serial_no
int64
1
24.2k
cuda_source
stringlengths
11
9.01M
401
__global__ void CuKnlSetField( double xCells, double yCells, double* energy0, double* energy1) { const int gid = threadIdx.x+blockIdx.x*blockDim.x; energy1[gid] = energy0[gid]; }
402
#include "probe.cuh" Probe::Probe(ProbeConfig cfg) : chan_indices_(cfg.n_active()), site_labels(cfg.n_active()), chan_grps(cfg.n_active()), x_coords(cfg.n_active()), y_coords(cfg.n_active()), is_active_(cfg.n_total), site_dists(cfg.n_active()) { n_total_ = cfg.n_total; if (n_total_ < cfg.n_active()) { throw std::domain_error( "Number of active channels cannot exceed total number of channels."); } if (cfg.srate_hz <= 0.0) { throw std::domain_error("Sample rate must be positive."); } srate_hz_ = cfg.srate_hz; unsigned k = 0; // nested for loop go brr for (const auto &channel_group : cfg.channel_groups) { const ChannelGroup grp = channel_group.second; for (auto j = 0; j < grp.n_channels(); ++j) { chan_indices_.at(k) = grp.channels.at(j); site_labels.at(k) = grp.site_labels.at(j); x_coords.at(k) = grp.x_coords.at(j); y_coords.at(k) = grp.y_coords.at(j); chan_grps[k++] = channel_group.first; } } SortChannels(); EnsureUnique(); FindInactive(); } /** * @brief Create the matrix of distances between channels on the probe. */ void Probe::MakeDistanceMatrix() { if (dist_mat_complete || site_dists.n_cols() != n_active()) return; for (unsigned i = 0; i < n_active(); ++i) { for (unsigned j = i + 1; j < n_active(); ++j) { auto dx = x_coords.at(i) - x_coords.at(j), dy = y_coords.at(i) - y_coords.at(j); site_dists.set_at(i, j, (float) std::hypot(dx, dy)); } } dist_mat_complete = true; } /** * @brief * @param site_idx * @param n_neighbors * @return Site indices of nearest neighbors to `site_idx` (including * `site_idx`). */ std::vector<uint32_t> Probe::NearestNeighbors(uint32_t site_idx, uint32_t n_neighbors) { MakeDistanceMatrix(); return site_dists.closest(site_idx, n_neighbors); } /** * @brief Get the channel index value of the site at `site_idx`. * @param site_idx Index of the site. * @return The channel index value of the site at `site_idx`. */ unsigned Probe::chan_index(unsigned site_idx) const { if (site_idx >= n_active()) { throw std::length_error("Index exceeds array dimensions."); } return chan_indices_.at(site_idx); } /** * @brief Get the site index value of the channel at `chan_idx`. * @param chan_idx Index of the channel. * @return The site index value of the channel at `chan_idx`. */ unsigned Probe::site_index(uint32_t chan_idx) const { auto idx = 0; for (auto it = is_active_.begin(); it < is_active_.begin() + chan_idx; ++it) { idx += *it; } return idx; } /** * @brief Get the label of the ith site. * @param site_idx Index of the site. * @return The ith site label. */ unsigned Probe::label_at(unsigned site_idx) const { if (site_idx >= n_active()) { throw std::length_error("Index exceeds array dimensions."); } return site_labels.at(site_idx); } /** * @brief Get the channel group label of the ith site. * @param site_idx Index of the site. * @return The channel group label of the ith site. */ unsigned Probe::group_at(unsigned site_idx) const { if (site_idx >= n_active()) { throw std::length_error("Index exceeds array dimensions."); } return chan_grps.at(site_idx); } /** * @brief Returns the x coordinate of the ith site. * @param site_idx Index of the site. * @return The x coordinate of the ith site. */ double Probe::x_at(unsigned site_idx) const { if (site_idx > n_active()) { throw std::length_error("Index exceeds array dimensions."); } return x_coords.at(site_idx); } /** * @brief Returns the y coordinate of the ith site. * @param site_idx Index of the site. * @return The y coordinate of the ith site. */ double Probe::y_at(unsigned site_idx) const { if (site_idx > n_active()) { throw std::length_error("Index exceeds array dimensions."); } return y_coords.at(site_idx); } /** * @brief Get the distance between the ith and jth sites. * @param left Site index. * @param right Site index. * @return Distance between left and right. */ float Probe::dist_between(uint32_t left, uint32_t right) { MakeDistanceMatrix(); return site_dists.at(left, right); } /** * @brief Sort site-indexed values by corresponding channel in ascending order. */ void Probe::SortChannels() { if (n_active() == 0) return; // get indices that would sort chan_indices_ auto as = utilities::argsort(chan_indices_); if (std::is_sorted(as.begin(), as.end())) { // nothing to do! return; } std::vector<unsigned> tmp_buf_s(n_active()); std::vector<double> tmp_buf_d(n_active()); // reorder chan_indices_, x_coords for (auto i = 0; i < as.size(); ++i) { tmp_buf_s.at(i) = chan_indices_.at(as.at(i)); tmp_buf_d.at(i) = x_coords.at(as.at(i)); } chan_indices_.assign(tmp_buf_s.begin(), tmp_buf_s.end()); x_coords.assign(tmp_buf_d.begin(), tmp_buf_d.end()); // reorder site_labels, y_coords for (auto i = 0; i < as.size(); ++i) { tmp_buf_s.at(i) = site_labels[as.at(i)]; tmp_buf_d.at(i) = y_coords[as.at(i)]; } site_labels.assign(tmp_buf_s.begin(), tmp_buf_s.end()); y_coords.assign(tmp_buf_d.begin(), tmp_buf_d.end()); // reorder chan_grps for (auto i = 0; i < as.size(); ++i) { tmp_buf_s.at(i) = chan_grps[as.at(i)]; } chan_grps.assign(tmp_buf_s.begin(), tmp_buf_s.end()); } /** * @brief Check that channel indices and site labels are unique, throwing an * error if this is not the case. */ void Probe::EnsureUnique() { // ensure all channel indices are unique unsigned ct; for (auto it = chan_indices_.begin(); it != chan_indices_.end(); ++it) { ct = std::count(it, chan_indices_.end(), *(it)); if (ct > 1) { throw std::domain_error("Channel indices are not unique."); } } for (auto it = site_labels.begin(); it != site_labels.end(); ++it) { ct = std::count(it, site_labels.end(), *(it)); if (ct > 1) { throw std::domain_error("Site labels are not unique."); } } } /** * @brief Find inactive channels and set their bits to 0 in is_active_. * * Assumes that chan_indices_ is sorted. */ void Probe::FindInactive() { for (auto i = 0; i < n_total_; ++i) { is_active_.at(i) = std::binary_search(chan_indices_.begin(), chan_indices_.end(), i); } } /** * @brief Determine whether a channel represents an active site. * @param i Channel index. * @return True iff the channel is an active site. */ bool Probe::is_active(unsigned int i) const { return is_active_.at(i); }
403
#include "includes.h" __global__ void cudaComputeSignature(double* hyperplanes, double* v, int* dimensions, bool* sig, long* hyperp_length) { long tid = threadIdx.x + blockDim.x * blockIdx.x; if (tid < *hyperp_length) { int d_dimensions = *dimensions; long pos = tid * d_dimensions; double sum = 0.0; for (int i = 0; i < d_dimensions; i++) sum += hyperplanes[i+pos] * v[i]; sig[tid] = (sum>=0); } }
404
#include "stdio.h" // printf() is only supported // for devices of compute capability 2.0 and higher #if defined(__CUDA_ARCH__) && (__CUDA_ARCH__ < 200) #define printf(f, ...) ((void)(f, __VA_ARGS__),0) #endif __global__ void helloCUDA(float f) { printf("Hello thread %d, f=%f\n", threadIdx.x, f); } int main() { helloCUDA<<<1, 5>>>(1.2345f); cudaDeviceSynchronize(); return 0; }
405
#include <cuda.h> #include <cuda_runtime.h> #include <stdio.h> #define N 1000000 __global__ void gpuAdd(int *d_a, int *d_b, int *d_c){ //总线程id = 当前块线程id.x + 块id*块维度x int tid = threadIdx.x + blockIdx.x * blockDim.x; while (tid < N) { d_c[tid] = d_a[tid] + d_b[tid];// 加法 tid += blockDim.x * gridDim.x; // 一次执行一个格子 块维度x*格子维度x } } int main(){ int *h_a, *h_b, *h_c; int *d_a0, *d_b0, *d_c0; int *d_a1, *d_b1, *d_c1; int sizeByte = N*sizeof(int)*2; //create two streams cudaStream_t stream0, stream1; cudaStreamCreate(&stream0); cudaStreamCreate(&stream1); cudaEvent_t start, stop; cudaEventCreate(&start); cudaEventCreate(&stop); cudaEventRecord(start,0); //Use cudaHostMalloc to allocate page-locked memory cudaHostAlloc(&h_a, sizeByte, cudaHostAllocDefault); cudaHostAlloc(&h_b, sizeByte, cudaHostAllocDefault); cudaHostAlloc(&h_c, sizeByte, cudaHostAllocDefault); //same as single stream, just add stream parameter when launching kernel for(int i=0;i<N*2;i++){ h_a[i] = i; h_b[i] = i; } cudaMalloc(&d_a0,sizeByte/2); cudaMalloc(&d_b0,sizeByte/2); cudaMalloc(&d_c0,sizeByte/2); cudaMalloc(&d_a1,sizeByte/2); cudaMalloc(&d_b1,sizeByte/2); cudaMalloc(&d_c1,sizeByte/2); cudaMemcpyAsync(d_a0, h_a, sizeByte/2, cudaMemcpyHostToDevice, stream0); cudaMemcpyAsync(d_a1, h_a + N, sizeByte/2, cudaMemcpyHostToDevice, stream1); cudaMemcpyAsync(d_b0, h_b, sizeByte/2, cudaMemcpyHostToDevice, stream0); cudaMemcpyAsync(d_b1, h_b + N, sizeByte/2, cudaMemcpyHostToDevice, stream1); gpuAdd<<<512,512,0,stream0>>>(d_a0,d_b0,d_c0); gpuAdd<<<512,512,0,stream1>>>(d_a1,d_b1,d_c1); cudaMemcpyAsync(h_c, d_c0, sizeByte/2, cudaMemcpyDeviceToHost, stream0); cudaMemcpyAsync(h_c+N, d_c1, sizeByte/2, cudaMemcpyDeviceToHost, stream1); //only synchronize on cpu/host cudaDeviceSynchronize(); cudaStreamSynchronize(stream0); cudaStreamSynchronize(stream1); cudaEventRecord(stop); cudaEventSynchronize(stop); float time = 0; cudaEventElapsedTime(&time, start, stop); printf("Time consumption: %lf\n", time); cudaEventDestroy(stop); cudaEventDestroy(start); int Correct = 1; int wrongIndex = -1; printf("Vector addition on GPU \n"); //Printing result on console for (int i = 0; i < 2*N; i++) { if ((h_a[i] + h_b[i] != h_c[i])) { Correct = 0; wrongIndex = i; break; } } if (Correct == 1) { printf("GPU has computed Sum Correctly\n"); } else { printf("There is an Error in GPU Computation, at index %d, CPU(%d)!=GPU(%d)\n", wrongIndex, (h_a[wrongIndex] + h_b[wrongIndex]), h_c[wrongIndex]); } // 清空GPU内存 cudaFree(d_a0); cudaFree(d_b0); cudaFree(d_c0); cudaFree(d_a0); cudaFree(d_b0); cudaFree(d_c0); // 清空cuda分配的cpu内存 cudaFreeHost(h_a); cudaFreeHost(h_b); cudaFreeHost(h_c); return 0; }
406
#include "cuda_runtime.h" #include "device_launch_parameters.h" #include <climits> #include <fstream> #include <iostream> #include <string> #include <vector> #include <chrono> #define gpuErrchk(ans) { gpuAssert((ans), __FILE__, __LINE__); } inline void gpuAssert(cudaError_t code, const char *file, int line, bool abort = true) { if (code != cudaSuccess) { fprintf(stderr, "GPUassert: %s %s %d\n", cudaGetErrorString(code), file, line); if (abort) exit(code); } } // Struct containing edge outputs computed in parallel // One produced per thread, aggregated after GPU computation struct EDGE_OUTPUT { // 3-node graphlet counts unsigned long long g31; unsigned long long g32; unsigned long long g33; // 4-node cliques and cycles unsigned long long g41; unsigned long long g44; // Unrestricted counts for 4-node connected graphlets unsigned long long T_T; unsigned long long Su_Sv; unsigned long long T_SuVSv; unsigned long long S_S; // Unrestricted counts for 4-node disconnected graphlets unsigned long long T_I; unsigned long long SuVSv_I; unsigned long long I_I; unsigned long long I_I_1; }; struct GRAPHLET_COUNTS { // 3-node graphlet counts unsigned long long g31; unsigned long long g32; unsigned long long g33; unsigned long long g34; // 4-node connected graphlet counts unsigned long long g41; unsigned long long g42; unsigned long long g43; unsigned long long g44; unsigned long long g45; unsigned long long g46; // 4-node disconnected graphlet counts unsigned long long g47; unsigned long long g48; unsigned long long g49; unsigned long long g410; unsigned long long g411; }; // CUDA kernel used to count graphlets of size k=4 // Each thread processes a single edge __global__ void graphlets(int* V, unsigned long long V_num, int* E, unsigned long long E_num, int* E_u, int* E_v, EDGE_OUTPUT* outputs) { // Calculate global thread index in 1D grid of 1D blocks // Used as the undirected edge number to compute int edge = (blockIdx.y * gridDim.x + blockIdx.x) * blockDim.x + threadIdx.x; // Return immediately if thread index is greater than maximum edge index if (edge >= E_num) return; // Using thread number, look up directed edge number in array of undirected edges int ei = E[edge]; // Lookup the endpoints of the current edge // TODO: Dynamically choose u to be the node with smallest neighborhood int u = E_u[ei]; int v = E_v[ei]; // Array length is 1 less because v is omitted int arr_len = V[u + 1] - V[u] - 1; // Array holding current index of edges in E_v of each of u's neighbors int* inds = new int[arr_len]; // Array holding maximum index of edges in E_v of each of u's neighbors int* ends = new int[arr_len]; // Array indicating whether each of u's neighbors neighbors v bool* neighbors_v = new bool[arr_len]; // To count graphlets, nodes are advanced in ascending order concurrently across u, v, // and all of u's neighbors. Through this walk, counts can be gathered by checking // which nodes have identical neighbors after each step int tri_e = 0, star_u = 0, star_v = 0; int iu = V[u], iv = V[v], arr_i = 0; while (iu < V[u + 1] || iv < V[v + 1]) { int cu = iu < V[u + 1] ? E_v[iu] : INT_MAX; int cv = iv < V[v + 1] ? E_v[iv] : INT_MAX; if (cu < cv) { if (cu != v) { // A star with u is found when the current node in the walk is a neighbor of u // but not a neighbor of v star_u++; inds[arr_i] = V[cu]; ends[arr_i] = V[cu + 1]; neighbors_v[arr_i] = false; arr_i++; } iu++; } else if (cv < cu) { if (cv != u) { // A star with v is found when the current node in the walk is a neighbor of v // but not a neighbor of u star_v++; } iv++; } else { // A triangle is found when the current node in the walk is both a neighbor of // u and a neighbor of v tri_e++; inds[arr_i] = V[cu]; ends[arr_i] = V[cu + 1]; neighbors_v[arr_i] = true; arr_i++; iu++; iv++; } } int cliq_e = 0, cyc_e = 0; iu = V[u]; iv = V[v]; while (iu < V[u + 1] || iv < V[v + 1]) { int cu = iu < V[u + 1] ? E_v[iu] : INT_MAX; int cv = iv < V[v + 1] ? E_v[iv] : INT_MAX; // Cycles and cliques can only occur when current node is in N(v) \ {u} if (cv <= cu && cv != u) { for (int arr_i = 0; arr_i < arr_len; arr_i++) { // Before checking for cliques or cycles, the edge index is advanced to the current // location in the walk while (inds[arr_i] < ends[arr_i] && E_v[inds[arr_i]] < cv) { inds[arr_i]++; } // If u's neighbor neighbors v's neighbor, a clique or cycle may be found if (inds[arr_i] < ends[arr_i] && E_v[inds[arr_i]] == cv) { if (cu == cv && neighbors_v[arr_i]) { // If u's neighbor and v's neighbor form triangles with e, a clique is found cliq_e++; } else if (cu != cv && !neighbors_v[arr_i]) { // If neither u's neighbor or v's neighbor form triangles with e, a cycle is found cyc_e++; } } } } if (cu <= cv) iu++; if (cv <= cu) iv++; } delete(inds); delete(ends); delete(neighbors_v); // 3-node graphlet and 4-node unrestricted counts calculated as described // in http://nesreenahmed.com/publications/ahmed-et-al-icdm2015.pdf outputs[edge].g31 = tri_e; outputs[edge].g32 = star_u + star_v; outputs[edge].g33 = V_num - (tri_e + star_u + star_v + 2); outputs[edge].g41 = cliq_e / 2; outputs[edge].g44 = cyc_e; outputs[edge].T_T = (tri_e * (tri_e - 1)) / 2; outputs[edge].Su_Sv = star_u * star_v; outputs[edge].T_SuVSv = tri_e * (star_u + star_v); outputs[edge].S_S = ((star_u * (star_u - 1)) / 2) + ((star_v * (star_v - 1)) / 2); outputs[edge].T_I = tri_e * outputs[edge].g33; outputs[edge].SuVSv_I = (star_u + star_v) * outputs[edge].g33; outputs[edge].I_I = (outputs[edge].g33 * (outputs[edge].g33 - 1)) / 2; outputs[edge].I_I_1 = E_num - (V[u + 1] - V[u] - 1) - (V[v + 1] - V[v] - 1) - 1; } int main(int argc, char *argv[]) { if (argc != 3) { std::cout << "usage: " << argv[0] << " <input_file> <block_size>" << std::endl; return EXIT_FAILURE; } // Number of threads in each block // Should be a multiple of GPU warp size (32 in recent architectures) int blocksize = atoi(argv[2]); // Nested vector used to store read file into adjacency list std::vector< std::vector<int> > adj_list; // Input network file provided by user // File format assume to be edge list std::ifstream infile(argv[1]); std::string su, sv; int u, v, edge_count = 0, max = -1; while (getline(infile, su, '\t') && getline(infile, sv)) { // Node ids assumed to be 1-indexed and decremented to be 0-indexed u = std::atoi(su.c_str()) - 1; v = std::atoi(sv.c_str()) - 1; // Dynamically add empty vectors as nodes are found in edge list int new_max = u > v ? u : v; if (new_max > max) { for (int i = max + 1; i <= new_max; i++) { adj_list.push_back(std::vector<int>(0)); } max = new_max; } // Add both directions of edge to adjacency list adj_list[u].push_back(v); adj_list[v].push_back(u); edge_count++; } int V_num = adj_list.size(); int E_num = edge_count; std::cout << "Graph found with " << V_num << " nodes and " << E_num << " edges" << std::endl; // Value of V[i] is index of E_u and E_v where vertex i's edges begin // Value of V[i+1] is index of E_u and E_v where vertex i's edges end std::vector<int> V; // Value of E[i] is the directed edge index in E_u and E_v associated with // the undirected edge at index i in E std::vector<int> E; // Value of E_u[i] is the source vertex id (as used in V) associated with edge i std::vector<int> E_u; // Value of E_v[i] is the destination vertex id of edge i std::vector<int> E_v; V.reserve(V_num + 1); E.reserve(E_num); E_u.reserve(E_num * 2); E_v.reserve(E_num * 2); // Build V, E_u, and E_v from adjacency list representation int edge_index = 0; for (int i = 0; i < (int) adj_list.size(); i++) { V.push_back(edge_index); for (int j = 0; j < (int) adj_list[i].size(); j++) { E_u.push_back(i); E_v.push_back(adj_list[i][j]); if (i < adj_list[i][j]) { E.push_back(E_u.size() - 1); } } edge_index += adj_list[i].size(); } V.push_back(edge_index); int max_degree = 0; for (int i = 1; i < (int) E.size(); i++) { int degree = E[i] - E[i - 1]; if (degree > max_degree) { max_degree = degree; } } // Create and initialize CUDA thread output structs std::vector<EDGE_OUTPUT> outputs(E_num); outputs.resize(E_num); // Pointers of V, E_u, E_v, and edge outputs in GPU memory int* V_ptr; int* E_ptr; int* E_u_ptr; int* E_v_ptr; EDGE_OUTPUT* outputs_ptr; int V_size = (V_num + 1) * sizeof(int); int E_size = E_num * sizeof(int); int outputs_size = E_num * sizeof(EDGE_OUTPUT); std::chrono::steady_clock::time_point begin = std::chrono::steady_clock::now(); // Malloc GPU memory and store location in pointers gpuErrchk(cudaMalloc((void**)&V_ptr, V_size)); gpuErrchk(cudaMalloc((void**)&E_ptr, E_size)); gpuErrchk(cudaMalloc((void**)&E_u_ptr, E_size * 2)); gpuErrchk(cudaMalloc((void**)&E_v_ptr, E_size * 2)); gpuErrchk(cudaMalloc((void**)&outputs_ptr, outputs_size)); cudaDeviceSynchronize(); std::chrono::steady_clock::time_point malloc_end = std::chrono::steady_clock::now(); // Copy data structures from main memory to allocated GPU memory gpuErrchk(cudaMemcpy(V_ptr, V.data(), V_size, cudaMemcpyHostToDevice)); gpuErrchk(cudaMemcpy(E_ptr, E.data(), E_size, cudaMemcpyHostToDevice)); gpuErrchk(cudaMemcpy(E_u_ptr, E_u.data(), E_size * 2, cudaMemcpyHostToDevice)); gpuErrchk(cudaMemcpy(E_v_ptr, E_v.data(), E_size * 2, cudaMemcpyHostToDevice)); gpuErrchk(cudaMemcpy(outputs_ptr, outputs.data(), outputs_size, cudaMemcpyHostToDevice)); cudaDeviceSynchronize(); std::chrono::steady_clock::time_point memcpy_input_end = std::chrono::steady_clock::now(); // Calculate number of blocks in CUDA grid based upon number of edges in graph int gridsize = E_num / blocksize; int gridlength = 1; if (E_num % blocksize > 0) { gridsize++; if (gridsize > 65535) { gridsize -= 65535; gridlength++; } } if (gridlength > 1) { gridsize = 65535; } // Create one-dimensional blocks and grids based upon blocksize and gridsize // TODO: Increase dimensionality in order to support larger networks dim3 dimBlock(blocksize, 1); dim3 dimGrid(gridsize, gridlength); int heap_size = (2 * sizeof(int) + sizeof(bool)) * max_degree * E_num; gpuErrchk(cudaDeviceSetLimit(cudaLimitMallocHeapSize, heap_size)); cudaDeviceSynchronize(); std::chrono::steady_clock::time_point kernel_begin = std::chrono::steady_clock::now(); // Execute CUDA kernel // TODO: Add timing to kernel execution and count aggregation below graphlets<<<dimGrid, dimBlock>>>(V_ptr, V_num, E_ptr, E_num, E_u_ptr, E_v_ptr, outputs_ptr); gpuErrchk(cudaGetLastError()); cudaDeviceSynchronize(); std::chrono::steady_clock::time_point kernel_end = std::chrono::steady_clock::now(); // Copy output data from GPU memory back into main memory gpuErrchk(cudaMemcpy(outputs.data(), outputs_ptr, outputs_size, cudaMemcpyDeviceToHost)); cudaDeviceSynchronize(); std::chrono::steady_clock::time_point memcpy_output_end = std::chrono::steady_clock::now(); // Free memory in GPU gpuErrchk(cudaFree(V_ptr)); gpuErrchk(cudaFree(E_ptr)); gpuErrchk(cudaFree(E_u_ptr)); gpuErrchk(cudaFree(E_v_ptr)); gpuErrchk(cudaFree(outputs_ptr)); cudaDeviceSynchronize(); std::chrono::steady_clock::time_point free_end = std::chrono::steady_clock::now(); // Compute aggregate outputs based upon individual edge outputs EDGE_OUTPUT aggregates = { 0 }; for (int i = 0; i < E_num; i++) { aggregates.g31 += outputs[i].g31; aggregates.g32 += outputs[i].g32; aggregates.g33 += outputs[i].g33; aggregates.g41 += outputs[i].g41; aggregates.g44 += outputs[i].g44; aggregates.T_T += outputs[i].T_T; aggregates.Su_Sv += outputs[i].Su_Sv; aggregates.T_SuVSv += outputs[i].T_SuVSv; aggregates.S_S += outputs[i].S_S; aggregates.T_I += outputs[i].T_I; aggregates.SuVSv_I += outputs[i].SuVSv_I; aggregates.I_I += outputs[i].I_I; aggregates.I_I_1 += outputs[i].I_I_1; } // 3-nodeand 4-node graphlet counts calculated as described // in http://nesreenahmed.com/publications/ahmed-et-al-icdm2015.pdf GRAPHLET_COUNTS counts = { 0 }; counts.g31 = aggregates.g31 / 3; counts.g32 = aggregates.g32 / 2; counts.g33 = aggregates.g33; counts.g34 = ((V_num * (V_num - 1) * (V_num - 2)) / (3 * 2)) - counts.g31 - counts.g32 - counts.g33; counts.g41 = aggregates.g41 / 6; counts.g42 = aggregates.T_T - 6 * counts.g41; counts.g43 = (aggregates.T_SuVSv - 4 * counts.g42) / 2; counts.g44 = aggregates.g44 / 4; counts.g45 = (aggregates.S_S - counts.g43) / 3; counts.g46 = aggregates.Su_Sv - 4 * counts.g44; counts.g47 = (aggregates.T_I - counts.g43) / 3; counts.g48 = (aggregates.SuVSv_I - 2 * counts.g46) / 2; counts.g49 = (aggregates.I_I_1 - (6 * counts.g41) - (4 * counts.g42) - (2 * counts.g43) - (4 * counts.g44) - (2 * counts.g46)) / 2; counts.g410 = aggregates.I_I - 2 * counts.g49; counts.g411 = ((V_num * (V_num - 1) * (V_num - 2) * (V_num - 3)) / (4 * 3 * 2)) - counts.g41 - counts.g42 - counts.g43 - counts.g44 - counts.g45 - counts.g46 - counts.g47 - counts.g48 - counts.g49 - counts.g410; std::chrono::steady_clock::time_point end = std::chrono::steady_clock::now(); std::cout << std::endl; std::cout << " Graphlet Counts" << std::endl; std::cout << "===========================" << std::endl; std::cout << std::endl; std::cout << "k=4 Connected Graphlets" << std::endl; std::cout << "---------------------------" << std::endl; std::cout << "4-clique (g41) : " << counts.g41 << std::endl; std::cout << "4-chordalcycle (g42) : " << counts.g42 << std::endl; std::cout << "4-tailedtriangle (g43) : " << counts.g43 << std::endl; std::cout << "4-cycle (g44) : " << counts.g44 << std::endl; std::cout << "3-star (g45) : " << counts.g45 << std::endl; std::cout << "4-path (g46) : " << counts.g46 << std::endl; std::cout << std::endl; std::cout << "k=4 Disconnected Graphlets" << std::endl; std::cout << "---------------------------" << std::endl; std::cout << "4-node-1-triangle (g47) : " << counts.g47 << std::endl; std::cout << "4-node-2-star (g48) : " << counts.g48 << std::endl; std::cout << "4-node-2-edge (g49) : " << counts.g49 << std::endl; std::cout << "4-node-1-edge (g410) : " << counts.g410 << std::endl; std::cout << "4-node-independent (g411) : " << counts.g411 << std::endl; std::cout << std::endl; std::cout << "k=3 Graphlets" << std::endl; std::cout << "---------------------------" << std::endl; std::cout << "triangle (g31) : " << counts.g31 << std::endl; std::cout << "2-star (g32) : " << counts.g32 << std::endl; std::cout << "3-node-1-edge (g33) : " << counts.g33 << std::endl; std::cout << "3-node-independent (g34) : " << counts.g34 << std::endl; std::cout << std::endl; std::cout << " Timing (us)" << std::endl; std::cout << "====================" << std::endl; std::cout << "total elapsed : " << std::chrono::duration_cast<std::chrono::microseconds>(end - begin).count() << std::endl; std::cout << "cudaMalloc : " << std::chrono::duration_cast<std::chrono::microseconds>(malloc_end - begin).count() << std::endl; std::cout << "cudaMemcpy (input) : " << std::chrono::duration_cast<std::chrono::microseconds>(memcpy_input_end - malloc_end).count() << std::endl; std::cout << "kernel (graphlets) : " << std::chrono::duration_cast<std::chrono::microseconds>(kernel_end - kernel_begin).count() << std::endl; std::cout << "cudaMemcpy (output): " << std::chrono::duration_cast<std::chrono::microseconds>(memcpy_output_end - kernel_end).count() << std::endl; std::cout << "cudaFree : " << std::chrono::duration_cast<std::chrono::microseconds>(free_end - memcpy_output_end).count() << std::endl; std::cout << "aggregate : " << std::chrono::duration_cast<std::chrono::microseconds>(end - memcpy_output_end).count() << std::endl; return EXIT_SUCCESS; }
407
#include <stdio.h> __global__ void add(int a, int b, int *c){ *c = a + b; } int main(){ int c; int *dev_c; cudaMalloc( (void**) &dev_c, sizeof(int) ); add<<<1, 1>>> (2, 7, dev_c); cudaMemcpy(&c, dev_c, sizeof(int), cudaMemcpyDeviceToHost); printf("2 + 7 = %d \n", c); cudaFree(dev_c); }
408
#include <cuda_runtime.h> #include <device_launch_parameters.h> #include <stdio.h> // __global__ indicates a function or "kernel" that runs on the device and is called from host code __global__ void hello_kernel(void) { // greet from the device : the GPU and its memory printf("Hello, world from the device!\n"); } int main(void) { // greet from the host : the CPU and its memory printf("Hello, world from the host!\n"); // triple angle brackets mark a call from host code to device code // launch a kernel with a single thread to greet from the device hello_kernel<<<1,1>>>(); // wait for the device to finish so that we see the message cudaDeviceSynchronize(); // check error printf("CUDA error: %s\n", cudaGetErrorString(cudaGetLastError())); return 0; } // nvcc separates source code into host and device components* // nvcc hello.cu -o hello
409
#include <stdlib.h> #include <stdio.h> #include <time.h> /* Every thread gets exactly one value in the unsorted array. */ #define THREADS 128 // 2^7 #define BLOCKS 1024 // 2^10 #define NUM_VALS THREADS*BLOCKS #define MAX_VALUE 8196 void print_elapsed(clock_t start, clock_t stop) { double elapsed = ((double) (stop - start)) / CLOCKS_PER_SEC; printf("Elapsed time: %.3fs\n", elapsed); } __global__ void count(int *A, int *B, int n) { int b_id = blockIdx.x, b_num = gridDim.x, b_size, b_offset, t_id = threadIdx.x, t_num = blockDim.x, t_size, t_offset, offset; // initialize a shared memory array to store the count for each block. __shared__ int count[MAX_VALUE]; // set intial values to zeros. Each thread sets its own share to zero. t_size = (t_num > MAX_VALUE ? 1 : MAX_VALUE / t_num); offset = t_id * t_size; for (int i = offset; i < offset + t_size && i < MAX_VALUE; ++i) count[i] = 0; // wait until all threads have completed the initialization process. __syncthreads(); // accumulate the counts of each value. Each thread counts a certain portain // of the unsorted array. b_size = (b_num > n ? 1 : n / b_num); b_offset = b_id * b_size; t_size = (t_num > b_size ? 1 : b_size / t_num); offset = b_offset + t_id * t_size; for (int i = offset; i < offset + t_size && i < b_offset + b_size && i < n; ++i) atomicAdd(&count[A[i]], 1); // wait until all threads have completed the couting phase. __syncthreads(); // copy the block count into global memory. Each thread copies its portioin to // the global memory. t_size = (t_num > MAX_VALUE ? 1 : MAX_VALUE / t_num); t_offset = t_id * t_size; offset = b_id * MAX_VALUE + t_offset; if (offset + t_size <= (b_id + 1) * MAX_VALUE) memcpy(&B[offset], &count[t_offset], sizeof(int) * t_size); } __global__ void merge(int *B) { int b_id = blockIdx.x, b_num = gridDim.x, b_size, b_offset, t_id = threadIdx.x, t_num = blockDim.x, t_size, offset; // loop through and merge until all arrays are merged. for (int i = b_num, j = 2; i != 1; i /= 2, j *= 2) { // each block will operate on b_size values which equal, the number of // count arrays * size of count arrays / number of blocks / 2. The final 2 // represents the merge process. b_size = i * MAX_VALUE / b_num / 2; b_offset = (b_id / j) * (j * MAX_VALUE) + b_size * (b_id % j); t_size = (t_num > b_size ? 1 : b_size / t_num); // calculate the offset that each thread will start at and sum counts. offset = b_offset + t_id * t_size; for (int k = offset, l = offset + (MAX_VALUE * (j / 2)); k < offset + t_size && k < b_offset + b_size; ++k, ++l) B[k] += B[l]; // wait untill all arrays are merged for every step. __syncthreads(); } } void bitonic_sort(int *values) { int *dev_values, *dev_ans; size_t size = NUM_VALS * sizeof(int); size_t size1 = MAX_VALUE * BLOCKS * sizeof(int); cudaMalloc((void**) &dev_values, size); cudaMalloc((void**) &dev_ans, size1); cudaMemcpy(dev_values, values, size, cudaMemcpyHostToDevice); dim3 blocks(BLOCKS,1); dim3 threads(THREADS,1); count<<<blocks, threads>>>(dev_values, dev_ans, NUM_VALS); merge<<<blocks, threads>>>(dev_ans); int ans[NUM_VALS]; cudaMemcpy(ans, dev_ans, size, cudaMemcpyDeviceToHost); cudaFree(dev_values); // Construct sorted array for (int i = 0, j = 0; i < MAX_VALUE; ++i) { for (int k = 0; k < ans[i]; ++k, ++j) { values[j] = i; } } } int main(int argc, char const *argv[]) { clock_t start, stop; int *values = (int*)malloc(NUM_VALS * sizeof(int)); FILE *f = fopen("reverse_dataset.txt", "r"); for(int i=0;i< NUM_VALS; i++) { fscanf(f, "%d\n", &values[i]); } cudaEvent_t estart, estop; start = clock(); cudaEventCreate( &estart ); cudaEventRecord( estart, 0 ); bitonic_sort(values); cudaEventCreate( &estop ); cudaEventRecord( estop, 0 ) ; cudaEventSynchronize( estop ); stop = clock(); float elapsedTime; cudaEventElapsedTime( &elapsedTime, estart, estop ) ; printf("Elapsed time: %f\n", elapsedTime); //print_elapsed(start, stop); return 0; }
410
#include <iostream> using std::endl; __global__ void sum_kernel(double *A, double *B, double *C, int N) { int idx = blockIdx.x * blockDim.x + threadIdx.x; if (idx >= N) { return; } double a = A[idx]; double b = B[idx]; C[idx] = a + b; } int main(int argc, char **argv) { // Size of vectors int n = 100000; // Host vectors double *h_a, *h_b, *h_c; // Size, in bytes, of each vector size_t bytes = n * sizeof(double); // Allocate memory for each vector on host h_a = (double *) malloc(bytes); h_b = (double *) malloc(bytes); h_c = (double *) malloc(bytes); int i; // Initialize vectors on host for (i = 0; i < n; i++) { h_a[i] = sin(i) * sin(i); h_b[i] = cos(i) * cos(i); } // Device input vectors double *d_a, *d_b, *d_c; // Allocate memory for each vector on GPU cudaMalloc(&d_a, bytes); cudaMalloc(&d_b, bytes); cudaMalloc(&d_c, bytes); // Copy host vectors to device cudaMemcpy(d_a, h_a, bytes, cudaMemcpyHostToDevice); cudaMemcpy(d_b, h_b, bytes, cudaMemcpyHostToDevice); int blockSize = 1024; int gridSize = (n - 1) / blockSize + 1; // Execute the kernel sum_kernel<<<gridSize, blockSize>>>(d_a, d_b, d_c, n); // Copy array back to host cudaMemcpy(h_c, d_c, bytes, cudaMemcpyDeviceToHost); // Release device memory cudaFree(d_a); cudaFree(d_b); cudaFree(d_c); double maxError = 0; for (int i = 0; i < n; ++i) { double error = abs(h_c[i] - 1.0); maxError = error > maxError ? error : maxError; } std::cout << "Max error = " << maxError << endl; }
411
/** * 3mm.cu: This file is part of the PolyBench/GPU 1.0 test suite. * * * Contact: Scott Grauer-Gray <sgrauerg@gmail.com> * Louis-Noel Pouchet <pouchet@cse.ohio-state.edu> * Web address: http://www.cse.ohio-state.edu/~pouchet/software/polybench/GPU */ #include <stdio.h> #include <stdlib.h> #include <math.h> #include <assert.h> #include <unistd.h> #include <sys/time.h> #include <cuda.h> #define GPU_DEVICE 0 //define the error threshold for the results "not matching" #define PERCENT_DIFF_ERROR_THRESHOLD 0.05 /* Problem size. */ //# define NI 512 //# define NJ 512 //# define NK 512 //# define NL 512 //# define NM 512 /* Thread block dimensions */ #define DIM_THREAD_BLOCK_X 32 #define DIM_THREAD_BLOCK_Y 8 /* Can switch DATA_TYPE between float and double */ typedef float DATA_TYPE; int NI; int NJ; int NK; int NL; int NM; void init_array(DATA_TYPE* A, DATA_TYPE* B, DATA_TYPE* C, DATA_TYPE* D) { int i, j; for (i = 0; i < NI; i++) { for (j = 0; j < NK; j++) { A[i*NK + j] = ((DATA_TYPE) i*j) / NI; } } for (i = 0; i < NK; i++) { for (j = 0; j < NJ; j++) { B[i*NJ + j] = ((DATA_TYPE) i*(j+1)) / NJ; } } for (i = 0; i < NJ; i++) { for (j = 0; j < NM; j++) { C[i*NM + j] = ((DATA_TYPE) i*(j+3)) / NL; } } for (i = 0; i < NM; i++) { for (j = 0; j < NL; j++) { D[i*NL + j] = ((DATA_TYPE) i*(j+2)) / NK; } } } __global__ void mm3_kernel1(DATA_TYPE *A, DATA_TYPE *B, DATA_TYPE *E,int NI, int NJ, int NK, int NL, int NM) { int j = blockIdx.x * blockDim.x + threadIdx.x; int i = blockIdx.y * blockDim.y + threadIdx.y; if ((i < NI) && (j < NJ)) { int k; for(k=0; k < NK; k++) { E[i * NJ + j] += A[i * NK + k] * B[k * NJ + j]; } } } __global__ void mm3_kernel2(DATA_TYPE *C, DATA_TYPE *D, DATA_TYPE *F,int NI, int NJ, int NK, int NL, int NM) { int j = blockIdx.x * blockDim.x + threadIdx.x; int i = blockIdx.y * blockDim.y + threadIdx.y; if ((i < NJ) && (j < NL)) { int k; for(k=0; k < NM; k++) { F[i * NL + j] += C[i * NM + k] * D[k * NL +j]; } } } __global__ void mm3_kernel3(DATA_TYPE *E, DATA_TYPE *F, DATA_TYPE *G, int NI, int NJ, int NK, int NL, int NM) { int j = blockIdx.x * blockDim.x + threadIdx.x; int i = blockIdx.y * blockDim.y + threadIdx.y; if ((i < NI) && (j < NL)) { int k; for(k=0; k < NJ; k++) { G[i * NL + j] += E[i * NJ + k] * F[k * NL + j]; } } } void mm3Cuda(DATA_TYPE* A_gpu, DATA_TYPE* B_gpu, DATA_TYPE* C_gpu, DATA_TYPE* D_gpu, DATA_TYPE* E_gpu, DATA_TYPE* F_gpu, DATA_TYPE* G_gpu, int NI, int NJ, int NK, int NL, int NM) { cudaEvent_t start, end; float time; dim3 block(DIM_THREAD_BLOCK_X, DIM_THREAD_BLOCK_Y); dim3 grid1((size_t)(ceil( ((float)NJ) / ((float)DIM_THREAD_BLOCK_X) )),(size_t)(ceil((float)NI/ ((float)DIM_THREAD_BLOCK_Y) ))); dim3 grid2((size_t)(ceil( ((float)NL) / ((float)DIM_THREAD_BLOCK_X) )),(size_t)(ceil((float)NJ/ ((float)DIM_THREAD_BLOCK_Y) ))); dim3 grid3((size_t)(ceil( ((float)NL) / ((float)DIM_THREAD_BLOCK_X) )),(size_t)(ceil((float)NI/ ((float)DIM_THREAD_BLOCK_Y) ))); //for(int i = 0; i < 5; i++){ cudaEventCreate(&start); cudaEventCreate(&end); cudaEventRecord(start); mm3_kernel1<<<grid1,block>>>(A_gpu, B_gpu, E_gpu,NI, NJ, NK, NL, NM); cudaDeviceSynchronize(); mm3_kernel2<<<grid2,block>>>(C_gpu, D_gpu, F_gpu,NI, NJ, NK, NL, NM); cudaDeviceSynchronize(); mm3_kernel3<<<grid3,block>>>(E_gpu, F_gpu, G_gpu,NI, NJ, NK, NL, NM); cudaDeviceSynchronize(); cudaEventRecord(end); cudaEventSynchronize(end); cudaEventElapsedTime(&time, start, end); fprintf(stdout, "%0.6lf\n", time); //} } int main(int argc, char** argv) { if(argc < 2){ printf("please no troll\n"); return 1; } NI = atoi(argv[1]); NJ = atoi(argv[1]); NK = atoi(argv[1]); NL = atoi(argv[1]); NM = atoi(argv[1]); DATA_TYPE* A; DATA_TYPE* B; DATA_TYPE* C; DATA_TYPE* D; DATA_TYPE* E; DATA_TYPE* F; DATA_TYPE* G; cudaMallocManaged(&A, NI*NK*sizeof(DATA_TYPE)); cudaMallocManaged(&B, NK*NJ*sizeof(DATA_TYPE)); cudaMallocManaged(&C, NJ*NM*sizeof(DATA_TYPE)); cudaMallocManaged(&D, NM*NL*sizeof(DATA_TYPE)); cudaMallocManaged(&E, NI*NJ*sizeof(DATA_TYPE)); cudaMallocManaged(&F, NJ*NL*sizeof(DATA_TYPE)); cudaMallocManaged(&G, NI*NL*sizeof(DATA_TYPE)); init_array(A, B, C, D); mm3Cuda(A, B, C, D, E, F, G, NI, NJ, NK, NL, NM); cudaFree(A); cudaFree(B); cudaFree(C); cudaFree(D); cudaFree(E); cudaFree(F); cudaFree(G); return 0; }
