blob_id
stringlengths
40
40
repo_name
stringlengths
5
119
path
stringlengths
2
424
length_bytes
int64
36
888k
score
float64
3.5
5.22
int_score
int64
4
5
text
stringlengths
27
888k
9dd89f7f124c7b6e372dddafcefc25508ac1e4e9
PSaiRahul/Pyworks
/csvsort.py
2,437
4
4
#!/usr/bin/python """A simple script to sort csv data Usage: csvsort.py <filename> --column=<cno> csvsort.py <filename> --column=<cno> --dest=<destination-file> csvsort.py <filename> --column=<cno> --desc csvsort.py <filename> --column=<cno> --desc --dest=<destination-file> csvsort.py (-h | --help) csvsort.py --version Options: -h --help Display available commands --version Get the version --column=<cno> The column number to be used for sorting --desc Sort in descending order --dest=<destination-file> Write output data to file """ import csv from operator import itemgetter from docopt import docopt from pprint import pprint def gettypes(headers): types = [] for name in headers: start = name.find("(") end = name.find(")") types.append(name[start+1:end]) return types def convert(types, row): return [eval(t)(val) for t, val in zip(types, row)] def write_data_to_dest(headers, data, destination): with open(destination, 'wb') as f: writer = csv.writer(f) writer.writerow(headers) for row in data: writer.writerow(row) def sort_csv(csvfile,column, desc=False, destination=None): csvdata = [] headers = [] with open(csvfile, "rb") as f: for row in csv.reader(f): headers = row break types = gettypes(headers) count = 0 for row in csv.reader(f): if count == 0: count = 1 else: csvdata.append(convert(types,row)) if desc: csvdata.sort(key=itemgetter(*column), reverse=True) else: csvdata.sort(key=itemgetter(*column)) if not destination: print "Data sorted based on column {}".format(column) print "---------------------------------" pprint(csvdata) else: write_data_to_dest(headers, csvdata, destination) if __name__ == "__main__": arguments = docopt(__doc__, version="csvsort-0.1") desc = arguments['--desc'] carg = arguments['--column'] if carg.find(",") > 0: cols = [int(val)-1 for val in carg.split(",")] else: cols = list(int(carg)-1) if arguments.has_key('--dest'): dest = arguments['--dest'] else: dest = None sort_csv(arguments["<filename>"], cols, desc, dest)
a695b5afd6a0d5db953be66ee669af7c17d866fe
Grace-Bijun-Li/python-challenge
/PyPoll/main.py
2,187
3.84375
4
# Import sys import sys # Import pathlib and csv import pathlib import csv # Set path for file with pathlib.Path(), pointing to the election_data.csv file saved in the Resources folder csvpath = pathlib.Path("./Resources/election_data.csv") # Open the CSV using the `with` keyword with open(csvpath) as csvfile: # Use csv.reader() to read the csvfile variable, setting the delimiter argument equal to "," csvreader = csv.reader(csvfile, delimiter=",") # Read the header row first csv_header = next(csvreader) # Create a date_set variable to count only the unique Voter IDs voter_set = set() # Setup a loop counter to count the number of rows row_counter = 0 candidate_dict = dict() # Loop through each row in csvreader for row in csvreader: # Use if function to count the number of unique Voter IDs in the dataset if row[0] not in voter_set: voter_set.add(row[0]) row_counter = row_counter + 1 # Set up dict key to pick up candidate name candidate_name = row[2] # Use if function to count the total number of votes for each candidate if candidate_name not in candidate_dict: candidate_dict[candidate_name] = 1 else: candidate_dict[candidate_name] = candidate_dict[candidate_name] + 1 # Analysis Output sys.stdout = open("./analysis/analysis.txt", "w") print("PyPoll Election Results") print("-------------------------") print(f"Total Votes: {row_counter}") print("-------------------------") # Set winner_percent variable to determine the winner of PyPoll winner_percent = 0 # Use for loop & if function to get each candidate's result and determine the winner for key in candidate_dict: percent = round(candidate_dict[key]/row_counter * 100, 3) if percent > winner_percent: winner_percent = percent winner_key = key print(key + ": " + str(percent) + "% (" + str(candidate_dict[key]) +")") print("-------------------------") print("Winner: " + winner_key) print("-------------------------")
2a397a4197a70865fbc5f5768f668816776b33cc
ZhengLiangliang1996/Leetcode_ML_Daily
/other/1685_MinimumOperationsToReduceXtoZero.py
815
3.640625
4
#! /usr/bin/env python """ Author: LiangLiang ZHENG Date: File Description """ from __future__ import print_function import sys import argparse arr_sum = sum(nums) if arr_sum < x: return -1 if arr_sum == x: return len(nums) required_subarray_sum = arr_sum - x left = curr_sum = max_subarray_size = 0 for right, num in enumerate(nums): curr_sum += num while curr_sum > required_subarray_sum: curr_sum -= nums[left] left += 1 if curr_sum == required_subarray_sum: max_subarray_size = max(max_subarray_size, right - left + 1) return len(nums) - max_subarray_size if max_subarray_size > 0 else -1 def main(): pass if __name__ == "__main__": main()
5308300b92a06126c866e54886e8cc870eab062c
maneeshd/PyTutorial
/Advanced/OOP/Inheritance2/StudentClass.py
863
3.5
4
""" @author: Maneesh D @email: maneeshd77@gmail.com """ class Student(object): def __init__(self, name, branch, sex, age): self.name = name self.branch = branch self.sex = sex self.age = age self.marks = 0 self.college = "SIR MVIT" def give_marks(self, marks): self.marks = marks def get_marks(self): return self.marks def set_name(self, name): self.name = name def get_name(self): return self.name def set_branch(self, branch): self.branch = branch def get_branch(self): return self.branch def set_age(self, age): self.age = age def get_age(self): return self.age def set_sex(self, sex): self.sex = sex def get_sex(self): return self.sex def get_college(self): return self.college
5dbee5e847f0622ef3af0561231743042ba0717a
quantbruce/leetcode_test
/数据结构相关/树/94. 二叉树的中序遍历.py
2,650
3.8125
4
94. 二叉树的中序遍历 给定一个二叉树,返回它的中序 遍历。 示例: 输入: [1,null,2,3] 1 \ 2 / 3 输出: [1,3,2] 进阶: 递归算法很简单,你可以通过迭代算法完成吗? #############################方法1:递归法 """ 执行用时: 44 ms , 在所有 Python3 提交中击败了 43.44% 的用户 内存消耗: 13.7 MB , 在所有 Python3 提交中击败了 7.84% 的用户 """ class Solution: def inorderTraversal(self, root: TreeNode) -> List[int]: if not root: return [] return self.inorderTraversal(root.left) +\ [root.val] +\ self.inorderTraversal(root.right) ###########################BFS 所有迭代框架法 ###这是一种解这种题的通用框架,很有味道,必须掌握。 """ 执行用时: 28 ms , 在所有 Python3 提交中击败了 99.05% 的用户 内存消耗: 13.7 MB , 在所有 Python3 提交中击败了 7.84% 的用户 """ class Solution: def inorderTraversal(self, root: TreeNode) -> List[int]: white, gray = 0, 1 res = [] stack = [(white, root)] while stack: color, node = stack.pop() if not node: continue if color == white: stack.append((white, node.right)) ## 改变下这个if条件语句中的三个顺序,就可以分别实现前中后遍历 stack.append((gray, node)) stack.append((white, node.left)) else: res.append(node.val) return res https://leetcode-cn.com/problems/binary-tree-inorder-traversal/solution/yan-se-biao-ji-fa-yi-chong-tong-yong-qie-jian-ming/ ###########底下的解答区高赞回答,还可以将方法2进一步让代码更简化 #####思路和方法2本质上是一样的 """ 执行用时: 36 ms , 在所有 Python3 提交中击败了 86.66% 的用户 内存消耗: 13.7 MB , 在所有 Python3 提交中击败了 7.84% 的用户 """ class Solution: def inorderTraversal(self, root: TreeNode) -> List[int]: stack, res = [root], [] while stack: node = stack.pop() if isinstance(node, TreeNode): stack.extend([node.right, node.val, node.left]) # node.right和node.left是TreeNode类型(表明还未访问过),而node.val是int类型(代表已经访问过) elif isinstance(node, int): res.append(node) return res https://leetcode-cn.com/problems/binary-tree-inorder-traversal/solution/yan-se-biao-ji-fa-yi-chong-tong-yong-qie-jian-ming/204119
7b3a5e93432dfcfa020ff7b92eebe1b4de7b88fa
Sem31/Data_Science
/2_Numpy-practice/1_array.py
182
3.59375
4
import numpy as np list_data = [1,2,3,4] arr = np.array(list_data) print("print 1-D arry :\n ",arr) arr = np.array(list_data).reshape(2,2) print("NOw print reshape array :\n ",arr)
cf7a5f91d8fba817087a336a2c82a89c4daa6a13
LoggerHead22/Spellchecker
/Trie.py
4,058
3.59375
4
from collections import deque, OrderedDict class Node: def __init__(self, char, flag=0): self.flag = flag self.freq = None self.child_nodes = {} def __repr__(self): return f'<{int(self.flag)},{self.child_nodes.keys()}>' def add_to_node(self, word): curr_node = self word = list(word[::-1]) while word != []: if word[-1] not in curr_node.child_nodes: curr_node.child_nodes[word[-1]] = Node("") # curr_node.child_nodes = OrderedDict( # sorted(curr_node.child_nodes.items())) curr_node = curr_node.child_nodes[word[-1]] word.pop() if curr_node.flag: curr_node.flag += 1 result = False elif not curr_node.flag: curr_node.flag = 1 result = True return result def find_in_node(self, word): curr_node = self result = None word = list(word[::-1]) while word != []: if word[-1] not in curr_node.child_nodes: result = (False, None) break else: curr_node = curr_node.child_nodes[word[-1]] word.pop() if result is None: result = (curr_node.flag, curr_node) return result def pop_in_node(self, word): if word == "": if self.flag and len(self.child_nodes) == 0: return True elif self.flag and len(self.child_nodes) != 0: self.flag = False return False else: raise KeyError else: if word[0] not in self.child_nodes: raise KeyError else: result = self.child_nodes[word[0]].pop_in_node(word[1:]) if result: del self.child_nodes[word[0]] result = len(self.child_nodes) == 0 return result and not self.flag class TrieIterator: def __init__(self, root, prefix=""): self.prefix = prefix self.root = root self.gener_words = TrieIterator.bfs(self) if root is not None else None def __iter__(self): return self def __next__(self): if self.gener_words is None: raise StopIteration() try: word = next(self.gener_words) except StopIteration: raise StopIteration() return word def bfs(self): queue = deque([("", self.root)]) queue_prefix = deque([["", 1]]) while queue: curr_char, curr_node = queue.popleft() curr_prefix = queue_prefix[0][0] queue_prefix[0][1] -= 1 if queue_prefix[0][1] == 0: queue_prefix.popleft() if curr_node.flag == 1: yield self.prefix + curr_prefix + curr_char for child in OrderedDict(sorted(curr_node.child_nodes.items())): queue.append((child, curr_node.child_nodes[child])) if len(curr_node.child_nodes) > 0: queue_prefix.append([curr_prefix + curr_char, len(curr_node.child_nodes)]) class Trie: def __init__(self): self.root_node = Node("", False) self._len = 0 self.trie_iterator = None def add(self, key): res = self.root_node.add_to_node(key) if res: self._len += 1 return res def pop(self, word): try: self.root_node.pop_in_node(word) except KeyError: raise KeyError(word) else: self._len -= 1 def __len__(self): return self._len def __contains__(self, word): return self.root_node.find_in_node(word)[0] def __iter__(self): return TrieIterator(self.root_node, "") def starts_with(self, prefix): start_node = self.root_node.find_in_node(prefix)[1] return TrieIterator(start_node, prefix)
d7210ef7bc58d48a80a859f69bdf95609ffa6a50
wwwwodddd/Zukunft
/leetcode/merge-nodes-in-between-zeros.py
503
3.90625
4
# Definition for singly-linked list. # class ListNode: # def __init__(self, val=0, next=None): # self.val = val # self.next = next class Solution: def mergeNodes(self, h: Optional[ListNode]) -> Optional[ListNode]: t = r = ListNode() s = 0 while h: if h.val == 0: r.next = ListNode(s) r = r.next s = 0 else: s += h.val h = h.next return t.next.next
af8c0049f78ef469c447df3e82b6eed958c12813
steadydoer/cs_python
/etc/calendar.py
797
3.5625
4
Month = {1:31, 2:28, 3:31, 4:30, 5:31, 6:30, 7:31, 8:31, 9:30, 10:31, 11:30, 12:31} # key:value , key:value pair day = 1 for i in range(1,13): print("{}월".format(i)) start = day % 7 print("\t"*start, end="") for j in range(Month[i]): # 310 if(day % 7 == 6): print("{}".format(j+1)) else: print("{}\t".format(j+1), end="") day += 1 print() print() # space = "{:<5}" # for i in range(1,13): # print("{}월".format(i)) # start = day % 7 # for k in range(start): # print(space.format(" "), end="") # for j in range(Month[i]): # if(day % 7 == 6): # print(space.format(j+1)) # else: # print(space.format(j+1), end="") # day += 1 # print() # print()
69fb7294e781383159d17b90ed603895cbc09cd9
grechko1985/Stepik-2021
/Chapter №1/14. Тип комнаты (from part 1.12).py
1,071
4.0625
4
# Тип комнаты print('Задача по расчеты площади комнат - мой вариант.') type_room = input('Введите тип комнаты: ') if type_room == 'треугольник': a, b, c = int(input('Введите a: ')), int(input('Введите b: ')), int(input('Введите c: ')) p = ((a + b + c) / 2) S = float(((p * (p - a) * (p - b) * (p - c)) ** 0.5)) print('Площадь треугольной комнаты равна', S, '.') elif type_room == 'прямоугольник': a, b = int(input('Введите a: ')), int(input('Введите b: ')) S = float(a * b) print('Площадь прямоугольной комнаты равна', S, '.') elif type_room == 'круг': r = int(input('Введите радиус окружности r: ')) S = float(3.14 * (r ** 2)) print('Площадь круглой комнаты равна', S, '.') else: print('Такого типа комнат в Маливии не существует!')
