repo_name
stringlengths
5
108
path
stringlengths
6
333
size
stringlengths
1
6
content
stringlengths
4
977k
license
stringclasses
15 values
wbstr/dbunit
src/test/java/org/dbunit/dataset/LowerCaseTableMetaDataTest.java
3791
/* * * The DbUnit Database Testing Framework * Copyright (C)2002-2004, DbUnit.org * * This library is free software; you can redistribute it and/or * modify it under the terms of the GNU Lesser General Public * License as published by the Free Software Foundation; either * version 2.1 of the License, or (at your option) any later version. * * This library is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Lesser General Public License for more details. * * You should have received a copy of the GNU Lesser General Public * License along with this library; if not, write to the Free Software * Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA * */ package org.dbunit.dataset; import junit.framework.TestCase; import org.dbunit.dataset.datatype.DataType; /** * @author Manuel Laflamme * @version $Revision: 421 $ * @since Feb 17, 2002 */ public class LowerCaseTableMetaDataTest extends TestCase { public LowerCaseTableMetaDataTest(String s) { super(s); } public void testGetTableName() throws Exception { String original = "TABLE_NAME"; String expected = original.toLowerCase(); ITableMetaData metaData = new LowerCaseTableMetaData( new DefaultTableMetaData(original, new Column[0])); assertEquals("table name", expected, metaData.getTableName()); } public void testGetColumns() throws Exception { Column[] columns = new Column[]{ new Column("NUMBER_COLUMN", DataType.NUMERIC, "qwerty", Column.NULLABLE), new Column("STRING_COLUMN", DataType.VARCHAR, "toto", Column.NO_NULLS), new Column("BOOLEAN_COLUMN", DataType.BOOLEAN), }; ITableMetaData metaData = new LowerCaseTableMetaData( "TABLE_NAME", columns); Column[] lowerColumns = metaData.getColumns(); assertEquals("column count", columns.length, lowerColumns.length); for (int i = 0; i < columns.length; i++) { Column column = columns[i]; Column lowerColumn = lowerColumns[i]; assertEquals("name", column.getColumnName().toLowerCase(), lowerColumn.getColumnName()); assertTrue("name not equals", !column.getColumnName().equals(lowerColumn.getColumnName())); assertEquals("type", column.getDataType(), lowerColumn.getDataType()); assertEquals("sql type", column.getSqlTypeName(), lowerColumn.getSqlTypeName()); assertEquals("nullable", column.getNullable(), lowerColumn.getNullable()); } assertEquals("key count", 0, metaData.getPrimaryKeys().length); } public void testGetPrimaryKeys() throws Exception { Column[] columns = new Column[]{ new Column("NUMBER_COLUMN", DataType.NUMERIC, "qwerty", Column.NULLABLE), new Column("STRING_COLUMN", DataType.VARCHAR, "toto", Column.NO_NULLS), new Column("BOOLEAN_COLUMN", DataType.BOOLEAN), }; String[] keyNames = new String[]{"Boolean_Column", "Number_Column"}; ITableMetaData metaData = new LowerCaseTableMetaData( "TABLE_NAME", columns, keyNames); Column[] keys = metaData.getPrimaryKeys(); assertEquals("key count", keyNames.length, keys.length); for (int i = 0; i < keys.length; i++) { assertTrue("name not equals", !keyNames[i].equals(keys[i].getColumnName())); assertEquals("key name", keyNames[i].toLowerCase(), keys[i].getColumnName()); } } }
lgpl-2.1
sbonoc/opencms-core
src/org/opencms/gwt/CmsClientUserSettingConverter.java
8618
/* * This library is part of OpenCms - * the Open Source Content Management System * * Copyright (c) Alkacon Software GmbH (http://www.alkacon.com) * * This library is free software; you can redistribute it and/or * modify it under the terms of the GNU Lesser General Public * License as published by the Free Software Foundation; either * version 2.1 of the License, or (at your option) any later version. * * This library is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Lesser General Public License for more details. * * For further information about Alkacon Software, please see the * company website: http://www.alkacon.com * * For further information about OpenCms, please see the * project website: http://www.opencms.org * * You should have received a copy of the GNU Lesser General Public * License along with this library; if not, write to the Free Software * Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA */ package org.opencms.gwt; import org.opencms.configuration.CmsDefaultUserSettings; import org.opencms.configuration.preferences.I_CmsPreference; import org.opencms.file.CmsObject; import org.opencms.file.CmsUser; import org.opencms.gwt.shared.CmsGwtConstants; import org.opencms.gwt.shared.CmsUserSettingsBean; import org.opencms.i18n.CmsMessages; import org.opencms.i18n.CmsMultiMessages; import org.opencms.jsp.CmsJspActionElement; import org.opencms.main.CmsLog; import org.opencms.main.OpenCms; import org.opencms.util.CmsMacroResolver; import org.opencms.workplace.commons.CmsPreferences; import org.opencms.xml.content.CmsXmlContentProperty; import org.opencms.xml.content.CmsXmlContentPropertyHelper; import java.util.Locale; import java.util.Map; import javax.servlet.http.HttpServletRequest; import javax.servlet.http.HttpServletResponse; import org.apache.commons.logging.Log; /** * Helper class to deal with loading and saving user preferences from the ADE user interface.<p> */ public class CmsClientUserSettingConverter { /** * Subclass of the normal action element which can be created even if we are not being called from a JSP.<p> */ class NoJspActionElement extends CmsJspActionElement { /** The CMS object to use. */ private CmsObject m_setCms; /** * Creates a new instance.<p> * * @param cms the CMS context to use * @param req the current request * @param res the current response */ public NoJspActionElement(CmsObject cms, HttpServletRequest req, HttpServletResponse res) { super(null, req, res); m_setCms = cms; } /** * @see org.opencms.jsp.CmsJspBean#getCmsObject() */ @Override public CmsObject getCmsObject() { return m_setCms; } /** * @see org.opencms.jsp.CmsJspBean#handleMissingFlexController() */ @Override protected void handleMissingFlexController() { // ignore } } /** Logger instance for this class. */ private static final Log LOG = CmsLog.getLog(CmsClientUserSettingConverter.class); /** The CMS context to use. */ private CmsObject m_cms; /** The workplace preferences dialog instance used for loading/saving user settings. */ private CmsPreferences m_preferences; /** The current request. */ private HttpServletRequest m_request; /** The macro resolver used for macros in preference property definitions. */ private CmsMacroResolver m_macroResolver = new CmsMacroResolver(); /** The current preferences. */ private CmsDefaultUserSettings m_currentPreferences; /** * Creates a new instance.<p> * * @param cms the current CMS context * @param request the current request * @param response the current response */ public CmsClientUserSettingConverter(CmsObject cms, HttpServletRequest request, HttpServletResponse response) { m_cms = cms; m_request = request; m_preferences = new CmsPreferences(new NoJspActionElement(cms, request, response)); m_currentPreferences = new CmsDefaultUserSettings(); m_currentPreferences.init(cms.getRequestContext().getCurrentUser()); m_preferences.setUserSettings(m_currentPreferences); Locale locale = OpenCms.getWorkplaceManager().getWorkplaceLocale(cms); CmsMultiMessages messages = new CmsMultiMessages(locale); messages.addMessages(OpenCms.getWorkplaceManager().getMessages(locale)); messages.addMessages(org.opencms.workplace.commons.Messages.get().getBundle(locale)); m_macroResolver.setMessages(messages); } /** * Loads the current user's preferences into a CmsUserSettingsBean.<p> * * @return the bean representing the current user's preferences */ public CmsUserSettingsBean loadSettings() { CmsUserSettingsBean result = new CmsUserSettingsBean(); CmsDefaultUserSettings currentSettings = new CmsDefaultUserSettings(); currentSettings.init(m_preferences.getUserSettings().getUser()); for (I_CmsPreference pref : OpenCms.getWorkplaceManager().getDefaultUserSettings().getPreferences().values()) { String tab = pref.getTab(); if (CmsGwtConstants.TAB_HIDDEN.equals(tab)) { continue; } CmsXmlContentProperty prop2 = pref.getPropertyDefinition(m_cms); String value = pref.getValue(currentSettings); CmsXmlContentProperty resolvedProp = CmsXmlContentPropertyHelper.resolveMacrosInProperty( prop2.withDefaultWidget("string"), m_macroResolver); result.addSetting(value, resolvedProp, CmsGwtConstants.TAB_BASIC.equals(tab)); } addAccountInfo(result); return result; } /** * Saves the given user preference values.<p> * * @param settings the user preference values to save * * @throws Exception if something goes wrong */ public void saveSettings(Map<String, String> settings) throws Exception { for (Map.Entry<String, String> entry : settings.entrySet()) { String key = entry.getKey(); String value = entry.getValue(); saveSetting(key, value); } m_preferences.getUserSettings().save(m_cms); m_preferences.updatePreferences(m_cms, m_request); } /** * Adds the account information to a user settings bean.<p> * * @param prefs the user settings bean to which the information should be added */ private void addAccountInfo(CmsUserSettingsBean prefs) { Locale wpLocale = OpenCms.getWorkplaceManager().getWorkplaceLocale(m_cms); CmsMessages wpMessages = org.opencms.workplace.commons.Messages.get().getBundle(wpLocale); CmsUser user = m_currentPreferences.getUser(); prefs.addAccountInfo(wpMessages.key(org.opencms.workplace.commons.Messages.GUI_LABEL_USER_0), user.getName()); prefs.addAccountInfo(wpMessages.key(org.opencms.workplace.commons.Messages.GUI_LABEL_EMAIL_0), user.getEmail()); prefs.addAccountInfo( wpMessages.key(org.opencms.workplace.commons.Messages.GUI_LABEL_LASTNAME_0), user.getLastname()); prefs.addAccountInfo( wpMessages.key(org.opencms.workplace.commons.Messages.GUI_LABEL_FIRSTNAME_0), user.getFirstname()); prefs.addAccountInfo( wpMessages.key(org.opencms.workplace.commons.Messages.GUI_INPUT_ADRESS_0), user.getAddress()); prefs.addAccountInfo( wpMessages.key(org.opencms.workplace.commons.Messages.GUI_LABEL_DESCRIPTION_0), user.getDescription(wpLocale)); } /** * Saves an individual user preference value.<p> * * @param key the key of the user preference * @param value the value of the user preference * * @throws Exception if something goes wrong */ private void saveSetting(String key, String value) throws Exception { Map<String, I_CmsPreference> prefs = OpenCms.getWorkplaceManager().getDefaultUserSettings().getPreferences(); if (prefs.containsKey(key)) { prefs.get(key).setValue(m_currentPreferences, value); } else { LOG.error("Can't save user setting '" + key + "'"); } } }
lgpl-2.1
deegree/deegree3
deegree-services/deegree-services-wms/src/main/java/org/deegree/services/wms/controller/capabilities/serialize/CopySerializer.java
1922
//$HeadURL$ /*---------------------------------------------------------------------------- This file is part of deegree, http://deegree.org/ Copyright (C) 2001-2015 by: - Department of Geography, University of Bonn - and - lat/lon GmbH - This library is free software; you can redistribute it and/or modify it under the terms of the GNU Lesser General Public License as published by the Free Software Foundation; either version 2.1 of the License, or (at your option) any later version. This library is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU Lesser General Public License for more details. You should have received a copy of the GNU Lesser General Public License along with this library; if not, write to the Free Software Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA Contact information: lat/lon GmbH Aennchenstr. 19, 53177 Bonn Germany http://lat-lon.de/ Department of Geography, University of Bonn Prof. Dr. Klaus Greve Postfach 1147, 53001 Bonn Germany http://www.geographie.uni-bonn.de/deegree/ e-mail: info@deegree.org ----------------------------------------------------------------------------*/ package org.deegree.services.wms.controller.capabilities.serialize; import static org.apache.commons.io.IOUtils.copy; import java.io.IOException; import java.io.InputStream; import java.io.OutputStream; /** * Copies exact the incoming stream in the response stream. * * @author <a href="mailto:goltz@lat-lon.de">Lyn Goltz</a> */ public class CopySerializer implements CapabilitiesSerializer { @Override public void serialize( InputStream capabilitiesXmlStream, OutputStream responseStream ) throws IOException { copy( capabilitiesXmlStream, responseStream ); } }
lgpl-2.1
threerings/nenya
core/src/main/java/com/threerings/media/timer/PerfTimer.java
1587
// // Nenya library - tools for developing networked games // Copyright (C) 2002-2012 Three Rings Design, Inc., All Rights Reserved // https://github.com/threerings/nenya // // This library is free software; you can redistribute it and/or modify it // under the terms of the GNU Lesser General Public License as published // by the Free Software Foundation; either version 2.1 of the License, or // (at your option) any later version. // // This library is distributed in the hope that it will be useful, // but WITHOUT ANY WARRANTY; without even the implied warranty of // MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU // Lesser General Public License for more details. // // You should have received a copy of the GNU Lesser General Public // License along with this library; if not, write to the Free Software // Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA package com.threerings.media.timer; import sun.misc.Perf; /** * A timer that uses the performance clock exposed by Sun in JDK 1.4.2. * @deprecated Use {@link NanoTimer} instead. */ @Deprecated // warning: sun.misc.Perf is Sun proprietary API and may be removed in a future release @SuppressWarnings("all") public class PerfTimer extends CalibratingTimer { public PerfTimer () { _timer = Perf.getPerf(); init(_timer.highResFrequency() / 1000, _timer.highResFrequency() / 1000000); } @Override public long current () { return _timer.highResCounter(); } /** A performance timer object. */ protected Perf _timer; }
lgpl-2.1
jstourac/wildfly
testsuite/integration/basic/src/test/java/org/jboss/as/test/integration/weld/alternative/WeldAlternativeTestCase.java
2293
/* * JBoss, Home of Professional Open Source * Copyright 2010, Red Hat Inc., and individual contributors as indicated * by the @authors tag. See the copyright.txt in the distribution for a * full listing of individual contributors. * * This is free software; you can redistribute it and/or modify it * under the terms of the GNU Lesser General Public License as * published by the Free Software Foundation; either version 2.1 of * the License, or (at your option) any later version. * * This software is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Lesser General Public License for more details. * * You should have received a copy of the GNU Lesser General Public * License along with this software; if not, write to the Free * Software Foundation, Inc., 51 Franklin St, Fifth Floor, Boston, MA * 02110-1301 USA, or see the FSF site: http://www.fsf.org. */ package org.jboss.as.test.integration.weld.alternative; import javax.inject.Inject; import org.jboss.arquillian.container.test.api.Deployment; import org.jboss.arquillian.junit.Arquillian; import org.jboss.shrinkwrap.api.Archive; import org.jboss.shrinkwrap.api.ShrinkWrap; import org.jboss.shrinkwrap.api.asset.StringAsset; import org.jboss.shrinkwrap.api.spec.JavaArchive; import org.junit.Assert; import org.junit.Test; import org.junit.runner.RunWith; /** * * A test of the Jakarta Contexts and Dependency Injection alternatives. This tests that the alternative * information in the beans.xml file is being parsed correctly. * * @author Stuart Douglas */ @RunWith(Arquillian.class) public class WeldAlternativeTestCase { @Deployment public static Archive<?> deploy() { JavaArchive jar = ShrinkWrap.create(JavaArchive.class); jar.addPackage(WeldAlternativeTestCase.class.getPackage()); jar.addAsManifestResource(new StringAsset("<beans><alternatives><class>" + AlternativeBean.class.getName() + "</class></alternatives></beans>"), "beans.xml"); return jar; } @Inject private SimpleBean bean; @Test public void testAlternatives() { Assert.assertEquals("Hello World", bean.sayHello()); } }
lgpl-2.1
s-match/s-match-core
src/main/java/it/unitn/disi/smatch/matchers/structure/node/NodeMatcherException.java
539
package it.unitn.disi.smatch.matchers.structure.node; import it.unitn.disi.smatch.matchers.structure.tree.TreeMatcherException; /** * Exception for Node Matchers. * * @author <a rel="author" href="http://autayeu.com/">Aliaksandr Autayeu</a> */ public class NodeMatcherException extends TreeMatcherException { public NodeMatcherException(String errorDescription) { super(errorDescription); } public NodeMatcherException(String errorDescription, Throwable cause) { super(errorDescription, cause); } }
lgpl-2.1
gagoncal/Selenium
Tester/src/test/java/com/LearningSeleniumWithJava/EE/WhenSearchingForDrupalUsingGoogleTest.java
1587
package com.LearningSeleniumWithJava.EE;/* Created by gabrielgoncalves on 22/09/16. */ import Pages.GooglePage; import org.junit.After; import org.junit.Assert; import org.junit.Before; import org.junit.Test; import org.openqa.selenium.By; import org.openqa.selenium.WebDriver; import org.openqa.selenium.WebElement; import org.openqa.selenium.chrome.ChromeDriver; import java.io.IOException; public class WhenSearchingForDrupalUsingGoogleTest { private String baseUrl; private WebDriver driver; private GooglePage.ScreenshotHelper screenshotHelper; private GooglePage.WaitForElement waitForElement private String CSSForText = "div[class='hdtb-mitem hdtb-msel hdtb-imb']" @Before public void openBrowser() { baseUrl = "https://www.google.pt/"; driver = new ChromeDriver(); driver.get(baseUrl); screenshotHelper = new GooglePage.ScreenshotHelper(); } @After public void saveScreenshotAndCloseBrowser() throws IOException { screenshotHelper.saveScreenshot("screenshot.png"); driver.quit(); } @Test public void pageTitleAfterSearchShouldBeginWithDrupal() throws IOException { Assert.assertEquals("The page title should equal Google at the start of the test.", "Google", driver.getTitle()); WebElement searchField = driver.findElement(By.name("q")); searchField.sendKeys("Drupal!"); searchField.submit(); waitForElement = WaitForElements.isElementLoaded(CSSForText); Assert.assertTrue(driver.getTitle().contains("Drupal")); } }
lgpl-2.1
joansmith/orbeon-forms
src/main/java/org/orbeon/oxf/processor/converter/AbstractRewrite.java
39658
/** * Copyright (C) 2010 Orbeon, Inc. * * This program is free software; you can redistribute it and/or modify it under the terms of the * GNU Lesser General Public License as published by the Free Software Foundation; either version * 2.1 of the License, or (at your option) any later version. * * This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; * without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. * See the GNU Lesser General Public License for more details. * * The full text of the license is available at http://www.gnu.org/copyleft/lesser.html */ package org.orbeon.oxf.processor.converter; import org.orbeon.oxf.externalcontext.URLRewriter; import org.orbeon.oxf.pipeline.api.ExternalContext; import org.orbeon.oxf.pipeline.api.PipelineContext; import org.orbeon.oxf.processor.ProcessorImpl; import org.orbeon.oxf.processor.ProcessorInputOutputInfo; import org.orbeon.oxf.processor.ProcessorOutput; import org.orbeon.oxf.processor.impl.CacheableTransformerOutputImpl; import org.orbeon.oxf.util.NetUtils; import org.orbeon.oxf.util.ScalaUtils; import org.orbeon.oxf.xml.SAXUtils; import org.orbeon.oxf.xml.XMLConstants; import org.orbeon.oxf.xml.XMLReceiver; import org.orbeon.oxf.xml.saxrewrite.DocumentRootState; import org.orbeon.oxf.xml.saxrewrite.FragmentRootState; import org.orbeon.oxf.xml.saxrewrite.State; import org.orbeon.oxf.xml.saxrewrite.StatefulHandler; import org.xml.sax.Attributes; import org.xml.sax.SAXException; import org.xml.sax.helpers.AttributesImpl; import java.util.ArrayList; import java.util.StringTokenizer; /** * Java impl of oxf-rewrite.xsl. Uses GOF state pattern + SAX to get the job done. The state machine ad hoc and relies a * bit on the simplicity of the transformation that we are performing. * * Wrt the transformation, here is the comment from oxf-rewrite.xsl : * * This stylesheet rewrites HTML or XHTML for servlets and portlets. URLs are parsed, so it must be made certain that * the URLs are well-formed. Absolute URLs are not modified. Relative or absolute paths are supported, as well as the * special case of a URL starting with a query string (e.g. "?name=value"). This last syntax is supported by most Web * browsers. * * A. For portlets, it does the following: * * 1. Rewrite form/@action to WSRP action URL encoding * 2. Rewrite a/@href and link/@href to WSRP render encoding * 3. Rewrite img/@src, input[@type='image']/@src and script/@src to WSRP resource URL encoding * 4. If no form/@method is supplied, force an HTTP POST * 5. Escape any wsrp_rewrite occurrence in text not within a script or * * SCRIPT element to wsrp_rewritewsrp_rewrite. WSRP 1.0 does not appear to specify a particular escape sequence, but we * use this one in Orbeon Forms Portal. The escaped sequence is recognized by the Orbeon Forms Portlet and restored to * the original sequence, so it is possible to include the string wsrp_rewrite within documents. * * 6. Occurrences of wsrp_rewrite found within script or SCRIPT elements, as well as occurrences within attributes, * are left untouched. This allows them to be recognized by the Orbeon Forms Portlet and rewritten. * * Known issues for portlets: * * o The input document should not contain; * o elements and attribute containing wsrp_rewrite * o namespace URIs containing wsrp_rewrite * o processing instructions containing wsrp_rewrite * * B. For servlets, it rewrites the URLs to be absolute paths, and prepends the context path. */ abstract class AbstractRewrite extends ProcessorImpl { static final String SCRIPT_ELT = "script"; static final String OBJECT_ELT = "object"; static final String ACTION_ATT = "action"; static final String METHOD_ATT = "method"; static final String HREF_ATT = "href"; static final String SRC_ATT = "src"; static final String BACKGROUND_ATT = "background"; static final String NOREWRITE_ATT = "url-norewrite"; /** * Base state. Simply forwards data to the destination content handler and returns itself. That is unless the * (element) depth becomes negative after an end element event. In this case the previous state is returned. This * means btw that we are really only considering state changes on start and end element events. */ protected static abstract class State2 extends State { /** * Performs the URL rewrites. */ protected final URLRewriter response; /** * Could have been another State. However since the value is determined in one state and then used by a * 'descendant' state doing so would have meant that descendant would have to walk it's ancestors to get the * value. So, since making this a field instead of a separate State sub-class was easier to implement and is * faster a field was used. */ protected int scriptDepth; protected final String rewriteURI; /** * @param previousState The previous state. * @param xmlReceiver The destination for the rewrite transformation. * @param response Used to perform URL rewrites. * @param scriptDepth How below script elt we are. * @param rewriteURI URI of elements (i.e. xhtml uri or "") of elements that need rewriting. */ State2(final State previousState, final XMLReceiver xmlReceiver, final URLRewriter response, final int scriptDepth, final String rewriteURI) { super(previousState, xmlReceiver); this.response = response; this.scriptDepth = scriptDepth; this.rewriteURI = rewriteURI; } /** * Adjusts scriptDepth */ final void scriptDepthOnStart(final String ns, final String lnam) { if (rewriteURI.equals(ns) && SCRIPT_ELT.equals(lnam)) { scriptDepth++; } } /** * Adjusts scriptDepth */ final void scriptDepthOnEnd(final String ns, final String lnam) { if (rewriteURI.equals(ns) && SCRIPT_ELT.equals(lnam)) { scriptDepth--; } } @Override protected void endElementStart(final String ns, final String lnam, final String qnam) throws SAXException { scriptDepthOnEnd(ns, lnam); super.endElementStart(ns, lnam, qnam); } } /** * The rewrite state. Essentially this corresponds to the default mode of oxf-rewrite.xsl. * Basically this: * <ul> * <li>Rewrites attributes in start element event when need be. * <li>Accumulates text from characters events so that proper char content rewriting can * happen. * <li>On an event that indicates the end of potentially rewritable text, e.g. start element, * rewrites and forwards the accumulated characters. * <li>When explicit no write is indicated, e.g. we see attributes no-rewrite=true, then * transition to the NoRewriteState. * </ul> */ static class RewriteState extends State2 { /** * Used to accumulate characters from characters event. Lazily init'd in characters. * * NOTE: We use CharBuffer for historical reasons. Since we support Java 1.5 and up, we could use StringBuilder. */ private java.nio.CharBuffer charactersBuf; private final ArrayList<Boolean> fObjectParent = new ArrayList<Boolean>(); /** * Calls super( ... ) and initializes wsrprewriteMatcher with "wsrp_rewrite" * * @param rewriteURI */ RewriteState(final State stt, final XMLReceiver xmlReceiver, final URLRewriter response , final int scriptDepth, final String rewriteURI) { super(stt, xmlReceiver, response, scriptDepth, rewriteURI); } /** * Handler for {http://www.w3.org/1999/xhtml}{elt name}. Assumes namespace test has already * happened. Implements : * <pre> * <xsl:template match="xhtml:{elt name}[@{res attrib name}]" > * <xsl:copy> * <xsl:copy-of select="@*[namespace-uri() = '']"/> * <xsl:attribute name="{res attrib name}"> * <xsl:value-of select="context:rewriteResourceURL(@{res attrib name})"/> * </xsl:attribute> * <xsl:apply-templates/> * </xsl:copy> * </xsl:template> * </pre> * * If match is satisfied then modified event is sent to destination contentHandler. * * @return null if match is not satisfied and this otherwise. * @throws SAXException if destination contentHandler throws SAXException */ private State2 handleEltWithResource (final String elt, final String resAtt, final String ns, final String lnam , final String qnam, final Attributes atts) throws SAXException { State2 ret = null; done : if (elt.equals(lnam)) { final String res = atts.getValue("", resAtt); if (res == null) break done; ret = this; final AttributesImpl newAtts = SAXUtils.getAttributesFromDefaultNamespace(atts); final String newRes = response.rewriteResourceURL(res, ExternalContext.Response.REWRITE_MODE_ABSOLUTE_PATH_OR_RELATIVE); final int idx = newAtts.getIndex("", resAtt); newAtts.setValue(idx, newRes); xmlReceiver.startElement(ns, lnam, qnam, newAtts); } return ret; } /** * Handle xhtml:object */ private State2 handleObject (final String ns, final String lnam , final String qnam, final Attributes atts) throws SAXException { State2 ret = null; done : if (OBJECT_ELT.equals(lnam)) { final String codebaseAttribute = atts.getValue("", "codebase"); final String classidAttribute = atts.getValue("", "classid"); final String dataAttribute = atts.getValue("", "data"); final String usemapAttribute = atts.getValue("", "usemap"); final String archiveAttribute = atts.getValue("", "archive");// space-separated if (classidAttribute == null && codebaseAttribute == null && dataAttribute == null && usemapAttribute == null && archiveAttribute == null) break done; ret = this; final AttributesImpl newAtts = SAXUtils.getAttributesFromDefaultNamespace(atts); if (codebaseAttribute != null) { final String newAttribute = response.rewriteResourceURL(codebaseAttribute, ExternalContext.Response.REWRITE_MODE_ABSOLUTE_PATH_OR_RELATIVE); final int idx = newAtts.getIndex("", "codebase"); newAtts.setValue(idx, newAttribute); } else { // We don't rewrite these attributes if there is a codebase if (classidAttribute != null) { final String newAttribute = response.rewriteResourceURL(classidAttribute, ExternalContext.Response.REWRITE_MODE_ABSOLUTE_PATH_OR_RELATIVE); final int idx = newAtts.getIndex("", "classid"); newAtts.setValue(idx, newAttribute); } if (dataAttribute != null) { final String newAttribute = response.rewriteResourceURL(dataAttribute, ExternalContext.Response.REWRITE_MODE_ABSOLUTE_PATH_OR_RELATIVE); final int idx = newAtts.getIndex("", "data"); newAtts.setValue(idx, newAttribute); } if (usemapAttribute != null) { final String newAttribute = response.rewriteResourceURL(usemapAttribute, ExternalContext.Response.REWRITE_MODE_ABSOLUTE_PATH_OR_RELATIVE); final int idx = newAtts.getIndex("", "usemap"); newAtts.setValue(idx, newAttribute); } if (archiveAttribute != null) { final StringTokenizer st = new StringTokenizer(archiveAttribute, " "); final StringBuilder sb = new StringBuilder(archiveAttribute.length() * 2); boolean first = true; while (st.hasMoreTokens()) { final String currentArchive = ScalaUtils.trimAllToEmpty(st.nextToken()); final String newArchive = response.rewriteResourceURL(currentArchive, ExternalContext.Response.REWRITE_MODE_ABSOLUTE_PATH_OR_RELATIVE); if (!first) { sb.append(' '); } sb.append(newArchive); first = false; } final int idx = newAtts.getIndex("", "archive"); newAtts.setValue(idx, sb.toString()); } } xmlReceiver.startElement(ns, lnam, qnam, newAtts); } return ret; } /** * Handle xhtml:applet */ private State2 handleApplet (final String ns, final String lnam , final String qnam, final Attributes atts) throws SAXException { State2 ret = null; done : if ("applet".equals(lnam)) { final String codebaseAttribute = atts.getValue("", "codebase"); final String archiveAttribute = atts.getValue("", "archive");// comma-separated // final String codeAttribute = atts.getValue("", "code");// not clear whether this needs to be rewritten if (archiveAttribute == null && codebaseAttribute == null) break done; ret = this; final AttributesImpl newAtts = SAXUtils.getAttributesFromDefaultNamespace(atts); if (codebaseAttribute != null) { final String newAttribute = response.rewriteResourceURL(codebaseAttribute, ExternalContext.Response.REWRITE_MODE_ABSOLUTE_PATH_OR_RELATIVE); final int idx = newAtts.getIndex("", "codebase"); newAtts.setValue(idx, newAttribute); } else { // We don't rewrite the @archive attribute if there is a codebase final StringTokenizer st = new StringTokenizer(archiveAttribute, ","); final StringBuilder sb = new StringBuilder(archiveAttribute.length() * 2); boolean first = true; while (st.hasMoreTokens()) { final String currentArchive = ScalaUtils.trimAllToEmpty(st.nextToken()); final String newArchive = response.rewriteResourceURL(currentArchive, ExternalContext.Response.REWRITE_MODE_ABSOLUTE_PATH_OR_RELATIVE); if (!first) { sb.append(' '); } sb.append(newArchive); first = false; } final int idx = newAtts.getIndex("", "archive"); newAtts.setValue(idx, sb.toString()); } xmlReceiver.startElement(ns, lnam, qnam, newAtts); } return ret; } /** * Handle xhtml:param */ private State2 handleParam (final String ns, final String lnam , final String qnam, final Attributes atts) throws SAXException { State2 ret = null; final boolean inObject = fObjectParent.size() >= 2 && fObjectParent.get(fObjectParent.size() - 2).booleanValue(); done : if (inObject && "param".equals(lnam)) { final String nameAttribute = atts.getValue("", "name"); final String valueAttribute = atts.getValue("", "value"); if (nameAttribute == null || valueAttribute == null) break done; ret = this; final AttributesImpl newAtts = SAXUtils.getAttributesFromDefaultNamespace(atts); if ("archive".equals(ScalaUtils.trimAllToEmpty(nameAttribute))) { final StringTokenizer st = new StringTokenizer(valueAttribute, ","); final StringBuilder sb = new StringBuilder(valueAttribute.length() * 2); boolean first = true; while (st.hasMoreTokens()) { final String currentArchive = ScalaUtils.trimAllToEmpty(st.nextToken()); final String newArchive = response.rewriteResourceURL(currentArchive, ExternalContext.Response.REWRITE_MODE_ABSOLUTE_PATH_OR_RELATIVE); if (!first) { sb.append(' '); } sb.append(newArchive); first = false; } final int idx = newAtts.getIndex("", "value"); newAtts.setValue(idx, sb.toString()); } xmlReceiver.startElement(ns, lnam, qnam, newAtts); } return ret; } /** * Handler for {http://www.w3.org/1999/xhtml}a. Assumes namespace test has already * happened. Implements : * <pre> * <xsl:template match="xhtml:a[@href]" > * <xsl:copy> * <xsl:copy-of select="@*[namespace-uri() = '']"/> * <xsl:attribute name="href"> * <xsl:choose> * <xsl:when test="not(@f:url-type) or @f:url-type = 'render'"> * <xsl:value-of select="context:rewriteRenderURL(@href)"/> * </xsl:when> * <xsl:when test="@f:url-type = 'action'"> * <xsl:value-of select="context:rewriteActionURL(@href)"/> * </xsl:when> * <xsl:when test="@f:url-type = 'resource'"> * <xsl:value-of select="context:rewriteResourceURL(@href)"/> * </xsl:when> * </xsl:choose> * </xsl:attribute> * <xsl:apply-templates/> * </xsl:copy> * </xsl:template> * </pre> * * If match is satisfied then modified event is sent to destination contentHandler. * * @return null if match is not satisfied and this otherwise. * @throws SAXException if destination contentHandler throws SAXException */ private State2 handleA (final String ns, final String lnam, final String qnam, final Attributes atts) throws SAXException { State2 ret = null; done : if ("a".equals(lnam)) { final String href = atts.getValue("", HREF_ATT); if (href == null) break done; ret = this; final AttributesImpl newAtts = SAXUtils.getAttributesFromDefaultNamespace(atts); final String urlType = atts.getValue(XMLConstants.OPS_FORMATTING_URI, "url-type"); final String portletMode = atts.getValue(XMLConstants.OPS_FORMATTING_URI, "portlet-mode"); final String windowState = atts.getValue(XMLConstants.OPS_FORMATTING_URI, "window-state"); final String newHref; if (urlType == null || "render".equals(urlType)) { newHref = response.rewriteRenderURL(href, portletMode, windowState); } else if ("action".equals(urlType)) { newHref = response.rewriteActionURL(href, portletMode, windowState); } else if ("resource".equals(urlType)) { newHref = response.rewriteResourceURL(href, ExternalContext.Response.REWRITE_MODE_ABSOLUTE_PATH_OR_RELATIVE); } else { newHref = null; } final int idx = newAtts.getIndex("", HREF_ATT); if (newHref == null && idx != -1) { newAtts.removeAttribute(idx); } else { newAtts.setValue(idx, newHref); } xmlReceiver.startElement(ns, lnam, qnam, newAtts); } return ret; } /** * Handler for {http://www.w3.org/1999/xhtml}area. Assumes namespace test has already * happened. Implements : * <pre> * <xsl:template match="xhtml:area[@href]" > * <xsl:copy> * <xsl:copy-of select="@*[namespace-uri() = '']"/> * <xsl:attribute name="href"> * <xsl:value-of select="context:rewriteActionURL(@href)"/> * </xsl:attribute> * <xsl:apply-templates/> * </xsl:copy> * </xsl:template> * </pre> * * If match is satisfied then modified event is sent to destination contentHandler. * * @return null if match is not satisfied and this otherwise. * @throws SAXException if destination contentHandler throws SAXException */ private State2 handleArea (final String ns, final String lnam, final String qnam, final Attributes atts) throws SAXException { State2 ret = null; done : if ("area".equals(lnam)) { final String href = atts.getValue("", HREF_ATT); if (href == null) break done; ret = this; final AttributesImpl newAtts = SAXUtils.getAttributesFromDefaultNamespace(atts); final String newHref = response.rewriteActionURL(href); final int idx = newAtts.getIndex("", HREF_ATT); newAtts.setValue(idx, newHref); xmlReceiver.startElement(ns, lnam, qnam, newAtts); } return ret; } /** * Handler for {http://www.w3.org/1999/xhtml}input. Assumes namespace test has already * happened. Implements : * <pre> * <xsl:template match="xhtml:input[@type='image' and @src]" > * <xsl:copy> * <xsl:copy-of select="@*[namespace-uri() = '']"/> * <xsl:attribute name="src"> * <xsl:value-of select="context:rewriteActionURL(@src)"/> * </xsl:attribute> * <xsl:apply-templates/> * </xsl:copy> * </xsl:template> * </pre> * * If match is satisfied then modified event is sent to destination contentHandler. * * @return null if @type='image' test is not satisfied and * handleEltWithResource( "input", "src", ... ) otherwise. * @throws SAXException if destination contentHandler throws SAXException */ private State2 handleInput (final String ns, final String lnam, final String qnam, final Attributes atts) throws SAXException { final State2 ret; final String typ = atts.getValue("", "type"); if ("image".equals(typ)) { ret = handleEltWithResource("input", SRC_ATT, ns, lnam, qnam, atts); } else { ret = null; } return ret; } /** * Handler for {http://www.w3.org/1999/xhtml}form. Assumes namespace test has already * happened. Implements : * <pre> * <xsl:template match="form | xhtml:form"> * <xsl:copy> * <xsl:copy-of select="@*[namespace-uri() = '']"/> * <xsl:choose> * <xsl:when test="@action"> * <xsl:attribute name="action"> * <xsl:value-of select="context:rewriteActionURL(@action)"/> * </xsl:attribute> * </xsl:when> * <xsl:otherwise> * <xsl:attribute name="action"> * <xsl:value-of select="context:rewriteActionURL('')"/> * </xsl:attribute> * </xsl:otherwise> * </xsl:choose> * <!-- Default is POST instead of GET for portlets --> * <xsl:if test="not(@method) and $container-type/* = 'portlet'"> * <xsl:attribute name="method">post</xsl:attribute> * </xsl:if> * <xsl:apply-templates/> * </xsl:copy> * </xsl:template> * </pre> * * If match is satisfied then modified event is sent to destination contentHandler. * * @return null match is not satisfied, this otherwise. * @throws SAXException if destination contentHandler throws SAXException */ private State2 handleForm (final String ns, final String lnam, final String qnam, final Attributes atts) throws SAXException { final State2 ret; if ("form".equals(lnam)) { final AttributesImpl newAtts = SAXUtils.getAttributesFromDefaultNamespace(atts); final String actn = newAtts.getValue("", ACTION_ATT); final String newActn; if (actn == null) { newActn = response.rewriteActionURL(""); newAtts.addAttribute("", ACTION_ATT, ACTION_ATT, "", newActn); } else { final int idx = newAtts.getIndex("", ACTION_ATT); newActn = response.rewriteActionURL(actn); newAtts.setValue(idx, newActn); } if (atts.getValue("", METHOD_ATT) == null) { newAtts.addAttribute("", METHOD_ATT, METHOD_ATT, "", "post"); } ret = this; xmlReceiver.startElement(ns, lnam, qnam, newAtts); } else { ret = null; } return ret; } /** * If we have accumulated character data rewrite it and forward it. Implements : * <pre> * <xsl:template match="text()"> * <xsl:value-of * select="replace(current(), 'wsrp_rewrite', 'wsrp_rewritewsrp_rewrite')"/> * <xsl:apply-templates/> * </xsl:template> * </pre> * If there no character data has been accumulated do nothing. Also clears buffer. */ private void flushCharacters() throws SAXException { final int bfLen = charactersBuf == null ? 0 : charactersBuf.position(); if (bfLen > 0) { charactersBuf.flip(); final char[] chs = charactersBuf.array(); final int chsStrt = charactersBuf.arrayOffset(); int last = 0; if (last < bfLen) { final int len = bfLen - last; xmlReceiver.characters(chs, chsStrt + last, len); } charactersBuf.clear(); } } /** * Just calls flushCharacters and super.endElement( ... ) */ @Override protected void endElementStart(final String ns, final String lnam, final String qnam) throws SAXException { fObjectParent.remove(fObjectParent.size() - 1); flushCharacters(); super.endElementStart(ns, lnam, qnam); } /** * Just calls flushCharacters then tests the event data. If * <ul> * <li> * * @url-norewrite='true' then forward the event to the destination content handler and * return new NoRewriteState( ... ), otherwise * </li> * <li> * if ns.equals( XHTML_URI ) then * <ul> * <li>if one of the handleXXX methods returns non-null do nothing, otherwise</li> * <li> * forward the event to the destination content handler and return this, otherwise * </li> * </ul> * </li> * <li> * if the element is {http://orbeon.org/oxf/xml/formatting}rewrite then implement : * <pre> * <xsl:choose> * <xsl:when test="@type = 'action'"> * <xsl:value-of select="context:rewriteActionURL(@url)"/> * </xsl:when> * <xsl:when test="@type = 'render'"> * <xsl:value-of select="context:rewriteRenderURL(@url)"/> * </xsl:when> * <xsl:otherwise> * <xsl:value-of select="context:rewriteResourceURL(@url)"/> * </xsl:otherwise> * </xsl:choose> * </pre> * Note this means that we forward characters to the destination content handler instead * of a start element event, otherwise * </li> * <li> * simply forward the event as is to the destination content handler and return this. * </li> * </ul> */ protected State startElementStart(final String ns, final String lnam, final String qnam, Attributes atts) throws SAXException { fObjectParent.add(Boolean.valueOf(OBJECT_ELT.equals(lnam) && XMLConstants.XHTML_NAMESPACE_URI.equals(ns))); final int noRewriteIndex = atts.getIndex(XMLConstants.OPS_FORMATTING_URI, NOREWRITE_ATT); final String noRewriteValue = atts.getValue(noRewriteIndex); State ret = null; flushCharacters(); if (noRewriteValue != null) { // Remove f:url-norewrite attribute final AttributesImpl attributesImpl = new AttributesImpl(atts); attributesImpl.removeAttribute(noRewriteIndex); atts = attributesImpl; } done : if ("true".equals(noRewriteValue)) { final State stt = new NoRewriteState(this, xmlReceiver, response, scriptDepth, rewriteURI); ret = stt.startElement(ns, lnam, qnam, atts); } else if (XMLConstants.OPS_FORMATTING_URI.equals(ns) && "rewrite".equals(lnam)) { final String typ = atts.getValue("", "type"); final String url = atts.getValue("", "url"); if (url != null) { final String newURL; if ("action".equals(typ)) { newURL = response.rewriteActionURL(url); } else if ("render".equals(typ)) { newURL = response.rewriteRenderURL(url); } else { newURL = response.rewriteResourceURL(url, ExternalContext.Response.REWRITE_MODE_ABSOLUTE_PATH_OR_RELATIVE); } final char[] chs = newURL.toCharArray(); xmlReceiver.characters(chs, 0, chs.length); } } else { scriptDepthOnStart(ns, lnam); if (rewriteURI.equals(ns)) { ret = handleA(ns, lnam, qnam, atts); if (ret != null) break done; ret = handleForm(ns, lnam, qnam, atts); if (ret != null) break done; ret = handleArea(ns, lnam, qnam, atts); if (ret != null) break done; ret = handleEltWithResource("link", HREF_ATT, ns, lnam, qnam, atts); if (ret != null) break done; ret = handleEltWithResource("img", SRC_ATT, ns, lnam, qnam, atts); if (ret != null) break done; ret = handleEltWithResource("frame", SRC_ATT, ns, lnam, qnam, atts); if (ret != null) break done; ret = handleEltWithResource("iframe", SRC_ATT, ns, lnam, qnam, atts); if (ret != null) break done; ret = handleEltWithResource(SCRIPT_ELT, SRC_ATT, ns, lnam, qnam, atts); if (ret != null) break done; ret = handleInput(ns, lnam, qnam, atts); if (ret != null) break done; ret = handleEltWithResource("td", BACKGROUND_ATT, ns, lnam, qnam, atts); if (ret != null) break done; ret = handleEltWithResource("body", BACKGROUND_ATT, ns, lnam, qnam, atts); if (ret != null) break done; ret = handleObject(ns, lnam, qnam, atts); if (ret != null) break done; ret = handleApplet(ns, lnam, qnam, atts); if (ret != null) break done; ret = handleParam(ns, lnam, qnam, atts); if (ret != null) break done; // Not valid in HTML, but useful for e.g. Dojo contentPane ret = handleEltWithResource("div", HREF_ATT, ns, lnam, qnam, atts); if (ret != null) break done; } ret = this; xmlReceiver.startElement(ns, lnam, qnam, atts); } return ret; } /** * If haveScriptAncestor then just forward data to destination contentHandler. Otherwise store that data in the * buffer and do not forward. Also manages init'ing and growing charactersBuf as need be. */ @Override public State characters(final char[] ch, final int strt, final int len) throws SAXException { if (scriptDepth > 0) { xmlReceiver.characters(ch, strt, len); } else { final int bufLen = charactersBuf == null ? 0 : charactersBuf.position(); final int cpcty = bufLen + (len * 2); if (charactersBuf == null || charactersBuf.remaining() < cpcty) { final java.nio.CharBuffer newBuf = java.nio.CharBuffer.allocate(cpcty); if (charactersBuf != null) { charactersBuf.flip(); newBuf.put(charactersBuf); } charactersBuf = newBuf; } charactersBuf.put(ch, strt, len); } return this; } /** * Just calls flushCharacters and super.ignorableWhitespace( ... ) */ @Override public State ignorableWhitespace(final char[] ch, final int strt, final int len) throws SAXException { flushCharacters(); return super.ignorableWhitespace(ch, strt, len); } /** * Just calls flushCharacters and super.processingInstruction( ... ) */ @Override public State processingInstruction(final String trgt, final String dat) throws SAXException { flushCharacters(); return super.processingInstruction(trgt, dat); } /** * Just calls flushCharacters and super.skippedEntity( ... ) */ @Override public State skippedEntity(final String nam) throws SAXException { flushCharacters(); return super.skippedEntity(nam); } } /** * Essentially this corresponds to the norewrite mode of oxf-rewrite.xsl. i.e. Just forwards events to the * destination content handler until we finish the initial element (depth < 0) or until it encounters * @url-norewrite='false'. In the first case transitions to the previous state and in the second case it transitions * to new RewriteState(this, contentHandler, response, haveScriptAncestor). */ static class NoRewriteState extends State2 { NoRewriteState(final State2 previousState, final XMLReceiver xmlReceiver, final URLRewriter response, final int scriptDepth, final String rewriteURI) { super(previousState, xmlReceiver, response, scriptDepth, rewriteURI); } protected State startElementStart(final String ns, final String lnam, final String qnam, Attributes atts) throws SAXException { final int noRewriteIndex = atts.getIndex(XMLConstants.OPS_FORMATTING_URI, NOREWRITE_ATT); final String noRewriteValue = atts.getValue(noRewriteIndex); final State ret; if (noRewriteValue != null) { // Remove f:url-norewrite attribute final AttributesImpl attributesImpl = new AttributesImpl(atts); attributesImpl.removeAttribute(noRewriteIndex); atts = attributesImpl; } if ("false".equals(noRewriteValue)) { final State stt = new RewriteState(this, xmlReceiver, response, scriptDepth, rewriteURI); ret = stt.startElement(ns, lnam, qnam, atts); } else { scriptDepthOnStart(ns, lnam); final Attributes newAtts = SAXUtils.getAttributesFromDefaultNamespace(atts); xmlReceiver.startElement(ns, lnam, qnam, newAtts); ret = this; } return ret; } } /** * Namespace of the elements that are to be rewritten. */ final String rewriteURI; /** * Just declares input 'data' and output 'data'. * * @param rewriteURI e.g. "http://www.w3.org/1999/xhtml" or "" */ public AbstractRewrite(final String rewriteURI) { this.rewriteURI = rewriteURI; addInputInfo(new ProcessorInputOutputInfo(INPUT_DATA)); addOutputInfo(new ProcessorInputOutputInfo(OUTPUT_DATA)); } @Override public ProcessorOutput createOutput(final String name) { final ProcessorOutput processorOutput = new CacheableTransformerOutputImpl(AbstractRewrite.this, name) { public void readImpl(final PipelineContext pipelineContext, final XMLReceiver xmlReceiver) { readInputAsSAX(pipelineContext, INPUT_DATA, getRewriteXMLReceiver(NetUtils.getExternalContext().getResponse(), xmlReceiver, false)); } }; addOutput(name, processorOutput); return processorOutput; } public XMLReceiver getRewriteXMLReceiver(final URLRewriter rewriter, final XMLReceiver xmlReceiver, final boolean fragment) { final State rootState; if (fragment) { // Start directly with rewrite state final FragmentRootState fragmentRootState = new FragmentRootState(null, xmlReceiver); final State afterRootState = new RewriteState(fragmentRootState, xmlReceiver, rewriter, 0, rewriteURI); fragmentRootState.setNextState(afterRootState); rootState = fragmentRootState; } else { // Start with root filter final DocumentRootState documentRootState = new DocumentRootState(null, xmlReceiver); final State afterRootState = new RewriteState(documentRootState, xmlReceiver, rewriter, 0, rewriteURI); documentRootState.setNextState(afterRootState); rootState = documentRootState; } return new StatefulHandler(rootState); } }
lgpl-2.1
alkacon/opencms-core
src-gwt/org/opencms/gwt/client/ui/contextmenu/CmsResourceInfo.java
2870
/* * This library is part of OpenCms - * the Open Source Content Management System * * Copyright (C) Alkacon Software (http://www.alkacon.com) * * This library is free software; you can redistribute it and/or * modify it under the terms of the GNU Lesser General Public * License as published by the Free Software Foundation; either * version 2.1 of the License, or (at your option) any later version. * * This library is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Lesser General Public License for more details. * * For further information about Alkacon Software, please see the * company website: http://www.alkacon.com * * For further information about OpenCms, please see the * project website: http://www.opencms.org * * You should have received a copy of the GNU Lesser General Public * License along with this library; if not, write to the Free Software * Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA */ package org.opencms.gwt.client.ui.contextmenu; import org.opencms.gwt.client.ui.resourceinfo.CmsResourceInfoDialog; import org.opencms.gwt.shared.CmsContextMenuEntryBean; import org.opencms.util.CmsUUID; import java.util.HashMap; /** * Context menu entry for displaying resource information.<p> */ public class CmsResourceInfo implements I_CmsHasContextMenuCommand, I_CmsContextMenuCommand { /** * Gets the context menu command instance.<p> * * @return the context menu command instance */ public static I_CmsContextMenuCommand getContextMenuCommand() { return new CmsResourceInfo(); } /** * @see org.opencms.gwt.client.ui.contextmenu.I_CmsContextMenuCommand#execute(org.opencms.util.CmsUUID, org.opencms.gwt.client.ui.contextmenu.I_CmsContextMenuHandler, org.opencms.gwt.shared.CmsContextMenuEntryBean) */ public void execute(CmsUUID structureId, I_CmsContextMenuHandler handler, CmsContextMenuEntryBean bean) { CmsResourceInfoDialog.load(structureId, true, null, new HashMap<String, String>(), null); } /** * @see org.opencms.gwt.client.ui.contextmenu.I_CmsContextMenuCommand#getItemWidget(org.opencms.util.CmsUUID, org.opencms.gwt.client.ui.contextmenu.I_CmsContextMenuHandler, org.opencms.gwt.shared.CmsContextMenuEntryBean) */ public A_CmsContextMenuItem getItemWidget( CmsUUID structureId, I_CmsContextMenuHandler handler, CmsContextMenuEntryBean bean) { return null; } /** * @see org.opencms.gwt.client.ui.contextmenu.I_CmsContextMenuCommand#hasItemWidget() */ public boolean hasItemWidget() { return false; } }
lgpl-2.1
sbonoc/opencms-core
src-gwt/org/opencms/acacia/client/widgets/CmsLocalizationWidgetFactory.java
2433
/* * This library is part of OpenCms - * the Open Source Content Management System * * Copyright (c) Alkacon Software GmbH (http://www.alkacon.com) * * This library is free software; you can redistribute it and/or * modify it under the terms of the GNU Lesser General Public * License as published by the Free Software Foundation; either * version 2.1 of the License, or (at your option) any later version. * * This library is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Lesser General Public License for more details. * * For further information about Alkacon Software, please see the * company website: http://www.alkacon.com * * For further information about OpenCms, please see the * project website: http://www.opencms.org * * You should have received a copy of the GNU Lesser General Public * License along with this library; if not, write to the Free Software * Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA */ package org.opencms.acacia.client.widgets; import org.opencms.acacia.client.I_CmsWidgetFactory; import org.opencms.ade.contenteditor.widgetregistry.client.WidgetRegistry; import org.opencms.gwt.client.I_CmsHasInit; import com.google.gwt.dom.client.Element; /** * Factory to generate basic input widget.<p> */ public class CmsLocalizationWidgetFactory implements I_CmsWidgetFactory, I_CmsHasInit { /** The widget name. */ private static final String WIDGET_NAME = "org.opencms.widgets.CmsLocalizationWidget"; /** * Initializes this class.<p> */ public static void initClass() { WidgetRegistry.getInstance().registerWidgetFactory(WIDGET_NAME, new CmsLocalizationWidgetFactory()); } /** * @see org.opencms.acacia.client.I_CmsWidgetFactory#createFormWidget(java.lang.String) */ public I_CmsFormEditWidget createFormWidget(String configuration) { return new CmsFormWidgetWrapper(new CmsTextboxWidget(configuration)); } /** * @see org.opencms.acacia.client.I_CmsWidgetFactory#createInlineWidget(java.lang.String, com.google.gwt.dom.client.Element) */ public I_CmsEditWidget createInlineWidget(String configuration, Element element) { return null; } }
lgpl-2.1
elkafoury/tux
src/org/eclipse/swt/browser/FilePicker.java
10726
/******************************************************************************* * Copyright (c) 2003, 2012 IBM Corporation and others. * All rights reserved. This program and the accompanying materials * are made available under the terms of the Eclipse Public License v1.0 * which accompanies this distribution, and is available at * http://www.eclipse.org/legal/epl-v10.html * * Contributors: * IBM Corporation - initial API and implementation *******************************************************************************/ package org.eclipse.swt.browser; import org.eclipse.swt.SWT; import org.eclipse.swt.internal.*; import org.eclipse.swt.internal.mozilla.*; import org.eclipse.swt.widgets.*; class FilePicker { XPCOMObject supports; XPCOMObject filePicker; int refCount = 0; short mode; int /*long*/ parentHandle; String[] files, masks; String defaultFilename, directory, title; static final String SEPARATOR = System.getProperty ("file.separator"); //$NON-NLS-1$ FilePicker () { createCOMInterfaces (); } int AddRef () { refCount++; return refCount; } void createCOMInterfaces () { /* Create each of the interfaces that this object implements */ supports = new XPCOMObject (new int[] {2, 0, 0}) { public int /*long*/ method0 (int /*long*/[] args) {return QueryInterface (args[0], args[1]);} public int /*long*/ method1 (int /*long*/[] args) {return AddRef ();} public int /*long*/ method2 (int /*long*/[] args) {return Release ();} }; filePicker = new XPCOMObject (new int[] {2, 0, 0, 3, 1, 2, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1}) { public int /*long*/ method0 (int /*long*/[] args) {return QueryInterface (args[0], args[1]);} public int /*long*/ method1 (int /*long*/[] args) {return AddRef ();} public int /*long*/ method2 (int /*long*/[] args) {return Release ();} public int /*long*/ method3 (int /*long*/[] args) {return Init (args[0], args[1], (short)args[2]);} public int /*long*/ method4 (int /*long*/[] args) {return AppendFilters ((int)/*64*/args[0]);} public int /*long*/ method5 (int /*long*/[] args) {return AppendFilter (args[0], args[1]);} public int /*long*/ method6 (int /*long*/[] args) {return GetDefaultString (args[0]);} public int /*long*/ method7 (int /*long*/[] args) {return SetDefaultString (args[0]);} public int /*long*/ method8 (int /*long*/[] args) {return GetDefaultExtension (args[0]);} public int /*long*/ method9 (int /*long*/[] args) {return SetDefaultExtension (args[0]);} public int /*long*/ method10 (int /*long*/[] args) {return GetFilterIndex (args[0]);} public int /*long*/ method11 (int /*long*/[] args) {return SetFilterIndex ((int)/*64*/args[0]);} public int /*long*/ method12 (int /*long*/[] args) {return GetDisplayDirectory (args[0]);} public int /*long*/ method13 (int /*long*/[] args) {return SetDisplayDirectory (args[0]);} public int /*long*/ method14 (int /*long*/[] args) {return GetFile (args[0]);} public int /*long*/ method15 (int /*long*/[] args) {return GetFileURL (args[0]);} public int /*long*/ method16 (int /*long*/[] args) {return GetFiles (args[0]);} public int /*long*/ method17 (int /*long*/[] args) {return Show (args[0]);} }; } void disposeCOMInterfaces () { if (supports != null) { supports.dispose (); supports = null; } if (filePicker != null) { filePicker.dispose (); filePicker = null; } } int /*long*/ getAddress () { return filePicker.getAddress (); } int QueryInterface (int /*long*/ riid, int /*long*/ ppvObject) { if (riid == 0 || ppvObject == 0) return XPCOM.NS_ERROR_NO_INTERFACE; nsID guid = new nsID (); XPCOM.memmove (guid, riid, nsID.sizeof); if (guid.Equals (nsISupports.NS_ISUPPORTS_IID)) { XPCOM.memmove (ppvObject, new int /*long*/[] {supports.getAddress ()}, C.PTR_SIZEOF); AddRef (); return XPCOM.NS_OK; } if (guid.Equals (nsIFilePicker.NS_IFILEPICKER_IID)) { XPCOM.memmove(ppvObject, new int /*long*/[] {filePicker.getAddress ()}, C.PTR_SIZEOF); AddRef (); return XPCOM.NS_OK; } if (guid.Equals (nsIFilePicker_1_8.NS_IFILEPICKER_IID)) { XPCOM.memmove(ppvObject, new int /*long*/[] {filePicker.getAddress ()}, C.PTR_SIZEOF); AddRef (); return XPCOM.NS_OK; } if (guid.Equals (nsIFilePicker_1_8.NS_IFILEPICKER_10_IID)) { XPCOM.memmove(ppvObject, new int /*long*/[] {filePicker.getAddress ()}, C.PTR_SIZEOF); AddRef (); return XPCOM.NS_OK; } XPCOM.memmove (ppvObject, new int /*long*/[] {0}, C.PTR_SIZEOF); return XPCOM.NS_ERROR_NO_INTERFACE; } int Release () { refCount--; if (refCount == 0) disposeCOMInterfaces (); return refCount; } Browser getBrowser (int /*long*/ aDOMWindow) { if (aDOMWindow == 0) return null; return Mozilla.getBrowser (aDOMWindow); } /* * As of Mozilla 1.8 some of nsIFilePicker's string arguments changed type. This method * answers a java string based on the type of string that is appropriate for the Mozilla * version being used. */ String parseAString (int /*long*/ string) { return null; } /* nsIFilePicker */ int Init (int /*long*/ parent, int /*long*/ title, short mode) { parentHandle = parent; this.mode = mode; this.title = parseAString (title); return XPCOM.NS_OK; } int Show (int /*long*/ _retval) { if (mode == nsIFilePicker.modeGetFolder) { /* picking a directory */ int result = showDirectoryPicker (); XPCOM.memmove (_retval, new short[] {(short)result}, 2); /* PRInt16 */ return XPCOM.NS_OK; } /* picking a file */ int style = mode == nsIFilePicker.modeSave ? SWT.SAVE : SWT.OPEN; if (mode == nsIFilePicker.modeOpenMultiple) style |= SWT.MULTI; Browser browser = getBrowser (parentHandle); Shell parent = null; if (browser != null) { parent = browser.getShell (); } else { parent = new Shell (); } FileDialog dialog = new FileDialog (parent, style); if (title != null) dialog.setText (title); if (directory != null) dialog.setFilterPath (directory); if (masks != null) dialog.setFilterExtensions (masks); if (defaultFilename != null) dialog.setFileName (defaultFilename); String filename = dialog.open (); files = dialog.getFileNames (); directory = dialog.getFilterPath (); title = defaultFilename = null; masks = null; int result = filename == null ? nsIFilePicker.returnCancel : nsIFilePicker.returnOK; XPCOM.memmove (_retval, new short[] {(short)result}, 2); /* PRInt16 */ return XPCOM.NS_OK; } int showDirectoryPicker () { Browser browser = getBrowser (parentHandle); Shell parent = null; if (browser != null) { parent = browser.getShell (); } else { parent = new Shell (); } DirectoryDialog dialog = new DirectoryDialog (parent, SWT.NONE); if (title != null) dialog.setText (title); if (directory != null) dialog.setFilterPath (directory); directory = dialog.open (); title = defaultFilename = null; files = masks = null; return directory == null ? nsIFilePicker.returnCancel : nsIFilePicker.returnOK; } int GetFiles (int /*long*/ aFiles) { return XPCOM.NS_ERROR_NOT_IMPLEMENTED; } int GetFileURL (int /*long*/ aFileURL) { return XPCOM.NS_ERROR_NOT_IMPLEMENTED; } int GetFile (int /*long*/ aFile) { String filename = ""; //$NON-NLS-1$ if (directory != null) filename += directory + SEPARATOR; if (files != null && files.length > 0) filename += files[0]; nsEmbedString path = new nsEmbedString (filename); int /*long*/[] file = new int /*long*/[1]; int rc = XPCOM.NS_NewLocalFile (path.getAddress (), 1, file); path.dispose (); if (rc != XPCOM.NS_OK) Mozilla.error (rc); if (file[0] == 0) Mozilla.error (XPCOM.NS_ERROR_NULL_POINTER); XPCOM.memmove (aFile, file, C.PTR_SIZEOF); return XPCOM.NS_OK; } int SetDisplayDirectory (int /*long*/ aDisplayDirectory) { if (aDisplayDirectory == 0) return XPCOM.NS_OK; nsILocalFile file = new nsILocalFile (aDisplayDirectory); int /*long*/ pathname = XPCOM.nsEmbedString_new (); int rc = file.GetPath (pathname); if (rc != XPCOM.NS_OK) Mozilla.error (rc); int length = XPCOM.nsEmbedString_Length (pathname); int /*long*/ buffer = XPCOM.nsEmbedString_get (pathname); char[] chars = new char[length]; XPCOM.memmove (chars, buffer, length * 2); XPCOM.nsEmbedString_delete (pathname); directory = new String (chars); return XPCOM.NS_OK; } int GetDisplayDirectory (int /*long*/ aDisplayDirectory) { String directoryName = directory != null ? directory : ""; //$NON-NLS-1$ nsEmbedString path = new nsEmbedString (directoryName); int /*long*/[] file = new int /*long*/[1]; int rc = XPCOM.NS_NewLocalFile (path.getAddress (), 1, file); path.dispose (); if (rc != XPCOM.NS_OK) Mozilla.error (rc); if (file[0] == 0) Mozilla.error (XPCOM.NS_ERROR_NULL_POINTER); XPCOM.memmove (aDisplayDirectory, file, C.PTR_SIZEOF); return XPCOM.NS_OK; } int SetFilterIndex (int aFilterIndex) { return XPCOM.NS_ERROR_NOT_IMPLEMENTED; } int GetFilterIndex (int /*long*/ aFilterIndex) { return XPCOM.NS_ERROR_NOT_IMPLEMENTED; } int SetDefaultExtension (int /*long*/ aDefaultExtension) { /* note that the type of argument 1 changed as of Mozilla 1.8 */ return XPCOM.NS_ERROR_NOT_IMPLEMENTED; } int GetDefaultExtension (int /*long*/ aDefaultExtension) { /* note that the type of argument 1 changed as of Mozilla 1.8 */ return XPCOM.NS_ERROR_NOT_IMPLEMENTED; } int SetDefaultString (int /*long*/ aDefaultString) { defaultFilename = parseAString (aDefaultString); return XPCOM.NS_OK; } int GetDefaultString (int /*long*/ aDefaultString) { /* note that the type of argument 1 changed as of Mozilla 1.8 */ return XPCOM.NS_ERROR_NOT_IMPLEMENTED; } int AppendFilter (int /*long*/ title, int /*long*/ filter) { /* note that the type of arguments 1 and 2 changed as of Mozilla 1.8 */ return XPCOM.NS_ERROR_NOT_IMPLEMENTED; } int AppendFilters (int filterMask) { String[] addFilters = null; switch (filterMask) { case nsIFilePicker.filterAll: case nsIFilePicker.filterApps: masks = null; /* this is equivalent to no filter */ break; case nsIFilePicker.filterHTML: addFilters = new String[] {"*.htm;*.html"}; //$NON-NLS-1$ break; case nsIFilePicker.filterImages: addFilters = new String[] {"*.gif;*.jpeg;*.jpg;*.png"}; //$NON-NLS-1$ break; case nsIFilePicker.filterText: addFilters = new String[] {"*.txt"}; //$NON-NLS-1$ break; case nsIFilePicker.filterXML: addFilters = new String[] {"*.xml"}; //$NON-NLS-1$ break; case nsIFilePicker.filterXUL: addFilters = new String[] {"*.xul"}; //$NON-NLS-1$ break; } if (masks == null) { masks = addFilters; } else { if (addFilters != null) { String[] newFilters = new String[masks.length + addFilters.length]; System.arraycopy (masks, 0, newFilters, 0, masks.length); System.arraycopy (addFilters, 0, newFilters, masks.length, addFilters.length); masks = newFilters; } } return XPCOM.NS_OK; } }
lgpl-2.1
EgorZhuk/pentaho-reporting
