article_title stringlengths 1 167 | section_title stringlengths 1 438 ⌀ | passage_text stringlengths 1 2.09k |
|---|---|---|
Shell jewelry | In prehistory | humans in Africa and the Levant were more culturally sophisticated than had previously been thought. In some cases shells had been transported a considerable distance from the species' natural habitat. One example is the site of Oued Djebbana in Algeria, for example, where an N. gibbosulus bead was found; at the time the shell was used there, this site was at least 190 km away from the sea.
Shell ornaments were very common during the Upper Paleolithic, from 50–40,000 years ago onwards, when they spread with modern humans to Europe and Asia. They generally take the form of perforated shells (as well |
Tahir Allauddin Al-Qadri Al-Gillani | Life sketch | on the second storey and Maulana Sardar Ahmed placed his own sons and students on the last level. At the conclusion of the gathering, the crowds were uncontrollable as they rushed in the hope of meeting or touching Al-Gilani so Maulana Sardar Ahmed ordered for a side wall had to be demolished so Al-Gillani could leave safely.
Al-Gillani would be invited as main guest to conferences and events, being held both nationally and internationally. These include the International Khatm e Nabuwat Conference held at Minar e Pakistan, the inauguration of Minhaj-ul-Quran International held at Lahore in 1984, the International Minhaj-ul-Quran Conference |
Startling Stories | Merwin and after & Derivative anthologies | and Kelly Freas.
Startling's instantly recognizable title logo was redolent of the magazine's pulp roots, and in early 1952 Mines decided to replace it with a more staid typeface. The covers became more sober, with spaceships replacing the women in brass bras. With the Spring 1955 issue, at the start of its final year, Startling dropped its long-standing policy of printing a novel in every issue, but only three issues later it ceased publication. Derivative anthologies Two anthologies of stories from Startling have been published. In 1949 Merlin Press brought out From Off This World, edited by Leo |
St. Joseph's Catholic Church (Wapakoneta, Ohio) | Early parish history | St. Joseph's Catholic Church (Wapakoneta, Ohio) Early parish history One of the first two Catholic priests in northern Ohio was John William Horstmann, a native of Osnabrück who had settled in the village of Glandorf to the north. Starting in 1832, he made monthly journeys of 50 miles (80 km) to Stallotown to the south. As Wapakoneta lies midway between these communities, he often visited with and celebrated Mass for its few Catholic families. After four years of these travels, he established a parish at Petersburg, approximately 4 miles (6.4 km) south of Wapakoneta.
By 1839, the Catholic community in |
Sigma Alpha Mu | Mission and creed & Candidate Education | appreciate our great heritage as a fraternity of Jewish men." Its creed is "To foster and maintain among its sons a spirit of fraternity, a spirit of mutual moral aid and support; to instill and maintain in the hearts of its sons love for and loyalty to Alma Mater and its ideals; to inculcate among its sons such ideals as will result in actions worthy of the highest precepts of true manhood, democracy, and humanity." Candidate Education Following a school's "rush", or recruitment period, all chapters of Sigma Alpha Mu allow for a Candidate Education (pledge) program where the candidates |
St. Thomas Aquinas Catholic Secondary School (London, Ontario) | History | St. Thomas Aquinas Catholic Secondary School (London, Ontario) History St. Thomas Aquinas was first established at the site of the former St. Joseph Catholic school on Charles Street in 1990. Construction began on the school's permanent site in 1993 on 8 hectares in the northwest sector of London, Ontario, adjacent to the Byron neighborhood. The current building, opened in 1994 and 152,314 square feet in size, was highly technologically advanced for its time with internet access throughout the school, as well as cable television and VCRs in virtually every classroom.
The school was built with the expectation that it would |
Steven Sinofsky | Book | Sinofsky talks about the focus of making a desirable high-quality product, while making no promises to the public, and shipping and delivering that product on time. |
Sauvira Kingdom | Modern equivalents & Cultural affinity | stated to be close to the Dwaraka and Anarta kingdoms. Modern equivalents The Sauvira people mentioned in the Mahabharata may also be related to the modern-day Saraiki people. Persian scholar Al-Beruni considered Sauvira to represent southwest Punjab, including Multan, Mithankot and adjacent areas in the region of the confluence of the Indus river with other rivers of Punjab in modern Pakistan. Cultural affinity Culturally, the Sauviras were mentioned by the character Karna as being similar to the Madras: "The Prasthalas, the Madras, the Gandharas, the Arattas, those called Khasas, the Vasatis, the Sindhus and the Sauviras are almost as |
Sommarnöje | Description | work was made in oil paint, showing Zorn's skill as a watercolourist. Less attention is paid to the other side of the lake, sketched roughly in the background. It is signed and dated in the lower left corner, "Zorn 86".
It was acquired by Edvard Levisson of Gothenburg, and then descended through the Schollin-Borg family. The painting was sold at the Stockholms Auktionsverk in June 2010 for SEK 26 million, setting a record for a Swedish painting. The previous record of SEK 22 million was set in 1990, for August Strindberg's 1892 oil painting Underlandet ("Wonderland"). |
Sultan bin Abdulaziz Al Saud | Donations & Personal life | in right perspectives.’ Personal life Prince Sultan had thirty-two children by his multiple wives. His eldest son Khalid bin Sultan, after Prince Sultan's death, was appointed deputy minister of defense and served in the post until 20 April 2013. Bandar bin Sultan was the secretary general of the national security council between 2005 and January 2015, and the former head of the general intelligency directorate. Fahd bin Sultan is the governor of the Tabuk province. Salman bin Sultan, another son, is the former deputy defense minister. Faisal bin Sultan (born 1951) is the secretary general of Sultan bin Abdulaziz Al |
Szegvár | Geography | Szegvár Geography It covers an area of 86.22 km² (33 sq mi) and has a population of 4385 people (2015). |
Tacoma Narrows Bridge (1950) | Design | Tower #3 in the design plans), and widening of the upper box strut for the new bridge's deck.
The road deck itself was seen as a major innovation in suspension bridge design. Lanes of traffic on typical suspension bridge roadways are divided by dashed paint lines, a solid strip, or a set of two strips of paint. On the 1950 span's final roadway design, the 46-foot (14 m)-wide roadway was split into four lanes of traffic, each lane being 9 ⁵⁄₈ feet (2.9 m) wide. Each lane was separated by a 3-inch (76 mm) deep, 33-inch (840 mm)-wide open air wind grate. Bordering the outside lanes |
St. Nicholas Greek Orthodox Cathedral (Tarpon Springs, Florida) | History | parish added a school in 1925.
