hexsha
stringlengths
40
40
size
int64
2
1.02M
ext
stringclasses
10 values
lang
stringclasses
1 value
max_stars_repo_path
stringlengths
4
245
max_stars_repo_name
stringlengths
6
130
max_stars_repo_head_hexsha
stringlengths
40
40
max_stars_repo_licenses
listlengths
1
10
max_stars_count
int64
1
191k
max_stars_repo_stars_event_min_datetime
stringlengths
24
24
max_stars_repo_stars_event_max_datetime
stringlengths
24
24
max_issues_repo_path
stringlengths
4
245
max_issues_repo_name
stringlengths
6
130
max_issues_repo_head_hexsha
stringlengths
40
40
max_issues_repo_licenses
listlengths
1
10
max_issues_count
int64
1
67k
max_issues_repo_issues_event_min_datetime
stringlengths
24
24
max_issues_repo_issues_event_max_datetime
stringlengths
24
24
max_forks_repo_path
stringlengths
4
245
max_forks_repo_name
stringlengths
6
130
max_forks_repo_head_hexsha
stringlengths
40
40
max_forks_repo_licenses
listlengths
1
10
max_forks_count
int64
1
105k
max_forks_repo_forks_event_min_datetime
stringlengths
24
24
max_forks_repo_forks_event_max_datetime
stringlengths
24
24
content
stringlengths
2
1.02M
avg_line_length
float64
1
958k
max_line_length
int64
1
987k
alphanum_fraction
float64
0
1
content_no_comment
stringlengths
0
1.01M
is_comment_constant_removed
bool
2 classes
is_sharp_comment_removed
bool
1 class
f726183b6b3459cd5406c87d8bc7c89200072c21
3,203
py
Python
crnt4sbml/safety_wrap.py
PNNL-Comp-Mass-Spec/CRNT4SBML
20406f452863f35f766b504fe2b3f3ab034b62fe
[ "Apache-2.0" ]
null
null
null
crnt4sbml/safety_wrap.py
PNNL-Comp-Mass-Spec/CRNT4SBML
20406f452863f35f766b504fe2b3f3ab034b62fe
[ "Apache-2.0" ]
1
2019-09-26T21:04:31.000Z
2019-09-26T21:04:31.000Z
crnt4sbml/safety_wrap.py
PNNL-Comp-Mass-Spec/CRNT4SBML
20406f452863f35f766b504fe2b3f3ab034b62fe
[ "Apache-2.0" ]
1
2019-10-29T20:41:34.000Z
2019-10-29T20:41:34.000Z
import os import pickle import numpy import antimony import roadrunner import rrplugins import sys roadrunner.Logger.setLevel(roadrunner.Logger.LOG_ERROR) roadrunner.Logger.disableLogging() roadrunner.Logger.disableConsoleLogging() roadrunner.Logger.disableFileLogging() rrplugins.setLogLevel('error') stderr_fileno = sys.stderr.fileno() stderr_save = os.dup(stderr_fileno) stderr_pipe = os.pipe() os.dup2(stderr_pipe[1], stderr_fileno) os.close(stderr_pipe[1]) # functions taken from Tellurium!! Give them # credit, they deserve it! ################################################# def __check_antimony_return_code(code): if code < 0: raise Exception('Antimony: {}'.format(antimony.getLastError())) def __antimony_to_sbml(ant): try: isfile = os.path.isfile(ant) except ValueError: isfile = False if isfile: code = antimony.loadAntimonyFile(ant) else: code = antimony.loadAntimonyString(ant) __check_antimony_return_code(code) mid = antimony.getMainModuleName() return antimony.getSBMLString(mid) def __loada(ant): return __load_antimony_model(ant) def __load_antimony_model(ant): sbml = __antimony_to_sbml(ant) return roadrunner.RoadRunner(sbml) with open('input_arguments.pickle', 'rb') as pickle_file: input_arguments = pickle.loads(pickle_file.read()) ant_str = input_arguments[0] direction = input_arguments[1] auto = rrplugins.Plugin("tel_auto2000") auto_parameters = input_arguments[2] antimony_r = __loada(ant_str) # # making the directory auto_fort_files if is does not exist # if not os.path.isdir("./auto_fort_files"): # os.mkdir("./auto_fort_files") auto.setProperty("SBML", antimony_r.getCurrentSBML()) auto.setProperty("ScanDirection", direction) auto.setProperty("PreSimulation", "True") auto.setProperty("PreSimulationDuration", 1.0) auto.setProperty('KeepTempFiles', True) auto.setProperty("TempFolder", "auto_fort_files") # assigning values provided by the user for i in auto_parameters.keys(): auto.setProperty(i, auto_parameters[i]) try: auto.execute() # indices where special points are pts = auto.BifurcationPoints # labeling of special points lbls = auto.BifurcationLabels # all data for parameters and species found by continuation bi_data = auto.BifurcationData # convertes bi_data to numpy array, where first # column is the principal continuation parameter and # the rest of the columns are the species bi_data_np = bi_data.toNumpy flag = True except Exception as e: flag = False pts = [] lbls = [] bi_data_np = numpy.zeros(2) ant_float_ids = antimony_r.model.getFloatingSpeciesIds() numpy.save('bi_data_np.npy', bi_data_np) output_arguments = [pts, lbls, ant_float_ids, flag] if os.path.exists("output_arguments.pickle"): os.remove("output_arguments.pickle") with open('output_arguments.pickle', 'wb') as outf: outf.write(pickle.dumps(output_arguments)) else: with open('output_arguments.pickle', 'wb') as outf: outf.write(pickle.dumps(output_arguments)) os.close(stderr_pipe[0]) os.dup2(stderr_save, stderr_fileno) os.close(stderr_save) os.close(stderr_fileno)
27.612069
71
0.73119
import os import pickle import numpy import antimony import roadrunner import rrplugins import sys roadrunner.Logger.setLevel(roadrunner.Logger.LOG_ERROR) roadrunner.Logger.disableLogging() roadrunner.Logger.disableConsoleLogging() roadrunner.Logger.disableFileLogging() rrplugins.setLogLevel('error') stderr_fileno = sys.stderr.fileno() stderr_save = os.dup(stderr_fileno) stderr_pipe = os.pipe() os.dup2(stderr_pipe[1], stderr_fileno) os.close(stderr_pipe[1]) to_parameters.keys(): auto.setProperty(i, auto_parameters[i]) try: auto.execute() pts = auto.BifurcationPoints lbls = auto.BifurcationLabels bi_data = auto.BifurcationData bi_data_np = bi_data.toNumpy flag = True except Exception as e: flag = False pts = [] lbls = [] bi_data_np = numpy.zeros(2) ant_float_ids = antimony_r.model.getFloatingSpeciesIds() numpy.save('bi_data_np.npy', bi_data_np) output_arguments = [pts, lbls, ant_float_ids, flag] if os.path.exists("output_arguments.pickle"): os.remove("output_arguments.pickle") with open('output_arguments.pickle', 'wb') as outf: outf.write(pickle.dumps(output_arguments)) else: with open('output_arguments.pickle', 'wb') as outf: outf.write(pickle.dumps(output_arguments)) os.close(stderr_pipe[0]) os.dup2(stderr_save, stderr_fileno) os.close(stderr_save) os.close(stderr_fileno)
true
true
f72619392a6697759ea4f17f8067b0b5a3548221
6,841
py
Python
pdm/resolver/providers.py
linw1995/pdm
f2f67f17efd9cd8593ce06a4933cc2303890dcec
[ "MIT" ]
null
null
null
pdm/resolver/providers.py
linw1995/pdm
f2f67f17efd9cd8593ce06a4933cc2303890dcec
[ "MIT" ]
null
null
null
pdm/resolver/providers.py
linw1995/pdm
f2f67f17efd9cd8593ce06a4933cc2303890dcec
[ "MIT" ]
null
null
null
from typing import Any, Dict, Iterable, List, Optional, Union from resolvelib import AbstractProvider from resolvelib.resolvers import RequirementInformation from pdm.models.candidates import Candidate from pdm.models.repositories import BaseRepository from pdm.models.requirements import Requirement from pdm.models.specifiers import PySpecSet from pdm.utils import url_without_fragments class BaseProvider(AbstractProvider): def __init__( self, repository: BaseRepository, requires_python: PySpecSet, allow_prereleases: Optional[bool] = None, ) -> None: self.repository = repository self.requires_python = requires_python # Root python_requires value self.allow_prereleases = allow_prereleases # Root allow_prereleases value self.requires_python_collection: Dict[Optional[str], PySpecSet] = {} self.summary_collection: Dict[str, str] = {} self.fetched_dependencies: Dict[str, List[Requirement]] = {} def identify(self, req: Union[Requirement, Candidate]) -> Optional[str]: return req.identify() def get_preference( self, resolution: Candidate, candidates: List[Candidate], information: List[RequirementInformation], ) -> int: return len(candidates) def find_matches(self, requirements: List[Requirement]) -> Iterable[Candidate]: file_req = next((req for req in requirements if not req.is_named), None) if file_req: can = Candidate(file_req, self.repository.environment) can.get_metadata() candidates = [can] else: candidates = self.repository.find_candidates( requirements[0], self.requires_python, self.allow_prereleases ) return [ can for can in candidates if all(self.is_satisfied_by(r, can) for r in requirements) ] def is_satisfied_by(self, requirement: Requirement, candidate: Candidate) -> bool: if not requirement.is_named: return not candidate.req.is_named and url_without_fragments( candidate.req.url ) == url_without_fragments(requirement.url) if not candidate.version: candidate.get_metadata() if getattr(candidate, "_preferred", False) and not candidate._requires_python: candidate.requires_python = str( self.repository.get_dependencies(candidate)[1] ) allow_prereleases = requirement.allow_prereleases if allow_prereleases is None: allow_prereleases = self.allow_prereleases if allow_prereleases is None: # if not specified, should allow what `find_candidates()` returns allow_prereleases = True requires_python = self.requires_python & requirement.requires_python return requirement.specifier.contains( candidate.version, allow_prereleases ) and requires_python.is_subset(candidate.requires_python) def get_dependencies(self, candidate: Candidate) -> List[Requirement]: deps, requires_python, summary = self.repository.get_dependencies(candidate) # Filter out incompatible dependencies(e.g. functools32) early so that # we don't get errors when building wheels. valid_deps: List[Requirement] = [] for dep in deps: if ( dep.requires_python & requires_python & self.requires_python ).is_impossible: continue dep.requires_python &= candidate.req.requires_python valid_deps.append(dep) candidate_key = self.identify(candidate) self.fetched_dependencies[candidate_key] = valid_deps self.summary_collection[candidate.req.key] = summary self.requires_python_collection[candidate.req.key] = requires_python return valid_deps def get_hashes(self, candidate: Candidate) -> Optional[Dict[str, str]]: return self.repository.get_hashes(candidate) class ReusePinProvider(BaseProvider): """A provider that reuses preferred pins if possible. This is used to implement "add", "remove", and "reuse upgrade", where already-pinned candidates in lockfile should be preferred. """ def __init__( self, preferred_pins: Dict[str, Candidate], tracked_names: Iterable[str], *args: Any ) -> None: super().__init__(*args) self.preferred_pins = preferred_pins self.tracked_names = set(tracked_names) def find_matches(self, requirements: List[Requirement]) -> Iterable[Candidate]: ident = self.identify(requirements[0]) if ident not in self.tracked_names and ident in self.preferred_pins: pin = self.preferred_pins[ident] pin._preferred = True yield pin yield from super().find_matches(requirements) class EagerUpdateProvider(ReusePinProvider): """A specialized provider to handle an "eager" upgrade strategy. An eager upgrade tries to upgrade not only packages specified, but also their dependencies (recursively). This contrasts to the "only-if-needed" default, which only promises to upgrade the specified package, and prevents touching anything else if at all possible. The provider is implemented as to keep track of all dependencies of the specified packages to upgrade, and free their pins when it has a chance. """ def is_satisfied_by(self, requirement: Requirement, candidate: Candidate) -> bool: # If this is a tracking package, tell the resolver out of using the # preferred pin, and into a "normal" candidate selection process. if self.identify(requirement) in self.tracked_names and getattr( candidate, "_preferred", False ): return False return super().is_satisfied_by(requirement, candidate) def get_dependencies(self, candidate: Candidate) -> List[Requirement]: # If this package is being tracked for upgrade, remove pins of its # dependencies, and start tracking these new packages. dependencies = super().get_dependencies(candidate) if self.identify(candidate) in self.tracked_names: for dependency in dependencies: name = self.identify(dependency) self.tracked_names.add(name) return dependencies def get_preference( self, resolution: Candidate, candidates: List[Candidate], information: List[RequirementInformation], ) -> int: # Resolve tracking packages so we have a chance to unpin them first. name = self.identify(candidates[0]) if name in self.tracked_names: return -1 return len(candidates)
40.720238
86
0.673586
from typing import Any, Dict, Iterable, List, Optional, Union from resolvelib import AbstractProvider from resolvelib.resolvers import RequirementInformation from pdm.models.candidates import Candidate from pdm.models.repositories import BaseRepository from pdm.models.requirements import Requirement from pdm.models.specifiers import PySpecSet from pdm.utils import url_without_fragments class BaseProvider(AbstractProvider): def __init__( self, repository: BaseRepository, requires_python: PySpecSet, allow_prereleases: Optional[bool] = None, ) -> None: self.repository = repository self.requires_python = requires_python self.allow_prereleases = allow_prereleases self.requires_python_collection: Dict[Optional[str], PySpecSet] = {} self.summary_collection: Dict[str, str] = {} self.fetched_dependencies: Dict[str, List[Requirement]] = {} def identify(self, req: Union[Requirement, Candidate]) -> Optional[str]: return req.identify() def get_preference( self, resolution: Candidate, candidates: List[Candidate], information: List[RequirementInformation], ) -> int: return len(candidates) def find_matches(self, requirements: List[Requirement]) -> Iterable[Candidate]: file_req = next((req for req in requirements if not req.is_named), None) if file_req: can = Candidate(file_req, self.repository.environment) can.get_metadata() candidates = [can] else: candidates = self.repository.find_candidates( requirements[0], self.requires_python, self.allow_prereleases ) return [ can for can in candidates if all(self.is_satisfied_by(r, can) for r in requirements) ] def is_satisfied_by(self, requirement: Requirement, candidate: Candidate) -> bool: if not requirement.is_named: return not candidate.req.is_named and url_without_fragments( candidate.req.url ) == url_without_fragments(requirement.url) if not candidate.version: candidate.get_metadata() if getattr(candidate, "_preferred", False) and not candidate._requires_python: candidate.requires_python = str( self.repository.get_dependencies(candidate)[1] ) allow_prereleases = requirement.allow_prereleases if allow_prereleases is None: allow_prereleases = self.allow_prereleases if allow_prereleases is None: allow_prereleases = True requires_python = self.requires_python & requirement.requires_python return requirement.specifier.contains( candidate.version, allow_prereleases ) and requires_python.is_subset(candidate.requires_python) def get_dependencies(self, candidate: Candidate) -> List[Requirement]: deps, requires_python, summary = self.repository.get_dependencies(candidate) valid_deps: List[Requirement] = [] for dep in deps: if ( dep.requires_python & requires_python & self.requires_python ).is_impossible: continue dep.requires_python &= candidate.req.requires_python valid_deps.append(dep) candidate_key = self.identify(candidate) self.fetched_dependencies[candidate_key] = valid_deps self.summary_collection[candidate.req.key] = summary self.requires_python_collection[candidate.req.key] = requires_python return valid_deps def get_hashes(self, candidate: Candidate) -> Optional[Dict[str, str]]: return self.repository.get_hashes(candidate) class ReusePinProvider(BaseProvider): def __init__( self, preferred_pins: Dict[str, Candidate], tracked_names: Iterable[str], *args: Any ) -> None: super().__init__(*args) self.preferred_pins = preferred_pins self.tracked_names = set(tracked_names) def find_matches(self, requirements: List[Requirement]) -> Iterable[Candidate]: ident = self.identify(requirements[0]) if ident not in self.tracked_names and ident in self.preferred_pins: pin = self.preferred_pins[ident] pin._preferred = True yield pin yield from super().find_matches(requirements) class EagerUpdateProvider(ReusePinProvider): def is_satisfied_by(self, requirement: Requirement, candidate: Candidate) -> bool: # If this is a tracking package, tell the resolver out of using the # preferred pin, and into a "normal" candidate selection process. if self.identify(requirement) in self.tracked_names and getattr( candidate, "_preferred", False ): return False return super().is_satisfied_by(requirement, candidate) def get_dependencies(self, candidate: Candidate) -> List[Requirement]: # If this package is being tracked for upgrade, remove pins of its # dependencies, and start tracking these new packages. dependencies = super().get_dependencies(candidate) if self.identify(candidate) in self.tracked_names: for dependency in dependencies: name = self.identify(dependency) self.tracked_names.add(name) return dependencies def get_preference( self, resolution: Candidate, candidates: List[Candidate], information: List[RequirementInformation], ) -> int: # Resolve tracking packages so we have a chance to unpin them first. name = self.identify(candidates[0]) if name in self.tracked_names: return -1 return len(candidates)
true
true
f726193a37608aae08e652a88fa96a6e2af5182f
427
py
Python
Python1/python1/word_counter.py
ceeblet/OST_PythonCertificationTrack
042e0ce964bc88b3f4132dcbd7e06c5f504eae34
[ "MIT" ]
null
null
null
Python1/python1/word_counter.py
ceeblet/OST_PythonCertificationTrack
042e0ce964bc88b3f4132dcbd7e06c5f504eae34
[ "MIT" ]
null
null
null
Python1/python1/word_counter.py
ceeblet/OST_PythonCertificationTrack
042e0ce964bc88b3f4132dcbd7e06c5f504eae34
[ "MIT" ]
null
null
null
#!/usr/local/bin/python3 """Count the number of different words in a text.""" text = """\ Baa, Baa, Black sheep, Have you any wool? Yes sir, yes sir, Three bags full; One for the master, And one for the dame, And one for the little boy Who lives down the lane.""" for punc in ",?;.": text = text.replace(punc, "") print(text) words = set(text.lower().split()) print("There are", len(words), "distinct words in the text.")
23.722222
61
0.672131
text = """\ Baa, Baa, Black sheep, Have you any wool? Yes sir, yes sir, Three bags full; One for the master, And one for the dame, And one for the little boy Who lives down the lane.""" for punc in ",?;.": text = text.replace(punc, "") print(text) words = set(text.lower().split()) print("There are", len(words), "distinct words in the text.")
true
true
f72619f4db7804ed8962e86a9e8a707a354a4d0e
32,049
py
Python
ros2interface/test/test_cli.py
craigh92/ros2cli
6c1af39c728145942346b40e998b8a3984f1b6c1
[ "Apache-2.0" ]
null
null
null
ros2interface/test/test_cli.py
craigh92/ros2cli
6c1af39c728145942346b40e998b8a3984f1b6c1
[ "Apache-2.0" ]
null
null
null
ros2interface/test/test_cli.py
craigh92/ros2cli
6c1af39c728145942346b40e998b8a3984f1b6c1
[ "Apache-2.0" ]
1
2021-01-20T03:26:07.000Z
2021-01-20T03:26:07.000Z
# Copyright 2019 Open Source Robotics Foundation, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import contextlib import itertools import re import sys import unittest from launch import LaunchDescription from launch.actions import ExecuteProcess import launch_testing import launch_testing.actions import launch_testing.asserts import launch_testing.markers import launch_testing.tools import pytest # Skip cli tests on Windows while they exhibit pathological behavior # https://github.com/ros2/build_farmer/issues/248 if sys.platform.startswith('win'): pytest.skip( 'CLI tests can block for a pathological amount of time on Windows.', allow_module_level=True) some_messages_from_test_msgs = [ 'test_msgs/msg/BasicTypes', 'test_msgs/msg/Constants', 'test_msgs/msg/Strings', ] some_services_from_test_msgs = [ 'test_msgs/srv/Arrays', 'test_msgs/srv/BasicTypes', 'test_msgs/srv/Empty', ] some_actions_from_test_msgs = [ 'test_msgs/action/Fibonacci' ] some_interfaces = ( some_messages_from_test_msgs + some_services_from_test_msgs + some_actions_from_test_msgs ) @pytest.mark.rostest @launch_testing.markers.keep_alive def generate_test_description(): return LaunchDescription([launch_testing.actions.ReadyToTest()]) class TestROS2InterfaceCLI(unittest.TestCase): @classmethod def setUpClass( cls, launch_service, proc_info, proc_output ): @contextlib.contextmanager def launch_interface_command(self, arguments, prepend_arguments=[], shell=False): interface_command_action = ExecuteProcess( cmd=[*prepend_arguments, 'ros2', 'interface', *arguments], additional_env={'PYTHONUNBUFFERED': '1'}, name='ros2interface-cli', shell=shell, output='screen' ) with launch_testing.tools.launch_process( launch_service, interface_command_action, proc_info, proc_output ) as interface_command: yield interface_command cls.launch_interface_command = launch_interface_command def test_list_interfaces(self): with self.launch_interface_command(arguments=['list']) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK filter_ = launch_testing.tools.basic_output_filter( filtered_prefixes=['Messages:', 'Services:', 'Actions:'] ) output_lines = filter_(interface_command.output).splitlines() assert launch_testing.tools.expect_output( expected_lines=itertools.repeat( re.compile(r'\s*[A-z0-9_]+(/[A-z0-9_]+)+'), len(output_lines) ), lines=output_lines, strict=True ) assert launch_testing.tools.expect_output( expected_lines=some_interfaces, lines=output_lines, strict=False ) def test_list_messages(self): with self.launch_interface_command(arguments=['list', '-m']) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK output_lines = interface_command.output.splitlines() assert launch_testing.tools.expect_output( expected_lines=itertools.chain( ['Messages:'], itertools.repeat( re.compile(r'\s*[A-z0-9_]+(/[A-z0-9_]+)+'), len(output_lines) - 1 ) ), lines=output_lines, strict=True ) assert launch_testing.tools.expect_output( expected_lines=some_messages_from_test_msgs, lines=output_lines, strict=False ) def test_list_services(self): with self.launch_interface_command(arguments=['list', '-s']) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK output_lines = interface_command.output.splitlines() assert launch_testing.tools.expect_output( expected_lines=itertools.chain( ['Services:'], itertools.repeat( re.compile(r'\s*[A-z0-9_]+(/[A-z0-9_]+)+'), len(output_lines) - 1 ) ), lines=output_lines, strict=True ) assert launch_testing.tools.expect_output( expected_lines=some_services_from_test_msgs, lines=output_lines, strict=False ) def test_list_actions(self): with self.launch_interface_command(arguments=['list', '-a']) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK output_lines = interface_command.output.splitlines() assert launch_testing.tools.expect_output( expected_lines=itertools.chain( ['Actions:'], itertools.repeat( re.compile(r'\s*[A-z0-9_]+(/[A-z0-9_]+)+'), len(output_lines) - 1 ) ), lines=output_lines, strict=True ) assert launch_testing.tools.expect_output( expected_lines=some_actions_from_test_msgs, lines=output_lines, strict=False ) def test_package_on_nonexistent_package(self): with self.launch_interface_command( arguments=['package', 'not_a_package'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == 1 assert launch_testing.tools.expect_output( expected_lines=["Unknown package 'not_a_package'"], text=interface_command.output, strict=True ) def test_package_on_test_msgs(self): with self.launch_interface_command( arguments=['package', 'test_msgs'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK output_lines = interface_command.output.splitlines() assert launch_testing.tools.expect_output( expected_lines=itertools.repeat( re.compile(r'test_msgs/(msg|srv|action)/[A-z0-9_]+'), len(output_lines) ), lines=output_lines, strict=True ) assert all(interface in output_lines for interface in some_interfaces) def test_packages(self): with self.launch_interface_command(arguments=['packages']) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK output_lines = interface_command.output.splitlines() assert 'test_msgs' in output_lines def test_packages_with_messages(self): with self.launch_interface_command( arguments=['packages', '-m'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK output_lines = interface_command.output.splitlines() assert 'test_msgs' in output_lines def test_packages_with_services(self): with self.launch_interface_command( arguments=['packages', '-s'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK output_lines = interface_command.output.splitlines() assert 'test_msgs' in output_lines def test_packages_with_actions(self): with self.launch_interface_command( arguments=['packages', '-a'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK output_lines = interface_command.output.splitlines() assert 'test_msgs' in output_lines def test_show_message(self): with self.launch_interface_command( arguments=['show', 'test_msgs/msg/BasicTypes'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK assert launch_testing.tools.expect_output( expected_lines=[ 'bool bool_value', 'byte byte_value', 'char char_value', 'float32 float32_value', 'float64 float64_value', 'int8 int8_value', 'uint8 uint8_value', 'int16 int16_value', 'uint16 uint16_value', 'int32 int32_value', 'uint32 uint32_value', 'int64 int64_value', 'uint64 uint64_value', ], text=interface_command.output, strict=True ) def test_show_all_comments_for_message(self): with self.launch_interface_command( arguments=['show', 'test_msgs/msg/Builtins', '--all-comments'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK assert launch_testing.tools.expect_output( expected_lines=[ 'builtin_interfaces/Duration duration_value', '\t# Duration defines a period between two time points.', '\t# Messages of this datatype are of ROS Time following this design:', '\t# https://design.ros2.org/articles/clock_and_time.html', '', '\t# Seconds component, range is valid over any possible int32 value.', '\tint32 sec', '', '\t# Nanoseconds component in the range of [0, 10e9).', '\tuint32 nanosec', 'builtin_interfaces/Time time_value', '\t# This message communicates ROS Time defined here:', '\t# https://design.ros2.org/articles/clock_and_time.html', '', '\t# The seconds component, valid over all int32 values.', '\tint32 sec', '', '\t# The nanoseconds component, valid in the range [0, 10e9).', '\tuint32 nanosec', ], text=interface_command.output, strict=True ) def test_show_no_comments_for_message(self): with self.launch_interface_command( arguments=['show', 'test_msgs/msg/Builtins', '--no-comments'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK assert launch_testing.tools.expect_output( expected_lines=[ 'builtin_interfaces/Duration duration_value', '\tint32 sec', '\tuint32 nanosec', 'builtin_interfaces/Time time_value', '\tint32 sec', '\tuint32 nanosec', ], text=interface_command.output, strict=True ) def test_show_service(self): with self.launch_interface_command( arguments=['show', 'test_msgs/srv/BasicTypes'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK assert launch_testing.tools.expect_output( expected_lines=[ 'bool bool_value', 'byte byte_value', 'char char_value', 'float32 float32_value', 'float64 float64_value', 'int8 int8_value', 'uint8 uint8_value', 'int16 int16_value', 'uint16 uint16_value', 'int32 int32_value', 'uint32 uint32_value', 'int64 int64_value', 'uint64 uint64_value', 'string string_value', '---', 'bool bool_value', 'byte byte_value', 'char char_value', 'float32 float32_value', 'float64 float64_value', 'int8 int8_value', 'uint8 uint8_value', 'int16 int16_value', 'uint16 uint16_value', 'int32 int32_value', 'uint32 uint32_value', 'int64 int64_value', 'uint64 uint64_value', 'string string_value', ], text=interface_command.output, strict=True ) def test_show_action(self): with self.launch_interface_command( arguments=['show', 'test_msgs/action/Fibonacci'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK assert launch_testing.tools.expect_output( expected_lines=[ '#goal definition', 'int32 order', '---', '#result definition', 'int32[] sequence', '---', '#feedback', 'int32[] sequence', ], text=interface_command.output, strict=True ) def test_show_nested_message(self): with self.launch_interface_command( arguments=['show', 'test_msgs/msg/Nested'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK assert launch_testing.tools.expect_output( expected_lines=[ 'BasicTypes basic_types_value', '\tbool bool_value', '\tbyte byte_value', '\tchar char_value', '\tfloat32 float32_value', '\tfloat64 float64_value', '\tint8 int8_value', '\tuint8 uint8_value', '\tint16 int16_value', '\tuint16 uint16_value', '\tint32 int32_value', '\tuint32 uint32_value', '\tint64 int64_value', '\tuint64 uint64_value', ], text=interface_command.output, strict=True ) def test_show_nested_action(self): with self.launch_interface_command( arguments=['show', 'test_msgs/action/NestedMessage'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK assert launch_testing.tools.expect_output( expected_lines=[ '# goal definition', 'Builtins nested_field_no_pkg', '\tbuiltin_interfaces/Duration duration_value', '\t\tint32 sec', '\t\tuint32 nanosec', '\tbuiltin_interfaces/Time time_value', '\t\tint32 sec', '\t\tuint32 nanosec', 'test_msgs/BasicTypes nested_field', '\tbool bool_value', '\tbyte byte_value', '\tchar char_value', '\tfloat32 float32_value', '\tfloat64 float64_value', '\tint8 int8_value', '\tuint8 uint8_value', '\tint16 int16_value', '\tuint16 uint16_value', '\tint32 int32_value', '\tuint32 uint32_value', '\tint64 int64_value', '\tuint64 uint64_value', 'builtin_interfaces/Time nested_different_pkg', '\tint32 sec', '\tuint32 nanosec', '---', '# result definition', 'Builtins nested_field_no_pkg', '\tbuiltin_interfaces/Duration duration_value', '\t\tint32 sec', '\t\tuint32 nanosec', '\tbuiltin_interfaces/Time time_value', '\t\tint32 sec', '\t\tuint32 nanosec', 'test_msgs/BasicTypes nested_field', '\tbool bool_value', '\tbyte byte_value', '\tchar char_value', '\tfloat32 float32_value', '\tfloat64 float64_value', '\tint8 int8_value', '\tuint8 uint8_value', '\tint16 int16_value', '\tuint16 uint16_value', '\tint32 int32_value', '\tuint32 uint32_value', '\tint64 int64_value', '\tuint64 uint64_value', 'builtin_interfaces/Time nested_different_pkg', '\tint32 sec', '\tuint32 nanosec', '---', '# feedback', 'Builtins nested_field_no_pkg', '\tbuiltin_interfaces/Duration duration_value', '\t\tint32 sec', '\t\tuint32 nanosec', '\tbuiltin_interfaces/Time time_value', '\t\tint32 sec', '\t\tuint32 nanosec', 'test_msgs/BasicTypes nested_field', '\tbool bool_value', '\tbyte byte_value', '\tchar char_value', '\tfloat32 float32_value', '\tfloat64 float64_value', '\tint8 int8_value', '\tuint8 uint8_value', '\tint16 int16_value', '\tuint16 uint16_value', '\tint32 int32_value', '\tuint32 uint32_value', '\tint64 int64_value', '\tuint64 uint64_value', 'builtin_interfaces/Time nested_different_pkg', '\tint32 sec', '\tuint32 nanosec', ], text=interface_command.output, strict=True ) def test_show_no_comments_for_nested_action(self): with self.launch_interface_command( arguments=['show', 'test_msgs/action/NestedMessage', '--no-comments'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK assert launch_testing.tools.expect_output( expected_lines=[ 'Builtins nested_field_no_pkg', '\tbuiltin_interfaces/Duration duration_value', '\t\tint32 sec', '\t\tuint32 nanosec', '\tbuiltin_interfaces/Time time_value', '\t\tint32 sec', '\t\tuint32 nanosec', 'test_msgs/BasicTypes nested_field', '\tbool bool_value', '\tbyte byte_value', '\tchar char_value', '\tfloat32 float32_value', '\tfloat64 float64_value', '\tint8 int8_value', '\tuint8 uint8_value', '\tint16 int16_value', '\tuint16 uint16_value', '\tint32 int32_value', '\tuint32 uint32_value', '\tint64 int64_value', '\tuint64 uint64_value', 'builtin_interfaces/Time nested_different_pkg', '\tint32 sec', '\tuint32 nanosec', '---', 'Builtins nested_field_no_pkg', '\tbuiltin_interfaces/Duration duration_value', '\t\tint32 sec', '\t\tuint32 nanosec', '\tbuiltin_interfaces/Time time_value', '\t\tint32 sec', '\t\tuint32 nanosec', 'test_msgs/BasicTypes nested_field', '\tbool bool_value', '\tbyte byte_value', '\tchar char_value', '\tfloat32 float32_value', '\tfloat64 float64_value', '\tint8 int8_value', '\tuint8 uint8_value', '\tint16 int16_value', '\tuint16 uint16_value', '\tint32 int32_value', '\tuint32 uint32_value', '\tint64 int64_value', '\tuint64 uint64_value', 'builtin_interfaces/Time nested_different_pkg', '\tint32 sec', '\tuint32 nanosec', '---', 'Builtins nested_field_no_pkg', '\tbuiltin_interfaces/Duration duration_value', '\t\tint32 sec', '\t\tuint32 nanosec', '\tbuiltin_interfaces/Time time_value', '\t\tint32 sec', '\t\tuint32 nanosec', 'test_msgs/BasicTypes nested_field', '\tbool bool_value', '\tbyte byte_value', '\tchar char_value', '\tfloat32 float32_value', '\tfloat64 float64_value', '\tint8 int8_value', '\tuint8 uint8_value', '\tint16 int16_value', '\tuint16 uint16_value', '\tint32 int32_value', '\tuint32 uint32_value', '\tint64 int64_value', '\tuint64 uint64_value', 'builtin_interfaces/Time nested_different_pkg', '\tint32 sec', '\tuint32 nanosec', ], text=interface_command.output, strict=True ) def test_show_all_comments_for_nested_action(self): with self.launch_interface_command( arguments=['show', 'test_msgs/action/NestedMessage', '--all-comments'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK assert launch_testing.tools.expect_output( expected_lines=[ '# goal definition', 'Builtins nested_field_no_pkg', '\tbuiltin_interfaces/Duration duration_value', '\t\t# Duration defines a period between two time points.', '\t\t# Messages of this datatype are of ROS Time following this design:', '\t\t# https://design.ros2.org/articles/clock_and_time.html', '', '\t\t# Seconds component, range is valid over any possible int32 value.', '\t\tint32 sec', '', '\t\t# Nanoseconds component in the range of [0, 10e9).', '\t\tuint32 nanosec', '\tbuiltin_interfaces/Time time_value', '\t\t# This message communicates ROS Time defined here:', '\t\t# https://design.ros2.org/articles/clock_and_time.html', '', '\t\t# The seconds component, valid over all int32 values.', '\t\tint32 sec', '', '\t\t# The nanoseconds component, valid in the range [0, 10e9).', '\t\tuint32 nanosec', 'test_msgs/BasicTypes nested_field', '\tbool bool_value', '\tbyte byte_value', '\tchar char_value', '\tfloat32 float32_value', '\tfloat64 float64_value', '\tint8 int8_value', '\tuint8 uint8_value', '\tint16 int16_value', '\tuint16 uint16_value', '\tint32 int32_value', '\tuint32 uint32_value', '\tint64 int64_value', '\tuint64 uint64_value', 'builtin_interfaces/Time nested_different_pkg', '\t# This message communicates ROS Time defined here:', '\t# https://design.ros2.org/articles/clock_and_time.html', '', '\t# The seconds component, valid over all int32 values.', '\tint32 sec', '', '\t# The nanoseconds component, valid in the range [0, 10e9).', '\tuint32 nanosec', '---', '# result definition', 'Builtins nested_field_no_pkg', '\tbuiltin_interfaces/Duration duration_value', '\t\t# Duration defines a period between two time points.', '\t\t# Messages of this datatype are of ROS Time following this design:', '\t\t# https://design.ros2.org/articles/clock_and_time.html', '', '\t\t# Seconds component, range is valid over any possible int32 value.', '\t\tint32 sec', '', '\t\t# Nanoseconds component in the range of [0, 10e9).', '\t\tuint32 nanosec', '\tbuiltin_interfaces/Time time_value', '\t\t# This message communicates ROS Time defined here:', '\t\t# https://design.ros2.org/articles/clock_and_time.html', '', '\t\t# The seconds component, valid over all int32 values.', '\t\tint32 sec', '', '\t\t# The nanoseconds component, valid in the range [0, 10e9).', '\t\tuint32 nanosec', 'test_msgs/BasicTypes nested_field', '\tbool bool_value', '\tbyte byte_value', '\tchar char_value', '\tfloat32 float32_value', '\tfloat64 float64_value', '\tint8 int8_value', '\tuint8 uint8_value', '\tint16 int16_value', '\tuint16 uint16_value', '\tint32 int32_value', '\tuint32 uint32_value', '\tint64 int64_value', '\tuint64 uint64_value', 'builtin_interfaces/Time nested_different_pkg', '\t# This message communicates ROS Time defined here:', '\t# https://design.ros2.org/articles/clock_and_time.html', '', '\t# The seconds component, valid over all int32 values.', '\tint32 sec', '', '\t# The nanoseconds component, valid in the range [0, 10e9).', '\tuint32 nanosec', '---', '# feedback', 'Builtins nested_field_no_pkg', '\tbuiltin_interfaces/Duration duration_value', '\t\t# Duration defines a period between two time points.', '\t\t# Messages of this datatype are of ROS Time following this design:', '\t\t# https://design.ros2.org/articles/clock_and_time.html', '', '\t\t# Seconds component, range is valid over any possible int32 value.', '\t\tint32 sec', '', '\t\t# Nanoseconds component in the range of [0, 10e9).', '\t\tuint32 nanosec', '\tbuiltin_interfaces/Time time_value', '\t\t# This message communicates ROS Time defined here:', '\t\t# https://design.ros2.org/articles/clock_and_time.html', '', '\t\t# The seconds component, valid over all int32 values.', '\t\tint32 sec', '', '\t\t# The nanoseconds component, valid in the range [0, 10e9).', '\t\tuint32 nanosec', 'test_msgs/BasicTypes nested_field', '\tbool bool_value', '\tbyte byte_value', '\tchar char_value', '\tfloat32 float32_value', '\tfloat64 float64_value', '\tint8 int8_value', '\tuint8 uint8_value', '\tint16 int16_value', '\tuint16 uint16_value', '\tint32 int32_value', '\tuint32 uint32_value', '\tint64 int64_value', '\tuint64 uint64_value', 'builtin_interfaces/Time nested_different_pkg', '\t# This message communicates ROS Time defined here:', '\t# https://design.ros2.org/articles/clock_and_time.html', '', '\t# The seconds component, valid over all int32 values.', '\tint32 sec', '', '\t# The nanoseconds component, valid in the range [0, 10e9).', '\tuint32 nanosec', ], text=interface_command.output, strict=True ) def test_show_not_a_package(self): with self.launch_interface_command( arguments=['show', 'not_a_package/msg/String'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == 1 assert launch_testing.tools.expect_output( expected_lines=["Unknown package 'not_a_package'"], text=interface_command.output, strict=True ) def test_show_not_an_interface(self): with self.launch_interface_command( arguments=['show', 'test_msgs/msg/NotAMessageTypeName'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == 1 assert launch_testing.tools.expect_output( expected_lines=[re.compile( r"Could not find the interface '.+NotAMessageTypeName\.idl'" )], text=interface_command.output, strict=True ) def test_show_stdin(self): with self.launch_interface_command( arguments=['show', '-'], prepend_arguments=[ sys.executable, '-c', r'"print(\"test_msgs/msg/BasicTypes\")"', '|' ], shell=True ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK assert launch_testing.tools.expect_output( expected_lines=[ 'bool bool_value', 'byte byte_value', 'char char_value', 'float32 float32_value', 'float64 float64_value', 'int8 int8_value', 'uint8 uint8_value', 'int16 int16_value', 'uint16 uint16_value', 'int32 int32_value', 'uint32 uint32_value', 'int64 int64_value', 'uint64 uint64_value', ], text=interface_command.output, strict=True )
40.931034
90
0.55568
