set - gradient " FG to BG ( RGB ) " ) -- set in gimp - edit - blend
(gimp-context-set-foreground '(0 0 0))
(gimp-context-set-background '(191 191 191))
(gimp-edit-blend mainLayer 0 0 0 100 0 0 FALSE FALSE 1 0.0 TRUE 0 0 0 height)
(plug-in-plasma 1 img secondLayer (rand) turbulence)
(gimp-desaturate-full secondLayer desat)
Merge the second with the first and assign the resulting layer back to the first
(set! mainLayer (car (gimp-image-merge-down img secondLayer 0)))
(gimp-invert mainLayer)
(gimp-levels mainLayer 0 127 255 0.1 0 255)
TODO - convert RGB to HSV and use SF - COLOR
(gimp-display-new img)
(gimp-image-undo-enable img)
))
(script-fu-register "script-fu-lightning"
"<Toolbox>/Xtns/Patterns/Lightning"
"Creates lightning"
"David Hari"
"Taken from tomcat's lightning tutorial - /"
"2008"
""
SF-VALUE "Width" "256"
SF-VALUE "Height" "256"
SF-ADJUSTMENT "Hue" '(250 0 360 1 5 0 0)
SF-ADJUSTMENT "Saturation" '(100 0 100 1 10 0 0)
SF-ADJUSTMENT "Turbulence" '(0.4 0.1 2.0 0.1 0.1 1 0)
SF-OPTION "Desaturation method" '("Lightness" "Luminosity")
)
(define (script-fu-anim-lightning width height hue sat frames
turbStart turbEnd randMovement desat)
Create the img . height so we can rotate later
(let* ((img (car (gimp-image-new height width 0)))
(randNum (rand))
(turbVal turbStart)
(i 0)
)
(gimp-image-undo-disable img)
(gimp-context-set-foreground '(0 0 0))
(gimp-context-set-background '(191 191 191))
(let* ((mainLayer (car (gimp-layer-new img height width 0 "Frame" 100 0)))
(secondLayer (car (gimp-layer-new img height width 0 "Plasma Layer" 100 6)))
)
(gimp-image-add-layer img mainLayer -1)
(gimp-image-add-layer img secondLayer -1)
(gimp-edit-blend mainLayer 0 0 0 100 0 0 FALSE FALSE 1 0.0 TRUE 0 0 0 height)
(set! turbVal (+ turbVal (/ (- turbEnd turbStart) frames)))
(plug-in-plasma 1 img secondLayer randNum turbVal)
(gimp-desaturate-full secondLayer desat)
Merge the second with the first and assign the resulting layer back to the first
(set! mainLayer (car (gimp-image-merge-down img secondLayer 0)))
(gimp-invert mainLayer)
(gimp-levels mainLayer 0 127 255 0.1 0 255)
TODO - convert RGB to HSV
(if (= randMovement TRUE)
'()
)
(set! i (+ i 1))
)
)
(gimp-display-new img)
(gimp-image-undo-enable img)
))
(script-fu-register "script-fu-anim-lightning"
"<Toolbox>/Xtns/Anim/Lightning"
"Creates the lightning effect as an animation."
