code
stringlengths
1
199k
import sys import os for path in [os.getcwd(),"SchemaExamples"]: sys.path.insert( 1, path ) #Pickup libs from shipped lib directory import logging logging.basicConfig(level=logging.INFO) # dev_appserver.py --log_level debug . log = logging.getLogger(__name__) from schemaexamples import SchemaExamples, Example SchemaExamples.loadExamplesFiles("default") print("Loaded %d examples " % (SchemaExamples.count())) log.info("Processing") changedFiles=[] changedCount = 0 for ex in SchemaExamples.allExamples(sort=True): if not ex.hasValidId(): ex.setKey(Example.nextId()) changedCount += 1 if not ex.getMeta('file') in changedFiles: changedFiles.append(ex.getMeta('file')) filename = "" f = None examples = SchemaExamples.allExamples(sort=True) log.info("Writing %s changed examples into %s files" % (changedCount,len(changedFiles))) OUTFILESUFFIX = "" #Overwrite sourcefiles for ex in examples: source = ex.getMeta('file') if source not in changedFiles: continue if source != filename: if f: f.close() filename = source fn = filename + OUTFILESUFFIX log.info("Writing %s" % fn) f = open(fn,"w") f.write(ex.serialize()) f.write("\n") if f: f.close()
"""Handling e-mail messages.""" import datetime import email.header import email.message import logging import typing as t import dateutil.parser from .connection import Connection _LOG = logging.getLogger(__name__) def recode_header(raw_data: t.Union[bytes, str]) -> str: """Normalize the header value.""" decoded_data = email.header.decode_header(raw_data) try: return email.header.make_header(decoded_data) except UnicodeDecodeError as err: try: return email.header.make_header([(decoded_data[0][0], 'utf-8')]) except: _LOG.exception('both "%s" and "utf-8" fail to decode the header', decoded_data[0][1]) raise ValueError(f'after decoding {raw_data!r}, obtained {decoded_data!r}' ' which cannot be re-made into a header') from err def is_name_and_address(text: str) -> bool: return '<' in text and '>' in text def split_name_and_address(text) -> tuple: if is_name_and_address(text): begin = text.rfind('<') end = text.rfind('>') assert begin < end return text[begin + 1:end], text[:begin] return text, None def recode_timezone_info(dt: datetime.datetime): name = dt.tzname() dst = dt.dst() dst = (' ' + dst) if dst != datetime.timedelta() else '' if name == 'UTC': return f'{name}{dst}' offset = dt.utcoffset() offset = ('+' if offset >= datetime.timedelta() else '') + str(offset.total_seconds() / 3600) if name is None or not name: return f'UTC{offset}{dst}' return f'{name} (UTC{offset}{dst})' class Message: """An e-mail message.""" def __init__(self, msg: email.message.EmailMessage = None, server: Connection = None, folder: str = None, msg_id: int = None): assert folder is None or isinstance(folder, str), type(folder) assert msg_id is None or isinstance(msg_id, int), type(msg_id) self._email_message = msg # type: email.message.EmailMessage self._origin_server = server # type: Connection self._origin_folder = folder # type: str self._origin_id = msg_id # type: int self.from_address = None # type: str self.from_name = None # type: str self.reply_to_address = None # type: str self.reply_to_name = None # type: str self.to_address = None # type: str self.to_name = None # type: str self.subject = None # type: str self.datetime = None # type: datetime.datetime self.timezone = None self.local_date = None self.local_time = None self.received = [] self.return_path = None self.envelope_to = None self.message_id = None self.content_type = None self.other_headers = [] self.flags = set() # type: t.Set[str] self.contents = [] self.attachments = [] if msg is not None: self._init_headers_from_email_message(msg) self._init_contents_from_email_message(msg) @property def date(self) -> datetime.date: if self.datetime is None: return None return self.datetime.date() @property def time(self) -> datetime.time: if self.datetime is None: return None return self.datetime.time() @property def is_read(self) -> bool: return 'Seen' in self.flags @property def is_unread(self) -> bool: return not self.is_read() @property def is_answered(self) -> bool: return 'Answered' in self.flags @property def is_flagged(self) -> bool: return 'Flagged' in self.flags @property def is_deleted(self) -> bool: return 'Deleted' in self.flags def _init_headers_from_email_message(self, msg: email.message.EmailMessage) -> None: for key, value in msg.items(): self._init_header_from_keyvalue(key, value) def _init_header_from_keyvalue(self, key: str, value: str) -> None: if key == 'From': self.from_address, self.from_name = split_name_and_address(str(recode_header(value))) elif key == 'Reply-To': self.reply_to_address, self.reply_to_name = split_name_and_address( str(recode_header(value))) elif key == 'To': self.to_address, self.to_name = split_name_and_address(str(recode_header(value))) elif key == 'Subject': self.subject = str(recode_header(value)) elif key == 'Date': self._init_datetime_from_header_value(value) elif key == 'Received': self.received.append(value) elif key == 'Return-Path': self.return_path = value elif key == 'Envelope-To': self.envelope_to = value elif key == 'Message-Id': self.message_id = value elif key == 'Content-Type': self.content_type = value else: self.other_headers.append((key, value)) def _init_datetime_from_header_value(self, value: str): self.datetime = None try: self.datetime = dateutil.parser.parse(value) except ValueError: try: self.datetime = dateutil.parser.parse(value, fuzzy=True) _LOG.debug( 'dateutil failed to parse string "%s" into a date/time,' ' using fuzzy=True results in: %s', value, self.datetime, exc_info=1) except ValueError: _LOG.debug( 'dateutil failed to parse string "%s" into a date/time,' ' even using fuzzy=True', value, exc_info=1) if self.datetime is not None: self.timezone = recode_timezone_info(self.datetime) def _init_contents_from_email_message(self, msg: email.message.EmailMessage) -> None: if not msg.get_payload(): return if msg.get_content_maintype() != 'multipart': self._init_contents_part(msg) return content_type = msg.get_content_type() parts = msg.get_payload() if isinstance(parts, str): _LOG.error('one of %i parts in a message is %s, but it has no subparts', len(parts), content_type) assert not parts, parts return assert isinstance(parts, list), type(parts) assert parts if content_type == 'multipart/alternative': if len(parts) > 1: _LOG.warning('taking last alternative of %i available in part type %s' ' - ignoring others', len(parts), content_type) self._init_contents_from_email_message(parts[-1]) elif content_type == 'multipart/related': if len(parts) > 1: _LOG.warning('taking only first part of %i available in part type %s' ' - ignoring related parts', len(parts), content_type) self._init_contents_from_email_message(parts[0]) elif content_type == 'multipart/mixed': for part in parts: self._init_contents_from_email_message(part) else: raise NotImplementedError(f'handling of "{content_type}" not implemented') def _init_contents_part(self, part: email.message.Message): content_type = part.get_content_type() if content_type not in {'text/plain', 'text/html'}: _LOG.info('treating message part with type %s as attachment', content_type) self.attachments.append(part) return charset = part.get_content_charset() if charset: text = part.get_payload(decode=True) try: text = text.decode(charset) except UnicodeDecodeError: _LOG.exception('failed to decode %i-character text using encoding "%s"', len(text), charset) else: text = part.get_payload() try: if isinstance(text, bytes): text = text.decode('utf-8') except UnicodeDecodeError: _LOG.exception('failed to decode %i-character text using encoding "%s"', len(text), 'utf-8') if not isinstance(text, str): _LOG.error('no content charset in a message %s in part %s -- attachment?', self.str_headers_compact(), part.as_bytes()[:128]) self.attachments.append(part) text = None if not text: return self.contents.append(text) def move_to(self, server: Connection, folder_name: str) -> None: """Move message to a specific folder on a specific server.""" assert isinstance(folder_name, str), type(folder_name) if server is not self._origin_server: from .imap_connection import IMAPConnection assert isinstance(self._origin_server, IMAPConnection), type(self._origin_server) assert isinstance(server, IMAPConnection), type(server) parts = self._origin_server.retrieve_message_parts( self._origin_id, ['UID', 'ENVELOPE', 'FLAGS', 'INTERNALDATE', 'BODY.PEEK[]'], self._origin_folder) _LOG.warning('moving %s between servers: from %s "%s" to %s "%s"', self, self._origin_server, self._origin_folder, server, folder_name) server.add_message(parts, folder_name) self._origin_server.delete_message(self._origin_id, self._origin_folder) return if folder_name == self._origin_folder: _LOG.debug('move_to() destination same as origin, nothing to do') return from .imap_connection import IMAPConnection assert isinstance(self._origin_server, IMAPConnection), type(self._origin_server) _LOG.warning('moving %s within same server %s: from "%s" to "%s"', self, self._origin_server, self._origin_folder, folder_name) self._origin_server.move_message(self._origin_id, folder_name, self._origin_folder) def copy_to(self, server: Connection, folder: str) -> None: raise NotImplementedError() def send_via(self, server: Connection) -> None: server.send_message(self._email_message) def str_oneline(self): return (f'{type(self).__name__}(From:{self.from_name}<{self.from_address}>,' f'To:{self.to_name}<{self.to_address}>,Subject:{self.subject},' f'DateAndTime:{self.datetime})') def str_headers(self): return '\n'.join([ f'From: {self.from_address}', f' {self.from_name}', f'Reply-To: {self.reply_to_address}', f' {self.reply_to_name}', f'To: {self.to_address}', f' {self.to_name}', f'Subject: {self.subject}', f'Date: {self.date}', f'Time: {self.time}', f'Timezone: {self.timezone}', f'Locally: {self.local_date}', f' {self.local_time}', # '', # ' Received: {}'.format(self.received), # ' Return-Path: {}'.format(self.return_path), # ' Envelope-To: {}'.format(self.envelope_to), # ' Message-Id: {}'.format(self.message_id), # ' Content-Type: {}'.format(self.content_type), # 'Other headers:', # '\n'.join([' {}: {}'.format(k, v) for k, v in self.other_headers]), ]) def str_headers_compact(self): return '\n'.join([ f'From: {self.from_address} {self.from_name}', f'Reply-To: {self.reply_to_address} {self.reply_to_name}', f'To: {self.to_address} {self.to_name}', f'Subject: {self.subject}', f'Datetime: {self.date} {self.time} {self.timezone}' ]) def str_quote(self): raise NotImplementedError() def str_forward(self): raise NotImplementedError() def str_complete(self): return '\n'.join([ self.str_headers(), '', f'id: {self._origin_id}', f'flags: {self.flags}', '', 'contents{}:'.format(f' (multipart, {len(self.contents)} parts)' if len(self.contents) > 1 else ''), 80*'=', (80*'=' + '\n').join(self.contents), 80*'=', ]) def __str__(self): return self.str_oneline() def __repr__(self): return self.str_headers_compact()
import proto # type: ignore from google.ads.googleads.v9.enums.types import ( response_content_type as gage_response_content_type, ) from google.ads.googleads.v9.resources.types import ( campaign_budget as gagr_campaign_budget, ) from google.protobuf import field_mask_pb2 # type: ignore from google.rpc import status_pb2 # type: ignore __protobuf__ = proto.module( package="google.ads.googleads.v9.services", marshal="google.ads.googleads.v9", manifest={ "GetCampaignBudgetRequest", "MutateCampaignBudgetsRequest", "CampaignBudgetOperation", "MutateCampaignBudgetsResponse", "MutateCampaignBudgetResult", }, ) class GetCampaignBudgetRequest(proto.Message): r"""Request message for [CampaignBudgetService.GetCampaignBudget][google.ads.googleads.v9.services.CampaignBudgetService.GetCampaignBudget]. Attributes: resource_name (str): Required. The resource name of the campaign budget to fetch. """ resource_name = proto.Field(proto.STRING, number=1,) class MutateCampaignBudgetsRequest(proto.Message): r"""Request message for [CampaignBudgetService.MutateCampaignBudgets][google.ads.googleads.v9.services.CampaignBudgetService.MutateCampaignBudgets]. Attributes: customer_id (str): Required. The ID of the customer whose campaign budgets are being modified. operations (Sequence[google.ads.googleads.v9.services.types.CampaignBudgetOperation]): Required. The list of operations to perform on individual campaign budgets. partial_failure (bool): If true, successful operations will be carried out and invalid operations will return errors. If false, all operations will be carried out in one transaction if and only if they are all valid. Default is false. validate_only (bool): If true, the request is validated but not executed. Only errors are returned, not results. response_content_type (google.ads.googleads.v9.enums.types.ResponseContentTypeEnum.ResponseContentType): The response content type setting. Determines whether the mutable resource or just the resource name should be returned post mutation. """ customer_id = proto.Field(proto.STRING, number=1,) operations = proto.RepeatedField( proto.MESSAGE, number=2, message="CampaignBudgetOperation", ) partial_failure = proto.Field(proto.BOOL, number=3,) validate_only = proto.Field(proto.BOOL, number=4,) response_content_type = proto.Field( proto.ENUM, number=5, enum=gage_response_content_type.ResponseContentTypeEnum.ResponseContentType, ) class CampaignBudgetOperation(proto.Message): r"""A single operation (create, update, remove) on a campaign budget. This message has `oneof`_ fields (mutually exclusive fields). For each oneof, at most one member field can be set at the same time. Setting any member of the oneof automatically clears all other members. .. _oneof: https://proto-plus-python.readthedocs.io/en/stable/fields.html#oneofs-mutually-exclusive-fields Attributes: update_mask (google.protobuf.field_mask_pb2.FieldMask): FieldMask that determines which resource fields are modified in an update. create (google.ads.googleads.v9.resources.types.CampaignBudget): Create operation: No resource name is expected for the new budget. This field is a member of `oneof`_ ``operation``. update (google.ads.googleads.v9.resources.types.CampaignBudget): Update operation: The campaign budget is expected to have a valid resource name. This field is a member of `oneof`_ ``operation``. remove (str): Remove operation: A resource name for the removed budget is expected, in this format: ``customers/{customer_id}/campaignBudgets/{budget_id}`` This field is a member of `oneof`_ ``operation``. """ update_mask = proto.Field( proto.MESSAGE, number=4, message=field_mask_pb2.FieldMask, ) create = proto.Field( proto.MESSAGE, number=1, oneof="operation", message=gagr_campaign_budget.CampaignBudget, ) update = proto.Field( proto.MESSAGE, number=2, oneof="operation", message=gagr_campaign_budget.CampaignBudget, ) remove = proto.Field(proto.STRING, number=3, oneof="operation",) class MutateCampaignBudgetsResponse(proto.Message): r"""Response message for campaign budget mutate. Attributes: partial_failure_error (google.rpc.status_pb2.Status): Errors that pertain to operation failures in the partial failure mode. Returned only when partial_failure = true and all errors occur inside the operations. If any errors occur outside the operations (e.g. auth errors), we return an RPC level error. results (Sequence[google.ads.googleads.v9.services.types.MutateCampaignBudgetResult]): All results for the mutate. """ partial_failure_error = proto.Field( proto.MESSAGE, number=3, message=status_pb2.Status, ) results = proto.RepeatedField( proto.MESSAGE, number=2, message="MutateCampaignBudgetResult", ) class MutateCampaignBudgetResult(proto.Message): r"""The result for the campaign budget mutate. Attributes: resource_name (str): Returned for successful operations. campaign_budget (google.ads.googleads.v9.resources.types.CampaignBudget): The mutated campaign budget with only mutable fields after mutate. The field will only be returned when response_content_type is set to "MUTABLE_RESOURCE". """ resource_name = proto.Field(proto.STRING, number=1,) campaign_budget = proto.Field( proto.MESSAGE, number=2, message=gagr_campaign_budget.CampaignBudget, ) __all__ = tuple(sorted(__protobuf__.manifest))
import sys data = sys.argv[1] java_file = open("vsense-ide/VSenseSDK/src/vsense_app/VSenseApp.java", "w") java_file.write(data) '''def isfloat(x): try: a = float(x) except ValueError: return False else: return True def isint(x): try: a = float(x) b = int(a) except ValueError: return False else: return a == b data = json.loads(sys.argv[1]) def forever(lines, value): lines = "while(true){" return lines def end(lines, value): lines += "}" return lines def repeat(lines, value): lines += "for(int i=0;i<"+str(value)+";i++){" return lines def wait(lines, value): lines += "try{Thread.sleep("+str(int(float(value)*1000))+");}catch(Exception e){System.out.println(e);}" return lines def init(lines, value): if (str(value[1]) == 'integer'): lines += "int "+str(value[0])+"=0;" return lines elif (str(value[1]) == 'float'): lines += "double "+str(value[0])+"=0.0;" return lines elif (str(value[1]) == 'string'): lines += "String "+str(value[0])+'="";' return lines def set_block(lines, value): lines += ""+str(value)+"=" return lines def var(lines, value): lines += str(value[0]) if(str(value[1]) == "true"): print value[1], 'dentro' lines += ";" return lines def num(lines, value): lines += str(value[0]) if(str(value[1]) == "true"): lines += ";" return lines def text(lines, value): lines += '"'+str(value[0])+'"' if(str(value[1]) == "true"): lines += ";" return lines def logic_operator(lines, value): if(str(value[0]) == "and"): lines += "&&" if(str(value[0]) == "or"): lines += "||" if(str(value[0]) == "not"): lines += "!" return lines def compare_operator(lines, value): if(str(value[0]) == "="): lines += "==" else: lines += str(value[0]) return lines def math_operator(lines, value): lines += str(value[0]) return lines def if_block(lines, value): lines += "if(" return lines def then_block(lines, value): lines += "){" return lines def else_block(lines, value): lines += "}else{" return lines blocks = { 'forever' : forever, 'end' : end, 'repeat' : repeat, 'wait' : wait, 'init' : init, 'set' : set_block, 'var' : var, 'num' : num, 'text' : text, 'logic_operator' : logic_operator, 'compare_operator' : compare_operator, 'math_operator' : math_operator, 'if' : if_block, 'then' : then_block, 'else' : else_block } middleSource = "" lines = "" for i in range(len(data)): id = str(data[i]['id']) value = data[i]['value'] middleSource += blocks[id](lines, value) templateOne = "import java.lang.Runtime;public class Main{public static void main(String args[]){" templateTwo = "}}" source = templateOne + middleSource + templateTwo''' print "http://www.ebay.com"
from application.extensions import db from configs.enum import TAG_TYPES __all__ = ['Tag'] class Tag(db.Document): meta = { 'db_alias': 'inventory_db', 'indexes': ['en'] } en = db.StringField(required=True, unique=True) cn = db.StringField() kind = db.StringField(required=True, choices=TAG_TYPES, default=TAG_TYPES.CATEGORY) def __unicode__(self): return '%s' % self.en @classmethod def get_tags(cls): return [dict(en=tag.en, cn=tag.cn) for tag in Tag.objects.all()] @classmethod def get_tag_or_create(cls, en, cn=None): if not Tag.objects(en=en): Tag(en=en, cn=cn, kind=TAG_TYPES.CATEGORY).save() @classmethod def update_cn(cls, en, cn): Tag.objects(en=en).update(set__cn=cn) def to_json(self): return dict( id=str(self.id), en=self.en, cn=self.cn, kind=self.kind)
from siconos.kernel import \ Model, MoreauJeanOSI, TimeDiscretisation, \ FrictionContact, NewtonImpactFrictionNSL import siconos.kernel as sk from siconos.mechanics.contact_detection.bullet import \ btConvexHullShape, btVector3, btCollisionObject, \ btBoxShape, btMatrix3x3, \ BulletSpaceFilter, \ BulletWeightedShape, BulletDS, BulletTimeStepping from numpy import zeros from numpy.linalg import norm t0 = 0 # start time T = 20 # end time h = 0.005 # time step g = 9.81 # gravity theta = 0.5 # theta scheme position_init = 10 velocity_init = 0 if (True): box = btConvexHullShape() box.addPoint(btVector3(-1.0, 1.0, -1.0)) box.addPoint(btVector3(-1.0, -1.0, -1.0)) box.addPoint(btVector3(-1.0, -1.0, 1.0)) box.addPoint(btVector3(-1.0, 1.0, 1.0)) box.addPoint(btVector3(1.0, 1.0, 1.0)) box.addPoint(btVector3(1.0, 1.0, -1.0)) box.addPoint(btVector3(1.0, -1.0, -1.0)) box.addPoint(btVector3(1.0, -1.0, 1.0)) else: box = btBoxShape(btVector3(1.0, 1.0, 1.0)) box1 = BulletWeightedShape(box, 1.0) body = BulletDS(box1, [0, 0, position_init, 1., 0, 0, 0], [0, 0, velocity_init, 0., 0., 0.]) weight = [0, 0, - box1.mass() * g] body.setFExtPtr(weight) bouncingBox = Model(t0, T) bouncingBox.nonSmoothDynamicalSystem().insertDynamicalSystem(body) osi = MoreauJeanOSI(theta) osi.insertDynamicalSystem(body) ground = btCollisionObject() ground.setCollisionFlags(btCollisionObject.CF_STATIC_OBJECT) groundShape = btBoxShape(btVector3(30, 30, .5)) basis = btMatrix3x3() basis.setIdentity() ground.getWorldTransform().setBasis(basis) ground.setCollisionShape(groundShape) ground.getWorldTransform().getOrigin().setZ(-.5) timedisc = TimeDiscretisation(t0, h) osnspb = FrictionContact(3) osnspb.numericsSolverOptions().iparam[0] = 1000 osnspb.numericsSolverOptions().dparam[0] = 1e-5 osnspb.setMStorageType(1) osnspb.setNumericsVerboseMode(False) osnspb.setKeepLambdaAndYState(True) nslaw = NewtonImpactFrictionNSL(0.8, 0., 0., 3) broadphase = BulletSpaceFilter(bouncingBox) broadphase.insert(nslaw, 0, 0) broadphase.collisionConfiguration().setConvexConvexMultipointIterations() broadphase.collisionConfiguration().setPlaneConvexMultipointIterations() broadphase.addStaticObject(ground, 0) simulation = BulletTimeStepping(timedisc) simulation.insertIntegrator(osi) simulation.insertNonSmoothProblem(osnspb) bouncingBox.initialize(simulation) N = (T - t0) / h dataPlot = zeros((N+1, 4)) q = body.q() v = body.velocity() dataPlot[0, 0] = t0 dataPlot[0, 1] = q[2] dataPlot[0, 2] = v[2] k = 1 while(simulation.hasNextEvent()): broadphase.buildInteractions(bouncingBox.currentTime()) simulation.computeOneStep() dataPlot[k, 0] = simulation.nextTime() dataPlot[k, 1] = q[2] dataPlot[k, 2] = v[2] if (broadphase.collisionWorld().getDispatcher().getNumManifolds() > 0): if bouncingBox.nonSmoothDynamicalSystem().topology().\ numberOfIndexSet() > 1: index1 = sk.interactions(simulation.indexSet(1)) if (len(index1) == 4): dataPlot[k, 3] = norm(index1[0].lambda_(1)) + \ norm(index1[1].lambda_(1)) + norm(index1[2].lambda_(1)) + \ norm(index1[3].lambda_(1)) k += 1 simulation.nextStep() from siconos.kernel import SimpleMatrix, getMatrix from numpy.linalg import norm ref = getMatrix(SimpleMatrix("result.ref")) print("norm(dataPlot - ref) = {0}".format(norm(dataPlot - ref))) if (norm(dataPlot - ref) > 1e-11): print("Warning. The result is rather different from the reference file.") from matplotlib.pyplot import subplot, title, plot, grid, show subplot(511) title('position') plot(dataPlot[0:k, 0], dataPlot[0:k, 1]) grid() subplot(513) title('velocity') plot(dataPlot[0:k, 0], dataPlot[0:k, 2]) grid() subplot(515) plot(dataPlot[0:k, 0], dataPlot[0:k, 3]) title('lambda') grid() show()
""" Views for managing Nova floating IPs. """ import logging from django import http from django.contrib import messages from django.utils.translation import ugettext as _ from horizon import api from horizon import forms from .forms import FloatingIpAssociate, FloatingIpAllocate LOG = logging.getLogger(__name__) class AssociateView(forms.ModalFormView): form_class = FloatingIpAssociate template_name = 'nova/access_and_security/floating_ips/associate.html' context_object_name = 'floating_ip' def get_object(self, *args, **kwargs): ip_id = kwargs['ip_id'] try: return api.tenant_floating_ip_get(self.request, ip_id) except Exception as e: LOG.exception('Error fetching floating ip with id "%s".' % ip_id) messages.error(self.request, _('Unable to associate floating ip: %s') % e) raise http.Http404("Floating IP %s not available." % ip_id) def get_initial(self): instances = [(server.id, 'id: %s, name: %s' % (server.id, server.name)) for server in api.server_list(self.request)] return {'floating_ip_id': self.object.id, 'floating_ip': self.object.ip, 'instances': instances} class AllocateView(forms.ModalFormView): form_class = FloatingIpAllocate template_name = 'nova/access_and_security/floating_ips/allocate.html' context_object_name = 'floating_ip' def get_initial(self): pools = api.floating_ip_pools_list(self.request) if pools: pool_list = [(pool.name, pool.name) for pool in api.floating_ip_pools_list(self.request)] else: pool_list = [(None, _("There are no Floating IP Pools"))] return {'tenant_id': self.request.user.tenant_id, 'pool_list': pool_list}
"""template URL Configuration The `urlpatterns` list routes URLs to views. For more information please see: https://docs.djangoproject.com/en/1.10/topics/http/urls/ Examples: Function views 1. Add an import: from my_app import views 2. Add a URL to urlpatterns: url(r'^$', views.home, name='home') Class-based views 1. Add an import: from other_app.views import Home 2. Add a URL to urlpatterns: url(r'^$', Home.as_view(), name='home') Including another URLconf 1. Import the include() function: from django.conf.urls import url, include 2. Add a URL to urlpatterns: url(r'^blog/', include('blog.urls')) """ from django.conf.urls import include from django.conf.urls import url from django.contrib import admin import views urlpatterns = [ url(r'^admin/', admin.site.urls), url(r'^web_app/', include('web_app.urls')), url(r'^', views.default_site), ]
"""Test for MetricsPlotsAndValidationsEvaluator.""" import os from absl.testing import parameterized import apache_beam as beam from apache_beam.testing import util import numpy as np import tensorflow as tf from tensorflow_model_analysis import constants from tensorflow_model_analysis.addons.fairness.metrics import lift from tensorflow_model_analysis.api import model_eval_lib from tensorflow_model_analysis.eval_saved_model import testutil from tensorflow_model_analysis.eval_saved_model.example_trainers import dnn_classifier from tensorflow_model_analysis.eval_saved_model.example_trainers import fixed_prediction_estimator_extra_fields from tensorflow_model_analysis.eval_saved_model.example_trainers import linear_classifier from tensorflow_model_analysis.eval_saved_model.example_trainers import multi_head from tensorflow_model_analysis.evaluators import metrics_plots_and_validations_evaluator from tensorflow_model_analysis.extractors import example_weights_extractor from tensorflow_model_analysis.extractors import features_extractor from tensorflow_model_analysis.extractors import labels_extractor from tensorflow_model_analysis.extractors import legacy_predict_extractor from tensorflow_model_analysis.extractors import predictions_extractor from tensorflow_model_analysis.extractors import slice_key_extractor from tensorflow_model_analysis.extractors import unbatch_extractor from tensorflow_model_analysis.metrics import attributions from tensorflow_model_analysis.metrics import binary_confusion_matrices from tensorflow_model_analysis.metrics import calibration from tensorflow_model_analysis.metrics import calibration_plot from tensorflow_model_analysis.metrics import confusion_matrix_plot from tensorflow_model_analysis.metrics import metric_specs from tensorflow_model_analysis.metrics import metric_types from tensorflow_model_analysis.metrics import ndcg from tensorflow_model_analysis.post_export_metrics import metrics as metric_fns from tensorflow_model_analysis.proto import config_pb2 from tensorflow_model_analysis.proto import validation_result_pb2 from tfx_bsl.tfxio import raw_tf_record from tfx_bsl.tfxio import tensor_adapter from tfx_bsl.tfxio import test_util from google.protobuf import text_format from tensorflow_metadata.proto.v0 import schema_pb2 _TF_MAJOR_VERSION = int(tf.version.VERSION.split('.')[0]) def _addExampleCountMetricCallback( # pylint: disable=invalid-name features_dict, predictions_dict, labels_dict): del features_dict del labels_dict metric_ops = {} value_op, update_op = metric_fns.total( tf.shape(input=predictions_dict['logits'])[0]) metric_ops['added_example_count'] = (value_op, update_op) return metric_ops class MetricsPlotsAndValidationsEvaluatorTest( testutil.TensorflowModelAnalysisTest, parameterized.TestCase): def _getExportDir(self): return os.path.join(self._getTempDir(), 'export_dir') def _getBaselineDir(self): return os.path.join(self._getTempDir(), 'baseline_export_dir') def _build_keras_model(self, model_name, model_dir, mul): input_layer = tf.keras.layers.Input(shape=(1,), name='input_1') output_layer = tf.keras.layers.Lambda( lambda x, mul: x * mul, output_shape=(1,), arguments={'mul': mul})( input_layer) model = tf.keras.models.Model([input_layer], output_layer) model.compile( optimizer=tf.keras.optimizers.Adam(lr=.001), loss=tf.keras.losses.BinaryCrossentropy(name='loss'), metrics=['accuracy']) model.save(model_dir, save_format='tf') return self.createTestEvalSharedModel( model_name=model_name, eval_saved_model_path=model_dir) def testFilterAndSeparateComputations(self): eval_config = config_pb2.EvalConfig( model_specs=[ config_pb2.ModelSpec(name='candidate', label_key='tips'), config_pb2.ModelSpec( name='baseline', label_key='tips', is_baseline=True) ], cross_slicing_specs=[config_pb2.CrossSlicingSpec()]) metrics_specs = metric_specs.specs_from_metrics( [ tf.keras.metrics.BinaryAccuracy(name='accuracy'), tf.keras.metrics.AUC(name='auc', num_thresholds=10000), tf.keras.metrics.AUC( name='auc_precison_recall', curve='PR', num_thresholds=10000), tf.keras.metrics.Precision(name='precision'), tf.keras.metrics.Recall(name='recall'), calibration.MeanLabel(name='mean_label'), calibration.MeanPrediction(name='mean_prediction'), calibration.Calibration(name='calibration'), confusion_matrix_plot.ConfusionMatrixPlot( name='confusion_matrix_plot'), calibration_plot.CalibrationPlot(name='calibration_plot'), lift.Lift(name='lift'), ], model_names=['candidate', 'baseline'], binarize=config_pb2.BinarizationOptions(class_ids={'values': [0, 5]})) computations = metric_specs.to_computations( metrics_specs, eval_config=eval_config) non_derived, derived, cross_slice, ci_derived = metrics_plots_and_validations_evaluator._filter_and_separate_computations( computations) # 2 models x 2 classes x _binary_confusion_matrix_[0.5]_100, # 2 models x 2 classes x _CalibrationHistogramCombiner # 2 models x 2 classes x _calibration_historgram_27 # 2 models x 2 classes x _CompilableMetricsCombiner, # 2 models x 2 classes x _WeightedLabelsPredictionsExamplesCombiner, # 4 models x _ExampleCountCombiner self.assertLen(non_derived, 20) # 2 models x 2 classes x _binary_confusion_matrices_[0.5], # 2 models x 2 classes x _binary_confusion_matrices_10000 # 2 models x 2 classes x _binary_confusion_matrices_confusion_matrix_plot # 2 models x 2 classes x precision # 2 models x 2 classes x recall # 2 models x 2 classes x calibration # 2 models x 2 classes x auc_precision_recall # 2 models x 2 classes x mean_prediction # 2 models x 2 classes x mean_label # 2 models x 2 classes x confusion_matrix_plot # 2 models x 2 classes x calibration_plot # 2 models x 2 classes x auc # 2 models x 2 classes x accuracy self.assertLen(derived, 52) # 2 models x 2 classes x lift self.assertLen(cross_slice, 4) # None of the metric has CIDerivedMetricComputation. self.assertEmpty(ci_derived) def testFilterAndSeparateComputationsWithCIDerivedMetrics(self): def derived_metric_fn(): pass def ci_derived_fn(): pass computations = [ metric_types.DerivedMetricComputation([metric_types.MetricKey('key1')], derived_metric_fn), metric_types.CIDerivedMetricComputation( [metric_types.MetricKey('key1')], ci_derived_fn), metric_types.CIDerivedMetricComputation( [metric_types.MetricKey('key1')], ci_derived_fn) ] _, derived, _, ci_derived = metrics_plots_and_validations_evaluator._filter_and_separate_computations( computations) self.assertLen(derived, 1) self.assertLen(ci_derived, 1) def testEvaluateWithKerasAndValidateMetrics(self): model_dir, baseline_dir = self._getExportDir(), self._getBaselineDir() eval_shared_model = self._build_keras_model('candidate', model_dir, mul=0) baseline_eval_shared_model = self._build_keras_model( 'baseline', baseline_dir, mul=1) schema = text_format.Parse( """ tensor_representation_group { key: "" value { tensor_representation { key: "input_1" value { dense_tensor { column_name: "input_1" shape { dim { size: 1 } } } } } } } feature { name: "input_1" type: FLOAT } feature { name: "label" type: FLOAT } feature { name: "example_weight" type: FLOAT } feature { name: "extra_feature" type: BYTES } """, schema_pb2.Schema()) tfx_io = test_util.InMemoryTFExampleRecord( schema=schema, raw_record_column_name=constants.ARROW_INPUT_COLUMN) tensor_adapter_config = tensor_adapter.TensorAdapterConfig( arrow_schema=tfx_io.ArrowSchema(), tensor_representations=tfx_io.TensorRepresentations()) examples = [ self._makeExample( input_1=0.0, label=1.0, example_weight=1.0, extra_feature='non_model_feature'), self._makeExample( input_1=1.0, label=0.0, example_weight=0.5, extra_feature='non_model_feature'), ] eval_config = config_pb2.EvalConfig( model_specs=[ config_pb2.ModelSpec( name='candidate', label_key='label', example_weight_key='example_weight'), config_pb2.ModelSpec( name='baseline', label_key='label', example_weight_key='example_weight', is_baseline=True) ], slicing_specs=[config_pb2.SlicingSpec()], metrics_specs=[ config_pb2.MetricsSpec( metrics=[ config_pb2.MetricConfig( class_name='ExampleCount', # 2 > 10, NOT OK. threshold=config_pb2.MetricThreshold( value_threshold=config_pb2.GenericValueThreshold( lower_bound={'value': 10}))), ], model_names=['candidate', 'baseline'], example_weights=config_pb2.ExampleWeightOptions( unweighted=True)), config_pb2.MetricsSpec( metrics=[ config_pb2.MetricConfig( class_name='WeightedExampleCount', # 1.5 < 1, NOT OK. threshold=config_pb2.MetricThreshold( value_threshold=config_pb2.GenericValueThreshold( upper_bound={'value': 1}))), ], model_names=['candidate', 'baseline'], example_weights=config_pb2.ExampleWeightOptions(weighted=True)), config_pb2.MetricsSpec( metrics=[ config_pb2.MetricConfig( class_name='MeanLabel', # 0 > 1 and 0 > 1?: NOT OK. threshold=config_pb2.MetricThreshold( change_threshold=config_pb2.GenericChangeThreshold( direction=config_pb2.MetricDirection .HIGHER_IS_BETTER, relative={'value': 1}, absolute={'value': 1}))), config_pb2.MetricConfig( # MeanPrediction = (0+0)/(1+0.5) = 0 class_name='MeanPrediction', # -.01 < 0 < .01, OK. # Diff% = -.333/.333 = -100% < -99%, OK. # Diff = 0 - .333 = -.333 < 0, OK. threshold=config_pb2.MetricThreshold( value_threshold=config_pb2.GenericValueThreshold( upper_bound={'value': .01}, lower_bound={'value': -.01}), change_threshold=config_pb2.GenericChangeThreshold( direction=config_pb2.MetricDirection .LOWER_IS_BETTER, relative={'value': -.99}, absolute={'value': 0}))) ], thresholds={ 'loss': config_pb2.MetricThreshold( value_threshold=config_pb2.GenericValueThreshold( upper_bound={'value': 0})) }, model_names=['candidate', 'baseline']), ], ) eval_shared_models = [eval_shared_model, baseline_eval_shared_model] extractors = [ features_extractor.FeaturesExtractor( eval_config=eval_config, tensor_representations=tensor_adapter_config.tensor_representations ), labels_extractor.LabelsExtractor(eval_config), example_weights_extractor.ExampleWeightsExtractor(eval_config), predictions_extractor.PredictionsExtractor( eval_shared_model=eval_shared_models, eval_config=eval_config, tensor_adapter_config=tensor_adapter_config), unbatch_extractor.UnbatchExtractor(), slice_key_extractor.SliceKeyExtractor(eval_config=eval_config) ] evaluators = [ metrics_plots_and_validations_evaluator .MetricsPlotsAndValidationsEvaluator( eval_config=eval_config, eval_shared_model=eval_shared_models) ] with beam.Pipeline() as pipeline: # pylint: disable=no-value-for-parameter evaluations = ( pipeline | 'Create' >> beam.Create([e.SerializeToString() for e in examples]) | 'BatchExamples' >> tfx_io.BeamSource() | 'InputsToExtracts' >> model_eval_lib.BatchedInputsToExtracts() | 'ExtractEvaluate' >> model_eval_lib.ExtractAndEvaluate( extractors=extractors, evaluators=evaluators)) # pylint: enable=no-value-for-parameter def check_validations(got): try: self.assertLen(got, 1) got = got[0] expected_metric_validations_per_slice = [ text_format.Parse( """ metric_key { name: "loss" model_name: "candidate" } metric_threshold { value_threshold { upper_bound { value: 0.0 } } } metric_value { double_value { value: 7.712474346160889 } } """, validation_result_pb2.ValidationFailure()), text_format.Parse( """ metric_key { name: "example_count" model_name: "candidate" example_weighted { } } metric_threshold { value_threshold { lower_bound { value: 10.0 } } } metric_value { double_value { value: 2.0 } } """, validation_result_pb2.ValidationFailure()), text_format.Parse( """ metric_key { name: "weighted_example_count" model_name: "candidate" example_weighted { value: true } } metric_threshold { value_threshold { upper_bound { value: 1.0 } } } metric_value { double_value { value: 1.5 } } """, validation_result_pb2.ValidationFailure()), text_format.Parse( """ metric_key { name: "mean_label" model_name: "candidate" is_diff: true example_weighted { value: true } } metric_threshold { change_threshold { absolute { value: 1.0 } relative { value: 1.0 } direction: HIGHER_IS_BETTER } } metric_value { double_value { value: 0.0 } } """, validation_result_pb2.ValidationFailure()), ] # Loss not supported in TFv1 if _TF_MAJOR_VERSION < 2: expected_metric_validations_per_slice[0].ClearField('metric_value') expected_metric_validations_per_slice[0].message = ( 'Metric not found.') self.assertFalse(got.validation_ok) self.assertLen(got.metric_validations_per_slice, 1) self.assertLen(got.metric_validations_per_slice[0].failures, len(expected_metric_validations_per_slice)) self.assertCountEqual(got.metric_validations_per_slice[0].failures, expected_metric_validations_per_slice) except AssertionError as err: raise util.BeamAssertException(err) util.assert_that(evaluations[constants.VALIDATIONS_KEY], check_validations) metric_filter = beam.metrics.metric.MetricsFilter().with_name( 'metric_computed_ExampleCount_v2_' + constants.TF_KERAS) actual_metrics_count = pipeline.run().metrics().query( filter=metric_filter)['counters'][0].committed self.assertEqual(actual_metrics_count, 1) def testEvaluateWithKerasAndDiffMetrics(self): model_dir, baseline_dir = self._getExportDir(), self._getBaselineDir() eval_shared_model = self._build_keras_model('candidate', model_dir, mul=0) baseline_eval_shared_model = self._build_keras_model( 'baseline', baseline_dir, mul=1) schema = text_format.Parse( """ tensor_representation_group { key: "" value { tensor_representation { key: "input_1" value { dense_tensor { column_name: "input_1" shape { dim { size: 1 } } } } } } } feature { name: "input_1" type: FLOAT } feature { name: "label" type: FLOAT } feature { name: "example_weight" type: FLOAT } feature { name: "extra_feature" type: BYTES } """, schema_pb2.Schema()) tfx_io = test_util.InMemoryTFExampleRecord( schema=schema, raw_record_column_name=constants.ARROW_INPUT_COLUMN) tensor_adapter_config = tensor_adapter.TensorAdapterConfig( arrow_schema=tfx_io.ArrowSchema(), tensor_representations=tfx_io.TensorRepresentations()) examples = [ self._makeExample( input_1=0.0, label=1.0, example_weight=1.0, extra_feature='non_model_feature'), self._makeExample( input_1=1.0, label=0.0, example_weight=0.5, extra_feature='non_model_feature'), ] eval_config = config_pb2.EvalConfig( model_specs=[ config_pb2.ModelSpec( name='candidate', label_key='label', example_weight_key='example_weight'), config_pb2.ModelSpec( name='baseline', label_key='label', example_weight_key='example_weight', is_baseline=True) ], slicing_specs=[config_pb2.SlicingSpec()], metrics_specs=metric_specs.specs_from_metrics( [ calibration.MeanLabel('mean_label'), calibration.MeanPrediction('mean_prediction') ], model_names=['candidate', 'baseline'])) eval_shared_models = [eval_shared_model, baseline_eval_shared_model] extractors = [ features_extractor.FeaturesExtractor( eval_config=eval_config, tensor_representations=tensor_adapter_config.tensor_representations ), labels_extractor.LabelsExtractor(eval_config), example_weights_extractor.ExampleWeightsExtractor(eval_config), predictions_extractor.PredictionsExtractor( eval_shared_model=eval_shared_models, eval_config=eval_config, tensor_adapter_config=tensor_adapter_config), unbatch_extractor.UnbatchExtractor(), slice_key_extractor.SliceKeyExtractor(eval_config=eval_config) ] evaluators = [ metrics_plots_and_validations_evaluator .MetricsPlotsAndValidationsEvaluator( eval_config=eval_config, eval_shared_model=eval_shared_models) ] with beam.Pipeline() as pipeline: # pylint: disable=no-value-for-parameter metrics = ( pipeline | 'Create' >> beam.Create([e.SerializeToString() for e in examples]) | 'BatchExamples' >> tfx_io.BeamSource() | 'InputsToExtracts' >> model_eval_lib.BatchedInputsToExtracts() | 'ExtractAndEvaluate' >> model_eval_lib.ExtractAndEvaluate( extractors=extractors, evaluators=evaluators)) # pylint: enable=no-value-for-parameter def check_metrics(got): try: self.assertLen(got, 1) got_slice_key, got_metrics = got[0] self.assertEqual(got_slice_key, ()) # check only the diff metrics. weighted_example_count_key = metric_types.MetricKey( name='weighted_example_count', model_name='candidate', is_diff=True, example_weighted=True) prediction_key = metric_types.MetricKey( name='mean_prediction', model_name='candidate', is_diff=True, example_weighted=True) label_key = metric_types.MetricKey( name='mean_label', model_name='candidate', is_diff=True, example_weighted=True) self.assertDictElementsAlmostEqual( got_metrics, { weighted_example_count_key: 0, label_key: 0, prediction_key: 0 - (0 * 1 + 1 * 0.5) / (1 + 0.5) }) except AssertionError as err: raise util.BeamAssertException(err) util.assert_that( metrics[constants.METRICS_KEY], check_metrics, label='metrics') def testEvaluateWithSlicing(self): temp_export_dir = self._getExportDir() _, export_dir = ( fixed_prediction_estimator_extra_fields .simple_fixed_prediction_estimator_extra_fields(None, temp_export_dir)) eval_config = config_pb2.EvalConfig( model_specs=[ config_pb2.ModelSpec( label_key='label', example_weight_key='fixed_float') ], slicing_specs=[ config_pb2.SlicingSpec(), config_pb2.SlicingSpec(feature_keys=['fixed_string']), ], metrics_specs=metric_specs.specs_from_metrics([ calibration.MeanLabel('mean_label'), calibration.MeanPrediction('mean_prediction') ])) eval_shared_model = self.createTestEvalSharedModel( eval_saved_model_path=export_dir) extractors = [ legacy_predict_extractor.PredictExtractor( eval_shared_model=eval_shared_model, eval_config=eval_config), unbatch_extractor.UnbatchExtractor(), slice_key_extractor.SliceKeyExtractor(eval_config=eval_config) ] evaluators = [ metrics_plots_and_validations_evaluator .MetricsPlotsAndValidationsEvaluator( eval_config=eval_config, eval_shared_model=eval_shared_model) ] # fixed_float used as example_weight key examples = [ self._makeExample( prediction=0.2, label=1.0, fixed_int=1, fixed_float=1.0, fixed_string='fixed_string1'), self._makeExample( prediction=0.8, label=0.0, fixed_int=1, fixed_float=1.0, fixed_string='fixed_string1'), self._makeExample( prediction=0.5, label=0.0, fixed_int=2, fixed_float=2.0, fixed_string='fixed_string2') ] tfx_io = raw_tf_record.RawBeamRecordTFXIO( physical_format='inmemory', raw_record_column_name=constants.ARROW_INPUT_COLUMN, telemetry_descriptors=['TFMATest']) with beam.Pipeline() as pipeline: # pylint: disable=no-value-for-parameter metrics = ( pipeline | 'Create' >> beam.Create([e.SerializeToString() for e in examples]) | 'BatchExamples' >> tfx_io.BeamSource() | 'InputsToExtracts' >> model_eval_lib.BatchedInputsToExtracts() | 'ExtractAndEvaluate' >> model_eval_lib.ExtractAndEvaluate( extractors=extractors, evaluators=evaluators)) # pylint: enable=no-value-for-parameter def check_metrics(got): try: self.assertLen(got, 3) slices = {} for slice_key, value in got: slices[slice_key] = value overall_slice = () fixed_string1_slice = (('fixed_string', b'fixed_string1'),) fixed_string2_slice = (('fixed_string', b'fixed_string2'),) self.asssertCountEqual( list(slices.keys()), [overall_slice, fixed_string1_slice, fixed_string2_slice]) weighted_example_count_key = metric_types.MetricKey( name='weighted_example_count', example_weighted=True) label_key = metric_types.MetricKey( name='mean_label', example_weighted=True) pred_key = metric_types.MetricKey( name='mean_prediction', example_weighted=True) self.assertDictElementsAlmostEqual( slices[overall_slice], { weighted_example_count_key: 4.0, label_key: (1.0 + 0.0 + 2 * 0.0) / (1.0 + 1.0 + 2.0), pred_key: (0.2 + 0.8 + 2 * 0.5) / (1.0 + 1.0 + 2.0), }) self.assertDictElementsAlmostEqual( slices[fixed_string1_slice], { weighted_example_count_key: 2.0, label_key: (1.0 + 0.0) / (1.0 + 1.0), pred_key: (0.2 + 0.8) / (1.0 + 1.0), }) self.assertDictElementsAlmostEqual( slices[fixed_string2_slice], { weighted_example_count_key: 2.0, label_key: (2 * 0.0) / 2.0, pred_key: (2 * 0.5) / 2.0, }) except AssertionError as err: raise util.BeamAssertException(err) util.assert_that( metrics[constants.METRICS_KEY], check_metrics, label='metrics') def testEvaluateWithAttributions(self): eval_config = config_pb2.EvalConfig( model_specs=[config_pb2.ModelSpec()], metrics_specs=[ config_pb2.MetricsSpec(metrics=[ config_pb2.MetricConfig(class_name=attributions .TotalAttributions().__class__.__name__) ]) ], options=config_pb2.Options( disabled_outputs={'values': ['eval_config_pb2.json']})) extractors = [slice_key_extractor.SliceKeyExtractor()] evaluators = [ metrics_plots_and_validations_evaluator .MetricsPlotsAndValidationsEvaluator(eval_config=eval_config) ] example1 = { 'labels': None, 'predictions': None, 'example_weights': np.array(1.0), 'features': {}, 'attributions': { 'feature1': 1.1, 'feature2': 1.2 } } example2 = { 'labels': None, 'predictions': None, 'example_weights': np.array(1.0), 'features': {}, 'attributions': { 'feature1': 2.1, 'feature2': 2.2 } } example3 = { 'labels': None, 'predictions': None, 'example_weights': np.array(1.0), 'features': {}, 'attributions': { 'feature1': np.array([3.1]), 'feature2': np.array([3.2]) } } with beam.Pipeline() as pipeline: # pylint: disable=no-value-for-parameter results = ( pipeline | 'Create' >> beam.Create([example1, example2, example3]) | 'ExtractEvaluate' >> model_eval_lib.ExtractAndEvaluate( extractors=extractors, evaluators=evaluators)) # pylint: enable=no-value-for-parameter def check_attributions(got): try: self.assertLen(got, 1) got_slice_key, got_attributions = got[0] self.assertEqual(got_slice_key, ()) total_attributions_key = metric_types.MetricKey( name='total_attributions') self.assertIn(total_attributions_key, got_attributions) self.assertDictElementsAlmostEqual( got_attributions[total_attributions_key], { 'feature1': (1.1 + 2.1 + 3.1), 'feature2': (1.2 + 2.2 + 3.2) }) except AssertionError as err: raise util.BeamAssertException(err) util.assert_that( results[constants.ATTRIBUTIONS_KEY], check_attributions, label='attributions') def testEvaluateWithConfidenceIntervals(self): # NOTE: This test does not actually test that confidence intervals are # accurate it only tests that the proto output by the test is well formed. # This test would pass if the confidence interval implementation did # nothing at all except compute the unsampled value. temp_export_dir = self._getExportDir() _, export_dir = ( fixed_prediction_estimator_extra_fields .simple_fixed_prediction_estimator_extra_fields(None, temp_export_dir)) options = config_pb2.Options() options.compute_confidence_intervals.value = True options.confidence_intervals.method = ( config_pb2.ConfidenceIntervalOptions.POISSON_BOOTSTRAP) eval_config = config_pb2.EvalConfig( model_specs=[ config_pb2.ModelSpec( label_key='label', example_weight_key='fixed_float') ], slicing_specs=[ config_pb2.SlicingSpec(), config_pb2.SlicingSpec(feature_keys=['fixed_string']), ], metrics_specs=metric_specs.specs_from_metrics([ calibration.MeanLabel('mean_label'), calibration.MeanPrediction('mean_prediction') ]), options=options) eval_shared_model = self.createTestEvalSharedModel( eval_saved_model_path=export_dir, tags=[tf.saved_model.SERVING]) extractors = [ features_extractor.FeaturesExtractor(eval_config), labels_extractor.LabelsExtractor(eval_config), example_weights_extractor.ExampleWeightsExtractor(eval_config), predictions_extractor.PredictionsExtractor( eval_shared_model=eval_shared_model, eval_config=eval_config), unbatch_extractor.UnbatchExtractor(), slice_key_extractor.SliceKeyExtractor(eval_config=eval_config) ] evaluators = [ metrics_plots_and_validations_evaluator .MetricsPlotsAndValidationsEvaluator( eval_config=eval_config, eval_shared_model=eval_shared_model) ] # fixed_float used as example_weight key examples = [ self._makeExample( prediction=0.2, label=1.0, fixed_int=1, fixed_float=1.0, fixed_string='fixed_string1'), self._makeExample( prediction=0.8, label=0.0, fixed_int=1, fixed_float=1.0, fixed_string='fixed_string1'), self._makeExample( prediction=0.5, label=0.0, fixed_int=2, fixed_float=2.0, fixed_string='fixed_string2') ] tfx_io = test_util.InMemoryTFExampleRecord( raw_record_column_name=constants.ARROW_INPUT_COLUMN) with beam.Pipeline() as pipeline: # pylint: disable=no-value-for-parameter metrics = ( pipeline | 'Create' >> beam.Create([e.SerializeToString() for e in examples]) | 'BatchExamples' >> tfx_io.BeamSource() | 'InputsToExtracts' >> model_eval_lib.BatchedInputsToExtracts() | 'ExtractAndEvaluate' >> model_eval_lib.ExtractAndEvaluate( extractors=extractors, evaluators=evaluators)) # pylint: enable=no-value-for-parameter def check_metrics(got): try: self.assertLen(got, 3) slices = {} for slice_key, value in got: slices[slice_key] = value overall_slice = () fixed_string1_slice = (('fixed_string', 'fixed_string1'),) fixed_string2_slice = (('fixed_string', 'fixed_string2'),) self.assertCountEqual( list(slices.keys()), [overall_slice, fixed_string1_slice, fixed_string2_slice]) example_count_key = metric_types.MetricKey(name='example_count') weighted_example_count_key = metric_types.MetricKey( name='weighted_example_count', example_weighted=True) label_key = metric_types.MetricKey( name='mean_label', example_weighted=True) pred_key = metric_types.MetricKey( name='mean_prediction', example_weighted=True) self.assertDictElementsAlmostEqual(slices[overall_slice], { example_count_key: 3, weighted_example_count_key: 4.0, }) self.assertDictElementsWithTDistributionAlmostEqual( slices[overall_slice], { label_key: (1.0 + 0.0 + 2 * 0.0) / (1.0 + 1.0 + 2.0), pred_key: (0.2 + 0.8 + 2 * 0.5) / (1.0 + 1.0 + 2.0), }) self.assertDictElementsAlmostEqual(slices[fixed_string1_slice], { example_count_key: 2, weighted_example_count_key: 2.0, }) self.assertDictElementsWithTDistributionAlmostEqual( slices[fixed_string1_slice], { label_key: (1.0 + 0.0) / (1.0 + 1.0), pred_key: (0.2 + 0.8) / (1.0 + 1.0), }) self.assertDictElementsAlmostEqual(slices[fixed_string2_slice], { example_count_key: 1, weighted_example_count_key: 2.0, }) self.assertDictElementsWithTDistributionAlmostEqual( slices[fixed_string2_slice], { label_key: (2 * 0.0) / 2.0, pred_key: (2 * 0.5) / 2.0, }) except AssertionError as err: raise util.BeamAssertException(err) util.assert_that( metrics[constants.METRICS_KEY], check_metrics, label='metrics') def testEvaluateWithJackknife(self): temp_export_dir = self._getExportDir() _, export_dir = ( fixed_prediction_estimator_extra_fields .simple_fixed_prediction_estimator_extra_fields(None, temp_export_dir)) options = config_pb2.Options() options.include_default_metrics.value = False options.compute_confidence_intervals.value = True options.confidence_intervals.method = ( config_pb2.ConfidenceIntervalOptions.JACKKNIFE) eval_config = config_pb2.EvalConfig( model_specs=[ config_pb2.ModelSpec( label_key='label', example_weight_key='fixed_float') ], slicing_specs=[ config_pb2.SlicingSpec(), config_pb2.SlicingSpec(feature_keys=['fixed_string']), ], metrics_specs=metric_specs.specs_from_metrics([ calibration.MeanLabel('mean_label'), calibration.MeanPrediction('mean_prediction') ]), options=options) eval_shared_model = self.createTestEvalSharedModel( eval_saved_model_path=export_dir, tags=[tf.saved_model.SERVING]) extractors = [ features_extractor.FeaturesExtractor(eval_config), labels_extractor.LabelsExtractor(eval_config), example_weights_extractor.ExampleWeightsExtractor(eval_config), predictions_extractor.PredictionsExtractor( eval_shared_model=eval_shared_model, eval_config=eval_config), unbatch_extractor.UnbatchExtractor(), slice_key_extractor.SliceKeyExtractor(eval_config=eval_config) ] evaluators = [ metrics_plots_and_validations_evaluator .MetricsPlotsAndValidationsEvaluator( eval_config=eval_config, eval_shared_model=eval_shared_model) ] # fixed_float used as example_weight key examples = [ self._makeExample( prediction=0.2, label=1.0, fixed_int=1, fixed_float=1.0, fixed_string='fixed_string1'), self._makeExample( prediction=0.8, label=0.0, fixed_int=1, fixed_float=1.0, fixed_string='fixed_string1'), self._makeExample( prediction=0.5, label=0.0, fixed_int=2, fixed_float=2.0, fixed_string='fixed_string2') ] tfx_io = test_util.InMemoryTFExampleRecord( raw_record_column_name=constants.ARROW_INPUT_COLUMN) with beam.Pipeline() as pipeline: # pylint: disable=no-value-for-parameter metrics = ( pipeline | 'Create' >> beam.Create( [e.SerializeToString() for e in examples * 1000]) | 'BatchExamples' >> tfx_io.BeamSource() | 'InputsToExtracts' >> model_eval_lib.BatchedInputsToExtracts() | 'ExtractAndEvaluate' >> model_eval_lib.ExtractAndEvaluate( extractors=extractors, evaluators=evaluators)) # pylint: enable=no-value-for-parameter def check_metrics(got): try: self.assertLen(got, 3) slices = {} for slice_key, value in got: slices[slice_key] = value overall_slice = () fixed_string1_slice = (('fixed_string', 'fixed_string1'),) fixed_string2_slice = (('fixed_string', 'fixed_string2'),) self.assertCountEqual( list(slices.keys()), [overall_slice, fixed_string1_slice, fixed_string2_slice]) example_count_key = metric_types.MetricKey(name='example_count') weighted_example_count_key = metric_types.MetricKey( name='weighted_example_count', example_weighted=True) label_key = metric_types.MetricKey( name='mean_label', example_weighted=True) pred_key = metric_types.MetricKey( name='mean_prediction', example_weighted=True) self.assertLen(slices[overall_slice], 4) self.assertDictElementsAlmostEqual(slices[overall_slice], { example_count_key: 3000, weighted_example_count_key: 4000.0 }) self.assertDictElementsWithTDistributionAlmostEqual( slices[overall_slice], { label_key: (1.0 + 0.0 + 2 * 0.0) / (1.0 + 1.0 + 2.0), pred_key: (0.2 + 0.8 + 2 * 0.5) / (1.0 + 1.0 + 2.0), }) self.assertDictElementsAlmostEqual( slices[fixed_string1_slice], {weighted_example_count_key: 2000.0}) self.assertDictElementsWithTDistributionAlmostEqual( slices[fixed_string1_slice], { label_key: (1.0 + 0.0) / (1.0 + 1.0), pred_key: (0.2 + 0.8) / (1.0 + 1.0), }) self.assertDictElementsAlmostEqual( slices[fixed_string2_slice], {weighted_example_count_key: 2000.0}) self.assertDictElementsWithTDistributionAlmostEqual( slices[fixed_string2_slice], { label_key: (2 * 0.0) / 2.0, pred_key: (2 * 0.5) / 2.0, }) except AssertionError as err: raise util.BeamAssertException(err) util.assert_that(metrics[constants.METRICS_KEY], check_metrics) def testEvaluateWithJackknifeAndDiffMetrics(self): model_dir, baseline_dir = self._getExportDir(), self._getBaselineDir() eval_shared_model = self._build_keras_model('candidate', model_dir, mul=0) baseline_eval_shared_model = self._build_keras_model( 'baseline', baseline_dir, mul=1) options = config_pb2.Options() options.compute_confidence_intervals.value = True options.confidence_intervals.method = ( config_pb2.ConfidenceIntervalOptions.JACKKNIFE) eval_config = config_pb2.EvalConfig( model_specs=[ config_pb2.ModelSpec( name='candidate', label_key='label', example_weight_key='example_weight'), config_pb2.ModelSpec( name='baseline', label_key='label', example_weight_key='example_weight', is_baseline=True) ], slicing_specs=[config_pb2.SlicingSpec()], metrics_specs=metric_specs.specs_from_metrics( [ calibration.MeanLabel('mean_label'), calibration.MeanPrediction('mean_prediction') ], model_names=['candidate', 'baseline']), options=options) eval_shared_models = { 'candidate': eval_shared_model, 'baseline': baseline_eval_shared_model } schema = text_format.Parse( """ tensor_representation_group { key: "" value { tensor_representation { key: "input_1" value { dense_tensor { column_name: "input_1" shape { dim { size: 1 } } } } } } } feature { name: "input_1" type: FLOAT } feature { name: "label" type: FLOAT } feature { name: "example_weight" type: FLOAT } feature { name: "extra_feature" type: BYTES } """, schema_pb2.Schema()) tfx_io = test_util.InMemoryTFExampleRecord( schema=schema, raw_record_column_name=constants.ARROW_INPUT_COLUMN) tensor_adapter_config = tensor_adapter.TensorAdapterConfig( arrow_schema=tfx_io.ArrowSchema(), tensor_representations=tfx_io.TensorRepresentations()) examples = [ self._makeExample( input_1=0.0, label=1.0, example_weight=1.0, extra_feature='non_model_feature'), self._makeExample( input_1=1.0, label=0.0, example_weight=0.5, extra_feature='non_model_feature'), ] extractors = [ features_extractor.FeaturesExtractor( eval_config=eval_config, tensor_representations=tensor_adapter_config.tensor_representations ), labels_extractor.LabelsExtractor(eval_config), example_weights_extractor.ExampleWeightsExtractor(eval_config), predictions_extractor.PredictionsExtractor( eval_shared_model=eval_shared_models, eval_config=eval_config, tensor_adapter_config=tensor_adapter_config), unbatch_extractor.UnbatchExtractor(), slice_key_extractor.SliceKeyExtractor(eval_config=eval_config) ] evaluators = [ metrics_plots_and_validations_evaluator .MetricsPlotsAndValidationsEvaluator( eval_config=eval_config, eval_shared_model=eval_shared_models) ] with beam.Pipeline() as pipeline: # pylint: disable=no-value-for-parameter metrics = ( pipeline | 'Create' >> beam.Create( [e.SerializeToString() for e in examples * 1000]) | 'BatchExamples' >> tfx_io.BeamSource() | 'InputsToExtracts' >> model_eval_lib.BatchedInputsToExtracts() | 'ExtractAndEvaluate' >> model_eval_lib.ExtractAndEvaluate( extractors=extractors, evaluators=evaluators)) # pylint: enable=no-value-for-parameter def check_metrics(got): try: self.assertLen(got, 1) got_slice_key, got_metrics = got[0] self.assertEqual(got_slice_key, ()) # check only the diff metrics. weighted_example_count_key = metric_types.MetricKey( name='weighted_example_count', model_name='candidate', is_diff=True, example_weighted=True) prediction_key = metric_types.MetricKey( name='mean_prediction', model_name='candidate', is_diff=True, example_weighted=True) label_key = metric_types.MetricKey( name='mean_label', model_name='candidate', is_diff=True, example_weighted=True) self.assertDictElementsWithTDistributionAlmostEqual( got_metrics, { weighted_example_count_key: 0, label_key: 0, prediction_key: 0 - (0 * 1 + 1 * 0.5) / (1 + 0.5) }) except AssertionError as err: raise util.BeamAssertException(err) util.assert_that(metrics[constants.METRICS_KEY], check_metrics) def testEvaluateWithRegressionModel(self): temp_export_dir = self._getExportDir() _, export_dir = ( fixed_prediction_estimator_extra_fields .simple_fixed_prediction_estimator_extra_fields(None, temp_export_dir)) eval_config = config_pb2.EvalConfig( model_specs=[ config_pb2.ModelSpec( label_key='label', example_weight_key='fixed_float') ], slicing_specs=[config_pb2.SlicingSpec()], metrics_specs=metric_specs.specs_from_metrics([ calibration.MeanLabel('mean_label'), calibration.MeanPrediction('mean_prediction') ])) eval_shared_model = self.createTestEvalSharedModel( eval_saved_model_path=export_dir, tags=[tf.saved_model.SERVING]) extractors = [ features_extractor.FeaturesExtractor(eval_config), labels_extractor.LabelsExtractor(eval_config), example_weights_extractor.ExampleWeightsExtractor(eval_config), predictions_extractor.PredictionsExtractor( eval_shared_model=eval_shared_model, eval_config=eval_config), unbatch_extractor.UnbatchExtractor(), slice_key_extractor.SliceKeyExtractor(eval_config=eval_config) ] evaluators = [ metrics_plots_and_validations_evaluator .MetricsPlotsAndValidationsEvaluator( eval_config=eval_config, eval_shared_model=eval_shared_model) ] # fixed_float used as example_weight key examples = [ self._makeExample( prediction=0.2, label=1.0, fixed_int=1, fixed_float=1.0, fixed_string='fixed_string1'), self._makeExample( prediction=0.8, label=0.0, fixed_int=1, fixed_float=1.0, fixed_string='fixed_string1'), self._makeExample( prediction=0.5, label=0.0, fixed_int=2, fixed_float=2.0, fixed_string='fixed_string2') ] tfx_io = test_util.InMemoryTFExampleRecord( raw_record_column_name=constants.ARROW_INPUT_COLUMN) with beam.Pipeline() as pipeline: # pylint: disable=no-value-for-parameter metrics = ( pipeline | 'Create' >> beam.Create([e.SerializeToString() for e in examples]) | 'BatchExamples' >> tfx_io.BeamSource() | 'InputsToExtracts' >> model_eval_lib.BatchedInputsToExtracts() | 'ExtractAndEvaluate' >> model_eval_lib.ExtractAndEvaluate( extractors=extractors, evaluators=evaluators)) # pylint: enable=no-value-for-parameter def check_metrics(got): try: self.assertLen(got, 1) got_slice_key, got_metrics = got[0] example_count_key = metric_types.MetricKey(name='example_count') weighted_example_count_key = metric_types.MetricKey( name='weighted_example_count', example_weighted=True) label_key = metric_types.MetricKey( name='mean_label', example_weighted=True) pred_key = metric_types.MetricKey( name='mean_prediction', example_weighted=True) self.assertEqual(got_slice_key, ()) self.assertDictElementsAlmostEqual( got_metrics, { example_count_key: 3, weighted_example_count_key: 4.0, label_key: (1.0 + 0.0 + 2 * 0.0) / (1.0 + 1.0 + 2.0), pred_key: (0.2 + 0.8 + 2 * 0.5) / (1.0 + 1.0 + 2.0), }) except AssertionError as err: raise util.BeamAssertException(err) util.assert_that( metrics[constants.METRICS_KEY], check_metrics, label='metrics') def testEvaluateWithCrossSliceLiftMetric(self): temp_export_dir = self._getExportDir() _, export_dir = ( fixed_prediction_estimator_extra_fields .simple_fixed_prediction_estimator_extra_fields(None, temp_export_dir)) eval_config = config_pb2.EvalConfig( model_specs=[ config_pb2.ModelSpec( label_key='label', example_weight_key='fixed_float') ], slicing_specs=[ config_pb2.SlicingSpec( feature_values={'fixed_string': 'fixed_string1'}), config_pb2.SlicingSpec( feature_values={'fixed_string': 'fixed_string2'}) ], cross_slicing_specs=[ config_pb2.CrossSlicingSpec( baseline_spec=config_pb2.SlicingSpec( feature_values={'fixed_string': 'fixed_string1'}), slicing_specs=[ config_pb2.SlicingSpec( feature_values={'fixed_string': 'fixed_string2'}) ]), ], metrics_specs=metric_specs.specs_from_metrics( [lift.Lift(num_buckets=3)])) eval_shared_model = self.createTestEvalSharedModel( eval_saved_model_path=export_dir, tags=[tf.saved_model.SERVING]) extractors = [ features_extractor.FeaturesExtractor(eval_config), labels_extractor.LabelsExtractor(eval_config), example_weights_extractor.ExampleWeightsExtractor(eval_config), predictions_extractor.PredictionsExtractor( eval_shared_model=eval_shared_model, eval_config=eval_config), unbatch_extractor.UnbatchExtractor(), slice_key_extractor.SliceKeyExtractor(eval_config=eval_config) ] evaluators = [ metrics_plots_and_validations_evaluator .MetricsPlotsAndValidationsEvaluator( eval_config=eval_config, eval_shared_model=eval_shared_model) ] # fixed_float used as example_weight key examples = [ self._makeExample( prediction=0.1, label=0.0, fixed_int=1, fixed_float=3.0, fixed_string='fixed_string1'), self._makeExample( prediction=0.5, label=0.3, fixed_int=1, fixed_float=5.0, fixed_string='fixed_string1'), self._makeExample( prediction=0.8, label=0.6, fixed_int=2, fixed_float=2.0, fixed_string='fixed_string1'), self._makeExample( prediction=0.3, label=0.9, fixed_int=1, fixed_float=8.0, fixed_string='fixed_string1'), self._makeExample( prediction=0.9, label=1.0, fixed_int=1, fixed_float=3.0, fixed_string='fixed_string1'), self._makeExample( prediction=0.8, label=0.0, fixed_int=2, fixed_float=1.0, fixed_string='fixed_string2'), self._makeExample( prediction=0.3, label=0.2, fixed_int=1, fixed_float=2.0, fixed_string='fixed_string2'), self._makeExample( prediction=0.5, label=0.5, fixed_int=1, fixed_float=5.0, fixed_string='fixed_string2'), self._makeExample( prediction=0.4, label=0.7, fixed_int=2, fixed_float=2.0, fixed_string='fixed_string2'), self._makeExample( prediction=0.3, label=1.0, fixed_int=2, fixed_float=3.0, fixed_string='fixed_string2') ] tfx_io = test_util.InMemoryTFExampleRecord( raw_record_column_name=constants.ARROW_INPUT_COLUMN) with beam.Pipeline() as pipeline: # pylint: disable=no-value-for-parameter metrics = ( pipeline | 'Create' >> beam.Create([e.SerializeToString() for e in examples]) | 'BatchExamples' >> tfx_io.BeamSource() | 'InputsToExtracts' >> model_eval_lib.BatchedInputsToExtracts() | 'ExtractAndEvaluate' >> model_eval_lib.ExtractAndEvaluate( extractors=extractors, evaluators=evaluators)) # pylint: enable=no-value-for-parameter def check_metrics(got): try: self.assertLen(got, 3) example_count_key = metric_types.MetricKey(name='example_count') weighted_example_count_key = metric_types.MetricKey( name='weighted_example_count', example_weighted=True) lift_key = metric_types.MetricKey( name='lift@3', example_weighted=True) for slice_key, metrics in got: if slice_key == (('fixed_string', 'fixed_string1'),): self.assertDictElementsAlmostEqual(metrics, { example_count_key: 5.0, weighted_example_count_key: 21.0, }) elif slice_key == (('fixed_string', 'fixed_string2'),): self.assertDictElementsAlmostEqual(metrics, { weighted_example_count_key: 13.0, example_count_key: 5.0, }) else: self.assertDictElementsAlmostEqual( metrics, { example_count_key: 0.0, weighted_example_count_key: 8.0, lift_key: -0.211538456165, }) except AssertionError as err: raise util.BeamAssertException(err) util.assert_that( metrics[constants.METRICS_KEY], check_metrics, label='metrics') def testEvaluateWithBinaryClassificationModel(self): n_classes = 2 temp_export_dir = self._getExportDir() _, export_dir = dnn_classifier.simple_dnn_classifier( None, temp_export_dir, n_classes=n_classes) # Add mean_label, example_count, weighted_example_count, calibration_plot eval_config = config_pb2.EvalConfig( model_specs=[ config_pb2.ModelSpec(label_key='label', example_weight_key='age') ], slicing_specs=[config_pb2.SlicingSpec()], metrics_specs=metric_specs.specs_from_metrics([ calibration.MeanLabel('mean_label'), calibration_plot.CalibrationPlot( name='calibration_plot', num_buckets=10) ])) eval_shared_model = self.createTestEvalSharedModel( eval_saved_model_path=export_dir, tags=[tf.saved_model.SERVING]) extractors = [ features_extractor.FeaturesExtractor(eval_config), labels_extractor.LabelsExtractor(eval_config), example_weights_extractor.ExampleWeightsExtractor(eval_config), predictions_extractor.PredictionsExtractor( eval_shared_model=eval_shared_model, eval_config=eval_config), unbatch_extractor.UnbatchExtractor(), slice_key_extractor.SliceKeyExtractor(eval_config=eval_config) ] evaluators = [ metrics_plots_and_validations_evaluator .MetricsPlotsAndValidationsEvaluator( eval_config=eval_config, eval_shared_model=eval_shared_model) ] examples = [ self._makeExample(age=1.0, language='english', label=0.0), self._makeExample(age=2.0, language='chinese', label=1.0), self._makeExample(age=3.0, language='chinese', label=0.0), ] tfx_io = test_util.InMemoryTFExampleRecord( raw_record_column_name=constants.ARROW_INPUT_COLUMN) with beam.Pipeline() as pipeline: # pylint: disable=no-value-for-parameter metrics_and_plots = ( pipeline | 'Create' >> beam.Create([e.SerializeToString() for e in examples]) | 'BatchExamples' >> tfx_io.BeamSource() | 'InputsToExtracts' >> model_eval_lib.BatchedInputsToExtracts() | 'ExtractAndEvaluate' >> model_eval_lib.ExtractAndEvaluate( extractors=extractors, evaluators=evaluators)) # pylint: enable=no-value-for-parameter def check_metrics(got): try: self.assertLen(got, 1) got_slice_key, got_metrics = got[0] self.assertEqual(got_slice_key, ()) example_count_key = metric_types.MetricKey(name='example_count') weighted_example_count_key = metric_types.MetricKey( name='weighted_example_count', example_weighted=True) label_key = metric_types.MetricKey( name='mean_label', example_weighted=True) self.assertDictElementsAlmostEqual( got_metrics, { example_count_key: 3, weighted_example_count_key: (1.0 + 2.0 + 3.0), label_key: (0 * 1.0 + 1 * 2.0 + 0 * 3.0) / (1.0 + 2.0 + 3.0), }) except AssertionError as err: raise util.BeamAssertException(err) def check_plots(got): try: self.assertLen(got, 1) got_slice_key, got_plots = got[0] self.assertEqual(got_slice_key, ()) plot_key = metric_types.PlotKey( 'calibration_plot', example_weighted=True) self.assertIn(plot_key, got_plots) # 10 buckets + 2 for edge cases self.assertLen(got_plots[plot_key].buckets, 12) except AssertionError as err: raise util.BeamAssertException(err) util.assert_that( metrics_and_plots[constants.METRICS_KEY], check_metrics, label='metrics') util.assert_that( metrics_and_plots[constants.PLOTS_KEY], check_plots, label='plots') def testEvaluateWithMultiClassModel(self): n_classes = 3 temp_export_dir = self._getExportDir() _, export_dir = dnn_classifier.simple_dnn_classifier( None, temp_export_dir, n_classes=n_classes) # Add example_count and weighted_example_count eval_config = config_pb2.EvalConfig( model_specs=[ config_pb2.ModelSpec(label_key='label', example_weight_key='age') ], slicing_specs=[config_pb2.SlicingSpec()], metrics_specs=metric_specs.specs_from_metrics( [calibration.MeanLabel('mean_label')], binarize=config_pb2.BinarizationOptions( class_ids={'values': range(n_classes)}))) eval_shared_model = self.createTestEvalSharedModel( eval_saved_model_path=export_dir, tags=[tf.saved_model.SERVING]) extractors = [ features_extractor.FeaturesExtractor(eval_config), labels_extractor.LabelsExtractor(eval_config), example_weights_extractor.ExampleWeightsExtractor(eval_config), predictions_extractor.PredictionsExtractor( eval_shared_model=eval_shared_model, eval_config=eval_config), unbatch_extractor.UnbatchExtractor(), slice_key_extractor.SliceKeyExtractor(eval_config=eval_config) ] evaluators = [ metrics_plots_and_validations_evaluator .MetricsPlotsAndValidationsEvaluator( eval_config=eval_config, eval_shared_model=eval_shared_model) ] examples = [ self._makeExample(age=1.0, language='english', label=0), self._makeExample(age=2.0, language='chinese', label=1), self._makeExample(age=3.0, language='english', label=2), self._makeExample(age=4.0, language='chinese', label=1), ] tfx_io = test_util.InMemoryTFExampleRecord( raw_record_column_name=constants.ARROW_INPUT_COLUMN) with beam.Pipeline() as pipeline: # pylint: disable=no-value-for-parameter metrics = ( pipeline | 'Create' >> beam.Create([e.SerializeToString() for e in examples]) | 'BatchExamples' >> tfx_io.BeamSource() | 'InputsToExtracts' >> model_eval_lib.BatchedInputsToExtracts() | 'ExtractAndEvaluate' >> model_eval_lib.ExtractAndEvaluate( extractors=extractors, evaluators=evaluators)) # pylint: enable=no-value-for-parameter def check_metrics(got): try: self.assertLen(got, 1) got_slice_key, got_metrics = got[0] example_count_key = metric_types.MetricKey(name='example_count') weighted_example_count_key = metric_types.MetricKey( name='weighted_example_count', example_weighted=True) label_key_class_0 = metric_types.MetricKey( name='mean_label', sub_key=metric_types.SubKey(class_id=0), example_weighted=True) label_key_class_1 = metric_types.MetricKey( name='mean_label', sub_key=metric_types.SubKey(class_id=1), example_weighted=True) label_key_class_2 = metric_types.MetricKey( name='mean_label', sub_key=metric_types.SubKey(class_id=2), example_weighted=True) self.assertEqual(got_slice_key, ()) self.assertDictElementsAlmostEqual( got_metrics, { example_count_key: 4, weighted_example_count_key: (1.0 + 2.0 + 3.0 + 4.0), label_key_class_0: (1 * 1.0 + 0 * 2.0 + 0 * 3.0 + 0 * 4.0) / (1.0 + 2.0 + 3.0 + 4.0), label_key_class_1: (0 * 1.0 + 1 * 2.0 + 0 * 3.0 + 1 * 4.0) / (1.0 + 2.0 + 3.0 + 4.0), label_key_class_2: (0 * 1.0 + 0 * 2.0 + 1 * 3.0 + 0 * 4.0) / (1.0 + 2.0 + 3.0 + 4.0) }) except AssertionError as err: raise util.BeamAssertException(err) util.assert_that( metrics[constants.METRICS_KEY], check_metrics, label='metrics') def testEvaluateWithMultiOutputModel(self): temp_export_dir = self._getExportDir() _, export_dir = multi_head.simple_multi_head(None, temp_export_dir) eval_config = config_pb2.EvalConfig( model_specs=[ config_pb2.ModelSpec( label_keys={ 'chinese_head': 'chinese_label', 'english_head': 'english_label', 'other_head': 'other_label' }, example_weight_keys={ 'chinese_head': 'age', 'english_head': 'age', 'other_head': 'age' }) ], slicing_specs=[config_pb2.SlicingSpec()], metrics_specs=metric_specs.specs_from_metrics({ 'chinese_head': [calibration.MeanLabel('mean_label')], 'english_head': [calibration.MeanLabel('mean_label')], 'other_head': [calibration.MeanLabel('mean_label')], })) eval_shared_model = self.createTestEvalSharedModel( eval_saved_model_path=export_dir, tags=[tf.saved_model.SERVING]) extractors = [ features_extractor.FeaturesExtractor(eval_config), labels_extractor.LabelsExtractor(eval_config), example_weights_extractor.ExampleWeightsExtractor(eval_config), predictions_extractor.PredictionsExtractor( eval_shared_model=eval_shared_model, eval_config=eval_config), unbatch_extractor.UnbatchExtractor(), slice_key_extractor.SliceKeyExtractor(eval_config=eval_config) ] evaluators = [ metrics_plots_and_validations_evaluator .MetricsPlotsAndValidationsEvaluator( eval_config=eval_config, eval_shared_model=eval_shared_model) ] examples = [ self._makeExample( age=1.0, language='english', english_label=1.0, chinese_label=0.0, other_label=0.0), self._makeExample( age=1.0, language='chinese', english_label=0.0, chinese_label=1.0, other_label=0.0), self._makeExample( age=2.0, language='english', english_label=1.0, chinese_label=0.0, other_label=0.0), self._makeExample( age=2.0, language='other', english_label=0.0, chinese_label=1.0, other_label=1.0), ] tfx_io = test_util.InMemoryTFExampleRecord( raw_record_column_name=constants.ARROW_INPUT_COLUMN) with beam.Pipeline() as pipeline: # pylint: disable=no-value-for-parameter metrics = ( pipeline | 'Create' >> beam.Create([e.SerializeToString() for e in examples]) | 'BatchExamples' >> tfx_io.BeamSource() | 'InputsToExtracts' >> model_eval_lib.BatchedInputsToExtracts() | 'ExtractAndEvaluate' >> model_eval_lib.ExtractAndEvaluate( extractors=extractors, evaluators=evaluators)) # pylint: enable=no-value-for-parameter def check_metrics(got): try: self.assertLen(got, 1) got_slice_key, got_metrics = got[0] self.assertEqual(got_slice_key, ()) example_count_key = metric_types.MetricKey(name='example_count') chinese_weighted_example_count_key = metric_types.MetricKey( name='weighted_example_count', output_name='chinese_head', example_weighted=True) chinese_label_key = metric_types.MetricKey( name='mean_label', output_name='chinese_head', example_weighted=True) english_weighted_example_count_key = metric_types.MetricKey( name='weighted_example_count', output_name='english_head', example_weighted=True) english_label_key = metric_types.MetricKey( name='mean_label', output_name='english_head', example_weighted=True) other_weighted_example_count_key = metric_types.MetricKey( name='weighted_example_count', output_name='other_head', example_weighted=True) other_label_key = metric_types.MetricKey( name='mean_label', output_name='other_head', example_weighted=True) self.assertDictElementsAlmostEqual( got_metrics, { example_count_key: 4, chinese_label_key: (0.0 + 1.0 + 2 * 0.0 + 2 * 1.0) / (1.0 + 1.0 + 2.0 + 2.0), chinese_weighted_example_count_key: (1.0 + 1.0 + 2.0 + 2.0), english_label_key: (1.0 + 0.0 + 2 * 1.0 + 2 * 0.0) / (1.0 + 1.0 + 2.0 + 2.0), english_weighted_example_count_key: (1.0 + 1.0 + 2.0 + 2.0), other_label_key: (0.0 + 0.0 + 2 * 0.0 + 2 * 1.0) / (1.0 + 1.0 + 2.0 + 2.0), other_weighted_example_count_key: (1.0 + 1.0 + 2.0 + 2.0) }) except AssertionError as err: raise util.BeamAssertException(err) util.assert_that( metrics[constants.METRICS_KEY], check_metrics, label='metrics') @parameterized.named_parameters( ('compiled_metrics', False), ('evaluate', True), ) def testEvaluateWithKerasModelWithInGraphMetrics(self, add_custom_metrics): # Custom metrics not supported in TFv1 if _TF_MAJOR_VERSION < 2: add_custom_metrics = False input1 = tf.keras.layers.Input(shape=(1,), name='input_1') input2 = tf.keras.layers.Input(shape=(1,), name='input_2') inputs = [input1, input2] input_layer = tf.keras.layers.concatenate(inputs) output_layer = tf.keras.layers.Dense( 1, activation=tf.nn.sigmoid, name='output')( input_layer) model = tf.keras.models.Model(inputs, output_layer) # The model.evaluate API is used when custom metrics are used. Otherwise # model.compiled_metrics is used. if add_custom_metrics: model.add_metric(tf.reduce_sum(input_layer), name='custom') model.compile( optimizer=tf.keras.optimizers.Adam(lr=.001), loss=tf.keras.losses.BinaryCrossentropy(name='loss'), metrics=[tf.keras.metrics.BinaryAccuracy(name='binary_accuracy')]) export_dir = self._getExportDir() model.save(export_dir, save_format='tf') eval_config = config_pb2.EvalConfig( model_specs=[ config_pb2.ModelSpec( label_key='label', example_weight_key='example_weight') ], slicing_specs=[config_pb2.SlicingSpec()], metrics_specs=metric_specs.specs_from_metrics( [calibration.MeanLabel('mean_label')], unweighted_metrics=[ tf.keras.metrics.BinaryAccuracy(name='binary_accuracy'), calibration.MeanLabel('mean_label') ])) eval_shared_model = self.createTestEvalSharedModel( eval_saved_model_path=export_dir) examples = [ self._makeExample( input_1=0.0, input_2=1.0, label=1.0, example_weight=1.0, extra_feature='non_model_feature'), self._makeExample( input_1=1.0, input_2=0.0, label=0.0, example_weight=0.5, extra_feature='non_model_feature'), ] schema = text_format.Parse( """ tensor_representation_group { key: "" value { tensor_representation { key: "input_1" value { dense_tensor { column_name: "input_1" shape { dim { size: 1 } } } } } tensor_representation { key: "input_2" value { dense_tensor { column_name: "input_2" shape { dim { size: 1 } } } } } } } feature { name: "input_1" type: FLOAT } feature { name: "input_2" type: FLOAT } feature { name: "label" type: FLOAT } feature { name: "example_weight" type: FLOAT } feature { name: "extra_feature" type: BYTES } """, schema_pb2.Schema()) tfx_io = test_util.InMemoryTFExampleRecord( schema=schema, raw_record_column_name=constants.ARROW_INPUT_COLUMN) tensor_adapter_config = tensor_adapter.TensorAdapterConfig( arrow_schema=tfx_io.ArrowSchema(), tensor_representations=tfx_io.TensorRepresentations()) extractors = [ features_extractor.FeaturesExtractor( eval_config=eval_config, tensor_representations=tensor_adapter_config.tensor_representations ), labels_extractor.LabelsExtractor(eval_config), example_weights_extractor.ExampleWeightsExtractor(eval_config), predictions_extractor.PredictionsExtractor( eval_shared_model=eval_shared_model, eval_config=eval_config, tensor_adapter_config=tensor_adapter_config), unbatch_extractor.UnbatchExtractor(), slice_key_extractor.SliceKeyExtractor(eval_config=eval_config) ] evaluators = [ metrics_plots_and_validations_evaluator .MetricsPlotsAndValidationsEvaluator( eval_config=eval_config, eval_shared_model=eval_shared_model) ] with beam.Pipeline() as pipeline: # pylint: disable=no-value-for-parameter metrics = ( pipeline | 'Create' >> beam.Create([e.SerializeToString() for e in examples]) | 'BatchExamples' >> tfx_io.BeamSource() | 'InputsToExtracts' >> model_eval_lib.BatchedInputsToExtracts() | 'ExtractAndEvaluate' >> model_eval_lib.ExtractAndEvaluate( extractors=extractors, evaluators=evaluators)) # pylint: enable=no-value-for-parameter def check_metrics(got): try: self.assertLen(got, 1) got_slice_key, got_metrics = got[0] self.assertEqual(got_slice_key, ()) example_count_key = metric_types.MetricKey(name='example_count') weighted_example_count_key = metric_types.MetricKey( name='weighted_example_count', example_weighted=True) label_key = metric_types.MetricKey( name='mean_label', example_weighted=True) label_unweighted_key = metric_types.MetricKey( name='mean_label', example_weighted=False) binary_accuracy_key = metric_types.MetricKey( name='binary_accuracy', example_weighted=None) self.assertIn(binary_accuracy_key, got_metrics) binary_accuracy_unweighted_key = metric_types.MetricKey( name='binary_accuracy', example_weighted=False) self.assertIn(binary_accuracy_unweighted_key, got_metrics) # Loss not supported in TFv1 if _TF_MAJOR_VERSION > 1: loss_key = metric_types.MetricKey( name='loss', example_weighted=None) self.assertIn(loss_key, got_metrics) expected_values = { example_count_key: 2, weighted_example_count_key: (1.0 + 0.5), label_key: (1.0 * 1.0 + 0.0 * 0.5) / (1.0 + 0.5), label_unweighted_key: (1.0 + 0.0) / (1.0 + 1.0), } if add_custom_metrics: custom_key = metric_types.MetricKey( name='custom', example_weighted=None) self.assertIn(custom_key, got_metrics) expected_values[custom_key] = 0.0 + 1.0 + 0.0 + 1.0 self.assertDictElementsAlmostEqual(got_metrics, expected_values) except AssertionError as err: raise util.BeamAssertException(err) util.assert_that( metrics[constants.METRICS_KEY], check_metrics, label='metrics') def testEvaluateWithQueryBasedMetrics(self): temp_export_dir = self._getExportDir() _, export_dir = ( fixed_prediction_estimator_extra_fields .simple_fixed_prediction_estimator_extra_fields(None, temp_export_dir)) eval_config = config_pb2.EvalConfig( model_specs=[ config_pb2.ModelSpec( label_key='label', example_weight_key='fixed_int') ], slicing_specs=[ config_pb2.SlicingSpec(), config_pb2.SlicingSpec(feature_keys=['fixed_string']), ], metrics_specs=metric_specs.specs_from_metrics( [ndcg.NDCG(gain_key='fixed_float', name='ndcg')], binarize=config_pb2.BinarizationOptions( top_k_list={'values': [1, 2]}), query_key='fixed_string')) eval_shared_model = self.createTestEvalSharedModel( eval_saved_model_path=export_dir, tags=[tf.saved_model.SERVING]) extractors = [ features_extractor.FeaturesExtractor(eval_config), labels_extractor.LabelsExtractor(eval_config), example_weights_extractor.ExampleWeightsExtractor(eval_config), predictions_extractor.PredictionsExtractor( eval_shared_model=eval_shared_model, eval_config=eval_config), unbatch_extractor.UnbatchExtractor(), slice_key_extractor.SliceKeyExtractor(eval_config=eval_config) ] evaluators = [ metrics_plots_and_validations_evaluator .MetricsPlotsAndValidationsEvaluator( eval_config=eval_config, eval_shared_model=eval_shared_model) ] # fixed_string used as query_key # fixed_float used as gain_key for NDCG # fixed_int used as example_weight_key for NDCG examples = [ self._makeExample( prediction=0.2, label=1.0, fixed_float=1.0, fixed_string='query1', fixed_int=1), self._makeExample( prediction=0.8, label=0.0, fixed_float=0.5, fixed_string='query1', fixed_int=1), self._makeExample( prediction=0.5, label=0.0, fixed_float=0.5, fixed_string='query2', fixed_int=2), self._makeExample( prediction=0.9, label=1.0, fixed_float=1.0, fixed_string='query2', fixed_int=2), self._makeExample( prediction=0.1, label=0.0, fixed_float=0.1, fixed_string='query2', fixed_int=2), self._makeExample( prediction=0.9, label=1.0, fixed_float=1.0, fixed_string='query3', fixed_int=3) ] tfx_io = test_util.InMemoryTFExampleRecord( raw_record_column_name=constants.ARROW_INPUT_COLUMN) with beam.Pipeline() as pipeline: # pylint: disable=no-value-for-parameter metrics = ( pipeline | 'Create' >> beam.Create([e.SerializeToString() for e in examples]) | 'BatchExamples' >> tfx_io.BeamSource() | 'InputsToExtracts' >> model_eval_lib.BatchedInputsToExtracts() | 'ExtractAndEvaluate' >> model_eval_lib.ExtractAndEvaluate( extractors=extractors, evaluators=evaluators)) # pylint: enable=no-value-for-parameter def check_metrics(got): try: self.assertLen(got, 4) slices = {} for slice_key, value in got: slices[slice_key] = value overall_slice = () query1_slice = (('fixed_string', 'query1'),) query2_slice = (('fixed_string', 'query2'),) query3_slice = (('fixed_string', 'query3'),) self.assertCountEqual( list(slices.keys()), [overall_slice, query1_slice, query2_slice, query3_slice]) example_count_key = metric_types.MetricKey(name='example_count') weighted_example_count_key = metric_types.MetricKey( name='weighted_example_count', example_weighted=True) ndcg1_key = metric_types.MetricKey( name='ndcg', sub_key=metric_types.SubKey(top_k=1), example_weighted=True) ndcg2_key = metric_types.MetricKey( name='ndcg', sub_key=metric_types.SubKey(top_k=2), example_weighted=True) # Query1 (weight=1): (p=0.8, g=0.5) (p=0.2, g=1.0) # Query2 (weight=2): (p=0.9, g=1.0) (p=0.5, g=0.5) (p=0.1, g=0.1) # Query3 (weight=3): (p=0.9, g=1.0) # # DCG@1: 0.5, 1.0, 1.0 # NDCG@1: 0.5, 1.0, 1.0 # Average NDCG@1: (1 * 0.5 + 2 * 1.0 + 3 * 1.0) / (1 + 2 + 3) ~ 0.92 # # DCG@2: (0.5 + 1.0/log(3) ~ 0.630930 # (1.0 + 0.5/log(3) ~ 1.315465 # 1.0 # NDCG@2: (0.5 + 1.0/log(3)) / (1.0 + 0.5/log(3)) ~ 0.85972 # (1.0 + 0.5/log(3)) / (1.0 + 0.5/log(3)) = 1.0 # 1.0 # Average NDCG@2: (1 * 0.860 + 2 * 1.0 + 3 * 1.0) / (1 + 2 + 3) ~ 0.97 self.assertDictElementsAlmostEqual( slices[overall_slice], { example_count_key: 6, weighted_example_count_key: 11.0, ndcg1_key: 0.9166667, ndcg2_key: 0.9766198 }) self.assertDictElementsAlmostEqual( slices[query1_slice], { example_count_key: 2, weighted_example_count_key: 2.0, ndcg1_key: 0.5, ndcg2_key: 0.85972 }) self.assertDictElementsAlmostEqual( slices[query2_slice], { example_count_key: 3, weighted_example_count_key: 6.0, ndcg1_key: 1.0, ndcg2_key: 1.0 }) self.assertDictElementsAlmostEqual( slices[query3_slice], { example_count_key: 1, weighted_example_count_key: 3.0, ndcg1_key: 1.0, ndcg2_key: 1.0 }) except AssertionError as err: raise util.BeamAssertException(err) util.assert_that( metrics[constants.METRICS_KEY], check_metrics, label='metrics') def testEvaluateWithEvalSavedModel(self): temp_export_dir = self._getExportDir() _, export_dir = linear_classifier.simple_linear_classifier( None, temp_export_dir) eval_config = config_pb2.EvalConfig( model_specs=[config_pb2.ModelSpec(signature_name='eval')], slicing_specs=[ config_pb2.SlicingSpec(), config_pb2.SlicingSpec(feature_keys=['slice_key']), ]) eval_shared_model = self.createTestEvalSharedModel( eval_saved_model_path=export_dir, add_metrics_callbacks=[_addExampleCountMetricCallback]) extractors = [ legacy_predict_extractor.PredictExtractor( eval_shared_model, eval_config=eval_config), unbatch_extractor.UnbatchExtractor(), slice_key_extractor.SliceKeyExtractor(eval_config=eval_config) ] evaluators = [ metrics_plots_and_validations_evaluator .MetricsPlotsAndValidationsEvaluator( eval_config=eval_config, eval_shared_model=eval_shared_model) ] examples = [ self._makeExample( age=3.0, language='english', label=1.0, slice_key='first_slice'), self._makeExample( age=3.0, language='chinese', label=0.0, slice_key='first_slice'), self._makeExample( age=4.0, language='english', label=0.0, slice_key='second_slice'), self._makeExample( age=5.0, language='chinese', label=1.0, slice_key='second_slice'), self._makeExample( age=5.0, language='chinese', label=1.0, slice_key='second_slice') ] tfx_io = raw_tf_record.RawBeamRecordTFXIO( physical_format='inmemory', raw_record_column_name=constants.ARROW_INPUT_COLUMN, telemetry_descriptors=['TFMATest']) with beam.Pipeline() as pipeline: # pylint: disable=no-value-for-parameter metrics = ( pipeline | 'Create' >> beam.Create([e.SerializeToString() for e in examples]) | 'BatchExamples' >> tfx_io.BeamSource() | 'InputsToExtracts' >> model_eval_lib.BatchedInputsToExtracts() | 'ExtractAndEvaluate' >> model_eval_lib.ExtractAndEvaluate( extractors=extractors, evaluators=evaluators)) # pylint: enable=no-value-for-parameter def check_metrics(got): try: self.assertLen(got, 3) slices = {} for slice_key, value in got: slices[slice_key] = value overall_slice = () first_slice = (('slice_key', 'first_slice'),) second_slice = (('slice_key', 'second_slice'),) self.assertCountEqual( list(slices.keys()), [overall_slice, first_slice, second_slice]) self.assertDictElementsAlmostEqual( slices[overall_slice], { metric_types.MetricKey( name='accuracy', example_weighted=None): 0.4, metric_types.MetricKey( name='label/mean', example_weighted=None): 0.6, metric_types.MetricKey( name='my_mean_age', example_weighted=None): 4.0, metric_types.MetricKey( name='my_mean_age_times_label', example_weighted=None): 2.6, metric_types.MetricKey( name='added_example_count', example_weighted=None): 5.0 }) self.assertDictElementsAlmostEqual( slices[first_slice], { metric_types.MetricKey( name='accuracy', example_weighted=None): 1.0, metric_types.MetricKey( name='label/mean', example_weighted=None): 0.5, metric_types.MetricKey( name='my_mean_age', example_weighted=None): 3.0, metric_types.MetricKey( name='my_mean_age_times_label', example_weighted=None): 1.5, metric_types.MetricKey( name='added_example_count', example_weighted=None): 2.0 }) self.assertDictElementsAlmostEqual( slices[second_slice], { metric_types.MetricKey( name='accuracy', example_weighted=None): 0.0, metric_types.MetricKey( name='label/mean', example_weighted=None): 2.0 / 3.0, metric_types.MetricKey( name='my_mean_age', example_weighted=None): 14.0 / 3.0, metric_types.MetricKey( name='my_mean_age_times_label', example_weighted=None): 10.0 / 3.0, metric_types.MetricKey( name='added_example_count', example_weighted=None): 3.0 }) except AssertionError as err: raise util.BeamAssertException(err) util.assert_that( metrics[constants.METRICS_KEY], check_metrics, label='metrics') def testValidateWithEvalSavedModel(self): temp_export_dir = self._getExportDir() _, export_dir = linear_classifier.simple_linear_classifier( None, temp_export_dir) eval_config = config_pb2.EvalConfig( model_specs=[config_pb2.ModelSpec(signature_name='eval')], metrics_specs=[ config_pb2.MetricsSpec( thresholds={ 'accuracy': config_pb2.MetricThreshold( value_threshold=config_pb2.GenericValueThreshold( lower_bound={'value': 0.9})), 'nonexistent_metrics': config_pb2.MetricThreshold( value_threshold=config_pb2.GenericValueThreshold( lower_bound={'value': 0.1})) }) ], slicing_specs=[ config_pb2.SlicingSpec(), ]) eval_shared_model = self.createTestEvalSharedModel( eval_saved_model_path=export_dir, add_metrics_callbacks=[_addExampleCountMetricCallback]) extractors = [ legacy_predict_extractor.PredictExtractor( eval_shared_model, eval_config=eval_config), unbatch_extractor.UnbatchExtractor(), slice_key_extractor.SliceKeyExtractor(eval_config=eval_config) ] evaluators = [ metrics_plots_and_validations_evaluator .MetricsPlotsAndValidationsEvaluator( eval_config=eval_config, eval_shared_model=eval_shared_model) ] examples = [ self._makeExample( age=3.0, language='english', label=1.0, slice_key='first_slice'), self._makeExample( age=3.0, language='chinese', label=0.0, slice_key='first_slice'), self._makeExample( age=4.0, language='english', label=0.0, slice_key='second_slice'), self._makeExample( age=5.0, language='chinese', label=1.0, slice_key='second_slice'), self._makeExample( age=5.0, language='chinese', label=1.0, slice_key='second_slice') ] tfx_io = raw_tf_record.RawBeamRecordTFXIO( physical_format='inmemory', raw_record_column_name=constants.ARROW_INPUT_COLUMN, telemetry_descriptors=['TFMATest']) with beam.Pipeline() as pipeline: # pylint: disable=no-value-for-parameter evaluations = ( pipeline | 'Create' >> beam.Create([e.SerializeToString() for e in examples]) | 'BatchExamples' >> tfx_io.BeamSource() | 'InputsToExtracts' >> model_eval_lib.BatchedInputsToExtracts() | 'ExtractAndEvaluate' >> model_eval_lib.ExtractAndEvaluate( extractors=extractors, evaluators=evaluators)) # pylint: enable=no-value-for-parameter def check_validations(got): try: self.assertLen(got, 1) got = got[0] expected_failures = [ text_format.Parse( """ metric_key { name: "accuracy" } metric_threshold { value_threshold { lower_bound { value: 0.9 } } } """, validation_result_pb2.ValidationFailure()), text_format.Parse( """ metric_key { name: "nonexistent_metrics" } metric_threshold { value_threshold { lower_bound { value: 0.1 } } } message: "Metric not found." """, validation_result_pb2.ValidationFailure()), ] self.assertFalse(got.validation_ok) self.assertLen(got.metric_validations_per_slice, 1) # Ignore the metric_value to avoid fragility of float rounding issue. # The correctness of the metric_value has been tested in other tests. failures = got.metric_validations_per_slice[0].failures self.assertLen(failures, len(expected_failures)) for failure, expected_failure in zip(failures, expected_failures): failure.ClearField('metric_value') self.assertProtoEquals(expected_failure, failure) except AssertionError as err: raise util.BeamAssertException(err) util.assert_that(evaluations[constants.VALIDATIONS_KEY], check_validations) def testEvaluateWithCrossSlicing(self): temp_export_dir1 = self._getExportDir() _, export_dir1 = ( fixed_prediction_estimator_extra_fields .simple_fixed_prediction_estimator_extra_fields(None, temp_export_dir1)) temp_export_dir2 = self._getExportDir() _, export_dir2 = ( fixed_prediction_estimator_extra_fields .simple_fixed_prediction_estimator_extra_fields(None, temp_export_dir2)) example_count_metric = config_pb2.MetricConfig( class_name='ExampleCount', # 5 >= 3, OK for overall slice # 3 >= 3, OK for ('fixed_string', 'fixed_string1') # 2 < 3, NOT OK for ('fixed_string', 'fixed_string2') # Keep this for verifying cross slice thresholds and single slice # thresholds are working together. threshold=config_pb2.MetricThreshold( value_threshold=config_pb2.GenericValueThreshold( lower_bound={'value': 3})), cross_slice_thresholds=[ config_pb2.CrossSliceMetricThreshold( # 5-2 >= 2, OK for ((), (('fixed_string', 'fixed_string1'),)) # 5-3 < 3, NOT OK for ((), (('fixed_string', 'fixed_string2'),)) threshold=config_pb2.MetricThreshold( value_threshold=config_pb2.GenericValueThreshold( lower_bound={'value': 3})), cross_slicing_specs=[ config_pb2.CrossSlicingSpec( baseline_spec=config_pb2.SlicingSpec(), slicing_specs=[ config_pb2.SlicingSpec( feature_keys=['fixed_string']) ]) ]) ]) mean_prediction_metric = config_pb2.MetricConfig( class_name='MeanPrediction', cross_slice_thresholds=[ config_pb2.CrossSliceMetricThreshold( # MeanPrediction values for slices: # (0.2*2+0.9*2)/(2+2)=0.55 # for (('fixed_string', 'fixed_string1'),) # (0.5*2+0.5*2+0.5*2)/(2+2+2)=0.5 # for (('fixed_string', 'fixed_string2'),) threshold=config_pb2.MetricThreshold( value_threshold=config_pb2.GenericValueThreshold( # This config should give value threshold error because # (0.55-0.5)=0.05 not inside the bound [0.1, 0.5]. upper_bound={'value': .5}, lower_bound={'value': .1}), change_threshold=config_pb2.GenericChangeThreshold( # This config should give change threshold error because # baseline model and candidate model have same # difference as 0.05 between cross slices. Cross slice # difference value is not changed. direction=config_pb2.MetricDirection.LOWER_IS_BETTER, relative={'value': -.99}, absolute={'value': 0})), cross_slicing_specs=[ config_pb2.CrossSlicingSpec( baseline_spec=config_pb2.SlicingSpec( feature_values={'fixed_string': 'fixed_string1'}), slicing_specs=[ config_pb2.SlicingSpec(feature_values={ 'fixed_string': 'fixed_string2' }) ]) ]) ]) eval_config = config_pb2.EvalConfig( model_specs=[ config_pb2.ModelSpec( name='candidate', label_key='label', example_weight_key='fixed_float'), config_pb2.ModelSpec( name='baseline', label_key='label', example_weight_key='fixed_float', is_baseline=True) ], slicing_specs=[ config_pb2.SlicingSpec(), config_pb2.SlicingSpec(feature_keys=['fixed_string']), ], cross_slicing_specs=[ config_pb2.CrossSlicingSpec( baseline_spec=config_pb2.SlicingSpec(), slicing_specs=[ config_pb2.SlicingSpec(feature_keys=['fixed_string']) ]), config_pb2.CrossSlicingSpec( baseline_spec=config_pb2.SlicingSpec( feature_values={'fixed_string': 'fixed_string1'}), slicing_specs=[ config_pb2.SlicingSpec( feature_values={'fixed_string': 'fixed_string2'}) ]) ], metrics_specs=[ config_pb2.MetricsSpec( metrics=[example_count_metric], model_names=['candidate', 'baseline'], example_weights=config_pb2.ExampleWeightOptions( unweighted=True)), config_pb2.MetricsSpec( metrics=[mean_prediction_metric], model_names=['candidate', 'baseline']), ]) eval_shared_model = [ self.createTestEvalSharedModel( model_name='candidate', eval_saved_model_path=export_dir1), self.createTestEvalSharedModel( model_name='baseline', eval_saved_model_path=export_dir2), ] extractors = [ legacy_predict_extractor.PredictExtractor( eval_shared_model=eval_shared_model, eval_config=eval_config), unbatch_extractor.UnbatchExtractor(), slice_key_extractor.SliceKeyExtractor(eval_config=eval_config) ] evaluators = [ metrics_plots_and_validations_evaluator .MetricsPlotsAndValidationsEvaluator( eval_config=eval_config, eval_shared_model=eval_shared_model) ] # fixed_float used as example_weight key examples = [ self._makeExample( prediction=0.2, label=1.0, fixed_int=1, fixed_float=1.0, fixed_string='fixed_string1'), self._makeExample( prediction=0.9, label=0.0, fixed_int=1, fixed_float=1.0, fixed_string='fixed_string1'), self._makeExample( prediction=0.5, label=0.0, fixed_int=2, fixed_float=2.0, fixed_string='fixed_string2'), self._makeExample( prediction=0.5, label=0.0, fixed_int=2, fixed_float=2.0, fixed_string='fixed_string2'), self._makeExample( prediction=0.5, label=0.0, fixed_int=2, fixed_float=2.0, fixed_string='fixed_string2'), ] tfx_io = raw_tf_record.RawBeamRecordTFXIO( physical_format='inmemory', raw_record_column_name=constants.ARROW_INPUT_COLUMN, telemetry_descriptors=['TFMATest']) with beam.Pipeline() as pipeline: # pylint: disable=no-value-for-parameter evaluations = ( pipeline | 'Create' >> beam.Create([e.SerializeToString() for e in examples]) | 'BatchExamples' >> tfx_io.BeamSource() | 'InputsToExtracts' >> model_eval_lib.BatchedInputsToExtracts() | 'ExtractAndEvaluate' >> model_eval_lib.ExtractAndEvaluate( extractors=extractors, evaluators=evaluators)) # pylint: enable=no-value-for-parameter def check_validations(got): try: self.assertLen(got, 6) def get_slice_keys_hash(metric_validation): slice_key, cross_slice_key = None, None if metric_validation.slice_key: slice_key = metric_validation.slice_key.SerializeToString() if metric_validation.cross_slice_key: cross_slice_key = ( metric_validation.cross_slice_key.SerializeToString()) return (slice_key, cross_slice_key) successful_validations = [] failed_validations = {} for validation_result in got: if validation_result.validation_ok: successful_validations.append(validation_result) else: self.assertLen(validation_result.metric_validations_per_slice, 1) validation_result = ( validation_result.metric_validations_per_slice[0]) slice_keys_hash = get_slice_keys_hash(validation_result) failed_validations[slice_keys_hash] = {} for failure in validation_result.failures: failure.ClearField('metric_value') failed_validations[slice_keys_hash][ failure.metric_key.SerializeToString()] = failure self.assertLen(successful_validations, 3) self.assertLen(failed_validations.keys(), 3) expected_validations = [ text_format.Parse( """ slice_key { single_slice_keys { column: "fixed_string" bytes_value: "fixed_string1" } } failures { metric_key { name: "example_count" model_name: "candidate" example_weighted { } } metric_threshold { value_threshold { lower_bound { value: 3.0 } } } } """, validation_result_pb2.MetricsValidationForSlice()), text_format.Parse( """ failures { metric_key { name: "example_count" model_name: "candidate" example_weighted { } } metric_threshold { value_threshold { lower_bound { value: 3.0 } } } } cross_slice_key { baseline_slice_key { } comparison_slice_key { single_slice_keys { column: "fixed_string" bytes_value: "fixed_string2" } } } """, validation_result_pb2.MetricsValidationForSlice()), text_format.Parse( """ failures { metric_key { name: "mean_prediction" model_name: "candidate" example_weighted { value: true } } metric_threshold { value_threshold { lower_bound { value: 0.1 } upper_bound { value: 0.5 } } } } failures { metric_key { name: "mean_prediction" model_name: "candidate" is_diff: true example_weighted { value: true } } metric_threshold { change_threshold { absolute { } relative { value: -0.99 } direction: LOWER_IS_BETTER } } } cross_slice_key { baseline_slice_key { single_slice_keys { column: "fixed_string" bytes_value: "fixed_string1" } } comparison_slice_key { single_slice_keys { column: "fixed_string" bytes_value: "fixed_string2" } } } """, validation_result_pb2.MetricsValidationForSlice()) ] expected_validations_dict = {} for expected_validation in expected_validations: slice_keys_hash = get_slice_keys_hash(expected_validation) expected_validations_dict[slice_keys_hash] = {} for failure in expected_validation.failures: expected_validations_dict[slice_keys_hash][ failure.metric_key.SerializeToString()] = failure self.assertEqual( set(failed_validations.keys()), set(expected_validations_dict.keys())) for slice_key, validation in failed_validations.items(): self.assertEqual( set(validation.keys()), set(expected_validations_dict[slice_key].keys())) for metric_key, failure in validation.items(): self.assertProtoEquals( failure, expected_validations_dict[slice_key][metric_key]) except AssertionError as err: raise util.BeamAssertException(err) util.assert_that(evaluations[constants.VALIDATIONS_KEY], check_validations) def testAddCrossSliceMetricsMatchAll(self): overall_slice_key = () slice_key1 = (('feature', 1),) slice_key2 = (('feature', 2),) slice_key3 = (('feature', 3),) metrics_dict = {} sliced_metrics = [(overall_slice_key, metrics_dict), (slice_key1, metrics_dict), (slice_key2, metrics_dict), (slice_key3, metrics_dict)] with beam.Pipeline() as pipeline: cross_sliced_metrics = ( pipeline | 'CreateSlicedMetrics' >> beam.Create(sliced_metrics) | 'AddCrossSliceMetrics' >> metrics_plots_and_validations_evaluator._AddCrossSliceMetrics( cross_slice_specs=[ config_pb2.CrossSlicingSpec( baseline_spec={}, slicing_specs=[]) ], cross_slice_computations=[])) def check_result(got_sliced_metrics): actual_slice_keys = [k for k, _ in got_sliced_metrics] expected_slice_keys = [ # cross slice keys (overall_slice_key, slice_key1), (overall_slice_key, slice_key2), (overall_slice_key, slice_key3), # single slice keys overall_slice_key, slice_key1, slice_key2, slice_key3 ] self.assertCountEqual(expected_slice_keys, actual_slice_keys) util.assert_that(cross_sliced_metrics, check_result) @parameterized.named_parameters( ('IntIsDiffable', 1, True), ('FloatIsDiffable', 1.0, True), ('NumpyFloatDtypeIsDiffable', np.array([1.0], dtype=np.float64), True), ('NumpyIntDtypeIsDiffable', np.array([1], dtype=np.int64), True), ('MessageNotDiffable', validation_result_pb2.ValidationResult(), False), ('TupleNotDiffable', binary_confusion_matrices.Matrices( thresholds=[-1e-7, 0.5, 1.0 + 1e-7], tp=[2.0, 1.0, 0.0], fp=[2.0, 0.0, 0.0], tn=[0.0, 2.0, 2.0], fn=[0.0, 1.0, 2.0]), False), ('BytesNotDiffable', b'some bytes', False), ('NumpyObjectDtypeNotDiffable', np.array(['obj'], dtype=np.object), False), ) def testIsMetricDiffable(self, metric_value, expected_is_diffable): self.assertEqual( expected_is_diffable, metrics_plots_and_validations_evaluator._is_metric_diffable( metric_value)) def testMetricsSpecsCountersInModelAgnosticMode(self): schema = text_format.Parse( """ feature { name: "label" type: FLOAT } feature { name: "prediction" type: FLOAT } """, schema_pb2.Schema()) tfx_io = test_util.InMemoryTFExampleRecord( schema=schema, raw_record_column_name=constants.ARROW_INPUT_COLUMN) examples = [ self._makeExample(label=1.0, prediction=0.7), self._makeExample(label=0.0, prediction=0.3), ] eval_config = config_pb2.EvalConfig( model_specs=[ config_pb2.ModelSpec( prediction_key='prediction', label_key='label') ], metrics_specs=[ config_pb2.MetricsSpec( metrics=[config_pb2.MetricConfig(class_name='ExampleCount')]) ], slicing_specs=[config_pb2.SlicingSpec()]) extractors = [ features_extractor.FeaturesExtractor(eval_config), labels_extractor.LabelsExtractor(eval_config), example_weights_extractor.ExampleWeightsExtractor(eval_config), predictions_extractor.PredictionsExtractor(eval_config), unbatch_extractor.UnbatchExtractor(), slice_key_extractor.SliceKeyExtractor(eval_config=eval_config) ] evaluators = [ metrics_plots_and_validations_evaluator .MetricsPlotsAndValidationsEvaluator(eval_config) ] with beam.Pipeline() as pipeline: _ = ( pipeline | 'Create' >> beam.Create([e.SerializeToString() for e in examples]) | 'BatchExamples' >> tfx_io.BeamSource() | 'InputsToExtracts' >> model_eval_lib.BatchedInputsToExtracts() | 'ExtractEvaluate' >> model_eval_lib.ExtractAndEvaluate( extractors=extractors, evaluators=evaluators)) metric_filter = beam.metrics.metric.MetricsFilter().with_name( 'metric_computed_ExampleCount_v2_' + constants.MODEL_AGNOSTIC) actual_metrics_count = pipeline.run().metrics().query( filter=metric_filter)['counters'][0].committed self.assertEqual(actual_metrics_count, 1) if __name__ == '__main__': tf.compat.v1.enable_v2_behavior() tf.test.main()