By 1935, the parish had outgrown the first church and began raising funds toward current structure. Construction began in 1941 and was completed in 1943, when it was consecrated by Archbishop Athenagoras (later Patriarch) at Epiphany. St. Nicholas was by then a significant center of community life as well, with major festivals surrounding Epiphany, Greek Independence Day, and Orthodox Easter. Honoring this, in 1975, the Tarpon Springs Board of Commissioners passed a resolution designating the city the "Epiphany City" of the United States.
St. Nicholas was elevated to cathedral status for West Florida on On January |
Semi-colony | Origins of the term | semi-colonial elite had to be overthrown by the workers and peasants, to liberate the country from its client-relationship with foreign powers, and make comprehensive local economic development possible.
The category of "intermediate countries" was introduced in the later 1920s. Thus, for example, at the 15th Congress of the CPSU in 1927, Stalin stated: “Judge for yourselves. Of the 1,905 million inhabitants of the entire globe, 1,134 million live in the colonies and dependent countries, 143,000,000 live in the U.S.S.R., 264,000,000 live in the intermediate countries, and only 363,000,000 live in the big imperialist countries, which oppress the colonies and dependent countries.” |
Slave states and free states | End of slavery | states. Eleven of these slave states, after conventions devoted to the topic, issued declarations of secession from the United States and created the Confederate States of America and were represented in the Confederate Congress. The slave states that stayed in the Union, Maryland, Missouri, Delaware, and Kentucky (called border states) remained seated in the U.S. Congress. By the time the Emancipation Proclamation was issued in 1863, Tennessee was already under Union control. Accordingly, the Proclamation applied only to the 10 remaining Confederate states. Abolition of slavery, as mandated by the Thirteenth Amendment, was a requirement for readmission of the conquered |
Sapta Puri | Haridwar | held here are the Ardh Kumbha Mela (half Kumbh Mela) held every six years. The 12 years cycle Kumbh Mela is held during January or February depending on the Hindu Calmanac. It is the occasion when lakhs of people congregate here for a holy dip in the Ganges. The Kumbh Mela (literal meaning is ('festival of pots') is the "confluence of faith" since lakhs of people irrespective of their caste affiliations attend it. Astrological combination of planets decide the date for the event; generally when Jupiter, Sun and Moon are in the same zodiacal sign of the Aquarius, but |
Spangler Center | Overview | Spangler Center Overview The building was named in honor of billionaire alumnus Clemmie Spangler, who made a donation to towards the construction. It cost $32 million in total. Its construction was completed in 2001.
According to the HBS website, the building "is considered the main student center for MBAs." It includes "29 project rooms", "a 350-seat auditorium", "IT Support Services, a branch of The Coop bookstore, a business center, a post office retail outlet, Student Association offices, a course material distribution center, and an ATM" as well as the Meredith Room, named for Spangler's wife, and the Williams Room, named for |
Sigma Alpha Mu | Community service | where they raise donations for Alzheimer's Research. Association board member Marshall Gelfand was instrumental in forging the partnership between the two organizations and received the fraternity's Certificate of Merit in 2005, which is awarded to ΣΑΜ alumni whose service and achievements in community endeavors are worthy of special recognition. Donations raised by the fraternity are part of The Judy Fund, established in 2003 on behalf of Mr. Gelfand's wife who in 1995, was diagnosed with Alzheimer's Disease. Mrs. Gelfand died in 2004. Alzheimer's Association's fastest growing individual named fund, The Judy Fund, has raised more than $5.1 million as of |
Tacoma Narrows Bridge (1950) | Traffic increases | and realigned from a meandering two-lane country road to a four-lane freeway that stretched from Tacoma to Gorst. As a result, traffic congestion grew enough to where backups began occurring. In 1980, average counts were at 38,973 vehicles per day. In 1990, the figure increased to 66,573—exceeding its designed daily capacity by 6,573. Many of the backups on the bridge occurred on the east end as workers from Tacoma headed towards their homes in Gig Harbor, and those backups would stretch as far as Interstate-5 nearly 6 miles (9.7 km) away. These backups continued to get worse, and by 2000, the |
TS Pretoria | Description & Pre-war | by Foster Wheeler, operating at 500 pounds per square inch (34 bar). In 1973, she was re-engined, being fitted with a diesel engine.
As built, the ship had accommodation for 152 first class and 338 second class passengers. In 1949, she was converted to a troopship, with accommodation for 1,491 troops. In 1959, she was refitted to carry 106 first class and 2,000 pilgrim class passengers. Pre-war Pretoria was built as yard number 536 by Blohm & Voss, Hamburg, Germany. She was launched on 16 July 1936. She was one of a pair of sister ships completed that year for Deutsche Ost-Afrika |
Strategic bombing during World War II | U.S. bombing in Europe | defending bombers, flying over Germany, Austria, and France at high altitudes during the daytime. Also, both the U.S. Government and its Army Air Forces commanders were reluctant to bomb enemy cities and towns indiscriminately. They claimed that by using the B-17 and the Norden bombsight, the USAAF should be able to carry out "precision bombing" on locations vital to the German war machine: factories, naval bases, shipyards, railroad yards, railroad junctions, power plants, steel mills, airfields, etc.
In January 1943, at the Casablanca Conference, it was agreed RAF Bomber Command operations against Germany would be reinforced by the USAAF in a |
Strategic bombing during World War II | The Battle of Britain and the Blitz | Coventry. Basil Collier, author of 'The Defence of the United Kingdom', the HMSO's official history, wrote:
Although the plan adopted by the Luftwaffe early September had mentioned attacks on the population of large cities, detailed records of the raids made during the autumn and the winter of 1940–41 does not suggest that indiscriminate bombing of the civilians was intended. The points of aim selected were largely factories and docks. Other objectives specifically allotted to bomber-crews included the City of London and the governmental quarter round Whitehall.
— Basil Collier
In addition to the conclusions of Basil Collier to that effect there are also, for |
Sylver Kyagulanyi | Early life and education & Music | Sylver Kyagulanyi Early life and education Kyagulanyi attended Nswanjere Junior Seminary for his primary education. He went to Kisubi Seminary and St Charles Lwangwa Secondary School, for his secondary education. He was admitted to Makerere University’s Mass Communication programme but left it and instead did a degree in Music Dance and Drama, specializing in music. Music He started singing when he was part of the soprano in Christ the King church choir in the early 1990s. Whilst in senior three, his song won the Youth Alive National Music Festival in 1995. Having won, Kyagulanyi continued developing his talent. During his |
Stuart Meissner | null | Sinaloa Cartel operates extensively out of Tesla's Gigafactory. As of October 2019, no action has been taken on these claims.