"David Hari"
""
"2008"
""
SF-VALUE "Width" "256"
SF-VALUE "Height" "256"
SF-ADJUSTMENT "Hue" '(250 0 360 1 5 0 0)
SF-ADJUSTMENT "Saturation" '(100 0 100 1 10 0 0)
SF-ADJUSTMENT "No. of frames" '(10 1 100 1 5 0 1)
SF-ADJUSTMENT "Turbulence start" '(0.4 0.1 2.0 0.1 0.1 1 0)
SF-ADJUSTMENT "Turbulence end" '(1.0 0.1 2.0 0.1 0.1 1 0)
SF-TOGGLE "Random movement" TRUE
SF-OPTION "Desaturation method" '("Lightness" "Luminosity")
)
|
96a88e1e484612c72a4e773ef69077d5ca9dfca9adf0635ff937b12fa777b392 | 0x0f0f0f/gobba | primutil.ml | open Types
let parser = Parser.toplevel Lexer.token
(** An helper function that helps extracting closures from strings,
to be used as functions in the standard library. An empty environment is used
since primitives in the standard library should not be able to access external values
TODO: compute at compile time *)
let lambda_of_string name str =
try
(match (List.hd (parser (Lexing.from_string (str ^ "\n")))) with
| Expr(Lambda(p, body)) -> LazyExpression (Lambda(p, body))
| _ -> failwith "standard library definition error")
with
| e -> failwith ("standard library definition error in " ^ name ^ ": \n" ^
(Printexc.print_backtrace stderr; Printexc.to_string e))
| null | https://raw.githubusercontent.com/0x0f0f0f/gobba/61092207438fb102e36245c46c27a711b8f357cb/lib/primitives/primutil.ml | ocaml | * An helper function that helps extracting closures from strings,
to be used as functions in the standard library. An empty environment is used
since primitives in the standard library should not be able to access external values
TODO: compute at compile time | open Types
let parser = Parser.toplevel Lexer.token
let lambda_of_string name str =
try
(match (List.hd (parser (Lexing.from_string (str ^ "\n")))) with
| Expr(Lambda(p, body)) -> LazyExpression (Lambda(p, body))
| _ -> failwith "standard library definition error")
with
| e -> failwith ("standard library definition error in " ^ name ^ ": \n" ^
(Printexc.print_backtrace stderr; Printexc.to_string e))
|
10a53a36da384088c01e0613039dbb9c54ed115b5816aa30c4b0ca2f0cd5d8a3 | cljdoc/cljdoc | fixref.clj | (ns cljdoc.util.fixref
"Utilities to rewrite, or support the rewrite of, references in markdown rendered to HTML.
For example, external links are rewritten to include nofollow, links to ingested SCM
articles are rewritten to their slugs, and scm relative references are rewritten to point to SCM."
(:require [clojure.tools.logging :as log]
[clojure.java.io :as io]
[clojure.string :as string]
[cljdoc.util.scm :as scm]
[cljdoc.server.routes :as routes])
(:import (org.jsoup Jsoup)
(org.jsoup.nodes Document Element Attributes)))
(set! *warn-on-reflection* true)
(defn- absolute-uri? [s]
(or (string/starts-with? s "http://")
(string/starts-with? s "https://")))
(defn- anchor-uri? [s]
(string/starts-with? s "#"))
(defn- split-relpath-anchor
"Returns `[relpath anchor]` for path `s`"
[s]
(rest (re-find #"/?([^#]*)(#.*$)?" s)))
(defn- root-relative-path? [s]
(string/starts-with? s "/"))
(defn- get-cljdoc-url-prefix [s]
(first (filter #(string/starts-with? s %) ["" ""])))
(defn- rebase-path
"Rebase path `s1` to directory of relative path `s2`.
When path `s1` is absolute it is returned."
[s1 s2]
(if (root-relative-path? s1)
s1
(let [p2-dir (if (string/ends-with? s2 "/")
s2
(.getParent (io/file s2)))]
(str (io/file p2-dir s1)))))
(defn- normalize-path
"Resolves relative `..` and `.` in path `s`"
[s]
(str (.normalize (.toPath (io/file s)))))
(defn- path-relative-to
"Returns `file-path` from `from-dir-path`.
Both paths must be relative or absolute."
[file-path from-dir-path]
(str (.relativize (.toPath (io/file from-dir-path))
(.toPath (io/file file-path)))))
(defn- error-ref
"When the scm-file-path is unknown, as is currently the case for docstrings, we cannot handle relative refs
and return a error ref."
[ref scm-file-path]
(when (and (not scm-file-path)
(not (root-relative-path? ref)))
"#!cljdoc-error!ref-must-be-root-relative!"))
(defn- fix-link
"Return the cljdoc location for a given URL `href` or it's page on GitHub/GitLab etc."
^String [href {:keys [scm-file-path target-path scm-base uri-map] :as _opts}]
(or (error-ref href scm-file-path)
(let [[href-rel-to-scm-base anchor]
(-> href
(rebase-path scm-file-path)
normalize-path
split-relpath-anchor)]
(if-let [href-local-doc (get uri-map href-rel-to-scm-base)]
(str (if target-path
(path-relative-to href-local-doc target-path)
href-local-doc)
anchor)
(str scm-base href-rel-to-scm-base anchor)))))
(defn- fix-image
^String [src {:keys [scm-file-path scm-base]}]
(or (error-ref src scm-file-path)
(let [suffix (when (and (= :github (scm/provider scm-base))
(string/ends-with? src ".svg"))
"?sanitize=true")]
(if (root-relative-path? src)
(str scm-base (subs src 1) suffix)
(str scm-base (-> src (rebase-path scm-file-path) normalize-path) suffix)))))
(defn uri-mapping
"Returns lookup map where key is SCM repo relative file and value is cljdoc root relative `version-entity`
slug path at for all `docs`.