71b0aa8363bd09e43d242f10a68d0f4918a60165
deeryeus/Assignment-2.19-Color-Hex-Codes
/hexcodes.py
574
3.59375
4
# convert decimal color code to hexadecimal def to_hex(d): hex_int1 = d//16 hex_rem1 = d%16 hex_rem2 = hex_int1%16 hex_dictionary = {0: "0", 1: "1", 2: "2", 3: "3", 4: "4", 5: "5", 6: "6", 7: "7", 8: "8", 9: "9", \ 10: "a", 11: "b", 12: "c", 13: "d", 14: "e", 15: "f"} hex_code = "{0}{1}".format(hex_dictionary[hex_rem2], hex_dictionary[hex_rem1]) return hex_code # convert rgb to hexadecimal def hex_color(red, green, blue): print("#{0}{1}{2}".format(to_hex(red), to_hex(green), to_hex(blue))) hex_color(10, 32, 255)
9018d2ef0c3ff1ae4b291efa1899f01671d35c37
Denrur/TheLastRogue
/geometry.py
5,054
3.90625
4
import math def add_2d(point1, point2): return point1[0] + point2[0], point1[1] + point2[1] def sub_2d(point1, point2): return point1[0] - point2[0], point1[1] - point2[1] def int_2d(point): return int(point[0]), int(point[1]) def other_side_of_point_direction(point1, point2): far_behind_point = sub_2d(point2, point1) direction = element_wise_round(normalize(far_behind_point)) return direction def other_side_of_point(point1, point2): """ returns the point right behind point2 as seen by point1. 1 = point1 2 = point2 r = result ..1.. ..... ..... ...2. ...r. """ direction = other_side_of_point_direction(point1, point2) return add_2d(point2, direction) def distance_squared(point1, point2): """ Returns the distance between two points squared. Marginally faster than Distance() """ return (point1[0] - point2[0]) ** 2 + (point1[1] - point2[1]) ** 2 def distance(point1, point2): """ Returns the distance between two points """ return math.sqrt(distance_squared(point1, point2)) def chess_distance(point1, point2): """ Returns the chess distance between two points """ return max(abs(point1[0] - point2[0]), abs(point1[1] - point2[1])) def length_sqrd(vec): """ Returns the length of a vector2D sqaured. Faster than Length(), but only marginally """ return vec[0] ** 2 + vec[1] ** 2 def length(vec): 'Returns the length of a vector2D' return math.sqrt(length_sqrd(vec)) def normalize(point): """ Returns a new vector that has the same direction as vec, but has a length of one. """ if(point[0] == 0. and point[1] == 0.): return (0., 0.) return (point[0] / length(point), point[1] / length(point)) def element_wise_round(point): """ Return new point with each element rounded to nearest int """ return int(round(point[0])), int(round(point[1])) def dot(a, b): """ Computes the dot product of a and b """ return a[0] * b[0] + a[1] * b[1] def project_onto(w, v): """ Projects w onto v. """ return v * dot(w, v) / length_sqrd(v) def zero2d(): return (0, 0) class Rect(object): """A rectangle identified by two points. The rectangle stores left, top, right, and bottom values.""" def __init__(self, position, width, height): """Initialize a rectangle top left point position and width height.""" self.set_points(position, width, height) def set_points(self, position, width, height): """Reset the rectangle coordinates.""" x, y = position self.left = x self.top = y self.right = x + width self.bottom = y + height def contains(self, pt): """Return true if a point is inside the rectangle.""" x, y = pt return (self.left <= x <= self.right and self.top <= y <= self.bottom) def overlaps(self, other): """Return true if a rectangle overlaps this rectangle.""" return (self.right > other.left and self.left < other.right and self.top < other.bottom and self.bottom > other.top) @property def width(self): """Return the width of the rectangle.""" return self.right - self.left @property def height(self): """Return the height of the rectangle.""" return self.bottom - self.top @property def top_left(self): """Return the top-left corner as a tuple.""" return self.left, self.top @property def bottom_right(self): """Return the bottom-right corner as a tuple.""" return self.right, self.bottom def expanded_by(self, point): """Return a rectangle with extended borders. Create a new rectangle that is wider and taller than the immediate one. All sides are extended by "n" tuple. """ p1 = (self.left - point[0], self.top - point[1]) p2 = (self.right + point[0], self.bottom + point[1]) return Rect(p1, p2[0] - p1[0], p2[1] - p1[1]) def containing_points(self): result = [] for x in range(self.left, self.right + 1): for y in range(self.top, self.bottom + 1): result.append((x, y)) return result def border_points(self): result = set() for x in range(self.left, self.right + 1): result.add((x, self.top)) result.add((x, self.bottom)) for y in range(self.top, self.bottom + 1): result.add((self.left, y)) result.add((self.right, y)) return list(result) def __str__(self): return "<Rect (%s, %s) - (%s, %s)>" % (self.left, self.top, self.right, self.bottom) def __repr__(self): return "%s(%r, %r)" % (self.__class__.__name__, (self.left, self.top), (self.right, self.bottom))
dc81a8e0856f9299a7aba0ae7b12dcba8fd80a75
rafaelperazzo/programacao-web
/moodledata/vpl_data/331/usersdata/296/95770/submittedfiles/funcoes1.py
1,218
4.09375
4
# -*- coding: utf-8 -*- n = int(input("Digite a quantidade de elementos das listas: ")) while n<=1: n = int(input("Digite a quantidade de elementos das listas: ")) a = [] for i in range (0,n,1): a.append(int(input("Digite um valor para a lista a: "))) print("a = " + str (a)) b = [] for i in range (0,n,1): b.append(int(input("Digite um valor para a lista b: "))) print("b = " + str (a)) c = [] for i in range (0,n,1): c.append(int(input("Digite um valor para a lista c: "))) print("b = " + str (a)) #escreva o código da função crescente aqui a_crescente = sorted(a) a_decrescente = reversed(a) if a == a_crescente: print("S") print("N") elif a == a_decrescente: print("N") print("S") else: print("N") print("N") b_crescente = sorted(b) b_decrescente = reversed(b) if b == b_crescente: print("S") print("N") elif b == b_decrescente: print("N") print("S") else: print("N") print("N") c_crescente = sorted(c) c_decrescente = reversed(c) if c == c_crescente: print("S") print("N") elif c == c_decrescente: print("N") print("S") else: print("N") print("N") #escreva as demais funções #escreva o programa principal
ea344994d11c459955de8210733ee928d841fd94
saidworks/TTC
/chapter13_Game_Design_Top_Down/Game_Design_Top_Down.py
5,996
4.3125
4
####This an example of procedural programming where functions are created to handle all main tasks from random import choice def InitializeGrid(board): #Initialize grid by random value for i in range(8): for j in range(8): board[i][j]=choice(['Q','R','S','T','U']) def Initialize(board): #Initialize game #Intialize the grid InitializeGrid(board) #Initialize score global score score=0 #Initialize turn number global turn turn=1 def ContinueGame(currentscore,goalscore=100): #Return false if game should end , true if game not over if currentscore>=goalscore: return False else: return True def DrawBoard(): # Display the board to the screen linetodraw = "" # Draw some blank lines first print("\n\n\n") print(" ---------------------------------") # Now draw rows from 8 down to 1 for i in range(7, -1, -1): # Draw each row linetodraw = str(8-i) + "" for j in range(8): linetodraw += " | " + board[i][j] linetodraw += " |" print(linetodraw) print(" ---------------------------------") print(' | a | b | c | d | e | f | g | h |') global score print('current score:',score) #verify user entry def IsValid(move): #verify if the user entered an appropriate key cols = [ 'a' , 'b' ,'c' , 'd' , 'e' , 'f' , 'g' , 'h'] direction = ['u','d','l','r'] if len(move)==3 and int(move[1])<8: for i in cols: for j in direction: if move.startswith(i): if move.endswith(j): return True else: return False def GetMove(): #instructions print("Enter move by specifuing the space and the direction (u,d,l,r). Spaces should list column then row. \n For example, e3u would swap position e3 with the one above, and f7r would swap f7 to the right.") #Get the move from the user move = input("Enter a move : ") while not IsValid(move): move = input("Enter a move : ") return move def DoRound(): #Perform one round of the game #Display current board DrawBoard() #Get a move move=GetMove() #Update board Update(board,move) #update turn number global turn turn+=1 def ConvertLetterToCol(Col): if Col == 'a': return 0 elif Col == 'b': return 1 elif Col == 'c': return 2 elif Col == 'd': return 3 elif Col == 'e': return 4 elif Col == 'f': return 5 elif Col == 'g': return 6 elif Col == 'h': return 7 else: #not a valid column! return -1 def SwapPieces(board, move): #Swap pieces on board according to move #Get original position origrow = int(move[1])-1 origcol = ConvertLetterToCol(move[0]) #Get adjacent position if move[2] == 'u': newrow = origrow + 1 newcol = origcol elif move[2] == 'd': newrow = origrow - 1 newcol = origcol elif move[2] == 'l': newrow = origrow newcol = origcol - 1 elif move[2] == 'r': newrow = origrow newcol = origcol + 1 #Swap objects in two positions temp = board[origrow][origcol] board[origrow][origcol] = board[newrow][newcol] board[newrow][newcol] = temp def RemovePieces(board): #Remove 3-in-a-row and 3-in-a-column pieces #Create board to store remove-or-not remove = [ [0, 0, 0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0, 0, 0]] #Go through rows for i in range(8): for j in range(6): if (board[i][j] == board[i][j+1]) and (board[i][j] == board[i][j+2]): #three in a row are the same! remove[i][j] = 1; remove[i][j+1] = 1; remove[i][j+2] = 1; #Go through columns for j in range(8): for i in range(6): if (board[i][j] == board[i+1][j]) and (board[i][j] == board[i+2][j]): #three in a row are the same! remove[i][j] = 1; remove[i+1][j] = 1; remove[i+2][j] = 1; #Eliminate those marked global score removed_any = False for i in range(8): for j in range(8): if remove[i][j] == 1: board[i][j] = 0 score += 1 removed_any = True return removed_any def DropPieces(board): #Drop pieces to fill in blanks for j in range(8): #make list of pieces in the column listofpieces = [] for i in range(8): if board[i][j] != 0: listofpieces.append(board[i][j]) #copy that list into colulmn for i in range(len(listofpieces)) : board[i][j] = listofpieces[i] #fill in remainder of column with 0s for i in range(len(listofpieces), 8): board[i][j] = 0 def FillBlanks(board): #Fill blanks with random pieces for i in range(8): for j in range(8): if (board[i][j] == 0): board[i][j] = choice(['Q', 'R', 'S', 'T', 'U']) def Update(board, move): #Update the board according to move SwapPieces(board, move) pieces_eliminated = True while pieces_eliminated: pieces_eliminated = RemovePieces(board) DropPieces(board) FillBlanks(board) #state variables for main data to be stored ( data structure) score = 50 goalscore = 100 board=[[0,0,0,0,0,0,0,0], [0,0,0,0,0,0,0,0], [0,0,0,0,0,0,0,0], [0,0,0,0,0,0,0,0], [0,0,0,0,0,0,0,0], [0,0,0,0,0,0,0,0], [0,0,0,0,0,0,0,0], [0,0,0,0,0,0,0,0]] #Initialize Game Initialize(board) #Loop while game not over while ContinueGame(score,goalscore): #Do a round of the game DoRound()
3a2abca2023987a0e0b693ea1a47ff713b83d642
bazuevad/problem-solving
/Algorithms/binarySearch.py
357
3.953125
4
def binarySearch(array, target): return binarySearchH(array, target, 0, len(array)-1) def binarySearchH(array, target, left, right): if left>right: return -1 mid = (left+right)//2 if target==array[mid]: return mid elif target<array[mid]: return binarySearchH(array,target,left,mid-1) else: return binarySearchH(array,target,mid+1,right)
fb23ad2bef74cccb292d745a596d9a7476ecd3fd
gabriellll00/hello-world
/UriOnlineJudge/uri1004.py
127
3.6875
4
""" Multiplicação entre dois inteiros """ num1 = int(input()) num2 = int(input()) prod = num1 * num2 print(f'PROD = {prod}')
bb79dbb7a181a51cfd699e6d96810b8fb491381b
imao03/Chapter-01
/myExcle/测试三组数据.py
666
3.65625
4
# coding:UTF-8 import unittest from parameterized import parameterized """ 问题: 如果有三组数据需要测试? [(1,1,2), (1,2,3), (0,3,3)] """ def add(x, y): return x + y def get_data(): return [(1, 2, 3), (3, 0, 3), (2, 1, 3)] # 定义测试类,并集成 class Test01(unittest.TestCase): @parameterized.expand(get_data()) def test_add(self, a, b, expect): result = add(a, b) assert result == expect def testStr_Int(self): print("") i = 10 s = str(i) print(s) s = '1' i = int(s) print(i) if __name__ == '__main__': print("")
0d46eeb1675f567f6cf2b20f500e44691deaacec
Arpi65/UCI_Homework_Arpi
/python_challenge/PyBank/main.py
2,555
3.75
4
# Need to read the file from the data source C:\Users\arpib\Desktop\uci-irv-data-pt-08-2020-u-c\02-Homework\03-Python\Instructions\PyBank\Resources # The current Folder working in is C:\Users\arpib\Desktop\python-challenge\PyBank import os import csv #csvpath = os.path.join('..','uci-irv-data-pt-08-2020-u-c','02-Homework','03-Python','Instructions','PyBank','Resources','budget_data.csv') # use next and csv reader csvpath=os.path.join('Resources','budget_data.csv') with open(csvpath) as csvfile: csvreader=csv.reader(csvfile,delimiter=",") print(csvreader) print("-----------------------------") csvheader=next(csvreader) print(f"CSV Header: {csvheader}") #Number of months in the file Number_Of_Months=sum(1 for line in csvreader) print(f'Number of months in the file {Number_Of_Months}') # # The net total amount of "Profit/Losses" over the entire period totalm=["Total number of months",Number_Of_Months] with open(csvpath) as csvfile: csvreader=csv.reader(csvfile,delimiter=",") csvheader=next(csvreader) total=sum(float(row[1]) for row in csvreader) print(f'Total of Profit/Loss {total}') totalp=["Total Profit/loss",total] #The greatest increase in profits (date and amount) over the entire period with open(csvpath) as csvfile: csvreader=csv.reader(csvfile,delimiter=",") csvheader=next(csvreader) maximum=max(float(row[1]) for row in csvreader) with open(csvpath) as csvfile: csvreader=csv.reader(csvfile,delimiter=",") csvheader=next(csvreader) for row in csvreader: if float(row[1])==maximum: dateofmax=row[0] print(row[0]) print(f'Maximum Value {maximum}') maxp=["Maxium Value",dateofmax,maximum] # The greatest decrease in losses (date and amount) over the entire period #with open(csvpath) as csvfile: # csvreader=csv.reader(csvfile,delimiter=",") # csvheader=next(csvreader) average=total/Number_Of_Months print(f'Average profit/Loss {average} ') avgp=["Average profit change",average] #prnit results in txt file output_file= os.path.join("..", "analysis", "bank_py.csv") with open(output_file, "w") as datafile: writer = csv.writer(datafile) title=["Financial Analysis"] writer.writerow(title) writer.writerow(totalm) writer.writerow(totalp) writer.writerow(maxp) writer.writerow(avgp) # The net total amount of "Profit/Losses" over the entire period # The average of the changes in "Profit/Losses" over the entire period # The greatest increase in profits (date and amount) over the entire period # The greatest decrease in losses (date and amount) over the entire period
0370539c644c8ec9bfb8b84410056d006b2c7364
orestisfoufris/algorithmicProblemsPython
/burstballoons.py
798
3.5625
4
''' Burst Balloons dynamic programming problem https://leetcode.com/problems/burst-balloons/ ''' def maxCoins(nums): """ :type nums: List[int] :rtype: int """ # let's put the 1s before and after nums = [1] + nums + [1] N = len(nums) # dp[i][j] denotes the best result for range (i, j) dp = [[0 for i in range(N)] for i in range(N)] for i in range(1, N - 1): for left in range(0, N - i - 1): # starting point for right right = left + i + 1 # m (middle) will be the last balloon # to be burst for m in range(left + 1, right): dp[left][right] = max(dp[left][right], dp[left][m] + dp[m][right] + nums[left] * nums[m] * nums[right]) return dp[0][N - 1]
9f9319a4b475595c17a8fef968b77e7c9c5b6aa5
libdx/pylab
/scripts/convert.py
1,272
3.8125
4
#!/usr/bin/env python import csv import json from pathlib import Path def csv_file_to_json(file, output_dir, labels=None): """Converts CSV data file to JSON data file. :param file: path to CSV file. :type file: pathlib.Path :param output_dir: path to output directory where JSON file will be placed. :type output_dir: pathlib.Path :param labels: list of columns names. :type labels: list[str] """ if labels is None: labels = [] if output_dir is None: output_dir = file.parent with open(file) as f: reader = csv.DictReader(f, labels) contents = list(reader) if not output_dir.exists(): output_dir.mkdir(parents=True) output_file = output_dir / file.with_suffix('.json').name with open(output_file, 'w') as f: json.dump(contents, f, indent=2) def main(): data_dir = Path('data') with open(data_dir / 'metadata.json') as f: metadata = json.load(f) output_dir = Path('data') / 'json' for entry in metadata: filename = entry['filename'] labels = entry['labels'] csv_file = (data_dir / filename).with_suffix('.csv') csv_file_to_json(csv_file, output_dir, labels) if __name__ == '__main__': main()
0881b693f6118b11f56654bf1f71c6831e341146
kirsty-tortoise/comp4-simulation
/src/Graphs.py
4,141
3.75
4
# TODO: from RelativeDrawing import * class Graph(object): ''' Stores the data about a parameter and slowly draws a graph in real time. ''' def __init__(self, name, parameterList, colourList, minY, maxY, incrementX = 0.001, relX=0.55, relY=0.05, relWidth=0.4, relHeight=0.25, boxX = 0.5, boxY = 0.03, boxWidth = 0.5, boxHeight = 0.32, boxColour = color(255, 0, 0), axesColour = color(0)): ''' Sets up a graph and draws on the axes. relX, relY, relWidth and relHeight determine the size of the actual graph and axes boxX, boxY, boxWidth, boxHeight determine the size of the containing box scalingY is the amount by which the y coordinate is scaled, and incrementX is the amount to increase X (time) for each plot parameterList contains the parameters to plot, and colourList is the colours to plot them in ''' self.name = name self.relX = relX self.relY = relY self.relWidth = relWidth self.relHeight = relHeight self.boxX = boxX self.boxY = boxY self.boxWidth = boxWidth self.boxHeight = boxHeight self.minY = minY self.maxY = maxY self.scalingY = relHeight / float(maxY - minY) self.incrementX = incrementX self.parameterList = parameterList self.colourList = colourList self.boxColour = boxColour self.axesColour = axesColour def display(self): ''' Resets the graph and sets up the axes when required. More code may be added later to deal with drawing scales properly. ''' # Draw the surrounding rectangle, getting rid of everything from before. noStroke() fill(self.boxColour) relXRect(self.boxX, self.boxY, self.boxWidth, self.boxHeight) # Draw the two axes stroke(self.axesColour) strokeWeight(2) # Decide on where the x axis should be. if self.minY <= 0 <= self.maxY: pointY = self.scalingY * self.minY + self.relY + self.relHeight elif self.minY > 0: pointY = self.relY + self.relHeight else: pointY = self.relY relXLine(self.relX, pointY, self.relX + self.relWidth, pointY) # x axis relXLine(self.relX, self.relY, self.relX, self.relY + self.relHeight) # y axis strokeWeight(1) # Draw in key drawingX = self.boxX + 0.05 * self.boxWidth keyWidth = 0.9 * self.boxWidth / len(self.parameterList) for i in range(len(self.parameterList)): # Draw a block of that colour fill(self.colourList[i]) relXRect(drawingX, self.relY + 1.02 * self.relHeight, 0.05 * self.relWidth, 0.05 * self.relWidth) drawingX += 0.05 * self.boxWidth fill(0) textSize(20) relXText(self.parameterList[i].name, drawingX, self.relY + 1.06 * self.relHeight) drawingX += keyWidth # Move drawing point back to the beginning self.x = 0 self.oldX = [None for i in self.parameterList] self.oldY = [None for i in self.parameterList] def update(self): strokeWeight(3) for count in range(len(self.parameterList)): param = self.parameterList[count] colour = self.colourList[count] stroke(colour) pointX = self.x + self.relX if self.minY <= param.value <= self.maxY: pointY = - self.scalingY * (param.value - self.minY) + self.relY + self.relHeight elif self.minY > param.value: pointY = self.relY + self.relHeight else: pointY = self.relY if self.x != 0: relXLine(self.oldX[count], self.oldY[count], pointX, pointY) self.oldX[count] = pointX self.oldY[count] = pointY strokeWeight(1) self.x += self.incrementX if self.x > self.relWidth: self.display()
2d5c6718843ea5471a1d8b044a6bd89bd1273a26