Following the 9/11 terrorist attacks Meissner volunteered at Ground Zero on “the pile” on the “bucket brigade” along with fire and policemen sifting through debris trying to find survivors. As a result of his volunteer work after 9/11 in 2016 , while also assisting in the 2016 presidential campaign, Meissner learned he had developed a rare cancer, which required major surgery and intensive chemotherapy, all the while continuing to support his children and oversee his law practice, but eventually survived his |
Tacoma Narrows Bridge (1950) | Design | Bridge, once finalized, were a sharp and drastic contrast from the design by Leon Moisseiff. Instead of a thin plate girder, an open-air stiffening truss with a depth of 33 feet (10 m) would form the new road deck. Newer, larger towers that rose 58 feet (18 m) higher and 21 feet (6.4 m) wider than Gertie's towers, would support the bridge's main cables, now 20 ¹⁄₄ inches (510 mm) in diameter versus Gertie's 17 ¹⁄₂ inches (440 mm). Newer, larger anchor blocks would support a load that weighed 1.6 times as much as the original bridge. However, some elements of Galloping Gertie were incorporated into the |
St Helena School, Colchester | History | of Geoffrey of Monmouth written in the twelfth century, St Helena was the daughter of Coel, a legendary King of Britain and duke of Colchester in the third century. She was the mother of Constantine the Great, the first Christian to rule the Roman Empire.
The original segregated arrangement remained until 1961, when, under Mr Hepburn Reid's stewardship, the school became a co-educational Secondary Modern. After twenty-five years as Head of the School, Mr Hepburn Reid retired in 1963 to be succeeded by Mr H S Boyle. When the school was reorganised again in 1977 becoming an 11-18 mixed Comprehensive School, |
Statutory rape | Current issues | persons held under the statutory rape law and has led to public demands that the law be changed by emergency legislation being enacted. On June 2, 2006 the Irish Supreme Court upheld an appeal by the state against the release of one such person, "Mr. A". Mr. A was rearrested shortly afterwards to continue serving his sentence.
In the aftermath of the December 2007 disclosure by then-16-year-old actress Jamie Lynn Spears, the sister of pop star Britney Spears, that the father of her baby is 18-year-old Casey Aldridge, there was talk of the prosecution of Aldridge for statutory rape, which could |
Stewart B. McKinney National Wildlife Refuge | History & News | Island was added to the refuge. Through generous donations and the help of many partners, Stewart B. McKinney National Wildlife Refuge now consists of ten refuge units spread across 70 miles (110 km) of Connecticut's coastline, from Westbrook to Greenwich. News In 2007 and 2008 the town of Stratford debated whether the town would sell town owned lands to the U.S. Fish and Wildlife Service. If the property is sold, it would presumably be made part of the McKinney Refuge. From the Connecticut Post:
STRATFORD — One of the former Town Council's final decisions was to direct Mayor James |
Snow Job (G.I. Joe) | Video games | G.I. Joe: The Rise of Cobra. |
Sungei Pari Towers | Features & Present state | Corbusier favored. Present state The flats are managed and rented out to low-income groups by the Ipoh City Council (Majlis Bandaraya Ipoh, MBI). The flats are mostly vacant since almost a decade ago. In 2012 it was reported that only the ground floor of the 15-storey block was occupied, by three tenants. However there already are plans to redevelop the flats since 2013. |
Sto Para Pente | Season 1 (2005-2006) summary | enemies, who tie them up to the railroad tracks, and the whole train scene from the first episode is repeated, and finally Amalia rescues them. When they are free, it is revealed that the mysterious leader of the bad guys is revealed to the viewers (but not the characters) to be the leader of a major (fictional) political party that has narrowly won the parliamentary elections, making him the new prime minister of Greece. During the whole season his face was never shown on camera and viewers knew him only by his raspy, menacing voice.
The last episode was shown |
State Elementary School Menteng 01 | History | State Elementary School Menteng 01 History The school was founded in 1934 as Carpentier Alting Stichting Nassau School (CAS) by the Dutch colonial administration and was reserved for Dutch children and children of the Indonesian nobility. The Indonesian government took over administration of the school in 1962, and has since been run by the Raden Saleh Foundation.
Notable former students include the children of Bambang Trihatmodjo, son of former president Suharto, as well as the grandchildren of former vice presidents Hamzah Haz and Try Sutrisno. In 1970–71, US President Barack Obama attended the school for one and a half years. |
Styrbjörn the Strong | Alleged descendants | in turn father of 'Thrugillus, called Sprageleg', while the Gesta tells a similar story but turns the Urso, father of 'Spratlingus' (sic) in John of Worcester's pedigree into the actual bear involved. Langebek suggested that Saxo's tale of a 'Wild' Björn, father of Thorkel, was an allegorical reference to Styrbjörn. Otto Brenner, in his accounting of the descendants of Gorm the Old, rejects Thorkill as son of Styrbjörn and Thyra. |
Strategic bombing during World War II | Legal considerations | Strategic bombing during World War II Legal considerations The Hague Conventions of 1899 and 1907, which address the codes of wartime conduct on land and at sea, were adopted before the rise of air power. Despite repeated diplomatic attempts to update international humanitarian law to include aerial warfare, it was not updated before the outbreak of World War II. The absence of specific international humanitarian law did not mean aerial warfare was not covered under the laws of war, but rather that there was no general agreement of how to interpret those laws. This means that aerial bombardment of civilian |
Stephen Fried | Books | very favorable reviews from The New York Times, The Washington Post Book World and The Philadelphia Inquirer, which called it "brave...remarkable...a book about leadership you don't have to be Jewish to appreciate." It was also named one of the ten best spiritual books of the year by Beliefnet, and is used as a seminary textbook and read by congregations preparing to choose new leaders. His following book, Husbandry: Sex, Love & Dirty Laundry—Inside the Minds of Married Men, was a collection of 31 essays about men and relationships, originally written for his Ladies' Home Journal column "Heart of a Husband."
Fried's |
Soul Rocker | La Milicia (2010–2012) & Los Inferno Rockers (2012–2016) | to crown the first ever AAA World Trios Championship, but lost to La Secta (Dark Cuervo, Dark Espiritu and Dark Ozz in the first round. One of La Milicia's' last matches was at Triplemanía XIX where Santana, Cota, Decnnis and Dark Dragon lost to Aero Star, Argenis, Fénix and Sugi San. Los Inferno Rockers (2012–2016) In mid-2012 AAA introduced a new masked trio known as Los Inferno Rockers (Machine Rocker, Devil Rocker and Soul Rocker), a trio of masked, glam-rocker inspired wrestlers who resembled the rock band Kiss. It was later verified that the former Tito Santana was under the |
Squatch | null | on inline skates, over vehicles owned by NBA players Ray Allen and Robert Swift.
The biography of the Edmonton Rush Lacrosse Club's yeti mascot, Slush, describes a history wherein the two characters grew up together in the Cascade Mountains. Squatch appeared during the Rush's inaugural game to "teach" Slush how to be a professional mascot.