Ex: `{\"README.md\" \"/d/lread/cljdoc-exerciser/1.0.34/doc/readme}`"
[version-entity docs]
(->> docs
(map (fn [d]
[(-> d :attrs :cljdoc.doc/source-file)
(->> (-> d :attrs :slug-path)
(string/join "/")
(assoc version-entity :article-slug)
(routes/url-for :artifact/doc :path-params))]))
(into {})))
(defn- parse-html ^Document [^String html-str]
(let [doc (Jsoup/parse html-str)
props (.outputSettings doc)]
(.prettyPrint props false)
doc))
(defn fix
"Rewrite references in HTML produced from rendering markdown.
Markdown from SCM can contains references to images and articles.
Relative <a> links are links to SCM:
* an SCM link that is an article that has been imported to cljdoc => local link
(slug for online, html file for offline)
* else => SCM formatted (aka blob) link at correct revision
Absolute <a> links
* when relinking back to cljdoc.org => to root relative to support local testing
* else => converted to nofollow link (this includes links rewritten to point SCM)
Relative <img> references are links to SCM:
- are converted to SCM raw references at correct revision
- svg files from GitHub add special querystring parameters
* `:html-str` the html of the content we are fixing
* `fix-opts` map contains
* `:scm-file-path` SCM repo home relative path of content
* `:target-path` local relative destination path of content, if provided, used to relativize link paths local path (used for offline bundles)
* `:uri-map` - map of relative scm paths to cljdoc doc slugs (or for offline bundles html files)
* `:scm` - scm-info from bundle used to link to correct SCM file revision"
[html-str {:keys [scm-file-path target-path scm uri-map] :as _fix-opts}]
(let [doc (parse-html html-str)]
(doseq [^Attributes scm-relative-link (->> (.select doc "a")
(map (fn [^Element e] (.attributes e)))
(remove (fn [^Attributes a] (= "wikilink" (.get a "data-source"))))
(remove (fn [^Attributes a] (absolute-uri? (.get a "href"))))
(remove (fn [^Attributes a] (anchor-uri? (.get a "href")))))]
(let [fixed-link (fix-link
(.get scm-relative-link "href")
{:scm-file-path scm-file-path
:target-path target-path
:scm-base (scm/rev-formatted-base-url scm)
:uri-map uri-map})]
(.put scm-relative-link "href" fixed-link)))
(doseq [^Attributes scm-relative-img (->> (.select doc "img")
(map (fn [^Element e] (.attributes e)))
(remove (fn [^Attributes a] (absolute-uri? (.get a "src")))))]
(.put scm-relative-img "src" (fix-image (.get scm-relative-img "src")
{:scm-file-path scm-file-path
:scm-base (scm/rev-raw-base-url scm)})))
(doseq [^Attributes absolute-link (->> (.select doc "a")
(map (fn [^Element e] (.attributes e)))
(filter (fn [^Attributes a] (absolute-uri? (.get a "href")))))]
(let [href (.get absolute-link "href")]
(if-let [cljdoc-prefix (get-cljdoc-url-prefix href)]
(.put absolute-link "href" (subs href (count cljdoc-prefix)))
(.put absolute-link "rel" "nofollow"))))
(.. doc body html toString)))
;; Some utilities to find which file in a git repository corresponds
;; to a file where a `def` is coming from --------------------------
(defn- find-full-filepath
"Return best match for `jar-file-path` source in `known-git-file-paths`."