import contextlib import itertools import re import sys import unittest from launch import LaunchDescription from launch.actions import ExecuteProcess import launch_testing import launch_testing.actions import launch_testing.asserts import launch_testing.markers import launch_testing.tools import pytest if sys.platform.startswith('win'): pytest.skip( 'CLI tests can block for a pathological amount of time on Windows.', allow_module_level=True) some_messages_from_test_msgs = [ 'test_msgs/msg/BasicTypes', 'test_msgs/msg/Constants', 'test_msgs/msg/Strings', ] some_services_from_test_msgs = [ 'test_msgs/srv/Arrays', 'test_msgs/srv/BasicTypes', 'test_msgs/srv/Empty', ] some_actions_from_test_msgs = [ 'test_msgs/action/Fibonacci' ] some_interfaces = ( some_messages_from_test_msgs + some_services_from_test_msgs + some_actions_from_test_msgs ) @pytest.mark.rostest @launch_testing.markers.keep_alive def generate_test_description(): return LaunchDescription([launch_testing.actions.ReadyToTest()]) class TestROS2InterfaceCLI(unittest.TestCase): @classmethod def setUpClass( cls, launch_service, proc_info, proc_output ): @contextlib.contextmanager def launch_interface_command(self, arguments, prepend_arguments=[], shell=False): interface_command_action = ExecuteProcess( cmd=[*prepend_arguments, 'ros2', 'interface', *arguments], additional_env={'PYTHONUNBUFFERED': '1'}, name='ros2interface-cli', shell=shell, output='screen' ) with launch_testing.tools.launch_process( launch_service, interface_command_action, proc_info, proc_output ) as interface_command: yield interface_command cls.launch_interface_command = launch_interface_command def test_list_interfaces(self): with self.launch_interface_command(arguments=['list']) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK filter_ = launch_testing.tools.basic_output_filter( filtered_prefixes=['Messages:', 'Services:', 'Actions:'] ) output_lines = filter_(interface_command.output).splitlines() assert launch_testing.tools.expect_output( expected_lines=itertools.repeat( re.compile(r'\s*[A-z0-9_]+(/[A-z0-9_]+)+'), len(output_lines) ), lines=output_lines, strict=True ) assert launch_testing.tools.expect_output( expected_lines=some_interfaces, lines=output_lines, strict=False ) def test_list_messages(self): with self.launch_interface_command(arguments=['list', '-m']) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK output_lines = interface_command.output.splitlines() assert launch_testing.tools.expect_output( expected_lines=itertools.chain( ['Messages:'], itertools.repeat( re.compile(r'\s*[A-z0-9_]+(/[A-z0-9_]+)+'), len(output_lines) - 1 ) ), lines=output_lines, strict=True ) assert launch_testing.tools.expect_output( expected_lines=some_messages_from_test_msgs, lines=output_lines, strict=False ) def test_list_services(self): with self.launch_interface_command(arguments=['list', '-s']) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK output_lines = interface_command.output.splitlines() assert launch_testing.tools.expect_output( expected_lines=itertools.chain( ['Services:'], itertools.repeat( re.compile(r'\s*[A-z0-9_]+(/[A-z0-9_]+)+'), len(output_lines) - 1 ) ), lines=output_lines, strict=True ) assert launch_testing.tools.expect_output( expected_lines=some_services_from_test_msgs, lines=output_lines, strict=False ) def test_list_actions(self): with self.launch_interface_command(arguments=['list', '-a']) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK output_lines = interface_command.output.splitlines() assert launch_testing.tools.expect_output( expected_lines=itertools.chain( ['Actions:'], itertools.repeat( re.compile(r'\s*[A-z0-9_]+(/[A-z0-9_]+)+'), len(output_lines) - 1 ) ), lines=output_lines, strict=True ) assert launch_testing.tools.expect_output( expected_lines=some_actions_from_test_msgs, lines=output_lines, strict=False ) def test_package_on_nonexistent_package(self): with self.launch_interface_command( arguments=['package', 'not_a_package'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == 1 assert launch_testing.tools.expect_output( expected_lines=["Unknown package 'not_a_package'"], text=interface_command.output, strict=True ) def test_package_on_test_msgs(self): with self.launch_interface_command( arguments=['package', 'test_msgs'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK output_lines = interface_command.output.splitlines() assert launch_testing.tools.expect_output( expected_lines=itertools.repeat( re.compile(r'test_msgs/(msg|srv|action)/[A-z0-9_]+'), len(output_lines) ), lines=output_lines, strict=True ) assert all(interface in output_lines for interface in some_interfaces) def test_packages(self): with self.launch_interface_command(arguments=['packages']) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK output_lines = interface_command.output.splitlines() assert 'test_msgs' in output_lines def test_packages_with_messages(self): with self.launch_interface_command( arguments=['packages', '-m'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK output_lines = interface_command.output.splitlines() assert 'test_msgs' in output_lines def test_packages_with_services(self): with self.launch_interface_command( arguments=['packages', '-s'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK output_lines = interface_command.output.splitlines() assert 'test_msgs' in output_lines def test_packages_with_actions(self): with self.launch_interface_command( arguments=['packages', '-a'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK output_lines = interface_command.output.splitlines() assert 'test_msgs' in output_lines def test_show_message(self): with self.launch_interface_command( arguments=['show', 'test_msgs/msg/BasicTypes'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK assert launch_testing.tools.expect_output( expected_lines=[ 'bool bool_value', 'byte byte_value', 'char char_value', 'float32 float32_value', 'float64 float64_value', 'int8 int8_value', 'uint8 uint8_value', 'int16 int16_value', 'uint16 uint16_value', 'int32 int32_value', 'uint32 uint32_value', 'int64 int64_value', 'uint64 uint64_value', ], text=interface_command.output, strict=True ) def test_show_all_comments_for_message(self): with self.launch_interface_command( arguments=['show', 'test_msgs/msg/Builtins', '--all-comments'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK assert launch_testing.tools.expect_output( expected_lines=[ 'builtin_interfaces/Duration duration_value', '\t# Duration defines a period between two time points.', '\t# Messages of this datatype are of ROS Time following this design:', '\t# https://design.ros2.org/articles/clock_and_time.html', '', '\t# Seconds component, range is valid over any possible int32 value.', '\tint32 sec', '', '\t# Nanoseconds component in the range of [0, 10e9).', '\tuint32 nanosec', 'builtin_interfaces/Time time_value', '\t# This message communicates ROS Time defined here:', '\t# https://design.ros2.org/articles/clock_and_time.html', '', '\t# The seconds component, valid over all int32 values.', '\tint32 sec', '', '\t# The nanoseconds component, valid in the range [0, 10e9).', '\tuint32 nanosec', ], text=interface_command.output, strict=True ) def test_show_no_comments_for_message(self): with self.launch_interface_command( arguments=['show', 'test_msgs/msg/Builtins', '--no-comments'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK assert launch_testing.tools.expect_output( expected_lines=[ 'builtin_interfaces/Duration duration_value', '\tint32 sec', '\tuint32 nanosec', 'builtin_interfaces/Time time_value', '\tint32 sec', '\tuint32 nanosec', ], text=interface_command.output, strict=True ) def test_show_service(self): with self.launch_interface_command( arguments=['show', 'test_msgs/srv/BasicTypes'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK assert launch_testing.tools.expect_output( expected_lines=[ 'bool bool_value', 'byte byte_value', 'char char_value', 'float32 float32_value', 'float64 float64_value', 'int8 int8_value', 'uint8 uint8_value', 'int16 int16_value', 'uint16 uint16_value', 'int32 int32_value', 'uint32 uint32_value', 'int64 int64_value', 'uint64 uint64_value', 'string string_value', '---', 'bool bool_value', 'byte byte_value', 'char char_value', 'float32 float32_value', 'float64 float64_value', 'int8 int8_value', 'uint8 uint8_value', 'int16 int16_value', 'uint16 uint16_value', 'int32 int32_value', 'uint32 uint32_value', 'int64 int64_value', 'uint64 uint64_value', 'string string_value', ], text=interface_command.output, strict=True ) def test_show_action(self): with self.launch_interface_command( arguments=['show', 'test_msgs/action/Fibonacci'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK assert launch_testing.tools.expect_output( expected_lines=[ '#goal definition', 'int32 order', '---', '#result definition', 'int32[] sequence', '---', '#feedback', 'int32[] sequence', ], text=interface_command.output, strict=True ) def test_show_nested_message(self): with self.launch_interface_command( arguments=['show', 'test_msgs/msg/Nested'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK assert launch_testing.tools.expect_output( expected_lines=[ 'BasicTypes basic_types_value', '\tbool bool_value', '\tbyte byte_value', '\tchar char_value', '\tfloat32 float32_value', '\tfloat64 float64_value', '\tint8 int8_value', '\tuint8 uint8_value', '\tint16 int16_value', '\tuint16 uint16_value', '\tint32 int32_value', '\tuint32 uint32_value', '\tint64 int64_value', '\tuint64 uint64_value', ], text=interface_command.output, strict=True ) def test_show_nested_action(self): with self.launch_interface_command( arguments=['show', 'test_msgs/action/NestedMessage'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK assert launch_testing.tools.expect_output( expected_lines=[ '# goal definition', 'Builtins nested_field_no_pkg', '\tbuiltin_interfaces/Duration duration_value', '\t\tint32 sec', '\t\tuint32 nanosec', '\tbuiltin_interfaces/Time time_value', '\t\tint32 sec', '\t\tuint32 nanosec', 'test_msgs/BasicTypes nested_field', '\tbool bool_value', '\tbyte byte_value', '\tchar char_value', '\tfloat32 float32_value', '\tfloat64 float64_value', '\tint8 int8_value', '\tuint8 uint8_value', '\tint16 int16_value', '\tuint16 uint16_value', '\tint32 int32_value', '\tuint32 uint32_value', '\tint64 int64_value', '\tuint64 uint64_value', 'builtin_interfaces/Time nested_different_pkg', '\tint32 sec', '\tuint32 nanosec', '---', '# result definition', 'Builtins nested_field_no_pkg', '\tbuiltin_interfaces/Duration duration_value', '\t\tint32 sec', '\t\tuint32 nanosec', '\tbuiltin_interfaces/Time time_value', '\t\tint32 sec', '\t\tuint32 nanosec', 'test_msgs/BasicTypes nested_field', '\tbool bool_value', '\tbyte byte_value', '\tchar char_value', '\tfloat32 float32_value', '\tfloat64 float64_value', '\tint8 int8_value', '\tuint8 uint8_value', '\tint16 int16_value', '\tuint16 uint16_value', '\tint32 int32_value', '\tuint32 uint32_value', '\tint64 int64_value', '\tuint64 uint64_value', 'builtin_interfaces/Time nested_different_pkg', '\tint32 sec', '\tuint32 nanosec', '---', '# feedback', 'Builtins nested_field_no_pkg', '\tbuiltin_interfaces/Duration duration_value', '\t\tint32 sec', '\t\tuint32 nanosec', '\tbuiltin_interfaces/Time time_value', '\t\tint32 sec', '\t\tuint32 nanosec', 'test_msgs/BasicTypes nested_field', '\tbool bool_value', '\tbyte byte_value', '\tchar char_value', '\tfloat32 float32_value', '\tfloat64 float64_value', '\tint8 int8_value', '\tuint8 uint8_value', '\tint16 int16_value', '\tuint16 uint16_value', '\tint32 int32_value', '\tuint32 uint32_value', '\tint64 int64_value', '\tuint64 uint64_value', 'builtin_interfaces/Time nested_different_pkg', '\tint32 sec', '\tuint32 nanosec', ], text=interface_command.output, strict=True ) def test_show_no_comments_for_nested_action(self): with self.launch_interface_command( arguments=['show', 'test_msgs/action/NestedMessage', '--no-comments'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK assert launch_testing.tools.expect_output( expected_lines=[ 'Builtins nested_field_no_pkg', '\tbuiltin_interfaces/Duration duration_value', '\t\tint32 sec', '\t\tuint32 nanosec', '\tbuiltin_interfaces/Time time_value', '\t\tint32 sec', '\t\tuint32 nanosec', 'test_msgs/BasicTypes nested_field', '\tbool bool_value', '\tbyte byte_value', '\tchar char_value', '\tfloat32 float32_value', '\tfloat64 float64_value', '\tint8 int8_value', '\tuint8 uint8_value', '\tint16 int16_value', '\tuint16 uint16_value', '\tint32 int32_value', '\tuint32 uint32_value', '\tint64 int64_value', '\tuint64 uint64_value', 'builtin_interfaces/Time nested_different_pkg', '\tint32 sec', '\tuint32 nanosec', '---', 'Builtins nested_field_no_pkg', '\tbuiltin_interfaces/Duration duration_value', '\t\tint32 sec', '\t\tuint32 nanosec', '\tbuiltin_interfaces/Time time_value', '\t\tint32 sec', '\t\tuint32 nanosec', 'test_msgs/BasicTypes nested_field', '\tbool bool_value', '\tbyte byte_value', '\tchar char_value', '\tfloat32 float32_value', '\tfloat64 float64_value', '\tint8 int8_value', '\tuint8 uint8_value', '\tint16 int16_value', '\tuint16 uint16_value', '\tint32 int32_value', '\tuint32 uint32_value', '\tint64 int64_value', '\tuint64 uint64_value', 'builtin_interfaces/Time nested_different_pkg', '\tint32 sec', '\tuint32 nanosec', '---', 'Builtins nested_field_no_pkg', '\tbuiltin_interfaces/Duration duration_value', '\t\tint32 sec', '\t\tuint32 nanosec', '\tbuiltin_interfaces/Time time_value', '\t\tint32 sec', '\t\tuint32 nanosec', 'test_msgs/BasicTypes nested_field', '\tbool bool_value', '\tbyte byte_value', '\tchar char_value', '\tfloat32 float32_value', '\tfloat64 float64_value', '\tint8 int8_value', '\tuint8 uint8_value', '\tint16 int16_value', '\tuint16 uint16_value', '\tint32 int32_value', '\tuint32 uint32_value', '\tint64 int64_value', '\tuint64 uint64_value', 'builtin_interfaces/Time nested_different_pkg', '\tint32 sec', '\tuint32 nanosec', ], text=interface_command.output, strict=True ) def test_show_all_comments_for_nested_action(self): with self.launch_interface_command( arguments=['show', 'test_msgs/action/NestedMessage', '--all-comments'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK assert launch_testing.tools.expect_output( expected_lines=[ '# goal definition', 'Builtins nested_field_no_pkg', '\tbuiltin_interfaces/Duration duration_value', '\t\t# Duration defines a period between two time points.', '\t\t# Messages of this datatype are of ROS Time following this design:', '\t\t# https://design.ros2.org/articles/clock_and_time.html', '', '\t\t# Seconds component, range is valid over any possible int32 value.', '\t\tint32 sec', '', '\t\t# Nanoseconds component in the range of [0, 10e9).', '\t\tuint32 nanosec', '\tbuiltin_interfaces/Time time_value', '\t\t# This message communicates ROS Time defined here:', '\t\t# https://design.ros2.org/articles/clock_and_time.html', '', '\t\t# The seconds component, valid over all int32 values.', '\t\tint32 sec', '', '\t\t# The nanoseconds component, valid in the range [0, 10e9).', '\t\tuint32 nanosec', 'test_msgs/BasicTypes nested_field', '\tbool bool_value', '\tbyte byte_value', '\tchar char_value', '\tfloat32 float32_value', '\tfloat64 float64_value', '\tint8 int8_value', '\tuint8 uint8_value', '\tint16 int16_value', '\tuint16 uint16_value', '\tint32 int32_value', '\tuint32 uint32_value', '\tint64 int64_value', '\tuint64 uint64_value', 'builtin_interfaces/Time nested_different_pkg', '\t# This message communicates ROS Time defined here:', '\t# https://design.ros2.org/articles/clock_and_time.html', '', '\t# The seconds component, valid over all int32 values.', '\tint32 sec', '', '\t# The nanoseconds component, valid in the range [0, 10e9).', '\tuint32 nanosec', '---', '# result definition', 'Builtins nested_field_no_pkg', '\tbuiltin_interfaces/Duration duration_value', '\t\t# Duration defines a period between two time points.', '\t\t# Messages of this datatype are of ROS Time following this design:', '\t\t# https://design.ros2.org/articles/clock_and_time.html', '', '\t\t# Seconds component, range is valid over any possible int32 value.', '\t\tint32 sec', '', '\t\t# Nanoseconds component in the range of [0, 10e9).', '\t\tuint32 nanosec', '\tbuiltin_interfaces/Time time_value', '\t\t# This message communicates ROS Time defined here:', '\t\t# https://design.ros2.org/articles/clock_and_time.html', '', '\t\t# The seconds component, valid over all int32 values.', '\t\tint32 sec', '', '\t\t# The nanoseconds component, valid in the range [0, 10e9).', '\t\tuint32 nanosec', 'test_msgs/BasicTypes nested_field', '\tbool bool_value', '\tbyte byte_value', '\tchar char_value', '\tfloat32 float32_value', '\tfloat64 float64_value', '\tint8 int8_value', '\tuint8 uint8_value', '\tint16 int16_value', '\tuint16 uint16_value', '\tint32 int32_value', '\tuint32 uint32_value', '\tint64 int64_value', '\tuint64 uint64_value', 'builtin_interfaces/Time nested_different_pkg', '\t# This message communicates ROS Time defined here:', '\t# https://design.ros2.org/articles/clock_and_time.html', '', '\t# The seconds component, valid over all int32 values.', '\tint32 sec', '', '\t# The nanoseconds component, valid in the range [0, 10e9).', '\tuint32 nanosec', '---', '# feedback', 'Builtins nested_field_no_pkg', '\tbuiltin_interfaces/Duration duration_value', '\t\t# Duration defines a period between two time points.', '\t\t# Messages of this datatype are of ROS Time following this design:', '\t\t# https://design.ros2.org/articles/clock_and_time.html', '', '\t\t# Seconds component, range is valid over any possible int32 value.', '\t\tint32 sec', '', '\t\t# Nanoseconds component in the range of [0, 10e9).', '\t\tuint32 nanosec', '\tbuiltin_interfaces/Time time_value', '\t\t# This message communicates ROS Time defined here:', '\t\t# https://design.ros2.org/articles/clock_and_time.html', '', '\t\t# The seconds component, valid over all int32 values.', '\t\tint32 sec', '', '\t\t# The nanoseconds component, valid in the range [0, 10e9).', '\t\tuint32 nanosec', 'test_msgs/BasicTypes nested_field', '\tbool bool_value', '\tbyte byte_value', '\tchar char_value', '\tfloat32 float32_value', '\tfloat64 float64_value', '\tint8 int8_value', '\tuint8 uint8_value', '\tint16 int16_value', '\tuint16 uint16_value', '\tint32 int32_value', '\tuint32 uint32_value', '\tint64 int64_value', '\tuint64 uint64_value', 'builtin_interfaces/Time nested_different_pkg', '\t# This message communicates ROS Time defined here:', '\t# https://design.ros2.org/articles/clock_and_time.html', '', '\t# The seconds component, valid over all int32 values.', '\tint32 sec', '', '\t# The nanoseconds component, valid in the range [0, 10e9).', '\tuint32 nanosec', ], text=interface_command.output, strict=True ) def test_show_not_a_package(self): with self.launch_interface_command( arguments=['show', 'not_a_package/msg/String'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == 1 assert launch_testing.tools.expect_output( expected_lines=["Unknown package 'not_a_package'"], text=interface_command.output, strict=True ) def test_show_not_an_interface(self): with self.launch_interface_command( arguments=['show', 'test_msgs/msg/NotAMessageTypeName'] ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == 1 assert launch_testing.tools.expect_output( expected_lines=[re.compile( r"Could not find the interface '.+NotAMessageTypeName\.idl'" )], text=interface_command.output, strict=True ) def test_show_stdin(self): with self.launch_interface_command( arguments=['show', '-'], prepend_arguments=[ sys.executable, '-c', r'"print(\"test_msgs/msg/BasicTypes\")"', '|' ], shell=True ) as interface_command: assert interface_command.wait_for_shutdown(timeout=2) assert interface_command.exit_code == launch_testing.asserts.EXIT_OK assert launch_testing.tools.expect_output( expected_lines=[ 'bool bool_value', 'byte byte_value', 'char char_value', 'float32 float32_value', 'float64 float64_value', 'int8 int8_value', 'uint8 uint8_value', 'int16 int16_value', 'uint16 uint16_value', 'int32 int32_value', 'uint32 uint32_value', 'int64 int64_value', 'uint64 uint64_value', ], text=interface_command.output, strict=True )
true
true
f7261a33bda347e1351ccdc5511b79b1e79f4d69
10,223
py
Python
we.py
TimeTraveller-San/FairGAN
526c2937714fc322714db54dc6a3f392f2c88e18
[ "MIT" ]
8
2020-03-06T12:53:53.000Z
2021-08-31T18:11:36.000Z
we.py
TimeTraveller-San/FairGAN
526c2937714fc322714db54dc6a3f392f2c88e18
[ "MIT" ]
null
null
null
we.py
TimeTraveller-San/FairGAN
526c2937714fc322714db54dc6a3f392f2c88e18
[ "MIT" ]
null
null
null
from __future__ import print_function, division import re import sys import numpy as np import scipy.sparse import codecs from sklearn.decomposition import PCA if sys.version_info[0] < 3: import io open = io.open else: unicode = str """ Tools for debiasing word embeddings Man is to Computer Programmer as Woman is to Homemaker? Debiasing Word Embeddings Tolga Bolukbasi, Kai-Wei Chang, James Zou, Venkatesh Saligrama, and Adam Kalai 2016 """ DEFAULT_NUM_WORDS = 27000 FILENAMES = {"g_wiki": "glove.6B.300d.small.txt", "g_twitter": "glove.twitter.27B.200d.small.txt", "g_crawl": "glove.840B.300d.small.txt", "w2v": "GoogleNews-word2vec.small.txt", "w2v_large": "GoogleNews-word2vec.txt"} def dedup(seq): seen = set() return [x for x in seq if not (x in seen or seen.add(x))] def safe_word(w): # ignore words with numbers, etc. # [a-zA-Z\.'_\- :;\(\)\]] for emoticons return (re.match(r"^[a-z_]*$", w) and len(w) < 20 and not re.match(r"^_*$", w)) def to_utf8(text, errors='strict', encoding='utf8'): """Convert a string (unicode or bytestring in `encoding`), to bytestring in utf8.""" if isinstance(text, unicode): return text.encode('utf8') # do bytestring -> unicode -> utf8 full circle, to ensure valid utf8 return unicode(text, encoding, errors=errors).encode('utf8') def load_embeddings_from_np(filename): print('loading ...') with codecs.open(filename + '.vocab', 'r', 'utf-8') as f_embed: vocab = [line.strip() for line in f_embed] wv = np.load(filename + '.wv.npy') return vocab, wv class WordEmbedding: def __init__(self, fname): self.thresh = None self.max_words = None self.desc = fname print("*** Reading data from " + fname) if fname.endswith(".bin"): import gensim.models model = gensim.models.KeyedVectors.load_word2vec_format(fname, binary=True) words = sorted([w for w in model.vocab], key=lambda w: model.vocab[w].index) vecs = [model[w] for w in words] elif fname.endswith(".txt"): print("Loading w2vec format") vecs = [] words = [] with open(fname, "r") as f: lines = f.readlines() for line in lines: tokens = line.split() v = np.array([float(x) for x in tokens[-300:]]) w = "_".join([str(x) for x in tokens[:-300]]) if len(v) != 300: print(f"Weird line: {tokens} | {len(v)}") continue words.append(w) vecs.append(v) else: print("Loading numpy format") words, vecs = load_embeddings_from_np(fname) self.vecs = np.array(vecs, dtype='float32') print(self.vecs.shape) self.words = words self.reindex() norms = np.linalg.norm(self.vecs, axis=1) if max(norms)-min(norms) > 0.0001: self.normalize() def reindex(self): self.index = {w: i for i, w in enumerate(self.words)} self.rindex = {i: w for i, w in enumerate(self.words)} self.n, self.d = self.vecs.shape assert self.n == len(self.words) == len(self.index) self._neighbors = None print(self.n, "words of dimension", self.d, ":", ", ".join(self.words[:4] + ["..."] + self.words[-4:])) def v(self, word): return self.vecs[self.index[word]] def diff(self, word1, word2): v = self.vecs[self.index[word1]] - self.vecs[self.index[word2]] return v/np.linalg.norm(v) def normalize(self): self.desc += ", normalize" self.vecs /= np.linalg.norm(self.vecs, axis=1)[:, np.newaxis] self.reindex() def shrink(self, numwords): self.desc += ", shrink " + str(numwords) self.filter_words(lambda w: self.index[w]<numwords) def filter_words(self, test): """ Keep some words based on test, e.g. lambda x: x.lower()==x """ self.desc += ", filter" kept_indices, words = zip(*[[i, w] for i, w in enumerate(self.words) if test(w)]) self.words = list(words) self.vecs = self.vecs[kept_indices, :] self.reindex() def save(self, filename): with open(filename, "w") as f: f.write("\n".join([w+" " + " ".join([str(x) for x in v]) for w, v in zip(self.words, self.vecs)])) print("Wrote", self.n, "words to", filename) def save_w2v(self, filename, binary=True): with open(filename, 'wb') as fout: fout.write(to_utf8("%s %s\n" % self.vecs.shape)) # store in sorted order: most frequent words at the top for i, word in enumerate(self.words): row = self.vecs[i] if binary: fout.write(to_utf8(word) + b" " + row.tostring()) else: fout.write(to_utf8("%s %s\n" % (word, ' '.join("%f" % val for val in row)))) def remove_directions(self, directions): #directions better be orthogonal self.desc += ", removed" for direction in directions: self.desc += " " if type(direction) is np.ndarray: v = direction / np.linalg.norm(direction) self.desc += "vector " else: w1, w2 = direction v = self.diff(w1, w2) self.desc += w1 + "-" + w2 self.vecs = self.vecs - self.vecs.dot(v)[:, np.newaxis].dot(v[np.newaxis, :]) self.normalize() def compute_neighbors_if_necessary(self, thresh, max_words): thresh = float(thresh) # dang python 2.7! if self._neighbors is not None and self.thresh == thresh and self.max_words == max_words: return print("Computing neighbors") self.thresh = thresh self.max_words = max_words vecs = self.vecs[:max_words] dots = vecs.dot(vecs.T) dots = scipy.sparse.csr_matrix(dots * (dots >= 1-thresh/2)) from collections import Counter rows, cols = dots.nonzero() nums = list(Counter(rows).values()) print("Mean:", np.mean(nums)-1) print("Median:", np.median(nums)-1) rows, cols, vecs = zip(*[(i, j, vecs[i]-vecs[j]) for i, j, x in zip(rows, cols, dots.data) if i<j]) self._neighbors = rows, cols, np.array([v/np.linalg.norm(v) for v in vecs]) def neighbors(self, word, thresh=1): dots = self.vecs.dot(self.v(word)) dd = dict(zip([abs(dot) for dot in dots], [i for i in range(len(dots))])) ns=[] for dot in sorted(dd, reverse=True): if dot>1-thresh/2: ns.append(self.words[int(dd[dot])]) return ns[1:] #Since first word is the word itself def neighborsNoSort(self, word, thresh=1): dots = self.vecs.dot(self.v(word)) dd = dict(zip([abs(dot) for dot in dots], [i for i in range(len(dots))])) ns=[] for dot in sorted(dd, reverse=True): if dot>1-thresh/2: ns.append(self.words[int(dd[dot])]) return ns[1:] #Since first word is the word itself def more_words_like_these(self, words, topn=50, max_freq=100000): v = sum(self.v(w) for w in words) dots = self.vecs[:max_freq].dot(v) thresh = sorted(dots)[-topn] words = [w for w, dot in zip(self.words, dots) if dot>=thresh] return sorted(words, key=lambda w: self.v(w).dot(v))[-topn:][::-1] def best_analogies_dist_thresh(self, v, thresh=1, topn=500, max_words=50000): """Metric is cos(a-c, b-d) if |b-d|^2 < thresh, otherwise 0 """ vecs, vocab = self.vecs[:max_words], self.words[:max_words] self.compute_neighbors_if_necessary(thresh, max_words) rows, cols, vecs = self._neighbors scores = vecs.dot(v/np.linalg.norm(v)) pi = np.argsort(-abs(scores)) ans = [] usedL = set() usedR = set() for i in pi: if abs(scores[i])<0.001: break row = rows[i] if scores[i] > 0 else cols[i] col = cols[i] if scores[i] > 0 else rows[i] if row in usedL or col in usedR: continue usedL.add(row) usedR.add(col) ans.append((vocab[row], vocab[col], abs(scores[i]))) if len(ans)==topn: break return ans def viz(analogies): print("\n".join(str(i).rjust(4)+a[0].rjust(29) + " | " + a[1].ljust(29) + (str(a[2]))[:4] for i, a in enumerate(analogies))) def text_plot_words(xs, ys, words, width = 90, height = 40, filename=None): PADDING = 10 # num chars on left and right in case words spill over res = [[' ' for i in range(width)] for j in range(height)] def rescale(nums): a = min(nums) b = max(nums) return [(x-a)/(b-a) for x in nums] print("x:", (min(xs), max(xs)), "y:",(min(ys),max(ys))) xs = rescale(xs) ys = rescale(ys) for (x, y, word) in zip(xs, ys, words): i = int(x*(width - 1 - PADDING)) j = int(y*(height-1)) row = res[j] z = list(row[i2] != ' ' for i2 in range(max(i-1, 0), min(width, i + len(word) + 1))) if any(z): continue for k in range(len(word)): if i+k>=width: break row[i+k] = word[k] string = "\n".join("".join(r) for r in res) # return string if filename: with open(filename, "w", encoding="utf8") as f: f.write(string) print("Wrote to", filename) else: print(string) def doPCA(pairs, embedding, num_components = 10): matrix = [] for a, b in pairs: center = (embedding.v(a) + embedding.v(b))/2 matrix.append(embedding.v(a) - center) matrix.append(embedding.v(b) - center) matrix = np.array(matrix) pca = PCA(n_components = num_components) pca.fit(matrix) # bar(range(num_components), pca.explained_variance_ratio_) return pca def drop(u, v): return u - v * u.dot(v) / v.dot(v)
36.773381
128
0.555806
from __future__ import print_function, division import re import sys import numpy as np import scipy.sparse import codecs from sklearn.decomposition import PCA if sys.version_info[0] < 3: import io open = io.open else: unicode = str DEFAULT_NUM_WORDS = 27000 FILENAMES = {"g_wiki": "glove.6B.300d.small.txt", "g_twitter": "glove.twitter.27B.200d.small.txt", "g_crawl": "glove.840B.300d.small.txt", "w2v": "GoogleNews-word2vec.small.txt", "w2v_large": "GoogleNews-word2vec.txt"} def dedup(seq): seen = set() return [x for x in seq if not (x in seen or seen.add(x))] def safe_word(w): return (re.match(r"^[a-z_]*$", w) and len(w) < 20 and not re.match(r"^_*$", w)) def to_utf8(text, errors='strict', encoding='utf8'): if isinstance(text, unicode): return text.encode('utf8') # do bytestring -> unicode -> utf8 full circle, to ensure valid utf8 return unicode(text, encoding, errors=errors).encode('utf8') def load_embeddings_from_np(filename): print('loading ...') with codecs.open(filename + '.vocab', 'r', 'utf-8') as f_embed: vocab = [line.strip() for line in f_embed] wv = np.load(filename + '.wv.npy') return vocab, wv class WordEmbedding: def __init__(self, fname): self.thresh = None self.max_words = None self.desc = fname print("*** Reading data from " + fname) if fname.endswith(".bin"): import gensim.models model = gensim.models.KeyedVectors.load_word2vec_format(fname, binary=True) words = sorted([w for w in model.vocab], key=lambda w: model.vocab[w].index) vecs = [model[w] for w in words] elif fname.endswith(".txt"): print("Loading w2vec format") vecs = [] words = [] with open(fname, "r") as f: lines = f.readlines() for line in lines: tokens = line.split() v = np.array([float(x) for x in tokens[-300:]]) w = "_".join([str(x) for x in tokens[:-300]]) if len(v) != 300: print(f"Weird line: {tokens} | {len(v)}") continue words.append(w) vecs.append(v) else: print("Loading numpy format") words, vecs = load_embeddings_from_np(fname) self.vecs = np.array(vecs, dtype='float32') print(self.vecs.shape) self.words = words self.reindex() norms = np.linalg.norm(self.vecs, axis=1) if max(norms)-min(norms) > 0.0001: self.normalize() def reindex(self): self.index = {w: i for i, w in enumerate(self.words)} self.rindex = {i: w for i, w in enumerate(self.words)} self.n, self.d = self.vecs.shape assert self.n == len(self.words) == len(self.index) self._neighbors = None print(self.n, "words of dimension", self.d, ":", ", ".join(self.words[:4] + ["..."] + self.words[-4:])) def v(self, word): return self.vecs[self.index[word]] def diff(self, word1, word2): v = self.vecs[self.index[word1]] - self.vecs[self.index[word2]] return v/np.linalg.norm(v) def normalize(self): self.desc += ", normalize" self.vecs /= np.linalg.norm(self.vecs, axis=1)[:, np.newaxis] self.reindex() def shrink(self, numwords): self.desc += ", shrink " + str(numwords) self.filter_words(lambda w: self.index[w]<numwords) def filter_words(self, test): self.desc += ", filter" kept_indices, words = zip(*[[i, w] for i, w in enumerate(self.words) if test(w)]) self.words = list(words) self.vecs = self.vecs[kept_indices, :] self.reindex() def save(self, filename): with open(filename, "w") as f: f.write("\n".join([w+" " + " ".join([str(x) for x in v]) for w, v in zip(self.words, self.vecs)])) print("Wrote", self.n, "words to", filename) def save_w2v(self, filename, binary=True): with open(filename, 'wb') as fout: fout.write(to_utf8("%s %s\n" % self.vecs.shape)) # store in sorted order: most frequent words at the top for i, word in enumerate(self.words): row = self.vecs[i] if binary: fout.write(to_utf8(word) + b" " + row.tostring()) else: fout.write(to_utf8("%s %s\n" % (word, ' '.join("%f" % val for val in row)))) def remove_directions(self, directions): #directions better be orthogonal self.desc += ", removed" for direction in directions: self.desc += " " if type(direction) is np.ndarray: v = direction / np.linalg.norm(direction) self.desc += "vector " else: w1, w2 = direction v = self.diff(w1, w2) self.desc += w1 + "-" + w2 self.vecs = self.vecs - self.vecs.dot(v)[:, np.newaxis].dot(v[np.newaxis, :]) self.normalize() def compute_neighbors_if_necessary(self, thresh, max_words): thresh = float(thresh) # dang python 2.7! if self._neighbors is not None and self.thresh == thresh and self.max_words == max_words: return print("Computing neighbors") self.thresh = thresh self.max_words = max_words vecs = self.vecs[:max_words] dots = vecs.dot(vecs.T) dots = scipy.sparse.csr_matrix(dots * (dots >= 1-thresh/2)) from collections import Counter rows, cols = dots.nonzero() nums = list(Counter(rows).values()) print("Mean:", np.mean(nums)-1) print("Median:", np.median(nums)-1) rows, cols, vecs = zip(*[(i, j, vecs[i]-vecs[j]) for i, j, x in zip(rows, cols, dots.data) if i<j]) self._neighbors = rows, cols, np.array([v/np.linalg.norm(v) for v in vecs]) def neighbors(self, word, thresh=1): dots = self.vecs.dot(self.v(word)) dd = dict(zip([abs(dot) for dot in dots], [i for i in range(len(dots))])) ns=[] for dot in sorted(dd, reverse=True): if dot>1-thresh/2: ns.append(self.words[int(dd[dot])]) return ns[1:] #Since first word is the word itself def neighborsNoSort(self, word, thresh=1): dots = self.vecs.dot(self.v(word)) dd = dict(zip([abs(dot) for dot in dots], [i for i in range(len(dots))])) ns=[] for dot in sorted(dd, reverse=True): if dot>1-thresh/2: ns.append(self.words[int(dd[dot])]) return ns[1:] #Since first word is the word itself def more_words_like_these(self, words, topn=50, max_freq=100000): v = sum(self.v(w) for w in words) dots = self.vecs[:max_freq].dot(v) thresh = sorted(dots)[-topn] words = [w for w, dot in zip(self.words, dots) if dot>=thresh] return sorted(words, key=lambda w: self.v(w).dot(v))[-topn:][::-1] def best_analogies_dist_thresh(self, v, thresh=1, topn=500, max_words=50000): vecs, vocab = self.vecs[:max_words], self.words[:max_words] self.compute_neighbors_if_necessary(thresh, max_words) rows, cols, vecs = self._neighbors scores = vecs.dot(v/np.linalg.norm(v)) pi = np.argsort(-abs(scores)) ans = [] usedL = set() usedR = set() for i in pi: if abs(scores[i])<0.001: break row = rows[i] if scores[i] > 0 else cols[i] col = cols[i] if scores[i] > 0 else rows[i] if row in usedL or col in usedR: continue usedL.add(row) usedR.add(col) ans.append((vocab[row], vocab[col], abs(scores[i]))) if len(ans)==topn: break return ans def viz(analogies): print("\n".join(str(i).rjust(4)+a[0].rjust(29) + " | " + a[1].ljust(29) + (str(a[2]))[:4] for i, a in enumerate(analogies))) def text_plot_words(xs, ys, words, width = 90, height = 40, filename=None): PADDING = 10 # num chars on left and right in case words spill over res = [[' ' for i in range(width)] for j in range(height)] def rescale(nums): a = min(nums) b = max(nums) return [(x-a)/(b-a) for x in nums] print("x:", (min(xs), max(xs)), "y:",(min(ys),max(ys))) xs = rescale(xs) ys = rescale(ys) for (x, y, word) in zip(xs, ys, words): i = int(x*(width - 1 - PADDING)) j = int(y*(height-1)) row = res[j] z = list(row[i2] != ' ' for i2 in range(max(i-1, 0), min(width, i + len(word) + 1))) if any(z): continue for k in range(len(word)): if i+k>=width: break row[i+k] = word[k] string = "\n".join("".join(r) for r in res) # return string if filename: with open(filename, "w", encoding="utf8") as f: f.write(string) print("Wrote to", filename) else: print(string) def doPCA(pairs, embedding, num_components = 10): matrix = [] for a, b in pairs: center = (embedding.v(a) + embedding.v(b))/2 matrix.append(embedding.v(a) - center) matrix.append(embedding.v(b) - center) matrix = np.array(matrix) pca = PCA(n_components = num_components) pca.fit(matrix) # bar(range(num_components), pca.explained_variance_ratio_) return pca def drop(u, v): return u - v * u.dot(v) / v.dot(v)
true
true
f7261adeb044fff4db6dbfd9fb7364d1c5977719
2,556
py
Python
PDK_Generator/inverse_design_y_branch/lumopt/geometries/parameterized_geometry.py
seanlam97/PDK_Generator
15c1f4f56575f8e21ea874443d06ef740ccb5aa5
[ "MIT" ]
null
null
null
PDK_Generator/inverse_design_y_branch/lumopt/geometries/parameterized_geometry.py
seanlam97/PDK_Generator
15c1f4f56575f8e21ea874443d06ef740ccb5aa5
[ "MIT" ]
3
2021-08-24T23:31:42.000Z
2021-08-25T16:45:54.000Z
PDK_Generator/inverse_design_y_branch/lumopt/geometries/parameterized_geometry.py
seanlam97/PDK_Generator
15c1f4f56575f8e21ea874443d06ef740ccb5aa5
[ "MIT" ]
null
null
null
import numpy as np import inspect from lumopt.geometries.geometry import Geometry class ParameterizedGeometry(Geometry): """ Defines a parametrized geometry using any of the built-in geometric structures available in the FDTD CAD. Users must provide a Python function with the signature ('params', 'fdtd', 'only_update'). The function must take the optimization parameters and a handle to the FDTD CAD to build the geometry under optimization (material assignments included). The flag 'only_update' is used to avoid frequent recreations of the parameterized geometry: when the flag is true, it is assumed that the geometry was already added at least once to the CAD. Parameters ---------- :param func: function with the signature ('params', 'fdtd', 'only_update', **kwargs). :param initial_params: flat array with the initial optimization parameter values. :param bounds: bounding ranges (min/max pairs) for each optimization parameter. :param dx: step size for computing the figure of merit gradient using permittivity perturbations. """ def __init__(self, func, initial_params, bounds, dx, deps_num_threads=1): self.deps_num_threads=deps_num_threads self.func = func self.current_params = np.array(initial_params).flatten() self.bounds = bounds self.dx = float(dx) if inspect.isfunction(self.func): bound_args = inspect.signature(self.func).bind('params', 'fdtd', 'only_update') if bound_args.args != ('params', 'fdtd', 'only_update'): raise UserWarning("user defined function does not take three positional arguments.") else: raise UserWarning("argument 'func' must be a Python function.") if self.dx <= 0.0: raise UserWarning("step size must be positive.") self.params_hist = list(self.current_params) def update_geometry(self, params, sim): self.current_params = params self.params_hist.append(params) def get_current_params(self): return self.current_params def calculate_gradients(self, gradient_fields): raise UserWarning("unsupported gradient calculation method.") def add_geo(self, sim, params, only_update): sim.fdtd.switchtolayout() if params is None: return self.func(self.current_params, sim.fdtd, only_update) else: return self.func(params, sim.fdtd, only_update)
45.642857
122
0.673709
import numpy as np import inspect from lumopt.geometries.geometry import Geometry class ParameterizedGeometry(Geometry): def __init__(self, func, initial_params, bounds, dx, deps_num_threads=1): self.deps_num_threads=deps_num_threads self.func = func self.current_params = np.array(initial_params).flatten() self.bounds = bounds self.dx = float(dx) if inspect.isfunction(self.func): bound_args = inspect.signature(self.func).bind('params', 'fdtd', 'only_update') if bound_args.args != ('params', 'fdtd', 'only_update'): raise UserWarning("user defined function does not take three positional arguments.") else: raise UserWarning("argument 'func' must be a Python function.") if self.dx <= 0.0: raise UserWarning("step size must be positive.") self.params_hist = list(self.current_params) def update_geometry(self, params, sim): self.current_params = params self.params_hist.append(params) def get_current_params(self): return self.current_params def calculate_gradients(self, gradient_fields): raise UserWarning("unsupported gradient calculation method.") def add_geo(self, sim, params, only_update): sim.fdtd.switchtolayout() if params is None: return self.func(self.current_params, sim.fdtd, only_update) else: return self.func(params, sim.fdtd, only_update)
true
true
f7261d7103b3c953a4264b678c7599501789f591
1,580
py
Python
2020/python/day-15-cleaned.py
tadhg-ohiggins/advent-of-code
d0f113955940e69cbe0953607f62862f8a8bb830
[ "CC0-1.0" ]
1
2021-12-04T18:09:44.000Z
2021-12-04T18:09:44.000Z
2020/python/day-15-cleaned.py
tadhg-ohiggins/advent-of-code
d0f113955940e69cbe0953607f62862f8a8bb830
[ "CC0-1.0" ]
null
null
null
2020/python/day-15-cleaned.py
tadhg-ohiggins/advent-of-code
d0f113955940e69cbe0953607f62862f8a8bb830
[ "CC0-1.0" ]
null
null
null
from functools import partial from itertools import count from typing import List from tutils import lmap, splitstrip, load_and_process_input DAY = "15" INPUT = f"input-{DAY}.txt" ANSWER1 = 240 ANSWER2 = 505 testdata = [ ([0, 3, 6], 2020, 436), ([1, 3, 2], 2020, 1), ([2, 1, 3], 2020, 10), ([1, 2, 3], 2020, 27), ([2, 3, 1], 2020, 78), ([3, 2, 1], 2020, 438), ([3, 1, 2], 2020, 1836), ] def find_nth_number(numbers: List[int], ordinal: int) -> int: positions = {x: i for i, x in enumerate(numbers)} for index in count(len(numbers) - 1): current = numbers[index] lastpos = positions.get(current, False) positions[current] = index steps_back = 0 if lastpos is False else index - lastpos numbers.append(steps_back) if len(numbers) == ordinal: break return steps_back def process(numbers: List[int], ordinal: int) -> int: return find_nth_number(numbers, ordinal) def cli_main() -> None: input_funcs = [ partial(str.strip), partial(splitstrip, sep=","), partial(lmap, int), ] numbers = load_and_process_input(INPUT, input_funcs) for nums, ordinal, tanswer in testdata: testanswer = find_nth_number(nums, ordinal) assert testanswer == tanswer answer_one = process(numbers[:], 2020) assert answer_one == ANSWER1 print("Answer one:", answer_one) answer_two = process(numbers[:], 30000000) assert answer_two == ANSWER2 print("Answer two:", answer_two) if __name__ == "__main__": cli_main()
26.333333
63
0.621519
from functools import partial from itertools import count from typing import List from tutils import lmap, splitstrip, load_and_process_input DAY = "15" INPUT = f"input-{DAY}.txt" ANSWER1 = 240 ANSWER2 = 505 testdata = [ ([0, 3, 6], 2020, 436), ([1, 3, 2], 2020, 1), ([2, 1, 3], 2020, 10), ([1, 2, 3], 2020, 27), ([2, 3, 1], 2020, 78), ([3, 2, 1], 2020, 438), ([3, 1, 2], 2020, 1836), ] def find_nth_number(numbers: List[int], ordinal: int) -> int: positions = {x: i for i, x in enumerate(numbers)} for index in count(len(numbers) - 1): current = numbers[index] lastpos = positions.get(current, False) positions[current] = index steps_back = 0 if lastpos is False else index - lastpos numbers.append(steps_back) if len(numbers) == ordinal: break return steps_back def process(numbers: List[int], ordinal: int) -> int: return find_nth_number(numbers, ordinal) def cli_main() -> None: input_funcs = [ partial(str.strip), partial(splitstrip, sep=","), partial(lmap, int), ] numbers = load_and_process_input(INPUT, input_funcs) for nums, ordinal, tanswer in testdata: testanswer = find_nth_number(nums, ordinal) assert testanswer == tanswer answer_one = process(numbers[:], 2020) assert answer_one == ANSWER1 print("Answer one:", answer_one) answer_two = process(numbers[:], 30000000) assert answer_two == ANSWER2 print("Answer two:", answer_two) if __name__ == "__main__": cli_main()
true
true
f7261da738c0c2709539722e8b91f6ba23d28fd1
8,211
py
Python
bridgedb/test/test_smtp.py
jugheadjones10/bridgedb
94d6bca4b22458c156898785d8f6ccedf562d884
[ "BSD-3-Clause-Clear" ]
null
null
null
bridgedb/test/test_smtp.py
jugheadjones10/bridgedb
94d6bca4b22458c156898785d8f6ccedf562d884
[ "BSD-3-Clause-Clear" ]
null
null
null
bridgedb/test/test_smtp.py
jugheadjones10/bridgedb
94d6bca4b22458c156898785d8f6ccedf562d884
[ "BSD-3-Clause-Clear" ]
null
null
null
"""integration tests for BridgeDB .""" from __future__ import print_function import smtplib import asyncore import threading import queue import random import os from smtpd import SMTPServer from twisted.trial import unittest from twisted.trial.unittest import FailTest from twisted.trial.unittest import SkipTest from bridgedb.test.util import processExists from bridgedb.test.util import getBridgeDBPID # ------------- SMTP Client Config SMTP_DEBUG_LEVEL = 0 # set to 1 to see SMTP message exchange BRIDGEDB_SMTP_SERVER_ADDRESS = "localhost" BRIDGEDB_SMTP_SERVER_PORT = 6725 # %d is parameterised with a random integer to make the sender unique FROM_ADDRESS_TEMPLATE = "test%d@127.0.0.1" # Minimum value used to parameterise FROM_ADDRESS_TEMPLATE MIN_FROM_ADDRESS = 1 # Max value used to parameterise FROM_ADDRESS_TEMPLATE. Needs to be pretty big # to reduce the chance of collisions MAX_FROM_ADDRESS = 10**8 TO_ADDRESS = "bridges@torproject.org" MESSAGE_TEMPLATE = """From: %s To: %s Subject: testing get bridges""" # ------------- SMTP Server Setup # Setup an SMTP server which we use to check for responses # from bridgedb. This needs to be done before sending the actual mail LOCAL_SMTP_SERVER_ADDRESS = 'localhost' LOCAL_SMTP_SERVER_PORT = 2525 # Must be the same as bridgedb's EMAIL_SMTP_PORT class EmailServer(SMTPServer): def process_message(self, peer, mailfrom, rcpttos, data, **kwargs): ''' Overridden from SMTP server, called whenever a message is received''' self.message_queue.put(data) def thread_proc(self): ''' This function runs in thread, and will continue looping until the _stop Event object is set by the stop() function''' while self._stop.is_set() == False: asyncore.loop(timeout=0.0, count=1) # Must close, or asyncore will hold on to the socket and subsequent # tests will fail with 'Address not in use'. self.close() def start(self): self.message_queue = queue.Queue() self._stop = threading.Event() self._thread = threading.Thread(target=self.thread_proc) # Ensures that if any tests do fail, then threads will exit when the # parent exits. self._thread.setDaemon(True) self._thread.start() @classmethod def startServer(cls): #print("Starting SMTP server on %s:%s" # % (LOCAL_SMTP_SERVER_ADDRESS, LOCAL_SMTP_SERVER_PORT)) server = EmailServer((LOCAL_SMTP_SERVER_ADDRESS, LOCAL_SMTP_SERVER_PORT), None) server.start() return server def stop(self): # Signal thread_proc to stop: self._stop.set() # Wait for thread_proc to return (shouldn't take long) self._thread.join() assert self._thread.is_alive() == False, "Thread is alive and kicking" def getAndCheckMessageContains(self, text, timeoutInSecs=2.0): try: message = self.message_queue.get(block=True, timeout=timeoutInSecs) # Queue.Empty, according to its documentation, is only supposed to be # raised when Queue.get(block=False) or Queue.get_nowait() are called. # I've no idea why it's getting raised here, when we're blocking for # it, but nonetheless it causes occasional, non-deterministic CI # failures: # # https://travis-ci.org/isislovecruft/bridgedb/jobs/58996136#L3281 except queue.Empty: pass else: assert message.find(text) != -1, ("Message did not contain text '%s'." "Full message is:\n %s" % (text, message)) def checkNoMessageReceived(self, timeoutInSecs=2.0): try: self.message_queue.get(block=True, timeout=timeoutInSecs) except queue.Empty: return True assert False, "Found a message in the queue, but expected none" def sendMail(fromAddress): #print("Connecting to %s:%d" # % (BRIDGEDB_SMTP_SERVER_ADDRESS, BRIDGEDB_SMTP_SERVER_PORT)) client = smtplib.SMTP(BRIDGEDB_SMTP_SERVER_ADDRESS, BRIDGEDB_SMTP_SERVER_PORT) client.set_debuglevel(SMTP_DEBUG_LEVEL) #print("Sending mail TO:%s, FROM:%s" # % (TO_ADDRESS, fromAddress)) result = client.sendmail(fromAddress, TO_ADDRESS, MESSAGE_TEMPLATE % (fromAddress, TO_ADDRESS)) assert result == {}, "Failed to send mail" client.quit() class SMTPTests(unittest.TestCase): def setUp(self): '''Called at the start of each test, ensures that the SMTP server is running. ''' here = os.getcwd() topdir = here.rstrip('_trial_temp') self.rundir = os.path.join(topdir, 'run') self.pidfile = os.path.join(self.rundir, 'bridgedb.pid') self.pid = getBridgeDBPID(self.pidfile) self.server = EmailServer.startServer() def tearDown(self): '''Called after each test, ensures that the SMTP server is cleaned up. ''' self.server.stop() def test_getBridges(self): if os.environ.get("CI"): if not self.pid or not processExists(self.pid): raise FailTest("Could not start BridgeDB process on CI server!") if not self.pid or not processExists(self.pid): raise SkipTest("Can't run test: no BridgeDB process running.") # send the mail to bridgedb, choosing a random email address sendMail(fromAddress=FROM_ADDRESS_TEMPLATE % random.randint(MIN_FROM_ADDRESS, MAX_FROM_ADDRESS)) # then check that our local SMTP server received a response # and that response contained some bridges self.server.getAndCheckMessageContains(b"Here are your bridges") def test_getBridges_rateLimitExceeded(self): if os.environ.get("CI"): if not self.pid or not processExists(self.pid): raise FailTest("Could not start BridgeDB process on CI server!") if not self.pid or not processExists(self.pid): raise SkipTest("Can't run test: no BridgeDB process running.") # send the mail to bridgedb, choosing a random email address FROM_ADDRESS = FROM_ADDRESS_TEMPLATE % random.randint( MIN_FROM_ADDRESS, MAX_FROM_ADDRESS) sendMail(FROM_ADDRESS) # then check that our local SMTP server received a response # and that response contained some bridges self.server.getAndCheckMessageContains(b"Here are your bridges") # send another request from the same email address sendMail(FROM_ADDRESS) # this time, the email response should not contain any bridges self.server.getAndCheckMessageContains( b"You have exceeded the rate limit. Please slow down!") # then we send another request from the same email address sendMail(FROM_ADDRESS) # now there should be no response at all (wait 1 second to make sure) self.server.checkNoMessageReceived(timeoutInSecs=1.0) def test_getBridges_stressTest(self): '''Sends a large number of emails in a short period of time, and checks that a response is received for each message. ''' if os.environ.get("CI"): if not self.pid or not processExists(self.pid): raise FailTest("Could not start BridgeDB process on CI server!") if not self.pid or not processExists(self.pid): raise SkipTest("Can't run test: no BridgeDB process running.") NUM_MAILS = 100 for i in range(NUM_MAILS): # Note: if by chance two emails with the same FROM_ADDRESS are # generated, this test will fail Setting 'MAX_FROM_ADDRESS' to be # a high value reduces the probability of this occuring, but does # not rule it out sendMail(fromAddress=FROM_ADDRESS_TEMPLATE % random.randint(MIN_FROM_ADDRESS, MAX_FROM_ADDRESS)) for i in range(NUM_MAILS): self.server.getAndCheckMessageContains(b"Here are your bridges")