from setuptools import setup, find_packages setup( name="sentinel", version="3.0.2", author="Joe Stahl (@happy-jo)", url="https://github.com/PUNCH-Cyber/stoq-plugins-public", license="Apache License 2.0", description="Send reults to Azure Sentinel (Log Analytics Workspace) using the Azure Log Analytics API", packages=find_packages(), include_package_data=True, )
def setup_ntp_test(request, bigip): def teardown(): n.servers = servers n.update() request.addfinalizer(teardown) n = bigip.sys.ntp.load() servers = n.servers return n, servers class iTestGlobal_Setting(object): def itest_RUL(self, request, bigip): # Load ip = '192.168.1.1' ntp1, orig_servers = setup_ntp_test(request, bigip) ntp2 = bigip.sys.ntp.load() assert len(ntp1.servers) == len(ntp2.servers) # Update ntp1.servers = [ip] ntp1.update() assert ip in ntp1.servers assert ip not in ntp2.servers # Refresh ntp2.refresh() assert ip in ntp2.servers
from __future__ import absolute_import, division, print_function, unicode_literals from logging import getLogger from os.path import realpath import re import struct from ..base.constants import PREFIX_PLACEHOLDER from ..common.compat import on_win from ..exceptions import CondaIOError, BinaryPrefixReplacementError from ..gateways.disk.update import CancelOperation, update_file_in_place_as_binary from ..models.enums import FileMode log = getLogger(__name__) SHEBANG_REGEX = (br'^(#!' # pretty much the whole match string br'(?:[ ]*)' # allow spaces between #! and beginning of the executable path br'(/(?:\\ |[^ \n\r\t])*)' # the executable is the next text block without an escaped space or non-space whitespace character # NOQA br'(.*)' # the rest of the line can contain option flags br')$') # end whole_shebang group class _PaddingError(Exception): pass def update_prefix(path, new_prefix, placeholder=PREFIX_PLACEHOLDER, mode=FileMode.text): if on_win and mode == FileMode.text: # force all prefix replacements to forward slashes to simplify need to escape backslashes # replace with unix-style path separators new_prefix = new_prefix.replace('\\', '/') def _update_prefix(original_data): # Step 1. do all prefix replacement data = replace_prefix(mode, original_data, placeholder, new_prefix) # Step 2. if the shebang is too long, shorten it using /usr/bin/env trick if not on_win: data = replace_long_shebang(mode, data) # Step 3. if the before and after content is the same, skip writing if data == original_data: raise CancelOperation() # Step 4. if we have a binary file, make sure the byte size is the same before # and after the update if mode == FileMode.binary and len(data) != len(original_data): raise BinaryPrefixReplacementError(path, placeholder, new_prefix, len(original_data), len(data)) return data update_file_in_place_as_binary(realpath(path), _update_prefix) def replace_prefix(mode, data, placeholder, new_prefix): if mode == FileMode.text: data = data.replace(placeholder.encode('utf-8'), new_prefix.encode('utf-8')) elif mode == FileMode.binary: data = binary_replace(data, placeholder.encode('utf-8'), new_prefix.encode('utf-8')) else: raise CondaIOError("Invalid mode: %r" % mode) return data def binary_replace(data, a, b): """ Perform a binary replacement of `data`, where the placeholder `a` is replaced with `b` and the remaining string is padded with null characters. All input arguments are expected to be bytes objects. """ if on_win: # on Windows for binary files, we currently only replace a pyzzer-type entry point # we skip all other prefix replacement if has_pyzzer_entry_point(data): return replace_pyzzer_entry_point_shebang(data, a, b) else: return data def replace(match): occurances = match.group().count(a) padding = (len(a) - len(b)) * occurances if padding < 0: raise _PaddingError return match.group().replace(a, b) + b'\0' * padding original_data_len = len(data) pat = re.compile(re.escape(a) + b'([^\0]*?)\0') data = pat.sub(replace, data) assert len(data) == original_data_len return data def has_pyzzer_entry_point(data): pos = data.rfind(b'PK\x05\x06') return pos >= 0 def replace_pyzzer_entry_point_shebang(all_data, placeholder, new_prefix): """Code adapted from pyzzer. This is meant to deal with entry point exe's created by distlib, which consist of a launcher, then a shebang, then a zip archive of the entry point code to run. We need to change the shebang. https://bitbucket.org/vinay.sajip/pyzzer/src/5d5740cb04308f067d5844a56fbe91e7a27efccc/pyzzer/__init__.py?at=default&fileviewer=file-view-default#__init__.py-112 # NOQA """ # Copyright (c) 2013 Vinay Sajip. # # Permission is hereby granted, free of charge, to any person obtaining a copy # of this software and associated documentation files (the "Software"), to deal # in the Software without restriction, including without limitation the rights # to use, copy, modify, merge, publish, distribute, sublicense, and/or sell # copies of the Software, and to permit persons to whom the Software is # furnished to do so, subject to the following conditions: # # The above copyright notice and this permission notice shall be included in # all copies or substantial portions of the Software. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR # IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, # FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE # AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER # LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, # OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN # THE SOFTWARE. launcher = shebang = None pos = all_data.rfind(b'PK\x05\x06') if pos >= 0: end_cdr = all_data[pos + 12:pos + 20] cdr_size, cdr_offset = struct.unpack('<LL', end_cdr) arc_pos = pos - cdr_size - cdr_offset data = all_data[arc_pos:] if arc_pos > 0: pos = all_data.rfind(b'#!', 0, arc_pos) if pos >= 0: shebang = all_data[pos:arc_pos] if pos > 0: launcher = all_data[:pos] if data and shebang and launcher: if hasattr(placeholder, 'encode'): placeholder = placeholder.encode('utf-8') if hasattr(new_prefix, 'encode'): new_prefix = new_prefix.encode('utf-8') shebang = shebang.replace(placeholder, new_prefix) all_data = b"".join([launcher, shebang, data]) return all_data def replace_long_shebang(mode, data): # this function only changes a shebang line if it exists and is greater than 127 characters if mode == FileMode.text: shebang_match = re.match(SHEBANG_REGEX, data, re.MULTILINE) if shebang_match: whole_shebang, executable, options = shebang_match.groups() if len(whole_shebang) > 127: executable_name = executable.decode('utf-8').split('/')[-1] new_shebang = '#!/usr/bin/env %s%s' % (executable_name, options.decode('utf-8')) data = data.replace(whole_shebang, new_shebang.encode('utf-8')) else: # TODO: binary shebangs exist; figure this out in the future if text works well pass return data
import commands import logging import json import time from core.alive import alive from core.voiceapplication import VoiceApplication from core.voicesynthetizer import VoiceSynthetizer from pprint import pprint class VoiceApp(object): def __init__(self, voicesynthetizer): self.modulename = 'Voice Application' self.voicesynthetizer = voicesynthetizer self.voiceapplication = VoiceApplication() def application(self): logging.info(self.modulename) repeater = 'python nuupxe.py -v \"Hola! En que puedo ayudarte?\"' status, output = commands.getstatusoutput(repeater) response = self.voiceapplication.action() repeater = 'python nuupxe.py -m \"' + response + '\"' status, output = commands.getstatusoutput(repeater)
from __future__ import absolute_import from __future__ import division from __future__ import print_function from __future__ import unicode_literals import datetime import logging import os import shutil import unittest import six import socket from tempfile import mkdtemp from airflow import AirflowException, settings, models from airflow.bin import cli from airflow.executors import SequentialExecutor from airflow.jobs import BackfillJob, SchedulerJob, LocalTaskJob from airflow.models import DAG, DagModel, DagBag, DagRun, Pool, TaskInstance as TI from airflow.operators.dummy_operator import DummyOperator from airflow.operators.bash_operator import BashOperator from airflow.utils.db import provide_session from airflow.utils.state import State from airflow.utils.timeout import timeout from airflow.utils.dag_processing import SimpleDagBag from mock import patch from sqlalchemy.orm.session import make_transient from tests.executors.test_executor import TestExecutor from tests.core import TEST_DAG_FOLDER from airflow import configuration configuration.load_test_config() import sqlalchemy try: from unittest import mock except ImportError: try: import mock except ImportError: mock = None DEV_NULL = '/dev/null' DEFAULT_DATE = datetime.datetime(2016, 1, 1) PARSEABLE_DAG_FILE_CONTENTS = '"airflow DAG"' UNPARSEABLE_DAG_FILE_CONTENTS = 'airflow DAG' TEMP_DAG_FILENAME = "temp_dag.py" class BackfillJobTest(unittest.TestCase): def setUp(self): self.parser = cli.CLIFactory.get_parser() self.dagbag = DagBag(include_examples=True) @unittest.skipIf('sqlite' in configuration.get('core', 'sql_alchemy_conn'), "concurrent access not supported in sqlite") def test_trigger_controller_dag(self): dag = self.dagbag.get_dag('example_trigger_controller_dag') target_dag = self.dagbag.get_dag('example_trigger_target_dag') dag.clear() target_dag.clear() scheduler = SchedulerJob() queue = mock.Mock() scheduler._process_task_instances(target_dag, queue=queue) self.assertFalse(queue.append.called) job = BackfillJob( dag=dag, start_date=DEFAULT_DATE, end_date=DEFAULT_DATE, ignore_first_depends_on_past=True ) job.run() scheduler = SchedulerJob() queue = mock.Mock() scheduler._process_task_instances(target_dag, queue=queue) self.assertTrue(queue.append.called) target_dag.clear() dag.clear() @unittest.skipIf('sqlite' in configuration.get('core', 'sql_alchemy_conn'), "concurrent access not supported in sqlite") def test_backfill_multi_dates(self): dag = self.dagbag.get_dag('example_bash_operator') dag.clear() job = BackfillJob( dag=dag, start_date=DEFAULT_DATE, end_date=DEFAULT_DATE + datetime.timedelta(days=1), ignore_first_depends_on_past=True ) job.run() session = settings.Session() drs = session.query(DagRun).filter( DagRun.dag_id=='example_bash_operator' ).order_by(DagRun.execution_date).all() self.assertTrue(drs[0].execution_date == DEFAULT_DATE) self.assertTrue(drs[0].state == State.SUCCESS) self.assertTrue(drs[1].execution_date == DEFAULT_DATE + datetime.timedelta(days=1)) self.assertTrue(drs[1].state == State.SUCCESS) dag.clear() session.close() @unittest.skipIf('sqlite' in configuration.get('core', 'sql_alchemy_conn'), "concurrent access not supported in sqlite") def test_backfill_examples(self): """ Test backfilling example dags """ # some DAGs really are just examples... but try to make them work! skip_dags = [ 'example_http_operator', 'example_twitter_dag', 'example_trigger_target_dag', 'example_trigger_controller_dag', # tested above 'test_utils', # sleeps forever ] logger = logging.getLogger('BackfillJobTest.test_backfill_examples') dags = [ dag for dag in self.dagbag.dags.values() if 'example_dags' in dag.full_filepath and dag.dag_id not in skip_dags ] for dag in dags: dag.clear( start_date=DEFAULT_DATE, end_date=DEFAULT_DATE) for i, dag in enumerate(sorted(dags, key=lambda d: d.dag_id)): logger.info('*** Running example DAG #{}: {}'.format(i, dag.dag_id)) job = BackfillJob( dag=dag, start_date=DEFAULT_DATE, end_date=DEFAULT_DATE, ignore_first_depends_on_past=True) job.run() def test_backfill_ordered_concurrent_execute(self): dag = DAG( dag_id='test_backfill_ordered_concurrent_execute', start_date=DEFAULT_DATE, schedule_interval="@daily") with dag: op1 = DummyOperator(task_id='leave1') op2 = DummyOperator(task_id='leave2') op3 = DummyOperator(task_id='upstream_level_1') op4 = DummyOperator(task_id='upstream_level_2') op5 = DummyOperator(task_id='upstream_level_3') # order randomly op2.set_downstream(op3) op1.set_downstream(op3) op4.set_downstream(op5) op3.set_downstream(op4) dag.clear() executor = TestExecutor(do_update=True) job = BackfillJob(dag=dag, executor=executor, start_date=DEFAULT_DATE, end_date=DEFAULT_DATE + datetime.timedelta(days=2), ) job.run() # test executor history keeps a list history = executor.history # check if right order. Every loop has a 'pause' (0) to change state # from RUNNING to SUCCESS. # 6,0,3,0,3,0,3,0 = 8 loops self.assertEqual(8, len(history)) loop_count = 0 while len(history) > 0: queued_tasks = history.pop(0) if loop_count == 0: # first loop should contain 6 tasks (3 days x 2 tasks) self.assertEqual(6, len(queued_tasks)) if loop_count == 2 or loop_count == 4 or loop_count == 6: # 3 days x 1 task self.assertEqual(3, len(queued_tasks)) loop_count += 1 def test_backfill_pooled_tasks(self): """ Test that queued tasks are executed by BackfillJob Test for https://github.com/airbnb/airflow/pull/1225 """ session = settings.Session() pool = Pool(pool='test_backfill_pooled_task_pool', slots=1) session.add(pool) session.commit() dag = self.dagbag.get_dag('test_backfill_pooled_task_dag') dag.clear() job = BackfillJob( dag=dag, start_date=DEFAULT_DATE, end_date=DEFAULT_DATE) # run with timeout because this creates an infinite loop if not # caught with timeout(seconds=30): job.run() ti = TI( task=dag.get_task('test_backfill_pooled_task'), execution_date=DEFAULT_DATE) ti.refresh_from_db() self.assertEqual(ti.state, State.SUCCESS) def test_backfill_depends_on_past(self): """ Test that backfill respects ignore_depends_on_past """ dag = self.dagbag.get_dag('test_depends_on_past') dag.clear() run_date = DEFAULT_DATE + datetime.timedelta(days=5) # backfill should deadlock self.assertRaisesRegexp( AirflowException, 'BackfillJob is deadlocked', BackfillJob(dag=dag, start_date=run_date, end_date=run_date).run) BackfillJob( dag=dag, start_date=run_date, end_date=run_date, ignore_first_depends_on_past=True).run() # ti should have succeeded ti = TI(dag.tasks[0], run_date) ti.refresh_from_db() self.assertEquals(ti.state, State.SUCCESS) def test_cli_backfill_depends_on_past(self): """ Test that CLI respects -I argument """ dag_id = 'test_dagrun_states_deadlock' run_date = DEFAULT_DATE + datetime.timedelta(days=1) args = [ 'backfill', dag_id, '-l', '-s', run_date.isoformat(), ] dag = self.dagbag.get_dag(dag_id) dag.clear() self.assertRaisesRegexp( AirflowException, 'BackfillJob is deadlocked', cli.backfill, self.parser.parse_args(args)) cli.backfill(self.parser.parse_args(args + ['-I'])) ti = TI(dag.get_task('test_depends_on_past'), run_date) ti.refresh_from_db() # task ran self.assertEqual(ti.state, State.SUCCESS) dag.clear() def test_sub_set_subdag(self): dag = DAG( 'test_sub_set_subdag', start_date=DEFAULT_DATE, default_args={'owner': 'owner1'}) with dag: op1 = DummyOperator(task_id='leave1') op2 = DummyOperator(task_id='leave2') op3 = DummyOperator(task_id='upstream_level_1') op4 = DummyOperator(task_id='upstream_level_2') op5 = DummyOperator(task_id='upstream_level_3') # order randomly op2.set_downstream(op3) op1.set_downstream(op3) op4.set_downstream(op5) op3.set_downstream(op4) dag.clear() dr = dag.create_dagrun(run_id="test", state=State.SUCCESS, execution_date=DEFAULT_DATE, start_date=DEFAULT_DATE) executor = TestExecutor(do_update=True) sub_dag = dag.sub_dag(task_regex="leave*", include_downstream=False, include_upstream=False) job = BackfillJob(dag=sub_dag, start_date=DEFAULT_DATE, end_date=DEFAULT_DATE, executor=executor) job.run() self.assertRaises(sqlalchemy.orm.exc.NoResultFound, dr.refresh_from_db) # the run_id should have changed, so a refresh won't work drs = DagRun.find(dag_id=dag.dag_id, execution_date=DEFAULT_DATE) dr = drs[0] self.assertEqual(BackfillJob.ID_FORMAT_PREFIX.format(DEFAULT_DATE.isoformat()), dr.run_id) for ti in dr.get_task_instances(): if ti.task_id == 'leave1' or ti.task_id == 'leave2': self.assertEqual(State.SUCCESS, ti.state) else: self.assertEqual(State.NONE, ti.state) def test_backfill_execute_subdag(self): dag = self.dagbag.get_dag('example_subdag_operator') subdag_op_task = dag.get_task('section-1') subdag = subdag_op_task.subdag subdag.schedule_interval = '@daily' start_date = datetime.datetime.now() executor = TestExecutor(do_update=True) job = BackfillJob(dag=subdag, start_date=start_date, end_date=start_date, executor=executor, donot_pickle=True) job.run() history = executor.history subdag_history = history[0] # check that all 5 task instances of the subdag 'section-1' were executed self.assertEqual(5, len(subdag_history)) for sdh in subdag_history: ti = sdh[3] self.assertIn('section-1-task-', ti.task_id) subdag.clear() dag.clear() class LocalTaskJobTest(unittest.TestCase): def setUp(self): pass @patch.object(LocalTaskJob, "_is_descendant_process") def test_localtaskjob_heartbeat(self, is_descendant): session = settings.Session() dag = DAG( 'test_localtaskjob_heartbeat', start_date=DEFAULT_DATE, default_args={'owner': 'owner1'}) with dag: op1 = DummyOperator(task_id='op1') dag.clear() dr = dag.create_dagrun(run_id="test", state=State.SUCCESS, execution_date=DEFAULT_DATE, start_date=DEFAULT_DATE, session=session) ti = dr.get_task_instance(task_id=op1.task_id, session=session) ti.state = State.RUNNING ti.hostname = "blablabla" session.commit() job1 = LocalTaskJob(task_instance=ti, ignore_ti_state=True, executor=SequentialExecutor()) self.assertRaises(AirflowException, job1.heartbeat_callback) is_descendant.return_value = True ti.state = State.RUNNING ti.hostname = socket.getfqdn() ti.pid = 1 session.merge(ti) session.commit() ret = job1.heartbeat_callback() self.assertEqual(ret, None) is_descendant.return_value = False self.assertRaises(AirflowException, job1.heartbeat_callback) def test_localtaskjob_double_trigger(self): dagbag = models.DagBag( dag_folder=TEST_DAG_FOLDER, include_examples=False, ) dag = dagbag.dags.get('test_localtaskjob_double_trigger') task = dag.get_task('test_localtaskjob_double_trigger_task') session = settings.Session() dag.clear() dr = dag.create_dagrun(run_id="test", state=State.SUCCESS, execution_date=DEFAULT_DATE, start_date=DEFAULT_DATE, session=session) ti = dr.get_task_instance(task_id=task.task_id, session=session) ti.state = State.RUNNING ti.hostname = socket.getfqdn() ti.pid = 1 session.commit() ti_run = TI(task=task, execution_date=DEFAULT_DATE) job1 = LocalTaskJob(task_instance=ti_run, ignore_ti_state=True, executor=SequentialExecutor()) self.assertRaises(AirflowException, job1.run) ti = dr.get_task_instance(task_id=task.task_id, session=session) self.assertEqual(ti.pid, 1) self.assertEqual(ti.state, State.RUNNING) session.close() class SchedulerJobTest(unittest.TestCase): # These defaults make the test faster to run default_scheduler_args = {"file_process_interval": 0, "processor_poll_interval": 0.5} def setUp(self): self.dagbag = DagBag() session = settings.Session() session.query(models.ImportError).delete() session.commit() @staticmethod def run_single_scheduler_loop_with_no_dags(dags_folder): """ Utility function that runs a single scheduler loop without actually changing/scheduling any dags. This is useful to simulate the other side effects of running a scheduler loop, e.g. to see what parse errors there are in the dags_folder. :param dags_folder: the directory to traverse :type directory: str """ scheduler = SchedulerJob( dag_id='this_dag_doesnt_exist', # We don't want to actually run anything num_runs=1, subdir=os.path.join(dags_folder)) scheduler.heartrate = 0 scheduler.run() def test_concurrency(self): dag_id = 'SchedulerJobTest.test_concurrency' task_id_1 = 'dummy_task' task_id_2 = 'dummy_task_nonexistent_queue' # important that len(tasks) is less than concurrency # because before scheduler._execute_task_instances would only # check the num tasks once so if concurrency was 3, # we could execute arbitrarily many tasks in the second run dag = DAG(dag_id=dag_id, start_date=DEFAULT_DATE, concurrency=3) task1 = DummyOperator(dag=dag, task_id=task_id_1) task2 = DummyOperator(dag=dag, task_id=task_id_2) dagbag = SimpleDagBag([dag]) scheduler = SchedulerJob(**self.default_scheduler_args) session = settings.Session() # create first dag run with 1 running and 1 queued dr1 = scheduler.create_dag_run(dag) ti1 = TI(task1, dr1.execution_date) ti2 = TI(task2, dr1.execution_date) ti1.refresh_from_db() ti2.refresh_from_db() ti1.state = State.RUNNING ti2.state = State.RUNNING session.merge(ti1) session.merge(ti2) session.commit() self.assertEqual(State.RUNNING, dr1.state) self.assertEqual(2, DAG.get_num_task_instances(dag_id, dag.task_ids, states=[State.RUNNING], session=session)) # create second dag run dr2 = scheduler.create_dag_run(dag) ti3 = TI(task1, dr2.execution_date) ti4 = TI(task2, dr2.execution_date) ti3.refresh_from_db() ti4.refresh_from_db() # manually set to scheduled so we can pick them up ti3.state = State.SCHEDULED ti4.state = State.SCHEDULED session.merge(ti3) session.merge(ti4) session.commit() self.assertEqual(State.RUNNING, dr2.state) scheduler._execute_task_instances(dagbag, [State.SCHEDULED]) # check that concurrency is respected ti1.refresh_from_db() ti2.refresh_from_db() ti3.refresh_from_db() ti4.refresh_from_db() self.assertEqual(3, DAG.get_num_task_instances(dag_id, dag.task_ids, states=[State.RUNNING, State.QUEUED], session=session)) self.assertEqual(State.RUNNING, ti1.state) self.assertEqual(State.RUNNING, ti2.state) six.assertCountEqual(self, [State.QUEUED, State.SCHEDULED], [ti3.state, ti4.state]) session.close() @provide_session def evaluate_dagrun( self, dag_id, expected_task_states, # dict of task_id: state dagrun_state, run_kwargs=None, advance_execution_date=False, session=None): """ Helper for testing DagRun states with simple two-task DAGS. This is hackish: a dag run is created but its tasks are run by a backfill. """ if run_kwargs is None: run_kwargs = {} scheduler = SchedulerJob(**self.default_scheduler_args) dag = self.dagbag.get_dag(dag_id) dag.clear() dr = scheduler.create_dag_run(dag) if advance_execution_date: # run a second time to schedule a dagrun after the start_date dr = scheduler.create_dag_run(dag) ex_date = dr.execution_date try: dag.run(start_date=ex_date, end_date=ex_date, **run_kwargs) except AirflowException: pass # test tasks for task_id, expected_state in expected_task_states.items(): task = dag.get_task(task_id) ti = TI(task, ex_date) ti.refresh_from_db() self.assertEqual(ti.state, expected_state) # load dagrun dr = DagRun.find(dag_id=dag_id, execution_date=ex_date) dr = dr[0] dr.dag = dag self.assertEqual(dr.state, dagrun_state) def test_dagrun_fail(self): """ DagRuns with one failed and one incomplete root task -> FAILED """ self.evaluate_dagrun( dag_id='test_dagrun_states_fail', expected_task_states={ 'test_dagrun_fail': State.FAILED, 'test_dagrun_succeed': State.UPSTREAM_FAILED, }, dagrun_state=State.FAILED) def test_dagrun_success(self): """ DagRuns with one failed and one successful root task -> SUCCESS """ self.evaluate_dagrun( dag_id='test_dagrun_states_success', expected_task_states={ 'test_dagrun_fail': State.FAILED, 'test_dagrun_succeed': State.SUCCESS, }, dagrun_state=State.SUCCESS) def test_dagrun_root_fail(self): """ DagRuns with one successful and one failed root task -> FAILED """ self.evaluate_dagrun( dag_id='test_dagrun_states_root_fail', expected_task_states={ 'test_dagrun_succeed': State.SUCCESS, 'test_dagrun_fail': State.FAILED, }, dagrun_state=State.FAILED) def test_dagrun_root_fail_unfinished(self): """ DagRuns with one unfinished and one failed root task -> RUNNING """ # Run both the failed and successful tasks scheduler = SchedulerJob(**self.default_scheduler_args) dag_id = 'test_dagrun_states_root_fail_unfinished' dag = self.dagbag.get_dag(dag_id) dag.clear() dr = scheduler.create_dag_run(dag) try: dag.run(start_date=dr.execution_date, end_date=dr.execution_date) except AirflowException: # Expect an exception since there is a failed task pass # Mark the successful task as never having run since we want to see if the # dagrun will be in a running state despite haveing an unfinished task. session = settings.Session() ti = dr.get_task_instance('test_dagrun_unfinished', session=session) ti.state = State.NONE session.commit() dr_state = dr.update_state() self.assertEqual(dr_state, State.RUNNING) def test_dagrun_deadlock_ignore_depends_on_past_advance_ex_date(self): """ DagRun is marked a success if ignore_first_depends_on_past=True Test that an otherwise-deadlocked dagrun is marked as a success if ignore_first_depends_on_past=True and the dagrun execution_date is after the start_date. """ self.evaluate_dagrun( dag_id='test_dagrun_states_deadlock', expected_task_states={ 'test_depends_on_past': State.SUCCESS, 'test_depends_on_past_2': State.SUCCESS, }, dagrun_state=State.SUCCESS, advance_execution_date=True, run_kwargs=dict(ignore_first_depends_on_past=True)) def test_dagrun_deadlock_ignore_depends_on_past(self): """ Test that ignore_first_depends_on_past doesn't affect results (this is the same test as test_dagrun_deadlock_ignore_depends_on_past_advance_ex_date except that start_date == execution_date so depends_on_past is irrelevant). """ self.evaluate_dagrun( dag_id='test_dagrun_states_deadlock', expected_task_states={ 'test_depends_on_past': State.SUCCESS, 'test_depends_on_past_2': State.SUCCESS, }, dagrun_state=State.SUCCESS, run_kwargs=dict(ignore_first_depends_on_past=True)) def test_scheduler_start_date(self): """ Test that the scheduler respects start_dates, even when DAGS have run """ dag_id = 'test_start_date_scheduling' dag = self.dagbag.get_dag(dag_id) dag.clear() self.assertTrue(dag.start_date > DEFAULT_DATE) scheduler = SchedulerJob(dag_id, num_runs=2, **self.default_scheduler_args) scheduler.run() # zero tasks ran session = settings.Session() self.assertEqual( len(session.query(TI).filter(TI.dag_id == dag_id).all()), 0) # previously, running this backfill would kick off the Scheduler # because it would take the most recent run and start from there # That behavior still exists, but now it will only do so if after the # start date backfill = BackfillJob( dag=dag, start_date=DEFAULT_DATE, end_date=DEFAULT_DATE) backfill.run() # one task ran session = settings.Session() self.assertEqual( len(session.query(TI).filter(TI.dag_id == dag_id).all()), 1) scheduler = SchedulerJob(dag_id, num_runs=2, **self.default_scheduler_args) scheduler.run() # still one task session = settings.Session() self.assertEqual( len(session.query(TI).filter(TI.dag_id == dag_id).all()), 1) def test_scheduler_multiprocessing(self): """ Test that the scheduler can successfully queue multiple dags in parallel """ dag_ids = ['test_start_date_scheduling', 'test_dagrun_states_success'] for dag_id in dag_ids: dag = self.dagbag.get_dag(dag_id) dag.clear() scheduler = SchedulerJob(dag_ids=dag_ids, file_process_interval=0, processor_poll_interval=0.5, num_runs=2) scheduler.run() # zero tasks ran dag_id = 'test_start_date_scheduling' session = settings.Session() self.assertEqual( len(session.query(TI).filter(TI.dag_id == dag_id).all()), 0) def test_scheduler_dagrun_once(self): """ Test if the scheduler does not create multiple dagruns if a dag is scheduled with @once and a start_date """ dag = DAG( 'test_scheduler_dagrun_once', start_date=datetime.datetime(2015, 1, 1), schedule_interval="@once") scheduler = SchedulerJob() dag.clear() dr = scheduler.create_dag_run(dag) self.assertIsNotNone(dr) dr = scheduler.create_dag_run(dag) self.assertIsNone(dr) def test_scheduler_process_task_instances(self): """ Test if _process_task_instances puts the right task instances into the queue. """ dag = DAG( dag_id='test_scheduler_process_execute_task', start_date=DEFAULT_DATE) dag_task1 = DummyOperator( task_id='dummy', dag=dag, owner='airflow') session = settings.Session() orm_dag = DagModel(dag_id=dag.dag_id) session.merge(orm_dag) session.commit() session.close() scheduler = SchedulerJob() dag.clear() dr = scheduler.create_dag_run(dag) self.assertIsNotNone(dr) queue = mock.Mock() scheduler._process_task_instances(dag, queue=queue) queue.append.assert_called_with( (dag.dag_id, dag_task1.task_id, DEFAULT_DATE) ) def test_scheduler_do_not_schedule_removed_task(self): dag = DAG( dag_id='test_scheduler_do_not_schedule_removed_task', start_date=DEFAULT_DATE) dag_task1 = DummyOperator( task_id='dummy', dag=dag, owner='airflow') session = settings.Session() orm_dag = DagModel(dag_id=dag.dag_id) session.merge(orm_dag) session.commit() session.close() scheduler = SchedulerJob() dag.clear() dr = scheduler.create_dag_run(dag) self.assertIsNotNone(dr) dag = DAG( dag_id='test_scheduler_do_not_schedule_removed_task', start_date=DEFAULT_DATE) queue = mock.Mock() scheduler._process_task_instances(dag, queue=queue) queue.put.assert_not_called() def test_scheduler_do_not_schedule_too_early(self): dag = DAG( dag_id='test_scheduler_do_not_schedule_too_early', start_date=datetime.datetime(2200, 1, 1)) dag_task1 = DummyOperator( task_id='dummy', dag=dag, owner='airflow') session = settings.Session() orm_dag = DagModel(dag_id=dag.dag_id) session.merge(orm_dag) session.commit() session.close() scheduler = SchedulerJob() dag.clear() dr = scheduler.create_dag_run(dag) self.assertIsNone(dr) queue = mock.Mock() scheduler._process_task_instances(dag, queue=queue) queue.put.assert_not_called() def test_scheduler_do_not_run_finished(self): dag = DAG( dag_id='test_scheduler_do_not_run_finished', start_date=DEFAULT_DATE) dag_task1 = DummyOperator( task_id='dummy', dag=dag, owner='airflow') session = settings.Session() orm_dag = DagModel(dag_id=dag.dag_id) session.merge(orm_dag) session.commit() scheduler = SchedulerJob() dag.clear() dr = scheduler.create_dag_run(dag) self.assertIsNotNone(dr) tis = dr.get_task_instances(session=session) for ti in tis: ti.state = State.SUCCESS session.commit() session.close() queue = mock.Mock() scheduler._process_task_instances(dag, queue=queue) queue.put.assert_not_called() def test_scheduler_add_new_task(self): """ Test if a task instance will be added if the dag is updated """ dag = DAG( dag_id='test_scheduler_add_new_task', start_date=DEFAULT_DATE) dag_task1 = DummyOperator( task_id='dummy', dag=dag, owner='airflow') session = settings.Session() orm_dag = DagModel(dag_id=dag.dag_id) session.merge(orm_dag) session.commit() session.close() scheduler = SchedulerJob() dag.clear() dr = scheduler.create_dag_run(dag) self.assertIsNotNone(dr) tis = dr.get_task_instances() self.assertEquals(len(tis), 1) dag_task2 = DummyOperator( task_id='dummy2', dag=dag, owner='airflow') queue = mock.Mock() scheduler._process_task_instances(dag, queue=queue) tis = dr.get_task_instances() self.assertEquals(len(tis), 2) def test_scheduler_verify_max_active_runs(self): """ Test if a a dagrun will not be scheduled if max_dag_runs has been reached """ dag = DAG( dag_id='test_scheduler_verify_max_active_runs', start_date=DEFAULT_DATE) dag.max_active_runs = 1 dag_task1 = DummyOperator( task_id='dummy', dag=dag, owner='airflow') session = settings.Session() orm_dag = DagModel(dag_id=dag.dag_id) session.merge(orm_dag) session.commit() session.close() scheduler = SchedulerJob() dag.clear() dr = scheduler.create_dag_run(dag) self.assertIsNotNone(dr) dr = scheduler.create_dag_run(dag) self.assertIsNone(dr) def test_scheduler_fail_dagrun_timeout(self): """ Test if a a dagrun wil be set failed if timeout """ dag = DAG( dag_id='test_scheduler_fail_dagrun_timeout', start_date=DEFAULT_DATE) dag.dagrun_timeout = datetime.timedelta(seconds=60) dag_task1 = DummyOperator( task_id='dummy', dag=dag, owner='airflow') session = settings.Session() orm_dag = DagModel(dag_id=dag.dag_id) session.merge(orm_dag) session.commit() scheduler = SchedulerJob() dag.clear() dr = scheduler.create_dag_run(dag) self.assertIsNotNone(dr) dr.start_date = datetime.datetime.now() - datetime.timedelta(days=1) session.merge(dr) session.commit() dr2 = scheduler.create_dag_run(dag) self.assertIsNotNone(dr2) dr.refresh_from_db(session=session) self.assertEquals(dr.state, State.FAILED) def test_scheduler_verify_max_active_runs_and_dagrun_timeout(self): """ Test if a a dagrun will not be scheduled if max_dag_runs has been reached and dagrun_timeout is not reached Test if a a dagrun will be scheduled if max_dag_runs has been reached but dagrun_timeout is also reached """ dag = DAG( dag_id='test_scheduler_verify_max_active_runs_and_dagrun_timeout', start_date=DEFAULT_DATE) dag.max_active_runs = 1 dag.dagrun_timeout = datetime.timedelta(seconds=60) dag_task1 = DummyOperator( task_id='dummy', dag=dag, owner='airflow') session = settings.Session() orm_dag = DagModel(dag_id=dag.dag_id) session.merge(orm_dag) session.commit() session.close() scheduler = SchedulerJob() dag.clear() dr = scheduler.create_dag_run(dag) self.assertIsNotNone(dr) # Should not be scheduled as DagRun has not timedout and max_active_runs is reached new_dr = scheduler.create_dag_run(dag) self.assertIsNone(new_dr) # Should be scheduled as dagrun_timeout has passed dr.start_date = datetime.datetime.now() - datetime.timedelta(days=1) session.merge(dr) session.commit() new_dr = scheduler.create_dag_run(dag) self.assertIsNotNone(new_dr) def test_scheduler_max_active_runs_respected_after_clear(self): """ Test if _process_task_instances only schedules ti's up to max_active_runs (related to issue AIRFLOW-137) """ dag = DAG( dag_id='test_scheduler_max_active_runs_respected_after_clear', start_date=DEFAULT_DATE) dag.max_active_runs = 3 dag_task1 = DummyOperator( task_id='dummy', dag=dag, owner='airflow') session = settings.Session() orm_dag = DagModel(dag_id=dag.dag_id) session.merge(orm_dag) session.commit() session.close() scheduler = SchedulerJob() dag.clear() # First create up to 3 dagruns in RUNNING state. scheduler.create_dag_run(dag) # Reduce max_active_runs to 1 dag.max_active_runs = 1 queue = mock.Mock() # and schedule them in, so we can check how many # tasks are put on the queue (should be one, not 3) scheduler._process_task_instances(dag, queue=queue) queue.append.assert_called_with( (dag.dag_id, dag_task1.task_id, DEFAULT_DATE) ) @patch.object(TI, 'pool_full') def test_scheduler_verify_pool_full(self, mock_pool_full): """ Test task instances not queued when pool is full """ mock_pool_full.return_value = False dag = DAG( dag_id='test_scheduler_verify_pool_full', start_date=DEFAULT_DATE) DummyOperator( task_id='dummy', dag=dag, owner='airflow', pool='test_scheduler_verify_pool_full') session = settings.Session() pool = Pool(pool='test_scheduler_verify_pool_full', slots=1) session.add(pool) orm_dag = DagModel(dag_id=dag.dag_id) orm_dag.is_paused = False session.merge(orm_dag) session.commit() scheduler = SchedulerJob() dag.clear() # Create 2 dagruns, which will create 2 task instances. dr = scheduler.create_dag_run(dag) self.assertIsNotNone(dr) self.assertEquals(dr.execution_date, DEFAULT_DATE) dr = scheduler.create_dag_run(dag) self.assertIsNotNone(dr) queue = [] scheduler._process_task_instances(dag, queue=queue) self.assertEquals(len(queue), 2) dagbag = SimpleDagBag([dag]) # Recreated part of the scheduler here, to kick off tasks -> executor for ti_key in queue: task = dag.get_task(ti_key[1]) ti = TI(task, ti_key[2]) # Task starts out in the scheduled state. All tasks in the # scheduled state will be sent to the executor ti.state = State.SCHEDULED # Also save this task instance to the DB. session.merge(ti) session.commit() scheduler._execute_task_instances(dagbag, (State.SCHEDULED, State.UP_FOR_RETRY)) self.assertEquals(len(scheduler.executor.queued_tasks), 1) def test_scheduler_auto_align(self): """ Test if the schedule_interval will be auto aligned with the start_date such that if the start_date coincides with the schedule the first execution_date will be start_date, otherwise it will be start_date + interval. """ dag = DAG( dag_id='test_scheduler_auto_align_1', start_date=datetime.datetime(2016, 1, 1, 10, 10, 0), schedule_interval="4 5 * * *" ) dag_task1 = DummyOperator( task_id='dummy', dag=dag, owner='airflow') session = settings.Session() orm_dag = DagModel(dag_id=dag.dag_id) session.merge(orm_dag) session.commit() scheduler = SchedulerJob() dag.clear() dr = scheduler.create_dag_run(dag) self.assertIsNotNone(dr) self.assertEquals(dr.execution_date, datetime.datetime(2016, 1, 2, 5, 4)) dag = DAG( dag_id='test_scheduler_auto_align_2', start_date=datetime.datetime(2016, 1, 1, 10, 10, 0), schedule_interval="10 10 * * *" ) dag_task1 = DummyOperator( task_id='dummy', dag=dag, owner='airflow') session = settings.Session() orm_dag = DagModel(dag_id=dag.dag_id) session.merge(orm_dag) session.commit() scheduler = SchedulerJob() dag.clear() dr = scheduler.create_dag_run(dag) self.assertIsNotNone(dr) self.assertEquals(dr.execution_date, datetime.datetime(2016, 1, 1, 10, 10)) def test_scheduler_reschedule(self): """ Checks if tasks that are not taken up by the executor get rescheduled """ executor = TestExecutor() dagbag = DagBag(executor=executor) dagbag.dags.clear() dagbag.executor = executor dag = DAG( dag_id='test_scheduler_reschedule', start_date=DEFAULT_DATE) dag_task1 = DummyOperator( task_id='dummy', dag=dag, owner='airflow') dag.clear() dag.is_subdag = False session = settings.Session() orm_dag = DagModel(dag_id=dag.dag_id) orm_dag.is_paused = False session.merge(orm_dag) session.commit() dagbag.bag_dag(dag=dag, root_dag=dag, parent_dag=dag) @mock.patch('airflow.models.DagBag', return_value=dagbag) @mock.patch('airflow.models.DagBag.collect_dags') def do_schedule(function, function2): # Use a empty file since the above mock will return the # expected DAGs. Also specify only a single file so that it doesn't # try to schedule the above DAG repeatedly. scheduler = SchedulerJob(num_runs=1, executor=executor, subdir=os.path.join(settings.DAGS_FOLDER, "no_dags.py")) scheduler.heartrate = 0 scheduler.run() do_schedule() self.assertEquals(1, len(executor.queued_tasks)) executor.queued_tasks.clear() do_schedule() self.assertEquals(2, len(executor.queued_tasks)) def test_retry_still_in_executor(self): """ Checks if the scheduler does not put a task in limbo, when a task is retried but is still present in the executor. """ executor = TestExecutor() dagbag = DagBag(executor=executor) dagbag.dags.clear() dagbag.executor = executor dag = DAG( dag_id='test_retry_still_in_executor', start_date=DEFAULT_DATE, schedule_interval="@once") dag_task1 = BashOperator( task_id='test_retry_handling_op', bash_command='exit 1', retries=1, dag=dag, owner='airflow') dag.clear() dag.is_subdag = False session = settings.Session() orm_dag = DagModel(dag_id=dag.dag_id) orm_dag.is_paused = False session.merge(orm_dag) session.commit() dagbag.bag_dag(dag=dag, root_dag=dag, parent_dag=dag) @mock.patch('airflow.models.DagBag', return_value=dagbag) @mock.patch('airflow.models.DagBag.collect_dags') def do_schedule(function, function2): # Use a empty file since the above mock will return the # expected DAGs. Also specify only a single file so that it doesn't # try to schedule the above DAG repeatedly. scheduler = SchedulerJob(num_runs=1, executor=executor, subdir=os.path.join(settings.DAGS_FOLDER, "no_dags.py")) scheduler.heartrate = 0 scheduler.run() do_schedule() self.assertEquals(1, len(executor.queued_tasks)) def run_with_error(task): try: task.run() except AirflowException: pass ti_tuple = six.next(six.itervalues(executor.queued_tasks)) (command, priority, queue, ti) = ti_tuple ti.task = dag_task1 # fail execution run_with_error(ti) self.assertEqual(ti.state, State.UP_FOR_RETRY) self.assertEqual(ti.try_number, 1) ti.refresh_from_db(lock_for_update=True, session=session) ti.state = State.SCHEDULED session.merge(ti) session.commit() # do not schedule do_schedule() self.assertTrue(executor.has_task(ti)) ti.refresh_from_db() self.assertEqual(ti.state, State.SCHEDULED) # now the executor has cleared and it should be allowed the re-queue executor.queued_tasks.clear() do_schedule() ti.refresh_from_db() self.assertEqual(ti.state, State.QUEUED) @unittest.skipUnless("INTEGRATION" in os.environ, "Can only run end to end") def test_retry_handling_job(self): """ Integration test of the scheduler not accidentally resetting the try_numbers for a task """ dag = self.dagbag.get_dag('test_retry_handling_job') dag_task1 = dag.get_task("test_retry_handling_op") dag.clear() scheduler = SchedulerJob(dag_id=dag.dag_id, num_runs=1) scheduler.heartrate = 0 scheduler.run() session = settings.Session() ti = session.query(TI).filter(TI.dag_id==dag.dag_id, TI.task_id==dag_task1.task_id).first() # make sure the counter has increased self.assertEqual(ti.try_number, 2) self.assertEqual(ti.state, State.UP_FOR_RETRY) def test_scheduler_run_duration(self): """ Verifies that the scheduler run duration limit is followed. """ dag_id = 'test_start_date_scheduling' dag = self.dagbag.get_dag(dag_id) dag.clear() self.assertTrue(dag.start_date > DEFAULT_DATE) expected_run_duration = 5 start_time = datetime.datetime.now() scheduler = SchedulerJob(dag_id, run_duration=expected_run_duration, **self.default_scheduler_args) scheduler.run() end_time = datetime.datetime.now() run_duration = (end_time - start_time).total_seconds() logging.info("Test ran in %.2fs, expected %.2fs", run_duration, expected_run_duration) self.assertLess(run_duration - expected_run_duration, 5.0) def test_dag_with_system_exit(self): """ Test to check that a DAG with a system.exit() doesn't break the scheduler. """ dag_id = 'exit_test_dag' dag_ids = [dag_id] dag_directory = os.path.join(settings.DAGS_FOLDER, "..", "dags_with_system_exit") dag_file = os.path.join(dag_directory, 'b_test_scheduler_dags.py') dagbag = DagBag(dag_folder=dag_file) for dag_id in dag_ids: dag = dagbag.get_dag(dag_id) dag.clear() scheduler = SchedulerJob(dag_ids=dag_ids, subdir= dag_directory, num_runs=1, **self.default_scheduler_args) scheduler.run() session = settings.Session() self.assertEqual( len(session.query(TI).filter(TI.dag_id == dag_id).all()), 1) def test_dag_get_active_runs(self): """ Test to check that a DAG returns it's active runs """ now = datetime.datetime.now() six_hours_ago_to_the_hour = (now - datetime.timedelta(hours=6)).replace(minute=0, second=0, microsecond=0) START_DATE = six_hours_ago_to_the_hour DAG_NAME1 = 'get_active_runs_test' default_args = { 'owner': 'airflow', 'depends_on_past': False, 'start_date': START_DATE } dag1 = DAG(DAG_NAME1, schedule_interval='* * * * *', max_active_runs=1, default_args=default_args ) run_this_1 = DummyOperator(task_id='run_this_1', dag=dag1) run_this_2 = DummyOperator(task_id='run_this_2', dag=dag1) run_this_2.set_upstream(run_this_1) run_this_3 = DummyOperator(task_id='run_this_3', dag=dag1) run_this_3.set_upstream(run_this_2) session = settings.Session() orm_dag = DagModel(dag_id=dag1.dag_id) session.merge(orm_dag) session.commit() session.close() scheduler = SchedulerJob() dag1.clear() dr = scheduler.create_dag_run(dag1) # We had better get a dag run self.assertIsNotNone(dr) execution_date = dr.execution_date running_dates = dag1.get_active_runs() try: running_date = running_dates[0] except: running_date = 'Except' self.assertEqual(execution_date, running_date, 'Running Date must match Execution Date') def test_dag_catchup_option(self): """ Test to check that a DAG with catchup = False only schedules beginning now, not back to the start date """ now = datetime.datetime.now() six_hours_ago_to_the_hour = (now - datetime.timedelta(hours=6)).replace(minute=0, second=0, microsecond=0) three_minutes_ago = now - datetime.timedelta(minutes=3) two_hours_and_three_minutes_ago = three_minutes_ago - datetime.timedelta(hours=2) START_DATE = six_hours_ago_to_the_hour DAG_NAME1 = 'no_catchup_test1' DAG_NAME2 = 'no_catchup_test2' DAG_NAME3 = 'no_catchup_test3' default_args = { 'owner': 'airflow', 'depends_on_past': False, 'start_date': START_DATE } dag1 = DAG(DAG_NAME1, schedule_interval='* * * * *', max_active_runs=1, default_args=default_args ) default_catchup = configuration.getboolean('scheduler', 'catchup_by_default') # Test configs have catchup by default ON self.assertEqual(default_catchup, True) # Correct default? self.assertEqual(dag1.catchup, True) dag2 = DAG(DAG_NAME2, schedule_interval='* * * * *', max_active_runs=1, catchup=False, default_args=default_args ) run_this_1 = DummyOperator(task_id='run_this_1', dag=dag2) run_this_2 = DummyOperator(task_id='run_this_2', dag=dag2) run_this_2.set_upstream(run_this_1) run_this_3 = DummyOperator(task_id='run_this_3', dag=dag2) run_this_3.set_upstream(run_this_2) session = settings.Session() orm_dag = DagModel(dag_id=dag2.dag_id) session.merge(orm_dag) session.commit() session.close() scheduler = SchedulerJob() dag2.clear() dr = scheduler.create_dag_run(dag2) # We had better get a dag run self.assertIsNotNone(dr) # The DR should be scheduled in the last 3 minutes, not 6 hours ago self.assertGreater(dr.execution_date, three_minutes_ago) # The DR should be scheduled BEFORE now self.assertLess(dr.execution_date, datetime.datetime.now()) dag3 = DAG(DAG_NAME3, schedule_interval='@hourly', max_active_runs=1, catchup=False, default_args=default_args ) run_this_1 = DummyOperator(task_id='run_this_1', dag=dag3) run_this_2 = DummyOperator(task_id='run_this_2', dag=dag3) run_this_2.set_upstream(run_this_1) run_this_3 = DummyOperator(task_id='run_this_3', dag=dag3) run_this_3.set_upstream(run_this_2) session = settings.Session() orm_dag = DagModel(dag_id=dag3.dag_id) session.merge(orm_dag) session.commit() session.close() scheduler = SchedulerJob() dag3.clear() dr = None dr = scheduler.create_dag_run(dag3) # We had better get a dag run self.assertIsNotNone(dr) # The DR should be scheduled in the last two hours, not 6 hours ago self.assertGreater(dr.execution_date, two_hours_and_three_minutes_ago) # The DR should be scheduled BEFORE now self.assertLess(dr.execution_date, datetime.datetime.now()) def test_add_unparseable_file_before_sched_start_creates_import_error(self): try: dags_folder = mkdtemp() unparseable_filename = os.path.join(dags_folder, TEMP_DAG_FILENAME) with open(unparseable_filename, 'w') as unparseable_file: unparseable_file.writelines(UNPARSEABLE_DAG_FILE_CONTENTS) self.run_single_scheduler_loop_with_no_dags(dags_folder) finally: shutil.rmtree(dags_folder) session = settings.Session() import_errors = session.query(models.ImportError).all() self.assertEqual(len(import_errors), 1) import_error = import_errors[0] self.assertEqual(import_error.filename, unparseable_filename) self.assertEqual(import_error.stacktrace, "invalid syntax ({}, line 1)".format(TEMP_DAG_FILENAME)) def test_add_unparseable_file_after_sched_start_creates_import_error(self): try: dags_folder = mkdtemp() unparseable_filename = os.path.join(dags_folder, TEMP_DAG_FILENAME) self.run_single_scheduler_loop_with_no_dags(dags_folder) with open(unparseable_filename, 'w') as unparseable_file: unparseable_file.writelines(UNPARSEABLE_DAG_FILE_CONTENTS) self.run_single_scheduler_loop_with_no_dags(dags_folder) finally: shutil.rmtree(dags_folder) session = settings.Session() import_errors = session.query(models.ImportError).all() self.assertEqual(len(import_errors), 1) import_error = import_errors[0] self.assertEqual(import_error.filename, unparseable_filename) self.assertEqual(import_error.stacktrace, "invalid syntax ({}, line 1)".format(TEMP_DAG_FILENAME)) def test_no_import_errors_with_parseable_dag(self): try: dags_folder = mkdtemp() parseable_filename = os.path.join(dags_folder, TEMP_DAG_FILENAME) with open(parseable_filename, 'w') as parseable_file: parseable_file.writelines(PARSEABLE_DAG_FILE_CONTENTS) self.run_single_scheduler_loop_with_no_dags(dags_folder) finally: shutil.rmtree(dags_folder) session = settings.Session() import_errors = session.query(models.ImportError).all() self.assertEqual(len(import_errors), 0) def test_new_import_error_replaces_old(self): try: dags_folder = mkdtemp() unparseable_filename = os.path.join(dags_folder, TEMP_DAG_FILENAME) # Generate original import error with open(unparseable_filename, 'w') as unparseable_file: unparseable_file.writelines(UNPARSEABLE_DAG_FILE_CONTENTS) self.run_single_scheduler_loop_with_no_dags(dags_folder) # Generate replacement import error (the error will be on the second line now) with open(unparseable_filename, 'w') as unparseable_file: unparseable_file.writelines( PARSEABLE_DAG_FILE_CONTENTS + os.linesep + UNPARSEABLE_DAG_FILE_CONTENTS) self.run_single_scheduler_loop_with_no_dags(dags_folder) finally: shutil.rmtree(dags_folder) session = settings.Session() import_errors = session.query(models.ImportError).all() self.assertEqual(len(import_errors), 1) import_error = import_errors[0] self.assertEqual(import_error.filename, unparseable_filename) self.assertEqual(import_error.stacktrace, "invalid syntax ({}, line 2)".format(TEMP_DAG_FILENAME)) def test_remove_error_clears_import_error(self): try: dags_folder = mkdtemp() filename_to_parse = os.path.join(dags_folder, TEMP_DAG_FILENAME) # Generate original import error with open(filename_to_parse, 'w') as file_to_parse: file_to_parse.writelines(UNPARSEABLE_DAG_FILE_CONTENTS) self.run_single_scheduler_loop_with_no_dags(dags_folder) # Remove the import error from the file with open(filename_to_parse, 'w') as file_to_parse: file_to_parse.writelines( PARSEABLE_DAG_FILE_CONTENTS) self.run_single_scheduler_loop_with_no_dags(dags_folder) finally: shutil.rmtree(dags_folder) session = settings.Session() import_errors = session.query(models.ImportError).all() self.assertEqual(len(import_errors), 0) def test_remove_file_clears_import_error(self): try: dags_folder = mkdtemp() filename_to_parse = os.path.join(dags_folder, TEMP_DAG_FILENAME) # Generate original import error with open(filename_to_parse, 'w') as file_to_parse: file_to_parse.writelines(UNPARSEABLE_DAG_FILE_CONTENTS) self.run_single_scheduler_loop_with_no_dags(dags_folder) finally: shutil.rmtree(dags_folder) # Rerun the scheduler once the dag file has been removed self.run_single_scheduler_loop_with_no_dags(dags_folder) session = settings.Session() import_errors = session.query(models.ImportError).all() self.assertEqual(len(import_errors), 0)
import shutil import os.path import pytest import hashlib import operator from unittest import TestCase from pyspark.sql.functions import col, concat, max, min, array, udf, lit from pyspark.sql.types import StructType, StructField, StringType, IntegerType, ArrayType, \ DoubleType from bigdl.orca import OrcaContext from bigdl.friesian.feature import FeatureTable, StringIndex, TargetCode from bigdl.dllib.nncontext import * class TestTable(TestCase): def setup_method(self, method): """ setup any state tied to the execution of the given method in a class. setup_method is invoked for every test method of a class. """ self.resource_path = os.path.join(os.path.split(__file__)[0], "../resources") def test_apply(self): file_path = os.path.join(self.resource_path, "parquet/data1.parquet") feature_tbl = FeatureTable.read_parquet(file_path) feature_tbl = feature_tbl.fillna(0, "col_1") # udf on single column transform = lambda x: x + 1 feature_tbl = feature_tbl.apply("col_1", "new_col_1", transform, dtype="int") col1_values = feature_tbl.select("col_1").df.rdd.flatMap(lambda x: x).collect() updated_col1_values = feature_tbl.select("new_col_1").df.rdd.flatMap(lambda x: x).collect() assert [v + 1 for v in col1_values] == updated_col1_values # udf on multi columns transform = lambda x: "xxxx" feature_tbl = feature_tbl.apply(["col_2", "col_4", "col_5"], "out", transform) out_values = feature_tbl.select("out").df.rdd.flatMap(lambda x: x).collect() assert out_values == ["xxxx"] * len(out_values) def test_apply_with_data(self): file_path = os.path.join(self.resource_path, "parquet/data1.parquet") feature_tbl = FeatureTable.read_parquet(file_path) feature_tbl = feature_tbl.fillna(0, "col_1") # udf on single column y = {"ace": 1, "aa": 2} transform = lambda x: y.get(x, 0) feature_tbl = feature_tbl.apply("col_5", "out", transform, "int") assert(feature_tbl.filter(col("out") == 2).size() == 3) assert(feature_tbl.filter(col("out") == 1).size() == 1) assert(feature_tbl.filter(col("out") == 0).size() == 1) def test_fillna_int(self): file_path = os.path.join(self.resource_path, "parquet/data1.parquet") feature_tbl = FeatureTable.read_parquet(file_path) filled_tbl = feature_tbl.fillna(5, ["col_2", "col_3"]) assert isinstance(filled_tbl, FeatureTable), "filled_tbl should be a FeatureTable" assert feature_tbl.df.filter("col_2 is null").count() != 0 and feature_tbl \ .df.filter("col_3 is null").count() != 0, "feature_tbl should not be changed" assert filled_tbl.df.filter("col_2 == 5").count() == 1, "col_2 null values should be " \ "filled with 5" assert filled_tbl.df.filter("col_3 == 5").count() == 1, "col_3 null values should be " \ "filled with 5" filled_tbl = feature_tbl.fillna(5, None) assert filled_tbl.df.filter("col_2 == 5").count() == 1, "col_2 null values should be " \ "filled with 5" assert filled_tbl.df.filter("col_3 == 5").count() == 1, "col_3 null values should be " \ "filled with 5" with self.assertRaises(Exception) as context: feature_tbl.fillna(0, ["col_2", "col_3", "col_8"]) self.assertTrue('do not exist in this Table' in str(context.exception)) def test_fillna_double(self): file_path = os.path.join(self.resource_path, "parquet/data1.parquet") feature_tbl = FeatureTable.read_parquet(file_path) filled_tbl = feature_tbl.fillna(3.2, ["col_2", "col_3"]) assert isinstance(filled_tbl, FeatureTable), "filled_tbl should be a FeatureTable" assert feature_tbl.df.filter("col_2 is null").count() != 0 and feature_tbl \ .df.filter("col_3 is null").count() != 0, "feature_tbl should not be changed" assert filled_tbl.df.filter("col_2 is null").count() == 0, "col_2 null values should be " \ "filled" assert filled_tbl.df.filter("col_3 is null").count() == 0, "col_3 null values should be " \ "filled" filled_tbl = feature_tbl.fillna(5, ["col_2", "col_3"]) assert filled_tbl.df.filter("col_2 == 5").count() == 1, "col_2 null values should be " \ "filled with 5" assert filled_tbl.df.filter("col_3 == 5").count() == 1, "col_3 null values should be " \ "filled with 5" def test_fillna_long(self): file_path = os.path.join(self.resource_path, "parquet/data1.parquet") feature_tbl = FeatureTable.read_parquet(file_path) filled_tbl = feature_tbl.fillna(3, ["col_1", "col_2", "col_3"]) assert isinstance(filled_tbl, FeatureTable), "filled_tbl should be a FeatureTable" assert feature_tbl.df.filter("col_2 is null").count() != 0 and feature_tbl \ .df.filter("col_3 is null").count() != 0, "feature_tbl should not be changed" assert filled_tbl.df.filter("col_1 is null").count() == 0, "col_1 null values should be " \ "filled" assert filled_tbl.df.filter("col_2 is null").count() == 0, "col_2 null values should be " \ "filled" assert filled_tbl.df.filter("col_3 is null").count() == 0, "col_3 null values should be " \ "filled" def test_fillna_string(self): file_path = os.path.join(self.resource_path, "parquet/data1.parquet") feature_tbl = FeatureTable.read_parquet(file_path) with self.assertRaises(Exception) as context: feature_tbl.fillna(3.2, ["col_4", "col_5"]) self.assertTrue('numeric does not match the type of column col_4' in str(context.exception)) filled_tbl = feature_tbl.fillna("bb", ["col_4", "col_5"]) assert isinstance(filled_tbl, FeatureTable), "filled_tbl should be a FeatureTable" assert filled_tbl.df.filter("col_4 is null").count() == 0, "col_4 null values should be " \ "filled" assert filled_tbl.df.filter("col_5 is null").count() == 0, "col_5 null values should be " \ "filled" def test_filter_by_frequency(self): data = [("a", "b", 1), ("b", "a", 2), ("a", "bc", 3), ("c", "c", 2), ("b", "a", 2), ("ab", "c", 1), ("c", "b", 1), ("a", "b", 1)] schema = StructType([StructField("A", StringType(), True), StructField("B", StringType(), True), StructField("C", IntegerType(), True)]) spark = OrcaContext.get_spark_session() df = spark.createDataFrame(data, schema) tbl = FeatureTable(df).filter_by_frequency(["A", "B", "C"]) assert tbl.to_spark_df().count() == 2, "the count of frequency >=2 should be 2" def test_hash_encode(self): spark = OrcaContext.get_spark_session() data = [("a", "b", 1), ("b", "a", 2), ("a", "c", 3), ("c", "c", 2), ("b", "a", 1), ("a", "d", 1)] schema = StructType([StructField("A", StringType(), True), StructField("B", StringType(), True), StructField("C", IntegerType(), True)]) df = spark.createDataFrame(data, schema) tbl = FeatureTable(df) hash_str = lambda x: hashlib.md5(str(x).encode('utf-8', 'strict')).hexdigest() hash_int = lambda x: int(hash_str(x), 16) % 100 hash_value = [] for row in df.collect(): hash_value.append(hash_int(row[0])) tbl_hash = [] for record in tbl.hash_encode(["A"], 100).to_spark_df().collect(): tbl_hash.append(int(record[0])) assert(operator.eq(hash_value, tbl_hash)), "the hash encoded value should be equal" def test_cross_hash_encode(self): spark = OrcaContext.get_spark_session() data = [("a", "b", "c", 1), ("b", "a", "d", 2), ("a", "c", "e", 3), ("c", "c", "c", 2), ("b", "a", "d", 1), ("a", "d", "e", 1)] schema = StructType([StructField("A", StringType(), True), StructField("B", StringType(), True), StructField("C", StringType(), True), StructField("D", IntegerType(), True)]) df = spark.createDataFrame(data, schema) cross_hash_df = df.withColumn("A_B_C", concat("A", "B", "C")) tbl = FeatureTable(df) cross_hash_str = lambda x: hashlib.md5(str(x).encode('utf-8', 'strict')).hexdigest() cross_hash_int = lambda x: int(cross_hash_str(x), 16) % 100 cross_hash_value = [] for row in cross_hash_df.collect(): cross_hash_value.append(cross_hash_int(row[4])) tbl_cross_hash = [] for record in tbl.cross_hash_encode(["A", "B", "C"], 100).to_spark_df().collect(): tbl_cross_hash.append(int(record[4])) assert(operator.eq(cross_hash_value, tbl_cross_hash)), "the crossed hash encoded value" \ "should be equal" def test_gen_string_idx(self): file_path = os.path.join(self.resource_path, "parquet/data1.parquet") feature_tbl = FeatureTable.read_parquet(file_path) string_idx_list = feature_tbl.gen_string_idx(["col_4", "col_5"], freq_limit=1) assert string_idx_list[0].size() == 3, "col_4 should have 3 indices" assert string_idx_list[1].size() == 2, "col_5 should have 2 indices" with tempfile.TemporaryDirectory() as local_path: for str_idx in string_idx_list: str_idx.write_parquet(local_path) str_idx_log = str_idx.log(["id"]) assert str_idx.df.filter("id == 1").count() == 1, "id in str_idx should = 1" assert str_idx_log.df.filter("id == 1").count() == 0, "id in str_idx_log should " \ "!= 1" assert os.path.isdir(local_path + "/col_4.parquet") assert os.path.isdir(local_path + "/col_5.parquet") new_col_4_idx = StringIndex.read_parquet(local_path + "/col_4.parquet") assert "col_4" in new_col_4_idx.df.columns, "col_4 should be a column of new_col_4_idx" with self.assertRaises(Exception) as context: StringIndex.read_parquet(local_path + "/col_5.parquet", "col_4") self.assertTrue('col_4 should be a column of the DataFrame' in str(context.exception)) def test_gen_string_idx_dict(self): file_path = os.path.join(self.resource_path, "parquet/data1.parquet") feature_tbl = FeatureTable.read_parquet(file_path) string_idx_list = feature_tbl.gen_string_idx(["col_4", "col_5"], freq_limit={"col_4": 1, "col_5": 3}) with self.assertRaises(Exception) as context: feature_tbl.gen_string_idx(["col_4", "col_5"], freq_limit="col_4:1,col_5:3") self.assertTrue('freq_limit only supports int, dict or None, but get str' in str( context.exception)) assert string_idx_list[0].size() == 3, "col_4 should have 3 indices" assert string_idx_list[1].size() == 1, "col_5 should have 1 indices" def test_gen_string_idx_none(self): file_path = os.path.join(self.resource_path, "parquet/data1.parquet") feature_tbl = FeatureTable.read_parquet(file_path) string_idx_list = feature_tbl.gen_string_idx(["col_4", "col_5"], freq_limit=None) assert string_idx_list[0].size() == 3, "col_4 should have 3 indices" assert string_idx_list[1].size() == 2, "col_5 should have 2 indices" def test_gen_reindex_mapping(self): file_path = os.path.join(self.resource_path, "parquet/data1.parquet") feature_tbl = FeatureTable.read_parquet(file_path) string_idx_list = feature_tbl.gen_string_idx(["col_4", "col_5"], freq_limit={"col_4": 1, "col_5": 1}, order_by_freq=False) tbl = feature_tbl.encode_string(["col_4", "col_5"], string_idx_list) index_tbls = tbl.gen_reindex_mapping(["col_4", "col_5"], 1) assert(index_tbls[0].size() == 3) assert(index_tbls[1].size() == 2) def test_gen_string_idx_union(self): file_path = os.path.join(self.resource_path, "parquet/data1.parquet") feature_tbl = FeatureTable.read_parquet(file_path) string_idx_list1 = feature_tbl \ .gen_string_idx(["col_4", 'col_5'], freq_limit=1) assert string_idx_list1[0].size() == 3, "col_4 should have 3 indices" assert string_idx_list1[1].size() == 2, "col_5 should have 2 indices" new_tbl1 = feature_tbl.encode_string(['col_4', 'col_5'], string_idx_list1) assert new_tbl1.max("col_5").to_list("max")[0] == 2, "col_5 max value should be 2" string_idx_list2 = feature_tbl \ .gen_string_idx(["col_4", {"src_cols": ["col_4", "col_5"], "col_name": 'col_5'}], freq_limit=1) assert string_idx_list2[0].size() == 3, "col_4 should have 3 indices" assert string_idx_list2[1].size() == 4, "col_5 should have 4 indices" new_tbl2 = feature_tbl.encode_string(['col_4', 'col_5'], string_idx_list2) assert new_tbl2.max("col_5").to_list("max")[0] == 4, "col_5 max value should be 4" string_idx_3 = feature_tbl \ .gen_string_idx({"src_cols": ["col_4", "col_5"], "col_name": 'col_5'}, freq_limit=1) assert string_idx_3.size() == 4, "col_5 should have 4 indices" new_tbl3 = feature_tbl.encode_string('col_5', string_idx_3) assert new_tbl3.max("col_5").to_list("max")[0] == 4, "col_5 max value should be 4" def test_gen_string_idx_split(self): file_path = os.path.join(self.resource_path, "parquet/data1.parquet") feature_tbl = FeatureTable.read_parquet(file_path) to_list_str = udf(lambda arr: ','.join(arr)) df = feature_tbl.dropna(['col_4', 'col_5']).df.withColumn("list1", array('col_4', 'col_5'))\ .withColumn("list1", to_list_str(col("list1"))) tbl = FeatureTable(df) string_idx_1 = tbl.gen_string_idx("list1", do_split=True, sep=",", freq_limit=1) assert string_idx_1.size() == 4, "list1 should have 4 indices" new_tbl1 = tbl.encode_string('list1', string_idx_1, do_split=True, sep=",") assert isinstance(new_tbl1.to_list("list1"), list), \ "encode list should return list of int" new_tbl2 = tbl.encode_string(['list1'], string_idx_1, do_split=True, sep=",", sort_for_array=True) l1 = new_tbl2.to_list("list1")[0] l2 = l1.copy() l2.sort() assert l1 == l2, "encode list with sort should sort" new_tbl3 = tbl.encode_string(['list1'], string_idx_1, do_split=True, sep=",", keep_most_frequent=True) assert isinstance(new_tbl3.to_list("list1")[0], int), \ "encode list with keep most frequent should only keep one int" def test_clip(self): file_path = os.path.join(self.resource_path, "parquet/data1.parquet") feature_tbl = FeatureTable.read_parquet(file_path) clip_tbl = feature_tbl.clip(["col_1", "col_2", "col_3"], min=2, max=None) assert isinstance(clip_tbl, FeatureTable), "clip_tbl should be a FeatureTable" assert feature_tbl.df.filter("col_1 < 2").count() != 0 and feature_tbl \ .df.filter("col_2 < 2").count() != 0, "feature_tbl should not be changed" assert clip_tbl.df.filter("col_1 < 2").count() == 0, "col_1 should >= 2" assert clip_tbl.df.filter("col_2 < 2").count() == 0, "col_2 should >= 2" assert clip_tbl.df.filter("col_3 < 2").count() == 0, "col_3 should >= 2" with self.assertRaises(Exception) as context: feature_tbl.clip(None, 2) self.assertTrue('columns should be str or a list of str, but got None.' in str(context.exception)) feature_tbl = FeatureTable.read_parquet(file_path) clip_tbl = feature_tbl.clip(["col_1", "col_2", "col_3"], min=None, max=1) assert isinstance(clip_tbl, FeatureTable), "clip_tbl should be a FeatureTable" assert feature_tbl.df.filter("col_1 > 1").count() != 0 and feature_tbl \ .df.filter("col_2 > 1").count() != 0, "feature_tbl should not be changed" assert clip_tbl.df.filter("col_1 > 1").count() == 0, "col_1 should <= 1" assert clip_tbl.df.filter("col_2 > 1").count() == 0, "col_2 should <= 1" assert clip_tbl.df.filter("col_3 > 1").count() == 0, "col_3 should <= 1" feature_tbl = FeatureTable.read_parquet(file_path) clip_tbl = feature_tbl.clip(["col_1", "col_2", "col_3"], min=0, max=1) assert isinstance(clip_tbl, FeatureTable), "clip_tbl should be a FeatureTable" assert feature_tbl.df.filter("col_1 > 1 or col_1 < 0").count() != 0 and feature_tbl \ .df.filter("col_2 > 1 or col_2 < 0").count() != 0, "feature_tbl should not be changed" assert clip_tbl.df.filter("col_1 < 0").count() == 0, "col_1 should >= 0" assert clip_tbl.df.filter("col_2 > 1").count() == 0, "col_2 should <= 1" assert clip_tbl.df.filter("col_3 < 0 or col_3 > 1").count() == 0, "col_3 should >=0 " \ "and <= 1" def test_dropna(self): file_path = os.path.join(self.resource_path, "parquet/data1.parquet") feature_tbl = FeatureTable.read_parquet(file_path) dropped_tbl = feature_tbl.dropna(["col_1", "col_4"]) assert isinstance(dropped_tbl, FeatureTable), "dropped_tbl should be a FeatureTable" assert feature_tbl.df.filter("col_1 is null").count() != 0 and feature_tbl\ .df.filter("col_4 is null").count() != 0, "feature_tbl should not be changed" assert dropped_tbl.df.filter("col_1 is null").count() == 0, "col_1 null values should " \ "be dropped" assert dropped_tbl.df.filter("col_4 is null").count() == 0, "col_4 null values should " \ "be dropped" assert 0 < dropped_tbl.df.count() < feature_tbl.df.count(), "the number of rows should " \ "be decreased" dropped_tbl = feature_tbl.dropna(["col_1", "col_4"], how="all") assert dropped_tbl.df.filter("col_1 is null and col_4 is null").count() == 0, \ "col_1 and col_4 should not both have null values" dropped_tbl = feature_tbl.dropna(["col_2", "col_4"], how="all") assert dropped_tbl.df.filter("col_2 is null").count() > 0, \ "col_2 should still have null values after dropna with how=all" dropped_tbl = feature_tbl.dropna(["col_2", "col_3", "col_5"], thresh=2) assert dropped_tbl.df.filter("col_2 is null").count() > 0, \ "col_2 should still have null values after dropna with thresh=2" assert dropped_tbl.df.filter("col_3 is null and col_5 is null").count() == 0, \ "col_3 and col_5 should not both have null values" def test_fill_median(self): file_path = os.path.join(self.resource_path, "parquet/data1.parquet") feature_tbl = FeatureTable.read_parquet(file_path) with self.assertRaises(Exception) as context: feature_tbl.fill_median(["col_4", "col_5"]) self.assertTrue('col_4 with data type StringType is not supported' in str(context.exception)) filled_tbl = feature_tbl.fill_median(["col_1", "col_2"]) assert isinstance(filled_tbl, FeatureTable), "filled_tbl should be a FeatureTable" assert filled_tbl.df.filter("col_1 is null").count() == 0, "col_1 null values should be " \ "filled" assert filled_tbl.df.filter("col_2 is null").count() == 0, "col_2 null values should be " \ "filled" def test_filter(self): file_path = os.path.join(self.resource_path, "parquet/data1.parquet") feature_tbl = FeatureTable.read_parquet(file_path) filtered_tbl = feature_tbl.filter(feature_tbl.col_1 == 1) assert filtered_tbl.size() == 3, "Only 3 out of 5 rows has value 1 for col_1" filtered_tbl2 = feature_tbl.filter( (feature_tbl.col("col_1") == 1) & (feature_tbl.col_2 == 1)) assert filtered_tbl2.size() == 1, "Only 1 out of 5 rows has value 1 for col_1 and col_2" def test_random_split(self): file_path = os.path.join(self.resource_path, "parquet/data1.parquet") feature_tbl = FeatureTable.read_parquet(file_path) table1, table2 = feature_tbl.random_split([0.8, 0.2], seed=1) cnt1, cnt2 = table1.size(), table2.size() cnt = feature_tbl.size() assert cnt == cnt1 + cnt2, "size of full table should equal to sum of size of splited ones" def test_rename(self): file_path = os.path.join(self.resource_path, "parquet/data1.parquet") feature_tbl = FeatureTable.read_parquet(file_path) name_dict = {"col_1": "new_col1", "col_4": "new_col4"} rename_tbl = feature_tbl.rename(name_dict) cols = rename_tbl.df.columns assert isinstance(rename_tbl, FeatureTable), "rename_tbl should be a FeatureTable" assert "col_1" in feature_tbl.df.columns, "feature_tbl should not be changed" assert "new_col1" in cols, "new_col1 should be a column of the renamed tbl." assert "new_col4" in cols, "new_col4 should be a column of the renamed tbl." def test_log(self): file_path = os.path.join(self.resource_path, "parquet/data1.parquet") feature_tbl = FeatureTable.read_parquet(file_path) log_tbl = feature_tbl.log(["col_1", "col_2", "col_3"]) assert isinstance(log_tbl, FeatureTable), "log_tbl should be a FeatureTable" assert feature_tbl.df.filter("col_1 == 1").count() != 0 and feature_tbl \ .df.filter("col_2 == 1").count() != 0, "feature_tbl should not be changed" assert log_tbl.df.filter("col_1 == 1").count() == 0, "col_1 should != 1" assert log_tbl.df.filter("col_2 == 1").count() == 0, "col_2 should != 1" assert log_tbl.df.filter("col_3 == 1").count() == 0, "col_3 should != 1" def test_merge(self): file_path = os.path.join(self.resource_path, "parquet/data1.parquet") feature_tbl = FeatureTable.read_parquet(file_path) merged_tbl = feature_tbl.merge_cols(["col_1", "col_2", "col_3"], "int_cols") assert "col_1" not in merged_tbl.df.columns, "col_1 shouldn't be a column of merged_tbl" assert "int_cols" in merged_tbl.df.columns, "int_cols should be a column of merged_tbl" assert "col_1" in feature_tbl.df.columns, "col_1 should be a column of feature_tbl" def test_norm(self): file_path = os.path.join(self.resource_path, "parquet/data1.parquet") feature_tbl = FeatureTable.read_parquet(file_path).fillna(0, ["col_2", "col_3"]) normalized_tbl, min_max_dic = feature_tbl.min_max_scale(["col_2"]) max_value = normalized_tbl.df.select("col_2") \ .agg(max(col("col_2")).alias("max")) \ .rdd.map(lambda row: row['max']).collect()[0] min_value = normalized_tbl.df.select("col_2") \ .agg(min(col("col_2")).alias("min")) \ .rdd.map(lambda row: row['min']).collect()[0] assert max_value <= 1, "col_2 shouldn't be more than 1 after normalization" assert min_value >= 0, "col_2 shouldn't be less than 0 after normalization" tbl2 = FeatureTable(feature_tbl.df.withColumn("col2-col3", array(["col_2", "col_3"]))) normalized_tbl2, min_max_dic2 = tbl2.min_max_scale(["col_2", "col2-col3"]) test_file_path = os.path.join(self.resource_path, "parquet/data3.parquet") test_tbl = FeatureTable.read_parquet(test_file_path).fillna(0, ["col_2", "col_3"]) scaled = test_tbl.transform_min_max_scale(["col_2"], min_max_dic) max_value = scaled.df.select("col_2") \ .agg(max(col("col_2")).alias("max")) \ .rdd.map(lambda row: row['max']).collect()[0] min_value = scaled.df.select("col_2") \ .agg(min(col("col_2")).alias("min")) \ .rdd.map(lambda row: row['min']).collect()[0] assert max_value <= 1, "col_2 shouldn't be more than 1 after normalization" assert min_value >= 0, "col_2 shouldn't be less than 0 after normalization" test_tbl2 = FeatureTable(test_tbl.df.withColumn("col2-col3", array(["col_2", "col_3"]))) scaled2 = test_tbl2.transform_min_max_scale(["col_2", "col2-col3"], min_max_dic2) max_value = scaled2.df.select("col2-col3") \ .agg(max(col("col2-col3")).alias("max")) \ .rdd.map(lambda row: row['max']).collect()[0] min_value = scaled2.df.select("col2-col3") \ .agg(min(col("col2-col3")).alias("min")) \ .rdd.map(lambda row: row['min']).collect()[0] assert max_value[0] <= 1 and max_value[1] <= 1, \ "col2-col3 shouldn't be more than 1 after normalization" assert min_value[0] >= 0 and min_value[1] >= 0, \ "col2-col3 shouldn't be less than 0 after normalization" def test_cross(self): file_path = os.path.join(self.resource_path, "parquet/data1.parquet") feature_tbl = FeatureTable.read_parquet(file_path).fillna(0, ["col_2", "col_3"]) crossed_tbl = feature_tbl.cross_columns([["col_2", "col_3"]], [100]) assert "col_2_col_3" in crossed_tbl.df.columns, "crossed column is not created" max_value = crossed_tbl.df.select("col_2_col_3") \ .agg(max(col("col_2_col_3")).alias("max")) \ .rdd.map(lambda row: row['max']).collect()[0] min_value = crossed_tbl.df.select("col_2_col_3") \ .agg(min(col("col_2_col_3")).alias("min")) \ .rdd.map(lambda row: row['min']).collect()[0] assert max_value <= 100, "cross value shouldn't be more than 100 after cross" assert min_value > 0, "cross value shouldn't be less than 0 after cross" def test_add_negative_items(self): spark = OrcaContext.get_spark_session() data = [("jack", 1, "2019-07-01 12:01:19.000"), ("jack", 2, "2019-08-01 12:01:19.000"), ("jack", 3, "2019-09-01 12:01:19.000"), ("alice", 4, "2019-09-01 12:01:19.000"), ("alice", 5, "2019-10-01 12:01:19.000"), ("alice", 6, "2019-11-01 12:01:19.000")] schema = StructType([ StructField("name", StringType(), True), StructField("item", IntegerType(), True), StructField("time", StringType(), True) ]) df = spark.createDataFrame(data=data, schema=schema) tbl = FeatureTable(df).add_negative_samples(10) dft = tbl.df assert tbl.size() == 12 assert dft.filter("label == 1").count() == 6 assert dft.filter("label == 0").count() == 6 def test_add_hist_seq(self): spark = OrcaContext.get_spark_session() data = [("jack", 1, "2019-07-01 12:01:19.000"), ("jack", 2, "2019-08-01 12:01:19.000"), ("jack", 3, "2019-09-01 12:01:19.000"), ("jack", 4, "2019-07-02 12:01:19.000"), ("jack", 5, "2019-08-03 12:01:19.000"), ("jack", 6, "2019-07-04 12:01:19.000"), ("jack", 7, "2019-08-05 12:01:19.000"), ("alice", 4, "2019-09-01 12:01:19.000"), ("alice", 5, "2019-10-01 12:01:19.000"), ("alice", 6, "2019-11-01 12:01:19.000")] schema = StructType([StructField("name", StringType(), True), StructField("item", IntegerType(), True), StructField("time", StringType(), True)]) df = spark.createDataFrame(data=data, schema=schema) df = df.withColumn("ts", col("time").cast("timestamp").cast("long")) tbl = FeatureTable(df.select("name", "item", "ts")) \ .add_hist_seq(["item"], "name", "ts", 1, 4) tbl2 = FeatureTable(df.select("name", "item", "ts")) \ .add_hist_seq(["item"], "name", "ts", 1, 4, 1) assert tbl.size() == 8 assert tbl.df.filter(col("name") == "alice").count() == 2 assert tbl.df.filter("name like '%jack'").count() == 6 assert "item_hist_seq" in tbl.df.columns assert tbl2.size() == 2 assert tbl2.df.filter(col("name") == "alice").count() == 1 assert tbl2.df.filter("name like '%jack'").count() == 1 assert "item_hist_seq" in tbl2.df.columns def test_gen_neg_hist_seq(self): spark = OrcaContext.get_spark_session() sc = OrcaContext.get_spark_context() data = [ ("jack", [1, 2, 3, 4, 5]), ("alice", [4, 5, 6, 7, 8]), ("rose", [1, 2])] schema = StructType([ StructField("name", StringType(), True), StructField("item_hist_seq", ArrayType(IntegerType()), True)]) df = spark.createDataFrame(data, schema) df2 = sc \ .parallelize([(1, 0), (2, 0), (3, 0), (4, 1), (5, 1), (6, 1), (7, 2), (8, 2), (9, 2)]) \ .toDF(["item", "category"]).withColumn("item", col("item").cast("Integer")) \ .withColumn("category", col("category").cast("Integer")) tbl = FeatureTable(df) tbl = tbl.add_neg_hist_seq(9, "item_hist_seq", 4) assert tbl.df.select("neg_item_hist_seq").count() == 3 def test_add_value_features(self): spark = OrcaContext.get_spark_session() sc = OrcaContext.get_spark_context() data = [ ("jack", [1, 2, 3, 4, 5]), ("alice", [4, 5, 6, 7, 8]), ("rose", [1, 2])] schema = StructType([ StructField("name", StringType(), True), StructField("item_hist_seq", ArrayType(IntegerType()), True)]) df = spark.createDataFrame(data, schema) df.filter("name like '%alice%'").show() df2 = sc \ .parallelize([(0, 0), (1, 0), (2, 0), (3, 0), (4, 1), (5, 1), (6, 1), (8, 2), (9, 2)]) \ .toDF(["item", "category"]).withColumn("item", col("item").cast("Integer")) \ .withColumn("category", col("category").cast("Integer")) tbl = FeatureTable(df) tbl2 = tbl.add_neg_hist_seq(9, "item_hist_seq", 4) tbl3 = tbl2.add_value_features(["item_hist_seq", "neg_item_hist_seq"], FeatureTable(df2), "item", "category") assert tbl3.df.select("category_hist_seq").count() == 3 assert tbl3.df.select("neg_category_hist_seq").count() == 3 assert tbl3.df.filter("name like '%alice%'").select("neg_category_hist_seq").count() == 1 assert tbl3.df.filter("name == 'rose'").select("neg_category_hist_seq").count() == 1 def test_reindex(self): file_path = os.path.join(self.resource_path, "parquet/data1.parquet") feature_tbl = FeatureTable.read_parquet(file_path) string_idx_list = feature_tbl.gen_string_idx(["col_4", "col_5"], freq_limit={"col_4": 1, "col_5": 1}, order_by_freq=False) tbl_with_index = feature_tbl.encode_string(["col_4", "col_5"], string_idx_list) index_tbls = tbl_with_index.gen_reindex_mapping(["col_4", "col_5"], 2) reindexed = tbl_with_index.reindex(["col_4", "col_5"], index_tbls) assert(reindexed.filter(col("col_4") == 0).size() == 2) assert(reindexed.filter(col("col_4") == 1).size() == 2) assert(reindexed.filter(col("col_5") == 0).size() == 1) assert(reindexed.filter(col("col_5") == 1).size() == 3) def test_pad(self): spark = OrcaContext.get_spark_session() data = [ ("jack", [1, 2, 3, 4, 5], [[1, 2, 3], [1, 2, 3]]), ("alice", [4, 5, 6, 7, 8], [[1, 2, 3], [1, 2, 3]]), ("rose", [1, 2], [[1, 2, 3]])] schema = StructType([StructField("name", StringType(), True), StructField("list", ArrayType(IntegerType()), True), StructField("matrix", ArrayType(ArrayType(IntegerType())))]) df = spark.createDataFrame(data, schema) tbl1 = FeatureTable(df).pad(["list", "matrix"], seq_len=4) dft1 = tbl1.df tbl2 = FeatureTable(df).pad(cols=["list", "matrix"], mask_cols=["list"], seq_len=4) assert dft1.filter("size(matrix) = 4").count() == 3 assert dft1.filter("size(list) = 4").count() == 3 assert tbl2.df.filter("size(list_mask) = 4").count() == 3 assert tbl2.df.filter("size(list_mask) = 2").count() == 0 assert "list_mask" in tbl2.df.columns def test_median(self): file_path = os.path.join(self.resource_path, "parquet/data1.parquet") feature_tbl = FeatureTable.read_parquet(file_path) with self.assertRaises(Exception) as context: feature_tbl.median(["col_4", "col_5"]) self.assertTrue('col_4 with data type StringType is not supported' in str(context.exception)) median_tbl = feature_tbl.median(["col_1", "col_2", "col_3"]) assert isinstance(median_tbl, FeatureTable), "median_tbl should be a FeatureTable" assert median_tbl.df.count() == 3, "the number of rows of median_tbl should be equal to " \ "the number of specified columns" assert median_tbl.df.filter("column == 'col_1'").count() == 1, "col_1 should exist in " \ "'column' of median_tbl" assert median_tbl.df.filter("column == 'col_2'").filter("median == 1.0").count() == 1, \ "the median of col_2 should be 1.0" def test_cast(self): spark = OrcaContext.get_spark_session() data = [("jack", "123", 14, 8), ("alice", "34", 25, 9), ("rose", "25344", 23, 10)] schema = StructType([StructField("name", StringType(), True), StructField("a", StringType(), True), StructField("b", IntegerType(), True), StructField("c", IntegerType(), True)]) df = spark.createDataFrame(data, schema) tbl = FeatureTable(df) tbl = tbl.cast("a", "int") assert dict(tbl.df.dtypes)['a'] == "int", "column a should be now be cast to integer type" tbl = tbl.cast("a", "float") assert dict(tbl.df.dtypes)['a'] == "float", "column a should be now be cast to float type" tbl = tbl.cast(["b", "c"], "double") assert dict(tbl.df.dtypes)['b'] == dict(tbl.df.dtypes)['c'] == "double", \ "column b and c should be now be cast to double type" tbl = tbl.cast(None, "float") assert dict(tbl.df.dtypes)['name'] == dict(tbl.df.dtypes)['a'] == dict(tbl.df.dtypes)['b'] \ == dict(tbl.df.dtypes)['c'] == "float", \ "all the columns should now be cast to float type" with self.assertRaises(Exception) as context: tbl = tbl.cast("a", "notvalid") self.assertTrue( "type should be string, boolean, int, long, short, float, double." in str(context.exception)) def test_select(self): file_path = os.path.join(self.resource_path, "parquet/data1.parquet") feature_tbl = FeatureTable.read_parquet(file_path) select_tbl = feature_tbl.select("col_1", "col_2") assert "col_1" in select_tbl.df.columns, "col_1 shoul be selected" assert "col_2" in select_tbl.df.columns, "col_2 shoud be selected" assert "col_3" not in select_tbl.df.columns, "col_3 shoud not be selected" assert feature_tbl.size() == select_tbl.size(), \ "the selected table should have the same rows" with self.assertRaises(Exception) as context: feature_tbl.select() self.assertTrue("cols should be str or a list of str, but got None." in str(context.exception)) def test_create_from_dict(self): indices = {'a': 1, 'b': 2, 'c': 3} col_name = 'letter' tbl = StringIndex.from_dict(indices, col_name) assert 'id' in tbl.df.columns, "id should be one column in the stringindex" assert 'letter' in tbl.df.columns, "letter should be one column in the stringindex" assert tbl.size() == 3, "the StringIndex should have three rows" with self.assertRaises(Exception) as context: StringIndex.from_dict(indices, None) self.assertTrue("col_name should be str, but get None" in str(context.exception)) with self.assertRaises(Exception) as context: StringIndex.from_dict(indices, 12) self.assertTrue("col_name should be str, but get int" in str(context.exception)) with self.assertRaises(Exception) as context: StringIndex.from_dict([indices], col_name) self.assertTrue("indices should be dict, but get list" in str(context.exception)) def test_encode_string_from_dict(self): spark = OrcaContext.get_spark_session() data = [("jack", "123", 14, 8), ("alice", "34", 25, 9), ("rose", "25344", 23, 10)] schema = StructType([StructField("name", StringType(), True), StructField("num", StringType(), True), StructField("age", IntegerType(), True), StructField("height", IntegerType(), True)]) tbl = FeatureTable(spark.createDataFrame(data, schema)) columns = ["name", "num"] indices = [] indices.append({"jack": 1, "alice": 2, "rose": 3}) indices.append({"123": 3, "34": 1, "25344": 2}) tbl = tbl.encode_string(columns, indices) assert 'name' in tbl.df.columns, "name should be still in the columns" assert 'num' in tbl.df.columns, "num should be still in the columns" assert tbl.df.where(tbl.df.age == 14).select("name").collect()[0]["name"] == 1, \ "the first row of name should be 1" assert tbl.df.where(tbl.df.height == 10).select("num").collect()[0]["num"] == 2, \ "the third row of num should be 2" def test_write_csv(self): spark = OrcaContext.get_spark_session() data = [("jack", 14, 8), ("alice", 25, 9), ("rose", 23, 10)] schema = StructType([StructField("name", StringType(), True), StructField("age", IntegerType(), True), StructField("height", IntegerType(), True)]) tbl = FeatureTable(spark.createDataFrame(data, schema)) directory = "write.csv" if os.path.exists("write.csv"): shutil.rmtree("write.csv") tbl.write_csv(directory, mode="overwrite", header=True, num_partitions=1) assert os.path.exists("write.csv"), "files not write" result = FeatureTable(spark.read.csv(directory, header=True)) assert isinstance(result, FeatureTable) assert result.size() == 3, "the size of result should be 3" assert result.filter("age == 23").size() == 1, "wrong age" assert result.filter("name == 'jack'").size() == 1, "wrong name" assert result.filter("name == 'alice'").size() == 1, "wrong name" shutil.rmtree(directory) def test_concat(self): spark = OrcaContext.get_spark_session() data1 = [("jack", 1)] data2 = [(2, "alice")] data3 = [("amy", 3, 50)] schema1 = StructType([StructField("name", StringType(), True), StructField("id", IntegerType(), True)]) schema2 = StructType([StructField("id", IntegerType(), True), StructField("name", StringType(), True)]) schema3 = StructType([StructField("name", StringType(), True), StructField("id", IntegerType(), True), StructField("weight", IntegerType(), True)]) tbl1 = FeatureTable(spark.createDataFrame(data1, schema1)) tbl2 = FeatureTable(spark.createDataFrame(data2, schema2)) tbl3 = FeatureTable(spark.createDataFrame(data3, schema3)) tbl = tbl1.concat(tbl1) assert tbl.size() == 2 tbl = tbl1.concat(tbl1, distinct=True) assert tbl.size() == 1 tbl = tbl1.concat(tbl2) assert tbl.filter("name == 'jack'").size() == 1 assert tbl.filter("name == 'alice'").size() == 1 tbl = tbl1.concat(tbl3, mode="inner") assert tbl.df.schema.names == ["name", "id"] tbl = tbl1.concat(tbl3, mode="outer") assert tbl.df.schema.names == ["name", "id", "weight"] assert tbl.fillna(0, "weight").filter("weight == 0").size() == 1 tbl = tbl1.concat([tbl1, tbl2, tbl3]) assert tbl.size() == 4 assert tbl.distinct().size() == 3 tbl = tbl1.concat([tbl1, tbl2, tbl3], distinct=True) assert tbl.size() == 3 def test_drop_duplicates(self): spark = OrcaContext.get_spark_session() schema = StructType([StructField("name", StringType(), True), StructField("grade", StringType(), True), StructField("number", IntegerType(), True)]) data = [("jack", "a", 1), ("jack", "a", 3), ("jack", "b", 2), ("amy", "a", 2), ("amy", "a", 5), ("amy", "a", 4)] tbl = FeatureTable(spark.createDataFrame(data, schema)) tbl2 = tbl.drop_duplicates(subset=['name', 'grade'], sort_cols='number', keep='min') tbl2.df.show() assert tbl2.size() == 3 assert tbl2.df.filter((tbl2.df.name == 'jack') & (tbl2.df.grade == 'a'))\ .select("number").collect()[0]["number"] == 1 assert tbl2.df.filter((tbl2.df.name == 'jack') & (tbl2.df.grade == 'b'))\ .select("number").collect()[0]["number"] == 2 assert tbl2.df.filter((tbl2.df.name == 'amy') & (tbl2.df.grade == 'a'))\ .select("number").collect()[0]["number"] == 2 tbl3 = tbl.drop_duplicates(subset=['name', 'grade'], sort_cols='number', keep='max') tbl3.df.show() assert tbl3.size() == 3 assert tbl3.df.filter((tbl2.df.name == 'jack') & (tbl2.df.grade == 'a'))\ .select("number").collect()[0]["number"] == 3 assert tbl3.df.filter((tbl2.df.name == 'jack') & (tbl2.df.grade == 'b'))\ .select("number").collect()[0]["number"] == 2 assert tbl3.df.filter((tbl2.df.name == 'amy') & (tbl2.df.grade == 'a'))\ .select("number").collect()[0]["number"] == 5 tbl4 = tbl.drop_duplicates(subset=None, sort_cols='number', keep='max') tbl4.df.show() assert tbl4.size() == 6 tbl5 = tbl.drop_duplicates(subset=['name', 'grade'], sort_cols=None, keep='max') tbl5.df.show() assert tbl5.size() == 3 tbl6 = tbl.drop_duplicates(subset=['name'], sort_cols=["grade", "number"], keep='max') assert tbl6.size() == 2 tbl6.df.show() assert tbl6.df.filter((tbl6.df.name == 'jack') & (tbl6.df.grade == 'b') & (tbl6.df.number == 2))\ .select("number").collect()[0]["number"] == 2 assert tbl6.df.filter((tbl6.df.name == 'amy') & (tbl6.df.grade == 'a') & (tbl6.df.number == 5))\ .select("number").collect()[0]["number"] == 5 def test_join(self): spark = OrcaContext.get_spark_session() schema = StructType([StructField("name", StringType(), True), StructField("id", IntegerType(), True)]) data = [("jack", 1), ("jack", 2), ("jack", 3)] tbl = FeatureTable(spark.createDataFrame(data, schema)) tbl2 = FeatureTable(spark.createDataFrame(data, schema)) tbl = tbl.join(tbl2, on="id", lsuffix="_l", rsuffix="_r") assert "name_l" in tbl.df.schema.names assert "id" in tbl.df.schema.names assert "name_r" in tbl.df.schema.names def test_cut_bins(self): spark = OrcaContext.get_spark_session() values = [("a", 23), ("b", 45), ("c", 10), ("d", 60), ("e", 56), ("f", 2), ("g", 25), ("h", 40), ("j", 33)] tbl = FeatureTable(spark.createDataFrame(values, ["name", "ages"])) splits = [6, 18, 60] labels = ["infant", "minor", "adult", "senior"] # test drop false, name defined new_tbl = tbl.cut_bins(bins=splits, columns="ages", labels=labels, out_cols="age_bucket", drop=False) assert "age_bucket" in new_tbl.columns assert "ages" in new_tbl.columns assert new_tbl.df.select("age_bucket").rdd.flatMap(lambda x: x).collect() ==\ ["adult", "adult", "minor", "senior", "adult", "infant", "adult", "adult", "adult"] # test out_col equal to input column new_tbl = tbl.cut_bins(bins=splits, columns="ages", labels=labels, out_cols="ages", drop=True) assert "ages" in new_tbl.columns assert new_tbl.df.select("ages").rdd.flatMap(lambda x: x).collect() == \ ["adult", "adult", "minor", "senior", "adult", "infant", "adult", "adult", "adult"] # test name not defined new_tbl = tbl.cut_bins(bins=splits, columns="ages", labels=labels, drop=True) assert "ages_bin" in new_tbl.columns assert new_tbl.df.select("ages_bin").rdd.flatMap(lambda x: x).collect() == \ ["adult", "adult", "minor", "senior", "adult", "infant", "adult", "adult", "adult"] # test integer bins new_tbl = tbl.cut_bins(bins=2, columns="ages", labels=labels, drop=False) assert "ages_bin" in new_tbl.columns assert new_tbl.df.select("ages_bin").rdd.flatMap(lambda x: x).collect() \ == ["minor", "adult", "minor", "senior", "adult", "minor", "minor", "adult", "adult"] # test label is None new_tbl = tbl.cut_bins(bins=4, columns="ages", drop=True) assert "ages_bin" in new_tbl.columns