Following the SuperSonics' move to Oklahoma City, the character was retired, and remains part of the intellectual property (name, colors, etc.) that the city of Seattle retained as part of the KeyArena lease settlement. The character's performer from 1999–2008 (Marc Taylor) remains under contract with the |
Suffolk University Law School | Research centers and institutes & Libraries and archives | book on Swedish Law in the 1960s. Libraries and archives In 1999, after construction of the new law school building was completed, the John Joseph Moakley Library moved to its new home, on the 5th through 7th floors, in Sargent Hall. The library contains over 450,000 volumes, and budget of new acquisitions reaching approximately $2 million, covering common law and statutes from all major areas of American law in each of the 50 states, the District of Columbia, and with primary legal materials from the U.S. federal government, Canada, the United Kingdom, the United Nations, and the European Union.
The library |
Sophie Lascelles | Education & Career & Personal life | University from 1998 to 2001, where she earned a B.A. in Fine Arts. She then went on to earn her M.F.A. in Fine Arts from the Slade School of Fine Art. Career Sophie Lascelles worked with Footsbarn Travelling Theatre in the early 1990s. She also exhibits her photography at studios such as Danielle Arnaud. Personal life Sophie married Timothy Pearce (born 1955) on 11 June 2011. They had had a daughter, Lilianda Rose Pearce, the previous year. |
T14 Heavy Tank | Design and development | to 101 mm.
The British initially ordered 8,500 in 1942 following which detail design work started. Testing of the pilot model which was completed in 1944 showed the vehicle to be much too heavy for practical use. By this time, the British Army was satisfied with the Churchill and its cruiser tank designs and further production of the T14 was halted.
Only two were built; one tested in the US and the other sent to Britain. The example sent to Britain survives in The Tank Museum, Bovington. The British had developed the Heavy Assault Tank A33 "Excelsior" design to the same specification as |
Roos Field | 2004 renovation & Attendance | the suites to donors, who will pay $30,000 to lease them for five years. The project called for a two-level 6,800-square-foot (630 m²) structure to replace the existing about 800-square-foot (74 m²) press box with the enclosed suites and a new press box on the west side of the stadium. The first floor of the elevated structure contains the donor suites and the second level is for the media and coaches. Each of the donor suites has 12 seats and room for additional people. The suites also have cable television, stereos, and refrigerators. Attendance In 2010, a record 11,702 fans watched |
TL-6 | Development & Design | threats, but it is highly inefficient to use anti-ship missiles such as Harpoon missile and Exocet that are designed against large warships for the destruction of these small boats, thus it is necessary to develop a light anti-ship missile to engage these small yet potentially highly lethal boats. Design While TL-10 series is specifically designed to engage boats displacing 500 tons or less, TL-6 series is specifically designed to engage larger naval vessel with displacement up to 1,000 tons. Along with C-704 that covers ships from 1,000 tons to 3,000 tons, and larger anti ship missiles such as C-802 that |
Stuffed bitter melon soup | General information & Ingredients | Stuffed bitter melon soup Stuffed bitter melon soup or stuffed bitter gourd soup is a soup in Chinese cuisine which is popular in Asia.
Its main ingredient is bitter melon with some different stuffed ingredients depending on who made it. The most used stuffed ingredient is pork. General information Bitter melon has many names depending on the country that call them, for example, Gourd melon, ‘Mara’ in Thai, and ‘Leung Gwa’, which means ‘the cooling melon’ in Cantonese.
Bitter melon is in season in the summer while dried for off-season. Ingredients The main ingredient is bitter melon. Most of the stuffed ingredient |
Strategic bombing during World War II | Rotterdam Blitz | providing direct tactical support for the hard-pressed German 22nd Infantry Division (under Lt. Gen. von Sponeck, which had airlanded on 10 May) in combat with Dutch forces northwest of the city, and in the eastern part of the city at the Meuse river bridge. At the last minute, the Netherlands decided to submit and sent a plenipotentiary and other negotiators across to German lines. There was an attempt to call off the assault, but the bombing mission had already begun. In legal terms, the attack was performed against a defended part of a city vital for the military objectives and |
Tacoma Narrows Bridge (1950) | Opening & Traffic increases | (US$198 million in present terms) - $5 million (US$52.1 million in present terms) more than the construction bond's cost and accrued interest. It was also historic, because the tolls were removed 13 years ahead of schedule. Traffic increases For the first few decades after its opening, traffic congestion was no issue. Off of the west end of the bridge, Highway 16 (until 1964, it was signed as Primary State Highway 14-PT) transformed to a four-lane freeway from a narrow two-lane country highway. By the late 1980s, as developers began constructing housing and shopping mall projects in Gig Harbor, Highway 16 was expanded |
Shock and Vibration Information Analysis Center | null | and vibration community to present and discuss new developments and ongoing research. The Symposium, established in 1947, includes both classified and unclassified sessions. The classified sessions allow critical technology and classified (up to secret level) research to be presented in closed forums of cleared U.S. government and government contractor researchers. Topics covered at the symposium include shock-ship testing, water shock, weapons effects (air blast, ground shock, cratering, penetration), shock physics, earthquake engineering, structural dynamics, and shock and vibration instrumentation and experiment techniques. Over 200 technical papers were typically presented. Panel discussions addressed topics such as new software developments or accelerometer |
Philippe Martin (politician) | Retaliation against the foie gras ban in California | Philippe Martin (politician) Retaliation against the foie gras ban in California On 1 July 2012, he asked French restaurateurs and wine merchants to stop selling Californian wines in protest against the entry into force of a California law prohibiting the sale of foie gras on grounds of animal welfare. |
TSS Earnslaw | Current status | years old. Visitors to the region can undertake a 1.5-hour cruise on board the TSS Earnslaw and view the workings of the steam engine and stokers.
Each year, the TSS Earnslaw undergoes an annual survey – typically from late May to early June – with every second year being taken out of the lake.
Each of the Earnslaw's screws is turned by a driveshaft driven by a triple-expansion steam engine. Passengers have access to a walkway in the engine room, where they can observe the operation of the engines during the cruise. The Earnslaw is the only working coal-fired steamship on the |
Royal Army Ordnance Corps | Field Train Department of the Board of Ordnance | for the movement of artillery pieces in the field (other than those pertaining to the Royal Horse Artillery). For the duration of conflict the Department's personnel accompanied the Artillery and Engineer units in the field providing them with logistic support (including repair facilities).