412
#include <cuda_runtime.h> #include <device_launch_parameters.h> #include <cuda.h> #include <device_functions.h> #include <cuda_runtime_api.h> #include<iostream> #define imin(a,b) (a<b?a:b) #define sum_squares(x) (x*(x+1)*(2*x+1)/6) const int N = 33 * 1024; const int threadsPerBlock = 256; const int blocksPerGrid = imin(32, (N + threadsPerBlock - 1) / threadsPerBlock); __global__ void dot(float* a, float* b, float* c) { __shared__ float cache[threadsPerBlock]; int tid = threadIdx.x + blockIdx.x * blockDim.x; int cacheIndex = threadIdx.x; float temp = 0; while (tid < N) { temp += a[tid] * b[tid]; tid += blockDim.x * gridDim.x; } cache[cacheIndex] = temp; // sync between All the threads in a Block __syncthreads(); int i = blockDim.x / 2; while (i != 0) { if (cacheIndex < i) { cache[cacheIndex] += cache[cacheIndex + i]; __syncthreads(); // Also incorrect } //__syncthreads(); // incorrect i /= 2; } if (cacheIndex == 0) { c[blockIdx.x] = cache[0]; } } int main(void) { float c; float* a, * b, * partial_c; float* dev_a, * dev_b, * dev_partial_c; a = (float*)malloc(sizeof(float) * N); b = (float*)malloc(sizeof(float) * N); partial_c = (float*)malloc(sizeof(float) * blocksPerGrid); cudaMalloc((void**)&dev_a, sizeof(float) * N); cudaMalloc((void**)&dev_b, sizeof(float) * N); cudaMalloc((void**)&dev_partial_c, sizeof(float) * blocksPerGrid); for (int i = 0; i < N; i++) { a[i] = i; b[i] = i * 2; } cudaMemcpy(dev_a, a, sizeof(float) * N, cudaMemcpyHostToDevice); cudaMemcpy(dev_b, b, sizeof(float) * N, cudaMemcpyHostToDevice); dot <<<blocksPerGrid, threadsPerBlock>>> (dev_a, dev_b, dev_partial_c); cudaMemcpy(partial_c, dev_partial_c, sizeof(float) * blocksPerGrid, cudaMemcpyDeviceToHost); c = 0; for (int i = 0; i < blocksPerGrid; i++) { c += partial_c[i]; } printf("Does GPU value %.6g = %.6g?\n", c, sum_squares((float)(N - 1))); cudaFree(dev_a); cudaFree(dev_b); cudaFree(dev_partial_c); free(a); free(b); free(partial_c); return 0; }
413
// RUN: %run_test hipify "%s" "%t" %hipify_args %clang_args "-Xclang" "-fcuda-allow-variadic-functions" /* Copyright (c) 2015-present Advanced Micro Devices, Inc. All rights reserved. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ // CHECK: #include "hip/hip_runtime.h" #include "cuda_runtime.h" #include <algorithm> #include <stdlib.h> #include <stdio.h> #include <string.h> #include <math.h> #include <type_traits> #define EXIT_WAIVED 2 const char* sampleName = "hipSimpleAtomicsTest"; using namespace std; // Auto-Verification Code bool testResult = true; bool computeGoldBitwise(...) { return true; } template<typename T, typename enable_if<is_integral<T>{}>::type* = nullptr> bool computeGoldBitwise(T* gpuData, int len) { T val = 0xff; for (int i = 0; i < len; ++i) { // 9th element should be 1 val &= (2 * i + 7); } if (val != gpuData[8]) { printf("atomicAnd failed\n"); return false; } val = 0; for (int i = 0; i < len; ++i) { // 10th element should be 0xff val |= (1 << i); } if (val != gpuData[9]) { printf("atomicOr failed\n"); return false; } val = 0xff; for (int i = 0; i < len; ++i) { // 11th element should be 0xff val ^= i; } if (val != gpuData[10]) { printf("atomicXor failed\n"); return false; } return true; } template<typename T> bool computeGold(T* gpuData, int len) { T val = 0; for (int i = 0; i < len; ++i) { val += 10; } if (val != gpuData[0]) { printf("atomicAdd failed\n"); return false; } val = 0; for (int i = 0; i < len; ++i) { val -= 10; } if (val != gpuData[1]) { printf("atomicSub failed\n"); return false; } bool found = false; for (T i = 0; i < len; ++i) { // third element should be a member of [0, len) if (i == gpuData[2]) { found = true; break; } } if (!found) { printf("atomicExch failed\n"); return false; } val = -(1 << 8); for (T i = 0; i < len; ++i) { // fourth element should be len-1 val = max(val, i); } if (val != gpuData[3]) { printf("atomicMax failed\n"); return false; } val = 1 << 8; for (T i = 0; i < len; ++i) { val = min(val, i); } if (val != gpuData[4]) { printf("atomicMin failed\n"); return false; } int limit = 17; val = 0; for (int i = 0; i < len; ++i) { val = (val >= limit) ? 0 : val + 1; } if (val != gpuData[5]) { printf("atomicInc failed\n"); return false; } limit = 137; val = 0; for (int i = 0; i < len; ++i) { val = ((val == 0) || (val > limit)) ? limit : val - 1; } if (val != gpuData[6]) { printf("atomicDec failed\n"); return false; } found = false; for (T i = 0; i < len; ++i) { // eighth element should be a member of [0, len) if (i == gpuData[7]) { found = true; break; } } if (!found) { printf("atomicCAS failed\n"); return false; } return computeGoldBitwise(gpuData, len); } __device__ void testKernelExch(...) {} template<typename T, typename enable_if<!is_same<T, double>{}>::type* = nullptr> __device__ void testKernelExch(T* g_odata) { // access thread id const T tid = blockDim.x * blockIdx.x + threadIdx.x; // Atomic exchange atomicExch(&g_odata[2], tid); } __device__ void testKernelSub(...) {} template< typename T, typename enable_if< is_same<T, int>{} || is_same<T, unsigned int>{}>::type* = nullptr> __device__ void testKernelSub(T* g_odata) { // Atomic subtraction (final should be 0) atomicSub(&g_odata[1], 10); } __device__ void testKernelIntegral(...) {} template<typename T, typename enable_if<is_integral<T>{}>::type* = nullptr> __device__ void testKernelIntegral(T* g_odata) { // access thread id const T tid = blockDim.x * blockIdx.x + threadIdx.x; // Atomic maximum atomicMax(&g_odata[3], tid); // Atomic minimum atomicMin(&g_odata[4], tid); // Atomic increment (modulo 17+1) atomicInc((unsigned int*)&g_odata[5], 17); // Atomic decrement atomicDec((unsigned int*)&g_odata[6], 137); // Atomic compare-and-swap atomicCAS(&g_odata[7], tid - 1, tid); // Atomic AND atomicAnd(&g_odata[8], 2 * tid + 7); // Atomic OR atomicOr(&g_odata[9], 1 << tid); // Atomic XOR atomicXor(&g_odata[10], tid); testKernelSub(g_odata); } template<typename T> __global__ void testKernel(T* g_odata) { // Atomic addition atomicAdd(&g_odata[0], 10); testKernelIntegral(g_odata); testKernelExch(g_odata); } template<typename T> void runTest() { // CHECK: hipDeviceProp_t deviceProp; cudaDeviceProp deviceProp; deviceProp.major = 0; deviceProp.minor = 0; int dev = 0; // CHECK: hipGetDeviceProperties(&deviceProp, dev); cudaGetDeviceProperties(&deviceProp, dev); // Statistics about the GPU device printf( "> GPU device has %d Multi-Processors, " "SM %d.%d compute capabilities\n\n", deviceProp.multiProcessorCount, deviceProp.major, deviceProp.minor); unsigned int numThreads = 256; unsigned int numBlocks = 64; unsigned int numData = 11; unsigned int memSize = sizeof(T) * numData; // Allocate mem for the result on host side T* hOData = (T*)malloc(memSize); // Initialize the memory for (unsigned int i = 0; i < numData; i++) hOData[i] = 0; // To make the AND and XOR tests generate something other than 0... hOData[8] = hOData[10] = 0xff; // Allocate device memory for result T* dOData; // CHECK: hipMalloc((void**)&dOData, memSize); cudaMalloc((void**)&dOData, memSize); // Copy host memory to device to initialize to zero // CHECK: hipMemcpy(dOData, hOData, memSize, hipMemcpyHostToDevice); cudaMemcpy(dOData, hOData, memSize, cudaMemcpyHostToDevice); // Execute the kernel // CHECK: hipLaunchKernelGGL(HIP_KERNEL_NAME(testKernel), dim3(numBlocks), dim3(numThreads), 0, 0, dOData); testKernel<<<numBlocks, numThreads>>>(dOData); // Copy result from device to host // CHECK: hipMemcpy(hOData, dOData, memSize, hipMemcpyDeviceToHost); cudaMemcpy(hOData, dOData, memSize, cudaMemcpyDeviceToHost); // Compute reference solution testResult = computeGold(hOData, numThreads * numBlocks); // Cleanup memory free(hOData); // CHECK: hipFree(dOData); cudaFree(dOData); } int main(int argc, char** argv) { printf("%s starting...\n", sampleName); runTest<int>(); runTest<unsigned int>(); runTest<unsigned long long>(); runTest<float>(); runTest<double>(); // CHECK: hipDeviceReset(); cudaDeviceReset(); printf("%s completed, returned %s\n", sampleName, testResult ? "OK" : "ERROR!"); exit(testResult ? EXIT_SUCCESS : EXIT_FAILURE); }
414
/* * Copyright (c) Meta Platforms, Inc. and affiliates. * All rights reserved. * * This source code is licensed under the BSD-style license found in the * LICENSE file in the root directory of this source tree. */ #include <cuda.h> __global__ void _slowKernel(char* ptr, int sz) { int idx = blockIdx.x * blockDim.x + threadIdx.x; for (; idx < sz; idx += (gridDim.x * blockDim.x)) { for (int i = 0; i < 100000; ++i) { ptr[idx] += ptr[(idx + 1007) % sz] + i; } } } void slowKernel(void* ptr, int kSize, cudaStream_t stream) { _slowKernel<<<128, 128, 0, stream>>>((char*)ptr, kSize); }
415
#include "math.h" __constant__ int sobelV[] = {1, 0, -1, 2, 0, -2, 1, 0, -1}; __constant__ int sobelH[] = {1, 2, 1, 0, 0, 0, -1, -2, -1}; extern "C" __global__ void grayEdgeDetection(int * output, int width, int thresh) { int idx = blockIdx.x * blockDim.x + threadIdx.x; int idy = blockIdx.y * blockDim.y + threadIdx.y; int pixelIndex = idx + (idy * width); int pixels[9]; for(int i = -1; i <= 1; i++) { for(int j = -1; j <= 1; j++) { pixels[((i + 1) * 3) + (j + 1)] = output[(idx + j) + ((idy + i) * width)]; } } /* pixels[0] = output[(idx - 1) + ((idy - 1) * width)]; pixels[1] = output[(idx) + ((idy - 1) * width)]; pixels[2] = output[(idx + 1) + ((idy - 1) * width)]; pixels[3] = output[(idx - 1) + (idy * width)]; pixels[4] = output[(idx) + (idy * width)]; pixels[5] = output[(idx + 1) + (idy * width)]; pixels[6] = output[(idx - 1) + ((idy + 1) * width)]; pixels[7] = output[(idx) + ((idy + 1) * width)]; pixels[8] = output[(idx + 1) + ((idy + 1) * width)]; */ int vertSum = 0; int horzSum = 0; for(int i = 0; i < 9; i++) { int grayVal = pixels[i] & 0xFF; vertSum = vertSum + (grayVal * sobelV[i]); horzSum = horzSum + (grayVal * sobelH[i]); } int sum = (int) (sqrt((double)((vertSum * vertSum) + (horzSum * horzSum)))); if(sum > 255) sum = 255; if(sum < thresh) sum = 0; output[pixelIndex] = sum; }
416
#include<stdio.h> #include<stdlib.h> #include<time.h> float random_number(int min, int max){ /* * Function: random_number * ----------------------- * return a random number between min and max as a float */ float num = rand() % (max + 1 - min) + min; return num; } unsigned long int getOffset(int * indices, int * dimensions, int num_dimensions){ /* * Function: getOffset * ------------------- * compute the offset from the base address of an array for given indices corresponding * to dimensions. * indices: pointer to array of indices e.g A[1,2,3] * dimensions: pointer to array of dimensions e.g dimensionality of A = 2x3x4 * num_dimensions: number of dimensions e.g dimensions(A) = 3 * * returns: * ------- * offset: the offset from the base memory address. (NOTE: independant of datatype) */ unsigned long int offset = 0.0; for(int indexIdx=0; indexIdx<num_dimensions; indexIdx++){ unsigned long int product = indices[indexIdx]; for(int dimIdx=indexIdx+1; dimIdx<num_dimensions; dimIdx ++){ product = product * dimensions[dimIdx]; } offset = offset + product; } return offset; } void randFill(float * arr, int * dimensions, int num_dimensions){ /* * Must be a recursable function */ // 1. Base condition if(num_dimensions==1){ printf("Reached base condition\n"); for(int i=0; i<dimensions[0]; i++){ *(arr + i) = random_number(1,100); } } // 2. Recursive condition else { int first_dim = dimensions[0]; int second_dim = dimensions[1]; printf("First dim : %d | Second dim : %d", first_dim, second_dim); int * new_dims = dimensions + 1; for(int dim=0; dim<first_dim; dim++){ randFill( arr+second_dim , new_dims, num_dimensions-1); } } } void randFill2d(float * arr, int * dimensions){ /* * Function: randFill3d * -------------------- * fills a 3d array with random numbers between 1,100 */ int HEIGHT = dimensions[0]; int WIDTH = dimensions[1]; for(int row=0; row<HEIGHT; row++){ for(int col=0; col<WIDTH; col++){ int indices[2] = {row, col}; *(arr + getOffset(indices, dimensions, 2)) = random_number(1,100); } } } void randFill3d(float * arr, int * dimensions){ /* * Function: randFill3d * -------------------- * fills a 3d array with random numbers between 1,100 */ int CHANNELS = dimensions[0]; int HEIGHT = dimensions[1]; int WIDTH = dimensions[2]; for(int chan=0; chan<CHANNELS; chan++){ for(int row=0; row<HEIGHT; row++){ for(int col=0; col<WIDTH; col++){ int indices[3] = {chan, row, col}; *(arr + getOffset(indices, dimensions, 3)) = random_number(1,100); } } } } void printArr2d(float * arr, int * dimensions){ int HEIGHT = dimensions[0]; int WIDTH = dimensions[1]; printf("\n2d Array: \n"); for(int r=0; r<HEIGHT; r++){ printf("\n"); for(int c=0; c<WIDTH; c++){ int indices[] = {r,c}; printf(" %.1f ", *(arr + getOffset(indices, dimensions, 2))); } } printf("\n"); } void printArr3d(float * arr, int * dimensions){ /* To print a 3d array - used multiple times */ int CHANNELS = dimensions[0]; int HEIGHT = dimensions[1]; int WIDTH = dimensions[2]; for(int chan=0; chan<CHANNELS; chan++){ printf("\nChannel %d", chan); for(int row=0; row<HEIGHT; row++){ printf("\n"); for(int col=0; col<WIDTH; col++){ int indices[3] = {chan, row, col}; printf(" %.1f ", *(arr + getOffset(indices, dimensions, 3))); } } printf("\n"); } } float * new3dArray(int DEPTH, int HEIGHT, int WIDTH){ float * arr = (float*)malloc(DEPTH*HEIGHT*WIDTH*sizeof(float)); return arr; } float * new2dArray(int HEIGHT, int WIDTH){ float * arr = (float*)malloc(HEIGHT*WIDTH*sizeof(float)); return arr; } /* int main() { // Test this! float arr[4][3] = { {1,2,3}, {4,5,6}, {7,8,9}, {10,11,12} }; // 4x3 array float * arr_ptr = &arr[0][0]; int indices[] = {2,1}; int dimensions[] = {4,3}; int num_dimensions = 2; unsigned long int offset = getOffset( indices, dimensions, num_dimensions ); printf("value at ( %d , %d ) is %f \n", indices[0], indices[1], arr[indices[0]][indices[1]]); printf("value at ( %d , %d ) is %f \n", indices[0], indices[1], *(arr_ptr + offset) ); // Test fillArr and printArr srand(time(0)); const int HEIGHT=2; const int WIDTH=3; const int DEPTH=4; float * multiArr = (float *)malloc(HEIGHT*WIDTH*DEPTH*sizeof(float)); int dimensions2[] = {DEPTH, HEIGHT, WIDTH}; randFill3d(multiArr, dimensions2); printArr3d(multiArr, dimensions2); return 0; } */
417
/* * ising_cuda_v1.cu * * Created on: Dec 26, 2019 * Author: Charalampos Eleftheriadis */ #include <stdio.h> #include <stdlib.h> #include <time.h> #define N 512 #define threadsNum 64 #define gpuErrchk(ans) { gpuAssert((ans), __FILE__, __LINE__); } inline void gpuAssert(cudaError_t code, const char *file, int line, bool abort=true) { if (code != cudaSuccess) { fprintf(stderr,"GPUassert: %s %s %d\n", cudaGetErrorString(code), file, line); if (abort) exit(code); } } // Kernel Function. __global__ void spin(int *G, double *w, int *newG, int n) { // Calculates Atomic Spin index. int index = blockIdx.x*blockDim.x + threadIdx.x; // Checks for out of bounds indexing and if so quits. if (index >= n*n) return; double weightSum = 0; // Calculates weight contribution for each neighboring Atomic Spin and sums it. weightSum += w[0] * G[((index/n - 2 + n)%n) * n + (index - 2 + n)%n]; weightSum += w[1] * G[((index/n - 2 + n)%n) * n + (index - 1 + n)%n]; weightSum += w[2] * G[((index/n - 2 + n)%n) * n + (index)%n]; weightSum += w[3] * G[((index/n - 2 + n)%n) * n + (index + 1 + n)%n]; weightSum += w[4] * G[((index/n - 2 + n)%n) * n + (index + 2 + n)%n]; weightSum += w[5] * G[((index/n - 1 + n)%n) * n + (index - 2 + n)%n]; weightSum += w[6] * G[((index/n - 1 + n)%n) * n + (index - 1 + n)%n]; weightSum += w[7] * G[((index/n - 1 + n)%n) * n + (index)%n]; weightSum += w[8] * G[((index/n - 1 + n)%n) * n + (index + 1 + n)%n]; weightSum += w[9] * G[((index/n - 1 + n)%n) * n + (index + 2 + n)%n]; weightSum += w[10] * G[((index/n + n)%n) * n + (index - 2 + n)%n]; weightSum += w[11] * G[((index/n + n)%n) * n + (index - 1 + n)%n]; // w[12] is not contributing anything. It's the current Atomic Spin. weightSum += w[13] * G[((index/n + n)%n) * n + (index + 1 + n)%n]; weightSum += w[14] * G[((index/n + n)%n) * n + (index + 2 + n)%n]; weightSum += w[15] * G[((index/n + 1 + n)%n) * n + (index - 2 + n)%n]; weightSum += w[16] * G[((index/n + 1 + n)%n) * n + (index - 1 + n)%n]; weightSum += w[17] * G[((index/n + 1 + n)%n) * n + (index)%n]; weightSum += w[18] * G[((index/n + 1 + n)%n) * n + (index + 1 + n)%n]; weightSum += w[19] * G[((index/n + 1 + n)%n) * n + (index + 2 + n)%n]; weightSum += w[20] * G[((index/n + 2 + n)%n) * n + (index - 2 + n)%n]; weightSum += w[21] * G[((index/n + 2 + n)%n) * n + (index - 1 + n)%n]; weightSum += w[22] * G[((index/n + 2 + n)%n) * n + (index)%n]; weightSum += w[23] * G[((index/n + 2 + n)%n) * n + (index + 1 + n)%n]; weightSum += w[24] * G[((index/n + 2 + n)%n) * n + (index + 2 + n)%n]; //! Can it be done more efficiently? if (weightSum > 0.0001) newG[index] = 1; else if (weightSum < -0.0001) newG[index] = -1; else newG[index] = G[index]; } // Kernel Function that checks whether the new Atomic Spins Matrix is the same as the old one. __global__ void check(int *G, int *newG, int n, int *same) { // Calculates Atomic Spin index. int index = blockIdx.x*blockDim.x + threadIdx.x; // Checks for out of bounds indexing and if so quits. if (index >= n*n) return; if (G[index] != newG[index]) *same = 0; } void ising(int *G, double *w, int k, int n) { // Creates and transfers the Weight Matrix to GPU memory. double *w_d; int w_size = 25*sizeof(double); gpuErrchk( cudaMalloc((void **) &w_d, w_size) ); gpuErrchk( cudaMemcpy(w_d, w, w_size, cudaMemcpyHostToDevice) ); // Creates and transfers the Atomic Spins Matrix to GPU memory. int *G_d; int G_size = n*n*sizeof(int); gpuErrchk( cudaMalloc((void **) &G_d, G_size) ); gpuErrchk( cudaMemcpy(G_d, G, G_size, cudaMemcpyHostToDevice) ); // Creates the new Atomic Spins Matrix to GPU memory. int *newG_d; gpuErrchk( cudaMalloc((void **) &newG_d, G_size) ); // Creates and transfers a flag that states whether the new Atomic Spins Matrix and the old are the same to GPU memory. int same = 1; int *same_d; gpuErrchk( cudaMalloc((void **) &same_d, sizeof(int)) ); gpuErrchk( cudaMemcpy(same_d, &same, sizeof(int), cudaMemcpyHostToDevice) ); // Creates a temporary variable for Atomic Spins Matrices' pointers swapping. int *temp_d; // Checks if function has to be iterated. for (int i=0; i<k; i++) { // Calls the kernel function balancing load to (n*n+threadsNum-1)/threadsNum blocks with threadsNum threads each. spin<<<(n*n+threadsNum-1)/threadsNum,threadsNum>>>(G_d, w_d, newG_d, n); gpuErrchk( cudaPeekAtLastError() ); gpuErrchk( cudaDeviceSynchronize() ); check<<<(n*n+threadsNum-1)/threadsNum,threadsNum>>>(G_d, newG_d, n, same_d); gpuErrchk( cudaPeekAtLastError() ); gpuErrchk( cudaDeviceSynchronize() ); gpuErrchk( cudaMemcpy(&same, same_d, sizeof(int), cudaMemcpyDeviceToHost) ); if (same) break; // Atomix Spin Matrices' pointers swapping. temp_d = G_d; G_d = newG_d; newG_d = temp_d; } // Copies data from GPU to CPU memory. gpuErrchk( cudaMemcpy(G, G_d, G_size, cudaMemcpyDeviceToHost) ); // Cleanup. gpuErrchk( cudaFree(w_d) ); gpuErrchk( cudaFree(G_d) ); gpuErrchk( cudaFree(newG_d) ); } int main() { // Weight Matrix. double w[] = { 0.004, 0.016, 0.026, 0.016, 0.004, 0.016, 0.071, 0.117, 0.071, 0.016, 0.026, 0.117, 0.000, 0.117, 0.026, 0.016, 0.071, 0.117, 0.071, 0.016, 0.004, 0.016, 0.026, 0.016, 0.004 }; // Number of dimensions for the square Atomic Spins Matrix. int n = N; // Allocates memory for the Atomic Spins Matrix. int *G = (int *)malloc(n*n * sizeof(int)); // Randomizes seed. srand(time(NULL)); // Fills the Atomic Spins Matrix with "-1" and "1" values from a uniform distribution. for (int i=0; i<n*n; i++) G[i] = ((rand() % 2) * 2) - 1; /* // Reads configuration file. size_t readStatus; FILE *conf_init = fopen("conf-init.bin","rb"); int initG[n*n]; readStatus = fread(&initG, sizeof(int), n*n, conf_init); if (readStatus != n*n) printf("Could not read conf-init.bin file.\n"); fclose(conf_init); // Fills the Atomic Spins Matrix with "-1" and "1" values from configuration file. for (int i=0; i<n*n; i++) G[i] = initG[i]; */ ising(G, w, 10, n); /* // Reads configuration file for state after one iteration. size_t readStatus1; FILE *conf_1 = fopen("conf-1.bin","rb"); int G1[n*n]; readStatus1 = fread(&G1, sizeof(int), n*n, conf_1); if (readStatus1 != n*n) printf("Could not read conf-1.bin file.\n"); fclose(conf_1); // Checks for errors. int errorsNum = 0; for (int i=0; i<n; i++) for (int j=0; j<n; j++) if (G[i*n+j] != G1[i*n+j]) errorsNum++; if (errorsNum == 0) printf("Correct Results!\n"); else printf("Wrong Results. Number of errors: %d\n", errorsNum); // Checks the results. for (int i=0; i<n; i++) { for (int j=0; j<n; j++) { if (G[i*n+j] == G1[i*n+j]) printf("="); else printf("!"); } printf("\n"); } printf("\n\n"); */ return 0; }
418
#include "includes.h" __device__ void generate2DGaussian(double * output, double sigma, int sz, bool normalize) { /*x and y coordinates of thread in kernel. The gaussian filters are *small enough for the kernel to fit into a single thread block of sz*sz*/ const int colIdx = threadIdx.x; const int rowIdx = threadIdx.y; int linearIdx = rowIdx*sz + colIdx; /*calculate distance from centre of filter*/ int distx = abs(colIdx - sz/2); int disty = abs(rowIdx - sz/2); output[linearIdx] = exp(-(pow((double)(distx), 2.0)+pow((double)(disty), 2.0))/(2*(pow(sigma, 2.0)))); if(normalize==true) { /*wait until all threads have assigned a value to their index in the output array*/ __syncthreads(); int i, j; double sum=0.0; for(i=0; i<sz; i++) { for(j=0; j<sz; j++) { sum += output[i*sz + j]; } } /*Let all threads calculate the sum before changing the value of the output array*/ __syncthreads(); output[linearIdx]/=sum; } } __global__ void getGaussian(double * output, double sigma) { int sz = ceil(sigma*3) * 2 + 1; int linearIdx = threadIdx.y*sz + threadIdx.x; if(linearIdx>=sz*sz) return; generate2DGaussian(output, sigma, sz, false); }
419
#include <algorithm> #include <cassert> #include <cstdlib> #include <functional> #include <iostream> #include <vector> #include <chrono> using namespace std; constexpr int M = 1 << 3 ; //M =8 constexpr int N = 1 << 3; constexpr int K = 1 << 3; constexpr int THREADS = 1 << 2; constexpr int M_padded = M + THREADS - M % THREADS; //8+4 - 8%4 = 12 constexpr int N_padded = N + THREADS - N % THREADS; constexpr int K_padded = K + THREADS - K % THREADS; constexpr int SHMEM_SIZE = THREADS * THREADS; // size de MemSh par threads __global__ void matrixMul(const int *a, const int *b, int *c); void verify_result(vector<int> &a, vector<int> &b, vector<int> &c); void initMatrix(vector<int>& ,int, int); void afficheMatrix(vector<int>& m,int line, int colone); auto get_time() { return chrono::high_resolution_clock::now(); } int main() { size_t bytes_a = M_padded * K_padded * sizeof(int); // MxN = MxK * KxN size_t bytes_b = K_padded * N_padded * sizeof(int); size_t bytes_c = M * N * sizeof(int); // CPU vector<int> h_a(M_padded * K_padded); //12*12 vector<int> h_b(K_padded * N_padded); // 12*12 vector<int> h_c(M * N); //8*8 initMatrix(h_a,M_padded,K_padded); initMatrix(h_b,K_padded,N_padded); // GPU int *d_a, *d_b, *d_c; cudaMalloc(&d_a, bytes_a); cudaMalloc(&d_b, bytes_b); cudaMalloc(&d_c, bytes_c); // CPU ---> GPU cudaMemcpy(d_a, h_a.data(), bytes_a, cudaMemcpyHostToDevice); cudaMemcpy(d_b, h_b.data(), bytes_b, cudaMemcpyHostToDevice); int BLOCKS_X = N_padded / THREADS; // 12/4 = 3 int BLOCKS_Y = M_padded / THREADS; // 12/4 =3 dim3 threads(THREADS, THREADS); // (4,4) dim3 blocks(BLOCKS_X, BLOCKS_Y); // (3,3) auto start = get_time(); matrixMul<<<blocks, threads>>>(d_a, d_b, d_c); //<<< (3,3), (4,4) >>> cudaMemcpy(h_c.data(), d_c, bytes_c, cudaMemcpyDeviceToHost); auto finish = get_time(); auto duration = chrono::duration_cast<chrono::milliseconds>(finish - start); cout << "temps écoulé en kernel = " << duration.count() << " ms\n"; afficheMatrix(h_c,M,N); verify_result(h_a, h_b, h_c); cout << "terminé avec succès"<<endl; cudaFree(d_a); cudaFree(d_b); cudaFree(d_c); return 0; } __global__ void matrixMul(const int *a, const int *b, int *c) { int row = blockIdx.y * blockDim.y + threadIdx.y; int col = blockIdx.x * blockDim.x + threadIdx.x; __shared__ int s_a[SHMEM_SIZE]; __shared__ int s_b[SHMEM_SIZE]; int tmp = 0; for (int i = 0; i < K_padded; i += blockDim.x) { s_a[threadIdx.y * blockDim.x + threadIdx.x] = a[row * K + i + threadIdx.x]; s_b[threadIdx.y * blockDim.x + threadIdx.x] = b[i * N + threadIdx.y * N + col]; __syncthreads(); for (int j = 0; j < blockDim.x; j++) tmp += s_a[threadIdx.y * blockDim.x + j] * s_b[j * blockDim.x + threadIdx.x]; __syncthreads(); } if (row < M && col < N) c[row * N + col] = tmp; } void verify_result(vector<int> &a, vector<int> &b, vector<int> &c) { for (int row = 0; row < M_padded; row++) { if (row >= M) continue; for (int col = 0; col < N_padded; col++) { if (col >= N) continue; int tmp = 0; for (int i = 0; i < K_padded; i++) tmp += a[row * K + i] * b[i * N + col]; assert(tmp == c[row * N + col]); } } } void initMatrix(vector<int>& m,int line, int colone) { for (int i = 0; i <line; i++) { for (int j = 0; j < colone; j++) { if (i < M && j < K) m[i * K + j] = rand() % 100; else m[i * K + j] = 0; cout<<m[i]<<" "; } cout<<endl; } cout<<"\n_______________________________________"<<endl; } void afficheMatrix(vector<int>& m,int line, int colone) { for (int i = 0; i <line; i++) { for (int j = 0; j < colone; j++) { cout<<m[i]<<" "; } cout<<endl; } cout<<"\n_______________________________________"<<endl; }
420
#include <cuda.h> #include <stdlib.h> #include <stdio.h> #include <cuda_profiler_api.h> #include <tuple> #include <iostream> #include <string.h> double time_host = 0; double time_device = 0; int sample_rounds = 10; void meanFilter_host(unsigned char* image_matrix,unsigned char* filtered_image_data,int image_width, int image_height, int window_size) { int half_window = (window_size-window_size % 2)/2; for(int i = 0; i < image_height; i += 1){ for(int j = 0; j < image_width; j += 1){ int k = 3*(i*image_height+j); int top_boundary; int bottom_boundary; int left_boundary; int right_boundary; if(i-half_window >= 0){ top_boundary = i-half_window; }else{ top_boundary = 0; } if(i+half_window <= image_height-1){ bottom_boundary = i+half_window; }else{ bottom_boundary = image_height-1; } if(j-half_window >= 0){ left_boundary = j-half_window; }else{ left_boundary = 0; } if(j+half_window <= image_width-1){ right_boundary = j+half_window; }else{ right_boundary = image_width-1; } double byte1 = 0; double byte2 = 0; double byte3 = 0; for(int x = top_boundary; x <= bottom_boundary; x++){ for(int y = left_boundary; y <= right_boundary; y++){ int pos = 3*(x*image_height + y); byte1 += image_matrix[pos]; byte2 += image_matrix[pos+1]; byte3 += image_matrix[pos+2]; } } int effective_window_size = (bottom_boundary-top_boundary+1)*(right_boundary-left_boundary+1); filtered_image_data[k] = byte1/effective_window_size; filtered_image_data[k+1] = byte2/effective_window_size; filtered_image_data[k+2] = byte3/effective_window_size; } } } __global__ void meanFilter_device(unsigned char* image_matrix, unsigned char* filtered_image_data, int image_width, int image_height, int window_size) { int j = blockIdx.x * blockDim.x + threadIdx.x; int i = blockIdx.y * blockDim.y + threadIdx.y; int half_window = (window_size-window_size % 2)/2; if (i < image_height && j < image_width){ int k = 3*(i*image_height+j); int top_boundary; int bottom_boundary; int left_boundary; int right_boundary; if(i-half_window >= 0){ top_boundary = i-half_window; }else{ top_boundary = 0; } if(i+half_window <= image_height-1){ bottom_boundary = i+half_window; }else{ bottom_boundary = image_height-1; } if(j-half_window >= 0){ left_boundary = j-half_window; }else{ left_boundary = 0; } if(j+half_window <= image_width-1){ right_boundary = j+half_window; }else{ right_boundary = image_width-1; } double byte1 = 0; double byte2 = 0; double byte3 = 0; for(int x = top_boundary; x <= bottom_boundary; x++){ for(int y = left_boundary; y <= right_boundary; y++){ int pos = 3*(x*image_height + y); byte1 += image_matrix[pos]; byte2 += image_matrix[pos+1]; byte3 += image_matrix[pos+2]; } } int effective_window_size = (bottom_boundary-top_boundary+1)*(right_boundary-left_boundary+1); filtered_image_data[k] = byte1/effective_window_size; filtered_image_data[k+1] = byte2/effective_window_size; filtered_image_data[k+2] = byte3/effective_window_size; } } int main(int argc,char **argv) { FILE* f = fopen(argv[1], "rb"); unsigned char info[54]; fread(info, sizeof(unsigned char), 54, f); int width, height; memcpy(&width, info + 18, sizeof(int)); memcpy(&height, info + 22, sizeof(int)); int window_size = strtol(argv[2],NULL,10); printf(" Window size: %d\n",window_size); printf("Image dimensions: (%d, %d)\n",width,height); int size = 3 * width * abs(height); unsigned char* data = new unsigned char[size]; unsigned char* result_image_data_d; unsigned char* result_image_data_h = new unsigned char[size]; unsigned char* result_image_data_h1 = new unsigned char[size]; unsigned char* image_data_d; fread(data, sizeof(unsigned char), size, f); fclose(f); int block_size = 32; int grid_size = width/block_size; dim3 dimBlock(block_size, block_size, 1); dim3 dimGrid(grid_size, grid_size, 1); for(int i = 0; i < sample_rounds; i += 1) { cudaMalloc((void **)&image_data_d,size*sizeof(unsigned char)); cudaMalloc((void **)&result_image_data_d,size*sizeof(unsigned char)); cudaMemcpy(image_data_d,data,size*sizeof(unsigned char),cudaMemcpyHostToDevice); clock_t start_d=clock(); meanFilter_device <<< dimGrid, dimBlock >>> (image_data_d, result_image_data_d, width, height, window_size); cudaThreadSynchronize(); cudaError_t error = cudaGetLastError(); if(error!=cudaSuccess) { fprintf(stderr,"ERROR: %s\n", cudaGetErrorString(error) ); exit(-1); } clock_t end_d = clock(); clock_t start_h = clock(); meanFilter_host(data, result_image_data_h1, width, height, window_size); clock_t end_h = clock(); cudaMemcpy(result_image_data_h,result_image_data_d,size*sizeof(unsigned char),cudaMemcpyDeviceToHost); time_host += (double)(end_h-start_h)/CLOCKS_PER_SEC; time_device += (double)(end_d-start_d)/CLOCKS_PER_SEC; cudaFree(image_data_d); cudaFree(result_image_data_d); } printf(" GPU Time: %f\n",(time_device/sample_rounds)); printf(" CPU Time: %f\n",(time_host/sample_rounds)); printf("CPU/GPU time: %f\n",(time_host/time_device)); return 0; }
421
// pi2.cu /* * A simple CUDA-enabled program that approximates \pi using monte-carlo * sampling. This version generates random numbers on-the-fly within each * kernel. */ #include <iostream> #include <curand.h> #include <curand_kernel.h> #include <stdlib.h> #include <unistd.h> #include <stdbool.h> using namespace std; __global__ void initThreads(float* d_out, curandState_t* states) { int idx = blockIdx.x * blockDim.x + threadIdx.x; curand_init(idx, idx, 0, &states[idx]); d_out[idx] = 0.0; } __global__ void pi(float* d_out, curandState_t* states, int N_TRIALS) { int idx = blockIdx.x * blockDim.x + threadIdx.x; curandState_t tmp_state = states[idx]; int count = 0; for(int i=1; i <= N_TRIALS; i++) { float x = curand_uniform(&tmp_state); float y = curand_uniform(&tmp_state); if( x*x + y*y <= 1.0f ) { count++; } } states[idx] = tmp_state; d_out[idx] += float(count)/float(N_TRIALS); } int main(int argc, char** argv) { int GRID_SIZE = 256; int BLOCK_SIZE = 256; int N_TRIALS = 1000; int N_RUNS = 10; char x; opterr = 0; while((x = getopt(argc, argv, "g:b:t:r:")) != -1) { switch(x) { case 'g': GRID_SIZE = atoi(optarg); break; case 'b': BLOCK_SIZE = atoi(optarg); break; case 't': N_TRIALS = atoi(optarg); break; case 'r': N_RUNS = atoi(optarg); break; case '?': if (optopt == 'g' || optopt == 'b' || optopt == 't' || optopt == 'r') { fprintf (stderr, "Option -%c requires an argument.\n", optopt); } else { fprintf (stderr, "Unknown option `-%c'.\n", optopt); } abort(); default: abort(); } } int N_KERNELS = GRID_SIZE * BLOCK_SIZE; float* h_pis = (float*) malloc(N_KERNELS*sizeof(float)); float* d_pis; cudaMalloc(&d_pis, N_KERNELS * sizeof(float)); curandState_t* states; cudaMalloc(&states, N_KERNELS * sizeof(curandState_t)); time_t start = clock(); initThreads<<<GRID_SIZE, BLOCK_SIZE>>>(d_pis, states); for(int irun=1; irun <= N_RUNS; irun++) { pi<<<GRID_SIZE, BLOCK_SIZE>>>(d_pis, states, N_TRIALS); } cudaMemcpy(h_pis, d_pis, N_KERNELS*sizeof(float), cudaMemcpyDeviceToHost); float avg = 0.0; for(int i=0; i < N_KERNELS; i++) { avg += h_pis[i] / N_RUNS; } avg /= N_KERNELS; time_t end = clock(); int64_t iters = int64_t(N_KERNELS)*int64_t(N_TRIALS)*int64_t(N_RUNS); int elapsed = 1000*(end-start)/CLOCKS_PER_SEC; cout << 4*avg << "\n"; cout << elapsed << "\n"; cout << float(iters)/float(elapsed) << " iters/ms\n"; free(h_pis); cudaFree(d_pis); cudaFree(states); return 0; }
422
#include <iostream> #include <cuda.h> #define DATA_TYPE float #define NX 1024*8 // A = NX * NY #define NY 1024*32 // B = NY * NZ #define NZ 1024 #define GPU_DEVICE 0 using namespace std; __global__ void MatMul(DATA_TYPE* A, DATA_TYPE* B, DATA_TYPE* Out){ int idx = blockIdx.x * blockDim.x + threadIdx.x; int idy = blockIdx.y * blockDim.y + threadIdx.y; DATA_TYPE tmp=0; for(int i=0; i<NY; ++i){ tmp += A[NY*idy+i] * B[i*NZ+idx]; } Out[NX*idy + idx] = tmp; } void init_mat(DATA_TYPE* MAT, int size){ for(int i=0; i<size; ++i){ MAT[i]=1; } } void GPU_argv_init(){ cudaDeviceProp deviceProp; cudaGetDeviceProperties(&deviceProp, GPU_DEVICE); cout<<"setting device "<< GPU_DEVICE << "with name" << deviceProp.name <<endl; cudaSetDevice( GPU_DEVICE); } int main(){ int size_A = NX*NY*sizeof(DATA_TYPE); int size_B = NY*NZ*sizeof(DATA_TYPE); int size_C = NX*NZ*sizeof(DATA_TYPE); DATA_TYPE* hA = (DATA_TYPE*)malloc(size_A); DATA_TYPE* hB = (DATA_TYPE*)malloc(size_B); DATA_TYPE* hC = (DATA_TYPE*)malloc(size_C); // result of matrix multiplication init_mat(hA, NX*NY); init_mat(hB, NY*NZ); DATA_TYPE* dA; DATA_TYPE* dB; DATA_TYPE* dC; GPU_argv_init(); cudaMalloc(&dA, size_A); cudaMalloc(&dB, size_B); cudaMalloc(&dC, size_C); cudaMemcpy(dA, hA, size_A, cudaMemcpyHostToDevice); cudaMemcpy(dB, hB, size_B, cudaMemcpyHostToDevice); dim3 block(32,8); dim3 grid(NY/block.x, 1); MatMul<<< block, grid >>>(dA,dB,dC); cudaDeviceSynchronize(); cudaError_t err = cudaGetLastError(); if (err != cudaSuccess) cout<<"Error:"<< cudaGetErrorString(err) <<endl; cudaMemcpy(hC, dC, size_C, cudaMemcpyDeviceToHost); for(int i=0; i<10; ++i){ cout<<hC[i]; if((i%128) == 127){ cout<<endl; } } cout<<endl; cudaFree(hA); cudaFree(hB); cudaFree(hC); }
423