assert new_tbl.df.select("ages_bin").rdd.flatMap(lambda x: x).collect() \ == [2, 3, 1, 5, 4, 1, 2, 3, 3] # test multiple columns values = [("a", 23, 23), ("b", 45, 45), ("c", 10, 10), ("d", 60, 60), ("e", 56, 56), ("f", 2, 2), ("g", 25, 25), ("h", 40, 40), ("j", 33, 33)] tbl = FeatureTable(spark.createDataFrame(values, ["name", "ages", "number"])) splits = [6, 18, 60] splits2 = [6, 18, 60] labels = ["infant", "minor", "adult", "senior"] new_tbl = tbl.cut_bins(bins={'ages': splits, 'number': splits2}, columns=["ages", 'number'], labels={'ages': labels, 'number': labels}, out_cols=None, drop=False) assert "ages_bin" in new_tbl.columns assert "ages" in new_tbl.columns assert "number_bin" in new_tbl.columns assert new_tbl.df.select("ages_bin").rdd.flatMap(lambda x: x).collect() ==\ ["adult", "adult", "minor", "senior", "adult", "infant", "adult", "adult", "adult"] def test_columns(self): file_path = os.path.join(self.resource_path, "parquet/data1.parquet") feature_tbl = FeatureTable.read_parquet(file_path) col_names = feature_tbl.columns assert isinstance(col_names, list), "col_names should be a list of strings" assert col_names == ["col_1", "col_2", "col_3", "col_4", "col_5"], \ "column names are incorrenct" def test_get_stats(self): spark = OrcaContext.get_spark_session() data = [("jack", "123", 14, 8.5), ("alice", "34", 25, 9.7), ("rose", "25344", 23, 10.0)] schema = StructType([StructField("name", StringType(), True), StructField("num", StringType(), True), StructField("age", IntegerType(), True), StructField("height", DoubleType(), True)]) tbl = FeatureTable(spark.createDataFrame(data, schema)) columns = ["age", "height"] # test str statistics = tbl.get_stats(columns, "min") assert len(statistics) == 2, "the dict should contain two statistics" assert statistics["age"] == 14, "the min value of age is not correct" assert statistics["height"] == 8.5, "the min value of height is not correct" columns = ["age", "height"] # test dict statistics = tbl.get_stats(columns, {"age": "max", "height": "avg"}) assert len(statistics) == 2, "the dict should contain two statistics" assert statistics["age"] == 25, "the max value of age is not correct" assert statistics["height"] == 9.4, "the avg value of height is not correct" # test list statistics = tbl.get_stats(columns, ["min", "max"]) assert len(statistics) == 2, "the dict should contain two statistics" assert statistics["age"][0] == 14, "the min value of age is not correct" assert statistics["age"][1] == 25, "the max value of age is not correct" assert statistics["height"][0] == 8.5, "the min value of height is not correct" assert statistics["height"][1] == 10.0, "the max value of height is not correct" # test dict of list statistics = tbl.get_stats(columns, {"age": ["min", "max"], "height": ["min", "avg"]}) assert len(statistics) == 2, "the dict should contain two statistics" assert statistics["age"][0] == 14, "the min value of age is not correct" assert statistics["age"][1] == 25, "the max value of age is not correct" assert statistics["height"][0] == 8.5, "the min value of height is not correct" assert statistics["height"][1] == 9.4, "the max value of height is not correct" statistics = tbl.get_stats(None, "min") assert len(statistics) == 2, "the dict should contain two statistics" assert statistics["age"] == 14, "the min value of age is not correct" assert statistics["height"] == 8.5, "the min value of height is not correct" def test_min(self): spark = OrcaContext.get_spark_session() data = [("jack", "123", 14, 8.5), ("alice", "34", 25, 9.7), ("rose", "25344", 23, 10.0)] schema = StructType([StructField("name", StringType(), True), StructField("num", StringType(), True), StructField("age", IntegerType(), True), StructField("height", DoubleType(), True)]) tbl = FeatureTable(spark.createDataFrame(data, schema)) columns = ["age", "height"] min_result = tbl.min(columns) assert min_result.to_list("min") == [14, 8.5], \ "the min value for age and height is not correct" def test_max(self): spark = OrcaContext.get_spark_session() data = [("jack", "123", 14, 8.5), ("alice", "34", 25, 9.7), ("rose", "25344", 23, 10.0)] schema = StructType([StructField("name", StringType(), True), StructField("num", StringType(), True), StructField("age", IntegerType(), True), StructField("height", DoubleType(), True)]) tbl = FeatureTable(spark.createDataFrame(data, schema)) columns = ["age", "height"] min_result = tbl.max(columns) assert min_result.to_list("max") == [25, 10.0], \ "the maximum value for age and height is not correct" def test_to_list(self): spark = OrcaContext.get_spark_session() data = [("jack", "123", 14, 8.5, [0, 0]), ("alice", "34", 25, 9.6, [1, 1]), ("rose", "25344", 23, 10.0, [2, 2])] schema = StructType([StructField("name", StringType(), True), StructField("num", StringType(), True), StructField("age", IntegerType(), True), StructField("height", DoubleType(), True), StructField("array", ArrayType(IntegerType()), True)]) tbl = FeatureTable(spark.createDataFrame(data, schema)) list1 = tbl.to_list("name") list2 = tbl.to_list("num") list3 = tbl.to_list("age") list4 = tbl.to_list("height") list5 = tbl.to_list("array") assert list1 == ["jack", "alice", "rose"], "the result of name is not correct" assert list2 == ["123", "34", "25344"], "the result of num is not correct" assert list3 == [14, 25, 23], "the result of age is not correct" assert list4 == [8.5, 9.6, 10.0], "the result of height is not correct" assert list5 == [[0, 0], [1, 1], [2, 2]], "the result of array is not correct" def test_to_dict(self): spark = OrcaContext.get_spark_session() # test the case the column of key is unique data = [("jack", "123", 14), ("alice", "34", 25), ("rose", "25344", 23)] schema = StructType([StructField("name", StringType(), True), StructField("num", StringType(), True), StructField("age", IntegerType(), True)]) tbl = FeatureTable(spark.createDataFrame(data, schema)) dictionary = tbl.to_dict() print(dictionary) assert dictionary["name"] == ['jack', 'alice', 'rose'] def test_to_pandas(self): spark = OrcaContext.get_spark_session() data = [("jack", "123", 14), ("alice", "34", 25), ("rose", "25344", 23)] schema = StructType([StructField("name", StringType(), True), StructField("num", StringType(), True), StructField("age", IntegerType(), True)]) tbl = FeatureTable(spark.createDataFrame(data, schema)) pddf = tbl.to_pandas() assert(pddf["name"].values.tolist() == ['jack', 'alice', 'rose']) def test_from_pandas(self): import pandas as pd data = [['tom', 10], ['nick', 15], ['juli', 14]] pddf = pd.DataFrame(data, columns=['Name', 'Age']) tbl = FeatureTable.from_pandas(pddf) assert(tbl.size() == 3) def test_sort(self): import pandas as pd data = [['tom', 10], ['nick', 15], ['juli', 14]] pddf = pd.DataFrame(data, columns=['Name', 'Age']) tbl = FeatureTable.from_pandas(pddf) tbl = tbl.sort("Age", ascending=False) assert(tbl.select("Name").to_list("Name") == ["nick", "juli", "tom"]) tbl = tbl.sort("Name") assert(tbl.select("Name").to_list("Name") == ["juli", "nick", "tom"]) def test_add(self): spark = OrcaContext.get_spark_session() data = [("jack", "123", 14, 8.5), ("alice", "34", 25, 9.6), ("rose", "25344", 23, 10.0)] schema = StructType([StructField("name", StringType(), True), StructField("num", StringType(), True), StructField("age", IntegerType(), True), StructField("height", DoubleType(), True)]) tbl = FeatureTable(spark.createDataFrame(data, schema)) columns = ["age", "height"] new_tbl = tbl.add(columns, 1.5) new_list = new_tbl.df.take(3) assert len(new_list) == 3, "new_tbl should have 3 rows" assert new_list[0]['age'] == 15.5, "the age of jack should increase 1.5" assert new_list[0]['height'] == 10, "the height of jack should increase 1.5" assert new_list[1]['age'] == 26.5, "the age of alice should increase 1.5" assert new_list[1]['height'] == 11.1, "the height of alice should increase 1.5" assert new_list[2]['age'] == 24.5, "the age of rose should increase 1.5" assert new_list[2]['height'] == 11.5, "the height of rose should increase 1.5" new_tbl = tbl.add(columns, -1) new_list = new_tbl.df.take(3) assert len(new_list) == 3, "new_tbl should have 3 rows" assert new_list[0]['age'] == 13, "the age of jack should decrease 1" assert new_list[0]['height'] == 7.5, "the height of jack should decrease 1" assert new_list[1]['age'] == 24, "the age of alice should decrease 1" assert new_list[1]['height'] == 8.6, "the height of alice should decrease 1" assert new_list[2]['age'] == 22, "the age of rose should decrease 1" assert new_list[2]['height'] == 9.0, "the height of rose should decrease 1" def test_sample(self): spark = OrcaContext.get_spark_session() df = spark.range(1000) feature_tbl = FeatureTable(df) total_line_1 = feature_tbl.size() feature_tbl2 = feature_tbl.sample(0.5) total_line_2 = feature_tbl2.size() assert int(total_line_1/2) - 100 < total_line_2 < int(total_line_1/2) + 100, \ "the number of rows should be half" total_distinct_line = feature_tbl2.distinct().size() assert total_line_2 == total_distinct_line, "all rows should be distinct" def test_group_by(self): file_path = os.path.join(self.resource_path, "parquet/data2.parquet") feature_tbl = FeatureTable.read_parquet(file_path) groupby_tbl1 = feature_tbl.group_by("col_4", agg={"col_1": ["sum", "count"]}) assert groupby_tbl1.df.filter("col_4 == 'a' and sum(col_1) == 3").count() == 1, \ "the sum of col_1 with col_4 = 'a' should be 3" assert groupby_tbl1.df.filter("col_4 == 'b' and `count(col_1)` == 5").count() == 1, \ "the count of col_1 with col_4 = 'b' should be 5" groupby_tbl2 = feature_tbl.group_by(agg={"target": "avg", "col_2": "last"}) assert groupby_tbl2.df.collect()[0]["avg(target)"] == 0.9, \ "the mean of target should be 0.9" groupby_tbl3 = feature_tbl.group_by("col_5", agg=["max", "min"], join=True) assert len(groupby_tbl3.df.columns) == len(feature_tbl.df.columns) + 10, \ "groupby_tbl3 should have (#df.columns - #columns)*len(agg)=10 more columns" assert groupby_tbl3.df.filter("col_5 == 'cc' and `max(col_2)` == 9").count() == \ feature_tbl.df.filter("col_5 == 'cc'").count(), \ "max of col_2 should 9 for all col_5 = 'cc' in groupby_tbl3" assert groupby_tbl3.df.filter("col_5 == 'aa' and `min(col_3)` == 1.0").count() == \ feature_tbl.df.filter("col_5 == 'aa'").count(), \ "min of col_3 should 1.0 for all col_5 = 'aa' in groupby_tbl3" groupby_tbl4 = feature_tbl.group_by(["col_4", "col_5"], agg="first", join=True) assert groupby_tbl4.df.filter("col_4 == 'b' and col_5 == 'dd' and `first(col_1)` == 0") \ .count() == feature_tbl.df.filter("col_4 == 'b' and col_5 == 'dd'").count(), \ "first of col_1 should be 0 for all col_4 = 'b' and col_5 = 'dd' in groupby_tbl4" def test_append_column(self): file_path = os.path.join(self.resource_path, "data.csv") tbl = FeatureTable.read_csv(file_path, header=True) tbl = tbl.append_column("z", lit(0)) assert tbl.select("z").size() == 4 assert tbl.filter("z == 0").size() == 4 tbl = tbl.append_column("str", lit("a")) assert tbl.select("str").size() == 4 assert tbl.filter("str == 'a'").size() == 4 tbl = tbl.append_column("float", lit(1.2)) assert tbl.select("float").size() == 4 assert tbl.filter("float == 1.2").size() == 4 def test_ordinal_shuffle(self): spark = OrcaContext.get_spark_session() data = [("a", 14), ("b", 25), ("c", 23), ("d", 2), ("e", 1)] schema = StructType([StructField("name", StringType(), True), StructField("num", IntegerType(), True)]) tbl = FeatureTable(spark.createDataFrame(data, schema).repartition(1)) shuffled_tbl = tbl.ordinal_shuffle_partition() rows = tbl.df.collect() shuffled_rows = shuffled_tbl.df.collect() rows.sort(key=lambda x: x[1]) shuffled_rows.sort(key=lambda x: x[1]) assert rows == shuffled_rows def test_write_parquet(self): file_path = os.path.join(self.resource_path, "parquet/data1.parquet") feature_tbl = FeatureTable.read_parquet(file_path) feature_tbl.write_parquet("saved.parquet") loaded_tbl = FeatureTable.read_parquet("saved.parquet") if os.path.exists("saved.parquet"): shutil.rmtree("saved.parquet") def test_read_csv(self): file_path = os.path.join(self.resource_path, "data.csv") feature_tbl = FeatureTable.read_csv(file_path, header=True) assert feature_tbl.size() == 4 columns = feature_tbl.columns assert columns == ["col1", "col2", "col3"] records = feature_tbl.df.collect() assert isinstance(records[0][0], float) assert isinstance(records[0][1], str) and isinstance(records[0][1], str) file_path2 = os.path.join(self.resource_path, "data_no_header.csv") feature_tbl2 = FeatureTable.read_csv(file_path2, names=["col1", "_col2", "col3"], dtype={"col1": "int"}) assert feature_tbl2.size() == 4 columns2 = feature_tbl2.columns assert columns2 == ["col1", "_col2", "col3"] records2 = feature_tbl2.df.collect() assert isinstance(records2[0][0], int) assert isinstance(records2[0][1], str) and isinstance(records2[0][1], str) feature_tbl3 = FeatureTable.read_csv(file_path, header=True, dtype=["int", "str", "str"]) records3 = feature_tbl3.df.collect() assert isinstance(records3[0][0], int) assert isinstance(records3[0][1], str) and isinstance(records3[0][1], str) def test_category_encode_and_one_hot_encode(self): file_path = os.path.join(self.resource_path, "data.csv") feature_tbl = FeatureTable.read_csv(file_path, header=True) feature_tbl, indices = feature_tbl.category_encode(columns=["col2", "col3"]) assert isinstance(indices, list) and len(indices) == 2 assert isinstance(indices[0], StringIndex) and isinstance(indices[1], StringIndex) assert indices[0].size() == 3 and indices[1].size() == 4 dict1 = indices[0].to_dict() dict2 = indices[1].to_dict() records = feature_tbl.df.collect() assert records[0][1] == dict1["x"] and records[0][2] == dict2["abc"] assert records[3][1] == dict1["z"] and records[2][2] == dict2["aaa"] feature_tbl = feature_tbl.one_hot_encode(columns=["col2", "col3"], prefix=["o1", "o2"]) feature_tbl.show() columns = feature_tbl.columns assert columns == ["col1", "o1_0", "o1_1", "o1_2", "o1_3", "o2_0", "o2_1", "o2_2", "o2_3", "o2_4"] records = feature_tbl.df.collect() record = records[0] value1 = dict1["x"] value2 = dict2["abc"] for i in range(1, 4): if i == value1: assert record[i+1] == 1 else: assert record[i+1] == 0 for i in range(1, 5): if i == value2: assert record[i+5] == 1 else: assert record[i+5] == 0 def test_split(self): file_path = os.path.join(self.resource_path, "ncf.csv") feature_tbl = FeatureTable.read_csv(file_path, header=True, dtype="int") tbl1, tbl2 = feature_tbl.split([0.8, 0.2], seed=1128) total_size = feature_tbl.size() size1 = tbl1.size() size2 = tbl2.size() assert size1 + size2 == total_size def test_target_encode(self): file_path = os.path.join(self.resource_path, "parquet/data2.parquet") feature_tbl = FeatureTable.read_parquet(file_path) with self.assertRaises(Exception) as context: feature_tbl.target_encode("col_4", "target", kfold=-1) self.assertTrue("kfold should be an integer larger than 0" in str(context.exception)) with self.assertRaises(Exception) as context: feature_tbl.target_encode("col_4", "col_5") self.assertTrue("target_cols should be numeric" in str(context.exception)) with self.assertRaises(Exception) as context: feature_tbl.target_encode("col_4", "target", target_mean={"target": "2"}) self.assertTrue("mean in target_mean should be numeric" in str(context.exception)) with self.assertRaises(Exception) as context: feature_tbl.target_encode("col_4", "target", kfold=2, fold_col="col_3") self.assertTrue("fold_col should be integer type" in str(context.exception)) target_tbl1, target_list1 = feature_tbl.target_encode("col_4", "target", kfold=1, smooth=0) assert len(target_list1) == 1, "len(target_list1) = len(cat_cols) of target_encode" target_code1 = target_list1[0] assert isinstance(target_code1, TargetCode), "target_list1 should be list of TargetCode" assert target_code1.df.filter("col_4 == 'a'").collect()[0]["col_4_te_target"] == \ feature_tbl.df.filter("col_4 == 'a'").agg({"target": "mean"}) \ .collect()[0]["avg(target)"], \ "col_4_te_target should contain mean of target grouped by col_4" cat_cols = ["col_4", "col_5"] target_cols = ["col_3", "target"] fold_col = "fold" target_mean = {"col_3": 5, "target": 0.5} out_cols = [[cat_col + target_col for target_col in target_cols] for cat_col in cat_cols] target_tbl2, target_list2 = feature_tbl.target_encode( cat_cols, target_cols, target_mean=target_mean, kfold=3, fold_seed=4, fold_col=fold_col, drop_cat=False, drop_fold=False, out_cols=out_cols) assert fold_col in target_tbl2.df.columns, "fold_col should be in target_tbl2" assert len(target_list2) == len(cat_cols), "len(target_list2) = len(cat_cols)" for i in range(len(cat_cols)): assert target_list2[i].cat_col == cat_cols[i], "each element in target_list2 should " \ "correspond to the element in cat_cols" for out_col in out_cols[i]: assert out_col in target_list2[i].df.columns, "every out_cols should be one of " \ "the columns in returned TargetCode" assert target_mean[target_list2[i].out_target_mean[out_col][0]] == \ target_list2[i].out_target_mean[out_col][1], \ "the global mean in TargetCode should be the same as the assigned mean in " \ "target_mean" target_tbl3, target_list3 = feature_tbl.target_encode([["col_4", "col_5"]], "target", kfold=2, drop_cat=False) assert len(target_tbl3.columns) == len(feature_tbl.columns) + 1, \ "target_tbl3 should have one more column col_4_col_5_te_target" def test_encode_target(self): file_path = os.path.join(self.resource_path, "parquet/data2.parquet") feature_tbl = FeatureTable.read_parquet(file_path) spark = OrcaContext.get_spark_session() data = [("aa", 2, 1.0), ("bb", 4, 2.0), ("cc", 6, 3.0), ("dd", 8, 4.0)] schema = StructType([StructField("unknown", StringType(), True), StructField("target_encode_count", IntegerType(), True), StructField("col_5_te_col_1", DoubleType(), True)]) df0 = spark.createDataFrame(data, schema) target_code0 = TargetCode(df0, cat_col="unknown", out_target_mean={"col_5_te_col_1": ("col_1", 0.5)}) with self.assertRaises(Exception) as context: feature_tbl.encode_target(target_code0) self.assertTrue("unknown in TargetCode.cat_col in targets does not exist in Table" in str(context.exception)) target_code1 = target_code0.rename({"unknown": "col_5"}) target_tbl1 = feature_tbl.encode_target(target_code1) assert target_tbl1.df.filter("col_5_te_col_1 == 1").count() == \ feature_tbl.df.filter("col_5 == 'aa'").count(), \ "the row with col_5 = 'aa' be encoded as col_5_te_col_1 = 1 in target_tbl1" assert target_tbl1.df.filter("col_3 == 8.0 and col_4 == 'd'") \ .filter("col_5_te_col_1 == 3"), \ "the row with col_3 = 8.0 and col_4 = 'd' has col_5 = 'cc', " \ "so it should be encoded with col_5_te_col_1 = 3 in target_tbl1" target_tbl2, target_list2 = feature_tbl.target_encode( ["col_4", "col_5"], ["col_3", "target"], kfold=2) target_tbl3 = feature_tbl.encode_target(target_list2, target_cols="target", drop_cat=False) assert "col_4" in target_tbl3.df.columns, \ "col_4 should exist in target_tbl2 since drop_cat is False" assert "col_4_te_target" in target_tbl3.df.columns, \ "col_4_te_target should exist in target_tbl2 as encoded column" assert "col_4_te_col_3" not in target_tbl3.df.columns, \ "col_4_te_col_3 should not exist in target_tbl2 since col_3 is not in target_cols" def test_difference_lag(self): file_path = os.path.join(self.resource_path, "parquet/data2.parquet") feature_tbl = FeatureTable.read_parquet(file_path) with self.assertRaises(Exception) as context: feature_tbl.difference_lag("col_4", "col_4") self.assertTrue("columns should be numeric" in str(context.exception)) diff_tbl1 = feature_tbl.difference_lag("col_1", "col_1") assert diff_tbl1.df.filter("col_1_diff_lag_col_1_1 == 1").count() == 5 and \ diff_tbl1.df.filter("col_1_diff_lag_col_1_1 == 0").count() == 13 and \ diff_tbl1.df.filter("col_1_diff_lag_col_1_1 is null").count() == 2, \ "col_1 has 6 different values and 1 null, so after sorted by col_1, there should" \ " be 5 rows with (lag of col_1) = 1, 2 rows with (lag of col_1) = null," \ " and other rows with (lag of col_1) = 0" diff_tbl2 = feature_tbl.difference_lag( ["col_1", "col_2"], ["col_3"], shifts=[1, -1], partition_cols=["col_5"], out_cols=[["c1p1", "c1m1"], ["c2p1", "c2m1"]]) assert diff_tbl2.df.filter("col_3 == 8.0 and col_5 == 'cc'") \ .filter("c1p1 == 1 and c1m1 == 2 and c2p1 == -1 and c2m1 == -4") \ .count() == 1, "the row with col_3 = 8.0 and col_5 = 'cc' should have c1p1 = 1, " \ "c1m1 = 2, c2p1 = -1, c2m1 = -4 after difference_lag" diff_tbl3 = feature_tbl.difference_lag("col_1", ["col_3"], shifts=[-1], partition_cols=["col_5"], out_cols="c1m1") assert diff_tbl3.df.filter("c1m1 == 2").count() == \ diff_tbl2.df.filter("c1m1 == 2").count(), \ "c1m1 should be the same in diff_tbl3 and in diff_tbl2" diff_tbl4 = feature_tbl.difference_lag("col_1", ["col_3"], shifts=[-1, 1], partition_cols=["col_5"], out_cols=["c1m1", "c1p1"]) assert diff_tbl4.df.filter("c1p1 == -1").count() == \ diff_tbl2.df.filter("c1p1 == -1").count(), \ "c1p1 should be the same in diff_tbl4 and in diff_tbl2" def test_cache(self): file_path = os.path.join(self.resource_path, "parquet/data2.parquet") feature_tbl = FeatureTable.read_parquet(file_path) feature_tbl.cache() assert feature_tbl.df.is_cached, "Cache table should be cached" feature_tbl.uncache() assert not feature_tbl.df.is_cached, "Uncache table should be uncached" if __name__ == "__main__": pytest.main([__file__])
''' Uses the SymCC-AFL hybrid from SymCC. ''' import os import time import shutil import threading import subprocess from fuzzers.afl import fuzzer as afl_fuzzer from fuzzers.aflplusplus import fuzzer as aflplusplus_fuzzer def get_symcc_build_dir(target_directory): """Return path to uninstrumented target directory.""" return os.path.join(target_directory, 'uninstrumented') def build(): """Build an AFL version and SymCC version of the benchmark""" # Backup the environment. orig_env = os.environ.copy() #src = os.getenv('SRC') #work = os.getenv('WORK') build_directory = os.getenv('OUT') fuzz_target = os.getenv('FUZZ_TARGET') # First, build an uninstrumented binary for Eclipser. aflplusplus_fuzzer.build("qemu", "eclipser") eclipser_dir = get_symcc_build_dir(build_directory) os.mkdir(eclipser_dir) fuzz_binary = build_directory + '/' + fuzz_target shutil.copy(fuzz_binary, eclipser_dir) if os.path.isdir(build_directory + '/seeds'): shutil.rmtree(build_directory + '/seeds') # Second, build an instrumented binary for AFL++. os.environ = orig_env aflplusplus_fuzzer.build("tracepc") print('[build] Copying afl-fuzz to $OUT directory') # Copy afl-fuzz shutil.copy('/afl/afl-fuzz', build_directory) shutil.copy("/afl/afl-showmap", build_directory) shutil.copy("/rust/bin/symcc_fuzzing_helper", eclipser_dir) symcc_build_dir = get_symcc_build_dir(os.environ['OUT']) # Copy over symcc artifacts and symbolic libc++. shutil.copy( "/symcc/build//SymRuntime-prefix/src/SymRuntime-build/libSymRuntime.so", symcc_build_dir) shutil.copy("/usr/lib/libz3.so", os.path.join(symcc_build_dir, "libz3.so")) shutil.copy("/rust/bin/symcc_fuzzing_helper", symcc_build_dir) shutil.copy("/symqemu/build/x86_64-linux-user/symqemu-x86_64", symcc_build_dir) def launch_afl_thread(input_corpus, output_corpus, target_binary, additional_flags): """ Simple wrapper for running AFL. """ afl_thread = threading.Thread(target=afl_fuzzer.run_afl_fuzz, args=(input_corpus, output_corpus, target_binary, additional_flags)) afl_thread.start() return afl_thread def fuzz(input_corpus, output_corpus, target_binary): """ Launches a master and a secondary instance of AFL, as well as the symcc helper. """ target_binary_dir = os.path.dirname(target_binary) symcc_workdir = get_symcc_build_dir(target_binary_dir) target_binary_name = os.path.basename(target_binary) symcc_target_binary = os.path.join(symcc_workdir, target_binary_name) os.environ['AFL_DISABLE_TRIM'] = "1" # Start a master and secondary instance of AFL. # We need both because of the way SymCC works. print('[run_fuzzer] Running AFL for SymCC') afl_fuzzer.prepare_fuzz_environment(input_corpus) launch_afl_thread(input_corpus, output_corpus, target_binary, ["-S", "afl-secondary"]) time.sleep(5) # Start an instance of SymCC. # We need to ensure it uses the symbolic version of libc++. symqemu_target = os.path.join(symcc_workdir, "symqemu-x86_64") if os.path.isfile(symqemu_target): print("Found symqemu target") else: print("Did not find symqemu target") print("Starting the SymCC helper") new_environ = os.environ.copy() new_environ['LD_LIBRARY_PATH'] = symcc_workdir cmd = [ os.path.join(symcc_workdir, "symcc_fuzzing_helper"), "-o", output_corpus, "-a", "afl-secondary", "-n", "symqemu", "-m", "--", symqemu_target, symcc_target_binary, "@@" ] print("Running command: %s" % (" ".join(cmd))) subprocess.Popen(cmd, env=new_environ)
import os import random from collections import defaultdict import xml.etree.ElementTree def parse_annotations(dir): all_files = [f for f in os.listdir(dir) if os.path.isfile(os.path.join(dir, f)) and f.lower().endswith('.xml')] filenames = defaultdict(list) for f in all_files: target_file = os.path.join(dir, f) # check that the annotation's xml file exists if os.path.isfile(target_file): print('parsing %s' % target_file) with open(target_file, 'r') as xml_file: # get the raw xml file from the annotation file raw_xml = xml_file.read().replace('\n', '') # read it into an Element data_xml = xml.etree.ElementTree.XML(raw_xml) # get all instances of filename, there should only be one! filename_xml = [f for f in data_xml.findall('filename')] if len(filename_xml) > 1: print('problem with %s, more than one filename!' % target_file) fname = filename_xml[0] # get all bounding boxes in this annotation for obj in data_xml.findall('object'): # get the animals present in this image, don't want the file extension for classname in obj.findall('name'): filenames[fname.text[0:-4]].append(classname.text) else: print('could not find %s, ignoring' % target_file) #for k in filenames: # print k, filenames[k] return filenames if __name__ == '__main__': # the ratio of data to be set aside for training training_ratio = 0.8 # class that will be marked as positive training examples classname1 = 'zebra_grevys' classname2 = 'zebra_plains' # directory that contains the xml annotations xml_dir = '/media/IBEIS/data/Annotations' annotations = parse_annotations(xml_dir) N = int(training_ratio * len(annotations)) keys = list(annotations.keys()) # shuffle the filenames to get a random training set random.shuffle(keys) # open the files to write the assignments to with open(classname1 + '_train.txt', 'w') as training_file, \ open(classname1 + '_test.txt', 'w') as test_file, \ open('test.txt', 'w') as test, \ open('trainval.txt', 'w') as trainval: for i, filename in enumerate(keys): # write the first N files to the training set if i < N: trainval.write(filename + '\n') # write 1 if the image contains the positive class, else -1 if classname1 in annotations[filename]: training_file.write(filename + ' 1\n') elif classname2 in annotations[filename]: training_file.write(filename + ' 1\n') else: training_file.write(filename + ' -1\n') # the rest of the files go to the test set, which all get 0s else: test.write(filename + '\n') test_file.write(filename + ' 0\n')
"""ggrc.views Handle non-RESTful views, e.g. routes which return HTML rather than JSON """ import collections import json from flask import flash from flask import g from flask import render_template from flask import url_for from werkzeug.exceptions import Forbidden from ggrc import models from ggrc import settings from ggrc.app import app from ggrc.app import db from ggrc.builder.json import publish from ggrc.builder.json import publish_representation from ggrc.converters import get_importables, get_exportables from ggrc.extensions import get_extension_modules from ggrc.fulltext import get_indexer from ggrc.fulltext.recordbuilder import fts_record_for from ggrc.fulltext.recordbuilder import model_is_indexed from ggrc.login import get_current_user from ggrc.login import login_required from ggrc.models import all_models from ggrc.models.background_task import create_task from ggrc.models.background_task import make_task_response from ggrc.models.background_task import queued_task from ggrc.models.reflection import AttributeInfo from ggrc.rbac import permissions from ggrc.services.common import as_json from ggrc.services.common import inclusion_filter from ggrc.views import converters from ggrc.views import cron from ggrc.views import filters from ggrc.views import mockups from ggrc.views import notifications from ggrc.views.common import RedirectedPolymorphView from ggrc.views.registry import object_view @app.route("/_background_tasks/reindex", methods=["POST"]) @queued_task def reindex(_): """ Web hook to update the full text search index """ do_reindex() return app.make_response(( 'success', 200, [('Content-Type', 'text/html')])) def do_reindex(): """ update the full text search index """ indexer = get_indexer() indexer.delete_all_records(False) # Find all models then remove base classes # (If we don't remove base classes, we get duplicates in the index.) inheritance_base_models = [ all_models.Directive, all_models.SystemOrProcess ] models_ = set(all_models.all_models) - set(inheritance_base_models) models_ = [model for model in models_ if model_is_indexed(model)] for model in models_: mapper_class = model._sa_class_manager.mapper.base_mapper.class_ query = model.query.options( db.undefer_group(mapper_class.__name__ + '_complete'), ) for query_chunk in generate_query_chunks(query): for instance in query_chunk: indexer.create_record(fts_record_for(instance), False) db.session.commit() def get_permissions_json(): """Get all permissions for current user""" permissions.permissions_for(permissions.get_user()) return json.dumps(getattr(g, '_request_permissions', None)) def get_config_json(): """Get public app config""" public_config = dict(app.config.public_config) for extension_module in get_extension_modules(): if hasattr(extension_module, 'get_public_config'): public_config.update( extension_module.get_public_config(get_current_user())) return json.dumps(public_config) def get_current_user_json(): """Get current user""" from ggrc.models.person import Person current_user = get_current_user() person = Person.eager_query().filter_by(id=current_user.id).one() result = publish_representation(publish(person, (), inclusion_filter)) return as_json(result) def get_attributes_json(): """Get a list of all custom attribute definitions""" attrs = models.CustomAttributeDefinition.eager_query().all() published = [] for attr in attrs: published.append(publish(attr)) published = publish_representation(published) return as_json(published) def get_import_types(export_only=False): types = get_exportables if export_only else get_importables data = [] for model in set(types().values()): data.append({ "model_singular": model.__name__, "title_plural": model._inflector.title_plural }) data.sort() response_json = json.dumps(data) return response_json def get_export_definitions(): return get_import_types(export_only=True) def get_import_definitions(): return get_import_types(export_only=False) def get_all_attributes_json(): """Get a list of all attribute definitions This exports all attributes related to a given model, including custom attributies and mapping attributes, that are used in csv import and export. """ published = {} ca_cache = collections.defaultdict(list) for attr in models.CustomAttributeDefinition.eager_query().all(): ca_cache[attr.definition_type].append(attr) for model in all_models.all_models: published[model.__name__] = \ AttributeInfo.get_attr_definitions_array(model, ca_cache=ca_cache) return as_json(published) @app.context_processor def base_context(): """Gets the base context""" return dict( get_model=models.get_model, permissions_json=get_permissions_json, permissions=permissions, config_json=get_config_json, current_user_json=get_current_user_json, attributes_json=get_attributes_json, all_attributes_json=get_all_attributes_json, import_definitions=get_import_definitions, export_definitions=get_export_definitions, ) @app.route("/") def index(): """The initial entry point of the app """ if not settings.PRODUCTION: flash(u"""<b>WARNING</b> - This is not the production instance of the GGRC application.<br><br> Company confidential, sensitive or personally identifiable information <b>*MUST NOT*</b> be entered or stored here. For any questions, please contact your administrator.""", "alert alert-warning") return render_template("welcome/index.haml") @app.route("/dashboard") @login_required def dashboard(): """The dashboard page """ return render_template("dashboard/index.haml") @app.route("/objectBrowser") @login_required def objectBrowser(): """The object Browser page """ return render_template("dashboard/index.haml") def generate_query_chunks(query): """Generate query chunks used by pagination""" chunk_size = 100 count = query.count() for offset in range(0, count, chunk_size): yield query.order_by('id').limit(chunk_size).offset(offset).all() @app.route("/admin/reindex", methods=["POST"]) @login_required def admin_reindex(): """Calls a webhook that reindexes indexable objects """ if not permissions.is_allowed_read("/admin", None, 1): raise Forbidden() task_queue = create_task("reindex", url_for(reindex.__name__), reindex) return task_queue.make_response( app.make_response(("scheduled %s" % task_queue.name, 200, [('Content-Type', 'text/html')]))) @app.route("/admin") @login_required def admin(): """The admin dashboard page """ if not permissions.is_allowed_read("/admin", None, 1): raise Forbidden() return render_template("admin/index.haml") @app.route("/assessments_view") @login_required def assessments_view(): """The clutter-free list of all Person's Assessments""" return render_template("assessments_view/index.haml") @app.route("/background_task/<id_task>", methods=['GET']) def get_task_response(id_task): """Gets the status of a background task""" return make_task_response(id_task) def contributed_object_views(): """Contributed object views""" return [ object_view(models.BackgroundTask), object_view(models.Program), object_view(models.Audit), object_view(models.Directive, RedirectedPolymorphView), object_view(models.Contract), object_view(models.Policy), object_view(models.Regulation), object_view(models.Standard), object_view(models.Clause), object_view(models.Section), object_view(models.Control), object_view(models.Assessment), object_view(models.AssessmentTemplate), object_view(models.Objective), object_view(models.System), object_view(models.Process), object_view(models.Product), object_view(models.Request), object_view(models.OrgGroup), object_view(models.Facility), object_view(models.Market), object_view(models.Project), object_view(models.DataAsset), object_view(models.AccessGroup), object_view(models.Person), object_view(models.Vendor), object_view(models.Issue), ] def all_object_views(): """Gets all object views defined in the application""" views = contributed_object_views() for extension_module in get_extension_modules(): contributions = getattr(extension_module, "contributed_object_views", None) if contributions: if callable(contributions): contributions = contributions() views.extend(contributions) return views def init_extra_views(app_): """Init any extra views needed by the app This should be used for any views that might use extension modules. """ mockups.init_mockup_views() filters.init_filter_views() converters.init_converter_views() cron.init_cron_views(app_) notifications.init_notification_views(app_) def init_all_views(app_): """Inits all views defined in the core module and submodules""" for entry in all_object_views(): entry.service_class.add_to( app_, '/{0}'.format(entry.url), entry.model_class, decorators=(login_required,) ) init_extra_views(app_) for extension_module in get_extension_modules(): ext_extra_views = getattr(extension_module, "init_extra_views", None) if ext_extra_views: ext_extra_views(app_) @app.route("/permissions") @login_required def user_permissions(): '''Permissions object for the currently logged in user ''' return get_permissions_json()
import datetime import cotyledon import threading from racoon.storage import connection from oslo_config import cfg from oslo_log import log from oslo_utils import timeutils CONF = cfg.CONF LOG = log.getLogger(__name__) class SearcherService(cotyledon.Service): def __init__(self, worker_id): super(SearcherService, self).__init__(worker_id) # this will keep set boolean atomic self.__shutdown = threading.Event() self.__shutdown_done = threading.Event() self.delay = cfg.CONF.collector.searcher_delay def run(self): while not self.__shutdown.is_set(): with timeutils.StopWatch() as timer: # therefore self.delay - time used by run job self.__shutdown.wait(max(0, self.delay - timer.elapsed())) # wait a while then collect self._run_job() self.__shutdown_done.set() def _run_job(self): LOG.info('search resources') con = connection.get_conn_from_config(CONF) # get start and end time end_timestamp = self._get_past() resources = con.get_resource_by_timestamp(end_timestamp) for r in resources: print r.resource_id print len(resources) def _get_past(self): start = datetime.datetime.utcnow() end = start - datetime.timedelta( seconds=self.delay) # end = end.strftime('%Y-%m-%dT%H:%M:%SZ') end = end.strftime('%Y-%m-%d %H:%M:%S') return end def terminate(self): self.__shutdown.set() LOG.info("Waiting ongoing processing to finish") self.__shutdown_done.wait() if __name__ == "__main__": from racoon import service service.prepare_service() cs = SearcherService(1) cs.run()
import unittest import numpy as np import SimpleITK as sitk import miapy.data.conversion as img class TestImageProperties(unittest.TestCase): def test_is_two_dimensional(self): x = 10 y = 10 image = sitk.Image([x, y], sitk.sitkUInt8) dut = img.ImageProperties(image) self.assertEqual(dut.is_two_dimensional(), True) self.assertEqual(dut.is_three_dimensional(), False) self.assertEqual(dut.is_vector_image(), False) def test_is_three_dimensional(self): x = 10 y = 10 z = 3 image = sitk.Image([x, y, z], sitk.sitkUInt8) dut = img.ImageProperties(image) self.assertEqual(dut.is_two_dimensional(), False) self.assertEqual(dut.is_three_dimensional(), True) self.assertEqual(dut.is_vector_image(), False) def test_is_vector_image(self): x = 10 y = 10 number_of_components_per_pixel = 3 image = sitk.Image([x, y], sitk.sitkVectorUInt8, number_of_components_per_pixel) dut = img.ImageProperties(image) self.assertEqual(dut.is_two_dimensional(), True) self.assertEqual(dut.is_three_dimensional(), False) self.assertEqual(dut.is_vector_image(), True) def test_properties(self): x = 10 y = 10 z = 3 pixel_id = sitk.sitkUInt8 size = (x, y, z) direction = (0, 1, 0, 1, 0, 0, 0, 0, 1) image = sitk.Image([x, y, z], pixel_id) image.SetOrigin(size) image.SetSpacing(size) image.SetDirection(direction) dut = img.ImageProperties(image) self.assertEqual(dut.size, size) self.assertEqual(dut.origin, size) self.assertEqual(dut.spacing, size) self.assertEqual(dut.direction, direction) self.assertEqual(dut.dimensions, z) self.assertEqual(dut.number_of_components_per_pixel, 1) self.assertEqual(dut.pixel_id, pixel_id) def test_equality(self): x = 10 y = 10 z = 3 pixel_id = sitk.sitkUInt8 size = (x, y, z) direction = (0, 1, 0, 1, 0, 0, 0, 0, 1) image = sitk.Image([x, y, z], pixel_id) image.SetOrigin(size) image.SetSpacing(size) image.SetDirection(direction) dut1 = img.ImageProperties(image) dut2 = img.ImageProperties(image) self.assertTrue(dut1 == dut2) self.assertFalse(dut1 != dut2) image = sitk.Image([x, y, z], sitk.sitkInt8) image.SetOrigin(size) image.SetSpacing(size) image.SetDirection(direction) dut1 = img.ImageProperties(image) self.assertTrue(dut1 == dut2) self.assertFalse(dut1 != dut2) image = sitk.Image([x, y, z], sitk.sitkVectorUInt8, 2) image.SetOrigin(size) image.SetSpacing(size) image.SetDirection(direction) dut1 = img.ImageProperties(image) self.assertTrue(dut1 == dut2) self.assertFalse(dut1 != dut2) def test_non_equality(self): x = 10 y = 10 z = 3 pixel_id = sitk.sitkUInt8 size = (x, y, z) direction = (0, 1, 0, 1, 0, 0, 0, 0, 1) image = sitk.Image([x, y, z], pixel_id) image.SetOrigin(size) image.SetSpacing(size) image.SetDirection(direction) dut1 = img.ImageProperties(image) different_size = (x, y, 2) # non-equal size image = sitk.Image(different_size, pixel_id) image.SetOrigin(size) image.SetSpacing(size) image.SetDirection(direction) dut2 = img.ImageProperties(image) self.assertFalse(dut1 == dut2) self.assertTrue(dut1 != dut2) # non-equal origin image = sitk.Image(size, pixel_id) image.SetOrigin(different_size) image.SetSpacing(size) image.SetDirection(direction) dut2 = img.ImageProperties(image) self.assertFalse(dut1 == dut2) self.assertTrue(dut1 != dut2) # non-equal spacing different_size = (x, y, 2) image = sitk.Image(size, pixel_id) image.SetOrigin(size) image.SetSpacing(different_size) image.SetDirection(direction) dut2 = img.ImageProperties(image) self.assertFalse(dut1 == dut2) self.assertTrue(dut1 != dut2) # non-equal direction different_size = (x, y, 2) image = sitk.Image(size, pixel_id) image.SetOrigin(size) image.SetSpacing(size) image.SetDirection((1, 0, 0, 0, 1, 0, 0, 0, 1)) dut2 = img.ImageProperties(image) self.assertFalse(dut1 == dut2) self.assertTrue(dut1 != dut2) class TestNumpySimpleITKImageBridge(unittest.TestCase): def setUp(self): dim_x = 5 dim_y = 10 dim_z = 3 self.no_vector_components = 4 # some unordinary origins, spacings and directions self.origin_spacing_2d = (dim_x, dim_y) self.direction_2d = (0, 1, 1, 0) self.origin_spacing_3d = (dim_x, dim_y, dim_z) self.direction_3d = (1, 0, 0, 0, 1, 0, 0, 0, 1) # set up images image = sitk.Image((dim_x, dim_y, dim_z), sitk.sitkUInt8) image.SetOrigin(self.origin_spacing_3d) image.SetSpacing(self.origin_spacing_3d) image.SetDirection(self.direction_3d) self.properties_3d = img.ImageProperties(image) image = sitk.Image((dim_x, dim_y), sitk.sitkUInt8) image.SetOrigin(self.origin_spacing_2d) image.SetSpacing(self.origin_spacing_2d) image.SetDirection(self.direction_2d) self.properties_2d = img.ImageProperties(image) # set up numpy arrays (note the inverted order of the dimension) self.array_image_shape_2d = np.zeros((dim_y, dim_x), np.uint8) self.array_2d_vector = np.zeros((dim_y * dim_x, self.no_vector_components), np.uint8) self.array_image_shape_2d_vector = np.zeros((dim_y, dim_x, self.no_vector_components), np.uint8) self.array_image_shape_3d = np.zeros((dim_z, dim_y, dim_x), np.uint8) self.array_3d_vector = np.zeros((dim_z * dim_y * dim_x, self.no_vector_components), np.uint8) self.array_image_shape_3d_vector = np.zeros((dim_z, dim_y, dim_x, self.no_vector_components), np.uint8) def test_vector_to_image(self): # test array shape (n,) i.e., (x * y) and (x * y * z) image = img.NumpySimpleITKImageBridge.convert(self.array_image_shape_3d.flatten(), self.properties_3d) self._assert_3d(image) image = img.NumpySimpleITKImageBridge.convert(self.array_image_shape_2d.flatten(), self.properties_2d) self._assert_2d(image) def test_array_to_image(self): # test array shape (y, x) and (z, y, x) image = img.NumpySimpleITKImageBridge.convert(self.array_image_shape_3d, self.properties_3d) self._assert_3d(image) image = img.NumpySimpleITKImageBridge.convert(self.array_image_shape_2d, self.properties_2d) self._assert_2d(image) def test_array_to_vector_image(self): # test array shape (y, x, v) and (z, y, x, v), where v = number of vector component image = img.NumpySimpleITKImageBridge.convert(self.array_image_shape_3d_vector, self.properties_3d) self._assert_3d(image, True) image = img.NumpySimpleITKImageBridge.convert(self.array_image_shape_2d_vector, self.properties_2d) self._assert_2d(image, True) def test_vector_to_vector_image(self): # test array shape (y * x, v) and (z * y * x, v), where v = number of vector components image = img.NumpySimpleITKImageBridge.convert(self.array_3d_vector, self.properties_3d) self._assert_3d(image, True) image = img.NumpySimpleITKImageBridge.convert(self.array_2d_vector, self.properties_2d) self._assert_2d(image, True) def test_convert_unknown_shape(self): with self.assertRaises(ValueError): img.NumpySimpleITKImageBridge.convert(self.array_image_shape_3d.flatten(), self.properties_2d) def _assert_2d(self, image: sitk.Image, is_vector=False): self.assertEqual(self.properties_2d.size, image.GetSize()) if is_vector: self.assertEqual(self.no_vector_components, image.GetNumberOfComponentsPerPixel()) else: self.assertEqual(1, image.GetNumberOfComponentsPerPixel()) self.assertEqual(self.origin_spacing_2d, image.GetOrigin()) self.assertEqual(self.origin_spacing_2d, image.GetSpacing()) self.assertEqual(self.direction_2d, image.GetDirection()) def _assert_3d(self, image: sitk.Image, is_vector=False): self.assertEqual(self.properties_3d.size, image.GetSize()) if is_vector: self.assertEqual(self.no_vector_components, image.GetNumberOfComponentsPerPixel()) else: self.assertEqual(1, image.GetNumberOfComponentsPerPixel()) self.assertEqual(self.origin_spacing_3d, image.GetOrigin()) self.assertEqual(self.origin_spacing_3d, image.GetSpacing()) self.assertEqual(self.direction_3d, image.GetDirection()) class TestSimpleITKNumpyImageBridge(unittest.TestCase): def test_convert(self): x = 10 y = 10 z = 3 size = (x, y, z) image = sitk.Image(size, sitk.sitkUInt8) array, properties = img.SimpleITKNumpyImageBridge.convert(image) self.assertEqual(isinstance(array, np.ndarray), True) self.assertEqual(array.shape, size[::-1]) self.assertEqual(array.dtype, np.uint8) self.assertEqual(isinstance(properties, img.ImageProperties), True) self.assertEqual(properties.size, size) def test_convert_None(self): with self.assertRaises(ValueError): img.SimpleITKNumpyImageBridge.convert(None)
""" Assorted utilities for working with neural networks in AllenNLP. """ import copy from collections import defaultdict, OrderedDict from itertools import chain import json import logging from os import PathLike import re from typing import Any, Dict, List, Optional, Sequence, Tuple, TypeVar, Union, NamedTuple import math import numpy import torch import torch.distributed as dist from allennlp.common.checks import ConfigurationError from allennlp.common.util import int_to_device, is_distributed, is_global_primary logger = logging.getLogger(__name__) T = TypeVar("T") StateDictType = Union[Dict[str, torch.Tensor], "OrderedDict[str, torch.Tensor]"] def move_to_device(obj, device: Union[torch.device, int]): """ Given a structure (possibly) containing Tensors, move all the Tensors to the specified device (or do nothing, if they are already on the target device). """ device = int_to_device(device) if isinstance(obj, torch.Tensor): # You may be wondering why we don't just always call `obj.to(device)` since that would # be a no-op anyway if `obj` is already on `device`. Well that works fine except # when PyTorch is not compiled with CUDA support, in which case even calling # `obj.to(torch.device("cpu"))` would result in an error. return obj if obj.device == device else obj.to(device=device) elif isinstance(obj, dict): for key, value in obj.items(): obj[key] = move_to_device(value, device) return obj elif isinstance(obj, list): for i, item in enumerate(obj): obj[i] = move_to_device(item, device) return obj elif isinstance(obj, tuple) and hasattr(obj, "_fields"): # This is the best way to detect a NamedTuple, it turns out. return obj.__class__(*(move_to_device(item, device) for item in obj)) elif isinstance(obj, tuple): return tuple(move_to_device(item, device) for item in obj) else: return obj def clamp_tensor(tensor, minimum, maximum): """ Supports sparse and dense tensors. Returns a tensor with values clamped between the provided minimum and maximum, without modifying the original tensor. """ if tensor.is_sparse: coalesced_tensor = tensor.coalesce() coalesced_tensor._values().clamp_(minimum, maximum) return coalesced_tensor else: return tensor.clamp(minimum, maximum) def batch_tensor_dicts( tensor_dicts: List[Dict[str, torch.Tensor]], remove_trailing_dimension: bool = False ) -> Dict[str, torch.Tensor]: """ Takes a list of tensor dictionaries, where each dictionary is assumed to have matching keys, and returns a single dictionary with all tensors with the same key batched together. # Parameters tensor_dicts : `List[Dict[str, torch.Tensor]]` The list of tensor dictionaries to batch. remove_trailing_dimension : `bool` If `True`, we will check for a trailing dimension of size 1 on the tensors that are being batched, and remove it if we find it. """ key_to_tensors: Dict[str, List[torch.Tensor]] = defaultdict(list) for tensor_dict in tensor_dicts: for key, tensor in tensor_dict.items(): key_to_tensors[key].append(tensor) batched_tensors = {} for key, tensor_list in key_to_tensors.items(): batched_tensor = torch.stack(tensor_list) if remove_trailing_dimension and all(tensor.size(-1) == 1 for tensor in tensor_list): batched_tensor = batched_tensor.squeeze(-1) batched_tensors[key] = batched_tensor return batched_tensors def get_lengths_from_binary_sequence_mask(mask: torch.BoolTensor) -> torch.LongTensor: """ Compute sequence lengths for each batch element in a tensor using a binary mask. # Parameters mask : `torch.BoolTensor`, required. A 2D binary mask of shape (batch_size, sequence_length) to calculate the per-batch sequence lengths from. # Returns `torch.LongTensor` A torch.LongTensor of shape (batch_size,) representing the lengths of the sequences in the batch. """ return mask.sum(-1) def get_mask_from_sequence_lengths( sequence_lengths: torch.Tensor, max_length: int ) -> torch.BoolTensor: """ Given a variable of shape `(batch_size,)` that represents the sequence lengths of each batch element, this function returns a `(batch_size, max_length)` mask variable. For example, if our input was `[2, 2, 3]`, with a `max_length` of 4, we'd return `[[1, 1, 0, 0], [1, 1, 0, 0], [1, 1, 1, 0]]`. We require `max_length` here instead of just computing it from the input `sequence_lengths` because it lets us avoid finding the max, then copying that value from the GPU to the CPU so that we can use it to construct a new tensor. """ # (batch_size, max_length) ones = sequence_lengths.new_ones(sequence_lengths.size(0), max_length) range_tensor = ones.cumsum(dim=1) return sequence_lengths.unsqueeze(1) >= range_tensor def sort_batch_by_length(tensor: torch.Tensor, sequence_lengths: torch.Tensor): """ Sort a batch first tensor by some specified lengths. # Parameters tensor : `torch.FloatTensor`, required. A batch first Pytorch tensor. sequence_lengths : `torch.LongTensor`, required. A tensor representing the lengths of some dimension of the tensor which we want to sort by. # Returns sorted_tensor : `torch.FloatTensor` The original tensor sorted along the batch dimension with respect to sequence_lengths. sorted_sequence_lengths : `torch.LongTensor` The original sequence_lengths sorted by decreasing size. restoration_indices : `torch.LongTensor` Indices into the sorted_tensor such that `sorted_tensor.index_select(0, restoration_indices) == original_tensor` permutation_index : `torch.LongTensor` The indices used to sort the tensor. This is useful if you want to sort many tensors using the same ordering. """ if not isinstance(tensor, torch.Tensor) or not isinstance(sequence_lengths, torch.Tensor): raise ConfigurationError("Both the tensor and sequence lengths must be torch.Tensors.") sorted_sequence_lengths, permutation_index = sequence_lengths.sort(0, descending=True) sorted_tensor = tensor.index_select(0, permutation_index) index_range = torch.arange(0, len(sequence_lengths), device=sequence_lengths.device) # This is the equivalent of zipping with index, sorting by the original # sequence lengths and returning the now sorted indices. _, reverse_mapping = permutation_index.sort(0, descending=False) restoration_indices = index_range.index_select(0, reverse_mapping) return sorted_tensor, sorted_sequence_lengths, restoration_indices, permutation_index def get_final_encoder_states( encoder_outputs: torch.Tensor, mask: torch.BoolTensor, bidirectional: bool = False ) -> torch.Tensor: """ Given the output from a `Seq2SeqEncoder`, with shape `(batch_size, sequence_length, encoding_dim)`, this method returns the final hidden state for each element of the batch, giving a tensor of shape `(batch_size, encoding_dim)`. This is not as simple as `encoder_outputs[:, -1]`, because the sequences could have different lengths. We use the mask (which has shape `(batch_size, sequence_length)`) to find the final state for each batch instance. Additionally, if `bidirectional` is `True`, we will split the final dimension of the `encoder_outputs` into two and assume that the first half is for the forward direction of the encoder and the second half is for the backward direction. We will concatenate the last state for each encoder dimension, giving `encoder_outputs[:, -1, :encoding_dim/2]` concatenated with `encoder_outputs[:, 0, encoding_dim/2:]`. """ # These are the indices of the last words in the sequences (i.e. length sans padding - 1). We # are assuming sequences are right padded. # Shape: (batch_size,) last_word_indices = mask.sum(1) - 1 batch_size, _, encoder_output_dim = encoder_outputs.size() expanded_indices = last_word_indices.view(-1, 1, 1).expand(batch_size, 1, encoder_output_dim) # Shape: (batch_size, 1, encoder_output_dim) final_encoder_output = encoder_outputs.gather(1, expanded_indices) final_encoder_output = final_encoder_output.squeeze(1) # (batch_size, encoder_output_dim) if bidirectional: final_forward_output = final_encoder_output[:, : (encoder_output_dim // 2)] final_backward_output = encoder_outputs[:, 0, (encoder_output_dim // 2) :] final_encoder_output = torch.cat([final_forward_output, final_backward_output], dim=-1) return final_encoder_output def get_dropout_mask(dropout_probability: float, tensor_for_masking: torch.Tensor): """ Computes and returns an element-wise dropout mask for a given tensor, where each element in the mask is dropped out with probability dropout_probability. Note that the mask is NOT applied to the tensor - the tensor is passed to retain the correct CUDA tensor type for the mask. # Parameters dropout_probability : `float`, required. Probability of dropping a dimension of the input. tensor_for_masking : `torch.Tensor`, required. # Returns `torch.FloatTensor` A torch.FloatTensor consisting of the binary mask scaled by 1/ (1 - dropout_probability). This scaling ensures expected values and variances of the output of applying this mask and the original tensor are the same. """ binary_mask = (torch.rand(tensor_for_masking.size()) > dropout_probability).to( tensor_for_masking.device ) # Scale mask by 1/keep_prob to preserve output statistics. dropout_mask = binary_mask.float().div(1.0 - dropout_probability) return dropout_mask def masked_softmax( vector: torch.Tensor, mask: torch.BoolTensor, dim: int = -1, memory_efficient: bool = False, ) -> torch.Tensor: """ `torch.nn.functional.softmax(vector)` does not work if some elements of `vector` should be masked. This performs a softmax on just the non-masked portions of `vector`. Passing `None` in for the mask is also acceptable; you'll just get a regular softmax. `vector` can have an arbitrary number of dimensions; the only requirement is that `mask` is broadcastable to `vector's` shape. If `mask` has fewer dimensions than `vector`, we will unsqueeze on dimension 1 until they match. If you need a different unsqueezing of your mask, do it yourself before passing the mask into this function. If `memory_efficient` is set to true, we will simply use a very large negative number for those masked positions so that the probabilities of those positions would be approximately 0. This is not accurate in math, but works for most cases and consumes less memory. In the case that the input vector is completely masked and `memory_efficient` is false, this function returns an array of `0.0`. This behavior may cause `NaN` if this is used as the last layer of a model that uses categorical cross-entropy loss. Instead, if `memory_efficient` is true, this function will treat every element as equal, and do softmax over equal numbers. """ if mask is None: result = torch.nn.functional.softmax(vector, dim=dim) else: while mask.dim() < vector.dim(): mask = mask.unsqueeze(1) if not memory_efficient: # To limit numerical errors from large vector elements outside the mask, we zero these out. result = torch.nn.functional.softmax(vector * mask, dim=dim) result = result * mask result = result / ( result.sum(dim=dim, keepdim=True) + tiny_value_of_dtype(result.dtype) ) else: masked_vector = vector.masked_fill(~mask, min_value_of_dtype(vector.dtype)) result = torch.nn.functional.softmax(masked_vector, dim=dim) return result def masked_log_softmax(vector: torch.Tensor, mask: torch.BoolTensor, dim: int = -1) -> torch.Tensor: """ `torch.nn.functional.log_softmax(vector)` does not work if some elements of `vector` should be masked. This performs a log_softmax on just the non-masked portions of `vector`. Passing `None` in for the mask is also acceptable; you'll just get a regular log_softmax. `vector` can have an arbitrary number of dimensions; the only requirement is that `mask` is broadcastable to `vector's` shape. If `mask` has fewer dimensions than `vector`, we will unsqueeze on dimension 1 until they match. If you need a different unsqueezing of your mask, do it yourself before passing the mask into this function. In the case that the input vector is completely masked, the return value of this function is arbitrary, but not `nan`. You should be masking the result of whatever computation comes out of this in that case, anyway, so the specific values returned shouldn't matter. Also, the way that we deal with this case relies on having single-precision floats; mixing half-precision floats with fully-masked vectors will likely give you `nans`. If your logits are all extremely negative (i.e., the max value in your logit vector is -50 or lower), the way we handle masking here could mess you up. But if you've got logit values that extreme, you've got bigger problems than this. """ if mask is not None: while mask.dim() < vector.dim(): mask = mask.unsqueeze(1) # vector + mask.log() is an easy way to zero out masked elements in logspace, but it # results in nans when the whole vector is masked. We need a very small value instead of a # zero in the mask for these cases. vector = vector + (mask + tiny_value_of_dtype(vector.dtype)).log() return torch.nn.functional.log_softmax(vector, dim=dim) def masked_max( vector: torch.Tensor, mask: torch.BoolTensor, dim: int, keepdim: bool = False, ) -> torch.Tensor: """ To calculate max along certain dimensions on masked values # Parameters vector : `torch.Tensor` The vector to calculate max, assume unmasked parts are already zeros mask : `torch.BoolTensor` The mask of the vector. It must be broadcastable with vector. dim : `int` The dimension to calculate max keepdim : `bool` Whether to keep dimension # Returns `torch.Tensor` A `torch.Tensor` of including the maximum values. """ replaced_vector = vector.masked_fill(~mask, min_value_of_dtype(vector.dtype)) max_value, _ = replaced_vector.max(dim=dim, keepdim=keepdim) return max_value def masked_mean( vector: torch.Tensor, mask: torch.BoolTensor, dim: int, keepdim: bool = False ) -> torch.Tensor: """ To calculate mean along certain dimensions on masked values # Parameters vector : `torch.Tensor` The vector to calculate mean. mask : `torch.BoolTensor` The mask of the vector. It must be broadcastable with vector. dim : `int` The dimension to calculate mean keepdim : `bool` Whether to keep dimension # Returns `torch.Tensor` A `torch.Tensor` of including the mean values. """ replaced_vector = vector.masked_fill(~mask, 0.0) value_sum = torch.sum(replaced_vector, dim=dim, keepdim=keepdim) value_count = torch.sum(mask, dim=dim, keepdim=keepdim) return value_sum / value_count.float().clamp(min=tiny_value_of_dtype(torch.float)) def masked_flip(padded_sequence: torch.Tensor, sequence_lengths: List[int]) -> torch.Tensor: """ Flips a padded tensor along the time dimension without affecting masked entries. # Parameters padded_sequence : `torch.Tensor` The tensor to flip along the time dimension. Assumed to be of dimensions (batch size, num timesteps, ...) sequence_lengths : `torch.Tensor` A list containing the lengths of each unpadded sequence in the batch. # Returns `torch.Tensor` A `torch.Tensor` of the same shape as padded_sequence. """ assert padded_sequence.size(0) == len( sequence_lengths ), f"sequence_lengths length ${len(sequence_lengths)} does not match batch size ${padded_sequence.size(0)}" num_timesteps = padded_sequence.size(1) flipped_padded_sequence = torch.flip(padded_sequence, [1]) sequences = [ flipped_padded_sequence[i, num_timesteps - length :] for i, length in enumerate(sequence_lengths) ] return torch.nn.utils.rnn.pad_sequence(sequences, batch_first=True) def viterbi_decode( tag_sequence: torch.Tensor, transition_matrix: torch.Tensor, tag_observations: Optional[List[int]] = None, allowed_start_transitions: torch.Tensor = None, allowed_end_transitions: torch.Tensor = None, top_k: int = None, ): """ Perform Viterbi decoding in log space over a sequence given a transition matrix specifying pairwise (transition) potentials between tags and a matrix of shape (sequence_length, num_tags) specifying unary potentials for possible tags per timestep. # Parameters tag_sequence : `torch.Tensor`, required. A tensor of shape (sequence_length, num_tags) representing scores for a set of tags over a given sequence. transition_matrix : `torch.Tensor`, required. A tensor of shape (num_tags, num_tags) representing the binary potentials for transitioning between a given pair of tags. tag_observations : `Optional[List[int]]`, optional, (default = `None`) A list of length `sequence_length` containing the class ids of observed elements in the sequence, with unobserved elements being set to -1. Note that it is possible to provide evidence which results in degenerate labelings if the sequences of tags you provide as evidence cannot transition between each other, or those transitions are extremely unlikely. In this situation we log a warning, but the responsibility for providing self-consistent evidence ultimately lies with the user. allowed_start_transitions : `torch.Tensor`, optional, (default = `None`) An optional tensor of shape (num_tags,) describing which tags the START token may transition *to*. If provided, additional transition constraints will be used for determining the start element of the sequence. allowed_end_transitions : `torch.Tensor`, optional, (default = `None`) An optional tensor of shape (num_tags,) describing which tags may transition *to* the end tag. If provided, additional transition constraints will be used for determining the end element of the sequence. top_k : `int`, optional, (default = `None`) Optional integer specifying how many of the top paths to return. For top_k>=1, returns a tuple of two lists: top_k_paths, top_k_scores, For top_k==None, returns a flattened tuple with just the top path and its score (not in lists, for backwards compatibility). # Returns viterbi_path : `List[int]` The tag indices of the maximum likelihood tag sequence. viterbi_score : `torch.Tensor` The score of the viterbi path. """ if top_k is None: top_k = 1 flatten_output = True elif top_k >= 1: flatten_output = False else: raise ValueError(f"top_k must be either None or an integer >=1. Instead received {top_k}") sequence_length, num_tags = list(tag_sequence.size()) has_start_end_restrictions = ( allowed_end_transitions is not None or allowed_start_transitions is not None ) if has_start_end_restrictions: if allowed_end_transitions is None: allowed_end_transitions = torch.zeros(num_tags) if allowed_start_transitions is None: allowed_start_transitions = torch.zeros(num_tags) num_tags = num_tags + 2 new_transition_matrix = torch.zeros(num_tags, num_tags) new_transition_matrix[:-2, :-2] = transition_matrix # Start and end transitions are fully defined, but cannot transition between each other. allowed_start_transitions = torch.cat( [allowed_start_transitions, torch.tensor([-math.inf, -math.inf])] ) allowed_end_transitions = torch.cat( [allowed_end_transitions, torch.tensor([-math.inf, -math.inf])] ) # First define how we may transition FROM the start and end tags. new_transition_matrix[-2, :] = allowed_start_transitions # We cannot transition from the end tag to any tag. new_transition_matrix[-1, :] = -math.inf new_transition_matrix[:, -1] = allowed_end_transitions # We cannot transition to the start tag from any tag. new_transition_matrix[:, -2] = -math.inf transition_matrix = new_transition_matrix if tag_observations: if len(tag_observations) != sequence_length: raise ConfigurationError( "Observations were provided, but they were not the same length " "as the sequence. Found sequence of length: {} and evidence: {}".format( sequence_length, tag_observations ) ) else: tag_observations = [-1 for _ in range(sequence_length)] if has_start_end_restrictions: tag_observations = [num_tags - 2] + tag_observations + [num_tags - 1] zero_sentinel = torch.zeros(1, num_tags) extra_tags_sentinel = torch.ones(sequence_length, 2) * -math.inf tag_sequence = torch.cat([tag_sequence, extra_tags_sentinel], -1) tag_sequence = torch.cat([zero_sentinel, tag_sequence, zero_sentinel], 0) sequence_length = tag_sequence.size(0) path_scores = [] path_indices = [] if tag_observations[0] != -1: one_hot = torch.zeros(num_tags) one_hot[tag_observations[0]] = 100000.0 path_scores.append(one_hot.unsqueeze(0)) else: path_scores.append(tag_sequence[0, :].unsqueeze(0)) # Evaluate the scores for all possible paths. for timestep in range(1, sequence_length): # Add pairwise potentials to current scores. summed_potentials = path_scores[timestep - 1].unsqueeze(2) + transition_matrix summed_potentials = summed_potentials.view(-1, num_tags) # Best pairwise potential path score from the previous timestep. max_k = min(summed_potentials.size()[0], top_k) scores, paths = torch.topk(summed_potentials, k=max_k, dim=0) # If we have an observation for this timestep, use it # instead of the distribution over tags. observation = tag_observations[timestep] # Warn the user if they have passed # invalid/extremely unlikely evidence. if tag_observations[timestep - 1] != -1 and observation != -1: if transition_matrix[tag_observations[timestep - 1], observation] < -10000: logger.warning( "The pairwise potential between tags you have passed as " "observations is extremely unlikely. Double check your evidence " "or transition potentials!" ) if observation != -1: one_hot = torch.zeros(num_tags) one_hot[observation] = 100000.0 path_scores.append(one_hot.unsqueeze(0)) else: path_scores.append(tag_sequence[timestep, :] + scores) path_indices.append(paths.squeeze()) # Construct the most likely sequence backwards. path_scores_v = path_scores[-1].view(-1) max_k = min(path_scores_v.size()[0], top_k) viterbi_scores, best_paths = torch.topk(path_scores_v, k=max_k, dim=0) viterbi_paths = [] for i in range(max_k): viterbi_path = [best_paths[i]] for backward_timestep in reversed(path_indices): viterbi_path.append(int(backward_timestep.view(-1)[viterbi_path[-1]])) # Reverse the backward path. viterbi_path.reverse() if has_start_end_restrictions: viterbi_path = viterbi_path[1:-1] # Viterbi paths uses (num_tags * n_permutations) nodes; therefore, we need to modulo. viterbi_path = [j % num_tags for j in viterbi_path] viterbi_paths.append(viterbi_path) if flatten_output: return viterbi_paths[0], viterbi_scores[0] return viterbi_paths, viterbi_scores def get_text_field_mask( text_field_tensors: Dict[str, Dict[str, torch.Tensor]], num_wrapping_dims: int = 0, padding_id: int = 0, ) -> torch.BoolTensor: """ Takes the dictionary of tensors produced by a `TextField` and returns a mask with 0 where the tokens are padding, and 1 otherwise. `padding_id` specifies the id of padding tokens. We also handle `TextFields` wrapped by an arbitrary number of `ListFields`, where the number of wrapping `ListFields` is given by `num_wrapping_dims`. If `num_wrapping_dims == 0`, the returned mask has shape `(batch_size, num_tokens)`. If `num_wrapping_dims > 0` then the returned mask has `num_wrapping_dims` extra dimensions, so the shape will be `(batch_size, ..., num_tokens)`. There could be several entries in the tensor dictionary with different shapes (e.g., one for word ids, one for character ids). In order to get a token mask, we use the tensor in the dictionary with the lowest number of dimensions. After subtracting `num_wrapping_dims`, if this tensor has two dimensions we assume it has shape `(batch_size, ..., num_tokens)`, and use it for the mask. If instead it has three dimensions, we assume it has shape `(batch_size, ..., num_tokens, num_features)`, and sum over the last dimension to produce the mask. Most frequently this will be a character id tensor, but it could also be a featurized representation of each token, etc. If the input `text_field_tensors` contains the "mask" key, this is returned instead of inferring the mask. """ masks = [] for indexer_name, indexer_tensors in text_field_tensors.items(): if "mask" in indexer_tensors: masks.append(indexer_tensors["mask"].bool()) if len(masks) == 1: return masks[0] elif len(masks) > 1: # TODO(mattg): My guess is this will basically never happen, so I'm not writing logic to # handle it. Should be straightforward to handle, though. If you see this error in # practice, open an issue on github. raise ValueError("found two mask outputs; not sure which to use!") tensor_dims = [ (tensor.dim(), tensor) for indexer_output in text_field_tensors.values() for tensor in indexer_output.values() ] tensor_dims.sort(key=lambda x: x[0]) smallest_dim = tensor_dims[0][0] - num_wrapping_dims if smallest_dim == 2: token_tensor = tensor_dims[0][1] return token_tensor != padding_id elif smallest_dim == 3: character_tensor = tensor_dims[0][1] return (character_tensor != padding_id).any(dim=-1) else: raise ValueError("Expected a tensor with dimension 2 or 3, found {}".format(smallest_dim)) def get_token_ids_from_text_field_tensors( text_field_tensors: Dict[str, Dict[str, torch.Tensor]], ) -> torch.Tensor: """ Our `TextFieldTensors` are complex output structures, because they try to handle a lot of potential variation. Sometimes, you just want to grab the token ids from this data structure, and that's not trivial without hard-coding assumptions about your data processing, which defeats the entire purpose of that generality. This method tries to let you get the token ids out of the data structure in your model without hard-coding any assumptions. """ for indexer_name, indexer_tensors in text_field_tensors.items(): for argument_name, tensor in indexer_tensors.items(): if argument_name in ["tokens", "token_ids", "input_ids"]: return tensor raise NotImplementedError( "Our heuristic for guessing the right token ids failed. Please open an issue on " "github with more detail on how you got this error, so we can implement more robust " "logic in this method." ) def weighted_sum(matrix: torch.Tensor, attention: torch.Tensor) -> torch.Tensor: """ Takes a matrix of vectors and a set of weights over the rows in the matrix (which we call an "attention" vector), and returns a weighted sum of the rows in the matrix. This is the typical computation performed after an attention mechanism. Note that while we call this a "matrix" of vectors and an attention "vector", we also handle higher-order tensors. We always sum over the second-to-last dimension of the "matrix", and we assume that all dimensions in the "matrix" prior to the last dimension are matched in the "vector". Non-matched dimensions in the "vector" must be `directly after the batch dimension`. For example, say I have a "matrix" with dimensions `(batch_size, num_queries, num_words, embedding_dim)`. The attention "vector" then must have at least those dimensions, and could have more. Both: - `(batch_size, num_queries, num_words)` (distribution over words for each query) - `(batch_size, num_documents, num_queries, num_words)` (distribution over words in a query for each document) are valid input "vectors", producing tensors of shape: `(batch_size, num_queries, embedding_dim)` and `(batch_size, num_documents, num_queries, embedding_dim)` respectively. """ # We'll special-case a few settings here, where there are efficient (but poorly-named) # operations in pytorch that already do the computation we need. if attention.dim() == 2 and matrix.dim() == 3: return attention.unsqueeze(1).bmm(matrix).squeeze(1) if attention.dim() == 3 and matrix.dim() == 3: return attention.bmm(matrix) if matrix.dim() - 1 < attention.dim(): expanded_size = list(matrix.size()) for i in range(attention.dim() - matrix.dim() + 1): matrix = matrix.unsqueeze(1) expanded_size.insert(i + 1, attention.size(i + 1)) matrix = matrix.expand(*expanded_size) intermediate = attention.unsqueeze(-1).expand_as(matrix) * matrix return intermediate.sum(dim=-2) def sequence_cross_entropy_with_logits( logits: torch.FloatTensor, targets: torch.LongTensor, weights: Union[torch.FloatTensor, torch.BoolTensor], average: str = "batch", label_smoothing: float = None, gamma: float = None, alpha: Union[float, List[float], torch.FloatTensor] = None, ) -> torch.FloatTensor: """ Computes the cross entropy loss of a sequence, weighted with respect to some user provided weights. Note that the weighting here is not the same as in the `torch.nn.CrossEntropyLoss()` criterion, which is weighting classes; here we are weighting the loss contribution from particular elements in the sequence. This allows loss computations for models which use padding. # Parameters logits : `torch.FloatTensor`, required. A `torch.FloatTensor` of size (batch_size, sequence_length, num_classes) which contains the unnormalized probability for each class. targets : `torch.LongTensor`, required. A `torch.LongTensor` of size (batch, sequence_length) which contains the index of the true class for each corresponding step. weights : `Union[torch.FloatTensor, torch.BoolTensor]`, required. A `torch.FloatTensor` of size (batch, sequence_length) average: `str`, optional (default = `"batch"`) If "batch", average the loss across the batches. If "token", average the loss across each item in the input. If `None`, return a vector of losses per batch element. label_smoothing : `float`, optional (default = `None`) Whether or not to apply label smoothing to the cross-entropy loss. For example, with a label smoothing value of 0.2, a 4 class classification target would look like `[0.05, 0.05, 0.85, 0.05]` if the 3rd class was the correct label. gamma : `float`, optional (default = `None`) Focal loss[*] focusing parameter `gamma` to reduces the relative loss for well-classified examples and put more focus on hard. The greater value `gamma` is, the more focus on hard examples. alpha : `Union[float, List[float]]`, optional (default = `None`) Focal loss[*] weighting factor `alpha` to balance between classes. Can be used independently with `gamma`. If a single `float` is provided, it is assumed binary case using `alpha` and `1 - alpha` for positive and negative respectively. If a list of `float` is provided, with the same length as the number of classes, the weights will match the classes. [*] T. Lin, P. Goyal, R. Girshick, K. He and P. Dollár, "Focal Loss for Dense Object Detection," 2017 IEEE International Conference on Computer Vision (ICCV), Venice, 2017, pp. 2999-3007. # Returns `torch.FloatTensor` A torch.FloatTensor representing the cross entropy loss. If `average=="batch"` or `average=="token"`, the returned loss is a scalar. If `average is None`, the returned loss is a vector of shape (batch_size,). """ if average not in {None, "token", "batch"}: raise ValueError("Got average f{average}, expected one of None, 'token', or 'batch'") # make sure weights are float weights = weights.to(logits.dtype) # sum all dim except batch non_batch_dims = tuple(range(1, len(weights.shape))) # shape : (batch_size,) weights_batch_sum = weights.sum(dim=non_batch_dims) # shape : (batch * sequence_length, num_classes) logits_flat = logits.view(-1, logits.size(-1)) # shape : (batch * sequence_length, num_classes) log_probs_flat = torch.nn.functional.log_softmax(logits_flat, dim=-1) # shape : (batch * max_len, 1) targets_flat = targets.view(-1, 1).long() # focal loss coefficient if gamma: # shape : (batch * sequence_length, num_classes) probs_flat = log_probs_flat.exp() # shape : (batch * sequence_length,) probs_flat = torch.gather(probs_flat, dim=1, index=targets_flat) # shape : (batch * sequence_length,) focal_factor = (1.0 - probs_flat) ** gamma # shape : (batch, sequence_length) focal_factor = focal_factor.view(*targets.size()) weights = weights * focal_factor if alpha is not None: # shape : () / (num_classes,) if isinstance(alpha, (float, int)): # shape : (2,) alpha_factor = torch.tensor( [1.0 - float(alpha), float(alpha)], dtype=weights.dtype, device=weights.device ) elif isinstance(alpha, (list, numpy.ndarray, torch.Tensor)): # shape : (c,) alpha_factor = torch.tensor(alpha, dtype=weights.dtype, device=weights.device) if not alpha_factor.size(): # shape : (1,) alpha_factor = alpha_factor.view(1) # shape : (2,) alpha_factor = torch.cat([1 - alpha_factor, alpha_factor]) else: raise TypeError( ("alpha must be float, list of float, or torch.FloatTensor, {} provided.").format( type(alpha) ) ) # shape : (batch, max_len) alpha_factor = torch.gather(alpha_factor, dim=0, index=targets_flat.view(-1)).view( *targets.size() ) weights = weights * alpha_factor if label_smoothing is not None and label_smoothing > 0.0: num_classes = logits.size(-1) smoothing_value = label_smoothing / num_classes # Fill all the correct indices with 1 - smoothing value. smoothed_targets = torch.full_like(log_probs_flat, smoothing_value).scatter_( -1, targets_flat, 1.0 - label_smoothing + smoothing_value ) negative_log_likelihood_flat = -log_probs_flat * smoothed_targets negative_log_likelihood_flat = negative_log_likelihood_flat.sum(-1, keepdim=True) else: # Contribution to the negative log likelihood only comes from the exact indices # of the targets, as the target distributions are one-hot. Here we use torch.gather # to extract the indices of the num_classes dimension which contribute to the loss. # shape : (batch * sequence_length, 1) negative_log_likelihood_flat = -torch.gather(log_probs_flat, dim=1, index=targets_flat) # shape : (batch, sequence_length) negative_log_likelihood = negative_log_likelihood_flat.view(*targets.size()) # shape : (batch, sequence_length) negative_log_likelihood = negative_log_likelihood * weights if average == "batch": # shape : (batch_size,) per_batch_loss = negative_log_likelihood.sum(non_batch_dims) / ( weights_batch_sum + tiny_value_of_dtype(negative_log_likelihood.dtype) ) num_non_empty_sequences = (weights_batch_sum > 0).sum() + tiny_value_of_dtype( negative_log_likelihood.dtype ) return per_batch_loss.sum() / num_non_empty_sequences elif average == "token": return negative_log_likelihood.sum() / ( weights_batch_sum.sum() + tiny_value_of_dtype(negative_log_likelihood.dtype) ) else: # shape : (batch_size,) per_batch_loss = negative_log_likelihood.sum(non_batch_dims) / ( weights_batch_sum + tiny_value_of_dtype(negative_log_likelihood.dtype) ) return per_batch_loss def replace_masked_values( tensor: torch.Tensor, mask: torch.BoolTensor, replace_with: float ) -> torch.Tensor: """ Replaces all masked values in `tensor` with `replace_with`. `mask` must be broadcastable to the same shape as `tensor`. We require that `tensor.dim() == mask.dim()`, as otherwise we won't know which dimensions of the mask to unsqueeze. This just does `tensor.masked_fill()`, except the pytorch method fills in things with a mask value of 1, where we want the opposite. You can do this in your own code with `tensor.masked_fill(~mask, replace_with)`. """ if tensor.dim() != mask.dim(): raise ConfigurationError( "tensor.dim() (%d) != mask.dim() (%d)" % (tensor.dim(), mask.dim()) ) return tensor.masked_fill(~mask, replace_with) def tensors_equal(tensor1: torch.Tensor, tensor2: torch.Tensor, tolerance: float = 1e-12) -> bool: """ A check for tensor equality (by value). We make sure that the tensors have the same shape, then check all of the entries in the tensor for equality. We additionally allow the input tensors to be lists or dictionaries, where we then do the above check on every position in the list / item in the dictionary. If we find objects that aren't tensors as we're doing that, we just defer to their equality check. This is kind of a catch-all method that's designed to make implementing `__eq__` methods easier, in a way that's really only intended to be useful for tests. """ if isinstance(tensor1, (list, tuple)): if not isinstance(tensor2, (list, tuple)) or len(tensor1) != len(tensor2): return False return all(tensors_equal(t1, t2, tolerance) for t1, t2 in zip(tensor1, tensor2)) elif isinstance(tensor1, dict): if not isinstance(tensor2, dict): return False if tensor1.keys() != tensor2.keys(): return False return all(tensors_equal(tensor1[key], tensor2[key], tolerance) for key in tensor1) elif isinstance(tensor1, torch.Tensor): if not isinstance(tensor2, torch.Tensor): return False if tensor1.size() != tensor2.size(): return False # Special case for bools since they don't support subtraction if tensor1.dtype == torch.bool or tensor2.dtype == torch.bool: return (tensor1 == tensor2).all() return ((tensor1 - tensor2).abs().float() < tolerance).all() else: try: return tensor1 == tensor2 except RuntimeError: print(type(tensor1), type(tensor2)) raise def device_mapping(cuda_device: int): """ In order to `torch.load()` a GPU-trained model onto a CPU (or specific GPU), you have to supply a `map_location` function. Call this with the desired `cuda_device` to get the function that `torch.load()` needs. """ def inner_device_mapping(storage: torch.Storage, location) -> torch.Storage: if cuda_device >= 0: return storage.cuda(cuda_device) else: return storage return inner_device_mapping def read_state_dict( path: Union[PathLike, str], strip_prefix: Optional[str] = None, ignore: Optional[List[str]] = None, strict: bool = True, cuda_device: int = -1, ) -> Dict[str, torch.Tensor]: """ Read a PyTorch model state dictionary from a checkpoint at the given `path`. # Parameters path : `Union[PathLike, str]`, required strip_prefix : `Optional[str]`, optional (default = `None`) A prefix to remove from all of the state dict keys. ignore : `Optional[List[str]]`, optional (default = `None`) Optional list of regular expressions. Keys that match any of these will be removed from the state dict. !!! Note If `strip_prefix` is given, the regular expressions in `ignore` are matched before the prefix is stripped. strict : `bool`, optional (default = `True`) If `True` (the default) and `strip_prefix` was never used or any of the regular expressions in `ignore` never matched, a `ValueError` will be raised. cuda_device : `int`, optional (default = `-1`) The device to load the parameters onto. Use `-1` (the default) for CPU. # Returns `Dict[str, torch.Tensor]` An ordered dictionary of the state. """ state = torch.load(path, map_location=device_mapping(cuda_device)) out: Dict[str, torch.Tensor] = OrderedDict() if ignore is not None and not isinstance(ignore, list): # If user accidentally passed in something that is not a list - like a string, # which is easy to do - the user would be confused why the resulting state dict # is empty. raise ValueError("'ignore' parameter should be a list") # In 'strict' mode, we need to keep track of whether we've used `strip_prefix` # and which regular expressions in `ignore` we've used. strip_prefix_used: Optional[bool] = None ignore_used: Optional[List[bool]] = None if strict and strip_prefix is not None: strip_prefix_used = False if strict and ignore: ignore_used = [False] * len(ignore) for key in state.keys(): ignore_key = False if ignore: for i, pattern in enumerate(ignore): if re.match(pattern, key): if ignore_used: ignore_used[i] = True logger.warning("ignoring %s from state dict", key) ignore_key = True break if ignore_key: continue new_key = key if strip_prefix and key.startswith(strip_prefix): strip_prefix_used = True new_key = key[len(strip_prefix) :] if not new_key: raise ValueError("'strip_prefix' resulted in an empty string for a key") out[new_key] = state[key] if strip_prefix_used is False: raise ValueError(f"'strip_prefix' of '{strip_prefix}' was never used") if ignore is not None and ignore_used is not None: for pattern, used in zip(ignore, ignore_used): if not used: raise ValueError(f"'ignore' pattern '{pattern}' didn't have any matches") return out def combine_tensors(combination: str, tensors: List[torch.Tensor]) -> torch.Tensor: """ Combines a list of tensors using element-wise operations and concatenation, specified by a `combination` string. The string refers to (1-indexed) positions in the input tensor list, and looks like `"1,2,1+2,3-1"`. We allow the following kinds of combinations : `x`, `x*y`, `x+y`, `x-y`, and `x/y`, where `x` and `y` are positive integers less than or equal to `len(tensors)`. Each of the binary operations is performed elementwise. You can give as many combinations as you want in the `combination` string. For example, for the input string `"1,2,1*2"`, the result would be `[1;2;1*2]`, as you would expect, where `[;]` is concatenation along the last dimension. If you have a fixed, known way to combine tensors that you use in a model, you should probably just use something like `torch.cat([x_tensor, y_tensor, x_tensor * y_tensor])`. This function adds some complexity that is only necessary if you want the specific combination used to be `configurable`. If you want to do any element-wise operations, the tensors involved in each element-wise operation must have the same shape. This function also accepts `x` and `y` in place of `1` and `2` in the combination string. """ if len(tensors) > 9: raise ConfigurationError("Double-digit tensor lists not currently supported") combination = combination.replace("x", "1").replace("y", "2") to_concatenate = [_get_combination(piece, tensors) for piece in combination.split(",")] return torch.cat(to_concatenate, dim=-1) def _rindex(sequence: Sequence[T], obj: T) -> int: """ Return zero-based index in the sequence of the last item whose value is equal to obj. Raises a ValueError if there is no such item. # Parameters sequence : `Sequence[T]` obj : `T` # Returns `int` zero-based index associated to the position of the last item equal to obj """ for i in range(len(sequence) - 1, -1, -1): if sequence[i] == obj: return i raise ValueError(f"Unable to find {obj} in sequence {sequence}.") def _get_combination(combination: str, tensors: List[torch.Tensor]) -> torch.Tensor: if combination.isdigit(): index = int(combination) - 1 return tensors[index] else: if len(combination) != 3: raise ConfigurationError("Invalid combination: " + combination) first_tensor = _get_combination(combination[0], tensors) second_tensor = _get_combination(combination[2], tensors) operation = combination[1] if operation == "*": return first_tensor * second_tensor elif operation == "/": return first_tensor / second_tensor elif operation == "+": return first_tensor + second_tensor elif operation == "-": return first_tensor - second_tensor else: raise ConfigurationError("Invalid operation: " + operation) def combine_tensors_and_multiply( combination: str, tensors: List[torch.Tensor], weights: torch.nn.Parameter ) -> torch.Tensor: """ Like [`combine_tensors`](./util.md#combine_tensors), but does a weighted (linear) multiplication while combining. This is a separate function from `combine_tensors` because we try to avoid instantiating large intermediate tensors during the combination, which is possible because we know that we're going to be multiplying by a weight vector in the end. # Parameters combination : `str` Same as in `combine_tensors` tensors : `List[torch.Tensor]` A list of tensors to combine, where the integers in the `combination` are (1-indexed) positions in this list of tensors. These tensors are all expected to have either three or four dimensions, with the final dimension being an embedding. If there are four dimensions, one of them must have length 1. weights : `torch.nn.Parameter` A vector of weights to use for the combinations. This should have shape (combined_dim,), as calculated by `get_combined_dim`. """ if len(tensors) > 9: raise ConfigurationError("Double-digit tensor lists not currently supported") combination = combination.replace("x", "1").replace("y", "2") pieces = combination.split(",") tensor_dims = [tensor.size(-1) for tensor in tensors] combination_dims = [_get_combination_dim(piece, tensor_dims) for piece in pieces] dims_so_far = 0 to_sum = [] for piece, combination_dim in zip(pieces, combination_dims): weight = weights[dims_so_far : (dims_so_far + combination_dim)] dims_so_far += combination_dim to_sum.append(_get_combination_and_multiply(piece, tensors, weight)) result = to_sum[0] for result_piece in to_sum[1:]: result = result + result_piece return result def _get_combination_and_multiply( combination: str, tensors: List[torch.Tensor], weight: torch.nn.Parameter ) -> torch.Tensor: if combination.isdigit(): index = int(combination) - 1 return torch.matmul(tensors[index], weight) else: if len(combination) != 3: raise ConfigurationError("Invalid combination: " + combination) first_tensor = _get_combination(combination[0], tensors) second_tensor = _get_combination(combination[2], tensors) operation = combination[1] if operation == "*": if first_tensor.dim() > 4 or second_tensor.dim() > 4: raise ValueError("Tensors with dim > 4 not currently supported") desired_dim = max(first_tensor.dim(), second_tensor.dim()) - 1 if first_tensor.dim() == 4: expanded_dim = _rindex(first_tensor.size(), 1) first_tensor = first_tensor.squeeze(expanded_dim) if second_tensor.dim() == 4: expanded_dim = _rindex(second_tensor.size(), 1) second_tensor = second_tensor.squeeze(expanded_dim) intermediate = first_tensor * weight result = torch.matmul(intermediate, second_tensor.transpose(-1, -2)) if result.dim() == desired_dim + 1: result = result.squeeze(-1) return result elif operation == "/": if first_tensor.dim() > 4 or second_tensor.dim() > 4: raise ValueError("Tensors with dim > 4 not currently supported") desired_dim = max(first_tensor.dim(), second_tensor.dim()) - 1 if first_tensor.dim() == 4: expanded_dim = _rindex(first_tensor.size(), 1) first_tensor = first_tensor.squeeze(expanded_dim) if second_tensor.dim() == 4: expanded_dim = _rindex(second_tensor.size(), 1) second_tensor = second_tensor.squeeze(expanded_dim) intermediate = first_tensor * weight result = torch.matmul(intermediate, second_tensor.pow(-1).transpose(-1, -2)) if result.dim() == desired_dim + 1: result = result.squeeze(-1) return result elif operation == "+": return torch.matmul(first_tensor, weight) + torch.matmul(second_tensor, weight) elif operation == "-": return torch.matmul(first_tensor, weight) - torch.matmul(second_tensor, weight) else: raise ConfigurationError("Invalid operation: " + operation) def get_combined_dim(combination: str, tensor_dims: List[int]) -> int: """ For use with [`combine_tensors`](./util.md#combine_tensors). This function computes the resultant dimension when calling `combine_tensors(combination, tensors)`, when the tensor dimension is known. This is necessary for knowing the sizes of weight matrices when building models that use `combine_tensors`. # Parameters combination : `str` A comma-separated list of combination pieces, like `"1,2,1*2"`, specified identically to `combination` in `combine_tensors`. tensor_dims : `List[int]` A list of tensor dimensions, where each dimension is from the `last axis` of the tensors that will be input to `combine_tensors`. """ if len(tensor_dims) > 9: raise ConfigurationError("Double-digit tensor lists not currently supported") combination = combination.replace("x", "1").replace("y", "2") return sum(_get_combination_dim(piece, tensor_dims) for piece in combination.split(",")) def _get_combination_dim(combination: str, tensor_dims: List[int]) -> int: if combination.isdigit(): index = int(combination) - 1 return tensor_dims[index] else: if len(combination) != 3: raise ConfigurationError("Invalid combination: " + combination) first_tensor_dim = _get_combination_dim(combination[0], tensor_dims) second_tensor_dim = _get_combination_dim(combination[2], tensor_dims) operation = combination[1] if first_tensor_dim != second_tensor_dim: raise ConfigurationError('Tensor dims must match for operation "{}"'.format(operation)) return first_tensor_dim def logsumexp(tensor: torch.Tensor, dim: int = -1, keepdim: bool = False) -> torch.Tensor: """ A numerically stable computation of logsumexp. This is mathematically equivalent to `tensor.exp().sum(dim, keep=keepdim).log()`. This function is typically used for summing log probabilities. # Parameters tensor : `torch.FloatTensor`, required. A tensor of arbitrary size. dim : `int`, optional (default = `-1`) The dimension of the tensor to apply the logsumexp to. keepdim: `bool`, optional (default = `False`) Whether to retain a dimension of size one at the dimension we reduce over. """ max_score, _ = tensor.max(dim, keepdim=keepdim) if keepdim: stable_vec = tensor - max_score else: stable_vec = tensor - max_score.unsqueeze(dim) return max_score + (stable_vec.exp().sum(dim, keepdim=keepdim)).log() def get_device_of(tensor: torch.Tensor) -> int: """ Returns the device of the tensor. """ if not tensor.is_cuda: return -1 else: return tensor.get_device() def flatten_and_batch_shift_indices(indices: torch.Tensor, sequence_length: int) -> torch.Tensor: """ This is a subroutine for [`batched_index_select`](./util.md#batched_index_select). The given `indices` of size `(batch_size, d_1, ..., d_n)` indexes into dimension 2 of a target tensor, which has size `(batch_size, sequence_length, embedding_size)`. This function returns a vector that correctly indexes into the flattened target. The sequence length of the target must be provided to compute the appropriate offsets. ```python indices = torch.ones([2,3], dtype=torch.long) # Sequence length of the target tensor. sequence_length = 10 shifted_indices = flatten_and_batch_shift_indices(indices, sequence_length) # Indices into the second element in the batch are correctly shifted # to take into account that the target tensor will be flattened before # the indices are applied. assert shifted_indices == [1, 1, 1, 11, 11, 11] ``` # Parameters indices : `torch.LongTensor`, required. sequence_length : `int`, required. The length of the sequence the indices index into. This must be the second dimension of the tensor. # Returns offset_indices : `torch.LongTensor` """ # Shape: (batch_size) if torch.max(indices) >= sequence_length or torch.min(indices) < 0: raise ConfigurationError( f"All elements in indices should be in range (0, {sequence_length - 1})" ) offsets = get_range_vector(indices.size(0), get_device_of(indices)) * sequence_length for _ in range(len(indices.size()) - 1): offsets = offsets.unsqueeze(1) # Shape: (batch_size, d_1, ..., d_n) offset_indices = indices + offsets # Shape: (batch_size * d_1 * ... * d_n) offset_indices = offset_indices.view(-1) return offset_indices def batched_index_select( target: torch.Tensor, indices: torch.LongTensor, flattened_indices: Optional[torch.LongTensor] = None, ) -> torch.Tensor: """ The given `indices` of size `(batch_size, d_1, ..., d_n)` indexes into the sequence dimension (dimension 2) of the target, which has size `(batch_size, sequence_length, embedding_size)`. This function returns selected values in the target with respect to the provided indices, which have size `(batch_size, d_1, ..., d_n, embedding_size)`. This can use the optionally precomputed `flattened_indices` with size `(batch_size * d_1 * ... * d_n)` if given. An example use case of this function is looking up the start and end indices of spans in a sequence tensor. This is used in the [CoreferenceResolver](https://docs.allennlp.org/models/main/models/coref/models/coref/) model to select contextual word representations corresponding to the start and end indices of mentions. The key reason this can't be done with basic torch functions is that we want to be able to use look-up tensors with an arbitrary number of dimensions (for example, in the coref model, we don't know a-priori how many spans we are looking up). # Parameters target : `torch.Tensor`, required. A 3 dimensional tensor of shape (batch_size, sequence_length, embedding_size). This is the tensor to be indexed. indices : `torch.LongTensor` A tensor of shape (batch_size, ...), where each element is an index into the `sequence_length` dimension of the `target` tensor. flattened_indices : `Optional[torch.Tensor]`, optional (default = `None`) An optional tensor representing the result of calling `flatten_and_batch_shift_indices` on `indices`. This is helpful in the case that the indices can be flattened once and cached for many batch lookups. # Returns