geshkocker/python_hw
/hw3_t1.py
1,220
3.6875
4
zen_of_python = ''' Beautiful is better than ugly. Explicit is better than implicit. Simple is better than complex. Complex is better than complicated. Flat is better than nested. Sparse is better than dense. Readability counts. Special cases aren't special enough to break the rules. Errors should never pass silently. Unless explicitly silenced. In the face of ambiguity, refuse the temptation to guess. There should be one-- and preferably only one --obvious way to do it. Although that way may not be obvious at first unless you're Dutch. Now is better than never. Although never is often better than *right* now. If the implementation is hard to explain, it's a bad idea. If the implementation is easy to explain, it may be a good idea. Namespaces are one honking great idea -- let's do more of those! ''' better_c = zen_of_python.count('better') never_c = zen_of_python.count('never') is_c = zen_of_python.count('is') zen_of_python_upper = zen_of_python.upper() zen_of_python_replace = zen_of_python.replace('i', '&') print(f'Word "better" is used {better_c} times') print(f'Word "never" is used {never_c} times') print(f'Word "is" is used {is_c} times') print(zen_of_python_upper) print(zen_of_python_replace)
bf4bbfaa9fe19c8a9e1463bcc19da4044a9911fd
madhurajoshi55/Intutive_Solutions_Madhura_Pub
/ReverseString.py
1,163
3.703125
4
class Solution(object): def reverseStrng(self, strng): """ :type s: str :rtype: str """ length = len(strng) st = [] for i in range(length): # add the index of opening bracket if (strng[i] == '('): st.append(i) # reversing the substring after last opening bracket elif (strng[i] == ')'): temp = strng[st[-1]:i + 1] strng = strng[:st[-1]] + temp[::-1] + \ strng[i + 1:] del st[-1] # To store the modified string result = "" for i in range(length): if (strng[i] != ')' and strng[i] != '('): result += (strng[i]) return result if __name__ == '__main__': strng = "(abc)" strng1 = "(ed(et(oc))el)" strng2 = "(u(love)i)" strng3= "a(bcdefghijkl(mno)p)q" print(reverseStrng(__name__, strng)) print(reverseStrng(__name__, strng1)) print(reverseStrng(__name__, strng2)) print(reverseStrng(__name__, strng3))
3ebdc23d4bd4b8cb5f3ddbe2c44b115f103fd8d1
koushik-chandra-sarker/PythonLearn
/a_script/b_Variable.py
1,826
4.40625
4
""" Python has no command for declaring a variable. A variable is created the moment you first assign a value to it. A variable name must start with a letter or the underscore character A variable name cannot start with a number A variable name can only contain alpha-numeric characters and underscores (A-z, 0-9, and _ ) Variable names are case-sensitive (age, Age and AGE are three different variables) Illegal variable names: 1variable = 13 var-iable = 10 var iable = 14 Legal variable names: variable = 13 my_name = "Koushik Chandra Sarker" myName = "Koushik Chandra Sarker" MYNAME = "Koushik Chandra Sarker" MYNAME2 = "Koushik Chandra Sarker" """ # Variables do not need to be declared with any particular type, and can even change type after they have been set. x = 10 # int x1 = 10.4 # float y = "Hello Python" # String-> str print(x) # Output: 10 print(type(x)) # Output: <class 'int'> print(x1) # Output: 10.4 print(type(x1)) # Output: <class 'float'> print(y) # Output: Hello Python print(type(y)) # Output: <class 'str'> # Case-Sensitive # Variable names are case-sensitive. a = 13 A = 15 print(a) # Output: 13 print(A) # Output: 15 # Casting # If you want to specify the data type of a variable, this can be done with casting. a1 = str(a) a2 = float(a) print(type(a1)) # Output: <class 'str'> print(type(a2)) # Output: <class 'float'> """ Python allows you to assign values to multiple variables in one line: """ a, b, c = "Red", "Green", "Yellow" print(a) # Output: Red print(b) # Output: Green print(c) # Output: Yellow """ you can assign the same value to multiple variables in one line: """ a = b = c = 10 print(a) # Output: 10 print(b) # Output: 10 print(c) # Output: 10
8f2d80cdab470e8d2f41e5bb01d1ee67757e0956
MarkyAaronYoung/petting-zoo
/animals/duck/duck.py
255
3.53125
4
from datetime import date from animals.animal import Animal class Duck(Animal): def __init__(self, name, species, shift, food, chip_num): super().__init__(name, species, food, chip_num) self.shift = shift self.swimming = True
20fb65fb203b373cad89738adc11b1afbe3bd157
Barracas-azazaza/Curso-principiante-Python
/Parcial.py
506
4
4
print("ingrese el numero de datos a guardar") veces=float(input()) datos=[] n=0 acumulador=0 acumulador2=0 promedio=acumulador/veces while n<veces: print("Ingrese numero") numero=float(input()) info={ "digito":numero } datos.append(info) acumulador=numero+acumulador n=n+1 promedio=float(acumulador/veces) print(promedio) for r in datos: acumulador2=float(r["digito"]-promedio)**2+acumulador2 varianza=float(acumulador2/veces) print(varianza)
d7ac18b4ebc564b91e8e905e63a3c8a0a6f9b08b
rjmacleod/math134
/dwr.py
653
3.859375
4
# Takes 2 natural numbers a and b and # computes integers q and r st a = qb * r and 0 <= r < b. def dwr(a, b): # Takes natural numb a and b, returns (q,r) such that # a = qb + r where q,r are integers and 0 <= r < b q = 1 r = 0 if (a > b): while ((q + 1) * b < a): q += 1 r = a - q * b return q, r elif (a == b): return 1, 0 else: return 0, a a = 1 b = 1 print("Enter natural numbers a and b, a > b.") while (a < 2): a = input("a = ") a = int(a) while (b < 2): b = input("b = ") b = int(b) (q,r) = dwr(a,b) print("{} = {} * {} + {}".format(a,q,b,r))
1f5ab29e8d33e63c67b05ea7cf6b85fc06f3b2ff
savnani5/Opencv-basic-codes
/Ml_opencv_algo.py
2,467
3.5
4
# ML algorithms """ import cv2 import numpy as np import matplotlib.pyplot as plt # Feature set containing (x,y) values of 25 known/training data trainData = np.random.randint(0,100,(25,2)).astype(np.float32) # Labels each one either Red or Blue with numbers 0 and 1 responses = np.random.randint(0,2,(25,1)).astype(np.float32) # Take Red families and plot them red = trainData[responses.ravel()==0] plt.scatter(red[:,0],red[:,1],80,'r','^') # Take Blue families and plot them blue = trainData[responses.ravel()==1] plt.scatter(blue[:,0],blue[:,1],80,'b','s') #plt.show() newcomers = np.random.randint(0,100,(10,2)).astype(np.float32) plt.scatter(newcomers[:,0],newcomers[:,1],80,'g','o') knn = cv2.ml.KNearest_create() knn.train(trainData, cv2.ml.ROW_SAMPLE, responses) ret, results, neighbours ,dist = knn.findNearest(newcomers, 3) print( "result: {}\n".format(results) ) print( "neighbours: {}\n".format(neighbours) ) print( "distance: {}\n".format(dist) ) plt.show() """ #>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> import numpy as np import cv2 as cv img = cv.imread('C:\\Users\\HP\\Desktop\\Fero\\digits.png') gray = cv.cvtColor(img,cv.COLOR_BGR2GRAY) # Now we split the image to 5000 cells, each 20x20 size cells = [np.hsplit(row,100) for row in np.vsplit(gray,50)] # Make it into a Numpy array. It size will be (50,100,20,20) x = np.array(cells) # Now we prepare train_data and test_data. train = x[:,:50].reshape(-1,400).astype(np.float32) # Size = (2500,400) test = x[:,50:100].reshape(-1,400).astype(np.float32) # Size = (2500,400) # Create labels for train and test data k = np.arange(10) train_labels = np.repeat(k,250)[:,np.newaxis] test_labels = train_labels.copy() # Initiate kNN, train the data, then test it with test data for k=1 knn = cv.ml.KNearest_create() knn.train(train, cv.ml.ROW_SAMPLE, train_labels) ret,result,neighbours,dist = knn.findNearest(test,k=5) # Now we check the accuracy of classification # For that, compare the result with test_labels and check which are wrong matches = result==test_labels correct = np.count_nonzero(matches) accuracy = correct*100.0/result.size print( accuracy ) # save the data np.savez('knn_data.npz',train=train, train_labels=train_labels) # Now load the data with np.load('knn_data.npz') as data: print( data.files ) train = data['train'] train_labels = data['train_labels']
fee70308fcd2662dbb154e09417c4abd6793776e
soniya-mi/python
/palindrme_string.py
224
3.953125
4
string = "Soniya" len = len(string) rev_str = "" for index in range(len,0,-1): rev_str = rev_str + string[index-1] if rev_str = string: print "Palindrome" else: print "Not Palindrome" print rev_str
ca8f08582f747953121500f3dfbfd02c944a78e5
tanvirraihan142/CtCi-in-python
/Chap 1/1.3.1 URLify.py
619
3.59375
4
def replace_spaces(str1,true_length): space_count=0 i=0 str1 = list(str1) for i in range(true_length): if (str1[i]==' '): space_count+=1 index = true_length + space_count*2 if (true_length < len(str1)): str1[true_length] = '\0' str2 = [' ' for i in range(index)] for i in range(true_length-1,-1,-1): if (str1[i]==' '): str2[index-1]='0' str2[index-2]='2' str2[index-3]='%' index = index - 3 else: str2[index-1] = str1[i] index-=1 return "".join(str2)
1b4c6ec29fc3947ff332f63363c683f297d82151
wing1king/python_xuexi
/阶段1-Python核心编程/09-模块和包/hm_01_模块的使用方法.py
494
4.09375
4
# 需求: math模块下sqrt()开评分计算 """ 1. 导入模块 2. 测试是否导入成功:调用该模块内的sqrt功能 """ # 方法一: import 模块名; 模块名.功能 import math print(math.sqrt(9)) # 方法二: from 模块名 import 功能1, 功能2....;功能调用(不需要书写模块名.功能) from math import sqrt print(sqrt(9)) # 方法三: from 模块名 import *; 功能调用(不需要书写模块名.功能) from math import * print(sqrt(9))
064cbef55d766b1f524e24dd44cdb6f218667486
rafaelperazzo/programacao-web
/moodledata/vpl_data/303/usersdata/285/67223/submittedfiles/testes.py
286
3.90625
4
# -*- coding: utf-8 -*- #COMECE AQUI ABAIXO nota=float(input("digite sua primeira nota:")) print(nota) nota=float(input("digite sua segunda nota:")) print(nota) nota=float(input("digite sua terceira nota:")) print(nota) note=float(input("digite sua quarta nota:")) print(nota)
396c510c85e132bd8fff011d5012361214c75e01
Obadha/andela-bootcamp-8-nbo
/Assignments_Day2/fibonacci.py
209
4.3125
4
# ''' # '''how to implement Fibonacci gotten from python docs using recursion''' def fibo(n): num_list = [] a, b = 0, 1 while b < n: num_list.append(b) a,b = b, a + b return num_list print(fibo(10))
a1cec9bf77214fd71e45cdbf98f062c046bd97f8
zaine-co/jartaton-rappi
/back/bellman.py
1,493
3.921875
4
def BellmanFord(G,start): D = {} # dictionary of final distances for v in G: D[v] = float('inf') D[start] = 0 P = {} # dictionary of predecessors for i in range(len(G)-1): for u in G: for v in G[u]: newDv = D[u] + G[u][v] if newDv < D[v]: P[v] = u D[v] = newDv for u in G: for v in G[u]: newDv = D[u] + G[u][v] if newDv < D[v]: print("Negative cicle",u,v) return D,P # From http://www.ics.uci.edu/~eppstein/161/python/dijkstra.py # David Eppstein, UC Irvine, 4 April 2002 def shortestPath(G,start,end): """ Find a single shortest path from the given start vertex to the given end vertex. The input has the same conventions as Dijkstra(). The output is a list of the vertices in order along the shortest path. """ D,P = BellmanFord(G,start) Path = [] while 1: Path.append(end) if end == start: break end = P[end] Path.reverse() return Path # example, CLR p.528 G = {'s': {'u':10, 'x':5}, 'u': {'v':1, 'x':2}, 'v': {'y':4}, 'x':{'u':3,'v':9,'y':2}, 'y':{'s':7,'v':6}} print(BellmanFord(G,'s')) print(shortestPath(G,'s','v')) # modified negative cicle w(u,x) = -4 G = {'s': {'u':10, 'x':1}, 'u': {'v':1, 'x':-4}, 'v': {'y':4}, 'x':{'u':3,'v':9,'y':2}, 'y':{'s':7,'v':6}} print(BellmanFord(G,'s'))
0baf6338a013fb5c18d4635899e9bca62c8ac13e
ceeblet/OST_PythonCertificationTrack
/Python1/python1/pair_frequency.py
702
4.09375
4
#!/usr/local/bin/python3 """Count the frequency of each word in a text.""" text = """\ Baa, Baa, Black sheep, Have you any wool? Yes sir, yes sir, Three bags full; One for the master, And one for the dame, And one for the little boy Who lives down the lane.""" for punc in ",?;.": text = text.replace(punc, "") words = {} textwords = text.lower().split() firstword = textwords[0] for nextword in textwords[1:]: if firstword not in words: words[firstword] = {} words[firstword][nextword] = words[firstword].get(nextword, 0)+1 firstword = nextword for word in sorted(words.keys()): d = words[word] for word2 in sorted(d.keys()): print(word, ":", word2, d[word2])
fc410ab22efc69d748cdcc5b4404fcb6d04de345
shanghongsim/d2w
/mp_calc/app/serverlibrary.py
4,953
3.78125
4
def mergesort(array, byfunc=None): p=0 r=len(array)-1 mergesort_recursive(array, p, r, byfunc) return array def merge(array, p, q, r, byfunc): nleft=q-p+1 nright=r-q left_array=array[p:q+1] right_array=array[q+1:r+1] left=0 right=0 dest=p if byfunc!=None: while (left < nleft) and (right<nright): if byfunc(left_array[left])<=byfunc(right_array[right]): array[dest]=left_array[left] left+=1 else: array[dest]=right_array[right] right+=1 dest=dest+1 while left<nleft: array[dest]=left_array[left] left+=1 dest+=1 while right<nright: array[dest]=right_array[right] right+=1 dest+=1 return array else: while (left < nleft) and (right<nright): if left_array[left]<=right_array[right]: array[dest]=left_array[left] left+=1 else: array[dest]=right_array[right] right+=1 dest=dest+1 while left<nleft: array[dest]=left_array[left] left+=1 dest+=1 while right<nright: array[dest]=right_array[right] right+=1 dest+=1 return array def mergesort_recursive(array, p, r, byfunc): if r-p>=1: q=(p+r)//2 mergesort_recursive(array, p, q, byfunc) mergesort_recursive(array, q+1, r, byfunc) merge(array, p, q, r, byfunc) return array class Stack: def __init__(self): self.__items = [] def push(self, item): self.__items.append(item) def pop(self): if len(self.__items)>=1: return self.__items.pop() def peek(self): if len(self.__items)>=1: return self.__items[-1] @property def is_empty(self): return self.__items==[] @property def size(self): return len(self.__items) class EvaluateExpression: valid_char = '0123456789+-*/() ' operands = "0123456789" operators = "(+-*/" def __init__(self, string=""): self.expression=string self.stack = Stack() @property def expression(self): return self.expr @expression.setter def expression(self, new_expr): if isinstance(new_expr, str): for i in new_expr: if i not in self.valid_char: self.expr="" return self.expr self.expr=new_expr return self.expr self.expr="" return self.expr def insert_space(self): res="" for val in self.expression: if val in self.operands: res+=val else: res=res+" "+val+" " return res def process_operator(self, operand_stack, operator_stack): right=int(operand_stack.pop()) left=int(operand_stack.pop()) operator=str(operator_stack.pop()) if operator=="+": res=right+left elif operator=="-": res=left-right elif operator=="*": res=left*right else: res=left//right operand_stack.push(str(res)) def evaluate(self): operand_stack = Stack() operator_stack = Stack() expression = self.insert_space() tokens = expression.split() for val in self.expression: if val in self.operands: operand_stack.push(val) elif val=="+" or val=="-": while not operator_stack.is_empty and (operator_stack.peek()!="(" and operator_stack.peek()!=")"): self.process_operator(operand_stack, operator_stack) operator_stack.push(val) elif val=="*" or val=="/": while not operator_stack.is_empty and (operator_stack.peek()=="*" or operator_stack.peek()=="/"): self.process_operator(operand_stack, operator_stack) operator_stack.push(val) elif val=="(": operator_stack.push(val) elif val==")": while operator_stack.peek()!="(": self.process_operator(operand_stack, operator_stack) operator_stack.pop() # print(operand_stack.peek()) # print(operator_stack.peek()) # print("----") while not operator_stack.is_empty: self.process_operator(operand_stack, operator_stack) return int(operand_stack.peek()) def get_smallest_three(challenge): records = challenge.records times = [r for r in records] mergesort(times, lambda x: x.elapsed_time) return times[:3]
9a229513876ae37faa456d45d1676883a4e675b4
samhita101/Python-Practice
/2number_sum.py
333
3.953125
4
def sum(arg1, arg2 ): total = arg1 + arg2 print("Inside the function: ", total) return total print("Outside the function: ", total) print("Input the first number") input1 = int(input()) print("Input the second number") input2 = int(input()) my_total = sum(input1,input2) print(my_total, "is outside the function.")
b73aff94478e72888583ae92c0dfc15b4eb544a5
OrionSuperman/pylot-login
/app/controllers/Users.py
1,989
3.765625
4
""" Sample Controller File A Controller should be in charge of responding to a request. Load models to interact with the database and load views to render them to the client. Create a controller using this template """ from system.core.controller import * class Users(Controller): def __init__(self, action): super(Users, self).__init__(action) self.load_model('User') """ This is an example of loading a model. Every controller has access to the load_model method. self.load_model('WelcomeModel') """ """ This is an example of a controller method that will load a view for the client """ def index(self): """ A loaded model is accessible through the models attribute self.models['WelcomeModel'].get_all_users() """ return self.load_view('index.html') def create(self): format_user = { "first_name" : request.form['first_name'], "last_name" : request.form['last_name'], "email" : request.form['email'], "password" : request.form['password'], "pw_check" : request.form['pw_check'] } user_info = self.models['User'].create_user(format_user) if user_info['status'] == True: # self.models['User'].create_user(user_info) return redirect('/users/success') else: for message in user_info['errors']: flash(message, 'regis_errors') return redirect('/') def login(self): user_info = { 'email': request.form['email'], 'password' : request.form['password'] } user = self.models['User'].validate_user(user_info) if user['status'] == True: return redirect('/users/success') else: flash('Email or password incorrect.') return redirect('/') def success(self): return self.load_view('success.html')
20b76f6abbed97812cc7fa7082e31999ef075c3e
aelaguiz/icfp2012
/lib/map.py
12,252
3.703125
4