designer/datasource-editor-scriptable/src/main/java/org/pentaho/reporting/ui/datasources/scriptable/ScriptableDataSourceEditor.java
23728
/*! * This program is free software; you can redistribute it and/or modify it under the * terms of the GNU Lesser General Public License, version 2.1 as published by the Free Software * Foundation. * * You should have received a copy of the GNU Lesser General Public License along with this * program; if not, you can obtain a copy at http://www.gnu.org/licenses/old-licenses/lgpl-2.1.html * or from the Free Software Foundation, Inc., * 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA. * * This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; * without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. * See the GNU Lesser General Public License for more details. * * Copyright (c) 2002-2013 Pentaho Corporation.. All rights reserved. */ package org.pentaho.reporting.ui.datasources.scriptable; import org.apache.bsf.BSFManager; import org.fife.ui.rsyntaxtextarea.RSyntaxTextArea; import org.fife.ui.rsyntaxtextarea.SyntaxConstants; import org.fife.ui.rtextarea.RTextScrollPane; import org.pentaho.reporting.engine.classic.core.ReportDataFactoryException; import org.pentaho.reporting.engine.classic.core.designtime.DesignTimeContext; import org.pentaho.reporting.engine.classic.core.designtime.datafactory.DataFactoryEditorSupport; import org.pentaho.reporting.engine.classic.core.modules.gui.commonswing.ExceptionDialog; import org.pentaho.reporting.engine.classic.core.util.ReportParameterValues; import org.pentaho.reporting.engine.classic.extensions.datasources.scriptable.ScriptableDataFactory; import org.pentaho.reporting.libraries.base.util.StringUtils; import org.pentaho.reporting.libraries.designtime.swing.BorderlessButton; import org.pentaho.reporting.libraries.designtime.swing.CommonDialog; import org.pentaho.reporting.libraries.designtime.swing.background.CancelEvent; import org.pentaho.reporting.libraries.designtime.swing.background.DataPreviewDialog; import org.pentaho.reporting.libraries.designtime.swing.background.PreviewWorker; import javax.swing.*; import javax.swing.border.EmptyBorder; import javax.swing.event.DocumentEvent; import javax.swing.event.DocumentListener; import javax.swing.event.ListSelectionEvent; import javax.swing.event.ListSelectionListener; import javax.swing.table.TableModel; import java.awt.*; import java.awt.event.ActionEvent; import java.awt.event.ActionListener; import java.net.URL; import java.util.ArrayList; import java.util.Iterator; import java.util.Map; import java.util.TreeMap; /** * @author David Kincade */ public class ScriptableDataSourceEditor extends CommonDialog { private class UpdateLanguageHandler implements ActionListener, ListSelectionListener { private UpdateLanguageHandler() { } public void actionPerformed( final ActionEvent e ) { updateComponents(); } /** * Called whenever the value of the selection changes. * * @param e the event that characterizes the change. */ public void valueChanged( final ListSelectionEvent e ) { updateComponents(); } } private static class InternalBSFManager extends BSFManager { private InternalBSFManager() { } public static String[] getRegisteredLanguages() { final ArrayList<String> list = new ArrayList<String>(); final Iterator iterator = registeredEngines.entrySet().iterator(); while ( iterator.hasNext() ) { final Map.Entry entry = (Map.Entry) iterator.next(); final String lang = (String) entry.getKey(); final String className = (String) entry.getValue(); try { // this is how BSH will load the class Class.forName( className, false, Thread.currentThread().getContextClassLoader() ); list.add( lang ); } catch ( Throwable t ) { // ignored. } } return list.toArray( new String[ list.size() ] ); } } private class QueryRemoveAction extends AbstractAction implements ListSelectionListener { private QueryRemoveAction() { final URL resource = ScriptableDataSourceEditor.class.getResource ( "/org/pentaho/reporting/ui/datasources/scriptable/resources/Remove.png" ); if ( resource != null ) { putValue( Action.SMALL_ICON, new ImageIcon( resource ) ); } else { putValue( Action.NAME, Messages.getString( "ScriptableDataSourceEditor.RemoveQuery.Name" ) ); } putValue( Action.SHORT_DESCRIPTION, Messages.getString( "ScriptableDataSourceEditor.RemoveQuery.Description" ) ); } public void actionPerformed( final ActionEvent e ) { final DataSetQuery query = (DataSetQuery) queryNameList.getSelectedValue(); if ( query != null ) { queries.remove( query.getQueryName() ); } inModifyingQueryNameList = true; updateQueryList(); queryNameList.clearSelection(); inModifyingQueryNameList = false; updateComponents(); } public void valueChanged( final ListSelectionEvent e ) { setEnabled( queryNameList.isSelectionEmpty() == false ); } } private class QueryNameTextFieldDocumentListener implements DocumentListener { public void insertUpdate( final DocumentEvent e ) { update(); } public void removeUpdate( final DocumentEvent e ) { update(); } public void changedUpdate( final DocumentEvent e ) { update(); } private void update() { if ( inModifyingQueryNameList ) { return; } final String queryName = queryNameTextField.getText(); final DataSetQuery currentQuery = (DataSetQuery) queryNameList.getSelectedValue(); if ( currentQuery == null ) { return; } if ( queryName.equals( currentQuery.getQueryName() ) ) { return; } if ( queries.containsKey( queryName ) ) { return; } inQueryNameUpdate = true; queries.remove( currentQuery.getQueryName() ); currentQuery.setQueryName( queryName ); queries.put( currentQuery.getQueryName(), currentQuery ); updateQueryList(); queryNameList.setSelectedValue( currentQuery, true ); inQueryNameUpdate = false; } } private static class QueryNameListCellRenderer extends DefaultListCellRenderer { public Component getListCellRendererComponent( final JList list, final Object value, final int index, final boolean isSelected, final boolean cellHasFocus ) { final JLabel listCellRendererComponent = (JLabel) super.getListCellRendererComponent( list, value, index, isSelected, cellHasFocus ); if ( value != null ) { final String queryName = ( (DataSetQuery) value ).getQueryName(); if ( StringUtils.isEmpty( queryName ) == false ) { listCellRendererComponent.setText( queryName ); } else { listCellRendererComponent.setText( " " ); } } return listCellRendererComponent; } } private class QueryNameListSelectionListener implements ListSelectionListener { public void valueChanged( final ListSelectionEvent e ) { if ( !inQueryNameUpdate ) { final DataSetQuery query = (DataSetQuery) queryNameList.getSelectedValue(); if ( query != null ) { queryNameTextField.setText( query.getQueryName() ); queryTextArea.setText( query.getQuery() ); updateComponents(); } else { queryNameTextField.setText( "" ); queryTextArea.setText( "" ); updateComponents(); } } } } private class QueryAddAction extends AbstractAction { private QueryAddAction() { final URL resource = ScriptableDataSourceEditor.class.getResource ( "/org/pentaho/reporting/ui/datasources/scriptable/resources/Add.png" ); if ( resource != null ) { putValue( Action.SMALL_ICON, new ImageIcon( resource ) ); } else { putValue( Action.NAME, Messages.getString( "ScriptableDataSourceEditor.AddQuery.Name" ) ); } putValue( Action.SHORT_DESCRIPTION, Messages.getString( "ScriptableDataSourceEditor.AddQuery.Description" ) ); } public void actionPerformed( final ActionEvent e ) { // Find a unique query name String queryName = Messages.getString( "ScriptableDataSourceEditor.Query" ); for ( int i = 1; i < 1000; ++i ) { final String newQueryName = Messages.getString( "ScriptableDataSourceEditor.Query" ) + ' ' + i; if ( !queries.containsKey( newQueryName ) ) { queryName = newQueryName; break; } } final DataSetQuery newQuery = new DataSetQuery( queryName, "" ); queries.put( newQuery.getQueryName(), newQuery ); inModifyingQueryNameList = true; updateQueryList(); queryNameList.setSelectedValue( newQuery, true ); inModifyingQueryNameList = false; updateComponents(); } } private class QueryDocumentListener implements DocumentListener { private QueryDocumentListener() { } public void insertUpdate( final DocumentEvent e ) { update(); } public void removeUpdate( final DocumentEvent e ) { update(); } public void changedUpdate( final DocumentEvent e ) { update(); } private void update() { final DataSetQuery currentQuery = (DataSetQuery) queryNameList.getSelectedValue(); if ( currentQuery == null ) { return; } currentQuery.setQuery( queryTextArea.getText() ); } } private class PreviewAction extends AbstractAction { private PreviewAction() { putValue( Action.NAME, Messages.getString( "ScriptableDataSourceEditor.Preview.Name" ) ); } public void actionPerformed( final ActionEvent aEvt ) { try { final ScriptableDataFactory dataFactory = produceFactory(); DataFactoryEditorSupport.configureDataFactoryForPreview( dataFactory, designTimeContext ); final DataPreviewDialog previewDialog = new DataPreviewDialog( ScriptableDataSourceEditor.this ); final ScriptablePreviewWorker worker = new ScriptablePreviewWorker( dataFactory, queryNameTextField.getText() ); previewDialog.showData( worker ); final ReportDataFactoryException factoryException = worker.getException(); if ( factoryException != null ) { ExceptionDialog.showExceptionDialog( ScriptableDataSourceEditor.this, Messages.getString( "ScriptableDataSourceEditor.PreviewError.Title" ), Messages.getString( "ScriptableDataSourceEditor.PreviewError.Message" ), factoryException ); } } catch ( Exception e ) { ExceptionDialog.showExceptionDialog( ScriptableDataSourceEditor.this, Messages.getString( "ScriptableDataSourceEditor.PreviewError.Title" ), Messages.getString( "ScriptableDataSourceEditor.PreviewError.Message" ), e ); } } } private static class ScriptablePreviewWorker implements PreviewWorker { private ScriptableDataFactory dataFactory; private TableModel resultTableModel; private ReportDataFactoryException exception; private String query; private ScriptablePreviewWorker( final ScriptableDataFactory dataFactory, final String query ) { if ( dataFactory == null ) { throw new NullPointerException(); } this.query = query; this.dataFactory = dataFactory; } public ReportDataFactoryException getException() { return exception; } public TableModel getResultTableModel() { return resultTableModel; } public void close() { } /** * Requests that the thread stop processing as soon as possible. */ public void cancelProcessing( final CancelEvent event ) { dataFactory.cancelRunningQuery(); } /** * When an object implementing interface <code>Runnable</code> is used to create a thread, starting the thread * causes the object's <code>run</code> method to be called in that separately executing thread. * <p/> * The general contract of the method <code>run</code> is that it may take any action whatsoever. * * @see Thread#run() */ public void run() { try { resultTableModel = dataFactory.queryData( query, new ReportParameterValues() ); } catch ( ReportDataFactoryException e ) { exception = e; } finally { dataFactory.close(); } } } private JList queryNameList; private JTextField queryNameTextField; private JList languageField; private RSyntaxTextArea queryTextArea; private RSyntaxTextArea initScriptTextArea; private RSyntaxTextArea shutdownScriptTextArea; private Map<String, DataSetQuery> queries; private boolean inQueryNameUpdate; private boolean inModifyingQueryNameList; private PreviewAction previewAction; private DesignTimeContext designTimeContext; public ScriptableDataSourceEditor( final DesignTimeContext designTimeContext ) { init( designTimeContext ); } public ScriptableDataSourceEditor( final DesignTimeContext designTimeContext, final Dialog owner ) { super( owner ); init( designTimeContext ); } public ScriptableDataSourceEditor( final DesignTimeContext designTimeContext, final Frame owner ) { super( owner ); init( designTimeContext ); } private void init( final DesignTimeContext designTimeContext ) { if ( designTimeContext == null ) { throw new NullPointerException(); } this.designTimeContext = designTimeContext; setTitle( Messages.getString( "ScriptableDataSourceEditor.Title" ) ); setModal( true ); previewAction = new PreviewAction(); queryNameTextField = new JTextField( null, 0 ); queryNameTextField.setColumns( 35 ); queryNameTextField.getDocument().addDocumentListener( new QueryNameTextFieldDocumentListener() ); queryTextArea = new RSyntaxTextArea(); queryTextArea.setSyntaxEditingStyle( SyntaxConstants.SYNTAX_STYLE_NONE ); queryTextArea.getDocument().addDocumentListener( new QueryDocumentListener() ); initScriptTextArea = new RSyntaxTextArea(); initScriptTextArea.setSyntaxEditingStyle( SyntaxConstants.SYNTAX_STYLE_NONE ); shutdownScriptTextArea = new RSyntaxTextArea(); shutdownScriptTextArea.setSyntaxEditingStyle( SyntaxConstants.SYNTAX_STYLE_NONE ); languageField = new JList( new DefaultComboBoxModel( InternalBSFManager.getRegisteredLanguages() ) ); languageField.setSelectionMode( ListSelectionModel.SINGLE_SELECTION ); languageField.getSelectionModel().addListSelectionListener( new UpdateLanguageHandler() ); queryNameList = new JList(); queryNameList.setSelectionMode( ListSelectionModel.SINGLE_SELECTION ); queryNameList.setVisibleRowCount( 5 ); queryNameList.addListSelectionListener( new QueryNameListSelectionListener() ); queryNameList.setCellRenderer( new QueryNameListCellRenderer() ); final QueryRemoveAction removeQueryAction = new QueryRemoveAction(); queryNameList.addListSelectionListener( removeQueryAction ); super.init(); } protected String getDialogId() { return "ScriptableDataSourceEditor"; } protected Component createContentPane() { final JPanel initScriptContentHolder = new JPanel( new BorderLayout() ); initScriptContentHolder .add( BorderLayout.NORTH, new JLabel( Messages.getString( "ScriptableDataSourceEditor.InitScript" ) ) ); initScriptContentHolder.add( BorderLayout.CENTER, new RTextScrollPane( 500, 600, initScriptTextArea, true ) ); final JPanel shutdownScriptContentHolder = new JPanel( new BorderLayout() ); shutdownScriptContentHolder .add( BorderLayout.NORTH, new JLabel( Messages.getString( "ScriptableDataSourceEditor.ShutdownScript" ) ) ); shutdownScriptContentHolder .add( BorderLayout.CENTER, new RTextScrollPane( 500, 600, shutdownScriptTextArea, true ) ); final JPanel queryDetailsNamePanel = new JPanel( new BorderLayout() ); queryDetailsNamePanel .add( new JLabel( Messages.getString( "ScriptableDataSourceEditor.QueryName" ) ), BorderLayout.NORTH ); queryDetailsNamePanel.add( queryNameTextField, BorderLayout.CENTER ); final JPanel queryContentHolder = new JPanel( new BorderLayout() ); queryContentHolder .add( BorderLayout.NORTH, new JLabel( Messages.getString( "ScriptableDataSourceEditor.QueryLabel" ) ) ); queryContentHolder.add( BorderLayout.CENTER, new RTextScrollPane( 500, 300, queryTextArea, true ) ); // Create the query details panel final JPanel queryDetailsPanel = new JPanel( new BorderLayout() ); queryDetailsPanel.setBorder( new EmptyBorder( 0, 8, 8, 8 ) ); queryDetailsPanel.add( BorderLayout.NORTH, queryDetailsNamePanel ); queryDetailsPanel.add( BorderLayout.CENTER, queryContentHolder ); final JPanel previewButtonPanel = new JPanel( new FlowLayout( FlowLayout.RIGHT ) ); previewButtonPanel.add( new JButton( previewAction ) ); final JPanel queryContentPanel = new JPanel( new BorderLayout() ); queryContentPanel.add( BorderLayout.NORTH, createQueryListPanel() ); queryContentPanel.add( BorderLayout.CENTER, queryDetailsPanel ); final JTabbedPane scriptsTabPane = new JTabbedPane(); scriptsTabPane.addTab( Messages.getString( "ScriptableDataSourceEditor.QueryTab" ), queryContentPanel ); scriptsTabPane.addTab( Messages.getString( "ScriptableDataSourceEditor.InitScriptTab" ), initScriptContentHolder ); scriptsTabPane .addTab( Messages.getString( "ScriptableDataSourceEditor.ShutdownScriptTab" ), shutdownScriptContentHolder ); final JLabel languageLabel = new JLabel( Messages.getString( "ScriptableDataSourceEditor.Language" ) ); languageLabel.setBorder( new EmptyBorder( 0, 0, 3, 0 ) ); final JPanel languagesPanel = new JPanel( new BorderLayout() ); languagesPanel.setBorder( new EmptyBorder( 8, 8, 8, 0 ) ); languagesPanel.add( BorderLayout.NORTH, languageLabel ); languagesPanel.add( BorderLayout.CENTER, new JScrollPane( languageField ) ); final JPanel contentPanel = new JPanel( new BorderLayout() ); contentPanel.add( BorderLayout.WEST, languagesPanel ); contentPanel.add( BorderLayout.CENTER, scriptsTabPane ); contentPanel.add( BorderLayout.SOUTH, previewButtonPanel ); return contentPanel; } private JPanel createQueryListPanel() { final QueryRemoveAction queryRemoveAction = new QueryRemoveAction(); queryNameList.addListSelectionListener( queryRemoveAction ); final JPanel theQueryButtonsPanel = new JPanel( new FlowLayout( FlowLayout.RIGHT ) ); theQueryButtonsPanel.add( new BorderlessButton( new QueryAddAction() ) ); theQueryButtonsPanel.add( new BorderlessButton( queryRemoveAction ) ); final JPanel theQueryControlsPanel = new JPanel( new BorderLayout() ); theQueryControlsPanel .add( BorderLayout.WEST, new JLabel( Messages.getString( "ScriptableDataSourceEditor.AvailableQueries" ) ) ); theQueryControlsPanel.add( BorderLayout.EAST, theQueryButtonsPanel ); final JPanel queryListPanel = new JPanel( new BorderLayout() ); queryListPanel.setBorder( BorderFactory.createEmptyBorder( 0, 8, 0, 8 ) ); queryListPanel.add( BorderLayout.NORTH, theQueryControlsPanel ); queryListPanel.add( BorderLayout.CENTER, new JScrollPane( queryNameList ) ); return queryListPanel; } public ScriptableDataFactory performConfiguration( final ScriptableDataFactory dataFactory, final String selectedQuery ) { // Reset the confirmed / cancel flag // Initialize the internal storage queries = new TreeMap<String, DataSetQuery>(); // Load the current configuration if ( dataFactory != null ) { languageField.setSelectedValue( dataFactory.getLanguage(), true ); final String[] queryNames = dataFactory.getQueryNames(); for ( int i = 0; i < queryNames.length; i++ ) { final String queryName = queryNames[ i ]; final String query = dataFactory.getQuery( queryName ); queries.put( queryName, new DataSetQuery( queryName, query ) ); } initScriptTextArea.setText( dataFactory.getScript() ); shutdownScriptTextArea.setText( dataFactory.getShutdownScript() ); } // Prepare the data and the enable the proper buttons updateComponents(); updateQueryList(); setSelectedQuery( selectedQuery ); // Enable the dialog if ( !performEdit() ) { return null; } return produceFactory(); } private ScriptableDataFactory produceFactory() { final ScriptableDataFactory returnDataFactory = new ScriptableDataFactory(); returnDataFactory.setLanguage( (String) languageField.getSelectedValue() ); if ( StringUtils.isEmpty( initScriptTextArea.getText() ) ) { returnDataFactory.setScript( null ); } else { returnDataFactory.setScript( initScriptTextArea.getText() ); } if ( StringUtils.isEmpty( shutdownScriptTextArea.getText() ) ) { returnDataFactory.setShutdownScript( null ); } else { returnDataFactory.setShutdownScript( shutdownScriptTextArea.getText() ); } final DataSetQuery[] queries = this.queries.values().toArray( new DataSetQuery[ this.queries.size() ] ); for ( int i = 0; i < queries.length; i++ ) { final DataSetQuery query = queries[ i ]; returnDataFactory.setQuery( query.getQueryName(), query.getQuery() ); } return returnDataFactory; } protected void updateQueryList() { queryNameList.removeAll(); queryNameList.setListData( queries.values().toArray( new DataSetQuery[ queries.size() ] ) ); } private void setSelectedQuery( final String aQuery ) { final ListModel theModel = queryNameList.getModel(); for ( int i = 0; i < theModel.getSize(); i++ ) { final DataSetQuery theDataSet = (DataSetQuery) theModel.getElementAt( i ); if ( theDataSet.getQueryName().equals( aQuery ) ) { queryNameList.setSelectedValue( theDataSet, true ); break; } } } protected void updateComponents() { final boolean querySelected = queryNameList.getSelectedIndex() != -1; final boolean hasQueries = queryNameList.getModel().getSize() > 0; queryNameTextField.setEnabled( querySelected ); queryTextArea.setEnabled( querySelected ); getConfirmAction().setEnabled( hasQueries && languageField.getSelectedIndex() != -1 ); queryTextArea.setSyntaxEditingStyle( mapLanguageToSyntaxHighlighting( (String) languageField.getSelectedValue() ) ); initScriptTextArea .setSyntaxEditingStyle( mapLanguageToSyntaxHighlighting( (String) languageField.getSelectedValue() ) ); shutdownScriptTextArea .setSyntaxEditingStyle( mapLanguageToSyntaxHighlighting( (String) languageField.getSelectedValue() ) ); previewAction.setEnabled( querySelected ); } private String mapLanguageToSyntaxHighlighting( final String language ) { if ( "beanshell".equals( language ) ) { return SyntaxConstants.SYNTAX_STYLE_JAVA; } if ( "groovy".equals( language ) ) { return SyntaxConstants.SYNTAX_STYLE_GROOVY; } if ( "javascript".equals( language ) ) { return SyntaxConstants.SYNTAX_STYLE_JAVASCRIPT; } if ( "jython".equals( language ) ) { return SyntaxConstants.SYNTAX_STYLE_PYTHON; } if ( "xslt".equals( language ) ) { return SyntaxConstants.SYNTAX_STYLE_XML; } return SyntaxConstants.SYNTAX_STYLE_NONE; } }
lgpl-2.1
sarabasiri62/Group2
jdExtract/JD/src/util/InstanceOfIfStatement.java
313
package util; import org.eclipse.jdt.core.dom.IfStatement; import org.eclipse.jdt.core.dom.Statement; public class InstanceOfIfStatement implements StatementInstanceChecker { public boolean instanceOf(Statement statement) { if(statement instanceof IfStatement) return true; else return false; } }
lgpl-2.1
phoenixctms/ctsms
core/src/test/java/org/phoenixctms/ctsms/service/massmail/test/MassMailService_getMassMailTest.java
1265
// This file is part of the Phoenix CTMS project (www.phoenixctms.org), // distributed under LGPL v2.1. Copyright (C) 2011 - 2017. // package org.phoenixctms.ctsms.service.massmail.test; import org.testng.Assert; import org.testng.annotations.Test; /** * <p> * Test case for method <code>getMassMail</code> of service <code>MassMailService</code>. * </p> * * @see org.phoenixctms.ctsms.service.massmail.MassMailService#getMassMail(org.phoenixctms.ctsms.vo.AuthenticationVO, java.lang.Long) */ @Test(groups={"service","MassMailService"}) public class MassMailService_getMassMailTest extends MassMailServiceBaseTest { /** * Test succes path for service method <code>getMassMail</code> * * Tests expected behaviour of service method. */ @Test public void testSuccessPath() { Assert.fail( "Test 'MassMailService_getMassMailTest.testSuccessPath()}' not implemented." ); } /* * Add test methods for each test case of the 'MassMailService.org.andromda.cartridges.spring.metafacades.SpringServiceOperationLogicImpl[org.phoenixctms.ctsms.service.massmail.MassMailService.getMassMail]()' service method. */ /** * Test special case XYZ for service method <code></code> */ /* @Test public void testCaseXYZ() { } */ }
lgpl-2.1
panifex/panifex-platform
panifex-module-api/src/main/java/org/panifex/module/api/tracker/SingleTracker.java
1082
/******************************************************************************* * Panifex platform * Copyright (C) 2013 Mario Krizmanic * * This library is free software; you can redistribute it and/or * modify it under the terms of the GNU Lesser General Public * License as published by the Free Software Foundation; either * version 2.1 of the License, or any later version. * * This library is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Lesser General Public License for more details. * * You should have received a copy of the GNU Lesser General Public * License along with this library; if not, write to the Free Software * Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA ******************************************************************************/ package org.panifex.module.api.tracker; public interface SingleTracker<Service> extends Tracker<Service> { Service service(); }
lgpl-2.1
GhostMonk3408/MidgarCrusade
src/main/java/fr/toss/FF7itemsk/itemk80.java
156
package fr.toss.FF7itemsk; public class itemk80 extends FF7itemskbase { public itemk80(int id) { super(id); setUnlocalizedName("itemk80"); } }
lgpl-2.1
sudheesh001/loklak_server
src/org/loklak/api/search/GenericScraper.java
3953
/** * GenericScraper * Copyright 22.02.2015 by Damini Satya, @daminisatya * * This library is free software; you can redistribute it and/or * modify it under the terms of the GNU Lesser General Public * License as published by the Free Software Foundation; either * version 2.1 of the License, or (at your option) any later version. * * This library is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Lesser General Public License for more details. * * You should have received a copy of the GNU Lesser General Public License * along with this program in the file lgpl21.txt * If not, see <http://www.gnu.org/licenses/>. */ package org.loklak.api.search; import java.io.IOException; import java.io.PrintWriter; import java.net.URLEncoder; import java.util.*; import java.io.*; import javax.servlet.ServletException; import javax.servlet.http.HttpServlet; import javax.servlet.http.HttpServletRequest; import javax.servlet.http.HttpServletResponse; import org.eclipse.jetty.util.log.Log; import org.json.JSONArray; import org.json.JSONObject; import org.loklak.data.DAO; import org.loklak.http.ClientConnection; import org.loklak.http.RemoteAccess; import org.loklak.server.Query; import org.loklak.tools.CharacterCoding; import org.loklak.tools.UTF8; import org.jsoup.Jsoup; import org.jsoup.helper.Validate; import org.jsoup.nodes.Document; import org.jsoup.nodes.Element; import org.jsoup.select.Elements; public class GenericScraper extends HttpServlet { private static final long serialVersionUID = 4653635987712691127L; @Override protected void doPost(HttpServletRequest request, HttpServletResponse response) throws ServletException, IOException { doGet(request, response); } @Override protected void doGet(HttpServletRequest request, HttpServletResponse response) throws ServletException, IOException { Query post = RemoteAccess.evaluate(request); // manage DoS if (post.isDoS_blackout()) {response.sendError(503, "your request frequency is too high"); return;} // evaluate get parameters String url = post.get("url", ""); JSONObject obj = new JSONObject(); //loading the data from the URL Document page = Jsoup.connect(url).get(); String title = page.title(); List<String> linkHref = new ArrayList<String>(); List<String> linkText = new ArrayList<String>(); List<String> src = new ArrayList<String>(); List<String> image = new ArrayList<String>(); Elements links = page.getElementsByTag("a"); Elements links2 = page.getElementsByTag("link"); Elements srciptLinks =page.getElementsByTag("script"); Elements imageLinks =page.getElementsByTag("img"); Elements taglang = page.getElementsByTag("html"); String language = taglang.attr("lang"); for (Element link : links) { if(link.attr("href") != null && link.attr("href").length() != 0){ linkHref.add(link.attr("href")); } if(link.text() != null && link.text().length() != 0){ linkText.add(link.text()); } } for (Element link : links2) { if(link.attr("href") != null && link.attr("href").length() != 0){ linkHref.add(link.attr("href")); } } for (Element link : srciptLinks) { if(link.attr("src") != null && link.attr("src").length() != 0){ src.add(link.attr("src")); } } for (Element link : imageLinks) { if(link.attr("src") != null && link.attr("src").length() != 0){ image.add(link.attr("src")); } } obj.put("title", title); obj.put("language", language); obj.put("Links", new JSONArray(linkHref)); obj.put("Text in Links", new JSONArray(linkText)); obj.put("source files", new JSONArray(src)); obj.put("Image files", new JSONArray(image)); //print JSON response.setCharacterEncoding("UTF-8"); PrintWriter sos = response.getWriter(); sos.print(obj.toString(2)); sos.println(); } }
lgpl-2.1
JiriOndrusek/wildfly-core
server/src/main/java/org/jboss/as/server/deployment/AbstractDeploymentUnitService.java
8587
/* * JBoss, Home of Professional Open Source. * Copyright 2010, Red Hat, Inc., and individual contributors * as indicated by the @author tags. See the copyright.txt file in the * distribution for a full listing of individual contributors. * * This is free software; you can redistribute it and/or modify it * under the terms of the GNU Lesser General Public License as * published by the Free Software Foundation; either version 2.1 of * the License, or (at your option) any later version. * * This software is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Lesser General Public License for more details. * * You should have received a copy of the GNU Lesser General Public * License along with this software; if not, write to the Free * Software Foundation, Inc., 51 Franklin St, Fifth Floor, Boston, MA * 02110-1301 USA, or see the FSF site: http://www.fsf.org. */ package org.jboss.as.server.deployment; import java.util.HashSet; import java.util.Set; import java.util.function.Consumer; import org.jboss.as.controller.capability.CapabilityServiceSupport; import org.jboss.as.controller.registry.ImmutableManagementResourceRegistration; import org.jboss.as.controller.registry.ManagementResourceRegistration; import org.jboss.as.controller.registry.Resource; import org.jboss.as.server.logging.ServerLogger; import org.jboss.as.server.services.security.AbstractVaultReader; import org.jboss.msc.inject.Injector; import org.jboss.msc.service.Service; import org.jboss.msc.service.ServiceController; import org.jboss.msc.service.ServiceName; import org.jboss.msc.service.ServiceRegistry; import org.jboss.msc.service.ServiceTarget; import org.jboss.msc.service.StabilityMonitor; import org.jboss.msc.service.StartContext; import org.jboss.msc.service.StartException; import org.jboss.msc.service.StopContext; import org.jboss.msc.value.InjectedValue; import org.wildfly.common.function.ExceptionConsumer; /** * Abstract service responsible for managing the life-cycle of a {@link DeploymentUnit}. * * @author John Bailey * @author <a href="mailto:ropalka@redhat.com">Richard Opalka</a> */ public abstract class AbstractDeploymentUnitService implements Service<DeploymentUnit> { private static final String FIRST_PHASE_NAME = Phase.values()[0].name(); final ImmutableManagementResourceRegistration registration; final ManagementResourceRegistration mutableRegistration; final Resource resource; final CapabilityServiceSupport capabilityServiceSupport; final AbstractVaultReader vaultReader; private final InjectedValue<DeployerChains> deployerChainsInjector = new InjectedValue<DeployerChains>(); private volatile DeploymentUnitPhaseBuilder phaseBuilder = null; private volatile DeploymentUnit deploymentUnit; private volatile StabilityMonitor monitor; AbstractDeploymentUnitService(final ImmutableManagementResourceRegistration registration, final ManagementResourceRegistration mutableRegistration, final Resource resource, final CapabilityServiceSupport capabilityServiceSupport, final AbstractVaultReader vaultReader) { this.mutableRegistration = mutableRegistration; this.capabilityServiceSupport = capabilityServiceSupport; this.registration = registration; this.vaultReader = vaultReader; this.resource = resource; } @Override public synchronized void start(final StartContext context) throws StartException { ServiceTarget target = context.getChildTarget(); final String deploymentName = context.getController().getName().getSimpleName(); monitor = new StabilityMonitor(); monitor.addController(context.getController()); deploymentUnit = createAndInitializeDeploymentUnit(context.getController().getServiceContainer()); final String managementName = deploymentUnit.getAttachment(Attachments.MANAGEMENT_NAME); if (deploymentUnit.getParent()==null) { ServerLogger.DEPLOYMENT_LOGGER.startingDeployment(managementName, deploymentName); } else { ServerLogger.DEPLOYMENT_LOGGER.startingSubDeployment(deploymentName); } ExceptionConsumer<StartContext, StartException> installer = startContext -> { ServiceName serviceName = this.deploymentUnit.getServiceName().append(FIRST_PHASE_NAME); DeploymentUnitPhaseService<?> phaseService = DeploymentUnitPhaseService.create(this.deploymentUnit, Phase.values()[0]); startContext.getChildTarget().addService(serviceName, phaseService) .addDependency(Services.JBOSS_DEPLOYMENT_CHAINS, DeployerChains.class, phaseService.getDeployerChainsInjector()) .install(); }; // If a builder was previously attached, reattach to the new deployment unit instance and build the initial phase using that builder if (this.phaseBuilder != null) { this.deploymentUnit.putAttachment(Attachments.DEPLOYMENT_UNIT_PHASE_BUILDER, this.phaseBuilder); Set<AttachmentKey<?>> initialAttachmentKeys = this.getDeploymentUnitAttachmentKeys(); Consumer<StopContext> uninstaller = stopContext -> { // Cleanup any deployment unit attachments that were not properly removed during DUP undeploy this.getDeploymentUnitAttachmentKeys().stream() .filter(key -> !initialAttachmentKeys.contains(key)) .forEach(key -> this.deploymentUnit.removeAttachment(key)); }; ServiceName serviceName = this.deploymentUnit.getServiceName().append("installer"); this.phaseBuilder.build(target, serviceName, new FunctionalVoidService(installer, uninstaller)).install(); } else { installer.accept(context); } } /** * Template method required for implementations to create and fully initialize a deployment unit instance. This method * should be used to attach any initial deployment unit attachments required for the deployment type. * * @param registry The service registry * @return An initialized DeploymentUnit instance */ protected abstract DeploymentUnit createAndInitializeDeploymentUnit(final ServiceRegistry registry); @Override public synchronized void stop(final StopContext context) { final String deploymentName = context.getController().getName().getSimpleName(); final String managementName = deploymentUnit.getAttachment(Attachments.MANAGEMENT_NAME); if (deploymentUnit.getParent()==null) { ServerLogger.DEPLOYMENT_LOGGER.stoppedDeployment(managementName, deploymentName, (int) (context.getElapsedTime() / 1000000L)); } else { ServerLogger.DEPLOYMENT_LOGGER.stoppedSubDeployment(deploymentName, (int) (context.getElapsedTime() / 1000000L)); } // Retain any attached builder across restarts this.phaseBuilder = this.deploymentUnit.getAttachment(Attachments.DEPLOYMENT_UNIT_PHASE_BUILDER); //clear up all attachments this.getDeploymentUnitAttachmentKeys().forEach(key -> deploymentUnit.removeAttachment(key)); deploymentUnit = null; monitor.removeController(context.getController()); monitor = null; DeploymentResourceSupport.cleanup(resource); } /** * Returns a new set containing the keys of all current deployment unit attachments. */ private Set<AttachmentKey<?>> getDeploymentUnitAttachmentKeys() { return ((SimpleAttachable) this.deploymentUnit).attachmentKeys(); } public synchronized DeploymentUnit getValue() throws IllegalStateException, IllegalArgumentException { return deploymentUnit; } public DeploymentStatus getStatus() { StabilityMonitor monitor = this.monitor; if (monitor == null) { return DeploymentStatus.STOPPED; } final Set<ServiceController<?>> problems = new HashSet<ServiceController<?>>(); try { monitor.awaitStability(problems, problems); } catch (final InterruptedException e) { // ignore } return problems.isEmpty() ? DeploymentStatus.OK : DeploymentStatus.FAILED; } Injector<DeployerChains> getDeployerChainsInjector() { return deployerChainsInjector; } public enum DeploymentStatus { NEW, OK, FAILED, STOPPED } }
lgpl-2.1
mcarniel/oswing
src/org/openswing/swing/client/FileControl.java
13570
package org.openswing.swing.client; import java.io.*; import java.util.ArrayList; import java.awt.event.*; import java.awt.*; import javax.swing.*; import org.openswing.swing.util.client.ClientSettings; import org.openswing.swing.util.client.ClientUtils; import javax.swing.JFileChooser; import org.openswing.swing.form.client.Form; /** * <p>Title: OpenSwing Framework</p> * <p>Description: Input control used for file upload: it allows to select a file from local file system, * read it and store it as byte[] within the control. * Moreover, it allows to download file starting from byte[] stored within the control. * Optionally, another attribute can be binded to this control, in order to store the file name. * </p> * <p>Copyright: Copyright (C) 2006 Mauro Carniel</p> * * <p> This file is part of OpenSwing Framework. * This library is free software; you can redistribute it and/or * modify it under the terms of the (LGPL) Lesser General Public * License as published by the Free Software Foundation; * * GNU LESSER GENERAL PUBLIC LICENSE * Version 2.1, February 1999 * * This library is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Library General Public License for more details. * * You should have received a copy of the GNU Library General Public * License along with this library; if not, write to the Free * Software Foundation, Inc., 675 Mass Ave, Cambridge, MA 02139, USA. * * The author may be contacted at: * maurocarniel@tin.it</p> * * @author Mauro Carniel * @version 1.0 */ public class FileControl extends BaseInputControl implements InputControl { /** flag used to define if a file import button must be showed; default value: <code>true</code> */ private boolean showUploadButton = true; /** flag used to define if a file export button must be showed; default value: <code>true</code> */ private boolean showDownloadButton = true; /** optional attribute name used to bind this attribute to the file name */ private String fileNameAttributeName = null; /** file filter used to filter image file selection from select button; default value: jpg and gif files only */ private javax.swing.filechooser.FileFilter fileFilter = new javax.swing.filechooser.FileFilter() { /** * Whether the given file is accepted by this filter. */ public boolean accept(File f) { return f.isFile() || f.isDirectory(); } /** * The description of this filter. * @see FileView#getName */ public String getDescription() { return "All file formats (*.*)"; } }; /** text field used to show file name */ private JTextField fileName = new JTextField(); /** button used to upadload file */ private JButton uploadButton = new JButton() { public void paint(Graphics g) { super.paint(g); int width = g.getFontMetrics().stringWidth("..."); if (isEnabled()) g.setColor(UIManager.getColor("Button.foreground")); else g.setColor(UIManager.getColor("Button.disabledForeground")); g.drawString("...", (this.getWidth()-width+1)/2, this.getHeight()/2+4); } }; /** button used to download file */ private JButton downloadButton = new JButton() { public void paint(Graphics g) { super.paint(g); int width = g.getFontMetrics().stringWidth("..."); if (isEnabled()) g.setColor(UIManager.getColor("Button.foreground")); else g.setColor(UIManager.getColor("Button.disabledForeground")); g.drawString("...", (this.getWidth()-width+1)/2, this.getHeight()/2+4); } }; /** bytes related to file */ private byte[] bytes; /** used in focus management */ private String oldFileName = null; public FileControl() { uploadButton.setPreferredSize(new Dimension(21, fileName.getPreferredSize().height)); downloadButton.setPreferredSize(new Dimension(21, fileName.getPreferredSize().height)); this.setLayout(new GridBagLayout()); fileName.setColumns(10); this.add(fileName, new GridBagConstraints(0, 0, 1, 1, 1.0, 1.0, GridBagConstraints.WEST, GridBagConstraints.HORIZONTAL, new Insets(0, 0, 0, 0), 0, 0)); uploadButton.setToolTipText(ClientSettings.getInstance().getResources().getResource("upload file")); downloadButton.setToolTipText(ClientSettings.getInstance().getResources().getResource("download file")); this.add(uploadButton, new GridBagConstraints(1, 0, 1, 1, 0.0, 1.0, GridBagConstraints.WEST, GridBagConstraints.HORIZONTAL, new Insets(0, 0, 0, 0), 0, 0)); this.add(downloadButton, new GridBagConstraints(2, 0, 1, 1, 0.0, 1.0, GridBagConstraints.WEST, GridBagConstraints.HORIZONTAL, new Insets(0, 0, 0, 0), 0, 0)); downloadButton.setEnabled(false); fileName.addFocusListener(new FocusAdapter() { /** * Invoked when a component gains the keyboard focus. */ public void focusGained(FocusEvent e) { oldFileName = fileName.getText(); } /** * Invoked when a component loses the keyboard focus. */ public void focusLost(FocusEvent e) { if (fileName.getText()==null || fileName.getText().trim().equals("")) { bytes = null; oldFileName = null; downloadButton.setEnabled(false); } else if (!fileName.getText().equals(oldFileName)) { readFile(fileName.getText()); } } }); uploadButton.addActionListener(new ActionListener() { public void actionPerformed(ActionEvent e) { JFileChooser f = new JFileChooser(); f.setDialogTitle(ClientSettings.getInstance().getResources().getResource("upload file")); f.setDialogType(f.OPEN_DIALOG); f.setApproveButtonText(ClientSettings.getInstance().getResources().getResource("upload file")); f.setFileSelectionMode(f.FILES_ONLY); if (fileFilter!=null) f.setFileFilter(fileFilter); int res = f.showOpenDialog(ClientUtils.getParentWindow(FileControl.this)); if (res==f.APPROVE_OPTION) { readFile(f.getSelectedFile().getAbsolutePath()); } } }); downloadButton.addActionListener(new ActionListener() { public void actionPerformed(ActionEvent e) { if (bytes==null) return; final JFileChooser f = new JFileChooser(); f.setDialogTitle(ClientSettings.getInstance().getResources().getResource("download file")); f.setDialogType(f.SAVE_DIALOG); f.setApproveButtonText(ClientSettings.getInstance().getResources().getResource("download file")); Form form = ClientUtils.getLinkedForm(FileControl.this); if (form != null && fileNameAttributeName!=null && !fileNameAttributeName.equals("")) { Object name = form.getVOModel().getValue(fileNameAttributeName); if (name!=null) f.setSelectedFile(new File(name.toString())); } int res = f.showSaveDialog(ClientUtils.getParentWindow(FileControl.this)); if (res==f.APPROVE_OPTION) { try { File file = f.getSelectedFile(); BufferedOutputStream out = new BufferedOutputStream(new FileOutputStream(file)); out.write(bytes); out.close(); } catch (Throwable ex) { OptionPane.showMessageDialog(ClientUtils.getParentWindow(FileControl.this),ex.getMessage(),ClientSettings.getInstance().getResources().getResource("Error while saving"),JOptionPane.ERROR_MESSAGE); } } } }); initListeners(); } private void readFile(String file) { try { File f = new File(file); Form form = ClientUtils.getLinkedForm(this); if (form != null && fileNameAttributeName!=null && !fileNameAttributeName.equals("")) { form.getVOModel().setValue(fileNameAttributeName,f.getName()); fileName.setText(f.getName()); } BufferedInputStream in = new BufferedInputStream(new FileInputStream(f)); bytes = new byte[(int)f.length()]; in.read(bytes); in.close(); // form.getVOModel().setValue(attributeName,bytes); downloadButton.setEnabled(true); } catch (Exception ex) { OptionPane.showMessageDialog(ClientUtils.getParentWindow(FileControl.this),"Error",ex.getMessage(),JOptionPane.ERROR_MESSAGE); bytes = null; } } /** * @return define if a file import button must be showed */ public final boolean isShowUploadButton() { return showUploadButton; } /** * Define if a file import button must be showed. * @param showUploadButton define if a file import button must be showed, in order to select and upload a file */ public final void setShowUploadButton(boolean showUploadButton) { if (showUploadButton && !this.showUploadButton) { this.add(uploadButton, new GridBagConstraints(1, 0, 1, 1, 0.0, 1.0, GridBagConstraints.WEST, GridBagConstraints.HORIZONTAL, new Insets(0, 0, 0, 0), 0, 0)); this.revalidate(); } else if (!showUploadButton && this.showUploadButton) { this.remove(uploadButton); this.revalidate(); } this.showUploadButton = showUploadButton; } /** * @return define if a file export button must be showed */ public final boolean isShowDownloadButton() { return showDownloadButton; } /** * Define if a file import button must be showed. * @param showDownloadButton define if a file export button must be showed, in order to download the file stored in the cell */ public final void setShowDownloadButton(boolean showDownloadButton) { if (showDownloadButton && !this.showDownloadButton) { this.add(downloadButton, new GridBagConstraints(1, 0, 1, 1, 0.0, 1.0, GridBagConstraints.WEST, GridBagConstraints.HORIZONTAL, new Insets(0, 0, 0, 0), 0, 0)); this.revalidate(); } else if (!showDownloadButton && this.showDownloadButton) { this.remove(downloadButton); this.revalidate(); } this.showDownloadButton = showDownloadButton; } /** * @return file filter used to filter file selection from import button */ public final javax.swing.filechooser.FileFilter getFileFilter() { return fileFilter; } /** * @return attribute name used to bind this attribute to the file name */ public final String getFileNameAttributeName() { return fileNameAttributeName; } /** * Set the attribute name used to bind this attribute to the file name. * @param fileNameAttributeName attribute name used to bind this attribute to the file name */ public final void setFileNameAttributeName(String fileNameAttributeName) { this.fileNameAttributeName = fileNameAttributeName; } /** * Set the file filter used to filter file selection from import button. * Default value: *.* * @param fileFilter file filter used to filter file selection from import button */ public final void setFileFilter(javax.swing.filechooser.FileFilter fileFilter) { this.fileFilter = fileFilter; } /** * @return file name */ public final String getFileName() { return fileName.getText(); } /** * @return file content */ public final byte[] getFile() { return bytes; } /** * Set file content. */ public final void setFile(byte[] bytes) { this.bytes = bytes; } /** * Replace enabled setting with editable setting (this allow tab swithing). * @param enabled flag used to set abilitation of control */ public final void setEnabled(boolean enabled) { try { if (!enabled) { fileName.setForeground(UIManager.getColor("TextField.foreground")); fileName.setBackground(UIManager.getColor("TextField.inactiveBackground")); } } catch (Exception ex) { } fileName.setEditable(enabled); uploadButton.setEnabled(enabled); fileName.setFocusable(enabled || ClientSettings.DISABLED_INPUT_CONTROLS_FOCUSABLE); } /** * @return current input control abilitation */ public final boolean isEnabled() { try { return fileName.isEditable(); } catch (Exception ex) { return false; } } /** * @return value related to the input control */ public final Object getValue() { return bytes; } /** * Set value to the input control. * @param value value to set into the input control */ public final void setValue(Object value) { bytes = (byte[])value; downloadButton.setEnabled(bytes!=null && bytes.length>0); Form form = ClientUtils.getLinkedForm(this); if (form != null && fileNameAttributeName!=null && !fileNameAttributeName.equals("")) { fileName.setText( (String)form.getVOModel().getValue(fileNameAttributeName) ); } } /** * @return component inside this whose contains the value */ public final JComponent getBindingComponent() { return fileName; } }
lgpl-2.1
1fechner/FeatureExtractor
sources/FeatureExtractor/lib/hibernate-release-5.1.0.Final/project/hibernate-core/src/test/java/org/hibernate/test/annotations/manytoonewithformula/Message.java
1710
/* * Hibernate, Relational Persistence for Idiomatic Java * * License: GNU Lesser General Public License (LGPL), version 2.1 or later. * See the lgpl.txt file in the root directory or <http://www.gnu.org/licenses/lgpl-2.1.html>. */ package org.hibernate.test.annotations.manytoonewithformula; import java.io.Serializable; import javax.persistence.Column; import javax.persistence.Entity; import javax.persistence.GeneratedValue; import javax.persistence.Id; import javax.persistence.ManyToOne; import org.hibernate.annotations.JoinColumnOrFormula; import org.hibernate.annotations.JoinColumnsOrFormulas; import org.hibernate.annotations.JoinFormula; /** * @author Sharath Reddy */ @Entity public class Message implements Serializable { private static final long serialVersionUID = 1L; private int id; private String languageCode; private String languageName; private Language language; @Id @GeneratedValue public int getId() { return id; } public void setId(int id) { this.id = id; } @Column(name="lang_code") public String getLanguageCode() { return languageCode; } public void setLanguageCode(String val) { this.languageCode = val; } @Column(name="lang_name") public String getLanguageName() { return languageName; } public void setLanguageName(String val) { this.languageName = val; } @ManyToOne @JoinColumnsOrFormulas( { @JoinColumnOrFormula(formula=@JoinFormula(value="UPPER(lang_code)")) //@JoinColumnOrFormula(formula=@JoinFormula(value="(select l.code from Language l where l.name = lang_name)")) }) public Language getLanguage() { return language; } public void setLanguage(Language language) { this.language = language; } }
lgpl-2.1
languagetool-org/languagetool
languagetool-office-extension/src/main/java/org/languagetool/openoffice/LtDictionary.java
8136
/* LanguageTool, a natural language style checker * Copyright (C) 2011 Daniel Naber (http://www.danielnaber.de) * * This library is free software; you can redistribute it and/or * modify it under the terms of the GNU Lesser General Public * License as published by the Free Software Foundation; either * version 2.1 of the License, or (at your option) any later version. * * This library is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Lesser General Public License for more details. * * You should have received a copy of the GNU Lesser General Public * License along with this library; if not, write to the Free Software * Foundation, Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 * USA */ package org.languagetool.openoffice; import java.util.ArrayList; import java.util.List; import org.languagetool.JLanguageTool; import com.sun.star.lang.Locale; import com.sun.star.linguistic2.DictionaryType; import com.sun.star.linguistic2.XDictionary; import com.sun.star.linguistic2.XDictionaryEntry; import com.sun.star.linguistic2.XSearchableDictionaryList; import com.sun.star.uno.XComponentContext; /** * Class to add manual LT dictionaries temporarily to LibreOffice/OpenOffice * @since 5.0 * @author Fred Kruse */ public class LtDictionary { private static boolean debugMode; // should be false except for testing private List<String> dictionaryList = new ArrayList<>(); private XDictionary listIgnoredWords = null; public LtDictionary() { debugMode = OfficeTools.DEBUG_MODE_LD; } /** * Add a non permanent dictionary to LO/OO that contains additional words defined in LT */ public boolean setLtDictionary(XComponentContext xContext, Locale locale, LinguisticServices linguServices) { XSearchableDictionaryList searchableDictionaryList = OfficeTools.getSearchableDictionaryList(xContext); if (searchableDictionaryList == null) { MessageHandler.printToLogFile("LtDictionary: setLtDictionary: searchableDictionaryList == null"); return false; } if (listIgnoredWords == null) { XDictionary[] dictionaryList = searchableDictionaryList.getDictionaries(); listIgnoredWords = dictionaryList[dictionaryList.length - 1]; } String shortCode = locale.Language; String dictionaryName = "__LT_" + shortCode + "_internal.dic"; if (!dictionaryList.contains(dictionaryName)) { dictionaryList.add(dictionaryName); XDictionary manualDictionary = searchableDictionaryList.createDictionary(dictionaryName, locale, DictionaryType.POSITIVE, ""); for (String word : getManualWordList(locale, linguServices)) { manualDictionary.add(word, false, ""); } manualDictionary.setActive(true); searchableDictionaryList.addDictionary(manualDictionary); MessageHandler.printToLogFile("Internal LT dicitionary for language " + shortCode + " added: Number of words = " + manualDictionary.getCount()); if (debugMode) { for (XDictionaryEntry entry : manualDictionary.getEntries()) { MessageHandler.printToLogFile(entry.getDictionaryWord()); } } return true; } return false; } /** * get the list of words out of spelling.txt files defined by LT */ private List<String> getManualWordList(Locale locale, LinguisticServices linguServices) { List<String> words = new ArrayList<>(); String shortLangCode = locale.Language; String path; for (int i = 0; i < 4; i++) { if (i == 0) { path = "/" + shortLangCode + "/spelling.txt"; } else if (i == 1) { path = "/" + shortLangCode + "/hunspell/spelling.txt"; } else if (i == 2) { path = "/" + shortLangCode + "/hunspell/spelling-" + shortLangCode + "-" + locale.Country + ".txt"; } else { path = "/" + shortLangCode + "/hunspell/spelling-" + shortLangCode + "_" + locale.Country + ".txt"; } if (JLanguageTool.getDataBroker().resourceExists(path)) { List<String> lines = JLanguageTool.getDataBroker().getFromResourceDirAsLines(path); if (lines != null) { for (String line : lines) { if (!line.isEmpty() && !line.startsWith("#")) { String[] lineWords = line.trim().split("\\h"); lineWords = lineWords[0].trim().split("/"); lineWords[0] = lineWords[0].replaceAll("_",""); if (!lineWords[0].isEmpty() && !words.contains(lineWords[0]) && !linguServices.isCorrectSpell(lineWords[0], locale)) { words.add(lineWords[0]); } } } } } } return words; } /** * Remove the non permanent LT dictionaries */ public boolean removeLtDictionaries(XComponentContext xContext) { if (!dictionaryList.isEmpty()) { XSearchableDictionaryList searchableDictionaryList = OfficeTools.getSearchableDictionaryList(xContext); if (searchableDictionaryList == null) { MessageHandler.printToLogFile("LtDictionary: removeLtDictionaries: searchableDictionaryList == null"); return false; } for (String dictionaryName : dictionaryList) { XDictionary manualDictionary = searchableDictionaryList.getDictionaryByName(dictionaryName); if (manualDictionary != null) { searchableDictionaryList.removeDictionary(manualDictionary); } } dictionaryList.clear(); return true; } return false; } /** * Add a word to the List of ignored words * Used for ignore all in spelling check */ public void addIgnoredWord(String word) { listIgnoredWords.add(word, false, ""); } /** * Remove a word from the List of ignored words * Used for ignore all in spelling check */ public void removeIgnoredWord(String word) { listIgnoredWords.remove(word); } /** * Add a word to a user dictionary */ public void addWordToDictionary(String dictionaryName, String word, XComponentContext xContext) { XSearchableDictionaryList searchableDictionaryList = OfficeTools.getSearchableDictionaryList(xContext); if (searchableDictionaryList == null) { MessageHandler.printToLogFile("LtDictionary: addWordToDictionary: searchableDictionaryList == null"); return; } XDictionary dictionary = searchableDictionaryList.getDictionaryByName(dictionaryName); dictionary.add(word, false, ""); } /** * Add a word to a user dictionary */ public void removeWordFromDictionary(String dictionaryName, String word, XComponentContext xContext) { XSearchableDictionaryList searchableDictionaryList = OfficeTools.getSearchableDictionaryList(xContext); if (searchableDictionaryList == null) { MessageHandler.printToLogFile("LtDictionary: removeWordFromDictionary: searchableDictionaryList == null"); return; } XDictionary dictionary = searchableDictionaryList.getDictionaryByName(dictionaryName); dictionary.remove(word); } /** * Get all user dictionaries */ public String[] getUserDictionaries(XComponentContext xContext) { XSearchableDictionaryList searchableDictionaryList = OfficeTools.getSearchableDictionaryList(xContext); if (searchableDictionaryList == null) { MessageHandler.printToLogFile("LtDictionary: getUserDictionaries: searchableDictionaryList == null"); return null; } XDictionary[] dictionaryList = searchableDictionaryList.getDictionaries(); if (listIgnoredWords == null) { listIgnoredWords = dictionaryList[dictionaryList.length - 1]; } List<String> userDictionaries = new ArrayList<String>(); for (XDictionary dictionary : dictionaryList) { if (dictionary.isActive()) { String name = dictionary.getName(); if (!name.startsWith("__LT_") && !name.equals(listIgnoredWords.getName())) { userDictionaries.add(new String(name)); } } } return userDictionaries.toArray(new String[userDictionaries.size()]); } }
lgpl-2.1
windauer/exist
exist-core/src/test/java/org/exist/xquery/IntersectTest.java
7426
package org.exist.xquery; import org.exist.dom.QName; import org.exist.dom.memtree.MemTreeBuilder; import org.exist.dom.persistent.DocumentImpl; import org.exist.dom.persistent.NodeProxy; import org.exist.numbering.DLN; import org.exist.numbering.NodeId; import org.exist.xquery.value.Item; import org.exist.xquery.value.Sequence; import org.exist.xquery.value.Type; import org.exist.xquery.value.ValueSequence; import org.junit.Test; import org.w3c.dom.Document; import javax.xml.XMLConstants; import static org.easymock.EasyMock.*; import static org.junit.Assert.assertEquals; /** * * @author <a href="mailto:adam.retter@googlemail.com">Adam Retter</a> */ public class IntersectTest { /** * Tests the XQuery `intersect` operator against an * in-memory node on both the left and right sides */ @Test public void memtree_intersect_memtree() throws XPathException, NoSuchMethodException { final XQueryContext mockContext = createMock(XQueryContext.class); final PathExpr mockLeft = createMock(PathExpr.class); final PathExpr mockRight = createMock(PathExpr.class); final Sequence mockContextSequence = createMock(Sequence.class); final Item mockContextItem = createMock(Item.class); final Profiler mockProfiler = createMock(Profiler.class); expect(mockContext.nextExpressionId()).andReturn(1); expect(mockContext.getProfiler()).andReturn(mockProfiler); final org.exist.dom.memtree.ElementImpl memElement = (org.exist.dom.memtree.ElementImpl)createInMemoryDocument().getDocumentElement(); expect(mockLeft.eval(mockContextSequence, mockContextItem)).andReturn(memElement); //memtree node expect(mockRight.eval(mockContextSequence, mockContextItem)).andReturn(memElement); //same memtree node expect(mockContext.getProfiler()).andReturn(mockProfiler); replay(mockRight, mockLeft, mockContext); //test final Intersect intersect = new Intersect(mockContext, mockLeft, mockRight); final Sequence result = intersect.eval(mockContextSequence, mockContextItem); assertEquals(1, ((ValueSequence)result).size()); verify(mockRight, mockLeft, mockContext); } /** * Tests the XQuery `intersect` operator against an * in-memory node on the left and a persistent node on the right */ @Test public void memtree_intersect_persistent() throws XPathException, NoSuchMethodException { final XQueryContext mockContext = createMock(XQueryContext.class); final PathExpr mockLeft = createMock(PathExpr.class); final PathExpr mockRight = createMock(PathExpr.class); final Sequence mockContextSequence = createMock(Sequence.class); final Item mockContextItem = createMock(Item.class); final Profiler mockProfiler = createMock(Profiler.class); final DocumentImpl mockPersistentDoc = createMock(DocumentImpl.class); final NodeProxy mockPersistentNode = createMockBuilder(NodeProxy.class) .withConstructor(DocumentImpl.class, NodeId.class) .withArgs(mockPersistentDoc, new DLN(1)) .addMockedMethods( NodeProxy.class.getMethod("isEmpty", new Class[]{}), NodeProxy.class.getMethod("getItemType", new Class[]{}), NodeProxy.class.getMethod("equals", new Class[]{Object.class}) ).createMock(); expect(mockContext.nextExpressionId()).andReturn(1); expect(mockContext.getProfiler()).andReturn(mockProfiler); expect(mockLeft.eval(mockContextSequence, mockContextItem)).andReturn((org.exist.dom.memtree.ElementImpl)createInMemoryDocument().getDocumentElement()); //memtree node expect(mockRight.eval(mockContextSequence, mockContextItem)).andReturn(mockPersistentNode); //persistent node expect(mockPersistentNode.isEmpty()).andReturn(false); expect(mockPersistentNode.getItemType()).andReturn(Type.NODE); expect(mockContext.getProfiler()).andReturn(mockProfiler); replay(mockPersistentDoc, mockPersistentNode, mockRight, mockLeft, mockContext); //test final Intersect intersect = new Intersect(mockContext, mockLeft, mockRight); final Sequence result = intersect.eval(mockContextSequence, mockContextItem); assertEquals(0, ((ValueSequence)result).size()); verify(mockPersistentDoc, mockPersistentNode, mockRight, mockLeft, mockContext); } /** * Tests the XQuery `intersect` operator against a * persistent node on the left and an in-memory node on the right */ @Test public void persistent_intersect_memtree() throws XPathException, NoSuchMethodException { final XQueryContext mockContext = createMock(XQueryContext.class); final PathExpr mockLeft = createMock(PathExpr.class); final PathExpr mockRight = createMock(PathExpr.class); final Sequence mockContextSequence = createMock(Sequence.class); final Item mockContextItem = createMock(Item.class); final Profiler mockProfiler = createMock(Profiler.class); final DocumentImpl mockPersistentDoc = createMock(DocumentImpl.class); final NodeProxy mockPersistentNode = createMockBuilder(NodeProxy.class) .withConstructor(DocumentImpl.class, NodeId.class) .withArgs(mockPersistentDoc, new DLN(1)) .addMockedMethods( NodeProxy.class.getMethod("isEmpty", new Class[]{}), NodeProxy.class.getMethod("getItemType", new Class[]{}), NodeProxy.class.getMethod("equals", new Class[]{Object.class}) ).createMock(); expect(mockContext.nextExpressionId()).andReturn(1); expect(mockContext.getProfiler()).andReturn(mockProfiler); expect(mockLeft.eval(mockContextSequence, mockContextItem)).andReturn(mockPersistentNode); //persistent node expect(mockRight.eval(mockContextSequence, mockContextItem)).andReturn((org.exist.dom.memtree.ElementImpl)createInMemoryDocument().getDocumentElement()); //memtree node expect(mockPersistentNode.isEmpty()).andReturn(false); expect(mockPersistentNode.getItemType()).andReturn(Type.NODE); expect(mockPersistentDoc.getDocId()).andReturn(1).times(2); expect(mockContext.getProfiler()).andReturn(mockProfiler); replay(mockPersistentDoc, mockPersistentNode, mockRight, mockLeft, mockContext); //test final Intersect intersect = new Intersect(mockContext, mockLeft, mockRight); final Sequence result = intersect.eval(mockContextSequence, mockContextItem); assertEquals(0, ((ValueSequence)result).size()); verify(mockPersistentDoc, mockPersistentNode, mockRight, mockLeft, mockContext); } private Document createInMemoryDocument() { final MemTreeBuilder memtree = new MemTreeBuilder(); memtree.startDocument(); memtree.startElement(new QName("m1", XMLConstants.NULL_NS_URI), null); memtree.startElement(new QName("m2", XMLConstants.NULL_NS_URI), null); memtree.characters("test data"); memtree.endElement(); memtree.endElement(); memtree.endDocument(); return memtree.getDocument(); } }
lgpl-2.1
mbatchelor/pentaho-reporting
libraries/libformula/src/main/java/org/pentaho/reporting/libraries/formula/function/text/UpperFunction.java
2517