39.666667
82
0.657776
from __future__ import print_function import smtplib import asyncore import threading import queue import random import os from smtpd import SMTPServer from twisted.trial import unittest from twisted.trial.unittest import FailTest from twisted.trial.unittest import SkipTest from bridgedb.test.util import processExists from bridgedb.test.util import getBridgeDBPID SMTP_DEBUG_LEVEL = 0 BRIDGEDB_SMTP_SERVER_ADDRESS = "localhost" BRIDGEDB_SMTP_SERVER_PORT = 6725 FROM_ADDRESS_TEMPLATE = "test%d@127.0.0.1" MIN_FROM_ADDRESS = 1 MAX_FROM_ADDRESS = 10**8 TO_ADDRESS = "bridges@torproject.org" MESSAGE_TEMPLATE = """From: %s To: %s Subject: testing get bridges""" LOCAL_SMTP_SERVER_ADDRESS = 'localhost' LOCAL_SMTP_SERVER_PORT = 2525 class EmailServer(SMTPServer): def process_message(self, peer, mailfrom, rcpttos, data, **kwargs): self.message_queue.put(data) def thread_proc(self): while self._stop.is_set() == False: asyncore.loop(timeout=0.0, count=1) # Must close, or asyncore will hold on to the socket and subsequent # tests will fail with 'Address not in use'. self.close() def start(self): self.message_queue = queue.Queue() self._stop = threading.Event() self._thread = threading.Thread(target=self.thread_proc) # Ensures that if any tests do fail, then threads will exit when the # parent exits. self._thread.setDaemon(True) self._thread.start() @classmethod def startServer(cls): #print("Starting SMTP server on %s:%s" # % (LOCAL_SMTP_SERVER_ADDRESS, LOCAL_SMTP_SERVER_PORT)) server = EmailServer((LOCAL_SMTP_SERVER_ADDRESS, LOCAL_SMTP_SERVER_PORT), None) server.start() return server def stop(self): # Signal thread_proc to stop: self._stop.set() # Wait for thread_proc to return (shouldn't take long) self._thread.join() assert self._thread.is_alive() == False, "Thread is alive and kicking" def getAndCheckMessageContains(self, text, timeoutInSecs=2.0): try: message = self.message_queue.get(block=True, timeout=timeoutInSecs) # it, but nonetheless it causes occasional, non-deterministic CI # failures: # # https://travis-ci.org/isislovecruft/bridgedb/jobs/58996136#L3281 except queue.Empty: pass else: assert message.find(text) != -1, ("Message did not contain text '%s'." "Full message is:\n %s" % (text, message)) def checkNoMessageReceived(self, timeoutInSecs=2.0): try: self.message_queue.get(block=True, timeout=timeoutInSecs) except queue.Empty: return True assert False, "Found a message in the queue, but expected none" def sendMail(fromAddress): #print("Connecting to %s:%d" # % (BRIDGEDB_SMTP_SERVER_ADDRESS, BRIDGEDB_SMTP_SERVER_PORT)) client = smtplib.SMTP(BRIDGEDB_SMTP_SERVER_ADDRESS, BRIDGEDB_SMTP_SERVER_PORT) client.set_debuglevel(SMTP_DEBUG_LEVEL) #print("Sending mail TO:%s, FROM:%s" # % (TO_ADDRESS, fromAddress)) result = client.sendmail(fromAddress, TO_ADDRESS, MESSAGE_TEMPLATE % (fromAddress, TO_ADDRESS)) assert result == {}, "Failed to send mail" client.quit() class SMTPTests(unittest.TestCase): def setUp(self): here = os.getcwd() topdir = here.rstrip('_trial_temp') self.rundir = os.path.join(topdir, 'run') self.pidfile = os.path.join(self.rundir, 'bridgedb.pid') self.pid = getBridgeDBPID(self.pidfile) self.server = EmailServer.startServer() def tearDown(self): self.server.stop() def test_getBridges(self): if os.environ.get("CI"): if not self.pid or not processExists(self.pid): raise FailTest("Could not start BridgeDB process on CI server!") if not self.pid or not processExists(self.pid): raise SkipTest("Can't run test: no BridgeDB process running.") sendMail(fromAddress=FROM_ADDRESS_TEMPLATE % random.randint(MIN_FROM_ADDRESS, MAX_FROM_ADDRESS)) self.server.getAndCheckMessageContains(b"Here are your bridges") def test_getBridges_rateLimitExceeded(self): if os.environ.get("CI"): if not self.pid or not processExists(self.pid): raise FailTest("Could not start BridgeDB process on CI server!") if not self.pid or not processExists(self.pid): raise SkipTest("Can't run test: no BridgeDB process running.") # send the mail to bridgedb, choosing a random email address FROM_ADDRESS = FROM_ADDRESS_TEMPLATE % random.randint( MIN_FROM_ADDRESS, MAX_FROM_ADDRESS) sendMail(FROM_ADDRESS) # then check that our local SMTP server received a response # and that response contained some bridges self.server.getAndCheckMessageContains(b"Here are your bridges") # send another request from the same email address sendMail(FROM_ADDRESS) # this time, the email response should not contain any bridges self.server.getAndCheckMessageContains( b"You have exceeded the rate limit. Please slow down!") # then we send another request from the same email address sendMail(FROM_ADDRESS) # now there should be no response at all (wait 1 second to make sure) self.server.checkNoMessageReceived(timeoutInSecs=1.0) def test_getBridges_stressTest(self): if os.environ.get("CI"): if not self.pid or not processExists(self.pid): raise FailTest("Could not start BridgeDB process on CI server!") if not self.pid or not processExists(self.pid): raise SkipTest("Can't run test: no BridgeDB process running.") NUM_MAILS = 100 for i in range(NUM_MAILS): sendMail(fromAddress=FROM_ADDRESS_TEMPLATE % random.randint(MIN_FROM_ADDRESS, MAX_FROM_ADDRESS)) for i in range(NUM_MAILS): self.server.getAndCheckMessageContains(b"Here are your bridges")
true
true
f7261db3cd3b74253335a7d73475dfcccd0a55ec
1,641
py
Python
unpackMFC.py
dare0021/KerasBasedSpeechClassifier
aa507b2a2eb39963bd9ed3279288dbe6c877166c
[ "MIT" ]
1
2016-12-28T07:18:52.000Z
2016-12-28T07:18:52.000Z
unpackMFC.py
dare0021/KerasBasedSpeechClassifier
aa507b2a2eb39963bd9ed3279288dbe6c877166c
[ "MIT" ]
2
2016-09-30T05:41:06.000Z
2017-03-28T11:58:58.000Z
unpackMFC.py
dare0021/KerasBasedSpeechClassifier
aa507b2a2eb39963bd9ed3279288dbe6c877166c
[ "MIT" ]
null
null
null
import numpy as np import struct # CMU Sphinx 4 mfc file opener # takes file path as input # Sphinx uses feature vectors of length 13 by default def run(input, featureVectorSize): file = open(input, 'r') size = struct.unpack('>i', ''.join(file.read(4)))[0] if ((float)(size)) / featureVectorSize - (float)(size // featureVectorSize) != 0: print "ERR: unpackMFC.run().featureVectorSize is inconsistent with the feature count read from the file given." print "File given: ", input print "Feature count read: ", size print "featureVectorSize: ", featureVectorSize assert False out = np.zeros(shape=(size/featureVectorSize, featureVectorSize)) for i in range(size): out[i//featureVectorSize][i%featureVectorSize] = struct.unpack('>f', ''.join(file.read(4)))[0] return out # Returns windowed result with 0 padding # e.g. for frames 1,2,3,4,5: [[1,2,3], [4,5,0]] # windowSize is in frames # a frame is 10ms # recommended value: 1~3 sec def returnWindowed(input, featureVectorSize, windowSize): raw = run(input, featureVectorSize) numcells = len(raw) // windowSize if len(raw) % windowSize > 0: numcells += 1 raw = raw.flatten() raw = np.append(raw, np.zeros(shape=(numcells*windowSize*featureVectorSize - len(raw)))) return raw.reshape(numcells, windowSize, featureVectorSize) def runForAll(input, featureVectorSize, windowSize): out = [] if windowSize > 1: for i in input: out.append(returnWindowed(i, featureVectorSize, windowSize)) else: for i in input: out.append(run(i, featureVectorSize)) return out # print returnWindowed("../SPK_DB/mfc13OnlySilences2e5/C002_M4_INDE_025.wav.mfc", 13, 100).shape
35.673913
113
0.724558
import numpy as np import struct def run(input, featureVectorSize): file = open(input, 'r') size = struct.unpack('>i', ''.join(file.read(4)))[0] if ((float)(size)) / featureVectorSize - (float)(size // featureVectorSize) != 0: print "ERR: unpackMFC.run().featureVectorSize is inconsistent with the feature count read from the file given." print "File given: ", input print "Feature count read: ", size print "featureVectorSize: ", featureVectorSize assert False out = np.zeros(shape=(size/featureVectorSize, featureVectorSize)) for i in range(size): out[i//featureVectorSize][i%featureVectorSize] = struct.unpack('>f', ''.join(file.read(4)))[0] return out def returnWindowed(input, featureVectorSize, windowSize): raw = run(input, featureVectorSize) numcells = len(raw) // windowSize if len(raw) % windowSize > 0: numcells += 1 raw = raw.flatten() raw = np.append(raw, np.zeros(shape=(numcells*windowSize*featureVectorSize - len(raw)))) return raw.reshape(numcells, windowSize, featureVectorSize) def runForAll(input, featureVectorSize, windowSize): out = [] if windowSize > 1: for i in input: out.append(returnWindowed(i, featureVectorSize, windowSize)) else: for i in input: out.append(run(i, featureVectorSize)) return out
false
true
f7261de6c7c541d6de5d6ee3125ac35b2d456e80
7,792
py
Python
test/functional/combine_logs.py
Techcoingithub/techcoin
6914faea0496d16d85f4f11fc1ae2ba05e9143b8
[ "MIT" ]
null
null
null
test/functional/combine_logs.py
Techcoingithub/techcoin
6914faea0496d16d85f4f11fc1ae2ba05e9143b8
[ "MIT" ]
1
2021-11-30T18:41:44.000Z
2022-01-17T17:55:26.000Z
test/functional/combine_logs.py
Techcoingithub/techcoin
6914faea0496d16d85f4f11fc1ae2ba05e9143b8
[ "MIT" ]
null
null
null
#!/usr/bin/env python3 # Copyright (c) 2017-2019 The Bitcoin Core developers # Distributed under the MIT software license, see the accompanying # file COPYING or http://www.opensource.org/licenses/mit-license.php. """Combine logs from multiple techcoin nodes as well as the test_framework log. This streams the combined log output to stdout. Use combine_logs.py > outputfile to write to an outputfile. If no argument is provided, the most recent test directory will be used.""" import argparse from collections import defaultdict, namedtuple import heapq import itertools import os import pathlib import re import sys import tempfile # N.B.: don't import any local modules here - this script must remain executable # without the parent module installed. # Should match same symbol in `test_framework.test_framework`. TMPDIR_PREFIX = "techcoin_func_test_" # Matches on the date format at the start of the log event TIMESTAMP_PATTERN = re.compile(r"^\d{4}-\d{2}-\d{2}T\d{2}:\d{2}:\d{2}(\.\d{6})?Z") LogEvent = namedtuple('LogEvent', ['timestamp', 'source', 'event']) def main(): """Main function. Parses args, reads the log files and renders them as text or html.""" parser = argparse.ArgumentParser( description=__doc__, formatter_class=argparse.RawTextHelpFormatter) parser.add_argument( 'testdir', nargs='?', default='', help=('temporary test directory to combine logs from. ' 'Defaults to the most recent')) parser.add_argument('-c', '--color', dest='color', action='store_true', help='outputs the combined log with events colored by source (requires posix terminal colors. Use less -r for viewing)') parser.add_argument('--html', dest='html', action='store_true', help='outputs the combined log as html. Requires jinja2. pip install jinja2') args = parser.parse_args() if args.html and args.color: print("Only one out of --color or --html should be specified") sys.exit(1) testdir = args.testdir or find_latest_test_dir() if not testdir: print("No test directories found") sys.exit(1) if not args.testdir: print("Opening latest test directory: {}".format(testdir), file=sys.stderr) colors = defaultdict(lambda: '') if args.color: colors["test"] = "\033[0;36m" # CYAN colors["node0"] = "\033[0;34m" # BLUE colors["node1"] = "\033[0;32m" # GREEN colors["node2"] = "\033[0;31m" # RED colors["node3"] = "\033[0;33m" # YELLOW colors["reset"] = "\033[0m" # Reset font color log_events = read_logs(testdir) if args.html: print_logs_html(log_events) else: print_logs_plain(log_events, colors) print_node_warnings(testdir, colors) def read_logs(tmp_dir): """Reads log files. Delegates to generator function get_log_events() to provide individual log events for each of the input log files.""" # Find out what the folder is called that holds the debug.log file glob = pathlib.Path(tmp_dir).glob('node0/**/debug.log') path = next(glob, None) if path: assert next(glob, None) is None # more than one debug.log, should never happen chain = re.search(r'node0/(.+?)/debug\.log$', path.as_posix()).group(1) # extract the chain name else: chain = 'regtest' # fallback to regtest (should only happen when none exists) files = [("test", "%s/test_framework.log" % tmp_dir)] for i in itertools.count(): logfile = "{}/node{}/{}/debug.log".format(tmp_dir, i, chain) if not os.path.isfile(logfile): break files.append(("node%d" % i, logfile)) return heapq.merge(*[get_log_events(source, f) for source, f in files]) def print_node_warnings(tmp_dir, colors): """Print nodes' errors and warnings""" warnings = [] for stream in ['stdout', 'stderr']: for i in itertools.count(): folder = "{}/node{}/{}".format(tmp_dir, i, stream) if not os.path.isdir(folder): break for (_, _, fns) in os.walk(folder): for fn in fns: warning = pathlib.Path('{}/{}'.format(folder, fn)).read_text().strip() if warning: warnings.append(("node{} {}".format(i, stream), warning)) print() for w in warnings: print("{} {} {} {}".format(colors[w[0].split()[0]], w[0], w[1], colors["reset"])) def find_latest_test_dir(): """Returns the latest tmpfile test directory prefix.""" tmpdir = tempfile.gettempdir() def join_tmp(basename): return os.path.join(tmpdir, basename) def is_valid_test_tmpdir(basename): fullpath = join_tmp(basename) return ( os.path.isdir(fullpath) and basename.startswith(TMPDIR_PREFIX) and os.access(fullpath, os.R_OK) ) testdir_paths = [ join_tmp(name) for name in os.listdir(tmpdir) if is_valid_test_tmpdir(name) ] return max(testdir_paths, key=os.path.getmtime) if testdir_paths else None def get_log_events(source, logfile): """Generator function that returns individual log events. Log events may be split over multiple lines. We use the timestamp regex match as the marker for a new log event.""" try: with open(logfile, 'r', encoding='utf-8') as infile: event = '' timestamp = '' for line in infile: # skip blank lines if line == '\n': continue # if this line has a timestamp, it's the start of a new log event. time_match = TIMESTAMP_PATTERN.match(line) if time_match: if event: yield LogEvent(timestamp=timestamp, source=source, event=event.rstrip()) timestamp = time_match.group() if time_match.group(1) is None: # timestamp does not have microseconds. Add zeroes. timestamp_micro = timestamp.replace("Z", ".000000Z") line = line.replace(timestamp, timestamp_micro) timestamp = timestamp_micro event = line # if it doesn't have a timestamp, it's a continuation line of the previous log. else: # Add the line. Prefix with space equivalent to the source + timestamp so log lines are aligned event += " " + line # Flush the final event yield LogEvent(timestamp=timestamp, source=source, event=event.rstrip()) except FileNotFoundError: print("File %s could not be opened. Continuing without it." % logfile, file=sys.stderr) def print_logs_plain(log_events, colors): """Renders the iterator of log events into text.""" for event in log_events: lines = event.event.splitlines() print("{0} {1: <5} {2} {3}".format(colors[event.source.rstrip()], event.source, lines[0], colors["reset"])) if len(lines) > 1: for line in lines[1:]: print("{0}{1}{2}".format(colors[event.source.rstrip()], line, colors["reset"])) def print_logs_html(log_events): """Renders the iterator of log events into html.""" try: import jinja2 except ImportError: print("jinja2 not found. Try `pip install jinja2`") sys.exit(1) print(jinja2.Environment(loader=jinja2.FileSystemLoader('./')) .get_template('combined_log_template.html') .render(title="Combined Logs from testcase", log_events=[event._asdict() for event in log_events])) if __name__ == '__main__': main()
38.574257
196
0.617941
import argparse from collections import defaultdict, namedtuple import heapq import itertools import os import pathlib import re import sys import tempfile # without the parent module installed. # Should match same symbol in `test_framework.test_framework`. TMPDIR_PREFIX = "techcoin_func_test_" # Matches on the date format at the start of the log event TIMESTAMP_PATTERN = re.compile(r"^\d{4}-\d{2}-\d{2}T\d{2}:\d{2}:\d{2}(\.\d{6})?Z") LogEvent = namedtuple('LogEvent', ['timestamp', 'source', 'event']) def main(): parser = argparse.ArgumentParser( description=__doc__, formatter_class=argparse.RawTextHelpFormatter) parser.add_argument( 'testdir', nargs='?', default='', help=('temporary test directory to combine logs from. ' 'Defaults to the most recent')) parser.add_argument('-c', '--color', dest='color', action='store_true', help='outputs the combined log with events colored by source (requires posix terminal colors. Use less -r for viewing)') parser.add_argument('--html', dest='html', action='store_true', help='outputs the combined log as html. Requires jinja2. pip install jinja2') args = parser.parse_args() if args.html and args.color: print("Only one out of --color or --html should be specified") sys.exit(1) testdir = args.testdir or find_latest_test_dir() if not testdir: print("No test directories found") sys.exit(1) if not args.testdir: print("Opening latest test directory: {}".format(testdir), file=sys.stderr) colors = defaultdict(lambda: '') if args.color: colors["test"] = "\033[0;36m" # CYAN colors["node0"] = "\033[0;34m" # BLUE colors["node1"] = "\033[0;32m" # GREEN colors["node2"] = "\033[0;31m" # RED colors["node3"] = "\033[0;33m" # YELLOW colors["reset"] = "\033[0m" # Reset font color log_events = read_logs(testdir) if args.html: print_logs_html(log_events) else: print_logs_plain(log_events, colors) print_node_warnings(testdir, colors) def read_logs(tmp_dir): # Find out what the folder is called that holds the debug.log file glob = pathlib.Path(tmp_dir).glob('node0/**/debug.log') path = next(glob, None) if path: assert next(glob, None) is None # more than one debug.log, should never happen chain = re.search(r'node0/(.+?)/debug\.log$', path.as_posix()).group(1) # extract the chain name else: chain = 'regtest' # fallback to regtest (should only happen when none exists) files = [("test", "%s/test_framework.log" % tmp_dir)] for i in itertools.count(): logfile = "{}/node{}/{}/debug.log".format(tmp_dir, i, chain) if not os.path.isfile(logfile): break files.append(("node%d" % i, logfile)) return heapq.merge(*[get_log_events(source, f) for source, f in files]) def print_node_warnings(tmp_dir, colors): warnings = [] for stream in ['stdout', 'stderr']: for i in itertools.count(): folder = "{}/node{}/{}".format(tmp_dir, i, stream) if not os.path.isdir(folder): break for (_, _, fns) in os.walk(folder): for fn in fns: warning = pathlib.Path('{}/{}'.format(folder, fn)).read_text().strip() if warning: warnings.append(("node{} {}".format(i, stream), warning)) print() for w in warnings: print("{} {} {} {}".format(colors[w[0].split()[0]], w[0], w[1], colors["reset"])) def find_latest_test_dir(): tmpdir = tempfile.gettempdir() def join_tmp(basename): return os.path.join(tmpdir, basename) def is_valid_test_tmpdir(basename): fullpath = join_tmp(basename) return ( os.path.isdir(fullpath) and basename.startswith(TMPDIR_PREFIX) and os.access(fullpath, os.R_OK) ) testdir_paths = [ join_tmp(name) for name in os.listdir(tmpdir) if is_valid_test_tmpdir(name) ] return max(testdir_paths, key=os.path.getmtime) if testdir_paths else None def get_log_events(source, logfile): try: with open(logfile, 'r', encoding='utf-8') as infile: event = '' timestamp = '' for line in infile: # skip blank lines if line == '\n': continue # if this line has a timestamp, it's the start of a new log event. time_match = TIMESTAMP_PATTERN.match(line) if time_match: if event: yield LogEvent(timestamp=timestamp, source=source, event=event.rstrip()) timestamp = time_match.group() if time_match.group(1) is None: timestamp_micro = timestamp.replace("Z", ".000000Z") line = line.replace(timestamp, timestamp_micro) timestamp = timestamp_micro event = line else: event += " " + line yield LogEvent(timestamp=timestamp, source=source, event=event.rstrip()) except FileNotFoundError: print("File %s could not be opened. Continuing without it." % logfile, file=sys.stderr) def print_logs_plain(log_events, colors): for event in log_events: lines = event.event.splitlines() print("{0} {1: <5} {2} {3}".format(colors[event.source.rstrip()], event.source, lines[0], colors["reset"])) if len(lines) > 1: for line in lines[1:]: print("{0}{1}{2}".format(colors[event.source.rstrip()], line, colors["reset"])) def print_logs_html(log_events): try: import jinja2 except ImportError: print("jinja2 not found. Try `pip install jinja2`") sys.exit(1) print(jinja2.Environment(loader=jinja2.FileSystemLoader('./')) .get_template('combined_log_template.html') .render(title="Combined Logs from testcase", log_events=[event._asdict() for event in log_events])) if __name__ == '__main__': main()
true
true
f7261e37ae3b0a363433aacc10d91805d93f9dcf
391
py
Python
src/create_github_project/commands/versions/__init__.py
nkomiya/create-github-project
e60028a3edf0fdee2f76ffd26296e01588235324
[ "MIT" ]
1
2021-08-20T08:28:45.000Z
2021-08-20T08:28:45.000Z
src/create_github_project/commands/versions/__init__.py
nkomiya/create-github-project
e60028a3edf0fdee2f76ffd26296e01588235324
[ "MIT" ]
37
2021-07-24T11:47:28.000Z
2021-08-08T19:23:24.000Z
src/create_github_project/commands/versions/__init__.py
nkomiya/create-github-project
e60028a3edf0fdee2f76ffd26296e01588235324
[ "MIT" ]
null
null
null
import click from .current import current from .update import update __all__ = [ 'build' ] @click.group(help='Manage tool versions.') def versions() -> None: pass def build(cmd: click.Group) -> None: """親コマンドにサブコマンドを追加する。 Args: cmd (click.Group): 親コマンド """ versions.add_command(current) versions.add_command(update) cmd.add_command(versions)
14.481481
42
0.657289
import click from .current import current from .update import update __all__ = [ 'build' ] @click.group(help='Manage tool versions.') def versions() -> None: pass def build(cmd: click.Group) -> None: versions.add_command(current) versions.add_command(update) cmd.add_command(versions)
true
true
f7261ecb34d10b321947c71f2d29ac44db652fb3
20,071
py
Python
vis/visualize_court.py
szhaofelicia/sgan
ead42d4bb3b1278c4c9ffcae8fa9c2dc036a52ff
[ "MIT" ]
3
2022-01-02T16:58:39.000Z
2022-02-07T08:29:48.000Z
vis/visualize_court.py
szhaofelicia/sgan
ead42d4bb3b1278c4c9ffcae8fa9c2dc036a52ff
[ "MIT" ]
null
null
null
vis/visualize_court.py
szhaofelicia/sgan
ead42d4bb3b1278c4c9ffcae8fa9c2dc036a52ff
[ "MIT" ]
null
null
null
import numpy as np # import plotly import plotly.graph_objects as go def draw_plotly_half_court(fig, fig_width=600, margins=10): # From: https://community.plot.ly/t/arc-shape-with-path/7205/5 def ellipse_arc(x_center=0.0, y_center=0.0, a=10.5, b=10.5, start_angle=0.0, end_angle=2 * np.pi, N=200, closed=False): t = np.linspace(start_angle, end_angle, N) x = x_center + a * np.cos(t) y = y_center + b * np.sin(t) path = f'M {x[0]}, {y[0]}' for k in range(1, len(t)): path += f'L{x[k]}, {y[k]}' if closed: path += ' Z' return path fig_height = fig_width * (470 + 2 * margins) / (500 + 2 * margins) fig.update_layout(width=fig_width, height=fig_height) # Set axes ranges fig.update_xaxes(range=[-250 - margins, 250 + margins]) fig.update_yaxes(range=[-52.5 - margins, 417.5 + margins]) threept_break_y = 89.47765084 three_line_col = "#777777" main_line_col = "#777777" fig.update_layout( # Line Horizontal margin=dict(l=20, r=20, t=20, b=20), paper_bgcolor="white", plot_bgcolor="white", yaxis=dict( scaleanchor="x", scaleratio=1, showgrid=False, zeroline=False, showline=False, ticks='', showticklabels=False, fixedrange=True, ), xaxis=dict( showgrid=False, zeroline=False, showline=False, ticks='', showticklabels=False, fixedrange=True, ), shapes=[ # half_layout=[ dict( type="rect", x0=-250, y0=-52.5, x1=250, y1=417.5, line=dict(color=main_line_col, width=1), # fillcolor='#333333', layer='below' ), ## sideline rect dict( type="rect", x0=-80, y0=-52.5, x1=80, y1=137.5, line=dict(color=main_line_col, width=1), # fillcolor='#333333', layer='below' ),# lane line rect dict( type="rect", x0=-60, y0=-52.5, x1=60, y1=137.5, line=dict(color=main_line_col, width=1), # fillcolor='#333333', layer='below' ), # foul line rect dict( type="circle", x0=-60, y0=77.5, x1=60, y1=197.5, xref="x", yref="y", line=dict(color=main_line_col, width=1), # fillcolor='#dddddd', layer='below' ), # free-throw circle dict( type="line", x0=-60, y0=137.5, x1=60, y1=137.5, line=dict(color=main_line_col, width=1), layer='below' ), # foul line dict( type="rect", x0=-2, y0=-7.25, x1=2, y1=-12.5, line=dict(color="#ec7607", width=1), fillcolor='#ec7607', ), # hoop rect dict( type="circle", x0=-7.5, y0=-7.5, x1=7.5, y1=7.5, xref="x", yref="y", line=dict(color="#ec7607", width=1), ), # hoop circle dict( type="line", x0=-30, y0=-12.5, x1=30, y1=-12.5, line=dict(color="#ec7607", width=1), ), # backboard dict(type="path", path=ellipse_arc(a=40, b=40, start_angle=0, end_angle=np.pi), line=dict(color=main_line_col, width=1), layer='below'), # no-change semi-circle dict(type="path", path=ellipse_arc(a=237.5, b=237.5, start_angle=0.386283101, end_angle=np.pi - 0.386283101), line=dict(color=main_line_col, width=1), layer='below'), # three-point line:arc dict( type="line", x0=-220, y0=-52.5, x1=-220, y1=threept_break_y, line=dict(color=three_line_col, width=1), layer='below' ), # three-point line:left edge # dict( # type="line", x0=-220, y0=-52.5, x1=-220, y1=threept_break_y, # line=dict(color=three_line_col, width=1), layer='below' # ), dict( type="line", x0=220, y0=-52.5, x1=220, y1=threept_break_y, line=dict(color=three_line_col, width=1), layer='below' ), # three-point line:right edge dict( type="line", x0=-250, y0=227.5, x1=-220, y1=227.5, line=dict(color=main_line_col, width=1), layer='below' ), # midcourt area marker:left dict( type="line", x0=250, y0=227.5, x1=220, y1=227.5, line=dict(color=main_line_col, width=1), layer='below' ), # midcourt area marker:right dict( type="line", x0=-90, y0=17.5, x1=-80, y1=17.5, line=dict(color=main_line_col, width=1), layer='below' ), # lane line marker dict( type="line", x0=-90, y0=27.5, x1=-80, y1=27.5, line=dict(color=main_line_col, width=1), layer='below' ), # lane line marker dict( type="line", x0=-90, y0=57.5, x1=-80, y1=57.5, line=dict(color=main_line_col, width=1), layer='below' ), # lane line marker dict( type="line", x0=-90, y0=87.5, x1=-80, y1=87.5, line=dict(color=main_line_col, width=1), layer='below' ), # lane line marker dict( type="line", x0=90, y0=17.5, x1=80, y1=17.5, line=dict(color=main_line_col, width=1), layer='below' ), # lane line marker dict( type="line", x0=90, y0=27.5, x1=80, y1=27.5, line=dict(color=main_line_col, width=1), layer='below' ), # lane line marker dict( type="line", x0=90, y0=57.5, x1=80, y1=57.5, line=dict(color=main_line_col, width=1), layer='below' ), # lane line marker dict( type="line", x0=90, y0=87.5, x1=80, y1=87.5, line=dict(color=main_line_col, width=1), layer='below' ), # lane line marker dict(type="path", path=ellipse_arc(y_center=417.5, a=60, b=60, start_angle=-0, end_angle=-np.pi), line=dict(color=main_line_col, width=1), layer='below'), # center circle: half ] ) return True def draw_plotly_whole_court(fig, fig_width=600, margins=10): # From: https://community.plot.ly/t/arc-shape-with-path/7205/5 def ellipse_arc(x_center=0.0, y_center=0.0, a=10.5, b=10.5, start_angle=0.0, end_angle=2 * np.pi, N=200, closed=False): t = np.linspace(start_angle, end_angle, N) x = x_center + a * np.cos(t) y = y_center + b * np.sin(t) path = f'M {x[0]}, {y[0]}' for k in range(1, len(t)): path += f'L{x[k]}, {y[k]}' if closed: path += ' Z' return path fig_height = fig_width * (470*2 + 2 * margins) / (500 + 2 * margins) fig.update_layout(width=fig_width, height=fig_height) # Set axes ranges fig.update_xaxes(range=[-250 - margins, 250 + margins]) fig.update_yaxes(range=[-52.5 - margins, 417.5+470 + margins]) # fig.update_xaxes(range=[ margins, 500 + margins]) # fig.update_yaxes(range=[margins, 470*2 + margins]) threept_break_y = 89.47765084 three_line_col = "#777777" main_line_col = "#777777" fig.update_layout( # Line Horizontal margin=dict(l=20, r=20, t=20, b=20), paper_bgcolor="white", plot_bgcolor="white", yaxis=dict( scaleanchor="x", scaleratio=1, showgrid=False, zeroline=False, showline=False, ticks='', showticklabels=False, fixedrange=True, ), xaxis=dict( showgrid=False, zeroline=False, showline=False, ticks='', showticklabels=False, fixedrange=True, ), # width:500, height: 470 shapes=[ dict( type="rect", x0=-250, y0=-52.5, x1=250, y1=417.5+470, line=dict(color=main_line_col, width=1), # fillcolor='#333333', layer='below' ), ## sideline rect # dict( # type="rect", x0=-250, y0=-52.5, x1=250, y1=417.5, # line=dict(color=main_line_col, width=1), # # fillcolor='#333333', # layer='below' # ), ## sideline rect dict( type="rect", x0=-80, y0=-52.5, x1=80, y1=137.5, line=dict(color=main_line_col, width=1), # fillcolor='#333333', layer='below' ),# lane line rect dict( type="rect", x0=-60, y0=-52.5, x1=60, y1=137.5, line=dict(color=main_line_col, width=1), # fillcolor='#333333', layer='below' ), # foul line rect dict( type="circle", x0=-60, y0=77.5, x1=60, y1=197.5, xref="x", yref="y", line=dict(color=main_line_col, width=1), # fillcolor='#dddddd', layer='below' ), # free-throw circle dict( type="line", x0=-60, y0=137.5, x1=60, y1=137.5, line=dict(color=main_line_col, width=1), layer='below' ), # foul line dict( type="rect", x0=-2, y0=-7.25, x1=2, y1=-12.5, line=dict(color="#ec7607", width=1), fillcolor='#ec7607', ), # hoop rect dict( type="circle", x0=-7.5, y0=-7.5, x1=7.5, y1=7.5, xref="x", yref="y", line=dict(color="#ec7607", width=1), ), # hoop circle dict( type="line", x0=-30, y0=-12.5, x1=30, y1=-12.5, line=dict(color="#ec7607", width=1), ), # backboard dict(type="path", path=ellipse_arc(a=40, b=40, start_angle=0, end_angle=np.pi), line=dict(color=main_line_col, width=1), layer='below'), # no-change semi-circle dict(type="path", path=ellipse_arc(a=237.5, b=237.5, start_angle=0.386283101, end_angle=np.pi - 0.386283101), line=dict(color=main_line_col, width=1), layer='below'), # three-point line:arc dict( type="line", x0=-220, y0=-52.5, x1=-220, y1=threept_break_y, line=dict(color=three_line_col, width=1), layer='below' ), # three-point line:left edge # dict( # type="line", x0=-220, y0=-52.5, x1=-220, y1=threept_break_y, # line=dict(color=three_line_col, width=1), layer='below' # ), dict( type="line", x0=220, y0=-52.5, x1=220, y1=threept_break_y, line=dict(color=three_line_col, width=1), layer='below' ), # three-point line:right edge dict( type="line", x0=-250, y0=227.5, x1=-220, y1=227.5, line=dict(color=main_line_col, width=1), layer='below' ), # midcourt area marker:left dict( type="line", x0=250, y0=227.5, x1=220, y1=227.5, line=dict(color=main_line_col, width=1), layer='below' ), # midcourt area marker:right dict( type="line", x0=-90, y0=17.5, x1=-80, y1=17.5, line=dict(color=main_line_col, width=1), layer='below' ), # lane line marker dict( type="line", x0=-90, y0=27.5, x1=-80, y1=27.5, line=dict(color=main_line_col, width=1), layer='below' ), # lane line marker dict( type="line", x0=-90, y0=57.5, x1=-80, y1=57.5, line=dict(color=main_line_col, width=1), layer='below' ), # lane line marker dict( type="line", x0=-90, y0=87.5, x1=-80, y1=87.5, line=dict(color=main_line_col, width=1), layer='below' ), # lane line marker dict( type="line", x0=90, y0=17.5, x1=80, y1=17.5, line=dict(color=main_line_col, width=1), layer='below' ), # lane line marker dict( type="line", x0=90, y0=27.5, x1=80, y1=27.5, line=dict(color=main_line_col, width=1), layer='below' ), # lane line marker dict( type="line", x0=90, y0=57.5, x1=80, y1=57.5, line=dict(color=main_line_col, width=1), layer='below' ), # lane line marker dict( type="line", x0=90, y0=87.5, x1=80, y1=87.5, line=dict(color=main_line_col, width=1), layer='below' ), # lane line marker dict(type="path", path=ellipse_arc(y_center=417.5, a=60, b=60, start_angle=-0, end_angle=-np.pi), line=dict(color=main_line_col, width=1), layer='below'), # center circle: half ## upper # dict( # type="rect", x0=-250, y0=-52.5, x1=250, y1=417.5, # line=dict(color=main_line_col, width=1), # # fillcolor='#333333', # layer='below' # ), ## sideline rect # dict( # type="rect", x0=-80, y0=-52.5, x1=80, y1=137.5, # line=dict(color=main_line_col, width=1), # # fillcolor='#333333', # layer='below' # ), # lane line rect # dict( # type="rect", x0=-60, y0=-52.5, x1=60, y1=137.5, # line=dict(color=main_line_col, width=1), # # fillcolor='#333333', # layer='below' # ), # foul line rect # dict( # type="circle", x0=-60, y0=77.5, x1=60, y1=197.5, xref="x", yref="y", # line=dict(color=main_line_col, width=1), # # fillcolor='#dddddd', # layer='below' # ), # free-throw circle # dict( # type="line", x0=-60, y0=137.5, x1=60, y1=137.5, # line=dict(color=main_line_col, width=1), # layer='below' # ), # foul line # # dict( # type="rect", x0=-2, y0=-7.25, x1=2, y1=-12.5, # line=dict(color="#ec7607", width=1), # fillcolor='#ec7607', # ), # hoop rect # dict( # type="circle", x0=-7.5, y0=-7.5, x1=7.5, y1=7.5, xref="x", yref="y", # line=dict(color="#ec7607", width=1), # ), # hoop circle # dict( # type="line", x0=-30, y0=-12.5, x1=30, y1=-12.5, # line=dict(color="#ec7607", width=1), # ), # backboard # # dict(type="path", # path=ellipse_arc(a=40, b=40, start_angle=0, end_angle=np.pi), # line=dict(color=main_line_col, width=1), layer='below'), # no-change semi-circle # dict(type="path", # path=ellipse_arc(a=237.5, b=237.5, start_angle=0.386283101, end_angle=np.pi - 0.386283101), # line=dict(color=main_line_col, width=1), layer='below'), # three-point line:arc # dict( # type="line", x0=-220, y0=-52.5, x1=-220, y1=threept_break_y, # line=dict(color=three_line_col, width=1), layer='below' # ), # three-point line:left edge # # dict( # # type="line", x0=-220, y0=-52.5, x1=-220, y1=threept_break_y, # # line=dict(color=three_line_col, width=1), layer='below' # # ), # dict( # type="line", x0=220, y0=-52.5, x1=220, y1=threept_break_y, # line=dict(color=three_line_col, width=1), layer='below' # ), # three-point line:right edge # # dict( # type="line", x0=-250, y0=227.5, x1=-220, y1=227.5, # line=dict(color=main_line_col, width=1), layer='below' # ), # midcourt area marker:left # dict( # type="line", x0=250, y0=227.5, x1=220, y1=227.5, # line=dict(color=main_line_col, width=1), layer='below' # ), # midcourt area marker:right # dict( # type="line", x0=-90, y0=17.5, x1=-80, y1=17.5, # line=dict(color=main_line_col, width=1), layer='below' # ), # lane line marker # dict( # type="line", x0=-90, y0=27.5, x1=-80, y1=27.5, # line=dict(color=main_line_col, width=1), layer='below' # ), # lane line marker # dict( # type="line", x0=-90, y0=57.5, x1=-80, y1=57.5, # line=dict(color=main_line_col, width=1), layer='below' # ), # lane line marker # dict( # type="line", x0=-90, y0=87.5, x1=-80, y1=87.5, # line=dict(color=main_line_col, width=1), layer='below' # ), # lane line marker # dict( # type="line", x0=90, y0=17.5, x1=80, y1=17.5, # line=dict(color=main_line_col, width=1), layer='below' # ), # lane line marker # dict( # type="line", x0=90, y0=27.5, x1=80, y1=27.5, # line=dict(color=main_line_col, width=1), layer='below' # ), # lane line marker # dict( # type="line", x0=90, y0=57.5, x1=80, y1=57.5, # line=dict(color=main_line_col, width=1), layer='below' # ), # lane line marker # dict( # type="line", x0=90, y0=87.5, x1=80, y1=87.5, # line=dict(color=main_line_col, width=1), layer='below' # ), # lane line marker # # dict(type="path", # path=ellipse_arc(y_center=417.5, a=60, b=60, start_angle=-0, end_angle=-np.pi), # line=dict(color=main_line_col, width=1), layer='below'), # center circle: half ] ) return True max_freq = 0.002 # freq_by_hex = np.array([min(max_freq, i) for i in league_hexbin_stats['freq_by_hex']]) colorscale = 'YlOrRd' marker_cmin = 0.1 marker_cmax = 0.6 ticktexts = [str(marker_cmin*100)+'%-', "", str(marker_cmax*100)+'%+'] fig = go.Figure() # draw_plotly_half_court(fig) draw_plotly_whole_court(fig) # fig.add_trace(go.Scatter( # x=xlocs, y=ylocs, mode='markers', name='markers', # marker=dict( # size=freq_by_hex, sizemode='area', sizeref=2. * max(freq_by_hex) / (11. ** 2), sizemin=2.5, # color=accs_by_hex, colorscale=colorscale, # colorbar=dict( # thickness=15, # x=0.84, # y=0.87, # yanchor='middle', # len=0.2, # title=dict( # text="<B>Accuracy</B>", # font=dict( # size=11, # color='#4d4d4d' # ), # ), # tickvals=[marker_cmin, (marker_cmin + marker_cmax) / 2, marker_cmax], # ticktext=ticktexts, # tickfont=dict( # size=11, # color='#4d4d4d' # ) # ), # cmin=marker_cmin, cmax=marker_cmax, # line=dict(width=1, color='#333333'), symbol='hexagon', # ), # )) # fig.show(config=dict(displayModeBar=False)) # fig.show() vis_dir='/media/felicia/Data/sgan_results/vis/' fig.write_image(vis_dir+"court.svg")
40.061876
123
0.478202
import numpy as np import plotly.graph_objects as go def draw_plotly_half_court(fig, fig_width=600, margins=10): def ellipse_arc(x_center=0.0, y_center=0.0, a=10.5, b=10.5, start_angle=0.0, end_angle=2 * np.pi, N=200, closed=False): t = np.linspace(start_angle, end_angle, N) x = x_center + a * np.cos(t) y = y_center + b * np.sin(t) path = f'M {x[0]}, {y[0]}' for k in range(1, len(t)): path += f'L{x[k]}, {y[k]}' if closed: path += ' Z' return path fig_height = fig_width * (470 + 2 * margins) / (500 + 2 * margins) fig.update_layout(width=fig_width, height=fig_height) fig.update_xaxes(range=[-250 - margins, 250 + margins]) fig.update_yaxes(range=[-52.5 - margins, 417.5 + margins]) threept_break_y = 89.47765084 three_line_col = "#777777" main_line_col = "#777777" fig.update_layout( margin=dict(l=20, r=20, t=20, b=20), paper_bgcolor="white", plot_bgcolor="white", yaxis=dict( scaleanchor="x", scaleratio=1, showgrid=False, zeroline=False, showline=False, ticks='', showticklabels=False, fixedrange=True, ), xaxis=dict( showgrid=False, zeroline=False, showline=False, ticks='', showticklabels=False, fixedrange=True, ), shapes=[ dict( type="rect", x0=-250, y0=-52.5, x1=250, y1=417.5, line=dict(color=main_line_col, width=1), layer='below' ), ct( type="rect", x0=-80, y0=-52.5, x1=80, y1=137.5, line=dict(color=main_line_col, width=1), layer='below' ), dict( type="rect", x0=-60, y0=-52.5, x1=60, y1=137.5, line=dict(color=main_line_col, width=1), layer='below' ), dict( type="circle", x0=-60, y0=77.5, x1=60, y1=197.5, xref="x", yref="y", line=dict(color=main_line_col, width=1), layer='below' ), dict( type="line", x0=-60, y0=137.5, x1=60, y1=137.5, line=dict(color=main_line_col, width=1), layer='below' ), dict( type="rect", x0=-2, y0=-7.25, x1=2, y1=-12.5, line=dict(color="#ec7607", width=1), fillcolor='#ec7607', ), dict( type="circle", x0=-7.5, y0=-7.5, x1=7.5, y1=7.5, xref="x", yref="y", line=dict(color="#ec7607", width=1), ), dict( type="line", x0=-30, y0=-12.5, x1=30, y1=-12.5, line=dict(color="#ec7607", width=1), ), dict(type="path", path=ellipse_arc(a=40, b=40, start_angle=0, end_angle=np.pi), line=dict(color=main_line_col, width=1), layer='below'), dict(type="path", path=ellipse_arc(a=237.5, b=237.5, start_angle=0.386283101, end_angle=np.pi - 0.386283101), line=dict(color=main_line_col, width=1), layer='below'), dict( type="line", x0=-220, y0=-52.5, x1=-220, y1=threept_break_y, line=dict(color=three_line_col, width=1), layer='below' ), dict( type="line", x0=220, y0=-52.5, x1=220, y1=threept_break_y, line=dict(color=three_line_col, width=1), layer='below' ), dict( type="line", x0=-250, y0=227.5, x1=-220, y1=227.5, line=dict(color=main_line_col, width=1), layer='below' ), dict( type="line", x0=250, y0=227.5, x1=220, y1=227.5, line=dict(color=main_line_col, width=1), layer='below' ), dict( type="line", x0=-90, y0=17.5, x1=-80, y1=17.5, line=dict(color=main_line_col, width=1), layer='below' ), dict( type="line", x0=-90, y0=27.5, x1=-80, y1=27.5, line=dict(color=main_line_col, width=1), layer='below' ), dict( type="line", x0=-90, y0=57.5, x1=-80, y1=57.5, line=dict(color=main_line_col, width=1), layer='below' ), dict( type="line", x0=-90, y0=87.5, x1=-80, y1=87.5, line=dict(color=main_line_col, width=1), layer='below' ), dict( type="line", x0=90, y0=17.5, x1=80, y1=17.5, line=dict(color=main_line_col, width=1), layer='below' ), dict( type="line", x0=90, y0=27.5, x1=80, y1=27.5, line=dict(color=main_line_col, width=1), layer='below' ), dict( type="line", x0=90, y0=57.5, x1=80, y1=57.5, line=dict(color=main_line_col, width=1), layer='below' ), dict( type="line", x0=90, y0=87.5, x1=80, y1=87.5, line=dict(color=main_line_col, width=1), layer='below' ), dict(type="path", path=ellipse_arc(y_center=417.5, a=60, b=60, start_angle=-0, end_angle=-np.pi), line=dict(color=main_line_col, width=1), layer='below'), ] ) return True def draw_plotly_whole_court(fig, fig_width=600, margins=10): def ellipse_arc(x_center=0.0, y_center=0.0, a=10.5, b=10.5, start_angle=0.0, end_angle=2 * np.pi, N=200, closed=False): t = np.linspace(start_angle, end_angle, N) x = x_center + a * np.cos(t) y = y_center + b * np.sin(t) path = f'M {x[0]}, {y[0]}' for k in range(1, len(t)): path += f'L{x[k]}, {y[k]}' if closed: path += ' Z' return path fig_height = fig_width * (470*2 + 2 * margins) / (500 + 2 * margins) fig.update_layout(width=fig_width, height=fig_height) fig.update_xaxes(range=[-250 - margins, 250 + margins]) fig.update_yaxes(range=[-52.5 - margins, 417.5+470 + margins]) threept_break_y = 89.47765084 three_line_col = "#777777" main_line_col = "#777777" fig.update_layout( margin=dict(l=20, r=20, t=20, b=20), paper_bgcolor="white", plot_bgcolor="white", yaxis=dict( scaleanchor="x", scaleratio=1, showgrid=False, zeroline=False, showline=False, ticks='', showticklabels=False, fixedrange=True, ), xaxis=dict( showgrid=False, zeroline=False, showline=False, ticks='', showticklabels=False, fixedrange=True, ), shapes=[ dict( type="rect", x0=-250, y0=-52.5, x1=250, y1=417.5+470, line=dict(color=main_line_col, width=1), layer='below' ), type="rect", x0=-80, y0=-52.5, x1=80, y1=137.5, line=dict(color=main_line_col, width=1), layer='below' ), dict( type="rect", x0=-60, y0=-52.5, x1=60, y1=137.5, line=dict(color=main_line_col, width=1), layer='below' ), dict( type="circle", x0=-60, y0=77.5, x1=60, y1=197.5, xref="x", yref="y", line=dict(color=main_line_col, width=1), layer='below' ), dict( type="line", x0=-60, y0=137.5, x1=60, y1=137.5, line=dict(color=main_line_col, width=1), layer='below' ), dict( type="rect", x0=-2, y0=-7.25, x1=2, y1=-12.5, line=dict(color="#ec7607", width=1), fillcolor='#ec7607', ), dict( type="circle", x0=-7.5, y0=-7.5, x1=7.5, y1=7.5, xref="x", yref="y", line=dict(color="#ec7607", width=1), ), dict( type="line", x0=-30, y0=-12.5, x1=30, y1=-12.5, line=dict(color="#ec7607", width=1), ), dict(type="path", path=ellipse_arc(a=40, b=40, start_angle=0, end_angle=np.pi), line=dict(color=main_line_col, width=1), layer='below'), dict(type="path", path=ellipse_arc(a=237.5, b=237.5, start_angle=0.386283101, end_angle=np.pi - 0.386283101), line=dict(color=main_line_col, width=1), layer='below'), dict( type="line", x0=-220, y0=-52.5, x1=-220, y1=threept_break_y, line=dict(color=three_line_col, width=1), layer='below' ), dict( type="line", x0=220, y0=-52.5, x1=220, y1=threept_break_y, line=dict(color=three_line_col, width=1), layer='below' ), dict( type="line", x0=-250, y0=227.5, x1=-220, y1=227.5, line=dict(color=main_line_col, width=1), layer='below' ), dict( type="line", x0=250, y0=227.5, x1=220, y1=227.5, line=dict(color=main_line_col, width=1), layer='below' ), dict( type="line", x0=-90, y0=17.5, x1=-80, y1=17.5, line=dict(color=main_line_col, width=1), layer='below' ), dict( type="line", x0=-90, y0=27.5, x1=-80, y1=27.5, line=dict(color=main_line_col, width=1), layer='below' ), dict( type="line", x0=-90, y0=57.5, x1=-80, y1=57.5, line=dict(color=main_line_col, width=1), layer='below' ), dict( type="line", x0=-90, y0=87.5, x1=-80, y1=87.5, line=dict(color=main_line_col, width=1), layer='below' ), dict( type="line", x0=90, y0=17.5, x1=80, y1=17.5, line=dict(color=main_line_col, width=1), layer='below' ), dict( type="line", x0=90, y0=27.5, x1=80, y1=27.5, line=dict(color=main_line_col, width=1), layer='below' ), dict( type="line", x0=90, y0=57.5, x1=80, y1=57.5, line=dict(color=main_line_col, width=1), layer='below' ), dict( type="line", x0=90, y0=87.5, x1=80, y1=87.5, line=dict(color=main_line_col, width=1), layer='below' ), dict(type="path", path=ellipse_arc(y_center=417.5, a=60, b=60, start_angle=-0, end_angle=-np.pi), line=dict(color=main_line_col, width=1), layer='below'), return True max_freq = 0.002 colorscale = 'YlOrRd' marker_cmin = 0.1 marker_cmax = 0.6 ticktexts = [str(marker_cmin*100)+'%-', "", str(marker_cmax*100)+'%+'] fig = go.Figure() draw_plotly_whole_court(fig) vis_dir='/media/felicia/Data/sgan_results/vis/' fig.write_image(vis_dir+"court.svg")