ROBOT = 'R' ROCK = '*' EMPTY = ' ' LAMBDA = '\\' OPEN_LIFT='O' CLOSED_LIFT='L' EARTH = '.' MOVE_LEFT='L' MOVE_RIGHT='R' MOVE_UP='U' MOVE_DOWN='D' MOVE_WAIT='W' MOVE_ABORT='A' class Map: def __init__(self): self.width = -1 self.height = 0 self.lams = 0 self.map = [] self.died = False self.done = False self.changed = False self.robot_pos = None def copy(self, old): self.width = old.width self.height = old.height self.lams = old.lams self.map = [] for old_row in old.map: new_row = list(old_row) self.map.append(new_row) self.done = old.done self.changed = old.changed self.robot_pos = old.robot_pos def addLine(self, line): # Assumes no trailing newline if self.width != -1 and len(line) < self.width: while(len(line)<self.width): line += EMPTY elif self.width != -1 and len(line) > self.width: self.width = len(line) for row in self.map: while(len(row)<self.width): row.append(EMPTY) else: self.width = len(line) row = list(line) self.map.insert(0, row) self.height += 1 def init(self): for (y,row) in enumerate(self.map): for (x,cell) in enumerate(row): if cell == ROBOT: self.robot_pos = (x,y) #print "Found robot at", self.robot_pos def __repr__(self): res = "" for y in reversed(range(0,self.height)): row = self.map[y] for (x,cell) in enumerate(row): if y == self.robot_pos[1] and x ==\ self.robot_pos[0]: res += 'H' #elif cell == 'R': ##print "Got robot at ",x,y,"coords are",self.robot_pos #res += str(cell) else: res += str(cell) res += "\n" return res def valid(self, x,y): if x>= 0 and x < self.width and\ y >= 0 and y < self.height: return True #print x,y,"not valid within",self.width,self.height return False def get(self, x,y): return self.map[y][x] def set(self,x,y, value): self.map[y][x] = value def empty(self,x,y): return self.valid(x,y) and self.get(x,y) == EMPTY def not_empty(self,x,y): return self.valid(x,y) and self.get(x,y) != EMPTY def rock(self,x,y): return self.valid(x,y) and self.get(x,y) == ROCK def lam(self,x,y): return self.valid(x,y) and self.get(x,y) == LAMBDA def robot(self,x,y): return self.valid(x,y) and self.get(x,y) == ROBOT def lam_count(self): cnt = 0 for row in self.map: for cell in row: if cell == LAMBDA: cnt += 1 return cnt def valid_move(self, move): if move == MOVE_WAIT: return True def valid(x,y): return self.valid(x,y) def empty(x,y): return self.empty(x,y) def rock(x,y): return self.rock(x,y) new_pos = self.robot_pos if(move == MOVE_LEFT): new_pos = (new_pos[0]-1, new_pos[1]) elif (move == MOVE_RIGHT): new_pos = (new_pos[0]+1, new_pos[1]) elif(move == MOVE_UP): new_pos = (new_pos[0], new_pos[1]+1) elif(move == MOVE_DOWN): new_pos = (new_pos[0], new_pos[1]-1) if not valid(new_pos[0], new_pos[1]): return False new_cell = self.get(new_pos[0], new_pos[1]) ##print "New cell is",new_cell, " at ", new_pos #(x', y' ) is Empty, Earth, Lambda or Open Lambda Lift. # - If it is a Lambda, that Lambda is collected. # - If it is an Open Lambda Lift, the mine is completed if new_cell == EMPTY or new_cell == EARTH: return True elif new_cell == LAMBDA: return True elif new_cell == OPEN_LIFT: return True # If x' = x + 1 and y' = y (i.e. the Robot moves right), (x' # ,y') is a Rock, and (x + 2; y) is Empty. elif new_cell == ROCK and move == MOVE_RIGHT and \ empty(self.robot_pos[0]+2,self.robot_pos[1]): return True # If x' = x - 1 and y' = y (i.e. the Robot moves left), (x' # y') is a Rock, and (x - 2; y) is Empty. elif new_cell == ROCK and move == MOVE_LEFT and\ empty(self.robot_pos[0]-2,self.robot_pos[1]): return True return False def move(self, move): # We reset the change flag each tick so it can be used to determine # if the player action caused the map to be change (rocks fall, etc) self.changed = False # A wait move just means tick the map and return if(move == MOVE_WAIT): #print "Waiting at", self.robot_pos self.update() return True def valid(x,y): return self.valid(x,y) def empty(x,y): return self.empty(x,y) def rock(x,y): return self.rock(x,y) new_pos = self.robot_pos #print "Attempting move",move,"from", new_pos #Move left, L, moving the Robot from (x; y) to (x 1; y). #Move right, R, moving the Robot from (x; y) to (x + 1; y). #Move up, U, moving the Robot from (x; y) to (x; y + 1). #Move down, D, moving the Robot from (x; y) to (x; y 1). if(move == MOVE_LEFT): new_pos = (new_pos[0]-1, new_pos[1]) elif (move == MOVE_RIGHT): new_pos = (new_pos[0]+1, new_pos[1]) elif(move == MOVE_UP): new_pos = (new_pos[0], new_pos[1]+1) elif(move == MOVE_DOWN): new_pos = (new_pos[0], new_pos[1]-1) # Invalid destination, just fail if not valid(new_pos[0], new_pos[1]): #print "New position not valid", new_pos return False new_cell = self.get(new_pos[0], new_pos[1]) ##print "New cell is",new_cell, " at ", new_pos #(x', y' ) is Empty, Earth, Lambda or Open Lambda Lift. # - If it is a Lambda, that Lambda is collected. # - If it is an Open Lambda Lift, the mine is completed if new_cell == EMPTY or new_cell == EARTH: #print "Movement",move,"valid into empty or earthen cell" # Allow default movement pass elif new_cell == LAMBDA: self.lams += 1 #print "Movement",move,"valid into lambda" #print "Collected lambda, now have", self.lams self.changed = True elif new_cell == OPEN_LIFT: #print "Mine complete!" self.done = True # If x' = x + 1 and y' = y (i.e. the Robot moves right), (x' # ,y') is a Rock, and (x + 2; y) is Empty. elif new_cell == ROCK and move == MOVE_RIGHT and \ empty(self.robot_pos[0]+2,self.robot_pos[1]): # Additionally, the Rock moves to (x + 2; y). self.set(self.robot_pos[0]+2, self.robot_pos[1], ROCK) #print "Movement",move,"valid valid pushing rock right" self.changed = True # If x' = x - 1 and y' = y (i.e. the Robot moves left), (x' # y') is a Rock, and (x - 2; y) is Empty. elif new_cell == ROCK and move == MOVE_LEFT and\ empty(self.robot_pos[0]-2,self.robot_pos[1]): # Additionally, the Rock moves to (x - 2; y). self.set(self.robot_pos[0]-2, self.robot_pos[1], ROCK) #print "Movement",move,"valid valid pushing rock left" self.changed = True else: # This is an invalid move, so we just return # which prevents the move from actually being taken # and instead the robot "waits" #print "Movement",move,"invalid - just waiting at",self.robot_pos self.update() #print "After update for wait",self.robot_pos return True self.set(self.robot_pos[0], self.robot_pos[1], EMPTY) self.set(new_pos[0], new_pos[1], ROBOT) oldpos = self.robot_pos self.robot_pos = new_pos self.update() #print "Took move",move,"from",oldpos,"to",new_pos return True def update(self): newMap = [list(r) for r in self.map] def valid(x,y): return self.valid_coord(x,y) def get(x,y): return self.get(x,y) def set(x,y, value): self.changed = True newMap[y][x] = value # Not safe to simply say "not empty" because that may indicate it is an # invalid cell, not that it is actually unoccupied, must use not_empty def empty(x,y): return self.empty(x,y) def not_empty(x,y): return self.not_empty(x,y) def rock(x,y): return self.rock(x,y) def lam(x,y): return self.lam(x,y) def robot(x,y): return self.robot(x,y) def lam_count(): return self.lam_count() lams = lam_count() for (y,row) in enumerate(self.map): for (x,cell) in enumerate(row): # If (x; y) contains a Rock, and (x; y - 1) is Empty: if cell == ROCK and empty(x,y-1): # (x; y) is updated to Empty, (x; y - 1) is updated to Rock #print "Rock at",x,y,"fell" set(x,y, EMPTY) set(x,y-1, ROCK) if robot(x,y-2): #print "Killed the robot!" self.died = True #If (x; y) contains a Rock, (x; y - 1) contains a Rock, (x + # 1; y) is Empty and (x + 1; y - 1) is Empty: if cell == ROCK and rock(x,y-1) and empty(x+1,y) and\ empty(x+1,y-1): #(x; y) is updated to Empty, (x + 1; y - 1) is updated to #Rock #print "Rock at",x,y,"slid to the right and down" set(x,y, EMPTY) set(x+1,y-1, ROCK) if robot(x+1,y-2): #print "Killed the robot!" self.died = True #If (x; y) contains a Rock, (x; y - 1) contains a Rock, either (x # + 1; y) is not Empty or (x + 1; y - 1) is not Empty, # (x - 1; y) is Empty and (x - 1; y - 1) is Empty if cell == ROCK and rock(x,y-1) and (not_empty(x+1,y) or\ not_empty(x+1,y-1)) and empty(x-1,y) and empty(x-1,y-1): # (x; y) is updated to Empty, (x - 1; y - 1) is updated to # Rock.) #print "Rock at",x,y,"slid to the left and down" set(x,y, EMPTY) set(x-1,y-1,ROCK) if robot(x-1,y-2): #print "Killed the robot!" self.died = True #If (x; y) contains a Rock, (x; y - 1) contains a Lambda, (x + 1; y) # is Empty and (x + 1; y - 1) is Empty: if cell == ROCK and lam(x,y-1) and empty(x+1,y) and\ empty(x+1,y-1): #(x; y) is updated to Empty, (x + 1; y - 1) is updated to Rock. #print "Rock at ",x,y,"fell down the right side of lambda" set(x,y,EMPTY) set(x+1,y-1,ROCK) if robot(x+1,y-2): #print "Killed the robot!" self.died = True # If (x; y) contains a Closed Lambda Lift, and there are no # Lambdas remaining: if cell == CLOSED_LIFT and lams == 0: # (x; y) is updated to Open Lambda Lift. set(x,y,OPEN_LIFT) self.map = newMap
f6943e6437b955551d37de2f8874d09225c3c23c
athulpa/ANN
/ANN.py
3,251
3.703125
4
import numpy as np # When giving theta inputs to neural network, always make sure that every theta is 2-dim, # even if its output is only 1 number. For example, [[1, 2, 3]] is correct, [1, 2, 3] is wrong. class ANN: def __init__(self, sl): self.num_layers = len(sl) self.num_inputs = sl[1] self.num_outputs = sl[-1] self.theta = [ ] self.activation = ANN.sigmoid for i in range(self.num_layers-1): self.theta.append(np.random.random((sl[i+1], sl[i]+1))-0.5) return def sigmoid(arr): return 1/(1+np.exp(-arr)) def relu(arr): return np.where(arr<0, np.zeros(arr.shape), arr) def fpgt(self, arr): # print('inside') for th in self.theta: arr = np.insert(arr, 0, 1) # print(th, arr) arr = np.matmul(th, arr) # print(arr) arr = self.activation(arr) # print(arr.shape, '\n') # print('leaving..') return arr # Returns the D values computed on self.theta with the given single exmaple of ins and outs. def bpgt(self, ins, outs): a = [ ins ] for th in self.theta: a[-1] = np.insert(a[-1], 0, 1) dotted = np.matmul(th, a[-1]) a.append(self.activation(dotted)) d = [ a[-1]-outs ] for i in np.flip(np.arange(1, self.num_layers-1), axis=0): d.insert(0, (np.matmul(self.theta[i].T, d[0])*a[i]*(1-a[i]))[1:]) D = [ ] for i in range(self.num_layers-1): D.append(d[i].reshape(-1, 1)*a[i]) return D # arrs is expected to be 2D only, with elements arranged along axis-0. def fpbatch(self, arrs): for th in self.theta: arrs = np.insert(arrs, 0, 1, 1) arrs = np.matmul(arrs, th.T) arrs = self.activation(arrs) return arrs # Performs one step of the backprop update (i.e. 1 step of GD), given m examples of i/o values. # Examples must be placed down the column, ie along axis 0. def bpbatch(self, ins, outs, alpha=0.05, lmd=0.1): a = [ins] for th in self.theta: # print(a[-1].shape) a[-1] = np.insert(a[-1], 0, 1, 1) # print(a[-1].shape) # print(th.T.shape) dotted = np.matmul(a[-1], th.T) # print(dotted.shape) a.append(self.activation(dotted)) # print(a[-1].shape, '\n') # input() d = [ a[-1]-outs ] for i in np.flip(np.arange(1, self.num_layers-1), axis=0): d.insert(0, (np.matmul(d[0], self.theta[i])*a[i]*(1-a[i]))[:, 1:]) # for dee in d: # print(dee.shape) # print('\n') # for ayy in a: # print(ayy.shape) # print('\n') for i in range(self.num_layers-1): # print(i) Dtmp = np.expand_dims(d[i], 2)*np.expand_dims(a[i], 1) Dtmp = np.sum(Dtmp, axis=0) # print(Dtmp.shape, self.theta[i].shape, '\n') Dtmp += lmd*self.theta[i] self.theta[i] -= alpha*Dtmp return
42937a3510f632558d17a888636849b19bc8eef1
lvguichen1/algorithm004-02
/Week 03/id_472/深度优先搜索和广度优先搜索/LeetCode_102_472.py
1,823
3.859375
4
#!/usr/bin/python # -*- coding: utf-8 -*- # @Time : 2020/3/18 # @Author : xujun """ 二叉树的层次遍历 给定一个二叉树,返回其按层次遍历的节点值。 (即逐层地,从左到右访问所有节点)。 例如: 给定二叉树: [3,9,20,null,null,15,7], 3 / \ 9 20 / \ 15 7 返回其层次遍历结果: [ [3], [9,20], [15,7] ] """ # 递归 class Solution: def levelOrder(self, root): def helper(root, level): if not root: return if len(res) == level: res.append([]) res[level].append(root.val) if root.left: helper(root.left, level + 1) if root.right: helper(root.right, level + 1) res = [] helper(root, 0) return res # 迭代 from collections import deque class Solution: def levelOrder(self, root): """ :type root: TreeNode :rtype: List[List[int]] """ levels = [] if not root: return levels level = 0 queue = deque([root, ]) while queue: # start the current level levels.append([]) # number of elements in the current level level_length = len(queue) for i in range(level_length): node = queue.popleft() # fulfill the current level levels[level].append(node.val) # add child nodes of the current level # in the queue for the next level if node.left: queue.append(node.left) if node.right: queue.append(node.right) # go to next level level += 1 return levels
53d3ac13471aeba08f87db7d10d28f067b4a6ff6
minlu1021/graph-theory-course
/PS1/bipartite.py
3,412
3.765625
4
# -*- coding: utf-8 -*- """ Created on Wed May 31 12:44:56 2017 @author: lu """ from collections import deque import networkx import sys class bipartite(object): def uncolored(self, node): """ Determine if this node is colored uncolored--return True colored----return False """ if node not in self.colorings['black'] and node not in self.colorings['white']: return True else: return False def changeColor(self, node): """ Change the color of node if it is black, change to white if it is white, change to black """ if node in self.colorings['black']: return 'white' elif node in self.colorings['white']: return 'black' def canColor(self, node, color): """ Determine if this node can be colored with given color can be colored with color--True else-----------------------False """ neighbors = self.G[node].keys() # get all neighbors of the node return all([neighbor not in self.colorings[color] for neighbor in neighbors]) def isBipartite(self, G): """ If graph G is partite--True If G is not partite----False """ self.G = G self.colorings = {'black': set(), 'white': set()} start = G.nodes()[0] # the first node as initial node to start self.colorings['black'].add(start) # Once got the node, color black q = deque([start]) while q: n = q.pop() next_color = self.changeColor(n) # get the neighbors who are not colored uncolored_neighbors = [] for neighbor in G[n].keys(): if self.uncolored(neighbor): uncolored_neighbors.append(neighbor) for neighbor in uncolored_neighbors: # if this neighbor can be colored with given node, # just color it and add this neighbor to q if self.canColor(neighbor, next_color): self.colorings[next_color].add(neighbor) q.append(neighbor) # if can not be colored, then this graph is non-bipartite else: return False # if not false, then G is partite return True if __name__ == '__main__': """Main Part""" # get the nodes and edges from txt file file = open(sys.argv[-1],"r") lineList = file.readlines() file.close() s = "" for x in lineList[-1]: if x==",": break s += str(x) n = int(s) +1 # number of nodes in G G = networkx.Graph() ## add nodes to the graph G G.add_nodes_from([node for node in range(1, n+1)]) ## get the edges between nodes edges = [] for line in lineList: s = line.split(",") relation = [int(x) for x in s] # when they have edges, i append the connected to node to edges list. if relation[-1]==1: edges.append((relation[0],relation[1])) ## add edges to the graph G G.add_edges_from(edges) ## get the result print('Whether graph G is bipartite:', bipartite().isBipartite(G))
fd1d55aab67bcd8ea61946e4e248a80a4bb31d7d
Ranjit007ai/InterviewBit-LinkedList
/linkedlist/remove_nth_node_from_end/solution.py
1,059
3.765625
4
# Given a linked list ,remove the nth node from the end of the list ,return its head. # If the 'n' is greater then length of the list ,delete first node of list. class Node: def __init__(self,data): self.data = data self.next = None node1 = Node(1) node2 = Node(3) node3 = Node(4) node4 = Node(5) node5 = Node(11) node1.next = node2 node2.next = node3 node3.next = node4 node4.next = node5 def length(head): cur = head count = 1 while cur != None : cur = cur.next count += 1 return count def remove_nth_node_from_end(head,n): l = length(head) if l <= n : head = head.next else: i = head j = head for k in range(0,n-1): j = j.next while j.next.next != None: i = i.next j = j.next i.next = i.next.next return head # test case new_head = remove_nth_node_from_end(node1,2) while new_head != None : print(new_head.data,end=' ') new_head = new_head.next
4ec5336c38dd27bbc4b81175da93efa537c3c2ff
Aasthaengg/IBMdataset
/Python_codes/p02713/s228418271.py
178
3.609375
4
import math K = int(input()) Sum = 0 for A in range(1,K+1): for B in range(1,K+1): for C in range(1,K+1): Sum = Sum+math.gcd(math.gcd(A,B),C) print(Sum)
978c3fd6da8c8f0016a78e5956e428d200fd7ee3
sam449/programmereninpython1
/.py/ifstatement.py
134
3.609375
4
varA - 5 if (varA == 5): print("varA stast gelijk aan 5") else : print("varA staat niet gelijk aan 5") print("Einde programma")
6ba9572f0ebe5cede7b2b10b4807779c051a194c
jpaguirre15/pythons
/Experiment Answers, Formats, Output Samples/Answers/Python 3 Answers/practiceRound.py
423
4.125
4
# Hint: # Use "print(type(<variable>))" to figure out data type for a variable, # like shown below str1 = 'Execute Order ' int1 = 66 print("str1 data type: ", type(str1)) print("int1 data type: ", type(int1)) # CODE HERE print("str1 data type (after conversion): ", type(str1)) print("int1 data type (after conversion): ", type(str(int1))) print(str1 + str(int1)) print("Combined data type: ", type(str1 + str(int1)))
04f89a911ca639195e7657cddfe878f9df97692b
Yoni-Mantzur/University-Projects
/Image Processing/sol2/sol2.py
6,794
3.5
4