//This is a matrix multiplication program in CUDA without any optimizations //like tiling, using shared memory etc #include<stdio.h> #include<stdlib.h> #include<cuda_runtime.h> #include<assert.h> __global__ void MatrixMulKernel(float* Md, float* Nd, float* Pd, int width) { //2D thread ID int bx=blockIdx.x; int by=blockIdx.y; int tdx=threadIdx.x; int tdy=threadIdx.y; int tx=bx*blockDim.x+tdx; int ty=by*blockDim.y+tdy; //Pvalue stores the Pd element that is computed by the thread float Pvalue=0; for(int k=0;k<width;++k){ float Mdelement=Md[ty*width+k]; float Ndelement=Nd[k*width+tx]; Pvalue += Mdelement*Ndelement; } //Write the matrix to device memory each thread writes one element Pd[ty*width+tx]=Pvalue; } int main(int argc, char** argv){ int width; int BlockDim; int GridDim; if (argc == 3){ width=atoi(argv[1]); BlockDim=atoi(argv[2]); GridDim=width/BlockDim; printf("Using matrix dimension %dx%d ,Block Dim %dx%d threads per block, Grid Dim %dx%d blocks per grid\n",width,width,BlockDim,BlockDim,GridDim,GridDim); }else{ width=512; BlockDim=16; GridDim=width/BlockDim; printf("Using Default Parameters: matrix dimension %dx%d ,Block Dim %dx%d threads per block, Grid Dim %dx%d blocks per grid\n",width,width,BlockDim,BlockDim,GridDim,GridDim); } dim3 dimBlock(BlockDim,BlockDim); dim3 dimGrid(GridDim,GridDim); cudaError_t error; cudaDeviceProp deviceProp; int devID=0; error=cudaGetDevice(&devID); if (error != cudaSuccess) { printf("cudaGetDevice returned error code %d, line(%d)\n", error, __LINE__); } error=cudaGetDeviceProperties(&deviceProp,devID); if (error != cudaSuccess){ printf("cudaGetDeviceProperties returned error code %d, line(%d)\n", error, __LINE__); }else{ printf("GPU Device %d: \"%s\" with compute capability %d.%d\n\n", devID, deviceProp.name, deviceProp.major, deviceProp.minor); } int size=width*width*sizeof(float); float* M=(float*)malloc(size); float* N=(float*)malloc(size); float* P=(float*)malloc(size); float* Md,*Nd,*Pd; if(!(M&&N)){ printf("Malloc failed\n"); exit(-1); } // initialization of host data for (int j = 0; j < width; j++) { for (int i = 0; i < width; i++) { M[j*width + i] = (float)(rand()%50); N[j*width + i] = (float)(rand()%50); P[j*width + i] = 0; } } error=cudaMalloc((void**)&Md,size); if(error!=cudaSuccess){ printf("Device memory allocation for M failed \n"); exit(-1); } error=cudaMalloc((void**)&Nd,size); if(error!=cudaSuccess){ printf("Device memory allocation for N failed \n"); exit(-1); } error=cudaMalloc((void**)&Pd,size); if(error!=cudaSuccess){ printf("Device memory allocation for P failed \n"); exit(-1); } error=cudaMemcpy(Md,M,size,cudaMemcpyHostToDevice); if(error!=cudaSuccess){ printf("Device memory copy for M failed \n"); exit(-1); } error=cudaMemcpy(Nd,N,size,cudaMemcpyHostToDevice); if(error!=cudaSuccess){ printf("Device memory copy for N failed \n"); exit(-1); } cudaEvent_t start; error=cudaEventCreate(&start); if(error!=cudaSuccess){ printf("cuda event start failed \n"); exit(-1); } cudaEvent_t stop; error=cudaEventCreate(&stop); if(error!=cudaSuccess){ printf("cuda event stop failed \n"); exit(-1); } error =cudaEventRecord(start,NULL); if(error!=cudaSuccess){ printf("cuda event start record failed \n"); exit(-1); } MatrixMulKernel<<<dimGrid,dimBlock>>>(Md,Nd,Pd,width); // error=cudaDeviceSynchronize(); error =cudaEventRecord(stop,NULL); if(error!=cudaSuccess){ printf("cuda event stop record failed with error=%s\n",cudaGetErrorString(error)); exit(-1); } error = cudaEventSynchronize(stop); if(error!=cudaSuccess){ printf("cuda event sync failed :%s\n",cudaGetErrorString(error)); exit(-1); } float msecTotal=0.0f; error = cudaEventElapsedTime(&msecTotal,start,stop); if(error!=cudaSuccess){ printf("cuda elapsed time calculation failed \n"); exit(-1); } float msecPerMatrixMul = msecTotal; double flopsPerMatrixMul = 2*width*width*width; double gigaFlops=(flopsPerMatrixMul*1.0e-9f)/(msecPerMatrixMul/1000.0f); printf("Performance= %.2f GFlop/s, Time= %.3f msec, Size= %.0f Ops, WorkgroupSize= %u threads/block\n", gigaFlops, msecPerMatrixMul, flopsPerMatrixMul, width * width); error=cudaMemcpy(P,Pd,size,cudaMemcpyDeviceToHost); if(error!=cudaSuccess){ printf("Device memoory copy back for Pd failed \n"); exit(-1); } printf("Very slow Host Matrix Mult \n"); float temp; // initialization of host data for (int i = 0; i < width; ++i) { for ( int j = 0; j < width; ++j) { temp=0; for(int k=0; k<width; ++k) temp+=M[i*width+k]*N[k*width+j]; if(temp != P[i*width+j]){ printf("Matrix Mult Screwed Up!! differ in values CPU:%f and GPU:%f \n",temp,P[i*width+j]); exit(-1); } } } free(M); free(N); free(P); cudaFree(Md); cudaFree(Nd); cudaFree(Pd); cudaDeviceReset(); return 1; }
424
#define TILE_DIM 32 template<typename T> __device__ void vectorDotVector(const T* A, const T* B, T* result, const int length) { __shared__ T a_tile[TILE_DIM]; __shared__ T b_tile[TILE_DIM]; __shared__ T result_tile[TILE_DIM]; for (int i = 0; i < TILE_DIM; i++) { result_tile[i] = 0; } int tx = threadIdx.x; for (int t = 0; t < (length - 1) / TILE_DIM + 1; t++) { int index = t * TILE_DIM + tx; if (index < length) { a_tile[tx] = A[index]; b_tile[tx] = B[index]; } else { a_tile[tx] = 0; b_tile[tx] = 0; } __syncthreads(); result_tile[tx] += a_tile[tx] * b_tile[tx]; __syncthreads(); } T resultValue = 0; if (tx == 0) { for (int i = 0; i < TILE_DIM; i++) { resultValue += result_tile[i]; } result[0] = resultValue; } } template<typename T> __device__ void columnDotRow(const T* vectorA, const T* vectorB, T* resultMatrix, const int lengthA, const int lengthB) { __shared__ T vectorA_tile[TILE_DIM]; __shared__ T vectorB_tile[TILE_DIM]; int bx = blockIdx.x; int by = blockIdx.y; int tx = threadIdx.x; int ty = threadIdx.y; int row = by * blockDim.y + ty; int col = bx * blockDim.x + tx; if (ty == 0) { if (row + tx < lengthA) { vectorA_tile[tx] = vectorA[row + tx]; } if (col < lengthB) { vectorB_tile[tx] = vectorB[col]; } } __syncthreads(); if (row < lengthA && col < lengthB) { resultMatrix[row * lengthB + col] = vectorA_tile[ty] * vectorB_tile[tx]; } }
425
#include <stdio.h> #include <cuda.h> int *a, *b; // host data int *c, *c2; // results //Cuda error checking - non mandatory void cudaCheckError() { cudaError_t e=cudaGetLastError(); if(e!=cudaSuccess) { printf("Cuda failure %s:%d: '%s'\n",__FILE__,__LINE__,cudaGetErrorString(e)); exit(0); } } //GPU kernel __global__ void matrixMultiply(int* A,int* B,int* C, int N){ int ai = threadIdx.y * blockDim.x; int bi = threadIdx.x; int ci = threadIdx.x + threadIdx.y * blockDim.x ; int result = 0; if(ci < N) { for(int i = 0; i < 4; i++){ result += A[ai] * B[bi]; ai++; bi += 4; } C[ci] = result; } } int main(int argc,char **argv) { printf("Begin \n"); //Iterations int n=16; //cantidad de elementos de la matriz, x * y //Number of blocks int nBytes = n*sizeof(int); //memory allocation a = (int *) malloc(nBytes); b = (int *) malloc(nBytes); c = (int *) malloc(nBytes); c2 = (int *) malloc(nBytes); // Data filling for(int i=0;i<n;i++) a[i]=i,b[i]=i; printf("Allocating device memory on host..\n"); //GPU memory allocation int *a_d,*b_d,*c_d; cudaMalloc((void **) &a_d, n*sizeof(int)); cudaMalloc((void **) &b_d, n*sizeof(int)); cudaMalloc((void **) &c_d, n*sizeof(int)); printf("Copying to device..\n"); cudaMemcpy(a_d, a, n*sizeof(int), cudaMemcpyHostToDevice); cudaMemcpy(b_d, b, n*sizeof(int), cudaMemcpyHostToDevice); //Work definition dim3 threadsPerBlock(4, 4); dim3 numBlocks(1, 1); printf("Doing GPU Vector Multiplication\n"); matrixMultiply<<<numBlocks, threadsPerBlock>>>(a_d, b_d, c_d, n); cudaCheckError(); //Wait for kernel call to finish cudaDeviceSynchronize(); //Copying data back to host, this is a blocking call and will not start until all kernels are finished printf("Copying back to host...\n"); cudaMemcpy(c, c_d, n*sizeof(int), cudaMemcpyDeviceToHost); int counter = 0; printf("A\n"); for(int i = 0; i < 4; i++) { for(int j = 0; j < 4; j++) { printf("%d ",a[counter]); counter++; } printf("\n"); } counter = 0; printf("B\n"); for(int i = 0; i < 4; i++) { for(int j = 0; j < 4; j++) { printf("%d ",b[counter]); counter++; } printf("\n"); } counter = 0; printf("C\n"); for(int i = 0; i < 4; i++) { for(int j = 0; j < 4; j++) { printf("%d ",c[counter]); counter++; } printf("\n"); } //Free GPU memory cudaFree(a_d); cudaFree(b_d); cudaFree(c_d); return 0; }
426
#include <algorithm> #include <fstream> #include <iostream> #include <sstream> #include <vector> #define THREADS 64 // Error check----- #define gpuErrchk(ans) \ { gpuAssert((ans), __FILE__, __LINE__); } inline void gpuAssert(cudaError_t code, const char *file, int line, bool abort = true) { if (code != cudaSuccess) { fprintf(stderr, "GPUassert: %s %s %d\n", cudaGetErrorString(code), file, line); if (abort) exit(code); } } // Error check----- // This is a very good idea to wrap your calls with that function.. Otherwise // you will not b Moreover, you may also want to look at how to use // cuda-memcheck and cuda-gdb for debuggin __global__ void deviceDFSk5(int *xadj, int *adj, int *nov, int *counter) { int id = blockIdx.x * blockDim.x + threadIdx.x; __shared__ int ct[THREADS]; if (id < *nov) { ct[threadIdx.x] = 0; for (int i = xadj[id]; i < xadj[id + 1]; i++) { // adj[i] are the neighbors of id vertex, none can be id by // definition (no loops of len-1) if (adj[i] != id) { for (int j = xadj[adj[i]]; j < xadj[adj[i] + 1]; j++) { // adj[j] are the neighbors of the second vertex on this path, // they can't be id. if (adj[j] != adj[i] && adj[j] != id) { for (int k = xadj[adj[j]]; k < xadj[adj[j] + 1]; k++) { // adj[k] are the neighbors of the third vertex, // they can't be equal to id or the second. if (adj[k] != adj[j] && adj[k] != adj[i] && adj[k] != id) { for (int l = xadj[adj[k]]; l < xadj[adj[k] + 1]; l++) { // adj[l] are the neighbors of the fourth vertex, // they can't be equal to id second or the third. if (adj[l] != adj[k] && adj[l] != adj[j] && adj[l] != adj[i] && adj[l] != id) { for (int m = xadj[adj[l]]; m < xadj[adj[l] + 1]; m++) { // adj[l] are the neighbors of the fourth vertex, // they can't be equal to id second or the third. if (adj[m] == id) { ct[threadIdx.x]++; } } } } } } } } } } counter[id] = ct[threadIdx.x]; } } __global__ void deviceDFSk4(int *xadj, int *adj, int *nov, int *counter) { int id = blockIdx.x * blockDim.x + threadIdx.x; __shared__ int ct[THREADS]; if (id < *nov) { ct[threadIdx.x] = 0; for (int i = xadj[id]; i < xadj[id + 1]; i++) { // adj[i] are the neighbors of id vertex, none can be id by // definition (no loops of len-1) if (adj[i] != id) { for (int j = xadj[adj[i]]; j < xadj[adj[i] + 1]; j++) { // adj[j] are the neighbors of the second vertex on this path, // they can't be id. if (adj[j] != adj[i] && adj[j] != id) { for (int k = xadj[adj[j]]; k < xadj[adj[j] + 1]; k++) { // adj[k] are the neighbors of the third vertex, // they can't be equal to id or the second. if (adj[k] != adj[j] && adj[k] != adj[i] && adj[k] != id) { for (int l = xadj[adj[k]]; l < xadj[adj[k] + 1]; l++) { // adj[l] are the neighbors of the fourth vertex, if (adj[l] == id) { ct[threadIdx.x]++; } } } } } } } } counter[id] = ct[threadIdx.x]; } } __global__ void deviceDFSk3(int *xadj, int *adj, int *nov, int *counter) { int id = blockIdx.x * blockDim.x + threadIdx.x; if (id < *nov) { for (int i = xadj[id]; i < xadj[id + 1]; i++) { if (adj[i] > id) { for (int j = xadj[adj[i]]; j < xadj[adj[i] + 1]; j++) { if (adj[j] > adj[i] && adj[j] > id) { for (int k = xadj[adj[j]]; k < xadj[adj[j] + 1]; k++) { if (adj[k] == id) { atomicAdd(&counter[id], 2); atomicAdd(&counter[adj[i]], 2); atomicAdd(&counter[adj[j]], 2); } } } } } } } } void wrapper(int *xadj, int *adj, int *nov, int nnz, int k) { cudaSetDevice(0); int *d_xadj; int *d_adj; int *d_nov; int *d_ct; int *ct = new int[*nov]; cudaMalloc((void **)&d_xadj, (*nov + 1) * sizeof(int)); cudaMalloc((void **)&d_adj, nnz * sizeof(int)); cudaMalloc((void **)&d_nov, sizeof(int)); cudaMalloc((void **)&d_ct, (*nov) * sizeof(int)); if (k == 3) { /*not that necessary, to ensure d_ct is set to zero in the least amount of * lines possible for k=3*/ memset(ct, 0, (*nov) * sizeof(int)); cudaMemcpy(d_ct, ct, (*nov) * sizeof(int), cudaMemcpyHostToDevice); } cudaMemcpy(d_xadj, xadj, (*nov + 1) * sizeof(int), cudaMemcpyHostToDevice); cudaMemcpy(d_adj, adj, (nnz) * sizeof(int), cudaMemcpyHostToDevice); cudaMemcpy(d_nov, nov, sizeof(int), cudaMemcpyHostToDevice); gpuErrchk(cudaDeviceSynchronize()); #ifdef DEBUG std::cout << "malloc copy done" << std::endl; #endif gpuErrchk(cudaDeviceSynchronize()); cudaEvent_t start, stop; cudaEventCreate(&start); cudaEventRecord(start, 0); if (k == 3) deviceDFSk3<<<(*nov + THREADS - 1) / THREADS, THREADS>>>(d_xadj, d_adj, d_nov, d_ct); if (k == 4) deviceDFSk4<<<(*nov + THREADS - 1) / THREADS, THREADS>>>(d_xadj, d_adj, d_nov, d_ct); if (k == 5) deviceDFSk5<<<(*nov + THREADS - 1) / THREADS, THREADS>>>(d_xadj, d_adj, d_nov, d_ct); gpuErrchk(cudaDeviceSynchronize()); cudaEventCreate(&stop); cudaEventRecord(stop, 0); cudaEventSynchronize(stop); cudaMemcpy(ct, d_ct, (*nov) * sizeof(int), cudaMemcpyDeviceToHost); for (int i = 0; i < *nov; i++) printf("%d %d\n", i, ct[i]); float elapsedTime; cudaEventElapsedTime(&elapsedTime, start, stop); printf("GPU took: %f s\n", elapsedTime / 1000); cudaFree(d_xadj); cudaFree(d_adj); cudaFree(d_nov); cudaFree(d_ct); } /*Read the given file and return CSR*/ void *read_edges(char *bin_name, int k) { std::cout << "fname: " << bin_name << std::endl; // count the newlines unsigned int number_of_lines = 0; FILE *infile = fopen(bin_name, "r"); int ch; while (EOF != (ch = getc(infile))) if ('\n' == ch) ++number_of_lines; ++number_of_lines; #ifdef DEBUG std::cout << number_of_lines << " lines" << std::endl; #endif fclose(infile); // read the first line, set it to no vertices. std::ifstream bp(bin_name); int *no_vertices = new int; std::string line; int i, j, max = 0; for (int iter = 0; iter < number_of_lines; iter++) { std::getline(bp, line); std::istringstream myss(line); if (!(myss >> i >> j)) { break; } if (i > max) max = i; if (j > max) max = j; } bp.clear(); bp.seekg(0); *no_vertices = max + 1; int no_edges = (number_of_lines)*2; // bidirectional /*TODO unique and no loop decreases this, we should resize adj * accordingly. Not the end of the world, we will never reach those * indices.*/ // if file ended with \n you'd keep it as is. std::vector<int> *A = new std::vector<int>[*no_vertices]; // std::cout << "allocated A" << std::endl; for (int iter = 0; iter < number_of_lines; iter++) { std::getline(bp, line); std::istringstream myss(line); if (!(myss >> i >> j)) { break; } #ifdef DEBUG std::cout << i << " " << j << std::endl; #endif if (i != j) { // ignore diagonal edges A[i].push_back(j); A[j].push_back(i); } } for (int i = 0; i < *no_vertices; i++) { std::sort(A[i].begin(), A[i].end()); // sort then unique. // you may have 3 1 and 1 3 // if you do not sort, unique doesn't do what I think it would. // also we prefer them sorted in case the file has 1 2 before 1 0 or // sth. using default comparison: std::vector<int>::iterator it; it = std::unique(A[i].begin(), A[i].end()); // 10 20 30 20 10 ? ? ? ? // ^ A[i].resize(std::distance(A[i].begin(), it)); // 10 20 30 20 10 } int sum = 0; int *xadj = new int[*no_vertices + 1]; // last one marks the end of the adj. int *adj = new int[no_edges]; // there are m+1 lines (m '\n's), 2m edges. xadj[0] = 0; for (int i = 0; i < *no_vertices; i++) { // adj.add_to_end(A[i]) for (int j = 0; j < A[i].size(); j++) { adj[sum + j] = A[i][j]; } sum += A[i].size(); xadj[i + 1] = sum; } std::cout << "Done reading." << std::endl; wrapper(xadj, adj, no_vertices, no_edges, k); return 0; } int main(int argc, char *argv[]) { /*first arg is filename, second is k*/ // omp_set_num_threads(8); read_edges(argv[1], atoi(argv[2])); return 0; }
427
#include "includes.h" /* Vector addition with a single thread for each addition */ /* Vector addition with thread mapping and thread accessing its neighbor parallely */ //slower than simpler /* Matrix Matrix multiplication with a single thread for each row */ /* Matrix Matrix multiplication with a single thread for each result element */ /* Matrix Vector multiplication with a block with 4 threads per block, shared block mem and parallel reduce */ __global__ void simple_addition(int *a, int *b,int *c,int len) { int tid=threadIdx.x +blockIdx.x*blockDim.x ; //while (tid<len) c[tid]=a[tid]+b[tid]; //printf("I am block: %d with tid: %d Result: %d \n",blockIdx.x,tid,c[tid]); }
428
#include <stdlib.h> #include <stdio.h> #include <iostream> #include <fstream> #include <string> #include <cmath> #define N 1024 #define BLOCK_SIZE 16 typedef struct { float *elements; int width; int height; } Matrix; void cpu_gj(Matrix A, float *x, float *b, float eps) { float res = 1.0f; float summ1, summ2; float *temp; temp = new float[A.width]; int counter = 0; while(res > eps) { summ2 = 0.0f; for(int i = 0; i < A.width; i++) { summ1 = 0.0f; for(int k =0; k < A.width; k++) if(k!=i) summ1 += A.elements[k + i*A.width]*x[k]; temp[i] = 1/A.elements[i+i*A.width]*(b[i] - summ1); summ2 += abs(temp[i] - x[i]); } for(int i = 0; i < A.width; i++) x[i] = temp[i]; res = summ2; counter++; if(counter==A.width) break; } delete[] temp; std::cout<<"Steps Taken to Convergence = "<< counter<<std::endl; } void load_Matrix(std::string file, Matrix A) { std::ifstream f; f.open(file); for( int i = 0; i <A.height; i++) for(int j = 0; j < A.width; j++) { f >> A.elements[j + A.width*i]; } f.close(); } __global__ void naive_gj(Matrix A, float *x, float *xout, float *b) //Computes one iteration of GJ { int gid = threadIdx.x + blockIdx.x*blockDim.x; float summ1 = 0.0f; float temp; for (int k =0; k < A.width; k++) { if(k!= gid) summ1 += A.elements[k + gid*A.width]*x[k]; } temp = 1.0f/A.elements[gid + gid*A.width]*(b[gid] - summ1); xout[gid] = temp; } __global__ void compute_r(float *xold, const float *xnew) //store abs(diff) in xold { int gid = threadIdx.x + blockDim.x*blockIdx.x; float temp = fabs(xnew[gid] - xold[gid]); xold[gid] = temp; } __global__ void reduce_r(float * d_out, const float *d_in) { // sdata is allocated in the kernel call: via dynamic shared memeory extern __shared__ float sdata[]; int myId = threadIdx.x + blockDim.x*blockIdx.x; int tid = threadIdx.x; //load shared mem from global mem sdata[tid] = d_in[myId]; __syncthreads(); // always sync before using sdata //do reduction over shared memory for(int s = blockDim.x/2; s>0; s >>=1) { if(tid < s) { sdata[tid] += sdata[tid + s]; } __syncthreads(); //make sure all additions are finished } //only tid 0 writes out result! if(tid == 0) { d_out[blockIdx.x] = sdata[0]; } } __global__ void fill(float *xout, float *xin) { int gid = threadIdx.x + blockDim.x*blockIdx.x; xout[gid] = xin[gid]; } void par_gj(Matrix A, float *x, float *b, float eps) { float res = 1.0f; int counter = 0; Matrix d_A; d_A.width = A.width; d_A.height = A.height; float *d_x, *d_b, *d_xnew; float *dres; dres = (float*)malloc(sizeof(float)); cudaMalloc((void**)&d_A.elements, A.width*A.height*sizeof(float)); cudaMalloc((void**)&d_x, A.width*sizeof(float)); cudaMalloc((void**)&d_b, A.height*sizeof(float)); cudaMalloc((void**)&d_xnew, A.width*sizeof(float)); cudaMemcpy(d_A.elements,A.elements,A.width*A.height*sizeof(float),cudaMemcpyHostToDevice); cudaMemcpy(d_x, x, A.width*sizeof(float),cudaMemcpyHostToDevice); cudaMemcpy(d_b, b, A.height*sizeof(float),cudaMemcpyHostToDevice); dim3 dimBlock(16); dim3 dimGrid((A.width+ dimBlock.x - 1)/dimBlock.x); while(res>eps) { //Compute x^{n+1} naive_gj<<<dimGrid,dimBlock>>>(d_A, d_x, d_xnew, d_b); cudaDeviceSynchronize(); //Compute vector of residuals compute_r<<<dimGrid,dimBlock>>>(d_x,d_xnew); //Store r in d_x cudaDeviceSynchronize(); //Reduce vector of residuals to find norm reduce_r<<<1,N, N*sizeof(float)>>>(d_x, d_x); cudaMemcpy(dres, d_x, sizeof(float), cudaMemcpyDeviceToHost); res = dres[0]; std::cout<<res<<std::endl; //X = Xnew fill<<<dimGrid,dimBlock>>>(d_x, d_xnew); cudaDeviceSynchronize(); counter++; if(counter==A.width) break; } std::cout<<"Steps Taken to Convergence = "<< counter<<std::endl; //export X cudaMemcpy(x, d_x, A.width*sizeof(float), cudaMemcpyDeviceToHost); cudaFree(d_x); cudaFree(d_A.elements); cudaFree(d_xnew); cudaFree(d_b); } int main() { // Matrix stuff! Matrix A; A.width = N; A.height = N; A.elements = (float*)malloc(N*N*sizeof(float)); load_Matrix("matrix.dat", A); // Vector stuff! float *x, *b; x = (float*)malloc(N*sizeof(float)); b = (float*)malloc(N*sizeof(float)); for(int i =0; i < N; i++) { b[i] = 1.0f; x[i] = 0.0f; } // Gauss-Jacobi Parameters float eps = 1e-7; // Call the Gauss-Jacobi algorithms par_gj(A, x, b, eps); std::cout<<"Soln X = "<<std::endl; for(int i = 0; i <10; i++) std::cout<< x[i] <<std::endl; // */ free(x); free(b); free(A.elements); }
429
/* * EyLeftUpdater.cpp * * Created on: 01 февр. 2016 г. * Author: aleksandr */ #include "EyLeftUpdater.h" #include "SmartIndex.h" /* * indx должен пренадлежать участку от [0, sizeY-1] */ __device__ void EyLeftUpdater::operator() (const int indx) { int n = indx; Ey(0, n) = coeff[0]*(Ey(2, n) + EyLeft(0, 1, n)) + coeff[1] * (EyLeft(0, 0, n) + EyLeft(2, 0, n) - Ey(1, n) - EyLeft(1, 1, n)) + coeff[2] * EyLeft(1, 0, n) - EyLeft(2, 1, n); for (int m = 0; m < 3; m++) { EyLeft(m, 1, n) = EyLeft(m, 0, n); EyLeft(m, 0, n) = Ey(m, n); } }
430
/* Histogram generation on the GPU. Host-side code. Author: Naga Kandasamy Date modified: 3/11/2017 */ // includes, system #include <stdlib.h> #include <stdio.h> #include <sys/time.h> #include <string.h> #include <math.h> #include <float.h> #define THREAD_BLOCK_SIZE 256 #define NUM_BLOCKS 60 // Define the size of a tile #define HISTOGRAM_SIZE 256 // Histogram has 256 bins // includes, kernels #include "histogram_kernel.cu" //////////////////////////////////////////////////////////////////////////////// // declaration, forward void run_test(int); void compute_on_device(int *, int *, int, int); void check_for_error(const char *); extern "C" void compute_gold(int *, int *, int, int); void check_histogram(int *, int, int); int main( int argc, char** argv) { if(argc != 2){ printf("Usage: histogram <num elements> \n"); exit(0); } int num_elements = atoi(argv[1]); run_test(num_elements); return 0; } //////////////////////////////////////////////////////////////////////////////// //! Generate the histogram on the CPU and the GPU and compare results for correctness //////////////////////////////////////////////////////////////////////////////// void run_test(int num_elements) { float diff; int i; int *histogram_on_cpu = (int *)malloc(sizeof(int) * HISTOGRAM_SIZE); // Space to store histogram generated by the CPU int *histogram_on_gpu = (int *)malloc(sizeof(int) * HISTOGRAM_SIZE); // Space to store histogram generated by the GPU // Allocate memory on the CPU for the input data int size = sizeof(int) * num_elements; int *input_data = (int *)malloc(size); // Randomly generate input data. Initialize the input data to be integer values between 0 and (HISTOGRAM_SIZE - 1) for(i = 0; i < num_elements; i++) input_data[i] = floorf((HISTOGRAM_SIZE - 1) * (rand()/(float)RAND_MAX)); printf("Creating histrgram on the CPU."); // Compute the reference solution on the CPU struct timeval start, stop; gettimeofday(&start, NULL); compute_gold(input_data, histogram_on_cpu, num_elements, HISTOGRAM_SIZE); gettimeofday(&stop, NULL); printf("Elapsed time on the CPU = %f \n",stop.tv_sec - start.tv_sec + (stop.tv_usec - start.tv_usec)/(float)1000000); check_histogram(histogram_on_cpu, num_elements, HISTOGRAM_SIZE); // Compute the result vector on the GPU compute_on_device(input_data, histogram_on_gpu, num_elements, HISTOGRAM_SIZE); check_histogram(histogram_on_gpu, num_elements, HISTOGRAM_SIZE); // Compute the differences between the CPU and GPU results diff = 0.0; for(i = 0; i < HISTOGRAM_SIZE; i++) diff = diff + abs(histogram_on_cpu[i] - histogram_on_gpu[i]); printf("Difference between the CPU and GPU result: %f. \n", diff); // cleanup memory free(input_data); free(histogram_on_cpu); free(histogram_on_gpu); return; } // Transfer the input data to the GPU, set up grid and thread dimensions, excute kernel function, and copy result back to the CPU void compute_on_device(int *input_data, int *histogram, int num_elements, int histogram_size) { int *input_data_on_device = NULL; int *histogram_on_device = NULL; // Allocate space on the GPU for the input data cudaMalloc((void**)&input_data_on_device, num_elements * sizeof(int)); cudaMemcpy(input_data_on_device, input_data, num_elements * sizeof(int), cudaMemcpyHostToDevice); // Allocate space on the GPU for the histogram and initialize the contents to zero cudaMalloc((void**)&histogram_on_device, histogram_size * sizeof(int)); cudaMemset(histogram_on_device, 0, histogram_size * sizeof(int)); // Set up the execution grid on the GPU dim3 thread_block(THREAD_BLOCK_SIZE, 1, 1); dim3 grid(NUM_BLOCKS,1); printf("Generating histogram on the GPU. \n"); struct timeval start, stop; gettimeofday(&start, NULL); // histogram_kernel_slow<<<grid, thread_block>>>(input_data_on_device, histogram_on_device, num_elements, histogram_size); histogram_kernel_fast<<<grid, thread_block>>>(input_data_on_device, histogram_on_device, num_elements, histogram_size); cudaThreadSynchronize(); gettimeofday(&stop, NULL); printf("Elapsed time on the GPU = %f \n",stop.tv_sec - start.tv_sec + (stop.tv_usec - start.tv_usec)/(float)1000000); check_for_error("KERNEL FAILURE"); // Copy the result back from the GPU and store cudaMemcpy(histogram, histogram_on_device, histogram_size * sizeof(int), cudaMemcpyDeviceToHost); // Free memory on the GPU cudaFree(input_data_on_device); cudaFree(histogram_on_device); } void check_histogram(int *histogram, int num_elements, int histogram_size) { int sum = 0; for(int i = 0; i < histogram_size; i++) sum += histogram[i]; printf("Number of histogram entries = %d. \n", sum); if(sum == num_elements) printf("Histogram generated successfully. \n"); else printf("Error generating histogram. \n"); printf("\n"); } void check_for_error(const char *msg) { cudaError_t err = cudaGetLastError(); if(cudaSuccess != err){ printf("CUDA ERROR: %s (%s). \n", msg, cudaGetErrorString(err)); exit(EXIT_FAILURE); } }
431
#include "includes.h" __global__ void unaccumulatedPartSizesKernel(int size, int *accumulatedSize, int *sizes) { int idx = blockIdx.x * blockDim.x + threadIdx.x; if(idx == 0) sizes[idx] = accumulatedSize[0]; else if(idx < size) { sizes[idx] = accumulatedSize[idx] - accumulatedSize[idx - 1]; } }
432
#include <stdio.h> #include <sys/time.h> __global__ void log1p(double p, double q, double * y) { y[0] = q + log1p(exp(p - q)); } __global__ void log_1p(double p, double q, double * y) { y[0] = q + log(1 + exp(p - q)); } int main(void) { double a, b; double * y; cudaMallocManaged(&y, sizeof(*y)); y[0] = 100.0; printf("Case1:\n"); a = -7869.9955677831958382739685475826263427734375; b = -7869.5160871966154445544816553592681884765625; log1p<<<1, 1>>>(a, b, y); printf("log1p CPU: %.60f\n", b + log1p(exp(a - b))); cudaDeviceSynchronize(); printf("log1p GPU: %.60f\n", y[0]); log_1p<<<1, 1>>>(a, b, y); printf("log(1 + x) CPU: %.60f\n", b + log(1 + exp(a - b))); cudaDeviceSynchronize(); printf("log(1 + x) GPU: %.60f\n", y[0]); printf("Case2:\n"); a = -39983.496316437478526495397090911865234375; b = -39983.274149101882358081638813018798828125; log1p<<<1, 1>>>(a, b, y); printf("log1p CPU: %.60f\n", b + log1p(exp(a - b))); cudaDeviceSynchronize(); printf("log1p GPU: %.60f\n", y[0]); log_1p<<<1, 1>>>(a, b, y); printf("log(1 + x) CPU: %.60f\n", b + log(1 + exp(a - b))); cudaDeviceSynchronize(); printf("log(1 + x) GPU: %.60f\n", y[0]); printf("Case3:\n"); a = -2639.88414462528953663422726094722747802734375; b = -2633.387596741364177432842552661895751953125; log1p<<<1, 1>>>(a, b, y); printf("log1p CPU: %.60f\n", b + log1p(exp(a - b))); cudaDeviceSynchronize(); printf("log1p GPU: %.60f\n", y[0]); log_1p<<<1, 1>>>(a, b, y); printf("log(1 + x) CPU: %.60f\n", b + log(1 + exp(a - b))); cudaDeviceSynchronize(); printf("log(1 + x) GPU: %.60f\n", y[0]); cudaFree(y); }
433
/* This is the function you need to implement. Quick reference: - input rows: 0 <= y < ny - input columns: 0 <= x < nx - element at row y and column x is stored in data[x + y*nx] - correlation between rows i and row j has to be stored in result[i + j*ny] - only parts with 0 <= j <= i < ny need to be filled */ #include <cuda_runtime.h> #include "device_launch_parameters.h" #include <iostream> #include <math.h> #include <vector> static inline void check(cudaError_t err, const char* context) { if (err != cudaSuccess) { std::cerr << "CUDA error: " << context << ": " << cudaGetErrorString(err) << std::endl; std::exit(EXIT_FAILURE); } } #define CHECK(x) check(x, #x) template <class T> void cuda_memcpy(T* target, const T* source, std::size_t num, cudaMemcpyKind direction) { CHECK(cudaMemcpy(target, source, num * sizeof(T), direction)); } // params: // data : transposed padding data __global__ void correlate_gpu(int ny, int nx, const float*data, float *result, int new_ny){ const int nd=16;// nd: nd==blockDim.x==blockDim.y // compute nd*nd results each thread. int step=nd*nd;// each block will compute step*step results. int ia=threadIdx.x; int ja=threadIdx.y; int ic=blockIdx.x; int jc=blockIdx.y; // int i=threadIdx.x+blockIdx.x*blockDim.x; // int j=threadIdx.y+blockIdx.y*blockDim.y; // if(i>=ny || j>=ny) return; // if (i>j){ // result[i*ny+j]=0; // return; // } float v[nd][nd]; // double temp=0; for(int ib=0; ib<nd; ib++){ for(int jb=0; jb<nd; jb++){ v[ib][jb]=0; } } for (int k=0; k<nx; ++k){ float x[nd]; float y[nd]; for(int ib=0; ib<nd; ib++){ int i=ic*step+ib*nd+ia; x[ib]=data[k*new_ny +i]; } for(int jb=0; jb<nd; jb++){ int j=jc*step+jb*nd+ja; y[jb]=data[k*new_ny+j]; } for(int ib=0; ib<nd; ib++){ for(int jb=0; jb<nd; jb++){ v[ib][jb]+=x[ib]*y[jb]; } } } for(int ib=0; ib<nd; ib++){ for(int jb=0; jb<nd; jb++){ int i=ic*step+ib*nd+ia; int j=jc*step+jb*nd+ja; if(i<ny&&j<ny&&i<=j){ result[ny*i+j]=v[ib][jb]; } } } // result[i*ny+j]=temp; } __global__ void padding_transpose(int ny, int nx, const float*data, float* result, int new_ny){ //result is padding and transpose data int ja=threadIdx.x; int i=blockIdx.y; for (int jb=0; jb<nx; jb+=blockDim.x){ int j=jb+ja; if (j>=nx) break; float v=i<ny?data[i*ny+j]:0; //padding result[new_ny*j+i]=v; //transpose } } static inline int divup(int a, int b) { return (a + b - 1)/b; } static inline int roundup(int a, int b) { return divup(a, b) * b; } void correlate(int ny, int nx, const float *data, float *result) { // const int nd=16;//compute nd*nd results each thread. could not less than const int block_size=16; //16*16 threads const int step=block_size*block_size; // each block will compute step*step results. int new_ny=roundup(ny,step); //allocate memory & copy data to GPU float *dGPU=NULL; CHECK(cudaMalloc((void**)&dGPU,ny*nx*sizeof(float))); float *padding=NULL; CHECK(cudaMalloc((void**)&padding,new_ny*nx*sizeof(float))); float *rGPU=NULL; CHECK(cudaMalloc((void**)&rGPU,ny*ny*sizeof(float))); // float *avg=new float[ny]{0}; // float *normalized=new float[ny*nx]{0}; // float *sqrtSqureSum=new float[ny]{0}; std::vector<float> avg(ny,0); std::vector<float> normalized(ny*nx,0); std::vector<float> sqrtSqureSum(ny,0); std::vector<float> transposed(nx*new_ny,0); for (int y=0; y<ny; ++y){ double temp=0; for (int x=0; x<nx; ++x){ temp+=data[y*nx+x]; } avg[y]=temp/nx; } for (int y=0; y<ny; ++y){ for (int x=0; x<nx; ++x){ normalized[y*nx+x]=data[y*nx+x]-avg[y]; } } // delete[] avg; for (int y=0; y<ny; ++y){ for (int x=0; x<nx; ++x){ sqrtSqureSum[y]+=pow(normalized[y*nx+x],2); } sqrtSqureSum[y]=sqrt(sqrtSqureSum[y]); } for (int y=0; y<ny; ++y){ for (int x=0; x<nx; ++x){ normalized[y*nx+x]/=sqrtSqureSum[y]; } } for (int y=0; y<ny; ++y){ for (int x=0; x<nx; ++x){ std::cout << normalized[y*nx+x] << " "; } std::cout<< std::endl ; } cuda_memcpy(dGPU,normalized.data(),ny*nx,cudaMemcpyHostToDevice); // Run kernel to padding and transpose { dim3 dimBlock(64,1); dim3 dimGrid(1,new_ny); padding_transpose<<<dimGrid,dimBlock>>>(ny,nx,dGPU,padding,new_ny); CHECK(cudaGetLastError()); } cuda_memcpy(transposed.data(), padding, new_ny * nx, cudaMemcpyDeviceToHost); std::cout << new_ny<<std::endl; std::cout << transposed.size()<<std::endl; for(int x=0;x<nx;x++){ for(int y=0;y<new_ny;y++){ std::cout<< transposed[x*new_ny+y] << " "; } std::cout<< std::endl<< "----"<< std::endl; } // for (int x=0;x<nx;++x){ // for (int y=0; y<ny; ++y){ // transposed[x*ny+y]=normalized[y*nx+x]; // } // } // Run kernel to calculate cp { dim3 dimBlock(block_size,block_size); dim3 dimGrid(new_ny/step,new_ny/step); correlate_gpu<<<dimGrid,dimBlock>>>(ny,nx,padding,rGPU,new_ny); CHECK(cudaGetLastError()); } cuda_memcpy(result, rGPU, ny * ny, cudaMemcpyDeviceToHost); // CHECK(cudaMemcpy(result, rGPU, ny * ny * sizeof(float), cudaMemcpyDeviceToHost)); CHECK(cudaFree(dGPU)); CHECK(cudaFree(padding)); CHECK(cudaFree(rGPU)); // delete[] normalized; } int main(){ int ny=3; int nx=2; // float data[]={+0.81472367, +0.90579194, // +0.45150527, +0.49610928}; //result: 1 1 0 1 float data[]={ -1.00000000, +1.00000000, +1.00000000, -1.00000000, -1.00000000, +1.00000000 }; // float data[]={-1.0, 1.0, 1.0, -1.0, -1.0,1.0, -1.0, -1.0, 1.0, 1.0, // -1.0, 1.0, 1.0, -1.0, -1.0,1.0, -1.0, -1.0, 1.0, 1.0,}; float result[9]; correlate(ny, nx, data, result); std::cout<<"result"<<std::endl; for (int i=0;i<4;i++){ std::cout<<result[i]<<" "; } // int nc=20; // std::vector<std::tuple<int,int,int>> rows((1+nc)*nc/2); // // #pragma omp parallel for // for (int ia = 0; ia < nc; ++ia) { // for (int ja = ia; ja < nc; ++ja) { // int ija = _pdep_u32(ia, 0x55555555) | _pdep_u32(ja, 0xAAAAAAAA); // int p= ia*nc-(ia-1)*ia/2; // std::cout<<p+ja-ia<<std::endl; // rows[p+(ja-ia)]=std::make_tuple(ija, ia, ja) ; // } // } // std::sort(rows.begin(), rows.end()); // int i=0; // std::cout<<"result"<<std::endl; // for(auto row:rows){ // std::cout<< i << ","<<std::get<0>(row) << ":" // << std::get<1>(row) << "," // << std::get<2>(row) << std::endl; // i++; // } // double4_t test={0,1,2,3}; // double4_t sw1=swap1(test); // double4_t sw2=swap2(test); // for (int i=0;i<4;i++){ // std::cout<<test[i]<<" "; // } // std::cout<<"result"<<std::endl; // for (int i=0;i<4;i++){ // std::cout<<sw1[i]<<" "; // } // std::cout<<"result"<<std::endl; // for (int i=0;i<4;i++){ // std::cout<<sw2[i]<<" "; // } return 0; }
434
#include<stdio.h> #include<cuda.h> # define M 1000 # define N 1000 __global__ void mult( int * a, int * b, int * c) { unsigned int i= blockDim.x *blockIdx.x + threadIdx.x; unsigned int j= blockDim.y *blockIdx.y + threadIdx.y; int sum=0; if(i<M && j<N) { for(int k=0;k<N;k++) { sum+=(a[i*N+k]* b[k*N+j]); } c[i*N+j]=sum; } else return ; } int check(int *a, int *b, int *c) { for(int i=0;i<M;i++) { for(int j=0;j<N;j++) { int sum=0; for(int k=0;k<N;k++) { sum+=a[i*N+k]*b[k*N+j]; } if(c[i*N+j]!=sum) return 0; } } return 1; } int main() { int *h_a, *h_b, *h_c; int *d_a, *d_b, *d_c; // allocating memory on host h_a = (int *)malloc(M * N * sizeof(int)); h_b = (int *)malloc(M * N * sizeof(int)); h_c = (int *)malloc(M * N * sizeof(int)); //assigning random values to the array elements for(int i=0;i<M;i++) { for(int j=0;j<N;j++) { h_a[i*M+j]=1; h_b[i*M+j]=2; } } //assigning memory on the device cudaMalloc((void **)&d_a, M*N*sizeof(int)); cudaMalloc((void **)&d_b, M*N*sizeof(int)); cudaMalloc((void **)&d_c, M*N*sizeof(int)); //copying elements from host to device cudaMemcpy(d_a, h_a, M*N*sizeof(int), cudaMemcpyHostToDevice); cudaMemcpy(d_b, h_b, M*N*sizeof(int), cudaMemcpyHostToDevice); //declaring the number of blocks and number of threads per block dim3 threads(32,32); dim3 blocks(M/32+1, N/32+1); //calling the function and calculating the sum on device mult<<< blocks, threads >>>(d_a, d_b, d_c); //copying the result to host memory cudaMemcpy(h_c, d_c, M*N*sizeof(int), cudaMemcpyDeviceToHost); if(check(h_a, h_b, h_c)) printf("Matrix multiplication is correct\n"); else printf("Matrix multiplication is incorrect\n"); cudaFree(d_a); cudaFree(d_b); cudaFree(d_c); free(h_a); free(h_b); free(h_c); }
435
#include "includes.h" /* #define N 512 #define N 2048 #define THREADS_PER_BLOCK 512 */ const int THREADS_PER_BLOCK = 32; const int N = 2048; __global__ void dotProd( int *a, int *b, int *c ) { __shared__ int temp[N]; temp[threadIdx.x] = a[threadIdx.x] * b[threadIdx.x]; __syncthreads(); // Evita condición de carrera. if( 0 == threadIdx.x ) { int sum = 0; for(int i = 0; i < N; i++ ) { sum += temp[i]; //lento } *c = sum; } }
436
__global__ void convolution2D(float *A,float *B,const int numRows,const int numCols) { int i = blockDim.x*blockIdx.x + threadIdx.x; int j = blockDim.y*blockIdx.y + threadIdx.y; if (i<numRows && j<numRows) { float pos1=0,pos2=0,pos3=0,pos4=0,pos5=0,pos6=0,pos7=0,pos8=0; if((i-1)>=0 && (j-1)>=0)pos1 = A[(i-1)*numCols+(j-1)]; if((i-1)>=0)pos2 = A[(i-1)*numCols+(j)]; if((i-1)>=0 && (j+1)<numCols)pos3 = A[(i-1)*numCols+(j+1)]; if((j-1)>=0)pos4 = A[(i)*numCols+(j-1)]; if((j+1)<numCols)pos5 = A[(i)*numCols+(j+1)]; if((i+1)<numRows && (j-1)>0)pos6 = A[(i+1)*numCols+(j-1)]; if((i+1)<numRows)pos7 = A[(i+1)*numCols+(j)]; if((i+1)<numRows && (j+1)<numCols)pos8 = A[(i+1)*numCols+(j+1)]; B[i*numCols + j] = (pos1 + pos2 + pos3 +pos4 + pos5 + pos6 + pos7 + pos8)/8; } }
437