/* * This program is free software; you can redistribute it and/or modify it under the * terms of the GNU Lesser General Public License, version 2.1 as published by the Free Software * Foundation. * * You should have received a copy of the GNU Lesser General Public License along with this * program; if not, you can obtain a copy at http://www.gnu.org/licenses/old-licenses/lgpl-2.1.html * or from the Free Software Foundation, Inc., * 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA. * * This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; * without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. * See the GNU Lesser General Public License for more details. * * Copyright (c) 2006 - 2017 Hitachi Vantara and Contributors. All rights reserved. */ package org.pentaho.reporting.libraries.formula.function.text; import org.pentaho.reporting.libraries.formula.EvaluationException; import org.pentaho.reporting.libraries.formula.FormulaContext; import org.pentaho.reporting.libraries.formula.LibFormulaErrorValue; import org.pentaho.reporting.libraries.formula.function.Function; import org.pentaho.reporting.libraries.formula.function.ParameterCallback; import org.pentaho.reporting.libraries.formula.lvalues.TypeValuePair; import org.pentaho.reporting.libraries.formula.typing.Type; import org.pentaho.reporting.libraries.formula.typing.coretypes.TextType; /** * This function returns the given text in upper case. * * @author Cedric Pronzato */ public class UpperFunction implements Function { private static final long serialVersionUID = 2415465663289752026L; public UpperFunction() { } public TypeValuePair evaluate( final FormulaContext context, final ParameterCallback parameters ) throws EvaluationException { final int parameterCount = parameters.getParameterCount(); if ( parameterCount != 1 ) { throw EvaluationException.getInstance( LibFormulaErrorValue.ERROR_ARGUMENTS_VALUE ); } final Type type1 = parameters.getType( 0 ); final Object value1 = parameters.getValue( 0 ); final String result = context.getTypeRegistry().convertToText( type1, value1 ); if ( result == null ) { throw EvaluationException.getInstance( LibFormulaErrorValue.ERROR_INVALID_ARGUMENT_VALUE ); } return new TypeValuePair( TextType.TYPE, result.toUpperCase( context.getLocalizationContext().getLocale() ) ); } public String getCanonicalName() { return "UPPER"; } }
lgpl-2.1
cytoscape/cytoscape-impl
webservice-impl/src/main/java/org/cytoscape/webservice/internal/ui/WebServiceContextMenu.java
965
package org.cytoscape.webservice.internal.ui; /* * #%L * Cytoscape Webservice Impl (webservice-impl) * $Id:$ * $HeadURL:$ * %% * Copyright (C) 2006 - 2021 The Cytoscape Consortium * %% * This program is free software: you can redistribute it and/or modify * it under the terms of the GNU Lesser General Public License as * published by the Free Software Foundation, either version 2.1 of the * License, or (at your option) any later version. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU General Lesser Public License for more details. * * You should have received a copy of the GNU General Lesser Public * License along with this program. If not, see * <http://www.gnu.org/licenses/lgpl-2.1.html>. * #L% */ public interface WebServiceContextMenu { String getCategory(); }
lgpl-2.1
geotools/geotools
modules/library/coverage/src/test/java/org/geotools/image/DisposeStopperTest.java
3003
/* * GeoTools - The Open Source Java GIS Toolkit * http://geotools.org * * (C) 2014, Open Source Geospatial Foundation (OSGeo) * * This library is free software; you can redistribute it and/or * modify it under the terms of the GNU Lesser General Public * License as published by the Free Software Foundation; * version 2.1 of the License. * * This library is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Lesser General Public License for more details. */ package org.geotools.image; import static org.junit.Assert.assertEquals; import static org.junit.Assert.assertFalse; import static org.junit.Assert.assertNotNull; import com.sun.media.jai.operator.ImageReadDescriptor; import it.geosolutions.imageioimpl.plugins.tiff.TIFFImageReader; import it.geosolutions.imageioimpl.plugins.tiff.TIFFImageReaderSpi; import java.awt.image.RenderedImage; import java.io.File; import java.io.FileNotFoundException; import java.io.IOException; import javax.imageio.ImageIO; import javax.imageio.stream.ImageInputStream; import org.geotools.TestData; import org.geotools.coverage.processing.MosaicTest; import org.geotools.image.util.ImageUtilities; import org.junit.Test; public class DisposeStopperTest { @Test public void testDispose() throws FileNotFoundException, IOException { final File tiff = TestData.file(MosaicTest.class, "sample0.tif"); boolean readSuccess = true; final TIFFImageReader reader = (it.geosolutions.imageioimpl.plugins.tiff.TIFFImageReader) new TIFFImageReaderSpi().createReaderInstance(); try (ImageInputStream stream = ImageIO.createImageInputStream(tiff)) { reader.setInput(stream); RenderedImage image = ImageReadDescriptor.create( stream, 0, false, false, false, null, null, null, reader, null); DisposeStopper stopper = new DisposeStopper(image); // Try to dispose. It shouldn't since we are using the wrapper. ImageUtilities.disposeImage(stopper); assertNotNull(image); // I still can get data since using the stopper the image isn't disposed assertEquals(187, image.getData().getSample(1, 5, 0)); ImageUtilities.disposeImage(image); image.getData().getSample(1, 5, 0); } catch (RuntimeException ioe) { // The dispose on the image (without using the disposeStopper wrapper) // should have successfully disposed so the read can't success readSuccess = false; } finally { if (reader != null) { try { reader.dispose(); } catch (Throwable t) { } } } assertFalse(readSuccess); } }
lgpl-2.1
DorgenJones/spatialindex-master
src/spatialindex/rtree/RTree.java
27751
// Spatial Index Library // // Copyright (C) 2002 Navel Ltd. // // This library is free software; you can redistribute it and/or // modify it under the terms of the GNU Lesser General Public // License as published by the Free Software Foundation; either // version 2.1 of the License, or (at your option) any later version. // // This library is distributed in the hope that it will be useful, // but WITHOUT ANY WARRANTY; without even the implied warranty of // MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU // Lesser General Public License for more details. // // You should have received a copy of the GNU Lesser General Public // License aint with this library; if not, write to the Free Software // Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA // // Contact information: // Mailing address: // Marios Hadjieleftheriou // University of California, Riverside // Department of Computer Science // Surge Building, Room 310 // Riverside, CA 92521 // // Email: // marioh@cs.ucr.edu package spatialindex.rtree; import java.io.ByteArrayInputStream; import java.io.ByteArrayOutputStream; import java.io.DataInputStream; import java.io.DataOutputStream; import java.io.IOException; import java.util.ArrayList; import java.util.Collections; import java.util.Comparator; import java.util.HashMap; import java.util.Stack; import spatialindex.spatialindex.IData; import spatialindex.spatialindex.IEntry; import spatialindex.spatialindex.INearestNeighborComparator; import spatialindex.spatialindex.INode; import spatialindex.spatialindex.INodeCommand; import spatialindex.spatialindex.IQueryStrategy; import spatialindex.spatialindex.IShape; import spatialindex.spatialindex.ISpatialIndex; import spatialindex.spatialindex.IStatistics; import spatialindex.spatialindex.IVisitor; import spatialindex.spatialindex.Point; import spatialindex.spatialindex.RWLock; import spatialindex.spatialindex.Region; import spatialindex.spatialindex.SpatialIndex; import spatialindex.storagemanager.IStorageManager; import spatialindex.storagemanager.InvalidPageException; import spatialindex.storagemanager.PropertySet; public class RTree implements ISpatialIndex { RWLock m_rwLock; IStorageManager m_pStorageManager; int m_rootID; int m_headerID; int m_treeVariant; double m_fillFactor; int m_indexCapacity; int m_leafCapacity; int m_nearMinimumOverlapFactor; // The R*-Tree 'p' constant, for calculating nearly minimum overlap cost. // [Beckmann, Kriegel, Schneider, Seeger 'The R*-tree: An efficient and Robust Access Method // for Points and Rectangles, Section 4.1] double m_splitDistributionFactor; // The R*-Tree 'm' constant, for calculating spliting distributions. // [Beckmann, Kriegel, Schneider, Seeger 'The R*-tree: An efficient and Robust Access Method // for Points and Rectangles, Section 4.2] double m_reinsertFactor; // The R*-Tree 'p' constant, for removing entries at reinserts. // [Beckmann, Kriegel, Schneider, Seeger 'The R*-tree: An efficient and Robust Access Method // for Points and Rectangles, Section 4.3] int m_dimension; Region m_infiniteRegion; Statistics m_stats; ArrayList m_writeNodeCommands = new ArrayList(); ArrayList m_readNodeCommands = new ArrayList(); ArrayList m_deleteNodeCommands = new ArrayList(); public RTree(PropertySet ps, IStorageManager sm) { m_rwLock = new RWLock(); m_pStorageManager = sm; m_rootID = IStorageManager.NewPage; m_headerID = IStorageManager.NewPage; m_treeVariant = SpatialIndex.RtreeVariantRstar; m_fillFactor = 0.7f; m_indexCapacity = 100; m_leafCapacity = 100; m_nearMinimumOverlapFactor = 32; m_splitDistributionFactor = 0.4f; m_reinsertFactor = 0.3f; m_dimension = 2; m_infiniteRegion = new Region(); m_stats = new Statistics(); Object var = ps.getProperty("IndexIdentifier"); if (var != null) { if (! (var instanceof Integer)) throw new IllegalArgumentException("Property IndexIdentifier must an Integer"); m_headerID = ((Integer) var).intValue(); try { initOld(ps); } catch (IOException e) { System.err.println(e); throw new IllegalStateException("initOld failed with IOException"); } } else { try { initNew(ps); } catch (IOException e) { System.err.println(e); throw new IllegalStateException("initNew failed with IOException"); } Integer i = new Integer(m_headerID); ps.setProperty("IndexIdentifier", i); } } // // ISpatialIndex interface // public void insertData(final byte[] data, final IShape shape, int id) { if (shape.getDimension() != m_dimension) throw new IllegalArgumentException("insertData: Shape has the wrong number of dimensions."); m_rwLock.write_lock(); try { Region mbr = shape.getMBR(); byte[] buffer = null; if (data != null && data.length > 0) { buffer = new byte[data.length]; System.arraycopy(data, 0, buffer, 0, data.length); } insertData_impl(buffer, mbr, id); // the buffer is stored in the tree. Do not delete here. } finally { m_rwLock.write_unlock(); } } public boolean deleteData(final IShape shape, int id) { if (shape.getDimension() != m_dimension) throw new IllegalArgumentException("deleteData: Shape has the wrong number of dimensions."); m_rwLock.write_lock(); try { Region mbr = shape.getMBR(); return deleteData_impl(mbr, id); } finally { m_rwLock.write_unlock(); } } public void containmentQuery(final IShape query, final IVisitor v) { if (query.getDimension() != m_dimension) throw new IllegalArgumentException("containmentQuery: Shape has the wrong number of dimensions."); rangeQuery(SpatialIndex.ContainmentQuery, query, v); } public void intersectionQuery(final IShape query, final IVisitor v) { if (query.getDimension() != m_dimension) throw new IllegalArgumentException("intersectionQuery: Shape has the wrong number of dimensions."); rangeQuery(SpatialIndex.IntersectionQuery, query, v); } public void pointLocationQuery(final IShape query, final IVisitor v) { if (query.getDimension() != m_dimension) throw new IllegalArgumentException("pointLocationQuery: Shape has the wrong number of dimensions."); Region r = null; if (query instanceof Point) { r = new Region((Point) query, (Point) query); } else if (query instanceof Region) { r = (Region) query; } else { throw new IllegalArgumentException("pointLocationQuery: IShape can be Point or Region only."); } rangeQuery(SpatialIndex.IntersectionQuery, r, v); } public void nearestNeighborQuery(int k, final IShape query, final IVisitor v, final INearestNeighborComparator nnc) { if (query.getDimension() != m_dimension) throw new IllegalArgumentException("nearestNeighborQuery: Shape has the wrong number of dimensions."); m_rwLock.read_lock(); try { // I need a priority queue here. It turns out that TreeSet sorts unique keys only and since I am // sorting according to distances, it is not assured that all distances will be unique. TreeMap // also sorts unique keys. Thus, I am simulating a priority queue using an ArrayList and binarySearch. ArrayList queue = new ArrayList(); Node n = readNode(m_rootID); queue.add(new NNEntry(n, 0.0)); int count = 0; double knearest = 0.0; while (queue.size() != 0) { NNEntry first = (NNEntry) queue.remove(0); if (first.m_pEntry instanceof Node) { n = (Node) first.m_pEntry; v.visitNode((INode) n); for (int cChild = 0; cChild < n.m_children; cChild++) { IEntry e; if (n.m_level == 0) { e = new Data(n.m_pData[cChild], n.m_pMBR[cChild], n.m_pIdentifier[cChild]); } else { e = (IEntry) readNode(n.m_pIdentifier[cChild]); } NNEntry e2 = new NNEntry(e, nnc.getMinimumDistance(query, e)); // Why don't I use a TreeSet here? See comment above... int loc = Collections.binarySearch(queue, e2, new NNEntryComparator()); if (loc >= 0) queue.add(loc, e2); else queue.add((-loc - 1), e2); } } else { // report all nearest neighbors with equal furthest distances. // (neighbors can be more than k, if many happen to have the same // furthest distance). if (count >= k && first.m_minDist > knearest) break; v.visitData((IData) first.m_pEntry); m_stats.m_queryResults++; count++; knearest = first.m_minDist; } } } finally { m_rwLock.read_unlock(); } } public void nearestNeighborQuery(int k, final IShape query, final IVisitor v) { if (query.getDimension() != m_dimension) throw new IllegalArgumentException("nearestNeighborQuery: Shape has the wrong number of dimensions."); NNComparator nnc = new NNComparator(); nearestNeighborQuery(k, query, v, nnc); } public void queryStrategy(final IQueryStrategy qs) { m_rwLock.read_lock(); int[] next = new int[] {m_rootID}; try { while (true) { Node n = readNode(next[0]); boolean[] hasNext = new boolean[] {false}; qs.getNextEntry(n, next, hasNext); if (hasNext[0] == false) break; } } finally { m_rwLock.read_unlock(); } } public PropertySet getIndexProperties() { PropertySet pRet = new PropertySet(); // dimension pRet.setProperty("Dimension", new Integer(m_dimension)); // index capacity pRet.setProperty("IndexCapacity", new Integer(m_indexCapacity)); // leaf capacity pRet.setProperty("LeafCapacity", new Integer(m_leafCapacity)); // R-tree variant pRet.setProperty("TreeVariant", new Integer(m_treeVariant)); // fill factor pRet.setProperty("FillFactor", new Double(m_fillFactor)); // near minimum overlap factor pRet.setProperty("NearMinimumOverlapFactor", new Integer(m_nearMinimumOverlapFactor)); // split distribution factor pRet.setProperty("SplitDistributionFactor", new Double(m_splitDistributionFactor)); // reinsert factor pRet.setProperty("ReinsertFactor", new Double(m_reinsertFactor)); return pRet; } public void addWriteNodeCommand(INodeCommand nc) { m_writeNodeCommands.add(nc); } public void addReadNodeCommand(INodeCommand nc) { m_readNodeCommands.add(nc); } public void addDeleteNodeCommand(INodeCommand nc) { m_deleteNodeCommands.add(nc); } public boolean isIndexValid() { boolean ret = true; Stack st = new Stack(); Node root = readNode(m_rootID); if (root.m_level != m_stats.m_treeHeight - 1) { System.err.println("Invalid tree height"); return false; } HashMap nodesInLevel = new HashMap(); nodesInLevel.put(new Integer(root.m_level), new Integer(1)); ValidateEntry e = new ValidateEntry(root.m_nodeMBR, root); st.push(e); while (! st.empty()) { e = (ValidateEntry) st.pop(); Region tmpRegion = (Region) m_infiniteRegion.clone(); for (int cDim = 0; cDim < m_dimension; cDim++) { tmpRegion.m_pLow[cDim] = Double.POSITIVE_INFINITY; tmpRegion.m_pHigh[cDim] = Double.NEGATIVE_INFINITY; for (int cChild = 0; cChild < e.m_pNode.m_children; cChild++) { tmpRegion.m_pLow[cDim] = Math.min(tmpRegion.m_pLow[cDim], e.m_pNode.m_pMBR[cChild].m_pLow[cDim]); tmpRegion.m_pHigh[cDim] = Math.max(tmpRegion.m_pHigh[cDim], e.m_pNode.m_pMBR[cChild].m_pHigh[cDim]); } } if (! (tmpRegion.equals(e.m_pNode.m_nodeMBR))) { System.err.println("Invalid parent information"); ret = false; } else if (! (tmpRegion.equals(e.m_parentMBR))) { System.err.println("Error in parent"); ret = false; } if (e.m_pNode.m_level != 0) { for (int cChild = 0; cChild < e.m_pNode.m_children; cChild++) { ValidateEntry tmpEntry = new ValidateEntry(e.m_pNode.m_pMBR[cChild], readNode(e.m_pNode.m_pIdentifier[cChild])); if (! nodesInLevel.containsKey(new Integer(tmpEntry.m_pNode.m_level))) { nodesInLevel.put(new Integer(tmpEntry.m_pNode.m_level), new Integer(1)); } else { int i = ((Integer) nodesInLevel.get(new Integer(tmpEntry.m_pNode.m_level))).intValue(); nodesInLevel.put(new Integer(tmpEntry.m_pNode.m_level), new Integer(i + 1)); } st.push(tmpEntry); } } } int nodes = 0; for (int cLevel = 0; cLevel < m_stats.m_treeHeight; cLevel++) { int i1 = ((Integer) nodesInLevel.get(new Integer(cLevel))).intValue(); int i2 = ((Integer) m_stats.m_nodesInLevel.get(cLevel)).intValue(); if (i1 != i2) { System.err.println("Invalid nodesInLevel information"); ret = false; } nodes += i2; } if (nodes != m_stats.m_nodes) { System.err.println("Invalid number of nodes information"); ret = false; } return ret; } public IStatistics getStatistics() { return (IStatistics) m_stats.clone(); } public void flush() throws IllegalStateException { try { storeHeader(); m_pStorageManager.flush(); } catch (IOException e) { System.err.println(e); throw new IllegalStateException("flush failed with IOException"); } } // // Internals // private void initNew(PropertySet ps) throws IOException { Object var; // tree variant. var = ps.getProperty("TreeVariant"); if (var != null) { if (var instanceof Integer) { int i = ((Integer) var).intValue(); if (i != SpatialIndex.RtreeVariantLinear && i != SpatialIndex.RtreeVariantQuadratic && i != SpatialIndex.RtreeVariantRstar) throw new IllegalArgumentException("Property TreeVariant not a valid variant"); m_treeVariant = i; } else { throw new IllegalArgumentException("Property TreeVariant must be an Integer"); } } // fill factor. var = ps.getProperty("FillFactor"); if (var != null) { if (var instanceof Double) { double f = ((Double) var).doubleValue(); if (f <= 0.0f || f >= 1.0f) throw new IllegalArgumentException("Property FillFactor must be in (0.0, 1.0)"); m_fillFactor = f; } else { throw new IllegalArgumentException("Property FillFactor must be a Double"); } } // index capacity. var = ps.getProperty("IndexCapacity"); if (var != null) { if (var instanceof Integer) { int i = ((Integer) var).intValue(); if (i < 3) throw new IllegalArgumentException("Property IndexCapacity must be >= 3"); m_indexCapacity = i; } else { throw new IllegalArgumentException("Property IndexCapacity must be an Integer"); } } // leaf capacity. var = ps.getProperty("LeafCapacity"); if (var != null) { if (var instanceof Integer) { int i = ((Integer) var).intValue(); if (i < 3) throw new IllegalArgumentException("Property LeafCapacity must be >= 3"); m_leafCapacity = i; } else { throw new IllegalArgumentException("Property LeafCapacity must be an Integer"); } } // near minimum overlap factor. var = ps.getProperty("NearMinimumOverlapFactor"); if (var != null) { if (var instanceof Integer) { int i = ((Integer) var).intValue(); if (i < 1 || i > m_indexCapacity || i > m_leafCapacity) throw new IllegalArgumentException("Property NearMinimumOverlapFactor must be less than both index and leaf capacities"); m_nearMinimumOverlapFactor = i; } else { throw new IllegalArgumentException("Property NearMinimumOverlapFactor must be an Integer"); } } // split distribution factor. var = ps.getProperty("SplitDistributionFactor"); if (var != null) { if (var instanceof Double) { double f = ((Double) var).doubleValue(); if (f <= 0.0f || f >= 1.0f) throw new IllegalArgumentException("Property SplitDistributionFactor must be in (0.0, 1.0)"); m_splitDistributionFactor = f; } else { throw new IllegalArgumentException("Property SplitDistriburionFactor must be a Double"); } } // reinsert factor. var = ps.getProperty("ReinsertFactor"); if (var != null) { if (var instanceof Double) { double f = ((Double) var).doubleValue(); if (f <= 0.0f || f >= 1.0f) throw new IllegalArgumentException("Property ReinsertFactor must be in (0.0, 1.0)"); m_reinsertFactor = f; } else { throw new IllegalArgumentException("Property ReinsertFactor must be a Double"); } } // dimension var = ps.getProperty("Dimension"); if (var != null) { if (var instanceof Integer) { int i = ((Integer) var).intValue(); if (i <= 1) throw new IllegalArgumentException("Property Dimension must be >= 1"); m_dimension = i; } else { throw new IllegalArgumentException("Property Dimension must be an Integer"); } } m_infiniteRegion.m_pLow = new double[m_dimension]; m_infiniteRegion.m_pHigh = new double[m_dimension]; for (int cDim = 0; cDim < m_dimension; cDim++) { m_infiniteRegion.m_pLow[cDim] = Double.POSITIVE_INFINITY; m_infiniteRegion.m_pHigh[cDim] = Double.NEGATIVE_INFINITY; } m_stats.m_treeHeight = 1; m_stats.m_nodesInLevel.add(new Integer(0)); Leaf root = new Leaf(this, -1); m_rootID = writeNode(root); storeHeader(); } private void initOld(PropertySet ps) throws IOException { loadHeader(); // only some of the properties may be changed. // the rest are just ignored. Object var; // tree variant. var = ps.getProperty("TreeVariant"); if (var != null) { if (var instanceof Integer) { int i = ((Integer) var).intValue(); if (i != SpatialIndex.RtreeVariantLinear && i != SpatialIndex.RtreeVariantQuadratic && i != SpatialIndex.RtreeVariantRstar) throw new IllegalArgumentException("Property TreeVariant not a valid variant"); m_treeVariant = i; } else { throw new IllegalArgumentException("Property TreeVariant must be an Integer"); } } // near minimum overlap factor. var = ps.getProperty("NearMinimumOverlapFactor"); if (var != null) { if (var instanceof Integer) { int i = ((Integer) var).intValue(); if (i < 1 || i > m_indexCapacity || i > m_leafCapacity) throw new IllegalArgumentException("Property NearMinimumOverlapFactor must be less than both index and leaf capacities"); m_nearMinimumOverlapFactor = i; } else { throw new IllegalArgumentException("Property NearMinimumOverlapFactor must be an Integer"); } } // split distribution factor. var = ps.getProperty("SplitDistributionFactor"); if (var != null) { if (var instanceof Double) { double f = ((Double) var).doubleValue(); if (f <= 0.0f || f >= 1.0f) throw new IllegalArgumentException("Property SplitDistributionFactor must be in (0.0, 1.0)"); m_splitDistributionFactor = f; } else { throw new IllegalArgumentException("Property SplitDistriburionFactor must be a Double"); } } // reinsert factor. var = ps.getProperty("ReinsertFactor"); if (var != null) { if (var instanceof Double) { double f = ((Double) var).doubleValue(); if (f <= 0.0f || f >= 1.0f) throw new IllegalArgumentException("Property ReinsertFactor must be in (0.0, 1.0)"); m_reinsertFactor = f; } else { throw new IllegalArgumentException("Property ReinsertFactor must be a Double"); } } m_infiniteRegion.m_pLow = new double[m_dimension]; m_infiniteRegion.m_pHigh = new double[m_dimension]; for (int cDim = 0; cDim < m_dimension; cDim++) { m_infiniteRegion.m_pLow[cDim] = Double.POSITIVE_INFINITY; m_infiniteRegion.m_pHigh[cDim] = Double.NEGATIVE_INFINITY; } } private void storeHeader() throws IOException { ByteArrayOutputStream bs = new ByteArrayOutputStream(); DataOutputStream ds = new DataOutputStream(bs); ds.writeInt(m_rootID); ds.writeInt(m_treeVariant); ds.writeDouble(m_fillFactor); ds.writeInt(m_indexCapacity); ds.writeInt(m_leafCapacity); ds.writeInt(m_nearMinimumOverlapFactor); ds.writeDouble(m_splitDistributionFactor); ds.writeDouble(m_reinsertFactor); ds.writeInt(m_dimension); ds.writeLong(m_stats.m_nodes); ds.writeLong(m_stats.m_data); ds.writeInt(m_stats.m_treeHeight); for (int cLevel = 0; cLevel < m_stats.m_treeHeight; cLevel++) { ds.writeInt(((Integer) m_stats.m_nodesInLevel.get(cLevel)).intValue()); } ds.flush(); m_headerID = m_pStorageManager.storeByteArray(m_headerID, bs.toByteArray()); } private void loadHeader() throws IOException { byte[] data = m_pStorageManager.loadByteArray(m_headerID); DataInputStream ds = new DataInputStream(new ByteArrayInputStream(data)); m_rootID = ds.readInt(); m_treeVariant = ds.readInt(); m_fillFactor = ds.readDouble(); m_indexCapacity = ds.readInt(); m_leafCapacity = ds.readInt(); m_nearMinimumOverlapFactor = ds.readInt(); m_splitDistributionFactor = ds.readDouble(); m_reinsertFactor = ds.readDouble(); m_dimension = ds.readInt(); m_stats.m_nodes = ds.readLong(); m_stats.m_data = ds.readLong(); m_stats.m_treeHeight = ds.readInt(); for (int cLevel = 0; cLevel < m_stats.m_treeHeight; cLevel++) { m_stats.m_nodesInLevel.add(new Integer(ds.readInt())); } } protected void insertData_impl(byte[] pData, Region mbr, int id) { assert mbr.getDimension() == m_dimension; boolean[] overflowTable; Stack pathBuffer = new Stack(); Node root = readNode(m_rootID); overflowTable = new boolean[root.m_level]; for (int cLevel = 0; cLevel < root.m_level; cLevel++) overflowTable[cLevel] = false; Node l = root.chooseSubtree(mbr, 0, pathBuffer); l.insertData(pData, mbr, id, pathBuffer, overflowTable); m_stats.m_data++; } protected void insertData_impl(byte[] pData, Region mbr, int id, int level, boolean[] overflowTable) { assert mbr.getDimension() == m_dimension; Stack pathBuffer = new Stack(); Node root = readNode(m_rootID); Node n = root.chooseSubtree(mbr, level, pathBuffer); n.insertData(pData, mbr, id, pathBuffer, overflowTable); } protected boolean deleteData_impl(final Region mbr, int id) { assert mbr.getDimension() == m_dimension; boolean bRet = false; Stack pathBuffer = new Stack(); Node root = readNode(m_rootID); Leaf l = root.findLeaf(mbr, id, pathBuffer); if (l != null) { l.deleteData(id, pathBuffer); m_stats.m_data--; bRet = true; } return bRet; } protected int writeNode(Node n) throws IllegalStateException { byte[] buffer = null; try { buffer = n.store(); } catch (IOException e) { System.err.println(e); throw new IllegalStateException("writeNode failed with IOException"); } int page; if (n.m_identifier < 0) page = IStorageManager.NewPage; else page = n.m_identifier; try { page = m_pStorageManager.storeByteArray(page, buffer); } catch (InvalidPageException e) { System.err.println(e); throw new IllegalStateException("writeNode failed with InvalidPageException"); } if (n.m_identifier < 0) { n.m_identifier = page; m_stats.m_nodes++; int i = ((Integer) m_stats.m_nodesInLevel.get(n.m_level)).intValue(); m_stats.m_nodesInLevel.set(n.m_level, new Integer(i + 1)); } m_stats.m_writes++; for (int cIndex = 0; cIndex < m_writeNodeCommands.size(); cIndex++) { ((INodeCommand) m_writeNodeCommands.get(cIndex)).execute(n); } return page; } protected Node readNode(int id) { byte[] buffer; DataInputStream ds = null; int nodeType = -1; Node n = null; try { buffer = m_pStorageManager.loadByteArray(id); ds = new DataInputStream(new ByteArrayInputStream(buffer)); nodeType = ds.readInt(); if (nodeType == SpatialIndex.PersistentIndex) n = new Index(this, -1, 0); else if (nodeType == SpatialIndex.PersistentLeaf) n = new Leaf(this, -1); else throw new IllegalStateException("readNode failed reading the correct node type information"); n.m_pTree = this; n.m_identifier = id; n.load(buffer); m_stats.m_reads++; } catch (InvalidPageException e) { System.err.println(e); throw new IllegalStateException("readNode failed with InvalidPageException"); } catch (IOException e) { System.err.println(e); throw new IllegalStateException("readNode failed with IOException"); } for (int cIndex = 0; cIndex < m_readNodeCommands.size(); cIndex++) { ((INodeCommand) m_readNodeCommands.get(cIndex)).execute(n); } return n; } protected void deleteNode(Node n) { try { m_pStorageManager.deleteByteArray(n.m_identifier); } catch (InvalidPageException e) { System.err.println(e); throw new IllegalStateException("deleteNode failed with InvalidPageException"); } m_stats.m_nodes--; int i = ((Integer) m_stats.m_nodesInLevel.get(n.m_level)).intValue(); m_stats.m_nodesInLevel.set(n.m_level, new Integer(i - 1)); for (int cIndex = 0; cIndex < m_deleteNodeCommands.size(); cIndex++) { ((INodeCommand) m_deleteNodeCommands.get(cIndex)).execute(n); } } private void rangeQuery(int type, final IShape query, final IVisitor v) { m_rwLock.read_lock(); try { Stack st = new Stack(); Node root = readNode(m_rootID); if (root.m_children > 0 && query.intersects(root.m_nodeMBR)) st.push(root); while (! st.empty()) { Node n = (Node) st.pop(); if (n.m_level == 0) { v.visitNode((INode) n); for (int cChild = 0; cChild < n.m_children; cChild++) { boolean b; if (type == SpatialIndex.ContainmentQuery) b = query.contains(n.m_pMBR[cChild]); else b = query.intersects(n.m_pMBR[cChild]); if (b) { Data data = new Data(n.m_pData[cChild], n.m_pMBR[cChild], n.m_pIdentifier[cChild]); v.visitData(data); m_stats.m_queryResults++; } } } else { v.visitNode((INode) n); for (int cChild = 0; cChild < n.m_children; cChild++) { if (query.intersects(n.m_pMBR[cChild])) { st.push(readNode(n.m_pIdentifier[cChild])); } } } } } finally { m_rwLock.read_unlock(); } } public String toString() { String s = "Dimension: " + m_dimension + "\n" + "Fill factor: " + m_fillFactor + "\n" + "Index capacity: " + m_indexCapacity + "\n" + "Leaf capacity: " + m_leafCapacity + "\n"; if (m_treeVariant == SpatialIndex.RtreeVariantRstar) { s += "Near minimum overlap factor: " + m_nearMinimumOverlapFactor + "\n" + "Reinsert factor: " + m_reinsertFactor + "\n" + "Split distribution factor: " + m_splitDistributionFactor + "\n"; } s += "Utilization: " + 100 * m_stats.getNumberOfData() / (m_stats.getNumberOfNodesInLevel(0) * m_leafCapacity) + "%" + "\n" + m_stats; return s; } class NNEntry { IEntry m_pEntry; double m_minDist; NNEntry(IEntry e, double f) { m_pEntry = e; m_minDist = f; } } class NNEntryComparator implements Comparator { public int compare(Object o1, Object o2) { NNEntry n1 = (NNEntry) o1; NNEntry n2 = (NNEntry) o2; if (n1.m_minDist < n2.m_minDist) return -1; if (n1.m_minDist > n2.m_minDist) return 1; return 0; } } class NNComparator implements INearestNeighborComparator { public double getMinimumDistance(IShape query, IEntry e) { IShape s = e.getShape(); return query.getMinimumDistance(s); } } class ValidateEntry { Region m_parentMBR; Node m_pNode; ValidateEntry(Region r, Node pNode) { m_parentMBR = r; m_pNode = pNode; } } class Data implements IData { int m_id; Region m_shape; byte[] m_pData; Data(byte[] pData, Region mbr, int id) { m_id = id; m_shape = mbr; m_pData = pData; } public int getIdentifier() { return m_id; } public IShape getShape() { return new Region(m_shape); } public byte[] getData() { byte[] data = new byte[m_pData.length]; System.arraycopy(m_pData, 0, data, 0, m_pData.length); return data; } } }
lgpl-2.1
lbtc-xxx/jboss-logmanager
src/main/java/org/jboss/logmanager/handlers/PeriodicRotatingFileHandler.java
10419
/* * JBoss, Home of Professional Open Source. * Copyright 2009, Red Hat Inc., and individual contributors * as indicated by the @author tags. See the copyright.txt file in the * distribution for a full listing of individual contributors. * * This is free software; you can redistribute it and/or modify it * under the terms of the GNU Lesser General Public License as * published by the Free Software Foundation; either version 2.1 of * the License, or (at your option) any later version. * * This software is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Lesser General Public License for more details. * * You should have received a copy of the GNU Lesser General Public * License along with this software; if not, write to the Free * Software Foundation, Inc., 51 Franklin St, Fifth Floor, Boston, MA * 02110-1301 USA, or see the FSF site: http://www.fsf.org. */ package org.jboss.logmanager.handlers; import org.jboss.logmanager.ExtLogRecord; import java.text.SimpleDateFormat; import java.util.Date; import java.util.Calendar; import java.util.TimeZone; import java.io.File; import java.io.FileNotFoundException; import java.util.logging.ErrorManager; /** * A file handler which rotates the log at a preset time interval. The interval is determined by the content of the * suffix string which is passed in to {@link #setSuffix(String)}. */ public class PeriodicRotatingFileHandler extends FileHandler { private SimpleDateFormat format; private String nextSuffix; private Period period = Period.NEVER; private long nextRollover = Long.MAX_VALUE; private TimeZone timeZone = TimeZone.getDefault(); /** * Construct a new instance with no formatter and no output file. */ public PeriodicRotatingFileHandler() { } /** * Construct a new instance with the given output file. * * @param fileName the file name * * @throws java.io.FileNotFoundException if the file could not be found on open */ public PeriodicRotatingFileHandler(final String fileName) throws FileNotFoundException { super(fileName); } /** * Construct a new instance with the given output file and append setting. * * @param fileName the file name * @param append {@code true} to append, {@code false} to overwrite * * @throws java.io.FileNotFoundException if the file could not be found on open */ public PeriodicRotatingFileHandler(final String fileName, final boolean append) throws FileNotFoundException { super(fileName, append); } /** * Construct a new instance with the given output file. * * @param file the file * @param suffix the format suffix to use * * @throws java.io.FileNotFoundException if the file could not be found on open */ public PeriodicRotatingFileHandler(final File file, final String suffix) throws FileNotFoundException { super(file); setSuffix(suffix); } /** * Construct a new instance with the given output file and append setting. * * @param file the file * @param suffix the format suffix to use * @param append {@code true} to append, {@code false} to overwrite * @throws java.io.FileNotFoundException if the file could not be found on open */ public PeriodicRotatingFileHandler(final File file, final String suffix, final boolean append) throws FileNotFoundException { super(file, append); setSuffix(suffix); } @Override public void setFile(final File file) throws FileNotFoundException { synchronized (outputLock) { super.setFile(file); if (format != null && file != null && file.lastModified() > 0) { calcNextRollover(file.lastModified()); } } } /** {@inheritDoc} This implementation checks to see if the scheduled rollover time has yet occurred. */ protected void preWrite(final ExtLogRecord record) { final long recordMillis = record.getMillis(); if (recordMillis >= nextRollover) { rollOver(); calcNextRollover(recordMillis); } } /** * Set the suffix string. The string is in a format which can be understood by {@link java.text.SimpleDateFormat}. * The period of the rotation is automatically calculated based on the suffix. * * @param suffix the suffix * @throws IllegalArgumentException if the suffix is not valid */ public void setSuffix(String suffix) throws IllegalArgumentException { final SimpleDateFormat format = new SimpleDateFormat(suffix); format.setTimeZone(timeZone); final int len = suffix.length(); Period period = Period.NEVER; for (int i = 0; i < len; i ++) { switch (suffix.charAt(i)) { case 'y': period = min(period, Period.YEAR); break; case 'M': period = min(period, Period.MONTH); break; case 'w': case 'W': period = min(period, Period.WEEK); break; case 'D': case 'd': case 'F': case 'E': period = min(period, Period.DAY); break; case 'a': period = min(period, Period.HALF_DAY); break; case 'H': case 'k': case 'K': case 'h': period = min(period, Period.HOUR); break; case 'm': period = min(period, Period.MINUTE); break; case '\'': while (suffix.charAt(++i) != '\''); break; case 's': case 'S': throw new IllegalArgumentException("Rotating by second or millisecond is not supported"); } } synchronized (outputLock) { this.format = format; this.period = period; final long now; final File file = getFile(); if (file != null && file.lastModified() > 0) { now = file.lastModified(); } else { now = System.currentTimeMillis(); } calcNextRollover(now); } } /** * Returns the suffix to be used. * * @return the suffix to be used */ protected final String getNextSuffix() { return nextSuffix; } private void rollOver() { try { final File file = getFile(); // first, close the original file (some OSes won't let you move/rename a file that is open) setFile(null); // next, rotate it file.renameTo(new File(file.getAbsolutePath() + nextSuffix)); // start new file setFile(file); } catch (FileNotFoundException e) { reportError("Unable to rotate log file", e, ErrorManager.OPEN_FAILURE); } } private void calcNextRollover(final long fromTime) { if (period == Period.NEVER) { nextRollover = Long.MAX_VALUE; return; } nextSuffix = format.format(new Date(fromTime)); final Calendar calendar = Calendar.getInstance(timeZone); calendar.setTimeInMillis(fromTime); final Period period = this.period; // clear out less-significant fields switch (period) { default: case YEAR: calendar.set(Calendar.MONTH, 0); case MONTH: calendar.set(Calendar.DAY_OF_MONTH, 0); calendar.clear(Calendar.WEEK_OF_MONTH); case WEEK: if (period == Period.WEEK) { calendar.set(Calendar.DAY_OF_WEEK, calendar.getFirstDayOfWeek()); } else { calendar.clear(Calendar.DAY_OF_WEEK); } calendar.clear(Calendar.DAY_OF_WEEK_IN_MONTH); case DAY: calendar.set(Calendar.HOUR_OF_DAY, 0); case HALF_DAY: if (period == Period.HALF_DAY) { calendar.set(Calendar.HOUR, 0); } else { //We want both HOUR_OF_DAY and (HOUR + AM_PM) to be zeroed out //This should ensure the hour is truly zeroed out calendar.set(Calendar.HOUR, 0); calendar.set(Calendar.AM_PM, 0); } case HOUR: calendar.set(Calendar.MINUTE, 0); case MINUTE: calendar.set(Calendar.SECOND, 0); calendar.set(Calendar.MILLISECOND, 0); } // increment the relevant field switch (period) { case YEAR: calendar.add(Calendar.YEAR, 1); break; case MONTH: calendar.add(Calendar.MONTH, 1); break; case WEEK: calendar.add(Calendar.WEEK_OF_YEAR, 1); break; case DAY: calendar.add(Calendar.DAY_OF_MONTH, 1); break; case HALF_DAY: calendar.add(Calendar.AM_PM, 1); break; case HOUR: calendar.add(Calendar.HOUR_OF_DAY, 1); break; case MINUTE: calendar.add(Calendar.MINUTE, 1); break; } nextRollover = calendar.getTimeInMillis(); } /** * Get the configured time zone for this handler. * * @return the configured time zone */ public TimeZone getTimeZone() { return timeZone; } /** * Set the configured time zone for this handler. * * @param timeZone the configured time zone */ public void setTimeZone(final TimeZone timeZone) { if (timeZone == null) { throw new NullPointerException("timeZone is null"); } this.timeZone = timeZone; } private static <T extends Comparable<? super T>> T min(T a, T b) { return a.compareTo(b) <= 0 ? a : b; } /** * Possible period values. Keep in strictly ascending order of magnitude. */ public enum Period { MINUTE, HOUR, HALF_DAY, DAY, WEEK, MONTH, YEAR, NEVER, } }
lgpl-2.1
kluver/lenskit
lenskit-core/src/main/java/org/lenskit/data/ratings/StandardRatingVectorPDAO.java
2905
/* * LensKit, an open source recommender systems toolkit. * Copyright 2010-2016 LensKit Contributors. See CONTRIBUTORS.md. * Work on LensKit has been funded by the National Science Foundation under * grants IIS 05-34939, 08-08692, 08-12148, and 10-17697. * * This program is free software; you can redistribute it and/or modify * it under the terms of the GNU Lesser General Public License as * published by the Free Software Foundation; either version 2.1 of the * License, or (at your option) any later version. * * This program is distributed in the hope that it will be useful, but WITHOUT * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS * FOR A PARTICULAR PURPOSE. See the GNU General Public License for more * details. * * You should have received a copy of the GNU General Public License along with * this program; if not, write to the Free Software Foundation, Inc., 51 * Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA. */ package org.lenskit.data.ratings; import it.unimi.dsi.fastutil.longs.Long2DoubleMap; import org.lenskit.data.dao.DataAccessObject; import org.lenskit.data.entities.CommonAttributes; import org.lenskit.util.IdBox; import org.lenskit.util.io.ObjectStream; import org.lenskit.util.io.ObjectStreams; import javax.annotation.Nonnull; import javax.annotation.concurrent.ThreadSafe; import javax.inject.Inject; import java.util.List; /** * Rating vector source that extracts user ratings from the database. */ @ThreadSafe public class StandardRatingVectorPDAO implements RatingVectorPDAO { private final DataAccessObject dao; private volatile IdBox<Long2DoubleMap> cachedValue; /** * Construct a rating vector source. * @param dao The data access object. */ @Inject public StandardRatingVectorPDAO(DataAccessObject dao) { this.dao = dao; } @Nonnull @Override public Long2DoubleMap userRatingVector(long user) { IdBox<Long2DoubleMap> cached = cachedValue; if (cached != null && cached.getId() == user) { return cached.getValue(); } Long2DoubleMap map; try (ObjectStream<Rating> stream = dao.query(Rating.class) .withAttribute(CommonAttributes.USER_ID, user) .stream()) { map = Ratings.userRatingVector(stream); } return map; } @Override public ObjectStream<IdBox<Long2DoubleMap>> streamUsers() { ObjectStream<IdBox<List<Rating>>> stream = dao.query(Rating.class) .groupBy(CommonAttributes.USER_ID) .stream(); return ObjectStreams.wrap(stream.map(u -> u.mapValue(Ratings::userRatingVector)), stream); } }
lgpl-2.1
mcarniel/oswing
srcdemo/demo37/TestVO.java
1296
package demo37; import org.openswing.swing.message.receive.java.ValueObjectImpl; import java.math.BigDecimal; import java.sql.Date; /** * <p>Title: OpenSwing Framework</p> * <p>Description: Test Value Object.</p> * <p>Copyright: Copyright (C) 2006 Mauro Carniel</p> * <p> </p> * @author Mauro Carniel * @version 1.0 */ public class TestVO extends ValueObjectImpl { private String itemCode; private String description; private java.math.BigDecimal qty; private java.math.BigDecimal price; private boolean hasChildren; public TestVO() { } public String getItemCode() { return itemCode; } public void setItemCode(String itemCode) { this.itemCode = itemCode; } public String getDescription() { return description; } public void setDescription(String description) { this.description = description; } public java.math.BigDecimal getQty() { return qty; } public void setQty(java.math.BigDecimal qty) { this.qty = qty; } public java.math.BigDecimal getPrice() { return price; } public void setPrice(java.math.BigDecimal price) { this.price = price; } public boolean isHasChildren() { return hasChildren; } public void setHasChildren(boolean hasChildren) { this.hasChildren = hasChildren; } }
lgpl-2.1
drhee/toxoMine
intermine/objectstore/main/src/org/intermine/sql/precompute/BestQuery.java
1880
package org.intermine.sql.precompute; /* * Copyright (C) 2002-2014 FlyMine * * This code may be freely distributed and modified under the * terms of the GNU Lesser General Public Licence. This should * be distributed with the code. See the LICENSE file for more * information or http://www.gnu.org/copyleft/lesser.html. * */ import org.intermine.sql.query.Query; import java.sql.SQLException; /** * This object is an abstract superclass for a Best Query tracker. Queries can be added to these * objects, and they will keep track of them. * * @author Matthew Wakeling * @author Andrew Varley */ public abstract class BestQuery { /** * Allows a Query to be added to this tracker. * * @param q a Query to be added to the tracker * @throws BestQueryException when adding should stop * @throws SQLException if error occurs in the underlying database */ public abstract void add(Query q) throws BestQueryException, SQLException; /** * Allows a Query to be added to this tracker. * * @param q a query String to be added to the tracker * @throws BestQueryException when adding should stop * @throws SQLException if error occurs in the underlying database */ public abstract void add(String q) throws BestQueryException, SQLException; /** * Gets the best Query found so far * * @return the best Query, or null if no Queries added to this object * @throws SQLException if error occurs in the underlying database */ public abstract Query getBestQuery() throws SQLException; /** * Gets the best query String found so far * * @return the best Query, or null if no Queries added to this object * @throws SQLException if error occurs in the underlying database */ public abstract String getBestQueryString() throws SQLException; }
lgpl-2.1
johnscancella/spotbugs
spotbugs-ant/src/main/java/edu/umd/cs/findbugs/anttask/ComputeBugHistoryTask.java
4496
/* * FindBugs - Find Bugs in Java programs * Copyright (C) 2003-2007 University of Maryland * * This library is free software; you can redistribute it and/or * modify it under the terms of the GNU Lesser General Public * License as published by the Free Software Foundation; either * version 2.1 of the License, or (at your option) any later version. * * This library is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Lesser General Public License for more details. * * You should have received a copy of the GNU Lesser General Public * License along with this library; if not, write to the Free Software * Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA */ package edu.umd.cs.findbugs.anttask; import java.io.File; import java.util.LinkedList; import java.util.List; import org.apache.tools.ant.BuildException; /** * Ant task to create/update a bug history database. * * @author David Hovemeyer */ public class ComputeBugHistoryTask extends AbstractFindBugsTask { private File outputFile; private boolean overrideRevisionNames; private boolean noPackageMoves; private boolean preciseMatch; private boolean precisePriorityMatch; private boolean quiet; private boolean withMessages; private final List<DataFile> dataFileList; public ComputeBugHistoryTask() { super("edu.umd.cs.findbugs.workflow.Update"); dataFileList = new LinkedList<DataFile>(); setFailOnError(true); } public void setOutput(File arg) { this.outputFile = arg; } public void setOverrideRevisionNames(boolean arg) { this.overrideRevisionNames = arg; } public void setNoPackageMoves(boolean arg) { this.noPackageMoves = arg; } public void setPreciseMatch(boolean arg) { this.preciseMatch = arg; } public void setPrecisePriorityMatch(boolean arg) { this.precisePriorityMatch = arg; } public void setQuiet(boolean arg) { this.quiet = arg; } public void setWithMessages(boolean arg) { this.withMessages = arg; } /** * Called to create DataFile objects in response to nested &lt;DataFile&gt; * elements. * * @return new DataFile object specifying the location of an input data file */ public DataFile createDataFile() { DataFile dataFile = new DataFile(); dataFileList.add(dataFile); return dataFile; } /* * (non-Javadoc) * * @see edu.umd.cs.findbugs.anttask.AbstractFindBugsTask#checkParameters() */ @Override protected void checkParameters() { super.checkParameters(); if (outputFile == null) { throw new BuildException("outputFile attribute must be set", getLocation()); } } /* * (non-Javadoc) * * @see * edu.umd.cs.findbugs.anttask.AbstractFindBugsTask#configureFindbugsEngine * () */ @Override protected void configureFindbugsEngine() { addArg("-output"); addArg(outputFile.getPath()); if (overrideRevisionNames) { addArg("-overrideRevisionNames"); } if (noPackageMoves) { addArg("-noPackageMoves"); } if (preciseMatch) { addArg("-preciseMatch"); } if (precisePriorityMatch) { addArg("-precisePriorityMatch"); } if (quiet) { addArg("-quiet"); } if (withMessages) { addArg("-withMessages"); } for (DataFile dataFile : dataFileList) { addArg(dataFile.getName()); } } /* * (non-Javadoc) * * @see * edu.umd.cs.findbugs.anttask.AbstractFindBugsTask#beforeExecuteJavaProcess * () */ @Override protected void beforeExecuteJavaProcess() { log("Running computeBugHistory..."); } /* * (non-Javadoc) * * @see * edu.umd.cs.findbugs.anttask.AbstractFindBugsTask#afterExecuteJavaProcess * (int) */ @Override protected void afterExecuteJavaProcess(int rc) { if (rc == 0) { log("History database written to " + outputFile.getPath()); } else { throw new BuildException("execution of " + getTaskName() + " failed"); } } }
lgpl-2.1
herculeshssj/unirio-ppgi-goalservice
GoalService/serviceDiscovery/src/main/ch/epfl/qosdisc/codims/ListServicesOperator.java
3451
/* * QoS Discovery Component * Copyright (C) 2006 Sebastian Gerlach * * This library is free software; you can redistribute it and/or * modify it under the terms of the GNU Lesser General Public * License as published by the Free Software Foundation; either * version 2.1 of the License, or (at your option) any later version. * * This library is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Lesser General Public License for more details. * * You should have received a copy of the GNU Lesser General Public * License along with this library; if not, write to the Free Software * Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA */ package ch.epfl.qosdisc.codims; import org.apache.log4j.Logger; import ch.epfl.codimsd.qeef.*; import ch.epfl.codimsd.qeef.types.*; import ch.epfl.codimsd.qeef.util.Constants; import ch.epfl.codimsd.qeef.relational.*; import ch.epfl.codimsd.qep.OpNode; /** * This operator outputs all the services we want to be working on. * * @author Sebastian Gerlach */ public class ListServicesOperator extends Acesso { /** * Output log for debug info. */ private static Logger log = Logger.getLogger(ListServicesOperator.class); /** * Constructor. * * @param id Operator id. * @param opNode Operatore node. */ public ListServicesOperator(int id, OpNode opNode) { // Call superconstructor. super(id); DataSourceManager dsManager = DataSourceManager.getDataSourceManager(); dataSource = (DataSource) dsManager.getDataSource(opNode.getOpTimeStamp()); metadata = null; } /** * Operator cleanup code. */ public void close() throws Exception { log.debug("Closing operator."); super.close(); } /** * Operator startup code. * * @throws Exception */ public void open() throws Exception { log.debug("Opening operator."); super.open(); } /* (non-Javadoc) * @see ch.epfl.codimsd.qeef.Operator#getNext(int) */ public DataUnit getNext(int consumerID) throws Exception { // Read next element from datasource. instance = (dataSource).read(); if (instance == null) return null; // Copy the string over into our output tuple. Tuple t = (Tuple) instance; OracleType oracleObject = (OracleType) t.getData(0); StringType stringType = new StringType((String)oracleObject.getObject()); Tuple newTuple = new Tuple(); newTuple.addData((Type)stringType); return newTuple; } /* (non-Javadoc) * @see ch.epfl.codimsd.qeef.Operator#setMetadata(ch.epfl.codimsd.qeef.Metadata[]) */ // @Override public void setMetadata(Metadata[] prMetadata) { // This just seems to be required by CoDIMS? log.debug("Setting metadata."); metadata = new Metadata[1]; metadata[0] = new TupleMetadata(); try { Column column = new Column("StringType", Config.getDataType(Constants.STRING), 1, 0, false, 0); metadata[0].addData(column); } catch (Exception ex) { ex.printStackTrace(); } } /* (non-Javadoc) * @see ch.epfl.codimsd.qeef.Operator#getMetadata(int) */ // @Override // public Metadata getMetadata(int idConsumer) { // // // Return something. // return new TupleMetadata(); // } }
lgpl-2.1
opennaru-dev/khan-session
khan-session-core/src/main/java/com/opennaru/khan/session/KhanSessionConfig.java
8356
/* * Opennaru, Inc. http://www.opennaru.com/ * * Copyright (C) 2014 Opennaru, Inc. and/or its affiliates. * All rights reserved by Opennaru, Inc. * * This is free software; you can redistribute it and/or modify it * under the terms of the GNU Lesser General Public License as * published by the Free Software Foundation; either version 2.1 of * the License, or (at your option) any later version. * * This software is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Lesser General Public License for more details. * * You should have received a copy of the GNU Lesser General Public * License along with this software; if not, write to the Free * Software Foundation, Inc., 51 Franklin St, Fifth Floor, Boston, MA * 02110-1301 USA, or see the FSF site: http://www.fsf.org. */ package com.opennaru.khan.session; /** * KHAN Session Configuration * * @author Junshik Jeon(service@opennaru.com, nameislocus@gmail.com) */ public class KhanSessionConfig { // if use library mode @Deprecated private boolean useLibraryMode; // namespace private String namespace; // exclude regular expression private String excludeRegExp; // session id key private String sessionIdKey; // cookie domain name private String domain; // cookie path private String path; // cookie secure private boolean secure; // cookie is httpOnly private boolean httpOnly; private boolean useAuthenticator; // if allow duplicate login private boolean allowDuplicateLogin; private boolean invalidateDuplicateLogin; // 중복로그인 강제 logout url private String logoutUrl; // Session timout minute private Integer sessionTimeoutMin; // Session save delay private Integer sessionSaveDelay; // enable MBean statistics private boolean enableStatistics; // enable Memory statistics private boolean enableMemoryStatistics; // for spring security private boolean enableImmediateSave; /** * check if library mode * @return */ public boolean isUseLibraryMode() { return useLibraryMode; } public void setUseLibraryMode(boolean useLibraryMode) { this.useLibraryMode = useLibraryMode; } /** * return namespace * @return */ public String getNamespace() { return namespace; } /** * set namespace * @param namespace */ public void setNamespace(String namespace) { this.namespace = namespace; } /** * return session id key * @return */ public String getSessionIdKey() { return sessionIdKey; } /** * set session id key * @param sessionIdKey */ public void setSessionIdKey(String sessionIdKey) { this.sessionIdKey = sessionIdKey; } /** * exclude url pattern * @return */ public String getExcludeRegExp() { return excludeRegExp; } /** * set exclude url pattern * @param excludeRegExp */ public void setExcludeRegExp(String excludeRegExp) { this.excludeRegExp = excludeRegExp; } /** * get cookie domain name * @return */ public String getDomain() { return domain; } /** * set cookie domain name * @param domain */ public void setDomain(String domain) { this.domain = domain; } /** * get cookie path * @return */ public String getPath() { return path; } /** * set cookie path * @param path */ public void setPath(String path) { this.path = path; } /** * set is secure cookie * @param secure */ public void setSecure(boolean secure) { this.secure = secure; } /** * is httponly cookie * @return */ public boolean isHttpOnly() { return httpOnly; } /** * set httponly cookie * @param httpOnly */ public void setHttpOnly(boolean httpOnly) { this.httpOnly = httpOnly; } public boolean useAuthenticator() { return useAuthenticator; } public void setUseAuthenticator(boolean useAuthenticator) { this.useAuthenticator = useAuthenticator; } /** * is allow duplicate login * @return */ public boolean isAllowDuplicateLogin() { return allowDuplicateLogin; } /** * set allow duplicate login * @param allowDuplicateLogin */ public void setAllowDuplicateLogin(boolean allowDuplicateLogin) { this.allowDuplicateLogin = allowDuplicateLogin; } public boolean isInvalidateDuplicateLogin() { return invalidateDuplicateLogin; } public void setInvalidateDuplicateLogin(boolean invalidateDuplicateLogin) { this.invalidateDuplicateLogin = invalidateDuplicateLogin; } /** * get logout url * @return */ public String getLogoutUrl() { return logoutUrl; } /** * set logout url * @param logoutUrl */ public void setLogoutUrl(String logoutUrl) { this.logoutUrl = logoutUrl; } /** * get session timeout min * @return */ public Integer getSessionTimeoutMin() { return sessionTimeoutMin; } /** * set session timeout min * @param sessionTimeoutMin */ public void setSessionTimeoutMin(Integer sessionTimeoutMin) { this.sessionTimeoutMin = sessionTimeoutMin; } public Integer getSessionSaveDelay() { return sessionSaveDelay; } public void setSessionSaveDelay(Integer sessionSaveDelay) { this.sessionSaveDelay = sessionSaveDelay; } /** * is secure * @return */ public boolean isSecure() { return secure; } /** * set secure * @param secure */ public void setSecure(Boolean secure) { this.secure = secure != null && secure; } /** * enable JMX statistics * @return */ public boolean isEnableStatistics() { return enableStatistics; } /** * set enable JMX statistics * @param enableStatistics */ public void setEnableStatistics(boolean enableStatistics) { this.enableStatistics = enableStatistics; } /** * enable memory JMX statistics * @return */ public boolean isEnableMemoryStatistics() { return enableMemoryStatistics; } /** * set enable memory JMX statistics * @param enableMemoryStatistics */ public void setEnableMemoryStatistics(boolean enableMemoryStatistics) { this.enableMemoryStatistics = enableMemoryStatistics; } public boolean isEnableImmediateSave() { return enableImmediateSave; } public void setEnableImmediateSave(boolean enableImmediateSave) { this.enableImmediateSave = enableImmediateSave; } @Override public String toString() { final StringBuffer sb = new StringBuffer("KhanSessionConfig{"); sb.append("useLibraryMode=").append(useLibraryMode); sb.append(", namespace='").append(namespace).append('\''); sb.append(", excludeRegExp='").append(excludeRegExp).append('\''); sb.append(", sessionIdKey='").append(sessionIdKey).append('\''); sb.append(", domain='").append(domain).append('\''); sb.append(", path='").append(path).append('\''); sb.append(", secure=").append(secure); sb.append(", httpOnly=").append(httpOnly); sb.append(", useAuthenticator=").append(useAuthenticator); sb.append(", allowDuplicateLogin=").append(allowDuplicateLogin); sb.append(", logoutUrl='").append(logoutUrl).append('\''); sb.append(", sessionTimeoutMin=").append(sessionTimeoutMin); sb.append(", sessionSaveDelay=").append(sessionSaveDelay); sb.append(", enableStatistics=").append(enableStatistics); sb.append(", enableMemoryStatistics=").append(enableMemoryStatistics); sb.append(", enableImmediateSave=").append(enableImmediateSave); sb.append('}'); return sb.toString(); } }
lgpl-2.1
dozed/align-api-project
procalign/src/main/java/fr/inrialpes/exmo/align/impl/eval/ThresholdGraphEvaluator.java
5069
/* * $Id: ThresholdGraphEvaluator.java 1608 2011-05-28 20:21:16Z euzenat $ * * Copyright (C) INRIA, 2004-2005, 2007-2010 * * This program is free software; you can redistribute it and/or modify * it under the terms of the GNU Lesser General Public License as published by * the Free Software Foundation; either version 2.1 of the License, or * (at your option) any later version. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU Lesser General Public License for more details. * * You should have received a copy of the GNU Lesser General Public License * along with this program; if not, write to the Free Software * Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA * */ package fr.inrialpes.exmo.align.impl.eval; import org.semanticweb.owl.align.Alignment; import org.semanticweb.owl.align.AlignmentException; import org.semanticweb.owl.align.Cell; import fr.inrialpes.exmo.align.impl.Namespace; import fr.inrialpes.exmo.align.parser.SyntaxElement; import java.util.Properties; import java.util.Vector; import java.io.PrintWriter; /** * Compute the F-measure/precision/recall at various thresholds * * @author Jerome Euzenat * @version $Id: ThresholdGraphEvaluator.java 1608 2011-05-28 20:21:16Z euzenat $ * */ public class ThresholdGraphEvaluator extends GraphEvaluator { private int STEP = 50; private double opt = 0.; // Optimum recorded value public ThresholdGraphEvaluator() { super(); } /** * Compute threshold graph */ public Vector<Pair> eval() { // throws AlignmentException return eval( (Properties)null ); } /** * Returns a list of Measure at threshold points (Pairs) * From an ordered vector of cells with their correctness status * * The basic strategy would be: * Take the alignment/(Compute P/R/Apply threshold)+ * But it is better to: take the cells in reverse order * Compute the measures on the fly * */ public Vector<Pair> eval( Properties params ) { // throws AlignmentException points = new Vector<Pair>(STEP+1); opt = 0.; int nbcorrect = 0; int nbfound = 0; double precision = 1.; double recall = 0.; double fmeasure = 0.; double prevt = cellSet.first().cell().getStrength(); // threshold for previous fellow double prevm = fmeasure; points.add( new Pair( 1., prevm ) ); // [T=100%] /* // This is the continuous version for ( EvalCell c : cellSet ) { nbfound++; if ( c.correct() ) nbcorrect++; if ( c.cell().getStrength() != prevt ) { // may record a new point fmeasure = 2*(double)nbcorrect/(double)(nbfound+nbexpected); // alternate formula if ( fmeasure != prevm ) { points.add( new Pair( prevt, prevm ) ); points.add( new Pair( c.cell().getStrength(), fmeasure ) ); prevm = fmeasure; if ( fmeasure > opt ) opt = fmeasure; // for real optimal } prevt = c.cell().getStrength(); } } fmeasure = 2*(double)nbcorrect/(double)(nbfound+nbexpected); */ // This is the version with increment // Determine what the increment is double increment = 1./(double)STEP; //System.err.println(" INCREMENT SET "+increment ); double next = 1.; next -= increment; for ( EvalCell c : cellSet ) { fmeasure = 2*(double)nbcorrect/(double)(nbfound+nbexpected); // alternate formula if ( fmeasure > opt && c.cell().getStrength() < prevt ) { opt = fmeasure; // for real optimal } else { // but only when all correspondences with same strength have been processed prevt = c.cell().getStrength(); } while ( next >= 0.001 && c.cell().getStrength() <= next ) { // increment achieved points.add( new Pair( next, fmeasure ) ); next -= increment; } nbfound++; if ( c.correct() ) { nbcorrect++; } } fmeasure = 2*(double)nbcorrect/(double)(nbfound+nbexpected); if ( fmeasure > opt ) opt = fmeasure; // for real optimal // In the end, it should exhaust all the thresholds while ( next >= 0.001 ) { // The bound is necessary for avoiding tikz problem points.add( new Pair( next, fmeasure ) ); // same measure next -= increment; } points.add( new Pair( 0., fmeasure ) ); // [T=0%] return points; } /** * This output the result */ public void write(PrintWriter writer) throws java.io.IOException { writer.println("<?xml version='1.0' encoding='utf-8' standalone='yes'?>"); writer.println("<"+SyntaxElement.RDF.print()+" xmlns:"+Namespace.RDF.shortCut+"='"+Namespace.RDF.prefix+"'>"); writer.println(" <output "+SyntaxElement.RDF_ABOUT.print()+"=''>"); writeXMLMap( writer ); writer.print(" <OPTIMUM>"+opt+"</OPTIMIM>\n"); writer.print(" </output>\n</"+SyntaxElement.RDF.print()+">\n"); } public double getGlobalResult(){ // can only be the full measure return opt; } public String xlabel() { return "threshold"; } public String ylabel() { return "fmeasure"; } }
lgpl-2.1
cj3636/TheNewJourney
src/main/java/com/thenewjourney/compat/jei/arcane/ArcaneHandler.java
1141
package com.thenewjourney.compat.jei.arcane; import mezz.jei.api.recipe.IRecipeHandler; import mezz.jei.api.recipe.IRecipeWrapper; import net.minecraft.item.ItemStack; public class ArcaneHandler implements IRecipeHandler<ArcaneRecipe> { @Override public Class<ArcaneRecipe> getRecipeClass() { return ArcaneRecipe.class; } @Override public String getRecipeCategoryUid() { return ArcaneCategory.ArcaneFURNACE; } @Override public String getRecipeCategoryUid(ArcaneRecipe recipe) { return ArcaneCategory.ArcaneFURNACE; } @Override public IRecipeWrapper getRecipeWrapper(ArcaneRecipe recipe) { return new ArcaneWrapper(recipe); } @Override public boolean isRecipeValid(ArcaneRecipe recipe) { if (recipe.getRecipeOutput() == null) { return false; } int inputCount = 0; for (ItemStack input : recipe.recipeItems) { if (input != null) { inputCount++; } } if (inputCount > 9) { return false; } return inputCount != 0; } }
lgpl-2.1
codehaus/drone
src/java/com/uwyn/drone/core/exceptions/LogoffErrorException.java
563