selected_targets : `torch.Tensor` A tensor with shape [indices.size(), target.size(-1)] representing the embedded indices extracted from the batch flattened target tensor. """ if flattened_indices is None: # Shape: (batch_size * d_1 * ... * d_n) flattened_indices = flatten_and_batch_shift_indices(indices, target.size(1)) # Shape: (batch_size * sequence_length, embedding_size) flattened_target = target.view(-1, target.size(-1)) # Shape: (batch_size * d_1 * ... * d_n, embedding_size) flattened_selected = flattened_target.index_select(0, flattened_indices) selected_shape = list(indices.size()) + [target.size(-1)] # Shape: (batch_size, d_1, ..., d_n, embedding_size) selected_targets = flattened_selected.view(*selected_shape) return selected_targets def masked_index_fill( target: torch.Tensor, indices: torch.LongTensor, mask: torch.BoolTensor, fill_value: int = 1 ) -> torch.Tensor: """ The given `indices` in `target` will be will be filled with `fill_value` given a `mask`. # Parameters target : `torch.Tensor`, required. A 2 dimensional tensor of shape (batch_size, sequence_length). This is the tensor to be filled. indices : `torch.LongTensor`, required A 2 dimensional tensor of shape (batch_size, num_indices), These are the indices that will be filled in the original tensor. mask : `torch.Tensor`, required. A 2 dimensional tensor of shape (batch_size, num_indices), mask.sum() == `nonzero_indices`. fill_value : `int`, optional (default = `1`) The value we fill the tensor with. # Returns filled_target : `torch.Tensor` A tensor with shape (batch_size, sequence_length) where 'indices' are filled with `fill_value` """ mask = mask.bool() prev_shape = target.size() # Shape: (batch_size * num_indices) flattened_indices = flatten_and_batch_shift_indices(indices * mask, target.size(1)) # Shape: (batch_size * num_indices, 1) mask = mask.view(-1) # Shape: (batch_size * sequence_length, 1) flattened_target = target.view(-1, 1) # Shape: (nonzero_indices, 1) unmasked_indices = flattened_indices[mask].unsqueeze(-1) flattened_target = flattened_target.scatter(0, unmasked_indices, fill_value) filled_target = flattened_target.reshape(prev_shape) return filled_target def masked_index_replace( target: torch.Tensor, indices: torch.LongTensor, mask: torch.BoolTensor, replace: torch.Tensor, ) -> torch.Tensor: """ The given `indices` in `target` will be will be replaced with corresponding index from the `replace` tensor given a `mask`. # Parameters target : `torch.Tensor`, required. A 3 dimensional tensor of shape (batch_size, sequence_length, embedding_dim). This is the tensor to be replaced into. indices : `torch.LongTensor`, required A 2 dimensional tensor of shape (batch_size, num_indices), These are the indices that will be replaced in the original tensor. mask : `torch.Tensor`, required. A 2 dimensional tensor of shape (batch_size, num_indices), mask.sum() == `nonzero_indices`. replace : `torch.Tensor`, required. A 3 dimensional tensor of shape (batch_size, num_indices, embedding_dim), The tensor to perform scatter from. # Returns replaced_target : `torch.Tensor` A tensor with shape (batch_size, sequence_length, embedding_dim) where 'indices' are replaced with the corrosponding vector from `replace` """ target = target.clone() mask = mask.bool() prev_shape = target.size() # Shape: (batch_size * num_indices) flattened_indices = flatten_and_batch_shift_indices(indices * mask, target.size(1)) # Shape: (batch_size * sequence_length, embedding_size) flattened_target = target.view(-1, target.size(-1)) # Shape: (nonzero_indices, 1) mask = mask.view(-1) flattened_target[flattened_indices[mask]] = replace.view(-1, replace.size(-1))[mask] # Shape: (batch_size, sequence_length, embedding_dim) replaced_target = flattened_target.reshape(prev_shape) return replaced_target def batched_span_select(target: torch.Tensor, spans: torch.LongTensor) -> torch.Tensor: """ The given `spans` of size `(batch_size, num_spans, 2)` indexes into the sequence dimension (dimension 2) of the target, which has size `(batch_size, sequence_length, embedding_size)`. This function returns segmented spans in the target with respect to the provided span indices. # Parameters target : `torch.Tensor`, required. A 3 dimensional tensor of shape (batch_size, sequence_length, embedding_size). This is the tensor to be indexed. indices : `torch.LongTensor` A 3 dimensional tensor of shape (batch_size, num_spans, 2) representing start and end indices (both inclusive) into the `sequence_length` dimension of the `target` tensor. # Returns span_embeddings : `torch.Tensor` A tensor with shape (batch_size, num_spans, max_batch_span_width, embedding_size] representing the embedded spans extracted from the batch flattened target tensor. span_mask: `torch.BoolTensor` A tensor with shape (batch_size, num_spans, max_batch_span_width) representing the mask on the returned span embeddings. """ # both of shape (batch_size, num_spans, 1) span_starts, span_ends = spans.split(1, dim=-1) # shape (batch_size, num_spans, 1) # These span widths are off by 1, because the span ends are `inclusive`. span_widths = span_ends - span_starts # We need to know the maximum span width so we can # generate indices to extract the spans from the sequence tensor. # These indices will then get masked below, such that if the length # of a given span is smaller than the max, the rest of the values # are masked. max_batch_span_width = span_widths.max().item() + 1 # Shape: (1, 1, max_batch_span_width) max_span_range_indices = get_range_vector(max_batch_span_width, get_device_of(target)).view( 1, 1, -1 ) # Shape: (batch_size, num_spans, max_batch_span_width) # This is a broadcasted comparison - for each span we are considering, # we are creating a range vector of size max_span_width, but masking values # which are greater than the actual length of the span. # # We're using <= here (and for the mask below) because the span ends are # inclusive, so we want to include indices which are equal to span_widths rather # than using it as a non-inclusive upper bound. span_mask = max_span_range_indices <= span_widths raw_span_indices = span_starts + max_span_range_indices # We also don't want to include span indices which greater than the sequence_length, # which happens because some spans near the end of the sequence # have a start index + max_batch_span_width > sequence_length, so we add this to the mask here. span_mask = span_mask & (raw_span_indices < target.size(1)) & (0 <= raw_span_indices) span_indices = raw_span_indices * span_mask # Shape: (batch_size, num_spans, max_batch_span_width, embedding_dim) span_embeddings = batched_index_select(target, span_indices) return span_embeddings, span_mask def flattened_index_select(target: torch.Tensor, indices: torch.LongTensor) -> torch.Tensor: """ The given `indices` of size `(set_size, subset_size)` specifies subsets of the `target` that each of the set_size rows should select. The `target` has size `(batch_size, sequence_length, embedding_size)`, and the resulting selected tensor has size `(batch_size, set_size, subset_size, embedding_size)`. # Parameters target : `torch.Tensor`, required. A Tensor of shape (batch_size, sequence_length, embedding_size). indices : `torch.LongTensor`, required. A LongTensor of shape (set_size, subset_size). All indices must be < sequence_length as this tensor is an index into the sequence_length dimension of the target. # Returns selected : `torch.Tensor`, required. A Tensor of shape (batch_size, set_size, subset_size, embedding_size). """ if indices.dim() != 2: raise ConfigurationError( "Indices passed to flattened_index_select had shape {} but " "only 2 dimensional inputs are supported.".format(indices.size()) ) # Shape: (batch_size, set_size * subset_size, embedding_size) flattened_selected = target.index_select(1, indices.view(-1)) # Shape: (batch_size, set_size, subset_size, embedding_size) selected = flattened_selected.view(target.size(0), indices.size(0), indices.size(1), -1) return selected def get_range_vector(size: int, device: int) -> torch.Tensor: """ Returns a range vector with the desired size, starting at 0. The CUDA implementation is meant to avoid copy data from CPU to GPU. """ if device > -1: return torch.cuda.LongTensor(size, device=device).fill_(1).cumsum(0) - 1 else: return torch.arange(0, size, dtype=torch.long) def bucket_values( distances: torch.Tensor, num_identity_buckets: int = 4, num_total_buckets: int = 10 ) -> torch.Tensor: """ Places the given values (designed for distances) into `num_total_buckets`semi-logscale buckets, with `num_identity_buckets` of these capturing single values. The default settings will bucket values into the following buckets: [0, 1, 2, 3, 4, 5-7, 8-15, 16-31, 32-63, 64+]. # Parameters distances : `torch.Tensor`, required. A Tensor of any size, to be bucketed. num_identity_buckets: `int`, optional (default = `4`). The number of identity buckets (those only holding a single value). num_total_buckets : `int`, (default = `10`) The total number of buckets to bucket values into. # Returns `torch.Tensor` A tensor of the same shape as the input, containing the indices of the buckets the values were placed in. """ # Chunk the values into semi-logscale buckets using .floor(). # This is a semi-logscale bucketing because we divide by log(2) after taking the log. # We do this to make the buckets more granular in the initial range, where we expect # most values to fall. We then add (num_identity_buckets - 1) because we want these indices # to start _after_ the fixed number of buckets which we specified would only hold single values. logspace_index = (distances.float().log() / math.log(2)).floor().long() + ( num_identity_buckets - 1 ) # create a mask for values which will go into single number buckets (i.e not a range). use_identity_mask = (distances <= num_identity_buckets).long() use_buckets_mask = 1 + (-1 * use_identity_mask) # Use the original values if they are less than num_identity_buckets, otherwise # use the logspace indices. combined_index = use_identity_mask * distances + use_buckets_mask * logspace_index # Clamp to put anything > num_total_buckets into the final bucket. return combined_index.clamp(0, num_total_buckets - 1) def add_sentence_boundary_token_ids( tensor: torch.Tensor, mask: torch.BoolTensor, sentence_begin_token: Any, sentence_end_token: Any ) -> Tuple[torch.Tensor, torch.BoolTensor]: """ Add begin/end of sentence tokens to the batch of sentences. Given a batch of sentences with size `(batch_size, timesteps)` or `(batch_size, timesteps, dim)` this returns a tensor of shape `(batch_size, timesteps + 2)` or `(batch_size, timesteps + 2, dim)` respectively. Returns both the new tensor and updated mask. # Parameters tensor : `torch.Tensor` A tensor of shape `(batch_size, timesteps)` or `(batch_size, timesteps, dim)` mask : `torch.BoolTensor` A tensor of shape `(batch_size, timesteps)` sentence_begin_token: `Any` Can be anything that can be broadcast in torch for assignment. For 2D input, a scalar with the `<S>` id. For 3D input, a tensor with length dim. sentence_end_token: `Any` Can be anything that can be broadcast in torch for assignment. For 2D input, a scalar with the `</S>` id. For 3D input, a tensor with length dim. # Returns tensor_with_boundary_tokens : `torch.Tensor` The tensor with the appended and prepended boundary tokens. If the input was 2D, it has shape (batch_size, timesteps + 2) and if the input was 3D, it has shape (batch_size, timesteps + 2, dim). new_mask : `torch.BoolTensor` The new mask for the tensor, taking into account the appended tokens marking the beginning and end of the sentence. """ sequence_lengths = mask.sum(dim=1).detach().cpu().numpy() tensor_shape = list(tensor.data.shape) new_shape = list(tensor_shape) new_shape[1] = tensor_shape[1] + 2 tensor_with_boundary_tokens = tensor.new_zeros(*new_shape, device=tensor.device) if len(tensor_shape) == 2: tensor_with_boundary_tokens[:, 1:-1] = tensor tensor_with_boundary_tokens[:, 0] = sentence_begin_token for i, j in enumerate(sequence_lengths): tensor_with_boundary_tokens[i, j + 1] = sentence_end_token new_mask = tensor_with_boundary_tokens != 0 elif len(tensor_shape) == 3: tensor_with_boundary_tokens[:, 1:-1, :] = tensor sentence_begin_token = sentence_begin_token.detach().to(tensor.device) sentence_end_token = sentence_end_token.detach().to(tensor.device) for i, j in enumerate(sequence_lengths): tensor_with_boundary_tokens[i, 0, :] = sentence_begin_token tensor_with_boundary_tokens[i, j + 1, :] = sentence_end_token new_mask = (tensor_with_boundary_tokens > 0).sum(dim=-1) > 0 else: raise ValueError("add_sentence_boundary_token_ids only accepts 2D and 3D input") return tensor_with_boundary_tokens, new_mask def remove_sentence_boundaries( tensor: torch.Tensor, mask: torch.BoolTensor ) -> Tuple[torch.Tensor, torch.Tensor]: """ Remove begin/end of sentence embeddings from the batch of sentences. Given a batch of sentences with size `(batch_size, timesteps, dim)` this returns a tensor of shape `(batch_size, timesteps - 2, dim)` after removing the beginning and end sentence markers. The sentences are assumed to be padded on the right, with the beginning of each sentence assumed to occur at index 0 (i.e., `mask[:, 0]` is assumed to be 1). Returns both the new tensor and updated mask. This function is the inverse of `add_sentence_boundary_token_ids`. # Parameters tensor : `torch.Tensor` A tensor of shape `(batch_size, timesteps, dim)` mask : `torch.BoolTensor` A tensor of shape `(batch_size, timesteps)` # Returns tensor_without_boundary_tokens : `torch.Tensor` The tensor after removing the boundary tokens of shape `(batch_size, timesteps - 2, dim)` new_mask : `torch.BoolTensor` The new mask for the tensor of shape `(batch_size, timesteps - 2)`. """ sequence_lengths = mask.sum(dim=1).detach().cpu().numpy() tensor_shape = list(tensor.data.shape) new_shape = list(tensor_shape) new_shape[1] = tensor_shape[1] - 2 tensor_without_boundary_tokens = tensor.new_zeros(*new_shape) new_mask = tensor.new_zeros((new_shape[0], new_shape[1]), dtype=torch.bool) for i, j in enumerate(sequence_lengths): if j > 2: tensor_without_boundary_tokens[i, : (j - 2), :] = tensor[i, 1 : (j - 1), :] new_mask[i, : (j - 2)] = True return tensor_without_boundary_tokens, new_mask def add_positional_features( tensor: torch.Tensor, min_timescale: float = 1.0, max_timescale: float = 1.0e4 ): """ Implements the frequency-based positional encoding described in [Attention is All you Need][0]. Adds sinusoids of different frequencies to a `Tensor`. A sinusoid of a different frequency and phase is added to each dimension of the input `Tensor`. This allows the attention heads to use absolute and relative positions. The number of timescales is equal to hidden_dim / 2 within the range (min_timescale, max_timescale). For each timescale, the two sinusoidal signals sin(timestep / timescale) and cos(timestep / timescale) are generated and concatenated along the hidden_dim dimension. [0]: https://www.semanticscholar.org/paper/Attention-Is-All-You-Need-Vaswani-Shazeer/0737da0767d77606169cbf4187b83e1ab62f6077 # Parameters tensor : `torch.Tensor` a Tensor with shape (batch_size, timesteps, hidden_dim). min_timescale : `float`, optional (default = `1.0`) The smallest timescale to use. max_timescale : `float`, optional (default = `1.0e4`) The largest timescale to use. # Returns `torch.Tensor` The input tensor augmented with the sinusoidal frequencies. """ # noqa _, timesteps, hidden_dim = tensor.size() timestep_range = get_range_vector(timesteps, get_device_of(tensor)).data.float() # We're generating both cos and sin frequencies, # so half for each. num_timescales = hidden_dim // 2 timescale_range = get_range_vector(num_timescales, get_device_of(tensor)).data.float() log_timescale_increments = math.log(float(max_timescale) / float(min_timescale)) / float( num_timescales - 1 ) inverse_timescales = min_timescale * torch.exp(timescale_range * -log_timescale_increments) # Broadcasted multiplication - shape (timesteps, num_timescales) scaled_time = timestep_range.unsqueeze(1) * inverse_timescales.unsqueeze(0) # shape (timesteps, 2 * num_timescales) sinusoids = torch.cat([torch.sin(scaled_time), torch.cos(scaled_time)], 1) if hidden_dim % 2 != 0: # if the number of dimensions is odd, the cos and sin # timescales had size (hidden_dim - 1) / 2, so we need # to add a row of zeros to make up the difference. sinusoids = torch.cat([sinusoids, sinusoids.new_zeros(timesteps, 1)], 1) return tensor + sinusoids.unsqueeze(0) def clone(module: torch.nn.Module, num_copies: int) -> torch.nn.ModuleList: """Produce N identical layers.""" return torch.nn.ModuleList(copy.deepcopy(module) for _ in range(num_copies)) def combine_initial_dims(tensor: torch.Tensor) -> torch.Tensor: """ Given a (possibly higher order) tensor of ids with shape (d1, ..., dn, sequence_length) Return a view that's (d1 * ... * dn, sequence_length). If original tensor is 1-d or 2-d, return it as is. """ if tensor.dim() <= 2: return tensor else: return tensor.view(-1, tensor.size(-1)) def uncombine_initial_dims(tensor: torch.Tensor, original_size: torch.Size) -> torch.Tensor: """ Given a tensor of embeddings with shape (d1 * ... * dn, sequence_length, embedding_dim) and the original shape (d1, ..., dn, sequence_length), return the reshaped tensor of embeddings with shape (d1, ..., dn, sequence_length, embedding_dim). If original size is 1-d or 2-d, return it as is. """ if len(original_size) <= 2: return tensor else: view_args = list(original_size) + [tensor.size(-1)] return tensor.view(*view_args) def inspect_parameters(module: torch.nn.Module, quiet: bool = False) -> Dict[str, Any]: """ Inspects the model/module parameters and their tunability. The output is structured in a nested dict so that parameters in same sub-modules are grouped together. This can be helpful to setup module path based regex, for example in initializer. It prints it by default (optional) and returns the inspection dict. Eg. output:: { "_text_field_embedder": { "token_embedder_tokens": { "_projection": { "bias": "tunable", "weight": "tunable" }, "weight": "frozen" } } } """ results: Dict[str, Any] = {} for name, param in sorted(module.named_parameters()): keys = name.split(".") write_to = results for key in keys[:-1]: if key not in write_to: write_to[key] = {} write_to = write_to[key] write_to[keys[-1]] = "tunable" if param.requires_grad else "frozen" if not quiet: print(json.dumps(results, indent=4)) return results def find_text_field_embedder(model: torch.nn.Module) -> torch.nn.Module: """ Takes a `Model` and returns the `Module` that is a `TextFieldEmbedder`. We return just the first one, as it's very rare to have more than one. If there isn't a `TextFieldEmbedder` in the given `Model`, we raise a `ValueError`. """ from allennlp.modules.text_field_embedders.text_field_embedder import TextFieldEmbedder for module in model.modules(): if isinstance(module, TextFieldEmbedder): return module raise ValueError("Couldn't find TextFieldEmbedder!") def find_embedding_layer(model: torch.nn.Module) -> torch.nn.Module: """ Takes a model (typically an AllenNLP `Model`, but this works for any `torch.nn.Module`) and makes a best guess about which module is the embedding layer. For typical AllenNLP models, this often is the `TextFieldEmbedder`, but if you're using a pre-trained contextualizer, we really want layer 0 of that contextualizer, not the output. So there are a bunch of hacks in here for specific pre-trained contextualizers. """ # We'll look for a few special cases in a first pass, then fall back to just finding a # TextFieldEmbedder in a second pass if we didn't find a special case. from transformers.models.gpt2.modeling_gpt2 import GPT2Model from transformers.models.bert.modeling_bert import BertEmbeddings from transformers.models.albert.modeling_albert import AlbertEmbeddings from transformers.models.roberta.modeling_roberta import RobertaEmbeddings from allennlp.modules.text_field_embedders.text_field_embedder import TextFieldEmbedder from allennlp.modules.text_field_embedders.basic_text_field_embedder import ( BasicTextFieldEmbedder, ) from allennlp.modules.token_embedders.embedding import Embedding for module in model.modules(): if isinstance(module, BertEmbeddings): return module.word_embeddings if isinstance(module, RobertaEmbeddings): return module.word_embeddings if isinstance(module, AlbertEmbeddings): return module.word_embeddings if isinstance(module, GPT2Model): return module.wte for module in model.modules(): if isinstance(module, TextFieldEmbedder): if isinstance(module, BasicTextFieldEmbedder): # We'll have a check for single Embedding cases, because we can be more efficient # in cases like this. If this check fails, then for something like hotflip we need # to actually run the text field embedder and construct a vector for each token. if len(module._token_embedders) == 1: embedder = list(module._token_embedders.values())[0] if isinstance(embedder, Embedding): if embedder._projection is None: # If there's a projection inside the Embedding, then we need to return # the whole TextFieldEmbedder, because there's more computation that # needs to be done than just multiply by an embedding matrix. return embedder return module raise RuntimeError("No embedding module found!") def get_token_offsets_from_text_field_inputs( text_field_inputs: List[Any], ) -> Optional[torch.Tensor]: """ Given a list of inputs to a TextFieldEmbedder, tries to find token offsets from those inputs, if there are any. You will have token offsets if you are using a mismatched token embedder; if you're not, the return value from this function should be None. This function is intended to be called from a `forward_hook` attached to a `TextFieldEmbedder`, so the inputs are formatted just as a list. It's possible in theory that you could have multiple offsets as inputs to a single call to a `TextFieldEmbedder`, but that's an extremely rare use case (I can't really imagine anyone wanting to do that). In that case, we'll only return the first one. If you need different behavior for your model, open an issue on github describing what you're doing. """ for input_index, text_field_input in enumerate(text_field_inputs): if not isinstance(text_field_input, dict): continue for input_value in text_field_input.values(): if not isinstance(input_value, dict): continue for embedder_arg_name, embedder_arg_value in input_value.items(): if embedder_arg_name == "offsets": return embedder_arg_value return None def extend_layer(layer: torch.nn.Module, new_dim: int) -> None: valid_layers = [torch.nn.Linear, torch.nn.Bilinear] if not any([isinstance(layer, i) for i in valid_layers]): raise ConfigurationError("Inappropriate layer type") extend_dim = new_dim - layer.out_features if not extend_dim: return layer if isinstance(layer, torch.nn.Linear): new_weight = torch.FloatTensor(extend_dim, layer.in_features) elif isinstance(layer, torch.nn.Bilinear): new_weight = torch.FloatTensor(extend_dim, layer.in1_features, layer.in2_features) new_bias = torch.FloatTensor(extend_dim) torch.nn.init.xavier_uniform_(new_weight) torch.nn.init.zeros_(new_bias) device = layer.weight.device layer.weight = torch.nn.Parameter( torch.cat([layer.weight.data, new_weight.to(device)], dim=0), requires_grad=layer.weight.requires_grad, ) layer.bias = torch.nn.Parameter( torch.cat([layer.bias.data, new_bias.to(device)], dim=0), requires_grad=layer.bias.requires_grad, ) layer.out_features = new_dim def masked_topk( input_: torch.FloatTensor, mask: torch.BoolTensor, k: Union[int, torch.LongTensor], dim: int = -1, ) -> Tuple[torch.LongTensor, torch.LongTensor, torch.FloatTensor]: """ Extracts the top-k items along a certain dimension. This is similar to `torch.topk` except: (1) we allow of a `mask` that makes the function not consider certain elements; (2) the returned top input, mask, and indices are sorted in their original order in the input; (3) May use the same k for all dimensions, or different k for each. # Parameters input_ : `torch.FloatTensor`, required. A tensor containing the items that we want to prune. mask : `torch.BoolTensor`, required. A tensor with the same shape as `input_` that makes the function not consider masked out (i.e. False) elements. k : `Union[int, torch.LongTensor]`, required. If a tensor of shape as `input_` except without dimension `dim`, specifies the number of items to keep for each dimension. If an int, keep the same number of items for all dimensions. # Returns top_input : `torch.FloatTensor` The values of the top-k scoring items. Has the same shape as `input_` except dimension `dim` has value `k` when it's an `int` or `k.max()` when it's a tensor. top_mask : `torch.BoolTensor` The corresponding mask for `top_input`. Has the shape as `top_input`. top_indices : `torch.IntTensor` The indices of the top-k scoring items into the original `input_` tensor. This is returned because it can be useful to retain pointers to the original items, if each item is being scored by multiple distinct scorers, for instance. Has the shape as `top_input`. """ if input_.size() != mask.size(): raise ValueError("`input_` and `mask` must have the same shape.") if not -input_.dim() <= dim < input_.dim(): raise ValueError("`dim` must be in `[-input_.dim(), input_.dim())`") dim = (dim + input_.dim()) % input_.dim() max_k = k if isinstance(k, int) else k.max() # We put the dim in question to the last dimension by permutation, and squash all leading dims. # [0, 1, ..., dim - 1, dim + 1, ..., input.dim() - 1, dim] permutation = list(range(input_.dim())) permutation.pop(dim) permutation += [dim] # [0, 1, ..., dim - 1, -1, dim, ..., input.dim() - 2]; for restoration reverse_permutation = list(range(input_.dim() - 1)) reverse_permutation.insert(dim, -1) other_dims_size = list(input_.size()) other_dims_size.pop(dim) permuted_size = other_dims_size + [max_k] # for restoration # If an int was given for number of items to keep, construct tensor by repeating the value. if isinstance(k, int): # Put the tensor on same device as the mask. k = k * torch.ones(*other_dims_size, dtype=torch.long, device=mask.device) else: if list(k.size()) != other_dims_size: raise ValueError( "`k` must have the same shape as `input_` with dimension `dim` removed." ) num_items = input_.size(dim) # (batch_size, num_items) -- "batch_size" refers to all other dimensions stacked together input_ = input_.permute(*permutation).reshape(-1, num_items) mask = mask.permute(*permutation).reshape(-1, num_items) k = k.reshape(-1) # Make sure that we don't select any masked items by setting their scores to be very # negative. input_ = replace_masked_values(input_, mask, min_value_of_dtype(input_.dtype)) # Shape: (batch_size, max_k) _, top_indices = input_.topk(max_k, 1) # Mask based on number of items to keep for each sentence. # Shape: (batch_size, max_k) top_indices_mask = get_mask_from_sequence_lengths(k, max_k).bool() # Fill all masked indices with largest "top" index for that sentence, so that all masked # indices will be sorted to the end. # Shape: (batch_size, 1) fill_value, _ = top_indices.max(dim=1, keepdim=True) # Shape: (batch_size, max_num_items_to_keep) top_indices = torch.where(top_indices_mask, top_indices, fill_value) # Now we order the selected indices in increasing order with # respect to their indices (and hence, with respect to the # order they originally appeared in the `embeddings` tensor). top_indices, _ = top_indices.sort(1) # Combine the masks on spans that are out-of-bounds, and the mask on spans that are outside # the top k for each sentence. # Shape: (batch_size, max_k) sequence_mask = mask.gather(1, top_indices) top_mask = top_indices_mask & sequence_mask # Shape: (batch_size, max_k) top_input = input_.gather(1, top_indices) return ( top_input.reshape(*permuted_size).permute(*reverse_permutation), top_mask.reshape(*permuted_size).permute(*reverse_permutation), top_indices.reshape(*permuted_size).permute(*reverse_permutation), ) def info_value_of_dtype(dtype: torch.dtype): """ Returns the `finfo` or `iinfo` object of a given PyTorch data type. Does not allow torch.bool. """ if dtype == torch.bool: raise TypeError("Does not support torch.bool") elif dtype.is_floating_point: return torch.finfo(dtype) else: return torch.iinfo(dtype) def min_value_of_dtype(dtype: torch.dtype): """ Returns the minimum value of a given PyTorch data type. Does not allow torch.bool. """ return info_value_of_dtype(dtype).min def max_value_of_dtype(dtype: torch.dtype): """ Returns the maximum value of a given PyTorch data type. Does not allow torch.bool. """ return info_value_of_dtype(dtype).max def tiny_value_of_dtype(dtype: torch.dtype): """ Returns a moderately tiny value for a given PyTorch data type that is used to avoid numerical issues such as division by zero. This is different from `info_value_of_dtype(dtype).tiny` because it causes some NaN bugs. Only supports floating point dtypes. """ if not dtype.is_floating_point: raise TypeError("Only supports floating point dtypes.") if dtype == torch.float or dtype == torch.double: return 1e-13 elif dtype == torch.half: return 1e-4 else: raise TypeError("Does not support dtype " + str(dtype)) _V = TypeVar("_V", int, float, torch.Tensor) def distributed_device() -> torch.device: """ Get the correct `torch.device` of the current process to use for distributed point-to-point communication. """ if not is_distributed(): raise RuntimeError( "'distributed_device()' can only be called within a distributed process group" ) return int_to_device(-1 if dist.get_backend() != "nccl" else torch.cuda.current_device()) def dist_reduce(value: _V, reduce_op) -> _V: """ Reduces the given `value` across all distributed worker nodes according the given reduction operation. If called outside of a distributed context, it will just return `value`. # Parameters value : `_V` The value to reduce across distributed nodes. reduce_op : `torch.distributed.ReduceOp` The [reduction operation](https://pytorch.org/docs/stable/distributed.html#torch.distributed.ReduceOp) to use. **kwargs : `Any` Additional arguments used to construct the tensor that will wrap `value`. # Returns `_V` The final value. """ if not is_distributed(): return value device = distributed_device() if isinstance(value, torch.Tensor): value_tensor = value.clone().to(device) else: value_tensor = torch.tensor(value, device=device) dist.all_reduce(value_tensor, op=reduce_op) if isinstance(value, torch.Tensor): return value_tensor return value_tensor.item() # type: ignore[return-value] def dist_reduce_sum(value: _V) -> _V: """ Sums the given `value` across distributed worker nodes. This is equivalent to calling `dist_reduce(v, dist.ReduceOp.SUM)`. """ # NOTE: Why have this check here even though the same check is in `dist_reduce()`? # Because we want to be able to call this function even when torch's distributed framework # is not available... # If torch's distributed framework is not available on the system, then `torch.distributed` # (imported here as `dist`) will just be an empty module. So calling `dist.ReduceOp.SUM` would # result in an `AttributeError`. if not is_distributed(): return value return dist_reduce(value, dist.ReduceOp.SUM) def _collect_state_dict( module: torch.nn.Module, state_dict: Optional[StateDictType], recurse: bool = True, prefix: str = "", ) -> Tuple[StateDictType, List[str], List[str]]: """ Collect a module's state dict across distributed processes. Returns the syncronized state dictionary, which will always be a valid state dict, and then the missing and unexpected keys corresponding to the original `state_dict`. Parameters that missing from the original `state_dict` will be populated from the corresponding parameter in the primary processes' module's state dict. !!! Note `missing_keys` and `unexpected_keys` are only populated in the primary process. """ # This is the device we'll use for the broadcast operation. dist_device = distributed_device() # We'll keep tensors on CPU in the returned state dict. state_dict_device = int_to_device(-1) missing_keys: List[str] = [] unexpected_keys: List[str] = [] # Gather current state dict and prepare to iterator over it. # We iterate over this state dict instead of `state_dict` so we can be sure # that the order is consistent across processes. # We'll also update this state dict as we go and return it at the end. if recurse: current_state_dict = module.state_dict() else: # Only collect state of direct members, including both parameters and buffers. current_state_dict = OrderedDict( chain( # Paramaters ((n, p.data) for (n, p) in module.named_parameters(recurse=False)), # Buffers module.named_buffers(recurse=False), ) ) keys = list(current_state_dict.keys()) # Gather unexpected_keys. if is_global_primary(): assert state_dict is not None for key in state_dict: if key not in keys: unexpected_keys.append(key) for key in keys: tensor = current_state_dict[key] if is_global_primary(): assert state_dict is not None if key in state_dict: # Update `tensor` to the value in `state_dict`. tensor = state_dict[key] else: missing_keys.append(key) logger.debug("Broadcasting distributed parameter '%s'", prefix + key) tensor = tensor.to(dist_device) dist.broadcast(tensor, 0) current_state_dict[key] = tensor.to(state_dict_device) return current_state_dict, missing_keys, unexpected_keys class _IncompatibleKeys(NamedTuple): missing_keys: List[str] unexpected_keys: List[str] def __repr__(self): if not self.missing_keys and not self.unexpected_keys: return "<All keys matched successfully>" return f"(missing_keys = {self.missing_keys}, unexpected_keys = {self.unexpected_keys})" def _check_incompatible_keys( module, missing_keys: List[str], unexpected_keys: List[str], strict: bool ): error_msgs: List[str] = [] if missing_keys: error_msgs.append( "Missing key(s) in state_dict: {}".format(", ".join(f'"{k}"' for k in missing_keys)) ) if unexpected_keys: error_msgs.append( "Unexpected key(s) in state_dict: {}".format( ", ".join(f'"{k}"' for k in unexpected_keys) ) ) if error_msgs and strict: raise RuntimeError( "Error(s) in loading state_dict for {}:\n\t{}".format( module.__class__.__name__, "\n\t".join(error_msgs) ) ) def load_state_dict_distributed( module: torch.nn.Module, state_dict: Optional[StateDictType], strict: bool = True, prefix: str = "", ) -> _IncompatibleKeys: """ Load a `state_dict` to the `module` within a distributed process. Only the global primary process requires the `state_dict` to not be `None`. All other processes will have the state tensors broadcasted to them one-by-one. If `strict` is `True`, then the keys of `state_dict` must exactly match the keys returned by `module.state_dict()`. !!! Note The returned `missing_keys` and `unexpected_keys` will only be accurate in the primary process. # Returns A `NamedTuple` with `missing_keys` and `unexpected_keys` fields, both of which are lists of strings. # Raises `RuntimeError` If `strict` is `True` and there are missing or unexpected keys. """ if not is_distributed(): return module.load_state_dict(state_dict, strict=strict) if is_global_primary(): assert state_dict is not None else: assert state_dict is None missing_keys: List[str] = [] unexpected_keys: List[str] = [] submodules = dict(module.named_children()) def update_key_list(original, updates): for key in updates: if key not in original: original.append(key) from allennlp.nn.parallel.sharded_module_mixin import ShardedModuleMixin # If we've found a sharded module or there aren't any more submodules of the current module, # we collect the state_dict and load it now instead of recursing further. if isinstance(module, ShardedModuleMixin) or not submodules: # Collect. state_dict, _missing_keys, _unexpected_keys = _collect_state_dict( module, state_dict, prefix=prefix ) assert state_dict is not None update_key_list(missing_keys, _missing_keys) update_key_list(unexpected_keys, _unexpected_keys) # And load. _missing_keys, _unexpected_keys = module.load_state_dict(state_dict, strict=False) update_key_list(missing_keys, _missing_keys) update_key_list(unexpected_keys, _unexpected_keys) else: # We'll recursively call this function on each submodule, but first we need # to collect any parameters that are direct members of this module. direct_member_state_dict, _missing_keys, _unexpected_keys = _collect_state_dict( module, state_dict, recurse=False, prefix=prefix, ) # `_unexpected_keys` will contain keys corresponding to submodules (not direct members) # that may be legitimate, so we ignore any `_unexpected_keys` here that correspond to submodules. _unexpected_keys = [ k for k in _unexpected_keys if "." not in k or k.split(".")[0] not in submodules.keys() ] update_key_list(missing_keys, _missing_keys) update_key_list(unexpected_keys, _unexpected_keys) # `_missing_keys` here will contain any keys corresponding to submodules, but # we'll remove those below. _missing_keys, _unexpected_keys = module.load_state_dict( direct_member_state_dict, strict=False ) update_key_list(missing_keys, _missing_keys) update_key_list(unexpected_keys, _unexpected_keys) # Okay, now for the recursive part. for name, submodule in submodules.items(): # Update `missing_keys` to remove keys corresponding to this submodule. # If they are actually missing after this step, we add them back in below. missing_keys = [k for k in missing_keys if not k.startswith(name + ".")] submodule_state_dict: Optional[StateDictType] = None if is_global_primary(): assert state_dict is not None submodule_state_dict = { key.replace(name + ".", "", 1): value for key, value in state_dict.items() if key.startswith(name + ".") } _missing_keys, _unexpected_keys = load_state_dict_distributed( submodule, submodule_state_dict, strict=False, prefix=prefix + name + ".", ) update_key_list(missing_keys, [f"{name}.{key}" for key in _missing_keys]) update_key_list(unexpected_keys, [f"{name}.{key}" for key in _unexpected_keys]) _check_incompatible_keys(module, missing_keys, unexpected_keys, strict) return _IncompatibleKeys(missing_keys, unexpected_keys)
__author__ = 'emalishenko' from model.group import Group from random import randrange def test_modify_group_name(app): group = Group(name="To be modified") if app.group.count() == 0: app.group.create(Group(name="New group name")) old_groups = app.group.get_group_list() index = randrange(len(old_groups)) group.id = old_groups[index].id app.group.modify_group_by_index(group, index) assert len(old_groups) == app.group.count() new_groups = app.group.get_group_list() old_groups[index] = group assert sorted(old_groups, key = Group.id_or_max) == sorted(new_groups, key = Group.id_or_max)
""" """ import pygimli as pg import pybert as pb class DCMultiElectrodeModellingC(pb.DCMultiElectrodeModelling): def __init__(self, mesh, data, verbose): super().__init__(mesh, data, verbose) self.setComplex(True) self._J = pg.matrix.BlockMatrix() self.setJacobian(self._J) self._C = pg.matrix.BlockMatrix() self.setConstraints(self._C) self.matrixHeap = [] # super().createConstraints = self.createConstraints def createDefaultStartModel(self): """ """ res = pb.getComplexData(self.data()) parCount = self.regionManager().parameterCount() re = pg.Vector(parCount, pg.mean(pg.math.real(res))) im = pg.Vector(parCount, -pg.mean(pg.math.imag(res))) return pg.cat(re, im) def createJacobian(self, model): print('=' * 100) if self.complex(): modelRe = model[0:int(len(model)/2)] modelIm = model[int(len(model)/2):len(model)] modelC = pg.math.toComplex(modelRe, modelIm) print("Real", min(modelRe), max(modelRe)) print("Imag", min(modelIm), max(modelIm)) u = self.prepareJacobian_(modelC) if self._J.rows() == 0: #re(data)/re(mod) = im(data)/im(mod) # we need a local copy until we have a gimli internal reference counter FIXTHIS M1 = pg.Matrix() M2 = pg.Matrix() self.matrixHeap.append(M1) self.matrixHeap.append(M2) JRe = self._J.addMatrix(M1) JIm = self._J.addMatrix(M2) self._J.addMatrixEntry(JRe, 0, 0) self._J.addMatrixEntry(JIm, 0, len(modelRe), -1.0) self._J.addMatrixEntry(JIm, self.data().size(), 0, 1.0) self._J.addMatrixEntry(JRe, self.data().size(), len(modelRe)) else: self._J.clean() k = pg.Vector(self.data()('k')) self.data().set('k', k*0.0 + 1.0) dMapResponse = pb.DataMap() dMapResponse.collect(self.electrodes(), self.solution()) respRe = dMapResponse.data(self.data(), False, False) respIm = dMapResponse.data(self.data(), False, True) #CVector resp(toComplex(respRe, respIm)); #RVector am(abs(resp) * dataContainer_->get("k")); #RVector ph(-phase(resp)); print("respRe", pg.math.median(respRe), min(respRe), max(respRe)) print("respIm", pg.math.median(respIm), min(respIm), max(respIm)) JC = pg.matrix.CMatrix() self.createJacobian_(modelC, u, JC) for i in range(JC.rows()): #JC[i] *= 1.0/(modelC*modelC) * k[i] JC[i] /= (modelC * modelC) / k[i] self._J.mat(0).copy(pg.math.real(JC)) self._J.mat(1).copy(pg.math.imag(JC)) #self.createJacobian_(modelRe*0.0+1.0, pg.math.real(u), self._J.mat(1)) #self.createJacobian_(modelRe*0.0+1.0, pg.math.imag(u), self._J.mat(2)) #self.createJacobian_(modelRe*0.0+1.0, pg.math.imag(u), self._J.mat(3)) sumsens0 = pg.Vector(self._J.mat(0).rows()) sumsens1 = pg.Vector(self._J.mat(0).rows()) sumsens2 = pg.Vector(self._J.mat(0).rows()) for i in range(self._J.mat(0).rows()): #self._J.mat(0)[i] *= 1./modelRe / respRe[i] #self._J.mat(1)[i] *= 1./modelIm / respRe[i] #self._J.mat(2)[i] *= 1./modelRe / respIm[i] #self._J.mat(3)[i] *= 1./modelIm / respIm[i] #self._J.mat(0)[i] *= 1./(modelRe * modelRe) * k[i] #self._J.mat(1)[i] *= 1./(modelRe * modelIm) * k[i] #self._J.mat(2)[i] *= 1./(modelIm * modelRe) * k[i] #self._J.mat(3)[i] *= 1./(modelIm * modelIm) * k[i] sumsens0[i] = sum(self._J.mat(0)[i]) sumsens1[i] = sum(self._J.mat(1)[i]) sumsens2[i] = abs(sum(JC[i])) print(pg.math.median(sumsens0), min(sumsens0), max(sumsens0)) print(pg.math.median(sumsens1), min(sumsens1), max(sumsens1)) print(pg.math.median(sumsens2), min(sumsens2), max(sumsens2)) self.data().set('k', k) self._J.recalcMatrixSize() else: # self.setVerbose(True) u = self.prepareJacobian_(model) #J = pg.Matrix() if self._J.rows() == 0: print('#' * 100) M1 = pg.Matrix() Jid = self._J.addMatrix(M1) self._J.addMatrixEntry(Jid, 0, 0) else: self._J.clean() self.createJacobian_(model, u, self._J.mat(0)) self._J.recalcMatrixSize() def createConstraints(self): """ """ print ("createConstrains(self, model):") Ctmp = pg.matrix.SparseMapMatrix() self.matrixHeap.append(Ctmp) self.regionManager().fillConstraints(Ctmp) CiD = self._C.addMatrix(Ctmp) self._C.addMatrixEntry(CiD, 0, 0) self._C.addMatrixEntry(CiD, Ctmp.rows(), Ctmp.cols()) self._C.recalcMatrixSize() data = pb.DataContainerERT('wa24c.dat') print(data) mesh = pg.meshtools.createParaMesh2dGrid(data.sensorPositions()) fop = DCMultiElectrodeModellingC(mesh, data, verbose=True) print(dir(fop)) print(fop.jacobian()) print(fop.jacobian().rows()) fop.regionManager().region(1).setBackground(True) fop.createRefinedForwardMesh(refine=True, pRefine=False) cData = pb.getComplexData(data) mag = pg.abs(cData) phi = -pg.phase(cData) print(pg.norm(mag-data('rhoa'))) print(pg.norm(phi-data('ip')/1000)) inv = pg.Inversion(pg.cat(mag, phi), fop, verbose=True, dosave=True) dataTrans = pg.trans.TransCumulative() datRe = pg.trans.TransLog() datIm = pg.trans.Trans() dataTrans.add(datRe, data.size()) dataTrans.add(datIm, data.size()) modRe = pg.trans.TransLog() modIm = pg.trans.TransLog() modelTrans = pg.trans.TransCumulative() modelTrans.add(modRe, fop.regionManager().parameterCount()) modelTrans.add(modIm, fop.regionManager().parameterCount()) inv.setTransData(dataTrans) inv.setTransModel(modelTrans) inv.setAbsoluteError(pg.cat(data("err")*mag, mag*phi*10.01)) inv.setLambda(5) inv.setMaxIter(5) #pg.Vector(503, 100.0))) model = inv.run() jacRe = fop.jacobian()[0] jacIm = fop.jacobian()[data.size()] modelMesh = fop.regionManager().paraDomain() pg.showLater(1) fig = pg.plt.figure() ax1 = fig.add_subplot(2, 2, 1) ax2 = fig.add_subplot(2, 2, 2) ax3 = fig.add_subplot(2, 2, 3) ax4 = fig.add_subplot(2, 2, 4) ax, cbar = pg.show(modelMesh, model[0:len(model)/2], colorBar=1) ax.set_title("model real") ax, cbar = pg.show(modelMesh, model[len(model)/2:len(model)], colorBar=1) ax.set_title("model imag") pg.showLater(0)
from abc import ABCMeta, abstractmethod import unittest from ray.rllib.utils.from_config import from_config from ray.rllib.utils.test_utils import check from ray.rllib.utils.framework import try_import_tf, try_import_torch tf = try_import_tf() tf.enable_eager_execution() torch, _ = try_import_torch() class TestFrameWorkAgnosticComponents(unittest.TestCase): """ Tests the Component base class to implement framework-agnostic functional units. """ def test_dummy_components(self): # Switch on eager for testing purposes. tf.enable_eager_execution() # Try to create from an abstract class w/o default constructor. # Expect None. test = from_config({ "type": AbstractDummyComponent, "framework": "torch" }) check(test, None) # Create a Component via python API (config dict). component = from_config( dict(type=DummyComponent, prop_a=1.0, prop_d="non_default")) check(component.prop_d, "non_default") # Create a tf Component from json file. component = from_config("dummy_config.json") check(component.prop_c, "default") check(component.prop_d, 4) # default check(component.add(3.3).numpy(), 5.3) # prop_b == 2.0 # Create a torch Component from yaml file. component = from_config("dummy_config.yml") check(component.prop_a, "something else") check(component.prop_d, 3) check(component.add(1.2), torch.Tensor([2.2])) # prop_b == 1.0 # Create tf Component from json-string (e.g. on command line). component = from_config( '{"type": "ray.rllib.utils.tests.' 'test_framework_agnostic_components.DummyComponent", ' '"prop_a": "A", "prop_b": -1.0, "prop_c": "non-default"}') check(component.prop_a, "A") check(component.prop_d, 4) # default check(component.add(-1.1).numpy(), -2.1) # prop_b == -1.0 # Create torch Component from yaml-string. component = from_config( "type: ray.rllib.utils.tests." "test_framework_agnostic_components.DummyComponent\n" "prop_a: B\nprop_b: -1.5\nprop_c: non-default\nframework: torch") check(component.prop_a, "B") check(component.prop_d, 4) # default check(component.add(-5.1), torch.Tensor([-6.6])) # prop_b == -1.5 class DummyComponent: """ A simple DummyComponent that can be used for testing framework-agnostic logic. Implements a simple `add()` method for adding a value to `self.prop_b`. """ def __init__(self, prop_a, prop_b=0.5, prop_c=None, framework="tf", **kwargs): self.framework = framework self.prop_a = prop_a self.prop_b = prop_b self.prop_c = prop_c or "default" self.prop_d = kwargs.pop("prop_d", 4) self.kwargs = kwargs def add(self, value): if self.framework == "tf": return self._add_tf(value) return self.prop_b + value def _add_tf(self, value): return tf.add(self.prop_b, value) class AbstractDummyComponent(DummyComponent, metaclass=ABCMeta): """ Used for testing `from_config()`. """ @abstractmethod def some_abstract_method(self): raise NotImplementedError
import khmer from khmer import LabelHash from screed.fasta import fasta_iter import screed import khmer_tst_utils as utils from nose.plugins.attrib import attr def teardown(): utils.cleanup() def test_n_labels(): lh = LabelHash(20, 1e7, 4) filename = utils.get_test_data('test-labels.fa') lh.consume_fasta_and_tag_with_labels(filename) print lh.n_labels() assert lh.n_labels() == 4 def test_get_label_dict(): lb = LabelHash(20, 1e7, 4) filename = utils.get_test_data('test-labels.fa') lb.consume_fasta_and_tag_with_labels(filename) labels = lb.get_label_dict() expected = [0L, 1L, 2L, 3L] for e_label in expected: assert e_label in labels for a_label in labels: assert a_label in expected def test_get_tag_labels(): lb = LabelHash(20, 1e7, 4) filename = utils.get_test_data('single-read.fq') lb.consume_fasta_and_tag_with_labels(filename) tag = 173473779682L labels = lb.get_tag_labels(tag) assert len(labels) == 1 assert labels.pop() == 0L def test_consume_fasta_and_tag_with_labels(): lb = LabelHash(20, 1e7, 4) read_1 = 'ACGTAACCGGTTAAACCCGGGTTTAAAACCCCGGGGTTTT' filename = utils.get_test_data('test-transcript.fa') total_reads, n_consumed = lb.consume_fasta_and_tag_with_labels(filename) print "doing get" assert lb.get(read_1[:20]) assert total_reads == 3 print "doing n_labels" print lb.n_labels() print "doing label dict" print lb.get_label_dict() print "get tagset" for tag in lb.get_tagset(): print "forward hash" print tag, khmer.forward_hash(tag, 20) for record in screed.open(filename): print "Sweeping tags" print lb.sweep_tag_neighborhood(record.sequence, 40) print "Sweeping labels..." print lb.sweep_label_neighborhood(record.sequence, 40) assert lb.n_labels() == 3 def test_consume_partitioned_fasta_and_tag_with_labels(): lb = LabelHash(20, 1e7, 4) filename = utils.get_test_data('real-partition-small.fa') total_reads, n_consumed = lb.consume_partitioned_fasta_and_tag_with_labels( filename) labels = set() for record in screed.open(filename): seq = record.sequence labels.update(lb.sweep_label_neighborhood(seq, 0, False, False)) # print lb.n_labels() # print labels assert len(labels) == 1 assert labels.pop() == 2L assert lb.n_labels() == 1 def test_consume_sequence_and_tag_with_labels(): lb = LabelHash(20, 1e6, 4) label = 0L sequence = 'ATGCATCGATCGATCGATCGATCGATCGATCGATCGATCG' n_consumed = lb.consume_sequence_and_tag_with_labels(sequence, label) labels = set() labels.update(lb.sweep_label_neighborhood(sequence)) assert label in labels assert len(labels) == 1 def test_sweep_tag_neighborhood(): lb = LabelHash(20, 1e7, 4) filename = utils.get_test_data('single-read.fq') lb.consume_fasta_and_tag(filename) tags = lb.sweep_tag_neighborhood('CAGGCGCCCACCACCGTGCCCTCCAACCTGATGGT') assert len(tags) == 1 assert tags.pop() == 173473779682L def test_sweep_label_neighborhood(): lb = LabelHash(20, 1e7, 4) filename = utils.get_test_data('single-read.fq') lb.consume_fasta_and_tag_with_labels(filename) labels = lb.sweep_label_neighborhood('CAGGCGCCCACCACCGTGCCCTCCAACCTGATGGT') assert len(labels) == 1 assert labels.pop() == 0L ''' * The test data set as four reads: A, B, C, and D * Overlaps are A <-> B <-> C, with D on its own * Thus, traversing from A should find labels from A and B, traversing from B should find labels from A, B, and C, and traversing from C should find labels from B and C ''' def test_label_tag_correctness(): lb = LabelHash(20, 1e7, 4) filename = utils.get_test_data('test-labels.fa') lb.consume_fasta_and_tag_with_labels(filename) # read A labels = lb.sweep_label_neighborhood( 'ATCGTGTAAGCTATCGTAATCGTAAGCTCTGCCTAGAGCTAGGCTAGGCTCTGCCTAGAG' 'CTAGGCTAGGTGTGCTCTGCCTAGAGCTAGGCTAGGTGT') print lb.sweep_tag_neighborhood( 'TTCGTGTAAGCTATCGTAATCGTAAGCTCTGCCTAGAGCTAGGCTAGGCTCTGCCTAGAG' 'CTAGGCTAGGTGTGCTCTGCTAGAGCTAGGCTAGGTGT') print labels print len('ATCGTGTAAGCTATCGTAATCGTAAGCTCTGCCTAGAGCTAGGCTAG') - 19 assert len(labels) == 2 assert 0L in labels assert 1L in labels # read B labels = lb.sweep_label_neighborhood( 'GCGTAATCGTAAGCTCTGCCTAGAGCTAGGCTAGCTCTGCCTAGAGCTAGGCTAGGTGTTGGGGATAG' 'ATAGATAGATGACCTAGAGCTAGGCTAGGTGTTGGGGATAGATAGATAGATGA') print labels assert len(labels) == 3 assert 0L in labels assert 1L in labels assert 2L in labels # read C labels = lb.sweep_label_neighborhood( 'TGGGATAGATAGATAGATGACCTAGAGCTAGGCTAGGTGTTGGGGATAGATAGATAGATGACCTAGAG' 'CTAGGCTAGGTGTTGGGGATAGATAGATAGATGAGTTGGGGATAGATAGATAGATGAGTGTAGATCCA' 'ACAACACATACA') print labels assert len(labels) == 2 assert 1L in labels assert 2L in labels # read D labels = lb.sweep_label_neighborhood( 'TATATATATAGCTAGCTAGCTAACTAGCTAGCATCGATCGATCGATC') print labels assert len(labels) == 1 assert 3L in labels def test__get_set_tag_density(): ht = khmer.LabelHash(32, 1, 1) orig = ht._get_tag_density() assert orig != 2 ht._set_tag_density(2) assert ht._get_tag_density() == 2 def test_n_occupied_1(): filename = utils.get_test_data('random-20-a.fa') K = 20 # size of kmer HT_SIZE = 100000 # size of hashtable N_HT = 1 # number of hashtables # test modified c++ n_occupied code ht1 = khmer.LabelHash(K, HT_SIZE, N_HT) for n, record in enumerate(fasta_iter(open(filename))): ht1.consume(record['sequence']) # this number calculated independently assert ht1.n_occupied() == 3877 def test_bloom_python_1(): # test python code to count unique kmers using bloom filter filename = utils.get_test_data('random-20-a.fa') K = 20 # size of kmer HT_SIZE = 100000 # size of hashtable N_HT = 3 # number of hashtables ht2 = khmer.LabelHash(K, HT_SIZE, N_HT) n_unique = 0 for n, record in enumerate(fasta_iter(open(filename))): sequence = record['sequence'] seq_len = len(sequence) for n in range(0, seq_len + 1 - K): kmer = sequence[n:n + K] if (not ht2.get(kmer)): n_unique += 1 ht2.count(kmer) assert n_unique == 3960 assert ht2.n_occupied() == 3882 assert ht2.n_unique_kmers() == 3960 # this number equals to n_unique def test_bloom_c_1(): # test c++ code to count unique kmers using bloom filter filename = utils.get_test_data('random-20-a.fa') K = 20 # size of kmer HT_SIZE = 100000 # size of hashtable N_HT = 3 # number of hashtables ht3 = khmer.LabelHash(K, HT_SIZE, N_HT) for n, record in enumerate(fasta_iter(open(filename))): ht3.consume(record['sequence']) assert ht3.n_occupied() == 3882 assert ht3.n_unique_kmers() == 3960 def test_n_occupied_2(): # simple one K = 4 HT_SIZE = 10 # use 11 N_HT = 1 ht1 = khmer.LabelHash(K, HT_SIZE, N_HT) ht1.count('AAAA') # 00 00 00 00 = 0 assert ht1.n_occupied() == 1 ht1.count('ACTG') # 00 10 01 11 = assert ht1.n_occupied() == 2 ht1.count('AACG') # 00 00 10 11 = 11 # collision 1 assert ht1.n_occupied() == 2 ht1.count('AGAC') # 00 11 00 10 # collision 2 assert ht1.n_occupied() == 2 def test_bloom_c_2(): # simple one K = 4 HT_SIZE = 10 # use 11 N_HT1 = 1 # hashtable size = 11 N_HT2 = 2 # hashtable size = 11,13 # use only 1 hashtable, no bloom filter ht1 = khmer.LabelHash(K, HT_SIZE, N_HT1) ht1.count('AAAA') # 00 00 00 00 = 0 ht1.count('ACTG') # 00 10 01 11 = assert ht1.n_unique_kmers() == 2 ht1.count('AACG') # 00 00 10 11 = 11 # collision with 1st kmer assert ht1.n_unique_kmers() == 2 ht1.count('AGAC') # 00 11 00 10 # collision with 2nd kmer assert ht1.n_unique_kmers() == 2 # use two hashtables with 11,13 ht2 = khmer.LabelHash(K, HT_SIZE, N_HT2) ht2.count('AAAA') # 00 00 00 00 = 0 ht2.count('ACTG') # 00 10 01 11 = 2*16 +4 +3 = 39 assert ht2.n_unique_kmers() == 2 ht2.count('AACG') # 00 00 10 11 = 11 # collision with only 1st kmer assert ht2.n_unique_kmers() == 3 ht2.count('AGAC') # 00 11 00 10 3*16 +2 = 50 # collision with both 2nd and 3rd kmers assert ht2.n_unique_kmers() == 3 @attr('highmem') def test_filter_if_present(): ht = khmer.LabelHash(32, 1e6, 2) maskfile = utils.get_test_data('filter-test-A.fa') inputfile = utils.get_test_data('filter-test-B.fa') outfile = utils.get_temp_filename('filter') ht.consume_fasta(maskfile) ht.filter_if_present(inputfile, outfile) records = list(fasta_iter(open(outfile))) assert len(records) == 1 assert records[0]['name'] == '3' @attr('highmem') def test_combine_pe(): inpfile = utils.get_test_data('combine_parts_1.fa') ht = khmer.LabelHash(32, 1, 1) ht.consume_partitioned_fasta(inpfile) assert ht.count_partitions() == (2, 0) s1 = "CATGCAGAAGTTCCGCAACCATACCGTTCAGT" pid1 = ht.get_partition_id(s1) s2 = "CAAATGTACATGCACTTAAAATCATCCAGCCG" pid2 = ht.get_partition_id(s2) assert pid1 == 2 assert pid2 == 80293 ht.join_partitions(pid1, pid2) pid1 = ht.get_partition_id(s1) pid2 = ht.get_partition_id(s2) assert pid1 == pid2 assert ht.count_partitions() == (1, 0) @attr('highmem') def test_load_partitioned(): inpfile = utils.get_test_data('combine_parts_1.fa') ht = khmer.LabelHash(32, 1, 1) ht.consume_partitioned_fasta(inpfile) assert ht.count_partitions() == (2, 0) s1 = "CATGCAGAAGTTCCGCAACCATACCGTTCAGT" assert ht.get(s1) s2 = "CAAATGTACATGCACTTAAAATCATCCAGCCG" assert ht.get(s2) s3 = "CATGCAGAAGTTCCGCAACCATACCGTTCAGTTCCTGGTGGCTA"[-32:] assert ht.get(s3) @attr('highmem') def test_count_within_radius_simple(): inpfile = utils.get_test_data('all-A.fa') ht = khmer.LabelHash(4, 1e6, 2) print ht.consume_fasta(inpfile) n = ht.count_kmers_within_radius('AAAA', 1) assert n == 1 n = ht.count_kmers_within_radius('AAAA', 10) assert n == 1 @attr('highmem') def test_count_within_radius_big(): inpfile = utils.get_test_data('random-20-a.fa') ht = khmer.LabelHash(20, 1e6, 4) ht.consume_fasta(inpfile) n = ht.count_kmers_within_radius('CGCAGGCTGGATTCTAGAGG', int(1e6)) assert n == 3960 ht = khmer.LabelHash(21, 1e6, 4) ht.consume_fasta(inpfile) n = ht.count_kmers_within_radius('CGCAGGCTGGATTCTAGAGGC', int(1e6)) assert n == 39 @attr('highmem') def test_count_kmer_degree(): inpfile = utils.get_test_data('all-A.fa') ht = khmer.LabelHash(4, 1e6, 2) ht.consume_fasta(inpfile) assert ht.kmer_degree('AAAA') == 2 assert ht.kmer_degree('AAAT') == 1 assert ht.kmer_degree('AATA') == 0 assert ht.kmer_degree('TAAA') == 1 @attr('highmem') def test_find_radius_for_volume(): inpfile = utils.get_test_data('all-A.fa') ht = khmer.LabelHash(4, 1e6, 2) ht.consume_fasta(inpfile) assert ht.find_radius_for_volume('AAAA', 0, 100) == 0 assert ht.find_radius_for_volume('AAAA', 1, 100) == 0 assert ht.find_radius_for_volume('AAAA', 2, 100) == 100 def test_circumference(): ht = khmer.LabelHash(4, 1e6, 2) ht.count('ATGC') ht.count('GATG') ht.count('ATGG') x = ht.count_kmers_on_radius('GATG', 1, 200) assert x == 2 ht.count('ATGA') x = ht.count_kmers_on_radius('GATG', 1, 200) assert x == 3, x ht.count('TGAT') x = ht.count_kmers_on_radius('GATG', 1, 200) assert x == 4, x def test_save_load_tagset(): ht = khmer.LabelHash(32, 1, 1) outfile = utils.get_temp_filename('tagset') ht.add_tag('A' * 32) ht.save_tagset(outfile) ht.add_tag('G' * 32) ht.load_tagset(outfile) # implicitly => clear_tags=True ht.save_tagset(outfile) # if tags have been cleared, then the new tagfile will be larger (34 bytes) # else smaller (26 bytes). fp = open(outfile, 'rb') data = fp.read() fp.close() assert len(data) == 26, len(data) def test_save_load_tagset_noclear(): ht = khmer.LabelHash(32, 1, 1) outfile = utils.get_temp_filename('tagset') ht.add_tag('A' * 32) ht.save_tagset(outfile) ht.add_tag('G' * 32) ht.load_tagset(outfile, False) # set clear_tags => False; zero tags ht.save_tagset(outfile) # if tags have been cleared, then the new tagfile will be large (34 bytes); # else small (26 bytes). fp = open(outfile, 'rb') data = fp.read() fp.close() assert len(data) == 34, len(data) @attr('highmem') def test_stop_traverse(): filename = utils.get_test_data('random-20-a.fa') K = 20 # size of kmer HT_SIZE = 100000 # size of hashtable N_HT = 3 # number of hashtables ht = khmer.LabelHash(K, HT_SIZE, N_HT) # without tagging/joining across consume, this breaks into two partition; # with, it is one partition. ht.add_stop_tag('TTGCATACGTTGAGCCAGCG') ht.consume_fasta_and_tag(filename) # DO NOT join reads across stoptags subset = ht.do_subset_partition(0, 0, True) ht.merge_subset(subset) n, _ = ht.count_partitions() assert n == 2, n @attr('highmem') def test_tag_across_stoptraverse(): filename = utils.get_test_data('random-20-a.fa') K = 20 # size of kmer HT_SIZE = 100000 # size of hashtable N_HT = 3 # number of hashtables ht = khmer.LabelHash(K, HT_SIZE, N_HT) # without tagging/joining across consume, this breaks into two partition; # with, it is one partition. ht.add_stop_tag('CCGAATATATAACAGCGACG') ht.consume_fasta_and_tag_with_stoptags(filename) # DO join reads across subset = ht.do_subset_partition(0, 0) n, _ = ht.count_partitions() assert n == 99 # reads only connected by traversal... n, _ = ht.subset_count_partitions(subset) assert n == 2 # but need main to cross stoptags. ht.merge_subset(subset) n, _ = ht.count_partitions() # ta-da! assert n == 1, n @attr('highmem') def test_notag_across_stoptraverse(): filename = utils.get_test_data('random-20-a.fa') K = 20 # size of kmer HT_SIZE = 100000 # size of hashtable N_HT = 3 # number of hashtables ht = khmer.LabelHash(K, HT_SIZE, N_HT) # connecting k-mer at the beginning/end of a read: breaks up into two. ht.add_stop_tag('TTGCATACGTTGAGCCAGCG') ht.consume_fasta_and_tag_with_stoptags(filename) subset = ht.do_subset_partition(0, 0) ht.merge_subset(subset) n, _ = ht.count_partitions() assert n == 2, n def test_find_stoptags(): ht = khmer.LabelHash(5, 1, 1) ht.add_stop_tag("AAAAA") assert ht.identify_stoptags_by_position("AAAAA") == [0] assert ht.identify_stoptags_by_position("AAAAAA") == [0, 1] assert ht.identify_stoptags_by_position("TTTTT") == [0] assert ht.identify_stoptags_by_position("TTTTTT") == [0, 1] def test_find_stoptags2(): ht = khmer.LabelHash(4, 1, 1) ht.add_stop_tag("ATGC") x = ht.identify_stoptags_by_position("ATGCATGCGCAT") assert x == [0, 2, 4, 8], x def test_get_ksize(): kh = khmer.LabelHash(22, 1, 1) assert kh.ksize() == 22 def test_get_hashsizes(): kh = khmer.LabelHash(22, 100, 4) assert kh.hashsizes() == [101, 103, 107, 109], kh.hashsizes() def test_extract_unique_paths_0(): kh = khmer.LabelHash(10, 1e5, 4) x = kh.extract_unique_paths('ATGGAGAGACACAGATAGACAGGAGTGGCGATG', 10, 1) assert x == ['ATGGAGAGACACAGATAGACAGGAGTGGCGATG'] kh.consume('ATGGAGAGACACAGATAGACAGGAGTGGCGATG') x = kh.extract_unique_paths('ATGGAGAGACACAGATAGACAGGAGTGGCGATG', 10, 1) assert not x def test_extract_unique_paths_1(): kh = khmer.LabelHash(10, 1e5, 4) kh.consume('AGTGGCGATG') x = kh.extract_unique_paths('ATGGAGAGACACAGATAGACAGGAGTGGCGATG', 10, 1) print x assert x == ['ATGGAGAGACACAGATAGACAGGAGTGGCGAT'] # all but the last k-mer def test_extract_unique_paths_2(): kh = khmer.LabelHash(10, 1e5, 4) kh.consume('ATGGAGAGAC') x = kh.extract_unique_paths('ATGGAGAGACACAGATAGACAGGAGTGGCGATG', 10, 1) print x assert x == ['TGGAGAGACACAGATAGACAGGAGTGGCGATG'] # all but the 1st k-mer def test_extract_unique_paths_3(): kh = khmer.LabelHash(10, 1e5, 4) kh.consume('ATGGAGAGAC') kh.consume('AGTGGCGATG') x = kh.extract_unique_paths('ATGGAGAGACACAGATAGACAGGAGTGGCGATG', 10, 1) print x # all but the 1st/last k-mer assert x == ['TGGAGAGACACAGATAGACAGGAGTGGCGAT'] def test_extract_unique_paths_4(): kh = khmer.LabelHash(10, 1e5, 4) kh.consume('ATGGAGAGAC') kh.consume('AGTGGCGATG') kh.consume('ATAGACAGGA') x = kh.extract_unique_paths('ATGGAGAGACACAGATAGACAGGAGTGGCGATG', 10, 1) print x assert x == ['TGGAGAGACACAGATAGACAGG', 'TAGACAGGAGTGGCGAT'] @attr('highmem') def test_find_unpart(): filename = utils.get_test_data('random-20-a.odd.fa') filename2 = utils.get_test_data('random-20-a.even.fa') K = 20 # size of kmer HT_SIZE = 100000 # size of hashtable N_HT = 3 # number of hashtables ht = khmer.LabelHash(K, HT_SIZE, N_HT) ht.consume_fasta_and_tag(filename) subset = ht.do_subset_partition(0, 0) ht.merge_subset(subset) n, _ = ht.count_partitions() assert n == 49 ht.find_unpart(filename2, True, False) n, _ = ht.count_partitions() assert n == 1, n # all sequences connect @attr('highmem') def test_find_unpart_notraverse(): filename = utils.get_test_data('random-20-a.odd.fa') filename2 = utils.get_test_data('random-20-a.even.fa') K = 20 # size of kmer HT_SIZE = 100000 # size of hashtable N_HT = 3 # number of hashtables ht = khmer.LabelHash(K, HT_SIZE, N_HT) ht.consume_fasta_and_tag(filename) subset = ht.do_subset_partition(0, 0) ht.merge_subset(subset) n, _ = ht.count_partitions() assert n == 49 ht.find_unpart(filename2, False, False) # <-- don't traverse n, _ = ht.count_partitions() assert n == 99, n # all sequences disconnected @attr('highmem') def test_find_unpart_fail(): filename = utils.get_test_data('random-20-a.odd.fa') filename2 = utils.get_test_data('random-20-a.odd.fa') # <- switch to odd K = 20 # size of kmer HT_SIZE = 100000 # size of hashtable N_HT = 3 # number of hashtables ht = khmer.LabelHash(K, HT_SIZE, N_HT) ht.consume_fasta_and_tag(filename) subset = ht.do_subset_partition(0, 0) ht.merge_subset(subset) n, _ = ht.count_partitions() assert n == 49 ht.find_unpart(filename2, True, False) n, _ = ht.count_partitions() assert n == 49, n # only 49 sequences worth of tags def test_simple_median(): hi = khmer.LabelHash(6, 1e6, 2) (median, average, stddev) = hi.get_median_count("AAAAAA") print median, average, stddev assert median == 0 assert average == 0.0 assert stddev == 0.0 hi.consume("AAAAAA") (median, average, stddev) = hi.get_median_count("AAAAAA") print median, average, stddev assert median == 1 assert average == 1.0 assert stddev == 0.0 def test_bad_primes(): try: hi = khmer._LabelHash.__new__(khmer.LabelHash, 6, ["a", "b", "c"]) assert 0, "Non number prime list should fail" except TypeError, e: print str(e)
from google import pubsub_v1 async def sample_pull(): # Create a client client = pubsub_v1.SubscriberAsyncClient() # Initialize request argument(s) request = pubsub_v1.PullRequest( subscription="subscription_value", max_messages=1277, ) # Make the request response = await client.pull(request=request) # Handle the response print(response)
from ncclient import manager import ncclient import xml.etree.ElementTree as ET host = "192.168.1.1" username="root" password="root" with manager.connect_ssh(host=host, port=830, username=username, password=password, hostkey_verify=False ) as m: print m.get_config(source='startup').data_xml
""" Server-side Keystone notification payload processing logic. """ from barbican.common import utils from barbican import i18n as u from barbican.model import repositories as rep from barbican.tasks import resources LOG = utils.getLogger(__name__) class KeystoneEventConsumer(resources.BaseTask): """Event consumer listening for notifications sent by Keystone deployment. Currently this processes only Keystone project delete event. """ def get_name(self): return u._('Project cleanup via Keystone notifications') def __init__(self, project_repo=None, order_repo=None, secret_repo=None, project_secret_repo=None, datum_repo=None, kek_repo=None, secret_meta_repo=None, container_repo=None, repositories=None, db_start=rep.start, db_commit=rep.commit, db_rollback=rep.rollback, db_clear=rep.clear): LOG.debug('Creating KeystoneEventConsumer task processor') self.db_start = db_start self.db_commit = db_commit self.db_rollback = db_rollback self.db_clear = db_clear self.repos = repositories if not repositories: self.repos = rep.Repositories( project_repo=project_repo, order_repo=order_repo, secret_repo=secret_repo, project_secret_repo=project_secret_repo, datum_repo=datum_repo, kek_repo=kek_repo, secret_meta_repo=secret_meta_repo, container_repo=container_repo) def process(self, *args, **kwargs): try: self.db_start() super(KeystoneEventConsumer, self).process(*args, **kwargs) self.db_commit() except Exception as e: """Exceptions that reach here needs to revert the entire transaction. No need to log error message as its already done earlier. """ self.db_rollback() raise e finally: self.db_clear() def retrieve_entity(self, project_id, resource_type=None, operation_type=None): project_repo = self.repos.project_repo return project_repo.find_by_external_project_id( external_project_id=project_id, suppress_exception=True) def handle_processing(self, barbican_project, *args, **kwargs): self.handle_cleanup(barbican_project, *args, **kwargs) def handle_error(self, project, status, message, exception, project_id=None, resource_type=None, operation_type=None): LOG.error( u._LE( 'Error processing Keystone event, project_id=%(project_id)s, ' 'event resource=%(resource)s, event operation=%(operation)s, ' 'status=%(status)s, error message=%(message)s' ), { 'project_id': project.project_id, 'resource': resource_type, 'operation': operation_type, 'status': status, 'message': message } ) def handle_success(self, project, project_id=None, resource_type=None, operation_type=None): LOG.info( u._LI( 'Successfully handled Keystone event, ' 'project_id=%(project_id)s, event resource=%(resource)s, ' 'event operation=%(operation)s' ), { 'project_id': project_id, 'resource': resource_type, 'operation': operation_type } ) def handle_cleanup(self, project, project_id=None, resource_type=None, operation_type=None): """Cleans up Barbican resources needed for Keystone project delete. :param project: Barbican project entity which is retrieved by project id available in Keystone notification. :param project_id: project identifier as present in Keystone notification. :param resource_type: type of resource updated as part of Keystone notification e.g. Keystone project, domain, user etc. :param operation_type: type of operation (created, updated, deleted etc.) performed on Keystone resource. """ if project is None: LOG.info(u._LI('No action is needed as there are no Barbican ' 'resources present for Keystone ' 'project_id=%s'), project_id) return # barbican entities use projects table 'id' field as foreign key. # Delete apis are using that id to lookup related entities and not # keystone project id which requires additional project table join. project_id = project.id rep.delete_all_project_resources(project_id, self.repos) # reached here means there is no error so log the successful # cleanup log entry. LOG.info(u._LI('Successfully completed Barbican resources cleanup for ' 'Keystone project_id=%s'), project_id)
import re import nltk regex_url = re.compile( r'^(?:http|ftp)s?://' # http:// or https:// # domain... r'(?:(?:[A-Z0-9](?:[A-Z0-9-]{0,61}[A-Z0-9])?\.)+' r'(?:[A-Z]{2,6}\.?|[A-Z0-9-]{2,}\.?)|' r'localhost|' # localhost... r'\d{1,3}\.\d{1,3}\.\d{1,3}\.\d{1,3})' # ...or ip r'(?::\d+)?' # optional port r'(?:/?|[/?]\S+)$', re.IGNORECASE) stopwords = nltk.corpus.stopwords.words('english') + [ '.', '..', '...', ',', '--', '\'s', '?', ')', '(', ':', '\'', '\'re', '"', '-', '}', '{', '<', '>', '=', 'these', 'there', 'they', 'those', 'whose', 'ours', 'your', 'yours', 'others', 'anothers' ] ignorewords = {'the', 'of', 'to', 'and', 'a', 'in', 'is', 'it', 'for', 'by', 'are', 'i', 'you', 'he', 'she', 'we', 'do', 'does', 'did', 'say', 'said', 'says', 'tell', 'told', 'what', 'where', 'when', 'how', 'who', 'whose', 'why', 'would'} def is_url(word): return regex_url.match(word) def is_number(s): try: float(s) return True except ValueError: return False class Words: def __init__(self): pass def count_words(self, text): w_aux = nltk.wordpunct_tokenize(text) scored_words = {} for word in w_aux: word = word.lower() if word not in stopwords and \ word not in ignorewords and \ len(word) > 1 and \ not is_url(word) and \ not is_number(word): try: scored_words[word] += 1 except: scored_words[word] = 1 return scored_words
""" Created on Thu Nov 23 11:23:03 2017 @author: tih """ import numpy as np import os import scipy.interpolate import gdal from openpyxl import load_workbook import osr from datetime import datetime, timedelta import pandas as pd import shutil import glob from netCDF4 import Dataset import warnings import SEBAL def main(): VegetationExcel =r"$HOME\SEBAL\Excel_PreSEBAL_v1_0.xlsx" # This excel defines the p and c factor and vegetation height. # Open Excel workbook used for Vegetation c and p factor conversions wb_veg = load_workbook(VegetationExcel, data_only=True) ws_veg = wb_veg['General_Input'] # Input for preSEBAL.py start_date = "%s" %str(ws_veg['B2'].value) end_date = "%s" %str(ws_veg['B3'].value) inputExcel= r"%s" %str(ws_veg['B4'].value) # The excel with all the SEBAL input data LU_data_FileName = r"%s" %str(ws_veg['B5'].value) # Path to Land Use map output_folder = r"%s" %str(ws_veg['B7'].value) # optional paramater DSSF_Folder= r"%s" %str(ws_veg['B6'].value) ######################## Load Excels ########################################## # Open Excel workbook for SEBAL inputs wb = load_workbook(inputExcel) # Get length of EXCEL sheet ws = wb['General_Input'] ws2 = wb['VIIRS_PROBAV_Input'] endExcel=int(ws.max_row) # Create Dict SEBAL_RUNS = dict() for number in range(2,endExcel+1): input_folder_SEBAL = str(ws['B%d' % number].value) output_folder_SEBAL = str(ws['C%d' % number].value) Image_Type = int(ws['D%d' % number].value) PROBA_V_name = str(ws2['D%d' % number].value) VIIRS_name = str(ws2['B%d' % number].value) SEBAL_RUNS[number] = {'input_folder': input_folder_SEBAL, 'output_folder': output_folder_SEBAL, 'image_type': Image_Type,'PROBA_V_name': PROBA_V_name,'VIIRS_name': VIIRS_name} Kind_Of_Runs_Dict = {} for k, v in SEBAL_RUNS.iteritems(): Kind_Of_Runs_Dict.setdefault(v['image_type'], []).append(k) ######################## Create output folders ########################################## output_folder_PreSEBAL_SEBAL = os.path.join(output_folder,'PreSEBAL_SEBAL_out') input_folder_HANTS = os.path.join(output_folder,'HANTS_in') output_folder_PreSEBAL = os.path.join(output_folder,'PreSEBAL_out') temp_folder_PreSEBAL = os.path.join(output_folder,'PreSEBAL_temp') temp_folder_PreSEBAL_LST = os.path.join(temp_folder_PreSEBAL,'LST') NDVI_outfolder = os.path.join(output_folder_PreSEBAL_SEBAL,'NDVI') Albedo_outfolder = os.path.join(output_folder_PreSEBAL_SEBAL,'Albedo') WaterMask_outfolder = os.path.join(output_folder_PreSEBAL_SEBAL,'WaterMask') LAI_outfolder = os.path.join(output_folder_PreSEBAL_SEBAL,'LAI') TRANS_outfolder = os.path.join(output_folder_PreSEBAL,'Transmissivity') Surface_Temperature_outfolder = os.path.join(output_folder_PreSEBAL_SEBAL,'Surface_Temperature') output_folder_HANTS_end_sharp = os.path.join(output_folder_PreSEBAL, 'LST_Sharpened') output_folder_HANTS_end_LAI = os.path.join(output_folder_PreSEBAL, 'LAI') output_folder_HANTS_end_Veg = os.path.join(output_folder_PreSEBAL, 'Vegetation_Height') output_folder_p_factor = os.path.join(output_folder_PreSEBAL, 'p_factor') output_folder_LUE = os.path.join(output_folder_PreSEBAL, 'LUE') if not os.path.exists(output_folder_PreSEBAL_SEBAL): os.makedirs(output_folder_PreSEBAL_SEBAL) if not os.path.exists(output_folder_PreSEBAL): os.mkdir(output_folder_PreSEBAL) if not os.path.exists(temp_folder_PreSEBAL): os.mkdir(temp_folder_PreSEBAL) if not os.path.exists(NDVI_outfolder): os.makedirs(NDVI_outfolder) if not os.path.exists(Albedo_outfolder): os.makedirs(Albedo_outfolder) if not os.path.exists(WaterMask_outfolder): os.makedirs(WaterMask_outfolder) if not os.path.exists(LAI_outfolder): os.makedirs(LAI_outfolder) if not os.path.exists(temp_folder_PreSEBAL_LST): os.makedirs(temp_folder_PreSEBAL_LST) if not os.path.exists(Surface_Temperature_outfolder): os.makedirs(Surface_Temperature_outfolder) if not os.path.exists(TRANS_outfolder): os.makedirs(TRANS_outfolder) if not os.path.exists(output_folder_HANTS_end_sharp): os.mkdir(output_folder_HANTS_end_sharp) if not os.path.exists(output_folder_HANTS_end_LAI): os.mkdir(output_folder_HANTS_end_LAI) if not os.path.exists(output_folder_HANTS_end_Veg): os.mkdir(output_folder_HANTS_end_Veg) if not os.path.exists(output_folder_p_factor): os.mkdir(output_folder_p_factor) if not os.path.exists(output_folder_LUE): os.mkdir(output_folder_LUE) # Do not show warnings warnings.filterwarnings('ignore') ############################## Define General info ############################ for number in Kind_Of_Runs_Dict[2]: # Number defines the column of the inputExcel print(number) if not (SEBAL_RUNS[number]['PROBA_V_name'] == 'None' and SEBAL_RUNS[number]['VIIRS_name'] == 'None'): Rp = 0.91 # Path radiance in the 10.4-12.5 µm band (W/m2/sr/µm) tau_sky = 0.866 # Narrow band transmissivity of air, range: [10.4-12.5 µm] surf_temp_offset = 3 # Surface temperature offset for water ######################## Open General info from SEBAL Excel ################### # Open the General_Input sheet ws = wb['General_Input'] # Extract the input and output folder, and Image type from the excel file input_folder = str(ws['B%d' % number].value) Image_Type = int(2) # Type of Image (1=Landsat & 2 = VIIRS & GLOBA-V) # Extract the Path to the DEM map from the excel file DEM_fileName = '%s' %str(ws['E%d' % number].value) #'DEM_HydroShed_m' # Open DEM and create Latitude and longitude files lat,lon,lat_fileName,lon_fileName=SEBAL.DEM_lat_lon(DEM_fileName, temp_folder_PreSEBAL) ######################## Extract general data for Landsat ########################################## if Image_Type == 1: # Open the Landsat_Input sheet ws = wb['Landsat_Input'] # Extract Landsat name, number and amount of thermal bands from excel file Name_Landsat_Image = str(ws['B%d' % number].value) # From glovis.usgs.gov Landsat_nr = int(ws['C%d' % number].value) # Type of Landsat (LS) image used (LS5, LS7, or LS8) Bands_thermal = int(ws['D%d' %number].value) # Number of LS bands to use to retrieve land surface # Pixel size of the model pixel_spacing=int(30) # the path to the MTL file of landsat Landsat_meta_fileName = os.path.join(input_folder, '%s_MTL.txt' % Name_Landsat_Image) # read out the general info out of the MTL file in Greenwich Time year, DOY, hour, minutes, UTM_Zone, Sun_elevation = SEBAL.info_general_metadata(Landsat_meta_fileName) # call definition info_general_metadata date=datetime.strptime('%s %s'%(year,DOY), '%Y %j') month = date.month day = date.day # define the kind of sensor and resolution of the sensor sensor1 = 'L%d' % Landsat_nr sensor2 = 'L%d' % Landsat_nr sensor3 = 'L%d' % Landsat_nr res1 = '30m' res2 = '%sm' %int(pixel_spacing) res3 = '30m' # Set the start parameter for determining transmissivity at 0 Determine_transmissivity = 0 ######################## Extract general data for VIIRS-PROBAV ########################################## if Image_Type == 2: # Open the VIIRS_PROBAV_Input sheet ws = wb['VIIRS_PROBAV_Input'] # Extract the name of the thermal and quality VIIRS image from the excel file Name_VIIRS_Image_TB = '%s' %str(ws['B%d' % number].value) # Extract the name to the PROBA-V image from the excel file Name_PROBAV_Image = '%s' %str(ws['D%d' % number].value) # Must be a tiff file # Pixel size of the model pixel_spacing=int(100) # UTM Zone of the end results UTM_Zone = float(ws['G%d' % number].value) if not Name_VIIRS_Image_TB == 'None': #Get time from the VIIRS dataset name (IMPORTANT TO KEEP THE TEMPLATE OF THE VIIRS NAME CORRECT example: npp_viirs_i05_20150701_124752_wgs84_fit.tif) Total_Day_VIIRS = Name_VIIRS_Image_TB.split('_')[3] Total_Time_VIIRS = Name_VIIRS_Image_TB.split('_')[4] # Get the information out of the VIIRS name in GMT (Greenwich time) year = int(Total_Day_VIIRS[0:4]) month = int(Total_Day_VIIRS[4:6]) day = int(Total_Day_VIIRS[6:8]) Startdate = '%d-%02d-%02d' % (year,month,day) DOY=datetime.strptime(Startdate,'%Y-%m-%d').timetuple().tm_yday hour = int(Total_Time_VIIRS[0:2]) minutes = int(Total_Time_VIIRS[2:4]) # If this is runned correctly, we can determine transmissivity ws = wb['Meteo_Input'] Field_Radiation_24 = '%s' %str(ws['J%d' % number].value) Field_Trans_24 = '%s' %str(ws['K%d' % number].value) Determine_transmissivity = 1 # else use PROBA-V day but than no transmissivity can be determined for now else: # Get the day and time from the PROBA-V Band_PROBAVhdf_fileName = os.path.join(input_folder, '%s.HDF5' % (Name_PROBAV_Image)) g=gdal.Open(Band_PROBAVhdf_fileName, gdal.GA_ReadOnly) Meta_data = g.GetMetadata() Date_PROBAV = str(Meta_data['LEVEL3_RADIOMETRY_BLUE_OBSERVATION_START_DATE']) year = int(Date_PROBAV.split("-")[0]) month = int(Date_PROBAV.split("-")[1]) day = int(Date_PROBAV.split("-")[2]) Var_name = '%d%02d%02d' %(year, month, day) DOY=datetime.strptime(Var_name,'%Y%m%d').timetuple().tm_yday # We cannot determine transmissivity Determine_transmissivity = 0 # Determine the transmissivity if possible (Determine_transmissivity = 1) if Determine_transmissivity == 1: # Rounded difference of the local time from Greenwich (GMT) (hours): delta_GTM = round(np.sign(lon[int(np.shape(lon)[0]/2), int(np.shape(lon)[1]/2)]) * lon[int(np.shape(lon)[0]/2), int(np.shape(lon)[1]/2)] * 24 / 360) if np.isnan(delta_GTM) == True: delta_GTM = round(np.nanmean(lon) * np.nanmean(lon) * 24 / 360) # Calculate local time hour += delta_GTM if hour < 0.0: day -= 1 hour += 24 if hour >= 24: day += 1 hour -= 24 # define the kind of sensor and resolution of the sensor sensor1 = 'PROBAV' sensor2 = 'VIIRS' res1 = '375m' res2 = '%sm' %int(pixel_spacing) res3 = '30m' ######################## Extract general data from DEM file and create Slope map ########################################## # Variable date name Var_name = '%d%02d%02d' %(year, month, day) # Reproject from Geog Coord Syst to UTM - # 1) DEM - Original DEM coordinates is Geographic: lat, lon dest, ulx_dem, lry_dem, lrx_dem, uly_dem, epsg_to = SEBAL.reproject_dataset( DEM_fileName, pixel_spacing, UTM_Zone=UTM_Zone) band = dest.GetRasterBand(1) # Get the reprojected dem band ncol = dest.RasterXSize # Get the reprojected dem column size nrow = dest.RasterYSize # Get the reprojected dem row size shape=[ncol, nrow] # Read out the DEM band and print the DEM properties data_DEM = band.ReadAsArray(0, 0, ncol, nrow) # 2) Latitude file - reprojection # reproject latitude to the landsat projection and save as tiff file lat_rep, ulx_dem, lry_dem, lrx_dem, uly_dem, epsg_to = SEBAL.reproject_dataset( lat_fileName, pixel_spacing, UTM_Zone=UTM_Zone) # Get the reprojected latitude data lat_proy = lat_rep.GetRasterBand(1).ReadAsArray(0, 0, ncol, nrow) # 3) Longitude file - reprojection # reproject longitude to the landsat projection and save as tiff file lon_rep, ulx_dem, lry_dem, lrx_dem, uly_dem, epsg_to = SEBAL.reproject_dataset(lon_fileName, pixel_spacing, UTM_Zone=UTM_Zone) # Get the reprojected longitude data lon_proy = lon_rep.GetRasterBand(1).ReadAsArray(0, 0, ncol, nrow) lon_fileName = os.path.join(temp_folder_PreSEBAL,'lon_resh.tif') SEBAL.save_GeoTiff_proy(dest, lon_proy, lon_fileName, shape, nband=1) # Calculate slope and aspect from the reprojected DEM deg2rad,rad2deg,slope,aspect=SEBAL.Calc_Gradient(data_DEM, pixel_spacing) if Determine_transmissivity == 1: # calculate the coz zenith angle Ra_mountain_24, Ra_inst, cos_zn_resh, dr, phi, delta = SEBAL.Calc_Ra_Mountain(lon,DOY,hour,minutes,lon_proy,lat_proy,slope,aspect) cos_zn_fileName = os.path.join(temp_folder_PreSEBAL,'cos_zn.tif') SEBAL.save_GeoTiff_proy(dest, cos_zn_resh, cos_zn_fileName, shape, nband=1) # Save the Ra Ra_inst_fileName = os.path.join(temp_folder_PreSEBAL,'Ra_inst.tif') SEBAL.save_GeoTiff_proy(dest, Ra_inst, Ra_inst_fileName, shape, nband=1) Ra_mountain_24_fileName = os.path.join(temp_folder_PreSEBAL,'Ra_mountain_24.tif') SEBAL.save_GeoTiff_proy(dest, Ra_mountain_24, Ra_mountain_24_fileName, shape, nband=1) #################### Calculate Transmissivity ########################################## # Open the General_Input sheet ws = wb['Meteo_Input'] # Extract the method radiation value Value_Method_Radiation_inst = '%s' %str(ws['L%d' % number].value) # Values to check if data is created Check_Trans_inst = 0 Check_Trans_24 = 0 ''' This is now turned off, so you need to fill in the instantanious transmissivity or Radiation # Extract the data to the method of radiation if int(Value_Method_Radiation_inst) == 2: Field_Radiation_inst = '%s' %str(ws['N%d' % number].value) if Field_Radiation_inst == 'None': # Instantanious Transmissivity files must be created Check_Trans_inst = 1 # Calculate Transmissivity quarters_hours = np.ceil(minutes/30.) * 30 hours_GMT = hour - delta_GTM if quarters_hours >= 60: hours_GMT += 1 quarters_hours = 0 # Define the instantanious LANDSAF file name_Landsaf_inst = 'HDF5_LSASAF_MSG_DSSF_MSG-Disk_%d%02d%02d%02d%02d.tif' %(year, month,day, hours_GMT, quarters_hours) file_Landsaf_inst = os.path.join(DSSF_Folder,name_Landsaf_inst) # Reproject the Ra_inst data to match the LANDSAF data Ra_inst_3Km_dest, ulx, lry, lrx, uly, epsg_to = SEBAL.reproject_dataset_example(Ra_inst_fileName, file_Landsaf_inst, method = 1) Ra_inst_3Km = Ra_inst_3Km_dest.GetRasterBand(1).ReadAsArray() Ra_inst_3Km[Ra_inst_3Km==0] = np.nan # Open the Rs LANDSAF data dest_Rs_inst_3Km = gdal.Open(file_Landsaf_inst) Rs_inst_3Km = dest_Rs_inst_3Km.GetRasterBand(1).ReadAsArray() Rs_inst_3Km = np.float_(Rs_inst_3Km)/10 Rs_inst_3Km[Rs_inst_3Km<0]=np.nan # Get shape LANDSAF data shape_trans=[dest_Rs_inst_3Km.RasterXSize , dest_Rs_inst_3Km.RasterYSize ] # Calculate Transmissivity 3Km Transmissivity_3Km = Rs_inst_3Km/Ra_inst_3Km Transmissivity_3Km_fileName = os.path.join(output_folder_temp,'Transmissivity_3Km.tif') SEBAL.save_GeoTiff_proy(Ra_inst_3Km_dest, Transmissivity_3Km, Transmissivity_3Km_fileName, shape_trans, nband=1) # Reproject Transmissivity to match DEM (now this is done by using the nearest neighbour method) Transmissivity_inst_dest, ulx, lry, lrx, uly, epsg_to = SEBAL.reproject_dataset_example(Transmissivity_3Km_fileName, cos_zn_fileName, method = 3) Transmissivity_inst = Transmissivity_inst_dest.GetRasterBand(1).ReadAsArray() Transmissivity_inst[Transmissivity_inst>0.98] = 0.98 Transmissivity_inst_fileName = os.path.join(TRANS_outfolder,'Transmissivity_inst_%s.tif' %Var_name) SEBAL.save_GeoTiff_proy(Transmissivity_inst_dest, Transmissivity_inst, Transmissivity_inst_fileName, shape, nband=1) ''' # Extract the method radiation value Value_Method_Radiation_24 = '%s' %str(ws['I%d' % number].value) # Extract the data to the method of radiation if int(Value_Method_Radiation_24) == 2: Field_Radiation_24 = '%s' %str(ws['K%d' % number].value) if Field_Radiation_24 == 'None': # Daily Transmissivity files must be created Check_Trans_24 = 1 # Create times that are needed to calculate daily Rs (LANDSAF) Starttime_GMT = datetime.strptime(Startdate,'%Y-%m-%d') + timedelta(hours=-delta_GTM) Endtime_GMT = Starttime_GMT + timedelta(days=1) Times = pd.date_range(Starttime_GMT, Endtime_GMT,freq = '30min') for Time in Times[:-1]: year_LANDSAF = Time.year month_LANDSAF = Time.month day_LANDSAF = Time.day hour_LANDSAF = Time.hour min_LANDSAF = Time.minute # Define the instantanious LANDSAF file #re = glob.glob('') name_Landsaf_inst = 'HDF5_LSASAF_MSG_DSSF_MSG-Disk_%d%02d%02d%02d%02d.tif' %(year_LANDSAF, month_LANDSAF,day_LANDSAF, hour_LANDSAF, min_LANDSAF) file_Landsaf_inst = os.path.join(DSSF_Folder,name_Landsaf_inst) # Open the Rs LANDSAF data dest_Rs_inst_3Km = gdal.Open(file_Landsaf_inst) Rs_one_3Km = dest_Rs_inst_3Km.GetRasterBand(1).ReadAsArray() Rs_one_3Km = np.float_(Rs_one_3Km)/10 Rs_one_3Km[Rs_one_3Km < 0]=np.nan if Time == Times[0]: Rs_24_3Km_tot = Rs_one_3Km else: Rs_24_3Km_tot += Rs_one_3Km Rs_24_3Km = Rs_24_3Km_tot / len(Times[:-1]) # Reproject the Ra_inst data to match the LANDSAF data Ra_24_3Km_dest, ulx, lry, lrx, uly, epsg_to = SEBAL.reproject_dataset_example(Ra_mountain_24_fileName, file_Landsaf_inst, method = 3) Ra_24_3Km = Ra_24_3Km_dest.GetRasterBand(1).ReadAsArray() Ra_24_3Km[Ra_24_3Km==0] = np.nan # Do gapfilling Ra_24_3Km = gap_filling(Ra_24_3Km,np.nan) # Get shape LANDSAF data shape_trans=[dest_Rs_inst_3Km.RasterXSize , dest_Rs_inst_3Km.RasterYSize ] # Calculate Transmissivity 3Km Transmissivity_24_3Km = Rs_24_3Km/Ra_24_3Km Transmissivity_24_3Km_fileName = os.path.join(temp_folder_PreSEBAL,'Transmissivity_24_3Km.tif') SEBAL.save_GeoTiff_proy(Ra_24_3Km_dest, Transmissivity_24_3Km, Transmissivity_24_3Km_fileName, shape_trans, nband=1) # Reproject Transmissivity to match DEM (now this is done by using the nearest neighbour method) Transmissivity_24_dest, ulx, lry, lrx, uly, epsg_to = SEBAL.reproject_dataset_example(Transmissivity_24_3Km_fileName, lon_fileName, method = 3) Transmissivity_24 = Transmissivity_24_dest.GetRasterBand(1).ReadAsArray() Transmissivity_24[Transmissivity_24>0.98] = 0.98 Transmissivity_24_fileName = os.path.join(TRANS_outfolder,'Transmissivity_24_%s.tif' %Var_name) SEBAL.save_GeoTiff_proy(Transmissivity_24_dest, Transmissivity_24, Transmissivity_24_fileName, shape, nband=1) #################### Calculate NDVI for LANDSAT ########################################## if Image_Type == 1: # Define bands used for each Landsat number if Landsat_nr == 5 or Landsat_nr == 7: Bands = np.array([1, 2, 3, 4, 5, 7, 6]) elif Landsat_nr == 8: Bands = np.array([2, 3, 4, 5, 6, 7, 10, 11]) else: print('Landsat image not supported, use Landsat 7 or 8') # Open MTL landsat and get the correction parameters Landsat_meta_fileName = os.path.join(input_folder, '%s_MTL.txt' % Name_Landsat_Image) Lmin, Lmax, k1_c, k2_c = SEBAL.info_band_metadata(Landsat_meta_fileName, Bands) # Mean solar exo-atmospheric irradiance for each band (W/m2/microm) # for the different Landsat images (L5, L7, or L8) ESUN_L5 = np.array([1983, 1796, 1536, 1031, 220, 83.44]) ESUN_L7 = np.array([1997, 1812, 1533, 1039, 230.8, 84.9]) ESUN_L8 = np.array([1973.28, 1842.68, 1565.17, 963.69, 245, 82.106]) # Open one band - To get the metadata of the landsat images only once (to get the extend) src_FileName = os.path.join(input_folder, '%s_B2.TIF' % Name_Landsat_Image) # before 10! ls,band_data,ulx,uly,lrx,lry,x_size_ls,y_size_ls = SEBAL.Get_Extend_Landsat(src_FileName) # Crop the Landsat images to the DEM extent - dst_FileName = os.path.join(temp_folder_PreSEBAL,'cropped_LS_b2.tif') # Before 10 !! # Clip the landsat image to match the DEM map lsc, ulx, lry, lrx, uly, epsg_to = SEBAL.reproject_dataset_example(src_FileName, lon_fileName) data_LS = lsc.GetRasterBand(1).ReadAsArray() SEBAL.save_GeoTiff_proy(dest, data_LS, dst_FileName, shape, nband=1) # Get the extend of the remaining landsat file after clipping based on the DEM file lsc,band_data,ulx,uly,lrx,lry,x_size_lsc,y_size_lsc = SEBAL.Get_Extend_Landsat(dst_FileName) # Create the corrected signals of Landsat in 1 array Reflect = SEBAL.Landsat_Reflect(Bands,input_folder,Name_Landsat_Image,output_folder,shape,Lmax,Lmin,ESUN_L5,ESUN_L7,ESUN_L8,cos_zn_resh,dr,Landsat_nr, cos_zn_fileName) # Calculate temporal water mask water_mask_temp=SEBAL.Water_Mask(shape,Reflect) # Calculate NDVI NDVI = SEBAL.Calc_NDVI(Reflect) # Calculate albedo albedo = SEBAL.Calc_albedo(Reflect) # Save NDVI NDVI_FileName = os.path.join(NDVI_outfolder,'NDVI_LS_%s.tif'%Var_name) SEBAL.save_GeoTiff_proy(dest, NDVI, NDVI_FileName, shape, nband=1) # Save albedo albedo_FileName = os.path.join(Albedo_outfolder,'Albedo_LS_%s.tif'%Var_name) SEBAL.save_GeoTiff_proy(dest, albedo, albedo_FileName, shape, nband=1) ################### Extract Meteo data for Landsat days from SEBAL Excel ################## # Open the Meteo_Input sheet ws = wb['Meteo_Input'] # ---------------------------- Instantaneous Air Temperature ------------ # Open meteo data, first try to open as value, otherwise as string (path) try: Temp_inst = float(ws['B%d' %number].value) # Instantaneous Air Temperature (°C) # if the data is not a value, than open as a string except: Temp_inst_name = '%s' %str(ws['B%d' %number].value) Temp_inst_fileName = os.path.join(output_folder, 'Temp', 'Temp_inst_input.tif') Temp_inst = SEBAL.Reshape_Reproject_Input_data(Temp_inst_name, Temp_inst_fileName, lon_fileName) try: RH_inst = float(ws['D%d' %number].value) # Instantaneous Relative humidity (%) # if the data is not a value, than open as a string except: RH_inst_name = '%s' %str(ws['D%d' %number].value) RH_inst_fileName = os.path.join(output_folder, 'Temp', 'RH_inst_input.tif') RH_inst = SEBAL.Reshape_Reproject_Input_data(RH_inst_name, RH_inst_fileName, lon_fileName) esat_inst = 0.6108 * np.exp(17.27 * Temp_inst / (Temp_inst + 237.3)) eact_inst = RH_inst * esat_inst / 100 #################### Calculate NDVI for VIIRS-PROBAV ########################################## if Image_Type == 2: if Name_PROBAV_Image == 'None': offset_all = [-1, 1, -2, 2, -3, 3,-4, 4,-5 ,5 ,-6 , 6, -7, 7, -8, 8] found_Name_PROBAV_Image = 0 for offset in offset_all: if found_Name_PROBAV_Image == 1: continue else: try: Name_PROBAV_Image = SEBAL_RUNS[number + offset]['PROBA_V_name'] if not Name_PROBAV_Image == 'None': found_Name_PROBAV_Image = 1 except: pass # Get the day and time from the PROBA-V Band_PROBAVhdf_fileName = os.path.join(input_folder, '%s.HDF5' % (Name_PROBAV_Image)) g=gdal.Open(Band_PROBAVhdf_fileName, gdal.GA_ReadOnly) Meta_data = g.GetMetadata() Date_PROBAV = str(Meta_data['LEVEL3_RADIOMETRY_BLUE_OBSERVATION_START_DATE']) year = int(Date_PROBAV.split("-")[0]) month = int(Date_PROBAV.split("-")[1]) day = int(Date_PROBAV.split("-")[2]) Var_name_2 = '%d%02d%02d' %(year, month, day) # Define the output name NDVI_FileName = os.path.join(NDVI_outfolder,'NDVI_PROBAV_%s.tif' %Var_name_2) Albedo_FileName = os.path.join(Albedo_outfolder, 'Albedo_PROBAV_%s.tif' %Var_name_2) water_mask_temp_FileName = os.path.join(WaterMask_outfolder, 'Water_Mask_PROBAV_%s.tif' %Var_name_2) else: NDVI_FileName = os.path.join(NDVI_outfolder,'NDVI_PROBAV_%s.tif' %Var_name) Albedo_FileName = os.path.join(Albedo_outfolder, 'Albedo_PROBAV_%s.tif' %Var_name) water_mask_temp_FileName = os.path.join(WaterMask_outfolder, 'Water_Mask_PROBAV_%s.tif' %Var_name) # vegetation maps that will be generated if not os.path.exists(NDVI_FileName): # Define the bands that will be used bands=['SM', 'B1', 'B2', 'B3', 'B4'] #'SM', 'BLUE', 'RED', 'NIR', 'SWIR' # Set the index number at 0 index=0 # create a zero array with the shape of the reprojected DEM file data_PROBAV=np.zeros((shape[1], shape[0])) spectral_reflectance_PROBAV=np.zeros([shape[1], shape[0], 5]) # constants n188_float=248 # Now it is 248, but we do not exactly know what this really means and if this is for constant for all images. # write the data one by one to the spectral_reflectance_PROBAV for bandnmr in bands: # Translate the PROBA-V names to the Landsat band names Band_number = {'SM':7,'B1':8,'B2':10,'B3':9,'B4':11} # Open the dataset Band_PROBAVhdf_fileName = os.path.join(input_folder, '%s.HDF5' % (Name_PROBAV_Image)) g=gdal.Open(Band_PROBAVhdf_fileName, gdal.GA_ReadOnly) # define data if it is not there yet if not 'Var_name' in locals(): Meta_data = g.GetMetadata() Date_PROBAV = str(Meta_data['LEVEL3_RADIOMETRY_BLUE_OBSERVATION_START_DATE']) year = int(Date_PROBAV.split("-")[0]) month = int(Date_PROBAV.split("-")[0]) day = int(Date_PROBAV.split("-")[0]) Var_name = '%d%02d%02d' %(year, month, day) # Open the .hdf file name_out = os.path.join(input_folder, '%s_test.tif' % (Name_PROBAV_Image)) name_in = g.GetSubDatasets()[Band_number[bandnmr]][0] # Get environmental variable SEBAL_env_paths = os.environ["SEBAL"].split(';') GDAL_env_path = SEBAL_env_paths[0] GDAL_TRANSLATE = os.path.join(GDAL_env_path, 'gdal_translate.exe') # run gdal translate command FullCmd = '%s -of GTiff %s %s' %(GDAL_TRANSLATE, name_in, name_out) SEBAL.Run_command_window(FullCmd) # Open data dest_PV = gdal.Open(name_out) Data = dest_PV.GetRasterBand(1).ReadAsArray() dest_PV = None # Remove temporary file os.remove(name_out) # Define the x and y spacing Meta_data = g.GetMetadata() Lat_Bottom = float(Meta_data['LEVEL3_GEOMETRY_BOTTOM_LEFT_LATITUDE']) Lat_Top = float(Meta_data['LEVEL3_GEOMETRY_TOP_RIGHT_LATITUDE']) Lon_Left = float(Meta_data['LEVEL3_GEOMETRY_BOTTOM_LEFT_LONGITUDE']) Lon_Right = float(Meta_data['LEVEL3_GEOMETRY_TOP_RIGHT_LONGITUDE']) Pixel_size = float((Meta_data['LEVEL3_GEOMETRY_VNIR_VAA_MAPPING']).split(' ')[-3]) # Define the georeference of the PROBA-V data geo_PROBAV=[Lon_Left-0.5*Pixel_size, Pixel_size, 0, Lat_Top+0.5*Pixel_size, 0, -Pixel_size] #0.000992063492063 # Define the name of the output file PROBAV_data_name=os.path.join(input_folder, '%s_%s.tif' % (Name_PROBAV_Image,bandnmr)) dst_fileName=os.path.join(input_folder, PROBAV_data_name) # create gtiff output with the PROBA-V band fmt = 'GTiff' driver = gdal.GetDriverByName(fmt) dst_dataset = driver.Create(dst_fileName, int(Data.shape[1]), int(Data.shape[0]), 1,gdal.GDT_Float32) dst_dataset.SetGeoTransform(geo_PROBAV) # set the reference info srs = osr.SpatialReference() srs.SetWellKnownGeogCS("WGS84") dst_dataset.SetProjection(srs.ExportToWkt()) # write the array in the geotiff band dst_dataset.GetRasterBand(1).WriteArray(Data) dst_dataset = None # Open the PROBA-V band in SEBAL g=gdal.Open(PROBAV_data_name.replace("\\","/")) # If the data cannot be opened, change the extension if g is None: PROBAV_data_name=os.path.join(input_folder, '%s_%s.tiff' % (Name_PROBAV_Image,bandnmr)) # Reproject the PROBA-V band to match DEM's resolution PROBAV, ulx, lry, lrx, uly, epsg_to = SEBAL.reproject_dataset_example( PROBAV_data_name, lon_fileName) # Open the reprojected PROBA-V band data data_PROBAV_DN = PROBAV.GetRasterBand(1).ReadAsArray(0, 0, ncol, nrow) # Define the filename to store the cropped Landsat image dst_FileName = os.path.join(output_folder, 'Output_PROBAV','proy_PROBAV_%s.tif' % bandnmr) # close the PROBA-V g=None # If the band data is not SM change the DN values into PROBA-V values and write into the spectral_reflectance_PROBAV if bandnmr is not 'SM': data_PROBAV[:, :]=data_PROBAV_DN/2000 spectral_reflectance_PROBAV[:, :, index]=data_PROBAV[:, :] # If the band data is the SM band than write the data into the spectral_reflectance_PROBAV and create cloud mask else: data_PROBAV[:, :]=data_PROBAV_DN Cloud_Mask_PROBAV=np.zeros((shape[1], shape[0])) Cloud_Mask_PROBAV[data_PROBAV[:,:]!=n188_float]=1 spectral_reflectance_PROBAV[:, :, index]=Cloud_Mask_PROBAV # Change the spectral reflectance to meet certain limits spectral_reflectance_PROBAV[:, :, index]=np.where(spectral_reflectance_PROBAV[:, :, index]<=0,np.nan,spectral_reflectance_PROBAV[:, :, index]) spectral_reflectance_PROBAV[:, :, index]=np.where(spectral_reflectance_PROBAV[:, :, index]>=150,np.nan,spectral_reflectance_PROBAV[:, :, index]) # Go to the next index index=index+1 # Bands in PROBAV spectral reflectance # 0 = MS # 1 = BLUE # 2 = NIR # 3 = RED # 4 = SWIR # Calculate surface albedo based on PROBA-V Surface_Albedo_PROBAV = 0.219 * spectral_reflectance_PROBAV[:, :, 1] + 0.361 * spectral_reflectance_PROBAV[:, :, 2] + 0.379 * spectral_reflectance_PROBAV[:, :, 3] + 0.041 * spectral_reflectance_PROBAV[:, :, 4] # Create Water mask based on PROBA-V water_mask_temp = np.zeros((shape[1], shape[0])) water_mask_temp[np.logical_and(spectral_reflectance_PROBAV[:, :, 2] >= spectral_reflectance_PROBAV[:, :, 3],data_DEM>0)]=1 # Calculate the NDVI based on PROBA-V n218_memory = spectral_reflectance_PROBAV[:, :, 2] + spectral_reflectance_PROBAV[:, :, 3] NDVI = np.zeros((shape[1], shape[0])) NDVI[n218_memory != 0] = ( spectral_reflectance_PROBAV[:, :, 3][n218_memory != 0] - spectral_reflectance_PROBAV[:, :, 2][n218_memory != 0] )/ ( spectral_reflectance_PROBAV[:, :, 2][n218_memory != 0] + spectral_reflectance_PROBAV[:, :, 3][n218_memory != 0] ) # Save Albedo for PROBA-V SEBAL.save_GeoTiff_proy(dest, Surface_Albedo_PROBAV, Albedo_FileName, shape, nband=1) # Save NDVI for PROBA-V SEBAL.save_GeoTiff_proy(dest, NDVI, NDVI_FileName, shape, nband=1) # Save Water Mask for PROBA-V SEBAL.save_GeoTiff_proy(dest, water_mask_temp, water_mask_temp_FileName, shape, nband=1) else: dest_NDVI = gdal.Open(NDVI_FileName) dest_water_mask_temp = gdal.Open(water_mask_temp_FileName) NDVI = dest_NDVI.GetRasterBand(1).ReadAsArray() water_mask_temp = dest_water_mask_temp.GetRasterBand(1).ReadAsArray() ############################ Calculate LAI ########################################## # Calculate the LAI FPAR,tir_emis,Nitrogen,vegt_cover,LAI,b10_emissivity = SEBAL.Calc_vegt_para(NDVI,water_mask_temp,shape) # Create LAI name if Image_Type == 1: LAI_FileName = os.path.join(LAI_outfolder,'LAI_LS_%s.tif' %Var_name) SEBAL.save_GeoTiff_proy(dest, LAI, LAI_FileName, shape, nband=1) #################### Calculate thermal for Landsat ########################################## if Image_Type == 1: # Calculate thermal therm_data = SEBAL.Landsat_therm_data(Bands,input_folder,Name_Landsat_Image,output_folder,ulx_dem,lry_dem,lrx_dem,uly_dem,shape) # Calculate surface temperature Surface_temp=SEBAL.Calc_surface_water_temp(Temp_inst,Landsat_nr,Lmax,Lmin,therm_data,b10_emissivity,k1_c,k2_c,eact_inst,shape,water_mask_temp,Bands_thermal,Rp,tau_sky,surf_temp_offset,Image_Type) # Save surface temperature therm_data_FileName = os.path.join(Surface_Temperature_outfolder,'Surface_Temperature_LS_%s.tif' %Var_name) SEBAL.save_GeoTiff_proy(dest, Surface_temp, therm_data_FileName, shape, nband=1) ################################## Calculate VIIRS surface temperature ######################## if Image_Type == 2: # If there is VIIRS data if not Name_VIIRS_Image_TB == 'None': # Define the VIIRS thermal data name VIIRS_data_name=os.path.join(input_folder, '%s' % (Name_VIIRS_Image_TB)) # Reproject VIIRS thermal data VIIRS, ulx, lry, lrx, uly, epsg_to = SEBAL.reproject_dataset_example(VIIRS_data_name, lon_fileName) # Open VIIRS thermal data data_VIIRS = VIIRS.GetRasterBand(1).ReadAsArray() # Define the thermal VIIRS output name proyVIIRS_fileName = os.path.join(temp_folder_PreSEBAL, 'Surface_Temp_VIIRS_%s.tif' %Var_name) # Save the thermal VIIRS data SEBAL.save_GeoTiff_proy(dest, data_VIIRS, proyVIIRS_fileName, shape, nband=1) # Set the conditions for the brightness temperature (100m) brightness_temp=np.where(data_VIIRS>=250, data_VIIRS, np.nan) # Constants k1=606.399172 k2=1258.78 L_lambda_b10_100=((2*6.63e-34*(3.0e8)**2)/((11.45e-6)**5*(np.exp((6.63e-34*3e8)/(1.38e-23*(11.45e-6)*brightness_temp))-1)))*1e-6 # Get Temperature for 100 and 375m resolution Temp_TOA_100 = SEBAL.Get_Thermal(L_lambda_b10_100,Rp,Temp_inst,tau_sky,tir_emis,k1,k2) # Conditions for surface temperature (100m) n120_surface_temp=Temp_TOA_100.clip(250, 450) # Save the surface temperature of the VIIRS in 100m resolution temp_surface_100_fileName_beforeTS = os.path.join(Surface_Temperature_outfolder,'Surface_Temperature_VIIRS_%s.tif' %Var_name) SEBAL.save_GeoTiff_proy(dest, n120_surface_temp, temp_surface_100_fileName_beforeTS, shape, nband=1) ###################### Create NC files for HANTS parameter testing #################################### # All HANTS variables VARS = ['NDVI', 'Albedo', 'Surface_Temperature'] # loop over the HANTS parameters for VAR in VARS: # Define paths for NDVI input_folder_HANTS_VAR = os.path.join(output_folder_PreSEBAL_SEBAL, VAR) if VAR == 'Surface_Temperature': name_format = 'Surface_Temperature_VIIRS_{0}.tif' else: name_format = '%s_PROBAV_{0}.tif' %VAR # define NC output for the 3D array nc_path = os.path.join(input_folder_HANTS_VAR,'%s_NC.nc' %VAR) # Set the working directory to the Tiff file of the HANTS parameter os.chdir(input_folder_HANTS_VAR) # Rename the variable in the name_format name_format_var = name_format.replace('{0}','*') # Find all tiff files equal to format re_var = glob.glob(name_format_var) # Open the first tiff file path_to_first_variable = os.path.join(input_folder_HANTS_VAR,re_var[0]) dest_first_var = gdal.Open(path_to_first_variable) # Read out the geo transforma paramters geo_first_var = dest_first_var.GetGeoTransform() x_size = int(dest_first_var.RasterXSize) y_size = int(dest_first_var.RasterYSize) cellsize = int(geo_first_var[1]) latlim = [geo_first_var[3]+geo_first_var[5]*y_size,geo_first_var[3]] lonlim = [geo_first_var[0],geo_first_var[0]+geo_first_var[1]*x_size] # Create netcdf import hants.wa_gdal as hants_gdal hants_gdal.create_netcdf(input_folder_HANTS_VAR, name_format, start_date, end_date, latlim, lonlim, cellsize, nc_path) def Create_Buffer(Data_In): ''' This function creates a 3D array which is used to apply the moving window ''' Buffer_area = 7 # A block of 2 times Buffer_area + 1 will be 1 if there is the pixel in the middle is 1 Data_Out=np.empty((len(Data_In),len(Data_In[1]))) Data_Out[:,:] = Data_In for ypixel in range(0,Buffer_area + 1): for xpixel in range(1,Buffer_area + 1): if ypixel==0: for xpixel in range(1,Buffer_area + 1): Data_Out[:,0:-xpixel] += Data_In[:,xpixel:] Data_Out[:,xpixel:] += Data_In[:,:-xpixel] for ypixel in range(1,Buffer_area + 1): Data_Out[ypixel:,:] += Data_In[:-ypixel,:] Data_Out[0:-ypixel,:] += Data_In[ypixel:,:] else: Data_Out[0:-xpixel,ypixel:] += Data_In[xpixel:,:-ypixel] Data_Out[xpixel:,ypixel:] += Data_In[:-xpixel,:-ypixel] Data_Out[0:-xpixel,0:-ypixel] += Data_In[xpixel:,ypixel:] Data_Out[xpixel:,0:-ypixel] += Data_In[:-xpixel,ypixel:] Data_Out[Data_Out>0.1] = 1 Data_Out[Data_Out<=0.1] = 0 return(Data_Out) def Get_epsg(g): try: # Get info of the dataset that is used for transforming gland_proj = g.GetProjection() Projection=gland_proj.split('EPSG","') epsg_to=int((str(Projection[-1]).split(']')[0])[0:-1]) except: epsg_to=4326 print('Was not able to get the projection, so WGS84 is assumed') return(epsg_to) def gap_filling(data,NoDataValue): """ This function fills the no data gaps in a numpy array Keyword arguments: dataset -- Array NoDataValue -- Value that must be filled """ # fill the no data values if NoDataValue is np.nan: mask = ~(np.isnan(data)) else: mask = ~(data==NoDataValue) xx, yy = np.meshgrid(np.arange(data.shape[1]), np.arange(data.shape[0])) xym = np.vstack( (np.ravel(xx[mask]), np.ravel(yy[mask])) ).T data0 = np.ravel( data[:,:][mask] ) interp0 = scipy.interpolate.NearestNDInterpolator( xym, data0 ) data_end = interp0(np.ravel(xx), np.ravel(yy)).reshape( xx.shape ) return (data_end) if __name__ == '__main__': main()