Between 1795 and 1815, the Field Train served in thirty expeditions and campaigns. In peacetime, the civilians and sergeants returned to their former duties, but the cadre of officers was retained; they were based initially in the Royal Arsenal, and then in the Grand Depot (just off Woolwich Common) where the guns were stored ready for deployment. At |
Statutory rape | Age of consent & Rationale of statutory rape laws | also specify a minimum difference in age in order for the offense to be applicable. Under such terms, if the adult is, for instance, less than three years older than the minor, no crime has been committed or the penalty is far less severe. These are called "Romeo and Juliet" clauses. Rationale of statutory rape laws Statutory rape laws are based on the premise that an individual is legally incapable of consenting to sexual intercourse until that person reaches a certain age. The law mandates that even if he or she willingly engages in sexual intercourse, the sex is not |
Serbian comics | "The Golden Age" (1932-1941) | publications: Mika Miš, Mikijeve novine (Mickey's Newspapers), Mikijevo carstvo (Mickey's Empire).
Later in 1934, the first two specialized comic magazines appeared - Strip and Crtani film (Cartoon). Their appearance and content were influenced by the Italian magazines Topolino, L'Audace and L'Avventuroso, as well as French magazines Le Journal de Mickey and Hop-là!. Another Russian immigrant named Nikola Navojev debuted in the pages of Strip. Although he died at the age of 27, Navojev was a prolific author who created a number of characters for Strip, of which jungle girl Tarcaneta (Tarzanette) is best-known today.
Most of the Golden Age artists were Russian |
Solomon Dalung | Early life and education & Nigerian Prisons Service career | a Master of Laws (LLM) degree from the University of Jos in 2007 while he was a lecturer at the same Institution. Nigerian Prisons Service career Barr. Dalung joined the Nigerian Prisons Service as a Prison Assistant in 1982 where he rose to the rank of Assistant Inspector of Prisons. In 1991, while still in the Prisons Service, he enrolled to the Law Program of the University of Jos to obtain a Bachelor of Laws degree which he obtained in the year 2000. Following his training as an attorney at the University of Jos and the Nigerian Law School, he |
Phacelia curvipes | Description | Phacelia curvipes Description Phacelia curvipes is an annual herb producing a small, branching stem up to about 15 centimeters long. It is glandular and hairy in texture. The leaves are oval or lance-shaped, 1 to 4 centimeters long, and borne on petioles. The hairy inflorescence is a cyme of several flowers. The flower has a bell-shaped or rounded, flattened corolla under a centimeter long. It is blue or purple with a white throat. |
Ryan Dalziel | Career | became under investigation for operating a Ponzi scheme in which he reportedly conned Dalziel and his father out of US$550,000. In May 2009, Dalziel won his judgement over Zogaib in the amount of US$608,000 and continues to legally battle to retrieve his money.
In 2009 Dalziel competed for Orbit Racing in the Grand American Sports Car Series recording one podium finish and numerous top tens.
Dalziel and teammates Terry Borcheller, João Barbosa, and Mike Rockenfeller won the 2010 Rolex 24 at Daytona driving a Porsche Riley for Action Express Racing. Following this, he began driving full-time for Starworks Motorsports alongside Mike Forest.
On |
Sto Para Pente | Season 1 (2005-2006) summary | died in the same airplane disaster 14 years ago (December 2, 1991), which makes their connection even stronger.
Later on, the five discover that the late Minister was, in his youth, the prosecutor in the trial of the man falsely accused of the young woman's murder. After the man's conviction, Stavrianidis came to realize the prisoner's innocence and set out to undo his false judgment. Not being able to expose the crime to the authorities (30 years had since passed and thus the statute of limitations had run out), Stavrianidis attempted to capture the real culprits by exposing an economic scandal |
Subgenomic mRNA | Result | 5'
GCCGCCCCGTATCGATCGTAGCGCACGTTATATATACGTTATTTCTGCGCGGAAAAAAAAA - Original template Strand
5' 3'
GCCGCCCCGTATCGATCGTAGCGCACGTTATATATAC---------------AAAAAAAAA |
GCCGCCCCGTATCGATCGTAGCGCAC--------------------------AAAAAAAAA | = Subgenomic mRNA.
GCCGCCCCGTAT----------------------------------------AAAAAAAAA |
GCCGCCCCGTAT = Nested |
Tacoma Narrows Bridge (1950) | Towers & Cables | the barge, taking a compressor and numerous other tools with it. Divers soon located the cable saddle in a deep hole during a slack tide (the only time divers could operate, and slack tides only occurred at night). After a three-day delay, it was raised to the surface, repaired (the impact bent a corner on it), and reinstalled. The earthquake delayed completion of both the east and west towers on the bridge. After the earthquake's aftershocks subsided, work resumed, and by July 17 both towers were announced as being completed. Cables Construction of the main cables began by erecting their |
Spirit Falls | null | Spirit Falls Spirit Falls is a 30 foot (9.1 m) waterfall located in the Jacobs Hill open space preserve in Royalston, Massachusetts. The preserve is managed by non-profit organization The Trustees of Reservations. The 22-mile (35 km) Tully Trail passes by the falls. |
St. Walburg, Saskatchewan | History & Economy | to Paradise Hill and Frenchman Butte. Later the rail line and the Saskatchewan Highway 26 ran beside each other from Prince to St. Walburg. The Canadian National Railway abandoned the entire branch line in 2005, when the remaining grain elevators closed. The line was officially abandoned in 2008. Economy The main industries are grain and cattle farming. The oil and natural gas industries have become increasingly important in the area. |
Strategic bombing during World War II | Nuclear bombings | B-29 bomber Enola Gay flew over the Japanese city of Hiroshima in southwest Honshū and dropped a gun-type uranium-235 atomic bomb (code-named Little Boy by the U.S.) on it. Two other B-29 aircraft were airborne nearby for the purposes of instrumentation and photography. When the planes first approached Hiroshima, Japanese anti-aircraft units in the city initially thought they were reconnaissance aircraft, since they were ordered not to shoot at one or few aircraft that did not pose a threat, in order to conserve their ammunition for large-scale air raids. The bomb killed roughly 90,000–166,000 people; half of these died quickly |
Store Dyrehave | Ecology | as the most common species, covering 414.8 hectares, while oak trees cover 132 hectares and other deciduous trees cover 120 hectares. Mainly found in the central part of the forest, evergreens cover approximately 364 hectares of which Picea species account for 227 hectares. The share of deciduous forest will gradually be increased.
Maltemosen, in the northern part of the forest, is a poor fen. Typical flora include cotton-grass and wild calla as well as the carnivorous sundew and greater bladderwort. Rågårdsmosen and Sortedam on the southwest side of Kongevejeb close to Ny Hammersholt, are peat bogs.