/* Write GPU code to perform the step(s) involved in counting sort. Add additional kernels and device functions as needed. */ __global__ void counting_sort_kernel(int *input_array, int *sorted_array, int *histogram, int *scan, int num_elements, int range) { extern __shared__ int temp[]; int threadID = blockIdx.x * blockDim.x + threadIdx.x; int blockID = threadIdx.x; int pout = 0, pin = 1; int n = range + 1; temp[blockID] = (blockID > 0) ? histogram[blockID - 1] : 0; int offset; for (offset = 1; offset < n; offset *= 2) { pout = 1 - pout; pin = 1 - pout; __syncthreads(); temp[pout * n + blockID] = temp[pin * n + blockID]; if (blockID >= offset) temp[pout * n + blockID] += temp[pin * n + blockID - offset]; } __syncthreads(); scan[blockID] = temp[pout * n + blockID]; int j; int start_idx = scan[threadID]; if (histogram[threadID] != 0) for (j = 0; j < histogram[threadID]; j++) sorted_array[start_idx + j] = threadID; return; } __global__ void histogram_kernel_fast(int *input_data, int *histogram, int num_elements, int histogram_size) { extern __shared__ unsigned int s[]; if(threadIdx.x < histogram_size) s[threadIdx.x] = 0; __syncthreads(); int offset = blockIdx.x * blockDim.x + threadIdx.x; int stride = blockDim.x * gridDim.x; while (offset < num_elements) { atomicAdd(&s[input_data[offset]], 1); offset += stride; } __syncthreads(); if(threadIdx.x < histogram_size) atomicAdd(&(histogram[threadIdx.x]), s[threadIdx.x]); }
438
#include "includes.h" __global__ void BoxReciprocalGPU(double *gpu_prefact, double *gpu_sumRnew, double *gpu_sumInew, double *gpu_energyRecip, int imageSize) { int threadID = blockIdx.x * blockDim.x + threadIdx.x; if(threadID >= imageSize) return; gpu_energyRecip[threadID] = ((gpu_sumRnew[threadID] * gpu_sumRnew[threadID] + gpu_sumInew[threadID] * gpu_sumInew[threadID]) * gpu_prefact[threadID]); }
439
#include "cuda_runtime.h" #include "device_launch_parameters.h" #include <cuda.h> #include <stdio.h> #include <device_functions.h> //#include "device_launch_parameters.h" #include <cuda_runtime_api.h> #include <iostream> #include <cstdlib> #include <fstream> #include <string> #include <cmath> #include <time.h> using namespace std; const int range = 128; const int workPerThread = 64;//cannot be smaller than the range int halfRange = range / 2; float cube[range*range*range]; int weight[range*range*range]; bool ou[range][range][range]; //float p = 0.8; __global__ void calculate(float *cubecu, int *weightcu, float *pixelcu, float *rotcu,float mx,float my,float mz,int range,int workPerThread)// float *mxcu, float *mycu, float *mzcu, int *rangecu) { float pos1[3]; float pos2[3]; int pos3[3]; int i, j, k,l,m; float tmp1; int posInCube; int zdim; __shared__ float rotcus[9];//,range; __shared__ float pixelcus[10000]; int xtot = 99; int ytot = 99; int total = xtot*ytot; int pixelstart= (threadIdx.y*blockDim.x + threadIdx.x)*64; int pixelend=pixelstart+64; if (pixelend > total) pixelend = total; for (i=pixelstart;i<pixelend;i++)//parallel fetch the depth image pixelcus[i] = pixelcu[i]; if ((threadIdx.x == 0) && (threadIdx.y == 0) && (threadIdx.z == 0)) { for (i = 0; i < 9; i++) rotcus[i] = rotcu[i]; //for (i = 0; i <total; i++) //pixelcus[i] = pixelcu[i]; } __syncthreads(); i = blockDim.x*blockIdx.x + threadIdx.x; j = blockDim.y*blockIdx.y + threadIdx.y; for (zdim = 0; zdim < workPerThread; zdim++) { //k = blockDim.z*blockIdx.z + threadIdx.z; k = workPerThread * blockIdx.z + zdim; //cubecu[k*range*range + j*range + i] = rotcus[0]; pos1[0] = i*0.2 / (range)-0.1 - mx; pos1[1] = j*0.2 / (range)-my; pos1[2] = k*0.2 / (range)-0.1 - mz; for (l = 0; l < 3; l++) { pos2[l] = 0; for (m = 0; m < 3; m++) { pos2[l] = pos2[l] + rotcus[l * 3 + m] * pos1[m]; } } pos3[0] = int((pos2[0] + 0.1) / 0.002 + 0.5); pos3[1] = int(pos2[1] / 0.002 + 0.5); //if ((blockIdx.x == 0) && (blockIdx.y == 0) && (blockIdx.z == 0) && (threadIdx.x == 0) && (threadIdx.y == 0) && (threadIdx.z == 0)) //cubecu[k*range*range + j*range + i]=rotcus[0]; //cubecu[0] = 2.0; if (((pos3[0] * ytot + pos3[1]) < xtot*ytot) && ((pos3[0] * ytot + pos3[1]) >= 0)) if (pixelcus[pos3[0] * ytot + pos3[1]] > -0.01) { //cubecu[k*range*range + j*range + i] = range; tmp1 = (pixelcus[pos3[0] * ytot + pos3[1]] - pos2[2]) / 0.001; if ((tmp1 > 1) || (tmp1 < -1)) tmp1 = 0; posInCube = i*range*range + j*range + k; cubecu[posInCube] = (cubecu[posInCube] * weightcu[posInCube] + tmp1) / (weightcu[posInCube] + 1); weightcu[posInCube] = weightcu[posInCube] + 1; } } } void pro(string a1, float *cubecu, int *weightcu)//calculate rotation matrix and call the 'calculate' function { int xtot, ytot; int i, j; float mx, my, mz, rx, ry, rz,an; float rot[9]; float pixel[100 * 100]; float *pixelcu, *rotcu; a1 += "data.txt"; ifstream fin1(a1); fin1 >> mx; fin1 >> my; fin1 >> mz; fin1 >> rx; fin1 >> ry; fin1 >> rz; fin1 >> an; fin1 >> xtot; fin1 >> ytot; for (i = 0; i<xtot; i++) for (j = 0; j<ytot; j++) { fin1 >> pixel[j+i*ytot]; } fin1.close(); rot[0] = 1 - 2 * ry*ry - 2 * rz*rz; rot[1] = 2 * rx*ry - 2 * rz*an; rot[2] = 2 * rx*rz + 2 * ry*an; rot[3] = 2 * rx*ry + 2 * rz*an; rot[4] = 1 - 2 * rx*rx - 2 * rz*rz; rot[5] = 2 * ry*rz - 2 * rx*an; rot[6] = 2 * rx*rz - 2 * ry*an; rot[7] = 2 * ry*rz + 2 * rx*an; rot[8] = 1 - 2 * rx*rx - 2 * ry*ry; dim3 gb(range/32, range/32, range/workPerThread); dim3 tb(32, 32, 1);//I set the dimension of x and y as 32 because the max threadNum per block is 1024 cudaMalloc((void **)&pixelcu, xtot*ytot * sizeof(float)); cudaMemcpy(pixelcu, pixel, xtot*ytot*sizeof(float), cudaMemcpyHostToDevice); cudaMalloc((void **)&rotcu, 9 * sizeof(float)); cudaMemcpy(rotcu, rot, 9 * sizeof(float), cudaMemcpyHostToDevice); calculate <<<gb, tb >>> (cubecu, weightcu, pixelcu, rotcu, mx, my, mz, range,workPerThread); //cudaFree(&mxcu); cudaFree(&mycu); cudaFree(&mzcu); cudaFree(&rangecu); cudaThreadSynchronize(); cudaFree(pixelcu); cudaFree(rotcu); } int main() { char tmp; int totalVertexOut; int i, j, k; float *cubecu; int *weightcu; clock_t startt = clock(); if (cudaSuccess != cudaMalloc((void **)&cubecu, range*range*range * sizeof(float))) cout << "error1"; if (cudaSuccess != cudaMemset(cubecu, 0, range*range*range * sizeof(float))) cout << "error2"; if (cudaSuccess != cudaMalloc((void **)&weightcu, range*range*range * sizeof(int))) cout << "error3"; if (cudaSuccess != cudaMemset(weightcu, 0, range*range*range * sizeof(int))) cout << "error4"; //----------------load the pixels and calculate the 3D matrix----------------------- pro("bun000",cubecu,weightcu); pro("bun090",cubecu,weightcu); pro("bun180", cubecu, weightcu); pro("bun270", cubecu, weightcu); pro("bun045", cubecu, weightcu); pro("ear_back", cubecu, weightcu); pro("top2", cubecu, weightcu); pro("top3", cubecu, weightcu); pro("bun315", cubecu, weightcu); pro("chin", cubecu, weightcu); //----------------------------------------------------- cudaMemcpy(cube, cubecu, range*range*range * sizeof(float), cudaMemcpyDeviceToHost); cudaMemcpy(weight, weightcu, range*range*range * sizeof(int), cudaMemcpyDeviceToHost); cudaFree(cubecu); cudaFree(weightcu); tmp = char(10); ofstream fout1("bunoutparallel.ply"); totalVertexOut = 0; //----------------struct the final output model------------------------ for (i = 0; i<range - 1; i++) for (j = 0; j<range - 1; j++) for (k = 0; k<range - 1; k++) { ou[i][j][k] = false; if (weight[i*range*range+j*range+k]>0) { if (weight[(i+1)*range*range+j*range+k]>0) if (cube[i*range*range + j*range + k] * cube[(i + 1)*range*range + j*range + k]<0) ou[i][j][k] = true; if (weight[i*range*range+(j+1)*range+k]>0) if (cube[i *range*range + j*range + k] * cube[i*range*range + (j + 1)*range + k]<0) ou[i][j][k] = true; if (weight[i*range*range +j*range+(k+1)]>0) if (cube[i*range*range + j*range + k] * cube[i*range*range + j*range + (k + 1)]<0) ou[i][j][k] = true; if (ou[i][j][k] == true) totalVertexOut++; } else ou[i][j][k] = false; } //----------------------------------------------------------- clock_t endt = clock(); fout1 << "ply" << tmp << "format ascii 1.0" << tmp; fout1 << "element vertex " << totalVertexOut << tmp; fout1 << "property float x" << tmp; fout1 << "property float y" << tmp; fout1 << "property float z" << tmp; fout1 << "end_header" << tmp; for (i = 0; i<range - 1; i++) for (j = 0; j<range - 1; j++) for (k = 0; k<range - 1; k++) if (ou[i][j][k] == true) { fout1 << i - halfRange << ' ' << j - halfRange << ' ' << k - halfRange << tmp; } fout1.close(); ofstream fout2("calculateTime"); double time = (double)(endt - startt) / CLOCKS_PER_SEC; fout2 << "cubesize:" << range << '*' << range << '*' << range << '\n'; fout2 << "time used (without initialize and output part):" << time << '\n'; fout2.close(); return 0; }
440
#include <iostream> #include <math.h> #include<cuda_profiler_api.h> //function to add the elements of two arrays __global__ void add(int n, float *x, float *y) { for (int i = 0; i < n; i++) y[i] = x[i] + y[i]; } int main(void) { //cudaProfilerStart(); int N = 1<<20; //1M elements //int N = 100; //100 elements //Allocate Unified Memory -- accessible from CPU or GPU float *x, *y, *d_x, *d_y; x = (float *)malloc(N*sizeof(float)); y = (float *)malloc(N*sizeof(float)); cudaMalloc(&d_x, N*sizeof(float)); cudaMalloc(&d_y, N*sizeof(float)); //initialize x and y arrays on the host for (int i = 0; i < N; i++) { x[i] = 1.0f; y[i] = 2.0f; } //Copy cudaMemcpy(d_x,x, N*sizeof(float), cudaMemcpyHostToDevice); cudaMemcpy(d_y,y, N*sizeof(float), cudaMemcpyHostToDevice); // Run kernel on 1M elements on the CPU add<<<1,1>>>(N, d_x, d_y); //Wait for GPU to finish before accessing on host //cudaDeviceSynchronize(); cudaMemcpy(y,d_y, N*sizeof(float), cudaMemcpyDeviceToHost); // Check for errors (all values should be 3.0f) float maxError = 0.0f; for (int i = 0; i < N; i++) maxError = fmax(maxError, fabs(y[i]-3.0f)); std::cout << "Max error: " << maxError << std::endl; // Free memory cudaFree(d_x); cudaFree(d_y); free(x); free(y); //cudaProfilerStop(); return 0; }
441
// // Created by Peter Rigole on 2019-04-17. // #include "NeuronProperties.cuh" NeuronProperties::NeuronProperties() : long_time_lambda(0.5), medium_time_lambda(0.5) {} // Copy constructor NeuronProperties::NeuronProperties(const NeuronProperties &neuronProperties) : long_time_lambda(neuronProperties.long_time_lambda), medium_time_lambda(neuronProperties.medium_time_lambda) {} // Destructor NeuronProperties::~NeuronProperties() {} __host__ __device__ float NeuronProperties::getLongTimeLambda() const { return long_time_lambda; } __host__ __device__ float NeuronProperties::getMediumTimeLambda() const { return medium_time_lambda; }
442
/* * BackpropagationCUDA.cu * * Created on: Jan 30, 2012 * Author: wchan */ /** * This file is needed because nvcc doesn't support C++0x yet... we can merge it back in later when nvcc adds support for the C++11 standard */ #include <thrust/device_ptr.h> #include <thrust/transform.h> void mult(double* x, double* y, size_t count) { thrust::device_ptr<double> x_ptr(x); thrust::device_ptr<double> y_ptr(y); thrust::transform(x_ptr, x_ptr + count, y_ptr, x_ptr, thrust::multiplies<double>()); }
443
#include "includes.h" __global__ void copy_sort_int( const float *orig, const unsigned int *sort_idx, const unsigned int nitems, float *sorted ) { for( int i = 0; i < nitems; ++ i ) { sorted[sort_idx[i]] = orig[i]; } }
444
#include "includes.h" __global__ void LeftRightBound2D(double *Hs, double *Ztopo, double *K2e, double *K2w, int BC2D, int M, int N) { int tid = threadIdx.x + blockIdx.x * blockDim.x; while (tid < M) { // no-flow BCs if (BC2D == 0) { Hs[tid*N] = Hs[tid*N+1]; Hs[(tid+1)*N-1] = Hs[(tid+1)*N-2]; } else { // Critical depth flow BCs Hs[tid*N] = hcri + Ztopo[tid*N]; Hs[(tid+1)*N-1] = hcri + Ztopo[(tid+1)*N-1]; } K2w[tid*N] = K2w[tid*N+1]; K2e[(tid+1)*N-1] = K2e[(tid+1)*N-2]; tid += blockDim.x * gridDim.x; } }
445
#include "includes.h" __global__ void imgGray(unsigned char * d_image, unsigned char* d_imagegray, int width, int height){ int row = blockIdx.y*blockDim.y+threadIdx.y; int col = blockIdx.x*blockDim.x+threadIdx.x; if ((width > col) && (height > row)){ d_imagegray[row*width+col]=d_image[(row*width+col)*3+2]*0.299+d_image[(row*width+col)*3+1]*0.587+d_image[(row*width+col)*3]*0.114; } }
446
#include <iostream> #include "../include/lglist.h" #include <thrust/device_vector.h> #define def_dvec(t) thrust::device_vector<t> #define to_ptr(x) thrust::raw_pointer_cast(&x[0]) using namespace std; const int MAX_LENGTH = 170; __device__ void printList(gpu_linearized_stl::list<float, MAX_LENGTH> &l){ if(l.empty()){ printf("\n===== Empty list =====\n\n"); return; } printf("\n===== Showing the list =====\n"); printf("list size = %d \n", l.size()); for(auto i=l.begin(); i!=l.end(); l.increment(i)){ printf("%.2f ", l.at(i)); } printf("\n\n"); } __global__ void test(float *output){ gpu_linearized_stl::list<float, MAX_LENGTH> list; printList(list); // for(int i=0;i<5;++i) list.push_back(i*1.7); printf("for(int i=0;i<5;++i) list.push_back(i*1.7);"); printList(list); // for(int i=6;i<10;++i) list.push_front(i*2.5); printf("for(int i=6;i<11;++i) list.push_front(i*2.5);"); printList(list); // for(int i=0;i<2;++i) list.pop_back(); printf("for(int i=0;i<2;++i) list.pop_back();"); printList(list); // for(int i=0;i<2;++i) list.pop_front(); printf("for(int i=0;i<2;++i) list.pop_front();"); printList(list); // printf("list.at(list.begin())\n"); printf("%.2f\n\n", list.at(list.begin())); // printf("list.front()\n"); printf("%.2f\n\n", list.front()); // auto idx = list.end(); printf("auto idx = list.end(); list.at(list.decrement(idx))\n"); printf("%.2f\n\n", list.at(list.decrement(idx))); // printf("list.back()\n"); printf("%.2f\n\n", list.back()); // list.reverse(); printf("list.reverse();"); printList(list); // list.insert(list.begin(), 3.14); printf("list.insert(list.begin(), 3.14);"); printList(list); // list.insert(list.end(), 3.14); printf("list.insert(list.end(), 3.14);"); printList(list); // list.erase(list.begin()); printf("list.erase(list.begin());"); printList(list); // printf("list.at(list.begin())\n"); printf("%.2f\n\n", list.at(list.begin())); // list.erase(list.end()); printf("list.erase(list.end());"); printList(list); // printf("list.back()\n"); printf("%.2f\n\n", list.back()); // for(auto p=list.begin(); p!=list.end(); list.increment(p)) list.insert(p, 22.22); printf("for(auto p=list.begin(); p!=list.end(); list.increment(p)) list.insert(p, 22.22);"); printList(list); // int p; while((p=list.find(22.22))!=list.end()) list.erase(p); printf("while((auto p=list.find(22.22))!=list.end()) list.erase(p);"); printList(list); gpu_linearized_stl::list<float, MAX_LENGTH> list2; list2.push_back(list.at(list.begin())); list.at(list.begin()) = 10086; printf("Reference checking"); printList(list); printList(list2); } int main(){ def_dvec(float) dev_out(1, 0); test<<<1, 2>>>(to_ptr(dev_out)); return 0; }
447
#include <stdio.h> #include <stdlib.h> #define MAXPOINTS 1000000 #define MAXSTEPS 1000000 #define MINPOINTS 20 #define PI 3.14159265 const int kThreadsPerBlock = 256; int nsteps, // Number of time steps tpoints; // Total points along string float values[MAXPOINTS + 2]; // Values at time t void check_param(void) { char tchar[20]; // check number of points, number of iterations while ((tpoints < MINPOINTS) || (tpoints > MAXPOINTS)) { printf("Enter number of points along vibrating string [%d-%d]: ", MINPOINTS, MAXPOINTS); scanf("%s", tchar); tpoints = atoi(tchar); if ((tpoints < MINPOINTS) || (tpoints > MAXPOINTS)) printf("Invalid. Please enter value between %d and %d\n", MINPOINTS, MAXPOINTS); } while ((nsteps < 1) || (nsteps > MAXSTEPS)) { printf("Enter number of time steps [1-%d]: ", MAXSTEPS); scanf("%s", tchar); nsteps = atoi(tchar); if ((nsteps < 1) || (nsteps > MAXSTEPS)) printf("Invalid. Please enter value between 1 and %d\n", MAXSTEPS); } printf("Using points = %d, steps = %d\n", tpoints, nsteps); } // Device function to calculate new values using wave equation __device__ float do_math(float value, float oldval) { float dtime = 0.3; float c = 1.0; float dx = 1.0; float tau = c * dtime / dx; float sqtau = tau * tau; return (2.0 * value - oldval + sqtau * (-2.0) * value); } // Kernel for computing value of a point at specific time with speific time step __global__ void init_and_update(float *dValues, int tpoints, int nsteps) { int index = blockIdx.x * blockDim.x + threadIdx.x; float fac, x; float value, oldval, newval; if (index >= 1 && index <= tpoints) { // Initialization fac = 2.0 * PI; // Double store in float x = (index - 1.0) / (tpoints - 1.0); // Double store in float value = sin((double)(fac * x)); // Force sin calculation in double oldval = value; // Update for (int i = 1; i <= nsteps; i++) { newval = (index == 1 || index == tpoints)? 0:do_math(value, oldval); oldval = value; value = newval; } dValues[index] = value; } } void printfinal() { for (int i = 1; i <= tpoints; i++) { printf("%6.4f ", values[i]); if (i%10 == 0) printf("\n"); } } int main(int argc, char *argv[]) { float *dValues; // Values in device int size = (MAXPOINTS + 2) * sizeof(float); // Size of memory to store values int numOfBlocks; // Number of blocks used to call kernel sscanf(argv[1],"%d",&tpoints); sscanf(argv[2],"%d",&nsteps); check_param(); cudaMalloc(&dValues, size); // Allocate memory in device numOfBlocks = (tpoints - 1) / kThreadsPerBlock + 1; // Compute and ceil number of block printf("Initializing points on the line...\n"); printf("Updating all points for all time steps...\n"); init_and_update<<<numOfBlocks, kThreadsPerBlock>>>(dValues, tpoints, nsteps); cudaMemcpy(values, dValues, size, cudaMemcpyDeviceToHost); // Copy result back to main memory printf("Printing final results...\n"); printfinal(); printf("\nDone.\n\n"); cudaFree(dValues); // Free memory in device return 0; }
448
#include "includes.h" __global__ void bcnn_backward_upsample_cuda_kernel(size_t dst_sz, float *src, int w, int h, int c, int n, int size, float *dst) { size_t i = (blockIdx.x + blockIdx.y * gridDim.x) * blockDim.x + threadIdx.x; if (i >= dst_sz) { return; } int dst_idx = i; int dst_w = i % (w * size); i = i / (w * size); int dst_h = i % (h * size); i = i / (h * size); int dst_c = i % c; i = i / c; int b = i % n; int in_w = dst_w / size; int in_h = dst_h / size; int in_c = dst_c; int src_idx = b * w * h * c + in_c * w * h + in_h * w + in_w; src[src_idx] += dst[dst_idx]; }
449
/* * reduce an array of 1's by the sum */ #include <stdio.h> #include <stdlib.h> void nonCudaReduce(float* out, float *in, int size); void startClock(char*); void stopClock(char*); void printClock(char*); int main(int argc, char** argv) { if (argc < 2) { printf("Usage: %s #-of-floats\n",argv[0]); exit(1); } int size = atoi(argv[1]); printf("size = %d\n",size); float *h_in; float h_out; h_in = (float*) malloc(size*sizeof(float)); for (int i = 0; i < size; i++) { h_in[i] = 1; } startClock("compute"); nonCudaReduce(&h_out,h_in,size); stopClock("compute"); printf("The sum is %f\n",h_out); free(h_in); printClock("compute"); } void nonCudaReduce(float* out, float* in, int size) { *out = 0.0; for (int i = 0; i < size; i++) { *out += in[i]; } }
450
#include "includes.h" __global__ void repack_input_kernel(float *input, float *re_packed_input, int w, int h, int c) { int index = blockIdx.x*blockDim.x + threadIdx.x; const int items_per_channel = w * h; int c_pack = index % 32; int chan_index = index / 32; int chan = (chan_index * 32) % c; int i = (chan_index * 32) / c; //for (chan = 0; chan < c; chan += 32) { //for (i = 0; i < items_per_channel; ++i) if(i < items_per_channel) { //for (c_pack = 0; c_pack < 32; ++c_pack) { float src = input[(chan + c_pack)*items_per_channel + i]; re_packed_input[chan*items_per_channel + i * 32 + c_pack] = src; } } } }
451
#include<stdio.h> void cpu() { printf("cpu\n"); } __global__ void gpu() { printf("gpu\n"); } int main() { cpu(); gpu<<<1,1>>>(); cudaDeviceSynchronize(); }
452
#include "includes.h" __global__ void reduceSmemDyn(int *g_idata, int *g_odata, unsigned int n) { extern __shared__ int smem[]; // set thread ID unsigned int tid = threadIdx.x; int *idata = g_idata + blockIdx.x * blockDim.x; // set to smem by each threads smem[tid] = idata[tid]; __syncthreads(); // in-place reduction in global memory if (blockDim.x >= 1024 && tid < 512) smem[tid] += smem[tid + 512]; __syncthreads(); if (blockDim.x >= 512 && tid < 256) smem[tid] += smem[tid + 256]; __syncthreads(); if (blockDim.x >= 256 && tid < 128) smem[tid] += smem[tid + 128]; __syncthreads(); if (blockDim.x >= 128 && tid < 64) smem[tid] += smem[tid + 64]; __syncthreads(); // unrolling warp if (tid < 32) { volatile int *vsmem = smem; vsmem[tid] += vsmem[tid + 32]; vsmem[tid] += vsmem[tid + 16]; vsmem[tid] += vsmem[tid + 8]; vsmem[tid] += vsmem[tid + 4]; vsmem[tid] += vsmem[tid + 2]; vsmem[tid] += vsmem[tid + 1]; } // write result for this block to global mem if (tid == 0) g_odata[blockIdx.x] = smem[0]; }
453
#include<stdio.h> #include<iostream> #include<fstream> #include<cuda.h> #include<time.h> #include<sys/time.h> #define IMAGE_LENGTH 2000 #define KERNEL_LENGTH 5 #define MAX_NUMBER 12 #define NumOfBlocks IMAGE_LENGTH/16 #define NumOfThreads 16 using namespace std; ofstream fs("convolucion.txt"); void print_Matrix(int** matrix, int n, int m){ for(int i = 0; i < n; i++){ for(int j = 0; j < m; j++){ cout<<" "<<matrix[i][j]; } cout<<endl; } } int** create_Matrix(int n, int m){ int **matrix; matrix = (int **)malloc(n*sizeof(int *)); for(int i=0; i < n; i++) { matrix[i] = (int *)malloc(m*sizeof(int)); } return matrix; } int** gpu_create_Matrix(int n, int m){ int **matrix; cudaMalloc((void***)&matrix, n*sizeof(int*)); for(int i=0; i < n; i++) { cudaMalloc((void**) &(matrix[i]), m*sizeof(int)); } return matrix; } int** gpu_copy_Matrix(int **host, int n, int m){ int** device = (int **)malloc(n * sizeof(int *)); int **aux = (int **)malloc(n * sizeof(int *)); cudaMalloc((void***)&device, n*sizeof(int*)); for(int i=0; i<n; i++) { cudaMalloc((void**) &(aux[i]), m*sizeof(int)); cudaMemcpy (aux[i], host[i], m*sizeof(float), cudaMemcpyHostToDevice); } cudaMemcpy(device, aux, n*sizeof(int *), cudaMemcpyHostToDevice); return device; } int** cpu_copy_Matrix(int **device, int n, int m){ int** host = (int **)malloc(n * sizeof(int *)); int **aux = (int **)malloc(n * sizeof(int *)); cudaMalloc((void***)&host, n*sizeof(int*)); for(int i=0; i<n; i++) { cudaMalloc((void**) &(aux[i]), m*sizeof(int)); cudaMemcpy (aux[i], device[i], m*sizeof(float), cudaMemcpyDeviceToHost); } cudaMemcpy(host, aux, n*sizeof(int *), cudaMemcpyDeviceToHost); return host; } int** copy_Matrix(int **orig, int n, int m){ int** cpy = create_Matrix(n,m); for(int i=0; i<n; i++) { for(int j=0; i<m; i++){ cpy[i][j] = orig[i][j]; } } return cpy; } void generate_Kernel_Matrix(int** a, int n, int m){ srand( (unsigned)time( NULL ) ); for(int i=0; i<n;i++){ for(int j=0;j<m;j++){ //a[i][j] = (rand()%MAX_NUMBER)+1;; a[i][j] = 1; } } } void generate_Image_Matrix(int** a, int n, int m, int index){ srand( (unsigned)time( NULL ) ); for(int i=0;i<index;i++){ for(int j=0;j<m;j++){ a[i][j] = 0; } } for(int i=0;i<n-index;i++){ for(int j=0;j<index;j++){ a[i][j] = 0; } } for(int i=n-index;i<n;i++){ for(int j=0;j<m;j++){ a[i][j] = 0; } } for(int i=0;i<n;i++){ for(int j=m-index;j<m;j++){ a[i][j] = 0; } } for(int i=index; i<n-index;i++){ for(int j=index;j<m-index;j++){ a[i][j] = (rand()%MAX_NUMBER)+1; //a[i][j] = j; } } } void init_Matrix(int** a,int n, int m){ for(int i=0; i<n;i++){ for(int j=0;j<m;j++){ a[i][j]=0; } } } bool compare_Matrix(int** A, int** B, int n, int m){ bool same = true; for(int i=0; i<n;i++){ for(int j=0;j<m;j++){ if(A[i][j]!=B[i][j]){ same = false; break; } } } return same; } int sumTermsMatrix(int** a, int n, int m){ int suma = 0; for(int i=0; i<n;i++){ for(int j=0;j<m;j++){ suma+=a[i][j]; } } return suma; } void convolucion(int** kernel, int** image, int** result, int KERNELCOUNT){ int i, j, n, m; int acumulador=0; for (i=0; i < IMAGE_LENGTH; i++){ for (j=0; j < IMAGE_LENGTH; j++){ for (n = 0; n < KERNEL_LENGTH; n++){ for (m = 0; m < KERNEL_LENGTH; m++){ acumulador += image[i + n][j + m] * kernel[n][m]; } } result[i][j] = acumulador/KERNELCOUNT; acumulador = 0; } } } __global__ void convolucionCUDA(int** kernel, int** image, int** result, int KERNELCOUNT){ int i, j, n, m; int acumulador=0; for (i=0; i < IMAGE_LENGTH; i++){ for (j=0; j < IMAGE_LENGTH; j++){ for (n = 0; n < KERNEL_LENGTH; n++){ for (m = 0; m < KERNEL_LENGTH; m++){ acumulador += image[i + n][j + m] * kernel[n][m]; } } result[i][j] = acumulador/KERNELCOUNT; acumulador = 0; } } } __global__ void convKernel(int *inData, int *filter, int dataCol, int dataRow, int filRowRad, int filColRad, int *outData) { __shared__ int padRect[2*1024]; int i, col, row, sum = 0; int globalCol = threadIdx.x + blockIdx.x * blockDim.x; int globalRow = threadIdx.y + blockIdx.y * blockDim.y; int globalIdx = globalCol * dataRow + globalRow; int localIdx = threadIdx.x * blockDim.y + threadIdx.y; int localCells = blockDim.x * blockDim.y; int padRectCol = threadIdx.x + filColRad; int padRectRow = threadIdx.y + filRowRad; int padRectOffset = 2*filRowRad + blockDim.y; int padRectCells = padRectOffset * (blockDim.x + 2*filColRad); int *padRectOut = (int*)&padRect[((padRectCells-1)/32 + 1) * 32]; //Padding up with 32 padRectOut[localIdx] = 0; int filOffset = filRowRad*2 + 1; int filCells = filOffset * (filColRad*2 + 1); int *localFilter = (int *)&padRectOut[((localCells-1)/32 + 1) * 32]; //Padding up with 32 // Copying the filter elements to shared memory for(i = 0; i < (filCells/localCells) + 1; i++) { int index = i*localCells + localIdx; if(index < filCells) { localFilter[index] = filter[index]; } } // Copying the Data elements to padded shared memory for(i = 0; i < (padRectCells/localCells) + 1; i++) { int index = i*localCells + localIdx; if(index < padRectCells) { int prCol = index / padRectOffset; int prRow = index % padRectOffset; int glCol = prCol + blockIdx.x*blockDim.x - filColRad; int glRow = prRow + blockIdx.y*blockDim.y - filRowRad; int glIdx = glCol * dataRow + glRow; if(glRow >= 0 && glRow < dataRow && glCol >= 0 && glCol < dataCol) padRect[index] = inData[glIdx]; else padRect[index] = 0; } } __syncthreads(); //Taking Convolution for(col = -filColRad; col <= filColRad; col++) { for(row = -filRowRad; row <= filRowRad; row++) { int filCol = filColRad - col; int filRow = filRowRad - row; int filIdx = filCol*filOffset + filRow; int filVal = localFilter[filIdx]; int prCol = padRectCol + col; int prRow = padRectRow + row; int prIdx = prCol*padRectOffset + prRow; sum += filVal * padRect[prIdx]; } } padRectOut[localIdx] = sum; __syncthreads(); outData[globalIdx] = padRectOut[localIdx]; } int main(){ float parallelTime, serialTime; cudaEvent_t tStart, tStop; cudaEventCreate(&tStart, 0); cudaEventCreate(&tStop, 0); int realKernelLength=0, index = 0; if(KERNEL_LENGTH%2!=0){ realKernelLength = KERNEL_LENGTH - 1; index = KERNEL_LENGTH/2; } else{ cout << "Matrix Convolution siempre debe ser 2*N+1"<<endl; exit(0); } int** kernel = create_Matrix(KERNEL_LENGTH, KERNEL_LENGTH); int** image = create_Matrix(IMAGE_LENGTH+realKernelLength, IMAGE_LENGTH+realKernelLength); int** result = create_Matrix(IMAGE_LENGTH, IMAGE_LENGTH); int** resultCUDA = create_Matrix(IMAGE_LENGTH, IMAGE_LENGTH); generate_Kernel_Matrix(kernel, KERNEL_LENGTH,KERNEL_LENGTH); generate_Image_Matrix(image, IMAGE_LENGTH+realKernelLength, IMAGE_LENGTH+realKernelLength, index); init_Matrix(result, IMAGE_LENGTH, IMAGE_LENGTH); int KERNELCOUNT = sumTermsMatrix(kernel,KERNEL_LENGTH,KERNEL_LENGTH); cudaEventRecord(tStart, 0); convolucion(kernel, image, result, KERNELCOUNT); cudaEventRecord(tStop, 0); cudaEventSynchronize(tStop); cudaEventElapsedTime(&serialTime, tStart, tStop); cudaEventDestroy(tStart); cudaEventDestroy(tStop); if(IMAGE_LENGTH<10){ cout << "Image: "<<endl; print_Matrix(image, IMAGE_LENGTH+realKernelLength, IMAGE_LENGTH+realKernelLength); cout << endl << endl; cout << "Kernel: "<<endl; print_Matrix(kernel, KERNEL_LENGTH, KERNEL_LENGTH); cout << endl << endl; cout << "Result: "<<endl; print_Matrix(result, IMAGE_LENGTH, IMAGE_LENGTH); } cout << "El tiempo en realizar la convolución en tiempo secuencial es: " << serialTime/1000 << endl; // int ns[] = {1, 2, 4, 8}; fs << "ImgLenght KerLenght numthd serialTime parallelTime eff speedUp"<< endl; // ---- int** gpu_kernel = copy_Matrix(kernel, KERNEL_LENGTH, KERNEL_LENGTH); int** gpu_image = copy_Matrix(image, IMAGE_LENGTH+realKernelLength, IMAGE_LENGTH+realKernelLength); init_Matrix(resultCUDA, IMAGE_LENGTH, IMAGE_LENGTH); int** gpu_result = copy_Matrix(resultCUDA, IMAGE_LENGTH, IMAGE_LENGTH); cudaEventCreate(&tStart, 0); cudaEventCreate(&tStop, 0); cudaEventRecord(tStart, 0); dim3 num_threads(NumOfThreads, 16, 1); dim3 numOfBlocks(NumOfBlocks, 1, 1); //convolucionCUDA<<<numOfBlocks, num_threads>>>(gpu_image, gpu_kernel, gpu_result, KERNELCOUNT); cudaEventRecord(tStop, 0); cudaEventSynchronize(tStop); cudaEventElapsedTime(&parallelTime, tStart, tStop); cudaEventDestroy(tStart); cudaEventDestroy(tStop); //resultCUDA = cpu_copy_Matrix(gpu_result, IMAGE_LENGTH, IMAGE_LENGTH); cout << "Son iguales: "<< compare_Matrix(result, resultCUDA, IMAGE_LENGTH, IMAGE_LENGTH) << endl; cout << "El tiempo en realizar la convolución en tiempo Paralelo con " << NumOfBlocks << " bloques y " << NumOfThreads <<" hilos es: " << parallelTime << endl; cout << "Speed UP: "<< serialTime/(parallelTime) << endl; cout << "Eficiencia: "<< serialTime/(parallelTime*NumOfThreads) << endl; fs << IMAGE_LENGTH << " " << KERNEL_LENGTH << " " << NumOfThreads <<" " << serialTime <<" " << parallelTime << " " << serialTime/(parallelTime*NumOfThreads)<<" "<< serialTime/(parallelTime) << endl; cudaFree(gpu_image); cudaFree(gpu_result); cudaFree(gpu_kernel); free(image); free(result); free(kernel); return 0; }
454
#include "includes.h" __global__ void ReturnFloat( float *sum, float *out, const float *pIn ) { out[threadIdx.x] = atomicAdd( &out[threadIdx.x], pIn[threadIdx.x] ); }
455
// https://devblogs.nvidia.com/even-easier-introduction-cuda // https://devblogs.nvidia.com/unified-memory-cuda-beginners #include <iostream> #include <math.h> // cuda kernel __global__ void add(size_t num_elements, const float* x, float* result) { size_t index = blockIdx.x * blockDim.x + threadIdx.x; size_t stride = blockDim.x * gridDim.x; for (size_t i = index; i < num_elements; i += stride) { result[i] += x[i]; } } int main() { const size_t num_elements = 1 << 20; // 1M elements float* x; float* y; cudaMallocManaged(&x, num_elements * sizeof(float)); cudaMallocManaged(&y, num_elements * sizeof(float)); for (size_t i = 0; i < num_elements; i++) { x[i] = 1.0f; y[i] = 2.0f; } // prefetch data to GPU int device = -1; cudaGetDevice(&device); cudaMemPrefetchAsync(x, num_elements * sizeof(float), device, NULL); cudaMemPrefetchAsync(y, num_elements * sizeof(float), device, NULL); size_t block_size = 256; size_t num_blocks = (num_elements + block_size - 1) / block_size; // run kernel on GPU add<<<num_blocks, block_size>>>(num_elements, x, y); // wait for GPU to finish cudaDeviceSynchronize(); float max_error = 0.0f; for (size_t i = 0; i < num_elements; i++) { max_error = fmax(max_error, fabs(y[i] - 3.0f)); } std::cout << "max error: " << max_error << std::endl; cudaFree(x); cudaFree(y); }
456
__global__ void reduction_sum(float *A,int num_elements){ int i = blockIdx.x*blockDim.x + threadIdx.x; if(i<num_elements){ for(int stride = 1;stride<num_elements;stride*=2){ __syncthreads(); if(i%(2*stride) == 0){ float temp = 0; if(i+stride<num_elements)temp = A[i + stride]; float partial_sum = A[i] + temp; A[i] = partial_sum; } } } }
457
#include <cuda.h> #include <iostream> using namespace std; /** * C = A + B (one element per thread) */ __global__ void addMatricesElt(float* C, const float* A, const float* B, int dim) { int col = blockIdx.x * blockDim.x + threadIdx.x; int row = blockIdx.y * blockDim.y + threadIdx.y; if(col < dim && row < dim) { int i = row*dim + col; C[i] = A[i] + B[i]; } } /** * C = A + B (one row per thread) */ __global__ void addMatricesRow(float* C, const float* A, const float* B, int dim) { int row = blockIdx.y * blockDim.y + threadIdx.y; if (row < dim) { int rowdim = row*dim; for (int col = 0; col < dim; ++col) { int i = rowdim + col; C[i] = A[i] + B[i]; } } } /** * C = A + B (one column per thread) */ __global__ void addMatricesCol(float* C, const float* A, const float* B, int dim) { int col = blockIdx.x * blockDim.x + threadIdx.x; if (col < dim) { for (int row = 0; row < dim; ++row) { int i = row*dim + col; C[i] = A[i] + B[i]; } } } int main(int argc, char* argv[]) { int dim = atoi(argv[1]); int size = dim*dim; // creating matrices on host side float* h_A = new float[size]; float* h_B = new float[size]; for (int i = 0; i < size; ++i) { h_A[i] = 1.0f; h_B[i] = 2.0f; } // Copy matrices on device side float* d_A; cudaMalloc((void**)&d_A, size*sizeof(float)); cudaMemcpy((void*)d_A, (void*)h_A, size*sizeof(float), cudaMemcpyHostToDevice); float* d_B; cudaMalloc((void**)&d_B, size*sizeof(float)); cudaMemcpy((void*)d_B, (void*)h_B, size*sizeof(float), cudaMemcpyHostToDevice); // Allocate C matrix on device float* d_C; cudaMalloc((void**)&d_C, size*sizeof(float)); // call Kernel int type = atoi(argv[2]); if (type == 1) { // one element per thread dim3 dimGrid(ceil(dim/16.0f), ceil(dim/16.0f), 1); dim3 dimBlock(16, 16, 1); addMatricesElt<<<dimGrid, dimBlock>>> (d_C, d_A, d_B, dim); } else if (type == 2) { // one row per thread dim3 dimGrid(1, ceil(dim/256.0f), 1); dim3 dimBlock(1, 256, 1); addMatricesRow<<<dimGrid, dimBlock>>> (d_C, d_A, d_B, dim); } else if (type == 3) { // one column per thread dim3 dimGrid(ceil(dim/256.0f), 1, 1); dim3 dimBlock(256, 1, 1); addMatricesCol<<<dimGrid, dimBlock>>> (d_C, d_A, d_B, dim); } else cout << "invalid argument!" << endl; // Recover C matrix from device to host float* h_C = new float[size]; cudaMemcpy((void*)h_C, (void*)d_C, size*sizeof(float), cudaMemcpyDeviceToHost); // Check results for (int i = 0; i < size; ++i) { if (fabs(h_C[i] - 3.0f) > 0.0001f) { cout << "ERROR: something is not right." << endl; break; } } // Finalize storage cudaFree(d_A); cudaFree(d_B); cudaFree(d_C); delete [] h_A; delete [] h_B; delete [] h_C; cout << "Closing..." << endl; return 0; }
458
extern "C" __global__ void shift(float2* arr, int resx, int resy, int resz, int size) { int i = blockDim.x * blockIdx.x + threadIdx.x; int idx = resx / 2; int idy = resy / 2; int idz = resz / 2; float2 tmp; if (i / resy / resz < idx) { if (i / resz % resy < idy) { if (i % resz < idz) { //0 tmp = arr[i]; arr[i] = arr[i + idz + idy * resz + idx * resy * resz]; arr[i + idz + idy * resz + idx * resy * resz] = tmp; } else { //1 tmp = arr[i]; arr[i] = arr[i - idz + idy * resz + idx * resy * resz]; arr[i - idz + idy * resz + idx * resy * resz] = tmp; } } else { if (i % resz < idz) { //2 tmp = arr[i]; arr[i] = arr[i + idz - idy * resz + idx * resy * resz]; arr[i + idz - idy * resz + idx * resy * resz] = tmp; } else { //3 tmp = arr[i]; arr[i] = arr[i - idz - idy * resz + idx * resy * resz]; arr[i - idz - idy * resz + idx * resy * resz] = tmp; } } } }
459