import cPickle import errno import itertools import os import sys import tempfile import traceback from conary import files, trove, callbacks from conary.deps import deps from conary.lib import util, openpgpfile, sha1helper, openpgpkey from conary.repository import changeset, errors, filecontents from conary.repository.datastore import DataStoreRepository, DataStore from conary.repository.datastore import DataStoreSet from conary.repository.repository import AbstractRepository from conary.repository.repository import ChangeSetJob from conary.repository import netclient from conary.server import schema class FilesystemChangeSetJob(ChangeSetJob): def __init__(self, repos, cs, *args, **kw): self.mirror = kw.get('mirror', False) self.requireSigs = kw.pop('requireSigs', False) self.callback = kw.get('callback', False) self.addTroveSetStart(repos, cs) ChangeSetJob.__init__(self, repos, cs, *args, **kw) repos.troveStore.addTroveSetDone(self.callback) def addTroveSetStart(self, repos, cs): newDirNames = set() newBaseNames = set() oldTroves = [] for i, csTrove in enumerate(cs.iterNewTroveList()): if csTrove.getOldVersion(): oldTroves.append(csTrove.getOldNameVersionFlavor()) for fileInfo in itertools.chain( csTrove.getNewFileList(raw = True), csTrove.getChangedFileList(raw = True)): if fileInfo[1] is None: continue newDirNames.add(fileInfo[1]) newBaseNames.add(fileInfo[2]) repos.troveStore.addTroveSetStart(oldTroves, newDirNames, newBaseNames) def _containsFileContents(self, sha1iter): return self.repos.troveStore.hasFileContents(sha1iter) def markTroveRemoved(self, name, version, flavor): self.repos.markTroveRemoved(name, version, flavor) def checkTroveCompleteness(self, trv): if not self.mirror and not trv.troveInfo.sigs.sha1(): raise errors.TroveChecksumMissing(trv.getName(), trv.getVersion(), trv.getFlavor()) if trv.troveInfo.incomplete(): if trv.troveInfo.troveVersion() > trove.TROVE_VERSION: raise errors.TroveSchemaError(trv.getName(), trv.getVersion(), trv.getFlavor(), trv.troveInfo.troveVersion(), trove.TROVE_VERSION) else: nvf = trv.getName(), trv.getVersion(), trv.getFlavor(), err = 'Attempted to commit incomplete trove %s=%s[%s]' % nvf raise errors.TroveIntegrityError(error=err, *nvf) def checkTroveSignatures(self, trv, callback): assert(hasattr(callback, 'verifyTroveSignatures')) if callback.keyCache is None: callback.keyCache = openpgpkey.getKeyCache() for fingerprint, timestamp, sig in trv.troveInfo.sigs.digitalSigs.iter(): try: pubKey = callback.keyCache.getPublicKey(fingerprint) if pubKey.isRevoked(): raise openpgpfile.IncompatibleKey('Key %s is revoked' %pubKey.getFingerprint()) expirationTime = pubKey.getTimestamp() if expirationTime and expirationTime < timestamp: raise openpgpfile.IncompatibleKey('Key %s is expired' %pubKey.getFingerprint()) except openpgpfile.KeyNotFound: # missing keys could be okay; that depends on the threshold # we've set. it's the callbacks problem in any case. pass res = ChangeSetJob.checkTroveSignatures(self, trv, callback) if len(res[1]) and self.requireSigs: raise openpgpfile.KeyNotFound('Repository does not recognize ' 'key: %s'% res[1][0]) class UpdateCallback(callbacks.UpdateCallback): def __init__(self, statusPath, trustThreshold, keyCache): self.path = statusPath if statusPath: self.tmpDir = os.path.dirname(statusPath) callbacks.UpdateCallback.__init__(self, trustThreshold, keyCache) def _dumpStatus(self, *args): if self.path: # make the new status dump in a temp location # for atomicity (fd, path) = tempfile.mkstemp(dir = self.tmpDir, suffix = '.commit-status') buf = cPickle.dumps(args) os.write(fd, buf) os.close(fd) os.rename(path, self.path) def creatingDatabaseTransaction(self, *args): self._dumpStatus('creatingDatabaseTransaction', *args) def updatingDatabase(self, *args): self._dumpStatus('updatingDatabase', *args) class FilesystemRepository(DataStoreRepository, AbstractRepository): def __init__(self, serverNameList, troveStore, contentsDir, repositoryMap, requireSigs = False, paranoidCommits = False): self.serverNameList = serverNameList self.paranoidCommits = paranoidCommits map = dict(repositoryMap) for serverName in serverNameList: map[serverName] = self # XXX this client needs to die from conary import conarycfg self.reposSet = netclient.NetworkRepositoryClient(map, conarycfg.UserInformation()) self.troveStore = troveStore self.requireSigs = requireSigs for dir in contentsDir: util.mkdirChain(dir) if len(contentsDir) == 1: store = DataStore(contentsDir[0]) else: storeList = [] for dir in contentsDir: storeList.append(DataStore(dir)) store = DataStoreSet(*storeList) DataStoreRepository.__init__(self, dataStore = store) AbstractRepository.__init__(self) def close(self): if self.troveStore is not None: self.troveStore.db.close() self.troveStore = None ### Package access functions def thawFlavor(self, flavor): return deps.ThawFlavor(flavor) def hasTrove(self, pkgName, version, flavor): return self.troveStore.hasTrove(pkgName, troveVersion = version, troveFlavor = flavor) def getTrove(self, pkgName, version, flavor, pristine = True, withFiles = True, hidden = False): return self.troveStore.getTrove( pkgName, version, flavor, withFiles = withFiles, hidden = hidden) def iterTroves(self, troveList, withFiles = True, hidden = False): return self.troveStore.iterTroves(troveList, withFiles = withFiles, hidden = hidden) def getParentTroves(self, troveList): return self.troveStore.getParentTroves(troveList) def addTrove(self, trv, trvCs, hidden = False, oldTroveSpec = None): return self.troveStore.addTrove(trv, trvCs, hidden = hidden) def addTroveDone(self, pkg, mirror=False): self.troveStore.addTroveDone(pkg, mirror=mirror) ### File functions def getFileVersion(self, pathId, fileId, fileVersion, withContents = 0): # the get trove netclient provides doesn't work with a # FilesystemRepository (it needs to create a change set which gets # passed) if fileVersion.getHost() not in self.serverNameList: # XXX This code is not needed as of version 1.0.14 of the client. assert(not withContents) return self.reposSet.getFileVersion(pathId, fileId, fileVersion) fileObj = self.troveStore.getFile(pathId, fileId) if withContents: if fileObj.hasContents: cont = filecontents.FromDataStore(self.contentsStore, file.contents.sha1()) else: cont = None return (fileObj, cont) return fileObj def getFileVersions(self, fileList, withContents = False): # this is for compatibility with <= 1.0.13 crossRepos = False for (pathId, fileId, fileVersion) in fileList: if fileVersion.getHost() not in self.serverNameList: crossRepos = True if crossRepos: for x in fileList: yield self.getFileVersion(withContents = withContents, *x) else: fileDict = self.troveStore.getFiles(fileList) for x in fileList: # (pathId, fileId) lookup try: fileObj = fileDict[x[0:2]] except KeyError: raise errors.FileStreamMissing(x[1]) if withContents: if file.hasContents: cont = filecontents.FromDataStore(self.contentsStore, file.contents.sha1()) else: cont = None yield (fileObj, cont) yield fileObj def addFileVersion(self, troveInfo, pathId, path, fileId, fileVersion, fileStream = None, withContents = True): troveInfo.addFile(pathId, path, fileId, fileVersion, fileStream = fileStream, withContents = withContents) ### def commitChangeSet(self, cs, mirror=False, hidden=False, serialize=False, excludeCapsuleContents = False, callback = None, statusPath = None): # when we add troves (no removals) we disable constraints on # the TroveFiles table; it speeds up large commits massively on # postgres enableConstraints = True # let's make sure commiting this change set is a sane thing to attempt for trvCs in cs.iterNewTroveList(): if trvCs.troveType() == trove.TROVE_TYPE_REMOVED: enableConstraints = False v = trvCs.getNewVersion() if v.isOnLocalHost(): label = v.branch().label() raise errors.CommitError('can not commit items on ' '%s label' %(label.asString())) self.troveStore.begin(serialize) if enableConstraints: enableConstraints = self.troveStore.db.disableTableConstraints( 'TroveFiles') if self.requireSigs: threshold = openpgpfile.TRUST_FULL else: threshold = openpgpfile.TRUST_UNTRUSTED # Callback for signature verification and progress if statusPath: assert not callback callback = UpdateCallback(statusPath=statusPath, trustThreshold=threshold, keyCache=self.troveStore.keyTable.keyCache) try: # reset time stamps only if we're not mirroring. FilesystemChangeSetJob(self, cs, self.serverNameList, resetTimestamps = not mirror, callback=callback, mirror = mirror, hidden = hidden, excludeCapsuleContents = excludeCapsuleContents, requireSigs = self.requireSigs) except openpgpfile.KeyNotFound: # don't be quite so noisy, this is a common error self.troveStore.rollback() raise except: print >> sys.stderr, "exception occurred while committing change set" print >> sys.stderr, ''.join(traceback.format_exception(*sys.exc_info())) print >> sys.stderr, "attempting rollback" self.troveStore.rollback() raise else: if self.paranoidCommits: for trvCs in cs.iterNewTroveList(): newTuple = trvCs.getNewNameVersionFlavor() if newTuple[1] is None: continue trv = self.getTrove(withFiles = True, *newTuple) assert(trv.verifyDigests()) if enableConstraints: enableConstraints.enable() self.troveStore.commit() def markTroveRemoved(self, name, version, flavor): sha1s = self.troveStore.markTroveRemoved(name, version, flavor) for sha1 in sha1s: try: self.contentsStore.removeFile(sha1helper.sha1ToString(sha1)) except OSError, e: if e.errno != errno.ENOENT: raise def getFileContents(self, itemList): contents = [] for item in itemList: (fileId, fileVersion) = item[0:2] # the get trove netclient provides doesn't work with a # FilesystemRepository (it needs to create a change set which gets # passed) if fileVersion.getHost() in self.serverNameList: fileObj = item[2] cont = filecontents.FromDataStore(self.contentsStore, fileObj.contents.sha1()) else: # XXX This code is not needed as of version 1.0.14 of the # client. # # a bit of sleight of hand here... we look for this file in # the trove it was first built in # # this could cause us to run out of file descriptors on large # troves. it might be better to close the file and return # a filecontents object? cont = self.reposSet.getFileContents([ item ])[0] contents.append(cont) return contents def createChangeSet(self, origTroveList, recurse = True, withFiles = True, withFileContents = True, excludeCapsuleContents = False, excludeAutoSource = False, mirrorMode = False, roleIds = None): """ @param origTroveList: a list of C{(troveName, flavor, oldVersion, newVersion, absolute)} tuples. If C{oldVersion == None} and C{absolute == 0}, then the trove is assumed to be new for the purposes of the change set. If C{newVersion == None} then the trove is being removed. If recurse is set, this yields one result for the entire troveList. If recurse is not set, it yields one result per troveList entry. @param excludeCapsuleContents: If True, troves which include capsules have all of their content excluded from the changeset no matter how withFileContents is set. """ cs = changeset.ChangeSet() externalTroveList = [] externalFileList = [] removedTroveList = [] dupFilter = set() resultList = [] # make a copy to remove things from troveList = origTroveList[:] # def createChangeSet begins here troveWrapper = _TroveListWrapper(troveList, self.troveStore, withFiles, roleIds = roleIds) for (job, old, new, streams) in troveWrapper: (troveName, (oldVersion, oldFlavor), (newVersion, newFlavor), absolute) = job # make sure we haven't already generated this changeset; since # troves can be included from other troves we could try # to generate quite a few duplicates if job in dupFilter: continue else: dupFilter.add(job) done = False if not newVersion: if oldVersion.getHost() not in self.serverNameList: externalTroveList.append((troveName, (oldVersion, oldFlavor), (None, None), absolute)) else: # remove this trove and any trove contained in it cs.oldTrove(troveName, oldVersion, oldFlavor) for (name, version, flavor) in \ old.iterTroveList(strongRefs=True): troveWrapper.append((name, (version, flavor), (None, None), absolute), False) done = True elif (newVersion.getHost() not in self.serverNameList or (oldVersion and oldVersion.getHost() not in self.serverNameList)): # don't try to make changesets between repositories; the # client can do that itself # we don't generate chagnesets between removed and # present troves; that's up to the client externalTroveList.append((troveName, (oldVersion, oldFlavor), (newVersion, newFlavor), absolute)) done = True elif (oldVersion and old.type() == trove.TROVE_TYPE_REMOVED): removedTroveList.append((troveName, (oldVersion, oldFlavor), (newVersion, newFlavor), absolute)) done = True if done: if not recurse: yield (cs, externalTroveList, externalFileList, removedTroveList) cs = changeset.ChangeSet() externalTroveList = [] externalFileList = [] removedTroveList = [] continue (troveChgSet, filesNeeded, pkgsNeeded) = \ new.diff(old, absolute = absolute) if recurse: for refJob in pkgsNeeded: refOldVersion = refJob[1][0] refNewVersion = refJob[2][0] if (refNewVersion and (refNewVersion.getHost() not in self.serverNameList) or (refOldVersion and refOldVersion.getHost() not in self.serverNameList) ): # don't try to make changesets between repositories; the # client can do that itself externalTroveList.append(refJob) else: troveWrapper.append(refJob, True) cs.newTrove(troveChgSet) if job in origTroveList and job[2][0] is not None: # add the primary w/ timestamps on the version try: primary = troveChgSet.getNewNameVersionFlavor() cs.addPrimaryTrove(*primary) except KeyError: # primary troves could be in the externalTroveList, in # which case they aren't primries pass # sort the set of files we need into bins based on the server # name serverIdx = {} getList = [] localFilesNeeded = [] for (pathId, oldFileId, oldFileVersion, newFileId, newFileVersion) in filesNeeded: # if either the old or new file version is on a different # repository, creating this diff is someone else's problem if (newFileVersion.getHost() not in self.serverNameList or (oldFileVersion and oldFileVersion.getHost() not in self.serverNameList)): externalFileList.append((pathId, troveName, (oldVersion, oldFlavor, oldFileId, oldFileVersion), (newVersion, newFlavor, newFileId, newFileVersion))) else: localFilesNeeded.append((pathId, oldFileId, oldFileVersion, newFileId, newFileVersion)) if oldFileVersion: getList.append((pathId, oldFileId, oldFileVersion)) getList.append((pathId, newFileId, newFileVersion)) # Walk this in reverse order. This may seem odd, but the # order in the final changeset is set by sorting that happens # in the change set object itself. The only reason we sort # here at all is to make sure PTR file types come before the # file they refer to. Reverse shorting makes this a bit easier. localFilesNeeded.sort() localFilesNeeded.reverse() ptrTable = {} for (pathId, oldFileId, oldFileVersion, newFileId, \ newFileVersion) in localFilesNeeded: oldFile = None if oldFileVersion: #oldFile = idIdx[(pathId, oldFileId)] oldFile = files.ThawFile(streams[oldFileId], pathId) oldCont = None newCont = None #newFile = idIdx[(pathId, newFileId)] newFile = files.ThawFile(streams[newFileId], pathId) if mirrorMode: (filecs, contentsHash) = changeset.fileChangeSet(pathId, None, newFile) else: (filecs, contentsHash) = changeset.fileChangeSet(pathId, oldFile, newFile) cs.addFile(oldFileId, newFileId, filecs) if (excludeCapsuleContents and new.troveInfo.capsule.type and new.troveInfo.capsule.type()): continue if (not withFileContents or (excludeAutoSource and newFile.flags.isAutoSource()) or (newFile.flags.isEncapsulatedContent() and not newFile.flags.isCapsuleOverride())): continue # this test catches files which have changed from not # config files to config files; these need to be included # unconditionally so we always have the pristine contents # to include in the local database if ((mirrorMode and newFile.hasContents) or contentsHash or (oldFile and newFile.flags.isConfig() and not oldFile.flags.isConfig())): if oldFileVersion and oldFile.hasContents: oldCont = self.getFileContents( [ (oldFileId, oldFileVersion, oldFile) ])[0] newCont = self.getFileContents( [ (newFileId, newFileVersion, newFile) ])[0] (contType, cont) = changeset.fileContentsDiff(oldFile, oldCont, newFile, newCont, mirrorMode = mirrorMode) # we don't let config files be ptr types; if they were # they could be ptrs to things which aren't config files, # which would completely hose the sort order we use. this # could be relaxed someday to let them be ptr's to other # config files if not newFile.flags.isConfig() and \ contType == changeset.ChangedFileTypes.file: contentsHash = newFile.contents.sha1() ptr = ptrTable.get(contentsHash, None) if ptr is not None: contType = changeset.ChangedFileTypes.ptr cont = filecontents.FromString(ptr) else: ptrTable[contentsHash] = pathId + newFileId if not newFile.flags.isConfig() and \ contType == changeset.ChangedFileTypes.file: cont = filecontents.CompressedFromDataStore( self.contentsStore, newFile.contents.sha1()) compressed = True else: compressed = False # ptr entries are not compressed, whether or not they # are config files. override the compressed rule from # above if contType == changeset.ChangedFileTypes.ptr: compressed = False cs.addFileContents(pathId, newFileId, contType, cont, newFile.flags.isConfig(), compressed = compressed) if not recurse: yield cs, externalTroveList, externalFileList, removedTroveList cs = changeset.ChangeSet() externalTroveList = [] externalFileList = [] removedTroveList = [] if recurse: yield cs, externalTroveList, externalFileList, removedTroveList class _TroveListWrapper: def _handleJob(self, job, recursed, idx): t = self.trvIterator.next() if t is not None: if self.withFiles: t, streams = t else: streams = {} if t is None: if recursed: # synthesize a removed trove for this missing # trove t = trove.Trove(job[0], job[idx][0], job[idx][1], type=trove.TROVE_TYPE_REMOVED) t.setIsMissing(True) t.computeDigests() # synthesize empty filestreams streams = {} else: # drain the iterator, in order to complete # the sql queries for x in self.trvIterator: pass raise errors.TroveMissing(job[0], job[idx][0]) return t, streams def next(self): if not self.l and self.new: # self.l (and self.trvIterator) are empty; look to # self.new for new jobs we need troveList = [] for job, recursed in self.new: # do we need the old trove? if job[1][0] is not None: troveList.append((job[0], job[1][0], job[1][1])) # do we need the new trove? if job[2][0] is not None: troveList.append((job[0], job[2][0], job[2][1])) # flip to the new job set and it's trove iterator, and # reset self.new for later additions self.trvIterator = self.troveStore.iterTroves( troveList, withFiles = self.withFiles, withFileStreams = self.withFiles, permCheckFilter = self._permCheck, hidden=True, ) self.l = self.new self.new = [] if self.l: job, recursed = self.l.pop(0) # Does it have an old job? if job[1][0] is None: old = None oldStreams = {} else: old, oldStreams = self._handleJob(job, recursed, 1) # Does it have a new job if job[2][0] is None: new = None newStreams = {} else: new, newStreams = self._handleJob(job, recursed, 2) newStreams.update(oldStreams) return job, old, new, newStreams else: raise StopIteration def _permCheck(self, cu, instanceTblName): # returns a list of instance id's we're allowed to see sql = """ DELETE FROM %s WHERE instanceId NOT IN (SELECT DISTINCT ugi.instanceId FROM %s JOIN UserGroupInstancesCache as ugi ON %s.instanceId = ugi.instanceId WHERE ugi.userGroupId IN (%s)) """ % (instanceTblName, instanceTblName, instanceTblName, ",".join("%d" % x for x in self.roleIds)) cu.execute(sql, start_transaction = False) def __iter__(self): while True: yield self.next() def append(self, item, recurse): self.new.append((item, recurse)) def __init__(self, l, troveStore, withFiles, roleIds = None): self.trvIterator = None self.new = [ (x, False) for x in l ] self.l = [] self.troveStore = troveStore self.withFiles = withFiles self.roleIds = roleIds
def isSentenceCorrect(sentence): pattern = '^[A-Z][^\?\!\.]*[!.?]{1}$' return re.match(pattern, sentence) is not None
import abc import six import yaml from nailgun import consts from nailgun.errors import errors from nailgun.expression import Expression from nailgun.logger import logger from nailgun import objects from nailgun.orchestrator import deployment_serializers from nailgun.orchestrator import tasks_templates as templates from nailgun.settings import settings def get_uids_for_tasks(nodes, tasks): """Return node uids where particular tasks should be executed :param nodes: list of Node db objects :param tasks: list of dicts :returns: list of strings """ roles = [] for task in tasks: # plugin tasks may store information about node # role not only in `role` key but also in `groups` task_role = task.get('role', task.get('groups')) if task_role == consts.ALL_ROLES: return get_uids_for_roles(nodes, consts.ALL_ROLES) elif task_role == consts.MASTER_ROLE: return [consts.MASTER_ROLE] elif isinstance(task_role, list): roles.extend(task_role) # if task has 'skipped' status it is allowed that 'roles' and # 'groups' are not be specified elif task['type'] != consts.ORCHESTRATOR_TASK_TYPES.skipped: logger.warn( 'Wrong roles format in task %s: either ' '`roles` or `groups` must be specified and contain ' 'a list of roles or "*"', task) return get_uids_for_roles(nodes, roles) def get_uids_for_roles(nodes, roles): """Returns list of uids for nodes that matches roles :param nodes: list of nodes :param roles: list of roles or consts.ALL_ROLES :returns: list of strings """ uids = set() if roles == consts.ALL_ROLES: uids.update([n.uid for n in nodes]) elif roles == consts.MASTER_ROLE: return [consts.MASTER_ROLE] elif isinstance(roles, list): for node in nodes: if set(roles) & set(objects.Node.all_roles(node)): uids.add(node.uid) else: logger.warn( 'Wrong roles format, `roles` should be a list or "*": %s', roles) return list(uids) @six.add_metaclass(abc.ABCMeta) class DeploymentHook(object): def should_execute(self): """Should be used to define conditions when task should be executed.""" return True @abc.abstractmethod def serialize(self): """Serialize task in expected by orchestrator format. This interface should return generator, because in some cases one external task - should serialize several tasks internally. """ class ExpressionBasedTask(DeploymentHook): def __init__(self, task, cluster): self.task = task self.cluster = cluster @property def _expression_context(self): return {'cluster': self.cluster, 'settings': self.cluster.attributes.editable} def should_execute(self): if 'condition' not in self.task: return True return Expression( self.task['condition'], self._expression_context).evaluate() class GenericNodeHook(ExpressionBasedTask): """Should be used for node serialization. """ hook_type = abc.abstractproperty def __init__(self, task, cluster, node): self.node = node super(GenericNodeHook, self).__init__(task, cluster) class PuppetHook(GenericNodeHook): hook_type = 'puppet' def serialize(self): yield templates.make_puppet_task([self.node['uid']], self.task) class StandartConfigRolesHook(ExpressionBasedTask): """Role hooks that serializes task based on config file only.""" def __init__(self, task, cluster, nodes): self.nodes = nodes super(StandartConfigRolesHook, self).__init__(task, cluster) def get_uids(self): return get_uids_for_roles(self.nodes, self.task['role']) def serialize(self): uids = self.get_uids() if uids: yield templates.make_generic_task(uids, self.task) class GenericRolesHook(StandartConfigRolesHook): identity = abc.abstractproperty class UploadMOSRepo(GenericRolesHook): identity = 'upload_core_repos' def get_uids(self): return get_uids_for_roles(self.nodes, consts.ALL_ROLES) def serialize(self): uids = self.get_uids() operating_system = self.cluster.release.operating_system repos = objects.Attributes.merged_attrs_values( self.cluster.attributes)['repo_setup']['repos'] if operating_system == consts.RELEASE_OS.centos: for repo in repos: yield templates.make_centos_repo_task(uids, repo) yield templates.make_yum_clean(uids) elif operating_system == consts.RELEASE_OS.ubuntu: # NOTE(ikalnitsky): # We have to clear /etc/apt/sources.list, because it # has a lot of invalid repos right after provisioning # and that lead us to deployment failures. yield templates.make_shell_task(uids, { 'parameters': { 'cmd': '> /etc/apt/sources.list', 'timeout': 10 }}) yield templates.make_ubuntu_apt_disable_ipv6(uids) # NOTE(kozhukalov): # This task is to allow installing packages from # unauthenticated repositories. yield templates.make_ubuntu_unauth_repos_task(uids) for repo in repos: yield templates.make_ubuntu_sources_task(uids, repo) if repo.get('priority'): # do not add preferences task to task list if we can't # complete it (e.g. can't retrieve or parse Release file) task = templates.make_ubuntu_preferences_task(uids, repo) if task is not None: yield task yield templates.make_apt_update_task(uids) class RsyncPuppet(GenericRolesHook): identity = 'rsync_core_puppet' def get_uids(self): return get_uids_for_roles(self.nodes, consts.ALL_ROLES) def serialize(self): src_path = self.task['parameters']['src'].format( MASTER_IP=settings.MASTER_IP, OPENSTACK_VERSION=self.cluster.release.version) uids = self.get_uids() yield templates.make_sync_scripts_task( uids, src_path, self.task['parameters']['dst']) class GenerateKeys(GenericRolesHook): identity = 'generate_keys' def serialize(self): uids = self.get_uids() self.task['parameters']['cmd'] = self.task['parameters']['cmd'].format( CLUSTER_ID=self.cluster.id) yield templates.make_shell_task(uids, self.task) class CopyKeys(GenericRolesHook): identity = 'copy_keys' def serialize(self): for file_path in self.task['parameters']['files']: file_path['src'] = file_path['src'].format( CLUSTER_ID=self.cluster.id) uids = self.get_uids() yield templates.make_generic_task( uids, self.task) class GenerateCephKeys(GenerateKeys): identity = 'generate_keys_ceph' class CopyCephKeys(CopyKeys): identity = 'copy_keys_ceph' class GenerateHaproxyKeys(GenericRolesHook): identity = 'generate_haproxy_keys' def serialize(self): uids = self.get_uids() self.task['parameters']['cmd'] = self.task['parameters']['cmd'].format( CLUSTER_ID=self.cluster.id, CN_HOSTNAME=self.cluster.attributes.editable ['public_ssl']['hostname']['value']) yield templates.make_shell_task(uids, self.task) class CopyHaproxyKeys(CopyKeys): identity = 'copy_haproxy_keys' class RestartRadosGW(GenericRolesHook): identity = 'restart_radosgw' def should_execute(self): for node in self.nodes: if 'ceph-osd' in node.all_roles: return True return False class CreateVMsOnCompute(GenericRolesHook): """Hook that uploads info about all nodes in cluster.""" identity = 'generate_vms' hook_type = 'puppet' def should_execute(self): return len(self.get_nodes()) > 0 def get_uids(self): return [node.uid for node in self.get_nodes()] def get_nodes(self): return objects.Cluster.get_nodes_to_spawn_vms(self.cluster) def serialize(self): uids = self.get_uids() yield templates.make_puppet_task(uids, self.task) class UploadNodesInfo(GenericRolesHook): """Hook that uploads info about all nodes in cluster.""" identity = 'upload_nodes_info' def serialize(self): q_nodes = objects.Cluster.get_nodes_not_for_deletion(self.cluster) # task can be executed only on deployed nodes nodes = set(q_nodes.filter_by(status=consts.NODE_STATUSES.ready)) # add nodes scheduled for deployment since they could be filtered out # above and task must be run also on them nodes.update(self.nodes) uids = [n.uid for n in nodes] # every node must have data about every other good node in cluster serialized_nodes = self._serialize_nodes(nodes) data = yaml.safe_dump({ 'nodes': serialized_nodes, }) path = self.task['parameters']['path'] yield templates.make_upload_task(uids, path=path, data=data) def _serialize_nodes(self, nodes): serializer = deployment_serializers.get_serializer_for_cluster( self.cluster) net_serializer = serializer.get_net_provider_serializer(self.cluster) serialized_nodes = serializer.node_list(nodes) serialized_nodes = net_serializer.update_nodes_net_info( self.cluster, serialized_nodes) return serialized_nodes class UpdateHosts(GenericRolesHook): """Updates hosts info on nodes in cluster.""" identity = 'update_hosts' def serialize(self): q_nodes = objects.Cluster.get_nodes_not_for_deletion(self.cluster) # task can be executed only on deployed nodes nodes = set(q_nodes.filter_by(status=consts.NODE_STATUSES.ready)) # add nodes scheduled for deployment since they could be filtered out # above and task must be run also on them nodes.update(self.nodes) uids = [n.uid for n in nodes] yield templates.make_puppet_task(uids, self.task) class TaskSerializers(object): """Class serves as fabric for different types of task serializers.""" stage_serializers = [UploadMOSRepo, RsyncPuppet, CopyKeys, RestartRadosGW, UploadNodesInfo, UpdateHosts, GenerateKeys, GenerateHaproxyKeys, CopyHaproxyKeys, GenerateCephKeys, CopyCephKeys] deploy_serializers = [PuppetHook, CreateVMsOnCompute] def __init__(self, stage_serializers=None, deploy_serializers=None): """Task serializers for stage (pre/post) are different from serializers used for main deployment. This should be considered as limitation of current architecture, and will be solved in next releases. :param stage_serializers: list of GenericRoleHook classes :param deploy_serializers: list of GenericNodeHook classes """ self._stage_serializers_map = {} self._deploy_serializers_map = {} if stage_serializers is None: stage_serializers = self.stage_serializers for serializer in stage_serializers: self.add_stage_serializer(serializer) if deploy_serializers is None: deploy_serializers = self.deploy_serializers for serializer in deploy_serializers: self.add_deploy_serializer(serializer) def add_stage_serializer(self, serializer): self._stage_serializers_map[serializer.identity] = serializer def add_deploy_serializer(self, serializer): if getattr(serializer, 'identity', None): self._deploy_serializers_map[serializer.identity] = serializer else: self._deploy_serializers_map[serializer.hook_type] = serializer def get_deploy_serializer(self, task): if 'type' not in task: raise errors.InvalidData('Task %s should have type', task) if task['id'] and task['id'] in self._deploy_serializers_map: return self._deploy_serializers_map[task['id']] elif task['type'] in self._deploy_serializers_map: return self._deploy_serializers_map[task['type']] else: # Currently we are not supporting anything except puppet as main # deployment engine, therefore exception should be raised, # but it should be verified by validation as well raise errors.SerializerNotSupported( 'Serialization of type {0} not supported. Task {1}'.format( task['type'], task)) def get_stage_serializer(self, task): if 'id' not in task: raise errors.InvalidData('Task %s should have id', task) if task['id'] in self._stage_serializers_map: return self._stage_serializers_map[task['id']] else: return StandartConfigRolesHook
import click import sys import time from solar.core import actions from solar.core import resource from solar.core import signals from solar.core import validation from solar.core.resource import virtual_resource as vr from solar import errors from solar import events as evapi from solar.interfaces.db import get_db PROFILE = False if PROFILE: import StringIO import cProfile import pstats pr = cProfile.Profile() GIT_PUPPET_LIBS_URL = 'https://github.com/CGenie/puppet-libs-resource' db = get_db() @click.group() def main(): pass def setup_resources(): db.clear() if PROFILE: pr.enable() node1, node2 = vr.create('nodes', 'templates/nodes.yaml', {}) # MARIADB mariadb_service1 = vr.create('mariadb_service1', 'resources/mariadb_service', { 'image': 'mariadb', 'port': 3306 })[0] signals.connect(node1, mariadb_service1) # RABBIT rabbitmq_service1 = vr.create('rabbitmq_service1', 'resources/rabbitmq_service/', { 'management_port': 15672, 'port': 5672, })[0] openstack_vhost = vr.create('openstack_vhost', 'resources/rabbitmq_vhost/', { 'vhost_name': 'openstack' })[0] openstack_rabbitmq_user = vr.create('openstack_rabbitmq_user', 'resources/rabbitmq_user/', { 'user_name': 'openstack', 'password': 'openstack_password' })[0] signals.connect(node1, rabbitmq_service1) signals.connect(rabbitmq_service1, openstack_vhost) signals.connect(rabbitmq_service1, openstack_rabbitmq_user) signals.connect(openstack_vhost, openstack_rabbitmq_user, { 'vhost_name', }) # KEYSTONE keystone_puppet = vr.create('keystone_puppet', 'resources/keystone_puppet', {})[0] evapi.add_dep(rabbitmq_service1.name, keystone_puppet.name, actions=('run', 'update')) keystone_db = vr.create('keystone_db', 'resources/mariadb_db/', { 'db_name': 'keystone_db', 'login_user': 'root' })[0] keystone_db_user = vr.create('keystone_db_user', 'resources/mariadb_user/', { 'user_name': 'keystone', 'user_password': 'keystone', })[0] keystone_service_endpoint = vr.create('keystone_service_endpoint', 'resources/keystone_service_endpoint', { 'endpoint_name': 'keystone', 'adminurl': 'http://{{admin_ip}}:{{admin_port}}/v2.0', 'internalurl': 'http://{{internal_ip}}:{{internal_port}}/v2.0', 'publicurl': 'http://{{public_ip}}:{{public_port}}/v2.0', 'description': 'OpenStack Identity Service', 'type': 'identity' })[0] admin_tenant = vr.create('admin_tenant', 'resources/keystone_tenant', { 'tenant_name': 'admin' })[0] admin_user = vr.create('admin_user', 'resources/keystone_user', { 'user_name': 'admin', 'user_password': 'admin' })[0] admin_role = vr.create('admin_role', 'resources/keystone_role', { 'role_name': 'admin' })[0] services_tenant = vr.create('services_tenant', 'resources/keystone_tenant', { 'tenant_name': 'services' })[0] admin_role_services = vr.create('admin_role_services', 'resources/keystone_role', { 'role_name': 'admin' })[0] signals.connect(node1, keystone_db) signals.connect(node1, keystone_db_user) signals.connect(node1, keystone_puppet) signals.connect(mariadb_service1, keystone_db, { 'port': 'login_port', 'root_user': 'login_user', 'root_password': 'login_password', 'ip' : 'db_host', }) signals.connect(keystone_db, keystone_db_user, { 'db_name', 'login_port', 'login_user', 'login_password', 'db_host' }) signals.connect(node1, keystone_service_endpoint) signals.connect(keystone_puppet, keystone_service_endpoint, { 'admin_token': 'admin_token', 'admin_port': ['admin_port', 'keystone_admin_port'], 'ip': ['keystone_host', 'admin_ip', 'internal_ip', 'public_ip'], 'port': ['internal_port', 'public_port'], }) signals.connect(keystone_puppet, admin_tenant) signals.connect(keystone_puppet, admin_tenant, { 'admin_port': 'keystone_port', 'ip': 'keystone_host' }) signals.connect(admin_tenant, admin_user) signals.connect(admin_user, admin_role) signals.connect(admin_user, admin_role_services) signals.connect(services_tenant, admin_role_services, { 'tenant_name' }) signals.connect(keystone_puppet, services_tenant) signals.connect(keystone_puppet, services_tenant, { 'admin_port': 'keystone_port', 'ip': 'keystone_host' }) signals.connect(keystone_db, keystone_puppet, { 'db_name', }) signals.connect(keystone_db_user, keystone_puppet, { 'user_name': 'db_user', 'user_password': 'db_password', 'db_host' : 'db_host' }) # OPENRC openrc = vr.create('openrc_file', 'resources/openrc_file', {})[0] signals.connect(node1, openrc) signals.connect(keystone_puppet, openrc, {'ip': 'keystone_host', 'admin_port':'keystone_port'}) signals.connect(admin_user, openrc, {'user_name': 'user_name','user_password':'password', 'tenant_name': 'tenant'}) # NEUTRON # Deploy chain neutron -> (plugins) -> neutron_server -> ( agents ) neutron_puppet = vr.create('neutron_puppet', 'resources/neutron_puppet', { 'core_plugin': 'neutron.plugins.ml2.plugin.Ml2Plugin' })[0] signals.connect(node1, neutron_puppet) signals.connect(rabbitmq_service1, neutron_puppet, { 'ip': 'rabbit_host', 'port': 'rabbit_port' }) signals.connect(openstack_rabbitmq_user, neutron_puppet, { 'user_name': 'rabbit_user', 'password': 'rabbit_password'}) signals.connect(openstack_vhost, neutron_puppet, { 'vhost_name': 'rabbit_virtual_host'}) # NEUTRON API (SERVER) neutron_server_puppet = vr.create('neutron_server_puppet', 'resources/neutron_server_puppet', { 'sync_db': True, })[0] neutron_db = vr.create('neutron_db', 'resources/mariadb_db/', { 'db_name': 'neutron_db', 'login_user': 'root'})[0] neutron_db_user = vr.create('neutron_db_user', 'resources/mariadb_user/', { 'user_name': 'neutron', 'user_password': 'neutron', 'login_user': 'root'})[0] neutron_keystone_user = vr.create('neutron_keystone_user', 'resources/keystone_user', { 'user_name': 'neutron', 'user_password': 'neutron' })[0] neutron_keystone_role = vr.create('neutron_keystone_role', 'resources/keystone_role', { 'role_name': 'admin' })[0] neutron_keystone_service_endpoint = vr.create('neutron_keystone_service_endpoint', 'resources/keystone_service_endpoint', { 'endpoint_name': 'neutron', 'adminurl': 'http://{{admin_ip}}:{{admin_port}}', 'internalurl': 'http://{{internal_ip}}:{{internal_port}}', 'publicurl': 'http://{{public_ip}}:{{public_port}}', 'description': 'OpenStack Network Service', 'type': 'network' })[0] signals.connect(node1, neutron_db) signals.connect(node1, neutron_db_user) signals.connect(mariadb_service1, neutron_db, { 'port': 'login_port', 'root_password': 'login_password', 'root_user': 'login_user', 'ip' : 'db_host'}) signals.connect(mariadb_service1, neutron_db_user, {'port': 'login_port', 'root_password': 'login_password'}) signals.connect(neutron_db, neutron_db_user, {'db_name', 'db_host'}) signals.connect(neutron_db_user, neutron_server_puppet, { 'user_name':'db_user', 'db_name':'db_name', 'user_password':'db_password', 'db_host' : 'db_host'}) signals.connect(node1, neutron_server_puppet) signals.connect(admin_user, neutron_server_puppet, { 'user_name': 'auth_user', 'user_password': 'auth_password', 'tenant_name': 'auth_tenant' }) signals.connect(keystone_puppet, neutron_server_puppet, { 'ip': 'auth_host', 'port': 'auth_port' }) signals.connect(services_tenant, neutron_keystone_user) signals.connect(neutron_keystone_user, neutron_keystone_role) signals.connect(keystone_puppet, neutron_keystone_service_endpoint, { 'ip': ['ip', 'keystone_host'], 'ssh_key': 'ssh_key', 'ssh_user': 'ssh_user', 'admin_port': 'keystone_admin_port', 'admin_token': 'admin_token', }) signals.connect(neutron_puppet, neutron_keystone_service_endpoint, { 'ip': ['admin_ip', 'internal_ip', 'public_ip'], 'bind_port': ['admin_port', 'internal_port', 'public_port'], }) # NEUTRON ML2 PLUGIN & ML2-OVS AGENT WITH GRE neutron_plugins_ml2 = vr.create('neutron_plugins_ml2', 'resources/neutron_plugins_ml2_puppet', {})[0] signals.connect(node1, neutron_plugins_ml2) neutron_agents_ml2 = vr.create('neutron_agents_ml2', 'resources/neutron_agents_ml2_ovs_puppet', { # TODO(bogdando) these should come from the node network resource 'enable_tunneling': True, 'tunnel_types': ['gre'], 'local_ip': '10.1.0.13' # should be the IP addr of the br-mesh int. })[0] signals.connect(node1, neutron_agents_ml2) # NEUTRON DHCP, L3, metadata agents neutron_agents_dhcp = vr.create('neutron_agents_dhcp', 'resources/neutron_agents_dhcp_puppet', {})[0] signals.connect(node1, neutron_agents_dhcp) neutron_agents_l3 = vr.create('neutron_agents_l3', 'resources/neutron_agents_l3_puppet', { # TODO(bogdando) these should come from the node network resource 'metadata_port': 8775, 'external_network_bridge': 'br-floating', })[0] signals.connect(node1, neutron_agents_l3) neutron_agents_metadata = vr.create('neutron_agents_metadata', 'resources/neutron_agents_metadata_puppet', { 'shared_secret': 'secret', })[0] signals.connect(node1, neutron_agents_metadata) signals.connect(neutron_server_puppet, neutron_agents_metadata, { 'auth_host', 'auth_port', 'auth_password', 'auth_tenant', 'auth_user', }) # NEUTRON FOR COMPUTE (node2) # Deploy chain neutron -> (plugins) -> ( agents ) neutron_puppet2 = vr.create('neutron_puppet2', 'resources/neutron_puppet', {})[0] signals.connect(node2, neutron_puppet2) signals.connect(neutron_puppet, neutron_puppet2, { 'rabbit_host', 'rabbit_port', 'rabbit_user', 'rabbit_password', 'rabbit_virtual_host', 'package_ensure', 'core_plugin', }) # NEUTRON OVS PLUGIN & AGENT WITH GRE FOR COMPUTE (node2) neutron_plugins_ml22 = vr.create('neutron_plugins_ml22', 'resources/neutron_plugins_ml2_puppet', {})[0] signals.connect(node2, neutron_plugins_ml22) neutron_agents_ml22 = vr.create('neutron_agents_ml22', 'resources/neutron_agents_ml2_ovs_puppet', { # TODO(bogdando) these should come from the node network resource 'enable_tunneling': True, 'tunnel_types': ['gre'], 'local_ip': '10.1.0.14' # Should be the IP addr of the br-mesh int. })[0] signals.connect(node2, neutron_agents_ml22) # CINDER cinder_puppet = vr.create('cinder_puppet', 'resources/cinder_puppet', {})[0] cinder_db = vr.create('cinder_db', 'resources/mariadb_db/', { 'db_name': 'cinder_db', 'login_user': 'root'})[0] cinder_db_user = vr.create('cinder_db_user', 'resources/mariadb_user/', { 'user_name': 'cinder', 'user_password': 'cinder', 'login_user': 'root'})[0] cinder_keystone_user = vr.create('cinder_keystone_user', 'resources/keystone_user', { 'user_name': 'cinder', 'user_password': 'cinder'})[0] cinder_keystone_role = vr.create('cinder_keystone_role', 'resources/keystone_role', { 'role_name': 'admin'})[0] cinder_keystone_service_endpoint = vr.create( 'cinder_keystone_service_endpoint', 'resources/keystone_service_endpoint', { 'endpoint_name': 'cinder', 'adminurl': 'http://{{admin_ip}}:{{admin_port}}/v2/%(tenant_id)s', 'internalurl': 'http://{{internal_ip}}:{{internal_port}}/v2/%(tenant_id)s', 'publicurl': 'http://{{public_ip}}:{{public_port}}/v2/%(tenant_id)s', 'description': 'OpenStack Block Storage Service', 'type': 'volumev2'})[0] signals.connect(node1, cinder_puppet) signals.connect(node1, cinder_db) signals.connect(node1, cinder_db_user) signals.connect(rabbitmq_service1, cinder_puppet, {'ip': 'rabbit_host', 'port': 'rabbit_port'}) signals.connect(admin_user, cinder_puppet, {'user_name': 'keystone_user', 'user_password': 'keystone_password', 'tenant_name': 'keystone_tenant'}) #? signals.connect(openstack_vhost, cinder_puppet, {'vhost_name': 'rabbit_virtual_host'}) signals.connect(openstack_rabbitmq_user, cinder_puppet, {'user_name': 'rabbit_userid', 'password': 'rabbit_password'}) signals.connect(mariadb_service1, cinder_db, { 'port': 'login_port', 'root_password': 'login_password', 'root_user': 'login_user', 'ip' : 'db_host'}) signals.connect(mariadb_service1, cinder_db_user, {'port': 'login_port', 'root_password': 'login_password'}) signals.connect(cinder_db, cinder_db_user, {'db_name', 'db_host'}) signals.connect(cinder_db_user, cinder_puppet, { 'user_name':'db_user', 'db_name':'db_name', 'user_password':'db_password', 'db_host' : 'db_host'}) signals.connect(keystone_puppet, cinder_puppet, {'ip': 'keystone_host', 'admin_port': 'keystone_port'}) #or non admin port? signals.connect(services_tenant, cinder_keystone_user) signals.connect(cinder_keystone_user, cinder_keystone_role) signals.connect(cinder_keystone_user, cinder_puppet, {'user_name': 'keystone_user', 'tenant_name': 'keystone_tenant', 'user_password': 'keystone_password'}) signals.connect(mariadb_service1, cinder_puppet, {'ip':'ip'}) signals.connect(cinder_puppet, cinder_keystone_service_endpoint, { 'ssh_key': 'ssh_key', 'ssh_user': 'ssh_user', 'ip': ['ip', 'keystone_host', 'admin_ip', 'internal_ip', 'public_ip'], 'port': ['admin_port', 'internal_port', 'public_port'],}) signals.connect(keystone_puppet, cinder_keystone_service_endpoint, { 'admin_port': 'keystone_admin_port', 'admin_token': 'admin_token'}) # CINDER GLANCE # Deploy chain: cinder_puppet -> cinder_glance -> ( cinder_api, cinder_scheduler, cinder_volume ) cinder_glance_puppet = vr.create('cinder_glance_puppet', 'resources/cinder_glance_puppet', {})[0] signals.connect(node1, cinder_glance_puppet) # CINDER API cinder_api_puppet = vr.create('cinder_api_puppet', 'resources/cinder_api_puppet', {})[0] signals.connect(node1, cinder_api_puppet) signals.connect(cinder_puppet, cinder_api_puppet, { 'keystone_password', 'keystone_tenant', 'keystone_user'}) signals.connect(cinder_puppet, cinder_api_puppet, { 'keystone_host': 'keystone_auth_host', 'keystone_port': 'keystone_auth_port'}) evapi.add_react(cinder_puppet.name, cinder_api_puppet.name, actions=('update',)) # CINDER SCHEDULER cinder_scheduler_puppet = vr.create('cinder_scheduler_puppet', 'resources/cinder_scheduler_puppet', {})[0] signals.connect(node1, cinder_scheduler_puppet) signals.connect(cinder_puppet, cinder_scheduler_puppet) evapi.add_react(cinder_puppet.name, cinder_scheduler_puppet.name, actions=('update',)) # CINDER VOLUME cinder_volume_puppet = vr.create('cinder_volume_puppet', 'resources/cinder_volume_puppet', {})[0] signals.connect(node1, cinder_volume_puppet) signals.connect(cinder_puppet, cinder_volume_puppet) evapi.add_react(cinder_puppet.name, cinder_volume_puppet.name, actions=('update',)) # NOVA nova_puppet = vr.create('nova_puppet', 'resources/nova_puppet', {})[0] nova_db = vr.create('nova_db', 'resources/mariadb_db/', { 'db_name': 'nova_db', 'login_user': 'root'})[0] nova_db_user = vr.create('nova_db_user', 'resources/mariadb_user/', { 'user_name': 'nova', 'user_password': 'nova', 'login_user': 'root'})[0] nova_keystone_user = vr.create('nova_keystone_user', 'resources/keystone_user', { 'user_name': 'nova', 'user_password': 'nova'})[0] nova_keystone_role = vr.create('nova_keystone_role', 'resources/keystone_role', { 'role_name': 'admin'})[0] nova_keystone_service_endpoint = vr.create('nova_keystone_service_endpoint', 'resources/keystone_service_endpoint', { 'endpoint_name': 'nova', 'adminurl': 'http://{{admin_ip}}:{{admin_port}}/v2/%(tenant_id)s', 'internalurl': 'http://{{internal_ip}}:{{internal_port}}/v2/%(tenant_id)s', 'publicurl': 'http://{{public_ip}}:{{public_port}}/v2/%(tenant_id)s', 'description': 'OpenStack Compute Service', 'type': 'compute'})[0] signals.connect(node1, nova_puppet) signals.connect(node1, nova_db) signals.connect(node1, nova_db_user) signals.connect(mariadb_service1, nova_db, { 'port': 'login_port', 'root_password': 'login_password', 'root_user': 'login_user', 'ip' : 'db_host'}) signals.connect(mariadb_service1, nova_db_user, { 'port': 'login_port', 'root_password': 'login_password'}) signals.connect(admin_user, nova_puppet, {'user_name': 'keystone_user', 'user_password': 'keystone_password', 'tenant_name': 'keystone_tenant'}) #? signals.connect(openstack_vhost, nova_puppet, {'vhost_name': 'rabbit_virtual_host'}) signals.connect(nova_db, nova_db_user, {'db_name', 'db_host'}) signals.connect(services_tenant, nova_keystone_user) signals.connect(nova_keystone_user, nova_keystone_role) signals.connect(keystone_puppet, nova_puppet, { 'ip': 'keystone_host', 'admin_port': 'keystone_port'}) signals.connect(nova_keystone_user, nova_puppet, { 'user_name': 'keystone_user', 'tenant_name': 'keystone_tenant', 'user_password': 'keystone_password'}) signals.connect(rabbitmq_service1, nova_puppet, { 'ip': 'rabbit_host', 'port': 'rabbit_port'}) signals.connect(openstack_rabbitmq_user, nova_puppet, { 'user_name': 'rabbit_userid', 'password': 'rabbit_password'}) signals.connect(keystone_puppet, nova_keystone_service_endpoint, { 'ip': 'keystone_host', 'admin_port': 'keystone_admin_port', 'admin_token': 'admin_token'}) signals.connect(mariadb_service1, nova_puppet, { 'ip':'db_host'}) signals.connect(nova_db_user, nova_puppet, { 'user_name':'db_user', 'db_name':'db_name', 'user_password':'db_password', 'db_host' : 'db_host'}) signals.connect(nova_puppet, nova_keystone_service_endpoint, { 'ip': ['ip', 'keystone_host', 'public_ip', 'internal_ip', 'admin_ip'], 'port': ['admin_port', 'internal_port', 'public_port'], 'ssh_key': 'ssh_key', 'ssh_user': 'ssh_user'}) # NOVA API nova_api_puppet = vr.create('nova_api_puppet', 'resources/nova_api_puppet', {})[0] signals.connect(node1, nova_api_puppet) signals.connect(nova_puppet, nova_api_puppet, { 'keystone_tenant': 'admin_tenant_name', 'keystone_user': 'admin_user', 'keystone_password': 'admin_password', 'keystone_host': 'auth_host', 'keystone_port': 'auth_port'}) signals.connect(nova_api_puppet, neutron_agents_metadata, {'ip': 'metadata_ip'}) # NOVA CONDUCTOR nova_conductor_puppet = vr.create('nova_conductor_puppet', 'resources/nova_conductor_puppet', {})[0] signals.connect(node1, nova_conductor_puppet) signals.connect(nova_puppet, nova_conductor_puppet) # NOVA SCHEDULER # NOTE(bogdando) Generic service is used. Package and service names for Ubuntu case # come from https://github.com/openstack/puppet-nova/blob/5.1.0/manifests/params.pp nova_scheduler_puppet = vr.create('nova_scheduler_puppet', 'resources/nova_generic_service_puppet', { 'title' : 'scheduler', 'package_name': 'nova-scheduler', 'service_name': 'nova-scheduler', })[0] signals.connect(node1, nova_scheduler_puppet) # NOVA COMPUTE # Deploy chain (nova, node_networking(TODO)) -> (nova_compute_libvirt, nova_neutron) -> nova_compute nova_compute_puppet = vr.create('nova_compute_puppet', 'resources/nova_compute_puppet', {})[0] # TODO (bogdando) figure out how to use it for multiple glance api servers nova_puppet2 = vr.create('nova_puppet2', 'resources/nova_puppet', { 'glance_api_servers': '{{glance_api_servers_host}}:{{glance_api_servers_port}}' })[0] signals.connect(nova_puppet, nova_puppet2, { 'ensure_package', 'rabbit_host', 'rabbit_password', 'rabbit_port', 'rabbit_userid', 'rabbit_virtual_host', 'db_user', 'db_password', 'db_name', 'db_host', 'keystone_password', 'keystone_port', 'keystone_host', 'keystone_tenant', 'keystone_user', }) # TODO(bogdando): Make a connection for nova_puppet2.glance_api_servers = "glance_api_puppet.ip:glance_api_puppet.bind_port" signals.connect(node2, nova_puppet2) signals.connect(node2, nova_compute_puppet) # NOVA COMPUTE LIBVIRT, NOVA_NEUTRON # NOTE(bogdando): changes nova config, so should notify nova compute service nova_compute_libvirt_puppet = vr.create('nova_compute_libvirt_puppet', 'resources/nova_compute_libvirt_puppet', {})[0] signals.connect(node2, nova_compute_libvirt_puppet) # compute configuration for neutron, use http auth/endpoint protocols, keystone v2 auth hardcoded for the resource nova_neutron_puppet = vr.create('nova_neutron_puppet', 'resources/nova_neutron_puppet', {})[0] signals.connect(node2, nova_neutron_puppet) signals.connect(neutron_server_puppet, nova_neutron_puppet, { 'auth_password': 'neutron_admin_password', 'auth_user': 'neutron_admin_username', 'auth_type': 'neutron_auth_strategy', 'auth_host': 'auth_host', 'auth_port': 'auth_port', 'auth_protocol': 'auth_protocol', }) signals.connect(neutron_keystone_service_endpoint, nova_neutron_puppet, { 'internal_ip':'neutron_endpoint_host', 'internal_port':'neutron_endpoint_port', }) # signals.connect(keystone_puppet, nova_network_puppet, {'ip': 'keystone_host', 'port': 'keystone_port'}) # signals.connect(keystone_puppet, nova_keystone_service_endpoint, {'ip': 'keystone_host', 'admin_port': 'keystone_port', 'admin_token': 'admin_token'}) # signals.connect(rabbitmq_service1, nova_network_puppet, {'ip': 'rabbitmq_host', 'port': 'rabbitmq_port'}) # GLANCE (base and API) glance_api_puppet = vr.create('glance_api_puppet', 'resources/glance_puppet', {})[0] glance_db_user = vr.create('glance_db_user', 'resources/mariadb_user/', { 'user_name': 'glance', 'user_password': 'glance', 'login_user': 'root'})[0] glance_db = vr.create('glance_db', 'resources/mariadb_db/', { 'db_name': 'glance', 'login_user': 'root'})[0] glance_keystone_user = vr.create('glance_keystone_user', 'resources/keystone_user', { 'user_name': 'glance', 'user_password': 'glance123'})[0] glance_keystone_role = vr.create('glance_keystone_role', 'resources/keystone_role', { 'role_name': 'admin'})[0] glance_keystone_service_endpoint = vr.create( 'glance_keystone_service_endpoint', 'resources/keystone_service_endpoint', { 'endpoint_name': 'glance', 'adminurl': 'http://{{admin_ip}}:{{admin_port}}', 'internalurl': 'http://{{internal_ip}}:{{internal_port}}', 'publicurl': 'http://{{public_ip}}:{{public_port}}', 'description': 'OpenStack Image Service', 'type': 'image'})[0] signals.connect(node1, glance_api_puppet) signals.connect(node1, glance_db) signals.connect(node1, glance_db_user) signals.connect(admin_user, glance_api_puppet, { 'user_name': 'keystone_user', 'user_password': 'keystone_password', 'tenant_name': 'keystone_tenant'}) #? signals.connect(mariadb_service1, glance_db, { 'port': 'login_port', 'root_password': 'login_password', 'root_user': 'login_user', 'ip' : 'db_host'}) signals.connect(mariadb_service1, glance_db_user, {'port': 'login_port', 'root_password': 'login_password'}) signals.connect(glance_db, glance_db_user, {'db_name', 'db_host'}) signals.connect(glance_db_user, glance_api_puppet, { 'user_name':'db_user', 'db_name':'db_name', 'user_password':'db_password', 'db_host' : 'db_host'}) signals.connect(keystone_puppet, glance_api_puppet, {'ip': 'keystone_host', 'admin_port': 'keystone_port'}) #or non admin port? signals.connect(services_tenant, glance_keystone_user) signals.connect(glance_keystone_user, glance_keystone_role) signals.connect(glance_keystone_user, glance_api_puppet, { 'user_name': 'keystone_user', 'tenant_name': 'keystone_tenant', 'user_password': 'keystone_password'}) signals.connect(mariadb_service1, glance_api_puppet, {'ip':'ip'}) signals.connect(glance_api_puppet, glance_keystone_service_endpoint, { 'ssh_key': 'ssh_key', 'ssh_user': 'ssh_user', 'ip': ['ip', 'keystone_host', 'admin_ip', 'internal_ip', 'public_ip'], 'bind_port': ['admin_port', 'internal_port', 'public_port'],}) signals.connect(keystone_puppet, glance_keystone_service_endpoint, { 'admin_port': 'keystone_admin_port', 'admin_token': 'admin_token'}) # GLANCE REGISTRY glance_registry_puppet = vr.create('glance_registry_puppet', 'resources/glance_registry_puppet', {})[0] signals.connect(node1, glance_registry_puppet) signals.connect(glance_api_puppet, glance_registry_puppet) # API and registry should not listen same ports # should not use the same log destination and a pipeline, # so disconnect them and restore the defaults signals.disconnect_receiver_by_input(glance_registry_puppet, 'bind_port') signals.disconnect_receiver_by_input(glance_registry_puppet, 'log_file') signals.disconnect_receiver_by_input(glance_registry_puppet, 'pipeline') glance_registry_puppet.update({ 'bind_port': 9191, 'log_file': '/var/log/glance/registry.log', 'pipeline': 'keystone', }) # Update glance_api_service for cinder signals.connect(glance_api_puppet, cinder_glance_puppet, { 'ip': 'glance_api_servers_host', 'bind_port': 'glance_api_servers_port' }) # Update glance_api_service for nova compute signals.connect(glance_api_puppet, nova_puppet2, { 'ip': 'glance_api_servers_host', 'bind_port': 'glance_api_servers_port' }) if PROFILE: pr.disable() s = StringIO.StringIO() sortby = 'cumulative' ps = pstats.Stats(pr, stream=s).sort_stats(sortby) ps.print_stats() print s.getvalue() sys.exit(0) has_errors = False for r in locals().values(): if not isinstance(r, resource.Resource): continue print 'Validating {}'.format(r.name) errors = validation.validate_resource(r) if errors: has_errors = True print 'ERROR: %s: %s' % (r.name, errors) if has_errors: sys.exit(1) resources_to_run = [ 'rabbitmq_service1', 'openstack_vhost', 'openstack_rabbitmq_user', 'mariadb_service1', 'keystone_db', 'keystone_db_user', 'keystone_puppet', 'openrc_file', 'admin_tenant', 'admin_user', 'admin_role', 'keystone_service_endpoint', 'services_tenant', 'neutron_db', 'neutron_db_user', 'neutron_keystone_user', 'neutron_keystone_role', 'neutron_puppet', 'neutron_keystone_service_endpoint', 'neutron_plugins_ml2', 'neutron_server_puppet', 'neutron_agents_ml2', 'neutron_agents_dhcp', 'neutron_agents_l3', 'neutron_agents_metadata', 'cinder_db', 'cinder_db_user', 'cinder_keystone_user', 'cinder_keystone_role', 'cinder_puppet', 'cinder_keystone_service_endpoint', 'cinder_glance_puppet', 'cinder_api_puppet', 'cinder_scheduler_puppet', 'cinder_volume_puppet', 'nova_db', 'nova_db_user', 'nova_keystone_user', 'nova_keystone_role', 'nova_puppet', 'nova_keystone_service_endpoint', 'nova_api_puppet', 'nova_conductor_puppet', 'nova_scheduler_puppet', 'glance_db', 'glance_db_user', 'glance_keystone_user', 'glance_keystone_role', 'glance_keystone_service_endpoint', 'glance_api_puppet', 'glance_registry_puppet', 'nova_puppet2', 'nova_compute_libvirt_puppet', 'nova_neutron_puppet', 'nova_compute_puppet', 'neutron_puppet2', 'neutron_plugins_ml22', 'neutron_agents_ml22', ] @click.command() def deploy(): setup_resources() # run resources = resource.load_all() resources = {r.name: r for r in resources} for name in resources_to_run: try: actions.resource_action(resources[name], 'run') except errors.SolarError as e: print 'WARNING: %s' % str(e) raise time.sleep(10) @click.command() def undeploy(): resources = resource.load_all() resources = {r.name: r for r in resources} for name in reversed(resources_to_run): try: actions.resource_action(resources[name], 'remove') except errors.SolarError as e: print 'WARNING: %s' % str(e) db.clear() main.add_command(deploy) main.add_command(undeploy) if __name__ == '__main__': main()
from __future__ import annotations from typing import * import asyncio import contextlib import datetime import logging import os import os.path import pathlib import resource import signal import socket import sys import tempfile import uuid import uvloop import click import setproctitle from . import logsetup logsetup.early_setup() from edb import buildmeta from edb.common import exceptions from edb.common import devmode from edb.common import signalctl from . import args as srvargs from . import daemon from . import defines from . import pgconnparams from . import pgcluster if TYPE_CHECKING: from . import server else: # Import server lazily to make sure that most of imports happen # under coverage (if we're testing with it). Otherwise # coverage will fail to detect that "import edb..." lines # actually were run. server = None logger = logging.getLogger('edb.server') _server_initialized = False def abort(msg, *args, exit_code=1) -> NoReturn: logger.critical(msg, *args) sys.exit(exit_code) @contextlib.contextmanager def _ensure_runstate_dir( default_runstate_dir: Optional[pathlib.Path], specified_runstate_dir: Optional[pathlib.Path] ) -> Iterator[pathlib.Path]: temp_runstate_dir = None if specified_runstate_dir is None: if default_runstate_dir is None: temp_runstate_dir = tempfile.TemporaryDirectory(prefix='edbrun-') runstate_parent = pathlib.Path(temp_runstate_dir.name) else: runstate_parent = default_runstate_dir try: runstate_dir = buildmeta.get_runstate_path(runstate_parent) except buildmeta.MetadataError: abort( f'cannot determine the runstate directory location; ' f'please use --runstate-dir to specify the correct location') else: runstate_dir = specified_runstate_dir runstate_dir = pathlib.Path(runstate_dir) if not runstate_dir.exists(): if not runstate_dir.parent.exists(): abort( f'cannot create the runstate directory: ' f'{str(runstate_dir.parent)!r} does not exist; please use ' f'--runstate-dir to specify the correct location') try: runstate_dir.mkdir() except PermissionError as ex: abort( f'cannot create the runstate directory: ' f'{ex!s}; please use --runstate-dir to specify ' f'the correct location') if not os.path.isdir(runstate_dir): abort(f'{str(runstate_dir)!r} is not a directory; please use ' f'--runstate-dir to specify the correct location') try: yield runstate_dir finally: if temp_runstate_dir is not None: temp_runstate_dir.cleanup() @contextlib.contextmanager def _internal_state_dir(runstate_dir): try: with tempfile.TemporaryDirectory(prefix="", dir=runstate_dir) as td: yield td except PermissionError as ex: abort(f'cannot write to the runstate directory: ' f'{ex!s}; please fix the permissions or use ' f'--runstate-dir to specify the correct location') async def _init_cluster(cluster, args: srvargs.ServerConfig) -> bool: from edb.server import bootstrap need_restart = await bootstrap.ensure_bootstrapped(cluster, args) global _server_initialized _server_initialized = True return need_restart def _sd_notify(message): notify_socket = os.environ.get('NOTIFY_SOCKET') if not notify_socket: return if notify_socket[0] == '@': notify_socket = '\0' + notify_socket[1:] sd_sock = socket.socket(socket.AF_UNIX, socket.SOCK_DGRAM) try: sd_sock.connect(notify_socket) sd_sock.sendall(message.encode()) except Exception as e: logger.info('Could not send systemd notification: %s', e) finally: sd_sock.close() def _init_parsers(): # Initialize all parsers, rebuilding grammars if # necessary. Do it earlier than later so that we don't # end up in a situation where all our compiler processes # are building parsers in parallel. from edb.edgeql import parser as ql_parser ql_parser.preload(allow_rebuild=devmode.is_in_dev_mode(), paralellize=True) async def _run_server( cluster, args: srvargs.ServerConfig, runstate_dir, internal_runstate_dir, *, do_setproctitle: bool, new_instance: bool, ): with signalctl.SignalController(signal.SIGINT, signal.SIGTERM) as sc: ss = server.Server( cluster=cluster, runstate_dir=runstate_dir, internal_runstate_dir=internal_runstate_dir, max_backend_connections=args.max_backend_connections, compiler_pool_size=args.compiler_pool_size, compiler_pool_mode=args.compiler_pool_mode, nethosts=args.bind_addresses, netport=args.port, auto_shutdown_after=args.auto_shutdown_after, echo_runtime_info=args.echo_runtime_info, status_sinks=args.status_sinks, startup_script=args.startup_script, binary_endpoint_security=args.binary_endpoint_security, http_endpoint_security=args.http_endpoint_security, backend_adaptive_ha=args.backend_adaptive_ha, default_auth_method=args.default_auth_method, testmode=args.testmode, new_instance=new_instance, ) await sc.wait_for(ss.init()) tls_cert_newly_generated = False if args.tls_cert_mode is srvargs.ServerTlsCertMode.SelfSigned: assert args.tls_cert_file is not None if not args.tls_cert_file.exists(): assert args.tls_key_file is not None _generate_cert( args.tls_cert_file, args.tls_key_file, ss.get_listen_hosts(), ) tls_cert_newly_generated = True ss.init_tls( args.tls_cert_file, args.tls_key_file, tls_cert_newly_generated) if args.bootstrap_only: if args.startup_script and new_instance: await sc.wait_for(ss.run_startup_script_and_exit()) return try: await sc.wait_for(ss.start()) if do_setproctitle: setproctitle.setproctitle( f"edgedb-server-{ss.get_listen_port()}" ) # Notify systemd that we've started up. _sd_notify('READY=1') try: await sc.wait_for(ss.serve_forever()) except signalctl.SignalError as e: logger.info('Received signal: %s.', e.signo) finally: _sd_notify('STOPPING=1') logger.info('Shutting down.') await sc.wait_for(ss.stop()) def _generate_cert( tls_cert_file: pathlib.Path, tls_key_file: pathlib.Path, listen_hosts: Iterable[str] ) -> None: logger.info(f'generating self-signed TLS certificate in "{tls_cert_file}"') from cryptography import x509 from cryptography.hazmat import backends from cryptography.hazmat.primitives import hashes from cryptography.hazmat.primitives import serialization from cryptography.hazmat.primitives.asymmetric import rsa from cryptography.x509 import oid backend = backends.default_backend() private_key = rsa.generate_private_key( public_exponent=65537, key_size=2048, backend=backend ) subject = x509.Name( [x509.NameAttribute(oid.NameOID.COMMON_NAME, "EdgeDB Server")] ) certificate = ( x509.CertificateBuilder() .subject_name(subject) .public_key(private_key.public_key()) .serial_number(int(uuid.uuid4())) .issuer_name(subject) .not_valid_before( datetime.datetime.today() - datetime.timedelta(days=1) ) .not_valid_after( datetime.datetime.today() + datetime.timedelta(weeks=1000) ) .add_extension( x509.SubjectAlternativeName( [ x509.DNSName(name) for name in listen_hosts if name not in {'0.0.0.0', '::'} ] ), critical=False, ) .sign( private_key=private_key, algorithm=hashes.SHA256(), backend=backend, ) ) with tls_cert_file.open("wb") as f: f.write(certificate.public_bytes(encoding=serialization.Encoding.PEM)) tls_cert_file.chmod(0o644) with tls_key_file.open("wb") as f: f.write( private_key.private_bytes( encoding=serialization.Encoding.PEM, format=serialization.PrivateFormat.TraditionalOpenSSL, encryption_algorithm=serialization.NoEncryption(), ) ) tls_key_file.chmod(0o600) async def _get_local_pgcluster( args: srvargs.ServerConfig, runstate_dir: pathlib.Path, tenant_id: str, ) -> Tuple[pgcluster.Cluster, srvargs.ServerConfig]: pg_max_connections = args.max_backend_connections if not pg_max_connections: max_conns = srvargs.compute_default_max_backend_connections() pg_max_connections = max_conns if args.testmode: max_conns = srvargs.adjust_testmode_max_connections(max_conns) logger.info(f'Configuring Postgres max_connections=' f'{pg_max_connections} under test mode.') args = args._replace(max_backend_connections=max_conns) logger.info(f'Using {max_conns} max backend connections based on ' f'total memory.') cluster = await pgcluster.get_local_pg_cluster( args.data_dir, runstate_dir=runstate_dir, # Plus two below to account for system connections. max_connections=pg_max_connections + 2, tenant_id=tenant_id, log_level=args.log_level, ) cluster.set_connection_params( pgconnparams.ConnectionParameters( user='postgres', database='template1', ), ) return cluster, args async def _get_remote_pgcluster( args: srvargs.ServerConfig, tenant_id: str, ) -> Tuple[pgcluster.RemoteCluster, srvargs.ServerConfig]: cluster = await pgcluster.get_remote_pg_cluster( args.backend_dsn, tenant_id=tenant_id, ) instance_params = cluster.get_runtime_params().instance_params max_conns = ( instance_params.max_connections - instance_params.reserved_connections) if not args.max_backend_connections: logger.info(f'Detected {max_conns} backend connections available.') if args.testmode: max_conns = srvargs.adjust_testmode_max_connections(max_conns) logger.info(f'Using max_backend_connections={max_conns} ' f'under test mode.') args = args._replace(max_backend_connections=max_conns) elif args.max_backend_connections > max_conns: abort(f'--max-backend-connections is too large for this backend; ' f'detected maximum available NUM: {max_conns}') return cluster, args async def run_server( args: srvargs.ServerConfig, *, do_setproctitle: bool=False, ) -> None: from . import server as server_mod global server server = server_mod ver_meta = buildmeta.get_version_metadata() extras = [] source = "" if build_date := ver_meta["build_date"]: nice_date = build_date.strftime("%Y-%m-%dT%H:%MZ") source += f" on {nice_date}" if ver_meta["scm_revision"]: source += f" from revision {ver_meta['scm_revision']}" if source_date := ver_meta["source_date"]: nice_date = source_date.strftime("%Y-%m-%dT%H:%MZ") source += f" ({nice_date})" if source: extras.append(f", built{source}") if ver_meta["target"]: extras.append(f"for {ver_meta['target']}") ver_line = buildmeta.get_version_string() + " ".join(extras) logger.info(f"starting EdgeDB server {ver_line}") if args.instance_name: logger.info(f'instance name: {args.instance_name!r}') if devmode.is_in_dev_mode(): logger.info(f'development mode active') logger.debug( f"defaulting to the '{args.default_auth_method}' authentication method" ) _init_parsers() pg_cluster_init_by_us = False pg_cluster_started_by_us = False if args.tenant_id is None: tenant_id = buildmeta.get_default_tenant_id() else: tenant_id = f'C{args.tenant_id}' cluster: Union[pgcluster.Cluster, pgcluster.RemoteCluster] default_runstate_dir: Optional[pathlib.Path] if args.data_dir: default_runstate_dir = args.data_dir else: default_runstate_dir = None specified_runstate_dir: Optional[pathlib.Path] if args.runstate_dir: specified_runstate_dir = args.runstate_dir elif args.bootstrap_only: # When bootstrapping a new EdgeDB instance it is often necessary # to avoid using the main runstate dir due to lack of permissions, # possibility of conflict with another running instance, etc. # The --bootstrap mode is also often runs unattended, i.e. # as a post-install hook during package installation. specified_runstate_dir = default_runstate_dir else: specified_runstate_dir = None runstate_dir_mgr = _ensure_runstate_dir( default_runstate_dir, specified_runstate_dir, ) with runstate_dir_mgr as runstate_dir: runstate_dir_str = str(runstate_dir) runstate_dir_str_len = len( runstate_dir_str.encode( sys.getfilesystemencoding(), errors=sys.getfilesystemencodeerrors(), ), ) if runstate_dir_str_len > defines.MAX_RUNSTATE_DIR_PATH: abort( f'the length of the specified path for server run state ' f'exceeds the maximum of {defines.MAX_RUNSTATE_DIR_PATH} ' f'bytes: {runstate_dir_str!r} ({runstate_dir_str_len} bytes)', exit_code=11, ) try: if args.data_dir: cluster, args = await _get_local_pgcluster( args, runstate_dir, tenant_id) elif args.backend_dsn: cluster, args = await _get_remote_pgcluster(args, tenant_id) else: # This should have been checked by main() already, # but be extra careful. abort('neither the data directory nor the remote Postgres DSN ' 'have been specified') except pgcluster.ClusterError as e: abort(str(e)) try: pg_cluster_init_by_us = await cluster.ensure_initialized() cluster_status = await cluster.get_status() if cluster_status == 'stopped': await cluster.start() pg_cluster_started_by_us = True elif cluster_status != 'running': abort('Could not start database cluster in %s', args.data_dir) need_cluster_restart = await _init_cluster(cluster, args) if need_cluster_restart and pg_cluster_started_by_us: logger.info('Restarting server to reload configuration...') await cluster.stop() await cluster.start() if ( not args.bootstrap_only or args.bootstrap_script or args.bootstrap_command or ( args.tls_cert_mode is srvargs.ServerTlsCertMode.SelfSigned ) ): if args.data_dir: cluster.set_connection_params( pgconnparams.ConnectionParameters( user='postgres', database=pgcluster.get_database_backend_name( defines.EDGEDB_TEMPLATE_DB, tenant_id=tenant_id, ), ), ) with _internal_state_dir(runstate_dir) as int_runstate_dir: if ( args.tls_cert_file and '<runstate>' in str(args.tls_cert_file) ): args = args._replace( tls_cert_file=pathlib.Path( str(args.tls_cert_file).replace( '<runstate>', int_runstate_dir) ), tls_key_file=pathlib.Path( str(args.tls_key_file).replace( '<runstate>', int_runstate_dir) ) ) await _run_server( cluster, args, runstate_dir, int_runstate_dir, do_setproctitle=do_setproctitle, new_instance=need_cluster_restart, ) except server.StartupError as e: abort(str(e)) except BaseException: if pg_cluster_init_by_us and not _server_initialized: logger.warning( 'server bootstrap did not complete successfully, ' 'removing the data directory') if await cluster.get_status() == 'running': await cluster.stop() cluster.destroy() raise finally: if args.temp_dir: if await cluster.get_status() == 'running': await cluster.stop() cluster.destroy() elif pg_cluster_started_by_us: if await cluster.get_status() == 'running': await cluster.stop() def bump_rlimit_nofile() -> None: try: fno_soft, fno_hard = resource.getrlimit(resource.RLIMIT_NOFILE) except resource.error: logger.warning('could not read RLIMIT_NOFILE') else: if fno_soft < defines.EDGEDB_MIN_RLIMIT_NOFILE: try: resource.setrlimit( resource.RLIMIT_NOFILE, (min(defines.EDGEDB_MIN_RLIMIT_NOFILE, fno_hard), fno_hard)) except resource.error: logger.warning('could not set RLIMIT_NOFILE') def server_main(**kwargs): logsetup.setup_logging(kwargs['log_level'], kwargs['log_to']) exceptions.install_excepthook() bump_rlimit_nofile() asyncio.set_event_loop_policy(uvloop.EventLoopPolicy()) if kwargs['devmode'] is not None: devmode.enable_dev_mode(kwargs['devmode']) try: server_args = srvargs.parse_args(**kwargs) except srvargs.InvalidUsageError as e: abort(e.args[0], exit_code=e.args[1]) if kwargs['background']: daemon_opts = {'detach_process': True} pidfile = kwargs['pidfile_dir'] / f".s.EDGEDB.{kwargs['port']}.lock" daemon_opts['pidfile'] = pidfile if kwargs['daemon_user']: daemon_opts['uid'] = kwargs['daemon_user'] if kwargs['daemon_group']: daemon_opts['gid'] = kwargs['daemon_group'] with daemon.DaemonContext(**daemon_opts): asyncio.run(run_server(server_args, setproctitle=True)) else: with devmode.CoverageConfig.enable_coverage_if_requested(): asyncio.run(run_server(server_args)) @click.command( 'EdgeDB Server', context_settings=dict(help_option_names=['-h', '--help'])) @srvargs.server_options def main(version=False, **kwargs): if kwargs.get('testmode') and 'EDGEDB_TEST_CATALOG_VERSION' in os.environ: buildmeta.EDGEDB_CATALOG_VERSION = int( os.environ['EDGEDB_TEST_CATALOG_VERSION'] ) if version: print(f"edgedb-server, version {buildmeta.get_version()}") sys.exit(0) server_main(**kwargs) def main_dev(): devmode.enable_dev_mode() main() if __name__ == '__main__': main()
_HTML_TYPES = { 'a': 'HTMLAnchorElement', 'abbr': 'HTMLUnknownElement', 'acronym': 'HTMLUnknownElement', 'address': 'HTMLUnknownElement', 'applet': 'HTMLUnknownElement', 'area': 'HTMLAreaElement', 'article': 'HTMLUnknownElement', 'aside': 'HTMLUnknownElement', 'audio': 'HTMLAudioElement', 'b': 'HTMLUnknownElement', 'base': 'HTMLBaseElement', 'basefont': 'HTMLUnknownElement', 'bdi': 'HTMLUnknownElement', 'bdo': 'HTMLUnknownElement', 'bgsound': 'HTMLUnknownElement', 'big': 'HTMLUnknownElement', 'blockquote': 'HTMLUnknownElement', 'br': 'HTMLBRElement', 'button': 'HTMLButtonElement', 'canvas': 'HTMLCanvasElement', 'caption': 'HTMLTableCaptionElement', 'center': 'HTMLUnknownElement', 'cite': 'HTMLUnknownElement', 'code': 'HTMLUnknownElement', 'col': 'HTMLTableColElement', 'colgroup': 'HTMLUnknownElement', 'command': 'HTMLUnknownElement', 'content': 'HTMLContentElement', 'data': 'HTMLDataElement', 'datalist': 'HTMLDataListElement', 'dd': 'HTMLUnknownElement', 'del': 'HTMLModElement', 'details': 'HTMLDetailsElement', 'dfn': 'HTMLUnknownElement', 'dialog': 'HTMLDialogElement', 'dir': 'HTMLDirectoryElement', 'div': 'HTMLDivElement', 'dl': 'HTMLDListElement', 'dt': 'HTMLUnknownElement', 'em': 'HTMLUnknownElement', 'embed': 'HTMLEmbedElement', 'fieldset': 'HTMLFieldSetElement', 'figcaption': 'HTMLUnknownElement', 'figure': 'HTMLUnknownElement', 'font': 'HTMLFontElement', 'footer': 'HTMLUnknownElement', 'form': 'HTMLFormElement', 'frame': 'HTMLFrameElement', 'frameset': 'HTMLFrameSetElement', 'h1': 'HTMLHeadingElement', 'h2': 'HTMLHeadingElement', 'h3': 'HTMLHeadingElement', 'h4': 'HTMLHeadingElement', 'h5': 'HTMLHeadingElement', 'h6': 'HTMLHeadingElement', 'header': 'HTMLUnknownElement', 'hgroup': 'HTMLUnknownElement', 'hr': 'HTMLHRElement', 'i': 'HTMLUnknownElement', 'iframe': 'HTMLIFrameElement', 'image': 'HTMLImageElement', 'img': 'HTMLImageElement', 'input': 'HTMLInputElement', 'ins': 'HTMLModElement', 'isindex': 'HTMLUnknownElement', 'kbd': 'HTMLUnknownElement', 'keygen': 'HTMLKeygenElement', 'label': 'HTMLLabelElement', 'layer': 'HTMLUnknownElement', 'legend': 'HTMLLegendElement', 'li': 'HTMLLIElement', 'link': 'HTMLLinkElement', 'listing': 'HTMLUnknownElement', 'main': 'HTMLUnknownElement', 'map': 'HTMLMapElement', 'mark': 'HTMLUnknownElement', 'marquee': 'HTMLMarqueeElement', 'menu': 'HTMLMenuElement', 'menuitem': 'HTMLMenuItemElement', 'meta': 'HTMLMetaElement', 'meter': 'HTMLMeterElement', 'nav': 'HTMLUnknownElement', 'nobr': 'HTMLUnknownElement', 'noembed': 'HTMLUnknownElement', 'noframes': 'HTMLUnknownElement', 'nolayer': 'HTMLUnknownElement', 'noscript': 'HTMLUnknownElement', 'object': 'HTMLObjectElement', 'ol': 'HTMLOListElement', 'optgroup': 'HTMLOptGroupElement', 'option': 'HTMLOptionElement', 'output': 'HTMLOutputElement', 'p': 'HTMLParagraphElement', 'param': 'HTMLParamElement', 'picture': 'HTMLPictureElement', 'plaintext': 'HTMLUnknownElement', 'pre': 'HTMLPreElement', 'progress': 'HTMLProgressElement', 'q': 'HTMLQuoteElement', 'rp': 'HTMLUnknownElement', 'rt': 'HTMLUnknownElement', 'ruby': 'HTMLUnknownElement', 's': 'HTMLUnknownElement', 'samp': 'HTMLUnknownElement', 'section': 'HTMLUnknownElement', 'select': 'HTMLSelectElement', 'shadow': 'HTMLShadowElement', 'small': 'HTMLUnknownElement', 'source': 'HTMLSourceElement', 'span': 'HTMLSpanElement', 'strike': 'HTMLUnknownElement', 'strong': 'HTMLUnknownElement', 'style': 'HTMLStyleElement', 'sub': 'HTMLUnknownElement', 'summary': 'HTMLUnknownElement', 'sup': 'HTMLUnknownElement', 'table': 'HTMLTableElement', 'tbody': 'HTMLTableSectionElement', 'td': 'HTMLUnknownElement', 'template': 'HTMLTemplateElement', 'textarea': 'HTMLTextAreaElement', 'tfoot': 'HTMLTableSectionElement', 'th': 'HTMLTableCellElement', 'thead': 'HTMLTableSectionElement', 'time': 'HTMLTimeElement', 'title': 'HTMLTitleElement', 'tr': 'HTMLTableRowElement', 'track': 'HTMLTrackElement', 'tt': 'HTMLUnknownElement', 'u': 'HTMLUnknownElement', 'ul': 'HTMLUListElement', 'var': 'HTMLUnknownElement', 'video': 'HTMLVideoElement', 'wbr': 'HTMLUnknownElement', 'xmp': 'HTMLUnknownElement' }
import sh from claw import configuration from claw import tests class StatusTest(tests.BaseTestWithInit): def test_basic(self): test_version = 'TEST_VERSION' port = self.server({'version': lambda: {'version': test_version}}) self.claw.generate(tests.STUB_CONFIGURATION) conf = configuration.Configuration(tests.STUB_CONFIGURATION) with conf.patch.handler_configuration as patch: patch.set_value('manager_ip', 'localhost') patch.set_value('manager_port', port) output = self.claw.status(tests.STUB_CONFIGURATION).stdout self.assertIn(test_version, output) def test_no_configuration(self): with self.assertRaises(sh.ErrorReturnCode) as c: self.claw.status(tests.STUB_CONFIGURATION) self.assertIn('Not initialized', c.exception.stderr) def test_no_manager_ip(self): self.claw.generate(tests.STUB_CONFIGURATION) with self.assertRaises(sh.ErrorReturnCode) as c: self.claw.status(tests.STUB_CONFIGURATION) self.assertIn('Configuration not bootstrapped', c.exception.stderr) def test_no_connectivity_to_manager(self): self.claw.generate(tests.STUB_CONFIGURATION) conf = configuration.Configuration(tests.STUB_CONFIGURATION) ip = '127.0.0.1' with conf.patch.handler_configuration as patch: patch.set_value('manager_ip', ip) with self.assertRaises(sh.ErrorReturnCode) as c: self.claw.status(tests.STUB_CONFIGURATION) self.assertIn('Not reachable', c.exception.stderr) self.assertIn(ip, c.exception.stderr)
rightPort = "COM9" if ('virtual' in globals() and virtual): virtualArduinoRight = Runtime.start("virtualArduinoRight", "VirtualArduino") virtualArduinoRight.connect(rightPort) Voice="cmu-bdl-hsmm" #Male US voice mouth = Runtime.start("i01.mouth", "MarySpeech") mouth.setVoice(Voice) i01 = Runtime.create("i01", "InMoov") right = Runtime.createAndStart("i01.right", "Arduino") right.connect(rightPort) i01.startEar() webgui = Runtime.create("WebGui","WebGui") webgui.autoStartBrowser(False) webgui.startService() webgui.startBrowser("http://localhost:8888/#/service/i01.ear") i01.startMouth() rightHand = Runtime.create("i01.rightHand","InMoovHand") rightHand.thumb.setVelocity(-1) rightHand.index.setVelocity(-1) rightHand.majeure.setVelocity(-1) rightHand.ringFinger.setVelocity(-1) rightHand.pinky.setVelocity(-1) rightHand.wrist.setVelocity(-1) rightHand.thumb.map(0,180,64,135) rightHand.index.map(0,180,42,160) rightHand.majeure.map(0,180,35,165) rightHand.ringFinger.map(0,180,40,140) rightHand.pinky.map(0,180,45,130) rightHand.wrist.map(0,180,30,135) rightHand.thumb.setRest(0) rightHand.index.setRest(0) rightHand.majeure.setRest(0) rightHand.ringFinger.setRest(0) rightHand.pinky.setRest(0) rightHand.wrist.setRest(0) i01 = Runtime.start("i01","InMoov") i01.startRightHand(rightPort) i01.rightHand.setAutoDisable(True) ear = i01.ear ear.addCommand("attach your right hand", "i01.rightHand", "enable") ear.addCommand("disconnect your right hand", "i01.rightHand", "disable") ear.addCommand("rest", "i01.rightHand", "rest")#hardcoded gesture ear.addCommand("relax", "python", "relax") ear.addCommand("open your hand", "python", "handopen") ear.addCommand("close your hand", "python", "handclose") ear.addCommand("capture gesture", ear.getName(), "captureGesture") ear.addCommand("manual", ear.getName(), "lockOutAllGrammarExcept", "voice control") ear.addCommand("voice control", ear.getName(), "clearLock") ear.addComfirmations("yes","correct","yeah","ya") ear.addNegations("no","wrong","nope","nah") ear.startListening() def relax(): i01.setHandVelocity("right", 30, 30, 30, 30, 30, 30) i01.moveHand("right",90,90,90,90,90,140) def handopen(): i01.setHandVelocity("right", -1.0, -1.0, -1.0, -1.0, -1.0, -1.0) i01.moveHand("right",0,0,0,0,0,0) i01.mouth.speak("ok I open my hand") def handclose(): i01.setHandVelocity("right", -1.0, -1.0, -1.0, -1.0, -1.0, -1.0) i01.moveHand("right",180,180,180,180,180,180) i01.mouth.speak("a nice and closed hand that is") relax()
from distutils.core import setup setup(name='ctctwspylib', version='0.1.1a1', description='A clone of the original lib from SourceForge (https://sourceforge.net/projects/ctctwspylib/)', author='Serdar Tumgoren', author_email='zstumgoren@gmail.com', url='https://github.com/zstumgoren/ctctwspylib', license='Apache 2.0', packages=['ctctwspylib'], install_requires=['csvkit'], classifiers=[ 'Environment :: Web Environment', 'Intended Audience :: Developers', 'License :: OSI Approved :: Apache Software License 2.0', 'Programming Language :: Python', 'Topic :: Software Development :: Libraries', ] )