/* * Copyright 2002-2004 Geert Bevin <gbevin[remove] at uwyn dot com> * Distributed under the terms of the GNU Lesser General Public * License, v2.1 or later * * $Id$ */ package com.uwyn.drone.core.exceptions; import com.uwyn.drone.core.Bot; public class LogoffErrorException extends CoreException { private Bot mBot = null; public LogoffErrorException(Bot bot, Throwable cause) { super("Error while logging off bot '"+bot.getNick()+"' from server '"+bot.getServer()+"'.", cause); mBot = bot; } public Bot getBot() { return mBot; } }
lgpl-2.1
jodygarnett/GeoGig
src/web/api/src/test/java/org/locationtech/geogig/web/api/commands/PullTest.java
18191
/* Copyright (c) 2016 Boundless and others. * All rights reserved. This program and the accompanying materials * are made available under the terms of the Eclipse Distribution License v1.0 * which accompanies this distribution, and is available at * https://www.eclipse.org/org/documents/edl-v10.html * * Contributors: * Johnathan Garrett (Prominent Edge) - initial implementation */ package org.locationtech.geogig.web.api.commands; import static org.junit.Assert.assertEquals; import static org.junit.Assert.assertTrue; import java.net.URI; import javax.json.JsonArray; import javax.json.JsonObject; import javax.json.JsonValue; import org.junit.Rule; import org.junit.Test; import org.locationtech.geogig.model.ObjectId; import org.locationtech.geogig.model.Ref; import org.locationtech.geogig.model.RevCommit; import org.locationtech.geogig.model.RevFeatureBuilder; import org.locationtech.geogig.plumbing.ResolveGeogigURI; import org.locationtech.geogig.porcelain.CloneOp; import org.locationtech.geogig.porcelain.CommitOp; import org.locationtech.geogig.porcelain.RemoteAddOp; import org.locationtech.geogig.repository.NodeRef; import org.locationtech.geogig.repository.Remote; import org.locationtech.geogig.repository.Repository; import org.locationtech.geogig.web.api.AbstractWebAPICommand; import org.locationtech.geogig.web.api.AbstractWebOpTest; import org.locationtech.geogig.web.api.CommandSpecException; import org.locationtech.geogig.web.api.ParameterSet; import org.locationtech.geogig.web.api.TestContext; import org.locationtech.geogig.web.api.TestData; import org.locationtech.geogig.web.api.TestParams; public class PullTest extends AbstractWebOpTest { @Rule public TestContext remoteTestContext = new TestContext(); @Rule public TestContext originalTestContext = new TestContext(); @Override protected String getRoute() { return "pull"; } @Override protected Class<? extends AbstractWebAPICommand> getCommandClass() { return Pull.class; } @Override protected boolean requiresTransaction() { return false; } @Test public void testBuildParameters() { ParameterSet options = TestParams.of("all", "true", "ref", "master", "remoteName", "origin", "authorName", "Tester", "authorEmail", "tester@example.com"); Pull op = (Pull) buildCommand(options); assertEquals("master", op.refSpec); assertEquals("origin", op.remoteName); assertEquals("Tester", op.authorName.get()); assertEquals("tester@example.com", op.authorEmail.get()); assertTrue(op.fetchAll); } @Test public void testPull() throws Exception { Repository remoteGeogig = remoteTestContext.get().getRepository(); TestData remoteTestData = new TestData(remoteGeogig); remoteTestData.init(); remoteTestData.loadDefaultData(); Ref remoteMaster = remoteGeogig.command(org.locationtech.geogig.plumbing.RefParse.class) .setName(Ref.MASTER).call().get(); Ref remoteBranch1 = remoteGeogig.command(org.locationtech.geogig.plumbing.RefParse.class) .setName("branch1").call().get(); Ref remoteBranch2 = remoteGeogig.command(org.locationtech.geogig.plumbing.RefParse.class) .setName("branch2").call().get(); Repository geogig = testContext.get().getRepository(); TestData testData = new TestData(geogig); testData.init(); testData.checkout("master"); URI remoteURI = remoteGeogig.command(ResolveGeogigURI.class).call().get(); Remote remote = geogig.command(RemoteAddOp.class).setName("origin") .setURL(remoteURI.toURL().toString()).call(); ParameterSet options = TestParams.of("remoteName", "origin", "ref", "master"); buildCommand(options).run(testContext.get()); Ref master = geogig.command(org.locationtech.geogig.plumbing.RefParse.class) .setName(Ref.MASTER).call().get(); Ref branch1 = geogig.command(org.locationtech.geogig.plumbing.RefParse.class) .setName("refs/remotes/origin/branch1").call().get(); Ref branch2 = geogig.command(org.locationtech.geogig.plumbing.RefParse.class) .setName("refs/remotes/origin/branch2").call().get(); assertEquals(remoteMaster.getObjectId(), master.getObjectId()); assertEquals(remoteBranch1.getObjectId(), branch1.getObjectId()); assertEquals(remoteBranch2.getObjectId(), branch2.getObjectId()); JsonObject response = getJSONResponse().getJsonObject("response"); assertTrue(response.getBoolean("success")); JsonObject pull = response.getJsonObject("Pull"); JsonObject remoteObject = pull.getJsonObject("Fetch").getJsonObject("Remote"); assertEquals(remote.getFetchURL(), remoteObject.getString("remoteURL")); JsonArray branch = remoteObject.getJsonArray("Branch"); String expected = "[{\"changeType\":\"ADDED_REF\",\"name\":\"branch1\",\"newValue\":\"" + branch1.getObjectId().toString() + "\"}," + "{\"changeType\":\"ADDED_REF\",\"name\":\"branch2\",\"newValue\":\"" + branch2.getObjectId().toString() + "\"}," + "{\"changeType\":\"ADDED_REF\",\"name\":\"master\",\"newValue\":\"" + master.getObjectId().toString() + "\"}]"; assertTrue(TestData.jsonEquals(TestData.toJSONArray(expected), branch, false)); assertEquals(remote.getFetchURL(), pull.getString("Remote")); assertEquals("master", pull.getString("Ref")); assertEquals(9, pull.getInt("Added")); assertEquals(0, pull.getInt("Removed")); assertEquals(0, pull.getInt("Modified")); } @Test public void testPullNewBranch() throws Exception { Repository remoteGeogig = remoteTestContext.get().getRepository(); TestData remoteTestData = new TestData(remoteGeogig); remoteTestData.init(); remoteTestData.loadDefaultData(); Ref remoteMaster = remoteGeogig.command(org.locationtech.geogig.plumbing.RefParse.class) .setName(Ref.MASTER).call().get(); Ref remoteBranch1 = remoteGeogig.command(org.locationtech.geogig.plumbing.RefParse.class) .setName("branch1").call().get(); Ref remoteBranch2 = remoteGeogig.command(org.locationtech.geogig.plumbing.RefParse.class) .setName("branch2").call().get(); Repository geogig = testContext.get().getRepository(); TestData testData = new TestData(geogig); testData.init(); testData.checkout("master"); URI remoteURI = remoteGeogig.command(ResolveGeogigURI.class).call().get(); Remote remote = geogig.command(RemoteAddOp.class).setName("origin") .setURL(remoteURI.toURL().toString()).call(); ParameterSet options = TestParams.of("remoteName", "origin", "ref", "branch1:newbranch"); buildCommand(options).run(testContext.get()); Ref master = geogig.command(org.locationtech.geogig.plumbing.RefParse.class) .setName("refs/remotes/origin/master").call().get(); Ref branch1 = geogig.command(org.locationtech.geogig.plumbing.RefParse.class) .setName("refs/remotes/origin/branch1").call().get(); Ref branch2 = geogig.command(org.locationtech.geogig.plumbing.RefParse.class) .setName("refs/remotes/origin/branch2").call().get(); Ref newbranch = geogig.command(org.locationtech.geogig.plumbing.RefParse.class) .setName("newbranch").call().get(); assertEquals(remoteMaster.getObjectId(), master.getObjectId()); assertEquals(remoteBranch1.getObjectId(), branch1.getObjectId()); assertEquals(remoteBranch2.getObjectId(), branch2.getObjectId()); assertEquals(remoteBranch1.getObjectId(), newbranch.getObjectId()); JsonObject response = getJSONResponse().getJsonObject("response"); assertTrue(response.getBoolean("success")); JsonObject pull = response.getJsonObject("Pull"); JsonObject remoteObject = pull.getJsonObject("Fetch").getJsonObject("Remote"); assertEquals(remote.getFetchURL(), remoteObject.getString("remoteURL")); JsonArray branch = remoteObject.getJsonArray("Branch"); String expected = "[{\"changeType\":\"ADDED_REF\",\"name\":\"branch1\",\"newValue\":\"" + branch1.getObjectId().toString() + "\"}," + "{\"changeType\":\"ADDED_REF\",\"name\":\"branch2\",\"newValue\":\"" + branch2.getObjectId().toString() + "\"}," + "{\"changeType\":\"ADDED_REF\",\"name\":\"master\",\"newValue\":\"" + master.getObjectId().toString() + "\"}]"; assertTrue(TestData.jsonEquals(TestData.toJSONArray(expected), branch, false)); assertEquals(remote.getFetchURL(), pull.getString("Remote")); assertEquals("newbranch", pull.getString("Ref")); assertEquals(6, pull.getInt("Added")); assertEquals(0, pull.getInt("Removed")); assertEquals(0, pull.getInt("Modified")); } @Test public void testPullNoUpdates() throws Exception { Repository remoteGeogig = remoteTestContext.get().getRepository(); TestData remoteTestData = new TestData(remoteGeogig); remoteTestData.init(); remoteTestData.loadDefaultData(); Ref remoteMaster = remoteGeogig.command(org.locationtech.geogig.plumbing.RefParse.class) .setName(Ref.MASTER).call().get(); Ref remoteBranch1 = remoteGeogig.command(org.locationtech.geogig.plumbing.RefParse.class) .setName("branch1").call().get(); Ref remoteBranch2 = remoteGeogig.command(org.locationtech.geogig.plumbing.RefParse.class) .setName("branch2").call().get(); Repository geogig = testContext.get().getRepository(); TestData testData = new TestData(geogig); testData.init(); testData.checkout("master"); URI remoteURI = remoteGeogig.command(ResolveGeogigURI.class).call().get(); geogig.command(CloneOp.class).setRepositoryURL(remoteURI.toURL().toString()).call(); ParameterSet options = TestParams.of("remoteName", "origin", "ref", "master"); buildCommand(options).run(testContext.get()); Ref master = geogig.command(org.locationtech.geogig.plumbing.RefParse.class) .setName("refs/remotes/origin/master").call().get(); Ref branch1 = geogig.command(org.locationtech.geogig.plumbing.RefParse.class) .setName("refs/remotes/origin/branch1").call().get(); Ref branch2 = geogig.command(org.locationtech.geogig.plumbing.RefParse.class) .setName("refs/remotes/origin/branch2").call().get(); assertEquals(remoteMaster.getObjectId(), master.getObjectId()); assertEquals(remoteBranch1.getObjectId(), branch1.getObjectId()); assertEquals(remoteBranch2.getObjectId(), branch2.getObjectId()); JsonObject response = getJSONResponse().getJsonObject("response"); assertTrue(response.getBoolean("success")); JsonObject pull = response.getJsonObject("Pull"); JsonObject fetchObj = pull.getJsonObject("Fetch"); assertTrue(TestData.jsonEquals(TestData.toJSON("{}"), fetchObj, false)); } @Test public void testPullFromTooShallowClone() throws Exception { Repository originalGeogig = originalTestContext.get().getRepository(); TestData originalTestData = new TestData(originalGeogig); originalTestData.init(); originalTestData.loadDefaultData(); URI originalURI = originalGeogig.command(ResolveGeogigURI.class).call().get(); // Set up the shallow clone Repository remoteGeogig = remoteTestContext.get().getRepository(); remoteGeogig.command(CloneOp.class).setDepth(1) .setRepositoryURL(originalURI.toURL().toString()).call(); Repository geogig = testContext.get().getRepository(); TestData testData = new TestData(geogig); testData.init(); testData.checkout("master"); URI remoteURI = remoteGeogig.command(ResolveGeogigURI.class).call().get(); geogig.command(RemoteAddOp.class).setName("origin").setURL(remoteURI.toURL().toString()) .call(); ParameterSet options = TestParams.of("remoteName", "origin", "ref", "master"); ex.expect(CommandSpecException.class); ex.expectMessage("Unable to pull, the remote history is shallow."); buildCommand(options).run(testContext.get()); } @Test public void testPullConflicts() throws Exception { Repository remoteGeogig = remoteTestContext.get().getRepository(); TestData remoteTestData = new TestData(remoteGeogig); remoteTestData.init(); remoteTestData.checkout("master"); remoteTestData.insert(TestData.point1); remoteTestData.add(); RevCommit ancestor = remoteGeogig.command(CommitOp.class).setMessage("point1").call(); Repository geogig = testContext.get().getRepository(); TestData testData = new TestData(geogig); testData.init(); testData.checkout("master"); URI remoteURI = remoteGeogig.command(ResolveGeogigURI.class).call().get(); geogig.command(CloneOp.class).setRepositoryURL(remoteURI.toURL().toString()).call(); remoteTestData.insert(TestData.point1_modified); remoteTestData.add(); RevCommit theirs = remoteGeogig.command(CommitOp.class).setMessage("modify point1").call(); ObjectId point1_id = RevFeatureBuilder.build(TestData.point1_modified).getId(); testData.remove(TestData.point1); testData.add(); RevCommit ours = geogig.command(CommitOp.class).setMessage("remove point1").call(); ParameterSet options = TestParams.of("remoteName", "origin", "ref", "master"); buildCommand(options).run(testContext.get()); JsonObject response = getJSONResponse().getJsonObject("response"); assertTrue(response.getBoolean("success")); JsonObject merge = response.getJsonObject("Merge"); assertEquals(ours.getId().toString(), merge.getString("ours")); assertEquals(ancestor.getId().toString(), merge.getString("ancestor")); assertEquals(theirs.getId().toString(), merge.getString("theirs")); assertEquals(1, merge.getInt("conflicts")); JsonArray featureArray = merge.getJsonArray("Feature"); assertEquals(1, featureArray.getValuesAs(JsonValue.class).size()); JsonObject feature = featureArray.getJsonObject(0); assertEquals("CONFLICT", feature.getString("change")); String path = NodeRef.appendChild(TestData.pointsType.getTypeName(), TestData.point1.getID()); assertEquals(path, feature.getString("id")); JsonArray geometryArray = feature.getJsonArray("geometry"); assertEquals(1, geometryArray.getValuesAs(JsonValue.class).size()); String geometry = geometryArray.getString(0); assertEquals("POINT (0 0)", geometry); assertEquals(point1_id.toString(), feature.getString("theirvalue")); assertEquals(ObjectId.NULL.toString(), feature.getString("ourvalue")); } @Test public void testPullConflictsDifferentBranch() throws Exception { Repository remoteGeogig = remoteTestContext.get().getRepository(); TestData remoteTestData = new TestData(remoteGeogig); remoteTestData.init(); remoteTestData.checkout("master"); remoteTestData.insert(TestData.point1); remoteTestData.add(); RevCommit ancestor = remoteGeogig.command(CommitOp.class).setMessage("point1").call(); Repository geogig = testContext.get().getRepository(); TestData testData = new TestData(geogig); testData.init(); testData.checkout("master"); URI remoteURI = remoteGeogig.command(ResolveGeogigURI.class).call().get(); geogig.command(CloneOp.class).setRepositoryURL(remoteURI.toURL().toString()).call(); remoteTestData.insert(TestData.point1_modified); remoteTestData.add(); RevCommit theirs = remoteGeogig.command(CommitOp.class).setMessage("modify point1").call(); ObjectId point1_id = RevFeatureBuilder.build(TestData.point1_modified).getId(); testData.remove(TestData.point1); testData.add(); RevCommit ours = geogig.command(CommitOp.class).setMessage("remove point1").call(); testData.branchAndCheckout("branch1"); ParameterSet options = TestParams.of("remoteName", "origin", "ref", "master:branch1"); buildCommand(options).run(testContext.get()); JsonObject response = getJSONResponse().getJsonObject("response"); assertTrue(response.getBoolean("success")); JsonObject merge = response.getJsonObject("Merge"); assertEquals(ours.getId().toString(), merge.getString("ours")); assertEquals(ancestor.getId().toString(), merge.getString("ancestor")); assertEquals(theirs.getId().toString(), merge.getString("theirs")); assertEquals(1, merge.getInt("conflicts")); JsonArray featureArray = merge.getJsonArray("Feature"); assertEquals(1, featureArray.getValuesAs(JsonValue.class).size()); JsonObject feature = featureArray.getJsonObject(0); assertEquals("CONFLICT", feature.getString("change")); String path = NodeRef.appendChild(TestData.pointsType.getTypeName(), TestData.point1.getID()); assertEquals(path, feature.getString("id")); JsonArray geometryArray = feature.getJsonArray("geometry"); assertEquals(1, geometryArray.getValuesAs(JsonValue.class).size()); String geometry = geometryArray.getString(0); assertEquals("POINT (0 0)", geometry); assertEquals(point1_id.toString(), feature.getString("theirvalue")); assertEquals(ObjectId.NULL.toString(), feature.getString("ourvalue")); } }
lgpl-2.1
optivo-org/fingbugs-1.3.9-optivo
src/java/edu/umd/cs/findbugs/ba/Location.java
4434
/* * Bytecode Analysis Framework * Copyright (C) 2003,2004 University of Maryland * * This library is free software; you can redistribute it and/or * modify it under the terms of the GNU Lesser General Public * License as published by the Free Software Foundation; either * version 2.1 of the License, or (at your option) any later version. * * This library is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Lesser General Public License for more details. * * You should have received a copy of the GNU Lesser General Public * License along with this library; if not, write to the Free Software * Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA */ package edu.umd.cs.findbugs.ba; import org.apache.bcel.generic.InstructionHandle; import edu.umd.cs.findbugs.annotations.NonNull; /** * A class representing a location in the CFG for a method. * Essentially, it represents a static instruction, <em>with the important caveat</em> * that CFGs have inlined JSR subroutines, meaning that a single InstructionHandle * in a CFG may represent several static locations. To this end, a Location * is comprised of both an InstructionHandle and the BasicBlock that * contains it. * <p/> * <p> Location objects may be compared with each other using the equals() method, * and may be used as keys in tree and hash maps and sets. * Note that <em>it is only valid to compare Locations produced from the same CFG</em>. * * @author David Hovemeyer * @see CFG */ public class Location implements Comparable<Location> { private final InstructionHandle handle; private final BasicBlock basicBlock; private int hash; /** * Constructor. * * @param handle the instruction * @param basicBlock the basic block containing the instruction */ public Location(@NonNull InstructionHandle handle, @NonNull BasicBlock basicBlock) { if (handle == null) throw new NullPointerException("handle cannot be null"); if (basicBlock == null) throw new NullPointerException("basicBlock cannot be null"); this.handle = handle; this.basicBlock = basicBlock; } public static Location getFirstLocation(@NonNull BasicBlock basicBlock) { InstructionHandle location = basicBlock.getFirstInstruction(); if (location == null) return null; return new Location(location, basicBlock); } public static Location getLastLocation(@NonNull BasicBlock basicBlock) { InstructionHandle lastInstruction = basicBlock.getLastInstruction(); /* if (lastInstruction == null) lastInstruction = basicBlock.getExceptionThrower(); if (lastInstruction == null) lastInstruction = basicBlock.getFirstInstruction(); */ if (lastInstruction == null) return null; return new Location(lastInstruction, basicBlock); } /** * Get the instruction handle. */ public InstructionHandle getHandle() { return handle; } /** * Get the basic block. */ public BasicBlock getBasicBlock() { return basicBlock; } /** * Return whether or not the Location is positioned at the * first instruction in the basic block. */ public boolean isFirstInstructionInBasicBlock() { return !basicBlock.isEmpty() && handle == basicBlock.getFirstInstruction(); } /** * Return whether or not the Location is positioned at the * last instruction in the basic block. */ public boolean isLastInstructionInBasicBlock() { return !basicBlock.isEmpty() && handle == basicBlock.getLastInstruction(); } public int compareTo(Location other) { int pos = handle.getPosition() - other.handle.getPosition(); return pos; } @Override public int hashCode() { if(hash == 0){ return hash = System.identityHashCode(basicBlock) + handle.getPosition(); } return hash; } @Override public boolean equals(Object o) { if (!(o instanceof Location)) return false; Location other = (Location) o; return basicBlock == other.basicBlock && handle == other.handle; } @Override public String toString() { return handle.toString() + " in basic block " + basicBlock.getLabel(); } /** * @return a compact string of the form "bb:xx", where "bb" is the * basic block number and "xx" is the bytecode offset */ public String toCompactString() { return basicBlock.getLabel() + ":" + handle.getPosition(); } } //vim:ts=4
lgpl-2.1
gado4b2/device-controllers
message-broker-common/src/main/java/com/hpe/broker/service/consumer/kafka/KafkaConsumerService.java
5973
package com.hpe.broker.service.consumer.kafka; import static com.hpe.broker.utility.UtilityLogger.logExceptionStackTrace; import static org.slf4j.LoggerFactory.getLogger; import java.util.Collections; import java.util.List; import java.util.Properties; import java.util.concurrent.CopyOnWriteArrayList; import java.util.concurrent.ExecutorService; import org.apache.kafka.clients.consumer.ConsumerRecord; import org.apache.kafka.clients.consumer.ConsumerRecords; import org.apache.kafka.clients.consumer.KafkaConsumer; import org.apache.kafka.common.serialization.Deserializer; import org.apache.kafka.common.serialization.StringDeserializer; import org.slf4j.Logger; import com.hpe.broker.service.consumer.BrokerConsumerService; import com.hpe.broker.service.consumer.handler.BrokerConsumerDataHandler; /** * @author sveera * */ public class KafkaConsumerService<K, V> implements BrokerConsumerService<V> { private final Logger logger = getLogger(getClass()); private final String kafkaBootStrapServers; private final String keyDeSerializerClass; private final String valueDeSerializerClass; private final String consumerGroupId; private final List<KafkaConsumerRunnable> kafkaConsumers = new CopyOnWriteArrayList<>(); protected final ExecutorService executorService; public KafkaConsumerService(String kafkaBootStrapServers, String keyDeSerializerClass, String valueDeSerializerClass, String consumerGroupId, ExecutorService executorService) { super(); this.kafkaBootStrapServers = kafkaBootStrapServers; this.keyDeSerializerClass = keyDeSerializerClass; this.valueDeSerializerClass = valueDeSerializerClass; this.consumerGroupId = consumerGroupId; this.executorService = executorService; } @Override public String getName() { return "kafka"; } @Override public void startService() { } @Override public void stopService() { for (KafkaConsumerRunnable kafkaConsumerRunnable : kafkaConsumers) kafkaConsumerRunnable.stopKafkaConsumerRunnable(); } @Override public void consumeData(String destination, BrokerConsumerDataHandler<V> brokerConsumerDataHandler) { KafkaConsumerRunnable kafkaConsumerRunnable = new KafkaConsumerRunnable(destination, brokerConsumerDataHandler); startConsumerThread(kafkaConsumerRunnable); } protected void startConsumerThread(KafkaConsumerRunnable kafkaConsumerRunnable) { kafkaConsumers.add(kafkaConsumerRunnable); logger.debug( "Trying to start new " + KafkaConsumerRunnable.class.getSimpleName() + " : " + kafkaConsumerRunnable); executorService.submit(kafkaConsumerRunnable); } protected class KafkaConsumerRunnable implements Runnable { private final Logger logger = getLogger(getClass()); private final String auto_commit_interval_ms = "1000"; private final int polling_interval = 100; private final String destination; private final BrokerConsumerDataHandler<V> brokerConsumerDataHandler; private volatile boolean isConsumerRunnable; private KafkaConsumer<K, V> kafkaConsumer; public KafkaConsumerRunnable(String destination, BrokerConsumerDataHandler<V> brokerConsumerDataHandler) { this.destination = destination; this.brokerConsumerDataHandler = brokerConsumerDataHandler; } @Override public void run() { try { tryInstantiatingKafkaConsumer(); while (isConsumerRunnable) startPollingForRecords(); } catch (Throwable th) { logExceptionStackTrace(th, getClass()); } finally { closingKafkaConsumer(); } } public void stopKafkaConsumerRunnable() { isConsumerRunnable = false; if (kafkaConsumer != null) kafkaConsumer.wakeup(); } private void tryInstantiatingKafkaConsumer() { try { initKafkaConsumer(); kafkaConsumer.subscribe(Collections.singletonList(destination)); isConsumerRunnable = true; } catch (Exception e) { logExceptionStackTrace(e, getClass()); throw new RuntimeException("Failed to start " + this.getClass().getSimpleName()); } } private void initKafkaConsumer() throws InstantiationException, IllegalAccessException, ClassNotFoundException { final Properties properties = new Properties(); properties.setProperty("bootstrap.servers", kafkaBootStrapServers); properties.setProperty("group.id", consumerGroupId); properties.setProperty("auto.commit.interval.ms", auto_commit_interval_ms); final Deserializer<K> keySerializer = keyDeSerializerClass == null || keyDeSerializerClass.isEmpty() ? (Deserializer<K>) new StringDeserializer() : (Deserializer<K>) Class.forName(keyDeSerializerClass).newInstance(); final Deserializer<V> valueSerializer = valueDeSerializerClass == null || valueDeSerializerClass.isEmpty() ? (Deserializer<V>) new StringDeserializer() : (Deserializer<V>) Class.forName(valueDeSerializerClass).newInstance(); kafkaConsumer = new KafkaConsumer<>(properties, keySerializer, valueSerializer); logger.trace("Kafka Consumer Instance been created " + kafkaConsumer); } protected void startPollingForRecords() { ConsumerRecords<K, V> records = kafkaConsumer.poll(polling_interval); for (ConsumerRecord<K, V> consumerRecord : records) tryProcessingMessage(consumerRecord); kafkaConsumer.commitSync(); } private void tryProcessingMessage(ConsumerRecord<K, V> consumerRecord) { try { logger.trace("Received consumer record in " + this.getClass().getSimpleName() + " with value " + consumerRecord.toString()); brokerConsumerDataHandler.handleConsumerMessage(consumerRecord.topic(), consumerRecord.value()); } catch (Throwable e) { logExceptionStackTrace(e, getClass()); } } private void closingKafkaConsumer() { if (kafkaConsumer != null) kafkaConsumer.close(); logger.trace("Closed " + this.toString() + " successfully."); } @Override public String toString() { return "KafkaConsumerRunnable [destination=" + destination + ", brokerConsumerDataHandler=" + brokerConsumerDataHandler + "]"; } } }
lgpl-2.1
whdc/ieo-beast
src/dr/app/beauti/BeautiFrame.java
34941
/* * BeautiFrame.java * * (c) 2002-2005 BEAST Development Core Team * * This package may be distributed under the * Lesser Gnu Public Licence (LGPL) */ package dr.app.beauti; import dr.app.beauti.ancestralStatesPanel.AncestralStatesPanel; import dr.app.beauti.clockModelsPanel.OldClockModelsPanel; import dr.app.beauti.components.ComponentFactory; import dr.app.beauti.components.ancestralstates.AncestralStatesComponentFactory; import dr.app.beauti.components.continuous.ContinuousComponentFactory; import dr.app.beauti.components.discrete.DiscreteTraitsComponentFactory; import dr.app.beauti.components.dollo.DolloComponentFactory; import dr.app.beauti.components.hpm.HierarchicalModelComponentFactory; import dr.app.beauti.components.sequenceerror.SequenceErrorModelComponentFactory; import dr.app.beauti.components.tipdatesampling.TipDateSamplingComponentFactory; import dr.app.beauti.datapanel.DataPanel; import dr.app.beauti.generator.BeastGenerator; import dr.app.beauti.generator.Generator; import dr.app.beauti.mcmcpanel.MCMCPanel; import dr.app.beauti.operatorspanel.OperatorsPanel; import dr.app.beauti.options.BeautiOptions; import dr.app.beauti.options.PartitionTreePrior; import dr.app.beauti.options.STARBEASTOptions; import dr.app.beauti.options.TraitData; import dr.app.beauti.priorsPanel.DefaultPriorDialog; import dr.app.beauti.priorsPanel.PriorsPanel; import dr.app.beauti.siteModelsPanel.SiteModelsPanel; import dr.app.beauti.taxonsetspanel.SpeciesSetPanel; import dr.app.beauti.taxonsetspanel.TaxonSetPanel; import dr.app.beauti.tipdatepanel.TipDatesPanel; import dr.app.beauti.traitspanel.TraitsPanel; import dr.app.beauti.treespanel.TreesPanel; import dr.app.beauti.util.BEAUTiImporter; import dr.app.beauti.util.TextUtil; import dr.app.gui.FileDrop; import dr.app.util.OSType; import dr.app.util.Utils; import dr.evolution.io.Importer.ImportException; import dr.evolution.io.NexusImporter.MissingBlockException; import jam.framework.DocumentFrame; import jam.framework.Exportable; import jam.util.IconUtils; import org.jdom.JDOMException; import javax.swing.*; import javax.swing.border.Border; import javax.swing.event.ChangeEvent; import javax.swing.event.ChangeListener; import javax.swing.filechooser.FileNameExtensionFilter; import javax.swing.plaf.BorderUIResource; import java.awt.*; import java.awt.event.HierarchyBoundsListener; import java.awt.event.HierarchyEvent; import java.io.*; /** * @author Andrew Rambaut * @author Alexei Drummond * @version $Id: BeautiFrame.java,v 1.22 2006/09/09 16:07:06 rambaut Exp $ */ public class BeautiFrame extends DocumentFrame { private static final long serialVersionUID = 2114148696789612509L; public final static String DATA_PARTITIONS = "Partitions"; public final static String TAXON_SETS = "Taxa"; public final static String TIP_DATES = "Tips"; public final static String TRAITS = "Traits"; public final static String SITE_MODELS = "Sites"; public final static String CLOCK_MODELS = "Clocks"; public final static String TREES = "Trees"; public final static String ANCESTRAL_STATES = "States"; public final static String PRIORS = "Priors"; public final static String OPERATORS = "Operators"; public final static String MCMC = "MCMC"; private BeautiOptions options; private BeastGenerator generator; private final ComponentFactory[] components; public final JTabbedPane tabbedPane = new JTabbedPane(); public final JLabel statusLabel = new JLabel(); private DataPanel dataPanel; private TipDatesPanel tipDatesPanel; private TraitsPanel traitsPanel; private TaxonSetPanel taxonSetPanel; private SpeciesSetPanel speciesSetPanel; private SiteModelsPanel siteModelsPanel; private AncestralStatesPanel ancestralStatesPanel; private OldClockModelsPanel clockModelsPanel; private TreesPanel treesPanel; private PriorsPanel priorsPanel; private OperatorsPanel operatorsPanel; private MCMCPanel mcmcPanel; private BeautiPanel currentPanel; private JFileChooser importChooser; // make JFileChooser chooser remember previous path private JFileChooser exportChooser; // make JFileChooser chooser remember previous path final Icon gearIcon = IconUtils.getIcon(this.getClass(), "images/gear.png"); public BeautiFrame(String title) { super(); setTitle(title); // Prevent the application to close in requestClose() // after a user cancel or a failure in beast file generation setDefaultCloseOperation(DO_NOTHING_ON_CLOSE); // getOpenAction().setEnabled(false); // getSaveAction().setEnabled(false); getFindAction().setEnabled(false); getZoomWindowAction().setEnabled(false); components = new ComponentFactory[] { AncestralStatesComponentFactory.INSTANCE, ContinuousComponentFactory.INSTANCE, DiscreteTraitsComponentFactory.INSTANCE, // DnDsComponentFactory.INSTANCE, DolloComponentFactory.INSTANCE, HierarchicalModelComponentFactory.INSTANCE, SequenceErrorModelComponentFactory.INSTANCE, TipDateSamplingComponentFactory.INSTANCE }; options = new BeautiOptions(components); generator = new BeastGenerator(options, components); this.getContentPane().addHierarchyBoundsListener(new HierarchyBoundsListener() { public void ancestorMoved(HierarchyEvent e) { } public void ancestorResized(HierarchyEvent e) { setStatusMessage(); } }); } public void initializeComponents() { dataPanel = new DataPanel(this, getImportAction(), getDeleteAction()/*, getImportTraitsAction()*/); tipDatesPanel = new TipDatesPanel(this); traitsPanel = new TraitsPanel(this, dataPanel, getImportTraitsAction()); taxonSetPanel = new TaxonSetPanel(this); speciesSetPanel = new SpeciesSetPanel(this); siteModelsPanel = new SiteModelsPanel(this, getDeleteAction()); ancestralStatesPanel = new AncestralStatesPanel(this); clockModelsPanel = new OldClockModelsPanel(this); // oldTreesPanel = new OldTreesPanel(this); treesPanel = new TreesPanel(this, getDeleteAction()); // speciesTreesPanel = new SpeciesTreesPanel(this); priorsPanel = new PriorsPanel(this, false); operatorsPanel = new OperatorsPanel(this); mcmcPanel = new MCMCPanel(this); int index = 0; tabbedPane.addTab(DATA_PARTITIONS, dataPanel); tabbedPane.setToolTipTextAt(index++, "<html>" + "Import sequence alignments, organize data partitions,<br>" + "link models between partitions and select *BEAST</html>"); tabbedPane.addTab(TAXON_SETS, taxonSetPanel); tabbedPane.setToolTipTextAt(index++, "<html>" + "Create and edit sets of taxa which can be used to <br>" + "define times of most recent common ancestors and <br>" + "to keep groups monophyletic.</html>"); // tabbedPane.addTab("Species Sets", speciesSetPanel); tabbedPane.addTab(TIP_DATES, tipDatesPanel); tabbedPane.setToolTipTextAt(index++, "<html>" + "Specify sampling dates of tips for use in temporal <br>" + "analyses of measurably evolving populations.</html>"); tabbedPane.addTab(TRAITS, traitsPanel); tabbedPane.setToolTipTextAt(index++, "<html>" + "Import and organize continuous and discrete traits <br>" + "for taxa, convert them into data partitions for evolutionary<br>" + "analysis.</html>"); tabbedPane.addTab(SITE_MODELS, siteModelsPanel); tabbedPane.setToolTipTextAt(index++, "<html>" + "Select evolutionary models to be used for each data <br>" + "partition including substitution models, codon partitioning<br>" + "and trait evolution models.</html>"); tabbedPane.addTab(CLOCK_MODELS, clockModelsPanel); tabbedPane.setToolTipTextAt(index++, "<html>" + "Select relaxed molecular clock models to be used across <br>" + "the tree. Specify sampling of rates.</html>"); tabbedPane.addTab(TREES, treesPanel); tabbedPane.setToolTipTextAt(index++, "<html>" + "Select the priors on trees including coalescent models<br>" + "birth-death speciation models and the *BEAST gene tree,<br>" + "species tree options.</html>"); tabbedPane.addTab(ANCESTRAL_STATES, ancestralStatesPanel); tabbedPane.setToolTipTextAt(index++, "<html>" + "Select options for sampling ancestral states at specific<br>" + "or all common ancestors, models of counting state changes<br>" + "and models of sequencing error for data partitions.</html>"); tabbedPane.addTab(PRIORS, priorsPanel); tabbedPane.setToolTipTextAt(index++, "<html>" + "Specify prior probability distributions on each and every<br>" + "parameter of the current model.</html>"); tabbedPane.addTab(OPERATORS, operatorsPanel); tabbedPane.setToolTipTextAt(index++, "<html>" + "Select and adjust the menu of operators that will be used<br>" + "to propose changes to the parameters. Switch off operators<br>" + "on certain parameters to fix them to initial values.</html>"); tabbedPane.addTab(MCMC, mcmcPanel); tabbedPane.setToolTipTextAt(index++, "<html>" + "Specify the details of MCMC sampling. This includes chain<br>" + "length, sampling frequencies, log file names and more.</html>"); for (int i = 1; i < tabbedPane.getTabCount(); i++) { tabbedPane.setEnabledAt(i, false); } currentPanel = (BeautiPanel) tabbedPane.getSelectedComponent(); tabbedPane.addChangeListener(new ChangeListener() { public void stateChanged(ChangeEvent e) { BeautiPanel selectedPanel = (BeautiPanel) tabbedPane.getSelectedComponent(); if (selectedPanel == dataPanel) { dataPanel.selectionChanged(); } else { getDeleteAction().setEnabled(false); } currentPanel.getOptions(options); setAllOptions(); currentPanel = selectedPanel; } }); JPanel basePanel = new JPanel(new BorderLayout(6, 6)); basePanel.setBorder(new BorderUIResource.EmptyBorderUIResource(new java.awt.Insets(12, 12, 12, 12))); // basePanel.setPreferredSize(new java.awt.Dimension(800, 600)); getExportAction().setEnabled(false); JButton generateButton = new JButton(getExportAction()); generateButton.putClientProperty("JButton.buttonType", "roundRect"); JPanel panel2 = new JPanel(new BorderLayout(6, 6)); panel2.add(statusLabel, BorderLayout.WEST); panel2.add(generateButton, BorderLayout.EAST); panel2.setMinimumSize(new java.awt.Dimension(10, 10)); basePanel.add(tabbedPane, BorderLayout.CENTER); basePanel.add(panel2, BorderLayout.SOUTH); add(basePanel, BorderLayout.CENTER); Toolkit tk = Toolkit.getDefaultToolkit(); Dimension d = tk.getScreenSize(); // System.out.println("Screen width = " + d.width); // System.out.println("Screen height = " + d.height); if (d.width < 1000 || d.height < 700) { setSize(new java.awt.Dimension(700, 550)); } else { setSize(new java.awt.Dimension(1024, 768)); } if (OSType.isMac()) { setMinimumSize(new java.awt.Dimension(640, 480)); } setAllOptions(); // make JFileChooser chooser remember previous path exportChooser = new JFileChooser(Utils.getCWD()); exportChooser.setFileFilter(new FileNameExtensionFilter("BEAST XML File", "xml", "beast")); exportChooser.setDialogTitle("Generate BEAST XML File..."); importChooser = new JFileChooser(Utils.getCWD()); importChooser.setMultiSelectionEnabled(true); importChooser.setFileFilter(new FileNameExtensionFilter( "Microsatellite (tab-delimited *.txt) Files", "txt")); importChooser.setFileFilter(new FileNameExtensionFilter( "NEXUS (*.nex) & BEAST (*.xml) Files", "nex", "nexus", "nx", "xml", "beast", "fa", "fasta", "afa")); importChooser.setDialogTitle("Import Aligment..."); Color focusColor = UIManager.getColor("Focus.color"); Border focusBorder = BorderFactory.createMatteBorder(2, 2, 2, 2, focusColor); dataPanel.setBorder(BorderFactory.createEmptyBorder(2, 2, 2, 2)); new FileDrop(null, dataPanel, focusBorder, new FileDrop.Listener() { public void filesDropped(java.io.File[] files) { importFiles(files); } // end filesDropped }); // end FileDrop.Listener } /** * set all the options for all panels */ public void setAllOptions() { try { dataPanel.setOptions(options); tipDatesPanel.setOptions(options); traitsPanel.setOptions(options); if (options.useStarBEAST) { speciesSetPanel.setOptions(options); } else { taxonSetPanel.setOptions(options); } siteModelsPanel.setOptions(options); clockModelsPanel.setOptions(options); treesPanel.setOptions(options); ancestralStatesPanel.setOptions(options); priorsPanel.setOptions(options); operatorsPanel.setOptions(options); mcmcPanel.setOptions(options); setStatusMessage(); } catch (IllegalArgumentException illegEx) { JOptionPane.showMessageDialog(this, illegEx.getMessage(), "Illegal Argument Exception", JOptionPane.ERROR_MESSAGE); } // enable/disable the other tabs and generate option depending on whether any // data has been loaded. boolean enabled = options.getDataPartitions().size() > 0; for (int i = 1; i < tabbedPane.getTabCount(); i++) { tabbedPane.setEnabledAt(i, enabled); } getExportAction().setEnabled(enabled); } /** * get all the options for all panels */ private void getAllOptions() { try { dataPanel.getOptions(options); tipDatesPanel.getOptions(options); traitsPanel.getOptions(options); if (options.useStarBEAST) { speciesSetPanel.getOptions(options); } else { taxonSetPanel.getOptions(options); } siteModelsPanel.getOptions(options); clockModelsPanel.getOptions(options); treesPanel.getOptions(options); ancestralStatesPanel.getOptions(options); priorsPanel.getOptions(options); operatorsPanel.getOptions(options); mcmcPanel.getOptions(options); } catch (IllegalArgumentException illegEx) { JOptionPane.showMessageDialog(this, illegEx.getMessage(), "Illegal Argument Exception", JOptionPane.ERROR_MESSAGE); } } public void doSelectAll() { if (currentPanel == dataPanel) { dataPanel.selectAll(); } } public final void dataSelectionChanged(boolean isSelected) { getDeleteAction().setEnabled(isSelected); } public final void modelSelectionChanged(boolean isSelected) { getDeleteAction().setEnabled(isSelected); } public void doDelete() { if (tabbedPane.getSelectedComponent() == dataPanel) { dataPanel.removeSelection(); // } else if (tabbedPane.getSelectedComponent() == modelsPanel) { // modelsPanel.delete(); // } else if (tabbedPane.getSelectedComponent() == treesPanel) { // treesPanel.delete(); } else { throw new RuntimeException("Delete should only be accessable from the Data and Models panels"); } setStatusMessage(); } public boolean requestClose() { if (isDirty() && options.hasData()) { int option = JOptionPane.showConfirmDialog(this, "You have made changes but have not generated\n" + "a BEAST XML file. Do you wish to generate\n" + "before closing this window?", "Unused changes", JOptionPane.YES_NO_CANCEL_OPTION, JOptionPane.WARNING_MESSAGE); if (option == JOptionPane.YES_OPTION) { return doGenerate(); } else if (option == JOptionPane.CANCEL_OPTION || option == JOptionPane.DEFAULT_OPTION) { return false; } return true; } return true; } public void doApplyTemplate() { FileDialog dialog = new FileDialog(this, "Apply Template", FileDialog.LOAD); dialog.setVisible(true); if (dialog.getFile() != null) { File file = new File(dialog.getDirectory(), dialog.getFile()); try { readFromFile(file); } catch (FileNotFoundException fnfe) { JOptionPane.showMessageDialog(this, "Unable to open template file: File not found", "Unable to open file", JOptionPane.ERROR_MESSAGE); } catch (IOException ioe) { JOptionPane.showMessageDialog(this, "Unable to read template file: " + ioe.getMessage(), "Unable to read file", JOptionPane.ERROR_MESSAGE); } } } protected boolean readFromFile(File file) throws IOException { FileInputStream fileIn = new FileInputStream(file); ObjectInputStream in = new ObjectInputStream(fileIn); try { options = (BeautiOptions) in.readObject(); } catch (ClassNotFoundException cnfe) { JOptionPane.showMessageDialog(this, "Unable to read BEAUti file: " + cnfe.getMessage(), "Unable to read file", JOptionPane.ERROR_MESSAGE); cnfe.printStackTrace(); //To change body of catch statement use File | Settings | File Templates. return false; } in.close(); fileIn.close(); generator = new BeastGenerator(options, components); return true; } public String getDefaultFileName() { return options.fileNameStem + ".beauti"; } protected boolean writeToFile(File file) throws IOException { OutputStream fileOut = new FileOutputStream(file); ObjectOutputStream out = new ObjectOutputStream(fileOut); out.writeObject(options); out.close(); fileOut.close(); return true; } public final void doImport() { int returnVal = importChooser.showOpenDialog(this); if (returnVal == JFileChooser.APPROVE_OPTION) { File[] files = importChooser.getSelectedFiles(); importFiles(files); tabbedPane.setSelectedComponent(dataPanel); } } private void importFiles(File[] files) { for (File file : files) { if (file == null || file.getName().equals("")) { JOptionPane.showMessageDialog(this, "Invalid file name", "Invalid file name", JOptionPane.ERROR_MESSAGE); } else { try { BEAUTiImporter beautiImporter = new BEAUTiImporter(this, options); beautiImporter.importFromFile(file); setDirty(); // } catch (FileNotFoundException fnfe) { // JOptionPane.showMessageDialog(this, "Unable to open file: File not found", // "Unable to open file", JOptionPane.ERROR_MESSAGE); } catch (IOException ioe) { JOptionPane.showMessageDialog(this, "File I/O Error unable to read file: " + ioe.getMessage(), "Unable to read file", JOptionPane.ERROR_MESSAGE); ioe.printStackTrace(); // there may be other files in the list so don't return // return; } catch (MissingBlockException ex) { JOptionPane.showMessageDialog(this, "TAXON, DATA or CHARACTERS block is missing in Nexus file: " + ex, "Missing Block in Nexus File", JOptionPane.ERROR_MESSAGE); ex.printStackTrace(); } catch (ImportException ime) { JOptionPane.showMessageDialog(this, "Error parsing imported file: " + ime, "Error reading file", JOptionPane.ERROR_MESSAGE); ime.printStackTrace(); } catch (JDOMException jde) { JOptionPane.showMessageDialog(this, "Error parsing imported file: " + jde, "Error reading file", JOptionPane.ERROR_MESSAGE); jde.printStackTrace(); // } catch (IllegalArgumentException illegEx) { // JOptionPane.showMessageDialog(this, illegEx.getMessage(), // "Illegal Argument Exception", JOptionPane.ERROR_MESSAGE); // // } catch (Exception ex) { // JOptionPane.showMessageDialog(this, "Fatal exception: " + ex, // "Error reading file", // JOptionPane.ERROR_MESSAGE); // ex.printStackTrace(); // return; } } } if (!options.hasIdenticalTaxa()) { setAllOptions(); // need this to refresh panels otherwise it will throw exception dataPanel.selectAll(); dataPanel.unlinkTrees(); } setAllOptions(); } public final boolean doImportTraits() { if (options.taxonList != null) { // validation of check empty taxonList FileDialog dialog = new FileDialog(this, "Import Traits File...", FileDialog.LOAD); dialog.setVisible(true); if (dialog.getFile() != null) { final File file = new File(dialog.getDirectory(), dialog.getFile()); try { BEAUTiImporter beautiImporter = new BEAUTiImporter(this, options); beautiImporter.importTraits(file); } catch (FileNotFoundException fnfe) { JOptionPane.showMessageDialog(this, "Unable to open file: File not found", "Unable to open file", JOptionPane.ERROR_MESSAGE); return false; } catch (IOException ioe) { JOptionPane.showMessageDialog(this, "Unable to read file: " + ioe.getMessage(), "Unable to read file", JOptionPane.ERROR_MESSAGE); return false; } catch (Exception ex) { JOptionPane.showMessageDialog(this, "Fatal exception: " + ex, "Error reading file", JOptionPane.ERROR_MESSAGE); ex.printStackTrace(); return false; } } else { return false; } traitsPanel.fireTraitsChanged(); setAllOptions(); tabbedPane.setSelectedComponent(traitsPanel); return true; } else { JOptionPane.showMessageDialog(this, "No taxa loaded yet, please import Alignment file.", "No taxa loaded", JOptionPane.ERROR_MESSAGE); return false; } } public boolean validateTraitName(String traitName) { // check that the name is valid if (traitName.trim().length() == 0) { Toolkit.getDefaultToolkit().beep(); return false; } // disallow a trait called 'date' if (traitName.equalsIgnoreCase("date")) { JOptionPane.showMessageDialog(this, "This trait name has a special meaning. Use the 'Tip Date' panel\n" + " to set dates for taxa.", "Reserved trait name", JOptionPane.WARNING_MESSAGE); return false; } if (options.useStarBEAST && traitName.equalsIgnoreCase(TraitData.TRAIT_SPECIES)) { JOptionPane.showMessageDialog(this, "This trait name is already in used to denote species\n" + "for *BEAST. Please select a different name.", "Reserved trait name", JOptionPane.WARNING_MESSAGE); return false; } // check that the trait name doesn't exist if (options.traitExists(traitName)) { int option = JOptionPane.showConfirmDialog(this, "A trait of this name already exists. Do you wish to replace\n" + "it with this new trait? This may result in the loss or change\n" + "in trait values for the taxa.", "Overwrite trait?", JOptionPane.YES_NO_OPTION, JOptionPane.WARNING_MESSAGE); if (option == JOptionPane.NO_OPTION) { return false; } } return true; } /** * Attempts to set up starBEAST - returns true if successful * @param useStarBEAST * @return */ public boolean setupStarBEAST(boolean useStarBEAST) { if (useStarBEAST) { if (!options.traitExists(TraitData.TRAIT_SPECIES)) { if (!traitsPanel.addTrait( "<html><p>" + "StarBEAST requires a trait to give species designations<br>" + "for each taxon. Create or import a discrete trait<br>" + "labelled 'species'.</p></html>", TraitData.TRAIT_SPECIES, true /* isSpeciesTrait */ )) { return false; } } else if (options.getTraitPartitions(options.getTrait(TraitData.TRAIT_SPECIES)).size() > 0) { int option = JOptionPane.showConfirmDialog(this, "The trait named '" + TraitData.TRAIT_SPECIES + "', used to denote species in *BEAST, is\n" + "already in use as a data partition. Do you wish to continue?", "Species trait already in use", JOptionPane.YES_NO_OPTION, JOptionPane.WARNING_MESSAGE); if (option == JOptionPane.NO_OPTION) { return false; } } dataPanel.selectAll(); dataPanel.unlinkAll(); options.starBEASTOptions = new STARBEASTOptions(options); options.fileNameStem = "StarBEASTLog"; tabbedPane.removeTabAt(1); tabbedPane.insertTab("Species Sets", null, speciesSetPanel, null, 1); } else { // remove species options.fileNameStem = MCMCPanel.DEFAULT_FILE_NAME_STEM; tabbedPane.removeTabAt(1); tabbedPane.insertTab("Taxon Sets", null, taxonSetPanel, null, 1); } options.useStarBEAST = useStarBEAST; treesPanel.updatePriorPanelForSpeciesAnalysis(); setStatusMessage(); return true; } public void updateDiscreteTraitAnalysis() { setStatusMessage(); } public void setupEBSP() { dataPanel.selectAll(); dataPanel.unlinkAll(); setAllOptions(); } public PartitionTreePrior getCurrentPartitionTreePrior() { treesPanel.setOptions(options); // need this to refresh the currentTreeModel return treesPanel.currentTreeModel.getPartitionTreePrior(); } public void setStatusMessage() { int width = this.getWidth() - 260; // minus generate button size if (width < 100) width = 100; // prevent too narrow String tw = TextUtil.wrapText(options.statusMessage(), statusLabel, width); // System.out.println(this.getWidth() + " " + tw); statusLabel.setText(tw); } public final boolean doGenerate() { try { generator.checkOptions(); } catch (Generator.GeneratorException ge) { JOptionPane.showMessageDialog(this, ge.getMessage(), "Invalid BEAUti setting : ", JOptionPane.ERROR_MESSAGE); if (ge.getSwitchToPanel() != null) { switchToPanel(ge.getSwitchToPanel()); } return false; } DefaultPriorDialog defaultPriorDialog = new DefaultPriorDialog(this); if (!defaultPriorDialog.showDialog(options)) { return false; } // offer stem as default exportChooser.setSelectedFile(new File(options.fileNameStem + ".xml")); final int returnVal = exportChooser.showSaveDialog(this); if (returnVal == JFileChooser.APPROVE_OPTION) { File file = exportChooser.getSelectedFile(); int n = JOptionPane.YES_OPTION; if (file.exists()) { n = JOptionPane.showConfirmDialog(this, file.getName(), "Overwrite the existing file?", JOptionPane.YES_NO_OPTION); } if (n == JOptionPane.YES_OPTION) { try { getAllOptions(); generator.generateXML(file); } catch (IOException ioe) { JOptionPane.showMessageDialog(this, "Unable to generate file due to I/O issue: " + ioe.getMessage(), "Unable to generate file", JOptionPane.ERROR_MESSAGE); return false; } catch (Generator.GeneratorException e) { JOptionPane.showMessageDialog(this, "The BEAST XML is incomplete because :\n" + e.getMessage(), "The BEAST XML is incomplete", JOptionPane.ERROR_MESSAGE); return false; } catch (Exception e) { JOptionPane.showMessageDialog(this, "Unable to generate file: " + e.getMessage(), "Unable to generate file", JOptionPane.ERROR_MESSAGE); return false; } } else { doGenerate(); } } clearDirty(); return true; } public void switchToPanel(String panelName) { for (int i = 0; i < tabbedPane.getTabCount(); i++) { if (tabbedPane.getTitleAt(i).equals(panelName)) { tabbedPane.setSelectedIndex(i); break; } } } public JComponent getExportableComponent() { JComponent exportable = null; Component comp = tabbedPane.getSelectedComponent(); if (comp instanceof Exportable) { exportable = ((Exportable) comp).getExportableComponent(); } else if (comp instanceof JComponent) { exportable = (JComponent) comp; } return exportable; } // public boolean doSave() { // return doSaveAs(); // } // // public boolean doSaveAs() { // FileDialog dialog = new FileDialog(this, // "Save Template As...", // FileDialog.SAVE); // // dialog.setVisible(true); // if (dialog.getFile() == null) { // // the dialog was cancelled... // return false; // } // // File file = new File(dialog.getDirectory(), dialog.getFile()); // // try { // if (writeToFile(file)) { // // clearDirty(); // } // } catch (IOException ioe) { // JOptionPane.showMessageDialog(this, "Unable to save file: " + ioe, // "Unable to save file", // JOptionPane.ERROR_MESSAGE); // } // // return true; // } // public Action getOpenAction() { // return openTemplateAction; // } // // private final AbstractAction openTemplateAction = new AbstractAction("Apply Template...") { // private static final long serialVersionUID = 2450459627280385426L; // // public void actionPerformed(ActionEvent ae) { // doApplyTemplate(); // } // }; // public Action getSaveAction() { // return saveAsAction; // } // // public Action getSaveAsAction() { // return saveAsAction; // } // // private final AbstractAction saveAsAction = new AbstractAction("Save Template As...") { // private static final long serialVersionUID = 2424923366448459342L; // // public void actionPerformed(ActionEvent ae) { // doSaveAs(); // } // }; public Action getImportAction() { return importAlignmentAction; } protected AbstractAction importAlignmentAction = new AbstractAction("Import Data...") { private static final long serialVersionUID = 3217702096314745005L; public void actionPerformed(java.awt.event.ActionEvent ae) { doImport(); } }; public Action getImportTraitsAction() { return importTraitsAction; } protected AbstractAction importTraitsAction = new AbstractAction("Import Traits") { private static final long serialVersionUID = 3217702096314745005L; public void actionPerformed(java.awt.event.ActionEvent ae) { doImportTraits(); } }; public Action getExportAction() { return generateAction; } protected AbstractAction generateAction = new AbstractAction("Generate BEAST File...", gearIcon) { private static final long serialVersionUID = -5329102618630268783L; public void actionPerformed(java.awt.event.ActionEvent ae) { doGenerate(); } }; }
lgpl-2.1
codice/imaging-nitf
render/src/main/java/org/codice/imaging/nitf/render/ImageMask.java
7602
/* * Copyright (c) Codice Foundation * * This is free software: you can redistribute it and/or modify it under the terms of the GNU Lesser * General Public License as published by the Free Software Foundation, either version 3 of the * License, or any later version. * * This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without * even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Lesser General Public License for more details. A copy of the GNU Lesser General Public License * is distributed along with this program and can be found at * <http://www.gnu.org/licenses/lgpl.html>. * */ package org.codice.imaging.nitf.render; import java.io.IOException; import java.util.ArrayList; import java.util.List; import javax.imageio.stream.ImageInputStream; import org.codice.imaging.nitf.core.image.ImageMode; import org.codice.imaging.nitf.core.image.ImageSegment; import org.slf4j.Logger; import org.slf4j.LoggerFactory; /** * Representation of the image mask. * * In NITF, there are two distinct image mask aspects - the concept that a block * might be missing, and the concept that a pixel value might indicate "no * data". * * Image masking is similar for the block, pixel and row interleve image modes. * Image masking for band-sequential images is handled slightly differently. */ public final class ImageMask { private static final Logger LOGGER = LoggerFactory.getLogger(ImageMask.class); private ImageSegment mImageSegment = null; private int[][] bmrnbndm = null; private final List<Integer> tmrnbndm = new ArrayList<>(); private int tpxcd = -1; private static final int BLOCK_NOT_RECORDED = 0xFFFFFFFF; /** * Create an image mask based on reading from an image segment and associated stream. * * @param imageSegment the image segment * @param imageStream the associated image stream (data) * @throws IOException if image mask parsing fails */ public ImageMask(final ImageSegment imageSegment, final ImageInputStream imageStream) throws IOException { mImageSegment = imageSegment; readImageMask(imageStream); } /** * Create an image mask based on a regular number of bytes per block. * * This is essentially a way to build an image mask for images that don't have one, but where the block layout is * predictable (i.e. there is no compression). * * @param imageSegment the image segment that specifies the image characteristics */ public ImageMask(final ImageSegment imageSegment) { mImageSegment = imageSegment; bmrnbndm = new int[mImageSegment.getNumberOfBlocksPerRow() * mImageSegment.getNumberOfBlocksPerColumn()][mImageSegment.getNumBands()]; int numBandsToRead = 1; if (mImageSegment.getImageMode() == ImageMode.BANDSEQUENTIAL) { numBandsToRead = mImageSegment.getNumBands(); } int bytesPerPixel = (int) mImageSegment.getNumberOfBytesPerBlock(); int blockCounter = 0; for (int m = 0; m < numBandsToRead; ++m) { for (int n = 0; n < mImageSegment.getNumberOfBlocksPerRow() * mImageSegment.getNumberOfBlocksPerColumn(); ++n) { bmrnbndm[n][m] = bytesPerPixel * blockCounter; blockCounter++; } } } private void readImageMask(final ImageInputStream imageInputStream) throws IOException { int imdatoff = imageInputStream.readInt(); int bmrlnth = imageInputStream.readShort(); int tmrlnth = imageInputStream.readShort(); int tpxcdlnth = imageInputStream.readShort(); LOGGER.debug(String.format("Blocked image data offset: 0x%08x", imdatoff)); LOGGER.debug(String.format("Block mask record length: 0x%04x", bmrlnth)); LOGGER.debug(String.format("Pad Pixel Mask Record Length: 0x%04x", tmrlnth)); LOGGER.debug(String.format("Pad Output pixel code length: 0x%04x", tpxcdlnth)); if (tpxcdlnth > 0) { tpxcd = 0; int numBytesToRead = (tpxcdlnth + Byte.SIZE - 1) / Byte.SIZE; LOGGER.debug("Reading TPXCD at length: {}", numBytesToRead); int bandBits = (int) imageInputStream.readBits(numBytesToRead * Byte.SIZE); for (int i = 0; i < mImageSegment.getNumBands(); ++i) { tpxcd |= (bandBits << (Byte.SIZE * i)); } LOGGER.debug(String.format("Pad Output pixel code : 0x%08x", tpxcd)); } int numBandsToRead = 1; if (mImageSegment.getImageMode() == ImageMode.BANDSEQUENTIAL) { numBandsToRead = mImageSegment.getNumBands(); } if (bmrlnth > 0) { bmrnbndm = new int[mImageSegment.getNumberOfBlocksPerRow() * mImageSegment.getNumberOfBlocksPerColumn()][mImageSegment.getNumBands()]; for (int m = 0; m < numBandsToRead; ++m) { for (int n = 0; n < mImageSegment.getNumberOfBlocksPerRow() * mImageSegment.getNumberOfBlocksPerColumn(); ++n) { bmrnbndm[n][m] = imageInputStream.readInt(); LOGGER.debug(String.format("mask blocks (band %d) %d: 0x%08x", m, n, bmrnbndm[n][m])); } } } if (tmrlnth > 0) { for (int m = 0; m < numBandsToRead; ++m) { for (int n = 0; n < mImageSegment.getNumberOfBlocksPerRow() * mImageSegment.getNumberOfBlocksPerColumn(); ++n) { int val = imageInputStream.readInt(); tmrnbndm.add(val); LOGGER.debug(String.format("mask pixel (band %d) %d: 0x%08x", m, n, val)); } } } } /** * Test if the specified block is not actually recorded in the file. * * This is always false if the image compression is not a masked variant. * * Image blocks are counted in row-major, column-minor order (e.g. if you * have three blocks across, and two blocks down, the block numbers are 0, * 1, 2 for the first row, and then 3, 4, 5 for the second row). * * @param blockNumber the block number to check for masking. * @param bandNumber the band to check for masking (only used for Band * Sequential). * @return true if the block is masked (not recorded in the file), otherwise * false. */ public boolean isMaskedBlock(final int blockNumber, final int bandNumber) { if (bmrnbndm == null) { return false; } if (blockNumber >= bmrnbndm.length || bandNumber >= bmrnbndm[blockNumber].length) { return false; } return (BLOCK_NOT_RECORDED == bmrnbndm[blockNumber][bandNumber]); } /** * Test if the specified pixel value indicates "no data". * * Pad pixels are typically rendered transparent, and should not be included * in image calculations (e.g. statistics, averaging, exploitation). * * @param value the pixel value to test. * @return true if this is a pad ("no data") pixel value, otherwise false. */ public boolean isPadPixel(final int value) { if (tpxcd == -1) { return false; } return (tpxcd == value); } /** * Check whether this image mask has valid per-pixel masking. * * If this is false, isPadPixel() will always return false. * * @return true if there is valid per-pixel masking, otherwise false */ public boolean hasPixelMasks() { return (tpxcd != -1); } }
lgpl-2.1
cacheonix/cacheonix-core
3rdparty/hibernate-3.2/test/org/hibernate/test/propertyref/inheritence/joined/Person.java
767
//$Id: Person.java 10921 2006-12-05 14:39:12Z steve.ebersole@jboss.com $ package org.hibernate.test.propertyref.inheritence.joined; /** * @author gavin */ public class Person { private Long id; private String name; private BankAccount bankAccount; /** * @return Returns the id. */ public Long getId() { return id; } /** * @param id The id to set. */ public void setId(Long id) { this.id = id; } /** * @return Returns the name. */ public String getName() { return name; } /** * @param name The name to set. */ public void setName(String name) { this.name = name; } public BankAccount getBankAccount() { return bankAccount; } public void setBankAccount(BankAccount bankAccount) { this.bankAccount = bankAccount; } }
lgpl-2.1
hal/core
gui/src/main/java/org/jboss/as/console/client/shared/subsys/jca/NewManagerWizard.java
2974
package org.jboss.as.console.client.shared.subsys.jca; import com.google.gwt.event.dom.client.ClickEvent; import com.google.gwt.event.dom.client.ClickHandler; import com.google.gwt.user.client.ui.VerticalPanel; import com.google.gwt.user.client.ui.Widget; import org.jboss.as.console.client.Console; import org.jboss.as.console.client.shared.help.FormHelpPanel; import org.jboss.as.console.client.shared.subsys.Baseadress; import org.jboss.as.console.client.shared.subsys.jca.model.JcaWorkmanager; import org.jboss.ballroom.client.widgets.forms.Form; import org.jboss.ballroom.client.widgets.forms.FormValidation; import org.jboss.ballroom.client.widgets.forms.TextBoxItem; import org.jboss.ballroom.client.widgets.window.DialogueOptions; import org.jboss.ballroom.client.widgets.window.WindowContentBuilder; import org.jboss.dmr.client.ModelNode; /** * @author Heiko Braun * @date 12/1/11 */ public class NewManagerWizard { private JcaPresenter presenter; public NewManagerWizard(JcaPresenter jcaPresenter) { this.presenter = jcaPresenter; } Widget asWidget() { VerticalPanel layout = new VerticalPanel(); layout.setStyleName("window-content"); final Form<JcaWorkmanager> form = new Form(JcaWorkmanager.class); TextBoxItem nameField = new TextBoxItem("name", Console.CONSTANTS.common_label_name()); form.setFields(nameField); DialogueOptions options = new DialogueOptions( // save new ClickHandler() { @Override public void onClick(ClickEvent event) { JcaWorkmanager manager = form.getUpdatedEntity(); FormValidation validation = form.validate(); if(validation.hasErrors()) return; presenter.createNewManager(manager); } }, // cancel new ClickHandler() { @Override public void onClick(ClickEvent event) { presenter.closeDialoge(); } } ); // ---------------------------------------- Widget formWidget = form.asWidget(); final FormHelpPanel helpPanel = new FormHelpPanel( new FormHelpPanel.AddressCallback() { @Override public ModelNode getAddress() { ModelNode address = new ModelNode(); address.set(Baseadress.get()); address.add("subsystem", "jca"); address.add("workmanager", "*"); return address; } }, form ); layout.add(helpPanel.asWidget()); layout.add(formWidget); return new WindowContentBuilder(layout, options).build(); } }
lgpl-2.1
1fechner/FeatureExtractor
sources/FeatureExtractor/lib/hibernate-release-5.1.0.Final/project/hibernate-envers/src/test/java/org/hibernate/envers/test/entities/collection/StringListEntity.java
1575