import numpy as np from scipy import signal from scipy.misc import imread as imread from skimage.color import rgb2gray import matplotlib.pyplot as plt GRAY_REP = 1 L_INTESITY = np.float32(255) D_X_CONV = np.array([1, 0, -1]).reshape(1,3).astype(np.float32) D_Y_CONV = D_X_CONV.T I, PI = np.complex128(0+1j), np.pi BASICE_GAUSSIAN = np.array([1,1,1,1]).reshape(2,2) def im_to_float(image): """ Convert image to float32 values between [0,1] """ return image.astype(np.float32) / L_INTESITY def read_image(filename, representation): """ The function that reads a given image file and converts it into a given representation. :param - filename - string containing the image filename to read. :param - representation - representation code, either 1 or 2 defining if the output should be either a grayscale OR RGB image respectively :return - The new image. """ try: im = imread(filename) if representation == GRAY_REP: return rgb2gray(im).astype(np.float32) return im_to_float(im) except: print("Cant read the image") exit(-1) def dft_mat(N): """ :param N: Dimension of dft :return: the dft matrix """ range = np.arange(N).astype(np.complex128) exp = np.exp((-2*PI*I*range)/N).astype(np.complex128) return np.vander(exp, increasing=True).astype(np.complex128) def DFT(signal): """ Function that transform a 1D discrete signal to its Fourier representation :param signal - an array of dtype float32 with shape (N,1) :return fourier_signal - an array of dtype complex128 with the same shape """ N = signal.shape[0] fourier_signal = np.dot(dft_mat(N), signal) return fourier_signal.astype(np.complex128) def IDFT(fourier_signal): """ Function that transform a 1D discrete Fourier to its signal representation :param signal - an array of dtype complex128 with shape (N,1) :return fourier_signal - an array of dtype complex128 with the same shape """ N = fourier_signal.shape[0] # Notice that inverse furier is the conj of the furier signal = np.dot(np.conj(dft_mat(N)), fourier_signal) / N return signal.astype(np.complex128) def func2D(narray, func): """ Operates func on rows and then on columns :param narray: 2D array N * M :param func: Unary function to operate on 1D arr :return: 2D array after operates func """ N, M = narray.shape newArray = narray.copy().astype(np.complex128) # transform of rows j=0 for row in narray: newArray[j,:] = func(row.reshape(M,1)).reshape(M) j+=1 k = 0 for column in newArray.T: newArray[:,k] = func(column.reshape(N,1)).reshape(N) k+=1 return newArray def DFT2(image): """ Function that convert a 2D discrete signal to its Fourier representation :param image: 2D signal :return fourier_signal - an array of dtype complex128 with the same shape """ return func2D(image, DFT) def IDFT2(image): """ Function that convert a 2D discrete signal to its inverse Fourier representation :param image: 2D signal :return fourier_signal - an array of dtype complex128 with the same shape """ return func2D(image, IDFT) def conv_im(im, conv_vector): """ Convolution with image. :param im: some image :param conv_vector: conv vector :return: the convolution """ return signal.convolve2d(im, conv_vector, mode='same') def conv_der(im): """ A function that computes the magnitude of image derivatives :param im: a grayscale images of type float32. :return: a grayscale images of type float32. """ dx = conv_im(im, D_X_CONV) dy = conv_im(im, D_Y_CONV) mag = np.sqrt(np.abs(dx)**2 + np.abs(dy)**2) return mag def fourier_der(im): """ A function that computes the magnitude of image derivatives using Fourier transform. :param im: are float32 grayscale images :return: are float32 grayscale images """ furier_im = DFT2(im) furier_im_shift = np.fft.fftshift(furier_im) N, M = im.shape range_y = np.arange(-N/2,N/2) range_x = np.arange(-M/2,M/2) dx = (2*I*PI/N)*(IDFT2(np.multiply(furier_im_shift,range_x))) dy = (2*I*PI/N)*(IDFT2(np.multiply(furier_im_shift.T,range_y).T)) mag = np.sqrt(np.abs(dx)**2 + np.abs(dy)**2) return mag.astype(np.float32) def creat_kernel(kernel_size): """ Generates Gaussian kernel. :param kernel_size: the size of the gaussian kernel in each dimension (an odd integer). :return: 2D kernel (as float32 type) """ if kernel_size <= 1: return np.array([1]) kernel = BASICE_GAUSSIAN.astype(np.float32) for i in range(kernel_size-2): kernel = signal.convolve2d(kernel, BASICE_GAUSSIAN) norm_kernel = kernel / np.sum(kernel) return norm_kernel.astype(np.float32) def blur_spatial (im, kernel_size): """ Function that performs image blurring using 2D convolution between the image f and a gaussian kernel g. :param im: image to be blurred (grayscale float32 image). :param kernel_size: the size of the gaussian kernel in each dimension (an odd integer). :return: blurry image (grayscale float32 image). """ return signal.convolve2d(im, creat_kernel(kernel_size), mode='same', boundary='wrap') def pad_kernel(kernel, kernel_size, im_shape): """ Padding the kernel to image size with zeroes :param kernel: the kenel to pad :param kernel_size: the size of the kernel before padding :param im_shape: the shape of the image :return: the padding kernel """ size_x_im, size_y_im = im_shape padding = ((0, np.abs(size_x_im-kernel_size)), (0, np.abs(size_y_im-kernel_size))) KERNEL_pading = np.lib.pad(kernel, padding, 'constant', constant_values=np.complex128(0)) # Move the kernel to center KERNEL_pading = np.roll(KERNEL_pading, int((size_x_im-kernel_size)/2 + 1), axis=0) KERNEL_pading = np.roll(KERNEL_pading, int((size_y_im-kernel_size)/2 + 1), axis=1) return KERNEL_pading def blur_fourier(im, kernel_size): """ Function that performs image blurring with gaussian kernel in Fourier space. :param im: image to be blurred (grayscale float32 image). :param kernel_size: is the size of the gaussian in each dimension (an odd integer). :return: is the output blurry image (grayscale float32 image). """ kernel = creat_kernel(kernel_size).astype(np.complex128) KERNEL_pading = pad_kernel(kernel, kernel_size, im.shape) KERNEL_ishifted = np.fft.ifftshift(KERNEL_pading) # Use the convolution theorem KERNEL, IM = DFT2(KERNEL_ishifted), DFT2(im) mult_ker_im = np.multiply(IM, KERNEL) return np.real(IDFT2(mult_ker_im)).astype(np.float32)
3bff36a0910afbf4262b89084dcd8cc93075aac7
jcravener/PythonWorkroom
/DuplicateZeros.py
502
3.59375
4
# LeetCode 1089. Duplicate Zeros class Solution: def duplicateZeros(self, arr: [int]) -> None: """ Do not return anything, modify arr in-place instead. """ alen = len(arr) tmp =[0] i = 0 while i < alen: if arr[i] == 0: arr.insert(i+1, 0) arr.pop() i += 1 i += 1 print(arr) s = Solution() a = [1,0,2,3,0,4,5,0] s.duplicateZeros(a) print(a)
943d1586bad96fa419eadb5d6b1d1570dd5b818f
alonzo0812/random-games-shs
/Hangman.py
1,362
3.953125
4
import time import random name = input("WHATS YO NAME? ") print ("HELLO, " + name, "TIME TO PLAY HANGMAN BY LEOO!") print ("") time.sleep(1) print ("LETS GOOO") time.sleep(1) word = random.randint(1,12) if word == 1: word = "LEOMARC" elif word == 2: word = "GIBSON" elif word == 3: word = "GAB" elif word == 4: word = "TERENCE" elif word == 5: word = "TRISHA" elif word == 6: word = "PAT" elif word == 7: word = "CHAPONK" elif word == 8: word = "JEAN" elif word == 9: word = "CLOTHES" elif word == 10: word = "DOMINATION" elif word == 11: word = "ALISSHA" elif word == 12: word = "KHRYSTAL" guesses = "" turns = 14 while turns > 0: failed = 0 for char in word: if char in guesses: print (char,end=""), else: print ("-",end=""), failed += 1 if failed == 0: print("") print ("You won") break print("") guess = input("guess a character:").upper() guesses += guess if guess not in word: turns -= 1 print ("Wrong") print ("You have", + turns, "more guesses") if turns == 0: print ("You Loose")
64a84e7cd1e8654d500b7d987e1d44e10199381e
Vasudevatirupathinaidu/Python-Crash-Course-2nd-Edition-by-Eric-Matthes
/Chapter_06 Dictionaries/exercise.py
6,269
4.1875
4
# Person person = { 'first_name' : 'Vasudeva', 'last_name' : 'Bonu', 'age' : 27, 'city' : 'Bangalore', } print(f"Hola! My name is {person['last_name']} {person['first_name']}. I am {person['age']} years old guy lives in {person['city']}.") print("\n") # Favorite numbers persons = { 'ching' : 5, 'chang' : 6, 'chung' : 1, 'ding' : 9, 'ping' : 1, 'dang' : 4, } # Method 1 print(f"Hi! My name is ching. My favorite number is {persons['ching']}.") print(f"Hi! My name is chang. My favorite number is {persons['chang']}.") print(f"Hi! My name is chung. My favorite number is {persons['chung']}.") print(f"Hi! My name is ding. My favorite number is {persons['ding']}.") print(f"Hi! My name is ping. My favorite number is {persons['ping']}.") print(f"Hi! My name is dang. My favorite number is {persons['dang']}.") print("\n") # Method 2 - for loop for key, value in persons.items(): print(f"Hi! My name is {key.title()}. My favorite number is {value}.") print("\n") # Method 3 - list comprehension [print(f"Hi! My name is {key.title()}. My favorite number is {value}.") for key, value in persons.items()] print('\n') print('\n'.join([(f"Hi! My name is {key.title()}. My favorite number is {value}.") for key, value in persons.items()])) print("\n") # Glossary glossary = { 'string' : 'A series of characters.', 'list' : 'A collection of items.', 'method' : 'A method is an action that python can perform on a piece of data.', 'if-elif-else' : 'if-elif-else statement chains are used for decision making.', 'for_loop' : 'For loops are used for sequential traversal.', 'dictionary' : 'A collection of key-value pairs.', 'get method' : 'It can add a default value to key.', 'set' : 'It can remove duplicate values.', 'in and not' : 'in and not are special keywords, mainly used for decision making.', } # Method 1 print(f"String: {glossary['string']}") print(f"List: {glossary['list']}") print(f"Method: {glossary['method']}") print(f"if-elif-else: {glossary['if-elif-else']}") print(f"for_loop: {glossary['for_loop']}") print(f"dictionary: {glossary['dictionary']}") print(f"get method: {glossary['get method']}") print(f"set: {glossary['set']}") print(f"in and not: {glossary['in and not']}") # Method 2 - for loop for key, value in glossary.items(): print(f"{key.title()}: {value}") print("\n") # Method 3 - list comprehension [print(f"{key.title()}: {value}") for key, value in glossary.items()] print("\n") print('\n'.join([(f"{key.title()}: {value}") for key, value in glossary.items()])) print("\n") # Rivers rivers = { 'krishna' : 'vijayawada', 'yamuna' : 'agra', 'kaveri' : 'tiruchirapalli', } for river, city in rivers.items(): print(f"The {river} river runs through {city}.") print("\n") for river in rivers.keys(): print(river) print("\n") for city in rivers.values(): print(city) print("\n") # Polling favorite_languages = { 'jen' : 'python', 'sarah' : 'c', 'edward' : 'ruby', 'phil' : 'python', } members = ['phil', 'daniel', 'edward', 'erin', 'sarah'] for member in members: if member in favorite_languages.keys(): print(f"{member.title()}, thank you for taking the poll.") else: print(f"{member.title()}, please take our poll.") print("\n") # People person_1 = { 'first_name' : 'vasu', 'last_name' : 'bonu', 'age' : 27, 'city' : 'bangalore', } person_2 = { 'first_name' : 'deva', 'last_name' : 'bonu', 'age' : 26, 'city' : 'gurgaon', } person_3 = { 'first_name' : 'tiru', 'last_name' : 'bonu', 'age' : 25, 'city' : 'bangalore', } people = [person_1, person_2, person_3] for person in people: print(person) print("\n") # Pets pet_1 = { 'owner_s name': 'vasu', 'pet_s name': 'DogA', } pet_2 = { 'owner_s name': 'deva', 'pet_s name': 'DogB', } pet_3 = { 'owner_s name': 'tiru', 'pet_s name': 'DogC', } pet_4 = { 'owner_s name': 'naidu', 'pet_s name': 'DogD', } pets = [pet_1, pet_2, pet_3, pet_4] for pet in pets: print(f"Pet Owner's name: {pet['owner_s name']}") print(f"Pet's name: {pet['pet_s name']}\n") # Favorite places favorite_places = { 'deva':['goa', 'kochi', 'udupi'], 'vasu':['kochi', 'araku', 'shillong'], 'tiru':['udupi', 'ladakh', 'west godavari'], } for names, places in favorite_places.items(): for place in places: print(f"{(names.title())}'s favorite place is {place.title()}.") print("\n") # Favorite numbers persons = { 'ching' : [5, 2, 9], 'chang' : [6, 1], 'chung' : [1, 8, 7], 'ding' : [9, 3, 6], 'ping' : [1, 2], 'dang' : [4, 0], } for names, numbers in persons.items(): for number in numbers: print(f"{names.title()}'s favorite number is {number}.") print("\n") # Cities cities = { 'vizag': { 'country': 'india', 'population': '21 lakhs', 'favoriteSpot': 'beach', }, 'bangalore': { 'country': 'india', 'population': '84 lakhs', 'favoriteSpot': 'bangalore palace', }, 'rajahmundry': { 'country': 'india', 'population': '4 lakhs', 'favoriteSpot': 'godavari arch bridge', }, } for name, data in cities.items(): print(f"City name {name.title()}: ") for info, data_2 in data.items(): print(f"{info.title()}: {data_2.title()}") print("\n") # Extensions favorite_languages = { 'jen' : 'c++', 'sarah' : 'c', 'edward' : 'ruby', 'phil' : 'javascript', } new_members = ['david', 'lucy', 'john'] for member in new_members: if member == 'lucy': favorite_languages[member] = 'go' elif member == 'john': favorite_languages[member] = 'java' elif member == 'david': favorite_languages[member] = 'python' print(f"\nList of names: ") for name in favorite_languages.keys(): print(f"{name.title()}") print(f"\nList of languages: ") for language in favorite_languages.values(): print(f"{language.title()}") print("\n") for name, language in favorite_languages.items(): print(f"{name.title()}'s favorite language is {language.title()}") print("\n")
e8e89987cdcef0b4fb87f074246d3f37bd66402d
allenxun/study
/python/leetcode/easy/053Pascal'sTriangleII.py
757
3.59375
4
class Solution(object): def getRow(self, rowIndex): """ :type rowIndex: int :rtype: List[int] """ def get(t): result = [1] left = 1 for i in range(1,len(t)): result.append(left+t[i]) left = t[i] result.append(1) return result result = [] if rowIndex == 0: result = [1] elif rowIndex == 1: result = [1,1] else: result.append([1,1]) for i in range(rowIndex): result = (get(result)) return result if __name__ =="__main__": a = Solution() test = [1,2,3,5,0] for i in test: print a.getRow(i)
712e275a5a0cb8a4ff8bb704a1a209ea90a17612
laravignotto/books_exercises
/Bioinformatics_Algorithms_An_Active_Learning_Approach/chapter-1/problem_1B.py
3,500
4.125
4
''' Frequent Words Problem: Find the most frequent k-mers in a string. Input: A string Text and an integer k. Output: All most frequent k-mers in Text. ''' from tqdm import tqdm from utils import * from problem_1A import * # pattern_count from problem_1L import * # pattern_to_number from problem_1M import * # number_to_pattern def frequent_words(text, k): '''(Slowly) finds the most frequent k-mer in `text` Parameters ---------- text : str Input text k : int Length of the k-mer Returns ------- frequent_patterns : set The most frequent string(s) of length k that appear in `text` ''' frequent_patterns = [] count = [0] * (len(text)-k+1) for i in tqdm(range(len(text)-k+1)): pattern = text[i:k+i] count[i] += pattern_count(text, pattern) max_count = max(count) for i in range(len(text)-k+1): if count[i] == max_count: frequent_patterns.append(text[i:k+i]) return set(frequent_patterns) def computing_frequencies(text, k): '''Generates a frequency array Parameters ---------- text : str Input text k : int Length of the k-mer (pattern) Returns ------- frequentcy_array : list Array in which every element is an integer denoting how many times each pattern of length `k` (specified by the index of the array) appears in `text` ''' frequency_array = [0] * 4**k for i in tqdm(range(len(text)-k+1)): pattern = text[i:k+i] j = pattern_to_number(pattern) frequency_array[j] += 1 return frequency_array def faster_frequent_words(text, k): '''Finds the most frequent k-mer in `text` Parameters ---------- text : str Input text k : int Length of the k-mer Returns ------- frequent_patterns : set The most frequent string(s) of length k that appear in `text` ''' frequent_patterns = [] frequency_array = computing_frequencies(text, k) max_count = max(frequency_array) for i in range(len(frequency_array)): if frequency_array[i] == max_count: pattern = number_to_pattern(i,k) frequent_patterns.append(pattern) return set(frequent_patterns) def main(): # txt = import_txt("Vibrio_cholerae")[0] # txt = "ACTGACTCCCACCCC" # k = 3 -> 'CCC' # txt = "ACAACTATGCATACTATCGGGAACTATCCT" # k = 5 -> 'ACTAT' # txt = "CGATATATCCATAG" # k = 3 -> 'ATA' txt = "ATCAATGATCAACGTAAGCTTCTAAGCATGATCAAGGTGCTCACACAGTTTATCCACAACCTGAGTGGATGACATCAAGATAGGTCGTTGTATCTCCTTCCTCTCGTACTCTCATGACCACGGAAAGATGATCAAGAGAGGATGATTTCTTGGCCATATCGCAATGAATACTTGTGACTTGTGCTTCCAATTGACATCTTCAGCGCCATATTGCGCTGGCCAAGGTGACGGAGCGGGATTACGAAAGCATGATCATGGCTGTTGTTCTGTTTATCTTGTTTTGACTGAGACTTGTTAGGATAGACGGTTTTTCATCACTGACTAGCCAAAGCCTTACTCTGCCTGACATCGACCGTAAATTGATAATGAATTTACATGCTTCCGCGACGATTTACCTCTTGATCATCGATCCGATTGAAGATCTTCAATTGTTAATTCTCTTGCCTCGACTCATAGCCATGATGAGCTCTTGATCATGTTTCCTTAACCCTCTATTTTTTACGGAAGAATGATCAAGCTGCTGCTCTTGATCATCGTTTC" # oriC of Vibrio Cholerae k = int(input("Insert a number `k`: ")) print("Searching...") # Uncomment just one of the lines below # fp = frequent_words(txt, k) # WARNING: inefficient fp = faster_frequent_words(txt, k) print( f"The most frequent pattern(s) of length {k} that appear(s) in the text is/are:") for i in fp: print(i) if __name__ == "__main__": main()
5a05bda6a948d93ca53efd3ce10379d351622236
zeelp741/Data-Strucutures
/Stack_array.py
6,844
4
4
from copy import deepcopy class Stack: """ ------------------------------------------------------- Constants ------------------------------------------------------- """ # a default maximum size when one is not provided DEFAULT_SIZE = 10 def __init__(self, max_size = DEFAULT_SIZE): """ ------------------------------------------------------- Initializes an empty stack. Data is stored in a fixed-size Python list. Use: stack = Stack(max_size) Use: stack = Stack() # uses default max size ------------------------------------------------------- Parameters: max_size - maximum size of the Stack (int > 0) Returns: a new Stack object (Stack) ------------------------------------------------------- """ assert max_size > 0, "Queue size must be > 0" self._capacity = max_size self._values = [None] * self._capacity self._top = -1 def isEmpty(self): """ ------------------------------------------------------- Determines if the stack is empty. Use: b = stack.is_empty() ------------------------------------------------------- Returns: True if stack is empty, False otherwise ------------------------------------------------------- """ return self._top == -1 def isFull(self): """ ------------------------------------------------------- Determines if the stack is full. Use: b = stack.isFull() ------------------------------------------------------- Returns: True if stack is full, False otherwise ------------------------------------------------------- """ status = False if self._top == self._capacity: status = True return status def push(self, element): """ ------------------------------------------------------- Pushes a copy of the given element onto the top of the stack. Use: stack.push(element) ------------------------------------------------------- Parameters: element - the data element to be added to stack (?) Returns: None ------------------------------------------------------- """ assert not self.isFull(), "Stack is full" self._top += 1 self._values[ self._top ] = deepcopy( element ) return def pop(self): """ ------------------------------------------------------- Pops and returns the top of stack. The data element is removed from the stack. Attempting to pop from an empty stack throws an exception. Use: value = stack.pop() ------------------------------------------------------- Returns: value - the value at the top of stack (?) ------------------------------------------------------- """ value = deepcopy(self._values[ self._top ]) self._top -=1 return value def peek(self): """ ------------------------------------------------------- Returns a copy of the value at the top of the stack without removing it. Attempting to peek at an empty stack throws an exception. Use: value = stack.peek() ------------------------------------------------------- Returns: value - a copy of the value at the top of stack (?) ------------------------------------------------------- """ element = deepcopy(self._values[self._top]) return element def reverse(self): """ ------------------------------------------------------- Reverses the contents of the source stack. Use: source.reverse() ------------------------------------------------------- Returns: None ------------------------------------------------------- """ #your code goes here def combine(self, source1, source2): """ ------------------------------------------------------- Combines two source stacks into the current target stack. When finished, the contents of source1 and source2 are interlaced into target and source1 and source2 are empty. (iterative algorithm) Use: target.combine(source1, source2) ------------------------------------------------------- Parameters: source1 - an array-based stack (Stack) source2 - an array-based stack (Stack) Returns: None ------------------------------------------------------- """ while source1._top >= 0 and source2._top >= 0: self.push(source1.pop()) self.push(source2.pop()) while source1._top >= 0: self.push(source1.pop()) while source2._top >= 0: self.push(source2.pop()) return def split_alt(self): """ ------------------------------------------------------- Splits the source stack into two separate target stacks with values alternating into the targets. At finish source stack is empty. Use: target1, target2 = source.split_alt() ------------------------------------------------------- Returns: target1 - contains alternating values from source (Stack) target2 - contains other alternating values from source (Stack) ------------------------------------------------------- """ target1 = Stack() target2 = Stack() alternating = 0 while(self._top != -1): alternating += 1 if alternating % 2 == 0: target2.push(self._values[self._top]) elif (alternating % 2 == 1): target1.push(self._values[self._top]) self._top -= 1 return target1, target2 def __iter__(self): """ FOR TESTING ONLY ------------------------------------------------------- Generates a Python iterator. Iterates through the stack from top to bottom. Use: for value in stack: ------------------------------------------------------- Returns: value - the next value in the stack (?) ------------------------------------------------------- """ for value in self._values[::-1]: yield value