""" This Python module contains tests for the prepifg.py PyRate module. """ import shutil import os from os.path import exists, join import sys import subprocess import tempfile from math import floor from itertools import product from pathlib import Path import pytest import numpy as np from numpy import isnan, nanmax, nanmin, nanmean, ones, nan, reshape, sum as npsum from numpy.testing import assert_array_almost_equal, assert_array_equal from osgeo import gdal import pyrate.configuration import pyrate.constants as C from pyrate.core.logger import pyratelogger as log from pyrate.core.shared import Ifg, DEM, dem_or_ifg from pyrate.core.shared import InputTypes from pyrate.core.prepifg_helper import CUSTOM_CROP, MAXIMUM_CROP, MINIMUM_CROP, ALREADY_SAME_SIZE from pyrate.core import roipac from pyrate.core.prepifg_helper import prepare_ifg, _resample, PreprocessError, CustomExts from pyrate.core.prepifg_helper import get_analysis_extent from pyrate.core import ifgconstants as ifc from pyrate.configuration import Configuration, MultiplePaths from pyrate import conv2tif, prepifg from tests import common from tests.common import SML_TEST_LEGACY_PREPIFG_DIR, PY37GDAL302, BASE_TEST, WORKING_DIR from tests.common import PREP_TEST_TIF, PREP_TEST_OBS, MEXICO_CROPA_CONF, assert_two_dirs_equal from tests.common import SML_TEST_DEM_TIF, SML_TEST_DEM_HDR, manipulate_test_conf, UnitTestAdaptation gdal.UseExceptions() DUMMY_SECTION_NAME = 'pyrate' if not exists(PREP_TEST_TIF): sys.exit("ERROR: Missing 'prepifg' dir for unittests\n") def test_prepifg_treats_inputs_and_outputs_read_only(gamma_conf, tempdir, coh_mask): tdir = Path(tempdir()) params = common.manipulate_test_conf(gamma_conf, tdir) params[C.COH_MASK] = coh_mask output_conf = tdir.joinpath('conf.cfg') pyrate.configuration.write_config_file(params=params, output_conf_file=output_conf) params = Configuration(output_conf.as_posix()).__dict__ conv2tif.main(params) tifs = list(Path(params[C.INTERFEROGRAM_DIR]).glob('*_unw.tif')) assert len(tifs) == 17 params = Configuration(output_conf.as_posix()).__dict__ prepifg.main(params) cropped_ifgs = list(Path(params[C.INTERFEROGRAM_DIR]).glob('*_ifg.tif')) cropped_cohs = list(Path(params[C.COHERENCE_DIR]).glob('*_coh.tif')) cropped_dem = list(Path(params[C.GEOMETRY_DIR]).glob('*_dem.tif')) if params[C.COH_FILE_LIST] is not None: # 17 + 1 dem + 17 coh files assert len(cropped_ifgs) + len(cropped_cohs) + len(cropped_dem) == 35 else: # 17 + 1 dem assert len(cropped_ifgs) + len(cropped_cohs) + len(cropped_dem) == 18 # check all tifs from conv2tif are still readonly for t in tifs: assert t.stat().st_mode == 33060 # check all prepifg outputs are readonly for c in cropped_cohs + cropped_ifgs + cropped_dem: assert c.stat().st_mode == 33060 def test_prepifg_file_types(tempdir, gamma_conf, coh_mask): tdir = Path(tempdir()) params = manipulate_test_conf(gamma_conf, tdir) params[C.COH_MASK] = coh_mask params[C.PARALLEL] = 0 output_conf_file = 'conf.conf' output_conf = tdir.joinpath(output_conf_file) pyrate.configuration.write_config_file(params=params, output_conf_file=output_conf) params_s = Configuration(output_conf).__dict__ conv2tif.main(params_s) # reread params from config params_s = Configuration(output_conf).__dict__ prepifg.main(params_s) ifg_files = list(Path(tdir.joinpath(params_s[C.INTERFEROGRAM_DIR])).glob('*_unw.tif')) assert len(ifg_files) == 17 mlooked_files = list(Path(tdir.joinpath(params_s[C.INTERFEROGRAM_DIR])).glob('*_ifg.tif')) assert len(mlooked_files) == 17 coh_files = list(Path(tdir.joinpath(params_s[C.COHERENCE_DIR])).glob('*_cc.tif')) mlooked_coh_files = list(Path(tdir.joinpath(params_s[C.COHERENCE_DIR])).glob('*_coh.tif')) if coh_mask: assert len(coh_files) == 17 assert len(mlooked_coh_files) == 17 dem_file = list(Path(tdir.joinpath(params_s[C.GEOMETRY_DIR])).glob('*_dem.tif'))[0] mlooked_dem_file = list(Path(tdir.joinpath(params_s[C.GEOMETRY_DIR])).glob('dem.tif'))[0] import itertools # assert coherence and ifgs have correct metadata for i in itertools.chain(*[ifg_files, mlooked_files, coh_files, mlooked_coh_files]): ifg = Ifg(i) ifg.open() md = ifg.meta_data if i.name.endswith('_unw.tif'): assert md[ifc.DATA_TYPE] == ifc.ORIG assert ifc.IFG_LKSX not in md assert ifc.IFG_LKSY not in md assert ifc.IFG_CROP not in md continue if i.name.endswith('_cc.tif'): assert md[ifc.DATA_TYPE] == ifc.COH assert ifc.IFG_LKSX not in md assert ifc.IFG_LKSY not in md assert ifc.IFG_CROP not in md continue if i.name.endswith('_coh.tif'): assert md[ifc.DATA_TYPE] == ifc.MULTILOOKED_COH assert md[ifc.IFG_LKSX] == '1' assert md[ifc.IFG_LKSY] == '1' assert md[ifc.IFG_CROP] == '1' continue if i.name.endswith('_ifg.tif'): if coh_mask: assert md[ifc.DATA_TYPE] == ifc.MLOOKED_COH_MASKED_IFG assert md[ifc.IFG_LKSX] == '1' assert md[ifc.IFG_LKSY] == '1' assert md[ifc.IFG_CROP] == '1' else: assert md[ifc.DATA_TYPE] == ifc.MULTILOOKED assert md[ifc.IFG_LKSX] == '1' assert md[ifc.IFG_LKSY] == '1' assert md[ifc.IFG_CROP] == '1' continue # assert dem has correct metadata dem = DEM(dem_file.as_posix()) dem.open() md = dem.dataset.GetMetadata() assert md[ifc.DATA_TYPE] == ifc.DEM assert ifc.IFG_LKSX not in md assert ifc.IFG_LKSY not in md assert ifc.IFG_CROP not in md dem = DEM(mlooked_dem_file.as_posix()) dem.open() md = dem.dataset.GetMetadata() assert md[ifc.DATA_TYPE] == ifc.MLOOKED_DEM assert ifc.IFG_LKSX in md assert ifc.IFG_LKSY in md assert ifc.IFG_CROP in md shutil.rmtree(tdir) def diff_exts_ifgs(): """Returns pair of test Ifgs with different extents""" bases = ['geo_060619-061002_unw.tif', 'geo_070326-070917_unw.tif'] headers = ['geo_060619-061002.unw.rsc', 'geo_070326-070917.unw.rsc'] random_dir = tempfile.mkdtemp() for p, h in zip(bases, headers): shutil.copy(src=os.path.join(PREP_TEST_TIF, p), dst=os.path.join(random_dir, p)) shutil.copy(src=os.path.join(PREP_TEST_OBS, h), dst=os.path.join(random_dir, h)) return [Ifg(join(random_dir, p)) for p in bases], random_dir def same_exts_ifgs(): """Return pair of Ifgs with same extents""" return [Ifg(join(PREP_TEST_TIF, f)) for f in ('geo_060619-061002.tif', 'geo_070326-070917.tif')] def extents_from_params(params): """Custom extents from supplied parameters""" keys = ( C.IFG_XFIRST, C.IFG_YFIRST, C.IFG_XLAST, C.IFG_YLAST) return CustomExts(*[params[k] for k in keys]) def test_extents_from_params(): xf, yf = 1.0, 2.0 xl, yl = 5.0, 7.0 pars = {C.IFG_XFIRST: xf, C.IFG_XLAST: xl, C.IFG_YFIRST: yf, C.IFG_YLAST: yl} assert extents_from_params(pars) == CustomExts(xf, yf, xl, yl) class TestPrepifgOutput(UnitTestAdaptation): """Tests aspects of the prepifg.py script, such as resampling.""" @staticmethod def assert_geotransform_equal(files): """ Asserts geotransforms for the given files are equivalent. Files can be paths to datasets, or GDAL dataset objects. """ assert len(files) > 1, "Need more than 1 file to compare" if not all([hasattr(f, "GetGeoTransform") for f in files]): datasets = [gdal.Open(f) for f in files] assert all(datasets) else: datasets = files transforms = [ds.GetGeoTransform() for ds in datasets] head = transforms[0] for t in transforms[1:]: assert_array_almost_equal(t, head, decimal=6, err_msg="Extents do not match!") @classmethod def setup_class(cls): cls.xs = 0.000833333 cls.ys = -cls.xs cls.ifgs, cls.random_dir = diff_exts_ifgs() cls.ifg_paths = [i.data_path for i in cls.ifgs] cls.params = Configuration(common.TEST_CONF_ROIPAC).__dict__ cls.params[C.OUT_DIR] = cls.random_dir cls.params[C.GEOMETRY_DIR] = Path(cls.random_dir).joinpath(C.GEOMETRY_DIR) cls.params[C.GEOMETRY_DIR].mkdir(exist_ok=True) cls.params[C.INTERFEROGRAM_DIR] = Path(cls.random_dir).joinpath(C.INTERFEROGRAM_DIR) cls.params[C.INTERFEROGRAM_DIR].mkdir(exist_ok=True) cls.headers = [roipac.roipac_header(i.data_path, cls.params) for i in cls.ifgs] paths = ["060619-061002_ifg.tif", "060619-061002_ifg.tif", "060619-061002_ifg.tif", "060619-061002_ifg.tif", "070326-070917_ifg.tif", "070326-070917_ifg.tif", "070326-070917_ifg.tif", "070326-070917_ifg.tif"] cls.exp_files = [join(cls.random_dir, C.INTERFEROGRAM_DIR, p) for p in paths] @staticmethod def test_mlooked_paths(): test_mlooked_path() @staticmethod def test_extents_from_params(): test_extents_from_params() @classmethod def teardown_class(cls): for exp_file in cls.exp_files: if exists(exp_file): os.remove(exp_file) for ifg in cls.ifgs: ifg.close() shutil.rmtree(cls.random_dir) def _custom_ext_latlons(self): return [150.91 + (7 * self.xs), # xfirst -34.17 + (16 * self.ys), # yfirst 150.91 + (27 * self.xs), # 20 cells from xfirst -34.17 + (44 * self.ys)] # 28 cells from yfirst def _custom_extents_tuple(self): return CustomExts(*self._custom_ext_latlons()) def assert_projection_equal(self, files): """ Asserts preojections for the given files are equivalent. Files can be paths to datasets, or GDAL dataset objects. """ assert len(files) > 1, "Need more than 1 file to compare" if not all([hasattr(f, "GetGeoTransform") for f in files]): datasets = [gdal.Open(f) for f in files] assert all(datasets) else: datasets = files projections = [ds.GetProjection() for ds in datasets] head = projections[0] for t in projections[1:]: self.assertEqual(t, head) def test_multilooked_projection_same_as_geotiff(self): xlooks = ylooks = 1 exts = get_analysis_extent(crop_opt=MAXIMUM_CROP, rasters=self.ifgs, xlooks=xlooks, ylooks=ylooks, user_exts=None) out_dir = tempfile.mkdtemp() params = common.min_params(out_dir) params[C.IFG_LKSX] = xlooks params[C.IFG_LKSY] = ylooks params[C.IFG_CROP_OPT] = MAXIMUM_CROP params[C.GEOMETRY_DIR] = Path(out_dir).joinpath(C.GEOMETRY_DIR) params[C.GEOMETRY_DIR].mkdir(exist_ok=True) params[C.INTERFEROGRAM_DIR] = Path(out_dir).joinpath(C.INTERFEROGRAM_DIR) params[C.INTERFEROGRAM_DIR].mkdir(exist_ok=True) mlooked_paths = [mlooked_path(f, params, input_type=InputTypes.IFG) for f in self.ifg_paths] for i, h, m in zip(self.ifg_paths, self.headers, mlooked_paths): prepare_ifg(i, xlooks, ylooks, exts, thresh=0.5, crop_opt=MAXIMUM_CROP, header=h, write_to_disk=True, out_path=m) self.assert_projection_equal(self.ifg_paths + mlooked_paths) def test_default_max_extents(self): """Test ifgcropopt=2 crops datasets to max bounding box extents.""" xlooks = ylooks = 1 prepare_ifgs(self.ifg_paths, MAXIMUM_CROP, xlooks, ylooks, self.headers, params=self.params) for f in [self.exp_files[1], self.exp_files[5]]: self.assertTrue(exists(f), msg="Output files not created") # output files should have same extents # NB: also verifies gdalwarp correctly copies geotransform across ifg = Ifg(self.exp_files[1]) ifg.open() gt = ifg.dataset.GetGeoTransform() # copied from gdalinfo output exp_gt = (150.91, 0.000833333, 0, -34.17, 0, -0.000833333) for i, j in zip(gt, exp_gt): self.assertAlmostEqual(i, j) self.assert_geotransform_equal([self.exp_files[1], self.exp_files[5]]) ifg.close() for i in self.ifgs: i.close() def test_min_extents(self): """Test ifgcropopt=1 crops datasets to min extents.""" xlooks = ylooks = 1 prepare_ifgs(self.ifg_paths, MINIMUM_CROP, xlooks, ylooks, headers=self.headers, params=self.params) ifg = Ifg(self.exp_files[0]) ifg.open() # output files should have same extents # NB: also verifies gdalwarp correctly copies geotransform across # NB: expected data copied from gdalinfo output gt = ifg.dataset.GetGeoTransform() exp_gt = (150.911666666, 0.000833333, 0, -34.172499999, 0, -0.000833333) for i, j in zip(gt, exp_gt): self.assertAlmostEqual(i, j) self.assert_geotransform_equal([self.exp_files[0], self.exp_files[4]]) ifg.close() for i in self.ifgs: i.close() def test_custom_extents(self): xlooks = ylooks = 1 cext = self._custom_extents_tuple() prepare_ifgs(self.ifg_paths, CUSTOM_CROP, xlooks, ylooks, headers=self.headers, user_exts=cext, params=self.params) ifg = Ifg(self.exp_files[2]) ifg.open() gt = ifg.dataset.GetGeoTransform() exp_gt = (cext.xfirst, self.xs, 0, cext.yfirst, 0, self.ys) for i, j in zip(gt, exp_gt): self.assertAlmostEqual(i, j) self.assert_geotransform_equal([self.exp_files[2], self.exp_files[6]]) # close ifgs ifg.close() for i in self.ifgs: i.close() def test_exception_without_all_4_crop_parameters(self): """Test misaligned cropping extents raise errors.""" xlooks = ylooks = 1 # empty string and none raises exceptio for i in [None, '']: cext = (150.92, -34.18, 150.94, i) self.assertRaises(PreprocessError, prepare_ifgs, self.ifg_paths, CUSTOM_CROP, xlooks, ylooks, self.headers, user_exts=cext, params=self.params) # three parameters provided self.assertRaises(PreprocessError, prepare_ifgs, self.ifg_paths, CUSTOM_CROP, xlooks, ylooks, self.headers, params=self.params, user_exts=(150.92, -34.18, 150.94)) # close ifgs for i in self.ifgs: i.close() def test_custom_extents_misalignment(self): """Test misaligned cropping extents raise errors.""" xlooks = ylooks = 1 latlons = tuple(self._custom_ext_latlons()) for i, _ in enumerate(['xfirst', 'yfirst', 'xlast', 'ylast']): # error = step / pi * [1000 100] for error in [0.265258, 0.026526]: tmp_latlon = list(latlons) tmp_latlon[i] += error cext = CustomExts(*tmp_latlon) self.assertRaises(PreprocessError, prepare_ifgs, self.ifg_paths, CUSTOM_CROP, xlooks, ylooks, user_exts=cext, headers=self.headers, params=self.params) # close ifgs for i in self.ifgs: i.close() def test_nodata(self): """Verify NODATA value copied correctly (amplitude band not copied)""" xlooks = ylooks = 1 prepare_ifgs(self.ifg_paths, MINIMUM_CROP, xlooks, ylooks, self.headers, self.params) for ex in [self.exp_files[0], self.exp_files[4]]: ifg = Ifg(ex) ifg.open() # NB: amplitude band doesn't have a NODATA value self.assertTrue(isnan(ifg.dataset.GetRasterBand(1).GetNoDataValue())) ifg.close() for i in self.ifgs: i.close() def test_nans(self): """Verify NaNs replace 0 in the multilooked phase band""" xlooks = ylooks = 1 prepare_ifgs(self.ifg_paths, MINIMUM_CROP, xlooks, ylooks, self.headers, self.params) for ex in [self.exp_files[0], self.exp_files[4]]: ifg = Ifg(ex) ifg.open() phase = ifg.phase_band.ReadAsArray() self.assertFalse((phase == 0).any()) self.assertTrue((isnan(phase)).any()) ifg.close() self.assertAlmostEqual(nanmax(phase), 4.247, 3) # copied from gdalinfo self.assertAlmostEqual(nanmin(phase), 0.009, 3) # copied from gdalinfo for i in self.ifgs: i.close() def test_multilook(self): """Test resampling method using a scaling factor of 4""" scale = 4 # assumes square cells self.ifgs.append(DEM(SML_TEST_DEM_TIF)) self.ifg_paths = [i.data_path for i in self.ifgs] # append the dem header self.headers.append(SML_TEST_DEM_HDR) cext = self._custom_extents_tuple() xlooks = ylooks = scale prepare_ifgs(self.ifg_paths, CUSTOM_CROP, xlooks, ylooks, thresh=1.0, user_exts=cext, headers=self.headers, params=self.params) for n, ipath in enumerate([self.exp_files[3], self.exp_files[7]]): i = Ifg(ipath) i.open() self.assertEqual(i.dataset.RasterXSize, 20 / scale) self.assertEqual(i.dataset.RasterYSize, 28 / scale) # verify resampling path = join(PREP_TEST_TIF, "geo_%s.tif" % Path(ipath).name.split('_ifg')[0]) ds = gdal.Open(path) src_data = ds.GetRasterBand(2).ReadAsArray() exp_resample = multilooking(src_data, scale, scale, thresh=0) self.assertEqual(exp_resample.shape, (7, 5)) assert_array_almost_equal(exp_resample, i.phase_band.ReadAsArray()) ds = None i.close() os.remove(ipath) # verify DEM has been correctly processed # ignore output values as resampling has already been tested for phase exp_dem_path = join(self.params[C.GEOMETRY_DIR], 'dem.tif') self.assertTrue(exists(exp_dem_path)) orignal_dem = DEM(SML_TEST_DEM_TIF) orignal_dem.open() dem_dtype = orignal_dem.dataset.GetRasterBand(1).DataType orignal_dem.close() dem = DEM(exp_dem_path) dem.open() # test multilooked dem is of the same datatype as the original dem tif self.assertEqual(dem_dtype, dem.dataset.GetRasterBand(1).DataType) self.assertEqual(dem.dataset.RasterXSize, 20 / scale) self.assertEqual(dem.dataset.RasterYSize, 28 / scale) data = dem.data self.assertTrue(data.ptp() != 0) # close ifgs dem.close() for i in self.ifgs: i.close() os.remove(exp_dem_path) def test_output_datatype(self): """Test resampling method using a scaling factor of 4""" scale = 4 # assumes square cells self.ifgs.append(DEM(SML_TEST_DEM_TIF)) ifg_paths = [i.data_path for i in self.ifgs] data_types = [InputTypes.IFG] * len(self.ifg_paths) ifg_paths.append(SML_TEST_DEM_TIF) data_types.append(InputTypes.DEM) self.headers.append(SML_TEST_DEM_HDR) cext = self._custom_extents_tuple() xlooks = ylooks = scale prepare_ifgs(ifg_paths, CUSTOM_CROP, xlooks, ylooks, thresh=1.0, user_exts=cext, headers=self.headers, params=self.params) self.params[C.IFG_LKSX] = xlooks self.params[C.IFG_LKSY] = ylooks self.params[C.IFG_CROP_OPT] = CUSTOM_CROP for i, t in zip(ifg_paths, data_types): mlooked_ifg = mlooked_path(i, self.params, input_type=t) ds1 = DEM(mlooked_ifg) ds1.open() ds2 = DEM(i) ds2.open() self.assertEqual(ds1.dataset.GetRasterBand(1).DataType, ds2.dataset.GetRasterBand(1).DataType) ds1 = ds2 = None def test_invalid_looks(self): """Verify only numeric values can be given for multilooking""" values = [0, -1, -10, -100000.6, ""] for v in values: self.assertRaises(PreprocessError, prepare_ifgs, self.ifg_paths, CUSTOM_CROP, xlooks=v, ylooks=1, headers=self.headers, params=self.params) self.assertRaises(PreprocessError, prepare_ifgs, self.ifg_paths, CUSTOM_CROP, xlooks=1, ylooks=v, headers=self.headers, params=self.params) class TestThresholdTests(UnitTestAdaptation): """Tests for threshold of data -> NaN during resampling.""" def test_nan_threshold_inputs(self): data = ones((1, 1)) for thresh in [-10, -1, -0.5, 1.000001, 10]: self.assertRaises(ValueError, _resample, data, 2, 2, thresh) @staticmethod def test_nan_threshold(): # test threshold based on number of NaNs per averaging tile data = ones((2, 10)) data[0, 3:] = nan data[1, 7:] = nan # key: NaN threshold as a % of pixels, expected result expected = [(0.0, [1, nan, nan, nan, nan]), (0.25, [1, nan, nan, nan, nan]), (0.5, [1, 1, nan, nan, nan]), (0.75, [1, 1, 1, nan, nan]), (1.0, [1, 1, 1, 1, nan])] for thresh, exp in expected: res = _resample(data, xscale=2, yscale=2, thresh=thresh) assert_array_equal(res, reshape(exp, res.shape)) @staticmethod def test_nan_threshold_alt(): # test threshold on odd numbers data = ones((3, 6)) data[0] = nan data[1, 2:5] = nan expected = [(0.4, [nan, nan]), (0.5, [1, nan]), (0.7, [1, 1])] for thresh, exp in expected: res = _resample(data, xscale=3, yscale=3, thresh=thresh) assert_array_equal(res, reshape(exp, res.shape)) class TestSameSizeTests(UnitTestAdaptation): """Tests aspects of the prepifg.py script, such as resampling.""" @classmethod def setup_class(cls): import datetime cls.xs = 0.000833333 cls.ys = -cls.xs cls.headers = [ {'NCOLS': 47, 'NROWS': 72, 'LAT': -34.17, 'LONG': 150.91, 'X_STEP': 0.000833333, 'Y_STEP': -0.000833333, 'WAVELENGTH_METRES': 0.0562356424, 'FIRST_DATE': datetime.date(2007, 3, 26), 'SECOND_DATE': datetime.date(2007, 9, 17), 'TIME_SPAN_YEAR': 0.4791238877481177, 'DATA_UNITS': 'RADIANS', 'INSAR_PROCESSOR': 'ROIPAC', 'X_LAST': 150.94916665099998, 'Y_LAST': -34.229999976, 'DATUM': 'WGS84', 'DATA_TYPE': 'ORIGINAL_IFG'}, {'NCOLS': 47, 'NROWS': 72, 'LAT': -34.17, 'LONG': 150.91, 'X_STEP': 0.000833333, 'Y_STEP': -0.000833333, 'WAVELENGTH_METRES': 0.0562356424, 'FIRST_DATE': datetime.date(2007, 3, 26), 'SECOND_DATE': datetime.date(2007, 9, 17), 'TIME_SPAN_YEAR': 0.4791238877481177, 'DATA_UNITS': 'RADIANS', 'INSAR_PROCESSOR': 'ROIPAC', 'X_LAST': 150.94916665099998, 'Y_LAST': -34.229999976, 'DATUM': 'WGS84', 'DATA_TYPE': 'ORIGINAL_IFG'} ] out_dir = tempfile.mkdtemp() cls.params = common.min_params(out_dir) cls.params[C.GEOMETRY_DIR] = Path(cls.params[C.OUT_DIR]).joinpath(C.GEOMETRY_DIR) cls.params[C.GEOMETRY_DIR].mkdir(exist_ok=True) cls.params[C.INTERFEROGRAM_DIR] = Path(cls.params[C.OUT_DIR]).joinpath(C.INTERFEROGRAM_DIR) cls.params[C.INTERFEROGRAM_DIR].mkdir(exist_ok=True) # TODO: check output files for same extents? # TODO: make prepifg dir readonly to test output to temp dir # TODO: move to class for testing same size option? def test_already_same_size(self): # should do nothing as layers are same size & no multilooking required ifgs = same_exts_ifgs() ifg_data_paths = [d.data_path for d in ifgs] res_tup = prepare_ifgs(ifg_data_paths, ALREADY_SAME_SIZE, 1, 1, self.headers, self.params) res = [r[1] for r in res_tup] self.assertTrue(all(res)) def test_already_same_size_mismatch(self): ifgs, random_dir = diff_exts_ifgs() ifg_data_paths = [d.data_path for d in ifgs] self.assertRaises(PreprocessError, prepare_ifgs, ifg_data_paths, ALREADY_SAME_SIZE, 1, 1, self.headers, self.params) for i in ifgs: i.close() shutil.rmtree(random_dir) # TODO: ensure multilooked files written to output dir def test_same_size_multilooking(self): ifgs = same_exts_ifgs() ifg_data_paths = [d.data_path for d in ifgs] xlooks = ylooks = 2 out_dir = tempfile.mkdtemp() params = common.min_params(out_dir) params[C.IFG_LKSX] = xlooks params[C.IFG_LKSY] = ylooks params[C.IFG_CROP_OPT] = ALREADY_SAME_SIZE params[C.GEOMETRY_DIR] = Path(params[C.OUT_DIR]).joinpath(C.GEOMETRY_DIR) params[C.GEOMETRY_DIR].mkdir(exist_ok=True) params[C.INTERFEROGRAM_DIR] = Path(params[C.OUT_DIR]).joinpath(C.INTERFEROGRAM_DIR) params[C.INTERFEROGRAM_DIR].mkdir(exist_ok=True) prepare_ifgs(ifg_data_paths, ALREADY_SAME_SIZE, xlooks, ylooks, self.headers, params) looks_paths = [mlooked_path(d, params, input_type=InputTypes.IFG) for d in ifg_data_paths] mlooked = [Ifg(i) for i in looks_paths] for m in mlooked: m.open() self.assertEqual(len(mlooked), 2) for ifg in mlooked: self.assertAlmostEqual(ifg.x_step, xlooks * self.xs) self.assertAlmostEqual(ifg.x_step, ylooks * self.xs) os.remove(ifg.data_path) def mlooked_path(path, params, input_type): m = MultiplePaths(path, params=params, input_type=input_type) return m.sampled_path def test_mlooked_path(): path = 'geo_060619-061002_unw.tif' for xlks, ylks, cr, input_type in product([2, 4, 8], [4, 2, 5], [1, 2, 3, 4], [InputTypes.IFG, InputTypes.COH]): out_dir = tempfile.mkdtemp() params = common.min_params(out_dir) params[C.IFG_LKSX] = xlks params[C.IFG_LKSY] = ylks params[C.IFG_CROP_OPT] = cr m = mlooked_path(path, params, input_type=input_type) assert Path(m).name == f'060619-061002_{input_type.value}.tif' class TestLocalMultilookTests: """Tests for local testing functions""" @staticmethod def test_multilooking_thresh(): data = ones((3, 6)) data[0] = nan data[1, 2:5] = nan expected = [(6, [nan, nan]), (5, [1, nan]), (4, [1, 1])] scale = 3 for thresh, exp in expected: res = multilooking(data, scale, scale, thresh) assert_array_equal(res, reshape(exp, res.shape)) def multilooking(src, xscale, yscale, thresh=0): """ src: numpy array of phase data thresh: min number of non-NaNs required for a valid tile resampling """ thresh = int(thresh) num_cells = xscale * yscale if thresh > num_cells or thresh < 0: msg = "Invalid threshold: %s (need 0 <= thr <= %s" % (thresh, num_cells) raise ValueError(msg) rows, cols = src.shape rows_lowres = int(floor(rows / yscale)) cols_lowres = int(floor(cols / xscale)) dest = ones((rows_lowres, cols_lowres)) * nan size = xscale * yscale for row in range(rows_lowres): for col in range(cols_lowres): ys = row * yscale ye = ys + yscale xs = col * xscale xe = xs + xscale patch = src[ys:ye, xs:xe] num_values = num_cells - npsum(isnan(patch)) if num_values >= thresh and num_values > 0: # nanmean() only works on 1g axis reshaped = patch.reshape(size) dest[row, col] = nanmean(reshaped) return dest class TestLegacyEqualityTestRoipacSmallTestData(UnitTestAdaptation): """ Legacy roipac prepifg equality test for small test data """ def setup_class(cls): from tests.common import small_data_setup cls.ifgs = small_data_setup() cls.ifg_paths = [i.data_path for i in cls.ifgs] params = Configuration(common.TEST_CONF_ROIPAC).__dict__ cls.headers = [roipac.roipac_header(i.data_path, params) for i in cls.ifgs] params[C.IFG_LKSX], params[C.IFG_LKSY], params[ C.IFG_CROP_OPT] = 1, 1, 1 prepare_ifgs(cls.ifg_paths, crop_opt=1, xlooks=1, ylooks=1, headers=cls.headers, params=params) looks_paths = [mlooked_path(d, params, t) for d, t in zip(cls.ifg_paths, [InputTypes.IFG]*len(cls.ifgs))] cls.ifgs_with_nan = [Ifg(i) for i in looks_paths] for ifg in cls.ifgs_with_nan: ifg.open() @classmethod def teardown_class(cls): for i in cls.ifgs_with_nan: if os.path.exists(i.data_path): i.close() os.remove(i.data_path) def test_legacy_prepifg_equality_array(self): """ Legacy prepifg equality test """ # path to csv folders from legacy output onlyfiles = [ fln for fln in os.listdir(SML_TEST_LEGACY_PREPIFG_DIR) if os.path.isfile(os.path.join(SML_TEST_LEGACY_PREPIFG_DIR, fln)) and fln.endswith('.csv') and fln.__contains__('_rad_') ] for fln in onlyfiles: ifg_data = np.genfromtxt(os.path.join( SML_TEST_LEGACY_PREPIFG_DIR, fln), delimiter=',') for k, j in enumerate(self.ifgs): if fln.split('_rad_')[-1].split('.')[0] == \ os.path.split(j.data_path)[-1].split('.')[0]: np.testing.assert_array_almost_equal(ifg_data, self.ifgs_with_nan[ k].phase_data, decimal=2) def test_legacy_prepifg_and_convert_phase(self): """ Legacy data prepifg equality test """ # path to csv folders from legacy output for i in self.ifgs_with_nan: if not i.mm_converted: i.convert_to_mm() onlyfiles = [ f for f in os.listdir(SML_TEST_LEGACY_PREPIFG_DIR) if os.path.isfile(os.path.join(SML_TEST_LEGACY_PREPIFG_DIR, f)) and f.endswith('.csv') and f.__contains__('_mm_')] count = 0 for i, f in enumerate(onlyfiles): ifg_data = np.genfromtxt(os.path.join( SML_TEST_LEGACY_PREPIFG_DIR, f), delimiter=',') for k, j in enumerate(self.ifgs): if f.split('_mm_')[-1].split('.')[0] == \ os.path.split(j.data_path)[-1].split('_unw.')[0]: count += 1 # all numbers equal np.testing.assert_array_almost_equal( ifg_data, self.ifgs_with_nan[k].phase_data, decimal=2) # means must also be equal self.assertAlmostEqual( nanmean(ifg_data), nanmean(self.ifgs_with_nan[k].phase_data), places=4) # number of nans must equal self.assertEqual( np.sum(np.isnan(ifg_data)), np.sum(np.isnan(self.ifgs_with_nan[k].phase_data))) # ensure we have the correct number of matches self.assertEqual(count, len(self.ifgs)) class TestOneIncidenceOrElevationMap(UnitTestAdaptation): @classmethod def setup_class(cls): cls.base_dir = tempfile.mkdtemp() cls.conf_file = tempfile.mktemp(suffix='.conf', dir=cls.base_dir) cls.ifgListFile = os.path.join(common.GAMMA_SML_TEST_DIR, 'ifms_17') cls.baseListFile = os.path.join(common.GAMMA_SML_TEST_DIR, 'baseline_17') @classmethod def teardown_class(cls): params = Configuration(cls.conf_file).__dict__ shutil.rmtree(cls.base_dir) common.remove_tifs(params[WORKING_DIR]) def make_input_files(self, inc='', ele=''): with open(self.conf_file, 'w') as conf: conf.write('{}: {}\n'.format(C.NO_DATA_VALUE, '0.0')) conf.write('{}: {}\n'.format(WORKING_DIR, common.GAMMA_SML_TEST_DIR)) conf.write('{}: {}\n'.format(C.OUT_DIR, self.base_dir)) conf.write('{}: {}\n'.format(C.IFG_FILE_LIST, self.ifgListFile)) conf.write('{}: {}\n'.format(C.BASE_FILE_LIST, self.baseListFile)) conf.write('{}: {}\n'.format(C.PROCESSOR, '1')) conf.write('{}: {}\n'.format( C.DEM_HEADER_FILE, os.path.join( common.GAMMA_SML_TEST_DIR, '20060619_utm_dem.par'))) conf.write('{}: {}\n'.format(C.IFG_LKSX, '1')) conf.write('{}: {}\n'.format(C.IFG_LKSY, '1')) conf.write('{}: {}\n'.format(C.IFG_CROP_OPT, '1')) conf.write('{}: {}\n'.format(C.NO_DATA_AVERAGING_THRESHOLD, '0.5')) conf.write('{}: {}\n'.format(C.HDR_FILE_LIST, common.SML_TEST_GAMMA_HEADER_LIST)) conf.write('{}: {}\n'.format(C.DEM_FILE, common.SML_TEST_DEM_GAMMA)) conf.write('{}: {}\n'.format(C.APS_INCIDENCE_MAP, inc)) conf.write('{}: {}\n'.format(C.APS_ELEVATION_MAP, ele)) conf.write('{}: {}\n'.format(C.APS_CORRECTION, '1')) conf.write('{}: {}\n'.format(C.APS_METHOD, '2')) conf.write('{}: {}\n'.format(C.TIME_SERIES_SM_ORDER, 1)) def common_check(self, ele, inc): import glob from pyrate.configuration import Configuration assert os.path.exists(self.conf_file) params = Configuration(self.conf_file).__dict__ conv2tif.main(params) sys.argv = ['dummy', self.conf_file] prepifg.main(params) # test 17 geotiffs created geotifs = glob.glob(os.path.join(params[C.OUT_DIR], '*_unw.tif')) self.assertEqual(17, len(geotifs)) # test dem geotiff created demtif = glob.glob(os.path.join(params[C.OUT_DIR], '*_dem.tif')) self.assertEqual(1, len(demtif)) # mlooked tifs mlooked_tifs = glob.glob(os.path.join(self.base_dir, '*_ifg.tif')) mlooked_tifs.append(os.path.join(self.base_dir, 'dem.tif')) # 19 including 17 ifgs, 1 dem and one incidence self.assertEqual(18, len(mlooked_tifs)) inc = glob.glob(os.path.join(self.base_dir, '*utm_{inc}.tif'.format(inc=inc))) self.assertEqual(0, len(inc)) def prepare_ifgs(raster_data_paths, crop_opt, xlooks, ylooks, headers, params, thresh=0.5, user_exts=None, write_to_disc=True): """ Wrapper function to prepare a sequence of interferogram files for PyRate analysis. See prepifg.prepare_ifg() for full description of inputs and returns. Note: function need refining for crop options :param list raster_data_paths: List of interferogram file paths :param int crop_opt: Crop option :param int xlooks: Number of multi-looks in x; 5 is 5 times smaller, 1 is no change :param int ylooks: Number of multi-looks in y :param float thresh: see thresh in prepare_ifgs() :param tuple user_exts: Tuple of user defined georeferenced extents for new file: (xfirst, yfirst, xlast, ylast)cropping coordinates :param bool write_to_disc: Write new data to disk :return: resampled_data: output cropped and resampled image :rtype: ndarray :return: out_ds: destination gdal dataset object :rtype: List[gdal.Dataset] """ if xlooks != ylooks: log.warning('X and Y multi-look factors are not equal') # use metadata check to check whether it's a dem or ifg rasters = [dem_or_ifg(r) for r in raster_data_paths] exts = get_analysis_extent(crop_opt, rasters, xlooks, ylooks, user_exts) out_paths = [] for r, t in zip(raster_data_paths, rasters): if isinstance(t, DEM): input_type = InputTypes.DEM else: input_type = InputTypes.IFG out_path = MultiplePaths(r, params, input_type).sampled_path out_paths.append(out_path) return [prepare_ifg(d, xlooks, ylooks, exts, thresh, crop_opt, h, write_to_disc, p) for d, h, p in zip(raster_data_paths, headers, out_paths)] @pytest.mark.mpi @pytest.mark.slow @pytest.mark.skipif(not PY37GDAL302, reason="Only run in one CI env") def test_coh_stats_equality(mexico_cropa_params): subprocess.run(f"mpirun -n 3 pyrate prepifg -f {MEXICO_CROPA_CONF.as_posix()}", shell=True) params = mexico_cropa_params mexico_cropa_coh_stats_dir = Path(BASE_TEST).joinpath("cropA", 'coherence_stats') assert_two_dirs_equal(params[C.COHERENCE_DIR], mexico_cropa_coh_stats_dir, ext="coh*.tif", num_files=3) # assert metadata was written from pyrate.prepifg import out_type_md_dict for stat_tif in mexico_cropa_coh_stats_dir.glob("coh*.tif"): ds = gdal.Open(stat_tif.as_posix()) md = ds.GetMetadata() expected_md = out_type_md_dict[stat_tif.stem.upper()] assert ifc.DATA_TYPE in md.keys() assert expected_md in md.values()
import csv import tushare as ts import datetime import os def getStockHistoryData(stockId,timeToMarket): if not re.match('^\d{8}$',timeToMarket) : timeToMarket = '20000101' endDate = datetime.datetime.strptime(timeToMarket,'%Y%m%d') toDate = datetime.datetime.now() fromDate = toDate - datetime.timedelta(days=96) path = '/home/cano/data/historykdata/historydata60/historydata' + stockId + '.csv' while(fromDate >= endDate): if (fromDate < endDate): fromDate = endDate print(fromDate) print(toDate) print('') data = ts.get_h_data(stockId,start=fromDate.strftime('%Y-%m-%d'),end=toDate.strftime('%Y-%m-%d'),autype='qfq',ktype='60') if data is not None : if os.path.exists(path): data.to_csv(path,mode='a',header=False) else: data.to_csv(path) toDate = fromDate - datetime.timedelta(days=1) fromDate = fromDate - datetime.timedelta(days=96) csvfile = open('/home/cano/data/stocklist.csv', 'r') reader = csv.reader(csvfile) for line in reader: if os.path.exists('/home/cano/data/historykdata/historydata60/historydata' + line[0] + '.csv'): continue print(line[0]) getStockHistoryData(line[0],line[15]) csvfile.close()
import unittest from mock import patch from mock import MagicMock as Mock from pyrax.clouddatabases import CloudDatabaseBackupManager from pyrax.clouddatabases import CloudDatabaseDatabase from pyrax.clouddatabases import CloudDatabaseFlavor from pyrax.clouddatabases import CloudDatabaseInstance from pyrax.clouddatabases import CloudDatabaseUser from pyrax.clouddatabases import CloudDatabaseVolume from pyrax.clouddatabases import assure_instance import pyrax.exceptions as exc from pyrax.resource import BaseResource import pyrax.utils as utils from pyrax import fakes example_uri = "http://example.com" class CloudDatabasesTest(unittest.TestCase): def __init__(self, *args, **kwargs): super(CloudDatabasesTest, self).__init__(*args, **kwargs) def setUp(self): self.instance = fakes.FakeDatabaseInstance() self.client = fakes.FakeDatabaseClient() def tearDown(self): pass def test_assure_instance(self): class TestClient(object): _manager = fakes.FakeManager() @assure_instance def test_method(self, instance): return instance client = TestClient() client._manager.get = Mock(return_value=self.instance) # Pass the instance ret = client.test_method(self.instance) self.assertTrue(ret is self.instance) # Pass the ID ret = client.test_method(self.instance.id) self.assertTrue(ret is self.instance) @patch("pyrax.manager.BaseManager", new=fakes.FakeManager) def test_instantiate_instance(self): inst = CloudDatabaseInstance(fakes.FakeManager(), {"id": 42, "volume": {"size": 1, "used": 0.2}}) self.assertTrue(isinstance(inst, CloudDatabaseInstance)) self.assertTrue(isinstance(inst.volume, CloudDatabaseVolume)) def test_list_databases(self): inst = self.instance inst._database_manager.list = Mock() limit = utils.random_unicode() marker = utils.random_unicode() inst.list_databases(limit=limit, marker=marker) inst._database_manager.list.assert_called_once_with(limit=limit, marker=marker) def test_list_users(self): inst = self.instance inst._user_manager.list = Mock() limit = utils.random_unicode() marker = utils.random_unicode() inst.list_users(limit=limit, marker=marker) inst._user_manager.list.assert_called_once_with(limit=limit, marker=marker) def test_get_database(self): inst = self.instance db1 = fakes.FakeEntity() db1.name = "a" db2 = fakes.FakeEntity() db2.name = "b" inst.list_databases = Mock(return_value=[db1, db2]) ret = inst.get_database("a") self.assertEqual(ret, db1) def test_get_database_bad(self): inst = self.instance db1 = fakes.FakeEntity() db1.name = "a" db2 = fakes.FakeEntity() db2.name = "b" inst.list_databases = Mock(return_value=[db1, db2]) self.assertRaises(exc.NoSuchDatabase, inst.get_database, "z") def test_dbmgr_get(self): mgr = fakes.FakeDatabaseManager() rsrc = fakes.FakeDatabaseInstance() rsrc.volume = {} mgr._get = Mock(return_value=rsrc) ret = mgr.get("fake") self.assertTrue(isinstance(ret, CloudDatabaseInstance)) self.assertTrue(isinstance(ret.volume, CloudDatabaseVolume)) def test_dbmgr_create_backup(self): inst = self.instance mgr = inst.manager name = utils.random_unicode() description = utils.random_unicode() mgr.api.method_post = Mock(return_value=(None, {"backup": {}})) expected_uri = "/backups" expected_body = {"backup": {"instance": inst.id, "name": name, "description": description}} mgr.create_backup(inst, name, description=description) mgr.api.method_post.assert_called_once_with(expected_uri, body=expected_body) @patch('pyrax.clouddatabases.CloudDatabaseInstance', new=fakes.FakeDatabaseInstance) def test_mgr_restore_backup(self): inst = self.instance mgr = inst.manager name = utils.random_unicode() flavor = utils.random_unicode() fref = utils.random_unicode() volume = utils.random_unicode() backup = utils.random_unicode() mgr.api.method_post = Mock(return_value=(None, {"instance": {}})) mgr.api._get_flavor_ref = Mock(return_value=fref) expected_uri = "/%s" % mgr.uri_base expected_body = {"instance": {"name": name, "flavorRef": fref, "volume": {"size": volume}, "restorePoint": {"backupRef": backup}}} mgr.restore_backup(backup, name, flavor, volume) mgr.api.method_post.assert_called_once_with(expected_uri, body=expected_body) def test_mgr_list_backups(self): inst = self.instance mgr = inst.manager mgr.api._backup_manager.list = Mock(return_value=(None, None)) mgr.list_backups(inst) mgr.api._backup_manager.list.assert_called_once_with(instance=inst, limit=20, marker=0) def test_mgr_list_backups_for_instance(self): inst = self.instance mgr = inst.manager mgr.api.method_get = Mock(return_value=(None, {"backups": []})) expected_uri = "/%s/%s/backups?limit=20&marker=0" % (mgr.uri_base, inst.id) mgr._list_backups_for_instance(inst) mgr.api.method_get.assert_called_once_with(expected_uri) def test_create_database(self): inst = self.instance inst._database_manager.create = Mock() inst._database_manager.find = Mock() db = inst.create_database(name="test") inst._database_manager.create.assert_called_once_with(name="test", character_set="utf8", collate="utf8_general_ci", return_none=True) def test_create_user(self): inst = self.instance inst._user_manager.create = Mock() inst._user_manager.find = Mock() name = utils.random_unicode() password = utils.random_unicode() database_names = utils.random_unicode() host = utils.random_unicode() inst.create_user(name=name, password=password, database_names=database_names, host=host) inst._user_manager.create.assert_called_once_with(name=name, password=password, database_names=[database_names], host=host, return_none=True) def test_delete_database(self): inst = self.instance inst._database_manager.delete = Mock() inst.delete_database("dbname") inst._database_manager.delete.assert_called_once_with("dbname") def test_delete_user(self): inst = self.instance inst._user_manager.delete = Mock() inst.delete_user("username") inst._user_manager.delete.assert_called_once_with("username") def test_delete_database_direct(self): inst = self.instance mgr = inst.manager name = utils.random_unicode() db = CloudDatabaseDatabase(mgr, info={"name": name}) mgr.delete = Mock() db.delete() mgr.delete.assert_called_once_with(name) def test_delete_user_direct(self): inst = self.instance mgr = inst.manager name = utils.random_unicode() user = CloudDatabaseUser(mgr, info={"name": name}) mgr.delete = Mock() user.delete() mgr.delete.assert_called_once_with(name) def test_enable_root_user(self): inst = self.instance pw = utils.random_unicode() fake_body = {"user": {"password": pw}} inst.manager.api.method_post = Mock(return_value=(None, fake_body)) ret = inst.enable_root_user() call_uri = "/instances/%s/root" % inst.id inst.manager.api.method_post.assert_called_once_with(call_uri) self.assertEqual(ret, pw) def test_root_user_status(self): inst = self.instance fake_body = {"rootEnabled": True} inst.manager.api.method_get = Mock(return_value=(None, fake_body)) ret = inst.root_user_status() call_uri = "/instances/%s/root" % inst.id inst.manager.api.method_get.assert_called_once_with(call_uri) self.assertTrue(ret) def test_restart(self): inst = self.instance inst.manager.action = Mock() ret = inst.restart() inst.manager.action.assert_called_once_with(inst, "restart") def test_resize(self): inst = self.instance flavor_ref = utils.random_unicode() inst.manager.api._get_flavor_ref = Mock(return_value=flavor_ref) fake_body = {"flavorRef": flavor_ref} inst.manager.action = Mock() ret = inst.resize(42) call_uri = "/instances/%s/action" % inst.id inst.manager.action.assert_called_once_with(inst, "resize", body=fake_body) def test_resize_volume_too_small(self): inst = self.instance inst.volume.get = Mock(return_value=2) self.assertRaises(exc.InvalidVolumeResize, inst.resize_volume, 1) def test_resize_volume(self): inst = self.instance fake_body = {"volume": {"size": 2}} inst.manager.action = Mock() ret = inst.resize_volume(2) inst.manager.action.assert_called_once_with(inst, "resize", body=fake_body) def test_resize_volume_direct(self): inst = self.instance vol = inst.volume fake_body = {"volume": {"size": 2}} inst.manager.action = Mock() ret = vol.resize(2) inst.manager.action.assert_called_once_with(inst, "resize", body=fake_body) def test_volume_get(self): inst = self.instance vol = inst.volume att = vol.size using_get = vol.get("size") self.assertEqual(att, using_get) def test_volume_get_fail(self): inst = self.instance vol = inst.volume self.assertRaises(AttributeError, vol.get, "fake") def test_inst_list_backups(self): inst = self.instance mgr = inst.manager mgr._list_backups_for_instance = Mock() inst.list_backups() mgr._list_backups_for_instance.assert_called_once_with(inst, limit=20, marker=0) def test_inst_create_backup(self): inst = self.instance mgr = inst.manager name = utils.random_unicode() description = utils.random_unicode() mgr.create_backup = Mock() inst.create_backup(name, description=description) mgr.create_backup.assert_called_once_with(inst, name, description=description) def test_get_flavor_property(self): inst = self.instance inst._loaded = True flavor = inst.flavor self.assertTrue(isinstance(flavor, CloudDatabaseFlavor)) def test_set_flavor_property_dict(self): inst = self.instance inst._loaded = True inst.flavor = {"name": "test"} self.assertTrue(isinstance(inst.flavor, CloudDatabaseFlavor)) def test_set_flavor_property_instance(self): inst = self.instance inst._loaded = True flavor = CloudDatabaseFlavor(inst.manager, {"name": "test"}) inst.flavor = flavor self.assertTrue(isinstance(inst.flavor, CloudDatabaseFlavor)) @patch("pyrax.manager.BaseManager", new=fakes.FakeManager) def test_list_databases_for_instance(self): clt = self.client inst = self.instance limit = utils.random_unicode() marker = utils.random_unicode() inst.list_databases = Mock(return_value=["db"]) ret = clt.list_databases(inst, limit=limit, marker=marker) self.assertEqual(ret, ["db"]) inst.list_databases.assert_called_once_with(limit=limit, marker=marker) @patch("pyrax.manager.BaseManager", new=fakes.FakeManager) def test_create_database_for_instance(self): clt = self.client inst = self.instance inst.create_database = Mock(return_value=["db"]) nm = utils.random_unicode() ret = clt.create_database(inst, nm) self.assertEqual(ret, ["db"]) inst.create_database.assert_called_once_with(nm, character_set=None, collate=None) def test_clt_get_database(self): clt = self.client inst = self.instance inst.get_database = Mock() nm = utils.random_unicode() clt.get_database(inst, nm) inst.get_database.assert_called_once_with(nm) @patch("pyrax.manager.BaseManager", new=fakes.FakeManager) def test_delete_database_for_instance(self): clt = self.client inst = self.instance inst.delete_database = Mock() nm = utils.random_unicode() clt.delete_database(inst, nm) inst.delete_database.assert_called_once_with(nm) @patch("pyrax.manager.BaseManager", new=fakes.FakeManager) def test_list_users_for_instance(self): clt = self.client inst = self.instance limit = utils.random_unicode() marker = utils.random_unicode() inst.list_users = Mock(return_value=["user"]) ret = clt.list_users(inst, limit=limit, marker=marker) self.assertEqual(ret, ["user"]) inst.list_users.assert_called_once_with(limit=limit, marker=marker) def test_create_user_for_instance(self): clt = self.client inst = self.instance inst.create_user = Mock() nm = utils.random_unicode() pw = utils.random_unicode() host = utils.random_unicode() ret = clt.create_user(inst, nm, pw, ["db"], host=host) inst.create_user.assert_called_once_with(name=nm, password=pw, database_names=["db"], host=host) @patch("pyrax.manager.BaseManager", new=fakes.FakeManager) def test_delete_user_for_instance(self): clt = self.client inst = self.instance inst.delete_user = Mock() nm = utils.random_unicode() clt.delete_user(inst, nm) inst.delete_user.assert_called_once_with(nm) @patch("pyrax.manager.BaseManager", new=fakes.FakeManager) def test_enable_root_user_for_instance(self): clt = self.client inst = self.instance inst.enable_root_user = Mock() clt.enable_root_user(inst) inst.enable_root_user.assert_called_once_with() @patch("pyrax.manager.BaseManager", new=fakes.FakeManager) def test_root_user_status_for_instance(self): clt = self.client inst = self.instance inst.root_user_status = Mock() clt.root_user_status(inst) inst.root_user_status.assert_called_once_with() @patch("pyrax.manager.BaseManager", new=fakes.FakeManager) def test_get_user_by_client(self): clt = self.client inst = self.instance inst.get_user = Mock() fakeuser = utils.random_unicode() clt.get_user(inst, fakeuser) inst.get_user.assert_called_once_with(fakeuser) def test_get_user(self): inst = self.instance good_name = utils.random_unicode() user = fakes.FakeDatabaseUser(manager=None, info={"name": good_name}) inst._user_manager.get = Mock(return_value=user) returned = inst.get_user(good_name) self.assertEqual(returned, user) def test_get_user_fail(self): inst = self.instance bad_name = utils.random_unicode() inst._user_manager.get = Mock(side_effect=exc.NotFound("")) self.assertRaises(exc.NoSuchDatabaseUser, inst.get_user, bad_name) def test_get_db_names(self): inst = self.instance mgr = inst._user_manager mgr.instance = inst dbname1 = utils.random_ascii() dbname2 = utils.random_ascii() inst.list_databases = Mock(return_value=((dbname1, dbname2))) resp = mgr._get_db_names(dbname1) self.assertEqual(resp, [dbname1]) def test_get_db_names_not_strict(self): inst = self.instance mgr = inst._user_manager mgr.instance = inst dbname1 = utils.random_ascii() dbname2 = utils.random_ascii() inst.list_databases = Mock(return_value=((dbname1, dbname2))) resp = mgr._get_db_names("BAD", strict=False) self.assertEqual(resp, ["BAD"]) def test_get_db_names_fail(self): inst = self.instance mgr = inst._user_manager mgr.instance = inst dbname1 = utils.random_ascii() dbname2 = utils.random_ascii() inst.list_databases = Mock(return_value=((dbname1, dbname2))) self.assertRaises(exc.NoSuchDatabase, mgr._get_db_names, "BAD") def test_change_user_password(self): inst = self.instance fakename = utils.random_ascii() newpass = utils.random_ascii() resp = fakes.FakeResponse() resp.status_code = 202 inst._user_manager.api.method_put = Mock(return_value=(resp, {})) fakeuser = fakes.FakeDatabaseUser(inst._user_manager, {"name": fakename}) inst._user_manager.get = Mock(return_value=fakeuser) inst.change_user_password(fakename, newpass) inst._user_manager.api.method_put.assert_called_once_with( "/None/%s" % fakename, body={"user": {"password": newpass}}) def test_update_user(self): inst = self.instance mgr = inst._user_manager user = utils.random_unicode() name = utils.random_unicode() password = utils.random_unicode() host = utils.random_unicode() mgr.update = Mock() inst.update_user(user, name=name, password=password, host=host) mgr.update.assert_called_once_with(user, name=name, password=password, host=host) def test_user_manager_update(self): inst = self.instance mgr = inst._user_manager username = utils.random_unicode() user = fakes.FakeDatabaseUser(mgr, info={"name": username}) name = utils.random_unicode() host = utils.random_unicode() password = utils.random_unicode() mgr.api.method_put = Mock(return_value=(None, None)) expected_uri = "/%s/%s" % (mgr.uri_base, username) expected_body = {"user": {"name": name, "host": host, "password": password}} mgr.update(user, name=name, host=host, password=password) mgr.api.method_put.assert_called_once_with(expected_uri, body=expected_body) def test_user_manager_update_missing(self): inst = self.instance mgr = inst._user_manager username = utils.random_unicode() user = fakes.FakeDatabaseUser(mgr, info={"name": username}) self.assertRaises(exc.MissingDBUserParameters, mgr.update, user) def test_user_manager_update_unchanged(self): inst = self.instance mgr = inst._user_manager username = utils.random_unicode() user = fakes.FakeDatabaseUser(mgr, info={"name": username}) self.assertRaises(exc.DBUpdateUnchanged, mgr.update, user, name=username) def test_list_user_access(self): inst = self.instance dbname1 = utils.random_ascii() dbname2 = utils.random_ascii() acc = {"databases": [{"name": dbname1}, {"name": dbname2}]} inst._user_manager.api.method_get = Mock(return_value=(None, acc)) db_list = inst.list_user_access("fakeuser") self.assertEqual(len(db_list), 2) self.assertTrue(db_list[0].name in (dbname1, dbname2)) def test_list_user_access_not_found(self): inst = self.instance mgr = inst._user_manager mgr.api.method_get = Mock(side_effect=exc.NotFound("")) username = utils.random_unicode() user = fakes.FakeDatabaseUser(mgr, info={"name": username}) self.assertRaises(exc.NoSuchDatabaseUser, mgr.list_user_access, user) def test_grant_user_access(self): inst = self.instance fakeuser = utils.random_ascii() dbname1 = utils.random_ascii() inst._user_manager.api.method_put = Mock(return_value=(None, None)) inst.grant_user_access(fakeuser, dbname1, strict=False) inst._user_manager.api.method_put.assert_called_once_with( "/None/%s/databases" % fakeuser, body={"databases": [{"name": dbname1}]}) def test_grant_user_access_not_found(self): inst = self.instance mgr = inst._user_manager mgr.api.method_put = Mock(side_effect=exc.NotFound("")) username = utils.random_unicode() user = fakes.FakeDatabaseUser(mgr, info={"name": username}) db_names = utils.random_unicode() mgr._get_db_names = Mock(return_value=[]) self.assertRaises(exc.NoSuchDatabaseUser, mgr.grant_user_access, user, db_names) def test_revoke_user_access(self): inst = self.instance fakeuser = utils.random_ascii() dbname1 = utils.random_ascii() inst._user_manager.api.method_delete = Mock(return_value=(None, None)) inst.revoke_user_access(fakeuser, dbname1, strict=False) inst._user_manager.api.method_delete.assert_called_once_with( "/None/%s/databases/%s" % (fakeuser, dbname1)) def test_backup_mgr_create_body(self): inst = self.instance mgr = inst.manager bu_mgr = mgr.api._backup_manager name = utils.random_unicode() description = utils.random_unicode() expected_body = {"backup": {"instance": inst.id, "name": name, "description": description}} ret = bu_mgr._create_body(name, inst, description=description) self.assertEqual(ret, expected_body) def test_backup_mgr_list(self): inst = self.instance mgr = inst.manager bu_mgr = mgr.api._backup_manager fake_val = utils.random_unicode() bu_mgr._list = Mock(return_value=fake_val) ret = bu_mgr.list() self.assertEqual(ret, fake_val) def test_backup_mgr_list_instance(self): inst = self.instance mgr = inst.manager bu_mgr = mgr.api._backup_manager db_mgr = mgr.api._manager db_mgr._list_backups_for_instance = Mock() bu_mgr.list(instance=inst) db_mgr._list_backups_for_instance.assert_called_once_with(inst, limit=20, marker=0) def test_clt_change_user_password(self): clt = self.client inst = self.instance inst.change_user_password = Mock() user = utils.random_unicode() pw = utils.random_unicode() clt.change_user_password(inst, user, pw) inst.change_user_password.assert_called_once_with(user, pw) def test_user_change_password(self): inst = self.instance mgr = inst.manager password = utils.random_unicode() user = CloudDatabaseUser(mgr, info={"name": "fake"}) mgr.change_user_password = Mock() user.change_password(password) mgr.change_user_password.assert_called_once_with(user, password) def test_clt_update_user(self): clt = self.client inst = self.instance inst.update_user = Mock() user = utils.random_unicode() name = utils.random_unicode() password = utils.random_unicode() host = utils.random_unicode() clt.update_user(inst, user, name=name, password=password, host=host) inst.update_user.assert_called_once_with(user, name=name, password=password, host=host) def test_user_update(self): inst = self.instance mgr = inst.manager name = utils.random_unicode() password = utils.random_unicode() host = utils.random_unicode() user = CloudDatabaseUser(mgr, info={"name": "fake"}) mgr.update = Mock() user.update(name=name, password=password, host=host) mgr.update.assert_called_once_with(user, name=name, password=password, host=host) def test_clt_list_user_access(self): clt = self.client inst = self.instance inst.list_user_access = Mock() user = utils.random_unicode() clt.list_user_access(inst, user) inst.list_user_access.assert_called_once_with(user) def test_user_list_user_access(self): inst = self.instance mgr = inst.manager user = CloudDatabaseUser(mgr, info={"name": "fake"}) mgr.list_user_access = Mock() user.list_user_access() mgr.list_user_access.assert_called_once_with(user) def test_clt_grant_user_access(self): clt = self.client inst = self.instance inst.grant_user_access = Mock() user = utils.random_unicode() db_names = utils.random_unicode() clt.grant_user_access(inst, user, db_names) inst.grant_user_access.assert_called_once_with(user, db_names, strict=True) def test_user_grant_user_access(self): inst = self.instance mgr = inst.manager user = CloudDatabaseUser(mgr, info={"name": "fake"}) db_names = utils.random_unicode() strict = utils.random_unicode() mgr.grant_user_access = Mock() user.grant_user_access(db_names, strict=strict) mgr.grant_user_access.assert_called_once_with(user, db_names, strict=strict) def test_clt_revoke_user_access(self): clt = self.client inst = self.instance inst.revoke_user_access = Mock() user = utils.random_unicode() db_names = utils.random_unicode() clt.revoke_user_access(inst, user, db_names) inst.revoke_user_access.assert_called_once_with(user, db_names, strict=True) def test_user_revoke_user_access(self): inst = self.instance mgr = inst.manager user = CloudDatabaseUser(mgr, info={"name": "fake"}) db_names = utils.random_unicode() strict = utils.random_unicode() mgr.revoke_user_access = Mock() user.revoke_user_access(db_names, strict=strict) mgr.revoke_user_access.assert_called_once_with(user, db_names, strict=strict) def test_clt_restart(self): clt = self.client inst = self.instance inst.restart = Mock() clt.restart(inst) inst.restart.assert_called_once_with() @patch("pyrax.manager.BaseManager", new=fakes.FakeManager) def test_inst_resize(self): clt = self.client inst = self.instance inst.resize = Mock() clt.resize(inst, "flavor") inst.resize.assert_called_once_with("flavor") def test_get_limits(self): self.assertRaises(NotImplementedError, self.client.get_limits) @patch("pyrax.manager.BaseManager", new=fakes.FakeManager) def test_list_flavors(self): clt = self.client clt._flavor_manager.list = Mock() limit = utils.random_unicode() marker = utils.random_unicode() clt.list_flavors(limit=limit, marker=marker) clt._flavor_manager.list.assert_called_once_with(limit=limit, marker=marker) @patch("pyrax.manager.BaseManager", new=fakes.FakeManager) def test_get_flavor(self): clt = self.client clt._flavor_manager.get = Mock() clt.get_flavor("flavorid") clt._flavor_manager.get.assert_called_once_with("flavorid") @patch("pyrax.manager.BaseManager", new=fakes.FakeManager) def test_get_flavor_ref_for_obj(self): clt = self.client info = {"id": 1, "name": "test_flavor", "ram": 42, "links": [{ "href": example_uri, "rel": "self"}]} flavor_obj = CloudDatabaseFlavor(clt._manager, info) ret = clt._get_flavor_ref(flavor_obj) self.assertEqual(ret, example_uri) @patch("pyrax.manager.BaseManager", new=fakes.FakeManager) def test_get_flavor_ref_for_id(self): clt = self.client info = {"id": 1, "name": "test_flavor", "ram": 42, "links": [{ "href": example_uri, "rel": "self"}]} flavor_obj = CloudDatabaseFlavor(clt._manager, info) clt.get_flavor = Mock(return_value=flavor_obj) ret = clt._get_flavor_ref(1) self.assertEqual(ret, example_uri) @patch("pyrax.manager.BaseManager", new=fakes.FakeManager) def test_get_flavor_ref_for_name(self): clt = self.client info = {"id": 1, "name": "test_flavor", "ram": 42, "links": [{ "href": example_uri, "rel": "self"}]} flavor_obj = CloudDatabaseFlavor(clt._manager, info) clt.get_flavor = Mock(side_effect=exc.NotFound("")) clt.list_flavors = Mock(return_value=[flavor_obj]) ret = clt._get_flavor_ref("test_flavor") self.assertEqual(ret, example_uri) @patch("pyrax.manager.BaseManager", new=fakes.FakeManager) def test_get_flavor_ref_for_ram(self): clt = self.client info = {"id": 1, "name": "test_flavor", "ram": 42, "links": [{ "href": example_uri, "rel": "self"}]} flavor_obj = CloudDatabaseFlavor(clt._manager, info) clt.get_flavor = Mock(side_effect=exc.NotFound("")) clt.list_flavors = Mock(return_value=[flavor_obj]) ret = clt._get_flavor_ref(42) self.assertEqual(ret, example_uri) @patch("pyrax.manager.BaseManager", new=fakes.FakeManager) def test_get_flavor_ref_not_found(self): clt = self.client info = {"id": 1, "name": "test_flavor", "ram": 42, "links": [{ "href": example_uri, "rel": "self"}]} flavor_obj = CloudDatabaseFlavor(clt._manager, info) clt.get_flavor = Mock(side_effect=exc.NotFound("")) clt.list_flavors = Mock(return_value=[flavor_obj]) self.assertRaises(exc.FlavorNotFound, clt._get_flavor_ref, "nonsense") def test_clt_list_backups(self): clt = self.client mgr = clt._backup_manager mgr.list = Mock() clt.list_backups() mgr.list.assert_called_once_with(instance=None, limit=20, marker=0) def test_clt_list_backups_for_instance(self): clt = self.client mgr = clt._backup_manager mgr.list = Mock() inst = utils.random_unicode() clt.list_backups(instance=inst) mgr.list.assert_called_once_with(instance=inst, limit=20, marker=0) def test_clt_get_backup(self): clt = self.client mgr = clt._backup_manager mgr.get = Mock() backup = utils.random_unicode() clt.get_backup(backup) mgr.get.assert_called_once_with(backup) def test_clt_delete_backup(self): clt = self.client mgr = clt._backup_manager mgr.delete = Mock() backup = utils.random_unicode() clt.delete_backup(backup) mgr.delete.assert_called_once_with(backup) def test_clt_create_backup(self): clt = self.client inst = self.instance name = utils.random_unicode() description = utils.random_unicode() inst.create_backup = Mock() clt.create_backup(inst, name, description=description) inst.create_backup.assert_called_once_with(name, description=description) def test_clt_restore_backup(self): clt = self.client mgr = clt._manager backup = utils.random_unicode() name = utils.random_unicode() flavor = utils.random_unicode() volume = utils.random_unicode() mgr.restore_backup = Mock() clt.restore_backup(backup, name, flavor, volume) mgr.restore_backup.assert_called_once_with(backup, name, flavor, volume) @patch("pyrax.manager.BaseManager", new=fakes.FakeManager) def test_create_body_db(self): mgr = self.instance._database_manager nm = utils.random_unicode() ret = mgr._create_body(nm, character_set="CS", collate="CO") expected = {"databases": [ {"name": nm, "character_set": "CS", "collate": "CO"}]} self.assertEqual(ret, expected) @patch("pyrax.manager.BaseManager", new=fakes.FakeManager) def test_create_body_user(self): inst = self.instance mgr = inst._user_manager nm = utils.random_unicode() pw = utils.random_unicode() dbnames = [utils.random_unicode(), utils.random_unicode()] ret = mgr._create_body(nm, password=pw, database_names=dbnames) expected = {"users": [ {"name": nm, "password": pw, "databases": [{"name": dbnames[0]}, {"name": dbnames[1]}]}]} self.assertEqual(ret, expected) @patch("pyrax.manager.BaseManager", new=fakes.FakeManager) def test_create_body_user_host(self): inst = self.instance mgr = inst._user_manager nm = utils.random_unicode() host = utils.random_unicode() pw = utils.random_unicode() dbnames = [utils.random_unicode(), utils.random_unicode()] ret = mgr._create_body(nm, host=host, password=pw, database_names=dbnames) expected = {"users": [ {"name": nm, "password": pw, "host": host, "databases": [{"name": dbnames[0]}, {"name": dbnames[1]}]}]} self.assertEqual(ret, expected) @patch("pyrax.manager.BaseManager", new=fakes.FakeManager) def test_create_body_flavor(self): clt = self.client nm = utils.random_unicode() clt._get_flavor_ref = Mock(return_value=example_uri) ret = clt._manager._create_body(nm) expected = {"instance": { "name": nm, "flavorRef": example_uri, "volume": {"size": 1}, "databases": [], "users": []}} self.assertEqual(ret, expected) @patch("pyrax.manager.BaseManager", new=fakes.FakeManager) def test_missing_db_parameters(self): clt = self.client nm = utils.random_unicode() clt._get_flavor_ref = Mock(return_value=example_uri) self.assertRaises(exc.MissingCloudDatabaseParameter, clt._manager._create_body,nm, version="10") @patch("pyrax.manager.BaseManager", new=fakes.FakeManager) def test_create_body_datastore(self): clt = self.client nm = utils.random_unicode() clt._get_flavor_ref = Mock(return_value=example_uri) ret = clt._manager._create_body(nm, version="10", type="MariaDB") expected = {"instance": { "name": nm, "flavorRef": example_uri, "volume": {"size": 1}, "databases": [], "users": [], "datastore": {"type": "MariaDB", "version": "10"}}} self.assertEqual(ret, expected) if __name__ == "__main__": unittest.main()
def enum(*sequential, **named): enums = dict(zip(sequential, range(len(sequential))), **named) return type('Enum', (), enums) def InitDebugTagTypes(): return enum( 'GroupToParagraph', 'MergeSubtitles', 'PrintSubtitles', 'File' ) def InitDebugTags(): DebugTagType = InitDebugTagTypes() debugTags = [] debugTags.append(DebugTagType.GroupToParagraph) #debugTags.append(DebugTagType.MergeSubtitles) debugTags.append(DebugTagType.PrintSubtitles) #debugTags.append(DebugTagType.File) return debugTags
""" Builtin vars node. Not used much, esp. not in the form with arguments. Maybe used in some meta programming, and hopefully can be predicted, because at run time, it is hard to support. """ from .ExpressionBases import ExpressionChildHavingBase class ExpressionBuiltinVars(ExpressionChildHavingBase): kind = "EXPRESSION_BUILTIN_VARS" named_child = "source" def __init__(self, source, source_ref): ExpressionChildHavingBase.__init__(self, value=source, source_ref=source_ref) def computeExpression(self, trace_collection): # TODO: Should be possible to predict this. trace_collection.onExceptionRaiseExit(BaseException) return self, None, None
import feedparser import socket from urllib.request import Request, urlopen class Bot: def __init__(self, host, port, nick, ident, realname, testchannel): self.host = host self.port = port self.nick = nick self.ident = ident self.realname = realname self.testchannel = testchannel self.readbuffer = "" self.connection = None @property def connect_to_server(self): self.connection = socket.socket() self.connection.connect((self.host, int(self.port))) print("Connecting...") return self.connection def set_nick(self): self.connection.send(("NICK %s\r\n" % self.nick).encode('utf-8')) print("Sending Nick request.") self.connection.send(("USER %s %s bla :%s\r\n" % (self.ident, self.host, self.realname)).encode('utf-8')) print("Sending User info.") def join_channel(self): self.connection.send(("JOIN %s\r\n" % self.testchannel).encode('utf-8')) print("Joining %s." % self.testchannel) def ping_pong(self, line): self.connection.send(("PONG %s\r\n" % line[1]).encode('utf-8')) def parse_irc_line(self, line, run_loop): print(line) line_split = line.split() if line_split[0] == "PING": self.ping_pong(line_split) elif line_split[0] == (":" + self.host) or line_split[0] == (":" + self.nick) or len(line_split) < 4: pass elif line_split[3] == (":" + self.nick): run_loop = self.parse_message(line_split, run_loop) return run_loop def parse_message(self, line_split, run_loop): sender = line_split[0].split("~")[1].split("@")[0] message = line_split[4:] if message[0] == "Hello!": print("Responding to \"Hello\" from %s." % sender) self.connection.send(("PRIVMSG %s :Hello %s!\r\n" % (self.testchannel, sender)).encode('utf-8')) elif message[0] == "Bye!": self.connection.send(("PRIVMSG %s :Good bye!\r\n" % self.testchannel).encode('utf-8')) print("Quiting IRC.") self.connection.send("QUIT\r\n".encode('utf-8')) run_loop = 0 elif message[0] == "news": try: if message[1] == "defcon": url = 'https://defcon.org/defconrss.xml' elif message[1] == "reddit": try: if message[2] == "security": linkpath = "security" elif message[2] == "netsec": linkpath = "netsec" else: linkpath = "" url = ("https://www.reddit.com/r/%s/.rss" % linkpath) except IndexError: url = "https://www.reddit.com/.rss" else: url = "https://news.google.com/news?&topic=tc&output=rss" except IndexError: url = "https://news.google.com/news?&topic=tc&output=rss" self.get_news(url) elif message[0] == "stock": try: self.get_stock(message[1]) except IndexError: send_message = ("PRIVMSG %s :%s Missing stock symbol.\r\n" % (self.testchannel, sender)).encode('utf-8') self.connection.send(send_message) return run_loop def get_stock(self, symbol): quote = urlopen(Request('http://finance.yahoo.com/d/quotes.csv?s=%s&f=l1' % symbol)) compname = urlopen(Request('http://finance.yahoo.com/d/quotes.csv?s=%s&f=n' % symbol)) amount = quote.read().decode('utf-8').strip() name = str(compname.read().decode('utf-8').strip()) self.connection.send(("PRIVMSG #%s :%s is at %s.\r\n" % (self.testchannel, name, amount)).encode('utf-8')) def get_news(self, url): rawdata = feedparser.parse(url) self.connection.send(("PRIVMSG %s :%s\r\n" % (self.testchannel, rawdata.entries[0].title)).encode('utf-8')) self.connection.send(("PRIVMSG %s :%s\r\n" % (self.testchannel, rawdata.entries[0].link)).encode('utf-8'))
__author__ = "Markus Gumbel" __copyright__ = "The authors" __license__ = "Apache 2" __email__ = "m.gumbel@hs-mannheim.de" __status__ = "Test" from math import pi as PI from Core.CellType import CellType from Core.ExecConfig import ExecConfig from Core.ModelConfig import ModelConfig from Steppable.InitializerSteppable import InitializerSteppable from Test.Steppable.MonitorSteppable import MonitorSteppable class SphereTest(ModelConfig): ''' Some experiments on a cell's shape. ''' def __init__(self, sim, simthread): ModelConfig.__init__(self, sim, simthread) def _initModel(self): self.name = "SphereTest" self.adhFactor = 0.5 # average adhesion = 0.5 self.cellTypes = self._createCellTypes() self.energyMatrix = self._createEnergyMatrix() self._run() # Must be the last statement. def _createCellTypes(self): cellTypes = [] medium = CellType(name="Medium", frozen=True, minDiameter=0, maxDiameter=0, growthVolumePerDay=0, nutrientRequirement=0, apoptosisTimeInDays=0, volFit=1.0, surFit=1.0) cellTypes.append(medium) cell = CellType(name="Cell", minDiameter=20, maxDiameter=20, growthVolumePerDay=10 * self.calcVolume(10), nutrientRequirement=1.0, apoptosisTimeInDays=180000, volFit=0.9, surFit=0.5) cellTypes.append(cell) return cellTypes def _initCells(self, stepable): r = self.cellTypes[1].getAvgDiameter() / 2.0 length = PI ** (1.0 / 2.0) * r if self.execConfig.dimensions == 2 \ else (4.0 / 3.0 * PI) ** (1.0 / 3.0) * r x = self.execConfig.xLength * 0.3 - length / 2.0 y = self.execConfig.yLength * 0.3 - length / 2.0 z = self.execConfig.zLength * 0.3 - length / 2.0 \ if self.execConfig.dimensions == 3 else 0 xl = length yl = length zl = 1 if self.execConfig.dimensions == 2 else length self._addCubicCell(0, x, y, z, xl, yl, zl, stepable) x = self.execConfig.xLength * 0.7 - length / 2.0 y = self.execConfig.yLength * 0.7 - length / 2.0 z = self.execConfig.zLength * 0.7 - length / 2.0 \ if self.execConfig.dimensions == 3 else 0 self._addCubicCell(1, x, y, z, xl, yl, zl, stepable) def _getSteppables(self): steppableList = [] steppableList.append(InitializerSteppable(self.sim, self)) steppableList.append(MonitorSteppable(self.sim, self)) return steppableList def _createExecConfig(self): return ExecConfig(xLength=70, yLength=70, zLength=70, voxelDensity=1.5)
from jinja2 import Environment, FileSystemLoader import os import pathlib from typing import List root_directory = pathlib.Path( os.path.realpath(os.path.dirname(os.path.realpath(__file__))) ).parent.parent print(root_directory) jinja_env = Environment( loader=FileSystemLoader(str(root_directory / "templates" / "poms")), keep_trailing_newline=True, ) def render(template_name: str, output_name: str, **kwargs): template = jinja_env.get_template(template_name) t = template.stream(kwargs) directory = os.path.dirname(output_name) if not os.path.isdir(directory): os.makedirs(directory) t.dump(str(output_name))
from keystoneclient.v2_0 import client as keystoneclient from heatclient import client as heatclient from Deployer import Deployer import uuid import logging HEAT_VERSION = '1' class HeatclientProvider(): @staticmethod def get_heatclient(extras): # first, a connection to keystone has to be established in order to load the service catalog for the orchestration endpoint (heat) # the design_uri has to be given in the sm.cfg file so that no other OpenStack deployment can be used kc = keystoneclient.Client(auth_url=extras['design_uri'], username=extras['username'], password=extras['password'], tenant_name=extras['tenant_name'] ) # get the orchestration part of the service catalog orch = kc.service_catalog.get_endpoints(service_type='orchestration', region_name=extras['region'], endpoint_type='publicURL' ) # create a heat client with acquired public endpoint # if the correct region had been given, there is supposed to be but one entry for the orchestrator URLs hc = heatclient.Client(HEAT_VERSION, endpoint=orch['orchestration'][0]['publicURL'],token=kc.auth_token) return hc class OpenstackDeployer(Deployer): def __init__(self, *args, **kwargs): """Create a heatclient instance. In kwargs, the following values have to be set: design_uri, username, password, tenant_name and region. These credentials need to be a valid Openstack login. """ self.logger = logging.getLogger("disco") ch = logging.StreamHandler() ch.setLevel(logging.INFO) formatter = logging.Formatter('%(asctime)s - %(name)s - %(levelname)s - %(message)s') ch.setFormatter(formatter) self.stack_name = args[0]['stack_name'] self.logger.addHandler(ch) self.hc = HeatclientProvider.get_heatclient(args[0]) def deploy(self, heatTemplate): """Deploy given Heat template on Openstack. :param heatTemplate: Heat template as a string which describes the cluster :return: stack.create's return value if successful, otherwise the thrown Exception """ # set the required attributes (stack name and Heat template) to what is needed heatTemplate = heatTemplate.rstrip() body = { 'stack_name': self.stack_name, 'template': heatTemplate } self.logger.info('the stack\'s name is '+body['stack_name']) tmp = None try: tmp = self.hc.stacks.create(**body) except Exception as e: tmp = e return tmp def retrieve(self, stack_id): ''' retrieve the requested output values given in list :param stack_id: ID of requested stack's outputs :return: each available requested output value as dictionary or None in case of exception ''' current_stack = self.hc.stacks.get(stack_id) return_value = {} if current_stack.stack_status=="CREATE_FAILED": current_stack.outputs.append({'output_key':'stack_status_reason','output_value':current_stack.stack_status_reason}) try: return current_stack.outputs except: return None # the value will be saved among the attributes which will be returned to the user return return_value def delete(self, stack_id): """ delete will delete the stack with the given stack id from OpenStack :param stack_id: stack's id on OpenStack :return: True for successful, False otherwise """ try: body = { 'stack_id': stack_id } try: self.hc.stacks.delete(**body) except: return False return True except: return False
N = int(input()) for i in range(0,N): nums = input().split(" ") X = int(nums[0]) Y = int(nums[1]) if(Y == 0): print("divisao impossivel") else: print("{0:.1f}".format(X/Y))
"""Classes and global objects related to resolving U{XML Namespaces<http://www.w3.org/TR/2006/REC-xml-names-20060816/index.html>}.""" import pyxb_114 import os import fnmatch import pyxb_114.utils.utility import archive import utility class _Resolvable_mixin (pyxb_114.cscRoot): """Mix-in indicating that this object may have references to unseen named components. This class is mixed-in to those XMLSchema components that have a reference to another component that is identified by a QName. Resolution of that component may need to be delayed if the definition of the component has not yet been read. """ #_TraceResolution = True _TraceResolution = False def isResolved (self): """Determine whether this named component is resolved. Override this in the child class.""" raise pyxb_114.LogicError('Resolved check not implemented in %s' % (self.__class__,)) def _resolve (self): """Perform whatever steps are required to resolve this component. Resolution is performed in the context of the namespace to which the component belongs. Invoking this method may fail to complete the resolution process if the component itself depends on unresolved components. The sole caller of this should be L{_NamespaceResolution_mixin.resolveDefinitions}. This method is permitted (nay, encouraged) to raise an exception if resolution requires interpreting a QName and the named component cannot be found. Override this in the child class. In the prefix, if L{isResolved} is true, return right away. If something prevents you from completing resolution, invoke L{self._queueForResolution()} (so it is retried later) and immediately return self. Prior to leaving after successful resolution discard any cached dom node by setting C{self.__domNode=None}. @return: C{self}, whether or not resolution succeeds. @raise pyxb_114.SchemaValidationError: if resolution requlres a reference to an unknown component """ raise pyxb_114.LogicError('Resolution not implemented in %s' % (self.__class__,)) def _queueForResolution (self, why=None, depends_on=None): """Short-hand to requeue an object if the class implements _namespaceContext(). """ if (why is not None) and self._TraceResolution: print 'Resolution delayed for %s: %s\n\tDepends on: %s' % (self, why, depends_on) self._namespaceContext().queueForResolution(self, depends_on) class _NamespaceResolution_mixin (pyxb_114.cscRoot): """Mix-in that aggregates those aspects of XMLNamespaces relevant to resolving component references. """ # A set of namespaces which some schema imported while processing with # this namespace as target. __importedNamespaces = None # A set of namespaces which appear in namespace declarations of schema # with this namespace as target. __referencedNamespaces = None # A list of Namespace._Resolvable_mixin instances that have yet to be # resolved. __unresolvedComponents = None # A map from Namespace._Resolvable_mixin instances in # __unresolvedComponents to sets of other unresolved objects on which they # depend. __unresolvedDependents = None def _reset (self): """CSC extension to reset fields of a Namespace. This one handles component-resolution--related data.""" getattr(super(_NamespaceResolution_mixin, self), '_reset', lambda *args, **kw: None)() self.__unresolvedComponents = [] self.__unresolvedDependents = {} self.__importedNamespaces = set() self.__referencedNamespaces = set() def _getState_csc (self, kw): kw.update({ 'importedNamespaces': self.__importedNamespaces, 'referencedNamespaces': self.__referencedNamespaces, }) return getattr(super(_NamespaceResolution_mixin, self), '_getState_csc', lambda _kw: _kw)(kw) def _setState_csc (self, kw): self.__importedNamespaces = kw['importedNamespaces'] self.__referencedNamespaces = kw['referencedNamespaces'] return getattr(super(_NamespaceResolution_mixin, self), '_setState_csc', lambda _kw: self)(kw) def importNamespace (self, namespace): self.__importedNamespaces.add(namespace) return self def _referenceNamespace (self, namespace): self._activate() self.__referencedNamespaces.add(namespace) return self def importedNamespaces (self): """Return the set of namespaces which some schema imported while processing with this namespace as target.""" return frozenset(self.__importedNamespaces) def _transferReferencedNamespaces (self, module_record): assert isinstance(module_record, archive.ModuleRecord) module_record._setReferencedNamespaces(self.__referencedNamespaces) self.__referencedNamespaces.clear() def referencedNamespaces (self): """Return the set of namespaces which appear in namespace declarations of schema with this namespace as target.""" return frozenset(self.__referencedNamespaces) rn = self.__referencedNamespaces.copy() for mr in self.moduleRecords(): if mr.isIncorporated(): rn.update(mr.referencedNamespaces()) return rn def queueForResolution (self, resolvable, depends_on=None): """Invoked to note that a component may have references that will need to be resolved. Newly created named components are often unresolved, as are components which, in the course of resolution, are found to depend on another unresolved component. @param resolvable: An instance of L{_Resolvable_mixin} that is later to be resolved. @keyword depends_on: C{None}, or an instance of L{_Resolvable_mixin} which C{resolvable} requires to be resolved in order to resolve itself. @return: C{resolvable} """ assert isinstance(resolvable, _Resolvable_mixin) if not resolvable.isResolved(): assert depends_on is None or isinstance(depends_on, _Resolvable_mixin) self.__unresolvedComponents.append(resolvable) if depends_on is not None and not depends_on.isResolved(): import pyxb_114.xmlschema.structures assert isinstance(depends_on, _Resolvable_mixin) assert isinstance(depends_on, pyxb_114.xmlschema.structures._NamedComponent_mixin) self.__unresolvedDependents.setdefault(resolvable, set()).add(depends_on) return resolvable def needsResolution (self): """Return C{True} iff this namespace has not been resolved.""" return self.__unresolvedComponents is not None def _replaceComponent_csc (self, existing_def, replacement_def): """Replace a component definition if present in the list of unresolved components. """ try: index = self.__unresolvedComponents.index(existing_def) print 'Replacing unresolved %s' % (existing_def,) if (replacement_def is None) or (replacement_def in self.__unresolvedComponents): del self.__unresolvedComponents[index] else: assert isinstance(replacement_def, _Resolvable_mixin) self.__unresolvedComponents[index] = replacement_def # Rather than assume the replacement depends on the same # resolvables as the original, just wipe the dependency record: # it'll get recomputed later if it's still important. if existing_def in self.__unresolvedDependents: del self.__unresolvedDependents[existing_def] except ValueError: pass return getattr(super(_NamespaceResolution_mixin, self), '_replaceComponent_csc', lambda *args, **kw: replacement_def)(existing_def, replacement_def) def resolveDefinitions (self, allow_unresolved=False): """Loop until all references within the associated resolvable objects have been resolved. This method iterates through all components on the unresolved list, invoking the _resolve method of each. If the component could not be resolved in this pass, it iis placed back on the list for the next iteration. If an iteration completes without resolving any of the unresolved components, a pyxb_114.NotInNamespaceError exception is raised. @note: Do not invoke this until all top-level definitions for the namespace have been provided. The resolution routines are entitled to raise a validation exception if a reference to an unrecognized component is encountered. """ num_loops = 0 if not self.needsResolution(): return True while 0 < len(self.__unresolvedComponents): # Save the list of unresolved objects, reset the list to capture # any new objects defined during resolution, and attempt the # resolution for everything that isn't resolved. unresolved = self.__unresolvedComponents #print 'Looping for %d unresolved definitions: %s' % (len(unresolved), ' '.join([ str(_r) for _r in unresolved])) num_loops += 1 #assert num_loops < 18 self.__unresolvedComponents = [] self.__unresolvedDependents = {} for resolvable in unresolved: # Attempt the resolution. resolvable._resolve() # Either we resolved it, or we queued it to try again later assert resolvable.isResolved() or (resolvable in self.__unresolvedComponents), 'Lost resolvable %s' % (resolvable,) # We only clone things that have scope None. We never # resolve things that have scope None. Therefore, we # should never have resolved something that has # clones. if (resolvable.isResolved() and (resolvable._clones() is not None)): assert False if self.__unresolvedComponents == unresolved: if allow_unresolved: return False # This only happens if we didn't code things right, or the # there is a circular dependency in some named component # (i.e., the schema designer didn't do things right). failed_components = [] import pyxb_114.xmlschema.structures for d in self.__unresolvedComponents: if isinstance(d, pyxb_114.xmlschema.structures._NamedComponent_mixin): failed_components.append('%s named %s' % (d.__class__.__name__, d.name())) else: if isinstance(d, pyxb_114.xmlschema.structures.AttributeUse): print d.attributeDeclaration() failed_components.append('Anonymous %s' % (d.__class__.__name__,)) raise pyxb_114.NotInNamespaceError('Infinite loop in resolution:\n %s' % ("\n ".join(failed_components),)) # Replace the list of unresolved components with None, so that # attempts to subsequently add another component fail. self.__unresolvedComponents = None self.__unresolvedDependents = None # NOTE: Dependencies may require that we keep these around for a while # longer. # # Remove the namespace context from everything, since we won't be # resolving anything else. self._releaseNamespaceContexts() return True def _unresolvedComponents (self): """Returns a reference to the list of unresolved components.""" return self.__unresolvedComponents def _unresolvedDependents (self): """Returns a map from unresolved components to sets of components that must be resolved first.""" return self.__unresolvedDependents def ResolveSiblingNamespaces (sibling_namespaces): """Resolve all components in the sibling_namespaces. @param sibling_namespaces : A set of namespaces expected to be closed under dependency.""" for ns in sibling_namespaces: ns.configureCategories([archive.NamespaceArchive._AnonymousCategory()]) ns.validateComponentModel() def cmp_for_deps (ns1, ns2): """Sort namespaces so dependencies get resolved first""" if ns2 not in dependency_map.get(ns1, set()): return -1 if ns1 not in dependency_map.get(ns2, set()): return 1 return 0 need_resolved_set = set(sibling_namespaces) dependency_map = {} last_state = None while need_resolved_set: need_resolved_list = list(need_resolved_set) if dependency_map: need_resolved_list.sort(cmp_for_deps) need_resolved_set = set() dependency_map = {} for ns in need_resolved_list: if not ns.needsResolution(): continue #print 'Attempting resolution %s' % (ns.uri(),) if not ns.resolveDefinitions(allow_unresolved=True): print 'Holding incomplete resolution %s' % (ns.uri(),) deps = dependency_map.setdefault(ns, set()) for (c, dcs) in ns._unresolvedDependents().iteritems(): for dc in dcs: dns = dc.expandedName().namespace() if dns != ns: deps.add(dns) print '%s depends on %s' % (ns, ' ; '.join([ str(_dns) for _dns in deps ])) need_resolved_set.add(ns) # Exception termination check: if we have the same set of incompletely # resolved namespaces, and each has the same number of unresolved # components, assume there's an truly unresolvable dependency: either # due to circularity, or because there was an external namespace that # was missed from the sibling list. state = [] for ns in need_resolved_set: state.append( (ns, len(ns._unresolvedComponents())) ) state = tuple(state) if last_state == state: raise pyxb_114.LogicError('Unexpected external dependency in sibling namespaces: %s' % ("\n ".join( [str(_ns) for _ns in need_resolved_set ]),)) last_state = state class NamespaceContext (object): """Records information associated with namespaces at a DOM node. """ def __str__ (self): rv = [ 'NamespaceContext ' ] if self.defaultNamespace() is not None: rv.extend([ '(defaultNamespace=', str(self.defaultNamespace()), ') ']) if self.targetNamespace() is not None: rv.extend([ '(targetNamespace=', str(self.targetNamespace()), ') ']) rv.append("\n") for (pfx, ns) in self.inScopeNamespaces().items(): if pfx is not None: rv.append(' xmlns:%s=%s' % (pfx, str(ns))) return ''.join(rv) __TargetNamespaceAttributes = { } @classmethod def _AddTargetNamespaceAttribute (cls, expanded_name, attribute_name): assert expanded_name is not None cls.__TargetNamespaceAttributes[expanded_name] = attribute_name @classmethod def _TargetNamespaceAttribute (cls, expanded_name): return cls.__TargetNamespaceAttributes.get(expanded_name, None) # Support for holding onto referenced namespaces until we have a target # namespace to give them to. __pendingReferencedNamespaces = None def defaultNamespace (self): """The default namespace in effect at this node. E.g., C{xmlns="URN:default"}.""" return self.__defaultNamespace __defaultNamespace = None # If C{True}, this context is within a schema that has no target # namespace, and we should use the target namespace as a fallback if no # default namespace is available and no namespace prefix appears on a # QName. This situation arises when a top-level schema has an absent # target namespace, or when a schema with an absent target namespace is # being included into a schema with a non-absent target namespace. __fallbackToTargetNamespace = False def targetNamespace (self): """The target namespace in effect at this node. Usually from the C{targetNamespace} attribute. If no namespace is specified for the schema, an absent namespace was assigned upon creation and will be returned.""" return self.__targetNamespace __targetNamespace = None def inScopeNamespaces (self): """Map from prefix strings to L{Namespace} instances associated with those prefixes. The prefix C{None} identifies the default namespace.""" return self.__inScopeNamespaces __inScopeNamespaces = None def prefixForNamespace (self, namespace): """Return a prefix associated with the given namespace in this context, or None if the namespace is the default or is not in scope.""" for (pfx, ns) in self.__inScopeNamespaces.items(): if namespace == ns: return pfx return None @classmethod def GetNodeContext (cls, node, **kw): """Get the L{NamespaceContext} instance that was assigned to the node. If none has been assigned and keyword parameters are present, create one treating this as the root node and the keyword parameters as configuration information (e.g., default_namespace). @raise pyxb_114.LogicError: no context is available and the keywords required to create one were not provided """ try: return node.__namespaceContext except AttributeError: return NamespaceContext(node, **kw) def setNodeContext (self, node): node.__namespaceContext = self def processXMLNS (self, prefix, uri): if not self.__mutableInScopeNamespaces: self.__inScopeNamespaces = self.__inScopeNamespaces.copy() self.__mutableInScopeNamespaces = True if uri: if prefix is None: ns = self.__defaultNamespace = utility.NamespaceForURI(uri, create_if_missing=True) self.__inScopeNamespaces[None] = self.__defaultNamespace else: ns = utility.NamespaceForURI(uri, create_if_missing=True) self.__inScopeNamespaces[prefix] = ns #if ns.prefix() is None: # ns.setPrefix(prefix) # @todo should we record prefix in namespace so we can use it # during generation? I'd rather make the user specify what to # use. if self.__targetNamespace: self.__targetNamespace._referenceNamespace(ns) else: self.__pendingReferencedNamespaces.add(ns) else: # NB: XMLNS 6.2 says that you can undefine a default # namespace, but does not say anything explicitly about # undefining a prefixed namespace. XML-Infoset 2.2 # paragraph 6 implies you can do this, but expat blows up # if you try it. I don't think it's legal. if prefix is not None: raise pyxb_114.NamespaceError(self, 'Attempt to undefine non-default namespace %s' % (attr.localName,)) self.__inScopeNamespaces.pop(prefix, None) self.__defaultNamespace = None def finalizeTargetNamespace (self, tns_uri=None, including_context=None): if tns_uri is not None: assert 0 < len(tns_uri) # Do not prevent overwriting target namespace; need this for WSDL # files where an embedded schema inadvertently inherits a target # namespace from its enclosing definitions element. Note that if # we don't check this here, we do have to check it when schema # documents are included into parent schema documents. self.__targetNamespace = utility.NamespaceForURI(tns_uri, create_if_missing=True) elif self.__targetNamespace is None: if including_context is not None: self.__targetNamespace = including_context.targetNamespace() self.__fallbackToTargetNamespace = True elif tns_uri is None: self.__targetNamespace = utility.CreateAbsentNamespace() else: self.__targetNamespace = utility.NamespaceForURI(tns_uri, create_if_missing=True) if self.__pendingReferencedNamespaces is not None: [ self.__targetNamespace._referenceNamespace(_ns) for _ns in self.__pendingReferencedNamespaces ] self.__pendingReferencedNamespace = None assert self.__targetNamespace is not None if (not self.__fallbackToTargetNamespace) and self.__targetNamespace.isAbsentNamespace(): self.__fallbackToTargetNamespace = True def __init__ (self, dom_node=None, parent_context=None, including_context=None, recurse=True, default_namespace=None, target_namespace=None, in_scope_namespaces=None, expanded_name=None, finalize_target_namespace=True): # MUST BE True for WSDL to work with minidom """Determine the namespace context that should be associated with the given node and, optionally, its element children. @param dom_node: The DOM node @type dom_node: C{xml.dom.Element} @keyword parent_context: Optional value that specifies the context associated with C{dom_node}'s parent node. If not provided, only the C{xml} namespace is in scope. @type parent_context: L{NamespaceContext} @keyword recurse: If True (default), create namespace contexts for all element children of C{dom_node} @type recurse: C{bool} @keyword default_namespace: Optional value to set as the default namespace. Values from C{parent_context} would override this, as would an C{xmlns} attribute in the C{dom_node}. @type default_namespace: L{NamespaceContext} @keyword target_namespace: Optional value to set as the target namespace. Values from C{parent_context} would override this, as would a C{targetNamespace} attribute in the C{dom_node} @type target_namespace: L{NamespaceContext} @keyword in_scope_namespaces: Optional value to set as the initial set of in-scope namespaces. The always-present namespaces are added to this if necessary. @type in_scope_namespaces: C{dict} mapping C{string} to L{Namespace}. """ import builtin if dom_node is not None: try: assert dom_node.__namespaceContext is None except AttributeError: pass dom_node.__namespaceContext = self self.__defaultNamespace = default_namespace self.__targetNamespace = target_namespace self.__inScopeNamespaces = builtin._UndeclaredNamespaceMap self.__mutableInScopeNamespaces = False if in_scope_namespaces is not None: if parent_context is not None: raise LogicError('Cannot provide both parent_context and in_scope_namespaces') self.__inScopeNamespaces = builtin._UndeclaredNamespaceMap.copy() self.__inScopeNamespaces.update(in_scope_namespaces) self.__mutableInScopeNamespaces = True if parent_context is not None: self.__inScopeNamespaces = parent_context.inScopeNamespaces() self.__mutableInScopeNamespaces = False self.__defaultNamespace = parent_context.defaultNamespace() self.__targetNamespace = parent_context.targetNamespace() self.__fallbackToTargetNamespace = parent_context.__fallbackToTargetNamespace if self.__targetNamespace is None: self.__pendingReferencedNamespaces = set() attribute_map = {} if dom_node is not None: if expanded_name is None: expanded_name = pyxb_114.namespace.ExpandedName(dom_node) for ai in range(dom_node.attributes.length): attr = dom_node.attributes.item(ai) if builtin.XMLNamespaces.uri() == attr.namespaceURI: prefix = attr.localName if 'xmlns' == prefix: prefix = None self.processXMLNS(prefix, attr.value) else: if attr.namespaceURI is not None: uri = utility.NamespaceForURI(attr.namespaceURI, create_if_missing=True) key = pyxb_114.namespace.ExpandedName(uri, attr.localName) else: key = pyxb_114.namespace.ExpandedName(None, attr.localName) attribute_map[key] = attr.value if finalize_target_namespace: tns_uri = None tns_attr = self._TargetNamespaceAttribute(expanded_name) if tns_attr is not None: tns_uri = attribute_map.get(tns_attr) self.finalizeTargetNamespace(tns_uri, including_context=including_context) # Store in each node the in-scope namespaces at that node; # we'll need them for QName interpretation of attribute # values. if (dom_node is not None) and recurse: from xml.dom import Node assert Node.ELEMENT_NODE == dom_node.nodeType for cn in dom_node.childNodes: if Node.ELEMENT_NODE == cn.nodeType: NamespaceContext(cn, self, True) def interpretQName (self, name, namespace=None): """Convert the provided name into an L{ExpandedName}, i.e. a tuple of L{Namespace} and local name. If the name includes a prefix, that prefix must map to an in-scope namespace in this context. Absence of a prefix maps to L{defaultNamespace()}, which must be provided (or defaults to the target namespace, if that is absent). @param name: A QName. @type name: C{str} or C{unicode} @param name: Optional namespace to use for unqualified names when there is no default namespace. Note that a defined default namespace, even if absent, supersedes this value. @return: An L{ExpandedName} tuple: ( L{Namespace}, C{str} ) @raise pyxb_114.SchemaValidationError: The prefix is not in scope @raise pyxb_114.SchemaValidationError: No prefix is given and the default namespace is absent """ assert isinstance(name, (str, unicode)) if 0 <= name.find(':'): (prefix, local_name) = name.split(':', 1) assert self.inScopeNamespaces() is not None namespace = self.inScopeNamespaces().get(prefix) if namespace is None: raise pyxb_114.SchemaValidationError('No namespace declared for QName %s prefix' % (name,)) else: local_name = name # Context default supersedes caller-provided namespace if self.defaultNamespace() is not None: namespace = self.defaultNamespace() # If there's no default namespace, but there is a fallback # namespace, use that instead. if (namespace is None) and self.__fallbackToTargetNamespace: namespace = self.targetNamespace() if namespace is None: raise pyxb_114.SchemaValidationError('QName %s with absent default namespace cannot be resolved' % (local_name,)) # Anything we're going to look stuff up in requires a component model. # Make sure we can load one, unless we're looking up in the thing # we're constructing (in which case it's being built right now). if (namespace != self.targetNamespace()): namespace.validateComponentModel() return pyxb_114.namespace.ExpandedName(namespace, local_name) def queueForResolution (self, component, depends_on=None): """Forwards to L{queueForResolution()<Namespace.queueForResolution>} in L{targetNamespace()}.""" assert isinstance(component, _Resolvable_mixin) return self.targetNamespace().queueForResolution(component, depends_on)
""" django-critic: urls """ from django.conf.urls.defaults import patterns, url urlpatterns = patterns('critic.views', url(r'^add/$', 'add_rating', name='critic_add_rating'), url(r'^render/(?P<content_type_id>\d+)/(?P<object_id>\d+)/$', 'render_rating', name='critic_rating_render'), url(r'^user_rating/(?P<content_type_id>\d+)/(?P<object_id>\d+)/$', 'user_rating_json', name='critic_user_rating_json'), url(r'^data/(?P<content_type_id>\d+)/(?P<object_id>\d+)/(?P<option>.*)/$', 'rating_data_json', name='critic_rating_data_json_by_option'), url(r'^data/(?P<content_type_id>\d+)/(?P<object_id>\d+)/$', 'rating_data_json', name='critic_rating_data_json'), )
import logging from distutils.version import LooseVersion from moksha.common.lib.converters import asbool from moksha.hub.reactor import reactor try: # stomper is not ready for py3 try: # Try first to use modern stomp-1.1 import stomper.stomp_11 as stomper except ImportError: # Failing that, use whatever is available. try: import stomper except ImportError: pass from stomper.stompbuffer import StompBuffer from twisted.internet.protocol import Protocol class Base(Protocol, stomper.Engine): pass except ImportError: Base = object log = logging.getLogger(__name__) class StompProtocol(Base): def __init__(self, client, username='', password=''): stomper.Engine.__init__(self) self.username = username self.password = password self.counter = 1 self.client = client self.buffer = StompBuffer() def connected(self, msg): """Once connected, subscribe to message queues """ stomper.Engine.connected(self, msg) log.info("StompProtocol Connected: session %s." % msg['headers']['session']) # https://stomp.github.io/stomp-specification-1.1.html#Heart-beating server_heartbeat = msg['headers'].get('heart-beat', 0) if server_heartbeat: log.debug("(server wants heart-beat (%s))" % server_heartbeat) sx, sy = server_heartbeat.split(',') server_heartbeat = int(sy) self.client.connected(server_heartbeat) def subscribe(self, dest, **headers): f = stomper.Frame() # https://stomp.github.io/stomp-specification-1.2.html#SUBSCRIBE_ack_Header ack = self.client.hub.config.get('stomp_ack_mode', 'auto') if stomper.STOMP_VERSION != '1.0': f.unpack(stomper.subscribe(dest, dest, ack=ack)) else: f.unpack(stomper.subscribe(dest, ack=ack)) f.headers.update(headers) cmd = f.pack() log.debug(cmd) self.transport.write(cmd.encode('utf-8')) def connectionMade(self): """ Register with stomp server """ log.debug("Connecting with stomp-%s" % stomper.STOMP_VERSION) if stomper.STOMP_VERSION != '1.0': host, port = self.client.addresses[self.client.address_index] interval = (self.client.client_heartbeat, 0) log.debug("(proposing heartbeat of (%i,%i))" % interval) cmd = stomper.connect(self.username, self.password, host, interval) else: cmd = stomper.connect(self.username, self.password) log.debug(cmd) self.transport.write(cmd.encode('utf-8')) def error(self, msg): """ Extend stomper's own error method to kill the hub. """ super(StompProtocol, self).error(msg) log.error("Requesting shutdown of hub for STOMP error.") reactor.callLater(0, self.client.hub.close) reactor.callLater(0, reactor.stop) def ack(self, msg): """ Override stomper's own ack to be smarter, based on mode. """ # stomper does the incorrect thing when the ack mode is auto. It acks # every message, regardless of the mode. However, if the mode is # 'auto', then we should *not* send acks. Here, make sure we don't # send an ack in that mode. if self.client.hub.config.get('stomp_ack_mode', 'auto') == 'auto': return stomper.NO_REPONSE_NEEDED # Otherwise, do what stomper do if the mode is *not* auto. return super(StompProtocol, self).ack(msg) def dataReceived(self, data): """Data received, react to it and respond if needed """ self.buffer.appendData(data.decode('utf-8', errors='replace')) while True: msg = self.buffer.getOneMessage() if msg is None: break handled = self.client.hub.consume_stomp_message(msg) # See if stomper thinks we need to send anything back. response = self.react(msg) # If this kind of message doesn't need any response, then quit. if not response: log.debug("StompProtocol sending no response to broker.") return # Otherwise, see if we need to turn a naive 'ack' from stomper into # a 'nack' if our consumers failed to do their jobs. if handled is False and response.startswith("ACK\n"): send_nacks = asbool(self.client.hub.config.get('stomp_send_explicit_nacks', True)) if not send_nacks: log.warn("Message handling failed. stomp_send_explicit_nacks=%r. " "Sending no reply to the broker.", send_nacks) # Return, so as not to send an erroneous ack. return if LooseVersion(stomper.STOMP_VERSION) < LooseVersion('1.1'): log.error("Unable to NACK stomp %r" % stomper.STOMP_VERSION) # Also, not sending an erroneous ack. return message_id = msg['headers']['message-id'] subscription = msg['headers']['subscription'] transaction_id = msg['headers'].get('transaction-id') response = stomper.nack(message_id, subscription, transaction_id) # Finally, send our response (ACK or NACK) back to the broker. if not handled: log.warn("handled=%r. Responding with %s" % (handled, response)) else: log.debug("handled=%r. Responding with %s" % (handled, response)) self.transport.write(response.encode('utf-8'))
