hexsha stringlengths 40 40 | size int64 2 1.02M | ext stringclasses 10 values | lang stringclasses 1 value | max_stars_repo_path stringlengths 4 245 | max_stars_repo_name stringlengths 6 130 | max_stars_repo_head_hexsha stringlengths 40 40 | max_stars_repo_licenses listlengths 1 10 | max_stars_count int64 1 191k ⌀ | max_stars_repo_stars_event_min_datetime stringlengths 24 24 ⌀ | max_stars_repo_stars_event_max_datetime stringlengths 24 24 ⌀ | max_issues_repo_path stringlengths 4 245 | max_issues_repo_name stringlengths 6 130 | max_issues_repo_head_hexsha stringlengths 40 40 | max_issues_repo_licenses listlengths 1 10 | max_issues_count int64 1 67k ⌀ | max_issues_repo_issues_event_min_datetime stringlengths 24 24 ⌀ | max_issues_repo_issues_event_max_datetime stringlengths 24 24 ⌀ | max_forks_repo_path stringlengths 4 245 | max_forks_repo_name stringlengths 6 130 | max_forks_repo_head_hexsha stringlengths 40 40 | max_forks_repo_licenses listlengths 1 10 | max_forks_count int64 1 105k ⌀ | max_forks_repo_forks_event_min_datetime stringlengths 24 24 ⌀ | max_forks_repo_forks_event_max_datetime stringlengths 24 24 ⌀ | content stringlengths 2 1.02M | avg_line_length float64 1 958k | max_line_length int64 1 987k | alphanum_fraction float64 0 1 | content_no_comment stringlengths 0 1.01M | is_comment_constant_removed bool 2 classes | is_sharp_comment_removed bool 1 class |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
f7029380b00f9f11d71141fa3f7732ac4f5ba6c7 | 8,120 | py | Python | lib/dnsServer/namecoindns.py | bankonmecoin/nmcontrol | 49a879b98bb2885e3ba7c9fdf6dfe7e122e0edad | [
"FTL"
] | 161 | 2015-01-08T19:45:20.000Z | 2022-01-15T18:25:21.000Z | lib/dnsServer/namecoindns.py | bankonmecoin/nmcontrol | 49a879b98bb2885e3ba7c9fdf6dfe7e122e0edad | [
"FTL"
] | 77 | 2015-01-02T02:20:59.000Z | 2020-05-25T08:33:56.000Z | lib/dnsServer/namecoindns.py | namecoin/nmcontrol | 49a879b98bb2885e3ba7c9fdf6dfe7e122e0edad | [
"FTL"
] | 36 | 2015-02-26T01:51:53.000Z | 2022-01-15T18:25:45.000Z | #name_scan "d/yourdomain" 1
import sys, os
#sys.path.append('/home/khal/sources/nmcontrol/lib/')
import DNS
import rpcClient
import struct, listdns, base64, types, json, random
#from jsonrpc import ServiceProxy
from utils import *
from common import *
class Source(object):
#def __init__(self):
#self.servers = app['services']['dns'].conf['resolver'].split(',')
#self.reqobj = DNS.Request()
#jsonfile = open("config.json", "r")
#data = json.loads(jsonfile.read())
#jsonfile.close()
#username = str(data[u"username"])
#port = data[u"port"]
#password = str(data[u"password"])
#self.sp = ServiceProxy("http://%(user)s:%(passwd)s@127.0.0.1:%(port)d" % dict(user=username, passwd=password, port=port))
#elf.sp = rpcClient.rpcClientNamecoin('127.0.0.1', port, username, password)
#self.sp = app['plugins']['domain']
# def _parse_file(self):
# f = open(self._filename, "r")
# for line in f.readlines():
# line = line.strip()
# if line and line[0] != '#':
# question, type, value = line.split()
# question = question.lower()
# type = type.upper()
# if question == '@':
# question = ''
# if type == 'A':
# answer = struct.pack("!I", ipstr2int(value))
# qtype = 1
# if type == 'NS':
# answer = labels2str(value.split("."))
# qtype = 2
# elif type == 'CNAME':
# answer = labels2str(value.split("."))
# qtype = 5
# elif type == 'TXT':
# answer = label2str(value)
# qtype = 16
# elif type == 'MX':
# preference, domain = value.split(":")
# answer = struct.pack("!H", int(preference))
# answer += labels2str(domain.split("."))
# qtype = 15
# self._answers.setdefault(question, {}).setdefault(qtype, []).append(answer)
# f.close()
def isIP(self, host) :
parts = host.split(".")
if len(parts) != 4:
return False
try :
valid = False
for part in parts :
intpart = int(part)
if intpart <= 255 and intpart >= 0 :
valid = True
else : return False
if valid :
return True
return False
except : return False
def get_response(self, query, domain, qtype, qclass, src_addr):
#print query
#print domain
#print qtype
#print qclass
#print src_addr
if qtype == 1:
#answer = struct.pack("!I", ipstr2int(value))
reqtype = "A"
if qtype == 2:
#answer = labels2str(value.split("."))
reqtype = "NS"
elif qtype == 5:
#answer = labels2str(value.split("."))
reqtype = "CNAME"
elif qtype == 16:
#answer = label2str(value)
reqtype = "TXT"
elif qtype == 15:
#preference, domain = value.split(":")
#nswer = struct.pack("!H", int(preference))
#answer += labels2str(domain.split("."))
reqtype = "MX"
elif qtype == 28:
#answer = struct.pack("!I", ipstr2int(value))
reqtype = "AAAA"
elif qtype == 52:
reqtype = "TLSA"
else : reqtype = None
answers = app['services']['dns'].lookup({"query":query, "domain":domain, "qtype":qtype, "qclass":qclass, "src_addr":src_addr})
#print 'domain:', domain
#print 'answers:', answers
if domain.endswith(".bit") or domain.endswith(".tor") :
#response = listdns.lookup(self.sp, {"query":query, "domain":domain, "qtype":qtype, "qclass":qclass, "src_addr":src_addr})
#response = self.sp.lookup({"query":query, "domain":domain, "qtype":qtype, "qclass":qclass, "src_addr":src_addr})
response = answers
results = []
if type(response) == types.DictType :
tempresults = {"qtype":response["type"], "qclass":response["class"], "ttl":response["ttl"]}
if response["type"] == 1 :
#if answers == [] :
# return self.get_response(query, domain, 5, qclass, src_addr)
tempresults["rdata"] = struct.pack("!I", ipstr2int(response["data"]))
elif response["type"] == 2 or response["type"] == 5:
tempresults["rdata"] = labels2str(response["data"].split("."))
elif response["type"] == 16 :
tempresults["rdata"] = labels2str(response["data"])
elif response["type"] == 15 :
tempresult = struct.pack("!H", response["data"][0])
tempresult += labels2str(response["data"][1].split("."))
tempresults["rdata"] = tempresult
elif response["type"] == 28 :
tempresults["rdata"] = response["data"]
elif response["type"] == 52 :
tempresult = '\x03\x00'
tempresult += chr(int(response["data"][0][0]))
tempresult += bytearray.fromhex(response["data"][0][1])
tempresults["rdata"] = tempresult
#else : return 3, []
results.append(tempresults)
return 0, results
if type(response) == types.StringType :
if self.isIP(response) :
return 0, [{"qtype":1, "qclass":qclass, "ttl":300, "rdata":struct.pack("!I", ipstr2int(response))}]
return 3, []
#if query not in self._answers:
#return 3, []
#if qtype in self._answers[query]:
#if domain == "sonicrules.bit":
# results = [{'qtype': 1, 'qclass':qclass, 'ttl': 300, 'rdata': struct.pack("!I", ipstr2int(self.reqobj.req("sonicrules.org", qtype=1).answers[0]["data"]))}]
# return 0, results
#elif qtype == 1:
# if they asked for an A record and we didn't find one, check for a CNAME
#return self.get_response(query, domain, 5, qclass, src_addr)
else:
#server = self.servers[random.randrange(0, len(self.servers)-1)]
#answers = self.reqobj.req(name=domain, qtype=qtype, server=server).answers
results = []
for response in answers :
tempresults = {"qtype":response["type"], "qclass":response["class"], "ttl":response["ttl"]}
if response["type"] == 1 :
if answers == [] :
return self.get_response(query, domain, 5, qclass, src_addr)
tempresults["rdata"] = struct.pack("!I", ipstr2int(response["data"]))
elif response["type"] == 2 or response["type"] == 5:
tempresults["rdata"] = labels2str(response["data"].split("."))
elif response["type"] == 16 :
tempresults["rdata"] = labels2str(response["data"])
elif response["type"] == 15 :
tempresult = struct.pack("!H", response["data"][0])
tempresult += labels2str(response["data"][1].split("."))
tempresults["rdata"] = tempresult
elif response["type"] == 28 :
if answers == [] :
return self.get_response(query, domain, 5, qclass, src_addr)
#tempresults["rdata"] = struct.pack("!I", ipstr2int(response["data"]))
tempresults["rdata"] = response["data"]
elif response["type"] == 52 :
tempresults["rdata"] = response["data"]
#else : return 3, []
results.append(tempresults)
return 0, results
return 3, []
| 46.936416 | 172 | 0.491995 |
import sys, os
import DNS
import rpcClient
import struct, listdns, base64, types, json, random
from utils import *
from common import *
class Source(object):
def isIP(self, host) :
parts = host.split(".")
if len(parts) != 4:
return False
try :
valid = False
for part in parts :
intpart = int(part)
if intpart <= 255 and intpart >= 0 :
valid = True
else : return False
if valid :
return True
return False
except : return False
def get_response(self, query, domain, qtype, qclass, src_addr):
if qtype == 1:
reqtype = "A"
if qtype == 2:
reqtype = "NS"
elif qtype == 5:
reqtype = "CNAME"
elif qtype == 16:
reqtype = "TXT"
elif qtype == 15:
reqtype = "MX"
elif qtype == 28:
reqtype = "AAAA"
elif qtype == 52:
reqtype = "TLSA"
else : reqtype = None
answers = app['services']['dns'].lookup({"query":query, "domain":domain, "qtype":qtype, "qclass":qclass, "src_addr":src_addr})
if domain.endswith(".bit") or domain.endswith(".tor") :
response = answers
results = []
if type(response) == types.DictType :
tempresults = {"qtype":response["type"], "qclass":response["class"], "ttl":response["ttl"]}
if response["type"] == 1 :
tempresults["rdata"] = struct.pack("!I", ipstr2int(response["data"]))
elif response["type"] == 2 or response["type"] == 5:
tempresults["rdata"] = labels2str(response["data"].split("."))
elif response["type"] == 16 :
tempresults["rdata"] = labels2str(response["data"])
elif response["type"] == 15 :
tempresult = struct.pack("!H", response["data"][0])
tempresult += labels2str(response["data"][1].split("."))
tempresults["rdata"] = tempresult
elif response["type"] == 28 :
tempresults["rdata"] = response["data"]
elif response["type"] == 52 :
tempresult = '\x03\x00'
tempresult += chr(int(response["data"][0][0]))
tempresult += bytearray.fromhex(response["data"][0][1])
tempresults["rdata"] = tempresult
results.append(tempresults)
return 0, results
if type(response) == types.StringType :
if self.isIP(response) :
return 0, [{"qtype":1, "qclass":qclass, "ttl":300, "rdata":struct.pack("!I", ipstr2int(response))}]
return 3, []
#return self.get_response(query, domain, 5, qclass, src_addr)
else:
#server = self.servers[random.randrange(0, len(self.servers)-1)]
#answers = self.reqobj.req(name=domain, qtype=qtype, server=server).answers
results = []
for response in answers :
tempresults = {"qtype":response["type"], "qclass":response["class"], "ttl":response["ttl"]}
if response["type"] == 1 :
if answers == [] :
return self.get_response(query, domain, 5, qclass, src_addr)
tempresults["rdata"] = struct.pack("!I", ipstr2int(response["data"]))
elif response["type"] == 2 or response["type"] == 5:
tempresults["rdata"] = labels2str(response["data"].split("."))
elif response["type"] == 16 :
tempresults["rdata"] = labels2str(response["data"])
elif response["type"] == 15 :
tempresult = struct.pack("!H", response["data"][0])
tempresult += labels2str(response["data"][1].split("."))
tempresults["rdata"] = tempresult
elif response["type"] == 28 :
if answers == [] :
return self.get_response(query, domain, 5, qclass, src_addr)
#tempresults["rdata"] = struct.pack("!I", ipstr2int(response["data"]))
tempresults["rdata"] = response["data"]
elif response["type"] == 52 :
tempresults["rdata"] = response["data"]
#else : return 3, []
results.append(tempresults)
return 0, results
return 3, []
| true | true |
f702939c992f164058c986345c72844ea2c3df0a | 2,852 | py | Python | tests/data_tests/writer_tests/json_writer_test.py | alueschow/polymatheia | e46a38b3686139bbab3a2fcfaa914d4ca938654e | [
"MIT"
] | 3 | 2020-09-15T15:15:34.000Z | 2021-06-15T10:35:07.000Z | tests/data_tests/writer_tests/json_writer_test.py | alueschow/polymatheia | e46a38b3686139bbab3a2fcfaa914d4ca938654e | [
"MIT"
] | 7 | 2020-09-03T12:53:34.000Z | 2020-10-05T09:14:29.000Z | tests/data_tests/writer_tests/json_writer_test.py | alueschow/polymatheia | e46a38b3686139bbab3a2fcfaa914d4ca938654e | [
"MIT"
] | 2 | 2020-10-13T09:12:21.000Z | 2021-04-15T14:19:06.000Z | """Tests for the :mod:`~polymatheia.data.writer` package."""
import json
import os
from shutil import rmtree
from polymatheia.data import NavigableDict
from polymatheia.data.writer import JSONWriter
DOCUMENTS = [NavigableDict(r) for r in [
{
'id': '1',
'name': {
'first': 'A',
'last': 'Person'
},
'age': 32,
'special tags': 'The first'
},
{
'id': '2',
'name': {
'first': ['Another', {'abbr': 'Nameless'}],
'last': 'Parrot'
},
'age': 23,
},
{
'id': '3',
'name': {
'first': 'The',
'last': 'Last'
},
'age': 65,
},
]]
def test_local_json_writing():
"""Test writing to the local filesystem."""
rmtree('tmp/json_writer_test', ignore_errors=True)
writer = JSONWriter('tmp/json_writer_test', 'id')
writer.write(DOCUMENTS)
count = 0
for basepath, _, filenames in os.walk('tmp/json_writer_test'):
for filename in filenames:
if filename.endswith('.json'):
count = count + len(filenames)
with open(os.path.join(basepath, filename)) as in_f:
doc = json.load(in_f)
assert 'id' in doc
assert 'name' in doc
if doc['id'] == '2':
assert 'first' in doc['name']
assert len(doc['name']['first']) == 2
else:
assert 'first' in doc['name']
assert 'last' in doc['name']
assert 'age' in doc
if doc['id'] == '1':
assert 'special tags' in doc
assert count == 3
def test_local_json_writing_pre_split_id_path():
"""Test writing to the local filesystem."""
rmtree('tmp/json_writer_test', ignore_errors=True)
writer = JSONWriter('tmp/json_writer_test', ['id'])
writer.write(DOCUMENTS)
count = 0
for basepath, _, filenames in os.walk('tmp/json_writer_test'):
for filename in filenames:
if filename.endswith('.json'):
count = count + len(filenames)
with open(os.path.join(basepath, filename)) as in_f:
doc = json.load(in_f)
assert 'id' in doc
assert 'name' in doc
if doc['id'] == '2':
assert 'first' in doc['name']
assert len(doc['name']['first']) == 2
else:
assert 'first' in doc['name']
assert 'last' in doc['name']
assert 'age' in doc
if doc['id'] == '1':
assert 'special tags' in doc
assert count == 3
| 31.688889 | 68 | 0.471599 | import json
import os
from shutil import rmtree
from polymatheia.data import NavigableDict
from polymatheia.data.writer import JSONWriter
DOCUMENTS = [NavigableDict(r) for r in [
{
'id': '1',
'name': {
'first': 'A',
'last': 'Person'
},
'age': 32,
'special tags': 'The first'
},
{
'id': '2',
'name': {
'first': ['Another', {'abbr': 'Nameless'}],
'last': 'Parrot'
},
'age': 23,
},
{
'id': '3',
'name': {
'first': 'The',
'last': 'Last'
},
'age': 65,
},
]]
def test_local_json_writing():
rmtree('tmp/json_writer_test', ignore_errors=True)
writer = JSONWriter('tmp/json_writer_test', 'id')
writer.write(DOCUMENTS)
count = 0
for basepath, _, filenames in os.walk('tmp/json_writer_test'):
for filename in filenames:
if filename.endswith('.json'):
count = count + len(filenames)
with open(os.path.join(basepath, filename)) as in_f:
doc = json.load(in_f)
assert 'id' in doc
assert 'name' in doc
if doc['id'] == '2':
assert 'first' in doc['name']
assert len(doc['name']['first']) == 2
else:
assert 'first' in doc['name']
assert 'last' in doc['name']
assert 'age' in doc
if doc['id'] == '1':
assert 'special tags' in doc
assert count == 3
def test_local_json_writing_pre_split_id_path():
rmtree('tmp/json_writer_test', ignore_errors=True)
writer = JSONWriter('tmp/json_writer_test', ['id'])
writer.write(DOCUMENTS)
count = 0
for basepath, _, filenames in os.walk('tmp/json_writer_test'):
for filename in filenames:
if filename.endswith('.json'):
count = count + len(filenames)
with open(os.path.join(basepath, filename)) as in_f:
doc = json.load(in_f)
assert 'id' in doc
assert 'name' in doc
if doc['id'] == '2':
assert 'first' in doc['name']
assert len(doc['name']['first']) == 2
else:
assert 'first' in doc['name']
assert 'last' in doc['name']
assert 'age' in doc
if doc['id'] == '1':
assert 'special tags' in doc
assert count == 3
| true | true |
f70293b9def8f86852689095cc552b5b73ffc04b | 13,289 | py | Python | tests/unit/registry_test.py | TUNE-Archive/freight_forwarder | 6ea4a49f474ec04abb8bb81b175c774a16b5312f | [
"MIT"
] | null | null | null | tests/unit/registry_test.py | TUNE-Archive/freight_forwarder | 6ea4a49f474ec04abb8bb81b175c774a16b5312f | [
"MIT"
] | null | null | null | tests/unit/registry_test.py | TUNE-Archive/freight_forwarder | 6ea4a49f474ec04abb8bb81b175c774a16b5312f | [
"MIT"
] | null | null | null | # -*- coding: utf-8; -*-
from __future__ import unicode_literals, absolute_import
import json
import requests
import six
from tests import unittest, mock
from freight_forwarder.registry import Registry, V1, V2
from freight_forwarder.registry.registry_base import RegistryBase, RegistryException
from ..factories.registry_factory import RegistryV1Factory, RegistryV2Factory
class RegistryTest(unittest.TestCase):
def setUp(self):
pass
def tearDown(self):
pass
@mock.patch.object(V1, '_validate_response', autospec=True, return_value=True)
@mock.patch('freight_forwarder.registry.registry_base.requests', autospec=True)
def test_registry_v1_init(self, mock_requests, mock_v1_validate):
test_registry = Registry()
self.assertIsInstance(test_registry, RegistryBase)
self.assertEquals(test_registry.ping(), True)
@mock.patch.object(V1, '_validate_response', name="v1_validate")
@mock.patch.object(V2, '_validate_response', name="v2_validate")
@mock.patch('freight_forwarder.registry.registry_base.requests', autospec=True)
def test_registry_v2_init(self, mock_requests, mock_v2, mock_v1):
mock_v1.side_effect = RegistryException("test")
mock_v2.return_value = True
test_v1_registry = RegistryV1Factory()
test_v2_registry = RegistryV2Factory()
# This is stated to ensure the test environment is setup correctly
# validated v1.ping() returns an exception
with self.assertRaises(RegistryException):
test_v1_registry.ping()
# validated v2.ping() returns an exception
self.assertEquals(test_v2_registry.ping(), True)
# Validate the logic of the registry class to return a V2 object
test_registry = Registry(address="https://v2.dockertest.io")
self.assertIsInstance(test_registry, RegistryBase)
class RegistryV1Test(unittest.TestCase):
def setUp(self):
pass
def tearDown(self):
pass
@mock.patch.object(V1, '_validate_response', return_value=True)
@mock.patch.object(V1, '_request_builder')
@mock.patch('freight_forwarder.registry.registry_base.requests', autospec=True)
def test_v1_search(self, mock_requests, mock_request_builder, mock_validate_response):
# Defined Search Request a
search_response_content = {
"num_results": 3,
"query": "test",
"results": [
{"description": "api test app", "name": "testproject/test-app"},
{"description": "database test app", "name": "testproject/test-db"},
{"description": "cache test app", "name": "testproject/test-cache"}
]
}
# Define Response Value for content once request has been validated
mock_request_builder.return_value = create_response_object(
url="https://search.registry.docker.com",
status_code=200,
content=json.dumps(search_response_content).encode('utf-8')
)
# Define Default value for utils _validate_reponse
mock_validate_response.return_value = True
# Build V1 Factory Registry
test_registry = RegistryV1Factory(address='https://search.registry.docker.com')
results = test_registry.search("test")
self.assertIsInstance(results, dict)
@mock.patch.object(V1, '_validate_response', return_value=True)
@mock.patch.object(V1, '_request_builder')
@mock.patch('freight_forwarder.registry.registry_base.requests', autospec=True)
def test_v1_tags(self, mock_requests, mock_request_builder, mock_validate_response):
tag_response_content = {
"0.1": "3fad19bfa2",
"latest": "xxxxxxxxxx",
"localtest": "xxxxxxxxxxxxxxae13",
"redis123123": "xxxxxxxxxxxxxxae132",
"jira1268": "xxxxxxxxxxxxxxae1324987"
}
formatted_output = [
'appexample/test-app:0.1',
'appexample/test-app:latest',
'appexample/test-app:us-east-01-dev',
'appexample/test-app:localtest',
'appexample/test-app:redis123123',
'appexample/test-app:jira1268'
]
mock_request_builder.return_value = create_response_object(
url="https://tag.registry.docker.com",
status_code=200,
content=json.dumps(tag_response_content).encode('utf-8')
)
mock_validate_response.return_value = True
test_registry = RegistryV1Factory(address='https://tag.registry.docker.com')
for tag in test_registry.tags("appexample/test-app"):
tag_output = "".join(tag)
self.assertIsInstance(tag_output, six.string_types)
self.assertIn(tag_output, formatted_output)
def test_delete_tag(self):
self.skipTest("Implemented but not used")
def test_delete(self):
self.skipTest("Implemented but not used")
def test_get_image_by_id(self):
self.skipTest("Implemented but not used")
def test_get_image_id_by_tag(self):
self.skipTest("Implemented but not used")
def set_image_tag(self):
self.skipTest("Implemented but not used")
class RegistryV2Test(unittest.TestCase):
def setUp(self):
pass
def tearDown(self):
pass
@mock.patch.object(V2, '_validate_response', name='mock_v2_validate_response', return_value=True)
@mock.patch.object(V2, '_request_builder', name='mock_v2_request_builder')
@mock.patch('freight_forwarder.registry.registry_base.requests', autospec=True)
def test_v2_search(self, mock_requests, mock_request_builder, mock_validate_response):
# Defined Search Request
search_response_content = json.dumps({"repositories": ["appexample/test-app",
"appexample/test-db",
"appexample/test-cache"]}).encode('utf-8')
response = create_response_object(url="https://v2search.registry.docker.com",
status_code=200,
content=search_response_content)
# Define Response Value for content once request has been validated
mock_request_builder.return_value = response
# Define Default value for utils _validate_response
mock_validate_response.return_value = True
# Build V1 Factory Registry
test_registry = RegistryV2Factory(address='https://v2search.registry.docker.com')
test_registry.search("test")
for search in test_registry.search("test"):
search_output = "".join(search)
self.assertIsInstance(search_output, six.string_types)
@mock.patch.object(V2, '_validate_response', name='mock_v2_validate_response', return_value=True)
@mock.patch.object(V2, '_request_builder', name='mock_v2_request_builder')
@mock.patch('freight_forwarder.registry.registry_base.requests', autospec=True)
def test_v2_tags(self, mock_requests, mock_request_builder, mock_validate_response):
tag_response_content = json.dumps({"name": "appexample/test-app",
"tags": [
"latest",
"0.0.15",
"asdfasb81"]
}
).encode('utf-8')
formatted_output = ['appexample/test-app:latest',
'appexample/test-app:0.0.15',
'appexample/test-app:asdfasb81']
response = create_response_object(url="https://v2tags.registry.docker.com",
status_code=200,
content=tag_response_content)
mock_request_builder.return_value = response
mock_validate_response.return_value = True
test_registry = RegistryV2Factory(address='https://v2tags.registry.docker.com')
for tags in test_registry.tags("appexample/test-app"):
tag_output = "".join(tags)
self.assertIsInstance(tag_output, six.string_types)
self.assertIn(tag_output, formatted_output)
def test_blobs(self):
self.skipTest("Not implemented")
def test_catalog(self, count=None, last=None):
self.skipTest("Not implemented")
def test_manifests(self):
self.skipTest("Not implemented")
class RegistryBaseTests(unittest.TestCase):
def setUp(self):
self.patch_requests = mock.patch('freight_forwarder.registry.registry_base.requests', autospec=True)
self.patch_requests.start()
self.test_registry = RegistryV1Factory(address="https://registrybasetest.docker.com")
def tearDown(self):
self.patch_requests.stop()
del self.test_registry
def test_ping(self):
self.skipTest("Defined as abc method. Override in class")
def test_tags(self):
self.skipTest("Defined as abc method. Override in class")
def test_init(self):
self.assertEquals(self.test_registry.scheme, 'https://')
self.assertEquals(self.test_registry.location, 'registrybasetest.docker.com')
self.assertEquals(self.test_registry.auth, None)
self.assertEquals(self.test_registry.__str__(), "https://registrybasetest.docker.com")
self.assertIsInstance(self.test_registry, RegistryBase)
def test_registry_base_auth_base_functionality(self):
self.assertEquals(self.test_registry.auth, None)
with self.assertRaises(TypeError):
self.test_registry.auth = ["user=test_user", "passwd=password"]
def test_registry_base_auth_with_auth(self):
pass
class RegistryExceptionTest(unittest.TestCase):
def setUp(self):
pass
def tearDown(self):
pass
def test_exception_with_status_code_and_url(self):
response = create_response_object(url="https://bad.docker.io",
status_code=503,
content={"test": "data"})
registry_exception = RegistryException(response)
self.assertIsInstance(registry_exception, RegistryException)
self.assertEquals(registry_exception.response.status_code, 503)
def test_exception_with_no_content(self):
response = create_response_object(url="https://nocontent.docker.io",
status_code=503)
registry_exception = RegistryException(response)
self.assertIsInstance(registry_exception, RegistryException)
self.assertEquals(registry_exception.message, 'There was an issue with the request to the docker registry.')
def test_exception_with_error_content(self):
# TODO - grab a properly formatted error for testing
response = create_response_object(url="https://errorcontent.docker.io",
status_code=500,
content=json.dumps({'error': 'Docker Registry Error Example'}))
registry_exception = RegistryException(response)
self.assertIsInstance(registry_exception, RegistryException)
self.assertEquals(registry_exception.message, 'Docker Registry Error Example')
# Test the class.__str__ MagicMethod
self.assertEquals("{0}".format(registry_exception), 'Docker Registry Error Example')
def create_response_object(url, status_code, content=None):
"""
The function generates a mock object that is properly formatted for the RegistryException and validates the input
:param url: url to pass through for the mock request object
:param status_code: status code to append to the response object
:param content: **required** if not provided, this attribute will be blocked
:return: Parent Mock: request.Reponse Child Mock: request - requests.PreparedRequest
"""
if not isinstance(url, six.string_types):
raise(TypeError("incorrect type provided for url"))
if not isinstance(status_code, six.integer_types):
raise(TypeError("incorrect type provided for http status code"))
mock_object_request = mock.MagicMock(spec=requests.PreparedRequest, url=url)
mock_object_response = mock.MagicMock(spec=requests.Response, request=mock_object_request)
mock_object_response.status_code = status_code
if content:
mock_object_response.content = content
else:
# this blocks the content attribute from being present
del mock_object_response.content
return mock_object_response
def format_image_results(registry_response_dict):
"""
Response attribute content is formatted correctly for the Images
:param response: response object with content attribute
:return: dict of various images
"""
if not isinstance(registry_response_dict, dict):
raise TypeError('registry_response_dict must be a dict.')
images = {}
results = registry_response_dict.get('results')
if results:
for image in results:
images[image.get('name')] = image
return images
| 40.889231 | 117 | 0.658063 |
from __future__ import unicode_literals, absolute_import
import json
import requests
import six
from tests import unittest, mock
from freight_forwarder.registry import Registry, V1, V2
from freight_forwarder.registry.registry_base import RegistryBase, RegistryException
from ..factories.registry_factory import RegistryV1Factory, RegistryV2Factory
class RegistryTest(unittest.TestCase):
def setUp(self):
pass
def tearDown(self):
pass
@mock.patch.object(V1, '_validate_response', autospec=True, return_value=True)
@mock.patch('freight_forwarder.registry.registry_base.requests', autospec=True)
def test_registry_v1_init(self, mock_requests, mock_v1_validate):
test_registry = Registry()
self.assertIsInstance(test_registry, RegistryBase)
self.assertEquals(test_registry.ping(), True)
@mock.patch.object(V1, '_validate_response', name="v1_validate")
@mock.patch.object(V2, '_validate_response', name="v2_validate")
@mock.patch('freight_forwarder.registry.registry_base.requests', autospec=True)
def test_registry_v2_init(self, mock_requests, mock_v2, mock_v1):
mock_v1.side_effect = RegistryException("test")
mock_v2.return_value = True
test_v1_registry = RegistryV1Factory()
test_v2_registry = RegistryV2Factory()
with self.assertRaises(RegistryException):
test_v1_registry.ping()
self.assertEquals(test_v2_registry.ping(), True)
test_registry = Registry(address="https://v2.dockertest.io")
self.assertIsInstance(test_registry, RegistryBase)
class RegistryV1Test(unittest.TestCase):
def setUp(self):
pass
def tearDown(self):
pass
@mock.patch.object(V1, '_validate_response', return_value=True)
@mock.patch.object(V1, '_request_builder')
@mock.patch('freight_forwarder.registry.registry_base.requests', autospec=True)
def test_v1_search(self, mock_requests, mock_request_builder, mock_validate_response):
search_response_content = {
"num_results": 3,
"query": "test",
"results": [
{"description": "api test app", "name": "testproject/test-app"},
{"description": "database test app", "name": "testproject/test-db"},
{"description": "cache test app", "name": "testproject/test-cache"}
]
}
mock_request_builder.return_value = create_response_object(
url="https://search.registry.docker.com",
status_code=200,
content=json.dumps(search_response_content).encode('utf-8')
)
mock_validate_response.return_value = True
test_registry = RegistryV1Factory(address='https://search.registry.docker.com')
results = test_registry.search("test")
self.assertIsInstance(results, dict)
@mock.patch.object(V1, '_validate_response', return_value=True)
@mock.patch.object(V1, '_request_builder')
@mock.patch('freight_forwarder.registry.registry_base.requests', autospec=True)
def test_v1_tags(self, mock_requests, mock_request_builder, mock_validate_response):
tag_response_content = {
"0.1": "3fad19bfa2",
"latest": "xxxxxxxxxx",
"localtest": "xxxxxxxxxxxxxxae13",
"redis123123": "xxxxxxxxxxxxxxae132",
"jira1268": "xxxxxxxxxxxxxxae1324987"
}
formatted_output = [
'appexample/test-app:0.1',
'appexample/test-app:latest',
'appexample/test-app:us-east-01-dev',
'appexample/test-app:localtest',
'appexample/test-app:redis123123',
'appexample/test-app:jira1268'
]
mock_request_builder.return_value = create_response_object(
url="https://tag.registry.docker.com",
status_code=200,
content=json.dumps(tag_response_content).encode('utf-8')
)
mock_validate_response.return_value = True
test_registry = RegistryV1Factory(address='https://tag.registry.docker.com')
for tag in test_registry.tags("appexample/test-app"):
tag_output = "".join(tag)
self.assertIsInstance(tag_output, six.string_types)
self.assertIn(tag_output, formatted_output)
def test_delete_tag(self):
self.skipTest("Implemented but not used")
def test_delete(self):
self.skipTest("Implemented but not used")
def test_get_image_by_id(self):
self.skipTest("Implemented but not used")
def test_get_image_id_by_tag(self):
self.skipTest("Implemented but not used")
def set_image_tag(self):
self.skipTest("Implemented but not used")
class RegistryV2Test(unittest.TestCase):
def setUp(self):
pass
def tearDown(self):
pass
@mock.patch.object(V2, '_validate_response', name='mock_v2_validate_response', return_value=True)
@mock.patch.object(V2, '_request_builder', name='mock_v2_request_builder')
@mock.patch('freight_forwarder.registry.registry_base.requests', autospec=True)
def test_v2_search(self, mock_requests, mock_request_builder, mock_validate_response):
search_response_content = json.dumps({"repositories": ["appexample/test-app",
"appexample/test-db",
"appexample/test-cache"]}).encode('utf-8')
response = create_response_object(url="https://v2search.registry.docker.com",
status_code=200,
content=search_response_content)
mock_request_builder.return_value = response
mock_validate_response.return_value = True
test_registry = RegistryV2Factory(address='https://v2search.registry.docker.com')
test_registry.search("test")
for search in test_registry.search("test"):
search_output = "".join(search)
self.assertIsInstance(search_output, six.string_types)
@mock.patch.object(V2, '_validate_response', name='mock_v2_validate_response', return_value=True)
@mock.patch.object(V2, '_request_builder', name='mock_v2_request_builder')
@mock.patch('freight_forwarder.registry.registry_base.requests', autospec=True)
def test_v2_tags(self, mock_requests, mock_request_builder, mock_validate_response):
tag_response_content = json.dumps({"name": "appexample/test-app",
"tags": [
"latest",
"0.0.15",
"asdfasb81"]
}
).encode('utf-8')
formatted_output = ['appexample/test-app:latest',
'appexample/test-app:0.0.15',
'appexample/test-app:asdfasb81']
response = create_response_object(url="https://v2tags.registry.docker.com",
status_code=200,
content=tag_response_content)
mock_request_builder.return_value = response
mock_validate_response.return_value = True
test_registry = RegistryV2Factory(address='https://v2tags.registry.docker.com')
for tags in test_registry.tags("appexample/test-app"):
tag_output = "".join(tags)
self.assertIsInstance(tag_output, six.string_types)
self.assertIn(tag_output, formatted_output)
def test_blobs(self):
self.skipTest("Not implemented")
def test_catalog(self, count=None, last=None):
self.skipTest("Not implemented")
def test_manifests(self):
self.skipTest("Not implemented")
class RegistryBaseTests(unittest.TestCase):
def setUp(self):
self.patch_requests = mock.patch('freight_forwarder.registry.registry_base.requests', autospec=True)
self.patch_requests.start()
self.test_registry = RegistryV1Factory(address="https://registrybasetest.docker.com")
def tearDown(self):
self.patch_requests.stop()
del self.test_registry
def test_ping(self):
self.skipTest("Defined as abc method. Override in class")
def test_tags(self):
self.skipTest("Defined as abc method. Override in class")
def test_init(self):
self.assertEquals(self.test_registry.scheme, 'https://')
self.assertEquals(self.test_registry.location, 'registrybasetest.docker.com')
self.assertEquals(self.test_registry.auth, None)
self.assertEquals(self.test_registry.__str__(), "https://registrybasetest.docker.com")
self.assertIsInstance(self.test_registry, RegistryBase)
def test_registry_base_auth_base_functionality(self):
self.assertEquals(self.test_registry.auth, None)
with self.assertRaises(TypeError):
self.test_registry.auth = ["user=test_user", "passwd=password"]
def test_registry_base_auth_with_auth(self):
pass
class RegistryExceptionTest(unittest.TestCase):
def setUp(self):
pass
def tearDown(self):
pass
def test_exception_with_status_code_and_url(self):
response = create_response_object(url="https://bad.docker.io",
status_code=503,
content={"test": "data"})
registry_exception = RegistryException(response)
self.assertIsInstance(registry_exception, RegistryException)
self.assertEquals(registry_exception.response.status_code, 503)
def test_exception_with_no_content(self):
response = create_response_object(url="https://nocontent.docker.io",
status_code=503)
registry_exception = RegistryException(response)
self.assertIsInstance(registry_exception, RegistryException)
self.assertEquals(registry_exception.message, 'There was an issue with the request to the docker registry.')
def test_exception_with_error_content(self):
response = create_response_object(url="https://errorcontent.docker.io",
status_code=500,
content=json.dumps({'error': 'Docker Registry Error Example'}))
registry_exception = RegistryException(response)
self.assertIsInstance(registry_exception, RegistryException)
self.assertEquals(registry_exception.message, 'Docker Registry Error Example')
self.assertEquals("{0}".format(registry_exception), 'Docker Registry Error Example')
def create_response_object(url, status_code, content=None):
if not isinstance(url, six.string_types):
raise(TypeError("incorrect type provided for url"))
if not isinstance(status_code, six.integer_types):
raise(TypeError("incorrect type provided for http status code"))
mock_object_request = mock.MagicMock(spec=requests.PreparedRequest, url=url)
mock_object_response = mock.MagicMock(spec=requests.Response, request=mock_object_request)
mock_object_response.status_code = status_code
if content:
mock_object_response.content = content
else:
del mock_object_response.content
return mock_object_response
def format_image_results(registry_response_dict):
if not isinstance(registry_response_dict, dict):
raise TypeError('registry_response_dict must be a dict.')
images = {}
results = registry_response_dict.get('results')
if results:
for image in results:
images[image.get('name')] = image
return images
| true | true |
f7029408ce730e634db3b1bb394319bb0bf2ed6b | 127 | py | Python | icevision/models/ross/efficientdet/loss_fn.py | ai-fast-track/mantisshrimp | cc6d6a4a048f6ddda2782b6593dcd6b083a673e4 | [
"Apache-2.0"
] | 580 | 2020-09-10T06:29:57.000Z | 2022-03-29T19:34:54.000Z | icevision/models/ross/efficientdet/loss_fn.py | ai-fast-track/mantisshrimp | cc6d6a4a048f6ddda2782b6593dcd6b083a673e4 | [
"Apache-2.0"
] | 691 | 2020-09-05T03:08:34.000Z | 2022-03-31T23:47:06.000Z | icevision/models/ross/efficientdet/loss_fn.py | lgvaz/mantisshrimp2 | 743cb7df0dae7eb1331fc2bb66fc9ca09db496cd | [
"Apache-2.0"
] | 105 | 2020-09-09T10:41:35.000Z | 2022-03-25T17:16:49.000Z | __all__ = ["loss_fn"]
from icevision.imports import *
def loss_fn(preds, targets) -> torch.Tensor:
return preds["loss"]
| 15.875 | 44 | 0.692913 | __all__ = ["loss_fn"]
from icevision.imports import *
def loss_fn(preds, targets) -> torch.Tensor:
return preds["loss"]
| true | true |
f702941de4e407f4a88237e388c77641c7894dd9 | 416 | py | Python | blog/migrations/0008_alter_post_content.py | samwel2000/portfolio-backend | a7cb50ffa34b9db64bc4532a9d79df0b082fd000 | [
"MIT"
] | null | null | null | blog/migrations/0008_alter_post_content.py | samwel2000/portfolio-backend | a7cb50ffa34b9db64bc4532a9d79df0b082fd000 | [
"MIT"
] | null | null | null | blog/migrations/0008_alter_post_content.py | samwel2000/portfolio-backend | a7cb50ffa34b9db64bc4532a9d79df0b082fd000 | [
"MIT"
] | null | null | null | # Generated by Django 3.2.4 on 2021-09-11 12:44
import ckeditor_uploader.fields
from django.db import migrations
class Migration(migrations.Migration):
dependencies = [
('blog', '0007_subscriber'),
]
operations = [
migrations.AlterField(
model_name='post',
name='content',
field=ckeditor_uploader.fields.RichTextUploadingField(),
),
]
| 20.8 | 68 | 0.625 |
import ckeditor_uploader.fields
from django.db import migrations
class Migration(migrations.Migration):
dependencies = [
('blog', '0007_subscriber'),
]
operations = [
migrations.AlterField(
model_name='post',
name='content',
field=ckeditor_uploader.fields.RichTextUploadingField(),
),
]
| true | true |
f702949d7e5cbdf335ceb60f0431804430f5686c | 2,126 | py | Python | tests/test_decorators.py | marwahaha/QSpectra | 328a4f78af1473d65c011eb99b903c7f0ef1db32 | [
"BSD-2-Clause"
] | 14 | 2018-02-01T03:06:26.000Z | 2021-09-16T02:50:31.000Z | tests/test_decorators.py | whaley-group-berkeley/qspectra | f0f971ea26c4595a9c7bd4ee98e31e9ba63451c6 | [
"BSD-2-Clause"
] | 5 | 2018-01-02T20:33:14.000Z | 2021-11-12T23:59:20.000Z | tests/test_decorators.py | whaley-group-berkeley/qspectra | f0f971ea26c4595a9c7bd4ee98e31e9ba63451c6 | [
"BSD-2-Clause"
] | 7 | 2018-04-19T05:08:41.000Z | 2021-09-16T01:45:24.000Z | import unittest
from numpy.testing import assert_allclose
from qspectra import polarization
from qspectra.simulate import decorators
class TestGetCallArgs(unittest.TestCase):
def test(self):
self.assertEqual(
decorators._get_call_args(lambda a: None, 1),
{'a': 1})
self.assertEqual(
decorators._get_call_args(lambda a, **b: None, 1),
{'a': 1})
self.assertEqual(
decorators._get_call_args(lambda a, **b: None, a=1, c=2),
{'a': 1, 'c': 2})
self.assertEqual(
decorators._get_call_args(lambda **b: None, a=1, c=2),
{'a': 1, 'c': 2})
with self.assertRaises(NotImplementedError):
decorators._get_call_args(lambda *a: None, 1, 2, 3)
class TestIsotropicAverage(unittest.TestCase):
def test_optional_2nd_order_isotropic_average(self):
binary = {'xx': 1, 'yy': 2, 'zz': 4}
f = decorators.optional_2nd_order_isotropic_average(
lambda polarization: (0, binary[polarization]))
assert_allclose(f('xx'), (0, 1))
assert_allclose(f('xx', exact_isotropic_average=False), (0, 1))
assert_allclose(f('xx', exact_isotropic_average=True), (0, 7 / 3.0))
assert_allclose(f('xy', exact_isotropic_average=True), (0, 0))
with self.assertRaises(ValueError):
# wrong number of polarizations
f('xyz', exact_isotropic_average=True)
def test_optional_4th_order_isotropic_average(self):
binary = {'xx': 1, 'yy': 2, 'zz': 4}
f = decorators.optional_4th_order_isotropic_average(
lambda polarization: (0, binary[polarization[:2]]
+ 10 * binary[polarization[2:]]))
assert_allclose(f('xxxx'), (0, 11))
ma = polarization.MAGIC_ANGLE
assert_allclose(f([0, 0, ma, ma], exact_isotropic_average=True),
(0, (11 + 12 + 14 + 21 + 22 + 24 + 41 + 42 + 44) / 9.0))
with self.assertRaises(ValueError):
# wrong number of polarizations
f('xyz', exact_isotropic_average=True)
| 41.686275 | 80 | 0.601129 | import unittest
from numpy.testing import assert_allclose
from qspectra import polarization
from qspectra.simulate import decorators
class TestGetCallArgs(unittest.TestCase):
def test(self):
self.assertEqual(
decorators._get_call_args(lambda a: None, 1),
{'a': 1})
self.assertEqual(
decorators._get_call_args(lambda a, **b: None, 1),
{'a': 1})
self.assertEqual(
decorators._get_call_args(lambda a, **b: None, a=1, c=2),
{'a': 1, 'c': 2})
self.assertEqual(
decorators._get_call_args(lambda **b: None, a=1, c=2),
{'a': 1, 'c': 2})
with self.assertRaises(NotImplementedError):
decorators._get_call_args(lambda *a: None, 1, 2, 3)
class TestIsotropicAverage(unittest.TestCase):
def test_optional_2nd_order_isotropic_average(self):
binary = {'xx': 1, 'yy': 2, 'zz': 4}
f = decorators.optional_2nd_order_isotropic_average(
lambda polarization: (0, binary[polarization]))
assert_allclose(f('xx'), (0, 1))
assert_allclose(f('xx', exact_isotropic_average=False), (0, 1))
assert_allclose(f('xx', exact_isotropic_average=True), (0, 7 / 3.0))
assert_allclose(f('xy', exact_isotropic_average=True), (0, 0))
with self.assertRaises(ValueError):
f('xyz', exact_isotropic_average=True)
def test_optional_4th_order_isotropic_average(self):
binary = {'xx': 1, 'yy': 2, 'zz': 4}
f = decorators.optional_4th_order_isotropic_average(
lambda polarization: (0, binary[polarization[:2]]
+ 10 * binary[polarization[2:]]))
assert_allclose(f('xxxx'), (0, 11))
ma = polarization.MAGIC_ANGLE
assert_allclose(f([0, 0, ma, ma], exact_isotropic_average=True),
(0, (11 + 12 + 14 + 21 + 22 + 24 + 41 + 42 + 44) / 9.0))
with self.assertRaises(ValueError):
f('xyz', exact_isotropic_average=True)
| true | true |
f70295f364c9fa7735e9cab7413024d68698092b | 64 | py | Python | enthought/traits/ui/editors/check_list_editor.py | enthought/etsproxy | 4aafd628611ebf7fe8311c9d1a0abcf7f7bb5347 | [
"BSD-3-Clause"
] | 3 | 2016-12-09T06:05:18.000Z | 2018-03-01T13:00:29.000Z | enthought/traits/ui/editors/check_list_editor.py | enthought/etsproxy | 4aafd628611ebf7fe8311c9d1a0abcf7f7bb5347 | [
"BSD-3-Clause"
] | 1 | 2020-12-02T00:51:32.000Z | 2020-12-02T08:48:55.000Z | enthought/traits/ui/editors/check_list_editor.py | enthought/etsproxy | 4aafd628611ebf7fe8311c9d1a0abcf7f7bb5347 | [
"BSD-3-Clause"
] | null | null | null | # proxy module
from traitsui.editors.check_list_editor import *
| 21.333333 | 48 | 0.828125 |
from traitsui.editors.check_list_editor import *
| true | true |
f70296d97876b7039d6cd67bbecc249889c24636 | 4,957 | py | Python | dataset_generation/ExtractSantini.py | YuHsin1998/EllSeg | 91a532650ef809eef081a7ef9af5f1940fb37a37 | [
"MIT"
] | 1 | 2021-05-26T05:45:42.000Z | 2021-05-26T05:45:42.000Z | dataset_generation/ExtractSantini.py | xiaohuaibaoguigui/EllSeg | ff56b255f8e650856aec9af23792e105897eba5c | [
"MIT"
] | null | null | null | dataset_generation/ExtractSantini.py | xiaohuaibaoguigui/EllSeg | ff56b255f8e650856aec9af23792e105897eba5c | [
"MIT"
] | null | null | null | #!/usr/bin/env python3
# -*- coding: utf-8 -*-
"""
Created on Wed May 29 16:16:57 2019
@author: rakshit
"""
import os
import cv2
import argparse
import matplotlib
import numpy as np
import deepdish as dd
import scipy.io as scio
print('Extracting Santini')
parser = argparse.ArgumentParser()
parser.add_argument('--noDisp', help='Specify flag to display labelled images', type=int)
parser.add_argument('--path2ds', help='Path to dataset', type=str)
args = parser.parse_args()
if args.noDisp:
noDisp = True
print('No graphics')
else:
noDisp = False
print('Showing figures')
gui_env = ['Qt5Agg','WXAgg','TKAgg','GTKAgg']
for gui in gui_env:
try:
print("testing: {}".format(gui))
matplotlib.use(gui,warn=False, force=True)
from matplotlib import pyplot as plt
break
except:
continue
print("Using: {}".format(matplotlib.get_backend()))
plt.ion()
args.path2ds = '/media/rakshit/tank/Dataset'
PATH_DIR = os.path.join(args.path2ds, 'Santini')
PATH_DS = os.path.join(args.path2ds, 'All')
PATH_MASTER = os.path.join(args.path2ds, 'MasterKey')
list_ds = ['1', '2', '3', '4', '5', '6']
sc = (640.0/384.0)
Image_counter = 0.0
ds_num = 24
def mypause(interval):
backend = plt.rcParams['backend']
if backend in matplotlib.rcsetup.interactive_bk:
figManager = matplotlib._pylab_helpers.Gcf.get_active()
if figManager is not None:
canvas = figManager.canvas
if canvas.figure.stale:
canvas.draw()
canvas.start_event_loop(interval)
return
def fix_pupil_loc(p, res):
# res: [H, W]
p[0] = 0.5*p[0]
p[1] = res[0] - 0.5*p[1]
return p
def readFormattedText(path2file, ignoreLines):
data = []
count = 0
f = open(path2file, 'r')
for line in f:
d = [int(d) for d in line.split() if d.isdigit()]
count = count + 1
if d and count > ignoreLines:
data.append(d)
f.close()
return data
for name in list_ds:
# Ignore the first row and column.
# Columns: [index, p_x, p_y]
opts = os.listdir(os.path.join(PATH_DIR, name))
for subdir in opts:
PATH_DATA = os.path.join(PATH_DIR, name, subdir)
# Read pupil data
Path2text = os.path.join(PATH_DATA, 'journal-{:04d}.txt'.format(int(subdir)-1))
Path2vid = os.path.join(PATH_DATA, 'eye-{:04d}-0000.avi'.format(int(subdir)-1))
PupilData = np.array(readFormattedText(Path2text, 2))
VidObj = cv2.VideoCapture(Path2vid)
keydict = {k:[] for k in ['pupil_loc', 'archive', 'data_type', 'resolution', 'dataset', 'subset']}
# Generate empty dictionaries
keydict['data_type'] = 0 # Only pupil center available
keydict['resolution'] = []
keydict['dataset'] = 'Santini'
keydict['subset'] = '{}-{}'.format(name, subdir)
# Create an empty dictionary as per agreed structure
Data = {k:[] for k in ['Images', 'Info', 'Masks', 'Masks_noSkin', 'Fits', 'pupil_loc']}
Data['Fits'] = {k:[] for k in ['pupil', 'pupil_norm', 'pupil_phi', 'iris', 'iris_norm', 'iris_phi']}
if not noDisp:
fig, plts = plt.subplots(1,1)
fr_num = 0
while(VidObj.isOpened()):
ret, I = VidObj.read()
if ret == True:
I = cv2.cvtColor(I, cv2.COLOR_BGR2GRAY)
I = cv2.resize(I, (640, 480), cv2.INTER_LANCZOS4)
Data['Images'].append(I)
keydict['resolution'].append(I.shape)
keydict['archive'].append(ds_num)
pupil_loc = fix_pupil_loc(PupilData[fr_num, 10:12]*sc, I.shape)
keydict['pupil_loc'].append(pupil_loc)
Data['pupil_loc'].append(pupil_loc)
Data['Info'].append(str(fr_num))
fr_num+=1
Image_counter+=1
if not noDisp:
if fr_num == 1:
cI = plts.imshow(I)
cX = plts.scatter(pupil_loc[0], pupil_loc[1])
plt.show()
plt.pause(.01)
else:
newLoc = np.array([pupil_loc[0], pupil_loc[1]])
cI.set_data(I)
cX.set_offsets(newLoc)
mypause(0.01)
else: # No more frames to load
break
Data['Images'] = np.stack(Data['Images'], axis=0)
Data['pupil_loc'] = np.stack(Data['pupil_loc'], axis=0)
keydict['pupil_loc'] = np.stack(keydict['pupil_loc'], axis=0)
keydict['resolution'] = np.stack(keydict['resolution'], axis=0)
keydict['archive'] = np.stack(keydict['archive'], axis=0)
# Save out data
dd.io.save(os.path.join(PATH_DS, str(ds_num)+'.h5'), Data)
scio.savemat(os.path.join(PATH_MASTER, str(ds_num)), keydict, appendmat=True)
ds_num=ds_num+1 | 33.046667 | 108 | 0.571717 |
import os
import cv2
import argparse
import matplotlib
import numpy as np
import deepdish as dd
import scipy.io as scio
print('Extracting Santini')
parser = argparse.ArgumentParser()
parser.add_argument('--noDisp', help='Specify flag to display labelled images', type=int)
parser.add_argument('--path2ds', help='Path to dataset', type=str)
args = parser.parse_args()
if args.noDisp:
noDisp = True
print('No graphics')
else:
noDisp = False
print('Showing figures')
gui_env = ['Qt5Agg','WXAgg','TKAgg','GTKAgg']
for gui in gui_env:
try:
print("testing: {}".format(gui))
matplotlib.use(gui,warn=False, force=True)
from matplotlib import pyplot as plt
break
except:
continue
print("Using: {}".format(matplotlib.get_backend()))
plt.ion()
args.path2ds = '/media/rakshit/tank/Dataset'
PATH_DIR = os.path.join(args.path2ds, 'Santini')
PATH_DS = os.path.join(args.path2ds, 'All')
PATH_MASTER = os.path.join(args.path2ds, 'MasterKey')
list_ds = ['1', '2', '3', '4', '5', '6']
sc = (640.0/384.0)
Image_counter = 0.0
ds_num = 24
def mypause(interval):
backend = plt.rcParams['backend']
if backend in matplotlib.rcsetup.interactive_bk:
figManager = matplotlib._pylab_helpers.Gcf.get_active()
if figManager is not None:
canvas = figManager.canvas
if canvas.figure.stale:
canvas.draw()
canvas.start_event_loop(interval)
return
def fix_pupil_loc(p, res):
p[0] = 0.5*p[0]
p[1] = res[0] - 0.5*p[1]
return p
def readFormattedText(path2file, ignoreLines):
data = []
count = 0
f = open(path2file, 'r')
for line in f:
d = [int(d) for d in line.split() if d.isdigit()]
count = count + 1
if d and count > ignoreLines:
data.append(d)
f.close()
return data
for name in list_ds:
opts = os.listdir(os.path.join(PATH_DIR, name))
for subdir in opts:
PATH_DATA = os.path.join(PATH_DIR, name, subdir)
Path2text = os.path.join(PATH_DATA, 'journal-{:04d}.txt'.format(int(subdir)-1))
Path2vid = os.path.join(PATH_DATA, 'eye-{:04d}-0000.avi'.format(int(subdir)-1))
PupilData = np.array(readFormattedText(Path2text, 2))
VidObj = cv2.VideoCapture(Path2vid)
keydict = {k:[] for k in ['pupil_loc', 'archive', 'data_type', 'resolution', 'dataset', 'subset']}
keydict['data_type'] = 0
keydict['resolution'] = []
keydict['dataset'] = 'Santini'
keydict['subset'] = '{}-{}'.format(name, subdir)
Data = {k:[] for k in ['Images', 'Info', 'Masks', 'Masks_noSkin', 'Fits', 'pupil_loc']}
Data['Fits'] = {k:[] for k in ['pupil', 'pupil_norm', 'pupil_phi', 'iris', 'iris_norm', 'iris_phi']}
if not noDisp:
fig, plts = plt.subplots(1,1)
fr_num = 0
while(VidObj.isOpened()):
ret, I = VidObj.read()
if ret == True:
I = cv2.cvtColor(I, cv2.COLOR_BGR2GRAY)
I = cv2.resize(I, (640, 480), cv2.INTER_LANCZOS4)
Data['Images'].append(I)
keydict['resolution'].append(I.shape)
keydict['archive'].append(ds_num)
pupil_loc = fix_pupil_loc(PupilData[fr_num, 10:12]*sc, I.shape)
keydict['pupil_loc'].append(pupil_loc)
Data['pupil_loc'].append(pupil_loc)
Data['Info'].append(str(fr_num))
fr_num+=1
Image_counter+=1
if not noDisp:
if fr_num == 1:
cI = plts.imshow(I)
cX = plts.scatter(pupil_loc[0], pupil_loc[1])
plt.show()
plt.pause(.01)
else:
newLoc = np.array([pupil_loc[0], pupil_loc[1]])
cI.set_data(I)
cX.set_offsets(newLoc)
mypause(0.01)
else:
break
Data['Images'] = np.stack(Data['Images'], axis=0)
Data['pupil_loc'] = np.stack(Data['pupil_loc'], axis=0)
keydict['pupil_loc'] = np.stack(keydict['pupil_loc'], axis=0)
keydict['resolution'] = np.stack(keydict['resolution'], axis=0)
keydict['archive'] = np.stack(keydict['archive'], axis=0)
dd.io.save(os.path.join(PATH_DS, str(ds_num)+'.h5'), Data)
scio.savemat(os.path.join(PATH_MASTER, str(ds_num)), keydict, appendmat=True)
ds_num=ds_num+1 | true | true |
f70296f7f9d79a7e89f869920b8a89f1d9105870 | 38,097 | py | Python | arkalos/app/arkalos_views/arkalos_common.py | kantale/arkalos | 0e8776a2458b6be79ceea8d78c91fe8c067df50a | [
"AFL-3.0"
] | null | null | null | arkalos/app/arkalos_views/arkalos_common.py | kantale/arkalos | 0e8776a2458b6be79ceea8d78c91fe8c067df50a | [
"AFL-3.0"
] | 1 | 2017-06-20T13:59:24.000Z | 2017-06-20T13:59:24.000Z | arkalos/app/arkalos_views/arkalos_common.py | kantale/arkalos | 0e8776a2458b6be79ceea8d78c91fe8c067df50a | [
"AFL-3.0"
] | null | null | null |
from django.http import HttpResponse
from django.contrib.auth.models import User
from django.contrib.auth import authenticate, login, logout
from django.shortcuts import redirect
from django.core.validators import URLValidator # https://stackoverflow.com/questions/7160737/python-how-to-validate-a-url-in-python-malformed-or-not
from django.core.exceptions import ValidationError, ObjectDoesNotExist
from django.db.models import Max, Count
from app.models import Reference, Tools, Reports, Tasks, TasksStats
import io
import re
import six
import uuid
import hashlib
import simplejson
#https://pybtex.org/
from pybtex.database import parse_string as parse_reference_string
import pybtex.database.input.bibtex
import pybtex.plugin
# Globals
pybtex_style = pybtex.plugin.find_plugin('pybtex.style.formatting', 'plain')()
pybtex_html_backend = pybtex.plugin.find_plugin('pybtex.backends', 'html')()
pybtex_parser = pybtex.database.input.bibtex.Parser()
sep = '||'
sep2 = '@@'
format_time_string = '%a, %d %b %Y %H:%M:%S' # RFC 2822 Internet email standard. https://docs.python.org/2/library/time.html#time.strftime # '%Y-%m-%d, %H:%M:%S'
url_validator = URLValidator() # https://stackoverflow.com/questions/7160737/python-how-to-validate-a-url-in-python-malformed-or-not
class ArkalosException(Exception):
pass
def get_guid():
'''
Create a new guid
'''
return str(uuid.uuid4())
def get_user_id(request):
'''
Get id of user
'''
is_authenticated = request.user.is_authenticated()
if is_authenticated:
return request.user.id
return None
def get_user(request):
'''
Get user object
'''
is_authenticated = request.user.is_authenticated()
if is_authenticated:
return request.user
return None
def fail(error_message=None):
'''
Failed AJAX request
'''
ret = {'success': False, 'error_message': error_message}
json = simplejson.dumps(ret)
return HttpResponse(json, content_type='application/json')
def success(data={}):
'''
success Ajax request
'''
data['success'] = True
json = simplejson.dumps(data)
return HttpResponse(json, content_type='application/json')
def has_data(f):
'''
Decorator that passes AJAX data to a function parameters
'''
def wrapper(*args, **kwargs):
request = args[0]
if request.method == 'POST':
if len(request.POST):
for k in request.POST:
kwargs[k] = request.POST[k]
else:
POST = simplejson.loads(request.body)
for k in POST:
kwargs[k] = POST[k]
elif request.method == 'GET':
for k in request.GET:
kwargs[k] = request.GET[k]
print ("GET: {} == {}".format(k, kwargs[k]))
return f(*args, **kwargs)
return wrapper
def has_field(field_names, errors):
'''
Check if field names are present
field_name: The field to check
'''
def decorator(f):
def wrapper(*args, **kwargs):
for field_index, field_name in enumerate(field_names):
if not field_name in kwargs:
if callable(errors):
kwargs['error'] = errors(field_name)
elif type(errors) is list:
kwargs['error'] = errors[field_index]
elif type(errors) is dict:
kwargs['error'] = errors[field_name]
elif type(errors) is str:
kwargs['error'] = errors
else:
# This should never happen
raise ArkalosException('Unknown error type: {}'.format(type(error).__name__))
return f(*args, **kwargs)
return f(*args, **kwargs)
return wrapper
return decorator
def has_error(f):
'''
Check if error in kwargs
'''
def wrapper(*args, **kwargs):
if 'error' in kwargs:
return fail(kwargs['error'])
return f(*args, **kwargs)
return wrapper
def username_exists(username):
'''
Checks if a username exists
'''
return User.objects.filter(username=username).exists()
def URL_validate(url):
'''
https://stackoverflow.com/questions/7160737/python-how-to-validate-a-url-in-python-malformed-or-not
'''
try:
url_validator(url)
except ValidationError as e:
return False
return True
def format_time(t):
'''
Universal method to string format time vars
'''
return t.strftime(format_time_string)
###########################################################################
##################DATABASE FUNCTIONS#######################################
###########################################################################
def bootstrap_table_format_field(entry, value):
'''
Formats the field of a bootstrap table. Values are taken from bidings
'''
if type(value) is str:
if type(entry) is dict:
return entry[value]
else:
return getattr(entry, value)
elif callable(value):
return value(entry)
def serve_boostrap_table2(model, query_f, filters, bindings, **kwargs):
'''
count_f = Tools.objects.values('name', 'url').annotate(Count('name')).count()
query_f = Tools.objects.values('name', 'url').annotate(Count('name'))
IT DOES NOT USE count_f !
'''
#count = count_f()
order = kwargs['order']
offset = kwargs['offset']
limit = kwargs['limit']
from_offset = int(offset)
to_offset = from_offset + int(limit)
if 'filter' in kwargs:
# "read" the filter
filter_ = kwargs['filter']
filter_ = simplejson.loads(filter_)
print ("Filter:")
print (filter_)
applied_filters = {filters[f][0](): filters[f][1](f_value) for f, f_value in filter_.items() if f in filters}
print ("Applied filters:")
print (applied_filters)
else:
applied_filters = {}
querySet = query_f(applied_filters)
count = querySet.count()
querySet = querySet[from_offset:to_offset]
ret = {'total': count}
ret['rows'] = [ {k: bootstrap_table_format_field(entry, v) for k, v in bindings.items()} for entry in querySet]
json = simplejson.dumps(ret)
return HttpResponse(json, content_type='application/json')
def serve_boostrap_table(model, bindings, order_by, **kwargs):
'''
http://bootstrap-table.wenzhixin.net.cn/
'''
count = model.objects.count()
order = kwargs['order']
offset = kwargs['offset']
limit = kwargs['limit']
from_offset = int(offset)
to_offset = from_offset + int(limit)
if 'filter' in kwargs:
filter_ = kwargs['filter']
filter_ = simplejson.loads(filter_)
filter_ = { bindings[k] + '__icontains':v for k,v in filter_.items()}
querySet = model.objects.filter(**filter_)
count = querySet.count()
querySet = querySet[from_offset:to_offset]
else:
querySet = model.objects.order_by(order_by)[from_offset:to_offset]
ret = {'total': count}
ret['rows'] = [ {k: bootstrap_table_format_field(entry, v) for k, v in bindings.items()} for entry in querySet]
json = simplejson.dumps(ret)
return HttpResponse(json, content_type='application/json')
def db_exists(model, filters):
'''
Does this entry exist?
'''
return model.objects.filter(**filters).exists()
def get_maximum_current_version(model, name):
'''
Return the next available current_version
'''
max_entry = model.objects.filter(name=name).aggregate(Max('current_version'))
if max_entry['current_version__max'] is None:
return 1
assert type(max_entry) is dict
assert len(max_entry) == 1
return max_entry['current_version__max'] + 1
def build_jstree_tool_dependencies(tool, prefix='', include_original=False):
'''
Build the dependency jstree of this tool
include_original are we including the original tool in the jstree?
'''
def node(t):
ret = {
'id': prefix + sep + t.name + sep + str(t.current_version), #Through this id we get info from jstree jandlers
'text': t.name + ' ' + str(t.current_version),
'children': [build_jstree_tool_dependencies(x, prefix, include_original=True) for x in t.dependencies.all()] + \
[{'text': x[0], 'type': 'exposed', 'value': x[1], 'description': x[2], 'id': prefix+sep+x[0]+sep+t.name+sep2+str(t.current_version)} for x in simplejson.loads(t.exposed)],
'current_version': t.current_version,
'name': t.name,
'type': 'tool',
}
return ret
if include_original:
return node(tool)
else:
return [node(dependent_tool) for dependent_tool in tool.dependencies.all()]
def build_jstree(model, name, prefix=''):
'''
Take an entry that has a previous_version and current_version
Build a jstree compatible structure
'''
index = {}
if prefix:
prefix_to_add = prefix + sep
else:
prefix_to_add = ''
def node(o):
current_version = o.current_version
ret = {
'id': prefix_to_add + o.name + sep + str(o.current_version),
'text': o.name + ' ' + str(o.current_version),
'children': [],
'current_version': o.current_version,
'name': o.name
}
index[current_version] = ret
return ret
ret = []
all_objects = model.objects.filter(name=name).order_by("current_version")
#ret.append(node(all_objects[0]))
for o in all_objects:
previous_version = o.previous_version
if previous_version is None:
ret.append(node(o))
else:
this_node = node(o)
index[previous_version]['children'].append(this_node)
#print (simplejson.dumps(ret))
return ret
###########################################################################
##################END OF DATABASE#######################################
###########################################################################
###########################################################################
################## REGISTER ###############################################
###########################################################################
@has_data
@has_field(['username', 'password', 'password_confirm', 'email'], lambda x :'{} is required'.format(x))
@has_error
def register(request, **kwargs):
'''
Register
'''
#print (kwargs)
username = kwargs['username']
password = kwargs['password']
password_confirm = kwargs['password_confirm']
email = kwargs['email']
#Check if this user exists
if username_exists(username):
return fail('Username {} exists'.format(username))
#Check if password match
if kwargs['password'] != kwargs['password_confirm']:
return fail('Passwords do not match')
#Create user
user = User.objects.create_user(username, email, password)
return success({})
@has_data
@has_field(['username', 'password'], lambda x :'{} is required'.format(x))
@has_error
def loginlocal(request, **kwargs):
'''
Function called from login
'''
username = kwargs['username']
password = kwargs['password']
user = authenticate(username=username, password=password)
if user is None:
return fail('Invalid username or password')
#if user.is_active: ... # https://docs.djangoproject.com/en/1.9/topics/auth/default/
login(request, user)
ret = {'username': username}
return success(ret)
def logoutlocal(request):
'''
logout
'''
logout(request)
return redirect('/')
###########################################################################
################## END OF REGISTER ########################################
###########################################################################
###############################
####REFERENCES#################
###############################
def reference_get_fields(content):
'''
Get the code of the bibtex entry
'''
p = parse_reference_string(content, 'bibtex')
p_len = len(p.entries)
if p_len == 0:
return False, 'Could not find BIBTEX entry'
if p_len > 1:
return False, 'More than one BIBTEX entries found'
code = p.entries.keys()[0]
if not 'title' in p.entries[code].fields:
return False, 'Could not find title information'
title = p.entries[code].fields['title']
if not hasattr(p.entries[code], 'persons'):
return False, 'Could not find author information'
if not 'author' in p.entries[code].persons:
return False, 'Could not find author information'
if len(p.entries[code].persons['author']) == 0:
return False, 'Could not find author information'
authors = sep.join([str(x) for x in p.entries[code].persons['author']])
return True, {'code': code, 'title': title, 'authors': authors}
def bibtex_to_html(content):
'''
Convert bibtex to html
Adapted from: http://pybtex-docutils.readthedocs.io/en/latest/quickstart.html#overview
'''
data = pybtex_parser.parse_stream(six.StringIO(content))
data_formatted = pybtex_style.format_entries(six.itervalues(data.entries))
output = io.StringIO()
pybtex_html_backend.write_to_stream(data_formatted, output)
html = output.getvalue()
html_s = html.split('\n')
html_s = html_s[9:-2]
new_html = '\n'.join(html_s).replace('<dd>', '').replace('</dd>', '')
return new_html
@has_data
@has_field(['content'], 'BIBTEX content is required')
@has_error
def add_reference(request, **kwargs):
'''
Add reference
'''
content = kwargs['content']
s, fields = reference_get_fields(content)
if not s:
return fail(fiels)
if db_exists(Reference, {'code': fields['code']}):
return fail('BIBTEX entry with code {} already exists'.format(code))
html = bibtex_to_html(content)
r = Reference(
user=get_user(request),
code=fields['code'],
title=fields['title'],
authors=fields['authors'],
content=content,
reference_type='BIBTEX',
html = html,
)
r.save()
return success()
@has_data
def get_references(request, **kwargs):
'''
Serve GET Request for References bootstrap table
'''
bindings = {
'id': 'code',
'content': 'html',
}
return serve_boostrap_table(Reference, bindings, 'id', **kwargs)
@has_data
@has_error
def get_reference(request, **kwargs):
'''
Get reference
'''
codes = kwargs['codes']
ret = {'data': {}, 'html': []}
c = 0
for code in codes:
try:
ref = Reference.objects.get(code=code)
c += 1
ret['data'][code] = {'counter': c}
ret['html'].append({'html': ref.html})
except ObjectDoesNotExist:
pass
ret['total'] = c
return success(ret)
@has_data
def reference_suggestions(request, **kwargs):
'''
Get called from tagas input
'''
query = kwargs['query']
querySet = Reference.objects.filter(content__icontains = query)[:10]
ret = [ {'value' : entry.code, 'html': entry.html} for entry in querySet] # We have a html representation for each Reference
json = simplejson.dumps(ret)
return HttpResponse(json, content_type='application/json')
def get_references_from_text(text):
'''
Get all reference objects from a text.
This is useful for the report
'''
ret = []
all_brackets = re.findall(r'\[[\w]+\]', text)
for bracket in all_brackets:
#Remove brackets
code = bracket[1:-1]
#Check if this a real reference
try:
ref = Reference.objects.get(code=code)
except ObjectDoesNotExist:
pass
else:
ret += [ref]
return ret
###############################
######END OF REFERENCES########
###############################
#################################
#### REPORTS ####################
#################################
@has_data
def get_reports(request, **kwargs):
'''
Serve bootstrap table for reports
'''
bindings = {
'name': 'name',
#'total_edits': lambda entry: entry['name__count'],
'content': lambda entry : ''
}
#return serve_boostrap_table(Reports, bindings, 'id', **kwargs)
return serve_boostrap_table2(
model = Reports,
#count_f = lambda : Reports.objects.values('name').annotate(Count('name')).count(),
query_f = lambda x : Reports.objects.filter(**x).values('name').distinct(),
bindings = bindings,
filters = {
'name': (lambda : 'name__icontains', lambda x : x) # name_contains = x
},
**kwargs
)
@has_data
@has_error
def get_reports_ui(request, **kwargs):
name = kwargs['name']
current_version = kwargs['current_version']
report = Reports.objects.get(name=name, current_version=current_version)
username = report.user.username
ret = {
'name': name,
'current_version': current_version,
'username': username,
'created_at': format_time(report.created_at),
'markdown': report.markdown,
'summary': report.summary,
}
return success(ret)
@has_data
@has_error
def add_report(request, **kwargs):
name = kwargs['name']
previous_version = kwargs['previous_version']
markdown = kwargs['markdown']
references = kwargs['references']
user = get_user(request)
#print (name)
#print (previous_version)
#print (markdown)
#print (references)
current_version = get_maximum_current_version(Reports, name)
previous_version = kwargs["previous_version"]
if previous_version == 'N/A':
previous_version = None
if current_version == 1:
previous_version = None
report = Reports(
name=name,
user=user,
current_version=current_version,
previous_version=previous_version,
markdown=markdown,
)
report.save()
fetched_references = [Reference.objects.get(name=x) for x in references]
report.references.add(*fetched_references)
report.save()
ret = {
'created_at' : format_time(report.created_at),
'current_version': current_version,
'jstree': build_jstree(Reports, report.name)
}
#print (ret)
return success(ret)
#################################
#### END OF REPORTS #############
#################################
#################################
####TOOLS / DATA#################
#################################
@has_data
def get_tools(request, **kwargs):
'''
Serve GET Request for Tools bootstrap table
def serve_boostrap_table2(model, count_f, query_f, bindings, **kwargs):
count_f = Tools.objects.values('name', 'url').annotate(Count('name')).count()
query_f = Tools.objects.values('name', 'url').annotate(Count('name')
'''
bindings = {
'name' : 'name',
'url': lambda entry : '<a href="{}" target="_blank">{}</a>'.format(entry['url'], entry['url']),
#'total_edits': lambda entry: entry['name__count'],
'description': lambda entry: ''
#'current_version': lambda entry: '{} -- {}'.format(entry.current_version, entry.previous_version),
#'current_version': 'current_version',
#'description': 'description',
#'description': lambda entry: '{} {} -- {}'.format(entry.description, entry.current_version, entry.previous_version),
}
#return serve_boostrap_table(Tools, bindings, 'name', **kwargs)
return serve_boostrap_table2(
model = Tools,
#count_f = lambda : Tools.objects.values('name', 'url').annotate(Count('name')).count(),
query_f = lambda x : Tools.objects.values('name', 'url').annotate(Count('name')),
filters = {
},
bindings = bindings,
**kwargs
)
@has_data
@has_error
def get_tools_ui(request, **kwargs):
'''
Called when we want an explicit tool from the UI
'''
name = kwargs['name']
current_version = kwargs['current_version']
tool = Tools.objects.get(name=name, current_version=current_version)
#print ('System: {}'.format(tool.system))
exposed = simplejson.loads(tool.exposed)
if not len(exposed):
exposed = [['', '', '']]
jstree = build_jstree(Tools, tool.name)
dependencies = build_jstree_tool_dependencies(tool, prefix='3', include_original=False)
#print ('DEPENDENCIES:')
#print (dependencies)
ret = {
'name': tool.name,
'current_version': current_version,
'version' : tool.version,
'system' : simplejson.loads(tool.system),
'username': tool.user.username,
'created_at': format_time(tool.created_at),
'url': tool.url,
'description': tool.description,
'installation': tool.installation,
'validate_installation': tool.validate_installation,
'exposed': exposed,
'jstree': jstree,
'references': [x.code for x in tool.references.all()],
'summary': tool.summary,
'dependencies': dependencies
}
return success(ret)
@has_data
@has_field(
['name', 'version', 'url', 'description', 'installation'],
['Name cannot be empty', 'Version cannot be empty', 'Link cannot be empty', 'Description cannot be empty', 'Installation cannot be empty'])
@has_error
def add_tool(request, **kwargs):
'''
Attempt to add a new Tool
'''
system = kwargs['system']
system_p = simplejson.loads(system)
if not len(system_p):
return fail('Please select one or more systems')
url = kwargs['url']
if not URL_validate(url):
return fail('URL: {} does not seem to be valid'.format(url))
references = kwargs['references']
references = simplejson.loads(references)
references = [Reference.objects.get(code=r) for r in references]
name = kwargs['name']
current_version = get_maximum_current_version(Tools, name)
previous_version = kwargs["previous_version"]
if previous_version == 'N/A':
previous_version = None
# else:
# print ('Previous version: {}'.format(previous_version))
# print ('Current version: {}'.format(current_version))
# a=1/0 # Throw exception deliberately
print ('Current version: {}'.format(current_version))
user = get_user(request)
version = kwargs['version']
description = kwargs['description']
installation=kwargs['installation']
validate_installation = kwargs['validate_installation']
exposed = kwargs['exposed']
#print ('Exposed: {} {}'.format(exposed, type(exposed).__name__)) # This is a list
exposed = [e for e in exposed if any(e)] # Remove empty
exposed = simplejson.dumps(exposed) # Serialize
summary = kwargs['summary']
new_tool = Tools(
user=user,
name=name,
version=version,
system=system,
current_version=current_version,
previous_version=previous_version,
url = url,
description = description,
installation = installation,
validate_installation = validate_installation,
exposed = exposed,
summary = summary,
);
new_tool.save()
#Add references
new_tool.references.add(*references)
new_tool.save()
jstree = build_jstree(Tools, new_tool.name)
#Add dependencies
dependencies = kwargs['dependencies']
dependencies_objects = [Tools.objects.get(name=dependency['name'], current_version=dependency['current_version']) for dependency in dependencies]
new_tool.dependencies.add(*dependencies_objects)
new_tool.save()
#Get created at
created_at = format_time(new_tool.created_at)
#print ('Created at: {}'.format(created_at))
ret = {
'created_at': created_at,
'current_version': current_version,
'jstree': jstree
}
return success(ret)
@has_data
@has_error
def jstree_tool(request, **kwargs):
'''
AJAX backend to get the version jstree for a tool
'''
name = kwargs['name']
prefix = kwargs['prefix']
ret = {
'jstree' : build_jstree(Tools, name, prefix=prefix),
}
return success(ret)
@has_data
@has_error
def jstree_report(request, **kwargs):
'''
AJAX backend to get the version jstree for a tool
'''
name = kwargs['name']
prefix = kwargs['prefix']
ret = {
'jstree' : build_jstree(Reports, name, prefix=prefix),
}
return success(ret)
@has_data
@has_error
def jstree_wf(request, **kwargs):
'''
AJAX backend to get the version jstree for a tool
'''
name = kwargs['name']
prefix = kwargs['prefix']
ret = {
'jstree' : build_jstree(Tasks, name, prefix=prefix),
}
return success(ret)
@has_data
@has_error
def jstree_tool_dependencies(request, **kwargs):
'''
AJAX backend to get the dependency jstree for a tool
'''
name = kwargs['name']
current_version = int(kwargs['current_version'])
if 'prefix' in kwargs:
prefix=kwargs['prefix']
else:
prefix = '3'
tool = Tools.objects.get(name=name, current_version=current_version)
ret = {
'jstree': build_jstree_tool_dependencies(tool, prefix=prefix, include_original=True)
}
#print(ret)
return success(ret)
@has_data
@has_error
def get_tool_dependencies(request, **kwargs):
'''
Return ONE LEVEL dependencies of this tool
'''
name = kwargs['name']
current_version = int(kwargs['current_version'])
tool = Tools.objects.get(name=name, current_version=current_version)
ret = {
'dependencies': [{'name': x.name, 'current_version': x.current_version} for x in tool.dependencies.all()]
}
return success(ret)
@has_data
@has_error
def get_tool_variables(request, **kwargs):
'''
Return the variables of this tool
'''
name = kwargs['name']
current_version = int(kwargs['current_version'])
tool = Tools.objects.get(name=name, current_version=current_version)
ret = {
'variables': simplejson.loads(tool.exposed)
}
return success(ret)
########################################
####END OF TOOLS / DATA#################
########################################
########################################
######### WORKFLOWS ####################
########################################
def jason_or_django(f):
'''
getattr and iterate methods for JSON or DJANGO objects
'''
def dec(*args, **kwargs):
if type(args[0]) is dict:
attr = lambda x,y : x[y]
iterate = lambda x,y : (k for k in x[y])
elif type(args[0]) is Tasks:
attr = lambda x,y : getattr(x,y)
iterate = lambda x,y : (k for k in getattr(x,y).all())
else:
raise ArkalosException('This should never happen: {}'.format(type(task)))
kwargs['attr'] = attr
kwargs['iterate'] = iterate
return f(*args, **kwargs)
return dec
@jason_or_django
def task_hash(task, **kwargs):
'''
Creates a unique hash for this task
attr: Get attribute
iterate: Iterator
'''
attr = kwargs['attr']
iterate = kwargs['iterate']
# Dictionary version
# to_hash = [
# task['name'],
# task['bash'],
# task['documentation'],
# '@@'.join(['&&'.join((x['name'], str(x['current_version']))) for x in task['dependencies'] if x['type'] == 'tool']),
# '!!'.join(['**'.join((x['name'], str(x['current_version']) if x['is_workflow'] else 'None')) for x in task['calls']]),
# '##'.join(task['inputs']),
# '$$'.join(task['outputs'])
# ]
# This works with both dictionary and django database objects
to_hash = [
attr(task, 'name'),
attr(task, 'bash'),
attr(task, 'documentation'),
'@@'.join(['&&'.join((attr(x, 'name'), str(attr(x, 'current_version')))) for x in iterate(task, 'dependencies')]),
'!!'.join(['**'.join((attr(x, 'name'), str(attr(x, 'current_version')) if attr(x, 'current_version') else 'None')) for x in iterate(task, 'calls')]),
'##'.join(attr(task, 'inputs')),
'$$'.join(attr(task, 'outputs')),
]
to_hash = '^^'.join(to_hash)
to_hash_b = bytearray(to_hash, encoding="utf-8")
return hashlib.sha256(to_hash_b).hexdigest()
def save_task_or_workflow(request, workflow_or_task):
'''
Saves a workflow or task
'''
if workflow_or_task['is_workflow']:
# This is worflow
is_workflow = True
if workflow_or_task['current_version'] is None:
# This workflow is not saved
# Get the previous_version
previous_version = workflow_or_task['previous_version']
# Get the current number
current_version = get_maximum_current_version(Tasks, workflow_or_task['name'])
else:
# This workflow is saved. Find it and return it
worklfow = Tasks.objects.get(name=workflow_or_task['name'], current_version=workflow_or_task['current_version'])
return worklfow
else:
# This is a task
is_workflow = False
current_version = None
previous_version = None
#Check if it exists in the database
try:
task = Tasks.objects.get(hash_field=workflow_or_task['hash_value'])
except ObjectDoesNotExist:
pass
else:
return task
# It does not exist. Create it!
task = Tasks(
user=get_user(request),
name=workflow_or_task['name'],
current_version=current_version,
previous_version=previous_version,
bash=workflow_or_task['bash'],
documentation=workflow_or_task['documentation'],
hash_field=workflow_or_task['hash_value'],
is_workflow=is_workflow,
inputs=simplejson.dumps(workflow_or_task['inputs']),
outputs=simplejson.dumps(workflow_or_task['outputs']),
)
task.save()
# Add dependencies
tools = []
for dependency in workflow_or_task['dependencies']:
if dependency['type'] != 'tool':
continue
tools += [Tools.objects.get(name=dependency['name'], current_version=dependency['current_version'])]
task.dependencies.add(*tools)
task.save()
# Add references
refs = get_references_from_text(workflow_or_task['documentation'])
task.references.add(*refs)
task.save()
return task
def update_TasksStats(task):
'''
Update the stats of this task
'''
name = task.name
try:
taskStat = TasksStats.objects.get(name=name)
except ObjectDoesNotExist:
taskStat = TasksStats(
name=name,
edits=1,
users=1,
last_edit=task,
)
else:
taskStat.edits += 1
taskStat.users = Tasks.objects.filter(name=name).values('user').count()
taskStat.last_edit=task
finally:
taskStat.save()
@has_data
@has_error
def add_workflow(request, **kwargs):
'''
Add a new workflow
'''
graph = kwargs['graph']
main_guid = kwargs['main_guid']
#Fix is_workflow
for node in graph:
node['is_workflow'] = node['type'] == 'workflow'
#Take main node
main_node = None
for node in graph:
if node['guid'] == main_guid:
main_node = node
break
assert not (main_node is None)
assert main_node['is_workflow']
# Check if there is another workflow with the same name
if main_node['previous_version'] is None: # It is a new workflow!
if db_exists(Tasks, {'name': main_node['name']}):
return fail('Another workflow with this name exists. Please choose another name')
# Check if this workflow calls another workflow which is unsaved (this is not allowed)
for node in graph:
if not node['is_workflow']: # It is not a workflow
continue
if node['guid'] == main_guid: # It is not the main workflow
continue
if node['current_version'] is None: # It is not saved
return fail('Could not save. Workflow: {} calls an UNSAVED workflow: {}'.format(main_node['name'], node['name']))
#Fix the "calls"
guids_to_graph = {node['guid']:node for node in graph}
for node in graph:
node['calls'] = [{'name': guids_to_graph[callee_guid]['name'], 'current_version': guids_to_graph[callee_guid]['current_version']} for callee_guid in node['serial_calls']]
#Do the following three things:
#1. Add hash_value information
#2. Take the hash of the main workflow
#3. Create a mapping from GUIDs to hash_values
from_guid_to_hash = {}
main_hash = None
guids_to_hashes = {}
for node in graph:
#print ('======')
#print(node)
node['hash_value'] = task_hash(node)
if node['guid'] == main_guid:
main_hash = node['hash_value']
guids_to_hashes[node['guid']] = node['hash_value']
assert not (main_hash is None)
# Save the graph and create a new dictionary with the saved objects
hash_objects_dict = {
node['hash_value']: save_task_or_workflow(request, node)
for node in graph
}
#Add the who calls whom information
for node in graph:
this_node_called =[hash_objects_dict[guids_to_hashes[callee_guid]] for callee_guid in node['serial_calls']]
if this_node_called:
hash_objects_dict[node['hash_value']].calls.add(*this_node_called)
hash_objects_dict[node['hash_value']].save()
#Update TaskStats. Perhaps can be done better with signals
update_TasksStats(hash_objects_dict[main_hash])
ret = {
'current_version': hash_objects_dict[main_hash].current_version,
'created_at': format_time(hash_objects_dict[main_hash].created_at),
}
return success(ret)
def workflow_graph(workflow_or_task):
'''
Create a caller--callee graph identical to the one sent from angular for a workflow
'''
ret = []
all_hashes = []
def create_node(node):
ret = {
'bash': node.bash,
'current_version': node.current_version,
'previous_version': node.previous_version,
'documentation': node.documentation,
'tools_jstree_data': [build_jstree_tool_dependencies(tool, prefix='5', include_original=True) for x in node.dependencies.all()],
'inputs': simplejson.loads(node.inputs),
'outputs': simplejson.loads(node.outputs),
'type': 'workflow' if node.is_workflow else 'task',
'hash_value': node.hash_field,
'children': []
}
if node.is_workflow:
ret['name'] = node.name + '_' + str(node.current_version)
ret['workflow_name'] = node.name
ret['created_at'] = format_time(node.created_at)
ret['username'] = node.user.username
else:
ret['name'] = node.name
return ret
def workflow_graph_rec(node):
if node.hash_field in all_hashes:
return
all_hashes.append(node.hash_field)
ret_json = create_node(node)
ret_json['serial_calls'] = []
for callee in node.calls.all():
ret_json['serial_calls'].append(callee.hash_field)
workflow_graph_rec(callee)
ret.append(ret_json)
workflow_graph_rec(workflow_or_task)
return ret
@has_data
def get_workflow(request, **kwargs):
'''
Creates a json object EXACTTLY the same as the one saved
return {
"name": node.type == 'workflow' ? node.workflow_name : node.name,
"bash": node.bash,
"current_version": node.current_version, // This is always null
"previous_version": node.previous_version,
"documentation": node.documentation,
"dependencies": node.tools_jstree_data,
"serial_calls" : node.serial_calls,
"inputs": node.inputs,
"outputs": node.outputs,
"type": node.type,
"guid": node.guid
};
'''
name = kwargs['name']
current_version = kwargs['current_version']
wf = Tasks.objects.get(name=name, current_version=current_version)
graph = workflow_graph(wf)
# print ('ret:')
# print (ret)
ret = {
'graph': graph,
'main_hash': wf.hash_field
}
return success(ret)
@has_data
def get_workflows(request, **kwargs):
'''
Serve bootstrap table for workflows
'''
def description(entry):
ret = '<p>Edits: <strong>%i</strong> Users: <strong>%i</strong> Last Edit: <strong>%s</strong><br />Last documentation: %s</p>' % (entry.edits, entry.users, format_time(entry.last_edit.created_at), entry.last_edit.documentation)
return ret
bindings = {
'name' : 'name',
'description': description,
}
#return serve_boostrap_table(Tools, bindings, 'name', **kwargs)
return serve_boostrap_table2(
model = TasksStats,
#count_f = lambda : Tasks.objects.values('name').count(), # COUNT ALL
query_f = lambda x : TasksStats.objects.filter(**x), # Query function
filters = {
'name': (lambda : 'name__icontains', lambda x : x) # name_contains = x
},
bindings = bindings,
**kwargs
)
########################################
####### END OF WORKFLOWS ###############
########################################
| 28.579895 | 236 | 0.590729 |
from django.http import HttpResponse
from django.contrib.auth.models import User
from django.contrib.auth import authenticate, login, logout
from django.shortcuts import redirect
from django.core.validators import URLValidator
from django.core.exceptions import ValidationError, ObjectDoesNotExist
from django.db.models import Max, Count
from app.models import Reference, Tools, Reports, Tasks, TasksStats
import io
import re
import six
import uuid
import hashlib
import simplejson
from pybtex.database import parse_string as parse_reference_string
import pybtex.database.input.bibtex
import pybtex.plugin
pybtex_style = pybtex.plugin.find_plugin('pybtex.style.formatting', 'plain')()
pybtex_html_backend = pybtex.plugin.find_plugin('pybtex.backends', 'html')()
pybtex_parser = pybtex.database.input.bibtex.Parser()
sep = '||'
sep2 = '@@'
format_time_string = '%a, %d %b %Y %H:%M:%S' ption):
pass
def get_guid():
return str(uuid.uuid4())
def get_user_id(request):
is_authenticated = request.user.is_authenticated()
if is_authenticated:
return request.user.id
return None
def get_user(request):
is_authenticated = request.user.is_authenticated()
if is_authenticated:
return request.user
return None
def fail(error_message=None):
ret = {'success': False, 'error_message': error_message}
json = simplejson.dumps(ret)
return HttpResponse(json, content_type='application/json')
def success(data={}):
data['success'] = True
json = simplejson.dumps(data)
return HttpResponse(json, content_type='application/json')
def has_data(f):
def wrapper(*args, **kwargs):
request = args[0]
if request.method == 'POST':
if len(request.POST):
for k in request.POST:
kwargs[k] = request.POST[k]
else:
POST = simplejson.loads(request.body)
for k in POST:
kwargs[k] = POST[k]
elif request.method == 'GET':
for k in request.GET:
kwargs[k] = request.GET[k]
print ("GET: {} == {}".format(k, kwargs[k]))
return f(*args, **kwargs)
return wrapper
def has_field(field_names, errors):
def decorator(f):
def wrapper(*args, **kwargs):
for field_index, field_name in enumerate(field_names):
if not field_name in kwargs:
if callable(errors):
kwargs['error'] = errors(field_name)
elif type(errors) is list:
kwargs['error'] = errors[field_index]
elif type(errors) is dict:
kwargs['error'] = errors[field_name]
elif type(errors) is str:
kwargs['error'] = errors
else:
raise ArkalosException('Unknown error type: {}'.format(type(error).__name__))
return f(*args, **kwargs)
return f(*args, **kwargs)
return wrapper
return decorator
def has_error(f):
def wrapper(*args, **kwargs):
if 'error' in kwargs:
return fail(kwargs['error'])
return f(*args, **kwargs)
return wrapper
def username_exists(username):
return User.objects.filter(username=username).exists()
def URL_validate(url):
try:
url_validator(url)
except ValidationError as e:
return False
return True
def format_time(t):
return t.strftime(format_time_string)
| true | true |
f70297f48478ba961bd1e24c7eaa558a44b1e6f1 | 52,230 | py | Python | app/venv/lib/python2.7/site-packages/numpy/lib/arraypad.py | anaheino/Ufo-sightings-map | 64af02093f97737cbbdfd8af9e1aeb4d8aa8fcdc | [
"MIT"
] | 652 | 2015-07-26T00:00:17.000Z | 2022-02-24T18:30:04.000Z | app/venv/lib/python2.7/site-packages/numpy/lib/arraypad.py | anaheino/Ufo-sightings-map | 64af02093f97737cbbdfd8af9e1aeb4d8aa8fcdc | [
"MIT"
] | 75 | 2016-01-14T16:03:02.000Z | 2020-04-29T22:51:53.000Z | app/venv/lib/python2.7/site-packages/numpy/lib/arraypad.py | anaheino/Ufo-sightings-map | 64af02093f97737cbbdfd8af9e1aeb4d8aa8fcdc | [
"MIT"
] | 40 | 2015-07-24T19:45:08.000Z | 2021-11-01T14:54:56.000Z | """
The arraypad module contains a group of functions to pad values onto the edges
of an n-dimensional array.
"""
from __future__ import division, absolute_import, print_function
import numpy as np
__all__ = ['pad']
###############################################################################
# Private utility functions.
def _arange_ndarray(arr, shape, axis, reverse=False):
"""
Create an ndarray of `shape` with increments along specified `axis`
Parameters
----------
arr : ndarray
Input array of arbitrary shape.
shape : tuple of ints
Shape of desired array. Should be equivalent to `arr.shape` except
`shape[axis]` which may have any positive value.
axis : int
Axis to increment along.
reverse : bool
If False, increment in a positive fashion from 1 to `shape[axis]`,
inclusive. If True, the bounds are the same but the order reversed.
Returns
-------
padarr : ndarray
Output array sized to pad `arr` along `axis`, with linear range from
1 to `shape[axis]` along specified `axis`.
Notes
-----
The range is deliberately 1-indexed for this specific use case. Think of
this algorithm as broadcasting `np.arange` to a single `axis` of an
arbitrarily shaped ndarray.
"""
initshape = tuple(1 if i != axis else shape[axis]
for (i, x) in enumerate(arr.shape))
if not reverse:
padarr = np.arange(1, shape[axis] + 1)
else:
padarr = np.arange(shape[axis], 0, -1)
padarr = padarr.reshape(initshape)
for i, dim in enumerate(shape):
if padarr.shape[i] != dim:
padarr = padarr.repeat(dim, axis=i)
return padarr
def _round_ifneeded(arr, dtype):
"""
Rounds arr inplace if destination dtype is integer.
Parameters
----------
arr : ndarray
Input array.
dtype : dtype
The dtype of the destination array.
"""
if np.issubdtype(dtype, np.integer):
arr.round(out=arr)
def _prepend_const(arr, pad_amt, val, axis=-1):
"""
Prepend constant `val` along `axis` of `arr`.
Parameters
----------
arr : ndarray
Input array of arbitrary shape.
pad_amt : int
Amount of padding to prepend.
val : scalar
Constant value to use. For best results should be of type `arr.dtype`;
if not `arr.dtype` will be cast to `arr.dtype`.
axis : int
Axis along which to pad `arr`.
Returns
-------
padarr : ndarray
Output array, with `pad_amt` constant `val` prepended along `axis`.
"""
if pad_amt == 0:
return arr
padshape = tuple(x if i != axis else pad_amt
for (i, x) in enumerate(arr.shape))
if val == 0:
return np.concatenate((np.zeros(padshape, dtype=arr.dtype), arr),
axis=axis)
else:
return np.concatenate(((np.zeros(padshape) + val).astype(arr.dtype),
arr), axis=axis)
def _append_const(arr, pad_amt, val, axis=-1):
"""
Append constant `val` along `axis` of `arr`.
Parameters
----------
arr : ndarray
Input array of arbitrary shape.
pad_amt : int
Amount of padding to append.
val : scalar
Constant value to use. For best results should be of type `arr.dtype`;
if not `arr.dtype` will be cast to `arr.dtype`.
axis : int
Axis along which to pad `arr`.
Returns
-------
padarr : ndarray
Output array, with `pad_amt` constant `val` appended along `axis`.
"""
if pad_amt == 0:
return arr
padshape = tuple(x if i != axis else pad_amt
for (i, x) in enumerate(arr.shape))
if val == 0:
return np.concatenate((arr, np.zeros(padshape, dtype=arr.dtype)),
axis=axis)
else:
return np.concatenate(
(arr, (np.zeros(padshape) + val).astype(arr.dtype)), axis=axis)
def _prepend_edge(arr, pad_amt, axis=-1):
"""
Prepend `pad_amt` to `arr` along `axis` by extending edge values.
Parameters
----------
arr : ndarray
Input array of arbitrary shape.
pad_amt : int
Amount of padding to prepend.
axis : int
Axis along which to pad `arr`.
Returns
-------
padarr : ndarray
Output array, extended by `pad_amt` edge values appended along `axis`.
"""
if pad_amt == 0:
return arr
edge_slice = tuple(slice(None) if i != axis else 0
for (i, x) in enumerate(arr.shape))
# Shape to restore singleton dimension after slicing
pad_singleton = tuple(x if i != axis else 1
for (i, x) in enumerate(arr.shape))
edge_arr = arr[edge_slice].reshape(pad_singleton)
return np.concatenate((edge_arr.repeat(pad_amt, axis=axis), arr),
axis=axis)
def _append_edge(arr, pad_amt, axis=-1):
"""
Append `pad_amt` to `arr` along `axis` by extending edge values.
Parameters
----------
arr : ndarray
Input array of arbitrary shape.
pad_amt : int
Amount of padding to append.
axis : int
Axis along which to pad `arr`.
Returns
-------
padarr : ndarray
Output array, extended by `pad_amt` edge values prepended along
`axis`.
"""
if pad_amt == 0:
return arr
edge_slice = tuple(slice(None) if i != axis else arr.shape[axis] - 1
for (i, x) in enumerate(arr.shape))
# Shape to restore singleton dimension after slicing
pad_singleton = tuple(x if i != axis else 1
for (i, x) in enumerate(arr.shape))
edge_arr = arr[edge_slice].reshape(pad_singleton)
return np.concatenate((arr, edge_arr.repeat(pad_amt, axis=axis)),
axis=axis)
def _prepend_ramp(arr, pad_amt, end, axis=-1):
"""
Prepend linear ramp along `axis`.
Parameters
----------
arr : ndarray
Input array of arbitrary shape.
pad_amt : int
Amount of padding to prepend.
end : scalar
Constal value to use. For best results should be of type `arr.dtype`;
if not `arr.dtype` will be cast to `arr.dtype`.
axis : int
Axis along which to pad `arr`.
Returns
-------
padarr : ndarray
Output array, with `pad_amt` values prepended along `axis`. The
prepended region ramps linearly from the edge value to `end`.
"""
if pad_amt == 0:
return arr
# Generate shape for final concatenated array
padshape = tuple(x if i != axis else pad_amt
for (i, x) in enumerate(arr.shape))
# Generate an n-dimensional array incrementing along `axis`
ramp_arr = _arange_ndarray(arr, padshape, axis,
reverse=True).astype(np.float64)
# Appropriate slicing to extract n-dimensional edge along `axis`
edge_slice = tuple(slice(None) if i != axis else 0
for (i, x) in enumerate(arr.shape))
# Shape to restore singleton dimension after slicing
pad_singleton = tuple(x if i != axis else 1
for (i, x) in enumerate(arr.shape))
# Extract edge, reshape to original rank, and extend along `axis`
edge_pad = arr[edge_slice].reshape(pad_singleton).repeat(pad_amt, axis)
# Linear ramp
slope = (end - edge_pad) / float(pad_amt)
ramp_arr = ramp_arr * slope
ramp_arr += edge_pad
_round_ifneeded(ramp_arr, arr.dtype)
# Ramp values will most likely be float, cast them to the same type as arr
return np.concatenate((ramp_arr.astype(arr.dtype), arr), axis=axis)
def _append_ramp(arr, pad_amt, end, axis=-1):
"""
Append linear ramp along `axis`.
Parameters
----------
arr : ndarray
Input array of arbitrary shape.
pad_amt : int
Amount of padding to append.
end : scalar
Constal value to use. For best results should be of type `arr.dtype`;
if not `arr.dtype` will be cast to `arr.dtype`.
axis : int
Axis along which to pad `arr`.
Returns
-------
padarr : ndarray
Output array, with `pad_amt` values appended along `axis`. The
appended region ramps linearly from the edge value to `end`.
"""
if pad_amt == 0:
return arr
# Generate shape for final concatenated array
padshape = tuple(x if i != axis else pad_amt
for (i, x) in enumerate(arr.shape))
# Generate an n-dimensional array incrementing along `axis`
ramp_arr = _arange_ndarray(arr, padshape, axis,
reverse=False).astype(np.float64)
# Slice a chunk from the edge to calculate stats on
edge_slice = tuple(slice(None) if i != axis else -1
for (i, x) in enumerate(arr.shape))
# Shape to restore singleton dimension after slicing
pad_singleton = tuple(x if i != axis else 1
for (i, x) in enumerate(arr.shape))
# Extract edge, reshape to original rank, and extend along `axis`
edge_pad = arr[edge_slice].reshape(pad_singleton).repeat(pad_amt, axis)
# Linear ramp
slope = (end - edge_pad) / float(pad_amt)
ramp_arr = ramp_arr * slope
ramp_arr += edge_pad
_round_ifneeded(ramp_arr, arr.dtype)
# Ramp values will most likely be float, cast them to the same type as arr
return np.concatenate((arr, ramp_arr.astype(arr.dtype)), axis=axis)
def _prepend_max(arr, pad_amt, num, axis=-1):
"""
Prepend `pad_amt` maximum values along `axis`.
Parameters
----------
arr : ndarray
Input array of arbitrary shape.
pad_amt : int
Amount of padding to prepend.
num : int
Depth into `arr` along `axis` to calculate maximum.
Range: [1, `arr.shape[axis]`] or None (entire axis)
axis : int
Axis along which to pad `arr`.
Returns
-------
padarr : ndarray
Output array, with `pad_amt` values appended along `axis`. The
prepended region is the maximum of the first `num` values along
`axis`.
"""
if pad_amt == 0:
return arr
# Equivalent to edge padding for single value, so do that instead
if num == 1:
return _prepend_edge(arr, pad_amt, axis)
# Use entire array if `num` is too large
if num is not None:
if num >= arr.shape[axis]:
num = None
# Slice a chunk from the edge to calculate stats on
max_slice = tuple(slice(None) if i != axis else slice(num)
for (i, x) in enumerate(arr.shape))
# Shape to restore singleton dimension after slicing
pad_singleton = tuple(x if i != axis else 1
for (i, x) in enumerate(arr.shape))
# Extract slice, calculate max, reshape to add singleton dimension back
max_chunk = arr[max_slice].max(axis=axis).reshape(pad_singleton)
# Concatenate `arr` with `max_chunk`, extended along `axis` by `pad_amt`
return np.concatenate((max_chunk.repeat(pad_amt, axis=axis), arr),
axis=axis)
def _append_max(arr, pad_amt, num, axis=-1):
"""
Pad one `axis` of `arr` with the maximum of the last `num` elements.
Parameters
----------
arr : ndarray
Input array of arbitrary shape.
pad_amt : int
Amount of padding to append.
num : int
Depth into `arr` along `axis` to calculate maximum.
Range: [1, `arr.shape[axis]`] or None (entire axis)
axis : int
Axis along which to pad `arr`.
Returns
-------
padarr : ndarray
Output array, with `pad_amt` values appended along `axis`. The
appended region is the maximum of the final `num` values along `axis`.
"""
if pad_amt == 0:
return arr
# Equivalent to edge padding for single value, so do that instead
if num == 1:
return _append_edge(arr, pad_amt, axis)
# Use entire array if `num` is too large
if num is not None:
if num >= arr.shape[axis]:
num = None
# Slice a chunk from the edge to calculate stats on
end = arr.shape[axis] - 1
if num is not None:
max_slice = tuple(
slice(None) if i != axis else slice(end, end - num, -1)
for (i, x) in enumerate(arr.shape))
else:
max_slice = tuple(slice(None) for x in arr.shape)
# Shape to restore singleton dimension after slicing
pad_singleton = tuple(x if i != axis else 1
for (i, x) in enumerate(arr.shape))
# Extract slice, calculate max, reshape to add singleton dimension back
max_chunk = arr[max_slice].max(axis=axis).reshape(pad_singleton)
# Concatenate `arr` with `max_chunk`, extended along `axis` by `pad_amt`
return np.concatenate((arr, max_chunk.repeat(pad_amt, axis=axis)),
axis=axis)
def _prepend_mean(arr, pad_amt, num, axis=-1):
"""
Prepend `pad_amt` mean values along `axis`.
Parameters
----------
arr : ndarray
Input array of arbitrary shape.
pad_amt : int
Amount of padding to prepend.
num : int
Depth into `arr` along `axis` to calculate mean.
Range: [1, `arr.shape[axis]`] or None (entire axis)
axis : int
Axis along which to pad `arr`.
Returns
-------
padarr : ndarray
Output array, with `pad_amt` values prepended along `axis`. The
prepended region is the mean of the first `num` values along `axis`.
"""
if pad_amt == 0:
return arr
# Equivalent to edge padding for single value, so do that instead
if num == 1:
return _prepend_edge(arr, pad_amt, axis)
# Use entire array if `num` is too large
if num is not None:
if num >= arr.shape[axis]:
num = None
# Slice a chunk from the edge to calculate stats on
mean_slice = tuple(slice(None) if i != axis else slice(num)
for (i, x) in enumerate(arr.shape))
# Shape to restore singleton dimension after slicing
pad_singleton = tuple(x if i != axis else 1
for (i, x) in enumerate(arr.shape))
# Extract slice, calculate mean, reshape to add singleton dimension back
mean_chunk = arr[mean_slice].mean(axis).reshape(pad_singleton)
_round_ifneeded(mean_chunk, arr.dtype)
# Concatenate `arr` with `mean_chunk`, extended along `axis` by `pad_amt`
return np.concatenate((mean_chunk.repeat(pad_amt, axis).astype(arr.dtype),
arr), axis=axis)
def _append_mean(arr, pad_amt, num, axis=-1):
"""
Append `pad_amt` mean values along `axis`.
Parameters
----------
arr : ndarray
Input array of arbitrary shape.
pad_amt : int
Amount of padding to append.
num : int
Depth into `arr` along `axis` to calculate mean.
Range: [1, `arr.shape[axis]`] or None (entire axis)
axis : int
Axis along which to pad `arr`.
Returns
-------
padarr : ndarray
Output array, with `pad_amt` values appended along `axis`. The
appended region is the maximum of the final `num` values along `axis`.
"""
if pad_amt == 0:
return arr
# Equivalent to edge padding for single value, so do that instead
if num == 1:
return _append_edge(arr, pad_amt, axis)
# Use entire array if `num` is too large
if num is not None:
if num >= arr.shape[axis]:
num = None
# Slice a chunk from the edge to calculate stats on
end = arr.shape[axis] - 1
if num is not None:
mean_slice = tuple(
slice(None) if i != axis else slice(end, end - num, -1)
for (i, x) in enumerate(arr.shape))
else:
mean_slice = tuple(slice(None) for x in arr.shape)
# Shape to restore singleton dimension after slicing
pad_singleton = tuple(x if i != axis else 1
for (i, x) in enumerate(arr.shape))
# Extract slice, calculate mean, reshape to add singleton dimension back
mean_chunk = arr[mean_slice].mean(axis=axis).reshape(pad_singleton)
_round_ifneeded(mean_chunk, arr.dtype)
# Concatenate `arr` with `mean_chunk`, extended along `axis` by `pad_amt`
return np.concatenate(
(arr, mean_chunk.repeat(pad_amt, axis).astype(arr.dtype)), axis=axis)
def _prepend_med(arr, pad_amt, num, axis=-1):
"""
Prepend `pad_amt` median values along `axis`.
Parameters
----------
arr : ndarray
Input array of arbitrary shape.
pad_amt : int
Amount of padding to prepend.
num : int
Depth into `arr` along `axis` to calculate median.
Range: [1, `arr.shape[axis]`] or None (entire axis)
axis : int
Axis along which to pad `arr`.
Returns
-------
padarr : ndarray
Output array, with `pad_amt` values prepended along `axis`. The
prepended region is the median of the first `num` values along `axis`.
"""
if pad_amt == 0:
return arr
# Equivalent to edge padding for single value, so do that instead
if num == 1:
return _prepend_edge(arr, pad_amt, axis)
# Use entire array if `num` is too large
if num is not None:
if num >= arr.shape[axis]:
num = None
# Slice a chunk from the edge to calculate stats on
med_slice = tuple(slice(None) if i != axis else slice(num)
for (i, x) in enumerate(arr.shape))
# Shape to restore singleton dimension after slicing
pad_singleton = tuple(x if i != axis else 1
for (i, x) in enumerate(arr.shape))
# Extract slice, calculate median, reshape to add singleton dimension back
med_chunk = np.median(arr[med_slice], axis=axis).reshape(pad_singleton)
_round_ifneeded(med_chunk, arr.dtype)
# Concatenate `arr` with `med_chunk`, extended along `axis` by `pad_amt`
return np.concatenate(
(med_chunk.repeat(pad_amt, axis).astype(arr.dtype), arr), axis=axis)
def _append_med(arr, pad_amt, num, axis=-1):
"""
Append `pad_amt` median values along `axis`.
Parameters
----------
arr : ndarray
Input array of arbitrary shape.
pad_amt : int
Amount of padding to append.
num : int
Depth into `arr` along `axis` to calculate median.
Range: [1, `arr.shape[axis]`] or None (entire axis)
axis : int
Axis along which to pad `arr`.
Returns
-------
padarr : ndarray
Output array, with `pad_amt` values appended along `axis`. The
appended region is the median of the final `num` values along `axis`.
"""
if pad_amt == 0:
return arr
# Equivalent to edge padding for single value, so do that instead
if num == 1:
return _append_edge(arr, pad_amt, axis)
# Use entire array if `num` is too large
if num is not None:
if num >= arr.shape[axis]:
num = None
# Slice a chunk from the edge to calculate stats on
end = arr.shape[axis] - 1
if num is not None:
med_slice = tuple(
slice(None) if i != axis else slice(end, end - num, -1)
for (i, x) in enumerate(arr.shape))
else:
med_slice = tuple(slice(None) for x in arr.shape)
# Shape to restore singleton dimension after slicing
pad_singleton = tuple(x if i != axis else 1
for (i, x) in enumerate(arr.shape))
# Extract slice, calculate median, reshape to add singleton dimension back
med_chunk = np.median(arr[med_slice], axis=axis).reshape(pad_singleton)
_round_ifneeded(med_chunk, arr.dtype)
# Concatenate `arr` with `med_chunk`, extended along `axis` by `pad_amt`
return np.concatenate(
(arr, med_chunk.repeat(pad_amt, axis).astype(arr.dtype)), axis=axis)
def _prepend_min(arr, pad_amt, num, axis=-1):
"""
Prepend `pad_amt` minimum values along `axis`.
Parameters
----------
arr : ndarray
Input array of arbitrary shape.
pad_amt : int
Amount of padding to prepend.
num : int
Depth into `arr` along `axis` to calculate minimum.
Range: [1, `arr.shape[axis]`] or None (entire axis)
axis : int
Axis along which to pad `arr`.
Returns
-------
padarr : ndarray
Output array, with `pad_amt` values prepended along `axis`. The
prepended region is the minimum of the first `num` values along
`axis`.
"""
if pad_amt == 0:
return arr
# Equivalent to edge padding for single value, so do that instead
if num == 1:
return _prepend_edge(arr, pad_amt, axis)
# Use entire array if `num` is too large
if num is not None:
if num >= arr.shape[axis]:
num = None
# Slice a chunk from the edge to calculate stats on
min_slice = tuple(slice(None) if i != axis else slice(num)
for (i, x) in enumerate(arr.shape))
# Shape to restore singleton dimension after slicing
pad_singleton = tuple(x if i != axis else 1
for (i, x) in enumerate(arr.shape))
# Extract slice, calculate min, reshape to add singleton dimension back
min_chunk = arr[min_slice].min(axis=axis).reshape(pad_singleton)
# Concatenate `arr` with `min_chunk`, extended along `axis` by `pad_amt`
return np.concatenate((min_chunk.repeat(pad_amt, axis=axis), arr),
axis=axis)
def _append_min(arr, pad_amt, num, axis=-1):
"""
Append `pad_amt` median values along `axis`.
Parameters
----------
arr : ndarray
Input array of arbitrary shape.
pad_amt : int
Amount of padding to append.
num : int
Depth into `arr` along `axis` to calculate minimum.
Range: [1, `arr.shape[axis]`] or None (entire axis)
axis : int
Axis along which to pad `arr`.
Returns
-------
padarr : ndarray
Output array, with `pad_amt` values appended along `axis`. The
appended region is the minimum of the final `num` values along `axis`.
"""
if pad_amt == 0:
return arr
# Equivalent to edge padding for single value, so do that instead
if num == 1:
return _append_edge(arr, pad_amt, axis)
# Use entire array if `num` is too large
if num is not None:
if num >= arr.shape[axis]:
num = None
# Slice a chunk from the edge to calculate stats on
end = arr.shape[axis] - 1
if num is not None:
min_slice = tuple(
slice(None) if i != axis else slice(end, end - num, -1)
for (i, x) in enumerate(arr.shape))
else:
min_slice = tuple(slice(None) for x in arr.shape)
# Shape to restore singleton dimension after slicing
pad_singleton = tuple(x if i != axis else 1
for (i, x) in enumerate(arr.shape))
# Extract slice, calculate min, reshape to add singleton dimension back
min_chunk = arr[min_slice].min(axis=axis).reshape(pad_singleton)
# Concatenate `arr` with `min_chunk`, extended along `axis` by `pad_amt`
return np.concatenate((arr, min_chunk.repeat(pad_amt, axis=axis)),
axis=axis)
def _pad_ref(arr, pad_amt, method, axis=-1):
"""
Pad `axis` of `arr` by reflection.
Parameters
----------
arr : ndarray
Input array of arbitrary shape.
pad_amt : tuple of ints, length 2
Padding to (prepend, append) along `axis`.
method : str
Controls method of reflection; options are 'even' or 'odd'.
axis : int
Axis along which to pad `arr`.
Returns
-------
padarr : ndarray
Output array, with `pad_amt[0]` values prepended and `pad_amt[1]`
values appended along `axis`. Both regions are padded with reflected
values from the original array.
Notes
-----
This algorithm does not pad with repetition, i.e. the edges are not
repeated in the reflection. For that behavior, use `mode='symmetric'`.
The modes 'reflect', 'symmetric', and 'wrap' must be padded with a
single function, lest the indexing tricks in non-integer multiples of the
original shape would violate repetition in the final iteration.
"""
# Implicit booleanness to test for zero (or None) in any scalar type
if pad_amt[0] == 0 and pad_amt[1] == 0:
return arr
##########################################################################
# Prepended region
# Slice off a reverse indexed chunk from near edge to pad `arr` before
ref_slice = tuple(slice(None) if i != axis else slice(pad_amt[0], 0, -1)
for (i, x) in enumerate(arr.shape))
ref_chunk1 = arr[ref_slice]
# Shape to restore singleton dimension after slicing
pad_singleton = tuple(x if i != axis else 1
for (i, x) in enumerate(arr.shape))
if pad_amt[0] == 1:
ref_chunk1 = ref_chunk1.reshape(pad_singleton)
# Memory/computationally more expensive, only do this if `method='odd'`
if 'odd' in method and pad_amt[0] > 0:
edge_slice1 = tuple(slice(None) if i != axis else 0
for (i, x) in enumerate(arr.shape))
edge_chunk = arr[edge_slice1].reshape(pad_singleton)
ref_chunk1 = 2 * edge_chunk - ref_chunk1
del edge_chunk
##########################################################################
# Appended region
# Slice off a reverse indexed chunk from far edge to pad `arr` after
start = arr.shape[axis] - pad_amt[1] - 1
end = arr.shape[axis] - 1
ref_slice = tuple(slice(None) if i != axis else slice(start, end)
for (i, x) in enumerate(arr.shape))
rev_idx = tuple(slice(None) if i != axis else slice(None, None, -1)
for (i, x) in enumerate(arr.shape))
ref_chunk2 = arr[ref_slice][rev_idx]
if pad_amt[1] == 1:
ref_chunk2 = ref_chunk2.reshape(pad_singleton)
if 'odd' in method:
edge_slice2 = tuple(slice(None) if i != axis else -1
for (i, x) in enumerate(arr.shape))
edge_chunk = arr[edge_slice2].reshape(pad_singleton)
ref_chunk2 = 2 * edge_chunk - ref_chunk2
del edge_chunk
# Concatenate `arr` with both chunks, extending along `axis`
return np.concatenate((ref_chunk1, arr, ref_chunk2), axis=axis)
def _pad_sym(arr, pad_amt, method, axis=-1):
"""
Pad `axis` of `arr` by symmetry.
Parameters
----------
arr : ndarray
Input array of arbitrary shape.
pad_amt : tuple of ints, length 2
Padding to (prepend, append) along `axis`.
method : str
Controls method of symmetry; options are 'even' or 'odd'.
axis : int
Axis along which to pad `arr`.
Returns
-------
padarr : ndarray
Output array, with `pad_amt[0]` values prepended and `pad_amt[1]`
values appended along `axis`. Both regions are padded with symmetric
values from the original array.
Notes
-----
This algorithm DOES pad with repetition, i.e. the edges are repeated.
For padding without repeated edges, use `mode='reflect'`.
The modes 'reflect', 'symmetric', and 'wrap' must be padded with a
single function, lest the indexing tricks in non-integer multiples of the
original shape would violate repetition in the final iteration.
"""
# Implicit booleanness to test for zero (or None) in any scalar type
if pad_amt[0] == 0 and pad_amt[1] == 0:
return arr
##########################################################################
# Prepended region
# Slice off a reverse indexed chunk from near edge to pad `arr` before
sym_slice = tuple(slice(None) if i != axis else slice(0, pad_amt[0])
for (i, x) in enumerate(arr.shape))
rev_idx = tuple(slice(None) if i != axis else slice(None, None, -1)
for (i, x) in enumerate(arr.shape))
sym_chunk1 = arr[sym_slice][rev_idx]
# Shape to restore singleton dimension after slicing
pad_singleton = tuple(x if i != axis else 1
for (i, x) in enumerate(arr.shape))
if pad_amt[0] == 1:
sym_chunk1 = sym_chunk1.reshape(pad_singleton)
# Memory/computationally more expensive, only do this if `method='odd'`
if 'odd' in method and pad_amt[0] > 0:
edge_slice1 = tuple(slice(None) if i != axis else 0
for (i, x) in enumerate(arr.shape))
edge_chunk = arr[edge_slice1].reshape(pad_singleton)
sym_chunk1 = 2 * edge_chunk - sym_chunk1
del edge_chunk
##########################################################################
# Appended region
# Slice off a reverse indexed chunk from far edge to pad `arr` after
start = arr.shape[axis] - pad_amt[1]
end = arr.shape[axis]
sym_slice = tuple(slice(None) if i != axis else slice(start, end)
for (i, x) in enumerate(arr.shape))
sym_chunk2 = arr[sym_slice][rev_idx]
if pad_amt[1] == 1:
sym_chunk2 = sym_chunk2.reshape(pad_singleton)
if 'odd' in method:
edge_slice2 = tuple(slice(None) if i != axis else -1
for (i, x) in enumerate(arr.shape))
edge_chunk = arr[edge_slice2].reshape(pad_singleton)
sym_chunk2 = 2 * edge_chunk - sym_chunk2
del edge_chunk
# Concatenate `arr` with both chunks, extending along `axis`
return np.concatenate((sym_chunk1, arr, sym_chunk2), axis=axis)
def _pad_wrap(arr, pad_amt, axis=-1):
"""
Pad `axis` of `arr` via wrapping.
Parameters
----------
arr : ndarray
Input array of arbitrary shape.
pad_amt : tuple of ints, length 2
Padding to (prepend, append) along `axis`.
axis : int
Axis along which to pad `arr`.
Returns
-------
padarr : ndarray
Output array, with `pad_amt[0]` values prepended and `pad_amt[1]`
values appended along `axis`. Both regions are padded wrapped values
from the opposite end of `axis`.
Notes
-----
This method of padding is also known as 'tile' or 'tiling'.
The modes 'reflect', 'symmetric', and 'wrap' must be padded with a
single function, lest the indexing tricks in non-integer multiples of the
original shape would violate repetition in the final iteration.
"""
# Implicit booleanness to test for zero (or None) in any scalar type
if pad_amt[0] == 0 and pad_amt[1] == 0:
return arr
##########################################################################
# Prepended region
# Slice off a reverse indexed chunk from near edge to pad `arr` before
start = arr.shape[axis] - pad_amt[0]
end = arr.shape[axis]
wrap_slice = tuple(slice(None) if i != axis else slice(start, end)
for (i, x) in enumerate(arr.shape))
wrap_chunk1 = arr[wrap_slice]
# Shape to restore singleton dimension after slicing
pad_singleton = tuple(x if i != axis else 1
for (i, x) in enumerate(arr.shape))
if pad_amt[0] == 1:
wrap_chunk1 = wrap_chunk1.reshape(pad_singleton)
##########################################################################
# Appended region
# Slice off a reverse indexed chunk from far edge to pad `arr` after
wrap_slice = tuple(slice(None) if i != axis else slice(0, pad_amt[1])
for (i, x) in enumerate(arr.shape))
wrap_chunk2 = arr[wrap_slice]
if pad_amt[1] == 1:
wrap_chunk2 = wrap_chunk2.reshape(pad_singleton)
# Concatenate `arr` with both chunks, extending along `axis`
return np.concatenate((wrap_chunk1, arr, wrap_chunk2), axis=axis)
def _normalize_shape(ndarray, shape, cast_to_int=True):
"""
Private function which does some checks and normalizes the possibly
much simpler representations of 'pad_width', 'stat_length',
'constant_values', 'end_values'.
Parameters
----------
narray : ndarray
Input ndarray
shape : {sequence, array_like, float, int}, optional
The width of padding (pad_width), the number of elements on the
edge of the narray used for statistics (stat_length), the constant
value(s) to use when filling padded regions (constant_values), or the
endpoint target(s) for linear ramps (end_values).
((before_1, after_1), ... (before_N, after_N)) unique number of
elements for each axis where `N` is rank of `narray`.
((before, after),) yields same before and after constants for each
axis.
(constant,) or val is a shortcut for before = after = constant for
all axes.
cast_to_int : bool, optional
Controls if values in ``shape`` will be rounded and cast to int
before being returned.
Returns
-------
normalized_shape : tuple of tuples
val => ((val, val), (val, val), ...)
[[val1, val2], [val3, val4], ...] => ((val1, val2), (val3, val4), ...)
((val1, val2), (val3, val4), ...) => no change
[[val1, val2], ] => ((val1, val2), (val1, val2), ...)
((val1, val2), ) => ((val1, val2), (val1, val2), ...)
[[val , ], ] => ((val, val), (val, val), ...)
((val , ), ) => ((val, val), (val, val), ...)
"""
ndims = ndarray.ndim
# Shortcut shape=None
if shape is None:
return ((None, None), ) * ndims
# Convert any input `info` to a NumPy array
arr = np.asarray(shape)
# Switch based on what input looks like
if arr.ndim <= 1:
if arr.shape == () or arr.shape == (1,):
# Single scalar input
# Create new array of ones, multiply by the scalar
arr = np.ones((ndims, 2), dtype=ndarray.dtype) * arr
elif arr.shape == (2,):
# Apply padding (before, after) each axis
# Create new axis 0, repeat along it for every axis
arr = arr[np.newaxis, :].repeat(ndims, axis=0)
else:
fmt = "Unable to create correctly shaped tuple from %s"
raise ValueError(fmt % (shape,))
elif arr.ndim == 2:
if arr.shape[1] == 1 and arr.shape[0] == ndims:
# Padded before and after by the same amount
arr = arr.repeat(2, axis=1)
elif arr.shape[0] == ndims:
# Input correctly formatted, pass it on as `arr`
arr = shape
else:
fmt = "Unable to create correctly shaped tuple from %s"
raise ValueError(fmt % (shape,))
else:
fmt = "Unable to create correctly shaped tuple from %s"
raise ValueError(fmt % (shape,))
# Cast if necessary
if cast_to_int is True:
arr = np.round(arr).astype(int)
# Convert list of lists to tuple of tuples
return tuple(tuple(axis) for axis in arr.tolist())
def _validate_lengths(narray, number_elements):
"""
Private function which does some checks and reformats pad_width and
stat_length using _normalize_shape.
Parameters
----------
narray : ndarray
Input ndarray
number_elements : {sequence, int}, optional
The width of padding (pad_width) or the number of elements on the edge
of the narray used for statistics (stat_length).
((before_1, after_1), ... (before_N, after_N)) unique number of
elements for each axis.
((before, after),) yields same before and after constants for each
axis.
(constant,) or int is a shortcut for before = after = constant for all
axes.
Returns
-------
_validate_lengths : tuple of tuples
int => ((int, int), (int, int), ...)
[[int1, int2], [int3, int4], ...] => ((int1, int2), (int3, int4), ...)
((int1, int2), (int3, int4), ...) => no change
[[int1, int2], ] => ((int1, int2), (int1, int2), ...)
((int1, int2), ) => ((int1, int2), (int1, int2), ...)
[[int , ], ] => ((int, int), (int, int), ...)
((int , ), ) => ((int, int), (int, int), ...)
"""
normshp = _normalize_shape(narray, number_elements)
for i in normshp:
chk = [1 if x is None else x for x in i]
chk = [1 if x >= 0 else -1 for x in chk]
if (chk[0] < 0) or (chk[1] < 0):
fmt = "%s cannot contain negative values."
raise ValueError(fmt % (number_elements,))
return normshp
###############################################################################
# Public functions
def pad(array, pad_width, mode=None, **kwargs):
"""
Pads an array.
Parameters
----------
array : array_like of rank N
Input array
pad_width : {sequence, array_like, int}
Number of values padded to the edges of each axis.
((before_1, after_1), ... (before_N, after_N)) unique pad widths
for each axis.
((before, after),) yields same before and after pad for each axis.
(pad,) or int is a shortcut for before = after = pad width for all
axes.
mode : str or function
One of the following string values or a user supplied function.
'constant'
Pads with a constant value.
'edge'
Pads with the edge values of array.
'linear_ramp'
Pads with the linear ramp between end_value and the
array edge value.
'maximum'
Pads with the maximum value of all or part of the
vector along each axis.
'mean'
Pads with the mean value of all or part of the
vector along each axis.
'median'
Pads with the median value of all or part of the
vector along each axis.
'minimum'
Pads with the minimum value of all or part of the
vector along each axis.
'reflect'
Pads with the reflection of the vector mirrored on
the first and last values of the vector along each
axis.
'symmetric'
Pads with the reflection of the vector mirrored
along the edge of the array.
'wrap'
Pads with the wrap of the vector along the axis.
The first values are used to pad the end and the
end values are used to pad the beginning.
<function>
Padding function, see Notes.
stat_length : sequence or int, optional
Used in 'maximum', 'mean', 'median', and 'minimum'. Number of
values at edge of each axis used to calculate the statistic value.
((before_1, after_1), ... (before_N, after_N)) unique statistic
lengths for each axis.
((before, after),) yields same before and after statistic lengths
for each axis.
(stat_length,) or int is a shortcut for before = after = statistic
length for all axes.
Default is ``None``, to use the entire axis.
constant_values : sequence or int, optional
Used in 'constant'. The values to set the padded values for each
axis.
((before_1, after_1), ... (before_N, after_N)) unique pad constants
for each axis.
((before, after),) yields same before and after constants for each
axis.
(constant,) or int is a shortcut for before = after = constant for
all axes.
Default is 0.
end_values : sequence or int, optional
Used in 'linear_ramp'. The values used for the ending value of the
linear_ramp and that will form the edge of the padded array.
((before_1, after_1), ... (before_N, after_N)) unique end values
for each axis.
((before, after),) yields same before and after end values for each
axis.
(constant,) or int is a shortcut for before = after = end value for
all axes.
Default is 0.
reflect_type : {'even', 'odd'}, optional
Used in 'reflect', and 'symmetric'. The 'even' style is the
default with an unaltered reflection around the edge value. For
the 'odd' style, the extented part of the array is created by
subtracting the reflected values from two times the edge value.
Returns
-------
pad : ndarray
Padded array of rank equal to `array` with shape increased
according to `pad_width`.
Notes
-----
.. versionadded:: 1.7.0
For an array with rank greater than 1, some of the padding of later
axes is calculated from padding of previous axes. This is easiest to
think about with a rank 2 array where the corners of the padded array
are calculated by using padded values from the first axis.
The padding function, if used, should return a rank 1 array equal in
length to the vector argument with padded values replaced. It has the
following signature::
padding_func(vector, iaxis_pad_width, iaxis, **kwargs)
where
vector : ndarray
A rank 1 array already padded with zeros. Padded values are
vector[:pad_tuple[0]] and vector[-pad_tuple[1]:].
iaxis_pad_width : tuple
A 2-tuple of ints, iaxis_pad_width[0] represents the number of
values padded at the beginning of vector where
iaxis_pad_width[1] represents the number of values padded at
the end of vector.
iaxis : int
The axis currently being calculated.
kwargs : misc
Any keyword arguments the function requires.
Examples
--------
>>> a = [1, 2, 3, 4, 5]
>>> np.lib.pad(a, (2,3), 'constant', constant_values=(4, 6))
array([4, 4, 1, 2, 3, 4, 5, 6, 6, 6])
>>> np.lib.pad(a, (2, 3), 'edge')
array([1, 1, 1, 2, 3, 4, 5, 5, 5, 5])
>>> np.lib.pad(a, (2, 3), 'linear_ramp', end_values=(5, -4))
array([ 5, 3, 1, 2, 3, 4, 5, 2, -1, -4])
>>> np.lib.pad(a, (2,), 'maximum')
array([5, 5, 1, 2, 3, 4, 5, 5, 5])
>>> np.lib.pad(a, (2,), 'mean')
array([3, 3, 1, 2, 3, 4, 5, 3, 3])
>>> np.lib.pad(a, (2,), 'median')
array([3, 3, 1, 2, 3, 4, 5, 3, 3])
>>> a = [[1, 2], [3, 4]]
>>> np.lib.pad(a, ((3, 2), (2, 3)), 'minimum')
array([[1, 1, 1, 2, 1, 1, 1],
[1, 1, 1, 2, 1, 1, 1],
[1, 1, 1, 2, 1, 1, 1],
[1, 1, 1, 2, 1, 1, 1],
[3, 3, 3, 4, 3, 3, 3],
[1, 1, 1, 2, 1, 1, 1],
[1, 1, 1, 2, 1, 1, 1]])
>>> a = [1, 2, 3, 4, 5]
>>> np.lib.pad(a, (2, 3), 'reflect')
array([3, 2, 1, 2, 3, 4, 5, 4, 3, 2])
>>> np.lib.pad(a, (2, 3), 'reflect', reflect_type='odd')
array([-1, 0, 1, 2, 3, 4, 5, 6, 7, 8])
>>> np.lib.pad(a, (2, 3), 'symmetric')
array([2, 1, 1, 2, 3, 4, 5, 5, 4, 3])
>>> np.lib.pad(a, (2, 3), 'symmetric', reflect_type='odd')
array([0, 1, 1, 2, 3, 4, 5, 5, 6, 7])
>>> np.lib.pad(a, (2, 3), 'wrap')
array([4, 5, 1, 2, 3, 4, 5, 1, 2, 3])
>>> def padwithtens(vector, pad_width, iaxis, kwargs):
... vector[:pad_width[0]] = 10
... vector[-pad_width[1]:] = 10
... return vector
>>> a = np.arange(6)
>>> a = a.reshape((2, 3))
>>> np.lib.pad(a, 2, padwithtens)
array([[10, 10, 10, 10, 10, 10, 10],
[10, 10, 10, 10, 10, 10, 10],
[10, 10, 0, 1, 2, 10, 10],
[10, 10, 3, 4, 5, 10, 10],
[10, 10, 10, 10, 10, 10, 10],
[10, 10, 10, 10, 10, 10, 10]])
"""
if not np.asarray(pad_width).dtype.kind == 'i':
raise TypeError('`pad_width` must be of integral type.')
narray = np.array(array)
pad_width = _validate_lengths(narray, pad_width)
allowedkwargs = {
'constant': ['constant_values'],
'edge': [],
'linear_ramp': ['end_values'],
'maximum': ['stat_length'],
'mean': ['stat_length'],
'median': ['stat_length'],
'minimum': ['stat_length'],
'reflect': ['reflect_type'],
'symmetric': ['reflect_type'],
'wrap': [],
}
kwdefaults = {
'stat_length': None,
'constant_values': 0,
'end_values': 0,
'reflect_type': 'even',
}
if isinstance(mode, str):
# Make sure have allowed kwargs appropriate for mode
for key in kwargs:
if key not in allowedkwargs[mode]:
raise ValueError('%s keyword not in allowed keywords %s' %
(key, allowedkwargs[mode]))
# Set kwarg defaults
for kw in allowedkwargs[mode]:
kwargs.setdefault(kw, kwdefaults[kw])
# Need to only normalize particular keywords.
for i in kwargs:
if i == 'stat_length':
kwargs[i] = _validate_lengths(narray, kwargs[i])
if i in ['end_values', 'constant_values']:
kwargs[i] = _normalize_shape(narray, kwargs[i],
cast_to_int=False)
elif mode is None:
raise ValueError('Keyword "mode" must be a function or one of %s.' %
(list(allowedkwargs.keys()),))
else:
# Drop back to old, slower np.apply_along_axis mode for user-supplied
# vector function
function = mode
# Create a new padded array
rank = list(range(len(narray.shape)))
total_dim_increase = [np.sum(pad_width[i]) for i in rank]
offset_slices = [slice(pad_width[i][0],
pad_width[i][0] + narray.shape[i])
for i in rank]
new_shape = np.array(narray.shape) + total_dim_increase
newmat = np.zeros(new_shape, narray.dtype)
# Insert the original array into the padded array
newmat[offset_slices] = narray
# This is the core of pad ...
for iaxis in rank:
np.apply_along_axis(function,
iaxis,
newmat,
pad_width[iaxis],
iaxis,
kwargs)
return newmat
# If we get here, use new padding method
newmat = narray.copy()
# API preserved, but completely new algorithm which pads by building the
# entire block to pad before/after `arr` with in one step, for each axis.
if mode == 'constant':
for axis, ((pad_before, pad_after), (before_val, after_val)) \
in enumerate(zip(pad_width, kwargs['constant_values'])):
newmat = _prepend_const(newmat, pad_before, before_val, axis)
newmat = _append_const(newmat, pad_after, after_val, axis)
elif mode == 'edge':
for axis, (pad_before, pad_after) in enumerate(pad_width):
newmat = _prepend_edge(newmat, pad_before, axis)
newmat = _append_edge(newmat, pad_after, axis)
elif mode == 'linear_ramp':
for axis, ((pad_before, pad_after), (before_val, after_val)) \
in enumerate(zip(pad_width, kwargs['end_values'])):
newmat = _prepend_ramp(newmat, pad_before, before_val, axis)
newmat = _append_ramp(newmat, pad_after, after_val, axis)
elif mode == 'maximum':
for axis, ((pad_before, pad_after), (chunk_before, chunk_after)) \
in enumerate(zip(pad_width, kwargs['stat_length'])):
newmat = _prepend_max(newmat, pad_before, chunk_before, axis)
newmat = _append_max(newmat, pad_after, chunk_after, axis)
elif mode == 'mean':
for axis, ((pad_before, pad_after), (chunk_before, chunk_after)) \
in enumerate(zip(pad_width, kwargs['stat_length'])):
newmat = _prepend_mean(newmat, pad_before, chunk_before, axis)
newmat = _append_mean(newmat, pad_after, chunk_after, axis)
elif mode == 'median':
for axis, ((pad_before, pad_after), (chunk_before, chunk_after)) \
in enumerate(zip(pad_width, kwargs['stat_length'])):
newmat = _prepend_med(newmat, pad_before, chunk_before, axis)
newmat = _append_med(newmat, pad_after, chunk_after, axis)
elif mode == 'minimum':
for axis, ((pad_before, pad_after), (chunk_before, chunk_after)) \
in enumerate(zip(pad_width, kwargs['stat_length'])):
newmat = _prepend_min(newmat, pad_before, chunk_before, axis)
newmat = _append_min(newmat, pad_after, chunk_after, axis)
elif mode == 'reflect':
for axis, (pad_before, pad_after) in enumerate(pad_width):
# Recursive padding along any axis where `pad_amt` is too large
# for indexing tricks. We can only safely pad the original axis
# length, to keep the period of the reflections consistent.
if ((pad_before > 0) or
(pad_after > 0)) and newmat.shape[axis] == 1:
# Extending singleton dimension for 'reflect' is legacy
# behavior; it really should raise an error.
newmat = _prepend_edge(newmat, pad_before, axis)
newmat = _append_edge(newmat, pad_after, axis)
continue
method = kwargs['reflect_type']
safe_pad = newmat.shape[axis] - 1
while ((pad_before > safe_pad) or (pad_after > safe_pad)):
pad_iter_b = min(safe_pad,
safe_pad * (pad_before // safe_pad))
pad_iter_a = min(safe_pad, safe_pad * (pad_after // safe_pad))
newmat = _pad_ref(newmat, (pad_iter_b,
pad_iter_a), method, axis)
pad_before -= pad_iter_b
pad_after -= pad_iter_a
safe_pad += pad_iter_b + pad_iter_a
newmat = _pad_ref(newmat, (pad_before, pad_after), method, axis)
elif mode == 'symmetric':
for axis, (pad_before, pad_after) in enumerate(pad_width):
# Recursive padding along any axis where `pad_amt` is too large
# for indexing tricks. We can only safely pad the original axis
# length, to keep the period of the reflections consistent.
method = kwargs['reflect_type']
safe_pad = newmat.shape[axis]
while ((pad_before > safe_pad) or
(pad_after > safe_pad)):
pad_iter_b = min(safe_pad,
safe_pad * (pad_before // safe_pad))
pad_iter_a = min(safe_pad, safe_pad * (pad_after // safe_pad))
newmat = _pad_sym(newmat, (pad_iter_b,
pad_iter_a), method, axis)
pad_before -= pad_iter_b
pad_after -= pad_iter_a
safe_pad += pad_iter_b + pad_iter_a
newmat = _pad_sym(newmat, (pad_before, pad_after), method, axis)
elif mode == 'wrap':
for axis, (pad_before, pad_after) in enumerate(pad_width):
# Recursive padding along any axis where `pad_amt` is too large
# for indexing tricks. We can only safely pad the original axis
# length, to keep the period of the reflections consistent.
safe_pad = newmat.shape[axis]
while ((pad_before > safe_pad) or
(pad_after > safe_pad)):
pad_iter_b = min(safe_pad,
safe_pad * (pad_before // safe_pad))
pad_iter_a = min(safe_pad, safe_pad * (pad_after // safe_pad))
newmat = _pad_wrap(newmat, (pad_iter_b, pad_iter_a), axis)
pad_before -= pad_iter_b
pad_after -= pad_iter_a
safe_pad += pad_iter_b + pad_iter_a
newmat = _pad_wrap(newmat, (pad_before, pad_after), axis)
return newmat
| 34.866489 | 79 | 0.579629 | from __future__ import division, absolute_import, print_function
import numpy as np
__all__ = ['pad']
t, axis)
slope = (end - edge_pad) / float(pad_amt)
ramp_arr = ramp_arr * slope
ramp_arr += edge_pad
_round_ifneeded(ramp_arr, arr.dtype)
return np.concatenate((ramp_arr.astype(arr.dtype), arr), axis=axis)
def _append_ramp(arr, pad_amt, end, axis=-1):
if pad_amt == 0:
return arr
padshape = tuple(x if i != axis else pad_amt
for (i, x) in enumerate(arr.shape))
ramp_arr = _arange_ndarray(arr, padshape, axis,
reverse=False).astype(np.float64)
edge_slice = tuple(slice(None) if i != axis else -1
for (i, x) in enumerate(arr.shape))
pad_singleton = tuple(x if i != axis else 1
for (i, x) in enumerate(arr.shape))
edge_pad = arr[edge_slice].reshape(pad_singleton).repeat(pad_amt, axis)
slope = (end - edge_pad) / float(pad_amt)
ramp_arr = ramp_arr * slope
ramp_arr += edge_pad
_round_ifneeded(ramp_arr, arr.dtype)
return np.concatenate((arr, ramp_arr.astype(arr.dtype)), axis=axis)
def _prepend_max(arr, pad_amt, num, axis=-1):
if pad_amt == 0:
return arr
if num == 1:
return _prepend_edge(arr, pad_amt, axis)
if num is not None:
if num >= arr.shape[axis]:
num = None
max_slice = tuple(slice(None) if i != axis else slice(num)
for (i, x) in enumerate(arr.shape))
pad_singleton = tuple(x if i != axis else 1
for (i, x) in enumerate(arr.shape))
max_chunk = arr[max_slice].max(axis=axis).reshape(pad_singleton)
return np.concatenate((max_chunk.repeat(pad_amt, axis=axis), arr),
axis=axis)
def _append_max(arr, pad_amt, num, axis=-1):
if pad_amt == 0:
return arr
if num == 1:
return _append_edge(arr, pad_amt, axis)
if num is not None:
if num >= arr.shape[axis]:
num = None
end = arr.shape[axis] - 1
if num is not None:
max_slice = tuple(
slice(None) if i != axis else slice(end, end - num, -1)
for (i, x) in enumerate(arr.shape))
else:
max_slice = tuple(slice(None) for x in arr.shape)
pad_singleton = tuple(x if i != axis else 1
for (i, x) in enumerate(arr.shape))
max_chunk = arr[max_slice].max(axis=axis).reshape(pad_singleton)
return np.concatenate((arr, max_chunk.repeat(pad_amt, axis=axis)),
axis=axis)
def _prepend_mean(arr, pad_amt, num, axis=-1):
if pad_amt == 0:
return arr
if num == 1:
return _prepend_edge(arr, pad_amt, axis)
if num is not None:
if num >= arr.shape[axis]:
num = None
mean_slice = tuple(slice(None) if i != axis else slice(num)
for (i, x) in enumerate(arr.shape))
pad_singleton = tuple(x if i != axis else 1
for (i, x) in enumerate(arr.shape))
mean_chunk = arr[mean_slice].mean(axis).reshape(pad_singleton)
_round_ifneeded(mean_chunk, arr.dtype)
return np.concatenate((mean_chunk.repeat(pad_amt, axis).astype(arr.dtype),
arr), axis=axis)
def _append_mean(arr, pad_amt, num, axis=-1):
if pad_amt == 0:
return arr
if num == 1:
return _append_edge(arr, pad_amt, axis)
if num is not None:
if num >= arr.shape[axis]:
num = None
end = arr.shape[axis] - 1
if num is not None:
mean_slice = tuple(
slice(None) if i != axis else slice(end, end - num, -1)
for (i, x) in enumerate(arr.shape))
else:
mean_slice = tuple(slice(None) for x in arr.shape)
pad_singleton = tuple(x if i != axis else 1
for (i, x) in enumerate(arr.shape))
mean_chunk = arr[mean_slice].mean(axis=axis).reshape(pad_singleton)
_round_ifneeded(mean_chunk, arr.dtype)
return np.concatenate(
(arr, mean_chunk.repeat(pad_amt, axis).astype(arr.dtype)), axis=axis)
def _prepend_med(arr, pad_amt, num, axis=-1):
if pad_amt == 0:
return arr
if num == 1:
return _prepend_edge(arr, pad_amt, axis)
if num is not None:
if num >= arr.shape[axis]:
num = None
med_slice = tuple(slice(None) if i != axis else slice(num)
for (i, x) in enumerate(arr.shape))
pad_singleton = tuple(x if i != axis else 1
for (i, x) in enumerate(arr.shape))
med_chunk = np.median(arr[med_slice], axis=axis).reshape(pad_singleton)
_round_ifneeded(med_chunk, arr.dtype)
return np.concatenate(
(med_chunk.repeat(pad_amt, axis).astype(arr.dtype), arr), axis=axis)
def _append_med(arr, pad_amt, num, axis=-1):
if pad_amt == 0:
return arr
if num == 1:
return _append_edge(arr, pad_amt, axis)
if num is not None:
if num >= arr.shape[axis]:
num = None
end = arr.shape[axis] - 1
if num is not None:
med_slice = tuple(
slice(None) if i != axis else slice(end, end - num, -1)
for (i, x) in enumerate(arr.shape))
else:
med_slice = tuple(slice(None) for x in arr.shape)
pad_singleton = tuple(x if i != axis else 1
for (i, x) in enumerate(arr.shape))
med_chunk = np.median(arr[med_slice], axis=axis).reshape(pad_singleton)
_round_ifneeded(med_chunk, arr.dtype)
return np.concatenate(
(arr, med_chunk.repeat(pad_amt, axis).astype(arr.dtype)), axis=axis)
def _prepend_min(arr, pad_amt, num, axis=-1):
if pad_amt == 0:
return arr
if num == 1:
return _prepend_edge(arr, pad_amt, axis)
if num is not None:
if num >= arr.shape[axis]:
num = None
min_slice = tuple(slice(None) if i != axis else slice(num)
for (i, x) in enumerate(arr.shape))
pad_singleton = tuple(x if i != axis else 1
for (i, x) in enumerate(arr.shape))
min_chunk = arr[min_slice].min(axis=axis).reshape(pad_singleton)
return np.concatenate((min_chunk.repeat(pad_amt, axis=axis), arr),
axis=axis)
def _append_min(arr, pad_amt, num, axis=-1):
if pad_amt == 0:
return arr
if num == 1:
return _append_edge(arr, pad_amt, axis)
if num is not None:
if num >= arr.shape[axis]:
num = None
end = arr.shape[axis] - 1
if num is not None:
min_slice = tuple(
slice(None) if i != axis else slice(end, end - num, -1)
for (i, x) in enumerate(arr.shape))
else:
min_slice = tuple(slice(None) for x in arr.shape)
pad_singleton = tuple(x if i != axis else 1
for (i, x) in enumerate(arr.shape))
min_chunk = arr[min_slice].min(axis=axis).reshape(pad_singleton)
return np.concatenate((arr, min_chunk.repeat(pad_amt, axis=axis)),
axis=axis)
def _pad_ref(arr, pad_amt, method, axis=-1):
if pad_amt[0] == 0 and pad_amt[1] == 0:
return arr
| true | true |
f70298a7b694786f2a04821421d50d8e82091c26 | 5,488 | py | Python | test/integration/src/py/test_bulk_transfers.py | emeseight/sifnode | cf52c0cf622fd5113c0a1a8f704e5f62ef3ae4c3 | [
"Apache-2.0"
] | 85 | 2020-10-24T07:35:55.000Z | 2022-03-27T10:27:55.000Z | test/integration/src/py/test_bulk_transfers.py | emeseight/sifnode | cf52c0cf622fd5113c0a1a8f704e5f62ef3ae4c3 | [
"Apache-2.0"
] | 1,760 | 2020-10-24T07:37:17.000Z | 2022-03-31T17:59:44.000Z | test/integration/src/py/test_bulk_transfers.py | emeseight/sifnode | cf52c0cf622fd5113c0a1a8f704e5f62ef3ae4c3 | [
"Apache-2.0"
] | 115 | 2020-10-31T07:32:38.000Z | 2022-03-29T21:12:25.000Z | import copy
import json
import logging
import pytest
import burn_lock_functions
import test_utilities
from integration_env_credentials import sifchain_cli_credentials_for_test
from pytest_utilities import generate_minimal_test_account
from test_utilities import EthereumToSifchainTransferRequest, SifchaincliCredentials
def create_new_sifaddr():
new_account_key = test_utilities.get_shell_output("uuidgen")
credentials = sifchain_cli_credentials_for_test(new_account_key)
new_addr = burn_lock_functions.create_new_sifaddr(credentials=credentials, keyname=new_account_key)
return new_addr["address"]
def create_new_sifaddr_and_key():
new_account_key = test_utilities.get_shell_output("uuidgen")
credentials = sifchain_cli_credentials_for_test(new_account_key)
new_addr = burn_lock_functions.create_new_sifaddr(credentials=credentials, keyname=new_account_key)
return new_addr["address"], new_addr["name"]
@pytest.mark.skip(reason="run manually")
def test_bulk_transfers(
basic_transfer_request: EthereumToSifchainTransferRequest,
smart_contracts_dir,
source_ethereum_address,
bridgebank_address,
bridgetoken_address,
ethereum_network,
):
n_transfers = int(test_utilities.get_optional_env_var("NTRANSFERS", 2))
ganache_delay = test_utilities.get_optional_env_var("GANACHE_DELAY", 1)
# test_utilities.get_shell_output(f"{integration_dir}/ganache_start.sh {ganache_delay}")
amount = "{:d}".format(5 * test_utilities.highest_gas_cost)
new_addresses_and_keys = list(map(lambda x: create_new_sifaddr_and_key(), range(n_transfers)))
logging.info(f"aandk: {new_addresses_and_keys}")
new_addresses = list(map(lambda a: a[0], new_addresses_and_keys))
logging.debug(f"new_addresses: {new_addresses}")
new_eth_addrs = test_utilities.create_ethereum_addresses(smart_contracts_dir, basic_transfer_request.ethereum_network, len(new_addresses))
logging.info(f"new eth addrs: {new_eth_addrs}")
request: EthereumToSifchainTransferRequest = copy.deepcopy(basic_transfer_request)
requests = list(map(lambda addr: {
"amount": amount,
"symbol": test_utilities.NULL_ADDRESS,
"sifchain_address": addr
}, new_addresses))
json_requests = json.dumps(requests)
test_utilities.run_yarn_command(
" ".join([
f"yarn --cwd {smart_contracts_dir}",
"integrationtest:sendBulkLockTx",
f"--amount {amount}",
f"--symbol eth",
f"--json_path {request.solidity_json_path}",
f"--sifchain_address {new_addresses[0]}",
f"--transactions \'{json_requests}\'",
f"--ethereum_address {source_ethereum_address}",
f"--bridgebank_address {bridgebank_address}",
f"--ethereum_network {ethereum_network}",
])
)
requests = list(map(lambda addr: {
"amount": amount,
"symbol": bridgetoken_address,
"sifchain_address": addr
}, new_addresses))
json_requests = json.dumps(requests)
yarn_result = test_utilities.run_yarn_command(
" ".join([
f"yarn --cwd {smart_contracts_dir}",
"integrationtest:sendBulkLockTx",
f"--amount {amount}",
"--lock_or_burn burn",
f"--symbol {bridgetoken_address}",
f"--json_path {request.solidity_json_path}",
f"--sifchain_address {new_addresses[0]}",
f"--transactions \'{json_requests}\'",
f"--ethereum_address {source_ethereum_address}",
f"--bridgebank_address {bridgebank_address}",
f"--ethereum_network {ethereum_network}",
])
)
logging.info(f"bulk result: {yarn_result}")
manual_advance = False
if manual_advance:
test_utilities.advance_n_ethereum_blocks(test_utilities.n_wait_blocks, smart_contracts_dir)
test_utilities.wait_for_ethereum_block_number(yarn_result["blockNumber"] + test_utilities.n_wait_blocks, basic_transfer_request);
for a in new_addresses:
test_utilities.wait_for_sif_account(a, basic_transfer_request.sifnoded_node, 90)
test_utilities.wait_for_sifchain_addr_balance(a, "ceth", amount, basic_transfer_request.sifnoded_node, 180)
test_utilities.wait_for_sifchain_addr_balance(a, "rowan", amount, basic_transfer_request.sifnoded_node, 180)
text_file = open("pfile.cmds", "w")
simple_credentials = SifchaincliCredentials(
keyring_passphrase=None,
keyring_backend="test",
from_key=None,
sifnoded_homedir=None
)
logging.info(f"all accounts are on sifchain and have the correct balance")
for sifaddr, ethaddr in zip(new_addresses_and_keys, new_eth_addrs):
r = copy.deepcopy(basic_transfer_request)
r.sifchain_address = sifaddr[0]
r.ethereum_address = ethaddr["address"]
r.amount = 100
simple_credentials.from_key = sifaddr[1]
c = test_utilities.send_from_sifchain_to_ethereum_cmd(r, simple_credentials)
text_file.write(f"{c}\n")
text_file.close()
# test_utilities.get_shell_output("cat pfile.cmds | parallel --trim lr -v {}")
test_utilities.get_shell_output("bash -x pfile.cmds")
for sifaddr, ethaddr in zip(new_addresses_and_keys, new_eth_addrs):
r = copy.deepcopy(basic_transfer_request)
r.ethereum_address = ethaddr["address"]
r.amount = 100
test_utilities.wait_for_eth_balance(r, 100, 300)
| 44.983607 | 142 | 0.714103 | import copy
import json
import logging
import pytest
import burn_lock_functions
import test_utilities
from integration_env_credentials import sifchain_cli_credentials_for_test
from pytest_utilities import generate_minimal_test_account
from test_utilities import EthereumToSifchainTransferRequest, SifchaincliCredentials
def create_new_sifaddr():
new_account_key = test_utilities.get_shell_output("uuidgen")
credentials = sifchain_cli_credentials_for_test(new_account_key)
new_addr = burn_lock_functions.create_new_sifaddr(credentials=credentials, keyname=new_account_key)
return new_addr["address"]
def create_new_sifaddr_and_key():
new_account_key = test_utilities.get_shell_output("uuidgen")
credentials = sifchain_cli_credentials_for_test(new_account_key)
new_addr = burn_lock_functions.create_new_sifaddr(credentials=credentials, keyname=new_account_key)
return new_addr["address"], new_addr["name"]
@pytest.mark.skip(reason="run manually")
def test_bulk_transfers(
basic_transfer_request: EthereumToSifchainTransferRequest,
smart_contracts_dir,
source_ethereum_address,
bridgebank_address,
bridgetoken_address,
ethereum_network,
):
n_transfers = int(test_utilities.get_optional_env_var("NTRANSFERS", 2))
ganache_delay = test_utilities.get_optional_env_var("GANACHE_DELAY", 1)
amount = "{:d}".format(5 * test_utilities.highest_gas_cost)
new_addresses_and_keys = list(map(lambda x: create_new_sifaddr_and_key(), range(n_transfers)))
logging.info(f"aandk: {new_addresses_and_keys}")
new_addresses = list(map(lambda a: a[0], new_addresses_and_keys))
logging.debug(f"new_addresses: {new_addresses}")
new_eth_addrs = test_utilities.create_ethereum_addresses(smart_contracts_dir, basic_transfer_request.ethereum_network, len(new_addresses))
logging.info(f"new eth addrs: {new_eth_addrs}")
request: EthereumToSifchainTransferRequest = copy.deepcopy(basic_transfer_request)
requests = list(map(lambda addr: {
"amount": amount,
"symbol": test_utilities.NULL_ADDRESS,
"sifchain_address": addr
}, new_addresses))
json_requests = json.dumps(requests)
test_utilities.run_yarn_command(
" ".join([
f"yarn --cwd {smart_contracts_dir}",
"integrationtest:sendBulkLockTx",
f"--amount {amount}",
f"--symbol eth",
f"--json_path {request.solidity_json_path}",
f"--sifchain_address {new_addresses[0]}",
f"--transactions \'{json_requests}\'",
f"--ethereum_address {source_ethereum_address}",
f"--bridgebank_address {bridgebank_address}",
f"--ethereum_network {ethereum_network}",
])
)
requests = list(map(lambda addr: {
"amount": amount,
"symbol": bridgetoken_address,
"sifchain_address": addr
}, new_addresses))
json_requests = json.dumps(requests)
yarn_result = test_utilities.run_yarn_command(
" ".join([
f"yarn --cwd {smart_contracts_dir}",
"integrationtest:sendBulkLockTx",
f"--amount {amount}",
"--lock_or_burn burn",
f"--symbol {bridgetoken_address}",
f"--json_path {request.solidity_json_path}",
f"--sifchain_address {new_addresses[0]}",
f"--transactions \'{json_requests}\'",
f"--ethereum_address {source_ethereum_address}",
f"--bridgebank_address {bridgebank_address}",
f"--ethereum_network {ethereum_network}",
])
)
logging.info(f"bulk result: {yarn_result}")
manual_advance = False
if manual_advance:
test_utilities.advance_n_ethereum_blocks(test_utilities.n_wait_blocks, smart_contracts_dir)
test_utilities.wait_for_ethereum_block_number(yarn_result["blockNumber"] + test_utilities.n_wait_blocks, basic_transfer_request);
for a in new_addresses:
test_utilities.wait_for_sif_account(a, basic_transfer_request.sifnoded_node, 90)
test_utilities.wait_for_sifchain_addr_balance(a, "ceth", amount, basic_transfer_request.sifnoded_node, 180)
test_utilities.wait_for_sifchain_addr_balance(a, "rowan", amount, basic_transfer_request.sifnoded_node, 180)
text_file = open("pfile.cmds", "w")
simple_credentials = SifchaincliCredentials(
keyring_passphrase=None,
keyring_backend="test",
from_key=None,
sifnoded_homedir=None
)
logging.info(f"all accounts are on sifchain and have the correct balance")
for sifaddr, ethaddr in zip(new_addresses_and_keys, new_eth_addrs):
r = copy.deepcopy(basic_transfer_request)
r.sifchain_address = sifaddr[0]
r.ethereum_address = ethaddr["address"]
r.amount = 100
simple_credentials.from_key = sifaddr[1]
c = test_utilities.send_from_sifchain_to_ethereum_cmd(r, simple_credentials)
text_file.write(f"{c}\n")
text_file.close()
test_utilities.get_shell_output("bash -x pfile.cmds")
for sifaddr, ethaddr in zip(new_addresses_and_keys, new_eth_addrs):
r = copy.deepcopy(basic_transfer_request)
r.ethereum_address = ethaddr["address"]
r.amount = 100
test_utilities.wait_for_eth_balance(r, 100, 300)
| true | true |
f702992dc148b3f53c8d0340cf67d9897004131c | 5,174 | py | Python | src/pip/_internal/build_env.py | atse/pip | b47b2fa8e6a70f2d8c93b14a1292bf6eb82b6355 | [
"MIT"
] | null | null | null | src/pip/_internal/build_env.py | atse/pip | b47b2fa8e6a70f2d8c93b14a1292bf6eb82b6355 | [
"MIT"
] | null | null | null | src/pip/_internal/build_env.py | atse/pip | b47b2fa8e6a70f2d8c93b14a1292bf6eb82b6355 | [
"MIT"
] | null | null | null | """Build Environment used for isolation during sdist building
"""
import logging
import os
import sys
import textwrap
from distutils.sysconfig import get_python_lib
from sysconfig import get_paths
from pip._vendor.pkg_resources import Requirement, VersionConflict, WorkingSet
from pip import __file__ as pip_location
from pip._internal.utils.misc import call_subprocess
from pip._internal.utils.temp_dir import TempDirectory
from pip._internal.utils.ui import open_spinner
logger = logging.getLogger(__name__)
class BuildEnvironment(object):
"""Creates and manages an isolated environment to install build deps
"""
def __init__(self):
self._temp_dir = TempDirectory(kind="build-env")
self._temp_dir.create()
@property
def path(self):
return self._temp_dir.path
def __enter__(self):
self.save_path = os.environ.get('PATH', None)
self.save_pythonpath = os.environ.get('PYTHONPATH', None)
self.save_nousersite = os.environ.get('PYTHONNOUSERSITE', None)
install_scheme = 'nt' if (os.name == 'nt') else 'posix_prefix'
install_dirs = get_paths(install_scheme, vars={
'base': self.path,
'platbase': self.path,
})
scripts = install_dirs['scripts']
if self.save_path:
os.environ['PATH'] = scripts + os.pathsep + self.save_path
else:
os.environ['PATH'] = scripts + os.pathsep + os.defpath
# Note: prefer distutils' sysconfig to get the
# library paths so PyPy is correctly supported.
purelib = get_python_lib(plat_specific=0, prefix=self.path)
platlib = get_python_lib(plat_specific=1, prefix=self.path)
if purelib == platlib:
lib_dirs = purelib
else:
lib_dirs = purelib + os.pathsep + platlib
if self.save_pythonpath:
os.environ['PYTHONPATH'] = lib_dirs + os.pathsep + \
self.save_pythonpath
else:
os.environ['PYTHONPATH'] = lib_dirs
os.environ['PYTHONNOUSERSITE'] = '1'
# Ensure .pth files are honored.
with open(os.path.join(purelib, 'sitecustomize.py'), 'w') as fp:
fp.write(textwrap.dedent(
'''
import site
site.addsitedir({!r})
'''
).format(purelib))
return self.path
def __exit__(self, exc_type, exc_val, exc_tb):
def restore_var(varname, old_value):
if old_value is None:
os.environ.pop(varname, None)
else:
os.environ[varname] = old_value
restore_var('PATH', self.save_path)
restore_var('PYTHONPATH', self.save_pythonpath)
restore_var('PYTHONNOUSERSITE', self.save_nousersite)
def cleanup(self):
self._temp_dir.cleanup()
def missing_requirements(self, reqs):
"""Return a list of the requirements from reqs that are not present
"""
missing = []
with self:
ws = WorkingSet(os.environ["PYTHONPATH"].split(os.pathsep))
for req in reqs:
try:
if ws.find(Requirement.parse(req)) is None:
missing.append(req)
except VersionConflict:
missing.append(req)
return missing
def install_requirements(self, finder, requirements, message):
args = [
sys.executable, os.path.dirname(pip_location), 'install',
'--ignore-installed', '--no-user', '--prefix', self.path,
'--no-warn-script-location',
]
if logger.getEffectiveLevel() <= logging.DEBUG:
args.append('-v')
for format_control in ('no_binary', 'only_binary'):
formats = getattr(finder.format_control, format_control)
args.extend(('--' + format_control.replace('_', '-'),
','.join(sorted(formats or {':none:'}))))
if finder.index_urls:
args.extend(['-i', finder.index_urls[0]])
for extra_index in finder.index_urls[1:]:
args.extend(['--extra-index-url', extra_index])
else:
args.append('--no-index')
for link in finder.find_links:
args.extend(['--find-links', link])
for _, host, _ in finder.secure_origins:
args.extend(['--trusted-host', host])
if finder.allow_all_prereleases:
args.append('--pre')
if finder.process_dependency_links:
args.append('--process-dependency-links')
args.append('--')
args.extend(requirements)
with open_spinner(message) as spinner:
call_subprocess(args, show_stdout=False, spinner=spinner)
class NoOpBuildEnvironment(BuildEnvironment):
"""A no-op drop-in replacement for BuildEnvironment
"""
def __init__(self):
pass
def __enter__(self):
pass
def __exit__(self, exc_type, exc_val, exc_tb):
pass
def cleanup(self):
pass
def install_requirements(self, finder, requirements, message):
raise NotImplementedError()
| 33.380645 | 78 | 0.603402 |
import logging
import os
import sys
import textwrap
from distutils.sysconfig import get_python_lib
from sysconfig import get_paths
from pip._vendor.pkg_resources import Requirement, VersionConflict, WorkingSet
from pip import __file__ as pip_location
from pip._internal.utils.misc import call_subprocess
from pip._internal.utils.temp_dir import TempDirectory
from pip._internal.utils.ui import open_spinner
logger = logging.getLogger(__name__)
class BuildEnvironment(object):
def __init__(self):
self._temp_dir = TempDirectory(kind="build-env")
self._temp_dir.create()
@property
def path(self):
return self._temp_dir.path
def __enter__(self):
self.save_path = os.environ.get('PATH', None)
self.save_pythonpath = os.environ.get('PYTHONPATH', None)
self.save_nousersite = os.environ.get('PYTHONNOUSERSITE', None)
install_scheme = 'nt' if (os.name == 'nt') else 'posix_prefix'
install_dirs = get_paths(install_scheme, vars={
'base': self.path,
'platbase': self.path,
})
scripts = install_dirs['scripts']
if self.save_path:
os.environ['PATH'] = scripts + os.pathsep + self.save_path
else:
os.environ['PATH'] = scripts + os.pathsep + os.defpath
# library paths so PyPy is correctly supported.
purelib = get_python_lib(plat_specific=0, prefix=self.path)
platlib = get_python_lib(plat_specific=1, prefix=self.path)
if purelib == platlib:
lib_dirs = purelib
else:
lib_dirs = purelib + os.pathsep + platlib
if self.save_pythonpath:
os.environ['PYTHONPATH'] = lib_dirs + os.pathsep + \
self.save_pythonpath
else:
os.environ['PYTHONPATH'] = lib_dirs
os.environ['PYTHONNOUSERSITE'] = '1'
# Ensure .pth files are honored.
with open(os.path.join(purelib, 'sitecustomize.py'), 'w') as fp:
fp.write(textwrap.dedent(
'''
import site
site.addsitedir({!r})
'''
).format(purelib))
return self.path
def __exit__(self, exc_type, exc_val, exc_tb):
def restore_var(varname, old_value):
if old_value is None:
os.environ.pop(varname, None)
else:
os.environ[varname] = old_value
restore_var('PATH', self.save_path)
restore_var('PYTHONPATH', self.save_pythonpath)
restore_var('PYTHONNOUSERSITE', self.save_nousersite)
def cleanup(self):
self._temp_dir.cleanup()
def missing_requirements(self, reqs):
missing = []
with self:
ws = WorkingSet(os.environ["PYTHONPATH"].split(os.pathsep))
for req in reqs:
try:
if ws.find(Requirement.parse(req)) is None:
missing.append(req)
except VersionConflict:
missing.append(req)
return missing
def install_requirements(self, finder, requirements, message):
args = [
sys.executable, os.path.dirname(pip_location), 'install',
'--ignore-installed', '--no-user', '--prefix', self.path,
'--no-warn-script-location',
]
if logger.getEffectiveLevel() <= logging.DEBUG:
args.append('-v')
for format_control in ('no_binary', 'only_binary'):
formats = getattr(finder.format_control, format_control)
args.extend(('--' + format_control.replace('_', '-'),
','.join(sorted(formats or {':none:'}))))
if finder.index_urls:
args.extend(['-i', finder.index_urls[0]])
for extra_index in finder.index_urls[1:]:
args.extend(['--extra-index-url', extra_index])
else:
args.append('--no-index')
for link in finder.find_links:
args.extend(['--find-links', link])
for _, host, _ in finder.secure_origins:
args.extend(['--trusted-host', host])
if finder.allow_all_prereleases:
args.append('--pre')
if finder.process_dependency_links:
args.append('--process-dependency-links')
args.append('--')
args.extend(requirements)
with open_spinner(message) as spinner:
call_subprocess(args, show_stdout=False, spinner=spinner)
class NoOpBuildEnvironment(BuildEnvironment):
def __init__(self):
pass
def __enter__(self):
pass
def __exit__(self, exc_type, exc_val, exc_tb):
pass
def cleanup(self):
pass
def install_requirements(self, finder, requirements, message):
raise NotImplementedError()
| true | true |
f70299a27cf778ccd0e0029d544c3610372d7746 | 5,483 | py | Python | src/negotiating_agent/test_agent/TU-Delft-Collaborative-AI-Negotiation/agents/random_agent/random_agent.py | HahaBill/CollaborativeAI | f771cd2f34774c74c58e49a7e983d6244ea35eff | [
"MIT"
] | 1 | 2022-02-17T19:14:46.000Z | 2022-02-17T19:14:46.000Z | src/negotiating_agent/test_agent/TU-Delft-Collaborative-AI-Negotiation/agents/random_agent/random_agent.py | HahaBill/CollaborativeAI | f771cd2f34774c74c58e49a7e983d6244ea35eff | [
"MIT"
] | null | null | null | src/negotiating_agent/test_agent/TU-Delft-Collaborative-AI-Negotiation/agents/random_agent/random_agent.py | HahaBill/CollaborativeAI | f771cd2f34774c74c58e49a7e983d6244ea35eff | [
"MIT"
] | null | null | null | import logging
from random import randint
import traceback
from typing import cast, Dict, List, Set, Collection
from geniusweb.actions.Accept import Accept
from geniusweb.actions.Action import Action
from geniusweb.actions.LearningDone import LearningDone
from geniusweb.actions.Offer import Offer
from geniusweb.actions.PartyId import PartyId
from geniusweb.actions.Vote import Vote
from geniusweb.actions.Votes import Votes
from geniusweb.bidspace.AllBidsList import AllBidsList
from geniusweb.inform.ActionDone import ActionDone
from geniusweb.inform.Finished import Finished
from geniusweb.inform.Inform import Inform
from geniusweb.inform.OptIn import OptIn
from geniusweb.inform.Settings import Settings
from geniusweb.inform.Voting import Voting
from geniusweb.inform.YourTurn import YourTurn
from geniusweb.issuevalue.Bid import Bid
from geniusweb.issuevalue.Domain import Domain
from geniusweb.issuevalue.Value import Value
from geniusweb.issuevalue.ValueSet import ValueSet
from geniusweb.party.Capabilities import Capabilities
from geniusweb.party.DefaultParty import DefaultParty
from geniusweb.profile.utilityspace.UtilitySpace import UtilitySpace
from geniusweb.profileconnection.ProfileConnectionFactory import (
ProfileConnectionFactory,
)
from geniusweb.progress.ProgressRounds import ProgressRounds
from geniusweb.utils import val
class RandomAgent(DefaultParty):
"""
Offers random bids until a bid with sufficient utility is offered.
"""
def __init__(self):
super().__init__()
self.getReporter().log(logging.INFO, "party is initialized")
self._profile = None
self._lastReceivedBid: Bid = None
# Override
def notifyChange(self, info: Inform):
# self.getReporter().log(logging.INFO,"received info:"+str(info))
if isinstance(info, Settings):
self._settings: Settings = cast(Settings, info)
self._me = self._settings.getID()
self._protocol: str = str(self._settings.getProtocol().getURI())
self._progress = self._settings.getProgress()
if "Learn" == self._protocol:
self.getConnection().send(LearningDone(self._me)) # type:ignore
else:
self._profile = ProfileConnectionFactory.create(
info.getProfile().getURI(), self.getReporter()
)
elif isinstance(info, ActionDone):
action: Action = cast(ActionDone, info).getAction()
if isinstance(action, Offer):
self._lastReceivedBid = cast(Offer, action).getBid()
elif isinstance(info, YourTurn):
self._myTurn()
if isinstance(self._progress, ProgressRounds):
self._progress = self._progress.advance()
elif isinstance(info, Finished):
self.terminate()
elif isinstance(info, Voting):
# MOPAC protocol
self._lastvotes = self._vote(cast(Voting, info))
val(self.getConnection()).send(self._lastvotes)
elif isinstance(info, OptIn):
val(self.getConnection()).send(self._lastvotes)
else:
self.getReporter().log(
logging.WARNING, "Ignoring unknown info " + str(info)
)
# Override
def getCapabilities(self) -> Capabilities:
return Capabilities(
set(["SAOP", "Learn", "MOPAC"]),
set(["geniusweb.profile.utilityspace.LinearAdditive"]),
)
# Override
def getDescription(self) -> str:
return "Offers random bids until a bid with sufficient utility is offered. Parameters minPower and maxPower can be used to control voting behaviour."
# Override
def terminate(self):
self.getReporter().log(logging.INFO, "party is terminating:")
super().terminate()
if self._profile != None:
self._profile.close()
self._profile = None
def _myTurn(self):
if self._isGood(self._lastReceivedBid):
action = Accept(self._me, self._lastReceivedBid)
else:
for _attempt in range(20):
bid = self._getRandomBid(self._profile.getProfile().getDomain())
if self._isGood(bid):
break
action = Offer(self._me, bid)
self.getConnection().send(action)
def _isGood(self, bid: Bid) -> bool:
if bid == None:
return False
profile = self._profile.getProfile()
if isinstance(profile, UtilitySpace):
return profile.getUtility(bid) > 0.6
raise Exception("Can not handle this type of profile")
def _getRandomBid(self, domain: Domain) -> Bid:
allBids = AllBidsList(domain)
return allBids.get(randint(0, allBids.size() - 1))
def _vote(self, voting: Voting) -> Votes:
"""
@param voting the {@link Voting} object containing the options
@return our next Votes.
"""
val = self._settings.getParameters().get("minPower")
minpower: int = val if isinstance(val, int) else 2
val = self._settings.getParameters().get("maxPower")
maxpower: int = val if isinstance(val, int) else 9999999
votes: Set[Vote] = set(
[
Vote(self._me, offer.getBid(), minpower, maxpower)
for offer in voting.getOffers()
if self._isGood(offer.getBid())
]
)
return Votes(self._me, votes)
| 38.612676 | 157 | 0.655116 | import logging
from random import randint
import traceback
from typing import cast, Dict, List, Set, Collection
from geniusweb.actions.Accept import Accept
from geniusweb.actions.Action import Action
from geniusweb.actions.LearningDone import LearningDone
from geniusweb.actions.Offer import Offer
from geniusweb.actions.PartyId import PartyId
from geniusweb.actions.Vote import Vote
from geniusweb.actions.Votes import Votes
from geniusweb.bidspace.AllBidsList import AllBidsList
from geniusweb.inform.ActionDone import ActionDone
from geniusweb.inform.Finished import Finished
from geniusweb.inform.Inform import Inform
from geniusweb.inform.OptIn import OptIn
from geniusweb.inform.Settings import Settings
from geniusweb.inform.Voting import Voting
from geniusweb.inform.YourTurn import YourTurn
from geniusweb.issuevalue.Bid import Bid
from geniusweb.issuevalue.Domain import Domain
from geniusweb.issuevalue.Value import Value
from geniusweb.issuevalue.ValueSet import ValueSet
from geniusweb.party.Capabilities import Capabilities
from geniusweb.party.DefaultParty import DefaultParty
from geniusweb.profile.utilityspace.UtilitySpace import UtilitySpace
from geniusweb.profileconnection.ProfileConnectionFactory import (
ProfileConnectionFactory,
)
from geniusweb.progress.ProgressRounds import ProgressRounds
from geniusweb.utils import val
class RandomAgent(DefaultParty):
def __init__(self):
super().__init__()
self.getReporter().log(logging.INFO, "party is initialized")
self._profile = None
self._lastReceivedBid: Bid = None
def notifyChange(self, info: Inform):
if isinstance(info, Settings):
self._settings: Settings = cast(Settings, info)
self._me = self._settings.getID()
self._protocol: str = str(self._settings.getProtocol().getURI())
self._progress = self._settings.getProgress()
if "Learn" == self._protocol:
self.getConnection().send(LearningDone(self._me))
else:
self._profile = ProfileConnectionFactory.create(
info.getProfile().getURI(), self.getReporter()
)
elif isinstance(info, ActionDone):
action: Action = cast(ActionDone, info).getAction()
if isinstance(action, Offer):
self._lastReceivedBid = cast(Offer, action).getBid()
elif isinstance(info, YourTurn):
self._myTurn()
if isinstance(self._progress, ProgressRounds):
self._progress = self._progress.advance()
elif isinstance(info, Finished):
self.terminate()
elif isinstance(info, Voting):
self._lastvotes = self._vote(cast(Voting, info))
val(self.getConnection()).send(self._lastvotes)
elif isinstance(info, OptIn):
val(self.getConnection()).send(self._lastvotes)
else:
self.getReporter().log(
logging.WARNING, "Ignoring unknown info " + str(info)
)
def getCapabilities(self) -> Capabilities:
return Capabilities(
set(["SAOP", "Learn", "MOPAC"]),
set(["geniusweb.profile.utilityspace.LinearAdditive"]),
)
def getDescription(self) -> str:
return "Offers random bids until a bid with sufficient utility is offered. Parameters minPower and maxPower can be used to control voting behaviour."
def terminate(self):
self.getReporter().log(logging.INFO, "party is terminating:")
super().terminate()
if self._profile != None:
self._profile.close()
self._profile = None
def _myTurn(self):
if self._isGood(self._lastReceivedBid):
action = Accept(self._me, self._lastReceivedBid)
else:
for _attempt in range(20):
bid = self._getRandomBid(self._profile.getProfile().getDomain())
if self._isGood(bid):
break
action = Offer(self._me, bid)
self.getConnection().send(action)
def _isGood(self, bid: Bid) -> bool:
if bid == None:
return False
profile = self._profile.getProfile()
if isinstance(profile, UtilitySpace):
return profile.getUtility(bid) > 0.6
raise Exception("Can not handle this type of profile")
def _getRandomBid(self, domain: Domain) -> Bid:
allBids = AllBidsList(domain)
return allBids.get(randint(0, allBids.size() - 1))
def _vote(self, voting: Voting) -> Votes:
val = self._settings.getParameters().get("minPower")
minpower: int = val if isinstance(val, int) else 2
val = self._settings.getParameters().get("maxPower")
maxpower: int = val if isinstance(val, int) else 9999999
votes: Set[Vote] = set(
[
Vote(self._me, offer.getBid(), minpower, maxpower)
for offer in voting.getOffers()
if self._isGood(offer.getBid())
]
)
return Votes(self._me, votes)
| true | true |
f70299a88cbcaeb559e7429ab61fc8c936bbdd40 | 475 | py | Python | src/constants.py | inwe-boku/windpower-decomposition-usa | e7b11c9fffc4864d2e4f3cb7e4c6f3cfaf469ff7 | [
"MIT"
] | null | null | null | src/constants.py | inwe-boku/windpower-decomposition-usa | e7b11c9fffc4864d2e4f3cb7e4c6f3cfaf469ff7 | [
"MIT"
] | null | null | null | src/constants.py | inwe-boku/windpower-decomposition-usa | e7b11c9fffc4864d2e4f3cb7e4c6f3cfaf469ff7 | [
"MIT"
] | null | null | null | METER_TO_KM = 1e-3
ONE_TO_KILO = 1e3
KM_TO_METER = 1e3
KILO_TO_ONE = 1e3
# Average earth radius, see https://en.wikipedia.org/wiki/Earth_radius
EARTH_RADIUS_KM = 6371.0088
# in reality air density varies between 1.14 and 1.42 in kg/m^3
AIR_DENSITY_RHO = 1.225
# of course this introduces a small mistake due to leap years, but in average it's quite ok
# Warning: in most cases it might be better to use mean() instead of sum()/HOURS_PER_YEAR
HOURS_PER_YEAR = 8765.812536
| 29.6875 | 91 | 0.766316 | METER_TO_KM = 1e-3
ONE_TO_KILO = 1e3
KM_TO_METER = 1e3
KILO_TO_ONE = 1e3
EARTH_RADIUS_KM = 6371.0088
AIR_DENSITY_RHO = 1.225
# Warning: in most cases it might be better to use mean() instead of sum()/HOURS_PER_YEAR
HOURS_PER_YEAR = 8765.812536
| true | true |
f70299afa9fb9cd0c528109e36d8380ed2dbcbe6 | 1,064 | py | Python | Python/add-binary.py | sm2774us/leetcode_interview_prep_2021 | 33b41bea66c266b733372d9a8b9d2965cd88bf8c | [
"Fair"
] | null | null | null | Python/add-binary.py | sm2774us/leetcode_interview_prep_2021 | 33b41bea66c266b733372d9a8b9d2965cd88bf8c | [
"Fair"
] | null | null | null | Python/add-binary.py | sm2774us/leetcode_interview_prep_2021 | 33b41bea66c266b733372d9a8b9d2965cd88bf8c | [
"Fair"
] | null | null | null | # Time: O(n)
# Space: O(1)
class Solution(object):
# @param a, a string
# @param b, a string
# @return a string
def addBinary(self, a, b):
result, carry, val = "", 0, 0
for i in range(max(len(a), len(b))):
val = carry
if i < len(a):
val += int(a[-(i + 1)])
if i < len(b):
val += int(b[-(i + 1)])
carry, val = divmod(val, 2)
result += str(val)
if carry:
result += str(carry)
return result[::-1]
# Time: O(n)
# Space: O(1)
from itertools import zip_longest
class Solution2(object):
def addBinary(self, a, b):
"""
:type a: str
:type b: str
:rtype: str
"""
result = ""
carry = 0
for x, y in zip_longest(reversed(a), reversed(b), fillvalue="0"):
carry, remainder = divmod(int(x)+int(y)+carry, 2)
result += str(remainder)
if carry:
result += str(carry)
return result[::-1]
| 23.644444 | 73 | 0.451128 |
class Solution(object):
def addBinary(self, a, b):
result, carry, val = "", 0, 0
for i in range(max(len(a), len(b))):
val = carry
if i < len(a):
val += int(a[-(i + 1)])
if i < len(b):
val += int(b[-(i + 1)])
carry, val = divmod(val, 2)
result += str(val)
if carry:
result += str(carry)
return result[::-1]
from itertools import zip_longest
class Solution2(object):
def addBinary(self, a, b):
result = ""
carry = 0
for x, y in zip_longest(reversed(a), reversed(b), fillvalue="0"):
carry, remainder = divmod(int(x)+int(y)+carry, 2)
result += str(remainder)
if carry:
result += str(carry)
return result[::-1]
| true | true |
f7029ae637a41736ba37b57a855102b48c280817 | 111,937 | py | Python | sympy/core/tests/test_args.py | nishithshah2211/sympy | edc620ca662f7163637c7fb5823f22523b7f2fe9 | [
"BSD-3-Clause"
] | 1 | 2019-06-27T13:40:28.000Z | 2019-06-27T13:40:28.000Z | sympy/core/tests/test_args.py | amitsaha/sympy | 43ddfc644fd604a3dc0d4cac0aebfecd051917c1 | [
"BSD-3-Clause"
] | null | null | null | sympy/core/tests/test_args.py | amitsaha/sympy | 43ddfc644fd604a3dc0d4cac0aebfecd051917c1 | [
"BSD-3-Clause"
] | null | null | null | """Test whether all elements of cls.args are instances of Basic. """
# NOTE: keep tests sorted by (module, class name) key. If a class can't
# be instantiated, add it here anyway with @SKIP("abstract class) (see
# e.g. Function).
import os
import re
import warnings
import io
from sympy import Basic, S, symbols, sqrt, sin, oo, Interval, exp
from sympy.core.compatibility import range
from sympy.utilities.pytest import XFAIL, SKIP
from sympy.utilities.exceptions import SymPyDeprecationWarning
x, y, z = symbols('x,y,z')
def test_all_classes_are_tested():
this = os.path.split(__file__)[0]
path = os.path.join(this, os.pardir, os.pardir)
sympy_path = os.path.abspath(path)
prefix = os.path.split(sympy_path)[0] + os.sep
re_cls = re.compile("^class ([A-Za-z][A-Za-z0-9_]*)\s*\(", re.MULTILINE)
modules = {}
for root, dirs, files in os.walk(sympy_path):
module = root.replace(prefix, "").replace(os.sep, ".")
for file in files:
if file.startswith(("_", "test_", "bench_")):
continue
if not file.endswith(".py"):
continue
with io.open(os.path.join(root, file), "r", encoding='utf-8') as f:
text = f.read()
submodule = module + '.' + file[:-3]
names = re_cls.findall(text)
if not names:
continue
try:
mod = __import__(submodule, fromlist=names)
except ImportError:
continue
def is_Basic(name):
cls = getattr(mod, name)
return issubclass(cls, Basic)
names = list(filter(is_Basic, names))
if names:
modules[submodule] = names
ns = globals()
failed = []
for module, names in modules.items():
mod = module.replace('.', '__')
for name in names:
test = 'test_' + mod + '__' + name
if test not in ns:
failed.append(module + '.' + name)
# reset all SymPyDeprecationWarning into errors
warnings.simplefilter("error", category=SymPyDeprecationWarning)
assert not failed, "Missing classes: %s. Please add tests for these to sympy/core/tests/test_args.py." % ", ".join(failed)
def _test_args(obj):
return all(isinstance(arg, Basic) for arg in obj.args)
def test_sympy__assumptions__assume__AppliedPredicate():
from sympy.assumptions.assume import AppliedPredicate, Predicate
assert _test_args(AppliedPredicate(Predicate("test"), 2))
def test_sympy__assumptions__assume__Predicate():
from sympy.assumptions.assume import Predicate
assert _test_args(Predicate("test"))
@XFAIL
def test_sympy__combinatorics__graycode__GrayCode():
from sympy.combinatorics.graycode import GrayCode
# an integer is given and returned from GrayCode as the arg
assert _test_args(GrayCode(3, start='100'))
assert _test_args(GrayCode(3, rank=1))
def test_sympy__combinatorics__subsets__Subset():
from sympy.combinatorics.subsets import Subset
assert _test_args(Subset([0, 1], [0, 1, 2, 3]))
assert _test_args(Subset(['c', 'd'], ['a', 'b', 'c', 'd']))
@XFAIL
def test_sympy__combinatorics__permutations__Permutation():
from sympy.combinatorics.permutations import Permutation
assert _test_args(Permutation([0, 1, 2, 3]))
def test_sympy__combinatorics__perm_groups__PermutationGroup():
from sympy.combinatorics.permutations import Permutation
from sympy.combinatorics.perm_groups import PermutationGroup
assert _test_args(PermutationGroup([Permutation([0, 1])]))
def test_sympy__combinatorics__polyhedron__Polyhedron():
from sympy.combinatorics.permutations import Permutation
from sympy.combinatorics.polyhedron import Polyhedron
from sympy.abc import w, x, y, z
pgroup = [Permutation([[0, 1, 2], [3]]),
Permutation([[0, 1, 3], [2]]),
Permutation([[0, 2, 3], [1]]),
Permutation([[1, 2, 3], [0]]),
Permutation([[0, 1], [2, 3]]),
Permutation([[0, 2], [1, 3]]),
Permutation([[0, 3], [1, 2]]),
Permutation([[0, 1, 2, 3]])]
corners = [w, x, y, z]
faces = [(w, x, y), (w, y, z), (w, z, x), (x, y, z)]
assert _test_args(Polyhedron(corners, faces, pgroup))
@XFAIL
def test_sympy__combinatorics__prufer__Prufer():
from sympy.combinatorics.prufer import Prufer
assert _test_args(Prufer([[0, 1], [0, 2], [0, 3]], 4))
def test_sympy__combinatorics__partitions__Partition():
from sympy.combinatorics.partitions import Partition
assert _test_args(Partition([1]))
@XFAIL
def test_sympy__combinatorics__partitions__IntegerPartition():
from sympy.combinatorics.partitions import IntegerPartition
assert _test_args(IntegerPartition([1]))
def test_sympy__concrete__products__Product():
from sympy.concrete.products import Product
assert _test_args(Product(x, (x, 0, 10)))
assert _test_args(Product(x, (x, 0, y), (y, 0, 10)))
@SKIP("abstract Class")
def test_sympy__concrete__expr_with_limits__ExprWithLimits():
from sympy.concrete.expr_with_limits import ExprWithLimits
assert _test_args(ExprWithLimits(x, (x, 0, 10)))
assert _test_args(ExprWithLimits(x*y, (x, 0, 10.),(y,1.,3)))
@SKIP("abstract Class")
def test_sympy__concrete__expr_with_limits__AddWithLimits():
from sympy.concrete.expr_with_limits import AddWithLimits
assert _test_args(AddWithLimits(x, (x, 0, 10)))
assert _test_args(AddWithLimits(x*y, (x, 0, 10),(y,1,3)))
@SKIP("abstract Class")
def test_sympy__concrete__expr_with_intlimits__ExprWithIntLimits():
from sympy.concrete.expr_with_intlimits import ExprWithIntLimits
assert _test_args(ExprWithIntLimits(x, (x, 0, 10)))
assert _test_args(ExprWithIntLimits(x*y, (x, 0, 10),(y,1,3)))
def test_sympy__concrete__summations__Sum():
from sympy.concrete.summations import Sum
assert _test_args(Sum(x, (x, 0, 10)))
assert _test_args(Sum(x, (x, 0, y), (y, 0, 10)))
def test_sympy__core__add__Add():
from sympy.core.add import Add
assert _test_args(Add(x, y, z, 2))
def test_sympy__core__basic__Atom():
from sympy.core.basic import Atom
assert _test_args(Atom())
def test_sympy__core__basic__Basic():
from sympy.core.basic import Basic
assert _test_args(Basic())
def test_sympy__core__containers__Dict():
from sympy.core.containers import Dict
assert _test_args(Dict({x: y, y: z}))
def test_sympy__core__containers__Tuple():
from sympy.core.containers import Tuple
assert _test_args(Tuple(x, y, z, 2))
def test_sympy__core__expr__AtomicExpr():
from sympy.core.expr import AtomicExpr
assert _test_args(AtomicExpr())
def test_sympy__core__expr__Expr():
from sympy.core.expr import Expr
assert _test_args(Expr())
def test_sympy__core__function__Application():
from sympy.core.function import Application
assert _test_args(Application(1, 2, 3))
def test_sympy__core__function__AppliedUndef():
from sympy.core.function import AppliedUndef
assert _test_args(AppliedUndef(1, 2, 3))
def test_sympy__core__function__Derivative():
from sympy.core.function import Derivative
assert _test_args(Derivative(2, x, y, 3))
@SKIP("abstract class")
def test_sympy__core__function__Function():
pass
def test_sympy__core__function__Lambda():
from sympy.core.function import Lambda
assert _test_args(Lambda((x, y), x + y + z))
def test_sympy__core__function__Subs():
from sympy.core.function import Subs
assert _test_args(Subs(x + y, x, 2))
def test_sympy__core__function__WildFunction():
from sympy.core.function import WildFunction
assert _test_args(WildFunction('f'))
def test_sympy__core__mod__Mod():
from sympy.core.mod import Mod
assert _test_args(Mod(x, 2))
def test_sympy__core__mul__Mul():
from sympy.core.mul import Mul
assert _test_args(Mul(2, x, y, z))
def test_sympy__core__numbers__Catalan():
from sympy.core.numbers import Catalan
assert _test_args(Catalan())
def test_sympy__core__numbers__ComplexInfinity():
from sympy.core.numbers import ComplexInfinity
assert _test_args(ComplexInfinity())
def test_sympy__core__numbers__EulerGamma():
from sympy.core.numbers import EulerGamma
assert _test_args(EulerGamma())
def test_sympy__core__numbers__Exp1():
from sympy.core.numbers import Exp1
assert _test_args(Exp1())
def test_sympy__core__numbers__Float():
from sympy.core.numbers import Float
assert _test_args(Float(1.23))
def test_sympy__core__numbers__GoldenRatio():
from sympy.core.numbers import GoldenRatio
assert _test_args(GoldenRatio())
def test_sympy__core__numbers__Half():
from sympy.core.numbers import Half
assert _test_args(Half())
def test_sympy__core__numbers__ImaginaryUnit():
from sympy.core.numbers import ImaginaryUnit
assert _test_args(ImaginaryUnit())
def test_sympy__core__numbers__Infinity():
from sympy.core.numbers import Infinity
assert _test_args(Infinity())
def test_sympy__core__numbers__Integer():
from sympy.core.numbers import Integer
assert _test_args(Integer(7))
@SKIP("abstract class")
def test_sympy__core__numbers__IntegerConstant():
pass
def test_sympy__core__numbers__NaN():
from sympy.core.numbers import NaN
assert _test_args(NaN())
def test_sympy__core__numbers__NegativeInfinity():
from sympy.core.numbers import NegativeInfinity
assert _test_args(NegativeInfinity())
def test_sympy__core__numbers__NegativeOne():
from sympy.core.numbers import NegativeOne
assert _test_args(NegativeOne())
def test_sympy__core__numbers__Number():
from sympy.core.numbers import Number
assert _test_args(Number(1, 7))
def test_sympy__core__numbers__NumberSymbol():
from sympy.core.numbers import NumberSymbol
assert _test_args(NumberSymbol())
def test_sympy__core__numbers__One():
from sympy.core.numbers import One
assert _test_args(One())
def test_sympy__core__numbers__Pi():
from sympy.core.numbers import Pi
assert _test_args(Pi())
def test_sympy__core__numbers__Rational():
from sympy.core.numbers import Rational
assert _test_args(Rational(1, 7))
@SKIP("abstract class")
def test_sympy__core__numbers__RationalConstant():
pass
def test_sympy__core__numbers__Zero():
from sympy.core.numbers import Zero
assert _test_args(Zero())
@SKIP("abstract class")
def test_sympy__core__operations__AssocOp():
pass
@SKIP("abstract class")
def test_sympy__core__operations__LatticeOp():
pass
def test_sympy__core__power__Pow():
from sympy.core.power import Pow
assert _test_args(Pow(x, 2))
def test_sympy__core__relational__Equality():
from sympy.core.relational import Equality
assert _test_args(Equality(x, 2))
def test_sympy__core__relational__GreaterThan():
from sympy.core.relational import GreaterThan
assert _test_args(GreaterThan(x, 2))
def test_sympy__core__relational__LessThan():
from sympy.core.relational import LessThan
assert _test_args(LessThan(x, 2))
@SKIP("abstract class")
def test_sympy__core__relational__Relational():
pass
def test_sympy__core__relational__StrictGreaterThan():
from sympy.core.relational import StrictGreaterThan
assert _test_args(StrictGreaterThan(x, 2))
def test_sympy__core__relational__StrictLessThan():
from sympy.core.relational import StrictLessThan
assert _test_args(StrictLessThan(x, 2))
def test_sympy__core__relational__Unequality():
from sympy.core.relational import Unequality
assert _test_args(Unequality(x, 2))
def test_sympy__sets__sets__EmptySet():
from sympy.sets.sets import EmptySet
assert _test_args(EmptySet())
def test_sympy__sets__sets__UniversalSet():
from sympy.sets.sets import UniversalSet
assert _test_args(UniversalSet())
def test_sympy__sets__sets__FiniteSet():
from sympy.sets.sets import FiniteSet
assert _test_args(FiniteSet(x, y, z))
def test_sympy__sets__sets__Interval():
from sympy.sets.sets import Interval
assert _test_args(Interval(0, 1))
def test_sympy__sets__sets__ProductSet():
from sympy.sets.sets import ProductSet, Interval
assert _test_args(ProductSet(Interval(0, 1), Interval(0, 1)))
@SKIP("does it make sense to test this?")
def test_sympy__sets__sets__Set():
from sympy.sets.sets import Set
assert _test_args(Set())
def test_sympy__sets__sets__Intersection():
from sympy.sets.sets import Intersection, Interval
assert _test_args(Intersection(Interval(0, 3), Interval(2, 4),
evaluate=False))
def test_sympy__sets__sets__Union():
from sympy.sets.sets import Union, Interval
assert _test_args(Union(Interval(0, 1), Interval(2, 3)))
def test_sympy__sets__sets__Complement():
from sympy.sets.sets import Complement
assert _test_args(Complement(Interval(0, 2), Interval(0, 1)))
def test_sympy__sets__sets__SymmetricDifference():
from sympy.sets.sets import FiniteSet, SymmetricDifference
assert _test_args(SymmetricDifference(FiniteSet(1, 2, 3), \
FiniteSet(2, 3, 4)))
def test_sympy__core__trace__Tr():
from sympy.core.trace import Tr
a, b = symbols('a b')
assert _test_args(Tr(a + b))
def test_sympy__sets__fancysets__Naturals():
from sympy.sets.fancysets import Naturals
assert _test_args(Naturals())
def test_sympy__sets__fancysets__Naturals0():
from sympy.sets.fancysets import Naturals0
assert _test_args(Naturals0())
def test_sympy__sets__fancysets__Integers():
from sympy.sets.fancysets import Integers
assert _test_args(Integers())
def test_sympy__sets__fancysets__Reals():
from sympy.sets.fancysets import Reals
assert _test_args(Reals())
def test_sympy__sets__fancysets__ImageSet():
from sympy.sets.fancysets import ImageSet
from sympy import S, Lambda, Symbol
x = Symbol('x')
assert _test_args(ImageSet(Lambda(x, x**2), S.Naturals))
def test_sympy__sets__fancysets__Range():
from sympy.sets.fancysets import Range
assert _test_args(Range(1, 5, 1))
def test_sympy__sets__contains__Contains():
from sympy.sets.fancysets import Range
from sympy.sets.contains import Contains
assert _test_args(Contains(x, Range(0, 10, 2)))
# STATS
from sympy.stats.crv_types import NormalDistribution
nd = NormalDistribution(0, 1)
from sympy.stats.frv_types import DieDistribution
die = DieDistribution(6)
def test_sympy__stats__crv__ContinuousDomain():
from sympy.stats.crv import ContinuousDomain
assert _test_args(ContinuousDomain(set([x]), Interval(-oo, oo)))
def test_sympy__stats__crv__SingleContinuousDomain():
from sympy.stats.crv import SingleContinuousDomain
assert _test_args(SingleContinuousDomain(x, Interval(-oo, oo)))
def test_sympy__stats__crv__ProductContinuousDomain():
from sympy.stats.crv import SingleContinuousDomain, ProductContinuousDomain
D = SingleContinuousDomain(x, Interval(-oo, oo))
E = SingleContinuousDomain(y, Interval(0, oo))
assert _test_args(ProductContinuousDomain(D, E))
def test_sympy__stats__crv__ConditionalContinuousDomain():
from sympy.stats.crv import (SingleContinuousDomain,
ConditionalContinuousDomain)
D = SingleContinuousDomain(x, Interval(-oo, oo))
assert _test_args(ConditionalContinuousDomain(D, x > 0))
def test_sympy__stats__crv__ContinuousPSpace():
from sympy.stats.crv import ContinuousPSpace, SingleContinuousDomain
D = SingleContinuousDomain(x, Interval(-oo, oo))
assert _test_args(ContinuousPSpace(D, nd))
def test_sympy__stats__crv__SingleContinuousPSpace():
from sympy.stats.crv import SingleContinuousPSpace
assert _test_args(SingleContinuousPSpace(x, nd))
def test_sympy__stats__crv__ProductContinuousPSpace():
from sympy.stats.crv import ProductContinuousPSpace, SingleContinuousPSpace
A = SingleContinuousPSpace(x, nd)
B = SingleContinuousPSpace(y, nd)
assert _test_args(ProductContinuousPSpace(A, B))
@SKIP("abstract class")
def test_sympy__stats__crv__SingleContinuousDistribution():
pass
def test_sympy__stats__drv__SingleDiscreteDomain():
from sympy.stats.drv import SingleDiscreteDomain
assert _test_args(SingleDiscreteDomain(x, S.Naturals))
def test_sympy__stats__drv__SingleDiscretePSpace():
from sympy.stats.drv import SingleDiscretePSpace
from sympy.stats.drv_types import PoissonDistribution
assert _test_args(SingleDiscretePSpace(x, PoissonDistribution(1)))
@SKIP("abstract class")
def test_sympy__stats__drv__SingleDiscreteDistribution():
pass
def test_sympy__stats__rv__RandomDomain():
from sympy.stats.rv import RandomDomain
from sympy.sets.sets import FiniteSet
assert _test_args(RandomDomain(FiniteSet(x), FiniteSet(1, 2, 3)))
def test_sympy__stats__rv__SingleDomain():
from sympy.stats.rv import SingleDomain
from sympy.sets.sets import FiniteSet
assert _test_args(SingleDomain(x, FiniteSet(1, 2, 3)))
def test_sympy__stats__rv__ConditionalDomain():
from sympy.stats.rv import ConditionalDomain, RandomDomain
from sympy.sets.sets import FiniteSet
D = RandomDomain(FiniteSet(x), FiniteSet(1, 2))
assert _test_args(ConditionalDomain(D, x > 1))
def test_sympy__stats__rv__PSpace():
from sympy.stats.rv import PSpace, RandomDomain
from sympy import FiniteSet
D = RandomDomain(FiniteSet(x), FiniteSet(1, 2, 3, 4, 5, 6))
assert _test_args(PSpace(D, die))
@SKIP("abstract Class")
def test_sympy__stats__rv__SinglePSpace():
pass
def test_sympy__stats__rv__RandomSymbol():
from sympy.stats.rv import RandomSymbol
from sympy.stats.crv import SingleContinuousPSpace
A = SingleContinuousPSpace(x, nd)
assert _test_args(RandomSymbol(A, x))
def test_sympy__stats__rv__ProductPSpace():
from sympy.stats.rv import ProductPSpace
from sympy.stats.crv import SingleContinuousPSpace
A = SingleContinuousPSpace(x, nd)
B = SingleContinuousPSpace(y, nd)
assert _test_args(ProductPSpace(A, B))
def test_sympy__stats__rv__ProductDomain():
from sympy.stats.rv import ProductDomain, SingleDomain
D = SingleDomain(x, Interval(-oo, oo))
E = SingleDomain(y, Interval(0, oo))
assert _test_args(ProductDomain(D, E))
def test_sympy__stats__frv_types__DiscreteUniformDistribution():
from sympy.stats.frv_types import DiscreteUniformDistribution
from sympy.core.containers import Tuple
assert _test_args(DiscreteUniformDistribution(Tuple(*list(range(6)))))
def test_sympy__stats__frv_types__DieDistribution():
from sympy.stats.frv_types import DieDistribution
assert _test_args(DieDistribution(6))
def test_sympy__stats__frv_types__BernoulliDistribution():
from sympy.stats.frv_types import BernoulliDistribution
assert _test_args(BernoulliDistribution(S.Half, 0, 1))
def test_sympy__stats__frv_types__BinomialDistribution():
from sympy.stats.frv_types import BinomialDistribution
assert _test_args(BinomialDistribution(5, S.Half, 1, 0))
def test_sympy__stats__frv_types__HypergeometricDistribution():
from sympy.stats.frv_types import HypergeometricDistribution
assert _test_args(HypergeometricDistribution(10, 5, 3))
def test_sympy__stats__frv_types__RademacherDistribution():
from sympy.stats.frv_types import RademacherDistribution
assert _test_args(RademacherDistribution())
def test_sympy__stats__frv__FiniteDomain():
from sympy.stats.frv import FiniteDomain
assert _test_args(FiniteDomain(set([(x, 1), (x, 2)]))) # x can be 1 or 2
def test_sympy__stats__frv__SingleFiniteDomain():
from sympy.stats.frv import SingleFiniteDomain
assert _test_args(SingleFiniteDomain(x, set([1, 2]))) # x can be 1 or 2
def test_sympy__stats__frv__ProductFiniteDomain():
from sympy.stats.frv import SingleFiniteDomain, ProductFiniteDomain
xd = SingleFiniteDomain(x, set([1, 2]))
yd = SingleFiniteDomain(y, set([1, 2]))
assert _test_args(ProductFiniteDomain(xd, yd))
def test_sympy__stats__frv__ConditionalFiniteDomain():
from sympy.stats.frv import SingleFiniteDomain, ConditionalFiniteDomain
xd = SingleFiniteDomain(x, set([1, 2]))
assert _test_args(ConditionalFiniteDomain(xd, x > 1))
def test_sympy__stats__frv__FinitePSpace():
from sympy.stats.frv import FinitePSpace, SingleFiniteDomain
xd = SingleFiniteDomain(x, set([1, 2, 3, 4, 5, 6]))
p = 1.0/6
xd = SingleFiniteDomain(x, set([1, 2]))
assert _test_args(FinitePSpace(xd, {(x, 1): S.Half, (x, 2): S.Half}))
def test_sympy__stats__frv__SingleFinitePSpace():
from sympy.stats.frv import SingleFinitePSpace
from sympy import Symbol
assert _test_args(SingleFinitePSpace(Symbol('x'), die))
def test_sympy__stats__frv__ProductFinitePSpace():
from sympy.stats.frv import SingleFinitePSpace, ProductFinitePSpace
from sympy import Symbol
xp = SingleFinitePSpace(Symbol('x'), die)
yp = SingleFinitePSpace(Symbol('y'), die)
assert _test_args(ProductFinitePSpace(xp, yp))
@SKIP("abstract class")
def test_sympy__stats__frv__SingleFiniteDistribution():
pass
@SKIP("abstract class")
def test_sympy__stats__crv__ContinuousDistribution():
pass
def test_sympy__stats__frv_types__FiniteDistributionHandmade():
from sympy.stats.frv_types import FiniteDistributionHandmade
assert _test_args(FiniteDistributionHandmade({1: 1}))
def test_sympy__stats__crv__ContinuousDistributionHandmade():
from sympy.stats.crv import ContinuousDistributionHandmade
from sympy import Symbol, Interval
assert _test_args(ContinuousDistributionHandmade(Symbol('x'),
Interval(0, 2)))
def test_sympy__stats__rv__Density():
from sympy.stats.rv import Density
from sympy.stats.crv_types import Normal
assert _test_args(Density(Normal('x', 0, 1)))
def test_sympy__stats__crv_types__ArcsinDistribution():
from sympy.stats.crv_types import ArcsinDistribution
assert _test_args(ArcsinDistribution(0, 1))
def test_sympy__stats__crv_types__BeniniDistribution():
from sympy.stats.crv_types import BeniniDistribution
assert _test_args(BeniniDistribution(1, 1, 1))
def test_sympy__stats__crv_types__BetaDistribution():
from sympy.stats.crv_types import BetaDistribution
assert _test_args(BetaDistribution(1, 1))
def test_sympy__stats__crv_types__BetaPrimeDistribution():
from sympy.stats.crv_types import BetaPrimeDistribution
assert _test_args(BetaPrimeDistribution(1, 1))
def test_sympy__stats__crv_types__CauchyDistribution():
from sympy.stats.crv_types import CauchyDistribution
assert _test_args(CauchyDistribution(0, 1))
def test_sympy__stats__crv_types__ChiDistribution():
from sympy.stats.crv_types import ChiDistribution
assert _test_args(ChiDistribution(1))
def test_sympy__stats__crv_types__ChiNoncentralDistribution():
from sympy.stats.crv_types import ChiNoncentralDistribution
assert _test_args(ChiNoncentralDistribution(1,1))
def test_sympy__stats__crv_types__ChiSquaredDistribution():
from sympy.stats.crv_types import ChiSquaredDistribution
assert _test_args(ChiSquaredDistribution(1))
def test_sympy__stats__crv_types__DagumDistribution():
from sympy.stats.crv_types import DagumDistribution
assert _test_args(DagumDistribution(1, 1, 1))
def test_sympy__stats__crv_types__ExponentialDistribution():
from sympy.stats.crv_types import ExponentialDistribution
assert _test_args(ExponentialDistribution(1))
def test_sympy__stats__crv_types__FDistributionDistribution():
from sympy.stats.crv_types import FDistributionDistribution
assert _test_args(FDistributionDistribution(1, 1))
def test_sympy__stats__crv_types__FisherZDistribution():
from sympy.stats.crv_types import FisherZDistribution
assert _test_args(FisherZDistribution(1, 1))
def test_sympy__stats__crv_types__FrechetDistribution():
from sympy.stats.crv_types import FrechetDistribution
assert _test_args(FrechetDistribution(1, 1, 1))
def test_sympy__stats__crv_types__GammaInverseDistribution():
from sympy.stats.crv_types import GammaInverseDistribution
assert _test_args(GammaInverseDistribution(1, 1))
def test_sympy__stats__crv_types__GammaDistribution():
from sympy.stats.crv_types import GammaDistribution
assert _test_args(GammaDistribution(1, 1))
def test_sympy__stats__crv_types__KumaraswamyDistribution():
from sympy.stats.crv_types import KumaraswamyDistribution
assert _test_args(KumaraswamyDistribution(1, 1))
def test_sympy__stats__crv_types__LaplaceDistribution():
from sympy.stats.crv_types import LaplaceDistribution
assert _test_args(LaplaceDistribution(0, 1))
def test_sympy__stats__crv_types__LogisticDistribution():
from sympy.stats.crv_types import LogisticDistribution
assert _test_args(LogisticDistribution(0, 1))
def test_sympy__stats__crv_types__LogNormalDistribution():
from sympy.stats.crv_types import LogNormalDistribution
assert _test_args(LogNormalDistribution(0, 1))
def test_sympy__stats__crv_types__MaxwellDistribution():
from sympy.stats.crv_types import MaxwellDistribution
assert _test_args(MaxwellDistribution(1))
def test_sympy__stats__crv_types__NakagamiDistribution():
from sympy.stats.crv_types import NakagamiDistribution
assert _test_args(NakagamiDistribution(1, 1))
def test_sympy__stats__crv_types__NormalDistribution():
from sympy.stats.crv_types import NormalDistribution
assert _test_args(NormalDistribution(0, 1))
def test_sympy__stats__crv_types__ParetoDistribution():
from sympy.stats.crv_types import ParetoDistribution
assert _test_args(ParetoDistribution(1, 1))
def test_sympy__stats__crv_types__QuadraticUDistribution():
from sympy.stats.crv_types import QuadraticUDistribution
assert _test_args(QuadraticUDistribution(1, 2))
def test_sympy__stats__crv_types__RaisedCosineDistribution():
from sympy.stats.crv_types import RaisedCosineDistribution
assert _test_args(RaisedCosineDistribution(1, 1))
def test_sympy__stats__crv_types__RayleighDistribution():
from sympy.stats.crv_types import RayleighDistribution
assert _test_args(RayleighDistribution(1))
def test_sympy__stats__crv_types__StudentTDistribution():
from sympy.stats.crv_types import StudentTDistribution
assert _test_args(StudentTDistribution(1))
def test_sympy__stats__crv_types__TriangularDistribution():
from sympy.stats.crv_types import TriangularDistribution
assert _test_args(TriangularDistribution(-1, 0, 1))
def test_sympy__stats__crv_types__UniformDistribution():
from sympy.stats.crv_types import UniformDistribution
assert _test_args(UniformDistribution(0, 1))
def test_sympy__stats__crv_types__UniformSumDistribution():
from sympy.stats.crv_types import UniformSumDistribution
assert _test_args(UniformSumDistribution(1))
def test_sympy__stats__crv_types__VonMisesDistribution():
from sympy.stats.crv_types import VonMisesDistribution
assert _test_args(VonMisesDistribution(1, 1))
def test_sympy__stats__crv_types__WeibullDistribution():
from sympy.stats.crv_types import WeibullDistribution
assert _test_args(WeibullDistribution(1, 1))
def test_sympy__stats__crv_types__WignerSemicircleDistribution():
from sympy.stats.crv_types import WignerSemicircleDistribution
assert _test_args(WignerSemicircleDistribution(1))
def test_sympy__stats__drv_types__PoissonDistribution():
from sympy.stats.drv_types import PoissonDistribution
assert _test_args(PoissonDistribution(1))
def test_sympy__stats__drv_types__GeometricDistribution():
from sympy.stats.drv_types import GeometricDistribution
assert _test_args(GeometricDistribution(.5))
def test_sympy__core__symbol__Dummy():
from sympy.core.symbol import Dummy
assert _test_args(Dummy('t'))
def test_sympy__core__symbol__Symbol():
from sympy.core.symbol import Symbol
assert _test_args(Symbol('t'))
def test_sympy__core__symbol__Wild():
from sympy.core.symbol import Wild
assert _test_args(Wild('x', exclude=[x]))
@SKIP("abstract class")
def test_sympy__functions__combinatorial__factorials__CombinatorialFunction():
pass
def test_sympy__functions__combinatorial__factorials__FallingFactorial():
from sympy.functions.combinatorial.factorials import FallingFactorial
assert _test_args(FallingFactorial(2, x))
def test_sympy__functions__combinatorial__factorials__MultiFactorial():
from sympy.functions.combinatorial.factorials import MultiFactorial
assert _test_args(MultiFactorial(x))
def test_sympy__functions__combinatorial__factorials__RisingFactorial():
from sympy.functions.combinatorial.factorials import RisingFactorial
assert _test_args(RisingFactorial(2, x))
def test_sympy__functions__combinatorial__factorials__binomial():
from sympy.functions.combinatorial.factorials import binomial
assert _test_args(binomial(2, x))
def test_sympy__functions__combinatorial__factorials__subfactorial():
from sympy.functions.combinatorial.factorials import subfactorial
assert _test_args(subfactorial(1))
def test_sympy__functions__combinatorial__factorials__factorial():
from sympy.functions.combinatorial.factorials import factorial
assert _test_args(factorial(x))
def test_sympy__functions__combinatorial__factorials__factorial2():
from sympy.functions.combinatorial.factorials import factorial2
assert _test_args(factorial2(x))
def test_sympy__functions__combinatorial__numbers__bell():
from sympy.functions.combinatorial.numbers import bell
assert _test_args(bell(x, y))
def test_sympy__functions__combinatorial__numbers__bernoulli():
from sympy.functions.combinatorial.numbers import bernoulli
assert _test_args(bernoulli(x))
def test_sympy__functions__combinatorial__numbers__catalan():
from sympy.functions.combinatorial.numbers import catalan
assert _test_args(catalan(x))
def test_sympy__functions__combinatorial__numbers__genocchi():
from sympy.functions.combinatorial.numbers import genocchi
assert _test_args(genocchi(x))
def test_sympy__functions__combinatorial__numbers__euler():
from sympy.functions.combinatorial.numbers import euler
assert _test_args(euler(x))
def test_sympy__functions__combinatorial__numbers__fibonacci():
from sympy.functions.combinatorial.numbers import fibonacci
assert _test_args(fibonacci(x))
def test_sympy__functions__combinatorial__numbers__harmonic():
from sympy.functions.combinatorial.numbers import harmonic
assert _test_args(harmonic(x, 2))
def test_sympy__functions__combinatorial__numbers__lucas():
from sympy.functions.combinatorial.numbers import lucas
assert _test_args(lucas(x))
def test_sympy__functions__elementary__complexes__Abs():
from sympy.functions.elementary.complexes import Abs
assert _test_args(Abs(x))
def test_sympy__functions__elementary__complexes__adjoint():
from sympy.functions.elementary.complexes import adjoint
assert _test_args(adjoint(x))
def test_sympy__functions__elementary__complexes__arg():
from sympy.functions.elementary.complexes import arg
assert _test_args(arg(x))
def test_sympy__functions__elementary__complexes__conjugate():
from sympy.functions.elementary.complexes import conjugate
assert _test_args(conjugate(x))
def test_sympy__functions__elementary__complexes__im():
from sympy.functions.elementary.complexes import im
assert _test_args(im(x))
def test_sympy__functions__elementary__complexes__re():
from sympy.functions.elementary.complexes import re
assert _test_args(re(x))
def test_sympy__functions__elementary__complexes__sign():
from sympy.functions.elementary.complexes import sign
assert _test_args(sign(x))
def test_sympy__functions__elementary__complexes__polar_lift():
from sympy.functions.elementary.complexes import polar_lift
assert _test_args(polar_lift(x))
def test_sympy__functions__elementary__complexes__periodic_argument():
from sympy.functions.elementary.complexes import periodic_argument
assert _test_args(periodic_argument(x, y))
def test_sympy__functions__elementary__complexes__principal_branch():
from sympy.functions.elementary.complexes import principal_branch
assert _test_args(principal_branch(x, y))
def test_sympy__functions__elementary__complexes__transpose():
from sympy.functions.elementary.complexes import transpose
assert _test_args(transpose(x))
def test_sympy__functions__elementary__exponential__LambertW():
from sympy.functions.elementary.exponential import LambertW
assert _test_args(LambertW(2))
@SKIP("abstract class")
def test_sympy__functions__elementary__exponential__ExpBase():
pass
def test_sympy__functions__elementary__exponential__exp():
from sympy.functions.elementary.exponential import exp
assert _test_args(exp(2))
def test_sympy__functions__elementary__exponential__exp_polar():
from sympy.functions.elementary.exponential import exp_polar
assert _test_args(exp_polar(2))
def test_sympy__functions__elementary__exponential__log():
from sympy.functions.elementary.exponential import log
assert _test_args(log(2))
@SKIP("abstract class")
def test_sympy__functions__elementary__hyperbolic__HyperbolicFunction():
pass
@SKIP("abstract class")
def test_sympy__functions__elementary__hyperbolic__ReciprocalHyperbolicFunction():
pass
def test_sympy__functions__elementary__hyperbolic__acosh():
from sympy.functions.elementary.hyperbolic import acosh
assert _test_args(acosh(2))
def test_sympy__functions__elementary__hyperbolic__acoth():
from sympy.functions.elementary.hyperbolic import acoth
assert _test_args(acoth(2))
def test_sympy__functions__elementary__hyperbolic__asinh():
from sympy.functions.elementary.hyperbolic import asinh
assert _test_args(asinh(2))
def test_sympy__functions__elementary__hyperbolic__atanh():
from sympy.functions.elementary.hyperbolic import atanh
assert _test_args(atanh(2))
def test_sympy__functions__elementary__hyperbolic__cosh():
from sympy.functions.elementary.hyperbolic import cosh
assert _test_args(cosh(2))
def test_sympy__functions__elementary__hyperbolic__coth():
from sympy.functions.elementary.hyperbolic import coth
assert _test_args(coth(2))
def test_sympy__functions__elementary__hyperbolic__csch():
from sympy.functions.elementary.hyperbolic import csch
assert _test_args(csch(2))
def test_sympy__functions__elementary__hyperbolic__sech():
from sympy.functions.elementary.hyperbolic import sech
assert _test_args(sech(2))
def test_sympy__functions__elementary__hyperbolic__sinh():
from sympy.functions.elementary.hyperbolic import sinh
assert _test_args(sinh(2))
def test_sympy__functions__elementary__hyperbolic__tanh():
from sympy.functions.elementary.hyperbolic import tanh
assert _test_args(tanh(2))
@SKIP("does this work at all?")