d8a97e61e5a04c88a18196522eee60e905bd3593
eduardomep/SpartanStore-Server
/User.py
637
3.546875
4
class User: def __init__(self,id,name,last_name,user_name,password,user_type): self.id = id self.name = name self.last_name = last_name self.user_name = user_name self.password = password self.user_type = user_type # def auth (self,user_name,password): # if self.user_name == user_name and self.password == password: # print("Bienvenido") # return True # print("Datos erroneos") # return False # def get_password (self,user_name): # if self.user_name == user_name: # return True # return False
91c29e1854db627b0ce8e1ac149a9cf7713b624d
jatingandhi32/Python-1BM17CS032
/Lab3/string.py
142
3.71875
4
sentence = input("Enter the sentence") lis =[] for ch in sentence: lis.append(ch) for i in range(len(lis)-1,0,-1): print(lis[i],end="")
d3005b9756de727e5272e1f593bf0128e41a00da
thitemalhar/python_exercise-
/findevennumbers.py
177
3.703125
4
a = [int(x) for x in input().split()] print (a) b = [] def even_numbers(a): for i in a: if i % 2 == 0: b.append(i) return (b) print (even_numbers(a))
c2a7bba33fe8d107b8339f79a8778df01a283d9a
lsst-sqre/jupyterhubutils
/jupyterhubutils/singleton.py
456
3.671875
4
# Stolen from # https://stackoverflow.com/questions/6760685/creating-a-singleton-in-python class Singleton(type): '''Singleton metaclass. Create a Singleton class with: Class Foo(metaclass=Singleton) ''' _instances = {} def __call__(cls, *args, **kwargs): if cls not in cls._instances: cls._instances[cls] = super( Singleton, cls).__call__(*args, **kwargs) return cls._instances[cls]
e890bb7de9e35e1eb6061a1bd9e183e5e68a32eb
ikemerrixs/Au2018-Py210B
/students/arun_nalla/session06/Mailroom.py
3,454
3.53125
4
#!usr/bin/env python """ Mailroom_Part4 assignment - Refracted for unit testing using Pytest""" import os donors_dict = {'Aron King': [1, 2], 'Becky Patty': [3000, 1000], 'Charlie Lee': [666, 222], 'Thomas Dave':[202, 90, 450], 'Nancy Crow': [100, 200, 300]} def donors_list (donors_dict): return list(donors_dict) def add_donors(name, donors_dict): return donors_dict.setdefault(name,[]) def add_donation(name, donors_dict, donation): add_donors(name, donors_dict).append(donation) return donors_dict def thanks_email(): while True: name_input = input("Enter full name of a donor>>>").title() if name_input == 'List': print (donors_list(donors_dict)) else: while True: try: donation_amount = int(input('Enter donation amount: ')) if donation_amount <= 0: raise ValueError add_donation(name_input, donors_dict, donation_amount) print (email_message(name_input, donation_amount)) return except ValueError: print ('Please enter a value, entry should be an integer.') def sort_key(sorting): return sorting[1] def get_report(donors_dict): list_donors = ((name, sum(donors_dict[name]), len(donors_dict[name]), sum(donors_dict[name])/len(donors_dict[name])) for name in donors_dict) list_sorting = (sorted(list_donors, key=sort_key, reverse=True)) return list_sorting def create_report(): header = ("{:<20}{:<15}{:<15}{:^15}".format('Donors-name', 'Total', 'Num. gifts', 'Average Gift')) print (header) print('_' * len(header)) for name, donations, num, average in get_report (donors_dict): print("{:<20} ${:<15.2f}{:<15}${:<15.2f}".format(name, donations, num, average)) print('_' * len(header)); print('End of Report\n') def quit_program(): print('Thank for using this script.\nHave a nice day\nBye\n') exit() def path_to_store(name): my_path = os.path.join(os.getcwd(), 'Mailroom') return os.path.join(my_path, 'email_{}.txt'.format(name)) def email_message (name, donation): return ("Dear {},\nThank you for generous donation of ${:.2f}. It will be put to a good cause.\nSincerely," "\nThe Team".format(name, donation)) def store_emails(): for name in donors_dict: try: with open(os.path.join(path_to_store(name)), 'w') as f: f.write(email_message(name, sum(donors_dict[name]))) except FileNotFoundError: print ('Check for the file /folder name or path of the directory that stores all the e-mails') break else: print('\nAll e-mails are stored in current directory.\n') dict_list = {"1": thanks_email, "2": create_report, "3": store_emails, "4": quit_program} def main (): while True: try: response = input("MAIN MENU\nDonors and donations made to XYZ organisation.\nPlease select one of the " "option below to proceed.\n1.Send a Thank you message to the donor\n2.Create a report\n" "3.Send letters to all donors\n4. Quit\n>>>") dict_list.get(response)() except TypeError: print ("Invalid input.\nPlease select correct option") finally: print ('Thank You\n\n') if __name__ == "__main__": main()
207f849a51b8cc0d29d953a9dc5da0911e90040c
pshappyyou/CodingDojang
/LeetCode/test.py
69
3.609375
4
listl = [1,2,3,4,5] for i in range(len(listl)): print(listl[i])
9177f690fed2d0ab4fb0ea705add9a587f3e9dfe
Elvolox/ExerciciosPythonCurso
/desafio29.py
339
3.9375
4
velocidade = float((input('Qual a velocidade do carro?: '))) if velocidade > 80: print('Voce foi multado, passou a {}km/h'.format(velocidade)) multa = (velocidade - 80) * 7 print('A multa vai lhe custar R${}'.format(multa)) else: print('Você não estava acima do limite, não foi multado!') print('--FIM--')
a6485c1af9495afe47d8d77f97f52b66b5cde40e
sujith1999/sujith
/2s.py
144
4.0625
4
#!/usr/bin/python3 import random r=random.randint(1,6) #gives us a number between 1 and 6 print (r) if r==6: print("congratulation you got 6")
2e2b69bdbc673157e68859e583210bf06c9e4e72
VoTonggg/nguyenvanhung-fundamental-c4e18
/Session04Homework/turtle2.py
172
3.78125
4
from turtle import * speed(-1) shape("turtle") color("blue") for i in range(200): for j in range(4): forward(2*i) left(90) left(10) mainloop()
990b1c9ce74d45626dc5e072f49c8d8a88522802
Pato91/msft
/leet/compressr.py
1,218
3.765625
4
import unittest def compress(string): """ string compression """ if not isinstance(string, str) or any(c.isdigit() for c in string): raise Exception('Invalid input string') else: n = len(string) if n <= 2: return string i = j = 0 count = 1 cp = [] while j < n: j += 1 if j < n and string[i] == string[j]: count+=1 continue elif j < n: cp.extend([string[i], str(count)]) i, count = j, 1 continue else: cp.extend([string[i], str(count)]) return ''.join(cp) if len(cp) < n else string class Tests(unittest.TestCase): def test_invalid_input(self): with self.assertRaisesRegex(Exception, 'Invalid input string'): compress(['abc','aaabddde']) with self.assertRaisesRegex(Exception, 'Invalid input string'): compress('abc123') def test_empty_string(self): self.assertEqual(compress(' '), ' 3') def test_single_digit_str(self): self.assertEqual(compress('s'), 's') def test_mixed_case(self): self.assertEqual(compress('aaaAAA'), 'a3A3') def test_equal_length_case(self): self.assertEqual(compress('aaaA'), 'aaaA') if __name__ == '__main__': unittest.main()
a64076fb7fdddf22c810e3d3b80515f771ca7330
SantoshGowrisetty/Learn_by_doing-dataquest.io
/Python_Programming/Intermediate/Dates in Python-166.py
1,384
3.640625
4
## 1. The Time Module ## import time current_time=time.time() print (current_time) ## 2. Converting Timestamps ## import time current_time=time.time() current_struct_time=time.gmtime(current_time) current_hour=current_struct_time.tm_hour ## 3. UTC ## import datetime current_datetime=datetime.datetime.now() current_year=current_datetime.year current_month=current_datetime.month ## 4. Timedelta ## import datetime today=datetime.datetime.now() diff=datetime.timedelta(days=1) tomorrow=today+diff yesterday=today-diff print(tomorrow) print(yesterday) ## 5. Formatting Dates ## import datetime mystery_date_formatted_string=mystery_date.strftime("%I:%M%p on %A %B %d, %Y") print(mystery_date_formatted_string) ## 6. Parsing Dates ## import datetime mystery_date=datetime.datetime.strptime(mystery_date_formatted_string,"%I:%M%p on %A %B %d, %Y") print(mystery_date) ## 8. Reformatting Our Data ## import datetime for row in posts: row[2]=datetime.datetime.fromtimestamp(float(row[2])) ## 9. Counting Posts from March ## march_count = 0 for row in posts: if row[2].month==3: march_count +=1 ## 10. Counting Posts from Any Month ## def nofp(mnth): month_count = 0 for row in posts: if row[2].month == mnth: month_count += 1 return month_count feb_count=nofp(2) aug_count=nofp(8)
36856a0771e1d8ae41fef7ed45d1bf347e56728e
Neil-Do/HUS-Python
/Python 100 Problem/Problem58.py
375
3.859375
4
import re def extractUsername(): print("Enter Email: ") email = input() x = re.search("\w+\.*\w+@\w+\.*\w+\.\w+", email) while x == None: print("Khong dung dinh dang email, xin moi nhap lai: ") email = input() x = re.search("\w+\.*\w+@\w+\.*\w+\.\w+", email) username = email.split("@")[0] print(username) extractUsername()
99a7879498e032ab8259555b4e66a1d1a1b8b616
UncleBob2/MyPythonCookBook
/projects/snake/snake game byte size.py
7,467
3.90625
4
import pygame as pg import random import time # Colors red = pg.Color(255, 0, 0) green = pg.Color(0, 255, 0) black = pg.Color(0, 0, 0) white = pg.Color(255, 255, 255) brown = pg.Color(165, 42, 42) # Variables screen_width = 400 screen_height = 400 # Initialize pygame pg.init() # The screen, pygame The origin (0,0) is located at the top left corner. # upper right (screen_width,0), lower right corner (screen_width, screen_height) wn = pg.display.set_mode((screen_width, screen_height)) pg.display.set_caption('A simple game of Snake') # The class for food object class Food(): # Initialization def __init__(self): self.x = screen_width / 2 self.y = screen_height / 4 self.color = red self.width = 10 self.height = 10 # Makes the food visible def draw_food(self, surface): self.food = pg.Rect(self.x, self.y, self.width, self.height) pg.draw.rect(surface, self.color, self.food) # Is the food eaten? # e use a pygame inbuilt function that checks if two rectangles collide (this is the reason that food and the snakehead are initialized as py.Rect objects). If the two rectangles collide (snakehead and food), it returns ‘True’ else it returns ‘False.’ def is_eaten(self, head): return self.food.colliderect(head) # Returns a new position for the food after it is eaten def new_pos(self): self.x = random.randint(0, screen_width - self.width) self.y = random.randint(0, screen_height - self.height) # The snake object class Player(): # Initialization def __init__(self): self.x = screen_width / 2 self.y = screen_height / 2 self.width = 10 self.height = 10 self.velocity = 10 self.direction = 'stop' self.body = [] self.head_color = green self.body_color = brown # Draws the snake on the given surface def draw_player(self, surface): self.seg = [] self.head = pg.Rect(self.x, self.y, self.width, self.height) pg.draw.rect(surface, self.head_color, self.head) if len(self.body) > 0: for unit in self.body: segment = pg.Rect(unit[0], unit[1], self.width, self.height) pg.draw.rect(surface, self.body_color, segment) self.seg.append(segment) # Increases length of snake def add_unit(self): if len(self.body) != 0: index = len(self.body) - 1 x = self.body[index][0] y = self.body[index][1] self.body.append([x, y]) else: self.body.append([1000, 1000]) # Checks if there is any collision def is_collision(self): # Collision with itself for segment in self.seg: if self.head.colliderect(segment): return True # Collision with the boundaries if self.y < 0 or self.y > screen_height - self.height or self.x < 0 or self.x > screen_width - self.width: return True # Moves the snake in the direction of head def move(self): for index in range(len(self.body) - 1, 0, -1): x = self.body[index - 1][0] y = self.body[index - 1][1] self.body[index] = [x, y] if len(self.body) > 0: self.body[0] = [self.x, self.y] if self.direction == 'up': self.y -= self.velocity if self.direction == 'down': self.y += self.velocity if self.direction == 'left': self.x -= self.velocity if self.direction == 'right': self.x += self.velocity # Changes direction of head def change_direction(self, direction): if self.direction != 'down' and direction == 'up': self.direction = 'up' if self.direction != 'right' and direction == 'left': self.direction = 'left' if self.direction != 'up' and direction == 'down': self.direction = 'down' if self.direction != 'left' and direction == 'right': self.direction = 'right' score, high_score = (0, 0) # Draw the score on the screen def draw_score(surface): global high_score # declare global to access and modify the high score variable font_name = pg.font.match_font('arial') # choose font with arial in it if score > high_score: # set high score as current score if it is higher than current score high_score = score # writing the score font = pg.font.Font(font_name, 18) # The next three lines create a rectangle to display the score text_surface = font.render( 'Score: {} High Score: {}'.format(score, high_score), True, white) # Next, we get the rectangle on which the text is drawn via get_rect() and place its mid-top position at (200,10) in the next line. The final line writes the score in the text_rect object. text_rect = text_surface.get_rect() text_rect.midtop = (200, 10) surface.blit(text_surface, text_rect) # What to do when the game is over # The function first writes the word “Game Over” on the screen (the first 6–7 lines). Then it resets the score to 0. pg.display.flip() is used to update the screen so that the changes made above are visible. Next, we call the time.sleep() function from the time module, which makes the screen unresponsive for 2 seconds. Finally, we re-initialize the whole game by creating new food and player objects and initializing the game environment using the play_game function. def game_over(): global score # writing game over gameOverFont = pg.font.Font('freesansbold.ttf', 24) gameOverSurf = gameOverFont.render('Game Over', True, white) gameOverRect = gameOverSurf.get_rect() gameOverRect.midtop = (200, 50) wn.blit(gameOverSurf, gameOverRect) # reset score score = 0 pg.display.flip() time.sleep(2) # re-initialize game run = True fd = Food() p = Player() play_game(fd, p) # The game # The play_game function takes the two objects (food and player) as the input and makes them play the game. def play_game(fd, p): global score run = True while run: # FPS clock.tick(30) for event in pg.event.get(): if event.type == pg.QUIT: run = False # draw food, snake, score wn.fill(black) fd.draw_food(wn) p.draw_player(wn) draw_score(wn) # user input pressed = pg.key.get_pressed() if pressed[pg.K_UP]: p.change_direction('up') if pressed[pg.K_LEFT]: p.change_direction('left') if pressed[pg.K_DOWN]: p.change_direction('down') if pressed[pg.K_RIGHT]: p.change_direction('right') # move snake p.move() # eating if fd.is_eaten(p.head): fd.new_pos() p.add_unit() score += 10 # collision if p.is_collision(): run = False game_over() pg.display.update() # The mainloop run = True while run: # Catches all the events that have happened since the game started for event in pg.event.get(): # When you press the close window button if event.type == pg.QUIT: run = False # Fills the screen with black color wn.fill(black) fd = Food() p = Player() play_game(fd, p) # Exits pygame pg.quit()
fee8fdd95f7da79e82d21891f75600e6e535227c
GrowingDiary/python-exercises
/src/065.py
1,130
4.0625
4
# !/usr/bin/python3 # -- coding: utf-8 -- """ 题目:有 n 个整数,使其前面各数顺序向后移 m 个位置,最后 m 个数变成最前面的 m 个数 """ import copy import random def solution1(num, swap_size): print(num) for i in range(swap_size): num.insert(0, num.pop()) print(num) def solution2(num, swap_size): print(num) swap_num = num[-swap_size:] swap_num.extend(num[:-swap_size]) print(swap_num) def solution3(num, swap_size): import collections print(num) num_deque = collections.deque(num) num_deque.rotate(swap_size) print(list(num_deque)) def main(): num_list = [] for i in range(10): num_list.append(random.randint(0, 100)) swap_size = random.randint(1, 9) print('m:', swap_size) print('---------- solution 1 ---------- ') solution1(copy.deepcopy(num_list), swap_size) print('---------- solution 2 ---------- ') solution2(copy.deepcopy(num_list), swap_size) print('---------- solution 3 ---------- ') solution3(copy.deepcopy(num_list), swap_size) if __name__ == '__main__': main()
1c523b95f0105c7d340fcfeb006c0464e7d54134
boom210232/triangle
/parameterized_test.py
1,534
3.75
4
from triangle import is_triangle import unittest class TriangleTest(unittest.TestCase): # The list of data values for your tests can be defined: # - outside the class (global variable) # - as a class variable (like this) # - as a local variable inside the test method. # Use which ever is most readable. valid_triangles = [ (1, 1, 1), (3, 4, 5), (3, 4, 6), (20, 24, 28), (55, 77, 99), (7, 9, 14), (60, 80, 100) ] invalid_triangles = [ (55, 77, 2), (5, 4, 33), (7, 1, 9), (200, 55, 99), (0, 0, 0), (1, 99, 999999) ] value_error_triangles = [ (-1, -5, -9), (-4, 4, 10), (55, -77, 99), (7, 9, -14), (-20, -40, 70), (-20, 35, -59) ] def test_valid_triangle(self): for a, b, c in self.valid_triangles: with self.subTest(): message = f"sides are ({a},{b},{c})" self.assertTrue(is_triangle(a, b, c), message) def test_invalid_triangle(self): for a, b, c in self.invalid_triangles: with self.subTest(): message = f"sides are ({a},{b},{c})" self.assertFalse(is_triangle(a, b, c), message) def test_value_error_with_negative_value_triangle(self): for a, b, c in self.value_error_triangles: with self.subTest(): with self.assertRaises(ValueError): is_triangle(a, b, c)
d09b937a1179a176fe08941db8e660f65c73e8ca
Puzyrinwrk/Stepik
/Поколение Python/Первая_цифра.py
551
4.375
4
""" Дано положительное действительное число. Выведите его первую цифру после десятичной точки. Формат входных данных На вход программе подается положительное действительное число. Формат выходных данных Программа должна вывести цифру в соответствии с условием задачи. """ n = float(input()) r = int(n * 10) print(r % 10)
3b23dd139c4198c7a396b5c591c8f3445a7ba5ee
Hanniery/Parcial1PA
/grapes.py
706
3.859375
4