#include "includes.h" __global__ void breadth_first_search_csr_gpu(unsigned int* cum_row_indexes, unsigned int* column_indexes, int* matrix_data, unsigned int* in_infections, unsigned int* out_infections, unsigned int rows) { unsigned int row = blockDim.x * blockIdx.x + threadIdx.x; if (row < rows) { if (in_infections[row] == 1) { out_infections[row] = 1; unsigned int row_start = cum_row_indexes[row]; unsigned int row_end = cum_row_indexes[row+1]; for (int i = row_start; i < row_end; i++) { int timesteps_to_transmission = matrix_data[i]; if (timesteps_to_transmission != 0) { if (timesteps_to_transmission == 1) { out_infections[column_indexes[i]] = 1; } matrix_data[i] -= 1; } } } } }
460
#include "includes.h" __global__ void ForwardLinear(float *A, float *W, float *b, int nRowsW, int nColsW, int nColsA, float *Z) { int row = blockIdx.y * blockDim.y + threadIdx.y; int col = blockIdx.x * blockDim.x + threadIdx.x; float ZValue = 0; if (row < nRowsW && col < nColsA) { for (int i = 0; i < nColsW; i++) { ZValue += W[row * nColsW + i] * A[i * nColsA + col]; } Z[row * nColsA + col] = ZValue + b[row]; } }
461
#include <stdio.h> #include <stdlib.h> #include <stdbool.h> #include <unistd.h> #include <math.h> #include <time.h> // Maximum value of the matrix element #define MAX 100 #define MAX_ITER 100 #define TOL 0.000001 // Generate a random float number with the maximum value of max float rand_float(int max) { return ((float)rand() / (float)(RAND_MAX)) * max; } // Calulates the space for the matrices (bytes) int calc_mem_size(int n, int m) { return (n * m * sizeof(float)); } // Calculates the sum of a given flat matrix (array) float calc_mat_sum(float **mat, int n, int m) { float sum = 0.0f; for (long i = 0; i < (n*m); i++) { sum += (*mat)[i]; } return sum; } // Allocate 2D matrix in the host void alloc_host_matrix(float **mat, int n, int m, bool must_init) { *mat = (float *) malloc(n * m * sizeof(float)); // In case of initializing the matrix with the initial values if (must_init) { for (int i = 0; i < (n*m); i++) { (*mat)[i] = rand_float(MAX); } } } // Allocate 2D matrix in the device void alloc_dev_matrix(float **mat, int n, int m) { size_t memSize = (n * m * sizeof(float)); cudaMalloc(&mat, memSize); } // Write the time results into a CSV file void write_to_file(int n, int num_blocks, int num_threads, float total_time, float exec_time) { FILE *f; char* file_name = "results.csv"; if (access(file_name, F_OK) == -1) { f = fopen(file_name, "a"); fprintf(f, "Matrix size;Blocks;Threads per block;Total time;Operations time;\n"); } else { f = fopen(file_name, "a"); } fprintf(f, "%d;%d;%d;%f;%f;\n", n, num_blocks, num_threads, total_time, exec_time); fclose(f); } // Solver (executed by each thread) __global__ void solver(float **mat, float **mat_diff, int n) { // Original position that this thread is assigned int i_org = (blockDim.x * blockIdx.x) + threadIdx.x; // Real position that this thread is going to compute int i = i_org; i = i + n; // VIP: The threads must avoid first row i = i + 1; // VIP: The threads must avoid first column // In case the thread is leftover if (i >= ((n*n) - n - 1)) { return; } float temp; float diff = 0; int cnt_iter = 0; const int pos_up = i - n; const int pos_do = i + n; const int pos_le = i - 1; const int pos_ri = i + 1; while (cnt_iter < MAX_ITER) { temp = (*mat)[i]; (*mat)[i] = 0.2 * ((*mat)[i] + (*mat)[pos_le] + (*mat)[pos_up] + (*mat)[pos_ri] + (*mat)[pos_do]); // The LAST difference between the prev value and the new value is stored diff = abs((*mat)[i] - temp); cnt_iter ++; } // Finally the difference is store in its corresponding cell // VIP: Use '=' not '+=' to avoid non-zero values on the first func call (*mat_diff)[i_org] = diff; } int main(int argc, char *argv[]) { if (argc < 3) { printf("Call this program with two parameters:\n"); printf("\t matrix_size: Add 2 to a power of 2 (e.g. : 18, 1026)\n"); printf("\t threads_per_block: Better a power of 2 (e.g. : 16, 32, 64)\n"); exit(1); } int n = atoi(argv[1]); int threads_per_block = atoi(argv[2]); printf("Matrix size = %d\n", n); printf("Threads per block = %d\n", threads_per_block); // Start recording the time clock_t i_total_t = clock(); float *host_mat_vals; float *host_mat_diff; float *dev_mat_vals; float *dev_mat_diff; // Allocating matrices space both in host and device alloc_host_matrix(&host_mat_vals, n, n, true); alloc_host_matrix(&host_mat_diff, n-2, n-2, false); alloc_dev_matrix(&dev_mat_vals, n, n); alloc_dev_matrix(&dev_mat_diff, n-2, n-2); // Calculating the memory size for allocating (bytes) size_t all_mat_size = calc_mem_size(n, n); size_t core_mat_size = calc_mem_size(n-2, n-2); // Passing data from host to device cudaMemcpy(dev_mat_vals, host_mat_vals, all_mat_size, cudaMemcpyHostToDevice); // Calculate the number of threads to launch (1 per core cell) int core_dim = (n-2) * (n-2); // Given a constant number of threads per block, determine the blocks int num_blocks = (int) ceil(core_dim / threads_per_block); dim3 dimGrid(num_blocks); dim3 dimBlock(threads_per_block); // Time before the execution clock_t i_exec_t = clock(); while (true) { // Make all the threads synchronous solver<<< dimGrid, dimBlock >>>(&dev_mat_vals, &dev_mat_diff, n); // The ThreadSynchronize would be neccesary in case Memcpy is not done // However, as it is called later on, the following line is commented // cudaThreadSynchronize(); // Passing the differential data back from the device to the host cudaMemcpy(host_mat_diff, dev_mat_diff, core_mat_size, cudaMemcpyDeviceToHost); // Breaks in case of reaching the TOL threshold float diffs_sum = calc_mat_sum(&host_mat_diff, n-2, n-2); float diffs_mean = diffs_sum / (n-2) / (n-2); if (diffs_mean < TOL) { break; } } // Time before the execution clock_t f_exec_t = clock(); // Passing data back from the device to the host cudaMemcpy(host_mat_vals, dev_mat_vals, all_mat_size, cudaMemcpyDeviceToHost); // Finally, the matrices are freed cudaFree(dev_mat_vals); cudaFree(dev_mat_diff); free(host_mat_vals); free(host_mat_diff); // Finish recording the time clock_t f_total_t = clock(); float total_time = (float)(f_total_t - i_total_t) / CLOCKS_PER_SEC; float exec_time = (float)(f_exec_t - i_exec_t) / CLOCKS_PER_SEC; printf("Total time: %f\n", total_time); printf("Operations time: %f\n", exec_time); write_to_file(n, num_blocks, threads_per_block, total_time, exec_time); return 0; }
462
//nvcc -ptx EM5.cu -ccbin "F:Visual Studio\VC\Tools\MSVC\14.12.25827\bin\Hostx64\x64" __device__ void EM1( double *r, double *z, double * ar0, double * br0, double * az0, double * bz0, const int parNum, const int gridR, const int gridZ, const double dr, const double dz ) { int globalBlockIndex = blockIdx.x + blockIdx.y * gridDim.x; int localThreadIdx = threadIdx.x + blockDim.x * threadIdx.y; int threadsPerBlock = blockDim.x*blockDim.y; int n = localThreadIdx + globalBlockIndex*threadsPerBlock; if ( n >= parNum ){ return; } double r0 = r[n]; double z0 = z[n]; int ar,az,a1,a2,a3,a4; double b1,b2,b3,b4; // Er ar = floor(r0/dr-0.5); az = floor(z0/dz); a1 = ar + az * gridR + 1; a2 = (ar+1) + az * gridR + 1; a3 = ar + (az+1) * gridR + 1; a4 = (ar+1) + (az+1) * gridR + 1; if( ar<0 ){ b1 = 0; b2 = (az*dz+dz-z0)/dz; b3 = 0; b4 = (z0-az*dz)/dz; a1 = 1; a3 = 1; } else if( ar >= gridR-1 ){ b1 = (az*dz+dz-z0)/dz; b2 = 0; b3 = (z0-az*dz)/dz; b4 = 0; a2 = 1; a4 = 1; } else{ b1 = ((ar+1.5)*dr-r0)*((az+1)*dz-z0)/(dr*dz); b2 = (r0-(ar+0.5)*dr)*((az+1)*dz-z0)/(dr*dz); b3 = ((ar+1.5)*dr-r0)*(z0-az*dz)/(dr*dz); b4 = (r0-(ar+0.5)*dr)*(z0-az*dz)/(dr*dz); } ar0[n] = a1; ar0[n+parNum] = a2; ar0[n+2*parNum] = a3; ar0[n+3*parNum] = a4; br0[n] = b1; br0[n+parNum] = b2; br0[n+2*parNum] = b3; br0[n+3*parNum] = b4; // Ez ar = floor(r0/dr); az = floor(z0/dz-0.5); a1 = ar + az * (gridR+1) + 1; a2 = (ar+1) + az * (gridR+1) + 1; a3 = ar + (az+1) * (gridR+1) + 1; a4 = (ar+1) + (az+1) * (gridR+1) + 1; if( az<0 ){ b1 = 0; b2 = 0; b3 = (ar*dr+dr-r0)/dr; b4 = (r0-ar*dr)/dr; a1 = 1; a2 = 1; } else if( az >= gridZ-1 ){ b1 = (ar*dr+dr-r0)/dr; b2 = (r0-ar*dr)/dr; b3 = 0; b4 = 0; a3 = 1; a4 = 1; } else{ b1 = ((ar+1)*dr-r0)*((az+1.5)*dz-z0)/(dr*dz); b2 = (r0-ar*dr)*((az+1.5)*dz-z0)/(dr*dz); b3 = ((ar+1)*dr-r0)*(z0-(az+0.5)*dz)/(dr*dz); b4 = (r0-ar*dr)*(z0-(az+0.5)*dz)/(dr*dz); } az0[n] = a1; az0[n+parNum] = a2; az0[n+2*parNum] = a3; az0[n+3*parNum] = a4; bz0[n] = b1; bz0[n+parNum] = b2; bz0[n+2*parNum] = b3; bz0[n+3*parNum] = b4; } __global__ void processMandelbrotElement( double *r, double *z, double * ar0, double * br0, double * az0, double * bz0, const int parNum, const int gridR, const int gridZ, const double dr, const double dz ) { EM1(r, z, ar0, br0, az0, bz0, parNum, gridR, gridZ, dr, dz); }
463
/************************************************************************ C-DAC Tech Workshop : hyPACK-2013 October 15-18, 2013 Example : multiple-cuda-streams.cu Objective : Objective is to demonstrate multiple streams for addition of two vectors Input : None Output : Time of cuda event elapsed time. Created : August-2013 E-mail : hpcfte@cdac.in **************************************************************************/ #include<stdio.h> void CUDA_SAFE_CALL(cudaError_t call) { cudaError_t ret = call; switch(ret) { case cudaSuccess: break; default: { printf(" ERROR at line :%i.%d' '%s\n",__LINE__,ret,cudaGetErrorString(ret)); exit(-1); break; } } } #define N (1024*1024) /* N = Vector Size */ #define FULL_DATA_SIZE (N*20) __global__ void kernel( int *a, int *b, int *c ) { int idx = threadIdx.x + blockIdx.x * blockDim.x; if (idx < N) { int idx1 = (idx + 1) % 256; int idx2 = (idx + 2) % 256; float as = (a[idx] + a[idx1] + a[idx2]) / 3.0f; float bs = (b[idx] + b[idx1] + b[idx2]) / 3.0f; c[idx] = (as + bs) / 2; } } int main( void ) { cudaDeviceProp prop; int whichDevice; CUDA_SAFE_CALL( cudaGetDevice( &whichDevice ) ); CUDA_SAFE_CALL( cudaGetDeviceProperties( &prop, whichDevice ) ); if (!prop.deviceOverlap) { printf( "Device will not handle overlaps, so no speed up from streams\n" ); return 0; } if( (prop.concurrentKernels == 0 )) //check concurrent kernel support { printf("> GPU does not support concurrent kernel execution\n"); printf(" CUDA kernel runs will be serialized\n"); } if(prop.asyncEngineCount == 0) //check concurrent data transfer support { printf("GPU does not support concurrent Data transer and overlaping of kernel execution & data transfer\n"); printf("Mem copy call will be blocking calls\n"); } cudaEvent_t start, stop; float elapsedTime; cudaStream_t stream0, stream1; int *host_a, *host_b, *host_c; int *dev_a0, *dev_b0, *dev_c0; int *dev_a1, *dev_b1, *dev_c1; // start the timers CUDA_SAFE_CALL( cudaEventCreate( &start ) ); CUDA_SAFE_CALL( cudaEventCreate( &stop ) ); // initialize the streams CUDA_SAFE_CALL( cudaStreamCreate( &stream0 ) ); CUDA_SAFE_CALL( cudaStreamCreate( &stream1 ) ); // allocate the memory on the GPU CUDA_SAFE_CALL( cudaMalloc( (void**)&dev_a0, N * sizeof(int) ) ); CUDA_SAFE_CALL( cudaMalloc( (void**)&dev_b0, N * sizeof(int) ) ); CUDA_SAFE_CALL( cudaMalloc( (void**)&dev_c0, N * sizeof(int) ) ); CUDA_SAFE_CALL( cudaMalloc( (void**)&dev_a1, N * sizeof(int) ) ); CUDA_SAFE_CALL( cudaMalloc( (void**)&dev_b1, N * sizeof(int) ) ); CUDA_SAFE_CALL( cudaMalloc( (void**)&dev_c1, N * sizeof(int) ) ); // allocate host locked memory, used to stream CUDA_SAFE_CALL( cudaHostAlloc( (void**)&host_a, FULL_DATA_SIZE * sizeof(int), cudaHostAllocDefault ) ); CUDA_SAFE_CALL( cudaHostAlloc( (void**)&host_b, FULL_DATA_SIZE * sizeof(int), cudaHostAllocDefault ) ); CUDA_SAFE_CALL( cudaHostAlloc( (void**)&host_c, FULL_DATA_SIZE * sizeof(int), cudaHostAllocDefault ) ); for (int i=0; i<FULL_DATA_SIZE; i++) { host_a[i] = rand(); host_b[i] = rand(); } CUDA_SAFE_CALL( cudaEventRecord( start, 0 ) ); // now loop over full data, in bite-sized chunks for (int i=0; i<FULL_DATA_SIZE; i+= N*2) { // enqueue copies of a in stream0 and stream1 CUDA_SAFE_CALL( cudaMemcpyAsync( dev_a0, host_a+i, N * sizeof(int), cudaMemcpyHostToDevice, stream0 ) ); CUDA_SAFE_CALL( cudaMemcpyAsync( dev_a1, host_a+i+N, N * sizeof(int), cudaMemcpyHostToDevice, stream1 ) ); // enqueue copies of b in stream0 and stream1 CUDA_SAFE_CALL( cudaMemcpyAsync( dev_b0, host_b+i, N * sizeof(int), cudaMemcpyHostToDevice, stream0 ) ); CUDA_SAFE_CALL( cudaMemcpyAsync( dev_b1, host_b+i+N, N * sizeof(int), cudaMemcpyHostToDevice, stream1 ) ); // enqueue kernels in stream0 and stream1 kernel<<<N/256,256,0,stream0>>>( dev_a0, dev_b0, dev_c0 ); kernel<<<N/256,256,0,stream1>>>( dev_a1, dev_b1, dev_c1 ); // enqueue copies of c from device to locked memory CUDA_SAFE_CALL( cudaMemcpyAsync( host_c+i, dev_c0, N * sizeof(int), cudaMemcpyDeviceToHost, stream0 ) ); CUDA_SAFE_CALL( cudaMemcpyAsync( host_c+i+N, dev_c1, N * sizeof(int), cudaMemcpyDeviceToHost, stream1 ) ); } CUDA_SAFE_CALL( cudaStreamSynchronize( stream0 ) ); CUDA_SAFE_CALL( cudaStreamSynchronize( stream1 ) ); CUDA_SAFE_CALL( cudaEventRecord( stop, 0 ) ); CUDA_SAFE_CALL( cudaEventSynchronize( stop ) ); CUDA_SAFE_CALL( cudaEventElapsedTime( &elapsedTime, start, stop ) ); printf( "Time taken: %3.1f ms\n", elapsedTime ); // cleanup the streams and memory CUDA_SAFE_CALL( cudaFreeHost( host_a ) ); CUDA_SAFE_CALL( cudaFreeHost( host_b ) ); CUDA_SAFE_CALL( cudaFreeHost( host_c ) ); CUDA_SAFE_CALL( cudaFree( dev_a0 ) ); CUDA_SAFE_CALL( cudaFree( dev_b0 ) ); CUDA_SAFE_CALL( cudaFree( dev_c0 ) ); CUDA_SAFE_CALL( cudaFree( dev_a1 ) ); CUDA_SAFE_CALL( cudaFree( dev_b1 ) ); CUDA_SAFE_CALL( cudaFree( dev_c1 ) ); CUDA_SAFE_CALL( cudaStreamDestroy( stream0 ) ); CUDA_SAFE_CALL( cudaStreamDestroy( stream1 ) ); return 0; }
464
#include <stdio.h> int main() { int nDevices; cudaGetDeviceCount(&nDevices); for (int i = 0; i < nDevices; i++) { cudaDeviceProp prop; cudaGetDeviceProperties(&prop, i); printf("Device Number: %d\n", i); printf(" Device name: %s\n", prop.name); printf(" Memory Clock Rate (KHz): %d\n", prop.memoryClockRate); printf(" Memory Bus Width (bits): %d\n", prop.memoryBusWidth); printf(" Peak Memory Bandwidth (GB/s): %f\n\n", 2.0*prop.memoryClockRate*(prop.memoryBusWidth/8)/1.0e6); printf(" Global Memory(GB): %lu\n", prop.totalGlobalMem / (1024 * 1024 * 1024)); printf(" Shared Memory per Block: %d\n", prop.sharedMemPerBlock); printf(" Registers per Block: %d\n", prop.regsPerBlock); printf(" Max Threads per Block: %d\n", prop.maxThreadsPerBlock); printf(" Multiprocessor Count: %d\n", prop.multiProcessorCount); printf(" Concurrent Kernels: %d\n", prop.concurrentKernels); printf(" L2 Cache Size: %d\n", prop.l2CacheSize); } /*cudaError_t err; int *edgeArray, numEdges = 4; err = cudaMalloc((void **)&edgeArray, (numEdges + 1) * sizeof(int)); if( err != cudaSuccess) { printf("CUDA error: %s ** at Line %d\n", cudaGetErrorString(err), __LINE__); return EXIT_FAILURE; }*/ }
465
#include <stdio.h> #include <math.h> #include <cuda_runtime_api.h> #include <time.h> #include <errno.h> /****************************************************************************** * This program takes an initial estimate of m and c and finds the associated * rms error. It is then as a base to generate and evaluate 8 new estimates, * which are steps in different directions in m-c space. The best estimate is * then used as the base for another iteration of "generate and evaluate". This * continues until none of the new estimates are better than the base. This is * a gradient search for a minimum in mc-space. * * To compile: * nvcc -o culinear culinear.cu -lm * * To run: * ./culinear * * Dr Kevan Buckley, University of Wolverhampton, 2018 *****************************************************************************/ typedef struct point_t { double x; double y; } point_t; int n_data = 1000; __device__ int d_n_data = 1000; point_t data[] = { {83.12,144.47},{65.27,114.80},{65.17,89.01},{68.57,122.90}, {77.57,136.93},{79.84,146.56},{84.42,123.51},{65.34,106.22}, {82.20,120.33},{65.35,142.11},{24.06,53.94},{35.61,87.53}, { 2.02,22.75},{44.01,89.41},{85.58,141.52},{54.14,88.90}, {35.94,84.11},{22.86,45.76},{75.88,111.25},{54.49,105.83}, {94.65,139.29},{74.97,140.29},{46.31,94.00},{48.12,108.88}, {99.29,146.97},{86.76,135.87},{70.11,120.41},{ 5.01,35.32}, {84.56,147.46},{ 0.19,39.41},{13.16,49.52},{34.11,93.57}, {78.99,108.24},{38.38,81.59},{79.20,115.25},{84.38,146.00}, {92.49,166.93},{19.70,61.69},{23.14,82.49},{13.97,44.80}, { 2.30,51.01},{15.33,34.49},{64.82,106.29},{39.99,76.65}, {85.93,162.61},{95.23,172.35},{11.05,60.11},{53.84,106.95}, {71.11,135.65},{33.67,88.76},{ 2.41,41.07},{52.19,108.83}, {30.21,57.75},{69.24,132.80},{96.44,157.86},{87.85,133.87}, {15.51,56.56},{53.81,106.32},{50.03,77.59},{77.05,136.93}, {37.29,81.30},{41.74,95.49},{53.91,109.94},{41.20,67.23}, {76.87,124.78},{39.99,82.29},{21.12,55.37},{34.62,65.13}, {20.91,51.88},{76.70,118.05},{ 4.76,45.66},{ 2.29,26.88}, {27.19,59.89},{ 6.82,36.36},{32.36,78.26},{48.72,99.14}, {80.55,127.01},{91.69,150.94},{ 9.68,29.41},{90.74,165.08}, {35.58,70.65},{90.86,166.10},{99.52,157.98},{15.66,47.55}, {45.23,88.34},{63.46,112.27},{64.21,115.27},{86.10,146.87}, {72.98,119.38},{31.78,67.38},{73.97,135.76},{24.43,70.15}, {74.86,135.38},{18.98,50.05},{49.32,106.88},{93.39,154.91}, { 1.29,39.63},{10.92,61.03},{35.04,64.55},{57.66,111.38}, {42.04,96.64},{ 8.79,40.02},{92.43,147.28},{49.08,85.76}, {30.62,85.66},{51.41,97.98},{88.25,141.92},{27.07,61.14}, {34.88,83.12},{90.82,151.63},{55.07,106.28},{25.73,62.03}, {34.53,63.56},{ 6.61,34.03},{15.62,50.85},{15.32,67.76}, {69.03,114.54},{32.46,56.91},{69.37,123.90},{10.78,57.26}, {10.53,31.37},{53.23,109.49},{ 7.26,44.18},{15.90,63.21}, { 8.53,36.85},{57.16,109.43},{80.74,122.57},{ 7.25,44.88}, {87.53,144.92},{90.70,165.27},{61.17,108.23},{53.14,111.23}, {94.75,138.45},{ 7.60,42.08},{18.83,76.22},{13.48,71.77}, { 0.66,39.45},{35.94,87.05},{88.24,169.85},{22.00,70.26}, {93.97,144.15},{93.09,164.94},{41.88,90.98},{35.68,63.90}, {93.69,160.24},{22.20,53.28},{79.69,118.82},{27.57,57.90}, {24.98,72.67},{86.50,133.90},{40.28,86.21},{14.60,48.01}, {72.54,139.19},{55.30,79.54},{ 3.81,33.25},{ 5.68,53.66}, {17.39,44.50},{82.43,123.95},{26.21,57.88},{50.93,102.91}, {41.54,78.81},{36.41,65.17},{39.67,84.96},{74.19,130.02}, {79.23,147.24},{ 5.43,43.11},{59.04,92.40},{ 4.77,21.65}, {62.12,113.31},{80.55,133.55},{42.32,75.65},{83.01,131.90}, {39.06,88.34},{98.75,175.85},{31.87,62.41},{58.73,96.47}, {10.18,53.65},{12.05,47.02},{77.15,116.12},{17.71,57.77}, {82.98,134.75},{18.11,37.59},{32.30,74.54},{81.96,143.75}, {11.77,47.90},{24.43,78.01},{60.70,116.42},{72.05,123.46}, {42.29,75.74},{ 9.64,53.11},{ 3.20,41.20},{75.68,127.51}, { 7.67,38.82},{ 9.55,45.92},{ 6.22,55.99},{15.01,53.21}, { 2.50,17.99},{30.97,64.75},{15.92,58.06},{39.77,79.31}, {30.30,80.76},{75.71,133.13},{18.68,54.70},{14.33,48.80}, {65.29,112.12},{85.98,156.29},{68.20,115.16},{76.18,127.58}, {12.05,52.54},{ 1.45,26.32},{51.07,91.58},{70.45,131.48}, {46.34,110.44},{86.40,140.67},{62.22,107.05},{39.48,96.73}, {59.28,114.38},{85.33,140.73},{21.85,63.28},{55.32,96.88}, {54.90,99.09},{81.45,134.43},{94.99,152.75},{60.61,91.15}, {85.61,132.87},{54.72,105.30},{ 9.85,37.72},{85.74,133.99}, {30.19,79.45},{87.18,142.65},{27.50,68.06},{48.21,81.13}, {89.60,139.38},{20.45,61.03},{60.56,101.17},{88.41,139.78}, {84.60,146.42},{25.34,45.91},{32.69,104.43},{13.63,53.03}, {80.26,124.62},{97.15,147.49},{99.16,177.78},{81.31,127.71}, {88.58,136.47},{24.77,59.82},{96.93,160.71},{51.92,102.46}, {27.33,67.99},{92.40,156.65},{87.22,135.40},{ 8.66,33.01}, {79.02,137.74},{92.16,158.93},{70.14,117.38},{31.39,83.34}, {98.54,150.47},{81.39,145.14},{32.19,90.89},{49.53,82.60}, {83.19,147.94},{65.68,121.26},{19.73,73.98},{19.26,39.84}, {68.81,127.82},{21.93,64.48},{22.98,67.44},{ 8.19,35.21}, {83.08,134.02},{69.30,124.24},{19.40,46.96},{64.13,120.93}, {61.91,118.90},{31.92,72.59},{97.06,157.02},{69.68,131.99}, {64.02,120.20},{86.75,141.47},{48.62,98.35},{62.34,118.54}, {23.10,73.71},{ 3.22,24.94},{47.03,98.28},{86.10,129.82}, {17.62,41.43},{20.60,62.70},{25.56,79.02},{98.74,168.44}, {25.25,68.33},{ 0.26,17.74},{73.72,125.70},{62.70,101.61}, {86.10,144.15},{ 7.59,38.21},{65.71,118.18},{57.83,104.28}, {48.00,91.86},{59.53,110.64},{75.08,131.55},{66.96,113.45}, {23.44,41.93},{ 7.22,33.51},{22.13,70.49},{20.24,70.87}, {36.57,59.85},{22.89,50.80},{88.83,128.03},{54.08,109.80}, {20.87,65.63},{80.15,132.14},{91.71,142.11},{12.37,46.56}, {31.09,82.71},{ 9.54,28.65},{16.74,44.18},{37.07,73.24}, { 1.67,41.10},{ 0.29,12.09},{34.05,80.10},{64.07,112.30}, {64.66,110.15},{21.74,62.28},{74.39,129.73},{53.67,90.13}, {75.14,147.83},{42.98,82.02},{66.29,121.10},{57.34,102.40}, {96.75,152.13},{13.36,48.35},{21.05,73.53},{81.77,135.48}, {88.21,171.75},{51.53,98.91},{21.88,63.71},{89.27,145.47}, {67.70,125.26},{72.69,126.45},{27.77,58.71},{69.38,115.18}, { 2.59,19.50},{93.93,149.24},{ 4.84,44.09},{19.21,43.14}, {10.58,38.47},{41.51,82.49},{88.02,148.21},{55.22,114.17}, {12.69,79.85},{91.81,160.45},{99.68,162.60},{62.74,103.63}, {10.21,47.93},{ 5.21,28.37},{89.57,148.01},{28.42,54.46}, {61.03,88.74},{73.04,120.93},{71.30,131.03},{ 6.42,27.57}, {82.06,114.82},{50.07,89.66},{76.06,137.34},{69.25,116.77}, {72.62,110.20},{ 8.88,48.25},{24.03,73.68},{52.59,102.23}, {84.77,139.15},{96.75,154.31},{70.15,122.87},{93.18,166.62}, { 6.17,58.46},{92.22,158.34},{74.61,131.25},{67.46,119.20}, {22.98,57.20},{37.45,86.95},{ 1.97,39.59},{48.29,116.20}, {52.60,109.07},{24.17,56.13},{58.56,116.56},{32.87,65.50}, { 0.34,43.67},{87.72,142.21},{37.41,62.88},{64.08,127.92}, {42.54,79.79},{35.53,88.48},{ 2.57,23.24},{77.80,122.09}, { 4.19,35.89},{11.53,28.55},{62.03,82.21},{55.15,93.33}, {63.96,120.79},{73.17,129.77},{57.12,113.60},{32.89,92.86}, {27.89,70.41},{39.21,74.83},{77.58,129.76},{77.44,149.05}, { 2.87,10.13},{11.11,44.31},{77.46,144.46},{45.30,100.95}, { 4.69,30.94},{89.47,157.53},{ 7.61,44.77},{23.09,74.16}, {91.49,156.06},{11.20,52.40},{21.47,77.05},{86.58,141.10}, {24.07,57.57},{76.46,137.23},{84.23,120.97},{96.42,157.37}, {98.02,155.25},{99.42,159.62},{12.67,68.56},{36.27,92.72}, {16.08,50.55},{29.05,58.27},{24.65,58.31},{22.59,71.18}, {54.34,115.03},{44.53,96.50},{50.73,109.29},{10.75,45.32}, {62.06,126.81},{12.61,62.62},{21.94,50.52},{86.83,160.25}, { 9.03,51.65},{73.37,127.89},{54.41,107.85},{95.96,172.35}, {69.67,130.26},{48.73,103.54},{62.30,113.08},{19.39,78.51}, {77.40,124.44},{ 1.63,34.05},{90.02,152.89},{64.47,110.81}, {47.10,103.92},{64.92,116.32},{42.67,73.30},{48.06,76.96}, {35.45,65.22},{98.35,158.55},{17.10,60.38},{29.75,70.75}, {85.75,135.77},{48.27,88.32},{42.05,73.57},{88.04,146.92}, { 9.72,34.51},{66.61,120.50},{52.60,91.06},{78.80,127.29}, {11.69,48.24},{ 2.59,39.39},{84.26,130.65},{10.82,43.81}, {97.33,173.24},{95.78,157.66},{51.35,81.72},{83.75,136.31}, {72.98,114.92},{70.67,120.19},{90.19,147.54},{39.23,71.88}, {35.17,78.15},{84.31,136.47},{ 4.96,37.06},{13.96,55.78}, {51.70,107.90},{48.21,98.95},{90.61,142.67},{ 4.39,50.63}, {76.09,120.85},{72.86,132.97},{69.73,118.54},{60.33,93.71}, { 5.07,42.46},{20.73,60.27},{42.45,89.87},{80.47,166.56}, {16.49,68.34},{97.12,153.22},{19.75,50.44},{75.75,121.87}, {16.84,69.99},{16.59,56.79},{22.78,65.78},{78.48,135.35}, {70.14,122.63},{39.36,74.32},{21.60,75.60},{66.51,101.96}, {62.88,107.89},{50.24,88.20},{60.77,106.24},{86.21,148.74}, { 9.38,44.95},{87.93,141.50},{13.25,49.13},{50.99,106.87}, {84.74,145.24},{91.76,140.41},{81.99,130.91},{58.39,94.20}, {84.02,153.63},{55.36,92.79},{ 2.69,36.03},{65.84,115.04}, {52.09,98.57},{16.14,46.02},{18.37,39.39},{49.37,96.53}, {43.87,80.59},{80.77,130.01},{45.87,98.61},{10.53,37.07}, {46.18,93.03},{24.75,71.96},{85.19,138.24},{66.97,129.60}, { 2.19,44.38},{68.15,89.75},{60.75,117.13},{15.45,62.88}, {59.82,93.68},{14.43,51.77},{46.38,75.94},{86.99,133.36}, {80.16,115.98},{71.51,113.22},{ 8.43,45.23},{36.84,81.44}, {99.22,143.60},{26.46,59.92},{92.97,161.39},{81.44,120.67}, { 4.33,31.81},{81.67,130.81},{34.26,76.67},{76.71,150.31}, {77.99,131.09},{45.96,90.46},{25.87,59.28},{51.79,104.69}, {14.95,41.47},{22.07,67.88},{84.04,152.63},{63.10,114.30}, {94.30,147.86},{56.55,108.74},{ 8.29,55.81},{30.76,84.68}, {68.20,133.71},{ 3.29,50.95},{89.16,145.76},{31.10,67.81}, { 0.88,41.80},{ 7.31,39.34},{51.82,103.09},{13.69,35.21}, {54.12,109.39},{41.60,79.94},{44.78,91.74},{ 0.83,42.82}, {88.24,138.49},{62.16,110.68},{ 7.00,25.60},{80.07,157.43}, {19.82,51.33},{11.07,53.28},{77.57,133.32},{94.77,146.08}, {19.43,67.02},{99.17,165.99},{32.86,70.06},{75.29,142.96}, {37.18,96.22},{37.29,112.25},{84.78,143.59},{93.33,138.44}, {74.44,121.57},{19.51,51.21},{82.81,123.17},{14.24,68.89}, { 3.64,29.43},{18.79,56.15},{97.75,161.17},{71.42,119.80}, { 5.68,42.40},{65.07,120.59},{53.09,109.96},{64.88,117.08}, {64.22,114.47},{22.87,69.56},{26.46,54.11},{38.98,79.57}, {89.71,145.31},{50.80,98.09},{50.17,95.25},{22.41,62.02}, {38.83,81.99},{ 4.82,22.56},{15.01,52.96},{41.12,76.82}, { 5.14,35.46},{40.40,78.76},{76.89,122.53},{99.60,164.21}, {17.56,69.70},{15.47,67.74},{79.33,143.39},{61.38,106.24}, {77.09,145.58},{22.38,57.87},{77.00,146.86},{85.47,139.32}, {78.29,125.77},{56.09,113.82},{29.85,57.95},{68.02,114.98}, {99.80,152.56},{56.13,99.68},{50.87,96.14},{70.92,118.34}, {18.13,52.54},{ 9.65,52.74},{21.14,64.53},{ 5.85,35.25}, { 3.90,35.84},{57.70,113.74},{32.65,79.44},{30.78,57.23}, {15.93,47.90},{94.54,158.57},{15.99,48.42},{54.03,97.67}, {94.56,145.55},{48.42,92.14},{33.50,75.93},{75.31,134.44}, { 7.53,33.84},{48.48,81.91},{62.78,135.05},{22.56,62.72}, {31.12,58.49},{30.90,48.51},{48.27,107.01},{29.57,56.55}, {31.84,67.56},{63.07,115.38},{96.22,146.90},{75.96,125.90}, {78.48,132.71},{ 4.47,19.69},{56.83,94.99},{90.74,136.22}, {18.37,45.45},{43.37,88.50},{75.13,127.54},{91.84,139.83}, {66.99,114.37},{35.62,97.15},{14.32,40.17},{35.62,77.26}, {98.70,157.47},{14.60,46.19},{27.33,82.11},{15.48,46.49}, {82.71,139.29},{17.78,59.32},{37.39,90.82},{29.65,66.51}, {14.27,48.09},{38.27,74.89},{69.32,120.78},{ 3.72,41.25}, { 6.44,62.75},{29.18,70.64},{46.02,71.57},{57.14,115.12}, {45.49,85.00},{38.75,82.52},{58.52,107.65},{54.88,99.55}, {71.98,123.01},{37.71,68.39},{43.32,82.62},{79.11,142.63}, {34.48,81.63},{73.53,130.77},{10.70,50.84},{23.54,68.26}, {63.75,124.89},{ 4.50,31.46},{55.35,99.71},{ 2.26, 1.63}, {65.48,121.04},{65.51,130.58},{74.76,130.05},{61.96,113.45}, {22.75,76.09},{12.11,56.20},{60.19,102.29},{27.93,78.04}, {14.21,40.49},{80.85,130.02},{98.75,163.54},{39.58,101.41}, {75.84,132.72},{ 2.21,14.08},{22.68,65.37},{81.91,138.57}, {71.29,114.89},{90.83,164.22},{94.44,151.59},{82.04,131.07}, {13.66,63.96},{48.38,87.90},{46.38,87.25},{22.28,63.31}, { 2.87,32.37},{10.02,58.24},{49.16,100.16},{86.62,135.56}, {39.26,90.93},{78.34,133.91},{82.53,139.45},{59.77,112.37}, {70.98,130.76},{66.60,114.24},{35.82,90.20},{30.53,71.96}, {69.51,139.87},{94.56,173.33},{21.42,59.83},{58.70,111.28}, {37.44,94.48},{31.15,63.11},{23.53,63.70},{ 5.11,63.57}, {55.81,123.51},{15.80,42.37},{83.53,149.47},{80.35,153.86}, {37.73,102.20},{95.31,133.18},{97.78,155.11},{59.12,116.15}, {10.35,41.60},{65.22,107.71},{54.83,108.60},{91.01,151.20}, {78.63,147.74},{51.16,110.76},{70.28,106.57},{70.08,129.60}, {47.41,99.55},{ 0.52,21.99},{54.85,94.95},{93.87,153.82}, {40.84,67.40},{57.23,116.36},{76.08,140.72},{62.88,107.11}, {23.52,58.75},{86.76,141.34},{76.61,131.49},{69.97,129.62}, { 6.16,24.48},{61.86,114.65},{30.69,88.16},{89.57,147.12}, {42.47,86.94},{29.92,69.93},{36.03,83.92},{90.74,139.60}, {32.22,73.11},{10.79,57.18},{28.87,59.02},{47.85,109.31}, {44.50,87.53},{10.85,44.35},{45.82,85.17},{43.53,93.85}, {57.17,103.94},{86.07,142.47},{97.68,151.83},{85.74,147.44}, { 4.78,35.45},{97.96,154.43},{99.31,154.34},{ 6.00,45.64}, {56.05,115.48},{24.98,66.31},{86.32,152.64},{ 1.08,40.11}, {42.92,80.64},{79.59,132.72},{71.87,107.43},{19.35,47.20}, {38.09,92.45},{18.94,60.66},{30.15,60.80},{19.43,53.20}, {63.91,129.49},{54.38,113.42},{42.06,91.30},{ 1.98,41.20}, { 5.47,23.84},{84.77,133.67},{ 4.93,38.23},{84.19,147.77}, {38.91,67.06},{25.87,60.48},{62.61,110.60},{28.58,84.46}, {92.31,152.06},{61.23,92.60},{82.96,125.80},{15.59,59.43}, {34.88,70.07},{13.29,35.70},{30.92,61.47},{93.31,141.05}, {68.91,126.91},{26.63,59.73},{37.41,72.67},{15.63,44.98}, {27.66,76.55},{99.90,164.33},{87.52,144.03},{ 4.42,29.79}, {30.91,59.24},{ 6.37,47.74},{78.59,133.51},{50.65,94.09}, {69.79,136.05},{60.30,120.16},{53.64,109.72},{ 9.80,62.05}, {84.72,134.75},{90.92,131.16},{70.20,126.34},{19.16,45.57}, {52.85,98.88},{69.27,123.71},{99.94,161.32},{92.46,161.95}, {94.75,159.49},{72.82,126.08},{92.27,145.98},{ 5.93,28.08}, {33.26,72.26},{ 2.12,39.38},{12.99,47.88},{57.53,112.68}, {46.70,94.90},{81.13,126.83},{12.80,69.03},{30.96,68.96}, {24.18,59.11},{ 2.27,41.30},{49.74,82.50},{62.55,126.09}, {48.84,95.14},{72.25,120.77},{ 3.22,24.46},{99.21,167.11}, {87.37,133.05},{82.33,144.86},{95.53,163.89},{94.11,145.19}, {13.11,35.64},{59.44,116.19},{24.27,62.07},{91.53,145.26}, {46.43,82.98},{99.89,151.74},{66.41,102.58},{56.46,114.65}, {62.68,99.59},{77.05,132.15},{47.38,81.81},{64.85,107.58}, {91.24,145.20},{65.69,126.13},{66.98,136.61},{ 4.95,29.94}, {75.39,156.04},{ 7.55,35.93},{29.83,62.85},{91.79,140.73}, {66.56,129.57},{36.16,67.39},{41.25,86.72},{94.82,156.68}, {24.15,66.85},{44.28,97.11},{31.82,69.41},{13.75,53.07}, {81.76,135.27},{23.72,77.94},{24.53,53.47},{23.66,67.62}, {21.90,56.35},{31.58,75.84},{31.28,70.78},{42.78,78.57}, {12.46,42.74},{74.68,148.57},{ 2.58,19.05},{91.39,147.46}, {56.50,121.13},{21.06,54.11},{27.09,57.00},{46.82,87.12}, {45.76,90.04},{85.87,149.19},{40.52,84.52},{72.24,118.46}, { 3.34,27.96},{24.68,51.90},{45.54,98.75},{ 9.05,54.03}, {84.14,127.96},{73.69,129.22},{22.43,56.43},{20.47,67.18}, {21.36,81.39},{88.61,147.49},{88.78,126.41},{36.54,90.18}, {23.39,47.90},{16.16,53.46},{34.88,76.16},{75.58,140.32}, {33.45,88.12},{89.01,142.71},{46.57,96.54},{25.00,56.85}, {99.78,171.85},{82.58,152.64},{13.94,52.87},{46.61,112.56}, {64.76,116.36},{31.86,63.96},{69.61,120.21},{53.72,100.82}, {81.88,142.33},{29.39,66.57},{86.67,143.51},{ 4.13,31.53}, {22.34,58.49},{64.54,116.47},{68.08,129.02},{34.02,98.04}, {55.23,104.11},{19.59,64.50},{84.85,156.51},{94.41,142.74}, {12.49,49.71},{27.81,63.84},{53.94,107.71},{92.25,147.58}, {87.89,148.18},{21.02,69.44},{57.05,97.23},{48.46,94.85}, { 3.81,37.26},{89.90,156.01},{57.31,88.22},{78.39,140.66}, {77.93,149.82},{23.15,62.96},{25.77,55.58},{74.11,141.26}, {21.31,64.10},{46.04,79.80},{65.78,117.56},{41.04,79.20}, {94.38,143.18},{81.52,133.84},{86.12,146.57},{39.38,85.36}, {63.01,110.79},{42.25,92.03},{48.83,86.99},{19.09,65.04} }; double residual_error(double x, double y, double m, double c) { double e = (m * x) + c - y; return e * e; } __device__ double d_residual_error(double x, double y, double m, double c){ double e = (m * x) + c - y; return e * e; } double rms_error(double m, double c) { int i; double mean; double error_sum = 0; for(i=0; i<n_data; i++) { error_sum += residual_error(data[i].x, data[i].y, m, c); } mean = error_sum / n_data; return sqrt(mean); } __global__ void d_rms_error(double *m, double *c, double *error_sum_arr, point_t *d_data) { int i = threadIdx.x + blockIdx.x * blockDim.x; error_sum_arr[i] = d_residual_error(d_data[i].x, d_data[i].y, *m, *c); } int time_difference(struct timespec *start, struct timespec *finish, long long int *difference) { long long int ds = finish->tv_sec - start->tv_sec; long long int dn = finish->tv_nsec - start->tv_nsec; if(dn < 0 ) { ds--; dn += 1000000000; } *difference = ds * 1000000000 + dn; return !(*difference > 0); } int main() { int i; double bm = 1.3; double bc = 10; double be; double dm[8]; double dc[8]; double e[8]; double step = 0.01; double best_error = 999999999; int best_error_i; int minimum_found = 0; double om[] = {0,1,1, 1, 0,-1,-1,-1}; double oc[] = {1,1,0,-1,-1,-1, 0, 1}; struct timespec start, finish; long long int time_elapsed; clock_gettime(CLOCK_MONOTONIC, &start); cudaError_t error; //Device variables double *d_dm; double *d_dc; double *d_error_sum_arr; point_t *d_data; be = rms_error(bm, bc); error = cudaMalloc(&d_dm, (sizeof(double) * 8)); if(error){ fprintf(stderr, "cudaMalloc on d_dm returned %d %s\n", error, cudaGetErrorString(error)); exit(1); } //Allocate memory for d_dc error = cudaMalloc(&d_dc, (sizeof(double) * 8)); if(error){ fprintf(stderr, "cudaMalloc on d_dc returned %d %s\n", error, cudaGetErrorString(error)); exit(1); } error = cudaMalloc(&d_error_sum_arr, (sizeof(double) * 1000)); if(error){ fprintf(stderr, "cudaMalloc on d_error_sum_arr returned %d %s\n", error, cudaGetErrorString(error)); exit(1); } //Allocate memory for d_data error = cudaMalloc(&d_data, sizeof(data)); if(error){ fprintf(stderr, "cudaMalloc on d_data returned %d %s\n", error, cudaGetErrorString(error)); exit(1); } while(!minimum_found) { for(i=0;i<8;i++) { dm[i] = bm + (om[i] * step); dc[i] = bc + (oc[i] * step); } //Copy memory for dm to d_dm error = cudaMemcpy(d_dm, dm, (sizeof(double) * 8), cudaMemcpyHostToDevice); if(error){ fprintf(stderr, "cudaMemcpy to d_dm returned %d %s\n", error, cudaGetErrorString(error)); } //Copy memory for dc to d_dc error = cudaMemcpy(d_dc, dc, (sizeof(double) * 8), cudaMemcpyHostToDevice); if(error){ fprintf(stderr, "cudaMemcpy to d_dc returned %d %s\n", error, cudaGetErrorString(error)); } //Copy memory for data to d_data error = cudaMemcpy(d_data, data, sizeof(data), cudaMemcpyHostToDevice); if(error){ fprintf(stderr, "cudaMemcpy to d_data returned %d %s\n", error, cudaGetErrorString(error)); } for(i=0;i<8;i++) { //Host variable storing the array returned from the kernel function. double h_error_sum_arr[1000]; //Stores the total sum of the values from the error sum array. double error_sum_total; //Stores the mean of the total sum of the error sums. double error_sum_mean; //Call the rms_error function using 100 blocks and 10 threads. d_rms_error <<<100,10>>>(&d_dm[i], &d_dc[i], d_error_sum_arr, d_data); cudaThreadSynchronize(); //Copy memory for d_error_sum_arr error = cudaMemcpy(&h_error_sum_arr, d_error_sum_arr, (sizeof(double) * 1000), cudaMemcpyDeviceToHost); if(error){ fprintf(stderr, "cudaMemcpy to error_sum returned %d %s\n", error, cudaGetErrorString(error)); } //Loop through the error sum array returned from the kernel function for(int j=0; j<n_data; j++) { //Add each error sum to the error sum total. error_sum_total += h_error_sum_arr[j]; } //Calculate the mean for the error sum. error_sum_mean = error_sum_total / n_data; //Calculate the square root for the error sum mean. e[i] = sqrt(error_sum_mean); if(e[i] < best_error) { best_error = e[i]; best_error_i = i; } //Reset the error sum total. error_sum_total = 0; } //printf("best m,c is %lf,%lf with error %lf in direction %d\n", //dm[best_error_i], dc[best_error_i], best_error, best_error_i); if(best_error < be) { be = best_error; bm = dm[best_error_i]; bc = dc[best_error_i]; } else { minimum_found = 1; } } //Free memory for d_dm error = cudaFree(d_dm); if(error){ fprintf(stderr, "cudaFree on d_dm returned %d %s\n", error, cudaGetErrorString(error)); exit(1); } //Free memory for d_dc error = cudaFree(d_dc); if(error){ fprintf(stderr, "cudaFree on d_dc returned %d %s\n", error, cudaGetErrorString(error)); exit(1); } //Free memory for d_data error = cudaFree(d_data); if(error){ fprintf(stderr, "cudaFree on d_data returned %d %s\n", error, cudaGetErrorString(error)); exit(1); } //Free memory for d_error_sum_arr error = cudaFree(d_error_sum_arr); if(error){ fprintf(stderr, "cudaFree on d_error_sum_arr returned %d %s\n", error, cudaGetErrorString(error)); exit(1); } printf("minimum m,c is %lf,%lf with error %lf\n", bm, bc, be); //Get the system time after we have run the linear regression function. clock_gettime(CLOCK_MONOTONIC, &finish); //Calculate the time spent between the start time and end time. time_difference(&start, &finish, &time_elapsed); //Output the time spent running the program. printf("Time elapsed was %lldns or %0.9lfs\n", time_elapsed, (time_elapsed/1.0e9)); return 0; }
466