true
true
f7261f4f8b69b121e8b4085d991fa58a731f368d
1,412
py
Python
cuestionario/urls.py
LisandroCanteros/Grupo2_COM06_Info2021
86ad9e08db4e8935bf397b6e4db0b3d9d72cb320
[ "MIT" ]
null
null
null
cuestionario/urls.py
LisandroCanteros/Grupo2_COM06_Info2021
86ad9e08db4e8935bf397b6e4db0b3d9d72cb320
[ "MIT" ]
null
null
null
cuestionario/urls.py
LisandroCanteros/Grupo2_COM06_Info2021
86ad9e08db4e8935bf397b6e4db0b3d9d72cb320
[ "MIT" ]
1
2021-09-05T23:29:56.000Z
2021-09-05T23:29:56.000Z
from django.urls import path from .views import ( CategoriasListView, pagina_principal, CuestionarioListView, cuestionario_vista, cuestionario_datos, guardar_resultados, resultado, nuevo_cuestionario, editar_cuestionario, eliminar_cuestionario, nueva_pregunta, nueva_respuesta, agregar_categoria, ) urlpatterns =[ path("", pagina_principal, name="pagina_principal"), path("nuevo_cuestionario/", nuevo_cuestionario, name="nuevo_cuestionario"), path("editar_cuestionario/<str:pk>", editar_cuestionario, name="editar_cuestionario"), path("eliminar_cuestionario/<str:pk>", eliminar_cuestionario, name="eliminar_cuestionario"), path("agregar_categoria", agregar_categoria, name="agregar_categoria"), path("agregar_pregunta/", nueva_pregunta, name="agregar_pregunta"), path("agregar_respuesta/", nueva_respuesta, name="agregar_respuesta"), path("categorias/", CategoriasListView.as_view(), name="categorias"), path("categorias/<str:categoria>/", CuestionarioListView.as_view(), name="categoria-actual"), path("categorias/<str:categoria>/<int:pk>/", cuestionario_vista, name="cuestionarios"), path("categorias/<str:categoria>/<int:pk>/jugar", cuestionario_datos, name="jugar"), path("categorias/<str:categoria>/<int:pk>/guardar/", guardar_resultados, name="guardar_cuestionarios"), path("resultado/<int:pk>/", resultado, name='resultado'), ]
45.548387
150
0.753541
from django.urls import path from .views import ( CategoriasListView, pagina_principal, CuestionarioListView, cuestionario_vista, cuestionario_datos, guardar_resultados, resultado, nuevo_cuestionario, editar_cuestionario, eliminar_cuestionario, nueva_pregunta, nueva_respuesta, agregar_categoria, ) urlpatterns =[ path("", pagina_principal, name="pagina_principal"), path("nuevo_cuestionario/", nuevo_cuestionario, name="nuevo_cuestionario"), path("editar_cuestionario/<str:pk>", editar_cuestionario, name="editar_cuestionario"), path("eliminar_cuestionario/<str:pk>", eliminar_cuestionario, name="eliminar_cuestionario"), path("agregar_categoria", agregar_categoria, name="agregar_categoria"), path("agregar_pregunta/", nueva_pregunta, name="agregar_pregunta"), path("agregar_respuesta/", nueva_respuesta, name="agregar_respuesta"), path("categorias/", CategoriasListView.as_view(), name="categorias"), path("categorias/<str:categoria>/", CuestionarioListView.as_view(), name="categoria-actual"), path("categorias/<str:categoria>/<int:pk>/", cuestionario_vista, name="cuestionarios"), path("categorias/<str:categoria>/<int:pk>/jugar", cuestionario_datos, name="jugar"), path("categorias/<str:categoria>/<int:pk>/guardar/", guardar_resultados, name="guardar_cuestionarios"), path("resultado/<int:pk>/", resultado, name='resultado'), ]
true
true
f7262028bb67932989ce287fc4342964d85098d4
843
py
Python
merak/commands/__init__.py
Yao1993/merak
517b7a8eca82eebbf22bcd3688a79e1e76ed9d42
[ "Apache-2.0" ]
16
2021-01-22T04:09:30.000Z
2022-03-17T10:38:34.000Z
merak/commands/__init__.py
Yao1993/merak
517b7a8eca82eebbf22bcd3688a79e1e76ed9d42
[ "Apache-2.0" ]
6
2021-04-12T10:09:47.000Z
2022-03-24T09:31:13.000Z
merak/commands/__init__.py
Yao1993/merak
517b7a8eca82eebbf22bcd3688a79e1e76ed9d42
[ "Apache-2.0" ]
2
2021-07-14T05:39:17.000Z
2021-07-28T16:27:40.000Z
# Copyright 2021 (David) Siu-Kei Muk. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== from __future__ import absolute_import from __future__ import division from __future__ import print_function from merak.commands.cythonize import Cythonize
42.15
80
0.709371
from __future__ import absolute_import from __future__ import division from __future__ import print_function from merak.commands.cythonize import Cythonize
true
true
f72620bb64981cc53d557d6184ba036e5477d39e
2,690
py
Python
dsp/core/spider.py
gods-view/AdclickIO
ccb73867e568aac5f40bd5890149626ce0be1897
[ "BSD-2-Clause" ]
null
null
null
dsp/core/spider.py
gods-view/AdclickIO
ccb73867e568aac5f40bd5890149626ce0be1897
[ "BSD-2-Clause" ]
null
null
null
dsp/core/spider.py
gods-view/AdclickIO
ccb73867e568aac5f40bd5890149626ce0be1897
[ "BSD-2-Clause" ]
null
null
null
# encoding=utf-8 import sys from imp import reload reload(sys) # sys.setdefaultencoding('utf8') import os, time # from configure import config from datetime import datetime as dt import requests # requests.adapters.DEFAULT_RETRIES = 5 # import chardet class HttpSpider: headers = { # 'User-Agent':'Mozilla/4.0 (compatible; MSIE 8.0; Windows NT 6.0; Trident/4.0)', # 'Connection':'keep-alive', # 'Content-Type: application/json' # "Accept-Encoding":"gzip,deflate" # "Authorization": "Bearer 5f6f8a89a85b6bde10c69198ca9a2e8ea9f13bf8" } def __init__(self): pass def show_error(self, error_log, msg): if error_log is None: print (time.strftime("%Y-%m-%d %H:%M:%S", time.localtime()), msg) else: error_log.error(msg) def internal_get(self, url, timeout=5, headers=''): # print (headers) # print (type(headers["Authorization"])) # self.headers = timeouts # print (type(self.headers["Authorization"])) if headers == '': response = requests.get(url, headers=self.headers, timeout=timeout) else: response = requests.get(url, headers=headers, timeout=timeout) # print (response.content) if response: return response.status_code, response.text else: return response.content, None def internal_post(self, url, data, timeout=5, headers=''): # print (data, type(data)) if headers == '': response = requests.post(url, data, headers=self.headers, timeout=timeout) else: response = requests.post(url, data, headers=headers, timeout=timeout) print (response, response.content) if response: return response.status_code, response.text else: return response.content, None def internal_patch(self, url, data, timeout=5): # print (data) response = requests.patch(url, data, headers=self.headers, timeout=timeout) # print (response, response.content) if response: return response.content, response.text else: return response.content, None def internal_put(self, url, data, timeout=5, headers=''): # print (data) if headers == '': response = requests.put(url, data, headers=self.headers, timeout=timeout) else: response = requests.put(url, data, headers=headers, timeout=timeout) print (response, response.content) if response: return response.status_code, response.text else: return response.content, None
32.409639
89
0.612268
import sys from imp import reload reload(sys) import os, time from datetime import datetime as dt import requests class HttpSpider: headers = { } def __init__(self): pass def show_error(self, error_log, msg): if error_log is None: print (time.strftime("%Y-%m-%d %H:%M:%S", time.localtime()), msg) else: error_log.error(msg) def internal_get(self, url, timeout=5, headers=''): if headers == '': response = requests.get(url, headers=self.headers, timeout=timeout) else: response = requests.get(url, headers=headers, timeout=timeout) if response: return response.status_code, response.text else: return response.content, None def internal_post(self, url, data, timeout=5, headers=''): if headers == '': response = requests.post(url, data, headers=self.headers, timeout=timeout) else: response = requests.post(url, data, headers=headers, timeout=timeout) print (response, response.content) if response: return response.status_code, response.text else: return response.content, None def internal_patch(self, url, data, timeout=5): response = requests.patch(url, data, headers=self.headers, timeout=timeout) if response: return response.content, response.text else: return response.content, None def internal_put(self, url, data, timeout=5, headers=''): if headers == '': response = requests.put(url, data, headers=self.headers, timeout=timeout) else: response = requests.put(url, data, headers=headers, timeout=timeout) print (response, response.content) if response: return response.status_code, response.text else: return response.content, None
true
true
f72622da8b3fb8fe690f929b9dd25369d65cc062
17,230
py
Python
turing_complete_interface/circuit_builder.py
scottanderson/turing-complete-interface
37d52265a2b7b693c1dc67505bd47622aa0f1e9f
[ "MIT" ]
4
2022-01-23T20:29:16.000Z
2022-03-20T06:10:47.000Z
turing_complete_interface/circuit_builder.py
scottanderson/turing-complete-interface
37d52265a2b7b693c1dc67505bd47622aa0f1e9f
[ "MIT" ]
null
null
null
turing_complete_interface/circuit_builder.py
scottanderson/turing-complete-interface
37d52265a2b7b693c1dc67505bd47622aa0f1e9f
[ "MIT" ]
1
2022-01-28T02:41:25.000Z
2022-01-28T02:41:25.000Z
from __future__ import annotations import json from dataclasses import dataclass, field from math import inf, sqrt from queue import PriorityQueue from typing import Any, Callable, Collection, TYPE_CHECKING, Iterable, Literal from bitarray import bitarray from turing_complete_interface.circuit_parser import Circuit, GateReference, GateShape, CircuitWire, CircuitPin, Pos from turing_complete_interface.truth_table import Atom from turing_complete_interface.logic_nodes import CombinedLogicNode, NodePin from turing_complete_interface.tc_components import get_component, rev_components if TYPE_CHECKING: import pydot @dataclass class IOPosition: component_name: str pin_mapping: dict[str, str] force_id: str = None force_position: tuple[int, int] = None custom_data: str = "" @classmethod def from_circuit(cls, circuit: Circuit) -> list[IOPosition]: ios = [] for gate in circuit.gates: shape, _ = get_component(gate.name, gate.custom_data) if not shape.is_io: continue ios.append(IOPosition(gate.name, {gate.id: next(iter(shape.pins))} if len(shape.pins) == 1 else { f"{gate.id}.{pin_name}": pin_name for pin_name in shape.pins }, gate.id, gate.pos, gate.custom_data)) return ios @classmethod def from_node(cls, node: CombinedLogicNode) -> list[IOPosition]: ios = [] for name, inp in node.inputs.items(): ios.append(IOPosition("Input1" if inp.bits == 1 else "Input1B", {name: "value"}, custom_data=name)) for name, out in node.outputs.items(): ios.append(IOPosition("Output1" if out.bits == 1 else "Output1B", {name: "value"}, custom_data=name)) return ios @dataclass class Space: x: int y: int w: int h: int _observer: Any = None _placed_boxes: list[tuple[int, int, int, int]] = field(default_factory=list) _protected: set[Any] = field(default_factory=set) _taken_spaces: bitarray = None def __post_init__(self): self._taken_spaces = bitarray([0] * (self.w * self.h)) self._taken_spaces[:] = 0 def place(self, w: int, h: int, force_pos: tuple[int, int] = None, hasher: Callable[[tuple[int, int]], Any] = None) -> tuple[int, int]: if force_pos is None: for idx in self._taken_spaces.itersearch(bitarray([0] * w)): y, x = divmod(idx, self.w) if x + w > self.w: continue if hasher is not None and hasher((x + self.x, y + self.y)) in self._protected: continue for k in range(h): if idx + k * self.w + w >= self.h * self.w: break if self._taken_spaces[idx + k * self.w:idx + k * self.w + w].any(): break else: break else: raise ValueError(f"No space left {w}, {h}") else: x, y = force_pos self._placed_boxes.append((x, y, w, h)) idx = y * self.w + x for k in range(h): self._taken_spaces[idx + k * self.w:idx + k * self.w + w] = 1 if hasher is not None: self._protected.add(hasher((x + self.x, y + self.y))) if self._observer is not None: self._observer(self) return x + self.x, y + self.y def is_filled(self, x: int, y: int): return self._taken_spaces[(y - self.y) * self.w + (x - self.x)] def clear(self): self._taken_spaces.clear() self._placed_boxes.clear() self._protected.clear() @dataclass class PathFinder: circuit: Circuit area: tuple[int, int, int, int] taken: list[list[Literal['gate', 'pin', 'wire_end'] | None]] def add_gate(self, gate_ref: GateReference, shape: GateShape): for bx, by in shape.blocks: p = gate_ref.translate((bx, by)) self.taken[p[0] - self.area[0]][p[1] - self.area[1]] = 'gate' for pin in shape.pins.values(): p = gate_ref.translate(pin.pos) self.taken[p[0] - self.area[0]][p[1] - self.area[1]] = 'pin' if shape.big_shape: for bx in range(shape.big_shape.tl[0], shape.big_shape.br[0]): for by in range(shape.big_shape.tl[1], shape.big_shape.br[1]): p = gate_ref.translate((bx, by)) self.taken[p[0] - self.area[0]][p[1] - self.area[1]] = 'gate' def add_wire_end(self, pos: Pos): self.taken[pos[0] - self.area[0]][pos[1] - self.area[1]] = 'wire_end' def reload(self): self.taken = [[None] * self.area[2] for _ in range(self.area[3])] for gate in self.circuit.gates: shape = get_component(gate, no_node=True)[0] self.add_gate(gate, shape) for wire in self.circuit.wires: if wire.positions: self.add_wire_end(wire.positions[0]) self.add_wire_end(wire.positions[-1]) def path_find(self, start: Pos, end: Pos): start = start[0] - self.area[0], start[1] - self.area[1] end = end[0] - self.area[0], end[1] - self.area[1] if self.taken[end[0]][end[1]] == "gate": return None def h(p): return sqrt((p[0] - end[0]) ** 2 + (p[1] - end[1]) ** 2) def reconstruct(): path = [(end[0] + self.area[0], end[1] + self.area[1])] current = end while current in came_from: current = came_from[current] path.append((current[0] + self.area[0], current[1] + self.area[1])) return path queue = PriorityQueue() queue.put((0, start)) came_from = {} path_cost = {start: 0} heuristic_cost = {} while not queue.empty(): _, (x, y) = queue.get() if (x, y) == end: return reconstruct() for dx in (-1, 0, 1): if not (0 <= x + dx < self.area[2]): continue for dy in (-1, 0, 1): if not (0 <= y + dy < self.area[3]): continue if dx == dy == 0: continue np = x + dx, y + dy if self.taken[np[0]][np[1]] is not None and (np != end): continue new_cost = path_cost[x, y] + 1 if new_cost < path_cost.get(np, inf): came_from[np] = x, y path_cost[np] = new_cost heuristic_cost[np] = new_cost + h(np) queue.put((heuristic_cost[np], np)) return None @classmethod def create(cls, circuit, area): self = cls(circuit, area, [[None] * area[3] for _ in range(area[2])]) self.reload() return self def build_circuit(node: CombinedLogicNode, io_positions: list[IOPosition], space: Space, level_version: int = 0, place_alone: Collection[str] = (), place_memory_alone=True) -> Circuit: taken_ids: set[int] = set() i = 1 def get_id() -> int: nonlocal i while i in taken_ids: i += 1 taken_ids.add(i) return i def place(shape: GateShape, io: bool = False, forced_pos: tuple[int, int] = None): ox, oy, w, h = shape.bounding_box def translate(p): return (int((p[0] + 30 - ox) // 8 - 3), int((p[1] + 30 - oy) // 8 - 3)) if forced_pos is not None: forced_pos = forced_pos[0] + ox - space.x, forced_pos[1] + ox - space.y t, l = space.place(w, h, forced_pos, (translate if io else None)) return t - ox, l - oy gate_refs = [] pin_locations: dict[NodePin, tuple[CircuitPin, int, int]] = {} for io in io_positions: shape, _ = get_component(io.component_name, io.custom_data) pos = place(shape, True, io.force_position) gi = get_id() if io.force_id is None else io.force_id gate_refs.append(GateReference(io.component_name, pos, 0, str(gi), io.custom_data)) for node_pin_name, shape_pin_name in io.pin_mapping.items(): dp = shape.pins[shape_pin_name].pos pin_locations[None, node_pin_name] = shape.pins[shape_pin_name], pos[0] + dp[0], pos[1] + dp[1] for name, n in node.nodes.items(): component_name, custom_data = rev_components[n.name] shape, inner_node = get_component(component_name, custom_data, no_node=True) pos = place(shape, (n.name in place_alone) or (name in place_alone) or (place_memory_alone and inner_node.state_size != 0)) gi = get_id() gate_refs.append(GateReference(component_name, pos, 0, str(gi), custom_data)) for node_pin_name, pin in shape.pins.items(): dp = pin.pos pin_locations[name, node_pin_name] = pin, pos[0] + dp[0], pos[1] + dp[1] wires = [] splitters = {} makers = {} bs_shape = get_component("ByteSplitter", "")[0] bm_shape = get_component("ByteMaker", "")[0] for wire in node.wires: source_pin, *start = pin_locations[wire.source] target_pin, *end = pin_locations[wire.target] start = tuple(start) end = tuple(end) if not source_pin.is_byte and not target_pin.is_byte: assert wire.source_bits == wire.target_bits == (0, 1), wire wires.append(CircuitWire(len(wires) + 1, False, 0, "", [tuple(start), tuple(end)])) elif source_pin.is_byte and not target_pin.is_byte: assert wire.target_bits == (0, 1) if start not in splitters: pos = place(bs_shape) splitter = splitters[start] = GateReference("ByteSplitter", pos, 0, str(get_id()), "") gate_refs.append(splitter) wires.append(CircuitWire(get_id(), True, 0, "", [start, bs_shape.pin_position(splitter, "in")])) else: splitter = splitters[start] wires.append(CircuitWire(get_id(), False, 0, "", [bs_shape.pin_position(splitter, f"r{wire.source_bits[0]}"), end])) elif not source_pin.is_byte and target_pin.is_byte: assert wire.source_bits == (0, 1) if end not in makers: pos = place(bm_shape) maker = makers[end] = GateReference("ByteMaker", pos, 0, str(get_id()), "") gate_refs.append(maker) wires.append(CircuitWire(get_id(), True, 0, "", [bm_shape.pin_position(maker, "out"), end])) else: maker = makers[end] wires.append(CircuitWire(get_id(), False, 0, "", [start, bm_shape.pin_position(maker, f"r{wire.target_bits[0]}")])) else: assert False, wire return Circuit(gate_refs, wires, 99_999, 99_999, level_version) def to_pydot(node: CombinedLogicNode, io_positions: list[IOPosition], space: Space) -> \ tuple[dict[str, tuple[str, IOPosition]], "pydot.Dot"]: import pydot g = pydot.Dot(graph_type="digraph", rankdir="LR", nodesep=1, ranksep=5, splines="ortho") for name, ln in node.nodes.items(): component_name, custom_data = rev_components[ln.name] shape, inner_node = get_component(component_name, custom_data, no_node=True) g.add_node(pydot.Node(name, fixedsize=True, shape="box", width=shape.bounding_box[2], height=shape.bounding_box[3], label=f"{component_name}[{name}]")) io_nodes = {} for io in io_positions: shape, _ = get_component(io.component_name, io.custom_data) name = "".join(io.pin_mapping) for p in io.pin_mapping: io_nodes[p] = name, io g.add_node(pydot.Node(name, fixedsize=True, shape="box", width=7, height=7, label=f"{io.component_name}[{name}]")) for wire in node.wires: if wire.source[0] is None: source = io_nodes[wire.source[1]][0] else: source = wire.source[0] if wire.target[0] is None: target = io_nodes[wire.target[1]][0] else: target = wire.target[0] g.add_edge(pydot.Edge(source, target, tailport="e", headport="w", )) return io_nodes, g def layout_with_pydot(node: CombinedLogicNode, io_positions: list[IOPosition], space: Space) -> Circuit: i = 1 taken_ids = set() def get_id() -> int: nonlocal i while i in taken_ids: i += 1 taken_ids.add(i) return i pin_to_io, graph = to_pydot(node, io_positions, space) graph.write_svg("test.svg") data = json.loads(graph.create(format='json0')) del graph ionames = {name: io for name, io in pin_to_io.values()} gate_refs = [] pin_locations = {} for obj in data["objects"]: name, pos = obj['name'], obj['pos'] pos = pos.split(',') pos = int(pos[0]) // 72 + space.x, int(pos[1]) // 72 + space.y if name in ionames: io: IOPosition = ionames[name] if io.force_id is not None: gid = int(io.force_id) taken_ids.add(gid) else: gid = get_id() component_name, custom_data = io.component_name, io.custom_data gate_refs.append(GateReference(io.component_name, pos, 0, str(gid), io.custom_data)) shape, _ = get_component(io.component_name, io.custom_data, True) for node_pin_name, shape_pin_name in io.pin_mapping.items(): dp = shape.pins[shape_pin_name].pos pin_locations[None, node_pin_name] = shape.pins[shape_pin_name], pos[0] + dp[0], pos[1] + dp[1] else: n = node.nodes[name] component_name, custom_data = rev_components[n.name] shape, inner_node = get_component(component_name, custom_data, no_node=True) gid = get_id() for node_pin_name, pin in shape.pins.items(): dp = pin.pos pin_locations[name, node_pin_name] = pin, pos[0] + dp[0], pos[1] + dp[1] space.place(shape.bounding_box[2], shape.bounding_box[3], (pos[0] - space.x, pos[1] - space.y)) gate_refs.append(GateReference(component_name, pos, 0, str(gid), custom_data)) wires = [] splitters = {} makers = {} bs_shape = get_component("ByteSplitter", "")[0] bm_shape = get_component("ByteMaker", "")[0] for wire in node.wires: source_pin, *start = pin_locations[wire.source] target_pin, *end = pin_locations[wire.target] start = tuple(start) end = tuple(end) if not source_pin.is_byte and not target_pin.is_byte: assert wire.source_bits == wire.target_bits == (0, 1), wire wires.append(CircuitWire(len(wires) + 1, False, 0, "", [tuple(start), tuple(end)])) elif source_pin.is_byte and not target_pin.is_byte: assert wire.target_bits == (0, 1) if start not in splitters: t, l = space.place(bm_shape.bounding_box[2], bm_shape.bounding_box[3]) pos = t - bm_shape.bounding_box[0], l - bm_shape.bounding_box[1] splitter = splitters[start] = GateReference("ByteSplitter", pos, 0, str(get_id()), "") gate_refs.append(splitter) wires.append(CircuitWire(get_id(), True, 0, "", [start, bs_shape.pin_position(splitter, "in")])) else: splitter = splitters[start] wires.append(CircuitWire(get_id(), False, 0, "", [bs_shape.pin_position(splitter, f"r{wire.source_bits[0]}"), end])) elif not source_pin.is_byte and target_pin.is_byte: assert wire.source_bits == (0, 1) if end not in makers: t, l = space.place(bm_shape.bounding_box[2], bm_shape.bounding_box[3]) pos = t - bm_shape.bounding_box[0], l - bm_shape.bounding_box[1] maker = makers[end] = GateReference("ByteMaker", pos, 0, str(get_id()), "") gate_refs.append(maker) wires.append(CircuitWire(get_id(), True, 0, "", [bm_shape.pin_position(maker, "out"), end])) else: maker = makers[end] wires.append(CircuitWire(get_id(), False, 0, "", [start, bm_shape.pin_position(maker, f"r{wire.target_bits[0]}")])) else: assert False, wire return Circuit(gate_refs, wires) GateType = Literal["and", "or", "nor", "nand"] def layout_two_levels(inputs: list[str], first: Iterable[tuple[str, tuple[Atom, ...], GateType]], second: Iterable[tuple[str, str, bool]], use_buffer: bool = True): pass
41.121718
116
0.556878
from __future__ import annotations import json from dataclasses import dataclass, field from math import inf, sqrt from queue import PriorityQueue from typing import Any, Callable, Collection, TYPE_CHECKING, Iterable, Literal from bitarray import bitarray from turing_complete_interface.circuit_parser import Circuit, GateReference, GateShape, CircuitWire, CircuitPin, Pos from turing_complete_interface.truth_table import Atom from turing_complete_interface.logic_nodes import CombinedLogicNode, NodePin from turing_complete_interface.tc_components import get_component, rev_components if TYPE_CHECKING: import pydot @dataclass class IOPosition: component_name: str pin_mapping: dict[str, str] force_id: str = None force_position: tuple[int, int] = None custom_data: str = "" @classmethod def from_circuit(cls, circuit: Circuit) -> list[IOPosition]: ios = [] for gate in circuit.gates: shape, _ = get_component(gate.name, gate.custom_data) if not shape.is_io: continue ios.append(IOPosition(gate.name, {gate.id: next(iter(shape.pins))} if len(shape.pins) == 1 else { f"{gate.id}.{pin_name}": pin_name for pin_name in shape.pins }, gate.id, gate.pos, gate.custom_data)) return ios @classmethod def from_node(cls, node: CombinedLogicNode) -> list[IOPosition]: ios = [] for name, inp in node.inputs.items(): ios.append(IOPosition("Input1" if inp.bits == 1 else "Input1B", {name: "value"}, custom_data=name)) for name, out in node.outputs.items(): ios.append(IOPosition("Output1" if out.bits == 1 else "Output1B", {name: "value"}, custom_data=name)) return ios @dataclass class Space: x: int y: int w: int h: int _observer: Any = None _placed_boxes: list[tuple[int, int, int, int]] = field(default_factory=list) _protected: set[Any] = field(default_factory=set) _taken_spaces: bitarray = None def __post_init__(self): self._taken_spaces = bitarray([0] * (self.w * self.h)) self._taken_spaces[:] = 0 def place(self, w: int, h: int, force_pos: tuple[int, int] = None, hasher: Callable[[tuple[int, int]], Any] = None) -> tuple[int, int]: if force_pos is None: for idx in self._taken_spaces.itersearch(bitarray([0] * w)): y, x = divmod(idx, self.w) if x + w > self.w: continue if hasher is not None and hasher((x + self.x, y + self.y)) in self._protected: continue for k in range(h): if idx + k * self.w + w >= self.h * self.w: break if self._taken_spaces[idx + k * self.w:idx + k * self.w + w].any(): break else: break else: raise ValueError(f"No space left {w}, {h}") else: x, y = force_pos self._placed_boxes.append((x, y, w, h)) idx = y * self.w + x for k in range(h): self._taken_spaces[idx + k * self.w:idx + k * self.w + w] = 1 if hasher is not None: self._protected.add(hasher((x + self.x, y + self.y))) if self._observer is not None: self._observer(self) return x + self.x, y + self.y def is_filled(self, x: int, y: int): return self._taken_spaces[(y - self.y) * self.w + (x - self.x)] def clear(self): self._taken_spaces.clear() self._placed_boxes.clear() self._protected.clear() @dataclass class PathFinder: circuit: Circuit area: tuple[int, int, int, int] taken: list[list[Literal['gate', 'pin', 'wire_end'] | None]] def add_gate(self, gate_ref: GateReference, shape: GateShape): for bx, by in shape.blocks: p = gate_ref.translate((bx, by)) self.taken[p[0] - self.area[0]][p[1] - self.area[1]] = 'gate' for pin in shape.pins.values(): p = gate_ref.translate(pin.pos) self.taken[p[0] - self.area[0]][p[1] - self.area[1]] = 'pin' if shape.big_shape: for bx in range(shape.big_shape.tl[0], shape.big_shape.br[0]): for by in range(shape.big_shape.tl[1], shape.big_shape.br[1]): p = gate_ref.translate((bx, by)) self.taken[p[0] - self.area[0]][p[1] - self.area[1]] = 'gate' def add_wire_end(self, pos: Pos): self.taken[pos[0] - self.area[0]][pos[1] - self.area[1]] = 'wire_end' def reload(self): self.taken = [[None] * self.area[2] for _ in range(self.area[3])] for gate in self.circuit.gates: shape = get_component(gate, no_node=True)[0] self.add_gate(gate, shape) for wire in self.circuit.wires: if wire.positions: self.add_wire_end(wire.positions[0]) self.add_wire_end(wire.positions[-1]) def path_find(self, start: Pos, end: Pos): start = start[0] - self.area[0], start[1] - self.area[1] end = end[0] - self.area[0], end[1] - self.area[1] if self.taken[end[0]][end[1]] == "gate": return None def h(p): return sqrt((p[0] - end[0]) ** 2 + (p[1] - end[1]) ** 2) def reconstruct(): path = [(end[0] + self.area[0], end[1] + self.area[1])] current = end while current in came_from: current = came_from[current] path.append((current[0] + self.area[0], current[1] + self.area[1])) return path queue = PriorityQueue() queue.put((0, start)) came_from = {} path_cost = {start: 0} heuristic_cost = {} while not queue.empty(): _, (x, y) = queue.get() if (x, y) == end: return reconstruct() for dx in (-1, 0, 1): if not (0 <= x + dx < self.area[2]): continue for dy in (-1, 0, 1): if not (0 <= y + dy < self.area[3]): continue if dx == dy == 0: continue np = x + dx, y + dy if self.taken[np[0]][np[1]] is not None and (np != end): continue new_cost = path_cost[x, y] + 1 if new_cost < path_cost.get(np, inf): came_from[np] = x, y path_cost[np] = new_cost heuristic_cost[np] = new_cost + h(np) queue.put((heuristic_cost[np], np)) return None @classmethod def create(cls, circuit, area): self = cls(circuit, area, [[None] * area[3] for _ in range(area[2])]) self.reload() return self def build_circuit(node: CombinedLogicNode, io_positions: list[IOPosition], space: Space, level_version: int = 0, place_alone: Collection[str] = (), place_memory_alone=True) -> Circuit: taken_ids: set[int] = set() i = 1 def get_id() -> int: nonlocal i while i in taken_ids: i += 1 taken_ids.add(i) return i def place(shape: GateShape, io: bool = False, forced_pos: tuple[int, int] = None): ox, oy, w, h = shape.bounding_box def translate(p): return (int((p[0] + 30 - ox) // 8 - 3), int((p[1] + 30 - oy) // 8 - 3)) if forced_pos is not None: forced_pos = forced_pos[0] + ox - space.x, forced_pos[1] + ox - space.y t, l = space.place(w, h, forced_pos, (translate if io else None)) return t - ox, l - oy gate_refs = [] pin_locations: dict[NodePin, tuple[CircuitPin, int, int]] = {} for io in io_positions: shape, _ = get_component(io.component_name, io.custom_data) pos = place(shape, True, io.force_position) gi = get_id() if io.force_id is None else io.force_id gate_refs.append(GateReference(io.component_name, pos, 0, str(gi), io.custom_data)) for node_pin_name, shape_pin_name in io.pin_mapping.items(): dp = shape.pins[shape_pin_name].pos pin_locations[None, node_pin_name] = shape.pins[shape_pin_name], pos[0] + dp[0], pos[1] + dp[1] for name, n in node.nodes.items(): component_name, custom_data = rev_components[n.name] shape, inner_node = get_component(component_name, custom_data, no_node=True) pos = place(shape, (n.name in place_alone) or (name in place_alone) or (place_memory_alone and inner_node.state_size != 0)) gi = get_id() gate_refs.append(GateReference(component_name, pos, 0, str(gi), custom_data)) for node_pin_name, pin in shape.pins.items(): dp = pin.pos pin_locations[name, node_pin_name] = pin, pos[0] + dp[0], pos[1] + dp[1] wires = [] splitters = {} makers = {} bs_shape = get_component("ByteSplitter", "")[0] bm_shape = get_component("ByteMaker", "")[0] for wire in node.wires: source_pin, *start = pin_locations[wire.source] target_pin, *end = pin_locations[wire.target] start = tuple(start) end = tuple(end) if not source_pin.is_byte and not target_pin.is_byte: assert wire.source_bits == wire.target_bits == (0, 1), wire wires.append(CircuitWire(len(wires) + 1, False, 0, "", [tuple(start), tuple(end)])) elif source_pin.is_byte and not target_pin.is_byte: assert wire.target_bits == (0, 1) if start not in splitters: pos = place(bs_shape) splitter = splitters[start] = GateReference("ByteSplitter", pos, 0, str(get_id()), "") gate_refs.append(splitter) wires.append(CircuitWire(get_id(), True, 0, "", [start, bs_shape.pin_position(splitter, "in")])) else: splitter = splitters[start] wires.append(CircuitWire(get_id(), False, 0, "", [bs_shape.pin_position(splitter, f"r{wire.source_bits[0]}"), end])) elif not source_pin.is_byte and target_pin.is_byte: assert wire.source_bits == (0, 1) if end not in makers: pos = place(bm_shape) maker = makers[end] = GateReference("ByteMaker", pos, 0, str(get_id()), "") gate_refs.append(maker) wires.append(CircuitWire(get_id(), True, 0, "", [bm_shape.pin_position(maker, "out"), end])) else: maker = makers[end] wires.append(CircuitWire(get_id(), False, 0, "", [start, bm_shape.pin_position(maker, f"r{wire.target_bits[0]}")])) else: assert False, wire return Circuit(gate_refs, wires, 99_999, 99_999, level_version) def to_pydot(node: CombinedLogicNode, io_positions: list[IOPosition], space: Space) -> \ tuple[dict[str, tuple[str, IOPosition]], "pydot.Dot"]: import pydot g = pydot.Dot(graph_type="digraph", rankdir="LR", nodesep=1, ranksep=5, splines="ortho") for name, ln in node.nodes.items(): component_name, custom_data = rev_components[ln.name] shape, inner_node = get_component(component_name, custom_data, no_node=True) g.add_node(pydot.Node(name, fixedsize=True, shape="box", width=shape.bounding_box[2], height=shape.bounding_box[3], label=f"{component_name}[{name}]")) io_nodes = {} for io in io_positions: shape, _ = get_component(io.component_name, io.custom_data) name = "".join(io.pin_mapping) for p in io.pin_mapping: io_nodes[p] = name, io g.add_node(pydot.Node(name, fixedsize=True, shape="box", width=7, height=7, label=f"{io.component_name}[{name}]")) for wire in node.wires: if wire.source[0] is None: source = io_nodes[wire.source[1]][0] else: source = wire.source[0] if wire.target[0] is None: target = io_nodes[wire.target[1]][0] else: target = wire.target[0] g.add_edge(pydot.Edge(source, target, tailport="e", headport="w", )) return io_nodes, g def layout_with_pydot(node: CombinedLogicNode, io_positions: list[IOPosition], space: Space) -> Circuit: i = 1 taken_ids = set() def get_id() -> int: nonlocal i while i in taken_ids: i += 1 taken_ids.add(i) return i pin_to_io, graph = to_pydot(node, io_positions, space) graph.write_svg("test.svg") data = json.loads(graph.create(format='json0')) del graph ionames = {name: io for name, io in pin_to_io.values()} gate_refs = [] pin_locations = {} for obj in data["objects"]: name, pos = obj['name'], obj['pos'] pos = pos.split(',') pos = int(pos[0]) // 72 + space.x, int(pos[1]) // 72 + space.y if name in ionames: io: IOPosition = ionames[name] if io.force_id is not None: gid = int(io.force_id) taken_ids.add(gid) else: gid = get_id() component_name, custom_data = io.component_name, io.custom_data gate_refs.append(GateReference(io.component_name, pos, 0, str(gid), io.custom_data)) shape, _ = get_component(io.component_name, io.custom_data, True) for node_pin_name, shape_pin_name in io.pin_mapping.items(): dp = shape.pins[shape_pin_name].pos pin_locations[None, node_pin_name] = shape.pins[shape_pin_name], pos[0] + dp[0], pos[1] + dp[1] else: n = node.nodes[name] component_name, custom_data = rev_components[n.name] shape, inner_node = get_component(component_name, custom_data, no_node=True) gid = get_id() for node_pin_name, pin in shape.pins.items(): dp = pin.pos pin_locations[name, node_pin_name] = pin, pos[0] + dp[0], pos[1] + dp[1] space.place(shape.bounding_box[2], shape.bounding_box[3], (pos[0] - space.x, pos[1] - space.y)) gate_refs.append(GateReference(component_name, pos, 0, str(gid), custom_data)) wires = [] splitters = {} makers = {} bs_shape = get_component("ByteSplitter", "")[0] bm_shape = get_component("ByteMaker", "")[0] for wire in node.wires: source_pin, *start = pin_locations[wire.source] target_pin, *end = pin_locations[wire.target] start = tuple(start) end = tuple(end) if not source_pin.is_byte and not target_pin.is_byte: assert wire.source_bits == wire.target_bits == (0, 1), wire wires.append(CircuitWire(len(wires) + 1, False, 0, "", [tuple(start), tuple(end)])) elif source_pin.is_byte and not target_pin.is_byte: assert wire.target_bits == (0, 1) if start not in splitters: t, l = space.place(bm_shape.bounding_box[2], bm_shape.bounding_box[3]) pos = t - bm_shape.bounding_box[0], l - bm_shape.bounding_box[1] splitter = splitters[start] = GateReference("ByteSplitter", pos, 0, str(get_id()), "") gate_refs.append(splitter) wires.append(CircuitWire(get_id(), True, 0, "", [start, bs_shape.pin_position(splitter, "in")])) else: splitter = splitters[start] wires.append(CircuitWire(get_id(), False, 0, "", [bs_shape.pin_position(splitter, f"r{wire.source_bits[0]}"), end])) elif not source_pin.is_byte and target_pin.is_byte: assert wire.source_bits == (0, 1) if end not in makers: t, l = space.place(bm_shape.bounding_box[2], bm_shape.bounding_box[3]) pos = t - bm_shape.bounding_box[0], l - bm_shape.bounding_box[1] maker = makers[end] = GateReference("ByteMaker", pos, 0, str(get_id()), "") gate_refs.append(maker) wires.append(CircuitWire(get_id(), True, 0, "", [bm_shape.pin_position(maker, "out"), end])) else: maker = makers[end] wires.append(CircuitWire(get_id(), False, 0, "", [start, bm_shape.pin_position(maker, f"r{wire.target_bits[0]}")])) else: assert False, wire return Circuit(gate_refs, wires) GateType = Literal["and", "or", "nor", "nand"] def layout_two_levels(inputs: list[str], first: Iterable[tuple[str, tuple[Atom, ...], GateType]], second: Iterable[tuple[str, str, bool]], use_buffer: bool = True): pass
true
true
f72623295ea209ba44d041366790eed08ce7ecff
7,709
py
Python
dvc/ignore.py
iksnagreb/dvc
a077135d76bd30205ca6db75bb76c55465be5255
[ "Apache-2.0" ]
1
2020-08-12T22:51:45.000Z
2020-08-12T22:51:45.000Z
dvc/ignore.py
iksnagreb/dvc
a077135d76bd30205ca6db75bb76c55465be5255
[ "Apache-2.0" ]
null
null
null
dvc/ignore.py
iksnagreb/dvc
a077135d76bd30205ca6db75bb76c55465be5255
[ "Apache-2.0" ]
1
2020-11-28T11:47:48.000Z
2020-11-28T11:47:48.000Z
import logging import os import re from itertools import groupby from pathspec.patterns import GitWildMatchPattern from pathspec.util import normalize_file from pygtrie import StringTrie from dvc.path_info import PathInfo from dvc.pathspec_math import merge_patterns from dvc.system import System from dvc.utils import relpath logger = logging.getLogger(__name__) class DvcIgnore: DVCIGNORE_FILE = ".dvcignore" def __call__(self, root, dirs, files): raise NotImplementedError class DvcIgnorePatterns(DvcIgnore): def __init__(self, pattern_list, dirname): self.pattern_list = pattern_list self.dirname = dirname self.prefix = self.dirname + os.sep regex_pattern_list = map( GitWildMatchPattern.pattern_to_regex, pattern_list ) self.ignore_spec = [ (ignore, re.compile("|".join(item[0] for item in group))) for ignore, group in groupby(regex_pattern_list, lambda x: x[1]) if ignore is not None ] @classmethod def from_files(cls, ignore_file_path, tree): assert os.path.isabs(ignore_file_path) dirname = os.path.normpath(os.path.dirname(ignore_file_path)) with tree.open(ignore_file_path, encoding="utf-8") as fobj: path_spec_lines = [ line for line in map(str.strip, fobj.readlines()) if line ] return cls(path_spec_lines, dirname) def __call__(self, root, dirs, files): files = [f for f in files if not self.matches(root, f)] dirs = [d for d in dirs if not self.matches(root, d, True)] return dirs, files def matches(self, dirname, basename, is_dir=False): # NOTE: `relpath` is too slow, so we have to assume that both # `dirname` and `self.dirname` are relative or absolute together. if dirname == self.dirname: path = basename elif dirname.startswith(self.prefix): rel = dirname[len(self.prefix) :] # NOTE: `os.path.join` is ~x5.5 slower path = f"{rel}{os.sep}{basename}" else: return False if not System.is_unix(): path = normalize_file(path) return self.ignore(path, is_dir) def ignore(self, path, is_dir): result = False if is_dir: path_dir = f"{path}/" for ignore, pattern in self.ignore_spec: if pattern.match(path) or pattern.match(path_dir): result = ignore else: for ignore, pattern in self.ignore_spec: if pattern.match(path): result = ignore return result def __hash__(self): return hash(self.dirname + ":" + "\n".join(self.pattern_list)) def __eq__(self, other): if not isinstance(other, DvcIgnorePatterns): return NotImplemented return (self.dirname == other.dirname) & ( self.pattern_list == other.pattern_list ) def __bool__(self): return bool(self.pattern_list) class DvcIgnorePatternsTrie(DvcIgnore): trie = None def __init__(self): if self.trie is None: self.trie = StringTrie(separator=os.sep) def __call__(self, root, dirs, files): ignore_pattern = self[root] if ignore_pattern: return ignore_pattern(root, dirs, files) return dirs, files def __setitem__(self, root, ignore_pattern): base_pattern = self[root] common_dirname, merged_pattern = merge_patterns( base_pattern.dirname, base_pattern.pattern_list, ignore_pattern.dirname, ignore_pattern.pattern_list, ) self.trie[root] = DvcIgnorePatterns(merged_pattern, common_dirname) def __getitem__(self, root): ignore_pattern = self.trie.longest_prefix(root) if ignore_pattern: return ignore_pattern.value return DvcIgnorePatterns([], root) class DvcIgnoreDirs(DvcIgnore): def __init__(self, basenames): self.basenames = set(basenames) def __call__(self, root, dirs, files): dirs = [d for d in dirs if d not in self.basenames] return dirs, files def __hash__(self): return hash(tuple(self.basenames)) def __eq__(self, other): if not isinstance(other, DvcIgnoreDirs): return NotImplemented return self.basenames == other.basenames class DvcIgnoreRepo(DvcIgnore): def __call__(self, root, dirs, files): def is_dvc_repo(directory): from dvc.repo import Repo return os.path.isdir(os.path.join(root, directory, Repo.DVC_DIR)) dirs = [d for d in dirs if not is_dvc_repo(d)] return dirs, files class DvcIgnoreFilterNoop: def __init__(self, tree, root_dir): pass def __call__(self, root, dirs, files): return dirs, files def is_ignored_dir(self, _): return False def is_ignored_file(self, _): return False class DvcIgnoreFilter: def __init__(self, tree, root_dir): self.tree = tree self.root_dir = root_dir self.ignores = { DvcIgnoreDirs([".git", ".hg", ".dvc"]), DvcIgnoreRepo(), } ignore_pattern_trie = DvcIgnorePatternsTrie() for root, dirs, _ in self.tree.walk(self.root_dir): ignore_pattern = self._get_ignore_pattern(root) if ignore_pattern: ignore_pattern_trie[root] = ignore_pattern self.ignores.add(ignore_pattern_trie) dirs[:], _ = self(root, dirs, []) def _get_ignore_pattern(self, dirname): ignore_file_path = os.path.join(dirname, DvcIgnore.DVCIGNORE_FILE) if self.tree.exists(ignore_file_path): return DvcIgnorePatterns.from_files(ignore_file_path, self.tree) return None def __call__(self, root, dirs, files): for ignore in self.ignores: dirs, files = ignore(root, dirs, files) return dirs, files def is_ignored_dir(self, path): if not self._parents_exist(path): return True path = os.path.abspath(path) if path == self.root_dir: return False dirname, basename = os.path.split(path) dirs, _ = self(dirname, [basename], []) return not dirs def is_ignored_file(self, path): if not self._parents_exist(path): return True dirname, basename = os.path.split(os.path.normpath(path)) _, files = self(os.path.abspath(dirname), [], [basename]) return not files def _parents_exist(self, path): from dvc.repo import Repo path = PathInfo(path) # if parent is root_dir or inside a .dvc dir we can skip this check if path.parent == self.root_dir or Repo.DVC_DIR in path.parts: return True # paths outside of the repo should be ignored path = relpath(path, self.root_dir) if path.startswith("..") or ( os.name == "nt" and not os.path.commonprefix( [os.path.abspath(path), self.root_dir] ) ): return False # check if parent directories are in our ignores, starting from # root_dir for parent_dir in reversed(PathInfo(path).parents): dirname, basename = os.path.split(parent_dir) if basename == ".": # parent_dir == root_dir continue dirs, _ = self(os.path.abspath(dirname), [basename], []) if not dirs: return False return True