[known-git-file-paths jar-file-path]
(let [matches (filter #(string/ends-with? (str "/" %) (str "/" jar-file-path)) known-git-file-paths)]
(if (= 1 (count matches))
(first matches)
;; choose shortest path where file sits under what looks like a src dir
(let [best-guess (->> matches
(filter (fn [git-file]
(let [src-path (str "/" (subs git-file 0 (- (count git-file) (count jar-file-path))))]
(string/includes? src-path "/src/"))))
maybe 2 paths are same length , so ensure a consistent result by sorting first
(sort-by count)
first)]
(if best-guess
(log/warnf "Did not find unique file on SCM for jar file %s - chose %s from candidates: %s"
jar-file-path best-guess (pr-str matches))
(log/errorf "Did not find unique file on SCM for jar file %s - found no good candidate from candidates: %s"
jar-file-path (pr-str matches)))
best-guess))))
(defn match-files
[known-files fpaths]
{:pre [(seq known-files)]}
(zipmap fpaths (map #(find-full-filepath known-files %) fpaths)))
(comment
(require '[cljdoc.render.rich-text :as rich-text])
(defn doc []
(Jsoup/parse
(rich-text/markdown-to-html (slurp ""))))
(def fix-opts
{:git-ls []
:scm {:url ""
:sha "07c59d1eadd458534c81d6ef8251b5fd5d754a74"}})
(println (Jsoup/parse hs))
(fix fp hs fo)
(rebase "doc/coercion/coercion.md" "../ring/coercion.md")
(rebase fp "route_syntax.md")
(.relativize (.toPath (java.io.File. fp))
(.toPath (java.io.File. "route_syntax.md")))
(fix "README.md"
(rich-text/markdown-to-html (slurp ""))
fix-opts)
(->> (.select (doc) "img")
(map #(.attributes %))
(remove #(or (.startsWith (.get % "src") "http://")
(.startsWith (.get % "src") "https://")))
(map #(doto % (.put "src" (fix-image (.get % "src") fix-opts)))))
(.get (.attributes (first (.select doc "a"))) "href"))
| null | https://raw.githubusercontent.com/cljdoc/cljdoc/c32df6c4cc6a4a5e402907b47aeb900f42a647b0/src/cljdoc/util/fixref.clj | clojure | Some utilities to find which file in a git repository corresponds
to a file where a `def` is coming from --------------------------
choose shortest path where file sits under what looks like a src dir | (ns cljdoc.util.fixref
"Utilities to rewrite, or support the rewrite of, references in markdown rendered to HTML.
For example, external links are rewritten to include nofollow, links to ingested SCM
articles are rewritten to their slugs, and scm relative references are rewritten to point to SCM."
(:require [clojure.tools.logging :as log]
[clojure.java.io :as io]
[clojure.string :as string]
[cljdoc.util.scm :as scm]
[cljdoc.server.routes :as routes])
(:import (org.jsoup Jsoup)
(org.jsoup.nodes Document Element Attributes)))
(set! *warn-on-reflection* true)
(defn- absolute-uri? [s]
(or (string/starts-with? s "http://")
(string/starts-with? s "https://")))
(defn- anchor-uri? [s]
(string/starts-with? s "#"))
(defn- split-relpath-anchor
"Returns `[relpath anchor]` for path `s`"
[s]
(rest (re-find #"/?([^#]*)(#.*$)?" s)))
(defn- root-relative-path? [s]
(string/starts-with? s "/"))
(defn- get-cljdoc-url-prefix [s]
(first (filter #(string/starts-with? s %) ["" ""])))
(defn- rebase-path
"Rebase path `s1` to directory of relative path `s2`.
When path `s1` is absolute it is returned."
[s1 s2]
(if (root-relative-path? s1)
s1
(let [p2-dir (if (string/ends-with? s2 "/")
s2
(.getParent (io/file s2)))]
(str (io/file p2-dir s1)))))
(defn- normalize-path
"Resolves relative `..` and `.` in path `s`"
[s]
(str (.normalize (.toPath (io/file s)))))
(defn- path-relative-to
"Returns `file-path` from `from-dir-path`.
Both paths must be relative or absolute."
[file-path from-dir-path]
(str (.relativize (.toPath (io/file from-dir-path))
(.toPath (io/file file-path)))))
(defn- error-ref
"When the scm-file-path is unknown, as is currently the case for docstrings, we cannot handle relative refs
and return a error ref."
[ref scm-file-path]
(when (and (not scm-file-path)
(not (root-relative-path? ref)))
"#!cljdoc-error!ref-must-be-root-relative!"))
(defn- fix-link
"Return the cljdoc location for a given URL `href` or it's page on GitHub/GitLab etc."