#include <iostream> #include <math.h> #include <vector> #include <string> #include <algorithm> #include <random> #include <chrono> #include <stdio.h> #define NB_THREADS 1024 #define NB_NUMBERS 200 #define NB_EXPERIMENTS 100 void print_vector(int* array, int k) { for(size_t i=0; i < k; i++) { printf("%d ", array[i]); } printf("\n"); } bool compare_vectors(int *v1, std::vector<int> v2) { for(int i=0; i < v2.size(); i++) { if (v1[i] != v2[i]) { printf("wrong at %d %d vs %d\n", i, v1[i], v2[i]); return false; } } return true; } std::vector<int> create_vector(int N) { std::vector<int> res; for(int i=0; i < N; i++) { res.push_back(i); } return res; } __global__ void bubble_sort(int *A, int n) { __shared__ int end[NB_THREADS]; // termination condition for each thread __shared__ int race[NB_NUMBERS]; // race condition for each element of input array for (int u=0; u<NB_THREADS; u++) { end[u] = 0; } for (int v=0; v<NB_NUMBERS; v++) { race[v] = 1; } int temp; int index = threadIdx.x; while (1) { end[index] = 1; for (int i=0; i<n; i++) { while (1) { if ((race[i] == 1 && race[i-1] == 1) || (i == 0 && race[i] == 1)) { if (A[i-1] > A[i]) { // Block race condition race[i] = 0; race[i-1] = 0; // Swap temp = A[i-1]; A[i-1] = A[i]; A[i] = temp; // Release race condition end[index] = 0; race[i] = 1; race[i-1] = 1; } break; } } } if (end[index] == 1) { break; } } } int main(void) { for (int e=0; e<NB_EXPERIMENTS; e++) { // Init random input array int range = NB_NUMBERS; std::vector<int> v = create_vector(range); std::vector<int> v_orig = create_vector(range); std::random_shuffle ( v.begin(), v.end() ); std::random_shuffle ( v.begin(), v.end() ); int *x; cudaMallocManaged(&x, range*sizeof(int)); for (int i = 0; i < range; i++) { x[i] = v[i]; printf("%d %d\n", x[i], v[i]); } print_vector(x, range); // Sort bubble_sort<<<1, NB_THREADS>>>(x, range); cudaDeviceSynchronize(); // Check output if (!compare_vectors(x, v_orig)) { printf("%s\n", "Wrong algorithm"); print_vector(x, range); break; } else { printf("%s %d\n", "True algorithm", e); } // Free memory cudaFree(x); } }
467
#include <stdio.h> #include <stdlib.h> // For the CUDA runtime routines (prefixed with "cuda_") #include <cuda_runtime.h> #include <sys/time.h> #include <cooperative_groups.h> //#include <helper_cuda.h> #define N_INPUTS 32 #define N_ARITH 74 __global__ void ac(float *A, const int *B, const int *C, const int *op_sel, int n_inputs, const int n_arith, int thresh, int iter) { int i= blockDim.x * blockIdx.x + threadIdx.x; int idx_off= i*n_inputs; float val_31, val_32, val_33, val_34, val_35, val_36, val_37, val_38, val_39, val_40, val_41, val_42, val_43, val_44, val_45, val_46, val_47, val_48, val_49, val_50, val_51, val_52, val_53, val_54, val_55, val_56, val_57, val_58, val_59, val_60, val_61, val_62, val_63, val_64, val_65, val_66, val_67, val_68, val_69, val_70, val_71, val_72, val_73, val_74, val_75, val_76, val_77, val_78, val_79, val_80, val_81, val_82, val_83, val_84, val_85, val_86, val_87, val_88, val_89, val_90, val_91, val_92, val_93, val_94, val_95, val_96, val_97, val_98, val_99, val_100, val_101, val_102, val_103, val_104; float *val= &A[idx_off]; for (int k=0; k<iter; k++) { val_31 = A[idx_off + 5] * val[29]; val_32 = val[6] * val[30]; val_33 = val[3] * val[29]; val_34 = val[4] * val[30]; val_35 = val_31 + val_32; val_36 = val_33 + val_34; val_37 = val[0] * val[15]; val_38 = val[1] * val[16]; val_39 = val[3] * val_37; val_40 = val[4] * val_37; val_41 = val[0] * val_38; val_42 = val[1] * val_38; val_43 = val_39 + val_41; val_44 = val_40 + val_42; val_45 = val[12] * val[19]; val_46 = val[13] * val[19]; val_47 = val[11] * val[20]; val_48 = val[14] * val[20]; val_49 = val[10] * val[19]; val_50 = val[11] * val[19]; val_51 = val[9] * val[20]; val_52 = val[12] * val[20]; val_53 = val_45 + val_47; val_54 = val_46 + val_48; val_55 = val_49 + val_51; val_56 = val_50 + val_52; val_57 = val[27] * val_43; val_58 = val[28] * val_44; val_59 = val_57 + val_58; val_60 = val[2] * val[25]; val_61 = val[2] * val[26]; val_62 = val[7] * val_60; val_63 = val[9] * val_61; val_64 = val[8] * val_60; val_65 = val[10] * val_61; val_66 = val[11] * val_62; val_67 = val[0] * val_63; val_68 = val[12] * val_62; val_69 = val[1] * val_63; val_70 = val[11] * val_64; val_71 = val[0] * val_65; val_72 = val[12] * val_64; val_73 = val[1] * val_65; val_74 = val_66 + val_67; val_75 = val_68 + val_69; val_76 = val_70 + val_71; val_77 = val_72 + val_73; val_78 = val[21] * val_35; val_79 = val[22] * val_36; val_80 = val_53 * val_78; val_81 = val_54 * val_79; val_82 = val_55 * val_78; val_83 = val_56 * val_79; val_84 = val_59 * val_80; val_85 = val_57 * val_80; val_86 = val_58 * val_81; val_87 = val_59 * val_82; val_88 = val_57 * val_82; val_89 = val_58 * val_83; val_90 = val_85 + val_86; val_91 = val_88 + val_89; val_92 = val[17] * val_74; val_93 = val[17] * val_75; val_94 = val[18] * val_76; val_95 = val[18] * val_77; val_96 = val_84 * val_92; val_97 = val_90 * val_93; val_98 = val_87 * val_94; val_99 = val_91 * val_95; val_100 = val_96 + val_98; val_101 = val_97 + val_99; val_102 = val[23] * val_100; val_103 = val[24] * val_101; val_104 = val_102 + val_103; A[i*n_inputs+5] += val_104; } A[i*n_inputs]= val_104; } int main(void) { // Error code to check return values for CUDA calls cudaError_t err = cudaSuccess; const int n_inputs= N_INPUTS; const int n_arith= N_ARITH; const int batch_size= 128; const int iter= 1; const int thresh= n_arith/3; size_t size= batch_size * (n_inputs) * sizeof(float); size_t size_idx= n_arith * sizeof(int); float *h_A= (float *)malloc(size); int *h_B= (int *)malloc(size_idx); int *h_C= (int *)malloc(size_idx); int *h_op_sel= (int *) malloc(size_idx); // Initialize the host input vectors for (int i = 0; i < n_arith; ++i) { if (i < thresh) { h_B[i] = rand() % (n_inputs); h_C[i] = rand() % (n_inputs); } else{ h_B[i] = rand() % (i); h_C[i] = rand() % (i); } h_op_sel[i]= rand() % 2; } for (int i= 0; i < n_inputs; ++i) { for (int b =0; b< batch_size; ++b) { //h_A[b* n_inputs + i]= float(rand()); h_A[b* n_inputs + i]= 0.5; } } // Allocate the device input vector A float *d_A = NULL; err = cudaMalloc((void **)&d_A, size); if (err != cudaSuccess) { fprintf(stderr, "Failed to allocate device vector A (error code %s)!\n", cudaGetErrorString(err)); exit(EXIT_FAILURE); } int *d_B = NULL; err = cudaMalloc((void **)&d_B, size_idx); if (err != cudaSuccess) { fprintf(stderr, "Failed to allocate device vector A (error code %s)!\n", cudaGetErrorString(err)); exit(EXIT_FAILURE); } int *d_C = NULL; err = cudaMalloc((void **)&d_C, size_idx); if (err != cudaSuccess) { fprintf(stderr, "Failed to allocate device vector A (error code %s)!\n", cudaGetErrorString(err)); exit(EXIT_FAILURE); } int *d_op_sel = NULL; err = cudaMalloc((void **)&d_op_sel, size_idx); if (err != cudaSuccess) { fprintf(stderr, "Failed to allocate device vector A (error code %s)!\n", cudaGetErrorString(err)); exit(EXIT_FAILURE); } // Copy the host input vectors A and B in host memory to the device input vectors in // device memory printf("Copy input data from the host memory to the CUDA device\n"); err = cudaMemcpy(d_A, h_A, size, cudaMemcpyHostToDevice); if (err != cudaSuccess) { fprintf(stderr, "Failed to copy vector A from host to device (error code %s)!\n", cudaGetErrorString(err)); exit(EXIT_FAILURE); } err = cudaMemcpy(d_B, h_B, size_idx, cudaMemcpyHostToDevice); if (err != cudaSuccess) { fprintf(stderr, "Failed to copy vector B from host to device (error code %s)!\n", cudaGetErrorString(err)); exit(EXIT_FAILURE); } err = cudaMemcpy(d_C, h_C, size_idx, cudaMemcpyHostToDevice); if (err != cudaSuccess) { fprintf(stderr, "Failed to copy vector C from host to device (error code %s)!\n", cudaGetErrorString(err)); exit(EXIT_FAILURE); } err = cudaMemcpy(d_op_sel, h_op_sel, size_idx, cudaMemcpyHostToDevice); if (err != cudaSuccess) { fprintf(stderr, "Failed to copy vector C from host to device (error code %s)!\n", cudaGetErrorString(err)); exit(EXIT_FAILURE); } // Launch the Vector Add CUDA Kernel int threadsPerBlock = 32; int blocksPerGrid= (batch_size + threadsPerBlock -1)/ threadsPerBlock; struct timeval t1, t2; // Perform Warmup ac<<<blocksPerGrid, threadsPerBlock>>>(d_A, d_B, d_C, d_op_sel, n_inputs, n_arith, thresh, iter); // FInish execution of kernel cudaDeviceSynchronize(); gettimeofday(&t1, 0); printf("CUDA kernel launch with %d blocks of %d threads\n", blocksPerGrid, threadsPerBlock); ac<<<blocksPerGrid, threadsPerBlock>>>(d_A, d_B, d_C, d_op_sel, n_inputs, n_arith, thresh, iter); // FInish execution of kernel cudaDeviceSynchronize(); gettimeofday(&t2, 0); double time = (1000000.0*(t2.tv_sec-t1.tv_sec) + t2.tv_usec-t1.tv_usec)/1000.0; printf("Time of kernel: %3.4f ms \n", time); err = cudaGetLastError(); if (err != cudaSuccess) { fprintf(stderr, "Failed to launch vectorAdd kernel (error code %s)!\n", cudaGetErrorString(err)); exit(EXIT_FAILURE); } printf("Throughput: %.3f Gops/sec\n", (((1.0*batch_size*iter*n_arith))/time)/10E6); // Copy the device result vector in device memory to the host result vector // in host memory. printf("Copy output data from the CUDA device to the host memory\n"); err = cudaMemcpy(h_A, d_A, size, cudaMemcpyDeviceToHost); if (err != cudaSuccess) { fprintf(stderr, "Failed to copy vector C from device to host (error code %s)!\n", cudaGetErrorString(err)); exit(EXIT_FAILURE); } //for (int i=0; i<numElements; i++) { for (int i=0; i<32; i++) { printf("%d : %f,", i, h_A[i*n_inputs]); } err = cudaFree(d_A); err = cudaFree(d_B); err = cudaFree(d_C); free(h_A); free(h_B); free(h_C); printf("Done!\n"); return 0; }
468
// includes, system #include <stdio.h> #include <assert.h> #include <stdlib.h> __global__ void notDivergent(int n) //The threads should perform the same work as //in divergent(), but the threads within a warp //should not diverge { } __global__ void divergent(int n) //The threads should perform the same work as //in notDivergent(), but the threads within //a warp should be forced to diverge { } // Program main ///////////////////////////////////////////////////////////////////// int main( int argc, char** argv) { const int N = 10000, threads = 10000; cudaEvent_t start, stop; float time; int nBlocks, nThreads; nThreads = 512; nBlocks = (threads + nThreads - 1)/nThreads; //Set up the timing variables and begin timing cudaEventCreate(&start); cudaEventCreate(&stop); cudaEventRecord(start, 0); //The Divergent Kernal divergent<<<nBlocks, nThreads>>>(N); //Stop timing cudaEventRecord(stop, 0); cudaEventSynchronize(stop); //Compute the Elapsed Time cudaEventElapsedTime(&time, start, stop); printf("divergent kernel: %f milliseconds\n", time); //begin new timing cudaEventRecord(start, 0); //The non-Divergent Kernel notDivergent<<<nBlocks, nThreads>>>(N); //Stop timing cudaEventRecord(stop, 0); cudaEventSynchronize(stop); //Compute the Kernel Time cudaEventElapsedTime(&time, start, stop); printf("non-divergent kernel: %f milliseconds\n", time); return 0; }
469
/** * Copyright 1993-2012 NVIDIA Corporation. All rights reserved. * * Please refer to the NVIDIA end user license agreement (EULA) associated * with this source code for terms and conditions that govern your use of * this software. Any use, reproduction, disclosure, or distribution of * this software and related documentation outside the terms of the EULA * is strictly prohibited. */ #include <cstdio> extern __global__ void myFirstKernel(void); int main(void){ myFirstKernel<<<1,1>>>(); printf("hi there, from CPU\n"); cudaDeviceSynchronize(); return 0; }
470
// This example introduces CUDA's heterogeneous model of memory // by demonstrating the difference between the "host" and "device" // memory spaces. // #include stdlib.h for malloc/free #include <stdlib.h> // #include stdio.h for printf #include <stdio.h> // nvcc automatically #includes headers needed for cudaMalloc, cudaFree, cudaMemcpy, & cudaMemset int main(void) { // create arrays of 16 elements int num_elements = 16; // compute the size of the arrays in bytes int num_bytes = num_elements * sizeof(int); // pointers to host & device arrays int *device_array = 0; int *host_array = 0; // malloc a host array host_array = (int*)malloc(num_bytes); // cudaMalloc a device array // we pass cudaMalloc a pointer to the device_array pointer cudaMalloc((void**)&device_array, num_bytes); // if either memory allocation failed, report an error message if(host_array == 0 || device_array == 0) { printf("couldn't allocate memory\n"); return 1; } // zero out the device array with cudaMemset cudaMemset(device_array, 0, num_bytes); // we can't dereference elements of device_array from the host directly: // that will likely cause a crash. instead, we must explicitly copy from // device memory to host memory to access the result // copy the contents of the device array to the host array to inspect the result // use cudaMemcpyDeviceToHost to indicate the direction of the copy cudaMemcpy(host_array, device_array, num_bytes, cudaMemcpyDeviceToHost); // print out the result element by element for(int i=0; i < num_elements; ++i) { printf("%d ", host_array[i]); } printf("\n"); // use free to free the host array free(host_array); // use cudaFree to free the device array cudaFree(device_array); }
471
//合并 访存 #include<stdio.h> #include<math.h> #include<time.h> #include <stdlib.h> int Max=16384; int width=32; typedef struct { double A1; double A2; double A3; double A4; }stru; __global__ void multi(stru *A,stru *b,double *C,const int Max){ int idx = blockIdx.x * blockDim.x + threadIdx.x; int idy = blockIdx.y * blockDim.y + threadIdx.y; double sum=0.0; if(idx<Max && idy<Max && idx==idy){ for(int i=0;i<Max/4;i++){ sum+=A[idx*Max/4+i].A1*b[i*4].A1+A[idx*Max/4+i].A2*b[i*4+1].A1+A[idx*Max/4+i].A3*b[i*4+2].A1+A[idx*Max/4+i].A4*b[i*4+3].A1; } C[idx]=sum; } } int main(){ printf("合并访存:\n"); stru *A =(stru *)malloc(Max * Max/4 * sizeof(stru)); //A stru *b =(stru *)malloc(Max * sizeof(stru)); //b double *C =(double *)malloc(Max * sizeof(double)); //C double *test_c=(double *)malloc(Max * sizeof(double)); //cpu_test int i,j; for(i=0;i<Max;i++){ for(j=0;j<Max/4;j++){ A[i*Max/4+j].A1=i-0.1*j*4+1; A[i*Max/4+j].A2=i-(0.1*j*4+1)+1; A[i*Max/4+j].A3=i-(0.1*j*4+2)+1; A[i*Max/4+j].A4=i-(0.1*j*4+3)+1; } } for(i=0;i<Max;i++){ b[i].A1=log(sqrt(i*i-i+2)); b[i].A2=0.0; b[i].A3=0.0; b[i].A4=0.0; C[i]=0.0; } stru *A_d,*b_d; double *C_d; cudaMalloc((void **)&A_d,Max * Max/4 * sizeof(stru)); cudaMalloc((void **)&b_d,Max *sizeof(stru)); cudaMalloc((void **)&C_d,Max *sizeof(double)); clock_t start,end; start=clock(); cudaMemcpy(A_d, A,Max*Max/4*sizeof(stru),cudaMemcpyHostToDevice); cudaMemcpy(b_d, b,Max*sizeof(stru),cudaMemcpyHostToDevice); cudaMemcpy(C_d, C,Max * sizeof(double), cudaMemcpyHostToDevice); dim3 block(width,width); dim3 grid(Max/block.x, Max/block.y); multi<<<grid,block>>>(A_d,b_d,C_d,Max); cudaMemcpy(C, C_d, Max * sizeof(double), cudaMemcpyDeviceToHost); end=clock(); double time=(end-start)*1000/CLOCKS_PER_SEC; //check result: //cpu: clock_t start_c,end_c; start_c=clock(); for (int i = 0; i < Max; ++i){ for (int j = 0; j < Max/4; ++j) { test_c[i]+=A[i*Max/4+j].A1*b[j*4].A1+A[i*Max/4+j].A2*b[j*4+1].A1+A[i*Max/4+j].A3*b[j*4+2].A1+A[i*Max/4+j].A4*b[j*4+3].A1; } } end_c=clock(); bool flag = true; for (int i = 0; i < Max; ++i){ float a=test_c[i]; float b=C[i]; if (a!=b) { printf("cpu:%lf gpu:%lf\n",a,b); flag = false; } } if (flag == true) printf("result correct\n"); else{ printf("resul wrong\n"); } double time_C=(end_c-start_c)*1000/CLOCKS_PER_SEC; printf("GPU TIME:%lf ms\n",time); printf("CPU TIME:%lf ms\n",time_C); cudaFree(A_d); cudaFree(b_d); cudaFree(C_d); free(A); free(b); free(C); }
472
#include<math.h> #include<time.h> #include<stdexcept> #include<iostream> #include<cstdlib> //for abs(x) #include<stdio.h> using namespace std; __global__ void kernel_multiplication( int* A, int* B, int* C,int N,int M); int main() { int NUMBER_OF_ELEMENTS; int VECTOR_SIZE; cout<<"Enter the vector size:"; cin>>VECTOR_SIZE; NUMBER_OF_ELEMENTS=VECTOR_SIZE; int SIZE = NUMBER_OF_ELEMENTS*sizeof(int); cudaEvent_t start,end,start1,end1; int* hostA = (int*)malloc(VECTOR_SIZE*sizeof(int)); int* hostB = (int*)malloc(SIZE*VECTOR_SIZE*sizeof(int)); int* hostC = (int*)malloc(VECTOR_SIZE*sizeof(int)); int* deviceA,*deviceB,*deviceC; srand(time(0)); int i,j; cout<<"\nVector:\n"; for(i=0;i<VECTOR_SIZE;i++) { hostA[i] = rand()%VECTOR_SIZE; cout<<hostA[i]<<"\t"; } //initialize matrix by random elements for(i=0;i<NUMBER_OF_ELEMENTS;i++) { for(j=0;j<VECTOR_SIZE;j++) { hostB[i*VECTOR_SIZE+j] = rand()%VECTOR_SIZE; } } cout<<"\nMatrix=\n"; for(i=0;i<NUMBER_OF_ELEMENTS;i++) { for(j=0;j<VECTOR_SIZE;j++) { cout<<hostB[i*VECTOR_SIZE+j]<<"\t"; } cout<<"\n"; } cudaMalloc(&deviceA,VECTOR_SIZE*sizeof(int)); cudaMalloc(&deviceB,NUMBER_OF_ELEMENTS*VECTOR_SIZE*sizeof(int)); cudaMalloc(&deviceC,VECTOR_SIZE*sizeof(int)); cudaEventCreate(&start); cudaEventCreate(&end); cudaEventCreate(&start1); cudaEventCreate(&end1); cudaEventRecord(start); cudaMemcpy(deviceA,hostA,VECTOR_SIZE*sizeof(int),cudaMemcpyHostToDevice); cudaMemcpy(deviceB,hostB,SIZE*VECTOR_SIZE,cudaMemcpyHostToDevice); kernel_multiplication<<<NUMBER_OF_ELEMENTS,1>>>(deviceA,deviceB,deviceC,NUMBER_OF_ELEMENTS,VECTOR_SIZE); cudaDeviceSynchronize(); cudaMemcpy(hostC,deviceC,VECTOR_SIZE*sizeof(int),cudaMemcpyDeviceToHost); cudaEventRecord(end); cudaEventSynchronize(end); float t=0; cudaEventElapsedTime(&t,start,end); cudaFree(deviceA); cudaFree(deviceB); cudaFree(deviceC); double error = 0; int* answer = (int*) malloc(VECTOR_SIZE*sizeof(int)); cudaEventRecord(start1); for(int i=0;i<NUMBER_OF_ELEMENTS;i++) { int sum = 0; for(int j=0;j<VECTOR_SIZE;j++) { sum += hostA[j]*hostB[j*VECTOR_SIZE+i]; } answer[i] = sum; } for(int k=0;k<VECTOR_SIZE;k++) { cout<<k<<")"<< "Expected value = "<<answer[k]<<" Actual value = "<<hostC[k]<<"\n"; error += double(abs(answer[k]-hostC[k])); } error=sqrt(error); cout<<"error = "<<error<<"\n"; cudaEventRecord(end1); cudaEventSynchronize(end1); float t1=0; cudaEventElapsedTime(&t1,start1,end1); cout<<"\nSequential time="<<t1; cout<<"\nParallel time="<<t<<endl; delete[] hostA; delete[] hostB; delete[] hostC; return cudaDeviceSynchronize(); } __global__ void kernel_multiplication( int* A, int* B, int* C, int N,int M) { int index = threadIdx.x + blockIdx.x * blockDim.x; int sum = 0; if(index<N) { for(int i=0;i<M;i++) sum+=A[i]*B[(i*M)+index]; C[index] = sum; } }
473
#include <cuda.h> #include <time.h> #include <stdlib.h> #include <stdio.h> #define STOP 0 #define START 1 /* Play with the following two values */ #define NB 1000000L //Size of array (long integer) #define MANY 200L //Number of transfers /* (over-)Simple chronometer function */ void chrono (int kind, float *time) { static clock_t counts; if (kind == START) { *time = 0.0; counts = clock(); return; } if (kind == STOP) { *time = ((float)(clock()-counts))/((float)CLOCKS_PER_SEC); } } int main () { float *ptr, *gpu_ptr; cudaError_t err; float time, number_of_Gbytes; long i, j; /* Dynamic allocations below */ // Allocate ptr on host below ptr = (float *)malloc(NB * sizeof(float)); // Allocate gpu_ptr on device below err = cudaMalloc(&gpu_ptr,sizeof(float)*NB); /* Some error handling */ if (ptr == NULL) { printf ("Not enough memory on host\n"); exit (1); } if (err != 0) { printf ("Pb allocating memory on device. Reason:\n"); printf ("%s\n", cudaGetErrorString (err)); exit (1); } /* Are the following two lines necessary ? */ for (i = 0; i < NB; i++) ptr[i] = 9.0; /* Transfer loop below */ chrono (START, &time); for (j = 0; j < MANY; j++) { // perform memory transfer here // cudaMemcpy(gpu_ptr,ptr,sizeof(float)*NB,cudaMemcpyHostToDevice); cudaMemcpy(gpu_ptr,ptr,sizeof(float)*NB,cudaMemcpyDeviceToHost); } chrono (STOP, &time); /* Output results */ number_of_Gbytes = (MANY*(float)sizeof(float)*NB/1024./1024./1024.); printf ("%f Gbytes transfered in %f seconds\n", number_of_Gbytes, time); printf ("Bandwidth = %f Gb/s\n", number_of_Gbytes / time); /* Clean the place */ cudaFree (gpu_ptr); free (ptr); return 0; }
474
#include "includes.h" __global__ void _segmentedScanBackKer(float *maxdist, int *maxdistidx, int *label, float *blockmaxdist, int *blocklabel, int *blockmaxdistidx, int numelements) { // 声明共享内存。用来存放中间结果小数组中的元素,也就是输入的原数组的每块最 // 后一个元素。共包含三个信息。 __shared__ float shdcurmaxdist[1]; __shared__ int shdcurlabel[1]; __shared__ int shdcurmaxdistindex[1]; // 状态位,用来标记上一块的最后一个元素的标签值是否和本段第一个元素的标签值 // 相同。 __shared__ int state[1]; // 计算需要进行块间累加位置索引(块外的数组索引)。 int idx = (blockIdx.x + 1) * blockDim.x + threadIdx.x; // 用每块的第一个线程来读取每块前一块的最后一个元素,从中间结果数组中读取。 if (threadIdx.x == 0) { shdcurmaxdist[0] = blockmaxdist[blockIdx.x]; shdcurlabel[0] = blocklabel[blockIdx.x]; shdcurmaxdistindex[0] = blockmaxdistidx[blockIdx.x]; // 用 state 来记录上一块的最后一个元素的标签值是否和本段第一个元素的 // 标签值相同,相同则为 1,不同则为 0。 state[0] = (label[idx] == shdcurlabel[0]); } // 块内同步。 __syncthreads(); // 如果状态位为 0,说明上一块和本块无关,不在一个区域内,直接返回。 if (state[0] == 0) return; // 如果数组索引大于数组长度,直接返回。 if (idx >= numelements) return; // 如果当前位置处的标签值和目前已知的最大垂距的标签值相同,并且垂距小于目前 // 已知的最大垂距,那么更新当前位置处的最大垂距记录和最大垂距位置的索引。 if (label[idx] == shdcurlabel[0] && maxdist[idx] < shdcurmaxdist[0]) { maxdist[idx] = shdcurmaxdist[0]; maxdistidx[idx] = shdcurmaxdistindex[0]; } }
475
#include "includes.h" __global__ void TemporalConvolutionTBC_bp_bias( float* matrix, float* target, int rows, int stride, float scale) { int i = blockIdx.x * 32 + threadIdx.x; float t = 0; for (int j = blockIdx.y; j < rows; j += gridDim.y) t += matrix[j * stride + i]; atomicAdd(&target[i], t * scale); }
476
#include <complex> #include <iostream> #include <cstdio> #include <cstdlib> #include <cmath> #include <cuComplex.h> // Kernel Definitions /****************************************************************************** * Function: CUDAisInMandelbrotSet * * Authors: Elliott Rarden & Katie Macmillan * * Description: * CUDAisInMandelbrotSet() takes in cuDoubleComplex number, c, and an int pointer * to return the number of iterations * * Parameters: [in] c * [in-out] iterations ******************************************************************************/ __device__ void CUDAisInMandelbrotSet(cuDoubleComplex c, int *iterations){ double zr = 0; double zi = 0; cuDoubleComplex z = make_cuDoubleComplex(zr, zi); int i = 0; for (i = 0; i < 100 && cuCabs(z) < 2.0; ++i){ z = cuCadd(cuCmul(z, z), c); // z = z*z + c; } *iterations = i; } /****************************************************************************** * Function: CUDAisInMandelbrotSet * * Authors: Elliott Rarden & Katie Macmillan * * Description: * CUDAisInJuliaSet() takes in two cuDoubleComplex numbers, c & z, and an int * pointer to return the number of iterations * * Parameters: [in] z * [in] c * [in-out] iterations ******************************************************************************/ __device__ void CUDAisInJuliaSet(cuDoubleComplex z, cuDoubleComplex c, int *iterations){ int i = 0; for (i = 0; i < 100 && cuCabs(z) < 2.0; ++i){ z = cuCadd(cuCmul(z, z), c); // z = z*z + c; } *iterations = i; } /****************************************************************************** * Function: mandelCalc * * Authors: Elliott Rarden & Katie Macmillan * * Description: * mandelCalc() is a kernel which takes in a set of real and imaginary values * and will calcualte in parallel wether or not each point is in or out of the * mandelbrot set. * * Parameters: [in] cReals * [in] cImags * [in-out] iterations * [in] len ******************************************************************************/ __global__ void mandelCalc(double *cReals, double *cImags, int *iterations, int len) { int i = blockDim.x * blockIdx.x + threadIdx.x; cuDoubleComplex num; if(i < len){ num = make_cuDoubleComplex(cReals[i], cImags[i]); CUDAisInMandelbrotSet(num, &iterations[i]); } } /****************************************************************************** * Function: juliaCalc * * Authors: Elliott Rarden & Katie Macmillan * * Description: * juliaCalc() is a kernel which takes in a set of real and imaginary values as * well as a real and imaginary number (as doubles), and will calcualte in * parallel wether or not each point in the arrays is in or out of the Julia set * associated with the given point * * Parameters: [in] zReal * [in] zImag * [in] cReals * [in] cImags * [in-out] iterations * [in] len ******************************************************************************/ __global__ void juliaCalc(double zReal, double zImag, double *cReals, double *cImags, int *iterations, int len) { int i = blockDim.x * blockIdx.x + threadIdx.x; cuDoubleComplex num; cuDoubleComplex z; if(i < len){ num = make_cuDoubleComplex(cReals[i], cImags[i]); z = make_cuDoubleComplex(zReal, zImag); CUDAisInJuliaSet(num, z, &iterations[i]); } } /****************************************************************************** * Function: cudaCalcMandelbrot * * Authors: Elliott Rarden & Katie Macmillan * * Description: * cudaCalcMandelbrot() is a function which takes in a set of real and imaginary * values, and will reutrn if each point is in our out of the mandelbrot set using * the in-out iterations parameter * * Parameters: [in] setOfReals * [in] setOfImags * [in-out] iterations * [in] len ******************************************************************************/ __host__ void cudaCalcMandelbrot(double *setOfReals, double *setOfImags, int *iterations, int len) { // Block management int n = len; // Device arrays double *d_set_reals; double *d_set_imags; int *d_iterations; // Allocate our memory on the device cudaMalloc(&d_set_reals, len * sizeof(double)); cudaMalloc(&d_set_imags, len * sizeof(double)); cudaMalloc(&d_iterations, len * sizeof(int)); // Copy our stuff to the device cudaMemcpy(d_set_reals, setOfReals, len * sizeof(double), cudaMemcpyHostToDevice); cudaMemcpy(d_set_imags, setOfImags, len * sizeof(double), cudaMemcpyHostToDevice); cudaMemcpy(d_iterations, iterations, len * sizeof(int), cudaMemcpyHostToDevice); // Run the code on the GPU int nThreads = 128; // should be multiple of 32 (up to 1024) int nBlocks = ( n + nThreads - 1 ) / nThreads; mandelCalc<<<nBlocks, nThreads>>>(d_set_reals, d_set_imags, d_iterations, len); // Copy stuff from the GPU to our host cudaMemcpy(setOfReals, d_set_reals, len * sizeof(double), cudaMemcpyDeviceToHost); cudaMemcpy(setOfImags, d_set_imags, len * sizeof(double), cudaMemcpyDeviceToHost); cudaMemcpy(iterations, d_iterations, len * sizeof(int), cudaMemcpyDeviceToHost); // Free the device memory cudaFree(d_set_reals); cudaFree(d_set_imags); cudaFree(d_iterations); } /****************************************************************************** * Function: cudaCalcJulia * * Authors: Elliott Rarden & Katie Macmillan * * Description: * cudaCalcJulia() is a function which takes in a real and imaginary z value and * a set of real and imaginary values, c, and will reutrn if each point in c is * in the Julia set associated with the point z * * Parameters: [in] zReal * [in] zImag * [in] cReals * [in] cImags * [in-out] iterations * [in] len ******************************************************************************/ __host__ void cudaCalcJulia(double zReal, double zImag, double *setOfReals, double *setOfImags, int *iterations, int len) { // Local variables int n = len; // Device variables double *d_set_reals; double *d_set_imags; int *d_iterations; // Allocate our memory on the device cudaMalloc(&d_set_reals, len * sizeof(double)); cudaMalloc(&d_set_imags, len * sizeof(double)); cudaMalloc(&d_iterations, len * sizeof(int)); // Copy our stuff to the device cudaMemcpy(d_set_reals, setOfReals, len * sizeof(double), cudaMemcpyHostToDevice); cudaMemcpy(d_set_imags, setOfImags, len * sizeof(double), cudaMemcpyHostToDevice); cudaMemcpy(d_iterations, iterations, len * sizeof(int), cudaMemcpyHostToDevice); // Run the code on the GPU int nThreads = 128; // should be multiple of 32 (up to 1024) int nBlocks = ( n + nThreads - 1 ) / nThreads; juliaCalc<<<nBlocks, nThreads>>>(zReal, zImag, d_set_reals, d_set_imags, d_iterations, len); // Copy stuff from the GPU to our host cudaMemcpy(iterations, d_iterations, len * sizeof(int), cudaMemcpyDeviceToHost); // Free the device memory cudaFree(d_set_reals); cudaFree(d_set_imags); cudaFree(d_iterations); }
477
#include <cuda.h> #include <stdio.h> #include <stdlib.h> #define BLOCK_SIZE 32 #define GROUP_OF_PIXELS 1 __global__ void mandelKernel(float upperX, float upperY, float lowerX, float lowerY, int* img, int resX, int resY, int maxIterations) { int row = blockIdx.y * blockDim.y + threadIdx.y; int col = (blockIdx.x * blockDim.x + threadIdx.x) * GROUP_OF_PIXELS; float stepX = (upperX - lowerX) / resX; float stepY = (upperY - lowerY) / resY; for (int i = 0; i < GROUP_OF_PIXELS && col < resX; i++, col++) { float x = lowerX + col * stepX; float y = lowerY + row * stepY; float z_re = x, z_im = y; int val = 0; for (; val < maxIterations; ++val) { if (z_re * z_re + z_im * z_im > 4.f) break; float new_re = z_re * z_re - z_im * z_im; float new_im = 2.f * z_re * z_im; z_re = x + new_re; z_im = y + new_im; } img[row * resX + col] = val; } } // Host front-end function that allocates the memory and launches the GPU kernel void hostFE (float upperX, float upperY, float lowerX, float lowerY, int* img, int resX, int resY, int maxIterations) { int *temp_img; int *output; size_t pitch; cudaHostAlloc((void **)&output, resX * resY * sizeof(int), cudaHostAllocDefault); cudaMallocPitch((void **) &temp_img, &pitch, resX * sizeof (int), resY); int group_block_size = BLOCK_SIZE * GROUP_OF_PIXELS; static int x_blocks = resX % group_block_size == 0 ? resX / group_block_size : resX / group_block_size + 1; static int y_blocks = resY % BLOCK_SIZE == 0 ? resY / BLOCK_SIZE : resY / BLOCK_SIZE + 1; dim3 block_size(BLOCK_SIZE, BLOCK_SIZE); dim3 num_block(x_blocks, y_blocks); mandelKernel<<<num_block, block_size>>>(upperX, upperY, lowerX, lowerY, temp_img, resX, resY, maxIterations); cudaMemcpy(output, temp_img, resX * resY * sizeof(int), cudaMemcpyDeviceToHost); memcpy(img, output, resX * resY * sizeof(int)); cudaFreeHost(output); cudaFree(temp_img); }
478
#include "plane.cuh" #include <stdio.h> __host__ __device__ Plane3::Plane3() { a = Vec3(); b = Vec3(); c = Vec3(); } __host__ __device__ Plane3::Plane3(Vec3 a, Vec3 b, Vec3 c) { this->a = a; this->b = b; this->c = c; } __host__ __device__ float determinant(Vec3 a, Vec3 b, Vec3 c) { return (a.x * b.y * c.z) + (b.x * c.y * a.z) + (c.x * a.y * b.z) - (c.x * b.y * a.z) - (b.x * a.y * c.z) - (a.x * c.y * b.z); } __host__ __device__ float Plane3::outside(Vec3 x) { Vec3 b_prime = b - a; Vec3 c_prime = c - a; Vec3 x_prime = x - a; return determinant(b_prime, c_prime, x_prime); } __host__ __device__ Vec3 Plane3::intersection_point(Vec3 line_origin, Vec3 line_direction) { Vec3 plane_normal = ((c - a).cross(b - a)).normalize(); float denom = plane_normal.dot(line_direction.normalize()); float t = 99999999; if (denom > 0.0001) { Vec3 line_origin_to_point = a - line_origin; t = line_origin_to_point.dot(plane_normal) / denom; } return line_origin + (line_direction.normalize() * t); // float t = (plane_normal.dot(a) - plane_normal.dot(line_origin)) / plane_normal.dot(line_direction.normalize()); // if (t < 0) // Falling of screen // t = 99999999.0; // return line_origin + ((line_direction).normalize() * t); }
479
#include "cuda_runtime.h" #include <stdio.h> #include <time.h> //#define SIZE 1000 using namespace std; __global__ void Convolution1(int *a,int *filter,int *result,int size_a,int size_filter,int size_result) { int i=blockIdx.x; int j=blockIdx.y; if(i<size_result||j<size_result) { for(int k=0;k<size_filter;k++) for(int l=0;l<size_filter;l++) result[i*size_result+j] += filter[k*size_filter+l]*a[(2*i+k)*size_a+2*j+l]; } } __global__ void Convolution3(int *a,int *filter,int *result,int size_a,int size_filter,int size_result) { int i=blockIdx.x; int j=blockIdx.y; int k=threadIdx.x; int l=threadIdx.y; if(i<size_result||j<size_result||k<size_filter||l<size_filter) { atomicAdd(&result[i*size_result+j],filter[k*size_filter+l]*a[(2*i+k)*size_a+2*j+l]); } } void Convolution2(int *a,int *filter,int *result,int size_a,int size_filter,int size_result) { for(int i=0;i<size_result;i++) { for(int j=0;j<size_result;j++) for(int k=0;k<size_filter;k++) for(int l=0;l<size_filter;l++) result[i*size_result+j] += filter[k*size_filter+l]*a[(2*i+k)*size_a+2*j+l]; } } int main() { int *a,*filter,*result,*result_serial,*result_optimal; int size_a,size_filter,size_result; clock_t t; double time_taken; x: printf("\nEnter size of array:"); scanf("%d",&size_a); printf("\nEnter size of filter:"); scanf("%d",&size_filter); if(size_a%2==0||size_filter%2==0) { printf("\nEnter odd numbers for sizes."); goto x; } if((size_a-size_filter)<0) { printf("\nEnter larger matrix size or smaller filter size."); goto x; } size_result=(size_a-size_filter)/2 +1; printf("Size of Matrix after Convolution with stride = (2) will be: %d \n",size_result); cudaMallocManaged(&a,size_a*size_a*sizeof(int)); cudaMallocManaged(&filter,size_filter*size_filter*sizeof(int)); cudaMallocManaged(&result,size_result*size_result*sizeof(int)); cudaMallocManaged(&result_optimal,size_result*size_result*sizeof(int)); cudaMallocManaged(&result_serial,size_result*size_result*sizeof(int)); srand(0); for(int i=0;i<size_a*size_a;i++) { a[i]=rand()%100; //printf("Enter a[%d]",i); //scanf("%d",&a[i]); } for(int i=0;i<size_filter*size_filter;i++) { filter[i]=rand()%100; //printf("Enter filter[%d]",i); //scanf("%d",&filter[i]); } for(int i=0;i<size_result*size_result;i++) { result[i]=0; result_serial[i]=0; result_optimal[i]=0; } dim3 res(size_result,size_result); dim3 fil(size_filter,size_filter); t=clock(); Convolution1<<<res,1>>>(a,filter,result,size_a,size_filter,size_result); cudaDeviceSynchronize(); t=clock()-t; time_taken=((double)t)/CLOCKS_PER_SEC; printf("Time for Convolution with %d threads: %f \n",size_result*size_result,time_taken); t=clock(); Convolution3<<<res,fil>>>(a,filter,result_optimal,size_a,size_filter,size_result); cudaDeviceSynchronize(); t=clock()-t; time_taken=((double)t)/CLOCKS_PER_SEC; printf("Time for Convolution with %d x %d threads: %f \n",size_result*size_result,size_filter*size_filter,time_taken); t=clock(); Convolution2(a,filter,result_serial,size_a,size_filter,size_result); t=clock()-t; time_taken=((double)t)/CLOCKS_PER_SEC; printf("Time for Convolution using serial:%f \n",time_taken); printf("\nSanity Check:"); if(size_filter*size_filter>11) for(int i=0;i<10;i++) { printf("\nresult[%d]=%d \nresult_serial[%d]=%d \nresult_optimal[%d]=%d\n",i,result[i],i,result_serial[i],i,result_optimal[i]); } else for(int i=0;i<size_filter*size_filter;i++) { printf("\nresult[%d]=%d \nresult_serial[%d]=%d \nresult_optimal[%d]=%d\n",i,result[i],i,result_serial[i],i,result_optimal[i]); } cudaFree(a); cudaFree(filter); cudaFree(result); cudaFree(result_serial); return 0; } /***********************OUTPUT************************* [user10@linux-teslagpu ~]$ ./a.out Enter size of array:10001 Enter size of filter:3 Size of Matrix after Convolution with stride = (2) will be: 5000 Time for Convolution with 25000000 threads: 0.000000 Time for Convolution using serial:1.990000 On Gtx 1050: E:\!KUNAL\MIT\BE\HPC\MiniProject>a.exe Enter size of array:10001 Enter size of filter:3 Size of Matrix after Convolution with stride = (2) will be: 5000 Time for Convolution with 25000000 threads: 2.210000 Time for Convolution with 25000000 x 9 threads: 0.134000 Time for Convolution using serial:3.210000 Sanity Check: result[0]=12792 result_serial[0]=12792 result_optimal[0]=12792 result[1]=14060 result_serial[1]=14060 result_optimal[1]=14060 result[2]=20138 result_serial[2]=20138 result_optimal[2]=20138 result[3]=19328 result_serial[3]=19328 result_optimal[3]=19328 result[4]=20288 result_serial[4]=20288 result_optimal[4]=20288 result[5]=14252 result_serial[5]=14252 result_optimal[5]=14252 result[6]=16804 result_serial[6]=16804 result_optimal[6]=16804 result[7]=20854 result_serial[7]=20854 result_optimal[7]=20854 result[8]=24886 result_serial[8]=24886 result_optimal[8]=24886 ******************************************************/