Store Dyrehave is home to |
Sivakumar Vijayan | Career & Personal life | Saala Khadoos movie released in 2016 and became both critically acclaimed and box office hit. Even the film critic subash k jha appreciated his cinematography in Saala khadoos and mentioned him as the third hero of the film. Personal life He lives in Chennai. |
Sharath Gayakwad | Early years & 2008 & 2010 | that Sharath was the first paralympic swimmer he had coached, and that Sharath had to work a lot on maintaining equilibrium, because of his deformity. He attended Sri Bhagawan Mahaveer Jain College for high school studies, where he was given a fee concession and given encouragement for training. 2008 Sharath Gayakwad has represented India at various national and international swimming events. He won four Gold, two Silver and two Bronze at the IWAS World Games, 2008. 2010 He won a Bronze medal clocking one minute and 20.90 seconds at the 2010 Asian Para Games, Guangzhou, China. |
Smallest organisms | Obligate endosymbiotic bacteria & Pelagibacter ubique & Mycoplasma genitalium | quadripunctulatus, consists of a circular chromosome of 112,031 base pairs.
The genome of Nanoarchaeum equitans is 490,885 nucleotides long. Pelagibacter ubique Pelagibacter ubique is one of the smallest known free-living bacteria, with a length of 370 to 890 nm and an average cell diameter of 120 to 200 nm. They also have the smallest free-living bacterium genome: 1.3Mbp, 1354 protein genes, 35 RNA genes. They are one of the most common and smallest organisms in the ocean, with their total weight exceeding that of all fish in the sea. Mycoplasma genitalium Mycoplasma genitalium, a parasitic bacterium which lives in the primate |
Tadashi Sawamura | Influence | Sawamu to become a kickboxer. To which after some rigorous training, he learned a devastating finishing move: "The Jumping Vacuum Knee" (Shinku tobi hiza geri)
The Japanese name for Hitmonlee, a Pokémon character, is Sawamurā, which is a reference to Sawamura.
In Cynthia, a girl embraces a sandbag which was kicked by Tadashi Sawamura. |
Strategic bombing during World War II | The Western Front, 1939 to May 1940 & Rotterdam Blitz | RAF bombed Mönchengladbach on the evening of 11 May 1940, while Bomber Command attempted to hit roads and rail near the Dutch-German border; four people were killed. Rotterdam Blitz The Germans used the threat of bombing Rotterdam to try to get the Dutch to come to terms and surrender. After a second ultimatum had been issued by the Germans, it appeared their effort had failed and on 14 May 1940, Luftwaffe bombers were ordered to bomb Rotterdam in an effort to force the capitulation of the besieged city. The controversial bombing targeted the centre of the besieged city, instead of |
Sto Para Pente | Season 2 (2006-2007) summary & The finale | to throw them off the case. While threatening Spyro's family over the phone, Dahlia speaks up, informing the prime minister that she is part of the case, and that she can do more harm to him with her power than he can to her friends. The five decide that Dahlia confront him in person, which is something that will have a detrimental effect on him. Pavrinos commits suicide when at the same time the man in black finds the five and is prepared to kill them, the police arrives and arrests both him and his assistant. The finale In the |
Stephen Fried | Career in journalism | writes for a variety of publications.
Fried's best-known magazine piece is "Cradle to Grave", the April 1998 Philadelphia cover story that led the biggest maternal homicide case in history to be reopened and solved. In it, he investigated the family tragedy of Art and Marie Noe, a Philadelphia-area couple who lost ten infant children from 1949 through 1968 to undetermined causes. Fried explored whether the Noes might have been responsible for those deaths, and his investigation led the Philadelphia homicide unit — which had officially closed the Noe file three decades earlier — to begin reexamining the deaths. One day after |
Stuffed bitter melon soup | Ingredients | are pork or fish, along with some condiments, such as, soy sauce, pepper, or salt. |
Strategic bombing during World War II | Japanese bombing & Italian bombing | on the neutral United States at Pearl Harbor and Oahu on 7 December 1941, resulting in almost 2,500 fatalities and plunging America into World War II the next day. There were also air raids on the Philippines and northern Australia (Bombing of Darwin, 19 February 1942). Italian bombing In 1940 and 1941, the Regia Aeronautica, seeking to disrupt Allied oil supplies, struck British targets in the Middle East, mainly using the CANT Z.1007 and Savoia-Marchetti SM.82 bombers. For a year starting in June 1940, Italian bombers attacked Mandatory Palestine, mainly targeting Haifa and Tel Aviv for their large refineries and |
Shell jewelry | null | Shell jewelry Shell jewelry is jewelry that is primarily made from seashells, the shells of marine mollusks. Shell jewelry is a type of shellcraft. One very common form of shell jewelry is necklaces that are composed of large numbers of beads, where each individual bead is the whole (but often drilled) shell of a small sea snail. Numerous other varieties of shell jewelry are made, including bracelets and earrings.
As well as sea snail shells, shell jewelry also sometimes uses the shells of clams (bivalves) and tusk shells (scaphopods). Occasionally shell jewelry is made from the shells of non-marine mollusks such |
Society of Architectural Historians of Great Britain | Purpose & History | society. It is published each autumn and members of SAHBG receive a copy. There is also a newsletter for members. History The foundation of the Society was prompted in 1955 by Turpin Bannister in discussion with Frank Jenkins, a British architect and scholar who worked with Bannister at the University of Illinois in the United States. Initially it was conceived as being a chapter of the American Society of Architectural Historians partly because Bannister had been a founder-member in 1940. However, it was decided in 1956 that the Society should be independent. The early members were mainly architects and teachers. |
Sto Para Pente | The finale | to Fotis' vain cousin Frida who, after revealing all the information about the murders and the economic scandals, becomes a celebrity overnight, rocketing "teleBOAS" ratings from 0.03% to 96%. The rest of the finale deals with the personal lives of the five heroes, focusing on the "goodbyes" each of them had to say. These scenes were filled with bittersweet and rather sentimental moments which were received with controversial reactions by the viewers, who were used to the light-hearted comedy style of the series (which, however, was not being dramatic and sentimental for the first time, as it had also had |
Strategic bombing during World War II | Legal considerations | and Japanese cities were the results not of reprisal but of deliberate policy, and bore witness that aerial bombardment of cities and factories has become a recognized part of modern warfare as carried out by all nations.
Article 25 of the 1899 and 1907 Hague Conventions on Land Warfare also did not provide a clear guideline on the extent to which civilians may be spared; the same can be held for naval forces. Consequently, cyclical arguments, such as those advanced by Italian general and air power theorist Giulio Douhet, do not appear to violate any of the Convention's provisions. Due to |
Sergeant Deadhead | Production & Reception | bit here" and Keaton would come up with something on his own and show it to the director.