ATTR_NOT_SPECIFIED = object() SHARED = 'shared' import logging import netaddr import re from quantum.common import exceptions as q_exc LOG = logging.getLogger(__name__) def is_attr_set(attribute): return attribute not in (None, ATTR_NOT_SPECIFIED) def _validate_boolean(data, valid_values=None): if data in [True, False]: return else: msg = _("'%s' is not boolean") % data LOG.debug("validate_boolean: %s", msg) return msg def _validate_values(data, valid_values=None): if data in valid_values: return else: msg_dict = dict(data=data, values=valid_values) msg = _("%(data)s is not in %(values)s") % msg_dict LOG.debug("validate_values: %s", msg) return msg def _validate_string(data, max_len=None): if not isinstance(data, basestring): msg = _("'%s' is not a valid string") % data LOG.debug("validate_string: %s", msg) return msg if max_len is not None: if len(data) > max_len: msg = _("'%(data)s' exceeds maximum length of " "%(max_len)s.") % locals() LOG.debug("validate_string: %s", msg) return msg def _validate_range(data, valid_values=None): min_value = valid_values[0] max_value = valid_values[1] if data >= min_value and data <= max_value: return else: msg_dict = dict(data=data, min_value=min_value, max_value=max_value) msg = _("%(data)s is not in range %(min_value)s through " "%(max_value)s") % msg_dict LOG.debug("validate_range: %s", msg) return msg def _validate_mac_address(data, valid_values=None): try: netaddr.EUI(data) return except Exception: msg = _("'%s' is not a valid MAC address") % data LOG.debug("validate_mac_address: %s", msg) return msg def _validate_ip_address(data, valid_values=None): try: netaddr.IPAddress(data) return except Exception: msg = _("'%s' is not a valid IP address") % data LOG.debug("validate_ip_address: %s", msg) return msg def _validate_ip_pools(data, valid_values=None): """Validate that start and end IP addresses are present In addition to this the IP addresses will also be validated""" if not isinstance(data, list): msg = _("'%s' in not a valid IP pool") % data LOG.debug("validate_ip_pools: %s", msg) return msg expected_keys = set(['start', 'end']) try: for ip_pool in data: if set(ip_pool.keys()) != expected_keys: msg = _("Expected keys not found. Expected: %s " "Provided: %s") % (expected_keys, ip_pool.keys()) LOG.debug("validate_ip_pools: %s", msg) return msg for k in expected_keys: msg = _validate_ip_address(ip_pool[k]) if msg: LOG.debug("validate_ip_pools: %s", msg) return msg except KeyError, e: args = {'key_name': e.message, 'ip_pool': ip_pool} msg = _("Invalid input. Required key: '%(key_name)s' " "missing from %(ip_pool)s.") % args LOG.debug("validate_ip_pools: %s", msg) return msg except TypeError, e: msg = _("Invalid input. Pool %s must be a dictionary.") % ip_pool LOG.debug("validate_ip_pools: %s", msg) return msg except Exception: msg = _("'%s' in not a valid IP pool") % data LOG.debug("validate_ip_pools: %s", msg) return msg def _validate_fixed_ips(data, valid_values=None): if not isinstance(data, list): msg = _("'%s' in not a valid fixed IP") % data LOG.debug("validate_fixed_ips: %s", msg) return msg ips = [] try: for fixed_ip in data: if 'ip_address' in fixed_ip: msg = _validate_ip_address(fixed_ip['ip_address']) if msg: LOG.debug("validate_fixed_ips: %s", msg) return msg if 'subnet_id' in fixed_ip: msg = _validate_regex(fixed_ip['subnet_id'], UUID_PATTERN) if msg: LOG.debug("validate_fixed_ips: %s", msg) return msg # Ensure that duplicate entries are not set - just checking IP # suffices. Duplicate subnet_id's are legitimate. if 'ip_address' in fixed_ip: if fixed_ip['ip_address'] in ips: msg = _("Duplicate entry %s") % fixed_ip LOG.debug("validate_fixed_ips: %s", msg) return msg ips.append(fixed_ip['ip_address']) except Exception: msg = _("'%s' in not a valid fixed IP") % data LOG.debug("validate_fixed_ips: %s", msg) return msg def _validate_nameservers(data, valid_values=None): if not hasattr(data, '__iter__'): msg = _("'%s' in not a valid nameserver") % data LOG.debug("validate_nameservers: %s", msg) return msg ips = set() for ip in data: msg = _validate_ip_address(ip) if msg: # This may be a hostname msg = _validate_regex(ip, HOSTNAME_PATTERN) if msg: msg = _("'%s' in not a valid nameserver") % ip LOG.debug("validate_nameservers: %s", msg) return msg if ip in ips: msg = _("Duplicate nameserver %s") % ip LOG.debug("validate_nameservers: %s", msg) return msg ips.add(ip) def _validate_hostroutes(data, valid_values=None): if not isinstance(data, list): msg = _("'%s' in not a valid hostroute") % data LOG.debug("validate_hostroutes: %s", msg) return msg hostroutes = [] try: for hostroute in data: msg = _validate_subnet(hostroute['destination']) if msg: LOG.debug("validate_hostroutes: %s", msg) return msg msg = _validate_ip_address(hostroute['nexthop']) if msg: LOG.debug("validate_hostroutes: %s", msg) return msg if hostroute in hostroutes: msg = _("Duplicate hostroute %s") % hostroute LOG.debug("validate_hostroutes: %s", msg) if msg: return msg hostroutes.append(hostroute) except: msg = _("'%s' in not a valid hostroute") % data LOG.debug("validate_hostroutes: %s", msg) return msg def _validate_ip_address_or_none(data, valid_values=None): if data is None: return None return _validate_ip_address(data, valid_values) def _validate_subnet(data, valid_values=None): try: netaddr.IPNetwork(data) if len(data.split('/')) == 2: return except Exception: pass msg = _("'%s' is not a valid IP subnet") % data LOG.debug("validate_subnet: %s", msg) return msg def _validate_regex(data, valid_values=None): try: if re.match(valid_values, data): return except TypeError: pass msg = _("'%s' is not valid input") % data LOG.debug("validate_regex: %s", msg) return msg def convert_to_boolean(data): try: i = int(data) if i in [True, False]: # Ensure that the value is True or False if i: return True else: return False except (ValueError, TypeError): if (data == "True" or data == "true"): return True if (data == "False" or data == "false"): return False msg = _("'%s' is not boolean") % data raise q_exc.InvalidInput(error_message=msg) def convert_to_int(data): try: return int(data) except (ValueError, TypeError): msg = _("'%s' is not a integer") % data raise q_exc.InvalidInput(error_message=msg) def convert_kvp_str_to_list(data): """Convert a value of the form 'key=value' to ['key', 'value']. :raises: q_exc.InvalidInput if any of the strings are malformed (e.g. do not contain a key). """ kvp = [x.strip() for x in data.split('=', 1)] if len(kvp) == 2 and kvp[0]: return kvp msg = _("'%s' is not of the form <key>=[value]") % data raise q_exc.InvalidInput(error_message=msg) def convert_kvp_list_to_dict(kvp_list): """Convert a list of 'key=value' strings to a dict. :raises: q_exc.InvalidInput if any of the strings are malformed (e.g. do not contain a key) or if any of the keys appear more than once. """ if kvp_list == ['True']: # No values were provided (i.e. '--flag-name') return {} kvp_map = {} for kvp_str in kvp_list: key, value = convert_kvp_str_to_list(kvp_str) kvp_map.setdefault(key, set()) kvp_map[key].add(value) return dict((x, list(y)) for x, y in kvp_map.iteritems()) HOSTNAME_PATTERN = ("(?=^.{1,254}$)(^(?:(?!\d+\.|-)[a-zA-Z0-9_\-]" "{1,63}(?<!-)\.?)+(?:[a-zA-Z]{2,})$)") HEX_ELEM = '[0-9A-Fa-f]' UUID_PATTERN = '-'.join([HEX_ELEM + '{8}', HEX_ELEM + '{4}', HEX_ELEM + '{4}', HEX_ELEM + '{4}', HEX_ELEM + '{12}']) MAC_PATTERN = "^%s[aceACE02468](:%s{2}){5}$" % (HEX_ELEM, HEX_ELEM) validators = {'type:boolean': _validate_boolean, 'type:values': _validate_values, 'type:string': _validate_string, 'type:range': _validate_range, 'type:mac_address': _validate_mac_address, 'type:fixed_ips': _validate_fixed_ips, 'type:ip_address': _validate_ip_address, 'type:ip_address_or_none': _validate_ip_address_or_none, 'type:subnet': _validate_subnet, 'type:regex': _validate_regex, 'type:ip_pools': _validate_ip_pools, 'type:hostroutes': _validate_hostroutes, 'type:nameservers': _validate_nameservers} RESOURCE_ATTRIBUTE_MAP = { 'networks': { 'id': {'allow_post': False, 'allow_put': False, 'validate': {'type:regex': UUID_PATTERN}, 'is_visible': True}, 'name': {'allow_post': True, 'allow_put': True, 'validate': {'type:string': None}, 'default': '', 'is_visible': True}, 'subnets': {'allow_post': False, 'allow_put': False, 'default': [], 'is_visible': True}, 'admin_state_up': {'allow_post': True, 'allow_put': True, 'default': True, 'convert_to': convert_to_boolean, 'validate': {'type:boolean': None}, 'is_visible': True}, 'status': {'allow_post': False, 'allow_put': False, 'is_visible': True}, 'tenant_id': {'allow_post': True, 'allow_put': False, 'validate': {'type:string': None}, 'required_by_policy': True, 'is_visible': True}, SHARED: {'allow_post': True, 'allow_put': True, 'default': False, 'convert_to': convert_to_boolean, 'validate': {'type:boolean': None}, 'is_visible': True, 'required_by_policy': True, 'enforce_policy': True}, }, 'ports': { 'id': {'allow_post': False, 'allow_put': False, 'validate': {'type:regex': UUID_PATTERN}, 'is_visible': True}, 'name': {'allow_post': True, 'allow_put': True, 'default': '', 'validate': {'type:string': None}, 'is_visible': True}, 'network_id': {'allow_post': True, 'allow_put': False, 'required_by_policy': True, 'validate': {'type:regex': UUID_PATTERN}, 'is_visible': True}, 'admin_state_up': {'allow_post': True, 'allow_put': True, 'default': True, 'convert_to': convert_to_boolean, 'validate': {'type:boolean': None}, 'is_visible': True}, 'mac_address': {'allow_post': True, 'allow_put': False, 'default': ATTR_NOT_SPECIFIED, 'validate': {'type:mac_address': None}, 'enforce_policy': True, 'is_visible': True}, 'fixed_ips': {'allow_post': True, 'allow_put': True, 'default': ATTR_NOT_SPECIFIED, 'convert_list_to': convert_kvp_list_to_dict, 'validate': {'type:fixed_ips': None}, 'enforce_policy': True, 'is_visible': True}, 'device_id': {'allow_post': True, 'allow_put': True, 'validate': {'type:string': None}, 'default': '', 'is_visible': True}, 'device_owner': {'allow_post': True, 'allow_put': True, 'validate': {'type:string': None}, 'default': '', 'is_visible': True}, 'tenant_id': {'allow_post': True, 'allow_put': False, 'validate': {'type:string': None}, 'required_by_policy': True, 'is_visible': True}, 'status': {'allow_post': False, 'allow_put': False, 'is_visible': True}, }, 'subnets': { 'id': {'allow_post': False, 'allow_put': False, 'validate': {'type:regex': UUID_PATTERN}, 'is_visible': True}, 'name': {'allow_post': True, 'allow_put': True, 'default': '', 'validate': {'type:string': None}, 'is_visible': True}, 'ip_version': {'allow_post': True, 'allow_put': False, 'convert_to': convert_to_int, 'validate': {'type:values': [4, 6]}, 'is_visible': True}, 'network_id': {'allow_post': True, 'allow_put': False, 'required_by_policy': True, 'validate': {'type:regex': UUID_PATTERN}, 'is_visible': True}, 'cidr': {'allow_post': True, 'allow_put': False, 'validate': {'type:subnet': None}, 'is_visible': True}, 'gateway_ip': {'allow_post': True, 'allow_put': True, 'default': ATTR_NOT_SPECIFIED, 'validate': {'type:ip_address_or_none': None}, 'is_visible': True}, #TODO(salvatore-orlando): Enable PUT on allocation_pools 'allocation_pools': {'allow_post': True, 'allow_put': False, 'default': ATTR_NOT_SPECIFIED, 'validate': {'type:ip_pools': None}, 'is_visible': True}, 'dns_nameservers': {'allow_post': True, 'allow_put': True, 'default': ATTR_NOT_SPECIFIED, 'validate': {'type:nameservers': None}, 'is_visible': True}, 'host_routes': {'allow_post': True, 'allow_put': True, 'default': ATTR_NOT_SPECIFIED, 'validate': {'type:hostroutes': None}, 'is_visible': True}, 'tenant_id': {'allow_post': True, 'allow_put': False, 'validate': {'type:string': None}, 'required_by_policy': True, 'is_visible': True}, 'enable_dhcp': {'allow_post': True, 'allow_put': True, 'default': True, 'convert_to': convert_to_boolean, 'validate': {'type:boolean': None}, 'is_visible': True}, SHARED: {'allow_post': False, 'allow_put': False, 'default': False, 'convert_to': convert_to_boolean, 'validate': {'type:boolean': None}, 'is_visible': False, 'required_by_policy': True, 'enforce_policy': True}, } } RESOURCE_HIERARCHY_MAP = { 'ports': {'parent': 'networks', 'identified_by': 'network_id'}, 'subnets': {'parent': 'networks', 'identified_by': 'network_id'} }
"""Gym-specific (non-Atari) utilities. Some network specifications specific to certain Gym environments are provided here. Includes a wrapper class around Gym environments. This class makes general Gym environments conformant with the API Dopamine is expecting. """ from __future__ import absolute_import from __future__ import division from __future__ import print_function import itertools import math from dopamine.discrete_domains import atari_lib import gin import gym from gym.wrappers.time_limit import TimeLimit import numpy as np import tensorflow as tf CARTPOLE_MIN_VALS = np.array([-2.4, -5., -math.pi/12., -math.pi*2.]) CARTPOLE_MAX_VALS = np.array([2.4, 5., math.pi/12., math.pi*2.]) ACROBOT_MIN_VALS = np.array([-1., -1., -1., -1., -5., -5.]) ACROBOT_MAX_VALS = np.array([1., 1., 1., 1., 5., 5.]) MOUNTAINCAR_MIN_VALS = np.array([-1.2, -0.07]) MOUNTAINCAR_MAX_VALS = np.array([0.6, 0.07]) gin.constant('gym_lib.CARTPOLE_OBSERVATION_SHAPE', (4, 1)) gin.constant('gym_lib.CARTPOLE_OBSERVATION_DTYPE', tf.float64) gin.constant('gym_lib.CARTPOLE_STACK_SIZE', 1) gin.constant('gym_lib.ACROBOT_OBSERVATION_SHAPE', (6, 1)) gin.constant('gym_lib.ACROBOT_OBSERVATION_DTYPE', tf.float64) gin.constant('gym_lib.ACROBOT_STACK_SIZE', 1) gin.constant('gym_lib.LUNAR_OBSERVATION_SHAPE', (8, 1)) gin.constant('gym_lib.LUNAR_OBSERVATION_DTYPE', tf.float64) gin.constant('gym_lib.LUNAR_STACK_SIZE', 1) gin.constant('gym_lib.MOUNTAINCAR_OBSERVATION_SHAPE', (2, 1)) gin.constant('gym_lib.MOUNTAINCAR_OBSERVATION_DTYPE', tf.float64) gin.constant('gym_lib.MOUNTAINCAR_STACK_SIZE', 1) MUJOCO_GAMES = ('Ant', 'HalfCheetah', 'Hopper', 'Humanoid', 'Walker2d') @gin.configurable def create_gym_environment(environment_name=None, version='v0'): """Wraps a Gym environment with some basic preprocessing. Args: environment_name: str, the name of the environment to run. version: str, version of the environment to run. Returns: A Gym environment with some standard preprocessing. """ assert environment_name is not None full_game_name = '{}-{}'.format(environment_name, version) env = gym.make(full_game_name) # Strip out the TimeLimit wrapper from Gym, which caps us at 200 steps. if isinstance(env, TimeLimit): env = env.env # Wrap the returned environment in a class which conforms to the API expected # by Dopamine. env = GymPreprocessing(env) return env @gin.configurable class BasicDiscreteDomainNetwork(tf.keras.layers.Layer): """The fully connected network used to compute the agent's Q-values. This sub network used within various other models. Since it is an inner block, we define it as a layer. These sub networks normalize their inputs to lie in range [-1, 1], using min_/max_vals. It supports both DQN- and Rainbow- style networks. Attributes: min_vals: float, minimum attainable values (must be same shape as `state`). max_vals: float, maximum attainable values (must be same shape as `state`). num_actions: int, number of actions. num_atoms: int or None, if None will construct a DQN-style network, otherwise will construct a Rainbow-style network. name: str, used to create scope for network parameters. activation_fn: function, passed to the layer constructors. """ def __init__(self, min_vals, max_vals, num_actions, num_atoms=None, name=None, activation_fn=tf.keras.activations.relu): super(BasicDiscreteDomainNetwork, self).__init__(name=name) self.num_actions = num_actions self.num_atoms = num_atoms self.min_vals = min_vals self.max_vals = max_vals # Defining layers. self.flatten = tf.keras.layers.Flatten() self.dense1 = tf.keras.layers.Dense(512, activation=activation_fn, name='fully_connected') self.dense2 = tf.keras.layers.Dense(512, activation=activation_fn, name='fully_connected') if num_atoms is None: self.last_layer = tf.keras.layers.Dense(num_actions, name='fully_connected') else: self.last_layer = tf.keras.layers.Dense(num_actions * num_atoms, name='fully_connected') def call(self, state): """Creates the output tensor/op given the state tensor as input.""" x = tf.cast(state, tf.float32) x = self.flatten(x) if self.min_vals is not None: x -= self.min_vals x /= self.max_vals - self.min_vals x = 2.0 * x - 1.0 # Rescale in range [-1, 1]. x = self.dense1(x) x = self.dense2(x) x = self.last_layer(x) return x @gin.configurable class CartpoleDQNNetwork(tf.keras.Model): """Keras DQN network for Cartpole.""" def __init__(self, num_actions, name=None): """Builds the deep network used to compute the agent's Q-values. It rescales the input features so they lie in range [-1, 1]. Args: num_actions: int, number of actions. name: str, used to create scope for network parameters. """ super(CartpoleDQNNetwork, self).__init__(name=name) self.net = BasicDiscreteDomainNetwork( CARTPOLE_MIN_VALS, CARTPOLE_MAX_VALS, num_actions) def call(self, state): """Creates the output tensor/op given the state tensor as input.""" x = self.net(state) return atari_lib.DQNNetworkType(x) class FourierBasis(object): """Fourier Basis linear function approximation. Requires the ranges for each dimension, and is thus able to use only sine or cosine (and uses cosine). So, this has half the coefficients that a full Fourier approximation would use. Many thanks to Will Dabney (wdabney@) for this implementation. From the paper: G.D. Konidaris, S. Osentoski and P.S. Thomas. (2011) Value Function Approximation in Reinforcement Learning using the Fourier Basis """ def __init__(self, nvars, min_vals=0, max_vals=None, order=3): self.order = order self.min_vals = min_vals self.max_vals = max_vals terms = itertools.product(range(order + 1), repeat=nvars) # Removing first iterate because it corresponds to the constant bias self.multipliers = tf.constant( [list(map(int, x)) for x in terms][1:], dtype=tf.float32) def scale(self, values): shifted = values - self.min_vals if self.max_vals is None: return shifted return shifted / (self.max_vals - self.min_vals) def compute_features(self, features): # Important to rescale features to be between [0,1] scaled = self.scale(features) return tf.cos(np.pi * tf.matmul(scaled, self.multipliers, transpose_b=True)) @gin.configurable class FourierDQNNetwork(tf.keras.Model): """Keras model for DQN.""" def __init__(self, min_vals, max_vals, num_actions, fourier_basis_order=3, name=None): """Builds the function approximator used to compute the agent's Q-values. It uses the features of the FourierBasis class and a linear layer without bias. Value Function Approximation in Reinforcement Learning using the Fourier Basis", Konidaris, Osentoski and Thomas (2011). Args: min_vals: float, minimum attainable values (must be same shape as `state`). max_vals: float, maximum attainable values (must be same shape as `state`). num_actions: int, number of actions. fourier_basis_order: int, order of the Fourier basis functions. name: str, used to create scope for network parameters. """ super(FourierDQNNetwork, self).__init__(name=name) self.num_actions = num_actions self.fourier_basis_order = fourier_basis_order self.min_vals = min_vals self.max_vals = max_vals # Defining layers. self.flatten = tf.keras.layers.Flatten() self.last_layer = tf.keras.layers.Dense(num_actions, use_bias=False, name='fully_connected') def call(self, state): """Creates the output tensor/op given the state tensor as input.""" x = tf.cast(state, tf.float32) x = self.flatten(x) # Since FourierBasis needs the shape of the input, we can only initialize # it during the first forward pass when we know the shape of the input. if not hasattr(self, 'feature_generator'): self.feature_generator = FourierBasis( x.get_shape().as_list()[-1], self.min_vals, self.max_vals, order=self.fourier_basis_order) x = self.feature_generator.compute_features(x) x = self.last_layer(x) return atari_lib.DQNNetworkType(x) @gin.configurable class CartpoleFourierDQNNetwork(FourierDQNNetwork): """Keras network for fourier Cartpole.""" def __init__(self, num_actions, name=None): """Builds the function approximator used to compute the agent's Q-values. It uses the Fourier basis features and a linear function approximator. Args: num_actions: int, number of actions. name: str, used to create scope for network parameters. """ super(CartpoleFourierDQNNetwork, self).__init__( CARTPOLE_MIN_VALS, CARTPOLE_MAX_VALS, num_actions, name=name) @gin.configurable class CartpoleRainbowNetwork(tf.keras.Model): """Keras Rainbow network for Cartpole.""" def __init__(self, num_actions, num_atoms, support, name=None): """Builds the deep network used to compute the agent's Q-values. It rescales the input features to a range that yields improved performance. Args: num_actions: int, number of actions. num_atoms: int, the number of buckets of the value function distribution. support: tf.linspace, the support of the Q-value distribution. name: str, used to create scope for network parameters. """ super(CartpoleRainbowNetwork, self).__init__(name=name) self.net = BasicDiscreteDomainNetwork( CARTPOLE_MIN_VALS, CARTPOLE_MAX_VALS, num_actions, num_atoms=num_atoms) self.num_actions = num_actions self.num_atoms = num_atoms self.support = support def call(self, state): x = self.net(state) logits = tf.reshape(x, [-1, self.num_actions, self.num_atoms]) probabilities = tf.keras.activations.softmax(logits) q_values = tf.reduce_sum(self.support * probabilities, axis=2) return atari_lib.RainbowNetworkType(q_values, logits, probabilities) @gin.configurable class AcrobotDQNNetwork(tf.keras.Model): """Keras DQN network for Acrobot.""" def __init__(self, num_actions, name=None): """Builds the deep network used to compute the agent's Q-values. It rescales the input features to a range that yields improved performance. Args: num_actions: int, number of actions. name: str, used to create scope for network parameters. """ super(AcrobotDQNNetwork, self).__init__(name=name) self.net = BasicDiscreteDomainNetwork( ACROBOT_MIN_VALS, ACROBOT_MAX_VALS, num_actions) def call(self, state): x = self.net(state) return atari_lib.DQNNetworkType(x) @gin.configurable class AcrobotFourierDQNNetwork(FourierDQNNetwork): """Keras fourier DQN network for Acrobot.""" def __init__(self, num_actions, name=None): """Builds the function approximator used to compute the agent's Q-values. It uses the Fourier basis features and a linear function approximator. Args: num_actions: int, number of actions. name: str, used to create scope for network parameters. """ super(AcrobotFourierDQNNetwork, self).__init__( ACROBOT_MIN_VALS, ACROBOT_MAX_VALS, num_actions, name=name) @gin.configurable class AcrobotRainbowNetwork(tf.keras.Model): """Keras Rainbow network for Acrobot.""" def __init__(self, num_actions, num_atoms, support, name=None): """Builds the deep network used to compute the agent's Q-values. It rescales the input features to a range that yields improved performance. Args: num_actions: int, number of actions. num_atoms: int, the number of buckets of the value function distribution. support: Tensor, the support of the Q-value distribution. name: str, used to create scope for network parameters. """ super(AcrobotRainbowNetwork, self).__init__(name=name) self.net = BasicDiscreteDomainNetwork( ACROBOT_MIN_VALS, ACROBOT_MAX_VALS, num_actions, num_atoms=num_atoms) self.num_actions = num_actions self.num_atoms = num_atoms self.support = support def call(self, state): x = self.net(state) logits = tf.reshape(x, [-1, self.num_actions, self.num_atoms]) probabilities = tf.keras.activations.softmax(logits) q_values = tf.reduce_sum(self.support * probabilities, axis=2) return atari_lib.RainbowNetworkType(q_values, logits, probabilities) @gin.configurable class LunarLanderDQNNetwork(tf.keras.Model): """Keras DQN network for LunarLander.""" def __init__(self, num_actions, name=None): """Builds the deep network used to compute the agent's Q-values. Args: num_actions: int, number of actions. name: str, used to create scope for network parameters. """ super(LunarLanderDQNNetwork, self).__init__(name=name) self.net = BasicDiscreteDomainNetwork(None, None, num_actions) def call(self, state): """Creates the output tensor/op given the state tensor as input.""" x = self.net(state) return atari_lib.DQNNetworkType(x) @gin.configurable class MountainCarDQNNetwork(tf.keras.Model): """Keras DQN network for MountainCar.""" def __init__(self, num_actions, name=None): """Builds the deep network used to compute the agent's Q-values. Args: num_actions: int, number of actions. name: str, used to create scope for network parameters. """ super(MountainCarDQNNetwork, self).__init__(name=name) self.net = BasicDiscreteDomainNetwork( MOUNTAINCAR_MIN_VALS, MOUNTAINCAR_MAX_VALS, num_actions) def call(self, state): """Creates the output tensor/op given the state tensor as input.""" x = self.net(state) return atari_lib.DQNNetworkType(x) @gin.configurable class GymPreprocessing(object): """A Wrapper class around Gym environments.""" def __init__(self, environment): self.environment = environment self.game_over = False @property def observation_space(self): return self.environment.observation_space @property def action_space(self): return self.environment.action_space @property def reward_range(self): return self.environment.reward_range @property def metadata(self): return self.environment.metadata def reset(self): return self.environment.reset() def step(self, action): observation, reward, game_over, info = self.environment.step(action) was_truncated = info.get('TimeLimit.truncated', False) game_over = game_over and not was_truncated self.game_over = game_over return observation, reward, game_over, info
""" This tool checks GitHub for the latest version of Modis and can produce the name of the current official version and the difference between that version and the version currently being used. """ import logging import requests from modis.tools import config logger = logging.getLogger(__name__) def infostr(): """ Get the version comparison info. Returns: version_str (str): A friendly response detailing the current version """ latest = _get() state = _compare(latest) if state == -1: return "A new version of Modis is available (v{})".format(latest) elif state == 0: return "You are running the latest version of Modis (v{})".format(config.VERSION) elif state == 1: return "You are running a preview version of Modis (v{} pre-release)".format(config.VERSION) def _get(): """Compare the current version to the latest on GitHub. Returns: version (list): The latest live version numbers """ logger.debug("Checking version...") # Get version info from GitHub try: r = requests.get("https://api.github.com/repos/Infraxion/Modis/releases/latest").json() if "message" not in r or r["message"] == "Not Found": r = requests.get("https://api.github.com/repos/Infraxion/Modis/releases").json()[0] except requests.ConnectionError: logger.warning("Could not connect to GitHub for version info") return [] # Parse version info if "tag_name" in r: version_name = r["tag_name"] version_tag = version_name.split('.') return version_tag else: return [] def _compare(release_version): """Compare the current version to the latest on GitHub. Args: release_version (list): The latest live version numbers Returns: comparison (int): -1=behind, 0=latest, 1=ahead """ current_version = config.VERSION.split('.') for vi in range(len(release_version)): if len(current_version) > vi: if current_version[vi] > release_version[vi]: return 1 elif current_version[vi] < release_version[vi]: return -1 elif release_version[vi] != "0": return -1 return 0
import os import subprocess os.system("kubectl delete -f cloudone-controller-glusterfs.json") os.system("kubectl delete -f cloudone-service.json") p = subprocess.Popen(['kubectl', 'get', 'pod'], stdout=subprocess.PIPE, stderr=subprocess.PIPE) output, err = p.communicate() output_line_list = output.split("\n") for output_line in output_line_list: if output_line.startswith("cloudone"): os.system("kubectl delete pod " + output_line.split(" ")[0])
"""Tests for tensorflow.python.framework.importer.""" from __future__ import absolute_import from __future__ import division from __future__ import print_function import numpy as np import tensorflow as tf from google.protobuf import text_format from tensorflow.core.framework import op_def_pb2 from tensorflow.python.framework import device from tensorflow.python.framework import op_def_registry _op_list = op_def_pb2.OpList() text_format.Merge(""" op { name: 'None' } op { name: 'Oi' output_arg { name: 'a' type: DT_INT32 } } op { name: 'Or' output_arg { name: 'a' type: DT_INT32 is_ref: true } } op { name: 'Of' output_arg { name: 'a' type: DT_FLOAT } } op { name: 'Ii' input_arg { name: 'a' type: DT_INT32 } } op { name: 'If' input_arg { name: 'a' type: DT_FLOAT } } op { name: 'Oii' output_arg { name: 'a' type: DT_INT32 } output_arg { name: 'b' type: DT_INT32 } } op { name: 'Oif' output_arg { name: 'a' type: DT_INT32 } output_arg { name: 'b' type: DT_FLOAT } } op { name: 'Iii' input_arg { name: 'a' type: DT_INT32 } input_arg { name: 'b' type: DT_INT32 } } op { name: 'Iff' input_arg { name: 'a' type: DT_FLOAT } input_arg { name: 'b' type: DT_FLOAT } } op { name: 'Iif' input_arg { name: 'a' type: DT_INT32 } input_arg { name: 'b' type: DT_FLOAT } } op { name: 'Iri' input_arg { name: 'a' type: DT_INT32 is_ref: true } input_arg { name: 'b' type: DT_INT32 } } op { name: 'In' input_arg { name: 'a' number_attr: 'N' type_attr: 'T' } attr { name: 'N' type: 'int' minimum: 1 } attr { name: 'T' type: 'type' } } op { name: 'Otl' output_arg { name: 'a' type_list_attr: 't' } attr { name: 'T' type: 'list(type)' minimum: 1 } } op { name: 'Unary' input_arg { name: 'a' type_attr: 'T' } output_arg { name: 'b' type_attr: 'T' } attr { name: 'T' type: 'type' } } op { name: 'OpWithDefaultAttr' output_arg { name: 'a' type: DT_INT32 } attr { name: 'default_float' type: 'float' default_value { f: 123.0 } } } op { name: 'OpWithFutureDefaultAttr' } """, _op_list) op_def_registry.register_op_list(_op_list) for op_def in _op_list.op: tf.RegisterShape(op_def.name)(None) class ImportGraphDefTest(tf.test.TestCase): def _MakeGraphDef(self, text, producer=tf.GRAPH_DEF_VERSION, min_consumer=tf.GRAPH_DEF_VERSION_MIN_CONSUMER): text = "versions: { producer: %d min_consumer: %d };\n%s" % ( producer, min_consumer, text) ret = tf.GraphDef() text_format.Merge(text, ret) return ret def testBasic(self): with tf.Graph().as_default(): a, b, c, d = tf.import_graph_def( self._MakeGraphDef(""" node { name: 'A' op: 'Oif' } node { name: 'B' op: 'Otl' attr { key: 't' value { list { type: DT_INT32 type: DT_FLOAT } } } } node { name: 'C' op: 'In' attr { key: 'N' value { i: 2 } } attr { key: 'T' value { type: DT_INT32 } } input: 'A:0' input: 'B:0' } node { name: 'D' op: 'In' attr { key: 'N' value { i: 2 } } attr { key: 'T' value { type: DT_FLOAT } } input: 'A:1' input: 'B:1' } """), return_elements=["A", "B", "C", "D"], name="import") # Assert that the import process creates distinct tensors. self.assertNotEqual(a.outputs[0].name, a.outputs[1].name) self.assertNotEqual(b.outputs[0].name, b.outputs[1].name) self.assertNotEqual(a.outputs[0].name, b.outputs[0].name) self.assertNotEqual(a.outputs[0].name, b.outputs[1].name) self.assertNotEqual(a.outputs[1].name, b.outputs[0].name) self.assertNotEqual(a.outputs[1].name, b.outputs[1].name) # Assert that the ops are connected according to the GraphDef topology. self.assertEqual(c.inputs[0], a.outputs[0]) self.assertEqual(c.inputs[1], b.outputs[0]) self.assertEqual(d.inputs[0], a.outputs[1]) self.assertEqual(d.inputs[1], b.outputs[1]) # Check the types of the returned ops and tensors. self.assertEqual(a.type, "Oif") self.assertEqual(b.type, "Otl") self.assertEqual(c.type, "In") self.assertEqual(d.type, "In") self.assertEqual(a.outputs[0].dtype, tf.int32) self.assertEqual(a.outputs[1].dtype, tf.float32) self.assertEqual(b.outputs[0].dtype, tf.int32) self.assertEqual(b.outputs[1].dtype, tf.float32) # Check the names of the returned ops. self.assertEqual(a.name, "import/A") self.assertEqual(b.name, "import/B") self.assertEqual(c.name, "import/C") self.assertEqual(d.name, "import/D") # Check that the op_def is still available. self.assertNotEqual(None, a.op_def) def testInputMap(self): with tf.Graph().as_default(): feed_a_0 = tf.constant(0, dtype=tf.int32) feed_b_1 = tf.constant(1, dtype=tf.int32) a, b, c, d = tf.import_graph_def( self._MakeGraphDef(""" node { name: 'A' op: 'Oii' } node { name: 'B' op: 'Oii' } node { name: 'C' op: 'In' attr { key: 'N' value { i: 2 } } attr { key: 'T' value { type: DT_INT32 } } input: 'A:0' input: 'B:0' } node { name: 'D' op: 'In' attr { key: 'N' value { i: 2 } } attr { key: 'T' value { type: DT_INT32 } } input: 'A:1' input: 'B:1' } """), input_map={"A:0": feed_a_0, "B:1": feed_b_1}, return_elements=["A", "B", "C", "D"]) self.assertEqual(c.inputs[0], feed_a_0) self.assertEqual(c.inputs[1], b.outputs[0]) self.assertEqual(d.inputs[0], a.outputs[1]) self.assertEqual(d.inputs[1], feed_b_1) def testInputMapBytes(self): with tf.Graph().as_default(): feed_a_0 = tf.constant(0, dtype=tf.int32) feed_b_1 = tf.constant(1, dtype=tf.int32) a, b, c, d = tf.import_graph_def( self._MakeGraphDef(""" node { name: 'A' op: 'Oii' } node { name: 'B' op: 'Oii' } node { name: 'C' op: 'In' attr { key: 'N' value { i: 2 } } attr { key: 'T' value { type: DT_INT32 } } input: 'A:0' input: 'B:0' } node { name: 'D' op: 'In' attr { key: 'N' value { i: 2 } } attr { key: 'T' value { type: DT_INT32 } } input: 'A:1' input: 'B:1' } """), input_map={b"A:0": feed_a_0, b"B:1": feed_b_1}, return_elements=[b"A", b"B", b"C", b"D"]) self.assertEqual(c.inputs[0], feed_a_0) self.assertEqual(c.inputs[1], b.outputs[0]) self.assertEqual(d.inputs[0], a.outputs[1]) self.assertEqual(d.inputs[1], feed_b_1) def testInputMapUnicode(self): with tf.Graph().as_default(): feed_a_0 = tf.constant(0, dtype=tf.int32) feed_b_1 = tf.constant(1, dtype=tf.int32) a, b, c, d = tf.import_graph_def( self._MakeGraphDef(""" node { name: 'A' op: 'Oii' } node { name: 'B' op: 'Oii' } node { name: 'C' op: 'In' attr { key: 'N' value { i: 2 } } attr { key: 'T' value { type: DT_INT32 } } input: 'A:0' input: 'B:0' } node { name: 'D' op: 'In' attr { key: 'N' value { i: 2 } } attr { key: 'T' value { type: DT_INT32 } } input: 'A:1' input: 'B:1' } """), input_map={u"A:0": feed_a_0, u"B:1": feed_b_1}, return_elements=[u"A", u"B", u"C", u"D"]) self.assertEqual(c.inputs[0], feed_a_0) self.assertEqual(c.inputs[1], b.outputs[0]) self.assertEqual(d.inputs[0], a.outputs[1]) self.assertEqual(d.inputs[1], feed_b_1) def testImplicitZerothOutput(self): with tf.Graph().as_default(): a, b = tf.import_graph_def( self._MakeGraphDef(""" node { name: 'A' op: 'Oii' } node { name: 'B' op: 'Ii' input: 'A' } """), return_elements=["A", "B"]) self.assertEqual(b.inputs[0], a.outputs[0]) def testInputMapImplicitZerothOutput(self): with tf.Graph().as_default(): feed_a_0 = tf.constant(0, dtype=tf.int32) b, = tf.import_graph_def( self._MakeGraphDef(""" node { name: 'A' op: 'Oii' } node { name: 'B' op: 'Ii' input: 'A:0' } """), input_map={"A": feed_a_0}, return_elements=["B"]) self.assertEqual(b.inputs[0], feed_a_0) def testWithControlDependency(self): with tf.Graph().as_default(): a, b = tf.import_graph_def( self._MakeGraphDef(""" node { name: 'A' op: 'None' } node { name: 'B' op: 'None' input: '^A' } """), return_elements=["A", "B"]) self.assertEqual(b.control_inputs, [a]) def testWithRefs(self): with tf.Graph().as_default(): a, b, c, d = tf.import_graph_def( self._MakeGraphDef(""" node { name: 'A' op: 'Or' } node { name: 'B' op: 'Oi' } node { name: 'C' op: 'Iii' input: 'A:0' input: 'B:0' } node { name: 'D' op: 'Iri' input: 'A:0' input: 'B:0' } """), return_elements=["A", "B", "C", "D"]) self.assertEqual(c.inputs[0], a.outputs[0]) self.assertEqual(c.inputs[1], b.outputs[0]) self.assertEqual(d.inputs[0], a.outputs[0]) self.assertEqual(d.inputs[1], b.outputs[0]) self.assertEqual(a.outputs[0].dtype, tf.int32_ref) self.assertEqual(c._input_dtypes, [tf.int32, tf.int32]) self.assertEqual(c.outputs, []) self.assertEqual(d._input_dtypes, [tf.int32_ref, tf.int32]) self.assertEqual(d.outputs, []) def testCyclic(self): with tf.Graph().as_default(): a, b = tf.import_graph_def( self._MakeGraphDef(""" node { name: 'A' op: 'Unary' attr { key: 'T' value { type: DT_INT32 } } input: 'B:0' } node { name: 'B' op: 'Unary' attr { key: 'T' value { type: DT_INT32 } } input: 'A:0' } """), return_elements=["A", "B"]) self.assertEqual(a.inputs[0], b.outputs[0]) self.assertEqual(b.inputs[0], a.outputs[0]) def testTypeMismatchInGraphDef(self): with tf.Graph().as_default(): with self.assertRaises(ValueError) as e: tf.import_graph_def( self._MakeGraphDef(""" node { name: 'A' op: 'Oi' } node { name: 'B' op: 'If' input: 'A:0' } """)) self.assertTrue( "Cannot convert a tensor of type int32 to an input of type float" in str(e.exception)) def testInvalidSignatureTooManyInputsInGraphDef(self): with tf.Graph().as_default(): with self.assertRaises(ValueError) as e: tf.import_graph_def( self._MakeGraphDef(""" node { name: 'A' op: 'Oi' } node { name: 'B' op: 'None' input: 'A:0' } """)) self.assertTrue("More inputs specified ('A:0') than the op expects" in str(e.exception)) def testInvalidSignatureNotEnoughInputsInGraphDef(self): with tf.Graph().as_default(): with self.assertRaises(ValueError) as e: tf.import_graph_def( self._MakeGraphDef(""" node { name: 'A' op: 'Oi' } node { name: 'B' op: 'Iif' input: 'A:0' } """)) self.assertTrue("Input types mismatch (expected 'int32, float32' but " "got 'int32')" in str(e.exception)) def testMissingInputOpInGraphDef(self): with tf.Graph().as_default(): with self.assertRaises(ValueError) as e: tf.import_graph_def( self._MakeGraphDef(""" node { name: 'B' op: 'If' input: 'A:0' } """)) self.assertTrue("Input tensor 'A:0' not found" in str(e.exception)) def testMissingInputOpInGraphDefButAppearsInInputMap(self): with tf.Graph().as_default(): feed_a_0 = tf.constant(5.0) b, = tf.import_graph_def( self._MakeGraphDef(""" node { name: 'B' op: 'If' input: 'A:0' } """), input_map={"A:0": feed_a_0}, return_elements=["B"]) self.assertEqual(b.inputs[0], feed_a_0) def testMissingInputTensorInGraphDef(self): with tf.Graph().as_default(): with self.assertRaises(ValueError) as e: tf.import_graph_def( self._MakeGraphDef(""" node { name: 'A' op: 'Of' } node { name: 'B' op: 'If' input: 'A:1' } """)) self.assertTrue("Input tensor 'A:1' not found" in str(e.exception)) def testMissingControlInputInGraphDef(self): with tf.Graph().as_default(): with self.assertRaises(ValueError) as e: tf.import_graph_def( self._MakeGraphDef(""" node { name: 'B' op: 'None' input: '^A' } """)) self.assertTrue("Control input '^A' not found" in str(e.exception)) def testInvalidTensorNameOutputIndexInGraphDef(self): with tf.Graph().as_default(): with self.assertRaises(ValueError) as e: tf.import_graph_def( self._MakeGraphDef(""" node { name: 'B' op: 'None' input: 'A:B' } """)) self.assertEqual("Cannot convert 'A:B' to a tensor name.", str(e.exception)) def testInvalidTensorNameInGraphDef(self): with tf.Graph().as_default(): with self.assertRaises(ValueError) as e: tf.import_graph_def( self._MakeGraphDef(""" node { name: 'B' op: 'None' input: 'A:B:0' } """)) self.assertEqual("Cannot convert 'A:B:0' to a tensor name.", str(e.exception)) def testMissingReturnOperation(self): with tf.Graph().as_default(): with self.assertRaises(ValueError) as e: tf.import_graph_def( self._MakeGraphDef(""" node { name: 'A' op: 'None' } """), return_elements=["B"]) self.assertTrue("return_element 'B' not found in graph_def." in str(e.exception)) def testMissingReturnTensor(self): with tf.Graph().as_default(): with self.assertRaises(ValueError) as e: tf.import_graph_def( self._MakeGraphDef(""" node { name: 'A' op: 'Oi' } """), return_elements=["A:1"]) self.assertTrue("return_element 'A:1' not found in graph_def." in str(e.exception)) with self.assertRaises(ValueError) as e: tf.import_graph_def( self._MakeGraphDef(""" node { name: 'A' op: 'Oi' } """), return_elements=["B:0"]) self.assertTrue("return_element 'B:0' not found in graph_def." in str(e.exception)) with self.assertRaises(ValueError) as e: tf.import_graph_def( self._MakeGraphDef(""" node { name: 'A' op: 'Oi' } """), return_elements=["A:B:0"]) self.assertTrue("return_element 'A:B:0' not found in graph_def." in str(e.exception)) def testMissingInputMap(self): with tf.Graph().as_default(): with self.assertRaises(ValueError) as e: tf.import_graph_def( self._MakeGraphDef(""" node { name: 'A' op: 'None' } """), input_map={"B:0": tf.constant(5.0)}) self.assertTrue("not found in graph_def: [B:0]" in str(e.exception)) def testInputMapTypeMismatch(self): with tf.Graph().as_default(): with self.assertRaises(ValueError) as e: tf.import_graph_def( self._MakeGraphDef(""" node { name: 'A' op: 'Oi' } node { name: 'B' op: 'Ii' input: 'A:0' } """), input_map={"A:0": tf.constant(5.0)}) self.assertTrue( "Cannot convert a tensor of type float32 to an input of type int32." in str(e.exception)) def testNoReturns(self): with tf.Graph().as_default() as g: ret = tf.import_graph_def( self._MakeGraphDef(""" node { name: 'A' op: 'None' } """)) self.assertEqual(ret, None) a = g.get_operation_by_name("import/A") self.assertEqual(a.type, "None") def testOverrideNamePrefix(self): with tf.Graph().as_default(): a, = tf.import_graph_def( self._MakeGraphDef(""" node { name: 'A' op: 'None' } """), return_elements=["A"], name="imported_graph") self.assertEqual(a.name, "imported_graph/A") def testNamePrefixColocationAttrs(self): original_graph_def = self._MakeGraphDef(""" node { name: 'A' op: 'None' } node { name: 'B' op: 'None' attr { key: '_class' value { list { s: 'loc:@A' } } } }""") with tf.Graph().as_default(): b, = tf.import_graph_def(original_graph_def, return_elements=["B"], name="imported_graph") self.assertProtoEqualsVersion(""" node { name: 'imported_graph/A' op: 'None' } node { name: 'imported_graph/B' op: 'None' attr { key: '_class' value { list { s: 'loc:@imported_graph/A' } } } }""", b.graph.as_graph_def()) def testNamePrefixColocationAttrsMultipleImport(self): original_graph_def = self._MakeGraphDef(""" node { name: 'A' op: 'None' } node { name: 'B' op: 'None' attr { key: '_class' value { list { s: 'loc:@A' } } } }""") with tf.Graph().as_default(): b, = tf.import_graph_def(original_graph_def, return_elements=["B"], name="") _, = tf.import_graph_def(original_graph_def, return_elements=["B"], name="") self.assertProtoEqualsVersion(""" node { name: 'A' op: 'None' } node { name: 'B' op: 'None' attr { key: '_class' value { list { s: 'loc:@A' } } } } node { name: 'A_1' op: 'None' } node { name: 'B_1' op: 'None' attr { key: '_class' value { list { s: 'loc:@A_1' } } } }""", b.graph.as_graph_def()) def testNamePrefixColocationAttrsNotFound(self): original_graph_def = self._MakeGraphDef(""" node { name: 'B' op: 'None' attr { key: '_class' value { list { s: 'loc:@A' } } } }""") with tf.Graph().as_default(): with self.assertRaisesRegexp(ValueError, "does not exist during import"): tf.import_graph_def(original_graph_def, return_elements=["B"], name="imported_graph") def testEmptyGraph(self): with tf.Graph().as_default() as g: init_version = g.version tf.import_graph_def(self._MakeGraphDef("")) self.assertEqual(init_version, g.version) def testInvalidInputForGraphDef(self): with tf.Graph().as_default(): with self.assertRaises(TypeError) as e: tf.import_graph_def("") self.assertEqual( "graph_def must be a GraphDef proto.", str(e.exception)) def testInvalidInputForInputMap(self): with tf.Graph().as_default(): with self.assertRaises(TypeError) as e: tf.import_graph_def(self._MakeGraphDef(""), input_map=[tf.constant(5.0)]) self.assertEqual("input_map must be a dictionary mapping strings to " "Tensor objects.", str(e.exception)) def testInvalidInputForReturnOperations(self): with tf.Graph().as_default(): with self.assertRaises(TypeError) as e: tf.import_graph_def(self._MakeGraphDef(""), return_elements=[7]) self.assertEqual( "return_elements must be a list of strings.", str(e.exception)) def testWithExtensionAndAttr(self): with tf.Graph().as_default() as g: c = tf.constant(5.0, dtype=tf.float32, name="c") tf.pack([c, c], name="pack") gdef = g.as_graph_def() with self.test_session(): pack, = tf.import_graph_def(gdef, return_elements=["pack"]) self.assertAllEqual(pack.outputs[0].eval(), [5.0, 5.0]) def testWithDevice(self): with tf.Graph().as_default() as g: # No device. a = tf.constant(3.0, name="a") with tf.device("/cpu:0"): b = tf.constant(4.0, name="b") with tf.device("/job:worker"): c = tf.constant(5.0, name="c") gdef = g.as_graph_def() with tf.Graph().as_default(): a2, b2, c2 = tf.import_graph_def( gdef, return_elements=["a", "b", "c"]) self.assertEqual(a.device, a2.device) self.assertEqual(b.device, b2.device) self.assertEqual(c.device, c2.device) with tf.Graph().as_default(): with tf.device(device.merge_device("/task:0")): a3, b3, c3 = tf.import_graph_def( gdef, return_elements=["a", "b", "c"]) self.assertEqual("/task:0", a3.device) self.assertEqual("/task:0/device:CPU:0", b3.device) # canonicalized. self.assertEqual(c.device + "/task:0", c3.device) with tf.Graph().as_default(): with tf.device(device.merge_device("/job:ps")): a4, b4, c4 = tf.import_graph_def( gdef, return_elements=["a", "b", "c"]) self.assertEqual("/job:ps", a4.device) self.assertEqual("/job:ps/device:CPU:0", b4.device) # canonicalized. self.assertEqual(c.device, c4.device) # worker overrides ps. with tf.Graph().as_default(): with tf.device(device.merge_device("/gpu:0")): a5, b5, c5 = tf.import_graph_def( gdef, return_elements=["a", "b", "c"]) self.assertEqual("/device:GPU:0", a5.device) self.assertEqual("/device:CPU:0", b5.device) # cpu overrides gpu. self.assertEqual(c.device + "/device:GPU:0", c5.device) def testWithDeviceFunctionDependingOnInputs(self): with tf.Graph().as_default() as g: with tf.device("/job:ps"): v = tf.Variable(1.0) unused_assign_op = v.assign(2.0) unused_assign_2_op = v.assign(3.0) unused_add_t = v + v gdef = g.as_graph_def() # We'll use the following device function to observe ops with two inputs. ops_with_two_inputs = [] def input_counter(op): if any(in_t.dtype.is_ref_dtype for in_t in op.inputs): ops_with_two_inputs.append(op) return "" with tf.Graph().as_default() as g: with tf.device(input_counter): tf.import_graph_def(gdef) # We expect to see the initializer, two assign operations, and the add op. self.assertEqual(4, len(ops_with_two_inputs)) def testGradient(self): with tf.Graph().as_default() as g: inputs = tf.placeholder(tf.float32, shape=[None, 100], name="input") weights = tf.placeholder(tf.float32, shape=[100, 10], name="weights") biases = tf.placeholder(tf.float32, shape=[10], name="biases") activations = tf.nn.relu(tf.matmul(inputs, weights) + biases, name="activations") loss = tf.reduce_mean(activations, name="loss") gdef = g.as_graph_def() with tf.Graph().as_default() as g: input_placeholder = tf.placeholder(tf.float32, shape=[32, 100]) weights_var = tf.Variable(tf.truncated_normal([100, 10]), name="weights") biases_var = tf.Variable(tf.zeros([10]), name="biases") activations, loss = tf.import_graph_def( gdef, input_map={"input:0": input_placeholder, "weights:0": weights_var, "biases:0": biases_var}, return_elements=["activations:0", "loss:0"]) self.assertEqual([32, 10], activations.get_shape()) self.assertEqual([], loss.get_shape()) weights_grad, biases_grad = tf.gradients(loss, [weights_var, biases_var]) self.assertEqual([100, 10], weights_grad.get_shape()) self.assertEqual([10], biases_grad.get_shape()) def testLargeGraph(self): with self.test_session(): # The default message byte limit is 64M. Ours is 2G with a warning at 512. # Adding a 130M entries float32 tensor should exceed the warning, but not # the hard limit. input_shape = [130, 1000, 1000] tensor_input = np.ones(input_shape, dtype=np.float32) t = tf.constant(tensor_input, shape=input_shape) g = tf.identity(t) g.eval() def testVersion(self): v0 = tf.GRAPH_DEF_VERSION_MIN_CONSUMER v2 = tf.GRAPH_DEF_VERSION v1 = (v0 + v2) // 2 for producer in v0, v1, v2: for min_consumer in v0, v1, v2: with tf.Graph().as_default(): a, = tf.import_graph_def( self._MakeGraphDef("node { name: 'A' op: 'Oii' }", producer=producer, min_consumer=min_consumer), return_elements=["A"]) self.assertEqual(a.graph.graph_def_versions.producer, producer) self.assertEqual(a.graph.graph_def_versions.min_consumer, min_consumer) def testVersionLow(self): with tf.Graph().as_default() as g: pat = (r"GraphDef producer version -1 below min producer %d supported " r"by TensorFlow \S+\. Please regenerate your graph.$" % tf.GRAPH_DEF_VERSION_MIN_PRODUCER) tf.import_graph_def(self._MakeGraphDef("", producer=-1)) x = tf.constant(7) # Need at least one op to get a C++ graph generated with self.test_session(graph=g) as sess: with self.assertRaisesRegexp(Exception, pat): sess.run(x) def testVersionHigh(self): with tf.Graph().as_default() as g: pat = (r"GraphDef min consumer version %d above current version %d " r"for TensorFlow \S+\. Please upgrade TensorFlow\.$" % (1 << 30, tf.GRAPH_DEF_VERSION)) tf.import_graph_def(self._MakeGraphDef("", min_consumer=1 << 30)) x = tf.constant(7) # Need at least one op to get a C++ graph generated with self.test_session(graph=g) as sess: with self.assertRaisesRegexp(Exception, pat): sess.run(x) def testDefaultAttrsAdded(self): with tf.Graph().as_default(): a = tf.import_graph_def( self._MakeGraphDef(""" node { name: 'A' op: 'OpWithDefaultAttr' } """), return_elements=["A"]) self.assertEqual(123.0, a[0].get_attr("default_float")) def testDefaultAttrsRemoved(self): producer_op_list = op_def_pb2.OpList() text_format.Merge(""" op { name: 'OpWithFutureDefaultAttr' attr { name: 'default_int' type: 'int' default_value { i: 456 } } } """, producer_op_list) # Attr only in producer_op_list with default value gets removed. with tf.Graph().as_default(): a = tf.import_graph_def( self._MakeGraphDef(""" node { name: 'A' op: 'OpWithFutureDefaultAttr' attr { key: 'default_int' value { i: 456 } } } """), return_elements=["A"], producer_op_list=producer_op_list) with self.assertRaisesRegexp(ValueError, "No attr named 'default_int'"): a[0].get_attr("default_int") # Attr only in producer_op_list with non-default value is preserved. with tf.Graph().as_default(): a = tf.import_graph_def( self._MakeGraphDef(""" node { name: 'A' op: 'OpWithFutureDefaultAttr' attr { key: 'default_int' value { i: 987 } } } """), return_elements=["A"], producer_op_list=producer_op_list) self.assertEqual(987, a[0].get_attr("default_int")) if __name__ == "__main__": tf.test.main()
import unittest from pyramid import testing class ViewTests(unittest.TestCase): def setUp(self): self.config = testing.setUp() def tearDown(self): testing.tearDown() def test_my_view(self): from .views import my_view request = testing.DummyRequest() info = my_view(request) # self.assertEqual(info['project'], 'angular-tictactoe')
from __future__ import unicode_literals, division, absolute_import, print_function import functools import itertools import operator import sys import os import codecs import types from . import unipath as path from .const import PY2, PY3, PY35, PYPY, OS_WIN, ASCII_CHARS, URL_SAFE, IRI_UNSAFE def _add_doc(func, doc): """Add documentation to a function.""" func.__doc__ = doc def _import_module(name): """Import module, returning the module after the last dot.""" __import__(name) return sys.modules[name] if PY2: string_types = basestring, integer_types = (int, long) class_types = (type, types.ClassType) text_type = unicode binary_type = str xrange = xrange str = unicode basestring = basestring unicode = unicode bytes = str long = long builtin_str = str raw_input = raw_input MAXSIZE = int((1 << 31) - 1) else: string_types = str, integer_types = int, class_types = type, text_type = str binary_type = bytes next = next unichr = chr imap = map izip = zip xrange = range str = str basestring = str unicode = str bytes = bytes long = int builtin_str = str raw_input = input MAXSIZE = sys.maxsize if PY2: from urllib import ( quote, unquote, quote_plus, unquote_plus, urlencode, getproxies, proxy_bypass, proxy_bypass_environment, getproxies_environment) from urlparse import urlparse, urlunparse, urljoin, urlsplit, urldefrag, parse_qs from urllib2 import parse_http_list, urlopen, Request, HTTPError import cookielib from Cookie import Morsel from StringIO import StringIO else: from urllib.parse import urlparse, urlunparse, urljoin, urlsplit, urlencode, quote, unquote, quote_plus, unquote_plus, urldefrag, parse_qs from urllib.request import parse_http_list, getproxies, proxy_bypass, proxy_bypass_environment, getproxies_environment, urlopen, Request from http import cookiejar as cookielib from http.cookies import Morsel from urllib.error import HTTPError from io import StringIO if PY2: from ConfigParser import ConfigParser from Queue import Queue, heapq, deque from repr import aRepr, repr from UserDict import UserDict from UserList import UserList from UserString import UserString from urllib3.packages.ordered_dict import OrderedDict else: from configparser import ConfigParser from queue import Queue import heapq from collections import deque from reprlib import aRepr, repr from collections import UserDict, UserList, UserString, OrderedDict if PY2: import __builtin__ # Python 2-builtin ranges produce lists lrange = __builtin__.range lzip = __builtin__.zip lmap = __builtin__.map lfilter = __builtin__.filter from itertools import ifilterfalse, izip_longest else: # list-producing versions of the major Python iterating functions def lrange(*args, **kwargs): return list(range(*args, **kwargs)) def lzip(*args, **kwargs): return list(zip(*args, **kwargs)) def lmap(*args, **kwargs): return list(map(*args, **kwargs)) def lfilter(*args, **kwargs): return list(filter(*args, **kwargs)) from itertools import filterfalse, zip_longest try: import simplejson as json except ImportError: import json try: advance_iterator = next except NameError: def advance_iterator(it): return it.next() next = advance_iterator try: callable = callable except NameError: def callable(obj): return any("__call__" in klass.__dict__ for klass in type(obj).__mro__) if PY2: def iterkeys(d, **kw): return d.iterkeys(**kw) def itervalues(d, **kw): return d.itervalues(**kw) def iteritems(d, **kw): return d.iteritems(**kw) def iterlists(d, **kw): return d.iterlists(**kw) viewkeys = operator.methodcaller("viewkeys") viewvalues = operator.methodcaller("viewvalues") viewitems = operator.methodcaller("viewitems") else: def iterkeys(d, **kw): return iter(d.keys(**kw)) def itervalues(d, **kw): return iter(d.values(**kw)) def iteritems(d, **kw): return iter(d.items(**kw)) def iterlists(d, **kw): return iter(d.lists(**kw)) viewkeys = operator.methodcaller("keys") viewvalues = operator.methodcaller("values") viewitems = operator.methodcaller("items") _add_doc(iterkeys, "Return an iterator over the keys of a dictionary.") _add_doc(itervalues, "Return an iterator over the values of a dictionary.") _add_doc(iteritems, "Return an iterator over the (key, value) pairs of a dictionary.") _add_doc(iterlists, "Return an iterator over the (key, [values]) pairs of a dictionary.") if PY2: def b(s): return s # Workaround for standalone backslash def u(s): return unicode(s.replace(r'\\', r'\\\\'), "unicode_escape") unichr = unichr int2byte = chr def byte2int(bs): return ord(bs[0]) def indexbytes(buf, i): return ord(buf[i]) iterbytes = functools.partial(itertools.imap, ord) import StringIO StringIO = BytesIO = StringIO.StringIO else: def b(s): return s.encode("latin-1") def u(s): return s unichr = chr import struct int2byte = struct.Struct(">B").pack del struct byte2int = operator.itemgetter(0) indexbytes = operator.getitem iterbytes = iter import io StringIO = io.StringIO BytesIO = io.BytesIO _add_doc(b, """Byte literal""") _add_doc(u, """Text literal""") if sys.version_info[0:2] < (3, 4): def wraps(wrapped, assigned=functools.WRAPPER_ASSIGNMENTS, updated=functools.WRAPPER_UPDATES): def wrapper(f): f = functools.wraps(wrapped, assigned, updated)(f) f.__wrapped__ = wrapped return f return wrapper else: wraps = functools.wraps def python_2_unicode_compatible(klass): """ A decorator that defines __unicode__ and __str__ methods under Python 2. Under Python 3 it does nothing. To support Python 2 and 3 with a single code base, define a __str__ method returning text and apply this decorator to the class. """ if PY2: if '__str__' not in klass.__dict__: raise ValueError("@python_2_unicode_compatible cannot be applied " "to %s because it doesn't define __str__()." % klass.__name__) klass.__unicode__ = klass.__str__ klass.__str__ = lambda self: self.__unicode__().encode('utf-8') return klass def utf8_str(p, enc='utf-8'): if p is None: return None if isinstance(p, text_type): return p.encode('utf-8') if enc != 'utf-8': return p.decode(enc).encode('utf-8') return p def unicode_str(p, enc='utf-8'): if p is None: return None if isinstance(p, text_type): return p return p.decode(enc) def to_text(data, encoding='utf8'): """ Make sure string is unicode type, decode with given encoding if it's not. If parameter is a object, object.__str__ will been called """ if isinstance(data, text_type): return data elif isinstance(data, binary_type): return data.decode(encoding, 'ignore') else: return text_type(data) def to_binary(data, encoding='utf8'): """ Make sure string is binary type, encode with given encoding if it's not. If parameter is a object, object.__str__ will been called """ if isinstance(data, binary_type): return data elif isinstance(data, text_type): return data.encode(encoding, 'ignore') else: return binary_type(data) def unicode_dict(_dict): """ Make sure keys and values of dict is unicode. """ r = {} for k, v in iteritems(_dict): r[unicode_obj(k)] = unicode_obj(v) return r def unicode_list(_list): """ Make sure every element in list is unicode. bytes will encode in base64 """ return [unicode_obj(x) for x in _list] def unicode_obj(obj): """ Make sure keys and values of dict/list/tuple is unicode. bytes will encode in base64. Can been decode by `decode_unicode_obj` """ if isinstance(obj, dict): return unicode_dict(obj) elif isinstance(obj, (list, tuple)): return unicode_list(obj) elif isinstance(obj, string_types): return to_text(obj) elif isinstance(obj, (int, float)): return obj elif obj is None: return obj else: try: return to_text(obj) except: return to_text(repr(obj)) def decode_unicode_obj(obj): """ Decode unicoded dict/list/tuple encoded by `unicode_obj` """ if isinstance(obj, dict): r = {} for k, v in iteritems(obj): r[to_binary(k)] = decode_unicode_obj(v) return r elif isinstance(obj, string_types): return to_binary(obj) elif isinstance(obj, (list, tuple)): return [decode_unicode_obj(x) for x in obj] else: return obj def unicode_argv(): if PY3: return sys.argv if OS_WIN: # Versions 2.x of Python don't support Unicode in sys.argv on # Windows, with the underlying Windows API instead replacing multi-byte # characters with '?'. So use shell32.GetCommandLineArgvW to get sys.argv # as a list of Unicode strings from ctypes import POINTER, byref, cdll, c_int, windll from ctypes.wintypes import LPCWSTR, LPWSTR GetCommandLineW = cdll.kernel32.GetCommandLineW GetCommandLineW.argtypes = [] GetCommandLineW.restype = LPCWSTR CommandLineToArgvW = windll.shell32.CommandLineToArgvW CommandLineToArgvW.argtypes = [LPCWSTR, POINTER(c_int)] CommandLineToArgvW.restype = POINTER(LPWSTR) cmd = GetCommandLineW() argc = c_int(0) argv = CommandLineToArgvW(cmd, byref(argc)) if argc.value > 0: # Remove Python executable and commands if present start = argc.value - len(sys.argv) return [argv[i] for i in range(start, argc.value)] # this should never happen return None else: argv = [] argvencoding = sys.stdin.encoding if argvencoding is None: argvencoding = sys.getfilesystemencoding() if argvencoding is None: argvencoding = 'utf-8' for arg in sys.argv: if isinstance(arg, text_type): argv.append(arg) else: argv.append(arg.decode(argvencoding)) return argv def main(): print(path.pathof(sys.argv[1])) if __name__ == '__main__': main()
import logging import os import sys def wire(): here = os.path.dirname(os.path.abspath(__file__)) parent = os.path.dirname(here) lib = os.path.join(parent, "lib") sys.path.append(lib) config = os.path.join(parent, "config") sys.path.append(config) wire() from ss2config import * import selfserve.tokens os.chdir(os.path.dirname(sys.argv[0])) # for STATE_DIR logger = logging.getLogger("%s.maint" % LOGGER_NAME) if __name__ == '__main__': if not sys.stderr.isatty(): logging.basicConfig(level=logging.__dict__[LOG_LEVEL_INTERACTIVE]) else: logging.basicConfig(level=logging.DEBUG) logger.debug('enabled verbose logging since isatty(%d)', sys.stderr.fileno()) for magics in [(PW_RESET_MAGIC, SESSION_MAGIC), ]: for hextoken, availid, expiry, _ in selfserve.tokens.iter_tokens(magics): if not selfserve.tokens.is_semantically_valid_token(hextoken, availid, expiry, None, None): # ### ignore NoSuchToken errors? selfserve.tokens.kill_token(hextoken)
"""Keepalived configuration datamodel Revision ID: 1e4c1d83044c Revises: 5a3ee5472c31 Create Date: 2015-08-06 10:39:54.998797 """ from alembic import op import sqlalchemy as sa from sqlalchemy import sql revision = '1e4c1d83044c' down_revision = '5a3ee5472c31' def upgrade(): op.create_table( u'vrrp_auth_method', sa.Column(u'name', sa.String(36), primary_key=True), sa.Column(u'description', sa.String(255), nullable=True) ) insert_table = sql.table( u'vrrp_auth_method', sql.column(u'name', sa.String), sql.column(u'description', sa.String) ) op.bulk_insert( insert_table, [ {'name': 'PASS'}, {'name': 'AH'} ] ) op.create_table( u'vrrp_group', sa.Column(u'load_balancer_id', sa.String(36), nullable=False), sa.Column(u'vrrp_group_name', sa.String(36), nullable=True), sa.Column(u'vrrp_auth_type', sa.String(16), nullable=True), sa.Column(u'vrrp_auth_pass', sa.String(36), nullable=True), sa.Column(u'advert_int', sa.Integer(), nullable=True), sa.PrimaryKeyConstraint(u'load_balancer_id'), sa.ForeignKeyConstraint([u'load_balancer_id'], [u'load_balancer.id'], name=u'fk_vrrp_group_load_balancer_id'), sa.ForeignKeyConstraint([u'vrrp_auth_type'], [u'vrrp_auth_method.name'], name=u'fk_load_balancer_vrrp_auth_method_name') ) op.add_column( u'listener', sa.Column(u'peer_port', sa.Integer(), nullable=True) ) op.add_column( u'amphora', sa.Column(u'vrrp_interface', sa.String(16), nullable=True) ) op.add_column( u'amphora', sa.Column(u'vrrp_id', sa.Integer(), nullable=True) ) op.add_column( u'amphora', sa.Column(u'vrrp_priority', sa.Integer(), nullable=True) )
from sqlalchemy import create_engine from sqlalchemy.orm import scoped_session, sessionmaker from sqlalchemy.ext.declarative import declarative_base engine = create_engine('mysql+mysqldb://root:root@localhost/test?charset=utf8', convert_unicode=True) db_session = scoped_session(sessionmaker(autocommit=False, autoflush=False, bind=engine)) Base = declarative_base() Base.query = db_session.query_property() def init_db(): from application.db import models Base.metadata.create_all(bind=engine)
from oslo_config import cfg from stevedore import driver from cloudkitty import config # noqa from cloudkitty import service CONF = cfg.CONF STORAGES_NAMESPACE = 'cloudkitty.storage.backends' def init_storage_backend(): CONF.import_opt('backend', 'cloudkitty.storage', 'storage') backend = driver.DriverManager( STORAGES_NAMESPACE, CONF.storage.backend) backend.driver.init() def main(): service.prepare_service() init_storage_backend()
""" Django settings for SegmentationService project. Generated by 'django-admin startproject' using Django 1.11.2. For more information on this file, see https://docs.djangoproject.com/en/1.11/topics/settings/ For the full list of settings and their values, see https://docs.djangoproject.com/en/1.11/ref/settings/ """ import os BASE_DIR = os.path.dirname(os.path.dirname(os.path.abspath(__file__))) SECRET_KEY = "+3kqv!q9^nky=07w%e8j_orelgln(j$)f&)gy=j+bef24+47j0" DEBUG = False ALLOWED_HOSTS = ['*'] INSTALLED_APPS = [ 'api.apps.ApiConfig', 'rest_framework', 'django.contrib.admin', 'django.contrib.auth', 'django.contrib.contenttypes', 'django.contrib.sessions', 'django.contrib.messages', 'django.contrib.staticfiles', ] MIDDLEWARE = [ 'django.middleware.security.SecurityMiddleware', 'django.contrib.sessions.middleware.SessionMiddleware', 'django.middleware.common.CommonMiddleware', 'django.middleware.csrf.CsrfViewMiddleware', 'django.contrib.auth.middleware.AuthenticationMiddleware', 'django.contrib.messages.middleware.MessageMiddleware', 'django.middleware.clickjacking.XFrameOptionsMiddleware', ] ROOT_URLCONF = 'SegmentationService.urls' TEMPLATES = [ { 'BACKEND': 'django.template.backends.django.DjangoTemplates', 'DIRS': [os.path.join(BASE_DIR, "templates")], 'APP_DIRS': True, 'OPTIONS': { 'context_processors': [ 'django.template.context_processors.debug', 'django.template.context_processors.request', 'django.contrib.auth.context_processors.auth', 'django.contrib.messages.context_processors.messages', ], }, }, ] WSGI_APPLICATION = 'SegmentationService.wsgi.application' LOGGING = { 'version': 1, 'disable_existing_loggers': False, 'formatters': { 'verbose': { 'format': '%(levelname)s %(asctime)s %(module)s %(message)s' }, 'simple': { 'format': '%(levelname)s %(message)s' }, }, 'handlers': { 'file': { 'level': 'DEBUG', 'class': 'logging.handlers.TimedRotatingFileHandler', 'filename': os.path.join(BASE_DIR, 'log/segmentation.log'), 'when': 'W0', 'backupCount': 52, 'formatter': 'verbose' }, }, 'loggers': { 'segmentation': { 'handlers': ['file'], 'level': 'DEBUG', 'propagate': True, }, 'segmentation.request': { 'handlers': ['file'], 'level': 'ERROR', 'propagate': False, }, }, } DATABASES = { 'default': { 'ENGINE': 'django.db.backends.sqlite3', 'NAME': os.path.join(BASE_DIR, 'db.sqlite3'), } } AUTH_PASSWORD_VALIDATORS = [ { 'NAME': 'django.contrib.auth.password_validation.UserAttributeSimilarityValidator', }, { 'NAME': 'django.contrib.auth.password_validation.MinimumLengthValidator', }, { 'NAME': 'django.contrib.auth.password_validation.CommonPasswordValidator', }, { 'NAME': 'django.contrib.auth.password_validation.NumericPasswordValidator', }, ] LANGUAGE_CODE = 'en-us' TIME_ZONE = 'America/Toronto' USE_I18N = True USE_L10N = True USE_TZ = True STATIC_URL = '/static/' STATIC_ROOT = os.path.join(BASE_DIR, 'static') BINARIZATION_SERIVICE_BASE_URL = "http://segmentationservice.acis.ufl.edu" MEDIA_ROOT = os.path.join(BASE_DIR, 'data') MEDIA_URL = '/data/' CSRF_COOKIE_SECURE = True SESSION_COOKIE_SECUR = True SECURE_CONTENT_TYPE_NOSNIFF = True SECURE_BROWSER_XSS_FILTER = True
import tushare as ts df = ts.get_h_data('600848',start='2016-08-05',end='2016-08-23', autype='hfq') print("#0", df) df = ts.get_hist_data('600848',start='2016-08-05',end='2016-08-23') print("#1", df) df = ts.get_hist_data('600848',start='2016-08-05',end='2016-08-23', ktype='W') print("#2", df) df = ts.get_hist_data('600848',start='2016-08-05',end='2016-08-23', ktype='M') print("#3", df) df = ts.get_hist_data('600848',start='2016-08-05',end='2016-08-23', ktype='5') print("#4", df) df = ts.get_hist_data('600848',start='2016-08-05',end='2016-08-23', ktype='15') print("#5", df) df = ts.get_hist_data('600848',start='2016-08-05',end='2016-08-23', ktype='30') print("#6", df) df = ts.get_hist_data('600848',start='2016-08-05',end='2016-08-23', ktype='60') print("#7", df)
import sys def kaprekar(n): n_digit_count = len(str(n)) m_str = str(n*n) r_str = m_str[-n_digit_count:] l_str = m_str[:-n_digit_count] l = 0 if len(l_str) == 0 else int(l_str) r = int(r_str) return l + r == n p = int(sys.stdin.readline()) q = int(sys.stdin.readline()) exists = False for i in range(p,q+1,1): if kaprekar(i): print(i, end=' ') exists = True if not exists: print('INVALID RANGE')
from pymongo import MongoClient import datetime import pymongo client = MongoClient() client = MongoClient('mongodb://mongodb_server:27017') db = client['test'] posts = db.posts post_data = { 'title': 'Python and MongoDB', 'content': 'PyMongo is fun, you guys', 'author': 'Scott' } result = posts.insert_one(post_data) print('One post: {0}'.format(result.inserted_id)) post_2 = { 'title': 'Virtual Environments', 'content': 'Use virtual environments, you guys', 'author': 'Scott', 'date': '2021-11-21' } post_3 = { 'title': 'Learning Python', 'content': 'Learn Python, it is easy', 'author': 'Bill' } new_result = posts.insert_many([post_2, post_3]) print('Multiple posts: {0}'.format(new_result.inserted_ids)) bills_post = posts.find_one({'author': 'Bill'}) print(bills_post) print("View all documents: ") cursor = posts.find() for document in cursor: print(document) print("Remove All Documents: ") result = posts.delete_many({}) print("To see the number of documents deleted: ", result.deleted_count)
import sys import synapseclient syn = synapseclient.login(silent=True) files = syn.restGET('/entity/md5/%s' % sys.argv[1]) for item in files['results']: print sys.argv[1], item['name'], item['id'], item['versionNumber']
"""Tests for asserts module.""" from __future__ import absolute_import from __future__ import division from __future__ import print_function from tensorflow.python.autograph.converters import asserts from tensorflow.python.autograph.converters import functions from tensorflow.python.autograph.core import converter_testing from tensorflow.python.framework import constant_op from tensorflow.python.framework import errors_impl from tensorflow.python.framework import ops from tensorflow.python.platform import test class AssertsTest(converter_testing.TestCase): def test_basic(self): def test_fn(a): assert a, 'testmsg' return a with ops.Graph().as_default(): with self.converted(test_fn, (functions, asserts), {}) as result: op = result.test_fn(constant_op.constant(False)) with self.assertRaisesRegexp(errors_impl.InvalidArgumentError, 'testmsg'): self.evaluate(op) if __name__ == '__main__': test.main()
import mock import os import sh import shutil import tempfile from six.moves import configparser import dlrn.shell from dlrn.build import build from dlrn.build import build_rpm_wrapper from dlrn.config import ConfigOptions from dlrn import db from dlrn.tests import base from dlrn import utils class FakePkgInfo(object): def preprocess(self, **argv): return dlrn.shell.pkginfo = FakePkgInfo() def mocked_listdir(directory): return ['python-pysaml2-3.0-1a.el7.centos.src.rpm'] @mock.patch('sh.restorecon', create=True) @mock.patch('sh.env', create=True) @mock.patch.object(sh.Command, '__call__', autospec=True) class TestBuild(base.TestCase): def setUp(self): super(TestBuild, self).setUp() self.configfile = configparser.RawConfigParser() self.configfile.read("projects.ini") self.configfile.set('DEFAULT', 'datadir', tempfile.mkdtemp()) self.configfile.set('DEFAULT', 'scriptsdir', tempfile.mkdtemp()) self.configfile.set('DEFAULT', 'baseurl', "file://%s" % self.configfile.get('DEFAULT', 'datadir')) self.config = ConfigOptions(self.configfile) shutil.copyfile(os.path.join("scripts", "centos8.cfg"), os.path.join(self.config.scriptsdir, "centos8.cfg")) with open(os.path.join(self.config.datadir, "delorean-deps.repo"), "w") as fp: fp.write("[test]\nname=test\nenabled=0\n") self.db_fd, filepath = tempfile.mkstemp() self.session = db.getSession("sqlite:///%s" % filepath) utils.loadYAML(self.session, './dlrn/tests/samples/commits_1.yaml') def tearDown(self): super(TestBuild, self).tearDown() shutil.rmtree(self.config.datadir) shutil.rmtree(self.config.scriptsdir) os.close(self.db_fd) # Make sure env vars are cleaned up if 'RELEASE_NUMBERING' in os.environ: del os.environ['RELEASE_NUMBERING'] if 'RELEASE_MINOR' in os.environ: del os.environ['RELEASE_MINOR'] @mock.patch('os.listdir', side_effect=mocked_listdir) def test_build_rpm_wrapper(self, ld_mock, sh_mock, env_mock, rc_mock): self.configfile.set('DEFAULT', 'build_driver', 'dlrn.drivers.mockdriver.MockBuildDriver') self.config = ConfigOptions(self.configfile) commit = db.getCommits(self.session)[-1] build_rpm_wrapper(commit, False, False, False, None, True) # 3 sh calls: # 1- build_srpm.sh # 2- mock (handled by env_mock) # 3- restorecon (handled by rc_mock) self.assertEqual(env_mock.call_count, 2) self.assertEqual(rc_mock.call_count, 1) self.assertTrue(os.path.exists(os.path.join(self.config.datadir, "dlrn-1.cfg"))) @mock.patch('dlrn.build.fetch_remote_file') @mock.patch('os.listdir', side_effect=mocked_listdir) def test_build_rpm_wrapper_custom_deps_url(self, ld_mock, get_mock, sh_mock, env_mock, rc_mock): self.configfile.set('DEFAULT', 'build_driver', 'dlrn.drivers.mockdriver.MockBuildDriver') self.configfile.set('DEFAULT', 'deps_url', 'file://%s/custom-deps.repo' % self.configfile.get('DEFAULT', 'datadir')) self.config = ConfigOptions(self.configfile) commit = db.getCommits(self.session)[-1] build_rpm_wrapper(commit, False, False, False, None, True) expected = [mock.call('file://%s/custom-deps.repo' % self.configfile.get('DEFAULT', 'datadir'))] self.assertEqual(expected, get_mock.call_args_list) @mock.patch('dlrn.build.fetch_remote_file') @mock.patch('os.listdir', side_effect=mocked_listdir) def test_build_rpm_wrapper_default_deps_url(self, ld_mock, url_mock, sh_mock, env_mock, rc_mock): self.configfile.set('DEFAULT', 'build_driver', 'dlrn.drivers.mockdriver.MockBuildDriver') self.config = ConfigOptions(self.configfile) commit = db.getCommits(self.session)[-1] build_rpm_wrapper(commit, False, False, False, None, True) expected = [mock.call('file://%s/delorean-deps.repo' % self.configfile.get('DEFAULT', 'datadir'))] self.assertEqual(expected, url_mock.call_args_list) @mock.patch('os.listdir', side_effect=mocked_listdir) def test_build_rpm_wrapper_release_numbering(self, ld_mock, sh_mock, env_mock, rc_mock): self.configfile.set('DEFAULT', 'build_driver', 'dlrn.drivers.mockdriver.MockBuildDriver') self.configfile.set('DEFAULT', 'release_numbering', 'minor.date.hash') self.configfile.set('DEFAULT', 'release_minor', '2') self.config = ConfigOptions(self.configfile) commit = db.getCommits(self.session)[-1] build_rpm_wrapper(commit, False, False, False, None, True) self.assertEqual(os.environ['RELEASE_NUMBERING'], 'minor.date.hash') self.assertEqual(os.environ['RELEASE_MINOR'], '2') @mock.patch('os.listdir', side_effect=mocked_listdir) def test_build(self, ld_mock, sh_mock, env_mock, rc_mock): self.configfile.set('DEFAULT', 'build_driver', 'dlrn.drivers.mockdriver.MockBuildDriver') self.config = ConfigOptions(self.configfile) commit = db.getCommits(self.session)[-1] try: build([], commit, None, False, False, False, True) except Exception as e: self.assertIn("No rpms built for", str(e)) @mock.patch('os.listdir', side_effect=mocked_listdir) def test_build_configdir(self, ld_mock, sh_mock, env_mock, rc_mock): configdir = tempfile.mkdtemp() self.configfile.set('DEFAULT', 'configdir', configdir) self.configfile.set('DEFAULT', 'build_driver', 'dlrn.drivers.mockdriver.MockBuildDriver') self.config = ConfigOptions(self.configfile) shutil.copyfile(os.path.join("scripts", "centos8.cfg"), os.path.join(configdir, "centos8.cfg")) commit = db.getCommits(self.session)[-1] expected = [mock.call('%s/centos8.cfg' % configdir, '%s/dlrn-1.cfg.new' % self.config.datadir), mock.call('%s/dlrn-1.cfg.new' % self.config.datadir, '%s/dlrn-1.cfg' % self.config.datadir)] with mock.patch('shutil.copyfile', side_effect=shutil.copyfile) as cp_mock: build_rpm_wrapper(commit, False, False, False, None, True) self.assertEqual(expected, cp_mock.call_args_list) @mock.patch('dlrn.drivers.kojidriver.KojiBuildDriver.build_package') @mock.patch('os.listdir', side_effect=mocked_listdir) @mock.patch('dlrn.drivers.kojidriver.KojiBuildDriver.write_mock_config', create=True) def test_build_rpm_wrapper_mock_config(self, wm_mock, ld_mock, bp_mock, sh_mock, env_mock, rc_mock): self.configfile.set('kojibuild_driver', 'fetch_mock_config', 'True') self.configfile.set('DEFAULT', 'build_driver', 'dlrn.drivers.kojidriver.KojiBuildDriver') self.config = ConfigOptions(self.configfile) commit = db.getCommits(self.session)[-1] build_rpm_wrapper(commit, False, False, False, None, True) self.assertEqual(wm_mock.call_count, 1)
import mock import six import webob import ddt from cinder.api.contrib import types_manage from cinder import context from cinder import exception from cinder import test from cinder.tests.unit.api import fakes from cinder.tests.unit import fake_constants as fake from cinder.volume import volume_types DEFAULT_VOLUME_TYPE = fake.VOLUME_TYPE_ID IN_USE_VOLUME_TYPE = fake.VOLUME_TYPE2_ID UPDATE_DESC_ONLY_TYPE = fake.VOLUME_TYPE3_ID UPDATE_NAME_ONLY_TYPE = fake.VOLUME_TYPE4_ID UPDATE_NAME_AFTER_DELETE_TYPE = fake.VOLUME_TYPE5_ID NOT_FOUND_VOLUME_TYPE = fake.WILL_NOT_BE_FOUND_ID def stub_volume_type(id): specs = {"key1": "value1", "key2": "value2", "key3": "value3", "key4": "value4", "key5": "value5"} return dict(id=id, name='vol_type_%s' % six.text_type(id), description='vol_type_desc_%s' % six.text_type(id), extra_specs=specs) def stub_volume_type_updated(id, is_public=True): return dict(id=id, name='vol_type_%s_%s' % (six.text_type(id), six.text_type(id)), is_public=is_public, description='vol_type_desc_%s_%s' % ( six.text_type(id), six.text_type(id))) def stub_volume_type_updated_desc_only(id): return dict(id=id, name='vol_type_%s' % six.text_type(id), description='vol_type_desc_%s_%s' % ( six.text_type(id), six.text_type(id))) def return_volume_types_get_volume_type(context, id): if id == fake.WILL_NOT_BE_FOUND_ID: raise exception.VolumeTypeNotFound(volume_type_id=id) return stub_volume_type(id) def return_volume_types_destroy(context, name): if name == fake.WILL_NOT_BE_FOUND_ID: raise exception.VolumeTypeNotFoundByName(volume_type_name=name) pass def return_volume_types_with_volumes_destroy(context, id): if id == IN_USE_VOLUME_TYPE: raise exception.VolumeTypeInUse(volume_type_id=id) pass def return_volume_types_create(context, name, specs, is_public, description): pass def return_volume_types_create_duplicate_type(context, name, specs, is_public, description): raise exception.VolumeTypeExists(id=name) def stub_volume_type_updated_name_only(id): return dict(id=id, name='vol_type_%s_%s' % (six.text_type(id), six.text_type(id)), description='vol_type_desc_%s' % six.text_type(id)) def stub_volume_type_updated_name_after_delete(id): return dict(id=id, name='vol_type_%s' % six.text_type(id), description='vol_type_desc_%s' % six.text_type(id)) def return_volume_types_get_volume_type_updated(id, is_public=True): if id == NOT_FOUND_VOLUME_TYPE: raise exception.VolumeTypeNotFound(volume_type_id=id) if id == UPDATE_DESC_ONLY_TYPE: return stub_volume_type_updated_desc_only(id) if id == UPDATE_NAME_ONLY_TYPE: return stub_volume_type_updated_name_only(id) if id == UPDATE_NAME_AFTER_DELETE_TYPE: return stub_volume_type_updated_name_after_delete(id) # anything else return stub_volume_type_updated(id, is_public=is_public) def return_volume_types_get_by_name(context, name): if name == NOT_FOUND_VOLUME_TYPE: raise exception.VolumeTypeNotFoundByName(volume_type_name=name) return stub_volume_type(name.split("_")[2]) def return_volume_types_get_default(): return stub_volume_type(DEFAULT_VOLUME_TYPE) def return_volume_types_get_default_not_found(): return {} @ddt.ddt class VolumeTypesManageApiTest(test.TestCase): def setUp(self): super(VolumeTypesManageApiTest, self).setUp() self.flags(host='fake') self.controller = types_manage.VolumeTypesManageController() """to reset notifier drivers left over from other api/contrib tests""" def tearDown(self): super(VolumeTypesManageApiTest, self).tearDown() def test_volume_types_delete(self): self.stubs.Set(volume_types, 'get_volume_type', return_volume_types_get_volume_type) self.stubs.Set(volume_types, 'destroy', return_volume_types_destroy) req = fakes.HTTPRequest.blank('/v2/%s/types/%s' % ( fake.PROJECT_ID, DEFAULT_VOLUME_TYPE)) self.assertEqual(0, len(self.notifier.notifications)) self.controller._delete(req, DEFAULT_VOLUME_TYPE) self.assertEqual(1, len(self.notifier.notifications)) def test_volume_types_delete_not_found(self): self.stubs.Set(volume_types, 'get_volume_type', return_volume_types_get_volume_type) self.stubs.Set(volume_types, 'destroy', return_volume_types_destroy) self.assertEqual(0, len(self.notifier.notifications)) req = fakes.HTTPRequest.blank('/v2/%s/types/%s' % ( fake.PROJECT_ID, NOT_FOUND_VOLUME_TYPE)) self.assertRaises(webob.exc.HTTPNotFound, self.controller._delete, req, NOT_FOUND_VOLUME_TYPE) self.assertEqual(1, len(self.notifier.notifications)) def test_volume_types_with_volumes_destroy(self): self.stubs.Set(volume_types, 'get_volume_type', return_volume_types_get_volume_type) self.stubs.Set(volume_types, 'destroy', return_volume_types_with_volumes_destroy) req = fakes.HTTPRequest.blank('/v2/%s/types/%s' % ( fake.PROJECT_ID, DEFAULT_VOLUME_TYPE)) self.assertEqual(0, len(self.notifier.notifications)) self.controller._delete(req, DEFAULT_VOLUME_TYPE) self.assertEqual(1, len(self.notifier.notifications)) @mock.patch('cinder.volume.volume_types.destroy') @mock.patch('cinder.volume.volume_types.get_volume_type') @mock.patch('cinder.policy.enforce') def test_volume_types_delete_with_non_admin(self, mock_policy_enforce, mock_get, mock_destroy): # allow policy authorized user to delete type mock_policy_enforce.return_value = None mock_get.return_value = \ {'extra_specs': {"key1": "value1"}, 'id': DEFAULT_VOLUME_TYPE, 'name': u'vol_type_1', 'description': u'vol_type_desc_%s' % DEFAULT_VOLUME_TYPE} mock_destroy.side_effect = return_volume_types_destroy req = fakes.HTTPRequest.blank('/v2/%s/types/%s' % (fake.PROJECT_ID, DEFAULT_VOLUME_TYPE), use_admin_context=False) self.assertEqual(0, len(self.notifier.notifications)) self.controller._delete(req, DEFAULT_VOLUME_TYPE) self.assertEqual(1, len(self.notifier.notifications)) # non policy authorized user fails to delete type mock_policy_enforce.side_effect = ( exception.PolicyNotAuthorized(action='type_delete')) self.assertRaises(exception.PolicyNotAuthorized, self.controller._delete, req, DEFAULT_VOLUME_TYPE) def test_create(self): self.stubs.Set(volume_types, 'create', return_volume_types_create) self.stubs.Set(volume_types, 'get_volume_type_by_name', return_volume_types_get_by_name) body = {"volume_type": {"name": "vol_type_1", "os-volume-type-access:is_public": True, "extra_specs": {"key1": "value1"}}} req = fakes.HTTPRequest.blank('/v2/%s/types' % fake.PROJECT_ID) self.assertEqual(0, len(self.notifier.notifications)) res_dict = self.controller._create(req, body) self.assertEqual(1, len(self.notifier.notifications)) id = res_dict['volume_type']['id'] self._check_test_results(res_dict, { 'expected_name': 'vol_type_1', 'expected_desc': 'vol_type_desc_%s' % id}) @mock.patch('cinder.volume.volume_types.create') @mock.patch('cinder.volume.volume_types.get_volume_type_by_name') def test_create_with_description_of_zero_length( self, mock_get_volume_type_by_name, mock_create_type): mock_get_volume_type_by_name.return_value = \ {'extra_specs': {"key1": "value1"}, 'id': DEFAULT_VOLUME_TYPE, 'name': u'vol_type_1', 'description': u''} type_description = "" body = {"volume_type": {"name": "vol_type_1", "description": type_description, "extra_specs": {"key1": "value1"}}} req = fakes.HTTPRequest.blank('/v2/%s/types' % fake.PROJECT_ID) res_dict = self.controller._create(req, body) self._check_test_results(res_dict, { 'expected_name': 'vol_type_1', 'expected_desc': ''}) def test_create_type_with_name_too_long(self): type_name = 'a' * 256 body = {"volume_type": {"name": type_name, "extra_specs": {"key1": "value1"}}} req = fakes.HTTPRequest.blank('/v2/%s/types' % fake.PROJECT_ID) self.assertRaises(exception.InvalidInput, self.controller._create, req, body) def test_create_type_with_description_too_long(self): type_description = 'a' * 256 body = {"volume_type": {"name": "vol_type_1", "description": type_description, "extra_specs": {"key1": "value1"}}} req = fakes.HTTPRequest.blank('/v2/%s/types' % fake.PROJECT_ID) self.assertRaises(exception.InvalidInput, self.controller._create, req, body) def test_create_duplicate_type_fail(self): self.stubs.Set(volume_types, 'create', return_volume_types_create_duplicate_type) self.stubs.Set(volume_types, 'get_volume_type_by_name', return_volume_types_get_by_name) body = {"volume_type": {"name": "vol_type_1", "extra_specs": {"key1": "value1"}}} req = fakes.HTTPRequest.blank('/v2/%s/types' % fake.PROJECT_ID) self.assertRaises(webob.exc.HTTPConflict, self.controller._create, req, body) def test_create_type_with_invalid_is_public(self): body = {"volume_type": {"name": "vol_type_1", "os-volume-type-access:is_public": "fake", "description": "test description", "extra_specs": {"key1": "value1"}}} req = fakes.HTTPRequest.blank('/v2/%s/types' % fake.PROJECT_ID) self.assertRaises(webob.exc.HTTPBadRequest, self.controller._create, req, body) def _create_volume_type_bad_body(self, body): req = fakes.HTTPRequest.blank('/v2/%s/types' % fake.PROJECT_ID) req.method = 'POST' self.assertRaises(webob.exc.HTTPBadRequest, self.controller._create, req, body) def test_create_no_body(self): self._create_volume_type_bad_body(body=None) def test_create_missing_volume(self): body = {'foo': {'a': 'b'}} self._create_volume_type_bad_body(body=body) def test_create_malformed_entity(self): body = {'volume_type': 'string'} self._create_volume_type_bad_body(body=body) @mock.patch('cinder.volume.volume_types.create') @mock.patch('cinder.volume.volume_types.get_volume_type_by_name') @mock.patch('cinder.policy.enforce') def test_create_with_none_admin(self, mock_policy_enforce, mock_get_volume_type_by_name, mock_create_type): # allow policy authorized user to create type mock_policy_enforce.return_value = None mock_get_volume_type_by_name.return_value = \ {'extra_specs': {"key1": "value1"}, 'id': DEFAULT_VOLUME_TYPE, 'name': u'vol_type_1', 'description': u'vol_type_desc_1'} body = {"volume_type": {"name": "vol_type_1", "os-volume-type-access:is_public": True, "extra_specs": {"key1": "value1"}}} req = fakes.HTTPRequest.blank('/v2/%s/types' % fake.PROJECT_ID, use_admin_context=False) self.assertEqual(0, len(self.notifier.notifications)) res_dict = self.controller._create(req, body) self.assertEqual(1, len(self.notifier.notifications)) self._check_test_results(res_dict, { 'expected_name': 'vol_type_1', 'expected_desc': 'vol_type_desc_1'}) # non policy authorized user fails to create type mock_policy_enforce.side_effect = ( exception.PolicyNotAuthorized(action='type_create')) self.assertRaises(exception.PolicyNotAuthorized, self.controller._create, req, body) @ddt.data({'a' * 256: 'a'}, {'a': 'a' * 256}, {'': 'a'}, 'foo', None) def test_create_type_with_invalid_extra_specs(self, value): body = {"volume_type": {"name": "vol_type_1", "os-volume-type-access:is_public": False, "description": "test description"}} body['volume_type']['extra_specs'] = value req = fakes.HTTPRequest.blank('/v2/%s/types' % fake.PROJECT_ID) self.assertRaises(exception.InvalidInput, self.controller._create, req, body) @mock.patch('cinder.volume.volume_types.update') @mock.patch('cinder.volume.volume_types.get_volume_type') def test_update(self, mock_get, mock_update): mock_get.return_value = return_volume_types_get_volume_type_updated( DEFAULT_VOLUME_TYPE, is_public=False) body = {"volume_type": {"is_public": False}} req = fakes.HTTPRequest.blank('/v2/%s/types/%s' % ( fake.PROJECT_ID, DEFAULT_VOLUME_TYPE)) req.method = 'PUT' self.assertEqual(0, len(self.notifier.notifications)) res_dict = self.controller._update(req, DEFAULT_VOLUME_TYPE, body) self.assertEqual(1, len(self.notifier.notifications)) self._check_test_results( res_dict, {'expected_desc': 'vol_type_desc_%s_%s' % (DEFAULT_VOLUME_TYPE, DEFAULT_VOLUME_TYPE), 'expected_name': 'vol_type_%s_%s' % (DEFAULT_VOLUME_TYPE, DEFAULT_VOLUME_TYPE), 'is_public': False}) @mock.patch('cinder.volume.volume_types.update') @mock.patch('cinder.volume.volume_types.get_volume_type') def test_update_type_with_description_having_length_zero( self, mock_get_volume_type, mock_type_update): mock_get_volume_type.return_value = \ {'id': DEFAULT_VOLUME_TYPE, 'name': u'vol_type_1', 'description': u''} type_description = "" body = {"volume_type": {"description": type_description}} req = fakes.HTTPRequest.blank('/v2/%s/types/%s' % ( fake.PROJECT_ID, DEFAULT_VOLUME_TYPE)) req.method = 'PUT' resp = self.controller._update(req, DEFAULT_VOLUME_TYPE, body) self._check_test_results(resp, {'expected_desc': '', 'expected_name': 'vol_type_1'}) def test_update_type_with_name_too_long(self): type_name = 'a' * 256 body = {"volume_type": {"name": type_name, "description": ""}} req = fakes.HTTPRequest.blank('/v2/%s/types/%s' % ( fake.PROJECT_ID, DEFAULT_VOLUME_TYPE)) req.method = 'PUT' self.assertRaises(exception.InvalidInput, self.controller._update, req, DEFAULT_VOLUME_TYPE, body) def test_update_type_with_description_too_long(self): type_description = 'a' * 256 body = {"volume_type": {"description": type_description}} req = fakes.HTTPRequest.blank('/v2/%s/types/%s' % ( fake.PROJECT_ID, DEFAULT_VOLUME_TYPE)) req.method = 'PUT' self.assertRaises(exception.InvalidInput, self.controller._update, req, DEFAULT_VOLUME_TYPE, body) @mock.patch('cinder.volume.volume_types.get_volume_type') @mock.patch('cinder.volume.volume_types.update') def test_update_non_exist(self, mock_update, mock_get_volume_type): mock_get_volume_type.side_effect = exception.VolumeTypeNotFound( volume_type_id=NOT_FOUND_VOLUME_TYPE) body = {"volume_type": {"name": "vol_type_1_1", "description": "vol_type_desc_1_1"}} req = fakes.HTTPRequest.blank('/v2/%s/types/%s' % ( fake.PROJECT_ID, NOT_FOUND_VOLUME_TYPE)) req.method = 'PUT' self.assertEqual(0, len(self.notifier.notifications)) self.assertRaises(webob.exc.HTTPNotFound, self.controller._update, req, NOT_FOUND_VOLUME_TYPE, body) self.assertEqual(1, len(self.notifier.notifications)) @mock.patch('cinder.volume.volume_types.get_volume_type') @mock.patch('cinder.volume.volume_types.update') def test_update_db_fail(self, mock_update, mock_get_volume_type): mock_update.side_effect = exception.VolumeTypeUpdateFailed( id=DEFAULT_VOLUME_TYPE) mock_get_volume_type.return_value = stub_volume_type( DEFAULT_VOLUME_TYPE) body = {"volume_type": {"name": "vol_type_1_1", "description": "vol_type_desc_1_1"}} req = fakes.HTTPRequest.blank('/v2/%s/types/%s' % ( fake.PROJECT_ID, DEFAULT_VOLUME_TYPE)) req.method = 'PUT' self.assertEqual(0, len(self.notifier.notifications)) self.assertRaises(webob.exc.HTTPInternalServerError, self.controller._update, req, DEFAULT_VOLUME_TYPE, body) self.assertEqual(1, len(self.notifier.notifications)) def test_update_no_name_no_description(self): body = {"volume_type": {}} req = fakes.HTTPRequest.blank('/v2/%s/types/%s' % ( fake.PROJECT_ID, DEFAULT_VOLUME_TYPE)) req.method = 'PUT' self.assertRaises(webob.exc.HTTPBadRequest, self.controller._update, req, DEFAULT_VOLUME_TYPE, body) def test_update_empty_name(self): body = {"volume_type": {"name": " ", "description": "something"}} req = fakes.HTTPRequest.blank('/v2/%s/types/%s' % ( fake.PROJECT_ID, DEFAULT_VOLUME_TYPE)) req.method = 'PUT' self.assertRaises(webob.exc.HTTPBadRequest, self.controller._update, req, DEFAULT_VOLUME_TYPE, body) @mock.patch('cinder.volume.volume_types.get_volume_type') @mock.patch('cinder.db.volume_type_update') @mock.patch('cinder.quota.VolumeTypeQuotaEngine.' 'update_quota_resource') def test_update_only_name(self, mock_update_quota, mock_update, mock_get): mock_get.return_value = return_volume_types_get_volume_type_updated( UPDATE_NAME_ONLY_TYPE) ctxt = context.RequestContext(fake.USER_ID, fake.PROJECT_ID, True) name = "vol_type_%s" % UPDATE_NAME_ONLY_TYPE updated_name = "%s_%s" % (name, UPDATE_NAME_ONLY_TYPE) desc = "vol_type_desc_%s" % UPDATE_NAME_ONLY_TYPE body = {"volume_type": {"name": name}} req = fakes.HTTPRequest.blank('/v2/%s/types/%s' % (fake.PROJECT_ID, UPDATE_NAME_ONLY_TYPE)) req.method = 'PUT' req.environ['cinder.context'] = ctxt self.assertEqual(0, len(self.notifier.notifications)) res_dict = self.controller._update(req, UPDATE_NAME_ONLY_TYPE, body) self.assertEqual(1, len(self.notifier.notifications)) mock_update_quota.assert_called_once_with(ctxt, updated_name, name) self._check_test_results(res_dict, {'expected_name': updated_name, 'expected_desc': desc}) @mock.patch('cinder.volume.volume_types.update') @mock.patch('cinder.volume.volume_types.get_volume_type') def test_update_only_description(self, mock_get, mock_update): mock_get.return_value = return_volume_types_get_volume_type_updated( UPDATE_DESC_ONLY_TYPE) name = "vol_type_%s" % UPDATE_DESC_ONLY_TYPE desc = "vol_type_desc_%s" % UPDATE_DESC_ONLY_TYPE updated_desc = "%s_%s" % (desc, UPDATE_DESC_ONLY_TYPE) body = {"volume_type": {"description": updated_desc}} req = fakes.HTTPRequest.blank('/v2/%s/types/%s' % ( fake.PROJECT_ID, UPDATE_DESC_ONLY_TYPE)) req.method = 'PUT' self.assertEqual(0, len(self.notifier.notifications)) res_dict = self.controller._update(req, UPDATE_DESC_ONLY_TYPE, body) self.assertEqual(1, len(self.notifier.notifications)) self._check_test_results(res_dict, {'expected_name': name, 'expected_desc': updated_desc}) @mock.patch('cinder.volume.volume_types.update') @mock.patch('cinder.volume.volume_types.get_volume_type') def test_update_only_is_public(self, mock_get, mock_update): is_public = False mock_get.return_value = return_volume_types_get_volume_type_updated( DEFAULT_VOLUME_TYPE, is_public=is_public) name = "vol_type_%s" % DEFAULT_VOLUME_TYPE updated_name = '%s_%s' % (name, DEFAULT_VOLUME_TYPE) desc = "vol_type_desc_%s" % DEFAULT_VOLUME_TYPE updated_desc = "%s_%s" % (desc, DEFAULT_VOLUME_TYPE) body = {"volume_type": {"is_public": is_public}} req = fakes.HTTPRequest.blank('/v2/%s/types/%s' % ( fake.PROJECT_ID, DEFAULT_VOLUME_TYPE)) req.method = 'PUT' self.assertEqual(0, len(self.notifier.notifications)) res_dict = self.controller._update(req, DEFAULT_VOLUME_TYPE, body) self.assertEqual(1, len(self.notifier.notifications)) self._check_test_results(res_dict, {'expected_name': updated_name, 'expected_desc': updated_desc, 'is_public': False}) def test_update_invalid_is_public(self): body = {"volume_type": {"name": "test", "description": "something", "is_public": "fake"}} req = fakes.HTTPRequest.blank('/v2/%s/types/%s' % ( fake.PROJECT_ID, DEFAULT_VOLUME_TYPE)) req.method = 'PUT' self.assertRaises(webob.exc.HTTPBadRequest, self.controller._update, req, DEFAULT_VOLUME_TYPE, body) @mock.patch('cinder.volume.volume_types.update') @mock.patch('cinder.volume.volume_types.get_volume_type') def test_rename_existing_name(self, mock_get, mock_update): id = UPDATE_NAME_AFTER_DELETE_TYPE name = "vol_type_%s" % id updated_name = "%s_%s" % (name, id) desc = "vol_type_desc_%s" % id mock_update.side_effect = exception.VolumeTypeExists( id=id, name=name) mock_get.return_value = return_volume_types_get_volume_type_updated( UPDATE_NAME_AFTER_DELETE_TYPE) # first attempt fail body = {"volume_type": {"name": name}} req = fakes.HTTPRequest.blank('/v2/%s/types/%s' % ( fake.PROJECT_ID, UPDATE_NAME_AFTER_DELETE_TYPE)) req.method = 'PUT' self.assertEqual(0, len(self.notifier.notifications)) self.assertRaises(webob.exc.HTTPConflict, self.controller._update, req, UPDATE_NAME_AFTER_DELETE_TYPE, body) self.assertEqual(1, len(self.notifier.notifications)) # delete self.notifier.reset() self.stubs.Set(volume_types, 'destroy', return_volume_types_destroy) req = fakes.HTTPRequest.blank('/v2/%s/types/%s' % ( fake.PROJECT_ID, UPDATE_NAME_AFTER_DELETE_TYPE)) self.assertEqual(0, len(self.notifier.notifications)) self.controller._delete(req, UPDATE_NAME_AFTER_DELETE_TYPE) self.assertEqual(1, len(self.notifier.notifications)) # update again mock_update.side_effect = mock.MagicMock() body = {"volume_type": {"name": updated_name}} req = fakes.HTTPRequest.blank('/v2/%s/types/%s' % ( fake.PROJECT_ID, UPDATE_NAME_AFTER_DELETE_TYPE)) req.method = 'PUT' self.notifier.reset() self.assertEqual(0, len(self.notifier.notifications)) res_dict = self.controller._update(req, UPDATE_NAME_AFTER_DELETE_TYPE, body) self._check_test_results(res_dict, {'expected_name': name, 'expected_desc': desc}) self.assertEqual(1, len(self.notifier.notifications)) @mock.patch('cinder.volume.volume_types.update') @mock.patch('cinder.volume.volume_types.get_volume_type') @mock.patch('cinder.policy.enforce') def test_update_with_non_admin(self, mock_policy_enforce, mock_get, mock_update): # allow policy authorized user to update type mock_policy_enforce.return_value = None mock_get.return_value = return_volume_types_get_volume_type_updated( DEFAULT_VOLUME_TYPE, is_public=False) name = "vol_type_%s" % DEFAULT_VOLUME_TYPE updated_name = "%s_%s" % (name, DEFAULT_VOLUME_TYPE) desc = "vol_type_desc_%s" % DEFAULT_VOLUME_TYPE updated_desc = "%s_%s" % (desc, DEFAULT_VOLUME_TYPE) body = {"volume_type": {"name": updated_name, "description": updated_desc, "is_public": False}} req = fakes.HTTPRequest.blank('/v2/%s/types/%s' % ( fake.PROJECT_ID, DEFAULT_VOLUME_TYPE), use_admin_context=False) req.method = 'PUT' self.assertEqual(0, len(self.notifier.notifications)) res_dict = self.controller._update(req, DEFAULT_VOLUME_TYPE, body) self.assertEqual(1, len(self.notifier.notifications)) self._check_test_results(res_dict, {'expected_desc': updated_desc, 'expected_name': updated_name, 'is_public': False}) # non policy authorized user fails to update type mock_policy_enforce.side_effect = ( exception.PolicyNotAuthorized(action='type_update')) self.assertRaises(exception.PolicyNotAuthorized, self.controller._update, req, DEFAULT_VOLUME_TYPE, body) def _check_test_results(self, results, expected_results): self.assertEqual(1, len(results)) self.assertEqual(expected_results['expected_desc'], results['volume_type']['description']) if expected_results.get('expected_name'): self.assertEqual(expected_results['expected_name'], results['volume_type']['name']) if expected_results.get('is_public') is not None: self.assertEqual(expected_results['is_public'], results['volume_type']['is_public'])
from __future__ import print_function import time from RF24 import * import RPi.GPIO as GPIO irq_gpio_pin = None radio = RF24(22, 0); def try_read_data(channel=0): if radio.available(): while radio.available(): len = radio.getDynamicPayloadSize() receive_payload = radio.read(len) print('Got payload size={} value="{}"'.format(len, receive_payload.decode('utf-8'))) # First, stop listening so we can talk radio.stopListening() # Send the final one back. radio.write(receive_payload) print('Sent response.') # Now, resume listening so we catch the next packets. radio.startListening() pipes = [0xF0F0F0F0E1, 0xF0F0F0F0D2] min_payload_size = 4 max_payload_size = 32 payload_size_increments_by = 1 next_payload_size = min_payload_size inp_role = 'none' send_payload = b'ABCDEFGHIJKLMNOPQRSTUVWXYZ789012' millis = lambda: int(round(time.time() * 1000)) print('pyRF24/examples/pingpair_dyn/') radio.begin() radio.enableDynamicPayloads() radio.setRetries(5, 15) radio.printDetails() print(' ************ Role Setup *********** ') while (inp_role != '0') and (inp_role != '1'): inp_role = str(input('Choose a role: Enter 0 for receiver, 1 for transmitter (CTRL+C to exit) ')) if inp_role == '0': print('Role: Pong Back, awaiting transmission') if irq_gpio_pin is not None: # set up callback for irq pin GPIO.setmode(GPIO.BCM) GPIO.setup(irq_gpio_pin, GPIO.IN, pull_up_down=GPIO.PUD_UP) GPIO.add_event_detect(irq_gpio_pin, GPIO.FALLING, callback=try_read_data) radio.openWritingPipe(pipes[1]) radio.openReadingPipe(1, pipes[0]) radio.startListening() else: print('Role: Ping Out, starting transmission') radio.openWritingPipe(pipes[0]) radio.openReadingPipe(1, pipes[1]) while 1: if inp_role == '1': # ping out # The payload will always be the same, what will change is how much of it we send. # First, stop listening so we can talk. radio.stopListening() # Take the time, and send it. This will block until complete print('Now sending length {} ... '.format(next_payload_size), end="") radio.write(send_payload[:next_payload_size]) # Now, continue listening radio.startListening() # Wait here until we get a response, or timeout started_waiting_at = millis() timeout = False while (not radio.available()) and (not timeout): if (millis() - started_waiting_at) > 500: timeout = True # Describe the results if timeout: print('failed, response timed out.') else: # Grab the response, compare, and send to debugging spew len = radio.getDynamicPayloadSize() receive_payload = radio.read(len) # Spew it print('got response size={} value="{}"'.format(len, receive_payload.decode('utf-8'))) # Update size for next time. next_payload_size += payload_size_increments_by if next_payload_size > max_payload_size: next_payload_size = min_payload_size time.sleep(0.1) else: # Pong back role. Receive each packet, dump it out, and send it back # if there is data ready if irq_gpio_pin is None: # no irq pin is set up -> poll it try_read_data() else: # callback routine set for irq pin takes care for reading - # do nothing, just sleeps in order not to burn cpu by looping time.sleep(1000)
from tensorforce import TensorforceError from tensorforce.core import tf_function from tensorforce.core.optimizers import UpdateModifier class OptimizerWrapper(UpdateModifier): """ Optimizer wrapper, which performs additional update modifications, argument order indicates modifier nesting from outside to inside (specification key: `optimizer_wrapper`). Args: optimizer (specification): Optimizer (<span style="color:#C00000"><b>required</b></span>). learning_rate (parameter, float > 0.0): Learning rate (<span style="color:#00C000"><b>default</b></span>: 1e-3). clipping_threshold (parameter, float > 0.0): Clipping threshold (<span style="color:#00C000"><b>default</b></span>: no clipping). multi_step (parameter, int >= 1): Number of optimization steps (<span style="color:#00C000"><b>default</b></span>: single step). subsampling_fraction (parameter, int > 0 | 0.0 < float <= 1.0): Absolute/relative fraction of batch timesteps to subsample (<span style="color:#00C000"><b>default</b></span>: no subsampling). linesearch_iterations (parameter, int >= 0): Maximum number of line search iterations, using a backtracking factor of 0.75 (<span style="color:#00C000"><b>default</b></span>: no line search). doublecheck_update (bool): Check whether update has decreased loss and otherwise reverse it name (string): (<span style="color:#0000C0"><b>internal use</b></span>). arguments_spec (specification): <span style="color:#0000C0"><b>internal use</b></span>. """ def __init__( self, optimizer, *, learning_rate=1e-3, clipping_threshold=None, multi_step=1, subsampling_fraction=1.0, linesearch_iterations=0, doublecheck_update=False, name=None, arguments_spec=None, # Deprecated optimizing_iterations=None, **kwargs ): if optimizing_iterations is not None: raise TensorforceError.deprecated( name='Optimizer', argument='optimizing_iterations', replacement='linesearch_iterations' ) if isinstance(optimizer, dict): if 'learning_rate' not in optimizer: optimizer['learning_rate'] = learning_rate else: optimizer = dict(type=optimizer) optimizer['learning_rate'] = learning_rate optimizer.update(kwargs) if doublecheck_update: optimizer = dict(type='doublecheck_step', optimizer=optimizer) if not isinstance(linesearch_iterations, int) or linesearch_iterations > 0: optimizer = dict( type='linesearch_step', optimizer=optimizer, max_iterations=linesearch_iterations ) if not isinstance(subsampling_fraction, float) or subsampling_fraction != 1.0: optimizer = dict( type='subsampling_step', optimizer=optimizer, fraction=subsampling_fraction ) if not isinstance(multi_step, int) or multi_step > 1: optimizer = dict(type='multi_step', optimizer=optimizer, num_steps=multi_step) if clipping_threshold is not None: optimizer = dict( type='clipping_step', optimizer=optimizer, threshold=clipping_threshold ) super().__init__(optimizer=optimizer, name=name, arguments_spec=arguments_spec) @tf_function(num_args=1) def step(self, *, arguments, variables, **kwargs): return self.optimizer.step(arguments=arguments, variables=variables, **kwargs)