480
#include <stdio.h> template <unsigned int blockSize> __device__ void warpReduce(volatile int* sdata, int tid) { if (blockSize >= 64) sdata[tid] += sdata[tid + 32]; if (blockSize >= 32) sdata[tid] += sdata[tid + 16]; if (blockSize >= 16) sdata[tid] += sdata[tid + 8]; if (blockSize >= 8) sdata[tid] += sdata[tid + 4]; if (blockSize >= 4) sdata[tid] += sdata[tid + 2]; if (blockSize >= 2) sdata[tid] += sdata[tid + 1]; } template <unsigned int blockSize> __global__ void reduce6(int *g_idata, int *g_odata, int n) { extern __shared__ int sdata[]; // perform first level of reduction, reading from global memory, writing to shared memory unsigned int tid = threadIdx.x; unsigned int i = blockIdx.x*(blockSize*2) + threadIdx.x; unsigned int gridSize = blockSize*2*gridDim.x; sdata[tid] = 0; while (i < n) { sdata[tid] += g_idata[i] + g_idata[i+blockSize]; i += gridSize; } __syncthreads(); // do reduction in shared mem if (blockSize >= 512) { if (tid < 256) { sdata[tid] += sdata[tid + 256]; } __syncthreads(); } if (blockSize >= 256) { if (tid < 128) { sdata[tid] += sdata[tid + 128]; } __syncthreads(); } if (blockSize >= 128) { if (tid < 64) { sdata[tid] += sdata[tid + 64]; } __syncthreads(); } if (tid < 32) warpReduce<blockSize>(sdata, tid); // write result for this block to global mem if (tid == 0) g_odata[blockIdx.x] = sdata[0]; } int main(void) { long int size = 1 << 26; long int s; int sizeByte = size*sizeof(int); int* h_data = (int*) malloc(sizeByte); for(int i = 0; i < size; i++) { // h_data[i] = rand() & 0xFF; h_data[i] = i % 10; } long long int sum = 0; for(int i = 0; i < size; i++) sum += h_data[i]; printf("CPU results = %lld \n", sum); int* d_idata = NULL; int* d_odata = NULL; cudaMalloc(&d_idata, sizeByte); cudaMalloc(&d_odata, sizeByte); cudaMemcpy(d_idata, h_data, sizeByte, cudaMemcpyHostToDevice); s = size >> 6; int blocks = (s+512-1)/512; reduce6<512><<<blocks/2, 512, 512*sizeof(int)>>>(d_idata, d_odata, size); cudaDeviceSynchronize(); printf("The size of array is %ld and it is processed on # of Blocks: %d \n", size, blocks/2); s = blocks/2; blocks = (s+512-1)/512; reduce6<512><<<blocks/2, 512, 512*sizeof(int)>>>(d_odata, d_idata, s); cudaDeviceSynchronize(); cudaMemcpy(h_data, d_idata, sizeof(int), cudaMemcpyDeviceToHost); printf("GPU result = %d\n", h_data[0]); cudaFree(d_idata); cudaFree(d_odata); free(h_data); }
481
/**** File: findRedsDriver.cu By: Ilya Nemtsov Compile: nvcc findRedsDriver.cu -o frgpu Run: ./frgpu ****/ #include <stdio.h> #include <math.h> #include <stdlib.h> #include <cuda.h> #define NUMPARTICLES 32768 #define NEIGHBORHOOD .05 #define THREADSPERBLOCK 128 void initPos(float *); float findDistance(float *, int, int); __device__ float findDistanceGPU(float *, int, int); void dumpResults(int index[]); __global__ void findRedsGPU(float *p, int *numI); int main() { cudaEvent_t start, stop; float time; float *pos, //host pos *dpos; //device pos int *numReds, //host numReds *dnumReds;//device numreds float psize = NUMPARTICLES * 4 * sizeof(float); //size of pos int nsize = NUMPARTICLES * sizeof(int); //size of numReds pos = (float *) malloc(psize); //allocate space for pos numReds = (int *) malloc(nsize); // allocate space for numreds initPos(pos); //initialize pos // your code to allocate device arrays for pos and numReds go here cudaMalloc((void** )&dpos, psize); cudaMalloc((void** )&dnumReds, nsize); // copy host pos to device pos cudaMemcpy(dpos,pos,psize, cudaMemcpyHostToDevice); // create timer events cudaEventCreate(&start); cudaEventCreate(&stop); cudaEventRecord(start, 0); /* invoke kernel findRedsGPU here */ findRedsGPU<<<NUMPARTICLES/THREADSPERBLOCK,THREADSPERBLOCK>>>(dpos, dnumReds); cudaThreadSynchronize(); // your code to copy results to numReds[] go here cudaMemcpy(numReds,dnumReds,nsize,cudaMemcpyDeviceToHost); cudaEventRecord(stop, 0); cudaEventSynchronize(stop); cudaEventElapsedTime(&time, start, stop); printf("Elapsed time = %f\n", time); dumpResults(numReds); // clean up free(pos); cudaFree(dpos); free(numReds); cudaFree(dnumReds); } void initPos(float *p) { // your code for initializing pos goes here int i; int roll; for (i=0; i<NUMPARTICLES; i++) { p[i*4] = rand() / (float) RAND_MAX; p[i*4+1] = rand() / (float) RAND_MAX; p[i*4+2] = rand() / (float) RAND_MAX; roll = rand() % 3; if (roll == 0) p[i*4+3] = 0xff0000; else if (roll == 1) p[i*4+3] = 0x00ff00; else p[i*4+3] = 0x0000ff; } } __device__ float findDistanceGPU(float *p, int i, int j) { // your code for calculating distance for particle i and j float dx, dy, dz; dx = p[i*4] - p[j*4]; dy = p[i*4+1] - p[j*4+1]; dz = p[i*4+2] - p[j*4+2]; return(sqrt(dx*dx + dy*dy + dz*dz)); } __global__ void findRedsGPU(float *p, int *numI) { // your code for counting red particles goes here int j; float distance; int i = blockDim.x * blockIdx.x + threadIdx.x; numI[i]=0; for(j=0; j< NUMPARTICLES; j++){ if(i!=j){ distance = findDistanceGPU(p, i, j); if(distance < NEIGHBORHOOD && p[j*4+3] == 0xff0000){ numI[i]++; } } } } void dumpResults(int index[]) { int i; FILE *fp; fp = fopen("./dump.out", "w"); for (i=0; i<NUMPARTICLES; i++) { fprintf(fp, "%d %d\n", i, index[i]); } fclose(fp); }
482
#include <cuda.h> #include <stdio.h> __global__ void K1() { unsigned num = 0; unsigned id = blockIdx.x * blockDim.x + threadIdx.x; for (unsigned ii = 0; ii < id; ++ii) num += ii; printf("K1: %d\n", threadIdx.x); } __global__ void K2() { unsigned num = 0; unsigned id = blockIdx.x * blockDim.x + threadIdx.x; for (unsigned ii = 0; ii < id; ++ii) num += ii; __syncthreads(); printf("K2: %d\n", threadIdx.x); } __global__ void K3() { printf("\tK3\n"); } int main() { int *ptr; cudaStream_t s1, s2, s3; cudaStreamCreate(&s1); cudaStreamCreate(&s2); cudaStreamCreate(&s3); K1<<<32, 32, 0, s1>>>(); cudaHostAlloc(&ptr, sizeof(int), 0); K2<<<1, 1024, 0, s2>>>(); K3<<<1, 32, 0, s3>>>(); cudaDeviceSynchronize(); return 0; }
483
#include <stdio.h> #include <cuda.h> #include <cuda_runtime.h> //#include <cutil_inline.h> extern "C" void runCudaPart(float a[], float b[], float c[], int n); __global__ void myKernel(float *a, float *b, float *c, int n) { int idx = blockIdx.x*blockDim.x + threadIdx.x; //return; if (idx < n) { c[idx] = a[idx] + b[idx]; //c[idx] = 10.0; } //printf("Test\n"); return; } // Main cuda function void runCudaPart(float *a, float *b, float *c, int n) { float *a_d, *b_d, *c_d; size_t size = n * sizeof(float); cudaMalloc((void **) &a_d, size); cudaMalloc((void **) &b_d, size); cudaMalloc((void **) &c_d, size); cudaMemcpy(a_d, a, size,cudaMemcpyHostToDevice); cudaMemcpy(b_d, b, size,cudaMemcpyHostToDevice); cudaMemcpy(c_d, c, size,cudaMemcpyHostToDevice); //cudaMemset(c_d, 0, n); printf("Executing CUDA kernel\n"); myKernel <<<1,100>>> (a_d, b_d, c_d, n); cudaMemcpy(c, c_d, size, cudaMemcpyDeviceToHost); printf("Kernel ended.\n"); }
484
#include "includes.h" float * g_outputs_d, *g_sweepers_d_2; __global__ void update_positions(float max_speed, float * outputs_d, float * sweepers_d) { int my_index = blockIdx.x * blockDim.x + threadIdx.x; sweepers_d[my_index] += (2 * outputs_d[my_index] * max_speed) - max_speed; }
485
//============================================================================================= // Name : thread3dStl.cu // Author : Jose Refojo // Version : // Creation date : 26-02-2014 // Copyright : Copyright belongs to Trinity Centre for High Performance Computing // Description : This program will initialize a number of arrays stored in stl vectors, // then it will grab data from each thread (such as thread position inside the block and block), // save it, send it back into the main memory, and print it //============================================================================================= #include <iostream> #include <stdio.h> #include <vector> using namespace std; #define BLOCK_SIZE 2 __global__ void scanTheadInformationGPU(float *threadXIdsGPU,int N,int M,int L) { int idx=blockIdx.x*blockDim.x+threadIdx.x; int idy=blockIdx.y*blockDim.y+threadIdx.y; int idz=blockIdx.z*blockDim.z+threadIdx.z; if ( idx < N ) { if ( idy < M ) { if ( idz < L ) { threadXIdsGPU[idx+idy*N+idz*N*M]=-(idx+idy*N+idz*N*M); //threadXIdsGPU[idz+idy*L+idx*M*L]=-(idz+idy*L+idx*M*L); } } } } int main() { // pointers to host memory matrices std::vector< float > vector1d; std::vector< std::vector< float* > > vector3d; float *vector1d_gpu; // pointers to device memory matrices //float *vectorGPU; // N,M and L are the sizes on each dimension int N=2,M=3,L=4,totalSize; unsigned int ui,uj,uk; totalSize=N*M*L; // Allocate arrays threadIds and blockIds on host vector1d.resize(totalSize); vector3d.resize(N, std::vector< float* > (M)); for (ui=0;ui<N;ui++) { for (uj=0;uj<M;uj++) { vector3d[ui][uj]=&(vector1d[uj*L+ui*M*L]); } } for (ui=0;ui<N;ui++) { for (uj=0;uj<M;uj++) { for (uk=0;uk<L;uk++) { //vector1d[ui+uj*N+uk*N*M]=ui+uj*N+uk*N*M; vector1d[uk+uj*L+ui*M*L]=uk+uj*L+ui*M*L; } } } // Allocate arrays threadIdsGPU and blockIdsGPU on device cudaMalloc ((void **) &vector1d_gpu, sizeof(float)*N*M*L); // Copy data from host memory to device memory cudaMemcpy(vector1d_gpu, &(vector1d[0]), sizeof(float)*N*M*L, cudaMemcpyHostToDevice); int block_size=BLOCK_SIZE; dim3 dimBlock(block_size,block_size,block_size); dim3 dimGrid ( (N/dimBlock.x) + (!(N%dimBlock.x)?0:1),(M/dimBlock.y) + (!(M%dimBlock.y)?0:1),(L/dimBlock.y) + (!(L%dimBlock.y)?0:1)); // Call the kernel scanTheadInformationGPU <<<dimGrid,dimBlock>>> (vector1d_gpu,N,M,L); // Copy data from device memory to host memory cudaMemcpy(&(vector1d[0]), vector1d_gpu, sizeof(float)*N*M*L, cudaMemcpyDeviceToHost); // Print all the data about the threads cout << "vector1d_host: (" << N << "," << M << "," << L << ")" << endl; for (ui=0;ui<N;ui++) { cout << "vector1d_host, slice in Z " << ui << ":" << endl; for (uj=0;uj<M;uj++) { for (uk=0;uk<L;uk++) { cout << vector1d[uk+uj*L+ui*M*L]; if (uk==L-1) { cout << endl;} else { cout << "\t"; } } } } cout << "vector3d_host: (" << N << "," << M << "," << L << ")" << endl; for (ui=0;ui<N;ui++) { cout << "vector3d_host, slice in Z " << ui << ":" << endl; for (uj=0;uj<M;uj++) { for (uk=0;uk<L;uk++) { cout << vector3d[ui][uj][uk]; if (uk==L-1) { cout << endl;} else { cout << "\t"; } } } } /* cout << "vector1d_host:" <<endl; for (ui=0; ui<numRows; ui++) { for (uj=0; uj<numColumns; uj++) { cout << input2d_host[ui][uj]; if (uj==numColumns-1) { cout << endl;} else { cout << "\t"; } } } cout << endl; */ }
486
#include <stdio.h> #include <cuda.h> int main() { // get the range of stream priorities for this device int priority_high, priority_low; cudaDeviceGetStreamPriorityRange(&priority_low, &priority_high); // create streams with highest and lowest available priorities cudaStream_t st_high, st_low; cudaStreamCreateWithPriority(&st_high, cudaStreamNonBlocking, priority_high); cudaStreamCreateWithPriority(&st_low, cudaStreamNonBlocking, priority_low); printf("%d -- %d\n", priority_low, priority_high); }
487
extern __device__ __constant__ int constNumber[4];
488
#define TILE_DIM 128 //template<typename T> //__device__ void sumColumns(const T* matrix, T* result, // const int rows, const int cols) { // // __shared__ T tile[TILE_DIM][TILE_DIM]; // // int by = blockIdx.y; // int ty = threadIdx.y; // int row = by * blockDim.y + ty; // T sum = 0; // // #pragma unroll // for (int t = 0; t < (cols - 1) / TILE_DIM + 1; t++) { // #pragma unroll // for (int i = 0; i < TILE_DIM; i++) { // int r = by * TILE_DIM + i; // int c = t * TILE_DIM + ty; // if (r < rows && c < cols) { // tile[i][ty] = matrix[r * cols + c]; // } else { // tile[i][ty] = 0; // } // } // __syncthreads(); // // #pragma unroll // for (int j = 0; j < TILE_DIM; j++) { // sum += tile[ty][j]; // } // __syncthreads(); // } // // if (row < rows) { // result[row] = sum; // } //} template<typename T> __device__ void sumColumns(const T* matrix, T* result, const int rows, const int cols) { __shared__ T tile[TILE_DIM]; int row = blockIdx.x; if (row < rows) { int index = threadIdx.x; int partLength = (cols + TILE_DIM - 1) / TILE_DIM; T sum = 0; #pragma unroll for (int i = 0; i < partLength; i++) { int col = i * TILE_DIM + index; if (col < cols) { T value = matrix[row * cols + col]; sum += value; } } tile[index] = sum; #pragma unroll for (int d = 1; d < TILE_DIM && d < cols; d <<= 1) { __syncthreads(); if (index % (d << 1) == 0) { int valueIndex = index + d; if (valueIndex < TILE_DIM) { T value = tile[valueIndex]; sum += value; tile[index] = sum; } } } if (index == 0) { result[row] = sum; } } }
489
/* This is a automatically generated test. Do not modify */ #include <stdio.h> #include <stdlib.h> #include <math.h> __global__ void compute(float comp, int var_1,int var_2,float var_3,int var_4,int var_5,float var_6,float var_7,float var_8,float var_9,float var_10,float var_11,float var_12,float var_13,float var_14,float var_15,float var_16,float var_17,float var_18,float var_19,float* var_20,float var_21,float var_22,float var_23,float var_24,float var_25,float var_26,float var_27,float var_28,float var_29,float var_30) { if (comp >= +1.9749E-43f + expf(-0.0f)) { for (int i=0; i < var_1; ++i) { if (comp == (var_3 - -0.0f)) { for (int i=0; i < var_2; ++i) { comp += (-0.0f * var_6 + var_7 + var_8 * -0.0f); float tmp_1 = +1.2736E-36f; comp = tmp_1 / acosf((-1.3056E36f + (var_9 / (+1.8507E6f / (-0.0f + (var_10 / var_11)))))); comp += (-0.0f + (var_12 * (var_13 - powf((var_14 - powf((+0.0f + -1.9912E-37f / (var_15 + (var_16 + -1.1420E-41f))), +0.0f)), (var_17 / -0.0f / logf(var_18 - (+1.4255E-41f - (var_19 / (+0.0f * -1.1114E-44f / +1.8196E-35f))))))))); for (int i=0; i < var_4; ++i) { var_20[i] = (var_21 * (var_22 - var_23)); comp += var_20[i] * +0.0f - (-1.2856E34f - (-1.6144E-43f / ldexpf(logf(floorf((var_24 + (var_25 * (-1.0566E22f * (-0.0f - var_26)))))), 2))); comp = (var_27 * var_28); } for (int i=0; i < var_5; ++i) { comp = -1.2844E-43f * (+1.0536E34f - (var_29 * (+0.0f - var_30))); } } } } } printf("%.17g\n", comp); } float* initPointer(float v) { float *ret = (float*) malloc(sizeof(float)*10); for(int i=0; i < 10; ++i) ret[i] = v; return ret; } int main(int argc, char** argv) { /* Program variables */ float tmp_1 = atof(argv[1]); int tmp_2 = atoi(argv[2]); int tmp_3 = atoi(argv[3]); float tmp_4 = atof(argv[4]); int tmp_5 = atoi(argv[5]); int tmp_6 = atoi(argv[6]); float tmp_7 = atof(argv[7]); float tmp_8 = atof(argv[8]); float tmp_9 = atof(argv[9]); float tmp_10 = atof(argv[10]); float tmp_11 = atof(argv[11]); float tmp_12 = atof(argv[12]); float tmp_13 = atof(argv[13]); float tmp_14 = atof(argv[14]); float tmp_15 = atof(argv[15]); float tmp_16 = atof(argv[16]); float tmp_17 = atof(argv[17]); float tmp_18 = atof(argv[18]); float tmp_19 = atof(argv[19]); float tmp_20 = atof(argv[20]); float* tmp_21 = initPointer( atof(argv[21]) ); float tmp_22 = atof(argv[22]); float tmp_23 = atof(argv[23]); float tmp_24 = atof(argv[24]); float tmp_25 = atof(argv[25]); float tmp_26 = atof(argv[26]); float tmp_27 = atof(argv[27]); float tmp_28 = atof(argv[28]); float tmp_29 = atof(argv[29]); float tmp_30 = atof(argv[30]); float tmp_31 = atof(argv[31]); compute<<<1,1>>>(tmp_1,tmp_2,tmp_3,tmp_4,tmp_5,tmp_6,tmp_7,tmp_8,tmp_9,tmp_10,tmp_11,tmp_12,tmp_13,tmp_14,tmp_15,tmp_16,tmp_17,tmp_18,tmp_19,tmp_20,tmp_21,tmp_22,tmp_23,tmp_24,tmp_25,tmp_26,tmp_27,tmp_28,tmp_29,tmp_30,tmp_31); cudaDeviceSynchronize(); return 0; }
490
#include <stdio.h> #include <stdlib.h> #include <sys/time.h> #include <assert.h> #ifndef THREADS_PER_BLOCK #define THREADS_PER_BLOCK 1024 #endif #define CUDA_ERROR_CHECK #define CudaSafeCall( err ) __cudaSafeCall( err, __FILE__, __LINE__ ) #define CudaCheckError() __cudaCheckError( __FILE__, __LINE__ ) inline void __cudaSafeCall( cudaError err, const char *file, const int line ) { #ifdef CUDA_ERROR_CHECK if ( cudaSuccess != err ) { fprintf( stderr, "cudaSafeCall() failed at %s:%i : %s\n", file, line, cudaGetErrorString( err ) ); exit( -1 ); } #endif return; } inline void __cudaCheckError( const char *file, const int line ) { #ifdef CUDA_ERROR_CHECK cudaError err = cudaGetLastError(); if ( cudaSuccess != err ) { fprintf( stderr, "cudaCheckError() failed at %s:%i : %s\n", file, line, cudaGetErrorString( err ) ); exit( -1 ); } // More careful checking. However, this will affect performance. // Comment away if needed. err = cudaDeviceSynchronize(); if( cudaSuccess != err ) { fprintf( stderr, "cudaCheckError() with sync failed at %s:%i : %s\n", file, line, cudaGetErrorString( err ) ); exit( -1 ); } } #endif #define S_LOWER_LIMIT 10.0f #define S_UPPER_LIMIT 100.0f #define K_LOWER_LIMIT 10.0f #define K_UPPER_LIMIT 100.0f #define T_LOWER_LIMIT 1.0f #define T_UPPER_LIMIT 10.0f #define R_LOWER_LIMIT 0.01f #define R_UPPER_LIMIT 0.05f #define SIGMA_LOWER_LIMIT 0.01f #define SIGMA_UPPER_LIMIT 0.10f __global__ void bs(float *drand, float *dput, float *dcall, int n) { int id = blockIdx.x * blockDim.x + threadIdx.x; if (id < n) { float c1 = 0.319381530f; float c2 = -0.356563782f; float c3 = 1.781477937f; float c4 = -1.821255978f; float c5 = 1.330274429f; float zero = 0.0f; float one = 1.0f; float two = 2.0f; float temp4 = 0.2316419f; float oneBySqrt2pi = 0.398942280f; float d1, d2; float phiD1, phiD2; float sigmaSqrtT; float KexpMinusRT; float inRand; inRand = drand[id]; float S = S_LOWER_LIMIT * inRand + S_UPPER_LIMIT * (1.0f - inRand); float K = K_LOWER_LIMIT * inRand + K_UPPER_LIMIT * (1.0f - inRand); float T = T_LOWER_LIMIT * inRand + T_UPPER_LIMIT * (1.0f - inRand); float R = R_LOWER_LIMIT * inRand + R_UPPER_LIMIT * (1.0f - inRand); float sigmaVal = SIGMA_LOWER_LIMIT * inRand + SIGMA_UPPER_LIMIT * (1.0f - inRand); sigmaSqrtT = sigmaVal * (float)sqrt(T); d1 = ((float)log(S / K) + (R + sigmaVal * sigmaVal / two) * T) / sigmaSqrtT; d2 = d1 - sigmaSqrtT; KexpMinusRT = K * (float)exp(-R * T); // phiD1 = phi(d1) float X = d1; float absX = (float)abs(X); float t = one / (one + temp4 * absX); float y = one - oneBySqrt2pi * (float)exp(-X * X / two) * t * (c1 + t * (c2 + t * (c3 + t * (c4 + t * c5)))); phiD1 = (X < zero) ? (one - y) : y; // phiD2 = phi(d2) X = d2; absX = abs(X); t = one / (one + temp4 * absX); y = one - oneBySqrt2pi * (float)exp(-X * X / two) * t * (c1 + t * (c2 + t * (c3 + t * (c4 + t * c5)))); phiD2 = (X < zero) ? (one - y) : y; dcall[id] = S * phiD1 - KexpMinusRT * phiD2; // phiD1 = phi(-d1); X = -d1; absX = abs(X); t = one / (one + temp4 * absX); y = one - oneBySqrt2pi * (float)exp(-X * X / two) * t * (c1 + t * (c2 + t * (c3 + t * (c4 + t * c5)))); phiD1 = (X < zero) ? (one - y) : y; // phiD2 = phi(-d2); X = -d2; absX = abs(X); t = one / (one + temp4 * absX); y = one - oneBySqrt2pi * (float)exp(-X * X / two) * t * (c1 + t * (c2 + t * (c3 + t * (c4 + t * c5)))); phiD2 = (X < zero) ? (one - y) : y; dput[id] = KexpMinusRT * phiD2 - S * phiD1; } } extern "C" { void bsCUDA(float* rand, float *put, float *call, int start, int end, int GPUN) { float *drand, *dput, *dcall; if (GPUN > 0) { assert(end - start + 1 == GPUN); #ifdef VERBOSE printf("In vcCUDA\n"); printf("\t GPUN: %d\n", GPUN); printf("\t range: %d..%d\n", start, end); #endif CudaSafeCall(cudaMalloc(&drand, sizeof(float) * GPUN)); CudaSafeCall(cudaMalloc(&dput, sizeof(float) * GPUN)); CudaSafeCall(cudaMalloc(&dcall, sizeof(float) * GPUN)); CudaSafeCall(cudaMemcpy(drand, rand + start, sizeof(float) * GPUN, cudaMemcpyHostToDevice)); bs<<<ceil(((float)GPUN)/THREADS_PER_BLOCK), THREADS_PER_BLOCK>>>(drand, dput, dcall, GPUN); CudaCheckError(); CudaSafeCall(cudaDeviceSynchronize()); CudaSafeCall(cudaMemcpy(put + start, dput, sizeof(float) * GPUN, cudaMemcpyDeviceToHost)); CudaSafeCall(cudaMemcpy(call + start, dcall, sizeof(float) * GPUN, cudaMemcpyDeviceToHost)); CudaSafeCall(cudaFree(drand)); CudaSafeCall(cudaFree(dput)); CudaSafeCall(cudaFree(dcall)); } } }
491
#include "includes.h" __global__ void copy_kernel_frombuf(char *dest, char *src, int rx_s, int rx_e, int ry_s, int ry_e, int rz_s, int rz_e, int x_step, int y_step, int z_step, int size_x, int size_y, int size_z, int buf_strides_x, int buf_strides_y, int buf_strides_z, int type_size, int dim, int OPS_soa) { int idx_z = rz_s + z_step * (blockDim.z * blockIdx.z + threadIdx.z); int idx_y = ry_s + y_step * (blockDim.y * blockIdx.y + threadIdx.y); int idx_x = rx_s + x_step * (blockDim.x * blockIdx.x + threadIdx.x); if ((x_step == 1 ? idx_x < rx_e : idx_x > rx_e) && (y_step == 1 ? idx_y < ry_e : idx_y > ry_e) && (z_step == 1 ? idx_z < rz_e : idx_z > rz_e)) { if (OPS_soa) dest += (idx_z * size_x * size_y + idx_y * size_x + idx_x) * type_size; else dest += (idx_z * size_x * size_y + idx_y * size_x + idx_x) * type_size * dim; src += ((idx_z - rz_s) * z_step * buf_strides_z + (idx_y - ry_s) * y_step * buf_strides_y + (idx_x - rx_s) * x_step * buf_strides_x) * type_size * dim; for (int d = 0; d < dim; d++) { memcpy(dest, src + d*type_size, type_size); if (OPS_soa) dest += size_x * size_y * size_z * type_size; else dest += type_size; } } }
492
#include<stdio.h> __global__ void kernel (float *out) { // shared memory // the size is determined by the host application extern __shared__ float sdata[]; // access thread id const unsigned int tid = threadIdx.x; // access number of threads in this block const unsigned int num_threads = blockDim.x; sdata[tid] = 0.0; __syncthreads(); //extern __shared__ float device_memory[]; // Compute the index variable int idx = blockIdx.x*blockDim.x + threadIdx.x; //device_memory[threadIdx.x] += blockDim.x; sdata[tid] += blockDim.x; //device_memory[threadIdx.x] += threadIdx.x; // Do I need this to get the output? // Maybe not //__syncthreads(); //out[threadIdx.x] = blockIdx.x; out[tid] = sdata[tid]; } int main() { int nbins = 16; int dimx = 16; int num_bytes = dimx*sizeof(float); float *d_a=0, *h_a=0; // device and host pointers // Allocate memory on host (CPU) h_a = (float*)malloc(num_bytes); // Allocate memory on device (GPU) cudaMalloc((void**)&d_a,num_bytes); // Check to see that there was enough memory for both // allocations. // If the memory allocation fails, it doesn't change the // pointer value. That is why we set them to be 0 at declaration, // and then see if they have changed or stayed the same. if (0==h_a || 0==d_a) { printf("couldn't allocate memory\n"); return 1; } // Initialize array to all 0's cudaMemset(d_a,0,num_bytes); //-----------------------------------------------------------------------// // Some explanatory code /* // This will give us 256 thread blocks, arranged in a 16x16 grid. dim3 grid(16,16); // This will give us 256 threads/block, arranged in a 16x16 grid. dim3 block(16,16); kernel<<<grid,block,0,0>>>(XXX); // This is a shortcut for launching some thread blocks. // It launches a grid of 32 thread blocks arranged in a 1x32 grid // and 512 threads per block, arranged in a 1x512 array. kernel<<<32,512>>>(YYY); */ //dim3 grid,block; //block.x = 8; //grid.x = dimx/block.x; //kernel<<<grid,block>>>(d_a); //kernel<<<4,16>>>(d_a); dim3 grid(16,16); dim3 block(16,16); kernel<<<grid,block,0,0>>>(d_a); cudaThreadSynchronize(); // Copy it back over cudaMemcpy(h_a,d_a,num_bytes,cudaMemcpyDeviceToHost); for (int i=0;i<dimx;i++) { printf("%f ",h_a[i]); } printf("\n"); free(h_a); cudaFree(d_a); return 0; }
493
#include <stdio.h> #include <stdlib.h> #include <string.h> #include <time.h> #include <zlib.h> int hNumberOfReads = 0; // holds number of reads that are processed int hReadsWritten = 0; // number of reads written to output file char input_filename[400]="/home/linux/cuda-workspace/PreprocessReads/test.txt"; // input file name char output_filename[400]="/mnt/sdc/Sequences/out.txt"; // output file name char GZIP_PIPE[410] = "gzip -> "; // option -gz will fallback to uncompressed if error on pipe opening char PIGZ_PIPE[410] = "pigz -> "; // option -pigz for multithreaded compression will fallback to gz and then to uncompressed gzFile inputFile; gzFile templateFile; // holds a second pointer in input read file for templating output with read name sequence and quality FILE *outputFile; bool overwrite_outputfile = false; // if set true the output file will be overwritten (cmd line option -f) bool write_gz_output = false; // specify .gz file compressed output (cmd line option -gz) bool write_pigz_output = false; // specify pigz multithreaded compression for output (-pigz option) bool AdaptorTrimming = true; // algorithm selectors bool QualityTrimming = true; bool gRNATrimming = false; int gRNA_start; // holds gRNA position relative to adaptor int gRNA_length; bool verbose = false; // if true print details of processing to screen bool FastQ_WARNING = false; // set to true is a FastQ file warning has been issued short MAX_READ_LENGTH = 203; // maximal length of reads in input file short MIN_OUT_READ_LEN = 26; // minimum length of reads after trimming to write to output file short MIN_BASE_QUAL = 20; // parameter for minimum quality for good base short MIN_QUAL_AFTER_BAD = 25; // parameter for average base quality after bad base short PHRED = 33; // subtract from qualities for numerical value of solexa bool auto_phred_detect = false; // if true try to detect PHRED format in FastQ input file int MAX_READS_ON_GPU = 10000000; // maximum number of reads that fit simultaneously on GPU #define MAX_ADAPTOR_LENGTH 100 // maximum length of adaptor sequence for trimming, can contain N for any base #define MAX_FASTQ_BUF_LINE 500 // structure of buffer for read from FastQ file char Adaptor[MAX_ADAPTOR_LENGTH] = "ATCTCGTATGCCGTCTTCTGCTT"; // adaptor on CPU side from parsing command line short mismatches = 2; // holds maximum number of mismatches on cpu side int numGPUs = 0; // holds number of CUDA devices in the system [1 TITAN to max 2 TITAN Z] #define MAX_GPU_NUM 4 int device[MAX_GPU_NUM]; // device numbers to use cudaStream_t upload_stream[MAX_GPU_NUM]; // cuda streams per device for overlapped asynchronous operation cudaStream_t compute_stream[MAX_GPU_NUM]; cudaStream_t download_stream[MAX_GPU_NUM]; char *dSequenceArray[MAX_GPU_NUM]; // device pointer to data array, will hold hReadSequence and hQualstr char *dQualArray[MAX_GPU_NUM]; // device pointer to data array, will hold hReadSequence and hQualstr short *dIntArray[MAX_GPU_NUM][2]; // two device pointers to integer array, will hold hReadLen cudaEvent_t QUAL_COPY_DONE[MAX_GPU_NUM]; // events for device host synchronization cudaEvent_t SEQ_COPY_DONE[MAX_GPU_NUM]; cudaEvent_t TrimmQ_DONE[MAX_GPU_NUM]; cudaEvent_t TrimmA_DONE[MAX_GPU_NUM]; cudaEvent_t DTH_COPY_DONE[MAX_GPU_NUM]; short *hReadLen[MAX_GPU_NUM][2]; // two buffer to hold read length on host char *hReadSequence[MAX_GPU_NUM][2]; // buffer holding sequences of reads on host char *hReadQualstr[MAX_GPU_NUM]; // two buffer holding qualities of reads on host struct read { char name[MAX_FASTQ_BUF_LINE]; char sequence[MAX_FASTQ_BUF_LINE]; char descr[MAX_FASTQ_BUF_LINE]; char qualstr[MAX_FASTQ_BUF_LINE]; } Read; // buffer one read from FastQ file i 4 lines // macro checks return value of the CUDA runtime call and exits the application if the call failed. #define CUDA_CHECK_RETURN(value) { \ cudaError_t _m_cudaStat = value; \ if (_m_cudaStat != cudaSuccess) { \ fprintf(stderr, "Error %s at line %d in file %s\n", \ cudaGetErrorString(_m_cudaStat), __LINE__, __FILE__); \ exit(1); \ } } // For trimming adaptor sequences store adaptor and length as well as quality cutoffs in device constant memory __constant__ __device__ char ADAPTOR[MAX_ADAPTOR_LENGTH]; // adaptor sequence can contain N for any match __constant__ __device__ short ADAPTOR_LEN; // length of adaptor sequence in bases __constant__ __device__ short MAX_MM=2; // maximum mismatches allowed not including Ns __constant__ __device__ short QUAL_PADDING=33; // hold PHRED base for qualities __constant__ __device__ short MIN_QUAL=20; // hold minimal quality that is considered good base __constant__ __device__ short MIN_AVERAGE_QUAL_AFTER_BAD=25; // minimum quality average of remaining read after bad base void SetAdaptorSequence(const char *AdaptorSequence, const short mismatches, const short PHRED, const short MIN_BASE_QUAL, const short MIN_QUAL_AFTER_BAD) { // define the adaptor, mismatches and quality parameters before trimming short AdLen = strnlen(AdaptorSequence, MAX_ADAPTOR_LENGTH); // get length of adaptor sequence for(int dev=0; dev < numGPUs; dev++) { cudaSetDevice(device[dev]); if(verbose) printf("[%d] Setting Adaptor sequence %s, length %d on GPU \n", dev, AdaptorSequence, AdLen); CUDA_CHECK_RETURN(cudaMemcpyToSymbol(ADAPTOR, AdaptorSequence, AdLen)); // copy to device CUDA_CHECK_RETURN(cudaMemcpyToSymbol(ADAPTOR_LEN, &AdLen, sizeof(short))); // constant memory if(verbose) printf("[%d] Setting mismatches %d, PHRED+%d on GPU \n", dev, mismatches, PHRED); CUDA_CHECK_RETURN(cudaMemcpyToSymbol(MAX_MM, &mismatches, sizeof(short))); CUDA_CHECK_RETURN(cudaMemcpyToSymbol(QUAL_PADDING, &PHRED, sizeof(short))); if(verbose) printf("[%d] Setting minimum base quality %d, average read quality after bad %d on GPU \n", dev, MIN_BASE_QUAL, MIN_QUAL_AFTER_BAD); CUDA_CHECK_RETURN(cudaMemcpyToSymbol(MIN_QUAL, &MIN_BASE_QUAL, sizeof(short))); CUDA_CHECK_RETURN(cudaMemcpyToSymbol(MIN_AVERAGE_QUAL_AFTER_BAD, &MIN_QUAL_AFTER_BAD, sizeof(short))); } } __global__ void Find_gRNA(char *dDataArray, short *read_length, int reads, short MAX_READ_LENGTH) { for(long idx = blockIdx.x * blockDim.x + threadIdx.x; idx < reads; idx += blockDim.x * gridDim.x) { if (idx < reads) { char *sequence = &dDataArray[idx*MAX_READ_LENGTH]; short rl=read_length[idx]; short n; short p=0; short mm=0; read_length[idx]=0; while (p <= rl-ADAPTOR_LEN) { mm=0; for (n=0; n<ADAPTOR_LEN; n++) { if (ADAPTOR[n]!='N' && sequence[p+n]!=ADAPTOR[n]) { mm++; if (mm > MAX_MM) break; } } if (mm <= MAX_MM) { read_length[idx]=p; break; } p++; } if (mm <= MAX_MM ) continue; p=rl-ADAPTOR_LEN+1; if (rl >= ADAPTOR_LEN-1) { mm=0; for (n=0; n<ADAPTOR_LEN-1; n++) { if (ADAPTOR[n]!='N' && sequence[p+n]!=ADAPTOR[n]) { mm++; if (mm >= MAX_MM) break; } } if (mm < MAX_MM) { read_length[idx]=p; continue; } } p++; if (rl >= ADAPTOR_LEN-2) { mm=0; for (n=0; n<ADAPTOR_LEN-2; n++) { if (ADAPTOR[n]!='N' && sequence[p+n]!=ADAPTOR[n]) { mm++; break; } } if (MAX_MM > (mm+1)) { read_length[idx]=p; } } } } } __global__ void TrimmAdaptors(char *dDataArray, short *read_length, int reads, short MAX_READ_LENGTH) { for(long idx = blockIdx.x * blockDim.x + threadIdx.x; idx < reads; idx += blockDim.x * gridDim.x) { if (idx < reads) { char *sequence = &dDataArray[idx*MAX_READ_LENGTH]; short rl=read_length[idx]; short n; short p=0; short mm=0; while (p <= rl-ADAPTOR_LEN) { mm=0; for (n=0; n<ADAPTOR_LEN; n++) { if (ADAPTOR[n]!='N' && sequence[p+n]!=ADAPTOR[n]) { mm++; if (mm > MAX_MM) break; } } if (mm <= MAX_MM) { read_length[idx]=p; break; } p++; } if (mm <= MAX_MM ) continue; p=rl-ADAPTOR_LEN+1; if (rl >= ADAPTOR_LEN-1) { mm=0; for (n=0; n<ADAPTOR_LEN-1; n++) { if (ADAPTOR[n]!='N' && sequence[p+n]!=ADAPTOR[n]) { mm++; if (mm >= MAX_MM) break; } } if (mm < MAX_MM) { read_length[idx]=p; continue; } } p++; if (rl >= ADAPTOR_LEN-2) { mm=0; for (n=0; n<ADAPTOR_LEN-2; n++) { if (ADAPTOR[n]!='N' && sequence[p+n]!=ADAPTOR[n]) { mm++; break; } } if (MAX_MM > (mm+1)) { read_length[idx]=p; } } } } } __global__ void TrimmQuals(char *quals, short *read_length, int reads, short MAX_READ_LENGTH) { for(long idx = blockIdx.x * blockDim.x + threadIdx.x; idx < reads; idx += blockDim.x * gridDim.x) { if (idx < reads) { char *q = &quals[idx*MAX_READ_LENGTH]; short rl=read_length[idx]; short i; for(i=0; i<rl; i++) { if ((q[i]-QUAL_PADDING)<=MIN_QUAL) { short s=0; short r=i+1; while (r<rl) { s=s+q[r]-QUAL_PADDING; r++; } if(s<(MIN_AVERAGE_QUAL_AFTER_BAD*(rl-i+1))) { read_length[idx]=i; break; } } } } } } void InitGPUs(void) { if(verbose) printf("\n"); for (int dev=0; dev<numGPUs; dev++) // initialize devices and allocate cuda resources { if(verbose) printf("[%d] Initializing GPU\n", dev); CUDA_CHECK_RETURN(cudaSetDevice(device[dev])); CUDA_CHECK_RETURN(cudaMalloc((void **)&dSequenceArray[dev], MAX_READS_ON_GPU * MAX_READ_LENGTH * sizeof(char))); // one data array CUDA_CHECK_RETURN(cudaMalloc((void **)&dQualArray[dev], MAX_READS_ON_GPU * MAX_READ_LENGTH * sizeof(char))); // one data array CUDA_CHECK_RETURN(cudaMalloc((void **)&dIntArray[dev][0], MAX_READS_ON_GPU * sizeof(short))); // two dIntArrays CUDA_CHECK_RETURN(cudaMalloc((void **)&dIntArray[dev][1], MAX_READS_ON_GPU * sizeof(short))); CUDA_CHECK_RETURN(cudaStreamCreate(&upload_stream[dev])); // create streams on devices CUDA_CHECK_RETURN(cudaStreamCreate(&compute_stream[dev])); CUDA_CHECK_RETURN(cudaStreamCreate(&download_stream[dev])); CUDA_CHECK_RETURN(cudaEventCreateWithFlags(&QUAL_COPY_DONE[dev], cudaEventDisableTiming || cudaEventBlockingSync)); // events for device host synchronization CUDA_CHECK_RETURN(cudaEventCreateWithFlags(&SEQ_COPY_DONE[dev], cudaEventDisableTiming)); CUDA_CHECK_RETURN(cudaEventCreateWithFlags(&TrimmQ_DONE[dev], cudaEventDisableTiming)); CUDA_CHECK_RETURN(cudaEventCreateWithFlags(&TrimmA_DONE[dev], cudaEventDisableTiming)); CUDA_CHECK_RETURN(cudaEventCreateWithFlags(&DTH_COPY_DONE[dev], cudaEventDisableTiming || cudaEventBlockingSync)); if(verbose) printf("[%d] Allocating pinned CPU memory for reads\n", dev); CUDA_CHECK_RETURN(cudaMallocHost((void **) &hReadLen[dev][0], MAX_READS_ON_GPU * sizeof(short))); // allocate two buffers for reads length CUDA_CHECK_RETURN(cudaMallocHost((void **) &hReadLen[dev][1], MAX_READS_ON_GPU * sizeof(short))); CUDA_CHECK_RETURN(cudaMallocHost((void **) &hReadSequence[dev][0], MAX_READS_ON_GPU * MAX_READ_LENGTH * sizeof(char))); // two buffers for reads sequence CUDA_CHECK_RETURN(cudaMallocHost((void **) &hReadSequence[dev][1], MAX_READS_ON_GPU * MAX_READ_LENGTH * sizeof(char))); CUDA_CHECK_RETURN(cudaMallocHost((void **) &hReadQualstr[dev], MAX_READS_ON_GPU * MAX_READ_LENGTH * sizeof(char))); // one buffer for qualities } } void FreeGPUs(void) { for (int dev=0; dev<numGPUs; dev++) // release cuda resources from all devices { CUDA_CHECK_RETURN(cudaSetDevice(device[dev])); CUDA_CHECK_RETURN(cudaEventDestroy(QUAL_COPY_DONE[dev])); CUDA_CHECK_RETURN(cudaEventDestroy(SEQ_COPY_DONE[dev])); CUDA_CHECK_RETURN(cudaEventDestroy(TrimmQ_DONE[dev])); CUDA_CHECK_RETURN(cudaEventDestroy(TrimmA_DONE[dev])); CUDA_CHECK_RETURN(cudaEventDestroy(DTH_COPY_DONE[dev])); CUDA_CHECK_RETURN(cudaStreamDestroy(upload_stream[dev])); CUDA_CHECK_RETURN(cudaStreamDestroy(compute_stream[dev])); CUDA_CHECK_RETURN(cudaStreamDestroy(download_stream[dev])); CUDA_CHECK_RETURN(cudaFree(dIntArray[dev][0])); CUDA_CHECK_RETURN(cudaFree(dIntArray[dev][1])); CUDA_CHECK_RETURN(cudaFree(dSequenceArray[dev])); CUDA_CHECK_RETURN(cudaFree(dQualArray[dev])); cudaFreeHost(hReadLen[dev][0]); // free all page locked host memory cudaFreeHost(hReadLen[dev][1]); cudaFreeHost(hReadSequence[dev][0]); cudaFreeHost(hReadSequence[dev][1]); cudaFreeHost(hReadQualstr[dev]); } } int FindGPUs(void) { int deviceCount; numGPUs = 0; CUDA_CHECK_RETURN(cudaGetDeviceCount(&deviceCount)); // search cuda devices and identify compute 3.5 with 6 GB if (deviceCount == 0) return(0); for (int dev=0; dev<deviceCount; dev++) { cudaSetDevice(dev); cudaDeviceProp deviceProp; cudaGetDeviceProperties(&deviceProp, dev); int driverVersion, runtimeVersion; cudaDriverGetVersion(&driverVersion); cudaRuntimeGetVersion(&runtimeVersion); if(((deviceProp.major == 3 && deviceProp.minor >= 5) || (deviceProp.major > 3)) && deviceProp.totalGlobalMem > 6144000000) { if(verbose) { printf("\nDevice %d: %s\n", dev, deviceProp.name); printf(" CUDA Driver / Runtime Version: %d.%d / %d.%d\n", driverVersion/1000, (driverVersion%100)/10, runtimeVersion/1000, (runtimeVersion%100)/10); printf(" CUDA Compute Capability: %d.