def test_sympy__functions__elementary__integers__RoundFunction():
from sympy.functions.elementary.integers import RoundFunction
assert _test_args(RoundFunction())
def test_sympy__functions__elementary__integers__ceiling():
from sympy.functions.elementary.integers import ceiling
assert _test_args(ceiling(x))
def test_sympy__functions__elementary__integers__floor():
from sympy.functions.elementary.integers import floor
assert _test_args(floor(x))
def test_sympy__functions__elementary__miscellaneous__IdentityFunction():
from sympy.functions.elementary.miscellaneous import IdentityFunction
assert _test_args(IdentityFunction())
def test_sympy__functions__elementary__miscellaneous__Max():
from sympy.functions.elementary.miscellaneous import Max
assert _test_args(Max(x, 2))
def test_sympy__functions__elementary__miscellaneous__Min():
from sympy.functions.elementary.miscellaneous import Min
assert _test_args(Min(x, 2))
@SKIP("abstract class")
def test_sympy__functions__elementary__miscellaneous__MinMaxBase():
pass
def test_sympy__functions__elementary__piecewise__ExprCondPair():
from sympy.functions.elementary.piecewise import ExprCondPair
assert _test_args(ExprCondPair(1, True))
def test_sympy__functions__elementary__piecewise__Piecewise():
from sympy.functions.elementary.piecewise import Piecewise
assert _test_args(Piecewise((1, x >= 0), (0, True)))
@SKIP("abstract class")
def test_sympy__functions__elementary__trigonometric__TrigonometricFunction():
pass
@SKIP("abstract class")
def test_sympy__functions__elementary__trigonometric__ReciprocalTrigonometricFunction():
pass
@SKIP("abstract class")
def test_sympy__functions__elementary__trigonometric__InverseTrigonometricFunction():
pass
def test_sympy__functions__elementary__trigonometric__acos():
from sympy.functions.elementary.trigonometric import acos
assert _test_args(acos(2))
def test_sympy__functions__elementary__trigonometric__acot():
from sympy.functions.elementary.trigonometric import acot
assert _test_args(acot(2))
def test_sympy__functions__elementary__trigonometric__asin():
from sympy.functions.elementary.trigonometric import asin
assert _test_args(asin(2))
def test_sympy__functions__elementary__trigonometric__asec():
from sympy.functions.elementary.trigonometric import asec
assert _test_args(asec(2))
def test_sympy__functions__elementary__trigonometric__acsc():
from sympy.functions.elementary.trigonometric import acsc
assert _test_args(acsc(2))
def test_sympy__functions__elementary__trigonometric__atan():
from sympy.functions.elementary.trigonometric import atan
assert _test_args(atan(2))
def test_sympy__functions__elementary__trigonometric__atan2():
from sympy.functions.elementary.trigonometric import atan2
assert _test_args(atan2(2, 3))
def test_sympy__functions__elementary__trigonometric__cos():
from sympy.functions.elementary.trigonometric import cos
assert _test_args(cos(2))
def test_sympy__functions__elementary__trigonometric__csc():
from sympy.functions.elementary.trigonometric import csc
assert _test_args(csc(2))
def test_sympy__functions__elementary__trigonometric__cot():
from sympy.functions.elementary.trigonometric import cot
assert _test_args(cot(2))
def test_sympy__functions__elementary__trigonometric__sin():
assert _test_args(sin(2))
def test_sympy__functions__elementary__trigonometric__sec():
from sympy.functions.elementary.trigonometric import sec
assert _test_args(sec(2))
def test_sympy__functions__elementary__trigonometric__tan():
from sympy.functions.elementary.trigonometric import tan
assert _test_args(tan(2))
@SKIP("abstract class")
def test_sympy__functions__special__bessel__BesselBase():
pass
@SKIP("abstract class")
def test_sympy__functions__special__bessel__SphericalBesselBase():
pass
def test_sympy__functions__special__bessel__besseli():
from sympy.functions.special.bessel import besseli
assert _test_args(besseli(x, 1))
def test_sympy__functions__special__bessel__besselj():
from sympy.functions.special.bessel import besselj
assert _test_args(besselj(x, 1))
def test_sympy__functions__special__bessel__besselk():
from sympy.functions.special.bessel import besselk
assert _test_args(besselk(x, 1))
def test_sympy__functions__special__bessel__bessely():
from sympy.functions.special.bessel import bessely
assert _test_args(bessely(x, 1))
def test_sympy__functions__special__bessel__hankel1():
from sympy.functions.special.bessel import hankel1
assert _test_args(hankel1(x, 1))
def test_sympy__functions__special__bessel__hankel2():
from sympy.functions.special.bessel import hankel2
assert _test_args(hankel2(x, 1))
def test_sympy__functions__special__bessel__jn():
from sympy.functions.special.bessel import jn
assert _test_args(jn(0, x))
def test_sympy__functions__special__bessel__yn():
from sympy.functions.special.bessel import yn
assert _test_args(yn(0, x))
def test_sympy__functions__special__bessel__AiryBase():
pass
def test_sympy__functions__special__bessel__airyai():
from sympy.functions.special.bessel import airyai
assert _test_args(airyai(2))
def test_sympy__functions__special__bessel__airybi():
from sympy.functions.special.bessel import airybi
assert _test_args(airybi(2))
def test_sympy__functions__special__bessel__airyaiprime():
from sympy.functions.special.bessel import airyaiprime
assert _test_args(airyaiprime(2))
def test_sympy__functions__special__bessel__airybiprime():
from sympy.functions.special.bessel import airybiprime
assert _test_args(airybiprime(2))
def test_sympy__functions__special__elliptic_integrals__elliptic_k():
from sympy.functions.special.elliptic_integrals import elliptic_k as K
assert _test_args(K(x))
def test_sympy__functions__special__elliptic_integrals__elliptic_f():
from sympy.functions.special.elliptic_integrals import elliptic_f as F
assert _test_args(F(x, y))
def test_sympy__functions__special__elliptic_integrals__elliptic_e():
from sympy.functions.special.elliptic_integrals import elliptic_e as E
assert _test_args(E(x))
assert _test_args(E(x, y))
def test_sympy__functions__special__elliptic_integrals__elliptic_pi():
from sympy.functions.special.elliptic_integrals import elliptic_pi as P
assert _test_args(P(x, y))
assert _test_args(P(x, y, z))
def test_sympy__functions__special__delta_functions__DiracDelta():
from sympy.functions.special.delta_functions import DiracDelta
assert _test_args(DiracDelta(x, 1))
def test_sympy__functions__special__delta_functions__Heaviside():
from sympy.functions.special.delta_functions import Heaviside
assert _test_args(Heaviside(x))
def test_sympy__functions__special__error_functions__erf():
from sympy.functions.special.error_functions import erf
assert _test_args(erf(2))
def test_sympy__functions__special__error_functions__erfc():
from sympy.functions.special.error_functions import erfc
assert _test_args(erfc(2))
def test_sympy__functions__special__error_functions__erfi():
from sympy.functions.special.error_functions import erfi
assert _test_args(erfi(2))
def test_sympy__functions__special__error_functions__erf2():
from sympy.functions.special.error_functions import erf2
assert _test_args(erf2(2, 3))
def test_sympy__functions__special__error_functions__erfinv():
from sympy.functions.special.error_functions import erfinv
assert _test_args(erfinv(2))
def test_sympy__functions__special__error_functions__erfcinv():
from sympy.functions.special.error_functions import erfcinv
assert _test_args(erfcinv(2))
def test_sympy__functions__special__error_functions__erf2inv():
from sympy.functions.special.error_functions import erf2inv
assert _test_args(erf2inv(2, 3))
@SKIP("abstract class")
def test_sympy__functions__special__error_functions__FresnelIntegral():
pass
def test_sympy__functions__special__error_functions__fresnels():
from sympy.functions.special.error_functions import fresnels
assert _test_args(fresnels(2))
def test_sympy__functions__special__error_functions__fresnelc():
from sympy.functions.special.error_functions import fresnelc
assert _test_args(fresnelc(2))
def test_sympy__functions__special__error_functions__erfs():
from sympy.functions.special.error_functions import _erfs
assert _test_args(_erfs(2))
def test_sympy__functions__special__error_functions__Ei():
from sympy.functions.special.error_functions import Ei
assert _test_args(Ei(2))
def test_sympy__functions__special__error_functions__li():
from sympy.functions.special.error_functions import li
assert _test_args(li(2))
def test_sympy__functions__special__error_functions__Li():
from sympy.functions.special.error_functions import Li
assert _test_args(Li(2))
@SKIP("abstract class")
def test_sympy__functions__special__error_functions__TrigonometricIntegral():
pass
def test_sympy__functions__special__error_functions__Si():
from sympy.functions.special.error_functions import Si
assert _test_args(Si(2))
def test_sympy__functions__special__error_functions__Ci():
from sympy.functions.special.error_functions import Ci
assert _test_args(Ci(2))
def test_sympy__functions__special__error_functions__Shi():
from sympy.functions.special.error_functions import Shi
assert _test_args(Shi(2))
def test_sympy__functions__special__error_functions__Chi():
from sympy.functions.special.error_functions import Chi
assert _test_args(Chi(2))
def test_sympy__functions__special__error_functions__expint():
from sympy.functions.special.error_functions import expint
assert _test_args(expint(y, x))
def test_sympy__functions__special__gamma_functions__gamma():
from sympy.functions.special.gamma_functions import gamma
assert _test_args(gamma(x))
def test_sympy__functions__special__gamma_functions__loggamma():
from sympy.functions.special.gamma_functions import loggamma
assert _test_args(loggamma(2))
def test_sympy__functions__special__gamma_functions__lowergamma():
from sympy.functions.special.gamma_functions import lowergamma
assert _test_args(lowergamma(x, 2))
def test_sympy__functions__special__gamma_functions__polygamma():
from sympy.functions.special.gamma_functions import polygamma
assert _test_args(polygamma(x, 2))
def test_sympy__functions__special__gamma_functions__uppergamma():
from sympy.functions.special.gamma_functions import uppergamma
assert _test_args(uppergamma(x, 2))
def test_sympy__functions__special__beta_functions__beta():
from sympy.functions.special.beta_functions import beta
assert _test_args(beta(x, x))
@SKIP("abstract class")
def test_sympy__functions__special__hyper__TupleParametersBase():
pass
@SKIP("abstract class")
def test_sympy__functions__special__hyper__TupleArg():
pass
def test_sympy__functions__special__hyper__hyper():
from sympy.functions.special.hyper import hyper
assert _test_args(hyper([1, 2, 3], [4, 5], x))
def test_sympy__functions__special__hyper__meijerg():
from sympy.functions.special.hyper import meijerg
assert _test_args(meijerg([1, 2, 3], [4, 5], [6], [], x))
@SKIP("abstract class")
def test_sympy__functions__special__hyper__HyperRep():
pass
def test_sympy__functions__special__hyper__HyperRep_power1():
from sympy.functions.special.hyper import HyperRep_power1
assert _test_args(HyperRep_power1(x, y))
def test_sympy__functions__special__hyper__HyperRep_power2():
from sympy.functions.special.hyper import HyperRep_power2
assert _test_args(HyperRep_power2(x, y))
def test_sympy__functions__special__hyper__HyperRep_log1():
from sympy.functions.special.hyper import HyperRep_log1
assert _test_args(HyperRep_log1(x))
def test_sympy__functions__special__hyper__HyperRep_atanh():
from sympy.functions.special.hyper import HyperRep_atanh
assert _test_args(HyperRep_atanh(x))
def test_sympy__functions__special__hyper__HyperRep_asin1():
from sympy.functions.special.hyper import HyperRep_asin1
assert _test_args(HyperRep_asin1(x))
def test_sympy__functions__special__hyper__HyperRep_asin2():
from sympy.functions.special.hyper import HyperRep_asin2
assert _test_args(HyperRep_asin2(x))
def test_sympy__functions__special__hyper__HyperRep_sqrts1():
from sympy.functions.special.hyper import HyperRep_sqrts1
assert _test_args(HyperRep_sqrts1(x, y))
def test_sympy__functions__special__hyper__HyperRep_sqrts2():
from sympy.functions.special.hyper import HyperRep_sqrts2
assert _test_args(HyperRep_sqrts2(x, y))
def test_sympy__functions__special__hyper__HyperRep_log2():
from sympy.functions.special.hyper import HyperRep_log2
assert _test_args(HyperRep_log2(x))
def test_sympy__functions__special__hyper__HyperRep_cosasin():
from sympy.functions.special.hyper import HyperRep_cosasin
assert _test_args(HyperRep_cosasin(x, y))
def test_sympy__functions__special__hyper__HyperRep_sinasin():
from sympy.functions.special.hyper import HyperRep_sinasin
assert _test_args(HyperRep_sinasin(x, y))
@SKIP("abstract class")
def test_sympy__functions__special__polynomials__OrthogonalPolynomial():
pass
def test_sympy__functions__special__polynomials__jacobi():
from sympy.functions.special.polynomials import jacobi
assert _test_args(jacobi(x, 2, 2, 2))
def test_sympy__functions__special__polynomials__gegenbauer():
from sympy.functions.special.polynomials import gegenbauer
assert _test_args(gegenbauer(x, 2, 2))
def test_sympy__functions__special__polynomials__chebyshevt():
from sympy.functions.special.polynomials import chebyshevt
assert _test_args(chebyshevt(x, 2))
def test_sympy__functions__special__polynomials__chebyshevt_root():
from sympy.functions.special.polynomials import chebyshevt_root
assert _test_args(chebyshevt_root(3, 2))
def test_sympy__functions__special__polynomials__chebyshevu():
from sympy.functions.special.polynomials import chebyshevu
assert _test_args(chebyshevu(x, 2))
def test_sympy__functions__special__polynomials__chebyshevu_root():
from sympy.functions.special.polynomials import chebyshevu_root
assert _test_args(chebyshevu_root(3, 2))
def test_sympy__functions__special__polynomials__hermite():
from sympy.functions.special.polynomials import hermite
assert _test_args(hermite(x, 2))
def test_sympy__functions__special__polynomials__legendre():
from sympy.functions.special.polynomials import legendre
assert _test_args(legendre(x, 2))
def test_sympy__functions__special__polynomials__assoc_legendre():
from sympy.functions.special.polynomials import assoc_legendre
assert _test_args(assoc_legendre(x, 0, y))
def test_sympy__functions__special__polynomials__laguerre():
from sympy.functions.special.polynomials import laguerre
assert _test_args(laguerre(x, 2))
def test_sympy__functions__special__polynomials__assoc_laguerre():
from sympy.functions.special.polynomials import assoc_laguerre
assert _test_args(assoc_laguerre(x, 0, y))
def test_sympy__functions__special__spherical_harmonics__Ynm():
from sympy.functions.special.spherical_harmonics import Ynm
assert _test_args(Ynm(1, 1, x, y))
def test_sympy__functions__special__spherical_harmonics__Znm():
from sympy.functions.special.spherical_harmonics import Znm
assert _test_args(Znm(1, 1, x, y))
def test_sympy__functions__special__tensor_functions__LeviCivita():
from sympy.functions.special.tensor_functions import LeviCivita
assert _test_args(LeviCivita(x, y, 2))
def test_sympy__functions__special__tensor_functions__KroneckerDelta():
from sympy.functions.special.tensor_functions import KroneckerDelta
assert _test_args(KroneckerDelta(x, y))
def test_sympy__functions__special__zeta_functions__dirichlet_eta():
from sympy.functions.special.zeta_functions import dirichlet_eta
assert _test_args(dirichlet_eta(x))
def test_sympy__functions__special__zeta_functions__zeta():
from sympy.functions.special.zeta_functions import zeta
assert _test_args(zeta(101))
def test_sympy__functions__special__zeta_functions__lerchphi():
from sympy.functions.special.zeta_functions import lerchphi
assert _test_args(lerchphi(x, y, z))
def test_sympy__functions__special__zeta_functions__polylog():
from sympy.functions.special.zeta_functions import polylog
assert _test_args(polylog(x, y))
def test_sympy__integrals__integrals__Integral():
from sympy.integrals.integrals import Integral
assert _test_args(Integral(2, (x, 0, 1)))
def test_sympy__integrals__risch__NonElementaryIntegral():
from sympy.integrals.risch import NonElementaryIntegral
assert _test_args(NonElementaryIntegral(exp(-x**2), x))
@SKIP("abstract class")
def test_sympy__integrals__transforms__IntegralTransform():
pass
def test_sympy__integrals__transforms__MellinTransform():
from sympy.integrals.transforms import MellinTransform
assert _test_args(MellinTransform(2, x, y))
def test_sympy__integrals__transforms__InverseMellinTransform():
from sympy.integrals.transforms import InverseMellinTransform
assert _test_args(InverseMellinTransform(2, x, y, 0, 1))
def test_sympy__integrals__transforms__LaplaceTransform():
from sympy.integrals.transforms import LaplaceTransform
assert _test_args(LaplaceTransform(2, x, y))
def test_sympy__integrals__transforms__InverseLaplaceTransform():
from sympy.integrals.transforms import InverseLaplaceTransform
assert _test_args(InverseLaplaceTransform(2, x, y, 0))
@SKIP("abstract class")
def test_sympy__integrals__transforms__FourierTypeTransform():
pass
def test_sympy__integrals__transforms__InverseFourierTransform():
from sympy.integrals.transforms import InverseFourierTransform
assert _test_args(InverseFourierTransform(2, x, y))
def test_sympy__integrals__transforms__FourierTransform():
from sympy.integrals.transforms import FourierTransform
assert _test_args(FourierTransform(2, x, y))
@SKIP("abstract class")
def test_sympy__integrals__transforms__SineCosineTypeTransform():
pass
def test_sympy__integrals__transforms__InverseSineTransform():
from sympy.integrals.transforms import InverseSineTransform
assert _test_args(InverseSineTransform(2, x, y))
def test_sympy__integrals__transforms__SineTransform():
from sympy.integrals.transforms import SineTransform
assert _test_args(SineTransform(2, x, y))
def test_sympy__integrals__transforms__InverseCosineTransform():
from sympy.integrals.transforms import InverseCosineTransform
assert _test_args(InverseCosineTransform(2, x, y))
def test_sympy__integrals__transforms__CosineTransform():
from sympy.integrals.transforms import CosineTransform
assert _test_args(CosineTransform(2, x, y))
@SKIP("abstract class")
def test_sympy__integrals__transforms__HankelTypeTransform():
pass
def test_sympy__integrals__transforms__InverseHankelTransform():
from sympy.integrals.transforms import InverseHankelTransform
assert _test_args(InverseHankelTransform(2, x, y, 0))
def test_sympy__integrals__transforms__HankelTransform():
from sympy.integrals.transforms import HankelTransform
assert _test_args(HankelTransform(2, x, y, 0))
@XFAIL
def test_sympy__liealgebras__cartan_type__CartanType_generator():
from sympy.liealgebras.cartan_type import CartanType_generator
assert _test_args(CartanType_generator("A2"))
@XFAIL
def test_sympy__liealgebras__cartan_type__Standard_Cartan():
from sympy.liealgebras.cartan_type import Standard_Cartan
assert _test_args(Standard_Cartan("A", 2))
@XFAIL
def test_sympy__liealgebras__weyl_group__WeylGroup():
from sympy.liealgebras.weyl_group import WeylGroup
assert _test_args(WeylGroup("B4"))
@XFAIL
def test_sympy__liealgebras__root_system__RootSystem():
from sympy.liealgebras.root_system import RootSystem
assert _test_args(RootSystem("A2"))
@XFAIL
def test_sympy__liealgebras__type_a__TypeA():
from sympy.liealgebras.type_a import TypeA
assert _test_args(TypeA(2))
@XFAIL
def test_sympy__liealgebras__type_b__TypeB():
from sympy.liealgebras.type_b import TypeB
assert _test_args(TypeB(4))
@XFAIL
def test_sympy__liealgebras__type_c__TypeC():
from sympy.liealgebras.type_c import TypeC
assert _test_args(TypeC(4))
@XFAIL
def test_sympy__liealgebras__type_d__TypeD():
from sympy.liealgebras.type_d import TypeD
assert _test_args(TypeD(4))
@XFAIL
def test_sympy__liealgebras__type_e__TypeE():
from sympy.liealgebras.type_e import TypeE
assert _test_args(TypeE(6))
@XFAIL
def test_sympy__liealgebras__type_f__TypeF():
from sympy.liealgebras.type_f import TypeF
assert _test_args(TypeF(4))
@XFAIL
def test_sympy__liealgebras__type_g__TypeG():
from sympy.liealgebras.type_g import TypeG
assert _test_args(TypeG(2))
def test_sympy__logic__boolalg__And():
from sympy.logic.boolalg import And
assert _test_args(And(x, y, 2))
@SKIP("abstract class")
def test_sympy__logic__boolalg__Boolean():
pass
def test_sympy__logic__boolalg__BooleanFunction():
from sympy.logic.boolalg import BooleanFunction
assert _test_args(BooleanFunction(1, 2, 3))
@SKIP("abstract class")
def test_sympy__logic__boolalg__BooleanAtom():
pass
def test_sympy__logic__boolalg__BooleanTrue():
from sympy.logic.boolalg import true
assert _test_args(true)
def test_sympy__logic__boolalg__BooleanFalse():
from sympy.logic.boolalg import false
assert _test_args(false)
def test_sympy__logic__boolalg__Equivalent():
from sympy.logic.boolalg import Equivalent
assert _test_args(Equivalent(x, 2))
def test_sympy__logic__boolalg__ITE():
from sympy.logic.boolalg import ITE
assert _test_args(ITE(x, y, 2))
def test_sympy__logic__boolalg__Implies():
from sympy.logic.boolalg import Implies
assert _test_args(Implies(x, y))
def test_sympy__logic__boolalg__Nand():
from sympy.logic.boolalg import Nand
assert _test_args(Nand(x, y, 2))
def test_sympy__logic__boolalg__Nor():
from sympy.logic.boolalg import Nor
assert _test_args(Nor(x, y))
def test_sympy__logic__boolalg__Not():
from sympy.logic.boolalg import Not
assert _test_args(Not(x))
def test_sympy__logic__boolalg__Or():
from sympy.logic.boolalg import Or
assert _test_args(Or(x, y))
def test_sympy__logic__boolalg__Xor():
from sympy.logic.boolalg import Xor
assert _test_args(Xor(x, y, 2))
def test_sympy__matrices__matrices__DeferredVector():
from sympy.matrices.matrices import DeferredVector
assert _test_args(DeferredVector("X"))
@SKIP("abstract class")
def test_sympy__matrices__expressions__matexpr__MatrixBase():
pass
def test_sympy__matrices__immutable__ImmutableMatrix():
from sympy.matrices.immutable import ImmutableMatrix
m = ImmutableMatrix([[1, 2], [3, 4]])
assert _test_args(m)
assert _test_args(Basic(*list(m)))
m = ImmutableMatrix(1, 1, [1])
assert _test_args(m)
assert _test_args(Basic(*list(m)))
m = ImmutableMatrix(2, 2, lambda i, j: 1)
assert m[0, 0] is S.One
m = ImmutableMatrix(2, 2, lambda i, j: 1/(1 + i) + 1/(1 + j))
assert m[1, 1] is S.One # true div. will give 1.0 if i,j not sympified
assert _test_args(m)
assert _test_args(Basic(*list(m)))
def test_sympy__matrices__immutable__ImmutableSparseMatrix():
from sympy.matrices.immutable import ImmutableSparseMatrix
m = ImmutableSparseMatrix([[1, 2], [3, 4]])
assert _test_args(m)
assert _test_args(Basic(*list(m)))
m = ImmutableSparseMatrix(1, 1, {(0, 0): 1})
assert _test_args(m)
assert _test_args(Basic(*list(m)))
m = ImmutableSparseMatrix(1, 1, [1])
assert _test_args(m)
assert _test_args(Basic(*list(m)))
m = ImmutableSparseMatrix(2, 2, lambda i, j: 1)
assert m[0, 0] is S.One
m = ImmutableSparseMatrix(2, 2, lambda i, j: 1/(1 + i) + 1/(1 + j))
assert m[1, 1] is S.One # true div. will give 1.0 if i,j not sympified
assert _test_args(m)
assert _test_args(Basic(*list(m)))
def test_sympy__matrices__expressions__slice__MatrixSlice():
from sympy.matrices.expressions.slice import MatrixSlice
from sympy.matrices.expressions import MatrixSymbol
X = MatrixSymbol('X', 4, 4)
assert _test_args(MatrixSlice(X, (0, 2), (0, 2)))
def test_sympy__matrices__expressions__blockmatrix__BlockDiagMatrix():
from sympy.matrices.expressions.blockmatrix import BlockDiagMatrix
from sympy.matrices.expressions import MatrixSymbol
X = MatrixSymbol('X', x, x)
Y = MatrixSymbol('Y', y, y)
assert _test_args(BlockDiagMatrix(X, Y))
def test_sympy__matrices__expressions__blockmatrix__BlockMatrix():
from sympy.matrices.expressions.blockmatrix import BlockMatrix
from sympy.matrices.expressions import MatrixSymbol, ZeroMatrix
X = MatrixSymbol('X', x, x)
Y = MatrixSymbol('Y', y, y)
Z = MatrixSymbol('Z', x, y)
O = ZeroMatrix(y, x)
assert _test_args(BlockMatrix([[X, Z], [O, Y]]))
def test_sympy__matrices__expressions__inverse__Inverse():
from sympy.matrices.expressions.inverse import Inverse
from sympy.matrices.expressions import MatrixSymbol
assert _test_args(Inverse(MatrixSymbol('A', 3, 3)))
def test_sympy__matrices__expressions__matadd__MatAdd():
from sympy.matrices.expressions.matadd import MatAdd
from sympy.matrices.expressions import MatrixSymbol
X = MatrixSymbol('X', x, y)
Y = MatrixSymbol('Y', x, y)
assert _test_args(MatAdd(X, Y))
def test_sympy__matrices__expressions__matexpr__Identity():
from sympy.matrices.expressions.matexpr import Identity
assert _test_args(Identity(3))
@SKIP("abstract class")
def test_sympy__matrices__expressions__matexpr__MatrixExpr():
pass
def test_sympy__matrices__expressions__matexpr__MatrixElement():
from sympy.matrices.expressions.matexpr import MatrixSymbol, MatrixElement
from sympy import S
assert _test_args(MatrixElement(MatrixSymbol('A', 3, 5), S(2), S(3)))
@XFAIL
def test_sympy__matrices__expressions__matexpr__MatrixSymbol():
from sympy.matrices.expressions.matexpr import MatrixSymbol
assert _test_args(MatrixSymbol('A', 3, 5))
def test_sympy__matrices__expressions__matexpr__ZeroMatrix():
from sympy.matrices.expressions.matexpr import ZeroMatrix
assert _test_args(ZeroMatrix(3, 5))
def test_sympy__matrices__expressions__matmul__MatMul():
from sympy.matrices.expressions.matmul import MatMul
from sympy.matrices.expressions import MatrixSymbol
X = MatrixSymbol('X', x, y)
Y = MatrixSymbol('Y', y, x)
assert _test_args(MatMul(X, Y))
def test_sympy__matrices__expressions__diagonal__DiagonalMatrix():
from sympy.matrices.expressions.diagonal import DiagonalMatrix
from sympy.matrices.expressions import MatrixSymbol
x = MatrixSymbol('x', 10, 1)
assert _test_args(DiagonalMatrix(x))
def test_sympy__matrices__expressions__diagonal__DiagonalOf():
from sympy.matrices.expressions.diagonal import DiagonalOf
from sympy.matrices.expressions import MatrixSymbol
X = MatrixSymbol('x', 10, 10)
assert _test_args(DiagonalOf(X))
def test_sympy__matrices__expressions__hadamard__HadamardProduct():
from sympy.matrices.expressions.hadamard import HadamardProduct
from sympy.matrices.expressions import MatrixSymbol
X = MatrixSymbol('X', x, y)
Y = MatrixSymbol('Y', x, y)
assert _test_args(HadamardProduct(X, Y))
def test_sympy__matrices__expressions__matpow__MatPow():
from sympy.matrices.expressions.matpow import MatPow
from sympy.matrices.expressions import MatrixSymbol
X = MatrixSymbol('X', x, x)
assert _test_args(MatPow(X, 2))
def test_sympy__matrices__expressions__transpose__Transpose():
from sympy.matrices.expressions.transpose import Transpose
from sympy.matrices.expressions import MatrixSymbol
assert _test_args(Transpose(MatrixSymbol('A', 3, 5)))
def test_sympy__matrices__expressions__adjoint__Adjoint():
from sympy.matrices.expressions.adjoint import Adjoint
from sympy.matrices.expressions import MatrixSymbol
assert _test_args(Adjoint(MatrixSymbol('A', 3, 5)))
def test_sympy__matrices__expressions__trace__Trace():
from sympy.matrices.expressions.trace import Trace
from sympy.matrices.expressions import MatrixSymbol
assert _test_args(Trace(MatrixSymbol('A', 3, 3)))
def test_sympy__matrices__expressions__determinant__Determinant():
from sympy.matrices.expressions.determinant import Determinant
from sympy.matrices.expressions import MatrixSymbol
assert _test_args(Determinant(MatrixSymbol('A', 3, 3)))
def test_sympy__matrices__expressions__funcmatrix__FunctionMatrix():
from sympy.matrices.expressions.funcmatrix import FunctionMatrix
from sympy import Lambda, symbols
i, j = symbols('i,j')
assert _test_args(FunctionMatrix(3, 3, Lambda((i, j), i - j) ))
def test_sympy__matrices__expressions__fourier__DFT():
from sympy.matrices.expressions.fourier import DFT
from sympy import S
assert _test_args(DFT(S(2)))
def test_sympy__matrices__expressions__fourier__IDFT():
from sympy.matrices.expressions.fourier import IDFT
from sympy import S
assert _test_args(IDFT(S(2)))
from sympy.matrices.expressions import MatrixSymbol
X = MatrixSymbol('X', 10, 10)
def test_sympy__matrices__expressions__factorizations__LofLU():
from sympy.matrices.expressions.factorizations import LofLU
assert _test_args(LofLU(X))
def test_sympy__matrices__expressions__factorizations__UofLU():
from sympy.matrices.expressions.factorizations import UofLU
assert _test_args(UofLU(X))
def test_sympy__matrices__expressions__factorizations__QofQR():
from sympy.matrices.expressions.factorizations import QofQR
assert _test_args(QofQR(X))
def test_sympy__matrices__expressions__factorizations__RofQR():
from sympy.matrices.expressions.factorizations import RofQR
assert _test_args(RofQR(X))
def test_sympy__matrices__expressions__factorizations__LofCholesky():
from sympy.matrices.expressions.factorizations import LofCholesky
assert _test_args(LofCholesky(X))
def test_sympy__matrices__expressions__factorizations__UofCholesky():
from sympy.matrices.expressions.factorizations import UofCholesky
assert _test_args(UofCholesky(X))
def test_sympy__matrices__expressions__factorizations__EigenVectors():
from sympy.matrices.expressions.factorizations import EigenVectors
assert _test_args(EigenVectors(X))
def test_sympy__matrices__expressions__factorizations__EigenValues():
from sympy.matrices.expressions.factorizations import EigenValues
assert _test_args(EigenValues(X))
def test_sympy__matrices__expressions__factorizations__UofSVD():
from sympy.matrices.expressions.factorizations import UofSVD
assert _test_args(UofSVD(X))
def test_sympy__matrices__expressions__factorizations__VofSVD():
from sympy.matrices.expressions.factorizations import VofSVD
assert _test_args(VofSVD(X))
def test_sympy__matrices__expressions__factorizations__SofSVD():
from sympy.matrices.expressions.factorizations import SofSVD
assert _test_args(SofSVD(X))
@SKIP("abstract class")
def test_sympy__matrices__expressions__factorizations__Factorization():
pass
def test_sympy__physics__vector__frame__CoordinateSym():
from sympy.physics.vector import CoordinateSym
from sympy.physics.vector import ReferenceFrame
assert _test_args(CoordinateSym('R_x', ReferenceFrame('R'), 0))
def test_sympy__physics__paulialgebra__Pauli():
from sympy.physics.paulialgebra import Pauli
assert _test_args(Pauli(1))
def test_sympy__physics__quantum__anticommutator__AntiCommutator():
from sympy.physics.quantum.anticommutator import AntiCommutator
assert _test_args(AntiCommutator(x, y))
def test_sympy__physics__quantum__cartesian__PositionBra3D():
from sympy.physics.quantum.cartesian import PositionBra3D
assert _test_args(PositionBra3D(x, y, z))
def test_sympy__physics__quantum__cartesian__PositionKet3D():
from sympy.physics.quantum.cartesian import PositionKet3D
assert _test_args(PositionKet3D(x, y, z))
def test_sympy__physics__quantum__cartesian__PositionState3D():
from sympy.physics.quantum.cartesian import PositionState3D
assert _test_args(PositionState3D(x, y, z))
def test_sympy__physics__quantum__cartesian__PxBra():
from sympy.physics.quantum.cartesian import PxBra
assert _test_args(PxBra(x, y, z))
def test_sympy__physics__quantum__cartesian__PxKet():
from sympy.physics.quantum.cartesian import PxKet
assert _test_args(PxKet(x, y, z))
def test_sympy__physics__quantum__cartesian__PxOp():
from sympy.physics.quantum.cartesian import PxOp
assert _test_args(PxOp(x, y, z))
def test_sympy__physics__quantum__cartesian__XBra():
from sympy.physics.quantum.cartesian import XBra
assert _test_args(XBra(x))
def test_sympy__physics__quantum__cartesian__XKet():
from sympy.physics.quantum.cartesian import XKet
assert _test_args(XKet(x))
def test_sympy__physics__quantum__cartesian__XOp():
from sympy.physics.quantum.cartesian import XOp
assert _test_args(XOp(x))
def test_sympy__physics__quantum__cartesian__YOp():
from sympy.physics.quantum.cartesian import YOp
assert _test_args(YOp(x))
def test_sympy__physics__quantum__cartesian__ZOp():
from sympy.physics.quantum.cartesian import ZOp
assert _test_args(ZOp(x))
def test_sympy__physics__quantum__cg__CG():
from sympy.physics.quantum.cg import CG
from sympy import S
assert _test_args(CG(S(3)/2, S(3)/2, S(1)/2, -S(1)/2, 1, 1))
def test_sympy__physics__quantum__cg__Wigner3j():
from sympy.physics.quantum.cg import Wigner3j
assert _test_args(Wigner3j(6, 0, 4, 0, 2, 0))
def test_sympy__physics__quantum__cg__Wigner6j():
from sympy.physics.quantum.cg import Wigner6j
assert _test_args(Wigner6j(1, 2, 3, 2, 1, 2))
def test_sympy__physics__quantum__cg__Wigner9j():
from sympy.physics.quantum.cg import Wigner9j
assert _test_args(Wigner9j(2, 1, 1, S(3)/2, S(1)/2, 1, S(1)/2, S(1)/2, 0))
def test_sympy__physics__quantum__circuitplot__Mz():
from sympy.physics.quantum.circuitplot import Mz
assert _test_args(Mz(0))
def test_sympy__physics__quantum__circuitplot__Mx():
from sympy.physics.quantum.circuitplot import Mx
assert _test_args(Mx(0))
def test_sympy__physics__quantum__commutator__Commutator():
from sympy.physics.quantum.commutator import Commutator
A, B = symbols('A,B', commutative=False)
assert _test_args(Commutator(A, B))
def test_sympy__physics__quantum__constants__HBar():
from sympy.physics.quantum.constants import HBar
assert _test_args(HBar())
def test_sympy__physics__quantum__dagger__Dagger():
from sympy.physics.quantum.dagger import Dagger
from sympy.physics.quantum.state import Ket
assert _test_args(Dagger(Dagger(Ket('psi'))))
def test_sympy__physics__quantum__gate__CGate():
from sympy.physics.quantum.gate import CGate, Gate
assert _test_args(CGate((0, 1), Gate(2)))
def test_sympy__physics__quantum__gate__CGateS():
from sympy.physics.quantum.gate import CGateS, Gate
assert _test_args(CGateS((0, 1), Gate(2)))
def test_sympy__physics__quantum__gate__CNotGate():
from sympy.physics.quantum.gate import CNotGate
assert _test_args(CNotGate(0, 1))
def test_sympy__physics__quantum__gate__Gate():
from sympy.physics.quantum.gate import Gate
assert _test_args(Gate(0))
def test_sympy__physics__quantum__gate__HadamardGate():
from sympy.physics.quantum.gate import HadamardGate
assert _test_args(HadamardGate(0))
def test_sympy__physics__quantum__gate__IdentityGate():
from sympy.physics.quantum.gate import IdentityGate
assert _test_args(IdentityGate(0))
def test_sympy__physics__quantum__gate__OneQubitGate():
from sympy.physics.quantum.gate import OneQubitGate
assert _test_args(OneQubitGate(0))
def test_sympy__physics__quantum__gate__PhaseGate():
from sympy.physics.quantum.gate import PhaseGate
assert _test_args(PhaseGate(0))
def test_sympy__physics__quantum__gate__SwapGate():
from sympy.physics.quantum.gate import SwapGate
assert _test_args(SwapGate(0, 1))
def test_sympy__physics__quantum__gate__TGate():
from sympy.physics.quantum.gate import TGate
assert _test_args(TGate(0))
def test_sympy__physics__quantum__gate__TwoQubitGate():
from sympy.physics.quantum.gate import TwoQubitGate
assert _test_args(TwoQubitGate(0))
def test_sympy__physics__quantum__gate__UGate():
from sympy.physics.quantum.gate import UGate
from sympy.matrices.immutable import ImmutableMatrix
from sympy import Integer, Tuple
assert _test_args(
UGate(Tuple(Integer(1)), ImmutableMatrix([[1, 0], [0, 2]])))
def test_sympy__physics__quantum__gate__XGate():
from sympy.physics.quantum.gate import XGate
assert _test_args(XGate(0))
def test_sympy__physics__quantum__gate__YGate():
from sympy.physics.quantum.gate import YGate
assert _test_args(YGate(0))
def test_sympy__physics__quantum__gate__ZGate():
from sympy.physics.quantum.gate import ZGate
assert _test_args(ZGate(0))
@SKIP("TODO: sympy.physics")
def test_sympy__physics__quantum__grover__OracleGate():
from sympy.physics.quantum.grover import OracleGate
assert _test_args(OracleGate())
def test_sympy__physics__quantum__grover__WGate():
from sympy.physics.quantum.grover import WGate
assert _test_args(WGate(1))
def test_sympy__physics__quantum__hilbert__ComplexSpace():
from sympy.physics.quantum.hilbert import ComplexSpace
assert _test_args(ComplexSpace(x))
def test_sympy__physics__quantum__hilbert__DirectSumHilbertSpace():
from sympy.physics.quantum.hilbert import DirectSumHilbertSpace, ComplexSpace, FockSpace
c = ComplexSpace(2)
f = FockSpace()
assert _test_args(DirectSumHilbertSpace(c, f))
def test_sympy__physics__quantum__hilbert__FockSpace():
from sympy.physics.quantum.hilbert import FockSpace
assert _test_args(FockSpace())
def test_sympy__physics__quantum__hilbert__HilbertSpace():
from sympy.physics.quantum.hilbert import HilbertSpace
assert _test_args(HilbertSpace())
def test_sympy__physics__quantum__hilbert__L2():
from sympy.physics.quantum.hilbert import L2
from sympy import oo, Interval
assert _test_args(L2(Interval(0, oo)))
def test_sympy__physics__quantum__hilbert__TensorPowerHilbertSpace():
from sympy.physics.quantum.hilbert import TensorPowerHilbertSpace, FockSpace
f = FockSpace()
assert _test_args(TensorPowerHilbertSpace(f, 2))
def test_sympy__physics__quantum__hilbert__TensorProductHilbertSpace():
from sympy.physics.quantum.hilbert import TensorProductHilbertSpace, FockSpace, ComplexSpace
c = ComplexSpace(2)
f = FockSpace()
assert _test_args(TensorProductHilbertSpace(f, c))
def test_sympy__physics__quantum__innerproduct__InnerProduct():
from sympy.physics.quantum import Bra, Ket, InnerProduct
b = Bra('b')
k = Ket('k')
assert _test_args(InnerProduct(b, k))
def test_sympy__physics__quantum__operator__DifferentialOperator():
from sympy.physics.quantum.operator import DifferentialOperator
from sympy import Derivative, Function
f = Function('f')
assert _test_args(DifferentialOperator(1/x*Derivative(f(x), x), f(x)))
def test_sympy__physics__quantum__operator__HermitianOperator():
from sympy.physics.quantum.operator import HermitianOperator
assert _test_args(HermitianOperator('H'))
def test_sympy__physics__quantum__operator__IdentityOperator():
from sympy.physics.quantum.operator import IdentityOperator
assert _test_args(IdentityOperator(5))
def test_sympy__physics__quantum__operator__Operator():
from sympy.physics.quantum.operator import Operator
assert _test_args(Operator('A'))
def test_sympy__physics__quantum__operator__OuterProduct():
from sympy.physics.quantum.operator import OuterProduct
from sympy.physics.quantum import Ket, Bra
b = Bra('b')
k = Ket('k')
assert _test_args(OuterProduct(k, b))
def test_sympy__physics__quantum__operator__UnitaryOperator():
from sympy.physics.quantum.operator import UnitaryOperator
assert _test_args(UnitaryOperator('U'))
def test_sympy__physics__quantum__piab__PIABBra():
from sympy.physics.quantum.piab import PIABBra
assert _test_args(PIABBra('B'))
def test_sympy__physics__quantum__boson__BosonOp():
from sympy.physics.quantum.boson import BosonOp
assert _test_args(BosonOp('a'))
assert _test_args(BosonOp('a', False))
def test_sympy__physics__quantum__boson__BosonFockKet():
from sympy.physics.quantum.boson import BosonFockKet
assert _test_args(BosonFockKet(1))
def test_sympy__physics__quantum__boson__BosonFockBra():
from sympy.physics.quantum.boson import BosonFockBra
assert _test_args(BosonFockBra(1))
def test_sympy__physics__quantum__boson__BosonCoherentKet():
from sympy.physics.quantum.boson import BosonCoherentKet
assert _test_args(BosonCoherentKet(1))
def test_sympy__physics__quantum__boson__BosonCoherentBra():
from sympy.physics.quantum.boson import BosonCoherentBra
assert _test_args(BosonCoherentBra(1))
def test_sympy__physics__quantum__fermion__FermionOp():
from sympy.physics.quantum.fermion import FermionOp
assert _test_args(FermionOp('c'))
assert _test_args(FermionOp('c', False))
def test_sympy__physics__quantum__fermion__FermionFockKet():
from sympy.physics.quantum.fermion import FermionFockKet
assert _test_args(FermionFockKet(1))
def test_sympy__physics__quantum__fermion__FermionFockBra():
from sympy.physics.quantum.fermion import FermionFockBra
assert _test_args(FermionFockBra(1))
def test_sympy__physics__quantum__pauli__SigmaOpBase():
from sympy.physics.quantum.pauli import SigmaOpBase
assert _test_args(SigmaOpBase())
def test_sympy__physics__quantum__pauli__SigmaX():
from sympy.physics.quantum.pauli import SigmaX
assert _test_args(SigmaX())
def test_sympy__physics__quantum__pauli__SigmaY():
from sympy.physics.quantum.pauli import SigmaY
assert _test_args(SigmaY())
def test_sympy__physics__quantum__pauli__SigmaZ():
from sympy.physics.quantum.pauli import SigmaZ
assert _test_args(SigmaZ())
def test_sympy__physics__quantum__pauli__SigmaMinus():
from sympy.physics.quantum.pauli import SigmaMinus
assert _test_args(SigmaMinus())
def test_sympy__physics__quantum__pauli__SigmaPlus():
from sympy.physics.quantum.pauli import SigmaPlus
assert _test_args(SigmaPlus())
def test_sympy__physics__quantum__pauli__SigmaZKet():
from sympy.physics.quantum.pauli import SigmaZKet
assert _test_args(SigmaZKet(0))
def test_sympy__physics__quantum__pauli__SigmaZBra():
from sympy.physics.quantum.pauli import SigmaZBra
assert _test_args(SigmaZBra(0))
def test_sympy__physics__quantum__piab__PIABHamiltonian():
from sympy.physics.quantum.piab import PIABHamiltonian
assert _test_args(PIABHamiltonian('P'))
def test_sympy__physics__quantum__piab__PIABKet():
from sympy.physics.quantum.piab import PIABKet
assert _test_args(PIABKet('K'))
def test_sympy__physics__quantum__qexpr__QExpr():
from sympy.physics.quantum.qexpr import QExpr
assert _test_args(QExpr(0))
def test_sympy__physics__quantum__qft__Fourier():
from sympy.physics.quantum.qft import Fourier
assert _test_args(Fourier(0, 1))
def test_sympy__physics__quantum__qft__IQFT():
from sympy.physics.quantum.qft import IQFT
assert _test_args(IQFT(0, 1))
def test_sympy__physics__quantum__qft__QFT():
from sympy.physics.quantum.qft import QFT
assert _test_args(QFT(0, 1))
def test_sympy__physics__quantum__qft__RkGate():
from sympy.physics.quantum.qft import RkGate
assert _test_args(RkGate(0, 1))
def test_sympy__physics__quantum__qubit__IntQubit():
from sympy.physics.quantum.qubit import IntQubit
assert _test_args(IntQubit(0))
def test_sympy__physics__quantum__qubit__IntQubitBra():
from sympy.physics.quantum.qubit import IntQubitBra
assert _test_args(IntQubitBra(0))
def test_sympy__physics__quantum__qubit__IntQubitState():
from sympy.physics.quantum.qubit import IntQubitState, QubitState
assert _test_args(IntQubitState(QubitState(0, 1)))
def test_sympy__physics__quantum__qubit__Qubit():
from sympy.physics.quantum.qubit import Qubit
assert _test_args(Qubit(0, 0, 0))
def test_sympy__physics__quantum__qubit__QubitBra():
from sympy.physics.quantum.qubit import QubitBra
assert _test_args(QubitBra('1', 0))
def test_sympy__physics__quantum__qubit__QubitState():
from sympy.physics.quantum.qubit import QubitState
assert _test_args(QubitState(0, 1))
def test_sympy__physics__quantum__density__Density():
from sympy.physics.quantum.density import Density
from sympy.physics.quantum.state import Ket
assert _test_args(Density([Ket(0), 0.5], [Ket(1), 0.5]))
@SKIP("TODO: sympy.physics.quantum.shor: Cmod Not Implemented")
def test_sympy__physics__quantum__shor__CMod():
from sympy.physics.quantum.shor import CMod
assert _test_args(CMod())
def test_sympy__physics__quantum__spin__CoupledSpinState():
from sympy.physics.quantum.spin import CoupledSpinState
assert _test_args(CoupledSpinState(1, 0, (1, 1)))
assert _test_args(CoupledSpinState(1, 0, (1, S(1)/2, S(1)/2)))
assert _test_args(CoupledSpinState(
1, 0, (1, S(1)/2, S(1)/2), ((2, 3, S(1)/2), (1, 2, 1)) ))
j, m, j1, j2, j3, j12, x = symbols('j m j1:4 j12 x')
assert CoupledSpinState(
j, m, (j1, j2, j3)).subs(j2, x) == CoupledSpinState(j, m, (j1, x, j3))
assert CoupledSpinState(j, m, (j1, j2, j3), ((1, 3, j12), (1, 2, j)) ).subs(j12, x) == \
CoupledSpinState(j, m, (j1, j2, j3), ((1, 3, x), (1, 2, j)) )
def test_sympy__physics__quantum__spin__J2Op():
from sympy.physics.quantum.spin import J2Op
assert _test_args(J2Op('J'))
def test_sympy__physics__quantum__spin__JminusOp():
from sympy.physics.quantum.spin import JminusOp
assert _test_args(JminusOp('J'))
def test_sympy__physics__quantum__spin__JplusOp():
from sympy.physics.quantum.spin import JplusOp
assert _test_args(JplusOp('J'))
def test_sympy__physics__quantum__spin__JxBra():
from sympy.physics.quantum.spin import JxBra
assert _test_args(JxBra(1, 0))
def test_sympy__physics__quantum__spin__JxBraCoupled():
from sympy.physics.quantum.spin import JxBraCoupled
assert _test_args(JxBraCoupled(1, 0, (1, 1)))
def test_sympy__physics__quantum__spin__JxKet():
from sympy.physics.quantum.spin import JxKet
assert _test_args(JxKet(1, 0))
def test_sympy__physics__quantum__spin__JxKetCoupled():
from sympy.physics.quantum.spin import JxKetCoupled
assert _test_args(JxKetCoupled(1, 0, (1, 1)))
def test_sympy__physics__quantum__spin__JxOp():
from sympy.physics.quantum.spin import JxOp
assert _test_args(JxOp('J'))
def test_sympy__physics__quantum__spin__JyBra():
from sympy.physics.quantum.spin import JyBra
assert _test_args(JyBra(1, 0))
def test_sympy__physics__quantum__spin__JyBraCoupled():
from sympy.physics.quantum.spin import JyBraCoupled
assert _test_args(JyBraCoupled(1, 0, (1, 1)))
def test_sympy__physics__quantum__spin__JyKet():
from sympy.physics.quantum.spin import JyKet
assert _test_args(JyKet(1, 0))
def test_sympy__physics__quantum__spin__JyKetCoupled():
from sympy.physics.quantum.spin import JyKetCoupled
assert _test_args(JyKetCoupled(1, 0, (1, 1)))
def test_sympy__physics__quantum__spin__JyOp():
from sympy.physics.quantum.spin import JyOp
assert _test_args(JyOp('J'))
def test_sympy__physics__quantum__spin__JzBra():
from sympy.physics.quantum.spin import JzBra
assert _test_args(JzBra(1, 0))
def test_sympy__physics__quantum__spin__JzBraCoupled():
from sympy.physics.quantum.spin import JzBraCoupled
assert _test_args(JzBraCoupled(1, 0, (1, 1)))
def test_sympy__physics__quantum__spin__JzKet():
from sympy.physics.quantum.spin import JzKet
assert _test_args(JzKet(1, 0))
def test_sympy__physics__quantum__spin__JzKetCoupled():
from sympy.physics.quantum.spin import JzKetCoupled
assert _test_args(JzKetCoupled(1, 0, (1, 1)))
def test_sympy__physics__quantum__spin__JzOp():
from sympy.physics.quantum.spin import JzOp
assert _test_args(JzOp('J'))
def test_sympy__physics__quantum__spin__Rotation():
from sympy.physics.quantum.spin import Rotation
from sympy import pi
assert _test_args(Rotation(pi, 0, pi/2))
def test_sympy__physics__quantum__spin__SpinState():
from sympy.physics.quantum.spin import SpinState
assert _test_args(SpinState(1, 0))
def test_sympy__physics__quantum__spin__WignerD():
from sympy.physics.quantum.spin import WignerD
assert _test_args(WignerD(0, 1, 2, 3, 4, 5))
def test_sympy__physics__quantum__state__Bra():
from sympy.physics.quantum.state import Bra
assert _test_args(Bra(0))
def test_sympy__physics__quantum__state__BraBase():
from sympy.physics.quantum.state import BraBase
assert _test_args(BraBase(0))
def test_sympy__physics__quantum__state__Ket():
from sympy.physics.quantum.state import Ket
assert _test_args(Ket(0))
def test_sympy__physics__quantum__state__KetBase():
from sympy.physics.quantum.state import KetBase
assert _test_args(KetBase(0))
def test_sympy__physics__quantum__state__State():
from sympy.physics.quantum.state import State
assert _test_args(State(0))
def test_sympy__physics__quantum__state__StateBase():
from sympy.physics.quantum.state import StateBase
assert _test_args(StateBase(0))
def test_sympy__physics__quantum__state__TimeDepBra():
from sympy.physics.quantum.state import TimeDepBra
assert _test_args(TimeDepBra('psi', 't'))
def test_sympy__physics__quantum__state__TimeDepKet():
from sympy.physics.quantum.state import TimeDepKet
assert _test_args(TimeDepKet('psi', 't'))
def test_sympy__physics__quantum__state__TimeDepState():
from sympy.physics.quantum.state import TimeDepState
assert _test_args(TimeDepState('psi', 't'))
def test_sympy__physics__quantum__state__Wavefunction():
from sympy.physics.quantum.state import Wavefunction
from sympy.functions import sin
from sympy import Piecewise, pi
n = 1
L = 1
g = Piecewise((0, x < 0), (0, x > L), (sqrt(2//L)*sin(n*pi*x/L), True))
assert _test_args(Wavefunction(g, x))
def test_sympy__physics__quantum__tensorproduct__TensorProduct():
from sympy.physics.quantum.tensorproduct import TensorProduct
assert _test_args(TensorProduct(x, y))
def test_sympy__physics__quantum__identitysearch__GateIdentity():
from sympy.physics.quantum.gate import X
from sympy.physics.quantum.identitysearch import GateIdentity
assert _test_args(GateIdentity(X(0), X(0)))
def test_sympy__physics__quantum__sho1d__SHOOp():
from sympy.physics.quantum.sho1d import SHOOp
assert _test_args(SHOOp('a'))
def test_sympy__physics__quantum__sho1d__RaisingOp():
from sympy.physics.quantum.sho1d import RaisingOp
assert _test_args(RaisingOp('a'))
def test_sympy__physics__quantum__sho1d__LoweringOp():
from sympy.physics.quantum.sho1d import LoweringOp
assert _test_args(LoweringOp('a'))
def test_sympy__physics__quantum__sho1d__NumberOp():
from sympy.physics.quantum.sho1d import NumberOp
assert _test_args(NumberOp('N'))
def test_sympy__physics__quantum__sho1d__Hamiltonian():
from sympy.physics.quantum.sho1d import Hamiltonian
assert _test_args(Hamiltonian('H'))
def test_sympy__physics__quantum__sho1d__SHOState():
from sympy.physics.quantum.sho1d import SHOState
assert _test_args(SHOState(0))
def test_sympy__physics__quantum__sho1d__SHOKet():
from sympy.physics.quantum.sho1d import SHOKet
assert _test_args(SHOKet(0))
def test_sympy__physics__quantum__sho1d__SHOBra():
from sympy.physics.quantum.sho1d import SHOBra
assert _test_args(SHOBra(0))
def test_sympy__physics__secondquant__AnnihilateBoson():
from sympy.physics.secondquant import AnnihilateBoson
assert _test_args(AnnihilateBoson(0))
def test_sympy__physics__secondquant__AnnihilateFermion():
from sympy.physics.secondquant import AnnihilateFermion
assert _test_args(AnnihilateFermion(0))
@SKIP("abstract class")
def test_sympy__physics__secondquant__Annihilator():
pass
def test_sympy__physics__secondquant__AntiSymmetricTensor():
from sympy.physics.secondquant import AntiSymmetricTensor
i, j = symbols('i j', below_fermi=True)
a, b = symbols('a b', above_fermi=True)
assert _test_args(AntiSymmetricTensor('v', (a, i), (b, j)))
def test_sympy__physics__secondquant__BosonState():
from sympy.physics.secondquant import BosonState
assert _test_args(BosonState((0, 1)))
@SKIP("abstract class")
def test_sympy__physics__secondquant__BosonicOperator():
pass
def test_sympy__physics__secondquant__Commutator():
from sympy.physics.secondquant import Commutator
assert _test_args(Commutator(x, y))
def test_sympy__physics__secondquant__CreateBoson():
from sympy.physics.secondquant import CreateBoson
assert _test_args(CreateBoson(0))
def test_sympy__physics__secondquant__CreateFermion():
from sympy.physics.secondquant import CreateFermion
assert _test_args(CreateFermion(0))
@SKIP("abstract class")
def test_sympy__physics__secondquant__Creator():
pass
def test_sympy__physics__secondquant__Dagger():
from sympy.physics.secondquant import Dagger
from sympy import I
assert _test_args(Dagger(2*I))
def test_sympy__physics__secondquant__FermionState():
from sympy.physics.secondquant import FermionState
assert _test_args(FermionState((0, 1)))
def test_sympy__physics__secondquant__FermionicOperator():
from sympy.physics.secondquant import FermionicOperator
assert _test_args(FermionicOperator(0))
def test_sympy__physics__secondquant__FockState():
from sympy.physics.secondquant import FockState
assert _test_args(FockState((0, 1)))
def test_sympy__physics__secondquant__FockStateBosonBra():
from sympy.physics.secondquant import FockStateBosonBra
assert _test_args(FockStateBosonBra((0, 1)))
def test_sympy__physics__secondquant__FockStateBosonKet():
from sympy.physics.secondquant import FockStateBosonKet
assert _test_args(FockStateBosonKet((0, 1)))
def test_sympy__physics__secondquant__FockStateBra():
from sympy.physics.secondquant import FockStateBra
assert _test_args(FockStateBra((0, 1)))
def test_sympy__physics__secondquant__FockStateFermionBra():
from sympy.physics.secondquant import FockStateFermionBra
assert _test_args(FockStateFermionBra((0, 1)))
def test_sympy__physics__secondquant__FockStateFermionKet():
from sympy.physics.secondquant import FockStateFermionKet
assert _test_args(FockStateFermionKet((0, 1)))
def test_sympy__physics__secondquant__FockStateKet():
from sympy.physics.secondquant import FockStateKet
assert _test_args(FockStateKet((0, 1)))
def test_sympy__physics__secondquant__InnerProduct():
from sympy.physics.secondquant import InnerProduct
from sympy.physics.secondquant import FockStateKet, FockStateBra
assert _test_args(InnerProduct(FockStateBra((0, 1)), FockStateKet((0, 1))))
def test_sympy__physics__secondquant__NO():
from sympy.physics.secondquant import NO, F, Fd
assert _test_args(NO(Fd(x)*F(y)))
def test_sympy__physics__secondquant__PermutationOperator():
from sympy.physics.secondquant import PermutationOperator
assert _test_args(PermutationOperator(0, 1))
def test_sympy__physics__secondquant__SqOperator():
from sympy.physics.secondquant import SqOperator
assert _test_args(SqOperator(0))
def test_sympy__physics__secondquant__TensorSymbol():
from sympy.physics.secondquant import TensorSymbol
assert _test_args(TensorSymbol(x))
def test_sympy__physics__units__Unit():
from sympy.physics.units import Unit
assert _test_args(Unit("meter", "m"))
def test_sympy__physics__unitsystems__dimensions__Dimension():
from sympy.physics.unitsystems.dimensions import Dimension
assert _test_args(Dimension(name="length", symbol="L", length=1))
def test_sympy__physics__unitsystems__quantities__Quantity():
from sympy.physics.unitsystems.quantities import Quantity
from sympy.physics.unitsystems.systems import mks
assert _test_args(Quantity(10, mks["m"]))
def test_sympy__physics__unitsystems__units__Constant():
from sympy.physics.unitsystems.units import Constant
from sympy.physics.unitsystems.dimensions import Dimension
length = Dimension(length=1)
assert _test_args(Constant(length, abbrev="u", factor=10))
def test_sympy__physics__unitsystems__units__Unit():
from sympy.physics.unitsystems.units import Unit
from sympy.physics.unitsystems.dimensions import Dimension
length = Dimension(length=1)
assert _test_args(Unit(length, abbrev="u", factor=10))
def test_sympy__core__numbers__AlgebraicNumber():
from sympy.core.numbers import AlgebraicNumber
assert _test_args(AlgebraicNumber(sqrt(2), [1, 2, 3]))
def test_sympy__polys__polytools__GroebnerBasis():
from sympy.polys.polytools import GroebnerBasis
assert _test_args(GroebnerBasis([x, y, z], x, y, z))
def test_sympy__polys__polytools__Poly():
from sympy.polys.polytools import Poly
assert _test_args(Poly(2, x, y))
def test_sympy__polys__polytools__PurePoly():
from sympy.polys.polytools import PurePoly
assert _test_args(PurePoly(2, x, y))
def test_sympy__polys__rootoftools__RootOf():
from sympy.polys.rootoftools import RootOf
assert _test_args(RootOf(x**3 + x + 1, 0))
def test_sympy__polys__rootoftools__RootSum():
from sympy.polys.rootoftools import RootSum
assert _test_args(RootSum(x**3 + x + 1, sin))
def test_sympy__series__limits__Limit():
from sympy.series.limits import Limit
assert _test_args(Limit(x, x, 0, dir='-'))
def test_sympy__series__order__Order():
from sympy.series.order import Order
assert _test_args(Order(1, x, y))
def test_sympy__simplify__hyperexpand__Hyper_Function():
from sympy.simplify.hyperexpand import Hyper_Function
assert _test_args(Hyper_Function([2], [1]))
def test_sympy__simplify__hyperexpand__G_Function():
from sympy.simplify.hyperexpand import G_Function
assert _test_args(G_Function([2], [1], [], []))
def test_sympy__tensor__indexed__Idx():
from sympy.tensor.indexed import Idx
assert _test_args(Idx('test'))
assert _test_args(Idx(1, (0, 10)))
def test_sympy__tensor__indexed__Indexed():
from sympy.tensor.indexed import Indexed, Idx
assert _test_args(Indexed('A', Idx('i'), Idx('j')))
def test_sympy__tensor__indexed__IndexedBase():
from sympy.tensor.indexed import IndexedBase
assert _test_args(IndexedBase('A', shape=(x, y)))
assert _test_args(IndexedBase('A', 1))
assert _test_args(IndexedBase('A')[0, 1])
@XFAIL
def test_sympy__physics__hep__gamma_matrices__GammaMatrixHead():
# This test fails, this class can be reconstructed from the *args
# of an instance using `TensorHead(*args)`
from sympy.physics.hep.gamma_matrices import GammaMatrixHead, Lorentz
from sympy.tensor.tensor import tensor_indices
i = tensor_indices('i', Lorentz)
assert _test_args(GammaMatrixHead())
def test_sympy__tensor__tensor__TensorIndexType():
from sympy.tensor.tensor import TensorIndexType
assert _test_args(TensorIndexType('Lorentz', metric=False))
def test_sympy__tensor__tensor__TensorSymmetry():
from sympy.tensor.tensor import TensorSymmetry, get_symmetric_group_sgs
assert _test_args(TensorSymmetry(get_symmetric_group_sgs(2)))
def test_sympy__tensor__tensor__TensorType():
from sympy.tensor.tensor import TensorIndexType, TensorSymmetry, get_symmetric_group_sgs, TensorType
Lorentz = TensorIndexType('Lorentz', dummy_fmt='L')
sym = TensorSymmetry(get_symmetric_group_sgs(1))
assert _test_args(TensorType([Lorentz], sym))
def test_sympy__tensor__tensor__TensorHead():
from sympy.tensor.tensor import TensorIndexType, TensorSymmetry, TensorType, get_symmetric_group_sgs, TensorHead
Lorentz = TensorIndexType('Lorentz', dummy_fmt='L')
sym = TensorSymmetry(get_symmetric_group_sgs(1))
S1 = TensorType([Lorentz], sym)
assert _test_args(TensorHead('p', S1, 0))
def test_sympy__tensor__tensor__TensorIndex():
from sympy.tensor.tensor import TensorIndexType, TensorIndex
Lorentz = TensorIndexType('Lorentz', dummy_fmt='L')
assert _test_args(TensorIndex('i', Lorentz))
@SKIP("abstract class")
def test_sympy__tensor__tensor__TensExpr():
pass
def test_sympy__tensor__tensor__TensAdd():
from sympy.tensor.tensor import TensorIndexType, TensorSymmetry, TensorType, get_symmetric_group_sgs, tensor_indices, TensAdd
Lorentz = TensorIndexType('Lorentz', dummy_fmt='L')
a, b = tensor_indices('a,b', Lorentz)
sym = TensorSymmetry(get_symmetric_group_sgs(1))
S1 = TensorType([Lorentz], sym)
p, q = S1('p,q')
t1 = p(a)
t2 = q(a)
assert _test_args(TensAdd(t1, t2))
def test_sympy__tensor__tensor__Tensor():
from sympy.core import S
from sympy.tensor.tensor import TensorIndexType, TensorSymmetry, TensorType, get_symmetric_group_sgs, tensor_indices, TensMul, TIDS
Lorentz = TensorIndexType('Lorentz', dummy_fmt='L')
a, b = tensor_indices('a,b', Lorentz)
sym = TensorSymmetry(get_symmetric_group_sgs(1))
S1 = TensorType([Lorentz], sym)
p = S1('p')
assert _test_args(p(a))
def test_sympy__tensor__tensor__TensMul():
from sympy.core import S
from sympy.tensor.tensor import TensorIndexType, TensorSymmetry, TensorType, get_symmetric_group_sgs, tensor_indices, TensMul, TIDS
Lorentz = TensorIndexType('Lorentz', dummy_fmt='L')
a, b = tensor_indices('a,b', Lorentz)
sym = TensorSymmetry(get_symmetric_group_sgs(1))
S1 = TensorType([Lorentz], sym)
p = S1('p')
q = S1('q')
assert _test_args(3*p(a)*q(b))
def test_as_coeff_add():
assert (7, (3*x, 4*x**2)) == (7 + 3*x + 4*x**2).as_coeff_add()
def test_sympy__geometry__curve__Curve():
from sympy.geometry.curve import Curve
assert _test_args(Curve((x, 1), (x, 0, 1)))
def test_sympy__geometry__point__Point():
from sympy.geometry.point import Point
assert _test_args(Point(0, 1))
def test_sympy__geometry__point3d__Point3D():
from sympy.geometry.point3d import Point3D
assert _test_args(Point3D(0, 1, 2))
def test_sympy__geometry__ellipse__Ellipse():
from sympy.geometry.ellipse import Ellipse
assert _test_args(Ellipse((0, 1), 2, 3))
def test_sympy__geometry__ellipse__Circle():
from sympy.geometry.ellipse import Circle
assert _test_args(Circle((0, 1), 2))
@SKIP("abstract class")
def test_sympy__geometry__line__LinearEntity():
pass
def test_sympy__geometry__line__Line():
from sympy.geometry.line import Line
assert _test_args(Line((0, 1), (2, 3)))
def test_sympy__geometry__line__Ray():
from sympy.geometry.line import Ray
assert _test_args(Ray((0, 1), (2, 3)))
def test_sympy__geometry__line__Segment():
from sympy.geometry.line import Segment
assert _test_args(Segment((0, 1), (2, 3)))
@SKIP("abstract class")
def test_sympy__geometry__line3d__LinearEntity3D():
pass
def test_sympy__geometry__line3d__Line3D():
from sympy.geometry.line3d import Line3D
assert _test_args(Line3D((0, 1, 1), (2, 3, 4)))
def test_sympy__geometry__line3d__Segment3D():
from sympy.geometry.line3d import Segment3D
assert _test_args(Segment3D((0, 1, 1), (2, 3, 4)))
def test_sympy__geometry__line3d__Ray3D():
from sympy.geometry.line3d import Ray3D
assert _test_args(Ray3D((0, 1, 1), (2, 3, 4)))
def test_sympy__geometry__plane__Plane():
from sympy.geometry.plane import Plane
assert _test_args(Plane((1, 1, 1), (-3, 4, -2), (1, 2, 3)))
def test_sympy__geometry__polygon__Polygon():
from sympy.geometry.polygon import Polygon
assert _test_args(Polygon((0, 1), (2, 3), (4, 5), (6, 7)))
def test_sympy__geometry__polygon__RegularPolygon():
from sympy.geometry.polygon import RegularPolygon
assert _test_args(RegularPolygon((0, 1), 2, 3, 4))
def test_sympy__geometry__polygon__Triangle():
from sympy.geometry.polygon import Triangle
assert _test_args(Triangle((0, 1), (2, 3), (4, 5)))
def test_sympy__geometry__entity__GeometryEntity():
from sympy.geometry.entity import GeometryEntity
from sympy.geometry.point import Point
assert _test_args(GeometryEntity(Point(1, 0), 1, [1, 2]))
def test_sympy__diffgeom__diffgeom__Manifold():
from sympy.diffgeom import Manifold
assert _test_args(Manifold('name', 3))
def test_sympy__diffgeom__diffgeom__Patch():
from sympy.diffgeom import Manifold, Patch
assert _test_args(Patch('name', Manifold('name', 3)))
def test_sympy__diffgeom__diffgeom__CoordSystem():
from sympy.diffgeom import Manifold, Patch, CoordSystem
assert _test_args(CoordSystem('name', Patch('name', Manifold('name', 3))))
@XFAIL
def test_sympy__diffgeom__diffgeom__Point():
from sympy.diffgeom import Manifold, Patch, CoordSystem, Point
assert _test_args(Point(
CoordSystem('name', Patch('name', Manifold('name', 3))), [x, y]))
def test_sympy__diffgeom__diffgeom__BaseScalarField():
from sympy.diffgeom import Manifold, Patch, CoordSystem, BaseScalarField
cs = CoordSystem('name', Patch('name', Manifold('name', 3)))
assert _test_args(BaseScalarField(cs, 0))
def test_sympy__diffgeom__diffgeom__BaseVectorField():
from sympy.diffgeom import Manifold, Patch, CoordSystem, BaseVectorField
cs = CoordSystem('name', Patch('name', Manifold('name', 3)))
assert _test_args(BaseVectorField(cs, 0))
def test_sympy__diffgeom__diffgeom__Differential():
from sympy.diffgeom import Manifold, Patch, CoordSystem, BaseScalarField, Differential
cs = CoordSystem('name', Patch('name', Manifold('name', 3)))
assert _test_args(Differential(BaseScalarField(cs, 0)))
def test_sympy__diffgeom__diffgeom__Commutator():
from sympy.diffgeom import Manifold, Patch, CoordSystem, BaseVectorField, Commutator
cs = CoordSystem('name', Patch('name', Manifold('name', 3)))
cs1 = CoordSystem('name1', Patch('name', Manifold('name', 3)))
v = BaseVectorField(cs, 0)
v1 = BaseVectorField(cs1, 0)
assert _test_args(Commutator(v, v1))
def test_sympy__diffgeom__diffgeom__TensorProduct():
from sympy.diffgeom import Manifold, Patch, CoordSystem, BaseScalarField, Differential, TensorProduct
cs = CoordSystem('name', Patch('name', Manifold('name', 3)))
d = Differential(BaseScalarField(cs, 0))
assert _test_args(TensorProduct(d, d))
def test_sympy__diffgeom__diffgeom__WedgeProduct():
from sympy.diffgeom import Manifold, Patch, CoordSystem, BaseScalarField, Differential, WedgeProduct
cs = CoordSystem('name', Patch('name', Manifold('name', 3)))
d = Differential(BaseScalarField(cs, 0))
d1 = Differential(BaseScalarField(cs, 1))
assert _test_args(WedgeProduct(d, d1))
def test_sympy__diffgeom__diffgeom__LieDerivative():
from sympy.diffgeom import Manifold, Patch, CoordSystem, BaseScalarField, Differential, BaseVectorField, LieDerivative
cs = CoordSystem('name', Patch('name', Manifold('name', 3)))
d = Differential(BaseScalarField(cs, 0))
v = BaseVectorField(cs, 0)
assert _test_args(LieDerivative(v, d))
@XFAIL
def test_sympy__diffgeom__diffgeom__BaseCovarDerivativeOp():
from sympy.diffgeom import Manifold, Patch, CoordSystem, BaseCovarDerivativeOp
cs = CoordSystem('name', Patch('name', Manifold('name', 3)))
assert _test_args(BaseCovarDerivativeOp(cs, 0, [[[0, ]*3, ]*3, ]*3))
def test_sympy__diffgeom__diffgeom__CovarDerivativeOp():
from sympy.diffgeom import Manifold, Patch, CoordSystem, BaseVectorField, CovarDerivativeOp
cs = CoordSystem('name', Patch('name', Manifold('name', 3)))
v = BaseVectorField(cs, 0)
_test_args(CovarDerivativeOp(v, [[[0, ]*3, ]*3, ]*3))
def test_sympy__categories__baseclasses__Class():
from sympy.categories.baseclasses import Class
assert _test_args(Class())
def test_sympy__categories__baseclasses__Object():
from sympy.categories import Object
assert _test_args(Object("A"))
@XFAIL
def test_sympy__categories__baseclasses__Morphism():
from sympy.categories import Object, Morphism
assert _test_args(Morphism(Object("A"), Object("B")))
def test_sympy__categories__baseclasses__IdentityMorphism():
from sympy.categories import Object, IdentityMorphism
assert _test_args(IdentityMorphism(Object("A")))
def test_sympy__categories__baseclasses__NamedMorphism():
from sympy.categories import Object, NamedMorphism
assert _test_args(NamedMorphism(Object("A"), Object("B"), "f"))
def test_sympy__categories__baseclasses__CompositeMorphism():
from sympy.categories import Object, NamedMorphism, CompositeMorphism
A = Object("A")
B = Object("B")
C = Object("C")
f = NamedMorphism(A, B, "f")
g = NamedMorphism(B, C, "g")
assert _test_args(CompositeMorphism(f, g))
def test_sympy__categories__baseclasses__Diagram():
from sympy.categories import Object, NamedMorphism, Diagram
A = Object("A")
B = Object("B")
C = Object("C")
f = NamedMorphism(A, B, "f")
d = Diagram([f])
assert _test_args(d)
def test_sympy__categories__baseclasses__Category():
from sympy.categories import Object, NamedMorphism, Diagram, Category
A = Object("A")
B = Object("B")
C = Object("C")
f = NamedMorphism(A, B, "f")
g = NamedMorphism(B, C, "g")
d1 = Diagram([f, g])
d2 = Diagram([f])
K = Category("K", commutative_diagrams=[d1, d2])
assert _test_args(K)
def test_sympy__ntheory__factor___totient():
from sympy.ntheory.factor_ import totient
k = symbols('k', integer=True)
t = totient(k)
assert _test_args(t)
def test_sympy__ntheory__factor___divisor_sigma():
from sympy.ntheory.factor_ import divisor_sigma
k = symbols('k', integer=True)
n = symbols('n', integer=True)
t = divisor_sigma(n, k)
assert _test_args(t)
def test_sympy__ntheory__residue_ntheory__mobius():
from sympy.ntheory import mobius
assert _test_args(mobius(2))
def test_sympy__physics__optics__waves__TWave():
from sympy.physics.optics import TWave
A, f, phi = symbols('A, f, phi')
assert _test_args(TWave(A, f, phi))
def test_sympy__physics__optics__gaussopt__BeamParameter():
from sympy.physics.optics import BeamParameter
assert _test_args(BeamParameter(530e-9, 1, w=1e-3))
def test_sympy__physics__optics__medium__Medium():
from sympy.physics.optics import Medium
assert _test_args(Medium('m'))
def test_sympy__printing__codeprinter__Assignment():
from sympy.printing.codeprinter import Assignment
assert _test_args(Assignment(x, y))
def test_sympy__vector__coordsysrect__CoordSysCartesian():
from sympy.vector.coordsysrect import CoordSysCartesian
assert _test_args(CoordSysCartesian('C'))
def test_sympy__vector__point__Point():
from sympy.vector.point import Point
assert _test_args(Point('P'))
def test_sympy__vector__basisdependent__BasisDependent():
from sympy.vector.basisdependent import BasisDependent
#These classes have been created to maintain an OOP hierarchy
#for Vectors and Dyadics. Are NOT meant to be initialized
def test_sympy__vector__basisdependent__BasisDependentMul():
from sympy.vector.basisdependent import BasisDependentMul
#These classes have been created to maintain an OOP hierarchy
#for Vectors and Dyadics. Are NOT meant to be initialized
def test_sympy__vector__basisdependent__BasisDependentAdd():
from sympy.vector.basisdependent import BasisDependentAdd
#These classes have been created to maintain an OOP hierarchy
#for Vectors and Dyadics. Are NOT meant to be initialized
def test_sympy__vector__basisdependent__BasisDependentZero():
from sympy.vector.basisdependent import BasisDependentZero
#These classes have been created to maintain an OOP hierarchy
#for Vectors and Dyadics. Are NOT meant to be initialized
def test_sympy__vector__vector__BaseVector():
from sympy.vector.vector import BaseVector
from sympy.vector.coordsysrect import CoordSysCartesian
C = CoordSysCartesian('C')
assert _test_args(BaseVector('Ci', 0, C, ' ', ' '))
def test_sympy__vector__vector__VectorAdd():
from sympy.vector.vector import VectorAdd, VectorMul
from sympy.vector.coordsysrect import CoordSysCartesian
C = CoordSysCartesian('C')
from sympy.abc import a, b, c, x, y, z
v1 = a*C.i + b*C.j + c*C.k
v2 = x*C.i + y*C.j + z*C.k
assert _test_args(VectorAdd(v1, v2))
assert _test_args(VectorMul(x, v1))
def test_sympy__vector__vector__VectorMul():
from sympy.vector.vector import VectorMul
from sympy.vector.coordsysrect import CoordSysCartesian
C = CoordSysCartesian('C')
from sympy.abc import a
assert _test_args(VectorMul(a, C.i))
def test_sympy__vector__vector__VectorZero():
from sympy.vector.vector import VectorZero
assert _test_args(VectorZero())
def test_sympy__vector__vector__Vector():
from sympy.vector.vector import Vector
#Vector is never to be initialized using args
pass
def test_sympy__vector__dyadic__Dyadic():
from sympy.vector.dyadic import Dyadic
#Dyadic is never to be initialized using args
pass
def test_sympy__vector__dyadic__BaseDyadic():
from sympy.vector.dyadic import BaseDyadic
from sympy.vector.coordsysrect import CoordSysCartesian
C = CoordSysCartesian('C')
assert _test_args(BaseDyadic(C.i, C.j))
def test_sympy__vector__dyadic__DyadicMul():
from sympy.vector.dyadic import BaseDyadic, DyadicMul
from sympy.vector.coordsysrect import CoordSysCartesian
C = CoordSysCartesian('C')
assert _test_args(DyadicMul(3, BaseDyadic(C.i, C.j)))
def test_sympy__vector__dyadic__DyadicAdd():
from sympy.vector.dyadic import BaseDyadic, DyadicAdd
from sympy.vector.coordsysrect import CoordSysCartesian
C = CoordSysCartesian('C')
assert _test_args(2 * DyadicAdd(BaseDyadic(C.i, C.i),
BaseDyadic(C.i, C.j)))
def test_sympy__vector__dyadic__DyadicZero():
from sympy.vector.dyadic import DyadicZero
assert _test_args(DyadicZero())
def test_sympy__vector__deloperator__Del():
from sympy.vector.deloperator import Del
from sympy.vector.coordsysrect import CoordSysCartesian
C = CoordSysCartesian('C')
assert _test_args(Del(C))
def test_sympy__vector__orienters__Orienter():
from sympy.vector.orienters import Orienter
#Not to be initialized
def test_sympy__vector__orienters__ThreeAngleOrienter():
from sympy.vector.orienters import ThreeAngleOrienter
#Not to be initialized
def test_sympy__vector__orienters__AxisOrienter():
from sympy.vector.orienters import AxisOrienter
from sympy.vector.coordsysrect import CoordSysCartesian
C = CoordSysCartesian('C')
assert _test_args(AxisOrienter(x, C.i))
def test_sympy__vector__orienters__BodyOrienter():
from sympy.vector.orienters import BodyOrienter
assert _test_args(BodyOrienter(x, y, z, '123'))
def test_sympy__vector__orienters__SpaceOrienter():
from sympy.vector.orienters import SpaceOrienter
assert _test_args(SpaceOrienter(x, y, z, '123'))
def test_sympy__vector__orienters__QuaternionOrienter():
from sympy.vector.orienters import QuaternionOrienter
a, b, c, d = symbols('a b c d')
assert _test_args(QuaternionOrienter(a, b, c, d))
def test_sympy__vector__scalar__BaseScalar():
from sympy.vector.scalar import BaseScalar
from sympy.vector.coordsysrect import CoordSysCartesian
C = CoordSysCartesian('C')
assert _test_args(BaseScalar('Cx', 0, C, ' ', ' '))
| 31.710198 | 135 | 0.778366 |
# be instantiated, add it here anyway with @SKIP("abstract class) (see
# e.g. Function).
import os
import re
import warnings
import io
from sympy import Basic, S, symbols, sqrt, sin, oo, Interval, exp
from sympy.core.compatibility import range
from sympy.utilities.pytest import XFAIL, SKIP
from sympy.utilities.exceptions import SymPyDeprecationWarning
x, y, z = symbols('x,y,z')
def test_all_classes_are_tested():
this = os.path.split(__file__)[0]
path = os.path.join(this, os.pardir, os.pardir)
sympy_path = os.path.abspath(path)
prefix = os.path.split(sympy_path)[0] + os.sep
re_cls = re.compile("^class ([A-Za-z][A-Za-z0-9_]*)\s*\(", re.MULTILINE)
modules = {}
for root, dirs, files in os.walk(sympy_path):
module = root.replace(prefix, "").replace(os.sep, ".")
for file in files:
if file.startswith(("_", "test_", "bench_")):
continue
if not file.endswith(".py"):
continue
with io.open(os.path.join(root, file), "r", encoding='utf-8') as f:
text = f.read()
submodule = module + '.' + file[:-3]
names = re_cls.findall(text)
if not names:
continue
try:
mod = __import__(submodule, fromlist=names)
except ImportError:
continue
def is_Basic(name):
cls = getattr(mod, name)
return issubclass(cls, Basic)
names = list(filter(is_Basic, names))
if names:
modules[submodule] = names
ns = globals()
failed = []
for module, names in modules.items():
mod = module.replace('.', '__')
for name in names:
test = 'test_' + mod + '__' + name
if test not in ns:
failed.append(module + '.' + name)
# reset all SymPyDeprecationWarning into errors
warnings.simplefilter("error", category=SymPyDeprecationWarning)
assert not failed, "Missing classes: %s. Please add tests for these to sympy/core/tests/test_args.py." % ", ".join(failed)
def _test_args(obj):
return all(isinstance(arg, Basic) for arg in obj.args)
def test_sympy__assumptions__assume__AppliedPredicate():
from sympy.assumptions.assume import AppliedPredicate, Predicate
assert _test_args(AppliedPredicate(Predicate("test"), 2))
def test_sympy__assumptions__assume__Predicate():
from sympy.assumptions.assume import Predicate
assert _test_args(Predicate("test"))
@XFAIL
def test_sympy__combinatorics__graycode__GrayCode():
from sympy.combinatorics.graycode import GrayCode
# an integer is given and returned from GrayCode as the arg
assert _test_args(GrayCode(3, start='100'))
assert _test_args(GrayCode(3, rank=1))
def test_sympy__combinatorics__subsets__Subset():
from sympy.combinatorics.subsets import Subset
assert _test_args(Subset([0, 1], [0, 1, 2, 3]))
assert _test_args(Subset(['c', 'd'], ['a', 'b', 'c', 'd']))
@XFAIL
def test_sympy__combinatorics__permutations__Permutation():
from sympy.combinatorics.permutations import Permutation
assert _test_args(Permutation([0, 1, 2, 3]))
def test_sympy__combinatorics__perm_groups__PermutationGroup():
from sympy.combinatorics.permutations import Permutation
from sympy.combinatorics.perm_groups import PermutationGroup
assert _test_args(PermutationGroup([Permutation([0, 1])]))
def test_sympy__combinatorics__polyhedron__Polyhedron():
from sympy.combinatorics.permutations import Permutation
from sympy.combinatorics.polyhedron import Polyhedron
from sympy.abc import w, x, y, z
pgroup = [Permutation([[0, 1, 2], [3]]),
Permutation([[0, 1, 3], [2]]),
Permutation([[0, 2, 3], [1]]),
Permutation([[1, 2, 3], [0]]),
Permutation([[0, 1], [2, 3]]),
Permutation([[0, 2], [1, 3]]),
Permutation([[0, 3], [1, 2]]),
Permutation([[0, 1, 2, 3]])]
corners = [w, x, y, z]
faces = [(w, x, y), (w, y, z), (w, z, x), (x, y, z)]
assert _test_args(Polyhedron(corners, faces, pgroup))
@XFAIL
def test_sympy__combinatorics__prufer__Prufer():
from sympy.combinatorics.prufer import Prufer
assert _test_args(Prufer([[0, 1], [0, 2], [0, 3]], 4))
def test_sympy__combinatorics__partitions__Partition():
from sympy.combinatorics.partitions import Partition
assert _test_args(Partition([1]))
@XFAIL
def test_sympy__combinatorics__partitions__IntegerPartition():
from sympy.combinatorics.partitions import IntegerPartition
assert _test_args(IntegerPartition([1]))
def test_sympy__concrete__products__Product():
from sympy.concrete.products import Product
assert _test_args(Product(x, (x, 0, 10)))
assert _test_args(Product(x, (x, 0, y), (y, 0, 10)))
@SKIP("abstract Class")
def test_sympy__concrete__expr_with_limits__ExprWithLimits():
from sympy.concrete.expr_with_limits import ExprWithLimits
assert _test_args(ExprWithLimits(x, (x, 0, 10)))
assert _test_args(ExprWithLimits(x*y, (x, 0, 10.),(y,1.,3)))
@SKIP("abstract Class")
def test_sympy__concrete__expr_with_limits__AddWithLimits():
from sympy.concrete.expr_with_limits import AddWithLimits
assert _test_args(AddWithLimits(x, (x, 0, 10)))
assert _test_args(AddWithLimits(x*y, (x, 0, 10),(y,1,3)))
@SKIP("abstract Class")
def test_sympy__concrete__expr_with_intlimits__ExprWithIntLimits():
from sympy.concrete.expr_with_intlimits import ExprWithIntLimits
assert _test_args(ExprWithIntLimits(x, (x, 0, 10)))
assert _test_args(ExprWithIntLimits(x*y, (x, 0, 10),(y,1,3)))
def test_sympy__concrete__summations__Sum():
from sympy.concrete.summations import Sum
assert _test_args(Sum(x, (x, 0, 10)))
assert _test_args(Sum(x, (x, 0, y), (y, 0, 10)))
def test_sympy__core__add__Add():
from sympy.core.add import Add
assert _test_args(Add(x, y, z, 2))
def test_sympy__core__basic__Atom():
from sympy.core.basic import Atom
assert _test_args(Atom())
def test_sympy__core__basic__Basic():
from sympy.core.basic import Basic
assert _test_args(Basic())
def test_sympy__core__containers__Dict():
from sympy.core.containers import Dict
assert _test_args(Dict({x: y, y: z}))
def test_sympy__core__containers__Tuple():
from sympy.core.containers import Tuple
assert _test_args(Tuple(x, y, z, 2))
def test_sympy__core__expr__AtomicExpr():
from sympy.core.expr import AtomicExpr
assert _test_args(AtomicExpr())
def test_sympy__core__expr__Expr():
from sympy.core.expr import Expr
assert _test_args(Expr())
def test_sympy__core__function__Application():
from sympy.core.function import Application
assert _test_args(Application(1, 2, 3))
def test_sympy__core__function__AppliedUndef():
from sympy.core.function import AppliedUndef
assert _test_args(AppliedUndef(1, 2, 3))
def test_sympy__core__function__Derivative():
from sympy.core.function import Derivative
assert _test_args(Derivative(2, x, y, 3))
@SKIP("abstract class")
def test_sympy__core__function__Function():
pass
def test_sympy__core__function__Lambda():
from sympy.core.function import Lambda
assert _test_args(Lambda((x, y), x + y + z))
def test_sympy__core__function__Subs():
from sympy.core.function import Subs
assert _test_args(Subs(x + y, x, 2))
def test_sympy__core__function__WildFunction():
from sympy.core.function import WildFunction
assert _test_args(WildFunction('f'))
def test_sympy__core__mod__Mod():
from sympy.core.mod import Mod
assert _test_args(Mod(x, 2))
def test_sympy__core__mul__Mul():
from sympy.core.mul import Mul
assert _test_args(Mul(2, x, y, z))
def test_sympy__core__numbers__Catalan():
from sympy.core.numbers import Catalan
assert _test_args(Catalan())
def test_sympy__core__numbers__ComplexInfinity():
from sympy.core.numbers import ComplexInfinity
assert _test_args(ComplexInfinity())
def test_sympy__core__numbers__EulerGamma():
from sympy.core.numbers import EulerGamma
assert _test_args(EulerGamma())
def test_sympy__core__numbers__Exp1():
from sympy.core.numbers import Exp1
assert _test_args(Exp1())
def test_sympy__core__numbers__Float():
from sympy.core.numbers import Float
assert _test_args(Float(1.23))
def test_sympy__core__numbers__GoldenRatio():
from sympy.core.numbers import GoldenRatio
assert _test_args(GoldenRatio())
def test_sympy__core__numbers__Half():
from sympy.core.numbers import Half
assert _test_args(Half())
def test_sympy__core__numbers__ImaginaryUnit():
from sympy.core.numbers import ImaginaryUnit
assert _test_args(ImaginaryUnit())
def test_sympy__core__numbers__Infinity():
from sympy.core.numbers import Infinity
assert _test_args(Infinity())
def test_sympy__core__numbers__Integer():
from sympy.core.numbers import Integer
assert _test_args(Integer(7))
@SKIP("abstract class")
def test_sympy__core__numbers__IntegerConstant():
pass
def test_sympy__core__numbers__NaN():
from sympy.core.numbers import NaN
assert _test_args(NaN())
def test_sympy__core__numbers__NegativeInfinity():
from sympy.core.numbers import NegativeInfinity
assert _test_args(NegativeInfinity())
def test_sympy__core__numbers__NegativeOne():
from sympy.core.numbers import NegativeOne
assert _test_args(NegativeOne())
def test_sympy__core__numbers__Number():
from sympy.core.numbers import Number
assert _test_args(Number(1, 7))
def test_sympy__core__numbers__NumberSymbol():
from sympy.core.numbers import NumberSymbol
assert _test_args(NumberSymbol())
def test_sympy__core__numbers__One():
from sympy.core.numbers import One
assert _test_args(One())
def test_sympy__core__numbers__Pi():
from sympy.core.numbers import Pi
assert _test_args(Pi())
def test_sympy__core__numbers__Rational():
from sympy.core.numbers import Rational
assert _test_args(Rational(1, 7))
@SKIP("abstract class")
def test_sympy__core__numbers__RationalConstant():
pass
def test_sympy__core__numbers__Zero():
from sympy.core.numbers import Zero
assert _test_args(Zero())
@SKIP("abstract class")
def test_sympy__core__operations__AssocOp():
pass
@SKIP("abstract class")
def test_sympy__core__operations__LatticeOp():
pass
def test_sympy__core__power__Pow():
from sympy.core.power import Pow
assert _test_args(Pow(x, 2))
def test_sympy__core__relational__Equality():
from sympy.core.relational import Equality
assert _test_args(Equality(x, 2))
def test_sympy__core__relational__GreaterThan():
from sympy.core.relational import GreaterThan
assert _test_args(GreaterThan(x, 2))
def test_sympy__core__relational__LessThan():
from sympy.core.relational import LessThan
assert _test_args(LessThan(x, 2))
@SKIP("abstract class")
def test_sympy__core__relational__Relational():
pass
def test_sympy__core__relational__StrictGreaterThan():
from sympy.core.relational import StrictGreaterThan
assert _test_args(StrictGreaterThan(x, 2))
def test_sympy__core__relational__StrictLessThan():
from sympy.core.relational import StrictLessThan
assert _test_args(StrictLessThan(x, 2))
def test_sympy__core__relational__Unequality():
from sympy.core.relational import Unequality
assert _test_args(Unequality(x, 2))
def test_sympy__sets__sets__EmptySet():
from sympy.sets.sets import EmptySet
assert _test_args(EmptySet())
def test_sympy__sets__sets__UniversalSet():
from sympy.sets.sets import UniversalSet
assert _test_args(UniversalSet())
def test_sympy__sets__sets__FiniteSet():
from sympy.sets.sets import FiniteSet
assert _test_args(FiniteSet(x, y, z))
def test_sympy__sets__sets__Interval():
from sympy.sets.sets import Interval
assert _test_args(Interval(0, 1))
def test_sympy__sets__sets__ProductSet():
from sympy.sets.sets import ProductSet, Interval
assert _test_args(ProductSet(Interval(0, 1), Interval(0, 1)))
@SKIP("does it make sense to test this?")
def test_sympy__sets__sets__Set():
from sympy.sets.sets import Set
assert _test_args(Set())
def test_sympy__sets__sets__Intersection():
from sympy.sets.sets import Intersection, Interval
assert _test_args(Intersection(Interval(0, 3), Interval(2, 4),
evaluate=False))
def test_sympy__sets__sets__Union():
from sympy.sets.sets import Union, Interval
assert _test_args(Union(Interval(0, 1), Interval(2, 3)))
def test_sympy__sets__sets__Complement():
from sympy.sets.sets import Complement
assert _test_args(Complement(Interval(0, 2), Interval(0, 1)))
def test_sympy__sets__sets__SymmetricDifference():
from sympy.sets.sets import FiniteSet, SymmetricDifference
assert _test_args(SymmetricDifference(FiniteSet(1, 2, 3), \
FiniteSet(2, 3, 4)))
def test_sympy__core__trace__Tr():
from sympy.core.trace import Tr
a, b = symbols('a b')
assert _test_args(Tr(a + b))
def test_sympy__sets__fancysets__Naturals():
from sympy.sets.fancysets import Naturals
assert _test_args(Naturals())
def test_sympy__sets__fancysets__Naturals0():
from sympy.sets.fancysets import Naturals0
assert _test_args(Naturals0())
def test_sympy__sets__fancysets__Integers():
from sympy.sets.fancysets import Integers
assert _test_args(Integers())
def test_sympy__sets__fancysets__Reals():
from sympy.sets.fancysets import Reals
assert _test_args(Reals())
def test_sympy__sets__fancysets__ImageSet():
from sympy.sets.fancysets import ImageSet
from sympy import S, Lambda, Symbol
x = Symbol('x')
assert _test_args(ImageSet(Lambda(x, x**2), S.Naturals))
def test_sympy__sets__fancysets__Range():
from sympy.sets.fancysets import Range
assert _test_args(Range(1, 5, 1))
def test_sympy__sets__contains__Contains():
from sympy.sets.fancysets import Range
from sympy.sets.contains import Contains
assert _test_args(Contains(x, Range(0, 10, 2)))
# STATS
from sympy.stats.crv_types import NormalDistribution
nd = NormalDistribution(0, 1)
from sympy.stats.frv_types import DieDistribution
die = DieDistribution(6)
def test_sympy__stats__crv__ContinuousDomain():
from sympy.stats.crv import ContinuousDomain
assert _test_args(ContinuousDomain(set([x]), Interval(-oo, oo)))
def test_sympy__stats__crv__SingleContinuousDomain():
from sympy.stats.crv import SingleContinuousDomain
assert _test_args(SingleContinuousDomain(x, Interval(-oo, oo)))
def test_sympy__stats__crv__ProductContinuousDomain():
from sympy.stats.crv import SingleContinuousDomain, ProductContinuousDomain
D = SingleContinuousDomain(x, Interval(-oo, oo))
E = SingleContinuousDomain(y, Interval(0, oo))
assert _test_args(ProductContinuousDomain(D, E))
def test_sympy__stats__crv__ConditionalContinuousDomain():
from sympy.stats.crv import (SingleContinuousDomain,
ConditionalContinuousDomain)
D = SingleContinuousDomain(x, Interval(-oo, oo))
assert _test_args(ConditionalContinuousDomain(D, x > 0))
def test_sympy__stats__crv__ContinuousPSpace():
from sympy.stats.crv import ContinuousPSpace, SingleContinuousDomain
D = SingleContinuousDomain(x, Interval(-oo, oo))
assert _test_args(ContinuousPSpace(D, nd))
def test_sympy__stats__crv__SingleContinuousPSpace():
from sympy.stats.crv import SingleContinuousPSpace
assert _test_args(SingleContinuousPSpace(x, nd))
def test_sympy__stats__crv__ProductContinuousPSpace():
from sympy.stats.crv import ProductContinuousPSpace, SingleContinuousPSpace
A = SingleContinuousPSpace(x, nd)
B = SingleContinuousPSpace(y, nd)
assert _test_args(ProductContinuousPSpace(A, B))
@SKIP("abstract class")
def test_sympy__stats__crv__SingleContinuousDistribution():
pass
def test_sympy__stats__drv__SingleDiscreteDomain():
from sympy.stats.drv import SingleDiscreteDomain
assert _test_args(SingleDiscreteDomain(x, S.Naturals))
def test_sympy__stats__drv__SingleDiscretePSpace():
from sympy.stats.drv import SingleDiscretePSpace
from sympy.stats.drv_types import PoissonDistribution
assert _test_args(SingleDiscretePSpace(x, PoissonDistribution(1)))
@SKIP("abstract class")
def test_sympy__stats__drv__SingleDiscreteDistribution():
pass
def test_sympy__stats__rv__RandomDomain():
from sympy.stats.rv import RandomDomain
from sympy.sets.sets import FiniteSet
assert _test_args(RandomDomain(FiniteSet(x), FiniteSet(1, 2, 3)))
def test_sympy__stats__rv__SingleDomain():
from sympy.stats.rv import SingleDomain
from sympy.sets.sets import FiniteSet
assert _test_args(SingleDomain(x, FiniteSet(1, 2, 3)))
def test_sympy__stats__rv__ConditionalDomain():
from sympy.stats.rv import ConditionalDomain, RandomDomain
from sympy.sets.sets import FiniteSet
D = RandomDomain(FiniteSet(x), FiniteSet(1, 2))
assert _test_args(ConditionalDomain(D, x > 1))
def test_sympy__stats__rv__PSpace():
from sympy.stats.rv import PSpace, RandomDomain
from sympy import FiniteSet
D = RandomDomain(FiniteSet(x), FiniteSet(1, 2, 3, 4, 5, 6))
assert _test_args(PSpace(D, die))
@SKIP("abstract Class")
def test_sympy__stats__rv__SinglePSpace():
pass
def test_sympy__stats__rv__RandomSymbol():
from sympy.stats.rv import RandomSymbol
from sympy.stats.crv import SingleContinuousPSpace
A = SingleContinuousPSpace(x, nd)
assert _test_args(RandomSymbol(A, x))
def test_sympy__stats__rv__ProductPSpace():
from sympy.stats.rv import ProductPSpace
from sympy.stats.crv import SingleContinuousPSpace
A = SingleContinuousPSpace(x, nd)
B = SingleContinuousPSpace(y, nd)
assert _test_args(ProductPSpace(A, B))
def test_sympy__stats__rv__ProductDomain():
from sympy.stats.rv import ProductDomain, SingleDomain
D = SingleDomain(x, Interval(-oo, oo))
E = SingleDomain(y, Interval(0, oo))
assert _test_args(ProductDomain(D, E))
def test_sympy__stats__frv_types__DiscreteUniformDistribution():
from sympy.stats.frv_types import DiscreteUniformDistribution
from sympy.core.containers import Tuple
assert _test_args(DiscreteUniformDistribution(Tuple(*list(range(6)))))
def test_sympy__stats__frv_types__DieDistribution():
from sympy.stats.frv_types import DieDistribution
assert _test_args(DieDistribution(6))
def test_sympy__stats__frv_types__BernoulliDistribution():
from sympy.stats.frv_types import BernoulliDistribution
assert _test_args(BernoulliDistribution(S.Half, 0, 1))
def test_sympy__stats__frv_types__BinomialDistribution():
from sympy.stats.frv_types import BinomialDistribution
assert _test_args(BinomialDistribution(5, S.Half, 1, 0))
def test_sympy__stats__frv_types__HypergeometricDistribution():
from sympy.stats.frv_types import HypergeometricDistribution
assert _test_args(HypergeometricDistribution(10, 5, 3))
def test_sympy__stats__frv_types__RademacherDistribution():
from sympy.stats.frv_types import RademacherDistribution
assert _test_args(RademacherDistribution())
def test_sympy__stats__frv__FiniteDomain():
from sympy.stats.frv import FiniteDomain
assert _test_args(FiniteDomain(set([(x, 1), (x, 2)]))) # x can be 1 or 2
def test_sympy__stats__frv__SingleFiniteDomain():
from sympy.stats.frv import SingleFiniteDomain
assert _test_args(SingleFiniteDomain(x, set([1, 2]))) # x can be 1 or 2
def test_sympy__stats__frv__ProductFiniteDomain():
from sympy.stats.frv import SingleFiniteDomain, ProductFiniteDomain
xd = SingleFiniteDomain(x, set([1, 2]))
yd = SingleFiniteDomain(y, set([1, 2]))
assert _test_args(ProductFiniteDomain(xd, yd))
def test_sympy__stats__frv__ConditionalFiniteDomain():
from sympy.stats.frv import SingleFiniteDomain, ConditionalFiniteDomain
xd = SingleFiniteDomain(x, set([1, 2]))
assert _test_args(ConditionalFiniteDomain(xd, x > 1))
def test_sympy__stats__frv__FinitePSpace():
from sympy.stats.frv import FinitePSpace, SingleFiniteDomain
xd = SingleFiniteDomain(x, set([1, 2, 3, 4, 5, 6]))
p = 1.0/6
xd = SingleFiniteDomain(x, set([1, 2]))
assert _test_args(FinitePSpace(xd, {(x, 1): S.Half, (x, 2): S.Half}))
def test_sympy__stats__frv__SingleFinitePSpace():
from sympy.stats.frv import SingleFinitePSpace
from sympy import Symbol
assert _test_args(SingleFinitePSpace(Symbol('x'), die))
def test_sympy__stats__frv__ProductFinitePSpace():
from sympy.stats.frv import SingleFinitePSpace, ProductFinitePSpace
from sympy import Symbol
xp = SingleFinitePSpace(Symbol('x'), die)
yp = SingleFinitePSpace(Symbol('y'), die)
assert _test_args(ProductFinitePSpace(xp, yp))
@SKIP("abstract class")
def test_sympy__stats__frv__SingleFiniteDistribution():
pass
@SKIP("abstract class")
def test_sympy__stats__crv__ContinuousDistribution():
pass
def test_sympy__stats__frv_types__FiniteDistributionHandmade():
from sympy.stats.frv_types import FiniteDistributionHandmade
assert _test_args(FiniteDistributionHandmade({1: 1}))
def test_sympy__stats__crv__ContinuousDistributionHandmade():
from sympy.stats.crv import ContinuousDistributionHandmade
from sympy import Symbol, Interval
assert _test_args(ContinuousDistributionHandmade(Symbol('x'),
Interval(0, 2)))
def test_sympy__stats__rv__Density():
from sympy.stats.rv import Density
from sympy.stats.crv_types import Normal
assert _test_args(Density(Normal('x', 0, 1)))
def test_sympy__stats__crv_types__ArcsinDistribution():
from sympy.stats.crv_types import ArcsinDistribution
assert _test_args(ArcsinDistribution(0, 1))
def test_sympy__stats__crv_types__BeniniDistribution():
from sympy.stats.crv_types import BeniniDistribution
assert _test_args(BeniniDistribution(1, 1, 1))
def test_sympy__stats__crv_types__BetaDistribution():
from sympy.stats.crv_types import BetaDistribution
assert _test_args(BetaDistribution(1, 1))
def test_sympy__stats__crv_types__BetaPrimeDistribution():
from sympy.stats.crv_types import BetaPrimeDistribution
assert _test_args(BetaPrimeDistribution(1, 1))
def test_sympy__stats__crv_types__CauchyDistribution():
from sympy.stats.crv_types import CauchyDistribution
assert _test_args(CauchyDistribution(0, 1))
def test_sympy__stats__crv_types__ChiDistribution():
from sympy.stats.crv_types import ChiDistribution
assert _test_args(ChiDistribution(1))
def test_sympy__stats__crv_types__ChiNoncentralDistribution():
from sympy.stats.crv_types import ChiNoncentralDistribution
assert _test_args(ChiNoncentralDistribution(1,1))
def test_sympy__stats__crv_types__ChiSquaredDistribution():
from sympy.stats.crv_types import ChiSquaredDistribution
assert _test_args(ChiSquaredDistribution(1))
def test_sympy__stats__crv_types__DagumDistribution():
from sympy.stats.crv_types import DagumDistribution
assert _test_args(DagumDistribution(1, 1, 1))
def test_sympy__stats__crv_types__ExponentialDistribution():
from sympy.stats.crv_types import ExponentialDistribution
assert _test_args(ExponentialDistribution(1))
def test_sympy__stats__crv_types__FDistributionDistribution():
from sympy.stats.crv_types import FDistributionDistribution
assert _test_args(FDistributionDistribution(1, 1))
def test_sympy__stats__crv_types__FisherZDistribution():
from sympy.stats.crv_types import FisherZDistribution
assert _test_args(FisherZDistribution(1, 1))
def test_sympy__stats__crv_types__FrechetDistribution():
from sympy.stats.crv_types import FrechetDistribution
assert _test_args(FrechetDistribution(1, 1, 1))
def test_sympy__stats__crv_types__GammaInverseDistribution():
from sympy.stats.crv_types import GammaInverseDistribution
assert _test_args(GammaInverseDistribution(1, 1))
def test_sympy__stats__crv_types__GammaDistribution():
from sympy.stats.crv_types import GammaDistribution
assert _test_args(GammaDistribution(1, 1))
def test_sympy__stats__crv_types__KumaraswamyDistribution():
from sympy.stats.crv_types import KumaraswamyDistribution
assert _test_args(KumaraswamyDistribution(1, 1))
def test_sympy__stats__crv_types__LaplaceDistribution():
from sympy.stats.crv_types import LaplaceDistribution
assert _test_args(LaplaceDistribution(0, 1))
def test_sympy__stats__crv_types__LogisticDistribution():
from sympy.stats.crv_types import LogisticDistribution
assert _test_args(LogisticDistribution(0, 1))
def test_sympy__stats__crv_types__LogNormalDistribution():
from sympy.stats.crv_types import LogNormalDistribution
assert _test_args(LogNormalDistribution(0, 1))
def test_sympy__stats__crv_types__MaxwellDistribution():
from sympy.stats.crv_types import MaxwellDistribution
assert _test_args(MaxwellDistribution(1))
def test_sympy__stats__crv_types__NakagamiDistribution():
from sympy.stats.crv_types import NakagamiDistribution
assert _test_args(NakagamiDistribution(1, 1))
def test_sympy__stats__crv_types__NormalDistribution():
from sympy.stats.crv_types import NormalDistribution
assert _test_args(NormalDistribution(0, 1))
def test_sympy__stats__crv_types__ParetoDistribution():
from sympy.stats.crv_types import ParetoDistribution
assert _test_args(ParetoDistribution(1, 1))
def test_sympy__stats__crv_types__QuadraticUDistribution():
from sympy.stats.crv_types import QuadraticUDistribution
assert _test_args(QuadraticUDistribution(1, 2))
def test_sympy__stats__crv_types__RaisedCosineDistribution():
from sympy.stats.crv_types import RaisedCosineDistribution
assert _test_args(RaisedCosineDistribution(1, 1))
def test_sympy__stats__crv_types__RayleighDistribution():
from sympy.stats.crv_types import RayleighDistribution
assert _test_args(RayleighDistribution(1))
def test_sympy__stats__crv_types__StudentTDistribution():
from sympy.stats.crv_types import StudentTDistribution
assert _test_args(StudentTDistribution(1))
def test_sympy__stats__crv_types__TriangularDistribution():
from sympy.stats.crv_types import TriangularDistribution
assert _test_args(TriangularDistribution(-1, 0, 1))
def test_sympy__stats__crv_types__UniformDistribution():
from sympy.stats.crv_types import UniformDistribution
assert _test_args(UniformDistribution(0, 1))
def test_sympy__stats__crv_types__UniformSumDistribution():
from sympy.stats.crv_types import UniformSumDistribution
assert _test_args(UniformSumDistribution(1))
def test_sympy__stats__crv_types__VonMisesDistribution():
from sympy.stats.crv_types import VonMisesDistribution
assert _test_args(VonMisesDistribution(1, 1))
def test_sympy__stats__crv_types__WeibullDistribution():
from sympy.stats.crv_types import WeibullDistribution
assert _test_args(WeibullDistribution(1, 1))
def test_sympy__stats__crv_types__WignerSemicircleDistribution():
from sympy.stats.crv_types import WignerSemicircleDistribution
assert _test_args(WignerSemicircleDistribution(1))
def test_sympy__stats__drv_types__PoissonDistribution():
from sympy.stats.drv_types import PoissonDistribution
assert _test_args(PoissonDistribution(1))
def test_sympy__stats__drv_types__GeometricDistribution():
from sympy.stats.drv_types import GeometricDistribution
assert _test_args(GeometricDistribution(.5))
def test_sympy__core__symbol__Dummy():
from sympy.core.symbol import Dummy
assert _test_args(Dummy('t'))
def test_sympy__core__symbol__Symbol():
from sympy.core.symbol import Symbol
assert _test_args(Symbol('t'))
def test_sympy__core__symbol__Wild():
from sympy.core.symbol import Wild
assert _test_args(Wild('x', exclude=[x]))
@SKIP("abstract class")
def test_sympy__functions__combinatorial__factorials__CombinatorialFunction():
pass
def test_sympy__functions__combinatorial__factorials__FallingFactorial():
from sympy.functions.combinatorial.factorials import FallingFactorial
assert _test_args(FallingFactorial(2, x))
def test_sympy__functions__combinatorial__factorials__MultiFactorial():
from sympy.functions.combinatorial.factorials import MultiFactorial
assert _test_args(MultiFactorial(x))
def test_sympy__functions__combinatorial__factorials__RisingFactorial():
from sympy.functions.combinatorial.factorials import RisingFactorial
assert _test_args(RisingFactorial(2, x))
def test_sympy__functions__combinatorial__factorials__binomial():
from sympy.functions.combinatorial.factorials import binomial
assert _test_args(binomial(2, x))
def test_sympy__functions__combinatorial__factorials__subfactorial():
from sympy.functions.combinatorial.factorials import subfactorial
assert _test_args(subfactorial(1))
def test_sympy__functions__combinatorial__factorials__factorial():
from sympy.functions.combinatorial.factorials import factorial
assert _test_args(factorial(x))
def test_sympy__functions__combinatorial__factorials__factorial2():
from sympy.functions.combinatorial.factorials import factorial2
assert _test_args(factorial2(x))
def test_sympy__functions__combinatorial__numbers__bell():
from sympy.functions.combinatorial.numbers import bell
assert _test_args(bell(x, y))
def test_sympy__functions__combinatorial__numbers__bernoulli():
from sympy.functions.combinatorial.numbers import bernoulli
assert _test_args(bernoulli(x))
def test_sympy__functions__combinatorial__numbers__catalan():
from sympy.functions.combinatorial.numbers import catalan
assert _test_args(catalan(x))
def test_sympy__functions__combinatorial__numbers__genocchi():
from sympy.functions.combinatorial.numbers import genocchi
assert _test_args(genocchi(x))
def test_sympy__functions__combinatorial__numbers__euler():
from sympy.functions.combinatorial.numbers import euler
assert _test_args(euler(x))
def test_sympy__functions__combinatorial__numbers__fibonacci():
from sympy.functions.combinatorial.numbers import fibonacci
assert _test_args(fibonacci(x))
def test_sympy__functions__combinatorial__numbers__harmonic():
from sympy.functions.combinatorial.numbers import harmonic
assert _test_args(harmonic(x, 2))
def test_sympy__functions__combinatorial__numbers__lucas():
from sympy.functions.combinatorial.numbers import lucas
assert _test_args(lucas(x))
def test_sympy__functions__elementary__complexes__Abs():
from sympy.functions.elementary.complexes import Abs
assert _test_args(Abs(x))
def test_sympy__functions__elementary__complexes__adjoint():
from sympy.functions.elementary.complexes import adjoint
assert _test_args(adjoint(x))
def test_sympy__functions__elementary__complexes__arg():
from sympy.functions.elementary.complexes import arg
assert _test_args(arg(x))
def test_sympy__functions__elementary__complexes__conjugate():
from sympy.functions.elementary.complexes import conjugate
assert _test_args(conjugate(x))
def test_sympy__functions__elementary__complexes__im():
from sympy.functions.elementary.complexes import im
assert _test_args(im(x))
def test_sympy__functions__elementary__complexes__re():
from sympy.functions.elementary.complexes import re
assert _test_args(re(x))
def test_sympy__functions__elementary__complexes__sign():
from sympy.functions.elementary.complexes import sign
assert _test_args(sign(x))
def test_sympy__functions__elementary__complexes__polar_lift():
from sympy.functions.elementary.complexes import polar_lift
assert _test_args(polar_lift(x))
def test_sympy__functions__elementary__complexes__periodic_argument():
from sympy.functions.elementary.complexes import periodic_argument
assert _test_args(periodic_argument(x, y))
def test_sympy__functions__elementary__complexes__principal_branch():
from sympy.functions.elementary.complexes import principal_branch
assert _test_args(principal_branch(x, y))
def test_sympy__functions__elementary__complexes__transpose():
from sympy.functions.elementary.complexes import transpose
assert _test_args(transpose(x))
def test_sympy__functions__elementary__exponential__LambertW():
from sympy.functions.elementary.exponential import LambertW
assert _test_args(LambertW(2))
@SKIP("abstract class")
def test_sympy__functions__elementary__exponential__ExpBase():
pass
def test_sympy__functions__elementary__exponential__exp():
from sympy.functions.elementary.exponential import exp
assert _test_args(exp(2))
def test_sympy__functions__elementary__exponential__exp_polar():
from sympy.functions.elementary.exponential import exp_polar
assert _test_args(exp_polar(2))
def test_sympy__functions__elementary__exponential__log():
from sympy.functions.elementary.exponential import log
assert _test_args(log(2))
@SKIP("abstract class")
def test_sympy__functions__elementary__hyperbolic__HyperbolicFunction():
pass
@SKIP("abstract class")
def test_sympy__functions__elementary__hyperbolic__ReciprocalHyperbolicFunction():
pass
def test_sympy__functions__elementary__hyperbolic__acosh():
from sympy.functions.elementary.hyperbolic import acosh
assert _test_args(acosh(2))
def test_sympy__functions__elementary__hyperbolic__acoth():
from sympy.functions.elementary.hyperbolic import acoth
assert _test_args(acoth(2))
def test_sympy__functions__elementary__hyperbolic__asinh():
from sympy.functions.elementary.hyperbolic import asinh
assert _test_args(asinh(2))
def test_sympy__functions__elementary__hyperbolic__atanh():
from sympy.functions.elementary.hyperbolic import atanh
assert _test_args(atanh(2))
def test_sympy__functions__elementary__hyperbolic__cosh():
from sympy.functions.elementary.hyperbolic import cosh
assert _test_args(cosh(2))
def test_sympy__functions__elementary__hyperbolic__coth():
from sympy.functions.elementary.hyperbolic import coth
assert _test_args(coth(2))
def test_sympy__functions__elementary__hyperbolic__csch():
from sympy.functions.elementary.hyperbolic import csch
assert _test_args(csch(2))
def test_sympy__functions__elementary__hyperbolic__sech():
from sympy.functions.elementary.hyperbolic import sech
assert _test_args(sech(2))
def test_sympy__functions__elementary__hyperbolic__sinh():
from sympy.functions.elementary.hyperbolic import sinh
assert _test_args(sinh(2))
def test_sympy__functions__elementary__hyperbolic__tanh():
from sympy.functions.elementary.hyperbolic import tanh
assert _test_args(tanh(2))
@SKIP("does this work at all?")
def test_sympy__functions__elementary__integers__RoundFunction():
from sympy.functions.elementary.integers import RoundFunction
assert _test_args(RoundFunction())
def test_sympy__functions__elementary__integers__ceiling():
from sympy.functions.elementary.integers import ceiling
assert _test_args(ceiling(x))
def test_sympy__functions__elementary__integers__floor():
from sympy.functions.elementary.integers import floor
assert _test_args(floor(x))
def test_sympy__functions__elementary__miscellaneous__IdentityFunction():
from sympy.functions.elementary.miscellaneous import IdentityFunction
assert _test_args(IdentityFunction())
def test_sympy__functions__elementary__miscellaneous__Max():
from sympy.functions.elementary.miscellaneous import Max
assert _test_args(Max(x, 2))
def test_sympy__functions__elementary__miscellaneous__Min():
from sympy.functions.elementary.miscellaneous import Min
assert _test_args(Min(x, 2))
@SKIP("abstract class")
def test_sympy__functions__elementary__miscellaneous__MinMaxBase():
pass
def test_sympy__functions__elementary__piecewise__ExprCondPair():
from sympy.functions.elementary.piecewise import ExprCondPair
assert _test_args(ExprCondPair(1, True))
def test_sympy__functions__elementary__piecewise__Piecewise():
from sympy.functions.elementary.piecewise import Piecewise
assert _test_args(Piecewise((1, x >= 0), (0, True)))
@SKIP("abstract class")
def test_sympy__functions__elementary__trigonometric__TrigonometricFunction():
pass
@SKIP("abstract class")
def test_sympy__functions__elementary__trigonometric__ReciprocalTrigonometricFunction():
pass
@SKIP("abstract class")
def test_sympy__functions__elementary__trigonometric__InverseTrigonometricFunction():
pass
def test_sympy__functions__elementary__trigonometric__acos():
from sympy.functions.elementary.trigonometric import acos
assert _test_args(acos(2))
def test_sympy__functions__elementary__trigonometric__acot():
from sympy.functions.elementary.trigonometric import acot
assert _test_args(acot(2))
def test_sympy__functions__elementary__trigonometric__asin():
from sympy.functions.elementary.trigonometric import asin
assert _test_args(asin(2))
def test_sympy__functions__elementary__trigonometric__asec():
from sympy.functions.elementary.trigonometric import asec
assert _test_args(asec(2))
def test_sympy__functions__elementary__trigonometric__acsc():
from sympy.functions.elementary.trigonometric import acsc
assert _test_args(acsc(2))
def test_sympy__functions__elementary__trigonometric__atan():
from sympy.functions.elementary.trigonometric import atan
assert _test_args(atan(2))
def test_sympy__functions__elementary__trigonometric__atan2():
from sympy.functions.elementary.trigonometric import atan2
assert _test_args(atan2(2, 3))
def test_sympy__functions__elementary__trigonometric__cos():
from sympy.functions.elementary.trigonometric import cos
assert _test_args(cos(2))
def test_sympy__functions__elementary__trigonometric__csc():
from sympy.functions.elementary.trigonometric import csc
assert _test_args(csc(2))
def test_sympy__functions__elementary__trigonometric__cot():
from sympy.functions.elementary.trigonometric import cot
assert _test_args(cot(2))
def test_sympy__functions__elementary__trigonometric__sin():
assert _test_args(sin(2))
def test_sympy__functions__elementary__trigonometric__sec():
from sympy.functions.elementary.trigonometric import sec
assert _test_args(sec(2))
def test_sympy__functions__elementary__trigonometric__tan():
from sympy.functions.elementary.trigonometric import tan
assert _test_args(tan(2))
@SKIP("abstract class")
def test_sympy__functions__special__bessel__BesselBase():
pass
@SKIP("abstract class")
def test_sympy__functions__special__bessel__SphericalBesselBase():
pass
def test_sympy__functions__special__bessel__besseli():
from sympy.functions.special.bessel import besseli
assert _test_args(besseli(x, 1))
def test_sympy__functions__special__bessel__besselj():
from sympy.functions.special.bessel import besselj
assert _test_args(besselj(x, 1))
def test_sympy__functions__special__bessel__besselk():
from sympy.functions.special.bessel import besselk
assert _test_args(besselk(x, 1))
def test_sympy__functions__special__bessel__bessely():
from sympy.functions.special.bessel import bessely
assert _test_args(bessely(x, 1))
def test_sympy__functions__special__bessel__hankel1():
from sympy.functions.special.bessel import hankel1
assert _test_args(hankel1(x, 1))
def test_sympy__functions__special__bessel__hankel2():
from sympy.functions.special.bessel import hankel2
assert _test_args(hankel2(x, 1))
def test_sympy__functions__special__bessel__jn():
from sympy.functions.special.bessel import jn
assert _test_args(jn(0, x))
def test_sympy__functions__special__bessel__yn():
from sympy.functions.special.bessel import yn
assert _test_args(yn(0, x))
def test_sympy__functions__special__bessel__AiryBase():
pass
def test_sympy__functions__special__bessel__airyai():
from sympy.functions.special.bessel import airyai
assert _test_args(airyai(2))
def test_sympy__functions__special__bessel__airybi():
from sympy.functions.special.bessel import airybi
assert _test_args(airybi(2))
def test_sympy__functions__special__bessel__airyaiprime():
from sympy.functions.special.bessel import airyaiprime
assert _test_args(airyaiprime(2))
def test_sympy__functions__special__bessel__airybiprime():
from sympy.functions.special.bessel import airybiprime
assert _test_args(airybiprime(2))
def test_sympy__functions__special__elliptic_integrals__elliptic_k():
from sympy.functions.special.elliptic_integrals import elliptic_k as K
assert _test_args(K(x))
def test_sympy__functions__special__elliptic_integrals__elliptic_f():
from sympy.functions.special.elliptic_integrals import elliptic_f as F
assert _test_args(F(x, y))
def test_sympy__functions__special__elliptic_integrals__elliptic_e():
from sympy.functions.special.elliptic_integrals import elliptic_e as E
assert _test_args(E(x))
assert _test_args(E(x, y))
def test_sympy__functions__special__elliptic_integrals__elliptic_pi():
from sympy.functions.special.elliptic_integrals import elliptic_pi as P
assert _test_args(P(x, y))
assert _test_args(P(x, y, z))
def test_sympy__functions__special__delta_functions__DiracDelta():
from sympy.functions.special.delta_functions import DiracDelta
assert _test_args(DiracDelta(x, 1))
def test_sympy__functions__special__delta_functions__Heaviside():
from sympy.functions.special.delta_functions import Heaviside
assert _test_args(Heaviside(x))
def test_sympy__functions__special__error_functions__erf():
from sympy.functions.special.error_functions import erf
assert _test_args(erf(2))
def test_sympy__functions__special__error_functions__erfc():
from sympy.functions.special.error_functions import erfc
assert _test_args(erfc(2))
def test_sympy__functions__special__error_functions__erfi():
from sympy.functions.special.error_functions import erfi
assert _test_args(erfi(2))
def test_sympy__functions__special__error_functions__erf2():
from sympy.functions.special.error_functions import erf2
assert _test_args(erf2(2, 3))
def test_sympy__functions__special__error_functions__erfinv():
from sympy.functions.special.error_functions import erfinv
assert _test_args(erfinv(2))
def test_sympy__functions__special__error_functions__erfcinv():
from sympy.functions.special.error_functions import erfcinv
assert _test_args(erfcinv(2))
def test_sympy__functions__special__error_functions__erf2inv():
from sympy.functions.special.error_functions import erf2inv
assert _test_args(erf2inv(2, 3))
@SKIP("abstract class")
def test_sympy__functions__special__error_functions__FresnelIntegral():
pass
def test_sympy__functions__special__error_functions__fresnels():
from sympy.functions.special.error_functions import fresnels
assert _test_args(fresnels(2))
def test_sympy__functions__special__error_functions__fresnelc():
from sympy.functions.special.error_functions import fresnelc
assert _test_args(fresnelc(2))
def test_sympy__functions__special__error_functions__erfs():
from sympy.functions.special.error_functions import _erfs
assert _test_args(_erfs(2))
def test_sympy__functions__special__error_functions__Ei():
from sympy.functions.special.error_functions import Ei
assert _test_args(Ei(2))
def test_sympy__functions__special__error_functions__li():
from sympy.functions.special.error_functions import li
assert _test_args(li(2))
def test_sympy__functions__special__error_functions__Li():
from sympy.functions.special.error_functions import Li
assert _test_args(Li(2))
@SKIP("abstract class")
def test_sympy__functions__special__error_functions__TrigonometricIntegral():
pass
def test_sympy__functions__special__error_functions__Si():
from sympy.functions.special.error_functions import Si
assert _test_args(Si(2))
def test_sympy__functions__special__error_functions__Ci():
from sympy.functions.special.error_functions import Ci
assert _test_args(Ci(2))
def test_sympy__functions__special__error_functions__Shi():
from sympy.functions.special.error_functions import Shi
assert _test_args(Shi(2))
def test_sympy__functions__special__error_functions__Chi():
from sympy.functions.special.error_functions import Chi
assert _test_args(Chi(2))
def test_sympy__functions__special__error_functions__expint():
from sympy.functions.special.error_functions import expint
assert _test_args(expint(y, x))
def test_sympy__functions__special__gamma_functions__gamma():
from sympy.functions.special.gamma_functions import gamma
assert _test_args(gamma(x))
def test_sympy__functions__special__gamma_functions__loggamma():
from sympy.functions.special.gamma_functions import loggamma
assert _test_args(loggamma(2))
def test_sympy__functions__special__gamma_functions__lowergamma():
from sympy.functions.special.gamma_functions import lowergamma
assert _test_args(lowergamma(x, 2))
def test_sympy__functions__special__gamma_functions__polygamma():
from sympy.functions.special.gamma_functions import polygamma
assert _test_args(polygamma(x, 2))
def test_sympy__functions__special__gamma_functions__uppergamma():
from sympy.functions.special.gamma_functions import uppergamma
assert _test_args(uppergamma(x, 2))
def test_sympy__functions__special__beta_functions__beta():
from sympy.functions.special.beta_functions import beta
assert _test_args(beta(x, x))
@SKIP("abstract class")
def test_sympy__functions__special__hyper__TupleParametersBase():
pass
@SKIP("abstract class")
def test_sympy__functions__special__hyper__TupleArg():
pass
def test_sympy__functions__special__hyper__hyper():
from sympy.functions.special.hyper import hyper
assert _test_args(hyper([1, 2, 3], [4, 5], x))
def test_sympy__functions__special__hyper__meijerg():
from sympy.functions.special.hyper import meijerg
assert _test_args(meijerg([1, 2, 3], [4, 5], [6], [], x))
@SKIP("abstract class")
def test_sympy__functions__special__hyper__HyperRep():
pass
def test_sympy__functions__special__hyper__HyperRep_power1():
from sympy.functions.special.hyper import HyperRep_power1
assert _test_args(HyperRep_power1(x, y))
def test_sympy__functions__special__hyper__HyperRep_power2():
from sympy.functions.special.hyper import HyperRep_power2
assert _test_args(HyperRep_power2(x, y))
def test_sympy__functions__special__hyper__HyperRep_log1():
from sympy.functions.special.hyper import HyperRep_log1
assert _test_args(HyperRep_log1(x))
def test_sympy__functions__special__hyper__HyperRep_atanh():
from sympy.functions.special.hyper import HyperRep_atanh
assert _test_args(HyperRep_atanh(x))
def test_sympy__functions__special__hyper__HyperRep_asin1():
from sympy.functions.special.hyper import HyperRep_asin1
assert _test_args(HyperRep_asin1(x))
def test_sympy__functions__special__hyper__HyperRep_asin2():
from sympy.functions.special.hyper import HyperRep_asin2
assert _test_args(HyperRep_asin2(x))
def test_sympy__functions__special__hyper__HyperRep_sqrts1():
from sympy.functions.special.hyper import HyperRep_sqrts1
assert _test_args(HyperRep_sqrts1(x, y))
def test_sympy__functions__special__hyper__HyperRep_sqrts2():
from sympy.functions.special.hyper import HyperRep_sqrts2
assert _test_args(HyperRep_sqrts2(x, y))
def test_sympy__functions__special__hyper__HyperRep_log2():
from sympy.functions.special.hyper import HyperRep_log2
assert _test_args(HyperRep_log2(x))
def test_sympy__functions__special__hyper__HyperRep_cosasin():
from sympy.functions.special.hyper import HyperRep_cosasin
assert _test_args(HyperRep_cosasin(x, y))
def test_sympy__functions__special__hyper__HyperRep_sinasin():
from sympy.functions.special.hyper import HyperRep_sinasin
assert _test_args(HyperRep_sinasin(x, y))
@SKIP("abstract class")
def test_sympy__functions__special__polynomials__OrthogonalPolynomial():
pass
def test_sympy__functions__special__polynomials__jacobi():
from sympy.functions.special.polynomials import jacobi
assert _test_args(jacobi(x, 2, 2, 2))
def test_sympy__functions__special__polynomials__gegenbauer():
from sympy.functions.special.polynomials import gegenbauer
assert _test_args(gegenbauer(x, 2, 2))
def test_sympy__functions__special__polynomials__chebyshevt():
from sympy.functions.special.polynomials import chebyshevt
assert _test_args(chebyshevt(x, 2))
def test_sympy__functions__special__polynomials__chebyshevt_root():
from sympy.functions.special.polynomials import chebyshevt_root
assert _test_args(chebyshevt_root(3, 2))
def test_sympy__functions__special__polynomials__chebyshevu():
from sympy.functions.special.polynomials import chebyshevu
assert _test_args(chebyshevu(x, 2))
def test_sympy__functions__special__polynomials__chebyshevu_root():
from sympy.functions.special.polynomials import chebyshevu_root
assert _test_args(chebyshevu_root(3, 2))
def test_sympy__functions__special__polynomials__hermite():
from sympy.functions.special.polynomials import hermite
assert _test_args(hermite(x, 2))
def test_sympy__functions__special__polynomials__legendre():
from sympy.functions.special.polynomials import legendre
assert _test_args(legendre(x, 2))
def test_sympy__functions__special__polynomials__assoc_legendre():
from sympy.functions.special.polynomials import assoc_legendre
assert _test_args(assoc_legendre(x, 0, y))
def test_sympy__functions__special__polynomials__laguerre():
from sympy.functions.special.polynomials import laguerre
assert _test_args(laguerre(x, 2))
def test_sympy__functions__special__polynomials__assoc_laguerre():
from sympy.functions.special.polynomials import assoc_laguerre
assert _test_args(assoc_laguerre(x, 0, y))
def test_sympy__functions__special__spherical_harmonics__Ynm():
from sympy.functions.special.spherical_harmonics import Ynm
assert _test_args(Ynm(1, 1, x, y))
def test_sympy__functions__special__spherical_harmonics__Znm():
from sympy.functions.special.spherical_harmonics import Znm
assert _test_args(Znm(1, 1, x, y))
def test_sympy__functions__special__tensor_functions__LeviCivita():
from sympy.functions.special.tensor_functions import LeviCivita
assert _test_args(LeviCivita(x, y, 2))
def test_sympy__functions__special__tensor_functions__KroneckerDelta():
from sympy.functions.special.tensor_functions import KroneckerDelta
assert _test_args(KroneckerDelta(x, y))
def test_sympy__functions__special__zeta_functions__dirichlet_eta():
from sympy.functions.special.zeta_functions import dirichlet_eta
assert _test_args(dirichlet_eta(x))
def test_sympy__functions__special__zeta_functions__zeta():
from sympy.functions.special.zeta_functions import zeta
assert _test_args(zeta(101))
def test_sympy__functions__special__zeta_functions__lerchphi():
from sympy.functions.special.zeta_functions import lerchphi
assert _test_args(lerchphi(x, y, z))
def test_sympy__functions__special__zeta_functions__polylog():
from sympy.functions.special.zeta_functions import polylog
assert _test_args(polylog(x, y))
def test_sympy__integrals__integrals__Integral():
from sympy.integrals.integrals import Integral
assert _test_args(Integral(2, (x, 0, 1)))
def test_sympy__integrals__risch__NonElementaryIntegral():
from sympy.integrals.risch import NonElementaryIntegral
assert _test_args(NonElementaryIntegral(exp(-x**2), x))
@SKIP("abstract class")
def test_sympy__integrals__transforms__IntegralTransform():
pass
def test_sympy__integrals__transforms__MellinTransform():
from sympy.integrals.transforms import MellinTransform
assert _test_args(MellinTransform(2, x, y))
def test_sympy__integrals__transforms__InverseMellinTransform():
from sympy.integrals.transforms import InverseMellinTransform
assert _test_args(InverseMellinTransform(2, x, y, 0, 1))
def test_sympy__integrals__transforms__LaplaceTransform():
from sympy.integrals.transforms import LaplaceTransform
assert _test_args(LaplaceTransform(2, x, y))
def test_sympy__integrals__transforms__InverseLaplaceTransform():
from sympy.integrals.transforms import InverseLaplaceTransform
assert _test_args(InverseLaplaceTransform(2, x, y, 0))
@SKIP("abstract class")
def test_sympy__integrals__transforms__FourierTypeTransform():
pass
def test_sympy__integrals__transforms__InverseFourierTransform():
from sympy.integrals.transforms import InverseFourierTransform
assert _test_args(InverseFourierTransform(2, x, y))
def test_sympy__integrals__transforms__FourierTransform():
from sympy.integrals.transforms import FourierTransform
assert _test_args(FourierTransform(2, x, y))
@SKIP("abstract class")
def test_sympy__integrals__transforms__SineCosineTypeTransform():
pass
def test_sympy__integrals__transforms__InverseSineTransform():
from sympy.integrals.transforms import InverseSineTransform
assert _test_args(InverseSineTransform(2, x, y))
def test_sympy__integrals__transforms__SineTransform():
from sympy.integrals.transforms import SineTransform
assert _test_args(SineTransform(2, x, y))
def test_sympy__integrals__transforms__InverseCosineTransform():
from sympy.integrals.transforms import InverseCosineTransform
assert _test_args(InverseCosineTransform(2, x, y))
def test_sympy__integrals__transforms__CosineTransform():
from sympy.integrals.transforms import CosineTransform
assert _test_args(CosineTransform(2, x, y))
@SKIP("abstract class")
def test_sympy__integrals__transforms__HankelTypeTransform():
pass
def test_sympy__integrals__transforms__InverseHankelTransform():
from sympy.integrals.transforms import InverseHankelTransform
assert _test_args(InverseHankelTransform(2, x, y, 0))
def test_sympy__integrals__transforms__HankelTransform():
from sympy.integrals.transforms import HankelTransform
assert _test_args(HankelTransform(2, x, y, 0))
@XFAIL
def test_sympy__liealgebras__cartan_type__CartanType_generator():
from sympy.liealgebras.cartan_type import CartanType_generator
assert _test_args(CartanType_generator("A2"))
@XFAIL
def test_sympy__liealgebras__cartan_type__Standard_Cartan():
from sympy.liealgebras.cartan_type import Standard_Cartan
assert _test_args(Standard_Cartan("A", 2))
@XFAIL
def test_sympy__liealgebras__weyl_group__WeylGroup():
from sympy.liealgebras.weyl_group import WeylGroup
assert _test_args(WeylGroup("B4"))
@XFAIL
def test_sympy__liealgebras__root_system__RootSystem():
from sympy.liealgebras.root_system import RootSystem
assert _test_args(RootSystem("A2"))
@XFAIL
def test_sympy__liealgebras__type_a__TypeA():
from sympy.liealgebras.type_a import TypeA
assert _test_args(TypeA(2))
@XFAIL
def test_sympy__liealgebras__type_b__TypeB():
from sympy.liealgebras.type_b import TypeB
assert _test_args(TypeB(4))
@XFAIL
def test_sympy__liealgebras__type_c__TypeC():
from sympy.liealgebras.type_c import TypeC
assert _test_args(TypeC(4))
@XFAIL
def test_sympy__liealgebras__type_d__TypeD():
from sympy.liealgebras.type_d import TypeD
assert _test_args(TypeD(4))
@XFAIL
def test_sympy__liealgebras__type_e__TypeE():
from sympy.liealgebras.type_e import TypeE
assert _test_args(TypeE(6))
@XFAIL
def test_sympy__liealgebras__type_f__TypeF():
from sympy.liealgebras.type_f import TypeF
assert _test_args(TypeF(4))
@XFAIL
def test_sympy__liealgebras__type_g__TypeG():
from sympy.liealgebras.type_g import TypeG
assert _test_args(TypeG(2))
def test_sympy__logic__boolalg__And():
from sympy.logic.boolalg import And
assert _test_args(And(x, y, 2))
@SKIP("abstract class")
def test_sympy__logic__boolalg__Boolean():
pass
def test_sympy__logic__boolalg__BooleanFunction():
from sympy.logic.boolalg import BooleanFunction
assert _test_args(BooleanFunction(1, 2, 3))
@SKIP("abstract class")
def test_sympy__logic__boolalg__BooleanAtom():
pass
def test_sympy__logic__boolalg__BooleanTrue():
from sympy.logic.boolalg import true
assert _test_args(true)
def test_sympy__logic__boolalg__BooleanFalse():
from sympy.logic.boolalg import false
assert _test_args(false)
def test_sympy__logic__boolalg__Equivalent():
from sympy.logic.boolalg import Equivalent
assert _test_args(Equivalent(x, 2))
def test_sympy__logic__boolalg__ITE():
from sympy.logic.boolalg import ITE
assert _test_args(ITE(x, y, 2))
def test_sympy__logic__boolalg__Implies():
from sympy.logic.boolalg import Implies
assert _test_args(Implies(x, y))
def test_sympy__logic__boolalg__Nand():
from sympy.logic.boolalg import Nand
assert _test_args(Nand(x, y, 2))
def test_sympy__logic__boolalg__Nor():
from sympy.logic.boolalg import Nor
assert _test_args(Nor(x, y))
def test_sympy__logic__boolalg__Not():
from sympy.logic.boolalg import Not
assert _test_args(Not(x))
def test_sympy__logic__boolalg__Or():
from sympy.logic.boolalg import Or
assert _test_args(Or(x, y))
def test_sympy__logic__boolalg__Xor():
from sympy.logic.boolalg import Xor
assert _test_args(Xor(x, y, 2))
def test_sympy__matrices__matrices__DeferredVector():
from sympy.matrices.matrices import DeferredVector
assert _test_args(DeferredVector("X"))
@SKIP("abstract class")
def test_sympy__matrices__expressions__matexpr__MatrixBase():
pass
def test_sympy__matrices__immutable__ImmutableMatrix():
from sympy.matrices.immutable import ImmutableMatrix
m = ImmutableMatrix([[1, 2], [3, 4]])
assert _test_args(m)
assert _test_args(Basic(*list(m)))
m = ImmutableMatrix(1, 1, [1])
assert _test_args(m)
assert _test_args(Basic(*list(m)))
m = ImmutableMatrix(2, 2, lambda i, j: 1)
assert m[0, 0] is S.One
m = ImmutableMatrix(2, 2, lambda i, j: 1/(1 + i) + 1/(1 + j))
assert m[1, 1] is S.One # true div. will give 1.0 if i,j not sympified
assert _test_args(m)
assert _test_args(Basic(*list(m)))
def test_sympy__matrices__immutable__ImmutableSparseMatrix():
from sympy.matrices.immutable import ImmutableSparseMatrix
m = ImmutableSparseMatrix([[1, 2], [3, 4]])
assert _test_args(m)
assert _test_args(Basic(*list(m)))
m = ImmutableSparseMatrix(1, 1, {(0, 0): 1})
assert _test_args(m)
assert _test_args(Basic(*list(m)))
m = ImmutableSparseMatrix(1, 1, [1])
assert _test_args(m)
assert _test_args(Basic(*list(m)))
m = ImmutableSparseMatrix(2, 2, lambda i, j: 1)
assert m[0, 0] is S.One
m = ImmutableSparseMatrix(2, 2, lambda i, j: 1/(1 + i) + 1/(1 + j))
assert m[1, 1] is S.One # true div. will give 1.0 if i,j not sympified
assert _test_args(m)
assert _test_args(Basic(*list(m)))
def test_sympy__matrices__expressions__slice__MatrixSlice():
from sympy.matrices.expressions.slice import MatrixSlice
from sympy.matrices.expressions import MatrixSymbol
X = MatrixSymbol('X', 4, 4)
assert _test_args(MatrixSlice(X, (0, 2), (0, 2)))
def test_sympy__matrices__expressions__blockmatrix__BlockDiagMatrix():
from sympy.matrices.expressions.blockmatrix import BlockDiagMatrix
from sympy.matrices.expressions import MatrixSymbol
X = MatrixSymbol('X', x, x)
Y = MatrixSymbol('Y', y, y)
assert _test_args(BlockDiagMatrix(X, Y))
def test_sympy__matrices__expressions__blockmatrix__BlockMatrix():
from sympy.matrices.expressions.blockmatrix import BlockMatrix
from sympy.matrices.expressions import MatrixSymbol, ZeroMatrix
X = MatrixSymbol('X', x, x)
Y = MatrixSymbol('Y', y, y)
Z = MatrixSymbol('Z', x, y)
O = ZeroMatrix(y, x)
assert _test_args(BlockMatrix([[X, Z], [O, Y]]))
def test_sympy__matrices__expressions__inverse__Inverse():
from sympy.matrices.expressions.inverse import Inverse
from sympy.matrices.expressions import MatrixSymbol
assert _test_args(Inverse(MatrixSymbol('A', 3, 3)))
def test_sympy__matrices__expressions__matadd__MatAdd():
from sympy.matrices.expressions.matadd import MatAdd
from sympy.matrices.expressions import MatrixSymbol
X = MatrixSymbol('X', x, y)
Y = MatrixSymbol('Y', x, y)
assert _test_args(MatAdd(X, Y))
def test_sympy__matrices__expressions__matexpr__Identity():
from sympy.matrices.expressions.matexpr import Identity
assert _test_args(Identity(3))
@SKIP("abstract class")
def test_sympy__matrices__expressions__matexpr__MatrixExpr():
pass
def test_sympy__matrices__expressions__matexpr__MatrixElement():
from sympy.matrices.expressions.matexpr import MatrixSymbol, MatrixElement
from sympy import S
assert _test_args(MatrixElement(MatrixSymbol('A', 3, 5), S(2), S(3)))
@XFAIL
def test_sympy__matrices__expressions__matexpr__MatrixSymbol():
from sympy.matrices.expressions.matexpr import MatrixSymbol
assert _test_args(MatrixSymbol('A', 3, 5))
def test_sympy__matrices__expressions__matexpr__ZeroMatrix():
from sympy.matrices.expressions.matexpr import ZeroMatrix
assert _test_args(ZeroMatrix(3, 5))
def test_sympy__matrices__expressions__matmul__MatMul():
from sympy.matrices.expressions.matmul import MatMul
from sympy.matrices.expressions import MatrixSymbol
X = MatrixSymbol('X', x, y)
Y = MatrixSymbol('Y', y, x)
assert _test_args(MatMul(X, Y))
def test_sympy__matrices__expressions__diagonal__DiagonalMatrix():
from sympy.matrices.expressions.diagonal import DiagonalMatrix
from sympy.matrices.expressions import MatrixSymbol
x = MatrixSymbol('x', 10, 1)
assert _test_args(DiagonalMatrix(x))
def test_sympy__matrices__expressions__diagonal__DiagonalOf():
from sympy.matrices.expressions.diagonal import DiagonalOf
from sympy.matrices.expressions import MatrixSymbol
X = MatrixSymbol('x', 10, 10)
assert _test_args(DiagonalOf(X))
def test_sympy__matrices__expressions__hadamard__HadamardProduct():
from sympy.matrices.expressions.hadamard import HadamardProduct
from sympy.matrices.expressions import MatrixSymbol
X = MatrixSymbol('X', x, y)
Y = MatrixSymbol('Y', x, y)
assert _test_args(HadamardProduct(X, Y))
def test_sympy__matrices__expressions__matpow__MatPow():
from sympy.matrices.expressions.matpow import MatPow
from sympy.matrices.expressions import MatrixSymbol
X = MatrixSymbol('X', x, x)
assert _test_args(MatPow(X, 2))
def test_sympy__matrices__expressions__transpose__Transpose():
from sympy.matrices.expressions.transpose import Transpose
from sympy.matrices.expressions import MatrixSymbol
assert _test_args(Transpose(MatrixSymbol('A', 3, 5)))
def test_sympy__matrices__expressions__adjoint__Adjoint():
from sympy.matrices.expressions.adjoint import Adjoint
from sympy.matrices.expressions import MatrixSymbol
assert _test_args(Adjoint(MatrixSymbol('A', 3, 5)))
def test_sympy__matrices__expressions__trace__Trace():
from sympy.matrices.expressions.trace import Trace
from sympy.matrices.expressions import MatrixSymbol
assert _test_args(Trace(MatrixSymbol('A', 3, 3)))
def test_sympy__matrices__expressions__determinant__Determinant():
from sympy.matrices.expressions.determinant import Determinant
from sympy.matrices.expressions import MatrixSymbol
assert _test_args(Determinant(MatrixSymbol('A', 3, 3)))
def test_sympy__matrices__expressions__funcmatrix__FunctionMatrix():
from sympy.matrices.expressions.funcmatrix import FunctionMatrix
from sympy import Lambda, symbols
i, j = symbols('i,j')
assert _test_args(FunctionMatrix(3, 3, Lambda((i, j), i - j) ))
def test_sympy__matrices__expressions__fourier__DFT():
from sympy.matrices.expressions.fourier import DFT
from sympy import S
assert _test_args(DFT(S(2)))
def test_sympy__matrices__expressions__fourier__IDFT():
from sympy.matrices.expressions.fourier import IDFT
from sympy import S
assert _test_args(IDFT(S(2)))
from sympy.matrices.expressions import MatrixSymbol
X = MatrixSymbol('X', 10, 10)
def test_sympy__matrices__expressions__factorizations__LofLU():
from sympy.matrices.expressions.factorizations import LofLU
assert _test_args(LofLU(X))
def test_sympy__matrices__expressions__factorizations__UofLU():
from sympy.matrices.expressions.factorizations import UofLU
assert _test_args(UofLU(X))
def test_sympy__matrices__expressions__factorizations__QofQR():
from sympy.matrices.expressions.factorizations import QofQR
assert _test_args(QofQR(X))
def test_sympy__matrices__expressions__factorizations__RofQR():
from sympy.matrices.expressions.factorizations import RofQR
assert _test_args(RofQR(X))
def test_sympy__matrices__expressions__factorizations__LofCholesky():
from sympy.matrices.expressions.factorizations import LofCholesky
assert _test_args(LofCholesky(X))
def test_sympy__matrices__expressions__factorizations__UofCholesky():
from sympy.matrices.expressions.factorizations import UofCholesky
assert _test_args(UofCholesky(X))
def test_sympy__matrices__expressions__factorizations__EigenVectors():
from sympy.matrices.expressions.factorizations import EigenVectors
assert _test_args(EigenVectors(X))
def test_sympy__matrices__expressions__factorizations__EigenValues():
from sympy.matrices.expressions.factorizations import EigenValues
assert _test_args(EigenValues(X))
def test_sympy__matrices__expressions__factorizations__UofSVD():
from sympy.matrices.expressions.factorizations import UofSVD
assert _test_args(UofSVD(X))
def test_sympy__matrices__expressions__factorizations__VofSVD():
from sympy.matrices.expressions.factorizations import VofSVD
assert _test_args(VofSVD(X))
def test_sympy__matrices__expressions__factorizations__SofSVD():
from sympy.matrices.expressions.factorizations import SofSVD
assert _test_args(SofSVD(X))
@SKIP("abstract class")
def test_sympy__matrices__expressions__factorizations__Factorization():
pass
def test_sympy__physics__vector__frame__CoordinateSym():
from sympy.physics.vector import CoordinateSym
from sympy.physics.vector import ReferenceFrame
assert _test_args(CoordinateSym('R_x', ReferenceFrame('R'), 0))
def test_sympy__physics__paulialgebra__Pauli():
from sympy.physics.paulialgebra import Pauli
assert _test_args(Pauli(1))
def test_sympy__physics__quantum__anticommutator__AntiCommutator():
from sympy.physics.quantum.anticommutator import AntiCommutator
assert _test_args(AntiCommutator(x, y))
def test_sympy__physics__quantum__cartesian__PositionBra3D():
from sympy.physics.quantum.cartesian import PositionBra3D
assert _test_args(PositionBra3D(x, y, z))
def test_sympy__physics__quantum__cartesian__PositionKet3D():
from sympy.physics.quantum.cartesian import PositionKet3D
assert _test_args(PositionKet3D(x, y, z))
def test_sympy__physics__quantum__cartesian__PositionState3D():
from sympy.physics.quantum.cartesian import PositionState3D
assert _test_args(PositionState3D(x, y, z))
def test_sympy__physics__quantum__cartesian__PxBra():
from sympy.physics.quantum.cartesian import PxBra
assert _test_args(PxBra(x, y, z))
def test_sympy__physics__quantum__cartesian__PxKet():
from sympy.physics.quantum.cartesian import PxKet
assert _test_args(PxKet(x, y, z))
def test_sympy__physics__quantum__cartesian__PxOp():
from sympy.physics.quantum.cartesian import PxOp
assert _test_args(PxOp(x, y, z))
def test_sympy__physics__quantum__cartesian__XBra():
from sympy.physics.quantum.cartesian import XBra
assert _test_args(XBra(x))
def test_sympy__physics__quantum__cartesian__XKet():
from sympy.physics.quantum.cartesian import XKet
assert _test_args(XKet(x))
def test_sympy__physics__quantum__cartesian__XOp():
from sympy.physics.quantum.cartesian import XOp
assert _test_args(XOp(x))
def test_sympy__physics__quantum__cartesian__YOp():
from sympy.physics.quantum.cartesian import YOp
assert _test_args(YOp(x))
def test_sympy__physics__quantum__cartesian__ZOp():
from sympy.physics.quantum.cartesian import ZOp
assert _test_args(ZOp(x))
def test_sympy__physics__quantum__cg__CG():
from sympy.physics.quantum.cg import CG
from sympy import S
assert _test_args(CG(S(3)/2, S(3)/2, S(1)/2, -S(1)/2, 1, 1))
def test_sympy__physics__quantum__cg__Wigner3j():
from sympy.physics.quantum.cg import Wigner3j
assert _test_args(Wigner3j(6, 0, 4, 0, 2, 0))
def test_sympy__physics__quantum__cg__Wigner6j():
from sympy.physics.quantum.cg import Wigner6j
assert _test_args(Wigner6j(1, 2, 3, 2, 1, 2))
def test_sympy__physics__quantum__cg__Wigner9j():
from sympy.physics.quantum.cg import Wigner9j
assert _test_args(Wigner9j(2, 1, 1, S(3)/2, S(1)/2, 1, S(1)/2, S(1)/2, 0))
def test_sympy__physics__quantum__circuitplot__Mz():
from sympy.physics.quantum.circuitplot import Mz
assert _test_args(Mz(0))
def test_sympy__physics__quantum__circuitplot__Mx():
from sympy.physics.quantum.circuitplot import Mx
assert _test_args(Mx(0))
def test_sympy__physics__quantum__commutator__Commutator():
from sympy.physics.quantum.commutator import Commutator
A, B = symbols('A,B', commutative=False)
assert _test_args(Commutator(A, B))
def test_sympy__physics__quantum__constants__HBar():
from sympy.physics.quantum.constants import HBar
assert _test_args(HBar())
def test_sympy__physics__quantum__dagger__Dagger():
from sympy.physics.quantum.dagger import Dagger
from sympy.physics.quantum.state import Ket
assert _test_args(Dagger(Dagger(Ket('psi'))))
def test_sympy__physics__quantum__gate__CGate():
from sympy.physics.quantum.gate import CGate, Gate
assert _test_args(CGate((0, 1), Gate(2)))
def test_sympy__physics__quantum__gate__CGateS():
from sympy.physics.quantum.gate import CGateS, Gate
assert _test_args(CGateS((0, 1), Gate(2)))
def test_sympy__physics__quantum__gate__CNotGate():
from sympy.physics.quantum.gate import CNotGate
assert _test_args(CNotGate(0, 1))
def test_sympy__physics__quantum__gate__Gate():
from sympy.physics.quantum.gate import Gate
assert _test_args(Gate(0))
def test_sympy__physics__quantum__gate__HadamardGate():
from sympy.physics.quantum.gate import HadamardGate
assert _test_args(HadamardGate(0))
def test_sympy__physics__quantum__gate__IdentityGate():
from sympy.physics.quantum.gate import IdentityGate
assert _test_args(IdentityGate(0))
def test_sympy__physics__quantum__gate__OneQubitGate():
from sympy.physics.quantum.gate import OneQubitGate
assert _test_args(OneQubitGate(0))
def test_sympy__physics__quantum__gate__PhaseGate():
from sympy.physics.quantum.gate import PhaseGate
assert _test_args(PhaseGate(0))
def test_sympy__physics__quantum__gate__SwapGate():
from sympy.physics.quantum.gate import SwapGate
assert _test_args(SwapGate(0, 1))
def test_sympy__physics__quantum__gate__TGate():
from sympy.physics.quantum.gate import TGate
assert _test_args(TGate(0))
def test_sympy__physics__quantum__gate__TwoQubitGate():
from sympy.physics.quantum.gate import TwoQubitGate
assert _test_args(TwoQubitGate(0))
def test_sympy__physics__quantum__gate__UGate():
from sympy.physics.quantum.gate import UGate
from sympy.matrices.immutable import ImmutableMatrix
from sympy import Integer, Tuple
assert _test_args(
UGate(Tuple(Integer(1)), ImmutableMatrix([[1, 0], [0, 2]])))
def test_sympy__physics__quantum__gate__XGate():
from sympy.physics.quantum.gate import XGate
assert _test_args(XGate(0))
def test_sympy__physics__quantum__gate__YGate():
from sympy.physics.quantum.gate import YGate
assert _test_args(YGate(0))
def test_sympy__physics__quantum__gate__ZGate():
from sympy.physics.quantum.gate import ZGate
assert _test_args(ZGate(0))
@SKIP("TODO: sympy.physics")
def test_sympy__physics__quantum__grover__OracleGate():
from sympy.physics.quantum.grover import OracleGate
assert _test_args(OracleGate())
def test_sympy__physics__quantum__grover__WGate():
from sympy.physics.quantum.grover import WGate
assert _test_args(WGate(1))
def test_sympy__physics__quantum__hilbert__ComplexSpace():
from sympy.physics.quantum.hilbert import ComplexSpace
assert _test_args(ComplexSpace(x))
def test_sympy__physics__quantum__hilbert__DirectSumHilbertSpace():
from sympy.physics.quantum.hilbert import DirectSumHilbertSpace, ComplexSpace, FockSpace
c = ComplexSpace(2)
f = FockSpace()
assert _test_args(DirectSumHilbertSpace(c, f))
def test_sympy__physics__quantum__hilbert__FockSpace():
from sympy.physics.quantum.hilbert import FockSpace
assert _test_args(FockSpace())
def test_sympy__physics__quantum__hilbert__HilbertSpace():
from sympy.physics.quantum.hilbert import HilbertSpace
assert _test_args(HilbertSpace())
def test_sympy__physics__quantum__hilbert__L2():
from sympy.physics.quantum.hilbert import L2
from sympy import oo, Interval
assert _test_args(L2(Interval(0, oo)))
def test_sympy__physics__quantum__hilbert__TensorPowerHilbertSpace():
from sympy.physics.quantum.hilbert import TensorPowerHilbertSpace, FockSpace
f = FockSpace()
assert _test_args(TensorPowerHilbertSpace(f, 2))
def test_sympy__physics__quantum__hilbert__TensorProductHilbertSpace():
from sympy.physics.quantum.hilbert import TensorProductHilbertSpace, FockSpace, ComplexSpace
c = ComplexSpace(2)
f = FockSpace()
assert _test_args(TensorProductHilbertSpace(f, c))
def test_sympy__physics__quantum__innerproduct__InnerProduct():
from sympy.physics.quantum import Bra, Ket, InnerProduct
b = Bra('b')
k = Ket('k')
assert _test_args(InnerProduct(b, k))
def test_sympy__physics__quantum__operator__DifferentialOperator():
from sympy.physics.quantum.operator import DifferentialOperator
from sympy import Derivative, Function
f = Function('f')
assert _test_args(DifferentialOperator(1/x*Derivative(f(x), x), f(x)))
def test_sympy__physics__quantum__operator__HermitianOperator():
from sympy.physics.quantum.operator import HermitianOperator
assert _test_args(HermitianOperator('H'))
def test_sympy__physics__quantum__operator__IdentityOperator():
from sympy.physics.quantum.operator import IdentityOperator
assert _test_args(IdentityOperator(5))
def test_sympy__physics__quantum__operator__Operator():
from sympy.physics.quantum.operator import Operator
assert _test_args(Operator('A'))
def test_sympy__physics__quantum__operator__OuterProduct():
from sympy.physics.quantum.operator import OuterProduct
from sympy.physics.quantum import Ket, Bra
b = Bra('b')
k = Ket('k')
assert _test_args(OuterProduct(k, b))
def test_sympy__physics__quantum__operator__UnitaryOperator():
from sympy.physics.quantum.operator import UnitaryOperator
assert _test_args(UnitaryOperator('U'))
def test_sympy__physics__quantum__piab__PIABBra():
from sympy.physics.quantum.piab import PIABBra
assert _test_args(PIABBra('B'))
def test_sympy__physics__quantum__boson__BosonOp():
from sympy.physics.quantum.boson import BosonOp
assert _test_args(BosonOp('a'))
assert _test_args(BosonOp('a', False))
def test_sympy__physics__quantum__boson__BosonFockKet():
from sympy.physics.quantum.boson import BosonFockKet
assert _test_args(BosonFockKet(1))
def test_sympy__physics__quantum__boson__BosonFockBra():
from sympy.physics.quantum.boson import BosonFockBra
assert _test_args(BosonFockBra(1))
def test_sympy__physics__quantum__boson__BosonCoherentKet():
from sympy.physics.quantum.boson import BosonCoherentKet
assert _test_args(BosonCoherentKet(1))
def test_sympy__physics__quantum__boson__BosonCoherentBra():
from sympy.physics.quantum.boson import BosonCoherentBra
assert _test_args(BosonCoherentBra(1))
def test_sympy__physics__quantum__fermion__FermionOp():
from sympy.physics.quantum.fermion import FermionOp
assert _test_args(FermionOp('c'))
assert _test_args(FermionOp('c', False))
def test_sympy__physics__quantum__fermion__FermionFockKet():
from sympy.physics.quantum.fermion import FermionFockKet
assert _test_args(FermionFockKet(1))
def test_sympy__physics__quantum__fermion__FermionFockBra():
from sympy.physics.quantum.fermion import FermionFockBra
assert _test_args(FermionFockBra(1))
def test_sympy__physics__quantum__pauli__SigmaOpBase():
from sympy.physics.quantum.pauli import SigmaOpBase
assert _test_args(SigmaOpBase())
def test_sympy__physics__quantum__pauli__SigmaX():
from sympy.physics.quantum.pauli import SigmaX
assert _test_args(SigmaX())
def test_sympy__physics__quantum__pauli__SigmaY():
from sympy.physics.quantum.pauli import SigmaY
assert _test_args(SigmaY())
def test_sympy__physics__quantum__pauli__SigmaZ():
from sympy.physics.quantum.pauli import SigmaZ
assert _test_args(SigmaZ())
def test_sympy__physics__quantum__pauli__SigmaMinus():
from sympy.physics.quantum.pauli import SigmaMinus
assert _test_args(SigmaMinus())
def test_sympy__physics__quantum__pauli__SigmaPlus():
from sympy.physics.quantum.pauli import SigmaPlus
assert _test_args(SigmaPlus())
def test_sympy__physics__quantum__pauli__SigmaZKet():
from sympy.physics.quantum.pauli import SigmaZKet
assert _test_args(SigmaZKet(0))
def test_sympy__physics__quantum__pauli__SigmaZBra():
from sympy.physics.quantum.pauli import SigmaZBra
assert _test_args(SigmaZBra(0))
def test_sympy__physics__quantum__piab__PIABHamiltonian():
from sympy.physics.quantum.piab import PIABHamiltonian
assert _test_args(PIABHamiltonian('P'))
def test_sympy__physics__quantum__piab__PIABKet():
from sympy.physics.quantum.piab import PIABKet
assert _test_args(PIABKet('K'))
def test_sympy__physics__quantum__qexpr__QExpr():
from sympy.physics.quantum.qexpr import QExpr
assert _test_args(QExpr(0))
def test_sympy__physics__quantum__qft__Fourier():
from sympy.physics.quantum.qft import Fourier
assert _test_args(Fourier(0, 1))
def test_sympy__physics__quantum__qft__IQFT():
from sympy.physics.quantum.qft import IQFT
assert _test_args(IQFT(0, 1))
def test_sympy__physics__quantum__qft__QFT():
from sympy.physics.quantum.qft import QFT
assert _test_args(QFT(0, 1))
def test_sympy__physics__quantum__qft__RkGate():
from sympy.physics.quantum.qft import RkGate
assert _test_args(RkGate(0, 1))
def test_sympy__physics__quantum__qubit__IntQubit():
from sympy.physics.quantum.qubit import IntQubit
assert _test_args(IntQubit(0))
def test_sympy__physics__quantum__qubit__IntQubitBra():
from sympy.physics.quantum.qubit import IntQubitBra
assert _test_args(IntQubitBra(0))
def test_sympy__physics__quantum__qubit__IntQubitState():
from sympy.physics.quantum.qubit import IntQubitState, QubitState
assert _test_args(IntQubitState(QubitState(0, 1)))
def test_sympy__physics__quantum__qubit__Qubit():
from sympy.physics.quantum.qubit import Qubit
assert _test_args(Qubit(0, 0, 0))
def test_sympy__physics__quantum__qubit__QubitBra():
from sympy.physics.quantum.qubit import QubitBra
assert _test_args(QubitBra('1', 0))
def test_sympy__physics__quantum__qubit__QubitState():
from sympy.physics.quantum.qubit import QubitState
assert _test_args(QubitState(0, 1))
def test_sympy__physics__quantum__density__Density():
from sympy.physics.quantum.density import Density
from sympy.physics.quantum.state import Ket
assert _test_args(Density([Ket(0), 0.5], [Ket(1), 0.5]))
@SKIP("TODO: sympy.physics.quantum.shor: Cmod Not Implemented")
def test_sympy__physics__quantum__shor__CMod():
from sympy.physics.quantum.shor import CMod
assert _test_args(CMod())
def test_sympy__physics__quantum__spin__CoupledSpinState():
from sympy.physics.quantum.spin import CoupledSpinState
assert _test_args(CoupledSpinState(1, 0, (1, 1)))
assert _test_args(CoupledSpinState(1, 0, (1, S(1)/2, S(1)/2)))
assert _test_args(CoupledSpinState(
1, 0, (1, S(1)/2, S(1)/2), ((2, 3, S(1)/2), (1, 2, 1)) ))
j, m, j1, j2, j3, j12, x = symbols('j m j1:4 j12 x')
assert CoupledSpinState(
j, m, (j1, j2, j3)).subs(j2, x) == CoupledSpinState(j, m, (j1, x, j3))
assert CoupledSpinState(j, m, (j1, j2, j3), ((1, 3, j12), (1, 2, j)) ).subs(j12, x) == \
CoupledSpinState(j, m, (j1, j2, j3), ((1, 3, x), (1, 2, j)) )
def test_sympy__physics__quantum__spin__J2Op():
from sympy.physics.quantum.spin import J2Op
assert _test_args(J2Op('J'))
def test_sympy__physics__quantum__spin__JminusOp():
from sympy.physics.quantum.spin import JminusOp
assert _test_args(JminusOp('J'))
def test_sympy__physics__quantum__spin__JplusOp():
from sympy.physics.quantum.spin import JplusOp
assert _test_args(JplusOp('J'))
def test_sympy__physics__quantum__spin__JxBra():
from sympy.physics.quantum.spin import JxBra
assert _test_args(JxBra(1, 0))
def test_sympy__physics__quantum__spin__JxBraCoupled():
from sympy.physics.quantum.spin import JxBraCoupled
assert _test_args(JxBraCoupled(1, 0, (1, 1)))
def test_sympy__physics__quantum__spin__JxKet():
from sympy.physics.quantum.spin import JxKet
assert _test_args(JxKet(1, 0))
def test_sympy__physics__quantum__spin__JxKetCoupled():
from sympy.physics.quantum.spin import JxKetCoupled
assert _test_args(JxKetCoupled(1, 0, (1, 1)))
def test_sympy__physics__quantum__spin__JxOp():
from sympy.physics.quantum.spin import JxOp
assert _test_args(JxOp('J'))
def test_sympy__physics__quantum__spin__JyBra():
from sympy.physics.quantum.spin import JyBra
assert _test_args(JyBra(1, 0))
def test_sympy__physics__quantum__spin__JyBraCoupled():
from sympy.physics.quantum.spin import JyBraCoupled
assert _test_args(JyBraCoupled(1, 0, (1, 1)))
def test_sympy__physics__quantum__spin__JyKet():
from sympy.physics.quantum.spin import JyKet
assert _test_args(JyKet(1, 0))
def test_sympy__physics__quantum__spin__JyKetCoupled():
from sympy.physics.quantum.spin import JyKetCoupled
assert _test_args(JyKetCoupled(1, 0, (1, 1)))
def test_sympy__physics__quantum__spin__JyOp():
from sympy.physics.quantum.spin import JyOp
assert _test_args(JyOp('J'))
def test_sympy__physics__quantum__spin__JzBra():
from sympy.physics.quantum.spin import JzBra
assert _test_args(JzBra(1, 0))
def test_sympy__physics__quantum__spin__JzBraCoupled():
from sympy.physics.quantum.spin import JzBraCoupled
assert _test_args(JzBraCoupled(1, 0, (1, 1)))
def test_sympy__physics__quantum__spin__JzKet():
from sympy.physics.quantum.spin import JzKet
assert _test_args(JzKet(1, 0))
def test_sympy__physics__quantum__spin__JzKetCoupled():
from sympy.physics.quantum.spin import JzKetCoupled
assert _test_args(JzKetCoupled(1, 0, (1, 1)))
def test_sympy__physics__quantum__spin__JzOp():
from sympy.physics.quantum.spin import JzOp
assert _test_args(JzOp('J'))
def test_sympy__physics__quantum__spin__Rotation():
from sympy.physics.quantum.spin import Rotation
from sympy import pi
assert _test_args(Rotation(pi, 0, pi/2))
def test_sympy__physics__quantum__spin__SpinState():
from sympy.physics.quantum.spin import SpinState
assert _test_args(SpinState(1, 0))
def test_sympy__physics__quantum__spin__WignerD():
from sympy.physics.quantum.spin import WignerD
assert _test_args(WignerD(0, 1, 2, 3, 4, 5))
def test_sympy__physics__quantum__state__Bra():
from sympy.physics.quantum.state import Bra
assert _test_args(Bra(0))
def test_sympy__physics__quantum__state__BraBase():
from sympy.physics.quantum.state import BraBase
assert _test_args(BraBase(0))
def test_sympy__physics__quantum__state__Ket():
from sympy.physics.quantum.state import Ket
assert _test_args(Ket(0))
def test_sympy__physics__quantum__state__KetBase():
from sympy.physics.quantum.state import KetBase
assert _test_args(KetBase(0))
def test_sympy__physics__quantum__state__State():
from sympy.physics.quantum.state import State
assert _test_args(State(0))
def test_sympy__physics__quantum__state__StateBase():
from sympy.physics.quantum.state import StateBase
assert _test_args(StateBase(0))
def test_sympy__physics__quantum__state__TimeDepBra():
from sympy.physics.quantum.state import TimeDepBra
assert _test_args(TimeDepBra('psi', 't'))
def test_sympy__physics__quantum__state__TimeDepKet():
from sympy.physics.quantum.state import TimeDepKet
assert _test_args(TimeDepKet('psi', 't'))
def test_sympy__physics__quantum__state__TimeDepState():
from sympy.physics.quantum.state import TimeDepState
assert _test_args(TimeDepState('psi', 't'))
def test_sympy__physics__quantum__state__Wavefunction():
from sympy.physics.quantum.state import Wavefunction
from sympy.functions import sin
from sympy import Piecewise, pi
n = 1
L = 1
g = Piecewise((0, x < 0), (0, x > L), (sqrt(2//L)*sin(n*pi*x/L), True))
assert _test_args(Wavefunction(g, x))
def test_sympy__physics__quantum__tensorproduct__TensorProduct():
from sympy.physics.quantum.tensorproduct import TensorProduct
assert _test_args(TensorProduct(x, y))
def test_sympy__physics__quantum__identitysearch__GateIdentity():
from sympy.physics.quantum.gate import X
from sympy.physics.quantum.identitysearch import GateIdentity
assert _test_args(GateIdentity(X(0), X(0)))
def test_sympy__physics__quantum__sho1d__SHOOp():
from sympy.physics.quantum.sho1d import SHOOp
assert _test_args(SHOOp('a'))
def test_sympy__physics__quantum__sho1d__RaisingOp():
from sympy.physics.quantum.sho1d import RaisingOp
assert _test_args(RaisingOp('a'))
def test_sympy__physics__quantum__sho1d__LoweringOp():
from sympy.physics.quantum.sho1d import LoweringOp
assert _test_args(LoweringOp('a'))
def test_sympy__physics__quantum__sho1d__NumberOp():
from sympy.physics.quantum.sho1d import NumberOp
assert _test_args(NumberOp('N'))
def test_sympy__physics__quantum__sho1d__Hamiltonian():
from sympy.physics.quantum.sho1d import Hamiltonian
assert _test_args(Hamiltonian('H'))
def test_sympy__physics__quantum__sho1d__SHOState():
from sympy.physics.quantum.sho1d import SHOState
assert _test_args(SHOState(0))
def test_sympy__physics__quantum__sho1d__SHOKet():
from sympy.physics.quantum.sho1d import SHOKet
assert _test_args(SHOKet(0))
def test_sympy__physics__quantum__sho1d__SHOBra():
from sympy.physics.quantum.sho1d import SHOBra
assert _test_args(SHOBra(0))
def test_sympy__physics__secondquant__AnnihilateBoson():
from sympy.physics.secondquant import AnnihilateBoson
assert _test_args(AnnihilateBoson(0))
def test_sympy__physics__secondquant__AnnihilateFermion():
from sympy.physics.secondquant import AnnihilateFermion
assert _test_args(AnnihilateFermion(0))
@SKIP("abstract class")
def test_sympy__physics__secondquant__Annihilator():
pass
def test_sympy__physics__secondquant__AntiSymmetricTensor():
from sympy.physics.secondquant import AntiSymmetricTensor
i, j = symbols('i j', below_fermi=True)
a, b = symbols('a b', above_fermi=True)
assert _test_args(AntiSymmetricTensor('v', (a, i), (b, j)))
def test_sympy__physics__secondquant__BosonState():
from sympy.physics.secondquant import BosonState
assert _test_args(BosonState((0, 1)))
@SKIP("abstract class")
def test_sympy__physics__secondquant__BosonicOperator():
pass
def test_sympy__physics__secondquant__Commutator():
from sympy.physics.secondquant import Commutator
assert _test_args(Commutator(x, y))
def test_sympy__physics__secondquant__CreateBoson():
from sympy.physics.secondquant import CreateBoson
assert _test_args(CreateBoson(0))
def test_sympy__physics__secondquant__CreateFermion():
from sympy.physics.secondquant import CreateFermion
assert _test_args(CreateFermion(0))
@SKIP("abstract class")
def test_sympy__physics__secondquant__Creator():
pass
def test_sympy__physics__secondquant__Dagger():
from sympy.physics.secondquant import Dagger
from sympy import I
assert _test_args(Dagger(2*I))
def test_sympy__physics__secondquant__FermionState():
from sympy.physics.secondquant import FermionState
assert _test_args(FermionState((0, 1)))
def test_sympy__physics__secondquant__FermionicOperator():
from sympy.physics.secondquant import FermionicOperator
assert _test_args(FermionicOperator(0))
def test_sympy__physics__secondquant__FockState():
from sympy.physics.secondquant import FockState
assert _test_args(FockState((0, 1)))
def test_sympy__physics__secondquant__FockStateBosonBra():
from sympy.physics.secondquant import FockStateBosonBra
assert _test_args(FockStateBosonBra((0, 1)))
def test_sympy__physics__secondquant__FockStateBosonKet():
from sympy.physics.secondquant import FockStateBosonKet
assert _test_args(FockStateBosonKet((0, 1)))
def test_sympy__physics__secondquant__FockStateBra():
from sympy.physics.secondquant import FockStateBra
assert _test_args(FockStateBra((0, 1)))
def test_sympy__physics__secondquant__FockStateFermionBra():
from sympy.physics.secondquant import FockStateFermionBra
assert _test_args(FockStateFermionBra((0, 1)))
def test_sympy__physics__secondquant__FockStateFermionKet():
from sympy.physics.secondquant import FockStateFermionKet
assert _test_args(FockStateFermionKet((0, 1)))
def test_sympy__physics__secondquant__FockStateKet():
from sympy.physics.secondquant import FockStateKet
assert _test_args(FockStateKet((0, 1)))
def test_sympy__physics__secondquant__InnerProduct():
from sympy.physics.secondquant import InnerProduct
from sympy.physics.secondquant import FockStateKet, FockStateBra
assert _test_args(InnerProduct(FockStateBra((0, 1)), FockStateKet((0, 1))))
def test_sympy__physics__secondquant__NO():
from sympy.physics.secondquant import NO, F, Fd
assert _test_args(NO(Fd(x)*F(y)))
def test_sympy__physics__secondquant__PermutationOperator():
from sympy.physics.secondquant import PermutationOperator
assert _test_args(PermutationOperator(0, 1))
def test_sympy__physics__secondquant__SqOperator():
from sympy.physics.secondquant import SqOperator
assert _test_args(SqOperator(0))
def test_sympy__physics__secondquant__TensorSymbol():
from sympy.physics.secondquant import TensorSymbol
assert _test_args(TensorSymbol(x))
def test_sympy__physics__units__Unit():
from sympy.physics.units import Unit
assert _test_args(Unit("meter", "m"))
def test_sympy__physics__unitsystems__dimensions__Dimension():
from sympy.physics.unitsystems.dimensions import Dimension
assert _test_args(Dimension(name="length", symbol="L", length=1))
def test_sympy__physics__unitsystems__quantities__Quantity():
from sympy.physics.unitsystems.quantities import Quantity
from sympy.physics.unitsystems.systems import mks
assert _test_args(Quantity(10, mks["m"]))
def test_sympy__physics__unitsystems__units__Constant():
from sympy.physics.unitsystems.units import Constant
from sympy.physics.unitsystems.dimensions import Dimension
length = Dimension(length=1)
assert _test_args(Constant(length, abbrev="u", factor=10))
def test_sympy__physics__unitsystems__units__Unit():
from sympy.physics.unitsystems.units import Unit
from sympy.physics.unitsystems.dimensions import Dimension
length = Dimension(length=1)
assert _test_args(Unit(length, abbrev="u", factor=10))
def test_sympy__core__numbers__AlgebraicNumber():
from sympy.core.numbers import AlgebraicNumber
assert _test_args(AlgebraicNumber(sqrt(2), [1, 2, 3]))
def test_sympy__polys__polytools__GroebnerBasis():
from sympy.polys.polytools import GroebnerBasis
assert _test_args(GroebnerBasis([x, y, z], x, y, z))
def test_sympy__polys__polytools__Poly():
from sympy.polys.polytools import Poly
assert _test_args(Poly(2, x, y))
def test_sympy__polys__polytools__PurePoly():
from sympy.polys.polytools import PurePoly
assert _test_args(PurePoly(2, x, y))
def test_sympy__polys__rootoftools__RootOf():
from sympy.polys.rootoftools import RootOf
assert _test_args(RootOf(x**3 + x + 1, 0))
def test_sympy__polys__rootoftools__RootSum():
from sympy.polys.rootoftools import RootSum
assert _test_args(RootSum(x**3 + x + 1, sin))
def test_sympy__series__limits__Limit():
from sympy.series.limits import Limit
assert _test_args(Limit(x, x, 0, dir='-'))
def test_sympy__series__order__Order():
from sympy.series.order import Order
assert _test_args(Order(1, x, y))
def test_sympy__simplify__hyperexpand__Hyper_Function():
from sympy.simplify.hyperexpand import Hyper_Function
assert _test_args(Hyper_Function([2], [1]))
def test_sympy__simplify__hyperexpand__G_Function():
from sympy.simplify.hyperexpand import G_Function
assert _test_args(G_Function([2], [1], [], []))
def test_sympy__tensor__indexed__Idx():
from sympy.tensor.indexed import Idx
assert _test_args(Idx('test'))
assert _test_args(Idx(1, (0, 10)))
def test_sympy__tensor__indexed__Indexed():
from sympy.tensor.indexed import Indexed, Idx
assert _test_args(Indexed('A', Idx('i'), Idx('j')))
def test_sympy__tensor__indexed__IndexedBase():
from sympy.tensor.indexed import IndexedBase
assert _test_args(IndexedBase('A', shape=(x, y)))
assert _test_args(IndexedBase('A', 1))
assert _test_args(IndexedBase('A')[0, 1])
@XFAIL
def test_sympy__physics__hep__gamma_matrices__GammaMatrixHead():
# This test fails, this class can be reconstructed from the *args
# of an instance using `TensorHead(*args)`
from sympy.physics.hep.gamma_matrices import GammaMatrixHead, Lorentz
from sympy.tensor.tensor import tensor_indices
i = tensor_indices('i', Lorentz)
assert _test_args(GammaMatrixHead())
def test_sympy__tensor__tensor__TensorIndexType():
from sympy.tensor.tensor import TensorIndexType
assert _test_args(TensorIndexType('Lorentz', metric=False))
def test_sympy__tensor__tensor__TensorSymmetry():
from sympy.tensor.tensor import TensorSymmetry, get_symmetric_group_sgs
assert _test_args(TensorSymmetry(get_symmetric_group_sgs(2)))
def test_sympy__tensor__tensor__TensorType():
from sympy.tensor.tensor import TensorIndexType, TensorSymmetry, get_symmetric_group_sgs, TensorType
Lorentz = TensorIndexType('Lorentz', dummy_fmt='L')
sym = TensorSymmetry(get_symmetric_group_sgs(1))
assert _test_args(TensorType([Lorentz], sym))
def test_sympy__tensor__tensor__TensorHead():
from sympy.tensor.tensor import TensorIndexType, TensorSymmetry, TensorType, get_symmetric_group_sgs, TensorHead
Lorentz = TensorIndexType('Lorentz', dummy_fmt='L')
sym = TensorSymmetry(get_symmetric_group_sgs(1))
S1 = TensorType([Lorentz], sym)
assert _test_args(TensorHead('p', S1, 0))
def test_sympy__tensor__tensor__TensorIndex():
from sympy.tensor.tensor import TensorIndexType, TensorIndex
Lorentz = TensorIndexType('Lorentz', dummy_fmt='L')
assert _test_args(TensorIndex('i', Lorentz))
@SKIP("abstract class")
def test_sympy__tensor__tensor__TensExpr():
pass
def test_sympy__tensor__tensor__TensAdd():
from sympy.tensor.tensor import TensorIndexType, TensorSymmetry, TensorType, get_symmetric_group_sgs, tensor_indices, TensAdd
Lorentz = TensorIndexType('Lorentz', dummy_fmt='L')
a, b = tensor_indices('a,b', Lorentz)
sym = TensorSymmetry(get_symmetric_group_sgs(1))
S1 = TensorType([Lorentz], sym)
p, q = S1('p,q')
t1 = p(a)
t2 = q(a)
assert _test_args(TensAdd(t1, t2))
def test_sympy__tensor__tensor__Tensor():
from sympy.core import S
from sympy.tensor.tensor import TensorIndexType, TensorSymmetry, TensorType, get_symmetric_group_sgs, tensor_indices, TensMul, TIDS
Lorentz = TensorIndexType('Lorentz', dummy_fmt='L')
a, b = tensor_indices('a,b', Lorentz)
sym = TensorSymmetry(get_symmetric_group_sgs(1))
S1 = TensorType([Lorentz], sym)
p = S1('p')
assert _test_args(p(a))
def test_sympy__tensor__tensor__TensMul():
from sympy.core import S
from sympy.tensor.tensor import TensorIndexType, TensorSymmetry, TensorType, get_symmetric_group_sgs, tensor_indices, TensMul, TIDS
Lorentz = TensorIndexType('Lorentz', dummy_fmt='L')
a, b = tensor_indices('a,b', Lorentz)
sym = TensorSymmetry(get_symmetric_group_sgs(1))
S1 = TensorType([Lorentz], sym)
p = S1('p')
q = S1('q')
assert _test_args(3*p(a)*q(b))
def test_as_coeff_add():
assert (7, (3*x, 4*x**2)) == (7 + 3*x + 4*x**2).as_coeff_add()
def test_sympy__geometry__curve__Curve():
from sympy.geometry.curve import Curve
assert _test_args(Curve((x, 1), (x, 0, 1)))
def test_sympy__geometry__point__Point():
from sympy.geometry.point import Point
assert _test_args(Point(0, 1))
def test_sympy__geometry__point3d__Point3D():
from sympy.geometry.point3d import Point3D
assert _test_args(Point3D(0, 1, 2))
def test_sympy__geometry__ellipse__Ellipse():
from sympy.geometry.ellipse import Ellipse
assert _test_args(Ellipse((0, 1), 2, 3))
def test_sympy__geometry__ellipse__Circle():
from sympy.geometry.ellipse import Circle
assert _test_args(Circle((0, 1), 2))
@SKIP("abstract class")
def test_sympy__geometry__line__LinearEntity():
pass
def test_sympy__geometry__line__Line():
from sympy.geometry.line import Line
assert _test_args(Line((0, 1), (2, 3)))
def test_sympy__geometry__line__Ray():
from sympy.geometry.line import Ray
assert _test_args(Ray((0, 1), (2, 3)))
def test_sympy__geometry__line__Segment():
from sympy.geometry.line import Segment
assert _test_args(Segment((0, 1), (2, 3)))
@SKIP("abstract class")
def test_sympy__geometry__line3d__LinearEntity3D():
pass
def test_sympy__geometry__line3d__Line3D():
from sympy.geometry.line3d import Line3D
assert _test_args(Line3D((0, 1, 1), (2, 3, 4)))
def test_sympy__geometry__line3d__Segment3D():
from sympy.geometry.line3d import Segment3D
assert _test_args(Segment3D((0, 1, 1), (2, 3, 4)))
def test_sympy__geometry__line3d__Ray3D():
from sympy.geometry.line3d import Ray3D
assert _test_args(Ray3D((0, 1, 1), (2, 3, 4)))
def test_sympy__geometry__plane__Plane():
from sympy.geometry.plane import Plane
assert _test_args(Plane((1, 1, 1), (-3, 4, -2), (1, 2, 3)))
def test_sympy__geometry__polygon__Polygon():
from sympy.geometry.polygon import Polygon
assert _test_args(Polygon((0, 1), (2, 3), (4, 5), (6, 7)))
def test_sympy__geometry__polygon__RegularPolygon():
from sympy.geometry.polygon import RegularPolygon
assert _test_args(RegularPolygon((0, 1), 2, 3, 4))
def test_sympy__geometry__polygon__Triangle():
from sympy.geometry.polygon import Triangle
assert _test_args(Triangle((0, 1), (2, 3), (4, 5)))
def test_sympy__geometry__entity__GeometryEntity():
from sympy.geometry.entity import GeometryEntity
from sympy.geometry.point import Point
assert _test_args(GeometryEntity(Point(1, 0), 1, [1, 2]))
def test_sympy__diffgeom__diffgeom__Manifold():
from sympy.diffgeom import Manifold
assert _test_args(Manifold('name', 3))
def test_sympy__diffgeom__diffgeom__Patch():
from sympy.diffgeom import Manifold, Patch
assert _test_args(Patch('name', Manifold('name', 3)))
def test_sympy__diffgeom__diffgeom__CoordSystem():
from sympy.diffgeom import Manifold, Patch, CoordSystem
assert _test_args(CoordSystem('name', Patch('name', Manifold('name', 3))))
@XFAIL
def test_sympy__diffgeom__diffgeom__Point():
from sympy.diffgeom import Manifold, Patch, CoordSystem, Point
assert _test_args(Point(
CoordSystem('name', Patch('name', Manifold('name', 3))), [x, y]))
def test_sympy__diffgeom__diffgeom__BaseScalarField():
from sympy.diffgeom import Manifold, Patch, CoordSystem, BaseScalarField
cs = CoordSystem('name', Patch('name', Manifold('name', 3)))
assert _test_args(BaseScalarField(cs, 0))
def test_sympy__diffgeom__diffgeom__BaseVectorField():
from sympy.diffgeom import Manifold, Patch, CoordSystem, BaseVectorField
cs = CoordSystem('name', Patch('name', Manifold('name', 3)))
assert _test_args(BaseVectorField(cs, 0))
def test_sympy__diffgeom__diffgeom__Differential():
from sympy.diffgeom import Manifold, Patch, CoordSystem, BaseScalarField, Differential
cs = CoordSystem('name', Patch('name', Manifold('name', 3)))
assert _test_args(Differential(BaseScalarField(cs, 0)))
def test_sympy__diffgeom__diffgeom__Commutator():
from sympy.diffgeom import Manifold, Patch, CoordSystem, BaseVectorField, Commutator
cs = CoordSystem('name', Patch('name', Manifold('name', 3)))
cs1 = CoordSystem('name1', Patch('name', Manifold('name', 3)))
v = BaseVectorField(cs, 0)
v1 = BaseVectorField(cs1, 0)
assert _test_args(Commutator(v, v1))
def test_sympy__diffgeom__diffgeom__TensorProduct():
from sympy.diffgeom import Manifold, Patch, CoordSystem, BaseScalarField, Differential, TensorProduct
cs = CoordSystem('name', Patch('name', Manifold('name', 3)))
d = Differential(BaseScalarField(cs, 0))
assert _test_args(TensorProduct(d, d))
def test_sympy__diffgeom__diffgeom__WedgeProduct():
from sympy.diffgeom import Manifold, Patch, CoordSystem, BaseScalarField, Differential, WedgeProduct
cs = CoordSystem('name', Patch('name', Manifold('name', 3)))
d = Differential(BaseScalarField(cs, 0))
d1 = Differential(BaseScalarField(cs, 1))
assert _test_args(WedgeProduct(d, d1))
def test_sympy__diffgeom__diffgeom__LieDerivative():
from sympy.diffgeom import Manifold, Patch, CoordSystem, BaseScalarField, Differential, BaseVectorField, LieDerivative
cs = CoordSystem('name', Patch('name', Manifold('name', 3)))
d = Differential(BaseScalarField(cs, 0))
v = BaseVectorField(cs, 0)
assert _test_args(LieDerivative(v, d))
@XFAIL
def test_sympy__diffgeom__diffgeom__BaseCovarDerivativeOp():
from sympy.diffgeom import Manifold, Patch, CoordSystem, BaseCovarDerivativeOp
cs = CoordSystem('name', Patch('name', Manifold('name', 3)))
assert _test_args(BaseCovarDerivativeOp(cs, 0, [[[0, ]*3, ]*3, ]*3))
def test_sympy__diffgeom__diffgeom__CovarDerivativeOp():
from sympy.diffgeom import Manifold, Patch, CoordSystem, BaseVectorField, CovarDerivativeOp
cs = CoordSystem('name', Patch('name', Manifold('name', 3)))
v = BaseVectorField(cs, 0)
_test_args(CovarDerivativeOp(v, [[[0, ]*3, ]*3, ]*3))
def test_sympy__categories__baseclasses__Class():
from sympy.categories.baseclasses import Class
assert _test_args(Class())
def test_sympy__categories__baseclasses__Object():
from sympy.categories import Object
assert _test_args(Object("A"))
@XFAIL
def test_sympy__categories__baseclasses__Morphism():
from sympy.categories import Object, Morphism
assert _test_args(Morphism(Object("A"), Object("B")))
def test_sympy__categories__baseclasses__IdentityMorphism():
from sympy.categories import Object, IdentityMorphism
assert _test_args(IdentityMorphism(Object("A")))
def test_sympy__categories__baseclasses__NamedMorphism():
from sympy.categories import Object, NamedMorphism
assert _test_args(NamedMorphism(Object("A"), Object("B"), "f"))
def test_sympy__categories__baseclasses__CompositeMorphism():
from sympy.categories import Object, NamedMorphism, CompositeMorphism
A = Object("A")
B = Object("B")
C = Object("C")
f = NamedMorphism(A, B, "f")
g = NamedMorphism(B, C, "g")
assert _test_args(CompositeMorphism(f, g))
def test_sympy__categories__baseclasses__Diagram():
from sympy.categories import Object, NamedMorphism, Diagram
A = Object("A")
B = Object("B")
C = Object("C")
f = NamedMorphism(A, B, "f")
d = Diagram([f])
assert _test_args(d)
def test_sympy__categories__baseclasses__Category():
from sympy.categories import Object, NamedMorphism, Diagram, Category
A = Object("A")
B = Object("B")
C = Object("C")
f = NamedMorphism(A, B, "f")
g = NamedMorphism(B, C, "g")
d1 = Diagram([f, g])
d2 = Diagram([f])
K = Category("K", commutative_diagrams=[d1, d2])
assert _test_args(K)
def test_sympy__ntheory__factor___totient():
from sympy.ntheory.factor_ import totient
k = symbols('k', integer=True)
t = totient(k)
assert _test_args(t)
def test_sympy__ntheory__factor___divisor_sigma():
from sympy.ntheory.factor_ import divisor_sigma
k = symbols('k', integer=True)
n = symbols('n', integer=True)
t = divisor_sigma(n, k)
assert _test_args(t)
def test_sympy__ntheory__residue_ntheory__mobius():
from sympy.ntheory import mobius
assert _test_args(mobius(2))
def test_sympy__physics__optics__waves__TWave():
from sympy.physics.optics import TWave
A, f, phi = symbols('A, f, phi')
assert _test_args(TWave(A, f, phi))
def test_sympy__physics__optics__gaussopt__BeamParameter():
from sympy.physics.optics import BeamParameter
assert _test_args(BeamParameter(530e-9, 1, w=1e-3))
def test_sympy__physics__optics__medium__Medium():
from sympy.physics.optics import Medium
assert _test_args(Medium('m'))
def test_sympy__printing__codeprinter__Assignment():
from sympy.printing.codeprinter import Assignment
assert _test_args(Assignment(x, y))
def test_sympy__vector__coordsysrect__CoordSysCartesian():
from sympy.vector.coordsysrect import CoordSysCartesian
assert _test_args(CoordSysCartesian('C'))
def test_sympy__vector__point__Point():
from sympy.vector.point import Point
assert _test_args(Point('P'))
def test_sympy__vector__basisdependent__BasisDependent():
from sympy.vector.basisdependent import BasisDependent
#These classes have been created to maintain an OOP hierarchy
#for Vectors and Dyadics. Are NOT meant to be initialized
def test_sympy__vector__basisdependent__BasisDependentMul():
from sympy.vector.basisdependent import BasisDependentMul
#These classes have been created to maintain an OOP hierarchy
#for Vectors and Dyadics. Are NOT meant to be initialized
def test_sympy__vector__basisdependent__BasisDependentAdd():
from sympy.vector.basisdependent import BasisDependentAdd
#These classes have been created to maintain an OOP hierarchy
#for Vectors and Dyadics. Are NOT meant to be initialized
def test_sympy__vector__basisdependent__BasisDependentZero():
from sympy.vector.basisdependent import BasisDependentZero
#These classes have been created to maintain an OOP hierarchy
#for Vectors and Dyadics. Are NOT meant to be initialized
def test_sympy__vector__vector__BaseVector():
from sympy.vector.vector import BaseVector
from sympy.vector.coordsysrect import CoordSysCartesian
C = CoordSysCartesian('C')
assert _test_args(BaseVector('Ci', 0, C, ' ', ' '))
def test_sympy__vector__vector__VectorAdd():
from sympy.vector.vector import VectorAdd, VectorMul
from sympy.vector.coordsysrect import CoordSysCartesian
C = CoordSysCartesian('C')
from sympy.abc import a, b, c, x, y, z
v1 = a*C.i + b*C.j + c*C.k
v2 = x*C.i + y*C.j + z*C.k
assert _test_args(VectorAdd(v1, v2))
assert _test_args(VectorMul(x, v1))
def test_sympy__vector__vector__VectorMul():
from sympy.vector.vector import VectorMul
from sympy.vector.coordsysrect import CoordSysCartesian
C = CoordSysCartesian('C')
from sympy.abc import a
assert _test_args(VectorMul(a, C.i))
def test_sympy__vector__vector__VectorZero():
from sympy.vector.vector import VectorZero
assert _test_args(VectorZero())
def test_sympy__vector__vector__Vector():
from sympy.vector.vector import Vector
#Vector is never to be initialized using args
pass
def test_sympy__vector__dyadic__Dyadic():
from sympy.vector.dyadic import Dyadic
#Dyadic is never to be initialized using args
pass
def test_sympy__vector__dyadic__BaseDyadic():
from sympy.vector.dyadic import BaseDyadic
from sympy.vector.coordsysrect import CoordSysCartesian
C = CoordSysCartesian('C')
assert _test_args(BaseDyadic(C.i, C.j))
def test_sympy__vector__dyadic__DyadicMul():
from sympy.vector.dyadic import BaseDyadic, DyadicMul
from sympy.vector.coordsysrect import CoordSysCartesian
C = CoordSysCartesian('C')
assert _test_args(DyadicMul(3, BaseDyadic(C.i, C.j)))
def test_sympy__vector__dyadic__DyadicAdd():
from sympy.vector.dyadic import BaseDyadic, DyadicAdd
from sympy.vector.coordsysrect import CoordSysCartesian
C = CoordSysCartesian('C')
assert _test_args(2 * DyadicAdd(BaseDyadic(C.i, C.i),
BaseDyadic(C.i, C.j)))
def test_sympy__vector__dyadic__DyadicZero():
from sympy.vector.dyadic import DyadicZero
assert _test_args(DyadicZero())
def test_sympy__vector__deloperator__Del():
from sympy.vector.deloperator import Del
from sympy.vector.coordsysrect import CoordSysCartesian
C = CoordSysCartesian('C')
assert _test_args(Del(C))
def test_sympy__vector__orienters__Orienter():
from sympy.vector.orienters import Orienter
#Not to be initialized
def test_sympy__vector__orienters__ThreeAngleOrienter():
from sympy.vector.orienters import ThreeAngleOrienter
#Not to be initialized
def test_sympy__vector__orienters__AxisOrienter():
from sympy.vector.orienters import AxisOrienter
from sympy.vector.coordsysrect import CoordSysCartesian
C = CoordSysCartesian('C')
assert _test_args(AxisOrienter(x, C.i))
def test_sympy__vector__orienters__BodyOrienter():
from sympy.vector.orienters import BodyOrienter
assert _test_args(BodyOrienter(x, y, z, '123'))
def test_sympy__vector__orienters__SpaceOrienter():
from sympy.vector.orienters import SpaceOrienter
assert _test_args(SpaceOrienter(x, y, z, '123'))
def test_sympy__vector__orienters__QuaternionOrienter():
from sympy.vector.orienters import QuaternionOrienter
a, b, c, d = symbols('a b c d')
assert _test_args(QuaternionOrienter(a, b, c, d))
def test_sympy__vector__scalar__BaseScalar():
from sympy.vector.scalar import BaseScalar
from sympy.vector.coordsysrect import CoordSysCartesian
C = CoordSysCartesian('C')
assert _test_args(BaseScalar('Cx', 0, C, ' ', ' '))
| true | true |
f7029b3beb7195ba068d85097363523b962ab536 | 136 | py | Python | ARC076/ARC076e.py | VolgaKurvar/AtCoder | 21acb489f1594bbb1cdc64fbf8421d876b5b476d | [
"Unlicense"
] | null | null | null | ARC076/ARC076e.py | VolgaKurvar/AtCoder | 21acb489f1594bbb1cdc64fbf8421d876b5b476d | [
"Unlicense"
] | null | null | null | ARC076/ARC076e.py | VolgaKurvar/AtCoder | 21acb489f1594bbb1cdc64fbf8421d876b5b476d | [
"Unlicense"
] | null | null | null | #ARC076e
def main():
import sys
input=sys.stdin.readline
sys.setrecursionlimit(10**6)
if __name__ == '__main__':
main() | 17 | 32 | 0.654412 |
def main():
import sys
input=sys.stdin.readline
sys.setrecursionlimit(10**6)
if __name__ == '__main__':
main() | true | true |
f7029c9b1d4976a50cf98e8502601e9ea1b91175 | 337 | py | Python | access/management/commands/access_create_internal_aliases.py | darkismus/kompassi | 35dea2c7af2857a69cae5c5982b48f01ba56da1f | [
"CC-BY-3.0"
] | 13 | 2015-11-29T12:19:12.000Z | 2021-02-21T15:42:11.000Z | access/management/commands/access_create_internal_aliases.py | darkismus/kompassi | 35dea2c7af2857a69cae5c5982b48f01ba56da1f | [
"CC-BY-3.0"
] | 23 | 2015-04-29T19:43:34.000Z | 2021-02-10T05:50:17.000Z | access/management/commands/access_create_internal_aliases.py | darkismus/kompassi | 35dea2c7af2857a69cae5c5982b48f01ba56da1f | [
"CC-BY-3.0"
] | 11 | 2015-09-20T18:59:00.000Z | 2020-02-07T08:47:34.000Z | from django.core.management.base import BaseCommand
from django.utils.timezone import now
class Command(BaseCommand):
args = '[event_slug...]'
help = 'Create missing email aliases'
def handle(*args, **opts):
from access.models import InternalEmailAlias
InternalEmailAlias.ensure_internal_email_aliases()
| 24.071429 | 58 | 0.732938 | from django.core.management.base import BaseCommand
from django.utils.timezone import now
class Command(BaseCommand):
args = '[event_slug...]'
help = 'Create missing email aliases'
def handle(*args, **opts):
from access.models import InternalEmailAlias
InternalEmailAlias.ensure_internal_email_aliases()
| true | true |
f7029d2c344fe7b18326f6b65133b21dcec1e3e7 | 956 | py | Python | django_server/feedback_map/rest/tests/base.py | ForumViriumHelsinki/FVHFeedbackMap | cfbf3dd8715e34351fb1ba628ebb0c5eb82e78e0 | [
"MIT"
] | null | null | null | django_server/feedback_map/rest/tests/base.py | ForumViriumHelsinki/FVHFeedbackMap | cfbf3dd8715e34351fb1ba628ebb0c5eb82e78e0 | [
"MIT"
] | 39 | 2020-12-30T11:03:49.000Z | 2021-11-10T12:16:29.000Z | django_server/feedback_map/rest/tests/base.py | ForumViriumHelsinki/FVHFeedbackMap | cfbf3dd8715e34351fb1ba628ebb0c5eb82e78e0 | [
"MIT"
] | 1 | 2020-12-08T13:19:33.000Z | 2020-12-08T13:19:33.000Z | from django.contrib.auth.models import User
from rest_framework.test import APITestCase
class FVHAPITestCase(APITestCase):
def assert_dict_contains(self, superset, subset, path=''):
for key, expected in subset.items():
full_path = path + key
received = superset.get(key, None)
if isinstance(expected, dict) and isinstance(received, dict):
self.assert_dict_contains(superset[key], expected, full_path + '.')
else:
assert received == expected, 'Value mismatch for key {}: {} != {}'.format(
full_path, expected, received
)
def create_user(self):
return User.objects.create(
username='courier', first_name='Coranne', last_name='Courier', email='coranne@couriersrus.com')
def create_and_login_user(self):
user = self.create_user()
self.client.force_login(user)
return user
| 38.24 | 111 | 0.621339 | from django.contrib.auth.models import User
from rest_framework.test import APITestCase
class FVHAPITestCase(APITestCase):
def assert_dict_contains(self, superset, subset, path=''):
for key, expected in subset.items():
full_path = path + key
received = superset.get(key, None)
if isinstance(expected, dict) and isinstance(received, dict):
self.assert_dict_contains(superset[key], expected, full_path + '.')
else:
assert received == expected, 'Value mismatch for key {}: {} != {}'.format(
full_path, expected, received
)
def create_user(self):
return User.objects.create(
username='courier', first_name='Coranne', last_name='Courier', email='coranne@couriersrus.com')
def create_and_login_user(self):
user = self.create_user()
self.client.force_login(user)
return user
| true | true |
f7029dd1805bb86b5c26cdc6d17720b337162e8a | 20,089 | bzl | Python | packages/typescript/internal/ts_project.bzl | JiaLiPassion/rules_nodejs | 2424d1e32b564fcc37b57d593b871461a62f3237 | [
"Apache-2.0"
] | null | null | null | packages/typescript/internal/ts_project.bzl | JiaLiPassion/rules_nodejs | 2424d1e32b564fcc37b57d593b871461a62f3237 | [
"Apache-2.0"
] | null | null | null | packages/typescript/internal/ts_project.bzl | JiaLiPassion/rules_nodejs | 2424d1e32b564fcc37b57d593b871461a62f3237 | [
"Apache-2.0"
] | null | null | null | "ts_project rule"
load("@build_bazel_rules_nodejs//:providers.bzl", "DeclarationInfo", "NpmPackageInfo", "declaration_info", "js_module_info", "run_node")
_DEFAULT_TSC = (
# BEGIN-INTERNAL
"@npm" +
# END-INTERNAL
"//typescript/bin:tsc"
)
_ATTRS = {
"args": attr.string_list(),
"declaration_dir": attr.string(),
"deps": attr.label_list(providers = [DeclarationInfo]),
"extends": attr.label_list(allow_files = [".json"]),
"out_dir": attr.string(),
"root_dir": attr.string(),
# NB: no restriction on extensions here, because tsc sometimes adds type-check support
# for more file kinds (like require('some.json')) and also
# if you swap out the `compiler` attribute (like with ngtsc)
# that compiler might allow more sources than tsc does.
"srcs": attr.label_list(allow_files = True, mandatory = True),
"tsc": attr.label(default = Label(_DEFAULT_TSC), executable = True, cfg = "host"),
"tsconfig": attr.label(mandatory = True, allow_single_file = [".json"]),
}
# tsc knows how to produce the following kinds of output files.
# NB: the macro `ts_project_macro` will set these outputs based on user
# telling us which settings are enabled in the tsconfig for this project.
_OUTPUTS = {
"buildinfo_out": attr.output(),
"js_outs": attr.output_list(),
"map_outs": attr.output_list(),
"typing_maps_outs": attr.output_list(),
"typings_outs": attr.output_list(),
}
_TsConfigInfo = provider(
doc = """Passes tsconfig.json files to downstream compilations so that TypeScript can read them.
This is needed to support Project References""",
fields = {
"tsconfigs": "depset of tsconfig.json files",
},
)
def _join(*elements):
return "/".join([f for f in elements if f])
def _ts_project_impl(ctx):
arguments = ctx.actions.args()
# Add user specified arguments *before* rule supplied arguments
arguments.add_all(ctx.attr.args)
arguments.add_all([
"--project",
ctx.file.tsconfig.path,
"--outDir",
_join(ctx.bin_dir.path, ctx.label.package, ctx.attr.out_dir),
"--rootDir",
_join(ctx.label.package, ctx.attr.root_dir) if ctx.label.package else ".",
])
if len(ctx.outputs.typings_outs) > 0:
declaration_dir = ctx.attr.declaration_dir if ctx.attr.declaration_dir else ctx.attr.out_dir
arguments.add_all([
"--declarationDir",
_join(ctx.bin_dir.path, ctx.label.package, declaration_dir),
])
# When users report problems, we can ask them to re-build with
# --define=VERBOSE_LOGS=1
# so anything that's useful to diagnose rule failures belongs here
if "VERBOSE_LOGS" in ctx.var.keys():
arguments.add_all([
# What files were in the ts.Program
"--listFiles",
# Did tsc write all outputs to the place we expect to find them?
"--listEmittedFiles",
# Why did module resolution fail?
"--traceResolution",
# Why was the build slow?
"--diagnostics",
"--extendedDiagnostics",
])
deps_depsets = []
for dep in ctx.attr.deps:
if _TsConfigInfo in dep:
deps_depsets.append(dep[_TsConfigInfo].tsconfigs)
if NpmPackageInfo in dep:
# TODO: we could maybe filter these to be tsconfig.json or *.d.ts only
# we don't expect tsc wants to read any other files from npm packages.
deps_depsets.append(dep[NpmPackageInfo].sources)
if DeclarationInfo in dep:
deps_depsets.append(dep[DeclarationInfo].transitive_declarations)
inputs = ctx.files.srcs + depset(transitive = deps_depsets).to_list() + [ctx.file.tsconfig]
if ctx.attr.extends:
inputs.extend(ctx.files.extends)
# We do not try to predeclare json_outs, because their output locations generally conflict with their path in the source tree.
# (The exception is when out_dir is used, then the .json output is a different path than the input.)
# However tsc will copy .json srcs to the output tree so we want to declare these outputs to include along with .js Default outs
# NB: We don't have emit_declaration_only setting here, so use presence of any JS outputs as an equivalent.
# tsc will only produce .json if it also produces .js
if len(ctx.outputs.js_outs):
json_outs = [
ctx.actions.declare_file(_join(ctx.attr.out_dir, src.short_path[len(ctx.label.package) + 1:]))
for src in ctx.files.srcs
if src.basename.endswith(".json")
]
else:
json_outs = []
outputs = json_outs + ctx.outputs.js_outs + ctx.outputs.map_outs + ctx.outputs.typings_outs + ctx.outputs.typing_maps_outs
if ctx.outputs.buildinfo_out:
outputs.append(ctx.outputs.buildinfo_out)
runtime_outputs = depset(json_outs + ctx.outputs.js_outs + ctx.outputs.map_outs)
typings_outputs = ctx.outputs.typings_outs + ctx.outputs.typing_maps_outs + [s for s in ctx.files.srcs if s.path.endswith(".d.ts")]
if len(outputs) > 0:
run_node(
ctx,
inputs = inputs,
arguments = [arguments],
outputs = outputs,
executable = "tsc",
progress_message = "Compiling TypeScript project %s [tsc -p %s]" % (
ctx.label,
ctx.file.tsconfig.short_path,
),
)
providers = [
# DefaultInfo is what you see on the command-line for a built library,
# and determines what files are used by a simple non-provider-aware
# downstream library.
# Only the JavaScript outputs are intended for use in non-TS-aware
# dependents.
DefaultInfo(
files = runtime_outputs,
runfiles = ctx.runfiles(
transitive_files = runtime_outputs,
collect_default = True,
),
),
js_module_info(
sources = runtime_outputs,
deps = ctx.attr.deps,
),
_TsConfigInfo(tsconfigs = depset([ctx.file.tsconfig] + ctx.files.extends, transitive = [
dep[_TsConfigInfo].tsconfigs
for dep in ctx.attr.deps
if _TsConfigInfo in dep
])),
]
# Don't provide DeclarationInfo if there are no typings to provide.
# Improves error messaging if a ts_project needs declaration = True
if len(typings_outputs) or len(ctx.attr.deps):
providers.append(declaration_info(depset(typings_outputs), ctx.attr.deps))
providers.append(OutputGroupInfo(types = depset(typings_outputs)))
return providers
ts_project = rule(
implementation = _ts_project_impl,
attrs = dict(_ATTRS, **_OUTPUTS),
)
def _validate_options_impl(ctx):
# Bazel won't run our action unless its output is needed, so make a marker file
# We make it a .d.ts file so we can plumb it to the deps of the ts_project compile.
marker = ctx.actions.declare_file("%s.optionsvalid.d.ts" % ctx.label.name)
arguments = ctx.actions.args()
arguments.add_all([ctx.file.tsconfig.path, marker.path, ctx.attr.target, struct(
declaration = ctx.attr.declaration,
declaration_map = ctx.attr.declaration_map,
composite = ctx.attr.composite,
emit_declaration_only = ctx.attr.emit_declaration_only,
source_map = ctx.attr.source_map,
incremental = ctx.attr.incremental,
).to_json()])
run_node(
ctx,
inputs = [ctx.file.tsconfig] + ctx.files.extends,
outputs = [marker],
arguments = [arguments],
executable = "validator",
)
return [
DeclarationInfo(
transitive_declarations = depset([marker]),
),
]
validate_options = rule(
implementation = _validate_options_impl,
attrs = {
"composite": attr.bool(),
"declaration": attr.bool(),
"declaration_map": attr.bool(),
"emit_declaration_only": attr.bool(),
"extends": attr.label_list(allow_files = [".json"]),
"incremental": attr.bool(),
"source_map": attr.bool(),
"target": attr.string(),
"tsconfig": attr.label(mandatory = True, allow_single_file = [".json"]),
"validator": attr.label(default = Label("//packages/typescript/bin:ts_project_options_validator"), executable = True, cfg = "host"),
},
)
def _out_paths(srcs, outdir, rootdir, ext):
rootdir_replace_pattern = rootdir + "/" if rootdir else ""
return [_join(outdir, f[:f.rindex(".")].replace(rootdir_replace_pattern, "") + ext) for f in srcs if not f.endswith(".d.ts") and not f.endswith(".json")]
def ts_project_macro(
name = "tsconfig",
tsconfig = None,
srcs = None,
args = [],
deps = [],
extends = None,
declaration = False,
source_map = False,
declaration_map = False,
composite = False,
incremental = False,
emit_declaration_only = False,
tsc = None,
validate = True,
declaration_dir = None,
out_dir = None,
root_dir = None,
**kwargs):
"""Compiles one TypeScript project using `tsc --project`
This is a drop-in replacement for the `tsc` rule automatically generated for the "typescript"
package, typically loaded from `@npm//typescript:index.bzl`. Unlike bare `tsc`, this rule understands
the Bazel interop mechanism (Providers) so that this rule works with others that produce or consume
TypeScript typings (`.d.ts` files).
Unlike `ts_library`, this rule is the thinnest possible layer of Bazel interoperability on top
of the TypeScript compiler. It shifts the burden of configuring TypeScript into the tsconfig.json file.
See https://github.com/bazelbuild/rules_nodejs/blob/master/docs/TypeScript.md#alternatives
for more details about the trade-offs between the two rules.
Some TypeScript options affect which files are emitted, and Bazel wants to know these ahead-of-time.
So several options from the tsconfig file must be mirrored as attributes to ts_project.
See https://www.typescriptlang.org/v2/en/tsconfig for a listing of the TypeScript options.
Any code that works with `tsc` should work with `ts_project` with a few caveats:
- Bazel requires that the `outDir` (and `declarationDir`) be set to
`bazel-out/[target architecture]/bin/path/to/package`
so we override whatever settings appear in your tsconfig.
- Bazel expects that each output is produced by a single rule.
Thus if you have two `ts_project` rules with overlapping sources (the same `.ts` file
appears in more than one) then you get an error about conflicting `.js` output
files if you try to build both together.
Worse, if you build them separately then the output directory will contain whichever
one you happened to build most recently. This is highly discouraged.
> Note: in order for TypeScript to resolve relative references to the bazel-out folder,
> we recommend that the base tsconfig contain a rootDirs section that includes all
> possible locations they may appear.
>
> We hope this will not be needed in some future release of TypeScript.
> Follow https://github.com/microsoft/TypeScript/issues/37257 for more info.
>
> For example, if the base tsconfig file relative to the workspace root is
> `path/to/tsconfig.json` then you should configure like:
>
> ```
> "compilerOptions": {
> "rootDirs": [
> ".",
> "../../bazel-out/darwin-fastbuild/bin/path/to",
> "../../bazel-out/k8-fastbuild/bin/path/to",
> "../../bazel-out/x64_windows-fastbuild/bin/path/to",
> "../../bazel-out/darwin-dbg/bin/path/to",
> "../../bazel-out/k8-dbg/bin/path/to",
> "../../bazel-out/x64_windows-dbg/bin/path/to",
> ]
> }
> ```
### Issues when running non-sandboxed
When using a non-sandboxed spawn strategy (which is the default on Windows), you may
observe these problems which require workarounds:
1) Bazel deletes outputs from the previous execution before running `tsc`.
This causes a problem with TypeScript's incremental mode: if the `.tsbuildinfo` file
is not known to be an output of the rule, then Bazel will leave it in the output
directory, and when `tsc` runs, it may see that the outputs written by the prior
invocation are up-to-date and skip the emit of these files. This will cause Bazel
to intermittently fail with an error that some outputs were not written.
This is why we depend on `composite` and/or `incremental` attributes to be provided,
so we can tell Bazel to expect a `.tsbuildinfo` output to ensure it is deleted before a
subsequent compilation.
At present, we don't do anything useful with the `.tsbuildinfo` output, and this rule
does not actually have incremental behavior. Deleting the file is actually
counter-productive in terms of TypeScript compile performance.
Follow https://github.com/bazelbuild/rules_nodejs/issues/1726
2) When using Project References, TypeScript will expect to verify that the outputs of referenced
projects are up-to-date with respect to their inputs.
(This is true even without using the `--build` option).
When using a non-sandboxed spawn strategy, `tsc` can read the sources from other `ts_project`
rules in your project, and will expect that the `tsconfig.json` file for those references will
indicate where the outputs were written. However the `outDir` is determined by this Bazel rule so
it cannot be known from reading the `tsconfig.json` file.
This problem is manifested as a TypeScript diagnostic like
`error TS6305: Output file '/path/to/execroot/a.d.ts' has not been built from source file '/path/to/execroot/a.ts'.`
As a workaround, you can give the Windows "fastbuild" output directory as the `outDir` in your tsconfig file.
On other platforms, the value isn't read so it does no harm.
See https://github.com/bazelbuild/rules_nodejs/tree/stable/packages/typescript/test/ts_project as an example.
We hope this will be fixed in a future release of TypeScript;
follow https://github.com/microsoft/TypeScript/issues/37378
3) When TypeScript encounters an import statement, it adds the source file resolved by that reference
to the program. However you may have included that source file in a different project, so this causes
the problem mentioned above where a source file is in multiple programs.
(Note, if you use Project References this is not the case, TS will know the referenced
file is part of the other program.)
This will result in duplicate emit for the same file, which produces an error
since the files written to the output tree are read-only.
Workarounds include using using Project References, or simply grouping the whole compilation
into one program (if this doesn't exceed your time budget).
Args:
name: A name for the target.
We recommend you use the basename (no `.json` extension) of the tsconfig file that should be compiled.
srcs: List of labels of TypeScript source files to be provided to the compiler.
If absent, defaults to `**/*.ts[x]` (all TypeScript files in the package).
deps: List of labels of other rules that produce TypeScript typings (.d.ts files)
tsconfig: Label of the tsconfig.json file to use for the compilation.
By default, we add `.json` to the `name` attribute.
extends: List of labels of tsconfig file(s) referenced in `extends` section of tsconfig.
Must include any tsconfig files "chained" by extends clauses.
args: List of strings of additional command-line arguments to pass to tsc.
tsc: Label of the TypeScript compiler binary to run.
For example, `tsc = "@my_deps//typescript/bin:tsc"`
Or you can pass a custom compiler binary instead.
validate: boolean; whether to check that the tsconfig settings match the attributes.
root_dir: a string specifying a subdirectory under the input package which should be consider the
root directory of all the input files.
Equivalent to the TypeScript --rootDir option.
By default it is '.', meaning the source directory where the BUILD file lives.
out_dir: a string specifying a subdirectory under the bazel-out folder where outputs are written.
Equivalent to the TypeScript --outDir option.
Note that Bazel always requires outputs be written under a subdirectory matching the input package,
so if your rule appears in path/to/my/package/BUILD.bazel and out_dir = "foo" then the .js files
will appear in bazel-out/[arch]/bin/path/to/my/package/foo/*.js.
By default the out_dir is '.', meaning the packages folder in bazel-out.
declaration_dir: a string specifying a subdirectory under the bazel-out folder where generated declaration
outputs are written. Equivalent to the TypeScript --declarationDir option.
By default declarations are written to the out_dir.
declaration: if the `declaration` bit is set in the tsconfig.
Instructs Bazel to expect a `.d.ts` output for each `.ts` source.
source_map: if the `sourceMap` bit is set in the tsconfig.
Instructs Bazel to expect a `.js.map` output for each `.ts` source.
declaration_map: if the `declarationMap` bit is set in the tsconfig.
Instructs Bazel to expect a `.d.ts.map` output for each `.ts` source.
composite: if the `composite` bit is set in the tsconfig.
Instructs Bazel to expect a `.tsbuildinfo` output and a `.d.ts` output for each `.ts` source.
incremental: if the `incremental` bit is set in the tsconfig.
Instructs Bazel to expect a `.tsbuildinfo` output.
emit_declaration_only: if the `emitDeclarationOnly` bit is set in the tsconfig.
Instructs Bazel *not* to expect `.js` or `.js.map` outputs for `.ts` sources.
**kwargs: passed through to underlying rule, allows eg. visibility, tags
"""
if srcs == None:
srcs = native.glob(["**/*.ts", "**/*.tsx"])
if tsconfig == None:
tsconfig = name + ".json"
extra_deps = []
if validate:
validate_options(
name = "_validate_%s_options" % name,
target = "//%s:%s" % (native.package_name(), name),
declaration = declaration,
source_map = source_map,
declaration_map = declaration_map,
composite = composite,
incremental = incremental,
emit_declaration_only = emit_declaration_only,
tsconfig = tsconfig,
extends = extends,
)
extra_deps.append("_validate_%s_options" % name)
typings_out_dir = declaration_dir if declaration_dir else out_dir
ts_project(
name = name,
srcs = srcs,
args = args,
deps = deps + extra_deps,
tsconfig = tsconfig,
extends = extends,
declaration_dir = declaration_dir,
out_dir = out_dir,
root_dir = root_dir,
js_outs = _out_paths(srcs, out_dir, root_dir, ".js") if not emit_declaration_only else [],
map_outs = _out_paths(srcs, out_dir, root_dir, ".js.map") if source_map and not emit_declaration_only else [],
typings_outs = _out_paths(srcs, typings_out_dir, root_dir, ".d.ts") if declaration or composite else [],
typing_maps_outs = _out_paths(srcs, typings_out_dir, root_dir, ".d.ts.map") if declaration_map else [],
buildinfo_out = tsconfig[:-5] + ".tsbuildinfo" if composite or incremental else None,
tsc = tsc,
**kwargs
)
| 45.865297 | 157 | 0.662104 |
load("@build_bazel_rules_nodejs//:providers.bzl", "DeclarationInfo", "NpmPackageInfo", "declaration_info", "js_module_info", "run_node")
_DEFAULT_TSC = (
"@npm" +
"//typescript/bin:tsc"
)
_ATTRS = {
"args": attr.string_list(),
"declaration_dir": attr.string(),
"deps": attr.label_list(providers = [DeclarationInfo]),
"extends": attr.label_list(allow_files = [".json"]),
"out_dir": attr.string(),
"root_dir": attr.string(),
"srcs": attr.label_list(allow_files = True, mandatory = True),
"tsc": attr.label(default = Label(_DEFAULT_TSC), executable = True, cfg = "host"),
"tsconfig": attr.label(mandatory = True, allow_single_file = [".json"]),
}
_OUTPUTS = {
"buildinfo_out": attr.output(),
"js_outs": attr.output_list(),
"map_outs": attr.output_list(),
"typing_maps_outs": attr.output_list(),
"typings_outs": attr.output_list(),
}
_TsConfigInfo = provider(
doc = """Passes tsconfig.json files to downstream compilations so that TypeScript can read them.
This is needed to support Project References""",
fields = {
"tsconfigs": "depset of tsconfig.json files",
},
)
def _join(*elements):
return "/".join([f for f in elements if f])
def _ts_project_impl(ctx):
arguments = ctx.actions.args()
arguments.add_all(ctx.attr.args)
arguments.add_all([
"--project",
ctx.file.tsconfig.path,
"--outDir",
_join(ctx.bin_dir.path, ctx.label.package, ctx.attr.out_dir),
"--rootDir",
_join(ctx.label.package, ctx.attr.root_dir) if ctx.label.package else ".",
])
if len(ctx.outputs.typings_outs) > 0:
declaration_dir = ctx.attr.declaration_dir if ctx.attr.declaration_dir else ctx.attr.out_dir
arguments.add_all([
"--declarationDir",
_join(ctx.bin_dir.path, ctx.label.package, declaration_dir),
])
if "VERBOSE_LOGS" in ctx.var.keys():
arguments.add_all([
# What files were in the ts.Program
"--listFiles",
# Did tsc write all outputs to the place we expect to find them?
"--listEmittedFiles",
# Why did module resolution fail?
"--traceResolution",
# Why was the build slow?
"--diagnostics",
"--extendedDiagnostics",
])
deps_depsets = []
for dep in ctx.attr.deps:
if _TsConfigInfo in dep:
deps_depsets.append(dep[_TsConfigInfo].tsconfigs)
if NpmPackageInfo in dep:
# TODO: we could maybe filter these to be tsconfig.json or *.d.ts only
# we don't expect tsc wants to read any other files from npm packages.
deps_depsets.append(dep[NpmPackageInfo].sources)
if DeclarationInfo in dep:
deps_depsets.append(dep[DeclarationInfo].transitive_declarations)
inputs = ctx.files.srcs + depset(transitive = deps_depsets).to_list() + [ctx.file.tsconfig]
if ctx.attr.extends:
inputs.extend(ctx.files.extends)
# tsc will only produce .json if it also produces .js
if len(ctx.outputs.js_outs):
json_outs = [
ctx.actions.declare_file(_join(ctx.attr.out_dir, src.short_path[len(ctx.label.package) + 1:]))
for src in ctx.files.srcs
if src.basename.endswith(".json")
]
else:
json_outs = []
outputs = json_outs + ctx.outputs.js_outs + ctx.outputs.map_outs + ctx.outputs.typings_outs + ctx.outputs.typing_maps_outs
if ctx.outputs.buildinfo_out:
outputs.append(ctx.outputs.buildinfo_out)
runtime_outputs = depset(json_outs + ctx.outputs.js_outs + ctx.outputs.map_outs)
typings_outputs = ctx.outputs.typings_outs + ctx.outputs.typing_maps_outs + [s for s in ctx.files.srcs if s.path.endswith(".d.ts")]
if len(outputs) > 0:
run_node(
ctx,
inputs = inputs,
arguments = [arguments],
outputs = outputs,
executable = "tsc",
progress_message = "Compiling TypeScript project %s [tsc -p %s]" % (
ctx.label,
ctx.file.tsconfig.short_path,
),
)
providers = [
# DefaultInfo is what you see on the command-line for a built library,
# and determines what files are used by a simple non-provider-aware
# downstream library.
# Only the JavaScript outputs are intended for use in non-TS-aware
# dependents.
DefaultInfo(
files = runtime_outputs,
runfiles = ctx.runfiles(
transitive_files = runtime_outputs,
collect_default = True,
),
),
js_module_info(
sources = runtime_outputs,
deps = ctx.attr.deps,
),
_TsConfigInfo(tsconfigs = depset([ctx.file.tsconfig] + ctx.files.extends, transitive = [
dep[_TsConfigInfo].tsconfigs
for dep in ctx.attr.deps
if _TsConfigInfo in dep
])),
]
# Don't provide DeclarationInfo if there are no typings to provide.
if len(typings_outputs) or len(ctx.attr.deps):
providers.append(declaration_info(depset(typings_outputs), ctx.attr.deps))
providers.append(OutputGroupInfo(types = depset(typings_outputs)))
return providers
ts_project = rule(
implementation = _ts_project_impl,
attrs = dict(_ATTRS, **_OUTPUTS),
)
def _validate_options_impl(ctx):
# We make it a .d.ts file so we can plumb it to the deps of the ts_project compile.
marker = ctx.actions.declare_file("%s.optionsvalid.d.ts" % ctx.label.name)
arguments = ctx.actions.args()
arguments.add_all([ctx.file.tsconfig.path, marker.path, ctx.attr.target, struct(
declaration = ctx.attr.declaration,
declaration_map = ctx.attr.declaration_map,
composite = ctx.attr.composite,
emit_declaration_only = ctx.attr.emit_declaration_only,
source_map = ctx.attr.source_map,
incremental = ctx.attr.incremental,
).to_json()])
run_node(
ctx,
inputs = [ctx.file.tsconfig] + ctx.files.extends,
outputs = [marker],
arguments = [arguments],
executable = "validator",
)
return [
DeclarationInfo(
transitive_declarations = depset([marker]),
),
]
validate_options = rule(
implementation = _validate_options_impl,
attrs = {
"composite": attr.bool(),
"declaration": attr.bool(),
"declaration_map": attr.bool(),
"emit_declaration_only": attr.bool(),
"extends": attr.label_list(allow_files = [".json"]),
"incremental": attr.bool(),
"source_map": attr.bool(),
"target": attr.string(),
"tsconfig": attr.label(mandatory = True, allow_single_file = [".json"]),
"validator": attr.label(default = Label("//packages/typescript/bin:ts_project_options_validator"), executable = True, cfg = "host"),
},
)
def _out_paths(srcs, outdir, rootdir, ext):
rootdir_replace_pattern = rootdir + "/" if rootdir else ""
return [_join(outdir, f[:f.rindex(".")].replace(rootdir_replace_pattern, "") + ext) for f in srcs if not f.endswith(".d.ts") and not f.endswith(".json")]
def ts_project_macro(
name = "tsconfig",
tsconfig = None,
srcs = None,
args = [],
deps = [],
extends = None,
declaration = False,
source_map = False,
declaration_map = False,
composite = False,
incremental = False,
emit_declaration_only = False,
tsc = None,
validate = True,
declaration_dir = None,
out_dir = None,
root_dir = None,
**kwargs):
if srcs == None:
srcs = native.glob(["**/*.ts", "**/*.tsx"])
if tsconfig == None:
tsconfig = name + ".json"
extra_deps = []
if validate:
validate_options(
name = "_validate_%s_options" % name,
target = "//%s:%s" % (native.package_name(), name),
declaration = declaration,
source_map = source_map,
declaration_map = declaration_map,
composite = composite,
incremental = incremental,
emit_declaration_only = emit_declaration_only,
tsconfig = tsconfig,
extends = extends,
)
extra_deps.append("_validate_%s_options" % name)
typings_out_dir = declaration_dir if declaration_dir else out_dir
ts_project(
name = name,
srcs = srcs,
args = args,
deps = deps + extra_deps,
tsconfig = tsconfig,
extends = extends,
declaration_dir = declaration_dir,
out_dir = out_dir,
root_dir = root_dir,
js_outs = _out_paths(srcs, out_dir, root_dir, ".js") if not emit_declaration_only else [],
map_outs = _out_paths(srcs, out_dir, root_dir, ".js.map") if source_map and not emit_declaration_only else [],
typings_outs = _out_paths(srcs, typings_out_dir, root_dir, ".d.ts") if declaration or composite else [],
typing_maps_outs = _out_paths(srcs, typings_out_dir, root_dir, ".d.ts.map") if declaration_map else [],
buildinfo_out = tsconfig[:-5] + ".tsbuildinfo" if composite or incremental else None,
tsc = tsc,
**kwargs
)
| true | true |
f7029df8f7bce93b2ecff06eff3a6b32d27d9d3d | 140 | py | Python | marrow/dsl/exc.py | marrow/dsl | 79899531361aace5741a79de79304e1f7aaa600d | [
"MIT"
] | 10 | 2018-02-23T07:13:29.000Z | 2021-11-08T14:53:47.000Z | marrow/dsl/exc.py | marrow/dsl | 79899531361aace5741a79de79304e1f7aaa600d | [
"MIT"
] | null | null | null | marrow/dsl/exc.py | marrow/dsl | 79899531361aace5741a79de79304e1f7aaa600d | [
"MIT"
] | null | null | null | # encoding: utf-8
from __future__ import unicode_literals
class TranslationError(Exception):
"""Failure to translate source."""
pass
| 14 | 39 | 0.757143 |
from __future__ import unicode_literals
class TranslationError(Exception):
pass
| true | true |
f7029e2387e943ad5f298a67c17e2e40f52d5567 | 362 | py | Python | sample_problems/problems_with_solution57.py | adi01trip01/adi_workspace | f493b3ba84645eec3a57607243760a826880d1a3 | [
"MIT"
] | null | null | null | sample_problems/problems_with_solution57.py | adi01trip01/adi_workspace | f493b3ba84645eec3a57607243760a826880d1a3 | [
"MIT"
] | null | null | null | sample_problems/problems_with_solution57.py | adi01trip01/adi_workspace | f493b3ba84645eec3a57607243760a826880d1a3 | [
"MIT"
] | null | null | null | # Write a Python program to get execution time for a Python method.
import time
def sum_of_n_numbers(x):
start_time = time.time()
s = 0
for i in range(1, x + 1):
s = s + i
end_time = time.time()
return s, end_time - start_time
n = 5
print("\nTime to sum of 1 to ", n, " and required time to calculate is :", sum_of_n_numbers(n))
| 21.294118 | 95 | 0.632597 |
import time
def sum_of_n_numbers(x):
start_time = time.time()
s = 0
for i in range(1, x + 1):
s = s + i
end_time = time.time()
return s, end_time - start_time
n = 5
print("\nTime to sum of 1 to ", n, " and required time to calculate is :", sum_of_n_numbers(n))
| true | true |
f7029e2981a4619967429d8979bc4eb77eb2ef8d | 13,759 | py | Python | kivy/input/providers/mtdev.py | DaleEMoore/kivy | 3fc5a455d8f50c857866082091f09b834ecf64af | [
"MIT"
] | 1 | 2017-10-25T03:23:36.000Z | 2017-10-25T03:23:36.000Z | kivy/input/providers/mtdev.py | DaleEMoore/kivy | 3fc5a455d8f50c857866082091f09b834ecf64af | [
"MIT"
] | null | null | null | kivy/input/providers/mtdev.py | DaleEMoore/kivy | 3fc5a455d8f50c857866082091f09b834ecf64af | [
"MIT"
] | null | null | null | '''
Native support for Multitouch devices on Linux, using libmtdev.
===============================================================
The Mtdev project is a part of the Ubuntu Maverick multitouch architecture.
You can read more on http://wiki.ubuntu.com/Multitouch
To configure MTDev, it's preferable to use probesysfs providers.
Check :py:class:`~kivy.input.providers.probesysfs` for more information.
Otherwise, add this to your configuration::
[input]
# devicename = hidinput,/dev/input/eventXX
acert230h = mtdev,/dev/input/event2
.. note::
You must have read access to the input event.
You can use a custom range for the X, Y and pressure values.
On some drivers, the range reported is invalid.
To fix that, you can add these options to the argument line:
* invert_x : 1 to invert X axis
* invert_y : 1 to invert Y axis
* min_position_x : X minimum
* max_position_x : X maximum
* min_position_y : Y minimum
* max_position_y : Y maximum
* min_pressure : pressure minimum
* max_pressure : pressure maximum
* min_touch_major : width shape minimum
* max_touch_major : width shape maximum
* min_touch_minor : width shape minimum
* max_touch_minor : height shape maximum
* rotation : 0,90,180 or 270 to rotate
'''
__all__ = ('MTDMotionEventProvider', 'MTDMotionEvent')
import os
from kivy.input.motionevent import MotionEvent
from kivy.input.shape import ShapeRect
class MTDMotionEvent(MotionEvent):
def depack(self, args):
self.is_touch = True
if 'x' in args:
self.sx = args['x']
else:
self.sx = -1
if 'y' in args:
self.sy = args['y']
else:
self.sy = -1
self.profile = ['pos']
if 'size_w' in args and 'size_h' in args:
self.shape = ShapeRect()
self.shape.width = args['size_w']
self.shape.height = args['size_h']
self.profile.append('shape')
if 'pressure' in args:
self.pressure = args['pressure']
self.profile.append('pressure')
super(MTDMotionEvent, self).depack(args)
def __str__(self):
i, sx, sy, d = (self.id, self.sx, self.sy, self.device)
return '<MTDMotionEvent id=%d pos=(%f, %f) device=%s>' % (i, sx, sy, d)
if 'KIVY_DOC' in os.environ:
# documentation hack
MTDMotionEventProvider = None
else:
import threading
import collections
from kivy.lib.mtdev import Device, \
MTDEV_TYPE_EV_ABS, MTDEV_CODE_SLOT, MTDEV_CODE_POSITION_X, \
MTDEV_CODE_POSITION_Y, MTDEV_CODE_PRESSURE, \
MTDEV_CODE_TOUCH_MAJOR, MTDEV_CODE_TOUCH_MINOR, \
MTDEV_CODE_TRACKING_ID, MTDEV_ABS_POSITION_X, \
MTDEV_ABS_POSITION_Y, MTDEV_ABS_TOUCH_MINOR, \
MTDEV_ABS_TOUCH_MAJOR
from kivy.input.provider import MotionEventProvider
from kivy.input.factory import MotionEventFactory
from kivy.logger import Logger
class MTDMotionEventProvider(MotionEventProvider):
options = ('min_position_x', 'max_position_x',
'min_position_y', 'max_position_y',
'min_pressure', 'max_pressure',
'min_touch_major', 'max_touch_major',
'min_touch_minor', 'max_touch_minor',
'invert_x', 'invert_y',
'rotation')
def __init__(self, device, args):
super(MTDMotionEventProvider, self).__init__(device, args)
self._device = None
self.input_fn = None
self.default_ranges = dict()
# split arguments
args = args.split(',')
if not args:
Logger.error('MTD: No filename pass to MTD configuration')
Logger.error('MTD: Use /dev/input/event0 for example')
return
# read filename
self.input_fn = args[0]
Logger.info('MTD: Read event from <%s>' % self.input_fn)
# read parameters
for arg in args[1:]:
if arg == '':
continue
arg = arg.split('=')
# ensure it's a key = value
if len(arg) != 2:
err = 'MTD: Bad parameter %s: Not in key=value format' %\
arg
Logger.error(err)
continue
# ensure the key exist
key, value = arg
if key not in MTDMotionEventProvider.options:
Logger.error('MTD: unknown %s option' % key)
continue
# ensure the value
try:
self.default_ranges[key] = int(value)
except ValueError:
err = 'MTD: invalid value %s for option %s' % (key, value)
Logger.error(err)
continue
# all good!
Logger.info('MTD: Set custom %s to %d' % (key, int(value)))
if 'rotation' not in self.default_ranges:
self.default_ranges['rotation'] = 0
elif self.default_ranges['rotation'] not in (0, 90, 180, 270):
Logger.error('HIDInput: invalid rotation value ({})'.format(
self.default_ranges['rotation']))
self.default_ranges['rotation'] = 0
def start(self):
if self.input_fn is None:
return
self.uid = 0
self.queue = collections.deque()
self.thread = threading.Thread(
target=self._thread_run,
kwargs=dict(
queue=self.queue,
input_fn=self.input_fn,
device=self.device,
default_ranges=self.default_ranges))
self.thread.daemon = True
self.thread.start()
def _thread_run(self, **kwargs):
input_fn = kwargs.get('input_fn')
queue = kwargs.get('queue')
device = kwargs.get('device')
drs = kwargs.get('default_ranges').get
touches = {}
touches_sent = []
point = {}
l_points = {}
def assign_coord(point, value, invert, coords):
cx, cy = coords
if invert:
value = 1. - value
if rotation == 0:
point[cx] = value
elif rotation == 90:
point[cy] = value
elif rotation == 180:
point[cx] = 1. - value
elif rotation == 270:
point[cy] = 1. - value
def process(points):
for args in points:
# this can happen if we have a touch going on already at
# the start of the app
if 'id' not in args:
continue
tid = args['id']
try:
touch = touches[tid]
except KeyError:
touch = MTDMotionEvent(device, tid, args)
touches[touch.id] = touch
touch.move(args)
action = 'update'
if tid not in touches_sent:
action = 'begin'
touches_sent.append(tid)
if 'delete' in args:
action = 'end'
del args['delete']
del touches[touch.id]
touches_sent.remove(tid)
touch.update_time_end()
queue.append((action, touch))
def normalize(value, vmin, vmax):
return (value - vmin) / float(vmax - vmin)
# open mtdev device
_fn = input_fn
_slot = 0
try:
_device = Device(_fn)
except OSError as e:
if e.errno == 13: # Permission denied
Logger.warn(
'MTD: Unable to open device "{0}". Please ensure you'
' have the appropriate permissions.'.format(_fn))
return
else:
raise
_changes = set()
# prepare some vars to get limit of some component
ab = _device.get_abs(MTDEV_ABS_POSITION_X)
range_min_position_x = drs('min_position_x', ab.minimum)
range_max_position_x = drs('max_position_x', ab.maximum)
Logger.info('MTD: <%s> range position X is %d - %d' %
(_fn, range_min_position_x, range_max_position_x))
ab = _device.get_abs(MTDEV_ABS_POSITION_Y)
range_min_position_y = drs('min_position_y', ab.minimum)
range_max_position_y = drs('max_position_y', ab.maximum)
Logger.info('MTD: <%s> range position Y is %d - %d' %
(_fn, range_min_position_y, range_max_position_y))
ab = _device.get_abs(MTDEV_ABS_TOUCH_MAJOR)
range_min_major = drs('min_touch_major', ab.minimum)
range_max_major = drs('max_touch_major', ab.maximum)
Logger.info('MTD: <%s> range touch major is %d - %d' %
(_fn, range_min_major, range_max_major))
ab = _device.get_abs(MTDEV_ABS_TOUCH_MINOR)
range_min_minor = drs('min_touch_minor', ab.minimum)
range_max_minor = drs('max_touch_minor', ab.maximum)
Logger.info('MTD: <%s> range touch minor is %d - %d' %
(_fn, range_min_minor, range_max_minor))
range_min_pressure = drs('min_pressure', 0)
range_max_pressure = drs('max_pressure', 255)
Logger.info('MTD: <%s> range pressure is %d - %d' %
(_fn, range_min_pressure, range_max_pressure))
invert_x = int(bool(drs('invert_x', 0)))
invert_y = int(bool(drs('invert_y', 0)))
Logger.info('MTD: <%s> axes invertion: X is %d, Y is %d' %
(_fn, invert_x, invert_y))
rotation = drs('rotation', 0)
Logger.info('MTD: <%s> rotation set to %d' %
(_fn, rotation))
while _device:
# idle as much as we can.
while _device.idle(1000):
continue
# got data, read all without redoing idle
while True:
data = _device.get()
if data is None:
break
# set the working slot
if data.type == MTDEV_TYPE_EV_ABS and \
data.code == MTDEV_CODE_SLOT:
_slot = data.value
continue
# fill the slot
if _slot not in l_points:
l_points[_slot] = dict()
point = l_points[_slot]
ev_value = data.value
ev_code = data.code
if ev_code == MTDEV_CODE_POSITION_X:
val = normalize(ev_value,
range_min_position_x,
range_max_position_x)
assign_coord(point, val, invert_x, 'xy')
elif ev_code == MTDEV_CODE_POSITION_Y:
val = 1. - normalize(ev_value,
range_min_position_y,
range_max_position_y)
assign_coord(point, val, invert_y, 'yx')
elif ev_code == MTDEV_CODE_PRESSURE:
point['pressure'] = normalize(ev_value,
range_min_pressure,
range_max_pressure)
elif ev_code == MTDEV_CODE_TOUCH_MAJOR:
point['size_w'] = normalize(ev_value,
range_min_major,
range_max_major)
elif ev_code == MTDEV_CODE_TOUCH_MINOR:
point['size_h'] = normalize(ev_value,
range_min_minor,
range_max_minor)
elif ev_code == MTDEV_CODE_TRACKING_ID:
if ev_value == -1:
point['delete'] = True
# force process of changes here, as the slot can be
# reused.
_changes.add(_slot)
process([l_points[x] for x in _changes])
_changes.clear()
continue
else:
point['id'] = ev_value
else:
# unrecognized command, ignore.
continue
_changes.add(_slot)
# push all changes
if _changes:
process([l_points[x] for x in _changes])
_changes.clear()
def update(self, dispatch_fn):
# dispatch all event from threads
try:
while True:
event_type, touch = self.queue.popleft()
dispatch_fn(event_type, touch)
except:
pass
MotionEventFactory.register('mtdev', MTDMotionEventProvider)
| 38.977337 | 79 | 0.49226 |
__all__ = ('MTDMotionEventProvider', 'MTDMotionEvent')
import os
from kivy.input.motionevent import MotionEvent
from kivy.input.shape import ShapeRect
class MTDMotionEvent(MotionEvent):
def depack(self, args):
self.is_touch = True
if 'x' in args:
self.sx = args['x']
else:
self.sx = -1
if 'y' in args:
self.sy = args['y']
else:
self.sy = -1
self.profile = ['pos']
if 'size_w' in args and 'size_h' in args:
self.shape = ShapeRect()
self.shape.width = args['size_w']
self.shape.height = args['size_h']
self.profile.append('shape')
if 'pressure' in args:
self.pressure = args['pressure']
self.profile.append('pressure')
super(MTDMotionEvent, self).depack(args)
def __str__(self):
i, sx, sy, d = (self.id, self.sx, self.sy, self.device)
return '<MTDMotionEvent id=%d pos=(%f, %f) device=%s>' % (i, sx, sy, d)
if 'KIVY_DOC' in os.environ:
MTDMotionEventProvider = None
else:
import threading
import collections
from kivy.lib.mtdev import Device, \
MTDEV_TYPE_EV_ABS, MTDEV_CODE_SLOT, MTDEV_CODE_POSITION_X, \
MTDEV_CODE_POSITION_Y, MTDEV_CODE_PRESSURE, \
MTDEV_CODE_TOUCH_MAJOR, MTDEV_CODE_TOUCH_MINOR, \
MTDEV_CODE_TRACKING_ID, MTDEV_ABS_POSITION_X, \
MTDEV_ABS_POSITION_Y, MTDEV_ABS_TOUCH_MINOR, \
MTDEV_ABS_TOUCH_MAJOR
from kivy.input.provider import MotionEventProvider
from kivy.input.factory import MotionEventFactory
from kivy.logger import Logger
class MTDMotionEventProvider(MotionEventProvider):
options = ('min_position_x', 'max_position_x',
'min_position_y', 'max_position_y',
'min_pressure', 'max_pressure',
'min_touch_major', 'max_touch_major',
'min_touch_minor', 'max_touch_minor',
'invert_x', 'invert_y',
'rotation')
def __init__(self, device, args):
super(MTDMotionEventProvider, self).__init__(device, args)
self._device = None
self.input_fn = None
self.default_ranges = dict()
args = args.split(',')
if not args:
Logger.error('MTD: No filename pass to MTD configuration')
Logger.error('MTD: Use /dev/input/event0 for example')
return
self.input_fn = args[0]
Logger.info('MTD: Read event from <%s>' % self.input_fn)
for arg in args[1:]:
if arg == '':
continue
arg = arg.split('=')
if len(arg) != 2:
err = 'MTD: Bad parameter %s: Not in key=value format' %\
arg
Logger.error(err)
continue
# ensure the key exist
key, value = arg
if key not in MTDMotionEventProvider.options:
Logger.error('MTD: unknown %s option' % key)
continue
# ensure the value
try:
self.default_ranges[key] = int(value)
except ValueError:
err = 'MTD: invalid value %s for option %s' % (key, value)
Logger.error(err)
continue
# all good!
Logger.info('MTD: Set custom %s to %d' % (key, int(value)))
if 'rotation' not in self.default_ranges:
self.default_ranges['rotation'] = 0
elif self.default_ranges['rotation'] not in (0, 90, 180, 270):
Logger.error('HIDInput: invalid rotation value ({})'.format(
self.default_ranges['rotation']))
self.default_ranges['rotation'] = 0
def start(self):
if self.input_fn is None:
return
self.uid = 0
self.queue = collections.deque()
self.thread = threading.Thread(
target=self._thread_run,
kwargs=dict(
queue=self.queue,
input_fn=self.input_fn,
device=self.device,
default_ranges=self.default_ranges))
self.thread.daemon = True
self.thread.start()
def _thread_run(self, **kwargs):
input_fn = kwargs.get('input_fn')
queue = kwargs.get('queue')
device = kwargs.get('device')
drs = kwargs.get('default_ranges').get
touches = {}
touches_sent = []
point = {}
l_points = {}
def assign_coord(point, value, invert, coords):
cx, cy = coords
if invert:
value = 1. - value
if rotation == 0:
point[cx] = value
elif rotation == 90:
point[cy] = value
elif rotation == 180:
point[cx] = 1. - value
elif rotation == 270:
point[cy] = 1. - value
def process(points):
for args in points:
# this can happen if we have a touch going on already at
# the start of the app
if 'id' not in args:
continue
tid = args['id']
try:
touch = touches[tid]
except KeyError:
touch = MTDMotionEvent(device, tid, args)
touches[touch.id] = touch
touch.move(args)
action = 'update'
if tid not in touches_sent:
action = 'begin'
touches_sent.append(tid)
if 'delete' in args:
action = 'end'
del args['delete']
del touches[touch.id]
touches_sent.remove(tid)
touch.update_time_end()
queue.append((action, touch))
def normalize(value, vmin, vmax):
return (value - vmin) / float(vmax - vmin)
# open mtdev device
_fn = input_fn
_slot = 0
try:
_device = Device(_fn)
except OSError as e:
if e.errno == 13: # Permission denied
Logger.warn(
'MTD: Unable to open device "{0}". Please ensure you'
' have the appropriate permissions.'.format(_fn))
return
else:
raise
_changes = set()
# prepare some vars to get limit of some component
ab = _device.get_abs(MTDEV_ABS_POSITION_X)
range_min_position_x = drs('min_position_x', ab.minimum)
range_max_position_x = drs('max_position_x', ab.maximum)
Logger.info('MTD: <%s> range position X is %d - %d' %
(_fn, range_min_position_x, range_max_position_x))
ab = _device.get_abs(MTDEV_ABS_POSITION_Y)
range_min_position_y = drs('min_position_y', ab.minimum)
range_max_position_y = drs('max_position_y', ab.maximum)
Logger.info('MTD: <%s> range position Y is %d - %d' %
(_fn, range_min_position_y, range_max_position_y))
ab = _device.get_abs(MTDEV_ABS_TOUCH_MAJOR)
range_min_major = drs('min_touch_major', ab.minimum)
range_max_major = drs('max_touch_major', ab.maximum)
Logger.info('MTD: <%s> range touch major is %d - %d' %
(_fn, range_min_major, range_max_major))
ab = _device.get_abs(MTDEV_ABS_TOUCH_MINOR)
range_min_minor = drs('min_touch_minor', ab.minimum)
range_max_minor = drs('max_touch_minor', ab.maximum)
Logger.info('MTD: <%s> range touch minor is %d - %d' %
(_fn, range_min_minor, range_max_minor))
range_min_pressure = drs('min_pressure', 0)
range_max_pressure = drs('max_pressure', 255)
Logger.info('MTD: <%s> range pressure is %d - %d' %
(_fn, range_min_pressure, range_max_pressure))
invert_x = int(bool(drs('invert_x', 0)))
invert_y = int(bool(drs('invert_y', 0)))
Logger.info('MTD: <%s> axes invertion: X is %d, Y is %d' %
(_fn, invert_x, invert_y))
rotation = drs('rotation', 0)
Logger.info('MTD: <%s> rotation set to %d' %
(_fn, rotation))
while _device:
# idle as much as we can.
while _device.idle(1000):
continue
# got data, read all without redoing idle
while True:
data = _device.get()
if data is None:
break
# set the working slot
if data.type == MTDEV_TYPE_EV_ABS and \
data.code == MTDEV_CODE_SLOT:
_slot = data.value
continue
# fill the slot
if _slot not in l_points:
l_points[_slot] = dict()
point = l_points[_slot]
ev_value = data.value
ev_code = data.code
if ev_code == MTDEV_CODE_POSITION_X:
val = normalize(ev_value,
range_min_position_x,
range_max_position_x)
assign_coord(point, val, invert_x, 'xy')
elif ev_code == MTDEV_CODE_POSITION_Y:
val = 1. - normalize(ev_value,
range_min_position_y,
range_max_position_y)
assign_coord(point, val, invert_y, 'yx')
elif ev_code == MTDEV_CODE_PRESSURE:
point['pressure'] = normalize(ev_value,
range_min_pressure,
range_max_pressure)
elif ev_code == MTDEV_CODE_TOUCH_MAJOR:
point['size_w'] = normalize(ev_value,
range_min_major,
range_max_major)
elif ev_code == MTDEV_CODE_TOUCH_MINOR:
point['size_h'] = normalize(ev_value,
range_min_minor,
range_max_minor)
elif ev_code == MTDEV_CODE_TRACKING_ID:
if ev_value == -1:
point['delete'] = True
# force process of changes here, as the slot can be
# reused.
_changes.add(_slot)
process([l_points[x] for x in _changes])
_changes.clear()
continue
else:
point['id'] = ev_value
else:
# unrecognized command, ignore.
continue
_changes.add(_slot)
# push all changes
if _changes:
process([l_points[x] for x in _changes])
_changes.clear()
def update(self, dispatch_fn):
# dispatch all event from threads
try:
while True:
event_type, touch = self.queue.popleft()
dispatch_fn(event_type, touch)
except:
pass
MotionEventFactory.register('mtdev', MTDMotionEventProvider)
| true | true |
f7029ebf8b275c2961b1fda13c18da5f443bfc24 | 825 | py | Python | backend/data_export/tests/test_dataset.py | arcada-uas/doccano | c29aece3dd4504eeaaa3466af0663bfe18b90dc1 | [
"MIT"
] | 2,082 | 2018-05-09T07:16:21.000Z | 2019-12-01T16:41:50.000Z | backend/data_export/tests/test_dataset.py | arcada-uas/doccano | c29aece3dd4504eeaaa3466af0663bfe18b90dc1 | [
"MIT"
] | 365 | 2018-07-31T13:49:05.000Z | 2019-11-29T11:25:17.000Z | backend/data_export/tests/test_dataset.py | arcada-uas/doccano | c29aece3dd4504eeaaa3466af0663bfe18b90dc1 | [
"MIT"
] | 476 | 2018-08-17T06:43:57.000Z | 2019-12-01T09:47:08.000Z | import unittest
from unittest.mock import MagicMock
import pandas as pd
from pandas.testing import assert_frame_equal
from data_export.pipeline.dataset import Dataset
class TestDataset(unittest.TestCase):
def setUp(self):
example = MagicMock()
example.to_dict.return_value = {"data": "example"}
self.examples = MagicMock()
self.examples.__iter__.return_value = [example]
label = MagicMock()
label.find_by.return_value = {"labels": ["label"]}
self.labels = MagicMock()
self.labels.__iter__.return_value = [label]
def test_to_dataframe(self):
dataset = Dataset(self.examples, self.labels)
df = dataset.to_dataframe()
expected = pd.DataFrame([{"data": "example", "labels": ["label"]}])
assert_frame_equal(df, expected)
| 31.730769 | 75 | 0.672727 | import unittest
from unittest.mock import MagicMock
import pandas as pd
from pandas.testing import assert_frame_equal
from data_export.pipeline.dataset import Dataset
class TestDataset(unittest.TestCase):
def setUp(self):
example = MagicMock()
example.to_dict.return_value = {"data": "example"}
self.examples = MagicMock()
self.examples.__iter__.return_value = [example]
label = MagicMock()
label.find_by.return_value = {"labels": ["label"]}
self.labels = MagicMock()
self.labels.__iter__.return_value = [label]
def test_to_dataframe(self):
dataset = Dataset(self.examples, self.labels)
df = dataset.to_dataframe()
expected = pd.DataFrame([{"data": "example", "labels": ["label"]}])
assert_frame_equal(df, expected)
| true | true |
f7029fff48454ff996b3fa84325dfe291ea89943 | 706 | py | Python | src/python/grpcio_channelz/grpc_version.py | xeno14/grpc | ceb12c6be5f801997db976b564ddb14f95e46ce9 | [
"Apache-2.0"
] | 2 | 2019-08-15T18:29:13.000Z | 2020-11-03T20:18:42.000Z | src/python/grpcio_channelz/grpc_version.py | xeno14/grpc | ceb12c6be5f801997db976b564ddb14f95e46ce9 | [
"Apache-2.0"
] | 2 | 2017-03-07T22:54:36.000Z | 2017-04-14T15:17:36.000Z | src/python/grpcio_channelz/grpc_version.py | xeno14/grpc | ceb12c6be5f801997db976b564ddb14f95e46ce9 | [
"Apache-2.0"
] | 1 | 2021-08-03T19:12:54.000Z | 2021-08-03T19:12:54.000Z | # Copyright 2018 The gRPC Authors
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
# AUTO-GENERATED FROM `$REPO_ROOT/templates/src/python/grpcio_channelz/grpc_version.py.template`!!!
VERSION = '1.23.0.dev0'
| 39.222222 | 99 | 0.763456 |
VERSION = '1.23.0.dev0'
| true | true |
f702a06791c1c7d80d4cc9c623916b3a47b3c85a | 15,279 | py | Python | tools/external_converter_v2/parser/kill_fluid/fluid_helper.py | kiritigowda/Anakin | 4ba2329153163590e11875dc6b4150031066915d | [
"Apache-2.0"
] | null | null | null | tools/external_converter_v2/parser/kill_fluid/fluid_helper.py | kiritigowda/Anakin | 4ba2329153163590e11875dc6b4150031066915d | [
"Apache-2.0"
] | 3 | 2018-06-22T09:08:44.000Z | 2018-07-04T08:38:30.000Z | tools/external_converter_v2/parser/kill_fluid/fluid_helper.py | kiritigowda/Anakin | 4ba2329153163590e11875dc6b4150031066915d | [
"Apache-2.0"
] | null | null | null | from ..proto import *
from ..graph_io import *
import paddle.fluid as fluid
import numpy as np
from paddle.fluid.core import VarDesc, AttrType
def union(list_a, list_b):
return list(set(list_a).union(set(list_b)))
def difference(list_a, list_b):
return list(set(list_a).difference(set(list_b)))
class Edge_for_fluid:
def __init__(self, param, target, var):
self.param = param
self.target = target
self.var = var
class Fluid_edger:
def __init__(self, param = None, target = None, var = None):
self.edges = []
if param is not None and target is not None:
edge = Edge_for_fluid(param, target, var)
self.edges.append(edge)
def __call__(self):
return self.all_targets()
def add(self, param, target, var = None):
edge = Edge_for_fluid(param, target, var)
self.edges.append(edge)
def rm_edges_by_param(self, param):
for edge in self.edges:
if edge.param == param:
edge_idx = self.edges.index(edge)
del self.edges[edge_idx]
def rm(self, target):
res = -1
for edge in self.edges:
if target == edge.target:
edge_idx = self.edges.index(edge)
del self.edges[edge_idx]
res = res + 1
if res != 0:
pass
def mv(self, old_target, new_target):
res = -1
for edge in self.edges:
if old_target == edge.target:
edge.target = new_target
res = res + 1
if res != 0:
pass
def all_params(self):
params = []
for edge in self.edges:
if edge.param not in params:
params.append(edge.param)
return params
def all_targets(self):
targets = []
for edge in self.edges:
targets.append(edge.target)
return targets
def targets(self, param):
targets = []
for edge in self.edges:
if edge.param == param:
targets.append(edge.target)
return targets
def target(self, param, idx = 0):
return self.targets(param)[idx]
def clear(self):
targets_list = self.all_targets()
for target in targets_list:
self.rm(target)
def targets_with_params(self):
list_of_targets_and_params = []
for edge in self.edges:
target_and_param = [edge.target, edge.param]
list_of_targets_and_params.append(target_and_param)
return list_of_targets_and_params
def vars_by_target(self, target):
vars = []
for edge in self.edges:
if edge.target == target and edge.var is not None:
vars.append(edge.var)
return vars
def __getitem__(self, idx):
if idx < len(self.edges):
return self.edges[idx]
return None
class Fluid_helper:
def __init__(self, scope, block):
self.scope = scope
self.block = block
def args_by_input_param(self, op, param_name):
if param_name in op.input_names:
return op.input(param_name)
else:
raise NameError('ERROR: param_name %s is not exists.' % ( param_name ) )
def args_by_output_param(self, op, param_name):
if param_name in op.output_names:
return op.output(param_name)
else:
raise NameError('ERROR: param_name %s is not exists.' % ( param_name ) )
def var_by_input_param(self, op, param_name, var_idx = 0):
var_name = self.args_by_input_param(op, param_name)[var_idx]
var = self.block.var(var_name)
return var
def var_by_output_param(self, op, param_name, var_idx = 0):
var_name = self.args_by_output_param(op, param_name)[var_idx]
var = self.block.var(var_name)
return var
def var_name_by_param(self, op, param_name, var_idx = 0):
if param_name not in op.input_names + op.output_names:
raise NameError('ERROR: param_name %s is not exists.' % ( param_name ) )
elif param_name in op.input_names:
if len(op.input(param_name)) > 0:
var_name_unicode = op.input(param_name)[var_idx]
else:
raise NameError('ERROR: param %s has not var.' % ( param_name ) )
elif param_name in op.output_names:
if len(op.output(param_name)) > 0:
var_name_unicode = op.output(param_name)[var_idx]
else:
raise NameError('ERROR: param %s has not var.' % ( param_name ) )
var = self.block.var(var_name_unicode)
var_name = var.name
return var_name
def var_by_param(self, op, param_name, var_idx = 0):
var_name = self.var_name_by_param(op, param_name, var_idx)
var = self.block.var(var_name)
return var
def shape_by_var_name(self, var_name, layout = 'NCHW'):
var = self.block.var(var_name)
long_tuple = var.shape
long_list = list(long_tuple)
if layout == 'NCHW':
int_list_4d = map(int, [1]*(4-len(long_list)) + long_list)
return int_list_4d
elif layout == 'UNMODIFIED':
return long_list
else:
raise NameError('ERROR: layout %s is not implemented yet.' % ( layout ) )
def np_data_by_var_name(self, var_name):
numpy_array = fluid.executor.fetch_var(var_name, self.scope, True)
return numpy_array
def dtype_by_var_name(self, var_name):
var = self.block.var(var_name)
fluid_var_type = var.dtype
dtype = ANAKIN_TENSOR_DTYPE[fluid_var_type]
return dtype
def is_persistable_param(self, op, param_name, var_idx = 0):
var = self.var_by_param(op, param_name, var_idx)
is_persistable_var = var.persistable
return is_persistable_var
def var_shape_by_param(self, transpose, op, param_name, var_idx = 0, layout = 'NCHW'):
if transpose is True:
raise NameError('ERROR: var_shape transpose is not implemented yet.')
else:
var_name = self.var_name_by_param(op, param_name, var_idx)
shape = self.shape_by_var_name(var_name, layout)
return shape
def data_with_shape_by_param(self,
op,
param_name,
transpose = False,
axes = None,
var_idx = 0,
is_flat_list = True,
layout = 'NCHW'):
np.set_printoptions(threshold=np.inf, suppress=True)
var_name = self.var_name_by_param(op, param_name, var_idx)
np_array = self.np_data_by_var_name(var_name)
if transpose is True:
np_array = np.transpose(np_array, axes)
np_shape = np.shape(np_array)
if layout == 'NCHW':
np_shape = map(int, [1]*(4-len(np_shape)) + list(np_shape))
if is_flat_list is True:
flat_list = list(np_array.flatten())
return [flat_list, np_shape]
else:
return [np_array, np_shape]
def np_param(self,
op,
param_name,
transpose = False,
axes = None,
var_idx = 0):
[data, np_shape] = self.data_with_shape_by_param(op, param_name, transpose, \
axes, var_idx, False)
return data
def dtype_by_param(self, op, param_name, var_idx = 0):
var_name = self.var_name_by_param(op, param_name, var_idx)
dtype = self.dtype_by_var_name(var_name)
return dtype
def is_list_type(self, op, attr_name):
if op.has_attr(attr_name):
fluid_attr_type = op.attr_type(attr_name)
if fluid_attr_type in ANAKIN_ATTR_IS_LIST.keys():
return ANAKIN_ATTR_IS_LIST[fluid_attr_type]
else:
return False # AttrType.LONG
else:
raise NameError('ERROR: attr_name %s is not exists.' % ( attr_name ) )
def dtype_of_attr(self, op, attr_name):
if op.has_attr(attr_name):
fluid_attr_type = op.attr_type(attr_name)
if fluid_attr_type in ANAKIN_ATTR_DTYPE.keys():
return ANAKIN_ATTR_DTYPE[fluid_attr_type]
else:
return INT32 # AttrType.LONG
else:
raise NameError('ERROR: attr_name %s is not exists.' % ( attr_name ) )
def attr_data_required(self, op, attr_name):
data = op.attr(attr_name)
is_list = self.is_list_type(op, attr_name)
dtype = self.dtype_of_attr(op, attr_name)
if dtype not in [INT32, FLOAT, STR]:
return data
elif dtype == INT32:
return map(int, data) if is_list else int(data)
elif dtype == FLOAT:
return map(float, data) if is_list else float(data)
elif dtype == STR:
return bytes(data)
def attr_data(self, op, attr_name, default_value = 0, type = None):
if op.has_attr(attr_name):
return self.attr_data_required(op, attr_name)
else:
#raise NameError('ERROR: attr_name %s is not exists.' % ( attr_name ) )
return default_value
def param_tensor_sh(self,
op,
param_name,
transpose = False,
axes = None,
reshape = None,
var_idx = 0,
layout = 'NCHW'):
tensor = TensorProtoIO()
[flat_data, shape] = self.data_with_shape_by_param(op, param_name, transpose, \
axes, var_idx, True, layout)
dtype = self.dtype_by_param(op, param_name, var_idx)
tensor.set_data_type(dtype)
if dtype in ANAKIN_TENSOR_DTYPESTR.keys():
tensor.set_data(flat_data, ANAKIN_TENSOR_DTYPESTR[dtype])
#pass #debug
else:
raise NameError('ERROR: Unknown data type (%s)' % ( dtype ) )
if reshape is not None:
tensor.set_shape(reshape)
else:
tensor.set_shape(shape)
return [tensor, shape]
def param_tensor(self,
op,
param_name,
transpose = False,
axes = None,
reshape = None,
var_idx = 0,
layout = 'NCHW'):
[tensor, shape] = self.param_tensor_sh(op, param_name, transpose, axes, \
reshape, var_idx, layout)
return tensor
def create_tensor(self, data_list, data_shape, dtype):
tensor = TensorProtoIO()
tensor.set_data_type(dtype)
tensor.set_data(data_list, ANAKIN_TENSOR_DTYPESTR[dtype])
tensor.set_shape(data_shape)
return tensor
def gru_tensor_convert(self, origin_h2h, origin_i2h, origin_b, offset=[2, 1, 0]):
hidden_size = int(origin_b.size // 3)
word_size = int(origin_i2h.size // hidden_size // 3)
tar_h2h=np.array(origin_h2h.flatten().tolist()[2*hidden_size*hidden_size:]\
+np.array(origin_h2h.flatten().tolist()[:2*hidden_size*hidden_size])\
.reshape(hidden_size,2,hidden_size)[:,[1,0],:].flatten().tolist())\
.reshape(1,1,hidden_size,3*hidden_size)
tar_i2h=origin_i2h.reshape(word_size,3,hidden_size)[:,offset,:]\
.reshape(1,1,word_size,3*hidden_size)
tar_b=origin_b.reshape(3, hidden_size)[offset, :].reshape(1,1,1,3 * hidden_size)
tar_i2h_h2h=np.concatenate([tar_i2h.flatten(),tar_h2h.flatten()])\
.reshape(1,1,1,3*hidden_size*hidden_size+3*word_size*hidden_size)
return tar_i2h_h2h, tar_b
def lstm_fc_tensor_merge_convert(self, origin_hidden_size, origin_lstm_w, origin_lstm_b, origin_fc_w, origin_fc_b):
layer_size = int (origin_hidden_size // 4)
input_size = int (origin_fc_w.size // origin_hidden_size)
lstm_bias_num = int (origin_lstm_b.size // layer_size)
tar_w = np.vstack((np.hstack((origin_fc_w[:, 1 * layer_size : 2 * layer_size],
origin_fc_w[:, 2 * layer_size : 3 * layer_size],
origin_fc_w[:, : 1 * layer_size],
origin_fc_w[:, 3 * layer_size :])),
np.hstack((origin_lstm_w[:, 1 * layer_size : 2 * layer_size],
origin_lstm_w[:, 2 * layer_size : 3 * layer_size],
origin_lstm_w[:, : 1 * layer_size],
origin_lstm_w[:, 3 * layer_size : ]))))
if origin_fc_b is not None:
split_fc_bc = origin_fc_b.flatten()[: 1 * layer_size]
split_fc_bi = origin_fc_b.flatten()[1 * layer_size : 2 * layer_size]
split_fc_bf = origin_fc_b.flatten()[2 * layer_size : 3 * layer_size]
split_fc_bo = origin_fc_b.flatten()[3 * layer_size : 4 * layer_size]
else:
split_fc_bc = np.zeros(layer_size)
split_fc_bi = np.zeros(layer_size)
split_fc_bf = np.zeros(layer_size)
split_fc_bo = np.zeros(layer_size)
split_lstm_bc = origin_lstm_b.flatten()[: 1 * layer_size]
split_lstm_bi = origin_lstm_b.flatten()[1 * layer_size: 2 * layer_size]
split_lstm_bf = origin_lstm_b.flatten()[2 * layer_size: 3 * layer_size]
split_lstm_bo = origin_lstm_b.flatten()[3 * layer_size: 4 * layer_size]
split_lstm_bc = np.add(split_lstm_bc, split_fc_bc)
split_lstm_bi = np.add(split_lstm_bi, split_fc_bi)
split_lstm_bf = np.add(split_lstm_bf, split_fc_bf)
split_lstm_bo = np.add(split_lstm_bo, split_fc_bo)
if lstm_bias_num == 4:
tar_b = np.array(split_lstm_bi.flatten().tolist()
+ split_lstm_bf.flatten().tolist()
+ split_lstm_bc.flatten().tolist()
+ split_lstm_bo.flatten().tolist())
else:
split_lstm_wic = origin_lstm_b.flatten()[4 * layer_size : 5 * layer_size]
split_lstm_wfc = origin_lstm_b.flatten()[5 * layer_size : 6 * layer_size]
split_lstm_woc = origin_lstm_b.flatten()[6 * layer_size :]
tar_b = np.array(split_lstm_bi.flatten().tolist()
+ split_lstm_bf.flatten().tolist()
+ split_lstm_bc.flatten().tolist()
+ split_lstm_bo.flatten().tolist()
+ split_lstm_wic.flatten().tolist()
+ split_lstm_wfc.flatten().tolist()
+ split_lstm_woc.flatten().tolist())
return tar_w.reshape(input_size+ layer_size, 4 * layer_size, 1, 1),\
tar_b.reshape(1, origin_lstm_b.size, 1, 1)
class Fluid_comparator:
def __init__(self, helper):
self.helper = helper
self.only_list = ['feed', 'fetch']
def compare_by_param(self, op_a, op_b, param):
is_weight_a = self.helper.is_persistable_param(op_a, param)
is_weight_b = self.helper.is_persistable_param(op_b, param)
if is_weight_a and is_weight_b:
np_a = self.helper.np_param(op_a, param)
np_b = self.helper.np_param(op_b, param)
if (np_a == np_b).all() == True:
return True
else:
return False
elif is_weight_a is is_weight_b:
return True
else:
return False
def have_same_weights(self, op_a, op_b):
is_same = True
if op_a.input_names == op_b.input_names:
params = op_a.input_names
for param in params:
if self.compare_by_param(op_a, op_b, param) is False:
is_same = False
return is_same
else:
return False
def compare_by_attr(self, op_a, op_b, attr_name):
data_a = self.helper.attr_data(op_a, attr_name)
data_b = self.helper.attr_data(op_b, attr_name)
return data_a == data_b
def have_same_attrs(self, op_a, op_b):
is_same = True
if op_a.attr_names == op_b.attr_names:
attrs = op_a.attr_names
for attr in attrs:
if self.compare_by_attr(op_a, op_b, attr) is False:
is_same = False
return is_same
else:
return False
def brothers(self, op_list):
is_same = True
if len(op_list) > 1:
idx = 0
for op_b in op_list[1:]:
if op_b.type not in self.only_list:
idx = op_list.index(op_b)
op_a = op_list[idx - 1]
if op_a.type not in self.only_list:
same_weights = self.have_same_weights(op_a, op_b)
same_attrs = self.have_same_attrs(op_a, op_b)
if (same_weights and same_attrs) is False:
is_same = False
else:
raise NameError('ERROR: %s is in only_list.' % ( op_a.type ))
else:
raise NameError('ERROR: %s is in only_list.' % ( op_b.type ))
return is_same
else:
raise NameError('ERROR: Members of op_list must be greater than 2.')
ANAKIN_TENSOR_DTYPE = {
VarDesc.VarType.BOOL: BOOLEN,
VarDesc.VarType.INT32: INT32,
VarDesc.VarType.FP16: FLOAT16,
VarDesc.VarType.FP32: FLOAT,
VarDesc.VarType.FP64: DOUBLE,
}
ANAKIN_TENSOR_DTYPESTR = {
STR: "string",
INT32: "int",
FLOAT: "float",
BOOLEN: "bool",
}
ANAKIN_ATTR_DTYPE = {
AttrType.INT: INT32,
AttrType.INTS: INT32,
AttrType.FLOAT: FLOAT,
AttrType.FLOATS: FLOAT,
AttrType.STRING: STR,
AttrType.STRINGS: STR,
AttrType.BOOL: BOOLEN,
AttrType.BOOLS: BOOLEN,
}
ANAKIN_ATTR_IS_LIST = {
AttrType.INT: False,
AttrType.INTS: True,
AttrType.FLOAT: False,
AttrType.FLOATS: True,
AttrType.STRING: False,
AttrType.STRINGS: True,
AttrType.BOOL: False,
AttrType.BOOLS: True,
}
APPEND_BIAS_OP_TYPE = [
'FC',
'mul',
'sequence_conv',
'conv2d',
'conv2d_transpose',
'depthwise_conv2d',
'elementwise_mul',
]
APPEND_ACT_OP_TYPE = [
'FC',
'mul',
'sequence_conv',
'conv2d',
'conv2d_transpose',
'batch_norm',
'layer_norm',
'row_conv',
'reshape',
]
| 29.553191 | 116 | 0.698344 | from ..proto import *
from ..graph_io import *
import paddle.fluid as fluid
import numpy as np
from paddle.fluid.core import VarDesc, AttrType
def union(list_a, list_b):
return list(set(list_a).union(set(list_b)))
def difference(list_a, list_b):
return list(set(list_a).difference(set(list_b)))
class Edge_for_fluid:
def __init__(self, param, target, var):
self.param = param
self.target = target
self.var = var
class Fluid_edger:
def __init__(self, param = None, target = None, var = None):
self.edges = []
if param is not None and target is not None:
edge = Edge_for_fluid(param, target, var)
self.edges.append(edge)
def __call__(self):
return self.all_targets()
def add(self, param, target, var = None):
edge = Edge_for_fluid(param, target, var)
self.edges.append(edge)
def rm_edges_by_param(self, param):
for edge in self.edges:
if edge.param == param:
edge_idx = self.edges.index(edge)
del self.edges[edge_idx]
def rm(self, target):
res = -1
for edge in self.edges:
if target == edge.target:
edge_idx = self.edges.index(edge)
del self.edges[edge_idx]
res = res + 1
if res != 0:
pass
def mv(self, old_target, new_target):
res = -1
for edge in self.edges:
if old_target == edge.target:
edge.target = new_target
res = res + 1
if res != 0:
pass
def all_params(self):
params = []
for edge in self.edges:
if edge.param not in params:
params.append(edge.param)
return params
def all_targets(self):
targets = []
for edge in self.edges:
targets.append(edge.target)
return targets
def targets(self, param):
targets = []
for edge in self.edges:
if edge.param == param:
targets.append(edge.target)
return targets
def target(self, param, idx = 0):
return self.targets(param)[idx]
def clear(self):
targets_list = self.all_targets()
for target in targets_list:
self.rm(target)
def targets_with_params(self):
list_of_targets_and_params = []
for edge in self.edges:
target_and_param = [edge.target, edge.param]
list_of_targets_and_params.append(target_and_param)
return list_of_targets_and_params
def vars_by_target(self, target):
vars = []
for edge in self.edges:
if edge.target == target and edge.var is not None:
vars.append(edge.var)
return vars
def __getitem__(self, idx):
if idx < len(self.edges):
return self.edges[idx]
return None
class Fluid_helper:
def __init__(self, scope, block):
self.scope = scope
self.block = block
def args_by_input_param(self, op, param_name):
if param_name in op.input_names:
return op.input(param_name)
else:
raise NameError('ERROR: param_name %s is not exists.' % ( param_name ) )
def args_by_output_param(self, op, param_name):
if param_name in op.output_names:
return op.output(param_name)
else:
raise NameError('ERROR: param_name %s is not exists.' % ( param_name ) )
def var_by_input_param(self, op, param_name, var_idx = 0):
var_name = self.args_by_input_param(op, param_name)[var_idx]
var = self.block.var(var_name)
return var
def var_by_output_param(self, op, param_name, var_idx = 0):
var_name = self.args_by_output_param(op, param_name)[var_idx]
var = self.block.var(var_name)
return var
def var_name_by_param(self, op, param_name, var_idx = 0):
if param_name not in op.input_names + op.output_names:
raise NameError('ERROR: param_name %s is not exists.' % ( param_name ) )
elif param_name in op.input_names:
if len(op.input(param_name)) > 0:
var_name_unicode = op.input(param_name)[var_idx]
else:
raise NameError('ERROR: param %s has not var.' % ( param_name ) )
elif param_name in op.output_names:
if len(op.output(param_name)) > 0:
var_name_unicode = op.output(param_name)[var_idx]
else:
raise NameError('ERROR: param %s has not var.' % ( param_name ) )
var = self.block.var(var_name_unicode)
var_name = var.name
return var_name
def var_by_param(self, op, param_name, var_idx = 0):
var_name = self.var_name_by_param(op, param_name, var_idx)
var = self.block.var(var_name)
return var
def shape_by_var_name(self, var_name, layout = 'NCHW'):
var = self.block.var(var_name)
long_tuple = var.shape
long_list = list(long_tuple)
if layout == 'NCHW':
int_list_4d = map(int, [1]*(4-len(long_list)) + long_list)
return int_list_4d
elif layout == 'UNMODIFIED':
return long_list
else:
raise NameError('ERROR: layout %s is not implemented yet.' % ( layout ) )
def np_data_by_var_name(self, var_name):
numpy_array = fluid.executor.fetch_var(var_name, self.scope, True)
return numpy_array
def dtype_by_var_name(self, var_name):
var = self.block.var(var_name)
fluid_var_type = var.dtype
dtype = ANAKIN_TENSOR_DTYPE[fluid_var_type]
return dtype
def is_persistable_param(self, op, param_name, var_idx = 0):
var = self.var_by_param(op, param_name, var_idx)
is_persistable_var = var.persistable
return is_persistable_var
def var_shape_by_param(self, transpose, op, param_name, var_idx = 0, layout = 'NCHW'):
if transpose is True:
raise NameError('ERROR: var_shape transpose is not implemented yet.')
else:
var_name = self.var_name_by_param(op, param_name, var_idx)
shape = self.shape_by_var_name(var_name, layout)
return shape
def data_with_shape_by_param(self,
op,
param_name,
transpose = False,
axes = None,
var_idx = 0,
is_flat_list = True,
layout = 'NCHW'):
np.set_printoptions(threshold=np.inf, suppress=True)
var_name = self.var_name_by_param(op, param_name, var_idx)
np_array = self.np_data_by_var_name(var_name)
if transpose is True:
np_array = np.transpose(np_array, axes)
np_shape = np.shape(np_array)
if layout == 'NCHW':
np_shape = map(int, [1]*(4-len(np_shape)) + list(np_shape))
if is_flat_list is True:
flat_list = list(np_array.flatten())
return [flat_list, np_shape]
else:
return [np_array, np_shape]
def np_param(self,
op,
param_name,
transpose = False,
axes = None,
var_idx = 0):
[data, np_shape] = self.data_with_shape_by_param(op, param_name, transpose, \
axes, var_idx, False)
return data
def dtype_by_param(self, op, param_name, var_idx = 0):
var_name = self.var_name_by_param(op, param_name, var_idx)
dtype = self.dtype_by_var_name(var_name)
return dtype
def is_list_type(self, op, attr_name):
if op.has_attr(attr_name):
fluid_attr_type = op.attr_type(attr_name)
if fluid_attr_type in ANAKIN_ATTR_IS_LIST.keys():
return ANAKIN_ATTR_IS_LIST[fluid_attr_type]
else:
return False
else:
raise NameError('ERROR: attr_name %s is not exists.' % ( attr_name ) )
def dtype_of_attr(self, op, attr_name):
if op.has_attr(attr_name):
fluid_attr_type = op.attr_type(attr_name)
if fluid_attr_type in ANAKIN_ATTR_DTYPE.keys():
return ANAKIN_ATTR_DTYPE[fluid_attr_type]
else:
return INT32
else:
raise NameError('ERROR: attr_name %s is not exists.' % ( attr_name ) )
def attr_data_required(self, op, attr_name):
data = op.attr(attr_name)
is_list = self.is_list_type(op, attr_name)
dtype = self.dtype_of_attr(op, attr_name)
if dtype not in [INT32, FLOAT, STR]:
return data
elif dtype == INT32:
return map(int, data) if is_list else int(data)
elif dtype == FLOAT:
return map(float, data) if is_list else float(data)
elif dtype == STR:
return bytes(data)
def attr_data(self, op, attr_name, default_value = 0, type = None):
if op.has_attr(attr_name):
return self.attr_data_required(op, attr_name)
else:
return default_value
def param_tensor_sh(self,
op,
param_name,
transpose = False,
axes = None,
reshape = None,
var_idx = 0,
layout = 'NCHW'):
tensor = TensorProtoIO()
[flat_data, shape] = self.data_with_shape_by_param(op, param_name, transpose, \
axes, var_idx, True, layout)
dtype = self.dtype_by_param(op, param_name, var_idx)
tensor.set_data_type(dtype)
if dtype in ANAKIN_TENSOR_DTYPESTR.keys():
tensor.set_data(flat_data, ANAKIN_TENSOR_DTYPESTR[dtype])
e:
raise NameError('ERROR: Unknown data type (%s)' % ( dtype ) )
if reshape is not None:
tensor.set_shape(reshape)
else:
tensor.set_shape(shape)
return [tensor, shape]
def param_tensor(self,
op,
param_name,
transpose = False,
axes = None,
reshape = None,
var_idx = 0,
layout = 'NCHW'):
[tensor, shape] = self.param_tensor_sh(op, param_name, transpose, axes, \
reshape, var_idx, layout)
return tensor
def create_tensor(self, data_list, data_shape, dtype):
tensor = TensorProtoIO()
tensor.set_data_type(dtype)
tensor.set_data(data_list, ANAKIN_TENSOR_DTYPESTR[dtype])
tensor.set_shape(data_shape)
return tensor
def gru_tensor_convert(self, origin_h2h, origin_i2h, origin_b, offset=[2, 1, 0]):
hidden_size = int(origin_b.size // 3)
word_size = int(origin_i2h.size // hidden_size // 3)
tar_h2h=np.array(origin_h2h.flatten().tolist()[2*hidden_size*hidden_size:]\
+np.array(origin_h2h.flatten().tolist()[:2*hidden_size*hidden_size])\
.reshape(hidden_size,2,hidden_size)[:,[1,0],:].flatten().tolist())\
.reshape(1,1,hidden_size,3*hidden_size)
tar_i2h=origin_i2h.reshape(word_size,3,hidden_size)[:,offset,:]\
.reshape(1,1,word_size,3*hidden_size)
tar_b=origin_b.reshape(3, hidden_size)[offset, :].reshape(1,1,1,3 * hidden_size)
tar_i2h_h2h=np.concatenate([tar_i2h.flatten(),tar_h2h.flatten()])\
.reshape(1,1,1,3*hidden_size*hidden_size+3*word_size*hidden_size)
return tar_i2h_h2h, tar_b
def lstm_fc_tensor_merge_convert(self, origin_hidden_size, origin_lstm_w, origin_lstm_b, origin_fc_w, origin_fc_b):
layer_size = int (origin_hidden_size // 4)
input_size = int (origin_fc_w.size // origin_hidden_size)
lstm_bias_num = int (origin_lstm_b.size // layer_size)
tar_w = np.vstack((np.hstack((origin_fc_w[:, 1 * layer_size : 2 * layer_size],
origin_fc_w[:, 2 * layer_size : 3 * layer_size],
origin_fc_w[:, : 1 * layer_size],
origin_fc_w[:, 3 * layer_size :])),
np.hstack((origin_lstm_w[:, 1 * layer_size : 2 * layer_size],
origin_lstm_w[:, 2 * layer_size : 3 * layer_size],
origin_lstm_w[:, : 1 * layer_size],
origin_lstm_w[:, 3 * layer_size : ]))))
if origin_fc_b is not None:
split_fc_bc = origin_fc_b.flatten()[: 1 * layer_size]
split_fc_bi = origin_fc_b.flatten()[1 * layer_size : 2 * layer_size]
split_fc_bf = origin_fc_b.flatten()[2 * layer_size : 3 * layer_size]
split_fc_bo = origin_fc_b.flatten()[3 * layer_size : 4 * layer_size]
else:
split_fc_bc = np.zeros(layer_size)
split_fc_bi = np.zeros(layer_size)
split_fc_bf = np.zeros(layer_size)
split_fc_bo = np.zeros(layer_size)
split_lstm_bc = origin_lstm_b.flatten()[: 1 * layer_size]
split_lstm_bi = origin_lstm_b.flatten()[1 * layer_size: 2 * layer_size]
split_lstm_bf = origin_lstm_b.flatten()[2 * layer_size: 3 * layer_size]
split_lstm_bo = origin_lstm_b.flatten()[3 * layer_size: 4 * layer_size]
split_lstm_bc = np.add(split_lstm_bc, split_fc_bc)
split_lstm_bi = np.add(split_lstm_bi, split_fc_bi)
split_lstm_bf = np.add(split_lstm_bf, split_fc_bf)
split_lstm_bo = np.add(split_lstm_bo, split_fc_bo)
if lstm_bias_num == 4:
tar_b = np.array(split_lstm_bi.flatten().tolist()
+ split_lstm_bf.flatten().tolist()
+ split_lstm_bc.flatten().tolist()
+ split_lstm_bo.flatten().tolist())
else:
split_lstm_wic = origin_lstm_b.flatten()[4 * layer_size : 5 * layer_size]
split_lstm_wfc = origin_lstm_b.flatten()[5 * layer_size : 6 * layer_size]
split_lstm_woc = origin_lstm_b.flatten()[6 * layer_size :]
tar_b = np.array(split_lstm_bi.flatten().tolist()
+ split_lstm_bf.flatten().tolist()
+ split_lstm_bc.flatten().tolist()
+ split_lstm_bo.flatten().tolist()
+ split_lstm_wic.flatten().tolist()
+ split_lstm_wfc.flatten().tolist()
+ split_lstm_woc.flatten().tolist())
return tar_w.reshape(input_size+ layer_size, 4 * layer_size, 1, 1),\
tar_b.reshape(1, origin_lstm_b.size, 1, 1)
class Fluid_comparator:
def __init__(self, helper):
self.helper = helper
self.only_list = ['feed', 'fetch']
def compare_by_param(self, op_a, op_b, param):
is_weight_a = self.helper.is_persistable_param(op_a, param)
is_weight_b = self.helper.is_persistable_param(op_b, param)
if is_weight_a and is_weight_b:
np_a = self.helper.np_param(op_a, param)
np_b = self.helper.np_param(op_b, param)
if (np_a == np_b).all() == True:
return True
else:
return False
elif is_weight_a is is_weight_b:
return True
else:
return False
def have_same_weights(self, op_a, op_b):
is_same = True
if op_a.input_names == op_b.input_names:
params = op_a.input_names
for param in params:
if self.compare_by_param(op_a, op_b, param) is False:
is_same = False
return is_same
else:
return False
def compare_by_attr(self, op_a, op_b, attr_name):
data_a = self.helper.attr_data(op_a, attr_name)
data_b = self.helper.attr_data(op_b, attr_name)
return data_a == data_b
def have_same_attrs(self, op_a, op_b):
is_same = True
if op_a.attr_names == op_b.attr_names:
attrs = op_a.attr_names
for attr in attrs:
if self.compare_by_attr(op_a, op_b, attr) is False:
is_same = False
return is_same
else:
return False
def brothers(self, op_list):
is_same = True
if len(op_list) > 1:
idx = 0
for op_b in op_list[1:]:
if op_b.type not in self.only_list:
idx = op_list.index(op_b)
op_a = op_list[idx - 1]
if op_a.type not in self.only_list:
same_weights = self.have_same_weights(op_a, op_b)
same_attrs = self.have_same_attrs(op_a, op_b)
if (same_weights and same_attrs) is False:
is_same = False
else:
raise NameError('ERROR: %s is in only_list.' % ( op_a.type ))
else:
raise NameError('ERROR: %s is in only_list.' % ( op_b.type ))
return is_same
else:
raise NameError('ERROR: Members of op_list must be greater than 2.')