Before the film came out, plans for a sequel were announced - Sergeant Deadhead Goes to Mars, meant to start 13 April 1966. Reception AIP made the film hoping that military comedies would provide them with a genre as popular as the beach party movies but it proved a commercial disappointment, Samuel Z Arkoff claiming it "bombed out". Norman Taurog's biographer claimed the film managed to recoup its costs and make a small profit for the studio. |
Sultan bin Abdulaziz Al Saud | Early experience | then Riyadh governor or emir, Prince Nasser. In 1947, Prince Sultan replaced Prince Nasser as governor of Riyadh. Prince Sultan also assisted King Abdulaziz's attempts to establish a national administrative system based on the Islamic Sharia law during this period. In 1947, Prince Sultan oversaw ARAMCO's construction of the Kingdom's rail link between Dammam and Riyadh. He was appointed as the kingdom’s first minister of agriculture in 1953 and minister of transport in 1955.
Although his direct military experience was brief, heading the Royal Guard in Riyadh in the early 1950s, he felt a lifelong connection to the military and the |
Startling Stories | Merwin and after | Standard Magazines stable was Captain Future, which had been launched a year after Startling, and featured the adventures of the superhero after whom the magazine was named. When it folded with its Spring 1944 issue, the series of novels was continued for some time in the pages of Startling; over the next six years ten more "Captain Future" novels appeared, with the last one, Birthplace of Creation, printed in the May 1951 issue.
Merwin's successor, Mines, also published some excellent work, though increased competition in the early 1950s from Galaxy and The Magazine of Fantasy & Science Fiction did lead |
Soul Rocker | El Poder del Norte (2005–2012) | El Poder del Norte' became a trio as they added former rival Tigre Cota to their group. At some point in 2009 Rio Bravo quit AAA, but since he was masked AAA opted to give another wrestler the Rio Bravo mask and name, presenting it as if it was the same person under the mask. The trio lost to Real Fuerza Aerea ("The Royal Air Force"; Argenis, Atomic Boy and Laredo Kid) at AAA's Héroes Inmortales III show. Santana and Cota would win the AAA Northern Tag Team Championship on March 7, 2010, which was the last recorded championship match. |
Startling Stories | Merwin and after | to some dilution of quality, and Startling's rates—one to two cents per word—could not compete with the leading magazines. However, Startling's editorial policy was more eclectic: it did not limit itself to one kind of story, but printed everything from melodramatic space opera to sociological sf, and Mines had a reputation as having "the most catholic tastes and the fewest inhibitions" of any of the science fiction magazine editors. In late 1952, Mines published Philip José Farmer's "The Lovers", a taboo-breaking story about aliens who can reproduce only by mating with humans. Illustrated with an eye-popping cover |
Sweetness of wine | Süssreserve & Austria | Spätlese, but more rarely for Auslese and upward.
The use of Süssreserve gives a different composition of sugars in the wine in comparison to arrested fermentation. Grape must contains mainly the sugars glucose and fructose. When wine ferments, glucose is fermented at a faster rate than fructose. Thus, arresting fermentation when a significant portions of the sugars have fermented gives a wine where the residual sugar consists mainly of fructose, while the use of Süssreserve will give a wine where the sweetness comes from a mixture of glucose and fructose. Austria In Austria, the Klosterneuburger Mostwaage (KMW) scale is used. The |
TS Pretoria | Pre-war & World War II | from Bremen, Germany to Hekla's aid. World War II In November 1939, Pretoria was requisitioned by the Kriegsmarine and used as a U-boat depot ship. Initially based at Kiel, Schleswig-Holstein, she served the 1st U-boat Flotilla, based at Neustadt, Hamburg, from January 1940. In December she was transferred to 21st U-boat Flotilla, based at Pillau, East Prussia. In 1945, she was converted to a hospital ship. Pretoria assisted in the evacuation of German civilians from the Eastern Territories towards the end of the war. In May 1945 she was in Copenhagen when Denmark was liberated, and UK forces captured |
Tacoma Narrows Bridge (1950) | Design | campus in Seattle. The facility was large enough to house a scale model of the completed bridge as long as 100 feet (30 m), plus section models for further testing. After Farquharson confirmed that Gertie collapsed due to its excessive flexibility and the aerodynamic forces as a result of the flexibility in its span, testing was then done on designs drawn by Smith. All of the new designs would feature a deep open stiffening truss instead of a solid plate girder.
Testing on the new bridge design was begun in November 1943 and continued through 1945. The studies included 200 different configurations, |
River Brun | Course | River Brun Course Thought to begin at the confluence of Hurstwood Brook (draining Wether Edge, Hameldon and supplying the Hurstwood Reservoir) and Rock Water at Foxstones Bridge near the village of Hurstwood, the river runs northwest towards the town of Burnley. Rock Water only begins a sort distance to the southeast, where Cant Clough Beck (from that reservoir) meets Shedden Clough.
Heading northwest, the river passes Omerod, the Hollins, the hamlet of Brownside and through the Rowley Lake near Rowley Hall before collecting Swinden Water and then the River Don at Netherwood Bridge and turning west. Entering Burnley at Heasandford, the |
Sivakumar Vijayan | Early life and education & Career | Sivakumar Vijayan Early life and education Sivakumar Vijayan was born in Chennai to a middle-class Tamil family and grew up in Chennai and Kolkata. He is an electronics engineer from Madras University and pursued a master's in Media and Entertainment business administration. His passion for film photography started during his college days and after completing his engineering he joined Satyajit Ray Film and Television Institute, Kolkata specialising in Motion picture photography(cinematography). His first independent film as a cinematographer was Vidiyum Munn (2013). Career After graduating from Satyajit Ray Film and Television Institute (SRFTI), he assisted cinematographer P. C. Sreeram in |
Simon Tunsted | Works | Simon Tunsted Works Tunsted wrote a commentary on the Meteorologica of Aristotle and improved the calculating device described by Richard of Wallingford in Tractatus Albionis. He is also usually credited as the author of the Quatuor Principalia Musicae, a mediaeval treatise on music which set out the musical principles on which the Ars nova movement was based. |
Tancredo Neves | Politician, Mineiro-style | whom he remained grateful. In 1984, when asked about the political parties he belonged to by the newspaper Pasquim, he explained that he had chosen his parties, like everyone from Minas Gerais did, according to municipal issues.
He joined the Progressive Party (PP) of Minas Gerais, party which was formed by members of the “Mineiro Republican Party”, who supported the Revolution in 1930. Later, when the “Progressive Party” was extinct, he joined the “Mineiro Nationalist Party”.
Tancredo was not able to finance his candidacy as state representative in 1934, but he was elected São João del Rei's city councilman in 1935 and |
Sohan Lal Bhatia | Biography | New Year Honours list. |
Scarlett Raven | Augmentism | was the first to encourage Raven to develop the initial concept further and explore the idea of using Augmented Reality in her paintings. Since adopting the process people can now stand in front of Raven's paintings and use technology to interact with the physical canvas.