%d\n", deviceProp.major, deviceProp.minor); printf(" PCI bus ID: %d:%d\n", deviceProp.pciBusID, deviceProp.pciDeviceID); printf(" Total amount of global memory: %.0f MBytes (%llu bytes)\n", (float)deviceProp.totalGlobalMem/1048576.0f, (unsigned long long) deviceProp.totalGlobalMem); printf(" Number of Multiprocessors: %d\n", deviceProp.multiProcessorCount); } device[numGPUs] = dev; numGPUs++; if (numGPUs >= MAX_GPU_NUM) break; } } return(numGPUs); } void OpenFiles() { // handle compression using zlib gzFile functions for input and pipe gzip for output if(!overwrite_outputfile) // test if output file exists if option -f is not specified { outputFile = fopen(output_filename, "r"); if(outputFile!=NULL) { printf("ERROR output file exists already. To overwrite run with option -f\n"); exit(255); } // do not attempt close file as we would have already exited if opening was successful ! } inputFile = gzopen(input_filename, "r"); if(inputFile == NULL) { printf("ERROR opening input file: %s\n", input_filename); exit(255); } templateFile = gzopen(input_filename, "r"); // holds a second access to input read file for rereading positions for output if(templateFile == NULL) { printf("ERROR opening second handle to input file.\n"); exit(255); } if(write_pigz_output) { outputFile = popen(strcat(PIGZ_PIPE, output_filename), "w"); if(outputFile == NULL) { printf("Option -pigz: could not open pipe ... falling back on libz.\n\tMake sure pigz is installed with: sudo apt-get install pigz\n"); write_gz_output = true; write_pigz_output = false; } } if(write_gz_output && !write_pigz_output) { outputFile = popen(strcat(GZIP_PIPE, output_filename), "w"); if(outputFile == NULL) { printf("Option -gz: could not open pipe ... falling back to uncompressed output.\n"); write_gz_output = false; } } if(!write_gz_output && !write_pigz_output) outputFile = fopen(output_filename, "w"); if(outputFile == NULL) { printf("ERROR opening output file: %s\n", output_filename); exit(255); } } int ReadBlockOfReads(int max_num_to_read, short *hReadLen, char* hReadSequence, char *hReadQualstr) { int n = 0; // returns the number of reads read short length; while(gzgets(inputFile, Read.name, MAX_FASTQ_BUF_LINE) != NULL) { if(Read.name[0] == 13) break; // end if CR <13> or LF <10> are encountered if(Read.name[0] == 10) break; if(gzgets(inputFile, Read.sequence, MAX_FASTQ_BUF_LINE)==NULL) { printf("ERROR parsing input!\n"); exit(255); } if(gzgets(inputFile, Read.descr, MAX_FASTQ_BUF_LINE)==NULL) { printf("ERROR parsing input!\n"); exit(255); } if(gzgets(inputFile, Read.qualstr, MAX_FASTQ_BUF_LINE)==NULL) { printf("ERROR parsing input!\n"); exit(255); } if(!FastQ_WARNING) // write warning if FastQ file contains non-standard lines { if(Read.name[0]!='@' || Read.descr[0]!='+') { printf("Warning: Encountered unusual line identifiers in FastQ file format.\n"); FastQ_WARNING = true; } } length = strlen(Read.sequence)-1; if(length > MAX_READ_LENGTH) length = MAX_READ_LENGTH; // printf("%d, ", length); memcpy(&hReadSequence[n*MAX_READ_LENGTH], Read.sequence, length); memcpy(&hReadQualstr[n*MAX_READ_LENGTH], Read.qualstr, length); hReadLen[n] = length; n++; if(n == max_num_to_read) break; } hNumberOfReads = hNumberOfReads + n; // update global variable to total number of reads return(n); } int WriteBlockOfReads(int num_of_reads_to_write, const short *hReadLen, short min_out_read_length) { int n=0; int w=0; short length; char str_buffer[MAX_FASTQ_BUF_LINE]; if(num_of_reads_to_write == 0) return(0); if(verbose) printf("I/O > num_of_reads_to_write = %d\n", num_of_reads_to_write); while(gzgets(templateFile, Read.name, MAX_FASTQ_BUF_LINE) != NULL) { if(gzgets(templateFile, Read.sequence, MAX_FASTQ_BUF_LINE)==NULL) { printf("ERROR parsing input file for writing trimmed output!\n"); exit(255); } if(gzgets(templateFile, Read.descr, MAX_FASTQ_BUF_LINE)==NULL) { printf("ERROR parsing input file for writing trimmed output!\n"); exit(255); } if(gzgets(templateFile, Read.qualstr, MAX_FASTQ_BUF_LINE)==NULL) { printf("ERROR parsing input file for writing trimmed output!\n"); exit(255); } length = hReadLen[n]; if(gRNATrimming) // isolate the gRNA from adaptor match { if(length>0) { strncpy(str_buffer, &Read.sequence[length+gRNA_start], gRNA_length); strncpy(&Read.sequence[0], str_buffer, gRNA_length); Read.sequence[gRNA_length]=10; Read.sequence[gRNA_length+1]=0; strncpy(str_buffer, &Read.qualstr[length+gRNA_start], gRNA_length); strncpy(&Read.qualstr[0], str_buffer, gRNA_length); Read.qualstr[gRNA_length]=10; Read.qualstr[gRNA_length+1]=0; fprintf(outputFile,"%s", Read.name); fprintf(outputFile,"%s", Read.sequence); fprintf(outputFile,"%s", Read.descr); fprintf(outputFile,"%s", Read.qualstr); w++; } } else // normal quality and adaptor trimming { if(length >= min_out_read_length) { Read.sequence[length]=10; // write only reads that are longer than minimum to output file Read.sequence[length+1]=0; Read.qualstr[length]=10; Read.qualstr[length+1]=0; fprintf(outputFile,"%s", Read.name); fprintf(outputFile,"%s", Read.sequence); fprintf(outputFile,"%s", Read.descr); fprintf(outputFile,"%s", Read.qualstr); w++; } } n++; if(n == num_of_reads_to_write) break; } hReadsWritten = hReadsWritten + w; return(n); } void CloseFiles(void) { gzclose(inputFile); gzclose(templateFile); if(write_gz_output || write_pigz_output) pclose(outputFile); else fclose(outputFile); } bool Detect_FastQ_Format_PHRED(void) { int n = 0; // returns the number of reads read short length; uint min_qual = 65; uint max_qual = 65; bool deciphered = false; inputFile = gzopen(input_filename, "r"); if(inputFile == NULL) { printf("ERROR opening input file %s\n", input_filename); exit(255); } while(gzgets(inputFile, Read.name, MAX_FASTQ_BUF_LINE) != NULL) { if(Read.name[0] == 13) break; // end if CR <13> or LF <10> are encountered if(Read.name[0] == 10) break; if(gzgets(inputFile, Read.sequence, MAX_FASTQ_BUF_LINE)==NULL) { printf("ERROR parsing input!\n"); exit(255); } if(gzgets(inputFile, Read.descr, MAX_FASTQ_BUF_LINE)==NULL) { printf("ERROR parsing input!\n"); exit(255); } if(gzgets(inputFile, Read.qualstr, MAX_FASTQ_BUF_LINE)==NULL) { printf("ERROR parsing input!\n"); exit(255); } if(!FastQ_WARNING) // write warning if FastQ file contains non-standard lines { if(Read.name[0]!='@' || Read.descr[0]!='+') { printf("Warning: Encountered unusual line identifiers in FastQ file format."); FastQ_WARNING = true; } } length = strlen(Read.sequence)-1; for(n=0; n<length;n++) { if(min_qual > (uint)Read.qualstr[n]) { min_qual = (uint) Read.qualstr[n]; } else { if(max_qual < (uint)Read.qualstr[n]) max_qual = (uint) Read.qualstr[n]; } } if(min_qual < 59) { PHRED = 33; // FastQ Sanger and Illumina 1.8+ format deciphered = true; break; } if(max_qual > 80) { PHRED = 64; // FastQ Illumina 1.3+ format deciphered = true; break; } } gzclose(inputFile); return(deciphered); } int PreprocessReadsOnGPU(void) { bool DONE = false; bool ALL_DONE = false; int ReadsProcessed = 0; int ReadsToProcess[MAX_GPU_NUM]; int ReadsSentToGPU[MAX_GPU_NUM]; int dev_side = 0; // left or right side of device memories [0] or [1] int dev_next_side = 1; int side_flip; if(verbose) printf("\nPreprocessing reads on GPU\n"); for(int dev=0; dev<numGPUs; dev++) // copy data and run kernels initial round to fill CUDA queue and not waste time ! { ReadsToProcess[dev] = 0; ReadsSentToGPU[dev] = 0; if(!DONE) { ReadsToProcess[dev] = ReadBlockOfReads(MAX_READS_ON_GPU, hReadLen[dev][dev_side], hReadSequence[dev][dev_side], hReadQualstr[dev]); if(ReadsToProcess[dev] < MAX_READS_ON_GPU) { DONE = true; } if(ReadsToProcess[dev] == 0) continue; CUDA_CHECK_RETURN(cudaSetDevice(device[dev])); if(QualityTrimming) CUDA_CHECK_RETURN(cudaMemcpyAsync(dQualArray[dev], hReadQualstr[dev], ReadsToProcess[dev] * MAX_READ_LENGTH * sizeof(char), cudaMemcpyHostToDevice, upload_stream[dev])); CUDA_CHECK_RETURN(cudaMemcpyAsync(dIntArray[dev][dev_side], hReadLen[dev][dev_side], ReadsToProcess[dev] * sizeof(short), cudaMemcpyHostToDevice, upload_stream[dev])); CUDA_CHECK_RETURN(cudaEventRecord(QUAL_COPY_DONE[dev], upload_stream[dev])); CUDA_CHECK_RETURN(cudaStreamWaitEvent(compute_stream[dev], QUAL_COPY_DONE[dev], 0)); if(QualityTrimming) { if(verbose) printf("[%d] TrimmQuals\n", device[dev]); TrimmQuals<<<4096, 256, 0, compute_stream[dev]>>>(dQualArray[dev], dIntArray[dev][dev_side], ReadsToProcess[dev], MAX_READ_LENGTH); CUDA_CHECK_RETURN(cudaGetLastError()); } CUDA_CHECK_RETURN(cudaEventRecord(TrimmQ_DONE[dev], compute_stream[dev])); if(AdaptorTrimming || gRNATrimming) CUDA_CHECK_RETURN(cudaMemcpyAsync(dSequenceArray[dev], hReadSequence[dev][dev_side], ReadsToProcess[dev] * MAX_READ_LENGTH * sizeof(char), cudaMemcpyHostToDevice, upload_stream[dev])); CUDA_CHECK_RETURN(cudaEventRecord(SEQ_COPY_DONE[dev], upload_stream[dev])); CUDA_CHECK_RETURN(cudaStreamWaitEvent(compute_stream[dev], SEQ_COPY_DONE[dev], 0)); if(gRNATrimming) { if(verbose) printf("[%d] Find_gRNA\n", device[dev]); Find_gRNA<<<4096, 256, 0, compute_stream[dev]>>>(dSequenceArray[dev], dIntArray[dev][dev_side], ReadsToProcess[dev], MAX_READ_LENGTH); CUDA_CHECK_RETURN(cudaGetLastError()); } else { if(AdaptorTrimming) { if(verbose) printf("[%d] TrimmAdaptors\n", device[dev]); TrimmAdaptors<<<4096, 256, 0, compute_stream[dev]>>>(dSequenceArray[dev], dIntArray[dev][dev_side], ReadsToProcess[dev], MAX_READ_LENGTH); CUDA_CHECK_RETURN(cudaGetLastError()); } } CUDA_CHECK_RETURN(cudaEventRecord(TrimmA_DONE[dev], compute_stream[dev])); CUDA_CHECK_RETURN(cudaStreamWaitEvent(download_stream[dev], TrimmA_DONE[dev], 0)); CUDA_CHECK_RETURN(cudaMemcpyAsync(hReadLen[dev][dev_side], dIntArray[dev][dev_side], ReadsToProcess[dev] * sizeof(short), cudaMemcpyDeviceToHost, download_stream[dev])); CUDA_CHECK_RETURN(cudaEventRecord(DTH_COPY_DONE[dev], download_stream[dev])); if(verbose) printf("[%d] Memcpy DtoH %d reads\n", device[dev], ReadsToProcess[dev]); ReadsSentToGPU[dev] = ReadsToProcess[dev]; ReadsToProcess[dev] = 0; } } while(!ALL_DONE) { ALL_DONE = true; // setup for test if should stop if there is no more data on the GPU if(!DONE) { for(int dev=0; dev<numGPUs; dev++) // read a block of data, copy QUALS to GPU and run QUAL kernel { ReadsToProcess[dev] = 0; CUDA_CHECK_RETURN(cudaSetDevice(device[dev])); if(ReadsSentToGPU[dev]>0) { CUDA_CHECK_RETURN(cudaEventSynchronize(TrimmQ_DONE[dev])); } ReadsToProcess[dev] = ReadBlockOfReads(MAX_READS_ON_GPU, hReadLen[dev][dev_next_side], hReadSequence[dev][dev_next_side], hReadQualstr[dev]); if(ReadsToProcess[dev] < MAX_READS_ON_GPU) { DONE = true; } if(ReadsToProcess[dev] == 0) break; ALL_DONE = false; // there is more work on the GPUs that requires further processing if(QualityTrimming) CUDA_CHECK_RETURN(cudaMemcpyAsync(dQualArray[dev], hReadQualstr[dev], ReadsToProcess[dev] * MAX_READ_LENGTH * sizeof(char), cudaMemcpyHostToDevice, upload_stream[dev])); CUDA_CHECK_RETURN(cudaMemcpyAsync(dIntArray[dev][dev_next_side], hReadLen[dev][dev_next_side], ReadsToProcess[dev] * sizeof(short), cudaMemcpyHostToDevice, upload_stream[dev])); CUDA_CHECK_RETURN(cudaEventRecord(QUAL_COPY_DONE[dev], upload_stream[dev])); CUDA_CHECK_RETURN(cudaStreamWaitEvent(compute_stream[dev], QUAL_COPY_DONE[dev], 0)); if(QualityTrimming) { if(verbose) printf("[%d] TrimmQuals\n", device[dev]); TrimmQuals<<<4096, 256, 0, compute_stream[dev]>>>(dQualArray[dev], dIntArray[dev][dev_next_side], ReadsToProcess[dev], MAX_READ_LENGTH); CUDA_CHECK_RETURN(cudaGetLastError()); } } } for(int dev=0; dev<numGPUs; dev++) // copy sequence and run Adaptor trim kernel { if(ReadsToProcess[dev]>0) { CUDA_CHECK_RETURN(cudaSetDevice(device[dev])); if(ReadsSentToGPU[dev]>0) { CUDA_CHECK_RETURN(cudaEventSynchronize(TrimmA_DONE[dev])); } if(AdaptorTrimming || gRNATrimming) CUDA_CHECK_RETURN(cudaMemcpyAsync(dSequenceArray[dev], hReadSequence[dev][dev_next_side], ReadsToProcess[dev] * MAX_READ_LENGTH * sizeof(char), cudaMemcpyHostToDevice, upload_stream[dev])); CUDA_CHECK_RETURN(cudaEventRecord(SEQ_COPY_DONE[dev], upload_stream[dev])); CUDA_CHECK_RETURN(cudaStreamWaitEvent(compute_stream[dev], SEQ_COPY_DONE[dev], 0)); if(gRNATrimming) { if(verbose) printf("[%d] Find_gRNA\n", device[dev]); Find_gRNA<<<4096, 256, 0, compute_stream[dev]>>>(dSequenceArray[dev], dIntArray[dev][dev_next_side], ReadsToProcess[dev], MAX_READ_LENGTH); CUDA_CHECK_RETURN(cudaGetLastError()); } else { if(AdaptorTrimming) { if(verbose) printf("[%d] TrimmAdaptors\n", device[dev]); TrimmAdaptors<<<4096, 256, 0, compute_stream[dev]>>>(dSequenceArray[dev], dIntArray[dev][dev_next_side], ReadsToProcess[dev], MAX_READ_LENGTH); CUDA_CHECK_RETURN(cudaGetLastError()); } } CUDA_CHECK_RETURN(cudaEventRecord(TrimmA_DONE[dev], compute_stream[dev])); } } for(int dev=0; dev<numGPUs; dev++) // copy data from devices and write output file { if(verbose) printf("[%d] > ReadsSentToGPU = %d\n", dev, ReadsSentToGPU[dev]); if(ReadsSentToGPU[dev]>0) { CUDA_CHECK_RETURN(cudaSetDevice(device[dev])); CUDA_CHECK_RETURN(cudaEventSynchronize(DTH_COPY_DONE[dev])); if(verbose) printf("[%d] Writing hReadLen[%d][%d]\n", device[dev], dev, dev_side); WriteBlockOfReads(ReadsSentToGPU[dev], hReadLen[dev][dev_side], MIN_OUT_READ_LEN); // write output block ReadsProcessed += ReadsSentToGPU[dev]; // count how many reads were considered for writing - actual output has minimal length requirement } if(ReadsToProcess[dev]>0) { CUDA_CHECK_RETURN(cudaStreamWaitEvent(download_stream[dev], TrimmA_DONE[dev], 0)); CUDA_CHECK_RETURN(cudaMemcpyAsync(hReadLen[dev][dev_next_side], dIntArray[dev][dev_next_side], ReadsToProcess[dev] * sizeof(short), cudaMemcpyDeviceToHost, download_stream[dev])); CUDA_CHECK_RETURN(cudaEventRecord(DTH_COPY_DONE[dev], download_stream[dev])); if(verbose) printf("[%d] Memcpy DtoH %d reads\n", device[dev], ReadsToProcess[dev]); } ReadsSentToGPU[dev] = ReadsToProcess[dev]; ReadsToProcess[dev] = 0; } side_flip = dev_side; // dev_side alternate between 0 and 1 to use memory efficiently dev_side = dev_next_side; dev_next_side = side_flip; } return(ReadsProcessed); } void usage_help(void) { printf("\nPreprocessReads multi-GPU version\n"); printf("\tsupports up to 4 NVIDIA GPUs with compute capability greater than 3.5 and at least 6 GB memory.\n"); printf("\tcompiled for minimum CUDA API 6.5 (build 20210107).\n"); printf("\nProgram Options:\n\n"); printf("\t-i, -I ....... specify the path for the input file [required]\n"); printf("\t-o, -O ....... specify the path for the output file [required]\n"); printf("\t-len, -Len ... specify the minimum length for reads written to the output file\n"); printf("\t-f ........... over write output file if it exists\n"); printf("\t-gz .......... write output to file in compressed format (.gz)\n"); printf("\t-pigz ........ write output to file in compressed format (.gz) using multithreaded compression\n"); printf("\t-v, -V ....... verbose, prints details on processing to screen\n"); printf("\t-a, -A ....... adaptor sequence, can contain Ns that will match any base in the read\n"); printf("\t-mm, -MM ..... number of mismatches allowed in adaptor search (not including Ns)\n"); printf("\t-Phred ....... sets the base of the qualities PHRED values [default 33], use AUTO for autodetection\n"); printf("\t-Qmin ........ sets the minimum acceptable quality score for a good base [default 20]\n"); printf("\t-Qualab ...... sets the minimum average base quality score for remainder of the read after a bad base [default 25]\n"); printf("\t-dev, -Dev ... specify CUDA device to use (can be used repeatedly for selecting multiple GPUs,\n"); printf("\t if not specified an automatic search for GPUs with compute capability 3.5 and 6 GB memory is performed)\n"); printf("\nAlgorithm selection:\n\n"); printf("\t/TA .......... select adaptor trimming only (can be also used before option /gRNA to avoid quality trimming)\n"); printf("\t/TQ .......... select quality trimming only\n"); printf("\t/TAQ ......... select quality and adaptor trimming [default]\n"); printf("\t/gRNA ........ select gRNA recovery, followed by start relative to start of adaptor sequence and length of gRNA to be retrieved\n"); printf("\t ( /gRNA 12 20 will retrieve 20 nucleotide read sequence starting 12 positions after the 5' end match of adaptor)\n"); printf("\nProgrammer options variables:\n"); printf("\t-G ........... set MAX_READS_ON_GPU variable\n"); printf("\t-R ........... set MAX_READ_LENGTH variable\n"); printf("\nexample usage:\n"); printf("\tPreprocessReads -dev 0 -dev 1 -i infile.fastq -o outfilename.fastq -len 26 -a ATTAGATCGATGCTA -mm 2\n\n"); exit(3); } void invalid_command_line_option(const char *errorstr) { printf("\nERROR %s\n", errorstr); printf("\nUsage ----------------------------------------------\n"); usage_help(); } void parseCommandLineArguments(int argc, char *argv[]) { bool inputfile_set = false; bool outputfile_set = false; bool adaptor_set = false; bool mismatch_set = false; bool outlen_set = false; for(int n=1; n<argc; n++) { if(argv[n][0] == '-') { char a = argv[n][1]; switch (a) { case 'I': case 'i': if(inputfile_set) invalid_command_line_option("option -i: input file name already specified."); if(++n<argc) { if(strlen(argv[n])>400) invalid_command_line_option("option -i: input file path length exceeds limit."); strcpy(input_filename, argv[n]); inputfile_set=true; break; } else invalid_command_line_option("option -i: INPUT file name missing."); break; case 'O': case 'o': if(outputfile_set) invalid_command_line_option("option -o: output file name already specified."); if(++n<argc) { if(strlen(argv[n])>400) invalid_command_line_option("option -o: output file path length exceeds limit."); strcpy(output_filename, argv[n]); outputfile_set=true; break; } else invalid_command_line_option("option -o: OUTPUT file name missing."); break; case 'l': case 'L': if(argv[n][2]!='e' || argv[n][3]!='n') invalid_command_line_option("invalid command line option encountered."); if(outlen_set) invalid_command_line_option("option -len: minimum read length to include in output file is already specified."); if(++n<argc) { int ol=atoi(argv[n]); if(ol<0 || ol>MAX_READ_LENGTH) invalid_command_line_option("option -len: encountered invalid minimum read length to include in output file."); MIN_OUT_READ_LEN = (short) ol; outlen_set=true; break; } else invalid_command_line_option("option -len: expected minimum output read length not found."); break; case 'A': case 'a': if(adaptor_set) invalid_command_line_option("option -a: adaptor sequence already specified."); if(++n<argc) { if(strlen(argv[n])>MAX_ADAPTOR_LENGTH) invalid_command_line_option("option -a: adaptor sequence length exceeds limit."); if(strlen(argv[n])<3) invalid_command_line_option("option -a: adaptor sequence length too short."); strcpy(Adaptor, argv[n]); adaptor_set=true; break; } else invalid_command_line_option("option -a: expected adaptor sequence."); break; case 'M': case 'm': if(argv[n][2]!='m' && argv[n][2]!='M') invalid_command_line_option("invalid command line option encountered."); if(mismatch_set) invalid_command_line_option("option -mm: number of mismatches is already specified."); if(++n<argc) { int mm=atoi(argv[n]); if(mm>20) invalid_command_line_option("option -mm: number of mismatches exceeds limit."); mismatches = (short) mm; mismatch_set=true; break; } else invalid_command_line_option("option -mm: expected number of mismatches not found."); break; case 'd': case 'D': if(argv[n][2]!='e' || argv[n][3]!='v') invalid_command_line_option("invalid command line option encountered."); if(numGPUs>=MAX_GPU_NUM) invalid_command_line_option("option -dev: number of CUDA devices exceeds maximum."); if(++n<argc) { int d=atoi(argv[n]); if(d<0 || d>20) invalid_command_line_option("option -dev: invalid device number."); device[numGPUs] = d; numGPUs++; break; } else invalid_command_line_option("option -dev: expected CUDA device number not found."); break; case 'f': overwrite_outputfile = true; // -f break; case 'g': // -gz if((argv[n][2]=='z') && (strlen(argv[n])==3)) { write_gz_output = true; break; } else invalid_command_line_option("invalid command line option encountered."); break; case 'p': case 'P': if((strcmp(argv[n], "-Pigz")==0) || (strcmp(argv[n], "-pigz")==0)) // -pigz { write_pigz_output = true; break; } else // -phred { if(argv[n][2]!='h' || argv[n][3]!='r' || argv[n][4]!='e' || argv[n][5]!='d') invalid_command_line_option("invalid command line option encountered."); if(++n<argc) { if((strcmp(argv[n], "AUTO")==0) || (strcmp(argv[n], "auto")==0)) { auto_phred_detect = true; break; } else { int d=atoi(argv[n]); if(d<0 || d>100) invalid_command_line_option("option -Phred: invalid phred base."); PHRED = d; break; } } else invalid_command_line_option("option -phred: expected number or AUTO not found."); } break; case 'Q': case 'q': if((strcmp(argv[n], "-Qmin")==0) || (strcmp(argv[n], "-qmin")==0)) { if(++n<argc) { int qm=atoi(argv[n]); if(qm<10 || qm>64) invalid_command_line_option("option -qmin: outside 10 to 64 limit."); MIN_BASE_QUAL = (short) qm; break; } else invalid_command_line_option("option -qmin: expected number not found."); } else { if((strcmp(argv[n], "-Qualab")==0) || (strcmp(argv[n], "-qualab")==0)) { if(++n<argc) { int qm=atoi(argv[n]); if(qm<10 || qm>64) invalid_command_line_option("option -qualab: outside 10 to 64 limit."); MIN_QUAL_AFTER_BAD = (short) qm; break; } else invalid_command_line_option("option -qmin: expected number not found."); } } break; case 'v': case 'V': verbose = true; break; case 'H': case 'h': case '?': printf("\nHELP ----------------------------------------------\n"); usage_help(); break; case 'G': // programmer option to set MAX_NUM_READS_ON_GPU parameter if(++n<argc) { int mrg=atoi(argv[n]); if(mrg<=0) invalid_command_line_option("invalid command line option encountered."); MAX_READS_ON_GPU = mrg; break; } else invalid_command_line_option("invalid command line option encountered."); break; case 'R': // programmer option to set MAX_READ_LENGTH parameter if(++n<argc) { int mrl=atoi(argv[n]); if(mrl<=0 || mrl>10000) invalid_command_line_option("invalid command line option encountered."); MAX_READ_LENGTH = (short) mrl; break; } else invalid_command_line_option("invalid command line option encountered."); break; default: invalid_command_line_option("invalid command line option encountered."); } } else { if(argv[n][0] == '/') { char a = argv[n][1]; switch (a) { case 'T': AdaptorTrimming = false; QualityTrimming = false; gRNATrimming = false; if(strlen(argv[n]) == 3) { if(argv[n][2]=='A') { AdaptorTrimming = true; break; } else { if(argv[n][2]=='Q') { QualityTrimming = true; break; } else invalid_command_line_option("option /T: algorithm selection is invalid."); } } else { if(strlen(argv[n])==3 && argv[n][2]=='A' && argv[n][3]=='Q') { AdaptorTrimming = true; QualityTrimming = true; break; } else invalid_command_line_option("option /T: algorithm selection is invalid."); } break; case 'g': if(strlen(argv[n]) == 5 && argv[n][2]=='R' && argv[n][3]=='N' && argv[n][4]=='A') { gRNATrimming = true; if(++n < argc) { gRNA_start = atoi(argv[n]); } else invalid_command_line_option("option /gRNA: expected start position relative to adaptor 5' not found."); if(++n < argc) { gRNA_length = atoi(argv[n]); } else invalid_command_line_option("option /gRNA: expected gRNA length not found."); break; } else invalid_command_line_option("option /g: algorithm selection is invalid."); break; } } else invalid_command_line_option("parsing command line options."); } } if(!inputfile_set || !outputfile_set || ((AdaptorTrimming || gRNATrimming) && !adaptor_set)) invalid_command_line_option("missing required command line options."); if(strcmp(input_filename, output_filename)==0) { printf("ERROR: encountered identical input and output file paths!\n"); // input file cannot be identical to output file exit(253); } printf("Setting parameters:\n"); printf("\tInput file name : %s\n", input_filename); printf("\tOutput file name : %s\n", output_filename); if(AdaptorTrimming || gRNATrimming) printf("\tAdaptor sequence : %s\n", Adaptor); if(verbose) { if(AdaptorTrimming || gRNATrimming) printf("\tMismatches = %d\n", mismatches); printf("\tTrimming: "); if(QualityTrimming) printf("Quality "); if(AdaptorTrimming) printf("Adaptors "); if(gRNATrimming) printf("Find gRNA"); printf("\n"); if(QualityTrimming) { printf("\tMinimum accepted base quality = %d; average quality of read after bad base = %d\n", MIN_BASE_QUAL, MIN_QUAL_AFTER_BAD); } printf("\tFastQ Quality Encoding: "); if(!auto_phred_detect) printf("PHRED+%d\n", PHRED); else printf("<AUTO DETECTION>\n"); printf("\tMAX_READ_LENGTH : %d\n", MAX_READ_LENGTH); printf("\tMinimum read length for output = %d\n", MIN_OUT_READ_LEN); if(overwrite_outputfile) printf("\tForce overwrite output file if it exists.\n"); } if(numGPUs>0) { printf("\nUsing CUDA devices: "); for(int n=0; n<numGPUs; n++) printf("[%d]", device[n]); printf("\n"); } } int main(int argc, char *argv[]) { time_t start_t = time(NULL); // for timing the process time_t end_t; int reads_processed = 0; parseCommandLineArguments(argc, argv); // get parameters from the command line if(numGPUs == 0) { if(FindGPUs() == 0) // check for GPUs { printf("\nERROR: No suitable CUDA devices found ... exiting\n"); exit(1); } else { if(numGPUs == 1) printf("\nOne CUDA device with at least compute capability 3.5 and 6 GB memory found.\n"); else printf("\n%d CUDA devices with at least compute capability 3.5 and 6 GB memory found.\n", numGPUs); } } if(auto_phred_detect) { if(Detect_FastQ_Format_PHRED()) { if(verbose) printf("<AUTO DETECTION> FastQ Quality Encoding: PHRED+%d\n", PHRED); } else { printf("\nERROR: Unable to detect FastQ format version.\n"); exit(32); } } OpenFiles(); // access files InitGPUs(); SetAdaptorSequence(Adaptor, mismatches, PHRED, MIN_BASE_QUAL, MIN_QUAL_AFTER_BAD); reads_processed = PreprocessReadsOnGPU(); printf("\nReads processed: %d\n", reads_processed); printf("Reads in input file %s : %d\n",input_filename, hNumberOfReads); printf("Reads written to output file %s : %d\n", output_filename, hReadsWritten); if(FastQ_WARNING) printf("Encountered potential issues with the FastQ file format in %s\n", input_filename); CloseFiles(); FreeGPUs(); end_t = time(NULL); printf("\nTotal time elapsed: %.0lf seconds\n", difftime(end_t, start_t)); // printf("\n<Press RTN key to exit>\n"); // getchar(); return(0); }
494
/* ============================================================================ Name : review_chp4_2.cu Author : freshield Version : Copyright : Your copyright notice Description : CUDA compute reciprocals ============================================================================ */ #include <stdio.h> #define N 100 __global__ void add(int *a, int *b, int *c){ int tid = blockIdx.x; if(tid < N){ c[tid] = a[tid] + b[tid]; } } __global__ void set_a(int *a){ int tid = blockIdx.x; if(tid < N){ a[tid] = -tid; } } __global__ void set_b(int *b){ int tid = blockIdx.x; if(tid < N){ b[tid] = tid * tid; } } int main(){ int a[N], b[N], c[N]; int *dev_a, *dev_b, *dev_c; cudaMalloc((void**)&dev_a, N * sizeof(int)); cudaMalloc((void**)&dev_b, N * sizeof(int)); cudaMalloc((void**)&dev_c, N * sizeof(int)); /* for(int i = 0; i < N; i++){ a[i] = -i; b[i] = i * i; } cudaMemcpy(dev_a, a, N * sizeof(int), cudaMemcpyHostToDevice); cudaMemcpy(dev_b, b, N * sizeof(int), cudaMemcpyHostToDevice); */ set_a<<<N,1>>>(dev_a); set_b<<<N,1>>>(dev_b); add<<<N,1>>>(dev_a, dev_b, dev_c); cudaMemcpy(a, dev_a, N * sizeof(int), cudaMemcpyDeviceToHost); cudaMemcpy(b, dev_b, N * sizeof(int), cudaMemcpyDeviceToHost); cudaMemcpy(c, dev_c, N * sizeof(int), cudaMemcpyDeviceToHost); for(int i = 0; i < N; i++){ printf("%d + %d = %d\n", a[i], b[i], c[i]); } cudaFree(dev_a); cudaFree(dev_b); cudaFree(dev_c); return 0; }
495
#include "includes.h" __global__ void empty_kernel() { }
496
#include<stdio.h> #include<stdlib.h> #include "cuda.h" __global__ void addVectors(int N, double *a, double *b, double *c) { int thread = threadIdx.x; int block = blockIdx.x; int blockSize = blockDim.x; int id = block*blockSize + thread; __shared__ double s_a[32]; __shared__ double s_b[32]; __shared__ double s_c[32]; //populate shared memory cache if (id<N) { s_a[thread] = a[id]; s_b[thread] = b[id]; } __syncthreads(); //make sure all threads have written to cache //perform the addition s_c[thread] = s_a[thread] + s_b[thread]; if (id<N) { c[id] = s_c[thread]; } } int main (int argc, char** argv) { int N = 100000; //vector size int Nthreads = 32; //number of threads per block int Nblocks = (N+Nthreads-1)/Nthreads; //WARNING integer division here double *h_a, *h_b, *h_c; //host vectors //allocate vectors h_a = (double *) malloc(N*sizeof(double)); h_b = (double *) malloc(N*sizeof(double)); h_c = (double *) malloc(N*sizeof(double)); double *d_a, *d_b, *d_c; //device arrays //allocate memory on device cudaMalloc(&d_a, N*sizeof(double)); cudaMalloc(&d_b, N*sizeof(double)); cudaMalloc(&d_c, N*sizeof(double)); //populate our vectors a and b for (int n=0;n<N;n++) { h_a[n] = n; h_b[n] = N-n; } //copy a and b to device cudaMemcpy(d_a,h_a,N*sizeof(double),cudaMemcpyHostToDevice); cudaMemcpy(d_b,h_b,N*sizeof(double),cudaMemcpyHostToDevice); // c = a+b // for (int n=0;n<N;n++) { // c[n] = a[n] + b[n]; // } //add the vectors on the device addVectors<<<Nblocks,Nthreads>>>(N,d_a,d_b,d_c); cudaMemcpy(h_c,d_c,N*sizeof(double),cudaMemcpyDeviceToHost); int printId = 0; printf("c[%d] = %f \n", printId, h_c[printId]); //free up device memory cudaFree(d_a); cudaFree(d_b); cudaFree(d_c); //free up memory free(h_a); free(h_b); free(h_c); }
497
#define N 16 #include<stdio.h> #include<stdlib.h> __global__ void add(int *a, int *b, int *c){ c[blockIdx.x] = a[blockIdx.x] + b[blockIdx.x]; printf("%d blockIdx=%d\n", c[blockIdx.x], blockIdx.x); } void random_ints(int *array, int size){ int i; for(i = 0; i < size; i++) array[i] = rand() % 10; } int main() { int *a, *b, *c; int *d_a, *d_b, *d_c; int size = N * sizeof(int); int i; a = (int *) malloc(size); b = (int *) malloc(size); c = (int *) malloc(size); random_ints(a, N); random_ints(b, N); random_ints(c, N); cudaMalloc((void **) &d_a, size); cudaMalloc((void **) &d_b, size); cudaMalloc((void **) &d_c, size); cudaMemcpy(d_a, a, size, cudaMemcpyHostToDevice); cudaMemcpy(d_b, b, size, cudaMemcpyHostToDevice); add<<<N, 1>>>(d_a, d_b, d_c); cudaMemcpy(c, d_c, size, cudaMemcpyDeviceToHost); printf("\n\n\n"); for(i = 0; i < N; i++) printf("%d index=%d\n", c[i], i); free(a); free(b); free(c); cudaFree(d_a); cudaFree(d_b); cudaFree(d_c); return 0; }
498
#include "includes.h" __global__ void cudaAcc_GPS_kernel_mod3( int NumDataPoints, float2* FreqData, float* PowerSpectrum) { const int sidx = (blockIdx.x * blockDim.x + threadIdx.x); float ax,ay; if ( sidx < NumDataPoints ) { ax = FreqData[sidx].x; ay = FreqData[sidx].y; PowerSpectrum[sidx] = __fadd_rn( __fmul_rn(ax,ax),__fmul_rn(ay,ay)); } }
499
#include "includes.h" __device__ unsigned char value( float n1, float n2, int hue ) { if (hue > 360) hue -= 360; else if (hue < 0) hue += 360; if (hue < 60) return (unsigned char)(255 * (n1 + (n2-n1)*hue/60)); if (hue < 180) return (unsigned char)(255 * n2); if (hue < 240) return (unsigned char)(255 * (n1 + (n2-n1)*(240-hue)/60)); return (unsigned char)(255 * n1); } __global__ void float_to_color( unsigned char *optr, const float *outSrc ) { // map from threadIdx/BlockIdx to pixel position int x = threadIdx.x + blockIdx.x * blockDim.x; int y = threadIdx.y + blockIdx.y * blockDim.y; int offset = x + y * blockDim.x * gridDim.x; float l = outSrc[offset]; float s = 1; int h = (180 + (int)(360.0f * outSrc[offset])) % 360; float m1, m2; if (l <= 0.5f) m2 = l * (1 + s); else m2 = l + s - l * s; m1 = 2 * l - m2; optr[offset*4 + 0] = value( m1, m2, h+120 ); optr[offset*4 + 1] = value( m1, m2, h ); optr[offset*4 + 2] = value( m1, m2, h -120 ); optr[offset*4 + 3] = 255; }
500
#include "3d-test.cuh" #include<iostream> #include<stdio.h> __host__ __device__ void scalingFunction(int array[]) { for(int i=0; i<8; i++) { array[i] = array[i] * 2.0; } } __host__ __device__ void distributeFunction(pencilComputation& p1,int x,int y){ for(int z=0; z<8; z++) { p1.outputMatrix[x][y][z] = p1.pencilVector[z]; } } __host__ __device__ void tOPrint(int i,int j,int k) { //pencilComputation p2; printf("The value of i:%d, j:%d, inputMatrix:%d, pencilVector:%d",i,j);//,p2.inputMatrix[i][j][k],p2.pencilVector[k]); } __global__ void pencilComputationFunction(pencilComputation& p1){ //pencilComputation p1; // auto p1 = *p1_in; // dereference the pointer p1.DStats("At start of pencilComputationFunction call"); int i = threadIdx.x ;//+ blockIdx.x * blockDim.x; int j = threadIdx.y ; // + blockIdx.y * blockDim.y; int z = threadIdx.z; for(int k=0; k<8 ; k++) { p1.pencilVector[k] = p1.inputMatrix[i][j][k]; } scalingFunction(p1.pencilVector); p1.DStats("After scalingFunction in pencilComputationFunction call"); distributeFunction(p1,i,j); p1.DStats("At END of pencilComputationFunction call"); // printf("**************************************\n"); } void pencilComputation::launcher(){ // // for(int i=0; i<2; i++) { // for(int j=0; j<2; j++) { // for(int k=0; k<2; k++) { // inputMatrix[i][j][k] = 10; // } // } // } dim3 grid(1,1,1); dim3 block(2,2,2); // #pragma acc enter data copyin(inputMatrix) copyout(outputMatrix) //pencilComputationFunction<<<grid,block>>>(*this); pencilComputationFunction<<<1,1>>>(*this); // pencilComputationFunction<<<1,1>>>(); cudaDeviceSynchronize(); } __host__ void pencilComputation::CStats(const char* message) { // Get sum, average and num-nonzero for each of inputMatrix & outputMatrix: printf("[CPU] Stats: %s\n", message); printf(" Sum Average NNZ\n"); int sumInput = 0; int sumOutput = 0; int nnzInput = 0; int nnzOutput = 0; for (int i = 0; i < matrix_size; i++) { for (int j = 0; j < matrix_size; j++) { for (int k = 0; k < matrix_size; k++) { if (inputMatrix[i][j][k] != 0) { nnzInput++; } if (outputMatrix[i][j][k] != 0) { nnzOutput++; } sumInput += inputMatrix[i][j][k]; sumOutput += outputMatrix[i][j][k]; } } } double averageInput = sumInput / (double)(matrix_size * matrix_size * matrix_size); double averageOutput = sumOutput / (double)(matrix_size * matrix_size * matrix_size); printf(" inputMatrix %d %g %d\n", sumInput, averageInput, nnzInput); printf(" outputMatrix %d %g %d\n", sumOutput, averageOutput, nnzOutput); int sumVector = 0; int nnzVector = 0; for (int i = 0; i < (matrix_size * matrix_size * matrix_size); i++) { sumVector += pencilVector[i]; if (pencilVector[i] != 0) { nnzVector++; } } double averageVector = sumVector / (double)(matrix_size * matrix_size * matrix_size); printf(" pencilVector %d %g %d\n", sumVector, averageVector, nnzVector); printf("\n"); } __device__ void pencilComputation::DStats(const char* message) { // Get sum, average and num-nonzero for each of inputMatrix & outputMatrix: printf("[Device] Matrix Stats: %s\n", message); printf(" Sum Average NNZ\n"); int sumInput = 0; int sumOutput = 0; int nnzInput = 0; int nnzOutput = 0; for (int i = 0; i < matrix_size; i++) { for (int j = 0; j < matrix_size; j++) { for (int k = 0; k < matrix_size; k++) { if (inputMatrix[i][j][k] != 0) { nnzInput++; } if (outputMatrix[i][j][k] != 0) { nnzOutput++; } sumInput += inputMatrix[i][j][k]; sumOutput += outputMatrix[i][j][k]; } } } double averageInput = sumInput / (double)(matrix_size * matrix_size * matrix_size); double averageOutput = sumOutput / (double)(matrix_size * matrix_size * matrix_size); printf(" inputMatrix %d %g %d\n", sumInput, averageInput, nnzInput); printf(" outputMatrix %d %g %d\n", sumOutput, averageOutput, nnzOutput); int sumVector = 0; int nnzVector = 0; for (int i = 0; i < (matrix_size * matrix_size * matrix_size); i++) { sumVector += pencilVector[i]; if (pencilVector[i] != 0) { nnzVector++; } } double averageVector = sumVector / (double)(matrix_size * matrix_size * matrix_size); printf(" pencilVector %d %g %d\n", sumVector, averageVector, nnzVector); printf("\n"); }