import os import json import shutil import tempfile from solar.core.handlers import base from solar.core.handlers.base import SOLAR_TEMP_LOCAL_LOCATION from solar.core.handlers.base import TempFileHandler from solar.core.log import log from solar.core.provider import SVNProvider ROLES_PATH = '/etc/ansible/roles' class AnsiblePlaybookBase(base.BaseHandler): def download_roles(self, urls): if not os.path.exists(ROLES_PATH): os.makedirs(ROLES_PATH) for url in urls: provider = SVNProvider(url) provider.run() shutil.copytree(provider.directory, ROLES_PATH) class AnsiblePlaybook(AnsiblePlaybookBase, TempFileHandler): def _make_playbook(self, resource, action, action_path): dir_path = self.dirs[resource.name] dest_file = tempfile.mkstemp(text=True, prefix=action, dir=dir_path)[1] shutil.copyfile(action_path, dest_file) inventory_path = os.path.join(dir_path, 'inventory') with open(inventory_path, 'w') as inv: inv.write(self._make_inventory(resource)) extra_vars_path = os.path.join(dir_path, 'extra_vars') with open(extra_vars_path, 'w') as extra: extra.write(self._make_extra_vars(resource)) return dest_file, inventory_path, extra_vars_path def _make_inventory(self, resource): inventory = '{0} ansible_connection=local user={1}' user = self.transport_run.get_transport_data(resource)['user'] host = 'localhost' return inventory.format(host, user) def _make_extra_vars(self, resource): r_args = resource.args return json.dumps(r_args) def action(self, resource, action): action_file = os.path.join( resource.db_obj.actions_path, resource.actions[action]) self.prepare_templates_and_scripts(resource, action) ansible_library_path = self._copy_ansible_library(resource) files = self._make_playbook(resource, action, action_file) playbook_file, inventory_file, extra_vars_file = files self.transport_sync.copy(resource, self.dst, '/tmp') variables = resource.args if 'roles' in variables: self.download_roles(variables['roles']) self.transport_sync.copy(resource, ROLES_PATH, ROLES_PATH) self.transport_sync.sync_all() remote_playbook_file = playbook_file.replace( SOLAR_TEMP_LOCAL_LOCATION, '/tmp/') remote_inventory_file = inventory_file.replace( SOLAR_TEMP_LOCAL_LOCATION, '/tmp/') remote_extra_vars_file = extra_vars_file.replace( SOLAR_TEMP_LOCAL_LOCATION, '/tmp/') if ansible_library_path: remote_ansible_library_path = ansible_library_path.replace( SOLAR_TEMP_LOCAL_LOCATION, '/tmp/') call_args = [ 'ansible-playbook', '--module-path', remote_ansible_library_path, '-i', remote_inventory_file, '--extra-vars', '@%s' % remote_extra_vars_file, remote_playbook_file ] else: call_args = [ 'ansible-playbook', '-i', remote_inventory_file, '--extra-vars', '@%s' % remote_extra_vars_file, remote_playbook_file ] log.debug('EXECUTING: %s', ' '.join(call_args)) rst = self.transport_run.run(resource, *call_args) self.verify_run_result(call_args, rst)
from __future__ import unicode_literals import mock from moto.packages.httpretty.core import HTTPrettyRequest, fake_gethostname, fake_gethostbyname def test_parse_querystring(): core = HTTPrettyRequest(headers='test test HTTP/1.1') qs = 'test test' response = core.parse_querystring(qs) assert response == {} def test_parse_request_body(): core = HTTPrettyRequest(headers='test test HTTP/1.1') qs = 'test' response = core.parse_request_body(qs) assert response == 'test' def test_fake_gethostname(): response = fake_gethostname() assert response == 'localhost' def test_fake_gethostbyname(): host = 'test' response = fake_gethostbyname(host=host) assert response == '127.0.0.1'
import ldap from ldap import filter as ldap_filter from keystone.common.ldap import fakeldap from keystone.common import logging from keystone import exception LOG = logging.getLogger(__name__) LDAP_VALUES = {'TRUE': True, 'FALSE': False} CONTROL_TREEDELETE = '1.2.840.113556.1.4.805' LDAP_SCOPES = {'one': ldap.SCOPE_ONELEVEL, 'sub': ldap.SCOPE_SUBTREE} LDAP_DEREF = {'always': ldap.DEREF_ALWAYS, 'default': None, 'finding': ldap.DEREF_FINDING, 'never': ldap.DEREF_NEVER, 'searching': ldap.DEREF_SEARCHING} def py2ldap(val): if isinstance(val, str): return val elif isinstance(val, bool): return 'TRUE' if val else 'FALSE' else: return str(val) def ldap2py(val): try: return LDAP_VALUES[val] except KeyError: pass try: return int(val) except ValueError: pass return val def safe_iter(attrs): if attrs is None: return elif isinstance(attrs, list): for e in attrs: yield e else: yield attrs def parse_deref(opt): try: return LDAP_DEREF[opt] except KeyError: raise ValueError((_('Invalid LDAP deref option: %s. Choose one of: ') % opt) + ', '.join(LDAP_DEREF.keys())) def ldap_scope(scope): try: return LDAP_SCOPES[scope] except KeyError: raise ValueError(_('Invalid LDAP scope: %s. Choose one of: ' % scope) + ', '.join(LDAP_SCOPES.keys())) class BaseLdap(object): DEFAULT_SUFFIX = "dc=example,dc=com" DEFAULT_OU = None DEFAULT_STRUCTURAL_CLASSES = None DEFAULT_ID_ATTR = 'cn' DEFAULT_OBJECTCLASS = None DEFAULT_FILTER = None DUMB_MEMBER_DN = 'cn=dumb,dc=nonexistent' NotFound = None notfound_arg = None options_name = None model = None attribute_mapping = {} attribute_ignore = [] tree_dn = None def __init__(self, conf): self.LDAP_URL = conf.ldap.url self.LDAP_USER = conf.ldap.user self.LDAP_PASSWORD = conf.ldap.password self.LDAP_SCOPE = ldap_scope(conf.ldap.query_scope) self.alias_dereferencing = parse_deref(conf.ldap.alias_dereferencing) self.page_size = conf.ldap.page_size if self.options_name is not None: self.suffix = conf.ldap.suffix if self.suffix is None: self.suffix = self.DEFAULT_SUFFIX dn = '%s_tree_dn' % self.options_name self.tree_dn = (getattr(conf.ldap, dn) or '%s,%s' % (self.DEFAULT_OU, self.suffix)) idatt = '%s_id_attribute' % self.options_name self.id_attr = getattr(conf.ldap, idatt) or self.DEFAULT_ID_ATTR objclass = '%s_objectclass' % self.options_name self.object_class = (getattr(conf.ldap, objclass) or self.DEFAULT_OBJECTCLASS) filter = '%s_filter' % self.options_name self.filter = getattr(conf.ldap, filter) or self.DEFAULT_FILTER allow_create = '%s_allow_create' % self.options_name self.allow_create = getattr(conf.ldap, allow_create) allow_update = '%s_allow_update' % self.options_name self.allow_update = getattr(conf.ldap, allow_update) allow_delete = '%s_allow_delete' % self.options_name self.allow_delete = getattr(conf.ldap, allow_delete) self.structural_classes = self.DEFAULT_STRUCTURAL_CLASSES if self.notfound_arg is None: self.notfound_arg = self.options_name + '_id' self.use_dumb_member = getattr(conf.ldap, 'use_dumb_member') self.dumb_member = (getattr(conf.ldap, 'dumb_member') or self.DUMB_MEMBER_DN) self.subtree_delete_enabled = getattr(conf.ldap, 'allow_subtree_delete') def _not_found(self, object_id): if self.NotFound is None: return exception.NotFound(target=object_id) else: return self.NotFound(**{self.notfound_arg: object_id}) def get_connection(self, user=None, password=None): if self.LDAP_URL.startswith('fake://'): conn = fakeldap.FakeLdap(self.LDAP_URL) else: conn = LdapWrapper(self.LDAP_URL, self.page_size, alias_dereferencing=self.alias_dereferencing) if user is None: user = self.LDAP_USER if password is None: password = self.LDAP_PASSWORD # not all LDAP servers require authentication, so we don't bind # if we don't have any user/pass if user and password: conn.simple_bind_s(user, password) return conn def _id_to_dn_string(self, id): return '%s=%s,%s' % (self.id_attr, ldap.dn.escape_dn_chars(str(id)), self.tree_dn) def _id_to_dn(self, id): if self.LDAP_SCOPE == ldap.SCOPE_ONELEVEL: return self._id_to_dn_string(id) conn = self.get_connection() search_result = conn.search_s( self.tree_dn, self.LDAP_SCOPE, '(&(%(id_attr)s=%(id)s)(objectclass=%(objclass)s))' % {'id_attr': self.id_attr, 'id': ldap.filter.escape_filter_chars(str(id)), 'objclass': self.object_class}) if search_result: dn, attrs = search_result[0] return dn else: return self._id_to_dn_string(id) @staticmethod def _dn_to_id(dn): return ldap.dn.str2dn(dn)[0][0][1] def _ldap_res_to_model(self, res): obj = self.model(id=self._dn_to_id(res[0])) for k in obj.known_keys: if k in self.attribute_ignore: continue try: v = res[1][self.attribute_mapping.get(k, k)] except KeyError: pass else: try: obj[k] = v[0] except IndexError: obj[k] = None return obj def affirm_unique(self, values): if values.get('name') is not None: try: self.get_by_name(values['name']) except exception.NotFound: pass else: raise exception.Conflict(type=self.options_name, details=_('Duplicate name, %s.') % values['name']) if values.get('id') is not None: try: self.get(values['id']) except exception.NotFound: pass else: raise exception.Conflict(type=self.options_name, details=_('Duplicate ID, %s.') % values['id']) def create(self, values): if not self.allow_create: action = _('LDAP %s create') % self.options_name raise exception.ForbiddenAction(action=action) conn = self.get_connection() object_classes = self.structural_classes + [self.object_class] attrs = [('objectClass', object_classes)] for k, v in values.iteritems(): if k == 'id' or k in self.attribute_ignore: continue if v is not None: attr_type = self.attribute_mapping.get(k, k) attrs.append((attr_type, [v])) if 'groupOfNames' in object_classes and self.use_dumb_member: attrs.append(('member', [self.dumb_member])) conn.add_s(self._id_to_dn(values['id']), attrs) return values def _ldap_get(self, id, filter=None): conn = self.get_connection() query = ('(&(%(id_attr)s=%(id)s)' '%(filter)s' '(objectClass=%(object_class)s))' % {'id_attr': self.id_attr, 'id': ldap.filter.escape_filter_chars(str(id)), 'filter': (filter or self.filter or ''), 'object_class': self.object_class}) try: res = conn.search_s(self.tree_dn, self.LDAP_SCOPE, query, self.attribute_mapping.values()) except ldap.NO_SUCH_OBJECT: return None try: return res[0] except IndexError: return None def _ldap_get_all(self, filter=None): conn = self.get_connection() query = '(&%s(objectClass=%s))' % (filter or self.filter or '', self.object_class) try: return conn.search_s(self.tree_dn, self.LDAP_SCOPE, query, self.attribute_mapping.values()) except ldap.NO_SUCH_OBJECT: return [] def get(self, id, filter=None): res = self._ldap_get(id, filter) if res is None: raise self._not_found(id) else: return self._ldap_res_to_model(res) def get_by_name(self, name, filter=None): query = ('(%s=%s)' % (self.attribute_mapping['name'], ldap_filter.escape_filter_chars(name))) res = self.get_all(query) try: return res[0] except IndexError: raise self._not_found(name) def get_all(self, filter=None): return [self._ldap_res_to_model(x) for x in self._ldap_get_all(filter)] def update(self, id, values, old_obj=None): if not self.allow_update: action = _('LDAP %s update') % self.options_name raise exception.ForbiddenAction(action=action) if old_obj is None: old_obj = self.get(id) modlist = [] for k, v in values.iteritems(): if k == 'id' or k in self.attribute_ignore: continue if v is None: if old_obj[k] is not None: modlist.append((ldap.MOD_DELETE, self.attribute_mapping.get(k, k), None)) elif old_obj[k] != v: if old_obj[k] is None: op = ldap.MOD_ADD else: op = ldap.MOD_REPLACE modlist.append((op, self.attribute_mapping.get(k, k), [v])) if modlist: conn = self.get_connection() try: conn.modify_s(self._id_to_dn(id), modlist) except ldap.NO_SUCH_OBJECT: raise self._not_found(id) def delete(self, id): if not self.allow_delete: action = _('LDAP %s delete') % self.options_name raise exception.ForbiddenAction(action=action) conn = self.get_connection() try: conn.delete_s(self._id_to_dn(id)) except ldap.NO_SUCH_OBJECT: raise self._not_found(id) def deleteTree(self, id): conn = self.get_connection() tree_delete_control = ldap.controls.LDAPControl(CONTROL_TREEDELETE, 0, None) try: conn.delete_ext_s(self._id_to_dn(id), serverctrls=[tree_delete_control]) except ldap.NO_SUCH_OBJECT: raise self._not_found(id) class LdapWrapper(object): def __init__(self, url, page_size, alias_dereferencing=None): LOG.debug(_("LDAP init: url=%s"), url) self.conn = ldap.initialize(url) if alias_dereferencing is not None: self.conn.set_option(ldap.OPT_DEREF, alias_dereferencing) self.page_size = page_size def simple_bind_s(self, user, password): LOG.debug(_("LDAP bind: dn=%s"), user) return self.conn.simple_bind_s(user, password) def add_s(self, dn, attrs): ldap_attrs = [(kind, [py2ldap(x) for x in safe_iter(values)]) for kind, values in attrs] if LOG.isEnabledFor(logging.DEBUG): sane_attrs = [(kind, values if kind != 'userPassword' else ['****']) for kind, values in ldap_attrs] LOG.debug(_('LDAP add: dn=%s, attrs=%s'), dn, sane_attrs) return self.conn.add_s(dn, ldap_attrs) def search_s(self, dn, scope, query, attrlist=None): if LOG.isEnabledFor(logging.DEBUG): LOG.debug(_('LDAP search: dn=%s, scope=%s, query=%s, attrs=%s'), dn, scope, query, attrlist) if self.page_size: res = self.paged_search_s(dn, scope, query, attrlist) else: res = self.conn.search_s(dn, scope, query, attrlist) o = [] for dn, attrs in res: o.append((dn, dict((kind, [ldap2py(x) for x in values]) for kind, values in attrs.iteritems()))) return o def paged_search_s(self, dn, scope, query, attrlist=None): res = [] lc = ldap.controls.SimplePagedResultsControl( controlType=ldap.LDAP_CONTROL_PAGE_OID, criticality=True, controlValue=(self.page_size, '')) msgid = self.conn.search_ext(dn, scope, query, attrlist, serverctrls=[lc]) # Endless loop request pages on ldap server until it has no data while True: # Request to the ldap server a page with 'page_size' entries rtype, rdata, rmsgid, serverctrls = self.conn.result3(msgid) # Receive the data res.extend(rdata) pctrls = [c for c in serverctrls if c.controlType == ldap.LDAP_CONTROL_PAGE_OID] if pctrls: # LDAP server supports pagination est, cookie = pctrls[0].controlValue if cookie: # There is more data still on the server # so we request another page lc.controlValue = (self.page_size, cookie) msgid = self.conn.search_ext(dn, scope, query, attrlist, serverctrls=[lc]) else: # Exit condition no more data on server break else: LOG.warning(_('LDAP Server does not support paging. ' 'Disable paging in keystone.conf to ' 'avoid this message.')) self._disable_paging() break return res def modify_s(self, dn, modlist): ldap_modlist = [ (op, kind, (None if values is None else [py2ldap(x) for x in safe_iter(values)])) for op, kind, values in modlist] if LOG.isEnabledFor(logging.DEBUG): sane_modlist = [(op, kind, (values if kind != 'userPassword' else ['****'])) for op, kind, values in ldap_modlist] LOG.debug(_("LDAP modify: dn=%s, modlist=%s"), dn, sane_modlist) return self.conn.modify_s(dn, ldap_modlist) def delete_s(self, dn): LOG.debug(_("LDAP delete: dn=%s"), dn) return self.conn.delete_s(dn) def delete_ext_s(self, dn, serverctrls): LOG.debug(_("LDAP delete_ext: dn=%s, serverctrls=%s"), dn, serverctrls) return self.conn.delete_ext_s(dn, serverctrls) def _disable_paging(self): # Disable the pagination from now on self.page_size = 0 class EnabledEmuMixIn(BaseLdap): """Emulates boolean 'enabled' attribute if turned on. Creates groupOfNames holding all enabled objects of this class, all missing objects are considered disabled. Options: * $name_enabled_emulation - boolean, on/off * $name_enabled_emulation_dn - DN of that groupOfNames, default is cn=enabled_$name,$tree_dn Where $name is self.options_name ('user' or 'tenant'), $tree_dn is self.tree_dn. """ def __init__(self, conf): super(EnabledEmuMixIn, self).__init__(conf) enabled_emulation = '%s_enabled_emulation' % self.options_name self.enabled_emulation = getattr(conf.ldap, enabled_emulation) enabled_emulation_dn = '%s_enabled_emulation_dn' % self.options_name self.enabled_emulation_dn = getattr(conf.ldap, enabled_emulation_dn) if not self.enabled_emulation_dn: self.enabled_emulation_dn = ('cn=enabled_%ss,%s' % (self.options_name, self.tree_dn)) def _get_enabled(self, object_id): conn = self.get_connection() dn = self._id_to_dn(object_id) query = '(member=%s)' % dn try: enabled_value = conn.search_s(self.enabled_emulation_dn, ldap.SCOPE_BASE, query) except ldap.NO_SUCH_OBJECT: return False else: return bool(enabled_value) def _add_enabled(self, object_id): if not self._get_enabled(object_id): conn = self.get_connection() modlist = [(ldap.MOD_ADD, 'member', [self._id_to_dn(object_id)])] try: conn.modify_s(self.enabled_emulation_dn, modlist) except ldap.NO_SUCH_OBJECT: attr_list = [('objectClass', ['groupOfNames']), ('member', [self._id_to_dn(object_id)])] if self.use_dumb_member: attr_list[1][1].append(self.dumb_member) conn.add_s(self.enabled_emulation_dn, attr_list) def _remove_enabled(self, object_id): conn = self.get_connection() modlist = [(ldap.MOD_DELETE, 'member', [self._id_to_dn(object_id)])] try: conn.modify_s(self.enabled_emulation_dn, modlist) except (ldap.NO_SUCH_OBJECT, ldap.NO_SUCH_ATTRIBUTE): pass def create(self, values): if self.enabled_emulation: enabled_value = values.pop('enabled', True) ref = super(EnabledEmuMixIn, self).create(values) if 'enabled' not in self.attribute_ignore: if enabled_value: self._add_enabled(ref['id']) ref['enabled'] = enabled_value return ref else: return super(EnabledEmuMixIn, self).create(values) def get(self, object_id, filter=None): ref = super(EnabledEmuMixIn, self).get(object_id, filter) if 'enabled' not in self.attribute_ignore and self.enabled_emulation: ref['enabled'] = self._get_enabled(object_id) return ref def get_all(self, filter=None): if 'enabled' not in self.attribute_ignore and self.enabled_emulation: # had to copy BaseLdap.get_all here to filter by DN tenant_list = [self._ldap_res_to_model(x) for x in self._ldap_get_all(filter) if x[0] != self.enabled_emulation_dn] for tenant_ref in tenant_list: tenant_ref['enabled'] = self._get_enabled(tenant_ref['id']) return tenant_list else: return super(EnabledEmuMixIn, self).get_all(filter) def update(self, object_id, values, old_obj=None): if 'enabled' not in self.attribute_ignore and self.enabled_emulation: data = values.copy() enabled_value = data.pop('enabled', None) super(EnabledEmuMixIn, self).update(object_id, data, old_obj) if enabled_value is not None: if enabled_value: self._add_enabled(object_id) else: self._remove_enabled(object_id) else: super(EnabledEmuMixIn, self).update(object_id, values, old_obj) def delete(self, object_id): if self.enabled_emulation: self._remove_enabled(object_id) super(EnabledEmuMixIn, self).delete(object_id)
__author__ = 'dominiczippilli' def foo(): pass
"""Loop utilities.""" import jax import jax.numpy as jnp def _while_loop_scan(cond_fun, body_fun, init_val, max_iter): """Scan-based implementation (jit ok, reverse-mode autodiff ok).""" def _iter(val): next_val = body_fun(val) next_cond = cond_fun(next_val) return next_val, next_cond def _fun(tup, it): val, cond = tup # When cond is met, we start doing no-ops. return jax.lax.cond(cond, _iter, lambda x: (x, False), val), it init = (init_val, cond_fun(init_val)) return jax.lax.scan(_fun, init, None, length=max_iter)[0][0] def _while_loop_python(cond_fun, body_fun, init_val, maxiter): """Python based implementation (no jit, reverse-mode autodiff ok).""" val = init_val for _ in range(maxiter): cond = cond_fun(val) if not cond: # When condition is met, break (not jittable). break val = body_fun(val) return val def _while_loop_lax(cond_fun, body_fun, init_val, maxiter): """lax.while_loop based implementation (jit by default, no reverse-mode).""" def _cond_fun(_val): it, val = _val return jnp.logical_and(cond_fun(val), it <= maxiter - 1) def _body_fun(_val): it, val = _val val = body_fun(val) return it+1, val return jax.lax.while_loop(_cond_fun, _body_fun, (0, init_val))[1] def while_loop(cond_fun, body_fun, init_val, maxiter, unroll=False, jit=False): """A while loop with a bounded number of iterations.""" if unroll: if jit: fun = _while_loop_scan else: fun = _while_loop_python else: if jit: fun = _while_loop_lax else: raise ValueError("unroll=False and jit=False cannot be used together") if jit and fun is not _while_loop_lax: # jit of a lax while_loop is redundant, and this jit would only # constrain maxiter to be static where it is not required. fun = jax.jit(fun, static_argnums=(0, 1, 3)) return fun(cond_fun, body_fun, init_val, maxiter)
from __future__ import unicode_literals from django.apps import AppConfig class SensorConfig(AppConfig): name = 'sensor'
""" WSGI config for BRB project. It exposes the WSGI callable as a module-level variable named ``application``. For more information on this file, see https://docs.djangoproject.com/en/1.10/howto/deployment/wsgi/ """ import os from django.core.wsgi import get_wsgi_application os.environ.setdefault("DJANGO_SETTINGS_MODULE", "brb.settings") application = get_wsgi_application()
"""The data range file system implementation.""" from dfvfs.lib import definitions from dfvfs.lib import errors from dfvfs.path import data_range_path_spec from dfvfs.vfs import data_range_file_entry from dfvfs.vfs import root_only_file_system class DataRangeFileSystem(root_only_file_system.RootOnlyFileSystem): """Class that implements a compresses stream file system object.""" TYPE_INDICATOR = definitions.TYPE_INDICATOR_DATA_RANGE def __init__(self, resolver_context): """Initializes a file system object. Args: resolver_context: the resolver context (instance of resolver.Context). """ super(DataRangeFileSystem, self).__init__(resolver_context) self._range_offset = None self._range_size = None def _Close(self): """Closes the file system object. Raises: IOError: if the close failed. """ self._range_offset = None self._range_size = None def _Open(self, path_spec, mode='rb'): """Opens the file system object defined by path specification. Args: path_spec: a path specification (instance of PathSpec). mode: optional file access mode. The default is 'rb' read-only binary. Raises: AccessError: if the access to open the file was denied. IOError: if the file system object could not be opened. PathSpecError: if the path specification is incorrect. ValueError: if the path specification is invalid. """ if not path_spec.HasParent(): raise errors.PathSpecError( u'Unsupported path specification without parent.') range_offset = getattr(path_spec, u'range_offset', None) if range_offset is None: raise errors.PathSpecError( u'Unsupported path specification without encoding method.') range_size = getattr(path_spec, u'range_size', None) if range_size is None: raise errors.PathSpecError( u'Unsupported path specification without encoding method.') self._range_offset = range_offset self._range_size = range_size def GetFileEntryByPathSpec(self, path_spec): """Retrieves a file entry for a path specification. Args: path_spec: a path specification (instance of PathSpec). Returns: A file entry (instance of vfs.FileEntry) or None. """ return data_range_file_entry.DataRangeFileEntry( self._resolver_context, self, path_spec, is_root=True, is_virtual=True) def GetRootFileEntry(self): """Retrieves the root file entry. Returns: A file entry (instance of vfs.FileEntry) or None. """ path_spec = data_range_path_spec.DataRangePathSpec( range_offset=self._range_offset, range_size=self._range_size, parent=self._path_spec.parent) return self.GetFileEntryByPathSpec(path_spec)
""" PyCOMPSs Testbench ======================== """ import unittest from modules.testNoReturn import testNoReturn from modules.testNoReturnClasses import testNoReturnClasses def main(): suite = unittest.TestLoader().loadTestsFromTestCase(testNoReturn) suite.addTest(unittest.TestLoader().loadTestsFromTestCase(testNoReturnClasses)) unittest.TextTestRunner(verbosity=2).run(suite) if __name__ == "__main__": main()
import logging from six import moves from tempest_lib import exceptions as lib_exc from testtools import matchers from tempest.api.messaging import base from tempest.common.utils import data_utils from tempest import test LOG = logging.getLogger(__name__) class TestQueues(base.BaseMessagingTest): @test.attr(type='smoke') def test_create_delete_queue(self): # Create & Delete Queue queue_name = data_utils.rand_name('test-') _, body = self.create_queue(queue_name) self.addCleanup(self.client.delete_queue, queue_name) # NOTE(gmann): create_queue returns response status code as 201 # so specifically checking the expected empty response body as # this is not going to be checked in response_checker(). self.assertEqual('', body) self.delete_queue(queue_name) self.assertRaises(lib_exc.NotFound, self.client.get_queue, queue_name) class TestManageQueue(base.BaseMessagingTest): @classmethod def resource_setup(cls): super(TestManageQueue, cls).resource_setup() cls.queues = list() for _ in moves.xrange(5): queue_name = data_utils.rand_name('Queues-Test') cls.queues.append(queue_name) # Create Queue cls.client.create_queue(queue_name) @test.attr(type='smoke') def test_check_queue_existence(self): # Checking Queue Existence for queue_name in self.queues: self.check_queue_exists(queue_name) @test.attr(type='smoke') def test_check_queue_head(self): # Checking Queue Existence by calling HEAD for queue_name in self.queues: self.check_queue_exists_head(queue_name) @test.attr(type='smoke') def test_list_queues(self): # Listing queues _, body = self.list_queues() self.assertEqual(len(body['queues']), len(self.queues)) for item in body['queues']: self.assertIn(item['name'], self.queues) @test.attr(type='smoke') def test_get_queue_stats(self): # Retrieve random queue queue_name = self.queues[data_utils.rand_int_id(0, len(self.queues) - 1)] # Get Queue Stats for a newly created Queue _, body = self.get_queue_stats(queue_name) msgs = body['messages'] for element in ('free', 'claimed', 'total'): self.assertEqual(0, msgs[element]) for element in ('oldest', 'newest'): self.assertNotIn(element, msgs) @test.attr(type='smoke') def test_set_and_get_queue_metadata(self): # Retrieve random queue queue_name = self.queues[data_utils.rand_int_id(0, len(self.queues) - 1)] # Check the Queue has no metadata _, body = self.get_queue_metadata(queue_name) self.assertThat(body, matchers.HasLength(0)) # Create metadata key3 = [0, 1, 2, 3, 4] key2 = data_utils.rand_name('value') req_body1 = dict() req_body1[data_utils.rand_name('key3')] = key3 req_body1[data_utils.rand_name('key2')] = key2 req_body = dict() req_body[data_utils.rand_name('key1')] = req_body1 # Set Queue Metadata self.set_queue_metadata(queue_name, req_body) # Get Queue Metadata _, body = self.get_queue_metadata(queue_name) self.assertThat(body, matchers.Equals(req_body)) @classmethod def resource_cleanup(cls): for queue_name in cls.queues: cls.client.delete_queue(queue_name) super(TestManageQueue, cls).resource_cleanup()
import pytest, requests, json from kubernetes.client.rest import ApiException from suite.resources_utils import ( wait_before_test, replace_configmap_from_yaml, get_last_reload_time, get_test_file_name, write_to_json, ) from suite.custom_resources_utils import ( read_custom_resource, ) from suite.vs_vsr_resources_utils import ( delete_virtual_server, create_virtual_server_from_yaml, patch_virtual_server_from_yaml, ) from suite.policy_resources_utils import ( create_policy_from_yaml, delete_policy, read_policy, ) from settings import TEST_DATA, DEPLOYMENTS std_cm_src = f"{DEPLOYMENTS}/common/nginx-config.yaml" test_cm_src = f"{TEST_DATA}/access-control/configmap/nginx-config.yaml" std_vs_src = f"{TEST_DATA}/access-control/standard/virtual-server.yaml" deny_pol_src = f"{TEST_DATA}/access-control/policies/access-control-policy-deny.yaml" deny_vs_src = f"{TEST_DATA}/access-control/spec/virtual-server-deny.yaml" allow_pol_src = f"{TEST_DATA}/access-control/policies/access-control-policy-allow.yaml" allow_vs_src = f"{TEST_DATA}/access-control/spec/virtual-server-allow.yaml" override_vs_src = f"{TEST_DATA}/access-control/spec/virtual-server-override.yaml" invalid_pol_src = f"{TEST_DATA}/access-control/policies/access-control-policy-invalid.yaml" invalid_vs_src = f"{TEST_DATA}/access-control/spec/virtual-server-invalid.yaml" allow_vs_src_route = f"{TEST_DATA}/access-control/route-subroute/virtual-server-allow-route.yaml" deny_vs_src_route = f"{TEST_DATA}/access-control/route-subroute/virtual-server-deny-route.yaml" invalid_vs_src_route = ( f"{TEST_DATA}/access-control/route-subroute/virtual-server-invalid-route.yaml" ) override_vs_src_route = ( f"{TEST_DATA}/access-control/route-subroute/virtual-server-override-route.yaml" ) override_vs_spec_route_src = ( f"{TEST_DATA}/access-control/route-subroute/virtual-server-override-spec-route.yaml" ) reload_times = {} @pytest.fixture(scope="class") def config_setup(request, kube_apis, ingress_controller_prerequisites) -> None: """ Replace configmap to add "set-real-ip-from" :param request: pytest fixture :param kube_apis: client apis :param ingress_controller_prerequisites: IC pre-requisites """ print(f"------------- Replace ConfigMap --------------") replace_configmap_from_yaml( kube_apis.v1, ingress_controller_prerequisites.config_map["metadata"]["name"], ingress_controller_prerequisites.namespace, test_cm_src, ) def fin(): print(f"------------- Restore ConfigMap --------------") replace_configmap_from_yaml( kube_apis.v1, ingress_controller_prerequisites.config_map["metadata"]["name"], ingress_controller_prerequisites.namespace, std_cm_src, ) write_to_json( f"reload-{get_test_file_name(request.node.fspath)}.json", reload_times ) request.addfinalizer(fin) @pytest.mark.policies @pytest.mark.parametrize( "crd_ingress_controller, virtual_server_setup", [ ( { "type": "complete", "extra_args": [ f"-enable-custom-resources", f"-enable-leader-election=false", f"-enable-prometheus-metrics", ], }, { "example": "access-control", "app_type": "simple", }, ) ], indirect=True, ) class TestAccessControlPoliciesVs: def restore_default_vs(self, kube_apis, virtual_server_setup) -> None: """ Restore VirtualServer without policy spec """ delete_virtual_server( kube_apis.custom_objects, virtual_server_setup.vs_name, virtual_server_setup.namespace ) create_virtual_server_from_yaml( kube_apis.custom_objects, std_vs_src, virtual_server_setup.namespace ) wait_before_test() @pytest.mark.parametrize("src", [deny_vs_src, deny_vs_src_route]) @pytest.mark.smoke def test_deny_policy( self, request, kube_apis, crd_ingress_controller, virtual_server_setup, test_namespace, config_setup, src, ): """ Test if ip (10.0.0.1) block-listing is working: default(no policy) -> deny """ resp = requests.get( virtual_server_setup.backend_1_url, headers={"host": virtual_server_setup.vs_host, "X-Real-IP": "10.0.0.1"}, ) print(f"Response: {resp.status_code}\n{resp.text}") assert resp.status_code == 200 print(f"Create deny policy") pol_name = create_policy_from_yaml(kube_apis.custom_objects, deny_pol_src, test_namespace) print(f"Patch vs with policy: {src}") patch_virtual_server_from_yaml( kube_apis.custom_objects, virtual_server_setup.vs_name, src, virtual_server_setup.namespace, ) wait_before_test() policy_info = read_custom_resource( kube_apis.custom_objects, test_namespace, "policies", pol_name ) print(f"\nUse IP listed in deny block: 10.0.0.1") resp1 = requests.get( virtual_server_setup.backend_1_url, headers={"host": virtual_server_setup.vs_host, "X-Real-IP": "10.0.0.1"}, ) print(f"Response: {resp1.status_code}\n{resp1.text}") print(f"\nUse IP not listed in deny block: 10.0.0.2") resp2 = requests.get( virtual_server_setup.backend_1_url, headers={"host": virtual_server_setup.vs_host, "X-Real-IP": "10.0.0.2"}, ) print(f"Response: {resp2.status_code}\n{resp2.text}") reload_ms = get_last_reload_time(virtual_server_setup.metrics_url, "nginx") print(f"last reload duration: {reload_ms} ms") reload_times[f"{request.node.name}"] = f"last reload duration: {reload_ms} ms" delete_policy(kube_apis.custom_objects, pol_name, test_namespace) self.restore_default_vs(kube_apis, virtual_server_setup) assert ( policy_info["status"] and policy_info["status"]["reason"] == "AddedOrUpdated" and policy_info["status"]["state"] == "Valid" ) assert ( resp1.status_code == 403 and "403 Forbidden" in resp1.text and resp2.status_code == 200 and "Server address:" in resp2.text ) @pytest.mark.parametrize("src", [allow_vs_src, allow_vs_src_route]) @pytest.mark.smoke def test_allow_policy( self, kube_apis, crd_ingress_controller, virtual_server_setup, test_namespace, config_setup, src, ): """ Test if ip (10.0.0.1) allow-listing is working: default(no policy) -> allow """ resp = requests.get( virtual_server_setup.backend_1_url, headers={"host": virtual_server_setup.vs_host, "X-Real-IP": "10.0.0.1"}, ) print(f"Response: {resp.status_code}\n{resp.text}") assert resp.status_code == 200 print(f"Create allow policy") pol_name = create_policy_from_yaml(kube_apis.custom_objects, allow_pol_src, test_namespace) patch_virtual_server_from_yaml( kube_apis.custom_objects, virtual_server_setup.vs_name, src, virtual_server_setup.namespace, ) wait_before_test() policy_info = read_custom_resource( kube_apis.custom_objects, test_namespace, "policies", pol_name ) print(f"\nUse IP listed in allow block: 10.0.0.1") resp1 = requests.get( virtual_server_setup.backend_1_url, headers={"host": virtual_server_setup.vs_host, "X-Real-IP": "10.0.0.1"}, ) print(f"\nUse IP listed not in allow block: 10.0.0.2") print(f"Response: {resp1.status_code}\n{resp1.text}") resp2 = requests.get( virtual_server_setup.backend_1_url, headers={"host": virtual_server_setup.vs_host, "X-Real-IP": "10.0.0.2"}, ) print(f"Response: {resp2.status_code}\n{resp2.text}") delete_policy(kube_apis.custom_objects, pol_name, test_namespace) self.restore_default_vs(kube_apis, virtual_server_setup) assert ( policy_info["status"] and policy_info["status"]["reason"] == "AddedOrUpdated" and policy_info["status"]["state"] == "Valid" ) assert ( resp1.status_code == 200 and "Server address:" in resp1.text and resp2.status_code == 403 and "403 Forbidden" in resp2.text ) @pytest.mark.parametrize("src", [override_vs_src, override_vs_src_route]) def test_override_policy( self, kube_apis, crd_ingress_controller, virtual_server_setup, test_namespace, config_setup, src, ): """ Test if ip allow-listing overrides block-listing: default(no policy) -> deny and allow """ resp = requests.get( virtual_server_setup.backend_1_url, headers={"host": virtual_server_setup.vs_host, "X-Real-IP": "10.0.0.1"}, ) print(f"Response: {resp.status_code}\n{resp.text}") assert resp.status_code == 200 print(f"Create deny policy") deny_pol_name = create_policy_from_yaml( kube_apis.custom_objects, deny_pol_src, test_namespace ) print(f"Create allow policy") allow_pol_name = create_policy_from_yaml( kube_apis.custom_objects, allow_pol_src, test_namespace ) patch_virtual_server_from_yaml( kube_apis.custom_objects, virtual_server_setup.vs_name, src, virtual_server_setup.namespace, ) wait_before_test() print(f"Use IP listed in both deny and allow policies: 10.0.0.1") resp = requests.get( virtual_server_setup.backend_1_url, headers={"host": virtual_server_setup.vs_host, "X-Real-IP": "10.0.0.1"}, ) print(f"Response: {resp.status_code}\n{resp.text}") delete_policy(kube_apis.custom_objects, deny_pol_name, test_namespace) delete_policy(kube_apis.custom_objects, allow_pol_name, test_namespace) self.restore_default_vs(kube_apis, virtual_server_setup) assert resp.status_code == 200 and "Server address:" in resp.text @pytest.mark.parametrize("src", [invalid_vs_src, invalid_vs_src_route]) def test_invalid_policy( self, kube_apis, crd_ingress_controller, virtual_server_setup, test_namespace, config_setup, src, ): """ Test if invalid policy is applied then response is 500 """ resp = requests.get( virtual_server_setup.backend_1_url, headers={"host": virtual_server_setup.vs_host, "X-Real-IP": "10.0.0.1"}, ) print(f"Response: {resp.status_code}\n{resp.text}") assert resp.status_code == 200 print(f"Create invalid policy") invalid_pol_name = create_policy_from_yaml( kube_apis.custom_objects, invalid_pol_src, test_namespace ) patch_virtual_server_from_yaml( kube_apis.custom_objects, virtual_server_setup.vs_name, src, virtual_server_setup.namespace, ) wait_before_test() resp = requests.get( virtual_server_setup.backend_1_url, headers={"host": virtual_server_setup.vs_host, "X-Real-IP": "10.0.0.1"}, ) print(f"Response: {resp.status_code}\n{resp.text}") vs_info = read_custom_resource( kube_apis.custom_objects, virtual_server_setup.namespace, "virtualservers", virtual_server_setup.vs_name, ) policy_info = read_custom_resource( kube_apis.custom_objects, test_namespace, "policies", invalid_pol_name ) delete_policy(kube_apis.custom_objects, invalid_pol_name, test_namespace) self.restore_default_vs(kube_apis, virtual_server_setup) assert resp.status_code == 500 and "500 Internal Server Error" in resp.text assert ( policy_info["status"] and policy_info["status"]["reason"] == "Rejected" and policy_info["status"]["state"] == "Invalid" ) assert ( vs_info["status"]["state"] == "Warning" and vs_info["status"]["reason"] == "AddedOrUpdatedWithWarning" ) @pytest.mark.parametrize("src", [deny_vs_src, deny_vs_src_route]) def test_deleted_policy( self, kube_apis, crd_ingress_controller, virtual_server_setup, test_namespace, config_setup, src, ): """ Test if valid policy is deleted then response is 500 """ resp = requests.get( virtual_server_setup.backend_1_url, headers={"host": virtual_server_setup.vs_host, "X-Real-IP": "10.0.0.1"}, ) print(f"Response: {resp.status_code}\n{resp.text}") assert resp.status_code == 200 print(f"Create deny policy") pol_name = create_policy_from_yaml(kube_apis.custom_objects, deny_pol_src, test_namespace) patch_virtual_server_from_yaml( kube_apis.custom_objects, virtual_server_setup.vs_name, src, virtual_server_setup.namespace, ) wait_before_test() vs_info = read_custom_resource( kube_apis.custom_objects, virtual_server_setup.namespace, "virtualservers", virtual_server_setup.vs_name, ) assert vs_info["status"]["state"] == "Valid" delete_policy(kube_apis.custom_objects, pol_name, test_namespace) wait_before_test() resp = requests.get( virtual_server_setup.backend_1_url, headers={"host": virtual_server_setup.vs_host, "X-Real-IP": "10.0.0.1"}, ) print(f"Response: {resp.status_code}\n{resp.text}") vs_info = read_custom_resource( kube_apis.custom_objects, virtual_server_setup.namespace, "virtualservers", virtual_server_setup.vs_name, ) self.restore_default_vs(kube_apis, virtual_server_setup) assert resp.status_code == 500 and "500 Internal Server Error" in resp.text assert ( vs_info["status"]["state"] == "Warning" and vs_info["status"]["reason"] == "AddedOrUpdatedWithWarning" ) def test_route_override_spec( self, kube_apis, crd_ingress_controller, virtual_server_setup, test_namespace, config_setup, ): """ Test allow policy specified under routes overrides block in spec """ resp = requests.get( virtual_server_setup.backend_1_url, headers={"host": virtual_server_setup.vs_host, "X-Real-IP": "10.0.0.1"}, ) print(f"Response: {resp.status_code}\n{resp.text}") assert resp.status_code == 200 print(f"Create deny policy") deny_pol_name = create_policy_from_yaml( kube_apis.custom_objects, deny_pol_src, test_namespace ) print(f"Create allow policy") allow_pol_name = create_policy_from_yaml( kube_apis.custom_objects, allow_pol_src, test_namespace ) patch_virtual_server_from_yaml( kube_apis.custom_objects, virtual_server_setup.vs_name, override_vs_spec_route_src, virtual_server_setup.namespace, ) wait_before_test() print(f"Use IP listed in both deny and allow policies: 10.0.0.1") resp = requests.get( virtual_server_setup.backend_1_url, headers={"host": virtual_server_setup.vs_host, "X-Real-IP": "10.0.0.1"}, ) print(f"Response: {resp.status_code}\n{resp.text}") self.restore_default_vs(kube_apis, virtual_server_setup) delete_policy(kube_apis.custom_objects, deny_pol_name, test_namespace) delete_policy(kube_apis.custom_objects, allow_pol_name, test_namespace) assert resp.status_code == 200 and "Server address:" in resp.text
from __future__ import unicode_literals from __future__ import absolute_import """ pypuppetdb PuppetDB API library ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ pypuppetdb is a library to work with PuppetDB's REST API. It provides a way to query PuppetDB and a set of additional methods and objects to make working with PuppetDB's API and the responses easier: >>> from pypuppetdb import connect >>> db = connect() >>> nodes = db.nodes() >>> print(nodes) <generator object 'nodes'> >>> for node in nodes: >>> print(node) host1 host2 ... This will return a generator object yielding Node objects for every returned node from PuppetDB. To query a single node the singular db.node() can be used: >>> node = db.node('hostname') >>> print(node) hostname The Node objects are a bit more special in that they can query for facts and resources themselves. Using those methods from a node object will automatically add a query to the request scoping the request to the node. >>> node = db.node('hostname') >>> print node.fact('osfamily') osfamily/hostname We can also query for facts: >>> facts = db.facts('osfamily') >>> print(facts) <generator object 'facts') >>> for fact in facts: >>> print(fact) osfamily/host1 osfamily/host2 That querries PuppetDB for the 'osfamily' fact and will yield Fact objects, one per node this fact is found on. >>> resources = db.resources('file') Will return a generator object containing all file resources you're managing across your infrastructure. This is probably a bad idea if you have a big number of nodes as the response will be huge. """ import logging from pypuppetdb.api import v2 from pypuppetdb.api import v3 from pypuppetdb.api import v4 from pypuppetdb.errors import UnsupportedVersionError try: # Python 2.7+ from logging import NullHandler except ImportError: # pragma: notest class NullHandler(logging.Handler): def emit(self, record): pass logging.getLogger(__name__).addHandler(NullHandler()) def connect(api_version=3, host='localhost', port=8080, ssl_verify=False, ssl_key=None, ssl_cert=None, timeout=10, protocol=None, url_path='/', username=None, password=None): """Connect with PuppetDB. This will return an object allowing you to query the API through its methods. :param api_version: Version of the API we're initialising. :type api_version: :obj:`int` :param host: (optional) Hostname or IP of PuppetDB. :type host: :obj:`string` :param port: (optional) Port on which to talk to PuppetDB. :type port: :obj:`int` :param ssl_verify: (optional) Verify PuppetDB server certificate. :type ssl_verify: :obj:`bool` or :obj:`string` True, False or filesystem \ path to CA certificate. :param ssl_key: (optional) Path to our client secret key. :type ssl_key: :obj:`None` or :obj:`string` representing a filesystem\ path. :param ssl_cert: (optional) Path to our client certificate. :type ssl_cert: :obj:`None` or :obj:`string` representing a filesystem\ path. :param timeout: (optional) Number of seconds to wait for a response. :type timeout: :obj:`int` :param protocol: (optional) Explicitly specify the protocol to be used (especially handy when using HTTPS with ssl_verify=False and without certs) :type protocol: :obj:`None` or :obj:`string` :param url_path: (optional) The URL path where PuppetDB is served (if not at the root / path) :type url_path: :obj:`None` or :obj:`string` :param username: (optional) The username to use for HTTP basic authentication :type username: :obj:`None` or :obj:`string` :param password: (optional) The password to use for HTTP basic authentication :type password: :obj:`None` or :obj:`string` :raises: :class:`~pypuppetdb.errors.UnsupportedVersionError` """ if api_version == 4: return v4.API(host=host, port=port, timeout=timeout, ssl_verify=ssl_verify, ssl_key=ssl_key, ssl_cert=ssl_cert, protocol=protocol, url_path=url_path, username=username, password=password) if api_version == 3: return v3.API(host=host, port=port, timeout=timeout, ssl_verify=ssl_verify, ssl_key=ssl_key, ssl_cert=ssl_cert, protocol=protocol, url_path=url_path, username=username, password=password) if api_version == 2: return v2.API(host=host, port=port, timeout=timeout, ssl_verify=ssl_verify, ssl_key=ssl_key, ssl_cert=ssl_cert, protocol=protocol, url_path=url_path, username=username, password=password) else: raise UnsupportedVersionError
from neutron.api import extensions from neutron.api.v2 import attributes as attr from neutron.api.v2 import resource_helper from oslo_log import log as logging LOG = logging.getLogger(__name__) def _validate_list_of_port_dicts(values, data): if not isinstance(values, list): msg = _("'%s' is not a list") % data return msg for item in values: msg = _validate_port_dict(item) if msg: return msg items = [tuple(entry.items()) for entry in values] if len(items) != len(set(items)): msg = _("Duplicate items in the list: '%s'") % values return msg def _validate_port_dict(values): if not isinstance(values, dict): msg = _("%s is not a valid dictionary") % values LOG.debug(msg) return msg port_id = values.get('port_id') fixed_ip = values.get('fixed_ip_address') msg = attr._validate_uuid(port_id) if msg: return msg if fixed_ip is None: return msg = attr._validate_ip_address(fixed_ip) if msg: return msg attr.validators['type:validate_list_of_port_dicts'] = ( _validate_list_of_port_dicts ) RESOURCE_NAME = "scalingip" RESOURCE_COLLECTION = RESOURCE_NAME + "s" RESOURCE_ATTRIBUTE_MAP = { RESOURCE_COLLECTION: { 'id': { 'allow_post': False, 'allow_put': False, 'validate': {'type:uuid': None}, 'is_visible': True, 'primary_key': True }, "scaling_ip_address": { 'allow_post': True, 'allow_put': False, 'validate': {'type:ip_address_or_none': None}, 'is_visible': True, 'default': None, 'enforce_policy': True }, "tenant_id": { 'allow_post': True, 'allow_put': False, 'required_by_policy': True, 'validate': {'type:string': attr.TENANT_ID_MAX_LEN}, 'is_visible': True }, "scaling_network_id": { 'allow_post': True, 'allow_put': False, 'validate': {'type:uuid': None}, 'is_visible': True }, "ports": { 'allow_post': True, 'allow_put': True, 'validate': { 'type:validate_list_of_port_dicts': None }, 'is_visible': True, 'required_by_policy': True } } } class Scalingip(extensions.ExtensionDescriptor): @classmethod def get_name(cls): return RESOURCE_NAME @classmethod def get_alias(cls): return RESOURCE_NAME @classmethod def get_description(cls): return "Scaling IPs" @classmethod def get_namespace(cls): return ("http://docs.openstack.org/network/ext/" "networks_quark/api/v2.0") @classmethod def get_updated(cls): return "2016-01-20T19:00:00-00:00" @classmethod def get_resources(cls): """Returns Ext Resources.""" plural_mappings = resource_helper.build_plural_mappings( {}, RESOURCE_ATTRIBUTE_MAP) attr.PLURALS.update(plural_mappings) return resource_helper.build_resource_info(plural_mappings, RESOURCE_ATTRIBUTE_MAP, None, register_quota=True) def get_extended_resources(self, version): if version == "2.0": return RESOURCE_ATTRIBUTE_MAP else: return {}
""" Licensed to the Apache Software Foundation (ASF) under one or more contributor license agreements. See the NOTICE file distributed with this work for additional information regarding copyright ownership. The ASF licenses this file to you under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. """ import logging import re import time from collections import namedtuple logger = logging.getLogger() AlertUri = namedtuple('AlertUri', 'uri is_ssl_enabled') class BaseAlert(object): # will force a kinit even if klist says there are valid tickets (4 hour default) _DEFAULT_KINIT_TIMEOUT = 14400000 RESULT_OK = "OK" RESULT_WARNING = "WARNING" RESULT_CRITICAL = "CRITICAL" RESULT_UNKNOWN = "UNKNOWN" RESULT_SKIPPED = "SKIPPED" HA_NAMESERVICE_PARAM = "{{ha-nameservice}}" HA_ALIAS_PARAM = "{{alias}}" def __init__(self, alert_meta, alert_source_meta, config): self.alert_meta = alert_meta self.alert_source_meta = alert_source_meta self.cluster_name = '' self.host_name = '' self.public_host_name = '' self.config = config def interval(self): """ gets the defined interval this check should run """ if not self.alert_meta.has_key('interval'): return 1 else: interval = self.alert_meta['interval'] return 1 if interval < 1 else interval def is_enabled(self): """ gets whether the definition is enabled """ return self.alert_meta['enabled'] def get_name(self): """ gets the unique name of the alert definition """ return self.alert_meta['name'] def get_uuid(self): """ gets the unique has of the alert definition """ return self.alert_meta['uuid'] def set_helpers(self, collector, cluster_configuration): """ sets helper objects for alerts without having to use them in a constructor """ self.collector = collector self.cluster_configuration = cluster_configuration def set_cluster(self, cluster_name, host_name, public_host_name = None): """ sets cluster information for the alert """ self.cluster_name = cluster_name self.host_name = host_name self.public_host_name = host_name if public_host_name: self.public_host_name = public_host_name def _get_alert_meta_value_safely(self, meta_key): """ safe way to get a value when outputting result json. will not throw an exception """ if self.alert_meta.has_key(meta_key): return self.alert_meta[meta_key] else: return None def collect(self): """ method used for collection. defers to _collect() """ res = (BaseAlert.RESULT_UNKNOWN, []) res_base_text = None try: res = self._collect() result_state = res[0] reporting_state = result_state.lower() # it's possible that the alert definition doesn't have reporting; safely # check for it and fallback to default text if it doesn't exist if ('reporting' in self.alert_source_meta) and \ (reporting_state in self.alert_source_meta['reporting']) and \ ('text' in self.alert_source_meta['reporting'][reporting_state]): res_base_text = self.alert_source_meta['reporting'][reporting_state]['text'] if res_base_text is None: res_base_text = self._get_reporting_text(result_state) except Exception as exception: message = "[Alert][{0}] Unable to execute alert. {1}".format( self.get_name(), str(exception)) # print the exception if in DEBUG, otherwise just log the warning if logger.isEnabledFor(logging.DEBUG): logger.exception(message) else: logger.warning(message) res = (BaseAlert.RESULT_UNKNOWN, [str(exception)]) res_base_text = "{0}" if logger.isEnabledFor(logging.DEBUG): logger.debug("[Alert][{0}] result = {1}".format(self.get_name(), str(res))) data = {} data['name'] = self._get_alert_meta_value_safely('name') data['label'] = self._get_alert_meta_value_safely('label') data['uuid'] = self._get_alert_meta_value_safely('uuid') data['cluster'] = self.cluster_name data['service'] = self._get_alert_meta_value_safely('serviceName') data['component'] = self._get_alert_meta_value_safely('componentName') data['timestamp'] = long(time.time() * 1000) data['enabled'] = self._get_alert_meta_value_safely('enabled') try: data['state'] = res[0] # * is the splat operator, which flattens a collection into positional arguments # flatten the array and then try formatting it try: data['text'] = res_base_text.format(*res[1]) except ValueError, value_error: logger.warn("[Alert][{0}] - {1}".format(self.get_name(), str(value_error))) # if there is a ValueError, it's probably because the text doesn't match the type of # positional arguemtns (ie {0:d} with a float) res_base_text = res_base_text.replace("d}", "s}") data_as_strings = map(str, res[1]) data['text'] = res_base_text.format(*data_as_strings) if logger.isEnabledFor(logging.DEBUG): logger.debug("[Alert][{0}] text = {1}".format(self.get_name(), data['text'])) except Exception, exception: logger.exception("[Alert][{0}] - The alert's data is not properly formatted".format(self.get_name())) # if there's a problem with getting the data returned from collect() then mark this # alert as UNKNOWN data['state'] = self.RESULT_UNKNOWN data['text'] = "There is a problem with the alert definition: {0}".format(str(exception)) finally: # put the alert into the collector so it can be collected on the next run self.collector.put(self.cluster_name, data) def _get_configuration_value(self, key): """ Gets the value of the specified configuration key from the cache. The key should be of the form {{foo-bar/baz}}. If the key given is not a lookup key and is instead a constant, such as "foo" or "5", then the constant is returned. If the key contains more than 1 parameter to lookup, then each match is looked up and replaced. If the value does not exist in the configs, then return None to indicate that this key could not be found. This should turn {{hdfs-site/value}}/whatever/{{hdfs-site/value2}} into value/whatever/value2 :return: the resolved value or None if any of the placeholder parameters does not exist in the configs """ if key is None: return None # parse {{foo-bar/baz}}/whatever/{{foobar-site/blah}} # into # ['foo-bar/baz', 'foobar-site/blah'] placeholder_keys = re.findall("{{(\S+?)}}", key) # if none found, then return the original if placeholder_keys is None or len(placeholder_keys) == 0: return key # for every match, get its configuration value and replace it in the key resolved_key = key for placeholder_key in placeholder_keys: value = self.cluster_configuration.get_configuration_value( self.cluster_name, placeholder_key) # if any of the placeholder keys is missing from the configuration, then # return None as per the contract of this function if value is None: return None # it's possible that a dictionary was request (ie {{hdfs-site}} instead # of {{hdfs-site/foo}} - in which case, we should just return the # dictionary as is if isinstance(value, dict): return value # {{foo-bar/baz}}/whatever -> http://server/whatever resolved_key = resolved_key.replace("{{%s}}" % placeholder_key, value) return resolved_key def _lookup_uri_property_keys(self, uri_structure): """ Loads the configuration lookup keys that the URI structure needs. This will return a named tuple that contains the keys needed to lookup parameterized URI values from the cached configuration. The URI structure looks something like: "uri":{ "http": foo, "https": bar, ... } """ if uri_structure is None: return None http_key = None https_key = None https_property_key = None https_property_value_key = None default_port = None kerberos_keytab = None kerberos_principal = None ha_nameservice = None ha_alias_key = None ha_http_pattern = None ha_https_pattern = None if 'http' in uri_structure: http_key = uri_structure['http'] if 'https' in uri_structure: https_key = uri_structure['https'] if 'https_property' in uri_structure: https_property_key = uri_structure['https_property'] if 'https_property_value' in uri_structure: https_property_value_key = uri_structure['https_property_value'] if 'default_port' in uri_structure: default_port = uri_structure['default_port'] if 'kerberos_keytab' in uri_structure: kerberos_keytab = uri_structure['kerberos_keytab'] if 'kerberos_principal' in uri_structure: kerberos_principal = uri_structure['kerberos_principal'] if 'high_availability' in uri_structure: ha = uri_structure['high_availability'] if 'nameservice' in ha: ha_nameservice = ha['nameservice'] if 'alias_key' in ha: ha_alias_key = ha['alias_key'] if 'http_pattern' in ha: ha_http_pattern = ha['http_pattern'] if 'https_pattern' in ha: ha_https_pattern = ha['https_pattern'] AlertUriLookupKeys = namedtuple('AlertUriLookupKeys', 'http https https_property https_property_value default_port ' 'kerberos_keytab kerberos_principal ' 'ha_nameservice ha_alias_key ha_http_pattern ha_https_pattern') alert_uri_lookup_keys = AlertUriLookupKeys(http=http_key, https=https_key, https_property=https_property_key, https_property_value=https_property_value_key, default_port=default_port, kerberos_keytab=kerberos_keytab, kerberos_principal=kerberos_principal, ha_nameservice=ha_nameservice, ha_alias_key=ha_alias_key, ha_http_pattern=ha_http_pattern, ha_https_pattern=ha_https_pattern ) return alert_uri_lookup_keys def _get_uri_from_structure(self, alert_uri_lookup_keys): """ Gets the URI to use by examining the URI structure from the definition. This will return a named tuple that has the uri and the SSL flag. The URI structure looks something like: "uri":{ "http": foo, "https": bar, ... } """ if alert_uri_lookup_keys is None: return None http_uri = None https_uri = None # first thing is first; if there are HA keys then try to dynamically build # the property which is used to get the actual value of the uri # (ie dfs.namenode.http-address.c1ha.nn2) if alert_uri_lookup_keys.ha_nameservice is not None or alert_uri_lookup_keys.ha_alias_key is not None: alert_uri = self._get_uri_from_ha_structure(alert_uri_lookup_keys) if alert_uri is not None: return alert_uri # attempt to parse and parameterize the various URIs; properties that # do not exist int he lookup map are returned as None if alert_uri_lookup_keys.http is not None: http_uri = self._get_configuration_value(alert_uri_lookup_keys.http) if alert_uri_lookup_keys.https is not None: https_uri = self._get_configuration_value(alert_uri_lookup_keys.https) # without a URI, there's no way to create the structure we need - return # the default port if specified, otherwise throw an exception if http_uri is None and https_uri is None: if alert_uri_lookup_keys.default_port is not None: alert_uri = AlertUri(uri=alert_uri_lookup_keys.default_port, is_ssl_enabled=False) return alert_uri else: raise Exception("Could not determine result. Either the http or https URI must be specified.") # start out assuming plaintext uri = http_uri is_ssl_enabled = False if https_uri is not None: # https without http implies SSL, otherwise look it up based on the properties if http_uri is None: is_ssl_enabled = True uri = https_uri elif self._check_uri_ssl_property(alert_uri_lookup_keys): is_ssl_enabled = True uri = https_uri alert_uri = AlertUri(uri=uri, is_ssl_enabled=is_ssl_enabled) return alert_uri def _get_uri_from_ha_structure(self, alert_uri_lookup_keys): """ Attempts to parse the HA URI structure in order to build a dynamic key that represents the correct host URI to check. :param alert_uri_lookup_keys: :return: the AlertUri named tuple if there is a valid HA URL, otherwise None """ if alert_uri_lookup_keys is None: return None logger.debug("[Alert][{0}] HA URI structure detected in definition, attempting to lookup dynamic HA properties".format(self.get_name())) ha_nameservice = self._get_configuration_value(alert_uri_lookup_keys.ha_nameservice) ha_alias_key = alert_uri_lookup_keys.ha_alias_key ha_http_pattern = alert_uri_lookup_keys.ha_http_pattern ha_https_pattern = alert_uri_lookup_keys.ha_https_pattern # if HA alias key is not defined then it's not HA environment if ha_alias_key is None: return None if alert_uri_lookup_keys.ha_nameservice is not None: # if there is a HA nameservice defined, but it can not be evaluated then it's not HA environment if ha_nameservice is None: return None # convert dfs.ha.namenodes.{{ha-nameservice}} into dfs.ha.namenodes.c1ha ha_alias_key = ha_alias_key.replace(self.HA_NAMESERVICE_PARAM, ha_nameservice) ha_nameservice_alias = self._get_configuration_value(ha_alias_key) if ha_nameservice_alias is None: logger.warning("[Alert][{0}] HA nameservice value is present but there are no aliases for {1}".format( self.get_name(), ha_alias_key)) return None else: ha_nameservice_alias = self._get_configuration_value(ha_alias_key) # if HA nameservice is not defined then the fact that the HA alias_key could not be evaluated shows that it's not HA environment if ha_nameservice_alias is None: return None # determine which pattern to use (http or https) ha_pattern = ha_http_pattern is_ssl_enabled = self._check_uri_ssl_property(alert_uri_lookup_keys) if is_ssl_enabled: ha_pattern = ha_https_pattern # no pattern found if ha_pattern is None: logger.warning("[Alert][{0}] There is no matching http(s) pattern for the HA URI".format( self.get_name())) return None if self.HA_NAMESERVICE_PARAM in ha_pattern and ha_nameservice is None: logger.warning("[Alert][{0}] An HA URI pattern of {1} was detected, but there is no nameservice key".format( self.get_name(), ha_pattern)) return None # convert dfs.namenode.http-address.{{ha-nameservice}}.{{alias}} into # dfs.namenode.http-address.c1ha.{{alias}} if ha_nameservice is not None: ha_pattern = ha_pattern.replace(self.HA_NAMESERVICE_PARAM, ha_nameservice) # for each alias, grab it and check to see if this host matches for alias in ha_nameservice_alias.split(','): # convert dfs.namenode.http-address.c1ha.{{alias}} into # dfs.namenode.http-address.c1ha.nn1 key = ha_pattern.replace(self.HA_ALIAS_PARAM, alias.strip()) # get the host for dfs.namenode.http-address.c1ha.nn1 and see if it's # this host value = self._get_configuration_value(key) if value is not None and (self.host_name in value or self.public_host_name in value): return AlertUri(uri=value, is_ssl_enabled=is_ssl_enabled) return None def _check_uri_ssl_property(self, alert_uri_lookup_keys): """ Gets whether the SSL property and value on the URI indicate an SSL connection. :param alert_uri_lookup_keys: :return: True if the SSL check property and value are defined and match otherwise False """ https_property = None https_property_value = None if alert_uri_lookup_keys.https_property is not None: https_property = self._get_configuration_value(alert_uri_lookup_keys.https_property) if alert_uri_lookup_keys.https_property_value is not None: https_property_value = self._get_configuration_value(alert_uri_lookup_keys.https_property_value) if https_property is None: return False return https_property == https_property_value def _collect(self): """ Low level function to collect alert data. The result is a tuple as: res[0] = the result code res[1] = the list of arguments supplied to the reporting text for the result code """ #TODO: After implementation uncomment /src/test/python/ambari_agent/TestMetricAlert.py:194 # and /src/test/python/ambari_agent/TestScriptAlert.py:52 raise NotImplementedError def _get_reporting_text(self, state): ''' Gets the default reporting text to use when the alert definition does not contain any. Subclasses can override this to return specific text. :param state: the state of the alert in uppercase (such as OK, WARNING, etc) :return: the parameterized text ''' return '{0}' """ See RFC3986, Appendix B Tested on the following cases: "192.168.54.1" "192.168.54.2:7661 "hdfs://192.168.54.3/foo/bar" "ftp://192.168.54.4:7842/foo/bar" Returns None if only a port is passed in """ @staticmethod def get_host_from_url(uri): if uri is None: return None # if not a string, return None if not isinstance(uri, basestring): return None # RFC3986, Appendix B parts = re.findall('^(([^:/?#]+):)?(//([^/?#]*))?([^?#]*)(\?([^#]*))?(#(.*))?', uri) # index of parts # scheme = 1 # authority = 3 # path = 4 # query = 6 # fragment = 8 host_and_port = uri if 0 == len(parts[0][1]): host_and_port = parts[0][4] elif 0 == len(parts[0][2]): host_and_port = parts[0][1] elif parts[0][2].startswith("//"): host_and_port = parts[0][3] if -1 == host_and_port.find(':'): if host_and_port.isdigit(): return None return host_and_port else: return host_and_port.split(':')[0]
import errno import os import re import subprocess import sys git_refnames = "$Format:%d$" git_full = "$Format:%H$" tag_prefix = "" parentdir_prefix = "myproject-" versionfile_source = "cameo/_version.py" def run_command(commands, args, cwd=None, verbose=False, hide_stderr=False): assert isinstance(commands, list) p = None for c in commands: try: # remember shell=False, so use git.cmd on windows, not just git p = subprocess.Popen([c] + args, cwd=cwd, stdout=subprocess.PIPE, stderr=(subprocess.PIPE if hide_stderr else None)) break except EnvironmentError: e = sys.exc_info()[1] if e.errno == errno.ENOENT: continue if verbose: print("unable to run %s" % args[0]) print(e) return None else: if verbose: print("unable to find command, tried %s" % (commands,)) return None stdout = p.communicate()[0].strip() if sys.version_info[0] >= 3: stdout = stdout.decode() if p.returncode != 0: if verbose: print("unable to run %s (error)" % args[0]) return None return stdout def versions_from_parentdir(parentdir_prefix, root, verbose=False): # Source tarballs conventionally unpack into a directory that includes # both the project name and a version string. dirname = os.path.basename(root) if not dirname.startswith(parentdir_prefix): if verbose: print("guessing rootdir is '%s', but '%s' doesn't start with " "prefix '%s'" % (root, dirname, parentdir_prefix)) return None return {"version": dirname[len(parentdir_prefix):], "full": ""} def git_get_keywords(versionfile_abs): # the code embedded in _version.py can just fetch the value of these # keywords. When used from setup.py, we don't want to import _version.py, # so we do it with a regexp instead. This function is not used from # _version.py. keywords = {} try: f = open(versionfile_abs, "r") for line in f.readlines(): if line.strip().startswith("git_refnames ="): mo = re.search(r'=\s*"(.*)"', line) if mo: keywords["refnames"] = mo.group(1) if line.strip().startswith("git_full ="): mo = re.search(r'=\s*"(.*)"', line) if mo: keywords["full"] = mo.group(1) f.close() except EnvironmentError: pass return keywords def git_versions_from_keywords(keywords, tag_prefix, verbose=False): if not keywords: return {} # keyword-finding function failed to find keywords refnames = keywords["refnames"].strip() if refnames.startswith("$Format"): if verbose: print("keywords are unexpanded, not using") return {} # unexpanded, so not in an unpacked git-archive tarball refs = set([r.strip() for r in refnames.strip("()").split(",")]) # starting in git-1.8.3, tags are listed as "tag: foo-1.0" instead of # just "foo-1.0". If we see a "tag: " prefix, prefer those. TAG = "tag: " tags = set([r[len(TAG):] for r in refs if r.startswith(TAG)]) if not tags: # Either we're using git < 1.8.3, or there really are no tags. We use # a heuristic: assume all version tags have a digit. The old git %d # expansion behaves like git log --decorate=short and strips out the # refs/heads/ and refs/tags/ prefixes that would let us distinguish # between branches and tags. By ignoring refnames without digits, we # filter out many common branch names like "release" and # "stabilization", as well as "HEAD" and "master". tags = set([r for r in refs if re.search(r'\d', r)]) if verbose: print("discarding '%s', no digits" % ",".join(refs-tags)) if verbose: print("likely tags: %s" % ",".join(sorted(tags))) for ref in sorted(tags): # sorting will prefer e.g. "2.0" over "2.0rc1" if ref.startswith(tag_prefix): r = ref[len(tag_prefix):] if verbose: print("picking %s" % r) return {"version": r, "full": keywords["full"].strip()} # no suitable tags, so version is "0+unknown", but full hex is still there if verbose: print("no suitable tags, using unknown + full revision id") return {"version": "0+unknown", "full": keywords["full"].strip()} def git_parse_vcs_describe(git_describe, tag_prefix, verbose=False): # TAG-NUM-gHEX[-dirty] or HEX[-dirty] . TAG might have hyphens. # dirty dirty = git_describe.endswith("-dirty") if dirty: git_describe = git_describe[:git_describe.rindex("-dirty")] dirty_suffix = ".dirty" if dirty else "" # now we have TAG-NUM-gHEX or HEX if "-" not in git_describe: # just HEX return "0+untagged.g"+git_describe+dirty_suffix, dirty # just TAG-NUM-gHEX mo = re.search(r'^(.+)-(\d+)-g([0-9a-f]+)$', git_describe) if not mo: # unparseable. Maybe git-describe is misbehaving? return "0+unparseable"+dirty_suffix, dirty # tag full_tag = mo.group(1) if not full_tag.startswith(tag_prefix): if verbose: fmt = "tag '%s' doesn't start with prefix '%s'" print(fmt % (full_tag, tag_prefix)) return None, dirty tag = full_tag[len(tag_prefix):] # distance: number of commits since tag distance = int(mo.group(2)) # commit: short hex revision ID commit = mo.group(3) # now build up version string, with post-release "local version # identifier". Our goal: TAG[+NUM.gHEX[.dirty]] . Note that if you get a # tagged build and then dirty it, you'll get TAG+0.gHEX.dirty . So you # can always test version.endswith(".dirty"). version = tag if distance or dirty: version += "+%d.g%s" % (distance, commit) + dirty_suffix return version, dirty def git_versions_from_vcs(tag_prefix, root, verbose=False): # this runs 'git' from the root of the source tree. This only gets called # if the git-archive 'subst' keywords were *not* expanded, and # _version.py hasn't already been rewritten with a short version string, # meaning we're inside a checked out source tree. if not os.path.exists(os.path.join(root, ".git")): if verbose: print("no .git in %s" % root) return {} # get_versions() will try next method GITS = ["git"] if sys.platform == "win32": GITS = ["git.cmd", "git.exe"] # if there is a tag, this yields TAG-NUM-gHEX[-dirty] # if there are no tags, this yields HEX[-dirty] (no NUM) stdout = run_command(GITS, ["describe", "--tags", "--dirty", "--always", "--long"], cwd=root) # --long was added in git-1.5.5 if stdout is None: return {} # try next method version, dirty = git_parse_vcs_describe(stdout, tag_prefix, verbose) # build "full", which is FULLHEX[.dirty] stdout = run_command(GITS, ["rev-parse", "HEAD"], cwd=root) if stdout is None: return {} full = stdout.strip() if dirty: full += ".dirty" return {"version": version, "full": full} def get_versions(default={"version": "0+unknown", "full": ""}, verbose=False): # I am in _version.py, which lives at ROOT/VERSIONFILE_SOURCE. If we have # __file__, we can work backwards from there to the root. Some # py2exe/bbfreeze/non-CPython implementations don't do __file__, in which # case we can only use expanded keywords. keywords = {"refnames": git_refnames, "full": git_full} ver = git_versions_from_keywords(keywords, tag_prefix, verbose) if ver: return ver try: root = os.path.realpath(__file__) # versionfile_source is the relative path from the top of the source # tree (where the .git directory might live) to this file. Invert # this to find the root from __file__. for i in versionfile_source.split('/'): root = os.path.dirname(root) except NameError: return default return (git_versions_from_vcs(tag_prefix, root, verbose) or versions_from_parentdir(parentdir_prefix, root, verbose) or default)
from operator import attrgetter from pyangbind.lib.yangtypes import RestrictedPrecisionDecimalType from pyangbind.lib.yangtypes import RestrictedClassType from pyangbind.lib.yangtypes import TypedListType from pyangbind.lib.yangtypes import YANGBool from pyangbind.lib.yangtypes import YANGListType from pyangbind.lib.yangtypes import YANGDynClass from pyangbind.lib.yangtypes import ReferenceType from pyangbind.lib.base import PybindBase from collections import OrderedDict from decimal import Decimal from bitarray import bitarray import six if six.PY3: import builtins as __builtin__ long = int elif six.PY2: import __builtin__ from . import area class areas(PybindBase): """ This class was auto-generated by the PythonClass plugin for PYANG from YANG module openconfig-network-instance - based on the path /network-instances/network-instance/protocols/protocol/ospfv2/areas. Each member element of the container is represented as a class variable - with a specific YANG type. YANG Description: Configuration and operational state relating to an OSPFv2 area. """ __slots__ = ("_path_helper", "_extmethods", "__area") _yang_name = "areas" _pybind_generated_by = "container" def __init__(self, *args, **kwargs): self._path_helper = False self._extmethods = False self.__area = YANGDynClass( base=YANGListType( "identifier", area.area, yang_name="area", parent=self, is_container="list", user_ordered=False, path_helper=self._path_helper, yang_keys="identifier", extensions=None, ), is_container="list", yang_name="area", parent=self, path_helper=self._path_helper, extmethods=self._extmethods, register_paths=True, extensions=None, namespace="http://openconfig.net/yang/network-instance", defining_module="openconfig-network-instance", yang_type="list", is_config=True, ) load = kwargs.pop("load", None) if args: if len(args) > 1: raise TypeError("cannot create a YANG container with >1 argument") all_attr = True for e in self._pyangbind_elements: if not hasattr(args[0], e): all_attr = False break if not all_attr: raise ValueError("Supplied object did not have the correct attributes") for e in self._pyangbind_elements: nobj = getattr(args[0], e) if nobj._changed() is False: continue setmethod = getattr(self, "_set_%s" % e) if load is None: setmethod(getattr(args[0], e)) else: setmethod(getattr(args[0], e), load=load) def _path(self): if hasattr(self, "_parent"): return self._parent._path() + [self._yang_name] else: return [ "network-instances", "network-instance", "protocols", "protocol", "ospfv2", "areas", ] def _get_area(self): """ Getter method for area, mapped from YANG variable /network_instances/network_instance/protocols/protocol/ospfv2/areas/area (list) YANG Description: The OSPFv2 areas within which the local system exists """ return self.__area def _set_area(self, v, load=False): """ Setter method for area, mapped from YANG variable /network_instances/network_instance/protocols/protocol/ospfv2/areas/area (list) If this variable is read-only (config: false) in the source YANG file, then _set_area is considered as a private method. Backends looking to populate this variable should do so via calling thisObj._set_area() directly. YANG Description: The OSPFv2 areas within which the local system exists """ if hasattr(v, "_utype"): v = v._utype(v) try: t = YANGDynClass( v, base=YANGListType( "identifier", area.area, yang_name="area", parent=self, is_container="list", user_ordered=False, path_helper=self._path_helper, yang_keys="identifier", extensions=None, ), is_container="list", yang_name="area", parent=self, path_helper=self._path_helper, extmethods=self._extmethods, register_paths=True, extensions=None, namespace="http://openconfig.net/yang/network-instance", defining_module="openconfig-network-instance", yang_type="list", is_config=True, ) except (TypeError, ValueError): raise ValueError( { "error-string": """area must be of a type compatible with list""", "defined-type": "list", "generated-type": """YANGDynClass(base=YANGListType("identifier",area.area, yang_name="area", parent=self, is_container='list', user_ordered=False, path_helper=self._path_helper, yang_keys='identifier', extensions=None), is_container='list', yang_name="area", parent=self, path_helper=self._path_helper, extmethods=self._extmethods, register_paths=True, extensions=None, namespace='http://openconfig.net/yang/network-instance', defining_module='openconfig-network-instance', yang_type='list', is_config=True)""", } ) self.__area = t if hasattr(self, "_set"): self._set() def _unset_area(self): self.__area = YANGDynClass( base=YANGListType( "identifier", area.area, yang_name="area", parent=self, is_container="list", user_ordered=False, path_helper=self._path_helper, yang_keys="identifier", extensions=None, ), is_container="list", yang_name="area", parent=self, path_helper=self._path_helper, extmethods=self._extmethods, register_paths=True, extensions=None, namespace="http://openconfig.net/yang/network-instance", defining_module="openconfig-network-instance", yang_type="list", is_config=True, ) area = __builtin__.property(_get_area, _set_area) _pyangbind_elements = OrderedDict([("area", area)]) from . import area class areas(PybindBase): """ This class was auto-generated by the PythonClass plugin for PYANG from YANG module openconfig-network-instance-l2 - based on the path /network-instances/network-instance/protocols/protocol/ospfv2/areas. Each member element of the container is represented as a class variable - with a specific YANG type. YANG Description: Configuration and operational state relating to an OSPFv2 area. """ __slots__ = ("_path_helper", "_extmethods", "__area") _yang_name = "areas" _pybind_generated_by = "container" def __init__(self, *args, **kwargs): self._path_helper = False self._extmethods = False self.__area = YANGDynClass( base=YANGListType( "identifier", area.area, yang_name="area", parent=self, is_container="list", user_ordered=False, path_helper=self._path_helper, yang_keys="identifier", extensions=None, ), is_container="list", yang_name="area", parent=self, path_helper=self._path_helper, extmethods=self._extmethods, register_paths=True, extensions=None, namespace="http://openconfig.net/yang/network-instance", defining_module="openconfig-network-instance", yang_type="list", is_config=True, ) load = kwargs.pop("load", None) if args: if len(args) > 1: raise TypeError("cannot create a YANG container with >1 argument") all_attr = True for e in self._pyangbind_elements: if not hasattr(args[0], e): all_attr = False break if not all_attr: raise ValueError("Supplied object did not have the correct attributes") for e in self._pyangbind_elements: nobj = getattr(args[0], e) if nobj._changed() is False: continue setmethod = getattr(self, "_set_%s" % e) if load is None: setmethod(getattr(args[0], e)) else: setmethod(getattr(args[0], e), load=load) def _path(self): if hasattr(self, "_parent"): return self._parent._path() + [self._yang_name] else: return [ "network-instances", "network-instance", "protocols", "protocol", "ospfv2", "areas", ] def _get_area(self): """ Getter method for area, mapped from YANG variable /network_instances/network_instance/protocols/protocol/ospfv2/areas/area (list) YANG Description: The OSPFv2 areas within which the local system exists """ return self.__area def _set_area(self, v, load=False): """ Setter method for area, mapped from YANG variable /network_instances/network_instance/protocols/protocol/ospfv2/areas/area (list) If this variable is read-only (config: false) in the source YANG file, then _set_area is considered as a private method. Backends looking to populate this variable should do so via calling thisObj._set_area() directly. YANG Description: The OSPFv2 areas within which the local system exists """ if hasattr(v, "_utype"): v = v._utype(v) try: t = YANGDynClass( v, base=YANGListType( "identifier", area.area, yang_name="area", parent=self, is_container="list", user_ordered=False, path_helper=self._path_helper, yang_keys="identifier", extensions=None, ), is_container="list", yang_name="area", parent=self, path_helper=self._path_helper, extmethods=self._extmethods, register_paths=True, extensions=None, namespace="http://openconfig.net/yang/network-instance", defining_module="openconfig-network-instance", yang_type="list", is_config=True, ) except (TypeError, ValueError): raise ValueError( { "error-string": """area must be of a type compatible with list""", "defined-type": "list", "generated-type": """YANGDynClass(base=YANGListType("identifier",area.area, yang_name="area", parent=self, is_container='list', user_ordered=False, path_helper=self._path_helper, yang_keys='identifier', extensions=None), is_container='list', yang_name="area", parent=self, path_helper=self._path_helper, extmethods=self._extmethods, register_paths=True, extensions=None, namespace='http://openconfig.net/yang/network-instance', defining_module='openconfig-network-instance', yang_type='list', is_config=True)""", } ) self.__area = t if hasattr(self, "_set"): self._set() def _unset_area(self): self.__area = YANGDynClass( base=YANGListType( "identifier", area.area, yang_name="area", parent=self, is_container="list", user_ordered=False, path_helper=self._path_helper, yang_keys="identifier", extensions=None, ), is_container="list", yang_name="area", parent=self, path_helper=self._path_helper, extmethods=self._extmethods, register_paths=True, extensions=None, namespace="http://openconfig.net/yang/network-instance", defining_module="openconfig-network-instance", yang_type="list", is_config=True, ) area = __builtin__.property(_get_area, _set_area) _pyangbind_elements = OrderedDict([("area", area)])
import unittest from datetime import datetime, timedelta from rx import Observable from rx.testing import TestScheduler, ReactiveTest, is_prime, MockDisposable from rx.disposables import Disposable, SerialDisposable from rx.subjects import Subject on_next = ReactiveTest.on_next on_completed = ReactiveTest.on_completed on_error = ReactiveTest.on_error subscribe = ReactiveTest.subscribe subscribed = ReactiveTest.subscribed disposed = ReactiveTest.disposed created = ReactiveTest.created class TimeInterval(object): def __init__(self, value, interval): if isinstance(interval, timedelta): interval = int(interval.microseconds/1000.0) self.value = value self.interval = interval def __str__(self): return "%s@%s" % (self.value, self.interval) def equals(other): return other.interval == self.interval and other.value == self.value class TestTimeInterval(unittest.TestCase): def test_time_interval_regular(self): scheduler = TestScheduler() xs = scheduler.create_hot_observable(on_next(150, 1), on_next(210, 2), on_next(230, 3), on_next(260, 4), on_next(300, 5), on_next(350, 6), on_completed(400)) def create(): def selector(x): return TimeInterval(x.value, x.interval) return xs.time_interval(scheduler).map(selector) results = scheduler.start(create) results.messages.assert_equal(on_next(210, TimeInterval(2, 10)), on_next(230, TimeInterval(3, 20)), on_next(260, TimeInterval(4, 30)), on_next(300, TimeInterval(5, 40)), on_next(350, TimeInterval(6, 50)), on_completed(400)) def test_time_interval_empty(self): scheduler = TestScheduler() def create(): return Observable.empty(scheduler).time_interval(scheduler) results = scheduler.start(create) results.messages.assert_equal(on_completed(201)) def test_time_interval_error(self): ex = 'ex' scheduler = TestScheduler() def create(): return Observable.throw_exception(ex, scheduler).time_interval(scheduler) results = scheduler.start(create) results.messages.assert_equal(on_error(201, ex)) def test_time_interval_never(self): scheduler = TestScheduler() def create(): return Observable.never().time_interval(scheduler) results = scheduler.start(create) results.messages.assert_equal()
from __future__ import unicode_literals from django.db import migrations class Migration(migrations.Migration): dependencies = [ ('lexicon', '0089_fix_citation'), ] operations = [ migrations.RemoveField( model_name='meaninglist', name='data', ), ]
from bambino.appenv import Repository, WebAppDir from contextlib import contextmanager from path import path import os import shutil import subprocess import tempfile import unittest class TestAppEnvIdentification(unittest.TestCase): def setUp(self): sb = self.sandbox = path(tempfile.mkdtemp()) ae1 = sb / 'ae1' ae2 = sb / 'ae2' ne1 = sb / 'ne2' for env in ae1, ae2: (env / '.git').makedirs_p() (env / 'etc').mkdir() ne1.mkdir() def makeone(self): return WebAppDir(self.sandbox) def test_envid(self): aef = self.makeone() assert aef.services envs = set(x.name for x in aef.services) assert envs == set(('ae1', 'ae2')), envs class TestAppEnvRepo(unittest.TestCase): temp_dir = os.getcwd() + '/temp' temp_etc_dir = temp_dir + '/etc' def setUp(self): # Create a simulated app env directory if not os.path.isdir(TestAppEnvRepo.temp_etc_dir): os.makedirs(TestAppEnvRepo.temp_etc_dir) def tearDown(self): # Remove the directory if os.path.isdir(TestAppEnvRepo.temp_dir): shutil.rmtree(TestAppEnvRepo.temp_dir, True) def test_config_billweb(self): """ Test the Repository.config property. This test WILL NOT be a true unit test because it requires a Git repository """ git_path = '/opt/webapp/billweb/etc' repository = Repository(git_path) config = repository.config self.assertTrue(config["author"]) self.assertTrue(config["date"]) self.assertTrue(config["commit"]) self.assertTrue(config["latest_commit"]) self.assertTrue(config["changed_files"]) def test_config_anweb(self): """ Test the Repository.config property. This test WILL NOT be a true unit test because it requires a Git repository """ git_path = '/opt/webapp/anweb/etc' repository = Repository(git_path) config = repository.config self.assertTrue(config["author"]) self.assertTrue(config["date"]) self.assertTrue(config["commit"]) self.assertTrue(config["latest_commit"]) self.assertTrue(config["changed_files"]) def make_env_app(self, args=[]): sb = self.sandbox = path(tempfile.mkdtemp()) with pushd(sb): predefined = [ 'git init', 'touch root.txt', 'git add .', 'git commit -a -m "commit to root"', 'mkdir etc', 'cd etc', 'git init', 'touch etc.txt', 'git add .', 'git commit -a -m "commit to etc"', 'cd ..'] devnul = '| > /dev/null 2>&1' for deffed in predefined: subprocess.check_output(deffed + devnul, shell=True) for arg in args: subprocess.check_output(arg + devnul, shell=True) from bambino.appenv import Service return Service(sb) def test_no_tag(self): repo = self.make_env_app() assert repo.app.last_tag == 'HEAD' def test_dirty(self): repo = self.make_env_app(['echo "hi" >> root.txt']) assert repo.app.is_dirty, repo def test_change_count(self): args = ['echo "hi" >> root.txt', 'git tag first_tag', 'git commit -a -m "im just saying"'] repo = self.make_env_app(args) assert repo.app.change_count == 1 def test_current_branch(self): args = ['git checkout -b my_branch'] repo = self.make_env_app(args) assert repo.app.current_branch == 'my_branch' def test_unchanged(self): repo = self.make_env_app() assert repo.status == 'tagged' def test_uncommitted_changes(self): args = ['echo "hi" >> root.txt'] repo = self.make_env_app(args) assert repo.status == 'uncommitted_changes' def test__get_latest_commit_sha1_from_log(self): git_path = '/opt/webapp/billweb/etc' repository = Repository(git_path) log_text = """commit 0fab9fbd022c71d4883dc153c2730f771b534c0a Author: Doug Morgan <doug@surveymonkey.com> Date: Tue Nov 13 11:30:22 2012 -0800 Update app.ini Testing changing path""" sha1 = repository._get_latest_commit_sha1_from_log(log_text) self.assertEqual(sha1, '0fab9fbd022c71d4883dc153c2730f771b534c0a') def test_committed_changes(self): args = ['echo "hi" >> root.txt', 'git tag first_tag', 'git commit -a -m "im just saying"'] repo = self.make_env_app(args) assert repo.status == 'change_to_app_and_config' @contextmanager def pushd(dir): old_dir = os.getcwd() os.chdir(dir) try: yield old_dir finally: os.chdir(old_dir) if __name__ == '__main__': unittest.main()
import simuvex from simuvex.s_type import SimTypeString class strcpy(simuvex.SimProcedure): #pylint:disable=arguments-differ def run(self, dst, src): self.argument_types = {0: self.ty_ptr(SimTypeString()), 1: self.ty_ptr(SimTypeString())} self.return_type = self.ty_ptr(SimTypeString()) strlen = simuvex.SimProcedures['libc.so.6']['strlen'] strncpy = simuvex.SimProcedures['libc.so.6']['strncpy'] src_len = self.inline_call(strlen, src) ret_expr = self.inline_call(strncpy, dst, src, src_len.ret_expr+1, src_len=src_len.ret_expr).ret_expr return ret_expr
""" Based on https://djangosnippets.org/snippets/1179/ """ from re import compile from django.conf import settings as django_settings from django.contrib.auth.views import redirect_to_login from django.urls import reverse from django_auth_adfs.exceptions import MFARequired from django_auth_adfs.config import settings LOGIN_EXEMPT_URLS = [ compile(django_settings.LOGIN_URL.lstrip('/')), compile(reverse("django_auth_adfs:login").lstrip('/')), compile(reverse("django_auth_adfs:logout").lstrip('/')), compile(reverse("django_auth_adfs:callback").lstrip('/')), ] if hasattr(settings, 'LOGIN_EXEMPT_URLS'): LOGIN_EXEMPT_URLS += [compile(expr) for expr in settings.LOGIN_EXEMPT_URLS] class LoginRequiredMiddleware: """ Middleware that requires a user to be authenticated to view any page other than LOGIN_URL. Exemptions to this requirement can optionally be specified in settings via a list of regular expressions in LOGIN_EXEMPT_URLS (which you can copy from your urls.py). Requires authentication middleware and template context processors to be loaded. You'll get an error if they aren't. """ def __init__(self, get_response): self.get_response = get_response def __call__(self, request): assert hasattr(request, 'user'), "The Login Required middleware requires " \ "authentication middleware to be installed. " \ "Edit your MIDDLEWARE setting to insert " \ "'django.contrib.auth.middleware.AuthenticationMiddleware'. " \ "If that doesn't work, ensure your TEMPLATE_CONTEXT_PROCESSORS " \ "setting includes 'django.core.context_processors.auth'." if not request.user.is_authenticated: path = request.path_info.lstrip('/') if not any(m.match(path) for m in LOGIN_EXEMPT_URLS): try: return redirect_to_login(request.get_full_path()) except MFARequired: return redirect_to_login('django_auth_adfs:login-force-mfa') return self.get_response(request)
import sys, os sys.path.insert(0, '..') extensions = ['sphinx.ext.autodoc', 'sphinx.ext.intersphinx'] intersphinx_mapping = {'python': ('http://docs.python.org/3.2', None), 'pymongo': ('http://api.mongodb.org/python/current/', None)} templates_path = ['_templates'] source_suffix = '.rst' master_doc = 'index' project = u'Mongotron' copyright = u'2013, The Montogron Authors' version = '0.1' release = '0.1' exclude_patterns = ['_build'] pygments_style = 'sphinx' html_theme = 'default' html_static_path = ['_static'] htmlhelp_basename = 'Mongotrondoc' latex_elements = { } latex_documents = [ ('index', 'Mongotron.tex', u'Mongotron Documentation', u'The Montogron Authors', 'manual'), ] man_pages = [ ('index', 'mongotron', u'Mongotron Documentation', [u'The Montogron Authors'], 1) ] texinfo_documents = [ ('index', 'Mongotron', u'Mongotron Documentation', u'The Montogron Authors', 'Mongotron', 'One line description of project.', 'Miscellaneous'), ]
import tempfile import subprocess import numpy as np from os.path import dirname class SelfTuningSpectralClustering(): # src_pat ex.) "^.*/X_(\d{3}).csv$" def __init__(self,n_clusters_max): self.exe=dirname(__file__)+"/self_tuning_spectral_clustering" self.n_clusters_max=n_clusters_max def mktemp(self): return tempfile.TemporaryFile() def fit_predict(self,X): ftemp_y = tempfile.NamedTemporaryFile() ftemp_X = tempfile.NamedTemporaryFile() np.savetxt(ftemp_X.name,X,delimiter=',') command="%s %d %s %s"%(self.exe,int(self.n_clusters_max),ftemp_X.name,ftemp_y.name) print(command) p = subprocess.call( command, shell=True ) #p.wait() y = np.loadtxt(ftemp_y.name,delimiter=',') return y
""" Implements parsing of Grako's EBNF idiom for grammars, and grammar model creation using the .grammars module. GrakoParserRoot is the bootstrap parser. It uses the facilities of parsing.Parser as generated parsers do, but it does not conform to the patterns in the generated code. Why? Because having Grako bootstrap itself from its grammar would be cool, but very bad engineering. GrakoParserRoot is hand-crafted. The GrakoGrammarGenerator class, a descendant of GrakoParserRoot constructs a model of the grammar using semantic actions the model elements defined in the .grammars module. """ from __future__ import (absolute_import, division, print_function, unicode_literals) from grako.bootstrap import GrakoBootstrapParser from grako.grammars import GrakoContext from grako.semantics import GrakoASTSemantics, GrakoSemantics __all__ = ['GrakoParser', 'GrakoGrammarGenerator'] class GrakoParserBase(GrakoBootstrapParser, GrakoContext): pass class GrakoParser(GrakoParserBase): def __init__(self, grammar_name, semantics=None, **kwargs): if semantics is None: semantics = GrakoASTSemantics() super(GrakoParser, self).__init__(semantics=semantics, **kwargs) class GrakoGrammarGenerator(GrakoParserBase): def __init__(self, grammar_name, semantics=None, parseinfo=True, **kwargs): if semantics is None: semantics = GrakoSemantics(grammar_name) super(GrakoGrammarGenerator, self).__init__( semantics=semantics, parseinfo=True, **kwargs )
from AnyQt.QtWidgets import QGroupBox, QHBoxLayout, QVBoxLayout from Orange.widgets import gui from Orange.widgets import settings from Orange.widgets.widget import OWWidget from orangecontrib.text.corpus import Corpus class Input: CORPUS = 'Corpus' class Output: CORPUS = 'Corpus' class OWBaseVectorizer(OWWidget): """ A base class for feature extraction methods. Notes: Ensure that `create_configuration_layout` and `update_method` are overwritten. """ # Input/output inputs = [ (Input.CORPUS, Corpus, 'set_data'), ] outputs = [ (Output.CORPUS, Corpus) ] want_main_area = False resizing_enabled = False # Settings autocommit = settings.Setting(True) Method = NotImplemented def __init__(self): super().__init__() self.corpus = None self.method = None box = QGroupBox(title='Options') box.setLayout(self.create_configuration_layout()) self.controlArea.layout().addWidget(box) buttons_layout = QHBoxLayout() buttons_layout.addWidget(self.report_button) buttons_layout.addSpacing(15) buttons_layout.addWidget( gui.auto_commit(None, self, 'autocommit', 'Commit', box=False) ) self.controlArea.layout().addLayout(buttons_layout) self.update_method() def set_data(self, data): self.corpus = data self.commit() def commit(self): self.apply() def apply(self): if self.corpus is not None: new_corpus = self.method.transform(self.corpus) self.send(Output.CORPUS, new_corpus) def update_method(self): self.method = self.Method() def on_change(self): self.update_method() self.commit() def send_report(self): self.report_items(self.method.report()) def create_configuration_layout(self): return QVBoxLayout()
def SimIRStmt_CAS(engine, state, stmt): # first, get the expression of the add with state.history.subscribe_actions() as addr_actions: addr = engine.handle_expression(state, stmt.addr) # figure out if it's a single or double double_element = (stmt.oldHi != 0xFFFFFFFF) and (stmt.expdHi is not None) if double_element: # translate the expected values with state.history.subscribe_actions() as cond_actions: expd_lo = engine.handle_expression(state, stmt.expdLo) expd_hi = engine.handle_expression(state, stmt.expdHi) # read the old values old_cnt = state.memory.load(addr, len(expd_lo)*2//8, endness=stmt.endness) old_hi, old_lo = old_cnt.chop(bits=len(expd_lo)) state.scratch.store_tmp(stmt.oldLo, old_lo, None, None) state.scratch.store_tmp(stmt.oldHi, old_hi, None, None) # the write data with state.history.subscribe_actions() as data_actions: data_lo = engine.handle_expression(state, stmt.dataLo) data_hi = engine.handle_expression(state, stmt.dataHi) data = state.solver.Concat(data_hi, data_lo) # do it condition = state.solver.And(old_lo == expd_lo, old_hi == expd_hi) data_ao = SimActionObject(data, deps=data_actions, state=state) addr_ao = SimActionObject(addr, deps=addr_actions, state=state) guard_ao = SimActionObject(condition, deps=cond_actions, state=state) size_ao = SimActionObject(len(data)) a = SimActionData(state, state.memory.id, SimActionData.WRITE, addr=addr_ao, data=data_ao, condition=guard_ao, size=size_ao) state.memory.store(addr, data, condition=condition, endness=stmt.endness, action=a) state.history.add_action(a) else: # translate the expected value with state.history.subscribe_actions() as cond_actions: expd_lo = engine.handle_expression(state, stmt.expdLo) # read the old values old_lo = state.memory.load(addr, len(expd_lo)//state.arch.byte_width, endness=stmt.endness) state.scratch.store_tmp(stmt.oldLo, old_lo, None, None) # the write data with state.history.subscribe_actions() as data_actions: data = engine.handle_expression(state, stmt.dataLo) # do it condition = old_lo == expd_lo data_ao = SimActionObject(data, deps=data_actions, state=state) addr_ao = SimActionObject(addr, deps=addr_actions, state=state) guard_ao = SimActionObject(condition, deps=cond_actions, state=state) size_ao = SimActionObject(len(data)) a = SimActionData(state, state.memory.id, SimActionData.WRITE, addr=addr_ao, data=data_ao, condition=guard_ao, size=size_ao) state.memory.store(addr, data, condition=condition, endness=stmt.endness, action=a) from ....state_plugins.sim_action import SimActionData from ....state_plugins.sim_action_object import SimActionObject
from django.conf.urls import patterns, include, url from django.contrib import admin admin.autodiscover() urlpatterns = patterns('', # Examples: # url(r'^$', 'dot_app.views.home', name='home'), # url(r'^blog/', include('blog.urls')), url(r'^admin/', include(admin.site.urls)), )