30.350394
77
0.609936
import logging import os import re from itertools import groupby from pathspec.patterns import GitWildMatchPattern from pathspec.util import normalize_file from pygtrie import StringTrie from dvc.path_info import PathInfo from dvc.pathspec_math import merge_patterns from dvc.system import System from dvc.utils import relpath logger = logging.getLogger(__name__) class DvcIgnore: DVCIGNORE_FILE = ".dvcignore" def __call__(self, root, dirs, files): raise NotImplementedError class DvcIgnorePatterns(DvcIgnore): def __init__(self, pattern_list, dirname): self.pattern_list = pattern_list self.dirname = dirname self.prefix = self.dirname + os.sep regex_pattern_list = map( GitWildMatchPattern.pattern_to_regex, pattern_list ) self.ignore_spec = [ (ignore, re.compile("|".join(item[0] for item in group))) for ignore, group in groupby(regex_pattern_list, lambda x: x[1]) if ignore is not None ] @classmethod def from_files(cls, ignore_file_path, tree): assert os.path.isabs(ignore_file_path) dirname = os.path.normpath(os.path.dirname(ignore_file_path)) with tree.open(ignore_file_path, encoding="utf-8") as fobj: path_spec_lines = [ line for line in map(str.strip, fobj.readlines()) if line ] return cls(path_spec_lines, dirname) def __call__(self, root, dirs, files): files = [f for f in files if not self.matches(root, f)] dirs = [d for d in dirs if not self.matches(root, d, True)] return dirs, files def matches(self, dirname, basename, is_dir=False): if dirname == self.dirname: path = basename elif dirname.startswith(self.prefix): rel = dirname[len(self.prefix) :] path = f"{rel}{os.sep}{basename}" else: return False if not System.is_unix(): path = normalize_file(path) return self.ignore(path, is_dir) def ignore(self, path, is_dir): result = False if is_dir: path_dir = f"{path}/" for ignore, pattern in self.ignore_spec: if pattern.match(path) or pattern.match(path_dir): result = ignore else: for ignore, pattern in self.ignore_spec: if pattern.match(path): result = ignore return result def __hash__(self): return hash(self.dirname + ":" + "\n".join(self.pattern_list)) def __eq__(self, other): if not isinstance(other, DvcIgnorePatterns): return NotImplemented return (self.dirname == other.dirname) & ( self.pattern_list == other.pattern_list ) def __bool__(self): return bool(self.pattern_list) class DvcIgnorePatternsTrie(DvcIgnore): trie = None def __init__(self): if self.trie is None: self.trie = StringTrie(separator=os.sep) def __call__(self, root, dirs, files): ignore_pattern = self[root] if ignore_pattern: return ignore_pattern(root, dirs, files) return dirs, files def __setitem__(self, root, ignore_pattern): base_pattern = self[root] common_dirname, merged_pattern = merge_patterns( base_pattern.dirname, base_pattern.pattern_list, ignore_pattern.dirname, ignore_pattern.pattern_list, ) self.trie[root] = DvcIgnorePatterns(merged_pattern, common_dirname) def __getitem__(self, root): ignore_pattern = self.trie.longest_prefix(root) if ignore_pattern: return ignore_pattern.value return DvcIgnorePatterns([], root) class DvcIgnoreDirs(DvcIgnore): def __init__(self, basenames): self.basenames = set(basenames) def __call__(self, root, dirs, files): dirs = [d for d in dirs if d not in self.basenames] return dirs, files def __hash__(self): return hash(tuple(self.basenames)) def __eq__(self, other): if not isinstance(other, DvcIgnoreDirs): return NotImplemented return self.basenames == other.basenames class DvcIgnoreRepo(DvcIgnore): def __call__(self, root, dirs, files): def is_dvc_repo(directory): from dvc.repo import Repo return os.path.isdir(os.path.join(root, directory, Repo.DVC_DIR)) dirs = [d for d in dirs if not is_dvc_repo(d)] return dirs, files class DvcIgnoreFilterNoop: def __init__(self, tree, root_dir): pass def __call__(self, root, dirs, files): return dirs, files def is_ignored_dir(self, _): return False def is_ignored_file(self, _): return False class DvcIgnoreFilter: def __init__(self, tree, root_dir): self.tree = tree self.root_dir = root_dir self.ignores = { DvcIgnoreDirs([".git", ".hg", ".dvc"]), DvcIgnoreRepo(), } ignore_pattern_trie = DvcIgnorePatternsTrie() for root, dirs, _ in self.tree.walk(self.root_dir): ignore_pattern = self._get_ignore_pattern(root) if ignore_pattern: ignore_pattern_trie[root] = ignore_pattern self.ignores.add(ignore_pattern_trie) dirs[:], _ = self(root, dirs, []) def _get_ignore_pattern(self, dirname): ignore_file_path = os.path.join(dirname, DvcIgnore.DVCIGNORE_FILE) if self.tree.exists(ignore_file_path): return DvcIgnorePatterns.from_files(ignore_file_path, self.tree) return None def __call__(self, root, dirs, files): for ignore in self.ignores: dirs, files = ignore(root, dirs, files) return dirs, files def is_ignored_dir(self, path): if not self._parents_exist(path): return True path = os.path.abspath(path) if path == self.root_dir: return False dirname, basename = os.path.split(path) dirs, _ = self(dirname, [basename], []) return not dirs def is_ignored_file(self, path): if not self._parents_exist(path): return True dirname, basename = os.path.split(os.path.normpath(path)) _, files = self(os.path.abspath(dirname), [], [basename]) return not files def _parents_exist(self, path): from dvc.repo import Repo path = PathInfo(path) if path.parent == self.root_dir or Repo.DVC_DIR in path.parts: return True path = relpath(path, self.root_dir) if path.startswith("..") or ( os.name == "nt" and not os.path.commonprefix( [os.path.abspath(path), self.root_dir] ) ): return False for parent_dir in reversed(PathInfo(path).parents): dirname, basename = os.path.split(parent_dir) if basename == ".": continue dirs, _ = self(os.path.abspath(dirname), [basename], []) if not dirs: return False return True
true
true
f726248f250b43e625a1784113284065ec6f8efa
6,073
py
Python
app/auth/routes.py
Alexsik76/flask_blog
e780469afe246a56c4e5c5744d16cf8cb7da9374
[ "Apache-2.0" ]
null
null
null
app/auth/routes.py
Alexsik76/flask_blog
e780469afe246a56c4e5c5744d16cf8cb7da9374
[ "Apache-2.0" ]
null
null
null
app/auth/routes.py
Alexsik76/flask_blog
e780469afe246a56c4e5c5744d16cf8cb7da9374
[ "Apache-2.0" ]
null
null
null
import os from functools import wraps from flask import flash, redirect, render_template, url_for, current_app, Markup, request from flask_login import login_user, login_required, logout_user, current_user from app.auth import bp from app.auth.forms import SignUpForm, RegistrationForm, LoginForm, ResetPasswordForm, NewPasswordForm, UserForm from app.auth.email import send_email from itsdangerous import URLSafeTimedSerializer from app.models import User from app import db def offer_to_log_in(email: str): href = f"""<a href="{url_for('auth.login', email=email)}" class="danger-link">Log In</a>""" message = f"The email: {email} is used. Please {href}." flash(Markup(message), 'danger') def get_email_from_token(token): serializer = URLSafeTimedSerializer(current_app.config['SECRET_KEY']) email = serializer.loads(token, salt=current_app.config['SECURITY_PASSWORD_SALT']) return email def redirect_authenticated(f): @wraps(f) def decorated_function(*args, **kwargs): if current_user.is_authenticated and current_user.email == get_email_from_token(kwargs.get('token')): return redirect(url_for('main.index')) return f(*args, **kwargs) return decorated_function @bp.route('/signup', methods=['GET', 'POST']) async def signup(): form = SignUpForm() is_busy = bool(User.query.filter_by(email=form.email.data).first()) if form.validate_on_submit() and not is_busy: res = await send_email(form.email.data, goal='registration') print(res) flash(f'To continue registration, follow the link in the letter.', 'info') return redirect(url_for('main.index')) elif is_busy: offer_to_log_in(form.email.data) return render_template('auth/signup.html', form=form) @bp.route('/register/<token>', methods=['GET', 'POST']) @redirect_authenticated def register(token): form = RegistrationForm() email = get_email_from_token(token) if bool(User.query.filter_by(email=email).first()): offer_to_log_in(email) return redirect(url_for('main.index')) form.email.data = email if form.validate_on_submit(): new_user = User( email=email, # noqa first_name=form.first_name.data, # noqa last_name=form.last_name.data, # noqa is_admin=True if email == current_app.config['ADMIN_EMAIL'] else False # noqa ) new_user.set_password(form.password.data) print(f'{new_user.is_admin:=}') db.session.add(new_user) db.session.commit() if not os.path.isdir(os.path.join(current_app.config['UPLOAD_PATH'], str(new_user.id))): os.mkdir(os.path.join(current_app.config['UPLOAD_PATH'], str(new_user.id))) flash('You can log in', 'success') return redirect(url_for('main.index')) return render_template('auth/register.html', form=form) @bp.route('/login', methods=['GET', 'POST']) def login(): form = LoginForm() if email := request.args.get('email'): form.email.data = email if form.validate_on_submit(): user = User.query.filter_by(email=form.email.data).first() if not user: flash(f'User with email {form.email.data} not registered', 'danger') return redirect(url_for('auth.signup')) elif not user.check_password(form.password.data): flash('Wrong password', 'danger') return redirect(url_for('main.index')) else: login_user(user, remember=form.remember_me.data) flash(f'Hi, {user.first_name}!', 'success') return redirect(url_for('main.index')) return render_template('auth/login.html', form=form) @bp.route('/log_out', methods=['GET', 'POST']) @login_required def log_out(): logout_user() flash('You are logged out', 'info') return redirect(url_for('main.index')) @bp.route('/reset_password', methods=['GET', 'POST']) def reset_password(): form = ResetPasswordForm() if current_user.is_authenticated: form.email.data = current_user.email form.email.render_kw = {'disabled': True} is_present = bool(User.query.filter_by(email=form.email.data).first()) if form.validate_on_submit(): if is_present: send_email(form.email.data, goal='reset') flash('To continue reset password, follow the link in the letter.', 'info') return redirect(url_for('main.index')) else: href = f"""<a href="{url_for('auth.signup', email=form.email.data)}" class="danger-link">Sign up</a>""" message = f"The email: {form.email.data} not founded. Please {href} or use correct email." flash(Markup(message), 'danger') return render_template('auth/signup.html', form=form) @bp.route('/new_password/<token>', methods=['GET', 'POST']) def new_password(token): form = NewPasswordForm() serializer = URLSafeTimedSerializer(current_app.config['SECRET_KEY']) email = serializer.loads(token, salt=current_app.config['SECURITY_PASSWORD_SALT']) form.email.data = email user = User.query.filter_by(email=email).first() if form.validate_on_submit(): user.set_password(form.password.data) db.session.commit() flash('Password was changed. You can log in', 'success') return redirect(url_for('main.index')) elif form.is_submitted(): return render_template('auth/new_password.html', form=form), 422 return render_template('auth/new_password.html', form=form) @bp.route('/user_page', methods=['GET', 'POST']) @login_required def user_page(): form = UserForm(obj=current_user) if form.validate_on_submit(): is_changed = False for field in 'email', 'first_name', 'last_name': if getattr(form, field).data is not getattr(current_user, field): setattr(current_user, field, getattr(form, field).data) is_changed = True if is_changed: db.session.commit() return render_template('auth/user_page.html', form=form)
39.953947
115
0.668698
import os from functools import wraps from flask import flash, redirect, render_template, url_for, current_app, Markup, request from flask_login import login_user, login_required, logout_user, current_user from app.auth import bp from app.auth.forms import SignUpForm, RegistrationForm, LoginForm, ResetPasswordForm, NewPasswordForm, UserForm from app.auth.email import send_email from itsdangerous import URLSafeTimedSerializer from app.models import User from app import db def offer_to_log_in(email: str): href = f"""<a href="{url_for('auth.login', email=email)}" class="danger-link">Log In</a>""" message = f"The email: {email} is used. Please {href}." flash(Markup(message), 'danger') def get_email_from_token(token): serializer = URLSafeTimedSerializer(current_app.config['SECRET_KEY']) email = serializer.loads(token, salt=current_app.config['SECURITY_PASSWORD_SALT']) return email def redirect_authenticated(f): @wraps(f) def decorated_function(*args, **kwargs): if current_user.is_authenticated and current_user.email == get_email_from_token(kwargs.get('token')): return redirect(url_for('main.index')) return f(*args, **kwargs) return decorated_function @bp.route('/signup', methods=['GET', 'POST']) async def signup(): form = SignUpForm() is_busy = bool(User.query.filter_by(email=form.email.data).first()) if form.validate_on_submit() and not is_busy: res = await send_email(form.email.data, goal='registration') print(res) flash(f'To continue registration, follow the link in the letter.', 'info') return redirect(url_for('main.index')) elif is_busy: offer_to_log_in(form.email.data) return render_template('auth/signup.html', form=form) @bp.route('/register/<token>', methods=['GET', 'POST']) @redirect_authenticated def register(token): form = RegistrationForm() email = get_email_from_token(token) if bool(User.query.filter_by(email=email).first()): offer_to_log_in(email) return redirect(url_for('main.index')) form.email.data = email if form.validate_on_submit(): new_user = User( email=email, first_name=form.first_name.data, last_name=form.last_name.data, is_admin=True if email == current_app.config['ADMIN_EMAIL'] else False ) new_user.set_password(form.password.data) print(f'{new_user.is_admin:=}') db.session.add(new_user) db.session.commit() if not os.path.isdir(os.path.join(current_app.config['UPLOAD_PATH'], str(new_user.id))): os.mkdir(os.path.join(current_app.config['UPLOAD_PATH'], str(new_user.id))) flash('You can log in', 'success') return redirect(url_for('main.index')) return render_template('auth/register.html', form=form) @bp.route('/login', methods=['GET', 'POST']) def login(): form = LoginForm() if email := request.args.get('email'): form.email.data = email if form.validate_on_submit(): user = User.query.filter_by(email=form.email.data).first() if not user: flash(f'User with email {form.email.data} not registered', 'danger') return redirect(url_for('auth.signup')) elif not user.check_password(form.password.data): flash('Wrong password', 'danger') return redirect(url_for('main.index')) else: login_user(user, remember=form.remember_me.data) flash(f'Hi, {user.first_name}!', 'success') return redirect(url_for('main.index')) return render_template('auth/login.html', form=form) @bp.route('/log_out', methods=['GET', 'POST']) @login_required def log_out(): logout_user() flash('You are logged out', 'info') return redirect(url_for('main.index')) @bp.route('/reset_password', methods=['GET', 'POST']) def reset_password(): form = ResetPasswordForm() if current_user.is_authenticated: form.email.data = current_user.email form.email.render_kw = {'disabled': True} is_present = bool(User.query.filter_by(email=form.email.data).first()) if form.validate_on_submit(): if is_present: send_email(form.email.data, goal='reset') flash('To continue reset password, follow the link in the letter.', 'info') return redirect(url_for('main.index')) else: href = f"""<a href="{url_for('auth.signup', email=form.email.data)}" class="danger-link">Sign up</a>""" message = f"The email: {form.email.data} not founded. Please {href} or use correct email." flash(Markup(message), 'danger') return render_template('auth/signup.html', form=form) @bp.route('/new_password/<token>', methods=['GET', 'POST']) def new_password(token): form = NewPasswordForm() serializer = URLSafeTimedSerializer(current_app.config['SECRET_KEY']) email = serializer.loads(token, salt=current_app.config['SECURITY_PASSWORD_SALT']) form.email.data = email user = User.query.filter_by(email=email).first() if form.validate_on_submit(): user.set_password(form.password.data) db.session.commit() flash('Password was changed. You can log in', 'success') return redirect(url_for('main.index')) elif form.is_submitted(): return render_template('auth/new_password.html', form=form), 422 return render_template('auth/new_password.html', form=form) @bp.route('/user_page', methods=['GET', 'POST']) @login_required def user_page(): form = UserForm(obj=current_user) if form.validate_on_submit(): is_changed = False for field in 'email', 'first_name', 'last_name': if getattr(form, field).data is not getattr(current_user, field): setattr(current_user, field, getattr(form, field).data) is_changed = True if is_changed: db.session.commit() return render_template('auth/user_page.html', form=form)
true
true
f7262560c667d65265155dbba12d860d64d7e43a
1,450
py
Python
utils/prediction.py
catskillsresearch/xview2-catskills
5671cff323c8121c0ae251e360e454a1e8568f58
[ "BSD-3-Clause" ]
null
null
null
utils/prediction.py
catskillsresearch/xview2-catskills
5671cff323c8121c0ae251e360e454a1e8568f58
[ "BSD-3-Clause" ]
null
null
null
utils/prediction.py
catskillsresearch/xview2-catskills
5671cff323c8121c0ae251e360e454a1e8568f58
[ "BSD-3-Clause" ]
null
null
null
#!/home/catskills/anaconda3/envs/xview2/bin/python import glob, os from shutil import copyfile from tqdm import tqdm from subprocess import call from IPython.utils.path import ensure_dir_exists # os.environ["CUDA_VISIBLE_DEVICES"]="1" # second gpu VERSION=os.getenv('VERSION') PROJECT='xview2-catskills' USERDIR='/home/catskills/Desktop' CODEDIR=f'{USERDIR}/{PROJECT}' DATADIR=f'{USERDIR}/dataxv2' TESTDIR=f'{DATADIR}/test/images/' SUBMIT_DIR=f'{DATADIR}/{VERSION}_submit_001' MODEL_DIR=f'/home/catskills/Desktop/dataxv2/release/{VERSION}' LOCALIZATION_MODEL=f'{MODEL_DIR}/localization.hdf5' DAMAGE_MODEL=f'{MODEL_DIR}/classification.hdf5' ensure_dir_exists(SUBMIT_DIR) files = glob.glob(f'{TESTDIR}test_pre_*.png') for pre_png in tqdm(files): post_png = pre_png.replace('_pre_','_post_') image_id = pre_png.split('.')[0].split('/')[-1].split('_')[-1] out_damage_png = f'{SUBMIT_DIR}/test_damage_{image_id}_prediction.png' if os.path.isfile(out_damage_png): continue out_local_json = f'{SUBMIT_DIR}/test_localization_{image_id}_prediction.json' out_local_png = f'{SUBMIT_DIR}/test_localization_{image_id}_prediction.png' C=f'./inference.sh -x {CODEDIR} -i {pre_png} -p {post_png} -l {LOCALIZATION_MODEL} -c {DAMAGE_MODEL} -o {out_damage_png} -y' call(C, shell=True) if os.path.isfile(out_damage_png): copyfile(out_damage_png, out_local_png) else: print("PROCESS FAILED", image_id)
37.179487
128
0.743448
import glob, os from shutil import copyfile from tqdm import tqdm from subprocess import call from IPython.utils.path import ensure_dir_exists getenv('VERSION') PROJECT='xview2-catskills' USERDIR='/home/catskills/Desktop' CODEDIR=f'{USERDIR}/{PROJECT}' DATADIR=f'{USERDIR}/dataxv2' TESTDIR=f'{DATADIR}/test/images/' SUBMIT_DIR=f'{DATADIR}/{VERSION}_submit_001' MODEL_DIR=f'/home/catskills/Desktop/dataxv2/release/{VERSION}' LOCALIZATION_MODEL=f'{MODEL_DIR}/localization.hdf5' DAMAGE_MODEL=f'{MODEL_DIR}/classification.hdf5' ensure_dir_exists(SUBMIT_DIR) files = glob.glob(f'{TESTDIR}test_pre_*.png') for pre_png in tqdm(files): post_png = pre_png.replace('_pre_','_post_') image_id = pre_png.split('.')[0].split('/')[-1].split('_')[-1] out_damage_png = f'{SUBMIT_DIR}/test_damage_{image_id}_prediction.png' if os.path.isfile(out_damage_png): continue out_local_json = f'{SUBMIT_DIR}/test_localization_{image_id}_prediction.json' out_local_png = f'{SUBMIT_DIR}/test_localization_{image_id}_prediction.png' C=f'./inference.sh -x {CODEDIR} -i {pre_png} -p {post_png} -l {LOCALIZATION_MODEL} -c {DAMAGE_MODEL} -o {out_damage_png} -y' call(C, shell=True) if os.path.isfile(out_damage_png): copyfile(out_damage_png, out_local_png) else: print("PROCESS FAILED", image_id)
true
true
f726258904982674e78e973db19b6f500c57c842
7,783
py
Python
integration/python/integration_api/models/baas_sub_account_vo.py
sumit4-ttn/SDK
b3ae385e5415e47ac70abd0b3fdeeaeee9aa7cff
[ "Apache-2.0" ]
null
null
null
integration/python/integration_api/models/baas_sub_account_vo.py
sumit4-ttn/SDK
b3ae385e5415e47ac70abd0b3fdeeaeee9aa7cff
[ "Apache-2.0" ]
null
null
null
integration/python/integration_api/models/baas_sub_account_vo.py
sumit4-ttn/SDK
b3ae385e5415e47ac70abd0b3fdeeaeee9aa7cff
[ "Apache-2.0" ]
null
null
null
# coding: utf-8 """ Hydrogen Integration API The Hydrogen Integration API # noqa: E501 OpenAPI spec version: 1.2.1 Contact: info@hydrogenplatform.com Generated by: https://github.com/swagger-api/swagger-codegen.git """ import pprint import re # noqa: F401 import six class BaasSubAccountVO(object): """NOTE: This class is auto generated by the swagger code generator program. Do not edit the class manually. """ """ Attributes: swagger_types (dict): The key is attribute name and the value is attribute type. attribute_map (dict): The key is attribute name and the value is json key in definition. """ swagger_types = { 'account_number': 'str', 'account_status': 'str', 'message': 'str', 'nucleus_portfolio_id': 'str', 'status': 'str', 'vendor_name': 'object', 'vendor_response': 'object' } attribute_map = { 'account_number': 'account_number', 'account_status': 'account_status', 'message': 'message', 'nucleus_portfolio_id': 'nucleus_portfolio_id', 'status': 'status', 'vendor_name': 'vendor_name', 'vendor_response': 'vendor_response' } def __init__(self, account_number=None, account_status=None, message=None, nucleus_portfolio_id=None, status=None, vendor_name=None, vendor_response=None): # noqa: E501 """BaasSubAccountVO - a model defined in Swagger""" # noqa: E501 self._account_number = None self._account_status = None self._message = None self._nucleus_portfolio_id = None self._status = None self._vendor_name = None self._vendor_response = None self.discriminator = None if account_number is not None: self.account_number = account_number if account_status is not None: self.account_status = account_status if message is not None: self.message = message if nucleus_portfolio_id is not None: self.nucleus_portfolio_id = nucleus_portfolio_id if status is not None: self.status = status if vendor_name is not None: self.vendor_name = vendor_name if vendor_response is not None: self.vendor_response = vendor_response @property def account_number(self): """Gets the account_number of this BaasSubAccountVO. # noqa: E501 :return: The account_number of this BaasSubAccountVO. # noqa: E501 :rtype: str """ return self._account_number @account_number.setter def account_number(self, account_number): """Sets the account_number of this BaasSubAccountVO. :param account_number: The account_number of this BaasSubAccountVO. # noqa: E501 :type: str """ self._account_number = account_number @property def account_status(self): """Gets the account_status of this BaasSubAccountVO. # noqa: E501 :return: The account_status of this BaasSubAccountVO. # noqa: E501 :rtype: str """ return self._account_status @account_status.setter def account_status(self, account_status): """Sets the account_status of this BaasSubAccountVO. :param account_status: The account_status of this BaasSubAccountVO. # noqa: E501 :type: str """ self._account_status = account_status @property def message(self): """Gets the message of this BaasSubAccountVO. # noqa: E501 :return: The message of this BaasSubAccountVO. # noqa: E501 :rtype: str """ return self._message @message.setter def message(self, message): """Sets the message of this BaasSubAccountVO. :param message: The message of this BaasSubAccountVO. # noqa: E501 :type: str """ self._message = message @property def nucleus_portfolio_id(self): """Gets the nucleus_portfolio_id of this BaasSubAccountVO. # noqa: E501 :return: The nucleus_portfolio_id of this BaasSubAccountVO. # noqa: E501 :rtype: str """ return self._nucleus_portfolio_id @nucleus_portfolio_id.setter def nucleus_portfolio_id(self, nucleus_portfolio_id): """Sets the nucleus_portfolio_id of this BaasSubAccountVO. :param nucleus_portfolio_id: The nucleus_portfolio_id of this BaasSubAccountVO. # noqa: E501 :type: str """ self._nucleus_portfolio_id = nucleus_portfolio_id @property def status(self): """Gets the status of this BaasSubAccountVO. # noqa: E501 :return: The status of this BaasSubAccountVO. # noqa: E501 :rtype: str """ return self._status @status.setter def status(self, status): """Sets the status of this BaasSubAccountVO. :param status: The status of this BaasSubAccountVO. # noqa: E501 :type: str """ self._status = status @property def vendor_name(self): """Gets the vendor_name of this BaasSubAccountVO. # noqa: E501 :return: The vendor_name of this BaasSubAccountVO. # noqa: E501 :rtype: object """ return self._vendor_name @vendor_name.setter def vendor_name(self, vendor_name): """Sets the vendor_name of this BaasSubAccountVO. :param vendor_name: The vendor_name of this BaasSubAccountVO. # noqa: E501 :type: object """ self._vendor_name = vendor_name @property def vendor_response(self): """Gets the vendor_response of this BaasSubAccountVO. # noqa: E501 :return: The vendor_response of this BaasSubAccountVO. # noqa: E501 :rtype: object """ return self._vendor_response @vendor_response.setter def vendor_response(self, vendor_response): """Sets the vendor_response of this BaasSubAccountVO. :param vendor_response: The vendor_response of this BaasSubAccountVO. # noqa: E501 :type: object """ self._vendor_response = vendor_response def to_dict(self): """Returns the model properties as a dict""" result = {} for attr, _ in six.iteritems(self.swagger_types): value = getattr(self, attr) if isinstance(value, list): result[attr] = list(map( lambda x: x.to_dict() if hasattr(x, "to_dict") else x, value )) elif hasattr(value, "to_dict"): result[attr] = value.to_dict() elif isinstance(value, dict): result[attr] = dict(map( lambda item: (item[0], item[1].to_dict()) if hasattr(item[1], "to_dict") else item, value.items() )) else: result[attr] = value if issubclass(BaasSubAccountVO, dict): for key, value in self.items(): result[key] = value return result def to_str(self): """Returns the string representation of the model""" return pprint.pformat(self.to_dict()) def __repr__(self): """For `print` and `pprint`""" return self.to_str() def __eq__(self, other): """Returns true if both objects are equal""" if not isinstance(other, BaasSubAccountVO): return False return self.__dict__ == other.__dict__ def __ne__(self, other): """Returns true if both objects are not equal""" return not self == other
28.613971
173
0.608634
import pprint import re import six class BaasSubAccountVO(object): swagger_types = { 'account_number': 'str', 'account_status': 'str', 'message': 'str', 'nucleus_portfolio_id': 'str', 'status': 'str', 'vendor_name': 'object', 'vendor_response': 'object' } attribute_map = { 'account_number': 'account_number', 'account_status': 'account_status', 'message': 'message', 'nucleus_portfolio_id': 'nucleus_portfolio_id', 'status': 'status', 'vendor_name': 'vendor_name', 'vendor_response': 'vendor_response' } def __init__(self, account_number=None, account_status=None, message=None, nucleus_portfolio_id=None, status=None, vendor_name=None, vendor_response=None): self._account_number = None self._account_status = None self._message = None self._nucleus_portfolio_id = None self._status = None self._vendor_name = None self._vendor_response = None self.discriminator = None if account_number is not None: self.account_number = account_number if account_status is not None: self.account_status = account_status if message is not None: self.message = message if nucleus_portfolio_id is not None: self.nucleus_portfolio_id = nucleus_portfolio_id if status is not None: self.status = status if vendor_name is not None: self.vendor_name = vendor_name if vendor_response is not None: self.vendor_response = vendor_response @property def account_number(self): return self._account_number @account_number.setter def account_number(self, account_number): self._account_number = account_number @property def account_status(self): return self._account_status @account_status.setter def account_status(self, account_status): self._account_status = account_status @property def message(self): return self._message @message.setter def message(self, message): self._message = message @property def nucleus_portfolio_id(self): return self._nucleus_portfolio_id @nucleus_portfolio_id.setter def nucleus_portfolio_id(self, nucleus_portfolio_id): self._nucleus_portfolio_id = nucleus_portfolio_id @property def status(self): return self._status @status.setter def status(self, status): self._status = status @property def vendor_name(self): return self._vendor_name @vendor_name.setter def vendor_name(self, vendor_name): self._vendor_name = vendor_name @property def vendor_response(self): return self._vendor_response @vendor_response.setter def vendor_response(self, vendor_response): self._vendor_response = vendor_response def to_dict(self): result = {} for attr, _ in six.iteritems(self.swagger_types): value = getattr(self, attr) if isinstance(value, list): result[attr] = list(map( lambda x: x.to_dict() if hasattr(x, "to_dict") else x, value )) elif hasattr(value, "to_dict"): result[attr] = value.to_dict() elif isinstance(value, dict): result[attr] = dict(map( lambda item: (item[0], item[1].to_dict()) if hasattr(item[1], "to_dict") else item, value.items() )) else: result[attr] = value if issubclass(BaasSubAccountVO, dict): for key, value in self.items(): result[key] = value return result def to_str(self): return pprint.pformat(self.to_dict()) def __repr__(self): return self.to_str() def __eq__(self, other): if not isinstance(other, BaasSubAccountVO): return False return self.__dict__ == other.__dict__ def __ne__(self, other): return not self == other
true
true
f72627ba2a2e2ffe351a5d1e289253920619cb97
3,942
py
Python
utils.py
ChristophReich1996/Mode_Collapse
937ee8bf96510fbf4070fc7e14b78276ab036b8c
[ "MIT" ]
14
2020-06-22T12:56:10.000Z
2022-03-31T10:23:00.000Z
utils.py
ChristophReich1996/Mode_Collapse
937ee8bf96510fbf4070fc7e14b78276ab036b8c
[ "MIT" ]
null
null
null
utils.py
ChristophReich1996/Mode_Collapse
937ee8bf96510fbf4070fc7e14b78276ab036b8c
[ "MIT" ]
2
2022-01-21T01:22:23.000Z
2022-02-13T18:08:08.000Z
from typing import Optional import torch import torch.nn as nn from torch.nn.utils import spectral_norm import numpy as np def get_generator(latent_size: int, use_spectral_norm: bool) -> nn.Module: """ Returns the generator network. :param latent_size: (int) Size of the latent input vector :param use_spectral_norm: (bool) If true spectral norm is utilized :return: (nn.Module) Simple feed forward neural network with three layers, """ if use_spectral_norm: return nn.Sequential(spectral_norm(nn.Linear(latent_size, 256, bias=True)), nn.LeakyReLU(), spectral_norm(nn.Linear(256, 256, bias=True)), nn.LeakyReLU(), spectral_norm(nn.Linear(256, 256, bias=True)), nn.LeakyReLU(), spectral_norm(nn.Linear(256, 256, bias=True)), nn.Tanh(), spectral_norm(nn.Linear(256, 2, bias=True))) return nn.Sequential(nn.Linear(latent_size, 256, bias=True), nn.LeakyReLU(), nn.Linear(256, 256, bias=True), nn.LeakyReLU(), nn.Linear(256, 256, bias=True), nn.LeakyReLU(), nn.Linear(256, 256, bias=True), nn.Tanh(), nn.Linear(256, 2, bias=True)) def get_discriminator(use_spectral_norm: bool) -> nn.Module: """ Returns the discriminator network. :param use_spectral_norm: (bool) If true spectral norm is utilized :return: (nn.Module) Simple feed forward neural network with three layers and probability output. """ if use_spectral_norm: return nn.Sequential(spectral_norm(nn.Linear(2, 256, bias=True)), nn.LeakyReLU(), spectral_norm(nn.Linear(256, 256, bias=True)), nn.LeakyReLU(), spectral_norm(nn.Linear(256, 256, bias=True)), nn.LeakyReLU(), spectral_norm(nn.Linear(256, 256, bias=True)), nn.LeakyReLU(), spectral_norm(nn.Linear(256, 1, bias=True))) return nn.Sequential(nn.Linear(2, 256, bias=True), nn.LeakyReLU(), nn.Linear(256, 256, bias=True), nn.LeakyReLU(), nn.Linear(256, 256, bias=True), nn.LeakyReLU(), nn.Linear(256, 256, bias=True), nn.LeakyReLU(), nn.Linear(256, 1, bias=True)) def get_data(samples: Optional[int] = 400, variance: Optional[float] = 0.05) -> torch.Tensor: """ Function generates a 2d ring of 8 Gaussians :param samples: (Optional[int]) Number of samples including in the resulting dataset. Must be a multiple of 8. :param variance: (Optional[float]) Variance of the gaussian :return: (torch.Tensor) generated data """ assert samples % 8 == 0 and samples > 0, "Number of samples must be a multiple of 8 and bigger than 0" # Init angels of the means angels = torch.cumsum((2 * np.pi / 8) * torch.ones((8)), dim=0) # Convert angles to 2D coordinates means = torch.stack([torch.cos(angels), torch.sin(angels)], dim=0) # Generate data data = torch.empty((2, samples)) counter = 0 for gaussian in range(means.shape[1]): for sample in range(int(samples / 8)): data[:, counter] = torch.normal(means[:, gaussian], variance) counter += 1 # Reshape data data = data.T # Shuffle data data = data[torch.randperm(data.shape[0])] # Convert numpy array to tensor return data.float()
44.292135
114
0.540081
from typing import Optional import torch import torch.nn as nn from torch.nn.utils import spectral_norm import numpy as np def get_generator(latent_size: int, use_spectral_norm: bool) -> nn.Module: if use_spectral_norm: return nn.Sequential(spectral_norm(nn.Linear(latent_size, 256, bias=True)), nn.LeakyReLU(), spectral_norm(nn.Linear(256, 256, bias=True)), nn.LeakyReLU(), spectral_norm(nn.Linear(256, 256, bias=True)), nn.LeakyReLU(), spectral_norm(nn.Linear(256, 256, bias=True)), nn.Tanh(), spectral_norm(nn.Linear(256, 2, bias=True))) return nn.Sequential(nn.Linear(latent_size, 256, bias=True), nn.LeakyReLU(), nn.Linear(256, 256, bias=True), nn.LeakyReLU(), nn.Linear(256, 256, bias=True), nn.LeakyReLU(), nn.Linear(256, 256, bias=True), nn.Tanh(), nn.Linear(256, 2, bias=True)) def get_discriminator(use_spectral_norm: bool) -> nn.Module: if use_spectral_norm: return nn.Sequential(spectral_norm(nn.Linear(2, 256, bias=True)), nn.LeakyReLU(), spectral_norm(nn.Linear(256, 256, bias=True)), nn.LeakyReLU(), spectral_norm(nn.Linear(256, 256, bias=True)), nn.LeakyReLU(), spectral_norm(nn.Linear(256, 256, bias=True)), nn.LeakyReLU(), spectral_norm(nn.Linear(256, 1, bias=True))) return nn.Sequential(nn.Linear(2, 256, bias=True), nn.LeakyReLU(), nn.Linear(256, 256, bias=True), nn.LeakyReLU(), nn.Linear(256, 256, bias=True), nn.LeakyReLU(), nn.Linear(256, 256, bias=True), nn.LeakyReLU(), nn.Linear(256, 1, bias=True)) def get_data(samples: Optional[int] = 400, variance: Optional[float] = 0.05) -> torch.Tensor: assert samples % 8 == 0 and samples > 0, "Number of samples must be a multiple of 8 and bigger than 0" angels = torch.cumsum((2 * np.pi / 8) * torch.ones((8)), dim=0) means = torch.stack([torch.cos(angels), torch.sin(angels)], dim=0) data = torch.empty((2, samples)) counter = 0 for gaussian in range(means.shape[1]): for sample in range(int(samples / 8)): data[:, counter] = torch.normal(means[:, gaussian], variance) counter += 1 data = data.T data = data[torch.randperm(data.shape[0])] return data.float()
true
true
f72627c561e2ac89a391788cfaf08f88db3539eb
585
py
Python
rgr/__init__.py
Faxn/rgr
656f4795bfbb5ca6bf7f9dd6c8e043a3242cd331
[ "BSD-2-Clause" ]
null
null
null
rgr/__init__.py
Faxn/rgr
656f4795bfbb5ca6bf7f9dd6c8e043a3242cd331
[ "BSD-2-Clause" ]
null
null
null
rgr/__init__.py
Faxn/rgr
656f4795bfbb5ca6bf7f9dd6c8e043a3242cd331
[ "BSD-2-Clause" ]
null
null
null
from . import lexer from .parseRoll import parser def roll(expression : str): "Runs the dice expression provided and returns long form result" try: tree = parser.parse(expression) result, hist = tree.roll() except Exception as E: return str(E) return result, hist, tree def compile(expression : str): tree = parser.parse(expression) return tree try: from .rgrcog import RGR def setup(bot): bot.add_cog(RGR(bot)) except ModuleNotFoundError as e: def setup(bot): raise Exception(str(e), e) pass
19.5
68
0.642735
from . import lexer from .parseRoll import parser def roll(expression : str): try: tree = parser.parse(expression) result, hist = tree.roll() except Exception as E: return str(E) return result, hist, tree def compile(expression : str): tree = parser.parse(expression) return tree try: from .rgrcog import RGR def setup(bot): bot.add_cog(RGR(bot)) except ModuleNotFoundError as e: def setup(bot): raise Exception(str(e), e) pass
true
true
f726282d7144fcaa8467eabd6470b58a1158a9e7
374
py
Python
projects/intruder_detection/main.py
henriwoodcock/developer
7ddd7f0b56564c0c13d5505c16b6f89c0c29886a
[ "CC-BY-4.0" ]
null
null
null
projects/intruder_detection/main.py
henriwoodcock/developer
7ddd7f0b56564c0c13d5505c16b6f89c0c29886a
[ "CC-BY-4.0" ]
null
null
null
projects/intruder_detection/main.py
henriwoodcock/developer
7ddd7f0b56564c0c13d5505c16b6f89c0c29886a
[ "CC-BY-4.0" ]
null
null
null
from machine import Pin, Timer def check_sensor(timer): global sensor if sensor.value() == 1: gp1.value(1) else: gp1.value(0) #GP4 - 5v output gp4 = Pin(4,Pin.OUT) gp4.value(1) #GP1 - output for LED gp1= Pin(1,Pin.OUT) #GP5 - input from sensor sensor = Pin(5,Pin.IN) tim = Timer() tim.init(freq=1.5, mode=Timer.PERIODIC, callback=check_sensor)
19.684211
62
0.65508
from machine import Pin, Timer def check_sensor(timer): global sensor if sensor.value() == 1: gp1.value(1) else: gp1.value(0) gp4 = Pin(4,Pin.OUT) gp4.value(1) gp1= Pin(1,Pin.OUT) sensor = Pin(5,Pin.IN) tim = Timer() tim.init(freq=1.5, mode=Timer.PERIODIC, callback=check_sensor)
true
true
f72629c9f8acea66ab3447479454246371b49923
1,440
py
Python
src/view/SqliteKeywords.py
struts2spring/sql-editor
082868dd92cbd8f0f6715f734f9ebe64032cbe4a
[ "MIT" ]
9
2018-10-15T04:57:37.000Z
2021-12-07T07:39:35.000Z
src/view/SqliteKeywords.py
struts2spring/sql-editor
082868dd92cbd8f0f6715f734f9ebe64032cbe4a
[ "MIT" ]
13
2018-10-19T11:52:44.000Z
2021-09-08T00:39:30.000Z
src/view/SqliteKeywords.py
struts2spring/sql-editor
082868dd92cbd8f0f6715f734f9ebe64032cbe4a
[ "MIT" ]
3
2018-10-25T11:08:04.000Z
2021-02-23T08:28:31.000Z
''' Created on 04-Feb-2017 @author: vijay ''' keyword = [ 'ABORT' , 'ACTION' , 'ADD' , 'AFTER' , 'ALL' , 'ALTER' , 'ANALYZE' , 'AND' , 'AS' , 'ASC' , 'ATTACH' , 'AUTOINCREMENT' , 'BEFORE' , 'BEGIN' , 'BETWEEN' , 'BY' , 'CASCADE' , 'CASE' , 'CAST' , 'CHECK' , 'COLLATE' , 'COLUMN' , 'COMMIT' , 'CONFLICT' , 'CONSTRAINT' , 'CREATE' , 'CROSS' , 'CURRENT_DATE' , 'CURRENT_TIME' , 'CURRENT_TIMESTAMP' , 'DATABASE' , 'DEFAULT' , 'DEFERRABLE' , 'DEFERRED' , 'DELETE' , 'DESC' , 'DETACH' , 'DISTINCT' , 'DROP' , 'EACH' , 'ELSE' , 'END' , 'ESCAPE' , 'EXCEPT' , 'EXCLUSIVE' , 'EXISTS' , 'EXPLAIN' , 'FAIL' , 'FOR' , 'FOREIGN' , 'FROM' , 'FULL' , 'GLOB' , 'GROUP' , 'HAVING' , 'IF' , 'IGNORE' , 'IMMEDIATE' , 'IN' , 'INDEX' , 'INDEXED' , 'INITIALLY' , 'INNER' , 'INSERT' , 'INSTEAD' , 'INTERSECT' , 'INTO' , 'IS' , 'ISNULL' , 'JOIN' , 'KEY' , 'LEFT' , 'LIKE' , 'LIMIT' , 'MATCH' , 'NATURAL' , 'NO' , 'NOT' , 'NOTNULL' , 'NULL' , 'OF' , 'OFFSET' , 'OR' , 'ORDER' , 'OUTER' , 'PLAN' , 'PRAGMA' , 'PRIMARY' , 'QUERY' , 'RAISE' , 'RECURSIVE' , 'REFERENCES' , 'REGEXP' , 'REINDEX' , 'RELEASE' , 'RENAME' , 'REPLACE' , 'RESTRICT' , 'RIGHT' , 'ROLLBACK' , 'ROW' , 'SAVEPOINT' , 'SELECT' , 'SET' , 'TABLE' , 'TEMP' , 'TEMPORARY' , 'THEN' , 'TO' , 'TRANSACTION' , 'TRIGGER' , 'UNION' , 'UNIQUE' , 'UPDATE' , 'USING' , 'VACUUM' , 'VALUES' , 'VIEW' , 'VIRTUAL' , 'WHEN' , 'WHERE' , 'WITH' , 'WITHOUT' ] if __name__ == '__main__': pass
10.510949
26
0.531944
keyword = [ 'ABORT' , 'ACTION' , 'ADD' , 'AFTER' , 'ALL' , 'ALTER' , 'ANALYZE' , 'AND' , 'AS' , 'ASC' , 'ATTACH' , 'AUTOINCREMENT' , 'BEFORE' , 'BEGIN' , 'BETWEEN' , 'BY' , 'CASCADE' , 'CASE' , 'CAST' , 'CHECK' , 'COLLATE' , 'COLUMN' , 'COMMIT' , 'CONFLICT' , 'CONSTRAINT' , 'CREATE' , 'CROSS' , 'CURRENT_DATE' , 'CURRENT_TIME' , 'CURRENT_TIMESTAMP' , 'DATABASE' , 'DEFAULT' , 'DEFERRABLE' , 'DEFERRED' , 'DELETE' , 'DESC' , 'DETACH' , 'DISTINCT' , 'DROP' , 'EACH' , 'ELSE' , 'END' , 'ESCAPE' , 'EXCEPT' , 'EXCLUSIVE' , 'EXISTS' , 'EXPLAIN' , 'FAIL' , 'FOR' , 'FOREIGN' , 'FROM' , 'FULL' , 'GLOB' , 'GROUP' , 'HAVING' , 'IF' , 'IGNORE' , 'IMMEDIATE' , 'IN' , 'INDEX' , 'INDEXED' , 'INITIALLY' , 'INNER' , 'INSERT' , 'INSTEAD' , 'INTERSECT' , 'INTO' , 'IS' , 'ISNULL' , 'JOIN' , 'KEY' , 'LEFT' , 'LIKE' , 'LIMIT' , 'MATCH' , 'NATURAL' , 'NO' , 'NOT' , 'NOTNULL' , 'NULL' , 'OF' , 'OFFSET' , 'OR' , 'ORDER' , 'OUTER' , 'PLAN' , 'PRAGMA' , 'PRIMARY' , 'QUERY' , 'RAISE' , 'RECURSIVE' , 'REFERENCES' , 'REGEXP' , 'REINDEX' , 'RELEASE' , 'RENAME' , 'REPLACE' , 'RESTRICT' , 'RIGHT' , 'ROLLBACK' , 'ROW' , 'SAVEPOINT' , 'SELECT' , 'SET' , 'TABLE' , 'TEMP' , 'TEMPORARY' , 'THEN' , 'TO' , 'TRANSACTION' , 'TRIGGER' , 'UNION' , 'UNIQUE' , 'UPDATE' , 'USING' , 'VACUUM' , 'VALUES' , 'VIEW' , 'VIRTUAL' , 'WHEN' , 'WHERE' , 'WITH' , 'WITHOUT' ] if __name__ == '__main__': pass
true
true
f72629d7ccf97ec969ccabc9f97fbd9dea75c8a0
2,228
py
Python
symbols/symbol_ssdh.py
galad-loth/LearnDescriptor
30552a699597415a13793eb85d21b5e33a296a99
[ "Apache-2.0" ]
100
2018-02-06T10:47:43.000Z
2022-02-16T01:11:30.000Z
symbols/symbol_ssdh.py
JiaxueLi/DeepMatch
30552a699597415a13793eb85d21b5e33a296a99
[ "Apache-2.0" ]
2
2019-07-24T17:22:37.000Z
2020-03-19T04:11:47.000Z
symbols/symbol_ssdh.py
JiaxueLi/DeepMatch
30552a699597415a13793eb85d21b5e33a296a99
[ "Apache-2.0" ]
21
2018-11-11T06:35:43.000Z
2020-11-25T07:52:20.000Z
# -*- coding: utf-8 -*- """ Created on Tue Mar 07 21:00:11 2017 @author: galad-loth """ import numpy as npy import mxnet as mx class HashLossLayer(mx.operator.NumpyOp): def __init__(self, w_bin,w_balance): super(HashLossLayer, self).__init__(False) self.w_bin=w_bin self.w_balance=w_balance def list_arguments(self): return ['data'] def list_outputs(self): return ['output'] def infer_shape(self, in_shape): data_shape=in_shape[0] return [data_shape],[data_shape] def forward(self, in_data, out_data): x=in_data[0] # l=in_data[1] y=out_data[0] xs=x-0.5 y[:]=1 y[xs<0]=0 # y[:]=npy.ones((x.shape[0],1))-l.reshape((x.shape[0],1))*x def backward(self, out_grad, in_data, out_data, in_grad): x=in_data[0] dx=in_grad[0] grad1=-2*(x-0.5)/x.shape[1] mu=npy.mean(x,axis=1) grad2=2*(mu-0.5)/x.shape[1] grad=self.w_bin*grad1+self.w_balance*grad2 dx[:]=grad def get_finetune_symbol(net_pre,arg_params, num_latent, num_class,layer_name='flatten'): """ net_pre: the pre-trained network symbol arg_params: the argument parameters of the pre-trained model num_latent: the number of latent layer units for the fine-tune datasets layer_name: the layer name before the last fully-connected layer """ all_layers = net_pre.get_internals() load_net = all_layers[layer_name+'_output'] latent = mx.symbol.FullyConnected(data=load_net, num_hidden=num_latent, name='latent_ssdh') latent = mx.sym.Activation(data=latent, act_type="sigmoid", name="sigmoid_ssdh") class_net = mx.symbol.FullyConnected(data=latent, num_hidden=num_class, name='fc_ssdh') class_net = mx.symbol.SoftmaxOutput(data=class_net, name='softmax') hash_loss=HashLossLayer(0.1,0.1) hash_net=hash_loss(data=latent, name="hash") net = mx.sym.Group([class_net,hash_net]) new_args = dict({k:arg_params[k] for k in arg_params if 'fc' not in k}) return (net, new_args)
33.757576