/* * Hibernate, Relational Persistence for Idiomatic Java * * License: GNU Lesser General Public License (LGPL), version 2.1 or later. * See the lgpl.txt file in the root directory or <http://www.gnu.org/licenses/lgpl-2.1.html>. */ package org.hibernate.envers.test.entities.collection; import java.util.ArrayList; import java.util.List; import javax.persistence.ElementCollection; import javax.persistence.Entity; import javax.persistence.GeneratedValue; import javax.persistence.Id; import org.hibernate.annotations.IndexColumn; import org.hibernate.envers.Audited; /** * @author Adam Warski (adam at warski dot org) */ @Entity public class StringListEntity { @Id @GeneratedValue private Integer id; @Audited @ElementCollection @IndexColumn(name = "list_index") private List<String> strings; public StringListEntity() { strings = new ArrayList<String>(); } public Integer getId() { return id; } public void setId(Integer id) { this.id = id; } public List<String> getStrings() { return strings; } public void setStrings(List<String> strings) { this.strings = strings; } public boolean equals(Object o) { if ( this == o ) { return true; } if ( !(o instanceof StringListEntity) ) { return false; } StringListEntity that = (StringListEntity) o; if ( id != null ? !id.equals( that.id ) : that.id != null ) { return false; } return true; } public int hashCode() { return (id != null ? id.hashCode() : 0); } public String toString() { return "SLE(id = " + id + ", strings = " + strings + ")"; } }
lgpl-2.1
cytoscape/cytoscape-impl
core-task-impl/src/main/java/org/cytoscape/task/internal/utils/CoreImplDocumentationConstants.java
2501
package org.cytoscape.task.internal.utils; public final class CoreImplDocumentationConstants { /** * See org.cytoscape.task.internal.table.AbstractTableDataTask.getNamespace(String) */ public static final String COLUMN_NAMESPACE_LONG_DESCRIPTION = "Node, Edge, and Network objects support the ```default```, ```local```, and ```hidden``` namespaces. Root networks also support the ```shared``` namespace. Custom namespaces may be specified by Apps."; public static final String COLUMN_NAMESPACE_EXAMPLE_STRING = "default"; /** * See * * org.cytoscape.task.internal.utils.ColumnListTunable.getColumnList(CyTable) * org.cytoscape.task.internal.utils.ColumnValueTunable.getColumnList(CyTable) * */ public static final String COLUMN_LIST_LONG_DESCRIPTION = "A list of column names, separated by commas."; public static final String COLUMN_LIST_EXAMPLE_STRING ="name,Column B"; /** * See org.cytoscape.task.internal.networkobjects.AbstractGetTask#getNode(CyNetwork, String) */ public static final String NODE_LONG_DESCRIPTION = "Selects a node by name, or, if the parameter has the prefix ```suid:```, selects a node by SUID."; /** * See org.cytoscape.task.internal.networkobjects.AbstractGetTask#getEdge(CyNetwork, String) */ public static final String EDGE_LONG_DESCRIPTION = "Selects an edge by name, or, if the parameter has the prefix ```suid:```, selects an edge by SUID."; /** * See org.cytoscape.task.internal.utils.DataUtils.getCSV(String) */ public static final String VALUE_LIST_LONG_DESCRIPTION = "A list of values separated by commas."; /** * See * * org.cytoscape.task.internal.networkobjects.GetEdgePropertiesTask.run(TaskMonitor) * org.cytoscape.task.internal.networkobjects.GetNetworkPropertiesTask.run(TaskMonitor) * org.cytoscape.task.internal.networkobjects.GetNodePropertiesTask.run(TaskMonitor) * org.cytoscape.task.internal.networkobjects.SetEdgePropertiesTask.run(TaskMonitor) * org.cytoscape.task.internal.networkobjects.SetNetworkPropertiesTask.run(TaskMonitor) * org.cytoscape.task.internal.networkobjects.SetNodePropertiesTask.run(TaskMonitor) */ public static final String PROPERTY_LIST_LONG_DESCRIPTION = "A list of property names separated by commas. Refer to the 'list properties' command avalable for node, edge and network namespaces."; /** * Renaming is the equivalent of a set/PUT, and doesn't need to return anything. */ public static final String RENAME_EXAMPLE_JSON = "{}"; }
lgpl-2.1
fjalvingh/domui
to.etc.domui/src/main/java/to/etc/domui/subinjector/ISubPageInjector.java
360
package to.etc.domui.subinjector; import org.eclipse.jdt.annotation.NonNull; import to.etc.domui.dom.html.SubPage; /** * A single thingy doing some injection task in a SubPage. * * @author <a href="mailto:jal@etc.to">Frits Jalvingh</a> * Created on 4-12-18. */ public interface ISubPageInjector { void inject(@NonNull SubPage page) throws Exception; }
lgpl-2.1
plast-lab/soot
src/main/java/soot/jimple/toolkits/pointer/nativemethods/NativeMethodClass.java
1885
package soot.jimple.toolkits.pointer.nativemethods; /*- * #%L * Soot - a J*va Optimization Framework * %% * Copyright (C) 2003 Feng Qian * %% * This program is free software: you can redistribute it and/or modify * it under the terms of the GNU Lesser General Public License as * published by the Free Software Foundation, either version 2.1 of the * License, or (at your option) any later version. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU General Lesser Public License for more details. * * You should have received a copy of the GNU General Lesser Public * License along with this program. If not, see * <http://www.gnu.org/licenses/lgpl-2.1.html>. * #L% */ import org.slf4j.Logger; import org.slf4j.LoggerFactory; import soot.SootMethod; import soot.jimple.toolkits.pointer.representations.ReferenceVariable; import soot.jimple.toolkits.pointer.util.NativeHelper; public abstract class NativeMethodClass { private static final Logger logger = LoggerFactory.getLogger(NativeMethodClass.class); private static final boolean DEBUG = false; protected NativeHelper helper; public NativeMethodClass(NativeHelper helper) { this.helper = helper; } /* * If a native method has no side effect, call this method. Currently, it does nothing. */ public static void defaultMethod(SootMethod method, ReferenceVariable thisVar, ReferenceVariable returnVar, ReferenceVariable params[]) { if (DEBUG) { logger.debug("No side effects : " + method.toString()); } } /* To be implemented by individual classes */ public abstract void simulateMethod(SootMethod method, ReferenceVariable thisVar, ReferenceVariable returnVar, ReferenceVariable params[]); }
lgpl-2.1
kluver/lenskit
lenskit-svd/src/main/java/org/lenskit/mf/BPR/TrainingPairGenerator.java
1524
/* * LensKit, an open source recommender systems toolkit. * Copyright 2010-2016 LensKit Contributors. See CONTRIBUTORS.md. * Work on LensKit has been funded by the National Science Foundation under * grants IIS 05-34939, 08-08692, 08-12148, and 10-17697. * * This program is free software; you can redistribute it and/or modify * it under the terms of the GNU Lesser General Public License as * published by the Free Software Foundation; either version 2.1 of the * License, or (at your option) any later version. * * This program is distributed in the hope that it will be useful, but WITHOUT * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS * FOR A PARTICULAR PURPOSE. See the GNU General Public License for more * details. * * You should have received a copy of the GNU General Public License along with * this program; if not, write to the Free Software Foundation, Inc., 51 * Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA. */ package org.lenskit.mf.BPR; /** * Class that operates over training events and generates batches of training * pairs (defined as a user and a pair of items where the user has expressed * a preference for one item over another. * * This interface makes no constraints over the properties of the training * batches. */ public interface TrainingPairGenerator { /** * @return something that can be iterated over to get the next batch of training pairs. */ Iterable<? extends TrainingItemPair> nextBatch(); }
lgpl-2.1
mbatchelor/pentaho-reporting
libraries/libformula/src/main/java/org/pentaho/reporting/libraries/formula/function/information/NaFunction.java
1986
/* * This program is free software; you can redistribute it and/or modify it under the * terms of the GNU Lesser General Public License, version 2.1 as published by the Free Software * Foundation. * * You should have received a copy of the GNU Lesser General Public License along with this * program; if not, you can obtain a copy at http://www.gnu.org/licenses/old-licenses/lgpl-2.1.html * or from the Free Software Foundation, Inc., * 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA. * * This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; * without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. * See the GNU Lesser General Public License for more details. * * Copyright (c) 2006 - 2017 Hitachi Vantara and Contributors. All rights reserved. */ package org.pentaho.reporting.libraries.formula.function.information; import org.pentaho.reporting.libraries.formula.EvaluationException; import org.pentaho.reporting.libraries.formula.FormulaContext; import org.pentaho.reporting.libraries.formula.LibFormulaErrorValue; import org.pentaho.reporting.libraries.formula.function.Function; import org.pentaho.reporting.libraries.formula.function.ParameterCallback; import org.pentaho.reporting.libraries.formula.lvalues.TypeValuePair; /** * This function class represents the constant error NA. * * @author Cedric Pronzato */ public class NaFunction implements Function { private static final long serialVersionUID = 3433794709691209411L; public NaFunction() { } public TypeValuePair evaluate( final FormulaContext context, final ParameterCallback parameters ) throws EvaluationException { if ( parameters.getParameterCount() != 0 ) { throw EvaluationException.getInstance( LibFormulaErrorValue.ERROR_ARGUMENTS_VALUE ); } throw EvaluationException.getInstance( LibFormulaErrorValue.ERROR_NA_VALUE ); } public String getCanonicalName() { return "NA"; } }
lgpl-2.1
kumar-physics/BioJava
biojava3-alignment/src/test/java/org/biojava3/alignment/TestDNAAlignment.java
4385
/** * BioJava development code * * This code may be freely distributed and modified under the terms of the GNU * Lesser General Public Licence. This should be distributed with the code. If * you do not have a copy, see: * * http://www.gnu.org/copyleft/lesser.html * * Copyright for this code is held jointly by the individual * authors. These should be listed in @author doc comments. * * For more information on the BioJava project and its aims, * or to join the biojava-l mailing list, visit the home page * at: * * http://www.biojava.org/ * * Created on Oct 5, 2011 * Created by Andreas Prlic * * @since 3.0.2 */ package org.biojava3.alignment; import java.io.InputStream; import java.util.ArrayList; import java.util.LinkedHashMap; import java.util.List; import junit.framework.TestCase; import org.biojava3.alignment.Alignments.PairwiseSequenceAlignerType; import org.biojava3.alignment.template.Profile; import org.biojava3.alignment.template.SequencePair; import org.biojava3.alignment.template.SubstitutionMatrix; import org.biojava3.core.sequence.DNASequence; import org.biojava3.core.sequence.compound.AmbiguityDNACompoundSet; import org.biojava3.core.sequence.compound.DNACompoundSet; import org.biojava3.core.sequence.compound.NucleotideCompound; import org.biojava3.core.sequence.io.FastaReaderHelper; import org.biojava3.core.util.ConcurrencyTools; public class TestDNAAlignment extends TestCase { public void testDNAAlignment() { try { List<DNASequence> lst = getDNAFASTAFile(); Profile<DNASequence, NucleotideCompound> profile = Alignments.getMultipleSequenceAlignment(lst); assertTrue(profile.getSize() == 10); assertTrue(profile.getAlignedSequence(1).getSequenceAsString().length() > 50); // here how to print the MSA: //System.out.printf("MSA:%n%s%n", profile); } catch (Exception e) { e.printStackTrace(); fail(e.getMessage()); } ConcurrencyTools.shutdown(); } private static List<DNASequence> getDNAFASTAFile() throws Exception { InputStream inStream = TestDNAAlignment.class.getResourceAsStream(String.format("/dna-fasta.txt")); LinkedHashMap<String, DNASequence> fastas = FastaReaderHelper.readFastaDNASequence(inStream); List<DNASequence> sequences = new ArrayList<DNASequence>(); for (String key : fastas.keySet()) { DNASequence seq = fastas.get(key); sequences.add(seq); } return sequences; } /** * @author brandstaetter */ public void testDNAMultipleAlignmentWithMixedCompoundSets() { DNASequence target = new DNASequence("ACTGACGTGTAGCTGACTGA", DNACompoundSet.getDNACompoundSet()); DNASequence query = new DNASequence("ACTGACGTGTAGCTGACTGTA", AmbiguityDNACompoundSet.getDNACompoundSet()); List<DNASequence> lst = new ArrayList<DNASequence>(); lst.add(target); lst.add(query); try { @SuppressWarnings("unused") Profile<DNASequence, NucleotideCompound> profile = Alignments.getMultipleSequenceAlignment(lst); fail("Alignments.getMultipleSequenceAlignment(lst) expected exception with differing compound sets"); } catch (IllegalArgumentException ex) { // expected exception } } /** * @author brandstaetter */ public void testDNAPairwiseAlignmentWithMixedCompoundSets() { DNASequence target = new DNASequence("ACTGACGTGTAGCTGACTGA", DNACompoundSet.getDNACompoundSet()); DNASequence query = new DNASequence("ACTGACGTGTAGCTGACTGT", AmbiguityDNACompoundSet.getDNACompoundSet()); SubstitutionMatrix<NucleotideCompound> matrix = SubstitutionMatrixHelper.getNuc4_4(); SimpleGapPenalty gapP = new SimpleGapPenalty(); gapP.setOpenPenalty((short) 5); gapP.setExtensionPenalty((short) 2); try { @SuppressWarnings("unused") SequencePair<DNASequence, NucleotideCompound> psa = Alignments.getPairwiseAlignment(query, target, PairwiseSequenceAlignerType.LOCAL, gapP, matrix); fail("Alignments.getPairwiseAlignment() expected exception with differing compound sets"); } catch (IllegalArgumentException ex) { // expected exception } } }
lgpl-2.1
pquiring/jfcraft
src/base/jfcraft/entity/EnderChest.java
3225
package jfcraft.entity; /** Ender Chest entity * * @author pquiring */ import javaforce.gl.*; import static javaforce.gl.GL.*; import jfcraft.data.*; import jfcraft.item.*; import jfcraft.opengl.*; public class EnderChest extends BlockEntity { public float lidAngle; public RenderDest dest; //can not be static since chest can be damaged public static Model model; //render assets private static TextureMap texture; protected static String textureName; public EnderChest() { id = Entities.ENDER_CHEST; } public String getName() { return "ENDER_CHEST"; } public RenderDest getDest() { return dest; } public void init(World world) { super.init(world); dest = new RenderDest(parts.length); isBlock = true; } public void initStatic() { super.initStatic(); textureName = "entity/chest/ender"; model = loadModel("chest"); } public void initStaticGL() { super.initStaticGL(); texture = Textures.getTexture(textureName, 0); } public void initInstance() { super.initInstance(); } private static String parts[] = {"CONTAINER", "LID", "LATCH"}; public void buildBuffers(RenderDest dest, RenderData data) { dest.resetAll(); //transfer data into dest for(int a=0;a<parts.length;a++) { RenderBuffers buf = dest.getBuffers(a); Object3 obj = model.getObject(parts[a]); buf.addVertex(obj.vpl.toArray()); buf.addPoly(obj.vil.toArray()); int cnt = obj.vpl.size(); for(int b=0;b<cnt;b++) { buf.addDefault(); } if (obj.maps.size() == 1) { //latch doesn't crack UVMap map = obj.getUVMap("normal"); buf.addTextureCoords(map.uvl.toArray()); } else { //container & lid UVMap map1 = obj.getUVMap("normal"); float uv1[] = map1.uvl.toArray(); if (data.crack == -1) { buf.addTextureCoords(uv1); } else { UVMap map2 = obj.getUVMap("crack"); float uv2[] = map2.uvl.toArray(); buf.adjustCrack(uv2, data.crack); buf.addTextureCoords(uv1, uv2); } } buf.org = obj.org; buf.type = obj.type; } } public void bindTexture() { texture.bind(); } public void copyBuffers() { dest.copyBuffers(); } public void setMatrixModel(int bodyPart, RenderBuffers buf) { mat.setIdentity(); mat.addRotate(-ang.y, 0, 1, 0); switch (bodyPart) { case 0: //container break; case 1: //lid case 2: //lock mat.addTranslate2(buf.org.x, buf.org.y, buf.org.z); mat.addRotate2(lidAngle, 1, 0, 0); mat.addTranslate2(-buf.org.x, -buf.org.y, -buf.org.z); break; } mat.addTranslate(pos.x, pos.y, pos.z); if (scale != 1.0f) { mat.addScale(scale, scale, scale); } glUniformMatrix4fv(Static.uniformMatrixModel, 1, GL_FALSE, mat.m); //model matrix } public void render() { for(int a=0;a<dest.count();a++) { RenderBuffers buf = dest.getBuffers(a); setMatrixModel(a, buf); buf.bindBuffers(); buf.render(); } glUniformMatrix4fv(Static.uniformMatrixModel, 1, GL_FALSE, Static.identity.m); //model matrix } }
lgpl-2.1
geotools/geotools
modules/unsupported/swt/src/main/java/org/geotools/swt/tool/AbstractZoomTool.java
2295
/* * GeoTools - The Open Source Java GIS Toolkit * http://geotools.org * * (C) 2002-2008, Open Source Geospatial Foundation (OSGeo) * * This library is free software; you can redistribute it and/or * modify it under the terms of the GNU Lesser General Public * License as published by the Free Software Foundation; * version 2.1 of the License. * * This library is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Lesser General Public License for more details. */ package org.geotools.swt.tool; import org.eclipse.swt.SWT; /** * Abstract base class for the zoom-in and zoom-out tools. Provides getter / setter methods for the * zoom increment. * * @author Michael Bedward * @since 2.6 */ public abstract class AbstractZoomTool extends CursorTool { /** The default zoom increment */ public static final double DEFAULT_ZOOM_FACTOR = 1.5; /** The working zoom increment */ protected double zoom; /** * Constructs a new abstract zoom tool. To activate the tool only on certain mouse events * provide a single mask, e.g. {@link SWT#BUTTON1}, or a combination of multiple SWT-masks. * * @param triggerButtonMask Mouse button which triggers the tool's activation or {@value * #ANY_BUTTON} if the tool is to be triggered by any button */ public AbstractZoomTool(int triggerButtonMask) { super(triggerButtonMask); setZoom(DEFAULT_ZOOM_FACTOR); } /** Constructs a new abstract zoom tool which is triggered by any mouse button. */ public AbstractZoomTool() { this(CursorTool.ANY_BUTTON); } /** * Get the current areal zoom increment. * * @return the current zoom increment as a double */ public double getZoom() { return zoom; } /** * Set the zoom increment * * @param newZoom the new zoom increment; values &lt;= 1.0 will be ignored * @return the previous zoom increment */ public double setZoom(double newZoom) { double old = zoom; if (newZoom > 1.0d) { zoom = newZoom; } return old; } }
lgpl-2.1
VitosPchela/xpst
xPSTLib/src/org/clearsighted/tutorbase/emscript/exprtree/CondNode.java
1454
/* Copyright (c) Clearsighted 2006-08 stephen@clearsighted.net This library is free software; you can redistribute it and/or modify it under the terms of the GNU Lesser General Public License as published by the Free Software Foundation; either version 2.1 of the License, or (at your option) any later version. This library is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU Lesser General Public License for more details. You should have received a copy of the GNU Lesser General Public License along with this library; if not, write to the Free Software Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA */ package org.clearsighted.tutorbase.emscript.exprtree; import java.util.HashMap; import org.clearsighted.tutorengine.GoalNode; import org.clearsighted.tutorengine.types.Operations; import org.clearsighted.tutorengine.types.Operations.Op; public class CondNode extends ExprNode { private Op type; public CondNode(Op type, ExprNode l, ExprNode r) { this.type = type; this.leftChild = l; this.rightChild = r; } @Override public Object eval(ExprEnv ee,HashMap<String, GoalNode> gns) throws ExprException { Object lev = leftChild.eval(ee,gns), rev = rightChild.eval(ee,gns); return Operations.doOp(type, lev, rev,gns); } }
lgpl-2.1
amikryukov/jagger
webclient/src/main/java/com/griddynamics/jagger/webclient/client/trends/Trends.java
53305
package com.griddynamics.jagger.webclient.client.trends; import ca.nanometrics.gflot.client.*; import ca.nanometrics.gflot.client.options.*; import ca.nanometrics.gflot.client.options.Range; import com.google.gwt.cell.client.CheckboxCell; import com.google.gwt.core.client.GWT; import com.google.gwt.core.client.Scheduler; import com.google.gwt.dom.client.Style; import com.google.gwt.event.dom.client.*; import com.google.gwt.event.logical.shared.SelectionEvent; import com.google.gwt.event.logical.shared.SelectionHandler; import com.google.gwt.event.logical.shared.ValueChangeEvent; import com.google.gwt.event.logical.shared.ValueChangeHandler; import com.google.gwt.http.client.URL; import com.google.gwt.i18n.client.DateTimeFormat; import com.google.gwt.resources.client.ImageResource; import com.google.gwt.safehtml.shared.SafeHtmlUtils; import com.google.gwt.uibinder.client.UiBinder; import com.google.gwt.uibinder.client.UiField; import com.google.gwt.uibinder.client.UiHandler; import com.google.gwt.user.cellview.client.*; import com.google.gwt.user.client.History; import com.google.gwt.user.client.Timer; import com.google.gwt.user.client.Window; import com.google.gwt.user.client.rpc.AsyncCallback; import com.google.gwt.user.client.ui.*; import com.google.gwt.user.datepicker.client.DateBox; import com.google.gwt.view.client.*; import com.griddynamics.jagger.webclient.client.*; import com.griddynamics.jagger.webclient.client.components.MetricPanel; import com.griddynamics.jagger.webclient.client.components.SessionPlotPanel; import com.griddynamics.jagger.webclient.client.components.SummaryPanel; import com.griddynamics.jagger.webclient.client.data.*; import com.griddynamics.jagger.webclient.client.dto.*; import com.griddynamics.jagger.webclient.client.handler.ShowCurrentValueHoverListener; import com.griddynamics.jagger.webclient.client.handler.ShowTaskDetailsListener; import com.griddynamics.jagger.webclient.client.mvp.JaggerPlaceHistoryMapper; import com.griddynamics.jagger.webclient.client.mvp.NameTokens; import com.griddynamics.jagger.webclient.client.resources.JaggerResources; import com.smartgwt.client.data.RecordList; import com.smartgwt.client.widgets.grid.ListGrid; import com.smartgwt.client.widgets.grid.ListGridRecord; import java.util.*; /** * @author "Artem Kirillov" (akirillov@griddynamics.com) * @since 5/28/12 */ public class Trends extends DefaultActivity { interface TrendsUiBinder extends UiBinder<Widget, Trends> { } private static TrendsUiBinder uiBinder = GWT.create(TrendsUiBinder.class); private static final int MAX_PLOT_COUNT = 30; @UiField TabLayoutPanel mainTabPanel; @UiField HTMLPanel plotPanel; @UiField(provided = true) DataGrid<SessionDataDto> sessionsDataGrid; @UiField(provided = true) CellTable<TaskDataDto> testDataGrid; @UiField(provided = true) SimplePager sessionsPager; @UiField(provided = true) CellTree taskDetailsTree; @UiField MetricPanel metricPanel; @UiField ScrollPanel scrollPanelTrends; @UiField ScrollPanel scrollPanelMetrics; @UiField HTMLPanel plotTrendsPanel; @UiField SummaryPanel summaryPanel; @UiField VerticalPanel sessionScopePlotList; SessionPlotPanel sessionPlotPanel; @UiField TextBox sessionIdsTextBox; private Timer stopTypingSessionIdsTimer; @UiField DateBox sessionsFrom; @UiField DateBox sessionsTo; @UiField Panel trendsDetails; @UiField SplitLayoutPanel settingsPanel; @UiField DeckPanel testsMetricsPanel; @UiHandler("uncheckSessionsButton") void handleUncheckSessionsButtonClick(ClickEvent e) { MultiSelectionModel model = (MultiSelectionModel<?>) sessionsDataGrid.getSelectionModel(); model.clear(); } @UiHandler("showCheckedSessionsButton") void handleShowCheckedSessionsButtonClick(ClickEvent e) { Set<SessionDataDto> sessionDataDtoSet = ((MultiSelectionModel<SessionDataDto>) sessionsDataGrid.getSelectionModel()).getSelectedSet(); filterSessions(sessionDataDtoSet); } @UiHandler("clearSessionFiltersButton") void handleClearSessionFiltersButtonClick(ClickEvent e) { sessionsTo.setValue(null, true); sessionsFrom.setValue(null, true); sessionIdsTextBox.setText(null); stopTypingSessionIdsTimer.schedule(10); } @UiHandler("getHyperlink") void getHyperlink(ClickEvent event){ MultiSelectionModel<SessionDataDto> sessionModel = (MultiSelectionModel)sessionsDataGrid.getSelectionModel(); MultiSelectionModel<TaskDataDto> testModel = (MultiSelectionModel)testDataGrid.getSelectionModel(); Set<SessionDataDto> sessions = sessionModel.getSelectedSet(); Set<TaskDataDto> tests = testModel.getSelectedSet(); Set<MetricNameDto> metrics = metricPanel.getSelected(); TaskDataTreeViewModel taskDataTreeViewModel = (TaskDataTreeViewModel) taskDetailsTree.getTreeViewModel(); Set<PlotNameDto> trends = taskDataTreeViewModel.getSelectionModel().getSelectedSet(); HashSet<String> sessionsIds = new HashSet<String>(); HashSet<TestsMetrics> testsMetricses = new HashSet<TestsMetrics>(tests.size()); HashMap<String, TestsMetrics> map = new HashMap<String, TestsMetrics>(tests.size()); for (SessionDataDto session : sessions){ sessionsIds.add(session.getSessionId()); } for (TaskDataDto taskDataDto : tests){ TestsMetrics testsMetrics = new TestsMetrics(taskDataDto.getTaskName(), new HashSet<String>(), new HashSet<String>()); testsMetricses.add(testsMetrics); map.put(taskDataDto.getTaskName(), testsMetrics); } for (MetricNameDto metricNameDto : metrics){ map.get(metricNameDto.getTests().getTaskName()).getMetrics().add(metricNameDto.getName()); } for (PlotNameDto plotNameDto : trends){ map.get(plotNameDto.getTest().getTaskName()).getTrends().add(plotNameDto.getPlotName()); } TrendsPlace newPlace = new TrendsPlace( mainTabPanel.getSelectedIndex() == 0 ? NameTokens.SUMMARY : mainTabPanel.getSelectedIndex() == 1 ? NameTokens.TRENDS : NameTokens.METRICS ); newPlace.setSelectedSessionIds(sessionsIds); newPlace.setSelectedTestsMetrics(testsMetricses); newPlace.setSessionTrends(sessionPlotPanel.getSelected()); String linkText = Window.Location.getHost()+Window.Location.getQueryString()+"/#"+new JaggerPlaceHistoryMapper().getToken(newPlace); linkText = URL.encode(linkText); //create a dialog for copy link final DialogBox dialog = new DialogBox(false, true); dialog.setText("Share link"); dialog.setModal(true); dialog.setAutoHideEnabled(true); dialog.setPopupPosition(event.getClientX(), event.getClientY()); final TextArea textArea = new TextArea(); textArea.setText(linkText); textArea.setWidth("300px"); textArea.setHeight("40px"); //select text Scheduler.get().scheduleDeferred(new Scheduler.ScheduledCommand() { @Override public void execute() { textArea.setVisible(true); textArea.setFocus(true); textArea.selectAll(); } }); dialog.add(textArea); dialog.show(); } private final Map<String, Set<MarkingDto>> markingsMap = new HashMap<String, Set<MarkingDto>>(); private FlowPanel loadIndicator; private final SessionDataAsyncDataProvider sessionDataProvider = new SessionDataAsyncDataProvider(); private final SessionDataForSessionIdsAsyncProvider sessionDataForSessionIdsAsyncProvider = new SessionDataForSessionIdsAsyncProvider(); private final SessionDataForDatePeriodAsyncProvider sessionDataForDatePeriodAsyncProvider = new SessionDataForDatePeriodAsyncProvider(); @UiField Widget widget; public Trends(JaggerResources resources) { super(resources); createWidget(); } private TrendsPlace place; private boolean selectTests = false; // cash for chosen metric spike for jfg-418 MetricFullData chosenMetrics = new MetricFullData(); //tells if trends plot should be redraw private boolean hasChanged = false; public void updatePlace(TrendsPlace place){ if (this.place != null) return; this.place = place; final TrendsPlace finalPlace = this.place; if (place.getSelectedSessionIds().isEmpty()){ sessionsDataGrid.getSelectionModel().addSelectionChangeHandler(new SessionSelectChangeHandler()); selectTests = true; testDataGrid.getSelectionModel().addSelectionChangeHandler(new TestSelectChangeHandler()); TaskDataTreeViewModel viewModel = (TaskDataTreeViewModel)taskDetailsTree.getTreeViewModel(); viewModel.getSelectionModel().addSelectionChangeHandler(new TaskPlotSelectionChangedHandler()); metricPanel.addSelectionListener(new MetricsSelectionChangedHandler()); chooseTab(place.getToken()); return; } SessionDataService.Async.getInstance().getBySessionIds(0, place.getSelectedSessionIds().size(), place.getSelectedSessionIds(), new AsyncCallback<PagedSessionDataDto>() { @Override public void onFailure(Throwable caught) { caught.printStackTrace(); } @Override public void onSuccess(PagedSessionDataDto result) { for (SessionDataDto session : result.getSessionDataDtoList()){ sessionsDataGrid.getSelectionModel().setSelected(session, true); } sessionsDataGrid.getSelectionModel().addSelectionChangeHandler(new SessionSelectChangeHandler()); sessionsDataGrid.getSelectionModel().setSelected(result.getSessionDataDtoList().iterator().next(), true); chooseTab(finalPlace.getToken()); } }); History.newItem(NameTokens.EMPTY); } private void filterSessions(Set<SessionDataDto> sessionDataDtoSet) { if (sessionDataDtoSet == null || sessionDataDtoSet.isEmpty()) { sessionIdsTextBox.setText(null); stopTypingSessionIdsTimer.schedule(10); return; } final StringBuilder builder = new StringBuilder(); boolean first = true; for (SessionDataDto sessionDataDto : sessionDataDtoSet) { if (!first) { builder.append("/"); } builder.append(sessionDataDto.getSessionId()); first = false; } sessionIdsTextBox.setText(builder.toString()); stopTypingSessionIdsTimer.schedule(10); } @Override protected Widget initializeWidget() { return widget; } private void createWidget() { setupTestDataGrid(); setupSessionDataGrid(); setupTestDetailsTree(); setupPager(); setupLoadIndicator(); uiBinder.createAndBindUi(this); setupTabPanel(); setupSessionNumberTextBox(); setupSessionsDateRange(); setupSettingsPanel(); } /** * Field to hold number of sessions that were chosen. * spike for rendering metrics plots */ private ArrayList<Long> chosenSessions = new ArrayList<Long>(); private SimplePlot createPlot(final String id, Markings markings, String xAxisLabel, double yMinimum, boolean isMetric) { PlotOptions plotOptions = new PlotOptions(); plotOptions.setZoomOptions(new ZoomOptions().setAmount(1.02)); plotOptions.setGlobalSeriesOptions(new GlobalSeriesOptions() .setLineSeriesOptions(new LineSeriesOptions().setLineWidth(1).setShow(true).setFill(0.1)) .setPointsOptions(new PointsSeriesOptions().setRadius(1).setShow(true)).setShadowSize(0d)); plotOptions.setPanOptions(new PanOptions().setInteractive(true)); if (isMetric) { plotOptions.addXAxisOptions(new AxisOptions().setZoomRange(true).setTickDecimals(0) .setTickFormatter(new TickFormatter() { @Override public String formatTickValue(double tickValue, Axis axis) { if (tickValue >= 0 && tickValue < chosenSessions.size()) return String.valueOf(chosenSessions.get((int) tickValue)); else return ""; } })); } else { plotOptions.addXAxisOptions(new AxisOptions().setZoomRange(true).setMinimum(0)); } plotOptions.addYAxisOptions(new AxisOptions().setZoomRange(false).setMinimum(yMinimum)); plotOptions.setLegendOptions(new LegendOptions().setNumOfColumns(2)); if (markings == null) { // Make the grid hoverable plotOptions.setGridOptions(new GridOptions().setHoverable(true)); } else { // Make the grid hoverable and add markings plotOptions.setGridOptions(new GridOptions().setHoverable(true).setMarkings(markings).setClickable(true)); } // create the plot SimplePlot plot = new SimplePlot(plotOptions); plot.setHeight(200); plot.setWidth("100%"); final PopupPanel popup = new PopupPanel(); popup.addStyleName(getResources().css().infoPanel()); final HTML popupPanelContent = new HTML(); popup.add(popupPanelContent); // add hover listener if (isMetric) { plot.addHoverListener(new ShowCurrentValueHoverListener(popup, popupPanelContent, xAxisLabel, chosenSessions), false); } else { plot.addHoverListener(new ShowCurrentValueHoverListener(popup, popupPanelContent, xAxisLabel, null), false); } if (!isMetric && markings != null && markingsMap != null && !markingsMap.isEmpty()) { final PopupPanel taskInfoPanel = new PopupPanel(); taskInfoPanel.setWidth("200px"); taskInfoPanel.addStyleName(getResources().css().infoPanel()); final HTML taskInfoPanelContent = new HTML(); taskInfoPanel.add(taskInfoPanelContent); taskInfoPanel.setAutoHideEnabled(true); plot.addClickListener(new ShowTaskDetailsListener(id, markingsMap, taskInfoPanel, 200, taskInfoPanelContent), false); } return plot; } private void setupSettingsPanel(){ SplitLayoutPanel root = (SplitLayoutPanel) widget; root.setWidgetToggleDisplayAllowed(settingsPanel, true); testsMetricsPanel.showWidget(0); sessionPlotPanel = new SessionPlotPanel(new SessionScopePlotCheckBoxClickHandler(), plotPanel); sessionScopePlotList.add(sessionPlotPanel); } private void setupTabPanel(){ mainTabPanel.addSelectionHandler(new SelectionHandler<Integer>() { @Override public void onSelection(SelectionEvent<Integer> event) { int selected = event.getSelectedItem(); switch (selected) { case 0: onSummaryTabSelected(); break; case 1: onTrendsTabSelected(); break; case 2: onMetricsTabSelected(); default: } } }); } private void onSummaryTabSelected() { testsMetricsPanel.showWidget(0); if (summaryPanel.getSessionComparisonPanel() != null) { if (chosenMetrics.getRecordList().isEmpty()) { summaryPanel.getSessionComparisonPanel().getGrid().setData( summaryPanel.getSessionComparisonPanel().getEmptyListGrid() ); } else { summaryPanel.getSessionComparisonPanel().getGrid().setData( chosenMetrics.getRecordList() ); } } } private void onTrendsTabSelected() { testsMetricsPanel.showWidget(0); mainTabPanel.forceLayout(); if (!chosenMetrics.getMetrics().isEmpty() && hasChanged) { plotTrendsPanel.clear(); for(Map.Entry<String, MetricDto> entry : chosenMetrics.getMetrics().entrySet()) { renderPlots( plotTrendsPanel, Arrays.asList(entry.getValue().getPlotSeriesDto()), entry.getKey(), entry.getValue().getPlotSeriesDto().getYAxisMin(), true ); } scrollPanelTrends.scrollToBottom(); hasChanged = false; } } private void onMetricsTabSelected() { testsMetricsPanel.showWidget(1); } private void chooseTab(String token) { if (NameTokens.SUMMARY.equals(token)) { mainTabPanel.selectTab(0); } else if (NameTokens.TRENDS.equals(token)) { mainTabPanel.selectTab(1); } else { mainTabPanel.selectTab(2); } } private void setupSessionDataGrid() { sessionsDataGrid = new DataGrid<SessionDataDto>(); sessionsDataGrid.setPageSize(15); sessionsDataGrid.setEmptyTableWidget(new Label("No Sessions")); // Add a selection model so we can select cells. final SelectionModel<SessionDataDto> selectionModel = new MultiSelectionModel<SessionDataDto>(new ProvidesKey<SessionDataDto>() { @Override public Object getKey(SessionDataDto item) { return item.getSessionId(); } }); sessionsDataGrid.setSelectionModel(selectionModel, DefaultSelectionEventManager.<SessionDataDto>createCheckboxManager()); // Checkbox column. This table will uses a checkbox column for selection. // Alternatively, you can call dataGrid.setSelectionEnabled(true) to enable mouse selection. Column<SessionDataDto, Boolean> checkColumn = new Column<SessionDataDto, Boolean>(new CheckboxCell(true, false)) { @Override public Boolean getValue(SessionDataDto object) { // Get the value from the selection model. return selectionModel.isSelected(object); } }; sessionsDataGrid.addColumn(checkColumn, SafeHtmlUtils.fromSafeConstant("<br/>")); sessionsDataGrid.setColumnWidth(checkColumn, 40, Style.Unit.PX); sessionsDataGrid.addColumn(new TextColumn<SessionDataDto>() { @Override public String getValue(SessionDataDto object) { return object.getName(); } }, "Name"); sessionsDataGrid.addColumn(new TextColumn<SessionDataDto>() { @Override public String getValue(SessionDataDto object) { return object.getStartDate(); } }, "Start Date"); sessionsDataGrid.addColumn(new TextColumn<SessionDataDto>() { @Override public String getValue(SessionDataDto object) { return object.getEndDate(); } }, "End Date"); sessionDataProvider.addDataDisplay(sessionsDataGrid); } private void setupTestDataGrid(){ testDataGrid = new CellTable<TaskDataDto>(); testDataGrid.setWidth("500px"); testDataGrid.setEmptyTableWidget(new Label("No Tests")); // Add a selection model so we can select cells. final SelectionModel<TaskDataDto> selectionModel = new MultiSelectionModel<TaskDataDto>(new ProvidesKey<TaskDataDto>() { @Override public Object getKey(TaskDataDto item) { return item.getTaskName(); } }); testDataGrid.setSelectionModel(selectionModel, DefaultSelectionEventManager.<TaskDataDto>createCheckboxManager()); // Checkbox column. This table will uses a checkbox column for selection. // Alternatively, you can call dataGrid.setSelectionEnabled(true) to enable mouse selection. Column<TaskDataDto, Boolean> checkColumn = new Column<TaskDataDto, Boolean>(new CheckboxCell(true, false)) { @Override public Boolean getValue(TaskDataDto object) { // Get the value from the selection model. return selectionModel.isSelected(object); } }; testDataGrid.addColumn(checkColumn, SafeHtmlUtils.fromSafeConstant("<br/>")); testDataGrid.setColumnWidth(checkColumn, 40, Style.Unit.PX); testDataGrid.addColumn(new TextColumn<TaskDataDto>() { @Override public String getValue(TaskDataDto object) { return object.getTaskName(); } }, "Tests"); testDataGrid.setRowData(Collections.EMPTY_LIST); } private void setupPager() { SimplePager.Resources pagerResources = GWT.create(SimplePager.Resources.class); sessionsPager = new SimplePager(SimplePager.TextLocation.CENTER, pagerResources, false, 0, true); sessionsPager.setDisplay(sessionsDataGrid); } private void setupTestDetailsTree() { CellTree.Resources res = GWT.create(CellTree.BasicResources.class); final MultiSelectionModel<PlotNameDto> selectionModel = new MultiSelectionModel<PlotNameDto>(); taskDetailsTree = new CellTree(new TaskDataTreeViewModel(selectionModel, getResources()), null, res); taskDetailsTree.addStyleName(getResources().css().taskDetailsTree()); } private void setupLoadIndicator() { ImageResource imageResource = getResources().getLoadIndicator(); Image image = new Image(imageResource); loadIndicator = new FlowPanel(); loadIndicator.addStyleName(getResources().css().centered()); loadIndicator.add(image); } private void setupSessionNumberTextBox() { stopTypingSessionIdsTimer = new Timer() { @Override public void run() { final String currentContent = sessionIdsTextBox.getText().trim(); // If session ID text box is empty then load all sessions if (currentContent == null || currentContent.isEmpty()) { sessionDataProvider.addDataDisplayIfNotExists(sessionsDataGrid); sessionDataForSessionIdsAsyncProvider.removeDataDisplayIfNotExists(sessionsDataGrid); return; } Set<String> sessionIds = new HashSet<String>(); if (currentContent.contains(",") || currentContent.contains(";") || currentContent.contains("/")) { sessionIds.addAll(Arrays.asList(currentContent.split("\\s*[,;/]\\s*"))); } else { sessionIds.add(currentContent); } sessionDataForSessionIdsAsyncProvider.setSessionIds(sessionIds); sessionDataProvider.removeDataDisplayIfNotExists(sessionsDataGrid); sessionDataForDatePeriodAsyncProvider.removeDataDisplayIfNotExists(sessionsDataGrid); sessionDataForSessionIdsAsyncProvider.addDataDisplayIfNotExists(sessionsDataGrid); } }; sessionIdsTextBox.addKeyUpHandler(new KeyUpHandler() { @Override public void onKeyUp(KeyUpEvent event) { sessionsFrom.setValue(null); sessionsTo.setValue(null); stopTypingSessionIdsTimer.schedule(500); } }); } private void setupSessionsDateRange() { DateTimeFormat format = DateTimeFormat.getFormat(DateTimeFormat.PredefinedFormat.YEAR_MONTH_NUM_DAY); sessionsFrom.setFormat(new DateBox.DefaultFormat(format)); sessionsTo.setFormat(new DateBox.DefaultFormat(format)); sessionsFrom.getTextBox().addValueChangeHandler(new EmptyDateBoxValueChangePropagator(sessionsFrom)); sessionsTo.getTextBox().addValueChangeHandler(new EmptyDateBoxValueChangePropagator(sessionsTo)); final ValueChangeHandler<Date> valueChangeHandler = new ValueChangeHandler<Date>() { @Override public void onValueChange(ValueChangeEvent<Date> dateValueChangeEvent) { sessionIdsTextBox.setValue(null); Date fromDate = sessionsFrom.getValue(); Date toDate = sessionsTo.getValue(); if (fromDate == null || toDate == null) { sessionDataProvider.addDataDisplayIfNotExists(sessionsDataGrid); sessionDataForDatePeriodAsyncProvider.removeDataDisplayIfNotExists(sessionsDataGrid); return; } sessionDataForDatePeriodAsyncProvider.setDateRange(fromDate, toDate); sessionDataProvider.removeDataDisplayIfNotExists(sessionsDataGrid); sessionDataForSessionIdsAsyncProvider.removeDataDisplayIfNotExists(sessionsDataGrid); sessionDataForDatePeriodAsyncProvider.addDataDisplayIfNotExists(sessionsDataGrid); } }; sessionsTo.addValueChangeHandler(valueChangeHandler); sessionsFrom.addValueChangeHandler(valueChangeHandler); } private boolean isMaxPlotCountReached() { return plotPanel.getWidgetCount() >= MAX_PLOT_COUNT; } private void renderPlots(HTMLPanel panel, List<PlotSeriesDto> plotSeriesDtoList, String id) { renderPlots(panel, plotSeriesDtoList, id, 0, false); } private void renderPlots(HTMLPanel panel, List<PlotSeriesDto> plotSeriesDtoList, String id, double yMinimum, boolean isMetric) { panel.add(loadIndicator); SimplePlot redrawingPlot = null; VerticalPanel plotGroupPanel = new VerticalPanel(); plotGroupPanel.setWidth("100%"); plotGroupPanel.getElement().setId(id); for (PlotSeriesDto plotSeriesDto : plotSeriesDtoList) { Markings markings = null; if (plotSeriesDto.getMarkingSeries() != null) { markings = new Markings(); for (MarkingDto plotDatasetDto : plotSeriesDto.getMarkingSeries()) { double x = plotDatasetDto.getValue(); markings.addMarking(new Marking().setX(new Range(x, x)).setLineWidth(1).setColor(plotDatasetDto.getColor())); } markingsMap.put(id, new TreeSet<MarkingDto>(plotSeriesDto.getMarkingSeries())); } final SimplePlot plot = createPlot(id, markings, plotSeriesDto.getXAxisLabel(), yMinimum, isMetric); redrawingPlot = plot; PlotModel plotModel = plot.getModel(); for (PlotDatasetDto plotDatasetDto : plotSeriesDto.getPlotSeries()) { SeriesHandler handler = plotModel.addSeries(plotDatasetDto.getLegend(), plotDatasetDto.getColor()); // Populate plot with data for (PointDto pointDto : plotDatasetDto.getPlotData()) { handler.add(new DataPoint(pointDto.getX(), pointDto.getY())); } } // Add X axis label Label xLabel = new Label(plotSeriesDto.getXAxisLabel()); xLabel.addStyleName(getResources().css().xAxisLabel()); Label plotHeader = new Label(plotSeriesDto.getPlotHeader()); plotHeader.addStyleName(getResources().css().plotHeader()); Label plotLegend = new Label("PLOT LEGEND"); plotLegend.addStyleName(getResources().css().plotLegend()); VerticalPanel vp = new VerticalPanel(); vp.setWidth("100%"); Label panLeftLabel = new Label(); panLeftLabel.addStyleName(getResources().css().panLabel()); panLeftLabel.getElement().appendChild(new Image(getResources().getArrowLeft()).getElement()); panLeftLabel.addClickHandler(new ClickHandler() { @Override public void onClick(ClickEvent event) { plot.pan(new Pan().setLeft(-100)); } }); Label panRightLabel = new Label(); panRightLabel.addStyleName(getResources().css().panLabel()); panRightLabel.getElement().appendChild(new Image(getResources().getArrowRight()).getElement()); panRightLabel.addClickHandler(new ClickHandler() { @Override public void onClick(ClickEvent event) { plot.pan(new Pan().setLeft(100)); } }); Label zoomInLabel = new Label("Zoom In"); zoomInLabel.addStyleName(getResources().css().zoomLabel()); zoomInLabel.addClickHandler(new ClickHandler() { @Override public void onClick(ClickEvent event) { plot.zoom(); } }); Label zoomOutLabel = new Label("Zoom Out"); zoomOutLabel.addStyleName(getResources().css().zoomLabel()); zoomOutLabel.addClickHandler(new ClickHandler() { @Override public void onClick(ClickEvent event) { plot.zoomOut(); } }); FlowPanel zoomPanel = new FlowPanel(); zoomPanel.addStyleName(getResources().css().zoomPanel()); zoomPanel.add(panLeftLabel); zoomPanel.add(panRightLabel); zoomPanel.add(zoomInLabel); zoomPanel.add(zoomOutLabel); vp.add(plotHeader); vp.add(zoomPanel); vp.add(plot); vp.add(xLabel); // Will be added if there is need it //vp.add(plotLegend); plotGroupPanel.add(vp); } int loadingId = panel.getWidgetCount() - 1; panel.remove(loadingId); panel.add(plotGroupPanel); // Redraw plot if (redrawingPlot != null) { redrawingPlot.redraw(); } } //=================================// //==========Nested Classes=========// //=================================// /** * Handles select session event */ private class TestSelectChangeHandler implements SelectionChangeEvent.Handler{ @Override public void onSelectionChange(SelectionChangeEvent event) { Set<TaskDataDto> selected = ((MultiSelectionModel<TaskDataDto>) event.getSource()).getSelectedSet(); Set<SessionDataDto> selectedSessions = ((MultiSelectionModel<SessionDataDto>)sessionsDataGrid.getSelectionModel()).getSelectedSet(); List<TaskDataDto> result = new ArrayList<TaskDataDto>(selected.size()); result.addAll(selected); TaskDataTreeViewModel taskDataTreeViewModel = (TaskDataTreeViewModel) taskDetailsTree.getTreeViewModel(); MultiSelectionModel<PlotNameDto> plotNameSelectionModel = taskDataTreeViewModel.getSelectionModel(); // Clear plots display plotPanel.clear(); plotTrendsPanel.clear(); chosenMetrics.clear(); // Clear task scope plot selection model plotNameSelectionModel.clear(); // Clear session scope plot list sessionPlotPanel.clearPlots(); // Clear markings dto map markingsMap.clear(); taskDataTreeViewModel.clear(); taskDataTreeViewModel.populateTaskList(result); // Populate available plots tree level for each task for selected session for (TaskDataDto taskDataDto : result) { taskDataTreeViewModel.getPlotNameDataProviders().put (taskDataDto, new TaskPlotNamesAsyncDataProvider(taskDataDto, summaryPanel.getSessionIds())); } summaryPanel.updateTests(selected); metricPanel.updateTests(selected); if (!selectTests){ selectTests = true; Set<MetricNameDto> metricsToSelect = new HashSet<MetricNameDto>(); Set<PlotNameDto> trendsToSelect = new HashSet<PlotNameDto>(); for (TaskDataDto taskDataDto : result){ for (TestsMetrics testMetric : place.getSelectedTestsMetrics()){ if (testMetric.getTestName().equals(taskDataDto.getTaskName())){ //add metrics for (String metricName : testMetric.getMetrics()){ MetricNameDto meticDto = new MetricNameDto(); meticDto.setName(metricName); meticDto.setTests(taskDataDto); metricsToSelect.add(meticDto); } //add plots for (String trendsName : testMetric.getTrends()){ PlotNameDto plotNameDto = new PlotNameDto(taskDataDto, trendsName); trendsToSelect.add(plotNameDto); } } } } MetricNameDto fireMetric = null; if (!metricsToSelect.isEmpty()) fireMetric = metricsToSelect.iterator().next(); for (MetricNameDto metric : metricsToSelect){ metricPanel.setSelected(metric); } metricPanel.addSelectionListener(new MetricsSelectionChangedHandler()); if (fireMetric != null) metricPanel.setSelected(fireMetric); PlotNameDto firePlot = null; if (!trendsToSelect.isEmpty()) firePlot = trendsToSelect.iterator().next(); for (PlotNameDto plotNameDto : trendsToSelect){ taskDataTreeViewModel.getSelectionModel().setSelected(plotNameDto, true); } taskDataTreeViewModel.getSelectionModel().addSelectionChangeHandler(new TaskPlotSelectionChangedHandler()); if (firePlot != null) taskDataTreeViewModel.getSelectionModel().setSelected(firePlot, true); }else{ if (selectedSessions.size() == 1){ final SessionDataDto session = selectedSessions.iterator().next(); PlotProviderService.Async.getInstance().getSessionScopePlotList(session.getSessionId(),new AsyncCallback<Set<String>>() { @Override public void onFailure(Throwable throwable) { throwable.printStackTrace(); } @Override public void onSuccess(Set<String> strings) { sessionPlotPanel.update(session.getSessionId(), strings); } }); } } } } private class SessionSelectChangeHandler implements SelectionChangeEvent.Handler { @Override public void onSelectionChange(SelectionChangeEvent event) { // Currently selection model for sessions is a single selection model Set<SessionDataDto> selected = ((MultiSelectionModel<SessionDataDto>) event.getSource()).getSelectedSet(); TaskDataTreeViewModel taskDataTreeViewModel = (TaskDataTreeViewModel) taskDetailsTree.getTreeViewModel(); MultiSelectionModel<PlotNameDto> plotNameSelectionModel = taskDataTreeViewModel.getSelectionModel(); //Refresh summary summaryPanel.updateSessions(selected); // Clear plots display plotPanel.clear(); plotTrendsPanel.clear(); chosenMetrics.clear(); // Clear task scope plot selection model plotNameSelectionModel.clear(); //clearPlots session plots sessionPlotPanel.clearPlots(); // Clear markings dto map markingsMap.clear(); taskDataTreeViewModel.clear(); metricPanel.updateTests(Collections.EMPTY_SET); testDataGrid.setRowData(Collections.EMPTY_LIST); if (selected.size() == 1) { // If selected single session clearPlots plot display, clearPlots plot selection and fetch all data for given session final String sessionId = selected.iterator().next().getSessionId(); // Populate task scope session list TaskDataService.Async.getInstance().getTaskDataForSession(sessionId, new AsyncCallback<List<TaskDataDto>>() { @Override public void onFailure(Throwable caught) { caught.printStackTrace(); } @Override public void onSuccess(List<TaskDataDto> result) { updateTests(result); } }); } else if (selected.size() > 1) { // If selected several sessions chosenSessions.clear(); final Set<String> sessionIds = new HashSet<String>(); for (SessionDataDto sessionDataDto : selected) { sessionIds.add(sessionDataDto.getSessionId()); chosenSessions.add(Long.valueOf(sessionDataDto.getSessionId())); Collections.sort(chosenSessions); } TaskDataService.Async.getInstance().getTaskDataForSessions(sessionIds, new AsyncCallback<List<TaskDataDto>>() { @Override public void onFailure(Throwable caught) { caught.printStackTrace(); } @Override public void onSuccess(List<TaskDataDto> result) { updateTests(result); } }); } } } private void updateTests(List<TaskDataDto> tests){ Set<SessionDataDto> selected = ((MultiSelectionModel<SessionDataDto>) sessionsDataGrid.getSelectionModel()).getSelectedSet(); if (selected.size() == 1){ final String sessionId = selected.iterator().next().getSessionId(); if (!selectTests){ PlotProviderService.Async.getInstance().getSessionScopePlotList(sessionId, new AsyncCallback<Set<String>>() { @Override public void onFailure(Throwable throwable) { throwable.printStackTrace(); } @Override public void onSuccess(Set<String> strings) { sessionPlotPanel.update(sessionId, strings); sessionPlotPanel.setSelected(place.getSessionTrends()); } }); }else{ PlotProviderService.Async.getInstance().getSessionScopePlotList(sessionId,new AsyncCallback<Set<String>>() { @Override public void onFailure(Throwable throwable) { throwable.printStackTrace(); } @Override public void onSuccess(Set<String> strings) { sessionPlotPanel.update(sessionId, strings); } }); } } if (tests.isEmpty()) { return; } MultiSelectionModel model = (MultiSelectionModel)testDataGrid.getSelectionModel(); model.clear(); testDataGrid.redraw(); testDataGrid.setRowData(tests); if (!selectTests){ TaskDataDto selectObject = null; Set<TestsMetrics> testsMetrics = place.getSelectedTestsMetrics(); for (TaskDataDto taskDataDto : tests){ for (TestsMetrics testMetric : testsMetrics){ if (testMetric.getTestName().equals(taskDataDto.getTaskName())){ if (selectObject == null) selectObject = taskDataDto; model.setSelected(taskDataDto, true); } } } model.addSelectionChangeHandler(new TestSelectChangeHandler()); //fire event if (selectObject != null){ model.setSelected(selectObject, true); }else{ //nothing to select selectTests = true; } } } /** * Handles metrics change */ private class MetricsSelectionChangedHandler extends PlotsServingBase implements SelectionChangeEvent.Handler { @Override public void onSelectionChange(SelectionChangeEvent event) { hasChanged = true; if (summaryPanel.getSessionComparisonPanel() == null) { plotTrendsPanel.clear(); chosenMetrics.clear(); return; } Set<MetricNameDto> metrics = metricPanel.getSelected(); final ListGridRecord[] emptyData = summaryPanel.getSessionComparisonPanel().getEmptyListGrid(); if (metrics.isEmpty()) { // Remove plots from display which were unchecked chosenMetrics.clear(); plotTrendsPanel.clear(); if (mainTabPanel.getSelectedIndex() == 0) { onSummaryTabSelected(); } } else { //Generate all id of plots which should be displayed Set<String> selectedMetricsIds = new HashSet<String>(); for (MetricNameDto plotNameDto : metrics) { selectedMetricsIds.add(generateMetricPlotId(plotNameDto)); } // Remove plots from display which were unchecked HashSet<String> metricIdsSet = new HashSet<String>(chosenMetrics.getMetrics().keySet()); for (String plotId : metricIdsSet) { if (!selectedMetricsIds.contains(plotId)) { chosenMetrics.getMetrics().remove(plotId); } } final ArrayList<MetricNameDto> notLoaded = new ArrayList<MetricNameDto>(); final ArrayList<MetricDto> loaded = new ArrayList<MetricDto>(); for (MetricNameDto metricName : metrics){ if (!summaryPanel.getCachedMetrics().containsKey(metricName)){ notLoaded.add(metricName); }else{ MetricDto metric = summaryPanel.getCachedMetrics().get(metricName); loaded.add(metric); } } MetricDataService.Async.getInstance().getMetrics(notLoaded, new AsyncCallback<List<MetricDto>>() { @Override public void onFailure(Throwable caught) { caught.printStackTrace(); } @Override public void onSuccess(List<MetricDto> result) { loaded.addAll(result); MetricRankingProvider.sortMetrics(loaded); RecordList recordList = new RecordList(); recordList.addList(emptyData); for (MetricDto metric : loaded){ summaryPanel.getCachedMetrics().put(metric.getMetricName(), metric); recordList.add(summaryPanel.getSessionComparisonPanel().generateRecord(metric)); } chosenMetrics.setRecordList(recordList); renderMetricPlots(loaded); if (mainTabPanel.getSelectedIndex() == 0) { onSummaryTabSelected(); } } }); } } private void renderMetricPlots(List<MetricDto> result) { for (MetricDto metric : result) { if (isMaxPlotCountReached()) { Window.alert("You are reached max count of plot on display"); break; } // Generate DOM id for plot final String id = generateMetricPlotId(metric.getMetricName()); if (!chosenMetrics.getMetrics().containsKey(id)) { chosenMetrics.getMetrics().put(id, metric); } // If plot has already displayed, then pass it if (plotTrendsPanel.getElementById(id) != null) { continue; } } if (mainTabPanel.getSelectedIndex() == 1) { onTrendsTabSelected(); } } } /** * Handles specific plot of task selection */ private class TaskPlotSelectionChangedHandler extends PlotsServingBase implements SelectionChangeEvent.Handler { @Override public void onSelectionChange(SelectionChangeEvent event) { Set<PlotNameDto> selected = ((MultiSelectionModel<PlotNameDto>) event.getSource()).getSelectedSet(); final Set<SessionDataDto> selectedSessions = ((MultiSelectionModel<SessionDataDto>) sessionsDataGrid.getSelectionModel()).getSelectedSet(); if (selected.isEmpty()) { // Remove plots from display which were unchecked for (int i = 0; i < plotPanel.getWidgetCount(); i++) { Widget widget = plotPanel.getWidget(i); String widgetId = widget.getElement().getId(); if (isTaskScopePlotId(widgetId) || isCrossSessionsTaskScopePlotId(widgetId)) { plotPanel.remove(i); break; } } } else if (selectedSessions.size() == 1) { // Generate all id of plots which should be displayed Set<String> selectedTaskIds = new HashSet<String>(); for (PlotNameDto plotNameDto : selected) { selectedTaskIds.add(generateTaskScopePlotId(plotNameDto)); } // Remove plots from display which were unchecked for (int i = 0; i < plotPanel.getWidgetCount(); i++) { Widget widget = plotPanel.getWidget(i); String widgetId = widget.getElement().getId(); if (!isTaskScopePlotId(widgetId) || selectedTaskIds.contains(widgetId)) { continue; } // Remove plot plotPanel.remove(i); } PlotProviderService.Async.getInstance().getPlotDatas(selected, new AsyncCallback<Map<PlotNameDto, List<PlotSeriesDto>>>() { @Override public void onFailure(Throwable caught) { caught.printStackTrace(); } @Override public void onSuccess(Map<PlotNameDto, List<PlotSeriesDto>> result) { for (PlotNameDto plotNameDto : result.keySet()){ if (isMaxPlotCountReached()) { Window.alert("You are reached max count of plot on display"); break; } // Generate DOM id for plot final String id = generateTaskScopePlotId(plotNameDto); // If plot has already displayed, then pass it if (plotPanel.getElementById(id) != null) { continue; } renderPlots(plotPanel, result.get(plotNameDto), id); scrollPanelMetrics.scrollToBottom(); } } }); } else { // Generate all id of plots which should be displayed Set<String> selectedTaskIds = new HashSet<String>(); for (PlotNameDto plotNameDto : selected) { selectedTaskIds.add(generateCrossSessionsTaskScopePlotId(plotNameDto)); } // Remove plots from display which were unchecked for (int i = 0; i < plotPanel.getWidgetCount(); i++) { Widget widget = plotPanel.getWidget(i); String widgetId = widget.getElement().getId(); if (!isCrossSessionsTaskScopePlotId(widgetId) || selectedTaskIds.contains(widgetId)) { continue; } // Remove plot plotPanel.remove(i); } // Creating plots and displaying theirs PlotProviderService.Async.getInstance().getPlotDatas(selected, new AsyncCallback<Map<PlotNameDto,List<PlotSeriesDto>>>() { @Override public void onFailure(Throwable caught) { caught.printStackTrace(); } @Override public void onSuccess(Map<PlotNameDto, List<PlotSeriesDto>> result) { for (PlotNameDto plotNameDto : result.keySet()){ if (isMaxPlotCountReached()) { Window.alert("You are reached max count of plot on display"); break; } // Generate DOM id for plot final String id = generateCrossSessionsTaskScopePlotId(plotNameDto); // If plot has already displayed, then pass it if (plotPanel.getElementById(id) != null) { continue; } renderPlots(plotPanel, result.get(plotNameDto), id); scrollPanelMetrics.scrollToBottom(); } } }); } } } /** * Handles clicks on session scope plot checkboxes */ private class SessionScopePlotCheckBoxClickHandler extends PlotsServingBase implements ValueChangeHandler<Boolean> { @Override public void onValueChange(ValueChangeEvent<Boolean> event) { final CheckBox source = (CheckBox) event.getSource(); final String sessionId = extractEntityIdFromDomId(source.getElement().getId()); final String plotName = source.getText(); final String id = generateSessionScopePlotId(sessionId, plotName); // If checkbox is checked if (source.getValue()) { plotPanel.add(loadIndicator); scrollPanelMetrics.scrollToBottom(); final int loadingId = plotPanel.getWidgetCount() - 1; PlotProviderService.Async.getInstance().getSessionScopePlotData(sessionId, plotName, new AsyncCallback<List<PlotSeriesDto>>() { @Override public void onFailure(Throwable caught) { plotPanel.remove(loadingId); Window.alert("Error is occurred during server request processing (Session scope plot data fetching for " + plotName + ")"); } @Override public void onSuccess(List<PlotSeriesDto> result) { plotPanel.remove(loadingId); if (result.isEmpty()) { Window.alert("There are no data found for " + plotName); } renderPlots(plotPanel, result, id); scrollPanelMetrics.scrollToBottom(); } }); } else { // Remove plots from display which were unchecked for (int i = 0; i < plotPanel.getWidgetCount(); i++) { Widget widget = plotPanel.getWidget(i); if (id.equals(widget.getElement().getId())) { // Remove plot plotPanel.remove(i); break; } } } } } }
lgpl-2.1
niithub/angelonline
util/src/main/java/com/njbd/ao/exception/LoginMismatchException.java
359
package com.njbd.ao.exception; import com.njbd.ao.enums.ErrorCode; public class LoginMismatchException extends APIRuntimeException { public LoginMismatchException() { super(ErrorCode.LOGIN_MISMATCH.getCode(), ErrorCode.LOGIN_MISMATCH.getMsg()); } public LoginMismatchException(int code, String msg) { super(code, msg); } }
lgpl-2.1
kumar-physics/BioJava
biojava3-genome/src/main/java/org/biojava3/genome/uniprot/UniprotToFasta.java
3766
package org.biojava3.genome.uniprot; import java.io.BufferedReader; import java.io.File; import java.io.FileReader; import java.util.ArrayList; import java.util.HashMap; import org.biojava3.core.sequence.AccessionID; import org.biojava3.core.sequence.ProteinSequence; import org.biojava3.core.sequence.io.FastaWriterHelper; /* * To change this template, choose Tools | Templates * and open the template in the editor. */ /** * * @author Scooter */ public class UniprotToFasta { public static void main( String[] args ){ try{ String uniprotDatFileName = "uniprot_trembl_fungi.dat"; String fastaFileName = "uniprot__trembel_fungi.faa"; UniprotToFasta uniprotToFasta = new UniprotToFasta(); uniprotToFasta.process(uniprotDatFileName, fastaFileName); }catch(Exception e){ e.printStackTrace(); } } /** * Convert a Uniprot sequence file to a fasta file. Allows you to download all sequence data for a species * and convert to fasta to be used in a blast database * @param uniprotDatFileName * @param fastaFileName * @throws Exception */ public void process( String uniprotDatFileName,String fastaFileName ) throws Exception{ FileReader fr = new FileReader(uniprotDatFileName); BufferedReader br = new BufferedReader(fr); String line = br.readLine(); String id = ""; StringBuffer sequence = new StringBuffer(); ArrayList<ProteinSequence> seqCodingRegionsList = new ArrayList<ProteinSequence>(); int count = 0; HashMap<String,String> uniqueGenes = new HashMap<String,String>(); HashMap<String,String> uniqueSpecies = new HashMap<String,String>(); while(line != null){ if(line.startsWith("ID")){ String[] data = line.split(" "); id = data[3]; }else if(line.startsWith("SQ")){ line = br.readLine(); while(!line.startsWith("//")){ for(int i = 0; i < line.length(); i++){ char aa = line.charAt(i); if((aa >= 'A' && aa <= 'Z') || (aa >= 'a' && aa <= 'z' )){ sequence.append(aa); } } line = br.readLine(); } // System.out.println(">" + id); // System.out.println(sequence.toString()); ProteinSequence seq = new ProteinSequence(sequence.toString() ); seq.setAccession(new AccessionID(id)); seqCodingRegionsList.add(seq); sequence = new StringBuffer(); count++; if(count % 100 == 0) System.out.println(count); String[] parts = id.split("_"); uniqueGenes.put(parts[0], ""); uniqueSpecies.put(parts[1],""); } line = br.readLine(); } // System.out.println("Unique Genes=" + uniqueGenes.size()); // System.out.println("Unique Species=" + uniqueSpecies.size()); // System.out.println("Total sequences=" + seqCodingRegionsList.size()); FastaWriterHelper.writeProteinSequence(new File(fastaFileName), seqCodingRegionsList); br.close(); fr.close(); // System.out.println(uniqueGenes.keySet()); // System.out.println("===================="); // System.out.println(uniqueSpecies.keySet()); } }
lgpl-2.1
jdpadrnos/MinecraftForge
src/main/java/net/minecraftforge/fluids/capability/ItemFluidContainer.java
1897
/* * Minecraft Forge * Copyright (c) 2016. * * This library is free software; you can redistribute it and/or * modify it under the terms of the GNU Lesser General Public * License as published by the Free Software Foundation version 2.1 * of the License. * * This library is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Lesser General Public License for more details. * * You should have received a copy of the GNU Lesser General Public * License along with this library; if not, write to the Free Software * Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA */ package net.minecraftforge.fluids.capability; import net.minecraft.item.Item; import net.minecraft.item.ItemStack; import net.minecraft.nbt.NBTTagCompound; import net.minecraftforge.common.capabilities.ICapabilityProvider; import net.minecraftforge.fluids.FluidContainerRegistry; import net.minecraftforge.fluids.IFluidContainerItem; import net.minecraftforge.fluids.capability.templates.FluidHandlerItemStack; /** * A simple fluid container, to replace the functionality of {@link FluidContainerRegistry) and {@link IFluidContainerItem}. * This fluid container may be set so that is can only completely filled or empty. (binary) * It may also be set so that it gets consumed when it is drained. (consumable) */ public class ItemFluidContainer extends Item { protected final int capacity; /** * @param capacity The maximum capacity of this fluid container. */ public ItemFluidContainer(int capacity) { this.capacity = capacity; } @Override public ICapabilityProvider initCapabilities(ItemStack stack, NBTTagCompound nbt) { return new FluidHandlerItemStack(stack, capacity); } }