^String [href {:keys [scm-file-path target-path scm-base uri-map] :as _opts}]
(or (error-ref href scm-file-path)
(let [[href-rel-to-scm-base anchor]
(-> href
(rebase-path scm-file-path)
normalize-path
split-relpath-anchor)]
(if-let [href-local-doc (get uri-map href-rel-to-scm-base)]
(str (if target-path
(path-relative-to href-local-doc target-path)
href-local-doc)
anchor)
(str scm-base href-rel-to-scm-base anchor)))))
(defn- fix-image
^String [src {:keys [scm-file-path scm-base]}]
(or (error-ref src scm-file-path)
(let [suffix (when (and (= :github (scm/provider scm-base))
(string/ends-with? src ".svg"))
"?sanitize=true")]
(if (root-relative-path? src)
(str scm-base (subs src 1) suffix)
(str scm-base (-> src (rebase-path scm-file-path) normalize-path) suffix)))))
(defn uri-mapping
"Returns lookup map where key is SCM repo relative file and value is cljdoc root relative `version-entity`
slug path at for all `docs`.
Ex: `{\"README.md\" \"/d/lread/cljdoc-exerciser/1.0.34/doc/readme}`"
[version-entity docs]
(->> docs
(map (fn [d]
[(-> d :attrs :cljdoc.doc/source-file)
(->> (-> d :attrs :slug-path)
(string/join "/")
(assoc version-entity :article-slug)
(routes/url-for :artifact/doc :path-params))]))
(into {})))
(defn- parse-html ^Document [^String html-str]
(let [doc (Jsoup/parse html-str)
props (.outputSettings doc)]
(.prettyPrint props false)
doc))
(defn fix
"Rewrite references in HTML produced from rendering markdown.
Markdown from SCM can contains references to images and articles.
Relative <a> links are links to SCM:
* an SCM link that is an article that has been imported to cljdoc => local link
(slug for online, html file for offline)
* else => SCM formatted (aka blob) link at correct revision
Absolute <a> links
* when relinking back to cljdoc.org => to root relative to support local testing
* else => converted to nofollow link (this includes links rewritten to point SCM)
Relative <img> references are links to SCM:
- are converted to SCM raw references at correct revision
- svg files from GitHub add special querystring parameters
* `:html-str` the html of the content we are fixing
* `fix-opts` map contains
* `:scm-file-path` SCM repo home relative path of content
* `:target-path` local relative destination path of content, if provided, used to relativize link paths local path (used for offline bundles)
* `:uri-map` - map of relative scm paths to cljdoc doc slugs (or for offline bundles html files)
* `:scm` - scm-info from bundle used to link to correct SCM file revision"
[html-str {:keys [scm-file-path target-path scm uri-map] :as _fix-opts}]
(let [doc (parse-html html-str)]
(doseq [^Attributes scm-relative-link (->> (.select doc "a")
(map (fn [^Element e] (.attributes e)))
(remove (fn [^Attributes a] (= "wikilink" (.get a "data-source"))))
(remove (fn [^Attributes a] (absolute-uri? (.get a "href"))))
(remove (fn [^Attributes a] (anchor-uri? (.get a "href")))))]
(let [fixed-link (fix-link
(.get scm-relative-link "href")
{:scm-file-path scm-file-path
:target-path target-path
:scm-base (scm/rev-formatted-base-url scm)
:uri-map uri-map})]
(.put scm-relative-link "href" fixed-link)))
(doseq [^Attributes scm-relative-img (->> (.select doc "img")
(map (fn [^Element e] (.attributes e)))
(remove (fn [^Attributes a] (absolute-uri? (.get a "src")))))]
(.put scm-relative-img "src" (fix-image (.get scm-relative-img "src")
{:scm-file-path scm-file-path
:scm-base (scm/rev-raw-base-url scm)})))
(doseq [^Attributes absolute-link (->> (.select doc "a")
(map (fn [^Element e] (.attributes e)))
(filter (fn [^Attributes a] (absolute-uri? (.get a "href")))))]
(let [href (.get absolute-link "href")]
(if-let [cljdoc-prefix (get-cljdoc-url-prefix href)]
(.put absolute-link "href" (subs href (count cljdoc-prefix)))
(.put absolute-link "rel" "nofollow"))))
(.. doc body html toString)))
(defn- find-full-filepath
"Return best match for `jar-file-path` source in `known-git-file-paths`."