96
0.612208
import numpy as npy import mxnet as mx class HashLossLayer(mx.operator.NumpyOp): def __init__(self, w_bin,w_balance): super(HashLossLayer, self).__init__(False) self.w_bin=w_bin self.w_balance=w_balance def list_arguments(self): return ['data'] def list_outputs(self): return ['output'] def infer_shape(self, in_shape): data_shape=in_shape[0] return [data_shape],[data_shape] def forward(self, in_data, out_data): x=in_data[0] y=out_data[0] xs=x-0.5 y[:]=1 y[xs<0]=0 def backward(self, out_grad, in_data, out_data, in_grad): x=in_data[0] dx=in_grad[0] grad1=-2*(x-0.5)/x.shape[1] mu=npy.mean(x,axis=1) grad2=2*(mu-0.5)/x.shape[1] grad=self.w_bin*grad1+self.w_balance*grad2 dx[:]=grad def get_finetune_symbol(net_pre,arg_params, num_latent, num_class,layer_name='flatten'): all_layers = net_pre.get_internals() load_net = all_layers[layer_name+'_output'] latent = mx.symbol.FullyConnected(data=load_net, num_hidden=num_latent, name='latent_ssdh') latent = mx.sym.Activation(data=latent, act_type="sigmoid", name="sigmoid_ssdh") class_net = mx.symbol.FullyConnected(data=latent, num_hidden=num_class, name='fc_ssdh') class_net = mx.symbol.SoftmaxOutput(data=class_net, name='softmax') hash_loss=HashLossLayer(0.1,0.1) hash_net=hash_loss(data=latent, name="hash") net = mx.sym.Group([class_net,hash_net]) new_args = dict({k:arg_params[k] for k in arg_params if 'fc' not in k}) return (net, new_args)
true
true
f72629ddc71a4e57e29e2e43fc86db58df8c4de3
23,900
py
Python
plotly_study/graph_objs/layout/ternary/aaxis/__init__.py
lucasiscovici/plotly_py
42ab769febb45fbbe0a3c677dc4306a4f59cea36
[ "MIT" ]
null
null
null
plotly_study/graph_objs/layout/ternary/aaxis/__init__.py
lucasiscovici/plotly_py
42ab769febb45fbbe0a3c677dc4306a4f59cea36
[ "MIT" ]
null
null
null
plotly_study/graph_objs/layout/ternary/aaxis/__init__.py
lucasiscovici/plotly_py
42ab769febb45fbbe0a3c677dc4306a4f59cea36
[ "MIT" ]
null
null
null
from plotly_study.basedatatypes import BaseLayoutHierarchyType as _BaseLayoutHierarchyType import copy as _copy class Title(_BaseLayoutHierarchyType): # font # ---- @property def font(self): """ Sets this axis' title font. Note that the title's font used to be customized by the now deprecated `titlefont` attribute. The 'font' property is an instance of Font that may be specified as: - An instance of plotly_study.graph_objs.layout.ternary.aaxis.title.Font - A dict of string/value properties that will be passed to the Font constructor Supported dict properties: color family HTML font family - the typeface that will be applied by the web browser. The web browser will only be able to apply a font if it is available on the system which it operates. Provide multiple font families, separated by commas, to indicate the preference in which to apply fonts if they aren't available on the system. The plotly service (at https://plot.ly or on-premise) generates images on a server, where only a select number of fonts are installed and supported. These include "Arial", "Balto", "Courier New", "Droid Sans",, "Droid Serif", "Droid Sans Mono", "Gravitas One", "Old Standard TT", "Open Sans", "Overpass", "PT Sans Narrow", "Raleway", "Times New Roman". size Returns ------- plotly_study.graph_objs.layout.ternary.aaxis.title.Font """ return self["font"] @font.setter def font(self, val): self["font"] = val # text # ---- @property def text(self): """ Sets the title of this axis. Note that before the existence of `title.text`, the title's contents used to be defined as the `title` attribute itself. This behavior has been deprecated. The 'text' property is a string and must be specified as: - A string - A number that will be converted to a string Returns ------- str """ return self["text"] @text.setter def text(self, val): self["text"] = val # property parent name # -------------------- @property def _parent_path_str(self): return "layout.ternary.aaxis" # Self properties description # --------------------------- @property def _prop_descriptions(self): return """\ font Sets this axis' title font. Note that the title's font used to be customized by the now deprecated `titlefont` attribute. text Sets the title of this axis. Note that before the existence of `title.text`, the title's contents used to be defined as the `title` attribute itself. This behavior has been deprecated. """ def __init__(self, arg=None, font=None, text=None, **kwargs): """ Construct a new Title object Parameters ---------- arg dict of properties compatible with this constructor or an instance of plotly_study.graph_objs.layout.ternary.aaxis.Title font Sets this axis' title font. Note that the title's font used to be customized by the now deprecated `titlefont` attribute. text Sets the title of this axis. Note that before the existence of `title.text`, the title's contents used to be defined as the `title` attribute itself. This behavior has been deprecated. Returns ------- Title """ super(Title, self).__init__("title") # Validate arg # ------------ if arg is None: arg = {} elif isinstance(arg, self.__class__): arg = arg.to_plotly_json() elif isinstance(arg, dict): arg = _copy.copy(arg) else: raise ValueError( """\ The first argument to the plotly_study.graph_objs.layout.ternary.aaxis.Title constructor must be a dict or an instance of plotly_study.graph_objs.layout.ternary.aaxis.Title""" ) # Handle skip_invalid # ------------------- self._skip_invalid = kwargs.pop("skip_invalid", False) # Import validators # ----------------- from plotly_study.validators.layout.ternary.aaxis import title as v_title # Initialize validators # --------------------- self._validators["font"] = v_title.FontValidator() self._validators["text"] = v_title.TextValidator() # Populate data dict with properties # ---------------------------------- _v = arg.pop("font", None) self["font"] = font if font is not None else _v _v = arg.pop("text", None) self["text"] = text if text is not None else _v # Process unknown kwargs # ---------------------- self._process_kwargs(**dict(arg, **kwargs)) # Reset skip_invalid # ------------------ self._skip_invalid = False from plotly_study.basedatatypes import BaseLayoutHierarchyType as _BaseLayoutHierarchyType import copy as _copy class Tickformatstop(_BaseLayoutHierarchyType): # dtickrange # ---------- @property def dtickrange(self): """ range [*min*, *max*], where "min", "max" - dtick values which describe some zoom level, it is possible to omit "min" or "max" value by passing "null" The 'dtickrange' property is an info array that may be specified as: * a list or tuple of 2 elements where: (0) The 'dtickrange[0]' property accepts values of any type (1) The 'dtickrange[1]' property accepts values of any type Returns ------- list """ return self["dtickrange"] @dtickrange.setter def dtickrange(self, val): self["dtickrange"] = val # enabled # ------- @property def enabled(self): """ Determines whether or not this stop is used. If `false`, this stop is ignored even within its `dtickrange`. The 'enabled' property must be specified as a bool (either True, or False) Returns ------- bool """ return self["enabled"] @enabled.setter def enabled(self, val): self["enabled"] = val # name # ---- @property def name(self): """ When used in a template, named items are created in the output figure in addition to any items the figure already has in this array. You can modify these items in the output figure by making your own item with `templateitemname` matching this `name` alongside your modifications (including `visible: false` or `enabled: false` to hide it). Has no effect outside of a template. The 'name' property is a string and must be specified as: - A string - A number that will be converted to a string Returns ------- str """ return self["name"] @name.setter def name(self, val): self["name"] = val # templateitemname # ---------------- @property def templateitemname(self): """ Used to refer to a named item in this array in the template. Named items from the template will be created even without a matching item in the input figure, but you can modify one by making an item with `templateitemname` matching its `name`, alongside your modifications (including `visible: false` or `enabled: false` to hide it). If there is no template or no matching item, this item will be hidden unless you explicitly show it with `visible: true`. The 'templateitemname' property is a string and must be specified as: - A string - A number that will be converted to a string Returns ------- str """ return self["templateitemname"] @templateitemname.setter def templateitemname(self, val): self["templateitemname"] = val # value # ----- @property def value(self): """ string - dtickformat for described zoom level, the same as "tickformat" The 'value' property is a string and must be specified as: - A string - A number that will be converted to a string Returns ------- str """ return self["value"] @value.setter def value(self, val): self["value"] = val # property parent name # -------------------- @property def _parent_path_str(self): return "layout.ternary.aaxis" # Self properties description # --------------------------- @property def _prop_descriptions(self): return """\ dtickrange range [*min*, *max*], where "min", "max" - dtick values which describe some zoom level, it is possible to omit "min" or "max" value by passing "null" enabled Determines whether or not this stop is used. If `false`, this stop is ignored even within its `dtickrange`. name When used in a template, named items are created in the output figure in addition to any items the figure already has in this array. You can modify these items in the output figure by making your own item with `templateitemname` matching this `name` alongside your modifications (including `visible: false` or `enabled: false` to hide it). Has no effect outside of a template. templateitemname Used to refer to a named item in this array in the template. Named items from the template will be created even without a matching item in the input figure, but you can modify one by making an item with `templateitemname` matching its `name`, alongside your modifications (including `visible: false` or `enabled: false` to hide it). If there is no template or no matching item, this item will be hidden unless you explicitly show it with `visible: true`. value string - dtickformat for described zoom level, the same as "tickformat" """ def __init__( self, arg=None, dtickrange=None, enabled=None, name=None, templateitemname=None, value=None, **kwargs ): """ Construct a new Tickformatstop object Parameters ---------- arg dict of properties compatible with this constructor or an instance of plotly_study.graph_objs.layout.ternary.aaxis.Tickformatstop dtickrange range [*min*, *max*], where "min", "max" - dtick values which describe some zoom level, it is possible to omit "min" or "max" value by passing "null" enabled Determines whether or not this stop is used. If `false`, this stop is ignored even within its `dtickrange`. name When used in a template, named items are created in the output figure in addition to any items the figure already has in this array. You can modify these items in the output figure by making your own item with `templateitemname` matching this `name` alongside your modifications (including `visible: false` or `enabled: false` to hide it). Has no effect outside of a template. templateitemname Used to refer to a named item in this array in the template. Named items from the template will be created even without a matching item in the input figure, but you can modify one by making an item with `templateitemname` matching its `name`, alongside your modifications (including `visible: false` or `enabled: false` to hide it). If there is no template or no matching item, this item will be hidden unless you explicitly show it with `visible: true`. value string - dtickformat for described zoom level, the same as "tickformat" Returns ------- Tickformatstop """ super(Tickformatstop, self).__init__("tickformatstops") # Validate arg # ------------ if arg is None: arg = {} elif isinstance(arg, self.__class__): arg = arg.to_plotly_json() elif isinstance(arg, dict): arg = _copy.copy(arg) else: raise ValueError( """\ The first argument to the plotly_study.graph_objs.layout.ternary.aaxis.Tickformatstop constructor must be a dict or an instance of plotly_study.graph_objs.layout.ternary.aaxis.Tickformatstop""" ) # Handle skip_invalid # ------------------- self._skip_invalid = kwargs.pop("skip_invalid", False) # Import validators # ----------------- from plotly_study.validators.layout.ternary.aaxis import ( tickformatstop as v_tickformatstop, ) # Initialize validators # --------------------- self._validators["dtickrange"] = v_tickformatstop.DtickrangeValidator() self._validators["enabled"] = v_tickformatstop.EnabledValidator() self._validators["name"] = v_tickformatstop.NameValidator() self._validators[ "templateitemname" ] = v_tickformatstop.TemplateitemnameValidator() self._validators["value"] = v_tickformatstop.ValueValidator() # Populate data dict with properties # ---------------------------------- _v = arg.pop("dtickrange", None) self["dtickrange"] = dtickrange if dtickrange is not None else _v _v = arg.pop("enabled", None) self["enabled"] = enabled if enabled is not None else _v _v = arg.pop("name", None) self["name"] = name if name is not None else _v _v = arg.pop("templateitemname", None) self["templateitemname"] = ( templateitemname if templateitemname is not None else _v ) _v = arg.pop("value", None) self["value"] = value if value is not None else _v # Process unknown kwargs # ---------------------- self._process_kwargs(**dict(arg, **kwargs)) # Reset skip_invalid # ------------------ self._skip_invalid = False from plotly_study.basedatatypes import BaseLayoutHierarchyType as _BaseLayoutHierarchyType import copy as _copy class Tickfont(_BaseLayoutHierarchyType): # color # ----- @property def color(self): """ The 'color' property is a color and may be specified as: - A hex string (e.g. '#ff0000') - An rgb/rgba string (e.g. 'rgb(255,0,0)') - An hsl/hsla string (e.g. 'hsl(0,100%,50%)') - An hsv/hsva string (e.g. 'hsv(0,100%,100%)') - A named CSS color: aliceblue, antiquewhite, aqua, aquamarine, azure, beige, bisque, black, blanchedalmond, blue, blueviolet, brown, burlywood, cadetblue, chartreuse, chocolate, coral, cornflowerblue, cornsilk, crimson, cyan, darkblue, darkcyan, darkgoldenrod, darkgray, darkgrey, darkgreen, darkkhaki, darkmagenta, darkolivegreen, darkorange, darkorchid, darkred, darksalmon, darkseagreen, darkslateblue, darkslategray, darkslategrey, darkturquoise, darkviolet, deeppink, deepskyblue, dimgray, dimgrey, dodgerblue, firebrick, floralwhite, forestgreen, fuchsia, gainsboro, ghostwhite, gold, goldenrod, gray, grey, green, greenyellow, honeydew, hotpink, indianred, indigo, ivory, khaki, lavender, lavenderblush, lawngreen, lemonchiffon, lightblue, lightcoral, lightcyan, lightgoldenrodyellow, lightgray, lightgrey, lightgreen, lightpink, lightsalmon, lightseagreen, lightskyblue, lightslategray, lightslategrey, lightsteelblue, lightyellow, lime, limegreen, linen, magenta, maroon, mediumaquamarine, mediumblue, mediumorchid, mediumpurple, mediumseagreen, mediumslateblue, mediumspringgreen, mediumturquoise, mediumvioletred, midnightblue, mintcream, mistyrose, moccasin, navajowhite, navy, oldlace, olive, olivedrab, orange, orangered, orchid, palegoldenrod, palegreen, paleturquoise, palevioletred, papayawhip, peachpuff, peru, pink, plum, powderblue, purple, red, rosybrown, royalblue, rebeccapurple, saddlebrown, salmon, sandybrown, seagreen, seashell, sienna, silver, skyblue, slateblue, slategray, slategrey, snow, springgreen, steelblue, tan, teal, thistle, tomato, turquoise, violet, wheat, white, whitesmoke, yellow, yellowgreen Returns ------- str """ return self["color"] @color.setter def color(self, val): self["color"] = val # family # ------ @property def family(self): """ HTML font family - the typeface that will be applied by the web browser. The web browser will only be able to apply a font if it is available on the system which it operates. Provide multiple font families, separated by commas, to indicate the preference in which to apply fonts if they aren't available on the system. The plotly service (at https://plot.ly or on- premise) generates images on a server, where only a select number of fonts are installed and supported. These include "Arial", "Balto", "Courier New", "Droid Sans",, "Droid Serif", "Droid Sans Mono", "Gravitas One", "Old Standard TT", "Open Sans", "Overpass", "PT Sans Narrow", "Raleway", "Times New Roman". The 'family' property is a string and must be specified as: - A non-empty string Returns ------- str """ return self["family"] @family.setter def family(self, val): self["family"] = val # size # ---- @property def size(self): """ The 'size' property is a number and may be specified as: - An int or float in the interval [1, inf] Returns ------- int|float """ return self["size"] @size.setter def size(self, val): self["size"] = val # property parent name # -------------------- @property def _parent_path_str(self): return "layout.ternary.aaxis" # Self properties description # --------------------------- @property def _prop_descriptions(self): return """\ color family HTML font family - the typeface that will be applied by the web browser. The web browser will only be able to apply a font if it is available on the system which it operates. Provide multiple font families, separated by commas, to indicate the preference in which to apply fonts if they aren't available on the system. The plotly service (at https://plot.ly or on-premise) generates images on a server, where only a select number of fonts are installed and supported. These include "Arial", "Balto", "Courier New", "Droid Sans",, "Droid Serif", "Droid Sans Mono", "Gravitas One", "Old Standard TT", "Open Sans", "Overpass", "PT Sans Narrow", "Raleway", "Times New Roman". size """ def __init__(self, arg=None, color=None, family=None, size=None, **kwargs): """ Construct a new Tickfont object Sets the tick font. Parameters ---------- arg dict of properties compatible with this constructor or an instance of plotly_study.graph_objs.layout.ternary.aaxis.Tickfont color family HTML font family - the typeface that will be applied by the web browser. The web browser will only be able to apply a font if it is available on the system which it operates. Provide multiple font families, separated by commas, to indicate the preference in which to apply fonts if they aren't available on the system. The plotly service (at https://plot.ly or on-premise) generates images on a server, where only a select number of fonts are installed and supported. These include "Arial", "Balto", "Courier New", "Droid Sans",, "Droid Serif", "Droid Sans Mono", "Gravitas One", "Old Standard TT", "Open Sans", "Overpass", "PT Sans Narrow", "Raleway", "Times New Roman". size Returns ------- Tickfont """ super(Tickfont, self).__init__("tickfont") # Validate arg # ------------ if arg is None: arg = {} elif isinstance(arg, self.__class__): arg = arg.to_plotly_json() elif isinstance(arg, dict): arg = _copy.copy(arg) else: raise ValueError( """\ The first argument to the plotly_study.graph_objs.layout.ternary.aaxis.Tickfont constructor must be a dict or an instance of plotly_study.graph_objs.layout.ternary.aaxis.Tickfont""" ) # Handle skip_invalid # ------------------- self._skip_invalid = kwargs.pop("skip_invalid", False) # Import validators # ----------------- from plotly_study.validators.layout.ternary.aaxis import tickfont as v_tickfont # Initialize validators # --------------------- self._validators["color"] = v_tickfont.ColorValidator() self._validators["family"] = v_tickfont.FamilyValidator() self._validators["size"] = v_tickfont.SizeValidator() # Populate data dict with properties # ---------------------------------- _v = arg.pop("color", None) self["color"] = color if color is not None else _v _v = arg.pop("family", None) self["family"] = family if family is not None else _v _v = arg.pop("size", None) self["size"] = size if size is not None else _v # Process unknown kwargs # ---------------------- self._process_kwargs(**dict(arg, **kwargs)) # Reset skip_invalid # ------------------ self._skip_invalid = False __all__ = ["Tickfont", "Tickformatstop", "Tickformatstop", "Title", "title"] from plotly_study.graph_objs.layout.ternary.aaxis import title
34.738372
90
0.567155
from plotly_study.basedatatypes import BaseLayoutHierarchyType as _BaseLayoutHierarchyType import copy as _copy class Title(_BaseLayoutHierarchyType): @property def font(self): return self["font"] @font.setter def font(self, val): self["font"] = val @property def text(self): return self["text"] @text.setter def text(self, val): self["text"] = val @property def _parent_path_str(self): return "layout.ternary.aaxis" @property def _prop_descriptions(self): return """\ font Sets this axis' title font. Note that the title's font used to be customized by the now deprecated `titlefont` attribute. text Sets the title of this axis. Note that before the existence of `title.text`, the title's contents used to be defined as the `title` attribute itself. This behavior has been deprecated. """ def __init__(self, arg=None, font=None, text=None, **kwargs): super(Title, self).__init__("title") # Validate arg # ------------ if arg is None: arg = {} elif isinstance(arg, self.__class__): arg = arg.to_plotly_json() elif isinstance(arg, dict): arg = _copy.copy(arg) else: raise ValueError( """\ The first argument to the plotly_study.graph_objs.layout.ternary.aaxis.Title constructor must be a dict or an instance of plotly_study.graph_objs.layout.ternary.aaxis.Title""" ) # Handle skip_invalid # ------------------- self._skip_invalid = kwargs.pop("skip_invalid", False) # Import validators # ----------------- from plotly_study.validators.layout.ternary.aaxis import title as v_title # Initialize validators # --------------------- self._validators["font"] = v_title.FontValidator() self._validators["text"] = v_title.TextValidator() # Populate data dict with properties # ---------------------------------- _v = arg.pop("font", None) self["font"] = font if font is not None else _v _v = arg.pop("text", None) self["text"] = text if text is not None else _v # Process unknown kwargs # ---------------------- self._process_kwargs(**dict(arg, **kwargs)) # Reset skip_invalid # ------------------ self._skip_invalid = False from plotly_study.basedatatypes import BaseLayoutHierarchyType as _BaseLayoutHierarchyType import copy as _copy class Tickformatstop(_BaseLayoutHierarchyType): # dtickrange # ---------- @property def dtickrange(self): return self["dtickrange"] @dtickrange.setter def dtickrange(self, val): self["dtickrange"] = val # enabled # ------- @property def enabled(self): return self["enabled"] @enabled.setter def enabled(self, val): self["enabled"] = val # name # ---- @property def name(self): return self["name"] @name.setter def name(self, val): self["name"] = val # templateitemname # ---------------- @property def templateitemname(self): return self["templateitemname"] @templateitemname.setter def templateitemname(self, val): self["templateitemname"] = val # value # ----- @property def value(self): return self["value"] @value.setter def value(self, val): self["value"] = val # property parent name # -------------------- @property def _parent_path_str(self): return "layout.ternary.aaxis" # Self properties description # --------------------------- @property def _prop_descriptions(self): return """\ dtickrange range [*min*, *max*], where "min", "max" - dtick values which describe some zoom level, it is possible to omit "min" or "max" value by passing "null" enabled Determines whether or not this stop is used. If `false`, this stop is ignored even within its `dtickrange`. name When used in a template, named items are created in the output figure in addition to any items the figure already has in this array. You can modify these items in the output figure by making your own item with `templateitemname` matching this `name` alongside your modifications (including `visible: false` or `enabled: false` to hide it). Has no effect outside of a template. templateitemname Used to refer to a named item in this array in the template. Named items from the template will be created even without a matching item in the input figure, but you can modify one by making an item with `templateitemname` matching its `name`, alongside your modifications (including `visible: false` or `enabled: false` to hide it). If there is no template or no matching item, this item will be hidden unless you explicitly show it with `visible: true`. value string - dtickformat for described zoom level, the same as "tickformat" """ def __init__( self, arg=None, dtickrange=None, enabled=None, name=None, templateitemname=None, value=None, **kwargs ): super(Tickformatstop, self).__init__("tickformatstops") # Validate arg # ------------ if arg is None: arg = {} elif isinstance(arg, self.__class__): arg = arg.to_plotly_json() elif isinstance(arg, dict): arg = _copy.copy(arg) else: raise ValueError( """\ The first argument to the plotly_study.graph_objs.layout.ternary.aaxis.Tickformatstop constructor must be a dict or an instance of plotly_study.graph_objs.layout.ternary.aaxis.Tickformatstop""" ) # Handle skip_invalid # ------------------- self._skip_invalid = kwargs.pop("skip_invalid", False) # Import validators # ----------------- from plotly_study.validators.layout.ternary.aaxis import ( tickformatstop as v_tickformatstop, ) # Initialize validators # --------------------- self._validators["dtickrange"] = v_tickformatstop.DtickrangeValidator() self._validators["enabled"] = v_tickformatstop.EnabledValidator() self._validators["name"] = v_tickformatstop.NameValidator() self._validators[ "templateitemname" ] = v_tickformatstop.TemplateitemnameValidator() self._validators["value"] = v_tickformatstop.ValueValidator() # Populate data dict with properties # ---------------------------------- _v = arg.pop("dtickrange", None) self["dtickrange"] = dtickrange if dtickrange is not None else _v _v = arg.pop("enabled", None) self["enabled"] = enabled if enabled is not None else _v _v = arg.pop("name", None) self["name"] = name if name is not None else _v _v = arg.pop("templateitemname", None) self["templateitemname"] = ( templateitemname if templateitemname is not None else _v ) _v = arg.pop("value", None) self["value"] = value if value is not None else _v # Process unknown kwargs # ---------------------- self._process_kwargs(**dict(arg, **kwargs)) # Reset skip_invalid # ------------------ self._skip_invalid = False from plotly_study.basedatatypes import BaseLayoutHierarchyType as _BaseLayoutHierarchyType import copy as _copy class Tickfont(_BaseLayoutHierarchyType): # color # ----- @property def color(self): return self["color"] @color.setter def color(self, val): self["color"] = val # family # ------ @property def family(self): return self["family"] @family.setter def family(self, val): self["family"] = val # size # ---- @property def size(self): return self["size"] @size.setter def size(self, val): self["size"] = val # property parent name # -------------------- @property def _parent_path_str(self): return "layout.ternary.aaxis" # Self properties description # --------------------------- @property def _prop_descriptions(self): return """\ color family HTML font family - the typeface that will be applied by the web browser. The web browser will only be able to apply a font if it is available on the system which it operates. Provide multiple font families, separated by commas, to indicate the preference in which to apply fonts if they aren't available on the system. The plotly service (at https://plot.ly or on-premise) generates images on a server, where only a select number of fonts are installed and supported. These include "Arial", "Balto", "Courier New", "Droid Sans",, "Droid Serif", "Droid Sans Mono", "Gravitas One", "Old Standard TT", "Open Sans", "Overpass", "PT Sans Narrow", "Raleway", "Times New Roman". size """ def __init__(self, arg=None, color=None, family=None, size=None, **kwargs): super(Tickfont, self).__init__("tickfont") if arg is None: arg = {} elif isinstance(arg, self.__class__): arg = arg.to_plotly_json() elif isinstance(arg, dict): arg = _copy.copy(arg) else: raise ValueError( """\ The first argument to the plotly_study.graph_objs.layout.ternary.aaxis.Tickfont constructor must be a dict or an instance of plotly_study.graph_objs.layout.ternary.aaxis.Tickfont""" ) self._skip_invalid = kwargs.pop("skip_invalid", False) from plotly_study.validators.layout.ternary.aaxis import tickfont as v_tickfont self._validators["color"] = v_tickfont.ColorValidator() self._validators["family"] = v_tickfont.FamilyValidator() self._validators["size"] = v_tickfont.SizeValidator() _v = arg.pop("color", None) self["color"] = color if color is not None else _v _v = arg.pop("family", None) self["family"] = family if family is not None else _v _v = arg.pop("size", None) self["size"] = size if size is not None else _v self._process_kwargs(**dict(arg, **kwargs)) self._skip_invalid = False __all__ = ["Tickfont", "Tickformatstop", "Tickformatstop", "Title", "title"] from plotly_study.graph_objs.layout.ternary.aaxis import title
true
true
f7262a2f0da63f591723f9cdf91c2bae40d81f7d
19,587
py
Python
pandas/tests/reshape/test_tile.py
stevenvandenberghe/pandas
8cbee356da1161c56c64f6f89cb5548bcadc3e44
[ "PSF-2.0", "Apache-2.0", "BSD-3-Clause-No-Nuclear-License-2014", "MIT", "ECL-2.0", "BSD-3-Clause" ]
null
null
null
pandas/tests/reshape/test_tile.py
stevenvandenberghe/pandas
8cbee356da1161c56c64f6f89cb5548bcadc3e44
[ "PSF-2.0", "Apache-2.0", "BSD-3-Clause-No-Nuclear-License-2014", "MIT", "ECL-2.0", "BSD-3-Clause" ]
null
null
null
pandas/tests/reshape/test_tile.py
stevenvandenberghe/pandas
8cbee356da1161c56c64f6f89cb5548bcadc3e44
[ "PSF-2.0", "Apache-2.0", "BSD-3-Clause-No-Nuclear-License-2014", "MIT", "ECL-2.0", "BSD-3-Clause" ]
2
2019-03-08T19:59:05.000Z
2020-09-27T03:18:37.000Z
import os import pytest import numpy as np from pandas.compat import zip from pandas import (Series, isna, to_datetime, DatetimeIndex, Timestamp, Interval, IntervalIndex, Categorical, cut, qcut, date_range) import pandas.util.testing as tm from pandas.api.types import CategoricalDtype as CDT from pandas.core.algorithms import quantile import pandas.core.reshape.tile as tmod class TestCut(object): def test_simple(self): data = np.ones(5, dtype='int64') result = cut(data, 4, labels=False) expected = np.array([1, 1, 1, 1, 1]) tm.assert_numpy_array_equal(result, expected, check_dtype=False) def test_bins(self): data = np.array([.2, 1.4, 2.5, 6.2, 9.7, 2.1]) result, bins = cut(data, 3, retbins=True) intervals = IntervalIndex.from_breaks(bins.round(3)) intervals = intervals.take([0, 0, 0, 1, 2, 0]) expected = Categorical(intervals, ordered=True) tm.assert_categorical_equal(result, expected) tm.assert_almost_equal(bins, np.array([0.1905, 3.36666667, 6.53333333, 9.7])) def test_right(self): data = np.array([.2, 1.4, 2.5, 6.2, 9.7, 2.1, 2.575]) result, bins = cut(data, 4, right=True, retbins=True) intervals = IntervalIndex.from_breaks(bins.round(3)) expected = Categorical(intervals, ordered=True) expected = expected.take([0, 0, 0, 2, 3, 0, 0]) tm.assert_categorical_equal(result, expected) tm.assert_almost_equal(bins, np.array([0.1905, 2.575, 4.95, 7.325, 9.7])) def test_noright(self): data = np.array([.2, 1.4, 2.5, 6.2, 9.7, 2.1, 2.575]) result, bins = cut(data, 4, right=False, retbins=True) intervals = IntervalIndex.from_breaks(bins.round(3), closed='left') intervals = intervals.take([0, 0, 0, 2, 3, 0, 1]) expected = Categorical(intervals, ordered=True) tm.assert_categorical_equal(result, expected) tm.assert_almost_equal(bins, np.array([0.2, 2.575, 4.95, 7.325, 9.7095])) def test_arraylike(self): data = [.2, 1.4, 2.5, 6.2, 9.7, 2.1] result, bins = cut(data, 3, retbins=True) intervals = IntervalIndex.from_breaks(bins.round(3)) intervals = intervals.take([0, 0, 0, 1, 2, 0]) expected = Categorical(intervals, ordered=True) tm.assert_categorical_equal(result, expected) tm.assert_almost_equal(bins, np.array([0.1905, 3.36666667, 6.53333333, 9.7])) def test_bins_from_intervalindex(self): c = cut(range(5), 3) expected = c result = cut(range(5), bins=expected.categories) tm.assert_categorical_equal(result, expected) expected = Categorical.from_codes(np.append(c.codes, -1), categories=c.categories, ordered=True) result = cut(range(6), bins=expected.categories) tm.assert_categorical_equal(result, expected) # doc example # make sure we preserve the bins ages = np.array([10, 15, 13, 12, 23, 25, 28, 59, 60]) c = cut(ages, bins=[0, 18, 35, 70]) expected = IntervalIndex.from_tuples([(0, 18), (18, 35), (35, 70)]) tm.assert_index_equal(c.categories, expected) result = cut([25, 20, 50], bins=c.categories) tm.assert_index_equal(result.categories, expected) tm.assert_numpy_array_equal(result.codes, np.array([1, 1, 2], dtype='int8')) def test_bins_not_monotonic(self): data = [.2, 1.4, 2.5, 6.2, 9.7, 2.1] pytest.raises(ValueError, cut, data, [0.1, 1.5, 1, 10]) def test_wrong_num_labels(self): data = [.2, 1.4, 2.5, 6.2, 9.7, 2.1] pytest.raises(ValueError, cut, data, [0, 1, 10], labels=['foo', 'bar', 'baz']) def test_cut_corner(self): # h3h pytest.raises(ValueError, cut, [], 2) pytest.raises(ValueError, cut, [1, 2, 3], 0.5) def test_cut_out_of_range_more(self): # #1511 s = Series([0, -1, 0, 1, -3], name='x') ind = cut(s, [0, 1], labels=False) exp = Series([np.nan, np.nan, np.nan, 0, np.nan], name='x') tm.assert_series_equal(ind, exp) def test_labels(self): arr = np.tile(np.arange(0, 1.01, 0.1), 4) result, bins = cut(arr, 4, retbins=True) ex_levels = IntervalIndex.from_breaks([-1e-3, 0.25, 0.5, 0.75, 1]) tm.assert_index_equal(result.categories, ex_levels) result, bins = cut(arr, 4, retbins=True, right=False) ex_levels = IntervalIndex.from_breaks([0, 0.25, 0.5, 0.75, 1 + 1e-3], closed='left') tm.assert_index_equal(result.categories, ex_levels) def test_cut_pass_series_name_to_factor(self): s = Series(np.random.randn(100), name='foo') factor = cut(s, 4) assert factor.name == 'foo' def test_label_precision(self): arr = np.arange(0, 0.73, 0.01) result = cut(arr, 4, precision=2) ex_levels = IntervalIndex.from_breaks([-0.00072, 0.18, 0.36, 0.54, 0.72]) tm.assert_index_equal(result.categories, ex_levels) def test_na_handling(self): arr = np.arange(0, 0.75, 0.01) arr[::3] = np.nan result = cut(arr, 4) result_arr = np.asarray(result) ex_arr = np.where(isna(arr), np.nan, result_arr) tm.assert_almost_equal(result_arr, ex_arr) result = cut(arr, 4, labels=False) ex_result = np.where(isna(arr), np.nan, result) tm.assert_almost_equal(result, ex_result) def test_inf_handling(self): data = np.arange(6) data_ser = Series(data, dtype='int64') bins = [-np.inf, 2, 4, np.inf] result = cut(data, bins) result_ser = cut(data_ser, bins) ex_uniques = IntervalIndex.from_breaks(bins) tm.assert_index_equal(result.categories, ex_uniques) assert result[5] == Interval(4, np.inf) assert result[0] == Interval(-np.inf, 2) assert result_ser[5] == Interval(4, np.inf) assert result_ser[0] == Interval(-np.inf, 2) def test_qcut(self): arr = np.random.randn(1000) # We store the bins as Index that have been rounded # to comparisons are a bit tricky. labels, bins = qcut(arr, 4, retbins=True) ex_bins = quantile(arr, [0, .25, .5, .75, 1.]) result = labels.categories.left.values assert np.allclose(result, ex_bins[:-1], atol=1e-2) result = labels.categories.right.values assert np.allclose(result, ex_bins[1:], atol=1e-2) ex_levels = cut(arr, ex_bins, include_lowest=True) tm.assert_categorical_equal(labels, ex_levels) def test_qcut_bounds(self): arr = np.random.randn(1000) factor = qcut(arr, 10, labels=False) assert len(np.unique(factor)) == 10 def test_qcut_specify_quantiles(self): arr = np.random.randn(100) factor = qcut(arr, [0, .25, .5, .75, 1.]) expected = qcut(arr, 4) tm.assert_categorical_equal(factor, expected) def test_qcut_all_bins_same(self): tm.assert_raises_regex(ValueError, "edges.*unique", qcut, [0, 0, 0, 0, 0, 0, 0, 0, 0, 0], 3) def test_cut_out_of_bounds(self): arr = np.random.randn(100) result = cut(arr, [-1, 0, 1]) mask = isna(result) ex_mask = (arr < -1) | (arr > 1) tm.assert_numpy_array_equal(mask, ex_mask) def test_cut_pass_labels(self): arr = [50, 5, 10, 15, 20, 30, 70] bins = [0, 25, 50, 100] labels = ['Small', 'Medium', 'Large'] result = cut(arr, bins, labels=labels) exp = Categorical(['Medium'] + 4 * ['Small'] + ['Medium', 'Large'], categories=labels, ordered=True) tm.assert_categorical_equal(result, exp) result = cut(arr, bins, labels=Categorical.from_codes([0, 1, 2], labels)) exp = Categorical.from_codes([1] + 4 * [0] + [1, 2], labels) tm.assert_categorical_equal(result, exp) # issue 16459 labels = ['Good', 'Medium', 'Bad'] result = cut(arr, 3, labels=labels) exp = cut(arr, 3, labels=Categorical(labels, categories=labels, ordered=True)) tm.assert_categorical_equal(result, exp) def test_qcut_include_lowest(self): values = np.arange(10) ii = qcut(values, 4) ex_levels = IntervalIndex( [Interval(-0.001, 2.25), Interval(2.25, 4.5), Interval(4.5, 6.75), Interval(6.75, 9)]) tm.assert_index_equal(ii.categories, ex_levels) def test_qcut_nas(self): arr = np.random.randn(100) arr[:20] = np.nan result = qcut(arr, 4) assert isna(result[:20]).all() def test_qcut_index(self): result = qcut([0, 2], 2) intervals = [Interval(-0.001, 1), Interval(1, 2)] expected = Categorical(intervals, ordered=True) tm.assert_categorical_equal(result, expected) def test_round_frac(self): # it works result = cut(np.arange(11.), 2) result = cut(np.arange(11.) / 1e10, 2) # #1979, negative numbers result = tmod._round_frac(-117.9998, precision=3) assert result == -118 result = tmod._round_frac(117.9998, precision=3) assert result == 118 result = tmod._round_frac(117.9998, precision=2) assert result == 118 result = tmod._round_frac(0.000123456, precision=2) assert result == 0.00012 def test_qcut_binning_issues(self): # #1978, 1979 path = os.path.join(tm.get_data_path(), 'cut_data.csv') arr = np.loadtxt(path) result = qcut(arr, 20) starts = [] ends = [] for lev in np.unique(result): s = lev.left e = lev.right assert s != e starts.append(float(s)) ends.append(float(e)) for (sp, sn), (ep, en) in zip(zip(starts[:-1], starts[1:]), zip(ends[:-1], ends[1:])): assert sp < sn assert ep < en assert ep <= sn def test_cut_return_intervals(self): s = Series([0, 1, 2, 3, 4, 5, 6, 7, 8]) res = cut(s, 3) exp_bins = np.linspace(0, 8, num=4).round(3) exp_bins[0] -= 0.008 exp = Series(IntervalIndex.from_breaks(exp_bins, closed='right').take( [0, 0, 0, 1, 1, 1, 2, 2, 2])).astype(CDT(ordered=True)) tm.assert_series_equal(res, exp) def test_qcut_return_intervals(self): s = Series([0, 1, 2, 3, 4, 5, 6, 7, 8]) res = qcut(s, [0, 0.333, 0.666, 1]) exp_levels = np.array([Interval(-0.001, 2.664), Interval(2.664, 5.328), Interval(5.328, 8)]) exp = Series(exp_levels.take([0, 0, 0, 1, 1, 1, 2, 2, 2])).astype( CDT(ordered=True)) tm.assert_series_equal(res, exp) def test_series_retbins(self): # GH 8589 s = Series(np.arange(4)) result, bins = cut(s, 2, retbins=True) expected = Series(IntervalIndex.from_breaks( [-0.003, 1.5, 3], closed='right').repeat(2)).astype( CDT(ordered=True)) tm.assert_series_equal(result, expected) result, bins = qcut(s, 2, retbins=True) expected = Series(IntervalIndex.from_breaks( [-0.001, 1.5, 3], closed='right').repeat(2)).astype( CDT(ordered=True)) tm.assert_series_equal(result, expected) def test_qcut_duplicates_bin(self): # GH 7751 values = [0, 0, 0, 0, 1, 2, 3] expected = IntervalIndex([Interval(-0.001, 1), Interval(1, 3)]) result = qcut(values, 3, duplicates='drop') tm.assert_index_equal(result.categories, expected) pytest.raises(ValueError, qcut, values, 3) pytest.raises(ValueError, qcut, values, 3, duplicates='raise') # invalid pytest.raises(ValueError, qcut, values, 3, duplicates='foo') def test_single_quantile(self): # issue 15431 expected = Series([0, 0]) s = Series([9., 9.]) result = qcut(s, 1, labels=False) tm.assert_series_equal(result, expected) result = qcut(s, 1) intervals = IntervalIndex([Interval(8.999, 9.0), Interval(8.999, 9.0)], closed='right') expected = Series(intervals).astype(CDT(ordered=True)) tm.assert_series_equal(result, expected) s = Series([-9., -9.]) expected = Series([0, 0]) result = qcut(s, 1, labels=False) tm.assert_series_equal(result, expected) result = qcut(s, 1) intervals = IntervalIndex([Interval(-9.001, -9.0), Interval(-9.001, -9.0)], closed='right') expected = Series(intervals).astype(CDT(ordered=True)) tm.assert_series_equal(result, expected) s = Series([0., 0.]) expected = Series([0, 0]) result = qcut(s, 1, labels=False) tm.assert_series_equal(result, expected) result = qcut(s, 1) intervals = IntervalIndex([Interval(-0.001, 0.0), Interval(-0.001, 0.0)], closed='right') expected = Series(intervals).astype(CDT(ordered=True)) tm.assert_series_equal(result, expected) s = Series([9]) expected = Series([0]) result = qcut(s, 1, labels=False) tm.assert_series_equal(result, expected) result = qcut(s, 1) intervals = IntervalIndex([Interval(8.999, 9.0)], closed='right') expected = Series(intervals).astype(CDT(ordered=True)) tm.assert_series_equal(result, expected) s = Series([-9]) expected = Series([0]) result = qcut(s, 1, labels=False) tm.assert_series_equal(result, expected) result = qcut(s, 1) intervals = IntervalIndex([Interval(-9.001, -9.0)], closed='right') expected = Series(intervals).astype(CDT(ordered=True)) tm.assert_series_equal(result, expected) s = Series([0]) expected = Series([0]) result = qcut(s, 1, labels=False) tm.assert_series_equal(result, expected) result = qcut(s, 1) intervals = IntervalIndex([Interval(-0.001, 0.0)], closed='right') expected = Series(intervals).astype(CDT(ordered=True)) tm.assert_series_equal(result, expected) def test_single_bin(self): # issue 14652 expected = Series([0, 0]) s = Series([9., 9.]) result = cut(s, 1, labels=False) tm.assert_series_equal(result, expected) s = Series([-9., -9.]) result = cut(s, 1, labels=False) tm.assert_series_equal(result, expected) expected = Series([0]) s = Series([9]) result = cut(s, 1, labels=False) tm.assert_series_equal(result, expected) s = Series([-9]) result = cut(s, 1, labels=False) tm.assert_series_equal(result, expected) # issue 15428 expected = Series([0, 0]) s = Series([0., 0.]) result = cut(s, 1, labels=False) tm.assert_series_equal(result, expected) expected = Series([0]) s = Series([0]) result = cut(s, 1, labels=False) tm.assert_series_equal(result, expected) def test_datetime_cut(self): # GH 14714 # testing for time data to be present as series data = to_datetime(Series(['2013-01-01', '2013-01-02', '2013-01-03'])) result, bins = cut(data, 3, retbins=True) expected = ( Series(IntervalIndex([ Interval(Timestamp('2012-12-31 23:57:07.200000'), Timestamp('2013-01-01 16:00:00')), Interval(Timestamp('2013-01-01 16:00:00'), Timestamp('2013-01-02 08:00:00')), Interval(Timestamp('2013-01-02 08:00:00'), Timestamp('2013-01-03 00:00:00'))])) .astype(CDT(ordered=True))) tm.assert_series_equal(result, expected) # testing for time data to be present as list data = [np.datetime64('2013-01-01'), np.datetime64('2013-01-02'), np.datetime64('2013-01-03')] result, bins = cut(data, 3, retbins=True) tm.assert_series_equal(Series(result), expected) # testing for time data to be present as ndarray data = np.array([np.datetime64('2013-01-01'), np.datetime64('2013-01-02'), np.datetime64('2013-01-03')]) result, bins = cut(data, 3, retbins=True) tm.assert_series_equal(Series(result), expected) # testing for time data to be present as datetime index data = DatetimeIndex(['2013-01-01', '2013-01-02', '2013-01-03']) result, bins = cut(data, 3, retbins=True) tm.assert_series_equal(Series(result), expected) def test_datetime_bin(self): data = [np.datetime64('2012-12-13'), np.datetime64('2012-12-15')] bin_data = ['2012-12-12', '2012-12-14', '2012-12-16'] expected = ( Series(IntervalIndex([ Interval(Timestamp(bin_data[0]), Timestamp(bin_data[1])), Interval(Timestamp(bin_data[1]), Timestamp(bin_data[2]))])) .astype(CDT(ordered=True))) for conv in [Timestamp, Timestamp, np.datetime64]: bins = [conv(v) for v in bin_data] result = cut(data, bins=bins) tm.assert_series_equal(Series(result), expected) bin_pydatetime = [Timestamp(v).to_pydatetime() for v in bin_data] result = cut(data, bins=bin_pydatetime) tm.assert_series_equal(Series(result), expected) bins = to_datetime(bin_data) result = cut(data, bins=bin_pydatetime) tm.assert_series_equal(Series(result), expected) def test_datetime_nan(self): def f(): cut(date_range('20130101', periods=3), bins=[0, 2, 4]) pytest.raises(ValueError, f) result = cut(date_range('20130102', periods=5), bins=date_range('20130101', periods=2)) mask = result.categories.isna() tm.assert_numpy_array_equal(mask, np.array([False])) mask = result.isna() tm.assert_numpy_array_equal( mask, np.array([False, True, True, True, True])) @pytest.mark.parametrize( "array_1_writeable, array_2_writeable", [(True, True), (True, False), (False, False)]) def test_cut_read_only(self, array_1_writeable, array_2_writeable): # issue 18773 array_1 = np.arange(0, 100, 10) array_1.flags.writeable = array_1_writeable array_2 = np.arange(0, 100, 10) array_2.flags.writeable = array_2_writeable hundred_elements = np.arange(100) tm.assert_categorical_equal(cut(hundred_elements, array_1), cut(hundred_elements, array_2))