lgpl-2.1
geotools/geotools
modules/library/coverage/src/main/java/org/geotools/coverage/processing/operation/SubsampleAverage.java
1526
/* * GeoTools - The Open Source Java GIS Toolkit * http://geotools.org * * (C) 2006-2008, Open Source Geospatial Foundation (OSGeo) * * This library is free software; you can redistribute it and/or * modify it under the terms of the GNU Lesser General Public * License as published by the Free Software Foundation; * version 2.1 of the License. * * This library is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Lesser General Public License for more details. */ package org.geotools.coverage.processing.operation; import org.geotools.coverage.processing.BaseScaleOperationJAI; /** * This operation is simply a wrapper for the JAI SubsampleAverage operation which allows me to * arbitrarily scale a rendered image while smoothing it out. * * @author Simone Giannecchini, GeoSolutions. * @version $Id: SubsampleAverage.java 23157 2006-12-01 01:29:53Z * desruisseaSubsampleAveragedCoverageator.SubsampleAverageDescriptor * @since 2.3 * @see javax.media.jai.operator.SubsampleAverageDescriptor */ public class SubsampleAverage extends BaseScaleOperationJAI { /** Serial number for interoperability with different versions. */ private static final long serialVersionUID = 1L; /** Constructs a default {@code "SubsampleAverage"} operation. */ public SubsampleAverage() { super("SubsampleAverage"); } }
lgpl-2.1
DiceNyan/DreamEcon_InventoryAdditionals
src/main/java/su/jfdev/skymine/inventorymoney/ClientMessageHandler.java
675
package su.jfdev.skymine.inventorymoney; import cpw.mods.fml.common.network.simpleimpl.IMessage; import cpw.mods.fml.common.network.simpleimpl.IMessageHandler; import cpw.mods.fml.common.network.simpleimpl.MessageContext; import cpw.mods.fml.relauncher.Side; import cpw.mods.fml.relauncher.SideOnly; /** * Created by Jamefrus on 21.08.2015. */ @SideOnly(Side.CLIENT) public class ClientMessageHandler implements IMessageHandler<ResponseMessage,IMessage> { @Override public IMessage onMessage(ResponseMessage message, MessageContext ctx) { if(ctx.side == Side.CLIENT){ ClientProxy.money = message.money; } return null; } }
lgpl-2.1
Romenig/ivprog2
src/usp/ime/line/ivprog/view/editor/codeblocks/CodeBaseGUI.java
1567
package usp.ime.line.ivprog.view.editor.codeblocks; import java.awt.BorderLayout; import javax.swing.JComponent; import javax.swing.JPanel; import javax.swing.border.EmptyBorder; import usp.ime.line.ivprog.IVProg2; import usp.ime.line.ivprog.view.editor.IVPFunctionBody; import usp.ime.line.ivprog.view.utils.GripArea; import usp.ime.line.ivprog.view.utils.RoundedJPanel; public abstract class CodeBaseGUI extends RoundedJPanel { private static final long serialVersionUID = 1L; protected JPanel compositePanel = new JPanel(); protected IVPFunctionBody escope = null; protected JComponent ivpContainer = null; private JPanel gripArea = new JPanel(); protected int indexAtContainer = -1; public CodeBaseGUI() { setLayout(new BorderLayout()); initGripArea(); initCompositePanel(); addMouseListener(IVProg2.getMouseListener()); } private void initCompositePanel() { compositePanel.setBorder(new EmptyBorder(2, 0, 2, 2)); compositePanel.setOpaque(false); compositePanel.setLayout(new BorderLayout(0, 0)); add(compositePanel, BorderLayout.CENTER); } private void initGripArea() { GripArea grip = new GripArea(); gripArea.setLayout(new BorderLayout()); gripArea.add(grip, BorderLayout.CENTER); gripArea.setBorder(new EmptyBorder(0, 2, 2, 2)); gripArea.add(grip, BorderLayout.CENTER); gripArea.setOpaque(false); add(gripArea, BorderLayout.WEST); } }
lgpl-2.1
mtommila/apfloat
apfloat/src/main/java/org/apfloat/internal/AbstractDataStorageBuilder.java
4565
/* * MIT License * * Copyright (c) 2002-2021 Mikko Tommila * * Permission is hereby granted, free of charge, to any person obtaining a copy * of this software and associated documentation files (the "Software"), to deal * in the Software without restriction, including without limitation the rights * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell * copies of the Software, and to permit persons to whom the Software is * furnished to do so, subject to the following conditions: * * The above copyright notice and this permission notice shall be included in all * copies or substantial portions of the Software. * * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE * SOFTWARE. */ package org.apfloat.internal; import org.apfloat.ApfloatContext; import org.apfloat.ApfloatRuntimeException; import org.apfloat.spi.DataStorageBuilder; import org.apfloat.spi.DataStorage; /** * Abstract base class for a data storage creation strategy. * Depending on the implementation-specific element size, the * requested data length and threshold values configured in the * current {@link ApfloatContext}, different types of data storages * are created. * * @since 1.7.0 * @version 1.8.2 * @author Mikko Tommila */ public abstract class AbstractDataStorageBuilder implements DataStorageBuilder { /** * Subclass constructor. */ protected AbstractDataStorageBuilder() { } @Override public DataStorage createDataStorage(long size) throws ApfloatRuntimeException { ApfloatContext ctx = ApfloatContext.getContext(); // Sizes are in bytes if (size <= ctx.getMemoryThreshold() && size <= getMaxCachedSize()) { return createCachedDataStorage(); } else { return createNonCachedDataStorage(); } } @Override public DataStorage createCachedDataStorage(long size) throws ApfloatRuntimeException { ApfloatContext ctx = ApfloatContext.getContext(); // Sizes are in bytes if (size <= ctx.getMaxMemoryBlockSize() && size <= getMaxCachedSize()) { // Use memory data storage if it can fit in memory return createCachedDataStorage(); } else { // If it can't fit in memory then still have to use disk data storage return createNonCachedDataStorage(); } } @Override public DataStorage createDataStorage(DataStorage dataStorage) throws ApfloatRuntimeException { if (isCached(dataStorage)) { long size = dataStorage.getSize(); ApfloatContext ctx = ApfloatContext.getContext(); // Sizes are in bytes if (size > ctx.getMemoryThreshold()) { // If it is a memory data storage and should be moved to disk then do so DataStorage tmp = createNonCachedDataStorage(); tmp.copyFrom(dataStorage); dataStorage = tmp; } } return dataStorage; } /** * Get the maximum cached data storage size. * * @return The maximum cached data storage size. */ protected abstract long getMaxCachedSize(); /** * Create a cached data storage. * * @return A new cached data storage. */ protected abstract DataStorage createCachedDataStorage() throws ApfloatRuntimeException; /** * Create a non-cached data storage. * * @return A new non-cached data storage. */ protected abstract DataStorage createNonCachedDataStorage() throws ApfloatRuntimeException; /** * Test if the data storage is of cached type. * * @param dataStorage The data storage. * * @return If the data storage is cached. */ protected abstract boolean isCached(DataStorage dataStorage) throws ApfloatRuntimeException; }
lgpl-2.1
apetresc/JFreeChart
src/test/java/org/jfree/chart/imagemap/junit/ImageMapPackageTests.java
3000
/* =========================================================== * JFreeChart : a free chart library for the Java(tm) platform * =========================================================== * * (C) Copyright 2000-2009, by Object Refinery Limited and Contributors. * * Project Info: http://www.jfree.org/jfreechart/index.html * * This library is free software; you can redistribute it and/or modify it * under the terms of the GNU Lesser General Public License as published by * the Free Software Foundation; either version 2.1 of the License, or * (at your option) any later version. * * This library is distributed in the hope that it will be useful, but * WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY * or FITNESS FOR A PARTICULAR PURPOSE. See the GNU Lesser General Public * License for more details. * * You should have received a copy of the GNU Lesser General Public * License along with this library; if not, write to the Free Software * Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, * USA. * * [Java is a trademark or registered trademark of Sun Microsystems, Inc. * in the United States and other countries.] * * ------------------------- * ImageMapPackageTests.java * ------------------------- * (C) Copyright 2007-2009, by Object Refinery Limited. * * Original Author: David Gilbert (for Object Refinery Limited); * Contributor(s): -; * * Changes: * -------- * 05-Dec-2007 : Version 1 (DG); * 25-Mar-2009 : Added DynamicDriveToolTipTagFragmentGeneratorTests, * ImageMapUtilitiesTests and * OverLIBToolTipTagFragmentGeneratorTests (DG); * */ package org.jfree.chart.imagemap.junit; import junit.framework.Test; import junit.framework.TestCase; import junit.framework.TestSuite; /** * A collection of tests for the org.jfree.chart.imagemap package. * <P> * These tests can be run using JUnit (http://www.junit.org). */ public class ImageMapPackageTests extends TestCase { /** * Returns a test suite to the JUnit test runner. * * @return The test suite. */ public static Test suite() { TestSuite suite = new TestSuite("org.jfree.chart.imagemap"); suite.addTestSuite(DynamicDriveToolTipTagFragmentGeneratorTests.class); suite.addTestSuite(ImageMapUtilitiesTests.class); suite.addTestSuite(OverLIBToolTipTagFragmentGeneratorTests.class); suite.addTestSuite(StandardToolTipTagFragmentGeneratorTests.class); suite.addTestSuite(StandardURLTagFragmentGeneratorTests.class); return suite; } /** * Constructs the test suite. * * @param name the suite name. */ public ImageMapPackageTests(String name) { super(name); } /** * Runs the test suite using JUnit's text-based runner. * * @param args ignored. */ public static void main(String[] args) { junit.textui.TestRunner.run(suite()); } }
lgpl-2.1
aloubyansky/wildfly-core
host-controller/src/main/java/org/jboss/as/host/controller/HostControllerService.java
16778
/* * JBoss, Home of Professional Open Source. * Copyright 2011, Red Hat, Inc., and individual contributors * as indicated by the @author tags. See the copyright.txt file in the * distribution for a full listing of individual contributors. * * This is free software; you can redistribute it and/or modify it * under the terms of the GNU Lesser General Public License as * published by the Free Software Foundation; either version 2.1 of * the License, or (at your option) any later version. * * This software is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Lesser General Public License for more details. * * You should have received a copy of the GNU Lesser General Public * License along with this software; if not, write to the Free * Software Foundation, Inc., 51 Franklin St, Fifth Floor, Boston, MA * 02110-1301 USA, or see the FSF site: http://www.fsf.org. */ package org.jboss.as.host.controller; import static java.security.AccessController.doPrivileged; import static org.jboss.as.controller.AbstractControllerService.EXECUTOR_CAPABILITY; import java.lang.management.ManagementFactory; import java.lang.management.RuntimeMXBean; import java.security.PrivilegedAction; import java.util.List; import java.util.Locale; import java.util.Map; import java.util.Properties; import java.util.TreeSet; import java.util.concurrent.ExecutorService; import java.util.concurrent.RejectedExecutionException; import java.util.concurrent.ScheduledExecutorService; import java.util.concurrent.ScheduledThreadPoolExecutor; import java.util.concurrent.SynchronousQueue; import java.util.concurrent.ThreadFactory; import java.util.concurrent.ThreadPoolExecutor; import java.util.concurrent.TimeUnit; import java.util.regex.Matcher; import java.util.regex.Pattern; import org.jboss.as.controller.CapabilityRegistry; import org.jboss.as.controller.ControlledProcessState; import org.jboss.as.controller.ProcessType; import org.jboss.as.domain.http.server.ConsoleAvailabilityService; import org.jboss.as.host.controller.logging.HostControllerLogger; import org.jboss.as.remoting.HttpListenerRegistryService; import org.jboss.as.remoting.management.ManagementRemotingServices; import org.jboss.as.server.BootstrapListener; import org.jboss.as.server.FutureServiceContainer; import org.jboss.as.server.Services; import org.jboss.as.server.logging.ServerLogger; import org.jboss.as.version.ProductConfig; import org.jboss.msc.service.Service; import org.jboss.msc.service.ServiceContainer; import org.jboss.msc.service.ServiceController; import org.jboss.msc.service.ServiceName; import org.jboss.msc.service.ServiceTarget; import org.jboss.msc.service.StartContext; import org.jboss.msc.service.StartException; import org.jboss.msc.service.StopContext; import org.jboss.msc.service.ValueService; import org.jboss.msc.value.ImmediateValue; import org.jboss.msc.value.InjectedValue; import org.jboss.msc.value.Value; import org.jboss.threads.AsyncFuture; import org.jboss.threads.EnhancedQueueExecutor; import org.jboss.threads.JBossThreadFactory; /** * The root service for a HostController process. * * @author Brian Stansberry (c) 2011 Red Hat Inc. */ public class HostControllerService implements Service<AsyncFuture<ServiceContainer>> { public static final ServiceName HC_SERVICE_NAME = ServiceName.JBOSS.append("host", "controller"); /** @deprecated Use the org.wildfly.management.executor capability */ @Deprecated public static final ServiceName HC_EXECUTOR_SERVICE_NAME = HC_SERVICE_NAME.append("executor"); public static final ServiceName HC_SCHEDULED_EXECUTOR_SERVICE_NAME = HC_SERVICE_NAME.append("scheduled", "executor"); private final ThreadGroup threadGroup = new ThreadGroup("Host Controller Service Threads"); private final ThreadFactory threadFactory = doPrivileged(new PrivilegedAction<JBossThreadFactory>() { public JBossThreadFactory run() { return new JBossThreadFactory(threadGroup, Boolean.FALSE, null, "%G - %t", null, null); } }); private final HostControllerEnvironment environment; private final HostRunningModeControl runningModeControl; private final ControlledProcessState processState; private final String authCode; private final CapabilityRegistry capabilityRegistry; private volatile FutureServiceContainer futureContainer; private volatile long startTime; public HostControllerService(final HostControllerEnvironment environment, final HostRunningModeControl runningModeControl, final String authCode, final ControlledProcessState processState, FutureServiceContainer futureContainer) { this.environment = environment; this.runningModeControl = runningModeControl; this.authCode = authCode; this.processState = processState; this.startTime = environment.getStartTime(); this.futureContainer = futureContainer; this.capabilityRegistry = new CapabilityRegistry(false); } public HostControllerService(final HostControllerEnvironment environment, final HostRunningModeControl runningModeControl, final String authCode, final ControlledProcessState processState) { this(environment, runningModeControl, authCode, processState, new FutureServiceContainer()); } @Override public void start(StartContext context) throws StartException { //Moved to AbstractControllerService.start() // processState.setStarting(); final ProductConfig config = environment.getProductConfig(); final String prettyVersion = config.getPrettyVersionString(); ServerLogger.AS_ROOT_LOGGER.serverStarting(prettyVersion); if (System.getSecurityManager() != null) { ServerLogger.AS_ROOT_LOGGER.securityManagerEnabled(); } if (ServerLogger.CONFIG_LOGGER.isDebugEnabled()) { final Properties properties = System.getProperties(); final StringBuilder b = new StringBuilder(8192); b.append("Configured system properties:"); for (String property : new TreeSet<String>(properties.stringPropertyNames())) { String propVal = property.toLowerCase(Locale.ROOT).contains("password") ? "<redacted>" : properties.getProperty(property, "<undefined>"); if (property.toLowerCase(Locale.ROOT).equals("sun.java.command") && !propVal.isEmpty()) { Pattern pattern = Pattern.compile("(-D(?:[^ ])+=)((?:[^ ])+)"); Matcher matcher = pattern.matcher(propVal); StringBuffer sb = new StringBuffer(propVal.length()); while (matcher.find()) { if (matcher.group(1).contains("password")) { matcher.appendReplacement(sb, Matcher.quoteReplacement(matcher.group(1) + "<redacted>")); } } matcher.appendTail(sb); propVal = sb.toString(); } b.append("\n\t").append(property).append(" = ").append(propVal); } ServerLogger.CONFIG_LOGGER.debug(b); ServerLogger.CONFIG_LOGGER.debugf("VM Arguments: %s", getVMArguments()); if (ServerLogger.CONFIG_LOGGER.isTraceEnabled()) { b.setLength(0); final Map<String, String> env = System.getenv(); b.append("Configured system environment:"); for (String key : new TreeSet<String>(env.keySet())) { String envVal = key.toLowerCase(Locale.ROOT).contains("password") ? "<redacted>" : env.get(key); b.append("\n\t").append(key).append(" = ").append(envVal); } ServerLogger.CONFIG_LOGGER.trace(b); } } final ServiceTarget serviceTarget = context.getChildTarget(); final ServiceController<?> myController = context.getController(); final ServiceContainer serviceContainer = myController.getServiceContainer(); long startTime = this.startTime; if (startTime == -1) { startTime = System.currentTimeMillis(); } else { this.startTime = -1; } final BootstrapListener bootstrapListener = new BootstrapListener(serviceContainer, startTime, serviceTarget, futureContainer, prettyVersion + " (Host Controller)", environment.getDomainTempDir()); bootstrapListener.getStabilityMonitor().addController(myController); // The first default services are registered before the bootstrap operations are executed. // Install the process controller client // if this is running embedded, then processcontroller is a noop, this can be extended later. final ProcessType processType = environment.getProcessType(); if (processType == ProcessType.EMBEDDED_HOST_CONTROLLER) { final ProcessControllerConnectionServiceNoop processControllerClient = new ProcessControllerConnectionServiceNoop(environment, authCode); serviceTarget.addService(ProcessControllerConnectionServiceNoop.SERVICE_NAME, processControllerClient).install(); } else { final ProcessControllerConnectionService processControllerClient = new ProcessControllerConnectionService(environment, authCode); serviceTarget.addService(ProcessControllerConnectionService.SERVICE_NAME, processControllerClient).install(); } // Executor Services final HostControllerExecutorService executorService = new HostControllerExecutorService(threadFactory); serviceTarget.addService(EXECUTOR_CAPABILITY.getCapabilityServiceName(), executorService) .addAliases(HC_EXECUTOR_SERVICE_NAME, ManagementRemotingServices.SHUTDOWN_EXECUTOR_NAME) // Use this executor for mgmt shutdown for now .install(); final HostControllerScheduledExecutorService scheduledExecutorService = new HostControllerScheduledExecutorService(threadFactory); serviceTarget.addService(HC_SCHEDULED_EXECUTOR_SERVICE_NAME, scheduledExecutorService) .addDependency(EXECUTOR_CAPABILITY.getCapabilityServiceName(), ExecutorService.class, scheduledExecutorService.executorInjector) .install(); // Install required path services. (Only install those identified as required) HostPathManagerService hostPathManagerService = new HostPathManagerService(capabilityRegistry); HostPathManagerService.addService(serviceTarget, hostPathManagerService, environment); HttpListenerRegistryService.install(serviceTarget); // Add product config service final Value<ProductConfig> productConfigValue = new ImmediateValue<ProductConfig>(config); serviceTarget.addService(Services.JBOSS_PRODUCT_CONFIG_SERVICE, new ValueService<ProductConfig>(productConfigValue)) .setInitialMode(ServiceController.Mode.ACTIVE) .install(); ConsoleAvailabilityService.addService(serviceTarget, bootstrapListener::logAdminConsole); DomainModelControllerService.addService(serviceTarget, environment, runningModeControl, processState, bootstrapListener, hostPathManagerService, capabilityRegistry, threadGroup); } @Override public void stop(StopContext context) { String prettyVersion = environment.getProductConfig().getPrettyVersionString(); //Moved to AbstractControllerService.stop() //processState.setStopping(); ServerLogger.AS_ROOT_LOGGER.serverStopped(prettyVersion, Integer.valueOf((int) (context.getElapsedTime() / 1000000L))); BootstrapListener.deleteStartupMarker(environment.getDomainTempDir()); } @Override public AsyncFuture<ServiceContainer> getValue() throws IllegalStateException, IllegalArgumentException { return futureContainer; } public HostControllerEnvironment getEnvironment() { return environment; } private String getVMArguments() { final StringBuilder result = new StringBuilder(1024); final RuntimeMXBean rmBean = ManagementFactory.getRuntimeMXBean(); final List<String> inputArguments = rmBean.getInputArguments(); for (String arg : inputArguments) { result.append(arg).append(" "); } return result.toString(); } static final class HostControllerExecutorService implements Service<ExecutorService> { final ThreadFactory threadFactory; private ExecutorService executorService; private HostControllerExecutorService(ThreadFactory threadFactory) { this.threadFactory = threadFactory; } @Override public synchronized void start(final StartContext context) throws StartException { if (EnhancedQueueExecutor.DISABLE_HINT) { executorService = new ThreadPoolExecutor(1, Integer.MAX_VALUE, 5L, TimeUnit.SECONDS, new SynchronousQueue<Runnable>(), threadFactory); } else { executorService = new EnhancedQueueExecutor.Builder() .setCorePoolSize(1) .setMaximumPoolSize(4096) .setKeepAliveTime(5L, TimeUnit.SECONDS) .setThreadFactory(threadFactory) .build(); } } @Override public synchronized void stop(final StopContext context) { Thread executorShutdown = new Thread(new Runnable() { @Override public void run() { boolean interrupted = false; try { executorService.shutdown(); executorService.awaitTermination(100, TimeUnit.MILLISECONDS); } catch (InterruptedException e) { interrupted = true; } finally { try { List<Runnable> tasks = executorService.shutdownNow(); executorService = null; if (!interrupted) { for (Runnable task : tasks) { HostControllerLogger.ROOT_LOGGER.debugf("%s -- Discarding unexecuted task %s", getClass().getSimpleName(), task); } } } finally { context.complete(); } } } }, "HostController ExecutorService Shutdown Thread"); executorShutdown.start(); context.asynchronous(); } @Override public synchronized ExecutorService getValue() throws IllegalStateException { return executorService; } } static final class HostControllerScheduledExecutorService implements Service<ScheduledExecutorService> { private final ThreadFactory threadFactory; private ScheduledThreadPoolExecutor scheduledExecutorService; private final InjectedValue<ExecutorService> executorInjector = new InjectedValue<>(); private HostControllerScheduledExecutorService(ThreadFactory threadFactory) { this.threadFactory = threadFactory; } @Override public synchronized void start(final StartContext context) throws StartException { scheduledExecutorService = new ScheduledThreadPoolExecutor(4 , threadFactory); scheduledExecutorService.setExecuteExistingDelayedTasksAfterShutdownPolicy(false); } @Override public synchronized void stop(final StopContext context) { Runnable r = new Runnable() { @Override public void run() { try { scheduledExecutorService.shutdown(); } finally { scheduledExecutorService = null; context.complete(); } } }; try { executorInjector.getValue().execute(r); } catch (RejectedExecutionException e) { r.run(); } finally { context.asynchronous(); } } @Override public synchronized ScheduledExecutorService getValue() throws IllegalStateException { return scheduledExecutorService; } } }
lgpl-2.1
skyvers/wildcat
skyve-ext/src/main/java/org/skyve/impl/persistence/hibernate/HibernateBizQL.java
2401
package org.skyve.impl.persistence.hibernate; import java.util.List; import org.hibernate.query.Query; import org.skyve.domain.Bean; import org.skyve.impl.persistence.AbstractBizQL; import org.skyve.persistence.AutoClosingIterable; import org.skyve.persistence.BizQL; import org.skyve.impl.persistence.hibernate.AbstractHibernatePersistence; import org.skyve.impl.persistence.hibernate.HibernateQueryDelegate; public class HibernateBizQL extends AbstractBizQL { private HibernateQueryDelegate delegate; public HibernateBizQL(String query, AbstractHibernatePersistence persistence) { super(query); delegate = new HibernateQueryDelegate(persistence); } @Override public <T extends Bean> List<T> beanResults() { Query<T> query = delegate.createHibernateQuery(this); return delegate.list(query, true, true, false); } @Override public <T extends Bean> AutoClosingIterable<T> beanIterable() { Query<T> query = delegate.createHibernateQuery(this); return delegate.iterate(query, true, true, false); } @Override public <T extends Bean> List<T> projectedResults() { Query<T> query = delegate.createHibernateQuery(this); return delegate.list(query, false, false, false); } @Override public <T extends Bean> AutoClosingIterable<T> projectedIterable() { Query<T> query = delegate.createHibernateQuery(this); return delegate.iterate(query, false, false, false); } @Override public <T> List<T> scalarResults(Class<T> type) { Query<T> query = delegate.createHibernateQuery(this); return delegate.list(query, true, true, false); } @Override public <T> AutoClosingIterable<T> scalarIterable(Class<T> type) { Query<T> query = delegate.createHibernateQuery(this); return delegate.iterate(query, true, true, false); } @Override public List<Object[]> tupleResults() { Query<Object[]> query = delegate.createHibernateQuery(this); return delegate.list(query, true, false, true); } @Override public AutoClosingIterable<Object[]> tupleIterable() { Query<Object[]> query = delegate.createHibernateQuery(this); return delegate.iterate(query, true, false, true); } @Override public int execute() { return delegate.execute(this); } @Override public BizQL setFirstResult(int first) { delegate.setFirstResult(first); return this; } @Override public BizQL setMaxResults(int max) { delegate.setMaxResults(max); return this; } }
lgpl-2.1
rambabu0006/onesevenhome
core-model/src/main/java/com/salesmanager/core/model/customer/WallPaperPortfolio.java
3719
package com.salesmanager.core.model.customer; import java.math.BigDecimal; import java.util.Date; import javax.persistence.Column; import javax.persistence.Entity; import javax.persistence.GeneratedValue; import javax.persistence.GenerationType; import javax.persistence.Id; import javax.persistence.JoinColumn; import javax.persistence.ManyToOne; import javax.persistence.OneToOne; import javax.persistence.Table; import javax.persistence.TableGenerator; import javax.persistence.Temporal; import javax.persistence.TemporalType; import javax.persistence.Transient; import com.salesmanager.core.constants.SchemaConstant; import com.salesmanager.core.model.catalog.product.price.FinalPrice; import com.salesmanager.core.model.generic.SalesManagerEntity; import com.salesmanager.core.model.services.Services; @Entity @Table(name = "WALLPAPER_PORTFOLIO", schema=SchemaConstant.SALESMANAGER_SCHEMA) public class WallPaperPortfolio extends SalesManagerEntity<Long, WallPaperPortfolio> { /** * */ private static final long serialVersionUID = 1L; @Id @Column(name = "ID") @TableGenerator(name = "TABLE_GEN", table = "SM_SEQUENCER", pkColumnName = "SEQ_NAME", valueColumnName = "SEQ_COUNT", pkColumnValue = "WALLPAPER_PORTFOLIO_SEQ_NEXT_VAL") @GeneratedValue(strategy = GenerationType.TABLE, generator = "TABLE_GEN") private Long id; @Temporal(TemporalType.DATE) @Column(name="CREATE_DATE") private Date createDate; @ManyToOne(targetEntity = Customer.class) @JoinColumn(name = "WALLPAPER_ID", nullable = false) private Customer customer; @Column (name ="PORTFOLIO_NAME", length=200) private String portfolioName; @Column (name ="IMAGE_URL", length=200) private String imageURL; @Column(name = "PRICE") private BigDecimal price; @Column (name ="SIZE", length=50) private String size; @Column (name ="THICKNESS", length=50) private String thickness; @Column (name ="BRAND", length=50) private String brand; @Column (name ="ADMIN_APPROVE_STATUS", length=5) private String status = "N"; @Column (name ="SERVICE_CHARGES") private BigDecimal serviceCharges; @Transient private Integer quantity = new Integer(0); public Integer getQuantity() { return quantity; } public void setQuantity(Integer quantity) { this.quantity = quantity; } public Long getId() { return id; } public void setId(Long id) { this.id = id; } public Date getCreateDate() { return createDate; } public void setCreateDate(Date createDate) { this.createDate = createDate; } public Customer getCustomer() { return customer; } public void setCustomer(Customer customer) { this.customer = customer; } public String getPortfolioName() { return portfolioName; } public void setPortfolioName(String portfolioName) { this.portfolioName = portfolioName; } public String getImageURL() { return imageURL; } public void setImageURL(String imageURL) { this.imageURL = imageURL; } public BigDecimal getPrice() { return price; } public void setPrice(BigDecimal price) { this.price = price; } public String getSize() { return size; } public void setSize(String size) { this.size = size; } public String getThickness() { return thickness; } public void setThickness(String thickness) { this.thickness = thickness; } public String getBrand() { return brand; } public void setBrand(String brand) { this.brand = brand; } public String getStatus() { return status; } public void setStatus(String status) { this.status = status; } public BigDecimal getServiceCharges() { return serviceCharges; } public void setServiceCharges(BigDecimal serviceCharges) { this.serviceCharges = serviceCharges; } }
lgpl-2.1
SimonKagstrom/cibyl
syscalls/softfloat/implementation/__asinf_helper.java
139
public static int __asinf_helper(int _a) { float a = Float.intBitsToFloat(_a); return Float.floatToIntBits( (float)mMath.asin(a) ); }
lgpl-2.1
jsmithe/ari4java
classes/ch/loway/oss/ari4java/generated/ari_1_7_0/models/Variable_impl_ari_1_7_0.java
1118
package ch.loway.oss.ari4java.generated.ari_1_7_0.models; // ---------------------------------------------------- // THIS CLASS WAS GENERATED AUTOMATICALLY // PLEASE DO NOT EDIT // Generated on: Sat Feb 04 15:23:09 CET 2017 // ---------------------------------------------------- import ch.loway.oss.ari4java.generated.*; import com.fasterxml.jackson.databind.annotation.JsonDeserialize; import java.util.Date; import java.util.List; import java.util.Map; /********************************************************** * The value of a channel variable * * Defined in file: asterisk.json * Generated by: Model *********************************************************/ public class Variable_impl_ari_1_7_0 implements Variable, java.io.Serializable { private static final long serialVersionUID = 1L; /** The value of the variable requested */ private String value; public String getValue() { return value; } @JsonDeserialize( as=String.class ) public void setValue(String val ) { value = val; } /** No missing signatures from interface */ }
lgpl-3.0
haisamido/SFDaaS
src/org/orekit/time/TDBScale.java
2874
/* Copyright 2002-2010 CS Communication & Systèmes * Licensed to CS Communication & Syst�mes (CS) under one or more * contributor license agreements. See the NOTICE file distributed with * this work for additional information regarding copyright ownership. * CS licenses this file to You under the Apache License, Version 2.0 * (the "License"); you may not use this file except in compliance with * the License. You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package org.orekit.time; import org.orekit.utils.Constants; /** Barycentric Dynamic Time. * <p>Time used to take account of time dilation when calculating orbits of planets, * asteroids, comets and interplanetary spacecraft in the Solar system. It was based * on a Dynamical time scale but was not well defined and not rigorously correct as * a relativistic time scale. It was subsequently deprecated in favour of * Barycentric Coordinate Time (TCB), but at the 2006 General Assembly of the * International Astronomical Union TDB was rehabilitated by making it a specific * fixed linear transformation of TCB.</p> * <p>By convention, TDB = TT + 0.001658 sin(g) + 0.000014 sin(2g)seconds * where g = 357.53 + 0.9856003 (JD - 2451545) degrees.</p> * @author Aude Privat * @version $Revision:1665 $ $Date:2008-06-11 12:12:59 +0200 (mer., 11 juin 2008) $ */ public class TDBScale implements TimeScale { /** Serializable UID. */ private static final long serialVersionUID = -4138483908215161856L; /** Package private constructor for the factory. */ TDBScale() { } /** {@inheritDoc} */ public double offsetFromTAI(final AbsoluteDate date) { final double dtDays = date.durationFrom(AbsoluteDate.J2000_EPOCH) / Constants.JULIAN_DAY; final double g = Math.toRadians(357.53 + 0.9856003 * dtDays); return TimeScalesFactory.getTT().offsetFromTAI(date) + (0.001658 * Math.sin(g) + 0.000014 * Math.sin(2 * g)); } /** {@inheritDoc} */ public double offsetToTAI(final DateComponents date, final TimeComponents time) { final AbsoluteDate reference = new AbsoluteDate(date, time, TimeScalesFactory.getTAI()); double offset = 0; for (int i = 0; i < 3; i++) { offset = -offsetFromTAI(reference.shiftedBy(offset)); } return offset; } /** {@inheritDoc} */ public String getName() { return "TDB"; } /** {@inheritDoc} */ public String toString() { return getName(); } }
lgpl-3.0
Unknow0/kyhtanil
server/src/main/java/unknow/kyhtanil/server/system/ProjectileSystem.java
1563
package unknow.kyhtanil.server.system; import java.util.function.IntPredicate; import com.artemis.Aspect; import com.artemis.ComponentMapper; import com.artemis.systems.IteratingSystem; import com.artemis.utils.IntBag; import unknow.kyhtanil.common.component.Position; import unknow.kyhtanil.common.component.StatShared; import unknow.kyhtanil.server.component.Projectile; import unknow.kyhtanil.server.manager.LocalizedManager; import unknow.kyhtanil.server.manager.UUIDManager; /** * manage projectile life time and on hit effect * * @author unknow */ public class ProjectileSystem extends IteratingSystem { private LocalizedManager locManager; private UUIDManager uuid; private ComponentMapper<Projectile> projectile; private ComponentMapper<Position> position; private ComponentMapper<StatShared> mobInfo; private IntPredicate c = e -> mobInfo.has(e); /** * create new ProjectileSystem */ public ProjectileSystem() { super(Aspect.all(Projectile.class, Position.class)); } @Override protected void process(int e) { Projectile proj = projectile.get(e); Position p = position.get(e); Integer src = uuid.getEntity(proj.source); if (src == null) { world.delete(e); return; } IntBag potential = locManager.get(p.x, p.y, 50, c); // TODO width & collision for (int i = 0; i < potential.size(); i++) { int t = potential.get(i); if (t == src.intValue()) continue; if (p.distance(position.get(t)) < 16) { if (proj.onHit != null) proj.onHit.accept(t); world.delete(e); return; } } } }
lgpl-3.0
galleon1/chocolate-milk
src/org/chocolate_milk/model/descriptors/ListDelRqTypeDescriptor.java
7540
/* * This class was automatically generated with * <a href="http://www.castor.org">Castor 1.3.1</a>, using an XML * Schema. * $Id: ListDelRqTypeDescriptor.java,v 1.1.1.1 2010-05-04 22:06:00 ryan Exp $ */ package org.chocolate_milk.model.descriptors; //---------------------------------/ //- Imported classes and packages -/ //---------------------------------/ import org.chocolate_milk.model.ListDelRqType; /** * Class ListDelRqTypeDescriptor. * * @version $Revision: 1.1.1.1 $ $Date: 2010-05-04 22:06:00 $ */ public class ListDelRqTypeDescriptor extends org.exolab.castor.xml.util.XMLClassDescriptorImpl { //--------------------------/ //- Class/Member Variables -/ //--------------------------/ /** * Field _elementDefinition. */ private boolean _elementDefinition; /** * Field _nsPrefix. */ private java.lang.String _nsPrefix; /** * Field _nsURI. */ private java.lang.String _nsURI; /** * Field _xmlName. */ private java.lang.String _xmlName; /** * Field _identity. */ private org.exolab.castor.xml.XMLFieldDescriptor _identity; //----------------/ //- Constructors -/ //----------------/ public ListDelRqTypeDescriptor() { super(); _xmlName = "ListDelRqType"; _elementDefinition = false; //-- set grouping compositor setCompositorAsSequence(); org.exolab.castor.xml.util.XMLFieldDescriptorImpl desc = null; org.exolab.castor.mapping.FieldHandler handler = null; org.exolab.castor.xml.FieldValidator fieldValidator = null; //-- initialize attribute descriptors //-- _requestID desc = new org.exolab.castor.xml.util.XMLFieldDescriptorImpl(java.lang.String.class, "_requestID", "requestID", org.exolab.castor.xml.NodeType.Attribute); desc.setImmutable(true); handler = new org.exolab.castor.xml.XMLFieldHandler() { @Override public java.lang.Object getValue( java.lang.Object object ) throws IllegalStateException { ListDelRqType target = (ListDelRqType) object; return target.getRequestID(); } @Override public void setValue( java.lang.Object object, java.lang.Object value) throws IllegalStateException, IllegalArgumentException { try { ListDelRqType target = (ListDelRqType) object; target.setRequestID( (java.lang.String) value); } catch (java.lang.Exception ex) { throw new IllegalStateException(ex.toString()); } } @Override @SuppressWarnings("unused") public java.lang.Object newInstance(java.lang.Object parent) { return null; } }; desc.setSchemaType("string"); desc.setHandler(handler); desc.setMultivalued(false); addFieldDescriptor(desc); //-- validation code for: _requestID fieldValidator = new org.exolab.castor.xml.FieldValidator(); { //-- local scope org.exolab.castor.xml.validators.StringValidator typeValidator; typeValidator = new org.exolab.castor.xml.validators.StringValidator(); fieldValidator.setValidator(typeValidator); typeValidator.setWhiteSpace("preserve"); } desc.setValidator(fieldValidator); //-- initialize element descriptors //-- _listDel desc = new org.exolab.castor.xml.util.XMLFieldDescriptorImpl(org.chocolate_milk.model.ListDel.class, "_listDel", "-error-if-this-is-used-", org.exolab.castor.xml.NodeType.Element); handler = new org.exolab.castor.xml.XMLFieldHandler() { @Override public java.lang.Object getValue( java.lang.Object object ) throws IllegalStateException { ListDelRqType target = (ListDelRqType) object; return target.getListDel(); } @Override public void setValue( java.lang.Object object, java.lang.Object value) throws IllegalStateException, IllegalArgumentException { try { ListDelRqType target = (ListDelRqType) object; target.setListDel( (org.chocolate_milk.model.ListDel) value); } catch (java.lang.Exception ex) { throw new IllegalStateException(ex.toString()); } } @Override @SuppressWarnings("unused") public java.lang.Object newInstance(java.lang.Object parent) { return new org.chocolate_milk.model.ListDel(); } }; desc.setSchemaType("org.chocolate_milk.model.ListDel"); desc.setHandler(handler); desc.setContainer(true); desc.setClassDescriptor(new org.chocolate_milk.model.descriptors.ListDelDescriptor()); desc.setRequired(true); desc.setMultivalued(false); addFieldDescriptor(desc); addSequenceElement(desc); //-- validation code for: _listDel fieldValidator = new org.exolab.castor.xml.FieldValidator(); fieldValidator.setMinOccurs(1); { //-- local scope } desc.setValidator(fieldValidator); } //-----------/ //- Methods -/ //-----------/ /** * Method getAccessMode. * * @return the access mode specified for this class. */ @Override() public org.exolab.castor.mapping.AccessMode getAccessMode( ) { return null; } /** * Method getIdentity. * * @return the identity field, null if this class has no * identity. */ @Override() public org.exolab.castor.mapping.FieldDescriptor getIdentity( ) { return _identity; } /** * Method getJavaClass. * * @return the Java class represented by this descriptor. */ @Override() public java.lang.Class getJavaClass( ) { return org.chocolate_milk.model.ListDelRqType.class; } /** * Method getNameSpacePrefix. * * @return the namespace prefix to use when marshaling as XML. */ @Override() public java.lang.String getNameSpacePrefix( ) { return _nsPrefix; } /** * Method getNameSpaceURI. * * @return the namespace URI used when marshaling and * unmarshaling as XML. */ @Override() public java.lang.String getNameSpaceURI( ) { return _nsURI; } /** * Method getValidator. * * @return a specific validator for the class described by this * ClassDescriptor. */ @Override() public org.exolab.castor.xml.TypeValidator getValidator( ) { return this; } /** * Method getXMLName. * * @return the XML Name for the Class being described. */ @Override() public java.lang.String getXMLName( ) { return _xmlName; } /** * Method isElementDefinition. * * @return true if XML schema definition of this Class is that * of a global * element or element with anonymous type definition. */ public boolean isElementDefinition( ) { return _elementDefinition; } }
lgpl-3.0
jjettenn/molgenis
molgenis-platform-integration-tests/src/test/java/org/molgenis/integrationtest/platform/datatypeediting/EnumAttributeTypeUpdateTest.java
6296
package org.molgenis.integrationtest.platform.datatypeediting; import org.molgenis.data.meta.AttributeType; import org.molgenis.data.validation.MolgenisValidationException; import org.molgenis.integrationtest.platform.PlatformITConfig; import org.springframework.test.context.ContextConfiguration; import org.testng.annotations.*; import static org.molgenis.data.meta.AttributeType.*; import static org.testng.Assert.*; @ContextConfiguration(classes = { PlatformITConfig.class }) public class EnumAttributeTypeUpdateTest extends AbstractAttributeTypeUpdateTest { @BeforeClass private void setup() { super.setup(ENUM, STRING); } @AfterMethod private void afterMethod() { super.afterMethod(ENUM); } @AfterClass public void afterClass() { super.afterClass(); } @DataProvider(name = "validConversionData") public Object[][] validConversionData() { return new Object[][] { { "1", STRING, "1" }, { "1", TEXT, "1" }, { "1", INT, 1 }, { "1", LONG, 1L } }; } /** * Valid conversion cases for ENUM to: * STRING, TEXT, INT, LONG * * @param valueToConvert The value that will be converted * @param typeToConvertTo The type to convert to * @param convertedValue The expected value after converting the type */ @Test(dataProvider = "validConversionData") public void testValidConversion(String valueToConvert, AttributeType typeToConvertTo, Object convertedValue) { testTypeConversion(valueToConvert, typeToConvertTo); // Assert if conversion was successful assertEquals(getActualDataType(), typeToConvertTo); assertEquals(getActualValue(), convertedValue); } @DataProvider(name = "invalidConversionTestCases") public Object[][] invalidConversionTestCases() { return new Object[][] { { "2b", INT, MolgenisValidationException.class, "Value [2b] of this entity attribute is not of type [INT or LONG]." }, { "2b", LONG, MolgenisValidationException.class, "Value [2b] of this entity attribute is not of type [INT or LONG]." }, { "1", DECIMAL, MolgenisValidationException.class, "Attribute data type update from [ENUM] to [DECIMAL] not allowed, allowed types are [INT, LONG, STRING, TEXT]" }, { "1", XREF, MolgenisValidationException.class, "Attribute data type update from [ENUM] to [XREF] not allowed, allowed types are [INT, LONG, STRING, TEXT]" }, { "1", CATEGORICAL, MolgenisValidationException.class, "Attribute data type update from [ENUM] to [CATEGORICAL] not allowed, allowed types are [INT, LONG, STRING, TEXT]" }, { "1", DATE, MolgenisValidationException.class, "Attribute data type update from [ENUM] to [DATE] not allowed, allowed types are [INT, LONG, STRING, TEXT]" }, { "1", DATE_TIME, MolgenisValidationException.class, "Attribute data type update from [ENUM] to [DATE_TIME] not allowed, allowed types are [INT, LONG, STRING, TEXT]" }, { "1", MREF, MolgenisValidationException.class, "Attribute data type update from [ENUM] to [MREF] not allowed, allowed types are [INT, LONG, STRING, TEXT]" }, { "1", CATEGORICAL_MREF, MolgenisValidationException.class, "Attribute data type update from [ENUM] to [CATEGORICAL_MREF] not allowed, allowed types are [INT, LONG, STRING, TEXT]" }, { "1", EMAIL, MolgenisValidationException.class, "Attribute data type update from [ENUM] to [EMAIL] not allowed, allowed types are [INT, LONG, STRING, TEXT]" }, { "1", HTML, MolgenisValidationException.class, "Attribute data type update from [ENUM] to [HTML] not allowed, allowed types are [INT, LONG, STRING, TEXT]" }, { "1", HYPERLINK, MolgenisValidationException.class, "Attribute data type update from [ENUM] to [HYPERLINK] not allowed, allowed types are [INT, LONG, STRING, TEXT]" }, { "1", COMPOUND, MolgenisValidationException.class, "Attribute data type update from [ENUM] to [COMPOUND] not allowed, allowed types are [INT, LONG, STRING, TEXT]" }, { "1", FILE, MolgenisValidationException.class, "Attribute data type update from [ENUM] to [FILE] not allowed, allowed types are [INT, LONG, STRING, TEXT]" }, { "1", BOOL, MolgenisValidationException.class, "Attribute data type update from [ENUM] to [BOOL] not allowed, allowed types are [INT, LONG, STRING, TEXT]" }, { "1b", STRING, MolgenisValidationException.class, "Invalid [enum] value [1b] for attribute [mainAttribute] of entity [null] with type [MAIN_ENTITY]. Value must be one of [1, 2b, abc]" }, { "1", SCRIPT, MolgenisValidationException.class, "Attribute data type update from [ENUM] to [SCRIPT] not allowed, allowed types are [INT, LONG, STRING, TEXT]" }, { "1", ONE_TO_MANY, MolgenisValidationException.class, "Invalid [xref] value [] for attribute [Referenced entity] of entity [mainAttribute] with type [sys_md_Attribute]. Offended expression: $('refEntityType').isNull().and($('type').matches(/^(categorical|categoricalmref|file|mref|onetomany|xref)$/).not()).or($('refEntityType').isNull().not().and($('type').matches(/^(categorical|categoricalmref|file|mref|onetomany|xref)$/))).value().Invalid [xref] value [] for attribute [Mapped by] of entity [mainAttribute] with type [sys_md_Attribute]. Offended expression: $('mappedBy').isNull().and($('type').eq('onetomany').not()).or($('mappedBy').isNull().not().and($('type').eq('onetomany'))).value()" } }; } /** * Invalid conversions cases for ENUM to: * INT, LONG, DECIMAL, XREF, CATEGORICAL, DATE, DATE_TIME, MREF, CATEGORICAL_MREF, EMAIL, HTML, HYPERLINK, COMPOUND, FILE, BOOL, STRING, SCRIPT, ONE_TO_MANY * * @param valueToConvert The value that will be converted * @param typeToConvertTo The type to convert to * @param exceptionClass The expected class of the exception that will be thrown * @param exceptionMessage The expected exception message */ @Test(dataProvider = "invalidConversionTestCases") public void testInvalidConversion(String valueToConvert, AttributeType typeToConvertTo, Class exceptionClass, String exceptionMessage) { try { testTypeConversion(valueToConvert, typeToConvertTo); fail("Conversion should have failed"); } catch (Exception exception) { assertTrue(exception.getClass().isAssignableFrom(exceptionClass)); assertEquals(exception.getMessage(), exceptionMessage); } } }
lgpl-3.0
Ja-ake/Common-Chicken-Runtime-Engine
CCRE_Igneous_cRIO/src/java/io/ObjectInputStream.java
1533
/* * Copyright 2014 Colby Skeggs. * * This file is part of the CCRE, the Common Chicken Runtime Engine. * * The CCRE is free software: you can redistribute it and/or modify it under the * terms of the GNU Lesser General Public License as published by the Free * Software Foundation, either version 3 of the License, or (at your option) any * later version. * * The CCRE is distributed in the hope that it will be useful, but WITHOUT ANY * WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR * A PARTICULAR PURPOSE. See the GNU Lesser General Public License for more * details. * * You should have received a copy of the GNU Lesser General Public License * along with the CCRE. If not, see <http://www.gnu.org/licenses/>. */ package java.io; /** * This is a not-really-implemented implementation of java.io.ObjectInputStream. * Don't use this. It is used when Retrotranslator downgrades the code to 1.3, * because 1.3 doesn't have ObjectInputStream. It doesn't have any functionality * because serialization doesn't work like this in 1.3. * * @see java.io.ObjectInputStream * @author skeggsc */ public class ObjectInputStream { /** * A faked method for the downgrade version of ObjectInputStream. * * @throws IOException (faked) * @throws ClassNotFoundException (faked) */ public void defaultReadObject() throws IOException, ClassNotFoundException { throw new RuntimeException("ObjectInputStreams are unusable when downgraded!"); } }
lgpl-3.0
SonarOpenCommunity/sonar-cxx
cxx-sensors/src/main/java/org/sonar/cxx/sensors/tests/dotnet/CxxUnitTestResultsImportSensor.java
4956
/* * C++ Community Plugin (cxx plugin) * Copyright (C) 2010-2022 SonarOpenCommunity * http://github.com/SonarOpenCommunity/sonar-cxx * * This program is free software; you can redistribute it and/or * modify it under the terms of the GNU Lesser General Public * License as published by the Free Software Foundation; either * version 3 of the License, or (at your option) any later version. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Lesser General Public License for more details. * * You should have received a copy of the GNU Lesser General Public License * along with this program; if not, write to the Free Software Foundation, * Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA. */ package org.sonar.cxx.sensors.tests.dotnet; // origin https://github.com/SonarSource/sonar-dotnet-tests-library/ // SonarQube .NET Tests Library // Copyright (C) 2014-2017 SonarSource SA // mailto:info AT sonarsource DOT com import java.io.File; import java.io.Serializable; import java.util.Arrays; import java.util.Collections; import java.util.List; import org.sonar.api.batch.sensor.SensorContext; import org.sonar.api.batch.sensor.SensorDescriptor; import org.sonar.api.config.PropertyDefinition; import org.sonar.api.measures.CoreMetrics; import org.sonar.api.measures.Metric; import org.sonar.api.resources.Qualifiers; import org.sonar.api.scanner.sensor.ProjectSensor; public class CxxUnitTestResultsImportSensor implements ProjectSensor { private final WildcardPatternFileProvider wildcardPatternFileProvider = new WildcardPatternFileProvider(new File("."), File.separator); private final CxxUnitTestResultsAggregator unitTestResultsAggregator; private SensorContext context; public CxxUnitTestResultsImportSensor(CxxUnitTestResultsAggregator unitTestResultsAggregator) { this.unitTestResultsAggregator = unitTestResultsAggregator; } public static List<PropertyDefinition> properties() { var category = "CXX External Analyzers"; return Collections.unmodifiableList(Arrays.asList( PropertyDefinition.builder(UnitTestConfiguration.VISUAL_STUDIO_TEST_RESULTS_PROPERTY_KEY) .multiValues(true) .name("VSTest Report(s)") .description( "Paths to VSTest reports. Multiple paths may be comma-delimited, or included via wildcards." + " Note that while measures such as the number of tests are displayed at project level, no drilldown" + " is available." + " In the SonarQube UI, enter one entry per field." ) .category(category) .subCategory("Visual C++") .onQualifiers(Qualifiers.PROJECT) .build(), PropertyDefinition.builder(UnitTestConfiguration.NUNIT_TEST_RESULTS_PROPERTY_KEY) .multiValues(true) .name("NUnit Report(s)") .description( "Paths to NUnit execution reports. Multiple paths may be comma-delimited, or included via wildcards." + " Note that while measures such as the number of tests are displayed at project level, no drilldown" + " is available." + " In the SonarQube UI, enter one entry per field." ) .category(category) .subCategory("NUnit") .onQualifiers(Qualifiers.PROJECT) .build() )); } @Override public void describe(SensorDescriptor descriptor) { descriptor .name("CXX VSTest/NUnit Test report import") .onlyWhenConfiguration(conf -> new UnitTestConfiguration(conf).hasUnitTestResultsProperty()) .onlyOnLanguages("cxx", "cpp", "c++", "c"); } @Override public void execute(SensorContext context) { this.context = context; analyze(new UnitTestResults(), new UnitTestConfiguration(context.config())); } public void analyze(UnitTestResults unitTestResults, UnitTestConfiguration unitTestConf) { var aggregatedResults = unitTestResultsAggregator.aggregate(wildcardPatternFileProvider, unitTestResults, unitTestConf); if (aggregatedResults != null) { saveMetric(CoreMetrics.TESTS, aggregatedResults.tests()); saveMetric(CoreMetrics.TEST_ERRORS, aggregatedResults.errors()); saveMetric(CoreMetrics.TEST_FAILURES, aggregatedResults.failures()); saveMetric(CoreMetrics.SKIPPED_TESTS, aggregatedResults.skipped()); Long executionTime = aggregatedResults.executionTime(); if (executionTime != null) { saveMetric(CoreMetrics.TEST_EXECUTION_TIME, executionTime); } } } private <T extends Serializable> void saveMetric(Metric<T> metric, T value) { context.<T>newMeasure() .withValue(value) .forMetric(metric) .on(context.project()) .save(); } }
lgpl-3.0
cismet/watergis-client
src/main/java/de/cismet/cismap/custom/attributerule/QpRuleSet.java
16703
/*************************************************** * * cismet GmbH, Saarbruecken, Germany * * ... and it just works. * ****************************************************/ /* * To change this template, choose Tools | Templates * and open the template in the editor. */ package de.cismet.cismap.custom.attributerule; import Sirius.navigator.connection.SessionManager; import com.vividsolutions.jts.geom.Geometry; import com.vividsolutions.jts.geom.Point; import org.apache.log4j.Logger; import org.deegree.datatypes.Types; import java.awt.image.BufferedImage; import java.net.URL; import java.sql.Timestamp; import java.util.ArrayList; import java.util.Date; import java.util.HashMap; import java.util.List; import java.util.Map; import java.util.Timer; import java.util.TimerTask; import java.util.TreeMap; import javax.imageio.ImageIO; import javax.swing.JLabel; import javax.swing.table.TableCellEditor; import javax.swing.table.TableCellRenderer; import javax.swing.table.TableModel; import de.cismet.cids.custom.watergis.server.search.RemoveUnnusedRoute; import de.cismet.cids.server.search.CidsServerSearch; import de.cismet.cismap.cidslayer.CidsLayer; import de.cismet.cismap.cidslayer.CidsLayerFeature; import de.cismet.cismap.cidslayer.CidsLayerFeatureFilter; import de.cismet.cismap.cidslayer.CidsLayerReferencedComboEditor; import de.cismet.cismap.commons.features.Feature; import de.cismet.cismap.commons.features.FeatureServiceFeature; import de.cismet.cismap.commons.featureservice.FeatureServiceAttribute; import de.cismet.cismap.commons.gui.attributetable.DateCellEditor; import de.cismet.cismap.commons.gui.attributetable.FeatureCreator; import de.cismet.cismap.commons.gui.attributetable.SimpleAttributeTableModel; import de.cismet.cismap.commons.gui.piccolo.FeatureAnnotationSymbol; import de.cismet.cismap.commons.rasterservice.MapService; import de.cismet.cismap.commons.util.SelectionManager; import de.cismet.cismap.linearreferencing.RouteTableCellEditor; import de.cismet.cismap.linearreferencing.StationTableCellEditor; import de.cismet.watergis.broker.AppBroker; import de.cismet.watergis.gui.actions.gaf.ReportAction; import de.cismet.watergis.gui.panels.GafProf; import de.cismet.watergis.utils.AbstractCidsLayerListCellRenderer; import de.cismet.watergis.utils.LinkTableCellRenderer; /** * DOCUMENT ME! * * @author therter * @version $Revision$, $Date$ */ public class QpRuleSet extends WatergisDefaultRuleSet { //~ Static fields/initializers --------------------------------------------- private static final org.apache.log4j.Logger LOG = Logger.getLogger(QpRuleSet.class); public static final BufferedImage ARROW; public static final BufferedImage SELECTED_ARROW; static { try { final URL arrowUrl = QpRuleSet.class.getResource( "/de/cismet/watergis/res/icons16/angle.png"); ARROW = ImageIO.read(arrowUrl); final URL arrowSelectedUrl = QpRuleSet.class.getResource( "/de/cismet/watergis/res/icons16/angleSelected.png"); SELECTED_ARROW = ImageIO.read(arrowSelectedUrl); // ARROW_NULL = new FeatureAnnotationSymbol(new ImageIcon( // "/de/cismet/cids/custom/objecteditors/wrrl_db_mv/angle_null.png").getImage()); } catch (Exception ex) { LOG.fatal(ex, ex); throw new RuntimeException(ex); } } //~ Instance initializers -------------------------------------------------- { final DateType date = new DateType(false, true); typeMap.put("geom", new Geom(true, false)); typeMap.put("ww_gr", new Catalogue("k_ww_gr", true, true, new Numeric(4, 0, false, false))); typeMap.put("ba_cd", new Varchar(50, false, false)); typeMap.put("ba_st", new Numeric(10, 2, false, false)); typeMap.put("la_cd", new Numeric(20, 0, false, false)); typeMap.put("la_st", new Numeric(10, 2, false, false)); typeMap.put("l_st", new Catalogue("k_l_st", true, true, new Varchar(10, false, false))); typeMap.put("re", new Numeric(11, 2, true, false)); typeMap.put("ho", new Numeric(10, 2, true, false)); typeMap.put("qp_nr", new Numeric(20, 0, true, false)); typeMap.put("upl_name", new Varchar(50, true, false)); typeMap.put("upl_datum", new Varchar(10, true, false)); typeMap.put("upl_zeit", new Varchar(8, true, false)); typeMap.put("aufn_name", new Varchar(50, false, true)); typeMap.put("aufn_datum", date); typeMap.put("aufn_zeit", new Time(false, true)); typeMap.put("freigabe", new Catalogue("k_freigabe", true, true, new Varchar(10, false, false))); typeMap.put("titel", new Varchar(250, false, true)); typeMap.put("beschreib", new Varchar(250, false, true)); typeMap.put("bemerkung", new Varchar(250, false, true)); typeMap.put("fis_g_date", new DateTime(false, false)); typeMap.put("fis_g_user", new Varchar(50, false, false)); } //~ Methods ---------------------------------------------------------------- @Override public boolean isColumnEditable(final String columnName) { if (columnName.equals("ww_gr")) { return AppBroker.getInstance().getOwner().equalsIgnoreCase("Administratoren"); } else { // Sonderfall ba_st und ba_st sollen nicht bearbeitbar sein return !columnName.equals("fis_g_user") && !columnName.equals("fis_g_date") && !columnName.equals("geom") && !columnName.equals("id") && !columnName.equals("ho") && !columnName.equals("re") && !columnName.equals("qp_nr") && !columnName.equals("la_st") && !columnName.equals("la_cd") && !columnName.equals("upl_name") && !columnName.equals("upl_datum") && !columnName.equals("upl_zeit") && !columnName.equals("ba_cd") && !columnName.equals("ba_st"); } } @Override public Object afterEdit(final FeatureServiceFeature feature, final String column, final int row, final Object oldValue, final Object newValue) { idOfCurrentlyCheckedFeature = feature.getId(); if (column.equals("aufn_datum")) { if ((newValue != null) && (newValue instanceof Date)) { final Date d = (Date)newValue; // d.year = year - 1900 if ((d.getYear() < 0) || d.after(new Date())) { showMessage("Es sind nur Datumseingaben zwischen dem 01.01.1900 und heute erlaubt", column); return oldValue; } if ((d.getYear() >= 0) && (d.getYear() < 50)) { if ( !showSecurityQuestion( "Wert außerhalb Standardbereich (01.01.1950 .. heute) --> verwenden ?", column, newValue)) { return oldValue; } } } } return super.afterEdit(feature, column, row, oldValue, newValue); } @Override public TableCellRenderer getCellRenderer(final String columnName) { if (columnName.equals("qp_nr")) { return new LinkTableCellRenderer(JLabel.RIGHT); } else { return super.getCellRenderer(columnName); } } @Override public TableCellEditor getCellEditor(final String columnName) { if (columnName.equals("ba_cd")) { final RouteTableCellEditor editor = new RouteTableCellEditor("dlm25w.fg_ba", "ba_st", false); final String filterString = getRouteFilter(); if (filterString != null) { editor.setRouteQuery(filterString); } return editor; } else if (columnName.equals("ba_st")) { return new StationTableCellEditor(columnName); } else if (columnName.equals("ww_gr")) { CidsLayerFeatureFilter filter = null; if (!AppBroker.getInstance().getOwner().equalsIgnoreCase("Administratoren")) { final String userName = AppBroker.getInstance().getOwner(); filter = new CidsLayerFeatureFilter() { @Override public boolean accept(final CidsLayerFeature bean) { if (bean == null) { return false; } return bean.getProperty("owner").equals(userName); } }; } else { filter = new WwGrAdminFilter(); } return new CidsLayerReferencedComboEditor(new FeatureServiceAttribute( "ww_gr", String.valueOf(Types.INTEGER), true), filter); } else if (columnName.equals("l_st")) { final CidsLayerFeatureFilter filter = createCidsLayerFeatureFilter("qp"); final CidsLayerReferencedComboEditor editor = new CidsLayerReferencedComboEditor( new FeatureServiceAttribute( columnName, String.valueOf(Types.VARCHAR), true), filter); editor.setNullable(true); editor.setListRenderer(new AbstractCidsLayerListCellRenderer() { @Override protected String toString(final CidsLayerFeature bean) { return bean.getProperty("l_st") + " - " + bean.getProperty("name"); } }); return editor; } else if (columnName.equals("freigabe")) { final CidsLayerFeatureFilter filter = createCidsLayerFeatureFilter("qp"); final CidsLayerReferencedComboEditor editor = new CidsLayerReferencedComboEditor( new FeatureServiceAttribute( columnName, String.valueOf(Types.VARCHAR), true), filter); editor.setNullable(true); editor.setListRenderer(new AbstractCidsLayerListCellRenderer() { @Override protected String toString(final CidsLayerFeature bean) { return bean.getProperty("freigabe") + " - " + bean.getProperty("name"); } }); return editor; } else if (columnName.equals("ba_st")) { return new StationTableCellEditor(columnName); } else if (columnName.equals("aufn_datum")) { return new DateCellEditor(); } else { return null; } } @Override public void beforeSave(final FeatureServiceFeature feature) { adjustFisGDateAndFisGUser(feature); } @Override public void afterSave(final TableModel model) { if (model instanceof SimpleAttributeTableModel) { final List<FeatureServiceFeature> removedFeatures = ((SimpleAttributeTableModel)model).getRemovedFeature(); if ((removedFeatures != null) && !removedFeatures.isEmpty()) { final List<Feature> selectedFeaturesToRemove = new ArrayList<Feature>(); for (final FeatureServiceFeature feature : removedFeatures) { final List<Feature> selectedFeatures = SelectionManager.getInstance().getSelectedFeatures(); for (final Feature f : selectedFeatures) { if (f instanceof CidsLayerFeature) { final CidsLayerFeature clf = (CidsLayerFeature)f; if ((clf.getProperty("qp_nr") != null) && (feature.getProperty("qp_nr") != null)) { final Integer selectedFeatureBaCd = (Integer)(clf.getProperty("qp_nr")); final Integer deletedFeatureBaCd = (Integer)(feature.getProperty("qp_nr")); if (selectedFeatureBaCd.equals(deletedFeatureBaCd)) { selectedFeaturesToRemove.add(f); } } } } } if (!selectedFeaturesToRemove.isEmpty()) { SelectionManager.getInstance().removeSelectedFeatures(selectedFeaturesToRemove); } } } } @Override public String[] getAdditionalFieldNames() { return new String[] { "re", "ho" }; } @Override public int getIndexOfAdditionalFieldName(final String name) { if (name.equals("re")) { return 8; } else if (name.equals("ho")) { return 9; } else { return super.getIndexOfAdditionalFieldName(name); } } @Override public Object getAdditionalFieldValue(final java.lang.String propertyName, final FeatureServiceFeature feature) { Double value = null; final Geometry geom = feature.getGeometry(); if (geom instanceof Point) { if (propertyName.equals("re")) { value = ((Point)geom).getX(); } else if (propertyName.equals("ho")) { value = ((Point)geom).getY(); } } return value; } @Override public String getAdditionalFieldFormula(final String propertyName) { if (propertyName.equals("re")) { return "st_x(geom)"; } else if (propertyName.equals("ho")) { return "st_y(geom)"; } return null; } @Override public Class getAdditionalFieldClass(final int index) { return Double.class; } @Override public FeatureCreator getFeatureCreator() { return null; } @Override public Map<String, Object> getDefaultValues() { final Map properties = new HashMap(); if ((AppBroker.getInstance().getOwnWwGr() != null)) { properties.put("ww_gr", AppBroker.getInstance().getOwnWwGr()); } else { properties.put("ww_gr", AppBroker.getInstance().getNiemandWwGr()); } return properties; } @Override public boolean isCatThree() { return true; } @Override public void mouseClicked(final FeatureServiceFeature feature, final String columnName, final Object value, final int clickCount) { if (columnName.equals("qp_nr")) { if ((value instanceof Integer) && (clickCount == 1) && (feature instanceof CidsLayerFeature)) { // if (DownloadManagerDialog.showAskingForUserTitle(AppBroker.getInstance().getRootWindow())) { // final String jobname = DownloadManagerDialog.getJobname(); // final CidsLayerFeature cidsFeature = (CidsLayerFeature)feature; // final String filename = value.toString(); // final String extension = ".pdf"; // // DownloadManager.instance().add(new QpDownload( // filename, // extension, // jobname, // null, // cidsFeature)); // } final ReportAction action = new ReportAction(); action.actionPerformed(null); } } } @Override public FeatureAnnotationSymbol getPointAnnotationSymbol(final FeatureServiceFeature feature) { final FeatureAnnotationSymbol symb; if ((GafProf.selectedFeature != null) && (GafProf.selectedFeature.getId() == feature.getId())) { symb = new FeatureAnnotationSymbol(SELECTED_ARROW); } else { symb = new FeatureAnnotationSymbol(ARROW); } symb.setSweetSpotX(0.5); symb.setSweetSpotY(0.5); return symb; } @Override public boolean hasCustomExportFeaturesMethod() { return true; } @Override public void exportFeatures() { AppBroker.getInstance().getGafExport().actionPerformed(null); } @Override public boolean hasCustomPrintFeaturesMethod() { return true; } @Override public void printFeatures() { AppBroker.getInstance().getGafPrint().actionPerformed(null); } }