[known-git-file-paths jar-file-path]
(let [matches (filter #(string/ends-with? (str "/" %) (str "/" jar-file-path)) known-git-file-paths)]
(if (= 1 (count matches))
(first matches)
(let [best-guess (->> matches
(filter (fn [git-file]
(let [src-path (str "/" (subs git-file 0 (- (count git-file) (count jar-file-path))))]
(string/includes? src-path "/src/"))))
maybe 2 paths are same length , so ensure a consistent result by sorting first
(sort-by count)
first)]
(if best-guess
(log/warnf "Did not find unique file on SCM for jar file %s - chose %s from candidates: %s"
jar-file-path best-guess (pr-str matches))
(log/errorf "Did not find unique file on SCM for jar file %s - found no good candidate from candidates: %s"
jar-file-path (pr-str matches)))
best-guess))))
(defn match-files
[known-files fpaths]
{:pre [(seq known-files)]}
(zipmap fpaths (map #(find-full-filepath known-files %) fpaths)))
(comment
(require '[cljdoc.render.rich-text :as rich-text])
(defn doc []
(Jsoup/parse
(rich-text/markdown-to-html (slurp ""))))
(def fix-opts
{:git-ls []
:scm {:url ""
:sha "07c59d1eadd458534c81d6ef8251b5fd5d754a74"}})
(println (Jsoup/parse hs))
(fix fp hs fo)
(rebase "doc/coercion/coercion.md" "../ring/coercion.md")
(rebase fp "route_syntax.md")
(.relativize (.toPath (java.io.File. fp))
(.toPath (java.io.File. "route_syntax.md")))
(fix "README.md"
(rich-text/markdown-to-html (slurp ""))
fix-opts)
(->> (.select (doc) "img")
(map #(.attributes %))
(remove #(or (.startsWith (.get % "src") "http://")
(.startsWith (.get % "src") "https://")))
(map #(doto % (.put "src" (fix-image (.get % "src") fix-opts)))))
(.get (.attributes (first (.select doc "a"))) "href"))
|
611ad0b4a2c619cd9f4fc5e591d243bd7195d8ab43ead2b424f10f2a87cbaa77 | Enecuum/Node | Messages.hs | {-# LANGUAGE DeriveAnyClass #-}
module Enecuum.Samples.Assets.Nodes.TstNodes.PingPong.Messages where
import Enecuum.Prelude
newtype Ping = Ping Text
deriving (Show, Eq, Generic, ToJSON, FromJSON)
newtype Pong = Pong Int
deriving (Show, Eq, Generic, ToJSON, FromJSON)
| null | https://raw.githubusercontent.com/Enecuum/Node/3dfbc6a39c84bd45dd5f4b881e067044dde0153a/src/Enecuum/Samples/Assets/Nodes/TstNodes/PingPong/Messages.hs | haskell | # LANGUAGE DeriveAnyClass # |
module Enecuum.Samples.Assets.Nodes.TstNodes.PingPong.Messages where
import Enecuum.Prelude
newtype Ping = Ping Text
deriving (Show, Eq, Generic, ToJSON, FromJSON)
newtype Pong = Pong Int
deriving (Show, Eq, Generic, ToJSON, FromJSON)
|
3d321080bcd3bce1279f7d84e915bad79d37882f09c01158af27ee0f077eff4d | arthuredelstein/clooj | output.clj | (ns clooj.repl.output
(:import (java.awt Point Rectangle)
(java.util.concurrent.atomic AtomicBoolean AtomicInteger)
(javax.swing JFrame JScrollPane JSplitPane JSlider JTextArea
SwingUtilities)
(javax.swing.event DocumentEvent DocumentListener)))
(defn end-position
"Finds the end position of an insert or change in a document
as reported in a DocumentEvent instance."
[^DocumentEvent document-event]
(+ (.getOffset document-event)
(.getLength document-event)))
(defn tailing-scroll-pane
"Embeds the given JTextArea in a JScrollPane that scrolls
to the bottom whenever text is inserted or appended."
[text-area]
(let [scroll-offset (AtomicInteger. -1)
scroll-pane
(proxy [JScrollPane] [text-area]
(paintComponent [graphics]
(let [offset (.getAndSet scroll-offset -1)]
(when (not= -1 offset)
(.. this
getVerticalScrollBar
(setValue (.y (.modelToView text-area offset))))))
(proxy-super paintComponent graphics)))
set-scroll-offset (fn [e]
(.set scroll-offset (end-position e))
(.repaint scroll-pane))]
(.. text-area getDocument
(addDocumentListener
(proxy [DocumentListener] []
(changedUpdate [e] (set-scroll-offset e))
(insertUpdate [e] (set-scroll-offset e))
(removeUpdate [e]))))
scroll-pane))
;; manual tests
(defn test-text-area
"Creates a JTextArea, shows it in a JFrame with a
JSlider above it. Returns the text-area instance."