37.026465
78
0.56512
import os import pytest import numpy as np from pandas.compat import zip from pandas import (Series, isna, to_datetime, DatetimeIndex, Timestamp, Interval, IntervalIndex, Categorical, cut, qcut, date_range) import pandas.util.testing as tm from pandas.api.types import CategoricalDtype as CDT from pandas.core.algorithms import quantile import pandas.core.reshape.tile as tmod class TestCut(object): def test_simple(self): data = np.ones(5, dtype='int64') result = cut(data, 4, labels=False) expected = np.array([1, 1, 1, 1, 1]) tm.assert_numpy_array_equal(result, expected, check_dtype=False) def test_bins(self): data = np.array([.2, 1.4, 2.5, 6.2, 9.7, 2.1]) result, bins = cut(data, 3, retbins=True) intervals = IntervalIndex.from_breaks(bins.round(3)) intervals = intervals.take([0, 0, 0, 1, 2, 0]) expected = Categorical(intervals, ordered=True) tm.assert_categorical_equal(result, expected) tm.assert_almost_equal(bins, np.array([0.1905, 3.36666667, 6.53333333, 9.7])) def test_right(self): data = np.array([.2, 1.4, 2.5, 6.2, 9.7, 2.1, 2.575]) result, bins = cut(data, 4, right=True, retbins=True) intervals = IntervalIndex.from_breaks(bins.round(3)) expected = Categorical(intervals, ordered=True) expected = expected.take([0, 0, 0, 2, 3, 0, 0]) tm.assert_categorical_equal(result, expected) tm.assert_almost_equal(bins, np.array([0.1905, 2.575, 4.95, 7.325, 9.7])) def test_noright(self): data = np.array([.2, 1.4, 2.5, 6.2, 9.7, 2.1, 2.575]) result, bins = cut(data, 4, right=False, retbins=True) intervals = IntervalIndex.from_breaks(bins.round(3), closed='left') intervals = intervals.take([0, 0, 0, 2, 3, 0, 1]) expected = Categorical(intervals, ordered=True) tm.assert_categorical_equal(result, expected) tm.assert_almost_equal(bins, np.array([0.2, 2.575, 4.95, 7.325, 9.7095])) def test_arraylike(self): data = [.2, 1.4, 2.5, 6.2, 9.7, 2.1] result, bins = cut(data, 3, retbins=True) intervals = IntervalIndex.from_breaks(bins.round(3)) intervals = intervals.take([0, 0, 0, 1, 2, 0]) expected = Categorical(intervals, ordered=True) tm.assert_categorical_equal(result, expected) tm.assert_almost_equal(bins, np.array([0.1905, 3.36666667, 6.53333333, 9.7])) def test_bins_from_intervalindex(self): c = cut(range(5), 3) expected = c result = cut(range(5), bins=expected.categories) tm.assert_categorical_equal(result, expected) expected = Categorical.from_codes(np.append(c.codes, -1), categories=c.categories, ordered=True) result = cut(range(6), bins=expected.categories) tm.assert_categorical_equal(result, expected) ages = np.array([10, 15, 13, 12, 23, 25, 28, 59, 60]) c = cut(ages, bins=[0, 18, 35, 70]) expected = IntervalIndex.from_tuples([(0, 18), (18, 35), (35, 70)]) tm.assert_index_equal(c.categories, expected) result = cut([25, 20, 50], bins=c.categories) tm.assert_index_equal(result.categories, expected) tm.assert_numpy_array_equal(result.codes, np.array([1, 1, 2], dtype='int8')) def test_bins_not_monotonic(self): data = [.2, 1.4, 2.5, 6.2, 9.7, 2.1] pytest.raises(ValueError, cut, data, [0.1, 1.5, 1, 10]) def test_wrong_num_labels(self): data = [.2, 1.4, 2.5, 6.2, 9.7, 2.1] pytest.raises(ValueError, cut, data, [0, 1, 10], labels=['foo', 'bar', 'baz']) def test_cut_corner(self): pytest.raises(ValueError, cut, [], 2) pytest.raises(ValueError, cut, [1, 2, 3], 0.5) def test_cut_out_of_range_more(self): s = Series([0, -1, 0, 1, -3], name='x') ind = cut(s, [0, 1], labels=False) exp = Series([np.nan, np.nan, np.nan, 0, np.nan], name='x') tm.assert_series_equal(ind, exp) def test_labels(self): arr = np.tile(np.arange(0, 1.01, 0.1), 4) result, bins = cut(arr, 4, retbins=True) ex_levels = IntervalIndex.from_breaks([-1e-3, 0.25, 0.5, 0.75, 1]) tm.assert_index_equal(result.categories, ex_levels) result, bins = cut(arr, 4, retbins=True, right=False) ex_levels = IntervalIndex.from_breaks([0, 0.25, 0.5, 0.75, 1 + 1e-3], closed='left') tm.assert_index_equal(result.categories, ex_levels) def test_cut_pass_series_name_to_factor(self): s = Series(np.random.randn(100), name='foo') factor = cut(s, 4) assert factor.name == 'foo' def test_label_precision(self): arr = np.arange(0, 0.73, 0.01) result = cut(arr, 4, precision=2) ex_levels = IntervalIndex.from_breaks([-0.00072, 0.18, 0.36, 0.54, 0.72]) tm.assert_index_equal(result.categories, ex_levels) def test_na_handling(self): arr = np.arange(0, 0.75, 0.01) arr[::3] = np.nan result = cut(arr, 4) result_arr = np.asarray(result) ex_arr = np.where(isna(arr), np.nan, result_arr) tm.assert_almost_equal(result_arr, ex_arr) result = cut(arr, 4, labels=False) ex_result = np.where(isna(arr), np.nan, result) tm.assert_almost_equal(result, ex_result) def test_inf_handling(self): data = np.arange(6) data_ser = Series(data, dtype='int64') bins = [-np.inf, 2, 4, np.inf] result = cut(data, bins) result_ser = cut(data_ser, bins) ex_uniques = IntervalIndex.from_breaks(bins) tm.assert_index_equal(result.categories, ex_uniques) assert result[5] == Interval(4, np.inf) assert result[0] == Interval(-np.inf, 2) assert result_ser[5] == Interval(4, np.inf) assert result_ser[0] == Interval(-np.inf, 2) def test_qcut(self): arr = np.random.randn(1000) labels, bins = qcut(arr, 4, retbins=True) ex_bins = quantile(arr, [0, .25, .5, .75, 1.]) result = labels.categories.left.values assert np.allclose(result, ex_bins[:-1], atol=1e-2) result = labels.categories.right.values assert np.allclose(result, ex_bins[1:], atol=1e-2) ex_levels = cut(arr, ex_bins, include_lowest=True) tm.assert_categorical_equal(labels, ex_levels) def test_qcut_bounds(self): arr = np.random.randn(1000) factor = qcut(arr, 10, labels=False) assert len(np.unique(factor)) == 10 def test_qcut_specify_quantiles(self): arr = np.random.randn(100) factor = qcut(arr, [0, .25, .5, .75, 1.]) expected = qcut(arr, 4) tm.assert_categorical_equal(factor, expected) def test_qcut_all_bins_same(self): tm.assert_raises_regex(ValueError, "edges.*unique", qcut, [0, 0, 0, 0, 0, 0, 0, 0, 0, 0], 3) def test_cut_out_of_bounds(self): arr = np.random.randn(100) result = cut(arr, [-1, 0, 1]) mask = isna(result) ex_mask = (arr < -1) | (arr > 1) tm.assert_numpy_array_equal(mask, ex_mask) def test_cut_pass_labels(self): arr = [50, 5, 10, 15, 20, 30, 70] bins = [0, 25, 50, 100] labels = ['Small', 'Medium', 'Large'] result = cut(arr, bins, labels=labels) exp = Categorical(['Medium'] + 4 * ['Small'] + ['Medium', 'Large'], categories=labels, ordered=True) tm.assert_categorical_equal(result, exp) result = cut(arr, bins, labels=Categorical.from_codes([0, 1, 2], labels)) exp = Categorical.from_codes([1] + 4 * [0] + [1, 2], labels) tm.assert_categorical_equal(result, exp) labels = ['Good', 'Medium', 'Bad'] result = cut(arr, 3, labels=labels) exp = cut(arr, 3, labels=Categorical(labels, categories=labels, ordered=True)) tm.assert_categorical_equal(result, exp) def test_qcut_include_lowest(self): values = np.arange(10) ii = qcut(values, 4) ex_levels = IntervalIndex( [Interval(-0.001, 2.25), Interval(2.25, 4.5), Interval(4.5, 6.75), Interval(6.75, 9)]) tm.assert_index_equal(ii.categories, ex_levels) def test_qcut_nas(self): arr = np.random.randn(100) arr[:20] = np.nan result = qcut(arr, 4) assert isna(result[:20]).all() def test_qcut_index(self): result = qcut([0, 2], 2) intervals = [Interval(-0.001, 1), Interval(1, 2)] expected = Categorical(intervals, ordered=True) tm.assert_categorical_equal(result, expected) def test_round_frac(self): result = cut(np.arange(11.), 2) result = cut(np.arange(11.) / 1e10, 2) ._round_frac(-117.9998, precision=3) assert result == -118 result = tmod._round_frac(117.9998, precision=3) assert result == 118 result = tmod._round_frac(117.9998, precision=2) assert result == 118 result = tmod._round_frac(0.000123456, precision=2) assert result == 0.00012 def test_qcut_binning_issues(self): th = os.path.join(tm.get_data_path(), 'cut_data.csv') arr = np.loadtxt(path) result = qcut(arr, 20) starts = [] ends = [] for lev in np.unique(result): s = lev.left e = lev.right assert s != e starts.append(float(s)) ends.append(float(e)) for (sp, sn), (ep, en) in zip(zip(starts[:-1], starts[1:]), zip(ends[:-1], ends[1:])): assert sp < sn assert ep < en assert ep <= sn def test_cut_return_intervals(self): s = Series([0, 1, 2, 3, 4, 5, 6, 7, 8]) res = cut(s, 3) exp_bins = np.linspace(0, 8, num=4).round(3) exp_bins[0] -= 0.008 exp = Series(IntervalIndex.from_breaks(exp_bins, closed='right').take( [0, 0, 0, 1, 1, 1, 2, 2, 2])).astype(CDT(ordered=True)) tm.assert_series_equal(res, exp) def test_qcut_return_intervals(self): s = Series([0, 1, 2, 3, 4, 5, 6, 7, 8]) res = qcut(s, [0, 0.333, 0.666, 1]) exp_levels = np.array([Interval(-0.001, 2.664), Interval(2.664, 5.328), Interval(5.328, 8)]) exp = Series(exp_levels.take([0, 0, 0, 1, 1, 1, 2, 2, 2])).astype( CDT(ordered=True)) tm.assert_series_equal(res, exp) def test_series_retbins(self): s = Series(np.arange(4)) result, bins = cut(s, 2, retbins=True) expected = Series(IntervalIndex.from_breaks( [-0.003, 1.5, 3], closed='right').repeat(2)).astype( CDT(ordered=True)) tm.assert_series_equal(result, expected) result, bins = qcut(s, 2, retbins=True) expected = Series(IntervalIndex.from_breaks( [-0.001, 1.5, 3], closed='right').repeat(2)).astype( CDT(ordered=True)) tm.assert_series_equal(result, expected) def test_qcut_duplicates_bin(self): values = [0, 0, 0, 0, 1, 2, 3] expected = IntervalIndex([Interval(-0.001, 1), Interval(1, 3)]) result = qcut(values, 3, duplicates='drop') tm.assert_index_equal(result.categories, expected) pytest.raises(ValueError, qcut, values, 3) pytest.raises(ValueError, qcut, values, 3, duplicates='raise') pytest.raises(ValueError, qcut, values, 3, duplicates='foo') def test_single_quantile(self): expected = Series([0, 0]) s = Series([9., 9.]) result = qcut(s, 1, labels=False) tm.assert_series_equal(result, expected) result = qcut(s, 1) intervals = IntervalIndex([Interval(8.999, 9.0), Interval(8.999, 9.0)], closed='right') expected = Series(intervals).astype(CDT(ordered=True)) tm.assert_series_equal(result, expected) s = Series([-9., -9.]) expected = Series([0, 0]) result = qcut(s, 1, labels=False) tm.assert_series_equal(result, expected) result = qcut(s, 1) intervals = IntervalIndex([Interval(-9.001, -9.0), Interval(-9.001, -9.0)], closed='right') expected = Series(intervals).astype(CDT(ordered=True)) tm.assert_series_equal(result, expected) s = Series([0., 0.]) expected = Series([0, 0]) result = qcut(s, 1, labels=False) tm.assert_series_equal(result, expected) result = qcut(s, 1) intervals = IntervalIndex([Interval(-0.001, 0.0), Interval(-0.001, 0.0)], closed='right') expected = Series(intervals).astype(CDT(ordered=True)) tm.assert_series_equal(result, expected) s = Series([9]) expected = Series([0]) result = qcut(s, 1, labels=False) tm.assert_series_equal(result, expected) result = qcut(s, 1) intervals = IntervalIndex([Interval(8.999, 9.0)], closed='right') expected = Series(intervals).astype(CDT(ordered=True)) tm.assert_series_equal(result, expected) s = Series([-9]) expected = Series([0]) result = qcut(s, 1, labels=False) tm.assert_series_equal(result, expected) result = qcut(s, 1) intervals = IntervalIndex([Interval(-9.001, -9.0)], closed='right') expected = Series(intervals).astype(CDT(ordered=True)) tm.assert_series_equal(result, expected) s = Series([0]) expected = Series([0]) result = qcut(s, 1, labels=False) tm.assert_series_equal(result, expected) result = qcut(s, 1) intervals = IntervalIndex([Interval(-0.001, 0.0)], closed='right') expected = Series(intervals).astype(CDT(ordered=True)) tm.assert_series_equal(result, expected) def test_single_bin(self): expected = Series([0, 0]) s = Series([9., 9.]) result = cut(s, 1, labels=False) tm.assert_series_equal(result, expected) s = Series([-9., -9.]) result = cut(s, 1, labels=False) tm.assert_series_equal(result, expected) expected = Series([0]) s = Series([9]) result = cut(s, 1, labels=False) tm.assert_series_equal(result, expected) s = Series([-9]) result = cut(s, 1, labels=False) tm.assert_series_equal(result, expected) expected = Series([0, 0]) s = Series([0., 0.]) result = cut(s, 1, labels=False) tm.assert_series_equal(result, expected) expected = Series([0]) s = Series([0]) result = cut(s, 1, labels=False) tm.assert_series_equal(result, expected) def test_datetime_cut(self): data = to_datetime(Series(['2013-01-01', '2013-01-02', '2013-01-03'])) result, bins = cut(data, 3, retbins=True) expected = ( Series(IntervalIndex([ Interval(Timestamp('2012-12-31 23:57:07.200000'), Timestamp('2013-01-01 16:00:00')), Interval(Timestamp('2013-01-01 16:00:00'), Timestamp('2013-01-02 08:00:00')), Interval(Timestamp('2013-01-02 08:00:00'), Timestamp('2013-01-03 00:00:00'))])) .astype(CDT(ordered=True))) tm.assert_series_equal(result, expected) data = [np.datetime64('2013-01-01'), np.datetime64('2013-01-02'), np.datetime64('2013-01-03')] result, bins = cut(data, 3, retbins=True) tm.assert_series_equal(Series(result), expected) data = np.array([np.datetime64('2013-01-01'), np.datetime64('2013-01-02'), np.datetime64('2013-01-03')]) result, bins = cut(data, 3, retbins=True) tm.assert_series_equal(Series(result), expected) data = DatetimeIndex(['2013-01-01', '2013-01-02', '2013-01-03']) result, bins = cut(data, 3, retbins=True) tm.assert_series_equal(Series(result), expected) def test_datetime_bin(self): data = [np.datetime64('2012-12-13'), np.datetime64('2012-12-15')] bin_data = ['2012-12-12', '2012-12-14', '2012-12-16'] expected = ( Series(IntervalIndex([ Interval(Timestamp(bin_data[0]), Timestamp(bin_data[1])), Interval(Timestamp(bin_data[1]), Timestamp(bin_data[2]))])) .astype(CDT(ordered=True))) for conv in [Timestamp, Timestamp, np.datetime64]: bins = [conv(v) for v in bin_data] result = cut(data, bins=bins) tm.assert_series_equal(Series(result), expected) bin_pydatetime = [Timestamp(v).to_pydatetime() for v in bin_data] result = cut(data, bins=bin_pydatetime) tm.assert_series_equal(Series(result), expected) bins = to_datetime(bin_data) result = cut(data, bins=bin_pydatetime) tm.assert_series_equal(Series(result), expected) def test_datetime_nan(self): def f(): cut(date_range('20130101', periods=3), bins=[0, 2, 4]) pytest.raises(ValueError, f) result = cut(date_range('20130102', periods=5), bins=date_range('20130101', periods=2)) mask = result.categories.isna() tm.assert_numpy_array_equal(mask, np.array([False])) mask = result.isna() tm.assert_numpy_array_equal( mask, np.array([False, True, True, True, True])) @pytest.mark.parametrize( "array_1_writeable, array_2_writeable", [(True, True), (True, False), (False, False)]) def test_cut_read_only(self, array_1_writeable, array_2_writeable): array_1 = np.arange(0, 100, 10) array_1.flags.writeable = array_1_writeable array_2 = np.arange(0, 100, 10) array_2.flags.writeable = array_2_writeable hundred_elements = np.arange(100) tm.assert_categorical_equal(cut(hundred_elements, array_1), cut(hundred_elements, array_2))
true
true
f7262bc097e3f3237af10e09e9f2a090111ba335
639
py
Python
app1/migrations/0029_auto_20200630_0454.py
vashuteotia123/zbcvit
da29b3281ccc87481a264b63c5b6c3a549945f33
[ "MIT" ]
6
2021-09-16T16:46:56.000Z
2022-02-06T13:00:08.000Z
app1/migrations/0029_auto_20200630_0454.py
vashuteotia123/zbcvit
da29b3281ccc87481a264b63c5b6c3a549945f33
[ "MIT" ]
null
null
null
app1/migrations/0029_auto_20200630_0454.py
vashuteotia123/zbcvit
da29b3281ccc87481a264b63c5b6c3a549945f33
[ "MIT" ]
1
2021-09-14T09:26:58.000Z
2021-09-14T09:26:58.000Z
# Generated by Django 3.0.6 on 2020-06-30 04:54 import datetime from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('app1', '0028_resources_resource_date_time'), ] operations = [ migrations.AlterField( model_name='resources', name='resource_content', field=models.CharField(max_length=100), ), migrations.AlterField( model_name='resources', name='resource_date_time', field=models.DateTimeField(default=datetime.datetime(2020, 6, 30, 4, 54, 42, 601836)), ), ]
25.56
98
0.613459
import datetime from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('app1', '0028_resources_resource_date_time'), ] operations = [ migrations.AlterField( model_name='resources', name='resource_content', field=models.CharField(max_length=100), ), migrations.AlterField( model_name='resources', name='resource_date_time', field=models.DateTimeField(default=datetime.datetime(2020, 6, 30, 4, 54, 42, 601836)), ), ]
true
true
f7262bf49b112b6af91f95cf730a2d48d81c073f
35
py
Python
tests/components/halohome/__init__.py
nayaverdier/core
7352602e47c2de0e54a20f427559c00bad2cd7b8
[ "Apache-2.0" ]
null
null
null
tests/components/halohome/__init__.py
nayaverdier/core
7352602e47c2de0e54a20f427559c00bad2cd7b8
[ "Apache-2.0" ]
null
null
null
tests/components/halohome/__init__.py
nayaverdier/core
7352602e47c2de0e54a20f427559c00bad2cd7b8
[ "Apache-2.0" ]
null
null
null
"""HALO Home integration tests."""
17.5
34
0.685714
true
true
f7262d295996bb4520eaf83ad3c5682b56392b0c
4,741
py
Python
lapidary/Utils.py
efeslab/dolma
039c5ed768bc879a83424075ccccf3bbd31794ae
[ "BSD-3-Clause" ]
6
2021-01-02T18:29:22.000Z
2021-10-03T18:55:01.000Z
lapidary/Utils.py
efeslab/dolma
039c5ed768bc879a83424075ccccf3bbd31794ae
[ "BSD-3-Clause" ]
2
2021-02-15T15:34:34.000Z
2022-01-30T17:46:00.000Z
lapidary/Utils.py
efeslab/dolma
039c5ed768bc879a83424075ccccf3bbd31794ae
[ "BSD-3-Clause" ]
3
2020-10-23T14:10:39.000Z
2021-11-16T10:00:40.000Z
import json from pathlib import Path from pprint import pprint import re, os from time import sleep class StatsFile: def __init__(self, file_path): self.current_offset = 0 self.file_size = 0 self.file_path = file_path self.cached_stats = {} self.backup_file_path = file_path.parent / "stats.backup.txt" self.backup_stats = '' def __del__(self): print('Cleaning stats...') if self.file_path.exists(): self.file_path.unlink() if self.backup_file_path.exists(): self.backup_file_path.unlink() with self.backup_file_path.open('w') as bk: bk.write(self.backup_stats) def get_current_stats(self): import m5 stats = {} m5.stats.dump() if self.file_size == self.file_path.stat().st_size: return self.cached_stats with self.file_path.open('r') as fd: tmp = fd.read() self.backup_stats = tmp[self.current_offset:] with self.file_path.open() as fd: fd.seek(self.current_offset) for line in fd: if '--------' in line or len(line.strip()) == 0: continue pieces = [x for x in line.split(' ') if len(x.strip()) > 0] if len(pieces) > 1: key = pieces[0].strip() val = pieces[1].strip() stats[key] = val self.current_offset = fd.tell() self.cached_stats = stats with self.file_path.open('w') as f: f.truncate() size = self.file_path.stat().st_size self.file_size = size return stats def parse_perf_output_insts(stderr_str): inst_pattern = re.compile('([0-9\,]+)\s*instructions') for line in stderr_str.split('\n'): line = line.strip() matches = inst_pattern.match(line) if matches is not None: return int(matches.group(1).replace(',','')) def get_num_insts_perf(cmd): from subprocess import run, PIPE if type(cmd) == str: cmd = [cmd] perf = ['perf', 'stat', '-e', 'instructions'] proc = run(perf + cmd, stdout=PIPE, stderr=PIPE) return parse_perf_output_insts(proc.stderr.decode('ascii')) def get_num_insts_perf_from_pid(pid): from subprocess import Popen, PIPE perf = ['perf', 'stat', '-e', 'instructions', '-p', str(pid)] proc = Popen(perf, stdout=PIPE, stderr=PIPE) sleep(timeout) proc.terminate() proc.wait() return parse_perf_output_insts(proc.stderr.decode('ascii')) def parse_mem_size_string(mem_size_str): mem_pattern = re.compile(r'([0-9]+)([kmgKMG][bB])?') matches = mem_pattern.match(mem_size_str) if not matches: raise Exception('{} is not a valid memory size!'.format(mem_size_str)) mem_size = int(matches.group(1)) try: size_modifier = matches.group(2).lower() if 'kb' in size_modifier: mem_size *= 1024 if 'mb' in size_modifier: mem_size *= (1024 ** 2) if 'gb' in size_modifier: mem_size *= (1024 ** 3) except: pass return mem_size def select_at_random(list_of_things, num_to_select): import random return random.sample(list_of_things, num_to_select) def select_evenly_spaced(list_or_dict, num_to_select): from natsort import natsorted, ns from copy import copy if num_to_select > len(list_or_dict): return copy(list_or_dict) sorted_keys = natsorted(list_or_dict, alg=ns.IGNORECASE) # https://en.wikipedia.org/wiki/Bresenham%27s_line_algorithm f = lambda m, n: [i*n//m + n//(2*m) for i in range(m)] indices = f(num_to_select, len(sorted_keys)) sublist = [ sorted_keys[i] for i in indices ] if isinstance(list_or_dict, list): return sublist return { k: list_or_dict[k] for k in sublist } def get_mem_size_from_mappings_file(mappings_file): assert isinstance(mappings_file, Path) with mappings_file.open() as f: mappings = json.load(f) return mappings['mem_size'] def get_directory_entries_by_time(directory_path): from natsort import natsorted assert isinstance(directory_path, Path) get_name = lambda d: str(d.name) return natsorted(directory_path.iterdir(), key=get_name) def _get_msr(identifier): import ctypes libc = ctypes.CDLL(None) syscall = libc.syscall SYS_arch_prctl = 158 ret_val = ctypes.c_uint64() syscall(SYS_arch_prctl, identifier, ctypes.pointer(ret_val)) return ret_val.value def get_fs_base(): ARCH_GET_FS = 0x1003 return _get_msr(ARCH_GET_FS) def get_gs_base(): ARCH_GET_GS = 0x1004 return _get_msr(ARCH_GET_GS)
30.986928
78
0.62645
import json from pathlib import Path from pprint import pprint import re, os from time import sleep class StatsFile: def __init__(self, file_path): self.current_offset = 0 self.file_size = 0 self.file_path = file_path self.cached_stats = {} self.backup_file_path = file_path.parent / "stats.backup.txt" self.backup_stats = '' def __del__(self): print('Cleaning stats...') if self.file_path.exists(): self.file_path.unlink() if self.backup_file_path.exists(): self.backup_file_path.unlink() with self.backup_file_path.open('w') as bk: bk.write(self.backup_stats) def get_current_stats(self): import m5 stats = {} m5.stats.dump() if self.file_size == self.file_path.stat().st_size: return self.cached_stats with self.file_path.open('r') as fd: tmp = fd.read() self.backup_stats = tmp[self.current_offset:] with self.file_path.open() as fd: fd.seek(self.current_offset) for line in fd: if '--------' in line or len(line.strip()) == 0: continue pieces = [x for x in line.split(' ') if len(x.strip()) > 0] if len(pieces) > 1: key = pieces[0].strip() val = pieces[1].strip() stats[key] = val self.current_offset = fd.tell() self.cached_stats = stats with self.file_path.open('w') as f: f.truncate() size = self.file_path.stat().st_size self.file_size = size return stats def parse_perf_output_insts(stderr_str): inst_pattern = re.compile('([0-9\,]+)\s*instructions') for line in stderr_str.split('\n'): line = line.strip() matches = inst_pattern.match(line) if matches is not None: return int(matches.group(1).replace(',','')) def get_num_insts_perf(cmd): from subprocess import run, PIPE if type(cmd) == str: cmd = [cmd] perf = ['perf', 'stat', '-e', 'instructions'] proc = run(perf + cmd, stdout=PIPE, stderr=PIPE) return parse_perf_output_insts(proc.stderr.decode('ascii')) def get_num_insts_perf_from_pid(pid): from subprocess import Popen, PIPE perf = ['perf', 'stat', '-e', 'instructions', '-p', str(pid)] proc = Popen(perf, stdout=PIPE, stderr=PIPE) sleep(timeout) proc.terminate() proc.wait() return parse_perf_output_insts(proc.stderr.decode('ascii')) def parse_mem_size_string(mem_size_str): mem_pattern = re.compile(r'([0-9]+)([kmgKMG][bB])?') matches = mem_pattern.match(mem_size_str) if not matches: raise Exception('{} is not a valid memory size!'.format(mem_size_str)) mem_size = int(matches.group(1)) try: size_modifier = matches.group(2).lower() if 'kb' in size_modifier: mem_size *= 1024 if 'mb' in size_modifier: mem_size *= (1024 ** 2) if 'gb' in size_modifier: mem_size *= (1024 ** 3) except: pass return mem_size def select_at_random(list_of_things, num_to_select): import random return random.sample(list_of_things, num_to_select) def select_evenly_spaced(list_or_dict, num_to_select): from natsort import natsorted, ns from copy import copy if num_to_select > len(list_or_dict): return copy(list_or_dict) sorted_keys = natsorted(list_or_dict, alg=ns.IGNORECASE) f = lambda m, n: [i*n//m + n//(2*m) for i in range(m)] indices = f(num_to_select, len(sorted_keys)) sublist = [ sorted_keys[i] for i in indices ] if isinstance(list_or_dict, list): return sublist return { k: list_or_dict[k] for k in sublist } def get_mem_size_from_mappings_file(mappings_file): assert isinstance(mappings_file, Path) with mappings_file.open() as f: mappings = json.load(f) return mappings['mem_size'] def get_directory_entries_by_time(directory_path): from natsort import natsorted assert isinstance(directory_path, Path) get_name = lambda d: str(d.name) return natsorted(directory_path.iterdir(), key=get_name) def _get_msr(identifier): import ctypes libc = ctypes.CDLL(None) syscall = libc.syscall SYS_arch_prctl = 158 ret_val = ctypes.c_uint64() syscall(SYS_arch_prctl, identifier, ctypes.pointer(ret_val)) return ret_val.value def get_fs_base(): ARCH_GET_FS = 0x1003 return _get_msr(ARCH_GET_FS) def get_gs_base(): ARCH_GET_GS = 0x1004 return _get_msr(ARCH_GET_GS)
true
true
f7262d782adc22a7c34947e4dd8321f0a9a524dc
767
py
Python
src/shop/migrations/0038_auto_20170323_2021.py
flokli/bornhack-website
9dd6b0b23c2e6b1fb2c5f03a8766d4aa96d4443d
[ "BSD-3-Clause" ]
7
2017-04-14T15:28:29.000Z
2021-09-10T09:45:38.000Z
src/shop/migrations/0038_auto_20170323_2021.py
flokli/bornhack-website
9dd6b0b23c2e6b1fb2c5f03a8766d4aa96d4443d
[ "BSD-3-Clause" ]
799
2016-04-28T09:31:50.000Z
2022-03-29T09:05:02.000Z
src/shop/migrations/0038_auto_20170323_2021.py
flokli/bornhack-website
9dd6b0b23c2e6b1fb2c5f03a8766d4aa96d4443d
[ "BSD-3-Clause" ]
35
2016-04-28T09:23:53.000Z
2021-05-02T12:36:01.000Z
# -*- coding: utf-8 -*- # Generated by Django 1.10.5 on 2017-03-23 19:21 from __future__ import unicode_literals from django.db import migrations, models class Migration(migrations.Migration): dependencies = [("shop", "0037_auto_20170319_2204")] operations = [ migrations.AlterField( model_name="order", name="payment_method", field=models.CharField( blank=True, choices=[ ("credit_card", "Credit card"), ("blockchain", "Blockchain"), ("bank_transfer", "Bank transfer"), ("cash", "Cash"), ], default="", max_length=50, ), ) ]
26.448276
56
0.494133
from __future__ import unicode_literals from django.db import migrations, models class Migration(migrations.Migration): dependencies = [("shop", "0037_auto_20170319_2204")] operations = [ migrations.AlterField( model_name="order", name="payment_method", field=models.CharField( blank=True, choices=[ ("credit_card", "Credit card"), ("blockchain", "Blockchain"), ("bank_transfer", "Bank transfer"), ("cash", "Cash"), ], default="", max_length=50, ), ) ]
true
true
f7262d80fffdbffc0cf859384e8240918a32ea46
31,714
py
Python
python/rz_linear/impl/RzLinearBackward.py
Jokeren/RzLinear
d318d95254cd5c3dcf814774d22dc71179450aa0
[ "MIT" ]
null
null
null
python/rz_linear/impl/RzLinearBackward.py
Jokeren/RzLinear
d318d95254cd5c3dcf814774d22dc71179450aa0
[ "MIT" ]
null
null
null
python/rz_linear/impl/RzLinearBackward.py
Jokeren/RzLinear
d318d95254cd5c3dcf814774d22dc71179450aa0
[ "MIT" ]
null
null
null
from typing import Tuple import torch import triton import triton.language as tl def rz_linear_backward_tl(input: torch.tensor, hashed_weight: torch.tensor, output_grad: torch.tensor, M: int, K: int, N: int, H: int, R3: int, R2: int, R1: int, R0: int, allow_tf32: bool = True, allow_autotune: bool = False, BLOCK_SIZE_M: int = 64, BLOCK_SIZE_N: int = 64, BLOCK_SIZE_K: int = 32, GROUP_SIZE: int = 4) -> Tuple[torch.tensor, torch.tensor]: input_grad = rz_linear_backward_input_grad_tl(output_grad, hashed_weight, M, K, N, H, R3, R2, R1, R0, allow_tf32=allow_tf32, allow_autotune=allow_autotune, BLOCK_SIZE_M=BLOCK_SIZE_M, BLOCK_SIZE_N=BLOCK_SIZE_N, BLOCK_SIZE_K=BLOCK_SIZE_K, GROUP_SIZE=GROUP_SIZE) weight_grad = rz_linear_backward_weight_grad_tl(input, output_grad, M, K, N, H, R3, R2, R1, R0, allow_tf32=allow_tf32, allow_autotune=allow_autotune, BLOCK_SIZE_M=BLOCK_SIZE_M, BLOCK_SIZE_N=BLOCK_SIZE_N, BLOCK_SIZE_K=BLOCK_SIZE_K, GROUP_SIZE=GROUP_SIZE) return input_grad, weight_grad def rz_linear_backward_weight_grad_tl(input: torch.tensor, output_grad: torch.tensor, M: int, K: int, N: int, H: int, R3: int, R2: int, R1: int, R0: int, allow_tf32: bool = True, allow_autotune: bool = True, BLOCK_SIZE_M: int = 64, BLOCK_SIZE_N: int = 64, BLOCK_SIZE_K: int = 32, GROUP_SIZE: int = 8) -> torch.tensor: ''' Compute input^T x output_grad and return a weight_grad tensor Args: input (Tensor): A MxK tensor output_grad (Tensor): A MxN tensor M, K, N, H (int): Matrix dimensions R3, R2, R1, R0 (int): Random numbers allow_tf32 (bool): If tensor core is allowed BLOCK_SIZE_M, BLOCK_SIZE_N, BLOCK_SIZE_K, GROUP_SIZE: Matrix tiling parameters for performance tunning Returns: hashed_weight_grad (Tensor): A 1xH tensor ''' assert (K % 4 == 0) assert (N % 4 == 0) # allocates output hashed_weight_grad = torch.zeros( (H), device=output_grad.device, dtype=output_grad.dtype) # 1D launch kernel where each block gets its own program. def grid(META): return ( triton.cdiv(K, META['BLOCK_SIZE_K']) * triton.cdiv(N, META['BLOCK_SIZE_N']), ) if allow_tf32: assert (M % 32 == 0) else: assert (M % 8 == 0) if allow_autotune: if allow_tf32: rz_linear_backward_weight_grad_kernel_tf32[grid]( input, output_grad, hashed_weight_grad, M, N, K, H, input.stride(1), input.stride(0), output_grad.stride(0), output_grad.stride(1), R3=R3, R2=R2, R1=R1, R0=R0, GROUP_SIZE=GROUP_SIZE ) else: rz_linear_backward_weight_grad_kernel_fp32[grid]( input, output_grad, hashed_weight_grad, M, N, K, H, input.stride(1), input.stride(0), output_grad.stride(0), output_grad.stride(1), R3=R3, R2=R2, R1=R1, R0=R0, GROUP_SIZE=GROUP_SIZE ) else: rz_linear_backward_weight_grad_kernel_notune[grid]( input, output_grad, hashed_weight_grad, M, N, K, H, input.stride(1), input.stride(0), output_grad.stride(0), output_grad.stride(1), R3=R3, R2=R2, R1=R1, R0=R0, allow_tf32=allow_tf32, GROUP_SIZE=GROUP_SIZE, BLOCK_SIZE_K=BLOCK_SIZE_K, BLOCK_SIZE_M=BLOCK_SIZE_M, BLOCK_SIZE_N=BLOCK_SIZE_N ) return hashed_weight_grad @triton.autotune( configs=[ # basic configs for compute-bound matmuls triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=8), triton.Config({'BLOCK_SIZE_N': 256, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=8), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_N': 256, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_N': 256, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_M': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_N': 256, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 16}, num_stages=2, num_warps=8), triton.Config({'BLOCK_SIZE_N': 256, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_M': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 32, 'BLOCK_SIZE_M': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_N': 32, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 32, 'BLOCK_SIZE_M': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_N': 32, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 16}, num_stages=2, num_warps=4), ], key=['M', 'N', 'K'], ) @triton.jit def rz_linear_backward_weight_grad_kernel_fp32( # Pointers to matrices a_ptr, b_ptr, c_ptr, # Matrix dimensions M, N, K, H, # The stride variables represent how much to increase the ptr by when moving by 1 # element in a particular dimension. stride_am, stride_ak, stride_bm, stride_bn, # Random numbers R3, R2, R1, R0, # Meta-parameters BLOCK_SIZE_M: tl.constexpr, BLOCK_SIZE_N: tl.constexpr, BLOCK_SIZE_K: tl.constexpr, GROUP_SIZE: tl.constexpr ): rz_linear_backward_weight_grad_core(a_ptr=a_ptr, b_ptr=b_ptr, c_ptr=c_ptr, M=M, N=N, K=K, H=H, stride_am=stride_am, stride_ak=stride_ak, stride_bm=stride_bm, stride_bn=stride_bn, R3=R3, R2=R2, R1=R1, R0=R0, allow_tf32=False, BLOCK_SIZE_M=BLOCK_SIZE_M, BLOCK_SIZE_N=BLOCK_SIZE_N, BLOCK_SIZE_K=BLOCK_SIZE_K, GROUP_SIZE=GROUP_SIZE) @triton.autotune( configs=[ # basic configs for compute-bound matmuls triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=8), triton.Config({'BLOCK_SIZE_N': 256, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=8), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_N': 256, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_N': 256, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_M': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_N': 256, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=8), triton.Config({'BLOCK_SIZE_N': 256, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=8), triton.Config({'BLOCK_SIZE_N': 256, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_M': 32}, num_stages=2, num_warps=8), triton.Config({'BLOCK_SIZE_N': 256, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=2, num_warps=8), triton.Config({'BLOCK_SIZE_N': 256, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 32}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_M': 32}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 32}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 32}, num_stages=2, num_warps=4), ], key=['M', 'N', 'K'], ) @triton.jit def rz_linear_backward_weight_grad_kernel_tf32( # Pointers to matrices a_ptr, b_ptr, c_ptr, # Matrix dimensions M, N, K, H, # The stride variables represent how much to increase the ptr by when moving by 1 # element in a particular dimension. stride_am, stride_ak, stride_bm, stride_bn, # Random numbers R3, R2, R1, R0, # Meta-parameters BLOCK_SIZE_M: tl.constexpr, BLOCK_SIZE_N: tl.constexpr, BLOCK_SIZE_K: tl.constexpr, GROUP_SIZE: tl.constexpr ): rz_linear_backward_weight_grad_core(a_ptr=a_ptr, b_ptr=b_ptr, c_ptr=c_ptr, M=M, N=N, K=K, H=H, stride_am=stride_am, stride_ak=stride_ak, stride_bm=stride_bm, stride_bn=stride_bn, R3=R3, R2=R2, R1=R1, R0=R0, allow_tf32=True, BLOCK_SIZE_M=BLOCK_SIZE_M, BLOCK_SIZE_N=BLOCK_SIZE_N, BLOCK_SIZE_K=BLOCK_SIZE_K, GROUP_SIZE=GROUP_SIZE) @triton.jit def rz_linear_backward_weight_grad_kernel_notune( # Pointers to matrices a_ptr, b_ptr, c_ptr, # Matrix dimensions M, N, K, H, # The stride variables represent how much to increase the ptr by when moving by 1 # element in a particular dimension. stride_am, stride_ak, stride_bm, stride_bn, # Random numbers R3, R2, R1, R0, allow_tf32: tl.constexpr, # Meta-parameters BLOCK_SIZE_M: tl.constexpr, BLOCK_SIZE_N: tl.constexpr, BLOCK_SIZE_K: tl.constexpr, GROUP_SIZE: tl.constexpr ): rz_linear_backward_weight_grad_core(a_ptr=a_ptr, b_ptr=b_ptr, c_ptr=c_ptr, M=M, N=N, K=K, H=H, stride_am=stride_am, stride_ak=stride_ak, stride_bm=stride_bm, stride_bn=stride_bn, R3=R3, R2=R2, R1=R1, R0=R0, allow_tf32=allow_tf32, BLOCK_SIZE_M=BLOCK_SIZE_M, BLOCK_SIZE_N=BLOCK_SIZE_N, BLOCK_SIZE_K=BLOCK_SIZE_K, GROUP_SIZE=GROUP_SIZE) @triton.jit def rz_linear_backward_weight_grad_core( # Pointers to matrices a_ptr, b_ptr, c_ptr, # Matrix dimensions M, N, K, H, # The stride variables represent how much to increase the ptr by when moving by 1 # element in a particular dimension. stride_am, stride_ak, stride_bm, stride_bn, # Random numbers R3, R2, R1, R0, allow_tf32: tl.constexpr, # Meta-parameters BLOCK_SIZE_M: tl.constexpr, BLOCK_SIZE_N: tl.constexpr, BLOCK_SIZE_K: tl.constexpr, GROUP_SIZE: tl.constexpr ): """Kernel for computing the matmul C = A^T x B. A has shape (M, K), B has shape (M, N) and C has shape (K, N) """ pid = tl.program_id(axis=0) num_pid_k = tl.cdiv(K, BLOCK_SIZE_K) num_pid_n = tl.cdiv(N, BLOCK_SIZE_N) num_pid_in_group = GROUP_SIZE * num_pid_n group_id = pid // num_pid_in_group first_pid_k = group_id * GROUP_SIZE group_size_k = min(num_pid_k - first_pid_k, GROUP_SIZE) pid_k = first_pid_k + (pid % group_size_k) pid_n = (pid % num_pid_in_group) // group_size_k # [BLOCK_SIZE_K, BLOCK_SIZE_M] offs_ak = pid_k * BLOCK_SIZE_K + tl.arange(0, BLOCK_SIZE_K) offs_am = tl.arange(0, BLOCK_SIZE_M) a_ptrs = a_ptr + offs_ak[:, None] * \ stride_am + offs_am[None, :] * stride_ak # [BLOCK_SIZE_M, BLOCK_SIZE_N] offs_bn = pid_n * BLOCK_SIZE_N + tl.arange(0, BLOCK_SIZE_N) offs_bm = tl.arange(0, BLOCK_SIZE_M) b_ptrs = b_ptr + offs_bm[:, None] * \ stride_bm + offs_bn[None, :] * stride_bn # [BLOCK_SIZE_K, BLOCK_SIZE_N] c = tl.zeros((BLOCK_SIZE_K, BLOCK_SIZE_N), dtype=tl.float32) for _ in range(0, M//BLOCK_SIZE_M): # Note that for simplicity, we don't apply a mask here. # This means that if M is not a multiple of BLOCK_SIZE_M, # this will access out-of-bounds memory and produce an # error or (worse!) incorrect results. # TODO(Keren): Add M checks a = tl.load(a_ptrs) b = tl.load(b_ptrs) # We accumulate along the M dimension c += tl.dot(a, b, allow_tf32=allow_tf32) # Advance the ptrs to the next M block a_ptrs += BLOCK_SIZE_M * stride_ak b_ptrs += BLOCK_SIZE_M * stride_bm # ----------------------------------------------------------- # Write back the block of the output matrix C c_offset = c_ptr + tl.arange(0, BLOCK_SIZE_K)[:, None] * \ BLOCK_SIZE_N + tl.arange(0, BLOCK_SIZE_N)[None, :] c_ptrs = c_offset + (pid_k * R3 + pid_n * R2 + R1) % R0 % (H - BLOCK_SIZE_K * BLOCK_SIZE_N) tl.atomic_add(c_ptrs, c) def rz_linear_backward_input_grad_tl(output_grad: torch.tensor, hashed_weight: torch.tensor, M: int, K: int, N: int, H: int, R3: int, R2: int, R1: int, R0: int, allow_tf32: bool = True, allow_autotune: bool = True, BLOCK_SIZE_M: int = 64, BLOCK_SIZE_N: int = 64, BLOCK_SIZE_K: int = 32, GROUP_SIZE: int = 4) -> torch.tensor: ''' Compute output_grad x hashed_weight^T and return an input_grad tensor Args: output_grad (Tensor): A MxN tensor hashed_weight (Tensor): A 1xH (KxN) tensor M, K, N, H (int): matrix dimensions R3, R2, R1, R0 (int): random numbers allow_tf32 (bool): If tensor core is allowed BLOCK_SIZE_M, BLOCK_SIZE_N, BLOCK_SIZE_K, GROUP_SIZE: Matrix tiling parameters for performance tunning Returns: input_grad (Tensor): A MxK tensor ''' assert (M % 4 == 0) assert (K % 4 == 0) # allocates output input_grad = torch.empty( (M, K), device=output_grad.device, dtype=output_grad.dtype) if allow_tf32: assert (N % 32 == 0) else: assert (N % 8 == 0) # 1D launch kernel where each block gets its own program. def grid(META): return ( triton.cdiv(M, META['BLOCK_SIZE_M']) * triton.cdiv(K, META['BLOCK_SIZE_K']), ) if allow_autotune: if allow_tf32: rz_linear_backward_input_grad_kernel_tf32[grid]( output_grad, hashed_weight, input_grad, M, N, K, H, output_grad.stride(0), output_grad.stride(1), input_grad.stride(0), input_grad.stride(1), R3=R3, R2=R2, R1=R1, R0=R0, GROUP_SIZE=GROUP_SIZE ) else: rz_linear_backward_input_grad_kernel_fp32[grid]( output_grad, hashed_weight, input_grad, M, N, K, H, output_grad.stride(0), output_grad.stride(1), input_grad.stride(0), input_grad.stride(1), R3=R3, R2=R2, R1=R1, R0=R0, GROUP_SIZE=GROUP_SIZE ) else: rz_linear_backward_input_grad_kernel_notune[grid]( output_grad, hashed_weight, input_grad, M, N, K, H, output_grad.stride(0), output_grad.stride(1), input_grad.stride(0), input_grad.stride(1), R3=R3, R2=R2, R1=R1, R0=R0, allow_tf32=allow_tf32, num_warps=4, num_stages=3, BLOCK_SIZE_M=BLOCK_SIZE_M, BLOCK_SIZE_N=BLOCK_SIZE_N, BLOCK_SIZE_K=BLOCK_SIZE_K, GROUP_SIZE=GROUP_SIZE ) return input_grad @triton.autotune( configs=[ # basic configs for compute-bound matmuls triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=8), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_N': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_N': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_N': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_N': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_N': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_N': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 32, 'BLOCK_SIZE_N': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_M': 32, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_N': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 32, 'BLOCK_SIZE_N': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_M': 32, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 16}, num_stages=2, num_warps=4), ], key=['M', 'N', 'K'], ) @triton.jit def rz_linear_backward_input_grad_kernel_fp32( # Pointers to matrices a_ptr, b_ptr, c_ptr, # Matrix dimensions M, N, K, H, # The stride variables represent how much to increase the ptr by when moving by 1 # element in a particular dimension. stride_am, stride_an, stride_cm, stride_ck, # Random numbers R3, R2, R1, R0, # Meta-parameters BLOCK_SIZE_M: tl.constexpr, BLOCK_SIZE_N: tl.constexpr, BLOCK_SIZE_K: tl.constexpr, GROUP_SIZE: tl.constexpr ): rz_linear_backward_input_grad_core(a_ptr=a_ptr, b_ptr=b_ptr, c_ptr=c_ptr, M=M, N=N, K=K, H=H, stride_am=stride_am, stride_an=stride_an, stride_cm=stride_cm, stride_ck=stride_ck, R3=R3, R2=R2, R1=R1, R0=R0, allow_tf32=False, BLOCK_SIZE_M=BLOCK_SIZE_M, BLOCK_SIZE_N=BLOCK_SIZE_N, BLOCK_SIZE_K=BLOCK_SIZE_K, GROUP_SIZE=GROUP_SIZE) @triton.autotune( configs=[ # basic configs for compute-bound matmuls triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=8), triton.Config({'BLOCK_SIZE_M': 256, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=8), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_M': 256, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_M': 256, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_N': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_N': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_N': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_N': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_M': 256, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=8), triton.Config({'BLOCK_SIZE_M': 256, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=8), triton.Config({'BLOCK_SIZE_M': 256, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_N': 32}, num_stages=2, num_warps=8), triton.Config({'BLOCK_SIZE_M': 256, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 32}, num_stages=2, num_warps=8), triton.Config({'BLOCK_SIZE_M': 256, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_N': 32}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_N': 32}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 32}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 32}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_N': 32}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_N': 32}, num_stages=2, num_warps=4), ], key=['M', 'N', 'K'], ) @triton.jit def rz_linear_backward_input_grad_kernel_tf32( # Pointers to matrices a_ptr, b_ptr, c_ptr, # Matrix dimensions M, N, K, H, # The stride variables represent how much to increase the ptr by when moving by 1 # element in a particular dimension. stride_am, stride_an, stride_cm, stride_ck, # Random numbers R3, R2, R1, R0, # Meta-parameters BLOCK_SIZE_M: tl.constexpr, BLOCK_SIZE_N: tl.constexpr, BLOCK_SIZE_K: tl.constexpr, GROUP_SIZE: tl.constexpr ): rz_linear_backward_input_grad_core(a_ptr=a_ptr, b_ptr=b_ptr, c_ptr=c_ptr, M=M, N=N, K=K, H=H, stride_am=stride_am, stride_an=stride_an, stride_cm=stride_cm, stride_ck=stride_ck, R3=R3, R2=R2, R1=R1, R0=R0, allow_tf32=True, BLOCK_SIZE_M=BLOCK_SIZE_M, BLOCK_SIZE_N=BLOCK_SIZE_N, BLOCK_SIZE_K=BLOCK_SIZE_K, GROUP_SIZE=GROUP_SIZE) @triton.jit def rz_linear_backward_input_grad_kernel_notune( # Pointers to matrices a_ptr, b_ptr, c_ptr, # Matrix dimensions M, N, K, H, # The stride variables represent how much to increase the ptr by when moving by 1 # element in a particular dimension. stride_am, stride_an, stride_cm, stride_ck, # Random numbers R3, R2, R1, R0, allow_tf32: tl.constexpr, # Meta-parameters BLOCK_SIZE_M: tl.constexpr, BLOCK_SIZE_N: tl.constexpr, BLOCK_SIZE_K: tl.constexpr, GROUP_SIZE: tl.constexpr ): rz_linear_backward_input_grad_core(a_ptr=a_ptr, b_ptr=b_ptr, c_ptr=c_ptr, M=M, N=N, K=K, H=H, stride_am=stride_am, stride_an=stride_an, stride_cm=stride_cm, stride_ck=stride_ck, R3=R3, R2=R2, R1=R1, R0=R0, allow_tf32=allow_tf32, BLOCK_SIZE_M=BLOCK_SIZE_M, BLOCK_SIZE_N=BLOCK_SIZE_N, BLOCK_SIZE_K=BLOCK_SIZE_K, GROUP_SIZE=GROUP_SIZE) @triton.jit def rz_linear_backward_input_grad_core( # Pointers to matrices a_ptr, b_ptr, c_ptr, # Matrix dimensions M, N, K, H, # The stride variables represent how much to increase the ptr by when moving by 1 # element in a particular dimension. stride_am, stride_an, stride_cm, stride_ck, # Random numbers R3, R2, R1, R0, allow_tf32: tl.constexpr, # Meta-parameters BLOCK_SIZE_M: tl.constexpr, BLOCK_SIZE_N: tl.constexpr, BLOCK_SIZE_K: tl.constexpr, GROUP_SIZE: tl.constexpr ): """Kernel for computing the matmul C = (A x B^T) A has shape (M, N), B has shape H->(K, N) and C has shape (M, K) """ pid = tl.program_id(axis=0) num_pid_k = tl.cdiv(K, BLOCK_SIZE_K) num_pid_m = tl.cdiv(M, BLOCK_SIZE_M) pid_m = pid // num_pid_k pid_k = pid % num_pid_k # [BLOCK_SIZE_M, BLOCK_SIZE_N] offs_am = pid_m * BLOCK_SIZE_M + tl.arange(0, BLOCK_SIZE_M) offs_an = tl.arange(0, BLOCK_SIZE_N) a_ptrs = a_ptr + offs_am[:, None] * \ stride_am + offs_an[None, :] * stride_an # [BLOCK_SIZE_N, BLOCK_SIZE_K] # Compute hash b_offset = b_ptr + \ tl.arange(0, BLOCK_SIZE_N)[ :, None] + tl.arange(0, BLOCK_SIZE_K)[None, :] * BLOCK_SIZE_N b_ptrs = b_offset + (pid_k * R3 + 0 * R2 + R1) % R0 % (H - BLOCK_SIZE_K * BLOCK_SIZE_N) # [BLOCK_SIZE_M, BLOCK_SIZE_K] c = tl.zeros((BLOCK_SIZE_M, BLOCK_SIZE_K), dtype=tl.float32) for n in range(0, N//BLOCK_SIZE_N): # Note that for simplicity, we don't apply a mask here. # This means that if N is not a multiple of BLOCK_SIZE_N, # this will access out-of-bounds memory and produce an # error or (worse!) incorrect results. # TODO(Keren): Add N checks a = tl.load(a_ptrs) b = tl.load(b_ptrs) # We accumulate along the N dimension c += tl.dot(a, b, allow_tf32=allow_tf32) # Advance the ptrs to the next N block a_ptrs += BLOCK_SIZE_N * stride_an b_ptrs = b_offset + (pid_k * R3 + (n + 1) * R2 + R1) % R0 % (H - BLOCK_SIZE_K * BLOCK_SIZE_N) # ----------------------------------------------------------- # Write back the block of the output matrix C # [BLOCK_SIZE_M, BLOCK_SIZE_K] offs_ck = pid_k * BLOCK_SIZE_K + tl.arange(0, BLOCK_SIZE_K) offs_cm = pid_m * BLOCK_SIZE_M + tl.arange(0, BLOCK_SIZE_M) c_ptrs = c_ptr + stride_cm * \ offs_cm[:, None] + stride_ck * offs_ck[None, :] c_mask = (offs_cm[:, None] < M) & (offs_ck[None, :] < K) tl.store(c_ptrs, c, mask=c_mask)