lgpl-3.0
joansmith/sonarqube
server/sonar-server/src/main/java/org/sonar/server/metric/DefaultMetricFinder.java
4019
/* * SonarQube * Copyright (C) 2009-2016 SonarSource SA * mailto:contact AT sonarsource DOT com * * This program is free software; you can redistribute it and/or * modify it under the terms of the GNU Lesser General Public * License as published by the Free Software Foundation; either * version 3 of the License, or (at your option) any later version. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Lesser General Public License for more details. * * You should have received a copy of the GNU Lesser General Public License * along with this program; if not, write to the Free Software Foundation, * Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA. */ package org.sonar.server.metric; import com.google.common.base.Function; import com.google.common.base.Predicate; import java.io.Serializable; import java.util.Collection; import java.util.List; import javax.annotation.Nonnull; import org.sonar.api.measures.Metric; import org.sonar.api.measures.MetricFinder; import org.sonar.db.metric.MetricDto; import org.sonar.db.DbSession; import org.sonar.db.MyBatis; import org.sonar.server.db.DbClient; import static com.google.common.collect.FluentIterable.from; public class DefaultMetricFinder implements MetricFinder { private final DbClient dbClient; public DefaultMetricFinder(DbClient dbClient) { this.dbClient = dbClient; } @Override public Metric findById(int id) { DbSession session = dbClient.openSession(false); try { MetricDto dto = dbClient.metricDao().selectById(session, id); if (dto != null && dto.isEnabled()) { return ToMetric.INSTANCE.apply(dto); } return null; } finally { MyBatis.closeQuietly(session); } } @Override public Metric findByKey(String key) { DbSession session = dbClient.openSession(false); try { MetricDto dto = dbClient.metricDao().selectByKey(session, key); if (dto != null && dto.isEnabled()) { return ToMetric.INSTANCE.apply(dto); } return null; } finally { MyBatis.closeQuietly(session); } } @Override public Collection<Metric> findAll(List<String> metricKeys) { DbSession session = dbClient.openSession(false); try { List<MetricDto> dtos = dbClient.metricDao().selectByKeys(session, metricKeys); return from(dtos).filter(IsEnabled.INSTANCE).transform(ToMetric.INSTANCE).toList(); } finally { MyBatis.closeQuietly(session); } } @Override public Collection<Metric> findAll() { DbSession session = dbClient.openSession(false); try { List<MetricDto> dtos = dbClient.metricDao().selectEnabled(session); return from(dtos).transform(ToMetric.INSTANCE).toList(); } finally { MyBatis.closeQuietly(session); } } private enum IsEnabled implements Predicate<MetricDto> { INSTANCE; @Override public boolean apply(@Nonnull MetricDto dto) { return dto.isEnabled(); } } private enum ToMetric implements Function<MetricDto, Metric> { INSTANCE; @Override public Metric apply(@Nonnull MetricDto dto) { Metric<Serializable> metric = new Metric<>(); metric.setId(dto.getId()); metric.setKey(dto.getKey()); metric.setDescription(dto.getDescription()); metric.setName(dto.getShortName()); metric.setBestValue(dto.getBestValue()); metric.setDomain(dto.getDomain()); metric.setEnabled(dto.isEnabled()); metric.setDirection(dto.getDirection()); metric.setHidden(dto.isHidden()); metric.setQualitative(dto.isQualitative()); metric.setType(Metric.ValueType.valueOf(dto.getValueType())); metric.setOptimizedBestValue(dto.isOptimizedBestValue()); metric.setUserManaged(dto.isUserManaged()); metric.setWorstValue(dto.getWorstValue()); return metric; } } }
lgpl-3.0
ideaconsult/i5
iuclid_5_5-io/src/main/java/eu/europa/echa/schemas/iuclid5/_20130101/studyrecord/EC_CHRONFISHTOX_SECTION/package-info.java
602
// // This file was generated by the JavaTM Architecture for XML Binding(JAXB) Reference Implementation, vJAXB 2.1.10 in JDK 6 // See <a href="http://java.sun.com/xml/jaxb">http://java.sun.com/xml/jaxb</a> // Any modifications to this file will be lost upon recompilation of the source schema. // Generated on: 2014.01.15 at 10:52:33 PM EET // @javax.xml.bind.annotation.XmlSchema(namespace = "http://echa.europa.eu/schemas/iuclid5/20130101", elementFormDefault = javax.xml.bind.annotation.XmlNsForm.QUALIFIED) package eu.europa.echa.schemas.iuclid5._20130101.studyrecord.EC_CHRONFISHTOX_SECTION;
lgpl-3.0
foyt/coops-sdk-java
src/main/java/fi/foyt/coops/model/Patch.java
812
package fi.foyt.coops.model; import java.util.Map; public class Patch { public Long getRevisionNumber() { return revisionNumber; } public void setRevisionNumber(Long revisionNumber) { this.revisionNumber = revisionNumber; } public String getPatch() { return patch; } public void setPatch(String patch) { this.patch = patch; } public String getAlgorithm() { return algorithm; } public void setAlgorithm(String algorithm) { this.algorithm = algorithm; } public Map<String, String> getProperties() { return properties; } public void setProperties(Map<String, String> properties) { this.properties = properties; } private Long revisionNumber; private String patch; private String algorithm; private Map<String, String> properties; }
lgpl-3.0
denarie/Portofino
portofino-chart/src/main/java/com/manydesigns/portofino/pageactions/chart/jfreechart/JFreeChartAction.java
15742
/* * Copyright (C) 2005-2017 ManyDesigns srl. All rights reserved. * http://www.manydesigns.com/ * * This is free software; you can redistribute it and/or modify it * under the terms of the GNU Lesser General Public License as * published by the Free Software Foundation; either version 3 of * the License, or (at your option) any later version. * * This software is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Lesser General Public License for more details. * * You should have received a copy of the GNU Lesser General Public * License along with this software; if not, write to the Free * Software Foundation, Inc., 51 Franklin St, Fifth Floor, Boston, MA * 02110-1301 USA, or see the FSF site: http://www.fsf.org. */ package com.manydesigns.portofino.pageactions.chart.jfreechart; import com.manydesigns.elements.ElementsThreadLocals; import com.manydesigns.elements.fields.Field; import com.manydesigns.elements.forms.Form; import com.manydesigns.elements.forms.FormBuilder; import com.manydesigns.elements.messages.SessionMessages; import com.manydesigns.elements.options.DefaultSelectionProvider; import com.manydesigns.elements.options.SelectionProvider; import com.manydesigns.elements.util.RandomUtil; import com.manydesigns.portofino.buttons.annotations.Button; import com.manydesigns.portofino.chart.ChartGenerator; import com.manydesigns.portofino.di.Inject; import com.manydesigns.portofino.logic.SelectionProviderLogic; import com.manydesigns.portofino.model.database.Database; import com.manydesigns.portofino.modules.DatabaseModule; import com.manydesigns.portofino.pageactions.AbstractPageAction; import com.manydesigns.portofino.pageactions.PageActionName; import com.manydesigns.portofino.pageactions.annotations.ConfigurationClass; import com.manydesigns.portofino.pageactions.annotations.ScriptTemplate; import com.manydesigns.portofino.pageactions.chart.jfreechart.configuration.JFreeChartConfiguration; import com.manydesigns.portofino.persistence.Persistence; import com.manydesigns.portofino.security.AccessLevel; import com.manydesigns.portofino.security.RequiresPermissions; import net.sourceforge.stripes.action.*; import net.sourceforge.stripes.util.UrlBuilder; import org.jfree.chart.JFreeChart; import org.slf4j.Logger; import org.slf4j.LoggerFactory; import javax.servlet.http.HttpServletResponse; import java.awt.*; import java.io.File; import java.io.FileInputStream; import java.io.FileNotFoundException; import java.io.InputStream; /* * @author Paolo Predonzani - paolo.predonzani@manydesigns.com * @author Angelo Lupo - angelo.lupo@manydesigns.com * @author Giampiero Granatella - giampiero.granatella@manydesigns.com * @author Alessio Stalla - alessio.stalla@manydesigns.com */ @RequiresPermissions(level = AccessLevel.VIEW) @ScriptTemplate("script_template.groovy") @ConfigurationClass(JFreeChartConfiguration.class) @PageActionName("Chart (with JFreeChart)") public class JFreeChartAction extends AbstractPageAction { public static final String copyright = "Copyright (C) 2005-2017 ManyDesigns srl"; //************************************************************************** // Constants //************************************************************************** public static final String CHART_FILENAME_FORMAT = "chart-{0}.png"; //************************************************************************** // Injections //************************************************************************** @Inject(DatabaseModule.PERSISTENCE) public Persistence persistence; //************************************************************************** // Web parameters //************************************************************************** public String chartId; public int width = 470; public int height = 354; public boolean antiAlias = true; public boolean borderVisible = true; //************************************************************************** // Model metadata //************************************************************************** public JFreeChartConfiguration chartConfiguration; //************************************************************************** // Presentation elements //************************************************************************** public Form form; public JFreeChart chart; public JFreeChartInstance jfreeChartInstance; public File file; public static final Logger logger = LoggerFactory.getLogger(JFreeChartAction.class); //************************************************************************** // Action default execute method //************************************************************************** @DefaultHandler public Resolution execute() { if(chartConfiguration == null) { return forwardToPageActionNotConfigured(); } try { // Run/generate the chart try { Thread.currentThread().setContextClassLoader(Class.class.getClassLoader()); generateChart(); } finally { Thread.currentThread().setContextClassLoader(JFreeChartAction.class.getClassLoader()); } chartId = RandomUtil.createRandomId(); String actionurl = context.getActionPath(); UrlBuilder chartResolution = new UrlBuilder(context.getLocale(), actionurl, false) .addParameter("chartId", chartId) .addParameter("chart", ""); String url = context.getRequest().getContextPath() + chartResolution.toString(); file = RandomUtil.getTempCodeFile(CHART_FILENAME_FORMAT, chartId); jfreeChartInstance = new JFreeChartInstance(chart, file, chartId, "Chart: " + chartConfiguration.getName(), width, height, url); } catch (Throwable e) { logger.error("Chart exception", e); return forwardToPageActionError(e); } return new ForwardResolution("/m/chart/jfreechart/display.jsp"); } public void generateChart() { ChartGenerator chartGenerator; if(chartConfiguration.getGeneratorClass() == null) { throw new IllegalStateException("Invalid chart type: " + chartConfiguration.getActualType()); } try { chartGenerator = chartConfiguration.getGeneratorClass().newInstance(); } catch (Exception e) { throw new RuntimeException("Invalid generator for chart", e); } chartGenerator.setAntiAlias(antiAlias); chartGenerator.setBorderVisible(borderVisible); chartGenerator.setHeight(height); chartGenerator.setWidth(width); chart = chartGenerator.generate(chartConfiguration, persistence, context.getLocale()); } public Resolution chart() throws FileNotFoundException { final File file = RandomUtil.getTempCodeFile(CHART_FILENAME_FORMAT, chartId); if(!file.exists()) { return new ErrorResolution(404); } final InputStream inputStream = new FileInputStream(file); //Cache the file, expire after 12h int expiresAfter = 12 * 60 * 60 * 1000; long now = System.currentTimeMillis(); HttpServletResponse response = context.getResponse(); response.setHeader("Cache-Control", "max-age=" + expiresAfter); response.setDateHeader("Last-Modified", now); response.setDateHeader("Expires", now + expiresAfter); response.setHeader("Pragma", ""); return new StreamingResolution("image/png", inputStream) { @Override protected void stream(HttpServletResponse response) throws Exception { super.stream(response); if(!file.delete()) { logger.warn("Could not delete temporary file for chart: " + file.getAbsolutePath()); } } }; } //************************************************************************** // Configuration //************************************************************************** public static final String[][] CONFIGURATION_FIELDS = {{"name", "type", "orientation", "legend", "database", "query", "urlExpression"}}; public static final String[] chartTypes1D = { JFreeChartConfiguration.Type.PIE.name(), JFreeChartConfiguration.Type.PIE3D.name(), JFreeChartConfiguration.Type.RING.name() }; public static final String[] chartTypes2D = { JFreeChartConfiguration.Type.AREA.name(), JFreeChartConfiguration.Type.BAR.name(), JFreeChartConfiguration.Type.BAR3D.name(), JFreeChartConfiguration.Type.LINE.name(), JFreeChartConfiguration.Type.LINE3D.name(), JFreeChartConfiguration.Type.STACKED_BAR.name(), JFreeChartConfiguration.Type.STACKED_BAR_3D.name() }; public final String[] chartTypeValues = new String[chartTypes1D.length + chartTypes2D.length + 2]; public final String[] chartTypeLabels = new String[chartTypeValues.length]; @Button(list = "pageHeaderButtons", titleKey = "configure", order = 1, icon = Button.ICON_WRENCH) @RequiresPermissions(level = AccessLevel.DEVELOP) public Resolution configure() { prepareConfigurationForms(); return new ForwardResolution("/m/chart/jfreechart/configure.jsp"); } @Override protected void prepareConfigurationForms() { super.prepareConfigurationForms(); String prefix = "com.manydesigns.portofino.jfreechart.type."; chartTypeValues[0] = "--1D"; chartTypeLabels[0] = "-- 1D charts --"; for(int i = 0; i < chartTypes1D.length; i++) { chartTypeValues[i + 1] = chartTypes1D[i]; chartTypeLabels[i + 1] = ElementsThreadLocals.getText(prefix + chartTypes1D[i], chartTypes1D[i]); } chartTypeValues[chartTypes1D.length + 1] = "--2D"; chartTypeLabels[chartTypes1D.length + 1] = "-- 2D charts --"; for(int i = 0; i < chartTypes2D.length; i++) { chartTypeValues[i + 2 + chartTypes1D.length] = chartTypes2D[i]; chartTypeLabels[i + 2 + chartTypes1D.length] = ElementsThreadLocals.getText(prefix + chartTypes2D[i], chartTypes2D[i]); } SelectionProvider databaseSelectionProvider = SelectionProviderLogic.createSelectionProvider("database", persistence.getModel().getDatabases(), Database.class, null, new String[]{"databaseName"}); DefaultSelectionProvider typeSelectionProvider = new DefaultSelectionProvider("type"); for(int i = 0; i < chartTypeValues.length; i++) { typeSelectionProvider.appendRow(chartTypeValues[i], chartTypeLabels[i], true); } String[] orientationValues = { JFreeChartConfiguration.Orientation.HORIZONTAL.name(), JFreeChartConfiguration.Orientation.VERTICAL.name() }; String[] orientationLabels = { "Horizontal", "Vertical" }; DefaultSelectionProvider orientationSelectionProvider = new DefaultSelectionProvider("orientation"); for(int i = 0; i < orientationValues.length; i++) { orientationSelectionProvider.appendRow(orientationValues[i], orientationLabels[i], true); } form = new FormBuilder(JFreeChartConfiguration.class) .configFields(CONFIGURATION_FIELDS) .configFieldSetNames("Chart") .configSelectionProvider(typeSelectionProvider, "type") .configSelectionProvider(orientationSelectionProvider, "orientation") .configSelectionProvider(databaseSelectionProvider, "database") .build(); form.readFromObject(chartConfiguration); } @Button(list = "configuration", key = "update.configuration", order = 1, type = Button.TYPE_PRIMARY) @RequiresPermissions(level = AccessLevel.DEVELOP) public Resolution updateConfiguration() { prepareConfigurationForms(); form.readFromObject(chartConfiguration); form.readFromRequest(context.getRequest()); readPageConfigurationFromRequest(); boolean valid = form.validate(); valid = validatePageConfiguration() && valid; Field typeField = form.findFieldByPropertyName("type"); String typeValue = typeField.getStringValue(); boolean placeHolderValue = typeValue != null && typeValue.startsWith("--"); if(placeHolderValue) { valid = false; String errorMessage = ElementsThreadLocals.getTextProvider().getText("elements.error.field.required"); typeField.getErrors().add(errorMessage); SessionMessages.addErrorMessage(""); } if (valid) { updatePageConfiguration(); if(chartConfiguration == null) { chartConfiguration = new JFreeChartConfiguration(); } form.writeToObject(chartConfiguration); saveConfiguration(chartConfiguration); SessionMessages.addInfoMessage(ElementsThreadLocals.getText("configuration.updated.successfully")); return cancel(); } else { return new ForwardResolution("/m/chart/jfreechart/configure.jsp"); } } public Resolution preparePage() { if(!pageInstance.getParameters().isEmpty()) { return new ErrorResolution(404); } chartConfiguration = (JFreeChartConfiguration) pageInstance.getConfiguration(); return null; } //************************************************************************** // Getter/setter //************************************************************************** public String getChartId() { return chartId; } public void setChartId(String chartId) { this.chartId = chartId; } public int getWidth() { return width; } public void setWidth(int width) { this.width = width; } public int getHeight() { return height; } public void setHeight(int height) { this.height = height; } public boolean isAntiAlias() { return antiAlias; } public void setAntiAlias(boolean antiAlias) { this.antiAlias = antiAlias; } public boolean isBorderVisible() { return borderVisible; } public void setBorderVisible(boolean borderVisible) { this.borderVisible = borderVisible; } public JFreeChartConfiguration getChartConfiguration() { return chartConfiguration; } public void setChartConfiguration(JFreeChartConfiguration chartConfiguration) { this.chartConfiguration = chartConfiguration; } public Form getForm() { return form; } public void setForm(Form form) { this.form = form; } public JFreeChart getChart() { return chart; } public void setChart(JFreeChart chart) { this.chart = chart; } public JFreeChartInstance getJfreeChartInstance() { return jfreeChartInstance; } public void setJfreeChartInstance(JFreeChartInstance jfreeChartInstance) { this.jfreeChartInstance = jfreeChartInstance; } }
lgpl-3.0
carterjohn21/LetsModReboot
src/main/java/com/carterjohn21/letsmodreboot/LetsModReboot.java
1040
package com.carterjohn21.letsmodreboot; import com.carterjohn21.letsmodreboot.proxy.IProxy; import com.carterjohn21.letsmodreboot.reference.Reference; import cpw.mods.fml.common.Mod; import cpw.mods.fml.common.SidedProxy; import cpw.mods.fml.common.event.FMLInitializationEvent; import cpw.mods.fml.common.event.FMLPostInitializationEvent; import cpw.mods.fml.common.event.FMLPreInitializationEvent; @Mod(modid = Reference.MOD_ID, name = Reference.MOD_NAME, version=Reference.VERSION) public class LetsModReboot { @Mod.Instance(Reference.MOD_ID) public static LetsModReboot instance; @SidedProxy(clientSide ="com.carterjohn21.letsmodreboot.proxy.ClientProxy", serverSide ="com.carterjohn21.letsmodreboot.ServerProxy" ) public static IProxy proxy; @Mod.EventHandler void preinit(FMLPreInitializationEvent event) { } @Mod.EventHandler public void init(FMLInitializationEvent event) { } @Mod.EventHandler public void postinit(FMLPostInitializationEvent event) { } }
lgpl-3.0
galleon1/chocolate-milk
src/org/chocolate_milk/model/types/BillingRateQueryRqTypeMetaDataType.java
2605
/* * This class was automatically generated with * <a href="http://www.castor.org">Castor 1.3.1</a>, using an XML * Schema. * $Id: BillingRateQueryRqTypeMetaDataType.java,v 1.1.1.1 2010-05-04 22:06:02 ryan Exp $ */ package org.chocolate_milk.model.types; /** * Enumeration BillingRateQueryRqTypeMetaDataType. * * @version $Revision: 1.1.1.1 $ $Date: 2010-05-04 22:06:02 $ */ public enum BillingRateQueryRqTypeMetaDataType { //------------------/ //- Enum Constants -/ //------------------/ /** * Constant NOMETADATA */ NOMETADATA("NoMetaData"), /** * Constant METADATAONLY */ METADATAONLY("MetaDataOnly"), /** * Constant METADATAANDRESPONSEDATA */ METADATAANDRESPONSEDATA("MetaDataAndResponseData"); //--------------------------/ //- Class/Member Variables -/ //--------------------------/ /** * Field value. */ private final java.lang.String value; /** * Field enumConstants. */ private static final java.util.Map<java.lang.String, BillingRateQueryRqTypeMetaDataType> enumConstants = new java.util.HashMap<java.lang.String, BillingRateQueryRqTypeMetaDataType>(); static { for (BillingRateQueryRqTypeMetaDataType c: BillingRateQueryRqTypeMetaDataType.values()) { BillingRateQueryRqTypeMetaDataType.enumConstants.put(c.value, c); } }; //----------------/ //- Constructors -/ //----------------/ private BillingRateQueryRqTypeMetaDataType(final java.lang.String value) { this.value = value; } //-----------/ //- Methods -/ //-----------/ /** * Method fromValue. * * @param value * @return the constant for this value */ public static org.chocolate_milk.model.types.BillingRateQueryRqTypeMetaDataType fromValue( final java.lang.String value) { BillingRateQueryRqTypeMetaDataType c = BillingRateQueryRqTypeMetaDataType.enumConstants.get(value); if (c != null) { return c; } throw new IllegalArgumentException(value); } /** * * * @param value */ public void setValue( final java.lang.String value) { } /** * Method toString. * * @return the value of this constant */ public java.lang.String toString( ) { return this.value; } /** * Method value. * * @return the value of this constant */ public java.lang.String value( ) { return this.value; } }
lgpl-3.0
galleon1/chocolate-milk
src/org/chocolate_milk/model/descriptors/TimeTrackingAddRqDescriptor.java
3628
/* * This class was automatically generated with * <a href="http://www.castor.org">Castor 1.3.1</a>, using an XML * Schema. * $Id: TimeTrackingAddRqDescriptor.java,v 1.1.1.1 2010-05-04 22:06:01 ryan Exp $ */ package org.chocolate_milk.model.descriptors; //---------------------------------/ //- Imported classes and packages -/ //---------------------------------/ import org.chocolate_milk.model.TimeTrackingAddRq; /** * Class TimeTrackingAddRqDescriptor. * * @version $Revision: 1.1.1.1 $ $Date: 2010-05-04 22:06:01 $ */ public class TimeTrackingAddRqDescriptor extends org.chocolate_milk.model.descriptors.TimeTrackingAddRqTypeDescriptor { //--------------------------/ //- Class/Member Variables -/ //--------------------------/ /** * Field _elementDefinition. */ private boolean _elementDefinition; /** * Field _nsPrefix. */ private java.lang.String _nsPrefix; /** * Field _nsURI. */ private java.lang.String _nsURI; /** * Field _xmlName. */ private java.lang.String _xmlName; /** * Field _identity. */ private org.exolab.castor.xml.XMLFieldDescriptor _identity; //----------------/ //- Constructors -/ //----------------/ public TimeTrackingAddRqDescriptor() { super(); setExtendsWithoutFlatten(new org.chocolate_milk.model.descriptors.TimeTrackingAddRqTypeDescriptor()); _xmlName = "TimeTrackingAddRq"; _elementDefinition = true; } //-----------/ //- Methods -/ //-----------/ /** * Method getAccessMode. * * @return the access mode specified for this class. */ @Override() public org.exolab.castor.mapping.AccessMode getAccessMode( ) { return null; } /** * Method getIdentity. * * @return the identity field, null if this class has no * identity. */ @Override() public org.exolab.castor.mapping.FieldDescriptor getIdentity( ) { if (_identity == null) { return super.getIdentity(); } return _identity; } /** * Method getJavaClass. * * @return the Java class represented by this descriptor. */ @Override() public java.lang.Class getJavaClass( ) { return org.chocolate_milk.model.TimeTrackingAddRq.class; } /** * Method getNameSpacePrefix. * * @return the namespace prefix to use when marshaling as XML. */ @Override() public java.lang.String getNameSpacePrefix( ) { return _nsPrefix; } /** * Method getNameSpaceURI. * * @return the namespace URI used when marshaling and * unmarshaling as XML. */ @Override() public java.lang.String getNameSpaceURI( ) { return _nsURI; } /** * Method getValidator. * * @return a specific validator for the class described by this * ClassDescriptor. */ @Override() public org.exolab.castor.xml.TypeValidator getValidator( ) { return this; } /** * Method getXMLName. * * @return the XML Name for the Class being described. */ @Override() public java.lang.String getXMLName( ) { return _xmlName; } /** * Method isElementDefinition. * * @return true if XML schema definition of this Class is that * of a global * element or element with anonymous type definition. */ public boolean isElementDefinition( ) { return _elementDefinition; } }
lgpl-3.0
alta189/Plug
src/main/java/com/alta189/plug/exception/InvalidPluginException.java
330
package com.alta189.plug.exception; public class InvalidPluginException extends Exception { public InvalidPluginException(String message) { super(message); } public InvalidPluginException(String message, Throwable cause) { super(message, cause); } public InvalidPluginException(Throwable cause) { super(cause); } }
lgpl-3.0
cismet/watergis-client
src/main/java/de/cismet/watergis/gui/actions/map/ZoomInAction.java
2257
/*************************************************** * * cismet GmbH, Saarbruecken, Germany * * ... and it just works. * ****************************************************/ /* * To change this template, choose Tools | Templates * and open the template in the editor. */ package de.cismet.watergis.gui.actions.map; import org.apache.log4j.Logger; import java.awt.event.ActionEvent; import javax.swing.AbstractAction; import javax.swing.ImageIcon; import javax.swing.KeyStroke; import de.cismet.cismap.commons.gui.MappingComponent; import de.cismet.watergis.broker.AppBroker; /** * DOCUMENT ME! * * @author Gilles Baatz * @version $Revision$, $Date$ */ public class ZoomInAction extends AbstractAction { //~ Static fields/initializers --------------------------------------------- private static final Logger LOG = Logger.getLogger(ZoomInAction.class); //~ Constructors ----------------------------------------------------------- /** * Creates a new CloseAction object. */ public ZoomInAction() { final String tooltip = org.openide.util.NbBundle.getMessage( ZoomInAction.class, "ZoomInAction.toolTipText"); putValue(SHORT_DESCRIPTION, tooltip); final String text = org.openide.util.NbBundle.getMessage( ZoomInAction.class, "ZoomInAction.text"); putValue(NAME, text); final String mnemonic = org.openide.util.NbBundle.getMessage( ZoomInAction.class, "ZoomInAction.mnemonic"); putValue(MNEMONIC_KEY, KeyStroke.getKeyStroke(mnemonic).getKeyCode()); final ImageIcon icon = new javax.swing.ImageIcon(getClass().getResource( "/de/cismet/watergis/res/icons16/icon-zoom-in.png")); putValue(SMALL_ICON, icon); } //~ Methods ---------------------------------------------------------------- @Override public void actionPerformed(final ActionEvent e) { AppBroker.getInstance().simpleZoom(1.5f); AppBroker.getInstance().switchMapMode(MappingComponent.ZOOM); } @Override public boolean isEnabled() { return true || AppBroker.getInstance().isActionsAlwaysEnabled(); } }
lgpl-3.0
Godin/sonar
server/sonar-db-migration/src/test/java/org/sonar/server/platform/db/migration/version/v61/AddErrorColumnsToCeActivityTest.java
2691
/* * SonarQube * Copyright (C) 2009-2019 SonarSource SA * mailto:info AT sonarsource DOT com * * This program is free software; you can redistribute it and/or * modify it under the terms of the GNU Lesser General Public * License as published by the Free Software Foundation; either * version 3 of the License, or (at your option) any later version. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Lesser General Public License for more details. * * You should have received a copy of the GNU Lesser General Public License * along with this program; if not, write to the Free Software Foundation, * Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA. */ package org.sonar.server.platform.db.migration.version.v61; import java.sql.SQLException; import java.sql.Types; import org.junit.Rule; import org.junit.Test; import org.junit.rules.ExpectedException; import org.sonar.db.CoreDbTester; import static java.lang.String.valueOf; public class AddErrorColumnsToCeActivityTest { private static final String TABLE = "CE_ACTIVITY"; @Rule public CoreDbTester db = CoreDbTester.createForSchema(AddErrorColumnsToCeActivityTest.class, "old_ce_activity.sql"); @Rule public ExpectedException expectedException = ExpectedException.none(); private AddErrorColumnsToCeActivity underTest = new AddErrorColumnsToCeActivity(db.database()); @Test public void migration_adds_column_to_empty_table() throws SQLException { underTest.execute(); verifyAddedColumns(); } @Test public void migration_adds_columns_to_populated_table() throws SQLException { for (int i = 0; i < 9; i++) { db.executeInsert( TABLE, "uuid", valueOf(i), "task_type", "PROJECT", "component_uuid", valueOf(i + 20), "analysis_uuid", valueOf(i + 30), "status", "ok", "is_last", "true", "is_last_key", "aa", "submitted_at", valueOf(84654), "created_at", valueOf(9512), "updated_at", valueOf(45120)); } underTest.execute(); verifyAddedColumns(); } @Test public void migration_is_not_reentrant() throws SQLException { underTest.execute(); expectedException.expect(IllegalStateException.class); expectedException.expectMessage("Fail to execute "); underTest.execute(); } private void verifyAddedColumns() { db.assertColumnDefinition(TABLE, "error_message", Types.VARCHAR, 1000, true); db.assertColumnDefinition(TABLE, "error_stacktrace", Types.CLOB, null, true); } }
lgpl-3.0
OpenSoftwareSolutions/PDFReporter
pdfreporter-core/src/org/oss/pdfreporter/engine/design/JRDesignPropertyExpression.java
1870
/* * JasperReports - Free Java Reporting Library. * Copyright (C) 2001 - 2011 Jaspersoft Corporation. All rights reserved. * http://www.jaspersoft.com * * Unless you have purchased a commercial license agreement from Jaspersoft, * the following license terms apply: * * This program is part of JasperReports. * * JasperReports is free software: you can redistribute it and/or modify * it under the terms of the GNU Lesser General Public License as published by * the Free Software Foundation, either version 3 of the License, or * (at your option) any later version. * * JasperReports is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU Lesser General Public License for more details. * * You should have received a copy of the GNU Lesser General Public License * along with JasperReports. If not, see <http://www.gnu.org/licenses/>. */ package org.oss.pdfreporter.engine.design; import org.oss.pdfreporter.engine.JRConstants; import org.oss.pdfreporter.engine.JRExpression; import org.oss.pdfreporter.engine.JRPropertyExpression; import org.oss.pdfreporter.engine.base.JRBasePropertyExpression; /** * Implementation of {@link JRPropertyExpression} to be used at report * design time. * * @author Lucian Chirita (lucianc@users.sourceforge.net) * @version $Id: JRDesignPropertyExpression.java 4595 2011-09-08 15:55:10Z teodord $ */ public class JRDesignPropertyExpression extends JRBasePropertyExpression { private static final long serialVersionUID = JRConstants.SERIAL_VERSION_UID; /** * Sets the property value expression. * * @param valueExpression the value expression */ public void setValueExpression(JRExpression valueExpression) { super.setValueExpression(valueExpression); } }
lgpl-3.0
mapsforge/vtm
vtm/src/org/oscim/layers/tile/vector/VectorTileLoader.java
9686
/* * Copyright 2012-2014 Hannes Janetzek * Copyright 2016-2022 devemux86 * * This file is part of the OpenScienceMap project (http://www.opensciencemap.org). * * This program is free software: you can redistribute it and/or modify it under the * terms of the GNU Lesser General Public License as published by the Free Software * Foundation, either version 3 of the License, or (at your option) any later version. * * This program is distributed in the hope that it will be useful, but WITHOUT ANY * WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A * PARTICULAR PURPOSE. See the GNU Lesser General Public License for more details. * * You should have received a copy of the GNU Lesser General Public License along with * this program. If not, see <http://www.gnu.org/licenses/>. */ package org.oscim.layers.tile.vector; import org.oscim.core.GeometryBuffer.GeometryType; import org.oscim.core.*; import org.oscim.layers.tile.MapTile; import org.oscim.layers.tile.TileLoader; import org.oscim.renderer.bucket.*; import org.oscim.theme.IRenderTheme; import org.oscim.theme.RenderTheme; import org.oscim.theme.styles.*; import org.oscim.tiling.ITileDataSource; import org.oscim.tiling.QueryResult; import org.slf4j.Logger; import org.slf4j.LoggerFactory; import static org.oscim.layers.tile.MapTile.State.LOADING; public class VectorTileLoader extends TileLoader implements RenderStyle.Callback { static final Logger log = LoggerFactory.getLogger(VectorTileLoader.class); protected static final double STROKE_INCREASE = 1.4; protected static final byte LAYERS = 11; public static final byte STROKE_MIN_ZOOM = 12; protected IRenderTheme renderTheme; /** * current TileDataSource used by this MapTileLoader */ protected ITileDataSource mTileDataSource; /** * currently processed MapElement */ protected MapElement mElement; /** * current line bucket (will be used for outline bucket) */ protected LineBucket mCurLineBucket; /** * Current bucket for adding elements */ protected int mCurBucket; /** * Line-scale-factor depending on zoom and latitude */ protected float mLineScale = 1.0f; protected RenderBuckets mBuckets; private final VectorTileLayer mTileLayer; public VectorTileLoader(VectorTileLayer tileLayer) { super(tileLayer.getManager()); mTileLayer = tileLayer; } @Override public void dispose() { if (mTileDataSource != null) mTileDataSource.dispose(); } @Override public void cancel() { if (mTileDataSource != null) mTileDataSource.cancel(); } @Override public boolean loadTile(MapTile tile) { if (mTileDataSource == null) { log.error("no tile source is set"); return false; } renderTheme = mTileLayer.getTheme(); if (renderTheme == null) { log.error("no theme is set"); return false; } //mTileLayer.getLoaderHooks(); /* account for area changes with latitude */ double lat = MercatorProjection.toLatitude(tile.y); mLineScale = (float) Math.pow(STROKE_INCREASE, tile.zoomLevel - STROKE_MIN_ZOOM); if (mLineScale < 1) mLineScale = 1; /* scale line width relative to latitude + PI * thumb */ mLineScale *= 0.4f + 0.6f * ((float) Math.sin(Math.abs(lat) * (Math.PI / 180))); mBuckets = new RenderBuckets(); tile.data = mBuckets; try { /* query data source, which calls process() callback */ mTileDataSource.query(tile, this); } catch (NullPointerException e) { log.debug("NPE {} {}", tile, e.getMessage()); e.printStackTrace(); } catch (Exception e) { log.debug("{} {}", tile, e.getMessage()); e.printStackTrace(); return false; } return true; } @Override public void completed(QueryResult result) { boolean ok = (result == QueryResult.SUCCESS); mTileLayer.callHooksComplete(mTile, ok); /* finish buckets- tessellate and cleanup on worker-thread */ mBuckets.prepare(); clearState(); super.completed(result); } protected static int getValidLayer(int layer) { if (layer < 0) { return 0; } else if (layer >= LAYERS) { return LAYERS - 1; } else { return layer; } } public void setDataSource(ITileDataSource dataSource) { dispose(); mTileDataSource = dataSource; } static class TagReplacement { public TagReplacement(String key) { this.key = key; this.tag = new Tag(key, null); } String key; Tag tag; } /** * Override this method to change tags that should be passed * to {@link RenderTheme} matching. * E.g. to replace tags that should not be cached in Rendertheme */ protected TagSet filterTags(TagSet tagSet) { return tagSet; } @Override public void process(MapElement element) { if (isCanceled() || !mTile.state(LOADING)) return; if (mTileLayer.callProcessHooks(mTile, mBuckets, element)) return; TagSet tags = filterTags(element.tags); if (tags == null) return; mElement = element; /* get and apply render instructions */ if (element.type == GeometryType.POINT) { renderNode(renderTheme.matchElement(element.type, tags, mTile.zoomLevel)); } else { mCurBucket = getValidLayer(element.layer) * renderTheme.getLevels() * (element.level > 0 ? element.level : 1); renderWay(renderTheme.matchElement(element.type, tags, mTile.zoomLevel)); } clearState(); } protected void renderWay(RenderStyle[] style) { if (style == null) return; for (int i = 0, n = style.length; i < n; i++) style[i].renderWay(this); } protected void renderNode(RenderStyle[] style) { if (style == null) return; for (int i = 0, n = style.length; i < n; i++) style[i].renderNode(this); } protected void clearState() { mCurLineBucket = null; mElement = null; } /*** * RenderThemeCallback ***/ @Override public void renderWay(LineStyle line, int level) { int nLevel = mCurBucket + level; if (line.outline && mCurLineBucket == null) { log.debug("missing line for outline! " + mElement.tags + " lvl:" + level + " layer:" + mElement.layer); return; } //LineBucket lb; if (line.stipple == 0 && line.texture == null) { //lb = mBuckets.getLineBucket(nLevel); // else // lb = mBuckets.getLineTexBucket(nLevel); LineBucket lb = mBuckets.getLineBucket(nLevel); if (lb.line == null) { lb.line = line; lb.scale = line.fixed ? 1 : mLineScale; lb.setExtents(-16, Tile.SIZE + 16); } if (line.outline) { lb.addOutline(mCurLineBucket); return; } lb.addLine(mElement); /* keep reference for outline layer(s) */ //if (!(lb instanceof LineTexBucket)) mCurLineBucket = lb; } else { LineTexBucket lb = mBuckets.getLineTexBucket(nLevel); if (lb.line == null) { lb.line = line; lb.scale = line.fixed ? 1 : mLineScale; lb.setExtents(-16, Tile.SIZE + 16); } //if (lb.line == null) { // lb.line = line; // float w = line.width; // if (!line.fixed) // w *= mLineScale; // lb.scale = w; //} lb.addLine(mElement); } } /* slower to load (requires tesselation) and uses * more memory but should be faster to render */ public static boolean USE_MESH_POLY = false; @Override public void renderArea(AreaStyle area, int level) { /* dont add faded out polygon layers */ if (mTile.zoomLevel < area.fadeScale) return; int nLevel = mCurBucket + level; mTileLayer.callThemeHooks(mTile, mBuckets, mElement, area, nLevel); if (USE_MESH_POLY || area.mesh) { MeshBucket mb = mBuckets.getMeshBucket(nLevel); mb.area = area; mb.addMesh(mElement); } else { PolygonBucket pb = mBuckets.getPolygonBucket(nLevel); pb.area = area; pb.addPolygon(mElement.points, mElement.index); } } @Override public void renderSymbol(SymbolStyle symbol) { mTileLayer.callThemeHooks(mTile, mBuckets, mElement, symbol, 0); } @Override public void renderExtrusion(ExtrusionStyle extrusion, int level) { mTileLayer.callThemeHooks(mTile, mBuckets, mElement, extrusion, level); } @Override public void renderCircle(CircleStyle circle, int level) { int nLevel = mCurBucket + level; CircleBucket cb = mBuckets.getCircleBucket(nLevel); cb.circle = circle; cb.addCircle(mElement); } @Override public void renderText(TextStyle text) { mTileLayer.callThemeHooks(mTile, mBuckets, mElement, text, 0); } }
lgpl-3.0
OurGrid/OurGrid
src/test/java/org/ourgrid/acceptance/suites/Suite3_Peer_2.java
1617
/* * Copyright (C) 2008 Universidade Federal de Campina Grande * * This file is part of OurGrid. * * OurGrid is free software: you can redistribute it and/or modify it under the * terms of the GNU Lesser General Public License as published by the Free * Software Foundation, either version 3 of the License, or (at your option) * any later version. * * This program is distributed in the hope that it will be useful, but WITHOUT * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or * FITNESS FOR A PARTICULAR PURPOSE. See the GNU Lesser General Public License * for more details. * * You should have received a copy of the GNU Lesser General Public License * along with this program. If not, see <http://www.gnu.org/licenses/>. * */ package org.ourgrid.acceptance.suites; import org.junit.runner.RunWith; import org.junit.runners.Suite; import org.junit.runners.Suite.SuiteClasses; import org.ourgrid.acceptance.peer.Req_016_Test; import org.ourgrid.acceptance.peer.Req_018_Test; import org.ourgrid.acceptance.peer.Req_019_Test; import org.ourgrid.acceptance.peer.Req_020_Test; import org.ourgrid.acceptance.peer.Req_022_Test; import org.ourgrid.acceptance.peer.Req_025_Test; import org.ourgrid.acceptance.peer.Req_027_Test; import org.ourgrid.acceptance.peer.Req_034_Test; @RunWith(Suite.class) @SuiteClasses({ Req_016_Test.class, Req_018_Test.class, Req_019_Test.class, Req_020_Test.class, Req_022_Test.class, Req_025_Test.class, Req_027_Test.class, Req_034_Test.class }) public class Suite3_Peer_2 { }
lgpl-3.0
racodond/sonar-css-plugin
css-frontend/src/main/java/org/sonar/css/model/property/standard/FontMaxSize.java
1633
/* * SonarQube CSS / SCSS / Less Analyzer * Copyright (C) 2013-2017 David RACODON * mailto: david.racodon@gmail.com * * This program is free software; you can redistribute it and/or * modify it under the terms of the GNU Lesser General Public * License as published by the Free Software Foundation; either * version 3 of the License, or (at your option) any later version. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Lesser General Public License for more details. * * You should have received a copy of the GNU Lesser General Public License * along with this program; if not, write to the Free Software Foundation, * Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA. */ package org.sonar.css.model.property.standard; import org.sonar.css.model.property.StandardProperty; import org.sonar.css.model.property.validator.ValidatorFactory; import org.sonar.css.model.property.validator.valueelement.IdentifierValidator; public class FontMaxSize extends StandardProperty { public FontMaxSize() { setExperimental(true); addLinks("https://drafts.csswg.org/css-fonts-4/#propdef-font-max-size"); addValidators( new IdentifierValidator("xx-small", "x-small", "small", "medium", "large", "x-large", "xx-large"), new IdentifierValidator("larger", "smaller"), new IdentifierValidator("infinity"), ValidatorFactory.getPositiveLengthValidator(), ValidatorFactory.getPositivePercentageValidator()); } }
lgpl-3.0
nicosio2/Tourality
simpleplayer/Java/org/pixelgaffer/turnierserver/tourality/SimplePlayer.java
1956
/* * SimplePlayer.java * * Copyright (C) 2015 Pixelgaffer * * This work is free software; you can redistribute it and/or modify it * under the terms of the GNU Lesser General Public License as published by the * Free Software Foundation; either version 2 of the License, or any later * version. * * This work is distributed in the hope that it will be useful, but without * any warranty; without even the implied warranty of merchantability or * fitness for a particular purpose. See version 2 and version 3 of the * GNU Lesser General Public License for more details. * * You should have received a copy of the GNU Lesser General Public License * along with this program. If not, see <http://www.gnu.org/licenses/>. */ package org.pixelgaffer.turnierserver.tourality; import java.awt.Point; import java.util.Random; import org.pixelgaffer.turnierserver.tourality.ai.*; public class SimplePlayer extends TouralityAi { //Dies ist der Konstruktor. Bitte modifiziere diesen nicht! public SimplePlayer(String[] args) { super(args); } private Random random = new Random(); //In dieser Methode machst du deinen Zug. Dir wird deine eigene Position, die Position des Gegners und das Spielfeld wie es momentan aussieht übergeben. //Zurückgeben musst du die Richtung in die du dich bewegen willst, oder Richtung.STEHENBLEIBEN wenn du stehenbleiben willst. @Override public Richtung bewegen(Point du, Point gegner, Feld[][] spielfeld) { return Richtung.values()[random.nextInt(Richtung.values().length)]; } //Dies hier ist die main-Methode. Du kannst sie so lassen wie sie ist und unser Networking-zeugs verwenden, du kannst deine KI aber auch //komplett selbst schreiben. Hierbei kannst du Ai.java in unserem GitHub-Repository als Vorbild nehmen. Falls du Verbesserungsvprschläge hast, //bitten wir dich, einen pull-request zu erstellen- public static void main(String[] args) { new SimplePlayer(args).start(); } }
lgpl-3.0
seanbright/ari4java
classes/ch/loway/oss/ari4java/generated/ari_1_5_0/actions/ActionEndpoints_impl_ari_1_5_0.java
5586
package ch.loway.oss.ari4java.generated.ari_1_5_0.actions; // ---------------------------------------------------- // THIS CLASS WAS GENERATED AUTOMATICALLY // PLEASE DO NOT EDIT // Generated on: Sat Jan 30 13:39:05 CET 2016 // ---------------------------------------------------- import ch.loway.oss.ari4java.generated.*; import java.util.Date; import java.util.List; import java.util.Map; import java.util.ArrayList; import ch.loway.oss.ari4java.tools.BaseAriAction; import ch.loway.oss.ari4java.tools.RestException; import ch.loway.oss.ari4java.tools.AriCallback; import ch.loway.oss.ari4java.tools.HttpParam; import ch.loway.oss.ari4java.tools.HttpResponse; import com.fasterxml.jackson.core.type.TypeReference; import ch.loway.oss.ari4java.generated.ari_1_5_0.models.*; /********************************************************** * * Generated by: Apis *********************************************************/ public class ActionEndpoints_impl_ari_1_5_0 extends BaseAriAction implements ActionEndpoints { /********************************************************** * Asterisk endpoints * * List all endpoints. *********************************************************/ private void buildList() { reset(); url = "/endpoints"; method = "GET"; } @Override public List<Endpoint> list() throws RestException { buildList(); String json = httpActionSync(); return deserializeJsonAsAbstractList( json, new TypeReference<List<Endpoint_impl_ari_1_5_0>>() {} ); } @Override public void list(AriCallback<List<Endpoint>> callback) { buildList(); httpActionAsync(callback, new TypeReference<List<Endpoint_impl_ari_1_5_0>>() {}); } /********************************************************** * Send a message to some technology URI or endpoint. * * Send a message to some technology URI or endpoint. *********************************************************/ private void buildSendMessage(String to, String from, String body, Map<String,String> variables) { reset(); url = "/endpoints/sendMessage"; method = "PUT"; lParamQuery.add( HttpParam.build( "to", to) ); lParamQuery.add( HttpParam.build( "from", from) ); lParamQuery.add( HttpParam.build( "body", body) ); lE.add( HttpResponse.build( 404, "Endpoint not found") ); } @Override public void sendMessage(String to, String from, String body, Map<String,String> variables) throws RestException { buildSendMessage(to, from, body, variables); String json = httpActionSync(); } @Override public void sendMessage(String to, String from, String body, Map<String,String> variables, AriCallback<Void> callback) { buildSendMessage(to, from, body, variables); httpActionAsync(callback); } /********************************************************** * Asterisk endpoints * * List available endoints for a given endpoint technology. *********************************************************/ private void buildListByTech(String tech) { reset(); url = "/endpoints/" + tech + ""; method = "GET"; lE.add( HttpResponse.build( 404, "Endpoints not found") ); } @Override public List<Endpoint> listByTech(String tech) throws RestException { buildListByTech(tech); String json = httpActionSync(); return deserializeJsonAsAbstractList( json, new TypeReference<List<Endpoint_impl_ari_1_5_0>>() {} ); } @Override public void listByTech(String tech, AriCallback<List<Endpoint>> callback) { buildListByTech(tech); httpActionAsync(callback, new TypeReference<List<Endpoint_impl_ari_1_5_0>>() {}); } /********************************************************** * Single endpoint * * Details for an endpoint. *********************************************************/ private void buildGet(String tech, String resource) { reset(); url = "/endpoints/" + tech + "/" + resource + ""; method = "GET"; lE.add( HttpResponse.build( 400, "Invalid parameters for sending a message.") ); lE.add( HttpResponse.build( 404, "Endpoints not found") ); } @Override public Endpoint get(String tech, String resource) throws RestException { buildGet(tech, resource); String json = httpActionSync(); return deserializeJson( json, Endpoint_impl_ari_1_5_0.class ); } @Override public void get(String tech, String resource, AriCallback<Endpoint> callback) { buildGet(tech, resource); httpActionAsync(callback, Endpoint_impl_ari_1_5_0.class); } /********************************************************** * Send a message to some endpoint in a technology. * * Send a message to some endpoint in a technology. *********************************************************/ private void buildSendMessageToEndpoint(String tech, String resource, String from, String body, Map<String,String> variables) { reset(); url = "/endpoints/" + tech + "/" + resource + "/sendMessage"; method = "PUT"; lParamQuery.add( HttpParam.build( "from", from) ); lParamQuery.add( HttpParam.build( "body", body) ); lE.add( HttpResponse.build( 400, "Invalid parameters for sending a message.") ); lE.add( HttpResponse.build( 404, "Endpoint not found") ); } @Override public void sendMessageToEndpoint(String tech, String resource, String from, String body, Map<String,String> variables) throws RestException { buildSendMessageToEndpoint(tech, resource, from, body, variables); String json = httpActionSync(); } @Override public void sendMessageToEndpoint(String tech, String resource, String from, String body, Map<String,String> variables, AriCallback<Void> callback) { buildSendMessageToEndpoint(tech, resource, from, body, variables); httpActionAsync(callback); } /** No missing signatures from interface */ };
lgpl-3.0
sing-group/aibench-project
aibench-core/src/main/java/es/uvigo/ei/aibench/core/datatypes/annotation/Property.java
1252
/* * #%L * The AIBench Core Plugin * %% * Copyright (C) 2006 - 2017 Daniel Glez-Peña and Florentino Fdez-Riverola * %% * This program is free software: you can redistribute it and/or modify * it under the terms of the GNU Lesser General Public License as * published by the Free Software Foundation, either version 3 of the * License, or (at your option) any later version. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU General Lesser Public License for more details. * * You should have received a copy of the GNU General Lesser Public * License along with this program. If not, see * <http://www.gnu.org/licenses/lgpl-3.0.html>. * #L% */ package es.uvigo.ei.aibench.core.datatypes.annotation; import java.lang.annotation.ElementType; import java.lang.annotation.Inherited; import java.lang.annotation.Retention; import java.lang.annotation.RetentionPolicy; import java.lang.annotation.Target; /** * @author Daniel Glez-Peña * */ @Retention(RetentionPolicy.RUNTIME) @Target(ElementType.METHOD) @Inherited public @interface Property { String name() default ""; }
lgpl-3.0
bartcharbon/molgenis
molgenis-data-security/src/main/java/org/molgenis/data/security/auth/GroupService.java
8535
package org.molgenis.data.security.auth; import static com.google.common.collect.Lists.newArrayList; import static java.util.Objects.requireNonNull; import static org.molgenis.data.meta.model.PackageMetadata.PACKAGE; import static org.molgenis.data.security.auth.RoleMetadata.ROLE; import static org.molgenis.security.core.SidUtils.createRoleAuthority; import com.google.common.collect.ImmutableSet; import java.util.ArrayList; import java.util.Collection; import java.util.List; import java.util.Set; import java.util.stream.Collectors; import org.molgenis.data.DataService; import org.molgenis.data.Fetch; import org.molgenis.data.UnknownEntityException; import org.molgenis.data.meta.model.Package; import org.molgenis.data.meta.model.PackageFactory; import org.molgenis.data.meta.model.PackageMetadata; import org.molgenis.data.security.exception.IsAlreadyMemberException; import org.molgenis.data.security.exception.NotAValidGroupRoleException; import org.molgenis.data.security.permission.RoleMembershipService; import org.molgenis.security.core.model.GroupValue; import org.molgenis.security.core.runas.RunAsSystem; import org.springframework.stereotype.Service; import org.springframework.transaction.annotation.Transactional; @Service public class GroupService { private final DataService dataService; private final PackageFactory packageFactory; private final GroupMetadata groupMetadata; private final RoleMembershipService roleMembershipService; private final RoleMembershipMetadata roleMembershipMetadata; public static final String MANAGER = "Manager"; public static final String EDITOR = "Editor"; public static final String VIEWER = "Viewer"; public static final String AUTHORITY_MANAGER = createRoleAuthority(MANAGER.toUpperCase()); public static final String AUTHORITY_EDITOR = createRoleAuthority(EDITOR.toUpperCase()); public static final String AUTHORITY_VIEWER = createRoleAuthority(VIEWER.toUpperCase()); public static final Set<String> DEFAULT_ROLES = ImmutableSet.of(MANAGER, EDITOR, VIEWER); @SuppressWarnings("squid:S00107") GroupService( PackageFactory packageFactory, DataService dataService, GroupMetadata groupMetadata, RoleMembershipService roleMembershipService, RoleMembershipMetadata roleMembershipMetadata) { this.packageFactory = requireNonNull(packageFactory); this.dataService = requireNonNull(dataService); this.groupMetadata = requireNonNull(groupMetadata); this.roleMembershipService = requireNonNull(roleMembershipService); this.roleMembershipMetadata = requireNonNull(roleMembershipMetadata); } /** * Creates {@link Group}, {@link Role} and {@link Package} entities and adds them to the * dataService. * * @param groupValue details of the group that should be created */ @Transactional public void persist(GroupValue groupValue) { Package rootPackage = packageFactory.create(groupValue.getRootPackage()); dataService.add(PACKAGE, rootPackage); } @RunAsSystem public Collection<Group> getGroups() { return dataService.findAll(GroupMetadata.GROUP, Group.class).collect(Collectors.toList()); } /** * Get the group entity by its unique name. * * @param groupName unique group name * @return group with given name * @throws UnknownEntityException in case no group with given name can be retrieved */ @RunAsSystem public Group getGroup(String groupName) { Fetch roleFetch = new Fetch().field(RoleMetadata.NAME).field(RoleMetadata.LABEL); Fetch fetch = new Fetch() .field(GroupMetadata.ROLES, roleFetch) .field(GroupMetadata.NAME) .field(GroupMetadata.LABEL) .field(GroupMetadata.DESCRIPTION) .field(GroupMetadata.ID) .field(GroupMetadata.PUBLIC) .field(GroupMetadata.ROOT_PACKAGE); Group group = dataService .query(GroupMetadata.GROUP, Group.class) .eq(GroupMetadata.NAME, groupName) .fetch(fetch) .findOne(); if (group == null) { throw new UnknownEntityException( groupMetadata, groupMetadata.getAttribute(GroupMetadata.NAME), groupName); } return group; } /** * Add member to group. User can only be added to a role that belongs to the group. The user can * only have a single role within the group * * @param group group to add the user to in the given role * @param user user to be added in the given role to the given group * @param role role in which the given user is to be added to given group */ @RunAsSystem public void addMember(final Group group, final User user, final Role role) { ArrayList<Role> groupRoles = newArrayList(group.getRoles()); Collection<RoleMembership> memberships = roleMembershipService.getMemberships(groupRoles); boolean isGroupRole = isGroupRole(role, groupRoles); if (!isGroupRole) { throw new NotAValidGroupRoleException(role, group); } boolean isMember = memberships.stream().parallel().anyMatch(m -> m.getUser().equals(user)); if (isMember) { throw new IsAlreadyMemberException(user, group); } roleMembershipService.addUserToRole(user, role); } private boolean isGroupRole(Role role, ArrayList<Role> groupRoles) { return groupRoles.stream().anyMatch(groupRole -> groupRole.getName().equals(role.getName())); } @RunAsSystem public void removeMember(final Group group, final User user) { ArrayList<Role> groupRoles = newArrayList(group.getRoles()); final RoleMembership membership = findRoleMembership(user, groupRoles); roleMembershipService.removeMembership(membership); } @RunAsSystem public void updateMemberRole(final Group group, final User member, final Role newRole) { ArrayList<Role> groupRoles = newArrayList(group.getRoles()); boolean isGroupRole = isGroupRole(newRole, groupRoles); if (!isGroupRole) { throw new NotAValidGroupRoleException(newRole, group); } final RoleMembership roleMembership = findRoleMembership(member, groupRoles); roleMembershipService.updateMembership(roleMembership, newRole); } @RunAsSystem public boolean isGroupNameAvailable(final GroupValue groupValue) { String rootPackageName = groupValue.getRootPackage().getName(); final Package existingPackage = dataService.query(PACKAGE, Package.class).eq(PackageMetadata.ID, rootPackageName).findOne(); return existingPackage == null; } private UnknownEntityException unknownMembershipForUser(User user) { return new UnknownEntityException( roleMembershipMetadata, roleMembershipMetadata.getAttribute(RoleMembershipMetadata.USER), user.getUsername()); } private RoleMembership findRoleMembership(User member, List<Role> groupRoles) { Collection<RoleMembership> memberships = roleMembershipService.getMemberships(groupRoles); return memberships.stream() .filter(m -> m.getUser().getId().equals(member.getId())) .findFirst() .orElseThrow(() -> unknownMembershipForUser(member)); } public void deleteGroup(String groupName) { Group group = dataService .query(GroupMetadata.GROUP, Group.class) .eq(GroupMetadata.NAME, groupName) .findOne(); if (group == null) { throw new UnknownEntityException( groupMetadata, groupMetadata.getAttribute(GroupMetadata.NAME), groupName); } dataService.delete(PACKAGE, group.getRootPackage()); } public void updateExtendsRole(Group group, Role groupRole, Role memberRole) { List<Role> newIncludes = removeIncludedGroupRoles(group, memberRole); if (!isGroupRole(groupRole, newArrayList(group.getRoles()))) { throw new NotAValidGroupRoleException(groupRole, group); } newIncludes.add(groupRole); memberRole.setIncludes(newIncludes); dataService.update(ROLE, memberRole); } public void removeExtendsRole(Group group, Role memberRole) { List<Role> newIncludes = removeIncludedGroupRoles(group, memberRole); memberRole.setIncludes(newIncludes); dataService.update(ROLE, memberRole); } private List<Role> removeIncludedGroupRoles(Group group, Role memberRole) { ArrayList<Role> includes = newArrayList(memberRole.getIncludes()); ArrayList<Role> groupRoles = newArrayList(group.getRoles()); return includes.stream() .filter(role -> !isGroupRole(role, groupRoles)) .collect(Collectors.toList()); } }
lgpl-3.0
aoindustries/aoserv-client
src/main/java/com/aoindustries/aoserv/client/email/CyrusImapdBind.java
5876