ANAKIN_TENSOR_DTYPE = {
VarDesc.VarType.BOOL: BOOLEN,
VarDesc.VarType.INT32: INT32,
VarDesc.VarType.FP16: FLOAT16,
VarDesc.VarType.FP32: FLOAT,
VarDesc.VarType.FP64: DOUBLE,
}
ANAKIN_TENSOR_DTYPESTR = {
STR: "string",
INT32: "int",
FLOAT: "float",
BOOLEN: "bool",
}
ANAKIN_ATTR_DTYPE = {
AttrType.INT: INT32,
AttrType.INTS: INT32,
AttrType.FLOAT: FLOAT,
AttrType.FLOATS: FLOAT,
AttrType.STRING: STR,
AttrType.STRINGS: STR,
AttrType.BOOL: BOOLEN,
AttrType.BOOLS: BOOLEN,
}
ANAKIN_ATTR_IS_LIST = {
AttrType.INT: False,
AttrType.INTS: True,
AttrType.FLOAT: False,
AttrType.FLOATS: True,
AttrType.STRING: False,
AttrType.STRINGS: True,
AttrType.BOOL: False,
AttrType.BOOLS: True,
}
APPEND_BIAS_OP_TYPE = [
'FC',
'mul',
'sequence_conv',
'conv2d',
'conv2d_transpose',
'depthwise_conv2d',
'elementwise_mul',
]
APPEND_ACT_OP_TYPE = [
'FC',
'mul',
'sequence_conv',
'conv2d',
'conv2d_transpose',
'batch_norm',
'layer_norm',
'row_conv',
'reshape',
]
| true | true |
f702a16a4c7e987eab3c8054b87c6ed9a6452980 | 10,100 | py | Python | myven/lib/python3.8/site-packages/ansible/modules/cloud/vmware/vcenter_folder.py | baltham/dne-dna-code | 4a13309a790a670d2f07e635c9264a0c29976c6a | [
"MIT"
] | 1 | 2021-04-02T08:08:39.000Z | 2021-04-02T08:08:39.000Z | myven/lib/python3.8/site-packages/ansible/modules/cloud/vmware/vcenter_folder.py | baltham/dne-dna-code | 4a13309a790a670d2f07e635c9264a0c29976c6a | [
"MIT"
] | null | null | null | myven/lib/python3.8/site-packages/ansible/modules/cloud/vmware/vcenter_folder.py | baltham/dne-dna-code | 4a13309a790a670d2f07e635c9264a0c29976c6a | [
"MIT"
] | 1 | 2020-05-03T01:13:16.000Z | 2020-05-03T01:13:16.000Z | #!/usr/bin/python
# -*- coding: utf-8 -*-
# Copyright: (c) 2018, Abhijeet Kasurde <akasurde@redhat.com>
# GNU General Public License v3.0+ (see COPYING or https://www.gnu.org/licenses/gpl-3.0.txt)
from __future__ import absolute_import, division, print_function
__metaclass__ = type
ANSIBLE_METADATA = {
'metadata_version': '1.1',
'status': ['preview'],
'supported_by': 'community'
}
DOCUMENTATION = r'''
---
module: vcenter_folder
short_description: Manage folders on given datacenter
description:
- This module can be used to create, delete, move and rename folder on then given datacenter.
version_added: '2.5'
author:
- Abhijeet Kasurde (@akasurde)
notes:
- Tested on vSphere 6.5
requirements:
- python >= 2.6
- PyVmomi
options:
datacenter:
description:
- Name of the datacenter.
required: True
folder_name:
description:
- Name of folder to be managed.
- This is case sensitive parameter.
- Folder name should be under 80 characters. This is a VMware restriction.
required: True
parent_folder:
description:
- Name of the parent folder under which new folder needs to be created.
- This is case sensitive parameter.
- Please specify unique folder name as there is no way to detect duplicate names.
- "If user wants to create a folder under '/DC0/vm/vm_folder', this value will be 'vm_folder'."
required: False
folder_type:
description:
- This is type of folder.
- "If set to C(vm), then 'VM and Template Folder' is created under datacenter."
- "If set to C(host), then 'Host and Cluster Folder' is created under datacenter."
- "If set to C(datastore), then 'Storage Folder' is created under datacenter."
- "If set to C(network), then 'Network Folder' is created under datacenter."
- This parameter is required, if C(state) is set to C(present) and parent_folder is absent.
- This option is ignored, if C(parent_folder) is set.
default: vm
required: False
choices: [ datastore, host, network, vm ]
state:
description:
- State of folder.
- If set to C(present) without parent folder parameter, then folder with C(folder_type) is created.
- If set to C(present) with parent folder parameter, then folder in created under parent folder. C(folder_type) is ignored.
- If set to C(absent), then folder is unregistered and destroyed.
default: present
choices: [ present, absent ]
extends_documentation_fragment: vmware.documentation
'''
EXAMPLES = r'''
- name: Create a VM folder on given datacenter
vcenter_folder:
hostname: '{{ vcenter_hostname }}'
username: '{{ vcenter_username }}'
password: '{{ vcenter_password }}'
datacenter: datacenter_name
folder_name: sample_vm_folder
folder_type: vm
state: present
register: vm_folder_creation_result
- name: Create a datastore folder on given datacenter
vcenter_folder:
hostname: '{{ vcenter_hostname }}'
username: '{{ vcenter_username }}'
password: '{{ vcenter_password }}'
datacenter: datacenter_name
folder_name: sample_datastore_folder
folder_type: datastore
state: present
register: datastore_folder_creation_result
- name: Create a sub folder under VM folder on given datacenter
vcenter_folder:
hostname: '{{ vcenter_hostname }}'
username: '{{ vcenter_username }}'
password: '{{ vcenter_password }}'
datacenter: datacenter_name
folder_name: sample_sub_folder
parent_folder: vm_folder
state: present
register: sub_folder_creation_result
- name: Delete a VM folder on given datacenter
vcenter_folder:
hostname: '{{ vcenter_hostname }}'
username: '{{ vcenter_username }}'
password: '{{ vcenter_password }}'
datacenter: datacenter_name
folder_name: sample_vm_folder
folder_type: vm
state: absent
register: vm_folder_deletion_result
'''
RETURN = r'''
result:
description:
- string stating about result
returned: success
type: string
sample: "Folder 'sub_network_folder' of type 'vm' created under vm_folder successfully."
'''
try:
from pyVmomi import vim, vmodl
except ImportError as e:
pass
from ansible.module_utils.basic import AnsibleModule
from ansible.module_utils.vmware import vmware_argument_spec, PyVmomi, find_datacenter_by_name, wait_for_task, get_all_objs
from ansible.module_utils._text import to_native
class VmwareFolderManager(PyVmomi):
def __init__(self, module):
super(VmwareFolderManager, self).__init__(module)
datacenter_name = self.params.get('datacenter', None)
self.datacenter_obj = find_datacenter_by_name(self.content, datacenter_name=datacenter_name)
if self.datacenter_obj is None:
self.module.fail_json(msg="Failed to find datacenter %s" % datacenter_name)
def ensure(self):
"""
Function to manage internal state management
Returns:
"""
state = self.module.params.get('state')
folder_type = self.module.params.get('folder_type')
folder_name = self.module.params.get('folder_name')
parent_folder = self.module.params.get('parent_folder', None)
results = dict(changed=False, result=dict())
if state == 'present':
# Create a new folder
try:
if parent_folder:
folder = self.get_folder_by_name(folder_name=parent_folder)
if folder:
folder.CreateFolder(folder_name)
results['changed'] = True
results['result'] = "Folder '%s' of type '%s' created under %s" \
" successfully." % (folder_name, folder_type, parent_folder)
else:
self.module.fail_json(msg="Failed to find the parent folder %s"
" for folder %s" % (parent_folder, folder_name))
else:
datacenter_folder_type = {
'vm': self.datacenter_obj.vmFolder,
'host': self.datacenter_obj.hostFolder,
'datastore': self.datacenter_obj.datastoreFolder,
'network': self.datacenter_obj.networkFolder,
}
datacenter_folder_type[folder_type].CreateFolder(folder_name)
results['changed'] = True
results['result'] = "Folder '%s' of type '%s' created successfully" % (folder_name, folder_type)
except vim.fault.DuplicateName as duplicate_name:
# To be consistent with the other vmware modules, We decided to accept this error
# and the playbook should simply carry on with other tasks.
# User will have to take care of this exception
# https://github.com/ansible/ansible/issues/35388#issuecomment-362283078
results['changed'] = False
results['result'] = "Failed to create folder as another object has same name" \
" in the same target folder : %s" % to_native(duplicate_name.msg)
except vim.fault.InvalidName as invalid_name:
self.module.fail_json(msg="Failed to create folder as folder name is not a valid "
"entity name : %s" % to_native(invalid_name.msg))
except Exception as general_exc:
self.module.fail_json(msg="Failed to create folder due to generic"
" exception : %s " % to_native(general_exc))
self.module.exit_json(**results)
elif state == 'absent':
folder_obj = self.get_folder_by_name(folder_name=folder_name)
if folder_obj:
try:
task = folder_obj.UnregisterAndDestroy()
results['changed'], results['result'] = wait_for_task(task=task)
except vim.fault.ConcurrentAccess as concurrent_access:
self.module.fail_json(msg="Failed to remove folder as another client"
" modified folder before this operation : %s" % to_native(concurrent_access.msg))
except vim.fault.InvalidState as invalid_state:
self.module.fail_json(msg="Failed to remove folder as folder is in"
" invalid state" % to_native(invalid_state.msg))
except Exception as e:
self.module.fail_json(msg="Failed to remove folder due to generic"
" exception %s " % to_native(e))
self.module.exit_json(**results)
def get_folder_by_name(self, folder_name):
"""
Function to get managed object of folder by name
Returns: Managed object of folder by name
"""
folder_objs = get_all_objs(self.content, [vim.Folder])
for folder in folder_objs:
if folder.name == folder_name:
return folder
return None
def main():
argument_spec = vmware_argument_spec()
argument_spec.update(
datacenter=dict(type='str', required=True),
folder_name=dict(type='str', required=True),
parent_folder=dict(type='str', required=False),
state=dict(type='str',
choices=['present', 'absent'],
default='present'),
folder_type=dict(type='str',
default='vm',
choices=['datastore', 'host', 'network', 'vm'],
required=False),
)
module = AnsibleModule(
argument_spec=argument_spec,
supports_check_mode=False,
)
if len(module.params.get('folder_name')) > 79:
module.fail_json(msg="Failed to manage folder as folder_name can only contain 80 characters.")
vcenter_folder_mgr = VmwareFolderManager(module)
vcenter_folder_mgr.ensure()
if __name__ == "__main__":
main()
| 39.76378 | 128 | 0.629307 |
from __future__ import absolute_import, division, print_function
__metaclass__ = type
ANSIBLE_METADATA = {
'metadata_version': '1.1',
'status': ['preview'],
'supported_by': 'community'
}
DOCUMENTATION = r'''
---
module: vcenter_folder
short_description: Manage folders on given datacenter
description:
- This module can be used to create, delete, move and rename folder on then given datacenter.
version_added: '2.5'
author:
- Abhijeet Kasurde (@akasurde)
notes:
- Tested on vSphere 6.5
requirements:
- python >= 2.6
- PyVmomi
options:
datacenter:
description:
- Name of the datacenter.
required: True
folder_name:
description:
- Name of folder to be managed.
- This is case sensitive parameter.
- Folder name should be under 80 characters. This is a VMware restriction.
required: True
parent_folder:
description:
- Name of the parent folder under which new folder needs to be created.
- This is case sensitive parameter.
- Please specify unique folder name as there is no way to detect duplicate names.
- "If user wants to create a folder under '/DC0/vm/vm_folder', this value will be 'vm_folder'."
required: False
folder_type:
description:
- This is type of folder.
- "If set to C(vm), then 'VM and Template Folder' is created under datacenter."
- "If set to C(host), then 'Host and Cluster Folder' is created under datacenter."
- "If set to C(datastore), then 'Storage Folder' is created under datacenter."
- "If set to C(network), then 'Network Folder' is created under datacenter."
- This parameter is required, if C(state) is set to C(present) and parent_folder is absent.
- This option is ignored, if C(parent_folder) is set.
default: vm
required: False
choices: [ datastore, host, network, vm ]
state:
description:
- State of folder.
- If set to C(present) without parent folder parameter, then folder with C(folder_type) is created.
- If set to C(present) with parent folder parameter, then folder in created under parent folder. C(folder_type) is ignored.
- If set to C(absent), then folder is unregistered and destroyed.
default: present
choices: [ present, absent ]
extends_documentation_fragment: vmware.documentation
'''
EXAMPLES = r'''
- name: Create a VM folder on given datacenter
vcenter_folder:
hostname: '{{ vcenter_hostname }}'
username: '{{ vcenter_username }}'
password: '{{ vcenter_password }}'
datacenter: datacenter_name
folder_name: sample_vm_folder
folder_type: vm
state: present
register: vm_folder_creation_result
- name: Create a datastore folder on given datacenter
vcenter_folder:
hostname: '{{ vcenter_hostname }}'
username: '{{ vcenter_username }}'
password: '{{ vcenter_password }}'
datacenter: datacenter_name
folder_name: sample_datastore_folder
folder_type: datastore
state: present
register: datastore_folder_creation_result
- name: Create a sub folder under VM folder on given datacenter
vcenter_folder:
hostname: '{{ vcenter_hostname }}'
username: '{{ vcenter_username }}'
password: '{{ vcenter_password }}'
datacenter: datacenter_name
folder_name: sample_sub_folder
parent_folder: vm_folder
state: present
register: sub_folder_creation_result
- name: Delete a VM folder on given datacenter
vcenter_folder:
hostname: '{{ vcenter_hostname }}'
username: '{{ vcenter_username }}'
password: '{{ vcenter_password }}'
datacenter: datacenter_name
folder_name: sample_vm_folder
folder_type: vm
state: absent
register: vm_folder_deletion_result
'''
RETURN = r'''
result:
description:
- string stating about result
returned: success
type: string
sample: "Folder 'sub_network_folder' of type 'vm' created under vm_folder successfully."
'''
try:
from pyVmomi import vim, vmodl
except ImportError as e:
pass
from ansible.module_utils.basic import AnsibleModule
from ansible.module_utils.vmware import vmware_argument_spec, PyVmomi, find_datacenter_by_name, wait_for_task, get_all_objs
from ansible.module_utils._text import to_native
class VmwareFolderManager(PyVmomi):
def __init__(self, module):
super(VmwareFolderManager, self).__init__(module)
datacenter_name = self.params.get('datacenter', None)
self.datacenter_obj = find_datacenter_by_name(self.content, datacenter_name=datacenter_name)
if self.datacenter_obj is None:
self.module.fail_json(msg="Failed to find datacenter %s" % datacenter_name)
def ensure(self):
state = self.module.params.get('state')
folder_type = self.module.params.get('folder_type')
folder_name = self.module.params.get('folder_name')
parent_folder = self.module.params.get('parent_folder', None)
results = dict(changed=False, result=dict())
if state == 'present':
try:
if parent_folder:
folder = self.get_folder_by_name(folder_name=parent_folder)
if folder:
folder.CreateFolder(folder_name)
results['changed'] = True
results['result'] = "Folder '%s' of type '%s' created under %s" \
" successfully." % (folder_name, folder_type, parent_folder)
else:
self.module.fail_json(msg="Failed to find the parent folder %s"
" for folder %s" % (parent_folder, folder_name))
else:
datacenter_folder_type = {
'vm': self.datacenter_obj.vmFolder,
'host': self.datacenter_obj.hostFolder,
'datastore': self.datacenter_obj.datastoreFolder,
'network': self.datacenter_obj.networkFolder,
}
datacenter_folder_type[folder_type].CreateFolder(folder_name)
results['changed'] = True
results['result'] = "Folder '%s' of type '%s' created successfully" % (folder_name, folder_type)
except vim.fault.DuplicateName as duplicate_name:
s['changed'] = False
results['result'] = "Failed to create folder as another object has same name" \
" in the same target folder : %s" % to_native(duplicate_name.msg)
except vim.fault.InvalidName as invalid_name:
self.module.fail_json(msg="Failed to create folder as folder name is not a valid "
"entity name : %s" % to_native(invalid_name.msg))
except Exception as general_exc:
self.module.fail_json(msg="Failed to create folder due to generic"
" exception : %s " % to_native(general_exc))
self.module.exit_json(**results)
elif state == 'absent':
folder_obj = self.get_folder_by_name(folder_name=folder_name)
if folder_obj:
try:
task = folder_obj.UnregisterAndDestroy()
results['changed'], results['result'] = wait_for_task(task=task)
except vim.fault.ConcurrentAccess as concurrent_access:
self.module.fail_json(msg="Failed to remove folder as another client"
" modified folder before this operation : %s" % to_native(concurrent_access.msg))
except vim.fault.InvalidState as invalid_state:
self.module.fail_json(msg="Failed to remove folder as folder is in"
" invalid state" % to_native(invalid_state.msg))
except Exception as e:
self.module.fail_json(msg="Failed to remove folder due to generic"
" exception %s " % to_native(e))
self.module.exit_json(**results)
def get_folder_by_name(self, folder_name):
folder_objs = get_all_objs(self.content, [vim.Folder])
for folder in folder_objs:
if folder.name == folder_name:
return folder
return None
def main():
argument_spec = vmware_argument_spec()
argument_spec.update(
datacenter=dict(type='str', required=True),
folder_name=dict(type='str', required=True),
parent_folder=dict(type='str', required=False),
state=dict(type='str',
choices=['present', 'absent'],
default='present'),
folder_type=dict(type='str',
default='vm',
choices=['datastore', 'host', 'network', 'vm'],
required=False),
)
module = AnsibleModule(
argument_spec=argument_spec,
supports_check_mode=False,
)
if len(module.params.get('folder_name')) > 79:
module.fail_json(msg="Failed to manage folder as folder_name can only contain 80 characters.")
vcenter_folder_mgr = VmwareFolderManager(module)
vcenter_folder_mgr.ensure()
if __name__ == "__main__":
main()
| true | true |
f702a18d54a46af8e2dc11e1153545101f920c8d | 10,971 | py | Python | disturbance/components/approvals/email.py | KellyThomas/disturbance | d2096d39a199dc615b430dc43b1d0e05fab4c35f | [
"Apache-2.0"
] | null | null | null | disturbance/components/approvals/email.py | KellyThomas/disturbance | d2096d39a199dc615b430dc43b1d0e05fab4c35f | [
"Apache-2.0"
] | null | null | null | disturbance/components/approvals/email.py | KellyThomas/disturbance | d2096d39a199dc615b430dc43b1d0e05fab4c35f | [
"Apache-2.0"
] | null | null | null | import logging
from django.core.mail import EmailMultiAlternatives, EmailMessage
from django.utils.encoding import smart_text
from django.core.urlresolvers import reverse
from django.conf import settings
from disturbance.components.emails.emails import TemplateEmailBase
from ledger.accounts.models import EmailUser
logger = logging.getLogger(__name__)
SYSTEM_NAME = settings.SYSTEM_NAME_SHORT + ' Automated Message'
class ApprovalExpireNotificationEmail(TemplateEmailBase):
subject = 'Your Approval has expired.'
html_template = 'disturbance/emails/approval_expire_notification.html'
txt_template = 'disturbance/emails/approval_expire_notification.txt'
class ApprovalCancelNotificationEmail(TemplateEmailBase):
subject = 'Your Approval has been cancelled.'
html_template = 'disturbance/emails/approval_cancel_notification.html'
txt_template = 'disturbance/emails/approval_cancel_notification.txt'
class ApprovalSuspendNotificationEmail(TemplateEmailBase):
subject = 'Your Approval has been suspended.'
html_template = 'disturbance/emails/approval_suspend_notification.html'
txt_template = 'disturbance/emails/approval_suspend_notification.txt'
class ApprovalSurrenderNotificationEmail(TemplateEmailBase):
subject = 'Your Approval has been surrendered.'
html_template = 'disturbance/emails/approval_surrender_notification.html'
txt_template = 'disturbance/emails/approval_surrender_notification.txt'
class ApprovalReinstateNotificationEmail(TemplateEmailBase):
subject = 'Your Approval has been reinstated.'
html_template = 'disturbance/emails/approval_reinstate_notification.html'
txt_template = 'disturbance/emails/approval_reinstate_notification.txt'
class ApprovalRenewalNotificationEmail(TemplateEmailBase):
subject = 'Your Approval is due for renewal.'
html_template = 'disturbance/emails/approval_renewal_notification.html'
txt_template = 'disturbance/emails/approval_renewal_notification.txt'
def send_approval_expire_email_notification(approval):
email = ApprovalExpireNotificationEmail()
proposal = approval.current_proposal
context = {
'approval': approval,
'proposal': proposal
}
all_ccs = []
if proposal.applicant.email:
cc_list = proposal.applicant.email
if cc_list:
all_ccs = [cc_list]
msg = email.send(proposal.submitter.email,cc=all_ccs, context=context)
sender = settings.DEFAULT_FROM_EMAIL
try:
sender_user = EmailUser.objects.get(email__icontains=sender)
except:
EmailUser.objects.create(email=sender, password='')
sender_user = EmailUser.objects.get(email__icontains=sender)
_log_approval_email(msg, approval, sender=sender_user)
_log_org_email(msg, proposal.applicant, proposal.submitter, sender=sender_user)
def send_approval_cancel_email_notification(approval, future_cancel=False):
email = ApprovalCancelNotificationEmail()
proposal = approval.current_proposal
context = {
'approval': approval,
'future_cancel': future_cancel
}
all_ccs = []
if proposal.applicant.email:
cc_list = proposal.applicant.email
if cc_list:
all_ccs = [cc_list]
sender = settings.DEFAULT_FROM_EMAIL
try:
sender_user = EmailUser.objects.get(email__icontains=sender)
except:
EmailUser.objects.create(email=sender, password='')
sender_user = EmailUser.objects.get(email__icontains=sender)
msg = email.send(proposal.submitter.email, cc=all_ccs, context=context)
sender = settings.DEFAULT_FROM_EMAIL
_log_approval_email(msg, approval, sender=sender_user)
_log_org_email(msg, proposal.applicant, proposal.submitter, sender=sender_user)
def send_approval_suspend_email_notification(approval, future_suspend=False):
email = ApprovalSuspendNotificationEmail()
proposal = approval.current_proposal
context = {
'approval': approval,
'details': approval.suspension_details['details'],
'from_date': approval.suspension_details['from_date'],
'to_date': approval.suspension_details['to_date'],
'future_suspend': future_suspend
}
all_ccs = []
if proposal.applicant.email:
cc_list = proposal.applicant.email
if cc_list:
all_ccs = [cc_list]
sender = settings.DEFAULT_FROM_EMAIL
try:
sender_user = EmailUser.objects.get(email__icontains=sender)
except:
EmailUser.objects.create(email=sender, password='')
sender_user = EmailUser.objects.get(email__icontains=sender)
msg = email.send(proposal.submitter.email, cc=all_ccs, context=context)
sender = settings.DEFAULT_FROM_EMAIL
_log_approval_email(msg, approval, sender=sender_user)
_log_org_email(msg, proposal.applicant, proposal.submitter, sender=sender_user)
def send_approval_surrender_email_notification(approval, future_surrender=False):
email = ApprovalSurrenderNotificationEmail()
proposal = approval.current_proposal
context = {
'approval': approval,
'details': approval.surrender_details['details'],
'surrender_date': approval.surrender_details['surrender_date'],
'future_surrender': future_surrender
}
all_ccs = []
if proposal.applicant.email:
cc_list = proposal.applicant.email
if cc_list:
all_ccs = [cc_list]
sender = settings.DEFAULT_FROM_EMAIL
try:
sender_user = EmailUser.objects.get(email__icontains=sender)
except:
EmailUser.objects.create(email=sender, password='')
sender_user = EmailUser.objects.get(email__icontains=sender)
msg = email.send(proposal.submitter.email, cc=all_ccs, context=context)
_log_approval_email(msg, approval, sender=sender_user)
_log_org_email(msg, proposal.applicant, proposal.submitter, sender=sender_user)
#approval renewal notice
def send_approval_renewal_email_notification(approval):
email = ApprovalRenewalNotificationEmail()
proposal = approval.current_proposal
context = {
'approval': approval,
'proposal': approval.current_proposal
}
all_ccs = []
if proposal.applicant.email:
cc_list = proposal.applicant.email
if cc_list:
all_ccs = [cc_list]
sender = settings.DEFAULT_FROM_EMAIL
try:
sender_user = EmailUser.objects.get(email__icontains=sender)
except:
EmailUser.objects.create(email=sender, password='')
sender_user = EmailUser.objects.get(email__icontains=sender)
#attach renewal notice
renewal_document= approval.renewal_document._file
if renewal_document is not None:
file_name = approval.renewal_document.name
attachment = (file_name, renewal_document.file.read(), 'application/pdf')
attachment = [attachment]
else:
attachment = []
msg = email.send(proposal.submitter.email, cc=all_ccs, attachments=attachment, context=context)
sender = settings.DEFAULT_FROM_EMAIL
_log_approval_email(msg, approval, sender=sender_user)
_log_org_email(msg, proposal.applicant, proposal.submitter, sender=sender_user)
def send_approval_reinstate_email_notification(approval, request):
email = ApprovalReinstateNotificationEmail()
proposal = approval.current_proposal
context = {
'approval': approval,
}
all_ccs = []
if proposal.applicant.email:
cc_list = proposal.applicant.email
if cc_list:
all_ccs = [cc_list]
msg = email.send(proposal.submitter.email,cc=all_ccs, context=context)
sender = request.user if request else settings.DEFAULT_FROM_EMAIL
_log_approval_email(msg, approval, sender=sender)
_log_org_email(msg, proposal.applicant, proposal.submitter, sender=sender)
def _log_approval_email(email_message, approval, sender=None):
from disturbance.components.approvals.models import ApprovalLogEntry
if isinstance(email_message, (EmailMultiAlternatives, EmailMessage,)):
# TODO this will log the plain text body, should we log the html instead
text = email_message.body
subject = email_message.subject
fromm = smart_text(sender) if sender else smart_text(email_message.from_email)
# the to email is normally a list
if isinstance(email_message.to, list):
to = ','.join(email_message.to)
else:
to = smart_text(email_message.to)
# we log the cc and bcc in the same cc field of the log entry as a ',' comma separated string
all_ccs = []
if email_message.cc:
all_ccs += list(email_message.cc)
if email_message.bcc:
all_ccs += list(email_message.bcc)
all_ccs = ','.join(all_ccs)
else:
text = smart_text(email_message)
subject = ''
to = approval.current_proposal.submitter.email
fromm = smart_text(sender) if sender else SYSTEM_NAME
all_ccs = ''
customer = approval.current_proposal.submitter
staff = sender
kwargs = {
'subject': subject,
'text': text,
'approval': approval,
'customer': customer,
'staff': staff,
'to': to,
'fromm': fromm,
'cc': all_ccs
}
email_entry = ApprovalLogEntry.objects.create(**kwargs)
return email_entry
def _log_org_email(email_message, organisation, customer ,sender=None):
from disturbance.components.organisations.models import OrganisationLogEntry
if isinstance(email_message, (EmailMultiAlternatives, EmailMessage,)):
# TODO this will log the plain text body, should we log the html instead
text = email_message.body
subject = email_message.subject
fromm = smart_text(sender) if sender else smart_text(email_message.from_email)
# the to email is normally a list
if isinstance(email_message.to, list):
to = ','.join(email_message.to)
else:
to = smart_text(email_message.to)
# we log the cc and bcc in the same cc field of the log entry as a ',' comma separated string
all_ccs = []
if email_message.cc:
all_ccs += list(email_message.cc)
if email_message.bcc:
all_ccs += list(email_message.bcc)
all_ccs = ','.join(all_ccs)
else:
text = smart_text(email_message)
subject = ''
to = customer
fromm = smart_text(sender) if sender else SYSTEM_NAME
all_ccs = ''
customer = customer
staff = sender
kwargs = {
'subject': subject,
'text': text,
'organisation': organisation,
'customer': customer,
'staff': staff,
'to': to,
'fromm': fromm,
'cc': all_ccs
}
email_entry = OrganisationLogEntry.objects.create(**kwargs)
return email_entry
| 35.970492 | 101 | 0.700939 | import logging
from django.core.mail import EmailMultiAlternatives, EmailMessage
from django.utils.encoding import smart_text
from django.core.urlresolvers import reverse
from django.conf import settings
from disturbance.components.emails.emails import TemplateEmailBase
from ledger.accounts.models import EmailUser
logger = logging.getLogger(__name__)
SYSTEM_NAME = settings.SYSTEM_NAME_SHORT + ' Automated Message'
class ApprovalExpireNotificationEmail(TemplateEmailBase):
subject = 'Your Approval has expired.'
html_template = 'disturbance/emails/approval_expire_notification.html'
txt_template = 'disturbance/emails/approval_expire_notification.txt'
class ApprovalCancelNotificationEmail(TemplateEmailBase):
subject = 'Your Approval has been cancelled.'
html_template = 'disturbance/emails/approval_cancel_notification.html'
txt_template = 'disturbance/emails/approval_cancel_notification.txt'
class ApprovalSuspendNotificationEmail(TemplateEmailBase):
subject = 'Your Approval has been suspended.'
html_template = 'disturbance/emails/approval_suspend_notification.html'
txt_template = 'disturbance/emails/approval_suspend_notification.txt'
class ApprovalSurrenderNotificationEmail(TemplateEmailBase):
subject = 'Your Approval has been surrendered.'
html_template = 'disturbance/emails/approval_surrender_notification.html'
txt_template = 'disturbance/emails/approval_surrender_notification.txt'
class ApprovalReinstateNotificationEmail(TemplateEmailBase):
subject = 'Your Approval has been reinstated.'
html_template = 'disturbance/emails/approval_reinstate_notification.html'
txt_template = 'disturbance/emails/approval_reinstate_notification.txt'
class ApprovalRenewalNotificationEmail(TemplateEmailBase):
subject = 'Your Approval is due for renewal.'
html_template = 'disturbance/emails/approval_renewal_notification.html'
txt_template = 'disturbance/emails/approval_renewal_notification.txt'
def send_approval_expire_email_notification(approval):
email = ApprovalExpireNotificationEmail()
proposal = approval.current_proposal
context = {
'approval': approval,
'proposal': proposal
}
all_ccs = []
if proposal.applicant.email:
cc_list = proposal.applicant.email
if cc_list:
all_ccs = [cc_list]
msg = email.send(proposal.submitter.email,cc=all_ccs, context=context)
sender = settings.DEFAULT_FROM_EMAIL
try:
sender_user = EmailUser.objects.get(email__icontains=sender)
except:
EmailUser.objects.create(email=sender, password='')
sender_user = EmailUser.objects.get(email__icontains=sender)
_log_approval_email(msg, approval, sender=sender_user)
_log_org_email(msg, proposal.applicant, proposal.submitter, sender=sender_user)
def send_approval_cancel_email_notification(approval, future_cancel=False):
email = ApprovalCancelNotificationEmail()
proposal = approval.current_proposal
context = {
'approval': approval,
'future_cancel': future_cancel
}
all_ccs = []
if proposal.applicant.email:
cc_list = proposal.applicant.email
if cc_list:
all_ccs = [cc_list]
sender = settings.DEFAULT_FROM_EMAIL
try:
sender_user = EmailUser.objects.get(email__icontains=sender)
except:
EmailUser.objects.create(email=sender, password='')
sender_user = EmailUser.objects.get(email__icontains=sender)
msg = email.send(proposal.submitter.email, cc=all_ccs, context=context)
sender = settings.DEFAULT_FROM_EMAIL
_log_approval_email(msg, approval, sender=sender_user)
_log_org_email(msg, proposal.applicant, proposal.submitter, sender=sender_user)
def send_approval_suspend_email_notification(approval, future_suspend=False):
email = ApprovalSuspendNotificationEmail()
proposal = approval.current_proposal
context = {
'approval': approval,
'details': approval.suspension_details['details'],
'from_date': approval.suspension_details['from_date'],
'to_date': approval.suspension_details['to_date'],
'future_suspend': future_suspend
}
all_ccs = []
if proposal.applicant.email:
cc_list = proposal.applicant.email
if cc_list:
all_ccs = [cc_list]
sender = settings.DEFAULT_FROM_EMAIL
try:
sender_user = EmailUser.objects.get(email__icontains=sender)
except:
EmailUser.objects.create(email=sender, password='')
sender_user = EmailUser.objects.get(email__icontains=sender)
msg = email.send(proposal.submitter.email, cc=all_ccs, context=context)
sender = settings.DEFAULT_FROM_EMAIL
_log_approval_email(msg, approval, sender=sender_user)
_log_org_email(msg, proposal.applicant, proposal.submitter, sender=sender_user)
def send_approval_surrender_email_notification(approval, future_surrender=False):
email = ApprovalSurrenderNotificationEmail()
proposal = approval.current_proposal
context = {
'approval': approval,
'details': approval.surrender_details['details'],
'surrender_date': approval.surrender_details['surrender_date'],
'future_surrender': future_surrender
}
all_ccs = []
if proposal.applicant.email:
cc_list = proposal.applicant.email
if cc_list:
all_ccs = [cc_list]
sender = settings.DEFAULT_FROM_EMAIL
try:
sender_user = EmailUser.objects.get(email__icontains=sender)
except:
EmailUser.objects.create(email=sender, password='')
sender_user = EmailUser.objects.get(email__icontains=sender)
msg = email.send(proposal.submitter.email, cc=all_ccs, context=context)
_log_approval_email(msg, approval, sender=sender_user)
_log_org_email(msg, proposal.applicant, proposal.submitter, sender=sender_user)
def send_approval_renewal_email_notification(approval):
email = ApprovalRenewalNotificationEmail()
proposal = approval.current_proposal
context = {
'approval': approval,
'proposal': approval.current_proposal
}
all_ccs = []
if proposal.applicant.email:
cc_list = proposal.applicant.email
if cc_list:
all_ccs = [cc_list]
sender = settings.DEFAULT_FROM_EMAIL
try:
sender_user = EmailUser.objects.get(email__icontains=sender)
except:
EmailUser.objects.create(email=sender, password='')
sender_user = EmailUser.objects.get(email__icontains=sender)
renewal_document= approval.renewal_document._file
if renewal_document is not None:
file_name = approval.renewal_document.name
attachment = (file_name, renewal_document.file.read(), 'application/pdf')
attachment = [attachment]
else:
attachment = []
msg = email.send(proposal.submitter.email, cc=all_ccs, attachments=attachment, context=context)
sender = settings.DEFAULT_FROM_EMAIL
_log_approval_email(msg, approval, sender=sender_user)
_log_org_email(msg, proposal.applicant, proposal.submitter, sender=sender_user)
def send_approval_reinstate_email_notification(approval, request):
email = ApprovalReinstateNotificationEmail()
proposal = approval.current_proposal
context = {
'approval': approval,
}
all_ccs = []
if proposal.applicant.email:
cc_list = proposal.applicant.email
if cc_list:
all_ccs = [cc_list]
msg = email.send(proposal.submitter.email,cc=all_ccs, context=context)
sender = request.user if request else settings.DEFAULT_FROM_EMAIL
_log_approval_email(msg, approval, sender=sender)
_log_org_email(msg, proposal.applicant, proposal.submitter, sender=sender)
def _log_approval_email(email_message, approval, sender=None):
from disturbance.components.approvals.models import ApprovalLogEntry
if isinstance(email_message, (EmailMultiAlternatives, EmailMessage,)):
text = email_message.body
subject = email_message.subject
fromm = smart_text(sender) if sender else smart_text(email_message.from_email)
if isinstance(email_message.to, list):
to = ','.join(email_message.to)
else:
to = smart_text(email_message.to)
all_ccs = []
if email_message.cc:
all_ccs += list(email_message.cc)
if email_message.bcc:
all_ccs += list(email_message.bcc)
all_ccs = ','.join(all_ccs)
else:
text = smart_text(email_message)
subject = ''
to = approval.current_proposal.submitter.email
fromm = smart_text(sender) if sender else SYSTEM_NAME
all_ccs = ''
customer = approval.current_proposal.submitter
staff = sender
kwargs = {
'subject': subject,
'text': text,
'approval': approval,
'customer': customer,
'staff': staff,
'to': to,
'fromm': fromm,
'cc': all_ccs
}
email_entry = ApprovalLogEntry.objects.create(**kwargs)
return email_entry
def _log_org_email(email_message, organisation, customer ,sender=None):
from disturbance.components.organisations.models import OrganisationLogEntry
if isinstance(email_message, (EmailMultiAlternatives, EmailMessage,)):
text = email_message.body
subject = email_message.subject
fromm = smart_text(sender) if sender else smart_text(email_message.from_email)
if isinstance(email_message.to, list):
to = ','.join(email_message.to)
else:
to = smart_text(email_message.to)
all_ccs = []
if email_message.cc:
all_ccs += list(email_message.cc)
if email_message.bcc:
all_ccs += list(email_message.bcc)
all_ccs = ','.join(all_ccs)
else:
text = smart_text(email_message)
subject = ''
to = customer
fromm = smart_text(sender) if sender else SYSTEM_NAME
all_ccs = ''
customer = customer
staff = sender
kwargs = {
'subject': subject,
'text': text,
'organisation': organisation,
'customer': customer,
'staff': staff,
'to': to,
'fromm': fromm,
'cc': all_ccs
}
email_entry = OrganisationLogEntry.objects.create(**kwargs)
return email_entry
| true | true |
f702a1d2e380b80b1174c5cef1e503b3d1000993 | 13,542 | py | Python | etender_service.py | Bodyan37/robot_tests.broker.etender | be35364965d886312e0b6d803f985f2cfc981a94 | [
"Apache-2.0"
] | null | null | null | etender_service.py | Bodyan37/robot_tests.broker.etender | be35364965d886312e0b6d803f985f2cfc981a94 | [
"Apache-2.0"
] | null | null | null | etender_service.py | Bodyan37/robot_tests.broker.etender | be35364965d886312e0b6d803f985f2cfc981a94 | [
"Apache-2.0"
] | null | null | null | # -*- coding: utf-8 -
from iso8601 import parse_date
from datetime import datetime, date, time, timedelta
import dateutil.parser
from pytz import timezone
import os
from decimal import Decimal
import re
TZ = timezone(os.environ['TZ'] if 'TZ' in os.environ else 'Europe/Kiev')
def get_all_etender_dates(initial_tender_data):
tender_period = initial_tender_data.tenderPeriod
start_dt = dateutil.parser.parse(tender_period['startDate'])
end_dt = dateutil.parser.parse(tender_period['endDate'])
data = type('periods', (), { # dynamically creating objects instead of another dict
'tenderStart': type('date', (), {'date': start_dt.strftime("%d-%m-%Y"),
'time': start_dt.strftime("%H:%M")}),
'tenderEnd': type('date', (), {'date': end_dt.strftime("%d-%m-%Y"),
'time': end_dt.strftime("%H:%M")})})
if 'enquiryPeriod' in initial_tender_data:
end_period = dateutil.parser.parse(initial_tender_data.enquiryPeriod['endDate'])
data.enquiryEnd = type('date', (), {'date': end_period.strftime("%d-%m-%Y"),
'time': end_period.strftime("%H:%M")})
return data
def get_procedure_type(methodType):
return {
'aboveThresholdUA': 'Відкриті торги',
'belowThreshold': 'Допорогові закупівлі',
'negotiation': 'Переговорна процедура',
'aboveThresholdEU': 'Відкриті торги з публікацією англійською мовою',
'aboveThresholdUA.defense': 'Переговорна процедура для потреб оборони',
'reporting': 'Звіт про укладений договір',
'competitiveDialogueEU': 'Конкурентний діалог з публікацією англійською мовою 1-ий етап',
'competitiveDialogueUA': 'Конкурентний діалог 1-ий етап',
'open_esco': 'Відкриті торги для закупівлі енергосервісу',
'esco': 'Відкриті торги для закупівлі енергосервісу',
'closeFrameworkAgreementUA': 'Відкриті торги для укладання рамкової угоди',
'open_framework': 'Відкриті торгии для укладання рамкової угоди'
}[methodType].decode('utf-8')
def get_method_type(procedure_name):
return {
u'переговорна процедура для потреб оборони': 'aboveThresholdUA.defense',
u'допорогові закупівлі': 'belowThreshold',
u'відкриті торги з публікацією англійською мовою': 'aboveThresholdEU',
u'переговорна процедура': 'negotiation',
u'відкриті торги': 'aboveThresholdUA',
u'конкурентний діалог 1-ий етап': 'competitiveDialogueUA',
u'конкурентний діалог 2-ий етап': 'competitiveDialogueUA.stage2',
u'звіт про укладений договір': 'reporting',
u'відкриті торги для закупівлі енергосервісу': 'open_esco',
u'відкриті торги для закупівлі енергосервісу': 'esco',
u'конкурентний діалог з публікацією англійською мовою 1-ий етап': 'competitiveDialogueEU',
u'конкурентний діалог з публікацією англійською мовою 2-ий етап': 'competitiveDialogueEU.stage2',
u'відкриті торги для укладання рамкової угоди': 'closeFrameworkAgreementUA',
u'відкриті торгии для укладання рамкової угоди': 'open_framework'
}[procedure_name]
def parse_etender_date(date, as_string=False):
# converts date from ui to datetime
d = datetime.strptime(date, '%d-%m-%Y, %H:%M')
if as_string:
return str(d)
return d
def cut_letters_and_parse_etender_date(date, as_string=True):
# converts date from ui
d = datetime.strptime(date.split(' ')[1], '%d-%m-%Y')
if as_string:
return str(d)
return d
def prepare_locator_to_scroll(locator):
if locator[:3] == 'id=':
return '//*[@id="{}"]'.format(locator[3:])
return locator[6:].replace("'", '"') # 6 for xpath=
def to_iso(date):
return date.isoformat()
def convert_etender_date_to_iso_format(date):
return TZ.localize(parse_etender_date(date)).isoformat()
def convet_fra_to_variable(raw):
b = re.findall(r'P(\d+)Y(\d+)M(\d+)D.*', raw)
c, d, e = b[0]
return c, d, e
def convet_raw_to_chack(raw):
raw = raw.replace(' ', '')
b = re.findall(r'(\d+)р(\d+)м(\d+)д', raw)
c, d, e = b[0]
return c, d, e
def get_year_from_full_date(string):
data_as_str = string.split('T')[0]
data_as_datetime = datetime.strptime(data_as_str, '%Y-%m-%d')
return str(data_as_datetime.year)
def convert_date_to_etender_format(isodate):
iso_dt = parse_date(isodate)
date_string = iso_dt.strftime("%d-%m-%Y")
return date_string
def convert_datetime_for_delivery(isodate):
iso_dt = parse_date(isodate)
date_string = iso_dt.strftime("%Y-%m-%d %H:%M")
return date_string
def convert_time_to_etender_format(isodate):
iso_dt = parse_date(isodate)
time_string = iso_dt.strftime("%H:%M")
return time_string
def float_to_string_2f(value):
return '{:.2f}'.format(value)
def float_to_string_3f(value):
return '{:.3f}'.format(value)
def string_to_float(string):
return float(string)
def change_data(initial_data):
#TODO: remove redundant hardcoded values
# initial_data['data']['procuringEntity']['identifier']['legalName'] = u"TenderOwner#"
# initial_data['data']['procuringEntity']['identifier']['id'] = u"88008800"
# initial_data['data']['procuringEntity']['name'] = u"TenderOwner#"
initial_data['data']['items'][0]['deliveryAddress']['locality'] = u"м. Київ"
initial_data['data']['items'][0]['deliveryAddress']['region'] = u"Київська область"
initial_data['data']['procuringEntity']['address']['locality'] = u"Алупка"
initial_data['data']['procuringEntity']['address']['postalCode'] = u"13531"
initial_data['data']['procuringEntity']['address']['region'] = u"АР Крим"
initial_data['data']['procuringEntity']['address']['streetAddress'] = u"Фрунзе, 666"
initial_data['data']['procuringEntity']['contactPoint']['name'] = u"Владелец Этого Тендера"
initial_data['data']['procuringEntity']['contactPoint']['telephone'] = u"613371488228"
initial_data['data']['procuringEntity']['contactPoint']['url'] = u"http://e-tender.ua/"
return initial_data
def change_data_for_tender_owner(initial_data):
initial_data['data']['procuringEntity']['identifier']['legalName'] = u"TenderOwner#"
initial_data['data']['procuringEntity']['identifier']['id'] = u"88008800"
initial_data['data']['procuringEntity']['name'] = u"TenderOwner#"
return initial_data
def change_buyers_data(initial_data):
initial_data['data']['buyers'][0]['name'] = u"TenderOwner#"
initial_data['data']['buyers'][0]['identifier']['id'] = u"88008800"
initial_data['data']['buyers'][0]['identifier']['legalName'] = u"TenderOwner#"
initial_data['data']['procuringEntity']['name'] = initial_data['data']['buyers'][0]['name']
initial_data['data']['procuringEntity']['identifier']['id'] = initial_data['data']['buyers'][0]['identifier']['id']
initial_data['data']['procuringEntity']['identifier']['legalName'] = \
initial_data['data']['buyers'][0]['identifier']['legalName']
return initial_data
def convert_etender_date_to_iso_format_and_add_timezone(date):
return TZ.localize(parse_etender_date(date)).isoformat()
def get_time_now():
time_string = datetime.now().strftime("%H:%M")
return time_string
def get_date_now():
date_string = datetime.now().strftime("%d-%m-%Y")
return date_string
def get_date_10d_future():
date_string = (datetime.now() + timedelta(days=10)).strftime("%d-%m-%Y")
return date_string
def get_time_offset(add_minutes=17):
_now = datetime.now() + timedelta(minutes=add_minutes)
return _now.time().strftime('%H:%M')
def convert_common_string_to_etender_string(string):
dict = get_helper_dictionary()
for key, val in dict.iteritems():
if val == string:
return key
return string
def parse_currency_value_with_spaces(raw):
# to convert raw values like '2 216 162,83 UAH' to string which is ready for conversion to float
return ''.join(raw.split(' ')[:-1]).replace(',', '.')
def get_minimalStep_currency(raw_value):
# to get currency 'UAH' from raw values like '2 216 162,83 UAH'
result_dic = raw_value.split(' ')
result = result_dic[-1]
return result
def parse_currency_value_with_spaces_percentage(raw):
# to convert raw values like '1,3244%' to string which is ready for conversion to float
result = raw.replace('%', '')
result = Decimal(result)
result = (result / 100)
result = float(result)
return result
def parse_currency_value_with_spaces_percentage_NBU(raw):
# to convert raw values like 'Hi – 1,3244%' to string which is ready for conversion to float
result = raw.split(' ', 4)[4]
result = result.replace('%', '')
result = Decimal(result)
result = (result / 100)
result = float(result)
return result
def convert_etender_string_to_common_string(string):
return get_helper_dictionary().get(string, string)
def get_helper_dictionary():
return {
u"КЛАСИФІКАТОР ДК 021:2015 (CPV)": u"ДК021",
u"кг.": u"кілограм",
u"грн.": u"UAH",
u"(з ПДВ)": True,
u"з ПДВ": True,
u"без ПДВ": False,
# TODO: remove this temporary workaround, consult with quinta team about input data
u"Дніпро": u"Дніпропетровськ",
#tender statuses
u'період уточнень': u'active.enquiries',
u'очікування пропозицій': u'active.tendering',
u'прекваліфікація': u'active.pre-qualification',
u'оцінка пропозицій': u'active.pre-qualification',
u'блокування перед аукціоном': u'active.pre-qualification.stand-still',
u'проведення переговорів': u'active.pre-qualification.stand-still',
u'перший проміжний етап': u'active.stage2.pending',
u'період аукціону': u'active.auction',
u'кваліфікація переможця': u'active.qualification',
u'пропозиції розглянуто': u'active.awarded',
u'завершена закупівля': u'complete',
u'перший етап завершено': u'complete',
u'закупівля не відбулась': u'unsuccessful',
u'відмінена закупівля': u'cancelled',
#bid statuses
u'Пропозиція не дійсна': u'invalid',
u"ст.35 ч. 2 п. 1": u"artContestIP",
u"ст.35 ч. 2 п. 2": u"noCompetition",
u"ст.35 ч. 2 п. 4": u"twiceUnsuccessful",
u"ст.35 ч. 2 п. 5": u"additionalPurchase",
u"ст.35 ч. 2 п. 6": u"additionalConstruction",
u"ст.35 ч. 2 п. 7": u"stateLegalServices",
u"Договір поки що не опубліковано": u"pending",
u"Договір опубліковано": u"active",
u"Переможець торгів": u"active",
u"учасник виграв закупівлю": u"active",
u'вимога': u'claim',
u'відповідь надана': u'answered',
u'задоволено': u'resolved',
u'не задоволено': u'declined',
u'скасована скаржником': u'cancelled',
u'відхилено': u'invalid',
u'залишена без відповіді': u'ignored',
u'очікується кваліфікація': u'pending',
u'відкликається скаржником': u'stopping',
u'очікує розгляду органом оскарження': u'pending',
u'Співфінансування з бюджетних коштів': u'budget',
u'на розгляді': u'pending',
u'Пропозиція не активована': u'invalid'
}
def get_feature_index(i):
return {0.05: '1',
0.01: '2',
0: '3'}[i]
def get_doc_type_index(i):
return {'financial_documents': '1',
'qualification_documents': '2',
'eligibility_documents': '3'}.get(i, i)
def convert_unit_name_to_unit_code(string):
return {
u"блок": u"D64",
u"гектар": u"HAR",
u"кілограми": u"KGM",
u"кілометри": u"KMT",
u"літр": u"LTR",
u"лот": u"LO",
u"метри квадратні": u"MTK",
u"метри кубічні": u"MTQ",
u"метри": u"MTR",
u"місяць": u"MON",
u"набір": u"SET",
u"пара": u"PR",
u"пачка": u"RM",
u"пачок": u"NMP",
u"послуга": u"E48",
u"рейс": u"E54",
u"тони": u"TNE",
u"упаковка": u"PK",
u"Флакон": u"VI",
u"штуки": u"H87",
u"ящик": u"BX",
}.get(string, string)
def convert_milestone_from_text_to_code(string):
return {
u"Аванс": u"prepayment",
u"Пiсляоплата": u"postpayment"
}.get(string, string)
def convert_milestone_from_text_to_title(string):
return {
u"Виконання робіт": "executionOfWorks",
u"Поставка товару": "deliveryOfGoods",
u"Надання послуг": "submittingServices",
u"Підписання договору": "signingTheContract",
u"Дата подання заявки": "submissionDateOfApplications",
u"Дата виставлення рахунку": "dateOfInvoicing",
u"Дата закінчення звітного періоду": "endDateOfTheReportingPeriod",
u"Інша подія": "anotherEvent",
}.get(string, string)
def convert_milestone_from_text_to_day_type(string):
return {
u"Робочі": "working",
u"Банківські": "banking",
u"Календарні": "calendar"
}.get(string, string)
def convert_main_procurement_category(string):
return {
u"Товари": "goods",
u"Послуги": "services",
u"Роботи": "works"
}.get(string, string)
def get_modulus_from_number(number):
if isinstance(number, int):
pass
elif isinstance(number, str):
number = int(number)
elif isinstance(number, unicode):
number = int(number)
return abs(number)
| 35.920424 | 119 | 0.645326 |
from iso8601 import parse_date
from datetime import datetime, date, time, timedelta
import dateutil.parser
from pytz import timezone
import os
from decimal import Decimal
import re
TZ = timezone(os.environ['TZ'] if 'TZ' in os.environ else 'Europe/Kiev')
def get_all_etender_dates(initial_tender_data):
tender_period = initial_tender_data.tenderPeriod
start_dt = dateutil.parser.parse(tender_period['startDate'])
end_dt = dateutil.parser.parse(tender_period['endDate'])
data = type('periods', (), {
'tenderStart': type('date', (), {'date': start_dt.strftime("%d-%m-%Y"),
'time': start_dt.strftime("%H:%M")}),
'tenderEnd': type('date', (), {'date': end_dt.strftime("%d-%m-%Y"),
'time': end_dt.strftime("%H:%M")})})
if 'enquiryPeriod' in initial_tender_data:
end_period = dateutil.parser.parse(initial_tender_data.enquiryPeriod['endDate'])
data.enquiryEnd = type('date', (), {'date': end_period.strftime("%d-%m-%Y"),
'time': end_period.strftime("%H:%M")})
return data
def get_procedure_type(methodType):
return {
'aboveThresholdUA': 'Відкриті торги',
'belowThreshold': 'Допорогові закупівлі',
'negotiation': 'Переговорна процедура',
'aboveThresholdEU': 'Відкриті торги з публікацією англійською мовою',
'aboveThresholdUA.defense': 'Переговорна процедура для потреб оборони',
'reporting': 'Звіт про укладений договір',
'competitiveDialogueEU': 'Конкурентний діалог з публікацією англійською мовою 1-ий етап',
'competitiveDialogueUA': 'Конкурентний діалог 1-ий етап',
'open_esco': 'Відкриті торги для закупівлі енергосервісу',
'esco': 'Відкриті торги для закупівлі енергосервісу',
'closeFrameworkAgreementUA': 'Відкриті торги для укладання рамкової угоди',
'open_framework': 'Відкриті торгии для укладання рамкової угоди'
}[methodType].decode('utf-8')
def get_method_type(procedure_name):
return {
u'переговорна процедура для потреб оборони': 'aboveThresholdUA.defense',
u'допорогові закупівлі': 'belowThreshold',
u'відкриті торги з публікацією англійською мовою': 'aboveThresholdEU',
u'переговорна процедура': 'negotiation',
u'відкриті торги': 'aboveThresholdUA',
u'конкурентний діалог 1-ий етап': 'competitiveDialogueUA',
u'конкурентний діалог 2-ий етап': 'competitiveDialogueUA.stage2',
u'звіт про укладений договір': 'reporting',
u'відкриті торги для закупівлі енергосервісу': 'open_esco',
u'відкриті торги для закупівлі енергосервісу': 'esco',
u'конкурентний діалог з публікацією англійською мовою 1-ий етап': 'competitiveDialogueEU',
u'конкурентний діалог з публікацією англійською мовою 2-ий етап': 'competitiveDialogueEU.stage2',
u'відкриті торги для укладання рамкової угоди': 'closeFrameworkAgreementUA',
u'відкриті торгии для укладання рамкової угоди': 'open_framework'
}[procedure_name]
def parse_etender_date(date, as_string=False):
d = datetime.strptime(date, '%d-%m-%Y, %H:%M')
if as_string:
return str(d)
return d
def cut_letters_and_parse_etender_date(date, as_string=True):
d = datetime.strptime(date.split(' ')[1], '%d-%m-%Y')
if as_string:
return str(d)
return d
def prepare_locator_to_scroll(locator):
if locator[:3] == 'id=':
return '//*[@id="{}"]'.format(locator[3:])
return locator[6:].replace("'", '"') # 6 for xpath=
def to_iso(date):
return date.isoformat()
def convert_etender_date_to_iso_format(date):
return TZ.localize(parse_etender_date(date)).isoformat()
def convet_fra_to_variable(raw):
b = re.findall(r'P(\d+)Y(\d+)M(\d+)D.*', raw)
c, d, e = b[0]
return c, d, e
def convet_raw_to_chack(raw):
raw = raw.replace(' ', '')
b = re.findall(r'(\d+)р(\d+)м(\d+)д', raw)
c, d, e = b[0]
return c, d, e
def get_year_from_full_date(string):
data_as_str = string.split('T')[0]
data_as_datetime = datetime.strptime(data_as_str, '%Y-%m-%d')
return str(data_as_datetime.year)
def convert_date_to_etender_format(isodate):
iso_dt = parse_date(isodate)
date_string = iso_dt.strftime("%d-%m-%Y")
return date_string
def convert_datetime_for_delivery(isodate):
iso_dt = parse_date(isodate)
date_string = iso_dt.strftime("%Y-%m-%d %H:%M")
return date_string
def convert_time_to_etender_format(isodate):
iso_dt = parse_date(isodate)
time_string = iso_dt.strftime("%H:%M")
return time_string
def float_to_string_2f(value):
return '{:.2f}'.format(value)
def float_to_string_3f(value):
return '{:.3f}'.format(value)
def string_to_float(string):
return float(string)
def change_data(initial_data):
#TODO: remove redundant hardcoded values
# initial_data['data']['procuringEntity']['identifier']['legalName'] = u"TenderOwner#"
# initial_data['data']['procuringEntity']['identifier']['id'] = u"88008800"
# initial_data['data']['procuringEntity']['name'] = u"TenderOwner#"
initial_data['data']['items'][0]['deliveryAddress']['locality'] = u"м. Київ"
initial_data['data']['items'][0]['deliveryAddress']['region'] = u"Київська область"
initial_data['data']['procuringEntity']['address']['locality'] = u"Алупка"
initial_data['data']['procuringEntity']['address']['postalCode'] = u"13531"
initial_data['data']['procuringEntity']['address']['region'] = u"АР Крим"
initial_data['data']['procuringEntity']['address']['streetAddress'] = u"Фрунзе, 666"
initial_data['data']['procuringEntity']['contactPoint']['name'] = u"Владелец Этого Тендера"
initial_data['data']['procuringEntity']['contactPoint']['telephone'] = u"613371488228"
initial_data['data']['procuringEntity']['contactPoint']['url'] = u"http://e-tender.ua/"
return initial_data
def change_data_for_tender_owner(initial_data):
initial_data['data']['procuringEntity']['identifier']['legalName'] = u"TenderOwner#"
initial_data['data']['procuringEntity']['identifier']['id'] = u"88008800"
initial_data['data']['procuringEntity']['name'] = u"TenderOwner#"
return initial_data
def change_buyers_data(initial_data):
initial_data['data']['buyers'][0]['name'] = u"TenderOwner#"
initial_data['data']['buyers'][0]['identifier']['id'] = u"88008800"
initial_data['data']['buyers'][0]['identifier']['legalName'] = u"TenderOwner#"
initial_data['data']['procuringEntity']['name'] = initial_data['data']['buyers'][0]['name']
initial_data['data']['procuringEntity']['identifier']['id'] = initial_data['data']['buyers'][0]['identifier']['id']
initial_data['data']['procuringEntity']['identifier']['legalName'] = \
initial_data['data']['buyers'][0]['identifier']['legalName']
return initial_data
def convert_etender_date_to_iso_format_and_add_timezone(date):
return TZ.localize(parse_etender_date(date)).isoformat()
def get_time_now():
time_string = datetime.now().strftime("%H:%M")
return time_string
def get_date_now():
date_string = datetime.now().strftime("%d-%m-%Y")
return date_string
def get_date_10d_future():
date_string = (datetime.now() + timedelta(days=10)).strftime("%d-%m-%Y")
return date_string
def get_time_offset(add_minutes=17):
_now = datetime.now() + timedelta(minutes=add_minutes)
return _now.time().strftime('%H:%M')
def convert_common_string_to_etender_string(string):
dict = get_helper_dictionary()
for key, val in dict.iteritems():
if val == string:
return key
return string
def parse_currency_value_with_spaces(raw):
# to convert raw values like '2 216 162,83 UAH' to string which is ready for conversion to float
return ''.join(raw.split(' ')[:-1]).replace(',', '.')
def get_minimalStep_currency(raw_value):
# to get currency 'UAH' from raw values like '2 216 162,83 UAH'
result_dic = raw_value.split(' ')
result = result_dic[-1]
return result
def parse_currency_value_with_spaces_percentage(raw):
# to convert raw values like '1,3244%' to string which is ready for conversion to float
result = raw.replace('%', '')
result = Decimal(result)
result = (result / 100)
result = float(result)
return result
def parse_currency_value_with_spaces_percentage_NBU(raw):
# to convert raw values like 'Hi – 1,3244%' to string which is ready for conversion to float
result = raw.split(' ', 4)[4]
result = result.replace('%', '')
result = Decimal(result)
result = (result / 100)
result = float(result)
return result
def convert_etender_string_to_common_string(string):
return get_helper_dictionary().get(string, string)
def get_helper_dictionary():
return {
u"КЛАСИФІКАТОР ДК 021:2015 (CPV)": u"ДК021",
u"кг.": u"кілограм",
u"грн.": u"UAH",
u"(з ПДВ)": True,
u"з ПДВ": True,
u"без ПДВ": False,
# TODO: remove this temporary workaround, consult with quinta team about input data
u"Дніпро": u"Дніпропетровськ",
#tender statuses
u'період уточнень': u'active.enquiries',
u'очікування пропозицій': u'active.tendering',
u'прекваліфікація': u'active.pre-qualification',
u'оцінка пропозицій': u'active.pre-qualification',
u'блокування перед аукціоном': u'active.pre-qualification.stand-still',
u'проведення переговорів': u'active.pre-qualification.stand-still',
u'перший проміжний етап': u'active.stage2.pending',
u'період аукціону': u'active.auction',
u'кваліфікація переможця': u'active.qualification',
u'пропозиції розглянуто': u'active.awarded',
u'завершена закупівля': u'complete',
u'перший етап завершено': u'complete',
u'закупівля не відбулась': u'unsuccessful',
u'відмінена закупівля': u'cancelled',
#bid statuses
u'Пропозиція не дійсна': u'invalid',
u"ст.35 ч. 2 п. 1": u"artContestIP",
u"ст.35 ч. 2 п. 2": u"noCompetition",
u"ст.35 ч. 2 п. 4": u"twiceUnsuccessful",
u"ст.35 ч. 2 п. 5": u"additionalPurchase",
u"ст.35 ч. 2 п. 6": u"additionalConstruction",
u"ст.35 ч. 2 п. 7": u"stateLegalServices",
u"Договір поки що не опубліковано": u"pending",
u"Договір опубліковано": u"active",
u"Переможець торгів": u"active",
u"учасник виграв закупівлю": u"active",
u'вимога': u'claim',
u'відповідь надана': u'answered',
u'задоволено': u'resolved',
u'не задоволено': u'declined',
u'скасована скаржником': u'cancelled',
u'відхилено': u'invalid',
u'залишена без відповіді': u'ignored',
u'очікується кваліфікація': u'pending',
u'відкликається скаржником': u'stopping',
u'очікує розгляду органом оскарження': u'pending',
u'Співфінансування з бюджетних коштів': u'budget',
u'на розгляді': u'pending',
u'Пропозиція не активована': u'invalid'
}
def get_feature_index(i):
return {0.05: '1',
0.01: '2',
0: '3'}[i]
def get_doc_type_index(i):
return {'financial_documents': '1',
'qualification_documents': '2',
'eligibility_documents': '3'}.get(i, i)
def convert_unit_name_to_unit_code(string):
return {
u"блок": u"D64",
u"гектар": u"HAR",
u"кілограми": u"KGM",
u"кілометри": u"KMT",
u"літр": u"LTR",
u"лот": u"LO",
u"метри квадратні": u"MTK",
u"метри кубічні": u"MTQ",
u"метри": u"MTR",
u"місяць": u"MON",
u"набір": u"SET",
u"пара": u"PR",
u"пачка": u"RM",
u"пачок": u"NMP",
u"послуга": u"E48",
u"рейс": u"E54",
u"тони": u"TNE",
u"упаковка": u"PK",
u"Флакон": u"VI",
u"штуки": u"H87",
u"ящик": u"BX",
}.get(string, string)
def convert_milestone_from_text_to_code(string):
return {
u"Аванс": u"prepayment",
u"Пiсляоплата": u"postpayment"
}.get(string, string)
def convert_milestone_from_text_to_title(string):
return {
u"Виконання робіт": "executionOfWorks",
u"Поставка товару": "deliveryOfGoods",
u"Надання послуг": "submittingServices",
u"Підписання договору": "signingTheContract",
u"Дата подання заявки": "submissionDateOfApplications",
u"Дата виставлення рахунку": "dateOfInvoicing",
u"Дата закінчення звітного періоду": "endDateOfTheReportingPeriod",
u"Інша подія": "anotherEvent",
}.get(string, string)
def convert_milestone_from_text_to_day_type(string):
return {
u"Робочі": "working",
u"Банківські": "banking",
u"Календарні": "calendar"
}.get(string, string)
def convert_main_procurement_category(string):
return {
u"Товари": "goods",
u"Послуги": "services",
u"Роботи": "works"
}.get(string, string)
def get_modulus_from_number(number):
if isinstance(number, int):
pass
elif isinstance(number, str):
number = int(number)
elif isinstance(number, unicode):
number = int(number)
return abs(number)
| true | true |
f702a1da97b07980eb0080e9eb0cd536cdc7c88d | 28,785 | py | Python | python/ray/tests/test_runtime_env.py | RaphaelCS/ray | 5f4d9085d2452186bff563fb2856e643c4c82095 | [
"Apache-2.0"
] | 1 | 2022-02-24T02:38:04.000Z | 2022-02-24T02:38:04.000Z | python/ray/tests/test_runtime_env.py | swag1ong/ray | fdbeef604692aa308973988b32405ec0d70f9f40 | [
"Apache-2.0"
] | null | null | null | python/ray/tests/test_runtime_env.py | swag1ong/ray | fdbeef604692aa308973988b32405ec0d70f9f40 | [
"Apache-2.0"
] | null | null | null | import os
import pytest
import sys
import random
import tempfile
import requests
from pathlib import Path
import ray
from ray.test_utils import (run_string_as_driver,
run_string_as_driver_nonblocking)
from ray._private.utils import (get_wheel_filename, get_master_wheel_url,
get_release_wheel_url)
import ray.experimental.internal_kv as kv
from time import sleep
driver_script = """
from time import sleep
import sys
import logging
sys.path.insert(0, "{working_dir}")
import ray
import ray.util
import os
try:
import test_module
except:
pass
try:
job_config = ray.job_config.JobConfig(
runtime_env={runtime_env}
)
if not job_config.runtime_env:
job_config=None
if os.environ.get("USE_RAY_CLIENT"):
ray.client("{address}").env({runtime_env}).namespace("").connect()
else:
ray.init(address="{address}",
job_config=job_config,
logging_level=logging.DEBUG,
namespace=""
)
except ValueError:
print("ValueError")
sys.exit(0)
except TypeError:
print("TypeError")
sys.exit(0)
except:
print("ERROR")
sys.exit(0)
if os.environ.get("EXIT_AFTER_INIT"):
sys.exit(0)
@ray.remote
def run_test():
return test_module.one()
@ray.remote
def check_file(name):
try:
with open(name) as f:
return f.read()
except:
return "FAILED"
@ray.remote
class TestActor(object):
@ray.method(num_returns=1)
def one(self):
return test_module.one()
{execute_statement}
if os.environ.get("USE_RAY_CLIENT"):
ray.util.disconnect()
else:
ray.shutdown()
sleep(10)
"""
def create_file(p):
if not p.parent.exists():
p.parent.mkdir()
with p.open("w") as f:
f.write("Test")
@pytest.fixture(scope="function")
def working_dir():
with tempfile.TemporaryDirectory() as tmp_dir:
path = Path(tmp_dir)
module_path = path / "test_module"
module_path.mkdir(parents=True)
init_file = module_path / "__init__.py"
test_file = module_path / "test.py"
with test_file.open(mode="w") as f:
f.write("""
def one():
return 1
""")
with init_file.open(mode="w") as f:
f.write("""
from test_module.test import one
""")
old_dir = os.getcwd()
os.chdir(tmp_dir)
yield tmp_dir
os.chdir(old_dir)
def start_client_server(cluster, client_mode):
from ray._private.runtime_env import PKG_DIR
if not client_mode:
return (cluster.address, {}, PKG_DIR)
ray.worker._global_node._ray_params.ray_client_server_port = "10003"
ray.worker._global_node.start_ray_client_server()
return ("localhost:10003", {"USE_RAY_CLIENT": "1"}, PKG_DIR)
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
def test_travel():
import uuid
with tempfile.TemporaryDirectory() as tmp_dir:
dir_paths = set()
file_paths = set()
item_num = 0
excludes = []
root = Path(tmp_dir) / "test"
def construct(path, excluded=False, depth=0):
nonlocal item_num
path.mkdir(parents=True)
if not excluded:
dir_paths.add(str(path))
if depth > 8:
return
if item_num > 500:
return
dir_num = random.randint(0, 10)
file_num = random.randint(0, 10)
for _ in range(dir_num):
uid = str(uuid.uuid4()).split("-")[0]
dir_path = path / uid
exclud_sub = random.randint(0, 5) == 0
if not excluded and exclud_sub:
excludes.append(str(dir_path.relative_to(root)))
if not excluded:
construct(dir_path, exclud_sub or excluded, depth + 1)
item_num += 1
if item_num > 1000:
return
for _ in range(file_num):
uid = str(uuid.uuid4()).split("-")[0]
with (path / uid).open("w") as f:
v = random.randint(0, 1000)
f.write(str(v))
if not excluded:
if random.randint(0, 5) == 0:
excludes.append(
str((path / uid).relative_to(root)))
else:
file_paths.add((str(path / uid), str(v)))
item_num += 1
construct(root)
exclude_spec = ray._private.runtime_env._get_excludes(root, excludes)
visited_dir_paths = set()
visited_file_paths = set()
def handler(path):
if path.is_dir():
visited_dir_paths.add(str(path))
else:
with open(path) as f:
visited_file_paths.add((str(path), f.read()))
ray._private.runtime_env._dir_travel(root, [exclude_spec], handler)
assert file_paths == visited_file_paths
assert dir_paths == visited_dir_paths
"""
The following test cases are related with runtime env. It following these steps
1) Creating a temporary dir with fixture working_dir
2) Using a template named driver_script defined globally
3) Overwrite runtime_env and execute_statement in the template
4) Execute it as a separate driver and return the result
"""
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
@pytest.mark.parametrize("client_mode", [True, False])
def test_empty_working_dir(ray_start_cluster_head, client_mode):
cluster = ray_start_cluster_head
(address, env, PKG_DIR) = start_client_server(cluster, client_mode)
env["EXIT_AFTER_INIT"] = "1"
with tempfile.TemporaryDirectory() as working_dir:
runtime_env = f"""{{
"working_dir": r"{working_dir}",
"py_modules": [r"{working_dir}"]
}}"""
# Execute the following cmd in driver with runtime_env
execute_statement = "sys.exit(0)"
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
assert out != "ERROR"
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
@pytest.mark.parametrize("client_mode", [True, False])
def test_invalid_working_dir(ray_start_cluster_head, working_dir, client_mode):
cluster = ray_start_cluster_head
(address, env, PKG_DIR) = start_client_server(cluster, client_mode)
env["EXIT_AFTER_INIT"] = "1"
runtime_env = "{ 'working_dir': 10 }"
# Execute the following cmd in driver with runtime_env
execute_statement = ""
script = driver_script.format(**locals())
out = run_string_as_driver(script, env).strip().split()[-1]
assert out == "TypeError"
runtime_env = "{ 'py_modules': [10] }"
# Execute the following cmd in driver with runtime_env
execute_statement = ""
script = driver_script.format(**locals())
out = run_string_as_driver(script, env).strip().split()[-1]
assert out == "TypeError"
runtime_env = f"{{ 'working_dir': os.path.join(r'{working_dir}', 'na') }}"
# Execute the following cmd in driver with runtime_env
execute_statement = ""
script = driver_script.format(**locals())
out = run_string_as_driver(script, env).strip().split()[-1]
assert out == "ValueError"
runtime_env = f"{{ 'py_modules': [os.path.join(r'{working_dir}', 'na')] }}"
# Execute the following cmd in driver with runtime_env
execute_statement = ""
script = driver_script.format(**locals())
out = run_string_as_driver(script, env).strip().split()[-1]
assert out == "ValueError"
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
@pytest.mark.parametrize("client_mode", [True, False])
def test_single_node(ray_start_cluster_head, working_dir, client_mode):
cluster = ray_start_cluster_head
(address, env, PKG_DIR) = start_client_server(cluster, client_mode)
# Setup runtime env here
runtime_env = f"""{{ "working_dir": "{working_dir}" }}"""
# Execute the following cmd in driver with runtime_env
execute_statement = "print(sum(ray.get([run_test.remote()] * 1000)))"
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
assert out.strip().split()[-1] == "1000"
assert len(list(Path(PKG_DIR).iterdir())) == 1
assert len(kv._internal_kv_list("gcs://")) == 0
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
@pytest.mark.parametrize("client_mode", [True, False])
def test_two_node(two_node_cluster, working_dir, client_mode):
cluster, _ = two_node_cluster
(address, env, PKG_DIR) = start_client_server(cluster, client_mode)
# Testing runtime env with working_dir
runtime_env = f"""{{ "working_dir": "{working_dir}" }}"""
# Execute the following cmd in driver with runtime_env
execute_statement = "print(sum(ray.get([run_test.remote()] * 1000)))"
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
assert out.strip().split()[-1] == "1000"
assert len(list(Path(PKG_DIR).iterdir())) == 1
assert len(kv._internal_kv_list("gcs://")) == 0
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
@pytest.mark.parametrize("client_mode", [True, False])
def test_two_node_module(two_node_cluster, working_dir, client_mode):
cluster, _ = two_node_cluster
(address, env, PKG_DIR) = start_client_server(cluster, client_mode)
# test runtime_env iwth py_modules
runtime_env = """{ "py_modules": [test_module.__path__[0]] }"""
# Execute the following cmd in driver with runtime_env
execute_statement = "print(sum(ray.get([run_test.remote()] * 1000)))"
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
assert out.strip().split()[-1] == "1000"
assert len(list(Path(PKG_DIR).iterdir())) == 1
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
@pytest.mark.parametrize("client_mode", [True, False])
def test_two_node_local_file(two_node_cluster, working_dir, client_mode):
with open(os.path.join(working_dir, "test_file"), "w") as f:
f.write("1")
cluster, _ = two_node_cluster
(address, env, PKG_DIR) = start_client_server(cluster, client_mode)
# test runtime_env iwth working_dir
runtime_env = f"""{{ "working_dir": "{working_dir}" }}"""
# Execute the following cmd in driver with runtime_env
execute_statement = """
vals = ray.get([check_file.remote('test_file')] * 1000)
print(sum([int(v) for v in vals]))
"""
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
assert out.strip().split()[-1] == "1000"
assert len(list(Path(PKG_DIR).iterdir())) == 1
assert len(kv._internal_kv_list("gcs://")) == 0
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
@pytest.mark.parametrize("client_mode", [True, False])
def test_exclusion(ray_start_cluster_head, working_dir, client_mode):
cluster = ray_start_cluster_head
(address, env, PKG_DIR) = start_client_server(cluster, client_mode)
working_path = Path(working_dir)
create_file(working_path / "tmp_dir" / "test_1")
create_file(working_path / "tmp_dir" / "test_2")
create_file(working_path / "tmp_dir" / "test_3")
create_file(working_path / "tmp_dir" / "sub_dir" / "test_1")
create_file(working_path / "tmp_dir" / "sub_dir" / "test_2")
create_file(working_path / "test1")
create_file(working_path / "test2")
create_file(working_path / "test3")
tmp_dir_test_3 = str((working_path / "tmp_dir" / "test_3").absolute())
runtime_env = f"""{{
"working_dir": r"{working_dir}",
}}"""
execute_statement = """
vals = ray.get([
check_file.remote('test1'),
check_file.remote('test2'),
check_file.remote('test3'),
check_file.remote(os.path.join('tmp_dir', 'test_1')),
check_file.remote(os.path.join('tmp_dir', 'test_2')),
check_file.remote(os.path.join('tmp_dir', 'test_3')),
check_file.remote(os.path.join('tmp_dir', 'sub_dir', 'test_1')),
check_file.remote(os.path.join('tmp_dir', 'sub_dir', 'test_2')),
])
print(','.join(vals))
"""
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
# Test it works before
assert out.strip().split("\n")[-1] == \
"Test,Test,Test,Test,Test,Test,Test,Test"
runtime_env = f"""{{
"working_dir": r"{working_dir}",
"excludes": [
# exclude by relative path
r"test2",
# exclude by dir
r"{str(Path("tmp_dir") / "sub_dir")}",
# exclude part of the dir
r"{str(Path("tmp_dir") / "test_1")}",
# exclude part of the dir
r"{str(Path("tmp_dir") / "test_2")}",
]
}}"""
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
assert out.strip().split("\n")[-1] == \
"Test,FAILED,Test,FAILED,FAILED,Test,FAILED,FAILED"
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
@pytest.mark.parametrize("client_mode", [True, False])
def test_exclusion_2(ray_start_cluster_head, working_dir, client_mode):
cluster = ray_start_cluster_head
(address, env, PKG_DIR) = start_client_server(cluster, client_mode)
working_path = Path(working_dir)
def create_file(p):
if not p.parent.exists():
p.parent.mkdir(parents=True)
with p.open("w") as f:
f.write("Test")
create_file(working_path / "tmp_dir" / "test_1")
create_file(working_path / "tmp_dir" / "test_2")
create_file(working_path / "tmp_dir" / "test_3")
create_file(working_path / "tmp_dir" / "sub_dir" / "test_1")
create_file(working_path / "tmp_dir" / "sub_dir" / "test_2")
create_file(working_path / "test1")
create_file(working_path / "test2")
create_file(working_path / "test3")
create_file(working_path / "cache" / "test_1")
create_file(working_path / "tmp_dir" / "cache" / "test_1")
create_file(working_path / "another_dir" / "cache" / "test_1")
tmp_dir_test_3 = str((working_path / "tmp_dir" / "test_3").absolute())
runtime_env = f"""{{
"working_dir": r"{working_dir}",
}}"""
execute_statement = """
vals = ray.get([
check_file.remote('test1'),
check_file.remote('test2'),
check_file.remote('test3'),
check_file.remote(os.path.join('tmp_dir', 'test_1')),
check_file.remote(os.path.join('tmp_dir', 'test_2')),
check_file.remote(os.path.join('tmp_dir', 'test_3')),
check_file.remote(os.path.join('tmp_dir', 'sub_dir', 'test_1')),
check_file.remote(os.path.join('tmp_dir', 'sub_dir', 'test_2')),
check_file.remote(os.path.join("cache", "test_1")),
check_file.remote(os.path.join("tmp_dir", "cache", "test_1")),
check_file.remote(os.path.join("another_dir", "cache", "test_1")),
])
print(','.join(vals))
"""
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
# Test it works before
assert out.strip().split("\n")[-1] == \
"Test,Test,Test,Test,Test,Test,Test,Test,Test,Test,Test"
with open(f"{working_dir}/.gitignore", "w") as f:
f.write("""
# Comment
test_[12]
/test1
!/tmp_dir/sub_dir/test_1
cache/
""")
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
t = out.strip().split("\n")[-1]
assert out.strip().split("\n")[-1] == \
"FAILED,Test,Test,FAILED,FAILED,Test,Test,FAILED,FAILED,FAILED,FAILED"
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
@pytest.mark.parametrize("client_mode", [True, False])
def test_runtime_env_getter(ray_start_cluster_head, working_dir, client_mode):
cluster = ray_start_cluster_head
(address, env, PKG_DIR) = start_client_server(cluster, client_mode)
runtime_env = f"""{{ "working_dir": "{working_dir}" }}"""
# Execute the following cmd in driver with runtime_env
execute_statement = """
print(ray.get_runtime_context().runtime_env["working_dir"])
"""
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
assert out.strip().split()[-1] == working_dir
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
@pytest.mark.parametrize("client_mode", [True, False])
def test_two_node_uri(two_node_cluster, working_dir, client_mode):
cluster, _ = two_node_cluster
(address, env, PKG_DIR) = start_client_server(cluster, client_mode)
import ray._private.runtime_env as runtime_env
import tempfile
with tempfile.NamedTemporaryFile(suffix="zip") as tmp_file:
pkg_name = runtime_env.get_project_package_name(working_dir, [], [])
pkg_uri = runtime_env.Protocol.PIN_GCS.value + "://" + pkg_name
runtime_env.create_project_package(working_dir, [], [], tmp_file.name)
runtime_env.push_package(pkg_uri, tmp_file.name)
runtime_env = f"""{{ "uris": ["{pkg_uri}"] }}"""
# Execute the following cmd in driver with runtime_env
execute_statement = "print(sum(ray.get([run_test.remote()] * 1000)))"
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
assert out.strip().split()[-1] == "1000"
assert len(list(Path(PKG_DIR).iterdir())) == 1
# pinned uri will not be deleted
print(list(kv._internal_kv_list("")))
assert len(kv._internal_kv_list("pingcs://")) == 1
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
@pytest.mark.parametrize("client_mode", [True, False])
def test_regular_actors(ray_start_cluster_head, working_dir, client_mode):
cluster = ray_start_cluster_head
(address, env, PKG_DIR) = start_client_server(cluster, client_mode)
runtime_env = f"""{{ "working_dir": "{working_dir}" }}"""
# Execute the following cmd in driver with runtime_env
execute_statement = """
test_actor = TestActor.options(name="test_actor").remote()
print(sum(ray.get([test_actor.one.remote()] * 1000)))
"""
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
assert out.strip().split()[-1] == "1000"
assert len(list(Path(PKG_DIR).iterdir())) == 1
assert len(kv._internal_kv_list("gcs://")) == 0
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
@pytest.mark.parametrize("client_mode", [True, False])
def test_detached_actors(ray_start_cluster_head, working_dir, client_mode):
cluster = ray_start_cluster_head
(address, env, PKG_DIR) = start_client_server(cluster, client_mode)
runtime_env = f"""{{ "working_dir": "{working_dir}" }}"""
# Execute the following cmd in driver with runtime_env
execute_statement = """
test_actor = TestActor.options(name="test_actor", lifetime="detached").remote()
print(sum(ray.get([test_actor.one.remote()] * 1000)))
"""
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
assert out.strip().split()[-1] == "1000"
# It's a detached actors, so it should still be there
assert len(kv._internal_kv_list("gcs://")) == 1
assert len(list(Path(PKG_DIR).iterdir())) == 2
pkg_dir = [f for f in Path(PKG_DIR).glob("*") if f.is_dir()][0]
import sys
sys.path.insert(0, str(pkg_dir))
test_actor = ray.get_actor("test_actor")
assert sum(ray.get([test_actor.one.remote()] * 1000)) == 1000
ray.kill(test_actor)
from time import sleep
sleep(5)
assert len(list(Path(PKG_DIR).iterdir())) == 1
assert len(kv._internal_kv_list("gcs://")) == 0
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
def test_jobconfig_compatible_1(ray_start_cluster_head, working_dir):
# start job_config=None
# start job_config=something
cluster = ray_start_cluster_head
(address, env, PKG_DIR) = start_client_server(cluster, True)
runtime_env = None
# To make the first one hanging there
execute_statement = """
sleep(600)
"""
script = driver_script.format(**locals())
# Have one running with job config = None
proc = run_string_as_driver_nonblocking(script, env)
# waiting it to be up
sleep(5)
runtime_env = f"""{{ "working_dir": "{working_dir}" }}"""
# Execute the second one which should work because Ray Client servers.
execute_statement = "print(sum(ray.get([run_test.remote()] * 1000)))"
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
assert out.strip().split()[-1] == "1000"
proc.kill()
proc.wait()
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
def test_jobconfig_compatible_2(ray_start_cluster_head, working_dir):
# start job_config=something
# start job_config=None
cluster = ray_start_cluster_head
(address, env, PKG_DIR) = start_client_server(cluster, True)
runtime_env = """{ "py_modules": [test_module.__path__[0]] }"""
# To make the first one hanging there
execute_statement = """
sleep(600)
"""
script = driver_script.format(**locals())
proc = run_string_as_driver_nonblocking(script, env)
sleep(5)
runtime_env = None
# Execute the following in the second one which should
# succeed
execute_statement = "print('OK')"
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
assert out.strip().split()[-1] == "OK", out
proc.kill()
proc.wait()
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
def test_jobconfig_compatible_3(ray_start_cluster_head, working_dir):
# start job_config=something
# start job_config=something else
cluster = ray_start_cluster_head
(address, env, PKG_DIR) = start_client_server(cluster, True)
runtime_env = """{ "py_modules": [test_module.__path__[0]] }"""
# To make the first one hanging ther
execute_statement = """
sleep(600)
"""
script = driver_script.format(**locals())
proc = run_string_as_driver_nonblocking(script, env)
sleep(5)
runtime_env = f"""
{{ "working_dir": test_module.__path__[0] }}""" # noqa: F541
# Execute the following cmd in the second one and ensure that
# it is able to run.
execute_statement = "print('OK')"
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
proc.kill()
proc.wait()
assert out.strip().split()[-1] == "OK"
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
def test_util_without_job_config(shutdown_only):
from ray.cluster_utils import Cluster
with tempfile.TemporaryDirectory() as tmp_dir:
with (Path(tmp_dir) / "lib.py").open("w") as f:
f.write("""
def one():
return 1
""")
old_dir = os.getcwd()
os.chdir(tmp_dir)
cluster = Cluster()
cluster.add_node(num_cpus=1)
ray.init(address=cluster.address)
(address, env, PKG_DIR) = start_client_server(cluster, True)
script = f"""
import ray
import ray.util
import os
ray.util.connect("{address}", job_config=None)
@ray.remote
def run():
from lib import one
return one()
print(ray.get([run.remote()])[0])
"""
out = run_string_as_driver(script, env)
print(out)
os.chdir(old_dir)
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
def test_init(shutdown_only):
with tempfile.TemporaryDirectory() as tmp_dir:
old_dir = os.getcwd()
os.chdir(tmp_dir)
with open("hello", "w") as f:
f.write("world")
job_config = ray.job_config.JobConfig(runtime_env={"working_dir": "."})
ray.init(job_config=job_config)
@ray.remote
class Test:
def test(self):
with open("hello") as f:
return f.read()
t = Test.remote()
assert ray.get(t.test.remote()) == "world"
os.chdir(old_dir)
def test_get_wheel_filename():
ray_version = "2.0.0.dev0"
for sys_platform in ["darwin", "linux", "win32"]:
for py_version in ["36", "37", "38"]:
filename = get_wheel_filename(sys_platform, ray_version,
py_version)
prefix = "https://s3-us-west-2.amazonaws.com/ray-wheels/latest/"
url = f"{prefix}{filename}"
assert requests.head(url).status_code == 200
def test_get_master_wheel_url():
ray_version = "2.0.0.dev0"
test_commit = "ba6cebe30fab6925e5b2d9e859ad064d53015246"
for sys_platform in ["darwin", "linux", "win32"]:
for py_version in ["36", "37", "38"]:
url = get_master_wheel_url(test_commit, sys_platform, ray_version,
py_version)
assert requests.head(url).status_code == 200, url
def test_get_release_wheel_url():
test_commits = {
"1.4.0rc1": "e7c7f6371a69eb727fa469e4cd6f4fbefd143b4c",
"1.3.0": "0b4b444fadcdc23226e11fef066b982175804232",
"1.2.0": "1b1a2496ca51b745c07c79fb859946d3350d471b"
}
for sys_platform in ["darwin", "linux", "win32"]:
for py_version in ["36", "37", "38"]:
for version, commit in test_commits.items():
url = get_release_wheel_url(commit, sys_platform, version,
py_version)
assert requests.head(url).status_code == 200, url
@pytest.mark.skipif(
sys.platform == "win32", reason="runtime_env unsupported on Windows.")
def test_decorator_task(ray_start_cluster_head):
@ray.remote(runtime_env={"env_vars": {"foo": "bar"}})
def f():
return os.environ.get("foo")
assert ray.get(f.remote()) == "bar"
@pytest.mark.skipif(
sys.platform == "win32", reason="runtime_env unsupported on Windows.")
def test_decorator_actor(ray_start_cluster_head):
@ray.remote(runtime_env={"env_vars": {"foo": "bar"}})
class A:
def g(self):
return os.environ.get("foo")
a = A.remote()
assert ray.get(a.g.remote()) == "bar"
@pytest.mark.skipif(
sys.platform == "win32", reason="runtime_env unsupported on Windows.")
def test_decorator_complex(shutdown_only):
ray.init(
job_config=ray.job_config.JobConfig(
runtime_env={"env_vars": {
"foo": "job"
}}))
@ray.remote
def env_from_job():
return os.environ.get("foo")
assert ray.get(env_from_job.remote()) == "job"
@ray.remote(runtime_env={"env_vars": {"foo": "task"}})
def f():
return os.environ.get("foo")
assert ray.get(f.remote()) == "task"
@ray.remote(runtime_env={"env_vars": {"foo": "actor"}})
class A:
def g(self):
return os.environ.get("foo")
a = A.remote()
assert ray.get(a.g.remote()) == "actor"
# Test that runtime_env can be overridden by specifying .options().
assert ray.get(
f.options(runtime_env={
"env_vars": {
"foo": "new"
}
}).remote()) == "new"
a = A.options(runtime_env={"env_vars": {"foo": "new2"}}).remote()
assert ray.get(a.g.remote()) == "new2"
def test_container_option_serialize():
runtime_env = {
"container": {
"image": "ray:latest",
"run_options": ["--name=test"]
}
}
job_config = ray.job_config.JobConfig(runtime_env=runtime_env)
job_config_serialized = job_config.serialize()
# job_config_serialized is JobConfig protobuf serialized string,
# job_config.runtime_env.raw_json has container_option info
# job_config.serialized_runtime_env also has container_option info
assert job_config_serialized.count(b"image") == 2
def test_working_dir_override_failure(shutdown_only):
ray.init()
@ray.remote(runtime_env={"working_dir": "."})
def f():
pass
with pytest.raises(NotImplementedError):
f.remote()
@ray.remote
def g():
pass
with pytest.raises(NotImplementedError):
g.options(runtime_env={"working_dir": "."}).remote()
@ray.remote(runtime_env={"working_dir": "."})
class A:
pass
with pytest.raises(NotImplementedError):
A.remote()
@ray.remote
class B:
pass
with pytest.raises(NotImplementedError):
B.options(runtime_env={"working_dir": "."}).remote()
if __name__ == "__main__":
import sys
sys.exit(pytest.main(["-sv", __file__]))
| 35.537037 | 79 | 0.640021 | import os
import pytest
import sys
import random
import tempfile
import requests
from pathlib import Path
import ray
from ray.test_utils import (run_string_as_driver,
run_string_as_driver_nonblocking)
from ray._private.utils import (get_wheel_filename, get_master_wheel_url,
get_release_wheel_url)
import ray.experimental.internal_kv as kv
from time import sleep
driver_script = """
from time import sleep
import sys
import logging
sys.path.insert(0, "{working_dir}")
import ray
import ray.util
import os
try:
import test_module
except:
pass
try:
job_config = ray.job_config.JobConfig(
runtime_env={runtime_env}
)
if not job_config.runtime_env:
job_config=None
if os.environ.get("USE_RAY_CLIENT"):
ray.client("{address}").env({runtime_env}).namespace("").connect()
else:
ray.init(address="{address}",
job_config=job_config,
logging_level=logging.DEBUG,
namespace=""
)
except ValueError:
print("ValueError")
sys.exit(0)
except TypeError:
print("TypeError")
sys.exit(0)
except:
print("ERROR")
sys.exit(0)
if os.environ.get("EXIT_AFTER_INIT"):
sys.exit(0)
@ray.remote
def run_test():
return test_module.one()
@ray.remote
def check_file(name):
try:
with open(name) as f:
return f.read()
except:
return "FAILED"
@ray.remote
class TestActor(object):
@ray.method(num_returns=1)
def one(self):
return test_module.one()
{execute_statement}
if os.environ.get("USE_RAY_CLIENT"):
ray.util.disconnect()
else:
ray.shutdown()
sleep(10)
"""
def create_file(p):
if not p.parent.exists():
p.parent.mkdir()
with p.open("w") as f:
f.write("Test")
@pytest.fixture(scope="function")
def working_dir():
with tempfile.TemporaryDirectory() as tmp_dir:
path = Path(tmp_dir)
module_path = path / "test_module"
module_path.mkdir(parents=True)
init_file = module_path / "__init__.py"
test_file = module_path / "test.py"
with test_file.open(mode="w") as f:
f.write("""
def one():
return 1
""")
with init_file.open(mode="w") as f:
f.write("""
from test_module.test import one
""")
old_dir = os.getcwd()
os.chdir(tmp_dir)
yield tmp_dir
os.chdir(old_dir)
def start_client_server(cluster, client_mode):
from ray._private.runtime_env import PKG_DIR
if not client_mode:
return (cluster.address, {}, PKG_DIR)
ray.worker._global_node._ray_params.ray_client_server_port = "10003"
ray.worker._global_node.start_ray_client_server()
return ("localhost:10003", {"USE_RAY_CLIENT": "1"}, PKG_DIR)
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
def test_travel():
import uuid
with tempfile.TemporaryDirectory() as tmp_dir:
dir_paths = set()
file_paths = set()
item_num = 0
excludes = []
root = Path(tmp_dir) / "test"
def construct(path, excluded=False, depth=0):
nonlocal item_num
path.mkdir(parents=True)
if not excluded:
dir_paths.add(str(path))
if depth > 8:
return
if item_num > 500:
return
dir_num = random.randint(0, 10)
file_num = random.randint(0, 10)
for _ in range(dir_num):
uid = str(uuid.uuid4()).split("-")[0]
dir_path = path / uid
exclud_sub = random.randint(0, 5) == 0
if not excluded and exclud_sub:
excludes.append(str(dir_path.relative_to(root)))
if not excluded:
construct(dir_path, exclud_sub or excluded, depth + 1)
item_num += 1
if item_num > 1000:
return
for _ in range(file_num):
uid = str(uuid.uuid4()).split("-")[0]
with (path / uid).open("w") as f:
v = random.randint(0, 1000)
f.write(str(v))
if not excluded:
if random.randint(0, 5) == 0:
excludes.append(
str((path / uid).relative_to(root)))
else:
file_paths.add((str(path / uid), str(v)))
item_num += 1
construct(root)
exclude_spec = ray._private.runtime_env._get_excludes(root, excludes)
visited_dir_paths = set()
visited_file_paths = set()
def handler(path):
if path.is_dir():
visited_dir_paths.add(str(path))
else:
with open(path) as f:
visited_file_paths.add((str(path), f.read()))
ray._private.runtime_env._dir_travel(root, [exclude_spec], handler)
assert file_paths == visited_file_paths
assert dir_paths == visited_dir_paths
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
@pytest.mark.parametrize("client_mode", [True, False])
def test_empty_working_dir(ray_start_cluster_head, client_mode):
cluster = ray_start_cluster_head
(address, env, PKG_DIR) = start_client_server(cluster, client_mode)
env["EXIT_AFTER_INIT"] = "1"
with tempfile.TemporaryDirectory() as working_dir:
runtime_env = f"""{{
"working_dir": r"{working_dir}",
"py_modules": [r"{working_dir}"]
}}"""
execute_statement = "sys.exit(0)"
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
assert out != "ERROR"
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
@pytest.mark.parametrize("client_mode", [True, False])
def test_invalid_working_dir(ray_start_cluster_head, working_dir, client_mode):
cluster = ray_start_cluster_head
(address, env, PKG_DIR) = start_client_server(cluster, client_mode)
env["EXIT_AFTER_INIT"] = "1"
runtime_env = "{ 'working_dir': 10 }"
execute_statement = ""
script = driver_script.format(**locals())
out = run_string_as_driver(script, env).strip().split()[-1]
assert out == "TypeError"
runtime_env = "{ 'py_modules': [10] }"
execute_statement = ""
script = driver_script.format(**locals())
out = run_string_as_driver(script, env).strip().split()[-1]
assert out == "TypeError"
runtime_env = f"{{ 'working_dir': os.path.join(r'{working_dir}', 'na') }}"
execute_statement = ""
script = driver_script.format(**locals())
out = run_string_as_driver(script, env).strip().split()[-1]
assert out == "ValueError"
runtime_env = f"{{ 'py_modules': [os.path.join(r'{working_dir}', 'na')] }}"
execute_statement = ""
script = driver_script.format(**locals())
out = run_string_as_driver(script, env).strip().split()[-1]
assert out == "ValueError"
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
@pytest.mark.parametrize("client_mode", [True, False])
def test_single_node(ray_start_cluster_head, working_dir, client_mode):
cluster = ray_start_cluster_head
(address, env, PKG_DIR) = start_client_server(cluster, client_mode)
runtime_env = f"""{{ "working_dir": "{working_dir}" }}"""
execute_statement = "print(sum(ray.get([run_test.remote()] * 1000)))"
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
assert out.strip().split()[-1] == "1000"
assert len(list(Path(PKG_DIR).iterdir())) == 1
assert len(kv._internal_kv_list("gcs://")) == 0
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
@pytest.mark.parametrize("client_mode", [True, False])
def test_two_node(two_node_cluster, working_dir, client_mode):
cluster, _ = two_node_cluster
(address, env, PKG_DIR) = start_client_server(cluster, client_mode)
runtime_env = f"""{{ "working_dir": "{working_dir}" }}"""
execute_statement = "print(sum(ray.get([run_test.remote()] * 1000)))"
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
assert out.strip().split()[-1] == "1000"
assert len(list(Path(PKG_DIR).iterdir())) == 1
assert len(kv._internal_kv_list("gcs://")) == 0
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
@pytest.mark.parametrize("client_mode", [True, False])
def test_two_node_module(two_node_cluster, working_dir, client_mode):
cluster, _ = two_node_cluster
(address, env, PKG_DIR) = start_client_server(cluster, client_mode)
runtime_env = """{ "py_modules": [test_module.__path__[0]] }"""
execute_statement = "print(sum(ray.get([run_test.remote()] * 1000)))"
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
assert out.strip().split()[-1] == "1000"
assert len(list(Path(PKG_DIR).iterdir())) == 1
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
@pytest.mark.parametrize("client_mode", [True, False])
def test_two_node_local_file(two_node_cluster, working_dir, client_mode):
with open(os.path.join(working_dir, "test_file"), "w") as f:
f.write("1")
cluster, _ = two_node_cluster
(address, env, PKG_DIR) = start_client_server(cluster, client_mode)
runtime_env = f"""{{ "working_dir": "{working_dir}" }}"""
execute_statement = """
vals = ray.get([check_file.remote('test_file')] * 1000)
print(sum([int(v) for v in vals]))
"""
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
assert out.strip().split()[-1] == "1000"
assert len(list(Path(PKG_DIR).iterdir())) == 1
assert len(kv._internal_kv_list("gcs://")) == 0
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
@pytest.mark.parametrize("client_mode", [True, False])
def test_exclusion(ray_start_cluster_head, working_dir, client_mode):
cluster = ray_start_cluster_head
(address, env, PKG_DIR) = start_client_server(cluster, client_mode)
working_path = Path(working_dir)
create_file(working_path / "tmp_dir" / "test_1")
create_file(working_path / "tmp_dir" / "test_2")
create_file(working_path / "tmp_dir" / "test_3")
create_file(working_path / "tmp_dir" / "sub_dir" / "test_1")
create_file(working_path / "tmp_dir" / "sub_dir" / "test_2")
create_file(working_path / "test1")
create_file(working_path / "test2")
create_file(working_path / "test3")
tmp_dir_test_3 = str((working_path / "tmp_dir" / "test_3").absolute())
runtime_env = f"""{{
"working_dir": r"{working_dir}",
}}"""
execute_statement = """
vals = ray.get([
check_file.remote('test1'),
check_file.remote('test2'),
check_file.remote('test3'),
check_file.remote(os.path.join('tmp_dir', 'test_1')),
check_file.remote(os.path.join('tmp_dir', 'test_2')),
check_file.remote(os.path.join('tmp_dir', 'test_3')),
check_file.remote(os.path.join('tmp_dir', 'sub_dir', 'test_1')),
check_file.remote(os.path.join('tmp_dir', 'sub_dir', 'test_2')),
])
print(','.join(vals))
"""
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
assert out.strip().split("\n")[-1] == \
"Test,Test,Test,Test,Test,Test,Test,Test"
runtime_env = f"""{{
"working_dir": r"{working_dir}",
"excludes": [
# exclude by relative path
r"test2",
# exclude by dir
r"{str(Path("tmp_dir") / "sub_dir")}",
# exclude part of the dir
r"{str(Path("tmp_dir") / "test_1")}",
# exclude part of the dir
r"{str(Path("tmp_dir") / "test_2")}",
]
}}"""
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
assert out.strip().split("\n")[-1] == \
"Test,FAILED,Test,FAILED,FAILED,Test,FAILED,FAILED"
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
@pytest.mark.parametrize("client_mode", [True, False])
def test_exclusion_2(ray_start_cluster_head, working_dir, client_mode):
cluster = ray_start_cluster_head
(address, env, PKG_DIR) = start_client_server(cluster, client_mode)
working_path = Path(working_dir)
def create_file(p):
if not p.parent.exists():
p.parent.mkdir(parents=True)
with p.open("w") as f:
f.write("Test")
create_file(working_path / "tmp_dir" / "test_1")
create_file(working_path / "tmp_dir" / "test_2")
create_file(working_path / "tmp_dir" / "test_3")
create_file(working_path / "tmp_dir" / "sub_dir" / "test_1")
create_file(working_path / "tmp_dir" / "sub_dir" / "test_2")
create_file(working_path / "test1")
create_file(working_path / "test2")
create_file(working_path / "test3")
create_file(working_path / "cache" / "test_1")
create_file(working_path / "tmp_dir" / "cache" / "test_1")
create_file(working_path / "another_dir" / "cache" / "test_1")
tmp_dir_test_3 = str((working_path / "tmp_dir" / "test_3").absolute())
runtime_env = f"""{{
"working_dir": r"{working_dir}",
}}"""
execute_statement = """
vals = ray.get([
check_file.remote('test1'),
check_file.remote('test2'),
check_file.remote('test3'),
check_file.remote(os.path.join('tmp_dir', 'test_1')),
check_file.remote(os.path.join('tmp_dir', 'test_2')),
check_file.remote(os.path.join('tmp_dir', 'test_3')),
check_file.remote(os.path.join('tmp_dir', 'sub_dir', 'test_1')),
check_file.remote(os.path.join('tmp_dir', 'sub_dir', 'test_2')),
check_file.remote(os.path.join("cache", "test_1")),
check_file.remote(os.path.join("tmp_dir", "cache", "test_1")),
check_file.remote(os.path.join("another_dir", "cache", "test_1")),
])
print(','.join(vals))
"""
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
assert out.strip().split("\n")[-1] == \
"Test,Test,Test,Test,Test,Test,Test,Test,Test,Test,Test"
with open(f"{working_dir}/.gitignore", "w") as f:
f.write("""
# Comment
test_[12]
/test1
!/tmp_dir/sub_dir/test_1
cache/
""")
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
t = out.strip().split("\n")[-1]
assert out.strip().split("\n")[-1] == \
"FAILED,Test,Test,FAILED,FAILED,Test,Test,FAILED,FAILED,FAILED,FAILED"
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
@pytest.mark.parametrize("client_mode", [True, False])
def test_runtime_env_getter(ray_start_cluster_head, working_dir, client_mode):
cluster = ray_start_cluster_head
(address, env, PKG_DIR) = start_client_server(cluster, client_mode)
runtime_env = f"""{{ "working_dir": "{working_dir}" }}"""
execute_statement = """
print(ray.get_runtime_context().runtime_env["working_dir"])
"""
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
assert out.strip().split()[-1] == working_dir
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
@pytest.mark.parametrize("client_mode", [True, False])
def test_two_node_uri(two_node_cluster, working_dir, client_mode):
cluster, _ = two_node_cluster
(address, env, PKG_DIR) = start_client_server(cluster, client_mode)
import ray._private.runtime_env as runtime_env
import tempfile
with tempfile.NamedTemporaryFile(suffix="zip") as tmp_file:
pkg_name = runtime_env.get_project_package_name(working_dir, [], [])
pkg_uri = runtime_env.Protocol.PIN_GCS.value + "://" + pkg_name
runtime_env.create_project_package(working_dir, [], [], tmp_file.name)
runtime_env.push_package(pkg_uri, tmp_file.name)
runtime_env = f"""{{ "uris": ["{pkg_uri}"] }}"""
execute_statement = "print(sum(ray.get([run_test.remote()] * 1000)))"
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
assert out.strip().split()[-1] == "1000"
assert len(list(Path(PKG_DIR).iterdir())) == 1
print(list(kv._internal_kv_list("")))
assert len(kv._internal_kv_list("pingcs://")) == 1
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
@pytest.mark.parametrize("client_mode", [True, False])
def test_regular_actors(ray_start_cluster_head, working_dir, client_mode):
cluster = ray_start_cluster_head
(address, env, PKG_DIR) = start_client_server(cluster, client_mode)
runtime_env = f"""{{ "working_dir": "{working_dir}" }}"""
execute_statement = """
test_actor = TestActor.options(name="test_actor").remote()
print(sum(ray.get([test_actor.one.remote()] * 1000)))
"""
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
assert out.strip().split()[-1] == "1000"
assert len(list(Path(PKG_DIR).iterdir())) == 1
assert len(kv._internal_kv_list("gcs://")) == 0
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
@pytest.mark.parametrize("client_mode", [True, False])
def test_detached_actors(ray_start_cluster_head, working_dir, client_mode):
cluster = ray_start_cluster_head
(address, env, PKG_DIR) = start_client_server(cluster, client_mode)
runtime_env = f"""{{ "working_dir": "{working_dir}" }}"""
execute_statement = """
test_actor = TestActor.options(name="test_actor", lifetime="detached").remote()
print(sum(ray.get([test_actor.one.remote()] * 1000)))
"""
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
assert out.strip().split()[-1] == "1000"
assert len(kv._internal_kv_list("gcs://")) == 1
assert len(list(Path(PKG_DIR).iterdir())) == 2
pkg_dir = [f for f in Path(PKG_DIR).glob("*") if f.is_dir()][0]
import sys
sys.path.insert(0, str(pkg_dir))
test_actor = ray.get_actor("test_actor")
assert sum(ray.get([test_actor.one.remote()] * 1000)) == 1000
ray.kill(test_actor)
from time import sleep
sleep(5)
assert len(list(Path(PKG_DIR).iterdir())) == 1
assert len(kv._internal_kv_list("gcs://")) == 0
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
def test_jobconfig_compatible_1(ray_start_cluster_head, working_dir):
# start job_config=None
# start job_config=something
cluster = ray_start_cluster_head
(address, env, PKG_DIR) = start_client_server(cluster, True)
runtime_env = None
# To make the first one hanging there
execute_statement = """
sleep(600)
"""
script = driver_script.format(**locals())
# Have one running with job config = None
proc = run_string_as_driver_nonblocking(script, env)
# waiting it to be up
sleep(5)
runtime_env = f"""{{ "working_dir": "{working_dir}" }}"""
# Execute the second one which should work because Ray Client servers.
execute_statement = "print(sum(ray.get([run_test.remote()] * 1000)))"
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
assert out.strip().split()[-1] == "1000"
proc.kill()
proc.wait()
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
def test_jobconfig_compatible_2(ray_start_cluster_head, working_dir):
# start job_config=something
# start job_config=None
cluster = ray_start_cluster_head
(address, env, PKG_DIR) = start_client_server(cluster, True)
runtime_env = """{ "py_modules": [test_module.__path__[0]] }"""
# To make the first one hanging there
execute_statement = """
sleep(600)
"""
script = driver_script.format(**locals())
proc = run_string_as_driver_nonblocking(script, env)
sleep(5)
runtime_env = None
# Execute the following in the second one which should
# succeed
execute_statement = "print('OK')"
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
assert out.strip().split()[-1] == "OK", out
proc.kill()
proc.wait()
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
def test_jobconfig_compatible_3(ray_start_cluster_head, working_dir):
# start job_config=something
# start job_config=something else
cluster = ray_start_cluster_head
(address, env, PKG_DIR) = start_client_server(cluster, True)
runtime_env = """{ "py_modules": [test_module.__path__[0]] }"""
# To make the first one hanging ther
execute_statement = """
sleep(600)
"""
script = driver_script.format(**locals())
proc = run_string_as_driver_nonblocking(script, env)
sleep(5)
runtime_env = f"""
{{ "working_dir": test_module.__path__[0] }}""" # noqa: F541
# Execute the following cmd in the second one and ensure that
# it is able to run.
execute_statement = "print('OK')"
script = driver_script.format(**locals())
out = run_string_as_driver(script, env)
proc.kill()
proc.wait()
assert out.strip().split()[-1] == "OK"
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
def test_util_without_job_config(shutdown_only):
from ray.cluster_utils import Cluster
with tempfile.TemporaryDirectory() as tmp_dir:
with (Path(tmp_dir) / "lib.py").open("w") as f:
f.write("""
def one():
return 1
""")
old_dir = os.getcwd()
os.chdir(tmp_dir)
cluster = Cluster()
cluster.add_node(num_cpus=1)
ray.init(address=cluster.address)
(address, env, PKG_DIR) = start_client_server(cluster, True)
script = f"""
import ray
import ray.util
import os
ray.util.connect("{address}", job_config=None)
@ray.remote
def run():
from lib import one
return one()
print(ray.get([run.remote()])[0])
"""
out = run_string_as_driver(script, env)
print(out)
os.chdir(old_dir)
@pytest.mark.skipif(sys.platform == "win32", reason="Fail to create temp dir.")
def test_init(shutdown_only):
with tempfile.TemporaryDirectory() as tmp_dir:
old_dir = os.getcwd()
os.chdir(tmp_dir)
with open("hello", "w") as f:
f.write("world")
job_config = ray.job_config.JobConfig(runtime_env={"working_dir": "."})
ray.init(job_config=job_config)
@ray.remote
class Test:
def test(self):
with open("hello") as f:
return f.read()
t = Test.remote()
assert ray.get(t.test.remote()) == "world"
os.chdir(old_dir)
def test_get_wheel_filename():
ray_version = "2.0.0.dev0"
for sys_platform in ["darwin", "linux", "win32"]:
for py_version in ["36", "37", "38"]:
filename = get_wheel_filename(sys_platform, ray_version,
py_version)
prefix = "https://s3-us-west-2.amazonaws.com/ray-wheels/latest/"
url = f"{prefix}{filename}"
assert requests.head(url).status_code == 200
def test_get_master_wheel_url():
ray_version = "2.0.0.dev0"
test_commit = "ba6cebe30fab6925e5b2d9e859ad064d53015246"
for sys_platform in ["darwin", "linux", "win32"]:
for py_version in ["36", "37", "38"]:
url = get_master_wheel_url(test_commit, sys_platform, ray_version,
py_version)
assert requests.head(url).status_code == 200, url
def test_get_release_wheel_url():
test_commits = {
"1.4.0rc1": "e7c7f6371a69eb727fa469e4cd6f4fbefd143b4c",
"1.3.0": "0b4b444fadcdc23226e11fef066b982175804232",
"1.2.0": "1b1a2496ca51b745c07c79fb859946d3350d471b"
}
for sys_platform in ["darwin", "linux", "win32"]:
for py_version in ["36", "37", "38"]:
for version, commit in test_commits.items():
url = get_release_wheel_url(commit, sys_platform, version,
py_version)
assert requests.head(url).status_code == 200, url
@pytest.mark.skipif(
sys.platform == "win32", reason="runtime_env unsupported on Windows.")
def test_decorator_task(ray_start_cluster_head):
@ray.remote(runtime_env={"env_vars": {"foo": "bar"}})
def f():
return os.environ.get("foo")
assert ray.get(f.remote()) == "bar"
@pytest.mark.skipif(
sys.platform == "win32", reason="runtime_env unsupported on Windows.")
def test_decorator_actor(ray_start_cluster_head):
@ray.remote(runtime_env={"env_vars": {"foo": "bar"}})
class A:
def g(self):
return os.environ.get("foo")
a = A.remote()
assert ray.get(a.g.remote()) == "bar"
@pytest.mark.skipif(
sys.platform == "win32", reason="runtime_env unsupported on Windows.")
def test_decorator_complex(shutdown_only):
ray.init(
job_config=ray.job_config.JobConfig(
runtime_env={"env_vars": {
"foo": "job"
}}))
@ray.remote
def env_from_job():
return os.environ.get("foo")
assert ray.get(env_from_job.remote()) == "job"
@ray.remote(runtime_env={"env_vars": {"foo": "task"}})
def f():
return os.environ.get("foo")
assert ray.get(f.remote()) == "task"
@ray.remote(runtime_env={"env_vars": {"foo": "actor"}})
class A:
def g(self):
return os.environ.get("foo")
a = A.remote()
assert ray.get(a.g.remote()) == "actor"
# Test that runtime_env can be overridden by specifying .options().
assert ray.get(
f.options(runtime_env={
"env_vars": {
"foo": "new"
}
}).remote()) == "new"
a = A.options(runtime_env={"env_vars": {"foo": "new2"}}).remote()
assert ray.get(a.g.remote()) == "new2"
def test_container_option_serialize():
runtime_env = {
"container": {
"image": "ray:latest",
"run_options": ["--name=test"]
}
}
job_config = ray.job_config.JobConfig(runtime_env=runtime_env)
job_config_serialized = job_config.serialize()
# job_config_serialized is JobConfig protobuf serialized string,
# job_config.runtime_env.raw_json has container_option info
# job_config.serialized_runtime_env also has container_option info
assert job_config_serialized.count(b"image") == 2
def test_working_dir_override_failure(shutdown_only):
ray.init()
@ray.remote(runtime_env={"working_dir": "."})
def f():
pass
with pytest.raises(NotImplementedError):
f.remote()
@ray.remote
def g():
pass
with pytest.raises(NotImplementedError):
g.options(runtime_env={"working_dir": "."}).remote()
@ray.remote(runtime_env={"working_dir": "."})
class A:
pass
with pytest.raises(NotImplementedError):
A.remote()
@ray.remote
class B:
pass
with pytest.raises(NotImplementedError):
B.options(runtime_env={"working_dir": "."}).remote()
if __name__ == "__main__":
import sys
sys.exit(pytest.main(["-sv", __file__]))
| true | true |
f702a468588e10d781ab9dbc62f627d8b569cd7c | 262 | py | Python | src/PostService/__init__.py | Group-13-Bachelor/Microservice | c7186953e6ef63d141ea148e74b6bbbe3242f71e | [
"MIT"
] | null | null | null | src/PostService/__init__.py | Group-13-Bachelor/Microservice | c7186953e6ef63d141ea148e74b6bbbe3242f71e | [
"MIT"
] | 1 | 2022-02-14T09:31:04.000Z | 2022-03-02T13:04:33.000Z | src/PostService/__init__.py | Group-13-Bachelor/Microservice | c7186953e6ef63d141ea148e74b6bbbe3242f71e | [
"MIT"
] | null | null | null | from flask import Flask
from flask_sqlalchemy import SQLAlchemy
app = Flask(__name__)
app.config['SQLALCHEMY_DATABASE_URI'] = 'sqlite:///posts.db'
app.config['SQLALCHEMY_TRACK_MODIFICATIONS'] = False
# app.config['FLASK_RUN_PORT'] = 5002
db = SQLAlchemy(app)
| 23.818182 | 60 | 0.774809 | from flask import Flask
from flask_sqlalchemy import SQLAlchemy
app = Flask(__name__)
app.config['SQLALCHEMY_DATABASE_URI'] = 'sqlite:///posts.db'
app.config['SQLALCHEMY_TRACK_MODIFICATIONS'] = False
db = SQLAlchemy(app)
| true | true |
f702a49b0738bb825345e613e66c54392b82e80e | 1,670 | py | Python | test/test_get_account_plan.py | Danilka/APIv3-python-library | c96472f47d652d2e09e8b4a48a80e33fde06e7f1 | [
"MIT"
] | null | null | null | test/test_get_account_plan.py | Danilka/APIv3-python-library | c96472f47d652d2e09e8b4a48a80e33fde06e7f1 | [
"MIT"
] | null | null | null | test/test_get_account_plan.py | Danilka/APIv3-python-library | c96472f47d652d2e09e8b4a48a80e33fde06e7f1 | [
"MIT"
] | null | null | null | # coding: utf-8
"""
SendinBlue API
SendinBlue provide a RESTFul API that can be used with any languages. With this API, you will be able to : - Manage your campaigns and get the statistics - Manage your contacts - Send transactional Emails and SMS - and much more... You can download our wrappers at https://github.com/orgs/sendinblue **Possible responses** | Code | Message | | :-------------: | ------------- | | 200 | OK. Successful Request | | 201 | OK. Successful Creation | | 202 | OK. Request accepted | | 204 | OK. Successful Update/Deletion | | 400 | Error. Bad Request | | 401 | Error. Authentication Needed | | 402 | Error. Not enough credit, plan upgrade needed | | 403 | Error. Permission denied | | 404 | Error. Object does not exist | | 405 | Error. Method not allowed | # noqa: E501
OpenAPI spec version: 3.0.0
Contact: contact@sendinblue.com
Generated by: https://github.com/swagger-api/swagger-codegen.git
"""
from __future__ import absolute_import
import unittest
import sib_api_v3_sdk
from sib_api_v3_sdk.models.get_account_plan import GetAccountPlan # noqa: E501
from sib_api_v3_sdk.rest import ApiException
class TestGetAccountPlan(unittest.TestCase):
"""GetAccountPlan unit test stubs"""
def setUp(self):
pass
def tearDown(self):
pass
def testGetAccountPlan(self):
"""Test GetAccountPlan"""
# FIXME: construct object with mandatory attributes with example values
# model = sib_api_v3_sdk.models.get_account_plan.GetAccountPlan() # noqa: E501
pass
if __name__ == '__main__':
unittest.main()
| 40.731707 | 820 | 0.673653 |
from __future__ import absolute_import
import unittest
import sib_api_v3_sdk
from sib_api_v3_sdk.models.get_account_plan import GetAccountPlan
from sib_api_v3_sdk.rest import ApiException
class TestGetAccountPlan(unittest.TestCase):
def setUp(self):
pass
def tearDown(self):
pass
def testGetAccountPlan(self):
s
if __name__ == '__main__':
unittest.main()
| true | true |
f702a4a82b4b1953954629cd1af554b044385a86 | 5,977 | py | Python | model/video_cnn.py | Fengdalu/LEARN-AN-EFFECTIVE-LIP-READING-MODEL-WITHOUT-PAINS | 8d5eef415c19b4c5e161259b1222fbfec6a5edb0 | [
"MIT"
] | 92 | 2020-11-16T04:23:14.000Z | 2022-02-28T19:29:18.000Z | model/video_cnn.py | echoyinke/learn-an-effective-lip-reading-model-without-pains | 8d5eef415c19b4c5e161259b1222fbfec6a5edb0 | [
"MIT"
] | 21 | 2020-12-26T05:53:56.000Z | 2022-01-26T06:47:18.000Z | model/video_cnn.py | echoyinke/learn-an-effective-lip-reading-model-without-pains | 8d5eef415c19b4c5e161259b1222fbfec6a5edb0 | [
"MIT"
] | 22 | 2020-11-20T04:09:37.000Z | 2021-12-25T13:27:27.000Z | # coding: utf-8
import math
import numpy as np
import torch
import torch.nn as nn
from torch.autograd import Variable
import torch.nn.functional as F
def conv3x3(in_planes, out_planes, stride=1):
return nn.Conv2d(in_planes, out_planes, kernel_size=3, stride=stride,
padding=1, bias=False)
def conv1x1(in_planes, out_planes, stride=1):
return nn.Conv2d(in_planes, out_planes, kernel_size=1)
class BasicBlock(nn.Module):
expansion = 1
def __init__(self, inplanes, planes, stride=1, downsample=None, se=False):
super(BasicBlock, self).__init__()
self.conv1 = conv3x3(inplanes, planes, stride)
self.bn1 = nn.BatchNorm2d(planes)
self.relu = nn.ReLU(inplace=True)
self.conv2 = conv3x3(planes, planes)
self.bn2 = nn.BatchNorm2d(planes)
self.downsample = downsample
self.stride = stride
self.se = se
if(self.se):
self.gap = nn.AdaptiveAvgPool2d(1)
self.conv3 = conv1x1(planes, planes//16)
self.conv4 = conv1x1(planes//16, planes)
def forward(self, x):
residual = x
out = self.conv1(x)
out = self.bn1(out)
out = self.relu(out)
out = self.conv2(out)
out = self.bn2(out)
if self.downsample is not None:
residual = self.downsample(x)
if(self.se):
w = self.gap(out)
w = self.conv3(w)
w = self.relu(w)
w = self.conv4(w).sigmoid()
out = out * w
out = out + residual
out = self.relu(out)
return out
class ResNet(nn.Module):
def __init__(self, block, layers, se=False):
self.inplanes = 64
super(ResNet, self).__init__()
self.se = se
self.layer1 = self._make_layer(block, 64, layers[0])
self.layer2 = self._make_layer(block, 128, layers[1], stride=2)
self.layer3 = self._make_layer(block, 256, layers[2], stride=2)
self.layer4 = self._make_layer(block, 512, layers[3], stride=2)
self.avgpool = nn.AdaptiveAvgPool2d(1)
self.bn = nn.BatchNorm1d(512)
for m in self.modules():
if isinstance(m, nn.Conv2d):
n = m.kernel_size[0] * m.kernel_size[1] * m.out_channels
m.weight.data.normal_(0, math.sqrt(2. / n))
elif isinstance(m, nn.BatchNorm2d):
m.weight.data.fill_(1)
m.bias.data.zero_()
elif isinstance(m, nn.BatchNorm1d):
m.weight.data.fill_(1)
m.bias.data.zero_()
def _make_layer(self, block, planes, blocks, stride=1):
downsample = None
if stride != 1 or self.inplanes != planes * block.expansion:
downsample = nn.Sequential(
nn.Conv2d(self.inplanes, planes * block.expansion,
kernel_size=1, stride=stride, bias=False),
nn.BatchNorm2d(planes * block.expansion),
)
layers = []
layers.append(block(self.inplanes, planes, stride, downsample, se=self.se))
self.inplanes = planes * block.expansion
for i in range(1, blocks):
layers.append(block(self.inplanes, planes, se=self.se))
return nn.Sequential(*layers)
def forward(self, x):
x = self.layer1(x)
x = self.layer2(x)
x = self.layer3(x)
x = self.layer4(x)
x = self.avgpool(x)
x = x.view(x.size(0), -1)
x = self.bn(x)
return x
class VideoCNN(nn.Module):
def __init__(self, se=False):
super(VideoCNN, self).__init__()
# frontend3D
self.frontend3D = nn.Sequential(
nn.Conv3d(1, 64, kernel_size=(5, 7, 7), stride=(1, 2, 2), padding=(2, 3, 3), bias=False),
nn.BatchNorm3d(64),
nn.ReLU(True),
nn.MaxPool3d(kernel_size=(1, 3, 3), stride=(1, 2, 2), padding=(0, 1, 1))
)
# resnet
self.resnet18 = ResNet(BasicBlock, [2, 2, 2, 2], se=se)
self.dropout = nn.Dropout(p=0.5)
# backend_gru
# initialize
self._initialize_weights()
def visual_frontend_forward(self, x):
x = x.transpose(1, 2)
x = self.frontend3D(x)
x = x.transpose(1, 2)
x = x.contiguous()
x = x.view(-1, 64, x.size(3), x.size(4))
x = self.resnet18(x)
return x
def forward(self, x):
b, t = x.size()[:2]
x = self.visual_frontend_forward(x)
#x = self.dropout(x)
feat = x.view(b, -1, 512)
x = x.view(b, -1, 512)
return x
def _initialize_weights(self):
for m in self.modules():
if isinstance(m, nn.Conv3d):
n = m.kernel_size[0] * m.kernel_size[1] * m.kernel_size[2] * m.out_channels
m.weight.data.normal_(0, math.sqrt(2. / n))
if m.bias is not None:
m.bias.data.zero_()
elif isinstance(m, nn.Conv2d):
n = m.kernel_size[0] * m.kernel_size[1] * m.out_channels
m.weight.data.normal_(0, math.sqrt(2. / n))
if m.bias is not None:
m.bias.data.zero_()
elif isinstance(m, nn.Conv1d):
n = m.kernel_size[0] * m.out_channels
m.weight.data.normal_(0, math.sqrt(2. / n))
if m.bias is not None:
m.bias.data.zero_()
elif isinstance(m, nn.BatchNorm3d):
m.weight.data.fill_(1)
m.bias.data.zero_()
elif isinstance(m, nn.BatchNorm2d):
m.weight.data.fill_(1)
m.bias.data.zero_()
elif isinstance(m, nn.BatchNorm1d):
m.weight.data.fill_(1)
m.bias.data.zero_()
| 31.624339 | 105 | 0.52953 |
import math
import numpy as np
import torch
import torch.nn as nn
from torch.autograd import Variable
import torch.nn.functional as F
def conv3x3(in_planes, out_planes, stride=1):
return nn.Conv2d(in_planes, out_planes, kernel_size=3, stride=stride,
padding=1, bias=False)
def conv1x1(in_planes, out_planes, stride=1):
return nn.Conv2d(in_planes, out_planes, kernel_size=1)
class BasicBlock(nn.Module):
expansion = 1
def __init__(self, inplanes, planes, stride=1, downsample=None, se=False):
super(BasicBlock, self).__init__()
self.conv1 = conv3x3(inplanes, planes, stride)
self.bn1 = nn.BatchNorm2d(planes)
self.relu = nn.ReLU(inplace=True)
self.conv2 = conv3x3(planes, planes)
self.bn2 = nn.BatchNorm2d(planes)
self.downsample = downsample
self.stride = stride
self.se = se
if(self.se):
self.gap = nn.AdaptiveAvgPool2d(1)
self.conv3 = conv1x1(planes, planes//16)
self.conv4 = conv1x1(planes//16, planes)
def forward(self, x):
residual = x
out = self.conv1(x)
out = self.bn1(out)
out = self.relu(out)
out = self.conv2(out)
out = self.bn2(out)
if self.downsample is not None:
residual = self.downsample(x)
if(self.se):
w = self.gap(out)
w = self.conv3(w)
w = self.relu(w)
w = self.conv4(w).sigmoid()
out = out * w
out = out + residual
out = self.relu(out)
return out
class ResNet(nn.Module):
def __init__(self, block, layers, se=False):
self.inplanes = 64
super(ResNet, self).__init__()
self.se = se
self.layer1 = self._make_layer(block, 64, layers[0])
self.layer2 = self._make_layer(block, 128, layers[1], stride=2)
self.layer3 = self._make_layer(block, 256, layers[2], stride=2)
self.layer4 = self._make_layer(block, 512, layers[3], stride=2)
self.avgpool = nn.AdaptiveAvgPool2d(1)
self.bn = nn.BatchNorm1d(512)
for m in self.modules():
if isinstance(m, nn.Conv2d):
n = m.kernel_size[0] * m.kernel_size[1] * m.out_channels
m.weight.data.normal_(0, math.sqrt(2. / n))
elif isinstance(m, nn.BatchNorm2d):
m.weight.data.fill_(1)
m.bias.data.zero_()
elif isinstance(m, nn.BatchNorm1d):
m.weight.data.fill_(1)
m.bias.data.zero_()
def _make_layer(self, block, planes, blocks, stride=1):
downsample = None
if stride != 1 or self.inplanes != planes * block.expansion:
downsample = nn.Sequential(
nn.Conv2d(self.inplanes, planes * block.expansion,
kernel_size=1, stride=stride, bias=False),
nn.BatchNorm2d(planes * block.expansion),
)
layers = []
layers.append(block(self.inplanes, planes, stride, downsample, se=self.se))
self.inplanes = planes * block.expansion
for i in range(1, blocks):
layers.append(block(self.inplanes, planes, se=self.se))
return nn.Sequential(*layers)
def forward(self, x):
x = self.layer1(x)
x = self.layer2(x)
x = self.layer3(x)
x = self.layer4(x)
x = self.avgpool(x)
x = x.view(x.size(0), -1)
x = self.bn(x)
return x
class VideoCNN(nn.Module):
def __init__(self, se=False):
super(VideoCNN, self).__init__()
self.frontend3D = nn.Sequential(
nn.Conv3d(1, 64, kernel_size=(5, 7, 7), stride=(1, 2, 2), padding=(2, 3, 3), bias=False),
nn.BatchNorm3d(64),
nn.ReLU(True),
nn.MaxPool3d(kernel_size=(1, 3, 3), stride=(1, 2, 2), padding=(0, 1, 1))
)
self.resnet18 = ResNet(BasicBlock, [2, 2, 2, 2], se=se)
self.dropout = nn.Dropout(p=0.5)
self._initialize_weights()
def visual_frontend_forward(self, x):
x = x.transpose(1, 2)
x = self.frontend3D(x)
x = x.transpose(1, 2)
x = x.contiguous()
x = x.view(-1, 64, x.size(3), x.size(4))
x = self.resnet18(x)
return x
def forward(self, x):
b, t = x.size()[:2]
x = self.visual_frontend_forward(x)
feat = x.view(b, -1, 512)
x = x.view(b, -1, 512)
return x
def _initialize_weights(self):
for m in self.modules():
if isinstance(m, nn.Conv3d):
n = m.kernel_size[0] * m.kernel_size[1] * m.kernel_size[2] * m.out_channels
m.weight.data.normal_(0, math.sqrt(2. / n))
if m.bias is not None:
m.bias.data.zero_()
elif isinstance(m, nn.Conv2d):
n = m.kernel_size[0] * m.kernel_size[1] * m.out_channels
m.weight.data.normal_(0, math.sqrt(2. / n))
if m.bias is not None:
m.bias.data.zero_()
elif isinstance(m, nn.Conv1d):
n = m.kernel_size[0] * m.out_channels
m.weight.data.normal_(0, math.sqrt(2. / n))
if m.bias is not None:
m.bias.data.zero_()
elif isinstance(m, nn.BatchNorm3d):
m.weight.data.fill_(1)
m.bias.data.zero_()
elif isinstance(m, nn.BatchNorm2d):
m.weight.data.fill_(1)
m.bias.data.zero_()
elif isinstance(m, nn.BatchNorm1d):
m.weight.data.fill_(1)
m.bias.data.zero_()
| true | true |
f702a59f427362751552fc4050a4365a830015ce | 740 | py | Python | hack-at-brown-2015/tweepy/__init__.py | hackatbrown/2015.hackatbrown.org | 6e6e10b010421228deb562909a1c8bb4272b759f | [
"MIT"
] | 24 | 2015-11-12T06:33:24.000Z | 2019-04-16T11:11:13.000Z | hack-at-brown-2015/tweepy/__init__.py | hackatbrown/2015.hackatbrown.org | 6e6e10b010421228deb562909a1c8bb4272b759f | [
"MIT"
] | 3 | 2015-11-12T22:16:22.000Z | 2021-08-09T07:00:27.000Z | hack-at-brown-2015/tweepy/__init__.py | hackatbrown/2015.hackatbrown.org | 6e6e10b010421228deb562909a1c8bb4272b759f | [
"MIT"
] | 7 | 2015-11-12T20:09:56.000Z | 2020-12-16T17:59:02.000Z | # Tweepy
# Copyright 2009-2010 Joshua Roesslein
# See LICENSE for details.
"""
Tweepy Twitter API library
"""
__version__ = '3.2.0'
__author__ = 'Joshua Roesslein'
__license__ = 'MIT'
from tweepy.models import Status, User, DirectMessage, Friendship, SavedSearch, SearchResults, ModelFactory, Category
from tweepy.error import TweepError
from tweepy.api import API
from tweepy.cache import Cache, MemoryCache, FileCache
from tweepy.auth import OAuthHandler, AppAuthHandler
from tweepy.streaming import Stream, StreamListener
from tweepy.cursor import Cursor
# Global, unauthenticated instance of API
api = API()
def debug(enable=True, level=1):
from six.moves.http_client import HTTPConnection
HTTPConnection.debuglevel = level
| 28.461538 | 117 | 0.793243 |
__version__ = '3.2.0'
__author__ = 'Joshua Roesslein'
__license__ = 'MIT'
from tweepy.models import Status, User, DirectMessage, Friendship, SavedSearch, SearchResults, ModelFactory, Category
from tweepy.error import TweepError
from tweepy.api import API
from tweepy.cache import Cache, MemoryCache, FileCache
from tweepy.auth import OAuthHandler, AppAuthHandler
from tweepy.streaming import Stream, StreamListener
from tweepy.cursor import Cursor
api = API()
def debug(enable=True, level=1):
from six.moves.http_client import HTTPConnection
HTTPConnection.debuglevel = level
| true | true |
f702a66aba0e0c08f62d9684b7fc08ee12f90210 | 1,370 | py | Python | automanual/add_spotify_uris.py | Julian/Great | d08f7b8c48b788931b65d377283ce5cbdde2e08b | [
"MIT"
] | 1 | 2020-10-31T17:28:20.000Z | 2020-10-31T17:28:20.000Z | automanual/add_spotify_uris.py | Julian/Great | d08f7b8c48b788931b65d377283ce5cbdde2e08b | [
"MIT"
] | 18 | 2018-01-14T17:01:47.000Z | 2021-03-08T17:36:32.000Z | automanual/add_spotify_uris.py | Julian/Great | d08f7b8c48b788931b65d377283ce5cbdde2e08b | [
"MIT"
] | null | null | null | #!/Users/julian/.local/share/virtualenvs/great/bin/pypy
import json
import sys
from great.models import music
from great.web import engine_from_config
from pyperclip import copy
from sqlalchemy import sql
from titlecase import titlecase
e = engine_from_config()
def canonicalize(artist):
if artist.isupper():
return artist
return titlecase(artist)
def spotify_uri(artist):
return e.execute(
sql.select(
[
music.artists.c.id,
music.artists.c.name,
music.artists.c.spotify_uri,
],
).where(music.artists.c.name.like(artist)),
).fetchone()
with open("/dev/tty") as tty:
for line in sys.stdin:
as_dict = json.loads(line)
artist, uri = canonicalize(as_dict["name"]), as_dict["uri"]
result = spotify_uri(artist)
if result is None:
print "Didn't find:", artist
elif result.spotify_uri is None:
e.execute(
sql.update(music.artists).where(
music.artists.c.id == result.id,
).values(spotify_uri=as_dict["uri"]),
)
elif result.spotify_uri != uri:
sys.exit(
"Wat! {!r} has current ID {!r}, not {!r}".format(
artist, result.spotify_uri, uri,
),
)
| 26.346154 | 67 | 0.566423 |
import json
import sys
from great.models import music
from great.web import engine_from_config
from pyperclip import copy
from sqlalchemy import sql
from titlecase import titlecase
e = engine_from_config()
def canonicalize(artist):
if artist.isupper():
return artist
return titlecase(artist)
def spotify_uri(artist):
return e.execute(
sql.select(
[
music.artists.c.id,
music.artists.c.name,
music.artists.c.spotify_uri,
],
).where(music.artists.c.name.like(artist)),
).fetchone()
with open("/dev/tty") as tty:
for line in sys.stdin:
as_dict = json.loads(line)
artist, uri = canonicalize(as_dict["name"]), as_dict["uri"]
result = spotify_uri(artist)
if result is None:
print "Didn't find:", artist
elif result.spotify_uri is None:
e.execute(
sql.update(music.artists).where(
music.artists.c.id == result.id,
).values(spotify_uri=as_dict["uri"]),
)
elif result.spotify_uri != uri:
sys.exit(
"Wat! {!r} has current ID {!r}, not {!r}".format(
artist, result.spotify_uri, uri,
),
)
| false | true |
f702a73b23acce91aa9cdd7f67b38c7b12687972 | 162,774 | py | Python | test/probe/test_sharder.py | masoud91/swift | 19b2e3756521d050a95fb2808d4780d52e7be97f | [
"Apache-2.0"
] | 3 | 2020-08-10T14:13:49.000Z | 2021-08-08T10:21:31.000Z | test/probe/test_sharder.py | masoud91/swift | 19b2e3756521d050a95fb2808d4780d52e7be97f | [
"Apache-2.0"
] | 1 | 2021-02-02T09:35:05.000Z | 2021-02-02T09:35:05.000Z | test/probe/test_sharder.py | masoud91/swift | 19b2e3756521d050a95fb2808d4780d52e7be97f | [
"Apache-2.0"
] | null | null | null | # Copyright (c) 2017 OpenStack Foundation
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or
# implied.
# See the License for the specific language governing permissions and
# limitations under the License.
import json
import os
import shutil
import subprocess
import uuid
from nose import SkipTest
import six
from six.moves.urllib.parse import quote
from swift.common import direct_client, utils
from swift.common.manager import Manager
from swift.common.memcached import MemcacheRing
from swift.common.utils import ShardRange, parse_db_filename, get_db_files, \
quorum_size, config_true_value, Timestamp, md5
from swift.container.backend import ContainerBroker, UNSHARDED, SHARDING, \
SHARDED
from swift.container.sharder import CleavingContext, ContainerSharder
from swift.container.replicator import ContainerReplicator
from swiftclient import client, get_auth, ClientException
from swift.proxy.controllers.base import get_cache_key
from swift.proxy.controllers.obj import num_container_updates
from test import annotate_failure
from test.probe import PROXY_BASE_URL
from test.probe.brain import BrainSplitter
from test.probe.common import ReplProbeTest, get_server_number, \
wait_for_server_to_hangup
import mock
MIN_SHARD_CONTAINER_THRESHOLD = 4
MAX_SHARD_CONTAINER_THRESHOLD = 100
class ShardCollector(object):
"""
Returns map of node to tuples of (headers, shard ranges) returned from node
"""
def __init__(self):
self.ranges = {}
def __call__(self, cnode, cpart, account, container):
self.ranges[cnode['id']] = direct_client.direct_get_container(
cnode, cpart, account, container,
headers={'X-Backend-Record-Type': 'shard'})
class BaseTestContainerSharding(ReplProbeTest):
DELIM = '-'
def _maybe_skip_test(self):
try:
cont_configs = [
utils.readconf(p, 'container-sharder')
for p in self.configs['container-sharder'].values()]
except ValueError:
raise SkipTest('No [container-sharder] section found in '
'container-server configs')
skip_reasons = []
auto_shard = all(config_true_value(c.get('auto_shard', False))
for c in cont_configs)
if not auto_shard:
skip_reasons.append(
'auto_shard must be true in all container_sharder configs')
self.max_shard_size = max(
int(c.get('shard_container_threshold', '1000000'))
for c in cont_configs)
if not (MIN_SHARD_CONTAINER_THRESHOLD <= self.max_shard_size
<= MAX_SHARD_CONTAINER_THRESHOLD):
skip_reasons.append(
'shard_container_threshold %d must be between %d and %d' %
(self.max_shard_size, MIN_SHARD_CONTAINER_THRESHOLD,
MAX_SHARD_CONTAINER_THRESHOLD))
def skip_check(reason_list, option, required):
values = {int(c.get(option, required)) for c in cont_configs}
if values != {required}:
reason_list.append('%s must be %s' % (option, required))
skip_check(skip_reasons, 'shard_scanner_batch_size', 10)
skip_check(skip_reasons, 'shard_batch_size', 2)
if skip_reasons:
raise SkipTest(', '.join(skip_reasons))
def _load_rings_and_configs(self):
super(BaseTestContainerSharding, self)._load_rings_and_configs()
# perform checks for skipping test before starting services
self._maybe_skip_test()
def _make_object_names(self, number, start=0):
return ['obj%s%04d' % (self.DELIM, x)
for x in range(start, start + number)]
def _setup_container_name(self):
# Container where we're PUTting objects
self.container_name = 'container%s%s' % (self.DELIM, uuid.uuid4())
def setUp(self):
client.logger.setLevel(client.logging.WARNING)
client.requests.logging.getLogger().setLevel(
client.requests.logging.WARNING)
super(BaseTestContainerSharding, self).setUp()
_, self.admin_token = get_auth(
PROXY_BASE_URL + '/auth/v1.0', 'admin:admin', 'admin')
self._setup_container_name()
self.init_brain(self.container_name)
self.sharders = Manager(['container-sharder'])
self.internal_client = self.make_internal_client()
self.memcache = MemcacheRing(['127.0.0.1:11211'])
def init_brain(self, container_name):
self.container_to_shard = container_name
self.brain = BrainSplitter(
self.url, self.token, self.container_to_shard,
None, 'container')
self.brain.put_container(policy_index=int(self.policy))
def stop_container_servers(self, node_numbers=None):
if node_numbers:
ipports = []
server2ipport = {v: k for k, v in self.ipport2server.items()}
for number in self.brain.node_numbers[node_numbers]:
self.brain.servers.stop(number=number)
server = 'container%d' % number
ipports.append(server2ipport[server])
else:
ipports = [k for k, v in self.ipport2server.items()
if v.startswith('container')]
self.brain.servers.stop()
for ipport in ipports:
wait_for_server_to_hangup(ipport)
def put_objects(self, obj_names, contents=None):
conn = client.Connection(preauthurl=self.url, preauthtoken=self.token)
results = []
for obj in obj_names:
rdict = {}
conn.put_object(self.container_name, obj,
contents=contents, response_dict=rdict)
results.append((obj, rdict['headers'].get('x-object-version-id')))
return results
def delete_objects(self, obj_names_and_versions):
conn = client.Connection(preauthurl=self.url, preauthtoken=self.token)
for obj in obj_names_and_versions:
if isinstance(obj, tuple):
obj, version = obj
conn.delete_object(self.container_name, obj,
query_string='version-id=%s' % version)
else:
conn.delete_object(self.container_name, obj)
def get_container_shard_ranges(self, account=None, container=None,
include_deleted=False):
account = account if account else self.account
container = container if container else self.container_to_shard
path = self.internal_client.make_path(account, container)
headers = {'X-Backend-Record-Type': 'shard'}
if include_deleted:
headers['X-Backend-Include-Deleted'] = 'true'
resp = self.internal_client.make_request(
'GET', path + '?format=json', headers, [200])
return [ShardRange.from_dict(sr) for sr in json.loads(resp.body)]
def direct_get_container_shard_ranges(self, account=None, container=None,
expect_failure=False):
collector = ShardCollector()
self.direct_container_op(
collector, account, container, expect_failure)
return collector.ranges
def get_storage_dir(self, part, node, account=None, container=None):
account = account or self.brain.account
container = container or self.container_name
server_type, config_number = get_server_number(
(node['ip'], node['port']), self.ipport2server)
assert server_type == 'container'
repl_server = '%s-replicator' % server_type
conf = utils.readconf(self.configs[repl_server][config_number],
section_name=repl_server)
datadir = os.path.join(conf['devices'], node['device'], 'containers')
container_hash = utils.hash_path(account, container)
return (utils.storage_directory(datadir, part, container_hash),
container_hash)
def get_db_file(self, part, node, account=None, container=None):
container_dir, container_hash = self.get_storage_dir(
part, node, account=account, container=container)
db_file = os.path.join(container_dir, container_hash + '.db')
self.assertTrue(get_db_files(db_file)) # sanity check
return db_file
def get_broker(self, part, node, account=None, container=None):
return ContainerBroker(
self.get_db_file(part, node, account, container))
def get_shard_broker(self, shard_range, node_index=0):
shard_part, shard_nodes = self.brain.ring.get_nodes(
shard_range.account, shard_range.container)
return self.get_broker(
shard_part, shard_nodes[node_index], shard_range.account,
shard_range.container)
def categorize_container_dir_content(self, account=None, container=None):
account = account or self.brain.account
container = container or self.container_name
part, nodes = self.brain.ring.get_nodes(account, container)
storage_dirs = [
self.get_storage_dir(part, node, account=account,
container=container)[0]
for node in nodes]
result = {
'shard_dbs': [],
'normal_dbs': [],
'pendings': [],
'locks': [],
'other': [],
}
for storage_dir in storage_dirs:
for f in os.listdir(storage_dir):
path = os.path.join(storage_dir, f)
if path.endswith('.db'):
hash_, epoch, ext = parse_db_filename(path)
if epoch:
result['shard_dbs'].append(path)
else:
result['normal_dbs'].append(path)
elif path.endswith('.db.pending'):
result['pendings'].append(path)
elif path.endswith('/.lock'):
result['locks'].append(path)
else:
result['other'].append(path)
if result['other']:
self.fail('Found unexpected files in storage directory:\n %s' %
'\n '.join(result['other']))
return result
def assert_dict_contains(self, expected_items, actual_dict):
ignored = set(expected_items) ^ set(actual_dict)
filtered_actual = {k: actual_dict[k]
for k in actual_dict if k not in ignored}
self.assertEqual(expected_items, filtered_actual)
def assert_shard_ranges_contiguous(self, expected_number, shard_ranges,
first_lower='', last_upper=''):
if shard_ranges and isinstance(shard_ranges[0], ShardRange):
actual_shard_ranges = sorted(shard_ranges)
else:
actual_shard_ranges = sorted(ShardRange.from_dict(d)
for d in shard_ranges)
self.assertLengthEqual(actual_shard_ranges, expected_number)
if expected_number:
with annotate_failure('Ranges %s.' % actual_shard_ranges):
self.assertEqual(first_lower, actual_shard_ranges[0].lower_str)
for x, y in zip(actual_shard_ranges, actual_shard_ranges[1:]):
self.assertEqual(x.upper, y.lower)
self.assertEqual(last_upper, actual_shard_ranges[-1].upper_str)
def assert_shard_range_equal(self, expected, actual, excludes=None):
excludes = excludes or []
expected_dict = dict(expected)
actual_dict = dict(actual)
for k in excludes:
expected_dict.pop(k, None)
actual_dict.pop(k, None)
self.assertEqual(expected_dict, actual_dict)
def assert_shard_range_lists_equal(self, expected, actual, excludes=None):
self.assertEqual(len(expected), len(actual))
for expected, actual in zip(expected, actual):
self.assert_shard_range_equal(expected, actual, excludes=excludes)
def assert_shard_range_state(self, expected_state, shard_ranges):
if shard_ranges and not isinstance(shard_ranges[0], ShardRange):
shard_ranges = [ShardRange.from_dict(data)
for data in shard_ranges]
self.assertEqual([expected_state] * len(shard_ranges),
[sr.state for sr in shard_ranges])
def assert_total_object_count(self, expected_object_count, shard_ranges):
actual = sum(sr['object_count'] for sr in shard_ranges)
self.assertEqual(expected_object_count, actual)
def assert_container_listing(self, expected_listing, req_hdrs=None):
req_hdrs = req_hdrs if req_hdrs else {}
headers, actual_listing = client.get_container(
self.url, self.token, self.container_name, headers=req_hdrs)
self.assertIn('x-container-object-count', headers)
expected_obj_count = len(expected_listing)
self.assertEqual(expected_listing, [
x['name'].encode('utf-8') if six.PY2 else x['name']
for x in actual_listing])
self.assertEqual(str(expected_obj_count),
headers['x-container-object-count'])
return headers, actual_listing
def assert_container_object_count(self, expected_obj_count):
headers = client.head_container(
self.url, self.token, self.container_name)
self.assertIn('x-container-object-count', headers)
self.assertEqual(str(expected_obj_count),
headers['x-container-object-count'])
def assert_container_post_ok(self, meta_value):
key = 'X-Container-Meta-Assert-Post-Works'
headers = {key: meta_value}
client.post_container(
self.url, self.token, self.container_name, headers=headers)
resp_headers = client.head_container(
self.url, self.token, self.container_name)
self.assertEqual(meta_value, resp_headers.get(key.lower()))
def assert_container_post_fails(self, meta_value):
key = 'X-Container-Meta-Assert-Post-Works'
headers = {key: meta_value}
with self.assertRaises(ClientException) as cm:
client.post_container(
self.url, self.token, self.container_name, headers=headers)
self.assertEqual(404, cm.exception.http_status)
def assert_container_delete_fails(self):
with self.assertRaises(ClientException) as cm:
client.delete_container(self.url, self.token, self.container_name)
self.assertEqual(409, cm.exception.http_status)
def assert_container_not_found(self):
with self.assertRaises(ClientException) as cm:
client.get_container(self.url, self.token, self.container_name)
self.assertEqual(404, cm.exception.http_status)
# check for headers leaking out while deleted
resp_headers = cm.exception.http_response_headers
self.assertNotIn('X-Container-Object-Count', resp_headers)
self.assertNotIn('X-Container-Bytes-Used', resp_headers)
self.assertNotIn('X-Timestamp', resp_headers)
self.assertNotIn('X-PUT-Timestamp', resp_headers)
def assert_container_has_shard_sysmeta(self):
node_headers = self.direct_head_container()
for node_id, headers in node_headers.items():
with annotate_failure('%s in %s' % (node_id, node_headers.keys())):
for k, v in headers.items():
if k.lower().startswith('x-container-sysmeta-shard'):
break
else:
self.fail('No shard sysmeta found in %s' % headers)
def assert_container_state(self, node, expected_state, num_shard_ranges):
headers, shard_ranges = direct_client.direct_get_container(
node, self.brain.part, self.account, self.container_to_shard,
headers={'X-Backend-Record-Type': 'shard'})
self.assertEqual(num_shard_ranges, len(shard_ranges))
self.assertIn('X-Backend-Sharding-State', headers)
self.assertEqual(
expected_state, headers['X-Backend-Sharding-State'])
return [ShardRange.from_dict(sr) for sr in shard_ranges]
def assert_subprocess_success(self, cmd_args):
try:
subprocess.check_output(cmd_args, stderr=subprocess.STDOUT)
except Exception as exc:
# why not 'except CalledProcessError'? because in my py3.6 tests
# the CalledProcessError wasn't caught by that! despite type(exc)
# being a CalledProcessError, isinstance(exc, CalledProcessError)
# is False and the type has a different hash - could be
# related to https://github.com/eventlet/eventlet/issues/413
try:
# assume this is a CalledProcessError
self.fail('%s with output:\n%s' % (exc, exc.output))
except AttributeError:
raise exc
def get_part_and_node_numbers(self, shard_range):
"""Return the partition and node numbers for a shard range."""
part, nodes = self.brain.ring.get_nodes(
shard_range.account, shard_range.container)
return part, [n['id'] + 1 for n in nodes]
def run_sharders(self, shard_ranges):
"""Run the sharder on partitions for given shard ranges."""
if not isinstance(shard_ranges, (list, tuple, set)):
shard_ranges = (shard_ranges,)
partitions = ','.join(str(self.get_part_and_node_numbers(sr)[0])
for sr in shard_ranges)
self.sharders.once(additional_args='--partitions=%s' % partitions)
def run_sharder_sequentially(self, shard_range=None):
"""Run sharder node by node on partition for given shard range."""
if shard_range:
part, node_numbers = self.get_part_and_node_numbers(shard_range)
else:
part, node_numbers = self.brain.part, self.brain.node_numbers
for node_number in node_numbers:
self.sharders.once(number=node_number,
additional_args='--partitions=%s' % part)
def run_custom_sharder(self, conf_index, custom_conf, **kwargs):
return self.run_custom_daemon(ContainerSharder, 'container-sharder',
conf_index, custom_conf, **kwargs)
class TestContainerShardingNonUTF8(BaseTestContainerSharding):
def test_sharding_listing(self):
# verify parameterised listing of a container during sharding
all_obj_names = self._make_object_names(4 * self.max_shard_size)
obj_names = all_obj_names[::2]
obj_content = 'testing'
self.put_objects(obj_names, contents=obj_content)
# choose some names approx in middle of each expected shard range
markers = [
obj_names[i] for i in range(self.max_shard_size // 4,
2 * self.max_shard_size,
self.max_shard_size // 2)]
def check_listing(objects, req_hdrs=None, **params):
req_hdrs = req_hdrs if req_hdrs else {}
qs = '&'.join('%s=%s' % (k, quote(str(v)))
for k, v in params.items())
headers, listing = client.get_container(
self.url, self.token, self.container_name, query_string=qs,
headers=req_hdrs)
listing = [x['name'].encode('utf-8') if six.PY2 else x['name']
for x in listing]
if params.get('reverse'):
marker = params.get('marker', ShardRange.MAX)
end_marker = params.get('end_marker', ShardRange.MIN)
expected = [o for o in objects if end_marker < o < marker]
expected.reverse()
else:
marker = params.get('marker', ShardRange.MIN)
end_marker = params.get('end_marker', ShardRange.MAX)
expected = [o for o in objects if marker < o < end_marker]
if 'limit' in params:
expected = expected[:params['limit']]
self.assertEqual(expected, listing)
self.assertIn('x-timestamp', headers)
self.assertIn('last-modified', headers)
self.assertIn('x-trans-id', headers)
self.assertEqual('bytes', headers.get('accept-ranges'))
self.assertEqual('application/json; charset=utf-8',
headers.get('content-type'))
def check_listing_fails(exp_status, **params):
qs = '&'.join(['%s=%s' % param for param in params.items()])
with self.assertRaises(ClientException) as cm:
client.get_container(
self.url, self.token, self.container_name, query_string=qs)
self.assertEqual(exp_status, cm.exception.http_status)
return cm.exception
def do_listing_checks(objs, hdrs=None):
hdrs = hdrs if hdrs else {}
check_listing(objs, hdrs)
check_listing(objs, hdrs, marker=markers[0], end_marker=markers[1])
check_listing(objs, hdrs, marker=markers[0], end_marker=markers[2])
check_listing(objs, hdrs, marker=markers[1], end_marker=markers[3])
check_listing(objs, hdrs, marker=markers[1], end_marker=markers[3],
limit=self.max_shard_size // 4)
check_listing(objs, hdrs, marker=markers[1], end_marker=markers[3],
limit=self.max_shard_size // 4)
check_listing(objs, hdrs, marker=markers[1], end_marker=markers[2],
limit=self.max_shard_size // 2)
check_listing(objs, hdrs, marker=markers[1], end_marker=markers[1])
check_listing(objs, hdrs, reverse=True)
check_listing(objs, hdrs, reverse=True, end_marker=markers[1])
check_listing(objs, hdrs, reverse=True, marker=markers[3],
end_marker=markers[1],
limit=self.max_shard_size // 4)
check_listing(objs, hdrs, reverse=True, marker=markers[3],
end_marker=markers[1], limit=0)
check_listing([], hdrs, marker=markers[0], end_marker=markers[0])
check_listing([], hdrs, marker=markers[0], end_marker=markers[1],
reverse=True)
check_listing(objs, hdrs, prefix='obj')
check_listing([], hdrs, prefix='zzz')
# delimiter
headers, listing = client.get_container(
self.url, self.token, self.container_name,
query_string='delimiter=' + quote(self.DELIM), headers=hdrs)
self.assertEqual([{'subdir': 'obj' + self.DELIM}], listing)
headers, listing = client.get_container(
self.url, self.token, self.container_name,
query_string='delimiter=j' + quote(self.DELIM), headers=hdrs)
self.assertEqual([{'subdir': 'obj' + self.DELIM}], listing)
limit = self.cluster_info['swift']['container_listing_limit']
exc = check_listing_fails(412, limit=limit + 1)
self.assertIn(b'Maximum limit', exc.http_response_content)
exc = check_listing_fails(400, delimiter='%ff')
self.assertIn(b'not valid UTF-8', exc.http_response_content)
# sanity checks
do_listing_checks(obj_names)
# Shard the container
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
# First run the 'leader' in charge of scanning, which finds all shard
# ranges and cleaves first two
self.sharders.once(number=self.brain.node_numbers[0],
additional_args='--partitions=%s' % self.brain.part)
# Then run sharder on other nodes which will also cleave first two
# shard ranges
for n in self.brain.node_numbers[1:]:
self.sharders.once(
number=n, additional_args='--partitions=%s' % self.brain.part)
# sanity check shard range states
for node in self.brain.nodes:
self.assert_container_state(node, 'sharding', 4)
shard_ranges = self.get_container_shard_ranges()
self.assertLengthEqual(shard_ranges, 4)
self.assert_shard_range_state(ShardRange.CLEAVED, shard_ranges[:2])
self.assert_shard_range_state(ShardRange.CREATED, shard_ranges[2:])
self.assert_container_delete_fails()
self.assert_container_has_shard_sysmeta() # confirm no sysmeta deleted
self.assert_container_post_ok('sharding')
do_listing_checks(obj_names)
# put some new objects spread through entire namespace; object updates
# should be directed to the shard container (both the cleaved and the
# created shards)
new_obj_names = all_obj_names[1::4]
self.put_objects(new_obj_names, obj_content)
# new objects that fell into the first two cleaved shard ranges are
# reported in listing; new objects in the yet-to-be-cleaved shard
# ranges are not yet included in listing because listings prefer the
# root over the final two shards that are not yet-cleaved
exp_obj_names = [o for o in obj_names + new_obj_names
if o <= shard_ranges[1].upper]
exp_obj_names += [o for o in obj_names
if o > shard_ranges[1].upper]
exp_obj_names.sort()
do_listing_checks(exp_obj_names)
# run all the sharders again and the last two shard ranges get cleaved
self.sharders.once(additional_args='--partitions=%s' % self.brain.part)
for node in self.brain.nodes:
self.assert_container_state(node, 'sharded', 4)
shard_ranges = self.get_container_shard_ranges()
self.assert_shard_range_state(ShardRange.ACTIVE, shard_ranges)
# listings are now gathered from all four shard ranges so should have
# all the specified objects
exp_obj_names = obj_names + new_obj_names
exp_obj_names.sort()
do_listing_checks(exp_obj_names)
# shard ranges may now be cached by proxy so do listings checks again
# forcing backend request
do_listing_checks(exp_obj_names, hdrs={'X-Newest': 'true'})
# post more metadata to the container and check that it is read back
# correctly from backend (using x-newest) and cache
test_headers = {'x-container-meta-test': 'testing',
'x-container-read': 'read_acl',
'x-container-write': 'write_acl',
'x-container-sync-key': 'sync_key',
# 'x-container-sync-to': 'sync_to',
'x-versions-location': 'versions',
'x-container-meta-access-control-allow-origin': 'aa',
'x-container-meta-access-control-expose-headers': 'bb',
'x-container-meta-access-control-max-age': '123'}
client.post_container(self.url, self.admin_token, self.container_name,
headers=test_headers)
headers, listing = client.get_container(
self.url, self.token, self.container_name,
headers={'X-Newest': 'true'})
exp_headers = dict(test_headers)
exp_headers.update({
'x-container-object-count': str(len(exp_obj_names)),
'x-container-bytes-used':
str(len(exp_obj_names) * len(obj_content))
})
for k, v in exp_headers.items():
self.assertIn(k, headers)
self.assertEqual(v, headers[k], dict(headers))
cache_headers, listing = client.get_container(
self.url, self.token, self.container_name)
for k, v in exp_headers.items():
self.assertIn(k, cache_headers)
self.assertEqual(v, cache_headers[k], dict(exp_headers))
# we don't expect any of these headers to be equal...
for k in ('x-timestamp', 'last-modified', 'date', 'x-trans-id',
'x-openstack-request-id'):
headers.pop(k, None)
cache_headers.pop(k, None)
self.assertEqual(headers, cache_headers)
self.assert_container_delete_fails()
self.assert_container_has_shard_sysmeta()
self.assert_container_post_ok('sharded')
# delete original objects
self.delete_objects(obj_names)
do_listing_checks(new_obj_names)
self.assert_container_delete_fails()
self.assert_container_has_shard_sysmeta()
self.assert_container_post_ok('sharded')
class TestContainerShardingFunkyNames(TestContainerShardingNonUTF8):
DELIM = '\n'
def _make_object_names(self, number):
return ['obj\n%04d%%Ff' % x for x in range(number)]
def _setup_container_name(self):
self.container_name = 'container\n%%Ff\n%s' % uuid.uuid4()
class TestContainerShardingUTF8(TestContainerShardingNonUTF8):
def _make_object_names(self, number, start=0):
# override default with names that include non-ascii chars
name_length = self.cluster_info['swift']['max_object_name_length']
obj_names = []
for x in range(start, start + number):
name = (u'obj-\u00e4\u00ea\u00ec\u00f2\u00fb\u1234-%04d' % x)
name = name.encode('utf8').ljust(name_length, b'o')
if not six.PY2:
name = name.decode('utf8')
obj_names.append(name)
return obj_names
def _setup_container_name(self):
# override default with max length name that includes non-ascii chars
super(TestContainerShardingUTF8, self)._setup_container_name()
name_length = self.cluster_info['swift']['max_container_name_length']
cont_name = \
self.container_name + u'-\u00e4\u00ea\u00ec\u00f2\u00fb\u1234'
self.container_name = cont_name.encode('utf8').ljust(name_length, b'x')
if not six.PY2:
self.container_name = self.container_name.decode('utf8')
class TestContainerShardingObjectVersioning(BaseTestContainerSharding):
def _maybe_skip_test(self):
super(TestContainerShardingObjectVersioning, self)._maybe_skip_test()
try:
vw_config = utils.readconf(self.configs['proxy-server'],
'filter:versioned_writes')
except ValueError:
raise SkipTest('No [filter:versioned_writes] section found in '
'proxy-server configs')
allow_object_versioning = config_true_value(
vw_config.get('allow_object_versioning', False))
if not allow_object_versioning:
raise SkipTest('allow_object_versioning must be true '
'in all versioned_writes configs')
def init_brain(self, container_name):
client.put_container(self.url, self.token, container_name, headers={
'X-Storage-Policy': self.policy.name,
'X-Versions-Enabled': 'true',
})
self.container_to_shard = '\x00versions\x00' + container_name
self.brain = BrainSplitter(
self.url, self.token, self.container_to_shard,
None, 'container')
def test_sharding_listing(self):
# verify parameterised listing of a container during sharding
all_obj_names = self._make_object_names(3) * self.max_shard_size
all_obj_names.extend(self._make_object_names(self.max_shard_size,
start=3))
obj_names = all_obj_names[::2]
obj_names_and_versions = self.put_objects(obj_names)
def sort_key(obj_and_ver):
obj, ver = obj_and_ver
return obj, ~Timestamp(ver)
obj_names_and_versions.sort(key=sort_key)
# choose some names approx in middle of each expected shard range
markers = [
obj_names_and_versions[i]
for i in range(self.max_shard_size // 4,
2 * self.max_shard_size,
self.max_shard_size // 2)]
def check_listing(objects, **params):
params['versions'] = ''
qs = '&'.join('%s=%s' % param for param in params.items())
headers, listing = client.get_container(
self.url, self.token, self.container_name, query_string=qs)
listing = [(x['name'].encode('utf-8') if six.PY2 else x['name'],
x['version_id'])
for x in listing]
if params.get('reverse'):
marker = (
params.get('marker', ShardRange.MAX),
~Timestamp(params['version_marker'])
if 'version_marker' in params else ~Timestamp('0'),
)
end_marker = (
params.get('end_marker', ShardRange.MIN),
Timestamp('0'),
)
expected = [o for o in objects
if end_marker < sort_key(o) < marker]
expected.reverse()
else:
marker = (
params.get('marker', ShardRange.MIN),
~Timestamp(params['version_marker'])
if 'version_marker' in params else Timestamp('0'),
)
end_marker = (
params.get('end_marker', ShardRange.MAX),
~Timestamp('0'),
)
expected = [o for o in objects
if marker < sort_key(o) < end_marker]
if 'limit' in params:
expected = expected[:params['limit']]
self.assertEqual(expected, listing)
def check_listing_fails(exp_status, **params):
params['versions'] = ''
qs = '&'.join('%s=%s' % param for param in params.items())
with self.assertRaises(ClientException) as cm:
client.get_container(
self.url, self.token, self.container_name, query_string=qs)
self.assertEqual(exp_status, cm.exception.http_status)
return cm.exception
def do_listing_checks(objects):
check_listing(objects)
check_listing(objects,
marker=markers[0][0], version_marker=markers[0][1])
check_listing(objects,
marker=markers[0][0], version_marker=markers[0][1],
limit=self.max_shard_size // 10)
check_listing(objects,
marker=markers[0][0], version_marker=markers[0][1],
limit=self.max_shard_size // 4)
check_listing(objects,
marker=markers[0][0], version_marker=markers[0][1],
limit=self.max_shard_size // 2)
check_listing(objects,
marker=markers[1][0], version_marker=markers[1][1])
check_listing(objects,
marker=markers[1][0], version_marker=markers[1][1],
limit=self.max_shard_size // 10)
check_listing(objects,
marker=markers[2][0], version_marker=markers[2][1],
limit=self.max_shard_size // 4)
check_listing(objects,
marker=markers[2][0], version_marker=markers[2][1],
limit=self.max_shard_size // 2)
check_listing(objects, reverse=True)
check_listing(objects, reverse=True,
marker=markers[1][0], version_marker=markers[1][1])
check_listing(objects, prefix='obj')
check_listing([], prefix='zzz')
# delimiter
headers, listing = client.get_container(
self.url, self.token, self.container_name,
query_string='delimiter=-')
self.assertEqual([{'subdir': 'obj-'}], listing)
headers, listing = client.get_container(
self.url, self.token, self.container_name,
query_string='delimiter=j-')
self.assertEqual([{'subdir': 'obj-'}], listing)
limit = self.cluster_info['swift']['container_listing_limit']
exc = check_listing_fails(412, limit=limit + 1)
self.assertIn(b'Maximum limit', exc.http_response_content)
exc = check_listing_fails(400, delimiter='%ff')
self.assertIn(b'not valid UTF-8', exc.http_response_content)
# sanity checks
do_listing_checks(obj_names_and_versions)
# Shard the container. Use an internal_client so we get an implicit
# X-Backend-Allow-Reserved-Names header
self.internal_client.set_container_metadata(
self.account, self.container_to_shard, {
'X-Container-Sysmeta-Sharding': 'True',
})
# First run the 'leader' in charge of scanning, which finds all shard
# ranges and cleaves first two
self.sharders.once(number=self.brain.node_numbers[0],
additional_args='--partitions=%s' % self.brain.part)
# Then run sharder on other nodes which will also cleave first two
# shard ranges
for n in self.brain.node_numbers[1:]:
self.sharders.once(
number=n, additional_args='--partitions=%s' % self.brain.part)
# sanity check shard range states
for node in self.brain.nodes:
self.assert_container_state(node, 'sharding', 4)
shard_ranges = self.get_container_shard_ranges()
self.assertLengthEqual(shard_ranges, 4)
self.assert_shard_range_state(ShardRange.CLEAVED, shard_ranges[:2])
self.assert_shard_range_state(ShardRange.CREATED, shard_ranges[2:])
self.assert_container_delete_fails()
self.assert_container_has_shard_sysmeta() # confirm no sysmeta deleted
self.assert_container_post_ok('sharding')
do_listing_checks(obj_names_and_versions)
# put some new objects spread through entire namespace
new_obj_names = all_obj_names[1::4]
new_obj_names_and_versions = self.put_objects(new_obj_names)
# new objects that fell into the first two cleaved shard ranges are
# reported in listing, new objects in the yet-to-be-cleaved shard
# ranges are not yet included in listing
exp_obj_names_and_versions = [
o for o in obj_names_and_versions + new_obj_names_and_versions
if '\x00' + o[0] <= shard_ranges[1].upper]
exp_obj_names_and_versions += [
o for o in obj_names_and_versions
if '\x00' + o[0] > shard_ranges[1].upper]
exp_obj_names_and_versions.sort(key=sort_key)
do_listing_checks(exp_obj_names_and_versions)
# run all the sharders again and the last two shard ranges get cleaved
self.sharders.once(additional_args='--partitions=%s' % self.brain.part)
for node in self.brain.nodes:
self.assert_container_state(node, 'sharded', 4)
shard_ranges = self.get_container_shard_ranges()
self.assert_shard_range_state(ShardRange.ACTIVE, shard_ranges)
exp_obj_names_and_versions = \
obj_names_and_versions + new_obj_names_and_versions
exp_obj_names_and_versions.sort(key=sort_key)
do_listing_checks(exp_obj_names_and_versions)
self.assert_container_delete_fails()
self.assert_container_has_shard_sysmeta()
self.assert_container_post_ok('sharded')
# delete original objects
self.delete_objects(obj_names_and_versions)
new_obj_names_and_versions.sort(key=sort_key)
do_listing_checks(new_obj_names_and_versions)
self.assert_container_delete_fails()
self.assert_container_has_shard_sysmeta()
self.assert_container_post_ok('sharded')
class TestContainerSharding(BaseTestContainerSharding):
def _test_sharded_listing(self, run_replicators=False):
obj_names = self._make_object_names(self.max_shard_size)
self.put_objects(obj_names)
# Verify that we start out with normal DBs, no shards
found = self.categorize_container_dir_content()
self.assertLengthEqual(found['normal_dbs'], 3)
self.assertLengthEqual(found['shard_dbs'], 0)
for db_file in found['normal_dbs']:
broker = ContainerBroker(db_file)
self.assertIs(True, broker.is_root_container())
self.assertEqual('unsharded', broker.get_db_state())
self.assertLengthEqual(broker.get_shard_ranges(), 0)
headers, pre_sharding_listing = client.get_container(
self.url, self.token, self.container_name)
self.assertEqual(obj_names, [
x['name'].encode('utf-8') if six.PY2 else x['name']
for x in pre_sharding_listing]) # sanity
# Shard it
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
pre_sharding_headers = client.head_container(
self.url, self.admin_token, self.container_name)
self.assertEqual('True',
pre_sharding_headers.get('x-container-sharding'))
# Only run the one in charge of scanning
self.sharders.once(number=self.brain.node_numbers[0],
additional_args='--partitions=%s' % self.brain.part)
# Verify that we have one sharded db -- though the other normal DBs
# received the shard ranges that got defined
found = self.categorize_container_dir_content()
self.assertLengthEqual(found['shard_dbs'], 1)
broker = self.get_broker(self.brain.part, self.brain.nodes[0])
# sanity check - the shard db is on replica 0
self.assertEqual(found['shard_dbs'][0], broker.db_file)
self.assertIs(True, broker.is_root_container())
self.assertEqual('sharded', broker.get_db_state())
orig_root_shard_ranges = [dict(sr) for sr in broker.get_shard_ranges()]
self.assertLengthEqual(orig_root_shard_ranges, 2)
self.assert_total_object_count(len(obj_names), orig_root_shard_ranges)
self.assert_shard_ranges_contiguous(2, orig_root_shard_ranges)
self.assertEqual([ShardRange.ACTIVE, ShardRange.ACTIVE],
[sr['state'] for sr in orig_root_shard_ranges])
# Contexts should still be there, and should be complete
contexts = set([ctx.done()
for ctx, _ in CleavingContext.load_all(broker)])
self.assertEqual({True}, contexts)
self.direct_delete_container(expect_failure=True)
self.assertLengthEqual(found['normal_dbs'], 2)
for db_file in found['normal_dbs']:
broker = ContainerBroker(db_file)
self.assertIs(True, broker.is_root_container())
self.assertEqual('unsharded', broker.get_db_state())
shard_ranges = [dict(sr) for sr in broker.get_shard_ranges()]
self.assertEqual([ShardRange.CREATED, ShardRange.CREATED],
[sr['state'] for sr in shard_ranges])
# the sharded db had shard range meta_timestamps and state updated
# during cleaving, so we do not expect those to be equal on other
# nodes
self.assert_shard_range_lists_equal(
orig_root_shard_ranges, shard_ranges,
excludes=['meta_timestamp', 'state', 'state_timestamp'])
contexts = list(CleavingContext.load_all(broker))
self.assertEqual([], contexts) # length check
if run_replicators:
Manager(['container-replicator']).once()
# replication doesn't change the db file names
found = self.categorize_container_dir_content()
self.assertLengthEqual(found['shard_dbs'], 1)
self.assertLengthEqual(found['normal_dbs'], 2)
# Now that everyone has shard ranges, run *everyone*
self.sharders.once(additional_args='--partitions=%s' % self.brain.part)
# Verify that we only have shard dbs now
found = self.categorize_container_dir_content()
self.assertLengthEqual(found['shard_dbs'], 3)
self.assertLengthEqual(found['normal_dbs'], 0)
# Shards stayed the same
for db_file in found['shard_dbs']:
broker = ContainerBroker(db_file)
self.assertIs(True, broker.is_root_container())
self.assertEqual('sharded', broker.get_db_state())
# Well, except for meta_timestamps, since the shards each reported
self.assert_shard_range_lists_equal(
orig_root_shard_ranges, broker.get_shard_ranges(),
excludes=['meta_timestamp', 'state_timestamp'])
for orig, updated in zip(orig_root_shard_ranges,
broker.get_shard_ranges()):
self.assertGreaterEqual(updated.state_timestamp,
orig['state_timestamp'])
self.assertGreaterEqual(updated.meta_timestamp,
orig['meta_timestamp'])
# Contexts should still be there, and should be complete
contexts = set([ctx.done()
for ctx, _ in CleavingContext.load_all(broker)])
self.assertEqual({True}, contexts)
# Check that entire listing is available
headers, actual_listing = self.assert_container_listing(obj_names)
# ... and check some other container properties
self.assertEqual(headers['last-modified'],
pre_sharding_headers['last-modified'])
# It even works in reverse!
headers, listing = client.get_container(self.url, self.token,
self.container_name,
query_string='reverse=on')
self.assertEqual(pre_sharding_listing[::-1], listing)
# and repeat checks to use shard ranges now cached in proxy
headers, actual_listing = self.assert_container_listing(obj_names)
self.assertEqual(headers['last-modified'],
pre_sharding_headers['last-modified'])
headers, listing = client.get_container(self.url, self.token,
self.container_name,
query_string='reverse=on')
self.assertEqual(pre_sharding_listing[::-1], listing)
# Now put some new objects into first shard, taking its count to
# 3 shard ranges' worth
more_obj_names = [
'beta%03d' % x for x in range(self.max_shard_size)]
self.put_objects(more_obj_names)
# The listing includes new objects (shard ranges haven't changed, just
# their object content, so cached shard ranges are still correct)...
headers, listing = self.assert_container_listing(
more_obj_names + obj_names)
self.assertEqual(pre_sharding_listing, listing[len(more_obj_names):])
# ...but root object count is out of date until the sharders run and
# update the root
self.assert_container_object_count(len(obj_names))
# run sharders on the shard to get root updated
shard_1 = ShardRange.from_dict(orig_root_shard_ranges[0])
self.run_sharders(shard_1)
self.assert_container_object_count(len(more_obj_names + obj_names))
# we've added objects enough that we need to shard the first shard
# *again* into three new sub-shards, but nothing happens until the root
# leader identifies shard candidate...
root_shard_ranges = self.direct_get_container_shard_ranges()
for node, (hdrs, root_shards) in root_shard_ranges.items():
self.assertLengthEqual(root_shards, 2)
with annotate_failure('node %s. ' % node):
self.assertEqual(
[ShardRange.ACTIVE] * 2,
[sr['state'] for sr in root_shards])
# orig shards 0, 1 should be contiguous
self.assert_shard_ranges_contiguous(2, root_shards)
# Now run the root leader to identify shard candidate...while one of
# the shard container servers is down
shard_1_part, shard_1_nodes = self.get_part_and_node_numbers(shard_1)
self.brain.servers.stop(number=shard_1_nodes[2])
self.sharders.once(number=self.brain.node_numbers[0],
additional_args='--partitions=%s' % self.brain.part)
# ... so third replica of first shard state is not moved to sharding
found_for_shard = self.categorize_container_dir_content(
shard_1.account, shard_1.container)
self.assertLengthEqual(found_for_shard['normal_dbs'], 3)
self.assertEqual(
[ShardRange.SHARDING, ShardRange.SHARDING, ShardRange.ACTIVE],
[ContainerBroker(db_file).get_own_shard_range().state
for db_file in found_for_shard['normal_dbs']])
# ...then run first cycle of first shard sharders in order, leader
# first, to get to predictable state where all nodes have cleaved 2 out
# of 3 ranges...starting with first two nodes
for node_number in shard_1_nodes[:2]:
self.sharders.once(
number=node_number,
additional_args='--partitions=%s' % shard_1_part)
# ... first two replicas start sharding to sub-shards
found_for_shard = self.categorize_container_dir_content(
shard_1.account, shard_1.container)
self.assertLengthEqual(found_for_shard['shard_dbs'], 2)
for db_file in found_for_shard['shard_dbs'][:2]:
broker = ContainerBroker(db_file)
with annotate_failure('shard db file %s. ' % db_file):
self.assertIs(False, broker.is_root_container())
self.assertEqual('sharding', broker.get_db_state())
self.assertEqual(
ShardRange.SHARDING, broker.get_own_shard_range().state)
shard_shards = broker.get_shard_ranges()
self.assertEqual(
[ShardRange.CLEAVED, ShardRange.CLEAVED,
ShardRange.CREATED],
[sr.state for sr in shard_shards])
self.assert_shard_ranges_contiguous(
3, shard_shards,
first_lower=orig_root_shard_ranges[0]['lower'],
last_upper=orig_root_shard_ranges[0]['upper'])
contexts = list(CleavingContext.load_all(broker))
self.assertEqual(len(contexts), 1)
context, _lm = contexts[0]
self.assertIs(context.cleaving_done, False)
self.assertIs(context.misplaced_done, True)
self.assertEqual(context.ranges_done, 2)
self.assertEqual(context.ranges_todo, 1)
self.assertEqual(context.max_row,
self.max_shard_size * 3 // 2)
# but third replica still has no idea it should be sharding
self.assertLengthEqual(found_for_shard['normal_dbs'], 3)
self.assertEqual(
ShardRange.ACTIVE,
ContainerBroker(
found_for_shard['normal_dbs'][2]).get_own_shard_range().state)
# ...but once sharder runs on third replica it will learn its state;
# note that any root replica on the stopped container server also won't
# know about the shards being in sharding state, so leave that server
# stopped for now so that shard fetches its state from an up-to-date
# root replica
self.sharders.once(
number=shard_1_nodes[2],
additional_args='--partitions=%s' % shard_1_part)
# third replica is sharding but has no sub-shard ranges yet...
found_for_shard = self.categorize_container_dir_content(
shard_1.account, shard_1.container)
self.assertLengthEqual(found_for_shard['shard_dbs'], 2)
self.assertLengthEqual(found_for_shard['normal_dbs'], 3)
broker = ContainerBroker(found_for_shard['normal_dbs'][2])
self.assertEqual('unsharded', broker.get_db_state())
self.assertEqual(
ShardRange.SHARDING, broker.get_own_shard_range().state)
self.assertFalse(broker.get_shard_ranges())
contexts = list(CleavingContext.load_all(broker))
self.assertEqual([], contexts) # length check
# ...until sub-shard ranges are replicated from another shard replica;
# there may also be a sub-shard replica missing so run replicators on
# all nodes to fix that if necessary
self.brain.servers.start(number=shard_1_nodes[2])
self.replicators.once()
# Now that the replicators have all run, third replica sees cleaving
# contexts for the first two
contexts = list(CleavingContext.load_all(broker))
self.assertEqual(len(contexts), 2)
# now run sharder again on third replica
self.sharders.once(
number=shard_1_nodes[2],
additional_args='--partitions=%s' % shard_1_part)
sharding_broker = ContainerBroker(found_for_shard['normal_dbs'][2])
self.assertEqual('sharding', sharding_broker.get_db_state())
broker_id = broker.get_info()['id']
# Old, unsharded DB doesn't have the context...
contexts = list(CleavingContext.load_all(broker))
self.assertEqual(len(contexts), 2)
self.assertNotIn(broker_id, [ctx[0].ref for ctx in contexts])
# ...but the sharding one does
contexts = list(CleavingContext.load_all(sharding_broker))
self.assertEqual(len(contexts), 3)
self.assertIn(broker_id, [ctx[0].ref for ctx in contexts])
# check original first shard range state and sub-shards - all replicas
# should now be in consistent state
found_for_shard = self.categorize_container_dir_content(
shard_1.account, shard_1.container)
self.assertLengthEqual(found_for_shard['shard_dbs'], 3)
self.assertLengthEqual(found_for_shard['normal_dbs'], 3)
for db_file in found_for_shard['shard_dbs']:
broker = ContainerBroker(db_file)
with annotate_failure('shard db file %s. ' % db_file):
self.assertIs(False, broker.is_root_container())
self.assertEqual('sharding', broker.get_db_state())
self.assertEqual(
ShardRange.SHARDING, broker.get_own_shard_range().state)
shard_shards = broker.get_shard_ranges()
self.assertEqual(
[ShardRange.CLEAVED, ShardRange.CLEAVED,
ShardRange.CREATED],
[sr.state for sr in shard_shards])
self.assert_shard_ranges_contiguous(
3, shard_shards,
first_lower=orig_root_shard_ranges[0]['lower'],
last_upper=orig_root_shard_ranges[0]['upper'])
# check third sub-shard is in created state
sub_shard = shard_shards[2]
found_for_sub_shard = self.categorize_container_dir_content(
sub_shard.account, sub_shard.container)
self.assertFalse(found_for_sub_shard['shard_dbs'])
self.assertLengthEqual(found_for_sub_shard['normal_dbs'], 3)
for db_file in found_for_sub_shard['normal_dbs']:
broker = ContainerBroker(db_file)
with annotate_failure('sub shard db file %s. ' % db_file):
self.assertIs(False, broker.is_root_container())
self.assertEqual('unsharded', broker.get_db_state())
self.assertEqual(
ShardRange.CREATED, broker.get_own_shard_range().state)
self.assertFalse(broker.get_shard_ranges())
# check root shard ranges
root_shard_ranges = self.direct_get_container_shard_ranges()
for node, (hdrs, root_shards) in root_shard_ranges.items():
self.assertLengthEqual(root_shards, 5)
with annotate_failure('node %s. ' % node):
# shard ranges are sorted by upper, state, lower, so expect:
# sub-shards, orig shard 0, orig shard 1
self.assertEqual(
[ShardRange.CLEAVED, ShardRange.CLEAVED,
ShardRange.CREATED, ShardRange.SHARDING,
ShardRange.ACTIVE],
[sr['state'] for sr in root_shards])
# sub-shards 0, 1, 2, orig shard 1 should be contiguous
self.assert_shard_ranges_contiguous(
4, root_shards[:3] + root_shards[4:])
# orig shards 0, 1 should be contiguous
self.assert_shard_ranges_contiguous(2, root_shards[3:])
self.assert_container_listing(more_obj_names + obj_names)
self.assert_container_object_count(len(more_obj_names + obj_names))
# Before writing, kill the cache
self.memcache.delete(get_cache_key(
self.account, self.container_name, shard='updating'))
# add another object that lands in the first of the new sub-shards
self.put_objects(['alpha'])
# check that alpha object is in the first new shard
shard_listings = self.direct_get_container(shard_shards[0].account,
shard_shards[0].container)
for node, (hdrs, listing) in shard_listings.items():
with annotate_failure(node):
self.assertIn('alpha', [o['name'] for o in listing])
self.assert_container_listing(['alpha'] + more_obj_names + obj_names)
# Run sharders again so things settle.
self.run_sharders(shard_1)
# Also run replicators to settle cleaving contexts
self.replicators.once()
# check original first shard range shards
for db_file in found_for_shard['shard_dbs']:
broker = ContainerBroker(db_file)
with annotate_failure('shard db file %s. ' % db_file):
self.assertIs(False, broker.is_root_container())
self.assertEqual('sharded', broker.get_db_state())
self.assertEqual(
[ShardRange.ACTIVE] * 3,
[sr.state for sr in broker.get_shard_ranges()])
# Contexts should still be there, and should be complete
contexts = set([ctx.done()
for ctx, _
in CleavingContext.load_all(broker)])
self.assertEqual({True}, contexts)
# check root shard ranges
root_shard_ranges = self.direct_get_container_shard_ranges()
for node, (hdrs, root_shards) in root_shard_ranges.items():
# old first shard range should have been deleted
self.assertLengthEqual(root_shards, 4)
with annotate_failure('node %s. ' % node):
self.assertEqual(
[ShardRange.ACTIVE] * 4,
[sr['state'] for sr in root_shards])
self.assert_shard_ranges_contiguous(4, root_shards)
headers, final_listing = self.assert_container_listing(
['alpha'] + more_obj_names + obj_names)
# check root
found = self.categorize_container_dir_content()
self.assertLengthEqual(found['shard_dbs'], 3)
self.assertLengthEqual(found['normal_dbs'], 0)
new_shard_ranges = None
for db_file in found['shard_dbs']:
broker = ContainerBroker(db_file)
self.assertIs(True, broker.is_root_container())
self.assertEqual('sharded', broker.get_db_state())
if new_shard_ranges is None:
new_shard_ranges = broker.get_shard_ranges(
include_deleted=True)
self.assertLengthEqual(new_shard_ranges, 5)
# Second half is still there, and unchanged
self.assertIn(
dict(orig_root_shard_ranges[1], meta_timestamp=None,
state_timestamp=None),
[dict(sr, meta_timestamp=None, state_timestamp=None)
for sr in new_shard_ranges])
# But the first half split in three, then deleted
by_name = {sr.name: sr for sr in new_shard_ranges}
self.assertIn(orig_root_shard_ranges[0]['name'], by_name)
old_shard_range = by_name.pop(
orig_root_shard_ranges[0]['name'])
self.assertTrue(old_shard_range.deleted)
self.assert_shard_ranges_contiguous(4, list(by_name.values()))
else:
# Everyone's on the same page. Well, except for
# meta_timestamps, since the shards each reported
other_shard_ranges = broker.get_shard_ranges(
include_deleted=True)
self.assert_shard_range_lists_equal(
new_shard_ranges, other_shard_ranges,
excludes=['meta_timestamp', 'state_timestamp'])
for orig, updated in zip(orig_root_shard_ranges,
other_shard_ranges):
self.assertGreaterEqual(updated.meta_timestamp,
orig['meta_timestamp'])
self.assert_container_delete_fails()
for obj in final_listing:
client.delete_object(
self.url, self.token, self.container_name, obj['name'])
# the objects won't be listed anymore
self.assert_container_listing([])
# but root container stats will not yet be aware of the deletions
self.assert_container_delete_fails()
# One server was down while the shard sharded its first two sub-shards,
# so there may be undeleted handoff db(s) for sub-shard(s) that were
# not fully replicated; run replicators now to clean up so they no
# longer report bogus stats to root.
self.replicators.once()
# Run sharder so that shard containers update the root. Do not run
# sharder on root container because that triggers shrinks which can
# cause root object count to temporarily be non-zero and prevent the
# final delete.
self.run_sharders(self.get_container_shard_ranges())
# then root is empty and can be deleted
self.assert_container_listing([])
self.assert_container_object_count(0)
client.delete_container(self.url, self.token, self.container_name)
def test_sharded_listing_no_replicators(self):
self._test_sharded_listing()
def test_sharded_listing_with_replicators(self):
self._test_sharded_listing(run_replicators=True)
def test_async_pendings(self):
obj_names = self._make_object_names(self.max_shard_size * 2)
# There are some updates *everyone* gets
self.put_objects(obj_names[::5])
# But roll some outages so each container only get ~2/5 more object
# records i.e. total of 3/5 updates per container; and async pendings
# pile up
for i, n in enumerate(self.brain.node_numbers, start=1):
self.brain.servers.stop(number=n)
self.put_objects(obj_names[i::5])
self.brain.servers.start(number=n)
# But there are also 1/5 updates *no one* gets
self.brain.servers.stop()
self.put_objects(obj_names[4::5])
self.brain.servers.start()
# Shard it
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
headers = client.head_container(self.url, self.admin_token,
self.container_name)
self.assertEqual('True', headers.get('x-container-sharding'))
# sanity check
found = self.categorize_container_dir_content()
self.assertLengthEqual(found['shard_dbs'], 0)
self.assertLengthEqual(found['normal_dbs'], 3)
for db_file in found['normal_dbs']:
broker = ContainerBroker(db_file)
self.assertIs(True, broker.is_root_container())
self.assertEqual(len(obj_names) * 3 // 5,
broker.get_info()['object_count'])
# Only run the 'leader' in charge of scanning.
# Each container has ~2 * max * 3/5 objects
# which are distributed from obj000 to obj<2 * max - 1>,
# so expect 3 shard ranges to be found: the first two will be complete
# shards with max/2 objects and lower/upper bounds spaced by approx:
# (2 * max - 1)/(2 * max * 3/5) * (max/2) =~ 5/6 * max
#
# Note that during this shard cycle the leader replicates to other
# nodes so they will end up with ~2 * max * 4/5 objects.
self.sharders.once(number=self.brain.node_numbers[0],
additional_args='--partitions=%s' % self.brain.part)
# Verify that we have one shard db -- though the other normal DBs
# received the shard ranges that got defined
found = self.categorize_container_dir_content()
self.assertLengthEqual(found['shard_dbs'], 1)
node_index_zero_db = found['shard_dbs'][0]
broker = ContainerBroker(node_index_zero_db)
self.assertIs(True, broker.is_root_container())
self.assertEqual(SHARDING, broker.get_db_state())
expected_shard_ranges = broker.get_shard_ranges()
self.assertLengthEqual(expected_shard_ranges, 3)
self.assertEqual(
[ShardRange.CLEAVED, ShardRange.CLEAVED, ShardRange.CREATED],
[sr.state for sr in expected_shard_ranges])
# Still have all three big DBs -- we've only cleaved 2 of the 3 shard
# ranges that got defined
self.assertLengthEqual(found['normal_dbs'], 3)
db_states = []
for db_file in found['normal_dbs']:
broker = ContainerBroker(db_file)
self.assertIs(True, broker.is_root_container())
db_states.append(broker.get_db_state())
# the sharded db had shard range meta_timestamps updated during
# cleaving, so we do not expect those to be equal on other nodes
self.assert_shard_range_lists_equal(
expected_shard_ranges, broker.get_shard_ranges(),
excludes=['meta_timestamp', 'state_timestamp', 'state'])
self.assertEqual(len(obj_names) * 3 // 5,
broker.get_info()['object_count'])
self.assertEqual([SHARDING, UNSHARDED, UNSHARDED], sorted(db_states))
# Run the other sharders so we're all in (roughly) the same state
for n in self.brain.node_numbers[1:]:
self.sharders.once(
number=n,
additional_args='--partitions=%s' % self.brain.part)
found = self.categorize_container_dir_content()
self.assertLengthEqual(found['shard_dbs'], 3)
self.assertLengthEqual(found['normal_dbs'], 3)
for db_file in found['normal_dbs']:
broker = ContainerBroker(db_file)
self.assertEqual(SHARDING, broker.get_db_state())
# no new rows
self.assertEqual(len(obj_names) * 3 // 5,
broker.get_info()['object_count'])
# Run updaters to clear the async pendings
Manager(['object-updater']).once()
# Our "big" dbs didn't take updates
for db_file in found['normal_dbs']:
broker = ContainerBroker(db_file)
self.assertEqual(len(obj_names) * 3 // 5,
broker.get_info()['object_count'])
# confirm that the async pending updates got redirected to the shards
for sr in expected_shard_ranges:
shard_listings = self.direct_get_container(sr.account,
sr.container)
for node, (hdrs, listing) in shard_listings.items():
shard_listing_names = [
o['name'].encode('utf-8') if six.PY2 else o['name']
for o in listing]
for obj in obj_names[4::5]:
if obj in sr:
self.assertIn(obj, shard_listing_names)
else:
self.assertNotIn(obj, shard_listing_names)
# The entire listing is not yet available - we have two cleaved shard
# ranges, complete with async updates, but for the remainder of the
# namespace only what landed in the original container
headers, listing = client.get_container(self.url, self.token,
self.container_name)
start_listing = [
o for o in obj_names if o <= expected_shard_ranges[1].upper]
self.assertEqual(
[x['name'].encode('utf-8') if six.PY2 else x['name']
for x in listing[:len(start_listing)]],
start_listing)
# we can't assert much about the remaining listing, other than that
# there should be something
self.assertTrue(
[x['name'].encode('utf-8') if six.PY2 else x['name']
for x in listing[len(start_listing):]])
self.assertIn('x-container-object-count', headers)
self.assertEqual(str(len(listing)),
headers['x-container-object-count'])
headers, listing = client.get_container(self.url, self.token,
self.container_name,
query_string='reverse=on')
self.assertEqual([x['name'].encode('utf-8') if six.PY2 else x['name']
for x in listing[-len(start_listing):]],
list(reversed(start_listing)))
self.assertIn('x-container-object-count', headers)
self.assertEqual(str(len(listing)),
headers['x-container-object-count'])
self.assertTrue(
[x['name'].encode('utf-8') if six.PY2 else x['name']
for x in listing[:-len(start_listing)]])
# Run the sharders again to get everything to settle
self.sharders.once()
found = self.categorize_container_dir_content()
self.assertLengthEqual(found['shard_dbs'], 3)
self.assertLengthEqual(found['normal_dbs'], 0)
# now all shards have been cleaved we should get the complete listing
headers, listing = client.get_container(self.url, self.token,
self.container_name)
self.assertEqual([x['name'].encode('utf-8') if six.PY2 else x['name']
for x in listing],
obj_names)
def test_shrinking(self):
int_client = self.make_internal_client()
def check_node_data(node_data, exp_hdrs, exp_obj_count, exp_shards,
exp_sharded_root_range=False):
hdrs, range_data = node_data
self.assert_dict_contains(exp_hdrs, hdrs)
sharded_root_range = False
other_range_data = []
for data in range_data:
sr = ShardRange.from_dict(data)
if (sr.account == self.account and
sr.container == self.container_name and
sr.state == ShardRange.SHARDED):
# only expect one root range
self.assertFalse(sharded_root_range, range_data)
sharded_root_range = True
self.assertEqual(ShardRange.MIN, sr.lower, sr)
self.assertEqual(ShardRange.MAX, sr.upper, sr)
else:
# include active root range in further assertions
other_range_data.append(data)
self.assertEqual(exp_sharded_root_range, sharded_root_range)
self.assert_shard_ranges_contiguous(exp_shards, other_range_data)
self.assert_total_object_count(exp_obj_count, other_range_data)
def check_shard_nodes_data(node_data, expected_state='unsharded',
expected_shards=0, exp_obj_count=0,
exp_sharded_root_range=False):
# checks that shard range is consistent on all nodes
root_path = '%s/%s' % (self.account, self.container_name)
exp_shard_hdrs = {
'X-Container-Sysmeta-Shard-Quoted-Root': quote(root_path),
'X-Backend-Sharding-State': expected_state}
object_counts = []
bytes_used = []
for node_id, node_data in node_data.items():
with annotate_failure('Node id %s.' % node_id):
check_node_data(
node_data, exp_shard_hdrs, exp_obj_count,
expected_shards, exp_sharded_root_range)
hdrs = node_data[0]
object_counts.append(int(hdrs['X-Container-Object-Count']))
bytes_used.append(int(hdrs['X-Container-Bytes-Used']))
if len(set(object_counts)) != 1:
self.fail('Inconsistent object counts: %s' % object_counts)
if len(set(bytes_used)) != 1:
self.fail('Inconsistent bytes used: %s' % bytes_used)
return object_counts[0], bytes_used[0]
repeat = [0]
def do_shard_then_shrink():
repeat[0] += 1
obj_names = ['obj-%s-%03d' % (repeat[0], x)
for x in range(self.max_shard_size)]
self.put_objects(obj_names)
# these two object names will fall at start of first shard range...
alpha = 'alpha-%s' % repeat[0]
beta = 'beta-%s' % repeat[0]
# Enable sharding
client.post_container(
self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
# sanity check
self.assert_container_listing(obj_names)
# Only run the one in charge of scanning
self.sharders.once(
number=self.brain.node_numbers[0],
additional_args='--partitions=%s' % self.brain.part)
# check root container
root_nodes_data = self.direct_get_container_shard_ranges()
self.assertEqual(3, len(root_nodes_data))
# nodes on which sharder has not run are still in unsharded state
# but have had shard ranges replicated to them
exp_obj_count = len(obj_names)
exp_hdrs = {'X-Backend-Sharding-State': 'unsharded',
'X-Container-Object-Count': str(exp_obj_count)}
node_id = self.brain.node_numbers[1] - 1
check_node_data(
root_nodes_data[node_id], exp_hdrs, exp_obj_count, 2)
node_id = self.brain.node_numbers[2] - 1
check_node_data(
root_nodes_data[node_id], exp_hdrs, exp_obj_count, 2)
# only one that ran sharder is in sharded state
exp_hdrs['X-Backend-Sharding-State'] = 'sharded'
node_id = self.brain.node_numbers[0] - 1
check_node_data(
root_nodes_data[node_id], exp_hdrs, exp_obj_count, 2)
orig_range_data = root_nodes_data[node_id][1]
orig_shard_ranges = [ShardRange.from_dict(r)
for r in orig_range_data]
# check first shard
shard_nodes_data = self.direct_get_container_shard_ranges(
orig_shard_ranges[0].account, orig_shard_ranges[0].container)
obj_count, bytes_used = check_shard_nodes_data(shard_nodes_data)
total_shard_object_count = obj_count
# check second shard
shard_nodes_data = self.direct_get_container_shard_ranges(
orig_shard_ranges[1].account, orig_shard_ranges[1].container)
obj_count, bytes_used = check_shard_nodes_data(shard_nodes_data)
total_shard_object_count += obj_count
self.assertEqual(exp_obj_count, total_shard_object_count)
# Now that everyone has shard ranges, run *everyone*
self.sharders.once(
additional_args='--partitions=%s' % self.brain.part)
# all root container nodes should now be in sharded state
root_nodes_data = self.direct_get_container_shard_ranges()
self.assertEqual(3, len(root_nodes_data))
for node_id, node_data in root_nodes_data.items():
with annotate_failure('Node id %s.' % node_id):
check_node_data(node_data, exp_hdrs, exp_obj_count, 2)
# run updaters to update .sharded account; shard containers have
# not updated account since having objects replicated to them
self.updaters.once()
shard_cont_count, shard_obj_count = int_client.get_account_info(
orig_shard_ranges[0].account, [204])
self.assertEqual(2 * repeat[0], shard_cont_count)
# the shards account should always have zero object count to avoid
# double accounting
self.assertEqual(0, shard_obj_count)
# checking the listing also refreshes proxy container info cache so
# that the proxy becomes aware that container is sharded and will
# now look up the shard target for subsequent updates
self.assert_container_listing(obj_names)
# Before writing, kill the cache
self.memcache.delete(get_cache_key(
self.account, self.container_name, shard='updating'))
# delete objects from first shard range
first_shard_objects = [obj_name for obj_name in obj_names
if obj_name <= orig_shard_ranges[0].upper]
for obj in first_shard_objects:
client.delete_object(
self.url, self.token, self.container_name, obj)
with self.assertRaises(ClientException):
client.get_object(
self.url, self.token, self.container_name, obj)
second_shard_objects = [obj_name for obj_name in obj_names
if obj_name > orig_shard_ranges[1].lower]
self.assert_container_listing(second_shard_objects)
# put a new object 'alpha' in first shard range
self.put_objects([alpha])
second_shard_objects = [obj_name for obj_name in obj_names
if obj_name > orig_shard_ranges[1].lower]
self.assert_container_listing([alpha] + second_shard_objects)
# while container servers are down, but proxy has container info in
# cache from recent listing, put another object; this update will
# lurk in async pending until the updaters run again; because all
# the root container servers are down and therefore cannot respond
# to a GET for a redirect target, the object update will default to
# being targeted at the root container
self.stop_container_servers()
# Before writing, kill the cache
self.memcache.delete(get_cache_key(
self.account, self.container_name, shard='updating'))
self.put_objects([beta])
self.brain.servers.start()
async_pendings = self.gather_async_pendings(
self.get_all_object_nodes())
num_container_replicas = len(self.brain.nodes)
num_obj_replicas = self.policy.object_ring.replica_count
expected_num_updates = num_container_updates(
num_container_replicas, quorum_size(num_container_replicas),
num_obj_replicas, self.policy.quorum)
expected_num_pendings = min(expected_num_updates, num_obj_replicas)
# sanity check
with annotate_failure('policy %s. ' % self.policy):
self.assertLengthEqual(async_pendings, expected_num_pendings)
# root object count is not updated...
self.assert_container_object_count(len(obj_names))
self.assert_container_listing([alpha] + second_shard_objects)
root_nodes_data = self.direct_get_container_shard_ranges()
self.assertEqual(3, len(root_nodes_data))
for node_id, node_data in root_nodes_data.items():
with annotate_failure('Node id %s.' % node_id):
check_node_data(node_data, exp_hdrs, exp_obj_count, 2)
range_data = node_data[1]
self.assert_shard_range_lists_equal(
orig_range_data, range_data,
excludes=['meta_timestamp', 'state_timestamp'])
# ...until the sharders run and update root; reclaim tombstones so
# that the shard is shrinkable
shard_0_part = self.get_part_and_node_numbers(
orig_shard_ranges[0])[0]
for conf_index in self.configs['container-sharder'].keys():
self.run_custom_sharder(conf_index, {'reclaim_age': 0},
override_partitions=[shard_0_part])
exp_obj_count = len(second_shard_objects) + 1
self.assert_container_object_count(exp_obj_count)
self.assert_container_listing([alpha] + second_shard_objects)
# root sharder finds donor, acceptor pair and pushes changes
self.sharders.once(
additional_args='--partitions=%s' % self.brain.part)
self.assert_container_listing([alpha] + second_shard_objects)
# run sharder on donor to shrink and replicate to acceptor
self.run_sharders(orig_shard_ranges[0])
self.assert_container_listing([alpha] + second_shard_objects)
# run sharder on acceptor to update root with stats
self.run_sharders(orig_shard_ranges[1])
self.assert_container_listing([alpha] + second_shard_objects)
self.assert_container_object_count(len(second_shard_objects) + 1)
# check root container
root_nodes_data = self.direct_get_container_shard_ranges()
self.assertEqual(3, len(root_nodes_data))
exp_hdrs['X-Container-Object-Count'] = str(exp_obj_count)
for node_id, node_data in root_nodes_data.items():
with annotate_failure('Node id %s.' % node_id):
# NB now only *one* shard range in root
check_node_data(node_data, exp_hdrs, exp_obj_count, 1)
# the acceptor shard is intact..
shard_nodes_data = self.direct_get_container_shard_ranges(
orig_shard_ranges[1].account, orig_shard_ranges[1].container)
obj_count, bytes_used = check_shard_nodes_data(shard_nodes_data)
# all objects should now be in this shard
self.assertEqual(exp_obj_count, obj_count)
# the donor shard is also still intact
donor = orig_shard_ranges[0]
shard_nodes_data = self.direct_get_container_shard_ranges(
donor.account, donor.container)
# the donor's shard range will have the acceptor's projected stats;
# donor also has copy of root shard range that will be ignored;
# note: expected_shards does not include the sharded root range
obj_count, bytes_used = check_shard_nodes_data(
shard_nodes_data, expected_state='sharded', expected_shards=1,
exp_obj_count=len(second_shard_objects) + 1,
exp_sharded_root_range=True)
# but the donor is empty and so reports zero stats
self.assertEqual(0, obj_count)
self.assertEqual(0, bytes_used)
# check the donor own shard range state
part, nodes = self.brain.ring.get_nodes(
donor.account, donor.container)
for node in nodes:
with annotate_failure(node):
broker = self.get_broker(
part, node, donor.account, donor.container)
own_sr = broker.get_own_shard_range()
self.assertEqual(ShardRange.SHRUNK, own_sr.state)
self.assertTrue(own_sr.deleted)
# delete all the second shard's object apart from 'alpha'
for obj in second_shard_objects:
client.delete_object(
self.url, self.token, self.container_name, obj)
self.assert_container_listing([alpha])
# run sharders: second range should not shrink away yet because it
# has tombstones
self.sharders.once() # second shard updates root stats
self.assert_container_listing([alpha])
self.sharders.once() # root finds shrinkable shard
self.assert_container_listing([alpha])
self.sharders.once() # shards shrink themselves
self.assert_container_listing([alpha])
# the acceptor shard is intact...
shard_nodes_data = self.direct_get_container_shard_ranges(
orig_shard_ranges[1].account, orig_shard_ranges[1].container)
obj_count, bytes_used = check_shard_nodes_data(shard_nodes_data)
self.assertEqual(1, obj_count)
# run sharders to reclaim tombstones so that the second shard is
# shrinkable
shard_1_part = self.get_part_and_node_numbers(
orig_shard_ranges[1])[0]
for conf_index in self.configs['container-sharder'].keys():
self.run_custom_sharder(conf_index, {'reclaim_age': 0},
override_partitions=[shard_1_part])
self.assert_container_listing([alpha])
# run sharders so second range shrinks away, requires up to 2
# cycles
self.sharders.once() # root finds shrinkable shard
self.assert_container_listing([alpha])
self.sharders.once() # shards shrink themselves
self.assert_container_listing([alpha])
# the second shard range has sharded and is empty
shard_nodes_data = self.direct_get_container_shard_ranges(
orig_shard_ranges[1].account, orig_shard_ranges[1].container)
check_shard_nodes_data(
shard_nodes_data, expected_state='sharded', expected_shards=1,
exp_obj_count=1)
# check root container
root_nodes_data = self.direct_get_container_shard_ranges()
self.assertEqual(3, len(root_nodes_data))
exp_hdrs = {'X-Backend-Sharding-State': 'collapsed',
# just the alpha object
'X-Container-Object-Count': '1'}
for node_id, node_data in root_nodes_data.items():
with annotate_failure('Node id %s.' % node_id):
# NB now no shard ranges in root
check_node_data(node_data, exp_hdrs, 0, 0)
# delete the alpha object
client.delete_object(
self.url, self.token, self.container_name, alpha)
# should now be able to delete the *apparently* empty container
client.delete_container(self.url, self.token, self.container_name)
self.assert_container_not_found()
self.direct_head_container(expect_failure=True)
# and the container stays deleted even after sharders run and shard
# send updates
self.sharders.once()
self.assert_container_not_found()
self.direct_head_container(expect_failure=True)
# now run updaters to deal with the async pending for the beta
# object
self.updaters.once()
# and the container is revived!
self.assert_container_listing([beta])
# finally, clear out the container
client.delete_object(
self.url, self.token, self.container_name, beta)
do_shard_then_shrink()
# repeat from starting point of a collapsed and previously deleted
# container
do_shard_then_shrink()
def test_delete_root_reclaim(self):
all_obj_names = self._make_object_names(self.max_shard_size)
self.put_objects(all_obj_names)
# Shard the container
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
for n in self.brain.node_numbers:
self.sharders.once(
number=n, additional_args='--partitions=%s' % self.brain.part)
# sanity checks
for node in self.brain.nodes:
self.assert_container_state(node, 'sharded', 2)
self.assert_container_delete_fails()
self.assert_container_has_shard_sysmeta()
self.assert_container_post_ok('sharded')
self.assert_container_listing(all_obj_names)
# delete all objects - updates redirected to shards
self.delete_objects(all_obj_names)
self.assert_container_listing([])
self.assert_container_post_ok('has objects')
# root not yet updated with shard stats
self.assert_container_object_count(len(all_obj_names))
self.assert_container_delete_fails()
self.assert_container_has_shard_sysmeta()
# run sharder on shard containers to update root stats
shard_ranges = self.get_container_shard_ranges()
self.assertLengthEqual(shard_ranges, 2)
self.run_sharders(shard_ranges)
self.assert_container_listing([])
self.assert_container_post_ok('empty')
self.assert_container_object_count(0)
# and now we can delete it!
client.delete_container(self.url, self.token, self.container_name)
self.assert_container_post_fails('deleted')
self.assert_container_not_found()
# see if it will reclaim
Manager(['container-updater']).once()
for conf_file in self.configs['container-replicator'].values():
conf = utils.readconf(conf_file, 'container-replicator')
conf['reclaim_age'] = 0
ContainerReplicator(conf).run_once()
# we don't expect warnings from sharder root audits
for conf_index in self.configs['container-sharder'].keys():
sharder = self.run_custom_sharder(conf_index, {})
self.assertEqual([], sharder.logger.get_lines_for_level('warning'))
# until the root wants to start reclaiming but we haven't shrunk yet!
found_warning = False
for conf_index in self.configs['container-sharder'].keys():
sharder = self.run_custom_sharder(conf_index, {'reclaim_age': 0})
warnings = sharder.logger.get_lines_for_level('warning')
if warnings:
self.assertTrue(warnings[0].startswith(
'Reclaimable db stuck waiting for shrinking'))
self.assertEqual(1, len(warnings))
found_warning = True
self.assertTrue(found_warning)
# TODO: shrink empty shards and assert everything reclaims
def _setup_replication_scenario(self, num_shards, extra_objs=('alpha',)):
# Get cluster to state where 2 replicas are sharding or sharded but 3rd
# replica is unsharded and has an object that the first 2 are missing.
# put objects while all servers are up
obj_names = self._make_object_names(
num_shards * self.max_shard_size // 2)
self.put_objects(obj_names)
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
node_numbers = self.brain.node_numbers
# run replicators first time to get sync points set
self.replicators.once()
# stop the leader node and one other server
self.stop_container_servers(slice(0, 2))
# ...then put one more object in first shard range namespace
self.put_objects(extra_objs)
# start leader and first other server, stop third server
for number in node_numbers[:2]:
self.brain.servers.start(number=number)
self.brain.servers.stop(number=node_numbers[2])
self.assert_container_listing(obj_names) # sanity check
# shard the container - first two shard ranges are cleaved
for number in node_numbers[:2]:
self.sharders.once(
number=number,
additional_args='--partitions=%s' % self.brain.part)
self.assert_container_listing(obj_names) # sanity check
return obj_names
def test_replication_to_sharding_container(self):
# verify that replication from an unsharded replica to a sharding
# replica does not replicate rows but does replicate shard ranges
obj_names = self._setup_replication_scenario(3)
for node in self.brain.nodes[:2]:
self.assert_container_state(node, 'sharding', 3)
# bring third server back up, run replicator
node_numbers = self.brain.node_numbers
self.brain.servers.start(number=node_numbers[2])
# sanity check...
self.assert_container_state(self.brain.nodes[2], 'unsharded', 0)
self.replicators.once(number=node_numbers[2])
# check db files unchanged
found = self.categorize_container_dir_content()
self.assertLengthEqual(found['shard_dbs'], 2)
self.assertLengthEqual(found['normal_dbs'], 3)
# the 'alpha' object is NOT replicated to the two sharded nodes
for node in self.brain.nodes[:2]:
broker = self.get_broker(self.brain.part, node)
with annotate_failure(
'Node id %s in %s' % (node['id'], self.brain.nodes[:2])):
self.assertFalse(broker.get_objects())
self.assert_container_state(node, 'sharding', 3)
self.brain.servers.stop(number=node_numbers[2])
self.assert_container_listing(obj_names)
# all nodes now have shard ranges
self.brain.servers.start(number=node_numbers[2])
node_data = self.direct_get_container_shard_ranges()
for node, (hdrs, shard_ranges) in node_data.items():
with annotate_failure(node):
self.assert_shard_ranges_contiguous(3, shard_ranges)
# complete cleaving third shard range on first two nodes
self.brain.servers.stop(number=node_numbers[2])
for number in node_numbers[:2]:
self.sharders.once(
number=number,
additional_args='--partitions=%s' % self.brain.part)
# ...and now they are in sharded state
self.assert_container_state(self.brain.nodes[0], 'sharded', 3)
self.assert_container_state(self.brain.nodes[1], 'sharded', 3)
# ...still no 'alpha' object in listing
self.assert_container_listing(obj_names)
# run the sharder on the third server, alpha object is included in
# shards that it cleaves
self.brain.servers.start(number=node_numbers[2])
self.assert_container_state(self.brain.nodes[2], 'unsharded', 3)
self.sharders.once(number=node_numbers[2],
additional_args='--partitions=%s' % self.brain.part)
self.assert_container_state(self.brain.nodes[2], 'sharding', 3)
self.sharders.once(number=node_numbers[2],
additional_args='--partitions=%s' % self.brain.part)
self.assert_container_state(self.brain.nodes[2], 'sharded', 3)
self.assert_container_listing(['alpha'] + obj_names)
def test_replication_to_sharded_container(self):
# verify that replication from an unsharded replica to a sharded
# replica does not replicate rows but does replicate shard ranges
obj_names = self._setup_replication_scenario(2)
for node in self.brain.nodes[:2]:
self.assert_container_state(node, 'sharded', 2)
# sanity check
found = self.categorize_container_dir_content()
self.assertLengthEqual(found['shard_dbs'], 2)
self.assertLengthEqual(found['normal_dbs'], 1)
for node in self.brain.nodes[:2]:
broker = self.get_broker(self.brain.part, node)
info = broker.get_info()
with annotate_failure(
'Node id %s in %s' % (node['id'], self.brain.nodes[:2])):
self.assertEqual(len(obj_names), info['object_count'])
self.assertFalse(broker.get_objects())
# bring third server back up, run replicator
node_numbers = self.brain.node_numbers
self.brain.servers.start(number=node_numbers[2])
# sanity check...
self.assert_container_state(self.brain.nodes[2], 'unsharded', 0)
self.replicators.once(number=node_numbers[2])
# check db files unchanged
found = self.categorize_container_dir_content()
self.assertLengthEqual(found['shard_dbs'], 2)
self.assertLengthEqual(found['normal_dbs'], 1)
# the 'alpha' object is NOT replicated to the two sharded nodes
for node in self.brain.nodes[:2]:
broker = self.get_broker(self.brain.part, node)
with annotate_failure(
'Node id %s in %s' % (node['id'], self.brain.nodes[:2])):
self.assertFalse(broker.get_objects())
self.assert_container_state(node, 'sharded', 2)
self.brain.servers.stop(number=node_numbers[2])
self.assert_container_listing(obj_names)
# all nodes now have shard ranges
self.brain.servers.start(number=node_numbers[2])
node_data = self.direct_get_container_shard_ranges()
for node, (hdrs, shard_ranges) in node_data.items():
with annotate_failure(node):
self.assert_shard_ranges_contiguous(2, shard_ranges)
# run the sharder on the third server, alpha object is included in
# shards that it cleaves
self.assert_container_state(self.brain.nodes[2], 'unsharded', 2)
self.sharders.once(number=node_numbers[2],
additional_args='--partitions=%s' % self.brain.part)
self.assert_container_state(self.brain.nodes[2], 'sharded', 2)
self.assert_container_listing(['alpha'] + obj_names)
def test_sharding_requires_sufficient_replication(self):
# verify that cleaving only progresses if each cleaved shard range is
# sufficiently replicated
# put enough objects for 4 shard ranges
obj_names = self._make_object_names(2 * self.max_shard_size)
self.put_objects(obj_names)
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
node_numbers = self.brain.node_numbers
leader_node = self.brain.nodes[0]
leader_num = node_numbers[0]
# run replicators first time to get sync points set
self.replicators.once()
# start sharding on the leader node
self.sharders.once(number=leader_num,
additional_args='--partitions=%s' % self.brain.part)
shard_ranges = self.assert_container_state(leader_node, 'sharding', 4)
self.assertEqual([ShardRange.CLEAVED] * 2 + [ShardRange.CREATED] * 2,
[sr.state for sr in shard_ranges])
# Check the current progress. It shouldn't be complete.
recon = direct_client.direct_get_recon(leader_node, "sharding")
expected_in_progress = {'all': [{'account': 'AUTH_test',
'active': 0,
'cleaved': 2,
'created': 2,
'found': 0,
'db_state': 'sharding',
'state': 'sharding',
'error': None,
'file_size': mock.ANY,
'meta_timestamp': mock.ANY,
'node_index': 0,
'object_count': len(obj_names),
'container': mock.ANY,
'path': mock.ANY,
'root': mock.ANY}]}
actual = recon['sharding_stats']['sharding']['sharding_in_progress']
self.assertEqual(expected_in_progress, actual)
# stop *all* container servers for third shard range
sr_part, sr_node_nums = self.get_part_and_node_numbers(shard_ranges[2])
for node_num in sr_node_nums:
self.brain.servers.stop(number=node_num)
# attempt to continue sharding on the leader node
self.sharders.once(number=leader_num,
additional_args='--partitions=%s' % self.brain.part)
# no cleaving progress was made
for node_num in sr_node_nums:
self.brain.servers.start(number=node_num)
shard_ranges = self.assert_container_state(leader_node, 'sharding', 4)
self.assertEqual([ShardRange.CLEAVED] * 2 + [ShardRange.CREATED] * 2,
[sr.state for sr in shard_ranges])
# stop two of the servers for third shard range, not including any
# server that happens to be the leader node
stopped = []
for node_num in sr_node_nums:
if node_num != leader_num:
self.brain.servers.stop(number=node_num)
stopped.append(node_num)
if len(stopped) >= 2:
break
self.assertLengthEqual(stopped, 2) # sanity check
# attempt to continue sharding on the leader node
self.sharders.once(number=leader_num,
additional_args='--partitions=%s' % self.brain.part)
# no cleaving progress was made
for node_num in stopped:
self.brain.servers.start(number=node_num)
shard_ranges = self.assert_container_state(leader_node, 'sharding', 4)
self.assertEqual([ShardRange.CLEAVED] * 2 + [ShardRange.CREATED] * 2,
[sr.state for sr in shard_ranges])
# stop just one of the servers for third shard range
stopped = []
for node_num in sr_node_nums:
if node_num != leader_num:
self.brain.servers.stop(number=node_num)
stopped.append(node_num)
break
self.assertLengthEqual(stopped, 1) # sanity check
# attempt to continue sharding the container
self.sharders.once(number=leader_num,
additional_args='--partitions=%s' % self.brain.part)
# this time cleaving completed
self.brain.servers.start(number=stopped[0])
shard_ranges = self.assert_container_state(leader_node, 'sharded', 4)
self.assertEqual([ShardRange.ACTIVE] * 4,
[sr.state for sr in shard_ranges])
# Check the leader's progress again, this time is should be complete
recon = direct_client.direct_get_recon(leader_node, "sharding")
expected_in_progress = {'all': [{'account': 'AUTH_test',
'active': 4,
'cleaved': 0,
'created': 0,
'found': 0,
'db_state': 'sharded',
'state': 'sharded',
'error': None,
'file_size': mock.ANY,
'meta_timestamp': mock.ANY,
'node_index': 0,
'object_count': len(obj_names),
'container': mock.ANY,
'path': mock.ANY,
'root': mock.ANY}]}
actual = recon['sharding_stats']['sharding']['sharding_in_progress']
self.assertEqual(expected_in_progress, actual)
def test_sharded_delete(self):
all_obj_names = self._make_object_names(self.max_shard_size)
self.put_objects(all_obj_names)
# Shard the container
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
for n in self.brain.node_numbers:
self.sharders.once(
number=n, additional_args='--partitions=%s' % self.brain.part)
# sanity checks
for node in self.brain.nodes:
self.assert_container_state(node, 'sharded', 2)
self.assert_container_delete_fails()
self.assert_container_has_shard_sysmeta()
self.assert_container_post_ok('sharded')
self.assert_container_listing(all_obj_names)
# delete all objects - updates redirected to shards
self.delete_objects(all_obj_names)
self.assert_container_listing([])
self.assert_container_post_ok('has objects')
# root not yet updated with shard stats
self.assert_container_object_count(len(all_obj_names))
self.assert_container_delete_fails()
self.assert_container_has_shard_sysmeta()
# run sharder on shard containers to update root stats
shard_ranges = self.get_container_shard_ranges()
self.assertLengthEqual(shard_ranges, 2)
self.run_sharders(shard_ranges)
self.assert_container_listing([])
self.assert_container_post_ok('empty')
self.assert_container_object_count(0)
# put a new object - update redirected to shard
self.put_objects(['alpha'])
self.assert_container_listing(['alpha'])
self.assert_container_object_count(0)
# before root learns about new object in shard, delete the container
client.delete_container(self.url, self.token, self.container_name)
self.assert_container_post_fails('deleted')
self.assert_container_not_found()
# run the sharders to update root with shard stats
self.run_sharders(shard_ranges)
self.assert_container_listing(['alpha'])
self.assert_container_object_count(1)
self.assert_container_delete_fails()
self.assert_container_post_ok('revived')
def test_object_update_redirection(self):
all_obj_names = self._make_object_names(self.max_shard_size)
self.put_objects(all_obj_names)
# Shard the container
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
for n in self.brain.node_numbers:
self.sharders.once(
number=n, additional_args='--partitions=%s' % self.brain.part)
# sanity checks
for node in self.brain.nodes:
self.assert_container_state(node, 'sharded', 2)
self.assert_container_delete_fails()
self.assert_container_has_shard_sysmeta()
self.assert_container_post_ok('sharded')
self.assert_container_listing(all_obj_names)
# delete all objects - updates redirected to shards
self.delete_objects(all_obj_names)
self.assert_container_listing([])
self.assert_container_post_ok('has objects')
# run sharder on shard containers to update root stats; reclaim
# the tombstones so that the shards appear to be shrinkable
shard_ranges = self.get_container_shard_ranges()
self.assertLengthEqual(shard_ranges, 2)
shard_partitions = [self.get_part_and_node_numbers(sr)[0]
for sr in shard_ranges]
for conf_index in self.configs['container-sharder'].keys():
self.run_custom_sharder(conf_index, {'reclaim_age': 0},
override_partitions=shard_partitions)
self.assert_container_object_count(0)
# First, test a misplaced object moving from one shard to another.
# with one shard server down, put a new 'alpha' object...
shard_part, shard_nodes = self.get_part_and_node_numbers(
shard_ranges[0])
self.brain.servers.stop(number=shard_nodes[2])
self.put_objects(['alpha'])
self.assert_container_listing(['alpha'])
self.assert_container_object_count(0)
self.assertLengthEqual(
self.gather_async_pendings(self.get_all_object_nodes()), 1)
self.brain.servers.start(number=shard_nodes[2])
# run sharder on root to discover first shrink candidate
self.sharders.once(additional_args='--partitions=%s' % self.brain.part)
# then run sharder on the shard node without the alpha object
self.sharders.once(additional_args='--partitions=%s' % shard_part,
number=shard_nodes[2])
# root sees first shard has shrunk
self.assertLengthEqual(self.get_container_shard_ranges(), 1)
# cached shard ranges still show first shard range as active so listing
# will include 'alpha' if the shard listing is fetched from node (0,1)
# but not if fetched from node 2; to achieve predictability we use
# x-newest to use shard ranges from the root so that only the second
# shard range is used for listing, so alpha object not in listing
self.assert_container_listing([], req_hdrs={'x-newest': 'true'})
self.assert_container_object_count(0)
# run the updaters: the async pending update will be redirected from
# shrunk shard to second shard
self.updaters.once()
self.assert_container_listing(['alpha'])
self.assert_container_object_count(0) # root not yet updated
# then run sharder on other shard nodes to complete shrinking
for number in shard_nodes[:2]:
self.sharders.once(additional_args='--partitions=%s' % shard_part,
number=number)
# and get root updated
self.run_sharders(shard_ranges[1])
self.assert_container_listing(['alpha'])
self.assert_container_object_count(1)
self.assertLengthEqual(self.get_container_shard_ranges(), 1)
# Now we have just one active shard, test a misplaced object moving
# from that shard to the root.
# with one shard server down, delete 'alpha' and put a 'beta' object...
shard_part, shard_nodes = self.get_part_and_node_numbers(
shard_ranges[1])
self.brain.servers.stop(number=shard_nodes[2])
# Before writing, kill the cache
self.memcache.delete(get_cache_key(
self.account, self.container_name, shard='updating'))
self.delete_objects(['alpha'])
self.put_objects(['beta'])
self.assert_container_listing(['beta'])
self.assert_container_object_count(1)
self.assertLengthEqual(
self.gather_async_pendings(self.get_all_object_nodes()), 2)
self.brain.servers.start(number=shard_nodes[2])
# run sharder on root to discover second shrink candidate - root is not
# yet aware of the beta object
self.sharders.once(additional_args='--partitions=%s' % self.brain.part)
# then run sharder on the shard node without the beta object, to shrink
# it to root - note this moves stale copy of alpha to the root db
self.sharders.once(additional_args='--partitions=%s' % shard_part,
number=shard_nodes[2])
# now there are no active shards
self.assertFalse(self.get_container_shard_ranges())
# with other two shard servers down, listing won't find beta object
for number in shard_nodes[:2]:
self.brain.servers.stop(number=number)
self.assert_container_listing(['alpha'])
self.assert_container_object_count(1)
# run the updaters: the async pending update will be redirected from
# shrunk shard to the root
self.updaters.once()
self.assert_container_listing(['beta'])
self.assert_container_object_count(1)
def test_misplaced_object_movement(self):
def merge_object(shard_range, name, deleted=0):
# it's hard to get a test to put a misplaced object into a shard,
# so this hack is used force an object record directly into a shard
# container db. Note: the actual object won't exist, we're just
# using this to test object records in container dbs.
shard_part, shard_nodes = self.brain.ring.get_nodes(
shard_range.account, shard_range.container)
shard_broker = self.get_broker(
shard_part, shard_nodes[0], shard_range.account,
shard_range.container)
shard_broker.merge_items(
[{'name': name, 'created_at': Timestamp.now().internal,
'size': 0, 'content_type': 'text/plain',
'etag': md5(usedforsecurity=False).hexdigest(),
'deleted': deleted,
'storage_policy_index': shard_broker.storage_policy_index}])
return shard_nodes[0]
all_obj_names = self._make_object_names(self.max_shard_size)
self.put_objects(all_obj_names)
# Shard the container
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
for n in self.brain.node_numbers:
self.sharders.once(
number=n, additional_args='--partitions=%s' % self.brain.part)
# sanity checks
for node in self.brain.nodes:
self.assert_container_state(node, 'sharded', 2)
self.assert_container_delete_fails()
self.assert_container_has_shard_sysmeta()
self.assert_container_post_ok('sharded')
self.assert_container_listing(all_obj_names)
# delete all objects in first shard range - updates redirected to shard
shard_ranges = self.get_container_shard_ranges()
self.assertLengthEqual(shard_ranges, 2)
shard_0_objects = [name for name in all_obj_names
if name in shard_ranges[0]]
shard_1_objects = [name for name in all_obj_names
if name in shard_ranges[1]]
self.delete_objects(shard_0_objects)
self.assert_container_listing(shard_1_objects)
self.assert_container_post_ok('has objects')
# run sharder on first shard container to update root stats; reclaim
# the tombstones so that the shard appears to be shrinkable
shard_0_part = self.get_part_and_node_numbers(shard_ranges[0])[0]
for conf_index in self.configs['container-sharder'].keys():
self.run_custom_sharder(conf_index, {'reclaim_age': 0},
override_partitions=[shard_0_part])
self.assert_container_object_count(len(shard_1_objects))
# First, test a misplaced object moving from one shard to another.
# run sharder on root to discover first shrink candidate
self.sharders.once(additional_args='--partitions=%s' % self.brain.part)
# then run sharder on first shard range to shrink it
self.run_sharders(shard_ranges[0])
# force a misplaced object into the shrunken shard range to simulate
# a client put that was in flight when it started to shrink
misplaced_node = merge_object(shard_ranges[0], 'alpha', deleted=0)
# root sees first shard has shrunk, only second shard range used for
# listing so alpha object not in listing
self.assertLengthEqual(self.get_container_shard_ranges(), 1)
self.assert_container_listing(shard_1_objects)
self.assert_container_object_count(len(shard_1_objects))
# until sharder runs on that node to move the misplaced object to the
# second shard range
shard_part, shard_nodes_numbers = self.get_part_and_node_numbers(
shard_ranges[0])
self.sharders.once(additional_args='--partitions=%s' % shard_part,
number=misplaced_node['id'] + 1)
self.assert_container_listing(['alpha'] + shard_1_objects)
# root not yet updated
self.assert_container_object_count(len(shard_1_objects))
# run sharder to get root updated
self.run_sharders(shard_ranges[1])
self.assert_container_listing(['alpha'] + shard_1_objects)
self.assert_container_object_count(len(shard_1_objects) + 1)
self.assertLengthEqual(self.get_container_shard_ranges(), 1)
# Now we have just one active shard, test a misplaced object moving
# from that shard to the root.
# delete most objects from second shard range, reclaim the tombstones,
# and run sharder on root to discover second shrink candidate
self.delete_objects(shard_1_objects)
shard_1_part = self.get_part_and_node_numbers(shard_ranges[1])[0]
for conf_index in self.configs['container-sharder'].keys():
self.run_custom_sharder(conf_index, {'reclaim_age': 0},
override_partitions=[shard_1_part])
self.sharders.once(additional_args='--partitions=%s' % self.brain.part)
# then run sharder on the shard node to shrink it to root - note this
# moves alpha to the root db
self.run_sharders(shard_ranges[1])
# now there are no active shards
self.assertFalse(self.get_container_shard_ranges())
# force some misplaced object updates into second shrunk shard range
merge_object(shard_ranges[1], 'alpha', deleted=1)
misplaced_node = merge_object(shard_ranges[1], 'beta', deleted=0)
# root is not yet aware of them
self.assert_container_listing(['alpha'])
self.assert_container_object_count(1)
# until sharder runs on that node to move the misplaced object
shard_part, shard_nodes_numbers = self.get_part_and_node_numbers(
shard_ranges[1])
self.sharders.once(additional_args='--partitions=%s' % shard_part,
number=misplaced_node['id'] + 1)
self.assert_container_listing(['beta'])
self.assert_container_object_count(1)
self.assert_container_delete_fails()
def test_misplaced_object_movement_from_deleted_shard(self):
def merge_object(shard_range, name, deleted=0):
# it's hard to get a test to put a misplaced object into a shard,
# so this hack is used force an object record directly into a shard
# container db. Note: the actual object won't exist, we're just
# using this to test object records in container dbs.
shard_part, shard_nodes = self.brain.ring.get_nodes(
shard_range.account, shard_range.container)
shard_broker = self.get_shard_broker(shard_range)
# In this test we want to merge into a deleted container shard
shard_broker.delete_db(Timestamp.now().internal)
shard_broker.merge_items(
[{'name': name, 'created_at': Timestamp.now().internal,
'size': 0, 'content_type': 'text/plain',
'etag': md5(usedforsecurity=False).hexdigest(),
'deleted': deleted,
'storage_policy_index': shard_broker.storage_policy_index}])
return shard_nodes[0]
all_obj_names = self._make_object_names(self.max_shard_size)
self.put_objects(all_obj_names)
# Shard the container
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
for n in self.brain.node_numbers:
self.sharders.once(
number=n, additional_args='--partitions=%s' % self.brain.part)
# sanity checks
for node in self.brain.nodes:
self.assert_container_state(node, 'sharded', 2)
self.assert_container_delete_fails()
self.assert_container_has_shard_sysmeta()
self.assert_container_post_ok('sharded')
self.assert_container_listing(all_obj_names)
# delete all objects in first shard range - updates redirected to shard
shard_ranges = self.get_container_shard_ranges()
self.assertLengthEqual(shard_ranges, 2)
shard_0_objects = [name for name in all_obj_names
if name in shard_ranges[0]]
shard_1_objects = [name for name in all_obj_names
if name in shard_ranges[1]]
self.delete_objects(shard_0_objects)
self.assert_container_listing(shard_1_objects)
self.assert_container_post_ok('has objects')
# run sharder on first shard container to update root stats
shard_0_part = self.get_part_and_node_numbers(shard_ranges[0])[0]
for conf_index in self.configs['container-sharder'].keys():
self.run_custom_sharder(conf_index, {'reclaim_age': 0},
override_partitions=[shard_0_part])
self.assert_container_object_count(len(shard_1_objects))
# First, test a misplaced object moving from one shard to another.
# run sharder on root to discover first shrink candidate
self.sharders.once(additional_args='--partitions=%s' % self.brain.part)
# then run sharder on first shard range to shrink it
self.run_sharders(shard_ranges[0])
# force a misplaced object into the shrunken shard range to simulate
# a client put that was in flight when it started to shrink
misplaced_node = merge_object(shard_ranges[0], 'alpha', deleted=0)
# root sees first shard has shrunk, only second shard range used for
# listing so alpha object not in listing
self.assertLengthEqual(self.get_container_shard_ranges(), 1)
self.assert_container_listing(shard_1_objects)
self.assert_container_object_count(len(shard_1_objects))
# until sharder runs on that node to move the misplaced object to the
# second shard range
shard_part, shard_nodes_numbers = self.get_part_and_node_numbers(
shard_ranges[0])
self.sharders.once(additional_args='--partitions=%s' % shard_part,
number=misplaced_node['id'] + 1)
self.assert_container_listing(['alpha'] + shard_1_objects)
# root not yet updated
self.assert_container_object_count(len(shard_1_objects))
# check the deleted shard did not push the wrong root path into the
# other container
for replica in 0, 1, 2:
shard_x_broker = self.get_shard_broker(shard_ranges[1], replica)
self.assertEqual("%s/%s" % (self.account, self.container_name),
shard_x_broker.root_path)
# run the sharder of the existing shard to update the root stats
# to prove the misplaced object was moved to the other shard _and_
# the other shard still has the correct root because it updates root's
# stats
self.run_sharders(shard_ranges[1])
self.assert_container_object_count(len(shard_1_objects) + 1)
def test_replication_to_sharded_container_from_unsharded_old_primary(self):
primary_ids = [n['id'] for n in self.brain.nodes]
handoff_node = next(n for n in self.brain.ring.devs
if n['id'] not in primary_ids)
# start with two sharded replicas and one unsharded with extra object
obj_names = self._setup_replication_scenario(2)
for node in self.brain.nodes[:2]:
self.assert_container_state(node, 'sharded', 2)
# Fake a ring change - copy unsharded db which has no shard ranges to a
# handoff to create illusion of a new unpopulated primary node
node_numbers = self.brain.node_numbers
new_primary_node = self.brain.nodes[2]
new_primary_node_number = node_numbers[2]
new_primary_dir, container_hash = self.get_storage_dir(
self.brain.part, new_primary_node)
old_primary_dir, container_hash = self.get_storage_dir(
self.brain.part, handoff_node)
utils.mkdirs(os.path.dirname(old_primary_dir))
shutil.move(new_primary_dir, old_primary_dir)
# make the cluster more or less "healthy" again
self.brain.servers.start(number=new_primary_node_number)
# get a db on every node...
client.put_container(self.url, self.token, self.container_name)
self.assertTrue(os.path.exists(os.path.join(
new_primary_dir, container_hash + '.db')))
found = self.categorize_container_dir_content()
self.assertLengthEqual(found['normal_dbs'], 1) # "new" primary
self.assertLengthEqual(found['shard_dbs'], 2) # existing primaries
# catastrophic failure! drive dies and is replaced on unchanged primary
failed_node = self.brain.nodes[0]
failed_dir, _container_hash = self.get_storage_dir(
self.brain.part, failed_node)
shutil.rmtree(failed_dir)
# replicate the "old primary" to everybody except the "new primary"
self.brain.servers.stop(number=new_primary_node_number)
self.replicators.once(number=handoff_node['id'] + 1)