Raven embeds a number of inputs into the artwork, at first physically with paint, then digitally using a variety of techniques. The full experience of the paintings can then be unlocked by using the Blippar app. To produce an Augmented Reality painting it takes tens of thousands of images, overlaid and layered.
Creating an Augmented Reality painting |
Tancredo Neves | The democratization of Brazil - Tancredo state legislator, and federal minister | Constituent Assembly was over, he assumed leadership of the Social Democratic Party workbench and led the opposition to Milton Campos' government. Milton Campos was part of the National Democratic Union (UDN), which had reached the "Liberty Palace" after a split in the PSD of Minas Gerais. Due to a fire in the building of the old "Legislative Assembly of Minas Gerais", very few documents of that Constituent Assembly were left intact.
He was elected congressman in 1950, and Juscelino Kubitschek was elected Governor of Minas Gerais, defeating situationist Gabriel Passos. In 1953, Juscelino and Getúlio agreed to appoint Tancredo Neves minister |
Sweetness of wine | History | was advocated by Virgil and Martial in Roman times. In contrast, the ancient Greeks would harvest the grapes early, to preserve some of their acidity, and then leave them in the sun for a few days to allow them to shrivel and concentrate the sugar. In Crete, a similar effect was achieved by twisting the stalks of the grape to deprive them of sap and letting them dry on the vine—a method that produced passum and the modern Italian equivalent, passito.
Stopping the fermentation also enhanced a wine's potential sweetness. In ancient times, this was achieved by submerging the amphorae in |
Stokvel | null | Stokvel Stokvels are invitation-only clubs of twelve or more people serving as rotating credit unions or saving schemes in South Africa where members contribute fixed sums of money to a central fund on a weekly, fortnightly or monthly basis. The name “stokvel” originated from the term “stock fairs”, as the rotating cattle auctions of English settlers
in the Eastern Cape during the early 19th century were known.
Stokvels generally have a constitution which dictates the size of the contributions, when the accumulated money is to be paid out and the roles and responsibilities of the members. Each month a different member |
Sto Para Pente | Season 2 (2006-2007) summary | the five come out of the coma, they do not remember the near-death experience. Their relatives decide to split them up in order to keep them safe and out of trouble, hoping that after a while the situation will cool off and they will give up on their investigations. Eventually they are allowed to go and see a movie together, but while there they bump into Delikaris's secretary who reveals to them the name of the fifth murderer. He is called Dimitris or Takis for short. She also provides them with another clue: the murdered girl from Thessaloniki had a |
Sydney 2000 (video game) | Gameplay | by running against other athletes at the same level. Although it's possible to compete in the Olympics as soon as the athlete reaches the Olympic Class, to get a perfect athlete (with 100% on all ratings) one must complete all minigames, including those on Olympic Class. As the game relies mostly on athletes' ratings, even players with lower button presses per minute can make World Record times without serious effort as long as they passed all the mini games. Other modes include an arcade mode, training and head to head, where two players can compete with their Olympic mode trained |
Subgenomic mRNA | Result & Examples | Set - indicates jumps. Examples This complex method of transcription is generally restricted to viruses, especially those of the single-stranded, positive-sense RNA or Class IV viruses using the Baltimore Classification System, e.g. viruses of the order Nidovirales.
It is primarily used for compacting more genetic information into a shorter amount of genetic material. |
St Chad's Church, Claughton | Architecture & External features | is said to be inscribed with the date 1296, making it the oldest bell in England. The other bell is dated 1727. Inside the church is a Perpendicular-style arcade dating from 1904, consisting of three semi-circular arches carried on round piers. The baluster font dates from the 18th or early 19th century. External features In the churchyard to the south of the church is a medieval sandstone cross base with an empty socket. It is listed at Grade II. |
Roscommon | History | Roscommon History Roscommon was the homeland of the Connachta dynasty, and included such kingdoms as Uí Maine, Delbhna Nuadat, Síol Muirdeach, and Moylurg. In addition, it contained areas known as Trícha cét's, Túath and is the homeland of surnames such as Ó Conchobhair (O'Conor, O'Connor), Mac Diarmada (McDermott), Ó Ceallaigh (Kelly), Ó Birn (Beirne, Byrne, Burns), Mac Donnchadha (McDonough) and Brennan (Mac Branáin and Ó Branáin).
The town is the location of a notable archaeological find in 1945 when a lunula, a gold necklace, and two discs were discovered. Both items are dated to the period 2300 and 1800 BC. |
Sultan bin Abdulaziz Al Saud | Morocco vacation | then convalesced at Agadir, Morocco. He went back to Saudi Arabia, but soon returned to Morocco in August 2009. During his vacation, the Saudi cabinet increased officer salaries, a traditional domain of Sultan.
In 2009, King Abdullah took charge of all defense purchases and reduced the power of the Defense Ministry. In October 2010, Abdullah personally conducted much of the negotiations for the U.S. arms package worth over $60 billion.
In November 2010, Sultan received Lebanese Prime Minister Saad Al-Hariri to discuss the future of Lebanon's government. He had been receiving treatment since 2009 for what analysts and diplomats believed to be cancer. |
SS Norlom | SS Norlom | where she departed on 11 September as a member of Convoy BX 73, which arrived at Halifax on 13 September. Norlom was a member of Convoy SC 142, which departed from Halifax on 15 September and arrived at Liverpool on 29 September, although Norlom did not arrive until 30 September.
Carrying a cargo of coal and lorries, Norlom departed from Liverpool on 27 October as a member of Convoy OS57 km, which split at sea on 9 November. Convoy OS 57 arrived at Freetown, Sierra Leone on 27 October. She was in the part of the convoy which formed Convoy KMS 31 |
Skirmish at Waters Creek | Background | Skirmish at Waters Creek Background The state of Virginia had not been the scene of significant military activity for most of the American Revolutionary War. This began to change with the arrival in October 1780 of 2,500 British Army troops under Brigadier General Alexander Leslie. These troops established a fortified position at Portsmouth, and began raiding the area for supplies. However, they were ordered to abandon the post by Lieutenant General Charles, Earl Cornwallis in November. In January 1781 another 1,600 troops, this time under the command of the traitor Benedict Arnold, arrived in Virginia. |
Sebastián Soria | Lekhwiya & Al Rayyan & International career | continental club competition during the AFC Champions League format. Al Rayyan Soria joined Al-Rayyan SC on a one-year deal in 2015. International career Soria was born and raised in Paysandú, but moved to Qatar early in his footballing career and became a naturalized citizen. He won a gold medal in the 2006 Asian Games for the Qatar U-23 team. The official Qatar SC website has him listed as being born in 1984. In addition, QFA's website lists his actual date of birth as 1983.
Soria saved the Qatari national team by scoring in the last 20 minutes, which helped tie the |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.