/* * aoserv-client - Java client for the AOServ Platform. * Copyright (C) 2017, 2018, 2019, 2021 AO Industries, Inc. * support@aoindustries.com * 7262 Bull Pen Cir * Mobile, AL 36695 * * This file is part of aoserv-client. * * aoserv-client is free software: you can redistribute it and/or modify * it under the terms of the GNU Lesser General Public License as published by * the Free Software Foundation, either version 3 of the License, or * (at your option) any later version. * * aoserv-client is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU Lesser General Public License for more details. * * You should have received a copy of the GNU Lesser General Public License * along with aoserv-client. If not, see <https://www.gnu.org/licenses/>. */ package com.aoindustries.aoserv.client.email; import com.aoapps.hodgepodge.io.stream.StreamableInput; import com.aoapps.hodgepodge.io.stream.StreamableOutput; import com.aoapps.lang.validation.ValidationException; import com.aoapps.net.DomainName; import com.aoindustries.aoserv.client.CachedObjectIntegerKey; import com.aoindustries.aoserv.client.net.Bind; import com.aoindustries.aoserv.client.pki.Certificate; import com.aoindustries.aoserv.client.schema.AoservProtocol; import com.aoindustries.aoserv.client.schema.Table; import java.io.IOException; import java.sql.ResultSet; import java.sql.SQLException; import java.util.Objects; /** * Each <code>CyrusImapdServer</code> may listen for network connections on * multiple <code>NetBind</code>s. A <code>CyrusImapdBind</code> ties * <code>CyrusImapdServer</code>s to <code>NetBinds</code>. * * @see CyrusImapdServer * @see Bind * * @author AO Industries, Inc. */ public final class CyrusImapdBind extends CachedObjectIntegerKey<CyrusImapdBind> { static final int COLUMN_NET_BIND = 0, COLUMN_CYRUS_IMAPD_SERVER = 1, COLUMN_SSL_CERTIFICATE = 3 ; static final String COLUMN_NET_BIND_name = "net_bind"; private int cyrus_imapd_server; private DomainName servername; private int certificate; private Boolean allowPlaintextAuth; /** * @deprecated Only required for implementation, do not use directly. * * @see #init(java.sql.ResultSet) * @see #read(com.aoapps.hodgepodge.io.stream.StreamableInput, com.aoindustries.aoserv.client.schema.AoservProtocol.Version) */ @Deprecated/* Java 9: (forRemoval = true) */ public CyrusImapdBind() { // Do nothing } @Override public String toStringImpl() throws SQLException, IOException { CyrusImapdServer server = getCyrusImapdServer(); Bind bind = getNetBind(); return server.toStringImpl() + '|' + bind.toStringImpl(); } @Override protected Object getColumnImpl(int i) { switch(i) { case COLUMN_NET_BIND: return pkey; case COLUMN_CYRUS_IMAPD_SERVER: return cyrus_imapd_server; case 2: return servername; case COLUMN_SSL_CERTIFICATE: return certificate == -1 ? null : certificate; case 4: return allowPlaintextAuth; default: throw new IllegalArgumentException("Invalid index: " + i); } } @Override public Table.TableID getTableID() { return Table.TableID.CYRUS_IMAPD_BINDS; } @Override public void init(ResultSet result) throws SQLException { try { int pos = 1; pkey = result.getInt(pos++); cyrus_imapd_server = result.getInt(pos++); servername = DomainName.valueOf(result.getString(pos++)); certificate = result.getInt(pos++); if(result.wasNull()) certificate = -1; allowPlaintextAuth = result.getBoolean(pos++); if(result.wasNull()) allowPlaintextAuth = null; } catch(ValidationException e) { throw new SQLException(e); } } @Override public void read(StreamableInput in, AoservProtocol.Version protocolVersion) throws IOException { try { pkey = in.readCompressedInt(); cyrus_imapd_server = in.readCompressedInt(); servername = DomainName.valueOf(in.readNullUTF()); certificate = in.readCompressedInt(); allowPlaintextAuth = in.readNullBoolean(); } catch(ValidationException e) { throw new IOException(e); } } @Override public void write(StreamableOutput out, AoservProtocol.Version protocolVersion) throws IOException { out.writeCompressedInt(pkey); out.writeCompressedInt(cyrus_imapd_server); out.writeNullUTF(Objects.toString(servername, null)); out.writeCompressedInt(certificate); out.writeNullBoolean(allowPlaintextAuth); } public Bind getNetBind() throws SQLException, IOException { Bind obj = table.getConnector().getNet().getBind().get(pkey); if(obj == null) throw new SQLException("Unable to find NetBind: " + pkey); return obj; } public CyrusImapdServer getCyrusImapdServer() throws SQLException, IOException { CyrusImapdServer obj = table.getConnector().getEmail().getCyrusImapdServer().get(cyrus_imapd_server); if(obj == null) throw new SQLException("Unable to find CyrusImapd: " + cyrus_imapd_server); return obj; } /** * The fully qualified hostname for <code>servername</code>. * * When {@code null}, defaults to {@link CyrusImapdServer#getServername()}. */ public DomainName getServername() { return servername; } /** * Gets the SSL certificate for this server. * * @return the SSL certificate or {@code null} when filtered or defaulting to {@link CyrusImapdServer#getCertificate()} */ public Certificate getCertificate() throws SQLException, IOException { if(certificate == -1) return null; // May be filtered return table.getConnector().getPki().getCertificate().get(certificate); } /** * Allows plaintext authentication (PLAIN/LOGIN) on non-TLS links. * * When {@code null}, defaults to {@link CyrusImapdServer#getAllowPlaintextAuth()}. */ public Boolean getAllowPlaintextAuth() { return allowPlaintextAuth; } }
lgpl-3.0
nelt/poomjobs
poomjobs-engine-in-memory/src/test/java/org/codingmatters/poomjobs/engine/inmemory/acceptance/list/InMemoryJobListServiceAcceptanceTest.java
936
package org.codingmatters.poomjobs.engine.inmemory.acceptance.list; import org.codingmatters.poomjobs.apis.TestConfigurationProvider; import org.codingmatters.poomjobs.apis.list.JobListServiceAcceptanceTest; import org.codingmatters.poomjobs.engine.inmemory.acceptance.InMemoryConfigurationProvider; import org.codingmatters.poomjobs.engine.inmemory.InMemoryEngine; import org.junit.After; import org.junit.Rule; /** * Created by nel on 06/07/15. */ public class InMemoryJobListServiceAcceptanceTest extends JobListServiceAcceptanceTest { @Rule public InMemoryConfigurationProvider configurationProvider = new InMemoryConfigurationProvider(); @Override protected TestConfigurationProvider getConfigurationProvider() { return this.configurationProvider; } @After public void tearDown() throws Exception { InMemoryEngine.removeEngine(this.configurationProvider.getQueueConfig()); } }
lgpl-3.0
Poesys-Associates/dataloader
dataloader/src/com/poesys/accounting/dataloader/oldaccounting/OldDataBuilder.java
50763
/* * Copyright (c) 2018 Poesys Associates. All rights reserved. * * This file is part of Poesys/Dataloader. * * Poesys/Dataloader is free software: you can redistribute it and/or modify it under * the terms of the GNU General Public License as published by the Free Software * Foundation, either version 3 of the License, or (at your option) any later * version. * * Poesys/Dataloader is distributed in the hope that it will be useful, but WITHOUT ANY * WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR * A PARTICULAR PURPOSE. See the GNU General Public License for more details. * * You should have received a copy of the GNU General Public License along with * Poesys/Dataloader. If not, see <http://www.gnu.org/licenses/>. */ package com.poesys.accounting.dataloader.oldaccounting; import java.io.BufferedReader; import java.io.IOException; import java.io.Reader; import java.math.BigDecimal; import java.math.BigInteger; import java.util.ArrayList; import java.util.Collections; import java.util.HashMap; import java.util.HashSet; import java.util.List; import java.util.Map; import java.util.Set; import com.poesys.accounting.dataloader.newaccounting.*; import org.apache.log4j.Logger; import com.poesys.accounting.dataloader.IBuilder; import com.poesys.accounting.dataloader.properties.IParameters; import com.poesys.db.InvalidParametersException; /** * Production implementation of the IBuilder interface that loads data from a designated path for a * list of fiscal years. * * @author Robert J. Muller */ public class OldDataBuilder implements IBuilder { /** logger for this class */ private static final Logger logger = Logger.getLogger(OldDataBuilder.class); /** the program parameters object */ private final IParameters parameters; /** the fiscal year being built */ private FiscalYear fiscalYear; /** the list of all fiscal years built so far */ private List<FiscalYear> fiscalYears = new ArrayList<>(); /** the set of transactions built from the data */ private final Set<com.poesys.accounting.dataloader.newaccounting.Transaction> transactions = new HashSet<>(); /** * the set of transactions for the current fiscal year; this gets cleared when each fiscal year * starts processing. This set exists to enable easier debugging of the transaction list, which * can get very large. The list for a specific year is much smaller, so you can more easily * inspect it in the debugger. The variable is not used elsewhere and has no accessors. */ private final Set<com.poesys.accounting.dataloader.newaccounting.Transaction> currentTransactions = new HashSet<>(); // operational constants /** limit on number of rows from file, prevents infinite loop */ private static final int LIMIT = 10000; /** * integer id for the start of the integer id series for balance transactions, because the old * accounting system doesn't actually have transaction ids for these transactions */ private static final String FIRST_BALANCE_TRANSACTION_ID = "100000"; // Data sets shared across process iterations /** the capital entities for the accounting entity accounts */ private CapitalStructure capitalStructure; /** map of capital entities indexed by capital/distribution account names */ private Map<String, CapitalEntity> capitalEntityMap = new HashMap<>(); /** the map of shared sets of account groups indexed by fiscal year */ private final Map<FiscalYear, Set<com.poesys.accounting.dataloader.newaccounting.AccountGroup>> groupSetsMap = new HashMap<>(); /** the shared set of accounts */ private final Set<com.poesys.accounting.dataloader.newaccounting.Account> accounts = new HashSet<>(); // Messages private static final String ZERO_RECEIVABLE_ID_ERROR = "zero receivable id for transaction not in first year"; private static final String NO_BALANCE_ERROR = "no balance for receivable account "; private static final String ZERO_BALANCE_ERROR = "zero balance for account "; private static final String ACCOUNT_ERROR = "cannot find account "; private static final String NULL_FILE_PATH_ERROR = "Null file path in parameter file"; private static final String FILE_READER_CLOSE_ERROR = "IO exception closing file reader"; private static final String READER_CLOSE_ERROR = "IO exception closing buffered reader"; private static final String GROUP_LOOKUP_ERROR = "cannot find group for account "; private static final String NULL_PARAMETER_ERROR = "parameters required but are null"; private static final String NULL_INCOME_SUMMARY_ERROR = "Null income summary account name in parameter file"; private static final String NO_SUCH_TRANSACTION_ERROR = "no such transaction "; private static final String NO_SUCH_ACCOUNT_ERROR = "no such account "; private static final String FISCAL_YEAR_ERROR = " in fiscal year "; private static final String INVALID_TRANSACTION_ERROR = "invalid transaction: "; private static final String INVALID_TRANSACTIONS_ERROR = "invalid transactions"; private static final String NO_REIMBURSEMENTS_ITEM_MAP_ERROR = "no reimbursements item map for fiscal year "; private static final String NO_RECEIVABLES_ITEM_MAP_ERROR = "no receivables item map for fiscal year "; private static final String NOT_RECEIVABLE_ACCOUNT_ERROR = "indexing receivable item but account is not a receivable account: "; private static final String INVALID_CAPITAL_ACCOUNT = "found account name in map but no such account name in capital structure: "; private static final String NO_NEW_CAPITAL_ENTITY_NAME_ERROR = "no new capital entity name"; private static final String NO_CAPITAL_ENTITY_NAME_ERROR = "no capital entity name"; private static final String NO_ACCOUNT_NAME_ERROR = "no name for lookup of account"; // lookup maps and index classes /** * lookup map that contains new-accounting groups indexed by old-accounting year and account * intervals */ private final Map<AccountGroup, com.poesys.accounting.dataloader.newaccounting.AccountGroup> groupMap = new HashMap<>(); /** map that organizes groups by account type for numbering */ private final Map<AccountType, List<AccountGroup>> typeMap = new HashMap<>(); /** * lookup map that translates account numbers to new-accounting account names; permits mapping of * incoming accounts for the current fiscal year to existing accounts from prior fiscal years by * name mapping */ private final Map<Integer, String> accountMap = new HashMap<>(); /** * lookup map that translates account numbers to new accounts; this provides a way to get the * account name for balance transactions to use as a transaction description; cleared by * buildFiscalYear() */ private final Map<Integer, com.poesys.accounting.dataloader.newaccounting.Account> accountNumberMap = new HashMap<>(); /** * lookup map that translates account names to new accounts; this provides a way to get the * account object based on the name; cleared by buildFiscalYear() */ private final Map<String, com.poesys.accounting.dataloader.newaccounting.Account> accountNameMap = new HashMap<>(); /** * lookup map that translates an old transaction id into a new-accounting transaction object; this * provides a way to map items to transactions; cleared by buildFiscalYear() */ private final Map<Integer, com.poesys.accounting.dataloader.newaccounting.Transaction> transactionMap = new HashMap<>(); /** * Map index object that indexes items by a combination of transaction id and account; used in * item lookup maps for receivables */ private class ItemIndex { private final Integer id; private final Float accountNumber; /** * Create a ItemIndex object. * * @param id the transaction id * @param accountNumber the account number (float, for example 111.1) */ public ItemIndex(Integer id, Float accountNumber) { this.id = id; this.accountNumber = accountNumber; } @Override public int hashCode() { final int prime = 31; int result = 1; result = prime * result + getOuterType().hashCode(); result = prime * result + ((accountNumber == null) ? 0 : accountNumber.hashCode()); result = prime * result + ((id == null) ? 0 : id.hashCode()); return result; } @Override public boolean equals(Object obj) { if (this == obj) { return true; } if (obj == null) { return false; } if (getClass() != obj.getClass()) { return false; } ItemIndex other = (ItemIndex)obj; if (!getOuterType().equals(other.getOuterType())) { return false; } if (accountNumber == null) { if (other.accountNumber != null) { return false; } } else if (!accountNumber.equals(other.accountNumber)) { return false; } if (id == null) { if (other.id != null) { return false; } } else if (!id.equals(other.id)) { return false; } return true; } private OldDataBuilder getOuterType() { return OldDataBuilder.this; } } /** * the shared lookup map of fiscal year maps of receivable items indexed by year, then by the * ItemIndex combination of transaction id and account (that is, Map(year, Map(itemIndex, item)); * the buildFiscalYear() method initializes the nested map for the year */ private final Map<Integer, Map<ItemIndex, com.poesys.accounting.dataloader.newaccounting.Item>> receivablesMap = new HashMap<>(); /** * the shared lookup map of fiscal year maps of reimbursing items indexed by year, then by the * ItemIndex combination of transaction id and account (that is, Map(year, Map(itemIndex, item)); * the buildFiscalYear() method initializes the nested map for the year */ private final Map<Integer, Map<ItemIndex, com.poesys.accounting.dataloader.newaccounting.Item>> reimbursementsMap = new HashMap<>(); // list of capital entities read directly private final List<CapitalEntity> entities = new ArrayList<>(); // sets of the data read directly; cleared by buildFiscalYear() private final Set<Reimbursement> reimbursementDataSet = new HashSet<>(); private final Set<Balance> balanceDataSet = new HashSet<>(); private final Set<Transaction> transactionDataSet = new HashSet<>(); private final Set<Item> itemDataSet = new HashSet<>(); /** * Strategy pattern that allows the Builder to share the basic file-reading code, putting the * construction-specific work into each strategy class. Each strategy builds all the data sets * that can be built a line at a time. The interface is publicly accessible for unit testing. */ public interface IBuildStrategy { /** * Strategy execution method, builds the target DTOs using the input data from the reader * * @param r the reader pointing to input data */ void build(BufferedReader r); } /** * A capital entity is a named entity that owns some part of the capital of the accounting system. * Each system has one or more entities with accompanying capital and distribution accounts. */ private class CapitalEntityStrategy implements IBuildStrategy { @Override public void build(BufferedReader r) { CapitalEntity entity = new CapitalEntity(r); entities.add(entity); } } /** * The system groups accounts into categories (Cash, Credit Cards, and so on) that grouped * accounts by number; each group had a range of accounts, always from nn0.00 to nn9.99, so groups * had "ten" accounts (plus some number of sub-accounts). The old accounting system had a set of * account groups for each year that included all the accounts in the year. The groups could be * rearranged from year to year (a group added, a group removed, or a group changed (that is, the * account number range would be associated with a different group name. The new system identifies * groups within account types ("Assets", "Liabilities" and so on) by name, so names are unique * within account type across all years. The Old Data Builder must therefore map groups into * new-accounting groups when creating fiscal-year-account links between accounts and fiscal * years, which is where groups associate with accounts and years. Also, to get the order number * of the group within the account type, the builder builds a data structure containing ordered * lists of groups indexed by account type. This operation builds the lists but leaves the * ordering and numbering to the client. */ private class AccountGroupStrategy implements IBuildStrategy { @Override public void build(BufferedReader r) { AccountGroup group = new AccountGroup(fiscalYear.getYear(), r); // Create new group, add to set for fiscal year com.poesys.accounting.dataloader.newaccounting.AccountGroup newGroup = new com.poesys.accounting.dataloader.newaccounting.AccountGroup(group.getName()); Set<com.poesys.accounting.dataloader.newaccounting.AccountGroup> groupSet = groupSetsMap.computeIfAbsent(fiscalYear, k -> new HashSet<>()); // No set yet, create it. // Add the group to the set. groupSet.add(newGroup); // Add new group to map indexed by old group groupMap.put(group, newGroup); // Add the group to the account type. AccountType type = group.getAccountType(); List<AccountGroup> groupList = typeMap.computeIfAbsent(type, k -> new ArrayList<>()); // no list yet for this type, create one // Add the group to the list. Note the list is not sorted at this point. groupList.add(group); } } /** * The old accounting system was implemented separately for each fiscal year, allowing for changes * to the account name and the changing of account numbers from year to year. The account map * associates a particular new-accounting name with an account number in a given year and later * years. The buildFiscalYear() method does not clear the account map. The data file for a given * fiscal year thus contains one row for each account number that represents a specific account * shifted to that number from the prior year. Later years will associate that number to that name * unless the account map in the subsequent year replaces the name with another name. You only * need to set the account number once for all subsequent years. */ private class AccountMapStrategy implements IBuildStrategy { @Override public void build(BufferedReader r) { // Read the map data and store in the map. AccountMap map = new AccountMap(r); // Convert account number from float to int, e.g., 100.21 -> 10021. Integer accountNumber = new Float(map.getAccountNumber() * 100F).intValue(); accountMap.put(accountNumber, map.getName()); } } /** * Accounts in the old system had unique account numbers with two parts separated by a decimal * point, which represented the main account and sub-accounts. These accounts were distinct for * each fiscal year, and this introduced the need to map from account number to account number * across fiscal years for balance sheet accounts. It also made comparing accounts across years * impossible. The new accounting system dispenses with the account numbers and the concept of * sub-accounts and just identifies an account by its name, and the account may be active or * inactive in a given fiscal year but applies to all fiscal years. This requires using a mapping * file to determine the account mapping. At the end of the account build() process step, the * accounts set reflects the unified set of accounts across all fiscal years read so far. The * account map, which maps account numbers to new accounts, represents the accounts in the current * fiscal year. Any account in the accounts set that is not mapped in the account map is not * active in the current fiscal year, meaning there is no FiscalYearAccount link between the * account and the FiscalYear in the database. */ private class AccountStrategy implements IBuildStrategy { /** Tracks account order number within groups */ Map<com.poesys.accounting.dataloader.newaccounting.AccountGroup, Integer> groupAccountOrderNumbers = new HashMap<>(); @Override public void build(BufferedReader r) { Integer year = fiscalYear.getYear(); Account oldAccount = new Account(fiscalYear.getYear(), r); // Convert account number to 5-digit integer for comparisons Float accountNumber = oldAccount.getAccountNumber(); Integer intAccountNumber = new Float(accountNumber * 100F).intValue(); // Determine whether the account is a receivable account. Boolean receivable = intAccountNumber >= 11000 && intAccountNumber < 12000; // Get the account group for the account. com.poesys.accounting.dataloader.newaccounting.AccountGroup group = null; Integer groupOrderNumber = null; for (AccountGroup key : groupMap.keySet()) { if (key.contains(year, accountNumber)) { group = groupMap.get(key); groupOrderNumber = key.getOrderNumber(); break; } } if (group == null || groupOrderNumber == null) { throw new RuntimeException(GROUP_LOOKUP_ERROR + oldAccount); } // Get the account name using the account map. This mapping links the // account to an account created in an earlier fiscal year or sets the // name to a "standardized" name rather than to the old name. String name = accountMap.get(intAccountNumber); // If not mapped, use the input name. name = (name == null ? oldAccount.getName() : name); // Create new account, add to set com.poesys.accounting.dataloader.newaccounting.Account newAccount = new com.poesys.accounting.dataloader.newaccounting.Account(name, name, oldAccount.getAccountType(), oldAccount.getDefaultDebit(), receivable); if (!accounts.add(newAccount)) { // The account is already in the accounts set, so get that account. newAccount = accountNameMap.get(name); } else { // The account is new, so add it to the name map. The OldDataBuilder // preserves the accounts set and the account name map over multiple // fiscal years. accountNameMap.put(name, newAccount); } // Set the capital account; this conditionally sets the capital account if // this account is the capital account. setCapitalAccount(newAccount); Integer accountOrderNumber = incrementAccountOrderNumber(group); // Index the account in the fiscal year account-number lookup map. The // getFiscalYear() method clears this map for each fiscal year, so this // method needs to add the account with the account number for this year // regardless of whether a previous year created the shared new-accounting // account. accountNumberMap.put(intAccountNumber, newAccount); logger.debug("Indexed account " + oldAccount.getAccountNumber()); // Add the account to the fiscal year by creating a FiscalYearAccount link // with the associated group. This operation links the account to the // fiscal year by creating a linking object in the database on store(). // The link is put into the three linked objects as well. FiscalYearAccount fsYAccount = new FiscalYearAccount(fiscalYear, oldAccount.getAccountType(), group, groupOrderNumber, newAccount, accountOrderNumber); fiscalYear.addAccount(fsYAccount); newAccount.addYear(fsYAccount); group.addLink(fsYAccount); } /** * If this account is one of the capital structure accounts, associate the generated capital * entity with the account. This links the account to the capital entity and vice versa. * * @param newAccount the account object */ private void setCapitalAccount(com.poesys.accounting.dataloader.newaccounting.Account newAccount) { String name = newAccount.getName(); CapitalEntity capEntity = capitalEntityMap.get(name); if (capEntity != null) { // The account name is in the capital entity map, so this is a capital // or distribution account; set the account in the entity in the proper // place. // Check for the capital entity name, required to get new entity object. if (capEntity.getName() == null) { throw new RuntimeException(NO_CAPITAL_ENTITY_NAME_ERROR); } for (com.poesys.accounting.dataloader.newaccounting.CapitalEntity newCapEntity : capitalStructure.getEntities()) { if (newCapEntity.getName() == null) { throw new RuntimeException(NO_NEW_CAPITAL_ENTITY_NAME_ERROR); } if (newCapEntity.getName().equals(capEntity.getName())) { // Found the entity to set with the account. if (capEntity.getCapitalAccountName().equals(name)) { // This is the capital account for the entity. newCapEntity.setCapitalAccount(newAccount); newAccount.setCapitalEntity(newCapEntity); } else if (capEntity.getDistributionAccountName() != null && capEntity.getDistributionAccountName().equals(name)) { newCapEntity.setDistributionAccount(newAccount); newAccount.setCapitalEntity(newCapEntity); } else if (capEntity.getDistributionAccountName() != null) { // error, neither capital nor distribution account matches throw new RuntimeException(INVALID_CAPITAL_ACCOUNT + name); } // else do nothing } } } } /** * Increment the account order number within the group. * * @param group the group containing the account * @return the next order number in the group */ private Integer incrementAccountOrderNumber(com.poesys.accounting.dataloader.newaccounting .AccountGroup group) { Integer accountOrderNumber; // Increment the counter for ordering the accounts within the group. accountOrderNumber = groupAccountOrderNumbers.get(group); if (accountOrderNumber == null) { // No count for this group yet, create it as 1. accountOrderNumber = 1; } else { // Order number is there, so increment it. accountOrderNumber++; } // Save the current order number. groupAccountOrderNumbers.put(group, accountOrderNumber); return accountOrderNumber; } } /** * Balances get set in the first fiscal year processed, associating an initial balance with an * account. The buildFiscalYear() method does not clear the balances. */ private class BalanceStrategy implements IBuildStrategy { @Override public void build(BufferedReader r) { Balance balance = new Balance(fiscalYear.getYear(), r); balanceDataSet.add(balance); } } /** * Reimbursements link reimbursing transactions to receivable transactions in the current or prior * fiscal years. These get cleared for each fiscal year. */ private class ReimbursementStrategy implements IBuildStrategy { @Override public void build(BufferedReader r) { Reimbursement reimbursement = new Reimbursement(fiscalYear.getYear(), r); reimbursementDataSet.add(reimbursement); } } /** * Transactions contain the set of transactions for each fiscal year. These get cleared for each * fiscal year. */ private class TransactionStrategy implements IBuildStrategy { @Override public void build(BufferedReader r) { Transaction transaction = new Transaction(fiscalYear.getYear(), r); transactionDataSet.add(transaction); } } /** * Transaction items associate with a transaction by id and an account by number, specifying the * debit or credit amount by which the transaction changes the value of the account.These get * cleared for each fiscal year. * * @author Robert J. Muller */ private class ItemStrategy implements IBuildStrategy { @Override public void build(BufferedReader r) { Item item = new Item(fiscalYear.getYear(), r); itemDataSet.add(item); } } /** * Create a OldDataBuilder object. The parameters object must contain a path to a directory * containing one sub-directory for each fiscal year, no gaps allowed, and must provide a series * of readers with the correct data characteristics. The fiscal year contains all the relevant * data that the client can use to create the accounting system. Building a fiscal year clears all * the data sets not shared between years, so the client must call all the process steps for a * given fiscal year, then get the fiscal year object. Use the appropriate getters to get the * shared data sets. * * @param parameters the program parameters object (path and file names) */ public OldDataBuilder(IParameters parameters) { this.parameters = parameters; if (parameters.getPath() == null) { throw new InvalidParametersException(NULL_FILE_PATH_ERROR); } } @Override public void buildCapitalStructure() { // Build the capital entities list for the accounting system. String incomeSummary = parameters.getIncomeSummaryAccountName(); if (incomeSummary == null || incomeSummary.isEmpty()) { throw new InvalidParametersException(NULL_INCOME_SUMMARY_ERROR); } capitalStructure = new CapitalStructure(incomeSummary); IBuildStrategy strategy = new CapitalEntityStrategy(); readFile(parameters.getCapitalEntityReader(), strategy); // Build a list of new-accounting capital entities from the old ones and add // the account names to the capital entity map. List<com.poesys.accounting.dataloader.newaccounting.CapitalEntity> newEntities = new ArrayList<>(); for (CapitalEntity entity : entities) { newEntities.add( new com.poesys.accounting.dataloader.newaccounting.CapitalEntity(entity.getName(), entity .getCapitalAccountName(), entity .getDistributionAccountName(), new BigDecimal( entity.getOwnership()))); capitalEntityMap.put(entity.getCapitalAccountName(), entity); if (entity.getDistributionAccountName() != null) { capitalEntityMap.put(entity.getDistributionAccountName(), entity); } } capitalStructure.addEntities(newEntities); } @Override public void buildFiscalYear(Integer year) { this.fiscalYear = new FiscalYear(year); fiscalYears.add(this.fiscalYear); logger.debug("Building fiscal year " + year); // Add the sub-map for the receivables. receivablesMap.put(year, new HashMap<>()); // Add the sub-map for the reimbursements. reimbursementsMap.put(year, new HashMap<>()); // Clear the temporary data sets for the fiscal year. reimbursementDataSet.clear(); balanceDataSet.clear(); transactionDataSet.clear(); itemDataSet.clear(); // Clear the lookup maps for accounts by account number and transactions by transaction id, // as those values vary by fiscal year. Note that this method does not clear the accounts by // account name lookup map, which uses the new-accounting name that does not vary by fiscal // year. Also note that the transaction set itself is not cleared, as it spans the fiscal years. accountNumberMap.clear(); transactionMap.clear(); // Clear currentTransaction data (debugging data) currentTransactions.clear(); } /** * Read a specified file into the corresponding data structures using the appropriate * IBuildStrategy object. The file must have fewer than 5,000 rows of data, which prevents * infinite loops. This method has public access to allow direct unit testing, as it is the * critical section of code in the class. * * @param reader the input data reader * @param strategy the build strategy object */ public void readFile(Reader reader, IBuildStrategy strategy) { BufferedReader r = null; if (reader == null || strategy == null) { throw new InvalidParametersException(NULL_PARAMETER_ERROR); } try { r = new BufferedReader(reader); // iterate building objects until end-of-stream exception or hard-coded // LIMIT is reached; the latter approach prevents an infinite loop from // buggy readers for (int i = 0; i < LIMIT; i++) { strategy.build(r); } } catch (EndOfStream e) { // reached end of file, ready to close } finally { try { reader.close(); } catch (IOException e) { // log and ignore logger.error(FILE_READER_CLOSE_ERROR, e); } if (r != null) { try { r.close(); } catch (IOException e) { // log and ignore logger.error(READER_CLOSE_ERROR, e); } } } } @Override public void buildAccountGroups() { IBuildStrategy strategy = new AccountGroupStrategy(); readFile(parameters.getAccountGroupReader(fiscalYear.getYear()), strategy); // type map is complete, sort the lists and generate order numbers; the // AccountGroup objects are also in the groupMap, so the order numbers // will be set for the objects in that map as well as the type map. for (List<AccountGroup> list : typeMap.values()) { // sort the list using compareTo Collections.sort(list); // generate order numbers starting at 1 int orderNumber = 1; Integer previousYear = null; for (AccountGroup group : list) { if (previousYear != null && !group.getYear().equals(previousYear)) { // year changed, reset counter to 1 orderNumber = 1; } group.setOrderNumber(orderNumber); previousYear = group.getYear(); orderNumber++; } } } @Override public void buildAccountMap() { IBuildStrategy strategy = new AccountMapStrategy(); readFile(parameters.getAccountMapReader(fiscalYear.getYear()), strategy); } @Override public void buildAccounts() { IBuildStrategy strategy = new AccountStrategy(); readFile(parameters.getAccountReader(fiscalYear.getYear()), strategy); } @Override public void buildBalances() { IBuildStrategy strategy = new BalanceStrategy(); readFile(parameters.getBalanceReader(fiscalYear.getYear()), strategy); if (!balanceDataSet.isEmpty()) { buildBalanceTransactions(); } } /** * Build the balance transactions and put them into the transaction set in the fiscal year. The * method creates one balance transaction per account balance, with one item. */ private void buildBalanceTransactions() { // Use a special, large transaction id for the balance transactions. This id // must be larger than any fiscal year transaction id in the old accounting // system. BigInteger id = new BigInteger(FIRST_BALANCE_TRANSACTION_ID); for (Balance balance : balanceDataSet) { com.poesys.accounting.dataloader.newaccounting.Account account = getAccountFromBalance(balance); // Create a new-accounting balance transaction (balance flag is true). com.poesys.accounting.dataloader.newaccounting.Transaction transaction = new com.poesys.accounting.dataloader.newaccounting.Transaction(id, account.getName(), fiscalYear.getStart(), false, true); // add the item to the transaction transaction.addItem(balance.getAmount(), account, balance.isDebit(), false); // validate the transaction if (!transaction.isValid()) { throw new RuntimeException(INVALID_TRANSACTION_ERROR + transaction); } // add the transaction to set of transactions transactions.add(transaction); // for receivable accounts, index the balance item if (account.isReceivable()) { indexReceivableItem(id.intValue(), balance.getAccountNumber(), balance.isDebit(), transaction.getItem(account)); } // increment the transaction id; assign because BigInteger is immutable id = id.add(BigInteger.ONE); } } /** * Given a specified balance, get the new accounting system account for the balance by looking up * the balance account number in the account map created earlier in the build process. * * @param balance the balance for which to get the account * @return the new accounting system account */ private com.poesys.accounting.dataloader.newaccounting.Account getAccountFromBalance(Balance balance) { Integer accountNumber = new Float(balance.getAccountNumber() * 100F).intValue(); return accountNumberMap.get(accountNumber); } @Override public void buildTransactions() { readTransactionsAndItems(); createTransactions(); createItems(); if (!validateTransactions()) { throw new RuntimeException(INVALID_TRANSACTIONS_ERROR + " for year " + fiscalYear.getYear()); } // Get the updater if any and update with generated transactions. IFiscalYearUpdater updater = parameters.getUpdater(); if (updater != null) { updater.update(fiscalYear, transactions, currentTransactions, this); } } /** * Read the transactions and items from the old-accounting data with the appropriate strategies. * Items are children of transactions, so the loader needs to load both together. */ private void readTransactionsAndItems() { // Read the transaction, item, and reimbursement files. IBuildStrategy strategy = new TransactionStrategy(); readFile(parameters.getTransactionReader(fiscalYear.getYear()), strategy); strategy = new ItemStrategy(); readFile(parameters.getItemReader(fiscalYear.getYear()), strategy); } /** * Iterate through the transaction data set and create all the new-accounting transactions, adding * them to the transaction lookup map indexed by transaction id. */ private void createTransactions() { // Iterate through transactions and create new-accounting transactions for (Transaction transaction : transactionDataSet) { BigInteger id = new BigInteger(transaction.getTransactionId().toString()); com.poesys.accounting.dataloader.newaccounting.Transaction newTransaction = new com.poesys.accounting.dataloader.newaccounting.Transaction(id, transaction.getDescription(), transaction .getTransactionDate(), false, false); // Add the transaction to the transaction map keyed on id. transactionMap.put(transaction.getTransactionId(), newTransaction); // Add the transaction to the set of transactions. transactions.add(newTransaction); currentTransactions.add(newTransaction); // Set the fiscal year's "last" id to the current id if it is greater than the current one. // At the end of the loop, the fiscal year's id will be the greatest id read from the file. fiscalYear.setLastId(id); } } /** * Iterate through the old-accounting items. Look up the transaction in the transaction map. Look * up the account in the account map. Add the item to the transaction, which creates the item and * associates it to the transaction and account. Throw a runtime exception if the transaction id * or the account number is not in the relevant lookup map. Index each receivable-account item * either as a receivable (debit) or reimbursement (credit). The buildReimbursements process step * that follows will use these lookups along with the reimbursements data set to create * reimbursement links. */ private void createItems() { for (Item item : itemDataSet) { // Get the transaction based on transaction id. com.poesys.accounting.dataloader.newaccounting.Transaction transaction = transactionMap.get(item.getTransactionId()); if (transaction == null) { throw new RuntimeException( NO_SUCH_TRANSACTION_ERROR + item.getTransactionId() + FISCAL_YEAR_ERROR + fiscalYear.getYear()); } // Convert account number to 5-digit integer for comparisons, then look up // the account with the integer. Integer accountNumber = new Float(item.getAccountNumber() * 100F).intValue(); com.poesys.accounting.dataloader.newaccounting.Account account = accountNumberMap.get(accountNumber); if (account == null) { throw new RuntimeException( NO_SUCH_ACCOUNT_ERROR + item.getAccountNumber() + FISCAL_YEAR_ERROR + fiscalYear.getYear()); } com.poesys.accounting.dataloader.newaccounting.Item newItem = transaction.addItem(item.getAmount(), account, item.isDebit(), item.isChecked()); // Index the item in receivables or reimbursements as required. if (account.isReceivable()) { indexReceivableItem(item.getTransactionId(), item.getAccountNumber(), item.isDebit(), newItem); } } } /** * Put a receivable account item into the receivables (debit) or reimbursements (credit) map. * * @param id the transaction id for the item * @param accountNumber the account number for the item; must be a receivable account number * @param debit whether the item is debit (true) or credit (false) * @param newItem the new-accounting version of the item */ private void indexReceivableItem(Integer id, Float accountNumber, boolean debit, com.poesys .accounting.dataloader.newaccounting.Item newItem) { // Check for receivable account Integer key = new Float(accountNumber * 100F).intValue(); com.poesys.accounting.dataloader.newaccounting.Account account = accountNumberMap.get(key); if (!account.isReceivable()) { throw new RuntimeException(NOT_RECEIVABLE_ACCOUNT_ERROR + accountNumber); } ItemIndex index = new ItemIndex(id, accountNumber); if (debit) { // Receivable item, add to map indexed by year and transaction id logger.debug( "Adding receivable item to receivables map: " + fiscalYear.getYear() + " - " + id + " " + "for" + " account " + accountNumber); receivablesMap.get(fiscalYear.getYear()).put(index, newItem); } else { // Reimbursing item, add to map indexed by year and transaction id logger.debug( "Adding reimbursing item to reimbursements map: " + fiscalYear.getYear() + " - " + id + "" + " for account " + accountNumber); reimbursementsMap.get(fiscalYear.getYear()).put(index, newItem); } } /** * Validate all the transactions currently in the transaction lookup map. If there are invalid * transactions, log them as errors. Log all the invalid transactions. If there is at least one * invalid transaction, return false; otherwise, return true. * * @return false if there is at least one invalid transaction; otherwise, true */ private boolean validateTransactions() { boolean valid = true; for (com.poesys.accounting.dataloader.newaccounting.Transaction transaction : transactionMap .values()) { if (!transaction.isValid()) { logger.error(INVALID_TRANSACTION_ERROR + transaction); if (valid) { // set flag to invalid if valid only, thus never resets to valid state valid = false; } } } return valid; } @Override public void buildReimbursements() { IBuildStrategy strategy = new ReimbursementStrategy(); readFile(parameters.getReimbursementReader(fiscalYear.getYear()), strategy); // Iterate through reimbursements. Use the shared item lookup maps to get // the new-accounting items to link, then reimburse the receivable items. for (Reimbursement reimbursement : reimbursementDataSet) { Integer receivableYear = reimbursement.getReceivableYear(); Integer receivableId = reimbursement.getReceivableTransactionId(); Float receivableAccountNumber = reimbursement.getAccountNumber(); if (receivableId.equals(0)) { // unchanged prior year reimbursement, determine whether this is an // oversight or whether to link the reimbursement to the balance // transaction for the account. receivableId = getBalanceReceivableId(receivableYear, receivableAccountNumber); logger.debug("Reimbursement is for 0 id, balance id is " + receivableId); } com.poesys.accounting.dataloader.newaccounting.Item receivableItem = lookupReceivableItem(receivableYear, receivableId, receivableAccountNumber); Integer reimbursementYear = reimbursement.getReimbursementYear(); Integer reimbursementId = reimbursement.getReimbursementTransactionId(); com.poesys.accounting.dataloader.newaccounting.Item reimbursementItem = lookupReimbursingItem(reimbursementYear, reimbursementId, receivableAccountNumber); // if both there, link the items. if (receivableItem != null && reimbursementItem != null) { receivableItem.reimburse(reimbursementItem, reimbursement.getReimbursedAmount(), reimbursement.getAllocatedAmount()); } else if (receivableItem == null) { // The receivable wasn't found, warn but ignore. logger.warn("Reimbursing transaction id " + reimbursementId + " reimburses year " + reimbursementYear + " id " + receivableId + " but " + receivableId + " was not found " + "" + "in " + receivableYear + " as a receivable."); } else { // The reimbursing item wasn't found, warn but ignore. logger.warn( "Reimbursing transaction id " + reimbursementId + " reimburses year " + receivableYear + " id " + receivableId + " but " + reimbursementId + " was not found in " + reimbursementYear + " as a reimbursement."); } } } /** * Get the balance id for a receivable account if the balance year is the same as the receivable * year; otherwise, throw a runtime exception. Make sure the balance for the account is non-zero, * and if it is zero, throw a runtime exception. * * @param receivableYear the designated receivable year of a reimbursement * @param receivableAccountNumber the old-accounting account number for the receivable account * @return the transaction id for the balance transaction for the receivable account */ private Integer getBalanceReceivableId(Integer receivableYear, Float receivableAccountNumber) { com.poesys.accounting.dataloader.newaccounting.Account account = getAccountFromNumber(receivableYear, receivableAccountNumber); // Find the balance transaction for the account. com.poesys.accounting.dataloader.newaccounting.Transaction balanceTransaction = null; for (com.poesys.accounting.dataloader.newaccounting.Item item : account.getItems()) { if (item.getTransaction().isBalance()) { balanceTransaction = item.getTransaction(); validateBalanceReceivable(receivableYear, receivableAccountNumber, balanceTransaction, item); } } return balanceTransaction != null ? balanceTransaction.getId().intValue() : null; } /** * Get a new-accounting Account object from a fiscal year and account number. Note that the * old-accounting account numbers are unique only within a fiscal year, so you need to know the * fiscal year if there is an error. * * @param year the fiscal year (used in error message) * @param accountNumber the account number in the fiscal year * @return the account */ private com.poesys.accounting.dataloader.newaccounting.Account getAccountFromNumber(Integer year, Float accountNumber) { // Get the account. Integer number = new Float(accountNumber * 100F).intValue(); com.poesys.accounting.dataloader.newaccounting.Account account = accountNumberMap.get(number); if (account == null) { throw new RuntimeException(ACCOUNT_ERROR + accountNumber + " for year " + year); } return account; } /** * Validate a balance transaction: <ul> <li>Is the item amount non-zero? Balance must be * positive.</li> <li>Is the balance transaction non-null?</li> <li>Is the year of the transaction * the same as the receivable year?</li> </ul> * * @param receivableYear the year of the receivable in the reimbursement * @param receivableAccountNumber the receivable account (for error report) * @param balanceTransaction the balance transaction to check * @param item the balance item to check */ private void validateBalanceReceivable(Integer receivableYear, Float receivableAccountNumber, com.poesys.accounting.dataloader.newaccounting .Transaction balanceTransaction, com.poesys.accounting .dataloader.newaccounting.Item item) { if (balanceTransaction == null) { throw new RuntimeException(NO_BALANCE_ERROR + receivableAccountNumber); } if (item.getAmount().equals(0.00D)) { throw new RuntimeException(ZERO_BALANCE_ERROR + receivableAccountNumber); } if (!balanceTransaction.getYear().equals(receivableYear)) { throw new RuntimeException(ZERO_RECEIVABLE_ID_ERROR); } } /** * Look up a receivable item in the receivables map. * * @param year the fiscal year of the item * @param id the transaction id of the item * @param accountNumber the account number of the item * @return the receivable item */ private com.poesys.accounting.dataloader.newaccounting.Item lookupReceivableItem(Integer year, Integer id, Float accountNumber) { logger.debug("Looking up receivable item for reimbursement: " + year + " - " + id); Map<ItemIndex, com.poesys.accounting.dataloader.newaccounting.Item> items = receivablesMap.get(year); if (items == null) { throw new RuntimeException(NO_RECEIVABLES_ITEM_MAP_ERROR + year); } ItemIndex index = new ItemIndex(id, accountNumber); return items.get(index); } /** * Look up a reimbursing item in the reimbursements map. * * @param year the fiscal year of the item * @param id the transaction id of the item * @param accountNumber the account number of the item * @return the reimbursing item */ private com.poesys.accounting.dataloader.newaccounting.Item lookupReimbursingItem(Integer year, Integer id, Float accountNumber) { logger.debug("Looking up reimbursing item for receivable: " + year + " - " + id); Map<ItemIndex, com.poesys.accounting.dataloader.newaccounting.Item> items = reimbursementsMap.get(year); if (items == null) { throw new RuntimeException(NO_REIMBURSEMENTS_ITEM_MAP_ERROR + year); } ItemIndex index = new ItemIndex(id, accountNumber); return items.get(index); } @Override public String getPath() { return parameters.getPath(); } @Override public List<FiscalYear> getFiscalYears() { return fiscalYears; } @Override public com.poesys.accounting.dataloader.newaccounting.FiscalYear getFiscalYear() { return fiscalYear; } @Override public CapitalStructure getCapitalStructure() { return capitalStructure; } @Override public Set<com.poesys.accounting.dataloader.newaccounting.AccountGroup> getAccountGroups (FiscalYear year) { return groupSetsMap.get(year); } /** * Get the typeMap for unit testing. * * @return the typeMap */ Map<AccountType, List<AccountGroup>> getTypeMap() { return typeMap; } @Override public Set<com.poesys.accounting.dataloader.newaccounting.Account> getAccounts() { return accounts; } /** * Get the balance data set. This package-access method permits unit testing of the * buildBalances() method, which fills in this balance data set. * * @return returns the balance data set for unit test validation */ Set<Balance> getBalanceDataSet() { return balanceDataSet; } @Override public com.poesys.accounting.dataloader.newaccounting.Account getAccountByName(String name) { if (name == null) { throw new RuntimeException(NO_ACCOUNT_NAME_ERROR); } return accountNameMap.get(name); } public Set<com.poesys.accounting.dataloader.newaccounting.Transaction> getTransactions() { return transactions; } }
lgpl-3.0
joaomneto/TitanCompanion
src/main/java/pt/joaomneto/titancompanion/adventure/impl/fragments/trok/TROKAdventureCombatFragment.java
9477
package pt.joaomneto.titancompanion.adventure.impl.fragments.trok; import android.app.AlertDialog; import android.content.Context; import android.content.DialogInterface; import android.content.res.Configuration; import android.os.Bundle; import android.view.LayoutInflater; import android.view.View; import android.view.ViewGroup; import android.view.inputmethod.InputMethodManager; import android.widget.AdapterView; import android.widget.AdapterView.OnItemSelectedListener; import android.widget.EditText; import android.widget.Spinner; import android.widget.TextView; import kotlin.jvm.functions.Function0; import pt.joaomneto.titancompanion.R; import pt.joaomneto.titancompanion.adventure.Adventure; import pt.joaomneto.titancompanion.adventure.impl.fragments.AdventureCombatFragment; import pt.joaomneto.titancompanion.adventure.impl.util.DiceRoll; import pt.joaomneto.titancompanion.adventurecreation.impl.adapter.DropdownStringAdapter; import pt.joaomneto.titancompanion.util.DiceRoller; import java.util.Arrays; import java.util.List; public class TROKAdventureCombatFragment extends AdventureCombatFragment { public static final String TROK15_GUNFIGHT = "TROK15_GUNFIGHT"; String overrideDamage = null; private Spinner damageSpinner = null; private TextView damageText = null; private List<String> damageList = Arrays.asList("4", "5", "6", "1D6"); @Override public View onCreateView(LayoutInflater inflater, ViewGroup container, Bundle savedInstanceState) { super.onCreate(savedInstanceState); setRootView(inflater.inflate(R.layout.fragment_15trok_adventure_combat, container, false)); damageSpinner = getRootView().findViewById(R.id.damageSpinner); damageText = getRootView().findViewById(R.id.damageText); if (damageSpinner != null) { DropdownStringAdapter adapter = new DropdownStringAdapter(getActivity(), android.R.layout.simple_list_item_1, damageList); damageSpinner.setAdapter(adapter); } if (overrideDamage != null) { damageSpinner.setSelection(damageList.indexOf(overrideDamage)); } else { damageSpinner.setSelection(0); } damageSpinner.setOnItemSelectedListener(new OnItemSelectedListener() { @Override public void onItemSelected(AdapterView<?> arg0, View arg1, int arg2, long arg3) { overrideDamage = damageList.get(arg2); } @Override public void onNothingSelected(AdapterView<?> arg0) { overrideDamage = null; } }); init(); return getRootView(); } protected void combatTurn() { if (getCombatPositions().size() == 0) return; if (getCombatStarted() == false) { setCombatStarted(true); getCombatTypeSwitch().setClickable(false); } if (getCombatMode().equals(TROK15_GUNFIGHT)) { gunfightCombatTurn(); } else { standardCombatTurn(); } } @Override public Function0<Integer> getDamage() { if (getCombatMode().equals(Companion.getNORMAL())) { return () -> 2; } else if (getCombatMode().equals(TROK15_GUNFIGHT)) { return () -> Companion.convertDamageStringToInteger(overrideDamage); } return () -> 2; } protected String combatTypeSwitchBehaviour(boolean isChecked) { setCombatMode(isChecked ? TROK15_GUNFIGHT : Companion.getNORMAL()); return getCombatMode(); } public String getOntext() { return getString(R.string.gunfight); } @Override protected void resetCombat(boolean clearResults) { super.resetCombat(clearResults); } protected void switchLayoutCombatStarted() { damageSpinner.setVisibility(View.GONE); damageText.setVisibility(View.GONE); super.switchLayoutCombatStarted(); } protected void switchLayoutReset(boolean clearResult) { damageSpinner.setVisibility(View.VISIBLE); damageText.setVisibility(View.VISIBLE); super.switchLayoutReset(clearResult); } protected int getKnockoutStamina() { return -1; } protected void addCombatButtonOnClick() { Adventure adv = (Adventure) getActivity(); final InputMethodManager mgr = (InputMethodManager) adv.getSystemService(Context.INPUT_METHOD_SERVICE); if (getCombatStarted()) return; AlertDialog.Builder builder = new AlertDialog.Builder(adv); final View addCombatantView = adv.getLayoutInflater().inflate( getCombatMode() == null || getCombatMode().equals(Companion.getNORMAL()) ? R.layout.component_add_combatant : R.layout.component_add_combatant_damage, null); final EditText damageValue = addCombatantView.findViewById(R.id.enemyDamage); if (damageValue != null) { damageValue.setText(getDefaultEnemyDamage()); damageValue.setRawInputType(Configuration.KEYBOARD_12KEY); } builder.setTitle(R.string.addEnemy).setCancelable(false).setNegativeButton(R.string.close, new DialogInterface.OnClickListener() { public void onClick(DialogInterface dialog, int id) { mgr.hideSoftInputFromWindow(addCombatantView.getWindowToken(), 0); dialog.cancel(); } }); builder.setPositiveButton(R.string.ok, new DialogInterface.OnClickListener() { public void onClick(DialogInterface dialog, int which) { mgr.hideSoftInputFromWindow(addCombatantView.getWindowToken(), 0); EditText enemySkillValue = addCombatantView.findViewById(R.id.enemySkillValue); EditText enemyStaminaValue = addCombatantView.findViewById(R.id.enemyStaminaValue); EditText handicapValue = addCombatantView.findViewById(R.id.handicapValue); Integer skill = Integer.valueOf(enemySkillValue.getText().toString()); Integer stamina = Integer.valueOf(enemyStaminaValue.getText().toString()); Integer handicap = Integer.valueOf(handicapValue.getText().toString()); addCombatant(skill, stamina, handicap, damageValue == null ? getDefaultEnemyDamage() : damageValue.getText().toString()); } }); AlertDialog alert = builder.create(); EditText skillValue = addCombatantView.findViewById(R.id.enemySkillValue); alert.setView(addCombatantView); mgr.toggleSoftInput(InputMethodManager.SHOW_FORCED, InputMethodManager.HIDE_IMPLICIT_ONLY); skillValue.requestFocus(); alert.show(); } @Override protected void startCombat() { if (getCombatMode().equals(TROK15_GUNFIGHT)) { for (int i = 0; i < getCombatPositions().size(); i++) { Combatant c = getCombatPositions().get(i); if (c != null) c.setDamage("4"); } } super.startCombat(); } protected String getDefaultEnemyDamage() { return "4"; } protected void gunfightCombatTurn() { Combatant position = getCurrentEnemy(); Adventure adv = (Adventure) getActivity(); // if (!finishedCombats.contains(currentCombat)) { setDraw(false); setLuckTest(false); setHit(false); DiceRoll diceRoll = DiceRoller.INSTANCE.roll2D6(); int skill = adv.getCombatSkillValue(); boolean hitEnemy = diceRoll.getSum() <= skill; if (hitEnemy) { int damage = getDamage().invoke(); position.setCurrentStamina(Math.max(0, position.getCurrentStamina() - damage)); setHit(true); getCombatResult().setText(getString(R.string.hitEnemyDamage, damage)); } else { setDraw(true); getCombatResult().setText(R.string.missedTheEnemy); } if (position.getCurrentStamina() == 0) { removeAndAdvanceCombat(position); getCombatResult().setText(getCombatResult().getText() + "\n" + getString(R.string.defeatedEnemy)); } for (int i = 0; i < getCombatPositions().size(); i++) { Combatant enemy = getCombatPositions().get(i); if (enemy != null && enemy.getCurrentStamina() > 0) { if (DiceRoller.INSTANCE.roll2D6().getSum() <= enemy.getCurrentSkill()) { int damage = Companion.convertDamageStringToInteger(enemy.getDamage()); getCombatResult().setText(getCombatResult().getText() + "\n" + getString(R.string.saCombatText2, enemy.getCurrentSkill(), enemy.getCurrentStamina(), damage)); adv.setCurrentStamina(Math.max(0, adv.getCurrentStamina() - damage)); } else { getCombatResult().setText(getCombatResult().getText() + "\n" + getString(R.string.saCombatText3, enemy.getCurrentSkill(), enemy.getCurrentStamina())); } } } if (adv.getCurrentStamina() <= 0) { getCombatResult().setText(R.string.youveDied); } refreshScreensFromResume(); } @Override public void refreshScreensFromResume() { getCombatantListAdapter().notifyDataSetChanged(); getCombatTypeSwitch().setEnabled(getCombatPositions().isEmpty()); } }
lgpl-3.0
sibbr/portal-qualidade
check-names/src/br/gov/sibbr/Report.java
756
package br.gov.sibbr; public class Report { BD bd = new BD(); public void start() { /* bd.abreConexao(); ArrayList<String> sourcefileid = new ArrayList<String>(); ArrayList<String> resource_name = new ArrayList<String>(); ResultSet rs = bd.consulta("Select sourcefileid, resource_name from public.resource_contact"); try{ while(rs.next()){ sourcefileid.add(rs.getString("sourcefileid")); resource_name.add(rs.getString("resource_name")); } }catch(Exception e){ e.printStackTrace(); } String lista[] = new String[resource_name.size()]; for(int i = 0; i < resource_name.size(); i++){ lista[i] = resource_name.get(i); System.out.println("Resource Name: " + lista[i]); } */ } }
lgpl-3.0
WarpOrganization/warp
core/src/main/java/net/warpgame/engine/core/execution/task/EngineTask.java
821
package net.warpgame.engine.core.execution.task; /** * @author Jaca777 * Created 2016-06-25 at 12 */ public abstract class EngineTask { private boolean initialized = false; /** * Call only this method in order to initialize the task. */ public void init() { if (initialized) throw new TaskInitializedException(); onInit(); initialized = true; } public void close() { if(!initialized) throw new TaskNotInitializedException(); onClose(); initialized = false; } public boolean isInitialized() { return initialized; } protected abstract void onInit(); protected abstract void onClose(); public abstract void update(int delta); public int getPriority() { return 0; } }
lgpl-3.0
alimg/maxball
app/src/main/java/com/xsonsui/maxball/LobbyBrowserActivity.java
5298
package com.xsonsui.maxball; import android.app.Activity; import android.content.Intent; import android.os.Bundle; import android.view.View; import android.view.ViewGroup; import android.widget.AdapterView; import android.widget.ArrayAdapter; import android.widget.EditText; import android.widget.ListView; import android.widget.Toast; import com.xsonsui.maxball.model.Lobby; import com.xsonsui.maxball.nuts.model.NetAddress; import java.util.List; public class LobbyBrowserActivity extends Activity{ LobbyManager lobbyManager = new LobbyManager(); private String mSessionId; public LobbyManager.Listener<List<NetAddress>> listLobbiesListener = new LobbyManager.Listener<List<NetAddress>>() { @Override public void onSuccess(List<NetAddress> result) { mAdapter.clear(); mAdapter.addAll(result); mAdapter.notifyDataSetInvalidated(); } @Override public void onFailed() { Toast.makeText(LobbyBrowserActivity.this, "Something bad happened :(", Toast.LENGTH_SHORT).show(); } }; private LobbyManager.Listener<String> registerListener = new LobbyManager.Listener<String>() { @Override public void onSuccess(String sessionId) { mSessionId = sessionId; lobbyManager.listLobbies(listLobbiesListener); } @Override public void onFailed() { Toast.makeText(LobbyBrowserActivity.this, "Something bad happened :(", Toast.LENGTH_SHORT).show(); finish(); } }; private ListView listView; private ArrayAdapter<NetAddress> mAdapter; private ViewGroup layoutCreateLobby; private EditText editLobbyName; private LobbyManager.Listener<Lobby> createLobbyListener = new LobbyManager.Listener<Lobby>() { @Override public void onSuccess(Lobby lobby) { Intent i = new Intent(LobbyBrowserActivity.this, GameActivity.class); i.putExtra("lobby", lobby); startActivity(i); } @Override public void onFailed() { Toast.makeText(LobbyBrowserActivity.this, "Something bad happened :(", Toast.LENGTH_SHORT).show(); } }; private String playerName; private String playerAvatar; @Override protected void onCreate(Bundle savedInstanceState){ super.onCreate(savedInstanceState); setContentView(R.layout.activity_lobby); Bundle extras = getIntent().getExtras(); playerName = extras.getString("name"); if(playerName.isEmpty()) playerName = "guest" + (int)(Math.random()*100000); playerAvatar = playerName.substring(0, 1); layoutCreateLobby = (ViewGroup)findViewById(R.id.layoutCreateLobby); layoutCreateLobby.setVisibility(View.GONE); editLobbyName = (EditText)findViewById(R.id.editText); listView = (ListView)findViewById(R.id.listView); mAdapter = new ArrayAdapter<NetAddress>(this, R.layout.lobby_list_item, R.id.textView); listView.setAdapter(mAdapter); findViewById(R.id.buttonRefresh).setOnClickListener(new View.OnClickListener() { @Override public void onClick(View view) { lobbyManager.listLobbies(listLobbiesListener); } }); findViewById(R.id.buttonCreate).setOnClickListener(new View.OnClickListener() { @Override public void onClick(View view) { layoutCreateLobby.setVisibility(View.VISIBLE); } }); layoutCreateLobby.setOnClickListener(new View.OnClickListener() { @Override public void onClick(View view) { layoutCreateLobby.setVisibility(View.GONE); } }); findViewById(R.id.buttonCreateLobby).setOnClickListener(new View.OnClickListener() { @Override public void onClick(View view) { String name = editLobbyName.getText().toString(); Intent i = new Intent(LobbyBrowserActivity.this, GameActivity.class); i.putExtra("action", "host"); i.putExtra("lobbyName", name); i.putExtra("sessionId", mSessionId); i.putExtra("playerName", playerName); i.putExtra("playerAvatar", playerAvatar); startActivity(i); } }); listView.setOnItemClickListener(new AdapterView.OnItemClickListener() { @Override public void onItemClick(AdapterView<?> adapterView, View view, int pos, long l) { NetAddress netAddress = mAdapter.getItem(pos); Intent i = new Intent(LobbyBrowserActivity.this, GameActivity.class); i.putExtra("action", "join"); i.putExtra("lobby", new Lobby(netAddress.srcAddress, netAddress.srcPort)); i.putExtra("sessionId", mSessionId); i.putExtra("playerName", playerName); i.putExtra("playerAvatar", playerAvatar); startActivity(i); } }); } @Override protected void onResume() { super.onResume(); lobbyManager.registerPlayer(playerName, registerListener); } }
lgpl-3.0
fommil/matrix-toolkits-java
src/test/java/no/uib/cipr/matrix/sparse/GMRESDiagonalTest.java
1125
/* * Copyright (C) 2003-2006 Bjørn-Ove Heimsund * * This file is part of MTJ. * * This library is free software; you can redistribute it and/or modify it * under the terms of the GNU Lesser General Public License as published by the * Free Software Foundation; either version 2.1 of the License, or (at your * option) any later version. * * This library is distributed in the hope that it will be useful, but WITHOUT * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or * FITNESS FOR A PARTICULAR PURPOSE. See the GNU Lesser General Public License * for more details. * * You should have received a copy of the GNU Lesser General Public License * along with this library; if not, write to the Free Software Foundation, * Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA */ package no.uib.cipr.matrix.sparse; /** * Test of GMRES with diagonal preconditioning */ public class GMRESDiagonalTest extends GMRESTest { @Override protected void createSolver() throws Exception { super.createSolver(); M = new DiagonalPreconditioner(A.numRows()); } }
lgpl-3.0