# We're willing to rsync the retiring db to the failed primary.
# This may or may not have shard ranges, depending on the order in
# which we hit the primaries, but it definitely *doesn't* have an
# epoch in its name yet. All objects are replicated.
self.assertTrue(os.path.exists(os.path.join(
failed_dir, container_hash + '.db')))
self.assertLengthEqual(os.listdir(failed_dir), 1)
broker = self.get_broker(self.brain.part, failed_node)
self.assertLengthEqual(broker.get_objects(), len(obj_names) + 1)
# The other out-of-date primary is within usync range but objects are
# not replicated to it because the handoff db learns about shard ranges
broker = self.get_broker(self.brain.part, self.brain.nodes[1])
self.assertLengthEqual(broker.get_objects(), 0)
# Handoff db still exists and now has shard ranges!
self.assertTrue(os.path.exists(os.path.join(
old_primary_dir, container_hash + '.db')))
broker = self.get_broker(self.brain.part, handoff_node)
shard_ranges = broker.get_shard_ranges()
self.assertLengthEqual(shard_ranges, 2)
self.assert_container_state(handoff_node, 'unsharded', 2)
# Replicate again, this time *including* "new primary"
self.brain.servers.start(number=new_primary_node_number)
self.replicators.once(number=handoff_node['id'] + 1)
# Ordinarily, we would have rsync_then_merge'd to "new primary"
# but instead we wait
broker = self.get_broker(self.brain.part, new_primary_node)
self.assertLengthEqual(broker.get_objects(), 0)
shard_ranges = broker.get_shard_ranges()
self.assertLengthEqual(shard_ranges, 2)
# so the next time the sharder comes along, it can push rows out
# and delete the big db
self.sharders.once(number=handoff_node['id'] + 1,
additional_args='--partitions=%s' % self.brain.part)
self.assert_container_state(handoff_node, 'sharded', 2)
self.assertFalse(os.path.exists(os.path.join(
old_primary_dir, container_hash + '.db')))
# the sharded db hangs around until replication confirms durability
# first attempt is not sufficiently successful
self.brain.servers.stop(number=node_numbers[0])
self.replicators.once(number=handoff_node['id'] + 1)
self.assertTrue(os.path.exists(old_primary_dir))
self.assert_container_state(handoff_node, 'sharded', 2)
# second attempt is successful and handoff db is deleted
self.brain.servers.start(number=node_numbers[0])
self.replicators.once(number=handoff_node['id'] + 1)
self.assertFalse(os.path.exists(old_primary_dir))
# run all the sharders, get us into a consistent state
self.sharders.once(additional_args='--partitions=%s' % self.brain.part)
self.assert_container_listing(['alpha'] + obj_names)
def test_replication_to_empty_new_primary_from_sharding_old_primary(self):
primary_ids = [n['id'] for n in self.brain.nodes]
handoff_node = next(n for n in self.brain.ring.devs
if n['id'] not in primary_ids)
num_shards = 3
obj_names = self._make_object_names(
num_shards * self.max_shard_size // 2)
self.put_objects(obj_names)
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
# run replicators first time to get sync points set
self.replicators.once()
# start sharding on only the leader node
leader_node = self.brain.nodes[0]
leader_node_number = self.brain.node_numbers[0]
self.sharders.once(number=leader_node_number)
self.assert_container_state(leader_node, 'sharding', 3)
for node in self.brain.nodes[1:]:
self.assert_container_state(node, 'unsharded', 3)
# Fake a ring change - copy leader node db to a handoff to create
# illusion of a new unpopulated primary leader node
new_primary_dir, container_hash = self.get_storage_dir(
self.brain.part, leader_node)
old_primary_dir, container_hash = self.get_storage_dir(
self.brain.part, handoff_node)
utils.mkdirs(os.path.dirname(old_primary_dir))
shutil.move(new_primary_dir, old_primary_dir)
self.assert_container_state(handoff_node, 'sharding', 3)
# run replicator on handoff node to create a fresh db on new primary
self.assertFalse(os.path.exists(new_primary_dir))
self.replicators.once(number=handoff_node['id'] + 1)
self.assertTrue(os.path.exists(new_primary_dir))
self.assert_container_state(leader_node, 'sharded', 3)
broker = self.get_broker(self.brain.part, leader_node)
shard_ranges = broker.get_shard_ranges()
self.assertLengthEqual(shard_ranges, 3)
self.assertEqual(
[ShardRange.CLEAVED, ShardRange.CLEAVED, ShardRange.CREATED],
[sr.state for sr in shard_ranges])
# db still exists on handoff
self.assertTrue(os.path.exists(old_primary_dir))
self.assert_container_state(handoff_node, 'sharding', 3)
# continue sharding it...
self.sharders.once(number=handoff_node['id'] + 1)
self.assert_container_state(leader_node, 'sharded', 3)
# now handoff is fully sharded the replicator will delete it
self.replicators.once(number=handoff_node['id'] + 1)
self.assertFalse(os.path.exists(old_primary_dir))
# all primaries now have active shard ranges but only one is in sharded
# state
self.assert_container_state(leader_node, 'sharded', 3)
for node in self.brain.nodes[1:]:
self.assert_container_state(node, 'unsharded', 3)
node_data = self.direct_get_container_shard_ranges()
for node_id, (hdrs, shard_ranges) in node_data.items():
with annotate_failure(
'node id %s from %s' % (node_id, node_data.keys)):
self.assert_shard_range_state(ShardRange.ACTIVE, shard_ranges)
# check handoff cleaved all objects before it was deleted - stop all
# but leader node so that listing is fetched from shards
for number in self.brain.node_numbers[1:3]:
self.brain.servers.stop(number=number)
self.assert_container_listing(obj_names)
for number in self.brain.node_numbers[1:3]:
self.brain.servers.start(number=number)
self.sharders.once()
self.assert_container_state(leader_node, 'sharded', 3)
for node in self.brain.nodes[1:]:
self.assert_container_state(node, 'sharding', 3)
self.sharders.once()
for node in self.brain.nodes:
self.assert_container_state(node, 'sharded', 3)
self.assert_container_listing(obj_names)
def test_sharded_account_updates(self):
# verify that .shards account updates have zero object count and bytes
# to avoid double accounting
all_obj_names = self._make_object_names(self.max_shard_size)
self.put_objects(all_obj_names, contents='xyz')
# Shard the container into 2 shards
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
for n in self.brain.node_numbers:
self.sharders.once(
number=n, additional_args='--partitions=%s' % self.brain.part)
# sanity checks
for node in self.brain.nodes:
shard_ranges = self.assert_container_state(node, 'sharded', 2)
self.assert_container_delete_fails()
self.assert_container_has_shard_sysmeta()
self.assert_container_post_ok('sharded')
self.assert_container_listing(all_obj_names)
# run the updaters to get account stats updated
self.updaters.once()
# check user account stats
metadata = self.internal_client.get_account_metadata(self.account)
self.assertEqual(1, int(metadata.get('x-account-container-count')))
self.assertEqual(self.max_shard_size,
int(metadata.get('x-account-object-count')))
self.assertEqual(3 * self.max_shard_size,
int(metadata.get('x-account-bytes-used')))
# check hidden .shards account stats
metadata = self.internal_client.get_account_metadata(
shard_ranges[0].account)
self.assertEqual(2, int(metadata.get('x-account-container-count')))
self.assertEqual(0, int(metadata.get('x-account-object-count')))
self.assertEqual(0, int(metadata.get('x-account-bytes-used')))
class TestContainerShardingMoreUTF8(TestContainerSharding):
def _make_object_names(self, number):
# override default with names that include non-ascii chars
name_length = self.cluster_info['swift']['max_object_name_length']
obj_names = []
for x in range(number):
name = (u'obj-\u00e4\u00ea\u00ec\u00f2\u00fb-%04d' % x)
name = name.encode('utf8').ljust(name_length, b'o')
if not six.PY2:
name = name.decode('utf8')
obj_names.append(name)
return obj_names
def _setup_container_name(self):
# override default with max length name that includes non-ascii chars
super(TestContainerShardingMoreUTF8, self)._setup_container_name()
name_length = self.cluster_info['swift']['max_container_name_length']
cont_name = \
self.container_name + u'-\u00e4\u00ea\u00ec\u00f2\u00fb\u1234'
self.container_name = cont_name.encode('utf8').ljust(name_length, b'x')
if not six.PY2:
self.container_name = self.container_name.decode('utf8')
class TestManagedContainerSharding(BaseTestContainerSharding):
'''Test sharding using swift-manage-shard-ranges'''
def sharders_once(self, **kwargs):
# inhibit auto_sharding regardless of the config setting
additional_args = kwargs.get('additional_args', [])
if not isinstance(additional_args, list):
additional_args = [additional_args]
additional_args.append('--no-auto-shard')
kwargs['additional_args'] = additional_args
self.sharders.once(**kwargs)
def test_manage_shard_ranges(self):
obj_names = self._make_object_names(7)
self.put_objects(obj_names)
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
# run replicators first time to get sync points set
self.replicators.once()
# sanity check: we don't have nearly enough objects for this to shard
# automatically
self.sharders_once(number=self.brain.node_numbers[0],
additional_args='--partitions=%s' % self.brain.part)
self.assert_container_state(self.brain.nodes[0], 'unsharded', 0)
self.assert_subprocess_success([
'swift-manage-shard-ranges',
self.get_db_file(self.brain.part, self.brain.nodes[0]),
'find_and_replace', '3', '--enable', '--minimum-shard-size', '2'])
self.assert_container_state(self.brain.nodes[0], 'unsharded', 2)
# "Run container-replicator to replicate them to other nodes."
self.replicators.once()
# "Run container-sharder on all nodes to shard the container."
self.sharders_once(additional_args='--partitions=%s' % self.brain.part)
# Everybody's settled
self.assert_container_state(self.brain.nodes[0], 'sharded', 2)
self.assert_container_state(self.brain.nodes[1], 'sharded', 2)
self.assert_container_state(self.brain.nodes[2], 'sharded', 2)
self.assert_container_listing(obj_names)
def test_manage_shard_ranges_compact(self):
# verify shard range compaction using swift-manage-shard-ranges
obj_names = self._make_object_names(8)
self.put_objects(obj_names)
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
# run replicators first time to get sync points set, and get container
# sharded into 4 shards
self.replicators.once()
self.assert_subprocess_success([
'swift-manage-shard-ranges',
self.get_db_file(self.brain.part, self.brain.nodes[0]),
'find_and_replace', '2', '--enable'])
self.assert_container_state(self.brain.nodes[0], 'unsharded', 4)
self.replicators.once()
# run sharders twice to cleave all 4 shard ranges
self.sharders_once(additional_args='--partitions=%s' % self.brain.part)
self.sharders_once(additional_args='--partitions=%s' % self.brain.part)
self.assert_container_state(self.brain.nodes[0], 'sharded', 4)
self.assert_container_state(self.brain.nodes[1], 'sharded', 4)
self.assert_container_state(self.brain.nodes[2], 'sharded', 4)
self.assert_container_listing(obj_names)
# now compact some ranges; use --max-shrinking to allow 2 shrinking
# shards
self.assert_subprocess_success([
'swift-manage-shard-ranges',
self.get_db_file(self.brain.part, self.brain.nodes[0]),
'compact', '--max-expanding', '1', '--max-shrinking', '2',
'--yes'])
shard_ranges = self.assert_container_state(
self.brain.nodes[0], 'sharded', 4)
self.assertEqual([ShardRange.SHRINKING] * 2 + [ShardRange.ACTIVE] * 2,
[sr.state for sr in shard_ranges])
self.replicators.once()
self.sharders_once()
# check there's now just 2 remaining shard ranges
shard_ranges = self.assert_container_state(
self.brain.nodes[0], 'sharded', 2)
self.assertEqual([ShardRange.ACTIVE] * 2,
[sr.state for sr in shard_ranges])
self.assert_container_listing(obj_names, req_hdrs={'X-Newest': 'True'})
# root container own shard range should still be SHARDED
for i, node in enumerate(self.brain.nodes):
with annotate_failure('node[%d]' % i):
broker = self.get_broker(self.brain.part, self.brain.nodes[0])
self.assertEqual(ShardRange.SHARDED,
broker.get_own_shard_range().state)
# now compact the final two shard ranges to the root; use
# --max-shrinking to allow 2 shrinking shards
self.assert_subprocess_success([
'swift-manage-shard-ranges',
self.get_db_file(self.brain.part, self.brain.nodes[0]),
'compact', '--yes', '--max-shrinking', '2'])
shard_ranges = self.assert_container_state(
self.brain.nodes[0], 'sharded', 2)
self.assertEqual([ShardRange.SHRINKING] * 2,
[sr.state for sr in shard_ranges])
self.replicators.once()
self.sharders_once()
self.assert_container_state(self.brain.nodes[0], 'collapsed', 0)
self.assert_container_listing(obj_names, req_hdrs={'X-Newest': 'True'})
# root container own shard range should now be ACTIVE
for i, node in enumerate(self.brain.nodes):
with annotate_failure('node[%d]' % i):
broker = self.get_broker(self.brain.part, self.brain.nodes[0])
self.assertEqual(ShardRange.ACTIVE,
broker.get_own_shard_range().state)
def test_manage_shard_ranges_repair_root(self):
# provoke overlaps in root container and repair
obj_names = self._make_object_names(16)
self.put_objects(obj_names)
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
# run replicators first time to get sync points set
self.replicators.once()
# find 4 shard ranges on nodes[0] - let's denote these ranges 0.0, 0.1,
# 0.2 and 0.3 that are installed with epoch_0
self.assert_subprocess_success([
'swift-manage-shard-ranges',
self.get_db_file(self.brain.part, self.brain.nodes[0]),
'find_and_replace', '4', '--enable'])
shard_ranges_0 = self.assert_container_state(self.brain.nodes[0],
'unsharded', 4)
# *Also* go find 3 shard ranges on *another node*, like a dumb-dumb -
# let's denote these ranges 1.0, 1.1 and 1.2 that are installed with
# epoch_1
self.assert_subprocess_success([
'swift-manage-shard-ranges',
self.get_db_file(self.brain.part, self.brain.nodes[1]),
'find_and_replace', '7', '--enable'])
shard_ranges_1 = self.assert_container_state(self.brain.nodes[1],
'unsharded', 3)
# Run sharder in specific order so that the replica with the older
# epoch_0 starts sharding first - this will prove problematic later!
# On first pass the first replica passes audit, creates shards and then
# syncs shard ranges with the other replicas, so it has a mix of 0.*
# shard ranges in CLEAVED state and 1.* ranges in FOUND state. It
# proceeds to cleave shard 0.0, but after 0.0 cleaving stalls because
# next in iteration is shard range 1.0 in FOUND state from the other
# replica that it cannot yet cleave.
self.sharders_once(number=self.brain.node_numbers[0],
additional_args='--partitions=%s' % self.brain.part)
# On first pass the second replica passes audit (it has its own found
# ranges and the first replica's created shard ranges but none in the
# same state overlap), creates its shards and then syncs shard ranges
# with the other replicas. All of the 7 shard ranges on this replica
# are now in CREATED state so it proceeds to cleave the first two shard
# ranges, 0.1 and 1.0.
self.sharders_once(number=self.brain.node_numbers[1],
additional_args='--partitions=%s' % self.brain.part)
self.replicators.once()
# Uh-oh
self.assert_container_state(self.brain.nodes[0], 'sharding', 7)
self.assert_container_state(self.brain.nodes[1], 'sharding', 7)
# There's a race: the third replica may be sharding, may be unsharded
# Try it again a few times
self.sharders_once(additional_args='--partitions=%s' % self.brain.part)
self.replicators.once()
self.sharders_once(additional_args='--partitions=%s' % self.brain.part)
# It's not really fixing itself... the sharder audit will detect
# overlapping ranges which prevents cleaving proceeding; expect the
# shard ranges to be mostly still in created state, with one or two
# possibly cleaved during first pass before the sharding got stalled
shard_ranges = self.assert_container_state(self.brain.nodes[0],
'sharding', 7)
self.assertEqual([ShardRange.CLEAVED] * 2 + [ShardRange.CREATED] * 5,
[sr.state for sr in shard_ranges])
shard_ranges = self.assert_container_state(self.brain.nodes[1],
'sharding', 7)
self.assertEqual([ShardRange.CLEAVED] * 2 + [ShardRange.CREATED] * 5,
[sr.state for sr in shard_ranges])
# But hey, at least listings still work! They're just going to get
# horribly out of date as more objects are added
self.assert_container_listing(obj_names)
# 'swift-manage-shard-ranges repair' will choose the second set of 3
# shard ranges (1.*) over the first set of 4 (0.*) because that's the
# path with most cleaving progress, and so shrink shard ranges 0.*.
db_file = self.get_db_file(self.brain.part, self.brain.nodes[0])
self.assert_subprocess_success(
['swift-manage-shard-ranges', db_file, 'repair', '--yes'])
# make sure all root replicas now sync their shard ranges
self.replicators.once()
# Run sharder on the shrinking shards. This should not change the state
# of any of the acceptors, particularly the ones that have yet to have
# object cleaved from the roots, because we don't want the as yet
# uncleaved acceptors becoming prematurely active and creating 'holes'
# in listings. The shrinking shard ranges should however get deleted in
# root container table.
self.run_sharders(shard_ranges_0)
shard_ranges = self.assert_container_state(self.brain.nodes[1],
'sharding', 3)
self.assertEqual([ShardRange.CLEAVED] * 1 + [ShardRange.CREATED] * 2,
[sr.state for sr in shard_ranges])
self.assert_container_listing(obj_names)
# check the unwanted shards did shrink away...
for shard_range in shard_ranges_0:
with annotate_failure(shard_range):
found_for_shard = self.categorize_container_dir_content(
shard_range.account, shard_range.container)
self.assertLengthEqual(found_for_shard['shard_dbs'], 3)
actual = []
for shard_db in found_for_shard['shard_dbs']:
broker = ContainerBroker(shard_db)
own_sr = broker.get_own_shard_range()
actual.append(
(broker.get_db_state(), own_sr.state, own_sr.deleted))
self.assertEqual([(SHARDED, ShardRange.SHRUNK, True)] * 3,
actual)
# At this point one of the first two replicas may have done some useful
# cleaving of 1.* shards, the other may have only cleaved 0.* shards,
# and the third replica may have cleaved no shards. We therefore need
# two more passes of the sharder to get to a predictable state where
# all replicas have cleaved all three 0.* shards.
self.sharders_once()
self.sharders_once()
# now we expect all replicas to have just the three 1.* shards, with
# the 0.* shards all deleted
brokers = {}
exp_shard_ranges = sorted(
[sr.copy(state=ShardRange.SHRUNK, deleted=True)
for sr in shard_ranges_0] +
[sr.copy(state=ShardRange.ACTIVE)
for sr in shard_ranges_1],
key=ShardRange.sort_key)
for node in (0, 1, 2):
with annotate_failure('node %s' % node):
broker = self.get_broker(self.brain.part,
self.brain.nodes[node])
brokers[node] = broker
shard_ranges = broker.get_shard_ranges()
self.assertEqual(shard_ranges_1, shard_ranges)
shard_ranges = broker.get_shard_ranges(include_deleted=True)
self.assertLengthEqual(shard_ranges, len(exp_shard_ranges))
self.maxDiff = None
self.assertEqual(exp_shard_ranges, shard_ranges)
self.assertEqual(ShardRange.SHARDED,
broker._own_shard_range().state)
# Sadly, the first replica to start sharding is still reporting its db
# state to be 'unsharded' because, although it has sharded, its shard
# db epoch (epoch_0) does not match its own shard range epoch
# (epoch_1), and that is because the second replica (with epoch_1)
# updated the own shard range and replicated it to all other replicas.
# If we had run the sharder on the second replica before the first
# replica, then by the time the first replica started sharding it would
# have learnt the newer epoch_1 and we wouldn't see this inconsistency.
self.assertEqual(UNSHARDED, brokers[0].get_db_state())
self.assertEqual(SHARDED, brokers[1].get_db_state())
self.assertEqual(SHARDED, brokers[2].get_db_state())
epoch_1 = brokers[1].db_epoch
self.assertEqual(epoch_1, brokers[2].db_epoch)
self.assertLess(brokers[0].db_epoch, epoch_1)
# the root replica that thinks it is unsharded is problematic - it will
# not return shard ranges for listings, but has no objects, so it's
# luck of the draw whether we get a listing or not at this point :(
# Run the sharders again: the first replica that is still 'unsharded'
# because of the older epoch_0 in its db filename will now start to
# shard again with a newer epoch_1 db, and will start to re-cleave the
# 3 active shards, albeit with zero objects to cleave.
self.sharders_once()
for node in (0, 1, 2):
with annotate_failure('node %s' % node):
broker = self.get_broker(self.brain.part,
self.brain.nodes[node])
brokers[node] = broker
shard_ranges = broker.get_shard_ranges()
self.assertEqual(shard_ranges_1, shard_ranges)
shard_ranges = broker.get_shard_ranges(include_deleted=True)
self.assertLengthEqual(shard_ranges, len(exp_shard_ranges))
self.assertEqual(exp_shard_ranges, shard_ranges)
self.assertEqual(ShardRange.SHARDED,
broker._own_shard_range().state)
self.assertEqual(epoch_1, broker.db_epoch)
self.assertIn(brokers[0].get_db_state(), (SHARDING, SHARDED))
self.assertEqual(SHARDED, brokers[1].get_db_state())
self.assertEqual(SHARDED, brokers[2].get_db_state())
# This cycle of the sharders also guarantees that all shards have had
# their state updated to ACTIVE from the root; this was not necessarily
# true at end of the previous sharder pass because a shard audit (when
# the shard is updated from a root) may have happened before all roots
# have had their shard ranges transitioned to ACTIVE.
for shard_range in shard_ranges_1:
with annotate_failure(shard_range):
found_for_shard = self.categorize_container_dir_content(
shard_range.account, shard_range.container)
self.assertLengthEqual(found_for_shard['normal_dbs'], 3)
actual = []
for shard_db in found_for_shard['normal_dbs']:
broker = ContainerBroker(shard_db)
own_sr = broker.get_own_shard_range()
actual.append(
(broker.get_db_state(), own_sr.state, own_sr.deleted))
self.assertEqual([(UNSHARDED, ShardRange.ACTIVE, False)] * 3,
actual)
# We may need one more pass of the sharder before all three shard
# ranges are cleaved (2 per pass) and all the root replicas are
# predictably in sharded state. Note: the accelerated cleaving of >2
# zero-object shard ranges per cycle is defeated if a shard happens
# to exist on the same node as the root because the roots cleaving
# process doesn't think that it created the shard db and will therefore
# replicate it as per a normal cleave.
self.sharders_once()
for node in (0, 1, 2):
with annotate_failure('node %s' % node):
broker = self.get_broker(self.brain.part,
self.brain.nodes[node])
brokers[node] = broker
shard_ranges = broker.get_shard_ranges()
self.assertEqual(shard_ranges_1, shard_ranges)
shard_ranges = broker.get_shard_ranges(include_deleted=True)
self.assertLengthEqual(shard_ranges, len(exp_shard_ranges))
self.assertEqual(exp_shard_ranges, shard_ranges)
self.assertEqual(ShardRange.SHARDED,
broker._own_shard_range().state)
self.assertEqual(epoch_1, broker.db_epoch)
self.assertEqual(SHARDED, broker.get_db_state())
# Finally, with all root replicas in a consistent state, the listing
# will be be predictably correct
self.assert_container_listing(obj_names)
def test_manage_shard_ranges_repair_shard(self):
# provoke overlaps in a shard container and repair them
obj_names = self._make_object_names(24)
initial_obj_names = obj_names[::2]
# put 12 objects in container
self.put_objects(initial_obj_names)
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
# run replicators first time to get sync points set
self.replicators.once()
# find 3 shard ranges on root nodes[0] and get the root sharded
self.assert_subprocess_success([
'swift-manage-shard-ranges',
self.get_db_file(self.brain.part, self.brain.nodes[0]),
'find_and_replace', '4', '--enable'])
self.replicators.once()
# cleave first two shards
self.sharders_once(additional_args='--partitions=%s' % self.brain.part)
# cleave third shard
self.sharders_once(additional_args='--partitions=%s' % self.brain.part)
# ensure all shards learn their ACTIVE state from root
self.sharders_once()
for node in (0, 1, 2):
with annotate_failure('node %d' % node):
shard_ranges = self.assert_container_state(
self.brain.nodes[node], 'sharded', 3)
for sr in shard_ranges:
self.assertEqual(ShardRange.ACTIVE, sr.state)
self.assert_container_listing(initial_obj_names)
# add objects to second shard range so it has 8 objects ; this range
# has bounds (obj-0006,obj-0014]
root_shard_ranges = self.get_container_shard_ranges()
self.assertEqual(3, len(root_shard_ranges))
shard_1 = root_shard_ranges[1]
self.assertEqual(obj_names[6], shard_1.lower)
self.assertEqual(obj_names[14], shard_1.upper)
more_obj_names = obj_names[7:15:2]
self.put_objects(more_obj_names)
expected_obj_names = sorted(initial_obj_names + more_obj_names)
self.assert_container_listing(expected_obj_names)
shard_1_part, shard_1_nodes = self.brain.ring.get_nodes(
shard_1.account, shard_1.container)
# find 3 sub-shards on one shard node; use --force-commits to ensure
# the recently PUT objects are included when finding the shard range
# pivot points
self.assert_subprocess_success([
'swift-manage-shard-ranges', '--force-commits',
self.get_db_file(shard_1_part, shard_1_nodes[1], shard_1.account,
shard_1.container),
'find_and_replace', '3', '--enable'])
# ... and mistakenly find 4 shard ranges on a different shard node :(
self.assert_subprocess_success([
'swift-manage-shard-ranges', '--force-commits',
self.get_db_file(shard_1_part, shard_1_nodes[2], shard_1.account,
shard_1.container),
'find_and_replace', '2', '--enable'])
# replicate the muddle of shard ranges between shard replicas, merged
# result is:
# '' - 6 shard ACTIVE
# 6 - 8 sub-shard FOUND
# 6 - 9 sub-shard FOUND
# 8 - 10 sub-shard FOUND
# 9 - 12 sub-shard FOUND
# 10 - 12 sub-shard FOUND
# 12 - 14 sub-shard FOUND
# 12 - 14 sub-shard FOUND
# 6 - 14 shard SHARDING
# 14 - '' shard ACTIVE
self.replicators.once()
# try hard to shard the shard...
self.sharders_once(additional_args='--partitions=%s' % shard_1_part)
self.sharders_once(additional_args='--partitions=%s' % shard_1_part)
self.sharders_once(additional_args='--partitions=%s' % shard_1_part)
# sharding hasn't completed and there's overlaps in the shard and root:
# the sub-shards will have been cleaved in the order listed above, but
# sub-shards (10 -12) and one of (12 - 14) will be overlooked because
# the cleave cursor will have moved past their namespace before they
# were yielded by the shard range iterator, so we now have:
# '' - 6 shard ACTIVE
# 6 - 8 sub-shard ACTIVE
# 6 - 9 sub-shard ACTIVE
# 8 - 10 sub-shard ACTIVE
# 10 - 12 sub-shard CREATED
# 9 - 12 sub-shard ACTIVE
# 12 - 14 sub-shard CREATED
# 12 - 14 sub-shard ACTIVE
# 14 - '' shard ACTIVE
sub_shard_ranges = self.get_container_shard_ranges(
shard_1.account, shard_1.container)
self.assertEqual(7, len(sub_shard_ranges), sub_shard_ranges)
root_shard_ranges = self.get_container_shard_ranges()
self.assertEqual(9, len(root_shard_ranges), root_shard_ranges)
self.assertEqual([ShardRange.ACTIVE] * 4 +
[ShardRange.CREATED, ShardRange.ACTIVE] * 2 +
[ShardRange.ACTIVE],
[sr.state for sr in root_shard_ranges])
# fix the overlaps - a set of 3 ACTIVE sub-shards will be chosen and 4
# other sub-shards will be shrunk away; apply the fix at the root
# container
db_file = self.get_db_file(self.brain.part, self.brain.nodes[0])
self.assert_subprocess_success(
['swift-manage-shard-ranges', db_file, 'repair', '--yes'])
self.replicators.once()
self.sharders_once()
self.sharders_once()
# check root now has just 5 shard ranges
root_shard_ranges = self.get_container_shard_ranges()
self.assertEqual(5, len(root_shard_ranges), root_shard_ranges)
self.assertEqual([ShardRange.ACTIVE] * 5,
[sr.state for sr in root_shard_ranges])
# check there are 1 sharded shard and 4 shrunk sub-shard ranges in the
# root (note, shard_1's shard ranges aren't updated once it has sharded
# because the sub-shards report their state to the root; we cannot make
# assertions about shrunk states in shard_1's shard range table)
root_shard_ranges = self.get_container_shard_ranges(
include_deleted=True)
self.assertEqual(10, len(root_shard_ranges), root_shard_ranges)
shrunk_shard_ranges = [sr for sr in root_shard_ranges
if sr.state == ShardRange.SHRUNK]
self.assertEqual(4, len(shrunk_shard_ranges), root_shard_ranges)
self.assertEqual([True] * 4,
[sr.deleted for sr in shrunk_shard_ranges])
sharded_shard_ranges = [sr for sr in root_shard_ranges
if sr.state == ShardRange.SHARDED]
self.assertEqual(1, len(sharded_shard_ranges), root_shard_ranges)
self.assert_container_listing(expected_obj_names)
| 49.930675 | 79 | 0.623613 |
import json
import os
import shutil
import subprocess
import uuid
from nose import SkipTest
import six
from six.moves.urllib.parse import quote
from swift.common import direct_client, utils
from swift.common.manager import Manager
from swift.common.memcached import MemcacheRing
from swift.common.utils import ShardRange, parse_db_filename, get_db_files, \
quorum_size, config_true_value, Timestamp, md5
from swift.container.backend import ContainerBroker, UNSHARDED, SHARDING, \
SHARDED
from swift.container.sharder import CleavingContext, ContainerSharder
from swift.container.replicator import ContainerReplicator
from swiftclient import client, get_auth, ClientException
from swift.proxy.controllers.base import get_cache_key
from swift.proxy.controllers.obj import num_container_updates
from test import annotate_failure
from test.probe import PROXY_BASE_URL
from test.probe.brain import BrainSplitter
from test.probe.common import ReplProbeTest, get_server_number, \
wait_for_server_to_hangup
import mock
MIN_SHARD_CONTAINER_THRESHOLD = 4
MAX_SHARD_CONTAINER_THRESHOLD = 100
class ShardCollector(object):
def __init__(self):
self.ranges = {}
def __call__(self, cnode, cpart, account, container):
self.ranges[cnode['id']] = direct_client.direct_get_container(
cnode, cpart, account, container,
headers={'X-Backend-Record-Type': 'shard'})
class BaseTestContainerSharding(ReplProbeTest):
DELIM = '-'
def _maybe_skip_test(self):
try:
cont_configs = [
utils.readconf(p, 'container-sharder')
for p in self.configs['container-sharder'].values()]
except ValueError:
raise SkipTest('No [container-sharder] section found in '
'container-server configs')
skip_reasons = []
auto_shard = all(config_true_value(c.get('auto_shard', False))
for c in cont_configs)
if not auto_shard:
skip_reasons.append(
'auto_shard must be true in all container_sharder configs')
self.max_shard_size = max(
int(c.get('shard_container_threshold', '1000000'))
for c in cont_configs)
if not (MIN_SHARD_CONTAINER_THRESHOLD <= self.max_shard_size
<= MAX_SHARD_CONTAINER_THRESHOLD):
skip_reasons.append(
'shard_container_threshold %d must be between %d and %d' %
(self.max_shard_size, MIN_SHARD_CONTAINER_THRESHOLD,
MAX_SHARD_CONTAINER_THRESHOLD))
def skip_check(reason_list, option, required):
values = {int(c.get(option, required)) for c in cont_configs}
if values != {required}:
reason_list.append('%s must be %s' % (option, required))
skip_check(skip_reasons, 'shard_scanner_batch_size', 10)
skip_check(skip_reasons, 'shard_batch_size', 2)
if skip_reasons:
raise SkipTest(', '.join(skip_reasons))
def _load_rings_and_configs(self):
super(BaseTestContainerSharding, self)._load_rings_and_configs()
self._maybe_skip_test()
def _make_object_names(self, number, start=0):
return ['obj%s%04d' % (self.DELIM, x)
for x in range(start, start + number)]
def _setup_container_name(self):
self.container_name = 'container%s%s' % (self.DELIM, uuid.uuid4())
def setUp(self):
client.logger.setLevel(client.logging.WARNING)
client.requests.logging.getLogger().setLevel(
client.requests.logging.WARNING)
super(BaseTestContainerSharding, self).setUp()
_, self.admin_token = get_auth(
PROXY_BASE_URL + '/auth/v1.0', 'admin:admin', 'admin')
self._setup_container_name()
self.init_brain(self.container_name)
self.sharders = Manager(['container-sharder'])
self.internal_client = self.make_internal_client()
self.memcache = MemcacheRing(['127.0.0.1:11211'])
def init_brain(self, container_name):
self.container_to_shard = container_name
self.brain = BrainSplitter(
self.url, self.token, self.container_to_shard,
None, 'container')
self.brain.put_container(policy_index=int(self.policy))
def stop_container_servers(self, node_numbers=None):
if node_numbers:
ipports = []
server2ipport = {v: k for k, v in self.ipport2server.items()}
for number in self.brain.node_numbers[node_numbers]:
self.brain.servers.stop(number=number)
server = 'container%d' % number
ipports.append(server2ipport[server])
else:
ipports = [k for k, v in self.ipport2server.items()
if v.startswith('container')]
self.brain.servers.stop()
for ipport in ipports:
wait_for_server_to_hangup(ipport)
def put_objects(self, obj_names, contents=None):
conn = client.Connection(preauthurl=self.url, preauthtoken=self.token)
results = []
for obj in obj_names:
rdict = {}
conn.put_object(self.container_name, obj,
contents=contents, response_dict=rdict)
results.append((obj, rdict['headers'].get('x-object-version-id')))
return results
def delete_objects(self, obj_names_and_versions):
conn = client.Connection(preauthurl=self.url, preauthtoken=self.token)
for obj in obj_names_and_versions:
if isinstance(obj, tuple):
obj, version = obj
conn.delete_object(self.container_name, obj,
query_string='version-id=%s' % version)
else:
conn.delete_object(self.container_name, obj)
def get_container_shard_ranges(self, account=None, container=None,
include_deleted=False):
account = account if account else self.account
container = container if container else self.container_to_shard
path = self.internal_client.make_path(account, container)
headers = {'X-Backend-Record-Type': 'shard'}
if include_deleted:
headers['X-Backend-Include-Deleted'] = 'true'
resp = self.internal_client.make_request(
'GET', path + '?format=json', headers, [200])
return [ShardRange.from_dict(sr) for sr in json.loads(resp.body)]
def direct_get_container_shard_ranges(self, account=None, container=None,
expect_failure=False):
collector = ShardCollector()
self.direct_container_op(
collector, account, container, expect_failure)
return collector.ranges
def get_storage_dir(self, part, node, account=None, container=None):
account = account or self.brain.account
container = container or self.container_name
server_type, config_number = get_server_number(
(node['ip'], node['port']), self.ipport2server)
assert server_type == 'container'
repl_server = '%s-replicator' % server_type
conf = utils.readconf(self.configs[repl_server][config_number],
section_name=repl_server)
datadir = os.path.join(conf['devices'], node['device'], 'containers')
container_hash = utils.hash_path(account, container)
return (utils.storage_directory(datadir, part, container_hash),
container_hash)
def get_db_file(self, part, node, account=None, container=None):
container_dir, container_hash = self.get_storage_dir(
part, node, account=account, container=container)
db_file = os.path.join(container_dir, container_hash + '.db')
self.assertTrue(get_db_files(db_file)) # sanity check
return db_file
def get_broker(self, part, node, account=None, container=None):
return ContainerBroker(
self.get_db_file(part, node, account, container))
def get_shard_broker(self, shard_range, node_index=0):
shard_part, shard_nodes = self.brain.ring.get_nodes(
shard_range.account, shard_range.container)
return self.get_broker(
shard_part, shard_nodes[node_index], shard_range.account,
shard_range.container)
def categorize_container_dir_content(self, account=None, container=None):
account = account or self.brain.account
container = container or self.container_name
part, nodes = self.brain.ring.get_nodes(account, container)
storage_dirs = [
self.get_storage_dir(part, node, account=account,
container=container)[0]
for node in nodes]
result = {
'shard_dbs': [],
'normal_dbs': [],
'pendings': [],
'locks': [],
'other': [],
}
for storage_dir in storage_dirs:
for f in os.listdir(storage_dir):
path = os.path.join(storage_dir, f)
if path.endswith('.db'):
hash_, epoch, ext = parse_db_filename(path)
if epoch:
result['shard_dbs'].append(path)
else:
result['normal_dbs'].append(path)
elif path.endswith('.db.pending'):
result['pendings'].append(path)
elif path.endswith('/.lock'):
result['locks'].append(path)
else:
result['other'].append(path)
if result['other']:
self.fail('Found unexpected files in storage directory:\n %s' %
'\n '.join(result['other']))
return result
def assert_dict_contains(self, expected_items, actual_dict):
ignored = set(expected_items) ^ set(actual_dict)
filtered_actual = {k: actual_dict[k]
for k in actual_dict if k not in ignored}
self.assertEqual(expected_items, filtered_actual)
def assert_shard_ranges_contiguous(self, expected_number, shard_ranges,
first_lower='', last_upper=''):
if shard_ranges and isinstance(shard_ranges[0], ShardRange):
actual_shard_ranges = sorted(shard_ranges)
else:
actual_shard_ranges = sorted(ShardRange.from_dict(d)
for d in shard_ranges)
self.assertLengthEqual(actual_shard_ranges, expected_number)
if expected_number:
with annotate_failure('Ranges %s.' % actual_shard_ranges):
self.assertEqual(first_lower, actual_shard_ranges[0].lower_str)
for x, y in zip(actual_shard_ranges, actual_shard_ranges[1:]):
self.assertEqual(x.upper, y.lower)
self.assertEqual(last_upper, actual_shard_ranges[-1].upper_str)
def assert_shard_range_equal(self, expected, actual, excludes=None):
excludes = excludes or []
expected_dict = dict(expected)
actual_dict = dict(actual)
for k in excludes:
expected_dict.pop(k, None)
actual_dict.pop(k, None)
self.assertEqual(expected_dict, actual_dict)
def assert_shard_range_lists_equal(self, expected, actual, excludes=None):
self.assertEqual(len(expected), len(actual))
for expected, actual in zip(expected, actual):
self.assert_shard_range_equal(expected, actual, excludes=excludes)
def assert_shard_range_state(self, expected_state, shard_ranges):
if shard_ranges and not isinstance(shard_ranges[0], ShardRange):
shard_ranges = [ShardRange.from_dict(data)
for data in shard_ranges]
self.assertEqual([expected_state] * len(shard_ranges),
[sr.state for sr in shard_ranges])
def assert_total_object_count(self, expected_object_count, shard_ranges):
actual = sum(sr['object_count'] for sr in shard_ranges)
self.assertEqual(expected_object_count, actual)
def assert_container_listing(self, expected_listing, req_hdrs=None):
req_hdrs = req_hdrs if req_hdrs else {}
headers, actual_listing = client.get_container(
self.url, self.token, self.container_name, headers=req_hdrs)
self.assertIn('x-container-object-count', headers)
expected_obj_count = len(expected_listing)
self.assertEqual(expected_listing, [
x['name'].encode('utf-8') if six.PY2 else x['name']
for x in actual_listing])
self.assertEqual(str(expected_obj_count),
headers['x-container-object-count'])
return headers, actual_listing
def assert_container_object_count(self, expected_obj_count):
headers = client.head_container(
self.url, self.token, self.container_name)
self.assertIn('x-container-object-count', headers)
self.assertEqual(str(expected_obj_count),
headers['x-container-object-count'])
def assert_container_post_ok(self, meta_value):
key = 'X-Container-Meta-Assert-Post-Works'
headers = {key: meta_value}
client.post_container(
self.url, self.token, self.container_name, headers=headers)
resp_headers = client.head_container(
self.url, self.token, self.container_name)
self.assertEqual(meta_value, resp_headers.get(key.lower()))
def assert_container_post_fails(self, meta_value):
key = 'X-Container-Meta-Assert-Post-Works'
headers = {key: meta_value}
with self.assertRaises(ClientException) as cm:
client.post_container(
self.url, self.token, self.container_name, headers=headers)
self.assertEqual(404, cm.exception.http_status)
def assert_container_delete_fails(self):
with self.assertRaises(ClientException) as cm:
client.delete_container(self.url, self.token, self.container_name)
self.assertEqual(409, cm.exception.http_status)
def assert_container_not_found(self):
with self.assertRaises(ClientException) as cm:
client.get_container(self.url, self.token, self.container_name)
self.assertEqual(404, cm.exception.http_status)
# check for headers leaking out while deleted
resp_headers = cm.exception.http_response_headers
self.assertNotIn('X-Container-Object-Count', resp_headers)
self.assertNotIn('X-Container-Bytes-Used', resp_headers)
self.assertNotIn('X-Timestamp', resp_headers)
self.assertNotIn('X-PUT-Timestamp', resp_headers)
def assert_container_has_shard_sysmeta(self):
node_headers = self.direct_head_container()
for node_id, headers in node_headers.items():
with annotate_failure('%s in %s' % (node_id, node_headers.keys())):
for k, v in headers.items():
if k.lower().startswith('x-container-sysmeta-shard'):
break
else:
self.fail('No shard sysmeta found in %s' % headers)
def assert_container_state(self, node, expected_state, num_shard_ranges):
headers, shard_ranges = direct_client.direct_get_container(
node, self.brain.part, self.account, self.container_to_shard,
headers={'X-Backend-Record-Type': 'shard'})
self.assertEqual(num_shard_ranges, len(shard_ranges))
self.assertIn('X-Backend-Sharding-State', headers)
self.assertEqual(
expected_state, headers['X-Backend-Sharding-State'])
return [ShardRange.from_dict(sr) for sr in shard_ranges]
def assert_subprocess_success(self, cmd_args):
try:
subprocess.check_output(cmd_args, stderr=subprocess.STDOUT)
except Exception as exc:
# why not 'except CalledProcessError'? because in my py3.6 tests
# the CalledProcessError wasn't caught by that! despite type(exc)
try:
self.fail('%s with output:\n%s' % (exc, exc.output))
except AttributeError:
raise exc
def get_part_and_node_numbers(self, shard_range):
part, nodes = self.brain.ring.get_nodes(
shard_range.account, shard_range.container)
return part, [n['id'] + 1 for n in nodes]
def run_sharders(self, shard_ranges):
if not isinstance(shard_ranges, (list, tuple, set)):
shard_ranges = (shard_ranges,)
partitions = ','.join(str(self.get_part_and_node_numbers(sr)[0])
for sr in shard_ranges)
self.sharders.once(additional_args='--partitions=%s' % partitions)
def run_sharder_sequentially(self, shard_range=None):
if shard_range:
part, node_numbers = self.get_part_and_node_numbers(shard_range)
else:
part, node_numbers = self.brain.part, self.brain.node_numbers
for node_number in node_numbers:
self.sharders.once(number=node_number,
additional_args='--partitions=%s' % part)
def run_custom_sharder(self, conf_index, custom_conf, **kwargs):
return self.run_custom_daemon(ContainerSharder, 'container-sharder',
conf_index, custom_conf, **kwargs)
class TestContainerShardingNonUTF8(BaseTestContainerSharding):
def test_sharding_listing(self):
all_obj_names = self._make_object_names(4 * self.max_shard_size)
obj_names = all_obj_names[::2]
obj_content = 'testing'
self.put_objects(obj_names, contents=obj_content)
markers = [
obj_names[i] for i in range(self.max_shard_size // 4,
2 * self.max_shard_size,
self.max_shard_size // 2)]
def check_listing(objects, req_hdrs=None, **params):
req_hdrs = req_hdrs if req_hdrs else {}
qs = '&'.join('%s=%s' % (k, quote(str(v)))
for k, v in params.items())
headers, listing = client.get_container(
self.url, self.token, self.container_name, query_string=qs,
headers=req_hdrs)
listing = [x['name'].encode('utf-8') if six.PY2 else x['name']
for x in listing]
if params.get('reverse'):
marker = params.get('marker', ShardRange.MAX)
end_marker = params.get('end_marker', ShardRange.MIN)
expected = [o for o in objects if end_marker < o < marker]
expected.reverse()
else:
marker = params.get('marker', ShardRange.MIN)
end_marker = params.get('end_marker', ShardRange.MAX)
expected = [o for o in objects if marker < o < end_marker]
if 'limit' in params:
expected = expected[:params['limit']]
self.assertEqual(expected, listing)
self.assertIn('x-timestamp', headers)
self.assertIn('last-modified', headers)
self.assertIn('x-trans-id', headers)
self.assertEqual('bytes', headers.get('accept-ranges'))
self.assertEqual('application/json; charset=utf-8',
headers.get('content-type'))
def check_listing_fails(exp_status, **params):
qs = '&'.join(['%s=%s' % param for param in params.items()])
with self.assertRaises(ClientException) as cm:
client.get_container(
self.url, self.token, self.container_name, query_string=qs)
self.assertEqual(exp_status, cm.exception.http_status)
return cm.exception
def do_listing_checks(objs, hdrs=None):
hdrs = hdrs if hdrs else {}
check_listing(objs, hdrs)
check_listing(objs, hdrs, marker=markers[0], end_marker=markers[1])
check_listing(objs, hdrs, marker=markers[0], end_marker=markers[2])
check_listing(objs, hdrs, marker=markers[1], end_marker=markers[3])
check_listing(objs, hdrs, marker=markers[1], end_marker=markers[3],
limit=self.max_shard_size // 4)
check_listing(objs, hdrs, marker=markers[1], end_marker=markers[3],
limit=self.max_shard_size // 4)
check_listing(objs, hdrs, marker=markers[1], end_marker=markers[2],
limit=self.max_shard_size // 2)
check_listing(objs, hdrs, marker=markers[1], end_marker=markers[1])
check_listing(objs, hdrs, reverse=True)
check_listing(objs, hdrs, reverse=True, end_marker=markers[1])
check_listing(objs, hdrs, reverse=True, marker=markers[3],
end_marker=markers[1],
limit=self.max_shard_size // 4)
check_listing(objs, hdrs, reverse=True, marker=markers[3],
end_marker=markers[1], limit=0)
check_listing([], hdrs, marker=markers[0], end_marker=markers[0])
check_listing([], hdrs, marker=markers[0], end_marker=markers[1],
reverse=True)
check_listing(objs, hdrs, prefix='obj')
check_listing([], hdrs, prefix='zzz')
headers, listing = client.get_container(
self.url, self.token, self.container_name,
query_string='delimiter=' + quote(self.DELIM), headers=hdrs)
self.assertEqual([{'subdir': 'obj' + self.DELIM}], listing)
headers, listing = client.get_container(
self.url, self.token, self.container_name,
query_string='delimiter=j' + quote(self.DELIM), headers=hdrs)
self.assertEqual([{'subdir': 'obj' + self.DELIM}], listing)
limit = self.cluster_info['swift']['container_listing_limit']
exc = check_listing_fails(412, limit=limit + 1)
self.assertIn(b'Maximum limit', exc.http_response_content)
exc = check_listing_fails(400, delimiter='%ff')
self.assertIn(b'not valid UTF-8', exc.http_response_content)
do_listing_checks(obj_names)
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
self.sharders.once(number=self.brain.node_numbers[0],
additional_args='--partitions=%s' % self.brain.part)
for n in self.brain.node_numbers[1:]:
self.sharders.once(
number=n, additional_args='--partitions=%s' % self.brain.part)
for node in self.brain.nodes:
self.assert_container_state(node, 'sharding', 4)
shard_ranges = self.get_container_shard_ranges()
self.assertLengthEqual(shard_ranges, 4)
self.assert_shard_range_state(ShardRange.CLEAVED, shard_ranges[:2])
self.assert_shard_range_state(ShardRange.CREATED, shard_ranges[2:])
self.assert_container_delete_fails()
self.assert_container_has_shard_sysmeta()
self.assert_container_post_ok('sharding')
do_listing_checks(obj_names)
new_obj_names = all_obj_names[1::4]
self.put_objects(new_obj_names, obj_content)
exp_obj_names = [o for o in obj_names + new_obj_names
if o <= shard_ranges[1].upper]
exp_obj_names += [o for o in obj_names
if o > shard_ranges[1].upper]
exp_obj_names.sort()
do_listing_checks(exp_obj_names)
self.sharders.once(additional_args='--partitions=%s' % self.brain.part)
for node in self.brain.nodes:
self.assert_container_state(node, 'sharded', 4)
shard_ranges = self.get_container_shard_ranges()
self.assert_shard_range_state(ShardRange.ACTIVE, shard_ranges)
exp_obj_names = obj_names + new_obj_names
exp_obj_names.sort()
do_listing_checks(exp_obj_names)
do_listing_checks(exp_obj_names, hdrs={'X-Newest': 'true'})
test_headers = {'x-container-meta-test': 'testing',
'x-container-read': 'read_acl',
'x-container-write': 'write_acl',
'x-container-sync-key': 'sync_key',
'x-versions-location': 'versions',
'x-container-meta-access-control-allow-origin': 'aa',
'x-container-meta-access-control-expose-headers': 'bb',
'x-container-meta-access-control-max-age': '123'}
client.post_container(self.url, self.admin_token, self.container_name,
headers=test_headers)
headers, listing = client.get_container(
self.url, self.token, self.container_name,
headers={'X-Newest': 'true'})
exp_headers = dict(test_headers)
exp_headers.update({
'x-container-object-count': str(len(exp_obj_names)),
'x-container-bytes-used':
str(len(exp_obj_names) * len(obj_content))
})
for k, v in exp_headers.items():
self.assertIn(k, headers)
self.assertEqual(v, headers[k], dict(headers))
cache_headers, listing = client.get_container(
self.url, self.token, self.container_name)
for k, v in exp_headers.items():
self.assertIn(k, cache_headers)
self.assertEqual(v, cache_headers[k], dict(exp_headers))
for k in ('x-timestamp', 'last-modified', 'date', 'x-trans-id',
'x-openstack-request-id'):
headers.pop(k, None)
cache_headers.pop(k, None)
self.assertEqual(headers, cache_headers)
self.assert_container_delete_fails()
self.assert_container_has_shard_sysmeta()
self.assert_container_post_ok('sharded')
# delete original objects
self.delete_objects(obj_names)
do_listing_checks(new_obj_names)
self.assert_container_delete_fails()
self.assert_container_has_shard_sysmeta()
self.assert_container_post_ok('sharded')
class TestContainerShardingFunkyNames(TestContainerShardingNonUTF8):
DELIM = '\n'
def _make_object_names(self, number):
return ['obj\n%04d%%Ff' % x for x in range(number)]
def _setup_container_name(self):
self.container_name = 'container\n%%Ff\n%s' % uuid.uuid4()
class TestContainerShardingUTF8(TestContainerShardingNonUTF8):
def _make_object_names(self, number, start=0):
# override default with names that include non-ascii chars
name_length = self.cluster_info['swift']['max_object_name_length']
obj_names = []
for x in range(start, start + number):
name = (u'obj-\u00e4\u00ea\u00ec\u00f2\u00fb\u1234-%04d' % x)
name = name.encode('utf8').ljust(name_length, b'o')
if not six.PY2:
name = name.decode('utf8')
obj_names.append(name)
return obj_names
def _setup_container_name(self):
# override default with max length name that includes non-ascii chars
super(TestContainerShardingUTF8, self)._setup_container_name()
name_length = self.cluster_info['swift']['max_container_name_length']
cont_name = \
self.container_name + u'-\u00e4\u00ea\u00ec\u00f2\u00fb\u1234'
self.container_name = cont_name.encode('utf8').ljust(name_length, b'x')
if not six.PY2:
self.container_name = self.container_name.decode('utf8')
class TestContainerShardingObjectVersioning(BaseTestContainerSharding):
def _maybe_skip_test(self):
super(TestContainerShardingObjectVersioning, self)._maybe_skip_test()
try:
vw_config = utils.readconf(self.configs['proxy-server'],
'filter:versioned_writes')
except ValueError:
raise SkipTest('No [filter:versioned_writes] section found in '
'proxy-server configs')
allow_object_versioning = config_true_value(
vw_config.get('allow_object_versioning', False))
if not allow_object_versioning:
raise SkipTest('allow_object_versioning must be true '
'in all versioned_writes configs')
def init_brain(self, container_name):
client.put_container(self.url, self.token, container_name, headers={
'X-Storage-Policy': self.policy.name,
'X-Versions-Enabled': 'true',
})
self.container_to_shard = '\x00versions\x00' + container_name
self.brain = BrainSplitter(
self.url, self.token, self.container_to_shard,
None, 'container')
def test_sharding_listing(self):
# verify parameterised listing of a container during sharding
all_obj_names = self._make_object_names(3) * self.max_shard_size
all_obj_names.extend(self._make_object_names(self.max_shard_size,
start=3))
obj_names = all_obj_names[::2]
obj_names_and_versions = self.put_objects(obj_names)
def sort_key(obj_and_ver):
obj, ver = obj_and_ver
return obj, ~Timestamp(ver)
obj_names_and_versions.sort(key=sort_key)
# choose some names approx in middle of each expected shard range
markers = [
obj_names_and_versions[i]
for i in range(self.max_shard_size // 4,
2 * self.max_shard_size,
self.max_shard_size // 2)]
def check_listing(objects, **params):
params['versions'] = ''
qs = '&'.join('%s=%s' % param for param in params.items())
headers, listing = client.get_container(
self.url, self.token, self.container_name, query_string=qs)
listing = [(x['name'].encode('utf-8') if six.PY2 else x['name'],
x['version_id'])
for x in listing]
if params.get('reverse'):
marker = (
params.get('marker', ShardRange.MAX),
~Timestamp(params['version_marker'])
if 'version_marker' in params else ~Timestamp('0'),
)
end_marker = (
params.get('end_marker', ShardRange.MIN),
Timestamp('0'),
)
expected = [o for o in objects
if end_marker < sort_key(o) < marker]
expected.reverse()
else:
marker = (
params.get('marker', ShardRange.MIN),
~Timestamp(params['version_marker'])
if 'version_marker' in params else Timestamp('0'),
)
end_marker = (
params.get('end_marker', ShardRange.MAX),
~Timestamp('0'),
)
expected = [o for o in objects
if marker < sort_key(o) < end_marker]
if 'limit' in params:
expected = expected[:params['limit']]
self.assertEqual(expected, listing)
def check_listing_fails(exp_status, **params):
params['versions'] = ''
qs = '&'.join('%s=%s' % param for param in params.items())
with self.assertRaises(ClientException) as cm:
client.get_container(
self.url, self.token, self.container_name, query_string=qs)
self.assertEqual(exp_status, cm.exception.http_status)
return cm.exception
def do_listing_checks(objects):
check_listing(objects)
check_listing(objects,
marker=markers[0][0], version_marker=markers[0][1])
check_listing(objects,
marker=markers[0][0], version_marker=markers[0][1],
limit=self.max_shard_size // 10)
check_listing(objects,
marker=markers[0][0], version_marker=markers[0][1],
limit=self.max_shard_size // 4)
check_listing(objects,
marker=markers[0][0], version_marker=markers[0][1],
limit=self.max_shard_size // 2)
check_listing(objects,
marker=markers[1][0], version_marker=markers[1][1])
check_listing(objects,
marker=markers[1][0], version_marker=markers[1][1],
limit=self.max_shard_size // 10)
check_listing(objects,
marker=markers[2][0], version_marker=markers[2][1],
limit=self.max_shard_size // 4)
check_listing(objects,
marker=markers[2][0], version_marker=markers[2][1],
limit=self.max_shard_size // 2)
check_listing(objects, reverse=True)
check_listing(objects, reverse=True,
marker=markers[1][0], version_marker=markers[1][1])
check_listing(objects, prefix='obj')
check_listing([], prefix='zzz')
# delimiter
headers, listing = client.get_container(
self.url, self.token, self.container_name,
query_string='delimiter=-')
self.assertEqual([{'subdir': 'obj-'}], listing)
headers, listing = client.get_container(
self.url, self.token, self.container_name,
query_string='delimiter=j-')
self.assertEqual([{'subdir': 'obj-'}], listing)
limit = self.cluster_info['swift']['container_listing_limit']
exc = check_listing_fails(412, limit=limit + 1)
self.assertIn(b'Maximum limit', exc.http_response_content)
exc = check_listing_fails(400, delimiter='%ff')
self.assertIn(b'not valid UTF-8', exc.http_response_content)
# sanity checks
do_listing_checks(obj_names_and_versions)
# Shard the container. Use an internal_client so we get an implicit
# X-Backend-Allow-Reserved-Names header
self.internal_client.set_container_metadata(
self.account, self.container_to_shard, {
'X-Container-Sysmeta-Sharding': 'True',
})
# First run the 'leader' in charge of scanning, which finds all shard
# ranges and cleaves first two
self.sharders.once(number=self.brain.node_numbers[0],
additional_args='--partitions=%s' % self.brain.part)
# Then run sharder on other nodes which will also cleave first two
# shard ranges
for n in self.brain.node_numbers[1:]:
self.sharders.once(
number=n, additional_args='--partitions=%s' % self.brain.part)
# sanity check shard range states
for node in self.brain.nodes:
self.assert_container_state(node, 'sharding', 4)
shard_ranges = self.get_container_shard_ranges()
self.assertLengthEqual(shard_ranges, 4)
self.assert_shard_range_state(ShardRange.CLEAVED, shard_ranges[:2])
self.assert_shard_range_state(ShardRange.CREATED, shard_ranges[2:])
self.assert_container_delete_fails()
self.assert_container_has_shard_sysmeta() # confirm no sysmeta deleted
self.assert_container_post_ok('sharding')
do_listing_checks(obj_names_and_versions)
# put some new objects spread through entire namespace
new_obj_names = all_obj_names[1::4]
new_obj_names_and_versions = self.put_objects(new_obj_names)
# new objects that fell into the first two cleaved shard ranges are
# reported in listing, new objects in the yet-to-be-cleaved shard
# ranges are not yet included in listing
exp_obj_names_and_versions = [
o for o in obj_names_and_versions + new_obj_names_and_versions
if '\x00' + o[0] <= shard_ranges[1].upper]
exp_obj_names_and_versions += [
o for o in obj_names_and_versions
if '\x00' + o[0] > shard_ranges[1].upper]
exp_obj_names_and_versions.sort(key=sort_key)
do_listing_checks(exp_obj_names_and_versions)
# run all the sharders again and the last two shard ranges get cleaved
self.sharders.once(additional_args='--partitions=%s' % self.brain.part)
for node in self.brain.nodes:
self.assert_container_state(node, 'sharded', 4)
shard_ranges = self.get_container_shard_ranges()
self.assert_shard_range_state(ShardRange.ACTIVE, shard_ranges)
exp_obj_names_and_versions = \
obj_names_and_versions + new_obj_names_and_versions
exp_obj_names_and_versions.sort(key=sort_key)
do_listing_checks(exp_obj_names_and_versions)
self.assert_container_delete_fails()
self.assert_container_has_shard_sysmeta()
self.assert_container_post_ok('sharded')
# delete original objects
self.delete_objects(obj_names_and_versions)
new_obj_names_and_versions.sort(key=sort_key)
do_listing_checks(new_obj_names_and_versions)
self.assert_container_delete_fails()
self.assert_container_has_shard_sysmeta()
self.assert_container_post_ok('sharded')
class TestContainerSharding(BaseTestContainerSharding):
def _test_sharded_listing(self, run_replicators=False):
obj_names = self._make_object_names(self.max_shard_size)
self.put_objects(obj_names)
# Verify that we start out with normal DBs, no shards
found = self.categorize_container_dir_content()
self.assertLengthEqual(found['normal_dbs'], 3)
self.assertLengthEqual(found['shard_dbs'], 0)
for db_file in found['normal_dbs']:
broker = ContainerBroker(db_file)
self.assertIs(True, broker.is_root_container())
self.assertEqual('unsharded', broker.get_db_state())
self.assertLengthEqual(broker.get_shard_ranges(), 0)
headers, pre_sharding_listing = client.get_container(
self.url, self.token, self.container_name)
self.assertEqual(obj_names, [
x['name'].encode('utf-8') if six.PY2 else x['name']
for x in pre_sharding_listing]) # sanity
# Shard it
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
pre_sharding_headers = client.head_container(
self.url, self.admin_token, self.container_name)
self.assertEqual('True',
pre_sharding_headers.get('x-container-sharding'))
# Only run the one in charge of scanning
self.sharders.once(number=self.brain.node_numbers[0],
additional_args='--partitions=%s' % self.brain.part)
# Verify that we have one sharded db -- though the other normal DBs
# received the shard ranges that got defined
found = self.categorize_container_dir_content()
self.assertLengthEqual(found['shard_dbs'], 1)
broker = self.get_broker(self.brain.part, self.brain.nodes[0])
# sanity check - the shard db is on replica 0
self.assertEqual(found['shard_dbs'][0], broker.db_file)
self.assertIs(True, broker.is_root_container())
self.assertEqual('sharded', broker.get_db_state())
orig_root_shard_ranges = [dict(sr) for sr in broker.get_shard_ranges()]
self.assertLengthEqual(orig_root_shard_ranges, 2)
self.assert_total_object_count(len(obj_names), orig_root_shard_ranges)
self.assert_shard_ranges_contiguous(2, orig_root_shard_ranges)
self.assertEqual([ShardRange.ACTIVE, ShardRange.ACTIVE],
[sr['state'] for sr in orig_root_shard_ranges])
# Contexts should still be there, and should be complete
contexts = set([ctx.done()
for ctx, _ in CleavingContext.load_all(broker)])
self.assertEqual({True}, contexts)
self.direct_delete_container(expect_failure=True)
self.assertLengthEqual(found['normal_dbs'], 2)
for db_file in found['normal_dbs']:
broker = ContainerBroker(db_file)
self.assertIs(True, broker.is_root_container())
self.assertEqual('unsharded', broker.get_db_state())
shard_ranges = [dict(sr) for sr in broker.get_shard_ranges()]
self.assertEqual([ShardRange.CREATED, ShardRange.CREATED],
[sr['state'] for sr in shard_ranges])
# the sharded db had shard range meta_timestamps and state updated
# during cleaving, so we do not expect those to be equal on other
# nodes
self.assert_shard_range_lists_equal(
orig_root_shard_ranges, shard_ranges,
excludes=['meta_timestamp', 'state', 'state_timestamp'])
contexts = list(CleavingContext.load_all(broker))
self.assertEqual([], contexts) # length check
if run_replicators:
Manager(['container-replicator']).once()
# replication doesn't change the db file names
found = self.categorize_container_dir_content()
self.assertLengthEqual(found['shard_dbs'], 1)
self.assertLengthEqual(found['normal_dbs'], 2)
self.sharders.once(additional_args='--partitions=%s' % self.brain.part)
found = self.categorize_container_dir_content()
self.assertLengthEqual(found['shard_dbs'], 3)
self.assertLengthEqual(found['normal_dbs'], 0)
for db_file in found['shard_dbs']:
broker = ContainerBroker(db_file)
self.assertIs(True, broker.is_root_container())
self.assertEqual('sharded', broker.get_db_state())
self.assert_shard_range_lists_equal(
orig_root_shard_ranges, broker.get_shard_ranges(),
excludes=['meta_timestamp', 'state_timestamp'])
for orig, updated in zip(orig_root_shard_ranges,
broker.get_shard_ranges()):
self.assertGreaterEqual(updated.state_timestamp,
orig['state_timestamp'])
self.assertGreaterEqual(updated.meta_timestamp,
orig['meta_timestamp'])
contexts = set([ctx.done()
for ctx, _ in CleavingContext.load_all(broker)])
self.assertEqual({True}, contexts)
headers, actual_listing = self.assert_container_listing(obj_names)
self.assertEqual(headers['last-modified'],
pre_sharding_headers['last-modified'])
headers, listing = client.get_container(self.url, self.token,
self.container_name,
query_string='reverse=on')
self.assertEqual(pre_sharding_listing[::-1], listing)
headers, actual_listing = self.assert_container_listing(obj_names)
self.assertEqual(headers['last-modified'],
pre_sharding_headers['last-modified'])
headers, listing = client.get_container(self.url, self.token,
self.container_name,
query_string='reverse=on')
self.assertEqual(pre_sharding_listing[::-1], listing)
more_obj_names = [
'beta%03d' % x for x in range(self.max_shard_size)]
self.put_objects(more_obj_names)
# The listing includes new objects (shard ranges haven't changed, just
headers, listing = self.assert_container_listing(
more_obj_names + obj_names)
self.assertEqual(pre_sharding_listing, listing[len(more_obj_names):])
self.assert_container_object_count(len(obj_names))
shard_1 = ShardRange.from_dict(orig_root_shard_ranges[0])
self.run_sharders(shard_1)
self.assert_container_object_count(len(more_obj_names + obj_names))
# *again* into three new sub-shards, but nothing happens until the root
# leader identifies shard candidate...
root_shard_ranges = self.direct_get_container_shard_ranges()
for node, (hdrs, root_shards) in root_shard_ranges.items():
self.assertLengthEqual(root_shards, 2)
with annotate_failure('node %s. ' % node):
self.assertEqual(
[ShardRange.ACTIVE] * 2,
[sr['state'] for sr in root_shards])
# orig shards 0, 1 should be contiguous
self.assert_shard_ranges_contiguous(2, root_shards)
# Now run the root leader to identify shard candidate...while one of
# the shard container servers is down
shard_1_part, shard_1_nodes = self.get_part_and_node_numbers(shard_1)
self.brain.servers.stop(number=shard_1_nodes[2])
self.sharders.once(number=self.brain.node_numbers[0],
additional_args='--partitions=%s' % self.brain.part)
# ... so third replica of first shard state is not moved to sharding
found_for_shard = self.categorize_container_dir_content(
shard_1.account, shard_1.container)
self.assertLengthEqual(found_for_shard['normal_dbs'], 3)
self.assertEqual(
[ShardRange.SHARDING, ShardRange.SHARDING, ShardRange.ACTIVE],
[ContainerBroker(db_file).get_own_shard_range().state
for db_file in found_for_shard['normal_dbs']])
# ...then run first cycle of first shard sharders in order, leader
# first, to get to predictable state where all nodes have cleaved 2 out
# of 3 ranges...starting with first two nodes
for node_number in shard_1_nodes[:2]:
self.sharders.once(
number=node_number,
additional_args='--partitions=%s' % shard_1_part)
# ... first two replicas start sharding to sub-shards
found_for_shard = self.categorize_container_dir_content(
shard_1.account, shard_1.container)
self.assertLengthEqual(found_for_shard['shard_dbs'], 2)
for db_file in found_for_shard['shard_dbs'][:2]:
broker = ContainerBroker(db_file)
with annotate_failure('shard db file %s. ' % db_file):
self.assertIs(False, broker.is_root_container())
self.assertEqual('sharding', broker.get_db_state())
self.assertEqual(
ShardRange.SHARDING, broker.get_own_shard_range().state)
shard_shards = broker.get_shard_ranges()
self.assertEqual(
[ShardRange.CLEAVED, ShardRange.CLEAVED,
ShardRange.CREATED],
[sr.state for sr in shard_shards])
self.assert_shard_ranges_contiguous(
3, shard_shards,
first_lower=orig_root_shard_ranges[0]['lower'],
last_upper=orig_root_shard_ranges[0]['upper'])
contexts = list(CleavingContext.load_all(broker))
self.assertEqual(len(contexts), 1)
context, _lm = contexts[0]
self.assertIs(context.cleaving_done, False)
self.assertIs(context.misplaced_done, True)
self.assertEqual(context.ranges_done, 2)
self.assertEqual(context.ranges_todo, 1)
self.assertEqual(context.max_row,
self.max_shard_size * 3 // 2)
# but third replica still has no idea it should be sharding
self.assertLengthEqual(found_for_shard['normal_dbs'], 3)
self.assertEqual(
ShardRange.ACTIVE,
ContainerBroker(
found_for_shard['normal_dbs'][2]).get_own_shard_range().state)
# ...but once sharder runs on third replica it will learn its state;
# note that any root replica on the stopped container server also won't
self.sharders.once(
number=shard_1_nodes[2],
additional_args='--partitions=%s' % shard_1_part)
found_for_shard = self.categorize_container_dir_content(
shard_1.account, shard_1.container)
self.assertLengthEqual(found_for_shard['shard_dbs'], 2)
self.assertLengthEqual(found_for_shard['normal_dbs'], 3)
broker = ContainerBroker(found_for_shard['normal_dbs'][2])
self.assertEqual('unsharded', broker.get_db_state())
self.assertEqual(
ShardRange.SHARDING, broker.get_own_shard_range().state)
self.assertFalse(broker.get_shard_ranges())
contexts = list(CleavingContext.load_all(broker))
self.assertEqual([], contexts)
self.brain.servers.start(number=shard_1_nodes[2])
self.replicators.once()
contexts = list(CleavingContext.load_all(broker))
self.assertEqual(len(contexts), 2)
self.sharders.once(
number=shard_1_nodes[2],
additional_args='--partitions=%s' % shard_1_part)
sharding_broker = ContainerBroker(found_for_shard['normal_dbs'][2])
self.assertEqual('sharding', sharding_broker.get_db_state())
broker_id = broker.get_info()['id']
contexts = list(CleavingContext.load_all(broker))
self.assertEqual(len(contexts), 2)
self.assertNotIn(broker_id, [ctx[0].ref for ctx in contexts])
# ...but the sharding one does
contexts = list(CleavingContext.load_all(sharding_broker))
self.assertEqual(len(contexts), 3)
self.assertIn(broker_id, [ctx[0].ref for ctx in contexts])
# check original first shard range state and sub-shards - all replicas
# should now be in consistent state
found_for_shard = self.categorize_container_dir_content(
shard_1.account, shard_1.container)
self.assertLengthEqual(found_for_shard['shard_dbs'], 3)
self.assertLengthEqual(found_for_shard['normal_dbs'], 3)
for db_file in found_for_shard['shard_dbs']:
broker = ContainerBroker(db_file)
with annotate_failure('shard db file %s. ' % db_file):
self.assertIs(False, broker.is_root_container())
self.assertEqual('sharding', broker.get_db_state())
self.assertEqual(
ShardRange.SHARDING, broker.get_own_shard_range().state)
shard_shards = broker.get_shard_ranges()
self.assertEqual(
[ShardRange.CLEAVED, ShardRange.CLEAVED,
ShardRange.CREATED],
[sr.state for sr in shard_shards])
self.assert_shard_ranges_contiguous(
3, shard_shards,
first_lower=orig_root_shard_ranges[0]['lower'],
last_upper=orig_root_shard_ranges[0]['upper'])
# check third sub-shard is in created state
sub_shard = shard_shards[2]
found_for_sub_shard = self.categorize_container_dir_content(
sub_shard.account, sub_shard.container)
self.assertFalse(found_for_sub_shard['shard_dbs'])
self.assertLengthEqual(found_for_sub_shard['normal_dbs'], 3)
for db_file in found_for_sub_shard['normal_dbs']:
broker = ContainerBroker(db_file)
with annotate_failure('sub shard db file %s. ' % db_file):
self.assertIs(False, broker.is_root_container())
self.assertEqual('unsharded', broker.get_db_state())
self.assertEqual(
ShardRange.CREATED, broker.get_own_shard_range().state)
self.assertFalse(broker.get_shard_ranges())
# check root shard ranges
root_shard_ranges = self.direct_get_container_shard_ranges()
for node, (hdrs, root_shards) in root_shard_ranges.items():
self.assertLengthEqual(root_shards, 5)
with annotate_failure('node %s. ' % node):
# shard ranges are sorted by upper, state, lower, so expect:
# sub-shards, orig shard 0, orig shard 1
self.assertEqual(
[ShardRange.CLEAVED, ShardRange.CLEAVED,
ShardRange.CREATED, ShardRange.SHARDING,
ShardRange.ACTIVE],
[sr['state'] for sr in root_shards])
# sub-shards 0, 1, 2, orig shard 1 should be contiguous
self.assert_shard_ranges_contiguous(
4, root_shards[:3] + root_shards[4:])
# orig shards 0, 1 should be contiguous
self.assert_shard_ranges_contiguous(2, root_shards[3:])
self.assert_container_listing(more_obj_names + obj_names)
self.assert_container_object_count(len(more_obj_names + obj_names))
# Before writing, kill the cache
self.memcache.delete(get_cache_key(
self.account, self.container_name, shard='updating'))
# add another object that lands in the first of the new sub-shards
self.put_objects(['alpha'])
# check that alpha object is in the first new shard
shard_listings = self.direct_get_container(shard_shards[0].account,
shard_shards[0].container)
for node, (hdrs, listing) in shard_listings.items():
with annotate_failure(node):
self.assertIn('alpha', [o['name'] for o in listing])
self.assert_container_listing(['alpha'] + more_obj_names + obj_names)
# Run sharders again so things settle.
self.run_sharders(shard_1)
# Also run replicators to settle cleaving contexts
self.replicators.once()
# check original first shard range shards
for db_file in found_for_shard['shard_dbs']:
broker = ContainerBroker(db_file)
with annotate_failure('shard db file %s. ' % db_file):
self.assertIs(False, broker.is_root_container())
self.assertEqual('sharded', broker.get_db_state())
self.assertEqual(
[ShardRange.ACTIVE] * 3,
[sr.state for sr in broker.get_shard_ranges()])
# Contexts should still be there, and should be complete
contexts = set([ctx.done()
for ctx, _
in CleavingContext.load_all(broker)])
self.assertEqual({True}, contexts)
# check root shard ranges
root_shard_ranges = self.direct_get_container_shard_ranges()
for node, (hdrs, root_shards) in root_shard_ranges.items():
# old first shard range should have been deleted
self.assertLengthEqual(root_shards, 4)
with annotate_failure('node %s. ' % node):
self.assertEqual(
[ShardRange.ACTIVE] * 4,
[sr['state'] for sr in root_shards])
self.assert_shard_ranges_contiguous(4, root_shards)
headers, final_listing = self.assert_container_listing(
['alpha'] + more_obj_names + obj_names)
# check root
found = self.categorize_container_dir_content()
self.assertLengthEqual(found['shard_dbs'], 3)
self.assertLengthEqual(found['normal_dbs'], 0)
new_shard_ranges = None
for db_file in found['shard_dbs']:
broker = ContainerBroker(db_file)
self.assertIs(True, broker.is_root_container())
self.assertEqual('sharded', broker.get_db_state())
if new_shard_ranges is None:
new_shard_ranges = broker.get_shard_ranges(
include_deleted=True)
self.assertLengthEqual(new_shard_ranges, 5)
# Second half is still there, and unchanged
self.assertIn(
dict(orig_root_shard_ranges[1], meta_timestamp=None,
state_timestamp=None),
[dict(sr, meta_timestamp=None, state_timestamp=None)
for sr in new_shard_ranges])
# But the first half split in three, then deleted
by_name = {sr.name: sr for sr in new_shard_ranges}
self.assertIn(orig_root_shard_ranges[0]['name'], by_name)
old_shard_range = by_name.pop(
orig_root_shard_ranges[0]['name'])
self.assertTrue(old_shard_range.deleted)
self.assert_shard_ranges_contiguous(4, list(by_name.values()))
else:
# Everyone's on the same page. Well, except for
other_shard_ranges = broker.get_shard_ranges(
include_deleted=True)
self.assert_shard_range_lists_equal(
new_shard_ranges, other_shard_ranges,
excludes=['meta_timestamp', 'state_timestamp'])
for orig, updated in zip(orig_root_shard_ranges,
other_shard_ranges):
self.assertGreaterEqual(updated.meta_timestamp,
orig['meta_timestamp'])
self.assert_container_delete_fails()
for obj in final_listing:
client.delete_object(
self.url, self.token, self.container_name, obj['name'])
self.assert_container_listing([])
# but root container stats will not yet be aware of the deletions
self.assert_container_delete_fails()
# One server was down while the shard sharded its first two sub-shards,
# so there may be undeleted handoff db(s) for sub-shard(s) that were
# not fully replicated; run replicators now to clean up so they no
# longer report bogus stats to root.
self.replicators.once()
# Run sharder so that shard containers update the root. Do not run
# sharder on root container because that triggers shrinks which can
# cause root object count to temporarily be non-zero and prevent the
# final delete.
self.run_sharders(self.get_container_shard_ranges())
# then root is empty and can be deleted
self.assert_container_listing([])
self.assert_container_object_count(0)
client.delete_container(self.url, self.token, self.container_name)
def test_sharded_listing_no_replicators(self):
self._test_sharded_listing()
def test_sharded_listing_with_replicators(self):
self._test_sharded_listing(run_replicators=True)
def test_async_pendings(self):
obj_names = self._make_object_names(self.max_shard_size * 2)
# There are some updates *everyone* gets
self.put_objects(obj_names[::5])
# But roll some outages so each container only get ~2/5 more object
# records i.e. total of 3/5 updates per container; and async pendings
# pile up
for i, n in enumerate(self.brain.node_numbers, start=1):
self.brain.servers.stop(number=n)
self.put_objects(obj_names[i::5])
self.brain.servers.start(number=n)
# But there are also 1/5 updates *no one* gets
self.brain.servers.stop()
self.put_objects(obj_names[4::5])
self.brain.servers.start()
# Shard it
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
headers = client.head_container(self.url, self.admin_token,
self.container_name)
self.assertEqual('True', headers.get('x-container-sharding'))
# sanity check
found = self.categorize_container_dir_content()
self.assertLengthEqual(found['shard_dbs'], 0)
self.assertLengthEqual(found['normal_dbs'], 3)
for db_file in found['normal_dbs']:
broker = ContainerBroker(db_file)
self.assertIs(True, broker.is_root_container())
self.assertEqual(len(obj_names) * 3 // 5,
broker.get_info()['object_count'])
# Only run the 'leader' in charge of scanning.
# Each container has ~2 * max * 3/5 objects
# which are distributed from obj000 to obj<2 * max - 1>,
# so expect 3 shard ranges to be found: the first two will be complete
# shards with max/2 objects and lower/upper bounds spaced by approx:
# (2 * max - 1)/(2 * max * 3/5) * (max/2) =~ 5/6 * max
#
# Note that during this shard cycle the leader replicates to other
# nodes so they will end up with ~2 * max * 4/5 objects.
self.sharders.once(number=self.brain.node_numbers[0],
additional_args='--partitions=%s' % self.brain.part)
# Verify that we have one shard db -- though the other normal DBs
# received the shard ranges that got defined
found = self.categorize_container_dir_content()
self.assertLengthEqual(found['shard_dbs'], 1)
node_index_zero_db = found['shard_dbs'][0]
broker = ContainerBroker(node_index_zero_db)
self.assertIs(True, broker.is_root_container())
self.assertEqual(SHARDING, broker.get_db_state())
expected_shard_ranges = broker.get_shard_ranges()
self.assertLengthEqual(expected_shard_ranges, 3)
self.assertEqual(
[ShardRange.CLEAVED, ShardRange.CLEAVED, ShardRange.CREATED],
[sr.state for sr in expected_shard_ranges])
# Still have all three big DBs -- we've only cleaved 2 of the 3 shard
self.assertLengthEqual(found['normal_dbs'], 3)
db_states = []
for db_file in found['normal_dbs']:
broker = ContainerBroker(db_file)
self.assertIs(True, broker.is_root_container())
db_states.append(broker.get_db_state())
self.assert_shard_range_lists_equal(
expected_shard_ranges, broker.get_shard_ranges(),
excludes=['meta_timestamp', 'state_timestamp', 'state'])
self.assertEqual(len(obj_names) * 3 // 5,
broker.get_info()['object_count'])
self.assertEqual([SHARDING, UNSHARDED, UNSHARDED], sorted(db_states))
for n in self.brain.node_numbers[1:]:
self.sharders.once(
number=n,
additional_args='--partitions=%s' % self.brain.part)
found = self.categorize_container_dir_content()
self.assertLengthEqual(found['shard_dbs'], 3)
self.assertLengthEqual(found['normal_dbs'], 3)
for db_file in found['normal_dbs']:
broker = ContainerBroker(db_file)
self.assertEqual(SHARDING, broker.get_db_state())
# no new rows
self.assertEqual(len(obj_names) * 3 // 5,
broker.get_info()['object_count'])
# Run updaters to clear the async pendings
Manager(['object-updater']).once()
# Our "big" dbs didn't take updates
for db_file in found['normal_dbs']:
broker = ContainerBroker(db_file)
self.assertEqual(len(obj_names) * 3 // 5,
broker.get_info()['object_count'])
for sr in expected_shard_ranges:
shard_listings = self.direct_get_container(sr.account,
sr.container)
for node, (hdrs, listing) in shard_listings.items():
shard_listing_names = [
o['name'].encode('utf-8') if six.PY2 else o['name']
for o in listing]
for obj in obj_names[4::5]:
if obj in sr:
self.assertIn(obj, shard_listing_names)
else:
self.assertNotIn(obj, shard_listing_names)
headers, listing = client.get_container(self.url, self.token,
self.container_name)
start_listing = [
o for o in obj_names if o <= expected_shard_ranges[1].upper]
self.assertEqual(
[x['name'].encode('utf-8') if six.PY2 else x['name']
for x in listing[:len(start_listing)]],
start_listing)
# there should be something
self.assertTrue(
[x['name'].encode('utf-8') if six.PY2 else x['name']
for x in listing[len(start_listing):]])
self.assertIn('x-container-object-count', headers)
self.assertEqual(str(len(listing)),
headers['x-container-object-count'])
headers, listing = client.get_container(self.url, self.token,
self.container_name,
query_string='reverse=on')
self.assertEqual([x['name'].encode('utf-8') if six.PY2 else x['name']
for x in listing[-len(start_listing):]],
list(reversed(start_listing)))
self.assertIn('x-container-object-count', headers)
self.assertEqual(str(len(listing)),
headers['x-container-object-count'])
self.assertTrue(
[x['name'].encode('utf-8') if six.PY2 else x['name']
for x in listing[:-len(start_listing)]])
# Run the sharders again to get everything to settle
self.sharders.once()
found = self.categorize_container_dir_content()
self.assertLengthEqual(found['shard_dbs'], 3)
self.assertLengthEqual(found['normal_dbs'], 0)
# now all shards have been cleaved we should get the complete listing
headers, listing = client.get_container(self.url, self.token,
self.container_name)
self.assertEqual([x['name'].encode('utf-8') if six.PY2 else x['name']
for x in listing],
obj_names)
def test_shrinking(self):
int_client = self.make_internal_client()
def check_node_data(node_data, exp_hdrs, exp_obj_count, exp_shards,
exp_sharded_root_range=False):
hdrs, range_data = node_data
self.assert_dict_contains(exp_hdrs, hdrs)
sharded_root_range = False
other_range_data = []
for data in range_data:
sr = ShardRange.from_dict(data)
if (sr.account == self.account and
sr.container == self.container_name and
sr.state == ShardRange.SHARDED):
# only expect one root range
self.assertFalse(sharded_root_range, range_data)
sharded_root_range = True
self.assertEqual(ShardRange.MIN, sr.lower, sr)
self.assertEqual(ShardRange.MAX, sr.upper, sr)
else:
# include active root range in further assertions
other_range_data.append(data)
self.assertEqual(exp_sharded_root_range, sharded_root_range)
self.assert_shard_ranges_contiguous(exp_shards, other_range_data)
self.assert_total_object_count(exp_obj_count, other_range_data)
def check_shard_nodes_data(node_data, expected_state='unsharded',
expected_shards=0, exp_obj_count=0,
exp_sharded_root_range=False):
# checks that shard range is consistent on all nodes
root_path = '%s/%s' % (self.account, self.container_name)
exp_shard_hdrs = {
'X-Container-Sysmeta-Shard-Quoted-Root': quote(root_path),
'X-Backend-Sharding-State': expected_state}
object_counts = []
bytes_used = []
for node_id, node_data in node_data.items():
with annotate_failure('Node id %s.' % node_id):
check_node_data(
node_data, exp_shard_hdrs, exp_obj_count,
expected_shards, exp_sharded_root_range)
hdrs = node_data[0]
object_counts.append(int(hdrs['X-Container-Object-Count']))
bytes_used.append(int(hdrs['X-Container-Bytes-Used']))
if len(set(object_counts)) != 1:
self.fail('Inconsistent object counts: %s' % object_counts)
if len(set(bytes_used)) != 1:
self.fail('Inconsistent bytes used: %s' % bytes_used)
return object_counts[0], bytes_used[0]
repeat = [0]
def do_shard_then_shrink():
repeat[0] += 1
obj_names = ['obj-%s-%03d' % (repeat[0], x)
for x in range(self.max_shard_size)]
self.put_objects(obj_names)
# these two object names will fall at start of first shard range...
alpha = 'alpha-%s' % repeat[0]
beta = 'beta-%s' % repeat[0]
# Enable sharding
client.post_container(
self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
# sanity check
self.assert_container_listing(obj_names)
# Only run the one in charge of scanning
self.sharders.once(
number=self.brain.node_numbers[0],
additional_args='--partitions=%s' % self.brain.part)
# check root container
root_nodes_data = self.direct_get_container_shard_ranges()
self.assertEqual(3, len(root_nodes_data))
# nodes on which sharder has not run are still in unsharded state
# but have had shard ranges replicated to them
exp_obj_count = len(obj_names)
exp_hdrs = {'X-Backend-Sharding-State': 'unsharded',
'X-Container-Object-Count': str(exp_obj_count)}
node_id = self.brain.node_numbers[1] - 1
check_node_data(
root_nodes_data[node_id], exp_hdrs, exp_obj_count, 2)
node_id = self.brain.node_numbers[2] - 1
check_node_data(
root_nodes_data[node_id], exp_hdrs, exp_obj_count, 2)
# only one that ran sharder is in sharded state
exp_hdrs['X-Backend-Sharding-State'] = 'sharded'
node_id = self.brain.node_numbers[0] - 1
check_node_data(
root_nodes_data[node_id], exp_hdrs, exp_obj_count, 2)
orig_range_data = root_nodes_data[node_id][1]
orig_shard_ranges = [ShardRange.from_dict(r)
for r in orig_range_data]
# check first shard
shard_nodes_data = self.direct_get_container_shard_ranges(
orig_shard_ranges[0].account, orig_shard_ranges[0].container)
obj_count, bytes_used = check_shard_nodes_data(shard_nodes_data)
total_shard_object_count = obj_count
# check second shard
shard_nodes_data = self.direct_get_container_shard_ranges(
orig_shard_ranges[1].account, orig_shard_ranges[1].container)
obj_count, bytes_used = check_shard_nodes_data(shard_nodes_data)
total_shard_object_count += obj_count
self.assertEqual(exp_obj_count, total_shard_object_count)
# Now that everyone has shard ranges, run *everyone*
self.sharders.once(
additional_args='--partitions=%s' % self.brain.part)
# all root container nodes should now be in sharded state
root_nodes_data = self.direct_get_container_shard_ranges()
self.assertEqual(3, len(root_nodes_data))
for node_id, node_data in root_nodes_data.items():
with annotate_failure('Node id %s.' % node_id):
check_node_data(node_data, exp_hdrs, exp_obj_count, 2)
# run updaters to update .sharded account; shard containers have
# not updated account since having objects replicated to them
self.updaters.once()
shard_cont_count, shard_obj_count = int_client.get_account_info(
orig_shard_ranges[0].account, [204])
self.assertEqual(2 * repeat[0], shard_cont_count)
# the shards account should always have zero object count to avoid
# double accounting
self.assertEqual(0, shard_obj_count)
# checking the listing also refreshes proxy container info cache so
# that the proxy becomes aware that container is sharded and will
# now look up the shard target for subsequent updates
self.assert_container_listing(obj_names)
# Before writing, kill the cache
self.memcache.delete(get_cache_key(
self.account, self.container_name, shard='updating'))
# delete objects from first shard range
first_shard_objects = [obj_name for obj_name in obj_names
if obj_name <= orig_shard_ranges[0].upper]
for obj in first_shard_objects:
client.delete_object(
self.url, self.token, self.container_name, obj)
with self.assertRaises(ClientException):
client.get_object(
self.url, self.token, self.container_name, obj)
second_shard_objects = [obj_name for obj_name in obj_names
if obj_name > orig_shard_ranges[1].lower]
self.assert_container_listing(second_shard_objects)
# put a new object 'alpha' in first shard range
self.put_objects([alpha])
second_shard_objects = [obj_name for obj_name in obj_names
if obj_name > orig_shard_ranges[1].lower]
self.assert_container_listing([alpha] + second_shard_objects)
# while container servers are down, but proxy has container info in
# cache from recent listing, put another object; this update will
# lurk in async pending until the updaters run again; because all
# the root container servers are down and therefore cannot respond
# to a GET for a redirect target, the object update will default to
# being targeted at the root container
self.stop_container_servers()
# Before writing, kill the cache
self.memcache.delete(get_cache_key(
self.account, self.container_name, shard='updating'))
self.put_objects([beta])
self.brain.servers.start()
async_pendings = self.gather_async_pendings(
self.get_all_object_nodes())
num_container_replicas = len(self.brain.nodes)
num_obj_replicas = self.policy.object_ring.replica_count
expected_num_updates = num_container_updates(
num_container_replicas, quorum_size(num_container_replicas),
num_obj_replicas, self.policy.quorum)
expected_num_pendings = min(expected_num_updates, num_obj_replicas)
# sanity check
with annotate_failure('policy %s. ' % self.policy):
self.assertLengthEqual(async_pendings, expected_num_pendings)
# root object count is not updated...
self.assert_container_object_count(len(obj_names))
self.assert_container_listing([alpha] + second_shard_objects)
root_nodes_data = self.direct_get_container_shard_ranges()
self.assertEqual(3, len(root_nodes_data))
for node_id, node_data in root_nodes_data.items():
with annotate_failure('Node id %s.' % node_id):
check_node_data(node_data, exp_hdrs, exp_obj_count, 2)
range_data = node_data[1]
self.assert_shard_range_lists_equal(
orig_range_data, range_data,
excludes=['meta_timestamp', 'state_timestamp'])
# ...until the sharders run and update root; reclaim tombstones so
# that the shard is shrinkable
shard_0_part = self.get_part_and_node_numbers(
orig_shard_ranges[0])[0]
for conf_index in self.configs['container-sharder'].keys():
self.run_custom_sharder(conf_index, {'reclaim_age': 0},
override_partitions=[shard_0_part])
exp_obj_count = len(second_shard_objects) + 1
self.assert_container_object_count(exp_obj_count)
self.assert_container_listing([alpha] + second_shard_objects)
# root sharder finds donor, acceptor pair and pushes changes
self.sharders.once(
additional_args='--partitions=%s' % self.brain.part)
self.assert_container_listing([alpha] + second_shard_objects)
# run sharder on donor to shrink and replicate to acceptor
self.run_sharders(orig_shard_ranges[0])
self.assert_container_listing([alpha] + second_shard_objects)
# run sharder on acceptor to update root with stats
self.run_sharders(orig_shard_ranges[1])
self.assert_container_listing([alpha] + second_shard_objects)
self.assert_container_object_count(len(second_shard_objects) + 1)
# check root container
root_nodes_data = self.direct_get_container_shard_ranges()
self.assertEqual(3, len(root_nodes_data))
exp_hdrs['X-Container-Object-Count'] = str(exp_obj_count)
for node_id, node_data in root_nodes_data.items():
with annotate_failure('Node id %s.' % node_id):
# NB now only *one* shard range in root
check_node_data(node_data, exp_hdrs, exp_obj_count, 1)
# the acceptor shard is intact..
shard_nodes_data = self.direct_get_container_shard_ranges(
orig_shard_ranges[1].account, orig_shard_ranges[1].container)
obj_count, bytes_used = check_shard_nodes_data(shard_nodes_data)
# all objects should now be in this shard
self.assertEqual(exp_obj_count, obj_count)
# the donor shard is also still intact
donor = orig_shard_ranges[0]
shard_nodes_data = self.direct_get_container_shard_ranges(
donor.account, donor.container)
# the donor's shard range will have the acceptor's projected stats;
# donor also has copy of root shard range that will be ignored;
# note: expected_shards does not include the sharded root range
obj_count, bytes_used = check_shard_nodes_data(
shard_nodes_data, expected_state='sharded', expected_shards=1,
exp_obj_count=len(second_shard_objects) + 1,
exp_sharded_root_range=True)
# but the donor is empty and so reports zero stats
self.assertEqual(0, obj_count)
self.assertEqual(0, bytes_used)
# check the donor own shard range state
part, nodes = self.brain.ring.get_nodes(
donor.account, donor.container)
for node in nodes:
with annotate_failure(node):
broker = self.get_broker(
part, node, donor.account, donor.container)
own_sr = broker.get_own_shard_range()
self.assertEqual(ShardRange.SHRUNK, own_sr.state)
self.assertTrue(own_sr.deleted)
# delete all the second shard's object apart from 'alpha'
for obj in second_shard_objects:
client.delete_object(
self.url, self.token, self.container_name, obj)
self.assert_container_listing([alpha])
self.sharders.once()
self.assert_container_listing([alpha])
self.sharders.once()
self.assert_container_listing([alpha])
self.sharders.once()
self.assert_container_listing([alpha])
shard_nodes_data = self.direct_get_container_shard_ranges(
orig_shard_ranges[1].account, orig_shard_ranges[1].container)
obj_count, bytes_used = check_shard_nodes_data(shard_nodes_data)
self.assertEqual(1, obj_count)
shard_1_part = self.get_part_and_node_numbers(
orig_shard_ranges[1])[0]
for conf_index in self.configs['container-sharder'].keys():
self.run_custom_sharder(conf_index, {'reclaim_age': 0},
override_partitions=[shard_1_part])
self.assert_container_listing([alpha])
self.sharders.once()
self.assert_container_listing([alpha])
self.sharders.once()
self.assert_container_listing([alpha])
shard_nodes_data = self.direct_get_container_shard_ranges(
orig_shard_ranges[1].account, orig_shard_ranges[1].container)
check_shard_nodes_data(
shard_nodes_data, expected_state='sharded', expected_shards=1,
exp_obj_count=1)
root_nodes_data = self.direct_get_container_shard_ranges()
self.assertEqual(3, len(root_nodes_data))
exp_hdrs = {'X-Backend-Sharding-State': 'collapsed',
'X-Container-Object-Count': '1'}
for node_id, node_data in root_nodes_data.items():
with annotate_failure('Node id %s.' % node_id):
check_node_data(node_data, exp_hdrs, 0, 0)
client.delete_object(
self.url, self.token, self.container_name, alpha)
client.delete_container(self.url, self.token, self.container_name)
self.assert_container_not_found()
self.direct_head_container(expect_failure=True)
self.sharders.once()
self.assert_container_not_found()
self.direct_head_container(expect_failure=True)
self.updaters.once()
self.assert_container_listing([beta])
client.delete_object(
self.url, self.token, self.container_name, beta)
do_shard_then_shrink()
do_shard_then_shrink()
def test_delete_root_reclaim(self):
all_obj_names = self._make_object_names(self.max_shard_size)
self.put_objects(all_obj_names)
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
for n in self.brain.node_numbers:
self.sharders.once(
number=n, additional_args='--partitions=%s' % self.brain.part)
for node in self.brain.nodes:
self.assert_container_state(node, 'sharded', 2)
self.assert_container_delete_fails()
self.assert_container_has_shard_sysmeta()
self.assert_container_post_ok('sharded')
self.assert_container_listing(all_obj_names)
self.delete_objects(all_obj_names)
self.assert_container_listing([])
self.assert_container_post_ok('has objects')
self.assert_container_object_count(len(all_obj_names))
self.assert_container_delete_fails()
self.assert_container_has_shard_sysmeta()
shard_ranges = self.get_container_shard_ranges()
self.assertLengthEqual(shard_ranges, 2)
self.run_sharders(shard_ranges)
self.assert_container_listing([])
self.assert_container_post_ok('empty')
self.assert_container_object_count(0)
client.delete_container(self.url, self.token, self.container_name)
self.assert_container_post_fails('deleted')
self.assert_container_not_found()
Manager(['container-updater']).once()
for conf_file in self.configs['container-replicator'].values():
conf = utils.readconf(conf_file, 'container-replicator')
conf['reclaim_age'] = 0
ContainerReplicator(conf).run_once()
for conf_index in self.configs['container-sharder'].keys():
sharder = self.run_custom_sharder(conf_index, {})
self.assertEqual([], sharder.logger.get_lines_for_level('warning'))
# until the root wants to start reclaiming but we haven't shrunk yet!
found_warning = False
for conf_index in self.configs['container-sharder'].keys():
sharder = self.run_custom_sharder(conf_index, {'reclaim_age': 0})
warnings = sharder.logger.get_lines_for_level('warning')
if warnings:
self.assertTrue(warnings[0].startswith(
'Reclaimable db stuck waiting for shrinking'))
self.assertEqual(1, len(warnings))
found_warning = True
self.assertTrue(found_warning)
def _setup_replication_scenario(self, num_shards, extra_objs=('alpha',)):
obj_names = self._make_object_names(
num_shards * self.max_shard_size // 2)
self.put_objects(obj_names)
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
node_numbers = self.brain.node_numbers
self.replicators.once()
self.stop_container_servers(slice(0, 2))
self.put_objects(extra_objs)
for number in node_numbers[:2]:
self.brain.servers.start(number=number)
self.brain.servers.stop(number=node_numbers[2])
self.assert_container_listing(obj_names)
for number in node_numbers[:2]:
self.sharders.once(
number=number,
additional_args='--partitions=%s' % self.brain.part)
self.assert_container_listing(obj_names)
return obj_names
def test_replication_to_sharding_container(self):
obj_names = self._setup_replication_scenario(3)
for node in self.brain.nodes[:2]:
self.assert_container_state(node, 'sharding', 3)
node_numbers = self.brain.node_numbers
self.brain.servers.start(number=node_numbers[2])
self.assert_container_state(self.brain.nodes[2], 'unsharded', 0)
self.replicators.once(number=node_numbers[2])
found = self.categorize_container_dir_content()
self.assertLengthEqual(found['shard_dbs'], 2)
self.assertLengthEqual(found['normal_dbs'], 3)
for node in self.brain.nodes[:2]:
broker = self.get_broker(self.brain.part, node)
with annotate_failure(
'Node id %s in %s' % (node['id'], self.brain.nodes[:2])):
self.assertFalse(broker.get_objects())
self.assert_container_state(node, 'sharding', 3)
self.brain.servers.stop(number=node_numbers[2])
self.assert_container_listing(obj_names)
self.brain.servers.start(number=node_numbers[2])
node_data = self.direct_get_container_shard_ranges()
for node, (hdrs, shard_ranges) in node_data.items():
with annotate_failure(node):
self.assert_shard_ranges_contiguous(3, shard_ranges)
self.brain.servers.stop(number=node_numbers[2])
for number in node_numbers[:2]:
self.sharders.once(
number=number,
additional_args='--partitions=%s' % self.brain.part)
self.assert_container_state(self.brain.nodes[0], 'sharded', 3)
self.assert_container_state(self.brain.nodes[1], 'sharded', 3)
self.assert_container_listing(obj_names)
self.brain.servers.start(number=node_numbers[2])
self.assert_container_state(self.brain.nodes[2], 'unsharded', 3)
self.sharders.once(number=node_numbers[2],
additional_args='--partitions=%s' % self.brain.part)
self.assert_container_state(self.brain.nodes[2], 'sharding', 3)
self.sharders.once(number=node_numbers[2],
additional_args='--partitions=%s' % self.brain.part)
self.assert_container_state(self.brain.nodes[2], 'sharded', 3)
self.assert_container_listing(['alpha'] + obj_names)
def test_replication_to_sharded_container(self):
obj_names = self._setup_replication_scenario(2)
for node in self.brain.nodes[:2]:
self.assert_container_state(node, 'sharded', 2)
found = self.categorize_container_dir_content()
self.assertLengthEqual(found['shard_dbs'], 2)
self.assertLengthEqual(found['normal_dbs'], 1)
for node in self.brain.nodes[:2]:
broker = self.get_broker(self.brain.part, node)
info = broker.get_info()
with annotate_failure(
'Node id %s in %s' % (node['id'], self.brain.nodes[:2])):
self.assertEqual(len(obj_names), info['object_count'])
self.assertFalse(broker.get_objects())
node_numbers = self.brain.node_numbers
self.brain.servers.start(number=node_numbers[2])
self.assert_container_state(self.brain.nodes[2], 'unsharded', 0)
self.replicators.once(number=node_numbers[2])
found = self.categorize_container_dir_content()
self.assertLengthEqual(found['shard_dbs'], 2)
self.assertLengthEqual(found['normal_dbs'], 1)
for node in self.brain.nodes[:2]:
broker = self.get_broker(self.brain.part, node)
with annotate_failure(
'Node id %s in %s' % (node['id'], self.brain.nodes[:2])):
self.assertFalse(broker.get_objects())
self.assert_container_state(node, 'sharded', 2)
self.brain.servers.stop(number=node_numbers[2])
self.assert_container_listing(obj_names)
self.brain.servers.start(number=node_numbers[2])
node_data = self.direct_get_container_shard_ranges()
for node, (hdrs, shard_ranges) in node_data.items():
with annotate_failure(node):
self.assert_shard_ranges_contiguous(2, shard_ranges)
self.assert_container_state(self.brain.nodes[2], 'unsharded', 2)
self.sharders.once(number=node_numbers[2],
additional_args='--partitions=%s' % self.brain.part)
self.assert_container_state(self.brain.nodes[2], 'sharded', 2)
self.assert_container_listing(['alpha'] + obj_names)
def test_sharding_requires_sufficient_replication(self):
obj_names = self._make_object_names(2 * self.max_shard_size)
self.put_objects(obj_names)
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
node_numbers = self.brain.node_numbers
leader_node = self.brain.nodes[0]
leader_num = node_numbers[0]
self.replicators.once()
self.sharders.once(number=leader_num,
additional_args='--partitions=%s' % self.brain.part)
shard_ranges = self.assert_container_state(leader_node, 'sharding', 4)
self.assertEqual([ShardRange.CLEAVED] * 2 + [ShardRange.CREATED] * 2,
[sr.state for sr in shard_ranges])
recon = direct_client.direct_get_recon(leader_node, "sharding")
expected_in_progress = {'all': [{'account': 'AUTH_test',
'active': 0,
'cleaved': 2,
'created': 2,
'found': 0,
'db_state': 'sharding',
'state': 'sharding',
'error': None,
'file_size': mock.ANY,
'meta_timestamp': mock.ANY,
'node_index': 0,
'object_count': len(obj_names),
'container': mock.ANY,
'path': mock.ANY,
'root': mock.ANY}]}
actual = recon['sharding_stats']['sharding']['sharding_in_progress']
self.assertEqual(expected_in_progress, actual)
# stop *all* container servers for third shard range
sr_part, sr_node_nums = self.get_part_and_node_numbers(shard_ranges[2])
for node_num in sr_node_nums:
self.brain.servers.stop(number=node_num)
# attempt to continue sharding on the leader node
self.sharders.once(number=leader_num,
additional_args='--partitions=%s' % self.brain.part)
# no cleaving progress was made
for node_num in sr_node_nums:
self.brain.servers.start(number=node_num)
shard_ranges = self.assert_container_state(leader_node, 'sharding', 4)
self.assertEqual([ShardRange.CLEAVED] * 2 + [ShardRange.CREATED] * 2,
[sr.state for sr in shard_ranges])
# stop two of the servers for third shard range, not including any
# server that happens to be the leader node
stopped = []
for node_num in sr_node_nums:
if node_num != leader_num:
self.brain.servers.stop(number=node_num)
stopped.append(node_num)
if len(stopped) >= 2:
break
self.assertLengthEqual(stopped, 2) # sanity check
# attempt to continue sharding on the leader node
self.sharders.once(number=leader_num,
additional_args='--partitions=%s' % self.brain.part)
# no cleaving progress was made
for node_num in stopped:
self.brain.servers.start(number=node_num)
shard_ranges = self.assert_container_state(leader_node, 'sharding', 4)
self.assertEqual([ShardRange.CLEAVED] * 2 + [ShardRange.CREATED] * 2,
[sr.state for sr in shard_ranges])
# stop just one of the servers for third shard range
stopped = []
for node_num in sr_node_nums:
if node_num != leader_num:
self.brain.servers.stop(number=node_num)
stopped.append(node_num)
break
self.assertLengthEqual(stopped, 1) # sanity check
# attempt to continue sharding the container
self.sharders.once(number=leader_num,
additional_args='--partitions=%s' % self.brain.part)
# this time cleaving completed
self.brain.servers.start(number=stopped[0])
shard_ranges = self.assert_container_state(leader_node, 'sharded', 4)
self.assertEqual([ShardRange.ACTIVE] * 4,
[sr.state for sr in shard_ranges])
# Check the leader's progress again, this time is should be complete
recon = direct_client.direct_get_recon(leader_node, "sharding")
expected_in_progress = {'all': [{'account': 'AUTH_test',
'active': 4,
'cleaved': 0,
'created': 0,
'found': 0,
'db_state': 'sharded',
'state': 'sharded',
'error': None,
'file_size': mock.ANY,
'meta_timestamp': mock.ANY,
'node_index': 0,
'object_count': len(obj_names),
'container': mock.ANY,
'path': mock.ANY,
'root': mock.ANY}]}
actual = recon['sharding_stats']['sharding']['sharding_in_progress']
self.assertEqual(expected_in_progress, actual)
def test_sharded_delete(self):
all_obj_names = self._make_object_names(self.max_shard_size)
self.put_objects(all_obj_names)
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
for n in self.brain.node_numbers:
self.sharders.once(
number=n, additional_args='--partitions=%s' % self.brain.part)
for node in self.brain.nodes:
self.assert_container_state(node, 'sharded', 2)
self.assert_container_delete_fails()
self.assert_container_has_shard_sysmeta()
self.assert_container_post_ok('sharded')
self.assert_container_listing(all_obj_names)
self.delete_objects(all_obj_names)
self.assert_container_listing([])
self.assert_container_post_ok('has objects')
self.assert_container_object_count(len(all_obj_names))
self.assert_container_delete_fails()
self.assert_container_has_shard_sysmeta()
shard_ranges = self.get_container_shard_ranges()
self.assertLengthEqual(shard_ranges, 2)
self.run_sharders(shard_ranges)
self.assert_container_listing([])
self.assert_container_post_ok('empty')
self.assert_container_object_count(0)
self.put_objects(['alpha'])
self.assert_container_listing(['alpha'])
self.assert_container_object_count(0)
client.delete_container(self.url, self.token, self.container_name)
self.assert_container_post_fails('deleted')
self.assert_container_not_found()
self.run_sharders(shard_ranges)
self.assert_container_listing(['alpha'])
self.assert_container_object_count(1)
self.assert_container_delete_fails()
self.assert_container_post_ok('revived')
def test_object_update_redirection(self):
all_obj_names = self._make_object_names(self.max_shard_size)
self.put_objects(all_obj_names)
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
for n in self.brain.node_numbers:
self.sharders.once(
number=n, additional_args='--partitions=%s' % self.brain.part)
for node in self.brain.nodes:
self.assert_container_state(node, 'sharded', 2)
self.assert_container_delete_fails()
self.assert_container_has_shard_sysmeta()
self.assert_container_post_ok('sharded')
self.assert_container_listing(all_obj_names)
self.delete_objects(all_obj_names)
self.assert_container_listing([])
self.assert_container_post_ok('has objects')
shard_ranges = self.get_container_shard_ranges()
self.assertLengthEqual(shard_ranges, 2)
shard_partitions = [self.get_part_and_node_numbers(sr)[0]
for sr in shard_ranges]
for conf_index in self.configs['container-sharder'].keys():
self.run_custom_sharder(conf_index, {'reclaim_age': 0},
override_partitions=shard_partitions)
self.assert_container_object_count(0)
shard_part, shard_nodes = self.get_part_and_node_numbers(
shard_ranges[0])
self.brain.servers.stop(number=shard_nodes[2])
self.put_objects(['alpha'])
self.assert_container_listing(['alpha'])
self.assert_container_object_count(0)
self.assertLengthEqual(
self.gather_async_pendings(self.get_all_object_nodes()), 1)
self.brain.servers.start(number=shard_nodes[2])
self.sharders.once(additional_args='--partitions=%s' % self.brain.part)
self.sharders.once(additional_args='--partitions=%s' % shard_part,
number=shard_nodes[2])
self.assertLengthEqual(self.get_container_shard_ranges(), 1)
self.assert_container_listing([], req_hdrs={'x-newest': 'true'})
self.assert_container_object_count(0)
self.updaters.once()
self.assert_container_listing(['alpha'])
self.assert_container_object_count(0)
for number in shard_nodes[:2]:
self.sharders.once(additional_args='--partitions=%s' % shard_part,
number=number)
self.run_sharders(shard_ranges[1])
self.assert_container_listing(['alpha'])
self.assert_container_object_count(1)
self.assertLengthEqual(self.get_container_shard_ranges(), 1)
shard_part, shard_nodes = self.get_part_and_node_numbers(
shard_ranges[1])
self.brain.servers.stop(number=shard_nodes[2])
self.memcache.delete(get_cache_key(
self.account, self.container_name, shard='updating'))
self.delete_objects(['alpha'])
self.put_objects(['beta'])
self.assert_container_listing(['beta'])
self.assert_container_object_count(1)
self.assertLengthEqual(
self.gather_async_pendings(self.get_all_object_nodes()), 2)
self.brain.servers.start(number=shard_nodes[2])
self.sharders.once(additional_args='--partitions=%s' % self.brain.part)
self.sharders.once(additional_args='--partitions=%s' % shard_part,
number=shard_nodes[2])
self.assertFalse(self.get_container_shard_ranges())
for number in shard_nodes[:2]:
self.brain.servers.stop(number=number)
self.assert_container_listing(['alpha'])
self.assert_container_object_count(1)
# run the updaters: the async pending update will be redirected from
# shrunk shard to the root
self.updaters.once()
self.assert_container_listing(['beta'])
self.assert_container_object_count(1)
def test_misplaced_object_movement(self):
def merge_object(shard_range, name, deleted=0):
# it's hard to get a test to put a misplaced object into a shard,
shard_part, shard_nodes = self.brain.ring.get_nodes(
shard_range.account, shard_range.container)
shard_broker = self.get_broker(
shard_part, shard_nodes[0], shard_range.account,
shard_range.container)
shard_broker.merge_items(
[{'name': name, 'created_at': Timestamp.now().internal,
'size': 0, 'content_type': 'text/plain',
'etag': md5(usedforsecurity=False).hexdigest(),
'deleted': deleted,
'storage_policy_index': shard_broker.storage_policy_index}])
return shard_nodes[0]
all_obj_names = self._make_object_names(self.max_shard_size)
self.put_objects(all_obj_names)
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
for n in self.brain.node_numbers:
self.sharders.once(
number=n, additional_args='--partitions=%s' % self.brain.part)
for node in self.brain.nodes:
self.assert_container_state(node, 'sharded', 2)
self.assert_container_delete_fails()
self.assert_container_has_shard_sysmeta()
self.assert_container_post_ok('sharded')
self.assert_container_listing(all_obj_names)
shard_ranges = self.get_container_shard_ranges()
self.assertLengthEqual(shard_ranges, 2)
shard_0_objects = [name for name in all_obj_names
if name in shard_ranges[0]]
shard_1_objects = [name for name in all_obj_names
if name in shard_ranges[1]]
self.delete_objects(shard_0_objects)
self.assert_container_listing(shard_1_objects)
self.assert_container_post_ok('has objects')
shard_0_part = self.get_part_and_node_numbers(shard_ranges[0])[0]
for conf_index in self.configs['container-sharder'].keys():
self.run_custom_sharder(conf_index, {'reclaim_age': 0},
override_partitions=[shard_0_part])
self.assert_container_object_count(len(shard_1_objects))
self.sharders.once(additional_args='--partitions=%s' % self.brain.part)
self.run_sharders(shard_ranges[0])
misplaced_node = merge_object(shard_ranges[0], 'alpha', deleted=0)
self.assertLengthEqual(self.get_container_shard_ranges(), 1)
self.assert_container_listing(shard_1_objects)
self.assert_container_object_count(len(shard_1_objects))
shard_part, shard_nodes_numbers = self.get_part_and_node_numbers(
shard_ranges[0])
self.sharders.once(additional_args='--partitions=%s' % shard_part,
number=misplaced_node['id'] + 1)
self.assert_container_listing(['alpha'] + shard_1_objects)
self.assert_container_object_count(len(shard_1_objects))
self.run_sharders(shard_ranges[1])
self.assert_container_listing(['alpha'] + shard_1_objects)
self.assert_container_object_count(len(shard_1_objects) + 1)
self.assertLengthEqual(self.get_container_shard_ranges(), 1)
self.delete_objects(shard_1_objects)
shard_1_part = self.get_part_and_node_numbers(shard_ranges[1])[0]
for conf_index in self.configs['container-sharder'].keys():
self.run_custom_sharder(conf_index, {'reclaim_age': 0},
override_partitions=[shard_1_part])
self.sharders.once(additional_args='--partitions=%s' % self.brain.part)
self.run_sharders(shard_ranges[1])
self.assertFalse(self.get_container_shard_ranges())
merge_object(shard_ranges[1], 'alpha', deleted=1)
misplaced_node = merge_object(shard_ranges[1], 'beta', deleted=0)
self.assert_container_listing(['alpha'])
self.assert_container_object_count(1)
shard_part, shard_nodes_numbers = self.get_part_and_node_numbers(
shard_ranges[1])
self.sharders.once(additional_args='--partitions=%s' % shard_part,
number=misplaced_node['id'] + 1)
self.assert_container_listing(['beta'])
self.assert_container_object_count(1)
self.assert_container_delete_fails()
def test_misplaced_object_movement_from_deleted_shard(self):
def merge_object(shard_range, name, deleted=0):
# so this hack is used force an object record directly into a shard
# container db. Note: the actual object won't exist, we're just
# using this to test object records in container dbs.
shard_part, shard_nodes = self.brain.ring.get_nodes(
shard_range.account, shard_range.container)
shard_broker = self.get_shard_broker(shard_range)
# In this test we want to merge into a deleted container shard
shard_broker.delete_db(Timestamp.now().internal)
shard_broker.merge_items(
[{'name': name, 'created_at': Timestamp.now().internal,
'size': 0, 'content_type': 'text/plain',
'etag': md5(usedforsecurity=False).hexdigest(),
'deleted': deleted,
'storage_policy_index': shard_broker.storage_policy_index}])
return shard_nodes[0]
all_obj_names = self._make_object_names(self.max_shard_size)
self.put_objects(all_obj_names)
# Shard the container
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
for n in self.brain.node_numbers:
self.sharders.once(
number=n, additional_args='--partitions=%s' % self.brain.part)
# sanity checks
for node in self.brain.nodes:
self.assert_container_state(node, 'sharded', 2)
self.assert_container_delete_fails()
self.assert_container_has_shard_sysmeta()
self.assert_container_post_ok('sharded')
self.assert_container_listing(all_obj_names)
# delete all objects in first shard range - updates redirected to shard
shard_ranges = self.get_container_shard_ranges()
self.assertLengthEqual(shard_ranges, 2)
shard_0_objects = [name for name in all_obj_names
if name in shard_ranges[0]]
shard_1_objects = [name for name in all_obj_names
if name in shard_ranges[1]]
self.delete_objects(shard_0_objects)
self.assert_container_listing(shard_1_objects)
self.assert_container_post_ok('has objects')
# run sharder on first shard container to update root stats
shard_0_part = self.get_part_and_node_numbers(shard_ranges[0])[0]
for conf_index in self.configs['container-sharder'].keys():
self.run_custom_sharder(conf_index, {'reclaim_age': 0},
override_partitions=[shard_0_part])
self.assert_container_object_count(len(shard_1_objects))
# First, test a misplaced object moving from one shard to another.
# run sharder on root to discover first shrink candidate
self.sharders.once(additional_args='--partitions=%s' % self.brain.part)
# then run sharder on first shard range to shrink it
self.run_sharders(shard_ranges[0])
# force a misplaced object into the shrunken shard range to simulate
# a client put that was in flight when it started to shrink
misplaced_node = merge_object(shard_ranges[0], 'alpha', deleted=0)
# root sees first shard has shrunk, only second shard range used for
# listing so alpha object not in listing
self.assertLengthEqual(self.get_container_shard_ranges(), 1)
self.assert_container_listing(shard_1_objects)
self.assert_container_object_count(len(shard_1_objects))
# until sharder runs on that node to move the misplaced object to the
# second shard range
shard_part, shard_nodes_numbers = self.get_part_and_node_numbers(
shard_ranges[0])
self.sharders.once(additional_args='--partitions=%s' % shard_part,
number=misplaced_node['id'] + 1)
self.assert_container_listing(['alpha'] + shard_1_objects)
# root not yet updated
self.assert_container_object_count(len(shard_1_objects))
# check the deleted shard did not push the wrong root path into the
# other container
for replica in 0, 1, 2:
shard_x_broker = self.get_shard_broker(shard_ranges[1], replica)
self.assertEqual("%s/%s" % (self.account, self.container_name),
shard_x_broker.root_path)
# run the sharder of the existing shard to update the root stats
# to prove the misplaced object was moved to the other shard _and_
# the other shard still has the correct root because it updates root's
self.run_sharders(shard_ranges[1])
self.assert_container_object_count(len(shard_1_objects) + 1)
def test_replication_to_sharded_container_from_unsharded_old_primary(self):
primary_ids = [n['id'] for n in self.brain.nodes]
handoff_node = next(n for n in self.brain.ring.devs
if n['id'] not in primary_ids)
obj_names = self._setup_replication_scenario(2)
for node in self.brain.nodes[:2]:
self.assert_container_state(node, 'sharded', 2)
node_numbers = self.brain.node_numbers
new_primary_node = self.brain.nodes[2]
new_primary_node_number = node_numbers[2]
new_primary_dir, container_hash = self.get_storage_dir(
self.brain.part, new_primary_node)
old_primary_dir, container_hash = self.get_storage_dir(
self.brain.part, handoff_node)
utils.mkdirs(os.path.dirname(old_primary_dir))
shutil.move(new_primary_dir, old_primary_dir)
self.brain.servers.start(number=new_primary_node_number)
client.put_container(self.url, self.token, self.container_name)
self.assertTrue(os.path.exists(os.path.join(
new_primary_dir, container_hash + '.db')))
found = self.categorize_container_dir_content()
self.assertLengthEqual(found['normal_dbs'], 1)
self.assertLengthEqual(found['shard_dbs'], 2)
failed_node = self.brain.nodes[0]
failed_dir, _container_hash = self.get_storage_dir(
self.brain.part, failed_node)
shutil.rmtree(failed_dir)
self.brain.servers.stop(number=new_primary_node_number)
self.replicators.once(number=handoff_node['id'] + 1)
# This may or may not have shard ranges, depending on the order in
# which we hit the primaries, but it definitely *doesn't* have an
self.assertTrue(os.path.exists(os.path.join(
failed_dir, container_hash + '.db')))
self.assertLengthEqual(os.listdir(failed_dir), 1)
broker = self.get_broker(self.brain.part, failed_node)
self.assertLengthEqual(broker.get_objects(), len(obj_names) + 1)
broker = self.get_broker(self.brain.part, self.brain.nodes[1])
self.assertLengthEqual(broker.get_objects(), 0)
self.assertTrue(os.path.exists(os.path.join(
old_primary_dir, container_hash + '.db')))
broker = self.get_broker(self.brain.part, handoff_node)
shard_ranges = broker.get_shard_ranges()
self.assertLengthEqual(shard_ranges, 2)
self.assert_container_state(handoff_node, 'unsharded', 2)
self.brain.servers.start(number=new_primary_node_number)
self.replicators.once(number=handoff_node['id'] + 1)
# but instead we wait
broker = self.get_broker(self.brain.part, new_primary_node)
self.assertLengthEqual(broker.get_objects(), 0)
shard_ranges = broker.get_shard_ranges()
self.assertLengthEqual(shard_ranges, 2)
# so the next time the sharder comes along, it can push rows out
# and delete the big db
self.sharders.once(number=handoff_node['id'] + 1,
additional_args='--partitions=%s' % self.brain.part)
self.assert_container_state(handoff_node, 'sharded', 2)
self.assertFalse(os.path.exists(os.path.join(
old_primary_dir, container_hash + '.db')))
# the sharded db hangs around until replication confirms durability
# first attempt is not sufficiently successful
self.brain.servers.stop(number=node_numbers[0])
self.replicators.once(number=handoff_node['id'] + 1)
self.assertTrue(os.path.exists(old_primary_dir))
self.assert_container_state(handoff_node, 'sharded', 2)
# second attempt is successful and handoff db is deleted
self.brain.servers.start(number=node_numbers[0])
self.replicators.once(number=handoff_node['id'] + 1)
self.assertFalse(os.path.exists(old_primary_dir))
# run all the sharders, get us into a consistent state
self.sharders.once(additional_args='--partitions=%s' % self.brain.part)
self.assert_container_listing(['alpha'] + obj_names)
def test_replication_to_empty_new_primary_from_sharding_old_primary(self):
primary_ids = [n['id'] for n in self.brain.nodes]
handoff_node = next(n for n in self.brain.ring.devs
if n['id'] not in primary_ids)
num_shards = 3
obj_names = self._make_object_names(
num_shards * self.max_shard_size // 2)
self.put_objects(obj_names)
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
# run replicators first time to get sync points set
self.replicators.once()
# start sharding on only the leader node
leader_node = self.brain.nodes[0]
leader_node_number = self.brain.node_numbers[0]
self.sharders.once(number=leader_node_number)
self.assert_container_state(leader_node, 'sharding', 3)
for node in self.brain.nodes[1:]:
self.assert_container_state(node, 'unsharded', 3)
# Fake a ring change - copy leader node db to a handoff to create
# illusion of a new unpopulated primary leader node
new_primary_dir, container_hash = self.get_storage_dir(
self.brain.part, leader_node)
old_primary_dir, container_hash = self.get_storage_dir(
self.brain.part, handoff_node)
utils.mkdirs(os.path.dirname(old_primary_dir))
shutil.move(new_primary_dir, old_primary_dir)
self.assert_container_state(handoff_node, 'sharding', 3)
# run replicator on handoff node to create a fresh db on new primary
self.assertFalse(os.path.exists(new_primary_dir))
self.replicators.once(number=handoff_node['id'] + 1)
self.assertTrue(os.path.exists(new_primary_dir))
self.assert_container_state(leader_node, 'sharded', 3)
broker = self.get_broker(self.brain.part, leader_node)
shard_ranges = broker.get_shard_ranges()
self.assertLengthEqual(shard_ranges, 3)
self.assertEqual(
[ShardRange.CLEAVED, ShardRange.CLEAVED, ShardRange.CREATED],
[sr.state for sr in shard_ranges])
# db still exists on handoff
self.assertTrue(os.path.exists(old_primary_dir))
self.assert_container_state(handoff_node, 'sharding', 3)
# continue sharding it...
self.sharders.once(number=handoff_node['id'] + 1)
self.assert_container_state(leader_node, 'sharded', 3)
# now handoff is fully sharded the replicator will delete it
self.replicators.once(number=handoff_node['id'] + 1)
self.assertFalse(os.path.exists(old_primary_dir))
# all primaries now have active shard ranges but only one is in sharded
# state
self.assert_container_state(leader_node, 'sharded', 3)
for node in self.brain.nodes[1:]:
self.assert_container_state(node, 'unsharded', 3)
node_data = self.direct_get_container_shard_ranges()
for node_id, (hdrs, shard_ranges) in node_data.items():
with annotate_failure(
'node id %s from %s' % (node_id, node_data.keys)):
self.assert_shard_range_state(ShardRange.ACTIVE, shard_ranges)
# check handoff cleaved all objects before it was deleted - stop all
# but leader node so that listing is fetched from shards
for number in self.brain.node_numbers[1:3]:
self.brain.servers.stop(number=number)
self.assert_container_listing(obj_names)
for number in self.brain.node_numbers[1:3]:
self.brain.servers.start(number=number)
self.sharders.once()
self.assert_container_state(leader_node, 'sharded', 3)
for node in self.brain.nodes[1:]:
self.assert_container_state(node, 'sharding', 3)
self.sharders.once()
for node in self.brain.nodes:
self.assert_container_state(node, 'sharded', 3)
self.assert_container_listing(obj_names)
def test_sharded_account_updates(self):
# verify that .shards account updates have zero object count and bytes
# to avoid double accounting
all_obj_names = self._make_object_names(self.max_shard_size)
self.put_objects(all_obj_names, contents='xyz')
# Shard the container into 2 shards
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
for n in self.brain.node_numbers:
self.sharders.once(
number=n, additional_args='--partitions=%s' % self.brain.part)
# sanity checks
for node in self.brain.nodes:
shard_ranges = self.assert_container_state(node, 'sharded', 2)
self.assert_container_delete_fails()
self.assert_container_has_shard_sysmeta()
self.assert_container_post_ok('sharded')
self.assert_container_listing(all_obj_names)
# run the updaters to get account stats updated
self.updaters.once()
# check user account stats
metadata = self.internal_client.get_account_metadata(self.account)
self.assertEqual(1, int(metadata.get('x-account-container-count')))
self.assertEqual(self.max_shard_size,
int(metadata.get('x-account-object-count')))
self.assertEqual(3 * self.max_shard_size,
int(metadata.get('x-account-bytes-used')))
# check hidden .shards account stats
metadata = self.internal_client.get_account_metadata(
shard_ranges[0].account)
self.assertEqual(2, int(metadata.get('x-account-container-count')))
self.assertEqual(0, int(metadata.get('x-account-object-count')))
self.assertEqual(0, int(metadata.get('x-account-bytes-used')))
class TestContainerShardingMoreUTF8(TestContainerSharding):
def _make_object_names(self, number):
# override default with names that include non-ascii chars
name_length = self.cluster_info['swift']['max_object_name_length']
obj_names = []
for x in range(number):
name = (u'obj-\u00e4\u00ea\u00ec\u00f2\u00fb-%04d' % x)
name = name.encode('utf8').ljust(name_length, b'o')
if not six.PY2:
name = name.decode('utf8')
obj_names.append(name)
return obj_names
def _setup_container_name(self):
# override default with max length name that includes non-ascii chars
super(TestContainerShardingMoreUTF8, self)._setup_container_name()
name_length = self.cluster_info['swift']['max_container_name_length']
cont_name = \
self.container_name + u'-\u00e4\u00ea\u00ec\u00f2\u00fb\u1234'
self.container_name = cont_name.encode('utf8').ljust(name_length, b'x')
if not six.PY2:
self.container_name = self.container_name.decode('utf8')
class TestManagedContainerSharding(BaseTestContainerSharding):
def sharders_once(self, **kwargs):
# inhibit auto_sharding regardless of the config setting
additional_args = kwargs.get('additional_args', [])
if not isinstance(additional_args, list):
additional_args = [additional_args]
additional_args.append('--no-auto-shard')
kwargs['additional_args'] = additional_args
self.sharders.once(**kwargs)
def test_manage_shard_ranges(self):
obj_names = self._make_object_names(7)
self.put_objects(obj_names)
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
# run replicators first time to get sync points set
self.replicators.once()
# sanity check: we don't have nearly enough objects for this to shard
self.sharders_once(number=self.brain.node_numbers[0],
additional_args='--partitions=%s' % self.brain.part)
self.assert_container_state(self.brain.nodes[0], 'unsharded', 0)
self.assert_subprocess_success([
'swift-manage-shard-ranges',
self.get_db_file(self.brain.part, self.brain.nodes[0]),
'find_and_replace', '3', '--enable', '--minimum-shard-size', '2'])
self.assert_container_state(self.brain.nodes[0], 'unsharded', 2)
self.replicators.once()
self.sharders_once(additional_args='--partitions=%s' % self.brain.part)
self.assert_container_state(self.brain.nodes[0], 'sharded', 2)
self.assert_container_state(self.brain.nodes[1], 'sharded', 2)
self.assert_container_state(self.brain.nodes[2], 'sharded', 2)
self.assert_container_listing(obj_names)
def test_manage_shard_ranges_compact(self):
# verify shard range compaction using swift-manage-shard-ranges
obj_names = self._make_object_names(8)
self.put_objects(obj_names)
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
# run replicators first time to get sync points set, and get container
# sharded into 4 shards
self.replicators.once()
self.assert_subprocess_success([
'swift-manage-shard-ranges',
self.get_db_file(self.brain.part, self.brain.nodes[0]),
'find_and_replace', '2', '--enable'])
self.assert_container_state(self.brain.nodes[0], 'unsharded', 4)
self.replicators.once()
# run sharders twice to cleave all 4 shard ranges
self.sharders_once(additional_args='--partitions=%s' % self.brain.part)
self.sharders_once(additional_args='--partitions=%s' % self.brain.part)
self.assert_container_state(self.brain.nodes[0], 'sharded', 4)
self.assert_container_state(self.brain.nodes[1], 'sharded', 4)
self.assert_container_state(self.brain.nodes[2], 'sharded', 4)
self.assert_container_listing(obj_names)
# now compact some ranges; use --max-shrinking to allow 2 shrinking
# shards
self.assert_subprocess_success([
'swift-manage-shard-ranges',
self.get_db_file(self.brain.part, self.brain.nodes[0]),
'compact', '--max-expanding', '1', '--max-shrinking', '2',
'--yes'])
shard_ranges = self.assert_container_state(
self.brain.nodes[0], 'sharded', 4)
self.assertEqual([ShardRange.SHRINKING] * 2 + [ShardRange.ACTIVE] * 2,
[sr.state for sr in shard_ranges])
self.replicators.once()
self.sharders_once()
# check there's now just 2 remaining shard ranges
shard_ranges = self.assert_container_state(
self.brain.nodes[0], 'sharded', 2)
self.assertEqual([ShardRange.ACTIVE] * 2,
[sr.state for sr in shard_ranges])
self.assert_container_listing(obj_names, req_hdrs={'X-Newest': 'True'})
for i, node in enumerate(self.brain.nodes):
with annotate_failure('node[%d]' % i):
broker = self.get_broker(self.brain.part, self.brain.nodes[0])
self.assertEqual(ShardRange.SHARDED,
broker.get_own_shard_range().state)
self.assert_subprocess_success([
'swift-manage-shard-ranges',
self.get_db_file(self.brain.part, self.brain.nodes[0]),
'compact', '--yes', '--max-shrinking', '2'])
shard_ranges = self.assert_container_state(
self.brain.nodes[0], 'sharded', 2)
self.assertEqual([ShardRange.SHRINKING] * 2,
[sr.state for sr in shard_ranges])
self.replicators.once()
self.sharders_once()
self.assert_container_state(self.brain.nodes[0], 'collapsed', 0)
self.assert_container_listing(obj_names, req_hdrs={'X-Newest': 'True'})
for i, node in enumerate(self.brain.nodes):
with annotate_failure('node[%d]' % i):
broker = self.get_broker(self.brain.part, self.brain.nodes[0])
self.assertEqual(ShardRange.ACTIVE,
broker.get_own_shard_range().state)
def test_manage_shard_ranges_repair_root(self):
obj_names = self._make_object_names(16)
self.put_objects(obj_names)
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
self.replicators.once()
# 0.2 and 0.3 that are installed with epoch_0
self.assert_subprocess_success([
'swift-manage-shard-ranges',
self.get_db_file(self.brain.part, self.brain.nodes[0]),
'find_and_replace', '4', '--enable'])
shard_ranges_0 = self.assert_container_state(self.brain.nodes[0],
'unsharded', 4)
# *Also* go find 3 shard ranges on *another node*, like a dumb-dumb -
# let's denote these ranges 1.0, 1.1 and 1.2 that are installed with
self.assert_subprocess_success([
'swift-manage-shard-ranges',
self.get_db_file(self.brain.part, self.brain.nodes[1]),
'find_and_replace', '7', '--enable'])
shard_ranges_1 = self.assert_container_state(self.brain.nodes[1],
'unsharded', 3)
self.sharders_once(number=self.brain.node_numbers[0],
additional_args='--partitions=%s' % self.brain.part)
# same state overlap), creates its shards and then syncs shard ranges
# with the other replicas. All of the 7 shard ranges on this replica
# are now in CREATED state so it proceeds to cleave the first two shard
# ranges, 0.1 and 1.0.
self.sharders_once(number=self.brain.node_numbers[1],
additional_args='--partitions=%s' % self.brain.part)
self.replicators.once()
# Uh-oh
self.assert_container_state(self.brain.nodes[0], 'sharding', 7)
self.assert_container_state(self.brain.nodes[1], 'sharding', 7)
# There's a race: the third replica may be sharding, may be unsharded
self.sharders_once(additional_args='--partitions=%s' % self.brain.part)
self.replicators.once()
self.sharders_once(additional_args='--partitions=%s' % self.brain.part)
# overlapping ranges which prevents cleaving proceeding; expect the
# shard ranges to be mostly still in created state, with one or two
# possibly cleaved during first pass before the sharding got stalled
shard_ranges = self.assert_container_state(self.brain.nodes[0],
'sharding', 7)
self.assertEqual([ShardRange.CLEAVED] * 2 + [ShardRange.CREATED] * 5,
[sr.state for sr in shard_ranges])
shard_ranges = self.assert_container_state(self.brain.nodes[1],
'sharding', 7)
self.assertEqual([ShardRange.CLEAVED] * 2 + [ShardRange.CREATED] * 5,
[sr.state for sr in shard_ranges])
# But hey, at least listings still work! They're just going to get
self.assert_container_listing(obj_names)
# path with most cleaving progress, and so shrink shard ranges 0.*.
db_file = self.get_db_file(self.brain.part, self.brain.nodes[0])
self.assert_subprocess_success(
['swift-manage-shard-ranges', db_file, 'repair', '--yes'])
# make sure all root replicas now sync their shard ranges
self.replicators.once()
# Run sharder on the shrinking shards. This should not change the state
# of any of the acceptors, particularly the ones that have yet to have
# object cleaved from the roots, because we don't want the as yet
self.run_sharders(shard_ranges_0)
shard_ranges = self.assert_container_state(self.brain.nodes[1],
'sharding', 3)
self.assertEqual([ShardRange.CLEAVED] * 1 + [ShardRange.CREATED] * 2,
[sr.state for sr in shard_ranges])
self.assert_container_listing(obj_names)
for shard_range in shard_ranges_0:
with annotate_failure(shard_range):
found_for_shard = self.categorize_container_dir_content(
shard_range.account, shard_range.container)
self.assertLengthEqual(found_for_shard['shard_dbs'], 3)
actual = []
for shard_db in found_for_shard['shard_dbs']:
broker = ContainerBroker(shard_db)
own_sr = broker.get_own_shard_range()
actual.append(
(broker.get_db_state(), own_sr.state, own_sr.deleted))
self.assertEqual([(SHARDED, ShardRange.SHRUNK, True)] * 3,
actual)
self.sharders_once()
self.sharders_once()
brokers = {}
exp_shard_ranges = sorted(
[sr.copy(state=ShardRange.SHRUNK, deleted=True)
for sr in shard_ranges_0] +
[sr.copy(state=ShardRange.ACTIVE)
for sr in shard_ranges_1],
key=ShardRange.sort_key)
for node in (0, 1, 2):
with annotate_failure('node %s' % node):
broker = self.get_broker(self.brain.part,
self.brain.nodes[node])
brokers[node] = broker
shard_ranges = broker.get_shard_ranges()
self.assertEqual(shard_ranges_1, shard_ranges)
shard_ranges = broker.get_shard_ranges(include_deleted=True)
self.assertLengthEqual(shard_ranges, len(exp_shard_ranges))
self.maxDiff = None
self.assertEqual(exp_shard_ranges, shard_ranges)
self.assertEqual(ShardRange.SHARDED,
broker._own_shard_range().state)
self.assertEqual(UNSHARDED, brokers[0].get_db_state())
self.assertEqual(SHARDED, brokers[1].get_db_state())
self.assertEqual(SHARDED, brokers[2].get_db_state())
epoch_1 = brokers[1].db_epoch
self.assertEqual(epoch_1, brokers[2].db_epoch)
self.assertLess(brokers[0].db_epoch, epoch_1)
# the root replica that thinks it is unsharded is problematic - it will
# not return shard ranges for listings, but has no objects, so it's
self.sharders_once()
for node in (0, 1, 2):
with annotate_failure('node %s' % node):
broker = self.get_broker(self.brain.part,
self.brain.nodes[node])
brokers[node] = broker
shard_ranges = broker.get_shard_ranges()
self.assertEqual(shard_ranges_1, shard_ranges)
shard_ranges = broker.get_shard_ranges(include_deleted=True)
self.assertLengthEqual(shard_ranges, len(exp_shard_ranges))
self.assertEqual(exp_shard_ranges, shard_ranges)
self.assertEqual(ShardRange.SHARDED,
broker._own_shard_range().state)
self.assertEqual(epoch_1, broker.db_epoch)
self.assertIn(brokers[0].get_db_state(), (SHARDING, SHARDED))
self.assertEqual(SHARDED, brokers[1].get_db_state())
self.assertEqual(SHARDED, brokers[2].get_db_state())
for shard_range in shard_ranges_1:
with annotate_failure(shard_range):
found_for_shard = self.categorize_container_dir_content(
shard_range.account, shard_range.container)
self.assertLengthEqual(found_for_shard['normal_dbs'], 3)
actual = []
for shard_db in found_for_shard['normal_dbs']:
broker = ContainerBroker(shard_db)
own_sr = broker.get_own_shard_range()
actual.append(
(broker.get_db_state(), own_sr.state, own_sr.deleted))
self.assertEqual([(UNSHARDED, ShardRange.ACTIVE, False)] * 3,
actual)
# replicate it as per a normal cleave.
self.sharders_once()
for node in (0, 1, 2):
with annotate_failure('node %s' % node):
broker = self.get_broker(self.brain.part,
self.brain.nodes[node])
brokers[node] = broker
shard_ranges = broker.get_shard_ranges()
self.assertEqual(shard_ranges_1, shard_ranges)
shard_ranges = broker.get_shard_ranges(include_deleted=True)
self.assertLengthEqual(shard_ranges, len(exp_shard_ranges))
self.assertEqual(exp_shard_ranges, shard_ranges)
self.assertEqual(ShardRange.SHARDED,
broker._own_shard_range().state)
self.assertEqual(epoch_1, broker.db_epoch)
self.assertEqual(SHARDED, broker.get_db_state())
# Finally, with all root replicas in a consistent state, the listing
# will be be predictably correct
self.assert_container_listing(obj_names)
def test_manage_shard_ranges_repair_shard(self):
# provoke overlaps in a shard container and repair them
obj_names = self._make_object_names(24)
initial_obj_names = obj_names[::2]
# put 12 objects in container
self.put_objects(initial_obj_names)
client.post_container(self.url, self.admin_token, self.container_name,
headers={'X-Container-Sharding': 'on'})
# run replicators first time to get sync points set
self.replicators.once()
# find 3 shard ranges on root nodes[0] and get the root sharded
self.assert_subprocess_success([
'swift-manage-shard-ranges',
self.get_db_file(self.brain.part, self.brain.nodes[0]),
'find_and_replace', '4', '--enable'])
self.replicators.once()
# cleave first two shards
self.sharders_once(additional_args='--partitions=%s' % self.brain.part)
# cleave third shard
self.sharders_once(additional_args='--partitions=%s' % self.brain.part)
# ensure all shards learn their ACTIVE state from root
self.sharders_once()
for node in (0, 1, 2):
with annotate_failure('node %d' % node):
shard_ranges = self.assert_container_state(
self.brain.nodes[node], 'sharded', 3)
for sr in shard_ranges:
self.assertEqual(ShardRange.ACTIVE, sr.state)
self.assert_container_listing(initial_obj_names)
# add objects to second shard range so it has 8 objects ; this range
# has bounds (obj-0006,obj-0014]
root_shard_ranges = self.get_container_shard_ranges()
self.assertEqual(3, len(root_shard_ranges))
shard_1 = root_shard_ranges[1]
self.assertEqual(obj_names[6], shard_1.lower)
self.assertEqual(obj_names[14], shard_1.upper)
more_obj_names = obj_names[7:15:2]
self.put_objects(more_obj_names)
expected_obj_names = sorted(initial_obj_names + more_obj_names)
self.assert_container_listing(expected_obj_names)
shard_1_part, shard_1_nodes = self.brain.ring.get_nodes(
shard_1.account, shard_1.container)
# find 3 sub-shards on one shard node; use --force-commits to ensure
# the recently PUT objects are included when finding the shard range
# pivot points
self.assert_subprocess_success([
'swift-manage-shard-ranges', '--force-commits',
self.get_db_file(shard_1_part, shard_1_nodes[1], shard_1.account,
shard_1.container),
'find_and_replace', '3', '--enable'])
# ... and mistakenly find 4 shard ranges on a different shard node :(
self.assert_subprocess_success([
'swift-manage-shard-ranges', '--force-commits',
self.get_db_file(shard_1_part, shard_1_nodes[2], shard_1.account,
shard_1.container),
'find_and_replace', '2', '--enable'])
# replicate the muddle of shard ranges between shard replicas, merged
# result is:
# '' - 6 shard ACTIVE
# 6 - 8 sub-shard FOUND
# 6 - 9 sub-shard FOUND
# 8 - 10 sub-shard FOUND
# 9 - 12 sub-shard FOUND
# 10 - 12 sub-shard FOUND
# 12 - 14 sub-shard FOUND
# 12 - 14 sub-shard FOUND
# 6 - 14 shard SHARDING
# 14 - '' shard ACTIVE
self.replicators.once()
# try hard to shard the shard...
self.sharders_once(additional_args='--partitions=%s' % shard_1_part)
self.sharders_once(additional_args='--partitions=%s' % shard_1_part)
self.sharders_once(additional_args='--partitions=%s' % shard_1_part)
# sharding hasn't completed and there's overlaps in the shard and root:
# the sub-shards will have been cleaved in the order listed above, but
# sub-shards (10 -12) and one of (12 - 14) will be overlooked because
# the cleave cursor will have moved past their namespace before they
# were yielded by the shard range iterator, so we now have:
# '' - 6 shard ACTIVE
# 6 - 8 sub-shard ACTIVE
# 6 - 9 sub-shard ACTIVE
# 8 - 10 sub-shard ACTIVE
# 10 - 12 sub-shard CREATED
# 9 - 12 sub-shard ACTIVE
# 12 - 14 sub-shard CREATED
# 12 - 14 sub-shard ACTIVE
# 14 - '' shard ACTIVE
sub_shard_ranges = self.get_container_shard_ranges(
shard_1.account, shard_1.container)
self.assertEqual(7, len(sub_shard_ranges), sub_shard_ranges)
root_shard_ranges = self.get_container_shard_ranges()
self.assertEqual(9, len(root_shard_ranges), root_shard_ranges)
self.assertEqual([ShardRange.ACTIVE] * 4 +
[ShardRange.CREATED, ShardRange.ACTIVE] * 2 +
[ShardRange.ACTIVE],
[sr.state for sr in root_shard_ranges])
# fix the overlaps - a set of 3 ACTIVE sub-shards will be chosen and 4
# other sub-shards will be shrunk away; apply the fix at the root
# container
db_file = self.get_db_file(self.brain.part, self.brain.nodes[0])
self.assert_subprocess_success(
['swift-manage-shard-ranges', db_file, 'repair', '--yes'])
self.replicators.once()
self.sharders_once()
self.sharders_once()
# check root now has just 5 shard ranges
root_shard_ranges = self.get_container_shard_ranges()
self.assertEqual(5, len(root_shard_ranges), root_shard_ranges)
self.assertEqual([ShardRange.ACTIVE] * 5,
[sr.state for sr in root_shard_ranges])
# check there are 1 sharded shard and 4 shrunk sub-shard ranges in the
# root (note, shard_1's shard ranges aren't updated once it has sharded
# because the sub-shards report their state to the root; we cannot make
# assertions about shrunk states in shard_1's shard range table)
root_shard_ranges = self.get_container_shard_ranges(
include_deleted=True)
self.assertEqual(10, len(root_shard_ranges), root_shard_ranges)
shrunk_shard_ranges = [sr for sr in root_shard_ranges
if sr.state == ShardRange.SHRUNK]
self.assertEqual(4, len(shrunk_shard_ranges), root_shard_ranges)
self.assertEqual([True] * 4,
[sr.deleted for sr in shrunk_shard_ranges])
sharded_shard_ranges = [sr for sr in root_shard_ranges
if sr.state == ShardRange.SHARDED]
self.assertEqual(1, len(sharded_shard_ranges), root_shard_ranges)
self.assert_container_listing(expected_obj_names)
| true | true |
f702a7af87b2f0f86ea66e1c3ec3667a9c27a8b5 | 20,904 | py | Python | pyisocalc/pyisocalc.py | andy-d-palmer/pyMS | 76453e45e2634bd5812c4fef4b47feb469010c9e | [
"Apache-2.0"
] | 6 | 2017-11-23T10:00:15.000Z | 2020-01-19T01:47:32.000Z | pyisocalc/pyisocalc.py | andy-d-palmer/pyMS | 76453e45e2634bd5812c4fef4b47feb469010c9e | [
"Apache-2.0"
] | null | null | null | pyisocalc/pyisocalc.py | andy-d-palmer/pyMS | 76453e45e2634bd5812c4fef4b47feb469010c9e | [
"Apache-2.0"
] | 3 | 2015-07-30T12:05:41.000Z | 2018-06-02T04:02:49.000Z | #!/usr/bin/env python
#########################################################################
# Author: Andy Ohlin (debian.user@gmx.com)
# Modified by: Andrew Palmer (palmer@embl.de)
# Artem Tarasov (lomereiter@gmail.com)
#
# Example usage:
# pyisocalc('Fe(ClO3)5',plot=false,gauss=0.25,charge=-2,resolution=250)
# Do "pyisocalc('--help') to find out more
#
##########################################################################
ver='0.2 (5 Sep. 2015)'
# Version 0.2 -- Modified from v0.8 of Andy Ohlin's code
#
# Dependencies:
# python2.7, python-numpy, python-matplotlib
# pyms-mass_spectrum
#
# Isotopic abundances and masses were copied from Wsearch32.
# Elemental oxidation states were mainly
# taken from Matthew Monroe's molecular weight calculator, with some changes.
#########################################################################
import re #for regular expressions
import sys
import time #for code execution analysis
import numpy as np
from numpy import shape,asarray,prod,zeros,repeat #for cartesian product
from numpy import random,histogram # for binning
from numpy import pi,sqrt,exp,true_divide,multiply # misc math functions
from numpy import linspace #for gaussian
from numpy import copysign
from itertools import groupby, imap
import operator
from ..mass_spectrum import mass_spectrum as MassSpectrum
from ..centroid_detection import gradient
# values updated on 16/12/2015 from http://www.ciaaw.org/isotopic-abundances.htm / http://www.ciaaw.org/atomic-masses.htm
PeriodicTable ={
'H': [1, 1, [1.007825032, 2.014101778], [0.999855, 0.000145]],
'He': [2, 0, [3.01602932, 4.002603254], [0.000002, 0.999998]],
'Li': [3, 1, [6.015122887, 7.01600344], [0.0485, 0.9515]],
'Be': [4, 2, [9.0121831], [1.0]],
'B': [5, 3, [10.012937, 11.009305], [0.1965, 0.8035]],
'C': [6, -4, [12, 13.00335484], [0.9894, 0.0106]],
'N': [7, 5, [14.003074, 15.0001089], [0.996205, 0.003795]],
'O': [8, -2, [15.99491462, 16.99913176, 17.99915961], [0.99757, 0.0003835, 0.002045]],
'F': [9, -1, [18.99840316], [1.0]],
'Ne': [10, 0, [19.99244018, 20.9938467, 21.9913851], [0.9048, 0.0027, 0.0925]],
'Na': [11, 1, [22.98976928], [1.0]],
'Mg': [12, 2, [23.9850417, 24.985837, 25.982593], [0.78965, 0.10011, 0.11025]],
'Al': [13, 3, [26.9815385], [1.0]],
'Si': [14, 4, [27.97692654, 28.97649467, 29.97377001], [0.922545, 0.04672, 0.030735]],
'P': [15, 5, [30.973762], [1.0]],
'S': [16, -2, [31.97207117, 32.97145891, 33.967867, 35.967081], [0.9485, 0.00763, 0.04365, 0.000158]],
'Cl': [17, -1, [34.9688527, 36.9659026], [0.758, 0.242]],
'Ar': [18, 0, [35.9675451, 37.962732, 39.96238312], [0.003336, 0.000629, 0.996035]],
'K': [19, 1, [38.96370649, 39.9639982, 40.96182526], [0.932581, 0.000117, 0.067302]],
'Ca': [20, 2, [39.9625909, 41.958618, 42.958766, 43.955482, 45.95369, 47.9525228], [0.96941, 0.00647, 0.00135, 0.02086, 0.00004, 0.00187]],
'Sc': [21, 3, [44.955908], [1.0]],
'Ti': [22, 4, [45.952628, 46.951759, 47.947942, 48.947866, 49.944787], [0.0825, 0.0744, 0.7372, 0.0541, 0.0518]],
'V': [23, 5, [49.947156, 50.943957], [0.0025, 0.9975]],
'Cr': [24, 2, [49.946042, 51.940506, 52.940648, 53.938879], [0.04345, 0.83789, 0.09501, 0.02365]],
'Mn': [25, 2, [54.938044], [1.0]],
'Fe': [26, 3, [53.939609, 55.934936, 56.935393, 57.933274], [0.05845, 0.91754, 0.02119, 0.00282]],
'Co': [27, 2, [58.933194], [1.0]],
'Ni': [28, 2, [57.935342, 59.930786, 60.931056, 61.928345, 63.927967], [0.680769, 0.262231, 0.011399, 0.036345, 0.009256]],
'Cu': [29, 2, [62.929598, 64.92779], [0.6915, 0.3085]],
'Zn': [30, 2, [63.929142, 65.926034, 66.927128, 67.924845, 69.92532], [0.4917, 0.2773, 0.0404, 0.1845, 0.0061]],
'Ga': [31, 3, [68.925574, 70.924703], [0.60108, 0.39892]],
'Ge': [32, 2, [69.924249, 71.9220758, 72.923459, 73.92117776, 75.9214027], [0.2052, 0.2745, 0.0776, 0.3652, 0.0775]],
'As': [33, 3, [74.921595], [1.0]],
'Se': [34, 4, [73.9224759, 75.9192137, 76.9199142, 77.917309, 79.916522, 81.9167], [0.0086, 0.0923, 0.076, 0.2369, 0.498, 0.0882]],
'Br': [35, -1, [78.918338, 80.91629], [0.5065, 0.4935]],
'Kr': [36, 0, [77.920365, 79.916378, 81.913483, 82.914127, 83.91149773, 85.91061063], [0.00355, 0.02286, 0.11593, 0.115, 0.56987, 0.17279]],
'Rb': [37, 1, [84.91178974, 86.90918053], [0.7217, 0.2783]],
'Sr': [38, 2, [83.913419, 85.909261, 86.908878, 87.905613], [0.0056, 0.0986, 0.07, 0.8258]],
'Y': [39, 3, [88.90584], [1.0]],
'Zr': [40, 4, [89.9047, 90.90564, 91.90503, 93.90631, 95.90827], [0.5145, 0.1122, 0.1715, 0.1738, 0.028]],
'Nb': [41, 5, [92.90637], [1.0]],
'Mo': [42, 6, [91.906808, 93.905085, 94.905839, 95.904676, 96.906018, 97.905405, 99.907472], [0.14649, 0.09187, 0.15873, 0.16673, 0.09582, 0.24292, 0.09744]],
'Tc': [43, 2, [97.90721], [1.0]],
'Ru': [44, 3, [95.90759, 97.90529, 98.905934, 99.904214, 100.905577, 101.904344, 103.90543], [0.0554, 0.0187, 0.1276, 0.126, 0.1706, 0.3155, 0.1862]],
'Rh': [45, 2, [102.9055], [1.0]],
'Pd': [46, 2, [101.9056, 103.904031, 104.90508, 105.90348, 107.903892, 109.905172], [0.0102, 0.1114, 0.2233, 0.2733, 0.2646, 0.1172]],
'Ag': [47, 1, [106.90509, 108.904755], [0.51839, 0.48161]],
'Cd': [48, 2, [105.90646, 107.904183, 109.903007, 110.904183, 111.902763, 112.904408, 113.903365, 115.904763], [0.01245, 0.00888, 0.1247, 0.12795, 0.24109, 0.12227, 0.28754, 0.07512]],
'In': [49, 3, [112.904062, 114.9038788], [0.04281, 0.95719]],
'Sn': [50, 4, [111.904824, 113.902783, 114.9033447, 115.901743, 116.902954, 117.901607, 118.903311, 119.902202, 121.90344, 123.905277], [0.0097, 0.0066, 0.0034, 0.1454, 0.0768, 0.2422, 0.0859, 0.3258, 0.0463, 0.0579]],
'Sb': [51, 3, [120.90381, 122.90421], [0.5721, 0.4279]],
'Te': [52, 4, [119.90406, 121.90304, 122.90427, 123.90282, 124.90443, 125.90331, 127.904461, 129.9062228], [0.0009, 0.0255, 0.0089, 0.0474, 0.0707, 0.1884, 0.3174, 0.3408]],
'I': [53, -1, [126.90447], [1.0]],
'Xe': [54, 0, [123.90589, 125.9043, 127.903531, 128.9047809, 129.9035094, 130.905084, 131.9041551, 133.905395, 135.9072145], [0.00095, 0.00089, 0.0191, 0.26401, 0.04071, 0.21232, 0.26909, 0.10436, 0.08857]],
'Cs': [55, 1, [132.905452], [1.0]],
'Ba': [56, 2, [129.90632, 131.905061, 133.904508, 134.905688, 135.904576, 136.905827, 137.905247], [0.0011, 0.001, 0.0242, 0.0659, 0.0785, 0.1123, 0.717]],
'La': [57, 3, [137.90712, 138.90636], [0.0008881, 0.9991119]],
'Ce': [58, 3, [135.907129, 137.90599, 139.90544, 141.90925], [0.00186, 0.00251, 0.88449, 0.11114]],
'Pr': [59, 3, [140.90766], [1.0]],
'Nd': [60, 3, [141.90773, 142.90982, 143.91009, 144.91258, 145.91312, 147.9169, 149.9209], [0.27153, 0.12173, 0.23798, 0.08293, 0.17189, 0.05756, 0.05638]],
'Pm': [61, 3, [144.91276], [1.0]],
'Sm': [62, 3, [143.91201, 146.9149, 147.91483, 148.91719, 149.91728, 151.91974, 153.92222], [0.0308, 0.15, 0.1125, 0.1382, 0.0737, 0.2674, 0.2274]],
'Eu': [63, 3, [150.91986, 152.92124], [0.4781, 0.5219]],
'Gd': [64, 3, [151.9198, 153.92087, 154.92263, 155.92213, 156.92397, 157.92411, 159.92706], [0.002, 0.0218, 0.148, 0.2047, 0.1565, 0.2484, 0.2186]],
'Tb': [65, 4, [158.92535], [1.0]],
'Dy': [66, 3, [155.92428, 157.92442, 159.9252, 160.92694, 161.92681, 162.92874, 163.92918], [0.00056, 0.00095, 0.02329, 0.18889, 0.25475, 0.24896, 0.2826]],
'Ho': [67, 3, [164.93033], [1.0]],
'Er': [68, 3, [161.92879, 163.92921, 165.9303, 166.93205, 167.93238, 169.93547], [0.00139, 0.01601, 0.33503, 0.22869, 0.26978, 0.1491]],
'Tm': [69, 3, [168.93422], [1.0]],
'Yb': [70, 3, [167.93389, 169.93477, 170.93633, 171.93639, 172.93822, 173.93887, 175.94258], [0.00126, 0.03023, 0.14216, 0.21754, 0.16098, 0.31896, 0.12887]],
'Lu': [71, 3, [174.94078, 175.94269], [0.97401, 0.02599]],
'Hf': [72, 4, [173.94005, 175.94141, 176.94323, 177.94371, 178.94582, 179.94656], [0.0016, 0.0526, 0.186, 0.2728, 0.1362, 0.3508]],
'Ta': [73, 5, [179.94746, 180.948], [0.0001201, 0.9998799]],
'W': [74, 6, [179.94671, 181.948204, 182.950223, 183.950931, 185.95436], [0.0012, 0.265, 0.1431, 0.3064, 0.2843]],
'Re': [75, 2, [184.952955, 186.95575], [0.374, 0.626]],
'Os': [76, 4, [183.952489, 185.95384, 186.95575, 187.95584, 188.95814, 189.95844, 191.96148], [0.0002, 0.0159, 0.0196, 0.1324, 0.1615, 0.2626, 0.4078]],
'Ir': [77, 4, [190.96059, 192.96292], [0.373, 0.627]],
'Pt': [78, 4, [189.95993, 191.96104, 193.962681, 194.964792, 195.964952, 197.96789], [0.00012, 0.00782, 0.32864, 0.33775, 0.25211, 0.07356]],
'Au': [79, 3, [196.966569], [1.0]],
'Hg': [80, 2, [195.96583, 197.966769, 198.968281, 199.968327, 200.970303, 201.970643, 203.973494], [0.0015, 0.1004, 0.1694, 0.2314, 0.1317, 0.2974, 0.0682]],
'Tl': [81, 1, [202.972345, 204.974428], [0.29515, 0.70485]],
'Pb': [82, 2, [203.973044, 205.974466, 206.975897, 207.976653], [0.014, 0.241, 0.221, 0.524]],
'Bi': [83, 3, [208.9804], [1.0]],
'Po': [84, 4, [209], [1.0]],
'At': [85, 7, [210], [1.0]],
'Rn': [86, 0, [222], [1.0]],
'Fr': [87, 1, [223], [1.0]],
'Ra': [88, 2, [226], [1.0]],
'Ac': [89, 3, [227], [1.0]],
'Th': [90, 4, [230.03313, 232.03806], [0.0002, 0.9998]],
'Pa': [91, 4, [231.03588], [1.0]],
'U': [92, 6, [234.04095, 235.04393, 238.05079], [0.000054 , 0.007204, 0.992742]],
'Ee':[0,0,[0.000548597],[1.0]]}
from collections import namedtuple
FormulaSegment = namedtuple('FormulaSegment', ['atom', 'number'])
#######################################
# Collect properties
#######################################
def getAverageMass(segment):
masses, ratios = PeriodicTable[segment.atom][2:4]
atomic_mass = np.dot(masses, ratios)
return atomic_mass * segment.number
def getCharge(segment):
atomic_charge = PeriodicTable[segment.atom][1]
return atomic_charge * segment.number
#####################################################
# Iterate over expanded formula to collect property
#####################################################
def getSegments(formula):
segments = re.findall('([A-Z][a-z]*)([0-9]*)',formula)
for atom, number in segments:
number = int(number) if number else 1
yield FormulaSegment(atom, number)
def molmass(formula):
return sum(imap(getAverageMass, getSegments(formula)))
def molcharge(formula):
return sum(imap(getCharge, getSegments(formula)))
################################################################################
#expands ((((M)N)O)P)Q to M*N*O*P*Q
################################################################################
def formulaExpander(formula):
while len(re.findall('\(\w*\)',formula))>0:
parenthetical=re.findall('\(\w*\)[0-9]+',formula)
for i in parenthetical:
p=re.findall('[0-9]+',str(re.findall('\)[0-9]+',i)))
j=re.findall('[A-Z][a-z]*[0-9]*',i)
oldj=j
for n in range(0,len(j)):
numero=re.findall('[0-9]+',j[n])
if len(numero)!=0:
for k in numero:
nu=re.sub(k,str(int(int(k)*int(p[0]))),j[n])
else:
nu=re.sub(j[n],j[n]+p[0],j[n])
j[n]=nu
newphrase=""
for m in j:
newphrase+=str(m)
formula=formula.replace(i,newphrase)
if (len((re.findall('\(\w*\)[0-9]+',formula)))==0) and (len(re.findall('\(\w*\)',formula))!=0):
formula=formula.replace('(','')
formula=formula.replace(')','')
lopoff=re.findall('[A-Z][a-z]*0',formula)
if lopoff!=[]:
formula=formula.replace(lopoff[0],'')
return formula
def singleElementPattern(segment, threshold=1e-9):
# see 'Efficient Calculation of Exact Fine Structure Isotope Patterns via the
# Multidimensional Fourier Transform' (A. Ipsen, 2014)
element, amount = segment.atom, segment.number
iso_mass, iso_abundance = map(np.array, PeriodicTable[element][2:4])
if len(iso_abundance) == 1:
return np.array([1.0]), iso_mass * amount
if amount == 1:
return iso_abundance, iso_mass
dim = len(iso_abundance) - 1
abundance = np.zeros([amount + 1] * dim)
abundance.flat[0] = iso_abundance[0]
abundance.flat[(amount+1)**np.arange(dim)] = iso_abundance[-1:0:-1]
abundance = np.real(np.fft.ifftn(np.fft.fftn(abundance) ** amount))
significant = np.where(abundance > threshold)
intensities = abundance[significant]
masses = amount * iso_mass[0] + (iso_mass[1:] - iso_mass[0]).dot(significant)
return intensities, masses
def trim(ry, my):
my, inv = np.unique(my, return_inverse=True)
ry = np.bincount(inv, weights=ry)
return ry, my
def cartesian(rx, mx, cutoff):
ry, my = asarray(rx[0]), asarray(mx[0])
for i in xrange(1, len(rx)):
newr = np.outer(rx[i], ry).ravel()
newm = np.add.outer(mx[i], my).ravel()
js = np.where(newr > cutoff)[0]
ry, my = newr[js], newm[js]
return trim(ry, my)
def isotopes(segments, cutoff):
patterns = [singleElementPattern(x, cutoff) for x in segments]
ratios = [x[0] for x in patterns]
masses = [x[1] for x in patterns]
return cartesian(ratios,masses,cutoff)
##################################################################################
# Does housekeeping to generate final intensity ratios and puts it into a dictionary
##################################################################################
def genDict(m,n,charges,cutoff):
m, n = np.asarray(m).round(8), np.asarray(n).round(8)
filter = n > cutoff
m, n = m[filter], n[filter]
n *= 100.0 / max(n)
m -= charges * PeriodicTable['Ee'][2][0]
if charges != 0:
m /= abs(charges)
return dict(zip(m, n))
def genGaussian(final,sigma, pts):
mzs = np.array(final.keys())
intensities = np.array(final.values())
xvector = np.linspace(min(mzs)-1,max(mzs)+1,pts)
yvector = intensities.dot(exp(-0.5 * (np.add.outer(mzs, -xvector)/sigma)**2))
yvector *= 100.0 / max(yvector)
return (xvector,yvector)
def mz(a,b,c):
if c==0:
c=b
if b==0:
c=1
mz=a/c
return mz
def checkhelpcall(sf):
print_help = False
exit = False
if sf=='--help':
exit = True
if sf == '':
print_help = True
if print_help:
print " "
print "\t\tThis is pyisocalc, an isotopic pattern calculator written in python (2.x)."
print "\t\tGet the latest version from http://sourceforge.net/p/pyisocalc"
print "\t\tThis is version",ver
print "\tUsage:"
print "\t-h\t--help \tYou're looking at it."
print "\t-f\t--formula\tFormula enclosed in apostrophes, e.g. 'Al2(NO3)4'."
print "\t-c\t--charge\tCharge, e.g. -2 or 3. Must be an integer. If not provided the charge will be calculated"
print "\t \t \tbased on default oxidation states as defined in this file."
print "\t-o\t--output\tFilename to save data into. The data will be saved as a tab-separated file. No output by default."
print "\t-p\t--plot \tWhether to plot or not. Can be yes, YES, Yes, Y, y. Default is no."
print "\t-g\t--gauss \tGaussian broadening factor (affects resolution). Default is 0.35. Lower value gives higher resolution."
print "\t \t \tAdjust this factor to make the spectrum look like the experimentally observed one."
print "\t-r\t--resolution\tNumber of points to use for the m/z axis (affects resolution). Default is 500. Higher is slower."
print " "
print "\t Example:"
print "\t./pyisocalc.py -f 'Fe(ClO3)5' -p y -g 0.25 -o ironperchlorate.dat -c -2 -r 250"
print ""
exit=True
return exit
def resolution2pts(min_x,max_x,resolution):
# turn resolving power into ft pts
# resolution = fwhm/max height
# turn resolution in points per mz then multipy by mz range
pts = resolution/1000 * (max(max_x-min_x,1))
return pts
def checkoutput(output):
save = True
if output == '':
save = False
return save
########
# main function#
########
def isodist(molecules,charges=0,output='',plot=False,sigma=0.05,resolution=50000,cutoff=0.0001,do_centroid=True,verbose=False):
#exit = checkhelpcall(molecules)
#save = checkoutput(output)
#if exit==True:
# sys.exit(0)
molecules=molecules.split(',')
for element in molecules:
element=formulaExpander(element)
if verbose:
print ('The mass of %(substance)s is %(Mass)f and the calculated charge is %(Charge)d with m/z of %(Mz)f.' % {'substance': \
element, 'Mass': molmass(element), 'Charge': molcharge(element),'Mz':mz(molmass(element),molcharge(element),charges)})
segments = list(getSegments(element))
if charges==None:
charges=sum(getCharge(x) for x in segments)
if verbose:
print "Using user-supplied charge of %d for mass spectrum" % charges
ratios, masses = isotopes(segments, cutoff)
final = genDict(masses, ratios, charges, cutoff)
ms_output = MassSpectrum()
pts = resolution2pts(min(final.keys()),max(final.keys()),resolution)
xvector,yvector=genGaussian(final,sigma,pts)
ms_output.add_spectrum(xvector,yvector)
if do_centroid:
mz_list,intensity_list,centroid_list = gradient(ms_output.get_spectrum()[0],ms_output.get_spectrum()[1],max_output=-1,weighted_bins=5)
ms_output.add_centroids(mz_list,intensity_list)
else:
ms_output.add_centroids(np.array(final.keys()),np.array(final.values()))
if plot==True:
import matplotlib.pyplot as plt #for plotting
plt.plot(xvector,yvector)
plt.plot(mz_list,intensity_list,'rx')
plt.show()
#if save==True:
# g=open(savefile,'w')
# xs=xvector.tolist()
# ys=yvector.tolist()
# for i in range(0,len(xs)):
# g.write(str(xs[i])+"\t"+str(ys[i])+"\n")
# g.close
return ms_output
def str_to_el(str_in):
import re
atom_number = re.split('([A-Z][a-z]*)', str_in)
el = {}
for atom, number in zip(atom_number[1::2], atom_number[2::2]):
if atom not in PeriodicTable:
raise ValueError("Element not recognised: {} in {}".format(atom, str_in))
if number == '':
number = '1'
number = int(number)
if not atom in el:
el[atom] = number
else:
el[atom] += number
return el
def rm_1bracket(str_in):
# find first and last brackets
rb = str_in.index(')')
lb = str_in[0:rb].rindex('(')
# check if multiplier after last bracket
if len(str_in) == rb + 1: # end of string
mult = "1"
mult_idx = 0
else:
mult = str_in[rb + 1:]
mult_idx = len(mult)
if not mult.isdigit(): # not a number
mult = '1'
mult_idx = 0
# exband brackets
str_tmp = ""
for m in range(0, int(mult)):
str_tmp = str_tmp + str_in[lb + 1:rb]
if lb == 0:
str_strt = ""
else:
str_strt = str_in[0:lb]
if rb == len(str_in) - 1:
str_end = ""
else:
str_end = str_in[rb + 1 + mult_idx:]
return str_strt + str_tmp + str_end
def strip_bracket(str_in):
go = True
try:
while go == True:
str_in = rm_1bracket(str_in)
except ValueError as e:
if str(e) != "substring not found":
raise
return str_in
def process_sf(str_in):
import re
# split_sign
sub_strings = re.split('([\+-])', str_in)
if not sub_strings[0] in (('+', '-')):
sub_strings = ["+"] + sub_strings
el = {}
for sign, sf in zip(sub_strings[0::2], sub_strings[1::2]):
# remove brackets
str_in = strip_bracket(sf)
# count elements
el_ = str_to_el(str_in)
for atom in el_:
number = int('{}1'.format(sign)) * el_[atom]
if not atom in el:
el[atom] = number
else:
el[atom] += number
return el
def process_complexes(str_in):
"""
Function splits strings at '.' and moves any preceding number to the end
so A.nB -> A+(B)n
:param str_in: molecular formula that may or may not contain complexes
:return: reformatted string
"""
def _move_num_to_end(s):
# move initial numbers to end
alpha_idx = [ss.isalpha() for ss in s].index(True)
str_re = "({}){}".format(s[alpha_idx:],s[0:alpha_idx])
return str_re
if '.' not in str_in:
return str_in
str_in = str_in.split(".")
str_out = ["{}".format(s) if s[0].isalpha() else _move_num_to_end(s) for s in str_in ]
str_out = "+".join(str_out)
return str_out
def prep_str(str_in):
str_in = process_complexes(str_in) #turn A.nB into A+(B)n
str_in.split("+")
return str_in
def complex_to_simple(str_in):
str_in = prep_str(str_in)
el_dict = process_sf(str_in)
if any((all([e==0 for e in el_dict.values()]),any([e<0 for e in el_dict.values()]))):
return None
sf_str = "".join(["{}{}".format(a,el_dict[a]) for a in el_dict if el_dict[a]>0])
return sf_str
| 44.954839 | 218 | 0.585677 |
372, 0.0541, 0.0518]],
'V': [23, 5, [49.947156, 50.943957], [0.0025, 0.9975]],
'Cr': [24, 2, [49.946042, 51.940506, 52.940648, 53.938879], [0.04345, 0.83789, 0.09501, 0.02365]],
'Mn': [25, 2, [54.938044], [1.0]],
'Fe': [26, 3, [53.939609, 55.934936, 56.935393, 57.933274], [0.05845, 0.91754, 0.02119, 0.00282]],
'Co': [27, 2, [58.933194], [1.0]],
'Ni': [28, 2, [57.935342, 59.930786, 60.931056, 61.928345, 63.927967], [0.680769, 0.262231, 0.011399, 0.036345, 0.009256]],
'Cu': [29, 2, [62.929598, 64.92779], [0.6915, 0.3085]],
'Zn': [30, 2, [63.929142, 65.926034, 66.927128, 67.924845, 69.92532], [0.4917, 0.2773, 0.0404, 0.1845, 0.0061]],
'Ga': [31, 3, [68.925574, 70.924703], [0.60108, 0.39892]],
'Ge': [32, 2, [69.924249, 71.9220758, 72.923459, 73.92117776, 75.9214027], [0.2052, 0.2745, 0.0776, 0.3652, 0.0775]],
'As': [33, 3, [74.921595], [1.0]],
'Se': [34, 4, [73.9224759, 75.9192137, 76.9199142, 77.917309, 79.916522, 81.9167], [0.0086, 0.0923, 0.076, 0.2369, 0.498, 0.0882]],
'Br': [35, -1, [78.918338, 80.91629], [0.5065, 0.4935]],
'Kr': [36, 0, [77.920365, 79.916378, 81.913483, 82.914127, 83.91149773, 85.91061063], [0.00355, 0.02286, 0.11593, 0.115, 0.56987, 0.17279]],
'Rb': [37, 1, [84.91178974, 86.90918053], [0.7217, 0.2783]],
'Sr': [38, 2, [83.913419, 85.909261, 86.908878, 87.905613], [0.0056, 0.0986, 0.07, 0.8258]],
'Y': [39, 3, [88.90584], [1.0]],
'Zr': [40, 4, [89.9047, 90.90564, 91.90503, 93.90631, 95.90827], [0.5145, 0.1122, 0.1715, 0.1738, 0.028]],
'Nb': [41, 5, [92.90637], [1.0]],
'Mo': [42, 6, [91.906808, 93.905085, 94.905839, 95.904676, 96.906018, 97.905405, 99.907472], [0.14649, 0.09187, 0.15873, 0.16673, 0.09582, 0.24292, 0.09744]],
'Tc': [43, 2, [97.90721], [1.0]],
'Ru': [44, 3, [95.90759, 97.90529, 98.905934, 99.904214, 100.905577, 101.904344, 103.90543], [0.0554, 0.0187, 0.1276, 0.126, 0.1706, 0.3155, 0.1862]],
'Rh': [45, 2, [102.9055], [1.0]],
'Pd': [46, 2, [101.9056, 103.904031, 104.90508, 105.90348, 107.903892, 109.905172], [0.0102, 0.1114, 0.2233, 0.2733, 0.2646, 0.1172]],
'Ag': [47, 1, [106.90509, 108.904755], [0.51839, 0.48161]],
'Cd': [48, 2, [105.90646, 107.904183, 109.903007, 110.904183, 111.902763, 112.904408, 113.903365, 115.904763], [0.01245, 0.00888, 0.1247, 0.12795, 0.24109, 0.12227, 0.28754, 0.07512]],
'In': [49, 3, [112.904062, 114.9038788], [0.04281, 0.95719]],
'Sn': [50, 4, [111.904824, 113.902783, 114.9033447, 115.901743, 116.902954, 117.901607, 118.903311, 119.902202, 121.90344, 123.905277], [0.0097, 0.0066, 0.0034, 0.1454, 0.0768, 0.2422, 0.0859, 0.3258, 0.0463, 0.0579]],
'Sb': [51, 3, [120.90381, 122.90421], [0.5721, 0.4279]],
'Te': [52, 4, [119.90406, 121.90304, 122.90427, 123.90282, 124.90443, 125.90331, 127.904461, 129.9062228], [0.0009, 0.0255, 0.0089, 0.0474, 0.0707, 0.1884, 0.3174, 0.3408]],
'I': [53, -1, [126.90447], [1.0]],
'Xe': [54, 0, [123.90589, 125.9043, 127.903531, 128.9047809, 129.9035094, 130.905084, 131.9041551, 133.905395, 135.9072145], [0.00095, 0.00089, 0.0191, 0.26401, 0.04071, 0.21232, 0.26909, 0.10436, 0.08857]],
'Cs': [55, 1, [132.905452], [1.0]],
'Ba': [56, 2, [129.90632, 131.905061, 133.904508, 134.905688, 135.904576, 136.905827, 137.905247], [0.0011, 0.001, 0.0242, 0.0659, 0.0785, 0.1123, 0.717]],
'La': [57, 3, [137.90712, 138.90636], [0.0008881, 0.9991119]],
'Ce': [58, 3, [135.907129, 137.90599, 139.90544, 141.90925], [0.00186, 0.00251, 0.88449, 0.11114]],
'Pr': [59, 3, [140.90766], [1.0]],
'Nd': [60, 3, [141.90773, 142.90982, 143.91009, 144.91258, 145.91312, 147.9169, 149.9209], [0.27153, 0.12173, 0.23798, 0.08293, 0.17189, 0.05756, 0.05638]],
'Pm': [61, 3, [144.91276], [1.0]],
'Sm': [62, 3, [143.91201, 146.9149, 147.91483, 148.91719, 149.91728, 151.91974, 153.92222], [0.0308, 0.15, 0.1125, 0.1382, 0.0737, 0.2674, 0.2274]],
'Eu': [63, 3, [150.91986, 152.92124], [0.4781, 0.5219]],
'Gd': [64, 3, [151.9198, 153.92087, 154.92263, 155.92213, 156.92397, 157.92411, 159.92706], [0.002, 0.0218, 0.148, 0.2047, 0.1565, 0.2484, 0.2186]],
'Tb': [65, 4, [158.92535], [1.0]],
'Dy': [66, 3, [155.92428, 157.92442, 159.9252, 160.92694, 161.92681, 162.92874, 163.92918], [0.00056, 0.00095, 0.02329, 0.18889, 0.25475, 0.24896, 0.2826]],
'Ho': [67, 3, [164.93033], [1.0]],
'Er': [68, 3, [161.92879, 163.92921, 165.9303, 166.93205, 167.93238, 169.93547], [0.00139, 0.01601, 0.33503, 0.22869, 0.26978, 0.1491]],
'Tm': [69, 3, [168.93422], [1.0]],
'Yb': [70, 3, [167.93389, 169.93477, 170.93633, 171.93639, 172.93822, 173.93887, 175.94258], [0.00126, 0.03023, 0.14216, 0.21754, 0.16098, 0.31896, 0.12887]],
'Lu': [71, 3, [174.94078, 175.94269], [0.97401, 0.02599]],
'Hf': [72, 4, [173.94005, 175.94141, 176.94323, 177.94371, 178.94582, 179.94656], [0.0016, 0.0526, 0.186, 0.2728, 0.1362, 0.3508]],
'Ta': [73, 5, [179.94746, 180.948], [0.0001201, 0.9998799]],
'W': [74, 6, [179.94671, 181.948204, 182.950223, 183.950931, 185.95436], [0.0012, 0.265, 0.1431, 0.3064, 0.2843]],
'Re': [75, 2, [184.952955, 186.95575], [0.374, 0.626]],
'Os': [76, 4, [183.952489, 185.95384, 186.95575, 187.95584, 188.95814, 189.95844, 191.96148], [0.0002, 0.0159, 0.0196, 0.1324, 0.1615, 0.2626, 0.4078]],
'Ir': [77, 4, [190.96059, 192.96292], [0.373, 0.627]],
'Pt': [78, 4, [189.95993, 191.96104, 193.962681, 194.964792, 195.964952, 197.96789], [0.00012, 0.00782, 0.32864, 0.33775, 0.25211, 0.07356]],
'Au': [79, 3, [196.966569], [1.0]],
'Hg': [80, 2, [195.96583, 197.966769, 198.968281, 199.968327, 200.970303, 201.970643, 203.973494], [0.0015, 0.1004, 0.1694, 0.2314, 0.1317, 0.2974, 0.0682]],
'Tl': [81, 1, [202.972345, 204.974428], [0.29515, 0.70485]],
'Pb': [82, 2, [203.973044, 205.974466, 206.975897, 207.976653], [0.014, 0.241, 0.221, 0.524]],
'Bi': [83, 3, [208.9804], [1.0]],
'Po': [84, 4, [209], [1.0]],
'At': [85, 7, [210], [1.0]],
'Rn': [86, 0, [222], [1.0]],
'Fr': [87, 1, [223], [1.0]],
'Ra': [88, 2, [226], [1.0]],
'Ac': [89, 3, [227], [1.0]],
'Th': [90, 4, [230.03313, 232.03806], [0.0002, 0.9998]],
'Pa': [91, 4, [231.03588], [1.0]],
'U': [92, 6, [234.04095, 235.04393, 238.05079], [0.000054 , 0.007204, 0.992742]],
'Ee':[0,0,[0.000548597],[1.0]]}
from collections import namedtuple
FormulaSegment = namedtuple('FormulaSegment', ['atom', 'number'])
#######################################
# Collect properties
#######################################
def getAverageMass(segment):
masses, ratios = PeriodicTable[segment.atom][2:4]
atomic_mass = np.dot(masses, ratios)
return atomic_mass * segment.number
def getCharge(segment):
atomic_charge = PeriodicTable[segment.atom][1]
return atomic_charge * segment.number
#####################################################
# Iterate over expanded formula to collect property
#####################################################
def getSegments(formula):
segments = re.findall('([A-Z][a-z]*)([0-9]*)',formula)
for atom, number in segments:
number = int(number) if number else 1
yield FormulaSegment(atom, number)
def molmass(formula):
return sum(imap(getAverageMass, getSegments(formula)))
def molcharge(formula):
return sum(imap(getCharge, getSegments(formula)))
################################################################################
#expands ((((M)N)O)P)Q to M*N*O*P*Q
################################################################################
def formulaExpander(formula):
while len(re.findall('\(\w*\)',formula))>0:
parenthetical=re.findall('\(\w*\)[0-9]+',formula)
for i in parenthetical:
p=re.findall('[0-9]+',str(re.findall('\)[0-9]+',i)))
j=re.findall('[A-Z][a-z]*[0-9]*',i)
oldj=j
for n in range(0,len(j)):
numero=re.findall('[0-9]+',j[n])
if len(numero)!=0:
for k in numero:
nu=re.sub(k,str(int(int(k)*int(p[0]))),j[n])
else:
nu=re.sub(j[n],j[n]+p[0],j[n])
j[n]=nu
newphrase=""
for m in j:
newphrase+=str(m)
formula=formula.replace(i,newphrase)
if (len((re.findall('\(\w*\)[0-9]+',formula)))==0) and (len(re.findall('\(\w*\)',formula))!=0):
formula=formula.replace('(','')
formula=formula.replace(')','')
lopoff=re.findall('[A-Z][a-z]*0',formula)
if lopoff!=[]:
formula=formula.replace(lopoff[0],'')
return formula
def singleElementPattern(segment, threshold=1e-9):
# see 'Efficient Calculation of Exact Fine Structure Isotope Patterns via the
# Multidimensional Fourier Transform' (A. Ipsen, 2014)
element, amount = segment.atom, segment.number
iso_mass, iso_abundance = map(np.array, PeriodicTable[element][2:4])
if len(iso_abundance) == 1:
return np.array([1.0]), iso_mass * amount
if amount == 1:
return iso_abundance, iso_mass
dim = len(iso_abundance) - 1
abundance = np.zeros([amount + 1] * dim)
abundance.flat[0] = iso_abundance[0]
abundance.flat[(amount+1)**np.arange(dim)] = iso_abundance[-1:0:-1]
abundance = np.real(np.fft.ifftn(np.fft.fftn(abundance) ** amount))
significant = np.where(abundance > threshold)
intensities = abundance[significant]
masses = amount * iso_mass[0] + (iso_mass[1:] - iso_mass[0]).dot(significant)
return intensities, masses
def trim(ry, my):
my, inv = np.unique(my, return_inverse=True)
ry = np.bincount(inv, weights=ry)
return ry, my
def cartesian(rx, mx, cutoff):
ry, my = asarray(rx[0]), asarray(mx[0])
for i in xrange(1, len(rx)):
newr = np.outer(rx[i], ry).ravel()
newm = np.add.outer(mx[i], my).ravel()
js = np.where(newr > cutoff)[0]
ry, my = newr[js], newm[js]
return trim(ry, my)
def isotopes(segments, cutoff):
patterns = [singleElementPattern(x, cutoff) for x in segments]
ratios = [x[0] for x in patterns]
masses = [x[1] for x in patterns]
return cartesian(ratios,masses,cutoff)
##################################################################################
# Does housekeeping to generate final intensity ratios and puts it into a dictionary
##################################################################################
def genDict(m,n,charges,cutoff):
m, n = np.asarray(m).round(8), np.asarray(n).round(8)
filter = n > cutoff
m, n = m[filter], n[filter]
n *= 100.0 / max(n)
m -= charges * PeriodicTable['Ee'][2][0]
if charges != 0:
m /= abs(charges)
return dict(zip(m, n))
def genGaussian(final,sigma, pts):
mzs = np.array(final.keys())
intensities = np.array(final.values())
xvector = np.linspace(min(mzs)-1,max(mzs)+1,pts)
yvector = intensities.dot(exp(-0.5 * (np.add.outer(mzs, -xvector)/sigma)**2))
yvector *= 100.0 / max(yvector)
return (xvector,yvector)
def mz(a,b,c):
if c==0:
c=b
if b==0:
c=1
mz=a/c
return mz
def checkhelpcall(sf):
print_help = False
exit = False
if sf=='--help':
exit = True
if sf == '':
print_help = True
if print_help:
print " "
print "\t\tThis is pyisocalc, an isotopic pattern calculator written in python (2.x)."
print "\t\tGet the latest version from http://sourceforge.net/p/pyisocalc"
print "\t\tThis is version",ver
print "\tUsage:"
print "\t-h\t--help \tYou're looking at it."
print "\t-f\t--formula\tFormula enclosed in apostrophes, e.g. 'Al2(NO3)4'."
print "\t-c\t--charge\tCharge, e.g. -2 or 3. Must be an integer. If not provided the charge will be calculated"
print "\t \t \tbased on default oxidation states as defined in this file."
print "\t-o\t--output\tFilename to save data into. The data will be saved as a tab-separated file. No output by default."
print "\t-p\t--plot \tWhether to plot or not. Can be yes, YES, Yes, Y, y. Default is no."
print "\t-g\t--gauss \tGaussian broadening factor (affects resolution). Default is 0.35. Lower value gives higher resolution."
print "\t \t \tAdjust this factor to make the spectrum look like the experimentally observed one."
print "\t-r\t--resolution\tNumber of points to use for the m/z axis (affects resolution). Default is 500. Higher is slower."
print " "
print "\t Example:"
print "\t./pyisocalc.py -f 'Fe(ClO3)5' -p y -g 0.25 -o ironperchlorate.dat -c -2 -r 250"
print ""
exit=True
return exit
def resolution2pts(min_x,max_x,resolution):
# turn resolving power into ft pts
# resolution = fwhm/max height
# turn resolution in points per mz then multipy by mz range
pts = resolution/1000 * (max(max_x-min_x,1))
return pts
def checkoutput(output):
save = True
if output == '':
save = False
return save
########
# main function#
########
def isodist(molecules,charges=0,output='',plot=False,sigma=0.05,resolution=50000,cutoff=0.0001,do_centroid=True,verbose=False):
#exit = checkhelpcall(molecules)
#save = checkoutput(output)
#if exit==True:
# sys.exit(0)
molecules=molecules.split(',')
for element in molecules:
element=formulaExpander(element)
if verbose:
print ('The mass of %(substance)s is %(Mass)f and the calculated charge is %(Charge)d with m/z of %(Mz)f.' % {'substance': \
element, 'Mass': molmass(element), 'Charge': molcharge(element),'Mz':mz(molmass(element),molcharge(element),charges)})
segments = list(getSegments(element))
if charges==None:
charges=sum(getCharge(x) for x in segments)
if verbose:
print "Using user-supplied charge of %d for mass spectrum" % charges
ratios, masses = isotopes(segments, cutoff)
final = genDict(masses, ratios, charges, cutoff)
ms_output = MassSpectrum()
pts = resolution2pts(min(final.keys()),max(final.keys()),resolution)
xvector,yvector=genGaussian(final,sigma,pts)
ms_output.add_spectrum(xvector,yvector)
if do_centroid:
mz_list,intensity_list,centroid_list = gradient(ms_output.get_spectrum()[0],ms_output.get_spectrum()[1],max_output=-1,weighted_bins=5)
ms_output.add_centroids(mz_list,intensity_list)
else:
ms_output.add_centroids(np.array(final.keys()),np.array(final.values()))
if plot==True:
import matplotlib.pyplot as plt #for plotting
plt.plot(xvector,yvector)
plt.plot(mz_list,intensity_list,'rx')
plt.show()
#if save==True:
# g=open(savefile,'w')
# xs=xvector.tolist()
# ys=yvector.tolist()
# for i in range(0,len(xs)):
# g.write(str(xs[i])+"\t"+str(ys[i])+"\n")
# g.close
return ms_output
def str_to_el(str_in):
import re
atom_number = re.split('([A-Z][a-z]*)', str_in)
el = {}
for atom, number in zip(atom_number[1::2], atom_number[2::2]):
if atom not in PeriodicTable:
raise ValueError("Element not recognised: {} in {}".format(atom, str_in))
if number == '':
number = '1'
number = int(number)
if not atom in el:
el[atom] = number
else:
el[atom] += number
return el
def rm_1bracket(str_in):
# find first and last brackets
rb = str_in.index(')')
lb = str_in[0:rb].rindex('(')
# check if multiplier after last bracket
if len(str_in) == rb + 1: # end of string
mult = "1"
mult_idx = 0
else:
mult = str_in[rb + 1:]
mult_idx = len(mult)
if not mult.isdigit(): # not a number
mult = '1'
mult_idx = 0
# exband brackets
str_tmp = ""
for m in range(0, int(mult)):
str_tmp = str_tmp + str_in[lb + 1:rb]
if lb == 0:
str_strt = ""
else:
str_strt = str_in[0:lb]
if rb == len(str_in) - 1:
str_end = ""
else:
str_end = str_in[rb + 1 + mult_idx:]
return str_strt + str_tmp + str_end
def strip_bracket(str_in):
go = True
try:
while go == True:
str_in = rm_1bracket(str_in)
except ValueError as e:
if str(e) != "substring not found":
raise
return str_in
def process_sf(str_in):
import re
# split_sign
sub_strings = re.split('([\+-])', str_in)
if not sub_strings[0] in (('+', '-')):
sub_strings = ["+"] + sub_strings
el = {}
for sign, sf in zip(sub_strings[0::2], sub_strings[1::2]):
# remove brackets
str_in = strip_bracket(sf)
# count elements
el_ = str_to_el(str_in)
for atom in el_:
number = int('{}1'.format(sign)) * el_[atom]
if not atom in el:
el[atom] = number
else:
el[atom] += number
return el
def process_complexes(str_in):
"""
Function splits strings at '.' and moves any preceding number to the end
so A.nB -> A+(B)n
:param str_in: molecular formula that may or may not contain complexes
:return: reformatted string
"""
def _move_num_to_end(s):
# move initial numbers to end
alpha_idx = [ss.isalpha() for ss in s].index(True)
str_re = "({}){}".format(s[alpha_idx:],s[0:alpha_idx])
return str_re
if '.' not in str_in:
return str_in
str_in = str_in.split(".")
str_out = ["{}".format(s) if s[0].isalpha() else _move_num_to_end(s) for s in str_in ]
str_out = "+".join(str_out)
return str_out
def prep_str(str_in):
str_in = process_complexes(str_in) #turn A.nB into A+(B)n
str_in.split("+")
return str_in
def complex_to_simple(str_in):
str_in = prep_str(str_in)
el_dict = process_sf(str_in)
if any((all([e==0 for e in el_dict.values()]),any([e<0 for e in el_dict.values()]))):
return None
sf_str = "".join(["{}{}".format(a,el_dict[a]) for a in el_dict if el_dict[a]>0])
return sf_str
| false | true |
f702a83360c91a0c7d5e24011db3653f658bd555 | 394 | py | Python | test/test_google_search.py | mtkumar123/CSC510_Project_LectureAid | 678e39596ca583eda961413118781bafa02c6f1d | [
"MIT"
] | null | null | null | test/test_google_search.py | mtkumar123/CSC510_Project_LectureAid | 678e39596ca583eda961413118781bafa02c6f1d | [
"MIT"
] | 45 | 2021-09-13T00:26:54.000Z | 2021-09-30T01:12:53.000Z | test/test_google_search.py | mtkumar123/CSC510_Project_LectureAid | 678e39596ca583eda961413118781bafa02c6f1d | [
"MIT"
] | 2 | 2021-09-29T00:40:56.000Z | 2021-10-17T14:28:25.000Z | import unittest
from code.google_search import get_people_also_ask_links
class TestGoogleSearch(unittest.TestCase):
def setUp(self) -> None:
pass
def test_get_people_also_ask_links(self):
"""Test the get_people_also_ask_links method"""
test = "principal components"
result = get_people_also_ask_links(test)
self.assertEqual(list, type(result))
| 30.307692 | 56 | 0.72335 | import unittest
from code.google_search import get_people_also_ask_links
class TestGoogleSearch(unittest.TestCase):
def setUp(self) -> None:
pass
def test_get_people_also_ask_links(self):
test = "principal components"
result = get_people_also_ask_links(test)
self.assertEqual(list, type(result))
| true | true |
f702aa423d4c47e5a80244f89f501ffc9d1a9a08 | 4,584 | py | Python | cinder/tests/api/contrib/test_volume_image_metadata.py | CloudVPS/cinder | 9097b9407b6ce16c7b5678682284a0ad0fcc652d | [
"Apache-2.0"
] | null | null | null | cinder/tests/api/contrib/test_volume_image_metadata.py | CloudVPS/cinder | 9097b9407b6ce16c7b5678682284a0ad0fcc652d | [
"Apache-2.0"
] | null | null | null | cinder/tests/api/contrib/test_volume_image_metadata.py | CloudVPS/cinder | 9097b9407b6ce16c7b5678682284a0ad0fcc652d | [
"Apache-2.0"
] | null | null | null | # vim: tabstop=4 shiftwidth=4 softtabstop=4
# Copyright 2012 OpenStack Foundation
#
# Licensed under the Apache License, Version 2.0 (the "License"); you may
# not use this file except in compliance with the License. You may obtain
# a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS, WITHOUT
# WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the
# License for the specific language governing permissions and limitations
# under the License.
import datetime
import json
import uuid
from xml.dom import minidom
import webob
from cinder.api import common
from cinder.api.openstack.wsgi import MetadataXMLDeserializer
from cinder.api.openstack.wsgi import XMLDeserializer
from cinder import db
from cinder import test
from cinder.tests.api import fakes
from cinder import volume
def fake_volume_get(*args, **kwargs):
return {
'id': 'fake',
'host': 'host001',
'status': 'available',
'size': 5,
'availability_zone': 'somewhere',
'created_at': datetime.datetime.now(),
'attach_status': None,
'display_name': 'anothervolume',
'display_description': 'Just another volume!',
'volume_type_id': None,
'snapshot_id': None,
'project_id': 'fake',
}
def fake_volume_get_all(*args, **kwargs):
return [fake_volume_get()]
fake_image_metadata = {
'image_id': 'someid',
'image_name': 'fake',
'kernel_id': 'somekernel',
'ramdisk_id': 'someramdisk',
}
def fake_get_volume_image_metadata(*args, **kwargs):
return fake_image_metadata
def fake_get_volumes_image_metadata(*args, **kwargs):
return {'fake': fake_image_metadata}
class VolumeImageMetadataTest(test.TestCase):
content_type = 'application/json'
def setUp(self):
super(VolumeImageMetadataTest, self).setUp()
self.stubs.Set(volume.API, 'get', fake_volume_get)
self.stubs.Set(volume.API, 'get_all', fake_volume_get_all)
self.stubs.Set(volume.API, 'get_volume_image_metadata',
fake_get_volume_image_metadata)
self.stubs.Set(volume.API, 'get_volumes_image_metadata',
fake_get_volumes_image_metadata)
self.stubs.Set(db, 'volume_get', fake_volume_get)
self.UUID = uuid.uuid4()
def _make_request(self, url):
req = webob.Request.blank(url)
req.accept = self.content_type
res = req.get_response(fakes.wsgi_app())
return res
def _get_image_metadata(self, body):
return json.loads(body)['volume']['volume_image_metadata']
def _get_image_metadata_list(self, body):
return [
volume['volume_image_metadata']
for volume in json.loads(body)['volumes']
]
def test_get_volume(self):
res = self._make_request('/v2/fake/volumes/%s' % self.UUID)
self.assertEqual(res.status_int, 200)
self.assertEqual(self._get_image_metadata(res.body),
fake_image_metadata)
def test_list_detail_volumes(self):
res = self._make_request('/v2/fake/volumes/detail')
self.assertEqual(res.status_int, 200)
self.assertEqual(self._get_image_metadata_list(res.body)[0],
fake_image_metadata)
class ImageMetadataXMLDeserializer(common.MetadataXMLDeserializer):
metadata_node_name = "volume_image_metadata"
class VolumeImageMetadataXMLTest(VolumeImageMetadataTest):
content_type = 'application/xml'
def _get_image_metadata(self, body):
deserializer = XMLDeserializer()
volume = deserializer.find_first_child_named(
minidom.parseString(body), 'volume')
image_metadata = deserializer.find_first_child_named(
volume, 'volume_image_metadata')
return MetadataXMLDeserializer().extract_metadata(image_metadata)
def _get_image_metadata_list(self, body):
deserializer = XMLDeserializer()
volumes = deserializer.find_first_child_named(
minidom.parseString(body), 'volumes')
volume_list = deserializer.find_children_named(volumes, 'volume')
image_metadata_list = [
deserializer.find_first_child_named(
volume, 'volume_image_metadata'
)
for volume in volume_list]
return map(MetadataXMLDeserializer().extract_metadata,
image_metadata_list)
| 32.978417 | 77 | 0.681065 |
import datetime
import json
import uuid
from xml.dom import minidom
import webob
from cinder.api import common
from cinder.api.openstack.wsgi import MetadataXMLDeserializer
from cinder.api.openstack.wsgi import XMLDeserializer
from cinder import db
from cinder import test
from cinder.tests.api import fakes
from cinder import volume
def fake_volume_get(*args, **kwargs):
return {
'id': 'fake',
'host': 'host001',
'status': 'available',
'size': 5,
'availability_zone': 'somewhere',
'created_at': datetime.datetime.now(),
'attach_status': None,
'display_name': 'anothervolume',
'display_description': 'Just another volume!',
'volume_type_id': None,
'snapshot_id': None,
'project_id': 'fake',
}
def fake_volume_get_all(*args, **kwargs):
return [fake_volume_get()]
fake_image_metadata = {
'image_id': 'someid',
'image_name': 'fake',
'kernel_id': 'somekernel',
'ramdisk_id': 'someramdisk',
}
def fake_get_volume_image_metadata(*args, **kwargs):
return fake_image_metadata
def fake_get_volumes_image_metadata(*args, **kwargs):
return {'fake': fake_image_metadata}
class VolumeImageMetadataTest(test.TestCase):
content_type = 'application/json'
def setUp(self):
super(VolumeImageMetadataTest, self).setUp()
self.stubs.Set(volume.API, 'get', fake_volume_get)
self.stubs.Set(volume.API, 'get_all', fake_volume_get_all)
self.stubs.Set(volume.API, 'get_volume_image_metadata',
fake_get_volume_image_metadata)
self.stubs.Set(volume.API, 'get_volumes_image_metadata',
fake_get_volumes_image_metadata)
self.stubs.Set(db, 'volume_get', fake_volume_get)
self.UUID = uuid.uuid4()
def _make_request(self, url):
req = webob.Request.blank(url)
req.accept = self.content_type
res = req.get_response(fakes.wsgi_app())
return res
def _get_image_metadata(self, body):
return json.loads(body)['volume']['volume_image_metadata']
def _get_image_metadata_list(self, body):
return [
volume['volume_image_metadata']
for volume in json.loads(body)['volumes']
]
def test_get_volume(self):
res = self._make_request('/v2/fake/volumes/%s' % self.UUID)
self.assertEqual(res.status_int, 200)
self.assertEqual(self._get_image_metadata(res.body),
fake_image_metadata)
def test_list_detail_volumes(self):
res = self._make_request('/v2/fake/volumes/detail')
self.assertEqual(res.status_int, 200)
self.assertEqual(self._get_image_metadata_list(res.body)[0],
fake_image_metadata)
class ImageMetadataXMLDeserializer(common.MetadataXMLDeserializer):
metadata_node_name = "volume_image_metadata"
class VolumeImageMetadataXMLTest(VolumeImageMetadataTest):
content_type = 'application/xml'
def _get_image_metadata(self, body):
deserializer = XMLDeserializer()
volume = deserializer.find_first_child_named(
minidom.parseString(body), 'volume')
image_metadata = deserializer.find_first_child_named(
volume, 'volume_image_metadata')
return MetadataXMLDeserializer().extract_metadata(image_metadata)
def _get_image_metadata_list(self, body):
deserializer = XMLDeserializer()
volumes = deserializer.find_first_child_named(
minidom.parseString(body), 'volumes')
volume_list = deserializer.find_children_named(volumes, 'volume')
image_metadata_list = [
deserializer.find_first_child_named(
volume, 'volume_image_metadata'
)
for volume in volume_list]
return map(MetadataXMLDeserializer().extract_metadata,
image_metadata_list)
| true | true |
f702aa947d0946923d43e7498a61a680b76392a9 | 663 | py | Python | solids/nvd/utils/schema.py | d3vzer0/vulnerabilities-pipeline | a6df7a233eaf66a8cb7c81aed69b377274ca3cf7 | [
"MIT"
] | 1 | 2021-11-22T09:57:20.000Z | 2021-11-22T09:57:20.000Z | solids/nvd/utils/schema.py | d3vzer0/vulnerabilities-pipeline | a6df7a233eaf66a8cb7c81aed69b377274ca3cf7 | [
"MIT"
] | 1 | 2021-08-03T21:56:03.000Z | 2021-08-09T15:05:40.000Z | solids/nvd/utils/schema.py | d3vzer0/vulnerabilities-pipeline | a6df7a233eaf66a8cb7c81aed69b377274ca3cf7 | [
"MIT"
] | null | null | null | from datetime import datetime
from typing import List, Dict, Optional
from pydantic import BaseModel, validator, root_validator
class ItemModel(BaseModel):
cve: Dict
configurations: Optional[Dict]
impact: Optional[Dict]
publishedDate: datetime
lastModifiedDate: datetime
class ResultModel(BaseModel):
CVE_data_timestamp: datetime
CVE_data_type: str
CVE_Items: List[ItemModel]
@validator('CVE_data_type')
def fixed_type(cls, v):
assert v == 'CVE', 'Must be of type CVE'
return v
class ResponseModel(BaseModel):
resultsPerPage: int
startIndex: int
totalResults: int
result: ResultModel
| 22.1 | 57 | 0.717949 | from datetime import datetime
from typing import List, Dict, Optional
from pydantic import BaseModel, validator, root_validator
class ItemModel(BaseModel):
cve: Dict
configurations: Optional[Dict]
impact: Optional[Dict]
publishedDate: datetime
lastModifiedDate: datetime
class ResultModel(BaseModel):
CVE_data_timestamp: datetime
CVE_data_type: str
CVE_Items: List[ItemModel]
@validator('CVE_data_type')
def fixed_type(cls, v):
assert v == 'CVE', 'Must be of type CVE'
return v
class ResponseModel(BaseModel):
resultsPerPage: int
startIndex: int
totalResults: int
result: ResultModel
| true | true |
f702ab8c70e4e0252724db9b6bec22b2fcca74e7 | 203 | py | Python | Ar_Script/past/eg_用户注册.py | archerckk/PyTest | 610dd89df8d70c096f4670ca11ed2f0ca3196ca5 | [
"MIT"
] | null | null | null | Ar_Script/past/eg_用户注册.py | archerckk/PyTest | 610dd89df8d70c096f4670ca11ed2f0ca3196ca5 | [
"MIT"
] | 1 | 2020-01-19T01:19:57.000Z | 2020-01-19T01:19:57.000Z | Ar_Script/past/eg_用户注册.py | archerckk/PyTest | 610dd89df8d70c096f4670ca11ed2f0ca3196ca5 | [
"MIT"
] | null | null | null | import easygui as g
user_info=g.multenterbox(title='账号中心',msg='【*用户名】为必填项\t【*真实姓名】为必填项\t【*手机号码】为必填项\t【*E-mail】为必填项',
fields=['*用户名','*真实姓名','固定电话','*手机号码','QQ','*E-mail']
) | 40.6 | 96 | 0.55665 | import easygui as g
user_info=g.multenterbox(title='账号中心',msg='【*用户名】为必填项\t【*真实姓名】为必填项\t【*手机号码】为必填项\t【*E-mail】为必填项',
fields=['*用户名','*真实姓名','固定电话','*手机号码','QQ','*E-mail']
) | true | true |
f702ad147472072f25a6a2b2c6f88dcb2a58ea04 | 2,652 | py | Python | api/__init__.py | aslanvaroqua/espa-api | 7ea02c0a0e9abb75db97f0989c6bdd22222fb3e6 | [
"Unlicense"
] | null | null | null | api/__init__.py | aslanvaroqua/espa-api | 7ea02c0a0e9abb75db97f0989c6bdd22222fb3e6 | [
"Unlicense"
] | null | null | null | api/__init__.py | aslanvaroqua/espa-api | 7ea02c0a0e9abb75db97f0989c6bdd22222fb3e6 | [
"Unlicense"
] | null | null | null | import re
import os
__location__ = os.path.realpath(os.path.join(os.getcwd(), os.path.dirname(__file__)))
""" Holds all the custom exceptions raised by the api """
class OrderNotFound(StandardError):
"""Error raised when an order is not found"""
def __init__(self, orderid):
"""Create new OrderNotFound
Args:
orderid (str): The orderid that was not found
"""
super(OrderNotFound, self).__init__(orderid)
class ItemNotFound(StandardError):
"""Error raised when an item is not found"""
def __init__(self, orderid, itemid):
"""Create new ItemNotFound
Args:
orderid (str): The orderid of the item
itemid (str): The id of the item that was not found
"""
super(ItemNotFound, self).__init__(orderid, itemid)
class ProductNotImplemented(NotImplementedError):
"""Exception to be thrown when trying to instantiate an unsupported
product"""
def __init__(self, product_id):
"""Constructor for the product not implemented
Keyword args:
product_id -- The product id of that is not implemented
Return:
None
"""
self.product_id = product_id
super(ProductNotImplemented, self).__init__(product_id)
class ValidationException(Exception):
"""Exceptions when there is an error with validating an order
example:
"3 validation errors": [
"Value u'' for field '<obj>.tm5.products[0]' cannot be blank'",
"Value u'' for field '<obj>.tm5.products[0]' is not in the enumeration: ['source_metadata', 'l1', 'toa', 'bt', 'cloud', 'sr', 'lst', 'swe', 'sr_ndvi', 'sr_evi', 'sr_savi', 'sr_msavi', 'sr_ndmi', 'sr_nbr', 'sr_nbr2', 'stats']",
"Value [u''] for field '<obj>.tm5.products' Requested products are not available"
]
"""
def __init__(self, msg):
err_ls = msg.split('\n')
err_key = err_ls[0].replace(':', '')
self.response = {err_key: []}
for err in err_ls[1:]:
if err:
err = re.sub(r'<obj>.', '', err)
self.response[err_key].append(err)
super(ValidationException, self).__init__(str(self.response))
class InventoryException(Exception):
"""Exception for handling problems with inventory handling"""
def __init__(self, msg):
super(InventoryException, self).__init__(msg)
self.response = {'Inputs Not Available': msg}
class InventoryConnectionException(Exception):
"""Exception handling if input data pool is down"""
def __init__(self, msg):
super(InventoryConnectionException, self).__init__(msg) | 30.482759 | 232 | 0.634992 | import re
import os
__location__ = os.path.realpath(os.path.join(os.getcwd(), os.path.dirname(__file__)))
class OrderNotFound(StandardError):
def __init__(self, orderid):
super(OrderNotFound, self).__init__(orderid)
class ItemNotFound(StandardError):
def __init__(self, orderid, itemid):
super(ItemNotFound, self).__init__(orderid, itemid)
class ProductNotImplemented(NotImplementedError):
def __init__(self, product_id):
self.product_id = product_id
super(ProductNotImplemented, self).__init__(product_id)
class ValidationException(Exception):
def __init__(self, msg):
err_ls = msg.split('\n')
err_key = err_ls[0].replace(':', '')
self.response = {err_key: []}
for err in err_ls[1:]:
if err:
err = re.sub(r'<obj>.', '', err)
self.response[err_key].append(err)
super(ValidationException, self).__init__(str(self.response))
class InventoryException(Exception):
def __init__(self, msg):
super(InventoryException, self).__init__(msg)
self.response = {'Inputs Not Available': msg}
class InventoryConnectionException(Exception):
def __init__(self, msg):
super(InventoryConnectionException, self).__init__(msg) | true | true |
f702af20dda49c4762d59b396d266f40cb1b5d33 | 48,802 | py | Python | Gomoku_minimax.py | thelazyant164/Gomoku | 7d87761ed5a72032ca3bebaf5cbfadc8977fb1f6 | [
"MIT"
] | null | null | null | Gomoku_minimax.py | thelazyant164/Gomoku | 7d87761ed5a72032ca3bebaf5cbfadc8977fb1f6 | [
"MIT"
] | null | null | null | Gomoku_minimax.py | thelazyant164/Gomoku | 7d87761ed5a72032ca3bebaf5cbfadc8977fb1f6 | [
"MIT"
] | null | null | null | #Import modules and libraries
from random import randint
from string import ascii_uppercase, ascii_lowercase
from itertools import permutations
from copy import deepcopy
from tail_recursion import tail_recursive, recurse
#Define board mapping function
def mapBoard(col, row, value):
board = [[value for x in range(col)] for y in range(row)]
return board
#Define metaboard mapping function
def mapMetaBoard(col, row):
metaboard = [[[[0, 0, 0, 0], [0, 0, 0, 0]] for x in range(col)] for y in range(row)]
return metaboard
#Define view board function
def viewBoard(board):
alphabet = ascii_uppercase
col = len(board[0])
row = len(board)
border = ""
topBorder = "#||"
for i in range(col):
border += "_" * 2
topBorder += alphabet[i]
topBorder += " "
border += "___"
print(topBorder)
print(border)
for i in range(row):
print(alphabet[i] + "||" + " ".join(board[i]) + "|")
#Define mark function
def mark(board, signature):
alphabet = ascii_uppercase
alphabet1 = ascii_lowercase
dimensionY = len(board)
dimensionX = len(board[0])
valid = False
while (not valid):
print("\n\nWhere do you want to mark?\n\n")
x = input(f"Column (A - {alphabet[dimensionX - 1]})? ")
y = input(f"Row (A - {alphabet[dimensionY - 1]})? ")
try:
x = alphabet.index(x)
except ValueError:
x = alphabet1.index(x)
try:
y = alphabet.index(y)
except:
y = alphabet1.index(y)
if (board[y][x] == ' '):
valid = True
else:
print('That position has already been marked. Please try again.\n')
board[y][x] = signature
print('\n')
viewBoard(board)
#Define function to find all occurences of 'X'
#Value is [opponentSignature]
#Return [[col1, row1], [col2, row2], ...]
def locate(value, board):
dimensionY = len(board)
dimensionX = len(board[0])
returnList = []
for row in range(dimensionY):
for col in range(dimensionX):
if (board[row][col] in value): returnList.append([col, row])
return returnList
#Define computer's turn -- recursive
@tail_recursive
def play(boardHistory, depleted, checked, iteration, winCond, forecasted, possibilities, board, selfSignature, opponentSignature, difficulty, first = True):
#AI
#Each of metaboard's position is a list [danger, opportunity]
#Define function to update metaboard
#TODO: refine to improve efficiency at detecting risks and opportunities of non-continuous streak & multi-directional streaks
#REQUIREMENTS 1: resonant effect on a tile immediately next to a continuous winCond - 1 streak == risk/opportunity factor of interrupted resonance on a tile conjoining 2 aligning sub-streaks whose sum >= winCond - 1
#REQUIREMENTS 2: implement weighted resonance system on a tile conjoining multiple directional streaks > resonance system for linear streaks
def meta(board, opponentSignature, selfSignature, winCond, difficulty):
#Define function to sweep perimeter of a position's coordinates and add attributes to them
#coord = [col, row]
def sweep(metaboard, coord, keyword, opponentSignature, selfSignature, winCond):
if (keyword == 'danger'):
type = 0
otherType = 1
signature = opponentSignature
else:
type = 1
otherType = 0
signature = selfSignature
coordVars = list(permutations([-1, 0, 1], 2))
coordVars.extend(((-1, -1), (1, 1)))
for coordVar in coordVars:
try:
if (coordVar in [(-1, -1), (1, 1)]):
pos = 2
elif (coordVar in [(0, -1), (0, 1)]):
pos = 0
elif (coordVar in [(-1, 0), (1, 0)]):
pos = 1
else:
pos = 3
row = coord[1] + coordVar[0]
if (row < 0 or row > len(metaboard)): raise IndexError
col = coord[0] + coordVar[1]
if (col < 0 or col > len(metaboard[0])): raise IndexError
#Ripple effect
if (not isinstance(metaboard[row][col], str)):
for i in range(winCond - 1):
if (not isinstance(metaboard[row][col], str)):
metaboard[row][col][type][pos] += (1 - i/(winCond - 1))
metaboard[row][col][otherType][pos] -= (1 - i/(winCond - 1))
row += coordVar[0]
if (row < 0 or row > len(metaboard)): raise IndexError
col += coordVar[1]
if (col < 0 or col > len(metaboard[0])): raise IndexError
elif (metaboard[row][col] == signature):
row += coordVar[0]
if (row < 0 or row > len(metaboard)): raise IndexError
col += coordVar[1]
if (col < 0 or col > len(metaboard[0])): raise IndexError
else:
raise IndexError
#alphabet = ascii_uppercase
#print(f'Metaboard at column {alphabet[col]} and row {alphabet[row]} has a {keyword} level of {metaboard[row][col][type]}.')
#Resonance effect
if (metaboard[row][col] == signature):
alignment = 0
while (metaboard[row][col] == signature):
row += coordVar[0]
if (row < 0 or row > len(metaboard)): raise IndexError
col += coordVar[1]
if (col < 0 or col > len(metaboard[0])): raise IndexError
alignment += 1
if (isinstance(metaboard[row][col], list)):
metaboard[row][col][type][pos] += alignment
except IndexError: pass
#Define function to screen entire metaboard for invalidation
def screen(metaboard, selfSignature, opponentSignature, winCond):
#Define function to rotate board 90 degree counter-clockwise with perspective to keeping OG board intact
def rotate(board):
#Define function to inverse board vertically
def invertY(board):
invertYBoard = []
dimensionY = len(board)
for row in range(dimensionY):
invertYBoard.append(board[dimensionY - row - 1])
return invertYBoard
rotateBoard = []
dimensionY = len(board)
dimensionX = len(board[0])
for col in range(dimensionX):
column = [board[row][col] for row in range(dimensionY)]
rotateBoard.append(column)
return invertY(rotateBoard)
#Define function to screen the top left corner of the board
def screenTopLeftCorner(metaboard, winCond, pos, name):
for row in range(winCond - 1):
for col in range(winCond - 1 - row):
if (isinstance(metaboard[row][col], list)):
#print(f'nullify {row}:{col}\'s danger and potential in the {name} diagonal')
metaboard[row][col][0][pos] = 0
metaboard[row][col][1][pos] = 0
#Define function to screen metaboard to invalidate 'type' from signature (e.g, invalidate dangers between two blocked self) horizontally
def screenHorizontal(metaboard, signature, type, winCond, pos):
dimensionX = len(metaboard[0])
if type == 'danger': type = 0
else: type = 1
#Format all selfSignature's coords found in each row
#sus = [susRow1, susRow3, ...]
#susRow1 = [[col1, row], [col3, row], ...]
sus = []
for row in metaboard:
susEachRow = []
for col in row:
if (col == signature): susEachRow.append([row.index(col), metaboard.index(row)])
sus.append(susEachRow)
sus = [susEachRow for susEachRow in sus if len(susEachRow) != 0]
#Filter out all invalid segments between two blocked self horizontally
for susEachRow in sus:
for i in range(len(susEachRow) - 1):
if (2 <= susEachRow[i + 1][0] - susEachRow[i][0] <= winCond):
for k in range(0, susEachRow[i + 1][0] - susEachRow[i][0]):
if (isinstance(metaboard[susEachRow[i][1]][susEachRow[i][0] + k], list)):
#print(f'Due to being blocked on both ends by {signature} at coordinates {susEachRow[i][0]}:{susEachRow[i][1]} and {susEachRow[i + 1][0]}:{susEachRow[i + 1][1]}, the position with the coordinates {susEachRow[i][1]}:{susEachRow[i][0] + k} has been nullified of its {type}\'s {pos}.')
metaboard[susEachRow[i][1]][susEachRow[i][0] + k][type][pos] = 0
#Filter out all invalid segments between self and border
for susEachRow in sus:
start = susEachRow[0]
end = susEachRow[-1]
if (1 <= start[0] < winCond):
for k in range(0, start[0]):
if (isinstance(metaboard[start[1]][k], list)):
#print(f'Due to being blocked on both ends by {signature} at coordinates {start[0]}:{start[1]} and the border, the position with the coordinates {start[1]}:{k} has been nullified of its {type}\'s {pos}.')
metaboard[start[1]][k][type][pos] = 0
if (1 <= dimensionX - end[0] - 1 < winCond):
for k in range(0, dimensionX - end[0] - 1):
if (isinstance(metaboard[end[1]][end[0] + k], list)):
#print(f'Due to being blocked on both ends by {signature} at coordinates {end[0]}:{end[1]} and the border, the position with the coordinates {end[1]}:{end[0] + k} has been nullified of its {type}\'s {pos}.')
metaboard[end[1]][end[0] + k][type][pos] = 0
return metaboard
#Define function to screen metaboard to invalidate 'type' from signature (e.g, invalidate dangers between two blocked self) diagonally
def screenDiagonal(metaboard, signature, type, winCond, pos):
dimensionY = len(metaboard)
dimensionX = len(metaboard[0])
if type == 'danger': type = 0
else: type = 1
#Format all selfSignature's coords found in each diagonal
#susDiagDown, Up, sus = [susDiag1, susDiag3, ...]
#susDiag1 = [[col1, row1], [col3, row3], ...]
sus = []
susDiagDown = []
lenSusDiagDown = []
susDiagUp = []
lenSusDiagUp = []
susDuplicate = []
for i in range(dimensionY):
susEachDiagDown = []
originalDiagLen = 0
for j in range(dimensionY):
try:
if (metaboard[i + j][j] == signature): susEachDiagDown.append([i + j, j])
originalDiagLen += 1
except IndexError:
pass
susDiagDown.append(susEachDiagDown)
if (len(susEachDiagDown) != 0):
lenSusDiagDown.append(originalDiagLen)
else: lenSusDiagDown.append(0)
for i in range(dimensionX):
susEachDiagUp = []
originalDiagLen = 0
for j in range(dimensionX):
try:
if (metaboard[j][i + j] == signature): susEachDiagUp.append([j, i + j])
originalDiagLen += 1
except IndexError: pass
susDiagUp.append(susEachDiagUp)
if (len(susEachDiagUp) != 0):
lenSusDiagUp.append(originalDiagLen)
else: lenSusDiagUp.append(0)
sus.extend(susDiagDown)
sus.extend(susDiagUp)
for i in range(min(dimensionX, dimensionY)):
if (metaboard[i][i] == signature): susDuplicate.append([i, i])
sus.remove(susDuplicate)
susDiagUp = [susEachDiag for susEachDiag in susDiagUp if len(susEachDiag) != 0]
lenSusDiagUp = [eachLen for eachLen in lenSusDiagUp if eachLen != 0]
susDiagDown = [susEachDiag for susEachDiag in susDiagDown if len(susEachDiag) != 0]
lenSusDiagDown = [eachLen for eachLen in lenSusDiagDown if eachLen != 0]
#Filter out all invalid segments between two blocked self diagontally
for susEachDiag in sus:
for i in range(len(susEachDiag) - 1):
if (2 <= susEachDiag[i + 1][0] - susEachDiag[i][0] <= winCond):
for k in range(0, susEachDiag[i + 1][0] - susEachDiag[i][0]):
if (isinstance(metaboard[susEachDiag[i][0] + k][susEachDiag[i][1] + k], list)):
#print(f'Due to being blocked on both ends by {signature} at coordinates {susEachDiag[i][0]}:{susEachDiag[i][1]} and {susEachDiag[i + 1][0]}:{susEachDiag[i + 1][1]}, the position with the coordinates {susEachDiag[i][0] + k}:{susEachDiag[i][1] + k} has been nullified of its {type}\'s {pos}.')
metaboard[susEachDiag[i][0] + k][susEachDiag[i][1] + k][type][pos] = 0
#Filter out all invalid segments between self and border for susDiagUp
for susEachDiag in susDiagUp:
start = susEachDiag[0]
end = susEachDiag[-1]
if (1 <= min(start[0], start[1]) < winCond):
for k in range(0, min(start[0], start[1]) + 1):
if (isinstance(metaboard[start[0] - k][start[1] - k], list)):
#print(f'Due to being blocked on both ends by {signature} at coordinates {start[0]}:{start[1]} and the corner, the position with the coordinates {start[0] + k}:{start[1] + k} has been nullified of its {type}\'s {pos}.')
metaboard[start[0] - k][start[1] - k][type][pos] = 0
if (1 <= lenSusDiagUp[susDiagUp.index(susEachDiag)] - min(end[0], end[1]) <= winCond):
for k in range(0, lenSusDiagUp[susDiagUp.index(susEachDiag)] - min(end[0], end[1])):
if (isinstance(metaboard[end[0] + k][end[1] + k], list)):
#print(f'Due to being blocked on both ends by {signature} at coordinates {end[0]}:{end[1]} and the corner, the position with the coordinates {end[0] + k}:{end[1] + k} has been nullified of its {type}\'s {pos}.')
metaboard[end[0] + k][end[1] + k][type][pos] = 0
#Filter out all invalid segments between self and border for susDiagDown
for susEachDiag in susDiagDown:
start = susEachDiag[0]
end = susEachDiag[-1]
if (1 <= min(start[0], start[1]) < winCond):
for k in range(0, min(start[0], start[1]) + 1):
if (isinstance(metaboard[start[0] - k][start[1] - k], list)):
#print(f'Due to being blocked on both ends by {signature} at coordinates {start[0]}:{start[1]} and the corner, the position with the coordinates {start[0] + k}:{start[1] + k} has been nullified of its {type}\'s {pos}.')
metaboard[start[0] - k][start[1] - k][type][pos] = 0
if (1 <= lenSusDiagDown[susDiagDown.index(susEachDiag)] - min(end[0], end[1]) <= winCond):
for k in range(0, lenSusDiagDown[susDiagDown.index(susEachDiag)] - min(end[0], end[1])):
if (isinstance(metaboard[end[0] + k][end[1] + k], list)):
#print(f'Due to being blocked on both ends by {signature} at coordinates {end[0]}:{end[1]} and the corner, the position with the coordinates {end[0] + k}:{end[1] + k} has been nullified of its {type}\'s {pos}.')
metaboard[end[0] + k][end[1] + k][type][pos] = 0
return metaboard
#pos: index of relevant value (0: horizontal, 1: vertical, 2: NW - SE, 3: NE - SW)
#Screen top left corner
screenTopLeftCorner(metaboard, winCond, 3, 'top left')
metaboard = rotate(metaboard)
#Screen top right corner
screenTopLeftCorner(metaboard, winCond, 2, 'top right')
metaboard = rotate(metaboard)
#Screen bottom right corner
screenTopLeftCorner(metaboard, winCond, 3, 'bottom right')
metaboard = rotate(metaboard)
#Screen bottom left corner
screenTopLeftCorner(metaboard, winCond, 2, 'bottom left')
metaboard = rotate(metaboard)
#Screen horizontally
screenHorizontal(metaboard, selfSignature, 'danger' , winCond, 0)
screenHorizontal(metaboard, opponentSignature, 'opportunity' , winCond, 0)
metaboard = rotate(metaboard)
#Screen vertically
screenHorizontal(metaboard, selfSignature, 'danger' , winCond, 1)
screenHorizontal(metaboard, opponentSignature, 'opportunity' , winCond, 1)
for i in range(3): metaboard = rotate(metaboard)
#Screen NW-SE diagonally
screenDiagonal(metaboard, selfSignature, 'danger' , winCond, 2)
screenDiagonal(metaboard, opponentSignature, 'opportunity' , winCond, 2)
metaboard = rotate(metaboard)
#Screen NE-SW diagonally
screenDiagonal(metaboard, selfSignature, 'danger' , winCond, 3)
screenDiagonal(metaboard, opponentSignature, 'opportunity' , winCond, 3)
for i in range(3): metaboard = rotate(metaboard)
metaboard = mapMetaBoard(len(board[0]), len(board))
dangerCoords = locate([opponentSignature], board)
opportunityCoords = locate([selfSignature], board)
for coord in dangerCoords:
metaboard[coord[1]][coord[0]] = opponentSignature
for coord in opportunityCoords:
metaboard[coord[1]][coord[0]] = selfSignature
for coord in dangerCoords:
sweep(metaboard, coord, 'danger', opponentSignature, selfSignature, winCond)
for coord in opportunityCoords:
sweep(metaboard, coord, 'opportunity', opponentSignature, selfSignature, winCond)
#Screening applies for difficulty 2 and up
if (difficulty >= 2):
screen(metaboard, selfSignature, opponentSignature, winCond)
return metaboard
#Define function to choose between aggresive or defensive
def stance(metaboard, difficulty):
dangerList = []
opportunityList = []
for row in metaboard:
for col in row:
if (isinstance(col, list)):
dangerList.append(max(col[0]))
opportunityList.append(max(col[1]))
pressingDanger = max(dangerList)
pressingOpportunity = max(opportunityList)
#print(f'Highest danger is {pressingDanger}, whilst highest opportunity is {pressingOpportunity}.')
#'Tactical' playstyle applies only for difficulty 3
if (difficulty >= 3):
if (pressingOpportunity > pressingDanger):
return 'aggressive', pressingOpportunity
elif (pressingOpportunity == pressingDanger):
return 'tactical', pressingOpportunity
else:
return 'defensive', pressingDanger
else:
if (pressingOpportunity >= pressingDanger):
return 'aggressive', pressingOpportunity
else:
return 'defensive', pressingDanger
#Define function to make a play
@tail_recursive
def decide(forecasted, checked, style, value, metaboard, difficulty):
if style == 'aggressive': type = 1
elif style == 'defensive': type = 0
else: type = 2
if (style in ['aggressive', 'defensive']):
for row in metaboard:
for col in row:
if (isinstance(col, list)):
if max(col[type]) == value:
#print(col[type].index(value))
x, y = row.index(col), metaboard.index(row)
else:
returnList = []
maxTracker = []
for row in range(len(metaboard)):
for col in range(len(metaboard[0])):
if (isinstance(metaboard[row][col], list)):
if (max(metaboard[row][col][0]) == value) or (max(metaboard[row][col][1]) == value):
#print(col[type].index(value))
returnList.append([col, row])
maxTracker.append(sum(metaboard[row][col][0]) + sum(metaboard[row][col][1]))
x, y = returnList[maxTracker.index(max(maxTracker))][0], returnList[maxTracker.index(max(maxTracker))][1]
if [*forecasted, [x, y]] not in checked:
return x, y
else:
#For a checked position, set metaboard value to negative
metaboardTemp = deepcopy(metaboard)
metaboardTemp[y][x] = [[-1, -1, -1, -1], [-1, -1, -1, -1]]
style, newValue = stance(metaboardTemp, difficulty)
#When all potential positions have been checked, all potential metaboard values will have been set to negative => depleted
if newValue != value: raise ValueError
return recurse(forecasted, checked, style, newValue, metaboardTemp, difficulty)
#Define function to swap self signature and opponent signature
def swap(selfSignature, opponentSignature):
temp = selfSignature
selfSignature = opponentSignature
opponentSignature = temp
return selfSignature, opponentSignature
#Define function to determine if terminal node has been reached
def reachedTerminal(forecasted):
if len(forecasted) >= 1:
last = forecasted[-1][0]
return isinstance(last, bool) or isinstance(last, float)
return False
#Define function to evaluate value of self node
def evalSelf(selfPlaying: bool, possibilities, iteration):
def countExact(values, countItem):
counted = 0
for value in values:
if value is countItem: counted += 1
return counted
#Define function to collapse all forecasted paths with same iteration count
def collapse(selfPlaying: bool, possibilities, iteration):
def contains(values, comparisonItem):
for value in values:
if value is comparisonItem: return True
return False
#Extract all forecasted paths with same iteration count
#print("All possibilities at this stage are: ", possibilities)
extracted = deepcopy([possibility for possibility in possibilities if possibility[-1][1] == iteration])
#if selfPlaying: print("Node layer ", iteration, " and maximizer is playing.")
#else: print("Node layer ", iteration, " and minimizer is playing.")
#print("Before collapse, all values at node layer ", iteration, " is ", extracted)
tempPossibilities = deepcopy([possibility for possibility in possibilities if possibility not in extracted])
#Heuristics: if only 1 or less forecasted at current node, skip collapse
if len(extracted) == 1:
#print("Taking shortcut to skip collapse because only 1 forecasted detected at layer ", iteration, ": ", extracted[0])
tempPossibilities.append(extracted[0])
return tempPossibilities
elif len(extracted) == 0:
#print("Taking shortcut to skip collapse because no forecasted detected at layer ", iteration)
return tempPossibilities
values = [extraction[-1][0] for extraction in extracted]
#print("Performing collapse on ", values)
tieLimiter = False
for value in values:
if isinstance(value, float): tieLimiter = True
#Prioritize boolean: if True exists, all positive possibilities can be pruned
if contains(values, True) and selfPlaying:
values = [value for value in values if not (isinstance(value, float) and value > 0)]
if contains(values, False) and not selfPlaying:
values = [value for value in values if not (isinstance(value, float) and value < 0)]
#When both True and False exists, eliminate any in-between
if contains(values, True) and contains(values, False):
values = [value for value in values if not isinstance(value, float)]
#print("Preliminary sifting is done. Now performing collapse on ", values)
if selfPlaying:
#Due to Python's max([False, 0.0]) -> False, must remove all False if 0.0 exists in maximizer's turn
if tieLimiter and contains(values, False):
values = [value for value in values if value is not False]
returnValue = max(values)
else:
#Due to Python's min([0.0, False]) -> 0.0, must remove all float if False exists in minimizer's turn
if contains(values, False):
returnValue = False
else:
returnValue = min(values)
#print("Collapse done, ", returnValue)
#Deeper eval performed when multiple returnValue in values; choose longest steps for min; shortest steps for max
#Heuristics: when multiple combinations of moves result in same state, keep only 1
if countExact(values, returnValue) > 1:
#print("Multiple forecasted evaluating to the same value detected. Comparing steps for each.")
extractedShortlisted = [forecasted for forecasted in extracted if forecasted[-1][0] is returnValue]
lenList = [len(forecasted) for forecasted in extractedShortlisted]
if selfPlaying:
fullReturnValue = extractedShortlisted[lenList.index(min(lenList))]
else:
fullReturnValue = extractedShortlisted[lenList.index(max(lenList))]
#print("From ", extractedShortlisted, " choose ", fullReturnValue)
else:
#Reconstruct full format of possibility holding returnValue and add back to possibilities
fullReturnValue = [possibility for possibility in extracted if possibility[-1][0] is returnValue][0]
#print("After collapse, all values at node layer ", iteration, " is ", fullReturnValue)
tempPossibilities.append(fullReturnValue)
return tempPossibilities
#Define function to decrement all forecasted paths (should be 1) with iteration count matching current (bubble-up)
def passUp(possibilities, iteration):
for possibility in possibilities:
if possibility[-1][1] == iteration: possibility[-1][1] -= 1
#Identify if a duplicated iteration count exists in possibilities, then collapse all those forecasted depending on self nature
iterationList = [possibility[-1][1] for possibility in possibilities]
#print(iterationList)
for iterationItem in iterationList:
if countExact(iterationList, iterationItem) > 1:
possibilities = collapse(selfPlaying, possibilities, iteration)
#print(iteration)
if (iteration > 0):
passUp(possibilities, iteration)
return possibilities
#Even iteration = machine plays; odd = human
#maxDepthSearch = layer of nodes forecasted ahead by AI -- CAREFUL! O(n) time complexity = b ** m, with m being maxDepthSearch and b being branching factor = (boardDimensionX * boardDimensionY - claimed tiles)
#For 3x3 board, set to 10 for full coverage
if len(board) == len(board[0]) and len(board) == 3:
maxDepthSearch = 10
#If game is in developing phase (i.e, number of placed marks <= 1/2 win condition)
elif max(len(locate(selfSignature, board)), len(locate(opponentSignature, board))) <= winCond/2:
maxDepthSearch = 2
else:
maxDepthSearch = 3
#possibilities = [forecasted1, forecasted2, ...]
#forecasted = [[x1, y1], [x2, y2], [x3, y3]..., [True, iteration]] containing moves of both players until end & boolean of win state(True when self is winner, False otherwise)
#forecasted = [[x1, y1], [x2, y2], [x3, y3]..., [score: float, iteration]] containing moves of both players until maxDepthSearch reached, score is evaluated to assign to board state (0 when tie, +highestTacticalValue when it's self's turn, - otherwise)
#Evaluate value of self node depending on min/max nature, run when all child nodes to maxDepthSearch are explored/ when terminal node is detected
#evalSelf only sifts through forecasteds and collapses those having the same iteration value (vying to value same node)
#When bubble up 1 node, take all forecasteds in possibilities with matching current iteration (if everything is right this should already be collapsed to only 1) and decrement that (to imply this value is passed upwards to parent node and is now parent node's originating value)
if reachedTerminal(forecasted):
selfPlaying = (iteration % 2 == 0)
forecastedCopy = deepcopy(forecasted)
possibilities.append(forecastedCopy)
possibilities = evalSelf(selfPlaying, possibilities, iteration)
iteration -= 1
#Reset back 1 node higher
forecasted.pop(-1)
forecasted.pop(-1)
return recurse(boardHistory, depleted, checked, iteration, winCond, forecasted, possibilities, board, selfSignature, opponentSignature, difficulty, False)
#Terminal node: winCond is met/maxDepthSearch reached/no possible moves left
if win(board, winCond, selfSignature, opponentSignature) or win(board, winCond, opponentSignature, selfSignature) or len(locate(' ', board)) == 0 or iteration == maxDepthSearch:
if forecasted not in checked:
checked.append(deepcopy(forecasted))
#If self/other is winner, document move
if win(board, winCond, selfSignature, opponentSignature):
#If it's computer's turn, and computer wins
if (iteration % 2 == 0):
forecasted.append([True, iteration])
#print("Forecasted a possible win if moves are as followed: ", forecasted)
#viewBoard(board)
else:
forecasted.append([False, iteration])
#print("Forecasted a possible loss if moves are as followed: ", forecasted)
#viewBoard(board)
elif win(board, winCond, opponentSignature, selfSignature):
#If it's computer's turn, and computer's opponent wins
if (iteration % 2 == 0):
forecasted.append([False, iteration])
#print("Forecasted a possible loss if moves are as followed: ", forecasted)
#viewBoard(board)
else:
forecasted.append([True, iteration])
#print("Forecasted a possible win if moves are as followed: ", forecasted)
#viewBoard(board)
elif iteration == maxDepthSearch:
metaboard = meta(board, opponentSignature, selfSignature, winCond, difficulty)
try:
style, value = stance(metaboard, difficulty)
#If self's turn
if (iteration % 2 == 0):
forecasted.append([float(value), iteration])
#print("Max search depth reached: ", forecasted)
#viewBoard(board)
else:
forecasted.append([float(-value), iteration])
#print("Max search depth reached: ", forecasted)
#viewBoard(board)
#When maxDepthSearch is reached, but game is also tied
except ValueError:
forecasted.append([0.0, iteration])
#print("Forecasted a possible tie at max depth search if moves are as followed: ", forecasted)
#viewBoard(board)
#When tie is reached through tiles depletion, score is set to 0.0
else:
forecasted.append([0.0, iteration])
#print("Forecasted a possible tie if moves are as followed: ", forecasted)
#viewBoard(board)
#Reset back 1 node higher
boardHistory.pop(-1)
board = deepcopy(boardHistory[-1])
#print("Breakpoint 2: Reset board back to ")
#viewBoard(board)
selfSignature, opponentSignature = swap(selfSignature, opponentSignature)
return recurse(boardHistory, depleted, checked, iteration, winCond, forecasted, possibilities, board, selfSignature, opponentSignature, difficulty, False)
#At each node layer, make a decision and "forecast" board and metaboard, then switch position with opponent and do the same
#Normal case: when self node is not terminal, and all children are not depleted yet/maxDepthSearch is not reached yet
#dimension = len(board)
metaboard = meta(board, opponentSignature, selfSignature, winCond, difficulty)
#Heuristics: if there is only one available move left, take that move
if (len(locate(' ', board)) == 1):
x = locate(' ', board)[0][0]
y = locate(' ', board)[0][1]
#For actual move; only apply when not projecting self as opponent
if (len(checked) == 0 and iteration == 0):
alphabet = ascii_uppercase
print(f'Computer has decided to play at column {alphabet[x]} and row {alphabet[y]}.\n\n')
board = boardHistory[0]
board[y][x] = selfSignature
viewBoard(board)
return board
#For a forecasted move
elif [*forecasted, [x, y]] not in checked:
forecasted.append([x, y])
checked.append(deepcopy(forecasted))
board[y][x] = selfSignature
boardHistory.append(deepcopy(board))
iteration += 1
selfSignature, opponentSignature = swap(selfSignature, opponentSignature)
return recurse(boardHistory, depleted, checked, iteration, winCond, forecasted, possibilities, board, selfSignature, opponentSignature, difficulty, False)
style, value = stance(metaboard, difficulty)
try:
#For first move only
if len(locate(selfSignature, board)) == 0 and len(locate(opponentSignature, board)) == 0:
#For symmetrical board or customized board dimension smaller than twice win condition
if len(board) == len(board[0]) or (len(board) < winCond * 2) or (len(board[0]) < winCond * 2):
move = [int(len(board[0])/2), int(len(board)/2)]
#For customized board dimension larger than twice win condition
else:
move = [randint(winCond, len(board[0]) - 1 - winCond), randint(winCond, len(board) - 1 - winCond)]
x = move[0]
y = move[1]
alphabet = ascii_uppercase
print(f'Computer has decided to play at column {alphabet[x]} and row {alphabet[y]}.\n\n')
board = boardHistory[0]
board[y][x] = selfSignature
viewBoard(board)
return board
else:
x, y = decide(forecasted, checked, style, value, metaboard, difficulty)
except ValueError:
depleted = True
#All child nodes had been depleted (i.e, checked has been populated with all possible forecasted combinations)
if depleted:
depleted = False
selfPlaying = (iteration % 2 == 0)
possibilities = evalSelf(selfPlaying, possibilities, iteration)
iteration -= 1
#If base case had been evaluated; root has been given value; iteration is negative => make a move
#All child branches had been depleted
if iteration < 0:
#print(possibilities)
move = possibilities[0][0]
x = move[0]
y = move[1]
alphabet = ascii_uppercase
print(f'Computer has decided to play at column {alphabet[x]} and row {alphabet[y]}.\n\n')
board = boardHistory[0]
board[y][x] = selfSignature
viewBoard(board)
return board
forecasted.pop(-1)
boardHistory.pop(-1)
board = deepcopy(boardHistory[-1])
#print("Breakpoint 1: Reset board back to ")
#viewBoard(board)
selfSignature, opponentSignature = swap(selfSignature, opponentSignature)
return recurse(boardHistory, depleted, checked, iteration, winCond, forecasted, possibilities, board, selfSignature, opponentSignature, difficulty, False)
forecasted.append([x, y])
checked.append(deepcopy(forecasted))
board[y][x] = selfSignature
#print(selfSignature, " took the move ", [x, y])
#viewBoard(board)
boardHistory.append(deepcopy(board))
#print(f'Assessing risk and opportunity, taking {style} move this turn at col {x}, row {y}.')
# valid = False
# while (not valid):
# x = randint(0, dimension - 1)
# y = randint(0, dimension - 1)
# if board[y][x] == ' ': valid = True
iteration += 1
#Swap player each turn
selfSignature, opponentSignature = swap(selfSignature, opponentSignature)
return recurse(boardHistory, depleted, checked, iteration, winCond, forecasted, possibilities, board, selfSignature, opponentSignature, difficulty, False)
#Define winning
def win(board, winCond, signature, opponentSignature):
#Define function to determine box containing played area
def box(board):
#Define function to find first occurence of 'X' or 'O', row-wise; if none is found, return 0
#Value is [signature, opponentSignature]
def locate(value, board):
dimensionY = len(board)
dimensionX = len(board[0])
for row in range(dimensionY):
for col in range(dimensionX):
if (board[row][col] in value):
return row
return 0
#Define function to inverse board vertically
def invertY(board):
invertYBoard = []
dimensionY = len(board)
for row in range(dimensionY):
invertYBoard.append(board[dimensionY - row - 1])
return invertYBoard
#Define function to rotate board 90 degree
def rotate(board):
rotateBoard = []
dimensionY = len(board)
dimensionX = len(board[0])
for col in range(dimensionX):
column = [board[row][col] for row in range(dimensionY)]
rotateBoard.append(column)
return rotateBoard
dimensionY = len(board)
dimensionX = len(board[0])
boundaryN = locate([signature, opponentSignature], board)
boundaryS = dimensionY - locate([signature, opponentSignature], invertY(board)) - 1
boundaryW = locate([signature, opponentSignature], rotate(board))
boundaryE = dimensionX - locate([signature, opponentSignature], invertY(rotate(board))) - 1
box = []
for row in range(boundaryN, boundaryS + 1):
boxRow = [board[row][col] for col in range(boundaryW, boundaryE + 1)]
box.append(boxRow)
return box
#Create as many winCond x winCond grids as needed to cover the entire played area
def grid(box, winCond):
dimensionY = len(box)
dimensionX = len(box[0])
gridY = dimensionY - winCond + 1
if (gridY < 1): gridY = 1
gridX = dimensionX - winCond + 1
if (gridX < 1): gridX = 1
#List of grids
grids = []
for offsetX in range(gridX):
for offsetY in range(gridY):
grid = []
for row in range(offsetY, offsetY + winCond):
rowY = []
for col in range(offsetX, offsetX + winCond):
try:
rowY.append(box[row][col])
except IndexError: pass
grid.append(rowY)
grids.append(grid)
return grids
for board in grid(box(board), winCond):
#Within each grid:
dimensionY = len(board)
dimensionX = len(board[0])
#Count 'O's in a row
for row in range(dimensionY):
if (board[row].count(signature) >= winCond):
return True
#Count 'O's in a column
columns = []
for col in range(dimensionX):
try:
columns.append([row[col] for row in board])
except IndexError: pass
for col in columns:
if (col.count(signature) >= winCond):
return True
#Count 'O's in a diagonal line
dimension = min(dimensionX, dimensionY)
diagonalsNW = []
diagonalsNE = []
for i in range(dimension):
diagonalNW = []
diagonalNE = []
for j in range(dimension):
try:
diagonalNW.append(board[j][j])
except IndexError: pass
try:
diagonalNE.append(board[j][dimension - j - 1])
except IndexError: pass
diagonalsNW.append(diagonalNW)
diagonalsNE.append(diagonalNE)
for diagonalNW in diagonalsNW:
if (diagonalNW.count(signature) >= winCond):
return True
for diagonalNE in diagonalsNE:
if (diagonalNE.count(signature) >= winCond):
return True
#Game loop
print('Welcome to a game of Tic-tac-toe!\nThe rule is simple: block your opponent before they can get a long enough streak in a continuous row, column or diagonal to win.\n')
mode = True
while (mode):
gamemode = input('Before we start, there are two gamemodes: custom and preset. Which one would you prefer?\n(c) for custom, (p) for preset. ')
if (gamemode not in ['c', 'p']):
print('Unrecognized input command. Please read the instructions carefully and try again.\n')
else:
mode = False
print('\n\n')
#Configuration settings for custom gamemode
configure = True
while (configure):
#Set custom dimension
invalid = True
while (invalid and gamemode == 'c'):
try:
dimensionX, dimensionY = input('Input dimension for game initialization:\n(width x length): ').split('x')
dimensionX = int(dimensionX)
dimensionY = int(dimensionY)
invalid = False
except:
print('Invalid input detected. Please try again.\n')
#Preset dimension
if (gamemode == 'p'):
print('Default grid set to 26x26.')
dimensionX = 26
dimensionY = 26
#Set win condition
valid = False
while (not valid and gamemode == 'c'):
try:
winCond = input('Input streak size to count as win: ')
winCond = int(winCond)
if (not isinstance(winCond, int) or 3 > winCond > min(dimensionX, dimensionY)): raise TypeError
valid = True
except:
print('Invalid input detected. Please try again.\n')
#Preset win condition
if (gamemode == 'p'):
print('Default win streak set to 5.')
winCond = 5
#Set difficulty
chose = False
while (not chose and gamemode == 'c'):
try:
difficulty = int(input('Choose difficulty (easiest: 1 - hardest: 3): '))
if (3 < difficulty or difficulty < 1): raise ValueError
chose = True
except:
print('Invalid input detected. Please try again.\n')
#Preset difficulty
if (gamemode == 'p'):
print('Default difficulty set to 3.')
difficulty = 3
#Set player's marker
proper = False
while (not proper and gamemode == 'c'):
marker = input('Choose your prefered marker:\n(o) for \'O\', (x) for \'X\': ')
if (marker not in ['x', 'o']):
print('Invalid input detected. Please try again.\n')
else:
proper = True
if (marker == 'o'):
opponentSignature = 'O'
selfSignature = 'X'
else:
opponentSignature = 'X'
selfSignature = 'O'
#Preset marker
if (gamemode == 'p'):
print('Default player marker set to \'X\'.')
opponentSignature = 'X'
selfSignature = 'O'
#Choose who goes first
ok = False
while (not ok and gamemode == 'c'):
playerGoesFirst = input('Do you want to go first?\n(y) for yes, (n) for no: ')
if (playerGoesFirst not in ['y', 'n']):
print('Invalid input detected. Please try again.\n')
else:
ok = True
playerGoesFirst = (playerGoesFirst == 'y')
#Preset first play
if (gamemode == 'p'):
print('Default: computer goes first.')
playerGoesFirst = False
#Replay loop
replay = True
while (replay):
print('\n\n')
board = mapBoard(int(dimensionX), int(dimensionY), ' ')
viewBoard(board)
while (True):
try:
locate([' '], board)[0]
except IndexError:
print('\nIt\'s a tie!')
break
#Player plays
if (playerGoesFirst):
mark(board, opponentSignature)
if (win(board, winCond, opponentSignature, selfSignature)):
print('Congratulations, you won!')
break
playerGoesFirst = True
try:
locate([' '], board)[0]
except IndexError:
print('\nIt\'s a tie!')
break
print('\n\nComputer is calculating...')
#Computer plays
board = play([deepcopy(board)], False, [], 0, winCond, [], [], board, selfSignature, opponentSignature, difficulty)
if (win(board, winCond, selfSignature, opponentSignature)):
print('Sorry, you lost!')
break
#Replay choice
makingChoice = True
while makingChoice:
choice = input('\n\nDo you want to replay?\n(y) to replay with current configurations, (n) to quit, (p) to play with recommended configurations, or (c) to replay with different configurations.\n')
if (choice == 'y'):
replay = True
configure = False
print('\n\n')
makingChoice = False
elif (choice == 'n'):
replay = False
configure = False
makingChoice = False
elif (choice == 'p'):
replay = False
configure = True
gamemode = 'p'
print('\n\n')
makingChoice = False
elif (choice == 'c'):
replay = False
configure = True
gamemode = 'c'
print('\n\n')
makingChoice = False
else:
print('Invalid input detected. Please try again.\n')
input('\nPress ENTER to quit.') | 50.053333 | 328 | 0.565346 |
from random import randint
from string import ascii_uppercase, ascii_lowercase
from itertools import permutations
from copy import deepcopy
from tail_recursion import tail_recursive, recurse
def mapBoard(col, row, value):
board = [[value for x in range(col)] for y in range(row)]
return board
def mapMetaBoard(col, row):
metaboard = [[[[0, 0, 0, 0], [0, 0, 0, 0]] for x in range(col)] for y in range(row)]
return metaboard
def viewBoard(board):
alphabet = ascii_uppercase
col = len(board[0])
row = len(board)
border = ""
topBorder = "#||"
for i in range(col):
border += "_" * 2
topBorder += alphabet[i]
topBorder += " "
border += "___"
print(topBorder)
print(border)
for i in range(row):
print(alphabet[i] + "||" + " ".join(board[i]) + "|")
def mark(board, signature):
alphabet = ascii_uppercase
alphabet1 = ascii_lowercase
dimensionY = len(board)
dimensionX = len(board[0])
valid = False
while (not valid):
print("\n\nWhere do you want to mark?\n\n")
x = input(f"Column (A - {alphabet[dimensionX - 1]})? ")
y = input(f"Row (A - {alphabet[dimensionY - 1]})? ")
try:
x = alphabet.index(x)
except ValueError:
x = alphabet1.index(x)
try:
y = alphabet.index(y)
except:
y = alphabet1.index(y)
if (board[y][x] == ' '):
valid = True
else:
print('That position has already been marked. Please try again.\n')
board[y][x] = signature
print('\n')
viewBoard(board)
def locate(value, board):
dimensionY = len(board)
dimensionX = len(board[0])
returnList = []
for row in range(dimensionY):
for col in range(dimensionX):
if (board[row][col] in value): returnList.append([col, row])
return returnList
@tail_recursive
def play(boardHistory, depleted, checked, iteration, winCond, forecasted, possibilities, board, selfSignature, opponentSignature, difficulty, first = True):
#AI
#Each of metaboard's position is a list [danger, opportunity]
def meta(board, opponentSignature, selfSignature, winCond, difficulty):
#coord = [col, row]
def sweep(metaboard, coord, keyword, opponentSignature, selfSignature, winCond):
if (keyword == 'danger'):
type = 0
otherType = 1
signature = opponentSignature
else:
type = 1
otherType = 0
signature = selfSignature
coordVars = list(permutations([-1, 0, 1], 2))
coordVars.extend(((-1, -1), (1, 1)))
for coordVar in coordVars:
try:
if (coordVar in [(-1, -1), (1, 1)]):
pos = 2
elif (coordVar in [(0, -1), (0, 1)]):
pos = 0
elif (coordVar in [(-1, 0), (1, 0)]):
pos = 1
else:
pos = 3
row = coord[1] + coordVar[0]
if (row < 0 or row > len(metaboard)): raise IndexError
col = coord[0] + coordVar[1]
if (col < 0 or col > len(metaboard[0])): raise IndexError
#Ripple effect
if (not isinstance(metaboard[row][col], str)):
for i in range(winCond - 1):
if (not isinstance(metaboard[row][col], str)):
metaboard[row][col][type][pos] += (1 - i/(winCond - 1))
metaboard[row][col][otherType][pos] -= (1 - i/(winCond - 1))
row += coordVar[0]
if (row < 0 or row > len(metaboard)): raise IndexError
col += coordVar[1]
if (col < 0 or col > len(metaboard[0])): raise IndexError
elif (metaboard[row][col] == signature):
row += coordVar[0]
if (row < 0 or row > len(metaboard)): raise IndexError
col += coordVar[1]
if (col < 0 or col > len(metaboard[0])): raise IndexError
else:
raise IndexError
#alphabet = ascii_uppercase
#print(f'Metaboard at column {alphabet[col]} and row {alphabet[row]} has a {keyword} level of {metaboard[row][col][type]}.')
#Resonance effect
if (metaboard[row][col] == signature):
alignment = 0
while (metaboard[row][col] == signature):
row += coordVar[0]
if (row < 0 or row > len(metaboard)): raise IndexError
col += coordVar[1]
if (col < 0 or col > len(metaboard[0])): raise IndexError
alignment += 1
if (isinstance(metaboard[row][col], list)):
metaboard[row][col][type][pos] += alignment
except IndexError: pass
#Define function to screen entire metaboard for invalidation
def screen(metaboard, selfSignature, opponentSignature, winCond):
#Define function to rotate board 90 degree counter-clockwise with perspective to keeping OG board intact
def rotate(board):
#Define function to inverse board vertically
def invertY(board):
invertYBoard = []
dimensionY = len(board)
for row in range(dimensionY):
invertYBoard.append(board[dimensionY - row - 1])
return invertYBoard
rotateBoard = []
dimensionY = len(board)
dimensionX = len(board[0])
for col in range(dimensionX):
column = [board[row][col] for row in range(dimensionY)]
rotateBoard.append(column)
return invertY(rotateBoard)
#Define function to screen the top left corner of the board
def screenTopLeftCorner(metaboard, winCond, pos, name):
for row in range(winCond - 1):
for col in range(winCond - 1 - row):
if (isinstance(metaboard[row][col], list)):
#print(f'nullify {row}:{col}\'s danger and potential in the {name} diagonal')
metaboard[row][col][0][pos] = 0
metaboard[row][col][1][pos] = 0
def screenHorizontal(metaboard, signature, type, winCond, pos):
dimensionX = len(metaboard[0])
if type == 'danger': type = 0
else: type = 1
#sus = [susRow1, susRow3, ...]