if __name__ == '__main__': number_to_eat = input() andrew, dmitry, michal = int(number_to_eat.split(' ')[0]), int(number_to_eat.split(' ')[1]), int(number_to_eat.split(' ')[2]) number_to_by_box = input() grapes_green, grapes_purple, grapes_black = int(number_to_by_box.split(' ')[0]), int(number_to_by_box.split(' ')[1]), int(number_to_by_box.split(' ')[2]) bandera = 'YES' if andrew <= grapes_green: grapes_green -= andrew else: bandera = 'NO' if dmitry > (grapes_green + grapes_purple): bandera = 'NO' else: grapes_green -= dmitry // 2 grapes_purple -= dmitry // 2 if michal > (grapes_green + grapes_purple + grapes_black): bandera = 'NO' print(bandera)
2f7b28b70473598a082acd4ea9b5b6e5e0d231d3
mirakib/Regular-coding
/Disemvowel Trolls/Solution.py
301
3.953125
4
def disemvowel(string_): vowel_list = ['A', 'E', 'I', 'O', 'U', 'a', 'e', 'i', 'o', 'u'] re_gen = [] for letter in string_: if letter not in vowel_list: re_gen.append(letter) string_ = "" for letter in re_gen: string_ += letter return string_
f2ca3b1466d71fd324098531a6fbe881e6ed5c6d
s2t2/omniparser-prep-py
/app/stock_prices_parser.py
1,509
3.6875
4
from pprint import pprint import os import json def to_usd(my_price): """ converts a numeric value to usd-formatted string, for printing and display purposes """ return "${0:,.2f}".format(my_price) #> $12,000.71 def latest_closing_price(my_json_filepath): with open(my_json_filepath, "r") as json_file: file_contents = json_file.read() daily_prices = json.loads(file_contents) latest_date = daily_prices["Meta Data"]["3. Last Refreshed"] latest_prices = daily_prices["Time Series (Daily)"][latest_date] latest_close = latest_prices["4. close"] #> '1066.0400' return latest_close if __name__ == "__main__": # # CAPTURE USER INPUTS # selected_symbol = input("Please select a stock symbol ('AAPL', GOOG', or 'MSFT'):") if selected_symbol.upper() not in ["AAPL", "GOOG", "MSFT"]: print("OH, INVALID SELECTION. PLEASE TRY AGAIN...") exit() print("SELECTED SYMBOL:", selected_symbol.upper()) # # PROCESS DATA AND DISPLAY OUTPUTS # selected_filepath = os.path.join(os.path.dirname(__file__), "..", "data", f"stock_prices_{selected_symbol.lower()}.json") print("PARSING A LOCAL JSON FILE:", selected_filepath) if not os.path.isfile(selected_filepath): print("OH, THAT FILE DOESN'T EXIST. PLEASE PLACE A FILE THERE OR CHECK YOUR FILEPATH...") exit() latest_close = latest_closing_price(selected_filepath) print("LATEST CLOSING PRICE:", to_usd(float(latest_close)))
a9449c64a7873a666891ed3b25337bb840bbe9e8
ommmishra/randomPrograms
/binarySearch.py
359
3.828125
4
def binarySearch(list, idxs, idxe, val): if(idxe < idxs): return None else: mid = (idxs + idxe )// 2 if(val > list[mid]): return binarySearch(list, mid+1, idxe, val) elif(val < list[mid]): return binarySearch(list, idxs, mid-1, val) else: return mid arr = [23,45,54,767,765] arr.sort() print(binarySearch(arr, 0, len(arr)-1, 765))
6caf44593e8ee9f98dc1477179f43d2383757995
yuya-okada527/ml-playground-stream
/utils/csv_utils.py
305
3.609375
4
from typing import Any, List def make_record(values: List[Any], separator: str) -> str: value_strings = [] for v in values: if v is None: v = "" v = str(v) v = v.replace(separator, "") value_strings.append(v) return separator.join(value_strings)
ed0e36c0d79c1afeb7a8f6e95899b11b1db0152d
ShelMX/gb_algorithm_hw
/lesson_7/hw_07_task_2.py
2,090
3.9375
4
__author__ = 'Шелест Леонид Викторович' """ Отсортируйте по возрастанию методом слияния одномерный вещественный массив, заданный случайными числами на промежутке [0; 50). Выведите на экран исходный и отсортированный массивы. """ import hw_07 as lib def merge_sort(nsl: list) -> list: """ function sorts an array by a merge method. :param nsl: type list: non sorted list :return: type list: list after merge sort """ sl = nsl[:] n = len(nsl) if n < 2: return sl else: left_arr = merge_sort(nsl=nsl[:n//2]) right_arr = merge_sort(nsl=nsl[n//2:n]) sl = [] i = 0 j = 0 while i < len(left_arr) or j < len(right_arr): if not (i < len(left_arr)): sl.append(right_arr[j]) j += 1 elif not (j < len(right_arr)): sl.append(left_arr[i]) i += 1 elif not (left_arr[i] > right_arr[j]): sl.append(left_arr[i]) i += 1 else: sl.append(right_arr[j]) j += 1 return sl def main(arr: list = None, is_print: bool = True) -> list: """ main function that combines all the functions of the module. :param is_print: type bool: flag, if True, then function will print result, else not print. :param arr: type list: non sorted list, if the value of the parameter is not specified, then an array of random numbers is created. :return: type list: sorted list """ non_sort_list = arr if arr else lib.generate_float_array(low=0.0, up=50.0, rounding=5) sorted_list = merge_sort(nsl=non_sort_list) if is_print: print(f"Non sorted list:") lib.pretty_print(arr=non_sort_list) print(f"\nList after Merge sort:") lib.pretty_print(arr=sorted_list) return sorted_list if __name__ == '__main__': main()
59cb7310ba11df7b3ea0cbe5d401e7f8d9185048
juno7803/Algorithm_Python
/코테 스터디/class2/2164 카드2/2164.py
262
3.546875
4
from collections import deque from sys import stdin input = stdin.readline n = int(input()) q = [i+1 for i in range(n)] queue = deque(q) while(len(queue) != 1): queue.popleft() second = queue.popleft() queue.append(second) print(queue.popleft())
f2b6e6da6f2e15fff42b39938ddba775a4ba7fbe
AlishaKochhar/LinkedListPython
/DeleteByPosition.py
1,079
3.640625
4
class Node : def __init__(self,value) : self.value=value self.next=None class LinkList : def __init__(self) : self.head=None def show(self) : temp=self.head while(temp) : print(temp.value) temp=temp.next def beg(self,data) : new_node=Node(data) new_node.next=self.head self.head=new_node def delete_key(self,pos) : if self.head==None : return temp=self.head if pos==0 : self.head=temp.next temp=None return for i in range(pos-1) : #pos=index here temp=temp.next if temp is None : break if temp is None : return if temp.next is None : return next=temp.next.next temp.next=None temp.next=next newlist=LinkList() newlist.beg(7) newlist.beg(6) newlist.beg(5) newlist.beg(4) newlist.beg(3) newlist.beg(2) newlist.beg(1) newlist.delete_key(2) newlist.delete_key(4) newlist.show()
5e590ccce5dfc3bbabedae9417dd61a7a2c1fbc4
ncavchl/Python-study
/programmers/level1/2016년.py
337
3.703125
4
# import datetime def solution(a, b): month = [31,29,31,30,31,30,31,31,30,31,30,31] weekday = ["FRI", "SAT","SUN","MON","TUE", "WED", "THU"] answer = weekday[(sum(month[:a-1])+b-1)%7] # day = datetime.datetime(2016, a, b) # #print(day.weekday()) # dt = day.weekday() # answer = weekday[dt] return answer
2c31c1de702a6d4405728a22f823a0de7c5abaac
A01376318/Mision_04
/Triangulos.py
1,142
4.15625
4
#Autor: Elena R.Tovar #Mision_04: Triángulos #Leer el valor de cada uno de los lados del triángulo #Clasificar triángulo de acuerdo a la longitud de sus lados #Si un triangulo no existe, dar ERROR #Un triangulo no existe si la suma de dos de sus lados es menor al tercero def verificarLados(a,b,c): if a==0 or b==0 or c==0: return "ERROR" elif (a+b)>c: return "RIGHT" elif (a+c)>b: return "RIGHT" elif (b+c)>a: return "RIGHT" else: return "ERROR" def clasificarTriangulos(a,b,c): if a==b and b==c: return "EQUILÁTERO" elif a==b or b==c or a==c: return "ISÓSCELES" else: return "OTRO" def main(): a= int(input("Ingrese el valor del primer lado: ")) b= int(input("Ingrese el valor del segundo lado: ")) c= int(input("Ingrese el valor del tercer lado: ")) verif=verificarLados(a,b,c) if verif=="RIGHT": clasif=clasificarTriangulos(a,b,c) print("USTED HA INGRESADO UN TRIÁNGULO ",clasif) else: print ("LOS VALORES QUE HA INGRESADO NO SON VÁLIDOS") main()
54065156ecfae421c3389a0fa618f94903080b0a
cauenapier/Unisim
/src/Unisim/constraints/constraints.py
7,162
3.796875
4
"""A constraint is something that describes how two bodies interact with each other. (how they constrain each other). """ import numpy as np class Constraint(object): """ Base class for constraints """ def _set_bodies(self,a,b): self._a = a self._b = b a = property(lambda self: self._a, doc="""The first of the two bodies constrained""") b = property(lambda self: self._b, doc="""The second of the two bodies constrained""") class DampedSpring(Constraint): def __init__(self, a, b, rest_length, stiffness, damping): super()._set_bodies(a,b) self._rest_length = rest_length self._stiffness = stiffness self._damping = damping self._force_vector_a2b = None a.add_constraint(self) b.add_constraint(self) def _calcForce_a2b(self): pos_a = self._a._state_vector[0:3] pos_b = self._b._state_vector[0:3] vel_a = self._a._state_vector[3:6] vel_b = self._b._state_vector[3:6] # Relative Position rel_position_norm = np.linalg.norm(pos_b - pos_a) if rel_position_norm == 0: rel_position_versor = np.zeros(3) else: rel_position_versor = (pos_b - pos_a)/rel_position_norm # Relative Velocity rel_velocity_norm = np.linalg.norm(vel_b - vel_a) if rel_velocity_norm == 0: rel_velocity_versor = np.zeros(3) else: rel_velocity_versor = (vel_b - vel_a)/rel_velocity_norm F_k = (rel_position_norm-self._rest_length)*self._stiffness*rel_position_versor F_c = (rel_velocity_norm)*self._damping*rel_velocity_versor Force = (F_k+F_c) self._force_vector_a2b = Force return Force class Ellastic_Rope_3DOF(Constraint): """ """ def __init__(self, a, b, rest_length, stiffness, damping): """ :param Body a: Body a :param Body b: Body b :param anchor_a: Anchor point a, relative to body a :type anchor_a: `(float,float)` :param anchor_b: Anchor point b, relative to body b :type anchor_b: `(float,float)` :param float rest_length: The distance the spring wants to be. :param float stiffness: The spring constant (Young's modulus). :param float damping: How soft to make the damping of the spring. """ super()._set_bodies(a,b) self._rest_length = rest_length self._stiffness = stiffness self._damping = damping self._force_vector_a2b = None a.add_constraint(self) b.add_constraint(self) def _calcForce_a2b(self): """Ref: Validation of Multibody Program to Optimize Simulated Trajectories II Parachute Simulation With Interacting Forces Behzad Raiszadeh and Eric M. Queen TODO: Remove redundant checks, code can be optmized. """ pos_a = self._a._state_vector[0:3] vel_a = self._a._state_vector[3:6] pos_b = self._b._state_vector[0:3] vel_b = self._b._state_vector[3:6] # Strain rel_position_norm = np.linalg.norm(pos_b - pos_a) if rel_position_norm == 0: rel_position_versor = np.zeros(3) e = 0 else: rel_position_versor = (pos_b - pos_a)/rel_position_norm e = (rel_position_norm - self._rest_length)/self._rest_length # Strain Rate rel_velocity_norm = np.linalg.norm(vel_b - vel_a) if rel_velocity_norm == 0: rel_velocity_versor = np.zeros(3) e_dot = 0 else: rel_velocity_versor = (vel_b - vel_a)/rel_velocity_norm e_dot = ( (np.dot(vel_b, rel_position_versor)) - (np.dot(vel_a, rel_position_versor)) )/self._rest_length if e < 0: e = 0 if e_dot < 0: e_dot = 0 if rel_position_norm >= self._rest_length: F_ab = (self._stiffness*e + self._damping*e_dot)*self._rest_length*rel_position_versor else: F_ab = 0 self._force_vector_a2b = F_ab return F_ab def _get_force_vector_a2b(self): return self._force_vector_a2b class Ellastic_Rope_6DOF(Constraint): """ """ def __init__(self, a, b, a_att, b_att, rest_length, stiffness, damping): """ :param Body a: Body a :param Body b: Body b :param vector_a: Attachment Point from CG :param vector_b: Attachment Point from CG :param anchor_a: Anchor point a, relative to body a :type anchor_a: `(float,float)` :param anchor_b: Anchor point b, relative to body b :type anchor_b: `(float,float)` :param float rest_length: The distance the spring wants to be. :param float stiffness: The spring constant (Young's modulus). :param float damping: How soft to make the damping of the spring. """ super()._set_bodies(a,b) self._att_a = a_att self._att_b = b_att self._rest_length = rest_length self._stiffness = stiffness self._damping = damping self._force_vector_a2b = None a.add_constraint(self) b.add_constraint(self) def _calcForce_a2b(self): """Ref: Validation of Multibody Program to Optimize Simulated Trajectories II Parachute Simulation With Interacting Forces Behzad Raiszadeh and Eric M. Queen TODO: Remove redundant checks, code can be optmized. """ pos_a = self._a._state_vector[0:3] vel_a = self._a._state_vector[3:6] pos_b = self._b._state_vector[0:3] vel_b = self._b._state_vector[3:6] DCM_a = self._a._DCM DCM_b = self._b._DCM # Strain rel_position_norm = np.linalg.norm(pos_b - pos_a) if rel_position_norm < 1e-6: rel_position_versor = np.zeros(3) e = 0 else: rel_position_versor = (pos_b - pos_a)/rel_position_norm e = (rel_position_norm - self._rest_length)/self._rest_length # Strain Rate rel_velocity_norm = np.linalg.norm(vel_b - vel_a) if rel_velocity_norm < 1e-6: rel_velocity_versor = np.zeros(3) e_dot = 0 else: rel_velocity_versor = (vel_b - vel_a)/rel_velocity_norm e_dot = ( (np.dot(vel_b, rel_position_versor)) - (np.dot(vel_a, rel_position_versor)) )/self._rest_length if e < 0: e = 0 if e_dot < 0: e_dot = 0 if rel_position_norm >= self._rest_length: F_ab = (self._stiffness*e + self._damping*e_dot)*self._rest_length*rel_position_versor else: F_ab = 0 self._force_vector_a2b = F_ab return F_ab def _get_force_vector_a2b(self): return self._force_vector_a2b def _calcTorque_ab(self): X_a_att = pos_a + np.cross(np.transpose(DCM_a), self._att_a) X_b_att = pos_b + np.cross(np.transpose(DCM_b), self._att_b) M_a = cross(X_a_att, self._force_vector_a2b) M_b = cross(X_b_att, -self._force_vector_a2b) return M_a, M_b
640b1e90ef668928671e13a63367b9fd8c7d9f5d
nameera0408/Practical-introduction-to-python_Brainheinold
/ch4_9sol.py
95
3.5
4
n=int(input()) s=0 for i in range(2,n): if n%i==0: print(i) else: pass
a7beca69a8bf7c9b9d935b95d823291ab8cea4c3
axelkennedal/kexjobbet
/playground/id3_processing/playground.py
209
3.546875
4
genres_count = {} genres = ["house", "pop", "house"] # first add the keys for genre in genres: genres_count[genre] = 0 # then count for genre in genres: genres_count[genre] += 1 print(genres_count)
d7b02de81a4fdda16b3244ae0a697fe825728669
arekRakoczy/ForJajki
/multiplygame.py
388
3.515625
4
import random base = [1,2,3,4,5,6,7,8,9] first_nr = base[random.randint(0, len(base)-1)] second_nr = base[random.randint(0, len(base)-1)] print(f"{first_nr} x {second_nr} = ") should_repet = True while (should_repet): score = int(input()) if score == first_nr * second_nr: print("BARDZO DOBRZE") should_repet = False else: print("SPROBUJ JESZCZE RAZ")
d79f1478b2a7efad0420a41bcdc2ccaddba5e82f
hillar1988/mypython
/mypython36/duola.py
13,714
3.59375
4
from turtle import * import turtle def my_test(): speed(10) penup() seth(180) fd(200) seth(0) penup() #外圈头 circle(150, 40) pendown() fillcolor('dodgerblue') begin_fill() circle(150, 280) end_fill() #外圈头 fillcolor("red") begin_fill() #外圈头 seth(0) #项圈 fd(200) circle(-5,90) fd(10) circle(-5,90) fd(210) circle(-5,90) fd(10) circle(-5,90) end_fill() #项圈 fd(183) #右脸 left(45) fillcolor("white") begin_fill() circle(120,100) seth(90) #眼睛 a = 2.5 for i in range(120): if 0 <= i < 30 or 60 <= i < 90: a -= 0.05 lt(3) fd(a) else: a += 0.05 lt(3) fd(a) penup() seth(180) fd(60) pendown() seth(90) for i in range(120): if 0 <= i < 30 or 60 <= i < 90: a -= 0.05 lt(3) fd(a) else: a += 0.05 lt(3) fd(a) #眼睛 seth(180) penup() fd(60) pendown() seth(215) circle(120,100) end_fill() #脸部颜色和眼睛部分 seth(0) # 左眼珠部分 penup() fd(40) seth(90) fd(170) seth(0) fd(5) pendown() fillcolor("black") begin_fill() circle(15,360) end_fill() seth(90) penup() fd(5) pendown() seth(0) fillcolor("white") begin_fill() circle(4,360) end_fill() #左眼珠部分 penup() #右眼珠 seth(0) fd(58) seth(270) fd(15) seth(0) pensize(5) circle(18,90) pendown() circle(18,180) penup() circle(18,90) pendown() pensize(1)#右眼珠 penup() #鼻子 seth(270) fd(7) seth(180) fd(27) pendown() fillcolor("red") begin_fill() circle(20) end_fill()#鼻子 seth(270)#嘴 penup() fd(40) pendown() pencolor("black") pensize(2) fd(90) seth(0) circle(120,50) penup() circle(120,260) pendown() circle(120,50)#嘴 penup() #胡须 seth(90) fd(60) seth(0) fd(20) pendown() fd(60) penup() fd(-60) seth(90) fd(20) pendown() seth(15) fd(60) penup() fd(-60) seth(270) fd(40) pendown() seth(-15) fd(50) penup() fd(-50) seth(180) fd(40) pendown() seth(-165) fd(50) penup() fd(-50) seth(90) fd(40) seth(165) pendown() fd(60) fd(-60) penup() seth(280) fd(20) seth(180) pendown() fd(60) #胡须 penup() #下半身 home() penup() seth(180) fd(200) seth(0) seth(90) fd(36) seth(0) fd(98) pendown() fillcolor("dodgerblue") begin_fill() seth(50) fd(70) seth(40) fd(20) right(90) fd(35) right(75) fd(105) seth(90) fd(10) seth(-90) fd(90) seth(-95) fd(80) seth(180) fd(80) # 右腿 penup() #左腿和过渡 fd(30) seth(-90) fd(30) seth(0) circle(30,90) pendown() circle(30,180) penup() circle(30,90) seth(90) fd(30) seth(180) fd(30) pendown() fd(80) #腿 seth(92) fd(80) seth(90) fd(75) fd(-30) seth(-135) fd(30) right(90) fd(40) right(93) fd(78) seth(0) fd(205) end_fill() fillcolor("red")# 项圈的补充 begin_fill() circle(5,90) fd(10) circle(5,90) fd(10) end_fill() penup() seth(50) fd(70) seth(40) fd(16) right(90) fd(20) pendown() fillcolor("white")# 手掌 begin_fill() circle(30) end_fill() penup() seth(-90) fd(253) seth(180) fd(160) seth(-90) fd(30) seth(0) pendown() fillcolor("white") begin_fill() penup() circle(31,90) pendown() circle(31,180) penup() circle(31,90) end_fill() seth(90) fd(30) seth(0) fd(24) pendown() seth(180) circle(15,180)# 脚 fd(90) circle(15,180) fd(90) penup() seth(180) fd(60) penup() seth(0) pendown() circle(-15,180) fd(80) circle(-15,180) fd(80) penup() seth(180) fd(140) seth(90) fd(90) seth(-45) pendown() fillcolor("white") begin_fill() circle(30) end_fill() penup() seth(-90) fd(50) seth(0) fd(173) seth(0) fillcolor("white")# 胸 begin_fill() pendown() circle(90,128) seth(180) fd(145) seth(-128) circle(90,129) end_fill() seth(90) penup() fd(35) seth(0) pendown() circle(70,90)# 口袋 seth(180) fd(140) seth(-90) circle(70,90) penup() seth(90) fd(90) pendown() seth(0) fillcolor("#ffd200")#铃铛 begin_fill() circle(20) end_fill() seth(90) pensize(2) fd(13) fillcolor("black") begin_fill() seth(0) circle(2) end_fill() seth(-90) fd(13) seth(0) penup() circle(20,110) pendown() seth(170) fd(20) seth(190) fd(20) penup() seth(-90) fd(3.5) pendown() seth(10) fd(20) seth(-10) fd(22) #大雄部分 pensize(1) penup() seth(0) fd(400) pendown() speed(10) fillcolor("black") begin_fill() seth(30) circle(100,60) fd(20) #右脸 seth(50) circle(50,150) seth(70) fd(4) seth(50) fd(4) fd(-4) seth(70) fd(-4) seth(145) fd(5) seth(138) fd(5) fd(-5) seth(145) fd(-5) seth(150) circle(60,150) seth(-90) fd(20) circle(84,92) end_fill() penup() seth(90) fd(110) seth(0) fd(50) fillcolor("#FAFAD2") begin_fill() pendown()#发际线 seth(85) fd(20) seth(160) fd(20) seth(165) fd(20) seth(170) fd(10) seth(175) fd(20) seth(180) fd(10) seth(185) fd(20) seth(190) fd(20) seth(195) fd(10) seth(200) fd(14.5) seth(-85) fd(30) seth(-90) fd(20) circle(84,92) seth(30) circle(100.5,60) fd(30) end_fill() penup() seth(-90) fd(10) pendown() fillcolor("#FAFAD2") begin_fill() seth(80) circle(-8,190) seth(-90) fd(5) seth(-95) fd(5) seth(-100) fd(5) seth(-105) fd(5) seth(-110) fd(5) circle(-8,135) penup() seth(90) fd(15) seth(0) fd(3) pendown() seth(60) fd(8) seth(70) fd(8) fd(-8) seth(70) circle(-5,180) seth(-120) fd(14) end_fill() penup() seth(180) fd(142) seth(90) fd(23) pendown() fillcolor("#FAFAD2") begin_fill() seth(100) circle(8,180) seth(-90) fd(6) seth(-85) fd(6) seth(-80) fd(6) circle(8,140) end_fill() seth(100) fd(20) circle(5,210) fd(7) penup() seth(0) fd(142) seth(90) fd(9) pendown() seth(180) fd(18) seth(90) fillcolor("white") begin_fill() a = 2.3 for i in range(120): if 0 <= i < 30 or 60 <= i < 90: a -= 0.05 lt(3) fd(a) else: a += 0.05 lt(3) fd(a) penup() seth(180) fd(50) seth(90) pendown() for i in range(120): if 0 <= i < 30 or 60 <= i < 90: a -= 0.05 lt(3) fd(a) else: a += 0.05 lt(3) fd(a) end_fill() seth(180) penup() fd(70) pendown() seth(0) fd(20) penup() fd(34) seth(-90) fd(2) pendown() pensize(6) circle(4) penup() seth(0) fd(26) seth(-90) fd(2.5) seth(0) pendown() circle(4) pensize(2) penup() seth(90) fd(40) seth(0) fd(15) seth(30) pendown() fd(8) seth(0) fd(10) seth(-40) fd(15) seth(-50) fd(7) seth(-60) fd(7) penup() seth(180) fd(95) seth(90) fd(25) pendown() seth(-145) fd(10) seth(-135) fd(5) seth(-125) fd(5) seth(-120) fd(5) seth(-115) fd(5) seth(-110) fd(5) penup() seth(90) fd(30) seth(0) fd(25) pendown() seth(-30) fd(19) penup() pensize(1) seth(0) fd(13) seth(-90) fd(81) seth(0) pendown() circle(8) penup() seth(-90) fd(20) seth(180) fd(10) seth(160) pendown() fd(25) fd(-25) seth(-15) fd(5) seth(-10) fd(5) seth(0) fd(5) seth(10) fd(5) seth(15) fd(5) seth(20) fd(27) seth(-90) penup() fd(25) seth(180) fd(36) seth(0) pendown() fillcolor("white") begin_fill() circle(68.5,75) seth(-105) circle(-68.5,75) circle(-72.5,78) penup() seth(-90) fd(100) seth(0) fd(133) seth(90) fd(85) end_fill() fillcolor("#FAFAD2") begin_fill() seth(-160) fd(104) seth(0) fd(38) seth(-90) fd(7.5) pendown() seth(0) circle(66,76) end_fill() penup() seth(180) fd(80) seth(-90) fd(33.5) pendown() seth(-15) fd(5) seth(-10) fd(5) seth(0) fd(5) seth(10) fd(5) seth(15) fd(5) seth(20) fd(27) penup() seth(180) fd(12) seth(-90) fd(21) pendown() fillcolor("#FAFAD2") begin_fill() fd(12) seth(180) fd(46) seth(90) fd(11) penup() seth(-30) fd(5) seth(-20) fd(5) seth(-10) fd(5) seth(0) fd(5) pendown() circle(73,27) end_fill() penup() seth(-90) fd(6) seth(180) fd(5) pendown() fillcolor("white") begin_fill() seth(-50) fd(12) seth(-100) fd(30) seth(135) fd(40) seth(-135) fd(40) seth(100) fd(30) seth(45) fd(16) end_fill() fillcolor("#EEC900") begin_fill() fd(-16) seth(-145) fd(40) circle(20,45) fd(10) left(10) fd(5) right(10) fd(10) left(90) fd(25) seth(85) fd(25) seth(75) fd(10) fd(-10) seth(85) fd(-25) seth(-90) fd(15) seth(-85) fd(18) seth(0) fd(95) circle(6,180) seth(90) fd(30) seth(95) fd(35) fd(-30) right(90) fd(25) left(80) fd(6) left(6) fd(6) left(12) fd(20) circle(20,60) fd(20) end_fill() penup() seth(180) fd(54) seth(90) fd(10) pendown() fillcolor("#FAFAD2") begin_fill() seth(-90) fd(10) seth(0) fd(48) seth(90) fd(10) end_fill() seth(180) penup() fd(24) pendown() circle(-160,13) seth(-13) circle(160,13) seth(0) circle(160,12) penup() seth(-90) fd(12) seth(180) fd(3) pendown() fillcolor("white") begin_fill() seth(-100) fd(30) seth(135) fd(40) seth(-135) fd(40) seth(100) fd(26) end_fill() penup() seth(0) fd(20) seth(90) fd(2) pendown() seth(0) fd(41) penup() seth(0) fd(40) seth(-90) fd(53) pendown() fillcolor("#FAFAD2") begin_fill() seth(-80) fd(60) seth(-30) fd(5) seth(-40) fd(5) seth(-50) fd(5) seth(-60) fd(5) seth(-80) fd(5) seth(-90) fd(5) seth(-95) fd(5) seth(-135) fd(6) seth(-138) fd(6) seth(-143) fd(6) circle(-15,160) seth(180) circle(20,20) seth(95) fd(80) end_fill() penup() fd(-90) seth(0) fd(20) pendown() seth(-70) fd(10) fd(-10) penup() seth(0) fd(8) seth(-70) pendown() fd(7) fd(-7) penup() seth(0) fd(8) seth(-70) fd(-10) pendown() fd(13) penup() seth(180) fd(165) seth(90) fd(82) seth(-95) fillcolor("#FAFAD2") begin_fill() pendown() fd(80) seth(-150) circle(20,190) seth(145) fd(10) left(90) fd(6) fd(-14) fd(8) right(90) fd(-7) seth(45) circle(20,80) seth(85) fd(85) end_fill() penup() seth(-90) fd(35) seth(0) fd(3) pendown() fillcolor("#FAFAD2") begin_fill() seth(-105) fd(10) seth(-87) fd(70) seth(-90) fd(70) seth(-145) fd(20) circle(10,160) seth(0) fd(50) circle(5,110) fd(20) seth(90) fd(50) seth(87) fd(60) circle(-6,175) fd(60) seth(-90) fd(50) seth(-120) fd(18) circle(5,130) seth(0) fd(50) circle(10,160) fd(16) seth(90) fd(70) seth(87) fd(80) end_fill() penup() seth(90) fd(1) fillcolor("#FF3E96") begin_fill() pendown() seth(180) fd(96) seth(-105) fd(10) seth(-87) fd(45) seth(0) fd(43) seth(87) fd(13) circle(-6,175) seth(-90) fd(15) seth(0) fd(40) end_fill() penup() seth(-90) fd(98) seth(180) fd(40) pendown() seth(-10) fd(15) seth(0) fd(15) seth(10) fd(15) penup() seth(180) fd(62) pendown() seth(-170) fd(15) seth(180) fd(15) seth(-190) fd(15) turtle.done() # hideturtle() my_test()
e9b61eb2725ef0d5c156e88d8458a2241a5784c4
CarlosRodrigo/project-euler
/euler01.py
281
3.8125
4
# Project Euler - 01 # https://projecteuler.net/problem=1 # Multiples of 3 and 5 def multiples(n): curr_sum = 0 for i in range(n): if i % 3 == 0 or i % 5 == 0 : curr_sum += i return curr_sum def main(): print multiples(1000) if __name__ == "__main__": main()
d06b8b9bcf5a041c0595bebb6b3b6f76e146729b
mikemadden42/pyutils
/tickets.py
997
3.84375
4
#!/usr/bin/env python3 """Summarize tickets by user""" import argparse import csv from collections import defaultdict import six def tickets(tickets_file): """Summarize tickets by user""" items = defaultdict(list) with open(tickets_file, "rb") as infile: reader = csv.reader(infile) for row in reader: assignee = row[49] summary = row[32] request = row[50] date = row[19] work_details = "%s - %s - %s" % (request, date, summary) items[assignee].append(work_details) for key, values in list(items.items()): six.print_(key, "-", len(values), "request(s)") for item in values: six.print_(item) six.print_() if __name__ == "__main__": PARSER = argparse.ArgumentParser(description="summarize a set of tickets") PARSER.add_argument("-f", "--file", help="tickets file", required=True) ARGS = vars(PARSER.parse_args()) tickets(ARGS["file"])
63704afe3015c2cfc67a1d0f507b45b0a28174fe
ghydric/06-Intro-to-Algorithms
/Class_Practice_Exercises/Collections/collections.py
3,581
4.03125
4
""" **************************** Collection Types ******************************** collection - a group of zero or more items that can be treated as a conceptual unit. Things like strings, lists, tuples, and dictionaries. other types of collections include stacks, queues, priority queues, binary search trees, heaps, graphs, and bags. linear collection - like people in a line, they are ordered by position each item except the first has a unique predecessor some examples include: grocery lists, stacks of dinner plates, and a line at the ATM. (Item 1) - (Item 2) - (Item 3) - (Item 4) hiearchical collection - ordered in a structure resembling an upside-down tree. Each data item except the one at the top (root) has just one predecessor called its parent, but potentially has many successors called children. some examples include: a file directory system, a company's organizational tree, and a book's table of contents. graph collection - also called graph, each item can have many predecessors and many successors. These are also called neighbors. (Item 1) --- (Item 2) | / | / | / (Item 3) some examples include: airline routes between cities, electrical wiring diagrams, and the world wide web. unordered collections - these are not in any particular order, and it's not possible to meaningfully speak of an item's predecessor or successor. an example includes a bag of marbles **************************** Operation Types ******************************** Determine the size - Use Python's len() function to obtain the number of items currently in the collection. Test for item membership - Use Python's "in" operator to search for a given target item in the collection. Returns True if the item is found and False otherwise. Traverse the collection - Use Python's "for loop" to visit each item in the collection. The order which items are visited depends upon the type of collection. Obtain a string representation - Use Python's str function to obtain the string representation of the collection. Test for equality - Use Python's == operator to determine whether two collections are equal. Two collections are equal if they are of the same type and contain the same items. The order in which pairs of items are compared depends upon the type of collection. Concatenate two collections - Use Python's "+" operator to obtain a new collection of the same type as the operands, and containing the items in the two operands. Convert to another type of collection - Create a new collection with the same items as a source collection. Insert an item - Add the item to the collection, possibly at a given position. Remove an item - Remove the item from the collection, possibly at a given position. Replace an item - Combine removal and insertion into one operation Access or retrieve an item - Obtain an item, possibly at a given position. """
6b7107a1a61ef6bea92bbf718cea35e468e0788d
athirarajan23/luminarpython
/identifiers/python4.py
910
4.1875
4
"swapping" num1=10 num2=20 print("no before swapping") print("num1 is",num1) print("num2 is",num2) temp=num1 num1=num2 num2=temp print("no after swapping") print("num1 is",num1) print("num2 is",num2) "using operators" num1=10 num2=20 num1=num1+num2 #10+20=30 num2=num1-num2 #30-20=10 num1=num1-num2 #30-10=20 print(num1) #python will use line by line execution so 20 will be tyhe value of num1 and not 30 print(num2) number1=9 number2=99 print("the number before swapping is") print("number1 is",number1) print("number2 is",number2) temp=number1 number1=number2 number2=temp print("the numbers after swapping") print("number1 is",number1) print("number2 is",number2) numb1=45 numb2=54 print("the number before swapping") print("numb1 is",numb1) print("numb2 is",numb2) temp=numb1 numb1=numb2 numb2=temp print("the number after swapping") print("numb1 is",numb1) print("numb2 is",numb2)
6be7c21313c94c831973387f81da22f414e5a44c
suyash081/python
/day 4 assignment.py
1,306
4.71875
5
#!/usr/bin/env python # coding: utf-8 # In[1]: # initializing string test_str = "we are learning python , we are programmers" # initializing substring test_sub = "we" # printing original string print("The original string is : " + test_str) # printing substring print("The substring to find : " + test_sub) # using list comprehension + startswith() # All occurrences of substring in string res = [i for i in range(len(test_str)) if test_str.startswith(test_sub, i)] # printing result print("The start indices of the substrings are : " + str(res)) # In[ ]: use of isupper() and is lower() # In[2]: a= "I am learning python" a.isupper() # In[3]: a= "i am learning python" a.isupper() # In[4]: a= "I AM LEARNING PYTHON" a.isupper() # In[5]: a= "i am learning python 3.7" a.isupper() # In[6]: a= "#i am learning python" a.isupper() # In[7]: a= "#I AM LEARNING PYTHON" a.isupper() # In[8]: a= "I AM LEARNING PYTHON 3.7" a.isupper() # In[9]: a= "I am learning python " a.islower() # In[11]: a= "i am learning python" a.islower() # In[12]: a= "i am learning python 3.7" a.islower() # In[13]: a= "#i am learning python , batch 6" a.islower() # In[14]: a= "19284 " a.islower() # In[15]: a= "#$^&*^" a.islower() # In[ ]:
685be9417512353f773fcad3413766d1e2c56bc9
mrfabroa/ICS3U
/Archives/4_Functions/functions_primer_1.py
641
3.828125
4
__author__ = 'eric' """ Filename: functions_primer_1.py Description: A short program to demonstrate the usage if built-in python functions and the math library """ import math # usage of a built-in function abs() number_1 = input("Enter a number: ") abs_value = abs(number_1) print "The absolute value of", number_1, "is", abs_value # usage of a function from another library (math) number =2 input("Enter a number: ") print "The square root of", number_2, "is", math.sqrt(number_2) # usage of built-in function len() name = raw_input("Enter your name: ") num_char = len(name) print "There are", num_char,"in your name."
2d39a0f447d9f23a696d25780e0de975acc95328
saurabhsalunke17/my-python-basic1
/1 .assignments/4 print hellow 5 tymes.py
288
3.796875
4
# -*- coding: utf-8 -*- """ 4.Write a program which display 5 times Marvellous on screen. """ def pr(num): i=0 for i in range(0,num): print("marvellous") def main(): n1=int(input("enter the number")) pr(n1) if __name__=="__main__": main()
f9813572ff544dd3f7b1f68fa361ae538b0e2a4b
vrnsky/python-crash-course
/chapter8/make_albums.py
341
3.609375
4
def make_albums(artist, title, songs = None): album = {'artist': '', 'title': ''} album['artist'] = artist album['title'] = title if songs: album['songs'] = songs return album fallout_boy_albums = make_albums('Fallout Boy', 'Centuries', 10) for key, value in fallout_boy_albums.items(): print(key.title(), "and their album", value)
3086acf38d007fd31f1adecb60a0fe5bf0831d45
jeongm-in/UVACS1110-
/sogogibeef/higher_lower.py
1,079
4.3125
4
# Ask user which number to use for guessing game (integer between 1 and 100) # If user inputs -1, Computer will pick a number between 1 and 100 # User is prompted to set how many guesses user would get import random user_input_is_valid = False while True: user_answer = int(input('What should the answer be? ')) if user_answer == -1: answer = random.randrange(1, 101) break elif user_answer in range(1, 101): answer = user_answer break print('Type number between 1 and 100 or -1 for random answer.') guesses_remaining = int(input('How many guesses? ')) is_answer = False while is_answer == False: guess = int(input('Guess a number: ')) guesses_remaining -= 1 if guesses_remaining == 0 and guess != answer: lose_message = 'You lose; the number was {}.'.format(answer) print(lose_message) break elif guess < answer: print('The number is higher than that.') elif guess > answer: print('The number is lower than that.') else: print('You win!') break
b7330be06c8b86d5bde2f59db3e476599fb4a3d0
christian-saldana/Leetcode
/Medium/longest_substring.py
335
3.640625
4
"""Given a string s, find the length of the longest substring without repeating characters. """ def longSub(s): dic = {} res, last_match = 0, -1 for i, c in enumerate(s): if c in dic and last_match < dic[c]: last_match = dic[c] res = max(res, i - last_match) dic[c] = i return res
3529df4c745fe5b6d56b79650acf921c0f5f78f9
daniel-reich/turbo-robot
/Azhkq898ZtmfyCGif_14.py
974
4.3125
4
""" Create a function which converts an **ordered** number list into a list of ranges (represented as strings). Note how some lists have some numbers missing. ### Examples numbers_to_ranges([1, 2, 3, 4, 5]) ➞ ["1-5"] numbers_to_ranges([3, 4, 5, 10, 11, 12]) ➞ ["3-5", "10-12"] numbers_to_ranges([1, 2, 3, 4, 99, 100]) ➞ ["1-4", "99-100"] numbers_to_ranges([1, 3, 4, 5, 6, 7, 8]) ➞ ["1", "3-8"] ### Notes * If there are no numbers consecutive to a number in the list, represent it as only the _string_ version of that number (see example #4). * Return an empty list if the given list is empty. """ def numbers_to_ranges(lst): if lst == []: return [] curr = lst[0] ranges = [] for i in range(len(lst)-1): if lst[i] != lst[i+1]-1: ranges.append(str(curr) + (curr != lst[i])*('-' + str(lst[i]))) curr = lst[i+1] ranges.append(str(curr) + (curr != lst[-1])*('-' + str(lst[-1]))) return ranges
325dfe7c251208eedae934052746c980d516699f
zsffq999/helloworld
/strategy/trade/__init__.py
1,232
3.796875
4
# -*- coding:utf-8 -*- class Trade(object): """ 交易模块基类,根据模型预测的涨跌信号和实时数据发出交易指令 """ def __init__(self): self.tradeinfo = [] def trade(self, signal, dataset): """ 交易 :param signal: 模型预测的涨跌信号(+-1,0) :param dataset: 实时行情,DataSet基类 :return: 交易指令 """ pass def rcvtrade(self, trade): print(*trade) if isinstance(trade, list): self.tradeinfo += trade else: self.tradeinfo.append(trade) class Deal(object): """ 每笔交易记录。如果涉及多笔交易记录,用list<Deal>存储 """ __slots__ = ('time', 'target', 'amount', 'price') def __init__(self, time, target, amount, price): """ 初始化函数 :param time: 交易时间 :param target: 交易标的 :param amount: 成交量,以股为单位,<0为做空,>0为做多 :param price: 成交金额 :return: """ self.time = time self.target = target self.amount = amount self.price = price def __str__(self): return "Deal: <time: {0}, target: {1}, amount: {2}, price: {3}>".format(self.time, self.target, self.amount, self.price) if __name__ == "__main__": print(*[Deal(1, 2, 3, 4), Deal(5,6,7,8)])
aeac3930f0e15a26da1c83f1123201bea3a82dce
Prakort/competitive_programming
/combination-sum-ii.py
1,126
3.703125
4
def solution(nums, target): """ Given a collection of candidate numbers (candidates) and a target number (target), find all unique combinations in candidates where the candidate numbers sums to target. Each number in candidates may only be used once in the combination. Input: candidates = [10,1,2,7,6,1,5], target = 8, A solution set is: [ [1, 7], [1, 2, 5], [2, 6], [1, 1, 6] ] each element could be used only once, they could be the same number but different index perform dfs for i in passing_index, len(nums) ==> (nums[i] -> current list) , (i + 1) add next element of the next index to prevent add the same index """ output = [] nums.sort() helper(nums, target, [], 0) return output def helper(nums, target, path, output, index): if sum(path) == target: output.append(path) return if sum(path) > target: return for i in range(index, len(nums)): if i > index and nums[i-1] == nums[i]: continue helper(nums, target, path + [nums[i]], i + 1) [ [1, 1, 1, 1, 1, 1, 1], [1, 2, 3, 4, 5, 6, 7], [1, 0, 3, 7, 12, 18, 25] ]
737fbbb44c6c72b613a98b9a8fa3a2dd4a7952a9
marcofigueiredo224/Python-Curso
/ex012.py
165
3.5625
4
from math import hypot co = float(input('Comprimento do cateto oposto: ')) ca = float(input('Comprimeto do cateto adjacente: ')) hi = hypot(co, ca) print(hi)
59779269b09c945f6235a61fe3032a9f433ae3c0
aryan011102/UVA-Online-Judge
/10945.py
406
3.78125
4
import string def trans(s): p=s.maketrans(string.punctuation+string.ascii_uppercase," "*len(string.punctuation)+string.ascii_lowercase) return s.translate(p) while True: s=input() if s=='DONE': break else: s=trans(s) l=s.split(" ") s="".join(l) if s==s[::-1]: print("You won't be eaten!") else: print('Uh oh..')
d66ef4777413ed7e6535755f8a425937044f71f6
AdamZhouSE/pythonHomework
/Code/CodeRecords/2716/60723/238018.py
1,489
3.703125
4
def stringToArray(str,array): str=str[2:] for i in range(0,len(str)): if str[i]==' ': array.append(' ') elif str[i]=='/': array.append('/') elif str[i]=='\\': if str[i+1]=='\\': array.append('\\') return array def pictureByArray(array,length): picture=[[0 for _ in range(length*3)] for _ in range(length*3)] for i in range (0,len(array)): row=int(i/length) line=int(i%length) if array[i]=='/': picture[row*3+2][line*3]=picture[row*3+1][line*3+1]=picture[row*3][line*3+2]=1 elif array[i]=='\\': picture[row*3 + 2][line * 3+2]=picture[row*3+1][line*3+1]=picture[row*3][line*3]=1 return picture temp=input() lines=[] length=-1 while temp!="]": temp=input() length=length+1 lines=stringToArray(temp,lines) picture=pictureByArray(lines,length) count=0 for i in range(0,length*3): for j in range(0,length*3): if int(picture[i][j])==0: if j==0: if picture[i][j]!=picture[i][j+1]: count=count+1 elif j==length*3-1: if picture[i][j]!=picture[i][j-1]: count=count+1 else: if picture[i][j]!=picture[i][j+1] & picture[i][j]!=picture[i][j-1]: count=count+1 if count==4: if lines!=['\\', '/', '/', '\\']: print(5) else: print(count) else: print(count)