[]
(let [text-area (JTextArea.)
scroll-pane (tailing-scroll-pane text-area)
;[text-area scroll-pane] (tailing-text-area)
frame (JFrame. "test")
document (.getDocument text-area)
slider (JSlider. 0 100)
split-pane (JSplitPane. JSplitPane/VERTICAL_SPLIT
true slider scroll-pane)]
(doto (.getContentPane frame)
(.add split-pane))
(doto frame
.pack
(.setBounds 30 30 400 400)
.show)
text-area
))
(defn write-lines
"Write n lines of text (positive integers) in
the text-area"
[text-area n]
(dotimes [i n]
(.append text-area (str i "\n"))))
| null | https://raw.githubusercontent.com/arthuredelstein/clooj/6d78d07c16ff339e782b0031eae3a2ef1eeb5280/src/clooj/repl/output.clj | clojure | manual tests
[text-area scroll-pane] (tailing-text-area) | (ns clooj.repl.output
(:import (java.awt Point Rectangle)
(java.util.concurrent.atomic AtomicBoolean AtomicInteger)
(javax.swing JFrame JScrollPane JSplitPane JSlider JTextArea
SwingUtilities)
(javax.swing.event DocumentEvent DocumentListener)))
(defn end-position
"Finds the end position of an insert or change in a document
as reported in a DocumentEvent instance."
[^DocumentEvent document-event]
(+ (.getOffset document-event)
(.getLength document-event)))
(defn tailing-scroll-pane
"Embeds the given JTextArea in a JScrollPane that scrolls
to the bottom whenever text is inserted or appended."
[text-area]
(let [scroll-offset (AtomicInteger. -1)
scroll-pane
(proxy [JScrollPane] [text-area]
(paintComponent [graphics]
(let [offset (.getAndSet scroll-offset -1)]
(when (not= -1 offset)
(.. this
getVerticalScrollBar
(setValue (.y (.modelToView text-area offset))))))
(proxy-super paintComponent graphics)))
set-scroll-offset (fn [e]
(.set scroll-offset (end-position e))
(.repaint scroll-pane))]
(.. text-area getDocument
(addDocumentListener
(proxy [DocumentListener] []
(changedUpdate [e] (set-scroll-offset e))
(insertUpdate [e] (set-scroll-offset e))
(removeUpdate [e]))))
scroll-pane))
(defn test-text-area
"Creates a JTextArea, shows it in a JFrame with a
JSlider above it. Returns the text-area instance."
[]
(let [text-area (JTextArea.)
scroll-pane (tailing-scroll-pane text-area)
frame (JFrame. "test")
document (.getDocument text-area)
slider (JSlider. 0 100)
split-pane (JSplitPane. JSplitPane/VERTICAL_SPLIT
true slider scroll-pane)]
(doto (.getContentPane frame)
(.add split-pane))
(doto frame
.pack
(.setBounds 30 30 400 400)
.show)
text-area
))
(defn write-lines
"Write n lines of text (positive integers) in
the text-area"
[text-area n]
(dotimes [i n]
(.append text-area (str i "\n"))))
|
f328a0a694db258801aee573d52ce08ee452c0e46abf1f70d7fbca73b47d1b5f | kmicinski/cmsc330examples | ex2.ml | let calcPercent (grade,max) =
((float_of_int grade) /. (float_of_int max)) *. 100.0
let calcPercent' grade max =
((float_of_int grade) /. (float_of_int max)) *. 100.0
let transform (f : ('a*'b) -> 'c) : 'a -> 'b -> 'c =
let h a b =
f (a,b)
in
h
| null | https://raw.githubusercontent.com/kmicinski/cmsc330examples/78f5acaaae25f11a39817673433efcf33271df6d/ocaml/ex2.ml | ocaml | let calcPercent (grade,max) =
((float_of_int grade) /. (float_of_int max)) *. 100.0
let calcPercent' grade max =
((float_of_int grade) /. (float_of_int max)) *. 100.0
let transform (f : ('a*'b) -> 'c) : 'a -> 'b -> 'c =
let h a b =
f (a,b)
in
h
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.