#susRow1 = [[col1, row], [col3, row], ...]
sus = []
for row in metaboard:
susEachRow = []
for col in row:
if (col == signature): susEachRow.append([row.index(col), metaboard.index(row)])
sus.append(susEachRow)
sus = [susEachRow for susEachRow in sus if len(susEachRow) != 0]
#Filter out all invalid segments between two blocked self horizontally
for susEachRow in sus:
for i in range(len(susEachRow) - 1):
if (2 <= susEachRow[i + 1][0] - susEachRow[i][0] <= winCond):
for k in range(0, susEachRow[i + 1][0] - susEachRow[i][0]):
if (isinstance(metaboard[susEachRow[i][1]][susEachRow[i][0] + k], list)):
#print(f'Due to being blocked on both ends by {signature} at coordinates {susEachRow[i][0]}:{susEachRow[i][1]} and {susEachRow[i + 1][0]}:{susEachRow[i + 1][1]}, the position with the coordinates {susEachRow[i][1]}:{susEachRow[i][0] + k} has been nullified of its {type}\'s {pos}.')
metaboard[susEachRow[i][1]][susEachRow[i][0] + k][type][pos] = 0
for susEachRow in sus:
start = susEachRow[0]
end = susEachRow[-1]
if (1 <= start[0] < winCond):
for k in range(0, start[0]):
if (isinstance(metaboard[start[1]][k], list)):
metaboard[start[1]][k][type][pos] = 0
if (1 <= dimensionX - end[0] - 1 < winCond):
for k in range(0, dimensionX - end[0] - 1):
if (isinstance(metaboard[end[1]][end[0] + k], list)):
#print(f'Due to being blocked on both ends by {signature} at coordinates {end[0]}:{end[1]} and the border, the position with the coordinates {end[1]}:{end[0] + k} has been nullified of its {type}\'s {pos}.')
metaboard[end[1]][end[0] + k][type][pos] = 0
return metaboard
def screenDiagonal(metaboard, signature, type, winCond, pos):
dimensionY = len(metaboard)
dimensionX = len(metaboard[0])
if type == 'danger': type = 0
else: type = 1
#susDiagDown, Up, sus = [susDiag1, susDiag3, ...]
#susDiag1 = [[col1, row1], [col3, row3], ...]
sus = []
susDiagDown = []
lenSusDiagDown = []
susDiagUp = []
lenSusDiagUp = []
susDuplicate = []
for i in range(dimensionY):
susEachDiagDown = []
originalDiagLen = 0
for j in range(dimensionY):
try:
if (metaboard[i + j][j] == signature): susEachDiagDown.append([i + j, j])
originalDiagLen += 1
except IndexError:
pass
susDiagDown.append(susEachDiagDown)
if (len(susEachDiagDown) != 0):
lenSusDiagDown.append(originalDiagLen)
else: lenSusDiagDown.append(0)
for i in range(dimensionX):
susEachDiagUp = []
originalDiagLen = 0
for j in range(dimensionX):
try:
if (metaboard[j][i + j] == signature): susEachDiagUp.append([j, i + j])
originalDiagLen += 1
except IndexError: pass
susDiagUp.append(susEachDiagUp)
if (len(susEachDiagUp) != 0):
lenSusDiagUp.append(originalDiagLen)
else: lenSusDiagUp.append(0)
sus.extend(susDiagDown)
sus.extend(susDiagUp)
for i in range(min(dimensionX, dimensionY)):
if (metaboard[i][i] == signature): susDuplicate.append([i, i])
sus.remove(susDuplicate)
susDiagUp = [susEachDiag for susEachDiag in susDiagUp if len(susEachDiag) != 0]
lenSusDiagUp = [eachLen for eachLen in lenSusDiagUp if eachLen != 0]
susDiagDown = [susEachDiag for susEachDiag in susDiagDown if len(susEachDiag) != 0]
lenSusDiagDown = [eachLen for eachLen in lenSusDiagDown if eachLen != 0]
#Filter out all invalid segments between two blocked self diagontally
for susEachDiag in sus:
for i in range(len(susEachDiag) - 1):
if (2 <= susEachDiag[i + 1][0] - susEachDiag[i][0] <= winCond):
for k in range(0, susEachDiag[i + 1][0] - susEachDiag[i][0]):
if (isinstance(metaboard[susEachDiag[i][0] + k][susEachDiag[i][1] + k], list)):
#print(f'Due to being blocked on both ends by {signature} at coordinates {susEachDiag[i][0]}:{susEachDiag[i][1]} and {susEachDiag[i + 1][0]}:{susEachDiag[i + 1][1]}, the position with the coordinates {susEachDiag[i][0] + k}:{susEachDiag[i][1] + k} has been nullified of its {type}\'s {pos}.')
metaboard[susEachDiag[i][0] + k][susEachDiag[i][1] + k][type][pos] = 0
for susEachDiag in susDiagUp:
start = susEachDiag[0]
end = susEachDiag[-1]
if (1 <= min(start[0], start[1]) < winCond):
for k in range(0, min(start[0], start[1]) + 1):
if (isinstance(metaboard[start[0] - k][start[1] - k], list)):
metaboard[start[0] - k][start[1] - k][type][pos] = 0
if (1 <= lenSusDiagUp[susDiagUp.index(susEachDiag)] - min(end[0], end[1]) <= winCond):
for k in range(0, lenSusDiagUp[susDiagUp.index(susEachDiag)] - min(end[0], end[1])):
if (isinstance(metaboard[end[0] + k][end[1] + k], list)):
#print(f'Due to being blocked on both ends by {signature} at coordinates {end[0]}:{end[1]} and the corner, the position with the coordinates {end[0] + k}:{end[1] + k} has been nullified of its {type}\'s {pos}.')
metaboard[end[0] + k][end[1] + k][type][pos] = 0
for susEachDiag in susDiagDown:
start = susEachDiag[0]
end = susEachDiag[-1]
if (1 <= min(start[0], start[1]) < winCond):
for k in range(0, min(start[0], start[1]) + 1):
if (isinstance(metaboard[start[0] - k][start[1] - k], list)):
metaboard[start[0] - k][start[1] - k][type][pos] = 0
if (1 <= lenSusDiagDown[susDiagDown.index(susEachDiag)] - min(end[0], end[1]) <= winCond):
for k in range(0, lenSusDiagDown[susDiagDown.index(susEachDiag)] - min(end[0], end[1])):
if (isinstance(metaboard[end[0] + k][end[1] + k], list)):
#print(f'Due to being blocked on both ends by {signature} at coordinates {end[0]}:{end[1]} and the corner, the position with the coordinates {end[0] + k}:{end[1] + k} has been nullified of its {type}\'s {pos}.')
metaboard[end[0] + k][end[1] + k][type][pos] = 0
return metaboard
screenTopLeftCorner(metaboard, winCond, 3, 'top left')
metaboard = rotate(metaboard)
screenTopLeftCorner(metaboard, winCond, 2, 'top right')
metaboard = rotate(metaboard)
screenTopLeftCorner(metaboard, winCond, 3, 'bottom right')
metaboard = rotate(metaboard)
screenTopLeftCorner(metaboard, winCond, 2, 'bottom left')
metaboard = rotate(metaboard)
screenHorizontal(metaboard, selfSignature, 'danger' , winCond, 0)
screenHorizontal(metaboard, opponentSignature, 'opportunity' , winCond, 0)
metaboard = rotate(metaboard)
screenHorizontal(metaboard, selfSignature, 'danger' , winCond, 1)
screenHorizontal(metaboard, opponentSignature, 'opportunity' , winCond, 1)
for i in range(3): metaboard = rotate(metaboard)
screenDiagonal(metaboard, selfSignature, 'danger' , winCond, 2)
screenDiagonal(metaboard, opponentSignature, 'opportunity' , winCond, 2)
metaboard = rotate(metaboard)
screenDiagonal(metaboard, selfSignature, 'danger' , winCond, 3)
screenDiagonal(metaboard, opponentSignature, 'opportunity' , winCond, 3)
for i in range(3): metaboard = rotate(metaboard)
metaboard = mapMetaBoard(len(board[0]), len(board))
dangerCoords = locate([opponentSignature], board)
opportunityCoords = locate([selfSignature], board)
for coord in dangerCoords:
metaboard[coord[1]][coord[0]] = opponentSignature
for coord in opportunityCoords:
metaboard[coord[1]][coord[0]] = selfSignature
for coord in dangerCoords:
sweep(metaboard, coord, 'danger', opponentSignature, selfSignature, winCond)
for coord in opportunityCoords:
sweep(metaboard, coord, 'opportunity', opponentSignature, selfSignature, winCond)
if (difficulty >= 2):
screen(metaboard, selfSignature, opponentSignature, winCond)
return metaboard
def stance(metaboard, difficulty):
dangerList = []
opportunityList = []
for row in metaboard:
for col in row:
if (isinstance(col, list)):
dangerList.append(max(col[0]))
opportunityList.append(max(col[1]))
pressingDanger = max(dangerList)
pressingOpportunity = max(opportunityList)
if (difficulty >= 3):
if (pressingOpportunity > pressingDanger):
return 'aggressive', pressingOpportunity
elif (pressingOpportunity == pressingDanger):
return 'tactical', pressingOpportunity
else:
return 'defensive', pressingDanger
else:
if (pressingOpportunity >= pressingDanger):
return 'aggressive', pressingOpportunity
else:
return 'defensive', pressingDanger
@tail_recursive
def decide(forecasted, checked, style, value, metaboard, difficulty):
if style == 'aggressive': type = 1
elif style == 'defensive': type = 0
else: type = 2
if (style in ['aggressive', 'defensive']):
for row in metaboard:
for col in row:
if (isinstance(col, list)):
if max(col[type]) == value:
x, y = row.index(col), metaboard.index(row)
else:
returnList = []
maxTracker = []
for row in range(len(metaboard)):
for col in range(len(metaboard[0])):
if (isinstance(metaboard[row][col], list)):
if (max(metaboard[row][col][0]) == value) or (max(metaboard[row][col][1]) == value):
returnList.append([col, row])
maxTracker.append(sum(metaboard[row][col][0]) + sum(metaboard[row][col][1]))
x, y = returnList[maxTracker.index(max(maxTracker))][0], returnList[maxTracker.index(max(maxTracker))][1]
if [*forecasted, [x, y]] not in checked:
return x, y
else:
metaboardTemp = deepcopy(metaboard)
metaboardTemp[y][x] = [[-1, -1, -1, -1], [-1, -1, -1, -1]]
style, newValue = stance(metaboardTemp, difficulty)
if newValue != value: raise ValueError
return recurse(forecasted, checked, style, newValue, metaboardTemp, difficulty)
def swap(selfSignature, opponentSignature):
temp = selfSignature
selfSignature = opponentSignature
opponentSignature = temp
return selfSignature, opponentSignature
def reachedTerminal(forecasted):
if len(forecasted) >= 1:
last = forecasted[-1][0]
return isinstance(last, bool) or isinstance(last, float)
return False
def evalSelf(selfPlaying: bool, possibilities, iteration):
def countExact(values, countItem):
counted = 0
for value in values:
if value is countItem: counted += 1
return counted
def collapse(selfPlaying: bool, possibilities, iteration):
def contains(values, comparisonItem):
for value in values:
if value is comparisonItem: return True
return False
extracted = deepcopy([possibility for possibility in possibilities if possibility[-1][1] == iteration])
tempPossibilities = deepcopy([possibility for possibility in possibilities if possibility not in extracted])
if len(extracted) == 1:
tempPossibilities.append(extracted[0])
return tempPossibilities
elif len(extracted) == 0:
return tempPossibilities
values = [extraction[-1][0] for extraction in extracted]
tieLimiter = False
for value in values:
if isinstance(value, float): tieLimiter = True
if contains(values, True) and selfPlaying:
values = [value for value in values if not (isinstance(value, float) and value > 0)]
if contains(values, False) and not selfPlaying:
values = [value for value in values if not (isinstance(value, float) and value < 0)]
if contains(values, True) and contains(values, False):
values = [value for value in values if not isinstance(value, float)]
if selfPlaying:
if tieLimiter and contains(values, False):
values = [value for value in values if value is not False]
returnValue = max(values)
else:
if contains(values, False):
returnValue = False
else:
returnValue = min(values)
if countExact(values, returnValue) > 1:
extractedShortlisted = [forecasted for forecasted in extracted if forecasted[-1][0] is returnValue]
lenList = [len(forecasted) for forecasted in extractedShortlisted]
if selfPlaying:
fullReturnValue = extractedShortlisted[lenList.index(min(lenList))]
else:
fullReturnValue = extractedShortlisted[lenList.index(max(lenList))]
else:
fullReturnValue = [possibility for possibility in extracted if possibility[-1][0] is returnValue][0]
tempPossibilities.append(fullReturnValue)
return tempPossibilities
def passUp(possibilities, iteration):
for possibility in possibilities:
if possibility[-1][1] == iteration: possibility[-1][1] -= 1
iterationList = [possibility[-1][1] for possibility in possibilities]
for iterationItem in iterationList:
if countExact(iterationList, iterationItem) > 1:
possibilities = collapse(selfPlaying, possibilities, iteration)
if (iteration > 0):
passUp(possibilities, iteration)
return possibilities
if len(board) == len(board[0]) and len(board) == 3:
maxDepthSearch = 10
elif max(len(locate(selfSignature, board)), len(locate(opponentSignature, board))) <= winCond/2:
maxDepthSearch = 2
else:
maxDepthSearch = 3
if reachedTerminal(forecasted):
selfPlaying = (iteration % 2 == 0)
forecastedCopy = deepcopy(forecasted)
possibilities.append(forecastedCopy)
possibilities = evalSelf(selfPlaying, possibilities, iteration)
iteration -= 1
#Reset back 1 node higher
forecasted.pop(-1)
forecasted.pop(-1)
return recurse(boardHistory, depleted, checked, iteration, winCond, forecasted, possibilities, board, selfSignature, opponentSignature, difficulty, False)
#Terminal node: winCond is met/maxDepthSearch reached/no possible moves left
if win(board, winCond, selfSignature, opponentSignature) or win(board, winCond, opponentSignature, selfSignature) or len(locate(' ', board)) == 0 or iteration == maxDepthSearch:
if forecasted not in checked:
checked.append(deepcopy(forecasted))
#If self/other is winner, document move
if win(board, winCond, selfSignature, opponentSignature):
#If it's computer's turn, and computer wins
if (iteration % 2 == 0):
forecasted.append([True, iteration])
#print("Forecasted a possible win if moves are as followed: ", forecasted)
#viewBoard(board)
else:
forecasted.append([False, iteration])
#print("Forecasted a possible loss if moves are as followed: ", forecasted)
#viewBoard(board)
elif win(board, winCond, opponentSignature, selfSignature):
#If it's computer's turn, and computer's opponent wins
if (iteration % 2 == 0):
forecasted.append([False, iteration])
else:
forecasted.append([True, iteration])
elif iteration == maxDepthSearch:
metaboard = meta(board, opponentSignature, selfSignature, winCond, difficulty)
try:
style, value = stance(metaboard, difficulty)
if (iteration % 2 == 0):
forecasted.append([float(value), iteration])
#print("Max search depth reached: ", forecasted)
#viewBoard(board)
else:
forecasted.append([float(-value), iteration])
#print("Max search depth reached: ", forecasted)
#viewBoard(board)
#When maxDepthSearch is reached, but game is also tied
except ValueError:
forecasted.append([0.0, iteration])
#print("Forecasted a possible tie at max depth search if moves are as followed: ", forecasted)
#viewBoard(board)
#When tie is reached through tiles depletion, score is set to 0.0
else:
forecasted.append([0.0, iteration])
#print("Forecasted a possible tie if moves are as followed: ", forecasted)
#viewBoard(board)
#Reset back 1 node higher
boardHistory.pop(-1)
board = deepcopy(boardHistory[-1])
#print("Breakpoint 2: Reset board back to ")
#viewBoard(board)
selfSignature, opponentSignature = swap(selfSignature, opponentSignature)
return recurse(boardHistory, depleted, checked, iteration, winCond, forecasted, possibilities, board, selfSignature, opponentSignature, difficulty, False)
#At each node layer, make a decision and "forecast" board and metaboard, then switch position with opponent and do the same
#Normal case: when self node is not terminal, and all children are not depleted yet/maxDepthSearch is not reached yet
#dimension = len(board)
metaboard = meta(board, opponentSignature, selfSignature, winCond, difficulty)
#Heuristics: if there is only one available move left, take that move
if (len(locate(' ', board)) == 1):
x = locate(' ', board)[0][0]
y = locate(' ', board)[0][1]
#For actual move; only apply when not projecting self as opponent
if (len(checked) == 0 and iteration == 0):
alphabet = ascii_uppercase
print(f'Computer has decided to play at column {alphabet[x]} and row {alphabet[y]}.\n\n')
board = boardHistory[0]
board[y][x] = selfSignature
viewBoard(board)
return board
#For a forecasted move
elif [*forecasted, [x, y]] not in checked:
forecasted.append([x, y])
checked.append(deepcopy(forecasted))
board[y][x] = selfSignature
boardHistory.append(deepcopy(board))
iteration += 1
selfSignature, opponentSignature = swap(selfSignature, opponentSignature)
return recurse(boardHistory, depleted, checked, iteration, winCond, forecasted, possibilities, board, selfSignature, opponentSignature, difficulty, False)
style, value = stance(metaboard, difficulty)
try:
#For first move only
if len(locate(selfSignature, board)) == 0 and len(locate(opponentSignature, board)) == 0:
#For symmetrical board or customized board dimension smaller than twice win condition
if len(board) == len(board[0]) or (len(board) < winCond * 2) or (len(board[0]) < winCond * 2):
move = [int(len(board[0])/2), int(len(board)/2)]
#For customized board dimension larger than twice win condition
else:
move = [randint(winCond, len(board[0]) - 1 - winCond), randint(winCond, len(board) - 1 - winCond)]
x = move[0]
y = move[1]
alphabet = ascii_uppercase
print(f'Computer has decided to play at column {alphabet[x]} and row {alphabet[y]}.\n\n')
board = boardHistory[0]
board[y][x] = selfSignature
viewBoard(board)
return board
else:
x, y = decide(forecasted, checked, style, value, metaboard, difficulty)
except ValueError:
depleted = True
#All child nodes had been depleted (i.e, checked has been populated with all possible forecasted combinations)
if depleted:
depleted = False
selfPlaying = (iteration % 2 == 0)
possibilities = evalSelf(selfPlaying, possibilities, iteration)
iteration -= 1
#If base case had been evaluated; root has been given value; iteration is negative => make a move
#All child branches had been depleted
if iteration < 0:
#print(possibilities)
move = possibilities[0][0]
x = move[0]
y = move[1]
alphabet = ascii_uppercase
print(f'Computer has decided to play at column {alphabet[x]} and row {alphabet[y]}.\n\n')
board = boardHistory[0]
board[y][x] = selfSignature
viewBoard(board)
return board
forecasted.pop(-1)
boardHistory.pop(-1)
board = deepcopy(boardHistory[-1])
#print("Breakpoint 1: Reset board back to ")
#viewBoard(board)
selfSignature, opponentSignature = swap(selfSignature, opponentSignature)
return recurse(boardHistory, depleted, checked, iteration, winCond, forecasted, possibilities, board, selfSignature, opponentSignature, difficulty, False)
forecasted.append([x, y])
checked.append(deepcopy(forecasted))
board[y][x] = selfSignature
#print(selfSignature, " took the move ", [x, y])
#viewBoard(board)
boardHistory.append(deepcopy(board))
#print(f'Assessing risk and opportunity, taking {style} move this turn at col {x}, row {y}.')
# valid = False
# while (not valid):
# x = randint(0, dimension - 1)
# y = randint(0, dimension - 1)
# if board[y][x] == ' ': valid = True
iteration += 1
#Swap player each turn
selfSignature, opponentSignature = swap(selfSignature, opponentSignature)
return recurse(boardHistory, depleted, checked, iteration, winCond, forecasted, possibilities, board, selfSignature, opponentSignature, difficulty, False)
#Define winning
def win(board, winCond, signature, opponentSignature):
#Define function to determine box containing played area
def box(board):
#Define function to find first occurence of 'X' or 'O', row-wise; if none is found, return 0
#Value is [signature, opponentSignature]
def locate(value, board):
dimensionY = len(board)
dimensionX = len(board[0])
for row in range(dimensionY):
for col in range(dimensionX):
if (board[row][col] in value):
return row
return 0
#Define function to inverse board vertically
def invertY(board):
invertYBoard = []
dimensionY = len(board)
for row in range(dimensionY):
invertYBoard.append(board[dimensionY - row - 1])
return invertYBoard
#Define function to rotate board 90 degree
def rotate(board):
rotateBoard = []
dimensionY = len(board)
dimensionX = len(board[0])
for col in range(dimensionX):
column = [board[row][col] for row in range(dimensionY)]
rotateBoard.append(column)
return rotateBoard
dimensionY = len(board)
dimensionX = len(board[0])
boundaryN = locate([signature, opponentSignature], board)
boundaryS = dimensionY - locate([signature, opponentSignature], invertY(board)) - 1
boundaryW = locate([signature, opponentSignature], rotate(board))
boundaryE = dimensionX - locate([signature, opponentSignature], invertY(rotate(board))) - 1
box = []
for row in range(boundaryN, boundaryS + 1):
boxRow = [board[row][col] for col in range(boundaryW, boundaryE + 1)]
box.append(boxRow)
return box
#Create as many winCond x winCond grids as needed to cover the entire played area
def grid(box, winCond):
dimensionY = len(box)
dimensionX = len(box[0])
gridY = dimensionY - winCond + 1
if (gridY < 1): gridY = 1
gridX = dimensionX - winCond + 1
if (gridX < 1): gridX = 1
#List of grids
grids = []
for offsetX in range(gridX):
for offsetY in range(gridY):
grid = []
for row in range(offsetY, offsetY + winCond):
rowY = []
for col in range(offsetX, offsetX + winCond):
try:
rowY.append(box[row][col])
except IndexError: pass
grid.append(rowY)
grids.append(grid)
return grids
for board in grid(box(board), winCond):
#Within each grid:
dimensionY = len(board)
dimensionX = len(board[0])
#Count 'O's in a row
for row in range(dimensionY):
if (board[row].count(signature) >= winCond):
return True
#Count 'O's in a column
columns = []
for col in range(dimensionX):
try:
columns.append([row[col] for row in board])
except IndexError: pass
for col in columns:
if (col.count(signature) >= winCond):
return True
#Count 'O's in a diagonal line
dimension = min(dimensionX, dimensionY)
diagonalsNW = []
diagonalsNE = []
for i in range(dimension):
diagonalNW = []
diagonalNE = []
for j in range(dimension):
try:
diagonalNW.append(board[j][j])
except IndexError: pass
try:
diagonalNE.append(board[j][dimension - j - 1])
except IndexError: pass
diagonalsNW.append(diagonalNW)
diagonalsNE.append(diagonalNE)
for diagonalNW in diagonalsNW:
if (diagonalNW.count(signature) >= winCond):
return True
for diagonalNE in diagonalsNE:
if (diagonalNE.count(signature) >= winCond):
return True
#Game loop
print('Welcome to a game of Tic-tac-toe!\nThe rule is simple: block your opponent before they can get a long enough streak in a continuous row, column or diagonal to win.\n')
mode = True
while (mode):
gamemode = input('Before we start, there are two gamemodes: custom and preset. Which one would you prefer?\n(c) for custom, (p) for preset. ')
if (gamemode not in ['c', 'p']):
print('Unrecognized input command. Please read the instructions carefully and try again.\n')
else:
mode = False
print('\n\n')
#Configuration settings for custom gamemode
configure = True
while (configure):
#Set custom dimension
invalid = True
while (invalid and gamemode == 'c'):
try:
dimensionX, dimensionY = input('Input dimension for game initialization:\n(width x length): ').split('x')
dimensionX = int(dimensionX)
dimensionY = int(dimensionY)
invalid = False
except:
print('Invalid input detected. Please try again.\n')
#Preset dimension
if (gamemode == 'p'):
print('Default grid set to 26x26.')
dimensionX = 26
dimensionY = 26
#Set win condition
valid = False
while (not valid and gamemode == 'c'):
try:
winCond = input('Input streak size to count as win: ')
winCond = int(winCond)
if (not isinstance(winCond, int) or 3 > winCond > min(dimensionX, dimensionY)): raise TypeError
valid = True
except:
print('Invalid input detected. Please try again.\n')
#Preset win condition
if (gamemode == 'p'):
print('Default win streak set to 5.')
winCond = 5
#Set difficulty
chose = False
while (not chose and gamemode == 'c'):
try:
difficulty = int(input('Choose difficulty (easiest: 1 - hardest: 3): '))
if (3 < difficulty or difficulty < 1): raise ValueError
chose = True
except:
print('Invalid input detected. Please try again.\n')
#Preset difficulty
if (gamemode == 'p'):
print('Default difficulty set to 3.')
difficulty = 3
#Set player's marker
proper = False
while (not proper and gamemode == 'c'):
marker = input('Choose your prefered marker:\n(o) for \'O\', (x) for \'X\': ')
if (marker not in ['x', 'o']):
print('Invalid input detected. Please try again.\n')
else:
proper = True
if (marker == 'o'):
opponentSignature = 'O'
selfSignature = 'X'
else:
opponentSignature = 'X'
selfSignature = 'O'
if (gamemode == 'p'):
print('Default player marker set to \'X\'.')
opponentSignature = 'X'
selfSignature = 'O'
ok = False
while (not ok and gamemode == 'c'):
playerGoesFirst = input('Do you want to go first?\n(y) for yes, (n) for no: ')
if (playerGoesFirst not in ['y', 'n']):
print('Invalid input detected. Please try again.\n')
else:
ok = True
playerGoesFirst = (playerGoesFirst == 'y')
if (gamemode == 'p'):
print('Default: computer goes first.')
playerGoesFirst = False
replay = True
while (replay):
print('\n\n')
board = mapBoard(int(dimensionX), int(dimensionY), ' ')
viewBoard(board)
while (True):
try:
locate([' '], board)[0]
except IndexError:
print('\nIt\'s a tie!')
break
#Player plays
if (playerGoesFirst):
mark(board, opponentSignature)
if (win(board, winCond, opponentSignature, selfSignature)):
print('Congratulations, you won!')
break
playerGoesFirst = True
try:
locate([' '], board)[0]
except IndexError:
print('\nIt\'s a tie!')
break
print('\n\nComputer is calculating...')
board = play([deepcopy(board)], False, [], 0, winCond, [], [], board, selfSignature, opponentSignature, difficulty)
if (win(board, winCond, selfSignature, opponentSignature)):
print('Sorry, you lost!')
break
makingChoice = True
while makingChoice:
choice = input('\n\nDo you want to replay?\n(y) to replay with current configurations, (n) to quit, (p) to play with recommended configurations, or (c) to replay with different configurations.\n')
if (choice == 'y'):
replay = True
configure = False
print('\n\n')
makingChoice = False
elif (choice == 'n'):
replay = False
configure = False
makingChoice = False
elif (choice == 'p'):
replay = False
configure = True
gamemode = 'p'
print('\n\n')
makingChoice = False
elif (choice == 'c'):
replay = False
configure = True
gamemode = 'c'
print('\n\n')
makingChoice = False
else:
print('Invalid input detected. Please try again.\n')
input('\nPress ENTER to quit.') | true | true |
f702b0c9185d321ac1b98814edddd6bd103a696b | 2,803 | py | Python | nmma/em/create_injection_slurm.py | DavidIbarr/nmma | 109fdd57add52cfea3553df8346981d6a117a7e7 | [
"MIT"
] | 1 | 2022-02-12T18:06:50.000Z | 2022-02-12T18:06:50.000Z | nmma/em/create_injection_slurm.py | DavidIbarr/nmma | 109fdd57add52cfea3553df8346981d6a117a7e7 | [
"MIT"
] | 10 | 2022-02-08T18:18:22.000Z | 2022-03-10T13:11:03.000Z | nmma/em/create_injection_slurm.py | DavidIbarr/nmma | 109fdd57add52cfea3553df8346981d6a117a7e7 | [
"MIT"
] | 12 | 2022-02-07T21:15:16.000Z | 2022-03-31T18:26:06.000Z | import os
import argparse
import json
import pandas as pd
import bilby
from bilby_pipe.create_injections import InjectionCreator
def main():
parser = argparse.ArgumentParser(description="Slurm files from nmma injection file")
parser.add_argument(
"--prior-file",
type=str,
required=True,
help="The prior file from which to generate injections",
)
parser.add_argument(
"--injection-file",
type=str,
required=True,
help="The bilby injection json file to be used",
)
parser.add_argument(
"--analysis-file",
type=str,
required=True,
help="The analysis bash script to be replicated",
)
parser.add_argument("-o", "--outdir", type=str, default="outdir")
args = parser.parse_args()
# load the injection json file
if args.injection_file:
if args.injection_file.endswith(".json"):
with open(args.injection_file, "rb") as f:
injection_data = json.load(f)
datadict = injection_data["injections"]["content"]
dataframe_from_inj = pd.DataFrame.from_dict(datadict)
else:
print("Only json supported.")
exit(1)
if len(dataframe_from_inj) > 0:
args.n_injection = len(dataframe_from_inj)
# create the injection dataframe from the prior_file
injection_creator = InjectionCreator(
prior_file=args.prior_file,
prior_dict=None,
n_injection=args.n_injection,
default_prior="PriorDict",
gps_file=None,
trigger_time=0,
generation_seed=0,
)
dataframe_from_prior = injection_creator.get_injection_dataframe()
# combine the dataframes
dataframe = pd.DataFrame.merge(
dataframe_from_inj,
dataframe_from_prior,
how="outer",
left_index=True,
right_index=True,
)
for index, row in dataframe.iterrows():
with open(args.analysis_file, "r") as file:
analysis = file.read()
outdir = os.path.join(args.outdir, str(index))
if not os.path.isdir(outdir):
os.makedirs(outdir)
priors = bilby.gw.prior.PriorDict(args.prior_file)
priors.to_file(outdir, label="injection")
priorfile = os.path.join(outdir, "injection.prior")
injfile = os.path.join(outdir, "lc.csv")
analysis = analysis.replace("PRIOR", priorfile)
analysis = analysis.replace("OUTDIR", outdir)
analysis = analysis.replace("INJOUT", injfile)
analysis = analysis.replace("INJNUM", str(index))
analysis_file = os.path.join(outdir, "inference.sh")
fid = open(analysis_file, "w")
fid.write(analysis)
fid.close()
if __name__ == "__main__":
main()
| 29.505263 | 88 | 0.625401 | import os
import argparse
import json
import pandas as pd
import bilby
from bilby_pipe.create_injections import InjectionCreator
def main():
parser = argparse.ArgumentParser(description="Slurm files from nmma injection file")
parser.add_argument(
"--prior-file",
type=str,
required=True,
help="The prior file from which to generate injections",
)
parser.add_argument(
"--injection-file",
type=str,
required=True,
help="The bilby injection json file to be used",
)
parser.add_argument(
"--analysis-file",
type=str,
required=True,
help="The analysis bash script to be replicated",
)
parser.add_argument("-o", "--outdir", type=str, default="outdir")
args = parser.parse_args()
if args.injection_file:
if args.injection_file.endswith(".json"):
with open(args.injection_file, "rb") as f:
injection_data = json.load(f)
datadict = injection_data["injections"]["content"]
dataframe_from_inj = pd.DataFrame.from_dict(datadict)
else:
print("Only json supported.")
exit(1)
if len(dataframe_from_inj) > 0:
args.n_injection = len(dataframe_from_inj)
injection_creator = InjectionCreator(
prior_file=args.prior_file,
prior_dict=None,
n_injection=args.n_injection,
default_prior="PriorDict",
gps_file=None,
trigger_time=0,
generation_seed=0,
)
dataframe_from_prior = injection_creator.get_injection_dataframe()
dataframe = pd.DataFrame.merge(
dataframe_from_inj,
dataframe_from_prior,
how="outer",
left_index=True,
right_index=True,
)
for index, row in dataframe.iterrows():
with open(args.analysis_file, "r") as file:
analysis = file.read()
outdir = os.path.join(args.outdir, str(index))
if not os.path.isdir(outdir):
os.makedirs(outdir)
priors = bilby.gw.prior.PriorDict(args.prior_file)
priors.to_file(outdir, label="injection")
priorfile = os.path.join(outdir, "injection.prior")
injfile = os.path.join(outdir, "lc.csv")
analysis = analysis.replace("PRIOR", priorfile)
analysis = analysis.replace("OUTDIR", outdir)
analysis = analysis.replace("INJOUT", injfile)
analysis = analysis.replace("INJNUM", str(index))
analysis_file = os.path.join(outdir, "inference.sh")
fid = open(analysis_file, "w")
fid.write(analysis)
fid.close()
if __name__ == "__main__":
main()
| true | true |
f702b0d886a22f71a467ec815515b251b1e19d71 | 3,125 | py | Python | testing/test_cases/object_formatting_test_cases.py | roym899/flake8-annotations | 8b28fe6d3d00fc601d0f6e151588056d231a2186 | [
"MIT"
] | 42 | 2020-09-02T22:45:19.000Z | 2022-03-23T20:09:20.000Z | testing/test_cases/object_formatting_test_cases.py | roym899/flake8-annotations | 8b28fe6d3d00fc601d0f6e151588056d231a2186 | [
"MIT"
] | 23 | 2020-09-03T12:17:49.000Z | 2022-03-31T15:07:45.000Z | testing/test_cases/object_formatting_test_cases.py | roym899/flake8-annotations | 8b28fe6d3d00fc601d0f6e151588056d231a2186 | [
"MIT"
] | 4 | 2021-03-30T13:40:52.000Z | 2022-02-14T14:19:51.000Z | from functools import partial
from typing import NamedTuple, Union
from flake8_annotations import Argument, Function
from flake8_annotations.enums import AnnotationType
class FormatTestCase(NamedTuple):
"""Named tuple for representing our test cases."""
test_object: Union[Argument, Function]
str_output: str
repr_output: str
# Define partial functions to simplify object creation
arg = partial(Argument, lineno=0, col_offset=0, annotation_type=AnnotationType.ARGS)
func = partial(Function, name="test_func", lineno=0, col_offset=0, decorator_list=[])
formatting_test_cases = {
"arg": FormatTestCase(
test_object=arg(argname="test_arg"),
str_output="<Argument: test_arg, Annotated: False>",
repr_output=(
"Argument("
"argname='test_arg', "
"lineno=0, "
"col_offset=0, "
"annotation_type=AnnotationType.ARGS, "
"has_type_annotation=False, "
"has_3107_annotation=False, "
"has_type_comment=False"
")"
),
),
"func_no_args": FormatTestCase(
test_object=func(args=[arg(argname="return")]),
str_output="<Function: test_func, Args: [<Argument: return, Annotated: False>]>",
repr_output=(
"Function("
"name='test_func', "
"lineno=0, "
"col_offset=0, "
"function_type=FunctionType.PUBLIC, "
"is_class_method=False, "
"class_decorator_type=None, "
"is_return_annotated=False, "
"has_type_comment=False, "
"has_only_none_returns=True, "
"is_nested=False, "
"decorator_list=[], "
"args=[Argument(argname='return', lineno=0, col_offset=0, annotation_type=AnnotationType.ARGS, " # noqa: E501
"has_type_annotation=False, has_3107_annotation=False, has_type_comment=False)]"
")"
),
),
"func_has_arg": FormatTestCase(
test_object=func(args=[arg(argname="foo"), arg(argname="return")]),
str_output="<Function: test_func, Args: [<Argument: foo, Annotated: False>, <Argument: return, Annotated: False>]>", # noqa: E501
repr_output=(
"Function("
"name='test_func', "
"lineno=0, "
"col_offset=0, "
"function_type=FunctionType.PUBLIC, "
"is_class_method=False, "
"class_decorator_type=None, "
"is_return_annotated=False, "
"has_type_comment=False, "
"has_only_none_returns=True, "
"is_nested=False, "
"decorator_list=[], "
"args=[Argument(argname='foo', lineno=0, col_offset=0, annotation_type=AnnotationType.ARGS, " # noqa: E501
"has_type_annotation=False, has_3107_annotation=False, has_type_comment=False), "
"Argument(argname='return', lineno=0, col_offset=0, annotation_type=AnnotationType.ARGS, " # noqa: E501
"has_type_annotation=False, has_3107_annotation=False, has_type_comment=False)]"
")"
),
),
}
| 38.580247 | 138 | 0.60704 | from functools import partial
from typing import NamedTuple, Union
from flake8_annotations import Argument, Function
from flake8_annotations.enums import AnnotationType
class FormatTestCase(NamedTuple):
test_object: Union[Argument, Function]
str_output: str
repr_output: str
arg = partial(Argument, lineno=0, col_offset=0, annotation_type=AnnotationType.ARGS)
func = partial(Function, name="test_func", lineno=0, col_offset=0, decorator_list=[])
formatting_test_cases = {
"arg": FormatTestCase(
test_object=arg(argname="test_arg"),
str_output="<Argument: test_arg, Annotated: False>",
repr_output=(
"Argument("
"argname='test_arg', "
"lineno=0, "
"col_offset=0, "
"annotation_type=AnnotationType.ARGS, "
"has_type_annotation=False, "
"has_3107_annotation=False, "
"has_type_comment=False"
")"
),
),
"func_no_args": FormatTestCase(
test_object=func(args=[arg(argname="return")]),
str_output="<Function: test_func, Args: [<Argument: return, Annotated: False>]>",
repr_output=(
"Function("
"name='test_func', "
"lineno=0, "
"col_offset=0, "
"function_type=FunctionType.PUBLIC, "
"is_class_method=False, "
"class_decorator_type=None, "
"is_return_annotated=False, "
"has_type_comment=False, "
"has_only_none_returns=True, "
"is_nested=False, "
"decorator_list=[], "
"args=[Argument(argname='return', lineno=0, col_offset=0, annotation_type=AnnotationType.ARGS, "
"has_type_annotation=False, has_3107_annotation=False, has_type_comment=False)]"
")"
),
),
"func_has_arg": FormatTestCase(
test_object=func(args=[arg(argname="foo"), arg(argname="return")]),
str_output="<Function: test_func, Args: [<Argument: foo, Annotated: False>, <Argument: return, Annotated: False>]>",
repr_output=(
"Function("
"name='test_func', "
"lineno=0, "
"col_offset=0, "
"function_type=FunctionType.PUBLIC, "
"is_class_method=False, "
"class_decorator_type=None, "
"is_return_annotated=False, "
"has_type_comment=False, "
"has_only_none_returns=True, "
"is_nested=False, "
"decorator_list=[], "
"args=[Argument(argname='foo', lineno=0, col_offset=0, annotation_type=AnnotationType.ARGS, "
"has_type_annotation=False, has_3107_annotation=False, has_type_comment=False), "
"Argument(argname='return', lineno=0, col_offset=0, annotation_type=AnnotationType.ARGS, "
"has_type_annotation=False, has_3107_annotation=False, has_type_comment=False)]"
")"
),
),
}
| true | true |
f702b11bd8a930c1afc521fe51421d52dde23c1f | 1,650 | py | Python | demos/matdb/demo_srim_compounddb_to_suzu.py | takaakiaoki/suzu | 431975a5345d9683f0a9453275764693e9e2064e | [
"MIT"
] | 6 | 2018-05-05T10:13:11.000Z | 2021-06-21T02:11:44.000Z | demos/matdb/demo_srim_compounddb_to_suzu.py | takaakiaoki/suzu | 431975a5345d9683f0a9453275764693e9e2064e | [
"MIT"
] | null | null | null | demos/matdb/demo_srim_compounddb_to_suzu.py | takaakiaoki/suzu | 431975a5345d9683f0a9453275764693e9e2064e | [
"MIT"
] | 5 | 2018-05-05T10:13:56.000Z | 2020-06-15T14:32:45.000Z | # coding: utf-8
import sys
import os
sys.path.insert(0, os.path.join(os.path.dirname(__file__),'../..'))
import suzu.matdb.srim_compounddb as compounddb
air = compounddb.Compound()
air.desc = 'Air, Dry near sea level (ICRU-104) 0.00120484 O-23.2, N-75.5, Ar-1.3'
air.name = '%Air, Dry (ICRU-104)'
air.density = 0.00120484
air.mass_percentage = True
air.elems = [(6, 0.000124), (8, 0.231781), (7, 0.755267), (18, 0.012827)]
air.bonding = [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0]
air.comment = """corrected by H. Paul, Sept. 2004
"""
air.fulltext = """*Air, Dry near sea level (ICRU-104) 0.00120484 O-23.2, N-75.5, Ar-1.3
"%Air, Dry (ICRU-104)", .00120484, 4, 6, .000124, 8, .231781, 7, .755267, 18, .012827
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
$ corrected by H. Paul, Sept. 2004
$"""
water = compounddb.Compound()
water.desc = 'Water (liquid) 1.00 H-2, O-1'
water.name = 'Water_Liquid (ICRU-276)'
water.density = 1.0
water.mass_percentage = False
water.elems = [(1, 2.0), (8, 1.0)]
water.bonding = [0.0, 0.0, 0.0, 2.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0]
water.comment = b"""Chemical Formula: H \u00c4\u00c4 O \u00c4\u00c4 H
There is about an 8% increase in the peak of the stopping power
for ions in water vapour relative to the liquid. (The peak of the
stopping occurs at an energy of about 100 keV/amu times the 2/3
power of the ion's atomic number.) Above the peak the phase
difference begins to disappear. This calculation is for the
LIQUID phase. """.decode('cp437')
print(water.to_suzu())
print(air.to_suzu())
| 37.5 | 106 | 0.638182 |
import sys
import os
sys.path.insert(0, os.path.join(os.path.dirname(__file__),'../..'))
import suzu.matdb.srim_compounddb as compounddb
air = compounddb.Compound()
air.desc = 'Air, Dry near sea level (ICRU-104) 0.00120484 O-23.2, N-75.5, Ar-1.3'
air.name = '%Air, Dry (ICRU-104)'
air.density = 0.00120484
air.mass_percentage = True
air.elems = [(6, 0.000124), (8, 0.231781), (7, 0.755267), (18, 0.012827)]
air.bonding = [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0]
air.comment = """corrected by H. Paul, Sept. 2004
"""
air.fulltext = """*Air, Dry near sea level (ICRU-104) 0.00120484 O-23.2, N-75.5, Ar-1.3
"%Air, Dry (ICRU-104)", .00120484, 4, 6, .000124, 8, .231781, 7, .755267, 18, .012827
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
$ corrected by H. Paul, Sept. 2004
$"""
water = compounddb.Compound()
water.desc = 'Water (liquid) 1.00 H-2, O-1'
water.name = 'Water_Liquid (ICRU-276)'
water.density = 1.0
water.mass_percentage = False
water.elems = [(1, 2.0), (8, 1.0)]
water.bonding = [0.0, 0.0, 0.0, 2.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0]
water.comment = b"""Chemical Formula: H \u00c4\u00c4 O \u00c4\u00c4 H
There is about an 8% increase in the peak of the stopping power
for ions in water vapour relative to the liquid. (The peak of the
stopping occurs at an energy of about 100 keV/amu times the 2/3
power of the ion's atomic number.) Above the peak the phase
difference begins to disappear. This calculation is for the
LIQUID phase. """.decode('cp437')
print(water.to_suzu())
print(air.to_suzu())
| true | true |
f702b1385043c102875d88217ec2b9871be5ba26 | 3,885 | py | Python | tool/metric.py | dkswxd/unetpp_pytorch_qiu | df439b07d13c5d8c87975f0cca4dd7a5ff19f8c2 | [
"Apache-2.0"
] | 1 | 2022-01-13T07:11:18.000Z | 2022-01-13T07:11:18.000Z | code/utils/metric.py | DKJJ/SSL4MIS | 7f139d0c71110052399f0a93b55a39ba85897561 | [
"MIT"
] | null | null | null | code/utils/metric.py | DKJJ/SSL4MIS | 7f139d0c71110052399f0a93b55a39ba85897561 | [
"MIT"
] | null | null | null | import numpy as np
from sklearn import metrics
from PIL import Image
def get_metrics(pred, logits, gt):
if isinstance(logits, list):
logits = logits[-1]
result = {'confusion_matrix': metrics.confusion_matrix(gt.flatten(), pred.flatten(), labels=[1, 0]),
'auc': roc(gt, logits)}
return result
def get_metrics_without_roc(pred, gt):
result = {'confusion_matrix': metrics.confusion_matrix(gt.flatten(), pred.flatten(), labels=[1, 0])}
return result
def show_metrics(metrics):
con_mat = np.zeros((2,2))
auc = 0.0
for m in metrics:
con_mat += m['confusion_matrix']
auc += m['auc']
auc /= len(metrics)
result = {'confusion_matrix': con_mat.tolist(),
'accuracy': accuracy(con_mat),
'kappa': kappa(con_mat),
'precision': precision(con_mat),
'sensitivity': sensitivity(con_mat),
'specificity': specificity(con_mat),
'auc': auc,
}
return result
def show_metrics_without_roc(metrics):
con_mat = np.zeros((2,2))
for m in metrics:
con_mat += m['confusion_matrix']
result = {'confusion_matrix': con_mat,
'accuracy': accuracy(con_mat),
'kappa': kappa(con_mat),
'precision': precision(con_mat),
'sensitivity': sensitivity(con_mat),
'specificity': specificity(con_mat),
}
return result
def show_metrics_from_save_image(data):
pred = data[:,:,0] // 255
gt = data[:,:,1] // 255
metrics = [get_metrics_without_roc(pred, gt)]
return show_metrics_without_roc(metrics)
def kappa(matrix):
matrix = np.array(matrix)
n = np.sum(matrix)
sum_po = 0
sum_pe = 0
for i in range(len(matrix[0])):
sum_po += matrix[i][i]
row = np.sum(matrix[i, :])
col = np.sum(matrix[:, i])
sum_pe += row * col
po = sum_po / n
pe = sum_pe / (n * n)
# print(po, pe)
return (po - pe) / (1 - pe)
def sensitivity(matrix):
return matrix[0][0]/(matrix[0][0]+matrix[1][0])
def specificity(matrix):
return matrix[1][1]/(matrix[1][1]+matrix[0][1])
def precision(matrix):
return matrix[0][0]/(matrix[0][0]+matrix[0][1])
def roc(gt, logits):
gtlist = gt.flatten()
predlist = logits.detach().cpu().numpy()[0, 1, ...].flatten()
fpr, tpr, thresholds = metrics.roc_curve(gtlist, predlist, pos_label=1)
roc_auc = metrics.auc(fpr, tpr) # auc为Roc曲线下的面积
return roc_auc
def accuracy(matrix):
return (matrix[0][0]+matrix[1][1])/(matrix[0][0]+matrix[0][1]+matrix[1][0]+matrix[1][1])
def error_rate(predictions, labels):
"""
Return the error rate based on dense predictions and 1-hot labels.
"""
return 100.0 - (
100.0 *
np.sum(np.argmin(predictions, 3) == np.argmin(labels, 3)) /
(predictions.shape[0] * predictions.shape[1] * predictions.shape[2]))
def save_predict(filename, data, gt, pred):
pred = pred * 255
gt = gt[0, 1, :, :]
gt = np.where(gt > 0.5, 255, 0)
differ = np.stack([np.zeros_like(pred), gt, pred], -1)
pred = np.stack([pred, pred, pred], -1)
gt = np.stack([gt, gt, gt], -1)
data = np.transpose(data, (0, 2, 3, 1))[0,...]
if data.shape[2] == 60:
data = data[:, :, 10:40:10]
elif data.shape[2] == 1:
data = np.concatenate([data, data, data], -1)
elif data.shape[2] == 15:
data = data[:, :, 0:15:5]
data -= np.min(data, axis=(0,1))
data /= (np.max(data, axis=(0,1))/255)
data = data.astype(np.uint8)
img = Image.fromarray(np.concatenate([data, pred, gt, differ], axis=1).astype(np.uint8))
img.save(filename)
def save_logits(filename, pred):
pred = pred * 255
pred = np.stack([pred, pred, pred], -1)
img = Image.fromarray(pred.astype(np.uint8))
img.save(filename)
| 31.08 | 104 | 0.583269 | import numpy as np
from sklearn import metrics
from PIL import Image
def get_metrics(pred, logits, gt):
if isinstance(logits, list):
logits = logits[-1]
result = {'confusion_matrix': metrics.confusion_matrix(gt.flatten(), pred.flatten(), labels=[1, 0]),
'auc': roc(gt, logits)}
return result
def get_metrics_without_roc(pred, gt):
result = {'confusion_matrix': metrics.confusion_matrix(gt.flatten(), pred.flatten(), labels=[1, 0])}
return result
def show_metrics(metrics):
con_mat = np.zeros((2,2))
auc = 0.0
for m in metrics:
con_mat += m['confusion_matrix']
auc += m['auc']
auc /= len(metrics)
result = {'confusion_matrix': con_mat.tolist(),
'accuracy': accuracy(con_mat),
'kappa': kappa(con_mat),
'precision': precision(con_mat),
'sensitivity': sensitivity(con_mat),
'specificity': specificity(con_mat),
'auc': auc,
}
return result
def show_metrics_without_roc(metrics):
con_mat = np.zeros((2,2))
for m in metrics:
con_mat += m['confusion_matrix']
result = {'confusion_matrix': con_mat,
'accuracy': accuracy(con_mat),
'kappa': kappa(con_mat),
'precision': precision(con_mat),
'sensitivity': sensitivity(con_mat),
'specificity': specificity(con_mat),
}
return result
def show_metrics_from_save_image(data):
pred = data[:,:,0] // 255
gt = data[:,:,1] // 255
metrics = [get_metrics_without_roc(pred, gt)]
return show_metrics_without_roc(metrics)
def kappa(matrix):
matrix = np.array(matrix)
n = np.sum(matrix)
sum_po = 0
sum_pe = 0
for i in range(len(matrix[0])):
sum_po += matrix[i][i]
row = np.sum(matrix[i, :])
col = np.sum(matrix[:, i])
sum_pe += row * col
po = sum_po / n
pe = sum_pe / (n * n)
return (po - pe) / (1 - pe)
def sensitivity(matrix):
return matrix[0][0]/(matrix[0][0]+matrix[1][0])
def specificity(matrix):
return matrix[1][1]/(matrix[1][1]+matrix[0][1])
def precision(matrix):
return matrix[0][0]/(matrix[0][0]+matrix[0][1])
def roc(gt, logits):
gtlist = gt.flatten()
predlist = logits.detach().cpu().numpy()[0, 1, ...].flatten()
fpr, tpr, thresholds = metrics.roc_curve(gtlist, predlist, pos_label=1)
roc_auc = metrics.auc(fpr, tpr)
return roc_auc
def accuracy(matrix):
return (matrix[0][0]+matrix[1][1])/(matrix[0][0]+matrix[0][1]+matrix[1][0]+matrix[1][1])
def error_rate(predictions, labels):
return 100.0 - (
100.0 *
np.sum(np.argmin(predictions, 3) == np.argmin(labels, 3)) /
(predictions.shape[0] * predictions.shape[1] * predictions.shape[2]))
def save_predict(filename, data, gt, pred):
pred = pred * 255
gt = gt[0, 1, :, :]
gt = np.where(gt > 0.5, 255, 0)
differ = np.stack([np.zeros_like(pred), gt, pred], -1)
pred = np.stack([pred, pred, pred], -1)
gt = np.stack([gt, gt, gt], -1)
data = np.transpose(data, (0, 2, 3, 1))[0,...]
if data.shape[2] == 60:
data = data[:, :, 10:40:10]
elif data.shape[2] == 1:
data = np.concatenate([data, data, data], -1)
elif data.shape[2] == 15:
data = data[:, :, 0:15:5]
data -= np.min(data, axis=(0,1))
data /= (np.max(data, axis=(0,1))/255)
data = data.astype(np.uint8)
img = Image.fromarray(np.concatenate([data, pred, gt, differ], axis=1).astype(np.uint8))
img.save(filename)
def save_logits(filename, pred):
pred = pred * 255
pred = np.stack([pred, pred, pred], -1)
img = Image.fromarray(pred.astype(np.uint8))
img.save(filename)
| true | true |
f702b1cdf62d8a65d17e50a4ab858928e5956b21 | 2,601 | py | Python | tests/GAPDemo_cor_002/run.py | sagscmi/GAPDemo2019 | 37ca1a9587a029194469cb084d309ccc2ea4be43 | [
"Apache-2.0"
] | null | null | null | tests/GAPDemo_cor_002/run.py | sagscmi/GAPDemo2019 | 37ca1a9587a029194469cb084d309ccc2ea4be43 | [
"Apache-2.0"
] | null | null | null | tests/GAPDemo_cor_002/run.py | sagscmi/GAPDemo2019 | 37ca1a9587a029194469cb084d309ccc2ea4be43 | [
"Apache-2.0"
] | null | null | null | from pysys.constants import *
from apama.basetest import ApamaBaseTest
from apama.correlator import CorrelatorHelper
from GAPDemoConnected import GAPDemoConnectedHelper
class PySysTest(ApamaBaseTest):
def __init__(self, descriptor, outsubdir, runner):
super(PySysTest, self).__init__(descriptor, outsubdir, runner)
self.helper = GAPDemoConnectedHelper(self, PROJECT)
def execute(self):
# Start application
correlator = self.helper.startApplication()
# Find a phone device
(phoneId, phoneName) = self.helper.getDeviceDetails()
self.log.info(f'Found c8y_SensorPhone device with name "{phoneName}" and id "{phoneId}"')
# Wait for application to subscribe to measurements from the phone
self.helper.waitForSubscription()
# Set baseline acceleration
self.helper.sendAcceleration(phoneId, 0.0, 0.0, 1.23)
# Wait for all events to be processed
self.helper.waitForBaseline()
# Get current active alarm counts
flipUpBefore = self.helper.countActiveAlarms("FlipUp")
self.log.info(f'Found {flipUpBefore} active "FlipUp" alarms before sending measurements')
flipDownBefore = self.helper.countActiveAlarms("FlipDown")
self.log.info(f'Found {flipDownBefore} active "FlipDown" alarms before sending measurements')
# Send acceleration measurements
self.log.info('Sending measurements...')
self.helper.sendAcceleration(phoneId, 0.0, 0.0, -0.9) # Up
self.helper.sendAcceleration(phoneId, 0.0, 0.0, 0.9) # Down
self.helper.sendAcceleration(phoneId, 0.0, 0.0, 0.4)
self.helper.sendAcceleration(phoneId, 0.0, 0.0, 0.0)
self.helper.sendAcceleration(phoneId, 0.0, 0.0, -0.4)
self.helper.sendAcceleration(phoneId, 0.0, 0.0, -0.9) # Up
self.helper.sendAcceleration(phoneId, 0.0, 0.0, 0.8)
self.helper.sendAcceleration(phoneId, 0.0, 0.0, 0.9)
self.helper.sendAcceleration(phoneId, 0.0, 0.0, 0.85) # Down
# wait for all events to be processed
self.helper.waitForMeasurements()
# Get latest active alarm counts and calculate delta
flipUpAfter = self.helper.countActiveAlarms("FlipUp")
self.log.info(f'Found {flipUpAfter} active "FlipUp" alarms after sending measurements')
flipDownAfter = self.helper.countActiveAlarms("FlipDown")
self.log.info(f'Found {flipDownAfter} active "FlipDown" alarms after sending measurements')
self.flipUpDelta = flipUpAfter - flipUpBefore
self.flipDownDelta = flipDownAfter - flipDownBefore
def validate(self):
self.assertEval("self.flipUpDelta=={expected}", expected=2)
self.assertEval("self.flipDownDelta=={expected}", expected=2)
| 42.639344 | 96 | 0.738562 | from pysys.constants import *
from apama.basetest import ApamaBaseTest
from apama.correlator import CorrelatorHelper
from GAPDemoConnected import GAPDemoConnectedHelper
class PySysTest(ApamaBaseTest):
def __init__(self, descriptor, outsubdir, runner):
super(PySysTest, self).__init__(descriptor, outsubdir, runner)
self.helper = GAPDemoConnectedHelper(self, PROJECT)
def execute(self):
correlator = self.helper.startApplication()
(phoneId, phoneName) = self.helper.getDeviceDetails()
self.log.info(f'Found c8y_SensorPhone device with name "{phoneName}" and id "{phoneId}"')
self.helper.waitForSubscription()
self.helper.sendAcceleration(phoneId, 0.0, 0.0, 1.23)
self.helper.waitForBaseline()
flipUpBefore = self.helper.countActiveAlarms("FlipUp")
self.log.info(f'Found {flipUpBefore} active "FlipUp" alarms before sending measurements')
flipDownBefore = self.helper.countActiveAlarms("FlipDown")
self.log.info(f'Found {flipDownBefore} active "FlipDown" alarms before sending measurements')
self.log.info('Sending measurements...')
self.helper.sendAcceleration(phoneId, 0.0, 0.0, -0.9)
self.helper.sendAcceleration(phoneId, 0.0, 0.0, 0.9)
self.helper.sendAcceleration(phoneId, 0.0, 0.0, 0.4)
self.helper.sendAcceleration(phoneId, 0.0, 0.0, 0.0)
self.helper.sendAcceleration(phoneId, 0.0, 0.0, -0.4)
self.helper.sendAcceleration(phoneId, 0.0, 0.0, -0.9)
self.helper.sendAcceleration(phoneId, 0.0, 0.0, 0.8)
self.helper.sendAcceleration(phoneId, 0.0, 0.0, 0.9)
self.helper.sendAcceleration(phoneId, 0.0, 0.0, 0.85)
self.helper.waitForMeasurements()
flipUpAfter = self.helper.countActiveAlarms("FlipUp")
self.log.info(f'Found {flipUpAfter} active "FlipUp" alarms after sending measurements')
flipDownAfter = self.helper.countActiveAlarms("FlipDown")
self.log.info(f'Found {flipDownAfter} active "FlipDown" alarms after sending measurements')
self.flipUpDelta = flipUpAfter - flipUpBefore
self.flipDownDelta = flipDownAfter - flipDownBefore
def validate(self):
self.assertEval("self.flipUpDelta=={expected}", expected=2)
self.assertEval("self.flipDownDelta=={expected}", expected=2)
| true | true |
f702b3026db98722fecc5c517e03dac41d42da66 | 802 | py | Python | youtubesearch/urls.py | shankarj67/Django-youtubesearch | 7a96592fa9c65ab44cce8724b0872675467a0863 | [
"MIT"
] | null | null | null | youtubesearch/urls.py | shankarj67/Django-youtubesearch | 7a96592fa9c65ab44cce8724b0872675467a0863 | [
"MIT"
] | 6 | 2020-06-05T20:50:34.000Z | 2021-06-10T18:27:49.000Z | youtubesearch/urls.py | shankarj67/Django-youtubesearch | 7a96592fa9c65ab44cce8724b0872675467a0863 | [
"MIT"
] | null | null | null | """youtubesearch URL Configuration
The `urlpatterns` list routes URLs to views. For more information please see:
https://docs.djangoproject.com/en/3.0/topics/http/urls/
Examples:
Function views
1. Add an import: from my_app import views
2. Add a URL to urlpatterns: path('', views.home, name='home')
Class-based views
1. Add an import: from other_app.views import Home
2. Add a URL to urlpatterns: path('', Home.as_view(), name='home')
Including another URLconf
1. Import the include() function: from django.urls import include, path
2. Add a URL to urlpatterns: path('blog/', include('blog.urls'))
"""
from django.contrib import admin
from django.urls import path, include
urlpatterns = [
path('admin/', admin.site.urls),
path('', include('search.urls')),
]
| 34.869565 | 77 | 0.704489 | from django.contrib import admin
from django.urls import path, include
urlpatterns = [
path('admin/', admin.site.urls),
path('', include('search.urls')),
]
| true | true |
f702b307d609b7a41be38ee79231f650669a6ccf | 90,700 | py | Python | selfdrive/car/hyundai/values.py | yayiblue/op_v0814_crwusiz | 8c047a54cd950af875239eefc80f3558693cb4f8 | [
"MIT"
] | null | null | null | selfdrive/car/hyundai/values.py | yayiblue/op_v0814_crwusiz | 8c047a54cd950af875239eefc80f3558693cb4f8 | [
"MIT"
] | null | null | null | selfdrive/car/hyundai/values.py | yayiblue/op_v0814_crwusiz | 8c047a54cd950af875239eefc80f3558693cb4f8 | [
"MIT"
] | null | null | null | from cereal import car
from selfdrive.car import dbc_dict
Ecu = car.CarParams.Ecu
class CarControllerParams:
ACCEL_MAX = 2.0
ACCEL_MIN = -3.7
STEER_MAX = 384 # 409 is the max, 255 is stock
STEER_DELTA_UP = 3
STEER_DELTA_DOWN = 7
STEER_DRIVER_ALLOWANCE = 50
STEER_DRIVER_MULTIPLIER = 2
STEER_DRIVER_FACTOR = 1
class CAR:
# Hyundai
ELANTRA_I30 = "HYUNDAI AVANTE,I30 2017~2020 (AD,PD)"
ELANTRA21 = "HYUNDAI AVANTE 2021 (CN7)"
ELANTRA21_HEV = "HYUNDAI AVANTE HEV 2021 (CN7)"
SONATA = "HYUNDAI SONATA 2020 (DN8)"
SONATA_HEV = "HYUNDAI SONATA HEV 2020 (DN8)"
SONATA_LF = "HYUNDAI SONATA 2016~2019 (LF)"
SONATA_LF_HEV = "HYUNDAI SONATA 2018 HEV (LF)"
KONA = "HYUNDAI KONA 2019 (OS)"
KONA_EV = "HYUNDAI KONA EV 2019 (OS)"
KONA_HEV = "HYUNDAI KONA HEV 2019 (OS)"
IONIQ_EV = "HYUNDAI IONIQ EV 2019~2020 (AE)"
IONIQ_HEV = "HYUNDAI IONIQ HEV 2017 (AE)"
SANTA_FE = "HYUNDAI SANTA FE 2019~2021 (TM)"
SANTA_FE_HEV = "HYUNDAI SANTA FE 2021~2022 (TM)"
PALISADE = "HYUNDAI PALISADE 2020 (LX2)"
VELOSTER = "HYUNDAI VELOSTER 2019 (JS)"
GRANDEUR = "GRANDEUR 2017~2019 (IG)"
GRANDEUR_HEV = "GRANDEUR HEV 2018~2019 (IG)"
GRANDEUR20 = "GRANDEUR 2020 (IG)"
GRANDEUR20_HEV = "GRANDEUR HEV 2020 (IG)"
NEXO = "HYUNDAI NEXO (FE)"
# Kia
FORTE = "KIA K3 2018 (BD)"
K5 = "KIA K5 2016~2020 (JF)"
K5_HEV = "KIA K5 HEV 2016~2020 (JF)"
K5_DL3 = "KIA K5 2021 (DL3)"
K5_DL3_HEV = "KIA K5 HEV 2021 (DL3)"
K7 = "KIA K7 2016-2019 (YG)"
K7_HEV = "KIA K7 HEV 2017-2019 (YG)"
K9 = "KIA K9 2019-2021 (RJ)"
SPORTAGE = "KIA SPORTAGE 2016~2020 (QL)"
SORENTO = "KIA SORENTO 2017~2020 (UM)"
MOHAVE = "KIA MOHAVE 2020 (HM)"
STINGER = "KIA STINGER 2018~2021 (CK)"
NIRO_EV = "KIA NIRO EV 2020 (DE)"
NIRO_HEV = "KIA NIRO HEV 2018 (DE)"
SOUL_EV = "KIA SOUL EV 2019 (SK3)"
SELTOS = "KIA SELTOS 2019 (SP2)"
# Genesis
GENESIS = "GENESIS 2014-2016 (DH)"
GENESIS_G70 = "GENESIS G70 2018~ (IK)"
GENESIS_G80 = "GENESIS G80 2018~ (DH)"
GENESIS_G90 = "GENESIS G90,EQ900 2016~2019 (HI)"
# ---------------------------------------------------------------------------------------
# E-CAN Signal CAR
# hyundai - G80 2020(RG3), GV70 2021(JK1), GV80 2020(JX1), TUSON 2021(NX4), STARIA 2021(UX4), IONIQ5 2021(NE)
# kia - CARNIVAL 2021(KA4), SORENTO 2020(MQ4), K8 2021(GL3)
# ---------------------------------------------------------------------------------------
class Buttons:
NONE = 0
RES_ACCEL = 1
SET_DECEL = 2
GAP_DIST = 3
CANCEL = 4
FINGERPRINTS = {
# Hyundai
CAR.ELANTRA_I30: [{
66: 8, 67: 8, 68: 8, 127: 8, 128: 8, 129: 8, 273: 8, 274: 8, 275: 8, 339: 8, 354: 3, 356: 4, 399: 8, 512: 6, 544: 8, 546: 8, 547: 8, 593: 8, 608: 8, 688: 5, 790: 8, 809: 8, 832: 8, 838: 8, 844: 8, 884: 8, 897: 8, 899: 8, 902: 8, 903: 8, 905: 8, 909: 8, 916: 8, 1040: 8, 1056: 8, 1057: 8, 1078: 4, 1087: 8, 1151: 6, 1155: 8, 1164: 8, 1168: 7, 1170: 8, 1191: 2, 1193: 8, 1253: 8, 1254: 8, 1255: 8, 1265: 4, 1280: 1, 1282: 4, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1314: 8, 1322: 8, 1331: 8, 1332: 8, 1342: 6, 1345: 8, 1348: 8, 1349: 8, 1351: 8, 1353: 8, 1356: 8, 1363: 8, 1365: 8, 1366: 8, 1367: 8, 1369: 8, 1407: 8, 1414: 3, 1415: 8, 1419: 8, 1425: 2, 1427: 6, 1440: 8, 1456: 4, 1470: 8, 1472: 8, 1485: 8, 1486: 8, 1487: 8, 1491: 8, 1530: 8, 1532: 5, 1792: 8, 1872: 8, 1937: 8, 1952: 8, 1953: 8, 1960: 8, 1968: 8, 1988: 8, 1990: 8, 1998: 8, 2000: 8, 2001: 8, 2003: 8, 2004: 8, 2005: 8, 2008: 8, 2009: 8, 2012: 8, 2013: 8, 2015: 8, 2016: 8, 2017: 8, 2024: 8, 2025: 8
}],
CAR.ELANTRA21: [{
67: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 524: 8, 544: 8, 593: 8, 608: 8, 688: 6, 809: 8, 832: 8, 854: 8, 865: 8, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 913: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1069: 8, 1078: 4, 1102: 8, 1107: 5, 1108: 8, 1136: 8, 1145: 8, 1151: 8, 1155: 8, 1156: 8, 1157: 4, 1162: 8, 1164: 8, 1168: 8, 1170: 8, 1173: 8, 1183: 8, 1186: 2, 1191: 2, 1193: 8, 1225: 8, 1227: 8, 1265: 4, 1268: 8, 1280: 8, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1339: 8, 1342: 8, 1343: 8, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1379: 8, 1384: 8, 1394: 8, 1407: 8, 1419: 8, 1427: 6, 1446: 8, 1456: 4, 1470: 8, 1485: 8, 1988: 8, 1996: 8, 2000: 8, 2004: 8, 2008: 8, 2012: 8
}],
CAR.ELANTRA21_HEV: [{
}],
CAR.SONATA: [{
67: 8, 68: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 544: 8, 545: 8, 546: 8, 547: 8, 548: 8, 549: 8, 550: 8, 576: 8, 593: 8, 608: 8, 688: 6, 809: 8, 832: 8, 854: 8, 865: 8, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 903: 8, 905: 8, 908: 8, 909: 8, 912: 7, 913: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1078: 4, 1089: 5, 1096: 8, 1107: 5, 1108: 8, 1114: 8, 1136: 8, 1145: 8, 1151: 8, 1155: 8, 1156: 8, 1157: 4, 1162: 8, 1164: 8, 1168: 8, 1170: 8, 1173: 8, 1180: 8, 1183: 8, 1184: 8, 1186: 2, 1191: 2, 1193: 8, 1210: 8, 1225: 8, 1227: 8, 1265: 4, 1268: 8, 1280: 8, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1330: 8, 1339: 8, 1342: 6, 1343: 8, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1371: 8, 1378: 8, 1379: 8, 1384: 8, 1394: 8, 1407: 8, 1419: 8, 1427: 6, 1446: 8, 1456: 4, 1460: 8, 1470: 8, 1485: 8, 1504: 3, 1988: 8, 1996: 8, 2000: 8, 2004: 8, 2008: 8, 2012: 8, 2015: 8
}],
CAR.SONATA_HEV: [{
127: 8, 304: 8, 320: 8, 339: 8, 352: 8, 356: 4, 544: 8, 546: 8, 548: 8, 576: 8, 593: 8, 688: 6, 757: 2, 832: 8, 865: 8, 881: 8, 882: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 913: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1078: 4, 1102: 8, 1108: 8, 1114: 8, 1136: 6, 1138: 5, 1151: 8, 1155: 8, 1156: 8, 1157: 4, 1162: 8, 1164: 8, 1168: 8, 1173: 8, 1180: 8, 1184: 8, 1186: 2, 1191: 2, 1193: 8, 1210: 8, 1225: 8, 1227: 8, 1265: 4, 1268: 8, 1280: 8, 1287: 4, 1290: 8, 1291: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1330: 8, 1339: 8, 1342: 6, 1343: 8, 1345: 8, 1348: 8, 1355: 8, 1363: 8, 1369: 8, 1371: 8, 1378: 8, 1407: 8, 1419: 8, 1427: 6, 1429: 8, 1430: 8, 1446: 8, 1448: 8, 1456: 4, 1460: 8, 1470: 8, 1476: 8, 1535: 8
}],
CAR.SONATA_LF: [{
66: 8, 67: 8, 68: 8, 127: 8, 273: 8, 274: 8, 275: 8, 339: 8, 356: 4, 399: 8, 447: 8, 512: 6, 544: 8, 593: 8, 608: 8, 688: 5, 790: 8, 809: 8, 832: 8, 884: 8, 897: 8, 899: 8, 902: 8, 903: 6, 916: 8, 1040: 8, 1056: 8, 1057: 8, 1078: 4, 1151: 6, 1168: 7, 1170: 8, 1253: 8, 1254: 8, 1255: 8, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1314: 8, 1322: 8, 1331: 8, 1332: 8, 1333: 8, 1342: 6, 1345: 8, 1348: 8, 1349: 8, 1351: 8, 1353: 8, 1363: 8, 1365: 8, 1366: 8, 1367: 8, 1369: 8, 1397: 8, 1407: 8, 1415: 8, 1419: 8, 1425: 2, 1427: 6, 1440: 8, 1456: 4, 1470: 8, 1472: 8, 1486: 8, 1487: 8, 1491: 8, 1530: 8, 1532: 5, 2000: 8, 2001: 8, 2004: 8, 2005: 8, 2008: 8, 2009: 8, 2012: 8, 2013: 8, 2014: 8, 2016: 8, 2017: 8, 2024: 8, 2025: 8
}],
CAR.SONATA_LF_HEV: [{
68: 8, 127: 8, 304: 8, 320: 8, 339: 8, 352: 8, 356: 4, 544: 7, 593: 8, 688: 5, 881: 8, 882: 8, 897: 8, 902: 8, 903: 6, 916: 8, 1040: 8, 1056: 8, 1057: 8, 1078: 4, 1136: 6, 1151: 6, 1168: 7, 1173: 8, 1186: 2, 1225: 8, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1291: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1331: 8, 1332: 8, 1333: 8, 1345: 8, 1348: 8, 1355: 8, 1363: 8, 1369: 8, 1407: 8, 1419: 8, 1425: 2, 1429: 8, 1430: 8, 1448: 8, 1456: 4, 1470: 8, 1476: 8, 1535: 8, 2000: 8, 2004: 8, 2005: 8, 2008: 8, 2012: 8, 2013: 8
}],
CAR.KONA: [{
67: 8, 127: 8, 304: 8, 320: 8, 339: 8, 354: 3, 356: 4, 544: 8, 593: 8, 608: 8, 688: 5, 809: 8, 832: 8, 854: 7, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 916: 8, 1040: 8, 1056: 8, 1057: 8, 1064: 8, 1078: 4, 1107: 5, 1136: 8, 1151: 6, 1156: 8, 1170: 8, 1173: 8, 1186: 2, 1191: 2, 1193: 8, 1265: 4,1280: 1, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1378: 8, 1384: 8, 1394: 8, 1407: 8, 1414: 3, 1419: 8, 1427: 6, 1456: 4, 1470: 8, 1988: 8, 1990: 8, 1996: 8, 1998: 8, 2000: 8, 2001: 8, 2004: 8, 2008: 8, 2009: 8, 2012: 8, 2015: 8
}],
CAR.KONA_EV: [{
127: 8, 304: 8, 320: 8, 339: 8, 352: 8, 356: 4, 544: 8, 549: 8, 593: 8, 688: 5, 832: 8, 881: 8, 882: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1078: 4, 1136: 8, 1151: 6, 1157: 4, 1168: 7, 1173: 8, 1183: 8, 1186: 2, 1191: 2, 1193: 8, 1225: 8, 1260: 8, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1291: 8, 1292: 8, 1294: 8, 1307: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1355: 8, 1363: 8, 1369: 8, 1378: 4, 1379: 8, 1407: 8, 1419: 8, 1426: 8, 1427: 6, 1429: 8, 1430: 8, 1456: 4, 1470: 8, 1473: 8, 1507: 8, 1535: 8, 1988: 8, 1996: 8, 2000: 8, 2004: 8, 2008: 8, 2012: 8, 2015: 8
}],
CAR.KONA_HEV: [{
68: 8, 127: 8, 304: 8, 320: 8, 339: 8, 352: 8, 356: 4, 544: 8, 546: 8, 547: 8, 548: 8, 549: 8, 576: 8, 593: 8, 688: 5, 832: 8, 881: 8, 882: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1078: 4, 1136: 6, 1138: 4, 1151: 6, 1155: 8, 1157: 4, 1164: 8, 1168: 7, 1173: 8, 1183: 8, 1186: 2, 1191: 2, 1193: 8, 1225: 8, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1291: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1355: 8, 1363: 8, 1369: 8, 1378: 8, 1379: 8, 1407: 8, 1419: 8, 1427: 6, 1429: 8, 1430: 8, 1448: 8, 1456: 4, 1470: 8, 1476: 8, 1535: 8
}],
CAR.IONIQ_EV: [{
127: 8, 304: 8, 320: 8, 339: 8, 352: 8, 356: 4, 524: 8, 544: 7, 546: 8, 593: 8, 688: 5, 832: 8, 881: 8, 882: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1078: 4, 1136: 8, 1151: 6, 1155: 8, 1156: 8, 1157: 4, 1164: 8, 1168: 7, 1173: 8, 1183: 8, 1186: 2, 1191: 2, 1225: 8, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1291: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1355: 8, 1363: 8, 1369: 8, 1379: 8, 1407: 8, 1419: 8, 1426: 8, 1427: 6, 1429: 8, 1430: 8, 1456: 4, 1470: 8, 1473: 8, 1507: 8, 1535: 8, 1988: 8, 1996: 8, 2000: 8, 2004: 8, 2005: 8, 2008: 8, 2012: 8, 2013: 8, 2015: 8
}],
CAR.IONIQ_HEV: [{
68:8, 127: 8, 304: 8, 320: 8, 339: 8, 352: 8, 356: 4, 524: 8, 544: 8, 576:8, 593: 8, 688: 5, 832: 8, 881: 8, 882: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1078: 4, 1136: 6, 1151: 6, 1155: 8, 1156: 8, 1157: 4, 1164: 8, 1168: 7, 1173: 8, 1183: 8, 1186: 2, 1191: 2, 1225: 8, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1291: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1355: 8, 1363: 8, 1369: 8, 1379: 8, 1407: 8, 1419: 8, 1426: 8, 1427: 6, 1429: 8, 1430: 8, 1448: 8, 1456: 4, 1470: 8, 1473: 8, 1476: 8, 1507: 8, 1535: 8, 1988: 8, 1996: 8, 2000: 8, 2004: 8, 2005: 8, 2008: 8, 2012: 8, 2013: 8
}],
CAR.SANTA_FE: [{
67: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 544: 8, 593: 8, 608: 8, 688: 6, 764: 8, 809: 8, 832: 8, 854: 7, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1064: 8, 1078: 4, 1107: 5, 1136: 8, 1151: 6, 1155: 8, 1156: 8, 1157: 4, 1162: 8, 1164: 8, 1168: 7, 1170: 8, 1173: 8, 1180: 8, 1183: 8, 1186: 2, 1191: 2, 1227: 8, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1371: 8, 1378: 8, 1384: 8, 1407: 8, 1414: 3, 1419: 8, 1427: 6, 1456: 4, 1470: 8, 1479: 8, 1990: 8, 1998: 8, 2000: 8, 2004: 8, 2008: 8, 2012: 8, 2015: 8
}],
CAR.SANTA_FE_HEV: [{
}],
CAR.PALISADE: [{
67: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 544: 8, 549: 8, 576: 8, 593: 8, 608: 8, 688: 6, 809: 8, 832: 8, 854: 7, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 913: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1064: 8, 1078: 4, 1107: 5, 1123: 8, 1136: 8, 1151: 6, 1155: 8, 1156: 8, 1157: 4, 1162: 8, 1164: 8, 1168: 7, 1170: 8, 1173: 8, 1180: 8, 1186: 2, 1191: 2, 1193: 8, 1210: 8, 1225: 8, 1227: 8, 1265: 4, 1280: 8, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1371: 8, 1378: 8, 1384: 8, 1407: 8, 1419: 8, 1427: 6, 1456: 4, 1470: 8, 2000: 8, 2005: 8, 2008: 8
}],
CAR.VELOSTER: [{
64: 8, 66: 8, 67: 8, 68: 8, 127: 8, 128: 8, 129: 8, 273: 8, 274: 8, 275: 8, 339: 8, 354: 3, 356: 4, 399: 8, 512: 6, 544: 8, 558: 8, 593: 8, 608: 8, 688: 5, 790: 8, 809: 8, 832: 8, 884: 8, 897: 8, 899: 8, 902: 8, 903: 8, 905: 8, 909: 8, 916: 8, 1040: 8, 1056: 8, 1057: 8, 1078: 4, 1170: 8, 1181: 5, 1186: 2, 1191: 2, 1265: 4, 1280: 1, 1282: 4, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1349: 8, 1351: 8, 1353: 8, 1356: 8, 1363: 8, 1365: 8, 1366: 8, 1367: 8, 1369: 8, 1378: 4, 1407: 8, 1414: 3, 1415: 8, 1419: 8, 1427: 6, 1440: 8, 1456: 4, 1470: 8, 1486: 8, 1487: 8, 1491: 8, 1530: 8, 1532: 5, 1872: 8, 1988: 8, 1996: 8, 2000: 8, 2001: 8, 2004: 8, 2008: 8, 2009: 8, 2012: 8, 2015: 8, 2016: 8, 2017: 8, 2024: 8, 2025: 8
}],
CAR.GRANDEUR: [{
67: 8, 68: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 544: 8, 546: 8, 547: 8, 549: 8, 593: 8, 608: 8, 688: 5, 809: 8, 832: 8, 854: 7, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1078: 4, 1136: 8, 1151: 6, 1156: 8, 1157: 4, 1162: 4, 1168: 7, 1170: 8, 1173: 8, 1185: 8, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1371: 8, 1378: 4, 1384: 8, 1407: 8, 1419: 8, 1425: 2, 1427: 6, 1456: 4, 1470: 8
}],
CAR.GRANDEUR_HEV: [{
68: 8, 127: 8, 304: 8, 320: 8, 339: 8, 352: 8, 356: 4, 516: 8, 544: 8, 546: 8, 576: 8, 593: 8, 688: 5, 832: 8, 865: 8, 881: 8, 882: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 913: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1078: 4, 1108: 8, 1136: 6, 1138: 5, 1151: 8, 1155: 8, 1156: 8, 1157: 4, 1162: 8, 1164: 8, 1168: 7, 1173: 8, 1180: 8, 1185: 8, 1186: 2, 1191: 2, 1193: 8, 1210: 8, 1225: 8, 1227: 8, 1265: 4, 1268: 8, 1280: 1, 1287: 4, 1290: 8, 1291: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 8, 1345: 8, 1348: 8, 1355: 8, 1363: 8, 1369: 8, 1371: 8, 1378: 4, 1379: 8, 1407: 8, 1419: 8, 1425: 2, 1427: 6, 1429: 8, 1430: 8, 1448: 8, 1456: 4, 1470: 8, 1476: 8, 1535: 8
}],
CAR.GRANDEUR20: [{
67: 8, 68: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 516: 8, 524: 8, 528: 8, 532: 8, 544: 8, 576: 8, 593: 8, 608: 8, 688: 5, 809: 8, 832: 8, 854: 8, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 913: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1078: 4, 1107: 5, 1136: 8, 1151: 8, 1155: 8, 1156: 8, 1157: 4, 1162: 8, 1164: 8, 1168: 8, 1170: 8, 1173: 8, 1180: 8, 1186: 2, 1191: 2, 1193: 8, 1210: 8, 1225: 8, 1227: 8, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 8, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1371: 8, 1378: 8, 1379: 8, 1384: 8, 1407: 8, 1419: 8, 1427: 6, 1456: 4, 1470: 8
}],
CAR.GRANDEUR20_HEV: [{
127: 8, 304: 8, 320: 8, 339: 8, 352: 8, 356: 4, 516: 8, 544: 8, 576: 8, 593: 8, 688: 5, 764: 8, 832: 8, 865: 8, 881: 8, 882: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 913: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1078: 4, 1108: 8, 1136: 6, 1138: 5, 1151: 8, 1155: 8, 1156: 8, 1157: 4, 1162: 8, 1164: 8, 1168: 8, 1173: 8, 1180: 8, 1186: 2, 1191: 2, 1193: 8, 1210: 8, 1225: 8, 1227: 8, 1265: 4, 1268: 8, 1280: 1, 1287: 4, 1290: 8, 1291: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 8, 1345: 8, 1348: 8, 1355: 8, 1363: 8, 1369: 8, 1371: 8, 1378: 8, 1407: 8, 1419: 8, 1427: 6, 1429: 8, 1430: 8, 1448: 8, 1456: 4, 1470: 8, 1476: 8, 1535: 8
}],
CAR.NEXO: [{
127: 8, 145: 8, 146: 8, 304: 8, 320: 8, 339: 8, 352: 8, 356: 4, 512: 6, 544: 8, 546: 8, 593: 8, 688: 5, 832: 8, 881: 8, 882: 8, 897: 8, 902: 8, 903: 8, 905: 8, 908: 8, 909: 8, 912: 7, 916: 8, 1056: 8, 1057: 8, 1078: 4, 1136: 8, 1151: 8, 1155: 8, 1156: 8, 1157: 4, 1162: 8, 1164: 8, 1168: 7, 1173: 8, 1174: 8, 1180: 8, 1183: 8, 1186: 2, 1191: 2, 1192: 8, 1193: 8, 1210: 8, 1219: 8, 1220: 8, 1222: 6, 1223: 8, 1224: 8, 1227: 8, 1230: 6, 1231: 6, 1265: 4, 1268: 8, 1280: 1, 1287: 4, 1290: 8, 1291: 8, 1292: 8, 1294: 8, 1297: 8, 1298: 8, 1305: 8, 1312: 8, 1315: 8, 1316: 8, 1322: 8, 1324: 8, 1342: 6, 1345: 8, 1348: 8, 1355: 8, 1363: 8, 1369: 8, 1371: 8, 1407: 8, 1419: 8, 1427: 6, 1429: 8, 1430: 8, 1437: 8, 1456: 4, 1460: 8, 1470: 8, 1484: 8, 1507: 8, 1520: 8, 1535: 8
}],
# Kia
CAR.FORTE: [{
67: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 544: 8, 593: 8, 608: 8, 688: 5, 809: 8, 832: 8, 854: 7, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 903: 8, 909: 8, 916: 8, 1040: 8, 1042: 8, 1078: 4, 1107: 5, 1136: 8, 1156: 8, 1170: 8, 1173: 8, 1191: 2, 1225: 8, 1265: 4, 1280: 4, 1287: 4, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1384: 8, 1394: 8, 1407: 8, 1427: 6, 1456: 4, 1470: 8
}],
CAR.K5: [{
64: 8, 66: 8, 67: 8, 68: 8, 127: 8, 128: 8, 129: 8, 273: 8, 274: 8, 275: 8, 339: 8, 354: 3, 356: 4, 399: 8, 447: 8, 512: 6, 544: 8, 593: 8, 608: 8, 625: 8, 688: 5, 790: 8, 809: 8, 832: 8, 884: 8, 897: 8, 899: 8, 902: 8, 903: 6, 909: 8, 912: 7, 916: 8, 1040: 8, 1056: 8, 1057: 8, 1078: 4, 1151: 6, 1168: 7, 1170: 8, 1186: 2, 1191: 2, 1236: 2, 1253: 8, 1254: 8, 1255: 8, 1265: 4, 1268: 8, 1280: 1, 1282: 4, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1331: 8, 1332: 8, 1333: 8, 1342: 6, 1345: 8, 1348: 8, 1349: 8, 1351: 8, 1353: 8, 1356: 8, 1363: 8, 1365: 8, 1366: 8, 1367: 8, 1369: 8, 1371: 8, 1407: 8, 1414: 3, 1415: 8, 1419: 8, 1425: 2, 1427: 6, 1440: 8, 1456: 4, 1470: 8, 1472: 8, 1486: 8, 1487: 8, 1491: 8, 1492: 8, 1530: 8, 1532: 5, 1905: 8, 1913: 8, 1952: 8, 1960: 8, 1988: 8, 1996: 8, 2001: 8, 2004: 8, 2008: 8, 2009: 8, 2012: 8, 2015: 8, 2016: 8, 2017: 8, 2024: 8, 2025: 8
}],
CAR.K5_HEV: [{
68: 8, 127: 8, 304: 8, 320: 8, 339: 8, 352: 8, 356: 4, 544: 8, 576: 8, 593: 8, 688: 5, 832: 8, 881: 8, 882: 8, 897: 8, 902: 8, 903: 6, 909: 8, 912: 7, 916: 8, 1040: 8, 1056: 8, 1057: 8, 1078: 4, 1136: 6, 1151: 6, 1168: 7, 1173: 8, 1180: 8, 1186: 2, 1191: 2, 1236: 2, 1265: 4, 1268: 8, 1280: 1, 1287: 4, 1290: 8, 1291: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1331: 8, 1332: 8, 1333: 8, 1342: 6, 1345: 8, 1348: 8, 1355: 8, 1363: 8, 1369: 8, 1371: 8, 1407: 8, 1419: 8, 1420: 8, 1425: 2, 1427: 6, 1429: 8, 1430: 8, 1448: 8, 1456: 4, 1470: 8, 1476: 8, 1535: 8
}],
CAR.K5_DL3: [{
}],
CAR.K5_DL3_HEV: [{
}],
CAR.SPORTAGE: [{
67: 8, 68: 8, 127: 8, 273: 8, 274: 8, 275: 8, 339: 8, 356: 4, 399: 8, 447: 8, 512: 6, 544: 8, 593: 8, 608: 8, 688: 5, 790: 8, 809: 8, 832: 8, 884: 8, 897: 8, 899: 8, 902: 8, 903: 6, 909: 8, 916: 8, 1040: 8, 1078: 4, 1170: 8, 1191: 2, 1253: 8, 1254: 8, 1255: 8, 1265: 4, 1280: 1, 1282: 4, 1287: 4, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1349: 8, 1351: 8, 1353: 8, 1363: 8, 1365: 8, 1366: 8, 1367: 8, 1369: 8, 1407: 8, 1419: 8, 1427: 6, 1440: 8, 1456: 4, 1470: 8, 1472: 8, 1486: 8, 1487: 8, 1491: 8, 1492: 8, 1530: 8
}],
CAR.SORENTO: [{
67: 8, 68: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 544: 8, 593: 8, 608: 8, 688: 5, 809: 8, 832: 8, 854: 7, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 903: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1064: 8, 1078: 4, 1107: 5, 1136: 8, 1151: 6, 1168: 7, 1170: 8, 1173: 8, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1331: 8, 1332: 8, 1333: 8, 1342: 6, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1370: 8, 1371: 8, 1384: 8, 1407: 8, 1411: 8, 1419: 8, 1425: 2, 1427: 6, 1444: 8, 1456: 4, 1470: 8, 1489: 1
}],
CAR.MOHAVE: [{
67: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 544: 8, 593: 8, 608: 8, 688: 5, 809: 8, 832: 8, 854: 8, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 905: 8, 909: 8, 913: 8, 916: 8, 1040: 8, 1056: 8, 1057: 8, 1064: 8, 1078: 4, 1107: 5, 1123: 8, 1136: 8, 1145: 8, 1151: 8, 1155: 8, 1156: 8, 1157: 4, 1162: 8, 1164: 8, 1168: 8, 1170: 8, 1173: 8, 1180: 8, 1186: 2, 1191: 2, 1193: 8, 1210: 8, 1225: 8, 1227: 8, 1265: 4, 1280: 8, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1371: 8, 1378: 8, 1384: 8, 1407: 8, 1419: 8, 1427: 6, 1456: 4, 1470: 8, 1479: 8
}],
CAR.STINGER: [{
67: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 358: 6, 359: 8, 544: 8, 576: 8, 593: 8, 608: 8, 688: 5, 809: 8, 832: 8, 854: 7, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 909: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1064: 8, 1078: 4, 1107: 5, 1136: 8, 1151: 6, 1168: 7, 1170: 8, 1173: 8, 1184: 8, 1265: 4, 1280: 1, 1281: 4, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1371: 8, 1378: 4, 1379: 8, 1384: 8, 1407: 8, 1419: 8, 1425: 2, 1427: 6, 1456: 4, 1470: 8, 2015: 8
}],
CAR.NIRO_EV: [{
127: 8, 304: 8, 320: 8, 339: 8, 352: 8, 356: 4, 516: 8, 544: 8, 593: 8, 688: 5, 832: 8, 881: 8, 882: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1078: 4, 1136: 8, 1151: 6, 1156: 8, 1157: 4, 1168: 7, 1173: 8, 1183: 8, 1186: 2, 1191: 2, 1193: 8, 1225: 8, 1260: 8, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1291: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1355: 8, 1363: 8, 1369: 8, 1407: 8, 1419: 8, 1426: 8, 1427: 6, 1429: 8, 1430: 8, 1456: 4, 1470: 8, 1473: 8, 1507: 8, 1535: 8, 1988: 8, 1990: 8, 1998: 8, 1996: 8, 2000: 8, 2004: 8, 2008: 8, 2012: 8, 2015: 8
}],
CAR.NIRO_HEV: [{
127: 8, 304: 8, 320: 8, 339: 8, 352: 8, 356: 4, 544: 8, 576: 8, 593: 8, 688: 5, 832: 8, 881: 8, 882: 8, 897: 8, 902: 8, 903: 8, 916: 8, 1040: 8, 1056: 8, 1057: 8, 1078: 4, 1136: 6, 1173: 8, 1225: 8, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1291: 8, 1292: 8, 1294: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1355: 8, 1363: 8, 1369: 8, 1419: 8, 1427: 6, 1429: 8, 1430: 8, 1448: 8, 1456: 4, 1470: 8, 1535: 8
}],
CAR.SOUL_EV: [{
127: 8, 304: 8, 320: 8, 339: 8, 352: 8, 356: 4, 544: 8, 546: 8, 548: 8, 549: 8, 593: 8, 688: 6, 832: 8, 881: 8, 882: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 913: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1078: 4, 1136: 8, 1151: 6, 1155: 8, 1156: 8, 1157: 4, 1162: 8, 1164: 8, 1168: 7, 1173: 8, 1186: 2, 1191: 2, 1193: 8, 1225: 8, 1227: 8, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1291: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1355: 8, 1363: 8, 1369: 8, 1378: 8, 1379: 8, 1407: 8, 1419: 8, 1426: 8, 1427: 6, 1429: 8, 1430: 8, 1456: 4, 1470: 8, 1473: 8, 1507: 8, 1535: 8
}],
CAR.SELTOS: [{
67: 8, 127: 8, 304: 8, 320: 8, 339: 8, 354: 8, 356: 4, 544: 8, 593: 8, 608: 8, 688: 6, 809: 8, 832: 8, 854: 8, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 905: 8, 909: 8, 910: 5, 911: 5, 913: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1078: 4, 1107: 5, 1114: 8, 1136: 8, 1145: 8, 1151: 8, 1155: 8, 1156: 8, 1157: 4, 1162: 8, 1164: 8, 1168: 8, 1170: 8, 1173: 8, 1186: 2, 1191: 2, 1225: 8, 1265: 4, 1280: 8, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1379: 8, 1384: 8, 1394: 8, 1407: 8, 1414: 3, 1419: 8, 1427: 6, 1446: 8, 1456: 4, 1470: 8, 1485: 8, 1911: 8
}],
CAR.K7: [{
67: 8, 68: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 544: 8, 546: 8, 593: 8, 608: 8, 688: 5, 809: 8, 832: 8, 854: 7, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 903: 8, 916: 8, 1040: 8, 1056: 8, 1057: 8, 1078: 4, 1107: 5, 1136: 8, 1151: 6, 1156: 8, 1157: 4, 1162: 4, 1168: 7, 1170: 8, 1173: 8, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1371: 8, 1378: 4, 1384: 8, 1407: 8, 1419: 8, 1427: 6, 1444: 8, 1456: 4, 1470: 8
}],
CAR.K7_HEV: [{
68: 8, 127: 8, 304: 8, 320: 8, 339: 8, 352: 8, 356: 4, 544: 8, 549: 8, 576: 8, 593: 8, 688: 5, 832: 8, 865: 8, 881: 8, 882: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 913: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1078: 4, 1096: 8, 1102: 8, 1108: 8, 1136: 6, 1138: 5, 1151: 8, 1155: 8, 1156: 8, 1157: 4, 1162: 8, 1164: 8, 1168: 7, 1173: 8, 1180: 8, 1186: 2, 1191: 2, 1210: 8, 1227: 8, 1265: 4, 1268: 8, 1280: 1, 1287: 4, 1290: 8, 1291: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1343: 8, 1345: 8, 1348: 8, 1355: 8, 1363: 8, 1369: 8, 1371: 8, 1378: 8, 1379: 8, 1407: 8, 1419: 8, 1427: 6, 1429: 8, 1430: 8, 1448: 8, 1456: 4, 1470: 8, 1476: 8, 1535: 8
}],
CAR.K9: [{
67: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 544: 8, 593: 8, 608: 8, 688: 5, 809: 8, 832: 8, 854: 7, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 916: 8, 1056: 8, 1057: 8, 1078: 4, 1107: 5, 1136: 8, 1151: 6, 1155: 8, 1156: 8, 1157: 4, 1162: 8, 1164: 8, 1168: 7, 1170: 8, 1173: 8, 1184: 8, 1186: 2, 1191: 2, 1227: 8, 1265: 4, 1280: 4, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1379: 8, 1384: 8, 1407: 8, 1419: 8, 1427: 6, 1456: 4, 1470: 8
}],
# Genesis
CAR.GENESIS: [{
67: 8, 68: 8, 304: 8, 320: 8, 339: 8, 356: 4, 544: 7, 593: 8, 608: 8, 688: 5, 809: 8, 832: 8, 854: 7, 870: 7, 871: 8, 872: 5, 897: 8, 902: 8, 903: 6, 912: 7, 916: 8, 1024: 2, 1040: 8, 1056: 8, 1057: 8, 1078: 4, 1107: 5, 1136: 8, 1151: 6, 1168: 7, 1170: 8, 1173: 8, 1184: 8, 1265: 4, 1268: 8, 1280: 1, 1281: 3, 1287: 4, 1292: 8, 1312: 8, 1322: 8, 1331: 8, 1332: 8, 1333: 8, 1334: 8, 1335: 8, 1342: 6, 1345: 8, 1363: 8, 1369: 8, 1370: 8, 1371: 8, 1378: 4, 1379: 8, 1384: 5, 1407: 8, 1419: 8, 1425: 2, 1427: 6, 1434: 2, 1437: 8, 1456: 4
}],
CAR.GENESIS_G70: [{
67: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 358: 6, 544: 8, 576: 8, 593: 8, 608: 8, 688: 5, 809: 8, 832: 8, 854: 7, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 909: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1064: 8, 1078: 4, 1107: 5, 1136: 8, 1151: 6, 1156: 8, 1168: 7, 1170: 8, 1173: 8, 1184: 8, 1186: 2, 1191: 2, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1379: 8, 1384: 8, 1407: 8, 1419: 8, 1427: 6, 1456: 4, 1470: 8, 1988: 8, 1996: 8, 2000: 8, 2004: 8, 2008: 8, 2012: 8, 2015: 8
}],
CAR.GENESIS_G80: [{
67: 8, 68: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 358: 6, 359: 8, 544: 8, 546: 8, 593: 8, 608: 8, 688: 5, 809: 8, 832: 8, 854: 7, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 903: 8, 916: 8, 1024: 2, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1064: 8, 1078: 4, 1107: 5, 1136: 8, 1151: 6, 1156: 8, 1157: 4, 1162: 8, 1168: 7, 1170: 8, 1173: 8, 1184: 8, 1265: 4, 1280: 1, 1281: 3, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1370: 8, 1371: 8, 1378: 4, 1384: 8, 1407: 8, 1419: 8, 1425: 2, 1427: 6, 1434: 2, 1437: 8, 1456: 4, 1470: 8
}],
CAR.GENESIS_G90: [{
67: 8, 68: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 358: 6, 359: 8, 544: 8, 546: 8, 593: 8, 608: 8, 688: 5, 809: 8, 832: 8, 854: 7, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 903: 8, 916: 8, 1040: 8, 1056: 8, 1057: 8, 1064: 8, 1078: 4, 1107: 5, 1136: 8, 1151: 6, 1156: 8, 1162: 4, 1168: 7, 1170: 8, 1173: 8, 1184: 8, 1265: 4, 1280: 1, 1281: 3, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1370: 8, 1371: 8, 1378: 4, 1384: 8, 1407: 8, 1419: 8, 1425: 2, 1427: 6, 1434: 2, 1456: 4, 1470: 8, 1988: 8, 2000: 8, 2003: 8, 2004: 8, 2005: 8, 2008: 8, 2011: 8, 2012: 8, 2013: 8, 2015: 8
}],
}
ECU_FINGERPRINT = {
Ecu.fwdCamera: [832, 1156, 1191, 1342] #832:lkas11, 1156:hda11_mfc, 1191:mfc_4a7, 1342:lkas12
}
FW_VERSIONS = {
# fwdRadar, fwdCamera, eps, esp, engine, transmission
# hyundai
CAR.ELANTRA_I30: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00PD__ SCC F-CUP 1.00 1.01 99110-G3100 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00PDP LKAS AT AUS RHD 1.00 1.01 99211-G4000 v60',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x00PDu MDPS C 1.00 1.01 56310/G3690 4PDUC101',
],
(Ecu.esp, 0x7d1, None): [
b'\xf1\x00PD ESC \x11 100 \a\x03 58910-G3AC0',
],
(Ecu.engine, 0x7e0, None): [
b'\x01TPD-1A506F000H00',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x816U2VA051\x00\x00\xf1\x006U2V0_C2\x00\x006U2VA051\x00\x00DPD0H16US0\x00\x00\x00\x00',
],
},
CAR.ELANTRA21: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00CN7_ SCC F-CUP 1.00 1.01 99110-AA000 ',
b'\xf1\x00CN7_ SCC FHCUP 1.00 1.01 99110-AA000 ',
b'\xf1\x8799110AA000\xf1\x00CN7_ SCC FHCUP 1.00 1.01 99110-AA000 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00CN7 MFC AT USA LHD 1.00 1.00 99210-AB000 200819'
b'\xf1\x00CN7 MFC AT USA LHD 1.00 1.03 99210-AA000 200819',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x87\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\xf1\x00CN7 MDPS C 1.00 1.06 \x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00 4CNDC106',
b'\xf1\x8756310/AA070\xf1\x00CN7 MDPS C 1.00 1.06 56310/AA070 4CNDC106',
b'\xf1\x8756310AA050\x00\xf1\x00CN7 MDPS C 1.00 1.06 56310AA050\x00 4CNDC106',
],
(Ecu.esp, 0x7d1, None): [
b'\xf1\x00CN ESC \t 101 \x10\x03 58910-AB800',
b'\xf1\x8758910-AA800\xf1\x00CN ESC \t 104 \x08\x03 58910-AA800',
b'\xf1\x8758910-AB800\xf1\x00CN ESC \t 101 \x10\x03 58910-AB800',
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x82CNCWD0AMFCXCSFFA',
b'\xf1\x82CNCWD0AMFCXCSFFB',
b'\xf1\x82CNCVD0AMFCXCSFFB',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x00HT6WA280BLHT6VA640A1CCN0N20NS5\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x00HT6WA280BLHT6VA640A1CCN0N20NS5\x00\x00\x00\x00\x00\x00\xe8\xba\xce\xfa',
b'\xf1\x87CXMQFM2135005JB2E\xb9\x89\x98W\xa9y\x97h\xa9\x98\x99wxvwh\x87\177\xffx\xff\xff\xff,,\xf1\x89HT6VA640A1\xf1\x82CCN0N20NS5\x00\x00\x00\x00\x00\x00',
b'\xf1\x87CXMQFM1916035JB2\x88vvgg\x87Wuwgev\xa9\x98\x88\x98h\x99\x9f\xffh\xff\xff\xff\xa5\xee\xf1\x89HT6VA640A1\xf1\x82CCN0N20NS5\x00\x00\x00\x00\x00\x00',
b'\xf1\x87CXLQF40189012JL2f\x88\x86\x88\x88vUex\xb8\x88\x88\x88\x87\x88\x89fh?\xffz\xff\xff\xff\x08z\xf1\x89HT6VA640A1\xf1\x82CCN0N20NS5\x00\x00\x00\x00\x00\x00',
],
},
CAR.ELANTRA21_HEV: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\000CNhe SCC FHCUP 1.00 1.01 99110-BY000 ',
b'\xf1\x8799110BY000\xf1\x00CNhe SCC FHCUP 1.00 1.01 99110-BY000 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\000CN7HMFC AT USA LHD 1.00 1.03 99210-AA000 200819'
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x8756310/BY050\xf1\000CN7 MDPS C 1.00 1.02 56310/BY050 4CNHC102'
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x816H6G5051\000\000\000\000\000\000\000\000'
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\0006U3L0_C2\000\0006U3K3051\000\000HCN0G16NS0\xb9?A\xaa',
b'\xf1\0006U3L0_C2\000\0006U3K3051\000\000HCN0G16NS0\000\000\000\000',
b'\xf1\x816U3K3051\000\000\xf1\0006U3L0_C2\000\0006U3K3051\000\000HCN0G16NS0\xb9?A\xaa',
b'\xf1\x816U3K3051\000\000\xf1\0006U3L0_C2\000\0006U3K3051\000\000HCN0G16NS0\000\000\000\000'
],
},
CAR.SONATA: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00DN8 1.00 99110-L0000 \xaa\xaa\xaa\xaa\xaa\xaa\xaa ',
b'\xf1\x00DN8 1.00 99110-L0000 \xaa\xaa\xaa\xaa\xaa\xaa\xaa\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x00DN8_ SCC F-CU- 1.00 1.00 99110-L0000 ',
b'\xf1\x00DN8_ SCC F-CUP 1.00 1.00 99110-L0000 ',
b'\xf1\x00DN8_ SCC F-CUP 1.00 1.02 99110-L1000 ',
b'\xf1\x00DN8_ SCC FHCUP 1.00 1.00 99110-L0000 ',
b'\xf1\x00DN8_ SCC FHCUP 1.00 1.01 99110-L1000 ',
b'\xf1\x00DN89110-L0000 \xaa\xaa\xaa\xaa\xaa\xaa\xaa ',
b'\xf1\x8799110L0000\xf1\x00DN8_ SCC F-CUP 1.00 1.00 99110-L0000 ',
b'\xf1\x8799110L0000\xf1\x00DN8_ SCC FHCUP 1.00 1.00 99110-L0000 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00DN8 MFC AT KOR LHD 1.00 1.02 99211-L1000 190422',
b'\xf1\x00DN8 MFC AT RUS LHD 1.00 1.03 99211-L1000 190705',
b'\xf1\x00DN8 MFC AT USA LHD 1.00 1.00 99211-L0000 190716',
b'\xf1\x00DN8 MFC AT USA LHD 1.00 1.01 99211-L0000 191016',
b'\xf1\x00DN8 MFC AT USA LHD 1.00 1.03 99211-L0000 210603',
b'\xf1\x00DN8 MFC AT USA LHD 1.00 1.05 99211-L1000 201109',
b'\xf1\x00DN8 MFC AT USA LHD 1.00 1.06 99211-L1000 210325',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x00DN8 MDPS C 1.00 1.01 \x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00 4DNAC101',
b'\xf1\x00DN8 MDPS C 1.00 1.01 56310-L0010 4DNAC101',
b'\xf1\x00DN8 MDPS C 1.00 1.01 56310L0010\x00 4DNAC101',
b'\xf1\x00DN8 MDPS R 1.00 1.00 57700-L0000 4DNAP100',
b'\xf1\x87\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\xf1\x00DN8 MDPS C 1.00 1.01 \x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00 4DNAC101',
b'\xf1\x8756310-L0010\xf1\x00DN8 MDPS C 1.00 1.01 56310-L0010 4DNAC101',
b'\xf1\x8756310-L0210\xf1\x00DN8 MDPS C 1.00 1.01 56310-L0210 4DNAC101',
b'\xf1\x8756310-L1010\xf1\x00DN8 MDPS C 1.00 1.03 56310-L1010 4DNDC103',
b'\xf1\x8756310-L1030\xf1\x00DN8 MDPS C 1.00 1.03 56310-L1030 4DNDC103',
b'\xf1\x8756310L0010\x00\xf1\x00DN8 MDPS C 1.00 1.01 56310L0010\x00 4DNAC101',
b'\xf1\x8756310L0210\x00\xf1\x00DN8 MDPS C 1.00 1.01 56310L0210\x00 4DNAC101',
b'\xf1\x8757700-L0000\xf1\x00DN8 MDPS R 1.00 1.00 57700-L0000 4DNAP100',
],
(Ecu.esp, 0x7d1, None): [
b'\xf1\x00DN ESC \a 106 \a\x01 58910-L0100',
b'\xf1\x00DN ESC \x01 102\x19\x04\x13 58910-L1300',
b'\xf1\x00DN ESC \x03 100 \x08\x01 58910-L0300',
b'\xf1\x00DN ESC \x06 104\x19\x08\x01 58910-L0100',
b'\xf1\x00DN ESC \x07 104\x19\x08\x01 58910-L0100',
b'\xf1\x00DN ESC \x08 103\x19\x06\x01 58910-L1300',
b'\xf1\x8758910-L0100\xf1\x00DN ESC \a 106 \a\x01 58910-L0100',
b'\xf1\x8758910-L0100\xf1\x00DN ESC \x06 104\x19\x08\x01 58910-L0100',
b'\xf1\x8758910-L0100\xf1\x00DN ESC \x06 106 \x07\x01 58910-L0100',
b'\xf1\x8758910-L0100\xf1\x00DN ESC \x07 104\x19\x08\x01 58910-L0100',
b'\xf1\x8758910-L0300\xf1\x00DN ESC \x03 100 \x08\x01 58910-L0300',
b'\xf1\x00DN ESC \x06 106 \x07\x01 58910-L0100',
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x81HM6M1_0a0_F00',
b'\xf1\x82DNBVN5GMCCXXXDCA',
b'\xf1\x82DNBVN5GMCCXXXG2F',
b'\xf1\x82DNBWN5TMDCXXXG2E',
b'\xf1\x82DNCVN5GMCCXXXF0A',
b'\xf1\x82DNCVN5GMCCXXXG2B',
b'\xf1\x870\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\xf1\x82DNDWN5TMDCXXXJ1A',
b'\xf1\x87391162M003',
b'\xf1\x87391162M013',
b'\xf1\x87391162M023',
b'HM6M1_0a0_F00',
b'HM6M1_0a0_G20',
b'HM6M2_0a0_BD0',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x00bcsh8p54 U913\x00\x00\x00\x00\x00\x00SDN8T16NB1\xe3\xc10\xa1',
b'\xf1\x00bcsh8p54 U913\x00\x00\x00\x00\x00\x00SDN8T16NB2\n\xdd^\xbc',
b'\xf1\x00HT6TA260BLHT6TA800A1TDN8C20KS4\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x00HT6TA260BLHT6TA810A1TDN8M25GS0\x00\x00\x00\x00\x00\x00\xaa\x8c\xd9p',
b'\xf1\x00HT6WA250BLHT6WA910A1SDN8G25NB1\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x00HT6WA250BLHT6WA910A1SDN8G25NB1\x00\x00\x00\x00\x00\x00\x96\xa1\xf1\x92',
b'\xf1\x00HT6WA280BLHT6WAD10A1SDN8G25NB2\x00\x00\x00\x00\x00\x00\x08\xc9O:',
b'\xf1\x00T02601BL T02730A1 VDN8T25XXX730NS5\xf7_\x92\xf5',
b'\xf1\x87954A02N060\x00\x00\x00\x00\x00\xf1\x81T02730A1 \xf1\x00T02601BL T02730A1 VDN8T25XXX730NS5\xf7_\x92\xf5',
b'\xf1\x87SAKFBA2926554GJ2VefVww\x87xwwwww\x88\x87xww\x87wTo\xfb\xffvUo\xff\x8d\x16\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SAKFBA3030524GJ2UVugww\x97yx\x88\x87\x88vw\x87gww\x87wto\xf9\xfffUo\xff\xa2\x0c\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SAKFBA3356084GJ2\x86fvgUUuWgw\x86www\x87wffvf\xb6\xcf\xfc\xffeUO\xff\x12\x19\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SAKFBA3474944GJ2ffvgwwwwg\x88\x86x\x88\x88\x98\x88ffvfeo\xfa\xff\x86fo\xff\t\xae\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SAKFBA3475714GJ2Vfvgvg\x96yx\x88\x97\x88ww\x87ww\x88\x87xs_\xfb\xffvUO\xff\x0f\xff\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALDBA3510954GJ3ww\x87xUUuWx\x88\x87\x88\x87w\x88wvfwfc_\xf9\xff\x98wO\xffl\xe0\xf1\x89HT6WA910A1\xf1\x82SDN8G25NB1\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SALDBA3573534GJ3\x89\x98\x89\x88EUuWgwvwwwwww\x88\x87xTo\xfa\xff\x86f\x7f\xffo\x0e\xf1\x89HT6WA910A1\xf1\x82SDN8G25NB1\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SALDBA3601464GJ3\x88\x88\x88\x88ffvggwvwvw\x87gww\x87wvo\xfb\xff\x98\x88\x7f\xffjJ\xf1\x89HT6WA910A1\xf1\x82SDN8G25NB1\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SALDBA3753044GJ3UUeVff\x86hwwwwvwwgvfgfvo\xf9\xfffU_\xffC\xae\xf1\x89HT6WA910A1\xf1\x82SDN8G25NB1\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SALDBA3862294GJ3vfvgvefVxw\x87\x87w\x88\x87xwwwwc_\xf9\xff\x87w\x9f\xff\xd5\xdc\xf1\x89HT6WA910A1\xf1\x82SDN8G25NB1\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SALDBA3873834GJ3fefVwuwWx\x88\x97\x88w\x88\x97xww\x87wU_\xfb\xff\x86f\x8f\xffN\x04\xf1\x89HT6WA910A1\xf1\x82SDN8G25NB1\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SALDBA4525334GJ3\x89\x99\x99\x99fevWh\x88\x86\x88fwvgw\x88\x87xfo\xfa\xffuDo\xff\xd1>\xf1\x89HT6WA910A1\xf1\x82SDN8G25NB1\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SALDBA4626804GJ3wwww\x88\x87\x88xx\x88\x87\x88wwgw\x88\x88\x98\x88\x95_\xf9\xffuDo\xff|\xe7\xf1\x89HT6WA910A1\xf1\x82SDN8G25NB1\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SALDBA4803224GJ3wwwwwvwg\x88\x88\x98\x88wwww\x87\x88\x88xu\x9f\xfc\xff\x87f\x8f\xff\xea\xea\xf1\x89HT6WA910A1\xf1\x82SDN8G25NB1\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SALDBA6212564GJ3\x87wwwUTuGg\x88\x86xx\x88\x87\x88\x87\x88\x98xu?\xf9\xff\x97f\x7f\xff\xb8\n\xf1\x89HT6WA910A1\xf1\x82SDN8G25NB1\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SALDBA6347404GJ3wwwwff\x86hx\x88\x97\x88\x88\x88\x88\x88vfgf\x88?\xfc\xff\x86Uo\xff\xec/\xf1\x89HT6WA910A1\xf1\x82SDN8G25NB1\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SALDBA6901634GJ3UUuWVeVUww\x87wwwwwvUge\x86/\xfb\xff\xbb\x99\x7f\xff]2\xf1\x89HT6WA910A1\xf1\x82SDN8G25NB1\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SALDBA7077724GJ3\x98\x88\x88\x88ww\x97ygwvwww\x87ww\x88\x87x\x87_\xfd\xff\xba\x99o\xff\x99\x01\xf1\x89HT6WA910A1\xf1\x82SDN8G25NB1\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SALFBA3525114GJ2wvwgvfvggw\x86wffvffw\x86g\x85_\xf9\xff\xa8wo\xffv\xcd\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA3624024GJ2\x88\x88\x88\x88wv\x87hx\x88\x97\x88x\x88\x97\x88ww\x87w\x86o\xfa\xffvU\x7f\xff\xd1\xec\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA3960824GJ2wwwwff\x86hffvfffffvfwfg_\xf9\xff\xa9\x88\x8f\xffb\x99\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA4011074GJ2fgvwwv\x87hw\x88\x87xww\x87wwfgvu_\xfa\xffefo\xff\x87\xc0\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA4121304GJ2x\x87xwff\x86hwwwwww\x87wwwww\x84_\xfc\xff\x98\x88\x9f\xffi\xa6\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA4195874GJ2EVugvf\x86hgwvwww\x87wgw\x86wc_\xfb\xff\x98\x88\x8f\xff\xe23\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA4625294GJ2eVefeUeVx\x88\x97\x88wwwwwwww\xa7o\xfb\xffvw\x9f\xff\xee.\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA4728774GJ2vfvg\x87vwgww\x87ww\x88\x97xww\x87w\x86_\xfb\xffeD?\xffk0\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA5129064GJ2vfvgwv\x87hx\x88\x87\x88ww\x87www\x87wd_\xfa\xffvfo\xff\x1d\x00\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA5454914GJ2\x98\x88\x88\x88\x87vwgx\x88\x87\x88xww\x87ffvf\xa7\x7f\xf9\xff\xa8w\x7f\xff\x1b\x90\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA5987784GJ2UVugDDtGx\x88\x87\x88w\x88\x87xwwwwd/\xfb\xff\x97fO\xff\xb0h\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA5987864GJ2fgvwUUuWgwvw\x87wxwwwww\x84/\xfc\xff\x97w\x7f\xff\xdf\x1d\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA6337644GJ2vgvwwv\x87hgffvwwwwwwww\x85O\xfa\xff\xa7w\x7f\xff\xc5\xfc\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA6802004GJ2UUuWUUuWgw\x86www\x87www\x87w\x96?\xf9\xff\xa9\x88\x7f\xff\x9fK\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA6892284GJ233S5\x87w\x87xx\x88\x87\x88vwwgww\x87w\x84?\xfb\xff\x98\x88\x8f\xff*\x9e\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA7005534GJ2eUuWfg\x86xxww\x87x\x88\x87\x88\x88w\x88\x87\x87O\xfc\xffuUO\xff\xa3k\xf1\x81U913\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U913\x00\x00\x00\x00\x00\x00SDN8T16NB1\xe3\xc10\xa1',
b'\xf1\x87SALFBA7152454GJ2gvwgFf\x86hx\x88\x87\x88vfWfffffd?\xfa\xff\xba\x88o\xff,\xcf\xf1\x81U913\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U913\x00\x00\x00\x00\x00\x00SDN8T16NB1\xe3\xc10\xa1',
b'\xf1\x87SALFBA7485034GJ2ww\x87xww\x87xfwvgwwwwvfgf\xa5/\xfc\xff\xa9w_\xff40\xf1\x81U913\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U913\x00\x00\x00\x00\x00\x00SDN8T16NB2\n\xdd^\xbc',
b'\xf1\x87SAMDBA7743924GJ3wwwwww\x87xgwvw\x88\x88\x88\x88wwww\x85_\xfa\xff\x86f\x7f\xff0\x9d\xf1\x89HT6WAD10A1\xf1\x82SDN8G25NB2\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SAMDBA7817334GJ3Vgvwvfvgww\x87wwwwwwfgv\x97O\xfd\xff\x88\x88o\xff\x8e\xeb\xf1\x89HT6WAD10A1\xf1\x82SDN8G25NB2\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SAMDBA8054504GJ3gw\x87xffvgffffwwwweUVUf?\xfc\xffvU_\xff\xddl\xf1\x89HT6WAD10A1\xf1\x82SDN8G25NB2\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SAMFB41553621GC7ww\x87xUU\x85Xvwwg\x88\x88\x88\x88wwgw\x86\xaf\xfb\xffuDo\xff\xaa\x8f\xf1\x81U913\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U913\x00\x00\x00\x00\x00\x00SDN8T16NB2\n\xdd^\xbc',
b'\xf1\x87SAMFB42555421GC7\x88\x88\x88\x88wvwgx\x88\x87\x88wwgw\x87wxw3\x8f\xfc\xff\x98f\x8f\xffga\xf1\x81U913\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U913\x00\x00\x00\x00\x00\x00SDN8T16NB2\n\xdd^\xbc',
b'\xf1\x87SAMFBA7978674GJ2gw\x87xgw\x97ywwwwvUGeUUeU\x87O\xfb\xff\x98w\x8f\xfffF\xf1\x81U913\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U913\x00\x00\x00\x00\x00\x00SDN8T16NB2\n\xdd^\xbc',
b'\xf1\x87SAMFBA9283024GJ2wwwwEUuWwwgwwwwwwwww\x87/\xfb\xff\x98w\x8f\xff<\xd3\xf1\x81U913\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U913\x00\x00\x00\x00\x00\x00SDN8T16NB2\n\xdd^\xbc',
b'\xf1\x87SAMFBA9708354GJ2wwwwVf\x86h\x88wx\x87xww\x87\x88\x88\x88\x88w/\xfa\xff\x97w\x8f\xff\x86\xa0\xf1\x81U913\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U913\x00\x00\x00\x00\x00\x00SDN8T16NB2\n\xdd^\xbc',
],
},
CAR.SONATA_HEV: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\000DNhe SCC FHCUP 1.00 1.02 99110-L5000 ',
b'\xf1\x8799110L5000\xf1\000DNhe SCC FHCUP 1.00 1.02 99110-L5000 ',
b'\xf1\000DNhe SCC F-CUP 1.00 1.02 99110-L5000 ',
b'\xf1\x8799110L5000\xf1\000DNhe SCC F-CUP 1.00 1.02 99110-L5000 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\000DN8HMFC AT USA LHD 1.00 1.04 99211-L1000 191016',
b'\xf1\x00DN8HMFC AT USA LHD 1.00 1.05 99211-L1000 201109',
b'\xf1\000DN8HMFC AT USA LHD 1.00 1.06 99211-L1000 210325',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x8756310-L5500\xf1\000DN8 MDPS C 1.00 1.02 56310-L5500 4DNHC102',
b'\xf1\x8756310-L5450\xf1\x00DN8 MDPS C 1.00 1.02 56310-L5450 4DNHC102',
b'\xf1\x8756310-L5450\xf1\000DN8 MDPS C 1.00 1.03 56310-L5450 4DNHC103',
],
(Ecu.esp, 0x7d1, None): [
b'\xf1\x8758910-L0100\xf1\x00DN ESC \x06 104\x19\x08\x01 58910-L0100\xf1\xa01.04',
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x87391062J002\xf1\xa0000P',
b'\xf1\x87391162J012',
b'\xf1\x87391162J013',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\000PSBG2333 E14\x00\x00\x00\x00\x00\x00\x00TDN2H20SA6N\xc2\xeeW',
b'\xf1\x87959102T250\000\000\000\000\000\xf1\x81E09\000\000\000\000\000\000\000\xf1\000PSBG2323 E09\000\000\000\000\000\000\000TDN2H20SA5\x97R\x88\x9e',
b'\xf1\000PSBG2323 E09\000\000\000\000\000\000\000TDN2H20SA5\x97R\x88\x9e',
b'\xf1\000PSBG2333 E16\000\000\000\000\000\000\000TDN2H20SA7\0323\xf9\xab',
b'\xf1\x87PCU\000\000\000\000\000\000\000\000\000\xf1\x81E16\000\000\000\000\000\000\000\xf1\000PSBG2333 E16\000\000\000\000\000\000\000TDN2H20SA7\0323\xf9\xab',
b'\xf1\x87959102T250\x00\x00\x00\x00\x00\xf1\x81E14\x00\x00\x00\x00\x00\x00\x00\xf1\x00PSBG2333 E14\x00\x00\x00\x00\x00\x00\x00TDN2H20SA6N\xc2\xeeW',
],
},
CAR.SONATA_LF: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00LF__ SCC F-CUP 1.00 1.00 96401-C2200 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00LFF LKAS AT USA LHD 1.00 1.01 95740-C1000 E51',
b'\xf1\x00LFF LKAS AT USA LHD 1.01 1.02 95740-C1000 E52',
],
(Ecu.esp, 0x7d1, None): [
b'\xf1\x00LF ESC \f 11 \x17\x01\x13 58920-C2610',
b'\xf1\x00LF ESC \t 11 \x17\x01\x13 58920-C2610',
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x81606D5051\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x81606D5K51\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x81606G1051\x00\x00\x00\x00\x00\x00\x00\x00',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x006T6H0_C2\x00\x006T6B4051\x00\x00TLF0G24NL1\xb0\x9f\xee\xf5',
b'\xf1\x87\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xf1\x816T6B4051\x00\x00\xf1\x006T6H0_C2\x00\x006T6B4051\x00\x00TLF0G24NL1\x00\x00\x00\x00',
b'\xf1\x87\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xf1\x816T6B4051\x00\x00\xf1\x006T6H0_C2\x00\x006T6B4051\x00\x00TLF0G24NL1\xb0\x9f\xee\xf5',
b'\xf1\x87\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xf1\x816T6B4051\x00\x00\xf1\x006T6H0_C2\x00\x006T6B4051\x00\x00TLF0G24SL2n\x8d\xbe\xd8',
b'\xf1\x87LAHSGN012918KF10\x98\x88x\x87\x88\x88x\x87\x88\x88\x98\x88\x87w\x88w\x88\x88\x98\x886o\xf6\xff\x98w\x7f\xff3\x00\xf1\x816W3B1051\x00\x00\xf1\x006W351_C2\x00\x006W3B1051\x00\x00TLF0T20NL2\x00\x00\x00\x00',
b'\xf1\x87LAHSGN012918KF10\x98\x88x\x87\x88\x88x\x87\x88\x88\x98\x88\x87w\x88w\x88\x88\x98\x886o\xf6\xff\x98w\x7f\xff3\x00\xf1\x816W3B1051\x00\x00\xf1\x006W351_C2\x00\x006W3B1051\x00\x00TLF0T20NL2H\r\xbdm',
],
},
CAR.KONA: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00OS__ SCC F-CUP 1.00 1.00 95655-J9200 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00OS9 LKAS AT USA LHD 1.00 1.00 95740-J9300 g21',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x00OS MDPS C 1.00 1.05 56310J9030\x00 4OSDC105',
],
(Ecu.esp, 0x7d1, None): [
b'\xf1\x816V5RAK00018.ELF\xf1\x00\x00\x00\x00\x00\x00\x00',
],
(Ecu.engine, 0x7e0, None): [
b'"\x01TOS-0NU06F301J02',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x816U2VE051\x00\x00\xf1\x006U2V0_C2\x00\x006U2VE051\x00\x00DOS4T16NS3\x00\x00\x00\x00',
],
},
CAR.KONA_EV: {
(Ecu.fwdRadar, 0x7D0, None): [
b'\xf1\x00DEev SCC F-CUP 1.00 1.00 99110-Q4000 ',
b'\xf1\x00OSev SCC F-CUP 1.00 1.00 99110-K4000 ',
b'\xf1\x00OSev SCC F-CUP 1.00 1.00 99110-K4100 ',
b'\xf1\x00OSev SCC F-CUP 1.00 1.01 99110-K4000 ',
b'\xf1\x00OSev SCC FNCUP 1.00 1.01 99110-K4000 ',
b'\xf1\x00DEev SCC F-CUP 1.00 1.03 96400-Q4100 ',
b'\xf1\x8799110Q4000\xf1\x00DEev SCC F-CUP 1.00 1.00 99110-Q4000 ',
b'\xf1\x8799110Q4100\xf1\x00DEev SCC F-CUP 1.00 1.00 99110-Q4100 ',
b'\xf1\x8799110Q4500\xf1\000DEev SCC F-CUP 1.00 1.00 99110-Q4500 ',
],
(Ecu.fwdCamera, 0x7C4, None): [
b'\xf1\x00DEE MFC AT USA LHD 1.00 1.03 95740-Q4000 180821',
b'\xf1\x00DEE MFC AT EUR LHD 1.00 1.00 99211-Q4000 191211',
b'\xf1\x00DEE MFC AT USA LHD 1.00 1.00 99211-Q4000 191211',
b'\xf1\000DEE MFC AT EUR LHD 1.00 1.00 99211-Q4100 200706',
b'\xf1\x00OSE LKAS AT EUR LHD 1.00 1.00 95740-K4100 W40',
b'\xf1\x00OSE LKAS AT EUR RHD 1.00 1.00 95740-K4100 W40',
b'\xf1\x00OSE LKAS AT KOR LHD 1.00 1.00 95740-K4100 W40',
b'\xf1\x00OE2 LKAS AT EUR LHD 1.00 1.00 95740-K4200 200',
b'\xf1\x00OSE LKAS AT USA LHD 1.00 1.00 95740-K4300 W50',
],
(Ecu.eps, 0x7D4, None): [
b'\xf1\x00OS MDPS C 1.00 1.03 56310/K4550 4OEDC103',
b'\xf1\x00OS MDPS C 1.00 1.04 56310K4000\x00 4OEDC104',
b'\xf1\x00OS MDPS C 1.00 1.04 56310K4050\x00 4OEDC104',
b'\xf1\x00DE MDPS C 1.00 1.05 56310Q4000\x00 4DEEC105',
b'\xf1\x00DE MDPS C 1.00 1.05 56310Q4100\x00 4DEEC105',
],
(Ecu.esp, 0x7D1, None): [
b'\xf1\x00OS IEB \r 105\x18\t\x18 58520-K4000',
b'\xf1\x00OS IEB \x01 212 \x11\x13 58520-K4000',
b'\xf1\x00OS IEB \x02 212 \x11\x13 58520-K4000',
b'\xf1\x00OS IEB \x03 210 \x02\x14 58520-K4000',
b'\xf1\x00OS IEB \x03 212 \x11\x13 58520-K4000',
],
},
CAR.KONA_HEV: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00OShe SCC FNCUP 1.00 1.01 99110-CM000 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00OSH LKAS AT KOR LHD 1.00 1.01 95740-CM000 l31',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x00OS MDPS C 1.00 1.00 56310CM030\x00 4OHDC100',
],
(Ecu.esp, 0x7d1, None): [
b'\xf1\x00OS IEB \x01 104 \x11 58520-CM000',
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x816H6F6051\x00\x00\x00\x00\x00\x00\x00\x00',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x816U3J9051\x00\x00\xf1\x006U3H1_C2\x00\x006U3J9051\x00\x00HOS0G16DS1\x16\xc7\xb0\xd9',
],
},
CAR.IONIQ_EV: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00AEev SCC F-CUP 1.00 1.00 96400-G7000 ',
b'\xf1\x00AEev SCC F-CUP 1.00 1.00 96400-G7100 ',
b'\xf1\x00AEev SCC F-CUP 1.00 1.01 99110-G7000 ',
b'\xf1\x00AEev SCC F-CUP 1.00 1.00 99110-G7200 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00AEE MFC AT EUR LHD 1.00 1.00 95740-G7200 160418',
b'\xf1\x00AEE MFC AT USA LHD 1.00 1.00 95740-G2400 180222',
b'\xf1\x00AEE MFC AT EUR LHD 1.00 1.03 95740-G2500 190516',
b'\xf1\x00AEE MFC AT EUR RHD 1.00 1.01 95740-G2600 190819',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x00AE MDPS C 1.00 1.02 56310G7300\x00 4AEEC102',
b'\xf1\x00AE MDPS C 1.00 1.04 56310/G7501 4AEEC104',
b'\xf1\x00AE MDPS C 1.00 1.01 56310/G7310 4APEC101',
b'\xf1\x00AE MDPS C 1.00 1.01 56310/G7560 4APEC101',
],
},
CAR.IONIQ_HEV: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\000AEhe SCC F-CUP 1.00 1.02 99110-G2100 ',
b'\xf1\x00AEhe SCC F-CUP 1.00 1.00 99110-G2200 ',
b'\xf1\x00AEhe SCC H-CUP 1.01 1.01 96400-G2000 ',
b'\xf1\x00AEhe SCC F-CUP 1.00 1.00 99110-G2600 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00AEH MFC AT EUR LHD 1.00 1.01 95740-G2600 190819',
b'\xf1\x00AEH MFC AT EUR LHD 1.00 1.00 95740-G2400 180222',
b'\xf1\000AEP MFC AT USA LHD 1.00 1.01 95740-G2600 190819',
b'\xf1\x00AEH MFC AT USA LHD 1.00 1.00 95740-G2700 201027',
],
(Ecu.eps, 0x7D4, None): [
b'\xf1\x00AE MDPS C 1.00 1.07 56310/G2301 4AEHC107',
b'\xf1\x00AE MDPS C 1.00 1.01 56310/G2310 4APHC101',
b'\xf1\000AE MDPS C 1.00 1.01 56310/G2510 4APHC101',
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x816H6F6051\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x816H6F2051\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x816H6F6051\000\000\000\000\000\000\000\000',
b'\xf1\x816H6G5051\x00\x00\x00\x00\x00\x00\x00\x00',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x816U3J8051\x00\x00\xf1\x006U3H1_C2\x00\x006U3J8051\x00\x00HAE0G16UL0Nd\xed:',
b'\xf1\x816U3H1051\x00\x00\xf1\x006U3H0_C2\x00\x006U3H1051\x00\x00HAE0G16US2\x95\xa2^$',
b'\xf1\x816U3J9051\000\000\xf1\0006U3H1_C2\000\0006U3J9051\000\000PAE0G16NL0\x82zT\xd2',
b'\xf1\x816U3J9051\x00\x00\xf1\x006U3H1_C2\x00\x006U3J9051\x00\x00HAE0G16NL2\x00\x00\x00\x00',
],
},
CAR.SANTA_FE: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00TM__ SCC F-CUP 1.00 1.01 99110-S2000 ',
b'\xf1\x00TM__ SCC F-CUP 1.00 1.02 99110-S2000 ',
b'\xf1\x00TM__ SCC F-CUP 1.00 1.03 99110-S2000 ',
b'\xf1\x00TM__ SCC F-CUP 1.00 1.00 99110-S1500 ',
b'\xf1\x8799110S1500\xf1\x00TM__ SCC F-CUP 1.00 1.00 99110-S1500 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00TM MFC AT USA LHD 1.00 1.00 99211-S2000 180409',
b'\xf1\x00TMA MFC AT MEX LHD 1.00 1.01 99211-S2500 210205',
b'\xf1\x00TMA MFC AT USA LHD 1.00 1.00 99211-S2500 200720',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x00TM MDPS C 1.00 1.00 56340-S2000 8409',
b'\xf1\x00TM MDPS C 1.00 1.00 56340-S2000 8A12',
b'\xf1\x00TM MDPS C 1.00 1.01 56340-S2000 9129',
b'\xf1\x00TM MDPS C 1.00 1.02 56370-S2AA0 0B19',
],
(Ecu.esp, 0x7d1, None): [
b'\xf1\x00TM ESC \r 100\x18\x031 58910-S2650',
b'\xf1\x00TM ESC \r 103\x18\x11\x08 58910-S2650',
b'\xf1\x00TM ESC \r 104\x19\a\b 58910-S2650',
b'\xf1\x00TM ESC \x02 100\x18\x030 58910-S2600',
b'\xf1\x00TM ESC \x02 102\x18\x07\x01 58910-S2600',
b'\xf1\x00TM ESC \x02 103\x18\x11\x07 58910-S2600',
b'\xf1\x00TM ESC \x02 104\x19\x07\x07 58910-S2600',
b'\xf1\x00TM ESC \x03 103\x18\x11\x07 58910-S2600',
b'\xf1\x00TM ESC \x0c 103\x18\x11\x08 58910-S2650',
b'\xf1\x00TM ESC \x02 101 \x08\x04 58910-S2GA0',
b'\xf1\x00TM ESC \x03 101 \x08\x02 58910-S2DA0',
b'\xf1\x8758910-S2DA0\xf1\x00TM ESC \x03 101 \x08\x02 58910-S2DA0',
b'\xf1\x8758910-S2GA0\xf1\x00TM ESC \x02 101 \x08\x04 58910-S2GA0',
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x81606EA051\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x81606G1051\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x81606G3051\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x82TMBZN5TMD3XXXG2E',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x87LBJSGA7082574HG0\x87www\x98\x88\x88\x88\x99\xaa\xb9\x9afw\x86gx\x99\xa7\x89co\xf8\xffvU_\xffR\xaf\xf1\x816W3C2051\x00\x00\xf1\x006W351_C2\x00\x006W3C2051\x00\x00TTM2T20NS1\x00\xa6\xe0\x91',
b'\xf1\x87LBKSGA0458404HG0vfvg\x87www\x89\x99\xa8\x99y\xaa\xa7\x9ax\x88\xa7\x88t_\xf9\xff\x86w\x8f\xff\x15x\xf1\x816W3C2051\x00\x00\xf1\x006W351_C2\x00\x006W3C2051\x00\x00TTM2T20NS1\x00\x00\x00\x00',
b'\xf1\x87LDJUEA6010814HG1\x87w\x87x\x86gvw\x88\x88\x98\x88gw\x86wx\x88\x97\x88\x85o\xf8\xff\x86f_\xff\xd37\xf1\x816W3C2051\x00\x00\xf1\x006W351_C2\x00\x006W3C2051\x00\x00TTM4T20NS0\xf8\x19\x92g',
b'\xf1\x87LDJUEA6458264HG1ww\x87x\x97x\x87\x88\x88\x99\x98\x89g\x88\x86xw\x88\x97x\x86o\xf7\xffvw\x8f\xff3\x9a\xf1\x816W3C2051\x00\x00\xf1\x006W351_C2\x00\x006W3C2051\x00\x00TTM4T20NS0\xf8\x19\x92g',
b'\xf1\x87LDKUEA2045844HG1wwww\x98\x88x\x87\x88\x88\xa8\x88x\x99\x97\x89x\x88\xa7\x88U\x7f\xf8\xffvfO\xffC\x1e\xf1\x816W3E0051\x00\x00\xf1\x006W351_C2\x00\x006W3E0051\x00\x00TTM4T20NS3\x00\x00\x00\x00',
b'\xf1\x87LDKUEA9993304HG1\x87www\x97x\x87\x88\x99\x99\xa9\x99x\x99\xa7\x89w\x88\x97x\x86_\xf7\xffwwO\xffl#\xf1\x816W3C2051\x00\x00\xf1\x006W351_C2\x00\x006W3C2051\x00\x00TTM4T20NS1R\x7f\x90\n',
b'\xf1\x87LDLUEA6061564HG1\xa9\x99\x89\x98\x87wwwx\x88\x97\x88x\x99\xa7\x89x\x99\xa7\x89sO\xf9\xffvU_\xff<\xde\xf1\x816W3E1051\x00\x00\xf1\x006W351_C2\x00\x006W3E1051\x00\x00TTM4T20NS50\xcb\xc3\xed',
b'\xf1\x87LDLUEA6159884HG1\x88\x87hv\x99\x99y\x97\x89\xaa\xb8\x9ax\x99\x87\x89y\x99\xb7\x99\xa7?\xf7\xff\x97wo\xff\xf3\x05\xf1\x816W3E1051\x00\x00\xf1\x006W351_C2\x00\x006W3E1051\x00\x00TTM4T20NS5\x00\x00\x00\x00',
b'\xf1\x87LDLUEA6852664HG1\x97wWu\x97www\x89\xaa\xc8\x9ax\x99\x97\x89x\x99\xa7\x89SO\xf7\xff\xa8\x88\x7f\xff\x03z\xf1\x816W3E1051\x00\x00\xf1\x006W351_C2\x00\x006W3E1051\x00\x00TTM4T20NS50\xcb\xc3\xed',
b'\xf1\x87LDLUEA6898374HG1fevW\x87wwwx\x88\x97\x88h\x88\x96\x88x\x88\xa7\x88ao\xf9\xff\x98\x99\x7f\xffD\xe2\xf1\x816W3E1051\x00\x00\xf1\x006W351_C2\x00\x006W3E1051\x00\x00TTM4T20NS5\x00\x00\x00\x00',
b'\xf1\x87LDLUEA6898374HG1fevW\x87wwwx\x88\x97\x88h\x88\x96\x88x\x88\xa7\x88ao\xf9\xff\x98\x99\x7f\xffD\xe2\xf1\x816W3E1051\x00\x00\xf1\x006W351_C2\x00\x006W3E1051\x00\x00TTM4T20NS50\xcb\xc3\xed',
b'\xf1\x87SBJWAA5842214GG0\x88\x87\x88xww\x87x\x89\x99\xa8\x99\x88\x99\x98\x89w\x88\x87xw_\xfa\xfffU_\xff\xd1\x8d\xf1\x816W3C2051\x00\x00\xf1\x006W351_C2\x00\x006W3C2051\x00\x00TTM2G24NS1\x98{|\xe3',
b'\xf1\x87SBJWAA5890864GG0\xa9\x99\x89\x98\x98\x87\x98y\x89\x99\xa8\x99w\x88\x87xww\x87wvo\xfb\xffuD_\xff\x9f\xb5\xf1\x816W3C2051\x00\x00\xf1\x006W351_C2\x00\x006W3C2051\x00\x00TTM2G24NS1\x98{|\xe3',
b'\xf1\x87SBJWAA6562474GG0ffvgeTeFx\x88\x97\x88ww\x87www\x87w\x84o\xfa\xff\x87fO\xff\xc2 \xf1\x816W3C2051\x00\x00\xf1\x006W351_C2\x00\x006W3C2051\x00\x00TTM2G24NS1\x00\x00\x00\x00',
b'\xf1\x87SBJWAA6562474GG0ffvgeTeFx\x88\x97\x88ww\x87www\x87w\x84o\xfa\xff\x87fO\xff\xc2 \xf1\x816W3C2051\x00\x00\xf1\x006W351_C2\x00\x006W3C2051\x00\x00TTM2G24NS1\x98{|\xe3',
b'\xf1\x87SBJWAA7780564GG0wvwgUUeVwwwwx\x88\x87\x88wwwwd_\xfc\xff\x86f\x7f\xff\xd7*\xf1\x816W3C2051\x00\x00\xf1\x006W351_C2\x00\x006W3C2051\x00\x00TTM2G24NS2F\x84<\xc0',
b'\xf1\x87SBJWAA8278284GG0ffvgUU\x85Xx\x88\x87\x88x\x88w\x88ww\x87w\x96o\xfd\xff\xa7U_\xff\xf2\xa0\xf1\x816W3C2051\x00\x00\xf1\x006W351_C2\x00\x006W3C2051\x00\x00TTM2G24NS2F\x84<\xc0',
b'\xf1\x87SBLWAA4363244GG0wvwgwv\x87hgw\x86ww\x88\x87xww\x87wdo\xfb\xff\x86f\x7f\xff3$\xf1\x816W3E1051\x00\x00\xf1\x006W351_C2\x00\x006W3E1051\x00\x00TTM2G24NS6\x00\x00\x00\x00',
b'\xf1\x87SBLWAA4363244GG0wvwgwv\x87hgw\x86ww\x88\x87xww\x87wdo\xfb\xff\x86f\x7f\xff3$\xf1\x816W3E1051\x00\x00\xf1\x006W351_C2\x00\x006W3E1051\x00\x00TTM2G24NS6x0\x17\xfe',
b'\xf1\x87SBLWAA4899564GG0VfvgUU\x85Xx\x88\x87\x88vfgf\x87wxwvO\xfb\xff\x97f\xb1\xffSB\xf1\x816W3E1051\x00\x00\xf1\x006W351_C2\x00\x006W3E1051\x00\x00TTM2G24NS7\x00\x00\x00\x00',
b'\xf1\x87SBLWAA6622844GG0wwwwff\x86hwwwwx\x88\x87\x88\x88\x88\x88\x88\x98?\xfd\xff\xa9\x88\x7f\xffn\xe5\xf1\x816W3E1051\x00\x00\xf1\x006W351_C2\x00\x006W3E1051\x00\x00TTM2G24NS7u\x1e{\x1c',
b'\xf1\x87SDJXAA7656854GG1DEtWUU\x85X\x88\x88\x98\x88w\x88\x87xx\x88\x87\x88\x96o\xfb\xff\x86f\x7f\xff.\xca\xf1\x816W3C2051\x00\x00\xf1\x006W351_C2\x00\x006W3C2051\x00\x00TTM4G24NS2\x00\x00\x00\x00',
b'\xf1\x87SDJXAA7656854GG1DEtWUU\x85X\x88\x88\x98\x88w\x88\x87xx\x88\x87\x88\x96o\xfb\xff\x86f\x7f\xff.\xca\xf1\x816W3C2051\x00\x00\xf1\x006W351_C2\x00\x006W3C2051\x00\x00TTM4G24NS2K\xdaV0',
b'\xf1\x87SDKXAA2443414GG1vfvgwv\x87h\x88\x88\x88\x88ww\x87wwwww\x99_\xfc\xffvD?\xffl\xd2\xf1\x816W3E1051\x00\x00\xf1\x006W351_C2\x00\x006W3E1051\x00\x00TTM4G24NS6\x00\x00\x00\x00',
b'\xf1\x00T02601BL T02730A1 VTMPT25XXX730NS2\xa6\x06\x88\xf7',
b'\xf1\x87SDMXCA8653204GN1EVugEUuWwwwwww\x87wwwwwv/\xfb\xff\xa8\x88\x9f\xff\xa5\x9c\xf1\x89HT6WAD00A1\xf1\x82STM4G25NH1\x00\x00\x00\x00\x00\x00',
b'\xf1\x87954A02N250\x00\x00\x00\x00\x00\xf1\x81T02730A1 \xf1\x00T02601BL T02730A1 VTMPT25XXX730NS2\xa6\x06\x88\xf7',
],
},
CAR.SANTA_FE_HEV: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x8799110CL500\xf1\x00TMhe SCC FHCUP 1.00 1.00 99110-CL500 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00TMH MFC AT USA LHD 1.00 1.03 99211-S1500 210224',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x00TM MDPS C 1.00 1.02 56310-CLAC0 4TSHC102',
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x87391312MTC1',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x87959102T250\x00\x00\x00\x00\x00\xf1\x81E14\x00\x00\x00\x00\x00\x00\x00\xf1\x00PSBG2333 E14\x00\x00\x00\x00\x00\x00\x00TTM2H16SA2\x80\xd7l\xb2',
],
},
CAR.PALISADE: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\000LX2_ SCC F-CUP 1.00 1.05 99110-S8100 ',
b'\xf1\x00LX2 SCC FHCUP 1.00 1.04 99110-S8100 ',
b'\xf1\x00LX2_ SCC FHCU- 1.00 1.05 99110-S8100 ',
b'\xf1\x00LX2_ SCC FHCUP 1.00 1.00 99110-S8110 ',
b'\xf1\x00LX2_ SCC FHCUP 1.00 1.04 99110-S8100 ',
b'\xf1\x00LX2_ SCC FHCUP 1.00 1.05 99110-S8100 ',
b'\xf1\x00ON__ FCA FHCUP 1.00 1.02 99110-S9100 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00LX2 MFC AT USA LHD 1.00 1.03 99211-S8100 190125',
b'\xf1\x00LX2 MFC AT USA LHD 1.00 1.05 99211-S8100 190909',
b'\xf1\x00LX2 MFC AT USA LHD 1.00 1.07 99211-S8100 200422',
b'\xf1\x00LX2 MFC AT USA LHD 1.00 1.08 99211-S8100 200903',
b'\xf1\x00ON MFC AT USA LHD 1.00 1.01 99211-S9100 181105',
b'\xf1\x00ON MFC AT USA LHD 1.00 1.03 99211-S9100 200720',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x00LX2 MDPS C 1,00 1,03 56310-S8020 4LXDC103', # modified firmware
b'\xf1\x00LX2 MDPS C 1.00 1.03 56310-S8020 4LXDC103',
b'\xf1\x00LX2 MDPS C 1.00 1.04 56310-S8020 4LXDC104',
b'\xf1\x00ON MDPS C 1.00 1.00 56340-S9000 8B13',
b'\xf1\x00ON MDPS C 1.00 1.01 56340-S9000 9201',
],
(Ecu.esp, 0x7d1, None): [
b'\xf1\x00LX ESC \x01 103\x19\t\x10 58910-S8360',
b'\xf1\x00LX ESC \x01 103\x31\t\020 58910-S8360',
b'\xf1\x00LX ESC \x0b 101\x19\x03\x17 58910-S8330',
b'\xf1\x00LX ESC \x0b 102\x19\x05\x07 58910-S8330',
b'\xf1\x00LX ESC \x0b 103\x19\t\x07 58910-S8330',
b'\xf1\x00LX ESC \x0b 103\x19\t\x10 58910-S8360',
b'\xf1\x00LX ESC \x0b 104 \x10\x16 58910-S8360',
b'\xf1\x00ON ESC \x0b 100\x18\x12\x18 58910-S9360',
b'\xf1\x00ON ESC \x0b 101\x19\t\x08 58910-S9360',
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x81640J0051\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x81640K0051\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x81640S1051\x00\x00\x00\x00\x00\x00\x00\x00',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x00bcsh8p54 U872\x00\x00\x00\x00\x00\x00TON4G38NB1\x96z28',
b'\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00TON4G38NB2[v\\\xb6',
b'\xf1\x87LBLUFN591307KF25vgvw\x97wwwy\x99\xa7\x99\x99\xaa\xa9\x9af\x88\x96h\x95o\xf7\xff\x99f/\xff\xe4c\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX2G38NB2\xd7\xc1/\xd1',
b'\xf1\x87LBLUFN650868KF36\xa9\x98\x89\x88\xa8\x88\x88\x88h\x99\xa6\x89fw\x86gw\x88\x97x\xaa\x7f\xf6\xff\xbb\xbb\x8f\xff+\x82\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX2G38NB3\xd1\xc3\xf8\xa8',
b'\xf1\x87LBLUFN655162KF36\x98\x88\x88\x88\x98\x88\x88\x88x\x99\xa7\x89x\x99\xa7\x89x\x99\x97\x89g\x7f\xf7\xffwU_\xff\xe9!\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX2G38NB3\xd1\xc3\xf8\xa8',
b'\xf1\x87LBLUFN731381KF36\xb9\x99\x89\x98\x98\x88\x88\x88\x89\x99\xa8\x99\x88\x99\xa8\x89\x88\x88\x98\x88V\177\xf6\xff\x99w\x8f\xff\xad\xd8\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\000bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX2G38NB3\xd1\xc3\xf8\xa8',
b'\xf1\x87LDKVAA0028604HH1\xa8\x88x\x87vgvw\x88\x99\xa8\x89gw\x86ww\x88\x97x\x97o\xf9\xff\x97w\x7f\xffo\x02\xf1\x81U872\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U872\x00\x00\x00\x00\x00\x00TON4G38NB1\x96z28',
b'\xf1\x87LDKVAA3068374HH1wwww\x87xw\x87y\x99\xa7\x99w\x88\x87xw\x88\x97x\x85\xaf\xfa\xffvU/\xffU\xdc\xf1\x81U872\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U872\x00\x00\x00\x00\x00\x00TON4G38NB1\x96z28',
b'\xf1\x87LDKVBN382172KF26\x98\x88\x88\x88\xa8\x88\x88\x88x\x99\xa7\x89\x87\x88\x98x\x98\x99\xa9\x89\xa5_\xf6\xffDDO\xff\xcd\x16\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB2\xafL]\xe7',
b'\xf1\x87LDKVBN424201KF26\xba\xaa\x9a\xa9\x99\x99\x89\x98\x89\x99\xa8\x99\x88\x99\x98\x89\x88\x99\xa8\x89v\x7f\xf7\xffwf_\xffq\xa6\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB2\xafL]\xe7',
b'\xf1\x87LDKVBN540766KF37\x87wgv\x87w\x87xx\x99\x97\x89v\x88\x97h\x88\x88\x88\x88x\x7f\xf6\xffvUo\xff\xd3\x01\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB2\xafL]\xe7',
b'\xf1\x87LDLVAA4225634HH1\x98\x88\x88\x88eUeVx\x88\x87\x88g\x88\x86xx\x88\x87\x88\x86o\xf9\xff\x87w\x7f\xff\xf2\xf7\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00TON4G38NB2[v\\\xb6',
b'\xf1\x87LDLVAA4777834HH1\x98\x88x\x87\x87wwwx\x88\x87\x88x\x99\x97\x89x\x88\x97\x88\x86o\xfa\xff\x86fO\xff\x1d9\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00TON4G38NB2[v\\\xb6',
b'\xf1\x87LDLVAA5194534HH1ffvguUUUx\x88\xa7\x88h\x99\x96\x89x\x88\x97\x88ro\xf9\xff\x98wo\xff\xaaM\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00TON4G38NB2[v\\\xb6',
b'\xf1\x87LDLVAA5949924HH1\xa9\x99y\x97\x87wwwx\x99\x97\x89x\x99\xa7\x89x\x99\xa7\x89\x87_\xfa\xffeD?\xff\xf1\xfd\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00TON4G38NB2[v\\\xb6',
b'\xf1\x87LDLVBN560098KF26\x86fff\x87vgfg\x88\x96xfw\x86gfw\x86g\x95\xf6\xffeU_\xff\x92c\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB2\xafL]\xe7',
b'\xf1\x87LDLVBN602045KF26\xb9\x99\x89\x98\x97vwgy\xaa\xb7\x9af\x88\x96hw\x99\xa7y\xa9\x7f\xf5\xff\x99w\x7f\xff,\xd3\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB3X\xa8\xc08',
b'\xf1\x87LDLVBN628911KF26\xa9\x99\x89\x98\x98\x88\x88\x88y\x99\xa7\x99fw\x86gw\x88\x87x\x83\x7f\xf6\xff\x98wo\xff2\xda\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB3X\xa8\xc08',
b'\xf1\x87LDLVBN645817KF37\x87www\x98\x87xwx\x99\x97\x89\x99\x99\x99\x99g\x88\x96x\xb6_\xf7\xff\x98fo\xff\xe2\x86\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB3X\xa8\xc08',
b'\xf1\x87LDLVBN662115KF37\x98\x88\x88\x88\xa8\x88\x88\x88x\x99\x97\x89x\x99\xa7\x89\x88\x99\xa8\x89\x88\x7f\xf7\xfffD_\xff\xdc\x84\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB3X\xa8\xc08',
b'\xf1\x87LDLVBN667933KF37\xb9\x99\x89\x98\xb9\x99\x99\x99x\x88\x87\x88w\x88\x87x\x88\x88\x98\x88\xcbo\xf7\xffe3/\xffQ!\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB3X\xa8\xc08',
b'\xf1\x87LDLVBN673087KF37\x97www\x86fvgx\x99\x97\x89\x99\xaa\xa9\x9ag\x88\x86x\xe9_\xf8\xff\x98w\x7f\xff"\xad\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB3X\xa8\xc08',
b'\xf1\x87LDLVBN673841KF37\x98\x88x\x87\x86g\x86xy\x99\xa7\x99\x88\x99\xa8\x89w\x88\x97xdo\xf5\xff\x98\x88\x8f\xffT\xec\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB3X\xa8\xc08',
b'\xf1\x87LDLVBN681363KF37\x98\x88\x88\x88\x97x\x87\x88y\xaa\xa7\x9a\x88\x88\x98\x88\x88\x88\x88\x88vo\xf6\xffvD\x7f\xff%v\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB3X\xa8\xc08',
b'\xf1\x87LDLVBN713782KF37\x99\x99y\x97\x98\x88\x88\x88x\x88\x97\x88\x88\x99\x98\x89\x88\x99\xa8\x89\x87o\xf7\xffeU?\xff7,\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB3X\xa8\xc08',
b'\xf1\x87LDLVBN713890KF26\xb9\x99\x89\x98\xa9\x99\x99\x99x\x99\x97\x89\x88\x99\xa8\x89\x88\x99\xb8\x89Do\xf7\xff\xa9\x88o\xffs\r\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB3X\xa8\xc08',
b'\xf1\x87LDLVBN733215KF37\x99\x98y\x87\x97wwwi\x99\xa6\x99x\x99\xa7\x89V\x88\x95h\x86o\xf7\xffeDO\xff\x12\xe7\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB3X\xa8\xc08',
b'\xf1\x87LDLVBN750044KF37\xca\xa9\x8a\x98\xa7wwwy\xaa\xb7\x9ag\x88\x96x\x88\x99\xa8\x89\xb9\x7f\xf6\xff\xa8w\x7f\xff\xbe\xde\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB3X\xa8\xc08',
b'\xf1\x87LDLVBN752612KF37\xba\xaa\x8a\xa8\x87w\x87xy\xaa\xa7\x9a\x88\x99\x98\x89x\x88\x97\x88\x96o\xf6\xffvU_\xffh\x1b\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB3X\xa8\xc08',
b'\xf1\x87LDLVBN755553KF37\x87xw\x87\x97w\x87xy\x99\xa7\x99\x99\x99\xa9\x99Vw\x95gwo\xf6\xffwUO\xff\xb5T\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB3X\xa8\xc08',
b'\xf1\x87LDLVBN757883KF37\x98\x87xw\x98\x87\x88xy\xaa\xb7\x9ag\x88\x96x\x89\x99\xa8\x99e\x7f\xf6\xff\xa9\x88o\xff5\x15\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB4\xd6\xe8\xd7\xa6',
b'\xf1\x87LDMVBN778156KF37\x87vWe\xa9\x99\x99\x99y\x99\xb7\x99\x99\x99\x99\x99x\x99\x97\x89\xa8\x7f\xf8\xffwf\x7f\xff\x82_\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB4\xd6\xe8\xd7\xa6',
b'\xf1\x87LDMVBN780576KF37\x98\x87hv\x97x\x97\x89x\x99\xa7\x89\x88\x99\x98\x89w\x88\x97x\x98\x7f\xf7\xff\xba\x88\x8f\xff\x1e0\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB4\xd6\xe8\xd7\xa6',
b'\xf1\x87LDMVBN783485KF37\x87www\x87vwgy\x99\xa7\x99\x99\x99\xa9\x99Vw\x95g\x89_\xf6\xff\xa9w_\xff\xc5\xd6\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB4\xd6\xe8\xd7\xa6',
b'\xf1\x87LDMVBN811844KF37\x87vwgvfffx\x99\xa7\x89Vw\x95gg\x88\xa6xe\x8f\xf6\xff\x97wO\xff\t\x80\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB4\xd6\xe8\xd7\xa6',
b'\xf1\x87LDMVBN830601KF37\xa7www\xa8\x87xwx\x99\xa7\x89Uw\x85Ww\x88\x97x\x88o\xf6\xff\x8a\xaa\x7f\xff\xe2:\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB4\xd6\xe8\xd7\xa6',
b'\xf1\x87LDMVBN848789KF37\x87w\x87x\x87w\x87xy\x99\xb7\x99\x87\x88\x98x\x88\x99\xa8\x89\x87\x7f\xf6\xfffUo\xff\xe3!\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB5\xb9\x94\xe8\x89',
b'\xf1\x87LDMVBN851595KF37\x97wgvvfffx\x99\xb7\x89\x88\x99\x98\x89\x87\x88\x98x\x99\x7f\xf7\xff\x97w\x7f\xff@\xf3\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB5\xb9\x94\xe8\x89',
b'\xf1\x87LDMVBN873175KF26\xa8\x88\x88\x88vfVex\x99\xb7\x89\x88\x99\x98\x89x\x88\x97\x88f\x7f\xf7\xff\xbb\xaa\x8f\xff,\x04\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB5\xb9\x94\xe8\x89',
b'\xf1\x87LDMVBN879401KF26veVU\xa8\x88\x88\x88g\x88\xa6xVw\x95gx\x88\xa7\x88v\x8f\xf9\xff\xdd\xbb\xbf\xff\xb3\x99\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB5\xb9\x94\xe8\x89',
b'\xf1\x87LDMVBN881314KF37\xa8\x88h\x86\x97www\x89\x99\xa8\x99w\x88\x97xx\x99\xa7\x89\xca\x7f\xf8\xff\xba\x99\x8f\xff\xd8v\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB5\xb9\x94\xe8\x89',
b'\xf1\x87LDMVBN888651KF37\xa9\x99\x89\x98vfff\x88\x99\x98\x89w\x99\xa7y\x88\x88\x98\x88D\x8f\xf9\xff\xcb\x99\x8f\xff\xa5\x1e\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB5\xb9\x94\xe8\x89',
b'\xf1\x87LDMVBN889419KF37\xa9\x99y\x97\x87w\x87xx\x88\x97\x88w\x88\x97x\x88\x99\x98\x89e\x9f\xf9\xffeUo\xff\x901\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB5\xb9\x94\xe8\x89',
b'\xf1\x87LDMVBN895969KF37vefV\x87vgfx\x99\xa7\x89\x99\x99\xb9\x99f\x88\x96he_\xf7\xffxwo\xff\x14\xf9\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB5\xb9\x94\xe8\x89',
b'\xf1\x87LDMVBN899222KF37\xa8\x88x\x87\x97www\x98\x99\x99\x89\x88\x99\x98\x89f\x88\x96hdo\xf7\xff\xbb\xaa\x9f\xff\xe2U\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB5\xb9\x94\xe8\x89',
b"\xf1\x87LBLUFN622950KF36\xa8\x88\x88\x88\x87w\x87xh\x99\x96\x89\x88\x99\x98\x89\x88\x99\x98\x89\x87o\xf6\xff\x98\x88o\xffx'\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX2G38NB3\xd1\xc3\xf8\xa8",
],
},
CAR.VELOSTER: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00JS__ SCC H-CUP 1.00 1.02 95650-J3200 ',
b'\xf1\x00JS__ SCC HNCUP 1.00 1.02 95650-J3100 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00JS LKAS AT USA LHD 1.00 1.02 95740-J3000 K32',
b'\xf1\x00JS LKAS AT KOR LHD 1.00 1.03 95740-J3000 K33',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x00JSL MDPS C 1.00 1.03 56340-J3000 8308',
],
(Ecu.esp, 0x7d1, None): [
b'\xf1\x00\x00\x00\x00\x00\x00\x00',
],
(Ecu.engine, 0x7e0, None): [
b'\x01TJS-JNU06F200H0A',
b'\x01TJS-JDK06F200H0A',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x816U2V8051\x00\x00\xf1\x006U2V0_C2\x00\x006U2V8051\x00\x00DJS0T16NS1\xba\x02\xb8\x80',
b'\xf1\x816U2V8051\x00\x00\xf1\x006U2V0_C2\x00\x006U2V8051\x00\x00DJS0T16NS1\x00\x00\x00\x00',
b'\xf1\x816U2V8051\x00\x00\xf1\x006U2V0_C2\x00\x006U2V8051\x00\x00DJS0T16KS2\016\xba\036\xa2',
],
},
# kia
CAR.FORTE: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00BD__ SCC H-CUP 1.00 1.02 99110-M6000 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00BD LKAS AT USA LHD 1.00 1.04 95740-M6000 J33',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x00BD MDPS C 1.00 1.02 56310-XX000 4BD2C102',
b'\xf1\x00BD MDPS C 1.00 1.08 56310/M6300 4BDDC108',
b'\xf1\x00BD MDPS C 1.00 1.08 56310M6300\x00 4BDDC108',
],
(Ecu.esp, 0x7d1, None): [
b'\xf1\x816VGRAH00018.ELF\xf1\x00\x00\x00\x00\x00\x00\x00',
],
(Ecu.engine, 0x7e0, None): [
b'\x01TBDM1NU06F200H01',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x816U2VC051\x00\x00\xf1\x006U2V0_C2\x00\x006U2VC051\x00\x00DBD0T16SS0\x00\x00\x00\x00',
b"\xf1\x816U2VC051\x00\x00\xf1\x006U2V0_C2\x00\x006U2VC051\x00\x00DBD0T16SS0\xcf\x1e'\xc3", ],
},
CAR.K5: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00JF__ SCC F-CUP 1.00 1.00 96400-D4110 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00JFA LKAS AT USA LHD 1.00 1.02 95895-D5000 h31',
b'\xf1\x00JFA LKAS AT USA LHD 1.00 1.00 95895-D5001 h32',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x00TM MDPS C 1.00 1.00 56340-S2000 8409',
],
(Ecu.esp, 0x7d1, None): [
b'\xf1\x00JF ESC \v 11 \x18\x030 58920-D5180',
],
(Ecu.engine, 0x7e0, None): [
b'\x01TJFAJNU06F201H03',
b'\xf1\x89F1JF600AISEIU702\xf1\x82F1JF600AISEIU702',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x816U2V8051\x00\x00\xf1\x006U2V0_C2\x00\x006U2V8051\x00\x00DJF0T16NL0\t\xd2GW', ],
},
CAR.K5_HEV: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00DEhe SCC H-CUP 1.01 1.02 96400-G5100 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00DEP MFC AT USA LHD 1.00 1.01 95740-G5010 170424',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x00DE MDPS C 1.00 1.09 56310G5301\x00 4DEHC109',
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x816H6F4051\x00\x00\x00\x00\x00\x00\x00\x00',
],
(Ecu.transmission, 0x7e1, None): [
b"\xf1\x816U3J2051\x00\x00\xf1\x006U3H0_C2\x00\x006U3J2051\x00\x00PDE0G16NS2\xf4'\\\x91", ],
},
CAR.K5_DL3: {
(Ecu.fwdRadar, 0x7D0, None): [
b'\xf1\000DL3_ SCC FHCUP 1.00 1.03 99110-L2000 ',
b'\xf1\x8799110L2000\xf1\000DL3_ SCC FHCUP 1.00 1.03 99110-L2000 ',
b'\xf1\x8799110L2100\xf1\x00DL3_ SCC F-CUP 1.00 1.03 99110-L2100 ',
b'\xf1\x8799110L2100\xf1\x00DL3_ SCC FHCUP 1.00 1.03 99110-L2100 ',
],
(Ecu.fwdCamera, 0x7C4, None): [
b'\xf1\000DL3 MFC AT USA LHD 1.00 1.03 99210-L3000 200915',
b'\xf1\x00DL3 MFC AT USA LHD 1.00 1.04 99210-L3000 210208',
],
(Ecu.eps, 0x7D4, None): [
b'\xf1\x8756310-L3110\xf1\000DL3 MDPS C 1.00 1.01 56310-L3110 4DLAC101',
b'\xf1\x8756310-L3220\xf1\x00DL3 MDPS C 1.00 1.01 56310-L3220 4DLAC101',
b'\xf1\x8757700-L3000\xf1\x00DL3 MDPS R 1.00 1.02 57700-L3000 4DLAP102',
],
(Ecu.esp, 0x7D1, None): [
b'\xf1\000DL ESC \006 101 \004\002 58910-L3200',
b'\xf1\x8758910-L3200\xf1\000DL ESC \006 101 \004\002 58910-L3200',
b'\xf1\x8758910-L3800\xf1\x00DL ESC \t 101 \x07\x02 58910-L3800',
b'\xf1\x8758910-L3600\xf1\x00DL ESC \x03 100 \x08\x02 58910-L3600',
],
(Ecu.engine, 0x7E0, None): [
b'\xf1\x87391212MKT0',
b'\xf1\x87391212MKV0',
b'\xf1\x870\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\xf1\x82DLDWN5TMDCXXXJ1B',
],
(Ecu.transmission, 0x7E1, None): [
b'\xf1\000bcsh8p54 U913\000\000\000\000\000\000TDL2T16NB1ia\v\xb8',
b'\xf1\x87SALFEA5652514GK2UUeV\x88\x87\x88xxwg\x87ww\x87wwfwvd/\xfb\xffvU_\xff\x93\xd3\xf1\x81U913\000\000\000\000\000\000\xf1\000bcsh8p54 U913\000\000\000\000\000\000TDL2T16NB1ia\v\xb8',
b'\xf1\x87SALFEA6046104GK2wvwgeTeFg\x88\x96xwwwwffvfe?\xfd\xff\x86fo\xff\x97A\xf1\x81U913\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U913\x00\x00\x00\x00\x00\x00TDL2T16NB1ia\x0b\xb8',
b'\xf1\x87SCMSAA8572454GK1\x87x\x87\x88Vf\x86hgwvwvwwgvwwgT?\xfb\xff\x97fo\xffH\xb8\xf1\x81U913\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U913\x00\x00\x00\x00\x00\x00TDL4T16NB05\x94t\x18',
b'\xf1\x87954A02N300\x00\x00\x00\x00\x00\xf1\x81T02730A1 \xf1\x00T02601BL T02730A1 WDL3T25XXX730NS2b\x1f\xb8%',
],
},
CAR.STINGER: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00CK__ SCC F_CUP 1.00 1.01 96400-J5100 ',
b'\xf1\x00CK__ SCC F_CUP 1.00 1.03 96400-J5100 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00CK MFC AT USA LHD 1.00 1.03 95740-J5000 170822',
b'\xf1\x00CK MFC AT USA LHD 1.00 1.04 95740-J5000 180504',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x00CK MDPS R 1.00 1.04 57700-J5200 4C2CL104',
b'\xf1\x00CK MDPS R 1.00 1.04 57700-J5220 4C2VL104',
b'\xf1\x00CK MDPS R 1.00 1.04 57700-J5420 4C4VL104',
b'\xf1\x00CK MDPS R 1.00 1.06 57700-J5420 4C4VL106',
b'\xf1\x00CK MDPS R 1.00 1.07 57700-J5420 4C4VL107',
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x81606DE051\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x81640E0051\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x81640L0051\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x82CKJN3TMSDE0B\x00\x00\x00\x00',
b'\xf1\x82CKKN3TMD_H0A\x00\x00\x00\x00',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x87VCJLE17622572DK0vd6D\x99\x98y\x97vwVffUfvfC%CuT&Dx\x87o\xff{\x1c\xf1\x81E21\x00\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 E21\x00\x00\x00\x00\x00\x00\x00SCK0T33NB0\x88\xa2\xe6\xf0',
b'\xf1\x87VDHLG17000192DK2xdFffT\xa5VUD$DwT\x86wveVeeD&T\x99\xba\x8f\xff\xcc\x99\xf1\x81E21\x00\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 E21\x00\x00\x00\x00\x00\x00\x00SCK0T33NB0\x88\xa2\xe6\xf0',
b'\xf1\x87VDHLG17000192DK2xdFffT\xa5VUD$DwT\x86wveVeeD&T\x99\xba\x8f\xff\xcc\x99\xf1\x89E21\x00\x00\x00\x00\x00\x00\x00\xf1\x82SCK0T33NB0',
b'\xf1\x87VDHLG17034412DK2vD6DfVvVTD$D\x99w\x88\x98EDEDeT6DgfO\xff\xc3=\xf1\x81E21\x00\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 E21\x00\x00\x00\x00\x00\x00\x00SCK0T33NB0\x88\xa2\xe6\xf0',
b'\xf1\x87VDHLG17118862DK2\x8awWwgu\x96wVfUVwv\x97xWvfvUTGTx\x87o\xff\xc9\xed\xf1\x81E21\x00\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 E21\x00\x00\x00\x00\x00\x00\x00SCK0T33NB0\x88\xa2\xe6\xf0',
b'\xf1\x87VDJLG18425192DK2xeGewfgf\x86eFeweWv\x88eVeuTGT\x89vo\xff\tJ\xf1\x81E24\x00\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 E24\x00\x00\x00\x00\x00\x00\x00SCK0T33NB1\x8a\xdcM\x90',
b'\xf1\x87VDKLJ18675252DK6\x89vhgwwwwveVU\x88w\x87w\x99vgf\x97vXfgw_\xff\xc2\xfb\xf1\x89E25\x00\x00\x00\x00\x00\x00\x00\xf1\x82TCK0T33NB2',
b'\xf1\x87WAJTE17552812CH4vfFffvfVeT5DwvvVVdFeegeg\x88\x88o\xff\x1a]\xf1\x81E21\x00\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 E21\x00\x00\x00\x00\x00\x00\x00TCK2T20NB1\x19\xd2\x00\x94',
],
},
CAR.NIRO_EV: {
(Ecu.fwdRadar, 0x7D0, None): [
b'\xf1\x00DEev SCC F-CUP 1.00 1.00 99110-Q4000 ',
b'\xf1\x00DEev SCC F-CUP 1.00 1.02 96400-Q4100 ',
b'\xf1\x00DEev SCC F-CUP 1.00 1.03 96400-Q4100 ',
b'\xf1\x00OSev SCC F-CUP 1.00 1.01 99110-K4000 ',
b'\xf1\x8799110Q4000\xf1\x00DEev SCC F-CUP 1.00 1.00 99110-Q4000 ',
b'\xf1\x8799110Q4100\xf1\x00DEev SCC F-CUP 1.00 1.00 99110-Q4100 ',
b'\xf1\x8799110Q4500\xf1\x00DEev SCC F-CUP 1.00 1.00 99110-Q4500 ',
b'\xf1\x8799110Q4600\xf1\x00DEev SCC FNCUP 1.00 1.00 99110-Q4600 ',
b'\xf1\x8799110Q4600\xf1\x00DEev SCC FHCUP 1.00 1.00 99110-Q4600 ',
],
(Ecu.fwdCamera, 0x7C4, None): [
b'\xf1\x00DEE MFC AT USA LHD 1.00 1.03 95740-Q4000 180821',
b'\xf1\x00DEE MFC AT EUR LHD 1.00 1.00 99211-Q4000 191211',
b'\xf1\x00DEE MFC AT USA LHD 1.00 1.00 99211-Q4000 191211',
b'\xf1\000DEE MFC AT EUR LHD 1.00 1.00 99211-Q4100 200706',
b'\xf1\x00OSE LKAS AT EUR LHD 1.00 1.00 95740-K4100 W40',
],
(Ecu.eps, 0x7D4, None): [
b'\xf1\x00OS MDPS C 1.00 1.04 56310K4050\x00 4OEDC104',
b'\xf1\x00DE MDPS C 1.00 1.05 56310Q4000\x00 4DEEC105',
b'\xf1\x00DE MDPS C 1.00 1.05 56310Q4100\x00 4DEEC105',
],
(Ecu.esp, 0x7D1, None): [
b'\xf1\x00OS IEB \r 212 \x11\x13 58520-K4000',
],
},
CAR.NIRO_HEV: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00DEhe SCC H-CUP 1.01 1.02 96400-G5100 ',
b'\xf1\x00DEhe SCC FHCUP 1.00 1.00 99110-G5600 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00DEP MFC AT USA LHD 1.00 1.01 95740-G5010 170424',
b'\xf1\x00DEH MFC AT USA LHD 1.00 1.07 99211-G5000 201221',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\000DE MDPS C 1.00 1.09 56310G5301\000 4DEHC109',
b'\xf1\x00DE MDPS C 1.00 1.01 56310G5520\x00 4DEPC101',
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x816H6F4051\000\000\000\000\000\000\000\000',
b'\xf1\x816H6G5051\x00\x00\x00\x00\x00\x00\x00\x00',
],
(Ecu.transmission, 0x7e1, None): [
b"\xf1\x816U3J2051\000\000\xf1\0006U3H0_C2\000\0006U3J2051\000\000PDE0G16NS2\xf4\'\\\x91",
b'\xf1\x816U3J2051\000\000\xf1\0006U3H0_C2\000\0006U3J2051\000\000PDE0G16NS2\000\000\000\000',
b'\xf1\x816U3J9051\x00\x00\xf1\x006U3H1_C2\x00\x006U3J9051\x00\x00HDE0G16NL3\x00\x00\x00\x00',
b'\xf1\x816U3J9051\x00\x00\xf1\x006U3H1_C2\x00\x006U3J9051\x00\x00HDE0G16NL3\xb9\xd3\xfaW',
],
},
CAR.SELTOS: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x8799110Q5100\xf1\000SP2_ SCC FHCUP 1.01 1.05 99110-Q5100 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\000SP2 MFC AT USA LHD 1.00 1.04 99210-Q5000 191114',
b'\xf1\000SP2 MFC AT USA LHD 1.00 1.05 99210-Q5000 201012',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\000SP2 MDPS C 1.00 1.04 56300Q5200 ',
b'\xf1\000SP2 MDPS C 1.01 1.05 56300Q5200 ',
],
(Ecu.esp, 0x7d1, None): [
b'\xf1\x8758910-Q5450\xf1\000SP ESC \a 101\031\t\005 58910-Q5450',
b'\xf1\x8758910-Q5450\xf1\000SP ESC \t 101\031\t\005 58910-Q5450',
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x81616D2051\000\000\000\000\000\000\000\000',
b'\xf1\x81616D5051\000\000\000\000\000\000\000\000',
b'\001TSP2KNL06F100J0K',
b'\001TSP2KNL06F200J0K',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x87CZLUB49370612JF7h\xa8y\x87\x99\xa7hv\x99\x97fv\x88\x87x\x89x\x96O\xff\x88\xff\xff\xff.@\xf1\x816V2C2051\000\000\xf1\0006V2B0_C2\000\0006V2C2051\000\000CSP4N20NS3\000\000\000\000',
b'\xf1\x87954A22D200\xf1\x81T01950A1 \xf1\000T0190XBL T01950A1 DSP2T16X4X950NS6\xd30\xa5\xb9',
b'\xf1\x87954A22D200\xf1\x81T01950A1 \xf1\000T0190XBL T01950A1 DSP2T16X4X950NS8\r\xfe\x9c\x8b',
],
},
CAR.K7: {
(Ecu.eps, 0x7d4, None): [b'\xf1\000YG MDPS C 1.00 1.01 56310F6350\000 4YG7C101',],
},
# Genesis
CAR.GENESIS_G70: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00IK__ SCC F-CUP 1.00 1.02 96400-G9100 ',
b'\xf1\x00IK__ SCC F-CUP 1.00 1.02 96400-G9100 \xf1\xa01.02',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00IK MFC AT USA LHD 1.00 1.01 95740-G9000 170920',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x00IK MDPS R 1.00 1.06 57700-G9420 4I4VL106',
b'\xf1\x00IK MDPS R 1.00 1.07 57700-G9220 4I2VL107',
],
(Ecu.esp, 0x7d1, None): [
b'\xf1\x00\x00\x00\x00\x00\x00\x00',
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x81640F0051\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x81640J0051\x00\x00\x00\x00\x00\x00\x00\x00',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x87VDJLT17895112DN4\x88fVf\x99\x88\x88\x88\x87fVe\x88vhwwUFU\x97eFex\x99\xff\xb7\x82\xf1\x81E25\x00\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 E25\x00\x00\x00\x00\x00\x00\x00SIK0T33NB2\x11\x1am\xda',
b'\xf1\x87VCJLP18407832DN3\x88vXfvUVT\x97eFU\x87d7v\x88eVeveFU\x89\x98\x7f\xff\xb2\xb0\xf1\x81E25\x00\x00\x00'
b'\x00\x00\x00\x00\xf1\x00bcsh8p54 E25\x00\x00\x00\x00\x00\x00\x00SIK0T33NB4\xecE\xefL',
],
},
}
CHECKSUM = {
"crc8": [CAR.SONATA, CAR.SANTA_FE, CAR.PALISADE, CAR.SELTOS, CAR.ELANTRA21, CAR.K5_DL3,
CAR.SONATA_HEV, CAR.SANTA_FE_HEV, CAR.SOUL_EV, CAR.ELANTRA21_HEV, CAR.K5_DL3_HEV],
"6B": [CAR.SORENTO, CAR.GENESIS],
}
FEATURES = {
"use_cluster_gears": # Use Cluster for Gear Selection, rather than Transmission [ CLU15 ]
{CAR.ELANTRA_I30, CAR.KONA, CAR.GRANDEUR, CAR.MOHAVE, CAR.NIRO_HEV, CAR.K7},
"use_tcu_gears": # Use TCU Message for Gear Selection [ TCU12 ]
{CAR.SONATA_LF, CAR.VELOSTER, CAR.K5},
"use_elect_gears": # Use Elect GEAR Message for Gear Selection [ ELECT_GEAR ]
{CAR.KONA_EV, CAR.IONIQ_EV, CAR.NEXO, CAR.NIRO_EV, CAR.SOUL_EV, CAR.KONA_HEV, CAR.IONIQ_HEV, CAR.NIRO_HEV,
CAR.SONATA_HEV, CAR.SONATA_LF_HEV, CAR.GRANDEUR_HEV, CAR.GRANDEUR20_HEV,
CAR.K5_HEV, CAR.K5_DL3_HEV, CAR.K7_HEV},
# Gear not set is [ LVR12 ]
# these cars use the [ FCA11 ] message for the AEB and FCW signals, all others use [ SCC12 ]
# "use_fca": {}, carstate aeb_fcw / qt ui aebselect toggle set
# "has_scc13": {},
# "has_scc14": {},
# new lfa car - carcontroller lfamfc / hyundaican lfamfc using qt ui mfcselect toggle set
}
EV_CAR = {CAR.KONA_EV, CAR.IONIQ_EV, CAR.NIRO_EV, CAR.SOUL_EV, CAR.NEXO}
HYBRID_CAR = {CAR.KONA_HEV, CAR.IONIQ_HEV, CAR.NIRO_HEV, CAR.SANTA_FE_HEV,
CAR.ELANTRA21_HEV, CAR.SONATA_HEV, CAR.SONATA_LF_HEV, CAR.GRANDEUR_HEV, CAR.GRANDEUR20_HEV,
CAR.K5_HEV, CAR.K5_DL3_HEV, CAR.K7_HEV}
EV_HYBRID_CAR = EV_CAR | HYBRID_CAR
DBC = {
# Hyundai
CAR.ELANTRA_I30: dbc_dict('hyundai_kia_generic', None),
CAR.ELANTRA21: dbc_dict('hyundai_kia_generic', None),
CAR.ELANTRA21_HEV: dbc_dict('hyundai_kia_generic', None),
CAR.SONATA: dbc_dict('hyundai_kia_generic', 'hyundai_kia_mando_front_radar'),
CAR.SONATA_HEV: dbc_dict('hyundai_kia_generic', 'hyundai_kia_mando_front_radar'),
CAR.SONATA_LF: dbc_dict('hyundai_kia_generic', None),
CAR.SONATA_LF_HEV: dbc_dict('hyundai_kia_generic', None),
CAR.KONA: dbc_dict('hyundai_kia_generic', None),
CAR.KONA_EV: dbc_dict('hyundai_kia_generic', None),
CAR.KONA_HEV: dbc_dict('hyundai_kia_generic', None),
CAR.IONIQ_EV: dbc_dict('hyundai_kia_generic', 'hyundai_kia_mando_front_radar'),
CAR.IONIQ_HEV: dbc_dict('hyundai_kia_generic', None),
CAR.SANTA_FE: dbc_dict('hyundai_kia_generic', 'hyundai_kia_mando_front_radar'),
CAR.SANTA_FE_HEV: dbc_dict('hyundai_kia_generic', None),
CAR.PALISADE: dbc_dict('hyundai_kia_generic', 'hyundai_kia_mando_front_radar'),
CAR.VELOSTER: dbc_dict('hyundai_kia_generic', None),
CAR.GRANDEUR: dbc_dict('hyundai_kia_generic', None),
CAR.GRANDEUR_HEV: dbc_dict('hyundai_kia_generic', None),
CAR.GRANDEUR20: dbc_dict('hyundai_kia_generic', None),
CAR.GRANDEUR20_HEV: dbc_dict('hyundai_kia_generic', None),
CAR.NEXO: dbc_dict('hyundai_kia_generic_nexo', None),
# Kia
CAR.FORTE: dbc_dict('hyundai_kia_generic', None),
CAR.K5: dbc_dict('hyundai_kia_generic', None),
CAR.K5_HEV: dbc_dict('hyundai_kia_generic', None),
CAR.K5_DL3: dbc_dict('hyundai_kia_generic', None),
CAR.K5_DL3_HEV: dbc_dict('hyundai_kia_generic', None),
CAR.SPORTAGE: dbc_dict('hyundai_kia_generic', None),
CAR.SORENTO: dbc_dict('hyundai_kia_generic', None),
CAR.MOHAVE: dbc_dict('hyundai_kia_generic', None),
CAR.STINGER: dbc_dict('hyundai_kia_generic', None),
CAR.NIRO_EV: dbc_dict('hyundai_kia_generic', 'hyundai_kia_mando_front_radar'),
CAR.NIRO_HEV: dbc_dict('hyundai_kia_generic', 'hyundai_kia_mando_front_radar'),
CAR.SOUL_EV: dbc_dict('hyundai_kia_generic', None),
CAR.SELTOS: dbc_dict('hyundai_kia_generic', None),
CAR.K7: dbc_dict('hyundai_kia_generic', None),
CAR.K7_HEV: dbc_dict('hyundai_kia_generic', None),
CAR.K9: dbc_dict('hyundai_kia_generic', None),
# Genesis
CAR.GENESIS: dbc_dict('hyundai_kia_generic', None),
CAR.GENESIS_G70: dbc_dict('hyundai_kia_generic', 'hyundai_kia_mando_front_radar'),
CAR.GENESIS_G80: dbc_dict('hyundai_kia_generic', None),
CAR.GENESIS_G90: dbc_dict('hyundai_kia_generic', None),
}
STEER_THRESHOLD = 150
def main():
for member, value in vars(CAR).items():
if not member.startswith("_"):
print(value)
if __name__ == "__main__":
main()
| 80.265487 | 974 | 0.644818 | from cereal import car
from selfdrive.car import dbc_dict
Ecu = car.CarParams.Ecu
class CarControllerParams:
ACCEL_MAX = 2.0
ACCEL_MIN = -3.7
STEER_MAX = 384
STEER_DELTA_UP = 3
STEER_DELTA_DOWN = 7
STEER_DRIVER_ALLOWANCE = 50
STEER_DRIVER_MULTIPLIER = 2
STEER_DRIVER_FACTOR = 1
class CAR:
ELANTRA_I30 = "HYUNDAI AVANTE,I30 2017~2020 (AD,PD)"
ELANTRA21 = "HYUNDAI AVANTE 2021 (CN7)"
ELANTRA21_HEV = "HYUNDAI AVANTE HEV 2021 (CN7)"
SONATA = "HYUNDAI SONATA 2020 (DN8)"
SONATA_HEV = "HYUNDAI SONATA HEV 2020 (DN8)"
SONATA_LF = "HYUNDAI SONATA 2016~2019 (LF)"
SONATA_LF_HEV = "HYUNDAI SONATA 2018 HEV (LF)"
KONA = "HYUNDAI KONA 2019 (OS)"
KONA_EV = "HYUNDAI KONA EV 2019 (OS)"
KONA_HEV = "HYUNDAI KONA HEV 2019 (OS)"
IONIQ_EV = "HYUNDAI IONIQ EV 2019~2020 (AE)"
IONIQ_HEV = "HYUNDAI IONIQ HEV 2017 (AE)"
SANTA_FE = "HYUNDAI SANTA FE 2019~2021 (TM)"
SANTA_FE_HEV = "HYUNDAI SANTA FE 2021~2022 (TM)"
PALISADE = "HYUNDAI PALISADE 2020 (LX2)"
VELOSTER = "HYUNDAI VELOSTER 2019 (JS)"
GRANDEUR = "GRANDEUR 2017~2019 (IG)"
GRANDEUR_HEV = "GRANDEUR HEV 2018~2019 (IG)"
GRANDEUR20 = "GRANDEUR 2020 (IG)"
GRANDEUR20_HEV = "GRANDEUR HEV 2020 (IG)"
NEXO = "HYUNDAI NEXO (FE)"
FORTE = "KIA K3 2018 (BD)"
K5 = "KIA K5 2016~2020 (JF)"
K5_HEV = "KIA K5 HEV 2016~2020 (JF)"
K5_DL3 = "KIA K5 2021 (DL3)"
K5_DL3_HEV = "KIA K5 HEV 2021 (DL3)"
K7 = "KIA K7 2016-2019 (YG)"
K7_HEV = "KIA K7 HEV 2017-2019 (YG)"
K9 = "KIA K9 2019-2021 (RJ)"
SPORTAGE = "KIA SPORTAGE 2016~2020 (QL)"
SORENTO = "KIA SORENTO 2017~2020 (UM)"
MOHAVE = "KIA MOHAVE 2020 (HM)"
STINGER = "KIA STINGER 2018~2021 (CK)"
NIRO_EV = "KIA NIRO EV 2020 (DE)"
NIRO_HEV = "KIA NIRO HEV 2018 (DE)"
SOUL_EV = "KIA SOUL EV 2019 (SK3)"
SELTOS = "KIA SELTOS 2019 (SP2)"
GENESIS = "GENESIS 2014-2016 (DH)"
GENESIS_G70 = "GENESIS G70 2018~ (IK)"
GENESIS_G80 = "GENESIS G80 2018~ (DH)"
GENESIS_G90 = "GENESIS G90,EQ900 2016~2019 (HI)"
class Buttons:
NONE = 0
RES_ACCEL = 1
SET_DECEL = 2
GAP_DIST = 3
CANCEL = 4
FINGERPRINTS = {
CAR.ELANTRA_I30: [{
66: 8, 67: 8, 68: 8, 127: 8, 128: 8, 129: 8, 273: 8, 274: 8, 275: 8, 339: 8, 354: 3, 356: 4, 399: 8, 512: 6, 544: 8, 546: 8, 547: 8, 593: 8, 608: 8, 688: 5, 790: 8, 809: 8, 832: 8, 838: 8, 844: 8, 884: 8, 897: 8, 899: 8, 902: 8, 903: 8, 905: 8, 909: 8, 916: 8, 1040: 8, 1056: 8, 1057: 8, 1078: 4, 1087: 8, 1151: 6, 1155: 8, 1164: 8, 1168: 7, 1170: 8, 1191: 2, 1193: 8, 1253: 8, 1254: 8, 1255: 8, 1265: 4, 1280: 1, 1282: 4, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1314: 8, 1322: 8, 1331: 8, 1332: 8, 1342: 6, 1345: 8, 1348: 8, 1349: 8, 1351: 8, 1353: 8, 1356: 8, 1363: 8, 1365: 8, 1366: 8, 1367: 8, 1369: 8, 1407: 8, 1414: 3, 1415: 8, 1419: 8, 1425: 2, 1427: 6, 1440: 8, 1456: 4, 1470: 8, 1472: 8, 1485: 8, 1486: 8, 1487: 8, 1491: 8, 1530: 8, 1532: 5, 1792: 8, 1872: 8, 1937: 8, 1952: 8, 1953: 8, 1960: 8, 1968: 8, 1988: 8, 1990: 8, 1998: 8, 2000: 8, 2001: 8, 2003: 8, 2004: 8, 2005: 8, 2008: 8, 2009: 8, 2012: 8, 2013: 8, 2015: 8, 2016: 8, 2017: 8, 2024: 8, 2025: 8
}],
CAR.ELANTRA21: [{
67: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 524: 8, 544: 8, 593: 8, 608: 8, 688: 6, 809: 8, 832: 8, 854: 8, 865: 8, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 913: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1069: 8, 1078: 4, 1102: 8, 1107: 5, 1108: 8, 1136: 8, 1145: 8, 1151: 8, 1155: 8, 1156: 8, 1157: 4, 1162: 8, 1164: 8, 1168: 8, 1170: 8, 1173: 8, 1183: 8, 1186: 2, 1191: 2, 1193: 8, 1225: 8, 1227: 8, 1265: 4, 1268: 8, 1280: 8, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1339: 8, 1342: 8, 1343: 8, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1379: 8, 1384: 8, 1394: 8, 1407: 8, 1419: 8, 1427: 6, 1446: 8, 1456: 4, 1470: 8, 1485: 8, 1988: 8, 1996: 8, 2000: 8, 2004: 8, 2008: 8, 2012: 8
}],
CAR.ELANTRA21_HEV: [{
}],
CAR.SONATA: [{
67: 8, 68: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 544: 8, 545: 8, 546: 8, 547: 8, 548: 8, 549: 8, 550: 8, 576: 8, 593: 8, 608: 8, 688: 6, 809: 8, 832: 8, 854: 8, 865: 8, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 903: 8, 905: 8, 908: 8, 909: 8, 912: 7, 913: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1078: 4, 1089: 5, 1096: 8, 1107: 5, 1108: 8, 1114: 8, 1136: 8, 1145: 8, 1151: 8, 1155: 8, 1156: 8, 1157: 4, 1162: 8, 1164: 8, 1168: 8, 1170: 8, 1173: 8, 1180: 8, 1183: 8, 1184: 8, 1186: 2, 1191: 2, 1193: 8, 1210: 8, 1225: 8, 1227: 8, 1265: 4, 1268: 8, 1280: 8, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1330: 8, 1339: 8, 1342: 6, 1343: 8, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1371: 8, 1378: 8, 1379: 8, 1384: 8, 1394: 8, 1407: 8, 1419: 8, 1427: 6, 1446: 8, 1456: 4, 1460: 8, 1470: 8, 1485: 8, 1504: 3, 1988: 8, 1996: 8, 2000: 8, 2004: 8, 2008: 8, 2012: 8, 2015: 8
}],
CAR.SONATA_HEV: [{
127: 8, 304: 8, 320: 8, 339: 8, 352: 8, 356: 4, 544: 8, 546: 8, 548: 8, 576: 8, 593: 8, 688: 6, 757: 2, 832: 8, 865: 8, 881: 8, 882: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 913: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1078: 4, 1102: 8, 1108: 8, 1114: 8, 1136: 6, 1138: 5, 1151: 8, 1155: 8, 1156: 8, 1157: 4, 1162: 8, 1164: 8, 1168: 8, 1173: 8, 1180: 8, 1184: 8, 1186: 2, 1191: 2, 1193: 8, 1210: 8, 1225: 8, 1227: 8, 1265: 4, 1268: 8, 1280: 8, 1287: 4, 1290: 8, 1291: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1330: 8, 1339: 8, 1342: 6, 1343: 8, 1345: 8, 1348: 8, 1355: 8, 1363: 8, 1369: 8, 1371: 8, 1378: 8, 1407: 8, 1419: 8, 1427: 6, 1429: 8, 1430: 8, 1446: 8, 1448: 8, 1456: 4, 1460: 8, 1470: 8, 1476: 8, 1535: 8
}],
CAR.SONATA_LF: [{
66: 8, 67: 8, 68: 8, 127: 8, 273: 8, 274: 8, 275: 8, 339: 8, 356: 4, 399: 8, 447: 8, 512: 6, 544: 8, 593: 8, 608: 8, 688: 5, 790: 8, 809: 8, 832: 8, 884: 8, 897: 8, 899: 8, 902: 8, 903: 6, 916: 8, 1040: 8, 1056: 8, 1057: 8, 1078: 4, 1151: 6, 1168: 7, 1170: 8, 1253: 8, 1254: 8, 1255: 8, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1314: 8, 1322: 8, 1331: 8, 1332: 8, 1333: 8, 1342: 6, 1345: 8, 1348: 8, 1349: 8, 1351: 8, 1353: 8, 1363: 8, 1365: 8, 1366: 8, 1367: 8, 1369: 8, 1397: 8, 1407: 8, 1415: 8, 1419: 8, 1425: 2, 1427: 6, 1440: 8, 1456: 4, 1470: 8, 1472: 8, 1486: 8, 1487: 8, 1491: 8, 1530: 8, 1532: 5, 2000: 8, 2001: 8, 2004: 8, 2005: 8, 2008: 8, 2009: 8, 2012: 8, 2013: 8, 2014: 8, 2016: 8, 2017: 8, 2024: 8, 2025: 8
}],
CAR.SONATA_LF_HEV: [{
68: 8, 127: 8, 304: 8, 320: 8, 339: 8, 352: 8, 356: 4, 544: 7, 593: 8, 688: 5, 881: 8, 882: 8, 897: 8, 902: 8, 903: 6, 916: 8, 1040: 8, 1056: 8, 1057: 8, 1078: 4, 1136: 6, 1151: 6, 1168: 7, 1173: 8, 1186: 2, 1225: 8, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1291: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1331: 8, 1332: 8, 1333: 8, 1345: 8, 1348: 8, 1355: 8, 1363: 8, 1369: 8, 1407: 8, 1419: 8, 1425: 2, 1429: 8, 1430: 8, 1448: 8, 1456: 4, 1470: 8, 1476: 8, 1535: 8, 2000: 8, 2004: 8, 2005: 8, 2008: 8, 2012: 8, 2013: 8
}],
CAR.KONA: [{
67: 8, 127: 8, 304: 8, 320: 8, 339: 8, 354: 3, 356: 4, 544: 8, 593: 8, 608: 8, 688: 5, 809: 8, 832: 8, 854: 7, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 916: 8, 1040: 8, 1056: 8, 1057: 8, 1064: 8, 1078: 4, 1107: 5, 1136: 8, 1151: 6, 1156: 8, 1170: 8, 1173: 8, 1186: 2, 1191: 2, 1193: 8, 1265: 4,1280: 1, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1378: 8, 1384: 8, 1394: 8, 1407: 8, 1414: 3, 1419: 8, 1427: 6, 1456: 4, 1470: 8, 1988: 8, 1990: 8, 1996: 8, 1998: 8, 2000: 8, 2001: 8, 2004: 8, 2008: 8, 2009: 8, 2012: 8, 2015: 8
}],
CAR.KONA_EV: [{
127: 8, 304: 8, 320: 8, 339: 8, 352: 8, 356: 4, 544: 8, 549: 8, 593: 8, 688: 5, 832: 8, 881: 8, 882: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1078: 4, 1136: 8, 1151: 6, 1157: 4, 1168: 7, 1173: 8, 1183: 8, 1186: 2, 1191: 2, 1193: 8, 1225: 8, 1260: 8, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1291: 8, 1292: 8, 1294: 8, 1307: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1355: 8, 1363: 8, 1369: 8, 1378: 4, 1379: 8, 1407: 8, 1419: 8, 1426: 8, 1427: 6, 1429: 8, 1430: 8, 1456: 4, 1470: 8, 1473: 8, 1507: 8, 1535: 8, 1988: 8, 1996: 8, 2000: 8, 2004: 8, 2008: 8, 2012: 8, 2015: 8
}],
CAR.KONA_HEV: [{
68: 8, 127: 8, 304: 8, 320: 8, 339: 8, 352: 8, 356: 4, 544: 8, 546: 8, 547: 8, 548: 8, 549: 8, 576: 8, 593: 8, 688: 5, 832: 8, 881: 8, 882: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1078: 4, 1136: 6, 1138: 4, 1151: 6, 1155: 8, 1157: 4, 1164: 8, 1168: 7, 1173: 8, 1183: 8, 1186: 2, 1191: 2, 1193: 8, 1225: 8, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1291: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1355: 8, 1363: 8, 1369: 8, 1378: 8, 1379: 8, 1407: 8, 1419: 8, 1427: 6, 1429: 8, 1430: 8, 1448: 8, 1456: 4, 1470: 8, 1476: 8, 1535: 8
}],
CAR.IONIQ_EV: [{
127: 8, 304: 8, 320: 8, 339: 8, 352: 8, 356: 4, 524: 8, 544: 7, 546: 8, 593: 8, 688: 5, 832: 8, 881: 8, 882: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1078: 4, 1136: 8, 1151: 6, 1155: 8, 1156: 8, 1157: 4, 1164: 8, 1168: 7, 1173: 8, 1183: 8, 1186: 2, 1191: 2, 1225: 8, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1291: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1355: 8, 1363: 8, 1369: 8, 1379: 8, 1407: 8, 1419: 8, 1426: 8, 1427: 6, 1429: 8, 1430: 8, 1456: 4, 1470: 8, 1473: 8, 1507: 8, 1535: 8, 1988: 8, 1996: 8, 2000: 8, 2004: 8, 2005: 8, 2008: 8, 2012: 8, 2013: 8, 2015: 8
}],
CAR.IONIQ_HEV: [{
68:8, 127: 8, 304: 8, 320: 8, 339: 8, 352: 8, 356: 4, 524: 8, 544: 8, 576:8, 593: 8, 688: 5, 832: 8, 881: 8, 882: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1078: 4, 1136: 6, 1151: 6, 1155: 8, 1156: 8, 1157: 4, 1164: 8, 1168: 7, 1173: 8, 1183: 8, 1186: 2, 1191: 2, 1225: 8, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1291: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1355: 8, 1363: 8, 1369: 8, 1379: 8, 1407: 8, 1419: 8, 1426: 8, 1427: 6, 1429: 8, 1430: 8, 1448: 8, 1456: 4, 1470: 8, 1473: 8, 1476: 8, 1507: 8, 1535: 8, 1988: 8, 1996: 8, 2000: 8, 2004: 8, 2005: 8, 2008: 8, 2012: 8, 2013: 8
}],
CAR.SANTA_FE: [{
67: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 544: 8, 593: 8, 608: 8, 688: 6, 764: 8, 809: 8, 832: 8, 854: 7, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1064: 8, 1078: 4, 1107: 5, 1136: 8, 1151: 6, 1155: 8, 1156: 8, 1157: 4, 1162: 8, 1164: 8, 1168: 7, 1170: 8, 1173: 8, 1180: 8, 1183: 8, 1186: 2, 1191: 2, 1227: 8, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1371: 8, 1378: 8, 1384: 8, 1407: 8, 1414: 3, 1419: 8, 1427: 6, 1456: 4, 1470: 8, 1479: 8, 1990: 8, 1998: 8, 2000: 8, 2004: 8, 2008: 8, 2012: 8, 2015: 8
}],
CAR.SANTA_FE_HEV: [{
}],
CAR.PALISADE: [{
67: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 544: 8, 549: 8, 576: 8, 593: 8, 608: 8, 688: 6, 809: 8, 832: 8, 854: 7, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 913: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1064: 8, 1078: 4, 1107: 5, 1123: 8, 1136: 8, 1151: 6, 1155: 8, 1156: 8, 1157: 4, 1162: 8, 1164: 8, 1168: 7, 1170: 8, 1173: 8, 1180: 8, 1186: 2, 1191: 2, 1193: 8, 1210: 8, 1225: 8, 1227: 8, 1265: 4, 1280: 8, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1371: 8, 1378: 8, 1384: 8, 1407: 8, 1419: 8, 1427: 6, 1456: 4, 1470: 8, 2000: 8, 2005: 8, 2008: 8
}],
CAR.VELOSTER: [{
64: 8, 66: 8, 67: 8, 68: 8, 127: 8, 128: 8, 129: 8, 273: 8, 274: 8, 275: 8, 339: 8, 354: 3, 356: 4, 399: 8, 512: 6, 544: 8, 558: 8, 593: 8, 608: 8, 688: 5, 790: 8, 809: 8, 832: 8, 884: 8, 897: 8, 899: 8, 902: 8, 903: 8, 905: 8, 909: 8, 916: 8, 1040: 8, 1056: 8, 1057: 8, 1078: 4, 1170: 8, 1181: 5, 1186: 2, 1191: 2, 1265: 4, 1280: 1, 1282: 4, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1349: 8, 1351: 8, 1353: 8, 1356: 8, 1363: 8, 1365: 8, 1366: 8, 1367: 8, 1369: 8, 1378: 4, 1407: 8, 1414: 3, 1415: 8, 1419: 8, 1427: 6, 1440: 8, 1456: 4, 1470: 8, 1486: 8, 1487: 8, 1491: 8, 1530: 8, 1532: 5, 1872: 8, 1988: 8, 1996: 8, 2000: 8, 2001: 8, 2004: 8, 2008: 8, 2009: 8, 2012: 8, 2015: 8, 2016: 8, 2017: 8, 2024: 8, 2025: 8
}],
CAR.GRANDEUR: [{
67: 8, 68: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 544: 8, 546: 8, 547: 8, 549: 8, 593: 8, 608: 8, 688: 5, 809: 8, 832: 8, 854: 7, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1078: 4, 1136: 8, 1151: 6, 1156: 8, 1157: 4, 1162: 4, 1168: 7, 1170: 8, 1173: 8, 1185: 8, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1371: 8, 1378: 4, 1384: 8, 1407: 8, 1419: 8, 1425: 2, 1427: 6, 1456: 4, 1470: 8
}],
CAR.GRANDEUR_HEV: [{
68: 8, 127: 8, 304: 8, 320: 8, 339: 8, 352: 8, 356: 4, 516: 8, 544: 8, 546: 8, 576: 8, 593: 8, 688: 5, 832: 8, 865: 8, 881: 8, 882: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 913: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1078: 4, 1108: 8, 1136: 6, 1138: 5, 1151: 8, 1155: 8, 1156: 8, 1157: 4, 1162: 8, 1164: 8, 1168: 7, 1173: 8, 1180: 8, 1185: 8, 1186: 2, 1191: 2, 1193: 8, 1210: 8, 1225: 8, 1227: 8, 1265: 4, 1268: 8, 1280: 1, 1287: 4, 1290: 8, 1291: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 8, 1345: 8, 1348: 8, 1355: 8, 1363: 8, 1369: 8, 1371: 8, 1378: 4, 1379: 8, 1407: 8, 1419: 8, 1425: 2, 1427: 6, 1429: 8, 1430: 8, 1448: 8, 1456: 4, 1470: 8, 1476: 8, 1535: 8
}],
CAR.GRANDEUR20: [{
67: 8, 68: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 516: 8, 524: 8, 528: 8, 532: 8, 544: 8, 576: 8, 593: 8, 608: 8, 688: 5, 809: 8, 832: 8, 854: 8, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 913: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1078: 4, 1107: 5, 1136: 8, 1151: 8, 1155: 8, 1156: 8, 1157: 4, 1162: 8, 1164: 8, 1168: 8, 1170: 8, 1173: 8, 1180: 8, 1186: 2, 1191: 2, 1193: 8, 1210: 8, 1225: 8, 1227: 8, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 8, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1371: 8, 1378: 8, 1379: 8, 1384: 8, 1407: 8, 1419: 8, 1427: 6, 1456: 4, 1470: 8
}],
CAR.GRANDEUR20_HEV: [{
127: 8, 304: 8, 320: 8, 339: 8, 352: 8, 356: 4, 516: 8, 544: 8, 576: 8, 593: 8, 688: 5, 764: 8, 832: 8, 865: 8, 881: 8, 882: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 913: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1078: 4, 1108: 8, 1136: 6, 1138: 5, 1151: 8, 1155: 8, 1156: 8, 1157: 4, 1162: 8, 1164: 8, 1168: 8, 1173: 8, 1180: 8, 1186: 2, 1191: 2, 1193: 8, 1210: 8, 1225: 8, 1227: 8, 1265: 4, 1268: 8, 1280: 1, 1287: 4, 1290: 8, 1291: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 8, 1345: 8, 1348: 8, 1355: 8, 1363: 8, 1369: 8, 1371: 8, 1378: 8, 1407: 8, 1419: 8, 1427: 6, 1429: 8, 1430: 8, 1448: 8, 1456: 4, 1470: 8, 1476: 8, 1535: 8
}],
CAR.NEXO: [{
127: 8, 145: 8, 146: 8, 304: 8, 320: 8, 339: 8, 352: 8, 356: 4, 512: 6, 544: 8, 546: 8, 593: 8, 688: 5, 832: 8, 881: 8, 882: 8, 897: 8, 902: 8, 903: 8, 905: 8, 908: 8, 909: 8, 912: 7, 916: 8, 1056: 8, 1057: 8, 1078: 4, 1136: 8, 1151: 8, 1155: 8, 1156: 8, 1157: 4, 1162: 8, 1164: 8, 1168: 7, 1173: 8, 1174: 8, 1180: 8, 1183: 8, 1186: 2, 1191: 2, 1192: 8, 1193: 8, 1210: 8, 1219: 8, 1220: 8, 1222: 6, 1223: 8, 1224: 8, 1227: 8, 1230: 6, 1231: 6, 1265: 4, 1268: 8, 1280: 1, 1287: 4, 1290: 8, 1291: 8, 1292: 8, 1294: 8, 1297: 8, 1298: 8, 1305: 8, 1312: 8, 1315: 8, 1316: 8, 1322: 8, 1324: 8, 1342: 6, 1345: 8, 1348: 8, 1355: 8, 1363: 8, 1369: 8, 1371: 8, 1407: 8, 1419: 8, 1427: 6, 1429: 8, 1430: 8, 1437: 8, 1456: 4, 1460: 8, 1470: 8, 1484: 8, 1507: 8, 1520: 8, 1535: 8
}],
CAR.FORTE: [{
67: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 544: 8, 593: 8, 608: 8, 688: 5, 809: 8, 832: 8, 854: 7, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 903: 8, 909: 8, 916: 8, 1040: 8, 1042: 8, 1078: 4, 1107: 5, 1136: 8, 1156: 8, 1170: 8, 1173: 8, 1191: 2, 1225: 8, 1265: 4, 1280: 4, 1287: 4, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1384: 8, 1394: 8, 1407: 8, 1427: 6, 1456: 4, 1470: 8
}],
CAR.K5: [{
64: 8, 66: 8, 67: 8, 68: 8, 127: 8, 128: 8, 129: 8, 273: 8, 274: 8, 275: 8, 339: 8, 354: 3, 356: 4, 399: 8, 447: 8, 512: 6, 544: 8, 593: 8, 608: 8, 625: 8, 688: 5, 790: 8, 809: 8, 832: 8, 884: 8, 897: 8, 899: 8, 902: 8, 903: 6, 909: 8, 912: 7, 916: 8, 1040: 8, 1056: 8, 1057: 8, 1078: 4, 1151: 6, 1168: 7, 1170: 8, 1186: 2, 1191: 2, 1236: 2, 1253: 8, 1254: 8, 1255: 8, 1265: 4, 1268: 8, 1280: 1, 1282: 4, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1331: 8, 1332: 8, 1333: 8, 1342: 6, 1345: 8, 1348: 8, 1349: 8, 1351: 8, 1353: 8, 1356: 8, 1363: 8, 1365: 8, 1366: 8, 1367: 8, 1369: 8, 1371: 8, 1407: 8, 1414: 3, 1415: 8, 1419: 8, 1425: 2, 1427: 6, 1440: 8, 1456: 4, 1470: 8, 1472: 8, 1486: 8, 1487: 8, 1491: 8, 1492: 8, 1530: 8, 1532: 5, 1905: 8, 1913: 8, 1952: 8, 1960: 8, 1988: 8, 1996: 8, 2001: 8, 2004: 8, 2008: 8, 2009: 8, 2012: 8, 2015: 8, 2016: 8, 2017: 8, 2024: 8, 2025: 8
}],
CAR.K5_HEV: [{
68: 8, 127: 8, 304: 8, 320: 8, 339: 8, 352: 8, 356: 4, 544: 8, 576: 8, 593: 8, 688: 5, 832: 8, 881: 8, 882: 8, 897: 8, 902: 8, 903: 6, 909: 8, 912: 7, 916: 8, 1040: 8, 1056: 8, 1057: 8, 1078: 4, 1136: 6, 1151: 6, 1168: 7, 1173: 8, 1180: 8, 1186: 2, 1191: 2, 1236: 2, 1265: 4, 1268: 8, 1280: 1, 1287: 4, 1290: 8, 1291: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1331: 8, 1332: 8, 1333: 8, 1342: 6, 1345: 8, 1348: 8, 1355: 8, 1363: 8, 1369: 8, 1371: 8, 1407: 8, 1419: 8, 1420: 8, 1425: 2, 1427: 6, 1429: 8, 1430: 8, 1448: 8, 1456: 4, 1470: 8, 1476: 8, 1535: 8
}],
CAR.K5_DL3: [{
}],
CAR.K5_DL3_HEV: [{
}],
CAR.SPORTAGE: [{
67: 8, 68: 8, 127: 8, 273: 8, 274: 8, 275: 8, 339: 8, 356: 4, 399: 8, 447: 8, 512: 6, 544: 8, 593: 8, 608: 8, 688: 5, 790: 8, 809: 8, 832: 8, 884: 8, 897: 8, 899: 8, 902: 8, 903: 6, 909: 8, 916: 8, 1040: 8, 1078: 4, 1170: 8, 1191: 2, 1253: 8, 1254: 8, 1255: 8, 1265: 4, 1280: 1, 1282: 4, 1287: 4, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1349: 8, 1351: 8, 1353: 8, 1363: 8, 1365: 8, 1366: 8, 1367: 8, 1369: 8, 1407: 8, 1419: 8, 1427: 6, 1440: 8, 1456: 4, 1470: 8, 1472: 8, 1486: 8, 1487: 8, 1491: 8, 1492: 8, 1530: 8
}],
CAR.SORENTO: [{
67: 8, 68: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 544: 8, 593: 8, 608: 8, 688: 5, 809: 8, 832: 8, 854: 7, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 903: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1064: 8, 1078: 4, 1107: 5, 1136: 8, 1151: 6, 1168: 7, 1170: 8, 1173: 8, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1331: 8, 1332: 8, 1333: 8, 1342: 6, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1370: 8, 1371: 8, 1384: 8, 1407: 8, 1411: 8, 1419: 8, 1425: 2, 1427: 6, 1444: 8, 1456: 4, 1470: 8, 1489: 1
}],
CAR.MOHAVE: [{
67: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 544: 8, 593: 8, 608: 8, 688: 5, 809: 8, 832: 8, 854: 8, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 905: 8, 909: 8, 913: 8, 916: 8, 1040: 8, 1056: 8, 1057: 8, 1064: 8, 1078: 4, 1107: 5, 1123: 8, 1136: 8, 1145: 8, 1151: 8, 1155: 8, 1156: 8, 1157: 4, 1162: 8, 1164: 8, 1168: 8, 1170: 8, 1173: 8, 1180: 8, 1186: 2, 1191: 2, 1193: 8, 1210: 8, 1225: 8, 1227: 8, 1265: 4, 1280: 8, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1371: 8, 1378: 8, 1384: 8, 1407: 8, 1419: 8, 1427: 6, 1456: 4, 1470: 8, 1479: 8
}],
CAR.STINGER: [{
67: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 358: 6, 359: 8, 544: 8, 576: 8, 593: 8, 608: 8, 688: 5, 809: 8, 832: 8, 854: 7, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 909: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1064: 8, 1078: 4, 1107: 5, 1136: 8, 1151: 6, 1168: 7, 1170: 8, 1173: 8, 1184: 8, 1265: 4, 1280: 1, 1281: 4, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1371: 8, 1378: 4, 1379: 8, 1384: 8, 1407: 8, 1419: 8, 1425: 2, 1427: 6, 1456: 4, 1470: 8, 2015: 8
}],
CAR.NIRO_EV: [{
127: 8, 304: 8, 320: 8, 339: 8, 352: 8, 356: 4, 516: 8, 544: 8, 593: 8, 688: 5, 832: 8, 881: 8, 882: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1078: 4, 1136: 8, 1151: 6, 1156: 8, 1157: 4, 1168: 7, 1173: 8, 1183: 8, 1186: 2, 1191: 2, 1193: 8, 1225: 8, 1260: 8, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1291: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1355: 8, 1363: 8, 1369: 8, 1407: 8, 1419: 8, 1426: 8, 1427: 6, 1429: 8, 1430: 8, 1456: 4, 1470: 8, 1473: 8, 1507: 8, 1535: 8, 1988: 8, 1990: 8, 1998: 8, 1996: 8, 2000: 8, 2004: 8, 2008: 8, 2012: 8, 2015: 8
}],
CAR.NIRO_HEV: [{
127: 8, 304: 8, 320: 8, 339: 8, 352: 8, 356: 4, 544: 8, 576: 8, 593: 8, 688: 5, 832: 8, 881: 8, 882: 8, 897: 8, 902: 8, 903: 8, 916: 8, 1040: 8, 1056: 8, 1057: 8, 1078: 4, 1136: 6, 1173: 8, 1225: 8, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1291: 8, 1292: 8, 1294: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1355: 8, 1363: 8, 1369: 8, 1419: 8, 1427: 6, 1429: 8, 1430: 8, 1448: 8, 1456: 4, 1470: 8, 1535: 8
}],
CAR.SOUL_EV: [{
127: 8, 304: 8, 320: 8, 339: 8, 352: 8, 356: 4, 544: 8, 546: 8, 548: 8, 549: 8, 593: 8, 688: 6, 832: 8, 881: 8, 882: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 913: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1078: 4, 1136: 8, 1151: 6, 1155: 8, 1156: 8, 1157: 4, 1162: 8, 1164: 8, 1168: 7, 1173: 8, 1186: 2, 1191: 2, 1193: 8, 1225: 8, 1227: 8, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1291: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1355: 8, 1363: 8, 1369: 8, 1378: 8, 1379: 8, 1407: 8, 1419: 8, 1426: 8, 1427: 6, 1429: 8, 1430: 8, 1456: 4, 1470: 8, 1473: 8, 1507: 8, 1535: 8
}],
CAR.SELTOS: [{
67: 8, 127: 8, 304: 8, 320: 8, 339: 8, 354: 8, 356: 4, 544: 8, 593: 8, 608: 8, 688: 6, 809: 8, 832: 8, 854: 8, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 905: 8, 909: 8, 910: 5, 911: 5, 913: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1078: 4, 1107: 5, 1114: 8, 1136: 8, 1145: 8, 1151: 8, 1155: 8, 1156: 8, 1157: 4, 1162: 8, 1164: 8, 1168: 8, 1170: 8, 1173: 8, 1186: 2, 1191: 2, 1225: 8, 1265: 4, 1280: 8, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1379: 8, 1384: 8, 1394: 8, 1407: 8, 1414: 3, 1419: 8, 1427: 6, 1446: 8, 1456: 4, 1470: 8, 1485: 8, 1911: 8
}],
CAR.K7: [{
67: 8, 68: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 544: 8, 546: 8, 593: 8, 608: 8, 688: 5, 809: 8, 832: 8, 854: 7, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 903: 8, 916: 8, 1040: 8, 1056: 8, 1057: 8, 1078: 4, 1107: 5, 1136: 8, 1151: 6, 1156: 8, 1157: 4, 1162: 4, 1168: 7, 1170: 8, 1173: 8, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1371: 8, 1378: 4, 1384: 8, 1407: 8, 1419: 8, 1427: 6, 1444: 8, 1456: 4, 1470: 8
}],
CAR.K7_HEV: [{
68: 8, 127: 8, 304: 8, 320: 8, 339: 8, 352: 8, 356: 4, 544: 8, 549: 8, 576: 8, 593: 8, 688: 5, 832: 8, 865: 8, 881: 8, 882: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 913: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1078: 4, 1096: 8, 1102: 8, 1108: 8, 1136: 6, 1138: 5, 1151: 8, 1155: 8, 1156: 8, 1157: 4, 1162: 8, 1164: 8, 1168: 7, 1173: 8, 1180: 8, 1186: 2, 1191: 2, 1210: 8, 1227: 8, 1265: 4, 1268: 8, 1280: 1, 1287: 4, 1290: 8, 1291: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1343: 8, 1345: 8, 1348: 8, 1355: 8, 1363: 8, 1369: 8, 1371: 8, 1378: 8, 1379: 8, 1407: 8, 1419: 8, 1427: 6, 1429: 8, 1430: 8, 1448: 8, 1456: 4, 1470: 8, 1476: 8, 1535: 8
}],
CAR.K9: [{
67: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 544: 8, 593: 8, 608: 8, 688: 5, 809: 8, 832: 8, 854: 7, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 903: 8, 905: 8, 909: 8, 916: 8, 1056: 8, 1057: 8, 1078: 4, 1107: 5, 1136: 8, 1151: 6, 1155: 8, 1156: 8, 1157: 4, 1162: 8, 1164: 8, 1168: 7, 1170: 8, 1173: 8, 1184: 8, 1186: 2, 1191: 2, 1227: 8, 1265: 4, 1280: 4, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1379: 8, 1384: 8, 1407: 8, 1419: 8, 1427: 6, 1456: 4, 1470: 8
}],
CAR.GENESIS: [{
67: 8, 68: 8, 304: 8, 320: 8, 339: 8, 356: 4, 544: 7, 593: 8, 608: 8, 688: 5, 809: 8, 832: 8, 854: 7, 870: 7, 871: 8, 872: 5, 897: 8, 902: 8, 903: 6, 912: 7, 916: 8, 1024: 2, 1040: 8, 1056: 8, 1057: 8, 1078: 4, 1107: 5, 1136: 8, 1151: 6, 1168: 7, 1170: 8, 1173: 8, 1184: 8, 1265: 4, 1268: 8, 1280: 1, 1281: 3, 1287: 4, 1292: 8, 1312: 8, 1322: 8, 1331: 8, 1332: 8, 1333: 8, 1334: 8, 1335: 8, 1342: 6, 1345: 8, 1363: 8, 1369: 8, 1370: 8, 1371: 8, 1378: 4, 1379: 8, 1384: 5, 1407: 8, 1419: 8, 1425: 2, 1427: 6, 1434: 2, 1437: 8, 1456: 4
}],
CAR.GENESIS_G70: [{
67: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 358: 6, 544: 8, 576: 8, 593: 8, 608: 8, 688: 5, 809: 8, 832: 8, 854: 7, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 909: 8, 916: 8, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1064: 8, 1078: 4, 1107: 5, 1136: 8, 1151: 6, 1156: 8, 1168: 7, 1170: 8, 1173: 8, 1184: 8, 1186: 2, 1191: 2, 1265: 4, 1280: 1, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1379: 8, 1384: 8, 1407: 8, 1419: 8, 1427: 6, 1456: 4, 1470: 8, 1988: 8, 1996: 8, 2000: 8, 2004: 8, 2008: 8, 2012: 8, 2015: 8
}],
CAR.GENESIS_G80: [{
67: 8, 68: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 358: 6, 359: 8, 544: 8, 546: 8, 593: 8, 608: 8, 688: 5, 809: 8, 832: 8, 854: 7, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 903: 8, 916: 8, 1024: 2, 1040: 8, 1042: 8, 1056: 8, 1057: 8, 1064: 8, 1078: 4, 1107: 5, 1136: 8, 1151: 6, 1156: 8, 1157: 4, 1162: 8, 1168: 7, 1170: 8, 1173: 8, 1184: 8, 1265: 4, 1280: 1, 1281: 3, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1370: 8, 1371: 8, 1378: 4, 1384: 8, 1407: 8, 1419: 8, 1425: 2, 1427: 6, 1434: 2, 1437: 8, 1456: 4, 1470: 8
}],
CAR.GENESIS_G90: [{
67: 8, 68: 8, 127: 8, 304: 8, 320: 8, 339: 8, 356: 4, 358: 6, 359: 8, 544: 8, 546: 8, 593: 8, 608: 8, 688: 5, 809: 8, 832: 8, 854: 7, 870: 7, 871: 8, 872: 8, 897: 8, 902: 8, 903: 8, 916: 8, 1040: 8, 1056: 8, 1057: 8, 1064: 8, 1078: 4, 1107: 5, 1136: 8, 1151: 6, 1156: 8, 1162: 4, 1168: 7, 1170: 8, 1173: 8, 1184: 8, 1265: 4, 1280: 1, 1281: 3, 1287: 4, 1290: 8, 1292: 8, 1294: 8, 1312: 8, 1322: 8, 1342: 6, 1345: 8, 1348: 8, 1363: 8, 1369: 8, 1370: 8, 1371: 8, 1378: 4, 1384: 8, 1407: 8, 1419: 8, 1425: 2, 1427: 6, 1434: 2, 1456: 4, 1470: 8, 1988: 8, 2000: 8, 2003: 8, 2004: 8, 2005: 8, 2008: 8, 2011: 8, 2012: 8, 2013: 8, 2015: 8
}],
}
ECU_FINGERPRINT = {
Ecu.fwdCamera: [832, 1156, 1191, 1342]
}
FW_VERSIONS = {
CAR.ELANTRA_I30: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00PD__ SCC F-CUP 1.00 1.01 99110-G3100 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00PDP LKAS AT AUS RHD 1.00 1.01 99211-G4000 v60',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x00PDu MDPS C 1.00 1.01 56310/G3690 4PDUC101',
],
(Ecu.esp, 0x7d1, None): [
b'\xf1\x00PD ESC \x11 100 \a\x03 58910-G3AC0',
],
(Ecu.engine, 0x7e0, None): [
b'\x01TPD-1A506F000H00',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x816U2VA051\x00\x00\xf1\x006U2V0_C2\x00\x006U2VA051\x00\x00DPD0H16US0\x00\x00\x00\x00',
],
},
CAR.ELANTRA21: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00CN7_ SCC F-CUP 1.00 1.01 99110-AA000 ',
b'\xf1\x00CN7_ SCC FHCUP 1.00 1.01 99110-AA000 ',
b'\xf1\x8799110AA000\xf1\x00CN7_ SCC FHCUP 1.00 1.01 99110-AA000 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00CN7 MFC AT USA LHD 1.00 1.00 99210-AB000 200819'
b'\xf1\x00CN7 MFC AT USA LHD 1.00 1.03 99210-AA000 200819',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x87\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\xf1\x00CN7 MDPS C 1.00 1.06 \x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00 4CNDC106',
b'\xf1\x8756310/AA070\xf1\x00CN7 MDPS C 1.00 1.06 56310/AA070 4CNDC106',
b'\xf1\x8756310AA050\x00\xf1\x00CN7 MDPS C 1.00 1.06 56310AA050\x00 4CNDC106',
],
(Ecu.esp, 0x7d1, None): [
b'\xf1\x00CN ESC \t 101 \x10\x03 58910-AB800',
b'\xf1\x8758910-AA800\xf1\x00CN ESC \t 104 \x08\x03 58910-AA800',
b'\xf1\x8758910-AB800\xf1\x00CN ESC \t 101 \x10\x03 58910-AB800',
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x82CNCWD0AMFCXCSFFA',
b'\xf1\x82CNCWD0AMFCXCSFFB',
b'\xf1\x82CNCVD0AMFCXCSFFB',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x00HT6WA280BLHT6VA640A1CCN0N20NS5\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x00HT6WA280BLHT6VA640A1CCN0N20NS5\x00\x00\x00\x00\x00\x00\xe8\xba\xce\xfa',
b'\xf1\x87CXMQFM2135005JB2E\xb9\x89\x98W\xa9y\x97h\xa9\x98\x99wxvwh\x87\177\xffx\xff\xff\xff,,\xf1\x89HT6VA640A1\xf1\x82CCN0N20NS5\x00\x00\x00\x00\x00\x00',
b'\xf1\x87CXMQFM1916035JB2\x88vvgg\x87Wuwgev\xa9\x98\x88\x98h\x99\x9f\xffh\xff\xff\xff\xa5\xee\xf1\x89HT6VA640A1\xf1\x82CCN0N20NS5\x00\x00\x00\x00\x00\x00',
b'\xf1\x87CXLQF40189012JL2f\x88\x86\x88\x88vUex\xb8\x88\x88\x88\x87\x88\x89fh?\xffz\xff\xff\xff\x08z\xf1\x89HT6VA640A1\xf1\x82CCN0N20NS5\x00\x00\x00\x00\x00\x00',
],
},
CAR.ELANTRA21_HEV: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\000CNhe SCC FHCUP 1.00 1.01 99110-BY000 ',
b'\xf1\x8799110BY000\xf1\x00CNhe SCC FHCUP 1.00 1.01 99110-BY000 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\000CN7HMFC AT USA LHD 1.00 1.03 99210-AA000 200819'
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x8756310/BY050\xf1\000CN7 MDPS C 1.00 1.02 56310/BY050 4CNHC102'
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x816H6G5051\000\000\000\000\000\000\000\000'
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\0006U3L0_C2\000\0006U3K3051\000\000HCN0G16NS0\xb9?A\xaa',
b'\xf1\0006U3L0_C2\000\0006U3K3051\000\000HCN0G16NS0\000\000\000\000',
b'\xf1\x816U3K3051\000\000\xf1\0006U3L0_C2\000\0006U3K3051\000\000HCN0G16NS0\xb9?A\xaa',
b'\xf1\x816U3K3051\000\000\xf1\0006U3L0_C2\000\0006U3K3051\000\000HCN0G16NS0\000\000\000\000'
],
},
CAR.SONATA: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00DN8 1.00 99110-L0000 \xaa\xaa\xaa\xaa\xaa\xaa\xaa ',
b'\xf1\x00DN8 1.00 99110-L0000 \xaa\xaa\xaa\xaa\xaa\xaa\xaa\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x00DN8_ SCC F-CU- 1.00 1.00 99110-L0000 ',
b'\xf1\x00DN8_ SCC F-CUP 1.00 1.00 99110-L0000 ',
b'\xf1\x00DN8_ SCC F-CUP 1.00 1.02 99110-L1000 ',
b'\xf1\x00DN8_ SCC FHCUP 1.00 1.00 99110-L0000 ',
b'\xf1\x00DN8_ SCC FHCUP 1.00 1.01 99110-L1000 ',
b'\xf1\x00DN89110-L0000 \xaa\xaa\xaa\xaa\xaa\xaa\xaa ',
b'\xf1\x8799110L0000\xf1\x00DN8_ SCC F-CUP 1.00 1.00 99110-L0000 ',
b'\xf1\x8799110L0000\xf1\x00DN8_ SCC FHCUP 1.00 1.00 99110-L0000 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00DN8 MFC AT KOR LHD 1.00 1.02 99211-L1000 190422',
b'\xf1\x00DN8 MFC AT RUS LHD 1.00 1.03 99211-L1000 190705',
b'\xf1\x00DN8 MFC AT USA LHD 1.00 1.00 99211-L0000 190716',
b'\xf1\x00DN8 MFC AT USA LHD 1.00 1.01 99211-L0000 191016',
b'\xf1\x00DN8 MFC AT USA LHD 1.00 1.03 99211-L0000 210603',
b'\xf1\x00DN8 MFC AT USA LHD 1.00 1.05 99211-L1000 201109',
b'\xf1\x00DN8 MFC AT USA LHD 1.00 1.06 99211-L1000 210325',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x00DN8 MDPS C 1.00 1.01 \x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00 4DNAC101',
b'\xf1\x00DN8 MDPS C 1.00 1.01 56310-L0010 4DNAC101',
b'\xf1\x00DN8 MDPS C 1.00 1.01 56310L0010\x00 4DNAC101',
b'\xf1\x00DN8 MDPS R 1.00 1.00 57700-L0000 4DNAP100',
b'\xf1\x87\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\xf1\x00DN8 MDPS C 1.00 1.01 \x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00 4DNAC101',
b'\xf1\x8756310-L0010\xf1\x00DN8 MDPS C 1.00 1.01 56310-L0010 4DNAC101',
b'\xf1\x8756310-L0210\xf1\x00DN8 MDPS C 1.00 1.01 56310-L0210 4DNAC101',
b'\xf1\x8756310-L1010\xf1\x00DN8 MDPS C 1.00 1.03 56310-L1010 4DNDC103',
b'\xf1\x8756310-L1030\xf1\x00DN8 MDPS C 1.00 1.03 56310-L1030 4DNDC103',
b'\xf1\x8756310L0010\x00\xf1\x00DN8 MDPS C 1.00 1.01 56310L0010\x00 4DNAC101',
b'\xf1\x8756310L0210\x00\xf1\x00DN8 MDPS C 1.00 1.01 56310L0210\x00 4DNAC101',
b'\xf1\x8757700-L0000\xf1\x00DN8 MDPS R 1.00 1.00 57700-L0000 4DNAP100',
],
(Ecu.esp, 0x7d1, None): [
b'\xf1\x00DN ESC \a 106 \a\x01 58910-L0100',
b'\xf1\x00DN ESC \x01 102\x19\x04\x13 58910-L1300',
b'\xf1\x00DN ESC \x03 100 \x08\x01 58910-L0300',
b'\xf1\x00DN ESC \x06 104\x19\x08\x01 58910-L0100',
b'\xf1\x00DN ESC \x07 104\x19\x08\x01 58910-L0100',
b'\xf1\x00DN ESC \x08 103\x19\x06\x01 58910-L1300',
b'\xf1\x8758910-L0100\xf1\x00DN ESC \a 106 \a\x01 58910-L0100',
b'\xf1\x8758910-L0100\xf1\x00DN ESC \x06 104\x19\x08\x01 58910-L0100',
b'\xf1\x8758910-L0100\xf1\x00DN ESC \x06 106 \x07\x01 58910-L0100',
b'\xf1\x8758910-L0100\xf1\x00DN ESC \x07 104\x19\x08\x01 58910-L0100',
b'\xf1\x8758910-L0300\xf1\x00DN ESC \x03 100 \x08\x01 58910-L0300',
b'\xf1\x00DN ESC \x06 106 \x07\x01 58910-L0100',
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x81HM6M1_0a0_F00',
b'\xf1\x82DNBVN5GMCCXXXDCA',
b'\xf1\x82DNBVN5GMCCXXXG2F',
b'\xf1\x82DNBWN5TMDCXXXG2E',
b'\xf1\x82DNCVN5GMCCXXXF0A',
b'\xf1\x82DNCVN5GMCCXXXG2B',
b'\xf1\x870\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\xf1\x82DNDWN5TMDCXXXJ1A',
b'\xf1\x87391162M003',
b'\xf1\x87391162M013',
b'\xf1\x87391162M023',
b'HM6M1_0a0_F00',
b'HM6M1_0a0_G20',
b'HM6M2_0a0_BD0',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x00bcsh8p54 U913\x00\x00\x00\x00\x00\x00SDN8T16NB1\xe3\xc10\xa1',
b'\xf1\x00bcsh8p54 U913\x00\x00\x00\x00\x00\x00SDN8T16NB2\n\xdd^\xbc',
b'\xf1\x00HT6TA260BLHT6TA800A1TDN8C20KS4\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x00HT6TA260BLHT6TA810A1TDN8M25GS0\x00\x00\x00\x00\x00\x00\xaa\x8c\xd9p',
b'\xf1\x00HT6WA250BLHT6WA910A1SDN8G25NB1\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x00HT6WA250BLHT6WA910A1SDN8G25NB1\x00\x00\x00\x00\x00\x00\x96\xa1\xf1\x92',
b'\xf1\x00HT6WA280BLHT6WAD10A1SDN8G25NB2\x00\x00\x00\x00\x00\x00\x08\xc9O:',
b'\xf1\x00T02601BL T02730A1 VDN8T25XXX730NS5\xf7_\x92\xf5',
b'\xf1\x87954A02N060\x00\x00\x00\x00\x00\xf1\x81T02730A1 \xf1\x00T02601BL T02730A1 VDN8T25XXX730NS5\xf7_\x92\xf5',
b'\xf1\x87SAKFBA2926554GJ2VefVww\x87xwwwww\x88\x87xww\x87wTo\xfb\xffvUo\xff\x8d\x16\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SAKFBA3030524GJ2UVugww\x97yx\x88\x87\x88vw\x87gww\x87wto\xf9\xfffUo\xff\xa2\x0c\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SAKFBA3356084GJ2\x86fvgUUuWgw\x86www\x87wffvf\xb6\xcf\xfc\xffeUO\xff\x12\x19\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SAKFBA3474944GJ2ffvgwwwwg\x88\x86x\x88\x88\x98\x88ffvfeo\xfa\xff\x86fo\xff\t\xae\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SAKFBA3475714GJ2Vfvgvg\x96yx\x88\x97\x88ww\x87ww\x88\x87xs_\xfb\xffvUO\xff\x0f\xff\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALDBA3510954GJ3ww\x87xUUuWx\x88\x87\x88\x87w\x88wvfwfc_\xf9\xff\x98wO\xffl\xe0\xf1\x89HT6WA910A1\xf1\x82SDN8G25NB1\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SALDBA3573534GJ3\x89\x98\x89\x88EUuWgwvwwwwww\x88\x87xTo\xfa\xff\x86f\x7f\xffo\x0e\xf1\x89HT6WA910A1\xf1\x82SDN8G25NB1\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SALDBA3601464GJ3\x88\x88\x88\x88ffvggwvwvw\x87gww\x87wvo\xfb\xff\x98\x88\x7f\xffjJ\xf1\x89HT6WA910A1\xf1\x82SDN8G25NB1\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SALDBA3753044GJ3UUeVff\x86hwwwwvwwgvfgfvo\xf9\xfffU_\xffC\xae\xf1\x89HT6WA910A1\xf1\x82SDN8G25NB1\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SALDBA3862294GJ3vfvgvefVxw\x87\x87w\x88\x87xwwwwc_\xf9\xff\x87w\x9f\xff\xd5\xdc\xf1\x89HT6WA910A1\xf1\x82SDN8G25NB1\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SALDBA3873834GJ3fefVwuwWx\x88\x97\x88w\x88\x97xww\x87wU_\xfb\xff\x86f\x8f\xffN\x04\xf1\x89HT6WA910A1\xf1\x82SDN8G25NB1\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SALDBA4525334GJ3\x89\x99\x99\x99fevWh\x88\x86\x88fwvgw\x88\x87xfo\xfa\xffuDo\xff\xd1>\xf1\x89HT6WA910A1\xf1\x82SDN8G25NB1\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SALDBA4626804GJ3wwww\x88\x87\x88xx\x88\x87\x88wwgw\x88\x88\x98\x88\x95_\xf9\xffuDo\xff|\xe7\xf1\x89HT6WA910A1\xf1\x82SDN8G25NB1\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SALDBA4803224GJ3wwwwwvwg\x88\x88\x98\x88wwww\x87\x88\x88xu\x9f\xfc\xff\x87f\x8f\xff\xea\xea\xf1\x89HT6WA910A1\xf1\x82SDN8G25NB1\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SALDBA6212564GJ3\x87wwwUTuGg\x88\x86xx\x88\x87\x88\x87\x88\x98xu?\xf9\xff\x97f\x7f\xff\xb8\n\xf1\x89HT6WA910A1\xf1\x82SDN8G25NB1\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SALDBA6347404GJ3wwwwff\x86hx\x88\x97\x88\x88\x88\x88\x88vfgf\x88?\xfc\xff\x86Uo\xff\xec/\xf1\x89HT6WA910A1\xf1\x82SDN8G25NB1\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SALDBA6901634GJ3UUuWVeVUww\x87wwwwwvUge\x86/\xfb\xff\xbb\x99\x7f\xff]2\xf1\x89HT6WA910A1\xf1\x82SDN8G25NB1\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SALDBA7077724GJ3\x98\x88\x88\x88ww\x97ygwvwww\x87ww\x88\x87x\x87_\xfd\xff\xba\x99o\xff\x99\x01\xf1\x89HT6WA910A1\xf1\x82SDN8G25NB1\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SALFBA3525114GJ2wvwgvfvggw\x86wffvffw\x86g\x85_\xf9\xff\xa8wo\xffv\xcd\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA3624024GJ2\x88\x88\x88\x88wv\x87hx\x88\x97\x88x\x88\x97\x88ww\x87w\x86o\xfa\xffvU\x7f\xff\xd1\xec\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA3960824GJ2wwwwff\x86hffvfffffvfwfg_\xf9\xff\xa9\x88\x8f\xffb\x99\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA4011074GJ2fgvwwv\x87hw\x88\x87xww\x87wwfgvu_\xfa\xffefo\xff\x87\xc0\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA4121304GJ2x\x87xwff\x86hwwwwww\x87wwwww\x84_\xfc\xff\x98\x88\x9f\xffi\xa6\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA4195874GJ2EVugvf\x86hgwvwww\x87wgw\x86wc_\xfb\xff\x98\x88\x8f\xff\xe23\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA4625294GJ2eVefeUeVx\x88\x97\x88wwwwwwww\xa7o\xfb\xffvw\x9f\xff\xee.\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA4728774GJ2vfvg\x87vwgww\x87ww\x88\x97xww\x87w\x86_\xfb\xffeD?\xffk0\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA5129064GJ2vfvgwv\x87hx\x88\x87\x88ww\x87www\x87wd_\xfa\xffvfo\xff\x1d\x00\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA5454914GJ2\x98\x88\x88\x88\x87vwgx\x88\x87\x88xww\x87ffvf\xa7\x7f\xf9\xff\xa8w\x7f\xff\x1b\x90\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA5987784GJ2UVugDDtGx\x88\x87\x88w\x88\x87xwwwwd/\xfb\xff\x97fO\xff\xb0h\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA5987864GJ2fgvwUUuWgwvw\x87wxwwwww\x84/\xfc\xff\x97w\x7f\xff\xdf\x1d\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA6337644GJ2vgvwwv\x87hgffvwwwwwwww\x85O\xfa\xff\xa7w\x7f\xff\xc5\xfc\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA6802004GJ2UUuWUUuWgw\x86www\x87www\x87w\x96?\xf9\xff\xa9\x88\x7f\xff\x9fK\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA6892284GJ233S5\x87w\x87xx\x88\x87\x88vwwgww\x87w\x84?\xfb\xff\x98\x88\x8f\xff*\x9e\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00SDN8T16NB0z{\xd4v',
b'\xf1\x87SALFBA7005534GJ2eUuWfg\x86xxww\x87x\x88\x87\x88\x88w\x88\x87\x87O\xfc\xffuUO\xff\xa3k\xf1\x81U913\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U913\x00\x00\x00\x00\x00\x00SDN8T16NB1\xe3\xc10\xa1',
b'\xf1\x87SALFBA7152454GJ2gvwgFf\x86hx\x88\x87\x88vfWfffffd?\xfa\xff\xba\x88o\xff,\xcf\xf1\x81U913\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U913\x00\x00\x00\x00\x00\x00SDN8T16NB1\xe3\xc10\xa1',
b'\xf1\x87SALFBA7485034GJ2ww\x87xww\x87xfwvgwwwwvfgf\xa5/\xfc\xff\xa9w_\xff40\xf1\x81U913\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U913\x00\x00\x00\x00\x00\x00SDN8T16NB2\n\xdd^\xbc',
b'\xf1\x87SAMDBA7743924GJ3wwwwww\x87xgwvw\x88\x88\x88\x88wwww\x85_\xfa\xff\x86f\x7f\xff0\x9d\xf1\x89HT6WAD10A1\xf1\x82SDN8G25NB2\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SAMDBA7817334GJ3Vgvwvfvgww\x87wwwwwwfgv\x97O\xfd\xff\x88\x88o\xff\x8e\xeb\xf1\x89HT6WAD10A1\xf1\x82SDN8G25NB2\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SAMDBA8054504GJ3gw\x87xffvgffffwwwweUVUf?\xfc\xffvU_\xff\xddl\xf1\x89HT6WAD10A1\xf1\x82SDN8G25NB2\x00\x00\x00\x00\x00\x00',
b'\xf1\x87SAMFB41553621GC7ww\x87xUU\x85Xvwwg\x88\x88\x88\x88wwgw\x86\xaf\xfb\xffuDo\xff\xaa\x8f\xf1\x81U913\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U913\x00\x00\x00\x00\x00\x00SDN8T16NB2\n\xdd^\xbc',
b'\xf1\x87SAMFB42555421GC7\x88\x88\x88\x88wvwgx\x88\x87\x88wwgw\x87wxw3\x8f\xfc\xff\x98f\x8f\xffga\xf1\x81U913\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U913\x00\x00\x00\x00\x00\x00SDN8T16NB2\n\xdd^\xbc',
b'\xf1\x87SAMFBA7978674GJ2gw\x87xgw\x97ywwwwvUGeUUeU\x87O\xfb\xff\x98w\x8f\xfffF\xf1\x81U913\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U913\x00\x00\x00\x00\x00\x00SDN8T16NB2\n\xdd^\xbc',
b'\xf1\x87SAMFBA9283024GJ2wwwwEUuWwwgwwwwwwwww\x87/\xfb\xff\x98w\x8f\xff<\xd3\xf1\x81U913\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U913\x00\x00\x00\x00\x00\x00SDN8T16NB2\n\xdd^\xbc',
b'\xf1\x87SAMFBA9708354GJ2wwwwVf\x86h\x88wx\x87xww\x87\x88\x88\x88\x88w/\xfa\xff\x97w\x8f\xff\x86\xa0\xf1\x81U913\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U913\x00\x00\x00\x00\x00\x00SDN8T16NB2\n\xdd^\xbc',
],
},
CAR.SONATA_HEV: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\000DNhe SCC FHCUP 1.00 1.02 99110-L5000 ',
b'\xf1\x8799110L5000\xf1\000DNhe SCC FHCUP 1.00 1.02 99110-L5000 ',
b'\xf1\000DNhe SCC F-CUP 1.00 1.02 99110-L5000 ',
b'\xf1\x8799110L5000\xf1\000DNhe SCC F-CUP 1.00 1.02 99110-L5000 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\000DN8HMFC AT USA LHD 1.00 1.04 99211-L1000 191016',
b'\xf1\x00DN8HMFC AT USA LHD 1.00 1.05 99211-L1000 201109',
b'\xf1\000DN8HMFC AT USA LHD 1.00 1.06 99211-L1000 210325',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x8756310-L5500\xf1\000DN8 MDPS C 1.00 1.02 56310-L5500 4DNHC102',
b'\xf1\x8756310-L5450\xf1\x00DN8 MDPS C 1.00 1.02 56310-L5450 4DNHC102',
b'\xf1\x8756310-L5450\xf1\000DN8 MDPS C 1.00 1.03 56310-L5450 4DNHC103',
],
(Ecu.esp, 0x7d1, None): [
b'\xf1\x8758910-L0100\xf1\x00DN ESC \x06 104\x19\x08\x01 58910-L0100\xf1\xa01.04',
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x87391062J002\xf1\xa0000P',
b'\xf1\x87391162J012',
b'\xf1\x87391162J013',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\000PSBG2333 E14\x00\x00\x00\x00\x00\x00\x00TDN2H20SA6N\xc2\xeeW',
b'\xf1\x87959102T250\000\000\000\000\000\xf1\x81E09\000\000\000\000\000\000\000\xf1\000PSBG2323 E09\000\000\000\000\000\000\000TDN2H20SA5\x97R\x88\x9e',
b'\xf1\000PSBG2323 E09\000\000\000\000\000\000\000TDN2H20SA5\x97R\x88\x9e',
b'\xf1\000PSBG2333 E16\000\000\000\000\000\000\000TDN2H20SA7\0323\xf9\xab',
b'\xf1\x87PCU\000\000\000\000\000\000\000\000\000\xf1\x81E16\000\000\000\000\000\000\000\xf1\000PSBG2333 E16\000\000\000\000\000\000\000TDN2H20SA7\0323\xf9\xab',
b'\xf1\x87959102T250\x00\x00\x00\x00\x00\xf1\x81E14\x00\x00\x00\x00\x00\x00\x00\xf1\x00PSBG2333 E14\x00\x00\x00\x00\x00\x00\x00TDN2H20SA6N\xc2\xeeW',
],
},
CAR.SONATA_LF: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00LF__ SCC F-CUP 1.00 1.00 96401-C2200 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00LFF LKAS AT USA LHD 1.00 1.01 95740-C1000 E51',
b'\xf1\x00LFF LKAS AT USA LHD 1.01 1.02 95740-C1000 E52',
],
(Ecu.esp, 0x7d1, None): [
b'\xf1\x00LF ESC \f 11 \x17\x01\x13 58920-C2610',
b'\xf1\x00LF ESC \t 11 \x17\x01\x13 58920-C2610',
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x81606D5051\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x81606D5K51\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x81606G1051\x00\x00\x00\x00\x00\x00\x00\x00',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x006T6H0_C2\x00\x006T6B4051\x00\x00TLF0G24NL1\xb0\x9f\xee\xf5',
b'\xf1\x87\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xf1\x816T6B4051\x00\x00\xf1\x006T6H0_C2\x00\x006T6B4051\x00\x00TLF0G24NL1\x00\x00\x00\x00',
b'\xf1\x87\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xf1\x816T6B4051\x00\x00\xf1\x006T6H0_C2\x00\x006T6B4051\x00\x00TLF0G24NL1\xb0\x9f\xee\xf5',
b'\xf1\x87\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xff\xf1\x816T6B4051\x00\x00\xf1\x006T6H0_C2\x00\x006T6B4051\x00\x00TLF0G24SL2n\x8d\xbe\xd8',
b'\xf1\x87LAHSGN012918KF10\x98\x88x\x87\x88\x88x\x87\x88\x88\x98\x88\x87w\x88w\x88\x88\x98\x886o\xf6\xff\x98w\x7f\xff3\x00\xf1\x816W3B1051\x00\x00\xf1\x006W351_C2\x00\x006W3B1051\x00\x00TLF0T20NL2\x00\x00\x00\x00',
b'\xf1\x87LAHSGN012918KF10\x98\x88x\x87\x88\x88x\x87\x88\x88\x98\x88\x87w\x88w\x88\x88\x98\x886o\xf6\xff\x98w\x7f\xff3\x00\xf1\x816W3B1051\x00\x00\xf1\x006W351_C2\x00\x006W3B1051\x00\x00TLF0T20NL2H\r\xbdm',
],
},
CAR.KONA: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00OS__ SCC F-CUP 1.00 1.00 95655-J9200 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00OS9 LKAS AT USA LHD 1.00 1.00 95740-J9300 g21',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x00OS MDPS C 1.00 1.05 56310J9030\x00 4OSDC105',
],
(Ecu.esp, 0x7d1, None): [
b'\xf1\x816V5RAK00018.ELF\xf1\x00\x00\x00\x00\x00\x00\x00',
],
(Ecu.engine, 0x7e0, None): [
b'"\x01TOS-0NU06F301J02',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x816U2VE051\x00\x00\xf1\x006U2V0_C2\x00\x006U2VE051\x00\x00DOS4T16NS3\x00\x00\x00\x00',
],
},
CAR.KONA_EV: {
(Ecu.fwdRadar, 0x7D0, None): [
b'\xf1\x00DEev SCC F-CUP 1.00 1.00 99110-Q4000 ',
b'\xf1\x00OSev SCC F-CUP 1.00 1.00 99110-K4000 ',
b'\xf1\x00OSev SCC F-CUP 1.00 1.00 99110-K4100 ',
b'\xf1\x00OSev SCC F-CUP 1.00 1.01 99110-K4000 ',
b'\xf1\x00OSev SCC FNCUP 1.00 1.01 99110-K4000 ',
b'\xf1\x00DEev SCC F-CUP 1.00 1.03 96400-Q4100 ',
b'\xf1\x8799110Q4000\xf1\x00DEev SCC F-CUP 1.00 1.00 99110-Q4000 ',
b'\xf1\x8799110Q4100\xf1\x00DEev SCC F-CUP 1.00 1.00 99110-Q4100 ',
b'\xf1\x8799110Q4500\xf1\000DEev SCC F-CUP 1.00 1.00 99110-Q4500 ',
],
(Ecu.fwdCamera, 0x7C4, None): [
b'\xf1\x00DEE MFC AT USA LHD 1.00 1.03 95740-Q4000 180821',
b'\xf1\x00DEE MFC AT EUR LHD 1.00 1.00 99211-Q4000 191211',
b'\xf1\x00DEE MFC AT USA LHD 1.00 1.00 99211-Q4000 191211',
b'\xf1\000DEE MFC AT EUR LHD 1.00 1.00 99211-Q4100 200706',
b'\xf1\x00OSE LKAS AT EUR LHD 1.00 1.00 95740-K4100 W40',
b'\xf1\x00OSE LKAS AT EUR RHD 1.00 1.00 95740-K4100 W40',
b'\xf1\x00OSE LKAS AT KOR LHD 1.00 1.00 95740-K4100 W40',
b'\xf1\x00OE2 LKAS AT EUR LHD 1.00 1.00 95740-K4200 200',
b'\xf1\x00OSE LKAS AT USA LHD 1.00 1.00 95740-K4300 W50',
],
(Ecu.eps, 0x7D4, None): [
b'\xf1\x00OS MDPS C 1.00 1.03 56310/K4550 4OEDC103',
b'\xf1\x00OS MDPS C 1.00 1.04 56310K4000\x00 4OEDC104',
b'\xf1\x00OS MDPS C 1.00 1.04 56310K4050\x00 4OEDC104',
b'\xf1\x00DE MDPS C 1.00 1.05 56310Q4000\x00 4DEEC105',
b'\xf1\x00DE MDPS C 1.00 1.05 56310Q4100\x00 4DEEC105',
],
(Ecu.esp, 0x7D1, None): [
b'\xf1\x00OS IEB \r 105\x18\t\x18 58520-K4000',
b'\xf1\x00OS IEB \x01 212 \x11\x13 58520-K4000',
b'\xf1\x00OS IEB \x02 212 \x11\x13 58520-K4000',
b'\xf1\x00OS IEB \x03 210 \x02\x14 58520-K4000',
b'\xf1\x00OS IEB \x03 212 \x11\x13 58520-K4000',
],
},
CAR.KONA_HEV: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00OShe SCC FNCUP 1.00 1.01 99110-CM000 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00OSH LKAS AT KOR LHD 1.00 1.01 95740-CM000 l31',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x00OS MDPS C 1.00 1.00 56310CM030\x00 4OHDC100',
],
(Ecu.esp, 0x7d1, None): [
b'\xf1\x00OS IEB \x01 104 \x11 58520-CM000',
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x816H6F6051\x00\x00\x00\x00\x00\x00\x00\x00',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x816U3J9051\x00\x00\xf1\x006U3H1_C2\x00\x006U3J9051\x00\x00HOS0G16DS1\x16\xc7\xb0\xd9',
],
},
CAR.IONIQ_EV: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00AEev SCC F-CUP 1.00 1.00 96400-G7000 ',
b'\xf1\x00AEev SCC F-CUP 1.00 1.00 96400-G7100 ',
b'\xf1\x00AEev SCC F-CUP 1.00 1.01 99110-G7000 ',
b'\xf1\x00AEev SCC F-CUP 1.00 1.00 99110-G7200 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00AEE MFC AT EUR LHD 1.00 1.00 95740-G7200 160418',
b'\xf1\x00AEE MFC AT USA LHD 1.00 1.00 95740-G2400 180222',
b'\xf1\x00AEE MFC AT EUR LHD 1.00 1.03 95740-G2500 190516',
b'\xf1\x00AEE MFC AT EUR RHD 1.00 1.01 95740-G2600 190819',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x00AE MDPS C 1.00 1.02 56310G7300\x00 4AEEC102',
b'\xf1\x00AE MDPS C 1.00 1.04 56310/G7501 4AEEC104',
b'\xf1\x00AE MDPS C 1.00 1.01 56310/G7310 4APEC101',
b'\xf1\x00AE MDPS C 1.00 1.01 56310/G7560 4APEC101',
],
},
CAR.IONIQ_HEV: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\000AEhe SCC F-CUP 1.00 1.02 99110-G2100 ',
b'\xf1\x00AEhe SCC F-CUP 1.00 1.00 99110-G2200 ',
b'\xf1\x00AEhe SCC H-CUP 1.01 1.01 96400-G2000 ',
b'\xf1\x00AEhe SCC F-CUP 1.00 1.00 99110-G2600 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00AEH MFC AT EUR LHD 1.00 1.01 95740-G2600 190819',
b'\xf1\x00AEH MFC AT EUR LHD 1.00 1.00 95740-G2400 180222',
b'\xf1\000AEP MFC AT USA LHD 1.00 1.01 95740-G2600 190819',
b'\xf1\x00AEH MFC AT USA LHD 1.00 1.00 95740-G2700 201027',
],
(Ecu.eps, 0x7D4, None): [
b'\xf1\x00AE MDPS C 1.00 1.07 56310/G2301 4AEHC107',
b'\xf1\x00AE MDPS C 1.00 1.01 56310/G2310 4APHC101',
b'\xf1\000AE MDPS C 1.00 1.01 56310/G2510 4APHC101',
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x816H6F6051\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x816H6F2051\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x816H6F6051\000\000\000\000\000\000\000\000',
b'\xf1\x816H6G5051\x00\x00\x00\x00\x00\x00\x00\x00',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x816U3J8051\x00\x00\xf1\x006U3H1_C2\x00\x006U3J8051\x00\x00HAE0G16UL0Nd\xed:',
b'\xf1\x816U3H1051\x00\x00\xf1\x006U3H0_C2\x00\x006U3H1051\x00\x00HAE0G16US2\x95\xa2^$',
b'\xf1\x816U3J9051\000\000\xf1\0006U3H1_C2\000\0006U3J9051\000\000PAE0G16NL0\x82zT\xd2',
b'\xf1\x816U3J9051\x00\x00\xf1\x006U3H1_C2\x00\x006U3J9051\x00\x00HAE0G16NL2\x00\x00\x00\x00',
],
},
CAR.SANTA_FE: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00TM__ SCC F-CUP 1.00 1.01 99110-S2000 ',
b'\xf1\x00TM__ SCC F-CUP 1.00 1.02 99110-S2000 ',
b'\xf1\x00TM__ SCC F-CUP 1.00 1.03 99110-S2000 ',
b'\xf1\x00TM__ SCC F-CUP 1.00 1.00 99110-S1500 ',
b'\xf1\x8799110S1500\xf1\x00TM__ SCC F-CUP 1.00 1.00 99110-S1500 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00TM MFC AT USA LHD 1.00 1.00 99211-S2000 180409',
b'\xf1\x00TMA MFC AT MEX LHD 1.00 1.01 99211-S2500 210205',
b'\xf1\x00TMA MFC AT USA LHD 1.00 1.00 99211-S2500 200720',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x00TM MDPS C 1.00 1.00 56340-S2000 8409',
b'\xf1\x00TM MDPS C 1.00 1.00 56340-S2000 8A12',
b'\xf1\x00TM MDPS C 1.00 1.01 56340-S2000 9129',
b'\xf1\x00TM MDPS C 1.00 1.02 56370-S2AA0 0B19',
],
(Ecu.esp, 0x7d1, None): [
b'\xf1\x00TM ESC \r 100\x18\x031 58910-S2650',
b'\xf1\x00TM ESC \r 103\x18\x11\x08 58910-S2650',
b'\xf1\x00TM ESC \r 104\x19\a\b 58910-S2650',
b'\xf1\x00TM ESC \x02 100\x18\x030 58910-S2600',
b'\xf1\x00TM ESC \x02 102\x18\x07\x01 58910-S2600',
b'\xf1\x00TM ESC \x02 103\x18\x11\x07 58910-S2600',
b'\xf1\x00TM ESC \x02 104\x19\x07\x07 58910-S2600',
b'\xf1\x00TM ESC \x03 103\x18\x11\x07 58910-S2600',
b'\xf1\x00TM ESC \x0c 103\x18\x11\x08 58910-S2650',
b'\xf1\x00TM ESC \x02 101 \x08\x04 58910-S2GA0',
b'\xf1\x00TM ESC \x03 101 \x08\x02 58910-S2DA0',
b'\xf1\x8758910-S2DA0\xf1\x00TM ESC \x03 101 \x08\x02 58910-S2DA0',
b'\xf1\x8758910-S2GA0\xf1\x00TM ESC \x02 101 \x08\x04 58910-S2GA0',
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x81606EA051\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x81606G1051\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x81606G3051\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x82TMBZN5TMD3XXXG2E',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x87LBJSGA7082574HG0\x87www\x98\x88\x88\x88\x99\xaa\xb9\x9afw\x86gx\x99\xa7\x89co\xf8\xffvU_\xffR\xaf\xf1\x816W3C2051\x00\x00\xf1\x006W351_C2\x00\x006W3C2051\x00\x00TTM2T20NS1\x00\xa6\xe0\x91',
b'\xf1\x87LBKSGA0458404HG0vfvg\x87www\x89\x99\xa8\x99y\xaa\xa7\x9ax\x88\xa7\x88t_\xf9\xff\x86w\x8f\xff\x15x\xf1\x816W3C2051\x00\x00\xf1\x006W351_C2\x00\x006W3C2051\x00\x00TTM2T20NS1\x00\x00\x00\x00',
b'\xf1\x87LDJUEA6010814HG1\x87w\x87x\x86gvw\x88\x88\x98\x88gw\x86wx\x88\x97\x88\x85o\xf8\xff\x86f_\xff\xd37\xf1\x816W3C2051\x00\x00\xf1\x006W351_C2\x00\x006W3C2051\x00\x00TTM4T20NS0\xf8\x19\x92g',
b'\xf1\x87LDJUEA6458264HG1ww\x87x\x97x\x87\x88\x88\x99\x98\x89g\x88\x86xw\x88\x97x\x86o\xf7\xffvw\x8f\xff3\x9a\xf1\x816W3C2051\x00\x00\xf1\x006W351_C2\x00\x006W3C2051\x00\x00TTM4T20NS0\xf8\x19\x92g',
b'\xf1\x87LDKUEA2045844HG1wwww\x98\x88x\x87\x88\x88\xa8\x88x\x99\x97\x89x\x88\xa7\x88U\x7f\xf8\xffvfO\xffC\x1e\xf1\x816W3E0051\x00\x00\xf1\x006W351_C2\x00\x006W3E0051\x00\x00TTM4T20NS3\x00\x00\x00\x00',
b'\xf1\x87LDKUEA9993304HG1\x87www\x97x\x87\x88\x99\x99\xa9\x99x\x99\xa7\x89w\x88\x97x\x86_\xf7\xffwwO\xffl#\xf1\x816W3C2051\x00\x00\xf1\x006W351_C2\x00\x006W3C2051\x00\x00TTM4T20NS1R\x7f\x90\n',
b'\xf1\x87LDLUEA6061564HG1\xa9\x99\x89\x98\x87wwwx\x88\x97\x88x\x99\xa7\x89x\x99\xa7\x89sO\xf9\xffvU_\xff<\xde\xf1\x816W3E1051\x00\x00\xf1\x006W351_C2\x00\x006W3E1051\x00\x00TTM4T20NS50\xcb\xc3\xed',
b'\xf1\x87LDLUEA6159884HG1\x88\x87hv\x99\x99y\x97\x89\xaa\xb8\x9ax\x99\x87\x89y\x99\xb7\x99\xa7?\xf7\xff\x97wo\xff\xf3\x05\xf1\x816W3E1051\x00\x00\xf1\x006W351_C2\x00\x006W3E1051\x00\x00TTM4T20NS5\x00\x00\x00\x00',
b'\xf1\x87LDLUEA6852664HG1\x97wWu\x97www\x89\xaa\xc8\x9ax\x99\x97\x89x\x99\xa7\x89SO\xf7\xff\xa8\x88\x7f\xff\x03z\xf1\x816W3E1051\x00\x00\xf1\x006W351_C2\x00\x006W3E1051\x00\x00TTM4T20NS50\xcb\xc3\xed',
b'\xf1\x87LDLUEA6898374HG1fevW\x87wwwx\x88\x97\x88h\x88\x96\x88x\x88\xa7\x88ao\xf9\xff\x98\x99\x7f\xffD\xe2\xf1\x816W3E1051\x00\x00\xf1\x006W351_C2\x00\x006W3E1051\x00\x00TTM4T20NS5\x00\x00\x00\x00',
b'\xf1\x87LDLUEA6898374HG1fevW\x87wwwx\x88\x97\x88h\x88\x96\x88x\x88\xa7\x88ao\xf9\xff\x98\x99\x7f\xffD\xe2\xf1\x816W3E1051\x00\x00\xf1\x006W351_C2\x00\x006W3E1051\x00\x00TTM4T20NS50\xcb\xc3\xed',
b'\xf1\x87SBJWAA5842214GG0\x88\x87\x88xww\x87x\x89\x99\xa8\x99\x88\x99\x98\x89w\x88\x87xw_\xfa\xfffU_\xff\xd1\x8d\xf1\x816W3C2051\x00\x00\xf1\x006W351_C2\x00\x006W3C2051\x00\x00TTM2G24NS1\x98{|\xe3',
b'\xf1\x87SBJWAA5890864GG0\xa9\x99\x89\x98\x98\x87\x98y\x89\x99\xa8\x99w\x88\x87xww\x87wvo\xfb\xffuD_\xff\x9f\xb5\xf1\x816W3C2051\x00\x00\xf1\x006W351_C2\x00\x006W3C2051\x00\x00TTM2G24NS1\x98{|\xe3',
b'\xf1\x87SBJWAA6562474GG0ffvgeTeFx\x88\x97\x88ww\x87www\x87w\x84o\xfa\xff\x87fO\xff\xc2 \xf1\x816W3C2051\x00\x00\xf1\x006W351_C2\x00\x006W3C2051\x00\x00TTM2G24NS1\x00\x00\x00\x00',
b'\xf1\x87SBJWAA6562474GG0ffvgeTeFx\x88\x97\x88ww\x87www\x87w\x84o\xfa\xff\x87fO\xff\xc2 \xf1\x816W3C2051\x00\x00\xf1\x006W351_C2\x00\x006W3C2051\x00\x00TTM2G24NS1\x98{|\xe3',
b'\xf1\x87SBJWAA7780564GG0wvwgUUeVwwwwx\x88\x87\x88wwwwd_\xfc\xff\x86f\x7f\xff\xd7*\xf1\x816W3C2051\x00\x00\xf1\x006W351_C2\x00\x006W3C2051\x00\x00TTM2G24NS2F\x84<\xc0',
b'\xf1\x87SBJWAA8278284GG0ffvgUU\x85Xx\x88\x87\x88x\x88w\x88ww\x87w\x96o\xfd\xff\xa7U_\xff\xf2\xa0\xf1\x816W3C2051\x00\x00\xf1\x006W351_C2\x00\x006W3C2051\x00\x00TTM2G24NS2F\x84<\xc0',
b'\xf1\x87SBLWAA4363244GG0wvwgwv\x87hgw\x86ww\x88\x87xww\x87wdo\xfb\xff\x86f\x7f\xff3$\xf1\x816W3E1051\x00\x00\xf1\x006W351_C2\x00\x006W3E1051\x00\x00TTM2G24NS6\x00\x00\x00\x00',
b'\xf1\x87SBLWAA4363244GG0wvwgwv\x87hgw\x86ww\x88\x87xww\x87wdo\xfb\xff\x86f\x7f\xff3$\xf1\x816W3E1051\x00\x00\xf1\x006W351_C2\x00\x006W3E1051\x00\x00TTM2G24NS6x0\x17\xfe',
b'\xf1\x87SBLWAA4899564GG0VfvgUU\x85Xx\x88\x87\x88vfgf\x87wxwvO\xfb\xff\x97f\xb1\xffSB\xf1\x816W3E1051\x00\x00\xf1\x006W351_C2\x00\x006W3E1051\x00\x00TTM2G24NS7\x00\x00\x00\x00',
b'\xf1\x87SBLWAA6622844GG0wwwwff\x86hwwwwx\x88\x87\x88\x88\x88\x88\x88\x98?\xfd\xff\xa9\x88\x7f\xffn\xe5\xf1\x816W3E1051\x00\x00\xf1\x006W351_C2\x00\x006W3E1051\x00\x00TTM2G24NS7u\x1e{\x1c',
b'\xf1\x87SDJXAA7656854GG1DEtWUU\x85X\x88\x88\x98\x88w\x88\x87xx\x88\x87\x88\x96o\xfb\xff\x86f\x7f\xff.\xca\xf1\x816W3C2051\x00\x00\xf1\x006W351_C2\x00\x006W3C2051\x00\x00TTM4G24NS2\x00\x00\x00\x00',
b'\xf1\x87SDJXAA7656854GG1DEtWUU\x85X\x88\x88\x98\x88w\x88\x87xx\x88\x87\x88\x96o\xfb\xff\x86f\x7f\xff.\xca\xf1\x816W3C2051\x00\x00\xf1\x006W351_C2\x00\x006W3C2051\x00\x00TTM4G24NS2K\xdaV0',
b'\xf1\x87SDKXAA2443414GG1vfvgwv\x87h\x88\x88\x88\x88ww\x87wwwww\x99_\xfc\xffvD?\xffl\xd2\xf1\x816W3E1051\x00\x00\xf1\x006W351_C2\x00\x006W3E1051\x00\x00TTM4G24NS6\x00\x00\x00\x00',
b'\xf1\x00T02601BL T02730A1 VTMPT25XXX730NS2\xa6\x06\x88\xf7',
b'\xf1\x87SDMXCA8653204GN1EVugEUuWwwwwww\x87wwwwwv/\xfb\xff\xa8\x88\x9f\xff\xa5\x9c\xf1\x89HT6WAD00A1\xf1\x82STM4G25NH1\x00\x00\x00\x00\x00\x00',
b'\xf1\x87954A02N250\x00\x00\x00\x00\x00\xf1\x81T02730A1 \xf1\x00T02601BL T02730A1 VTMPT25XXX730NS2\xa6\x06\x88\xf7',
],
},
CAR.SANTA_FE_HEV: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x8799110CL500\xf1\x00TMhe SCC FHCUP 1.00 1.00 99110-CL500 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00TMH MFC AT USA LHD 1.00 1.03 99211-S1500 210224',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x00TM MDPS C 1.00 1.02 56310-CLAC0 4TSHC102',
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x87391312MTC1',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x87959102T250\x00\x00\x00\x00\x00\xf1\x81E14\x00\x00\x00\x00\x00\x00\x00\xf1\x00PSBG2333 E14\x00\x00\x00\x00\x00\x00\x00TTM2H16SA2\x80\xd7l\xb2',
],
},
CAR.PALISADE: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\000LX2_ SCC F-CUP 1.00 1.05 99110-S8100 ',
b'\xf1\x00LX2 SCC FHCUP 1.00 1.04 99110-S8100 ',
b'\xf1\x00LX2_ SCC FHCU- 1.00 1.05 99110-S8100 ',
b'\xf1\x00LX2_ SCC FHCUP 1.00 1.00 99110-S8110 ',
b'\xf1\x00LX2_ SCC FHCUP 1.00 1.04 99110-S8100 ',
b'\xf1\x00LX2_ SCC FHCUP 1.00 1.05 99110-S8100 ',
b'\xf1\x00ON__ FCA FHCUP 1.00 1.02 99110-S9100 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00LX2 MFC AT USA LHD 1.00 1.03 99211-S8100 190125',
b'\xf1\x00LX2 MFC AT USA LHD 1.00 1.05 99211-S8100 190909',
b'\xf1\x00LX2 MFC AT USA LHD 1.00 1.07 99211-S8100 200422',
b'\xf1\x00LX2 MFC AT USA LHD 1.00 1.08 99211-S8100 200903',
b'\xf1\x00ON MFC AT USA LHD 1.00 1.01 99211-S9100 181105',
b'\xf1\x00ON MFC AT USA LHD 1.00 1.03 99211-S9100 200720',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x00LX2 MDPS C 1,00 1,03 56310-S8020 4LXDC103', # modified firmware
b'\xf1\x00LX2 MDPS C 1.00 1.03 56310-S8020 4LXDC103',
b'\xf1\x00LX2 MDPS C 1.00 1.04 56310-S8020 4LXDC104',
b'\xf1\x00ON MDPS C 1.00 1.00 56340-S9000 8B13',
b'\xf1\x00ON MDPS C 1.00 1.01 56340-S9000 9201',
],
(Ecu.esp, 0x7d1, None): [
b'\xf1\x00LX ESC \x01 103\x19\t\x10 58910-S8360',
b'\xf1\x00LX ESC \x01 103\x31\t\020 58910-S8360',
b'\xf1\x00LX ESC \x0b 101\x19\x03\x17 58910-S8330',
b'\xf1\x00LX ESC \x0b 102\x19\x05\x07 58910-S8330',
b'\xf1\x00LX ESC \x0b 103\x19\t\x07 58910-S8330',
b'\xf1\x00LX ESC \x0b 103\x19\t\x10 58910-S8360',
b'\xf1\x00LX ESC \x0b 104 \x10\x16 58910-S8360',
b'\xf1\x00ON ESC \x0b 100\x18\x12\x18 58910-S9360',
b'\xf1\x00ON ESC \x0b 101\x19\t\x08 58910-S9360',
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x81640J0051\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x81640K0051\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x81640S1051\x00\x00\x00\x00\x00\x00\x00\x00',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x00bcsh8p54 U872\x00\x00\x00\x00\x00\x00TON4G38NB1\x96z28',
b'\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00TON4G38NB2[v\\\xb6',
b'\xf1\x87LBLUFN591307KF25vgvw\x97wwwy\x99\xa7\x99\x99\xaa\xa9\x9af\x88\x96h\x95o\xf7\xff\x99f/\xff\xe4c\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX2G38NB2\xd7\xc1/\xd1',
b'\xf1\x87LBLUFN650868KF36\xa9\x98\x89\x88\xa8\x88\x88\x88h\x99\xa6\x89fw\x86gw\x88\x97x\xaa\x7f\xf6\xff\xbb\xbb\x8f\xff+\x82\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX2G38NB3\xd1\xc3\xf8\xa8',
b'\xf1\x87LBLUFN655162KF36\x98\x88\x88\x88\x98\x88\x88\x88x\x99\xa7\x89x\x99\xa7\x89x\x99\x97\x89g\x7f\xf7\xffwU_\xff\xe9!\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX2G38NB3\xd1\xc3\xf8\xa8',
b'\xf1\x87LBLUFN731381KF36\xb9\x99\x89\x98\x98\x88\x88\x88\x89\x99\xa8\x99\x88\x99\xa8\x89\x88\x88\x98\x88V\177\xf6\xff\x99w\x8f\xff\xad\xd8\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\000bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX2G38NB3\xd1\xc3\xf8\xa8',
b'\xf1\x87LDKVAA0028604HH1\xa8\x88x\x87vgvw\x88\x99\xa8\x89gw\x86ww\x88\x97x\x97o\xf9\xff\x97w\x7f\xffo\x02\xf1\x81U872\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U872\x00\x00\x00\x00\x00\x00TON4G38NB1\x96z28',
b'\xf1\x87LDKVAA3068374HH1wwww\x87xw\x87y\x99\xa7\x99w\x88\x87xw\x88\x97x\x85\xaf\xfa\xffvU/\xffU\xdc\xf1\x81U872\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U872\x00\x00\x00\x00\x00\x00TON4G38NB1\x96z28',
b'\xf1\x87LDKVBN382172KF26\x98\x88\x88\x88\xa8\x88\x88\x88x\x99\xa7\x89\x87\x88\x98x\x98\x99\xa9\x89\xa5_\xf6\xffDDO\xff\xcd\x16\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB2\xafL]\xe7',
b'\xf1\x87LDKVBN424201KF26\xba\xaa\x9a\xa9\x99\x99\x89\x98\x89\x99\xa8\x99\x88\x99\x98\x89\x88\x99\xa8\x89v\x7f\xf7\xffwf_\xffq\xa6\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB2\xafL]\xe7',
b'\xf1\x87LDKVBN540766KF37\x87wgv\x87w\x87xx\x99\x97\x89v\x88\x97h\x88\x88\x88\x88x\x7f\xf6\xffvUo\xff\xd3\x01\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB2\xafL]\xe7',
b'\xf1\x87LDLVAA4225634HH1\x98\x88\x88\x88eUeVx\x88\x87\x88g\x88\x86xx\x88\x87\x88\x86o\xf9\xff\x87w\x7f\xff\xf2\xf7\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00TON4G38NB2[v\\\xb6',
b'\xf1\x87LDLVAA4777834HH1\x98\x88x\x87\x87wwwx\x88\x87\x88x\x99\x97\x89x\x88\x97\x88\x86o\xfa\xff\x86fO\xff\x1d9\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00TON4G38NB2[v\\\xb6',
b'\xf1\x87LDLVAA5194534HH1ffvguUUUx\x88\xa7\x88h\x99\x96\x89x\x88\x97\x88ro\xf9\xff\x98wo\xff\xaaM\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00TON4G38NB2[v\\\xb6',
b'\xf1\x87LDLVAA5949924HH1\xa9\x99y\x97\x87wwwx\x99\x97\x89x\x99\xa7\x89x\x99\xa7\x89\x87_\xfa\xffeD?\xff\xf1\xfd\xf1\x81U903\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U903\x00\x00\x00\x00\x00\x00TON4G38NB2[v\\\xb6',
b'\xf1\x87LDLVBN560098KF26\x86fff\x87vgfg\x88\x96xfw\x86gfw\x86g\x95\xf6\xffeU_\xff\x92c\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB2\xafL]\xe7',
b'\xf1\x87LDLVBN602045KF26\xb9\x99\x89\x98\x97vwgy\xaa\xb7\x9af\x88\x96hw\x99\xa7y\xa9\x7f\xf5\xff\x99w\x7f\xff,\xd3\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB3X\xa8\xc08',
b'\xf1\x87LDLVBN628911KF26\xa9\x99\x89\x98\x98\x88\x88\x88y\x99\xa7\x99fw\x86gw\x88\x87x\x83\x7f\xf6\xff\x98wo\xff2\xda\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB3X\xa8\xc08',
b'\xf1\x87LDLVBN645817KF37\x87www\x98\x87xwx\x99\x97\x89\x99\x99\x99\x99g\x88\x96x\xb6_\xf7\xff\x98fo\xff\xe2\x86\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB3X\xa8\xc08',
b'\xf1\x87LDLVBN662115KF37\x98\x88\x88\x88\xa8\x88\x88\x88x\x99\x97\x89x\x99\xa7\x89\x88\x99\xa8\x89\x88\x7f\xf7\xfffD_\xff\xdc\x84\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB3X\xa8\xc08',
b'\xf1\x87LDLVBN667933KF37\xb9\x99\x89\x98\xb9\x99\x99\x99x\x88\x87\x88w\x88\x87x\x88\x88\x98\x88\xcbo\xf7\xffe3/\xffQ!\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB3X\xa8\xc08',
b'\xf1\x87LDLVBN673087KF37\x97www\x86fvgx\x99\x97\x89\x99\xaa\xa9\x9ag\x88\x86x\xe9_\xf8\xff\x98w\x7f\xff"\xad\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB3X\xa8\xc08',
b'\xf1\x87LDLVBN673841KF37\x98\x88x\x87\x86g\x86xy\x99\xa7\x99\x88\x99\xa8\x89w\x88\x97xdo\xf5\xff\x98\x88\x8f\xffT\xec\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB3X\xa8\xc08',
b'\xf1\x87LDLVBN681363KF37\x98\x88\x88\x88\x97x\x87\x88y\xaa\xa7\x9a\x88\x88\x98\x88\x88\x88\x88\x88vo\xf6\xffvD\x7f\xff%v\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB3X\xa8\xc08',
b'\xf1\x87LDLVBN713782KF37\x99\x99y\x97\x98\x88\x88\x88x\x88\x97\x88\x88\x99\x98\x89\x88\x99\xa8\x89\x87o\xf7\xffeU?\xff7,\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB3X\xa8\xc08',
b'\xf1\x87LDLVBN713890KF26\xb9\x99\x89\x98\xa9\x99\x99\x99x\x99\x97\x89\x88\x99\xa8\x89\x88\x99\xb8\x89Do\xf7\xff\xa9\x88o\xffs\r\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB3X\xa8\xc08',
b'\xf1\x87LDLVBN733215KF37\x99\x98y\x87\x97wwwi\x99\xa6\x99x\x99\xa7\x89V\x88\x95h\x86o\xf7\xffeDO\xff\x12\xe7\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB3X\xa8\xc08',
b'\xf1\x87LDLVBN750044KF37\xca\xa9\x8a\x98\xa7wwwy\xaa\xb7\x9ag\x88\x96x\x88\x99\xa8\x89\xb9\x7f\xf6\xff\xa8w\x7f\xff\xbe\xde\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB3X\xa8\xc08',
b'\xf1\x87LDLVBN752612KF37\xba\xaa\x8a\xa8\x87w\x87xy\xaa\xa7\x9a\x88\x99\x98\x89x\x88\x97\x88\x96o\xf6\xffvU_\xffh\x1b\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB3X\xa8\xc08',
b'\xf1\x87LDLVBN755553KF37\x87xw\x87\x97w\x87xy\x99\xa7\x99\x99\x99\xa9\x99Vw\x95gwo\xf6\xffwUO\xff\xb5T\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX4G38NB3X\xa8\xc08',
b'\xf1\x87LDLVBN757883KF37\x98\x87xw\x98\x87\x88xy\xaa\xb7\x9ag\x88\x96x\x89\x99\xa8\x99e\x7f\xf6\xff\xa9\x88o\xff5\x15\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB4\xd6\xe8\xd7\xa6',
b'\xf1\x87LDMVBN778156KF37\x87vWe\xa9\x99\x99\x99y\x99\xb7\x99\x99\x99\x99\x99x\x99\x97\x89\xa8\x7f\xf8\xffwf\x7f\xff\x82_\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB4\xd6\xe8\xd7\xa6',
b'\xf1\x87LDMVBN780576KF37\x98\x87hv\x97x\x97\x89x\x99\xa7\x89\x88\x99\x98\x89w\x88\x97x\x98\x7f\xf7\xff\xba\x88\x8f\xff\x1e0\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB4\xd6\xe8\xd7\xa6',
b'\xf1\x87LDMVBN783485KF37\x87www\x87vwgy\x99\xa7\x99\x99\x99\xa9\x99Vw\x95g\x89_\xf6\xff\xa9w_\xff\xc5\xd6\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB4\xd6\xe8\xd7\xa6',
b'\xf1\x87LDMVBN811844KF37\x87vwgvfffx\x99\xa7\x89Vw\x95gg\x88\xa6xe\x8f\xf6\xff\x97wO\xff\t\x80\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB4\xd6\xe8\xd7\xa6',
b'\xf1\x87LDMVBN830601KF37\xa7www\xa8\x87xwx\x99\xa7\x89Uw\x85Ww\x88\x97x\x88o\xf6\xff\x8a\xaa\x7f\xff\xe2:\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB4\xd6\xe8\xd7\xa6',
b'\xf1\x87LDMVBN848789KF37\x87w\x87x\x87w\x87xy\x99\xb7\x99\x87\x88\x98x\x88\x99\xa8\x89\x87\x7f\xf6\xfffUo\xff\xe3!\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB5\xb9\x94\xe8\x89',
b'\xf1\x87LDMVBN851595KF37\x97wgvvfffx\x99\xb7\x89\x88\x99\x98\x89\x87\x88\x98x\x99\x7f\xf7\xff\x97w\x7f\xff@\xf3\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB5\xb9\x94\xe8\x89',
b'\xf1\x87LDMVBN873175KF26\xa8\x88\x88\x88vfVex\x99\xb7\x89\x88\x99\x98\x89x\x88\x97\x88f\x7f\xf7\xff\xbb\xaa\x8f\xff,\x04\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB5\xb9\x94\xe8\x89',
b'\xf1\x87LDMVBN879401KF26veVU\xa8\x88\x88\x88g\x88\xa6xVw\x95gx\x88\xa7\x88v\x8f\xf9\xff\xdd\xbb\xbf\xff\xb3\x99\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB5\xb9\x94\xe8\x89',
b'\xf1\x87LDMVBN881314KF37\xa8\x88h\x86\x97www\x89\x99\xa8\x99w\x88\x97xx\x99\xa7\x89\xca\x7f\xf8\xff\xba\x99\x8f\xff\xd8v\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB5\xb9\x94\xe8\x89',
b'\xf1\x87LDMVBN888651KF37\xa9\x99\x89\x98vfff\x88\x99\x98\x89w\x99\xa7y\x88\x88\x98\x88D\x8f\xf9\xff\xcb\x99\x8f\xff\xa5\x1e\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB5\xb9\x94\xe8\x89',
b'\xf1\x87LDMVBN889419KF37\xa9\x99y\x97\x87w\x87xx\x88\x97\x88w\x88\x97x\x88\x99\x98\x89e\x9f\xf9\xffeUo\xff\x901\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB5\xb9\x94\xe8\x89',
b'\xf1\x87LDMVBN895969KF37vefV\x87vgfx\x99\xa7\x89\x99\x99\xb9\x99f\x88\x96he_\xf7\xffxwo\xff\x14\xf9\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB5\xb9\x94\xe8\x89',
b'\xf1\x87LDMVBN899222KF37\xa8\x88x\x87\x97www\x98\x99\x99\x89\x88\x99\x98\x89f\x88\x96hdo\xf7\xff\xbb\xaa\x9f\xff\xe2U\xf1\x81U922\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U922\x00\x00\x00\x00\x00\x00SLX4G38NB5\xb9\x94\xe8\x89',
b"\xf1\x87LBLUFN622950KF36\xa8\x88\x88\x88\x87w\x87xh\x99\x96\x89\x88\x99\x98\x89\x88\x99\x98\x89\x87o\xf6\xff\x98\x88o\xffx'\xf1\x81U891\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U891\x00\x00\x00\x00\x00\x00SLX2G38NB3\xd1\xc3\xf8\xa8",
],
},
CAR.VELOSTER: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00JS__ SCC H-CUP 1.00 1.02 95650-J3200 ',
b'\xf1\x00JS__ SCC HNCUP 1.00 1.02 95650-J3100 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00JS LKAS AT USA LHD 1.00 1.02 95740-J3000 K32',
b'\xf1\x00JS LKAS AT KOR LHD 1.00 1.03 95740-J3000 K33',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x00JSL MDPS C 1.00 1.03 56340-J3000 8308',
],
(Ecu.esp, 0x7d1, None): [
b'\xf1\x00\x00\x00\x00\x00\x00\x00',
],
(Ecu.engine, 0x7e0, None): [
b'\x01TJS-JNU06F200H0A',
b'\x01TJS-JDK06F200H0A',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x816U2V8051\x00\x00\xf1\x006U2V0_C2\x00\x006U2V8051\x00\x00DJS0T16NS1\xba\x02\xb8\x80',
b'\xf1\x816U2V8051\x00\x00\xf1\x006U2V0_C2\x00\x006U2V8051\x00\x00DJS0T16NS1\x00\x00\x00\x00',
b'\xf1\x816U2V8051\x00\x00\xf1\x006U2V0_C2\x00\x006U2V8051\x00\x00DJS0T16KS2\016\xba\036\xa2',
],
},
# kia
CAR.FORTE: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00BD__ SCC H-CUP 1.00 1.02 99110-M6000 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00BD LKAS AT USA LHD 1.00 1.04 95740-M6000 J33',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x00BD MDPS C 1.00 1.02 56310-XX000 4BD2C102',
b'\xf1\x00BD MDPS C 1.00 1.08 56310/M6300 4BDDC108',
b'\xf1\x00BD MDPS C 1.00 1.08 56310M6300\x00 4BDDC108',
],
(Ecu.esp, 0x7d1, None): [
b'\xf1\x816VGRAH00018.ELF\xf1\x00\x00\x00\x00\x00\x00\x00',
],
(Ecu.engine, 0x7e0, None): [
b'\x01TBDM1NU06F200H01',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x816U2VC051\x00\x00\xf1\x006U2V0_C2\x00\x006U2VC051\x00\x00DBD0T16SS0\x00\x00\x00\x00',
b"\xf1\x816U2VC051\x00\x00\xf1\x006U2V0_C2\x00\x006U2VC051\x00\x00DBD0T16SS0\xcf\x1e'\xc3", ],
},
CAR.K5: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00JF__ SCC F-CUP 1.00 1.00 96400-D4110 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00JFA LKAS AT USA LHD 1.00 1.02 95895-D5000 h31',
b'\xf1\x00JFA LKAS AT USA LHD 1.00 1.00 95895-D5001 h32',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x00TM MDPS C 1.00 1.00 56340-S2000 8409',
],
(Ecu.esp, 0x7d1, None): [
b'\xf1\x00JF ESC \v 11 \x18\x030 58920-D5180',
],
(Ecu.engine, 0x7e0, None): [
b'\x01TJFAJNU06F201H03',
b'\xf1\x89F1JF600AISEIU702\xf1\x82F1JF600AISEIU702',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x816U2V8051\x00\x00\xf1\x006U2V0_C2\x00\x006U2V8051\x00\x00DJF0T16NL0\t\xd2GW', ],
},
CAR.K5_HEV: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00DEhe SCC H-CUP 1.01 1.02 96400-G5100 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00DEP MFC AT USA LHD 1.00 1.01 95740-G5010 170424',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x00DE MDPS C 1.00 1.09 56310G5301\x00 4DEHC109',
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x816H6F4051\x00\x00\x00\x00\x00\x00\x00\x00',
],
(Ecu.transmission, 0x7e1, None): [
b"\xf1\x816U3J2051\x00\x00\xf1\x006U3H0_C2\x00\x006U3J2051\x00\x00PDE0G16NS2\xf4'\\\x91", ],
},
CAR.K5_DL3: {
(Ecu.fwdRadar, 0x7D0, None): [
b'\xf1\000DL3_ SCC FHCUP 1.00 1.03 99110-L2000 ',
b'\xf1\x8799110L2000\xf1\000DL3_ SCC FHCUP 1.00 1.03 99110-L2000 ',
b'\xf1\x8799110L2100\xf1\x00DL3_ SCC F-CUP 1.00 1.03 99110-L2100 ',
b'\xf1\x8799110L2100\xf1\x00DL3_ SCC FHCUP 1.00 1.03 99110-L2100 ',
],
(Ecu.fwdCamera, 0x7C4, None): [
b'\xf1\000DL3 MFC AT USA LHD 1.00 1.03 99210-L3000 200915',
b'\xf1\x00DL3 MFC AT USA LHD 1.00 1.04 99210-L3000 210208',
],
(Ecu.eps, 0x7D4, None): [
b'\xf1\x8756310-L3110\xf1\000DL3 MDPS C 1.00 1.01 56310-L3110 4DLAC101',
b'\xf1\x8756310-L3220\xf1\x00DL3 MDPS C 1.00 1.01 56310-L3220 4DLAC101',
b'\xf1\x8757700-L3000\xf1\x00DL3 MDPS R 1.00 1.02 57700-L3000 4DLAP102',
],
(Ecu.esp, 0x7D1, None): [
b'\xf1\000DL ESC \006 101 \004\002 58910-L3200',
b'\xf1\x8758910-L3200\xf1\000DL ESC \006 101 \004\002 58910-L3200',
b'\xf1\x8758910-L3800\xf1\x00DL ESC \t 101 \x07\x02 58910-L3800',
b'\xf1\x8758910-L3600\xf1\x00DL ESC \x03 100 \x08\x02 58910-L3600',
],
(Ecu.engine, 0x7E0, None): [
b'\xf1\x87391212MKT0',
b'\xf1\x87391212MKV0',
b'\xf1\x870\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\xf1\x82DLDWN5TMDCXXXJ1B',
],
(Ecu.transmission, 0x7E1, None): [
b'\xf1\000bcsh8p54 U913\000\000\000\000\000\000TDL2T16NB1ia\v\xb8',
b'\xf1\x87SALFEA5652514GK2UUeV\x88\x87\x88xxwg\x87ww\x87wwfwvd/\xfb\xffvU_\xff\x93\xd3\xf1\x81U913\000\000\000\000\000\000\xf1\000bcsh8p54 U913\000\000\000\000\000\000TDL2T16NB1ia\v\xb8',
b'\xf1\x87SALFEA6046104GK2wvwgeTeFg\x88\x96xwwwwffvfe?\xfd\xff\x86fo\xff\x97A\xf1\x81U913\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U913\x00\x00\x00\x00\x00\x00TDL2T16NB1ia\x0b\xb8',
b'\xf1\x87SCMSAA8572454GK1\x87x\x87\x88Vf\x86hgwvwvwwgvwwgT?\xfb\xff\x97fo\xffH\xb8\xf1\x81U913\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 U913\x00\x00\x00\x00\x00\x00TDL4T16NB05\x94t\x18',
b'\xf1\x87954A02N300\x00\x00\x00\x00\x00\xf1\x81T02730A1 \xf1\x00T02601BL T02730A1 WDL3T25XXX730NS2b\x1f\xb8%',
],
},
CAR.STINGER: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00CK__ SCC F_CUP 1.00 1.01 96400-J5100 ',
b'\xf1\x00CK__ SCC F_CUP 1.00 1.03 96400-J5100 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00CK MFC AT USA LHD 1.00 1.03 95740-J5000 170822',
b'\xf1\x00CK MFC AT USA LHD 1.00 1.04 95740-J5000 180504',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x00CK MDPS R 1.00 1.04 57700-J5200 4C2CL104',
b'\xf1\x00CK MDPS R 1.00 1.04 57700-J5220 4C2VL104',
b'\xf1\x00CK MDPS R 1.00 1.04 57700-J5420 4C4VL104',
b'\xf1\x00CK MDPS R 1.00 1.06 57700-J5420 4C4VL106',
b'\xf1\x00CK MDPS R 1.00 1.07 57700-J5420 4C4VL107',
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x81606DE051\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x81640E0051\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x81640L0051\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x82CKJN3TMSDE0B\x00\x00\x00\x00',
b'\xf1\x82CKKN3TMD_H0A\x00\x00\x00\x00',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x87VCJLE17622572DK0vd6D\x99\x98y\x97vwVffUfvfC%CuT&Dx\x87o\xff{\x1c\xf1\x81E21\x00\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 E21\x00\x00\x00\x00\x00\x00\x00SCK0T33NB0\x88\xa2\xe6\xf0',
b'\xf1\x87VDHLG17000192DK2xdFffT\xa5VUD$DwT\x86wveVeeD&T\x99\xba\x8f\xff\xcc\x99\xf1\x81E21\x00\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 E21\x00\x00\x00\x00\x00\x00\x00SCK0T33NB0\x88\xa2\xe6\xf0',
b'\xf1\x87VDHLG17000192DK2xdFffT\xa5VUD$DwT\x86wveVeeD&T\x99\xba\x8f\xff\xcc\x99\xf1\x89E21\x00\x00\x00\x00\x00\x00\x00\xf1\x82SCK0T33NB0',
b'\xf1\x87VDHLG17034412DK2vD6DfVvVTD$D\x99w\x88\x98EDEDeT6DgfO\xff\xc3=\xf1\x81E21\x00\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 E21\x00\x00\x00\x00\x00\x00\x00SCK0T33NB0\x88\xa2\xe6\xf0',
b'\xf1\x87VDHLG17118862DK2\x8awWwgu\x96wVfUVwv\x97xWvfvUTGTx\x87o\xff\xc9\xed\xf1\x81E21\x00\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 E21\x00\x00\x00\x00\x00\x00\x00SCK0T33NB0\x88\xa2\xe6\xf0',
b'\xf1\x87VDJLG18425192DK2xeGewfgf\x86eFeweWv\x88eVeuTGT\x89vo\xff\tJ\xf1\x81E24\x00\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 E24\x00\x00\x00\x00\x00\x00\x00SCK0T33NB1\x8a\xdcM\x90',
b'\xf1\x87VDKLJ18675252DK6\x89vhgwwwwveVU\x88w\x87w\x99vgf\x97vXfgw_\xff\xc2\xfb\xf1\x89E25\x00\x00\x00\x00\x00\x00\x00\xf1\x82TCK0T33NB2',
b'\xf1\x87WAJTE17552812CH4vfFffvfVeT5DwvvVVdFeegeg\x88\x88o\xff\x1a]\xf1\x81E21\x00\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 E21\x00\x00\x00\x00\x00\x00\x00TCK2T20NB1\x19\xd2\x00\x94',
],
},
CAR.NIRO_EV: {
(Ecu.fwdRadar, 0x7D0, None): [
b'\xf1\x00DEev SCC F-CUP 1.00 1.00 99110-Q4000 ',
b'\xf1\x00DEev SCC F-CUP 1.00 1.02 96400-Q4100 ',
b'\xf1\x00DEev SCC F-CUP 1.00 1.03 96400-Q4100 ',
b'\xf1\x00OSev SCC F-CUP 1.00 1.01 99110-K4000 ',
b'\xf1\x8799110Q4000\xf1\x00DEev SCC F-CUP 1.00 1.00 99110-Q4000 ',
b'\xf1\x8799110Q4100\xf1\x00DEev SCC F-CUP 1.00 1.00 99110-Q4100 ',
b'\xf1\x8799110Q4500\xf1\x00DEev SCC F-CUP 1.00 1.00 99110-Q4500 ',
b'\xf1\x8799110Q4600\xf1\x00DEev SCC FNCUP 1.00 1.00 99110-Q4600 ',
b'\xf1\x8799110Q4600\xf1\x00DEev SCC FHCUP 1.00 1.00 99110-Q4600 ',
],
(Ecu.fwdCamera, 0x7C4, None): [
b'\xf1\x00DEE MFC AT USA LHD 1.00 1.03 95740-Q4000 180821',
b'\xf1\x00DEE MFC AT EUR LHD 1.00 1.00 99211-Q4000 191211',
b'\xf1\x00DEE MFC AT USA LHD 1.00 1.00 99211-Q4000 191211',
b'\xf1\000DEE MFC AT EUR LHD 1.00 1.00 99211-Q4100 200706',
b'\xf1\x00OSE LKAS AT EUR LHD 1.00 1.00 95740-K4100 W40',
],
(Ecu.eps, 0x7D4, None): [
b'\xf1\x00OS MDPS C 1.00 1.04 56310K4050\x00 4OEDC104',
b'\xf1\x00DE MDPS C 1.00 1.05 56310Q4000\x00 4DEEC105',
b'\xf1\x00DE MDPS C 1.00 1.05 56310Q4100\x00 4DEEC105',
],
(Ecu.esp, 0x7D1, None): [
b'\xf1\x00OS IEB \r 212 \x11\x13 58520-K4000',
],
},
CAR.NIRO_HEV: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00DEhe SCC H-CUP 1.01 1.02 96400-G5100 ',
b'\xf1\x00DEhe SCC FHCUP 1.00 1.00 99110-G5600 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00DEP MFC AT USA LHD 1.00 1.01 95740-G5010 170424',
b'\xf1\x00DEH MFC AT USA LHD 1.00 1.07 99211-G5000 201221',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\000DE MDPS C 1.00 1.09 56310G5301\000 4DEHC109',
b'\xf1\x00DE MDPS C 1.00 1.01 56310G5520\x00 4DEPC101',
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x816H6F4051\000\000\000\000\000\000\000\000',
b'\xf1\x816H6G5051\x00\x00\x00\x00\x00\x00\x00\x00',
],
(Ecu.transmission, 0x7e1, None): [
b"\xf1\x816U3J2051\000\000\xf1\0006U3H0_C2\000\0006U3J2051\000\000PDE0G16NS2\xf4\'\\\x91",
b'\xf1\x816U3J2051\000\000\xf1\0006U3H0_C2\000\0006U3J2051\000\000PDE0G16NS2\000\000\000\000',
b'\xf1\x816U3J9051\x00\x00\xf1\x006U3H1_C2\x00\x006U3J9051\x00\x00HDE0G16NL3\x00\x00\x00\x00',
b'\xf1\x816U3J9051\x00\x00\xf1\x006U3H1_C2\x00\x006U3J9051\x00\x00HDE0G16NL3\xb9\xd3\xfaW',
],
},
CAR.SELTOS: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x8799110Q5100\xf1\000SP2_ SCC FHCUP 1.01 1.05 99110-Q5100 ',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\000SP2 MFC AT USA LHD 1.00 1.04 99210-Q5000 191114',
b'\xf1\000SP2 MFC AT USA LHD 1.00 1.05 99210-Q5000 201012',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\000SP2 MDPS C 1.00 1.04 56300Q5200 ',
b'\xf1\000SP2 MDPS C 1.01 1.05 56300Q5200 ',
],
(Ecu.esp, 0x7d1, None): [
b'\xf1\x8758910-Q5450\xf1\000SP ESC \a 101\031\t\005 58910-Q5450',
b'\xf1\x8758910-Q5450\xf1\000SP ESC \t 101\031\t\005 58910-Q5450',
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x81616D2051\000\000\000\000\000\000\000\000',
b'\xf1\x81616D5051\000\000\000\000\000\000\000\000',
b'\001TSP2KNL06F100J0K',
b'\001TSP2KNL06F200J0K',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x87CZLUB49370612JF7h\xa8y\x87\x99\xa7hv\x99\x97fv\x88\x87x\x89x\x96O\xff\x88\xff\xff\xff.@\xf1\x816V2C2051\000\000\xf1\0006V2B0_C2\000\0006V2C2051\000\000CSP4N20NS3\000\000\000\000',
b'\xf1\x87954A22D200\xf1\x81T01950A1 \xf1\000T0190XBL T01950A1 DSP2T16X4X950NS6\xd30\xa5\xb9',
b'\xf1\x87954A22D200\xf1\x81T01950A1 \xf1\000T0190XBL T01950A1 DSP2T16X4X950NS8\r\xfe\x9c\x8b',
],
},
CAR.K7: {
(Ecu.eps, 0x7d4, None): [b'\xf1\000YG MDPS C 1.00 1.01 56310F6350\000 4YG7C101',],
},
CAR.GENESIS_G70: {
(Ecu.fwdRadar, 0x7d0, None): [
b'\xf1\x00IK__ SCC F-CUP 1.00 1.02 96400-G9100 ',
b'\xf1\x00IK__ SCC F-CUP 1.00 1.02 96400-G9100 \xf1\xa01.02',
],
(Ecu.fwdCamera, 0x7c4, None): [
b'\xf1\x00IK MFC AT USA LHD 1.00 1.01 95740-G9000 170920',
],
(Ecu.eps, 0x7d4, None): [
b'\xf1\x00IK MDPS R 1.00 1.06 57700-G9420 4I4VL106',
b'\xf1\x00IK MDPS R 1.00 1.07 57700-G9220 4I2VL107',
],
(Ecu.esp, 0x7d1, None): [
b'\xf1\x00\x00\x00\x00\x00\x00\x00',
],
(Ecu.engine, 0x7e0, None): [
b'\xf1\x81640F0051\x00\x00\x00\x00\x00\x00\x00\x00',
b'\xf1\x81640J0051\x00\x00\x00\x00\x00\x00\x00\x00',
],
(Ecu.transmission, 0x7e1, None): [
b'\xf1\x87VDJLT17895112DN4\x88fVf\x99\x88\x88\x88\x87fVe\x88vhwwUFU\x97eFex\x99\xff\xb7\x82\xf1\x81E25\x00\x00\x00\x00\x00\x00\x00\xf1\x00bcsh8p54 E25\x00\x00\x00\x00\x00\x00\x00SIK0T33NB2\x11\x1am\xda',
b'\xf1\x87VCJLP18407832DN3\x88vXfvUVT\x97eFU\x87d7v\x88eVeveFU\x89\x98\x7f\xff\xb2\xb0\xf1\x81E25\x00\x00\x00'
b'\x00\x00\x00\x00\xf1\x00bcsh8p54 E25\x00\x00\x00\x00\x00\x00\x00SIK0T33NB4\xecE\xefL',
],
},
}
CHECKSUM = {
"crc8": [CAR.SONATA, CAR.SANTA_FE, CAR.PALISADE, CAR.SELTOS, CAR.ELANTRA21, CAR.K5_DL3,
CAR.SONATA_HEV, CAR.SANTA_FE_HEV, CAR.SOUL_EV, CAR.ELANTRA21_HEV, CAR.K5_DL3_HEV],
"6B": [CAR.SORENTO, CAR.GENESIS],
}
FEATURES = {
"use_cluster_gears":
{CAR.ELANTRA_I30, CAR.KONA, CAR.GRANDEUR, CAR.MOHAVE, CAR.NIRO_HEV, CAR.K7},
"use_tcu_gears":
{CAR.SONATA_LF, CAR.VELOSTER, CAR.K5},
"use_elect_gears":
{CAR.KONA_EV, CAR.IONIQ_EV, CAR.NEXO, CAR.NIRO_EV, CAR.SOUL_EV, CAR.KONA_HEV, CAR.IONIQ_HEV, CAR.NIRO_HEV,
CAR.SONATA_HEV, CAR.SONATA_LF_HEV, CAR.GRANDEUR_HEV, CAR.GRANDEUR20_HEV,
CAR.K5_HEV, CAR.K5_DL3_HEV, CAR.K7_HEV},
}
EV_CAR = {CAR.KONA_EV, CAR.IONIQ_EV, CAR.NIRO_EV, CAR.SOUL_EV, CAR.NEXO}
HYBRID_CAR = {CAR.KONA_HEV, CAR.IONIQ_HEV, CAR.NIRO_HEV, CAR.SANTA_FE_HEV,
CAR.ELANTRA21_HEV, CAR.SONATA_HEV, CAR.SONATA_LF_HEV, CAR.GRANDEUR_HEV, CAR.GRANDEUR20_HEV,
CAR.K5_HEV, CAR.K5_DL3_HEV, CAR.K7_HEV}
EV_HYBRID_CAR = EV_CAR | HYBRID_CAR
DBC = {
CAR.ELANTRA_I30: dbc_dict('hyundai_kia_generic', None),
CAR.ELANTRA21: dbc_dict('hyundai_kia_generic', None),
CAR.ELANTRA21_HEV: dbc_dict('hyundai_kia_generic', None),
CAR.SONATA: dbc_dict('hyundai_kia_generic', 'hyundai_kia_mando_front_radar'),
CAR.SONATA_HEV: dbc_dict('hyundai_kia_generic', 'hyundai_kia_mando_front_radar'),
CAR.SONATA_LF: dbc_dict('hyundai_kia_generic', None),
CAR.SONATA_LF_HEV: dbc_dict('hyundai_kia_generic', None),
CAR.KONA: dbc_dict('hyundai_kia_generic', None),
CAR.KONA_EV: dbc_dict('hyundai_kia_generic', None),
CAR.KONA_HEV: dbc_dict('hyundai_kia_generic', None),
CAR.IONIQ_EV: dbc_dict('hyundai_kia_generic', 'hyundai_kia_mando_front_radar'),
CAR.IONIQ_HEV: dbc_dict('hyundai_kia_generic', None),
CAR.SANTA_FE: dbc_dict('hyundai_kia_generic', 'hyundai_kia_mando_front_radar'),
CAR.SANTA_FE_HEV: dbc_dict('hyundai_kia_generic', None),
CAR.PALISADE: dbc_dict('hyundai_kia_generic', 'hyundai_kia_mando_front_radar'),
CAR.VELOSTER: dbc_dict('hyundai_kia_generic', None),
CAR.GRANDEUR: dbc_dict('hyundai_kia_generic', None),
CAR.GRANDEUR_HEV: dbc_dict('hyundai_kia_generic', None),
CAR.GRANDEUR20: dbc_dict('hyundai_kia_generic', None),
CAR.GRANDEUR20_HEV: dbc_dict('hyundai_kia_generic', None),
CAR.NEXO: dbc_dict('hyundai_kia_generic_nexo', None),
CAR.FORTE: dbc_dict('hyundai_kia_generic', None),
CAR.K5: dbc_dict('hyundai_kia_generic', None),
CAR.K5_HEV: dbc_dict('hyundai_kia_generic', None),
CAR.K5_DL3: dbc_dict('hyundai_kia_generic', None),
CAR.K5_DL3_HEV: dbc_dict('hyundai_kia_generic', None),
CAR.SPORTAGE: dbc_dict('hyundai_kia_generic', None),
CAR.SORENTO: dbc_dict('hyundai_kia_generic', None),
CAR.MOHAVE: dbc_dict('hyundai_kia_generic', None),
CAR.STINGER: dbc_dict('hyundai_kia_generic', None),
CAR.NIRO_EV: dbc_dict('hyundai_kia_generic', 'hyundai_kia_mando_front_radar'),
CAR.NIRO_HEV: dbc_dict('hyundai_kia_generic', 'hyundai_kia_mando_front_radar'),
CAR.SOUL_EV: dbc_dict('hyundai_kia_generic', None),
CAR.SELTOS: dbc_dict('hyundai_kia_generic', None),
CAR.K7: dbc_dict('hyundai_kia_generic', None),
CAR.K7_HEV: dbc_dict('hyundai_kia_generic', None),
CAR.K9: dbc_dict('hyundai_kia_generic', None),
CAR.GENESIS: dbc_dict('hyundai_kia_generic', None),
CAR.GENESIS_G70: dbc_dict('hyundai_kia_generic', 'hyundai_kia_mando_front_radar'),
CAR.GENESIS_G80: dbc_dict('hyundai_kia_generic', None),
CAR.GENESIS_G90: dbc_dict('hyundai_kia_generic', None),
}
STEER_THRESHOLD = 150
def main():
for member, value in vars(CAR).items():
if not member.startswith("_"):
print(value)
if __name__ == "__main__":
main()
| true | true |
f702b3137c31de742296618ee6e83a233c38cd21 | 7,384 | py | Python | src/primaires/communication/editeurs/messagerie/edt_envoi.py | stormi/tsunami | bdc853229834b52b2ee8ed54a3161a1a3133d926 | [
"BSD-3-Clause"
] | null | null | null | src/primaires/communication/editeurs/messagerie/edt_envoi.py | stormi/tsunami | bdc853229834b52b2ee8ed54a3161a1a3133d926 | [
"BSD-3-Clause"
] | null | null | null | src/primaires/communication/editeurs/messagerie/edt_envoi.py | stormi/tsunami | bdc853229834b52b2ee8ed54a3161a1a3133d926 | [
"BSD-3-Clause"
] | null | null | null | # -*-coding:Utf-8 -*
# Copyright (c) 2010 LE GOFF Vincent
# All rights reserved.
#
# Redistribution and use in source and binary forms, with or without
# modification, are permitted provided that the following conditions are met:
#
# * Redistributions of source code must retain the above copyright notice, this
# list of conditions and the following disclaimer.
# * Redistributions in binary form must reproduce the above copyright notice,
# this list of conditions and the following disclaimer in the documentation
# and/or other materials provided with the distribution.
# * Neither the name of the copyright holder nor the names of its contributors
# may be used to endorse or promote products derived from this software
# without specific prior written permission.
#
# THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS"
# AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
# IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
# ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE
# LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR
# CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT
# OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
# INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN
# CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
# POSSIBILITY OF SUCH DAMAGE.
"""Fichier contenant le contexte éditeur EdtBoiteEnvoi"""
from primaires.interpreteur.editeur import Editeur
from primaires.interpreteur.editeur.env_objet import EnveloppeObjet
from primaires.communication.editeurs.medit import EdtMedit
from primaires.communication.mudmail import ENVOYE
from primaires.format.fonctions import couper_phrase
class EdtBoiteEnvoi(Editeur):
"""Classe définissant le contexte-éditeur 'boîte d'envoi'.
Ce contexte liste les messages envoyés et propose des options d'édition.
"""
def __init__(self, pere, objet=None, attribut=None):
"""Constructeur de l'éditeur"""
Editeur.__init__(self, pere, objet, attribut)
self.ajouter_option("l", self.opt_lire)
self.ajouter_option("c", self.opt_copier)
self.ajouter_option("s", self.opt_supprimer)
def accueil(self):
"""Méthode d'accueil"""
joueur = self.pere.joueur
mails = type(self).importeur.communication.mails.get_mails_pour(
joueur, ENVOYE)
msg = "||tit| " + "Messages envoyés".ljust(76) + "|ff||\n"
msg += self.opts.separateur + "\n"
msg += self.aide_courte + "\n\n"
if not mails:
msg += "|att|Vous n'avez envoyé aucun message.|ff|"
else:
taille = 0
for mail in mails:
t_sujet = len(couper_phrase(mail.sujet, 33))
if t_sujet > taille:
taille = t_sujet
taille = (taille < 5 and 5) or taille
msg += "+" + "-".ljust(taille + 41, "-") + "+\n"
msg += "| |tit|N°|ff| | |tit|" + "Sujet".ljust(taille)
msg += "|ff| | |tit|Destinataire|ff| | |tit|" + "Date".ljust(16)
msg += "|ff| |\n"
i = 1
for mail in mails:
msg += "| |rg|" + str(i).rjust(2) + "|ff| | "
msg += "|vr|" + couper_phrase(mail.sujet, 33).ljust( \
taille) + "|ff| | |blc|"
msg += couper_phrase(mail.aff_dest,12).ljust(12) + "|ff| | "
msg += "|jn|" + mail.date.isoformat(" ")[:16] + "|ff| |\n"
i += 1
msg += "+" + "-".ljust(taille + 41, "-") + "+"
return msg
def opt_lire(self, arguments):
"""Option lire"""
if not arguments or arguments.isspace():
self.pere.joueur << "|err|Vous devez préciser le numéro d'un " \
"message.|ff|"
return
mails = type(self).importeur.communication.mails.get_mails_pour(
self.pere.joueur, ENVOYE)
try:
num = int(arguments.split(" ")[0])
except ValueError:
self.pere.joueur << "|err|Vous devez spécifier un nombre entier " \
"valide.|ff|"
else:
i = 1
l_mail = None
for mail in mails:
if num == i:
l_mail = mail
break
i += 1
if l_mail is None:
self.pere.joueur << "|err|Le numéro spécifié ne correspond à " \
"aucun message.|ff|"
return
self.pere.joueur << l_mail.afficher()
def opt_copier(self, arguments):
"""Option copier"""
if not arguments or arguments.isspace():
self.pere.joueur << "|err|Vous devez préciser le numéro d'un " \
"message.|ff|"
return
mails = type(self).importeur.communication.mails.get_mails_pour(
self.pere.joueur, ENVOYE)
try:
num = int(arguments.split(" ")[0])
except ValueError:
self.pere.joueur << "|err|Vous devez spécifier un nombre entier " \
"valide.|ff|"
else:
i = 1
c_mail = None
for mail in mails:
if num == i:
c_mail = mail
break
i += 1
if c_mail is None:
self.pere.joueur << "|err|Le numéro spécifié ne correspond à " \
"aucun message.|ff|"
return
mail = type(self).importeur.communication.mails.creer_mail(
self.pere.joueur)
mail.sujet = "CC:" + c_mail.sujet
mail.liste_dest = c_mail.liste_dest
mail.contenu.ajouter_paragraphe(str(c_mail.contenu))
enveloppe = EnveloppeObjet(EdtMedit, mail, None)
enveloppe.parent = self
contexte = enveloppe.construire(self.pere.joueur)
self.pere.joueur.contextes.ajouter(contexte)
contexte.actualiser()
def opt_supprimer(self, arguments):
"""Option supprimer"""
if not arguments or arguments.isspace():
self.pere.joueur << "|err|Vous devez préciser le numéro d'un " \
"message.|ff|"
return
mails = type(self).importeur.communication.mails.get_mails_pour(
self.pere.joueur, ENVOYE)
try:
num = int(arguments.split(" ")[0])
except ValueError:
self.pere.joueur << "|err|Vous devez spécifier un nombre entier " \
"valide.|ff|"
else:
i = 1
s_mail = None
for mail in mails:
if num == i:
s_mail = mail
break
i += 1
if s_mail is None:
self.pere.joueur << "|err|Le numéro spécifié ne correspond à " \
"aucun message.|ff|"
return
del type(self).importeur.communication.mails[s_mail.id]
self.pere.joueur << "|att|Ce message a bien été supprimé.|ff|"
| 41.717514 | 80 | 0.566766 |
from primaires.interpreteur.editeur import Editeur
from primaires.interpreteur.editeur.env_objet import EnveloppeObjet
from primaires.communication.editeurs.medit import EdtMedit
from primaires.communication.mudmail import ENVOYE
from primaires.format.fonctions import couper_phrase
class EdtBoiteEnvoi(Editeur):
def __init__(self, pere, objet=None, attribut=None):
Editeur.__init__(self, pere, objet, attribut)
self.ajouter_option("l", self.opt_lire)
self.ajouter_option("c", self.opt_copier)
self.ajouter_option("s", self.opt_supprimer)
def accueil(self):
joueur = self.pere.joueur
mails = type(self).importeur.communication.mails.get_mails_pour(
joueur, ENVOYE)
msg = "||tit| " + "Messages envoyés".ljust(76) + "|ff||\n"
msg += self.opts.separateur + "\n"
msg += self.aide_courte + "\n\n"
if not mails:
msg += "|att|Vous n'avez envoyé aucun message.|ff|"
else:
taille = 0
for mail in mails:
t_sujet = len(couper_phrase(mail.sujet, 33))
if t_sujet > taille:
taille = t_sujet
taille = (taille < 5 and 5) or taille
msg += "+" + "-".ljust(taille + 41, "-") + "+\n"
msg += "| |tit|N°|ff| | |tit|" + "Sujet".ljust(taille)
msg += "|ff| | |tit|Destinataire|ff| | |tit|" + "Date".ljust(16)
msg += "|ff| |\n"
i = 1
for mail in mails:
msg += "| |rg|" + str(i).rjust(2) + "|ff| | "
msg += "|vr|" + couper_phrase(mail.sujet, 33).ljust( \
taille) + "|ff| | |blc|"
msg += couper_phrase(mail.aff_dest,12).ljust(12) + "|ff| | "
msg += "|jn|" + mail.date.isoformat(" ")[:16] + "|ff| |\n"
i += 1
msg += "+" + "-".ljust(taille + 41, "-") + "+"
return msg
def opt_lire(self, arguments):
if not arguments or arguments.isspace():
self.pere.joueur << "|err|Vous devez préciser le numéro d'un " \
"message.|ff|"
return
mails = type(self).importeur.communication.mails.get_mails_pour(
self.pere.joueur, ENVOYE)
try:
num = int(arguments.split(" ")[0])
except ValueError:
self.pere.joueur << "|err|Vous devez spécifier un nombre entier " \
"valide.|ff|"
else:
i = 1
l_mail = None
for mail in mails:
if num == i:
l_mail = mail
break
i += 1
if l_mail is None:
self.pere.joueur << "|err|Le numéro spécifié ne correspond à " \
"aucun message.|ff|"
return
self.pere.joueur << l_mail.afficher()
def opt_copier(self, arguments):
if not arguments or arguments.isspace():
self.pere.joueur << "|err|Vous devez préciser le numéro d'un " \
"message.|ff|"
return
mails = type(self).importeur.communication.mails.get_mails_pour(
self.pere.joueur, ENVOYE)
try:
num = int(arguments.split(" ")[0])
except ValueError:
self.pere.joueur << "|err|Vous devez spécifier un nombre entier " \
"valide.|ff|"
else:
i = 1
c_mail = None
for mail in mails:
if num == i:
c_mail = mail
break
i += 1
if c_mail is None:
self.pere.joueur << "|err|Le numéro spécifié ne correspond à " \
"aucun message.|ff|"
return
mail = type(self).importeur.communication.mails.creer_mail(
self.pere.joueur)
mail.sujet = "CC:" + c_mail.sujet
mail.liste_dest = c_mail.liste_dest
mail.contenu.ajouter_paragraphe(str(c_mail.contenu))
enveloppe = EnveloppeObjet(EdtMedit, mail, None)
enveloppe.parent = self
contexte = enveloppe.construire(self.pere.joueur)
self.pere.joueur.contextes.ajouter(contexte)
contexte.actualiser()
def opt_supprimer(self, arguments):
if not arguments or arguments.isspace():
self.pere.joueur << "|err|Vous devez préciser le numéro d'un " \
"message.|ff|"
return
mails = type(self).importeur.communication.mails.get_mails_pour(
self.pere.joueur, ENVOYE)
try:
num = int(arguments.split(" ")[0])
except ValueError:
self.pere.joueur << "|err|Vous devez spécifier un nombre entier " \
"valide.|ff|"
else:
i = 1
s_mail = None
for mail in mails:
if num == i:
s_mail = mail
break
i += 1
if s_mail is None:
self.pere.joueur << "|err|Le numéro spécifié ne correspond à " \
"aucun message.|ff|"
return
del type(self).importeur.communication.mails[s_mail.id]
self.pere.joueur << "|att|Ce message a bien été supprimé.|ff|"
| true | true |
f702b3e836707390409c7ac1aa8b29e284bbca51 | 8,633 | py | Python | pyro/infer/trace_elbo.py | cnheider/pyro | 60bcab73ada30c2b3f05d525690c9664ff6fc22e | [
"MIT"
] | null | null | null | pyro/infer/trace_elbo.py | cnheider/pyro | 60bcab73ada30c2b3f05d525690c9664ff6fc22e | [
"MIT"
] | null | null | null | pyro/infer/trace_elbo.py | cnheider/pyro | 60bcab73ada30c2b3f05d525690c9664ff6fc22e | [
"MIT"
] | null | null | null | from __future__ import absolute_import, division, print_function
import numbers
import warnings
import torch
from torch.autograd import Variable
import pyro
import pyro.poutine as poutine
from pyro.distributions.util import is_identically_zero
from pyro.infer.elbo import ELBO
from pyro.infer.enum import iter_discrete_traces
from pyro.infer.util import torch_backward, torch_data_sum, torch_sum
from pyro.poutine.util import prune_subsample_sites
from pyro.util import check_model_guide_match, is_nan
def check_enum_discrete_can_run(model_trace, guide_trace):
"""
Checks whether `enum_discrete` is supported for the given (model, guide) pair.
:param Trace model: A model trace.
:param Trace guide: A guide trace.
:raises: NotImplementedError
"""
# Check that all batch_log_pdf shapes are the same,
# since we currently do not correctly handle broadcasting.
model_trace.compute_batch_log_pdf()
guide_trace.compute_batch_log_pdf()
shapes = {}
for source, trace in [("model", model_trace), ("guide", guide_trace)]:
for name, site in trace.nodes.items():
if site["type"] == "sample":
shapes[site["batch_log_pdf"].size()] = (source, name)
if len(shapes) > 1:
raise NotImplementedError(
"enum_discrete does not support mixture of batched and un-batched variables. "
"Try rewriting your model to avoid batching or running with enum_discrete=False. "
"Found the following variables of different batch shapes:\n{}".format(
"\n".join(["{} {}: shape = {}".format(source, name, tuple(shape))
for shape, (source, name) in sorted(shapes.items())])))
class Trace_ELBO(ELBO):
"""
A trace implementation of ELBO-based SVI
"""
def _get_traces(self, model, guide, *args, **kwargs):
"""
runs the guide and runs the model against the guide with
the result packaged as a trace generator
"""
for i in range(self.num_particles):
if self.enum_discrete:
# This iterates over a bag of traces, for each particle.
for scale, guide_trace in iter_discrete_traces("flat", guide, *args, **kwargs):
model_trace = poutine.trace(poutine.replay(model, guide_trace),
graph_type="flat").get_trace(*args, **kwargs)
check_model_guide_match(model_trace, guide_trace)
guide_trace = prune_subsample_sites(guide_trace)
model_trace = prune_subsample_sites(model_trace)
check_enum_discrete_can_run(model_trace, guide_trace)
guide_trace.compute_score_parts()
log_r = model_trace.batch_log_pdf() - guide_trace.batch_log_pdf()
weight = scale / self.num_particles
yield weight, model_trace, guide_trace, log_r
continue
guide_trace = poutine.trace(guide).get_trace(*args, **kwargs)
model_trace = poutine.trace(poutine.replay(model, guide_trace)).get_trace(*args, **kwargs)
check_model_guide_match(model_trace, guide_trace)
guide_trace = prune_subsample_sites(guide_trace)
model_trace = prune_subsample_sites(model_trace)
guide_trace.compute_score_parts()
log_r = model_trace.log_pdf() - guide_trace.log_pdf()
weight = 1.0 / self.num_particles
yield weight, model_trace, guide_trace, log_r
def _is_batched(self, weight):
return self.enum_discrete and \
isinstance(weight, Variable) and \
weight.dim() > 0 and \
weight.size(0) > 1
def loss(self, model, guide, *args, **kwargs):
"""
:returns: returns an estimate of the ELBO
:rtype: float
Evaluates the ELBO with an estimator that uses num_particles many samples/particles.
"""
elbo = 0.0
for weight, model_trace, guide_trace, log_r in self._get_traces(model, guide, *args, **kwargs):
elbo_particle = weight * 0
if self._is_batched(weight):
log_pdf = "batch_log_pdf"
else:
log_pdf = "log_pdf"
for name in model_trace.nodes.keys():
if model_trace.nodes[name]["type"] == "sample":
if model_trace.nodes[name]["is_observed"]:
elbo_particle += model_trace.nodes[name][log_pdf]
else:
elbo_particle += model_trace.nodes[name][log_pdf]
elbo_particle -= guide_trace.nodes[name][log_pdf]
# drop terms of weight zero to avoid nans
if isinstance(weight, numbers.Number):
if weight == 0.0:
elbo_particle = torch.zeros_like(elbo_particle)
else:
elbo_particle[weight == 0] = 0.0
elbo += torch_data_sum(weight * elbo_particle)
loss = -elbo
if is_nan(loss):
warnings.warn('Encountered NAN loss')
return loss
def loss_and_grads(self, model, guide, *args, **kwargs):
"""
:returns: returns an estimate of the ELBO
:rtype: float
Computes the ELBO as well as the surrogate ELBO that is used to form the gradient estimator.
Performs backward on the latter. Num_particle many samples are used to form the estimators.
"""
elbo = 0.0
# grab a trace from the generator
for weight, model_trace, guide_trace, log_r in self._get_traces(model, guide, *args, **kwargs):
elbo_particle = weight * 0
surrogate_elbo_particle = weight * 0
batched = self._is_batched(weight)
# compute elbo and surrogate elbo
if batched:
log_pdf = "batch_log_pdf"
else:
log_pdf = "log_pdf"
for name, model_site in model_trace.nodes.items():
if model_site["type"] == "sample":
model_log_pdf = model_site[log_pdf]
if model_site["is_observed"]:
elbo_particle += model_log_pdf
surrogate_elbo_particle += model_log_pdf
else:
guide_site = guide_trace.nodes[name]
guide_log_pdf, score_function_term, entropy_term = guide_site["score_parts"]
if not batched:
guide_log_pdf = guide_log_pdf.sum()
elbo_particle += model_log_pdf - guide_log_pdf
surrogate_elbo_particle += model_log_pdf
if not is_identically_zero(entropy_term):
if not batched:
entropy_term = entropy_term.sum()
surrogate_elbo_particle -= entropy_term
if not is_identically_zero(score_function_term):
if not batched:
score_function_term = score_function_term.sum()
surrogate_elbo_particle += log_r.detach() * score_function_term
# drop terms of weight zero to avoid nans
if isinstance(weight, numbers.Number):
if weight == 0.0:
elbo_particle = torch.zeros_like(elbo_particle)
surrogate_elbo_particle = torch.zeros_like(surrogate_elbo_particle)
else:
weight_eq_zero = (weight == 0)
elbo_particle[weight_eq_zero] = 0.0
surrogate_elbo_particle[weight_eq_zero] = 0.0
elbo += torch_data_sum(weight * elbo_particle)
surrogate_elbo_particle = torch_sum(weight * surrogate_elbo_particle)
# collect parameters to train from model and guide
trainable_params = set(site["value"]
for trace in (model_trace, guide_trace)
for site in trace.nodes.values()
if site["type"] == "param")
if trainable_params:
surrogate_loss_particle = -surrogate_elbo_particle
torch_backward(surrogate_loss_particle)
pyro.get_param_store().mark_params_active(trainable_params)
loss = -elbo
if is_nan(loss):
warnings.warn('Encountered NAN loss')
return loss
| 42.950249 | 103 | 0.586355 | from __future__ import absolute_import, division, print_function
import numbers
import warnings
import torch
from torch.autograd import Variable
import pyro
import pyro.poutine as poutine
from pyro.distributions.util import is_identically_zero
from pyro.infer.elbo import ELBO
from pyro.infer.enum import iter_discrete_traces
from pyro.infer.util import torch_backward, torch_data_sum, torch_sum
from pyro.poutine.util import prune_subsample_sites
from pyro.util import check_model_guide_match, is_nan
def check_enum_discrete_can_run(model_trace, guide_trace):
model_trace.compute_batch_log_pdf()
guide_trace.compute_batch_log_pdf()
shapes = {}
for source, trace in [("model", model_trace), ("guide", guide_trace)]:
for name, site in trace.nodes.items():
if site["type"] == "sample":
shapes[site["batch_log_pdf"].size()] = (source, name)
if len(shapes) > 1:
raise NotImplementedError(
"enum_discrete does not support mixture of batched and un-batched variables. "
"Try rewriting your model to avoid batching or running with enum_discrete=False. "
"Found the following variables of different batch shapes:\n{}".format(
"\n".join(["{} {}: shape = {}".format(source, name, tuple(shape))
for shape, (source, name) in sorted(shapes.items())])))
class Trace_ELBO(ELBO):
def _get_traces(self, model, guide, *args, **kwargs):
for i in range(self.num_particles):
if self.enum_discrete:
for scale, guide_trace in iter_discrete_traces("flat", guide, *args, **kwargs):
model_trace = poutine.trace(poutine.replay(model, guide_trace),
graph_type="flat").get_trace(*args, **kwargs)
check_model_guide_match(model_trace, guide_trace)
guide_trace = prune_subsample_sites(guide_trace)
model_trace = prune_subsample_sites(model_trace)
check_enum_discrete_can_run(model_trace, guide_trace)
guide_trace.compute_score_parts()
log_r = model_trace.batch_log_pdf() - guide_trace.batch_log_pdf()
weight = scale / self.num_particles
yield weight, model_trace, guide_trace, log_r
continue
guide_trace = poutine.trace(guide).get_trace(*args, **kwargs)
model_trace = poutine.trace(poutine.replay(model, guide_trace)).get_trace(*args, **kwargs)
check_model_guide_match(model_trace, guide_trace)
guide_trace = prune_subsample_sites(guide_trace)
model_trace = prune_subsample_sites(model_trace)
guide_trace.compute_score_parts()
log_r = model_trace.log_pdf() - guide_trace.log_pdf()
weight = 1.0 / self.num_particles
yield weight, model_trace, guide_trace, log_r
def _is_batched(self, weight):
return self.enum_discrete and \
isinstance(weight, Variable) and \
weight.dim() > 0 and \
weight.size(0) > 1
def loss(self, model, guide, *args, **kwargs):
elbo = 0.0
for weight, model_trace, guide_trace, log_r in self._get_traces(model, guide, *args, **kwargs):
elbo_particle = weight * 0
if self._is_batched(weight):
log_pdf = "batch_log_pdf"
else:
log_pdf = "log_pdf"
for name in model_trace.nodes.keys():
if model_trace.nodes[name]["type"] == "sample":
if model_trace.nodes[name]["is_observed"]:
elbo_particle += model_trace.nodes[name][log_pdf]
else:
elbo_particle += model_trace.nodes[name][log_pdf]
elbo_particle -= guide_trace.nodes[name][log_pdf]
if isinstance(weight, numbers.Number):
if weight == 0.0:
elbo_particle = torch.zeros_like(elbo_particle)
else:
elbo_particle[weight == 0] = 0.0
elbo += torch_data_sum(weight * elbo_particle)
loss = -elbo
if is_nan(loss):
warnings.warn('Encountered NAN loss')
return loss
def loss_and_grads(self, model, guide, *args, **kwargs):
elbo = 0.0
for weight, model_trace, guide_trace, log_r in self._get_traces(model, guide, *args, **kwargs):
elbo_particle = weight * 0
surrogate_elbo_particle = weight * 0
batched = self._is_batched(weight)
if batched:
log_pdf = "batch_log_pdf"
else:
log_pdf = "log_pdf"
for name, model_site in model_trace.nodes.items():
if model_site["type"] == "sample":
model_log_pdf = model_site[log_pdf]
if model_site["is_observed"]:
elbo_particle += model_log_pdf
surrogate_elbo_particle += model_log_pdf
else:
guide_site = guide_trace.nodes[name]
guide_log_pdf, score_function_term, entropy_term = guide_site["score_parts"]
if not batched:
guide_log_pdf = guide_log_pdf.sum()
elbo_particle += model_log_pdf - guide_log_pdf
surrogate_elbo_particle += model_log_pdf
if not is_identically_zero(entropy_term):
if not batched:
entropy_term = entropy_term.sum()
surrogate_elbo_particle -= entropy_term
if not is_identically_zero(score_function_term):
if not batched:
score_function_term = score_function_term.sum()
surrogate_elbo_particle += log_r.detach() * score_function_term
if isinstance(weight, numbers.Number):
if weight == 0.0:
elbo_particle = torch.zeros_like(elbo_particle)
surrogate_elbo_particle = torch.zeros_like(surrogate_elbo_particle)
else:
weight_eq_zero = (weight == 0)
elbo_particle[weight_eq_zero] = 0.0
surrogate_elbo_particle[weight_eq_zero] = 0.0
elbo += torch_data_sum(weight * elbo_particle)
surrogate_elbo_particle = torch_sum(weight * surrogate_elbo_particle)
trainable_params = set(site["value"]
for trace in (model_trace, guide_trace)
for site in trace.nodes.values()
if site["type"] == "param")
if trainable_params:
surrogate_loss_particle = -surrogate_elbo_particle
torch_backward(surrogate_loss_particle)
pyro.get_param_store().mark_params_active(trainable_params)
loss = -elbo
if is_nan(loss):
warnings.warn('Encountered NAN loss')
return loss
| true | true |
f702b5e51d59cc678d28c85bdace0ba9bb5040f9 | 120 | py | Python | hydromt/workflows/__init__.py | couasnonanais/hydromt | 6ff3bb6e76cea8247be171f1fe781c0cbb7e9c9e | [
"MIT"
] | null | null | null | hydromt/workflows/__init__.py | couasnonanais/hydromt | 6ff3bb6e76cea8247be171f1fe781c0cbb7e9c9e | [
"MIT"
] | null | null | null | hydromt/workflows/__init__.py | couasnonanais/hydromt | 6ff3bb6e76cea8247be171f1fe781c0cbb7e9c9e | [
"MIT"
] | null | null | null | # -*- coding: utf-8 -*-
"""HydroMT workflows"""
from .basin_mask import *
from .forcing import *
from .rivers import *
| 17.142857 | 25 | 0.658333 |
from .basin_mask import *
from .forcing import *
from .rivers import *
| true | true |
f702b5f83d11d2fb519cd57e45d49aaab4d30380 | 1,456 | py | Python | ddtrace/contrib/falcon/__init__.py | SzySteve/dd-trace-py | 90d1d5981c72ea312c21ac04e5be47521d0f0f2e | [
"Apache-2.0",
"BSD-3-Clause"
] | null | null | null | ddtrace/contrib/falcon/__init__.py | SzySteve/dd-trace-py | 90d1d5981c72ea312c21ac04e5be47521d0f0f2e | [
"Apache-2.0",
"BSD-3-Clause"
] | null | null | null | ddtrace/contrib/falcon/__init__.py | SzySteve/dd-trace-py | 90d1d5981c72ea312c21ac04e5be47521d0f0f2e | [
"Apache-2.0",
"BSD-3-Clause"
] | null | null | null | """
To trace the falcon web framework, install the trace middleware::
import falcon
from ddtrace import tracer
from ddtrace.contrib.falcon import TraceMiddleware
mw = TraceMiddleware(tracer, 'my-falcon-app')
falcon.API(middleware=[mw])
You can also use the autopatching functionality::
import falcon
from ddtrace import tracer, patch
patch(falcon=True)
app = falcon.API()
To disable distributed tracing when using autopatching, set the
``DATADOG_FALCON_DISTRIBUTED_TRACING`` environment variable to ``False``.
**Supported span hooks**
The following is a list of available tracer hooks that can be used to intercept
and modify spans created by this integration.
- ``request``
- Called before the response has been finished
- ``def on_falcon_request(span, request, response)``
Example::
import falcon
from ddtrace import config, patch_all
patch_all()
app = falcon.API()
@config.falcon.hooks.on('request')
def on_falcon_request(span, request, response):
span.set_tag('my.custom', 'tag')
:ref:`Headers tracing <http-headers-tracing>` is supported for this integration.
"""
from ...utils.importlib import require_modules
required_modules = ["falcon"]
with require_modules(required_modules) as missing_modules:
if not missing_modules:
from .middleware import TraceMiddleware
from .patch import patch
__all__ = ["TraceMiddleware", "patch"]
| 25.54386 | 80 | 0.723214 | from ...utils.importlib import require_modules
required_modules = ["falcon"]
with require_modules(required_modules) as missing_modules:
if not missing_modules:
from .middleware import TraceMiddleware
from .patch import patch
__all__ = ["TraceMiddleware", "patch"]
| true | true |
f702b664d120e7b3a5ada847d1a9b2e095657822 | 12,217 | py | Python | script/sync.py | gonzalezjo/tcecgui | 30fd82a0b83c7db7335eb3e7b05487d1fad1dbb3 | [
"Apache-2.0"
] | null | null | null | script/sync.py | gonzalezjo/tcecgui | 30fd82a0b83c7db7335eb3e7b05487d1fad1dbb3 | [
"Apache-2.0"
] | null | null | null | script/sync.py | gonzalezjo/tcecgui | 30fd82a0b83c7db7335eb3e7b05487d1fad1dbb3 | [
"Apache-2.0"
] | null | null | null | # coding: utf-8
# @author octopoulo <polluxyz@gmail.com>
# @version 2020-05-01
"""
Sync
"""
import gzip
from logging import getLogger
import os
import re
import shutil
from subprocess import run
from time import time
from typing import Any
from PIL import Image, ImageFile
from common import makedirs_safe, read_text_safe, write_text_safe
from css_minify import css_minify
# folders, might want to edit these
BASE = os.path.dirname(os.path.dirname(__file__))
COMPILER = os.path.join(BASE, 'script/closure-compiler-v20200406.jar')
CSS_FOLDER = os.path.join(BASE, 'css')
JAVA = 'java'
JS_FOLDER = os.path.join(BASE, 'js')
LOCAL = BASE
# edit these files
CSS_FILES = [
'light',
]
JS_FILES = {
'4d': [
'libs/three',
'libs/stats',
'libs/GLTFLoader',
'libs/DRACOLoader',
'libs/camera-controls',
],
'all': [
'libs/socket.io',
':common',
'libs/chess-quick',
':engine',
':global',
':3d',
':xboard',
':graph',
':game',
':temp',
':network',
':startup',
':config',
'script',
],
'chart': [
'libs/chart-quick',
],
}
NEED_GZIPS = {
'4d_.js',
'ammo.wasm.js',
'ammo.wasm.wasm',
'chart_.js',
'chart.min.js',
'dark.css',
'dark-archive.css',
'draco_decoder.js',
'draco_decoder.wasm',
'draco_wasm_wrapper.js',
'fra.json',
'index.html',
'jpn.json',
'light-archive.css',
'manifest.json',
'pieces-draco.glb',
'rus.json',
'sea.css',
'sea-archive.css',
'ukr.json',
}
# don't gzip inside those folders
SKIP_GZIPS = {
'archive',
'doc',
'image',
'model',
'node_modules',
'script',
'sound',
'test',
'theme',
}
class Sync:
"""Sync
"""
#
def __init__(self, **kwargs):
self.kwargs = kwargs
self.clean = kwargs.get('clean') # type: bool
self.host = kwargs.get('host') # type: str
self.no_compress = kwargs.get('no_compress') # type: bool
self.no_debug = kwargs.get('no_debug') # type: bool
self.no_process = kwargs.get('no_process') # type: bool
self.zip = kwargs.get('zip') # type: bool
self.logger = getLogger(self.__class__.__name__)
def combine_pieces(self, folder: str):
"""Combine chess pieces png files into 1 file
"""
if 'metro' in folder:
height = 160
width = 160
else:
height = 80
width = 80
combined = Image.new('RGBA', (width * 12, height), (0, 255, 0, 0))
output = f'{folder}.png'
i = 0
pieces = 'bknpqr'
for color in 'bw':
for piece in pieces:
name = f'{color}{piece}'
image = Image.open(os.path.join(folder, f'{name}.png'))
offset = (i * width, 0)
combined.paste(image, offset)
i += 1
combined.save(output, format='png')
print('a', end='')
def combine_themes(self, folder: str):
"""Combine all pieces of each theme
"""
sources = os.listdir(folder)
for source in sources:
filename = os.path.join(folder, source)
if os.path.isdir(filename):
self.combine_pieces(filename)
def compress_3d(self, data: str) -> str:
"""Compress THREE javascript
"""
data = re.sub(r'\bTHREE\b', 'T', data)
data = re.sub(r'console\.(error|warn)\(.+?\);', '', data, flags=re.S)
return data
def compress_gzip(self, filename: str):
"""Gzip compress a file
"""
output = f'{filename}.gz'
with open(filename, 'rb') as f_in:
with gzip.open(output, 'wb') as f_out:
shutil.copyfileobj(f_in, f_out)
# synchronise the date/time
if os.path.isfile(output):
info = os.stat(output)
os.utime(filename, (info.st_atime, info.st_mtime))
print('g', end='')
def compress_js(self, filename: str) -> str:
"""Compress javascript
"""
base, ext = os.path.splitext(filename)
output = f'{base}_{ext}'
if self.no_compress:
shutil.copy(filename, output)
return output
args = [
JAVA,
'-jar', COMPILER,
'--js', filename,
'--js_output_file', output,
'--language_in', 'ECMASCRIPT_2018',
'--language_out', 'ECMASCRIPT_2018',
]
if self.kwargs.get('advanced'):
args.extend(['--compilation_level', 'ADVANCED'])
run(args)
return output
def gzip_files(self, folder: str, depth: int, delete: bool):
"""Gzip all wanted files, recursively
"""
queues = []
sources = os.listdir(folder)
for source in sources:
if source.startswith(('.', '_')):
continue
filename = os.path.join(folder, source)
if os.path.isdir(filename):
if source not in SKIP_GZIPS:
queues.append(filename)
continue
# file
if not os.path.isfile(filename):
continue
if source not in NEED_GZIPS:
continue
output = f'{filename}.gz'
source_time = os.path.getmtime(filename)
if os.path.isfile(output):
destin_time = os.path.getmtime(output)
if delete:
os.unlink(output)
print('d', end='')
else:
destin_time = 0
if not delete and source_time != destin_time:
self.compress_gzip(filename)
print(f"{' ' * depth}{filename}")
for queue in queues:
self.gzip_files(queue, depth + 1, delete)
@staticmethod
def import_file(match: Any) -> str:
"""@import {common.js}
"""
source = match.group(1)
filename = os.path.join(JS_FOLDER, source)
data = read_text_safe(filename) or ''
if source.endswith('.js'):
data = re.sub(r'["\']use strict["\'];?', '', data)
return data
def normalise_folders(self):
"""Add the missing / (slash) at the end of the folder
"""
global CSS_FOLDER, JS_FOLDER, LOCAL
if CSS_FOLDER[-1] != '/':
CSS_FOLDER += '/'
if JS_FOLDER[-1] != '/':
JS_FOLDER += '/'
if LOCAL[-1] != '/':
LOCAL += '/'
def create_index(self):
"""Create the new index.html
"""
base = os.path.join(LOCAL, 'index_base.html')
base_time = os.path.getmtime(base)
index = os.path.join(LOCAL, 'index.html')
index_time = os.path.getmtime(index) if os.path.isfile(index) else 0
change = 0
if base_time >= index_time:
change += 1
# 1) minimise JS
for js_output, js_files in JS_FILES.items():
all_js = os.path.join(JS_FOLDER, f'{js_output}.js')
all_min_js = os.path.join(JS_FOLDER, f'{js_output}_.js')
# common/engine changed => need to update, even though we're not using those files
js_dates = [os.path.abspath(f"{JS_FOLDER}{js_file.strip(':')}.js") for js_file in js_files]
js_names = [os.path.abspath(f'{JS_FOLDER}{js_file}.js') for js_file in js_files if js_file[0] != ':']
if js_output == 'all':
# script_js = os.path.join(JS_FOLDER, 'script.js')
extras = []
else:
extras = []
# skip?
update = True
if os.path.isfile(all_min_js) and os.path.isfile(all_js):
all_time = os.path.getmtime(all_min_js)
update = False
for js_date in js_dates + extras:
update |= os.path.isfile(js_date) and os.path.getmtime(js_date) >= all_time
if not update:
print('J', end='')
continue
datas = []
for js_name in js_names:
print(js_name)
script_data = read_text_safe(js_name)
if not script_data:
continue
# process the script.js
if js_name.endswith('script.js'):
script_data = re.sub('@import {(.*?)}', self.import_file, script_data);
script_data = re.sub('// BEGIN.*?// END', '', script_data, flags=re.S)
if self.no_debug:
script_data = re.sub('// <<.*?// >>', '', script_data, flags=re.S)
# use HOST
print(f'host={self.host}')
if self.host != '/':
script_data = script_data.replace("HOST = '/',", f"HOST = '{self.host}',")
datas.append(script_data)
data = '\n'.join(datas)
if '4d' in js_output:
data = self.compress_3d(data)
write_text_safe(all_js, data)
self.compress_js(all_js)
print('j', end='')
change += 1
# 2) minimise CSS
all_css = os.path.join(CSS_FOLDER, 'all.css')
all_min_css = os.path.join(CSS_FOLDER, 'all_.css')
css_names = [os.path.abspath(f'{CSS_FOLDER}{css_file}.css') for css_file in CSS_FILES]
update = True
if os.path.isfile(all_min_css) and os.path.isfile(all_css):
all_time = os.path.getmtime(all_min_css)
update = False
for css_name in css_names:
update |= os.path.isfile(css_name) and os.path.getmtime(css_name) >= all_time
if update:
datas = []
for css_name in css_names:
datas.append(read_text_safe(css_name) or '')
data = '\n'.join(datas)
write_text_safe(all_css, data)
css_data = css_minify(data)
write_text_safe(all_min_css, css_data)
print('c', end='')
change += 1
else:
css_data = read_text_safe(all_min_css) or ''
print('C', end='')
if not change:
print('X', end='')
return
# 3) remove BEGIN ... END
html = read_text_safe(base)
html = re.sub('<!-- BEGIN -->.*?<!-- END -->', '', html, flags=re.S)
html = re.sub('// BEGIN.*?// END', '', html, flags=re.S)
# use the HOST
if self.host != '/':
replaces = {
'href="/': f'href="{self.host}',
'src="/': f'src="{self.host}',
}
for key, value in replaces.items():
html = html.replace(key, value)
# 4) create the new index.html
if not self.no_process:
all_min_js = os.path.join(JS_FOLDER, 'all_.js')
js_data = read_text_safe(all_min_js) or ''
replaces = {
'<!-- {SCRIPT} -->': f'<script>{js_data}</script>',
'<!-- {STYLE} -->': f'<style>{css_data}</style>',
}
for key, value in replaces.items():
html = html.replace(key, value)
html = re.sub('<!-- .*? -->', '', html, flags=re.S)
html = re.sub(r'\n\s+', '\n', html)
filename = os.path.join(LOCAL, 'index.html')
write_text_safe(filename, html)
def synchronise(self) -> bool:
"""Synchronise the files
"""
self.normalise_folders()
self.create_index()
if self.clean:
self.gzip_files(LOCAL, 0, True)
elif self.zip:
self.gzip_files(LOCAL, 0, False)
return True
if __name__ == '__main__':
start = time()
sync = Sync()
if 0:
sync.combine_themes(os.path.join(BASE, 'theme'))
else:
sync.synchronise()
end = time()
print(f'\nELAPSED: {end-start:.3f} seconds')
| 29.438554 | 113 | 0.503397 |
import gzip
from logging import getLogger
import os
import re
import shutil
from subprocess import run
from time import time
from typing import Any
from PIL import Image, ImageFile
from common import makedirs_safe, read_text_safe, write_text_safe
from css_minify import css_minify
BASE = os.path.dirname(os.path.dirname(__file__))
COMPILER = os.path.join(BASE, 'script/closure-compiler-v20200406.jar')
CSS_FOLDER = os.path.join(BASE, 'css')
JAVA = 'java'
JS_FOLDER = os.path.join(BASE, 'js')
LOCAL = BASE
CSS_FILES = [
'light',
]
JS_FILES = {
'4d': [
'libs/three',
'libs/stats',
'libs/GLTFLoader',
'libs/DRACOLoader',
'libs/camera-controls',
],
'all': [
'libs/socket.io',
':common',
'libs/chess-quick',
':engine',
':global',
':3d',
':xboard',
':graph',
':game',
':temp',
':network',
':startup',
':config',
'script',
],
'chart': [
'libs/chart-quick',
],
}
NEED_GZIPS = {
'4d_.js',
'ammo.wasm.js',
'ammo.wasm.wasm',
'chart_.js',
'chart.min.js',
'dark.css',
'dark-archive.css',
'draco_decoder.js',
'draco_decoder.wasm',
'draco_wasm_wrapper.js',
'fra.json',
'index.html',
'jpn.json',
'light-archive.css',
'manifest.json',
'pieces-draco.glb',
'rus.json',
'sea.css',
'sea-archive.css',
'ukr.json',
}
SKIP_GZIPS = {
'archive',
'doc',
'image',
'model',
'node_modules',
'script',
'sound',
'test',
'theme',
}
class Sync:
#
def __init__(self, **kwargs):
self.kwargs = kwargs
self.clean = kwargs.get('clean') # type: bool
self.host = kwargs.get('host') # type: str
self.no_compress = kwargs.get('no_compress') # type: bool
self.no_debug = kwargs.get('no_debug') # type: bool
self.no_process = kwargs.get('no_process') # type: bool
self.zip = kwargs.get('zip') # type: bool
self.logger = getLogger(self.__class__.__name__)
def combine_pieces(self, folder: str):
if 'metro' in folder:
height = 160
width = 160
else:
height = 80
width = 80
combined = Image.new('RGBA', (width * 12, height), (0, 255, 0, 0))
output = f'{folder}.png'
i = 0
pieces = 'bknpqr'
for color in 'bw':
for piece in pieces:
name = f'{color}{piece}'
image = Image.open(os.path.join(folder, f'{name}.png'))
offset = (i * width, 0)
combined.paste(image, offset)
i += 1
combined.save(output, format='png')
print('a', end='')
def combine_themes(self, folder: str):
sources = os.listdir(folder)
for source in sources:
filename = os.path.join(folder, source)
if os.path.isdir(filename):
self.combine_pieces(filename)
def compress_3d(self, data: str) -> str:
data = re.sub(r'\bTHREE\b', 'T', data)
data = re.sub(r'console\.(error|warn)\(.+?\);', '', data, flags=re.S)
return data
def compress_gzip(self, filename: str):
output = f'{filename}.gz'
with open(filename, 'rb') as f_in:
with gzip.open(output, 'wb') as f_out:
shutil.copyfileobj(f_in, f_out)
# synchronise the date/time
if os.path.isfile(output):
info = os.stat(output)
os.utime(filename, (info.st_atime, info.st_mtime))
print('g', end='')
def compress_js(self, filename: str) -> str:
base, ext = os.path.splitext(filename)
output = f'{base}_{ext}'
if self.no_compress:
shutil.copy(filename, output)
return output
args = [
JAVA,
'-jar', COMPILER,
'--js', filename,
'--js_output_file', output,
'--language_in', 'ECMASCRIPT_2018',
'--language_out', 'ECMASCRIPT_2018',
]
if self.kwargs.get('advanced'):
args.extend(['--compilation_level', 'ADVANCED'])
run(args)
return output
def gzip_files(self, folder: str, depth: int, delete: bool):
queues = []
sources = os.listdir(folder)
for source in sources:
if source.startswith(('.', '_')):
continue
filename = os.path.join(folder, source)
if os.path.isdir(filename):
if source not in SKIP_GZIPS:
queues.append(filename)
continue
# file
if not os.path.isfile(filename):
continue
if source not in NEED_GZIPS:
continue
output = f'{filename}.gz'
source_time = os.path.getmtime(filename)
if os.path.isfile(output):
destin_time = os.path.getmtime(output)
if delete:
os.unlink(output)
print('d', end='')
else:
destin_time = 0
if not delete and source_time != destin_time:
self.compress_gzip(filename)
print(f"{' ' * depth}{filename}")
for queue in queues:
self.gzip_files(queue, depth + 1, delete)
@staticmethod
def import_file(match: Any) -> str:
source = match.group(1)
filename = os.path.join(JS_FOLDER, source)
data = read_text_safe(filename) or ''
if source.endswith('.js'):
data = re.sub(r'["\']use strict["\'];?', '', data)
return data
def normalise_folders(self):
global CSS_FOLDER, JS_FOLDER, LOCAL
if CSS_FOLDER[-1] != '/':
CSS_FOLDER += '/'
if JS_FOLDER[-1] != '/':
JS_FOLDER += '/'
if LOCAL[-1] != '/':
LOCAL += '/'
def create_index(self):
base = os.path.join(LOCAL, 'index_base.html')
base_time = os.path.getmtime(base)
index = os.path.join(LOCAL, 'index.html')
index_time = os.path.getmtime(index) if os.path.isfile(index) else 0
change = 0
if base_time >= index_time:
change += 1
# 1) minimise JS
for js_output, js_files in JS_FILES.items():
all_js = os.path.join(JS_FOLDER, f'{js_output}.js')
all_min_js = os.path.join(JS_FOLDER, f'{js_output}_.js')
# common/engine changed => need to update, even though we're not using those files
js_dates = [os.path.abspath(f"{JS_FOLDER}{js_file.strip(':')}.js") for js_file in js_files]
js_names = [os.path.abspath(f'{JS_FOLDER}{js_file}.js') for js_file in js_files if js_file[0] != ':']
if js_output == 'all':
extras = []
else:
extras = []
update = True
if os.path.isfile(all_min_js) and os.path.isfile(all_js):
all_time = os.path.getmtime(all_min_js)
update = False
for js_date in js_dates + extras:
update |= os.path.isfile(js_date) and os.path.getmtime(js_date) >= all_time
if not update:
print('J', end='')
continue
datas = []
for js_name in js_names:
print(js_name)
script_data = read_text_safe(js_name)
if not script_data:
continue
if js_name.endswith('script.js'):
script_data = re.sub('@import {(.*?)}', self.import_file, script_data);
script_data = re.sub('// BEGIN.*?// END', '', script_data, flags=re.S)
if self.no_debug:
script_data = re.sub('// <<.*?// >>', '', script_data, flags=re.S)
print(f'host={self.host}')
if self.host != '/':
script_data = script_data.replace("HOST = '/',", f"HOST = '{self.host}',")
datas.append(script_data)
data = '\n'.join(datas)
if '4d' in js_output:
data = self.compress_3d(data)
write_text_safe(all_js, data)
self.compress_js(all_js)
print('j', end='')
change += 1
all_css = os.path.join(CSS_FOLDER, 'all.css')
all_min_css = os.path.join(CSS_FOLDER, 'all_.css')
css_names = [os.path.abspath(f'{CSS_FOLDER}{css_file}.css') for css_file in CSS_FILES]
update = True
if os.path.isfile(all_min_css) and os.path.isfile(all_css):
all_time = os.path.getmtime(all_min_css)
update = False
for css_name in css_names:
update |= os.path.isfile(css_name) and os.path.getmtime(css_name) >= all_time
if update:
datas = []
for css_name in css_names:
datas.append(read_text_safe(css_name) or '')
data = '\n'.join(datas)
write_text_safe(all_css, data)
css_data = css_minify(data)
write_text_safe(all_min_css, css_data)
print('c', end='')
change += 1
else:
css_data = read_text_safe(all_min_css) or ''
print('C', end='')
if not change:
print('X', end='')
return
html = read_text_safe(base)
html = re.sub('<!-- BEGIN -->.*?<!-- END -->', '', html, flags=re.S)
html = re.sub('// BEGIN.*?// END', '', html, flags=re.S)
if self.host != '/':
replaces = {
'href="/': f'href="{self.host}',
'src="/': f'src="{self.host}',
}
for key, value in replaces.items():
html = html.replace(key, value)
if not self.no_process:
all_min_js = os.path.join(JS_FOLDER, 'all_.js')
js_data = read_text_safe(all_min_js) or ''
replaces = {
'<!-- {SCRIPT} -->': f'<script>{js_data}</script>',
'<!-- {STYLE} -->': f'<style>{css_data}</style>',
}
for key, value in replaces.items():
html = html.replace(key, value)
html = re.sub('<!-- .*? -->', '', html, flags=re.S)
html = re.sub(r'\n\s+', '\n', html)
filename = os.path.join(LOCAL, 'index.html')
write_text_safe(filename, html)
def synchronise(self) -> bool:
self.normalise_folders()
self.create_index()
if self.clean:
self.gzip_files(LOCAL, 0, True)
elif self.zip:
self.gzip_files(LOCAL, 0, False)
return True
if __name__ == '__main__':
start = time()
sync = Sync()
if 0:
sync.combine_themes(os.path.join(BASE, 'theme'))
else:
sync.synchronise()
end = time()
print(f'\nELAPSED: {end-start:.3f} seconds')
| true | true |
f702b7c58a323d000bad0d9da5c5c1cb62e79373 | 1,508 | py | Python | tests/main.py | viniarck/yala | 6e5493371645a6584dd54bc1a13ff819257f45a8 | [
"MIT"
] | 3 | 2020-05-29T05:03:01.000Z | 2020-06-09T14:40:28.000Z | tests/main.py | viniarck/yala | 6e5493371645a6584dd54bc1a13ff819257f45a8 | [
"MIT"
] | 25 | 2020-05-29T05:03:15.000Z | 2021-11-15T05:21:21.000Z | tests/main.py | viniarck/yala | 6e5493371645a6584dd54bc1a13ff819257f45a8 | [
"MIT"
] | null | null | null | """Tests for the main module."""
import unittest
from unittest.mock import Mock, patch
from yala.main import LinterRunner
class TestLinterRunner(unittest.TestCase):
"""Test the LinterRunner class."""
@patch('yala.main.Config')
def test_chosen_not_found(self, mock_config):
"""Should print an error when chosen linter is not found."""
# Linter chosen by the user
name = 'my linter'
mock_config.user_linters = [name]
_, stderr = self._path_and_run(mock_config, name)
self.assertIn('Did you install', stderr[0])
@patch('yala.main.Config')
def test_not_chosen_not_found(self, mock_config):
"""Should not print an error when chosen linter is not found."""
# No linters chosen by the user
mock_config.user_linters = []
stdout, stderr = self._path_and_run(mock_config)
self.assertEqual(0, len(stdout))
self.assertEqual(0, len(stderr))
def _path_and_run(self, mock_config, name='my linter'):
cls = self._mock_linter_class(name)
mock_config.get_linter_classes.return_value = [cls]
with patch('yala.main.subprocess.run', side_effect=FileNotFoundError):
linter_cfg_tgts = cls, mock_config, []
return LinterRunner.run(linter_cfg_tgts)
@staticmethod
def _mock_linter_class(name):
linter_class = Mock()
linter = linter_class.return_value
linter.command_with_options = linter.name = name
return linter_class
| 35.904762 | 78 | 0.67374 | import unittest
from unittest.mock import Mock, patch
from yala.main import LinterRunner
class TestLinterRunner(unittest.TestCase):
@patch('yala.main.Config')
def test_chosen_not_found(self, mock_config):
name = 'my linter'
mock_config.user_linters = [name]
_, stderr = self._path_and_run(mock_config, name)
self.assertIn('Did you install', stderr[0])
@patch('yala.main.Config')
def test_not_chosen_not_found(self, mock_config):
mock_config.user_linters = []
stdout, stderr = self._path_and_run(mock_config)
self.assertEqual(0, len(stdout))
self.assertEqual(0, len(stderr))
def _path_and_run(self, mock_config, name='my linter'):
cls = self._mock_linter_class(name)
mock_config.get_linter_classes.return_value = [cls]
with patch('yala.main.subprocess.run', side_effect=FileNotFoundError):
linter_cfg_tgts = cls, mock_config, []
return LinterRunner.run(linter_cfg_tgts)
@staticmethod
def _mock_linter_class(name):
linter_class = Mock()
linter = linter_class.return_value
linter.command_with_options = linter.name = name
return linter_class
| true | true |
f702b8499e7e86033ca8009acb49c904c799a1ff | 3,359 | py | Python | custom_components/kontomierz_sensor/sensor.py | pawelhulek/kontomierz-sensor | 7e7862c259d11a3406ebc6faabe7f2c4bd9ff70b | [
"MIT"
] | 2 | 2022-02-15T19:41:22.000Z | 2022-03-08T09:46:53.000Z | custom_components/kontomierz_sensor/sensor.py | pawelhulek/kontomierz-sensor | 7e7862c259d11a3406ebc6faabe7f2c4bd9ff70b | [
"MIT"
] | null | null | null | custom_components/kontomierz_sensor/sensor.py | pawelhulek/kontomierz-sensor | 7e7862c259d11a3406ebc6faabe7f2c4bd9ff70b | [
"MIT"
] | null | null | null | """Platform for sensor integration."""
from __future__ import annotations
import homeassistant.helpers.config_validation as cv
import requests
import voluptuous as vol
from homeassistant.components.sensor import SensorEntity, PLATFORM_SCHEMA, SensorStateClass, SensorDeviceClass
from homeassistant.const import CONF_USERNAME, CONF_PASSWORD, CONF_API_TOKEN
from homeassistant.core import HomeAssistant
from homeassistant.helpers.entity_platform import AddEntitiesCallback
from homeassistant.helpers.typing import ConfigType, DiscoveryInfoType
from requests.auth import HTTPBasicAuth
PLATFORM_SCHEMA = PLATFORM_SCHEMA.extend({
vol.Required(CONF_USERNAME): cv.string,
vol.Required(CONF_PASSWORD): cv.string,
vol.Required(CONF_API_TOKEN): cv.string,
})
def setup_platform(
hass: HomeAssistant,
config: ConfigType,
add_entities: AddEntitiesCallback,
discovery_info: DiscoveryInfoType | None = None
) -> None:
"""Set up the sensor platform."""
url = "https://secure.kontomierz.pl/k4/user_accounts.json?api_key=" + config.get(CONF_API_TOKEN)
payload = {}
headers = {
'Content-Type': 'application/json',
'Accept': 'application/json',
}
response = requests.get(url, auth=HTTPBasicAuth(config.get(CONF_USERNAME), config.get(CONF_PASSWORD)),
headers=headers, data=payload)
response_json = response.json()
for x in response_json:
account = x.get('user_account')
add_entities(
[KontomierzSensor(hass, config, account.get('bank_name') + " - " + account.get('display_name'),
account.get('iban'))])
class KontomierzSensor(SensorEntity):
"""Representation of a Sensor."""
def __init__(self, hass, config: dict, entity_name: string, iban: string) -> None:
self._attr_device_class = SensorDeviceClass.MONETARY
self._attr_state_class = SensorStateClass.MEASUREMENT
self._state = None
self.hass = hass
self.username = config.get(CONF_USERNAME)
self.password = config.get(CONF_PASSWORD)
self.apiToken = config.get(CONF_API_TOKEN)
self.entity_name = entity_name
self.iban = iban
@property
def unique_id(self) -> str | None:
return "kontomierz_sensor" + self.entity_name
@property
def name(self) -> str:
return self.entity_name
@property
def state(self):
"""Return the state of the sensor."""
return self._state
def update(self) -> None:
"""Fetch new state data for the sensor.
This is the only method that should fetch new data for Home Assistant.
"""
url = "https://secure.kontomierz.pl/k4/user_accounts.json?api_key=" + self.apiToken
response = requests.get(url, auth=HTTPBasicAuth(self.username, self.password), headers={
'Content-Type': 'application/json',
'Accept': 'application/json',
}, data={})
response_json = response.json()
result = 0.0
for x in response_json:
user_account = x.get('user_account')
if self.iban == user_account.get('iban'):
result = float(user_account.get('balance'))
self._attr_native_unit_of_measurement = user_account.get('currency_name')
self._state = result
| 36.912088 | 110 | 0.671033 | from __future__ import annotations
import homeassistant.helpers.config_validation as cv
import requests
import voluptuous as vol
from homeassistant.components.sensor import SensorEntity, PLATFORM_SCHEMA, SensorStateClass, SensorDeviceClass
from homeassistant.const import CONF_USERNAME, CONF_PASSWORD, CONF_API_TOKEN
from homeassistant.core import HomeAssistant
from homeassistant.helpers.entity_platform import AddEntitiesCallback
from homeassistant.helpers.typing import ConfigType, DiscoveryInfoType
from requests.auth import HTTPBasicAuth
PLATFORM_SCHEMA = PLATFORM_SCHEMA.extend({
vol.Required(CONF_USERNAME): cv.string,
vol.Required(CONF_PASSWORD): cv.string,
vol.Required(CONF_API_TOKEN): cv.string,
})
def setup_platform(
hass: HomeAssistant,
config: ConfigType,
add_entities: AddEntitiesCallback,
discovery_info: DiscoveryInfoType | None = None
) -> None:
url = "https://secure.kontomierz.pl/k4/user_accounts.json?api_key=" + config.get(CONF_API_TOKEN)
payload = {}
headers = {
'Content-Type': 'application/json',
'Accept': 'application/json',
}
response = requests.get(url, auth=HTTPBasicAuth(config.get(CONF_USERNAME), config.get(CONF_PASSWORD)),
headers=headers, data=payload)
response_json = response.json()
for x in response_json:
account = x.get('user_account')
add_entities(
[KontomierzSensor(hass, config, account.get('bank_name') + " - " + account.get('display_name'),
account.get('iban'))])
class KontomierzSensor(SensorEntity):
def __init__(self, hass, config: dict, entity_name: string, iban: string) -> None:
self._attr_device_class = SensorDeviceClass.MONETARY
self._attr_state_class = SensorStateClass.MEASUREMENT
self._state = None
self.hass = hass
self.username = config.get(CONF_USERNAME)
self.password = config.get(CONF_PASSWORD)
self.apiToken = config.get(CONF_API_TOKEN)
self.entity_name = entity_name
self.iban = iban
@property
def unique_id(self) -> str | None:
return "kontomierz_sensor" + self.entity_name
@property
def name(self) -> str:
return self.entity_name
@property
def state(self):
return self._state
def update(self) -> None:
url = "https://secure.kontomierz.pl/k4/user_accounts.json?api_key=" + self.apiToken
response = requests.get(url, auth=HTTPBasicAuth(self.username, self.password), headers={
'Content-Type': 'application/json',
'Accept': 'application/json',
}, data={})
response_json = response.json()
result = 0.0
for x in response_json:
user_account = x.get('user_account')
if self.iban == user_account.get('iban'):
result = float(user_account.get('balance'))
self._attr_native_unit_of_measurement = user_account.get('currency_name')
self._state = result
| true | true |
f702b8a772bb5d14f134560768bd7b16e89d9a92 | 15,785 | py | Python | models/__init__.py | Sriram-Ravula/ncsnv2 | f610b59441a34063fae1c02aa06837b7eec95c03 | [
"MIT"
] | null | null | null | models/__init__.py | Sriram-Ravula/ncsnv2 | f610b59441a34063fae1c02aa06837b7eec95c03 | [
"MIT"
] | null | null | null | models/__init__.py | Sriram-Ravula/ncsnv2 | f610b59441a34063fae1c02aa06837b7eec95c03 | [
"MIT"
] | null | null | null | import torch
import numpy as np
def get_sigmas(config):
if config.model.sigma_dist == 'geometric':
sigmas = torch.tensor(
np.exp(np.linspace(np.log(config.model.sigma_begin), np.log(config.model.sigma_end),
config.model.num_classes))).float().to(config.device)
elif config.model.sigma_dist == 'uniform':
sigmas = torch.tensor(
np.linspace(config.model.sigma_begin, config.model.sigma_end, config.model.num_classes)
).float().to(config.device)
else:
raise NotImplementedError('sigma distribution not supported')
return sigmas
@torch.no_grad()
def anneal_Langevin_dynamics(x_mod, scorenet, sigmas, n_steps_each=200, step_lr=0.000008,
final_only=False, verbose=False, denoise=True, add_noise=True):
images = []
with torch.no_grad():
for c, sigma in enumerate(sigmas):
labels = torch.ones(x_mod.shape[0], device=x_mod.device) * c #dummy target 1...T depending on iteration
labels = labels.long()
step_size = step_lr * (sigma / sigmas[-1]) ** 2
for s in range(n_steps_each):
grad = scorenet(x_mod, labels)
#choose whether to add random noise during each gradient ascent step
if add_noise:
noise = torch.randn_like(x_mod)
else:
noise = torch.zeros_like(x_mod)
#calculate l2 norms of gradient (score) and the additive noise for logging
grad_norm = torch.norm(grad.view(grad.shape[0], -1), dim=-1).mean()
noise_norm = torch.norm(noise.view(noise.shape[0], -1), dim=-1).mean()
x_mod = x_mod + step_size * grad + noise * np.sqrt(step_size * 2) #core Langevin step
#calc l2 norm of iterate variable for logging
image_norm = torch.norm(x_mod.view(x_mod.shape[0], -1), dim=-1).mean()
#calc snr as scaled version of [||s(x, \sigma_i)|| / ||z_t||] and mean of score for logging
snr = np.sqrt(step_size / 2.) * grad_norm / noise_norm
grad_mean_norm = torch.norm(grad.mean(dim=0).view(-1)) ** 2 * sigma ** 2
if not final_only:
images.append(x_mod.to('cpu'))
if verbose:
print("level: {}, step_size: {}, grad_norm: {}, image_norm: {}, snr: {}, grad_mean_norm: {}".format(
c, step_size, grad_norm.item(), image_norm.item(), snr.item(), grad_mean_norm.item()))
#final denoising step if desired - removes the very last additive z_L
if denoise:
last_noise = (len(sigmas) - 1) * torch.ones(x_mod.shape[0], device=x_mod.device)
last_noise = last_noise.long()
x_mod = x_mod + sigmas[-1] ** 2 * scorenet(x_mod, last_noise)
images.append(x_mod.to('cpu'))
if final_only:
return [x_mod.to('cpu')]
else:
return images
@torch.no_grad()
def langevin_Inverse(x_mod, y, A, scorenet, sigmas, n_steps_each=200, step_lr=0.000008,
final_only=False, verbose=False, denoise=True, add_noise=True,
decimate_sigma=None, mode=None, true_x=None):
images = []
#if desired, decimate the number of noise scales to speed up inference
if decimate_sigma is not None:
sigmas_temp = sigmas[0:-1:decimate_sigma].tolist() #grab every decimate_sigma'th value except the last one
sigmas_temp.append(sigmas[-1]) #add the last sigma value back to the list
# num_sigmas = sigmas.shape[0] // decimate_sigma
# sigmas_temp = []
# for i in range(num_sigmas):
# sigmas_temp.append(sigmas[-1])
sigmas = sigmas_temp #swap the new decimated sigma list for the main one
mse = torch.nn.MSELoss()
N, C, H, W = x_mod.shape
steps = np.geomspace(start=5, stop=1, num=len(sigmas))
c2 = 1
with torch.no_grad():
#outer loop over noise scales
for c, sigma in enumerate(sigmas):
#dummy target 1...T depending on iteration
labels = torch.ones(x_mod.shape[0], device=x_mod.device) * c
labels = labels.long()
#step_size = step_lr * (sigma / sigmas[-1]) ** 2
step_size = steps[c]
#Inner loop over T
for s in range(n_steps_each):
#s(x_t) ~= \grad_x log p(x) -- THE PRIOR
grad = scorenet(x_mod, labels)
prior_norm = torch.norm(grad.view(grad.shape[0], -1), dim=-1).mean()
#prior_mean_norm = torch.norm(grad.mean(dim=0).view(-1)) ** 2 * sigma ** 2
#calculate the maximum likelihood gradient - i.e. MSE gradient
#A should be [N, m, C * H * W], x should be [N, C, H, W], y should be [N, m, 1]
if mode=='denoising':
Axt = x_mod
mle_grad = (Axt - y) * (1 / N) #for denoising, y has same dimension as x
else:
Axt = torch.matmul(A, x_mod.view(N, -1, 1))
mle_grad = torch.matmul(torch.transpose(A, -2, -1), Axt - y).view(N, C, H, W) * c2 #MSE gradient
#mle_grad = torch.matmul(torch.transpose(A, -2, -1), torch.sign(Axt - y)).view(N, C, H, W) * (1 / N) #L1 error gradient
likelihood_norm = torch.norm(mle_grad.view(mle_grad.shape[0], -1), dim=-1).mean()
#likelihood_mean_norm = torch.norm(mle_grad.mean(dim=0).view(-1)) ** 2
if c == 0 and s == 0:
c2 = prior_norm.item() / likelihood_norm.item()
mle_grad = mle_grad * c2 #MSE gradient
likelihood_norm = torch.norm(mle_grad.view(mle_grad.shape[0], -1), dim=-1).mean()
#The final gradient
grad = grad - mle_grad
grad_norm = torch.norm(grad.view(grad.shape[0], -1), dim=-1).mean()
#grad_mean_norm = torch.norm(grad.mean(dim=0).view(-1)) ** 2
#choose whether to add random noise during each gradient ascent step
if add_noise:
noise = torch.randn_like(x_mod)
else:
noise = torch.zeros_like(x_mod)
x_mod = x_mod + step_size * grad + noise * np.sqrt(step_size * 2) #core Langevin step
#calc l2 norm of iterate variable for logging
image_norm = torch.norm(x_mod.view(x_mod.shape[0], -1), dim=-1).mean()
noise_norm = torch.norm(noise.view(noise.shape[0], -1), dim=-1).mean()
snr = np.sqrt(step_size / 2.) * prior_norm / noise_norm
mse_iter = mse(Axt, y)
if true_x is not None:
mse_true = mse(true_x, x_mod)
if not final_only:
images.append(x_mod.to('cpu'))
if verbose:
print("\nlevel: {}, step_size: {:.4f}, prior_norm: {:.4f}, likelihood_norm: {:.4f}, grad_norm: {:.4f} \
image_norm: {:.4f}, train_mse: {:.4f}".format( \
c, step_size, prior_norm.item(), likelihood_norm.item(), grad_norm.item(), image_norm.item(), \
mse_iter.item()))
if true_x is not None:
print("true_mse: {:.4f}".format(mse_true.item()))
#final denoising step if desired - removes the very last additive z_L
if denoise:
last_noise = (len(sigmas) - 1) * torch.ones(x_mod.shape[0], device=x_mod.device)
last_noise = last_noise.long()
x_mod = x_mod + sigmas[-1] ** 2 * scorenet(x_mod, last_noise)
images.append(x_mod.to('cpu'))
if final_only:
return [x_mod.to('cpu')]
else:
return images
@torch.no_grad()
def inverse_solver(x_mod, y, A, scorenet, sigmas, lr = [5, 1], c1=1, c2=1, auto_c2=True,
final_only=False, verbose=False, likelihood_every=1,
decimate_sigma=None, mode=None, true_x=None, sigma_type = 'subsample', likelihood_type="l2"):
images = []
#if desired, decimate the number of noise scales to speed up inference
if decimate_sigma is not None:
if sigma_type == 'subsample': #grab equally-spaced sigma values
sigmas_temp = sigmas[0:-1:decimate_sigma].tolist()
sigmas_temp.append(sigmas[-1])
elif sigma_type == 'last': #grab just the last sigma value multiple times
num_sigmas = sigmas.shape[0] // decimate_sigma
sigmas_temp = []
for i in range(num_sigmas):
sigmas_temp.append(sigmas[-1])
else:
sigmas_temp = sigmas
sigmas = sigmas_temp
mse = torch.nn.MSELoss()
N, C, H, W = x_mod.shape
steps = np.geomspace(start=lr[0], stop=lr[1], num=len(sigmas))
likelihood_norm = 0
with torch.no_grad():
if sigma_type == 'last':
labels = torch.ones(x_mod.shape[0], device=x_mod.device) * 1099
labels = labels.long()
for c, sigma in enumerate(sigmas):
if sigma_type == 'subsample':
labels = torch.ones(x_mod.shape[0], device=x_mod.device) * decimate_sigma * c
labels = labels.long()
elif sigma_type != 'last':
labels = torch.ones(x_mod.shape[0], device=x_mod.device) * c
labels = labels.long()
step_size = steps[c]
#s(x_t) ~= \grad_x log p(x) -- THE PRIOR
grad = scorenet(x_mod, labels) * c1
prior_norm = torch.norm(grad.view(grad.shape[0], -1), dim=-1).mean()
if c % likelihood_every == 0:
#\grad_x log p(y | x) -- LIKELIHOOD
if mode=='denoising':
Axt = x_mod
if likelihood_type == "l2":
mle_grad = (Axt - y) * c2
elif likelihood_type == "l1":
mle_grad = torch.sign(Axt - y) * c2
else:
Axt = torch.matmul(A, x_mod.view(N, -1, 1))
if likelihood_type == "l2":
mle_grad = torch.matmul(torch.transpose(A, -2, -1), Axt - y).view(N, C, H, W) * c2
elif likelihood_type == "l1":
mle_grad = torch.matmul(torch.transpose(A, -2, -1), torch.sign(Axt - y)).view(N, C, H, W) * c2
likelihood_norm = torch.norm(mle_grad.view(mle_grad.shape[0], -1), dim=-1).mean()
if auto_c2 and c == 0:
c2 = prior_norm.item() / likelihood_norm.item()
mle_grad = mle_grad * c2 #MSE gradient
likelihood_norm = torch.norm(mle_grad.view(mle_grad.shape[0], -1), dim=-1).mean()
grad = grad - mle_grad
grad_norm = torch.norm(grad.view(grad.shape[0], -1), dim=-1).mean()
x_mod = x_mod + step_size * grad
#x_mod = torch.clamp(x_mod, 0.0, 1.0)
#calc l2 norm of iterate variable for logging
image_norm = torch.norm(x_mod.view(x_mod.shape[0], -1), dim=-1).mean()
mse_iter = mse(Axt, y)
if true_x is not None:
mse_true = mse(true_x, x_mod)
if not final_only:
images.append(x_mod.cpu())
if verbose:
print("\n iteration: {}, sigma: {:.4f}, step_size: {:.4f}, prior_norm: {:.4f}, likelihood_norm: {:.4f}, grad_norm: {:.4f} \
image_norm: {:.4f}, train_mse: {:.4f}".format( \
c, sigma, step_size, prior_norm.item(), likelihood_norm.item(), grad_norm.item(), image_norm.item(), \
mse_iter.item()))
if true_x is not None:
print("true_mse: {:.4f}".format(mse_true.item()))
if final_only:
return [x_mod.to('cpu')]
else:
return images
@torch.no_grad()
def anneal_Langevin_dynamics_inpainting(x_mod, refer_image, scorenet, sigmas, image_size,
n_steps_each=100, step_lr=0.000008):
"""
Currently only good for 32x32 images. Assuming the right half is missing.
"""
images = []
#refer_image is the untainted x (?)
#right now this only works with 3-channel images
refer_image = refer_image.unsqueeze(1).expand(-1, x_mod.shape[1], -1, -1, -1)
refer_image = refer_image.contiguous().view(-1, 3, image_size, image_size)
x_mod = x_mod.view(-1, 3, image_size, image_size)
cols = image_size // 2
half_refer_image = refer_image[..., :cols]
with torch.no_grad():
for c, sigma in enumerate(sigmas):
labels = torch.ones(x_mod.shape[0], device=x_mod.device) * c
labels = labels.long()
step_size = step_lr * (sigma / sigmas[-1]) ** 2
for s in range(n_steps_each):
images.append(x_mod.to('cpu'))
corrupted_half_image = half_refer_image + torch.randn_like(half_refer_image) * sigma
x_mod[:, :, :, :cols] = corrupted_half_image
noise = torch.randn_like(x_mod) * np.sqrt(step_size * 2)
grad = scorenet(x_mod, labels)
x_mod = x_mod + step_size * grad + noise
print("class: {}, step_size: {}, mean {}, max {}".format(c, step_size, grad.abs().mean(),
grad.abs().max()))
return images
@torch.no_grad()
def anneal_Langevin_dynamics_interpolation(x_mod, scorenet, sigmas, n_interpolations, n_steps_each=200, step_lr=0.000008,
final_only=False, verbose=False):
images = []
n_rows = x_mod.shape[0]
x_mod = x_mod[:, None, ...].repeat(1, n_interpolations, 1, 1, 1)
x_mod = x_mod.reshape(-1, *x_mod.shape[2:])
for c, sigma in enumerate(sigmas):
labels = torch.ones(x_mod.shape[0], device=x_mod.device) * c
labels = labels.long()
step_size = step_lr * (sigma / sigmas[-1]) ** 2
for s in range(n_steps_each):
grad = scorenet(x_mod, labels)
noise_p = torch.randn(n_rows, x_mod.shape[1], x_mod.shape[2], x_mod.shape[3],
device=x_mod.device)
noise_q = torch.randn(n_rows, x_mod.shape[1], x_mod.shape[2], x_mod.shape[3],
device=x_mod.device)
angles = torch.linspace(0, np.pi / 2., n_interpolations, device=x_mod.device)
noise = noise_p[:, None, ...] * torch.cos(angles)[None, :, None, None, None] + \
noise_q[:, None, ...] * torch.sin(angles)[None, :, None, None, None]
noise = noise.reshape(-1, *noise.shape[2:])
grad_norm = torch.norm(grad.view(grad.shape[0], -1), dim=-1).mean()
noise_norm = torch.norm(noise.view(noise.shape[0], -1), dim=-1).mean()
image_norm = torch.norm(x_mod.view(x_mod.shape[0], -1), dim=-1).mean()
x_mod = x_mod + step_size * grad + noise * np.sqrt(step_size * 2)
snr = np.sqrt(step_size / 2.) * grad_norm / noise_norm
if not final_only:
images.append(x_mod.to('cpu'))
if verbose:
print(
"level: {}, step_size: {}, image_norm: {}, grad_norm: {}, snr: {}".format(
c, step_size, image_norm.item(), grad_norm.item(), snr.item()))
if final_only:
return [x_mod.to('cpu')]
else:
return images | 44.092179 | 139 | 0.540703 | import torch
import numpy as np
def get_sigmas(config):
if config.model.sigma_dist == 'geometric':
sigmas = torch.tensor(
np.exp(np.linspace(np.log(config.model.sigma_begin), np.log(config.model.sigma_end),
config.model.num_classes))).float().to(config.device)
elif config.model.sigma_dist == 'uniform':
sigmas = torch.tensor(
np.linspace(config.model.sigma_begin, config.model.sigma_end, config.model.num_classes)
).float().to(config.device)
else:
raise NotImplementedError('sigma distribution not supported')
return sigmas
@torch.no_grad()
def anneal_Langevin_dynamics(x_mod, scorenet, sigmas, n_steps_each=200, step_lr=0.000008,
final_only=False, verbose=False, denoise=True, add_noise=True):
images = []
with torch.no_grad():
for c, sigma in enumerate(sigmas):
labels = torch.ones(x_mod.shape[0], device=x_mod.device) * c
labels = labels.long()
step_size = step_lr * (sigma / sigmas[-1]) ** 2
for s in range(n_steps_each):
grad = scorenet(x_mod, labels)
if add_noise:
noise = torch.randn_like(x_mod)
else:
noise = torch.zeros_like(x_mod)
grad_norm = torch.norm(grad.view(grad.shape[0], -1), dim=-1).mean()
noise_norm = torch.norm(noise.view(noise.shape[0], -1), dim=-1).mean()
x_mod = x_mod + step_size * grad + noise * np.sqrt(step_size * 2)
image_norm = torch.norm(x_mod.view(x_mod.shape[0], -1), dim=-1).mean()
snr = np.sqrt(step_size / 2.) * grad_norm / noise_norm
grad_mean_norm = torch.norm(grad.mean(dim=0).view(-1)) ** 2 * sigma ** 2
if not final_only:
images.append(x_mod.to('cpu'))
if verbose:
print("level: {}, step_size: {}, grad_norm: {}, image_norm: {}, snr: {}, grad_mean_norm: {}".format(
c, step_size, grad_norm.item(), image_norm.item(), snr.item(), grad_mean_norm.item()))
if denoise:
last_noise = (len(sigmas) - 1) * torch.ones(x_mod.shape[0], device=x_mod.device)
last_noise = last_noise.long()
x_mod = x_mod + sigmas[-1] ** 2 * scorenet(x_mod, last_noise)
images.append(x_mod.to('cpu'))
if final_only:
return [x_mod.to('cpu')]
else:
return images
@torch.no_grad()
def langevin_Inverse(x_mod, y, A, scorenet, sigmas, n_steps_each=200, step_lr=0.000008,
final_only=False, verbose=False, denoise=True, add_noise=True,
decimate_sigma=None, mode=None, true_x=None):
images = []
if decimate_sigma is not None:
sigmas_temp = sigmas[0:-1:decimate_sigma].tolist()
sigmas_temp.append(sigmas[-1]) #add the last sigma value back to the list
# num_sigmas = sigmas.shape[0] // decimate_sigma
# sigmas_temp = []
# for i in range(num_sigmas):
# sigmas_temp.append(sigmas[-1])
sigmas = sigmas_temp #swap the new decimated sigma list for the main one
mse = torch.nn.MSELoss()
N, C, H, W = x_mod.shape
steps = np.geomspace(start=5, stop=1, num=len(sigmas))
c2 = 1
with torch.no_grad():
#outer loop over noise scales
for c, sigma in enumerate(sigmas):
#dummy target 1...T depending on iteration
labels = torch.ones(x_mod.shape[0], device=x_mod.device) * c
labels = labels.long()
#step_size = step_lr * (sigma / sigmas[-1]) ** 2
step_size = steps[c]
#Inner loop over T
for s in range(n_steps_each):
#s(x_t) ~= \grad_x log p(x) -- THE PRIOR
grad = scorenet(x_mod, labels)
prior_norm = torch.norm(grad.view(grad.shape[0], -1), dim=-1).mean()
#prior_mean_norm = torch.norm(grad.mean(dim=0).view(-1)) ** 2 * sigma ** 2
#calculate the maximum likelihood gradient - i.e. MSE gradient
#A should be [N, m, C * H * W], x should be [N, C, H, W], y should be [N, m, 1]
if mode=='denoising':
Axt = x_mod
mle_grad = (Axt - y) * (1 / N) #for denoising, y has same dimension as x
else:
Axt = torch.matmul(A, x_mod.view(N, -1, 1))
mle_grad = torch.matmul(torch.transpose(A, -2, -1), Axt - y).view(N, C, H, W) * c2 #MSE gradient
#mle_grad = torch.matmul(torch.transpose(A, -2, -1), torch.sign(Axt - y)).view(N, C, H, W) * (1 / N) #L1 error gradient
likelihood_norm = torch.norm(mle_grad.view(mle_grad.shape[0], -1), dim=-1).mean()
#likelihood_mean_norm = torch.norm(mle_grad.mean(dim=0).view(-1)) ** 2
if c == 0 and s == 0:
c2 = prior_norm.item() / likelihood_norm.item()
mle_grad = mle_grad * c2 #MSE gradient
likelihood_norm = torch.norm(mle_grad.view(mle_grad.shape[0], -1), dim=-1).mean()
#The final gradient
grad = grad - mle_grad
grad_norm = torch.norm(grad.view(grad.shape[0], -1), dim=-1).mean()
#grad_mean_norm = torch.norm(grad.mean(dim=0).view(-1)) ** 2
#choose whether to add random noise during each gradient ascent step
if add_noise:
noise = torch.randn_like(x_mod)
else:
noise = torch.zeros_like(x_mod)
x_mod = x_mod + step_size * grad + noise * np.sqrt(step_size * 2) #core Langevin step
#calc l2 norm of iterate variable for logging
image_norm = torch.norm(x_mod.view(x_mod.shape[0], -1), dim=-1).mean()
noise_norm = torch.norm(noise.view(noise.shape[0], -1), dim=-1).mean()
snr = np.sqrt(step_size / 2.) * prior_norm / noise_norm
mse_iter = mse(Axt, y)
if true_x is not None:
mse_true = mse(true_x, x_mod)
if not final_only:
images.append(x_mod.to('cpu'))
if verbose:
print("\nlevel: {}, step_size: {:.4f}, prior_norm: {:.4f}, likelihood_norm: {:.4f}, grad_norm: {:.4f} \
image_norm: {:.4f}, train_mse: {:.4f}".format( \
c, step_size, prior_norm.item(), likelihood_norm.item(), grad_norm.item(), image_norm.item(), \
mse_iter.item()))
if true_x is not None:
print("true_mse: {:.4f}".format(mse_true.item()))
#final denoising step if desired - removes the very last additive z_L
if denoise:
last_noise = (len(sigmas) - 1) * torch.ones(x_mod.shape[0], device=x_mod.device)
last_noise = last_noise.long()
x_mod = x_mod + sigmas[-1] ** 2 * scorenet(x_mod, last_noise)
images.append(x_mod.to('cpu'))
if final_only:
return [x_mod.to('cpu')]
else:
return images
@torch.no_grad()
def inverse_solver(x_mod, y, A, scorenet, sigmas, lr = [5, 1], c1=1, c2=1, auto_c2=True,
final_only=False, verbose=False, likelihood_every=1,
decimate_sigma=None, mode=None, true_x=None, sigma_type = 'subsample', likelihood_type="l2"):
images = []
#if desired, decimate the number of noise scales to speed up inference
if decimate_sigma is not None:
if sigma_type == 'subsample': #grab equally-spaced sigma values
sigmas_temp = sigmas[0:-1:decimate_sigma].tolist()
sigmas_temp.append(sigmas[-1])
elif sigma_type == 'last': #grab just the last sigma value multiple times
num_sigmas = sigmas.shape[0] // decimate_sigma
sigmas_temp = []
for i in range(num_sigmas):
sigmas_temp.append(sigmas[-1])
else:
sigmas_temp = sigmas
sigmas = sigmas_temp
mse = torch.nn.MSELoss()
N, C, H, W = x_mod.shape
steps = np.geomspace(start=lr[0], stop=lr[1], num=len(sigmas))
likelihood_norm = 0
with torch.no_grad():
if sigma_type == 'last':
labels = torch.ones(x_mod.shape[0], device=x_mod.device) * 1099
labels = labels.long()
for c, sigma in enumerate(sigmas):
if sigma_type == 'subsample':
labels = torch.ones(x_mod.shape[0], device=x_mod.device) * decimate_sigma * c
labels = labels.long()
elif sigma_type != 'last':
labels = torch.ones(x_mod.shape[0], device=x_mod.device) * c
labels = labels.long()
step_size = steps[c]
#s(x_t) ~= \grad_x log p(x) -- THE PRIOR
grad = scorenet(x_mod, labels) * c1
prior_norm = torch.norm(grad.view(grad.shape[0], -1), dim=-1).mean()
if c % likelihood_every == 0:
#\grad_x log p(y | x) -- LIKELIHOOD
if mode=='denoising':
Axt = x_mod
if likelihood_type == "l2":
mle_grad = (Axt - y) * c2
elif likelihood_type == "l1":
mle_grad = torch.sign(Axt - y) * c2
else:
Axt = torch.matmul(A, x_mod.view(N, -1, 1))
if likelihood_type == "l2":
mle_grad = torch.matmul(torch.transpose(A, -2, -1), Axt - y).view(N, C, H, W) * c2
elif likelihood_type == "l1":
mle_grad = torch.matmul(torch.transpose(A, -2, -1), torch.sign(Axt - y)).view(N, C, H, W) * c2
likelihood_norm = torch.norm(mle_grad.view(mle_grad.shape[0], -1), dim=-1).mean()
if auto_c2 and c == 0:
c2 = prior_norm.item() / likelihood_norm.item()
mle_grad = mle_grad * c2 #MSE gradient
likelihood_norm = torch.norm(mle_grad.view(mle_grad.shape[0], -1), dim=-1).mean()
grad = grad - mle_grad
grad_norm = torch.norm(grad.view(grad.shape[0], -1), dim=-1).mean()
x_mod = x_mod + step_size * grad
#x_mod = torch.clamp(x_mod, 0.0, 1.0)
#calc l2 norm of iterate variable for logging
image_norm = torch.norm(x_mod.view(x_mod.shape[0], -1), dim=-1).mean()
mse_iter = mse(Axt, y)
if true_x is not None:
mse_true = mse(true_x, x_mod)
if not final_only:
images.append(x_mod.cpu())
if verbose:
print("\n iteration: {}, sigma: {:.4f}, step_size: {:.4f}, prior_norm: {:.4f}, likelihood_norm: {:.4f}, grad_norm: {:.4f} \
image_norm: {:.4f}, train_mse: {:.4f}".format( \
c, sigma, step_size, prior_norm.item(), likelihood_norm.item(), grad_norm.item(), image_norm.item(), \
mse_iter.item()))
if true_x is not None:
print("true_mse: {:.4f}".format(mse_true.item()))
if final_only:
return [x_mod.to('cpu')]
else:
return images
@torch.no_grad()
def anneal_Langevin_dynamics_inpainting(x_mod, refer_image, scorenet, sigmas, image_size,
n_steps_each=100, step_lr=0.000008):
images = []
#refer_image is the untainted x (?)
#right now this only works with 3-channel images
refer_image = refer_image.unsqueeze(1).expand(-1, x_mod.shape[1], -1, -1, -1)
refer_image = refer_image.contiguous().view(-1, 3, image_size, image_size)
x_mod = x_mod.view(-1, 3, image_size, image_size)
cols = image_size // 2
half_refer_image = refer_image[..., :cols]
with torch.no_grad():
for c, sigma in enumerate(sigmas):
labels = torch.ones(x_mod.shape[0], device=x_mod.device) * c
labels = labels.long()
step_size = step_lr * (sigma / sigmas[-1]) ** 2
for s in range(n_steps_each):
images.append(x_mod.to('cpu'))
corrupted_half_image = half_refer_image + torch.randn_like(half_refer_image) * sigma
x_mod[:, :, :, :cols] = corrupted_half_image
noise = torch.randn_like(x_mod) * np.sqrt(step_size * 2)
grad = scorenet(x_mod, labels)
x_mod = x_mod + step_size * grad + noise
print("class: {}, step_size: {}, mean {}, max {}".format(c, step_size, grad.abs().mean(),
grad.abs().max()))
return images
@torch.no_grad()
def anneal_Langevin_dynamics_interpolation(x_mod, scorenet, sigmas, n_interpolations, n_steps_each=200, step_lr=0.000008,
final_only=False, verbose=False):
images = []
n_rows = x_mod.shape[0]
x_mod = x_mod[:, None, ...].repeat(1, n_interpolations, 1, 1, 1)
x_mod = x_mod.reshape(-1, *x_mod.shape[2:])
for c, sigma in enumerate(sigmas):
labels = torch.ones(x_mod.shape[0], device=x_mod.device) * c
labels = labels.long()
step_size = step_lr * (sigma / sigmas[-1]) ** 2
for s in range(n_steps_each):
grad = scorenet(x_mod, labels)
noise_p = torch.randn(n_rows, x_mod.shape[1], x_mod.shape[2], x_mod.shape[3],
device=x_mod.device)
noise_q = torch.randn(n_rows, x_mod.shape[1], x_mod.shape[2], x_mod.shape[3],
device=x_mod.device)
angles = torch.linspace(0, np.pi / 2., n_interpolations, device=x_mod.device)
noise = noise_p[:, None, ...] * torch.cos(angles)[None, :, None, None, None] + \
noise_q[:, None, ...] * torch.sin(angles)[None, :, None, None, None]
noise = noise.reshape(-1, *noise.shape[2:])
grad_norm = torch.norm(grad.view(grad.shape[0], -1), dim=-1).mean()
noise_norm = torch.norm(noise.view(noise.shape[0], -1), dim=-1).mean()
image_norm = torch.norm(x_mod.view(x_mod.shape[0], -1), dim=-1).mean()
x_mod = x_mod + step_size * grad + noise * np.sqrt(step_size * 2)
snr = np.sqrt(step_size / 2.) * grad_norm / noise_norm
if not final_only:
images.append(x_mod.to('cpu'))
if verbose:
print(
"level: {}, step_size: {}, image_norm: {}, grad_norm: {}, snr: {}".format(
c, step_size, image_norm.item(), grad_norm.item(), snr.item()))
if final_only:
return [x_mod.to('cpu')]
else:
return images | true | true |
f702b9242485f5679da54c8293d1d4239b240653 | 10,790 | py | Python | kivymd/uix/useranimationcard.py | RedGui/KivyMD | 5fc9c4c52d01816ba8885fed57f89bf923b38c15 | [
"MIT"
] | null | null | null | kivymd/uix/useranimationcard.py | RedGui/KivyMD | 5fc9c4c52d01816ba8885fed57f89bf923b38c15 | [
"MIT"
] | null | null | null | kivymd/uix/useranimationcard.py | RedGui/KivyMD | 5fc9c4c52d01816ba8885fed57f89bf923b38c15 | [
"MIT"
] | null | null | null | """
User Animation Card
===================
Copyright (c) 2019 Ivanov Yuri
For suggestions and questions:
<kivydevelopment@gmail.com>
This file is distributed under the terms of the same license,
as the Kivy framework.
Example
-------
from kivymd.app import MDApp
from kivy.lang import Builder
from kivy.factory import Factory
from kivymd.toast import toast
from kivymd.theming import ThemeManager
from kivymd.uix.useranimationcard import MDUserAnimationCard
from kivymd.uix.button import MDIconButton
from kivymd.uix.list import ILeftBodyTouch
# Your content for a contact card.
Builder.load_string('''
#:import get_hex_from_color kivy.utils.get_hex_from_color
<TestAnimationCard@BoxLayout>
orientation: 'vertical'
padding: dp(10)
spacing: dp(10)
size_hint_y: None
height: self.minimum_height
BoxLayout:
size_hint_y: None
height: self.minimum_height
Widget:
MDRoundFlatButton:
text: "Free call"
Widget:
MDRoundFlatButton:
text: "Free message"
Widget:
OneLineIconListItem:
text: "Video call"
IconLeftSampleWidget:
icon: 'camera-front-variant'
TwoLineIconListItem:
text: "Call Viber Out"
secondary_text: "[color=%s]Advantageous rates for calls[/color]" % get_hex_from_color(app.theme_cls.primary_color)
IconLeftSampleWidget:
icon: 'phone'
TwoLineIconListItem:
text: "Call over mobile network"
secondary_text: "[color=%s]Operator's tariffs apply[/color]" % get_hex_from_color(app.theme_cls.primary_color)
IconLeftSampleWidget:
icon: 'remote'
''')
class IconLeftSampleWidget(ILeftBodyTouch, MDIconButton):
pass
class Example(MDApp):
title = "Example Animation Card"
def __init__(self, **kwargs):
super().__init__(**kwargs)
self.user_animation_card = None
def build(self):
def main_back_callback():
toast('Close card')
if not self.user_animation_card:
self.user_animation_card = MDUserAnimationCard(
user_name="Lion Lion",
path_to_avatar="./assets/african-lion-951778_1280.jpg",
callback=main_back_callback)
self.user_animation_card.box_content.add_widget(
Factory.TestAnimationCard())
self.user_animation_card.open()
Example().run()
"""
from kivy.clock import Clock
from kivy.animation import Animation
from kivy.core.window import Window
from kivy.metrics import dp, sp
from kivy.properties import ObjectProperty, StringProperty, ListProperty
from kivy.lang import Builder
from kivy.uix.boxlayout import BoxLayout
from kivy.uix.floatlayout import FloatLayout
from kivy.uix.modalview import ModalView
from kivymd.uix.behaviors import SpecificBackgroundColorBehavior
from kivymd.uix.button import MDIconButton
from kivymd.theming import ThemableBehavior
Builder.load_string(
"""
#:import Window kivy.core.window.Window
#:import StiffScrollEffect kivymd.stiffscroll.StiffScrollEffect
<ModifiedToolbar>
size_hint_y: None
height: root.theme_cls.standard_increment
padding: [root.theme_cls.horizontal_margins - dp(12), 0]
BoxLayout:
id: left_actions
orientation: 'horizontal'
size_hint_x: None
padding: [0, (self.height - dp(48))/2]
BoxLayout:
padding: dp(12), 0
MDLabel:
font_style: 'H6'
opposite_colors: root.opposite_colors
theme_text_color: 'Custom'
text_color: root.specific_text_color
text: root.title
shorten: True
shorten_from: 'right'
BoxLayout:
id: right_actions
orientation: 'horizontal'
size_hint_x: None
padding: [0, (self.height - dp(48))/2]
<UserAnimationCard>
canvas:
Color:
rgba:
root.theme_cls.bg_dark \
if root.theme_cls.theme_style == 'Dark' \
else root.theme_cls.bg_light
Rectangle:
size: self.size
pos: self.pos
FitImage:
id: image
source: root.path_to_avatar
size_hint: 1, None
height: Window.height * 40 // 100
y: Window.height - self.height
allow_stretch: True
keep_ratio: False
canvas.after:
Color:
rgba: root._primary_color
Rectangle:
size: self.size
pos: self.pos
MDLabel:
id: user_name
font_style: 'H4'
theme_text_color: 'Custom'
color: 1, 1, 1, 1
shorten: True
shorten_from: 'right'
text: root.user_name
size_hint_y: None
height: self.texture_size[1]
ModifiedToolbar:
id: toolbar
md_bg_color: 0, 0, 0, 0
left_action_items: [['arrow-left', lambda x: root._callback_back()]]
y: Window.height - self.height
ScrollView:
id: scroll
y: -image.height
effect_cls: StiffScrollEffect
scroll_distance: 100
GridLayout:
id: box_content
size_hint_y: None
height: self.minimum_height
cols: 1
canvas:
Color:
rgba:
root.theme_cls.bg_dark \
if root.theme_cls.theme_style == 'Dark' \
else root.theme_cls.bg_light
Rectangle:
size: self.size
pos: self.pos
"""
)
class MDUserAnimationCard(ThemableBehavior, ModalView):
user_name = StringProperty()
path_to_avatar = StringProperty()
box_content = ObjectProperty()
callback = ObjectProperty()
_anim_bottom = True
def __init__(self, **kwargs):
super().__init__(**kwargs)
self._primary_color = self.theme_cls.primary_color
self._primary_color[3] = 0
self.user_animation_card = UserAnimationCard(
user_name=self.user_name,
path_to_avatar=self.path_to_avatar,
_callback_back=self._callback_back,
_primary_color=self._primary_color,
)
self.user_animation_card.ids.user_name.pos = (
dp(15),
Window.height - self.user_animation_card.ids.image.height,
)
self.box_content = self.user_animation_card.ids.box_content
self.add_widget(self.user_animation_card)
self._obj_avatar = self.user_animation_card.ids.image
self._obj_user_name = self.user_animation_card.ids.user_name
self._obj_toolbar = self.user_animation_card.ids.toolbar
self._obj_scroll = self.user_animation_card.ids.scroll
self._set_current_pos_objects()
def _callback_back(self):
self.dismiss()
if self.callback:
self.callback()
def on_open(self):
self._primary_color = self.theme_cls.primary_color
self._primary_color[3] = 0
self.user_animation_card._primary_color = self._primary_color
def _set_current_pos_objects(self):
self._avatar_y = self._obj_avatar.y
self._toolbar_y = self._obj_toolbar.y
self._user_name_y = self._obj_user_name.y
self._scroll_y = self._obj_scroll.y
def on_touch_move(self, touch):
if touch.ud["swipe_begin"] < touch.y:
if self._anim_bottom:
self._anim_bottom = False
self.animation_to_top()
else:
if not self._anim_bottom:
self._anim_bottom = True
self.animation_to_bottom()
def on_touch_down(self, touch):
touch.ud["swipe_begin"] = touch.y
return super().on_touch_down(touch)
def on_touch_up(self, touch):
touch.ud["swipe_begin"] = 0
def animation_to_bottom(self):
Animation(y=self._scroll_y, d=0.4, t="in_out_cubic").start(
self._obj_scroll
)
Animation(y=self._user_name_y, d=0.5, x=dp(15), t="in_out_cubic").start(
self._obj_user_name
)
Animation(font_size=sp(36), d=0.3, t="in_out_cubic").start(
self._obj_user_name
)
Animation(_primary_color=[0, 0, 0, 0], d=0.3, t="in_out_cubic").start(
self.user_animation_card
)
Animation(y=self._avatar_y, d=0.4, t="in_out_cubic").start(
self._obj_avatar
)
def animation_to_top(self):
user_name_y = (
Window.height
- self._obj_toolbar.height
+ (self.theme_cls.standard_increment // 2 - dp(12))
)
user_name_x = self.theme_cls.horizontal_margins + dp(12) * 5
Animation(y=-self._obj_toolbar.height, d=0.4, t="in_out_cubic").start(
self._obj_scroll
)
Animation(y=user_name_y, d=0.3, x=user_name_x, t="in_out_cubic").start(
self._obj_user_name
)
Animation(font_size=sp(20), d=0.3, t="in_out_cubic").start(
self._obj_user_name
)
Animation(
_primary_color=self.theme_cls.primary_color, d=0.3, t="in_out_cubic"
).start(self.user_animation_card)
Animation(y=self._obj_avatar.y + 30, d=0.4, t="in_out_cubic").start(
self._obj_avatar
)
class UserAnimationCard(ThemableBehavior, FloatLayout):
user_name = StringProperty()
path_to_avatar = StringProperty()
_callback_back = ObjectProperty()
_primary_color = ListProperty()
class ModifiedToolbar(
ThemableBehavior, SpecificBackgroundColorBehavior, BoxLayout
):
left_action_items = ListProperty()
title = StringProperty()
def __init__(self, **kwargs):
super().__init__(**kwargs)
self.bind(specific_text_color=self.update_action_bar_text_colors)
Clock.schedule_once(
lambda x: self.on_left_action_items(0, self.left_action_items)
)
def on_left_action_items(self, instance, value):
self.update_action_bar(self.ids["left_actions"], value)
def update_action_bar(self, action_bar, action_bar_items):
action_bar.clear_widgets()
new_width = 0
for item in action_bar_items:
new_width += dp(48)
action_bar.add_widget(
MDIconButton(
icon=item[0],
on_release=item[1],
opposite_colors=True,
text_color=self.specific_text_color,
theme_text_color="Custom",
)
)
action_bar.width = new_width
def update_action_bar_text_colors(self, instance, value):
for child in self.ids["left_actions"].children:
child.text_color = self.specific_text_color
| 29.642857 | 122 | 0.624838 |
from kivy.clock import Clock
from kivy.animation import Animation
from kivy.core.window import Window
from kivy.metrics import dp, sp
from kivy.properties import ObjectProperty, StringProperty, ListProperty
from kivy.lang import Builder
from kivy.uix.boxlayout import BoxLayout
from kivy.uix.floatlayout import FloatLayout
from kivy.uix.modalview import ModalView
from kivymd.uix.behaviors import SpecificBackgroundColorBehavior
from kivymd.uix.button import MDIconButton
from kivymd.theming import ThemableBehavior
Builder.load_string(
"""
#:import Window kivy.core.window.Window
#:import StiffScrollEffect kivymd.stiffscroll.StiffScrollEffect
<ModifiedToolbar>
size_hint_y: None
height: root.theme_cls.standard_increment
padding: [root.theme_cls.horizontal_margins - dp(12), 0]
BoxLayout:
id: left_actions
orientation: 'horizontal'
size_hint_x: None
padding: [0, (self.height - dp(48))/2]
BoxLayout:
padding: dp(12), 0
MDLabel:
font_style: 'H6'
opposite_colors: root.opposite_colors
theme_text_color: 'Custom'
text_color: root.specific_text_color
text: root.title
shorten: True
shorten_from: 'right'
BoxLayout:
id: right_actions
orientation: 'horizontal'
size_hint_x: None
padding: [0, (self.height - dp(48))/2]
<UserAnimationCard>
canvas:
Color:
rgba:
root.theme_cls.bg_dark \
if root.theme_cls.theme_style == 'Dark' \
else root.theme_cls.bg_light
Rectangle:
size: self.size
pos: self.pos
FitImage:
id: image
source: root.path_to_avatar
size_hint: 1, None
height: Window.height * 40 // 100
y: Window.height - self.height
allow_stretch: True
keep_ratio: False
canvas.after:
Color:
rgba: root._primary_color
Rectangle:
size: self.size
pos: self.pos
MDLabel:
id: user_name
font_style: 'H4'
theme_text_color: 'Custom'
color: 1, 1, 1, 1
shorten: True
shorten_from: 'right'
text: root.user_name
size_hint_y: None
height: self.texture_size[1]
ModifiedToolbar:
id: toolbar
md_bg_color: 0, 0, 0, 0
left_action_items: [['arrow-left', lambda x: root._callback_back()]]
y: Window.height - self.height
ScrollView:
id: scroll
y: -image.height
effect_cls: StiffScrollEffect
scroll_distance: 100
GridLayout:
id: box_content
size_hint_y: None
height: self.minimum_height
cols: 1
canvas:
Color:
rgba:
root.theme_cls.bg_dark \
if root.theme_cls.theme_style == 'Dark' \
else root.theme_cls.bg_light
Rectangle:
size: self.size
pos: self.pos
"""
)
class MDUserAnimationCard(ThemableBehavior, ModalView):
user_name = StringProperty()
path_to_avatar = StringProperty()
box_content = ObjectProperty()
callback = ObjectProperty()
_anim_bottom = True
def __init__(self, **kwargs):
super().__init__(**kwargs)
self._primary_color = self.theme_cls.primary_color
self._primary_color[3] = 0
self.user_animation_card = UserAnimationCard(
user_name=self.user_name,
path_to_avatar=self.path_to_avatar,
_callback_back=self._callback_back,
_primary_color=self._primary_color,
)
self.user_animation_card.ids.user_name.pos = (
dp(15),
Window.height - self.user_animation_card.ids.image.height,
)
self.box_content = self.user_animation_card.ids.box_content
self.add_widget(self.user_animation_card)
self._obj_avatar = self.user_animation_card.ids.image
self._obj_user_name = self.user_animation_card.ids.user_name
self._obj_toolbar = self.user_animation_card.ids.toolbar
self._obj_scroll = self.user_animation_card.ids.scroll
self._set_current_pos_objects()
def _callback_back(self):
self.dismiss()
if self.callback:
self.callback()
def on_open(self):
self._primary_color = self.theme_cls.primary_color
self._primary_color[3] = 0
self.user_animation_card._primary_color = self._primary_color
def _set_current_pos_objects(self):
self._avatar_y = self._obj_avatar.y
self._toolbar_y = self._obj_toolbar.y
self._user_name_y = self._obj_user_name.y
self._scroll_y = self._obj_scroll.y
def on_touch_move(self, touch):
if touch.ud["swipe_begin"] < touch.y:
if self._anim_bottom:
self._anim_bottom = False
self.animation_to_top()
else:
if not self._anim_bottom:
self._anim_bottom = True
self.animation_to_bottom()
def on_touch_down(self, touch):
touch.ud["swipe_begin"] = touch.y
return super().on_touch_down(touch)
def on_touch_up(self, touch):
touch.ud["swipe_begin"] = 0
def animation_to_bottom(self):
Animation(y=self._scroll_y, d=0.4, t="in_out_cubic").start(
self._obj_scroll
)
Animation(y=self._user_name_y, d=0.5, x=dp(15), t="in_out_cubic").start(
self._obj_user_name
)
Animation(font_size=sp(36), d=0.3, t="in_out_cubic").start(
self._obj_user_name
)
Animation(_primary_color=[0, 0, 0, 0], d=0.3, t="in_out_cubic").start(
self.user_animation_card
)
Animation(y=self._avatar_y, d=0.4, t="in_out_cubic").start(
self._obj_avatar
)
def animation_to_top(self):
user_name_y = (
Window.height
- self._obj_toolbar.height
+ (self.theme_cls.standard_increment // 2 - dp(12))
)
user_name_x = self.theme_cls.horizontal_margins + dp(12) * 5
Animation(y=-self._obj_toolbar.height, d=0.4, t="in_out_cubic").start(
self._obj_scroll
)
Animation(y=user_name_y, d=0.3, x=user_name_x, t="in_out_cubic").start(
self._obj_user_name
)
Animation(font_size=sp(20), d=0.3, t="in_out_cubic").start(
self._obj_user_name
)
Animation(
_primary_color=self.theme_cls.primary_color, d=0.3, t="in_out_cubic"
).start(self.user_animation_card)
Animation(y=self._obj_avatar.y + 30, d=0.4, t="in_out_cubic").start(
self._obj_avatar
)
class UserAnimationCard(ThemableBehavior, FloatLayout):
user_name = StringProperty()
path_to_avatar = StringProperty()
_callback_back = ObjectProperty()
_primary_color = ListProperty()
class ModifiedToolbar(
ThemableBehavior, SpecificBackgroundColorBehavior, BoxLayout
):
left_action_items = ListProperty()
title = StringProperty()
def __init__(self, **kwargs):
super().__init__(**kwargs)
self.bind(specific_text_color=self.update_action_bar_text_colors)
Clock.schedule_once(
lambda x: self.on_left_action_items(0, self.left_action_items)
)
def on_left_action_items(self, instance, value):
self.update_action_bar(self.ids["left_actions"], value)
def update_action_bar(self, action_bar, action_bar_items):
action_bar.clear_widgets()
new_width = 0
for item in action_bar_items:
new_width += dp(48)
action_bar.add_widget(
MDIconButton(
icon=item[0],
on_release=item[1],
opposite_colors=True,
text_color=self.specific_text_color,
theme_text_color="Custom",
)
)
action_bar.width = new_width
def update_action_bar_text_colors(self, instance, value):
for child in self.ids["left_actions"].children:
child.text_color = self.specific_text_color
| true | true |
f702bcd10e528ab743515c3efc44683485009bd7 | 1,733 | py | Python | app/api/resources/validators.py | eLemmings/back | ba5dbc5f64625b61150ce53f12a9393fba060f02 | [
"MIT"
] | null | null | null | app/api/resources/validators.py | eLemmings/back | ba5dbc5f64625b61150ce53f12a9393fba060f02 | [
"MIT"
] | null | null | null | app/api/resources/validators.py | eLemmings/back | ba5dbc5f64625b61150ce53f12a9393fba060f02 | [
"MIT"
] | null | null | null | # Moduł definiujący walidatory API
from marshmallow import Schema, fields, validate
fields.Email.default_error_messages['required'] = 'Email jest wymagany'
fields.Email.default_error_messages['invalid'] = 'Niepoprawny adres email'
class VUser(Schema):
# Walidator rejestracji
nick = fields.String(
required=True, validate=validate.Length(min=4, max=30, error='Login musi mieć 4 - 30 znaków'))
email = fields.Email(required=True)
password = fields.String(
required=True, validate=validate.Length(min=8, max=30, error='Hasło musi mieć 8 - 30 znakow'))
class VUserLogin(Schema):
# Walidator logowania
email = fields.Email(required=True)
password = fields.String(
required=True, validate=validate.Length(min=8, max=30, error='Hasło jest wymagane'))
class VEmail(Schema):
# Walidator adresu email
email = fields.Email(required=True)
class VUserPatch(Schema):
# Walidator zapytania o zmianę pól w rekordzie użytkownika
field = fields.String(required=True, validate=validate.OneOf(['nick']))
value = fields.String(required=True)
class VEntry(Schema):
# Walidator wpisu w dzienniku
value = fields.Number(required=True)
description = fields.String()
class VDiary(Schema):
# Walidator dziennika
name = fields.String(required=True)
max = fields.Number(required=True)
date = fields.Number()
color = fields.String(validate=validate.Regexp("#[0-9a-fA-F]{6}"))
entries = fields.List(fields.Nested(VEntry), required=True)
class VJson(Schema):
# Walidator danych JSON
diaries = fields.List(fields.Nested(VDiary))
class VDiaryIndex(Schema):
# Walidator indexu dziennika
index = fields.Integer(required=True)
| 28.883333 | 102 | 0.713791 |
from marshmallow import Schema, fields, validate
fields.Email.default_error_messages['required'] = 'Email jest wymagany'
fields.Email.default_error_messages['invalid'] = 'Niepoprawny adres email'
class VUser(Schema):
nick = fields.String(
required=True, validate=validate.Length(min=4, max=30, error='Login musi mieć 4 - 30 znaków'))
email = fields.Email(required=True)
password = fields.String(
required=True, validate=validate.Length(min=8, max=30, error='Hasło musi mieć 8 - 30 znakow'))
class VUserLogin(Schema):
email = fields.Email(required=True)
password = fields.String(
required=True, validate=validate.Length(min=8, max=30, error='Hasło jest wymagane'))
class VEmail(Schema):
email = fields.Email(required=True)
class VUserPatch(Schema):
field = fields.String(required=True, validate=validate.OneOf(['nick']))
value = fields.String(required=True)
class VEntry(Schema):
value = fields.Number(required=True)
description = fields.String()
class VDiary(Schema):
name = fields.String(required=True)
max = fields.Number(required=True)
date = fields.Number()
color = fields.String(validate=validate.Regexp("#[0-9a-fA-F]{6}"))
entries = fields.List(fields.Nested(VEntry), required=True)
class VJson(Schema):
diaries = fields.List(fields.Nested(VDiary))
class VDiaryIndex(Schema):
index = fields.Integer(required=True)
| true | true |
f702bd8bccda922a4d40e754a378080f65315f49 | 2,869 | py | Python | option.py | ISKU/BOJ-Solutions-Downloader | 2277b2d00204ea47c1a086438100b6057daaa244 | [
"MIT"
] | 2 | 2019-01-04T18:48:23.000Z | 2019-10-27T10:48:09.000Z | option.py | ISKU/BOJ-Solutions-Downloader | 2277b2d00204ea47c1a086438100b6057daaa244 | [
"MIT"
] | null | null | null | option.py | ISKU/BOJ-Solutions-Downloader | 2277b2d00204ea47c1a086438100b6057daaa244 | [
"MIT"
] | null | null | null | class Option:
def __init__(self, option_info):
self.option_info = option_info
self.flag = option_info['flag']
def mkdir(self):
if self.flag == False:
return False
return self.option_info['mkdir']
def dir_name(self, problem):
if self.flag == False:
return ''
if not self.mkdir():
return ''
return self.replace_name(self.option_info['dir_name'], problem) + '/'
def source_name(self, problem):
if self.flag == False:
return problem['problem_id']
return self.replace_info(self.option_info['source_name'], problem)
def replace_name(self, value, problem):
value = value.replace('[NO]', problem['problem_id'])
value = value.replace('[TITLE]', problem['problem_title'])
return value
def get_ext(self, language):
extensions = {
'C': '.c',
'C++': '.cpp',
'C++11': '.cpp',
'C++14': '.cpp',
'C++17': '.cpp',
'Java': '.java',
'Java (OpenJDK)': '.java',
'C11': '.c',
'Python 2': '.py',
'Python 3': '.py',
'PyPy2': '.py',
'PyPy3': '.py',
'Ruby2.5': '.rb',
'Kotlin': '.kt',
'Swift': '.swift',
'C# 6.0': '.cs',
'Text': '.txt',
'node.js': 'js',
'Go': '.go',
'F#': '.fs',
'PHP': '.php',
'Pascal': '.pas',
'Lua': '.lua',
'Perl': '.pl',
'Objective-C': '.m',
'Objective-C++': '.mm',
'C (Clang)': '.c',
'C++11 (Clang)': '.cpp',
'C++14 (Clang)': '.cpp',
'C++17 (Clang)': '.cpp',
'Golfscript': '.gs',
'Bash': '.sh',
'Fortran': '.f95',
'Scheme': '.scm',
'Ada': '.ada',
'awk': '.awk',
'OCaml': '.ml',
'Brainfuck': '.bf',
'Whitespace': '.ws',
'Tcl': '.tcl',
'Assembly (32bit)': '.asm',
'Assembly (32bit)': '.asm',
'D': '.d',
'Clojure': '.clj',
'Rhino': '.js',
'Cobol': '.cob',
'SpiderMonkey': '.js',
'Pike': '.pike',
'sed': '.sed',
'Rust': '.rs',
'Boo': '.boo',
'Intercal': '.i',
'bc': '.bc',
'Nemerle': '.n',
'Cobra': '.cobra',
'Algol 68': '.a68',
'Befunge': '.bf',
'Haxe': '.hx',
'LOLCODE': '.lol',
'VB.NET 4.0': '.vb',
'아희': '.aheui'
}
if not language in extensions:
return True, 'Unknown extension'
return False, extensions[language]
| 29.57732 | 77 | 0.385849 | class Option:
def __init__(self, option_info):
self.option_info = option_info
self.flag = option_info['flag']
def mkdir(self):
if self.flag == False:
return False
return self.option_info['mkdir']
def dir_name(self, problem):
if self.flag == False:
return ''
if not self.mkdir():
return ''
return self.replace_name(self.option_info['dir_name'], problem) + '/'
def source_name(self, problem):
if self.flag == False:
return problem['problem_id']
return self.replace_info(self.option_info['source_name'], problem)
def replace_name(self, value, problem):
value = value.replace('[NO]', problem['problem_id'])
value = value.replace('[TITLE]', problem['problem_title'])
return value
def get_ext(self, language):
extensions = {
'C': '.c',
'C++': '.cpp',
'C++11': '.cpp',
'C++14': '.cpp',
'C++17': '.cpp',
'Java': '.java',
'Java (OpenJDK)': '.java',
'C11': '.c',
'Python 2': '.py',
'Python 3': '.py',
'PyPy2': '.py',
'PyPy3': '.py',
'Ruby2.5': '.rb',
'Kotlin': '.kt',
'Swift': '.swift',
'C# 6.0': '.cs',
'Text': '.txt',
'node.js': 'js',
'Go': '.go',
'F#': '.fs',
'PHP': '.php',
'Pascal': '.pas',
'Lua': '.lua',
'Perl': '.pl',
'Objective-C': '.m',
'Objective-C++': '.mm',
'C (Clang)': '.c',
'C++11 (Clang)': '.cpp',
'C++14 (Clang)': '.cpp',
'C++17 (Clang)': '.cpp',
'Golfscript': '.gs',
'Bash': '.sh',
'Fortran': '.f95',
'Scheme': '.scm',
'Ada': '.ada',
'awk': '.awk',
'OCaml': '.ml',
'Brainfuck': '.bf',
'Whitespace': '.ws',
'Tcl': '.tcl',
'Assembly (32bit)': '.asm',
'Assembly (32bit)': '.asm',
'D': '.d',
'Clojure': '.clj',
'Rhino': '.js',
'Cobol': '.cob',
'SpiderMonkey': '.js',
'Pike': '.pike',
'sed': '.sed',
'Rust': '.rs',
'Boo': '.boo',
'Intercal': '.i',
'bc': '.bc',
'Nemerle': '.n',
'Cobra': '.cobra',
'Algol 68': '.a68',
'Befunge': '.bf',
'Haxe': '.hx',
'LOLCODE': '.lol',
'VB.NET 4.0': '.vb',
'아희': '.aheui'
}
if not language in extensions:
return True, 'Unknown extension'
return False, extensions[language]
| true | true |
f702bdf164ec4134439d875a2ad83515cbba5787 | 5,769 | py | Python | torch/ao/quantization/fuse_modules.py | WBobby/pytorch | 655960460ccca936fa5c06df6bbafd25b5582115 | [
"Intel"
] | 24 | 2020-11-02T21:25:12.000Z | 2022-03-17T07:20:33.000Z | torch/ao/quantization/fuse_modules.py | WBobby/pytorch | 655960460ccca936fa5c06df6bbafd25b5582115 | [
"Intel"
] | 1 | 2019-08-01T00:17:43.000Z | 2019-09-12T01:31:53.000Z | torch/ao/quantization/fuse_modules.py | WBobby/pytorch | 655960460ccca936fa5c06df6bbafd25b5582115 | [
"Intel"
] | 12 | 2020-11-06T05:00:37.000Z | 2022-01-30T19:17:36.000Z |
import copy
import torch.nn as nn
from torch.quantization.fuser_method_mappings import get_fuser_method
# for backward compatiblity
from torch.quantization.fuser_method_mappings import fuse_conv_bn # noqa: F401
from torch.quantization.fuser_method_mappings import fuse_conv_bn_relu # noqa: F401
from typing import List, Optional
# Generalization of getattr
def _get_module(model, submodule_key):
tokens = submodule_key.split('.')
cur_mod = model
for s in tokens:
cur_mod = getattr(cur_mod, s)
return cur_mod
# Generalization of setattr
def _set_module(model, submodule_key, module):
tokens = submodule_key.split('.')
sub_tokens = tokens[:-1]
cur_mod = model
for s in sub_tokens:
cur_mod = getattr(cur_mod, s)
setattr(cur_mod, tokens[-1], module)
def fuse_known_modules(mod_list, additional_fuser_method_mapping=None):
r"""Returns a list of modules that fuses the operations specified
in the input module list.
Fuses only the following sequence of modules:
conv, bn
conv, bn, relu
conv, relu
linear, bn
linear, relu
For these sequences, the first element in the output module list performs
the fused operation. The rest of the elements are set to nn.Identity()
"""
types = tuple(type(m) for m in mod_list)
fuser_method = get_fuser_method(types, additional_fuser_method_mapping)
if fuser_method is None:
raise NotImplementedError("Cannot fuse modules: {}".format(types))
new_mod : List[Optional[nn.Module]] = [None] * len(mod_list)
fused = fuser_method(*mod_list)
# NOTE: forward hooks not processed in the two following for loops will be lost after the fusion
# Move pre forward hooks of the base module to resulting fused module
for handle_id, pre_hook_fn in mod_list[0]._forward_pre_hooks.items():
fused.register_forward_pre_hook(pre_hook_fn)
del mod_list[0]._forward_pre_hooks[handle_id]
# Move post forward hooks of the last module to resulting fused module
for handle_id, hook_fn in mod_list[-1]._forward_hooks.items():
fused.register_forward_hook(hook_fn)
del mod_list[-1]._forward_hooks[handle_id]
new_mod[0] = fused
for i in range(1, len(mod_list)):
identity = nn.Identity()
identity.training = mod_list[0].training
new_mod[i] = identity
return new_mod
def _fuse_modules(model, modules_to_fuse, fuser_func=fuse_known_modules, fuse_custom_config_dict=None):
if fuse_custom_config_dict is None:
fuse_custom_config_dict = {}
additional_fuser_method_mapping = fuse_custom_config_dict.get("additional_fuser_method_mapping", {})
mod_list = []
for item in modules_to_fuse:
mod_list.append(_get_module(model, item))
# Fuse list of modules
new_mod_list = fuser_func(mod_list, additional_fuser_method_mapping)
# Replace original module list with fused module list
for i, item in enumerate(modules_to_fuse):
_set_module(model, item, new_mod_list[i])
def fuse_modules(model, modules_to_fuse, inplace=False, fuser_func=fuse_known_modules, fuse_custom_config_dict=None):
r"""Fuses a list of modules into a single module
Fuses only the following sequence of modules:
conv, bn
conv, bn, relu
conv, relu
linear, relu
bn, relu
All other sequences are left unchanged.
For these sequences, replaces the first item in the list
with the fused module, replacing the rest of the modules
with identity.
Args:
model: Model containing the modules to be fused
modules_to_fuse: list of list of module names to fuse. Can also be a list
of strings if there is only a single list of modules to fuse.
inplace: bool specifying if fusion happens in place on the model, by default
a new model is returned
fuser_func: Function that takes in a list of modules and outputs a list of fused modules
of the same length. For example,
fuser_func([convModule, BNModule]) returns the list [ConvBNModule, nn.Identity()]
Defaults to torch.quantization.fuse_known_modules
`fuse_custom_config_dict`: custom configuration for fusion
.. code-block:: python
# Example of fuse_custom_config_dict
fuse_custom_config_dict = {
# Additional fuser_method mapping
"additional_fuser_method_mapping": {
(torch.nn.Conv2d, torch.nn.BatchNorm2d): fuse_conv_bn
},
}
Returns:
model with fused modules. A new copy is created if inplace=True.
Examples::
>>> m = myModel()
>>> # m is a module containing the sub-modules below
>>> modules_to_fuse = [ ['conv1', 'bn1', 'relu1'], ['submodule.conv', 'submodule.relu']]
>>> fused_m = torch.ao.quantization.fuse_modules(m, modules_to_fuse)
>>> output = fused_m(input)
>>> m = myModel()
>>> # Alternately provide a single list of modules to fuse
>>> modules_to_fuse = ['conv1', 'bn1', 'relu1']
>>> fused_m = torch.ao.quantization.fuse_modules(m, modules_to_fuse)
>>> output = fused_m(input)
"""
if not inplace:
model = copy.deepcopy(model)
if all(isinstance(module_element, str) for module_element in modules_to_fuse):
# Handle case of modules_to_fuse being a list
_fuse_modules(model, modules_to_fuse, fuser_func, fuse_custom_config_dict)
else:
# Handle case of modules_to_fuse being a list of lists
for module_list in modules_to_fuse:
_fuse_modules(model, module_list, fuser_func, fuse_custom_config_dict)
return model
| 38.97973 | 117 | 0.688508 |
import copy
import torch.nn as nn
from torch.quantization.fuser_method_mappings import get_fuser_method
from torch.quantization.fuser_method_mappings import fuse_conv_bn
from torch.quantization.fuser_method_mappings import fuse_conv_bn_relu
from typing import List, Optional
def _get_module(model, submodule_key):
tokens = submodule_key.split('.')
cur_mod = model
for s in tokens:
cur_mod = getattr(cur_mod, s)
return cur_mod
def _set_module(model, submodule_key, module):
tokens = submodule_key.split('.')
sub_tokens = tokens[:-1]
cur_mod = model
for s in sub_tokens:
cur_mod = getattr(cur_mod, s)
setattr(cur_mod, tokens[-1], module)
def fuse_known_modules(mod_list, additional_fuser_method_mapping=None):
types = tuple(type(m) for m in mod_list)
fuser_method = get_fuser_method(types, additional_fuser_method_mapping)
if fuser_method is None:
raise NotImplementedError("Cannot fuse modules: {}".format(types))
new_mod : List[Optional[nn.Module]] = [None] * len(mod_list)
fused = fuser_method(*mod_list)
for handle_id, pre_hook_fn in mod_list[0]._forward_pre_hooks.items():
fused.register_forward_pre_hook(pre_hook_fn)
del mod_list[0]._forward_pre_hooks[handle_id]
for handle_id, hook_fn in mod_list[-1]._forward_hooks.items():
fused.register_forward_hook(hook_fn)
del mod_list[-1]._forward_hooks[handle_id]
new_mod[0] = fused
for i in range(1, len(mod_list)):
identity = nn.Identity()
identity.training = mod_list[0].training
new_mod[i] = identity
return new_mod
def _fuse_modules(model, modules_to_fuse, fuser_func=fuse_known_modules, fuse_custom_config_dict=None):
if fuse_custom_config_dict is None:
fuse_custom_config_dict = {}
additional_fuser_method_mapping = fuse_custom_config_dict.get("additional_fuser_method_mapping", {})
mod_list = []
for item in modules_to_fuse:
mod_list.append(_get_module(model, item))
new_mod_list = fuser_func(mod_list, additional_fuser_method_mapping)
for i, item in enumerate(modules_to_fuse):
_set_module(model, item, new_mod_list[i])
def fuse_modules(model, modules_to_fuse, inplace=False, fuser_func=fuse_known_modules, fuse_custom_config_dict=None):
if not inplace:
model = copy.deepcopy(model)
if all(isinstance(module_element, str) for module_element in modules_to_fuse):
_fuse_modules(model, modules_to_fuse, fuser_func, fuse_custom_config_dict)
else:
for module_list in modules_to_fuse:
_fuse_modules(model, module_list, fuser_func, fuse_custom_config_dict)
return model
| true | true |
f702c178fa0468bda62c777ae3343f3ff32258d0 | 2,947 | py | Python | idaes/apps/ripe/__init__.py | OOAmusat/idaes-pse | ae7d3bb8e372bc32822dcdcb75e9fd96b78da539 | [
"RSA-MD"
] | null | null | null | idaes/apps/ripe/__init__.py | OOAmusat/idaes-pse | ae7d3bb8e372bc32822dcdcb75e9fd96b78da539 | [
"RSA-MD"
] | null | null | null | idaes/apps/ripe/__init__.py | OOAmusat/idaes-pse | ae7d3bb8e372bc32822dcdcb75e9fd96b78da539 | [
"RSA-MD"
] | 1 | 2022-03-17T11:08:43.000Z | 2022-03-17T11:08:43.000Z | #################################################################################
# The Institute for the Design of Advanced Energy Systems Integrated Platform
# Framework (IDAES IP) was produced under the DOE Institute for the
# Design of Advanced Energy Systems (IDAES), and is copyright (c) 2018-2021
# by the software owners: The Regents of the University of California, through
# Lawrence Berkeley National Laboratory, National Technology & Engineering
# Solutions of Sandia, LLC, Carnegie Mellon University, West Virginia University
# Research Corporation, et al. All rights reserved.
#
# Please see the files COPYRIGHT.md and LICENSE.md for full copyright and
# license information.
#################################################################################
"""
# Institute for the Design of Advanced Energy Systems Process Systems
# Engineering Framework (IDAES PSE Framework) Copyright (c) 2018, by the
# software owners: The Regents of the University of California, through
# Lawrence Berkeley National Laboratory, National Technology & Engineering
# Solutions of Sandia, LLC, Carnegie Mellon University, West Virginia
# University Research Corporation, et al. All rights reserved.
#
# Please see the files COPYRIGHT.txt and LICENSE.txt for full copyright and
# license information, respectively. Both files are also available online
# at the URL "https://github.com/IDAES/idaes".
"""
__all__ = [
"ripemodel",
"ems",
"rspace",
"sharedata",
"debug",
"powerlawp5",
"powerlaw2",
"powerlaw3",
"powerlaw4",
"avrami2",
"avrami3",
"avrami4",
"avrami5",
"randomnuc",
"ptompkins",
"jander",
"antijander",
"valensi",
"parabolic",
"gb3d",
"zlt",
"grain",
# PYLINT-TODO-FIX: this seems to be a genuine error since "massact" is not imported from .mechs
"massact", # pylint: disable=undefined-all-variable
"massactm",
"getmechs",
]
from .main import ripemodel, ripewrite, print_results # noqa: F401
from .shared import rspace, sharedata, debug # noqa: F401
from .atermconstruct import (
makeaterm,
formatinputs,
checkargs,
normalizefeatures,
) # noqa: F401
from .kinforms import lin, linjac, arr, arrjac, refarr, refarrjac # noqa: F401
from .mechs import (
powerlawp5,
powerlaw2,
powerlaw3,
powerlaw4,
avrami2,
avrami3,
avrami4,
avrami5,
randomnuc,
ptompkins,
jander,
antijander,
valensi,
parabolic,
gb3d,
zlt,
grain,
getmechs,
massactm,
) # noqa: F401
from .genpyomo import ripeomo # noqa: F401
from .targets import (
doalamo,
dopwalamo,
gentargets,
sstargets,
dynamictargets,
) # noqa: F401
from .confinv import confinv # noqa: F401
from .emsampling import constructmodel, ems # noqa: F401
from .checkoptions import checkoptions # noqa: F401
from .bounds import stoich_cons, count_neg, get_bounds # noqa: F401
| 30.697917 | 99 | 0.663386 | true | true | |
f702c1a5dc7274750e530ef4de6a21cb1e73cad8 | 1,465 | py | Python | tests/helpers/test_init.py | dauden1184/home-assistant | f4c6d389b77d0efa86644e76604eaea5d21abdb5 | [
"Apache-2.0"
] | 37 | 2018-05-22T07:17:26.000Z | 2022-03-03T13:14:46.000Z | tests/helpers/test_init.py | dauden1184/home-assistant | f4c6d389b77d0efa86644e76604eaea5d21abdb5 | [
"Apache-2.0"
] | 125 | 2018-12-11T07:31:20.000Z | 2021-07-27T08:20:03.000Z | tests/helpers/test_init.py | dauden1184/home-assistant | f4c6d389b77d0efa86644e76604eaea5d21abdb5 | [
"Apache-2.0"
] | 21 | 2017-07-26T17:09:40.000Z | 2022-03-27T22:37:22.000Z | """Test component helpers."""
# pylint: disable=protected-access
from collections import OrderedDict
import unittest
from homeassistant import helpers
from tests.common import get_test_home_assistant
class TestHelpers(unittest.TestCase):
"""Tests homeassistant.helpers module."""
# pylint: disable=invalid-name
def setUp(self):
"""Init needed objects."""
self.hass = get_test_home_assistant()
# pylint: disable=invalid-name
def tearDown(self):
"""Stop everything that was started."""
self.hass.stop()
def test_extract_domain_configs(self):
"""Test the extraction of domain configuration."""
config = {
'zone': None,
'zoner': None,
'zone ': None,
'zone Hallo': None,
'zone 100': None,
}
self.assertEqual(set(['zone', 'zone Hallo', 'zone 100']),
set(helpers.extract_domain_configs(config, 'zone')))
def test_config_per_platform(self):
"""Test config per platform method."""
config = OrderedDict([
('zone', {'platform': 'hello'}),
('zoner', None),
('zone Hallo', [1, {'platform': 'hello 2'}]),
('zone 100', None),
])
assert [
('hello', config['zone']),
(None, 1),
('hello 2', config['zone Hallo'][1]),
] == list(helpers.config_per_platform(config, 'zone'))
| 28.72549 | 77 | 0.56314 |
from collections import OrderedDict
import unittest
from homeassistant import helpers
from tests.common import get_test_home_assistant
class TestHelpers(unittest.TestCase):
def setUp(self):
self.hass = get_test_home_assistant()
def tearDown(self):
self.hass.stop()
def test_extract_domain_configs(self):
config = {
'zone': None,
'zoner': None,
'zone ': None,
'zone Hallo': None,
'zone 100': None,
}
self.assertEqual(set(['zone', 'zone Hallo', 'zone 100']),
set(helpers.extract_domain_configs(config, 'zone')))
def test_config_per_platform(self):
config = OrderedDict([
('zone', {'platform': 'hello'}),
('zoner', None),
('zone Hallo', [1, {'platform': 'hello 2'}]),
('zone 100', None),
])
assert [
('hello', config['zone']),
(None, 1),
('hello 2', config['zone Hallo'][1]),
] == list(helpers.config_per_platform(config, 'zone'))
| true | true |
f702c27587a9d8e0dceffc00ca6aaa56ec63ef6f | 3,699 | py | Python | tools/processing.py | SmolakK/HuMobi | 67b40f839a843123093582935e89f91e16bc4374 | [
"BSD-3-Clause"
] | null | null | null | tools/processing.py | SmolakK/HuMobi | 67b40f839a843123093582935e89f91e16bc4374 | [
"BSD-3-Clause"
] | null | null | null | tools/processing.py | SmolakK/HuMobi | 67b40f839a843123093582935e89f91e16bc4374 | [
"BSD-3-Clause"
] | null | null | null | import pandas as pd
import numpy as np
def top_time(ind=None, gs=None):
"""
Selects the location (by coordinates) which was visited for the longest period during given time interval
:param ind: user id
:param gs: GeoDataFrame from groupby execution containing all the data in the given time interval
:return: user id (if given) and the data for the longest visited location
"""
aggregated = []
for tstamp, g in gs: # for each record in the GeoDataFrame
if len(g) > 1: # if there is more than one record
diff_places = (g['geometry'].shift(-1) != g['geometry']).iloc[:-1] # checks when coordinates change
if diff_places.any(): # if there is change in locations
g_res = g.reset_index() # drop index
diffs = g_res.shift(-1)['datetime'] - g_res['datetime'] # find time differences (spent in location)
joined_dfs = g_res.join(diffs, rsuffix='a') # add them to locations
joined_dfs['geometry'] = g_res['geometry'].astype(str) # copy geometry as string
point_max = joined_dfs.groupby('geometry')['datetimea'].sum().idxmax() # grouping locations find the longest time sum
selected = g[g['geometry'].astype(str) == point_max] # select the location with the highest total time
else:
selected = g # if one location visited - copy GeoDataFrame
else:
selected = g
aggregated.append(selected)
if ind is None:
return pd.concat(aggregated)
else:
return ind, pd.concat(aggregated)
def mode_geoseries(ind, gs):
"""
Calculates mode for GeoSeries
:param ind: identifier
:param gs: GeoSeries
:return: identifier and a mode for GeoSeries
"""
aggregated = []
for g in gs:
if g[1].empty:
aggregated.append(None)
else:
selected = g[1].mode()
selected = selected.set_index(g[1].index)
aggregated.append(selected)
return ind, pd.concat(aggregated)
def rowwise_average(gs, row_count=None):
"""
Calculates an average for each row in each group - rowwise.
:param gs: GeoSeries
:param row_count: defines how much rows should be considered
:return: averaged GeoSeries rowwise
"""
if row_count is None:
row_count = gs.groupby(level=0).size().max()
return pd.Series([gs.groupby(level=0).nth(n).mean() for n in range(row_count)])
def groupwise_average(gs):
"""
Calculates an average from each group of GeoSeries
:param gs: GeoSeries
:return: averaged GeoSeries
"""
return gs.groupby(level=0).mean()
def groupwise_normalise(gs):
"""
Normalises each group of GeoSeries
:param gs: GeoSeries
:return: normalised GeoSeries
"""
return gs.groupby(level=0).apply(lambda x: x / x.sum())
def groupwise_expansion(gs):
"""
Calculates expanding mean for each group of GeoSeries
:param gs: GeoSeries
:return: averaged GeoSeries
"""
return gs.groupby(level=0).expanding().mean()
def total_normalise(gs):
"""
Performs complete normalisation of GeoSeries
:param gs: GeoSeries
:return: normalised GeoSeries
"""
return gs / gs.sum()
def start_end(trajectories_frame):
"""
Compresses stops in TrajectoriesFrame by adding start and end of visits in locations
:param trajectories_frame: TrajectoriesFrame object class
:return: compressed TrajectoriesFrame
"""
to_concat = []
if 'date' not in trajectories_frame.columns:
trajectories_frame['date'] = trajectories_frame.index.get_level_values(1)
for gs in trajectories_frame.groupby(level=0):
firsts = gs[1][gs[1]['geometry'].shift() != gs[1]['geometry']]
lasts = gs[1][gs[1]['geometry'].shift(-1) != gs[1]['geometry']]
firsts.loc[:, 'start'] = firsts['date']
lasts = lasts.set_index(firsts.index)
firsts.loc[:, 'end'] = lasts['date']
firsts = firsts[firsts['start'] != firsts['end']]
to_concat.append(firsts)
return pd.concat(to_concat)
| 31.347458 | 122 | 0.712625 | import pandas as pd
import numpy as np
def top_time(ind=None, gs=None):
aggregated = []
for tstamp, g in gs:
if len(g) > 1:
diff_places = (g['geometry'].shift(-1) != g['geometry']).iloc[:-1]
if diff_places.any():
g_res = g.reset_index()
diffs = g_res.shift(-1)['datetime'] - g_res['datetime']
joined_dfs = g_res.join(diffs, rsuffix='a')
joined_dfs['geometry'] = g_res['geometry'].astype(str)
point_max = joined_dfs.groupby('geometry')['datetimea'].sum().idxmax()
selected = g[g['geometry'].astype(str) == point_max]
else:
selected = g
else:
selected = g
aggregated.append(selected)
if ind is None:
return pd.concat(aggregated)
else:
return ind, pd.concat(aggregated)
def mode_geoseries(ind, gs):
aggregated = []
for g in gs:
if g[1].empty:
aggregated.append(None)
else:
selected = g[1].mode()
selected = selected.set_index(g[1].index)
aggregated.append(selected)
return ind, pd.concat(aggregated)
def rowwise_average(gs, row_count=None):
if row_count is None:
row_count = gs.groupby(level=0).size().max()
return pd.Series([gs.groupby(level=0).nth(n).mean() for n in range(row_count)])
def groupwise_average(gs):
return gs.groupby(level=0).mean()
def groupwise_normalise(gs):
return gs.groupby(level=0).apply(lambda x: x / x.sum())
def groupwise_expansion(gs):
return gs.groupby(level=0).expanding().mean()
def total_normalise(gs):
return gs / gs.sum()
def start_end(trajectories_frame):
to_concat = []
if 'date' not in trajectories_frame.columns:
trajectories_frame['date'] = trajectories_frame.index.get_level_values(1)
for gs in trajectories_frame.groupby(level=0):
firsts = gs[1][gs[1]['geometry'].shift() != gs[1]['geometry']]
lasts = gs[1][gs[1]['geometry'].shift(-1) != gs[1]['geometry']]
firsts.loc[:, 'start'] = firsts['date']
lasts = lasts.set_index(firsts.index)
firsts.loc[:, 'end'] = lasts['date']
firsts = firsts[firsts['start'] != firsts['end']]
to_concat.append(firsts)
return pd.concat(to_concat)
| true | true |
f702c2aa854a720c28f7a9cad75cc8ce2656eab8 | 36 | py | Python | show_config.py | temper8/MatBench | 1ea24d18af35b57ef2d61148709eb6d49835fe97 | [
"MIT"
] | null | null | null | show_config.py | temper8/MatBench | 1ea24d18af35b57ef2d61148709eb6d49835fe97 | [
"MIT"
] | null | null | null | show_config.py | temper8/MatBench | 1ea24d18af35b57ef2d61148709eb6d49835fe97 | [
"MIT"
] | null | null | null | import numpy as np
np.show_config() | 18 | 19 | 0.777778 | import numpy as np
np.show_config() | true | true |
f702c2d50f706742af9223282c2024342b6a82c5 | 897 | py | Python | Output.py | itsayeshanaeem/WCPSAccess | 12b7a2f28a0f849a42336357723a57b6cb5905c9 | [
"CNRI-Python"
] | null | null | null | Output.py | itsayeshanaeem/WCPSAccess | 12b7a2f28a0f849a42336357723a57b6cb5905c9 | [
"CNRI-Python"
] | null | null | null | Output.py | itsayeshanaeem/WCPSAccess | 12b7a2f28a0f849a42336357723a57b6cb5905c9 | [
"CNRI-Python"
] | null | null | null | from PIL import Image as im
import numpy as np
from io import BytesIO
import csv
class outputResponse():
def __init__(self,reponse):
self.response = reponse
def retrieveResult(response, returntype):
if (returntype == "image/png" or returntype == "image/jpeg"):
img_arr = np.array(im.open(BytesIO(response.content)))
data = im.fromarray(img_arr)
data.show()
elif (returntype == "text/csv"):
response = response.content.decode('utf-8')
my_list = response.split (",")
with open ('x.csv', 'w') as file:
writer = csv.writer(file, delimiter = ',')
writer.writerow(my_list)
elif (returntype == 1 or returntype == 0):
print(response.content)
else:
response = response.content.decode('utf-8')
print (response)
| 30.931034 | 69 | 0.571906 | from PIL import Image as im
import numpy as np
from io import BytesIO
import csv
class outputResponse():
def __init__(self,reponse):
self.response = reponse
def retrieveResult(response, returntype):
if (returntype == "image/png" or returntype == "image/jpeg"):
img_arr = np.array(im.open(BytesIO(response.content)))
data = im.fromarray(img_arr)
data.show()
elif (returntype == "text/csv"):
response = response.content.decode('utf-8')
my_list = response.split (",")
with open ('x.csv', 'w') as file:
writer = csv.writer(file, delimiter = ',')
writer.writerow(my_list)
elif (returntype == 1 or returntype == 0):
print(response.content)
else:
response = response.content.decode('utf-8')
print (response)
| true | true |
f702c446130e944a036310a43721bc766a7a5bdb | 766 | py | Python | tests/test_types_file.py | betasewer/machaon | 63ccb4405ac693f14f9d25f6a706466a917dddbf | [
"MIT"
] | 2 | 2020-07-05T08:39:12.000Z | 2022-01-19T22:08:21.000Z | tests/test_types_file.py | betasewer/machaon | 63ccb4405ac693f14f9d25f6a706466a917dddbf | [
"MIT"
] | 23 | 2020-06-23T16:18:17.000Z | 2021-12-29T09:56:48.000Z | tests/test_types_file.py | betasewer/machaon | 63ccb4405ac693f14f9d25f6a706466a917dddbf | [
"MIT"
] | null | null | null | import pytest
import os
from machaon.types.file import TextFile
from machaon.types.shell import Path
from machaon.core.invocation import instant_return_test, instant_context
def test_construct(tmp_path):
FILEPATH = Path(__file__)
context = instant_context()
context.define_type(TextFile)
f = instant_return_test(context, FILEPATH, "TextFile").value
assert isinstance(f, TextFile)
assert isinstance(f.path(), Path)
assert f.pathstr == FILEPATH.get()
p = Path(tmp_path) / "hello.txt"
f = instant_return_test(context, p, "TextFile").value
f.set_encoding("utf-8")
assert f.encoding() == "utf-8"
with f.open("w"):
f.stream.write("HELLO\n")
f.stream.write("WORLD")
assert f.text() == "HELLO\nWORLD"
| 28.37037 | 72 | 0.693211 | import pytest
import os
from machaon.types.file import TextFile
from machaon.types.shell import Path
from machaon.core.invocation import instant_return_test, instant_context
def test_construct(tmp_path):
FILEPATH = Path(__file__)
context = instant_context()
context.define_type(TextFile)
f = instant_return_test(context, FILEPATH, "TextFile").value
assert isinstance(f, TextFile)
assert isinstance(f.path(), Path)
assert f.pathstr == FILEPATH.get()
p = Path(tmp_path) / "hello.txt"
f = instant_return_test(context, p, "TextFile").value
f.set_encoding("utf-8")
assert f.encoding() == "utf-8"
with f.open("w"):
f.stream.write("HELLO\n")
f.stream.write("WORLD")
assert f.text() == "HELLO\nWORLD"
| true | true |
f702c5549f1e9d10bb50fdc16097c0795dafbdde | 692 | py | Python | practice/Python3/regular_expressions/regular_expressions.py | 21-guns/algo | b2a0665d7520cca1bd8a9a4fceed0ba09618eadd | [
"MIT"
] | null | null | null | practice/Python3/regular_expressions/regular_expressions.py | 21-guns/algo | b2a0665d7520cca1bd8a9a4fceed0ba09618eadd | [
"MIT"
] | null | null | null | practice/Python3/regular_expressions/regular_expressions.py | 21-guns/algo | b2a0665d7520cca1bd8a9a4fceed0ba09618eadd | [
"MIT"
] | 1 | 2018-01-10T13:39:47.000Z | 2018-01-10T13:39:47.000Z | import re
# match whole string
data1 = "aaab"
data2 = "aaaba"
pattern = r"\Aa+b\Z"
match1 = re.match(pattern, data1)
print(match1)
match2 = re.match(pattern, data2)
print(match2)
# regular expression options
data = "AaaA\n\raaaA"
pattern = r"^(a+)$"
match = re.match(pattern, data, re.I | re.M)
print(match)
print(match.group())
# search all matches
data = "Pi = 3.14, exponent = 2.718"
pattern = r"(\d+\.\d+)"
matches = re.findall(pattern, data)
print(matches)
# replacement of the match(with catch group)
data = re.sub(pattern, r'<f>\1</f>', data)
print(data)
# search for a match
match = re.search(pattern, data)
if match:
print(match.group())
print(float(match.group()))
| 18.210526 | 44 | 0.669075 | import re
data1 = "aaab"
data2 = "aaaba"
pattern = r"\Aa+b\Z"
match1 = re.match(pattern, data1)
print(match1)
match2 = re.match(pattern, data2)
print(match2)
data = "AaaA\n\raaaA"
pattern = r"^(a+)$"
match = re.match(pattern, data, re.I | re.M)
print(match)
print(match.group())
data = "Pi = 3.14, exponent = 2.718"
pattern = r"(\d+\.\d+)"
matches = re.findall(pattern, data)
print(matches)
data = re.sub(pattern, r'<f>\1</f>', data)
print(data)
match = re.search(pattern, data)
if match:
print(match.group())
print(float(match.group()))
| true | true |
f702c5f926fe8566850d15108b97b51680b44657 | 1,043 | py | Python | django_bnr/migrations/0001_initial.py | presslabs/django-bnr | 07ed65ba8e153197862baa8a4428e068ade99c9e | [
"MIT"
] | null | null | null | django_bnr/migrations/0001_initial.py | presslabs/django-bnr | 07ed65ba8e153197862baa8a4428e068ade99c9e | [
"MIT"
] | null | null | null | django_bnr/migrations/0001_initial.py | presslabs/django-bnr | 07ed65ba8e153197862baa8a4428e068ade99c9e | [
"MIT"
] | null | null | null | # -*- coding: utf-8 -*-
from __future__ import unicode_literals
from django.db import models, migrations
class Migration(migrations.Migration):
dependencies = [
]
operations = [
migrations.CreateModel(
name='Rate',
fields=[
('id', models.AutoField(verbose_name='ID', serialize=False, auto_created=True, primary_key=True)),
('rate', models.DecimalField(null=True, verbose_name=b'Exchange rate', max_digits=8, decimal_places=4, blank=True)),
('date', models.DateField(db_index=True)),
('currency', models.CharField(default=b'USD', max_length=3, db_index=True, choices=[(b'CHF', b'CHF'), (b'EUR', b'EUR'), (b'GBP', b'GBP'), (b'USD', b'USD')])),
],
options={
'ordering': ['-date', 'currency'],
},
bases=(models.Model,),
),
migrations.AlterUniqueTogether(
name='rate',
unique_together=set([('date', 'currency')]),
),
]
| 33.645161 | 174 | 0.549377 |
from __future__ import unicode_literals
from django.db import models, migrations
class Migration(migrations.Migration):
dependencies = [
]
operations = [
migrations.CreateModel(
name='Rate',
fields=[
('id', models.AutoField(verbose_name='ID', serialize=False, auto_created=True, primary_key=True)),
('rate', models.DecimalField(null=True, verbose_name=b'Exchange rate', max_digits=8, decimal_places=4, blank=True)),
('date', models.DateField(db_index=True)),
('currency', models.CharField(default=b'USD', max_length=3, db_index=True, choices=[(b'CHF', b'CHF'), (b'EUR', b'EUR'), (b'GBP', b'GBP'), (b'USD', b'USD')])),
],
options={
'ordering': ['-date', 'currency'],
},
bases=(models.Model,),
),
migrations.AlterUniqueTogether(
name='rate',
unique_together=set([('date', 'currency')]),
),
]
| true | true |
f702c66ec9d5bae5d0c6a271922042b43ed38eb8 | 38 | py | Python | {{cookiecutter.project_slug}}/base/settings_local.py | claysllanxavier/django-cookiecutter | 97de7ff4ed3dc94c32bf756a57aee0664a888cbc | [
"BSD-3-Clause"
] | 8 | 2021-08-13T17:48:27.000Z | 2022-02-22T02:34:15.000Z | {{cookiecutter.project_slug}}/base/settings_local.py | claysllanxavier/django-cookiecutter | 97de7ff4ed3dc94c32bf756a57aee0664a888cbc | [
"BSD-3-Clause"
] | 2 | 2022-03-24T20:39:00.000Z | 2022-03-24T20:39:48.000Z | {{cookiecutter.project_slug}}/base/settings_local.py | claysllanxavier/django-cookiecutter | 97de7ff4ed3dc94c32bf756a57aee0664a888cbc | [
"BSD-3-Clause"
] | 2 | 2021-09-21T00:05:27.000Z | 2022-01-03T10:50:05.000Z | DEBUG = True
ALLOWED_HOSTS = ['*', ]
| 9.5 | 23 | 0.578947 | DEBUG = True
ALLOWED_HOSTS = ['*', ]
| true | true |
f702c68adf8353a935ab00dad8bf99c1aab432d1 | 1,577 | py | Python | develop_language/python/doc/spider/wall_papers.py | magic428/subjects_notes | 6930adbb3f445c11ca9d024abb12a53d6aca19e7 | [
"MIT"
] | 2 | 2020-03-18T17:13:00.000Z | 2020-03-25T02:34:03.000Z | develop_language/python/doc/spider/wall_papers.py | magic428/subjects_notes | 6930adbb3f445c11ca9d024abb12a53d6aca19e7 | [
"MIT"
] | null | null | null | develop_language/python/doc/spider/wall_papers.py | magic428/subjects_notes | 6930adbb3f445c11ca9d024abb12a53d6aca19e7 | [
"MIT"
] | null | null | null |
# coding: utf-8
# # python 爬虫相关
# ## 1. class 定义和使用
# In[11]:
import os
import requests
import time
import random
from lxml import etree
class Spider(object):
def __init__(self, savePath, keyWord):
self.headers = {
"User-Agent": "Mozilla/5.0 (Macintosh; Intel Mac OS X 10_12_5) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/59.0.3071.104 Safari/537.36",
}
self.keyWord = keyWord
self.filePath = (savePath + keyWord + '/')
def createFile(self):
filePath = self.filePath
if not os.path.exists(filePath):
os.makedirs(filePath)
def getPageNum(self):
#用来获取搜索关键词得到的结果总页面数,用totalPagenum记录。由于数字是夹在形如:1,985 Wallpapers found for “dog”的string中,
#所以需要用个小函数,提取字符串中的数字保存到列表numlist中,再逐个拼接成完整数字。。。
total = ""
url = ("https://alpha.wallhaven.cc/search?q={}&categories=111&purity=100&sorting=relevance&order=desc").format(self.keyWord)
html = requests.get(url)
selector = etree.HTML(html.text)
pageInfo = selector.xpath('//header[@class="listing-header"]/h1[1]/text()')
string = str(pageInfo[0])
numList = list(filter(str.isdigit, string))
for item in numList:
total += item
totalPageNum = int(total)
return totalPageNum
def main_func(self):
count = self.getPageNum()
print("We have found:{} images!".format(count))
# In[13]:
s = Spider("/home/klm/work/spider/", "girl")
print s.headers, s.filePath
s.main_func()
| 29.203704 | 151 | 0.606848 |
import random
from lxml import etree
class Spider(object):
def __init__(self, savePath, keyWord):
self.headers = {
"User-Agent": "Mozilla/5.0 (Macintosh; Intel Mac OS X 10_12_5) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/59.0.3071.104 Safari/537.36",
}
self.keyWord = keyWord
self.filePath = (savePath + keyWord + '/')
def createFile(self):
filePath = self.filePath
if not os.path.exists(filePath):
os.makedirs(filePath)
def getPageNum(self):
total = ""
url = ("https://alpha.wallhaven.cc/search?q={}&categories=111&purity=100&sorting=relevance&order=desc").format(self.keyWord)
html = requests.get(url)
selector = etree.HTML(html.text)
pageInfo = selector.xpath('//header[@class="listing-header"]/h1[1]/text()')
string = str(pageInfo[0])
numList = list(filter(str.isdigit, string))
for item in numList:
total += item
totalPageNum = int(total)
return totalPageNum
def main_func(self):
count = self.getPageNum()
print("We have found:{} images!".format(count))
s = Spider("/home/klm/work/spider/", "girl")
print s.headers, s.filePath
s.main_func()
| false | true |
f702c70a99f711f50de59372d5545d6e6a043b23 | 41,365 | py | Python | main.py | yukkerike/vklml | 2efb6fa506a71f8dec8286c833b92985e70dc164 | [
"MIT"
] | 6 | 2020-10-14T20:11:16.000Z | 2022-02-08T16:12:46.000Z | main.py | yukkerike/vklml | 2efb6fa506a71f8dec8286c833b92985e70dc164 | [
"MIT"
] | null | null | null | main.py | yukkerike/vklml | 2efb6fa506a71f8dec8286c833b92985e70dc164 | [
"MIT"
] | null | null | null | import logging
import logging.handlers
import sys
import os
import json
import sqlite3
import signal
import threading
import time
import difflib
import vk_api
from vk_api.longpoll import VkLongPoll, VkEventType
import requests.exceptions
cwd = os.path.dirname(os.path.abspath(__file__))
logging.basicConfig(
format='%(asctime)s - %(levelname)s - %(message)s',
stream=sys.stdout,
level=logging.WARNING
)
logger = logging.getLogger(__name__)
logger.setLevel(logging.INFO)
handler = logging.handlers.RotatingFileHandler(
os.path.join(cwd, 'log.txt'),
maxBytes=102400
)
handler.setFormatter(logging.Formatter('%(asctime)s - %(levelname)s - %(message)s'))
logger.addHandler(handler)
logger.info("Запуск...")
def handle_exception(exc_type, exc_value, exc_traceback):
if issubclass(exc_type, requests.exceptions.RequestException):
return
elif issubclass(exc_type, KeyboardInterrupt):
sys.__excepthook__(exc_type, exc_value, exc_traceback)
return
logger.error("Непойманное исключение.", exc_info=(exc_type, exc_value, exc_traceback))
sys.excepthook = handle_exception
defaultConfig = {
"ACCESS_TOKEN": "",
"createIndex": False,
"maxCacheAge": 86400,
"preloadMessages": False,
"customActions": False,
"disableMessagesLogging": False,
'enableFlaskWebServer': False,
'useAuth': False,
'users': {
'admin':'password'
},
'port': 8080,
'https': False,
'httpsPort': 8443,
'cert': [
os.path.join(cwd, "cert.pem"),
os.path.join(cwd, "key.pem")
]
}
def grab_token_from_args():
if len(sys.argv) > 1:
defaultConfig['ACCESS_TOKEN'] = sys.argv[1]
elif defaultConfig['ACCESS_TOKEN'] == "":
raise Exception("Не задан ACCESS_TOKEN")
if not os.path.exists(os.path.join(cwd, "config.json")):
with open(os.path.join(cwd, "config.json"), 'w') as conf:
grab_token_from_args()
json.dump(defaultConfig, conf, indent=4)
config = defaultConfig
del defaultConfig
else:
with open(os.path.join(cwd, "config.json"), 'r') as conf:
config = json.load(conf)
for i in config:
if i in defaultConfig:
defaultConfig[i] = config[i]
grab_token_from_args()
if len(set(config)) - len(set(defaultConfig)) != 0:
with open(os.path.join(cwd, "config.json"), 'w') as conf:
json.dump(defaultConfig, conf, indent=4)
config = defaultConfig
del defaultConfig
stop_mutex = threading.Lock()
def run_flask_server():
port = config['httpsPort'] if config['https'] else config['port']
import socket
ip = socket.gethostbyname(socket.gethostname())
del socket
while True:
try:
if config['https']:
logger.info("Trying to run on https://%s:%s/", ip, port)
app.run(
host='0.0.0.0',
port=port,
ssl_context=(
config['cert'][0],
config['cert'][1]
)
)
else:
logger.info("Trying to run on http://%s:%s/", ip, port)
app.run(host='0.0.0.0', port=port)
except OSError:
port += 1
if config['enableFlaskWebServer']:
from flaskWebServer import app
threading.Thread(target=run_flask_server).start()
if config['createIndex']:
from updateIndex import indexUpdater
indexUpdater()
def tryAgainIfFailed(func, *args, maxRetries=5, **kwargs):
c = maxRetries
delay = 1
while True:
try:
return func(*args, **kwargs)
except vk_api.exceptions.ApiError:
if str(sys.exc_info()[1]).find("User authorization failed") != -1:
logger.warning("Токен недействителен.")
interrupt_handler(0, None)
raise Warning
except requests.exceptions.RequestException:
if delay < 32:
delay*=2
time.sleep(delay)
continue
except BaseException:
if maxRetries == 0:
logger.exception("После %s попыток %s(%s%s) завершился с ошибкой.", c, func.__name__, args, kwargs)
raise Warning
logger.warning("Перезапуск %s(%s%s) через %s секунд...", func.__name__, args, kwargs, delay)
if delay < 32:
delay*=2
time.sleep(delay)
if maxRetries > 0:
maxRetries -= 1
continue
vk_session = vk_api.VkApi(token=config['ACCESS_TOKEN'],api_version='5.130')
longpoll = VkLongPoll(vk_session, wait=60, mode=2)
vk = vk_session.get_api()
account_id = tryAgainIfFailed(vk.users.get)[0]['id']
if not config['disableMessagesLogging']:
if not os.path.exists(
os.path.join(
cwd,
"mesAct"
)
):
os.makedirs(
os.path.join(
cwd,
"mesAct"
)
)
f = open(
os.path.join(
cwd,
"mesAct",
"vkGetVideoLink.html"
),
'w',
encoding='utf-8'
)
f.write("""<!DOCTYPE html>
<html>
<head>
<meta charset="utf-8">
<style>
html,body,iframe{
width: 100%;
height: 100%;
}
</style>
</head>
<body>
<p>Если видео не проигрывается, прямую ссылку можно получить через api:</p>
<script>
function embedLink(id) {
var link = document.createElement('a');
link.href = "https://vk.com/dev/video.get?params[videos]=0_0," + id + "¶ms[count]=1¶ms[offset]=1";
link.innerText = id;
link.setAttribute('target', '_blank')
document.getElementsByTagName("body")[0].appendChild(link);
}
function embedPlayer(link) {
var frame = document.createElement('iframe');
frame.src = link;
frame.style = "width:100%;height:100%;";
frame.setAttribute('allowFullScreen', '')
document.getElementsByTagName("body")[0].appendChild(frame);
}
function splitArgs(){
var args = document.location.search;
var lastAmpersand = args.lastIndexOf('&');
return [args.slice(1, lastAmpersand), args.slice(lastAmpersand + 1)];
}
var args = splitArgs();
embedLink(args[1]);
embedPlayer(args[0]);
</script>
</body>
</html>""")
f.close()
if not os.path.exists(
os.path.join(
cwd,
"messages.db"
)
):
conn = sqlite3.connect(
os.path.join(
cwd,
"messages.db"
),
check_same_thread=False,
isolation_level=None,
timeout=15.0
)
cursor = conn.cursor()
cursor.execute("""CREATE TABLE "messages" (
"peer_id" INTEGER NOT NULL,
"user_id" INTEGER NOT NULL,
"message_id" INTEGER NOT NULL UNIQUE,
"message" TEXT,
"attachments" TEXT,
"timestamp" INTEGER NOT NULL,
"fwd_messages" TEXT
)""")
cursor.execute("""CREATE TABLE "chats_cache" (
"chat_id" INTEGER NOT NULL UNIQUE,
"chat_name" TEXT NOT NULL
)""")
cursor.execute("""CREATE TABLE "users_cache" (
"user_id" INTEGER NOT NULL UNIQUE,
"user_name" TEXT NOT NULL
)""")
account_name = tryAgainIfFailed(
vk.users.get,
user_id=account_id
)[0]
account_name = f"{account_name['first_name']} {account_name['last_name']}"
cursor.execute(
"""INSERT INTO users_cache (user_id,user_name) VALUES (?,?)""",
(account_id, account_name,)
)
conn.commit()
else:
conn = sqlite3.connect(
os.path.join(cwd, "messages.db"),
check_same_thread=False,
timeout=15.0
)
cursor = conn.cursor()
if not os.path.exists(
os.path.join(
cwd,
"mesAct",
"bootstrap.css"
)
):
f = open(
os.path.join(
cwd,
"mesAct",
"bootstrap.css"
),
'w',
encoding='utf-8'
)
f.write(':root{--blue:#007bff;--indigo:#6610f2;--purple:#6f42c1;--pink:#e83e8c;--red:#dc3545;--orange:#fd7e14;--yellow:#ffc107;--green:#28a745;--teal:#20c997;--cyan:#17a2b8;--white:#fff;--gray:#6c757d;--gray-dark:#343a40;--primary:#007bff;--secondary:#6c757d;--success:#28a745;--info:#17a2b8;--warning:#ffc107;--danger:#dc3545;--light:#f8f9fa;--dark:#343a40;--breakpoint-xs:0;--breakpoint-sm:576px;--breakpoint-md:768px;--breakpoint-lg:992px;--breakpoint-xl:1200px;--font-family-sans-serif:-apple-system,BlinkMacSystemFont,"Segoe UI",Roboto,"Helvetica Neue",Arial,"Noto Sans",sans-serif,"Apple Color Emoji","Segoe UI Emoji","Segoe UI Symbol","Noto Color Emoji";--font-family-monospace:SFMono-Regular,Menlo,Monaco,Consolas,"Liberation Mono","Courier New",monospace}*,::after,::before{box-sizing:border-box}html{font-family:sans-serif;line-height:1.15;-webkit-text-size-adjust:100%;-webkit-tap-highlight-color:transparent}body{margin:0;font-family:-apple-system,BlinkMacSystemFont,"Segoe UI",Roboto,"Helvetica Neue",Arial,"Noto Sans",sans-serif,"Apple Color Emoji","Segoe UI Emoji","Segoe UI Symbol","Noto Color Emoji";font-size:1rem;font-weight:400;line-height:1.5;color:#212529;text-align:left;background-color:#fff}dl,ol,ul{margin-top:0;margin-bottom:1rem}b,strong{font-weight:bolder}a{color:#007bff;text-decoration:none;background-color:transparent}img{vertical-align:middle;border-style:none}table{border-collapse:collapse}.table{width:100%;margin-bottom:1rem;color:#212529}.table td,.table th{padding:.75rem;vertical-align:top;border-top:1px solid #dee2e6}.table-sm td,.table-sm th{padding:.3rem}.table-bordered{border:1px solid #dee2e6}.table-bordered td,.table-bordered th{border:1px solid #dee2e6}.list-group{display:-ms-flexbox;display:flex;-ms-flex-direction:column;flex-direction:column;padding-left:0;margin-bottom:0;border-radius:.25rem}.list-group-item{position:relative;display:block;padding:.75rem 1.25rem;background-color:#fff;border:1px solid rgba(0,0,0,.125)}.list-group-item:first-child{border-top-left-radius:inherit;border-top-right-radius:inherit}.list-group-item:last-child{border-bottom-right-radius:inherit;border-bottom-left-radius:inherit}.list-group-item+.list-group-item{border-top-width:0}.stretched-link::after{position:absolute;top:0;right:0;bottom:0;left:0;z-index:1;pointer-events:auto;content:"";background-color:rgba(0,0,0,0)}.mes{word-break:break-all}img,a,audio{display:block}img{max-width:100%}')
f.close()
if config['customActions']:
from customActions import customActions
cust = customActions(vk, conn, cursor)
def bgWatcher():
while True:
maxCacheAge = config['maxCacheAge']
with stop_mutex:
logger.info("Обслуживание БД...")
try:
showMessagesWithDeletedAttachments()
except BaseException:
logger.exception("Ошибка при поиске удаленных фото")
try:
if maxCacheAge != -1:
cursor.execute(
"""DELETE FROM messages WHERE timestamp < ?""",
(time.time() - maxCacheAge,)
)
conn.commit()
cursor.execute("VACUUM")
else:
maxCacheAge = 86400
except BaseException:
logger.exception("Ошибка при очистке базы данных")
logger.info("Обслуживание БД завершено.")
time.sleep(maxCacheAge)
def interrupt_handler(signum, frame):
conn.commit()
cursor.close()
try:
tableWatcher.cancel()
except AttributeError:
pass
logger.info("Завершение...")
os._exit(0)
signal.signal(signal.SIGINT, interrupt_handler)
signal.signal(signal.SIGTERM, interrupt_handler)
def eventWorker_predefinedDisabled():
global events
while True:
flag.wait()
event = events.pop(0)
with stop_mutex:
try:
cust.act(event)
except BaseException:
logger.exception("Ошибка в customActions. \n %s", vars(event))
if len(events) == 0:
flag.clear()
def eventWorker_customDisabled():
global events
while True:
flag.wait()
event = events.pop(0)
with stop_mutex:
predefinedActions(event)
if len(events) == 0:
flag.clear()
conn.commit()
def eventWorker():
global events
while True:
flag.wait()
event = events.pop(0)
with stop_mutex:
try:
cust.act(event)
except BaseException:
logger.exception("Ошибка в customActions. \n %s", vars(event))
predefinedActions(event)
if len(events) == 0:
flag.clear()
conn.commit()
def predefinedActions(event):
try:
if event.type == VkEventType.MESSAGE_NEW:
cursor.execute(
"""INSERT INTO messages(peer_id,user_id,message_id,message,attachments,timestamp,fwd_messages) VALUES (?,?,?,?,?,?,?)""",
(event.peer_id, event.user_id, event.message_id, event.message, event.message_data[1], event.timestamp, event.message_data[2],)
)
conn.commit()
elif event.type == VkEventType.MESSAGE_EDIT:
if event.message_data[0]:
activityReport(event.message_id, event.peer_id, event.user_id, event.timestamp, True, event.message_data[1], event.message_data[2], event.text)
cursor.execute(
"""INSERT or REPLACE INTO messages(peer_id,user_id,message_id,message,attachments,timestamp,fwd_messages) VALUES (?,?,?,?,?,?,?)""",
(event.peer_id, event.user_id, event.message_id, event.message, event.message_data[1], event.timestamp, event.message_data[2],)
)
conn.commit()
elif event.type == VkEventType.MESSAGE_FLAGS_SET:
try:
activityReport(event.message_id)
cursor.execute(
"""DELETE FROM messages WHERE message_id = ?""",
(event.message_id,)
)
conn.commit()
except TypeError:
logger.info("Удаление невозможно, сообщение отсутствует в БД.")
except sqlite3.IntegrityError:
logger.warning("Запущено несколько копий программы, завершение...")
interrupt_handler(0, None)
except Warning:
pass
except BaseException:
logger.exception("Ошибка при сохранении сообщения. \n %s", vars(event))
def main():
logger.info("Запущен основной цикл.")
global events
for event in longpoll.listen():
try:
if event.raw[0] == 4 or event.raw[0] == 5:
if event.attachments != {}:
event.message_data = getAttachments(event)
else:
event.message_data = True, None, None
if event.from_user and event.raw[2] & 2:
event.user_id = account_id
elif event.from_group:
if event.from_me:
event.user_id = account_id
else:
event.user_id = event.peer_id
if not event.message:
event.message = None
events.append(event)
flag.set()
elif event.raw[0] == 2 and (event.raw[2] & 131072 or event.raw[2] & 128):
events.append(event)
flag.set()
except Warning:
pass
except BaseException:
logger.exception("Ошибка при добавлении события в очередь. \n %s", vars(event))
def showMessagesWithDeletedAttachments():
cursor.execute("""SELECT message_id, attachments FROM messages WHERE attachments IS NOT NULL""")
fetch_attachments = [[str(i[0]), json.loads(i[1])] for i in cursor.fetchall()]
cursor.execute("""SELECT message_id, fwd_messages FROM messages WHERE fwd_messages IS NOT NULL""")
fetch_fwd = [[str(i[0]), json.loads(i[1])] for i in cursor.fetchall()]
c = 0
for i in range(len(fetch_attachments)):
for j in fetch_attachments[i - c][1]:
if j['type'] == 'photo' or j['type'] == 'video' or j['type'] == 'doc':
break
else:
del fetch_attachments[i - c]
c += 1
messages_attachments = []
messages_fwd = []
for i in [[j[0] for j in fetch_attachments[i:i + 100]] for i in range(0, len(fetch_attachments), 100)]:
messages_attachments.extend(tryAgainIfFailed(
vk.messages.getById,
message_ids=','.join(i))['items']
)
for i in [[j[0] for j in fetch_fwd[i:i + 100]] for i in range(0, len(fetch_fwd), 100)]:
messages_fwd.extend(tryAgainIfFailed(
vk.messages.getById,
message_ids=','.join(i))['items']
)
c = 0
for i in range(len(fetch_attachments)):
if compareAttachments(messages_attachments[i - c]['attachments'], fetch_attachments[i - c][1]):
del fetch_attachments[i - c]
del messages_attachments[i - c]
c += 1
for i in range(len(fetch_attachments)):
activityReport(fetch_attachments[i][0])
if messages_attachments[i]['attachments'] == []:
cursor.execute(
"""UPDATE messages SET attachments = ? WHERE message_id = ?""",
(None, fetch_attachments[i][0],)
)
else:
cursor.execute(
"""UPDATE messages SET attachments = ? WHERE message_id = ?""",
(
json.dumps(messages_attachments[i]['attachments']),
fetch_attachments[i][0],
)
)
c = 0
for i in range(len(fetch_fwd)):
if compareFwd(
messages_fwd[i - c],
{
'fwd_messages': fetch_fwd[i - c][1]
}
):
del fetch_fwd[i - c]
del messages_fwd[i - c]
c += 1
for i in range(len(fetch_fwd)):
activityReport(fetch_fwd[i][0])
if messages_fwd[i]['fwd_messages'] == []:
cursor.execute(
"""UPDATE messages SET fwd_messages = ? WHERE message_id = ?""",
(None, fetch_fwd[i][0],)
)
else:
cursor.execute(
"""UPDATE messages SET fwd_messages = ? WHERE message_id = ?""",
(
json.dumps(messages_fwd[i]['fwd_messages']),
fetch_fwd[i][0],
)
)
conn.commit()
def compareFwd(new, old):
if 'reply_message' in new:
new['fwd_messages'] = [new['reply_message']]
if 'reply_message' in old:
old['fwd_messages'] = [old['reply_message']]
for i in range(len(old['fwd_messages'])):
if 'fwd_messages' in old['fwd_messages'][i] and 'fwd_messages' in new['fwd_messages'][i]:
if not compareFwd(
new['fwd_messages'][i],
old['fwd_messages'][i]
):
return False
if not compareAttachments(
new['fwd_messages'][i]['attachments'],
old['fwd_messages'][i]['attachments']
):
return False
return True
def compareAttachments(new, old):
if len(new) < len(old):
return False
return True
def attachmentsParse(urls):
if urls is None:
return ""
html = """<div>
"""
for i in urls:
urlSplit = i.split(',')
if i.find('vk.com/sticker/') != -1:
html += """ <img src="{}" />
""".format(i)
elif i.find('.jpg') != -1 and i.find(',') == -1:
html += """ <img src="{}" />
""".format(i)
elif i.find('.mp3') != -1:
html += """ <audio src="{}" controls></audio>
""".format(i)
elif i.find('https://vk.com/audio') != -1:
html += """ <a href="{}" target="_blank">
{}
</a>
""".format(i, i[23:-11].replace('%20', ' '))
elif i.find('@') != -1:
i = i.rsplit('@', 1)
html += """ <a href="{}" target="_blank">
{}
</a>
""".format(i[1], i[0])
elif len(urlSplit) == 3:
html += """ <a href="{}" target="_blank">
Видео
<img src="{}"/>
</a>
""".format(f"./vkGetVideoLink.html?{urlSplit[1]}&{urlSplit[2]}", urlSplit[0])
else:
html += """ <a href="{0}" target="_blank">
{0}
</a>
""".format(i)
html += """</div>"""
return html
def getAttachments(event):
message_id = event.message_id
fullLoadUnNeeded = not (event.raw[0] == 5 or 'fwd' in event.attachments)
count = 0
if fullLoadUnNeeded:
for i in range(1,11):
if f'attach{i}_type' in event.attachments:
if event.attachments[f'attach{i}_type'] not in ('sticker', 'link'):
fullLoadUnNeeded = False
else:
count = i
break
if fullLoadUnNeeded:
attachments = []
for i in range(1,count):
if event.attachments[f'attach{i}_type'] == 'sticker':
attachments.append({'type':'sticker','sticker':{'images':[{'height':64,'url':f'https://vk.com/sticker/1-{event.attachments[f"attach{i}"]}-64'}]}})
else:
if f'attach{i}_title' in event.attachments:
title = event.attachments[f'attach{i}_title']
else:
title = event.attachments[f'attach{i}_url']
attachments.append({'type':'link','link':{'title':title,'url':event.attachments[f'attach{i}_url']}})
return False, json.dumps(attachments, ensure_ascii=False,), None
mes = tryAgainIfFailed(
vk.messages.getById,
message_ids=message_id
)['items']
if not len(mes):
logger.info("Не удалось запросить вложения для сообщения, message_id = %i.", event.message_id)
return False, "[]", "[]"
else:
mes = mes[0]
hasUpdateTime = 'update_time' in mes
fwd_messages = None
if 'reply_message' in mes:
fwd_messages = json.dumps([mes['reply_message']], ensure_ascii=False,)
elif mes['fwd_messages'] != []:
fwd_messages = json.dumps(mes['fwd_messages'], ensure_ascii=False,)
if mes['attachments'] == []:
attachments = None
else:
attachments = json.dumps(mes['attachments'], ensure_ascii=False,)
return hasUpdateTime, attachments, fwd_messages
def parseUrls(attachments):
urls = []
for i in attachments:
if i['type'] == 'photo':
maxHeight = 0
maxUrl = ""
for j in i['photo']['sizes']:
if j['height'] > maxHeight:
maxHeight = j['height']
maxUrl = j['url']
urls.append(maxUrl)
elif i['type'] == 'audio_message':
urls.append(i['audio_message']['link_mp3'])
elif i['type'] == 'sticker':
urls.append(i['sticker']['images'][0]['url'])
elif i['type'] == 'gift':
urls.append(i['gift']['thumb_48'])
elif i['type'] == 'link':
urls.append(f"Ссылка: {i['link']['title']}@{i['link']['url']}")
elif i['type'] == 'video':
urls.append(f"{i['video']['image'][0]['url']},{i['video']['player']},{i['video']['owner_id']}_{i['video']['id']}_{i['video']['access_key']}")
elif i['type'] == 'wall':
urls.append(f"Пост: {i['wall']['text'][:25]}@https://vk.com/wall{i['wall']['from_id']}_{i['wall']['id']}")
elif i['type'] == 'wall_reply':
urls.append(f"Комментарий: {i['wall_reply']['text'][:25]}@https://vk.com/wall{i['wall_reply']['owner_id']}_{i['wall_reply']['post_id']}?reply={i['wall_reply']['id']}")
elif i['type'] == 'audio':
urls.append(f"https://vk.com/audio?q={i['audio']['artist'].replace(' ', '%20')}%20-%20{i['audio']['title'].replace(' ', '%20')}&tab=global")
elif i['type'] == 'audio_playlist':
urls.append(f"Плейлист: {i['audio_playlist']['title']}@https://vk.com/music?z=audio_playlist{i['audio_playlist']['owner_id']}_{i['audio_playlist']['id']}/{i['audio_playlist']['access_key']}")
elif i['type'] == 'market':
urls.append(f"https://vk.com/market?w=product{i['market']['owner_id']}_{i['market']['id']}")
elif i['type'] == 'poll':
urls.append(f"Голосование: {i['poll']['question'][:25]}@https://vk.com/poll{i['poll']['owner_id']}_{i['poll']['id']}")
elif i['type'] == 'doc':
urls.append(f"Документ: {i['doc']['title']}@{i['doc']['url']}")
else:
if 'url' in i[i['type']]:
urls.append(i[i['type']]['url'])
if urls == []:
return None
return urls
def getPeerName(id):
if id > 2000000000:
cursor.execute("""SELECT chat_name FROM chats_cache WHERE chat_id = ?""", (id,))
fetch = cursor.fetchone()
if fetch is None:
try:
name = tryAgainIfFailed(
vk.messages.getChat,
chat_id=id-2000000000
)['title']
cursor.execute("""INSERT INTO chats_cache (chat_id,chat_name) VALUES (?,?)""", (id, name,))
conn.commit()
except Warning:
name = "Секретный чат, используйте токен другого приложения"
else:
name = fetch[0]
elif id < 0:
cursor.execute("""SELECT user_name FROM users_cache WHERE user_id = ?""", (id,))
fetch = cursor.fetchone()
if fetch is None:
name = tryAgainIfFailed(
vk.groups.getById,
group_id=-id
)[0]['name']
cursor.execute("""INSERT INTO users_cache (user_id,user_name) VALUES (?,?)""", (id, name,))
conn.commit()
else:
name = fetch[0]
else:
cursor.execute("""SELECT user_name FROM users_cache WHERE user_id = ?""", (id,))
fetch = cursor.fetchone()
if fetch is None:
name = tryAgainIfFailed(
vk.users.get,
user_id=id
)[0]
name = f"{name['first_name']} {name['last_name']}"
cursor.execute("""INSERT INTO users_cache (user_id,user_name) VALUES (?,?)""", (id, name,))
conn.commit()
else:
name = fetch[0]
return name
def fwdParse(fwd):
html = """<table class="table table-sm table-bordered">
"""
for i in fwd:
user_name = getPeerName(i['from_id'])
if i['from_id'] < 0:
html += """ <tr>
<td>
<a href='https://vk.com/public{}' target="_blank">
{}
</a>
</td>
</tr>
""".format(-i['from_id'], user_name)
else:
html += """ <tr>
<td>
<a href='https://vk.com/id{}' target="_blank">
{}
</a>
</td>
</tr>
""".format(i['from_id'], user_name)
if i['text'] != "":
html += """ <tr>
<td>
<div class='mes'>
{}
</div>
""".format(xssFilter(i['text']))
else:
html += """ <tr>
<td>
"""
if i['attachments'] != []:
html += attachmentsParse(parseUrls(i['attachments']))
if 'fwd_messages' in i:
html += fwdParse(i['fwd_messages'])
elif 'reply_message' in i:
html += fwdParse([i['reply_message']])
html += """ </td>
</tr>
<tr>
<td>
{}
</td>
</tr>
""".format(time.strftime('%H:%M:%S %d.%m.%y', time.localtime(i['date'])))
html += "</table>"
return html
def xssFilter(s):
return s\
.replace('<', '<')\
.replace('>', '>')\
.replace('\n', '<br />')
def compareStrings(a, b):
aCounter = 0
bCounter = 0
for i in difflib.SequenceMatcher(None, a, b).get_opcodes():
if i[0] == 'insert':
b = f"{b[: i[3]+bCounter]}<ins>{b[i[3]+bCounter : i[4]+bCounter]}</ins>{b[i[4]+bCounter:]}"
bCounter += 11
elif i[0] == 'delete':
a = f"{a[: i[1]+aCounter]}<ins>{a[i[1]+aCounter : i[2]+aCounter]}</ins>{a[i[2]+aCounter:]}"
aCounter += 11
elif i[0] == 'replace':
a = f"{a[: i[1]+aCounter]}<ins>{a[i[1]+aCounter : i[2]+aCounter]}</ins>{a[i[2]+aCounter:]}"
b = f"{b[: i[3]+bCounter]}<ins>{b[i[3]+bCounter : i[4]+bCounter]}</ins>{b[i[4]+bCounter:]}"
aCounter += 11
bCounter += 11
return a, b
def activityReport(message_id, peer_id=None, user_id=None, timestamp=None, isEdited=False, attachments=None, fwd=None, message=None):
try:
peer_name = user_name = oldMessage = oldAttachments = date = oldFwd = None
cursor.execute("""SELECT * FROM messages WHERE message_id = ?""", (message_id,))
fetch = cursor.fetchone()
if attachments is not None:
attachments = parseUrls(json.loads(attachments))
if fwd is not None:
fwd = json.loads(fwd)
if fetch is None:
if isEdited:
logger.info("Изменение сообщения, отсутствующего в БД, message_id = %i.", message_id)
fetch = [0]*7
peer_name = getPeerName(peer_id)
user_name = getPeerName(user_id)
oldMessage = f"⚠️ {message}"
oldAttachments = attachments
oldFwd = fwd
date = f"<b>Доб:</b> {time.strftime('%H:%M:%S %d.%m', time.localtime(timestamp))}<br /><b>Изм:</b> {time.strftime('%H:%M:%S %d.%m', time.localtime())}"
else:
raise TypeError
else:
if fetch[3] is not None:
oldMessage = str(fetch[3])
if fetch[4] is not None:
oldAttachments = parseUrls(json.loads(fetch[4]))
if fetch[6] is not None:
oldFwd = json.loads(fetch[6])
peer_name = getPeerName(fetch[0])
user_name = getPeerName(fetch[1])
date = f"<b>Доб:</b> {time.strftime('%H:%M:%S %d.%m', time.localtime(fetch[5]))}<br /><b>Изм:</b> {time.strftime('%H:%M:%S %d.%m', time.localtime())}"
peer_id = fetch[0]
user_id = fetch[1]
del fetch
row = """ <tr><!-- {} -->
<td>{}
</td>
<td>{}
</td>
{}
<td>
{}
</td>
</tr>
"""
messageBlock = """
<div class='mes'>
{}
</div>"""
attachmentsBlock = """
<div>
<b>Вложения</b><br />
{}
</div>"""
fwdBlock = """
<div>
<b>Пересланное</b><br />
{}
</div>"""
if peer_id > 2000000000:
peer_id = """
<a href='https://vk.com/im?sel=c{}' target='_blank'>
{}
</a>""".format(str(peer_id-2000000000), peer_name)
elif peer_id < 0:
peer_id = """
<a href='https://vk.com/public{}' target='_blank'>
{}
</a>""".format(str(-peer_id), peer_name)
else:
peer_id = """
<a href='https://vk.com/id{}' target='_blank'>
{}
</a>""".format(str(peer_id), peer_name)
if user_id < 0:
user_id = """
<a href='https://vk.com/public{}' target='_blank'>
{}
</a>""".format(str(-user_id), user_name)
else:
user_id = """
<a href='https://vk.com/id{}' target='_blank'>
{}
</a>""".format(str(user_id), user_name)
if isEdited:
if not (oldMessage is None or message is None):
message = xssFilter(message)
oldMessage = xssFilter(oldMessage)
message, oldMessage = compareStrings(message, oldMessage)
oldMessage = messageBlock.format(oldMessage)
message = messageBlock.format(message)
elif oldMessage is None:
oldMessage = ""
message = messageBlock.format(xssFilter(message))
else:
oldMessage = messageBlock.format(xssFilter(oldMessage))
message = ""
if oldAttachments is not None:
oldAttachments = attachmentsBlock.format(attachmentsParse(oldAttachments))
else:
oldAttachments = ""
if oldFwd is not None:
oldFwd = fwdBlock.format(fwdParse(oldFwd))
else:
oldFwd = ""
if attachments is not None:
attachments = attachmentsBlock.format(attachmentsParse(attachments))
else:
attachments = ""
if fwd is not None:
fwd = fwdBlock.format(fwdParse(fwd))
else:
fwd = ""
messageBlock = """<td width='50%'>
<b>Старое</b><br />{}
</td>
<td width='50%'>
<b>Новое</b><br />{}
</td>""".format(oldMessage+oldAttachments+oldFwd, message+attachments+fwd)
else:
if oldMessage is not None:
oldMessage = messageBlock.format(xssFilter(oldMessage))
else:
oldMessage = ""
if oldAttachments is not None:
oldAttachments = attachmentsBlock.format(attachmentsParse(oldAttachments))
else:
oldAttachments = ""
if oldFwd is not None:
oldFwd = fwdBlock.format(fwdParse(oldFwd))
else:
oldFwd = ""
messageBlock = """<td width='100%' colspan='2'>
<b>Удалено</b><br />{}
</td>""".format(oldMessage+oldAttachments+oldFwd)
row = row.format(message_id, peer_id, user_id, messageBlock, date)
if os.path.exists(
os.path.join(
cwd,
"mesAct",
f"messages_{time.strftime('%d%m%y', time.localtime())}.html"
)
):
messagesActivities = open(
os.path.join(
cwd,
"mesAct",
f"messages_{time.strftime('%d%m%y',time.localtime())}.html"
),
'r',
encoding='utf-8'
)
messagesDump = messagesActivities.read()
messagesActivities.close()
messagesActivities = open(
os.path.join(
cwd,
"mesAct",
f"messages_{time.strftime('%d%m%y',time.localtime())}.html"
),
'w',
encoding='utf-8'
)
else:
messagesDump = template
messagesActivities = open(
os.path.join(
cwd,
"mesAct",
f"messages_{time.strftime('%d%m%y',time.localtime())}.html"
),
'w',
encoding='utf-8'
)
messagesDump = messagesDump[:offset]+row+messagesDump[offset:]
messagesActivities.write(messagesDump)
messagesActivities.close()
except TypeError:
raise TypeError
except BaseException:
logger.exception("Ошибка при логгировании изменений.")
if not config['disableMessagesLogging']:
tableWatcher = threading.Thread(target=bgWatcher)
tableWatcher.start()
template = """<!DOCTYPE html>
<html>
<head>
<meta charset="utf-8">
<link rel="stylesheet" href="./bootstrap.css">
</head>
<body>
<table class="table table-sm">
</table>
</body>
</html>"""
offset = template.index(""" </table>""")
events = []
flag = threading.Event()
def preloadMessages():
logger.info("Предзагрузка сообщений...")
offset = 0
peer_ids = []
messages = []
shouldContinue = True
try:
while shouldContinue:
shouldContinue = False
dialogs = tryAgainIfFailed(vk.messages.getConversations, offset=offset, count=20)
for i in range(0,len(dialogs['items'])):
if dialogs['items'][i]['last_message']['date'] >= time.time() - config['maxCacheAge']:
peer_ids.append(dialogs['items'][i]['conversation']['peer']['id'])
if i == len(dialogs['items']) - 1:
shouldContinue = True
offset+=20
for i in peer_ids:
offset = 0
if i > 2000000000:
count = 200
else:
count = 50
shouldContinue = True
while shouldContinue:
shouldContinue = False
mes = vk.messages.getHistory(offset=offset, count=count, peer_id=i)['items']
if mes[-1]['date']>= time.time() - config['maxCacheAge']:
shouldContinue = True
offset+=count
for j in mes:
if j['date'] >= time.time() - config['maxCacheAge']:
messages.append(j)
for i in messages:
message_id = i['id']
with stop_mutex:
cursor.execute("""SELECT message_id FROM messages WHERE message_id = ?""", (message_id,))
if cursor.fetchone() is not None:
continue
peer_id = i['peer_id']
user_id = i['from_id']
message = i['text']
timestamp = i['date']
fwd_messages = None
if 'reply_message' in i:
fwd_messages = json.dumps([i['reply_message']], ensure_ascii=False,)
elif i['fwd_messages'] != []:
fwd_messages = json.dumps(i['fwd_messages'], ensure_ascii=False,)
if i['attachments'] == []:
attachments = None
else:
attachments = json.dumps(i['attachments'], ensure_ascii=False,)
with stop_mutex:
cursor.execute(
"""INSERT INTO messages(peer_id,user_id,message_id,message,attachments,timestamp,fwd_messages) VALUES (?,?,?,?,?,?,?)""",
(peer_id, user_id, message_id, message, attachments, timestamp, fwd_messages,)
)
conn.commit()
except BaseException:
logger.exception("Ошибка во время предзагрузки сообщений")
logger.info("Предзагрузка сообщений завершена.")
if config['customActions'] and config['disableMessagesLogging']:
threading.Thread(target=eventWorker_predefinedDisabled).start()
elif not config['disableMessagesLogging'] and not config['customActions']:
threading.Thread(target=eventWorker_customDisabled).start()
else:
threading.Thread(target=eventWorker).start()
if config['preloadMessages']:
threading.Thread(target=preloadMessages).start()
try:
tryAgainIfFailed(
main,
maxRetries=-1
)
except Warning:
pass
| 39.47042 | 2,443 | 0.512656 | import logging
import logging.handlers
import sys
import os
import json
import sqlite3
import signal
import threading
import time
import difflib
import vk_api
from vk_api.longpoll import VkLongPoll, VkEventType
import requests.exceptions
cwd = os.path.dirname(os.path.abspath(__file__))
logging.basicConfig(
format='%(asctime)s - %(levelname)s - %(message)s',
stream=sys.stdout,
level=logging.WARNING
)
logger = logging.getLogger(__name__)
logger.setLevel(logging.INFO)
handler = logging.handlers.RotatingFileHandler(
os.path.join(cwd, 'log.txt'),
maxBytes=102400
)
handler.setFormatter(logging.Formatter('%(asctime)s - %(levelname)s - %(message)s'))
logger.addHandler(handler)
logger.info("Запуск...")
def handle_exception(exc_type, exc_value, exc_traceback):
if issubclass(exc_type, requests.exceptions.RequestException):
return
elif issubclass(exc_type, KeyboardInterrupt):
sys.__excepthook__(exc_type, exc_value, exc_traceback)
return
logger.error("Непойманное исключение.", exc_info=(exc_type, exc_value, exc_traceback))
sys.excepthook = handle_exception
defaultConfig = {
"ACCESS_TOKEN": "",
"createIndex": False,
"maxCacheAge": 86400,
"preloadMessages": False,
"customActions": False,
"disableMessagesLogging": False,
'enableFlaskWebServer': False,
'useAuth': False,
'users': {
'admin':'password'
},
'port': 8080,
'https': False,
'httpsPort': 8443,
'cert': [
os.path.join(cwd, "cert.pem"),
os.path.join(cwd, "key.pem")
]
}
def grab_token_from_args():
if len(sys.argv) > 1:
defaultConfig['ACCESS_TOKEN'] = sys.argv[1]
elif defaultConfig['ACCESS_TOKEN'] == "":
raise Exception("Не задан ACCESS_TOKEN")
if not os.path.exists(os.path.join(cwd, "config.json")):
with open(os.path.join(cwd, "config.json"), 'w') as conf:
grab_token_from_args()
json.dump(defaultConfig, conf, indent=4)
config = defaultConfig
del defaultConfig
else:
with open(os.path.join(cwd, "config.json"), 'r') as conf:
config = json.load(conf)
for i in config:
if i in defaultConfig:
defaultConfig[i] = config[i]
grab_token_from_args()
if len(set(config)) - len(set(defaultConfig)) != 0:
with open(os.path.join(cwd, "config.json"), 'w') as conf:
json.dump(defaultConfig, conf, indent=4)
config = defaultConfig
del defaultConfig
stop_mutex = threading.Lock()
def run_flask_server():
port = config['httpsPort'] if config['https'] else config['port']
import socket
ip = socket.gethostbyname(socket.gethostname())
del socket
while True:
try:
if config['https']:
logger.info("Trying to run on https://%s:%s/", ip, port)
app.run(
host='0.0.0.0',
port=port,
ssl_context=(
config['cert'][0],
config['cert'][1]
)
)
else:
logger.info("Trying to run on http://%s:%s/", ip, port)
app.run(host='0.0.0.0', port=port)
except OSError:
port += 1
if config['enableFlaskWebServer']:
from flaskWebServer import app
threading.Thread(target=run_flask_server).start()
if config['createIndex']:
from updateIndex import indexUpdater
indexUpdater()
def tryAgainIfFailed(func, *args, maxRetries=5, **kwargs):
c = maxRetries
delay = 1
while True:
try:
return func(*args, **kwargs)
except vk_api.exceptions.ApiError:
if str(sys.exc_info()[1]).find("User authorization failed") != -1:
logger.warning("Токен недействителен.")
interrupt_handler(0, None)
raise Warning
except requests.exceptions.RequestException:
if delay < 32:
delay*=2
time.sleep(delay)
continue
except BaseException:
if maxRetries == 0:
logger.exception("После %s попыток %s(%s%s) завершился с ошибкой.", c, func.__name__, args, kwargs)
raise Warning
logger.warning("Перезапуск %s(%s%s) через %s секунд...", func.__name__, args, kwargs, delay)
if delay < 32:
delay*=2
time.sleep(delay)
if maxRetries > 0:
maxRetries -= 1
continue
vk_session = vk_api.VkApi(token=config['ACCESS_TOKEN'],api_version='5.130')
longpoll = VkLongPoll(vk_session, wait=60, mode=2)
vk = vk_session.get_api()
account_id = tryAgainIfFailed(vk.users.get)[0]['id']
if not config['disableMessagesLogging']:
if not os.path.exists(
os.path.join(
cwd,
"mesAct"
)
):
os.makedirs(
os.path.join(
cwd,
"mesAct"
)
)
f = open(
os.path.join(
cwd,
"mesAct",
"vkGetVideoLink.html"
),
'w',
encoding='utf-8'
)
f.write("""<!DOCTYPE html>
<html>
<head>
<meta charset="utf-8">
<style>
html,body,iframe{
width: 100%;
height: 100%;
}
</style>
</head>
<body>
<p>Если видео не проигрывается, прямую ссылку можно получить через api:</p>
<script>
function embedLink(id) {
var link = document.createElement('a');
link.href = "https://vk.com/dev/video.get?params[videos]=0_0," + id + "¶ms[count]=1¶ms[offset]=1";
link.innerText = id;
link.setAttribute('target', '_blank')
document.getElementsByTagName("body")[0].appendChild(link);
}
function embedPlayer(link) {
var frame = document.createElement('iframe');
frame.src = link;
frame.style = "width:100%;height:100%;";
frame.setAttribute('allowFullScreen', '')
document.getElementsByTagName("body")[0].appendChild(frame);
}
function splitArgs(){
var args = document.location.search;
var lastAmpersand = args.lastIndexOf('&');
return [args.slice(1, lastAmpersand), args.slice(lastAmpersand + 1)];
}
var args = splitArgs();
embedLink(args[1]);
embedPlayer(args[0]);
</script>
</body>
</html>""")
f.close()
if not os.path.exists(
os.path.join(
cwd,
"messages.db"
)
):
conn = sqlite3.connect(
os.path.join(
cwd,
"messages.db"
),
check_same_thread=False,
isolation_level=None,
timeout=15.0
)
cursor = conn.cursor()
cursor.execute("""CREATE TABLE "messages" (
"peer_id" INTEGER NOT NULL,
"user_id" INTEGER NOT NULL,
"message_id" INTEGER NOT NULL UNIQUE,
"message" TEXT,
"attachments" TEXT,
"timestamp" INTEGER NOT NULL,
"fwd_messages" TEXT
)""")
cursor.execute("""CREATE TABLE "chats_cache" (
"chat_id" INTEGER NOT NULL UNIQUE,
"chat_name" TEXT NOT NULL
)""")
cursor.execute("""CREATE TABLE "users_cache" (
"user_id" INTEGER NOT NULL UNIQUE,
"user_name" TEXT NOT NULL
)""")
account_name = tryAgainIfFailed(
vk.users.get,
user_id=account_id
)[0]
account_name = f"{account_name['first_name']} {account_name['last_name']}"
cursor.execute(
"""INSERT INTO users_cache (user_id,user_name) VALUES (?,?)""",
(account_id, account_name,)
)
conn.commit()
else:
conn = sqlite3.connect(
os.path.join(cwd, "messages.db"),
check_same_thread=False,
timeout=15.0
)
cursor = conn.cursor()
if not os.path.exists(
os.path.join(
cwd,
"mesAct",
"bootstrap.css"
)
):
f = open(
os.path.join(
cwd,
"mesAct",
"bootstrap.css"
),
'w',
encoding='utf-8'
)
f.write(':root{--blue:#007bff;--indigo:#6610f2;--purple:#6f42c1;--pink:#e83e8c;--red:#dc3545;--orange:#fd7e14;--yellow:#ffc107;--green:#28a745;--teal:#20c997;--cyan:#17a2b8;--white:#fff;--gray:#6c757d;--gray-dark:#343a40;--primary:#007bff;--secondary:#6c757d;--success:#28a745;--info:#17a2b8;--warning:#ffc107;--danger:#dc3545;--light:#f8f9fa;--dark:#343a40;--breakpoint-xs:0;--breakpoint-sm:576px;--breakpoint-md:768px;--breakpoint-lg:992px;--breakpoint-xl:1200px;--font-family-sans-serif:-apple-system,BlinkMacSystemFont,"Segoe UI",Roboto,"Helvetica Neue",Arial,"Noto Sans",sans-serif,"Apple Color Emoji","Segoe UI Emoji","Segoe UI Symbol","Noto Color Emoji";--font-family-monospace:SFMono-Regular,Menlo,Monaco,Consolas,"Liberation Mono","Courier New",monospace}*,::after,::before{box-sizing:border-box}html{font-family:sans-serif;line-height:1.15;-webkit-text-size-adjust:100%;-webkit-tap-highlight-color:transparent}body{margin:0;font-family:-apple-system,BlinkMacSystemFont,"Segoe UI",Roboto,"Helvetica Neue",Arial,"Noto Sans",sans-serif,"Apple Color Emoji","Segoe UI Emoji","Segoe UI Symbol","Noto Color Emoji";font-size:1rem;font-weight:400;line-height:1.5;color:#212529;text-align:left;background-color:#fff}dl,ol,ul{margin-top:0;margin-bottom:1rem}b,strong{font-weight:bolder}a{color:#007bff;text-decoration:none;background-color:transparent}img{vertical-align:middle;border-style:none}table{border-collapse:collapse}.table{width:100%;margin-bottom:1rem;color:#212529}.table td,.table th{padding:.75rem;vertical-align:top;border-top:1px solid #dee2e6}.table-sm td,.table-sm th{padding:.3rem}.table-bordered{border:1px solid #dee2e6}.table-bordered td,.table-bordered th{border:1px solid #dee2e6}.list-group{display:-ms-flexbox;display:flex;-ms-flex-direction:column;flex-direction:column;padding-left:0;margin-bottom:0;border-radius:.25rem}.list-group-item{position:relative;display:block;padding:.75rem 1.25rem;background-color:#fff;border:1px solid rgba(0,0,0,.125)}.list-group-item:first-child{border-top-left-radius:inherit;border-top-right-radius:inherit}.list-group-item:last-child{border-bottom-right-radius:inherit;border-bottom-left-radius:inherit}.list-group-item+.list-group-item{border-top-width:0}.stretched-link::after{position:absolute;top:0;right:0;bottom:0;left:0;z-index:1;pointer-events:auto;content:"";background-color:rgba(0,0,0,0)}.mes{word-break:break-all}img,a,audio{display:block}img{max-width:100%}')
f.close()
if config['customActions']:
from customActions import customActions
cust = customActions(vk, conn, cursor)
def bgWatcher():
while True:
maxCacheAge = config['maxCacheAge']
with stop_mutex:
logger.info("Обслуживание БД...")
try:
showMessagesWithDeletedAttachments()
except BaseException:
logger.exception("Ошибка при поиске удаленных фото")
try:
if maxCacheAge != -1:
cursor.execute(
"""DELETE FROM messages WHERE timestamp < ?""",
(time.time() - maxCacheAge,)
)
conn.commit()
cursor.execute("VACUUM")
else:
maxCacheAge = 86400
except BaseException:
logger.exception("Ошибка при очистке базы данных")
logger.info("Обслуживание БД завершено.")
time.sleep(maxCacheAge)
def interrupt_handler(signum, frame):
conn.commit()
cursor.close()
try:
tableWatcher.cancel()
except AttributeError:
pass
logger.info("Завершение...")
os._exit(0)
signal.signal(signal.SIGINT, interrupt_handler)
signal.signal(signal.SIGTERM, interrupt_handler)
def eventWorker_predefinedDisabled():
global events
while True:
flag.wait()
event = events.pop(0)
with stop_mutex:
try:
cust.act(event)
except BaseException:
logger.exception("Ошибка в customActions. \n %s", vars(event))
if len(events) == 0:
flag.clear()
def eventWorker_customDisabled():
global events
while True:
flag.wait()
event = events.pop(0)
with stop_mutex:
predefinedActions(event)
if len(events) == 0:
flag.clear()
conn.commit()
def eventWorker():
global events
while True:
flag.wait()
event = events.pop(0)
with stop_mutex:
try:
cust.act(event)
except BaseException:
logger.exception("Ошибка в customActions. \n %s", vars(event))
predefinedActions(event)
if len(events) == 0:
flag.clear()
conn.commit()
def predefinedActions(event):
try:
if event.type == VkEventType.MESSAGE_NEW:
cursor.execute(
"""INSERT INTO messages(peer_id,user_id,message_id,message,attachments,timestamp,fwd_messages) VALUES (?,?,?,?,?,?,?)""",
(event.peer_id, event.user_id, event.message_id, event.message, event.message_data[1], event.timestamp, event.message_data[2],)
)
conn.commit()
elif event.type == VkEventType.MESSAGE_EDIT:
if event.message_data[0]:
activityReport(event.message_id, event.peer_id, event.user_id, event.timestamp, True, event.message_data[1], event.message_data[2], event.text)
cursor.execute(
"""INSERT or REPLACE INTO messages(peer_id,user_id,message_id,message,attachments,timestamp,fwd_messages) VALUES (?,?,?,?,?,?,?)""",
(event.peer_id, event.user_id, event.message_id, event.message, event.message_data[1], event.timestamp, event.message_data[2],)
)
conn.commit()
elif event.type == VkEventType.MESSAGE_FLAGS_SET:
try:
activityReport(event.message_id)
cursor.execute(
"""DELETE FROM messages WHERE message_id = ?""",
(event.message_id,)
)
conn.commit()
except TypeError:
logger.info("Удаление невозможно, сообщение отсутствует в БД.")
except sqlite3.IntegrityError:
logger.warning("Запущено несколько копий программы, завершение...")
interrupt_handler(0, None)
except Warning:
pass
except BaseException:
logger.exception("Ошибка при сохранении сообщения. \n %s", vars(event))
def main():
logger.info("Запущен основной цикл.")
global events
for event in longpoll.listen():
try:
if event.raw[0] == 4 or event.raw[0] == 5:
if event.attachments != {}:
event.message_data = getAttachments(event)
else:
event.message_data = True, None, None
if event.from_user and event.raw[2] & 2:
event.user_id = account_id
elif event.from_group:
if event.from_me:
event.user_id = account_id
else:
event.user_id = event.peer_id
if not event.message:
event.message = None
events.append(event)
flag.set()
elif event.raw[0] == 2 and (event.raw[2] & 131072 or event.raw[2] & 128):
events.append(event)
flag.set()
except Warning:
pass
except BaseException:
logger.exception("Ошибка при добавлении события в очередь. \n %s", vars(event))
def showMessagesWithDeletedAttachments():
cursor.execute("""SELECT message_id, attachments FROM messages WHERE attachments IS NOT NULL""")
fetch_attachments = [[str(i[0]), json.loads(i[1])] for i in cursor.fetchall()]
cursor.execute("""SELECT message_id, fwd_messages FROM messages WHERE fwd_messages IS NOT NULL""")
fetch_fwd = [[str(i[0]), json.loads(i[1])] for i in cursor.fetchall()]
c = 0
for i in range(len(fetch_attachments)):
for j in fetch_attachments[i - c][1]:
if j['type'] == 'photo' or j['type'] == 'video' or j['type'] == 'doc':
break
else:
del fetch_attachments[i - c]
c += 1
messages_attachments = []
messages_fwd = []
for i in [[j[0] for j in fetch_attachments[i:i + 100]] for i in range(0, len(fetch_attachments), 100)]:
messages_attachments.extend(tryAgainIfFailed(
vk.messages.getById,
message_ids=','.join(i))['items']
)
for i in [[j[0] for j in fetch_fwd[i:i + 100]] for i in range(0, len(fetch_fwd), 100)]:
messages_fwd.extend(tryAgainIfFailed(
vk.messages.getById,
message_ids=','.join(i))['items']
)
c = 0
for i in range(len(fetch_attachments)):
if compareAttachments(messages_attachments[i - c]['attachments'], fetch_attachments[i - c][1]):
del fetch_attachments[i - c]
del messages_attachments[i - c]
c += 1
for i in range(len(fetch_attachments)):
activityReport(fetch_attachments[i][0])
if messages_attachments[i]['attachments'] == []:
cursor.execute(
"""UPDATE messages SET attachments = ? WHERE message_id = ?""",
(None, fetch_attachments[i][0],)
)
else:
cursor.execute(
"""UPDATE messages SET attachments = ? WHERE message_id = ?""",
(
json.dumps(messages_attachments[i]['attachments']),
fetch_attachments[i][0],
)
)
c = 0
for i in range(len(fetch_fwd)):
if compareFwd(
messages_fwd[i - c],
{
'fwd_messages': fetch_fwd[i - c][1]
}
):
del fetch_fwd[i - c]
del messages_fwd[i - c]
c += 1
for i in range(len(fetch_fwd)):
activityReport(fetch_fwd[i][0])
if messages_fwd[i]['fwd_messages'] == []:
cursor.execute(
"""UPDATE messages SET fwd_messages = ? WHERE message_id = ?""",
(None, fetch_fwd[i][0],)
)
else:
cursor.execute(
"""UPDATE messages SET fwd_messages = ? WHERE message_id = ?""",
(
json.dumps(messages_fwd[i]['fwd_messages']),
fetch_fwd[i][0],
)
)
conn.commit()
def compareFwd(new, old):
if 'reply_message' in new:
new['fwd_messages'] = [new['reply_message']]
if 'reply_message' in old:
old['fwd_messages'] = [old['reply_message']]
for i in range(len(old['fwd_messages'])):
if 'fwd_messages' in old['fwd_messages'][i] and 'fwd_messages' in new['fwd_messages'][i]:
if not compareFwd(
new['fwd_messages'][i],
old['fwd_messages'][i]
):
return False
if not compareAttachments(
new['fwd_messages'][i]['attachments'],
old['fwd_messages'][i]['attachments']
):
return False
return True
def compareAttachments(new, old):
if len(new) < len(old):
return False
return True
def attachmentsParse(urls):
if urls is None:
return ""
html = """<div>
"""
for i in urls:
urlSplit = i.split(',')
if i.find('vk.com/sticker/') != -1:
html += """ <img src="{}" />
""".format(i)
elif i.find('.jpg') != -1 and i.find(',') == -1:
html += """ <img src="{}" />
""".format(i)
elif i.find('.mp3') != -1:
html += """ <audio src="{}" controls></audio>
""".format(i)
elif i.find('https://vk.com/audio') != -1:
html += """ <a href="{}" target="_blank">
{}
</a>
""".format(i, i[23:-11].replace('%20', ' '))
elif i.find('@') != -1:
i = i.rsplit('@', 1)
html += """ <a href="{}" target="_blank">
{}
</a>
""".format(i[1], i[0])
elif len(urlSplit) == 3:
html += """ <a href="{}" target="_blank">
Видео
<img src="{}"/>
</a>
""".format(f"./vkGetVideoLink.html?{urlSplit[1]}&{urlSplit[2]}", urlSplit[0])
else:
html += """ <a href="{0}" target="_blank">
{0}
</a>
""".format(i)
html += """</div>"""
return html
def getAttachments(event):
message_id = event.message_id
fullLoadUnNeeded = not (event.raw[0] == 5 or 'fwd' in event.attachments)
count = 0
if fullLoadUnNeeded:
for i in range(1,11):
if f'attach{i}_type' in event.attachments:
if event.attachments[f'attach{i}_type'] not in ('sticker', 'link'):
fullLoadUnNeeded = False
else:
count = i
break
if fullLoadUnNeeded:
attachments = []
for i in range(1,count):
if event.attachments[f'attach{i}_type'] == 'sticker':
attachments.append({'type':'sticker','sticker':{'images':[{'height':64,'url':f'https://vk.com/sticker/1-{event.attachments[f"attach{i}"]}-64'}]}})
else:
if f'attach{i}_title' in event.attachments:
title = event.attachments[f'attach{i}_title']
else:
title = event.attachments[f'attach{i}_url']
attachments.append({'type':'link','link':{'title':title,'url':event.attachments[f'attach{i}_url']}})
return False, json.dumps(attachments, ensure_ascii=False,), None
mes = tryAgainIfFailed(
vk.messages.getById,
message_ids=message_id
)['items']
if not len(mes):
logger.info("Не удалось запросить вложения для сообщения, message_id = %i.", event.message_id)
return False, "[]", "[]"
else:
mes = mes[0]
hasUpdateTime = 'update_time' in mes
fwd_messages = None
if 'reply_message' in mes:
fwd_messages = json.dumps([mes['reply_message']], ensure_ascii=False,)
elif mes['fwd_messages'] != []:
fwd_messages = json.dumps(mes['fwd_messages'], ensure_ascii=False,)
if mes['attachments'] == []:
attachments = None
else:
attachments = json.dumps(mes['attachments'], ensure_ascii=False,)
return hasUpdateTime, attachments, fwd_messages
def parseUrls(attachments):
urls = []
for i in attachments:
if i['type'] == 'photo':
maxHeight = 0
maxUrl = ""
for j in i['photo']['sizes']:
if j['height'] > maxHeight:
maxHeight = j['height']
maxUrl = j['url']
urls.append(maxUrl)
elif i['type'] == 'audio_message':
urls.append(i['audio_message']['link_mp3'])
elif i['type'] == 'sticker':
urls.append(i['sticker']['images'][0]['url'])
elif i['type'] == 'gift':
urls.append(i['gift']['thumb_48'])
elif i['type'] == 'link':
urls.append(f"Ссылка: {i['link']['title']}@{i['link']['url']}")
elif i['type'] == 'video':
urls.append(f"{i['video']['image'][0]['url']},{i['video']['player']},{i['video']['owner_id']}_{i['video']['id']}_{i['video']['access_key']}")
elif i['type'] == 'wall':
urls.append(f"Пост: {i['wall']['text'][:25]}@https://vk.com/wall{i['wall']['from_id']}_{i['wall']['id']}")
elif i['type'] == 'wall_reply':
urls.append(f"Комментарий: {i['wall_reply']['text'][:25]}@https://vk.com/wall{i['wall_reply']['owner_id']}_{i['wall_reply']['post_id']}?reply={i['wall_reply']['id']}")
elif i['type'] == 'audio':
urls.append(f"https://vk.com/audio?q={i['audio']['artist'].replace(' ', '%20')}%20-%20{i['audio']['title'].replace(' ', '%20')}&tab=global")
elif i['type'] == 'audio_playlist':
urls.append(f"Плейлист: {i['audio_playlist']['title']}@https://vk.com/music?z=audio_playlist{i['audio_playlist']['owner_id']}_{i['audio_playlist']['id']}/{i['audio_playlist']['access_key']}")
elif i['type'] == 'market':
urls.append(f"https://vk.com/market?w=product{i['market']['owner_id']}_{i['market']['id']}")
elif i['type'] == 'poll':
urls.append(f"Голосование: {i['poll']['question'][:25]}@https://vk.com/poll{i['poll']['owner_id']}_{i['poll']['id']}")
elif i['type'] == 'doc':
urls.append(f"Документ: {i['doc']['title']}@{i['doc']['url']}")
else:
if 'url' in i[i['type']]:
urls.append(i[i['type']]['url'])
if urls == []:
return None
return urls
def getPeerName(id):
if id > 2000000000:
cursor.execute("""SELECT chat_name FROM chats_cache WHERE chat_id = ?""", (id,))
fetch = cursor.fetchone()
if fetch is None:
try:
name = tryAgainIfFailed(
vk.messages.getChat,
chat_id=id-2000000000
)['title']
cursor.execute("""INSERT INTO chats_cache (chat_id,chat_name) VALUES (?,?)""", (id, name,))
conn.commit()
except Warning:
name = "Секретный чат, используйте токен другого приложения"
else:
name = fetch[0]
elif id < 0:
cursor.execute("""SELECT user_name FROM users_cache WHERE user_id = ?""", (id,))
fetch = cursor.fetchone()
if fetch is None:
name = tryAgainIfFailed(
vk.groups.getById,
group_id=-id
)[0]['name']
cursor.execute("""INSERT INTO users_cache (user_id,user_name) VALUES (?,?)""", (id, name,))
conn.commit()
else:
name = fetch[0]
else:
cursor.execute("""SELECT user_name FROM users_cache WHERE user_id = ?""", (id,))
fetch = cursor.fetchone()
if fetch is None:
name = tryAgainIfFailed(
vk.users.get,
user_id=id
)[0]
name = f"{name['first_name']} {name['last_name']}"
cursor.execute("""INSERT INTO users_cache (user_id,user_name) VALUES (?,?)""", (id, name,))
conn.commit()
else:
name = fetch[0]
return name
def fwdParse(fwd):
html = """<table class="table table-sm table-bordered">
"""
for i in fwd:
user_name = getPeerName(i['from_id'])
if i['from_id'] < 0:
html += """ <tr>
<td>
<a href='https://vk.com/public{}' target="_blank">
{}
</a>
</td>
</tr>
""".format(-i['from_id'], user_name)
else:
html += """ <tr>
<td>
<a href='https://vk.com/id{}' target="_blank">
{}
</a>
</td>
</tr>
""".format(i['from_id'], user_name)
if i['text'] != "":
html += """ <tr>
<td>
<div class='mes'>
{}
</div>
""".format(xssFilter(i['text']))
else:
html += """ <tr>
<td>
"""
if i['attachments'] != []:
html += attachmentsParse(parseUrls(i['attachments']))
if 'fwd_messages' in i:
html += fwdParse(i['fwd_messages'])
elif 'reply_message' in i:
html += fwdParse([i['reply_message']])
html += """ </td>
</tr>
<tr>
<td>
{}
</td>
</tr>
""".format(time.strftime('%H:%M:%S %d.%m.%y', time.localtime(i['date'])))
html += "</table>"
return html
def xssFilter(s):
return s\
.replace('<', '<')\
.replace('>', '>')\
.replace('\n', '<br />')
def compareStrings(a, b):
aCounter = 0
bCounter = 0
for i in difflib.SequenceMatcher(None, a, b).get_opcodes():
if i[0] == 'insert':
b = f"{b[: i[3]+bCounter]}<ins>{b[i[3]+bCounter : i[4]+bCounter]}</ins>{b[i[4]+bCounter:]}"
bCounter += 11
elif i[0] == 'delete':
a = f"{a[: i[1]+aCounter]}<ins>{a[i[1]+aCounter : i[2]+aCounter]}</ins>{a[i[2]+aCounter:]}"
aCounter += 11
elif i[0] == 'replace':
a = f"{a[: i[1]+aCounter]}<ins>{a[i[1]+aCounter : i[2]+aCounter]}</ins>{a[i[2]+aCounter:]}"
b = f"{b[: i[3]+bCounter]}<ins>{b[i[3]+bCounter : i[4]+bCounter]}</ins>{b[i[4]+bCounter:]}"
aCounter += 11
bCounter += 11
return a, b
def activityReport(message_id, peer_id=None, user_id=None, timestamp=None, isEdited=False, attachments=None, fwd=None, message=None):
try:
peer_name = user_name = oldMessage = oldAttachments = date = oldFwd = None
cursor.execute("""SELECT * FROM messages WHERE message_id = ?""", (message_id,))
fetch = cursor.fetchone()
if attachments is not None:
attachments = parseUrls(json.loads(attachments))
if fwd is not None:
fwd = json.loads(fwd)
if fetch is None:
if isEdited:
logger.info("Изменение сообщения, отсутствующего в БД, message_id = %i.", message_id)
fetch = [0]*7
peer_name = getPeerName(peer_id)
user_name = getPeerName(user_id)
oldMessage = f"⚠️ {message}"
oldAttachments = attachments
oldFwd = fwd
date = f"<b>Доб:</b> {time.strftime('%H:%M:%S %d.%m', time.localtime(timestamp))}<br /><b>Изм:</b> {time.strftime('%H:%M:%S %d.%m', time.localtime())}"
else:
raise TypeError
else:
if fetch[3] is not None:
oldMessage = str(fetch[3])
if fetch[4] is not None:
oldAttachments = parseUrls(json.loads(fetch[4]))
if fetch[6] is not None:
oldFwd = json.loads(fetch[6])
peer_name = getPeerName(fetch[0])
user_name = getPeerName(fetch[1])
date = f"<b>Доб:</b> {time.strftime('%H:%M:%S %d.%m', time.localtime(fetch[5]))}<br /><b>Изм:</b> {time.strftime('%H:%M:%S %d.%m', time.localtime())}"
peer_id = fetch[0]
user_id = fetch[1]
del fetch
row = """ <tr><!-- {} -->
<td>{}
</td>
<td>{}
</td>
{}
<td>
{}
</td>
</tr>
"""
messageBlock = """
<div class='mes'>
{}
</div>"""
attachmentsBlock = """
<div>
<b>Вложения</b><br />
{}
</div>"""
fwdBlock = """
<div>
<b>Пересланное</b><br />
{}
</div>"""
if peer_id > 2000000000:
peer_id = """
<a href='https://vk.com/im?sel=c{}' target='_blank'>
{}
</a>""".format(str(peer_id-2000000000), peer_name)
elif peer_id < 0:
peer_id = """
<a href='https://vk.com/public{}' target='_blank'>
{}
</a>""".format(str(-peer_id), peer_name)
else:
peer_id = """
<a href='https://vk.com/id{}' target='_blank'>
{}
</a>""".format(str(peer_id), peer_name)
if user_id < 0:
user_id = """
<a href='https://vk.com/public{}' target='_blank'>
{}
</a>""".format(str(-user_id), user_name)
else:
user_id = """
<a href='https://vk.com/id{}' target='_blank'>
{}
</a>""".format(str(user_id), user_name)
if isEdited:
if not (oldMessage is None or message is None):
message = xssFilter(message)
oldMessage = xssFilter(oldMessage)
message, oldMessage = compareStrings(message, oldMessage)
oldMessage = messageBlock.format(oldMessage)
message = messageBlock.format(message)
elif oldMessage is None:
oldMessage = ""
message = messageBlock.format(xssFilter(message))
else:
oldMessage = messageBlock.format(xssFilter(oldMessage))
message = ""
if oldAttachments is not None:
oldAttachments = attachmentsBlock.format(attachmentsParse(oldAttachments))
else:
oldAttachments = ""
if oldFwd is not None:
oldFwd = fwdBlock.format(fwdParse(oldFwd))
else:
oldFwd = ""
if attachments is not None:
attachments = attachmentsBlock.format(attachmentsParse(attachments))
else:
attachments = ""
if fwd is not None:
fwd = fwdBlock.format(fwdParse(fwd))
else:
fwd = ""
messageBlock = """<td width='50%'>
<b>Старое</b><br />{}
</td>
<td width='50%'>
<b>Новое</b><br />{}
</td>""".format(oldMessage+oldAttachments+oldFwd, message+attachments+fwd)
else:
if oldMessage is not None:
oldMessage = messageBlock.format(xssFilter(oldMessage))
else:
oldMessage = ""
if oldAttachments is not None:
oldAttachments = attachmentsBlock.format(attachmentsParse(oldAttachments))
else:
oldAttachments = ""
if oldFwd is not None:
oldFwd = fwdBlock.format(fwdParse(oldFwd))
else:
oldFwd = ""
messageBlock = """<td width='100%' colspan='2'>
<b>Удалено</b><br />{}
</td>""".format(oldMessage+oldAttachments+oldFwd)
row = row.format(message_id, peer_id, user_id, messageBlock, date)
if os.path.exists(
os.path.join(
cwd,
"mesAct",
f"messages_{time.strftime('%d%m%y', time.localtime())}.html"
)
):
messagesActivities = open(
os.path.join(
cwd,
"mesAct",
f"messages_{time.strftime('%d%m%y',time.localtime())}.html"
),
'r',
encoding='utf-8'
)
messagesDump = messagesActivities.read()
messagesActivities.close()
messagesActivities = open(
os.path.join(
cwd,
"mesAct",
f"messages_{time.strftime('%d%m%y',time.localtime())}.html"
),
'w',
encoding='utf-8'
)
else:
messagesDump = template
messagesActivities = open(
os.path.join(
cwd,
"mesAct",
f"messages_{time.strftime('%d%m%y',time.localtime())}.html"
),
'w',
encoding='utf-8'
)
messagesDump = messagesDump[:offset]+row+messagesDump[offset:]
messagesActivities.write(messagesDump)
messagesActivities.close()
except TypeError:
raise TypeError
except BaseException:
logger.exception("Ошибка при логгировании изменений.")
if not config['disableMessagesLogging']:
tableWatcher = threading.Thread(target=bgWatcher)
tableWatcher.start()
template = """<!DOCTYPE html>
<html>
<head>
<meta charset="utf-8">
<link rel="stylesheet" href="./bootstrap.css">
</head>
<body>
<table class="table table-sm">
</table>
</body>
</html>"""
offset = template.index(""" </table>""")
events = []
flag = threading.Event()
def preloadMessages():
logger.info("Предзагрузка сообщений...")
offset = 0
peer_ids = []
messages = []
shouldContinue = True
try:
while shouldContinue:
shouldContinue = False
dialogs = tryAgainIfFailed(vk.messages.getConversations, offset=offset, count=20)
for i in range(0,len(dialogs['items'])):
if dialogs['items'][i]['last_message']['date'] >= time.time() - config['maxCacheAge']:
peer_ids.append(dialogs['items'][i]['conversation']['peer']['id'])
if i == len(dialogs['items']) - 1:
shouldContinue = True
offset+=20
for i in peer_ids:
offset = 0
if i > 2000000000:
count = 200
else:
count = 50
shouldContinue = True
while shouldContinue:
shouldContinue = False
mes = vk.messages.getHistory(offset=offset, count=count, peer_id=i)['items']
if mes[-1]['date']>= time.time() - config['maxCacheAge']:
shouldContinue = True
offset+=count
for j in mes:
if j['date'] >= time.time() - config['maxCacheAge']:
messages.append(j)
for i in messages:
message_id = i['id']
with stop_mutex:
cursor.execute("""SELECT message_id FROM messages WHERE message_id = ?""", (message_id,))
if cursor.fetchone() is not None:
continue
peer_id = i['peer_id']
user_id = i['from_id']
message = i['text']
timestamp = i['date']
fwd_messages = None
if 'reply_message' in i:
fwd_messages = json.dumps([i['reply_message']], ensure_ascii=False,)
elif i['fwd_messages'] != []:
fwd_messages = json.dumps(i['fwd_messages'], ensure_ascii=False,)
if i['attachments'] == []:
attachments = None
else:
attachments = json.dumps(i['attachments'], ensure_ascii=False,)
with stop_mutex:
cursor.execute(
"""INSERT INTO messages(peer_id,user_id,message_id,message,attachments,timestamp,fwd_messages) VALUES (?,?,?,?,?,?,?)""",
(peer_id, user_id, message_id, message, attachments, timestamp, fwd_messages,)
)
conn.commit()
except BaseException:
logger.exception("Ошибка во время предзагрузки сообщений")
logger.info("Предзагрузка сообщений завершена.")
if config['customActions'] and config['disableMessagesLogging']:
threading.Thread(target=eventWorker_predefinedDisabled).start()
elif not config['disableMessagesLogging'] and not config['customActions']:
threading.Thread(target=eventWorker_customDisabled).start()
else:
threading.Thread(target=eventWorker).start()
if config['preloadMessages']:
threading.Thread(target=preloadMessages).start()
try:
tryAgainIfFailed(
main,
maxRetries=-1
)
except Warning:
pass
| true | true |
f702c7b2633322629d2c55aa4ffcdb1946ff6acb | 946 | py | Python | events.py | tilakchandlo/swing | f4aa10dd2858dfe85dc1d5c7077c883d2cf19d8d | [
"Apache-2.0"
] | 1 | 2021-07-05T10:18:30.000Z | 2021-07-05T10:18:30.000Z | events.py | tilakchandlo/swing | f4aa10dd2858dfe85dc1d5c7077c883d2cf19d8d | [
"Apache-2.0"
] | null | null | null | events.py | tilakchandlo/swing | f4aa10dd2858dfe85dc1d5c7077c883d2cf19d8d | [
"Apache-2.0"
] | 1 | 2021-04-29T11:08:59.000Z | 2021-04-29T11:08:59.000Z | """
Definition of events.
"""
from abc import ABC
EVENT_LOG = 'eLog' #Log Event
EVENT_MARKETDATA = 'eMarketData' #Pushing MarketData Event
EVENT_TRADE = 'eTrade' #Trade Event
EVENT_BUY = 'eBuy' #Buy Event
EVENT_SELL = 'eSell' #Sell Event
EVENT_CANCEL = 'eCancel' #Cancel Event
EVENT_POSITION = 'ePosition' #Position Query Event
EVENT_STATUS = 'eStatus' #Order Status Event
EVENT_ACCOUNT = 'eAccount' #Account Query Event
EVENT_PROFIT_CHANGED = 'eProfitChanged' #Profit Event
class StrategyEvent:
def __init__(self, type_=None, even_param_=None):
self.type_ = type_
self.even_param_ = even_param_
def clear(self):
"""
Delete unreferenced source.
"""
self.even_param_.clear()
class EventEngine(ABC):
pass
| 27.028571 | 68 | 0.571882 |
from abc import ABC
EVENT_LOG = 'eLog'
EVENT_MARKETDATA = 'eMarketData'
EVENT_TRADE = 'eTrade'
EVENT_BUY = 'eBuy'
EVENT_SELL = 'eSell'
EVENT_CANCEL = 'eCancel'
EVENT_POSITION = 'ePosition'
EVENT_STATUS = 'eStatus'
EVENT_ACCOUNT = 'eAccount'
EVENT_PROFIT_CHANGED = 'eProfitChanged'
class StrategyEvent:
def __init__(self, type_=None, even_param_=None):
self.type_ = type_
self.even_param_ = even_param_
def clear(self):
self.even_param_.clear()
class EventEngine(ABC):
pass
| true | true |
f702ca819293ff5b6e420a06411eaf1637cfb437 | 5,235 | py | Python | web/addons/sale_stock/res_config.py | diogocs1/comps | 63df07f6cf21c41e4527c06e2d0499f23f4322e7 | [
"Apache-2.0"
] | 1 | 2019-12-29T11:53:56.000Z | 2019-12-29T11:53:56.000Z | odoo/addons/sale_stock/res_config.py | tuanquanghpvn/odoo8-tutorial | 52d25f1ca5f233c431cb9d3b24b79c3b4fb5127e | [
"MIT"
] | null | null | null | odoo/addons/sale_stock/res_config.py | tuanquanghpvn/odoo8-tutorial | 52d25f1ca5f233c431cb9d3b24b79c3b4fb5127e | [
"MIT"
] | 3 | 2020-10-08T14:42:10.000Z | 2022-01-28T14:12:29.000Z | # -*- coding: utf-8 -*-
##############################################################################
#
# OpenERP, Open Source Business Applications
# Copyright (C) 2004-2012 OpenERP S.A. (<http://openerp.com>).
#
# This program is free software: you can redistribute it and/or modify
# it under the terms of the GNU Affero General Public License as
# published by the Free Software Foundation, either version 3 of the
# License, or (at your option) any later version.
#
# This program is distributed in the hope that it will be useful,
# but WITHOUT ANY WARRANTY; without even the implied warranty of
# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
# GNU Affero General Public License for more details.
#
# You should have received a copy of the GNU Affero General Public License
# along with this program. If not, see <http://www.gnu.org/licenses/>.
#
##############################################################################
import openerp
from openerp import SUPERUSER_ID
from openerp.osv import fields, osv
from openerp.tools.translate import _
class sale_configuration(osv.osv_memory):
_inherit = 'sale.config.settings'
_columns = {
'group_invoice_deli_orders': fields.boolean('Generate invoices after and based on delivery orders',
implied_group='sale_stock.group_invoice_deli_orders',
help="To allow your salesman to make invoices for Delivery Orders using the menu 'Deliveries to Invoice'."),
'task_work': fields.boolean("Prepare invoices based on task's activities",
help='Lets you transfer the entries under tasks defined for Project Management to '
'the Timesheet line entries for particular date and particular user with the effect of creating, editing and deleting either ways '
'and to automatically creates project tasks from procurement lines.\n'
'-This installs the modules project_timesheet and sale_service.'),
'default_order_policy': fields.selection(
[('manual', 'Invoice based on sales orders'), ('picking', 'Invoice based on deliveries')],
'The default invoicing method is', default_model='sale.order',
help="You can generate invoices based on sales orders or based on shippings."),
'module_delivery': fields.boolean('Allow adding shipping costs',
help='Allows you to add delivery methods in sales orders and delivery orders.\n'
'You can define your own carrier and delivery grids for prices.\n'
'-This installs the module delivery.'),
'default_picking_policy' : fields.boolean("Deliver all at once when all products are available.",
help = "Sales order by default will be configured to deliver all products at once instead of delivering each product when it is available. This may have an impact on the shipping price."),
'group_mrp_properties': fields.boolean('Product properties on order lines',
implied_group='sale.group_mrp_properties',
help="Allows you to tag sales order lines with properties."),
'module_project_timesheet': fields.boolean("Project Timesheet"),
'module_sale_service': fields.boolean("Sale Service"),
'group_route_so_lines': fields.boolean('Choose MTO, drop shipping,... on sales order lines',
implied_group='sale_stock.group_route_so_lines',
help="Allows you to choose a delivery route on sales order lines"),
}
_defaults = {
'default_order_policy': 'manual',
}
def default_get(self, cr, uid, fields, context=None):
res = super(sale_configuration, self).default_get(cr, uid, fields, context)
# task_work, time_unit depend on other fields
res['task_work'] = res.get('module_sale_service') and res.get('module_project_timesheet')
return res
def get_default_sale_config(self, cr, uid, ids, context=None):
ir_values = self.pool.get('ir.values')
default_picking_policy = ir_values.get_default(cr, uid, 'sale.order', 'picking_policy')
return {
'default_picking_policy': default_picking_policy == 'one',
}
def set_sale_defaults(self, cr, uid, ids, context=None):
if uid != SUPERUSER_ID and not self.pool['res.users'].has_group(cr, uid, 'base.group_erp_manager'):
raise openerp.exceptions.AccessError(_("Only administrators can change the settings"))
ir_values = self.pool.get('ir.values')
wizard = self.browse(cr, uid, ids)[0]
default_picking_policy = 'one' if wizard.default_picking_policy else 'direct'
ir_values.set_default(cr, SUPERUSER_ID, 'sale.order', 'picking_policy', default_picking_policy)
res = super(sale_configuration, self).set_sale_defaults(cr, uid, ids, context)
return res
def onchange_invoice_methods(self, cr, uid, ids, group_invoice_so_lines, group_invoice_deli_orders, context=None):
if not group_invoice_deli_orders:
return {'value': {'default_order_policy': 'manual'}}
if not group_invoice_so_lines:
return {'value': {'default_order_policy': 'picking'}}
return {}
| 56.290323 | 200 | 0.670487 | true | true | |
f702caa371c248da66937b8521efe91e4540f538 | 3,164 | py | Python | tests/test_preprocessing.py | liuyigh/CITE-seq-Count | 5d03e382468fb28187dc15ee1d612dacaac52246 | [
"MIT"
] | null | null | null | tests/test_preprocessing.py | liuyigh/CITE-seq-Count | 5d03e382468fb28187dc15ee1d612dacaac52246 | [
"MIT"
] | null | null | null | tests/test_preprocessing.py | liuyigh/CITE-seq-Count | 5d03e382468fb28187dc15ee1d612dacaac52246 | [
"MIT"
] | null | null | null | import pytest
import io
from cite_seq_count import preprocessing
@pytest.fixture
def data():
from collections import OrderedDict
from itertools import islice
# Test file paths
pytest.correct_whitelist_path = 'tests/test_data/whitelists/correct.csv'
pytest.correct_tags_path = 'tests/test_data/tags/correct.csv'
pytest.correct_R1_path = 'tests/test_data/fastq/correct_R1.fastq.gz'
pytest.correct_R2_path = 'tests/test_data/fastq/correct_R2.fastq.gz'
pytest.corrupt_R1_path = 'tests/test_data/fastq/corrupted_R1.fastq.gz'
pytest.corrupt_R2_path = 'tests/test_data/fastq/corrupted_R2.fastq.gz'
# Create some variables to compare to
pytest.correct_whitelist = set(['ACTGTTTTATTGGCCT','TTCATAAGGTAGGGAT'])
pytest.correct_tags = {
'AGGACCATCCAA':'CITE_LEN_12_1',
'ACATGTTACCGT':'CITE_LEN_12_2',
'AGCTTACTATCC':'CITE_LEN_12_3',
'TCGATAATGCGAGTACAA':'CITE_LEN_18_1',
'GAGGCTGAGCTAGCTAGT':'CITE_LEN_18_2',
'GGCTGATGCTGACTGCTA':'CITE_LEN_18_3',
'TGTGACGTATTGCTAGCTAG':'CITE_LEN_20_1',
'ACTGTCTAACGGGTCAGTGC':'CITE_LEN_20_2',
'TATCACATCGGTGGATCCAT':'CITE_LEN_20_3'}
pytest.correct_ordered_tags = OrderedDict({
'TGTGACGTATTGCTAGCTAG':'CITE_LEN_20_1-TGTGACGTATTGCTAGCTAG',
'ACTGTCTAACGGGTCAGTGC':'CITE_LEN_20_2-ACTGTCTAACGGGTCAGTGC',
'TATCACATCGGTGGATCCAT':'CITE_LEN_20_3-TATCACATCGGTGGATCCAT',
'TCGATAATGCGAGTACAA':'CITE_LEN_18_1-TCGATAATGCGAGTACAA',
'GAGGCTGAGCTAGCTAGT':'CITE_LEN_18_2-GAGGCTGAGCTAGCTAGT',
'GGCTGATGCTGACTGCTA':'CITE_LEN_18_3-GGCTGATGCTGACTGCTA',
'AGGACCATCCAA':'CITE_LEN_12_1-AGGACCATCCAA',
'ACATGTTACCGT':'CITE_LEN_12_2-ACATGTTACCGT',
'AGCTTACTATCC':'CITE_LEN_12_3-AGCTTACTATCC'})
pytest.barcode_slice = slice(0, 16)
pytest.umi_slice = slice(16, 26)
pytest.barcode_umi_length = 26
@pytest.mark.dependency()
def test_parse_whitelist_csv(data):
assert preprocessing.parse_whitelist_csv(pytest.correct_whitelist_path, 16, 1) == (pytest.correct_whitelist,1)
@pytest.mark.dependency()
def test_parse_tags_csv(data):
assert preprocessing.parse_tags_csv(pytest.correct_tags_path) == pytest.correct_tags
@pytest.mark.dependency(depends=['test_parse_tags_csv'])
def test_check_tags(data):
assert preprocessing.check_tags(pytest.correct_tags, 5) == pytest.correct_ordered_tags
@pytest.mark.dependency(depends=['test_check_tags'])
def test_check_distance_too_big_between_tags(data):
with pytest.raises(SystemExit):
preprocessing.check_tags(pytest.correct_tags, 8)
@pytest.mark.dependency(depends=['test_parse_whitelist_csv'])
def test_check_barcodes_lengths(data):
assert preprocessing.check_barcodes_lengths(26, 1, 16, 17, 26) == (pytest.barcode_slice, pytest.umi_slice, pytest.barcode_umi_length)
@pytest.mark.dependency()
def test_get_n_lines(data):
assert preprocessing.get_n_lines(pytest.correct_R1_path) == (200 * 4)
@pytest.mark.dependency(depends=['test_get_n_lines'])
def test_get_n_lines_not_multiple_of_4(data):
with pytest.raises(SystemExit):
preprocessing.get_n_lines(pytest.corrupt_R1_path) | 43.342466 | 137 | 0.760114 | import pytest
import io
from cite_seq_count import preprocessing
@pytest.fixture
def data():
from collections import OrderedDict
from itertools import islice
pytest.correct_whitelist_path = 'tests/test_data/whitelists/correct.csv'
pytest.correct_tags_path = 'tests/test_data/tags/correct.csv'
pytest.correct_R1_path = 'tests/test_data/fastq/correct_R1.fastq.gz'
pytest.correct_R2_path = 'tests/test_data/fastq/correct_R2.fastq.gz'
pytest.corrupt_R1_path = 'tests/test_data/fastq/corrupted_R1.fastq.gz'
pytest.corrupt_R2_path = 'tests/test_data/fastq/corrupted_R2.fastq.gz'
pytest.correct_whitelist = set(['ACTGTTTTATTGGCCT','TTCATAAGGTAGGGAT'])
pytest.correct_tags = {
'AGGACCATCCAA':'CITE_LEN_12_1',
'ACATGTTACCGT':'CITE_LEN_12_2',
'AGCTTACTATCC':'CITE_LEN_12_3',
'TCGATAATGCGAGTACAA':'CITE_LEN_18_1',
'GAGGCTGAGCTAGCTAGT':'CITE_LEN_18_2',
'GGCTGATGCTGACTGCTA':'CITE_LEN_18_3',
'TGTGACGTATTGCTAGCTAG':'CITE_LEN_20_1',
'ACTGTCTAACGGGTCAGTGC':'CITE_LEN_20_2',
'TATCACATCGGTGGATCCAT':'CITE_LEN_20_3'}
pytest.correct_ordered_tags = OrderedDict({
'TGTGACGTATTGCTAGCTAG':'CITE_LEN_20_1-TGTGACGTATTGCTAGCTAG',
'ACTGTCTAACGGGTCAGTGC':'CITE_LEN_20_2-ACTGTCTAACGGGTCAGTGC',
'TATCACATCGGTGGATCCAT':'CITE_LEN_20_3-TATCACATCGGTGGATCCAT',
'TCGATAATGCGAGTACAA':'CITE_LEN_18_1-TCGATAATGCGAGTACAA',
'GAGGCTGAGCTAGCTAGT':'CITE_LEN_18_2-GAGGCTGAGCTAGCTAGT',
'GGCTGATGCTGACTGCTA':'CITE_LEN_18_3-GGCTGATGCTGACTGCTA',
'AGGACCATCCAA':'CITE_LEN_12_1-AGGACCATCCAA',
'ACATGTTACCGT':'CITE_LEN_12_2-ACATGTTACCGT',
'AGCTTACTATCC':'CITE_LEN_12_3-AGCTTACTATCC'})
pytest.barcode_slice = slice(0, 16)
pytest.umi_slice = slice(16, 26)
pytest.barcode_umi_length = 26
@pytest.mark.dependency()
def test_parse_whitelist_csv(data):
assert preprocessing.parse_whitelist_csv(pytest.correct_whitelist_path, 16, 1) == (pytest.correct_whitelist,1)
@pytest.mark.dependency()
def test_parse_tags_csv(data):
assert preprocessing.parse_tags_csv(pytest.correct_tags_path) == pytest.correct_tags
@pytest.mark.dependency(depends=['test_parse_tags_csv'])
def test_check_tags(data):
assert preprocessing.check_tags(pytest.correct_tags, 5) == pytest.correct_ordered_tags
@pytest.mark.dependency(depends=['test_check_tags'])
def test_check_distance_too_big_between_tags(data):
with pytest.raises(SystemExit):
preprocessing.check_tags(pytest.correct_tags, 8)
@pytest.mark.dependency(depends=['test_parse_whitelist_csv'])
def test_check_barcodes_lengths(data):
assert preprocessing.check_barcodes_lengths(26, 1, 16, 17, 26) == (pytest.barcode_slice, pytest.umi_slice, pytest.barcode_umi_length)
@pytest.mark.dependency()
def test_get_n_lines(data):
assert preprocessing.get_n_lines(pytest.correct_R1_path) == (200 * 4)
@pytest.mark.dependency(depends=['test_get_n_lines'])
def test_get_n_lines_not_multiple_of_4(data):
with pytest.raises(SystemExit):
preprocessing.get_n_lines(pytest.corrupt_R1_path) | true | true |
f702cc5e6ea08c3e34d01f04c4c75d3ab18e6e75 | 4,384 | py | Python | chess/python/chess_server.py | MrXisOnline/C-Program | 9b95802a2d62f46f28039b5dae306d30296ecab0 | [
"MIT"
] | null | null | null | chess/python/chess_server.py | MrXisOnline/C-Program | 9b95802a2d62f46f28039b5dae306d30296ecab0 | [
"MIT"
] | null | null | null | chess/python/chess_server.py | MrXisOnline/C-Program | 9b95802a2d62f46f28039b5dae306d30296ecab0 | [
"MIT"
] | null | null | null | from game_data import *
from hosting import ServerHandler, ClientHandler
import json
board = [
["R", "K", "B", "Q", "E", "B", "K", "R"],
["P", "P", "P", "P", "P", "P", "P", "P"],
[" ", " ", " ", " ", " ", " ", " ", " "],
[" ", " ", " ", " ", " ", " ", " ", " "],
[" ", " ", " ", " ", " ", " ", " ", " "],
[" ", " ", " ", " ", " ", " ", " ", " "],
["P", "P", "P", "P", "P", "P", "P", "P"],
["R", "K", "B", "Q", "E", "B", "K", "R"]
]
pieces = Initiator()
pos_handler = PositionHandler(pieces[0]+pieces[1])
p1 = Player("white", pieces[0])
p2 = Player("black", pieces[1])
player_handler = PlayerHandler(p1, p2)
end = False
win_team = None
checkmate = False
try:
try:
net = eval(input("Enter Server IP, Port to Host: "))
except KeyboardInterrupt:
exit()
if type(net[0]) == str and net[1] > 5000 and net[1] < 65000:
server = ServerHandler(*net)
DisplayBoard(board)
while True:
error_msg = ""
if player_handler.current.team == "white":
if checkmate:
error_msg = "You're in Checkmate"
print(player_handler.current.give_pieces_position())
try:
piece_pos = eval(input("Position of Piece: "))
piece_to_go = eval(input("Position To Go: "))
except KeyboardInterrupt:
break
if PositionChecks(piece_pos) and PositionChecks(piece_to_go):
piece = pos_handler.get_piece(piece_pos)
if piece == False or piece.team != player_handler.current.team:
error_msg = "Piece Position is Incorrect"
else:
check, piece, n_board = player_handler.play_piece(piece, piece_to_go, board, pos_handler)
if check:
board = n_board
if piece != " ":
pieces[2].append(piece)
player_handler.remove_piece(piece)
pos_handler = PositionHandler(player_handler.player1.pieces + player_handler.player2.pieces)
end, lose_player = player_handler.game_end()
checkmate = player_handler.checkmate(board, pos_handler)
player_handler.change_player()
else:
error_msg = "Bad Position"
else:
error_msg = "Bad Position"
clear_screen()
DisplayBoard(board)
print(error_msg)
if end:
break
win_team = "white" if lose_player.team == "black" else "black"
else:
if checkmate:
server.send_state(server.encode_state("", "", "You're in Checkmate"))
server.send_state(server.encode_state(board, player_handler.current.give_pieces_position(), ""))
server.send_state("input")
pos_data = server.recv_inputs()
try:
pos_data = json.loads(pos_data)
print(pos_data)
piece_pos = tuple(pos_data["piece_pos"])
piece_to_go = tuple(pos_data["piece_to_go"])
if PositionChecks(piece_pos) and PositionChecks(piece_to_go):
piece = pos_handler.get_piece(piece_pos)
print(piece)
if piece == False or piece.team != player_handler.current.team:
server.send_state(server.encode_state("", "", "Piece Position is Incorrect"))
else:
check, piece, n_board = player_handler.play_piece(piece, piece_to_go, board, pos_handler)
if check:
board = n_board
if piece != " ":
pieces[2].append(piece)
player_handler.remove_piece(piece)
pos_handler = PositionHandler(player_handler.player1.pieces + player_handler.player2.pieces)
end, lose_player = player_handler.game_end()
checkmate = player_handler.checkmate(board, pos_handler)
player_handler.change_player()
server.send_state(server.encode_state(board, "", ""))
else:
server.send_state(server.encode_state("", "", "Bad Position"))
else:
server.send_state(server.encode_state("", "", "Bad Position"))
# clear_screen()
if end:
win_team = "white" if lose_player.team == "black" else "black"
break
clear_screen()
DisplayBoard(board)
except json.decoder.JSONDecodeError:
pass
server.send_state(server.encode_state("", "", f"{win_team} Won The Match"))
server.close_conn("end")
else:
print("[-] IP/Port is not Correctly Specified as rules.")
print("[-] Ip should be like \"127.0.0.1\" and Port Should be Between 5000 and 65000")
print("[-] Enter both like this \"127.0.0.1\", 9999")
print("[-] Do It Correctly Next Time Bitch :]")
except ConnectionResetError:
print("Client Disconnected")
except SyntaxError:
server.close_conn("end")
print("Syntax Error") | 36.840336 | 100 | 0.627053 | from game_data import *
from hosting import ServerHandler, ClientHandler
import json
board = [
["R", "K", "B", "Q", "E", "B", "K", "R"],
["P", "P", "P", "P", "P", "P", "P", "P"],
[" ", " ", " ", " ", " ", " ", " ", " "],
[" ", " ", " ", " ", " ", " ", " ", " "],
[" ", " ", " ", " ", " ", " ", " ", " "],
[" ", " ", " ", " ", " ", " ", " ", " "],
["P", "P", "P", "P", "P", "P", "P", "P"],
["R", "K", "B", "Q", "E", "B", "K", "R"]
]
pieces = Initiator()
pos_handler = PositionHandler(pieces[0]+pieces[1])
p1 = Player("white", pieces[0])
p2 = Player("black", pieces[1])
player_handler = PlayerHandler(p1, p2)
end = False
win_team = None
checkmate = False
try:
try:
net = eval(input("Enter Server IP, Port to Host: "))
except KeyboardInterrupt:
exit()
if type(net[0]) == str and net[1] > 5000 and net[1] < 65000:
server = ServerHandler(*net)
DisplayBoard(board)
while True:
error_msg = ""
if player_handler.current.team == "white":
if checkmate:
error_msg = "You're in Checkmate"
print(player_handler.current.give_pieces_position())
try:
piece_pos = eval(input("Position of Piece: "))
piece_to_go = eval(input("Position To Go: "))
except KeyboardInterrupt:
break
if PositionChecks(piece_pos) and PositionChecks(piece_to_go):
piece = pos_handler.get_piece(piece_pos)
if piece == False or piece.team != player_handler.current.team:
error_msg = "Piece Position is Incorrect"
else:
check, piece, n_board = player_handler.play_piece(piece, piece_to_go, board, pos_handler)
if check:
board = n_board
if piece != " ":
pieces[2].append(piece)
player_handler.remove_piece(piece)
pos_handler = PositionHandler(player_handler.player1.pieces + player_handler.player2.pieces)
end, lose_player = player_handler.game_end()
checkmate = player_handler.checkmate(board, pos_handler)
player_handler.change_player()
else:
error_msg = "Bad Position"
else:
error_msg = "Bad Position"
clear_screen()
DisplayBoard(board)
print(error_msg)
if end:
break
win_team = "white" if lose_player.team == "black" else "black"
else:
if checkmate:
server.send_state(server.encode_state("", "", "You're in Checkmate"))
server.send_state(server.encode_state(board, player_handler.current.give_pieces_position(), ""))
server.send_state("input")
pos_data = server.recv_inputs()
try:
pos_data = json.loads(pos_data)
print(pos_data)
piece_pos = tuple(pos_data["piece_pos"])
piece_to_go = tuple(pos_data["piece_to_go"])
if PositionChecks(piece_pos) and PositionChecks(piece_to_go):
piece = pos_handler.get_piece(piece_pos)
print(piece)
if piece == False or piece.team != player_handler.current.team:
server.send_state(server.encode_state("", "", "Piece Position is Incorrect"))
else:
check, piece, n_board = player_handler.play_piece(piece, piece_to_go, board, pos_handler)
if check:
board = n_board
if piece != " ":
pieces[2].append(piece)
player_handler.remove_piece(piece)
pos_handler = PositionHandler(player_handler.player1.pieces + player_handler.player2.pieces)
end, lose_player = player_handler.game_end()
checkmate = player_handler.checkmate(board, pos_handler)
player_handler.change_player()
server.send_state(server.encode_state(board, "", ""))
else:
server.send_state(server.encode_state("", "", "Bad Position"))
else:
server.send_state(server.encode_state("", "", "Bad Position"))
if end:
win_team = "white" if lose_player.team == "black" else "black"
break
clear_screen()
DisplayBoard(board)
except json.decoder.JSONDecodeError:
pass
server.send_state(server.encode_state("", "", f"{win_team} Won The Match"))
server.close_conn("end")
else:
print("[-] IP/Port is not Correctly Specified as rules.")
print("[-] Ip should be like \"127.0.0.1\" and Port Should be Between 5000 and 65000")
print("[-] Enter both like this \"127.0.0.1\", 9999")
print("[-] Do It Correctly Next Time Bitch :]")
except ConnectionResetError:
print("Client Disconnected")
except SyntaxError:
server.close_conn("end")
print("Syntax Error") | true | true |
f702ccf3a56618e39a544845aed829d512ad3ede | 6,100 | py | Python | pydifact/segments.py | mj0nez/pydifact | 3833060d30a3ac5601ec14902d844655ca9b0fc4 | [
"MIT"
] | null | null | null | pydifact/segments.py | mj0nez/pydifact | 3833060d30a3ac5601ec14902d844655ca9b0fc4 | [
"MIT"
] | null | null | null | pydifact/segments.py | mj0nez/pydifact | 3833060d30a3ac5601ec14902d844655ca9b0fc4 | [
"MIT"
] | null | null | null | # Pydifact - a python edifact library
#
# Copyright (c) 2019 Christian González
#
# Permission is hereby granted, free of charge, to any person obtaining a copy of
# this software and associated documentation files (the "Software"), to deal in
# the Software without restriction, including without limitation the rights to
# use, copy, modify, merge, publish, distribute, sublicense, and/or sell
# copies of the Software, and to permit persons to whom the Software is
# furnished to do so, subject to the following conditions:
#
# The above copyright notice and this permission notice shall be included in all
# copies or substantial portions of the Software.
#
# THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
# IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
# FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
# AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
# LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
# OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
# THE SOFTWARE.
from typing import Union, List
from pydifact.api import EDISyntaxError, PluginMount
from pydifact.control import Characters
class SegmentProvider(metaclass=PluginMount):
"""This is a plugin mount point for Segment plugins which represent a certain EDIFACT Segment.
Classes implementing this PluginMount should provide the following attributes:
"""
def __str__(self):
"""Returns the user readable text representation of this segment."""
def validate(self) -> bool:
"""Validates the Segment."""
class Segment(SegmentProvider):
"""Represents a low-level segment of an EDI interchange.
This class is used internally. read-world implementations of specialized should subclass Segment and provide
the `tag` and `validate` attributes.
"""
# tag is not a class attribute in this case, as each Segment instance could have another tag.
__omitted__ = True
def __init__(self, tag: str, *elements: Union[str, List[str]]):
"""Create a new Segment instance.
:param str tag: The code/tag of the segment. Must not be empty.
:param list elements: The data elements for this segment, as (possibly empty) list.
"""
self.tag = tag
# The data elements for this segment.
# this is converted to a list (due to the fact that python creates a tuple
# when passing a variable arguments list to a method)
self.elements = list(elements)
def __str__(self) -> str:
"""Returns the Segment in Python list printout"""
return "'{tag}' EDI segment: {elements}".format(
tag=self.tag, elements=str(self.elements)
)
def __repr__(self) -> str:
return "{} segment: {}".format(self.tag, str(self.elements))
def __eq__(self, other) -> bool:
# FIXME the other way round too? isinstance(other, type(self))?
return (
isinstance(self, type(other))
and self.tag == other.tag
and list(self.elements) == list(other.elements)
)
def __getitem__(self, key):
return self.elements[key]
def __setitem__(self, key, value):
self.elements[key] = value
def validate(self) -> bool:
"""
Segment validation.
The Segment class is part of the lower level interfaces of pydifact.
So it assumes that the given parameters are correct, there is no validation done here.
However, in segments derived from this class, there should be validation.
:return: bool True if given tag and elements are a valid EDIFACT segment, False if not.
"""
# FIXME: there should be a way of returning an error message - WHICH kind of validation failed.
if not self.tag:
return False
return True
class EDIenergySegment(Segment):
def __init__(self, tag: str, *elements: Union[str, List[str]]):
super().__init__(tag, *elements)
def validate(self) -> bool:
if not super().validate():
return False
else:
# TODO add validation method for EDI@Energy
pass
class SegmentFactory:
"""Factory for producing segments."""
characters = None
@staticmethod
def create_segment(
name: str, *elements: Union[str, List[str]], validate: bool = True
) -> Segment:
"""Create a new instance of the relevant class type.
:param name: The name of the segment
:param elements: The data elements for this segment
:param validate: bool if True, the created segment is validated before return
"""
if not SegmentFactory.characters:
SegmentFactory.characters = Characters()
# Basic segment type validation is done here.
# The more special validation must be done in the corresponding Segment
if not name:
raise EDISyntaxError("The tag of a segment must not be empty.")
if type(name) != str:
raise EDISyntaxError(
"The tag name of a segment must be a str, but is a {}: {}".format(
type(name), name
)
)
if not name.isalnum():
raise EDISyntaxError(
"Tag '{}': A tag name must only contain alphanumeric characters.".format(
name
)
)
for Plugin in SegmentProvider.plugins:
if getattr(Plugin, "tag", "") == name:
s = Plugin(name, *elements)
break
else:
# we don't support this kind of EDIFACT segment (yet), so
# just create a generic Segment()
s = Segment(name, *elements)
if validate:
if not s.validate():
raise EDISyntaxError(
"could not create '{}' Segment. Validation failed.".format(name)
)
# FIXME: characters is not used!
return s
| 35.465116 | 112 | 0.640656 |
from typing import Union, List
from pydifact.api import EDISyntaxError, PluginMount
from pydifact.control import Characters
class SegmentProvider(metaclass=PluginMount):
def __str__(self):
def validate(self) -> bool:
class Segment(SegmentProvider):
__omitted__ = True
def __init__(self, tag: str, *elements: Union[str, List[str]]):
self.tag = tag
self.elements = list(elements)
def __str__(self) -> str:
return "'{tag}' EDI segment: {elements}".format(
tag=self.tag, elements=str(self.elements)
)
def __repr__(self) -> str:
return "{} segment: {}".format(self.tag, str(self.elements))
def __eq__(self, other) -> bool:
return (
isinstance(self, type(other))
and self.tag == other.tag
and list(self.elements) == list(other.elements)
)
def __getitem__(self, key):
return self.elements[key]
def __setitem__(self, key, value):
self.elements[key] = value
def validate(self) -> bool:
if not self.tag:
return False
return True
class EDIenergySegment(Segment):
def __init__(self, tag: str, *elements: Union[str, List[str]]):
super().__init__(tag, *elements)
def validate(self) -> bool:
if not super().validate():
return False
else:
pass
class SegmentFactory:
characters = None
@staticmethod
def create_segment(
name: str, *elements: Union[str, List[str]], validate: bool = True
) -> Segment:
if not SegmentFactory.characters:
SegmentFactory.characters = Characters()
if not name:
raise EDISyntaxError("The tag of a segment must not be empty.")
if type(name) != str:
raise EDISyntaxError(
"The tag name of a segment must be a str, but is a {}: {}".format(
type(name), name
)
)
if not name.isalnum():
raise EDISyntaxError(
"Tag '{}': A tag name must only contain alphanumeric characters.".format(
name
)
)
for Plugin in SegmentProvider.plugins:
if getattr(Plugin, "tag", "") == name:
s = Plugin(name, *elements)
break
else:
# just create a generic Segment()
s = Segment(name, *elements)
if validate:
if not s.validate():
raise EDISyntaxError(
"could not create '{}' Segment. Validation failed.".format(name)
)
# FIXME: characters is not used!
return s
| true | true |
f702cd6d3b749291e05ca743af5b6d809f48a705 | 2,141 | py | Python | common/realtime.py | wolterhv/openpilot | c189d15af9a613d8f109b39298c0ab3e22f39f6d | [
"MIT"
] | 171 | 2018-11-18T16:41:27.000Z | 2022-03-15T06:58:04.000Z | common/realtime.py | wolterhv/openpilot | c189d15af9a613d8f109b39298c0ab3e22f39f6d | [
"MIT"
] | 41 | 2018-08-01T17:36:08.000Z | 2020-12-16T02:42:57.000Z | common/realtime.py | wolterhv/openpilot | c189d15af9a613d8f109b39298c0ab3e22f39f6d | [
"MIT"
] | 378 | 2018-10-23T16:36:06.000Z | 2022-03-11T08:59:51.000Z | """Utilities for reading real time clocks and keeping soft real time constraints."""
import gc
import os
import time
import multiprocessing
from common.clock import sec_since_boot # pylint: disable=no-name-in-module, import-error
from selfdrive.hardware import PC, TICI
# time step for each process
DT_CTRL = 0.01 # controlsd
DT_MDL = 0.05 # model
DT_TRML = 0.5 # thermald and manager
# driver monitoring
if TICI:
DT_DMON = 0.05
else:
DT_DMON = 0.1
class Priority:
# CORE 2
# - modeld = 55
# - camerad = 54
CTRL_LOW = 51 # plannerd & radard
# CORE 3
# - boardd = 55
CTRL_HIGH = 53
def set_realtime_priority(level):
if not PC:
os.sched_setscheduler(0, os.SCHED_FIFO, os.sched_param(level))
def set_core_affinity(core):
if not PC:
os.sched_setaffinity(0, [core,])
def config_realtime_process(core, priority):
gc.disable()
set_realtime_priority(priority)
set_core_affinity(core)
class Ratekeeper():
def __init__(self, rate, print_delay_threshold=0.):
"""Rate in Hz for ratekeeping. print_delay_threshold must be nonnegative."""
self._interval = 1. / rate
self._next_frame_time = sec_since_boot() + self._interval
self._print_delay_threshold = print_delay_threshold
self._frame = 0
self._remaining = 0
self._process_name = multiprocessing.current_process().name
@property
def frame(self):
return self._frame
@property
def remaining(self):
return self._remaining
# Maintain loop rate by calling this at the end of each loop
def keep_time(self):
lagged = self.monitor_time()
if self._remaining > 0:
time.sleep(self._remaining)
return lagged
# this only monitor the cumulative lag, but does not enforce a rate
def monitor_time(self):
lagged = False
remaining = self._next_frame_time - sec_since_boot()
self._next_frame_time += self._interval
if self._print_delay_threshold is not None and remaining < -self._print_delay_threshold:
print("%s lagging by %.2f ms" % (self._process_name, -remaining * 1000))
lagged = True
self._frame += 1
self._remaining = remaining
return lagged
| 24.895349 | 92 | 0.714152 | import gc
import os
import time
import multiprocessing
from common.clock import sec_since_boot
from selfdrive.hardware import PC, TICI
DT_CTRL = 0.01
DT_MDL = 0.05
DT_TRML = 0.5
if TICI:
DT_DMON = 0.05
else:
DT_DMON = 0.1
class Priority:
CTRL_LOW = 51
CTRL_HIGH = 53
def set_realtime_priority(level):
if not PC:
os.sched_setscheduler(0, os.SCHED_FIFO, os.sched_param(level))
def set_core_affinity(core):
if not PC:
os.sched_setaffinity(0, [core,])
def config_realtime_process(core, priority):
gc.disable()
set_realtime_priority(priority)
set_core_affinity(core)
class Ratekeeper():
def __init__(self, rate, print_delay_threshold=0.):
self._interval = 1. / rate
self._next_frame_time = sec_since_boot() + self._interval
self._print_delay_threshold = print_delay_threshold
self._frame = 0
self._remaining = 0
self._process_name = multiprocessing.current_process().name
@property
def frame(self):
return self._frame
@property
def remaining(self):
return self._remaining
def keep_time(self):
lagged = self.monitor_time()
if self._remaining > 0:
time.sleep(self._remaining)
return lagged
def monitor_time(self):
lagged = False
remaining = self._next_frame_time - sec_since_boot()
self._next_frame_time += self._interval
if self._print_delay_threshold is not None and remaining < -self._print_delay_threshold:
print("%s lagging by %.2f ms" % (self._process_name, -remaining * 1000))
lagged = True
self._frame += 1
self._remaining = remaining
return lagged
| true | true |
f702cdd14336fe2d99f8b21d1c298aa8279cf0b2 | 7,420 | py | Python | pyluna-pathology/luna/pathology/point_annotation/proxy_table/generate.py | msk-mind/data-processing | c016d218da2eca003d06b96f2c03f16b3ce97873 | [
"Apache-2.0"
] | 1 | 2022-03-29T03:48:00.000Z | 2022-03-29T03:48:00.000Z | pyluna-pathology/luna/pathology/point_annotation/proxy_table/generate.py | msk-mind/data-processing | c016d218da2eca003d06b96f2c03f16b3ce97873 | [
"Apache-2.0"
] | 96 | 2020-11-15T01:39:12.000Z | 2021-08-24T14:37:49.000Z | pyluna-pathology/luna/pathology/point_annotation/proxy_table/generate.py | msk-mind/luna | 282b5bd594cb5bf1ef2a7fdf56fca9bea5ad7102 | [
"Apache-2.0"
] | 1 | 2021-01-04T15:14:23.000Z | 2021-01-04T15:14:23.000Z |
import os, json
import shutil, logging
import click
from pyspark.sql.functions import lit, udf, explode, array, to_json
from pyspark.sql.types import ArrayType, StringType, IntegerType, MapType, StructType, StructField
from luna.common.CodeTimer import CodeTimer
from luna.common.config import ConfigSet
from luna.common.custom_logger import init_logger
from luna.common.sparksession import SparkConfig
from luna.common.utils import get_absolute_path
from luna.pathology.common.slideviewer_client import fetch_slide_ids
import luna.common.constants as const
os.environ['OPENBLAS_NUM_THREADS'] = '1'
def download_point_annotation(slideviewer_url, slideviewer_path, project_id, user):
"""Downloads point-click nuclear annotations using slideviewer API
Args:
slideviewer_url (string): slideviewer base url e.g. https://slideviewer-url.com
slideviewer_path (string): slide path in slideviewer
project_id (string): slideviewer project id
user (string): username used to create the expert annotation
Returns:
json: point-click nuclear annotations
"""
from slideviewer_client import download_sv_point_annotation
print (f" >>>>>>> Processing [{slideviewer_path}] <<<<<<<<")
url = slideviewer_url + "/slides/" + str(user) + "@mskcc.org/projects;" + \
str(project_id) + ';' + slideviewer_path + "/getSVGLabels/nucleus"
print(url)
return download_sv_point_annotation(url)
@click.command()
@click.option('-d', '--data_config_file', default=None, type=click.Path(exists=True),
help="path to yaml file containing data input and output parameters. "
"See data_config.yaml.template")
@click.option('-a', '--app_config_file', default='config.yaml', type=click.Path(exists=True),
help="path to yaml file containing application runtime parameters. "
"See config.yaml.template")
def cli(data_config_file, app_config_file):
"""This module generates a parquet table of point-click nuclear annotation jsons.
The configuration files are copied to your project/configs/table_name folder
to persist the metadata used to generate the proxy table.
INPUT PARAMETERS
app_config_file - path to yaml file containing application runtime parameters. See config.yaml.template
data_config_file - path to yaml file containing data input and output parameters. See data_config.yaml.template
- ROOT_PATH: path to output data
- DATA_TYPE: data type used in table name e.g. POINT_RAW_JSON
- PROJECT: your project name. used in table path
- DATASET_NAME: optional, dataset name to version your table
- PROJECT_ID: Slideviewer project id
- USERS: list of users that provide expert annotations for this project
- SLIDEVIEWER_CSV_FILE: an optional path to a SlideViewer csv file to use that lists the names of the whole slide images
and for which the regional annotation proxy table generator should download point annotations.
If this field is left blank, then the regional annotation proxy table generator will download this file from SlideViewer.
TABLE SCHEMA
- slideviewer_path: path to original slide image in slideviewer platform
- slide_id: id for the slide. synonymous with image_id
- sv_project_id: same as the PROJECT_ID from data_config_file, refers to the SlideViewer project number.
- sv_json: json annotation file downloaded from slideviewer.
- user: username of the annotator for a given annotation
- sv_json_record_uuid: hash of raw json annotation file from slideviewer, format: SVPTJSON-{json_hash}
"""
logger = init_logger()
with CodeTimer(logger, 'generate POINT_RAW_JSON table'):
logger.info('data config file: ' + data_config_file)
logger.info('app config file: ' + app_config_file)
# load configs
cfg = ConfigSet(name=const.DATA_CFG, config_file=data_config_file)
cfg = ConfigSet(name=const.APP_CFG, config_file=app_config_file)
# copy app and data configuration to destination config dir
config_location = const.CONFIG_LOCATION(cfg)
os.makedirs(config_location, exist_ok=True)
shutil.copy(app_config_file, os.path.join(config_location, "app_config.yaml"))
shutil.copy(data_config_file, os.path.join(config_location, "data_config.yaml"))
logger.info("config files copied to %s", config_location)
create_proxy_table()
def create_proxy_table():
"""Create a proxy table of point annotation json files downloaded from the SlideViewer API
Each row of the table is a point annotation json created by a user for a slide.
Returns:
None
"""
cfg = ConfigSet()
logger = logging.getLogger(__name__)
spark = SparkConfig().spark_session(config_name=const.APP_CFG, app_name="luna.pathology.point_annotation.proxy_table.generate")
# load paths from configs
point_table_path = const.TABLE_LOCATION(cfg)
PROJECT_ID = cfg.get_value(path=const.DATA_CFG+'::PROJECT_ID')
SLIDEVIEWER_URL = cfg.get_value(path=const.DATA_CFG+'::SLIDEVIEWER_URL')
# Get slide list to use
# Download CSV file in the project configs dir
slides = fetch_slide_ids(SLIDEVIEWER_URL, PROJECT_ID, const.CONFIG_LOCATION(cfg),
cfg.get_value(path=const.DATA_CFG+'::SLIDEVIEWER_CSV_FILE'))
logger.info(slides)
schema = StructType([StructField("slideviewer_path", StringType()),
StructField("slide_id", StringType()),
StructField("sv_project_id", IntegerType())
])
df = spark.createDataFrame(slides, schema)
# populate columns
df = df.withColumn("users", array([lit(user) for user in cfg.get_value(const.DATA_CFG+'::USERS')]))
df = df.select("slideviewer_path", "slide_id", "sv_project_id", explode("users").alias("user"))
# download slide point annotation jsons
# example point json:
# [{"project_id":"8","image_id":"123.svs","label_type":"nucleus","x":"1440","y":"747","class":"0","classname":"Tissue 1"},{"project_id":"8","image_id":"123.svs","label_type":"nucleus","x":"1424","y":"774","class":"3","classname":"Tissue 4"}]
point_json_struct = ArrayType(
MapType(StringType(), StringType())
)
spark.sparkContext.addPyFile(get_absolute_path(__file__, "../../common/slideviewer_client.py"))
download_point_annotation_udf = udf(download_point_annotation, point_json_struct)
df = df.withColumn("sv_json",
download_point_annotation_udf(lit(SLIDEVIEWER_URL), "slideviewer_path", "sv_project_id", "user"))\
.cache()
# drop empty jsons that may have been created
df = df.dropna(subset=["sv_json"])
# populate "date_added", "date_updated","latest", "sv_json_record_uuid"
spark.sparkContext.addPyFile(get_absolute_path(__file__, "../../common/EnsureByteContext.py"))
spark.sparkContext.addPyFile(get_absolute_path(__file__, "../../common/utils.py"))
from luna.common.utils import generate_uuid_dict
sv_json_record_uuid_udf = udf(generate_uuid_dict, StringType())
df = df.withColumn("sv_json_record_uuid", sv_json_record_uuid_udf(to_json("sv_json"), array(lit("SVPTJSON"))))
df.show(10, False)
df.write.format("parquet").mode("overwrite").save(point_table_path)
if __name__ == "__main__":
cli()
| 41.920904 | 245 | 0.714555 |
import os, json
import shutil, logging
import click
from pyspark.sql.functions import lit, udf, explode, array, to_json
from pyspark.sql.types import ArrayType, StringType, IntegerType, MapType, StructType, StructField
from luna.common.CodeTimer import CodeTimer
from luna.common.config import ConfigSet
from luna.common.custom_logger import init_logger
from luna.common.sparksession import SparkConfig
from luna.common.utils import get_absolute_path
from luna.pathology.common.slideviewer_client import fetch_slide_ids
import luna.common.constants as const
os.environ['OPENBLAS_NUM_THREADS'] = '1'
def download_point_annotation(slideviewer_url, slideviewer_path, project_id, user):
from slideviewer_client import download_sv_point_annotation
print (f" >>>>>>> Processing [{slideviewer_path}] <<<<<<<<")
url = slideviewer_url + "/slides/" + str(user) + "@mskcc.org/projects;" + \
str(project_id) + ';' + slideviewer_path + "/getSVGLabels/nucleus"
print(url)
return download_sv_point_annotation(url)
@click.command()
@click.option('-d', '--data_config_file', default=None, type=click.Path(exists=True),
help="path to yaml file containing data input and output parameters. "
"See data_config.yaml.template")
@click.option('-a', '--app_config_file', default='config.yaml', type=click.Path(exists=True),
help="path to yaml file containing application runtime parameters. "
"See config.yaml.template")
def cli(data_config_file, app_config_file):
logger = init_logger()
with CodeTimer(logger, 'generate POINT_RAW_JSON table'):
logger.info('data config file: ' + data_config_file)
logger.info('app config file: ' + app_config_file)
cfg = ConfigSet(name=const.DATA_CFG, config_file=data_config_file)
cfg = ConfigSet(name=const.APP_CFG, config_file=app_config_file)
config_location = const.CONFIG_LOCATION(cfg)
os.makedirs(config_location, exist_ok=True)
shutil.copy(app_config_file, os.path.join(config_location, "app_config.yaml"))
shutil.copy(data_config_file, os.path.join(config_location, "data_config.yaml"))
logger.info("config files copied to %s", config_location)
create_proxy_table()
def create_proxy_table():
cfg = ConfigSet()
logger = logging.getLogger(__name__)
spark = SparkConfig().spark_session(config_name=const.APP_CFG, app_name="luna.pathology.point_annotation.proxy_table.generate")
point_table_path = const.TABLE_LOCATION(cfg)
PROJECT_ID = cfg.get_value(path=const.DATA_CFG+'::PROJECT_ID')
SLIDEVIEWER_URL = cfg.get_value(path=const.DATA_CFG+'::SLIDEVIEWER_URL')
slides = fetch_slide_ids(SLIDEVIEWER_URL, PROJECT_ID, const.CONFIG_LOCATION(cfg),
cfg.get_value(path=const.DATA_CFG+'::SLIDEVIEWER_CSV_FILE'))
logger.info(slides)
schema = StructType([StructField("slideviewer_path", StringType()),
StructField("slide_id", StringType()),
StructField("sv_project_id", IntegerType())
])
df = spark.createDataFrame(slides, schema)
df = df.withColumn("users", array([lit(user) for user in cfg.get_value(const.DATA_CFG+'::USERS')]))
df = df.select("slideviewer_path", "slide_id", "sv_project_id", explode("users").alias("user"))
point_json_struct = ArrayType(
MapType(StringType(), StringType())
)
spark.sparkContext.addPyFile(get_absolute_path(__file__, "../../common/slideviewer_client.py"))
download_point_annotation_udf = udf(download_point_annotation, point_json_struct)
df = df.withColumn("sv_json",
download_point_annotation_udf(lit(SLIDEVIEWER_URL), "slideviewer_path", "sv_project_id", "user"))\
.cache()
df = df.dropna(subset=["sv_json"])
spark.sparkContext.addPyFile(get_absolute_path(__file__, "../../common/EnsureByteContext.py"))
spark.sparkContext.addPyFile(get_absolute_path(__file__, "../../common/utils.py"))
from luna.common.utils import generate_uuid_dict
sv_json_record_uuid_udf = udf(generate_uuid_dict, StringType())
df = df.withColumn("sv_json_record_uuid", sv_json_record_uuid_udf(to_json("sv_json"), array(lit("SVPTJSON"))))
df.show(10, False)
df.write.format("parquet").mode("overwrite").save(point_table_path)
if __name__ == "__main__":
cli()
| true | true |
f702cf37a5d2c8ddbc6bd4cf2cda75e9eb2dcfea | 10,938 | py | Python | MSSE-2021/train_model.py | clsteel/DeepPostures | 8a7bed8f1e47e4a502080bf6edd513b822ea0bdf | [
"Apache-2.0"
] | 1 | 2021-06-23T13:28:51.000Z | 2021-06-23T13:28:51.000Z | MSSE-2021/train_model.py | clsteel/DeepPostures | 8a7bed8f1e47e4a502080bf6edd513b822ea0bdf | [
"Apache-2.0"
] | null | null | null | MSSE-2021/train_model.py | clsteel/DeepPostures | 8a7bed8f1e47e4a502080bf6edd513b822ea0bdf | [
"Apache-2.0"
] | null | null | null | # Copyright 2021 Supun Nakandala. All Rights Reserved.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
# ==============================================================================
import os
import sys
import numpy as np
import tensorflow as tf
import pandas as pd
import random
import math
import argparse
sys.path.append('./')
from commons import cnn_bi_lstm_model, input_iterator
# Setting random seeds
tf.random.set_random_seed(2019)
random.seed(2019)
np.random.seed(2019)
def get_train_ops(y, logits, learning_rate, n_classes, class_weights):
y = tf.reshape(y, [-1])
logits = tf.reshape(logits, [-1, n_classes])
balanced_accuracy, update_op = tf.metrics.mean_per_class_accuracy(y, tf.argmax(logits, 1), n_classes)
y = tf.reshape(tf.one_hot(y, depth=n_classes, axis=1), [-1, n_classes])
loss = tf.reduce_sum(tf.nn.softmax_cross_entropy_with_logits_v2(logits=logits, labels=y) * tf.reduce_sum(tf.constant(class_weights, dtype=tf.float32) * y, axis=1))
optimizer = tf.train.AdamOptimizer(learning_rate=learning_rate)
train_op = optimizer.minimize(loss)
return train_op, update_op, balanced_accuracy, loss
def window_generator(data_root, win_size_10s, subject_ids):
x_segments = []; y_segments = []
for subject_id in subject_ids:
for x_seq, _, y_seq in input_iterator(data_root, subject_id, train=True):
x_window = []; y_window = []
for x,y in zip(x_seq, y_seq):
x_window.append(x)
y_window.append(y)
if len(y_window) == win_size_10s:
yield np.stack(x_window, axis=0), np.stack(y_window, axis=0)
x_window = []; y_window = []
if __name__ == "__main__":
parser = argparse.ArgumentParser(description='Argument parser for training CNN model.')
optional_arguments = parser._action_groups.pop()
required_arguments = parser.add_argument_group('required arguments')
required_arguments.add_argument('--pre-processed-dir', help='Pre-processed data directory', required=True)
optional_arguments.add_argument('--transfer-learning-model', help='Transfer learning model name (default: CHAP_ALL_ADULTS)', default=None, required=False, choices=['CHAP_ALL_ADULTS'])
optional_arguments.add_argument('--learning-rate', help='Learning rate for training the model (default: 0.0001)', default=1e-4, type=float, required=False)
optional_arguments.add_argument('--num-epochs', help='Number of epochs to train the model (default: 15)', default=15, type=int, required=False)
optional_arguments.add_argument('--batch-size', help='Training batch size (default: 16)', default=16, type=int, required=False)
optional_arguments.add_argument('--amp-factor', help='Factor to increase the number of neurons in the CNN layers (default: 2)', default=2, type=int, required=False)
optional_arguments.add_argument('--cnn-window-size', help='CNN window size in seconds on which the predictions to be made (default: 10)', default=10, type=int, required=False)
optional_arguments.add_argument('--bi-lstm-window-size', help='BiLSTM window size in minutes on which the predictions to be smoothed (default: 7)', default=7, type=int, required=False)
optional_arguments.add_argument('--shuffle-buffer-size', help='Training data shuffle buffer size in terms of number of records (default: 10000)', default=10000, type=int, required=False)
optional_arguments.add_argument('--training-data-fraction', help='Percentage of subjects to be used for training (default: 60)', default=60, type=int, required=False)
optional_arguments.add_argument('--validation-data-fraction', help='Percentage of subjects to be used for validation (default: 20)', default=20, type=int, required=False)
optional_arguments.add_argument('--testing-data-fraction', help='Percentage of subjects to be used for testing (default: 20)', default=20, type=int, required=False)
optional_arguments.add_argument('--model-checkpoint-path', help='Path where the trained model will be saved (default: ./model-checkpoint)', default='./model-checkpoint', required=False)
optional_arguments.add_argument('--num-classes', help='Number of classes in the training dataset (default: 2)', default=2, type=int, required=False)
optional_arguments.add_argument('--class-weights', help='Class weights for loss aggregation (default: [1.0, 1.0])', default='[1.0, 1.0]', required=False)
optional_arguments.add_argument('--down-sample-frequency', help='Downsample frequency in Hz for GT3X data (default: 10)', default=10, type=int, required=False)
optional_arguments.add_argument('--silent', help='Whether to hide info messages', default=False, required=False, action='store_true')
parser._action_groups.append(optional_arguments)
args = parser.parse_args()
if os.path.exists(args.model_checkpoint_path):
raise Exception('Model checkpoint: {} already exists.'.format(args.model_checkpoint_path))
if args.transfer_learning_model:
if args.transfer_learning_model == 'CHAP_ALL_ADULTS':
args.amp_factor = 2
args.cnn_window_size = 10
args.bi_lstm_win_size = 7
else:
raise Exception('Unsupported transfer learning model: {}'.format(args.transfer_learning_model))
assert (args.training_data_fraction + args.validation_data_fraction + args.testing_data_fraction) == 100, 'Train, validation,test split fractions should add up to 100%'
subject_ids = [fname.split('.')[0] for fname in os.listdir(args.pre_processed_dir)]
random.shuffle(subject_ids)
n_train_subjects = int(math.ceil(len(subject_ids) * args.training_data_fraction / 100.))
train_subjects = subject_ids[:n_train_subjects]
subject_ids = subject_ids[n_train_subjects:]
test_frac = args.testing_data_fraction / (100.0 - args.training_data_fraction) * 100
n_test_subjects = int(math.ceil(len(subject_ids) * test_frac / 100.))
test_subjects = subject_ids[:n_test_subjects]
valid_subjects = subject_ids[n_test_subjects:]
output_shapes = ((args.bi_lstm_window_size*(60//args.cnn_window_size), args.cnn_window_size*args.down_sample_frequency, 3), (args.bi_lstm_window_size*(60//args.cnn_window_size)))
bi_lstm_win_size = 60//args.down_sample_frequency * args.bi_lstm_window_size
train_dataset = tf.data.Dataset.from_generator(lambda: window_generator(args.pre_processed_dir, bi_lstm_win_size, train_subjects),output_types=(tf.float32, tf.int32),
output_shapes=output_shapes).shuffle(args.shuffle_buffer_size).batch(args.batch_size).prefetch(10)
valid_dataset = tf.data.Dataset.from_generator(lambda: window_generator(args.pre_processed_dir, bi_lstm_win_size, valid_subjects),output_types=(tf.float32, tf.int32),
output_shapes=output_shapes).batch(args.batch_size).prefetch(10)
test_dataset = tf.data.Dataset.from_generator(lambda: window_generator(args.pre_processed_dir, bi_lstm_win_size, test_subjects),output_types=(tf.float32, tf.int32),
output_shapes=output_shapes).batch(args.batch_size).prefetch(10)
iterator = tf.data.Iterator.from_structure(train_dataset.output_types, train_dataset.output_shapes)
train_init_op = iterator.make_initializer(train_dataset)
valid_init_op = iterator.make_initializer(valid_dataset)
test_init_op = iterator.make_initializer(test_dataset)
x, y = iterator.get_next()
x = tf.reshape(x, [-1, args.cnn_window_size*args.down_sample_frequency, 3, 1])
x = tf.identity(x, name='input')
y = tf.reshape(y, [-1, bi_lstm_win_size])
learning_rate = tf.placeholder(tf.float32)
logits = cnn_bi_lstm_model(x, args.amp_factor, bi_lstm_win_size, args.num_classes)
output = tf.argmax(tf.reshape(logits, [-1, args.num_classes]), axis=1, name='output')
prediction = tf.identity(tf.argmax(logits, axis=1), name='prediction')
class_weights = eval(args.class_weights)
train_op, update_op, balanced_accuracy, loss = get_train_ops(y, logits, learning_rate, args.num_classes, class_weights)
with tf.Session() as sess:
sess.run(tf.global_variables_initializer())
if args.transfer_learning_model:
ckpt_path = os.path.join(os.path.dirname(os.path.realpath(__file__)), 'pre-trained-models', '{}_CKPT'.format(args.transfer_learning_model), 'model')
# Weights for the final classification layer (dense) are ignored
variables = [v for v in tf.get_collection(tf.GraphKeys.GLOBAL_VARIABLES) if not v.name.startswith('dense/')]
restorer = tf.train.Saver(variables)
restorer.restore(sess, ckpt_path)
if not args.silent:
print('Training subjects: {}'.format(train_subjects))
print('Validation subjects: {}'.format(valid_subjects))
print('Testing subjects: {}'.format(test_subjects))
for epoch in range(args.num_epochs):
for label, init_op, subjects in zip(["Train", "Validation", "Test"],
[train_init_op, valid_init_op, test_init_op], [train_subjects, valid_subjects, test_subjects]):
sess.run(tf.local_variables_initializer())
sess.run(init_op)
losses = []
while True:
try:
if label == "Train":
_, _, l = sess.run([train_op, update_op, loss], feed_dict={learning_rate: args.learning_rate})
elif label == "Validation":
_, l = sess.run([update_op, loss])
elif label == "Test":
_, l = sess.run([update_op, loss])
losses.append(l)
except tf.errors.OutOfRangeError:
if not args.silent:
ba = sess.run(balanced_accuracy)
print("Epoch: %d, %s Loss: %f, Balanced Accuracy: %f" %(epoch, label, sum(losses), ba))
break
if not os.path.exists(args.model_checkpoint_path):
os.makedirs(args.model_checkpoint_path)
tf.saved_model.simple_save(sess, os.path.join(args.model_checkpoint_path, 'CUSTOM_MODEL'), inputs={"input": x}, outputs={"output": output})
if not args.silent:
print('Model saved in path: {}'.format(args.model_checkpoint_path))
| 59.124324 | 190 | 0.6951 |
import os
import sys
import numpy as np
import tensorflow as tf
import pandas as pd
import random
import math
import argparse
sys.path.append('./')
from commons import cnn_bi_lstm_model, input_iterator
tf.random.set_random_seed(2019)
random.seed(2019)
np.random.seed(2019)
def get_train_ops(y, logits, learning_rate, n_classes, class_weights):
y = tf.reshape(y, [-1])
logits = tf.reshape(logits, [-1, n_classes])
balanced_accuracy, update_op = tf.metrics.mean_per_class_accuracy(y, tf.argmax(logits, 1), n_classes)
y = tf.reshape(tf.one_hot(y, depth=n_classes, axis=1), [-1, n_classes])
loss = tf.reduce_sum(tf.nn.softmax_cross_entropy_with_logits_v2(logits=logits, labels=y) * tf.reduce_sum(tf.constant(class_weights, dtype=tf.float32) * y, axis=1))
optimizer = tf.train.AdamOptimizer(learning_rate=learning_rate)
train_op = optimizer.minimize(loss)
return train_op, update_op, balanced_accuracy, loss
def window_generator(data_root, win_size_10s, subject_ids):
x_segments = []; y_segments = []
for subject_id in subject_ids:
for x_seq, _, y_seq in input_iterator(data_root, subject_id, train=True):
x_window = []; y_window = []
for x,y in zip(x_seq, y_seq):
x_window.append(x)
y_window.append(y)
if len(y_window) == win_size_10s:
yield np.stack(x_window, axis=0), np.stack(y_window, axis=0)
x_window = []; y_window = []
if __name__ == "__main__":
parser = argparse.ArgumentParser(description='Argument parser for training CNN model.')
optional_arguments = parser._action_groups.pop()
required_arguments = parser.add_argument_group('required arguments')
required_arguments.add_argument('--pre-processed-dir', help='Pre-processed data directory', required=True)
optional_arguments.add_argument('--transfer-learning-model', help='Transfer learning model name (default: CHAP_ALL_ADULTS)', default=None, required=False, choices=['CHAP_ALL_ADULTS'])
optional_arguments.add_argument('--learning-rate', help='Learning rate for training the model (default: 0.0001)', default=1e-4, type=float, required=False)
optional_arguments.add_argument('--num-epochs', help='Number of epochs to train the model (default: 15)', default=15, type=int, required=False)
optional_arguments.add_argument('--batch-size', help='Training batch size (default: 16)', default=16, type=int, required=False)
optional_arguments.add_argument('--amp-factor', help='Factor to increase the number of neurons in the CNN layers (default: 2)', default=2, type=int, required=False)
optional_arguments.add_argument('--cnn-window-size', help='CNN window size in seconds on which the predictions to be made (default: 10)', default=10, type=int, required=False)
optional_arguments.add_argument('--bi-lstm-window-size', help='BiLSTM window size in minutes on which the predictions to be smoothed (default: 7)', default=7, type=int, required=False)
optional_arguments.add_argument('--shuffle-buffer-size', help='Training data shuffle buffer size in terms of number of records (default: 10000)', default=10000, type=int, required=False)
optional_arguments.add_argument('--training-data-fraction', help='Percentage of subjects to be used for training (default: 60)', default=60, type=int, required=False)
optional_arguments.add_argument('--validation-data-fraction', help='Percentage of subjects to be used for validation (default: 20)', default=20, type=int, required=False)
optional_arguments.add_argument('--testing-data-fraction', help='Percentage of subjects to be used for testing (default: 20)', default=20, type=int, required=False)
optional_arguments.add_argument('--model-checkpoint-path', help='Path where the trained model will be saved (default: ./model-checkpoint)', default='./model-checkpoint', required=False)
optional_arguments.add_argument('--num-classes', help='Number of classes in the training dataset (default: 2)', default=2, type=int, required=False)
optional_arguments.add_argument('--class-weights', help='Class weights for loss aggregation (default: [1.0, 1.0])', default='[1.0, 1.0]', required=False)
optional_arguments.add_argument('--down-sample-frequency', help='Downsample frequency in Hz for GT3X data (default: 10)', default=10, type=int, required=False)
optional_arguments.add_argument('--silent', help='Whether to hide info messages', default=False, required=False, action='store_true')
parser._action_groups.append(optional_arguments)
args = parser.parse_args()
if os.path.exists(args.model_checkpoint_path):
raise Exception('Model checkpoint: {} already exists.'.format(args.model_checkpoint_path))
if args.transfer_learning_model:
if args.transfer_learning_model == 'CHAP_ALL_ADULTS':
args.amp_factor = 2
args.cnn_window_size = 10
args.bi_lstm_win_size = 7
else:
raise Exception('Unsupported transfer learning model: {}'.format(args.transfer_learning_model))
assert (args.training_data_fraction + args.validation_data_fraction + args.testing_data_fraction) == 100, 'Train, validation,test split fractions should add up to 100%'
subject_ids = [fname.split('.')[0] for fname in os.listdir(args.pre_processed_dir)]
random.shuffle(subject_ids)
n_train_subjects = int(math.ceil(len(subject_ids) * args.training_data_fraction / 100.))
train_subjects = subject_ids[:n_train_subjects]
subject_ids = subject_ids[n_train_subjects:]
test_frac = args.testing_data_fraction / (100.0 - args.training_data_fraction) * 100
n_test_subjects = int(math.ceil(len(subject_ids) * test_frac / 100.))
test_subjects = subject_ids[:n_test_subjects]
valid_subjects = subject_ids[n_test_subjects:]
output_shapes = ((args.bi_lstm_window_size*(60//args.cnn_window_size), args.cnn_window_size*args.down_sample_frequency, 3), (args.bi_lstm_window_size*(60//args.cnn_window_size)))
bi_lstm_win_size = 60//args.down_sample_frequency * args.bi_lstm_window_size
train_dataset = tf.data.Dataset.from_generator(lambda: window_generator(args.pre_processed_dir, bi_lstm_win_size, train_subjects),output_types=(tf.float32, tf.int32),
output_shapes=output_shapes).shuffle(args.shuffle_buffer_size).batch(args.batch_size).prefetch(10)
valid_dataset = tf.data.Dataset.from_generator(lambda: window_generator(args.pre_processed_dir, bi_lstm_win_size, valid_subjects),output_types=(tf.float32, tf.int32),
output_shapes=output_shapes).batch(args.batch_size).prefetch(10)
test_dataset = tf.data.Dataset.from_generator(lambda: window_generator(args.pre_processed_dir, bi_lstm_win_size, test_subjects),output_types=(tf.float32, tf.int32),
output_shapes=output_shapes).batch(args.batch_size).prefetch(10)
iterator = tf.data.Iterator.from_structure(train_dataset.output_types, train_dataset.output_shapes)
train_init_op = iterator.make_initializer(train_dataset)
valid_init_op = iterator.make_initializer(valid_dataset)
test_init_op = iterator.make_initializer(test_dataset)
x, y = iterator.get_next()
x = tf.reshape(x, [-1, args.cnn_window_size*args.down_sample_frequency, 3, 1])
x = tf.identity(x, name='input')
y = tf.reshape(y, [-1, bi_lstm_win_size])
learning_rate = tf.placeholder(tf.float32)
logits = cnn_bi_lstm_model(x, args.amp_factor, bi_lstm_win_size, args.num_classes)
output = tf.argmax(tf.reshape(logits, [-1, args.num_classes]), axis=1, name='output')
prediction = tf.identity(tf.argmax(logits, axis=1), name='prediction')
class_weights = eval(args.class_weights)
train_op, update_op, balanced_accuracy, loss = get_train_ops(y, logits, learning_rate, args.num_classes, class_weights)
with tf.Session() as sess:
sess.run(tf.global_variables_initializer())
if args.transfer_learning_model:
ckpt_path = os.path.join(os.path.dirname(os.path.realpath(__file__)), 'pre-trained-models', '{}_CKPT'.format(args.transfer_learning_model), 'model')
variables = [v for v in tf.get_collection(tf.GraphKeys.GLOBAL_VARIABLES) if not v.name.startswith('dense/')]
restorer = tf.train.Saver(variables)
restorer.restore(sess, ckpt_path)
if not args.silent:
print('Training subjects: {}'.format(train_subjects))
print('Validation subjects: {}'.format(valid_subjects))
print('Testing subjects: {}'.format(test_subjects))
for epoch in range(args.num_epochs):
for label, init_op, subjects in zip(["Train", "Validation", "Test"],
[train_init_op, valid_init_op, test_init_op], [train_subjects, valid_subjects, test_subjects]):
sess.run(tf.local_variables_initializer())
sess.run(init_op)
losses = []
while True:
try:
if label == "Train":
_, _, l = sess.run([train_op, update_op, loss], feed_dict={learning_rate: args.learning_rate})
elif label == "Validation":
_, l = sess.run([update_op, loss])
elif label == "Test":
_, l = sess.run([update_op, loss])
losses.append(l)
except tf.errors.OutOfRangeError:
if not args.silent:
ba = sess.run(balanced_accuracy)
print("Epoch: %d, %s Loss: %f, Balanced Accuracy: %f" %(epoch, label, sum(losses), ba))
break
if not os.path.exists(args.model_checkpoint_path):
os.makedirs(args.model_checkpoint_path)
tf.saved_model.simple_save(sess, os.path.join(args.model_checkpoint_path, 'CUSTOM_MODEL'), inputs={"input": x}, outputs={"output": output})
if not args.silent:
print('Model saved in path: {}'.format(args.model_checkpoint_path))
| true | true |
f702d0bfaf4d80a5d7eaa4d7d94718ae6a61ede4 | 16,945 | py | Python | port/boards/mpython-classroom-kit/modules/mpython_classroom_kit_driver.py | xjiezheng/mpython | 010a92aa0c0984b9418ca124a3466616c3e6d77e | [
"MIT"
] | 6 | 2019-10-02T09:59:28.000Z | 2020-10-11T07:15:58.000Z | port/boards/mpython-classroom-kit/modules/mpython_classroom_kit_driver.py | xjiezheng/mpython | 010a92aa0c0984b9418ca124a3466616c3e6d77e | [
"MIT"
] | 5 | 2019-10-08T07:13:08.000Z | 2019-10-09T04:06:07.000Z | port/boards/mpython-classroom-kit/modules/mpython_classroom_kit_driver.py | xjiezheng/mpython | 010a92aa0c0984b9418ca124a3466616c3e6d77e | [
"MIT"
] | 2 | 2019-09-11T10:50:12.000Z | 2020-03-07T21:17:44.000Z | # labplus mPython-box library
# MIT license; Copyright (c) 2018 labplus
# mpython-box buildin periphers drivers
# history:
# V1.0 zhaohuijiang
from machine import Pin, UART
import time
import ujson
from time import sleep_ms, sleep_us, sleep
# touchpad
class BS8112A(object):
""" """
def __init__(self, i2c):
self.addr = 80
# config
self._i2c = i2c
self.config = [0xB0, 0x00, 0x00, 0x83, 0xf3, 0x98, 0x0f, 0x0f,
0x0f, 0x0f, 0x0f, 0x0f, 0x0f, 0x0f, 0x0f, 0x0f, 0x0f, 0x0f, 0x00]
checksum = 0
for i in range(1, 19):
checksum += self.config[i]
checksum &= 0xff
self.config[18] = checksum
# print(self.config[18])
retry = 0
if (retry < 5):
try:
self._i2c.writeto(self.addr, bytearray(self.config), True)
return
except:
retry = retry + 1
else:
raise Exception("bs8112a i2c read/write error!")
# i2c.writeto(self.addr, b'\xB0', False)
# time.sleep_ms(10)
# print(i2c.readfrom(self.addr, 17, True))
# key map:
# value bit7 bit6 bit5 bit4 bit3 bit2 bit1 bit0
# bs8112a key Key8 Key7 Key6 Key5 Key4 Key3 Key2 Key1
# mpython key N O H T Y P
def key_value(self):
retry = 0
if (retry < 5):
try:
self._i2c.writeto(self.addr, b'\x08', False)
time.sleep_ms(10)
value = self._i2c.readfrom(self.addr, 1, True)
time.sleep_ms(10)
return value
except:
retry = retry + 1
else:
raise Exception("bs8112a i2c read/write error!")
class Codec_mode():
ES_MODULE_ADC_DAC = 0x00
ES_MODULE_DAC = 0x01
ES_MODULE_ADC = 0x02
class Es8388():
""" """
def __init__(self, i2c, adc_volume=0, dac_volume=0, volume=65):
self._i2c = i2c
self.addr = 16
self.adc_volume = adc_volume
self.dac_volume = dac_volume
self.volume = volume
self.set_voice_mute(1)
retry = 0
if (retry < 5):
try:
# i2c.writeto(self.addr, bytearray([0x19, 0x04])) # ES8388_DACCONTROL3 0x04 mute/0x00 unmute&ramp;DAC unmute and disabled digital volume control soft ramp
# Chip Control and Power Management
self._i2c.writeto(self.addr, bytearray(
[0x01, 0x50])) # ES8388_CONTROL2 0x40?
# ES8388_CHIPPOWER normal all and power up all
self._i2c.writeto(self.addr, bytearray([0x02, 0x00]))
# ES8388_MASTERMODE CODEC IN I2S SLAVE MODE 0x00: slave
self._i2c.writeto(self.addr, bytearray([0x08, 0x00]))
# dac setup
# ES8388_DACPOWER . disable DAC and disable Lout/Rout/1/2
self._i2c.writeto(self.addr, bytearray([0x04, 0xC0]))
# ES8388_CONTROL1. Enfr=0,Play&Record Mode,(0x17-both of mic&paly)
self._i2c.writeto(self.addr, bytearray([0x00, 0x12]))
# ES8388_DACCONTROL1 1a 0x18:16bit iis , 0x00:24
self._i2c.writeto(self.addr, bytearray([0x17, 0x18]))
# ES8388_DACCONTROL2 DACFsMode,SINGLE SPEED; DACFsRatio,256
self._i2c.writeto(self.addr, bytearray([0x18, 0x02]))
# ES8388_DACCONTROL16 0x00 audio on LIN1&RIN1, 0x09 LIN2&RIN2
self._i2c.writeto(self.addr, bytearray([0x26, 0x00]))
# ES8388_DACCONTROL17 only left DAC to left mixer enable 0db
self._i2c.writeto(self.addr, bytearray([0x27, 0x90]))
# ES8388_DACCONTROL20 only right DAC to right mixer enable 0db
self._i2c.writeto(self.addr, bytearray([0x2a, 0x90]))
# ES8388_DACCONTROL21 set internal ADC and DAC use the same LRCK clock, ADC LRCK as internal LRCK
self._i2c.writeto(self.addr, bytearray([0x2b, 0x80]))
# ES8388_DACCONTROL23 vroi=0
self._i2c.writeto(self.addr, bytearray([0x2d, 0x00]))
self.set_adc_dac_volume(
Codec_mode.ES_MODULE_DAC, self.dac_volume, 0) # 0db
# ES8388_DACPOWER 0x3c Enable DAC and Enable Lout/Rout/1/2
self._i2c.writeto(self.addr, bytearray([0x04, 0x3c]))
# adc setup
self._i2c.writeto(self.addr, bytearray(
[0x03, 0xff])) # ES8388_ADCPOWER
# ES8388_ADCCONTROL1 MIC Left and Right channel PGA gain
self._i2c.writeto(self.addr, bytearray([0x09, 0xbb]))
# ES8388_ADCCONTROL2 0x00 LINSEL & RINSEL, LIN1/RIN1 as ADC Input; DSSEL,use one DS Reg11; DSR, LINPUT1-RINPUT1
self._i2c.writeto(self.addr, bytearray([0x0a, 0x00]))
# ES8388_ADCCONTROL3 clock input
self._i2c.writeto(self.addr, bytearray([0x0b, 0x02]))
# ES8388_ADCCONTROL4 Left/Right data, Left/Right justified mode, Bits length 16bit, I2S format 0x0c?
self._i2c.writeto(self.addr, bytearray([0x0c, 0x0c]))
# ES8388_ADCCONTROL5 ADCFsMode,singel SPEED,RATIO=256
self._i2c.writeto(self.addr, bytearray([0x0d, 0x02]))
# ALC for Microphone
self.set_adc_dac_volume(
Codec_mode.ES_MODULE_ADC, self.adc_volume, 0) # 0db
# ES8388_ADCPOWER Power on ADC, Enable LIN&RIN, Power off MICBIAS, set int1lp to low power mode
self._i2c.writeto(self.addr, bytearray([0x03, 0x09]))
# set volume
self.set_volume(self.volume)
self.set_voice_mute(0)
# test
# for i in range(0, 52):
# i2c.writeto(self.addr, bytearray([i]))
# print("%d: %d" % (i, i2c.readfrom(self.addr, 1)[0]))
return
except:
retry = retry + 1
else:
raise Exception("es8388 i2c read/write error!")
def deinit(self):
retry = 0
if (retry < 5):
try:
# ES8388_CHIPPOWER reset and stop es838
self._i2c.writeto(self.addr, bytearray([0x02, 0xff]))
return
except:
retry = retry + 1
else:
raise Exception("bs8112a i2c read/write error!")
def set_adc_dac_volume(self, mode, volume, dot):
_volume = volume
if (_volume < -96):
_volume = -96
else:
_volume = 0
_dot = 0
if dot >= 5:
_dot = 1
_volume = (-_volume << 1) + _dot
retry = 0
if (retry < 5):
try:
if (mode == Codec_mode.ES_MODULE_ADC or mode == Codec_mode.ES_MODULE_ADC_DAC):
self._i2c.writeto(self.addr, bytearray(
[0x10, _volume])) # ES8388_ADCCONTROL8
self._i2c.writeto(self.addr, bytearray(
[0x11, _volume])) # ES8388_ADCCONTROL9
if (mode == Codec_mode.ES_MODULE_DAC or mode == Codec_mode.ES_MODULE_ADC_DAC):
self._i2c.writeto(self.addr, bytearray(
[0x1b, _volume])) # ES8388_DACCONTROL5
self._i2c.writeto(self.addr, bytearray(
[0x1a, _volume])) # ES8388_DACCONTROL4
return
except:
retry = retry + 1
else:
raise Exception("bs8112a i2c read/write error!")
def set_volume(self, volume):
self.volume = volume
if (self.volume < 0):
self.volume = 0
elif (self.volume > 100):
self.volume = 100
retry = 0
if (retry < 5):
try:
self._i2c.writeto(self.addr, bytearray(
[0x2e, self.volume//3])) # ES8388_DACCONTROL24
self._i2c.writeto(self.addr, bytearray(
[0x2f, self.volume//3])) # ES8388_DACCONTROL25
self._i2c.writeto(self.addr, bytearray(
[0x30, 0])) # ES8388_DACCONTROL26
self._i2c.writeto(self.addr, bytearray(
[0x31, 0])) # ES8388_DACCONTROL27
# print("volume L: %d" % (self.volume//3))
return
except:
retry = retry + 1
else:
raise Exception("bs8112a i2c read/write error!")
def get_volume(self):
return self.volume
def set_voice_mute(self, mute):
retry = 0
if (retry < 5):
try:
self._i2c.writeto(self.addr, b'\x19')
dac_ctr3 = self._i2c.readfrom(self.addr, 1)[0]
if(mute):
dac_ctr3 |= 0x04
else:
dac_ctr3 &= 0xFB
self._i2c.writeto(self.addr, bytearray([0x19, dac_ctr3]))
except:
retry = retry + 1
else:
raise Exception("bs8112a i2c read/write error!")
uart2 = UART(2, baudrate=1152000, rx=Pin.P8, tx=Pin.P23,
timeout=50, timeout_char=1024, rxbuf=2048, txbuf=2048)
class K210Error(Exception):
"""K210异常类"""
pass
class blob():
def __init__(self,*args):
self.dict = args[0]
def __repr__(self):
return self.dict
def x(self):
return self.dict['x']
def y(self):
return self.dict['y']
def w(self):
return self.dict['w']
def h(self):
return self.dict['h']
def rect(self):
return(self.dict['x'], self.dict['y'], self.dict['w'], self.dict['h'])
def pixels(self):
return self.dict['pixels']
def cx(self):
return self.dict['cx']
def cy(self):
return self.dict['cy']
def rotation(self):
return self.dict['rotation']
def code(self):
return self.dict['code']
def count(self):
return self.dict['count']
class K210():
def __init__(self):
t1 = time.ticks_ms()
while (time.ticks_diff(time.ticks_ms(), t1) < 10000):
rsp = self.send_cmd({'GET_KEYS': 0}) # 通过发获取按键指令测试K210是否初始化成功
if rsp is not None:
return
raise K210Error("K210 init failed!")
def send_cmd(self, command, wait=True, timeout=200):
json_stream = ujson.dumps(command)
uart2.write(json_stream + '\n')
# print("UART_Send:%s" % (json_stream + '\n'))
t1 = time.ticks_ms()
while wait:
if uart2.any() > 0:
r=None
r = uart2.readline()
r= r.strip()
while uart2.readline():
pass
# print("UART_Recv:%s" % r)
try:
rsp = ujson.loads(r)
except Exception as e:
print(e)
break
else:
if rsp and isinstance(rsp, dict):
for key, value in rsp.items():
if key == 'ERROR':
raise K210Error(value)
if key == 'RESP':
return value
if time.ticks_diff(time.ticks_ms(), t1) > timeout:
# raise K210Error("k210 not respone!")
return None
def get_key(self):
return self.send_cmd({'GET_KEYS': 0})
def get_distance(self):
resp = self.send_cmd({'GET_DISTANCE': 0})
if resp is None:
resp = 340
return resp
def set_cam_led(self, on_off):
return self.send_cmd({'SET_CAM_LED': on_off})
def set_motor(self, speed):
return self.send_cmd({'SET_MOTOR': speed})
def file_open(self, *args):
return self.send_cmd({'FILE_OPEN': args})
def file_read(self, *args):
return self.send_cmd({'FILE_READ': args[0]},timeout=300)
def file_write(self, *args):
return self.send_cmd({'FILE_WRITE': args[0]},timeout=300)
def file_close(self):
return self.send_cmd({'FILE_CLOSE': 0})
def reset(self):
self.send_cmd({'RESET': 0},False)
def select_model(self, *args):
self.send_cmd({'SELE_MOD': args[0]}, timeout=3000)
def load_model(self, **kws):
self.send_cmd({'LOD_MOD': kws}, timeout=3000)
def detect_yolo(self):
return self.send_cmd({'DET_YO': 0})
def predict_net(self):
return self.send_cmd({'PRE_NET': 0})
def deinit_yolo(self):
return self.send_cmd({'DINT_YO': 0})
def deinit_net(self):
return self.send_cmd({'DINT_NET': 0})
def camera_snapshot(self):
return self.send_cmd({'SNAPSHOT': 0})
def camera_reset(self):
return self.send_cmd({'CAM_RST': 0},timeout=3000)
def camera_run(self, *arg):
return self.send_cmd({'CAM_RUN': arg[0]})
def camera_set_pixformat(self, *arg):
return self.send_cmd({'CAM_SET_PF': arg[0]})
def camera_set_contrast(self, *arg):
return self.send_cmd({'CAM_SET_CRA': arg[0]})
def camera_set_brightness(self, *arg):
return self.send_cmd({'CAM_SET_BRG': arg[0]})
def camera_set_saturation(self, *arg):
return self.send_cmd({'CAM_SET_SAT': arg[0]})
def camera_set_auto_gain(self, *arg, **kw):
return self.send_cmd({'CAM_AUTO_GAIN': [arg, kw]})
def camera_set_auto_whitebal(self, *arg):
return self.send_cmd({'CAM_AUTO_WBAL': arg[0]})
def camera_set_windowing(self, *arg):
return self.send_cmd({'CAM_SET_WIN': arg[0]})
def camera_set_hmirror(self, *arg):
return self.send_cmd({'CAM_SET_HM': arg[0]})
def camera_set_vflip(self, *arg):
return self.send_cmd({'CAM_SET_VF': arg[0]})
def camera_skip_frames(self, *arg, **kw):
return self.send_cmd({'CAM_SKIP_FRM': [arg, kw]})
def lcd_init(self, *args, **kws):
return self.send_cmd({'LCD_INT': [args, kws]},timeout=5000)
def lcd_display(self, **kws):
return self.send_cmd({'LCD_DISP': kws})
def lcd_clear(self, **kws):
return self.send_cmd({'LCD_CLR': kws})
def lcd_draw_string(self, *args):
return self.send_cmd({'LCD_STR': args})
def image_load(self, *args, **kws):
self.send_cmd({'IMG_LOD': [args, kws]})
time.sleep_ms(200)
def image_width(self):
return self.send_cmd({'IMG_WID': 0})
def image_hight(self):
return self.send_cmd({'IMG_HIG': 0})
def image_format(self):
return self.send_cmd({'IMG_FRM': 0})
def image_size(self):
return self.send_cmd({'IMG_SIZE': 0})
def image_get_pixel(self, *args, **kws):
return self.send_cmd({'IMG_GET_PIX': [args, kws]})
def image_set_pixel(self, *args, **kws):
self.send_cmd({'IMG_SET_PIX': [args, kws]})
def image_mean_pool(self, *args, **kws):
self.send_cmd({'IMG_MEAN_P': [args, kws]})
def image_to_grayscale(self):
self.send_cmd({'IMG_TO_GRAY': 0})
def image_to_rainbow(self):
self.send_cmd({'IMG_TO_RB': 0})
def image_copy(self, *args, **kws):
self.send_cmd({'IMG_CPY': [args, kws]})
def image_save(self, *args, **kws):
self.send_cmd({'IMG_SAVE': [args, kws]})
time.sleep_ms(200)
def image_clear(self):
self.send_cmd({'IMG_CLR': 0})
def image_draw_line(self, *args, **kws):
self.send_cmd({'IMG_DRW_LN': [args, kws]})
def image_draw_rectangle(self, *args, **kws):
self.send_cmd({'IMG_DRW_RECTANG': [args, kws]})
def image_draw_circle(self, *args, **kws):
self.send_cmd({'IMG_DRW_CIR': [args, kws]})
def image_draw_string(self, *args, **kws):
self.send_cmd({'IMG_DRW_STR': [args, kws]})
def image_draw_cross(self, *args, **kws):
self.send_cmd({'IMG_DRW_CRS': [args, kws]})
def image_draw_arrow(self, *args, **kws):
self.send_cmd({'IMG_DRW_ARR': [args, kws]})
def image_draw_image(self, *args, **kws):
self.send_cmd({'IMG_DRW_IMG': [args, kws]})
def image_binary(self, *args, **kws):
self.send_cmd({'IMG_BINARY': [args, kws]})
def image_invert(self):
self.send_cmd({'IMG_INVERT': 0})
def image_erode(self, *args, **kws):
self.send_cmd({'IMG_ERODE': [args, kws]})
def image_dilate(self, *args, **kws):
self.send_cmd({'IMG_DIL': [args, kws]})
def image_negate(self, *args, **kws):
self.send_cmd({'IMG_NEG': [args, kws]})
def image_mean(self, *args, **kws):
self.send_cmd({'IMG_MEAN': [args, kws]})
def image_mode(self, *args, **kws):
self.send_cmd({'IMG_MODE': [args, kws]})
def image_median(self, *args, **kws):
self.send_cmd({'IMG_MEDIAN': [args, kws]})
def image_midpoint(self, *args, **kws):
self.send_cmd({'IMG_MIDP': [args, kws]})
def image_cartoon(self, *args, **kws):
self.send_cmd({'IMG_CART': [args, kws]})
def image_conv3(self, *args, **kws):
self.send_cmd({'IMG_CONV': [args, kws]})
def image_gaussian(self, *args, **kws):
self.send_cmd({'IMG_GAUS': [args, kws]})
def image_bilateral(self, *args, **kws):
self.send_cmd({'IMG_BIL': [args, kws]})
def image_linpolar(self, *args, **kws):
self.send_cmd({'IMG_LINP': [args, kws]})
def image_logpolar(self, *args, **kws):
self.send_cmd({'IMG_LOGP': [args, kws]})
def image_rotation_corr(self, *args, **kws):
self.send_cmd({'IMG_ROT_COR': [args, kws]})
def image_find_blobs(self, *args, **kws):
return [blob(i) for i in self.send_cmd({'IMG_FID_BLOB': [args, kws]})]
| 31.851504 | 167 | 0.580525 |
from machine import Pin, UART
import time
import ujson
from time import sleep_ms, sleep_us, sleep
class BS8112A(object):
def __init__(self, i2c):
self.addr = 80
self._i2c = i2c
self.config = [0xB0, 0x00, 0x00, 0x83, 0xf3, 0x98, 0x0f, 0x0f,
0x0f, 0x0f, 0x0f, 0x0f, 0x0f, 0x0f, 0x0f, 0x0f, 0x0f, 0x0f, 0x00]
checksum = 0
for i in range(1, 19):
checksum += self.config[i]
checksum &= 0xff
self.config[18] = checksum
retry = 0
if (retry < 5):
try:
self._i2c.writeto(self.addr, bytearray(self.config), True)
return
except:
retry = retry + 1
else:
raise Exception("bs8112a i2c read/write error!")
def key_value(self):
retry = 0
if (retry < 5):
try:
self._i2c.writeto(self.addr, b'\x08', False)
time.sleep_ms(10)
value = self._i2c.readfrom(self.addr, 1, True)
time.sleep_ms(10)
return value
except:
retry = retry + 1
else:
raise Exception("bs8112a i2c read/write error!")
class Codec_mode():
ES_MODULE_ADC_DAC = 0x00
ES_MODULE_DAC = 0x01
ES_MODULE_ADC = 0x02
class Es8388():
def __init__(self, i2c, adc_volume=0, dac_volume=0, volume=65):
self._i2c = i2c
self.addr = 16
self.adc_volume = adc_volume
self.dac_volume = dac_volume
self.volume = volume
self.set_voice_mute(1)
retry = 0
if (retry < 5):
try:
self._i2c.writeto(self.addr, bytearray([0x02, 0x00]))
self._i2c.writeto(self.addr, bytearray([0x08, 0x00]))
self._i2c.writeto(self.addr, bytearray([0x04, 0xC0]))
self._i2c.writeto(self.addr, bytearray([0x00, 0x12]))
self._i2c.writeto(self.addr, bytearray([0x17, 0x18]))
self._i2c.writeto(self.addr, bytearray([0x18, 0x02]))
self._i2c.writeto(self.addr, bytearray([0x26, 0x00]))
self._i2c.writeto(self.addr, bytearray([0x27, 0x90]))
self._i2c.writeto(self.addr, bytearray([0x2a, 0x90]))
self._i2c.writeto(self.addr, bytearray([0x2b, 0x80]))
self._i2c.writeto(self.addr, bytearray([0x2d, 0x00]))
self.set_adc_dac_volume(
Codec_mode.ES_MODULE_DAC, self.dac_volume, 0)
self._i2c.writeto(self.addr, bytearray([0x04, 0x3c]))
self._i2c.writeto(self.addr, bytearray(
[0x03, 0xff]))
self._i2c.writeto(self.addr, bytearray([0x09, 0xbb]))
self._i2c.writeto(self.addr, bytearray([0x0a, 0x00]))
self._i2c.writeto(self.addr, bytearray([0x0b, 0x02]))
self._i2c.writeto(self.addr, bytearray([0x0c, 0x0c]))
self._i2c.writeto(self.addr, bytearray([0x0d, 0x02]))
self.set_adc_dac_volume(
Codec_mode.ES_MODULE_ADC, self.adc_volume, 0)
self._i2c.writeto(self.addr, bytearray([0x03, 0x09]))
self.set_volume(self.volume)
self.set_voice_mute(0)
return
except:
retry = retry + 1
else:
raise Exception("es8388 i2c read/write error!")
def deinit(self):
retry = 0
if (retry < 5):
try:
self._i2c.writeto(self.addr, bytearray([0x02, 0xff]))
return
except:
retry = retry + 1
else:
raise Exception("bs8112a i2c read/write error!")
def set_adc_dac_volume(self, mode, volume, dot):
_volume = volume
if (_volume < -96):
_volume = -96
else:
_volume = 0
_dot = 0
if dot >= 5:
_dot = 1
_volume = (-_volume << 1) + _dot
retry = 0
if (retry < 5):
try:
if (mode == Codec_mode.ES_MODULE_ADC or mode == Codec_mode.ES_MODULE_ADC_DAC):
self._i2c.writeto(self.addr, bytearray(
[0x10, _volume]))
self._i2c.writeto(self.addr, bytearray(
[0x11, _volume]))
if (mode == Codec_mode.ES_MODULE_DAC or mode == Codec_mode.ES_MODULE_ADC_DAC):
self._i2c.writeto(self.addr, bytearray(
[0x1b, _volume]))
self._i2c.writeto(self.addr, bytearray(
[0x1a, _volume]))
return
except:
retry = retry + 1
else:
raise Exception("bs8112a i2c read/write error!")
def set_volume(self, volume):
self.volume = volume
if (self.volume < 0):
self.volume = 0
elif (self.volume > 100):
self.volume = 100
retry = 0
if (retry < 5):
try:
self._i2c.writeto(self.addr, bytearray(
[0x2e, self.volume//3]))
self._i2c.writeto(self.addr, bytearray(
[0x2f, self.volume//3]))
self._i2c.writeto(self.addr, bytearray(
[0x30, 0]))
self._i2c.writeto(self.addr, bytearray(
[0x31, 0]))
return
except:
retry = retry + 1
else:
raise Exception("bs8112a i2c read/write error!")
def get_volume(self):
return self.volume
def set_voice_mute(self, mute):
retry = 0
if (retry < 5):
try:
self._i2c.writeto(self.addr, b'\x19')
dac_ctr3 = self._i2c.readfrom(self.addr, 1)[0]
if(mute):
dac_ctr3 |= 0x04
else:
dac_ctr3 &= 0xFB
self._i2c.writeto(self.addr, bytearray([0x19, dac_ctr3]))
except:
retry = retry + 1
else:
raise Exception("bs8112a i2c read/write error!")
uart2 = UART(2, baudrate=1152000, rx=Pin.P8, tx=Pin.P23,
timeout=50, timeout_char=1024, rxbuf=2048, txbuf=2048)
class K210Error(Exception):
pass
class blob():
def __init__(self,*args):
self.dict = args[0]
def __repr__(self):
return self.dict
def x(self):
return self.dict['x']
def y(self):
return self.dict['y']
def w(self):
return self.dict['w']
def h(self):
return self.dict['h']
def rect(self):
return(self.dict['x'], self.dict['y'], self.dict['w'], self.dict['h'])
def pixels(self):
return self.dict['pixels']
def cx(self):
return self.dict['cx']
def cy(self):
return self.dict['cy']
def rotation(self):
return self.dict['rotation']
def code(self):
return self.dict['code']
def count(self):
return self.dict['count']
class K210():
def __init__(self):
t1 = time.ticks_ms()
while (time.ticks_diff(time.ticks_ms(), t1) < 10000):
rsp = self.send_cmd({'GET_KEYS': 0})
if rsp is not None:
return
raise K210Error("K210 init failed!")
def send_cmd(self, command, wait=True, timeout=200):
json_stream = ujson.dumps(command)
uart2.write(json_stream + '\n')
t1 = time.ticks_ms()
while wait:
if uart2.any() > 0:
r=None
r = uart2.readline()
r= r.strip()
while uart2.readline():
pass
try:
rsp = ujson.loads(r)
except Exception as e:
print(e)
break
else:
if rsp and isinstance(rsp, dict):
for key, value in rsp.items():
if key == 'ERROR':
raise K210Error(value)
if key == 'RESP':
return value
if time.ticks_diff(time.ticks_ms(), t1) > timeout:
return None
def get_key(self):
return self.send_cmd({'GET_KEYS': 0})
def get_distance(self):
resp = self.send_cmd({'GET_DISTANCE': 0})
if resp is None:
resp = 340
return resp
def set_cam_led(self, on_off):
return self.send_cmd({'SET_CAM_LED': on_off})
def set_motor(self, speed):
return self.send_cmd({'SET_MOTOR': speed})
def file_open(self, *args):
return self.send_cmd({'FILE_OPEN': args})
def file_read(self, *args):
return self.send_cmd({'FILE_READ': args[0]},timeout=300)
def file_write(self, *args):
return self.send_cmd({'FILE_WRITE': args[0]},timeout=300)
def file_close(self):
return self.send_cmd({'FILE_CLOSE': 0})
def reset(self):
self.send_cmd({'RESET': 0},False)
def select_model(self, *args):
self.send_cmd({'SELE_MOD': args[0]}, timeout=3000)
def load_model(self, **kws):
self.send_cmd({'LOD_MOD': kws}, timeout=3000)
def detect_yolo(self):
return self.send_cmd({'DET_YO': 0})
def predict_net(self):
return self.send_cmd({'PRE_NET': 0})
def deinit_yolo(self):
return self.send_cmd({'DINT_YO': 0})
def deinit_net(self):
return self.send_cmd({'DINT_NET': 0})
def camera_snapshot(self):
return self.send_cmd({'SNAPSHOT': 0})
def camera_reset(self):
return self.send_cmd({'CAM_RST': 0},timeout=3000)
def camera_run(self, *arg):
return self.send_cmd({'CAM_RUN': arg[0]})
def camera_set_pixformat(self, *arg):
return self.send_cmd({'CAM_SET_PF': arg[0]})
def camera_set_contrast(self, *arg):
return self.send_cmd({'CAM_SET_CRA': arg[0]})
def camera_set_brightness(self, *arg):
return self.send_cmd({'CAM_SET_BRG': arg[0]})
def camera_set_saturation(self, *arg):
return self.send_cmd({'CAM_SET_SAT': arg[0]})
def camera_set_auto_gain(self, *arg, **kw):
return self.send_cmd({'CAM_AUTO_GAIN': [arg, kw]})
def camera_set_auto_whitebal(self, *arg):
return self.send_cmd({'CAM_AUTO_WBAL': arg[0]})
def camera_set_windowing(self, *arg):
return self.send_cmd({'CAM_SET_WIN': arg[0]})
def camera_set_hmirror(self, *arg):
return self.send_cmd({'CAM_SET_HM': arg[0]})
def camera_set_vflip(self, *arg):
return self.send_cmd({'CAM_SET_VF': arg[0]})
def camera_skip_frames(self, *arg, **kw):
return self.send_cmd({'CAM_SKIP_FRM': [arg, kw]})
def lcd_init(self, *args, **kws):
return self.send_cmd({'LCD_INT': [args, kws]},timeout=5000)
def lcd_display(self, **kws):
return self.send_cmd({'LCD_DISP': kws})
def lcd_clear(self, **kws):
return self.send_cmd({'LCD_CLR': kws})
def lcd_draw_string(self, *args):
return self.send_cmd({'LCD_STR': args})
def image_load(self, *args, **kws):
self.send_cmd({'IMG_LOD': [args, kws]})
time.sleep_ms(200)
def image_width(self):
return self.send_cmd({'IMG_WID': 0})
def image_hight(self):
return self.send_cmd({'IMG_HIG': 0})
def image_format(self):
return self.send_cmd({'IMG_FRM': 0})
def image_size(self):
return self.send_cmd({'IMG_SIZE': 0})
def image_get_pixel(self, *args, **kws):
return self.send_cmd({'IMG_GET_PIX': [args, kws]})
def image_set_pixel(self, *args, **kws):
self.send_cmd({'IMG_SET_PIX': [args, kws]})
def image_mean_pool(self, *args, **kws):
self.send_cmd({'IMG_MEAN_P': [args, kws]})
def image_to_grayscale(self):
self.send_cmd({'IMG_TO_GRAY': 0})
def image_to_rainbow(self):
self.send_cmd({'IMG_TO_RB': 0})
def image_copy(self, *args, **kws):
self.send_cmd({'IMG_CPY': [args, kws]})
def image_save(self, *args, **kws):
self.send_cmd({'IMG_SAVE': [args, kws]})
time.sleep_ms(200)
def image_clear(self):
self.send_cmd({'IMG_CLR': 0})
def image_draw_line(self, *args, **kws):
self.send_cmd({'IMG_DRW_LN': [args, kws]})
def image_draw_rectangle(self, *args, **kws):
self.send_cmd({'IMG_DRW_RECTANG': [args, kws]})
def image_draw_circle(self, *args, **kws):
self.send_cmd({'IMG_DRW_CIR': [args, kws]})
def image_draw_string(self, *args, **kws):
self.send_cmd({'IMG_DRW_STR': [args, kws]})
def image_draw_cross(self, *args, **kws):
self.send_cmd({'IMG_DRW_CRS': [args, kws]})
def image_draw_arrow(self, *args, **kws):
self.send_cmd({'IMG_DRW_ARR': [args, kws]})
def image_draw_image(self, *args, **kws):
self.send_cmd({'IMG_DRW_IMG': [args, kws]})
def image_binary(self, *args, **kws):
self.send_cmd({'IMG_BINARY': [args, kws]})
def image_invert(self):
self.send_cmd({'IMG_INVERT': 0})
def image_erode(self, *args, **kws):
self.send_cmd({'IMG_ERODE': [args, kws]})
def image_dilate(self, *args, **kws):
self.send_cmd({'IMG_DIL': [args, kws]})
def image_negate(self, *args, **kws):
self.send_cmd({'IMG_NEG': [args, kws]})
def image_mean(self, *args, **kws):
self.send_cmd({'IMG_MEAN': [args, kws]})
def image_mode(self, *args, **kws):
self.send_cmd({'IMG_MODE': [args, kws]})
def image_median(self, *args, **kws):
self.send_cmd({'IMG_MEDIAN': [args, kws]})
def image_midpoint(self, *args, **kws):
self.send_cmd({'IMG_MIDP': [args, kws]})
def image_cartoon(self, *args, **kws):
self.send_cmd({'IMG_CART': [args, kws]})
def image_conv3(self, *args, **kws):
self.send_cmd({'IMG_CONV': [args, kws]})
def image_gaussian(self, *args, **kws):
self.send_cmd({'IMG_GAUS': [args, kws]})
def image_bilateral(self, *args, **kws):
self.send_cmd({'IMG_BIL': [args, kws]})
def image_linpolar(self, *args, **kws):
self.send_cmd({'IMG_LINP': [args, kws]})
def image_logpolar(self, *args, **kws):
self.send_cmd({'IMG_LOGP': [args, kws]})
def image_rotation_corr(self, *args, **kws):
self.send_cmd({'IMG_ROT_COR': [args, kws]})
def image_find_blobs(self, *args, **kws):
return [blob(i) for i in self.send_cmd({'IMG_FID_BLOB': [args, kws]})]
| true | true |
f702d1ee5d85bb2a40fcf9e18f5769b34c6eb104 | 229 | py | Python | examples/fortran/run.py | pyflosic/fodMC | 93259b527d39cc02dcded0c42f89a73ba16851d1 | [
"Apache-2.0"
] | 5 | 2019-06-24T08:03:58.000Z | 2021-04-13T14:54:50.000Z | examples/fortran/run.py | pyflosic/fodMC | 93259b527d39cc02dcded0c42f89a73ba16851d1 | [
"Apache-2.0"
] | 15 | 2019-05-20T10:40:46.000Z | 2021-07-20T16:40:25.000Z | examples/fortran/run.py | pyflosic/fodMC | 93259b527d39cc02dcded0c42f89a73ba16851d1 | [
"Apache-2.0"
] | 2 | 2019-09-28T12:40:59.000Z | 2021-07-20T15:06:11.000Z | import fodmc
# output_mode: PyFLOSIC, NRLMOL
# output_name: NameOfMolecule.xyz (for PyFLOSIC only)
output_mode = ['NRLMOL','PyFLOSIC'][1]
output_name = ['', 'test.xyz'][1]
fodmc.fodmc_mod.get_guess(output_mode,output_name)
| 32.714286 | 54 | 0.737991 | import fodmc
output_mode = ['NRLMOL','PyFLOSIC'][1]
output_name = ['', 'test.xyz'][1]
fodmc.fodmc_mod.get_guess(output_mode,output_name)
| true | true |
f702d2430cad6f9017bafe76fa53486b73f6bf16 | 5,816 | py | Python | tests/gcp/sensors/test_cloud_storage_transfer_service.py | ktmud/incubator-airflow | 43154c643c3c598c769d645891f2e8e123f8bdde | [
"Apache-2.0"
] | 5 | 2020-07-17T07:33:58.000Z | 2022-03-02T06:23:47.000Z | tests/gcp/sensors/test_cloud_storage_transfer_service.py | ktmud/incubator-airflow | 43154c643c3c598c769d645891f2e8e123f8bdde | [
"Apache-2.0"
] | 7 | 2020-06-03T14:55:17.000Z | 2021-12-30T00:01:50.000Z | tests/gcp/sensors/test_cloud_storage_transfer_service.py | ktmud/incubator-airflow | 43154c643c3c598c769d645891f2e8e123f8bdde | [
"Apache-2.0"
] | 12 | 2020-01-09T14:02:39.000Z | 2022-01-24T07:18:51.000Z | # -*- coding: utf-8 -*-
#
# Licensed to the Apache Software Foundation (ASF) under one
# or more contributor license agreements. See the NOTICE file
# distributed with this work for additional information
# regarding copyright ownership. The ASF licenses this file
# to you under the Apache License, Version 2.0 (the
# "License"); you may not use this file except in compliance
# with the License. You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing,
# software distributed under the License is distributed on an
# "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
# KIND, either express or implied. See the License for the
# specific language governing permissions and limitations
# under the License.
import unittest
import mock
from parameterized import parameterized
from airflow.gcp.hooks.cloud_storage_transfer_service import GcpTransferOperationStatus
from airflow.gcp.sensors.cloud_storage_transfer_service import CloudDataTransferServiceJobStatusSensor
class TestGcpStorageTransferOperationWaitForJobStatusSensor(unittest.TestCase):
@mock.patch('airflow.gcp.sensors.cloud_storage_transfer_service.CloudDataTransferServiceHook')
def test_wait_for_status_success(self, mock_tool):
operations = [{'metadata': {'status': GcpTransferOperationStatus.SUCCESS}}]
mock_tool.return_value.list_transfer_operations.return_value = operations
mock_tool.operations_contain_expected_statuses.return_value = True
op = CloudDataTransferServiceJobStatusSensor(
task_id='task-id',
job_name='job-name',
project_id='project-id',
expected_statuses=GcpTransferOperationStatus.SUCCESS,
)
context = {'ti': (mock.Mock(**{'xcom_push.return_value': None}))}
result = op.poke(context)
mock_tool.return_value.list_transfer_operations.assert_called_once_with(
request_filter={'project_id': 'project-id', 'job_names': ['job-name']}
)
mock_tool.operations_contain_expected_statuses.assert_called_once_with(
operations=operations, expected_statuses={GcpTransferOperationStatus.SUCCESS}
)
self.assertTrue(result)
@mock.patch('airflow.gcp.sensors.cloud_storage_transfer_service.CloudDataTransferServiceHook')
def test_wait_for_status_success_default_expected_status(self, mock_tool):
op = CloudDataTransferServiceJobStatusSensor(
task_id='task-id',
job_name='job-name',
project_id='project-id',
expected_statuses=GcpTransferOperationStatus.SUCCESS,
)
context = {'ti': (mock.Mock(**{'xcom_push.return_value': None}))}
result = op.poke(context)
mock_tool.operations_contain_expected_statuses.assert_called_once_with(
operations=mock.ANY, expected_statuses={GcpTransferOperationStatus.SUCCESS}
)
self.assertTrue(result)
@mock.patch('airflow.gcp.sensors.cloud_storage_transfer_service.CloudDataTransferServiceHook')
def test_wait_for_status_after_retry(self, mock_tool):
operations_set = [
[{'metadata': {'status': GcpTransferOperationStatus.SUCCESS}}],
[{'metadata': {'status': GcpTransferOperationStatus.SUCCESS}}],
]
mock_tool.return_value.list_transfer_operations.side_effect = operations_set
mock_tool.operations_contain_expected_statuses.side_effect = [False, True]
op = CloudDataTransferServiceJobStatusSensor(
task_id='task-id',
job_name='job-name',
project_id='project-id',
expected_statuses=GcpTransferOperationStatus.SUCCESS,
)
context = {'ti': (mock.Mock(**{'xcom_push.return_value': None}))}
result = op.poke(context)
self.assertFalse(result)
mock_tool.operations_contain_expected_statuses.assert_called_once_with(
operations=operations_set[0], expected_statuses={GcpTransferOperationStatus.SUCCESS}
)
mock_tool.operations_contain_expected_statuses.reset_mock()
result = op.poke(context)
self.assertTrue(result)
mock_tool.operations_contain_expected_statuses.assert_called_once_with(
operations=operations_set[1], expected_statuses={GcpTransferOperationStatus.SUCCESS}
)
@parameterized.expand(
[
(GcpTransferOperationStatus.SUCCESS, {GcpTransferOperationStatus.SUCCESS}),
({GcpTransferOperationStatus.SUCCESS}, {GcpTransferOperationStatus.SUCCESS}),
(
{GcpTransferOperationStatus.SUCCESS, GcpTransferOperationStatus.SUCCESS},
{GcpTransferOperationStatus.SUCCESS, GcpTransferOperationStatus.SUCCESS},
),
]
)
@mock.patch('airflow.gcp.sensors.cloud_storage_transfer_service.CloudDataTransferServiceHook')
def test_wait_for_status_normalize_status(self, expected_status, received_status, mock_tool):
operations = [{'metadata': {'status': GcpTransferOperationStatus.SUCCESS}}]
mock_tool.return_value.list_transfer_operations.return_value = operations
mock_tool.operations_contain_expected_statuses.side_effect = [False, True]
op = CloudDataTransferServiceJobStatusSensor(
task_id='task-id',
job_name='job-name',
project_id='project-id',
expected_statuses=expected_status,
)
context = {'ti': (mock.Mock(**{'xcom_push.return_value': None}))}
result = op.poke(context)
self.assertFalse(result)
mock_tool.operations_contain_expected_statuses.assert_called_once_with(
operations=operations, expected_statuses=received_status
)
| 42.144928 | 102 | 0.714752 |
import unittest
import mock
from parameterized import parameterized
from airflow.gcp.hooks.cloud_storage_transfer_service import GcpTransferOperationStatus
from airflow.gcp.sensors.cloud_storage_transfer_service import CloudDataTransferServiceJobStatusSensor
class TestGcpStorageTransferOperationWaitForJobStatusSensor(unittest.TestCase):
@mock.patch('airflow.gcp.sensors.cloud_storage_transfer_service.CloudDataTransferServiceHook')
def test_wait_for_status_success(self, mock_tool):
operations = [{'metadata': {'status': GcpTransferOperationStatus.SUCCESS}}]
mock_tool.return_value.list_transfer_operations.return_value = operations
mock_tool.operations_contain_expected_statuses.return_value = True
op = CloudDataTransferServiceJobStatusSensor(
task_id='task-id',
job_name='job-name',
project_id='project-id',
expected_statuses=GcpTransferOperationStatus.SUCCESS,
)
context = {'ti': (mock.Mock(**{'xcom_push.return_value': None}))}
result = op.poke(context)
mock_tool.return_value.list_transfer_operations.assert_called_once_with(
request_filter={'project_id': 'project-id', 'job_names': ['job-name']}
)
mock_tool.operations_contain_expected_statuses.assert_called_once_with(
operations=operations, expected_statuses={GcpTransferOperationStatus.SUCCESS}
)
self.assertTrue(result)
@mock.patch('airflow.gcp.sensors.cloud_storage_transfer_service.CloudDataTransferServiceHook')
def test_wait_for_status_success_default_expected_status(self, mock_tool):
op = CloudDataTransferServiceJobStatusSensor(
task_id='task-id',
job_name='job-name',
project_id='project-id',
expected_statuses=GcpTransferOperationStatus.SUCCESS,
)
context = {'ti': (mock.Mock(**{'xcom_push.return_value': None}))}
result = op.poke(context)
mock_tool.operations_contain_expected_statuses.assert_called_once_with(
operations=mock.ANY, expected_statuses={GcpTransferOperationStatus.SUCCESS}
)
self.assertTrue(result)
@mock.patch('airflow.gcp.sensors.cloud_storage_transfer_service.CloudDataTransferServiceHook')
def test_wait_for_status_after_retry(self, mock_tool):
operations_set = [
[{'metadata': {'status': GcpTransferOperationStatus.SUCCESS}}],
[{'metadata': {'status': GcpTransferOperationStatus.SUCCESS}}],
]
mock_tool.return_value.list_transfer_operations.side_effect = operations_set
mock_tool.operations_contain_expected_statuses.side_effect = [False, True]
op = CloudDataTransferServiceJobStatusSensor(
task_id='task-id',
job_name='job-name',
project_id='project-id',
expected_statuses=GcpTransferOperationStatus.SUCCESS,
)
context = {'ti': (mock.Mock(**{'xcom_push.return_value': None}))}
result = op.poke(context)
self.assertFalse(result)
mock_tool.operations_contain_expected_statuses.assert_called_once_with(
operations=operations_set[0], expected_statuses={GcpTransferOperationStatus.SUCCESS}
)
mock_tool.operations_contain_expected_statuses.reset_mock()
result = op.poke(context)
self.assertTrue(result)
mock_tool.operations_contain_expected_statuses.assert_called_once_with(
operations=operations_set[1], expected_statuses={GcpTransferOperationStatus.SUCCESS}
)
@parameterized.expand(
[
(GcpTransferOperationStatus.SUCCESS, {GcpTransferOperationStatus.SUCCESS}),
({GcpTransferOperationStatus.SUCCESS}, {GcpTransferOperationStatus.SUCCESS}),
(
{GcpTransferOperationStatus.SUCCESS, GcpTransferOperationStatus.SUCCESS},
{GcpTransferOperationStatus.SUCCESS, GcpTransferOperationStatus.SUCCESS},
),
]
)
@mock.patch('airflow.gcp.sensors.cloud_storage_transfer_service.CloudDataTransferServiceHook')
def test_wait_for_status_normalize_status(self, expected_status, received_status, mock_tool):
operations = [{'metadata': {'status': GcpTransferOperationStatus.SUCCESS}}]
mock_tool.return_value.list_transfer_operations.return_value = operations
mock_tool.operations_contain_expected_statuses.side_effect = [False, True]
op = CloudDataTransferServiceJobStatusSensor(
task_id='task-id',
job_name='job-name',
project_id='project-id',
expected_statuses=expected_status,
)
context = {'ti': (mock.Mock(**{'xcom_push.return_value': None}))}
result = op.poke(context)
self.assertFalse(result)
mock_tool.operations_contain_expected_statuses.assert_called_once_with(
operations=operations, expected_statuses=received_status
)
| true | true |
f702d248ad2a10ba4e875fcb3f658bb636bddf06 | 455 | py | Python | maps/migrations/0012_auto_20201019_2139.py | naveennvrgup/smart-traffic-light | 1c4d050314d8dc42ebf11491b3421c511e2718f3 | [
"MIT"
] | null | null | null | maps/migrations/0012_auto_20201019_2139.py | naveennvrgup/smart-traffic-light | 1c4d050314d8dc42ebf11491b3421c511e2718f3 | [
"MIT"
] | null | null | null | maps/migrations/0012_auto_20201019_2139.py | naveennvrgup/smart-traffic-light | 1c4d050314d8dc42ebf11491b3421c511e2718f3 | [
"MIT"
] | null | null | null | # Generated by Django 3.1.1 on 2020-10-19 16:09
import datetime
from django.db import migrations, models
class Migration(migrations.Migration):
dependencies = [
('maps', '0011_auto_20201019_1839'),
]
operations = [
migrations.AlterField(
model_name='trafficsignal',
name='timer',
field=models.DateTimeField(default=datetime.datetime(2020, 10, 19, 21, 39, 12, 862273)),
),
]
| 22.75 | 100 | 0.621978 |
import datetime
from django.db import migrations, models
class Migration(migrations.Migration):
dependencies = [
('maps', '0011_auto_20201019_1839'),
]
operations = [
migrations.AlterField(
model_name='trafficsignal',
name='timer',
field=models.DateTimeField(default=datetime.datetime(2020, 10, 19, 21, 39, 12, 862273)),
),
]
| true | true |
f702d2497d469161032517772b4500ad115d0b1e | 670 | py | Python | kekangpai/band/migrations/0003_auto_20160725_1313.py | returnToZ/BandHelper | ce8ca3094c6cc4b05b213766710ba6263f41705d | [
"Apache-2.0"
] | null | null | null | kekangpai/band/migrations/0003_auto_20160725_1313.py | returnToZ/BandHelper | ce8ca3094c6cc4b05b213766710ba6263f41705d | [
"Apache-2.0"
] | null | null | null | kekangpai/band/migrations/0003_auto_20160725_1313.py | returnToZ/BandHelper | ce8ca3094c6cc4b05b213766710ba6263f41705d | [
"Apache-2.0"
] | 1 | 2021-12-15T02:31:09.000Z | 2021-12-15T02:31:09.000Z | # -*- coding: utf-8 -*-
# Generated by Django 1.9.1 on 2016-07-25 13:13
from __future__ import unicode_literals
from django.db import migrations, models
import django.db.models.deletion
class Migration(migrations.Migration):
dependencies = [
('band', '0002_auto_20160725_1313'),
]
operations = [
migrations.RemoveField(
model_name='personal',
name='id',
),
migrations.AlterField(
model_name='personal',
name='username',
field=models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, primary_key=True, serialize=False, to='band.Account'),
),
]
| 25.769231 | 135 | 0.626866 |
from __future__ import unicode_literals
from django.db import migrations, models
import django.db.models.deletion
class Migration(migrations.Migration):
dependencies = [
('band', '0002_auto_20160725_1313'),
]
operations = [
migrations.RemoveField(
model_name='personal',
name='id',
),
migrations.AlterField(
model_name='personal',
name='username',
field=models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, primary_key=True, serialize=False, to='band.Account'),
),
]
| true | true |
f702d3674b7ec06859bfdd3f9e087d7eefda8de1 | 191,102 | py | Python | imgaug/augmenters/size.py | fchouteau/imgaug | b282b97c13a27a32f91c2e2666db1e128e00cfde | [
"MIT"
] | 1 | 2020-02-26T01:05:12.000Z | 2020-02-26T01:05:12.000Z | imgaug/augmenters/size.py | youbin2014/imgaug | b282b97c13a27a32f91c2e2666db1e128e00cfde | [
"MIT"
] | null | null | null | imgaug/augmenters/size.py | youbin2014/imgaug | b282b97c13a27a32f91c2e2666db1e128e00cfde | [
"MIT"
] | null | null | null | """
Augmenters that somehow change the size of the images.
List of augmenters:
* :class:`Resize`
* :class:`CropAndPad`
* :class:`Crop`
* :class:`Pad`
* :class:`PadToFixedSize`
* :class:`CenterPadToFixedSize`
* :class:`CropToFixedSize`
* :class:`CenterCropToFixedSize`
* :class:`CropToMultiplesOf`
* :class:`CenterCropToMultiplesOf`
* :class:`PadToMultiplesOf`
* :class:`CenterPadToMultiplesOf`
* :class:`CropToPowersOf`
* :class:`CenterCropToPowersOf`
* :class:`PadToPowersOf`
* :class:`CenterPadToPowersOf`
* :class:`CropToAspectRatio`
* :class:`CenterCropToAspectRatio`
* :class:`PadToAspectRatio`
* :class:`CenterPadToAspectRatio`
* :class:`CropToSquare`
* :class:`CenterCropToSquare`
* :class:`PadToSquare`
* :class:`CenterPadToSquare`
* :class:`KeepSizeByResize`
"""
from __future__ import print_function, division, absolute_import
import re
import functools
import numpy as np
import cv2
import imgaug as ia
from imgaug.imgaug import _normalize_cv2_input_arr_
from . import meta
from .. import parameters as iap
def _crop_trbl_to_xyxy(shape, top, right, bottom, left, prevent_zero_size=True):
if prevent_zero_size:
top, right, bottom, left = _crop_prevent_zero_size(
shape[0], shape[1], top, right, bottom, left)
height, width = shape[0:2]
x1 = left
x2 = width - right
y1 = top
y2 = height - bottom
# these steps prevent negative sizes
# if x2==x1 or y2==y1 then the output arr has size 0 for the respective axis
# note that if height/width of arr is zero, then y2==y1 or x2==x1, which
# is still valid, even if height/width is zero and results in a zero-sized
# axis
x2 = max(x2, x1)
y2 = max(y2, y1)
return x1, y1, x2, y2
def _crop_arr_(arr, top, right, bottom, left, prevent_zero_size=True):
x1, y1, x2, y2 = _crop_trbl_to_xyxy(arr.shape, top, right, bottom, left,
prevent_zero_size=prevent_zero_size)
return arr[y1:y2, x1:x2, ...]
def _crop_and_pad_arr(arr, croppings, paddings, pad_mode="constant",
pad_cval=0, keep_size=False):
height, width = arr.shape[0:2]
image_cr = _crop_arr_(arr, *croppings)
image_cr_pa = pad(
image_cr,
top=paddings[0], right=paddings[1],
bottom=paddings[2], left=paddings[3],
mode=pad_mode, cval=pad_cval)
if keep_size:
image_cr_pa = ia.imresize_single_image(image_cr_pa, (height, width))
return image_cr_pa
def _crop_and_pad_heatmap_(heatmap, croppings_img, paddings_img,
pad_mode="constant", pad_cval=0.0, keep_size=False):
return _crop_and_pad_hms_or_segmaps_(heatmap, croppings_img,
paddings_img, pad_mode, pad_cval,
keep_size)
def _crop_and_pad_segmap_(segmap, croppings_img, paddings_img,
pad_mode="constant", pad_cval=0, keep_size=False):
return _crop_and_pad_hms_or_segmaps_(segmap, croppings_img,
paddings_img, pad_mode, pad_cval,
keep_size)
def _crop_and_pad_hms_or_segmaps_(augmentable, croppings_img,
paddings_img, pad_mode="constant",
pad_cval=None, keep_size=False):
if isinstance(augmentable, ia.HeatmapsOnImage):
arr_attr_name = "arr_0to1"
pad_cval = pad_cval if pad_cval is not None else 0.0
else:
assert isinstance(augmentable, ia.SegmentationMapsOnImage), (
"Expected HeatmapsOnImage or SegmentationMapsOnImage, got %s." % (
type(augmentable)))
arr_attr_name = "arr"
pad_cval = pad_cval if pad_cval is not None else 0
arr = getattr(augmentable, arr_attr_name)
arr_shape_orig = arr.shape
augm_shape = augmentable.shape
croppings_proj = _project_size_changes(croppings_img, augm_shape, arr.shape)
paddings_proj = _project_size_changes(paddings_img, augm_shape, arr.shape)
croppings_proj = _crop_prevent_zero_size(arr.shape[0], arr.shape[1],
*croppings_proj)
arr_cr = _crop_arr_(arr,
croppings_proj[0], croppings_proj[1],
croppings_proj[2], croppings_proj[3])
arr_cr_pa = pad(
arr_cr,
top=paddings_proj[0], right=paddings_proj[1],
bottom=paddings_proj[2], left=paddings_proj[3],
mode=pad_mode,
cval=pad_cval)
setattr(augmentable, arr_attr_name, arr_cr_pa)
if keep_size:
augmentable = augmentable.resize(arr_shape_orig[0:2])
else:
augmentable.shape = _compute_shape_after_crop_and_pad(
augmentable.shape, croppings_img, paddings_img)
return augmentable
def _crop_and_pad_kpsoi_(kpsoi, croppings_img, paddings_img, keep_size):
# using the trbl function instead of croppings_img has the advantage
# of incorporating prevent_zero_size, dealing with zero-sized input image
# axis and dealing the negative crop amounts
x1, y1, _x2, _y2 = _crop_trbl_to_xyxy(kpsoi.shape, *croppings_img)
crop_left = x1
crop_top = y1
shape_orig = kpsoi.shape
shifted = kpsoi.shift_(
x=-crop_left+paddings_img[3],
y=-crop_top+paddings_img[0])
shifted.shape = _compute_shape_after_crop_and_pad(
shape_orig, croppings_img, paddings_img)
if keep_size:
shifted = shifted.on_(shape_orig)
return shifted
def _compute_shape_after_crop_and_pad(old_shape, croppings, paddings):
x1, y1, x2, y2 = _crop_trbl_to_xyxy(old_shape, *croppings)
new_shape = list(old_shape)
new_shape[0] = y2 - y1 + paddings[0] + paddings[2]
new_shape[1] = x2 - x1 + paddings[1] + paddings[3]
return tuple(new_shape)
def _crop_prevent_zero_size(height, width, crop_top, crop_right, crop_bottom,
crop_left):
remaining_height = height - (crop_top + crop_bottom)
remaining_width = width - (crop_left + crop_right)
if remaining_height < 1:
regain = abs(remaining_height) + 1
regain_top = regain // 2
regain_bottom = regain // 2
if regain_top + regain_bottom < regain:
regain_top += 1
if regain_top > crop_top:
diff = regain_top - crop_top
regain_top = crop_top
regain_bottom += diff
elif regain_bottom > crop_bottom:
diff = regain_bottom - crop_bottom
regain_bottom = crop_bottom
regain_top += diff
crop_top = crop_top - regain_top
crop_bottom = crop_bottom - regain_bottom
if remaining_width < 1:
regain = abs(remaining_width) + 1
regain_right = regain // 2
regain_left = regain // 2
if regain_right + regain_left < regain:
regain_right += 1
if regain_right > crop_right:
diff = regain_right - crop_right
regain_right = crop_right
regain_left += diff
elif regain_left > crop_left:
diff = regain_left - crop_left
regain_left = crop_left
regain_right += diff
crop_right = crop_right - regain_right
crop_left = crop_left - regain_left
return (
max(crop_top, 0), max(crop_right, 0), max(crop_bottom, 0),
max(crop_left, 0))
def _project_size_changes(trbl, from_shape, to_shape):
if from_shape[0:2] == to_shape[0:2]:
return trbl
height_to = to_shape[0]
width_to = to_shape[1]
height_from = from_shape[0]
width_from = from_shape[1]
top = trbl[0]
right = trbl[1]
bottom = trbl[2]
left = trbl[3]
# Adding/subtracting 1e-4 here helps for the case where a heatmap/segmap
# is exactly half the size of an image and the size change on an axis is
# an odd value. Then the projected value would end up being <something>.5
# and the rounding would always round up to the next integer. If both
# sides then have the same change, they are both rounded up, resulting
# in more change than expected.
# E.g. image height is 8, map height is 4, change is 3 at the top and 3 at
# the bottom. The changes are projected to 4*(3/8) = 1.5 and both rounded
# up to 2.0. Hence, the maps are changed by 4 (100% of the map height,
# vs. 6 for images, which is 75% of the image height).
top = _int_r(height_to * (top/height_from) - 1e-4)
right = _int_r(width_to * (right/width_from) + 1e-4)
bottom = _int_r(height_to * (bottom/height_from) + 1e-4)
left = _int_r(width_to * (left/width_from) - 1e-4)
return top, right, bottom, left
def _int_r(value):
return int(np.round(value))
# TODO somehow integrate this with pad()
def _handle_pad_mode_param(pad_mode):
pad_modes_available = {
"constant", "edge", "linear_ramp", "maximum", "mean", "median",
"minimum", "reflect", "symmetric", "wrap"}
if pad_mode == ia.ALL:
return iap.Choice(list(pad_modes_available))
if ia.is_string(pad_mode):
assert pad_mode in pad_modes_available, (
"Value '%s' is not a valid pad mode. Valid pad modes are: %s." % (
pad_mode, ", ".join(pad_modes_available)))
return iap.Deterministic(pad_mode)
if isinstance(pad_mode, list):
assert all([v in pad_modes_available for v in pad_mode]), (
"At least one in list %s is not a valid pad mode. Valid pad "
"modes are: %s." % (str(pad_mode), ", ".join(pad_modes_available)))
return iap.Choice(pad_mode)
if isinstance(pad_mode, iap.StochasticParameter):
return pad_mode
raise Exception(
"Expected pad_mode to be ia.ALL or string or list of strings or "
"StochasticParameter, got %s." % (type(pad_mode),))
def _handle_position_parameter(position):
if position == "uniform":
return iap.Uniform(0.0, 1.0), iap.Uniform(0.0, 1.0)
if position == "normal":
return (
iap.Clip(iap.Normal(loc=0.5, scale=0.35 / 2),
minval=0.0, maxval=1.0),
iap.Clip(iap.Normal(loc=0.5, scale=0.35 / 2),
minval=0.0, maxval=1.0)
)
if position == "center":
return iap.Deterministic(0.5), iap.Deterministic(0.5)
if (ia.is_string(position)
and re.match(r"^(left|center|right)-(top|center|bottom)$",
position)):
mapping = {"top": 0.0, "center": 0.5, "bottom": 1.0, "left": 0.0,
"right": 1.0}
return (
iap.Deterministic(mapping[position.split("-")[0]]),
iap.Deterministic(mapping[position.split("-")[1]])
)
if isinstance(position, iap.StochasticParameter):
return position
if isinstance(position, tuple):
assert len(position) == 2, (
"Expected tuple with two entries as position parameter. "
"Got %d entries with types %s.." % (
len(position), str([type(item) for item in position])))
for item in position:
if ia.is_single_number(item) and (item < 0 or item > 1.0):
raise Exception(
"Both position values must be within the value range "
"[0.0, 1.0]. Got type %s with value %.8f." % (
type(item), item,))
position = [iap.Deterministic(item)
if ia.is_single_number(item)
else item for item in position]
only_sparams = all([isinstance(item, iap.StochasticParameter)
for item in position])
assert only_sparams, (
"Expected tuple with two entries that are both either "
"StochasticParameter or float/int. Got types %s." % (
str([type(item) for item in position])
))
return tuple(position)
raise Exception(
"Expected one of the following as position parameter: string "
"'uniform', string 'normal', string 'center', a string matching "
"regex ^(left|center|right)-(top|center|bottom)$, a single "
"StochasticParameter or a tuple of two entries, both being either "
"StochasticParameter or floats or int. Got instead type %s with "
"content '%s'." % (
type(position),
(str(position)
if len(str(position)) < 20
else str(position)[0:20] + "...")
)
)
# TODO this is the same as in imgaug.py, make DRY
def _assert_two_or_three_dims(shape):
if hasattr(shape, "shape"):
shape = shape.shape
assert len(shape) in [2, 3], (
"Expected image with two or three dimensions, but got %d dimensions "
"and shape %s." % (len(shape), shape))
def pad(arr, top=0, right=0, bottom=0, left=0, mode="constant", cval=0):
"""Pad an image-like array on its top/right/bottom/left side.
This function is a wrapper around :func:`numpy.pad`.
Supported dtypes
----------------
* ``uint8``: yes; fully tested (1)
* ``uint16``: yes; fully tested (1)
* ``uint32``: yes; fully tested (2) (3)
* ``uint64``: yes; fully tested (2) (3)
* ``int8``: yes; fully tested (1)
* ``int16``: yes; fully tested (1)
* ``int32``: yes; fully tested (1)
* ``int64``: yes; fully tested (2) (3)
* ``float16``: yes; fully tested (2) (3)
* ``float32``: yes; fully tested (1)
* ``float64``: yes; fully tested (1)
* ``float128``: yes; fully tested (2) (3)
* ``bool``: yes; tested (2) (3)
- (1) Uses ``cv2`` if `mode` is one of: ``"constant"``, ``"edge"``,
``"reflect"``, ``"symmetric"``. Otherwise uses ``numpy``.
- (2) Uses ``numpy``.
- (3) Rejected by ``cv2``.
Parameters
----------
arr : (H,W) ndarray or (H,W,C) ndarray
Image-like array to pad.
top : int, optional
Amount of pixels to add to the top side of the image.
Must be ``0`` or greater.
right : int, optional
Amount of pixels to add to the right side of the image.
Must be ``0`` or greater.
bottom : int, optional
Amount of pixels to add to the bottom side of the image.
Must be ``0`` or greater.
left : int, optional
Amount of pixels to add to the left side of the image.
Must be ``0`` or greater.
mode : str, optional
Padding mode to use. See :func:`numpy.pad` for details.
In case of mode ``constant``, the parameter `cval` will be used as
the ``constant_values`` parameter to :func:`numpy.pad`.
In case of mode ``linear_ramp``, the parameter `cval` will be used as
the ``end_values`` parameter to :func:`numpy.pad`.
cval : number or iterable of number, optional
Value to use for padding if `mode` is ``constant``.
See :func:`numpy.pad` for details. The cval is expected to match the
input array's dtype and value range. If an iterable is used, it is
expected to contain one value per channel. The number of values
and number of channels are expected to match.
Returns
-------
(H',W') ndarray or (H',W',C) ndarray
Padded array with height ``H'=H+top+bottom`` and width
``W'=W+left+right``.
"""
import imgaug.dtypes as iadt
_assert_two_or_three_dims(arr)
assert all([v >= 0 for v in [top, right, bottom, left]]), (
"Expected padding amounts that are >=0, but got %d, %d, %d, %d "
"(top, right, bottom, left)" % (top, right, bottom, left))
is_multi_cval = ia.is_iterable(cval)
if top > 0 or right > 0 or bottom > 0 or left > 0:
min_value, _, max_value = iadt.get_value_range_of_dtype(arr.dtype)
# without the if here there are crashes for float128, e.g. if
# cval is an int (just using float(cval) seems to not be accurate
# enough)
if arr.dtype.name == "float128":
cval = np.float128(cval) # pylint: disable=no-member
if is_multi_cval:
cval = np.clip(cval, min_value, max_value)
else:
cval = max(min(cval, max_value), min_value)
# Note that copyMakeBorder() hangs/runs endlessly if arr has an
# axis of size 0 and mode is "reflect".
# Numpy also complains in these cases if mode is not "constant".
has_zero_sized_axis = any([axis == 0 for axis in arr.shape])
if has_zero_sized_axis:
mode = "constant"
mapping_mode_np_to_cv2 = {
"constant": cv2.BORDER_CONSTANT,
"edge": cv2.BORDER_REPLICATE,
"linear_ramp": None,
"maximum": None,
"mean": None,
"median": None,
"minimum": None,
"reflect": cv2.BORDER_REFLECT_101,
"symmetric": cv2.BORDER_REFLECT,
"wrap": None,
cv2.BORDER_CONSTANT: cv2.BORDER_CONSTANT,
cv2.BORDER_REPLICATE: cv2.BORDER_REPLICATE,
cv2.BORDER_REFLECT_101: cv2.BORDER_REFLECT_101,
cv2.BORDER_REFLECT: cv2.BORDER_REFLECT
}
bad_mode_cv2 = mapping_mode_np_to_cv2.get(mode, None) is None
# these datatypes all simply generate a "TypeError: src data type = X
# is not supported" error
bad_datatype_cv2 = (
arr.dtype.name
in ["uint32", "uint64", "int64", "float16", "float128", "bool"]
)
# OpenCV turns the channel axis for arrays with 0 channels to 512
# TODO add direct test for this. indirectly tested via Pad
bad_shape_cv2 = (arr.ndim == 3 and arr.shape[-1] == 0)
if not bad_datatype_cv2 and not bad_mode_cv2 and not bad_shape_cv2:
# convert cval to expected type, as otherwise we get TypeError
# for np inputs
kind = arr.dtype.kind
if is_multi_cval:
cval = [float(cval_c) if kind == "f" else int(cval_c)
for cval_c in cval]
else:
cval = float(cval) if kind == "f" else int(cval)
if arr.ndim == 2 or arr.shape[2] <= 4:
# without this, only the first channel is padded with the cval,
# all following channels with 0
if arr.ndim == 3 and not is_multi_cval:
cval = tuple([cval] * arr.shape[2])
arr_pad = cv2.copyMakeBorder(
_normalize_cv2_input_arr_(arr),
top=top, bottom=bottom, left=left, right=right,
borderType=mapping_mode_np_to_cv2[mode], value=cval)
if arr.ndim == 3 and arr_pad.ndim == 2:
arr_pad = arr_pad[..., np.newaxis]
else:
result = []
channel_start_idx = 0
cval = cval if is_multi_cval else tuple([cval] * arr.shape[2])
while channel_start_idx < arr.shape[2]:
arr_c = arr[..., channel_start_idx:channel_start_idx+4]
cval_c = cval[channel_start_idx:channel_start_idx+4]
arr_pad_c = cv2.copyMakeBorder(
_normalize_cv2_input_arr_(arr_c),
top=top, bottom=bottom, left=left, right=right,
borderType=mapping_mode_np_to_cv2[mode], value=cval_c)
arr_pad_c = np.atleast_3d(arr_pad_c)
result.append(arr_pad_c)
channel_start_idx += 4
arr_pad = np.concatenate(result, axis=2)
else:
# paddings for 2d case
paddings_np = [(top, bottom), (left, right)]
# add paddings for 3d case
if arr.ndim == 3:
paddings_np.append((0, 0))
if mode == "constant":
if arr.ndim > 2 and is_multi_cval:
arr_pad_chans = [
np.pad(arr[..., c], paddings_np[0:2], mode=mode,
constant_values=cval[c])
for c in np.arange(arr.shape[2])]
arr_pad = np.stack(arr_pad_chans, axis=-1)
else:
arr_pad = np.pad(arr, paddings_np, mode=mode,
constant_values=cval)
elif mode == "linear_ramp":
if arr.ndim > 2 and is_multi_cval:
arr_pad_chans = [
np.pad(arr[..., c], paddings_np[0:2], mode=mode,
end_values=cval[c])
for c in np.arange(arr.shape[2])]
arr_pad = np.stack(arr_pad_chans, axis=-1)
else:
arr_pad = np.pad(arr, paddings_np, mode=mode,
end_values=cval)
else:
arr_pad = np.pad(arr, paddings_np, mode=mode)
return arr_pad
return np.copy(arr)
def pad_to_aspect_ratio(arr, aspect_ratio, mode="constant", cval=0,
return_pad_amounts=False):
"""Pad an image array on its sides so that it matches a target aspect ratio.
See :func:`~imgaug.imgaug.compute_paddings_for_aspect_ratio` for an
explanation of how the required padding amounts are distributed per
image axis.
Supported dtypes
----------------
See :func:`~imgaug.augmenters.size.pad`.
Parameters
----------
arr : (H,W) ndarray or (H,W,C) ndarray
Image-like array to pad.
aspect_ratio : float
Target aspect ratio, given as width/height. E.g. ``2.0`` denotes the
image having twice as much width as height.
mode : str, optional
Padding mode to use. See :func:`~imgaug.imgaug.pad` for details.
cval : number, optional
Value to use for padding if `mode` is ``constant``.
See :func:`numpy.pad` for details.
return_pad_amounts : bool, optional
If ``False``, then only the padded image will be returned. If
``True``, a ``tuple`` with two entries will be returned, where the
first entry is the padded image and the second entry are the amounts
by which each image side was padded. These amounts are again a
``tuple`` of the form ``(top, right, bottom, left)``, with each value
being an ``int``.
Returns
-------
(H',W') ndarray or (H',W',C) ndarray
Padded image as ``(H',W')`` or ``(H',W',C)`` ndarray, fulfilling the
given `aspect_ratio`.
tuple of int
Amounts by which the image was padded on each side, given as a
``tuple`` ``(top, right, bottom, left)``.
This ``tuple`` is only returned if `return_pad_amounts` was set to
``True``.
"""
pad_top, pad_right, pad_bottom, pad_left = \
compute_paddings_to_reach_aspect_ratio(arr, aspect_ratio)
arr_padded = pad(
arr,
top=pad_top,
right=pad_right,
bottom=pad_bottom,
left=pad_left,
mode=mode,
cval=cval
)
if return_pad_amounts:
return arr_padded, (pad_top, pad_right, pad_bottom, pad_left)
return arr_padded
def pad_to_multiples_of(arr, height_multiple, width_multiple, mode="constant",
cval=0, return_pad_amounts=False):
"""Pad an image array until its side lengths are multiples of given values.
See :func:`~imgaug.imgaug.compute_paddings_for_aspect_ratio` for an
explanation of how the required padding amounts are distributed per
image axis.
Supported dtypes
----------------
See :func:`~imgaug.augmenters.size.pad`.
Parameters
----------
arr : (H,W) ndarray or (H,W,C) ndarray
Image-like array to pad.
height_multiple : None or int
The desired multiple of the height. The computed padding amount will
reflect a padding that increases the y axis size until it is a multiple
of this value.
width_multiple : None or int
The desired multiple of the width. The computed padding amount will
reflect a padding that increases the x axis size until it is a multiple
of this value.
mode : str, optional
Padding mode to use. See :func:`~imgaug.imgaug.pad` for details.
cval : number, optional
Value to use for padding if `mode` is ``constant``.
See :func:`numpy.pad` for details.
return_pad_amounts : bool, optional
If ``False``, then only the padded image will be returned. If
``True``, a ``tuple`` with two entries will be returned, where the
first entry is the padded image and the second entry are the amounts
by which each image side was padded. These amounts are again a
``tuple`` of the form ``(top, right, bottom, left)``, with each value
being an integer.
Returns
-------
(H',W') ndarray or (H',W',C) ndarray
Padded image as ``(H',W')`` or ``(H',W',C)`` ndarray.
tuple of int
Amounts by which the image was padded on each side, given as a
``tuple`` ``(top, right, bottom, left)``.
This ``tuple`` is only returned if `return_pad_amounts` was set to
``True``.
"""
pad_top, pad_right, pad_bottom, pad_left = \
compute_paddings_to_reach_multiples_of(
arr, height_multiple, width_multiple)
arr_padded = pad(
arr,
top=pad_top,
right=pad_right,
bottom=pad_bottom,
left=pad_left,
mode=mode,
cval=cval
)
if return_pad_amounts:
return arr_padded, (pad_top, pad_right, pad_bottom, pad_left)
return arr_padded
def compute_paddings_to_reach_aspect_ratio(arr, aspect_ratio):
"""Compute pad amounts required to fulfill an aspect ratio.
"Pad amounts" here denotes the number of pixels that have to be added to
each side to fulfill the desired constraint.
The aspect ratio is given as ``ratio = width / height``.
Depending on which dimension is smaller (height or width), only the
corresponding sides (top/bottom or left/right) will be padded.
The axis-wise padding amounts are always distributed equally over the
sides of the respective axis (i.e. left and right, top and bottom). For
odd pixel amounts, one pixel will be left over after the equal
distribution and could be added to either side of the axis. This function
will always add such a left over pixel to the bottom (y-axis) or
right (x-axis) side.
Parameters
----------
arr : (H,W) ndarray or (H,W,C) ndarray or tuple of int
Image-like array or shape tuple for which to compute pad amounts.
aspect_ratio : float
Target aspect ratio, given as width/height. E.g. ``2.0`` denotes the
image having twice as much width as height.
Returns
-------
tuple of int
Required padding amounts to reach the target aspect ratio, given as a
``tuple`` of the form ``(top, right, bottom, left)``.
"""
_assert_two_or_three_dims(arr)
assert aspect_ratio > 0, (
"Expected to get an aspect ratio >0, got %.4f." % (aspect_ratio,))
pad_top = 0
pad_right = 0
pad_bottom = 0
pad_left = 0
shape = arr.shape if hasattr(arr, "shape") else arr
height, width = shape[0:2]
if height == 0:
height = 1
pad_bottom += 1
if width == 0:
width = 1
pad_right += 1
aspect_ratio_current = width / height
if aspect_ratio_current < aspect_ratio:
# image is more vertical than desired, width needs to be increased
diff = (aspect_ratio * height) - width
pad_right += int(np.ceil(diff / 2))
pad_left += int(np.floor(diff / 2))
elif aspect_ratio_current > aspect_ratio:
# image is more horizontal than desired, height needs to be increased
diff = ((1/aspect_ratio) * width) - height
pad_top += int(np.floor(diff / 2))
pad_bottom += int(np.ceil(diff / 2))
return pad_top, pad_right, pad_bottom, pad_left
def compute_croppings_to_reach_aspect_ratio(arr, aspect_ratio):
"""Compute crop amounts required to fulfill an aspect ratio.
"Crop amounts" here denotes the number of pixels that have to be removed
from each side to fulfill the desired constraint.
The aspect ratio is given as ``ratio = width / height``.
Depending on which dimension is smaller (height or width), only the
corresponding sides (top/bottom or left/right) will be cropped.
The axis-wise padding amounts are always distributed equally over the
sides of the respective axis (i.e. left and right, top and bottom). For
odd pixel amounts, one pixel will be left over after the equal
distribution and could be added to either side of the axis. This function
will always add such a left over pixel to the bottom (y-axis) or
right (x-axis) side.
If an aspect ratio cannot be reached exactly, this function will return
rather one pixel too few than one pixel too many.
Parameters
----------
arr : (H,W) ndarray or (H,W,C) ndarray or tuple of int
Image-like array or shape tuple for which to compute crop amounts.
aspect_ratio : float
Target aspect ratio, given as width/height. E.g. ``2.0`` denotes the
image having twice as much width as height.
Returns
-------
tuple of int
Required cropping amounts to reach the target aspect ratio, given as a
``tuple`` of the form ``(top, right, bottom, left)``.
"""
_assert_two_or_three_dims(arr)
assert aspect_ratio > 0, (
"Expected to get an aspect ratio >0, got %.4f." % (aspect_ratio,))
shape = arr.shape if hasattr(arr, "shape") else arr
assert shape[0] > 0, (
"Expected to get an array with height >0, got shape %s." % (shape,))
height, width = shape[0:2]
aspect_ratio_current = width / height
top = 0
right = 0
bottom = 0
left = 0
if aspect_ratio_current < aspect_ratio:
# image is more vertical than desired, height needs to be reduced
# c = H - W/r
crop_amount = height - (width / aspect_ratio)
crop_amount = min(crop_amount, height - 1)
top = int(np.floor(crop_amount / 2))
bottom = int(np.ceil(crop_amount / 2))
elif aspect_ratio_current > aspect_ratio:
# image is more horizontal than desired, width needs to be reduced
# c = W - Hr
crop_amount = width - height * aspect_ratio
crop_amount = min(crop_amount, width - 1)
left = int(np.floor(crop_amount / 2))
right = int(np.ceil(crop_amount / 2))
return top, right, bottom, left
def compute_paddings_to_reach_multiples_of(arr, height_multiple,
width_multiple):
"""Compute pad amounts until img height/width are multiples of given values.
See :func:`~imgaug.imgaug.compute_paddings_for_aspect_ratio` for an
explanation of how the required padding amounts are distributed per
image axis.
Parameters
----------
arr : (H,W) ndarray or (H,W,C) ndarray or tuple of int
Image-like array or shape tuple for which to compute pad amounts.
height_multiple : None or int
The desired multiple of the height. The computed padding amount will
reflect a padding that increases the y axis size until it is a multiple
of this value.
width_multiple : None or int
The desired multiple of the width. The computed padding amount will
reflect a padding that increases the x axis size until it is a multiple
of this value.
Returns
-------
tuple of int
Required padding amounts to reach multiples of the provided values,
given as a ``tuple`` of the form ``(top, right, bottom, left)``.
"""
def _compute_axis_value(axis_size, multiple):
if multiple is None:
return 0, 0
if axis_size == 0:
to_pad = multiple
elif axis_size % multiple == 0:
to_pad = 0
else:
to_pad = multiple - (axis_size % multiple)
return int(np.floor(to_pad/2)), int(np.ceil(to_pad/2))
_assert_two_or_three_dims(arr)
if height_multiple is not None:
assert height_multiple > 0, (
"Can only pad to multiples of 1 or larger, got %d." % (
height_multiple,))
if width_multiple is not None:
assert width_multiple > 0, (
"Can only pad to multiples of 1 or larger, got %d." % (
width_multiple,))
shape = arr.shape if hasattr(arr, "shape") else arr
height, width = shape[0:2]
top, bottom = _compute_axis_value(height, height_multiple)
left, right = _compute_axis_value(width, width_multiple)
return top, right, bottom, left
def compute_croppings_to_reach_multiples_of(arr, height_multiple,
width_multiple):
"""Compute croppings to reach multiples of given heights/widths.
See :func:`~imgaug.imgaug.compute_paddings_for_aspect_ratio` for an
explanation of how the required cropping amounts are distributed per
image axis.
Parameters
----------
arr : (H,W) ndarray or (H,W,C) ndarray or tuple of int
Image-like array or shape tuple for which to compute crop amounts.
height_multiple : None or int
The desired multiple of the height. The computed croppings will
reflect a crop operation that decreases the y axis size until it is
a multiple of this value.
width_multiple : None or int
The desired multiple of the width. The computed croppings amount will
reflect a crop operation that decreases the x axis size until it is
a multiple of this value.
Returns
-------
tuple of int
Required cropping amounts to reach multiples of the provided values,
given as a ``tuple`` of the form ``(top, right, bottom, left)``.
"""
def _compute_axis_value(axis_size, multiple):
if multiple is None:
return 0, 0
if axis_size == 0:
to_crop = 0
elif axis_size % multiple == 0:
to_crop = 0
else:
to_crop = axis_size % multiple
return int(np.floor(to_crop/2)), int(np.ceil(to_crop/2))
_assert_two_or_three_dims(arr)
if height_multiple is not None:
assert height_multiple > 0, (
"Can only crop to multiples of 1 or larger, got %d." % (
height_multiple,))
if width_multiple is not None:
assert width_multiple > 0, (
"Can only crop to multiples of 1 or larger, got %d." % (
width_multiple,))
shape = arr.shape if hasattr(arr, "shape") else arr
height, width = shape[0:2]
top, bottom = _compute_axis_value(height, height_multiple)
left, right = _compute_axis_value(width, width_multiple)
return top, right, bottom, left
def compute_paddings_to_reach_powers_of(arr, height_base, width_base,
allow_zero_exponent=False):
"""Compute paddings to reach powers of given base values.
For given axis size ``S``, padded size ``S'`` (``S' >= S``) and base ``B``
this function computes paddings that fulfill ``S' = B^E``, where ``E``
is any exponent from the discrete interval ``[0 .. inf)``.
See :func:`~imgaug.imgaug.compute_paddings_for_aspect_ratio` for an
explanation of how the required padding amounts are distributed per
image axis.
Parameters
----------
arr : (H,W) ndarray or (H,W,C) ndarray or tuple of int
Image-like array or shape tuple for which to compute pad amounts.
height_base : None or int
The desired base of the height.
width_base : None or int
The desired base of the width.
allow_zero_exponent : bool, optional
Whether ``E=0`` in ``S'=B^E`` is a valid value. If ``True``, axes
with size ``0`` or ``1`` will be padded up to size ``B^0=1`` and
axes with size ``1 < S <= B`` will be padded up to ``B^1=B``.
If ``False``, the minimum output axis size is always at least ``B``.
Returns
-------
tuple of int
Required padding amounts to fulfill ``S' = B^E`` given as a
``tuple`` of the form ``(top, right, bottom, left)``.
"""
def _compute_axis_value(axis_size, base):
if base is None:
return 0, 0
if axis_size == 0:
to_pad = 1 if allow_zero_exponent else base
elif axis_size <= base:
to_pad = base - axis_size
else:
# log_{base}(axis_size) in numpy
exponent = np.log(axis_size) / np.log(base)
to_pad = (base ** int(np.ceil(exponent))) - axis_size
return int(np.floor(to_pad/2)), int(np.ceil(to_pad/2))
_assert_two_or_three_dims(arr)
if height_base is not None:
assert height_base > 1, (
"Can only pad to base larger than 1, got %d." % (height_base,))
if width_base is not None:
assert width_base > 1, (
"Can only pad to base larger than 1, got %d." % (width_base,))
shape = arr.shape if hasattr(arr, "shape") else arr
height, width = shape[0:2]
top, bottom = _compute_axis_value(height, height_base)
left, right = _compute_axis_value(width, width_base)
return top, right, bottom, left
def compute_croppings_to_reach_powers_of(arr, height_base, width_base,
allow_zero_exponent=False):
"""Compute croppings to reach powers of given base values.
For given axis size ``S``, cropped size ``S'`` (``S' <= S``) and base ``B``
this function computes croppings that fulfill ``S' = B^E``, where ``E``
is any exponent from the discrete interval ``[0 .. inf)``.
See :func:`~imgaug.imgaug.compute_paddings_for_aspect_ratio` for an
explanation of how the required cropping amounts are distributed per
image axis.
.. note::
For axes where ``S == 0``, this function alwayws returns zeros as
croppings.
For axes where ``1 <= S < B`` see parameter `allow_zero_exponent`.
Parameters
----------
arr : (H,W) ndarray or (H,W,C) ndarray or tuple of int
Image-like array or shape tuple for which to compute crop amounts.
height_base : None or int
The desired base of the height.
width_base : None or int
The desired base of the width.
allow_zero_exponent : bool
Whether ``E=0`` in ``S'=B^E`` is a valid value. If ``True``, axes
with size ``1 <= S < B`` will be cropped to size ``B^0=1``.
If ``False``, axes with sizes ``S < B`` will not be changed.
Returns
-------
tuple of int
Required cropping amounts to fulfill ``S' = B^E`` given as a
``tuple`` of the form ``(top, right, bottom, left)``.
"""
def _compute_axis_value(axis_size, base):
if base is None:
return 0, 0
if axis_size == 0:
to_crop = 0
elif axis_size < base:
# crop down to B^0 = 1
to_crop = axis_size - 1 if allow_zero_exponent else 0
else:
# log_{base}(axis_size) in numpy
exponent = np.log(axis_size) / np.log(base)
to_crop = axis_size - (base ** int(exponent))
return int(np.floor(to_crop/2)), int(np.ceil(to_crop/2))
_assert_two_or_three_dims(arr)
if height_base is not None:
assert height_base > 1, (
"Can only crop to base larger than 1, got %d." % (height_base,))
if width_base is not None:
assert width_base > 1, (
"Can only crop to base larger than 1, got %d." % (width_base,))
shape = arr.shape if hasattr(arr, "shape") else arr
height, width = shape[0:2]
top, bottom = _compute_axis_value(height, height_base)
left, right = _compute_axis_value(width, width_base)
return top, right, bottom, left
@ia.deprecated(alt_func="Resize",
comment="Resize has the exactly same interface as Scale.")
def Scale(*args, **kwargs):
"""Augmenter that resizes images to specified heights and widths."""
# pylint: disable=invalid-name
return Resize(*args, **kwargs)
class Resize(meta.Augmenter):
"""Augmenter that resizes images to specified heights and widths.
Supported dtypes
----------------
See :func:`~imgaug.imgaug.imresize_many_images`.
Parameters
----------
size : 'keep' or int or float or tuple of int or tuple of float or list of int or list of float or imgaug.parameters.StochasticParameter or dict
The new size of the images.
* If this has the string value ``keep``, the original height and
width values will be kept (image is not resized).
* If this is an ``int``, this value will always be used as the new
height and width of the images.
* If this is a ``float`` ``v``, then per image the image's height
``H`` and width ``W`` will be changed to ``H*v`` and ``W*v``.
* If this is a ``tuple``, it is expected to have two entries
``(a, b)``. If at least one of these are ``float`` s, a value
will be sampled from range ``[a, b]`` and used as the ``float``
value to resize the image (see above). If both are ``int`` s, a
value will be sampled from the discrete range ``[a..b]`` and
used as the integer value to resize the image (see above).
* If this is a ``list``, a random value from the ``list`` will be
picked to resize the image. All values in the ``list`` must be
``int`` s or ``float`` s (no mixture is possible).
* If this is a ``StochasticParameter``, then this parameter will
first be queried once per image. The resulting value will be used
for both height and width.
* If this is a ``dict``, it may contain the keys ``height`` and
``width`` or the keys ``shorter-side`` and ``longer-side``. Each
key may have the same datatypes as above and describes the
scaling on x and y-axis or the shorter and longer axis,
respectively. Both axis are sampled independently. Additionally,
one of the keys may have the value ``keep-aspect-ratio``, which
means that the respective side of the image will be resized so
that the original aspect ratio is kept. This is useful when only
resizing one image size by a pixel value (e.g. resize images to
a height of ``64`` pixels and resize the width so that the
overall aspect ratio is maintained).
interpolation : imgaug.ALL or int or str or list of int or list of str or imgaug.parameters.StochasticParameter, optional
Interpolation to use.
* If ``imgaug.ALL``, then a random interpolation from ``nearest``,
``linear``, ``area`` or ``cubic`` will be picked (per image).
* If ``int``, then this interpolation will always be used.
Expected to be any of the following:
``cv2.INTER_NEAREST``, ``cv2.INTER_LINEAR``, ``cv2.INTER_AREA``,
``cv2.INTER_CUBIC``
* If string, then this interpolation will always be used.
Expected to be any of the following:
``nearest``, ``linear``, ``area``, ``cubic``
* If ``list`` of ``int`` / ``str``, then a random one of the values
will be picked per image as the interpolation.
* If a ``StochasticParameter``, then this parameter will be
queried per image and is expected to return an ``int`` or
``str``.
seed : None or int or imgaug.random.RNG or numpy.random.Generator or numpy.random.BitGenerator or numpy.random.SeedSequence or numpy.random.RandomState, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
name : None or str, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
**old_kwargs
Outdated parameters. Avoid using these.
Examples
--------
>>> import imgaug.augmenters as iaa
>>> aug = iaa.Resize(32)
Resize all images to ``32x32`` pixels.
>>> aug = iaa.Resize(0.5)
Resize all images to ``50`` percent of their original size.
>>> aug = iaa.Resize((16, 22))
Resize all images to a random height and width within the discrete
interval ``[16..22]`` (uniformly sampled per image).
>>> aug = iaa.Resize((0.5, 0.75))
Resize all any input image so that its height (``H``) and width (``W``)
become ``H*v`` and ``W*v``, where ``v`` is uniformly sampled from the
interval ``[0.5, 0.75]``.
>>> aug = iaa.Resize([16, 32, 64])
Resize all images either to ``16x16``, ``32x32`` or ``64x64`` pixels.
>>> aug = iaa.Resize({"height": 32})
Resize all images to a height of ``32`` pixels and keeps the original
width.
>>> aug = iaa.Resize({"height": 32, "width": 48})
Resize all images to a height of ``32`` pixels and a width of ``48``.
>>> aug = iaa.Resize({"height": 32, "width": "keep-aspect-ratio"})
Resize all images to a height of ``32`` pixels and resizes the
x-axis (width) so that the aspect ratio is maintained.
>>> aug = iaa.Resize(
>>> {"shorter-side": 224, "longer-side": "keep-aspect-ratio"})
Resize all images to a height/width of ``224`` pixels, depending on which
axis is shorter and resize the other axis so that the aspect ratio is
maintained.
>>> aug = iaa.Resize({"height": (0.5, 0.75), "width": [16, 32, 64]})
Resize all images to a height of ``H*v``, where ``H`` is the original
height and ``v`` is a random value sampled from the interval
``[0.5, 0.75]``. The width/x-axis of each image is resized to either
``16`` or ``32`` or ``64`` pixels.
>>> aug = iaa.Resize(32, interpolation=["linear", "cubic"])
Resize all images to ``32x32`` pixels. Randomly use either ``linear``
or ``cubic`` interpolation.
"""
def __init__(self, size, interpolation="cubic",
seed=None, name=None, **old_kwargs):
super(Resize, self).__init__(
seed=seed, name=name, **old_kwargs)
self.size, self.size_order = self._handle_size_arg(size, False)
self.interpolation = self._handle_interpolation_arg(interpolation)
@classmethod
def _handle_size_arg(cls, size, subcall):
def _dict_to_size_tuple(val1, val2):
kaa = "keep-aspect-ratio"
not_both_kaa = (val1 != kaa or val2 != kaa)
assert not_both_kaa, (
"Expected at least one value to not be \"keep-aspect-ratio\", "
"but got it two times.")
size_tuple = []
for k in [val1, val2]:
if k in ["keep-aspect-ratio", "keep"]:
entry = iap.Deterministic(k)
else:
entry = cls._handle_size_arg(k, True)
size_tuple.append(entry)
return tuple(size_tuple)
def _contains_any_key(dict_, keys):
return any([key in dict_ for key in keys])
# HW = height, width
# SL = shorter, longer
size_order = "HW"
if size == "keep":
result = iap.Deterministic("keep")
elif ia.is_single_number(size):
assert size > 0, "Expected only values > 0, got %s" % (size,)
result = iap.Deterministic(size)
elif not subcall and isinstance(size, dict):
if len(size.keys()) == 0:
result = iap.Deterministic("keep")
elif _contains_any_key(size, ["height", "width"]):
height = size.get("height", "keep")
width = size.get("width", "keep")
result = _dict_to_size_tuple(height, width)
elif _contains_any_key(size, ["shorter-side", "longer-side"]):
shorter = size.get("shorter-side", "keep")
longer = size.get("longer-side", "keep")
result = _dict_to_size_tuple(shorter, longer)
size_order = "SL"
else:
raise ValueError(
"Expected dictionary containing no keys, "
"the keys \"height\" and/or \"width\", "
"or the keys \"shorter-side\" and/or \"longer-side\". "
"Got keys: %s." % (str(size.keys()),))
elif isinstance(size, tuple):
assert len(size) == 2, (
"Expected size tuple to contain exactly 2 values, "
"got %d." % (len(size),))
assert size[0] > 0 and size[1] > 0, (
"Expected size tuple to only contain values >0, "
"got %d and %d." % (size[0], size[1]))
if ia.is_single_float(size[0]) or ia.is_single_float(size[1]):
result = iap.Uniform(size[0], size[1])
else:
result = iap.DiscreteUniform(size[0], size[1])
elif isinstance(size, list):
if len(size) == 0:
result = iap.Deterministic("keep")
else:
all_int = all([ia.is_single_integer(v) for v in size])
all_float = all([ia.is_single_float(v) for v in size])
assert all_int or all_float, (
"Expected to get only integers or floats.")
assert all([v > 0 for v in size]), (
"Expected all values to be >0.")
result = iap.Choice(size)
elif isinstance(size, iap.StochasticParameter):
result = size
else:
raise ValueError(
"Expected number, tuple of two numbers, list of numbers, "
"dictionary of form "
"{'height': number/tuple/list/'keep-aspect-ratio'/'keep', "
"'width': <analogous>}, dictionary of form "
"{'shorter-side': number/tuple/list/'keep-aspect-ratio'/"
"'keep', 'longer-side': <analogous>} "
"or StochasticParameter, got %s." % (type(size),)
)
if subcall:
return result
return result, size_order
@classmethod
def _handle_interpolation_arg(cls, interpolation):
if interpolation == ia.ALL:
interpolation = iap.Choice(
["nearest", "linear", "area", "cubic"])
elif ia.is_single_integer(interpolation):
interpolation = iap.Deterministic(interpolation)
elif ia.is_string(interpolation):
interpolation = iap.Deterministic(interpolation)
elif ia.is_iterable(interpolation):
interpolation = iap.Choice(interpolation)
elif isinstance(interpolation, iap.StochasticParameter):
pass
else:
raise Exception(
"Expected int or string or iterable or StochasticParameter, "
"got %s." % (type(interpolation),))
return interpolation
def _augment_batch_(self, batch, random_state, parents, hooks):
nb_rows = batch.nb_rows
samples = self._draw_samples(nb_rows, random_state)
if batch.images is not None:
batch.images = self._augment_images_by_samples(batch.images,
samples)
if batch.heatmaps is not None:
# TODO this uses the same interpolation as for images for heatmaps
# while other augmenters resort to cubic
batch.heatmaps = self._augment_maps_by_samples(
batch.heatmaps, "arr_0to1", samples)
if batch.segmentation_maps is not None:
batch.segmentation_maps = self._augment_maps_by_samples(
batch.segmentation_maps, "arr",
(samples[0], samples[1], [None] * nb_rows))
for augm_name in ["keypoints", "bounding_boxes", "polygons",
"line_strings"]:
augm_value = getattr(batch, augm_name)
if augm_value is not None:
func = functools.partial(
self._augment_keypoints_by_samples,
samples=samples)
cbaois = self._apply_to_cbaois_as_keypoints(augm_value, func)
setattr(batch, augm_name, cbaois)
return batch
def _augment_images_by_samples(self, images, samples):
input_was_array = False
input_dtype = None
if ia.is_np_array(images):
input_was_array = True
input_dtype = images.dtype
samples_a, samples_b, samples_ip = samples
result = []
for i, image in enumerate(images):
h, w = self._compute_height_width(image.shape, samples_a[i],
samples_b[i], self.size_order)
image_rs = ia.imresize_single_image(image, (h, w),
interpolation=samples_ip[i])
result.append(image_rs)
if input_was_array:
all_same_size = (len({image.shape for image in result}) == 1)
if all_same_size:
result = np.array(result, dtype=input_dtype)
return result
def _augment_maps_by_samples(self, augmentables, arr_attr_name, samples):
result = []
samples_h, samples_w, samples_ip = samples
for i, augmentable in enumerate(augmentables):
arr = getattr(augmentable, arr_attr_name)
arr_shape = arr.shape
img_shape = augmentable.shape
h_img, w_img = self._compute_height_width(
img_shape, samples_h[i], samples_w[i], self.size_order)
h = int(np.round(h_img * (arr_shape[0] / img_shape[0])))
w = int(np.round(w_img * (arr_shape[1] / img_shape[1])))
h = max(h, 1)
w = max(w, 1)
if samples_ip[0] is not None:
# TODO change this for heatmaps to always have cubic or
# automatic interpolation?
augmentable_resize = augmentable.resize(
(h, w), interpolation=samples_ip[i])
else:
augmentable_resize = augmentable.resize((h, w))
augmentable_resize.shape = (h_img, w_img) + img_shape[2:]
result.append(augmentable_resize)
return result
def _augment_keypoints_by_samples(self, kpsois, samples):
result = []
samples_a, samples_b, _samples_ip = samples
for i, kpsoi in enumerate(kpsois):
h, w = self._compute_height_width(
kpsoi.shape, samples_a[i], samples_b[i], self.size_order)
new_shape = (h, w) + kpsoi.shape[2:]
keypoints_on_image_rs = kpsoi.on_(new_shape)
result.append(keypoints_on_image_rs)
return result
def _draw_samples(self, nb_images, random_state):
rngs = random_state.duplicate(3)
if isinstance(self.size, tuple):
samples_h = self.size[0].draw_samples(nb_images,
random_state=rngs[0])
samples_w = self.size[1].draw_samples(nb_images,
random_state=rngs[1])
else:
samples_h = self.size.draw_samples(nb_images, random_state=rngs[0])
samples_w = samples_h
samples_ip = self.interpolation.draw_samples(nb_images,
random_state=rngs[2])
return samples_h, samples_w, samples_ip
@classmethod
def _compute_height_width(cls, image_shape, sample_a, sample_b, size_order):
imh, imw = image_shape[0:2]
if size_order == 'SL':
# size order: short, long
if imh < imw:
h, w = sample_a, sample_b
else:
w, h = sample_a, sample_b
else:
# size order: height, width
h, w = sample_a, sample_b
if ia.is_single_float(h):
assert h > 0, "Expected 'h' to be >0, got %.4f" % (h,)
h = int(np.round(imh * h))
h = h if h > 0 else 1
elif h == "keep":
h = imh
if ia.is_single_float(w):
assert w > 0, "Expected 'w' to be >0, got %.4f" % (w,)
w = int(np.round(imw * w))
w = w if w > 0 else 1
elif w == "keep":
w = imw
# at least the checks for keep-aspect-ratio must come after
# the float checks, as they are dependent on the results
# this is also why these are not written as elifs
if h == "keep-aspect-ratio":
h_per_w_orig = imh / imw
h = int(np.round(w * h_per_w_orig))
if w == "keep-aspect-ratio":
w_per_h_orig = imw / imh
w = int(np.round(h * w_per_h_orig))
return h, w
def get_parameters(self):
"""See :func:`~imgaug.augmenters.meta.Augmenter.get_parameters`."""
return [self.size, self.interpolation, self.size_order]
class _CropAndPadSamplingResult(object):
def __init__(self, crop_top, crop_right, crop_bottom, crop_left,
pad_top, pad_right, pad_bottom, pad_left, pad_mode, pad_cval):
self.crop_top = crop_top
self.crop_right = crop_right
self.crop_bottom = crop_bottom
self.crop_left = crop_left
self.pad_top = pad_top
self.pad_right = pad_right
self.pad_bottom = pad_bottom
self.pad_left = pad_left
self.pad_mode = pad_mode
self.pad_cval = pad_cval
@property
def croppings(self):
"""Get absolute pixel amounts of croppings as a TRBL tuple."""
return self.crop_top, self.crop_right, self.crop_bottom, self.crop_left
@property
def paddings(self):
"""Get absolute pixel amounts of paddings as a TRBL tuple."""
return self.pad_top, self.pad_right, self.pad_bottom, self.pad_left
class CropAndPad(meta.Augmenter):
"""Crop/pad images by pixel amounts or fractions of image sizes.
Cropping removes pixels at the sides (i.e. extracts a subimage from
a given full image). Padding adds pixels to the sides (e.g. black pixels).
This augmenter will never crop images below a height or width of ``1``.
.. note::
This augmenter automatically resizes images back to their original size
after it has augmented them. To deactivate this, add the
parameter ``keep_size=False``.
Supported dtypes
----------------
if (keep_size=False):
* ``uint8``: yes; fully tested
* ``uint16``: yes; tested
* ``uint32``: yes; tested
* ``uint64``: yes; tested
* ``int8``: yes; tested
* ``int16``: yes; tested
* ``int32``: yes; tested
* ``int64``: yes; tested
* ``float16``: yes; tested
* ``float32``: yes; tested
* ``float64``: yes; tested
* ``float128``: yes; tested
* ``bool``: yes; tested
if (keep_size=True):
minimum of (
``imgaug.augmenters.size.CropAndPad(keep_size=False)``,
:func:`~imgaug.imgaug.imresize_many_images`
)
Parameters
----------
px : None or int or imgaug.parameters.StochasticParameter or tuple, optional
The number of pixels to crop (negative values) or pad (positive values)
on each side of the image. Either this or the parameter `percent` may
be set, not both at the same time.
* If ``None``, then pixel-based cropping/padding will not be used.
* If ``int``, then that exact number of pixels will always be
cropped/padded.
* If ``StochasticParameter``, then that parameter will be used for
each image. Four samples will be drawn per image (top, right,
bottom, left), unless `sample_independently` is set to ``False``,
as then only one value will be sampled per image and used for
all sides.
* If a ``tuple`` of two ``int`` s with values ``a`` and ``b``,
then each side will be cropped/padded by a random amount sampled
uniformly per image and side from the inteval ``[a, b]``. If
however `sample_independently` is set to ``False``, only one
value will be sampled per image and used for all sides.
* If a ``tuple`` of four entries, then the entries represent top,
right, bottom, left. Each entry may be a single ``int`` (always
crop/pad by exactly that value), a ``tuple`` of two ``int`` s
``a`` and ``b`` (crop/pad by an amount within ``[a, b]``), a
``list`` of ``int`` s (crop/pad by a random value that is
contained in the ``list``) or a ``StochasticParameter`` (sample
the amount to crop/pad from that parameter).
percent : None or number or imgaug.parameters.StochasticParameter or tuple, optional
The number of pixels to crop (negative values) or pad (positive values)
on each side of the image given as a *fraction* of the image
height/width. E.g. if this is set to ``-0.1``, the augmenter will
always crop away ``10%`` of the image's height at both the top and the
bottom (both ``10%`` each), as well as ``10%`` of the width at the
right and left.
Expected value range is ``(-1.0, inf)``.
Either this or the parameter `px` may be set, not both
at the same time.
* If ``None``, then fraction-based cropping/padding will not be
used.
* If ``number``, then that fraction will always be cropped/padded.
* If ``StochasticParameter``, then that parameter will be used for
each image. Four samples will be drawn per image (top, right,
bottom, left). If however `sample_independently` is set to
``False``, only one value will be sampled per image and used for
all sides.
* If a ``tuple`` of two ``float`` s with values ``a`` and ``b``,
then each side will be cropped/padded by a random fraction
sampled uniformly per image and side from the interval
``[a, b]``. If however `sample_independently` is set to
``False``, only one value will be sampled per image and used for
all sides.
* If a ``tuple`` of four entries, then the entries represent top,
right, bottom, left. Each entry may be a single ``float``
(always crop/pad by exactly that percent value), a ``tuple`` of
two ``float`` s ``a`` and ``b`` (crop/pad by a fraction from
``[a, b]``), a ``list`` of ``float`` s (crop/pad by a random
value that is contained in the list) or a ``StochasticParameter``
(sample the percentage to crop/pad from that parameter).
pad_mode : imgaug.ALL or str or list of str or imgaug.parameters.StochasticParameter, optional
Padding mode to use. The available modes match the numpy padding modes,
i.e. ``constant``, ``edge``, ``linear_ramp``, ``maximum``, ``median``,
``minimum``, ``reflect``, ``symmetric``, ``wrap``. The modes
``constant`` and ``linear_ramp`` use extra values, which are provided
by ``pad_cval`` when necessary. See :func:`~imgaug.imgaug.pad` for
more details.
* If ``imgaug.ALL``, then a random mode from all available modes
will be sampled per image.
* If a ``str``, it will be used as the pad mode for all images.
* If a ``list`` of ``str``, a random one of these will be sampled
per image and used as the mode.
* If ``StochasticParameter``, a random mode will be sampled from
this parameter per image.
pad_cval : number or tuple of number list of number or imgaug.parameters.StochasticParameter, optional
The constant value to use if the pad mode is ``constant`` or the end
value to use if the mode is ``linear_ramp``.
See :func:`~imgaug.imgaug.pad` for more details.
* If ``number``, then that value will be used.
* If a ``tuple`` of two ``number`` s and at least one of them is
a ``float``, then a random number will be uniformly sampled per
image from the continuous interval ``[a, b]`` and used as the
value. If both ``number`` s are ``int`` s, the interval is
discrete.
* If a ``list`` of ``number``, then a random value will be chosen
from the elements of the ``list`` and used as the value.
* If ``StochasticParameter``, a random value will be sampled from
that parameter per image.
keep_size : bool, optional
After cropping and padding, the result image will usually have a
different height/width compared to the original input image. If this
parameter is set to ``True``, then the cropped/padded image will be
resized to the input image's size, i.e. the augmenter's output shape
is always identical to the input shape.
sample_independently : bool, optional
If ``False`` *and* the values for `px`/`percent` result in exactly
*one* probability distribution for all image sides, only one single
value will be sampled from that probability distribution and used for
all sides. I.e. the crop/pad amount then is the same for all sides.
If ``True``, four values will be sampled independently, one per side.
seed : None or int or imgaug.random.RNG or numpy.random.Generator or numpy.random.BitGenerator or numpy.random.SeedSequence or numpy.random.RandomState, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
name : None or str, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
**old_kwargs
Outdated parameters. Avoid using these.
Examples
--------
>>> import imgaug.augmenters as iaa
>>> aug = iaa.CropAndPad(px=(-10, 0))
Crop each side by a random pixel value sampled uniformly per image and
side from the discrete interval ``[-10..0]``.
>>> aug = iaa.CropAndPad(px=(0, 10))
Pad each side by a random pixel value sampled uniformly per image and
side from the discrete interval ``[0..10]``. The padding happens by
zero-padding, i.e. it adds black pixels (default setting).
>>> aug = iaa.CropAndPad(px=(0, 10), pad_mode="edge")
Pad each side by a random pixel value sampled uniformly per image and
side from the discrete interval ``[0..10]``. The padding uses the
``edge`` mode from numpy's pad function, i.e. the pixel colors around
the image sides are repeated.
>>> aug = iaa.CropAndPad(px=(0, 10), pad_mode=["constant", "edge"])
Similar to the previous example, but uses zero-padding (``constant``) for
half of the images and ``edge`` padding for the other half.
>>> aug = iaa.CropAndPad(px=(0, 10), pad_mode=ia.ALL, pad_cval=(0, 255))
Similar to the previous example, but uses any available padding mode.
In case the padding mode ends up being ``constant`` or ``linear_ramp``,
and random intensity is uniformly sampled (once per image) from the
discrete interval ``[0..255]`` and used as the intensity of the new
pixels.
>>> aug = iaa.CropAndPad(px=(0, 10), sample_independently=False)
Pad each side by a random pixel value sampled uniformly once per image
from the discrete interval ``[0..10]``. Each sampled value is used
for *all* sides of the corresponding image.
>>> aug = iaa.CropAndPad(px=(0, 10), keep_size=False)
Pad each side by a random pixel value sampled uniformly per image and
side from the discrete interval ``[0..10]``. Afterwards, do **not**
resize the padded image back to the input image's size. This will increase
the image's height and width by a maximum of ``20`` pixels.
>>> aug = iaa.CropAndPad(px=((0, 10), (0, 5), (0, 10), (0, 5)))
Pad the top and bottom by a random pixel value sampled uniformly from the
discrete interval ``[0..10]``. Pad the left and right analogously by
a random value sampled from ``[0..5]``. Each value is always sampled
independently.
>>> aug = iaa.CropAndPad(percent=(0, 0.1))
Pad each side by a random fraction sampled uniformly from the continuous
interval ``[0.0, 0.10]``. The fraction is sampled once per image and
side. E.g. a sampled fraction of ``0.1`` for the top side would pad by
``0.1*H``, where ``H`` is the height of the input image.
>>> aug = iaa.CropAndPad(
>>> percent=([0.05, 0.1], [0.05, 0.1], [0.05, 0.1], [0.05, 0.1]))
Pads each side by either ``5%`` or ``10%``. The values are sampled
once per side and image.
>>> aug = iaa.CropAndPad(px=(-10, 10))
Sample uniformly per image and side a value ``v`` from the discrete range
``[-10..10]``. Then either crop (negative sample) or pad (positive sample)
the side by ``v`` pixels.
"""
def __init__(self, px=None, percent=None, pad_mode="constant", pad_cval=0,
keep_size=True, sample_independently=True,
seed=None, name=None, **old_kwargs):
# pylint: disable=invalid-name
super(CropAndPad, self).__init__(
seed=seed, name=name, **old_kwargs)
self.mode, self.all_sides, self.top, self.right, self.bottom, \
self.left = self._handle_px_and_percent_args(px, percent)
self.pad_mode = _handle_pad_mode_param(pad_mode)
# TODO enable ALL here, like in e.g. Affine
self.pad_cval = iap.handle_discrete_param(
pad_cval, "pad_cval", value_range=None, tuple_to_uniform=True,
list_to_choice=True, allow_floats=True)
self.keep_size = keep_size
self.sample_independently = sample_independently
# set these to None to use the same values as sampled for the
# images (not tested)
self._pad_mode_heatmaps = "constant"
self._pad_mode_segmentation_maps = "constant"
self._pad_cval_heatmaps = 0.0
self._pad_cval_segmentation_maps = 0
@classmethod
def _handle_px_and_percent_args(cls, px, percent):
# pylint: disable=invalid-name
all_sides = None
top, right, bottom, left = None, None, None, None
if px is None and percent is None:
mode = "noop"
elif px is not None and percent is not None:
raise Exception("Can only pad by pixels or percent, not both.")
elif px is not None:
mode = "px"
all_sides, top, right, bottom, left = cls._handle_px_arg(px)
else: # = elif percent is not None:
mode = "percent"
all_sides, top, right, bottom, left = cls._handle_percent_arg(
percent)
return mode, all_sides, top, right, bottom, left
@classmethod
def _handle_px_arg(cls, px):
# pylint: disable=invalid-name
all_sides = None
top, right, bottom, left = None, None, None, None
if ia.is_single_integer(px):
all_sides = iap.Deterministic(px)
elif isinstance(px, tuple):
assert len(px) in [2, 4], (
"Expected 'px' given as a tuple to contain 2 or 4 "
"entries, got %d." % (len(px),))
def handle_param(p):
if ia.is_single_integer(p):
return iap.Deterministic(p)
if isinstance(p, tuple):
assert len(p) == 2, (
"Expected tuple of 2 values, got %d." % (len(p)))
only_ints = (
ia.is_single_integer(p[0])
and ia.is_single_integer(p[1]))
assert only_ints, (
"Expected tuple of integers, got %s and %s." % (
type(p[0]), type(p[1])))
return iap.DiscreteUniform(p[0], p[1])
if isinstance(p, list):
assert len(p) > 0, (
"Expected non-empty list, but got empty one.")
assert all([ia.is_single_integer(val) for val in p]), (
"Expected list of ints, got types %s." % (
", ".join([str(type(v)) for v in p])))
return iap.Choice(p)
if isinstance(p, iap.StochasticParameter):
return p
raise Exception(
"Expected int, tuple of two ints, list of ints or "
"StochasticParameter, got type %s." % (type(p),))
if len(px) == 2:
all_sides = handle_param(px)
else: # len == 4
top = handle_param(px[0])
right = handle_param(px[1])
bottom = handle_param(px[2])
left = handle_param(px[3])
elif isinstance(px, iap.StochasticParameter):
top = right = bottom = left = px
else:
raise Exception(
"Expected int, tuple of 4 "
"ints/tuples/lists/StochasticParameters or "
"StochasticParameter, got type %s." % (type(px),))
return all_sides, top, right, bottom, left
@classmethod
def _handle_percent_arg(cls, percent):
all_sides = None
top, right, bottom, left = None, None, None, None
if ia.is_single_number(percent):
assert percent > -1.0, (
"Expected 'percent' to be >-1.0, got %.4f." % (percent,))
all_sides = iap.Deterministic(percent)
elif isinstance(percent, tuple):
assert len(percent) in [2, 4], (
"Expected 'percent' given as a tuple to contain 2 or 4 "
"entries, got %d." % (len(percent),))
def handle_param(p):
if ia.is_single_number(p):
return iap.Deterministic(p)
if isinstance(p, tuple):
assert len(p) == 2, (
"Expected tuple of 2 values, got %d." % (len(p),))
only_numbers = (
ia.is_single_number(p[0])
and ia.is_single_number(p[1]))
assert only_numbers, (
"Expected tuple of numbers, got %s and %s." % (
type(p[0]), type(p[1])))
assert p[0] > -1.0 and p[1] > -1.0, (
"Expected tuple of values >-1.0, got %.4f and "
"%.4f." % (p[0], p[1]))
return iap.Uniform(p[0], p[1])
if isinstance(p, list):
assert len(p) > 0, (
"Expected non-empty list, but got empty one.")
assert all([ia.is_single_number(val) for val in p]), (
"Expected list of numbers, got types %s." % (
", ".join([str(type(v)) for v in p])))
assert all([val > -1.0 for val in p]), (
"Expected list of values >-1.0, got values %s." % (
", ".join(["%.4f" % (v,) for v in p])))
return iap.Choice(p)
if isinstance(p, iap.StochasticParameter):
return p
raise Exception(
"Expected int, tuple of two ints, list of ints or "
"StochasticParameter, got type %s." % (type(p),))
if len(percent) == 2:
all_sides = handle_param(percent)
else: # len == 4
top = handle_param(percent[0])
right = handle_param(percent[1])
bottom = handle_param(percent[2])
left = handle_param(percent[3])
elif isinstance(percent, iap.StochasticParameter):
top = right = bottom = left = percent
else:
raise Exception(
"Expected number, tuple of 4 "
"numbers/tuples/lists/StochasticParameters or "
"StochasticParameter, got type %s." % (type(percent),))
return all_sides, top, right, bottom, left
def _augment_batch_(self, batch, random_state, parents, hooks):
shapes = batch.get_rowwise_shapes()
samples = self._draw_samples(random_state, shapes)
if batch.images is not None:
batch.images = self._augment_images_by_samples(batch.images,
samples)
if batch.heatmaps is not None:
batch.heatmaps = self._augment_maps_by_samples(
batch.heatmaps,
self._pad_mode_heatmaps, self._pad_cval_heatmaps,
samples)
if batch.segmentation_maps is not None:
batch.segmentation_maps = self._augment_maps_by_samples(
batch.segmentation_maps,
self._pad_mode_segmentation_maps,
self._pad_cval_segmentation_maps, samples)
for augm_name in ["keypoints", "bounding_boxes", "polygons",
"line_strings"]:
augm_value = getattr(batch, augm_name)
if augm_value is not None:
func = functools.partial(
self._augment_keypoints_by_samples,
samples=samples)
cbaois = self._apply_to_cbaois_as_keypoints(augm_value, func)
setattr(batch, augm_name, cbaois)
return batch
def _augment_images_by_samples(self, images, samples):
result = []
for i, image in enumerate(images):
samples_i = samples[i]
image_cr_pa = _crop_and_pad_arr(
image, samples_i.croppings, samples_i.paddings,
samples_i.pad_mode, samples_i.pad_cval, self.keep_size)
result.append(image_cr_pa)
if ia.is_np_array(images):
if self.keep_size:
result = np.array(result, dtype=images.dtype)
else:
nb_shapes = len({image.shape for image in result})
if nb_shapes == 1:
result = np.array(result, dtype=images.dtype)
return result
def _augment_maps_by_samples(self, augmentables, pad_mode, pad_cval,
samples):
result = []
for i, augmentable in enumerate(augmentables):
samples_img = samples[i]
augmentable = _crop_and_pad_hms_or_segmaps_(
augmentable,
croppings_img=samples_img.croppings,
paddings_img=samples_img.paddings,
pad_mode=(pad_mode
if pad_mode is not None
else samples_img.pad_mode),
pad_cval=(pad_cval
if pad_cval is not None
else samples_img.pad_cval),
keep_size=self.keep_size
)
result.append(augmentable)
return result
def _augment_keypoints_by_samples(self, keypoints_on_images, samples):
result = []
for i, keypoints_on_image in enumerate(keypoints_on_images):
samples_i = samples[i]
kpsoi_aug = _crop_and_pad_kpsoi_(
keypoints_on_image, croppings_img=samples_i.croppings,
paddings_img=samples_i.paddings, keep_size=self.keep_size)
result.append(kpsoi_aug)
return result
def _draw_samples(self, random_state, shapes):
nb_rows = len(shapes)
if self.mode == "noop":
top = right = bottom = left = np.full((nb_rows,), 0,
dtype=np.int32)
else:
if self.all_sides is not None:
if self.sample_independently:
samples = self.all_sides.draw_samples(
(nb_rows, 4), random_state=random_state)
top = samples[:, 0]
right = samples[:, 1]
bottom = samples[:, 2]
left = samples[:, 3]
else:
sample = self.all_sides.draw_samples(
(nb_rows,), random_state=random_state)
top = right = bottom = left = sample
else:
top = self.top.draw_samples(
(nb_rows,), random_state=random_state)
right = self.right.draw_samples(
(nb_rows,), random_state=random_state)
bottom = self.bottom.draw_samples(
(nb_rows,), random_state=random_state)
left = self.left.draw_samples(
(nb_rows,), random_state=random_state)
if self.mode == "px":
# no change necessary for pixel values
pass
elif self.mode == "percent":
# percentage values have to be transformed to pixel values
shapes_arr = np.array([shape[0:2] for shape in shapes],
dtype=np.float32)
heights = shapes_arr[:, 0]
widths = shapes_arr[:, 1]
top = np.round(heights * top).astype(np.int32)
right = np.round(widths * right).astype(np.int32)
bottom = np.round(heights * bottom).astype(np.int32)
left = np.round(widths * left).astype(np.int32)
else:
raise Exception("Invalid mode")
def _only_above_zero(arr):
arr = np.copy(arr)
mask = (arr < 0)
arr[mask] = 0
return arr
crop_top = _only_above_zero((-1) * top)
crop_right = _only_above_zero((-1) * right)
crop_bottom = _only_above_zero((-1) * bottom)
crop_left = _only_above_zero((-1) * left)
pad_top = _only_above_zero(top)
pad_right = _only_above_zero(right)
pad_bottom = _only_above_zero(bottom)
pad_left = _only_above_zero(left)
pad_mode = self.pad_mode.draw_samples((nb_rows,),
random_state=random_state)
pad_cval = self.pad_cval.draw_samples((nb_rows,),
random_state=random_state)
# TODO vectorize this part -- especially return only one instance
result = []
for i, shape in enumerate(shapes):
height, width = shape[0:2]
crop_top_i, crop_right_i, crop_bottom_i, crop_left_i = \
_crop_prevent_zero_size(
height, width,
crop_top[i], crop_right[i], crop_bottom[i], crop_left[i])
# add here any_crop_y to not warn in case of zero height/width
# images
any_crop_y = (crop_top_i > 0 or crop_bottom_i > 0)
if any_crop_y and crop_top_i + crop_bottom_i >= height:
ia.warn(
"Expected generated crop amounts in CropAndPad for top and "
"bottom image side to be less than the image's height, but "
"got %d (top) and %d (bottom) vs. image height %d. This "
"will result in an image with output height=1 (if input "
"height was >=1) or output height=0 (if input height "
"was 0)." % (crop_top_i, crop_bottom_i, height))
# add here any_crop_x to not warn in case of zero height/width
# images
any_crop_x = (crop_left_i > 0 or crop_right_i > 0)
if any_crop_x and crop_left_i + crop_right_i >= width:
ia.warn(
"Expected generated crop amounts in CropAndPad for left "
"and right image side to be less than the image's width, "
"but got %d (left) and %d (right) vs. image width %d. "
"This will result in an image with output width=1 (if "
"input width was >=1) or output width=0 (if input width "
"was 0)." % (crop_left_i, crop_right_i, width))
result.append(
_CropAndPadSamplingResult(
crop_top=crop_top_i,
crop_right=crop_right_i,
crop_bottom=crop_bottom_i,
crop_left=crop_left_i,
pad_top=pad_top[i],
pad_right=pad_right[i],
pad_bottom=pad_bottom[i],
pad_left=pad_left[i],
pad_mode=pad_mode[i],
pad_cval=pad_cval[i]))
return result
def get_parameters(self):
"""See :func:`~imgaug.augmenters.meta.Augmenter.get_parameters`."""
return [self.all_sides, self.top, self.right, self.bottom, self.left,
self.pad_mode, self.pad_cval]
class Pad(CropAndPad):
"""Pad images, i.e. adds columns/rows of pixels to them.
Supported dtypes
----------------
See :class:`~imgaug.augmenters.size.CropAndPad`.
Parameters
----------
px : None or int or imgaug.parameters.StochasticParameter or tuple, optional
The number of pixels to pad on each side of the image.
Expected value range is ``[0, inf)``.
Either this or the parameter `percent` may be set, not both at the same
time.
* If ``None``, then pixel-based padding will not be used.
* If ``int``, then that exact number of pixels will always be
padded.
* If ``StochasticParameter``, then that parameter will be used for
each image. Four samples will be drawn per image (top, right,
bottom, left), unless `sample_independently` is set to ``False``,
as then only one value will be sampled per image and used for
all sides.
* If a ``tuple`` of two ``int`` s with values ``a`` and ``b``,
then each side will be padded by a random amount sampled
uniformly per image and side from the inteval ``[a, b]``. If
however `sample_independently` is set to ``False``, only one
value will be sampled per image and used for all sides.
* If a ``tuple`` of four entries, then the entries represent top,
right, bottom, left. Each entry may be a single ``int`` (always
pad by exactly that value), a ``tuple`` of two ``int`` s
``a`` and ``b`` (pad by an amount within ``[a, b]``), a
``list`` of ``int`` s (pad by a random value that is
contained in the ``list``) or a ``StochasticParameter`` (sample
the amount to pad from that parameter).
percent : None or int or float or imgaug.parameters.StochasticParameter or tuple, optional
The number of pixels to pad
on each side of the image given as a *fraction* of the image
height/width. E.g. if this is set to ``0.1``, the augmenter will
always pad ``10%`` of the image's height at both the top and the
bottom (both ``10%`` each), as well as ``10%`` of the width at the
right and left.
Expected value range is ``[0.0, inf)``.
Either this or the parameter `px` may be set, not both
at the same time.
* If ``None``, then fraction-based padding will not be
used.
* If ``number``, then that fraction will always be padded.
* If ``StochasticParameter``, then that parameter will be used for
each image. Four samples will be drawn per image (top, right,
bottom, left). If however `sample_independently` is set to
``False``, only one value will be sampled per image and used for
all sides.
* If a ``tuple`` of two ``float`` s with values ``a`` and ``b``,
then each side will be padded by a random fraction
sampled uniformly per image and side from the interval
``[a, b]``. If however `sample_independently` is set to
``False``, only one value will be sampled per image and used for
all sides.
* If a ``tuple`` of four entries, then the entries represent top,
right, bottom, left. Each entry may be a single ``float``
(always pad by exactly that fraction), a ``tuple`` of
two ``float`` s ``a`` and ``b`` (pad by a fraction from
``[a, b]``), a ``list`` of ``float`` s (pad by a random
value that is contained in the list) or a ``StochasticParameter``
(sample the percentage to pad from that parameter).
pad_mode : imgaug.ALL or str or list of str or imgaug.parameters.StochasticParameter, optional
Padding mode to use. The available modes match the numpy padding modes,
i.e. ``constant``, ``edge``, ``linear_ramp``, ``maximum``, ``median``,
``minimum``, ``reflect``, ``symmetric``, ``wrap``. The modes
``constant`` and ``linear_ramp`` use extra values, which are provided
by ``pad_cval`` when necessary. See :func:`~imgaug.imgaug.pad` for
more details.
* If ``imgaug.ALL``, then a random mode from all available modes
will be sampled per image.
* If a ``str``, it will be used as the pad mode for all images.
* If a ``list`` of ``str``, a random one of these will be sampled
per image and used as the mode.
* If ``StochasticParameter``, a random mode will be sampled from
this parameter per image.
pad_cval : number or tuple of number list of number or imgaug.parameters.StochasticParameter, optional
The constant value to use if the pad mode is ``constant`` or the end
value to use if the mode is ``linear_ramp``.
See :func:`~imgaug.imgaug.pad` for more details.
* If ``number``, then that value will be used.
* If a ``tuple`` of two ``number`` s and at least one of them is
a ``float``, then a random number will be uniformly sampled per
image from the continuous interval ``[a, b]`` and used as the
value. If both ``number`` s are ``int`` s, the interval is
discrete.
* If a ``list`` of ``number``, then a random value will be chosen
from the elements of the ``list`` and used as the value.
* If ``StochasticParameter``, a random value will be sampled from
that parameter per image.
keep_size : bool, optional
After padding, the result image will usually have a
different height/width compared to the original input image. If this
parameter is set to ``True``, then the padded image will be
resized to the input image's size, i.e. the augmenter's output shape
is always identical to the input shape.
sample_independently : bool, optional
If ``False`` *and* the values for `px`/`percent` result in exactly
*one* probability distribution for all image sides, only one single
value will be sampled from that probability distribution and used for
all sides. I.e. the pad amount then is the same for all sides.
If ``True``, four values will be sampled independently, one per side.
seed : None or int or imgaug.random.RNG or numpy.random.Generator or numpy.random.BitGenerator or numpy.random.SeedSequence or numpy.random.RandomState, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
name : None or str, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
**old_kwargs
Outdated parameters. Avoid using these.
Examples
--------
>>> import imgaug.augmenters as iaa
>>> aug = iaa.Pad(px=(0, 10))
Pad each side by a random pixel value sampled uniformly per image and
side from the discrete interval ``[0..10]``. The padding happens by
zero-padding, i.e. it adds black pixels (default setting).
>>> aug = iaa.Pad(px=(0, 10), pad_mode="edge")
Pad each side by a random pixel value sampled uniformly per image and
side from the discrete interval ``[0..10]``. The padding uses the
``edge`` mode from numpy's pad function, i.e. the pixel colors around
the image sides are repeated.
>>> aug = iaa.Pad(px=(0, 10), pad_mode=["constant", "edge"])
Similar to the previous example, but uses zero-padding (``constant``) for
half of the images and ``edge`` padding for the other half.
>>> aug = iaa.Pad(px=(0, 10), pad_mode=ia.ALL, pad_cval=(0, 255))
Similar to the previous example, but uses any available padding mode.
In case the padding mode ends up being ``constant`` or ``linear_ramp``,
and random intensity is uniformly sampled (once per image) from the
discrete interval ``[0..255]`` and used as the intensity of the new
pixels.
>>> aug = iaa.Pad(px=(0, 10), sample_independently=False)
Pad each side by a random pixel value sampled uniformly once per image
from the discrete interval ``[0..10]``. Each sampled value is used
for *all* sides of the corresponding image.
>>> aug = iaa.Pad(px=(0, 10), keep_size=False)
Pad each side by a random pixel value sampled uniformly per image and
side from the discrete interval ``[0..10]``. Afterwards, do **not**
resize the padded image back to the input image's size. This will increase
the image's height and width by a maximum of ``20`` pixels.
>>> aug = iaa.Pad(px=((0, 10), (0, 5), (0, 10), (0, 5)))
Pad the top and bottom by a random pixel value sampled uniformly from the
discrete interval ``[0..10]``. Pad the left and right analogously by
a random value sampled from ``[0..5]``. Each value is always sampled
independently.
>>> aug = iaa.Pad(percent=(0, 0.1))
Pad each side by a random fraction sampled uniformly from the continuous
interval ``[0.0, 0.10]``. The fraction is sampled once per image and
side. E.g. a sampled fraction of ``0.1`` for the top side would pad by
``0.1*H``, where ``H`` is the height of the input image.
>>> aug = iaa.Pad(
>>> percent=([0.05, 0.1], [0.05, 0.1], [0.05, 0.1], [0.05, 0.1]))
Pads each side by either ``5%`` or ``10%``. The values are sampled
once per side and image.
"""
def __init__(self, px=None, percent=None, pad_mode="constant", pad_cval=0,
keep_size=True, sample_independently=True,
seed=None, name=None, **old_kwargs):
def recursive_validate(value):
if value is None:
return value
if ia.is_single_number(value):
assert value >= 0, "Expected value >0, got %.4f" % (value,)
return value
if isinstance(value, iap.StochasticParameter):
return value
if isinstance(value, tuple):
return tuple([recursive_validate(v_) for v_ in value])
if isinstance(value, list):
return [recursive_validate(v_) for v_ in value]
raise Exception(
"Expected None or int or float or StochasticParameter or "
"list or tuple, got %s." % (type(value),))
px = recursive_validate(px)
percent = recursive_validate(percent)
super(Pad, self).__init__(
px=px,
percent=percent,
pad_mode=pad_mode,
pad_cval=pad_cval,
keep_size=keep_size,
sample_independently=sample_independently,
seed=seed, name=name, **old_kwargs)
class Crop(CropAndPad):
"""Crop images, i.e. remove columns/rows of pixels at the sides of images.
This augmenter allows to extract smaller-sized subimages from given
full-sized input images. The number of pixels to cut off may be defined
in absolute values or as fractions of the image sizes.
This augmenter will never crop images below a height or width of ``1``.
Supported dtypes
----------------
See :class:`~imgaug.augmenters.size.CropAndPad`.
Parameters
----------
px : None or int or imgaug.parameters.StochasticParameter or tuple, optional
The number of pixels to crop on each side of the image.
Expected value range is ``[0, inf)``.
Either this or the parameter `percent` may be set, not both at the same
time.
* If ``None``, then pixel-based cropping will not be used.
* If ``int``, then that exact number of pixels will always be
cropped.
* If ``StochasticParameter``, then that parameter will be used for
each image. Four samples will be drawn per image (top, right,
bottom, left), unless `sample_independently` is set to ``False``,
as then only one value will be sampled per image and used for
all sides.
* If a ``tuple`` of two ``int`` s with values ``a`` and ``b``,
then each side will be cropped by a random amount sampled
uniformly per image and side from the inteval ``[a, b]``. If
however `sample_independently` is set to ``False``, only one
value will be sampled per image and used for all sides.
* If a ``tuple`` of four entries, then the entries represent top,
right, bottom, left. Each entry may be a single ``int`` (always
crop by exactly that value), a ``tuple`` of two ``int`` s
``a`` and ``b`` (crop by an amount within ``[a, b]``), a
``list`` of ``int`` s (crop by a random value that is
contained in the ``list``) or a ``StochasticParameter`` (sample
the amount to crop from that parameter).
percent : None or int or float or imgaug.parameters.StochasticParameter or tuple, optional
The number of pixels to crop
on each side of the image given as a *fraction* of the image
height/width. E.g. if this is set to ``0.1``, the augmenter will
always crop ``10%`` of the image's height at both the top and the
bottom (both ``10%`` each), as well as ``10%`` of the width at the
right and left.
Expected value range is ``[0.0, 1.0)``.
Either this or the parameter `px` may be set, not both
at the same time.
* If ``None``, then fraction-based cropping will not be
used.
* If ``number``, then that fraction will always be cropped.
* If ``StochasticParameter``, then that parameter will be used for
each image. Four samples will be drawn per image (top, right,
bottom, left). If however `sample_independently` is set to
``False``, only one value will be sampled per image and used for
all sides.
* If a ``tuple`` of two ``float`` s with values ``a`` and ``b``,
then each side will be cropped by a random fraction
sampled uniformly per image and side from the interval
``[a, b]``. If however `sample_independently` is set to
``False``, only one value will be sampled per image and used for
all sides.
* If a ``tuple`` of four entries, then the entries represent top,
right, bottom, left. Each entry may be a single ``float``
(always crop by exactly that fraction), a ``tuple`` of
two ``float`` s ``a`` and ``b`` (crop by a fraction from
``[a, b]``), a ``list`` of ``float`` s (crop by a random
value that is contained in the list) or a ``StochasticParameter``
(sample the percentage to crop from that parameter).
keep_size : bool, optional
After cropping, the result image will usually have a
different height/width compared to the original input image. If this
parameter is set to ``True``, then the cropped image will be
resized to the input image's size, i.e. the augmenter's output shape
is always identical to the input shape.
sample_independently : bool, optional
If ``False`` *and* the values for `px`/`percent` result in exactly
*one* probability distribution for all image sides, only one single
value will be sampled from that probability distribution and used for
all sides. I.e. the crop amount then is the same for all sides.
If ``True``, four values will be sampled independently, one per side.
seed : None or int or imgaug.random.RNG or numpy.random.Generator or numpy.random.BitGenerator or numpy.random.SeedSequence or numpy.random.RandomState, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
name : None or str, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
**old_kwargs
Outdated parameters. Avoid using these.
Examples
--------
>>> import imgaug.augmenters as iaa
>>> aug = iaa.Crop(px=(0, 10))
Crop each side by a random pixel value sampled uniformly per image and
side from the discrete interval ``[0..10]``.
>>> aug = iaa.Crop(px=(0, 10), sample_independently=False)
Crop each side by a random pixel value sampled uniformly once per image
from the discrete interval ``[0..10]``. Each sampled value is used
for *all* sides of the corresponding image.
>>> aug = iaa.Crop(px=(0, 10), keep_size=False)
Crop each side by a random pixel value sampled uniformly per image and
side from the discrete interval ``[0..10]``. Afterwards, do **not**
resize the cropped image back to the input image's size. This will decrease
the image's height and width by a maximum of ``20`` pixels.
>>> aug = iaa.Crop(px=((0, 10), (0, 5), (0, 10), (0, 5)))
Crop the top and bottom by a random pixel value sampled uniformly from the
discrete interval ``[0..10]``. Crop the left and right analogously by
a random value sampled from ``[0..5]``. Each value is always sampled
independently.
>>> aug = iaa.Crop(percent=(0, 0.1))
Crop each side by a random fraction sampled uniformly from the continuous
interval ``[0.0, 0.10]``. The fraction is sampled once per image and
side. E.g. a sampled fraction of ``0.1`` for the top side would crop by
``0.1*H``, where ``H`` is the height of the input image.
>>> aug = iaa.Crop(
>>> percent=([0.05, 0.1], [0.05, 0.1], [0.05, 0.1], [0.05, 0.1]))
Crops each side by either ``5%`` or ``10%``. The values are sampled
once per side and image.
"""
def __init__(self, px=None, percent=None, keep_size=True,
sample_independently=True,
seed=None, name=None, **old_kwargs):
def recursive_negate(value):
if value is None:
return value
if ia.is_single_number(value):
assert value >= 0, "Expected value >0, got %.4f." % (value,)
return -value
if isinstance(value, iap.StochasticParameter):
return iap.Multiply(value, -1)
if isinstance(value, tuple):
return tuple([recursive_negate(v_) for v_ in value])
if isinstance(value, list):
return [recursive_negate(v_) for v_ in value]
raise Exception(
"Expected None or int or float or StochasticParameter or "
"list or tuple, got %s." % (type(value),))
px = recursive_negate(px)
percent = recursive_negate(percent)
super(Crop, self).__init__(
px=px,
percent=percent,
keep_size=keep_size,
sample_independently=sample_independently,
seed=seed, name=name, **old_kwargs)
# TODO maybe rename this to PadToMinimumSize?
# TODO this is very similar to CropAndPad, maybe add a way to generate crop
# values imagewise via a callback in in CropAndPad?
# TODO why is padding mode and cval here called pad_mode, pad_cval but in other
# cases mode/cval?
class PadToFixedSize(meta.Augmenter):
"""Pad images to a predefined minimum width and/or height.
If images are already at the minimum width/height or are larger, they will
not be padded. Note that this also means that images will not be cropped if
they exceed the required width/height.
The augmenter randomly decides per image how to distribute the required
padding amounts over the image axis. E.g. if 2px have to be padded on the
left or right to reach the required width, the augmenter will sometimes
add 2px to the left and 0px to the right, sometimes add 2px to the right
and 0px to the left and sometimes add 1px to both sides. Set `position`
to ``center`` to prevent that.
Supported dtypes
----------------
See :func:`~imgaug.augmenters.size.pad`.
Parameters
----------
width : int or None
Pad images up to this minimum width.
If ``None``, image widths will not be altered.
height : int or None
Pad images up to this minimum height.
If ``None``, image heights will not be altered.
pad_mode : imgaug.ALL or str or list of str or imgaug.parameters.StochasticParameter, optional
See :func:`~imgaug.augmenters.size.CropAndPad.__init__`.
pad_cval : number or tuple of number or list of number or imgaug.parameters.StochasticParameter, optional
See :func:`~imgaug.augmenters.size.CropAndPad.__init__`.
position : {'uniform', 'normal', 'center', 'left-top', 'left-center', 'left-bottom', 'center-top', 'center-center', 'center-bottom', 'right-top', 'right-center', 'right-bottom'} or tuple of float or StochasticParameter or tuple of StochasticParameter, optional
Sets the center point of the padding, which determines how the
required padding amounts are distributed to each side. For a ``tuple``
``(a, b)``, both ``a`` and ``b`` are expected to be in range
``[0.0, 1.0]`` and describe the fraction of padding applied to the
left/right (low/high values for ``a``) and the fraction of padding
applied to the top/bottom (low/high values for ``b``). A padding
position at ``(0.5, 0.5)`` would be the center of the image and
distribute the padding equally to all sides. A padding position at
``(0.0, 1.0)`` would be the left-bottom and would apply 100% of the
required padding to the bottom and left sides of the image so that
the bottom left corner becomes more and more the new image
center (depending on how much is padded).
* If string ``uniform`` then the share of padding is randomly and
uniformly distributed over each side.
Equivalent to ``(Uniform(0.0, 1.0), Uniform(0.0, 1.0))``.
* If string ``normal`` then the share of padding is distributed
based on a normal distribution, leading to a focus on the
center of the images.
Equivalent to
``(Clip(Normal(0.5, 0.45/2), 0, 1),
Clip(Normal(0.5, 0.45/2), 0, 1))``.
* If string ``center`` then center point of the padding is
identical to the image center.
Equivalent to ``(0.5, 0.5)``.
* If a string matching regex
``^(left|center|right)-(top|center|bottom)$``, e.g. ``left-top``
or ``center-bottom`` then sets the center point of the padding
to the X-Y position matching that description.
* If a tuple of float, then expected to have exactly two entries
between ``0.0`` and ``1.0``, which will always be used as the
combination the position matching (x, y) form.
* If a ``StochasticParameter``, then that parameter will be queried
once per call to ``augment_*()`` to get ``Nx2`` center positions
in ``(x, y)`` form (with ``N`` the number of images).
* If a ``tuple`` of ``StochasticParameter``, then expected to have
exactly two entries that will both be queried per call to
``augment_*()``, each for ``(N,)`` values, to get the center
positions. First parameter is used for ``x`` coordinates,
second for ``y`` coordinates.
seed : None or int or imgaug.random.RNG or numpy.random.Generator or numpy.random.BitGenerator or numpy.random.SeedSequence or numpy.random.RandomState, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
name : None or str, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
**old_kwargs
Outdated parameters. Avoid using these.
Examples
--------
>>> import imgaug.augmenters as iaa
>>> aug = iaa.PadToFixedSize(width=100, height=100)
For image sides smaller than ``100`` pixels, pad to ``100`` pixels. Do
nothing for the other edges. The padding is randomly (uniformly)
distributed over the sides, so that e.g. sometimes most of the required
padding is applied to the left, sometimes to the right (analogous
top/bottom).
>>> aug = iaa.PadToFixedSize(width=100, height=100, position="center")
For image sides smaller than ``100`` pixels, pad to ``100`` pixels. Do
nothing for the other image sides. The padding is always equally
distributed over the left/right and top/bottom sides.
>>> aug = iaa.PadToFixedSize(width=100, height=100, pad_mode=ia.ALL)
For image sides smaller than ``100`` pixels, pad to ``100`` pixels and
use any possible padding mode for that. Do nothing for the other image
sides. The padding is always equally distributed over the left/right and
top/bottom sides.
>>> aug = iaa.Sequential([
>>> iaa.PadToFixedSize(width=100, height=100),
>>> iaa.CropToFixedSize(width=100, height=100)
>>> ])
Pad images smaller than ``100x100`` until they reach ``100x100``.
Analogously, crop images larger than ``100x100`` until they reach
``100x100``. The output images therefore have a fixed size of ``100x100``.
"""
def __init__(self, width, height, pad_mode="constant", pad_cval=0,
position="uniform",
seed=None, name=None, **old_kwargs):
super(PadToFixedSize, self).__init__(
seed=seed, name=name, **old_kwargs)
self.size = (width, height)
# Position of where to pad. The further to the top left this is, the
# larger the share of pixels that will be added to the top and left
# sides. I.e. set to (Deterministic(0.0), Deterministic(0.0)) to only
# add at the top and left, (Deterministic(1.0), Deterministic(1.0))
# to only add at the bottom right. Analogously (0.5, 0.5) pads equally
# on both axis, (0.0, 1.0) pads left and bottom, (1.0, 0.0) pads right
# and top.
self.position = _handle_position_parameter(position)
self.pad_mode = _handle_pad_mode_param(pad_mode)
# TODO enable ALL here like in eg Affine
self.pad_cval = iap.handle_discrete_param(
pad_cval, "pad_cval", value_range=None, tuple_to_uniform=True,
list_to_choice=True, allow_floats=True)
# set these to None to use the same values as sampled for the
# images (not tested)
self._pad_mode_heatmaps = "constant"
self._pad_mode_segmentation_maps = "constant"
self._pad_cval_heatmaps = 0.0
self._pad_cval_segmentation_maps = 0
def _augment_batch_(self, batch, random_state, parents, hooks):
# Providing the whole batch to _draw_samples() would not be necessary
# for this augmenter. The number of rows would be sufficient. This
# formulation however enables derived augmenters to use rowwise shapes
# without having to compute them here for this augmenter.
samples = self._draw_samples(batch, random_state)
if batch.images is not None:
batch.images = self._augment_images_by_samples(batch.images,
samples)
if batch.heatmaps is not None:
batch.heatmaps = self._augment_maps_by_samples(
batch.heatmaps, samples, self._pad_mode_heatmaps,
self._pad_cval_heatmaps)
if batch.segmentation_maps is not None:
batch.segmentation_maps = self._augment_maps_by_samples(
batch.segmentation_maps, samples, self._pad_mode_heatmaps,
self._pad_cval_heatmaps)
for augm_name in ["keypoints", "bounding_boxes", "polygons",
"line_strings"]:
augm_value = getattr(batch, augm_name)
if augm_value is not None:
func = functools.partial(
self._augment_keypoints_by_samples,
samples=samples)
cbaois = self._apply_to_cbaois_as_keypoints(augm_value, func)
setattr(batch, augm_name, cbaois)
return batch
def _augment_images_by_samples(self, images, samples):
result = []
sizes, pad_xs, pad_ys, pad_modes, pad_cvals = samples
for i, (image, size) in enumerate(zip(images, sizes)):
width_min, height_min = size
height_image, width_image = image.shape[:2]
paddings = self._calculate_paddings(height_image, width_image,
height_min, width_min,
pad_xs[i], pad_ys[i])
image = _crop_and_pad_arr(
image, (0, 0, 0, 0), paddings, pad_modes[i], pad_cvals[i],
keep_size=False)
result.append(image)
# TODO result is always a list. Should this be converted to an array
# if possible (not guaranteed that all images have same size,
# some might have been larger than desired height/width)
return result
def _augment_keypoints_by_samples(self, keypoints_on_images, samples):
result = []
sizes, pad_xs, pad_ys, _, _ = samples
for i, (kpsoi, size) in enumerate(zip(keypoints_on_images, sizes)):
width_min, height_min = size
height_image, width_image = kpsoi.shape[:2]
paddings_img = self._calculate_paddings(height_image, width_image,
height_min, width_min,
pad_xs[i], pad_ys[i])
keypoints_padded = _crop_and_pad_kpsoi_(
kpsoi, (0, 0, 0, 0), paddings_img,
keep_size=False)
result.append(keypoints_padded)
return result
def _augment_maps_by_samples(self, augmentables, samples, pad_mode,
pad_cval):
sizes, pad_xs, pad_ys, pad_modes, pad_cvals = samples
for i, (augmentable, size) in enumerate(zip(augmentables, sizes)):
width_min, height_min = size
height_img, width_img = augmentable.shape[:2]
paddings_img = self._calculate_paddings(
height_img, width_img, height_min, width_min,
pad_xs[i], pad_ys[i])
# TODO for the previous method (and likely the new/current one
# too):
# for 30x30 padded to 32x32 with 15x15 heatmaps this results
# in paddings of 1 on each side (assuming
# position=(0.5, 0.5)) giving 17x17 heatmaps when they should
# be 16x16. Error is due to each side getting projected 0.5
# padding which is rounded to 1. This doesn't seem right.
augmentables[i] = _crop_and_pad_hms_or_segmaps_(
augmentables[i],
(0, 0, 0, 0),
paddings_img,
pad_mode=pad_mode if pad_mode is not None else pad_modes[i],
pad_cval=pad_cval if pad_cval is not None else pad_cvals[i],
keep_size=False)
return augmentables
def _draw_samples(self, batch, random_state):
nb_images = batch.nb_rows
rngs = random_state.duplicate(4)
if isinstance(self.position, tuple):
pad_xs = self.position[0].draw_samples(nb_images,
random_state=rngs[0])
pad_ys = self.position[1].draw_samples(nb_images,
random_state=rngs[1])
else:
pads = self.position.draw_samples((nb_images, 2),
random_state=rngs[0])
pad_xs = pads[:, 0]
pad_ys = pads[:, 1]
pad_modes = self.pad_mode.draw_samples(nb_images,
random_state=rngs[2])
pad_cvals = self.pad_cval.draw_samples(nb_images,
random_state=rngs[3])
# We return here the sizes even though they are static as it allows
# derived augmenters to define image-specific heights/widths.
return [self.size] * nb_images, pad_xs, pad_ys, pad_modes, pad_cvals
@classmethod
def _calculate_paddings(cls, height_image, width_image,
height_min, width_min, pad_xs_i, pad_ys_i):
pad_top = 0
pad_right = 0
pad_bottom = 0
pad_left = 0
if width_min is not None and width_image < width_min:
pad_total_x = width_min - width_image
pad_left = int((1-pad_xs_i) * pad_total_x)
pad_right = pad_total_x - pad_left
if height_min is not None and height_image < height_min:
pad_total_y = height_min - height_image
pad_top = int((1-pad_ys_i) * pad_total_y)
pad_bottom = pad_total_y - pad_top
return pad_top, pad_right, pad_bottom, pad_left
def get_parameters(self):
"""See :func:`~imgaug.augmenters.meta.Augmenter.get_parameters`."""
return [self.size[0], self.size[1], self.pad_mode, self.pad_cval,
self.position]
class CenterPadToFixedSize(PadToFixedSize):
"""Pad images equally on all sides up to given minimum heights/widths.
This is an alias for :class:`~imgaug.augmenters.size.PadToFixedSize`
with ``position="center"``. It spreads the pad amounts equally over
all image sides, while :class:`~imgaug.augmenters.size.PadToFixedSize`
by defaults spreads them randomly.
Supported dtypes
----------------
See :class:`~imgaug.augmenters.size.PadToFixedSize`.
Parameters
----------
width : int or None
See :func:`PadToFixedSize.__init__`.
height : int or None
See :func:`PadToFixedSize.__init__`.
pad_mode : imgaug.ALL or str or list of str or imgaug.parameters.StochasticParameter, optional
See :func:`PadToFixedSize.__init__`.
pad_cval : number or tuple of number or list of number or imgaug.parameters.StochasticParameter, optional
See :func:`PadToFixedSize.__init__`.
seed : None or int or imgaug.random.RNG or numpy.random.Generator or numpy.random.BitGenerator or numpy.random.SeedSequence or numpy.random.RandomState, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
name : None or str, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
**old_kwargs
Outdated parameters. Avoid using these.
Examples
--------
>>> import imgaug.augmenters as iaa
>>> aug = iaa.CenterPadToFixedSize(height=20, width=30)
Create an augmenter that pads images up to ``20x30``, with the padded
rows added *equally* on the top and bottom (analogous for the padded
columns).
"""
def __init__(self, width, height, pad_mode="constant", pad_cval=0,
seed=None, name=None, **old_kwargs):
super(CenterPadToFixedSize, self).__init__(
width=width, height=height, pad_mode=pad_mode, pad_cval=pad_cval,
position="center",
seed=seed, name=name, **old_kwargs)
# TODO maybe rename this to CropToMaximumSize ?
# TODO this is very similar to CropAndPad, maybe add a way to generate crop
# values imagewise via a callback in in CropAndPad?
# TODO add crop() function in imgaug, similar to pad
class CropToFixedSize(meta.Augmenter):
"""Crop images down to a predefined maximum width and/or height.
If images are already at the maximum width/height or are smaller, they
will not be cropped. Note that this also means that images will not be
padded if they are below the required width/height.
The augmenter randomly decides per image how to distribute the required
cropping amounts over the image axis. E.g. if 2px have to be cropped on
the left or right to reach the required width, the augmenter will
sometimes remove 2px from the left and 0px from the right, sometimes
remove 2px from the right and 0px from the left and sometimes remove 1px
from both sides. Set `position` to ``center`` to prevent that.
Supported dtypes
----------------
* ``uint8``: yes; fully tested
* ``uint16``: yes; tested
* ``uint32``: yes; tested
* ``uint64``: yes; tested
* ``int8``: yes; tested
* ``int16``: yes; tested
* ``int32``: yes; tested
* ``int64``: yes; tested
* ``float16``: yes; tested
* ``float32``: yes; tested
* ``float64``: yes; tested
* ``float128``: yes; tested
* ``bool``: yes; tested
Parameters
----------
width : int or None
Crop images down to this maximum width.
If ``None``, image widths will not be altered.
height : int or None
Crop images down to this maximum height.
If ``None``, image heights will not be altered.
position : {'uniform', 'normal', 'center', 'left-top', 'left-center', 'left-bottom', 'center-top', 'center-center', 'center-bottom', 'right-top', 'right-center', 'right-bottom'} or tuple of float or StochasticParameter or tuple of StochasticParameter, optional
Sets the center point of the cropping, which determines how the
required cropping amounts are distributed to each side. For a
``tuple`` ``(a, b)``, both ``a`` and ``b`` are expected to be in
range ``[0.0, 1.0]`` and describe the fraction of cropping applied
to the left/right (low/high values for ``a``) and the fraction
of cropping applied to the top/bottom (low/high values for ``b``).
A cropping position at ``(0.5, 0.5)`` would be the center of the
image and distribute the cropping equally over all sides. A cropping
position at ``(1.0, 0.0)`` would be the right-top and would apply
100% of the required cropping to the right and top sides of the image.
* If string ``uniform`` then the share of cropping is randomly
and uniformly distributed over each side.
Equivalent to ``(Uniform(0.0, 1.0), Uniform(0.0, 1.0))``.
* If string ``normal`` then the share of cropping is distributed
based on a normal distribution, leading to a focus on the center
of the images.
Equivalent to
``(Clip(Normal(0.5, 0.45/2), 0, 1),
Clip(Normal(0.5, 0.45/2), 0, 1))``.
* If string ``center`` then center point of the cropping is
identical to the image center.
Equivalent to ``(0.5, 0.5)``.
* If a string matching regex
``^(left|center|right)-(top|center|bottom)$``, e.g.
``left-top`` or ``center-bottom`` then sets the center point of
the cropping to the X-Y position matching that description.
* If a tuple of float, then expected to have exactly two entries
between ``0.0`` and ``1.0``, which will always be used as the
combination the position matching (x, y) form.
* If a ``StochasticParameter``, then that parameter will be queried
once per call to ``augment_*()`` to get ``Nx2`` center positions
in ``(x, y)`` form (with ``N`` the number of images).
* If a ``tuple`` of ``StochasticParameter``, then expected to have
exactly two entries that will both be queried per call to
``augment_*()``, each for ``(N,)`` values, to get the center
positions. First parameter is used for ``x`` coordinates,
second for ``y`` coordinates.
seed : None or int or imgaug.random.RNG or numpy.random.Generator or numpy.random.BitGenerator or numpy.random.SeedSequence or numpy.random.RandomState, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
name : None or str, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
**old_kwargs
Outdated parameters. Avoid using these.
Examples
--------
>>> import imgaug.augmenters as iaa
>>> aug = iaa.CropToFixedSize(width=100, height=100)
For image sides larger than ``100`` pixels, crop to ``100`` pixels. Do
nothing for the other sides. The cropping amounts are randomly (and
uniformly) distributed over the sides of the image.
>>> aug = iaa.CropToFixedSize(width=100, height=100, position="center")
For sides larger than ``100`` pixels, crop to ``100`` pixels. Do nothing
for the other sides. The cropping amounts are always equally distributed
over the left/right sides of the image (and analogously for top/bottom).
>>> aug = iaa.Sequential([
>>> iaa.PadToFixedSize(width=100, height=100),
>>> iaa.CropToFixedSize(width=100, height=100)
>>> ])
Pad images smaller than ``100x100`` until they reach ``100x100``.
Analogously, crop images larger than ``100x100`` until they reach
``100x100``. The output images therefore have a fixed size of ``100x100``.
"""
def __init__(self, width, height, position="uniform",
seed=None, name=None, **old_kwargs):
super(CropToFixedSize, self).__init__(
seed=seed, name=name, **old_kwargs)
self.size = (width, height)
# Position of where to crop. The further to the top left this is,
# the larger the share of pixels that will be cropped from the top
# and left sides. I.e. set to (Deterministic(0.0), Deterministic(0.0))
# to only crop at the top and left,
# (Deterministic(1.0), Deterministic(1.0)) to only crop at the bottom
# right. Analogously (0.5, 0.5) crops equally on both axis,
# (0.0, 1.0) crops left and bottom, (1.0, 0.0) crops right and top.
self.position = _handle_position_parameter(position)
def _augment_batch_(self, batch, random_state, parents, hooks):
# Providing the whole batch to _draw_samples() would not be necessary
# for this augmenter. The number of rows would be sufficient. This
# formulation however enables derived augmenters to use rowwise shapes
# without having to compute them here for this augmenter.
samples = self._draw_samples(batch, random_state)
if batch.images is not None:
batch.images = self._augment_images_by_samples(batch.images,
samples)
if batch.heatmaps is not None:
batch.heatmaps = self._augment_maps_by_samples(
batch.heatmaps, samples)
if batch.segmentation_maps is not None:
batch.segmentation_maps = self._augment_maps_by_samples(
batch.segmentation_maps, samples)
for augm_name in ["keypoints", "bounding_boxes", "polygons",
"line_strings"]:
augm_value = getattr(batch, augm_name)
if augm_value is not None:
func = functools.partial(
self._augment_keypoints_by_samples,
samples=samples)
cbaois = self._apply_to_cbaois_as_keypoints(augm_value, func)
setattr(batch, augm_name, cbaois)
return batch
def _augment_images_by_samples(self, images, samples):
result = []
sizes, offset_xs, offset_ys = samples
for i, (image, size) in enumerate(zip(images, sizes)):
w, h = size
height_image, width_image = image.shape[0:2]
croppings = self._calculate_crop_amounts(
height_image, width_image, h, w, offset_ys[i], offset_xs[i])
image_cropped = _crop_and_pad_arr(image, croppings, (0, 0, 0, 0),
keep_size=False)
result.append(image_cropped)
return result
def _augment_keypoints_by_samples(self, kpsois, samples):
result = []
sizes, offset_xs, offset_ys = samples
for i, (kpsoi, size) in enumerate(zip(kpsois, sizes)):
w, h = size
height_image, width_image = kpsoi.shape[0:2]
croppings_img = self._calculate_crop_amounts(
height_image, width_image, h, w, offset_ys[i], offset_xs[i])
kpsoi_cropped = _crop_and_pad_kpsoi_(
kpsoi, croppings_img, (0, 0, 0, 0), keep_size=False)
result.append(kpsoi_cropped)
return result
def _augment_maps_by_samples(self, augmentables, samples):
sizes, offset_xs, offset_ys = samples
for i, (augmentable, size) in enumerate(zip(augmentables, sizes)):
w, h = size
height_image, width_image = augmentable.shape[0:2]
croppings_img = self._calculate_crop_amounts(
height_image, width_image, h, w, offset_ys[i], offset_xs[i])
augmentables[i] = _crop_and_pad_hms_or_segmaps_(
augmentable, croppings_img, (0, 0, 0, 0), keep_size=False)
return augmentables
@classmethod
def _calculate_crop_amounts(cls, height_image, width_image,
height_max, width_max,
offset_y, offset_x):
crop_top = 0
crop_right = 0
crop_bottom = 0
crop_left = 0
if height_max is not None and height_image > height_max:
crop_top = int(offset_y * (height_image - height_max))
crop_bottom = height_image - height_max - crop_top
if width_max is not None and width_image > width_max:
crop_left = int(offset_x * (width_image - width_max))
crop_right = width_image - width_max - crop_left
return crop_top, crop_right, crop_bottom, crop_left
def _draw_samples(self, batch, random_state):
nb_images = batch.nb_rows
rngs = random_state.duplicate(2)
if isinstance(self.position, tuple):
offset_xs = self.position[0].draw_samples(nb_images,
random_state=rngs[0])
offset_ys = self.position[1].draw_samples(nb_images,
random_state=rngs[1])
else:
offsets = self.position.draw_samples((nb_images, 2),
random_state=rngs[0])
offset_xs = offsets[:, 0]
offset_ys = offsets[:, 1]
offset_xs = 1.0 - offset_xs
offset_ys = 1.0 - offset_ys
# We return here the sizes even though they are static as it allows
# derived augmenters to define image-specific heights/widths.
return [self.size] * nb_images, offset_xs, offset_ys
def get_parameters(self):
"""See :func:`~imgaug.augmenters.meta.Augmenter.get_parameters`."""
return [self.size[0], self.size[1], self.position]
class CenterCropToFixedSize(CropToFixedSize):
"""Take a crop from the center of each image.
This is an alias for :class:`~imgaug.augmenters.size.CropToFixedSize` with
``position="center"``.
.. note::
If images already have a width and/or height below the provided
width and/or height then this augmenter will do nothing for the
respective axis. Hence, resulting images can be smaller than the
provided axis sizes.
Supported dtypes
----------------
See :class:`~imgaug.augmenters.size.CropToFixedSize`.
Parameters
----------
width : int or None
See :func:`CropToFixedSize.__init__`.
height : int or None
See :func:`CropToFixedSize.__init__`.
seed : None or int or imgaug.random.RNG or numpy.random.Generator or numpy.random.BitGenerator or numpy.random.SeedSequence or numpy.random.RandomState, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
name : None or str, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
**old_kwargs
Outdated parameters. Avoid using these.
Examples
--------
>>> import imgaug.augmenters as iaa
>>> crop = iaa.CenterCropToFixedSize(height=20, width=10)
Create an augmenter that takes ``20x10`` sized crops from the center of
images.
"""
def __init__(self, width, height,
seed=None, name=None, **old_kwargs):
super(CenterCropToFixedSize, self).__init__(
width=width, height=height, position="center",
seed=seed, name=name, **old_kwargs)
class CropToMultiplesOf(CropToFixedSize):
"""Crop images down until their height/width is a multiple of a value.
.. note::
For a given axis size ``A`` and multiple ``M``, if ``A`` is in the
interval ``[0 .. M]``, the axis will not be changed.
As a result, this augmenter can still produce axis sizes that are
not multiples of the given values.
Supported dtypes
----------------
See :class:`~imgaug.augmenters.size.CropToFixedSize`.
Parameters
----------
width_multiple : int or None
Multiple for the width. Images will be cropped down until their
width is a multiple of this value.
If ``None``, image widths will not be altered.
height_multiple : int or None
Multiple for the height. Images will be cropped down until their
height is a multiple of this value.
If ``None``, image heights will not be altered.
position : {'uniform', 'normal', 'center', 'left-top', 'left-center', 'left-bottom', 'center-top', 'center-center', 'center-bottom', 'right-top', 'right-center', 'right-bottom'} or tuple of float or StochasticParameter or tuple of StochasticParameter, optional
See :func:`CropToFixedSize.__init__`.
seed : None or int or imgaug.random.RNG or numpy.random.Generator or numpy.random.BitGenerator or numpy.random.SeedSequence or numpy.random.RandomState, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
name : None or str, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
**old_kwargs
Outdated parameters. Avoid using these.
Examples
--------
>>> import imgaug.augmenters as iaa
>>> aug = iaa.CropToMultiplesOf(height_multiple=10, width_multiple=6)
Create an augmenter that crops images to multiples of ``10`` along
the y-axis (i.e. 10, 20, 30, ...) and to multiples of ``6`` along the
x-axis (i.e. 6, 12, 18, ...).
The rows to be cropped will be spread *randomly* over the top and bottom
sides (analogous for the left/right sides).
"""
def __init__(self, width_multiple, height_multiple, position="uniform",
seed=None, name=None, **old_kwargs):
super(CropToMultiplesOf, self).__init__(
width=None, height=None, position=position,
seed=seed, name=name, **old_kwargs)
self.width_multiple = width_multiple
self.height_multiple = height_multiple
def _draw_samples(self, batch, random_state):
_sizes, offset_xs, offset_ys = super(
CropToMultiplesOf, self
)._draw_samples(batch, random_state)
shapes = batch.get_rowwise_shapes()
sizes = []
for shape in shapes:
height, width = shape[0:2]
croppings = compute_croppings_to_reach_multiples_of(
shape,
height_multiple=self.height_multiple,
width_multiple=self.width_multiple)
# TODO change that
# note that these are not in the same order as shape tuples
# in CropToFixedSize
new_size = (
width - croppings[1] - croppings[3],
height - croppings[0] - croppings[2]
)
sizes.append(new_size)
return sizes, offset_xs, offset_ys
def get_parameters(self):
"""See :func:`~imgaug.augmenters.meta.Augmenter.get_parameters`."""
return [self.width_multiple, self.height_multiple, self.position]
class CenterCropToMultiplesOf(CropToMultiplesOf):
"""Crop images equally on all sides until H/W are multiples of given values.
This is the same as :class:`~imgaug.augmenters.size.CropToMultiplesOf`,
but uses ``position="center"`` by default, which spreads the crop amounts
equally over all image sides, while
:class:`~imgaug.augmenters.size.CropToMultiplesOf` by default spreads
them randomly.
Supported dtypes
----------------
See :class:`~imgaug.augmenters.size.CropToFixedSize`.
Parameters
----------
width_multiple : int or None
See :func:`CropToMultiplesOf.__init__`.
height_multiple : int or None
See :func:`CropToMultiplesOf.__init__`.
seed : None or int or imgaug.random.RNG or numpy.random.Generator or numpy.random.BitGenerator or numpy.random.SeedSequence or numpy.random.RandomState, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
name : None or str, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
**old_kwargs
Outdated parameters. Avoid using these.
Examples
--------
>>> import imgaug.augmenters as iaa
>>> aug = iaa.CenterCropToMultiplesOf(height_multiple=10, width_multiple=6)
Create an augmenter that crops images to multiples of ``10`` along
the y-axis (i.e. 10, 20, 30, ...) and to multiples of ``6`` along the
x-axis (i.e. 6, 12, 18, ...).
The rows to be cropped will be spread *equally* over the top and bottom
sides (analogous for the left/right sides).
"""
def __init__(self, width_multiple, height_multiple,
seed=None, name=None, **old_kwargs):
super(CenterCropToMultiplesOf, self).__init__(
width_multiple=width_multiple,
height_multiple=height_multiple,
position="center",
seed=seed, name=name, **old_kwargs)
class PadToMultiplesOf(PadToFixedSize):
"""Pad images until their height/width is a multiple of a value.
Supported dtypes
----------------
See :class:`~imgaug.augmenters.size.PadToFixedSize`.
Parameters
----------
width_multiple : int or None
Multiple for the width. Images will be padded until their
width is a multiple of this value.
If ``None``, image widths will not be altered.
height_multiple : int or None
Multiple for the height. Images will be padded until their
height is a multiple of this value.
If ``None``, image heights will not be altered.
pad_mode : imgaug.ALL or str or list of str or imgaug.parameters.StochasticParameter, optional
See :func:`~imgaug.augmenters.size.PadToFixedSize.__init__`.
pad_cval : number or tuple of number or list of number or imgaug.parameters.StochasticParameter, optional
See :func:`~imgaug.augmenters.size.PadToFixedSize.__init__`.
position : {'uniform', 'normal', 'center', 'left-top', 'left-center', 'left-bottom', 'center-top', 'center-center', 'center-bottom', 'right-top', 'right-center', 'right-bottom'} or tuple of float or StochasticParameter or tuple of StochasticParameter, optional
See :func:`PadToFixedSize.__init__`.
seed : None or int or imgaug.random.RNG or numpy.random.Generator or numpy.random.BitGenerator or numpy.random.SeedSequence or numpy.random.RandomState, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
name : None or str, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
**old_kwargs
Outdated parameters. Avoid using these.
Examples
--------
>>> import imgaug.augmenters as iaa
>>> aug = iaa.PadToMultiplesOf(height_multiple=10, width_multiple=6)
Create an augmenter that pads images to multiples of ``10`` along
the y-axis (i.e. 10, 20, 30, ...) and to multiples of ``6`` along the
x-axis (i.e. 6, 12, 18, ...).
The rows to be padded will be spread *randomly* over the top and bottom
sides (analogous for the left/right sides).
"""
def __init__(self, width_multiple, height_multiple,
pad_mode="constant", pad_cval=0,
position="uniform",
seed=None, name=None, **old_kwargs):
super(PadToMultiplesOf, self).__init__(
width=None, height=None, pad_mode=pad_mode, pad_cval=pad_cval,
position=position,
seed=seed, name=name, **old_kwargs)
self.width_multiple = width_multiple
self.height_multiple = height_multiple
def _draw_samples(self, batch, random_state):
_sizes, pad_xs, pad_ys, pad_modes, pad_cvals = super(
PadToMultiplesOf, self
)._draw_samples(batch, random_state)
shapes = batch.get_rowwise_shapes()
sizes = []
for shape in shapes:
height, width = shape[0:2]
paddings = compute_paddings_to_reach_multiples_of(
shape,
height_multiple=self.height_multiple,
width_multiple=self.width_multiple)
# TODO change that
# note that these are not in the same order as shape tuples
# in PadToFixedSize
new_size = (
width + paddings[1] + paddings[3],
height + paddings[0] + paddings[2]
)
sizes.append(new_size)
return sizes, pad_xs, pad_ys, pad_modes, pad_cvals
def get_parameters(self):
"""See :func:`~imgaug.augmenters.meta.Augmenter.get_parameters`."""
return [self.width_multiple, self.height_multiple,
self.pad_mode, self.pad_cval,
self.position]
class CenterPadToMultiplesOf(PadToMultiplesOf):
"""Pad images equally on all sides until H/W are multiples of given values.
This is the same as :class:`~imgaug.augmenters.size.PadToMultiplesOf`, but
uses ``position="center"`` by default, which spreads the pad amounts
equally over all image sides, while
:class:`~imgaug.augmenters.size.PadToMultiplesOf` by default spreads them
randomly.
Supported dtypes
----------------
See :class:`~imgaug.augmenters.size.PadToFixedSize`.
Parameters
----------
width_multiple : int or None
See :func:`PadToMultiplesOf.__init__`.
height_multiple : int or None
See :func:`PadToMultiplesOf.__init__`.
pad_mode : imgaug.ALL or str or list of str or imgaug.parameters.StochasticParameter, optional
See :func:`~imgaug.augmenters.size.PadToMultiplesOf.__init__`.
pad_cval : number or tuple of number or list of number or imgaug.parameters.StochasticParameter, optional
See :func:`~imgaug.augmenters.size.PadToMultiplesOf.__init__`.
seed : None or int or imgaug.random.RNG or numpy.random.Generator or numpy.random.BitGenerator or numpy.random.SeedSequence or numpy.random.RandomState, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
name : None or str, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
**old_kwargs
Outdated parameters. Avoid using these.
Examples
--------
>>> import imgaug.augmenters as iaa
>>> aug = iaa.CenterPadToMultiplesOf(height_multiple=10, width_multiple=6)
Create an augmenter that pads images to multiples of ``10`` along
the y-axis (i.e. 10, 20, 30, ...) and to multiples of ``6`` along the
x-axis (i.e. 6, 12, 18, ...).
The rows to be padded will be spread *equally* over the top and bottom
sides (analogous for the left/right sides).
"""
def __init__(self, width_multiple, height_multiple,
pad_mode="constant", pad_cval=0,
seed=None, name=None, **old_kwargs):
super(CenterPadToMultiplesOf, self).__init__(
width_multiple=width_multiple,
height_multiple=height_multiple,
pad_mode=pad_mode,
pad_cval=pad_cval,
position="center",
seed=seed, name=name, **old_kwargs)
class CropToPowersOf(CropToFixedSize):
"""Crop images until their height/width is a power of a base.
This augmenter removes pixels from an axis with size ``S`` leading to the
new size ``S'`` until ``S' = B^E`` is fulfilled, where ``B`` is a
provided base (e.g. ``2``) and ``E`` is an exponent from the discrete
interval ``[1 .. inf)``.
.. note::
This augmenter does nothing for axes with size less than ``B^1 = B``.
If you have images with ``S < B^1``, it is recommended
to combine this augmenter with a padding augmenter that pads each
axis up to ``B``.
Supported dtypes
----------------
See :class:`~imgaug.augmenters.size.CropToFixedSize`.
Parameters
----------
width_base : int or None
Base for the width. Images will be cropped down until their
width fulfills ``width' = width_base ^ E`` with ``E`` being any
natural number.
If ``None``, image widths will not be altered.
height_base : int or None
Base for the height. Images will be cropped down until their
height fulfills ``height' = height_base ^ E`` with ``E`` being any
natural number.
If ``None``, image heights will not be altered.
position : {'uniform', 'normal', 'center', 'left-top', 'left-center', 'left-bottom', 'center-top', 'center-center', 'center-bottom', 'right-top', 'right-center', 'right-bottom'} or tuple of float or StochasticParameter or tuple of StochasticParameter, optional
See :func:`CropToFixedSize.__init__`.
seed : None or int or imgaug.random.RNG or numpy.random.Generator or numpy.random.BitGenerator or numpy.random.SeedSequence or numpy.random.RandomState, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
name : None or str, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
**old_kwargs
Outdated parameters. Avoid using these.
Examples
--------
>>> import imgaug.augmenters as iaa
>>> aug = iaa.CropToPowersOf(height_base=3, width_base=2)
Create an augmenter that crops each image down to powers of ``3`` along
the y-axis (i.e. 3, 9, 27, ...) and powers of ``2`` along the x-axis (i.e.
2, 4, 8, 16, ...).
The rows to be cropped will be spread *randomly* over the top and bottom
sides (analogous for the left/right sides).
"""
def __init__(self, width_base, height_base, position="uniform",
seed=None, name=None, **old_kwargs):
super(CropToPowersOf, self).__init__(
width=None, height=None, position=position,
seed=seed, name=name, **old_kwargs)
self.width_base = width_base
self.height_base = height_base
def _draw_samples(self, batch, random_state):
_sizes, offset_xs, offset_ys = super(
CropToPowersOf, self
)._draw_samples(batch, random_state)
shapes = batch.get_rowwise_shapes()
sizes = []
for shape in shapes:
height, width = shape[0:2]
croppings = compute_croppings_to_reach_powers_of(
shape,
height_base=self.height_base,
width_base=self.width_base)
# TODO change that
# note that these are not in the same order as shape tuples
# in CropToFixedSize
new_size = (
width - croppings[1] - croppings[3],
height - croppings[0] - croppings[2]
)
sizes.append(new_size)
return sizes, offset_xs, offset_ys
def get_parameters(self):
"""See :func:`~imgaug.augmenters.meta.Augmenter.get_parameters`."""
return [self.width_base, self.height_base, self.position]
class CenterCropToPowersOf(CropToPowersOf):
"""Crop images equally on all sides until H/W is a power of a base.
This is the same as :class:`~imgaug.augmenters.size.CropToPowersOf`, but
uses ``position="center"`` by default, which spreads the crop amounts
equally over all image sides, while
:class:`~imgaug.augmenters.size.CropToPowersOf` by default spreads them
randomly.
Supported dtypes
----------------
See :class:`~imgaug.augmenters.size.CropToFixedSize`.
Parameters
----------
width_base : int or None
See :func:`CropToPowersOf.__init__`.
height_base : int or None
See :func:`CropToPowersOf.__init__`.
seed : None or int or imgaug.random.RNG or numpy.random.Generator or numpy.random.BitGenerator or numpy.random.SeedSequence or numpy.random.RandomState, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
name : None or str, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
**old_kwargs
Outdated parameters. Avoid using these.
Examples
--------
>>> import imgaug.augmenters as iaa
>>> aug = iaa.CropToPowersOf(height_base=3, width_base=2)
Create an augmenter that crops each image down to powers of ``3`` along
the y-axis (i.e. 3, 9, 27, ...) and powers of ``2`` along the x-axis (i.e.
2, 4, 8, 16, ...).
The rows to be cropped will be spread *equally* over the top and bottom
sides (analogous for the left/right sides).
"""
def __init__(self, width_base, height_base,
seed=None, name=None, **old_kwargs):
super(CenterCropToPowersOf, self).__init__(
width_base=width_base, height_base=height_base, position="center",
seed=seed, name=name, **old_kwargs)
class PadToPowersOf(PadToFixedSize):
"""Pad images until their height/width is a power of a base.
This augmenter adds pixels to an axis with size ``S`` leading to the
new size ``S'`` until ``S' = B^E`` is fulfilled, where ``B`` is a
provided base (e.g. ``2``) and ``E`` is an exponent from the discrete
interval ``[1 .. inf)``.
Supported dtypes
----------------
See :class:`~imgaug.augmenters.size.PadToFixedSize`.
Parameters
----------
width_base : int or None
Base for the width. Images will be padded down until their
width fulfills ``width' = width_base ^ E`` with ``E`` being any
natural number.
If ``None``, image widths will not be altered.
height_base : int or None
Base for the height. Images will be padded until their
height fulfills ``height' = height_base ^ E`` with ``E`` being any
natural number.
If ``None``, image heights will not be altered.
pad_mode : imgaug.ALL or str or list of str or imgaug.parameters.StochasticParameter, optional
See :func:`~imgaug.augmenters.size.PadToFixedSize.__init__`.
pad_cval : number or tuple of number or list of number or imgaug.parameters.StochasticParameter, optional
See :func:`~imgaug.augmenters.size.PadToFixedSize.__init__`.
position : {'uniform', 'normal', 'center', 'left-top', 'left-center', 'left-bottom', 'center-top', 'center-center', 'center-bottom', 'right-top', 'right-center', 'right-bottom'} or tuple of float or StochasticParameter or tuple of StochasticParameter, optional
See :func:`PadToFixedSize.__init__`.
seed : None or int or imgaug.random.RNG or numpy.random.Generator or numpy.random.BitGenerator or numpy.random.SeedSequence or numpy.random.RandomState, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
name : None or str, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
**old_kwargs
Outdated parameters. Avoid using these.
Examples
--------
>>> import imgaug.augmenters as iaa
>>> aug = iaa.PadToPowersOf(height_base=3, width_base=2)
Create an augmenter that pads each image to powers of ``3`` along the
y-axis (i.e. 3, 9, 27, ...) and powers of ``2`` along the x-axis (i.e. 2,
4, 8, 16, ...).
The rows to be padded will be spread *randomly* over the top and bottom
sides (analogous for the left/right sides).
"""
def __init__(self, width_base, height_base,
pad_mode="constant", pad_cval=0,
position="uniform",
seed=None, name=None, **old_kwargs):
super(PadToPowersOf, self).__init__(
width=None, height=None, pad_mode=pad_mode, pad_cval=pad_cval,
position=position,
seed=seed, name=name, **old_kwargs)
self.width_base = width_base
self.height_base = height_base
def _draw_samples(self, batch, random_state):
_sizes, pad_xs, pad_ys, pad_modes, pad_cvals = super(
PadToPowersOf, self
)._draw_samples(batch, random_state)
shapes = batch.get_rowwise_shapes()
sizes = []
for shape in shapes:
height, width = shape[0:2]
paddings = compute_paddings_to_reach_powers_of(
shape,
height_base=self.height_base,
width_base=self.width_base)
# TODO change that
# note that these are not in the same order as shape tuples
# in PadToFixedSize
new_size = (
width + paddings[1] + paddings[3],
height + paddings[0] + paddings[2]
)
sizes.append(new_size)
return sizes, pad_xs, pad_ys, pad_modes, pad_cvals
def get_parameters(self):
"""See :func:`~imgaug.augmenters.meta.Augmenter.get_parameters`."""
return [self.width_base, self.height_base,
self.pad_mode, self.pad_cval,
self.position]
class CenterPadToPowersOf(PadToPowersOf):
"""Pad images equally on all sides until H/W is a power of a base.
This is the same as :class:`~imgaug.augmenters.size.PadToPowersOf`, but uses
``position="center"`` by default, which spreads the pad amounts equally
over all image sides, while :class:`~imgaug.augmenters.size.PadToPowersOf`
by default spreads them randomly.
Supported dtypes
----------------
See :class:`~imgaug.augmenters.size.PadToFixedSize`.
Parameters
----------
width_base : int or None
See :func:`PadToPowersOf.__init__`.
height_base : int or None
See :func:`PadToPowersOf.__init__`.
pad_mode : imgaug.ALL or str or list of str or imgaug.parameters.StochasticParameter, optional
See :func:`~imgaug.augmenters.size.PadToPowersOf.__init__`.
pad_cval : number or tuple of number or list of number or imgaug.parameters.StochasticParameter, optional
See :func:`~imgaug.augmenters.size.PadToPowersOf.__init__`.
seed : None or int or imgaug.random.RNG or numpy.random.Generator or numpy.random.BitGenerator or numpy.random.SeedSequence or numpy.random.RandomState, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
name : None or str, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
**old_kwargs
Outdated parameters. Avoid using these.
Examples
--------
>>> import imgaug.augmenters as iaa
>>> aug = iaa.CenterPadToPowersOf(height_base=5, width_base=2)
Create an augmenter that pads each image to powers of ``3`` along the
y-axis (i.e. 3, 9, 27, ...) and powers of ``2`` along the x-axis (i.e. 2,
4, 8, 16, ...).
The rows to be padded will be spread *equally* over the top and bottom
sides (analogous for the left/right sides).
"""
def __init__(self, width_base, height_base,
pad_mode="constant", pad_cval=0,
seed=None, name=None, **old_kwargs):
super(CenterPadToPowersOf, self).__init__(
width_base=width_base, height_base=height_base,
pad_mode=pad_mode, pad_cval=pad_cval,
position="center",
seed=seed, name=name, **old_kwargs)
class CropToAspectRatio(CropToFixedSize):
"""Crop images until their width/height matches an aspect ratio.
This augmenter removes either rows or columns until the image reaches
the desired aspect ratio given in ``width / height``. The cropping
operation is stopped once the desired aspect ratio is reached or the image
side to crop reaches a size of ``1``. If any side of the image starts
with a size of ``0``, the image will not be changed.
Supported dtypes
----------------
See :class:`~imgaug.augmenters.size.CropToFixedSize`.
Parameters
----------
aspect_ratio : number
The desired aspect ratio, given as ``width/height``. E.g. a ratio
of ``2.0`` denotes an image that is twice as wide as it is high.
position : {'uniform', 'normal', 'center', 'left-top', 'left-center', 'left-bottom', 'center-top', 'center-center', 'center-bottom', 'right-top', 'right-center', 'right-bottom'} or tuple of float or StochasticParameter or tuple of StochasticParameter, optional
See :func:`CropToFixedSize.__init__`.
seed : None or int or imgaug.random.RNG or numpy.random.Generator or numpy.random.BitGenerator or numpy.random.SeedSequence or numpy.random.RandomState, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
name : None or str, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
**old_kwargs
Outdated parameters. Avoid using these.
Examples
--------
>>> import imgaug.augmenters as iaa
>>> aug = iaa.CropToAspectRatio(2.0)
Create an augmenter that crops each image until its aspect ratio is as
close as possible to ``2.0`` (i.e. two times as many pixels along the
x-axis than the y-axis).
The rows to be cropped will be spread *randomly* over the top and bottom
sides (analogous for the left/right sides).
"""
def __init__(self, aspect_ratio, position="uniform",
seed=None, name=None, **old_kwargs):
super(CropToAspectRatio, self).__init__(
width=None, height=None, position=position,
seed=seed, name=name, **old_kwargs)
self.aspect_ratio = aspect_ratio
def _draw_samples(self, batch, random_state):
_sizes, offset_xs, offset_ys = super(
CropToAspectRatio, self
)._draw_samples(batch, random_state)
shapes = batch.get_rowwise_shapes()
sizes = []
for shape in shapes:
height, width = shape[0:2]
if height == 0 or width == 0:
croppings = (0, 0, 0, 0)
else:
croppings = compute_croppings_to_reach_aspect_ratio(
shape,
aspect_ratio=self.aspect_ratio)
# TODO change that
# note that these are not in the same order as shape tuples
# in CropToFixedSize
new_size = (
width - croppings[1] - croppings[3],
height - croppings[0] - croppings[2]
)
sizes.append(new_size)
return sizes, offset_xs, offset_ys
def get_parameters(self):
"""See :func:`~imgaug.augmenters.meta.Augmenter.get_parameters`."""
return [self.aspect_ratio, self.position]
class CenterCropToAspectRatio(CropToAspectRatio):
"""Crop images equally on all sides until they reach an aspect ratio.
This is the same as :class:`~imgaug.augmenters.size.CropToAspectRatio`, but
uses ``position="center"`` by default, which spreads the crop amounts
equally over all image sides, while
:class:`~imgaug.augmenters.size.CropToAspectRatio` by default spreads
them randomly.
Supported dtypes
----------------
See :class:`~imgaug.augmenters.size.CropToFixedSize`.
Parameters
----------
aspect_ratio : number
See :func:`CropToAspectRatio.__init__`.
seed : None or int or imgaug.random.RNG or numpy.random.Generator or numpy.random.BitGenerator or numpy.random.SeedSequence or numpy.random.RandomState, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
name : None or str, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
**old_kwargs
Outdated parameters. Avoid using these.
Examples
--------
>>> import imgaug.augmenters as iaa
>>> aug = iaa.CenterCropToAspectRatio(2.0)
Create an augmenter that crops each image until its aspect ratio is as
close as possible to ``2.0`` (i.e. two times as many pixels along the
x-axis than the y-axis).
The rows to be cropped will be spread *equally* over the top and bottom
sides (analogous for the left/right sides).
"""
def __init__(self, aspect_ratio,
seed=None, name=None, **old_kwargs):
super(CenterCropToAspectRatio, self).__init__(
aspect_ratio=aspect_ratio, position="center",
seed=seed, name=name, **old_kwargs)
class PadToAspectRatio(PadToFixedSize):
"""Pad images until their width/height matches an aspect ratio.
This augmenter adds either rows or columns until the image reaches
the desired aspect ratio given in ``width / height``.
Supported dtypes
----------------
See :class:`~imgaug.augmenters.size.PadToFixedSize`.
Parameters
----------
aspect_ratio : number
The desired aspect ratio, given as ``width/height``. E.g. a ratio
of ``2.0`` denotes an image that is twice as wide as it is high.
position : {'uniform', 'normal', 'center', 'left-top', 'left-center', 'left-bottom', 'center-top', 'center-center', 'center-bottom', 'right-top', 'right-center', 'right-bottom'} or tuple of float or StochasticParameter or tuple of StochasticParameter, optional
See :func:`PadToFixedSize.__init__`.
pad_mode : imgaug.ALL or str or list of str or imgaug.parameters.StochasticParameter, optional
See :func:`~imgaug.augmenters.size.PadToFixedSize.__init__`.
pad_cval : number or tuple of number or list of number or imgaug.parameters.StochasticParameter, optional
See :func:`~imgaug.augmenters.size.PadToFixedSize.__init__`.
seed : None or int or imgaug.random.RNG or numpy.random.Generator or numpy.random.BitGenerator or numpy.random.SeedSequence or numpy.random.RandomState, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
name : None or str, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
**old_kwargs
Outdated parameters. Avoid using these.
Examples
--------
>>> import imgaug.augmenters as iaa
>>> aug = iaa.PadToAspectRatio(2.0)
Create an augmenter that pads each image until its aspect ratio is as
close as possible to ``2.0`` (i.e. two times as many pixels along the
x-axis than the y-axis).
The rows to be padded will be spread *randomly* over the top and bottom
sides (analogous for the left/right sides).
"""
def __init__(self, aspect_ratio, pad_mode="constant", pad_cval=0,
position="uniform",
seed=None, name=None, **old_kwargs):
super(PadToAspectRatio, self).__init__(
width=None, height=None, pad_mode=pad_mode, pad_cval=pad_cval,
position=position,
seed=seed, name=name, **old_kwargs)
self.aspect_ratio = aspect_ratio
def _draw_samples(self, batch, random_state):
_sizes, pad_xs, pad_ys, pad_modes, pad_cvals = super(
PadToAspectRatio, self
)._draw_samples(batch, random_state)
shapes = batch.get_rowwise_shapes()
sizes = []
for shape in shapes:
height, width = shape[0:2]
paddings = compute_paddings_to_reach_aspect_ratio(
shape,
aspect_ratio=self.aspect_ratio)
# TODO change that
# note that these are not in the same order as shape tuples
# in PadToFixedSize
new_size = (
width + paddings[1] + paddings[3],
height + paddings[0] + paddings[2]
)
sizes.append(new_size)
return sizes, pad_xs, pad_ys, pad_modes, pad_cvals
def get_parameters(self):
"""See :func:`~imgaug.augmenters.meta.Augmenter.get_parameters`."""
return [self.aspect_ratio, self.pad_mode, self.pad_cval,
self.position]
class CenterPadToAspectRatio(PadToAspectRatio):
"""Pad images equally on all sides until H/W matches an aspect ratio.
This is the same as :class:`~imgaug.augmenters.size.PadToAspectRatio`, but
uses ``position="center"`` by default, which spreads the pad amounts
equally over all image sides, while
:class:`~imgaug.augmenters.size.PadToAspectRatio` by default spreads them
randomly.
Supported dtypes
----------------
See :class:`~imgaug.augmenters.size.PadToFixedSize`.
Parameters
----------
aspect_ratio : number
See :func:`PadToAspectRatio.__init__`.
name : None or str, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
pad_mode : imgaug.ALL or str or list of str or imgaug.parameters.StochasticParameter, optional
See :func:`~imgaug.augmenters.size.PadToAspectRatio.__init__`.
pad_cval : number or tuple of number or list of number or imgaug.parameters.StochasticParameter, optional
See :func:`~imgaug.augmenters.size.PadToAspectRatio.__init__`.
deterministic : bool, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
random_state : None or int or imgaug.random.RNG or numpy.random.Generator or numpy.random.BitGenerator or numpy.random.SeedSequence or numpy.random.RandomState, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
Examples
--------
>>> import imgaug.augmenters as iaa
>>> aug = iaa.PadToAspectRatio(2.0)
Create am augmenter that pads each image until its aspect ratio is as
close as possible to ``2.0`` (i.e. two times as many pixels along the
x-axis than the y-axis).
The rows to be padded will be spread *equally* over the top and bottom
sides (analogous for the left/right sides).
"""
def __init__(self, aspect_ratio, pad_mode="constant", pad_cval=0,
seed=None, name=None, **old_kwargs):
super(CenterPadToAspectRatio, self).__init__(
aspect_ratio=aspect_ratio, position="center",
pad_mode=pad_mode, pad_cval=pad_cval,
seed=seed, name=name, **old_kwargs)
class CropToSquare(CropToAspectRatio):
"""Crop images until their width and height are identical.
This is identical to :class:`~imgaug.augmenters.size.CropToAspectRatio`
with ``aspect_ratio=1.0``.
Images with axis sizes of ``0`` will not be altered.
Supported dtypes
----------------
See :class:`~imgaug.augmenters.size.CropToFixedSize`.
Parameters
----------
position : {'uniform', 'normal', 'center', 'left-top', 'left-center', 'left-bottom', 'center-top', 'center-center', 'center-bottom', 'right-top', 'right-center', 'right-bottom'} or tuple of float or StochasticParameter or tuple of StochasticParameter, optional
See :func:`CropToFixedSize.__init__`.
seed : None or int or imgaug.random.RNG or numpy.random.Generator or numpy.random.BitGenerator or numpy.random.SeedSequence or numpy.random.RandomState, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
name : None or str, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
**old_kwargs
Outdated parameters. Avoid using these.
Examples
--------
>>> import imgaug.augmenters as iaa
>>> aug = iaa.CropToSquare()
Create an augmenter that crops each image until its square, i.e. height
and width match.
The rows to be cropped will be spread *randomly* over the top and bottom
sides (analogous for the left/right sides).
"""
def __init__(self, position="uniform",
seed=None, name=None, **old_kwargs):
super(CropToSquare, self).__init__(
aspect_ratio=1.0, position=position,
seed=seed, name=name, **old_kwargs)
class CenterCropToSquare(CropToSquare):
"""Crop images equally on all sides until their height/width are identical.
In contrast to :class:`~imgaug.augmenters.size.CropToSquare`, this
augmenter always tries to spread the columns/rows to remove equally over
both sides of the respective axis to be cropped.
:class:`~imgaug.augmenters.size.CropToAspectRatio` by default spreads the
croppings randomly.
This augmenter is identical to :class:`~imgaug.augmenters.size.CropToSquare`
with ``position="center"``, and thereby the same as
:class:`~imgaug.augmenters.size.CropToAspectRatio` with
``aspect_ratio=1.0, position="center"``.
Images with axis sizes of ``0`` will not be altered.
Supported dtypes
----------------
See :class:`~imgaug.augmenters.size.CropToFixedSize`.
Parameters
----------
seed : None or int or imgaug.random.RNG or numpy.random.Generator or numpy.random.BitGenerator or numpy.random.SeedSequence or numpy.random.RandomState, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
name : None or str, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
**old_kwargs
Outdated parameters. Avoid using these.
Examples
--------
>>> import imgaug.augmenters as iaa
>>> aug = iaa.CenterCropToSquare()
Create an augmenter that crops each image until its square, i.e. height
and width match.
The rows to be cropped will be spread *equally* over the top and bottom
sides (analogous for the left/right sides).
"""
def __init__(self, seed=None, name=None, **old_kwargs):
super(CenterCropToSquare, self).__init__(
position="center",
seed=seed, name=name, **old_kwargs)
class PadToSquare(PadToAspectRatio):
"""Pad images until their height and width are identical.
This augmenter is identical to
:class:`~imgaug.augmenters.size.PadToAspectRatio` with ``aspect_ratio=1.0``.
Supported dtypes
----------------
See :class:`~imgaug.augmenters.size.PadToFixedSize`.
Parameters
----------
position : {'uniform', 'normal', 'center', 'left-top', 'left-center', 'left-bottom', 'center-top', 'center-center', 'center-bottom', 'right-top', 'right-center', 'right-bottom'} or tuple of float or StochasticParameter or tuple of StochasticParameter, optional
See :func:`PadToFixedSize.__init__`.
pad_mode : imgaug.ALL or str or list of str or imgaug.parameters.StochasticParameter, optional
See :func:`~imgaug.augmenters.size.PadToFixedSize.__init__`.
pad_cval : number or tuple of number or list of number or imgaug.parameters.StochasticParameter, optional
See :func:`~imgaug.augmenters.size.PadToFixedSize.__init__`.
seed : None or int or imgaug.random.RNG or numpy.random.Generator or numpy.random.BitGenerator or numpy.random.SeedSequence or numpy.random.RandomState, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
name : None or str, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
**old_kwargs
Outdated parameters. Avoid using these.
Examples
--------
>>> import imgaug.augmenters as iaa
>>> aug = iaa.PadToSquare()
Create an augmenter that pads each image until its square, i.e. height
and width match.
The rows to be padded will be spread *randomly* over the top and bottom
sides (analogous for the left/right sides).
"""
def __init__(self, pad_mode="constant", pad_cval=0, position="uniform",
seed=None, name=None, **old_kwargs):
super(PadToSquare, self).__init__(
aspect_ratio=1.0, pad_mode=pad_mode, pad_cval=pad_cval,
position=position,
seed=seed, name=name, **old_kwargs)
class CenterPadToSquare(PadToSquare):
"""Pad images equally on all sides until their height & width are identical.
This is the same as :class:`~imgaug.augmenters.size.PadToSquare`, but uses
``position="center"`` by default, which spreads the pad amounts equally
over all image sides, while :class:`~imgaug.augmenters.size.PadToSquare`
by default spreads them randomly. This augmenter is thus also identical to
:class:`~imgaug.augmenters.size.PadToAspectRatio` with
``aspect_ratio=1.0, position="center"``.
Supported dtypes
----------------
See :class:`~imgaug.augmenters.size.PadToFixedSize`.
Parameters
----------
name : None or str, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
pad_mode : imgaug.ALL or str or list of str or imgaug.parameters.StochasticParameter, optional
See :func:`~imgaug.augmenters.size.PadToAspectRatio.__init__`.
pad_cval : number or tuple of number or list of number or imgaug.parameters.StochasticParameter, optional
See :func:`~imgaug.augmenters.size.PadToAspectRatio.__init__`.
deterministic : bool, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
random_state : None or int or imgaug.random.RNG or numpy.random.Generator or numpy.random.BitGenerator or numpy.random.SeedSequence or numpy.random.RandomState, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
Examples
--------
>>> import imgaug.augmenters as iaa
>>> aug = iaa.CenterPadToSquare()
Create an augmenter that pads each image until its square, i.e. height
and width match.
The rows to be padded will be spread *equally* over the top and bottom
sides (analogous for the left/right sides).
"""
def __init__(self, pad_mode="constant", pad_cval=0,
seed=None, name=None, **old_kwargs):
super(CenterPadToSquare, self).__init__(
pad_mode=pad_mode, pad_cval=pad_cval, position="center",
seed=seed, name=name, **old_kwargs)
class KeepSizeByResize(meta.Augmenter):
"""Resize images back to their input sizes after applying child augmenters.
Combining this with e.g. a cropping augmenter as the child will lead to
images being resized back to the input size after the crop operation was
applied. Some augmenters have a ``keep_size`` argument that achieves the
same goal (if set to ``True``), though this augmenter offers control over
the interpolation mode and which augmentables to resize (images, heatmaps,
segmentation maps).
Supported dtypes
----------------
See :func:`~imgaug.imgaug.imresize_many_images`.
Parameters
----------
children : Augmenter or list of imgaug.augmenters.meta.Augmenter or None, optional
One or more augmenters to apply to images. These augmenters may change
the image size.
interpolation : KeepSizeByResize.NO_RESIZE or {'nearest', 'linear', 'area', 'cubic'} or {cv2.INTER_NEAREST, cv2.INTER_LINEAR, cv2.INTER_AREA, cv2.INTER_CUBIC} or list of str or list of int or StochasticParameter, optional
The interpolation mode to use when resizing images.
Can take any value that :func:`~imgaug.imgaug.imresize_single_image`
accepts, e.g. ``cubic``.
* If this is ``KeepSizeByResize.NO_RESIZE`` then images will not
be resized.
* If this is a single ``str``, it is expected to have one of the
following values: ``nearest``, ``linear``, ``area``, ``cubic``.
* If this is a single integer, it is expected to have a value
identical to one of: ``cv2.INTER_NEAREST``,
``cv2.INTER_LINEAR``, ``cv2.INTER_AREA``, ``cv2.INTER_CUBIC``.
* If this is a ``list`` of ``str`` or ``int``, it is expected that
each ``str``/``int`` is one of the above mentioned valid ones.
A random one of these values will be sampled per image.
* If this is a ``StochasticParameter``, it will be queried once per
call to ``_augment_images()`` and must return ``N`` ``str`` s or
``int`` s (matching the above mentioned ones) for ``N`` images.
interpolation_heatmaps : KeepSizeByResize.SAME_AS_IMAGES or KeepSizeByResize.NO_RESIZE or {'nearest', 'linear', 'area', 'cubic'} or {cv2.INTER_NEAREST, cv2.INTER_LINEAR, cv2.INTER_AREA, cv2.INTER_CUBIC} or list of str or list of int or StochasticParameter, optional
The interpolation mode to use when resizing heatmaps.
Meaning and valid values are similar to `interpolation`. This
parameter may also take the value ``KeepSizeByResize.SAME_AS_IMAGES``,
which will lead to copying the interpolation modes used for the
corresponding images. The value may also be returned on a per-image
basis if `interpolation_heatmaps` is provided as a
``StochasticParameter`` or may be one possible value if it is
provided as a ``list`` of ``str``.
interpolation_segmaps : KeepSizeByResize.SAME_AS_IMAGES or KeepSizeByResize.NO_RESIZE or {'nearest', 'linear', 'area', 'cubic'} or {cv2.INTER_NEAREST, cv2.INTER_LINEAR, cv2.INTER_AREA, cv2.INTER_CUBIC} or list of str or list of int or StochasticParameter, optional
The interpolation mode to use when resizing segmentation maps.
Similar to `interpolation_heatmaps`.
**Note**: For segmentation maps, only ``NO_RESIZE`` or nearest
neighbour interpolation (i.e. ``nearest``) make sense in the vast
majority of all cases.
seed : None or int or imgaug.random.RNG or numpy.random.Generator or numpy.random.BitGenerator or numpy.random.SeedSequence or numpy.random.RandomState, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
name : None or str, optional
See :func:`~imgaug.augmenters.meta.Augmenter.__init__`.
**old_kwargs
Outdated parameters. Avoid using these.
Examples
--------
>>> import imgaug.augmenters as iaa
>>> aug = iaa.KeepSizeByResize(
>>> iaa.Crop((20, 40), keep_size=False)
>>> )
Apply random cropping to input images, then resize them back to their
original input sizes. The resizing is done using this augmenter instead
of the corresponding internal resizing operation in ``Crop``.
>>> aug = iaa.KeepSizeByResize(
>>> iaa.Crop((20, 40), keep_size=False),
>>> interpolation="nearest"
>>> )
Same as in the previous example, but images are now always resized using
nearest neighbour interpolation.
>>> aug = iaa.KeepSizeByResize(
>>> iaa.Crop((20, 40), keep_size=False),
>>> interpolation=["nearest", "cubic"],
>>> interpolation_heatmaps=iaa.KeepSizeByResize.SAME_AS_IMAGES,
>>> interpolation_segmaps=iaa.KeepSizeByResize.NO_RESIZE
>>> )
Similar to the previous example, but images are now sometimes resized
using linear interpolation and sometimes using nearest neighbour
interpolation. Heatmaps are resized using the same interpolation as was
used for the corresponding image. Segmentation maps are not resized and
will therefore remain at their size after cropping.
"""
NO_RESIZE = "NO_RESIZE"
SAME_AS_IMAGES = "SAME_AS_IMAGES"
def __init__(self, children,
interpolation="cubic",
interpolation_heatmaps=SAME_AS_IMAGES,
interpolation_segmaps="nearest",
seed=None, name=None, **old_kwargs):
super(KeepSizeByResize, self).__init__(
seed=seed, name=name, **old_kwargs)
self.children = children
def _validate_param(val, allow_same_as_images):
valid_ips_and_resize = ia.IMRESIZE_VALID_INTERPOLATIONS \
+ [KeepSizeByResize.NO_RESIZE]
if allow_same_as_images and val == self.SAME_AS_IMAGES:
return self.SAME_AS_IMAGES
if val in valid_ips_and_resize:
return iap.Deterministic(val)
if isinstance(val, list):
assert len(val) > 0, (
"Expected a list of at least one interpolation method. "
"Got an empty list.")
valid_ips_here = valid_ips_and_resize
if allow_same_as_images:
valid_ips_here = valid_ips_here \
+ [KeepSizeByResize.SAME_AS_IMAGES]
only_valid_ips = all([ip in valid_ips_here for ip in val])
assert only_valid_ips, (
"Expected each interpolations to be one of '%s', got "
"'%s'." % (str(valid_ips_here), str(val)))
return iap.Choice(val)
if isinstance(val, iap.StochasticParameter):
return val
raise Exception(
"Expected interpolation to be one of '%s' or a list of "
"these values or a StochasticParameter. Got type %s." % (
str(ia.IMRESIZE_VALID_INTERPOLATIONS), type(val)))
self.children = meta.handle_children_list(children, self.name, "then")
self.interpolation = _validate_param(interpolation, False)
self.interpolation_heatmaps = _validate_param(interpolation_heatmaps,
True)
self.interpolation_segmaps = _validate_param(interpolation_segmaps,
True)
def _augment_batch_(self, batch, random_state, parents, hooks):
with batch.propagation_hooks_ctx(self, hooks, parents):
images_were_array = None
if batch.images is not None:
images_were_array = ia.is_np_array(batch.images)
shapes_orig = self._get_shapes(batch)
samples = self._draw_samples(batch.nb_rows, random_state)
batch = self.children.augment_batch_(
batch, parents=parents + [self], hooks=hooks)
if batch.images is not None:
batch.images = self._keep_size_images(
batch.images, shapes_orig["images"], images_were_array,
samples)
if batch.heatmaps is not None:
# dont use shapes_orig["images"] because they might be None
batch.heatmaps = self._keep_size_maps(
batch.heatmaps, shapes_orig["heatmaps"],
shapes_orig["heatmaps_arr"], samples[1])
if batch.segmentation_maps is not None:
# dont use shapes_orig["images"] because they might be None
batch.segmentation_maps = self._keep_size_maps(
batch.segmentation_maps, shapes_orig["segmentation_maps"],
shapes_orig["segmentation_maps_arr"], samples[2])
for augm_name in ["keypoints", "bounding_boxes", "polygons",
"line_strings"]:
augm_value = getattr(batch, augm_name)
if augm_value is not None:
func = functools.partial(
self._keep_size_keypoints,
shapes_orig=shapes_orig[augm_name],
interpolations=samples[0])
cbaois = self._apply_to_cbaois_as_keypoints(augm_value,
func)
setattr(batch, augm_name, cbaois)
return batch
@classmethod
def _keep_size_images(cls, images, shapes_orig, images_were_array,
samples):
interpolations, _, _ = samples
gen = zip(images, interpolations, shapes_orig)
result = []
for image, interpolation, input_shape in gen:
if interpolation == KeepSizeByResize.NO_RESIZE:
result.append(image)
else:
result.append(
ia.imresize_single_image(image, input_shape[0:2],
interpolation))
if images_were_array:
# note here that NO_RESIZE can have led to different shapes
nb_shapes = len({image.shape for image in result})
if nb_shapes == 1:
result = np.array(result, dtype=images.dtype)
return result
@classmethod
def _keep_size_maps(cls, augmentables, shapes_orig_images,
shapes_orig_arrs, interpolations):
result = []
gen = zip(augmentables, interpolations,
shapes_orig_arrs, shapes_orig_images)
for augmentable, interpolation, arr_shape_orig, img_shape_orig in gen:
if interpolation == "NO_RESIZE":
result.append(augmentable)
else:
augmentable = augmentable.resize(
arr_shape_orig[0:2], interpolation=interpolation)
augmentable.shape = img_shape_orig
result.append(augmentable)
return result
@classmethod
def _keep_size_keypoints(cls, kpsois_aug, shapes_orig, interpolations):
result = []
gen = zip(kpsois_aug, interpolations, shapes_orig)
for kpsoi_aug, interpolation, input_shape in gen:
if interpolation == KeepSizeByResize.NO_RESIZE:
result.append(kpsoi_aug)
else:
result.append(kpsoi_aug.on_(input_shape))
return result
@classmethod
def _get_shapes(cls, batch):
result = dict()
for column in batch.columns:
result[column.name] = [cell.shape for cell in column.value]
if batch.heatmaps is not None:
result["heatmaps_arr"] = [
cell.arr_0to1.shape for cell in batch.heatmaps]
if batch.segmentation_maps is not None:
result["segmentation_maps_arr"] = [
cell.arr.shape for cell in batch.segmentation_maps]
return result
def _draw_samples(self, nb_images, random_state):
rngs = random_state.duplicate(3)
interpolations = self.interpolation.draw_samples((nb_images,),
random_state=rngs[0])
if self.interpolation_heatmaps == KeepSizeByResize.SAME_AS_IMAGES:
interpolations_heatmaps = np.copy(interpolations)
else:
interpolations_heatmaps = self.interpolation_heatmaps.draw_samples(
(nb_images,), random_state=rngs[1]
)
# Note that `interpolations_heatmaps == self.SAME_AS_IMAGES`
# works here only if the datatype of the array is such that it
# may contain strings. It does not work properly for e.g.
# integer arrays and will produce a single bool output, even
# for arrays with more than one entry.
same_as_imgs_idx = [ip == self.SAME_AS_IMAGES
for ip in interpolations_heatmaps]
interpolations_heatmaps[same_as_imgs_idx] = \
interpolations[same_as_imgs_idx]
if self.interpolation_segmaps == KeepSizeByResize.SAME_AS_IMAGES:
interpolations_segmaps = np.copy(interpolations)
else:
# TODO This used previously the same seed as the heatmaps part
# leading to the same sampled values. Was that intentional?
# Doesn't look like it should be that way.
interpolations_segmaps = self.interpolation_segmaps.draw_samples(
(nb_images,), random_state=rngs[2]
)
# Note that `interpolations_heatmaps == self.SAME_AS_IMAGES`
# works here only if the datatype of the array is such that it
# may contain strings. It does not work properly for e.g.
# integer arrays and will produce a single bool output, even
# for arrays with more than one entry.
same_as_imgs_idx = [ip == self.SAME_AS_IMAGES
for ip in interpolations_segmaps]
interpolations_segmaps[same_as_imgs_idx] = \
interpolations[same_as_imgs_idx]
return interpolations, interpolations_heatmaps, interpolations_segmaps
def _to_deterministic(self):
aug = self.copy()
aug.children = aug.children.to_deterministic()
aug.deterministic = True
aug.random_state = self.random_state.derive_rng_()
return aug
def get_parameters(self):
"""See :func:`~imgaug.augmenters.meta.Augmenter.get_parameters`."""
return [self.interpolation, self.interpolation_heatmaps]
def get_children_lists(self):
"""See :func:`~imgaug.augmenters.meta.Augmenter.get_children_lists`."""
return [self.children]
def __str__(self):
pattern = (
"%s("
"interpolation=%s, "
"interpolation_heatmaps=%s, "
"name=%s, "
"children=%s, "
"deterministic=%s"
")")
return pattern % (
self.__class__.__name__, self.interpolation,
self.interpolation_heatmaps, self.name, self.children,
self.deterministic)
| 41.498806 | 269 | 0.610104 | from __future__ import print_function, division, absolute_import
import re
import functools
import numpy as np
import cv2
import imgaug as ia
from imgaug.imgaug import _normalize_cv2_input_arr_
from . import meta
from .. import parameters as iap
def _crop_trbl_to_xyxy(shape, top, right, bottom, left, prevent_zero_size=True):
if prevent_zero_size:
top, right, bottom, left = _crop_prevent_zero_size(
shape[0], shape[1], top, right, bottom, left)
height, width = shape[0:2]
x1 = left
x2 = width - right
y1 = top
y2 = height - bottom
x2 = max(x2, x1)
y2 = max(y2, y1)
return x1, y1, x2, y2
def _crop_arr_(arr, top, right, bottom, left, prevent_zero_size=True):
x1, y1, x2, y2 = _crop_trbl_to_xyxy(arr.shape, top, right, bottom, left,
prevent_zero_size=prevent_zero_size)
return arr[y1:y2, x1:x2, ...]
def _crop_and_pad_arr(arr, croppings, paddings, pad_mode="constant",
pad_cval=0, keep_size=False):
height, width = arr.shape[0:2]
image_cr = _crop_arr_(arr, *croppings)
image_cr_pa = pad(
image_cr,
top=paddings[0], right=paddings[1],
bottom=paddings[2], left=paddings[3],
mode=pad_mode, cval=pad_cval)
if keep_size:
image_cr_pa = ia.imresize_single_image(image_cr_pa, (height, width))
return image_cr_pa
def _crop_and_pad_heatmap_(heatmap, croppings_img, paddings_img,
pad_mode="constant", pad_cval=0.0, keep_size=False):
return _crop_and_pad_hms_or_segmaps_(heatmap, croppings_img,
paddings_img, pad_mode, pad_cval,
keep_size)
def _crop_and_pad_segmap_(segmap, croppings_img, paddings_img,
pad_mode="constant", pad_cval=0, keep_size=False):
return _crop_and_pad_hms_or_segmaps_(segmap, croppings_img,
paddings_img, pad_mode, pad_cval,
keep_size)
def _crop_and_pad_hms_or_segmaps_(augmentable, croppings_img,
paddings_img, pad_mode="constant",
pad_cval=None, keep_size=False):
if isinstance(augmentable, ia.HeatmapsOnImage):
arr_attr_name = "arr_0to1"
pad_cval = pad_cval if pad_cval is not None else 0.0
else:
assert isinstance(augmentable, ia.SegmentationMapsOnImage), (
"Expected HeatmapsOnImage or SegmentationMapsOnImage, got %s." % (
type(augmentable)))
arr_attr_name = "arr"
pad_cval = pad_cval if pad_cval is not None else 0
arr = getattr(augmentable, arr_attr_name)
arr_shape_orig = arr.shape
augm_shape = augmentable.shape
croppings_proj = _project_size_changes(croppings_img, augm_shape, arr.shape)
paddings_proj = _project_size_changes(paddings_img, augm_shape, arr.shape)
croppings_proj = _crop_prevent_zero_size(arr.shape[0], arr.shape[1],
*croppings_proj)
arr_cr = _crop_arr_(arr,
croppings_proj[0], croppings_proj[1],
croppings_proj[2], croppings_proj[3])
arr_cr_pa = pad(
arr_cr,
top=paddings_proj[0], right=paddings_proj[1],
bottom=paddings_proj[2], left=paddings_proj[3],
mode=pad_mode,
cval=pad_cval)
setattr(augmentable, arr_attr_name, arr_cr_pa)
if keep_size:
augmentable = augmentable.resize(arr_shape_orig[0:2])
else:
augmentable.shape = _compute_shape_after_crop_and_pad(
augmentable.shape, croppings_img, paddings_img)
return augmentable
def _crop_and_pad_kpsoi_(kpsoi, croppings_img, paddings_img, keep_size):
x1, y1, _x2, _y2 = _crop_trbl_to_xyxy(kpsoi.shape, *croppings_img)
crop_left = x1
crop_top = y1
shape_orig = kpsoi.shape
shifted = kpsoi.shift_(
x=-crop_left+paddings_img[3],
y=-crop_top+paddings_img[0])
shifted.shape = _compute_shape_after_crop_and_pad(
shape_orig, croppings_img, paddings_img)
if keep_size:
shifted = shifted.on_(shape_orig)
return shifted
def _compute_shape_after_crop_and_pad(old_shape, croppings, paddings):
x1, y1, x2, y2 = _crop_trbl_to_xyxy(old_shape, *croppings)
new_shape = list(old_shape)
new_shape[0] = y2 - y1 + paddings[0] + paddings[2]
new_shape[1] = x2 - x1 + paddings[1] + paddings[3]
return tuple(new_shape)
def _crop_prevent_zero_size(height, width, crop_top, crop_right, crop_bottom,
crop_left):
remaining_height = height - (crop_top + crop_bottom)
remaining_width = width - (crop_left + crop_right)
if remaining_height < 1:
regain = abs(remaining_height) + 1
regain_top = regain // 2
regain_bottom = regain // 2
if regain_top + regain_bottom < regain:
regain_top += 1
if regain_top > crop_top:
diff = regain_top - crop_top
regain_top = crop_top
regain_bottom += diff
elif regain_bottom > crop_bottom:
diff = regain_bottom - crop_bottom
regain_bottom = crop_bottom
regain_top += diff
crop_top = crop_top - regain_top
crop_bottom = crop_bottom - regain_bottom
if remaining_width < 1:
regain = abs(remaining_width) + 1
regain_right = regain // 2
regain_left = regain // 2
if regain_right + regain_left < regain:
regain_right += 1
if regain_right > crop_right:
diff = regain_right - crop_right
regain_right = crop_right
regain_left += diff
elif regain_left > crop_left:
diff = regain_left - crop_left
regain_left = crop_left
regain_right += diff
crop_right = crop_right - regain_right
crop_left = crop_left - regain_left
return (
max(crop_top, 0), max(crop_right, 0), max(crop_bottom, 0),
max(crop_left, 0))
def _project_size_changes(trbl, from_shape, to_shape):
if from_shape[0:2] == to_shape[0:2]:
return trbl
height_to = to_shape[0]
width_to = to_shape[1]
height_from = from_shape[0]
width_from = from_shape[1]
top = trbl[0]
right = trbl[1]
bottom = trbl[2]
left = trbl[3]
top = _int_r(height_to * (top/height_from) - 1e-4)
right = _int_r(width_to * (right/width_from) + 1e-4)
bottom = _int_r(height_to * (bottom/height_from) + 1e-4)
left = _int_r(width_to * (left/width_from) - 1e-4)
return top, right, bottom, left
def _int_r(value):
return int(np.round(value))
def _handle_pad_mode_param(pad_mode):
pad_modes_available = {
"constant", "edge", "linear_ramp", "maximum", "mean", "median",
"minimum", "reflect", "symmetric", "wrap"}
if pad_mode == ia.ALL:
return iap.Choice(list(pad_modes_available))
if ia.is_string(pad_mode):
assert pad_mode in pad_modes_available, (
"Value '%s' is not a valid pad mode. Valid pad modes are: %s." % (
pad_mode, ", ".join(pad_modes_available)))
return iap.Deterministic(pad_mode)
if isinstance(pad_mode, list):
assert all([v in pad_modes_available for v in pad_mode]), (
"At least one in list %s is not a valid pad mode. Valid pad "
"modes are: %s." % (str(pad_mode), ", ".join(pad_modes_available)))
return iap.Choice(pad_mode)
if isinstance(pad_mode, iap.StochasticParameter):
return pad_mode
raise Exception(
"Expected pad_mode to be ia.ALL or string or list of strings or "
"StochasticParameter, got %s." % (type(pad_mode),))
def _handle_position_parameter(position):
if position == "uniform":
return iap.Uniform(0.0, 1.0), iap.Uniform(0.0, 1.0)
if position == "normal":
return (
iap.Clip(iap.Normal(loc=0.5, scale=0.35 / 2),
minval=0.0, maxval=1.0),
iap.Clip(iap.Normal(loc=0.5, scale=0.35 / 2),
minval=0.0, maxval=1.0)
)
if position == "center":
return iap.Deterministic(0.5), iap.Deterministic(0.5)
if (ia.is_string(position)
and re.match(r"^(left|center|right)-(top|center|bottom)$",
position)):
mapping = {"top": 0.0, "center": 0.5, "bottom": 1.0, "left": 0.0,
"right": 1.0}
return (
iap.Deterministic(mapping[position.split("-")[0]]),
iap.Deterministic(mapping[position.split("-")[1]])
)
if isinstance(position, iap.StochasticParameter):
return position
if isinstance(position, tuple):
assert len(position) == 2, (
"Expected tuple with two entries as position parameter. "
"Got %d entries with types %s.." % (
len(position), str([type(item) for item in position])))
for item in position:
if ia.is_single_number(item) and (item < 0 or item > 1.0):
raise Exception(
"Both position values must be within the value range "
"[0.0, 1.0]. Got type %s with value %.8f." % (
type(item), item,))
position = [iap.Deterministic(item)
if ia.is_single_number(item)
else item for item in position]
only_sparams = all([isinstance(item, iap.StochasticParameter)
for item in position])
assert only_sparams, (
"Expected tuple with two entries that are both either "
"StochasticParameter or float/int. Got types %s." % (
str([type(item) for item in position])
))
return tuple(position)
raise Exception(
"Expected one of the following as position parameter: string "
"'uniform', string 'normal', string 'center', a string matching "
"regex ^(left|center|right)-(top|center|bottom)$, a single "
"StochasticParameter or a tuple of two entries, both being either "
"StochasticParameter or floats or int. Got instead type %s with "
"content '%s'." % (
type(position),
(str(position)
if len(str(position)) < 20
else str(position)[0:20] + "...")
)
)
def _assert_two_or_three_dims(shape):
if hasattr(shape, "shape"):
shape = shape.shape
assert len(shape) in [2, 3], (
"Expected image with two or three dimensions, but got %d dimensions "
"and shape %s." % (len(shape), shape))
def pad(arr, top=0, right=0, bottom=0, left=0, mode="constant", cval=0):
import imgaug.dtypes as iadt
_assert_two_or_three_dims(arr)
assert all([v >= 0 for v in [top, right, bottom, left]]), (
"Expected padding amounts that are >=0, but got %d, %d, %d, %d "
"(top, right, bottom, left)" % (top, right, bottom, left))
is_multi_cval = ia.is_iterable(cval)
if top > 0 or right > 0 or bottom > 0 or left > 0:
min_value, _, max_value = iadt.get_value_range_of_dtype(arr.dtype)
if arr.dtype.name == "float128":
cval = np.float128(cval)
if is_multi_cval:
cval = np.clip(cval, min_value, max_value)
else:
cval = max(min(cval, max_value), min_value)
has_zero_sized_axis = any([axis == 0 for axis in arr.shape])
if has_zero_sized_axis:
mode = "constant"
mapping_mode_np_to_cv2 = {
"constant": cv2.BORDER_CONSTANT,
"edge": cv2.BORDER_REPLICATE,
"linear_ramp": None,
"maximum": None,
"mean": None,
"median": None,
"minimum": None,
"reflect": cv2.BORDER_REFLECT_101,
"symmetric": cv2.BORDER_REFLECT,
"wrap": None,
cv2.BORDER_CONSTANT: cv2.BORDER_CONSTANT,
cv2.BORDER_REPLICATE: cv2.BORDER_REPLICATE,
cv2.BORDER_REFLECT_101: cv2.BORDER_REFLECT_101,
cv2.BORDER_REFLECT: cv2.BORDER_REFLECT
}
bad_mode_cv2 = mapping_mode_np_to_cv2.get(mode, None) is None
# is not supported" error
bad_datatype_cv2 = (
arr.dtype.name
in ["uint32", "uint64", "int64", "float16", "float128", "bool"]
)
bad_shape_cv2 = (arr.ndim == 3 and arr.shape[-1] == 0)
if not bad_datatype_cv2 and not bad_mode_cv2 and not bad_shape_cv2:
kind = arr.dtype.kind
if is_multi_cval:
cval = [float(cval_c) if kind == "f" else int(cval_c)
for cval_c in cval]
else:
cval = float(cval) if kind == "f" else int(cval)
if arr.ndim == 2 or arr.shape[2] <= 4:
if arr.ndim == 3 and not is_multi_cval:
cval = tuple([cval] * arr.shape[2])
arr_pad = cv2.copyMakeBorder(
_normalize_cv2_input_arr_(arr),
top=top, bottom=bottom, left=left, right=right,
borderType=mapping_mode_np_to_cv2[mode], value=cval)
if arr.ndim == 3 and arr_pad.ndim == 2:
arr_pad = arr_pad[..., np.newaxis]
else:
result = []
channel_start_idx = 0
cval = cval if is_multi_cval else tuple([cval] * arr.shape[2])
while channel_start_idx < arr.shape[2]:
arr_c = arr[..., channel_start_idx:channel_start_idx+4]
cval_c = cval[channel_start_idx:channel_start_idx+4]
arr_pad_c = cv2.copyMakeBorder(
_normalize_cv2_input_arr_(arr_c),
top=top, bottom=bottom, left=left, right=right,
borderType=mapping_mode_np_to_cv2[mode], value=cval_c)
arr_pad_c = np.atleast_3d(arr_pad_c)
result.append(arr_pad_c)
channel_start_idx += 4
arr_pad = np.concatenate(result, axis=2)
else:
paddings_np = [(top, bottom), (left, right)]
if arr.ndim == 3:
paddings_np.append((0, 0))
if mode == "constant":
if arr.ndim > 2 and is_multi_cval:
arr_pad_chans = [
np.pad(arr[..., c], paddings_np[0:2], mode=mode,
constant_values=cval[c])
for c in np.arange(arr.shape[2])]
arr_pad = np.stack(arr_pad_chans, axis=-1)
else:
arr_pad = np.pad(arr, paddings_np, mode=mode,
constant_values=cval)
elif mode == "linear_ramp":
if arr.ndim > 2 and is_multi_cval:
arr_pad_chans = [
np.pad(arr[..., c], paddings_np[0:2], mode=mode,
end_values=cval[c])
for c in np.arange(arr.shape[2])]
arr_pad = np.stack(arr_pad_chans, axis=-1)
else:
arr_pad = np.pad(arr, paddings_np, mode=mode,
end_values=cval)
else:
arr_pad = np.pad(arr, paddings_np, mode=mode)
return arr_pad
return np.copy(arr)
def pad_to_aspect_ratio(arr, aspect_ratio, mode="constant", cval=0,
return_pad_amounts=False):
pad_top, pad_right, pad_bottom, pad_left = \
compute_paddings_to_reach_aspect_ratio(arr, aspect_ratio)
arr_padded = pad(
arr,
top=pad_top,
right=pad_right,
bottom=pad_bottom,
left=pad_left,
mode=mode,
cval=cval
)
if return_pad_amounts:
return arr_padded, (pad_top, pad_right, pad_bottom, pad_left)
return arr_padded
def pad_to_multiples_of(arr, height_multiple, width_multiple, mode="constant",
cval=0, return_pad_amounts=False):
pad_top, pad_right, pad_bottom, pad_left = \
compute_paddings_to_reach_multiples_of(
arr, height_multiple, width_multiple)
arr_padded = pad(
arr,
top=pad_top,
right=pad_right,
bottom=pad_bottom,
left=pad_left,
mode=mode,
cval=cval
)
if return_pad_amounts:
return arr_padded, (pad_top, pad_right, pad_bottom, pad_left)
return arr_padded
def compute_paddings_to_reach_aspect_ratio(arr, aspect_ratio):
_assert_two_or_three_dims(arr)
assert aspect_ratio > 0, (
"Expected to get an aspect ratio >0, got %.4f." % (aspect_ratio,))
pad_top = 0
pad_right = 0
pad_bottom = 0
pad_left = 0
shape = arr.shape if hasattr(arr, "shape") else arr
height, width = shape[0:2]
if height == 0:
height = 1
pad_bottom += 1
if width == 0:
width = 1
pad_right += 1
aspect_ratio_current = width / height
if aspect_ratio_current < aspect_ratio:
diff = (aspect_ratio * height) - width
pad_right += int(np.ceil(diff / 2))
pad_left += int(np.floor(diff / 2))
elif aspect_ratio_current > aspect_ratio:
diff = ((1/aspect_ratio) * width) - height
pad_top += int(np.floor(diff / 2))
pad_bottom += int(np.ceil(diff / 2))
return pad_top, pad_right, pad_bottom, pad_left
def compute_croppings_to_reach_aspect_ratio(arr, aspect_ratio):
_assert_two_or_three_dims(arr)
assert aspect_ratio > 0, (
"Expected to get an aspect ratio >0, got %.4f." % (aspect_ratio,))
shape = arr.shape if hasattr(arr, "shape") else arr
assert shape[0] > 0, (
"Expected to get an array with height >0, got shape %s." % (shape,))
height, width = shape[0:2]
aspect_ratio_current = width / height
top = 0
right = 0
bottom = 0
left = 0
if aspect_ratio_current < aspect_ratio:
crop_amount = height - (width / aspect_ratio)
crop_amount = min(crop_amount, height - 1)
top = int(np.floor(crop_amount / 2))
bottom = int(np.ceil(crop_amount / 2))
elif aspect_ratio_current > aspect_ratio:
crop_amount = width - height * aspect_ratio
crop_amount = min(crop_amount, width - 1)
left = int(np.floor(crop_amount / 2))
right = int(np.ceil(crop_amount / 2))
return top, right, bottom, left
def compute_paddings_to_reach_multiples_of(arr, height_multiple,
width_multiple):
def _compute_axis_value(axis_size, multiple):
if multiple is None:
return 0, 0
if axis_size == 0:
to_pad = multiple
elif axis_size % multiple == 0:
to_pad = 0
else:
to_pad = multiple - (axis_size % multiple)
return int(np.floor(to_pad/2)), int(np.ceil(to_pad/2))
_assert_two_or_three_dims(arr)
if height_multiple is not None:
assert height_multiple > 0, (
"Can only pad to multiples of 1 or larger, got %d." % (
height_multiple,))
if width_multiple is not None:
assert width_multiple > 0, (
"Can only pad to multiples of 1 or larger, got %d." % (
width_multiple,))
shape = arr.shape if hasattr(arr, "shape") else arr
height, width = shape[0:2]
top, bottom = _compute_axis_value(height, height_multiple)
left, right = _compute_axis_value(width, width_multiple)
return top, right, bottom, left
def compute_croppings_to_reach_multiples_of(arr, height_multiple,
width_multiple):
def _compute_axis_value(axis_size, multiple):
if multiple is None:
return 0, 0
if axis_size == 0:
to_crop = 0
elif axis_size % multiple == 0:
to_crop = 0
else:
to_crop = axis_size % multiple
return int(np.floor(to_crop/2)), int(np.ceil(to_crop/2))
_assert_two_or_three_dims(arr)
if height_multiple is not None:
assert height_multiple > 0, (
"Can only crop to multiples of 1 or larger, got %d." % (
height_multiple,))
if width_multiple is not None:
assert width_multiple > 0, (
"Can only crop to multiples of 1 or larger, got %d." % (
width_multiple,))
shape = arr.shape if hasattr(arr, "shape") else arr
height, width = shape[0:2]
top, bottom = _compute_axis_value(height, height_multiple)
left, right = _compute_axis_value(width, width_multiple)
return top, right, bottom, left
def compute_paddings_to_reach_powers_of(arr, height_base, width_base,
allow_zero_exponent=False):
def _compute_axis_value(axis_size, base):
if base is None:
return 0, 0
if axis_size == 0:
to_pad = 1 if allow_zero_exponent else base
elif axis_size <= base:
to_pad = base - axis_size
else:
exponent = np.log(axis_size) / np.log(base)
to_pad = (base ** int(np.ceil(exponent))) - axis_size
return int(np.floor(to_pad/2)), int(np.ceil(to_pad/2))
_assert_two_or_three_dims(arr)
if height_base is not None:
assert height_base > 1, (
"Can only pad to base larger than 1, got %d." % (height_base,))
if width_base is not None:
assert width_base > 1, (
"Can only pad to base larger than 1, got %d." % (width_base,))
shape = arr.shape if hasattr(arr, "shape") else arr
height, width = shape[0:2]
top, bottom = _compute_axis_value(height, height_base)
left, right = _compute_axis_value(width, width_base)
return top, right, bottom, left
def compute_croppings_to_reach_powers_of(arr, height_base, width_base,
allow_zero_exponent=False):
def _compute_axis_value(axis_size, base):
if base is None:
return 0, 0
if axis_size == 0:
to_crop = 0
elif axis_size < base:
to_crop = axis_size - 1 if allow_zero_exponent else 0
else:
exponent = np.log(axis_size) / np.log(base)
to_crop = axis_size - (base ** int(exponent))
return int(np.floor(to_crop/2)), int(np.ceil(to_crop/2))
_assert_two_or_three_dims(arr)
if height_base is not None:
assert height_base > 1, (
"Can only crop to base larger than 1, got %d." % (height_base,))
if width_base is not None:
assert width_base > 1, (
"Can only crop to base larger than 1, got %d." % (width_base,))
shape = arr.shape if hasattr(arr, "shape") else arr
height, width = shape[0:2]
top, bottom = _compute_axis_value(height, height_base)
left, right = _compute_axis_value(width, width_base)
return top, right, bottom, left
@ia.deprecated(alt_func="Resize",
comment="Resize has the exactly same interface as Scale.")
def Scale(*args, **kwargs):
return Resize(*args, **kwargs)
class Resize(meta.Augmenter):
def __init__(self, size, interpolation="cubic",
seed=None, name=None, **old_kwargs):
super(Resize, self).__init__(
seed=seed, name=name, **old_kwargs)
self.size, self.size_order = self._handle_size_arg(size, False)
self.interpolation = self._handle_interpolation_arg(interpolation)
@classmethod
def _handle_size_arg(cls, size, subcall):
def _dict_to_size_tuple(val1, val2):
kaa = "keep-aspect-ratio"
not_both_kaa = (val1 != kaa or val2 != kaa)
assert not_both_kaa, (
"Expected at least one value to not be \"keep-aspect-ratio\", "
"but got it two times.")
size_tuple = []
for k in [val1, val2]:
if k in ["keep-aspect-ratio", "keep"]:
entry = iap.Deterministic(k)
else:
entry = cls._handle_size_arg(k, True)
size_tuple.append(entry)
return tuple(size_tuple)
def _contains_any_key(dict_, keys):
return any([key in dict_ for key in keys])
size_order = "HW"
if size == "keep":
result = iap.Deterministic("keep")
elif ia.is_single_number(size):
assert size > 0, "Expected only values > 0, got %s" % (size,)
result = iap.Deterministic(size)
elif not subcall and isinstance(size, dict):
if len(size.keys()) == 0:
result = iap.Deterministic("keep")
elif _contains_any_key(size, ["height", "width"]):
height = size.get("height", "keep")
width = size.get("width", "keep")
result = _dict_to_size_tuple(height, width)
elif _contains_any_key(size, ["shorter-side", "longer-side"]):
shorter = size.get("shorter-side", "keep")
longer = size.get("longer-side", "keep")
result = _dict_to_size_tuple(shorter, longer)
size_order = "SL"
else:
raise ValueError(
"Expected dictionary containing no keys, "
"the keys \"height\" and/or \"width\", "
"or the keys \"shorter-side\" and/or \"longer-side\". "
"Got keys: %s." % (str(size.keys()),))
elif isinstance(size, tuple):
assert len(size) == 2, (
"Expected size tuple to contain exactly 2 values, "
"got %d." % (len(size),))
assert size[0] > 0 and size[1] > 0, (
"Expected size tuple to only contain values >0, "
"got %d and %d." % (size[0], size[1]))
if ia.is_single_float(size[0]) or ia.is_single_float(size[1]):
result = iap.Uniform(size[0], size[1])
else:
result = iap.DiscreteUniform(size[0], size[1])
elif isinstance(size, list):
if len(size) == 0:
result = iap.Deterministic("keep")
else:
all_int = all([ia.is_single_integer(v) for v in size])
all_float = all([ia.is_single_float(v) for v in size])
assert all_int or all_float, (
"Expected to get only integers or floats.")
assert all([v > 0 for v in size]), (
"Expected all values to be >0.")
result = iap.Choice(size)
elif isinstance(size, iap.StochasticParameter):
result = size
else:
raise ValueError(
"Expected number, tuple of two numbers, list of numbers, "
"dictionary of form "
"{'height': number/tuple/list/'keep-aspect-ratio'/'keep', "
"'width': <analogous>}, dictionary of form "
"{'shorter-side': number/tuple/list/'keep-aspect-ratio'/"
"'keep', 'longer-side': <analogous>} "
"or StochasticParameter, got %s." % (type(size),)
)
if subcall:
return result
return result, size_order
@classmethod
def _handle_interpolation_arg(cls, interpolation):
if interpolation == ia.ALL:
interpolation = iap.Choice(
["nearest", "linear", "area", "cubic"])
elif ia.is_single_integer(interpolation):
interpolation = iap.Deterministic(interpolation)
elif ia.is_string(interpolation):
interpolation = iap.Deterministic(interpolation)
elif ia.is_iterable(interpolation):
interpolation = iap.Choice(interpolation)
elif isinstance(interpolation, iap.StochasticParameter):
pass
else:
raise Exception(
"Expected int or string or iterable or StochasticParameter, "
"got %s." % (type(interpolation),))
return interpolation
def _augment_batch_(self, batch, random_state, parents, hooks):
nb_rows = batch.nb_rows
samples = self._draw_samples(nb_rows, random_state)
if batch.images is not None:
batch.images = self._augment_images_by_samples(batch.images,
samples)
if batch.heatmaps is not None:
batch.heatmaps = self._augment_maps_by_samples(
batch.heatmaps, "arr_0to1", samples)
if batch.segmentation_maps is not None:
batch.segmentation_maps = self._augment_maps_by_samples(
batch.segmentation_maps, "arr",
(samples[0], samples[1], [None] * nb_rows))
for augm_name in ["keypoints", "bounding_boxes", "polygons",
"line_strings"]:
augm_value = getattr(batch, augm_name)
if augm_value is not None:
func = functools.partial(
self._augment_keypoints_by_samples,
samples=samples)
cbaois = self._apply_to_cbaois_as_keypoints(augm_value, func)
setattr(batch, augm_name, cbaois)
return batch
def _augment_images_by_samples(self, images, samples):
input_was_array = False
input_dtype = None
if ia.is_np_array(images):
input_was_array = True
input_dtype = images.dtype
samples_a, samples_b, samples_ip = samples
result = []
for i, image in enumerate(images):
h, w = self._compute_height_width(image.shape, samples_a[i],
samples_b[i], self.size_order)
image_rs = ia.imresize_single_image(image, (h, w),
interpolation=samples_ip[i])
result.append(image_rs)
if input_was_array:
all_same_size = (len({image.shape for image in result}) == 1)
if all_same_size:
result = np.array(result, dtype=input_dtype)
return result
def _augment_maps_by_samples(self, augmentables, arr_attr_name, samples):
result = []
samples_h, samples_w, samples_ip = samples
for i, augmentable in enumerate(augmentables):
arr = getattr(augmentable, arr_attr_name)
arr_shape = arr.shape
img_shape = augmentable.shape
h_img, w_img = self._compute_height_width(
img_shape, samples_h[i], samples_w[i], self.size_order)
h = int(np.round(h_img * (arr_shape[0] / img_shape[0])))
w = int(np.round(w_img * (arr_shape[1] / img_shape[1])))
h = max(h, 1)
w = max(w, 1)
if samples_ip[0] is not None:
augmentable_resize = augmentable.resize(
(h, w), interpolation=samples_ip[i])
else:
augmentable_resize = augmentable.resize((h, w))
augmentable_resize.shape = (h_img, w_img) + img_shape[2:]
result.append(augmentable_resize)
return result
def _augment_keypoints_by_samples(self, kpsois, samples):
result = []
samples_a, samples_b, _samples_ip = samples
for i, kpsoi in enumerate(kpsois):
h, w = self._compute_height_width(
kpsoi.shape, samples_a[i], samples_b[i], self.size_order)
new_shape = (h, w) + kpsoi.shape[2:]
keypoints_on_image_rs = kpsoi.on_(new_shape)
result.append(keypoints_on_image_rs)
return result
def _draw_samples(self, nb_images, random_state):
rngs = random_state.duplicate(3)
if isinstance(self.size, tuple):
samples_h = self.size[0].draw_samples(nb_images,
random_state=rngs[0])
samples_w = self.size[1].draw_samples(nb_images,
random_state=rngs[1])
else:
samples_h = self.size.draw_samples(nb_images, random_state=rngs[0])
samples_w = samples_h
samples_ip = self.interpolation.draw_samples(nb_images,
random_state=rngs[2])
return samples_h, samples_w, samples_ip
@classmethod
def _compute_height_width(cls, image_shape, sample_a, sample_b, size_order):
imh, imw = image_shape[0:2]
if size_order == 'SL':
if imh < imw:
h, w = sample_a, sample_b
else:
w, h = sample_a, sample_b
else:
h, w = sample_a, sample_b
if ia.is_single_float(h):
assert h > 0, "Expected 'h' to be >0, got %.4f" % (h,)
h = int(np.round(imh * h))
h = h if h > 0 else 1
elif h == "keep":
h = imh
if ia.is_single_float(w):
assert w > 0, "Expected 'w' to be >0, got %.4f" % (w,)
w = int(np.round(imw * w))
w = w if w > 0 else 1
elif w == "keep":
w = imw
if h == "keep-aspect-ratio":
h_per_w_orig = imh / imw
h = int(np.round(w * h_per_w_orig))
if w == "keep-aspect-ratio":
w_per_h_orig = imw / imh
w = int(np.round(h * w_per_h_orig))
return h, w
def get_parameters(self):
return [self.size, self.interpolation, self.size_order]
class _CropAndPadSamplingResult(object):
def __init__(self, crop_top, crop_right, crop_bottom, crop_left,
pad_top, pad_right, pad_bottom, pad_left, pad_mode, pad_cval):
self.crop_top = crop_top
self.crop_right = crop_right
self.crop_bottom = crop_bottom
self.crop_left = crop_left
self.pad_top = pad_top
self.pad_right = pad_right
self.pad_bottom = pad_bottom
self.pad_left = pad_left
self.pad_mode = pad_mode
self.pad_cval = pad_cval
@property
def croppings(self):
return self.crop_top, self.crop_right, self.crop_bottom, self.crop_left
@property
def paddings(self):
return self.pad_top, self.pad_right, self.pad_bottom, self.pad_left
class CropAndPad(meta.Augmenter):
def __init__(self, px=None, percent=None, pad_mode="constant", pad_cval=0,
keep_size=True, sample_independently=True,
seed=None, name=None, **old_kwargs):
super(CropAndPad, self).__init__(
seed=seed, name=name, **old_kwargs)
self.mode, self.all_sides, self.top, self.right, self.bottom, \
self.left = self._handle_px_and_percent_args(px, percent)
self.pad_mode = _handle_pad_mode_param(pad_mode)
self.pad_cval = iap.handle_discrete_param(
pad_cval, "pad_cval", value_range=None, tuple_to_uniform=True,
list_to_choice=True, allow_floats=True)
self.keep_size = keep_size
self.sample_independently = sample_independently
self._pad_mode_heatmaps = "constant"
self._pad_mode_segmentation_maps = "constant"
self._pad_cval_heatmaps = 0.0
self._pad_cval_segmentation_maps = 0
@classmethod
def _handle_px_and_percent_args(cls, px, percent):
all_sides = None
top, right, bottom, left = None, None, None, None
if px is None and percent is None:
mode = "noop"
elif px is not None and percent is not None:
raise Exception("Can only pad by pixels or percent, not both.")
elif px is not None:
mode = "px"
all_sides, top, right, bottom, left = cls._handle_px_arg(px)
else:
mode = "percent"
all_sides, top, right, bottom, left = cls._handle_percent_arg(
percent)
return mode, all_sides, top, right, bottom, left
@classmethod
def _handle_px_arg(cls, px):
all_sides = None
top, right, bottom, left = None, None, None, None
if ia.is_single_integer(px):
all_sides = iap.Deterministic(px)
elif isinstance(px, tuple):
assert len(px) in [2, 4], (
"Expected 'px' given as a tuple to contain 2 or 4 "
"entries, got %d." % (len(px),))
def handle_param(p):
if ia.is_single_integer(p):
return iap.Deterministic(p)
if isinstance(p, tuple):
assert len(p) == 2, (
"Expected tuple of 2 values, got %d." % (len(p)))
only_ints = (
ia.is_single_integer(p[0])
and ia.is_single_integer(p[1]))
assert only_ints, (
"Expected tuple of integers, got %s and %s." % (
type(p[0]), type(p[1])))
return iap.DiscreteUniform(p[0], p[1])
if isinstance(p, list):
assert len(p) > 0, (
"Expected non-empty list, but got empty one.")
assert all([ia.is_single_integer(val) for val in p]), (
"Expected list of ints, got types %s." % (
", ".join([str(type(v)) for v in p])))
return iap.Choice(p)
if isinstance(p, iap.StochasticParameter):
return p
raise Exception(
"Expected int, tuple of two ints, list of ints or "
"StochasticParameter, got type %s." % (type(p),))
if len(px) == 2:
all_sides = handle_param(px)
else:
top = handle_param(px[0])
right = handle_param(px[1])
bottom = handle_param(px[2])
left = handle_param(px[3])
elif isinstance(px, iap.StochasticParameter):
top = right = bottom = left = px
else:
raise Exception(
"Expected int, tuple of 4 "
"ints/tuples/lists/StochasticParameters or "
"StochasticParameter, got type %s." % (type(px),))
return all_sides, top, right, bottom, left
@classmethod
def _handle_percent_arg(cls, percent):
all_sides = None
top, right, bottom, left = None, None, None, None
if ia.is_single_number(percent):
assert percent > -1.0, (
"Expected 'percent' to be >-1.0, got %.4f." % (percent,))
all_sides = iap.Deterministic(percent)
elif isinstance(percent, tuple):
assert len(percent) in [2, 4], (
"Expected 'percent' given as a tuple to contain 2 or 4 "
"entries, got %d." % (len(percent),))
def handle_param(p):
if ia.is_single_number(p):
return iap.Deterministic(p)
if isinstance(p, tuple):
assert len(p) == 2, (
"Expected tuple of 2 values, got %d." % (len(p),))
only_numbers = (
ia.is_single_number(p[0])
and ia.is_single_number(p[1]))
assert only_numbers, (
"Expected tuple of numbers, got %s and %s." % (
type(p[0]), type(p[1])))
assert p[0] > -1.0 and p[1] > -1.0, (
"Expected tuple of values >-1.0, got %.4f and "
"%.4f." % (p[0], p[1]))
return iap.Uniform(p[0], p[1])
if isinstance(p, list):
assert len(p) > 0, (
"Expected non-empty list, but got empty one.")
assert all([ia.is_single_number(val) for val in p]), (
"Expected list of numbers, got types %s." % (
", ".join([str(type(v)) for v in p])))
assert all([val > -1.0 for val in p]), (
"Expected list of values >-1.0, got values %s." % (
", ".join(["%.4f" % (v,) for v in p])))
return iap.Choice(p)
if isinstance(p, iap.StochasticParameter):
return p
raise Exception(
"Expected int, tuple of two ints, list of ints or "
"StochasticParameter, got type %s." % (type(p),))
if len(percent) == 2:
all_sides = handle_param(percent)
else:
top = handle_param(percent[0])
right = handle_param(percent[1])
bottom = handle_param(percent[2])
left = handle_param(percent[3])
elif isinstance(percent, iap.StochasticParameter):
top = right = bottom = left = percent
else:
raise Exception(
"Expected number, tuple of 4 "
"numbers/tuples/lists/StochasticParameters or "
"StochasticParameter, got type %s." % (type(percent),))
return all_sides, top, right, bottom, left
def _augment_batch_(self, batch, random_state, parents, hooks):
shapes = batch.get_rowwise_shapes()
samples = self._draw_samples(random_state, shapes)
if batch.images is not None:
batch.images = self._augment_images_by_samples(batch.images,
samples)
if batch.heatmaps is not None:
batch.heatmaps = self._augment_maps_by_samples(
batch.heatmaps,
self._pad_mode_heatmaps, self._pad_cval_heatmaps,
samples)
if batch.segmentation_maps is not None:
batch.segmentation_maps = self._augment_maps_by_samples(
batch.segmentation_maps,
self._pad_mode_segmentation_maps,
self._pad_cval_segmentation_maps, samples)
for augm_name in ["keypoints", "bounding_boxes", "polygons",
"line_strings"]:
augm_value = getattr(batch, augm_name)
if augm_value is not None:
func = functools.partial(
self._augment_keypoints_by_samples,
samples=samples)
cbaois = self._apply_to_cbaois_as_keypoints(augm_value, func)
setattr(batch, augm_name, cbaois)
return batch
def _augment_images_by_samples(self, images, samples):
result = []
for i, image in enumerate(images):
samples_i = samples[i]
image_cr_pa = _crop_and_pad_arr(
image, samples_i.croppings, samples_i.paddings,
samples_i.pad_mode, samples_i.pad_cval, self.keep_size)
result.append(image_cr_pa)
if ia.is_np_array(images):
if self.keep_size:
result = np.array(result, dtype=images.dtype)
else:
nb_shapes = len({image.shape for image in result})
if nb_shapes == 1:
result = np.array(result, dtype=images.dtype)
return result
def _augment_maps_by_samples(self, augmentables, pad_mode, pad_cval,
samples):
result = []
for i, augmentable in enumerate(augmentables):
samples_img = samples[i]
augmentable = _crop_and_pad_hms_or_segmaps_(
augmentable,
croppings_img=samples_img.croppings,
paddings_img=samples_img.paddings,
pad_mode=(pad_mode
if pad_mode is not None
else samples_img.pad_mode),
pad_cval=(pad_cval
if pad_cval is not None
else samples_img.pad_cval),
keep_size=self.keep_size
)
result.append(augmentable)
return result
def _augment_keypoints_by_samples(self, keypoints_on_images, samples):
result = []
for i, keypoints_on_image in enumerate(keypoints_on_images):
samples_i = samples[i]
kpsoi_aug = _crop_and_pad_kpsoi_(
keypoints_on_image, croppings_img=samples_i.croppings,
paddings_img=samples_i.paddings, keep_size=self.keep_size)
result.append(kpsoi_aug)
return result
def _draw_samples(self, random_state, shapes):
nb_rows = len(shapes)
if self.mode == "noop":
top = right = bottom = left = np.full((nb_rows,), 0,
dtype=np.int32)
else:
if self.all_sides is not None:
if self.sample_independently:
samples = self.all_sides.draw_samples(
(nb_rows, 4), random_state=random_state)
top = samples[:, 0]
right = samples[:, 1]
bottom = samples[:, 2]
left = samples[:, 3]
else:
sample = self.all_sides.draw_samples(
(nb_rows,), random_state=random_state)
top = right = bottom = left = sample
else:
top = self.top.draw_samples(
(nb_rows,), random_state=random_state)
right = self.right.draw_samples(
(nb_rows,), random_state=random_state)
bottom = self.bottom.draw_samples(
(nb_rows,), random_state=random_state)
left = self.left.draw_samples(
(nb_rows,), random_state=random_state)
if self.mode == "px":
pass
elif self.mode == "percent":
shapes_arr = np.array([shape[0:2] for shape in shapes],
dtype=np.float32)
heights = shapes_arr[:, 0]
widths = shapes_arr[:, 1]
top = np.round(heights * top).astype(np.int32)
right = np.round(widths * right).astype(np.int32)
bottom = np.round(heights * bottom).astype(np.int32)
left = np.round(widths * left).astype(np.int32)
else:
raise Exception("Invalid mode")
def _only_above_zero(arr):
arr = np.copy(arr)
mask = (arr < 0)
arr[mask] = 0
return arr
crop_top = _only_above_zero((-1) * top)
crop_right = _only_above_zero((-1) * right)
crop_bottom = _only_above_zero((-1) * bottom)
crop_left = _only_above_zero((-1) * left)
pad_top = _only_above_zero(top)
pad_right = _only_above_zero(right)
pad_bottom = _only_above_zero(bottom)
pad_left = _only_above_zero(left)
pad_mode = self.pad_mode.draw_samples((nb_rows,),
random_state=random_state)
pad_cval = self.pad_cval.draw_samples((nb_rows,),
random_state=random_state)
result = []
for i, shape in enumerate(shapes):
height, width = shape[0:2]
crop_top_i, crop_right_i, crop_bottom_i, crop_left_i = \
_crop_prevent_zero_size(
height, width,
crop_top[i], crop_right[i], crop_bottom[i], crop_left[i])
any_crop_y = (crop_top_i > 0 or crop_bottom_i > 0)
if any_crop_y and crop_top_i + crop_bottom_i >= height:
ia.warn(
"Expected generated crop amounts in CropAndPad for top and "
"bottom image side to be less than the image's height, but "
"got %d (top) and %d (bottom) vs. image height %d. This "
"will result in an image with output height=1 (if input "
"height was >=1) or output height=0 (if input height "
"was 0)." % (crop_top_i, crop_bottom_i, height))
# add here any_crop_x to not warn in case of zero height/width
# images
any_crop_x = (crop_left_i > 0 or crop_right_i > 0)
if any_crop_x and crop_left_i + crop_right_i >= width:
ia.warn(
"Expected generated crop amounts in CropAndPad for left "
"and right image side to be less than the image's width, "
"but got %d (left) and %d (right) vs. image width %d. "
"This will result in an image with output width=1 (if "
"input width was >=1) or output width=0 (if input width "
"was 0)." % (crop_left_i, crop_right_i, width))
result.append(
_CropAndPadSamplingResult(
crop_top=crop_top_i,
crop_right=crop_right_i,
crop_bottom=crop_bottom_i,
crop_left=crop_left_i,
pad_top=pad_top[i],
pad_right=pad_right[i],
pad_bottom=pad_bottom[i],
pad_left=pad_left[i],
pad_mode=pad_mode[i],
pad_cval=pad_cval[i]))
return result
def get_parameters(self):
return [self.all_sides, self.top, self.right, self.bottom, self.left,
self.pad_mode, self.pad_cval]
class Pad(CropAndPad):
def __init__(self, px=None, percent=None, pad_mode="constant", pad_cval=0,
keep_size=True, sample_independently=True,
seed=None, name=None, **old_kwargs):
def recursive_validate(value):
if value is None:
return value
if ia.is_single_number(value):
assert value >= 0, "Expected value >0, got %.4f" % (value,)
return value
if isinstance(value, iap.StochasticParameter):
return value
if isinstance(value, tuple):
return tuple([recursive_validate(v_) for v_ in value])
if isinstance(value, list):
return [recursive_validate(v_) for v_ in value]
raise Exception(
"Expected None or int or float or StochasticParameter or "
"list or tuple, got %s." % (type(value),))
px = recursive_validate(px)
percent = recursive_validate(percent)
super(Pad, self).__init__(
px=px,
percent=percent,
pad_mode=pad_mode,
pad_cval=pad_cval,
keep_size=keep_size,
sample_independently=sample_independently,
seed=seed, name=name, **old_kwargs)
class Crop(CropAndPad):
def __init__(self, px=None, percent=None, keep_size=True,
sample_independently=True,
seed=None, name=None, **old_kwargs):
def recursive_negate(value):
if value is None:
return value
if ia.is_single_number(value):
assert value >= 0, "Expected value >0, got %.4f." % (value,)
return -value
if isinstance(value, iap.StochasticParameter):
return iap.Multiply(value, -1)
if isinstance(value, tuple):
return tuple([recursive_negate(v_) for v_ in value])
if isinstance(value, list):
return [recursive_negate(v_) for v_ in value]
raise Exception(
"Expected None or int or float or StochasticParameter or "
"list or tuple, got %s." % (type(value),))
px = recursive_negate(px)
percent = recursive_negate(percent)
super(Crop, self).__init__(
px=px,
percent=percent,
keep_size=keep_size,
sample_independently=sample_independently,
seed=seed, name=name, **old_kwargs)
class PadToFixedSize(meta.Augmenter):
def __init__(self, width, height, pad_mode="constant", pad_cval=0,
position="uniform",
seed=None, name=None, **old_kwargs):
super(PadToFixedSize, self).__init__(
seed=seed, name=name, **old_kwargs)
self.size = (width, height)
self.position = _handle_position_parameter(position)
self.pad_mode = _handle_pad_mode_param(pad_mode)
self.pad_cval = iap.handle_discrete_param(
pad_cval, "pad_cval", value_range=None, tuple_to_uniform=True,
list_to_choice=True, allow_floats=True)
self._pad_mode_heatmaps = "constant"
self._pad_mode_segmentation_maps = "constant"
self._pad_cval_heatmaps = 0.0
self._pad_cval_segmentation_maps = 0
def _augment_batch_(self, batch, random_state, parents, hooks):
samples = self._draw_samples(batch, random_state)
if batch.images is not None:
batch.images = self._augment_images_by_samples(batch.images,
samples)
if batch.heatmaps is not None:
batch.heatmaps = self._augment_maps_by_samples(
batch.heatmaps, samples, self._pad_mode_heatmaps,
self._pad_cval_heatmaps)
if batch.segmentation_maps is not None:
batch.segmentation_maps = self._augment_maps_by_samples(
batch.segmentation_maps, samples, self._pad_mode_heatmaps,
self._pad_cval_heatmaps)
for augm_name in ["keypoints", "bounding_boxes", "polygons",
"line_strings"]:
augm_value = getattr(batch, augm_name)
if augm_value is not None:
func = functools.partial(
self._augment_keypoints_by_samples,
samples=samples)
cbaois = self._apply_to_cbaois_as_keypoints(augm_value, func)
setattr(batch, augm_name, cbaois)
return batch
def _augment_images_by_samples(self, images, samples):
result = []
sizes, pad_xs, pad_ys, pad_modes, pad_cvals = samples
for i, (image, size) in enumerate(zip(images, sizes)):
width_min, height_min = size
height_image, width_image = image.shape[:2]
paddings = self._calculate_paddings(height_image, width_image,
height_min, width_min,
pad_xs[i], pad_ys[i])
image = _crop_and_pad_arr(
image, (0, 0, 0, 0), paddings, pad_modes[i], pad_cvals[i],
keep_size=False)
result.append(image)
return result
def _augment_keypoints_by_samples(self, keypoints_on_images, samples):
result = []
sizes, pad_xs, pad_ys, _, _ = samples
for i, (kpsoi, size) in enumerate(zip(keypoints_on_images, sizes)):
width_min, height_min = size
height_image, width_image = kpsoi.shape[:2]
paddings_img = self._calculate_paddings(height_image, width_image,
height_min, width_min,
pad_xs[i], pad_ys[i])
keypoints_padded = _crop_and_pad_kpsoi_(
kpsoi, (0, 0, 0, 0), paddings_img,
keep_size=False)
result.append(keypoints_padded)
return result
def _augment_maps_by_samples(self, augmentables, samples, pad_mode,
pad_cval):
sizes, pad_xs, pad_ys, pad_modes, pad_cvals = samples
for i, (augmentable, size) in enumerate(zip(augmentables, sizes)):
width_min, height_min = size
height_img, width_img = augmentable.shape[:2]
paddings_img = self._calculate_paddings(
height_img, width_img, height_min, width_min,
pad_xs[i], pad_ys[i])
augmentables[i] = _crop_and_pad_hms_or_segmaps_(
augmentables[i],
(0, 0, 0, 0),
paddings_img,
pad_mode=pad_mode if pad_mode is not None else pad_modes[i],
pad_cval=pad_cval if pad_cval is not None else pad_cvals[i],
keep_size=False)
return augmentables
def _draw_samples(self, batch, random_state):
nb_images = batch.nb_rows
rngs = random_state.duplicate(4)
if isinstance(self.position, tuple):
pad_xs = self.position[0].draw_samples(nb_images,
random_state=rngs[0])
pad_ys = self.position[1].draw_samples(nb_images,
random_state=rngs[1])
else:
pads = self.position.draw_samples((nb_images, 2),
random_state=rngs[0])
pad_xs = pads[:, 0]
pad_ys = pads[:, 1]
pad_modes = self.pad_mode.draw_samples(nb_images,
random_state=rngs[2])
pad_cvals = self.pad_cval.draw_samples(nb_images,
random_state=rngs[3])
# We return here the sizes even though they are static as it allows
# derived augmenters to define image-specific heights/widths.
return [self.size] * nb_images, pad_xs, pad_ys, pad_modes, pad_cvals
@classmethod
def _calculate_paddings(cls, height_image, width_image,
height_min, width_min, pad_xs_i, pad_ys_i):
pad_top = 0
pad_right = 0
pad_bottom = 0
pad_left = 0
if width_min is not None and width_image < width_min:
pad_total_x = width_min - width_image
pad_left = int((1-pad_xs_i) * pad_total_x)
pad_right = pad_total_x - pad_left
if height_min is not None and height_image < height_min:
pad_total_y = height_min - height_image
pad_top = int((1-pad_ys_i) * pad_total_y)
pad_bottom = pad_total_y - pad_top
return pad_top, pad_right, pad_bottom, pad_left
def get_parameters(self):
return [self.size[0], self.size[1], self.pad_mode, self.pad_cval,
self.position]
class CenterPadToFixedSize(PadToFixedSize):
def __init__(self, width, height, pad_mode="constant", pad_cval=0,
seed=None, name=None, **old_kwargs):
super(CenterPadToFixedSize, self).__init__(
width=width, height=height, pad_mode=pad_mode, pad_cval=pad_cval,
position="center",
seed=seed, name=name, **old_kwargs)
# TODO maybe rename this to CropToMaximumSize ?
# TODO this is very similar to CropAndPad, maybe add a way to generate crop
# values imagewise via a callback in in CropAndPad?
# TODO add crop() function in imgaug, similar to pad
class CropToFixedSize(meta.Augmenter):
def __init__(self, width, height, position="uniform",
seed=None, name=None, **old_kwargs):
super(CropToFixedSize, self).__init__(
seed=seed, name=name, **old_kwargs)
self.size = (width, height)
# Position of where to crop. The further to the top left this is,
# the larger the share of pixels that will be cropped from the top
# and left sides. I.e. set to (Deterministic(0.0), Deterministic(0.0))
# to only crop at the top and left,
# (Deterministic(1.0), Deterministic(1.0)) to only crop at the bottom
# right. Analogously (0.5, 0.5) crops equally on both axis,
# (0.0, 1.0) crops left and bottom, (1.0, 0.0) crops right and top.
self.position = _handle_position_parameter(position)
def _augment_batch_(self, batch, random_state, parents, hooks):
# Providing the whole batch to _draw_samples() would not be necessary
# for this augmenter. The number of rows would be sufficient. This
# formulation however enables derived augmenters to use rowwise shapes
# without having to compute them here for this augmenter.
samples = self._draw_samples(batch, random_state)
if batch.images is not None:
batch.images = self._augment_images_by_samples(batch.images,
samples)
if batch.heatmaps is not None:
batch.heatmaps = self._augment_maps_by_samples(
batch.heatmaps, samples)
if batch.segmentation_maps is not None:
batch.segmentation_maps = self._augment_maps_by_samples(
batch.segmentation_maps, samples)
for augm_name in ["keypoints", "bounding_boxes", "polygons",
"line_strings"]:
augm_value = getattr(batch, augm_name)
if augm_value is not None:
func = functools.partial(
self._augment_keypoints_by_samples,
samples=samples)
cbaois = self._apply_to_cbaois_as_keypoints(augm_value, func)
setattr(batch, augm_name, cbaois)
return batch
def _augment_images_by_samples(self, images, samples):
result = []
sizes, offset_xs, offset_ys = samples
for i, (image, size) in enumerate(zip(images, sizes)):
w, h = size
height_image, width_image = image.shape[0:2]
croppings = self._calculate_crop_amounts(
height_image, width_image, h, w, offset_ys[i], offset_xs[i])
image_cropped = _crop_and_pad_arr(image, croppings, (0, 0, 0, 0),
keep_size=False)
result.append(image_cropped)
return result
def _augment_keypoints_by_samples(self, kpsois, samples):
result = []
sizes, offset_xs, offset_ys = samples
for i, (kpsoi, size) in enumerate(zip(kpsois, sizes)):
w, h = size
height_image, width_image = kpsoi.shape[0:2]
croppings_img = self._calculate_crop_amounts(
height_image, width_image, h, w, offset_ys[i], offset_xs[i])
kpsoi_cropped = _crop_and_pad_kpsoi_(
kpsoi, croppings_img, (0, 0, 0, 0), keep_size=False)
result.append(kpsoi_cropped)
return result
def _augment_maps_by_samples(self, augmentables, samples):
sizes, offset_xs, offset_ys = samples
for i, (augmentable, size) in enumerate(zip(augmentables, sizes)):
w, h = size
height_image, width_image = augmentable.shape[0:2]
croppings_img = self._calculate_crop_amounts(
height_image, width_image, h, w, offset_ys[i], offset_xs[i])
augmentables[i] = _crop_and_pad_hms_or_segmaps_(
augmentable, croppings_img, (0, 0, 0, 0), keep_size=False)
return augmentables
@classmethod
def _calculate_crop_amounts(cls, height_image, width_image,
height_max, width_max,
offset_y, offset_x):
crop_top = 0
crop_right = 0
crop_bottom = 0
crop_left = 0
if height_max is not None and height_image > height_max:
crop_top = int(offset_y * (height_image - height_max))
crop_bottom = height_image - height_max - crop_top
if width_max is not None and width_image > width_max:
crop_left = int(offset_x * (width_image - width_max))
crop_right = width_image - width_max - crop_left
return crop_top, crop_right, crop_bottom, crop_left
def _draw_samples(self, batch, random_state):
nb_images = batch.nb_rows
rngs = random_state.duplicate(2)
if isinstance(self.position, tuple):
offset_xs = self.position[0].draw_samples(nb_images,
random_state=rngs[0])
offset_ys = self.position[1].draw_samples(nb_images,
random_state=rngs[1])
else:
offsets = self.position.draw_samples((nb_images, 2),
random_state=rngs[0])
offset_xs = offsets[:, 0]
offset_ys = offsets[:, 1]
offset_xs = 1.0 - offset_xs
offset_ys = 1.0 - offset_ys
# We return here the sizes even though they are static as it allows
# derived augmenters to define image-specific heights/widths.
return [self.size] * nb_images, offset_xs, offset_ys
def get_parameters(self):
return [self.size[0], self.size[1], self.position]
class CenterCropToFixedSize(CropToFixedSize):
def __init__(self, width, height,
seed=None, name=None, **old_kwargs):
super(CenterCropToFixedSize, self).__init__(
width=width, height=height, position="center",
seed=seed, name=name, **old_kwargs)
class CropToMultiplesOf(CropToFixedSize):
def __init__(self, width_multiple, height_multiple, position="uniform",
seed=None, name=None, **old_kwargs):
super(CropToMultiplesOf, self).__init__(
width=None, height=None, position=position,
seed=seed, name=name, **old_kwargs)
self.width_multiple = width_multiple
self.height_multiple = height_multiple
def _draw_samples(self, batch, random_state):
_sizes, offset_xs, offset_ys = super(
CropToMultiplesOf, self
)._draw_samples(batch, random_state)
shapes = batch.get_rowwise_shapes()
sizes = []
for shape in shapes:
height, width = shape[0:2]
croppings = compute_croppings_to_reach_multiples_of(
shape,
height_multiple=self.height_multiple,
width_multiple=self.width_multiple)
# TODO change that
# note that these are not in the same order as shape tuples
# in CropToFixedSize
new_size = (
width - croppings[1] - croppings[3],
height - croppings[0] - croppings[2]
)
sizes.append(new_size)
return sizes, offset_xs, offset_ys
def get_parameters(self):
return [self.width_multiple, self.height_multiple, self.position]
class CenterCropToMultiplesOf(CropToMultiplesOf):
def __init__(self, width_multiple, height_multiple,
seed=None, name=None, **old_kwargs):
super(CenterCropToMultiplesOf, self).__init__(
width_multiple=width_multiple,
height_multiple=height_multiple,
position="center",
seed=seed, name=name, **old_kwargs)
class PadToMultiplesOf(PadToFixedSize):
def __init__(self, width_multiple, height_multiple,
pad_mode="constant", pad_cval=0,
position="uniform",
seed=None, name=None, **old_kwargs):
super(PadToMultiplesOf, self).__init__(
width=None, height=None, pad_mode=pad_mode, pad_cval=pad_cval,
position=position,
seed=seed, name=name, **old_kwargs)
self.width_multiple = width_multiple
self.height_multiple = height_multiple
def _draw_samples(self, batch, random_state):
_sizes, pad_xs, pad_ys, pad_modes, pad_cvals = super(
PadToMultiplesOf, self
)._draw_samples(batch, random_state)
shapes = batch.get_rowwise_shapes()
sizes = []
for shape in shapes:
height, width = shape[0:2]
paddings = compute_paddings_to_reach_multiples_of(
shape,
height_multiple=self.height_multiple,
width_multiple=self.width_multiple)
# TODO change that
# note that these are not in the same order as shape tuples
# in PadToFixedSize
new_size = (
width + paddings[1] + paddings[3],
height + paddings[0] + paddings[2]
)
sizes.append(new_size)
return sizes, pad_xs, pad_ys, pad_modes, pad_cvals
def get_parameters(self):
return [self.width_multiple, self.height_multiple,
self.pad_mode, self.pad_cval,
self.position]
class CenterPadToMultiplesOf(PadToMultiplesOf):
def __init__(self, width_multiple, height_multiple,
pad_mode="constant", pad_cval=0,
seed=None, name=None, **old_kwargs):
super(CenterPadToMultiplesOf, self).__init__(
width_multiple=width_multiple,
height_multiple=height_multiple,
pad_mode=pad_mode,
pad_cval=pad_cval,
position="center",
seed=seed, name=name, **old_kwargs)
class CropToPowersOf(CropToFixedSize):
def __init__(self, width_base, height_base, position="uniform",
seed=None, name=None, **old_kwargs):
super(CropToPowersOf, self).__init__(
width=None, height=None, position=position,
seed=seed, name=name, **old_kwargs)
self.width_base = width_base
self.height_base = height_base
def _draw_samples(self, batch, random_state):
_sizes, offset_xs, offset_ys = super(
CropToPowersOf, self
)._draw_samples(batch, random_state)
shapes = batch.get_rowwise_shapes()
sizes = []
for shape in shapes:
height, width = shape[0:2]
croppings = compute_croppings_to_reach_powers_of(
shape,
height_base=self.height_base,
width_base=self.width_base)
# TODO change that
# note that these are not in the same order as shape tuples
# in CropToFixedSize
new_size = (
width - croppings[1] - croppings[3],
height - croppings[0] - croppings[2]
)
sizes.append(new_size)
return sizes, offset_xs, offset_ys
def get_parameters(self):
return [self.width_base, self.height_base, self.position]
class CenterCropToPowersOf(CropToPowersOf):
def __init__(self, width_base, height_base,
seed=None, name=None, **old_kwargs):
super(CenterCropToPowersOf, self).__init__(
width_base=width_base, height_base=height_base, position="center",
seed=seed, name=name, **old_kwargs)
class PadToPowersOf(PadToFixedSize):
def __init__(self, width_base, height_base,
pad_mode="constant", pad_cval=0,
position="uniform",
seed=None, name=None, **old_kwargs):
super(PadToPowersOf, self).__init__(
width=None, height=None, pad_mode=pad_mode, pad_cval=pad_cval,
position=position,
seed=seed, name=name, **old_kwargs)
self.width_base = width_base
self.height_base = height_base
def _draw_samples(self, batch, random_state):
_sizes, pad_xs, pad_ys, pad_modes, pad_cvals = super(
PadToPowersOf, self
)._draw_samples(batch, random_state)
shapes = batch.get_rowwise_shapes()
sizes = []
for shape in shapes:
height, width = shape[0:2]
paddings = compute_paddings_to_reach_powers_of(
shape,
height_base=self.height_base,
width_base=self.width_base)
# TODO change that
# note that these are not in the same order as shape tuples
# in PadToFixedSize
new_size = (
width + paddings[1] + paddings[3],
height + paddings[0] + paddings[2]
)
sizes.append(new_size)
return sizes, pad_xs, pad_ys, pad_modes, pad_cvals
def get_parameters(self):
return [self.width_base, self.height_base,
self.pad_mode, self.pad_cval,
self.position]
class CenterPadToPowersOf(PadToPowersOf):
def __init__(self, width_base, height_base,
pad_mode="constant", pad_cval=0,
seed=None, name=None, **old_kwargs):
super(CenterPadToPowersOf, self).__init__(
width_base=width_base, height_base=height_base,
pad_mode=pad_mode, pad_cval=pad_cval,
position="center",
seed=seed, name=name, **old_kwargs)
class CropToAspectRatio(CropToFixedSize):
def __init__(self, aspect_ratio, position="uniform",
seed=None, name=None, **old_kwargs):
super(CropToAspectRatio, self).__init__(
width=None, height=None, position=position,
seed=seed, name=name, **old_kwargs)
self.aspect_ratio = aspect_ratio
def _draw_samples(self, batch, random_state):
_sizes, offset_xs, offset_ys = super(
CropToAspectRatio, self
)._draw_samples(batch, random_state)
shapes = batch.get_rowwise_shapes()
sizes = []
for shape in shapes:
height, width = shape[0:2]
if height == 0 or width == 0:
croppings = (0, 0, 0, 0)
else:
croppings = compute_croppings_to_reach_aspect_ratio(
shape,
aspect_ratio=self.aspect_ratio)
# TODO change that
# note that these are not in the same order as shape tuples
# in CropToFixedSize
new_size = (
width - croppings[1] - croppings[3],
height - croppings[0] - croppings[2]
)
sizes.append(new_size)
return sizes, offset_xs, offset_ys
def get_parameters(self):
return [self.aspect_ratio, self.position]
class CenterCropToAspectRatio(CropToAspectRatio):
def __init__(self, aspect_ratio,
seed=None, name=None, **old_kwargs):
super(CenterCropToAspectRatio, self).__init__(
aspect_ratio=aspect_ratio, position="center",
seed=seed, name=name, **old_kwargs)
class PadToAspectRatio(PadToFixedSize):
def __init__(self, aspect_ratio, pad_mode="constant", pad_cval=0,
position="uniform",
seed=None, name=None, **old_kwargs):
super(PadToAspectRatio, self).__init__(
width=None, height=None, pad_mode=pad_mode, pad_cval=pad_cval,
position=position,
seed=seed, name=name, **old_kwargs)
self.aspect_ratio = aspect_ratio
def _draw_samples(self, batch, random_state):
_sizes, pad_xs, pad_ys, pad_modes, pad_cvals = super(
PadToAspectRatio, self
)._draw_samples(batch, random_state)
shapes = batch.get_rowwise_shapes()
sizes = []
for shape in shapes:
height, width = shape[0:2]
paddings = compute_paddings_to_reach_aspect_ratio(
shape,
aspect_ratio=self.aspect_ratio)
# TODO change that
# note that these are not in the same order as shape tuples
# in PadToFixedSize
new_size = (
width + paddings[1] + paddings[3],
height + paddings[0] + paddings[2]
)
sizes.append(new_size)
return sizes, pad_xs, pad_ys, pad_modes, pad_cvals
def get_parameters(self):
return [self.aspect_ratio, self.pad_mode, self.pad_cval,
self.position]
class CenterPadToAspectRatio(PadToAspectRatio):
def __init__(self, aspect_ratio, pad_mode="constant", pad_cval=0,
seed=None, name=None, **old_kwargs):
super(CenterPadToAspectRatio, self).__init__(
aspect_ratio=aspect_ratio, position="center",
pad_mode=pad_mode, pad_cval=pad_cval,
seed=seed, name=name, **old_kwargs)
class CropToSquare(CropToAspectRatio):
def __init__(self, position="uniform",
seed=None, name=None, **old_kwargs):
super(CropToSquare, self).__init__(
aspect_ratio=1.0, position=position,
seed=seed, name=name, **old_kwargs)
class CenterCropToSquare(CropToSquare):
def __init__(self, seed=None, name=None, **old_kwargs):
super(CenterCropToSquare, self).__init__(
position="center",
seed=seed, name=name, **old_kwargs)
class PadToSquare(PadToAspectRatio):
def __init__(self, pad_mode="constant", pad_cval=0, position="uniform",
seed=None, name=None, **old_kwargs):
super(PadToSquare, self).__init__(
aspect_ratio=1.0, pad_mode=pad_mode, pad_cval=pad_cval,
position=position,
seed=seed, name=name, **old_kwargs)
class CenterPadToSquare(PadToSquare):
def __init__(self, pad_mode="constant", pad_cval=0,
seed=None, name=None, **old_kwargs):
super(CenterPadToSquare, self).__init__(
pad_mode=pad_mode, pad_cval=pad_cval, position="center",
seed=seed, name=name, **old_kwargs)
class KeepSizeByResize(meta.Augmenter):
NO_RESIZE = "NO_RESIZE"
SAME_AS_IMAGES = "SAME_AS_IMAGES"
def __init__(self, children,
interpolation="cubic",
interpolation_heatmaps=SAME_AS_IMAGES,
interpolation_segmaps="nearest",
seed=None, name=None, **old_kwargs):
super(KeepSizeByResize, self).__init__(
seed=seed, name=name, **old_kwargs)
self.children = children
def _validate_param(val, allow_same_as_images):
valid_ips_and_resize = ia.IMRESIZE_VALID_INTERPOLATIONS \
+ [KeepSizeByResize.NO_RESIZE]
if allow_same_as_images and val == self.SAME_AS_IMAGES:
return self.SAME_AS_IMAGES
if val in valid_ips_and_resize:
return iap.Deterministic(val)
if isinstance(val, list):
assert len(val) > 0, (
"Expected a list of at least one interpolation method. "
"Got an empty list.")
valid_ips_here = valid_ips_and_resize
if allow_same_as_images:
valid_ips_here = valid_ips_here \
+ [KeepSizeByResize.SAME_AS_IMAGES]
only_valid_ips = all([ip in valid_ips_here for ip in val])
assert only_valid_ips, (
"Expected each interpolations to be one of '%s', got "
"'%s'." % (str(valid_ips_here), str(val)))
return iap.Choice(val)
if isinstance(val, iap.StochasticParameter):
return val
raise Exception(
"Expected interpolation to be one of '%s' or a list of "
"these values or a StochasticParameter. Got type %s." % (
str(ia.IMRESIZE_VALID_INTERPOLATIONS), type(val)))
self.children = meta.handle_children_list(children, self.name, "then")
self.interpolation = _validate_param(interpolation, False)
self.interpolation_heatmaps = _validate_param(interpolation_heatmaps,
True)
self.interpolation_segmaps = _validate_param(interpolation_segmaps,
True)
def _augment_batch_(self, batch, random_state, parents, hooks):
with batch.propagation_hooks_ctx(self, hooks, parents):
images_were_array = None
if batch.images is not None:
images_were_array = ia.is_np_array(batch.images)
shapes_orig = self._get_shapes(batch)
samples = self._draw_samples(batch.nb_rows, random_state)
batch = self.children.augment_batch_(
batch, parents=parents + [self], hooks=hooks)
if batch.images is not None:
batch.images = self._keep_size_images(
batch.images, shapes_orig["images"], images_were_array,
samples)
if batch.heatmaps is not None:
# dont use shapes_orig["images"] because they might be None
batch.heatmaps = self._keep_size_maps(
batch.heatmaps, shapes_orig["heatmaps"],
shapes_orig["heatmaps_arr"], samples[1])
if batch.segmentation_maps is not None:
# dont use shapes_orig["images"] because they might be None
batch.segmentation_maps = self._keep_size_maps(
batch.segmentation_maps, shapes_orig["segmentation_maps"],
shapes_orig["segmentation_maps_arr"], samples[2])
for augm_name in ["keypoints", "bounding_boxes", "polygons",
"line_strings"]:
augm_value = getattr(batch, augm_name)
if augm_value is not None:
func = functools.partial(
self._keep_size_keypoints,
shapes_orig=shapes_orig[augm_name],
interpolations=samples[0])
cbaois = self._apply_to_cbaois_as_keypoints(augm_value,
func)
setattr(batch, augm_name, cbaois)
return batch
@classmethod
def _keep_size_images(cls, images, shapes_orig, images_were_array,
samples):
interpolations, _, _ = samples
gen = zip(images, interpolations, shapes_orig)
result = []
for image, interpolation, input_shape in gen:
if interpolation == KeepSizeByResize.NO_RESIZE:
result.append(image)
else:
result.append(
ia.imresize_single_image(image, input_shape[0:2],
interpolation))
if images_were_array:
# note here that NO_RESIZE can have led to different shapes
nb_shapes = len({image.shape for image in result})
if nb_shapes == 1:
result = np.array(result, dtype=images.dtype)
return result
@classmethod
def _keep_size_maps(cls, augmentables, shapes_orig_images,
shapes_orig_arrs, interpolations):
result = []
gen = zip(augmentables, interpolations,
shapes_orig_arrs, shapes_orig_images)
for augmentable, interpolation, arr_shape_orig, img_shape_orig in gen:
if interpolation == "NO_RESIZE":
result.append(augmentable)
else:
augmentable = augmentable.resize(
arr_shape_orig[0:2], interpolation=interpolation)
augmentable.shape = img_shape_orig
result.append(augmentable)
return result
@classmethod
def _keep_size_keypoints(cls, kpsois_aug, shapes_orig, interpolations):
result = []
gen = zip(kpsois_aug, interpolations, shapes_orig)
for kpsoi_aug, interpolation, input_shape in gen:
if interpolation == KeepSizeByResize.NO_RESIZE:
result.append(kpsoi_aug)
else:
result.append(kpsoi_aug.on_(input_shape))
return result
@classmethod
def _get_shapes(cls, batch):
result = dict()
for column in batch.columns:
result[column.name] = [cell.shape for cell in column.value]
if batch.heatmaps is not None:
result["heatmaps_arr"] = [
cell.arr_0to1.shape for cell in batch.heatmaps]
if batch.segmentation_maps is not None:
result["segmentation_maps_arr"] = [
cell.arr.shape for cell in batch.segmentation_maps]
return result
def _draw_samples(self, nb_images, random_state):
rngs = random_state.duplicate(3)
interpolations = self.interpolation.draw_samples((nb_images,),
random_state=rngs[0])
if self.interpolation_heatmaps == KeepSizeByResize.SAME_AS_IMAGES:
interpolations_heatmaps = np.copy(interpolations)
else:
interpolations_heatmaps = self.interpolation_heatmaps.draw_samples(
(nb_images,), random_state=rngs[1]
)
# Note that `interpolations_heatmaps == self.SAME_AS_IMAGES`
# works here only if the datatype of the array is such that it
# may contain strings. It does not work properly for e.g.
# integer arrays and will produce a single bool output, even
# for arrays with more than one entry.
same_as_imgs_idx = [ip == self.SAME_AS_IMAGES
for ip in interpolations_heatmaps]
interpolations_heatmaps[same_as_imgs_idx] = \
interpolations[same_as_imgs_idx]
if self.interpolation_segmaps == KeepSizeByResize.SAME_AS_IMAGES:
interpolations_segmaps = np.copy(interpolations)
else:
# TODO This used previously the same seed as the heatmaps part
# leading to the same sampled values. Was that intentional?
# Doesn't look like it should be that way.
interpolations_segmaps = self.interpolation_segmaps.draw_samples(
(nb_images,), random_state=rngs[2]
)
same_as_imgs_idx = [ip == self.SAME_AS_IMAGES
for ip in interpolations_segmaps]
interpolations_segmaps[same_as_imgs_idx] = \
interpolations[same_as_imgs_idx]
return interpolations, interpolations_heatmaps, interpolations_segmaps
def _to_deterministic(self):
aug = self.copy()
aug.children = aug.children.to_deterministic()
aug.deterministic = True
aug.random_state = self.random_state.derive_rng_()
return aug
def get_parameters(self):
return [self.interpolation, self.interpolation_heatmaps]
def get_children_lists(self):
return [self.children]
def __str__(self):
pattern = (
"%s("
"interpolation=%s, "
"interpolation_heatmaps=%s, "
"name=%s, "
"children=%s, "
"deterministic=%s"
")")
return pattern % (
self.__class__.__name__, self.interpolation,
self.interpolation_heatmaps, self.name, self.children,
self.deterministic)
| true | true |
f702d36d493f53a3b370731decea28a5e15dc587 | 2,317 | py | Python | tests/memory.py | vpaeder/pymcp2221 | 90f9ae85d7b852128d642e1382f9a7628fc72057 | [
"MIT"
] | null | null | null | tests/memory.py | vpaeder/pymcp2221 | 90f9ae85d7b852128d642e1382f9a7628fc72057 | [
"MIT"
] | null | null | null | tests/memory.py | vpaeder/pymcp2221 | 90f9ae85d7b852128d642e1382f9a7628fc72057 | [
"MIT"
] | null | null | null | from .common import *
__all__ = ["TestReadWriteMemory"]
class TestReadWriteMemory(MCPTestCase):
def test_read_flash_ok(self):
self.mcp.dev.read.return_value = self.xb0_00
self.assertEqual(self.mcp._read_flash(FlashDataSubcode.ChipSettings), self.xb0_00[4:14])
def test_read_sram_ok(self):
self.mcp.dev.read.return_value = self.x61
self.assertEqual(self.mcp._read_sram(SramDataSubcode.ChipSettings), self.x61[4:22])
self.assertEqual(self.mcp._read_sram(SramDataSubcode.GPSettings), self.x61[22:26])
def test_read_flash_byte_ok(self):
self.mcp.dev.read.return_value = self.xb0_00
for n in range(0,9):
result = self.mcp._read_flash_byte(FlashDataSubcode.ChipSettings, n, range(8))
value = int("".join(["1" if x else "0" for x in reversed(result)]),2)
self.assertEqual(value, self.xb0_00[4+n])
def test_read_sram_byte_ok(self):
self.mcp.dev.read.return_value = self.x61
for n in range(0,9):
result = self.mcp._read_sram_byte(SramDataSubcode.ChipSettings, n, range(8))
value = int("".join(["1" if x else "0" for x in reversed(result)]),2)
self.assertEqual(value, self.x61[4+n])
def test_write_flash_byte_ok(self):
# tests that 'write_flash_byte' sends the right data to hid write command
xb1_00 = bytearray(64)
xb1_00[0] = 0xb1
with patch.object(self.mcp, "_read_response", return_value = self.xb0_00):
for byte in range(9):
for bit in range(8):
xb1_00[2:12] = self.xb0_00[4:14]
xb1_00[2+byte] = self.mcp._MCP2221__and(xb1_00[2+byte], 0xff - (1<<bit))
self.mcp._write_flash_byte(FlashDataSubcode.ChipSettings, byte, [bit], [False])
self.assertEqual(self.mcp.dev.write.call_args[0][0], xb1_00)
def test_write_sram_ok(self):
# tests that 'write_sram' sends the right data to hid write command
with patch.object(self.mcp, "_read_response", return_value = self.x61):
v = 0xff
for byte in range(9):
self.mcp._write_sram(SramDataSubcode.ChipSettings, byte, v)
self.assertEqual(self.mcp.dev.write.call_args[0][0][2+byte], v)
| 47.285714 | 99 | 0.634009 | from .common import *
__all__ = ["TestReadWriteMemory"]
class TestReadWriteMemory(MCPTestCase):
def test_read_flash_ok(self):
self.mcp.dev.read.return_value = self.xb0_00
self.assertEqual(self.mcp._read_flash(FlashDataSubcode.ChipSettings), self.xb0_00[4:14])
def test_read_sram_ok(self):
self.mcp.dev.read.return_value = self.x61
self.assertEqual(self.mcp._read_sram(SramDataSubcode.ChipSettings), self.x61[4:22])
self.assertEqual(self.mcp._read_sram(SramDataSubcode.GPSettings), self.x61[22:26])
def test_read_flash_byte_ok(self):
self.mcp.dev.read.return_value = self.xb0_00
for n in range(0,9):
result = self.mcp._read_flash_byte(FlashDataSubcode.ChipSettings, n, range(8))
value = int("".join(["1" if x else "0" for x in reversed(result)]),2)
self.assertEqual(value, self.xb0_00[4+n])
def test_read_sram_byte_ok(self):
self.mcp.dev.read.return_value = self.x61
for n in range(0,9):
result = self.mcp._read_sram_byte(SramDataSubcode.ChipSettings, n, range(8))
value = int("".join(["1" if x else "0" for x in reversed(result)]),2)
self.assertEqual(value, self.x61[4+n])
def test_write_flash_byte_ok(self):
xb1_00 = bytearray(64)
xb1_00[0] = 0xb1
with patch.object(self.mcp, "_read_response", return_value = self.xb0_00):
for byte in range(9):
for bit in range(8):
xb1_00[2:12] = self.xb0_00[4:14]
xb1_00[2+byte] = self.mcp._MCP2221__and(xb1_00[2+byte], 0xff - (1<<bit))
self.mcp._write_flash_byte(FlashDataSubcode.ChipSettings, byte, [bit], [False])
self.assertEqual(self.mcp.dev.write.call_args[0][0], xb1_00)
def test_write_sram_ok(self):
with patch.object(self.mcp, "_read_response", return_value = self.x61):
v = 0xff
for byte in range(9):
self.mcp._write_sram(SramDataSubcode.ChipSettings, byte, v)
self.assertEqual(self.mcp.dev.write.call_args[0][0][2+byte], v)
| true | true |
f702d376e02116e4fdc4ce32b9b5c0c6704c892d | 1,829 | py | Python | pi/pi.py | saneravi/ML_Stuff | 74e1ed7ba9f4dccb555792315a14ba6071150304 | [
"MIT"
] | 209 | 2015-01-02T03:47:12.000Z | 2022-03-06T16:54:47.000Z | pi/pi.py | Kerwin-Xie/algorithms | 4347a9b7bf54ef378d16d26ef9e357ddc710664b | [
"MIT"
] | 3 | 2015-12-06T14:40:34.000Z | 2021-03-22T17:40:24.000Z | pi/pi.py | Kerwin-Xie/algorithms | 4347a9b7bf54ef378d16d26ef9e357ddc710664b | [
"MIT"
] | 114 | 2015-01-31T08:37:10.000Z | 2022-02-23T04:42:28.000Z | #!/usr/bin/env python
from decimal import Decimal, getcontext
from fractions import Fraction
digits = 500
getcontext().prec = digits
def leibnitz(n):
"""
Parameters
----------
n : int
Returns
-------
Fraction
Approximation of pi.
"""
pi = Fraction(0)
sign = 1
for k in range(1, n, 2):
pi = pi + sign*Fraction(4, k)
sign *= -1
return pi
def calc_pi(n):
"""
Calculate PI.
Parameters
----------
n : int
Number of fractions.
Returns
-------
Fraction
Approximation of pi.
"""
pi = Fraction(0)
for k in range(n):
# print(Fraction(-1,4)**k)
pi += (Fraction(-1, 4)**k * (Fraction(1, 1+2*k)
+ Fraction(2, 1+4*k)
+ Fraction(1, 3+4*k)))
return pi
def get_correct_digits(approx):
"""
Get how many digits were correct.
Parameters
----------
approx : str
String representation of an approximation of pi.
Returns
-------
int
The number of correct digits. If the number has too many correct
digits, -1 is returned.
"""
pi = ("3.14159265358979323846264338327950288419716939937510582097494459230"
"78164062862089986280348253421170679")
for i, el in enumerate(pi):
if len(approx) <= i:
return i-1
if el != approx[i]:
return i
return -1 # Very good!
if __name__ == "__main__":
# for n in range(1,180):
# approx = calc_pi(n)
# dec =Decimal(approx.numerator) / Decimal(approx.denominator)
# #print(dec)
# print("correct digits: %s (n=%i)" % (get_correct_digits(str(dec)),n))
n = digits
approx = calc_pi(n)
dec = Decimal(approx.numerator) / Decimal(approx.denominator)
print(dec)
| 21.022989 | 79 | 0.547294 |
from decimal import Decimal, getcontext
from fractions import Fraction
digits = 500
getcontext().prec = digits
def leibnitz(n):
pi = Fraction(0)
sign = 1
for k in range(1, n, 2):
pi = pi + sign*Fraction(4, k)
sign *= -1
return pi
def calc_pi(n):
pi = Fraction(0)
for k in range(n):
pi += (Fraction(-1, 4)**k * (Fraction(1, 1+2*k)
+ Fraction(2, 1+4*k)
+ Fraction(1, 3+4*k)))
return pi
def get_correct_digits(approx):
pi = ("3.14159265358979323846264338327950288419716939937510582097494459230"
"78164062862089986280348253421170679")
for i, el in enumerate(pi):
if len(approx) <= i:
return i-1
if el != approx[i]:
return i
return -1
if __name__ == "__main__":
n = digits
approx = calc_pi(n)
dec = Decimal(approx.numerator) / Decimal(approx.denominator)
print(dec)
| true | true |
f702d5de917640b0135e726ec3ce2820b1f09d38 | 1,295 | py | Python | app/data/check.py | redforge/Flask_Signin | b9fe05e0a9af07603622c22d8eba060c2d696d52 | [
"Unlicense"
] | 2 | 2018-08-08T20:26:16.000Z | 2020-06-03T01:06:27.000Z | app/data/check.py | redforge/Flask_Signin | b9fe05e0a9af07603622c22d8eba060c2d696d52 | [
"Unlicense"
] | 2 | 2018-08-08T23:26:19.000Z | 2018-08-08T23:41:33.000Z | app/data/check.py | threethan/Parts-and-Crafts-Sign-In | b9fe05e0a9af07603622c22d8eba060c2d696d52 | [
"Unlicense"
] | null | null | null | import os.path
from app.data.database import init_db, db_path, get_expected_pathname, set_path
def db_exists():
return os.path.isfile(db_path)
def check_db():
global db_path
if (db_path != get_expected_pathname()):
print('DB Check: Running backup')
backup_database_to(get_expected_pathname())
init_db()
if (not db_exists()):
print('DB Check: No database found. Making a new one...')
init_db()
from app.data.camper_editing import reset_locs
reset_locs()
def backup_database_to(filename):
global db_path
from shutil import copy2
s = open('data/BACKUPDATA', 'a+')
s.seek(0)
prev_path = s.read()
set_path(filename)
db_path = filename #this line is a crude fix for some messy scoping
s.truncate(0)
s.seek(0)
s.write(filename)
if (prev_path == ""):
print("No previous database found, a new one will be generated. This may happen if the BACKUPDATA file is missing or corrupt.")
return False
elif (prev_path == filename):
print("Tried to back up to the same file!")
else:
print ("backing up & copying")
from app.data.camper_editing import reset_locs
copy2(prev_path, filename)
reset_locs()
return filename
| 27.553191 | 135 | 0.650193 | import os.path
from app.data.database import init_db, db_path, get_expected_pathname, set_path
def db_exists():
return os.path.isfile(db_path)
def check_db():
global db_path
if (db_path != get_expected_pathname()):
print('DB Check: Running backup')
backup_database_to(get_expected_pathname())
init_db()
if (not db_exists()):
print('DB Check: No database found. Making a new one...')
init_db()
from app.data.camper_editing import reset_locs
reset_locs()
def backup_database_to(filename):
global db_path
from shutil import copy2
s = open('data/BACKUPDATA', 'a+')
s.seek(0)
prev_path = s.read()
set_path(filename)
db_path = filename
s.truncate(0)
s.seek(0)
s.write(filename)
if (prev_path == ""):
print("No previous database found, a new one will be generated. This may happen if the BACKUPDATA file is missing or corrupt.")
return False
elif (prev_path == filename):
print("Tried to back up to the same file!")
else:
print ("backing up & copying")
from app.data.camper_editing import reset_locs
copy2(prev_path, filename)
reset_locs()
return filename
| true | true |
f702d66e53c80b655a01fddefa34c998ecff7a5e | 4,255 | py | Python | sdk/python/pulumi_aws_native/resourcegroups/get_group.py | pulumi/pulumi-aws-native | 1ae4a4d9c2256b2a79ca536f8d8497b28d10e4c3 | [
"Apache-2.0"
] | 29 | 2021-09-30T19:32:07.000Z | 2022-03-22T21:06:08.000Z | sdk/python/pulumi_aws_native/resourcegroups/get_group.py | pulumi/pulumi-aws-native | 1ae4a4d9c2256b2a79ca536f8d8497b28d10e4c3 | [
"Apache-2.0"
] | 232 | 2021-09-30T19:26:26.000Z | 2022-03-31T23:22:06.000Z | sdk/python/pulumi_aws_native/resourcegroups/get_group.py | pulumi/pulumi-aws-native | 1ae4a4d9c2256b2a79ca536f8d8497b28d10e4c3 | [
"Apache-2.0"
] | 4 | 2021-11-10T19:42:01.000Z | 2022-02-05T10:15:49.000Z | # coding=utf-8
# *** WARNING: this file was generated by the Pulumi SDK Generator. ***
# *** Do not edit by hand unless you're certain you know what you are doing! ***
import warnings
import pulumi
import pulumi.runtime
from typing import Any, Mapping, Optional, Sequence, Union, overload
from .. import _utilities
from . import outputs
from ._enums import *
__all__ = [
'GetGroupResult',
'AwaitableGetGroupResult',
'get_group',
'get_group_output',
]
@pulumi.output_type
class GetGroupResult:
def __init__(__self__, arn=None, configuration=None, description=None, resource_query=None, resources=None, tags=None):
if arn and not isinstance(arn, str):
raise TypeError("Expected argument 'arn' to be a str")
pulumi.set(__self__, "arn", arn)
if configuration and not isinstance(configuration, list):
raise TypeError("Expected argument 'configuration' to be a list")
pulumi.set(__self__, "configuration", configuration)
if description and not isinstance(description, str):
raise TypeError("Expected argument 'description' to be a str")
pulumi.set(__self__, "description", description)
if resource_query and not isinstance(resource_query, dict):
raise TypeError("Expected argument 'resource_query' to be a dict")
pulumi.set(__self__, "resource_query", resource_query)
if resources and not isinstance(resources, list):
raise TypeError("Expected argument 'resources' to be a list")
pulumi.set(__self__, "resources", resources)
if tags and not isinstance(tags, list):
raise TypeError("Expected argument 'tags' to be a list")
pulumi.set(__self__, "tags", tags)
@property
@pulumi.getter
def arn(self) -> Optional[str]:
"""
The Resource Group ARN.
"""
return pulumi.get(self, "arn")
@property
@pulumi.getter
def configuration(self) -> Optional[Sequence['outputs.GroupConfigurationItem']]:
return pulumi.get(self, "configuration")
@property
@pulumi.getter
def description(self) -> Optional[str]:
"""
The description of the resource group
"""
return pulumi.get(self, "description")
@property
@pulumi.getter(name="resourceQuery")
def resource_query(self) -> Optional['outputs.GroupResourceQuery']:
return pulumi.get(self, "resource_query")
@property
@pulumi.getter
def resources(self) -> Optional[Sequence[str]]:
return pulumi.get(self, "resources")
@property
@pulumi.getter
def tags(self) -> Optional[Sequence['outputs.GroupTag']]:
return pulumi.get(self, "tags")
class AwaitableGetGroupResult(GetGroupResult):
# pylint: disable=using-constant-test
def __await__(self):
if False:
yield self
return GetGroupResult(
arn=self.arn,
configuration=self.configuration,
description=self.description,
resource_query=self.resource_query,
resources=self.resources,
tags=self.tags)
def get_group(name: Optional[str] = None,
opts: Optional[pulumi.InvokeOptions] = None) -> AwaitableGetGroupResult:
"""
Schema for ResourceGroups::Group
:param str name: The name of the resource group
"""
__args__ = dict()
__args__['name'] = name
if opts is None:
opts = pulumi.InvokeOptions()
if opts.version is None:
opts.version = _utilities.get_version()
__ret__ = pulumi.runtime.invoke('aws-native:resourcegroups:getGroup', __args__, opts=opts, typ=GetGroupResult).value
return AwaitableGetGroupResult(
arn=__ret__.arn,
configuration=__ret__.configuration,
description=__ret__.description,
resource_query=__ret__.resource_query,
resources=__ret__.resources,
tags=__ret__.tags)
@_utilities.lift_output_func(get_group)
def get_group_output(name: Optional[pulumi.Input[str]] = None,
opts: Optional[pulumi.InvokeOptions] = None) -> pulumi.Output[GetGroupResult]:
"""
Schema for ResourceGroups::Group
:param str name: The name of the resource group
"""
...
| 33.242188 | 123 | 0.66134 |
import warnings
import pulumi
import pulumi.runtime
from typing import Any, Mapping, Optional, Sequence, Union, overload
from .. import _utilities
from . import outputs
from ._enums import *
__all__ = [
'GetGroupResult',
'AwaitableGetGroupResult',
'get_group',
'get_group_output',
]
@pulumi.output_type
class GetGroupResult:
def __init__(__self__, arn=None, configuration=None, description=None, resource_query=None, resources=None, tags=None):
if arn and not isinstance(arn, str):
raise TypeError("Expected argument 'arn' to be a str")
pulumi.set(__self__, "arn", arn)
if configuration and not isinstance(configuration, list):
raise TypeError("Expected argument 'configuration' to be a list")
pulumi.set(__self__, "configuration", configuration)
if description and not isinstance(description, str):
raise TypeError("Expected argument 'description' to be a str")
pulumi.set(__self__, "description", description)
if resource_query and not isinstance(resource_query, dict):
raise TypeError("Expected argument 'resource_query' to be a dict")
pulumi.set(__self__, "resource_query", resource_query)
if resources and not isinstance(resources, list):
raise TypeError("Expected argument 'resources' to be a list")
pulumi.set(__self__, "resources", resources)
if tags and not isinstance(tags, list):
raise TypeError("Expected argument 'tags' to be a list")
pulumi.set(__self__, "tags", tags)
@property
@pulumi.getter
def arn(self) -> Optional[str]:
return pulumi.get(self, "arn")
@property
@pulumi.getter
def configuration(self) -> Optional[Sequence['outputs.GroupConfigurationItem']]:
return pulumi.get(self, "configuration")
@property
@pulumi.getter
def description(self) -> Optional[str]:
return pulumi.get(self, "description")
@property
@pulumi.getter(name="resourceQuery")
def resource_query(self) -> Optional['outputs.GroupResourceQuery']:
return pulumi.get(self, "resource_query")
@property
@pulumi.getter
def resources(self) -> Optional[Sequence[str]]:
return pulumi.get(self, "resources")
@property
@pulumi.getter
def tags(self) -> Optional[Sequence['outputs.GroupTag']]:
return pulumi.get(self, "tags")
class AwaitableGetGroupResult(GetGroupResult):
# pylint: disable=using-constant-test
def __await__(self):
if False:
yield self
return GetGroupResult(
arn=self.arn,
configuration=self.configuration,
description=self.description,
resource_query=self.resource_query,
resources=self.resources,
tags=self.tags)
def get_group(name: Optional[str] = None,
opts: Optional[pulumi.InvokeOptions] = None) -> AwaitableGetGroupResult:
__args__ = dict()
__args__['name'] = name
if opts is None:
opts = pulumi.InvokeOptions()
if opts.version is None:
opts.version = _utilities.get_version()
__ret__ = pulumi.runtime.invoke('aws-native:resourcegroups:getGroup', __args__, opts=opts, typ=GetGroupResult).value
return AwaitableGetGroupResult(
arn=__ret__.arn,
configuration=__ret__.configuration,
description=__ret__.description,
resource_query=__ret__.resource_query,
resources=__ret__.resources,
tags=__ret__.tags)
@_utilities.lift_output_func(get_group)
def get_group_output(name: Optional[pulumi.Input[str]] = None,
opts: Optional[pulumi.InvokeOptions] = None) -> pulumi.Output[GetGroupResult]:
...
| true | true |
f702d67213c52e98de50c82d2ad8245c7db39257 | 926 | py | Python | 10.Algorithms_Data_Structure/Searching_n_Sorting/QuickSort.py | cuicaihao/Data_Science_Python | ca4cb64bf9afc1011c192586362d0dd036e9441e | [
"MIT"
] | 2 | 2018-04-26T12:11:41.000Z | 2018-10-09T19:37:57.000Z | 10.Algorithms_Data_Structure/Searching_n_Sorting/QuickSort.py | cuicaihao/Data_Science_Python | ca4cb64bf9afc1011c192586362d0dd036e9441e | [
"MIT"
] | null | null | null | 10.Algorithms_Data_Structure/Searching_n_Sorting/QuickSort.py | cuicaihao/Data_Science_Python | ca4cb64bf9afc1011c192586362d0dd036e9441e | [
"MIT"
] | 4 | 2018-10-09T19:37:59.000Z | 2021-01-23T11:31:16.000Z | import numpy as np
def partition(arr, low, high):
i = (low-1) # index of smaller element
pivot = arr[high] # pivot
for j in range(low, high):
# If current element is smaller than the pivot
if arr[j] < pivot:
# increment index of smaller element
i = i+1
arr[i], arr[j] = arr[j], arr[i]
arr[i+1], arr[high] = arr[high], arr[i+1]
return (i + 1)
def quickSort(arr, low, high):
if low < high:
# pi is partitioning index, arr[p] is now
# at right place
pi = partition(arr, low, high)
# Separately sort elements before
# partition and after partition
quickSort(arr, low, pi-1)
quickSort(arr, pi + 1, high)
# Driver code to test above
# arr = [10, 7, 8, 9, 1, 5]
arr = np.random.randint(0, 1000000, 200000)
n = len(arr)
quickSort(arr, 0, n-1)
# print(f"Sorted array is: {arr}")
| 23.74359 | 54 | 0.560475 | import numpy as np
def partition(arr, low, high):
i = (low-1)
pivot = arr[high]
for j in range(low, high):
if arr[j] < pivot:
i = i+1
arr[i], arr[j] = arr[j], arr[i]
arr[i+1], arr[high] = arr[high], arr[i+1]
return (i + 1)
def quickSort(arr, low, high):
if low < high:
pi = partition(arr, low, high)
quickSort(arr, low, pi-1)
quickSort(arr, pi + 1, high)
arr = np.random.randint(0, 1000000, 200000)
n = len(arr)
quickSort(arr, 0, n-1)
| true | true |
f702d6e6217d88af39f7200ed453d1d9edb2e766 | 20,236 | py | Python | idm/load_test.py | handavid/perf-scripts | 910cdc0a10f2d3fde703726ea270487bedec50df | [
"Apache-2.0"
] | null | null | null | idm/load_test.py | handavid/perf-scripts | 910cdc0a10f2d3fde703726ea270487bedec50df | [
"Apache-2.0"
] | null | null | null | idm/load_test.py | handavid/perf-scripts | 910cdc0a10f2d3fde703726ea270487bedec50df | [
"Apache-2.0"
] | null | null | null | #!/bin/env python3
# Steps requried to use
# install requried libraries
# (root)# dnf install python3-ldap3
#
# Create python virtual environment directory
# (user)$ python3 -m venv ./venv3
#
# Enable virtual environment
# (user)$ source ./venv3/bin/activate
#
# Update pip and then install needed libary
# (user-venv3)$ pip install --upgrade pip
# (user-venv3)$ pip install python-freeipa
# (user-venv3)$ pip install ldap3
#
# Execute Script:
# (user-venv3)$ ./load_test.py -h
# -- not required, saved as a note
# dnf install python3-requests-kerberos python3-requests-gssapi
import sys
import time
from datetime import datetime
import re
import argparse
import logging
#from linetimer import CodeTimer
import itertools
import pprint
import subprocess
import socket
import dns.resolver
import urllib3
urllib3.disable_warnings(urllib3.exceptions.InsecureRequestWarning)
# from ldap3 import Server, Connection, ALL, MODIFY_ADD
import ldap3
from python_freeipa import ClientMeta
# import requests
#from requests_kerberos import HTTPKerberosAuth
# generate a 4 digit randomizer from the current time
# randomizer = int(time.time()) % 10000
randomizer = datetime.now().strftime("%d%H%M")
start_timestr = datetime.now().strftime("%Y%m%d %H:%M")
start_time = time.time()
uid_template = "tuser{}_{{seq}}".format(randomizer)
pp=pprint.PrettyPrinter(indent=2)
class LogFilter(object):
def __init__(self,level,type='ge'):
self.__level = level
self.__type = type
def filter(self, logRecord):
if self.__type == 'ge':
return logRecord.levelno >= self.__level
elif self.__type == 'eq':
return logRecord.levelno == self.__level
else:
return logRecord.levelno <= self.__level
class MyLogger(logging.getLoggerClass()):
_PERF = 21
def __init__(self, name, **kwargs ):
super().__init__(name, **kwargs)
logging.addLevelName(self._PERF, 'PERF')
def perf(self, message, *args, **kwargs):
if self.isEnabledFor(self._PERF):
self._log(self._PERF, message, args, **kwargs)
logging.setLoggerClass(MyLogger)
logger = logging.getLogger('IDM_user_load_tester')
logger.setLevel(logging.INFO)
_stout_handler = logging.StreamHandler()
_stout_handler.setLevel(logging.INFO)
logger.addHandler(_stout_handler)
def iter_timer(iterable, step=10, label=""):
start = time.time()
last_t = start
loop_tag = "loop {}{}{{}}".format(label, " "*bool(label))
logger.perf(loop_tag.format("start"))
pos = 0
# step_count=len(iterable)//step
for item in iterable:
pos = pos + 1
if pos != 0 and pos % step == 0:
logger.perf("{}: {:4.3f} {:4.3f}".format(item,time.time() - start, time.time() - last_t))
last_t = time.time()
yield item
logger.perf("{}: {:4.3f} {:4.3f}".format(pos,time.time() - start, time.time() - last_t))
logger.perf(loop_tag.format("end"))
def loop_timer(count,step=10,label=""):
start = time.time()
last_t = start
loop_tag = "loop {}{}{{}}".format(label, " "*bool(label))
logger.perf(loop_tag.format("start"))
for item in range(count):
if item != 0 and item % step == 0:
logger.perf("{}: {:4.3f} {:4.3f}".format(item,time.time() - start, time.time() - last_t))
last_t = time.time()
yield item
logger.perf("{}: {:4.3f} {:4.3f}".format(count,time.time() - start, time.time() - last_t))
logger.perf(loop_tag.format("end"))
# creates a generator to iterate through a list in chunks
# returns an iterator chunk of the iterable of up to the given size.
def chunker(iterable, size):
it = iter(iterable)
while True:
chunk = tuple(itertools.islice(it,size))
if not chunk:
return
yield chunk
def dump_ldap_stats(reset=True):
logger.debug(ldap_conn.usage)
if reset:
ldap_conn.usage.reset()
def generate_user(seq_num, ldif_out=False, dc_dn=None):
#create a list/dict of user entries to use for passing to a function
user = {}
user["a_uid"] = uid_template.format(seq=seq_num)
user["o_givenname"] = str(seq_num)
user["o_sn"] = "tuser_{}".format(randomizer)
user["o_cn"] = "{} {}".format(user["o_givenname"], user["o_sn"])
user["o_preferredlanguage"]='EN'
user["o_employeetype"]="Created via load_test.py. Run started at: {}".format(start_timestr)
# if the user is to be used for LDIF, strip the first two prepended chars
if ldif_out:
clean_rex = r"^._"
keylist = list(user.keys())
user['attributes']={}
for key in keylist:
new_key = re.sub(clean_rex,'',key)
user['attributes'][new_key]=user[key]
del user[key]
if dc_dn is not None:
user['dn']="uid={},cn=staged users,cn=accounts,cn=provisioning,{}".format(user['attributes']['uid'],dc_dn)
user['object_class']=['top','inetorgperson']
return user
def add_users_api(total):
users=[]
for i in loop_timer(args.count,args.count//10,label="user_add_api"):
user = generate_user(i)
users.append(user["a_uid"])
logger.debug(user)
if args.stage:
user_out = client.stageuser_add(**user)
else:
user_out = client.user_add(**user)
logger.debug(user_out)
return users
def add_users_stage(total):
users=[]
if args.ldap_stage:
for i in loop_timer(args.count,args.count//10,label="user_add_stage_ldap"):
user = generate_user(i, ldif_out=True, dc_dn=dom_dn)
users.append(user['attributes']['uid'])
user_dn=user['dn']
del user['dn']
ldap_conn.add(user_dn,**user)
else:
for i in loop_timer(args.count,args.count//10,label="user_add_stage"):
user = generate_user(i)
users.append(user["a_uid"])
logger.debug(user)
user_out = client.stageuser_add(**user)
logger.debug(user_out)
for i in iter_timer(users,args.count//10,label="user_activate"):
activate_out = client.stageuser_activate(i)
logger.debug(activate_out)
return users
def get_users(template):
logger.perf("Checking for user template '{}'".format(template))
if client.user_find(template,o_sizelimit=1)['count'] > 0:
users = [ user['uid'][0] for user in client.user_find(template,o_sizelimit=0,o_timelimit=0)['result']]
logger.perf("Found {} users".format(len(users)))
else:
logger.perf("Unable to find user template")
exit(1)
return users
def get_users_ldap(template):
logger.perf("Checking for user template '{}'".format(template))
results = client.user_find(template,o_sizelimit=1)
if results['count'] > 0:
result=results['result'][0]
uid = result['uid'][0]
user_dn=result['dn']
base_dn = re.sub("uid={},".format(uid),'',user_dn)
entry_gen = ldap_conn.extend.standard.paged_search(search_base = base_dn,
search_filter = "(uid={}*)".format(template),
search_scope = ldap3.SUBTREE,
attributes = '*',
paged_size=1000,
generator=True)
total = 0
users=[]
for entry in entry_gen:
# print(entry)
total += 1
if total % 10000 == 0:
logger.perf("Loaded {} users".format(total))
dump_ldap_stats()
# extract user uid. For some reason uid is a list, we only need the first
users.append(entry['attributes']['uid'][0])
if args.user_limit>-1 and total >= args.user_limit:
break
logger.perf("Loaded {} users".format(len(users)))
dump_ldap_stats()
else:
logger.perf("Unable to find user template")
exit(1)
return users
def create_group_add_users_api(i,users):
group_name = "group{}_{}".format(randomizer,i)
group_desc = "Test group vor load_test.py. Run started at: {}".format(start_timestr)
logger.info("Creating group: {}".format(group_name))
result = client.group_add(group_name, o_description=group_desc)
if result["value"]==group_name:
logger.info("Success")
logger.debug(result)
logger.perf("Group: {}".format(group_name))
logger.info("Adding {} users".format(len(users)))
result = client.group_add_member(group_name, o_user=users)
logger.info("Done")
logger.debug(result)
def create_group_add_users_ldap(i,users,ldap_conn,base_user_dn,chunk=-1):
group_name = "group{}_{}".format(randomizer,i)
group_desc = "Test group vor load_test.py. Run started at: {}".format(start_timestr)
logger.info("Creating group: {}".format(group_name))
result = client.group_add(group_name, o_description=group_desc,o_raw=True)
group_dn=result['result']['dn']
logger.debug(result)
mod_group_users_ldap(users, ldap_conn, base_user_dn, group_dn, ldap3.MODIFY_ADD, chunk)
def remove_group_users_ldap(users, ldap_conn, base_user_dn, group_name, group_dn, chunk=-1):
logger.info("Group to delete: {}".format(group_dn))
start = time.time()
mod_group_users_ldap(users, ldap_conn, base_user_dn, group_dn, ldap3.MODIFY_DELETE, chunk)
logger.perf("Removing users from group took: {:4.3f}".format(time.time() - start))
result = client.group_show(group_name)
logger.info("Group show: {}".format(result))
logger.info("Delete group from IDM: {}".format(group_dn))
start = time.time()
result = client.group_del(group_name)
logger.perf("Delete group using API took: {:4.3f}".format(time.time() - start))
logger.info("Group del resul: {}".format(result))
def ldap_modify_retry(*fargs, **kwargs):
for retry_num in range(args.max_retries+1):
try:
return(ldap_conn.modify(*fargs,**kwargs))
except Exception as e:
logger.perf("Exception Occured")
logger.perf("'{}'".format(e))
logger.perf("{} retries left".format(args.max_retries-retry_num))
ldap_conn.unbind()
ldap_conn.bind()
logger.info("LDAP Connection rebound")
def mod_group_users_ldap(users, ldap_conn, base_user_dn, group_dn, ldap_mod_op, chunk=-1):
if chunk==-1:
chunk=len(users)
user_dn_list = [base_user_dn.format(user) for user in users]
for user_dn_chunk in chunker(user_dn_list,chunk):
# print(user_dn_chunk)
logger.perf("Chunk ({})".format(len(user_dn_chunk)))
logger.debug("Showing fist 20 of user_dn_chunk: {}".format(user_dn_chunk[:20]))
# result = ldap_conn.modify(group_dn,{"member":[(ldap_mod_op, user_dn_chunk)]})
result = ldap_modify_retry(group_dn,{"member":[(ldap_mod_op, user_dn_chunk)]})
dump_ldap_stats()
logger.debug("LDAP Modify result: {}".format(result))
if args.rebind:
logger.perf("rebinding LDAP connection")
ldap_conn.unbind()
ldap_conn.bind()
if args.delay>0:
logger.perf("Sleeping {} seconds".format(args.delay))
time.sleep(args.delay)
def check_dns_record(server, domain, record):
resolver = dns.resolver.Resolver()
resolver.nameservers=[socket.gethostbyname(server)]
try:
rdata = resolver.query(record + "." + domain)
logger.perf("Server [{}] answered with [{}]".format(server, rdata[0].address))
return 1
except dns.resolver.NXDOMAIN:
logger.perf("Record [{}] doesn't exist on server [{}]".format(record + "." + domain, server))
return 0
parser = argparse.ArgumentParser(description="Generate load test data for IdM",
formatter_class=argparse.ArgumentDefaultsHelpFormatter)
parser.add_argument('-v', dest='verbosity', action='count', default=0,
help="Increase Verbosity, default is errors only. Only effective up to 3 levels.")
parser.add_argument('-c', type=int, dest='count',
help="Total count of users to add")
parser.add_argument('-g', dest='group_count', default=1, type=int,
help="Number of groups to create")
parser.add_argument('-S', dest='server', type=str,
help="Server to connect to")
parser.add_argument('-U', dest='user', type=str,
help="User account to use for connect")
parser.add_argument('-P', dest='password', type=str,
help="Password for connection")
parser.add_argument('--stage', dest='stage', action='store_true', default=False,
help="Create user in stage not active")
parser.add_argument('--stage-ldap', dest='ldap_stage', default=False, action='store_true',
help='Create stage users via ldap not API')
parser.add_argument('--ldap-group', dest='ldap_group', default=False, action='store_true',
help="Add users to group using LDAP directly")
parser.add_argument('--ldap-group-remove', dest='ldap_group_del', type=str,
help="Remove users from group using LDAP directly")
parser.add_argument('-C', dest='chunk', type=int, default=-1,
help="Chunk size for batching user adds to groups, -1 means all users given in count")
parser.add_argument('-r', dest='reuse_template', type=str,
help="Reuse existing users for group add using given user naming template")
parser.add_argument('-D', dest='delay',type=int, default=0,
help="Delay N seconds between chunks")
parser.add_argument('--rebind', dest='rebind',default=False,action='store_true',
help="Perform a unmind/bind operation between ldap operations.")
parser.add_argument('-l', dest='user_limit', type=int, default=-1,
help="Limit the number of users returned by reuse")
parser.add_argument('--max-retries',dest='max_retries', type=int, default=0,
help="Maximum number of retries for a failed chunk operation")
parser.add_argument('--check-repl', dest='check_repl',default=False,action='store_true',
help="Check when replication is finished by adding a DNS record")
args=parser.parse_args()
# setting up logger here to prevent log files being generated when showing help
perf_logfile = "perf_{}".format(randomizer)
_perf_handler = logging.FileHandler(perf_logfile)
_perf_formatter = logging.Formatter("%(asctime)s; %(message)s")
_perf_handler.setFormatter(_perf_formatter)
_perf_handler.addFilter(LogFilter(MyLogger._PERF,type='eq'))
logger.addHandler(_perf_handler)
if args.verbosity:
# Error is a level of 40.
level=30-(args.verbosity*10)
if level<0:
level=0
logger.setLevel(level)
levels={ 5: "CRITICAL",
4: "ERROR",
3: "WARNING",
2: "INFO",
1: "DEBUG",
0: "ALL" }
if level!=30:
log_file = "log_{}".format(randomizer)
_file_handler = logging.FileHandler(log_file)
_file_formatter = logging.Formatter('%(asctime)s %(levelname)s :: %(message)s')
_file_handler.setFormatter(_file_formatter)
_file_handler.addFilter(LogFilter(level))
logger.addHandler(_file_handler)
logger.info("Logging to file '{}'".format(log_file))
logger.info("Debug level: {0} ({1})".format(levels[level // 10],level))
# client = ClientMeta('ipaserver0.example.com',False)
# client.login('admin', 'admin123')
# kerberos seems broken using OS rpms on RHEL 8
#client.login_kerberos()
# user = client.user_add('test4', 'John', 'Doe', 'John Doe', o_preferredlanguage='EN')
# Output some data to the user about the script options passed in
# Not working as expected when git not found
try:
commit_info = str(subprocess.check_output(['git', 'log', '-n', '1', '--pretty=tformat:"%ci %H"']),"utf-8").strip()
logger.perf("Commit Info: {}".format(commit_info))
except:
logger.perf("No git info found")
pass
logger.perf("Start Time: {}".format(start_timestr))
logger.perf("User count: {} Group count: {}".format(args.count,args.group_count))
logger.perf("Server: {}".format(args.server))
logger.perf("Perf Log file: {}".format(perf_logfile))
if args.stage:
if args.ldap_stage:
logger.perf("Creating Stage users via ldap")
else:
logger.perf("Creating Stage users via API")
else:
logger.perf("Creating active users via API")
if args.ldap_group:
logger.perf("Adding users to groups via LDAP")
if args.chunk>-1:
logger.perf(" Using a chunk size of {}".format(args.chunk))
else:
logger.perf("Adding users to groups via API")
if args.reuse_template:
logger.perf("Reusing users starting with: '{}'".format(args.reuse_template))
if args.user_limit>-1:
logger.perf(" Limiting reuse to first {} users found".format(args.user_limit))
logger.debug(args)
logger.perf('----')
# end start header
client = ClientMeta(args.server,False)
client.login(args.user, args.password)
dnszone = client.dnszone_find(o_forward_only=True)['result'][0]
servers = dnszone['nsrecord']
domain = dnszone['idnsname'][0]['__dns_name__']
logger.info("Found servers: {} for domain: [{}]".format(servers, domain))
if args.ldap_group or args.ldap_stage:
user_dn=client.user_show(args.user,o_all=True)['result']['dn']
base_user_dn = re.sub("^uid={}".format(args.user),'uid={}',user_dn)
dom_dn = re.search("(dc=.*)",user_dn, re.IGNORECASE).group(1)
ldap_server = ldap3.Server(args.server, get_info=ldap3.ALL)
ldap_conn = ldap3.Connection(ldap_server,user=user_dn, password=args.password, auto_bind=True, collect_usage=True)
if args.reuse_template:
user_dn=client.user_show(args.user,o_all=True)['result']['dn']
base_user_dn = re.sub("^uid={},".format(args.user),'',user_dn)
logger.debug("base_user_dn: {}".format(base_user_dn))
ldap_server = ldap3.Server(args.server, get_info=ldap3.ALL)
ldap_conn = ldap3.Connection(ldap_server,user=user_dn, password=args.password, auto_bind=True, collect_usage=True)
users=get_users_ldap(args.reuse_template)
else:
logger.info("Creating {} users".format(args.count))
logger.info("template: {}".format(uid_template))
logger.info("Checking for existing templated users")
user_check=client.user_find(uid_template.format(seq=0))
if user_check["count"]>0:
sec_to_wait = 61 - datetime.now().second
logger.error("Existing users found please wait {} seconds".format(sec_to_wait))
exit(1)
else:
logger.info("Proceeding")
if args.stage:
users = add_users_stage(args.count)
else:
users = add_users_api(args.count)
if args.ldap_group:
# print(ldap_server.info)
# for i in iter_timer(range(args.group_count),step=1,label="group_add_user_ldap"):
# create_group_add_users_ldap(i,users,ldap_conn,base_user_dn,chunk=args.chunk)
for i in loop_timer(args.group_count,1,label="group_add_user_ldap"):
create_group_add_users_ldap(i,users,ldap_conn,base_user_dn,chunk=args.chunk)
elif args.ldap_group_del is not None:
user_dn=client.user_show(args.user,o_all=True)['result']['dn']
group_dn=client.group_show(args.ldap_group_del,o_all=True)['result']['dn']
base_user_dn = re.sub("^uid={}".format(args.user),'uid={}',user_dn)
ldap_server = ldap3.Server(args.server, get_info=ldap3.ALL)
ldap_conn = ldap3.Connection(ldap_server,user=user_dn, password=args.password, auto_bind=True)
remove_group_users_ldap(users, ldap_conn, base_user_dn, args.ldap_group_del, group_dn, chunk=args.chunk)
else:
for i in loop_timer(args.group_count,1,label="group_add_user_api"):
create_group_add_users_api(i,users)
logger.perf('----')
logger.perf("End Time: {}".format(datetime.now().strftime("%Y%m%d %H:%M")))
run_time=time.time() - start_time
logger.perf("Total Run Time: {:.3f}sec".format(run_time))
logger.perf("Total Run time: {:d}min {:.3f}sec".format(int(run_time//60),run_time%60))
if args.check_repl:
record = "trecord{}".format(randomizer)
client.dnsrecord_add(a_dnszoneidnsname=domain, a_idnsname=record, o_a_part_ip_address='1.1.1.1')
check_result = 0
itr_ctr = 0
while check_result < len(servers) and itr_ctr < 600:
time.sleep(1)
check_result = 0
logger.perf("---- Iteration [{}] ----".format(itr_ctr))
for server in servers:
check_result += check_dns_record(server, domain, record)
itr_ctr += 1
logger.perf('----')
logger.perf("End Time with replication: {}".format(datetime.now().strftime("%Y%m%d %H:%M")))
run_time=time.time() - start_time
logger.perf("Total Run Time with replication: {:.3f}sec".format(run_time))
logger.perf("Total Run time with replication: {:d}min {:.3f}sec".format(int(run_time//60),run_time%60))
| 36.859745 | 117 | 0.676517 |
sys
import time
from datetime import datetime
import re
import argparse
import logging
import itertools
import pprint
import subprocess
import socket
import dns.resolver
import urllib3
urllib3.disable_warnings(urllib3.exceptions.InsecureRequestWarning)
import ldap3
from python_freeipa import ClientMeta
randomizer = datetime.now().strftime("%d%H%M")
start_timestr = datetime.now().strftime("%Y%m%d %H:%M")
start_time = time.time()
uid_template = "tuser{}_{{seq}}".format(randomizer)
pp=pprint.PrettyPrinter(indent=2)
class LogFilter(object):
def __init__(self,level,type='ge'):
self.__level = level
self.__type = type
def filter(self, logRecord):
if self.__type == 'ge':
return logRecord.levelno >= self.__level
elif self.__type == 'eq':
return logRecord.levelno == self.__level
else:
return logRecord.levelno <= self.__level
class MyLogger(logging.getLoggerClass()):
_PERF = 21
def __init__(self, name, **kwargs ):
super().__init__(name, **kwargs)
logging.addLevelName(self._PERF, 'PERF')
def perf(self, message, *args, **kwargs):
if self.isEnabledFor(self._PERF):
self._log(self._PERF, message, args, **kwargs)
logging.setLoggerClass(MyLogger)
logger = logging.getLogger('IDM_user_load_tester')
logger.setLevel(logging.INFO)
_stout_handler = logging.StreamHandler()
_stout_handler.setLevel(logging.INFO)
logger.addHandler(_stout_handler)
def iter_timer(iterable, step=10, label=""):
start = time.time()
last_t = start
loop_tag = "loop {}{}{{}}".format(label, " "*bool(label))
logger.perf(loop_tag.format("start"))
pos = 0
for item in iterable:
pos = pos + 1
if pos != 0 and pos % step == 0:
logger.perf("{}: {:4.3f} {:4.3f}".format(item,time.time() - start, time.time() - last_t))
last_t = time.time()
yield item
logger.perf("{}: {:4.3f} {:4.3f}".format(pos,time.time() - start, time.time() - last_t))
logger.perf(loop_tag.format("end"))
def loop_timer(count,step=10,label=""):
start = time.time()
last_t = start
loop_tag = "loop {}{}{{}}".format(label, " "*bool(label))
logger.perf(loop_tag.format("start"))
for item in range(count):
if item != 0 and item % step == 0:
logger.perf("{}: {:4.3f} {:4.3f}".format(item,time.time() - start, time.time() - last_t))
last_t = time.time()
yield item
logger.perf("{}: {:4.3f} {:4.3f}".format(count,time.time() - start, time.time() - last_t))
logger.perf(loop_tag.format("end"))
def chunker(iterable, size):
it = iter(iterable)
while True:
chunk = tuple(itertools.islice(it,size))
if not chunk:
return
yield chunk
def dump_ldap_stats(reset=True):
logger.debug(ldap_conn.usage)
if reset:
ldap_conn.usage.reset()
def generate_user(seq_num, ldif_out=False, dc_dn=None):
user = {}
user["a_uid"] = uid_template.format(seq=seq_num)
user["o_givenname"] = str(seq_num)
user["o_sn"] = "tuser_{}".format(randomizer)
user["o_cn"] = "{} {}".format(user["o_givenname"], user["o_sn"])
user["o_preferredlanguage"]='EN'
user["o_employeetype"]="Created via load_test.py. Run started at: {}".format(start_timestr)
if ldif_out:
clean_rex = r"^._"
keylist = list(user.keys())
user['attributes']={}
for key in keylist:
new_key = re.sub(clean_rex,'',key)
user['attributes'][new_key]=user[key]
del user[key]
if dc_dn is not None:
user['dn']="uid={},cn=staged users,cn=accounts,cn=provisioning,{}".format(user['attributes']['uid'],dc_dn)
user['object_class']=['top','inetorgperson']
return user
def add_users_api(total):
users=[]
for i in loop_timer(args.count,args.count//10,label="user_add_api"):
user = generate_user(i)
users.append(user["a_uid"])
logger.debug(user)
if args.stage:
user_out = client.stageuser_add(**user)
else:
user_out = client.user_add(**user)
logger.debug(user_out)
return users
def add_users_stage(total):
users=[]
if args.ldap_stage:
for i in loop_timer(args.count,args.count//10,label="user_add_stage_ldap"):
user = generate_user(i, ldif_out=True, dc_dn=dom_dn)
users.append(user['attributes']['uid'])
user_dn=user['dn']
del user['dn']
ldap_conn.add(user_dn,**user)
else:
for i in loop_timer(args.count,args.count//10,label="user_add_stage"):
user = generate_user(i)
users.append(user["a_uid"])
logger.debug(user)
user_out = client.stageuser_add(**user)
logger.debug(user_out)
for i in iter_timer(users,args.count//10,label="user_activate"):
activate_out = client.stageuser_activate(i)
logger.debug(activate_out)
return users
def get_users(template):
logger.perf("Checking for user template '{}'".format(template))
if client.user_find(template,o_sizelimit=1)['count'] > 0:
users = [ user['uid'][0] for user in client.user_find(template,o_sizelimit=0,o_timelimit=0)['result']]
logger.perf("Found {} users".format(len(users)))
else:
logger.perf("Unable to find user template")
exit(1)
return users
def get_users_ldap(template):
logger.perf("Checking for user template '{}'".format(template))
results = client.user_find(template,o_sizelimit=1)
if results['count'] > 0:
result=results['result'][0]
uid = result['uid'][0]
user_dn=result['dn']
base_dn = re.sub("uid={},".format(uid),'',user_dn)
entry_gen = ldap_conn.extend.standard.paged_search(search_base = base_dn,
search_filter = "(uid={}*)".format(template),
search_scope = ldap3.SUBTREE,
attributes = '*',
paged_size=1000,
generator=True)
total = 0
users=[]
for entry in entry_gen:
total += 1
if total % 10000 == 0:
logger.perf("Loaded {} users".format(total))
dump_ldap_stats()
users.append(entry['attributes']['uid'][0])
if args.user_limit>-1 and total >= args.user_limit:
break
logger.perf("Loaded {} users".format(len(users)))
dump_ldap_stats()
else:
logger.perf("Unable to find user template")
exit(1)
return users
def create_group_add_users_api(i,users):
group_name = "group{}_{}".format(randomizer,i)
group_desc = "Test group vor load_test.py. Run started at: {}".format(start_timestr)
logger.info("Creating group: {}".format(group_name))
result = client.group_add(group_name, o_description=group_desc)
if result["value"]==group_name:
logger.info("Success")
logger.debug(result)
logger.perf("Group: {}".format(group_name))
logger.info("Adding {} users".format(len(users)))
result = client.group_add_member(group_name, o_user=users)
logger.info("Done")
logger.debug(result)
def create_group_add_users_ldap(i,users,ldap_conn,base_user_dn,chunk=-1):
group_name = "group{}_{}".format(randomizer,i)
group_desc = "Test group vor load_test.py. Run started at: {}".format(start_timestr)
logger.info("Creating group: {}".format(group_name))
result = client.group_add(group_name, o_description=group_desc,o_raw=True)
group_dn=result['result']['dn']
logger.debug(result)
mod_group_users_ldap(users, ldap_conn, base_user_dn, group_dn, ldap3.MODIFY_ADD, chunk)
def remove_group_users_ldap(users, ldap_conn, base_user_dn, group_name, group_dn, chunk=-1):
logger.info("Group to delete: {}".format(group_dn))
start = time.time()
mod_group_users_ldap(users, ldap_conn, base_user_dn, group_dn, ldap3.MODIFY_DELETE, chunk)
logger.perf("Removing users from group took: {:4.3f}".format(time.time() - start))
result = client.group_show(group_name)
logger.info("Group show: {}".format(result))
logger.info("Delete group from IDM: {}".format(group_dn))
start = time.time()
result = client.group_del(group_name)
logger.perf("Delete group using API took: {:4.3f}".format(time.time() - start))
logger.info("Group del resul: {}".format(result))
def ldap_modify_retry(*fargs, **kwargs):
for retry_num in range(args.max_retries+1):
try:
return(ldap_conn.modify(*fargs,**kwargs))
except Exception as e:
logger.perf("Exception Occured")
logger.perf("'{}'".format(e))
logger.perf("{} retries left".format(args.max_retries-retry_num))
ldap_conn.unbind()
ldap_conn.bind()
logger.info("LDAP Connection rebound")
def mod_group_users_ldap(users, ldap_conn, base_user_dn, group_dn, ldap_mod_op, chunk=-1):
if chunk==-1:
chunk=len(users)
user_dn_list = [base_user_dn.format(user) for user in users]
for user_dn_chunk in chunker(user_dn_list,chunk):
logger.perf("Chunk ({})".format(len(user_dn_chunk)))
logger.debug("Showing fist 20 of user_dn_chunk: {}".format(user_dn_chunk[:20]))
result = ldap_modify_retry(group_dn,{"member":[(ldap_mod_op, user_dn_chunk)]})
dump_ldap_stats()
logger.debug("LDAP Modify result: {}".format(result))
if args.rebind:
logger.perf("rebinding LDAP connection")
ldap_conn.unbind()
ldap_conn.bind()
if args.delay>0:
logger.perf("Sleeping {} seconds".format(args.delay))
time.sleep(args.delay)
def check_dns_record(server, domain, record):
resolver = dns.resolver.Resolver()
resolver.nameservers=[socket.gethostbyname(server)]
try:
rdata = resolver.query(record + "." + domain)
logger.perf("Server [{}] answered with [{}]".format(server, rdata[0].address))
return 1
except dns.resolver.NXDOMAIN:
logger.perf("Record [{}] doesn't exist on server [{}]".format(record + "." + domain, server))
return 0
parser = argparse.ArgumentParser(description="Generate load test data for IdM",
formatter_class=argparse.ArgumentDefaultsHelpFormatter)
parser.add_argument('-v', dest='verbosity', action='count', default=0,
help="Increase Verbosity, default is errors only. Only effective up to 3 levels.")
parser.add_argument('-c', type=int, dest='count',
help="Total count of users to add")
parser.add_argument('-g', dest='group_count', default=1, type=int,
help="Number of groups to create")
parser.add_argument('-S', dest='server', type=str,
help="Server to connect to")
parser.add_argument('-U', dest='user', type=str,
help="User account to use for connect")
parser.add_argument('-P', dest='password', type=str,
help="Password for connection")
parser.add_argument('--stage', dest='stage', action='store_true', default=False,
help="Create user in stage not active")
parser.add_argument('--stage-ldap', dest='ldap_stage', default=False, action='store_true',
help='Create stage users via ldap not API')
parser.add_argument('--ldap-group', dest='ldap_group', default=False, action='store_true',
help="Add users to group using LDAP directly")
parser.add_argument('--ldap-group-remove', dest='ldap_group_del', type=str,
help="Remove users from group using LDAP directly")
parser.add_argument('-C', dest='chunk', type=int, default=-1,
help="Chunk size for batching user adds to groups, -1 means all users given in count")
parser.add_argument('-r', dest='reuse_template', type=str,
help="Reuse existing users for group add using given user naming template")
parser.add_argument('-D', dest='delay',type=int, default=0,
help="Delay N seconds between chunks")
parser.add_argument('--rebind', dest='rebind',default=False,action='store_true',
help="Perform a unmind/bind operation between ldap operations.")
parser.add_argument('-l', dest='user_limit', type=int, default=-1,
help="Limit the number of users returned by reuse")
parser.add_argument('--max-retries',dest='max_retries', type=int, default=0,
help="Maximum number of retries for a failed chunk operation")
parser.add_argument('--check-repl', dest='check_repl',default=False,action='store_true',
help="Check when replication is finished by adding a DNS record")
args=parser.parse_args()
# setting up logger here to prevent log files being generated when showing help
perf_logfile = "perf_{}".format(randomizer)
_perf_handler = logging.FileHandler(perf_logfile)
_perf_formatter = logging.Formatter("%(asctime)s; %(message)s")
_perf_handler.setFormatter(_perf_formatter)
_perf_handler.addFilter(LogFilter(MyLogger._PERF,type='eq'))
logger.addHandler(_perf_handler)
if args.verbosity:
# Error is a level of 40.
level=30-(args.verbosity*10)
if level<0:
level=0
logger.setLevel(level)
levels={ 5: "CRITICAL",
4: "ERROR",
3: "WARNING",
2: "INFO",
1: "DEBUG",
0: "ALL" }
if level!=30:
log_file = "log_{}".format(randomizer)
_file_handler = logging.FileHandler(log_file)
_file_formatter = logging.Formatter('%(asctime)s %(levelname)s :: %(message)s')
_file_handler.setFormatter(_file_formatter)
_file_handler.addFilter(LogFilter(level))
logger.addHandler(_file_handler)
logger.info("Logging to file '{}'".format(log_file))
logger.info("Debug level: {0} ({1})".format(levels[level // 10],level))
# client = ClientMeta('ipaserver0.example.com',False)
# client.login('admin', 'admin123')
# kerberos seems broken using OS rpms on RHEL 8
#client.login_kerberos()
# user = client.user_add('test4', 'John', 'Doe', 'John Doe', o_preferredlanguage='EN')
# Output some data to the user about the script options passed in
# Not working as expected when git not found
try:
commit_info = str(subprocess.check_output(['git', 'log', '-n', '1', '--pretty=tformat:"%ci %H"']),"utf-8").strip()
logger.perf("Commit Info: {}".format(commit_info))
except:
logger.perf("No git info found")
pass
logger.perf("Start Time: {}".format(start_timestr))
logger.perf("User count: {} Group count: {}".format(args.count,args.group_count))
logger.perf("Server: {}".format(args.server))
logger.perf("Perf Log file: {}".format(perf_logfile))
if args.stage:
if args.ldap_stage:
logger.perf("Creating Stage users via ldap")
else:
logger.perf("Creating Stage users via API")
else:
logger.perf("Creating active users via API")
if args.ldap_group:
logger.perf("Adding users to groups via LDAP")
if args.chunk>-1:
logger.perf(" Using a chunk size of {}".format(args.chunk))
else:
logger.perf("Adding users to groups via API")
if args.reuse_template:
logger.perf("Reusing users starting with: '{}'".format(args.reuse_template))
if args.user_limit>-1:
logger.perf(" Limiting reuse to first {} users found".format(args.user_limit))
logger.debug(args)
logger.perf('----')
# end start header
client = ClientMeta(args.server,False)
client.login(args.user, args.password)
dnszone = client.dnszone_find(o_forward_only=True)['result'][0]
servers = dnszone['nsrecord']
domain = dnszone['idnsname'][0]['__dns_name__']
logger.info("Found servers: {} for domain: [{}]".format(servers, domain))
if args.ldap_group or args.ldap_stage:
user_dn=client.user_show(args.user,o_all=True)['result']['dn']
base_user_dn = re.sub("^uid={}".format(args.user),'uid={}',user_dn)
dom_dn = re.search("(dc=.*)",user_dn, re.IGNORECASE).group(1)
ldap_server = ldap3.Server(args.server, get_info=ldap3.ALL)
ldap_conn = ldap3.Connection(ldap_server,user=user_dn, password=args.password, auto_bind=True, collect_usage=True)
if args.reuse_template:
user_dn=client.user_show(args.user,o_all=True)['result']['dn']
base_user_dn = re.sub("^uid={},".format(args.user),'',user_dn)
logger.debug("base_user_dn: {}".format(base_user_dn))
ldap_server = ldap3.Server(args.server, get_info=ldap3.ALL)
ldap_conn = ldap3.Connection(ldap_server,user=user_dn, password=args.password, auto_bind=True, collect_usage=True)
users=get_users_ldap(args.reuse_template)
else:
logger.info("Creating {} users".format(args.count))
logger.info("template: {}".format(uid_template))
logger.info("Checking for existing templated users")
user_check=client.user_find(uid_template.format(seq=0))
if user_check["count"]>0:
sec_to_wait = 61 - datetime.now().second
logger.error("Existing users found please wait {} seconds".format(sec_to_wait))
exit(1)
else:
logger.info("Proceeding")
if args.stage:
users = add_users_stage(args.count)
else:
users = add_users_api(args.count)
if args.ldap_group:
# print(ldap_server.info)
# for i in iter_timer(range(args.group_count),step=1,label="group_add_user_ldap"):
# create_group_add_users_ldap(i,users,ldap_conn,base_user_dn,chunk=args.chunk)
for i in loop_timer(args.group_count,1,label="group_add_user_ldap"):
create_group_add_users_ldap(i,users,ldap_conn,base_user_dn,chunk=args.chunk)
elif args.ldap_group_del is not None:
user_dn=client.user_show(args.user,o_all=True)['result']['dn']
group_dn=client.group_show(args.ldap_group_del,o_all=True)['result']['dn']
base_user_dn = re.sub("^uid={}".format(args.user),'uid={}',user_dn)
ldap_server = ldap3.Server(args.server, get_info=ldap3.ALL)
ldap_conn = ldap3.Connection(ldap_server,user=user_dn, password=args.password, auto_bind=True)
remove_group_users_ldap(users, ldap_conn, base_user_dn, args.ldap_group_del, group_dn, chunk=args.chunk)
else:
for i in loop_timer(args.group_count,1,label="group_add_user_api"):
create_group_add_users_api(i,users)
logger.perf('----')
logger.perf("End Time: {}".format(datetime.now().strftime("%Y%m%d %H:%M")))
run_time=time.time() - start_time
logger.perf("Total Run Time: {:.3f}sec".format(run_time))
logger.perf("Total Run time: {:d}min {:.3f}sec".format(int(run_time//60),run_time%60))
if args.check_repl:
record = "trecord{}".format(randomizer)
client.dnsrecord_add(a_dnszoneidnsname=domain, a_idnsname=record, o_a_part_ip_address='1.1.1.1')
check_result = 0
itr_ctr = 0
while check_result < len(servers) and itr_ctr < 600:
time.sleep(1)
check_result = 0
logger.perf("---- Iteration [{}] ----".format(itr_ctr))
for server in servers:
check_result += check_dns_record(server, domain, record)
itr_ctr += 1
logger.perf('----')
logger.perf("End Time with replication: {}".format(datetime.now().strftime("%Y%m%d %H:%M")))
run_time=time.time() - start_time
logger.perf("Total Run Time with replication: {:.3f}sec".format(run_time))
logger.perf("Total Run time with replication: {:d}min {:.3f}sec".format(int(run_time//60),run_time%60))
| true | true |
f702d770ee6291d4f0860e1e69892baca123eccb | 10,186 | py | Python | tests/components/upnp/test_config_flow.py | miccico/core | 14c205384171dee59c1a908f8449f9864778b2dc | [
"Apache-2.0"
] | 4 | 2016-06-22T12:00:41.000Z | 2018-06-11T20:31:25.000Z | tests/components/upnp/test_config_flow.py | miccico/core | 14c205384171dee59c1a908f8449f9864778b2dc | [
"Apache-2.0"
] | 57 | 2020-10-15T06:47:00.000Z | 2022-03-31T06:11:18.000Z | tests/components/upnp/test_config_flow.py | miccico/core | 14c205384171dee59c1a908f8449f9864778b2dc | [
"Apache-2.0"
] | 6 | 2019-07-06T00:43:13.000Z | 2021-01-16T13:27:06.000Z | """Test UPnP/IGD config flow."""
from datetime import timedelta
from unittest.mock import AsyncMock, patch
from homeassistant import config_entries, data_entry_flow
from homeassistant.components import ssdp
from homeassistant.components.upnp.const import (
CONFIG_ENTRY_SCAN_INTERVAL,
CONFIG_ENTRY_ST,
CONFIG_ENTRY_UDN,
DEFAULT_SCAN_INTERVAL,
DISCOVERY_LOCATION,
DISCOVERY_NAME,
DISCOVERY_ST,
DISCOVERY_UDN,
DISCOVERY_UNIQUE_ID,
DISCOVERY_USN,
DOMAIN,
DOMAIN_COORDINATORS,
)
from homeassistant.components.upnp.device import Device
from homeassistant.helpers.typing import HomeAssistantType
from homeassistant.setup import async_setup_component
from .mock_device import MockDevice
from tests.common import MockConfigEntry
async def test_flow_ssdp_discovery(hass: HomeAssistantType):
"""Test config flow: discovered + configured through ssdp."""
udn = "uuid:device_1"
location = "dummy"
mock_device = MockDevice(udn)
discoveries = [
{
DISCOVERY_LOCATION: location,
DISCOVERY_NAME: mock_device.name,
DISCOVERY_ST: mock_device.device_type,
DISCOVERY_UDN: mock_device.udn,
DISCOVERY_UNIQUE_ID: mock_device.unique_id,
DISCOVERY_USN: mock_device.usn,
}
]
with patch.object(
Device, "async_create_device", AsyncMock(return_value=mock_device)
), patch.object(
Device, "async_discover", AsyncMock(return_value=discoveries)
), patch.object(
Device, "async_supplement_discovery", AsyncMock(return_value=discoveries[0])
):
# Discovered via step ssdp.
result = await hass.config_entries.flow.async_init(
DOMAIN,
context={"source": config_entries.SOURCE_SSDP},
data={
ssdp.ATTR_SSDP_LOCATION: location,
ssdp.ATTR_SSDP_ST: mock_device.device_type,
ssdp.ATTR_SSDP_USN: mock_device.usn,
ssdp.ATTR_UPNP_UDN: mock_device.udn,
},
)
assert result["type"] == data_entry_flow.RESULT_TYPE_FORM
assert result["step_id"] == "ssdp_confirm"
# Confirm via step ssdp_confirm.
result = await hass.config_entries.flow.async_configure(
result["flow_id"],
user_input={},
)
assert result["type"] == data_entry_flow.RESULT_TYPE_CREATE_ENTRY
assert result["title"] == mock_device.name
assert result["data"] == {
CONFIG_ENTRY_ST: mock_device.device_type,
CONFIG_ENTRY_UDN: mock_device.udn,
}
async def test_flow_ssdp_discovery_incomplete(hass: HomeAssistantType):
"""Test config flow: incomplete discovery through ssdp."""
udn = "uuid:device_1"
location = "dummy"
mock_device = MockDevice(udn)
# Discovered via step ssdp.
result = await hass.config_entries.flow.async_init(
DOMAIN,
context={"source": config_entries.SOURCE_SSDP},
data={
ssdp.ATTR_SSDP_ST: mock_device.device_type,
# ssdp.ATTR_UPNP_UDN: mock_device.udn, # Not provided.
ssdp.ATTR_SSDP_LOCATION: location,
},
)
assert result["type"] == data_entry_flow.RESULT_TYPE_ABORT
assert result["reason"] == "incomplete_discovery"
async def test_flow_user(hass: HomeAssistantType):
"""Test config flow: discovered + configured through user."""
udn = "uuid:device_1"
location = "dummy"
mock_device = MockDevice(udn)
discoveries = [
{
DISCOVERY_LOCATION: location,
DISCOVERY_NAME: mock_device.name,
DISCOVERY_ST: mock_device.device_type,
DISCOVERY_UDN: mock_device.udn,
DISCOVERY_UNIQUE_ID: mock_device.unique_id,
DISCOVERY_USN: mock_device.usn,
}
]
with patch.object(
Device, "async_create_device", AsyncMock(return_value=mock_device)
), patch.object(
Device, "async_discover", AsyncMock(return_value=discoveries)
), patch.object(
Device, "async_supplement_discovery", AsyncMock(return_value=discoveries[0])
):
# Discovered via step user.
result = await hass.config_entries.flow.async_init(
DOMAIN, context={"source": config_entries.SOURCE_USER}
)
assert result["type"] == data_entry_flow.RESULT_TYPE_FORM
assert result["step_id"] == "user"
# Confirmed via step user.
result = await hass.config_entries.flow.async_configure(
result["flow_id"],
user_input={"unique_id": mock_device.unique_id},
)
assert result["type"] == data_entry_flow.RESULT_TYPE_CREATE_ENTRY
assert result["title"] == mock_device.name
assert result["data"] == {
CONFIG_ENTRY_ST: mock_device.device_type,
CONFIG_ENTRY_UDN: mock_device.udn,
}
async def test_flow_import(hass: HomeAssistantType):
"""Test config flow: discovered + configured through configuration.yaml."""
udn = "uuid:device_1"
mock_device = MockDevice(udn)
location = "dummy"
discoveries = [
{
DISCOVERY_LOCATION: location,
DISCOVERY_NAME: mock_device.name,
DISCOVERY_ST: mock_device.device_type,
DISCOVERY_UDN: mock_device.udn,
DISCOVERY_UNIQUE_ID: mock_device.unique_id,
DISCOVERY_USN: mock_device.usn,
}
]
with patch.object(
Device, "async_create_device", AsyncMock(return_value=mock_device)
), patch.object(
Device, "async_discover", AsyncMock(return_value=discoveries)
), patch.object(
Device, "async_supplement_discovery", AsyncMock(return_value=discoveries[0])
):
# Discovered via step import.
result = await hass.config_entries.flow.async_init(
DOMAIN, context={"source": config_entries.SOURCE_IMPORT}
)
assert result["type"] == data_entry_flow.RESULT_TYPE_CREATE_ENTRY
assert result["title"] == mock_device.name
assert result["data"] == {
CONFIG_ENTRY_ST: mock_device.device_type,
CONFIG_ENTRY_UDN: mock_device.udn,
}
async def test_flow_import_already_configured(hass: HomeAssistantType):
"""Test config flow: discovered, but already configured."""
udn = "uuid:device_1"
mock_device = MockDevice(udn)
# Existing entry.
config_entry = MockConfigEntry(
domain=DOMAIN,
data={
CONFIG_ENTRY_UDN: mock_device.udn,
CONFIG_ENTRY_ST: mock_device.device_type,
},
options={CONFIG_ENTRY_SCAN_INTERVAL: DEFAULT_SCAN_INTERVAL},
)
config_entry.add_to_hass(hass)
# Discovered via step import.
result = await hass.config_entries.flow.async_init(
DOMAIN, context={"source": config_entries.SOURCE_IMPORT}
)
assert result["type"] == data_entry_flow.RESULT_TYPE_ABORT
assert result["reason"] == "already_configured"
async def test_flow_import_incomplete(hass: HomeAssistantType):
"""Test config flow: incomplete discovery, configured through configuration.yaml."""
udn = "uuid:device_1"
mock_device = MockDevice(udn)
location = "dummy"
discoveries = [
{
DISCOVERY_LOCATION: location,
DISCOVERY_NAME: mock_device.name,
# DISCOVERY_ST: mock_device.device_type,
DISCOVERY_UDN: mock_device.udn,
DISCOVERY_UNIQUE_ID: mock_device.unique_id,
DISCOVERY_USN: mock_device.usn,
}
]
with patch.object(Device, "async_discover", AsyncMock(return_value=discoveries)):
# Discovered via step import.
result = await hass.config_entries.flow.async_init(
DOMAIN, context={"source": config_entries.SOURCE_IMPORT}
)
assert result["type"] == data_entry_flow.RESULT_TYPE_ABORT
assert result["reason"] == "incomplete_discovery"
async def test_options_flow(hass: HomeAssistantType):
"""Test options flow."""
# Set up config entry.
udn = "uuid:device_1"
location = "http://192.168.1.1/desc.xml"
mock_device = MockDevice(udn)
discoveries = [
{
DISCOVERY_LOCATION: location,
DISCOVERY_NAME: mock_device.name,
DISCOVERY_ST: mock_device.device_type,
DISCOVERY_UDN: mock_device.udn,
DISCOVERY_UNIQUE_ID: mock_device.unique_id,
DISCOVERY_USN: mock_device.usn,
}
]
config_entry = MockConfigEntry(
domain=DOMAIN,
data={
CONFIG_ENTRY_UDN: mock_device.udn,
CONFIG_ENTRY_ST: mock_device.device_type,
},
options={CONFIG_ENTRY_SCAN_INTERVAL: DEFAULT_SCAN_INTERVAL},
)
config_entry.add_to_hass(hass)
config = {
# no upnp, ensures no import-flow is started.
}
with patch.object(
Device, "async_create_device", AsyncMock(return_value=mock_device)
), patch.object(Device, "async_discover", AsyncMock(return_value=discoveries)):
# Initialisation of component.
await async_setup_component(hass, "upnp", config)
await hass.async_block_till_done()
# DataUpdateCoordinator gets a default of 30 seconds for updates.
coordinator = hass.data[DOMAIN][DOMAIN_COORDINATORS][mock_device.udn]
assert coordinator.update_interval == timedelta(seconds=DEFAULT_SCAN_INTERVAL)
# Options flow with no input results in form.
result = await hass.config_entries.options.async_init(
config_entry.entry_id,
)
assert result["type"] == data_entry_flow.RESULT_TYPE_FORM
# Options flow with input results in update to entry.
result2 = await hass.config_entries.options.async_configure(
result["flow_id"],
user_input={CONFIG_ENTRY_SCAN_INTERVAL: 60},
)
assert result2["type"] == data_entry_flow.RESULT_TYPE_CREATE_ENTRY
assert config_entry.options == {
CONFIG_ENTRY_SCAN_INTERVAL: 60,
}
# Also updates DataUpdateCoordinator.
assert coordinator.update_interval == timedelta(seconds=60)
| 35.124138 | 88 | 0.660613 |
from datetime import timedelta
from unittest.mock import AsyncMock, patch
from homeassistant import config_entries, data_entry_flow
from homeassistant.components import ssdp
from homeassistant.components.upnp.const import (
CONFIG_ENTRY_SCAN_INTERVAL,
CONFIG_ENTRY_ST,
CONFIG_ENTRY_UDN,
DEFAULT_SCAN_INTERVAL,
DISCOVERY_LOCATION,
DISCOVERY_NAME,
DISCOVERY_ST,
DISCOVERY_UDN,
DISCOVERY_UNIQUE_ID,
DISCOVERY_USN,
DOMAIN,
DOMAIN_COORDINATORS,
)
from homeassistant.components.upnp.device import Device
from homeassistant.helpers.typing import HomeAssistantType
from homeassistant.setup import async_setup_component
from .mock_device import MockDevice
from tests.common import MockConfigEntry
async def test_flow_ssdp_discovery(hass: HomeAssistantType):
udn = "uuid:device_1"
location = "dummy"
mock_device = MockDevice(udn)
discoveries = [
{
DISCOVERY_LOCATION: location,
DISCOVERY_NAME: mock_device.name,
DISCOVERY_ST: mock_device.device_type,
DISCOVERY_UDN: mock_device.udn,
DISCOVERY_UNIQUE_ID: mock_device.unique_id,
DISCOVERY_USN: mock_device.usn,
}
]
with patch.object(
Device, "async_create_device", AsyncMock(return_value=mock_device)
), patch.object(
Device, "async_discover", AsyncMock(return_value=discoveries)
), patch.object(
Device, "async_supplement_discovery", AsyncMock(return_value=discoveries[0])
):
result = await hass.config_entries.flow.async_init(
DOMAIN,
context={"source": config_entries.SOURCE_SSDP},
data={
ssdp.ATTR_SSDP_LOCATION: location,
ssdp.ATTR_SSDP_ST: mock_device.device_type,
ssdp.ATTR_SSDP_USN: mock_device.usn,
ssdp.ATTR_UPNP_UDN: mock_device.udn,
},
)
assert result["type"] == data_entry_flow.RESULT_TYPE_FORM
assert result["step_id"] == "ssdp_confirm"
result = await hass.config_entries.flow.async_configure(
result["flow_id"],
user_input={},
)
assert result["type"] == data_entry_flow.RESULT_TYPE_CREATE_ENTRY
assert result["title"] == mock_device.name
assert result["data"] == {
CONFIG_ENTRY_ST: mock_device.device_type,
CONFIG_ENTRY_UDN: mock_device.udn,
}
async def test_flow_ssdp_discovery_incomplete(hass: HomeAssistantType):
udn = "uuid:device_1"
location = "dummy"
mock_device = MockDevice(udn)
result = await hass.config_entries.flow.async_init(
DOMAIN,
context={"source": config_entries.SOURCE_SSDP},
data={
ssdp.ATTR_SSDP_ST: mock_device.device_type,
dp.ATTR_SSDP_LOCATION: location,
},
)
assert result["type"] == data_entry_flow.RESULT_TYPE_ABORT
assert result["reason"] == "incomplete_discovery"
async def test_flow_user(hass: HomeAssistantType):
udn = "uuid:device_1"
location = "dummy"
mock_device = MockDevice(udn)
discoveries = [
{
DISCOVERY_LOCATION: location,
DISCOVERY_NAME: mock_device.name,
DISCOVERY_ST: mock_device.device_type,
DISCOVERY_UDN: mock_device.udn,
DISCOVERY_UNIQUE_ID: mock_device.unique_id,
DISCOVERY_USN: mock_device.usn,
}
]
with patch.object(
Device, "async_create_device", AsyncMock(return_value=mock_device)
), patch.object(
Device, "async_discover", AsyncMock(return_value=discoveries)
), patch.object(
Device, "async_supplement_discovery", AsyncMock(return_value=discoveries[0])
):
result = await hass.config_entries.flow.async_init(
DOMAIN, context={"source": config_entries.SOURCE_USER}
)
assert result["type"] == data_entry_flow.RESULT_TYPE_FORM
assert result["step_id"] == "user"
result = await hass.config_entries.flow.async_configure(
result["flow_id"],
user_input={"unique_id": mock_device.unique_id},
)
assert result["type"] == data_entry_flow.RESULT_TYPE_CREATE_ENTRY
assert result["title"] == mock_device.name
assert result["data"] == {
CONFIG_ENTRY_ST: mock_device.device_type,
CONFIG_ENTRY_UDN: mock_device.udn,
}
async def test_flow_import(hass: HomeAssistantType):
udn = "uuid:device_1"
mock_device = MockDevice(udn)
location = "dummy"
discoveries = [
{
DISCOVERY_LOCATION: location,
DISCOVERY_NAME: mock_device.name,
DISCOVERY_ST: mock_device.device_type,
DISCOVERY_UDN: mock_device.udn,
DISCOVERY_UNIQUE_ID: mock_device.unique_id,
DISCOVERY_USN: mock_device.usn,
}
]
with patch.object(
Device, "async_create_device", AsyncMock(return_value=mock_device)
), patch.object(
Device, "async_discover", AsyncMock(return_value=discoveries)
), patch.object(
Device, "async_supplement_discovery", AsyncMock(return_value=discoveries[0])
):
result = await hass.config_entries.flow.async_init(
DOMAIN, context={"source": config_entries.SOURCE_IMPORT}
)
assert result["type"] == data_entry_flow.RESULT_TYPE_CREATE_ENTRY
assert result["title"] == mock_device.name
assert result["data"] == {
CONFIG_ENTRY_ST: mock_device.device_type,
CONFIG_ENTRY_UDN: mock_device.udn,
}
async def test_flow_import_already_configured(hass: HomeAssistantType):
udn = "uuid:device_1"
mock_device = MockDevice(udn)
config_entry = MockConfigEntry(
domain=DOMAIN,
data={
CONFIG_ENTRY_UDN: mock_device.udn,
CONFIG_ENTRY_ST: mock_device.device_type,
},
options={CONFIG_ENTRY_SCAN_INTERVAL: DEFAULT_SCAN_INTERVAL},
)
config_entry.add_to_hass(hass)
result = await hass.config_entries.flow.async_init(
DOMAIN, context={"source": config_entries.SOURCE_IMPORT}
)
assert result["type"] == data_entry_flow.RESULT_TYPE_ABORT
assert result["reason"] == "already_configured"
async def test_flow_import_incomplete(hass: HomeAssistantType):
udn = "uuid:device_1"
mock_device = MockDevice(udn)
location = "dummy"
discoveries = [
{
DISCOVERY_LOCATION: location,
DISCOVERY_NAME: mock_device.name,
DISCOVERY_UDN: mock_device.udn,
DISCOVERY_UNIQUE_ID: mock_device.unique_id,
DISCOVERY_USN: mock_device.usn,
}
]
with patch.object(Device, "async_discover", AsyncMock(return_value=discoveries)):
result = await hass.config_entries.flow.async_init(
DOMAIN, context={"source": config_entries.SOURCE_IMPORT}
)
assert result["type"] == data_entry_flow.RESULT_TYPE_ABORT
assert result["reason"] == "incomplete_discovery"
async def test_options_flow(hass: HomeAssistantType):
udn = "uuid:device_1"
location = "http://192.168.1.1/desc.xml"
mock_device = MockDevice(udn)
discoveries = [
{
DISCOVERY_LOCATION: location,
DISCOVERY_NAME: mock_device.name,
DISCOVERY_ST: mock_device.device_type,
DISCOVERY_UDN: mock_device.udn,
DISCOVERY_UNIQUE_ID: mock_device.unique_id,
DISCOVERY_USN: mock_device.usn,
}
]
config_entry = MockConfigEntry(
domain=DOMAIN,
data={
CONFIG_ENTRY_UDN: mock_device.udn,
CONFIG_ENTRY_ST: mock_device.device_type,
},
options={CONFIG_ENTRY_SCAN_INTERVAL: DEFAULT_SCAN_INTERVAL},
)
config_entry.add_to_hass(hass)
config = {
}
with patch.object(
Device, "async_create_device", AsyncMock(return_value=mock_device)
), patch.object(Device, "async_discover", AsyncMock(return_value=discoveries)):
await async_setup_component(hass, "upnp", config)
await hass.async_block_till_done()
coordinator = hass.data[DOMAIN][DOMAIN_COORDINATORS][mock_device.udn]
assert coordinator.update_interval == timedelta(seconds=DEFAULT_SCAN_INTERVAL)
result = await hass.config_entries.options.async_init(
config_entry.entry_id,
)
assert result["type"] == data_entry_flow.RESULT_TYPE_FORM
result2 = await hass.config_entries.options.async_configure(
result["flow_id"],
user_input={CONFIG_ENTRY_SCAN_INTERVAL: 60},
)
assert result2["type"] == data_entry_flow.RESULT_TYPE_CREATE_ENTRY
assert config_entry.options == {
CONFIG_ENTRY_SCAN_INTERVAL: 60,
}
assert coordinator.update_interval == timedelta(seconds=60)
| true | true |
f702d8d44ce7219920cb5618642b42930ac1bfe7 | 48 | py | Python | datasets/__init__.py | riccardodelutio/superpixel_fcn | d30a690836d7d6673b0a9f136019779f9e753f84 | [
"MIT"
] | 291 | 2020-03-25T17:37:46.000Z | 2022-03-31T12:32:29.000Z | datasets/__init__.py | wangyxxjtu/PCNet | ae4db30eeab92a1cbb30c6ef1c9878d8dbddbaf8 | [
"MIT"
] | 32 | 2020-04-05T09:01:25.000Z | 2022-03-13T00:37:12.000Z | datasets/__init__.py | wangyxxjtu/PCNet | ae4db30eeab92a1cbb30c6ef1c9878d8dbddbaf8 | [
"MIT"
] | 71 | 2020-04-02T01:03:52.000Z | 2022-03-25T12:12:11.000Z | from .BSD500 import BSD500
__all__ = ('BSD500')
| 16 | 26 | 0.729167 | from .BSD500 import BSD500
__all__ = ('BSD500')
| true | true |
f702d8f110cd6e8a6a3ce7d246c153a15a956d43 | 85 | py | Python | code/abc146_a_07.py | KoyanagiHitoshi/AtCoder | 731892543769b5df15254e1f32b756190378d292 | [
"MIT"
] | 3 | 2019-08-16T16:55:48.000Z | 2021-04-11T10:21:40.000Z | code/abc146_a_07.py | KoyanagiHitoshi/AtCoder | 731892543769b5df15254e1f32b756190378d292 | [
"MIT"
] | null | null | null | code/abc146_a_07.py | KoyanagiHitoshi/AtCoder | 731892543769b5df15254e1f32b756190378d292 | [
"MIT"
] | null | null | null | week = ["SUN", "MON", "TUE", "WED", "THU", "FRI", "SAT"]
print(7-week.index(input())) | 42.5 | 56 | 0.529412 | week = ["SUN", "MON", "TUE", "WED", "THU", "FRI", "SAT"]
print(7-week.index(input())) | true | true |
f702d98b6cf99f5c87c159957faf64295569a643 | 11,484 | py | Python | priorityqueue.py | mjwestcott/priorityqueue | 6bb9876644fe5ec307fd4ea1b73e4a722f89e408 | [
"MIT"
] | 6 | 2015-12-18T21:06:54.000Z | 2020-03-19T09:29:10.000Z | priorityqueue/priorityqueue.py | gaurav-kumar-pandit/competitiveprogramming | 1edb34ee7167599404ac45b9155588b79592ef4d | [
"MIT"
] | null | null | null | priorityqueue/priorityqueue.py | gaurav-kumar-pandit/competitiveprogramming | 1edb34ee7167599404ac45b9155588b79592ef4d | [
"MIT"
] | 2 | 2021-05-22T13:45:06.000Z | 2022-03-06T18:22:05.000Z | """
priorityqueue.py
Priority Queue Implementation with a O(log n) Remove Method
This file implements min- amd max-oriented priority queues based on binary
heaps. I found the need for a priority queue with a O(log n) remove method.
This can't be achieved with any of Python's built in collections including
the heapq module, so I built my own. The heap is arranged according to a given
key function.
Usage:
>>> from priorityqueue import MinHeapPriorityQueue
>>> items = [4, 0, 1, 3, 2]
>>> pq = MinHeapPriorityQueue(items)
>>> pq.pop()
0
A priority queue accepts an optional key function.
>>> items = ['yy', 'ttttttt', 'z', 'wwww', 'uuuuuu', 'vvvvv', 'xxx']
>>> pq = MinHeapPriorityQueue(items, key=len)
>>> pq.pop()
'z'
>>> pq.pop()
'yy'
Internally, the queue is a list of tokens of type 'Locator', which contain
the priority value, the item itself, and its current index in the heap.
The index field is updated whenever the heap is modified. This is what
allows us to remove in O(log n). Appending an item returns it's Locator.
>>> token = pq.append('a')
>>> token
Locator(value=1, item='a', index=0)
>>> pq.remove(token)
'a'
If we want to be able to remove any item in the list we can maintain an
auxiliary dictionary mapping items to their Locators. Here's a simple
example with unique items:
>>> items = [12, 46, 89, 101, 72, 81]
>>> pq = MinHeapPriorityQueue()
>>> locs = {}
>>> for item in items:
... locs[item] = pq.append(item)
>>> locs[46]
Locator(value=46, item=46, index=1)
>>> pq.remove(locs[46])
46
Iterating with 'for item in pq' or iter() will produce the items, not the
Locator instances used in the internal representation. The items will be
generated in sorted order.
>>> items = [3, 1, 0, 2, 4]
>>> pq = MinHeapPriorityQueue(items)
>>> for item in pq:
... print(item)
0
1
2
3
4
"""
# Inspired by:
# - AdaptableHeapPriorityQueue in 'Data Structures and Algorithms in Python'
# - the Go Standard library's heap package
# - Python's heapq module
# - Raymond Hettinger's SortedCollection on ActiveState
# - Peter Norvig's PriorityQueue in the Python AIMA repo
class MinHeapPriorityQueue():
"""A locator-based min-oriented priority queue implemented with a binary
heap, arranged according to a key function.
Operation Running Time
len(P), P.peek() O(1)
P.update(loc, value, item) O(log n)
P.append(item) O(log n)*
P.pop() O(log n)*
P.remove(loc) O(log n)*
*amortized due to occasional resizing of the underlying python list
"""
def __init__(self, iterable=(), key=lambda x: x):
self._key = key
decorated = [(key(item), item) for item in iterable]
self._pq = [self.Locator(value, item, i) for i, (value, item) in enumerate(decorated)]
if len(self._pq) > 1:
self._heapify()
class Locator:
"""Token for locating an entry of the priority queue."""
__slots__ = '_value', '_item', '_index'
def __init__(self, value, item, i):
self._value = value
self._item = item
self._index = i
def __eq__(self, other):
return self._value == other._value
def __lt__(self, other):
return self._value < other._value
def __le__(self, other):
return self._value <= other._value
def __repr__(self):
return '{}(value={!r}, item={!r}, index={})'.format(
self.__class__.__name__,
self._value,
self._item,
self._index
)
#------------------------------------------------------------------------------
# non-public
def _parent(self, j):
return (j-1) // 2
def _left(self, j):
return 2*j + 1
def _right(self, j):
return 2*j + 2
def _swap(self, i, j):
"""Swap the elements at indices i and j of array."""
self._pq[i], self._pq[j] = self._pq[j], self._pq[i]
# Update the indices in the Locator instances.
self._pq[i]._index = i
self._pq[j]._index = j
def _upheap(self, i):
parent = self._parent(i)
if i > 0 and self._pq[i] < self._pq[parent]:
self._swap(i, parent)
self._upheap(parent)
def _downheap(self, i):
n = len(self._pq)
left, right = self._left(i), self._right(i)
if left < n:
child = left
if right < n and self._pq[right] < self._pq[left]:
child = right
if self._pq[child] < self._pq[i]:
self._swap(i, child)
self._downheap(child)
def _fix(self, i):
self._upheap(i)
self._downheap(i)
def _heapify(self):
start = self._parent(len(self) - 1) # Start at parent of last leaf
for j in range(start, -1, -1): # going to and includng the root.
self._downheap(j)
#------------------------------------------------------------------------------
# public
def append(self, item):
"""Add an item to the heap"""
token = self.Locator(self._key(item), item, len(self._pq))
self._pq.append(token)
self._upheap(len(self._pq) - 1) # Upheap newly added position.
return token
def update(self, loc, newval, newitem):
"""Update the priority value and item for the entry identified by Locator loc."""
j = loc._index
if not (0 <= j < len(self) and self._pq[j] is loc):
raise ValueError('Invalid locator')
loc._value = newval
loc._item = newitem
self._fix(j)
def remove(self, loc):
"""Remove and return the item identified by Locator loc."""
j = loc._index
if not (0 <= j < len(self) and self._pq[j] is loc):
raise ValueError('Invalid locator')
if j == len(self) - 1:
self._pq.pop()
else:
self._swap(j, len(self) - 1)
self._pq.pop()
self._fix(j)
return loc._item
def peek(self):
"""Return but do not remove item with minimum priority value."""
loc = self._pq[0]
return loc._item
def pop(self):
"""Remove and return item with minimum priority value."""
self._swap(0, len(self._pq) - 1)
loc = self._pq.pop()
self._downheap(0)
return loc._item
@property
def items(self):
return [token._item for token in self._pq]
def __len__(self):
return len(self._pq)
def __contains__(self, item):
return item in self.items
def __iter__(self):
return iter(sorted(self.items))
def __repr__(self):
return '{}({})'.format(self.__class__.__name__, self._pq)
class MaxHeapPriorityQueue(MinHeapPriorityQueue):
"""A locator-based max-oriented priority queue implemented with a binary
heap, arranged according to a key function.
Operation Running Time
len(P), P.peek() O(1)
P.update(loc, value, item) O(log n)
P.append(item) O(log n)*
P.pop() O(log n)*
P.remove(loc) O(log n)*
*amortized due to occasional resizing of the underlying python list
"""
# Override all relevant private methods of MinHeapPriorityQueue
# with max-oriented versions.
def _upheap(self, i):
parent = self._parent(i)
if i > 0 and self._pq[parent] < self._pq[i]:
self._swap(i, parent)
self._upheap(parent)
def _downheap(self, i):
n = len(self._pq)
left, right = self._left(i), self._right(i)
if left < n:
child = left
if right < n and self._pq[left] < self._pq[right]:
child = right
if self._pq[i] < self._pq[child]:
self._swap(i, child)
self._downheap(child)
def __iter__(self):
return iter(sorted(self.items, reverse=True))
__doc__ += """
>>> import random; random.seed(42)
>>> from priorityqueue import MinHeapPriorityQueue, MaxHeapPriorityQueue
Function to verify the min-heap invariant is true for all elements of pq.
>>> def verify(pq):
... n = len(pq._pq)
... for i in range(n):
... left, right = 2*i + 1, 2*i + 2
... if left < n:
... assert pq._pq[i] <= pq._pq[left]
... if right < n:
... assert pq._pq[i] <= pq._pq[right]
Function to verify the max-heap invariant is true for all elements of pq.
>>> def verify_max(pq):
... n = len(pq._pq)
... for i in range(n):
... left, right = 2*i + 1, 2*i + 2
... if left < n:
... assert pq._pq[i] >= pq._pq[left]
... if right < n:
... assert pq._pq[i] >= pq._pq[right]
>>> items = [random.randint(1, 100) for _ in range(10000)]
>>> pq = MinHeapPriorityQueue(items)
>>> verify(pq)
>>> pq = MaxHeapPriorityQueue(items)
>>> verify_max(pq)
Check multiple signs for priority values.
>>> items = list(range(100, -100, -1))
>>> random.shuffle(items)
>>> pq = MinHeapPriorityQueue(items)
>>> verify(pq)
>>> pq = MaxHeapPriorityQueue(items)
>>> verify_max(pq)
Test pop, peek, append, remove, update, __len__, and __contains__ operations.
>>> items = ['jjjjjjjjjj', 'iiiiiiiii', 'hhhhhhhh',
... 'ggggggg', 'ffffff', 'eeeee',
... 'dddd', 'ccc', 'bb', 'a']
>>> pq = MinHeapPriorityQueue(items, key=len)
>>> verify(pq)
>>> pq.pop()
'a'
>>> pq.pop()
'bb'
>>> pq.peek()
'ccc'
>>> pq.pop()
'ccc'
>>> pq.pop()
'dddd'
>>> pq.peek()
'eeeee'
>>> pq.pop()
'eeeee'
>>> _ = pq.append('a')
>>> _ = pq.append('bb')
>>> verify(pq)
>>> pq = MaxHeapPriorityQueue(key=len)
>>> pq.append([1, 2, 3])
Locator(value=3, item=[1, 2, 3], index=0)
>>> pq.append([1, 2, 3, 4, 5, 6])
Locator(value=6, item=[1, 2, 3, 4, 5, 6], index=0)
>>> pq.append([1])
Locator(value=1, item=[1], index=2)
>>> pq.append([1, 2, 3, 4, 5, 6, 7, 8, 9])
Locator(value=9, item=[1, 2, 3, 4, 5, 6, 7, 8, 9], index=0)
>>> len(pq)
4
>>> [1] in pq
True
>>> [1, 2, 3, 4, 5] in pq
False
>>> items = list(range(1, 10001))
>>> random.shuffle(items)
>>> pq = MinHeapPriorityQueue(items)
>>> verify(pq)
>>> len(pq) == 10000
True
>>> for i in range(1, 10001):
... x = pq.pop()
... assert x == i
>>> pq = MinHeapPriorityQueue()
>>> locs = {}
>>> for x in items:
... locs[x] = pq.append(x)
>>> pq.remove(locs[1])
1
>>> pq.remove(locs[2])
2
>>> pq.pop()
3
>>> for i in range(4, 100):
... _ = pq.remove(locs[i])
>>> pq.pop()
100
>>> verify(pq)
>>> pq.update(locs[999], 1, 'test')
>>> 999 in pq
False
>>> pq.pop()
'test'
>>> 998 in pq
True
Test the items and __repr__ methods.
>>> items = ['a', 'b', 'c']
>>> pq = MinHeapPriorityQueue(items)
>>> pq
MinHeapPriorityQueue([Locator(value='a', item='a', index=0), Locator(value='b', item='b', index=1), Locator(value='c', item='c', index=2)])
>>> pq.items == ['a', 'b', 'c']
True
Check that __iter__ generates items in sorted order.
>>> items = list(range(1000))
>>> pq = MinHeapPriorityQueue(items)
>>> for i, x in enumerate(pq):
... assert i == x
>>> pq = MaxHeapPriorityQueue(items)
>>> for i, x in enumerate(pq):
... assert 999 - i == x
"""
if __name__ == "__main__":
import doctest
doctest.testmod()
| 29.674419 | 139 | 0.562609 |
# - Python's heapq module
# - Peter Norvig's PriorityQueue in the Python AIMA repo
class MinHeapPriorityQueue():
def __init__(self, iterable=(), key=lambda x: x):
self._key = key
decorated = [(key(item), item) for item in iterable]
self._pq = [self.Locator(value, item, i) for i, (value, item) in enumerate(decorated)]
if len(self._pq) > 1:
self._heapify()
class Locator:
__slots__ = '_value', '_item', '_index'
def __init__(self, value, item, i):
self._value = value
self._item = item
self._index = i
def __eq__(self, other):
return self._value == other._value
def __lt__(self, other):
return self._value < other._value
def __le__(self, other):
return self._value <= other._value
def __repr__(self):
return '{}(value={!r}, item={!r}, index={})'.format(
self.__class__.__name__,
self._value,
self._item,
self._index
)
def _parent(self, j):
return (j-1) // 2
def _left(self, j):
return 2*j + 1
def _right(self, j):
return 2*j + 2
def _swap(self, i, j):
self._pq[i], self._pq[j] = self._pq[j], self._pq[i]
self._pq[i]._index = i
self._pq[j]._index = j
def _upheap(self, i):
parent = self._parent(i)
if i > 0 and self._pq[i] < self._pq[parent]:
self._swap(i, parent)
self._upheap(parent)
def _downheap(self, i):
n = len(self._pq)
left, right = self._left(i), self._right(i)
if left < n:
child = left
if right < n and self._pq[right] < self._pq[left]:
child = right
if self._pq[child] < self._pq[i]:
self._swap(i, child)
self._downheap(child)
def _fix(self, i):
self._upheap(i)
self._downheap(i)
def _heapify(self):
start = self._parent(len(self) - 1)
for j in range(start, -1, -1):
self._downheap(j)
def append(self, item):
token = self.Locator(self._key(item), item, len(self._pq))
self._pq.append(token)
self._upheap(len(self._pq) - 1)
return token
def update(self, loc, newval, newitem):
j = loc._index
if not (0 <= j < len(self) and self._pq[j] is loc):
raise ValueError('Invalid locator')
loc._value = newval
loc._item = newitem
self._fix(j)
def remove(self, loc):
j = loc._index
if not (0 <= j < len(self) and self._pq[j] is loc):
raise ValueError('Invalid locator')
if j == len(self) - 1:
self._pq.pop()
else:
self._swap(j, len(self) - 1)
self._pq.pop()
self._fix(j)
return loc._item
def peek(self):
loc = self._pq[0]
return loc._item
def pop(self):
self._swap(0, len(self._pq) - 1)
loc = self._pq.pop()
self._downheap(0)
return loc._item
@property
def items(self):
return [token._item for token in self._pq]
def __len__(self):
return len(self._pq)
def __contains__(self, item):
return item in self.items
def __iter__(self):
return iter(sorted(self.items))
def __repr__(self):
return '{}({})'.format(self.__class__.__name__, self._pq)
class MaxHeapPriorityQueue(MinHeapPriorityQueue):
def _upheap(self, i):
parent = self._parent(i)
if i > 0 and self._pq[parent] < self._pq[i]:
self._swap(i, parent)
self._upheap(parent)
def _downheap(self, i):
n = len(self._pq)
left, right = self._left(i), self._right(i)
if left < n:
child = left
if right < n and self._pq[left] < self._pq[right]:
child = right
if self._pq[i] < self._pq[child]:
self._swap(i, child)
self._downheap(child)
def __iter__(self):
return iter(sorted(self.items, reverse=True))
__doc__ += """
>>> import random; random.seed(42)
>>> from priorityqueue import MinHeapPriorityQueue, MaxHeapPriorityQueue
Function to verify the min-heap invariant is true for all elements of pq.
>>> def verify(pq):
... n = len(pq._pq)
... for i in range(n):
... left, right = 2*i + 1, 2*i + 2
... if left < n:
... assert pq._pq[i] <= pq._pq[left]
... if right < n:
... assert pq._pq[i] <= pq._pq[right]
Function to verify the max-heap invariant is true for all elements of pq.
>>> def verify_max(pq):
... n = len(pq._pq)
... for i in range(n):
... left, right = 2*i + 1, 2*i + 2
... if left < n:
... assert pq._pq[i] >= pq._pq[left]
... if right < n:
... assert pq._pq[i] >= pq._pq[right]
>>> items = [random.randint(1, 100) for _ in range(10000)]
>>> pq = MinHeapPriorityQueue(items)
>>> verify(pq)
>>> pq = MaxHeapPriorityQueue(items)
>>> verify_max(pq)
Check multiple signs for priority values.
>>> items = list(range(100, -100, -1))
>>> random.shuffle(items)
>>> pq = MinHeapPriorityQueue(items)
>>> verify(pq)
>>> pq = MaxHeapPriorityQueue(items)
>>> verify_max(pq)
Test pop, peek, append, remove, update, __len__, and __contains__ operations.
>>> items = ['jjjjjjjjjj', 'iiiiiiiii', 'hhhhhhhh',
... 'ggggggg', 'ffffff', 'eeeee',
... 'dddd', 'ccc', 'bb', 'a']
>>> pq = MinHeapPriorityQueue(items, key=len)
>>> verify(pq)
>>> pq.pop()
'a'
>>> pq.pop()
'bb'
>>> pq.peek()
'ccc'
>>> pq.pop()
'ccc'
>>> pq.pop()
'dddd'
>>> pq.peek()
'eeeee'
>>> pq.pop()
'eeeee'
>>> _ = pq.append('a')
>>> _ = pq.append('bb')
>>> verify(pq)
>>> pq = MaxHeapPriorityQueue(key=len)
>>> pq.append([1, 2, 3])
Locator(value=3, item=[1, 2, 3], index=0)
>>> pq.append([1, 2, 3, 4, 5, 6])
Locator(value=6, item=[1, 2, 3, 4, 5, 6], index=0)
>>> pq.append([1])
Locator(value=1, item=[1], index=2)
>>> pq.append([1, 2, 3, 4, 5, 6, 7, 8, 9])
Locator(value=9, item=[1, 2, 3, 4, 5, 6, 7, 8, 9], index=0)
>>> len(pq)
4
>>> [1] in pq
True
>>> [1, 2, 3, 4, 5] in pq
False
>>> items = list(range(1, 10001))
>>> random.shuffle(items)
>>> pq = MinHeapPriorityQueue(items)
>>> verify(pq)
>>> len(pq) == 10000
True
>>> for i in range(1, 10001):
... x = pq.pop()
... assert x == i
>>> pq = MinHeapPriorityQueue()
>>> locs = {}
>>> for x in items:
... locs[x] = pq.append(x)
>>> pq.remove(locs[1])
1
>>> pq.remove(locs[2])
2
>>> pq.pop()
3
>>> for i in range(4, 100):
... _ = pq.remove(locs[i])
>>> pq.pop()
100
>>> verify(pq)
>>> pq.update(locs[999], 1, 'test')
>>> 999 in pq
False
>>> pq.pop()
'test'
>>> 998 in pq
True
Test the items and __repr__ methods.
>>> items = ['a', 'b', 'c']
>>> pq = MinHeapPriorityQueue(items)
>>> pq
MinHeapPriorityQueue([Locator(value='a', item='a', index=0), Locator(value='b', item='b', index=1), Locator(value='c', item='c', index=2)])
>>> pq.items == ['a', 'b', 'c']
True
Check that __iter__ generates items in sorted order.
>>> items = list(range(1000))
>>> pq = MinHeapPriorityQueue(items)
>>> for i, x in enumerate(pq):
... assert i == x
>>> pq = MaxHeapPriorityQueue(items)
>>> for i, x in enumerate(pq):
... assert 999 - i == x
"""
if __name__ == "__main__":
import doctest
doctest.testmod()
| true | true |
f702d9f83de12d57ddae1af8f5e99968f870e9e6 | 971 | py | Python | fixture/application.py | dmi-vor/python_training | 1e7b480bd40ce55fe19d19042c7d5ed4ffc873c8 | [
"Apache-2.0"
] | null | null | null | fixture/application.py | dmi-vor/python_training | 1e7b480bd40ce55fe19d19042c7d5ed4ffc873c8 | [
"Apache-2.0"
] | null | null | null | fixture/application.py | dmi-vor/python_training | 1e7b480bd40ce55fe19d19042c7d5ed4ffc873c8 | [
"Apache-2.0"
] | null | null | null | from selenium import webdriver
from fixture.session import SessionHelper
from fixture.group import GroupHelper
from fixture.contact import ContactHelper
class Application:
def __init__(self, browser, base_url):
if browser == "firefox":
self.wd = webdriver.Firefox()
elif browser == "chrome":
self.wd = webdriver.Chrome()
elif browser == "ie":
self.wd = webdriver.Ie()
else:
raise ValueError("Unrecognized browser %s" % browser)
self.wd.implicitly_wait(5)
self.session = SessionHelper(self)
self.group = GroupHelper(self)
self.contact = ContactHelper(self)
self.base_url=base_url
def is_valid(self):
try:
self.wd.current_url
return True
except:
return False
def open_home_page(self):
wd = self.wd
wd.get(self.base_url)
def destroy(self):
self.wd.quit()
| 25.552632 | 65 | 0.603502 | from selenium import webdriver
from fixture.session import SessionHelper
from fixture.group import GroupHelper
from fixture.contact import ContactHelper
class Application:
def __init__(self, browser, base_url):
if browser == "firefox":
self.wd = webdriver.Firefox()
elif browser == "chrome":
self.wd = webdriver.Chrome()
elif browser == "ie":
self.wd = webdriver.Ie()
else:
raise ValueError("Unrecognized browser %s" % browser)
self.wd.implicitly_wait(5)
self.session = SessionHelper(self)
self.group = GroupHelper(self)
self.contact = ContactHelper(self)
self.base_url=base_url
def is_valid(self):
try:
self.wd.current_url
return True
except:
return False
def open_home_page(self):
wd = self.wd
wd.get(self.base_url)
def destroy(self):
self.wd.quit()
| true | true |
f702daa51357e8ff5b5a56b6929c7d46c451dc9e | 1,385 | py | Python | src/basior/logic_pkg/tramline.py | Marcin-Szadkowski/B.A.S.I.O.R | 5b90ab6a05fdf2a3db8e5b9ba80a858a6628ab8c | [
"MIT"
] | 1 | 2020-04-26T17:41:33.000Z | 2020-04-26T17:41:33.000Z | src/basior/logic_pkg/tramline.py | Marcin-Szadkowski/B.A.S.I.O.R | 5b90ab6a05fdf2a3db8e5b9ba80a858a6628ab8c | [
"MIT"
] | null | null | null | src/basior/logic_pkg/tramline.py | Marcin-Szadkowski/B.A.S.I.O.R | 5b90ab6a05fdf2a3db8e5b9ba80a858a6628ab8c | [
"MIT"
] | 2 | 2020-06-17T16:03:01.000Z | 2020-06-28T20:53:06.000Z | import matplotlib.pyplot as plt
from shapely.geometry import MultiLineString
from .route_iterator import RouteIterator
from .graphconverter import GraphConverter
class TramLine(object):
"""Class represents single tram line for example '33: from Pilczyce to Sępolno' """
def __init__(self, number, direction_to, dl):
"""
Basic requirements to unambiguously define line
:param number: number of line as str
:param direction_to:
:param dl: DataLoader object
"""
self.number = number # Stored as str
self.direction_to = direction_to
self.default_route = dl.load_single_line(number, direction_to) # As you can default_route is type LineString
self.stops = dl.load_tram_stops(self.default_route) # List of shapely.Point objects
self.current_route = self.default_route
self.route_in_order = GraphConverter.find_route_in_order(dl, self)
"""
def show(self, with_stops=True):
# Development tool. Plot line
if isinstance(self.current_route, MultiLineString):
for line in self.current_route:
plt.plot(line.xy[0], line.xy[1])
else:
plt.plot(self.current_route.xy[0], self.current_route.xy[1])
if with_stops:
plt.scatter([p.x for p in self.stops], [p.y for p in self.stops])
plt.show()
"""
| 36.447368 | 117 | 0.66787 | import matplotlib.pyplot as plt
from shapely.geometry import MultiLineString
from .route_iterator import RouteIterator
from .graphconverter import GraphConverter
class TramLine(object):
def __init__(self, number, direction_to, dl):
self.number = number
self.direction_to = direction_to
self.default_route = dl.load_single_line(number, direction_to)
self.stops = dl.load_tram_stops(self.default_route)
self.current_route = self.default_route
self.route_in_order = GraphConverter.find_route_in_order(dl, self)
| true | true |
f702dab63fb7a27fbc99af60fb2c5b50e7bb5377 | 4,365 | py | Python | rhasspywake_snowboy_hermes/__main__.py | Romkabouter/rhasspy-wake-snowboy-hermes | 6ad5372c89650987f92c22c0b745661680c17c94 | [
"MIT"
] | null | null | null | rhasspywake_snowboy_hermes/__main__.py | Romkabouter/rhasspy-wake-snowboy-hermes | 6ad5372c89650987f92c22c0b745661680c17c94 | [
"MIT"
] | null | null | null | rhasspywake_snowboy_hermes/__main__.py | Romkabouter/rhasspy-wake-snowboy-hermes | 6ad5372c89650987f92c22c0b745661680c17c94 | [
"MIT"
] | null | null | null | """Hermes MQTT service for Rhasspy wakeword with snowboy"""
import argparse
import asyncio
import dataclasses
import itertools
import json
import logging
import os
import sys
import typing
from pathlib import Path
import paho.mqtt.client as mqtt
import rhasspyhermes.cli as hermes_cli
from . import SnowboyModel, WakeHermesMqtt
_DIR = Path(__file__).parent
_LOGGER = logging.getLogger("rhasspywake_snowboy_hermes")
# -----------------------------------------------------------------------------
def main():
"""Main method."""
parser = argparse.ArgumentParser(prog="rhasspy-wake-snowboy-hermes")
parser.add_argument(
"--model",
required=True,
action="append",
nargs="+",
help="Snowboy model settings (model, sensitivity, audio_gain, apply_frontend)",
)
parser.add_argument(
"--model-dir",
action="append",
default=[],
help="Directories with snowboy models",
)
parser.add_argument(
"--wakeword-id",
action="append",
help="Wakeword IDs of each keyword (default: use file name)",
)
parser.add_argument(
"--stdin-audio", action="store_true", help="Read WAV audio from stdin"
)
parser.add_argument(
"--udp-audio",
nargs=3,
action="append",
help="Host/port/siteId for UDP audio input",
)
parser.add_argument("--lang", help="Set lang in hotword detected message")
hermes_cli.add_hermes_args(parser)
args = parser.parse_args()
hermes_cli.setup_logging(args)
_LOGGER.debug(args)
if args.model_dir:
args.model_dir = [Path(d) for d in args.model_dir]
# Use embedded models too
args.model_dir.append(_DIR / "models")
# Load model settings
models: typing.List[SnowboyModel] = []
for model_settings in args.model:
model_path = Path(model_settings[0])
if not model_path.is_file():
# Resolve relative to model directories
for model_dir in args.model_dir:
maybe_path = model_dir / model_path.name
if maybe_path.is_file():
model_path = maybe_path
break
_LOGGER.debug("Loading model from %s", str(model_path))
model = SnowboyModel(model_path=model_path)
if len(model_settings) > 1:
model.sensitivity = model_settings[1]
if len(model_settings) > 2:
model.audio_gain = float(model_settings[2])
if len(model_settings) > 3:
model.apply_frontend = model_settings[3].strip().lower() == "true"
models.append(model)
wakeword_ids = [
kn[1]
for kn in itertools.zip_longest(
args.model, args.wakeword_id or [], fillvalue=""
)
]
if args.stdin_audio:
# Read WAV from stdin, detect, and exit
client = None
hermes = WakeHermesMqtt(client, models, wakeword_ids)
for site_id in args.site_id:
hermes.load_detectors(site_id)
if os.isatty(sys.stdin.fileno()):
print("Reading WAV data from stdin...", file=sys.stderr)
wav_bytes = sys.stdin.buffer.read()
# Print results as JSON
for result in hermes.handle_audio_frame(wav_bytes):
result_dict = dataclasses.asdict(result)
json.dump(result_dict, sys.stdout, ensure_ascii=False)
return
udp_audio = []
if args.udp_audio:
udp_audio = [
(host, int(port), site_id) for host, port, site_id in args.udp_audio
]
# Listen for messages
client = mqtt.Client()
hermes = WakeHermesMqtt(
client,
models,
wakeword_ids,
model_dirs=args.model_dir,
udp_audio=udp_audio,
site_ids=args.site_id,
lang=args.lang,
)
for site_id in args.site_id:
hermes.load_detectors(site_id)
_LOGGER.debug("Connecting to %s:%s", args.host, args.port)
hermes_cli.connect(client, args)
client.loop_start()
try:
# Run event loop
asyncio.run(hermes.handle_messages_async())
except KeyboardInterrupt:
pass
finally:
_LOGGER.debug("Shutting down")
client.loop_stop()
# -----------------------------------------------------------------------------
if __name__ == "__main__":
main()
| 26.615854 | 87 | 0.59748 | import argparse
import asyncio
import dataclasses
import itertools
import json
import logging
import os
import sys
import typing
from pathlib import Path
import paho.mqtt.client as mqtt
import rhasspyhermes.cli as hermes_cli
from . import SnowboyModel, WakeHermesMqtt
_DIR = Path(__file__).parent
_LOGGER = logging.getLogger("rhasspywake_snowboy_hermes")
def main():
parser = argparse.ArgumentParser(prog="rhasspy-wake-snowboy-hermes")
parser.add_argument(
"--model",
required=True,
action="append",
nargs="+",
help="Snowboy model settings (model, sensitivity, audio_gain, apply_frontend)",
)
parser.add_argument(
"--model-dir",
action="append",
default=[],
help="Directories with snowboy models",
)
parser.add_argument(
"--wakeword-id",
action="append",
help="Wakeword IDs of each keyword (default: use file name)",
)
parser.add_argument(
"--stdin-audio", action="store_true", help="Read WAV audio from stdin"
)
parser.add_argument(
"--udp-audio",
nargs=3,
action="append",
help="Host/port/siteId for UDP audio input",
)
parser.add_argument("--lang", help="Set lang in hotword detected message")
hermes_cli.add_hermes_args(parser)
args = parser.parse_args()
hermes_cli.setup_logging(args)
_LOGGER.debug(args)
if args.model_dir:
args.model_dir = [Path(d) for d in args.model_dir]
args.model_dir.append(_DIR / "models")
models: typing.List[SnowboyModel] = []
for model_settings in args.model:
model_path = Path(model_settings[0])
if not model_path.is_file():
for model_dir in args.model_dir:
maybe_path = model_dir / model_path.name
if maybe_path.is_file():
model_path = maybe_path
break
_LOGGER.debug("Loading model from %s", str(model_path))
model = SnowboyModel(model_path=model_path)
if len(model_settings) > 1:
model.sensitivity = model_settings[1]
if len(model_settings) > 2:
model.audio_gain = float(model_settings[2])
if len(model_settings) > 3:
model.apply_frontend = model_settings[3].strip().lower() == "true"
models.append(model)
wakeword_ids = [
kn[1]
for kn in itertools.zip_longest(
args.model, args.wakeword_id or [], fillvalue=""
)
]
if args.stdin_audio:
client = None
hermes = WakeHermesMqtt(client, models, wakeword_ids)
for site_id in args.site_id:
hermes.load_detectors(site_id)
if os.isatty(sys.stdin.fileno()):
print("Reading WAV data from stdin...", file=sys.stderr)
wav_bytes = sys.stdin.buffer.read()
for result in hermes.handle_audio_frame(wav_bytes):
result_dict = dataclasses.asdict(result)
json.dump(result_dict, sys.stdout, ensure_ascii=False)
return
udp_audio = []
if args.udp_audio:
udp_audio = [
(host, int(port), site_id) for host, port, site_id in args.udp_audio
]
client = mqtt.Client()
hermes = WakeHermesMqtt(
client,
models,
wakeword_ids,
model_dirs=args.model_dir,
udp_audio=udp_audio,
site_ids=args.site_id,
lang=args.lang,
)
for site_id in args.site_id:
hermes.load_detectors(site_id)
_LOGGER.debug("Connecting to %s:%s", args.host, args.port)
hermes_cli.connect(client, args)
client.loop_start()
try:
asyncio.run(hermes.handle_messages_async())
except KeyboardInterrupt:
pass
finally:
_LOGGER.debug("Shutting down")
client.loop_stop()
if __name__ == "__main__":
main()
| true | true |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.