48.124431
159
0.574037
from typing import Tuple import torch import triton import triton.language as tl def rz_linear_backward_tl(input: torch.tensor, hashed_weight: torch.tensor, output_grad: torch.tensor, M: int, K: int, N: int, H: int, R3: int, R2: int, R1: int, R0: int, allow_tf32: bool = True, allow_autotune: bool = False, BLOCK_SIZE_M: int = 64, BLOCK_SIZE_N: int = 64, BLOCK_SIZE_K: int = 32, GROUP_SIZE: int = 4) -> Tuple[torch.tensor, torch.tensor]: input_grad = rz_linear_backward_input_grad_tl(output_grad, hashed_weight, M, K, N, H, R3, R2, R1, R0, allow_tf32=allow_tf32, allow_autotune=allow_autotune, BLOCK_SIZE_M=BLOCK_SIZE_M, BLOCK_SIZE_N=BLOCK_SIZE_N, BLOCK_SIZE_K=BLOCK_SIZE_K, GROUP_SIZE=GROUP_SIZE) weight_grad = rz_linear_backward_weight_grad_tl(input, output_grad, M, K, N, H, R3, R2, R1, R0, allow_tf32=allow_tf32, allow_autotune=allow_autotune, BLOCK_SIZE_M=BLOCK_SIZE_M, BLOCK_SIZE_N=BLOCK_SIZE_N, BLOCK_SIZE_K=BLOCK_SIZE_K, GROUP_SIZE=GROUP_SIZE) return input_grad, weight_grad def rz_linear_backward_weight_grad_tl(input: torch.tensor, output_grad: torch.tensor, M: int, K: int, N: int, H: int, R3: int, R2: int, R1: int, R0: int, allow_tf32: bool = True, allow_autotune: bool = True, BLOCK_SIZE_M: int = 64, BLOCK_SIZE_N: int = 64, BLOCK_SIZE_K: int = 32, GROUP_SIZE: int = 8) -> torch.tensor: assert (K % 4 == 0) assert (N % 4 == 0) hashed_weight_grad = torch.zeros( (H), device=output_grad.device, dtype=output_grad.dtype) def grid(META): return ( triton.cdiv(K, META['BLOCK_SIZE_K']) * triton.cdiv(N, META['BLOCK_SIZE_N']), ) if allow_tf32: assert (M % 32 == 0) else: assert (M % 8 == 0) if allow_autotune: if allow_tf32: rz_linear_backward_weight_grad_kernel_tf32[grid]( input, output_grad, hashed_weight_grad, M, N, K, H, input.stride(1), input.stride(0), output_grad.stride(0), output_grad.stride(1), R3=R3, R2=R2, R1=R1, R0=R0, GROUP_SIZE=GROUP_SIZE ) else: rz_linear_backward_weight_grad_kernel_fp32[grid]( input, output_grad, hashed_weight_grad, M, N, K, H, input.stride(1), input.stride(0), output_grad.stride(0), output_grad.stride(1), R3=R3, R2=R2, R1=R1, R0=R0, GROUP_SIZE=GROUP_SIZE ) else: rz_linear_backward_weight_grad_kernel_notune[grid]( input, output_grad, hashed_weight_grad, M, N, K, H, input.stride(1), input.stride(0), output_grad.stride(0), output_grad.stride(1), R3=R3, R2=R2, R1=R1, R0=R0, allow_tf32=allow_tf32, GROUP_SIZE=GROUP_SIZE, BLOCK_SIZE_K=BLOCK_SIZE_K, BLOCK_SIZE_M=BLOCK_SIZE_M, BLOCK_SIZE_N=BLOCK_SIZE_N ) return hashed_weight_grad @triton.autotune( configs=[ triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=8), triton.Config({'BLOCK_SIZE_N': 256, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=8), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_N': 256, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_N': 256, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_M': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_N': 256, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 16}, num_stages=2, num_warps=8), triton.Config({'BLOCK_SIZE_N': 256, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_M': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 32, 'BLOCK_SIZE_M': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_N': 32, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 32, 'BLOCK_SIZE_M': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_N': 32, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 16}, num_stages=2, num_warps=4), ], key=['M', 'N', 'K'], ) @triton.jit def rz_linear_backward_weight_grad_kernel_fp32( a_ptr, b_ptr, c_ptr, M, N, K, H, stride_am, stride_ak, stride_bm, stride_bn, R3, R2, R1, R0, BLOCK_SIZE_M: tl.constexpr, BLOCK_SIZE_N: tl.constexpr, BLOCK_SIZE_K: tl.constexpr, GROUP_SIZE: tl.constexpr ): rz_linear_backward_weight_grad_core(a_ptr=a_ptr, b_ptr=b_ptr, c_ptr=c_ptr, M=M, N=N, K=K, H=H, stride_am=stride_am, stride_ak=stride_ak, stride_bm=stride_bm, stride_bn=stride_bn, R3=R3, R2=R2, R1=R1, R0=R0, allow_tf32=False, BLOCK_SIZE_M=BLOCK_SIZE_M, BLOCK_SIZE_N=BLOCK_SIZE_N, BLOCK_SIZE_K=BLOCK_SIZE_K, GROUP_SIZE=GROUP_SIZE) @triton.autotune( configs=[ triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=8), triton.Config({'BLOCK_SIZE_N': 256, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=8), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_N': 256, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_N': 256, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_M': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_N': 256, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=8), triton.Config({'BLOCK_SIZE_N': 256, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=8), triton.Config({'BLOCK_SIZE_N': 256, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_M': 32}, num_stages=2, num_warps=8), triton.Config({'BLOCK_SIZE_N': 256, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=2, num_warps=8), triton.Config({'BLOCK_SIZE_N': 256, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 32}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_M': 32}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_M': 32}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_N': 128, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 32}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_N': 64, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_M': 32}, num_stages=2, num_warps=4), ], key=['M', 'N', 'K'], ) @triton.jit def rz_linear_backward_weight_grad_kernel_tf32( a_ptr, b_ptr, c_ptr, M, N, K, H, stride_am, stride_ak, stride_bm, stride_bn, R3, R2, R1, R0, BLOCK_SIZE_M: tl.constexpr, BLOCK_SIZE_N: tl.constexpr, BLOCK_SIZE_K: tl.constexpr, GROUP_SIZE: tl.constexpr ): rz_linear_backward_weight_grad_core(a_ptr=a_ptr, b_ptr=b_ptr, c_ptr=c_ptr, M=M, N=N, K=K, H=H, stride_am=stride_am, stride_ak=stride_ak, stride_bm=stride_bm, stride_bn=stride_bn, R3=R3, R2=R2, R1=R1, R0=R0, allow_tf32=True, BLOCK_SIZE_M=BLOCK_SIZE_M, BLOCK_SIZE_N=BLOCK_SIZE_N, BLOCK_SIZE_K=BLOCK_SIZE_K, GROUP_SIZE=GROUP_SIZE) @triton.jit def rz_linear_backward_weight_grad_kernel_notune( a_ptr, b_ptr, c_ptr, M, N, K, H, stride_am, stride_ak, stride_bm, stride_bn, R3, R2, R1, R0, allow_tf32: tl.constexpr, BLOCK_SIZE_M: tl.constexpr, BLOCK_SIZE_N: tl.constexpr, BLOCK_SIZE_K: tl.constexpr, GROUP_SIZE: tl.constexpr ): rz_linear_backward_weight_grad_core(a_ptr=a_ptr, b_ptr=b_ptr, c_ptr=c_ptr, M=M, N=N, K=K, H=H, stride_am=stride_am, stride_ak=stride_ak, stride_bm=stride_bm, stride_bn=stride_bn, R3=R3, R2=R2, R1=R1, R0=R0, allow_tf32=allow_tf32, BLOCK_SIZE_M=BLOCK_SIZE_M, BLOCK_SIZE_N=BLOCK_SIZE_N, BLOCK_SIZE_K=BLOCK_SIZE_K, GROUP_SIZE=GROUP_SIZE) @triton.jit def rz_linear_backward_weight_grad_core( a_ptr, b_ptr, c_ptr, M, N, K, H, stride_am, stride_ak, stride_bm, stride_bn, R3, R2, R1, R0, allow_tf32: tl.constexpr, BLOCK_SIZE_M: tl.constexpr, BLOCK_SIZE_N: tl.constexpr, BLOCK_SIZE_K: tl.constexpr, GROUP_SIZE: tl.constexpr ): pid = tl.program_id(axis=0) num_pid_k = tl.cdiv(K, BLOCK_SIZE_K) num_pid_n = tl.cdiv(N, BLOCK_SIZE_N) num_pid_in_group = GROUP_SIZE * num_pid_n group_id = pid // num_pid_in_group first_pid_k = group_id * GROUP_SIZE group_size_k = min(num_pid_k - first_pid_k, GROUP_SIZE) pid_k = first_pid_k + (pid % group_size_k) pid_n = (pid % num_pid_in_group) // group_size_k offs_ak = pid_k * BLOCK_SIZE_K + tl.arange(0, BLOCK_SIZE_K) offs_am = tl.arange(0, BLOCK_SIZE_M) a_ptrs = a_ptr + offs_ak[:, None] * \ stride_am + offs_am[None, :] * stride_ak offs_bn = pid_n * BLOCK_SIZE_N + tl.arange(0, BLOCK_SIZE_N) offs_bm = tl.arange(0, BLOCK_SIZE_M) b_ptrs = b_ptr + offs_bm[:, None] * \ stride_bm + offs_bn[None, :] * stride_bn c = tl.zeros((BLOCK_SIZE_K, BLOCK_SIZE_N), dtype=tl.float32) for _ in range(0, M//BLOCK_SIZE_M): # This means that if M is not a multiple of BLOCK_SIZE_M, # this will access out-of-bounds memory and produce an # error or (worse!) incorrect results. # TODO(Keren): Add M checks a = tl.load(a_ptrs) b = tl.load(b_ptrs) # We accumulate along the M dimension c += tl.dot(a, b, allow_tf32=allow_tf32) # Advance the ptrs to the next M block a_ptrs += BLOCK_SIZE_M * stride_ak b_ptrs += BLOCK_SIZE_M * stride_bm # ----------------------------------------------------------- # Write back the block of the output matrix C c_offset = c_ptr + tl.arange(0, BLOCK_SIZE_K)[:, None] * \ BLOCK_SIZE_N + tl.arange(0, BLOCK_SIZE_N)[None, :] c_ptrs = c_offset + (pid_k * R3 + pid_n * R2 + R1) % R0 % (H - BLOCK_SIZE_K * BLOCK_SIZE_N) tl.atomic_add(c_ptrs, c) def rz_linear_backward_input_grad_tl(output_grad: torch.tensor, hashed_weight: torch.tensor, M: int, K: int, N: int, H: int, R3: int, R2: int, R1: int, R0: int, allow_tf32: bool = True, allow_autotune: bool = True, BLOCK_SIZE_M: int = 64, BLOCK_SIZE_N: int = 64, BLOCK_SIZE_K: int = 32, GROUP_SIZE: int = 4) -> torch.tensor: assert (M % 4 == 0) assert (K % 4 == 0) # allocates output input_grad = torch.empty( (M, K), device=output_grad.device, dtype=output_grad.dtype) if allow_tf32: assert (N % 32 == 0) else: assert (N % 8 == 0) # 1D launch kernel where each block gets its own program. def grid(META): return ( triton.cdiv(M, META['BLOCK_SIZE_M']) * triton.cdiv(K, META['BLOCK_SIZE_K']), ) if allow_autotune: if allow_tf32: rz_linear_backward_input_grad_kernel_tf32[grid]( output_grad, hashed_weight, input_grad, M, N, K, H, output_grad.stride(0), output_grad.stride(1), input_grad.stride(0), input_grad.stride(1), R3=R3, R2=R2, R1=R1, R0=R0, GROUP_SIZE=GROUP_SIZE ) else: rz_linear_backward_input_grad_kernel_fp32[grid]( output_grad, hashed_weight, input_grad, M, N, K, H, output_grad.stride(0), output_grad.stride(1), input_grad.stride(0), input_grad.stride(1), R3=R3, R2=R2, R1=R1, R0=R0, GROUP_SIZE=GROUP_SIZE ) else: rz_linear_backward_input_grad_kernel_notune[grid]( output_grad, hashed_weight, input_grad, M, N, K, H, output_grad.stride(0), output_grad.stride(1), input_grad.stride(0), input_grad.stride(1), R3=R3, R2=R2, R1=R1, R0=R0, allow_tf32=allow_tf32, num_warps=4, num_stages=3, BLOCK_SIZE_M=BLOCK_SIZE_M, BLOCK_SIZE_N=BLOCK_SIZE_N, BLOCK_SIZE_K=BLOCK_SIZE_K, GROUP_SIZE=GROUP_SIZE ) return input_grad @triton.autotune( configs=[ # basic configs for compute-bound matmuls triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=8), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_N': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_N': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_N': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_N': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_N': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_N': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 32, 'BLOCK_SIZE_N': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_M': 32, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_N': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 32, 'BLOCK_SIZE_N': 16}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_M': 32, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 16}, num_stages=2, num_warps=4), ], key=['M', 'N', 'K'], ) @triton.jit def rz_linear_backward_input_grad_kernel_fp32( # Pointers to matrices a_ptr, b_ptr, c_ptr, # Matrix dimensions M, N, K, H, # The stride variables represent how much to increase the ptr by when moving by 1 # element in a particular dimension. stride_am, stride_an, stride_cm, stride_ck, # Random numbers R3, R2, R1, R0, # Meta-parameters BLOCK_SIZE_M: tl.constexpr, BLOCK_SIZE_N: tl.constexpr, BLOCK_SIZE_K: tl.constexpr, GROUP_SIZE: tl.constexpr ): rz_linear_backward_input_grad_core(a_ptr=a_ptr, b_ptr=b_ptr, c_ptr=c_ptr, M=M, N=N, K=K, H=H, stride_am=stride_am, stride_an=stride_an, stride_cm=stride_cm, stride_ck=stride_ck, R3=R3, R2=R2, R1=R1, R0=R0, allow_tf32=False, BLOCK_SIZE_M=BLOCK_SIZE_M, BLOCK_SIZE_N=BLOCK_SIZE_N, BLOCK_SIZE_K=BLOCK_SIZE_K, GROUP_SIZE=GROUP_SIZE) @triton.autotune( configs=[ # basic configs for compute-bound matmuls triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=8), triton.Config({'BLOCK_SIZE_M': 256, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=8), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_M': 256, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_M': 256, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_N': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_N': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_N': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_N': 32}, num_stages=4, num_warps=4), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_M': 256, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=8), triton.Config({'BLOCK_SIZE_M': 256, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=8), triton.Config({'BLOCK_SIZE_M': 256, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_N': 32}, num_stages=3, num_warps=4), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_N': 32}, num_stages=2, num_warps=8), triton.Config({'BLOCK_SIZE_M': 256, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 32}, num_stages=2, num_warps=8), triton.Config({'BLOCK_SIZE_M': 256, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_N': 32}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 256, 'BLOCK_SIZE_N': 32}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 32}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 128, 'BLOCK_SIZE_N': 32}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_M': 128, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_N': 32}, num_stages=2, num_warps=4), triton.Config({'BLOCK_SIZE_M': 64, 'BLOCK_SIZE_K': 64, 'BLOCK_SIZE_N': 32}, num_stages=2, num_warps=4), ], key=['M', 'N', 'K'], ) @triton.jit def rz_linear_backward_input_grad_kernel_tf32( # Pointers to matrices a_ptr, b_ptr, c_ptr, # Matrix dimensions M, N, K, H, # The stride variables represent how much to increase the ptr by when moving by 1 # element in a particular dimension. stride_am, stride_an, stride_cm, stride_ck, # Random numbers R3, R2, R1, R0, # Meta-parameters BLOCK_SIZE_M: tl.constexpr, BLOCK_SIZE_N: tl.constexpr, BLOCK_SIZE_K: tl.constexpr, GROUP_SIZE: tl.constexpr ): rz_linear_backward_input_grad_core(a_ptr=a_ptr, b_ptr=b_ptr, c_ptr=c_ptr, M=M, N=N, K=K, H=H, stride_am=stride_am, stride_an=stride_an, stride_cm=stride_cm, stride_ck=stride_ck, R3=R3, R2=R2, R1=R1, R0=R0, allow_tf32=True, BLOCK_SIZE_M=BLOCK_SIZE_M, BLOCK_SIZE_N=BLOCK_SIZE_N, BLOCK_SIZE_K=BLOCK_SIZE_K, GROUP_SIZE=GROUP_SIZE) @triton.jit def rz_linear_backward_input_grad_kernel_notune( # Pointers to matrices a_ptr, b_ptr, c_ptr, # Matrix dimensions M, N, K, H, # The stride variables represent how much to increase the ptr by when moving by 1 # element in a particular dimension. stride_am, stride_an, stride_cm, stride_ck, # Random numbers R3, R2, R1, R0, allow_tf32: tl.constexpr, # Meta-parameters BLOCK_SIZE_M: tl.constexpr, BLOCK_SIZE_N: tl.constexpr, BLOCK_SIZE_K: tl.constexpr, GROUP_SIZE: tl.constexpr ): rz_linear_backward_input_grad_core(a_ptr=a_ptr, b_ptr=b_ptr, c_ptr=c_ptr, M=M, N=N, K=K, H=H, stride_am=stride_am, stride_an=stride_an, stride_cm=stride_cm, stride_ck=stride_ck, R3=R3, R2=R2, R1=R1, R0=R0, allow_tf32=allow_tf32, BLOCK_SIZE_M=BLOCK_SIZE_M, BLOCK_SIZE_N=BLOCK_SIZE_N, BLOCK_SIZE_K=BLOCK_SIZE_K, GROUP_SIZE=GROUP_SIZE) @triton.jit def rz_linear_backward_input_grad_core( # Pointers to matrices a_ptr, b_ptr, c_ptr, # Matrix dimensions M, N, K, H, # The stride variables represent how much to increase the ptr by when moving by 1 # element in a particular dimension. stride_am, stride_an, stride_cm, stride_ck, # Random numbers R3, R2, R1, R0, allow_tf32: tl.constexpr, # Meta-parameters BLOCK_SIZE_M: tl.constexpr, BLOCK_SIZE_N: tl.constexpr, BLOCK_SIZE_K: tl.constexpr, GROUP_SIZE: tl.constexpr ): pid = tl.program_id(axis=0) num_pid_k = tl.cdiv(K, BLOCK_SIZE_K) num_pid_m = tl.cdiv(M, BLOCK_SIZE_M) pid_m = pid // num_pid_k pid_k = pid % num_pid_k # [BLOCK_SIZE_M, BLOCK_SIZE_N] offs_am = pid_m * BLOCK_SIZE_M + tl.arange(0, BLOCK_SIZE_M) offs_an = tl.arange(0, BLOCK_SIZE_N) a_ptrs = a_ptr + offs_am[:, None] * \ stride_am + offs_an[None, :] * stride_an # [BLOCK_SIZE_N, BLOCK_SIZE_K] # Compute hash b_offset = b_ptr + \ tl.arange(0, BLOCK_SIZE_N)[ :, None] + tl.arange(0, BLOCK_SIZE_K)[None, :] * BLOCK_SIZE_N b_ptrs = b_offset + (pid_k * R3 + 0 * R2 + R1) % R0 % (H - BLOCK_SIZE_K * BLOCK_SIZE_N) # [BLOCK_SIZE_M, BLOCK_SIZE_K] c = tl.zeros((BLOCK_SIZE_M, BLOCK_SIZE_K), dtype=tl.float32) for n in range(0, N//BLOCK_SIZE_N): # Note that for simplicity, we don't apply a mask here. a = tl.load(a_ptrs) b = tl.load(b_ptrs) c += tl.dot(a, b, allow_tf32=allow_tf32) a_ptrs += BLOCK_SIZE_N * stride_an b_ptrs = b_offset + (pid_k * R3 + (n + 1) * R2 + R1) % R0 % (H - BLOCK_SIZE_K * BLOCK_SIZE_N) offs_ck = pid_k * BLOCK_SIZE_K + tl.arange(0, BLOCK_SIZE_K) offs_cm = pid_m * BLOCK_SIZE_M + tl.arange(0, BLOCK_SIZE_M) c_ptrs = c_ptr + stride_cm * \ offs_cm[:, None] + stride_ck * offs_ck[None, :] c_mask = (offs_cm[:, None] < M) & (offs_ck[None, :] < K) tl.store(c_ptrs, c, mask=c_mask)
true
true
f7262ddf11eb39c0eb95d69c00ccbce7ab819c84
1,604
py
Python
test/lazy/test_added_diag_lazy_tensor.py
cdgreenidge/gpytorch
d4cc610963bd812052e43e3aed84fb8b2ec94aa6
[ "MIT" ]
null
null
null
test/lazy/test_added_diag_lazy_tensor.py
cdgreenidge/gpytorch
d4cc610963bd812052e43e3aed84fb8b2ec94aa6
[ "MIT" ]
null
null
null
test/lazy/test_added_diag_lazy_tensor.py
cdgreenidge/gpytorch
d4cc610963bd812052e43e3aed84fb8b2ec94aa6
[ "MIT" ]
null
null
null
#!/usr/bin/env python3 import torch import unittest from gpytorch.lazy import NonLazyTensor, DiagLazyTensor, AddedDiagLazyTensor from test.lazy._lazy_tensor_test_case import LazyTensorTestCase class TestAddedDiagLazyTensor(LazyTensorTestCase, unittest.TestCase): seed = 0 should_test_sample = True def create_lazy_tensor(self): tensor = torch.randn(5, 5) tensor = tensor.transpose(-1, -2).matmul(tensor) tensor.requires_grad_(True) diag = torch.tensor([1.0, 2.0, 4.0, 2.0, 3.0], requires_grad=True) return AddedDiagLazyTensor(NonLazyTensor(tensor), DiagLazyTensor(diag)) def evaluate_lazy_tensor(self, lazy_tensor): diag = lazy_tensor._diag_tensor._diag tensor = lazy_tensor._lazy_tensor.tensor return tensor + diag.diag() class TestAddedDiagLazyTensorBatch(LazyTensorTestCase, unittest.TestCase): seed = 4 should_test_sample = True def create_lazy_tensor(self): tensor = torch.randn(3, 5, 5) tensor = tensor.transpose(-1, -2).matmul(tensor) tensor.requires_grad_(True) diag = torch.tensor( [[1.0, 2.0, 4.0, 2.0, 3.0], [2.0, 1.0, 2.0, 1.0, 4.0], [1.0, 2.0, 2.0, 3.0, 4.0]], requires_grad=True ) return AddedDiagLazyTensor(NonLazyTensor(tensor), DiagLazyTensor(diag)) def evaluate_lazy_tensor(self, lazy_tensor): diag = lazy_tensor._diag_tensor._diag tensor = lazy_tensor._lazy_tensor.tensor return tensor + torch.cat([diag[i].diag().unsqueeze(0) for i in range(3)]) if __name__ == "__main__": unittest.main()
34.12766
113
0.682045
import torch import unittest from gpytorch.lazy import NonLazyTensor, DiagLazyTensor, AddedDiagLazyTensor from test.lazy._lazy_tensor_test_case import LazyTensorTestCase class TestAddedDiagLazyTensor(LazyTensorTestCase, unittest.TestCase): seed = 0 should_test_sample = True def create_lazy_tensor(self): tensor = torch.randn(5, 5) tensor = tensor.transpose(-1, -2).matmul(tensor) tensor.requires_grad_(True) diag = torch.tensor([1.0, 2.0, 4.0, 2.0, 3.0], requires_grad=True) return AddedDiagLazyTensor(NonLazyTensor(tensor), DiagLazyTensor(diag)) def evaluate_lazy_tensor(self, lazy_tensor): diag = lazy_tensor._diag_tensor._diag tensor = lazy_tensor._lazy_tensor.tensor return tensor + diag.diag() class TestAddedDiagLazyTensorBatch(LazyTensorTestCase, unittest.TestCase): seed = 4 should_test_sample = True def create_lazy_tensor(self): tensor = torch.randn(3, 5, 5) tensor = tensor.transpose(-1, -2).matmul(tensor) tensor.requires_grad_(True) diag = torch.tensor( [[1.0, 2.0, 4.0, 2.0, 3.0], [2.0, 1.0, 2.0, 1.0, 4.0], [1.0, 2.0, 2.0, 3.0, 4.0]], requires_grad=True ) return AddedDiagLazyTensor(NonLazyTensor(tensor), DiagLazyTensor(diag)) def evaluate_lazy_tensor(self, lazy_tensor): diag = lazy_tensor._diag_tensor._diag tensor = lazy_tensor._lazy_tensor.tensor return tensor + torch.cat([diag[i].diag().unsqueeze(0) for i in range(3)]) if __name__ == "__main__": unittest.main()
true
true
f7262e47ccd52c7b99efed84275928088089c827
1,307
py
Python
rally/plugins/openstack/scenarios/monasca/metrics.py
mail2nsrajesh/rally
d8995226fe75c573d6d64c7ade8a4ceca0758366
[ "Apache-2.0" ]
null
null
null
rally/plugins/openstack/scenarios/monasca/metrics.py
mail2nsrajesh/rally
d8995226fe75c573d6d64c7ade8a4ceca0758366
[ "Apache-2.0" ]
null
null
null
rally/plugins/openstack/scenarios/monasca/metrics.py
mail2nsrajesh/rally
d8995226fe75c573d6d64c7ade8a4ceca0758366
[ "Apache-2.0" ]
null
null
null
# All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. from rally import consts from rally.plugins.openstack import scenario from rally.plugins.openstack.scenarios.monasca import utils as monascautils from rally.task import validation """Scenarios for monasca Metrics API.""" @validation.add("required_services", services=[consts.Service.MONASCA]) @validation.add("required_platform", platform="openstack", users=True) @scenario.configure(name="MonascaMetrics.list_metrics") class ListMetrics(monascautils.MonascaScenario): def run(self, **kwargs): """Fetch user's metrics. :param kwargs: optional arguments for list query: name, dimensions, start_time, etc """ self._list_metrics(**kwargs)
35.324324
78
0.722265
from rally import consts from rally.plugins.openstack import scenario from rally.plugins.openstack.scenarios.monasca import utils as monascautils from rally.task import validation @validation.add("required_services", services=[consts.Service.MONASCA]) @validation.add("required_platform", platform="openstack", users=True) @scenario.configure(name="MonascaMetrics.list_metrics") class ListMetrics(monascautils.MonascaScenario): def run(self, **kwargs): self._list_metrics(**kwargs)
true
true
f7262f0f2023d57b85b341ec89f31256cc3f6c36
4,563
py
Python
onmt/models/model_saver.py
UKPLab/emnlp2019-dualgraph
da38be675c392af43db436e3b2f0c8ff355c04f9
[ "MIT" ]
25
2019-09-05T07:57:45.000Z
2021-12-08T01:59:57.000Z
onmt/models/model_saver.py
15071347094/emnlp2019-dualgraph
0c58fb7f3ad3b9da3b92b2d2841558807fc79fd0
[ "MIT" ]
2
2020-11-21T00:41:44.000Z
2020-11-25T00:36:19.000Z
onmt/models/model_saver.py
15071347094/emnlp2019-dualgraph
0c58fb7f3ad3b9da3b92b2d2841558807fc79fd0
[ "MIT" ]
6
2020-01-27T22:54:56.000Z
2020-11-24T02:48:05.000Z
import os import torch import torch.nn as nn from collections import deque from onmt.utils.logging import logger from copy import deepcopy def build_model_saver(model_opt, opt, model, fields, optim): model_saver = ModelSaver(opt.save_model, model, model_opt, fields, optim, opt.keep_checkpoint) return model_saver class ModelSaverBase(object): """Base class for model saving operations Inherited classes must implement private methods: * `_save` * `_rm_checkpoint """ def __init__(self, base_path, model, model_opt, fields, optim, keep_checkpoint=-1): self.base_path = base_path self.model = model self.model_opt = model_opt self.fields = fields self.optim = optim self.last_saved_step = None self.keep_checkpoint = keep_checkpoint if keep_checkpoint > 0: self.checkpoint_queue = deque([], maxlen=keep_checkpoint) def save(self, step, moving_average=None): """Main entry point for model saver It wraps the `_save` method with checks and apply `keep_checkpoint` related logic """ if self.keep_checkpoint == 0 or step == self.last_saved_step: return if moving_average: save_model = deepcopy(self.model) for avg, param in zip(moving_average, save_model.parameters()): param.data.copy_(avg.data) else: save_model = self.model chkpt, chkpt_name = self._save(step, save_model) self.last_saved_step = step if moving_average: del save_model if self.keep_checkpoint > 0: if len(self.checkpoint_queue) == self.checkpoint_queue.maxlen: todel = self.checkpoint_queue.popleft() self._rm_checkpoint(todel) self.checkpoint_queue.append(chkpt_name) def _save(self, step): """Save a resumable checkpoint. Args: step (int): step number Returns: (object, str): * checkpoint: the saved object * checkpoint_name: name (or path) of the saved checkpoint """ raise NotImplementedError() def _rm_checkpoint(self, name): """Remove a checkpoint Args: name(str): name that indentifies the checkpoint (it may be a filepath) """ raise NotImplementedError() class ModelSaver(ModelSaverBase): """Simple model saver to filesystem""" def _save(self, step, model): real_model = (model.module if isinstance(model, nn.DataParallel) else model) real_generator = (real_model.generator.module if isinstance(real_model.generator, nn.DataParallel) else real_model.generator) model_state_dict = real_model.state_dict() model_state_dict = {k: v for k, v in model_state_dict.items() if 'generator' not in k} generator_state_dict = real_generator.state_dict() # NOTE: We need to trim the vocab to remove any unk tokens that # were not originally here. vocab = deepcopy(self.fields) if hasattr(model.encoder, 'is_graph_encoder'): sides = ["src", "node1", "node2", "tgt"] else: sides = ["src", "tgt"] for side in sides: keys_to_pop = [] if hasattr(vocab[side], "fields"): unk_token = vocab[side].fields[0][1].vocab.itos[0] for key, value in vocab[side].fields[0][1].vocab.stoi.items(): if value == 0 and key != unk_token: keys_to_pop.append(key) for key in keys_to_pop: vocab[side].fields[0][1].vocab.stoi.pop(key, None) checkpoint = { 'model': model_state_dict, 'generator': generator_state_dict, 'vocab': vocab, 'opt': self.model_opt, 'optim': self.optim.state_dict(), } logger.info("Saving checkpoint %s_step_%d.pt" % (self.base_path, step)) checkpoint_path = '%s_step_%d.pt' % (self.base_path, step) torch.save(checkpoint, checkpoint_path) return checkpoint, checkpoint_path def _rm_checkpoint(self, name): os.remove(name)
31.040816
79
0.570896
import os import torch import torch.nn as nn from collections import deque from onmt.utils.logging import logger from copy import deepcopy def build_model_saver(model_opt, opt, model, fields, optim): model_saver = ModelSaver(opt.save_model, model, model_opt, fields, optim, opt.keep_checkpoint) return model_saver class ModelSaverBase(object): def __init__(self, base_path, model, model_opt, fields, optim, keep_checkpoint=-1): self.base_path = base_path self.model = model self.model_opt = model_opt self.fields = fields self.optim = optim self.last_saved_step = None self.keep_checkpoint = keep_checkpoint if keep_checkpoint > 0: self.checkpoint_queue = deque([], maxlen=keep_checkpoint) def save(self, step, moving_average=None): if self.keep_checkpoint == 0 or step == self.last_saved_step: return if moving_average: save_model = deepcopy(self.model) for avg, param in zip(moving_average, save_model.parameters()): param.data.copy_(avg.data) else: save_model = self.model chkpt, chkpt_name = self._save(step, save_model) self.last_saved_step = step if moving_average: del save_model if self.keep_checkpoint > 0: if len(self.checkpoint_queue) == self.checkpoint_queue.maxlen: todel = self.checkpoint_queue.popleft() self._rm_checkpoint(todel) self.checkpoint_queue.append(chkpt_name) def _save(self, step): raise NotImplementedError() def _rm_checkpoint(self, name): raise NotImplementedError() class ModelSaver(ModelSaverBase): def _save(self, step, model): real_model = (model.module if isinstance(model, nn.DataParallel) else model) real_generator = (real_model.generator.module if isinstance(real_model.generator, nn.DataParallel) else real_model.generator) model_state_dict = real_model.state_dict() model_state_dict = {k: v for k, v in model_state_dict.items() if 'generator' not in k} generator_state_dict = real_generator.state_dict() vocab = deepcopy(self.fields) if hasattr(model.encoder, 'is_graph_encoder'): sides = ["src", "node1", "node2", "tgt"] else: sides = ["src", "tgt"] for side in sides: keys_to_pop = [] if hasattr(vocab[side], "fields"): unk_token = vocab[side].fields[0][1].vocab.itos[0] for key, value in vocab[side].fields[0][1].vocab.stoi.items(): if value == 0 and key != unk_token: keys_to_pop.append(key) for key in keys_to_pop: vocab[side].fields[0][1].vocab.stoi.pop(key, None) checkpoint = { 'model': model_state_dict, 'generator': generator_state_dict, 'vocab': vocab, 'opt': self.model_opt, 'optim': self.optim.state_dict(), } logger.info("Saving checkpoint %s_step_%d.pt" % (self.base_path, step)) checkpoint_path = '%s_step_%d.pt' % (self.base_path, step) torch.save(checkpoint, checkpoint_path) return checkpoint, checkpoint_path def _rm_checkpoint(self, name): os.remove(name)
true
true
f7262f809657c84b116f0216cd007d0f3032680e
393
py
Python
CTForces/wsgi.py
pomo-mondreganto/CTForces-old
86758192f800108ff109f07fe155d5a98b4a3e14
[ "MIT" ]
null
null
null
CTForces/wsgi.py
pomo-mondreganto/CTForces-old
86758192f800108ff109f07fe155d5a98b4a3e14
[ "MIT" ]
6
2021-10-01T14:18:34.000Z
2021-10-01T14:19:17.000Z
CTForces/wsgi.py
pomo-mondreganto/CTForces-old
86758192f800108ff109f07fe155d5a98b4a3e14
[ "MIT" ]
null
null
null
""" WSGI config for CTForces project. It exposes the WSGI callable as a module-level variable named ``application``. For more information on this file, see https://docs.djangoproject.com/en/2.0/howto/deployment/wsgi/ """ import os from django.core.wsgi import get_wsgi_application os.environ.setdefault("DJANGO_SETTINGS_MODULE", "CTForces.settings") application = get_wsgi_application()
23.117647
78
0.78626
import os from django.core.wsgi import get_wsgi_application os.environ.setdefault("DJANGO_SETTINGS_MODULE", "CTForces.settings") application = get_wsgi_application()
true
true
f7262f94e75074ce3f184e5fc532f018ccd981b9
1,224
py
Python
6.0-expresiones-regulares/src/spider.py
zehemz/clases-python-101
633cb5f0cbc85e64e242514f0394754a5bed0513
[ "Apache-2.0" ]
null
null
null
6.0-expresiones-regulares/src/spider.py
zehemz/clases-python-101
633cb5f0cbc85e64e242514f0394754a5bed0513
[ "Apache-2.0" ]
null
null
null
6.0-expresiones-regulares/src/spider.py
zehemz/clases-python-101
633cb5f0cbc85e64e242514f0394754a5bed0513
[ "Apache-2.0" ]
null
null
null
''' Created on Jul 27, 2016 @author: zehemz ''' from lxml import html from lxml import etree from io import StringIO, BytesIO from copy import deepcopy import requests import re import pickle def writeList(list): file = open("websScrapeadas.txt", "wb") for element in list: file.write(element+ '\n') file.close() BASE_URL = 'http://www.clarin.com' page = requests.get('http://www.clarin.com') try: compiledRe = re.compile(r'href=[\'"]?(.*_0_[^\'">]+)') matches = compiledRe.findall(page.content) print(matches) except Exception as error: print(type(error)) print(error) modifiedUrls = [(BASE_URL + url) for url in matches] pickle.dump(modifiedUrls, open("lista.p", "wb")) writeList(modifiedUrls) count = 0 for url in modifiedUrls: try: page = requests.get(url) except Exception as error: print(error) continue try: tree = html.fromstring(page.content) except Exception as error: print(error) continue nota = tree.xpath('//div[@class="nota"]//p/text()') file = open(str(count)+".txt", "wb") for parrafo in nota: file.write(parrafo.encode("utf-8")) file.close() count +=1
21.473684
58
0.631536
from lxml import html from lxml import etree from io import StringIO, BytesIO from copy import deepcopy import requests import re import pickle def writeList(list): file = open("websScrapeadas.txt", "wb") for element in list: file.write(element+ '\n') file.close() BASE_URL = 'http://www.clarin.com' page = requests.get('http://www.clarin.com') try: compiledRe = re.compile(r'href=[\'"]?(.*_0_[^\'">]+)') matches = compiledRe.findall(page.content) print(matches) except Exception as error: print(type(error)) print(error) modifiedUrls = [(BASE_URL + url) for url in matches] pickle.dump(modifiedUrls, open("lista.p", "wb")) writeList(modifiedUrls) count = 0 for url in modifiedUrls: try: page = requests.get(url) except Exception as error: print(error) continue try: tree = html.fromstring(page.content) except Exception as error: print(error) continue nota = tree.xpath('//div[@class="nota"]//p/text()') file = open(str(count)+".txt", "wb") for parrafo in nota: file.write(parrafo.encode("utf-8")) file.close() count +=1
true
true
f7263292ff3ace28bdfe5eb80b3b1e74c3e9814c
945
py
Python
commands/help.py
DevStrikerTech/Clash-of-Clans-Band-Bot
472c12feeefe053247458c133ee822b16e7537e1
[ "MIT" ]
19
2021-01-17T02:09:42.000Z
2021-01-27T00:49:42.000Z
commands/help.py
DevStrikerTech/Clash-of-Clans-Band-Bot
472c12feeefe053247458c133ee822b16e7537e1
[ "MIT" ]
null
null
null
commands/help.py
DevStrikerTech/Clash-of-Clans-Band-Bot
472c12feeefe053247458c133ee822b16e7537e1
[ "MIT" ]
20
2021-01-26T19:24:23.000Z
2022-03-10T14:02:49.000Z
from routes.band import write_comment class Help: def __init__(self, get_all_post): self.get_all_post = get_all_post self.help_information() def help_information(self): get_all_post = self.get_all_post post_response_content = get_all_post['result_data']['items'] for item in post_response_content: commment_count = item['comment_count'] content = item['content'] post_key = item['post_key'] if '!help' in content and commment_count == 0: write_comment(comment_body=f'Here are the list of bot commands:\n' f'!clan -> Clan Information\n' f'!player -> Player Infomation\n' f'!warlog -> Warlog Infomation\n' f'!joke -> Tells a random joke', post_key=post_key)
39.375
94
0.538624
from routes.band import write_comment class Help: def __init__(self, get_all_post): self.get_all_post = get_all_post self.help_information() def help_information(self): get_all_post = self.get_all_post post_response_content = get_all_post['result_data']['items'] for item in post_response_content: commment_count = item['comment_count'] content = item['content'] post_key = item['post_key'] if '!help' in content and commment_count == 0: write_comment(comment_body=f'Here are the list of bot commands:\n' f'!clan -> Clan Information\n' f'!player -> Player Infomation\n' f'!warlog -> Warlog Infomation\n' f'!joke -> Tells a random joke', post_key=post_key)
true
true
f726331ddb1b01708d32c521d8e3e991bbc3909a
2,338
py
Python
kubragen2/build.py
RangelReale/kubragen2
2118f1429a9b9da937582db1f41d4f12b78773e2
[ "MIT" ]
1
2022-02-14T07:31:57.000Z
2022-02-14T07:31:57.000Z
kubragen2/build.py
RangelReale/kubragen2
2118f1429a9b9da937582db1f41d4f12b78773e2
[ "MIT" ]
null
null
null
kubragen2/build.py
RangelReale/kubragen2
2118f1429a9b9da937582db1f41d4f12b78773e2
[ "MIT" ]
null
null
null
import copy from typing import Any, MutableMapping, MutableSequence, Union from .data import DataGetValue, Data, BaseData from .exception import InvalidOperationError class DataBuilder: def build_prop(self, data: Union[MutableMapping, MutableSequence], key: Any) -> None: """ Cleanup instances of Data class in Mapping or Sequence. """ if isinstance(data[key], BaseData): if isinstance(data[key], Data): if not data[key].is_enabled(): del data[key] else: data[key] = data[key].get_value() else: raise InvalidOperationError('Cannot use BaseData in build') def build(self, data: Any, in_place: bool = True) -> Any: """ Cleanup all instances of Data classes, removing if not enabled or replacing by its value. :param data: the data to mutate :param in_place: whether to modify the data in-place. If False, data will be duplicated using copy.deepcopy :return: the same value passed, mutated, except if it is *Data{enabled=False}*, in this case it returns None. """ if not in_place: data = copy.deepcopy(data) if isinstance(data, MutableMapping): keylist = list(data.keys()) for key in keylist: self.build_prop(data, key) for item in data.values(): self.build(item) return data elif isinstance(data, MutableSequence): for key in range(len(data) - 1, -1, -1): self.build_prop(data, key) for item in data: self.build(item) return data return self.get_value(data) def get_value(self, data: Any) -> Any: return DataGetValue(data) def BuildData(data: Any, in_place: bool = True) -> Any: """ Cleanup all instances of Data classes, removing if not enabled or replacing by its value. :param data: the data to mutate :param in_place: whether to modify the data in-place. If False, data will be duplicated using copy.deepcopy :return: the same value passed, mutated, except if it is *Data{enabled=False}*, in this case it returns None. """ return DataBuilder().build(data, in_place=in_place)
37.709677
117
0.60864
import copy from typing import Any, MutableMapping, MutableSequence, Union from .data import DataGetValue, Data, BaseData from .exception import InvalidOperationError class DataBuilder: def build_prop(self, data: Union[MutableMapping, MutableSequence], key: Any) -> None: if isinstance(data[key], BaseData): if isinstance(data[key], Data): if not data[key].is_enabled(): del data[key] else: data[key] = data[key].get_value() else: raise InvalidOperationError('Cannot use BaseData in build') def build(self, data: Any, in_place: bool = True) -> Any: if not in_place: data = copy.deepcopy(data) if isinstance(data, MutableMapping): keylist = list(data.keys()) for key in keylist: self.build_prop(data, key) for item in data.values(): self.build(item) return data elif isinstance(data, MutableSequence): for key in range(len(data) - 1, -1, -1): self.build_prop(data, key) for item in data: self.build(item) return data return self.get_value(data) def get_value(self, data: Any) -> Any: return DataGetValue(data) def BuildData(data: Any, in_place: bool = True) -> Any: return DataBuilder().build(data, in_place=in_place)
true
true
f72633913ec545cd03a516a113ee6f370da07cd3
663
py
Python
blogsrc/manage.py
mesutcifci/personal-blog
11fca60e1dc628617c00bb01d55d2fac71d60603
[ "MIT" ]
1
2020-12-12T01:02:56.000Z
2020-12-12T01:02:56.000Z
blogsrc/manage.py
mesutcifci/personal-blog
11fca60e1dc628617c00bb01d55d2fac71d60603
[ "MIT" ]
null
null
null
blogsrc/manage.py
mesutcifci/personal-blog
11fca60e1dc628617c00bb01d55d2fac71d60603
[ "MIT" ]
1
2020-12-11T08:50:14.000Z
2020-12-11T08:50:14.000Z
#!/usr/bin/env python """Django's command-line utility for administrative tasks.""" import os import sys def main(): """Run administrative tasks.""" os.environ.setdefault('DJANGO_SETTINGS_MODULE', 'blogsrc.settings') try: from django.core.management import execute_from_command_line except ImportError as exc: raise ImportError( "Couldn't import Django. Are you sure it's installed and " "available on your PYTHONPATH environment variable? Did you " "forget to activate a virtual environment?" ) from exc execute_from_command_line(sys.argv) if __name__ == '__main__': main()
28.826087
73
0.678733
import os import sys def main(): os.environ.setdefault('DJANGO_SETTINGS_MODULE', 'blogsrc.settings') try: from django.core.management import execute_from_command_line except ImportError as exc: raise ImportError( "Couldn't import Django. Are you sure it's installed and " "available on your PYTHONPATH environment variable? Did you " "forget to activate a virtual environment?" ) from exc execute_from_command_line(sys.argv) if __name__ == '__main__': main()
true
true
f726350f5bcbf20607a3fc3fd9daee81853b87c0
5,551
py
Python
enaml/qt/qt_color_dialog.py
pberkes/enaml
cbcbee929e3117dfe56c0b06dc2385acc832b0e8
[ "BSD-3-Clause-Clear" ]
11
2015-03-14T14:30:51.000Z
2022-03-15T13:01:44.000Z
enaml/qt/qt_color_dialog.py
pberkes/enaml
cbcbee929e3117dfe56c0b06dc2385acc832b0e8
[ "BSD-3-Clause-Clear" ]
3
2015-01-31T11:12:56.000Z
2022-03-14T00:53:25.000Z
enaml/qt/qt_color_dialog.py
pberkes/enaml
cbcbee929e3117dfe56c0b06dc2385acc832b0e8
[ "BSD-3-Clause-Clear" ]
4
2015-01-27T01:56:14.000Z
2021-02-23T07:21:20.000Z
#------------------------------------------------------------------------------ # Copyright (c) 2013, Nucleic Development Team. # # Distributed under the terms of the Modified BSD License. # # The full license is in the file COPYING.txt, distributed with this software. #------------------------------------------------------------------------------ from atom.api import Int, Typed from enaml.colors import Color from enaml.widgets.color_dialog import ProxyColorDialog from .QtCore import Signal from .QtGui import QColor, QColorDialog from .qt_toolkit_dialog import QtToolkitDialog def color_from_qcolor(q): """ Convert a QColor into an Enaml Color. Parameters ---------- q : QColor The Qt color to convert to Enaml Color. Returns ------- result : Color or None An Enaml Color or None if the QColor is not valid. """ if not q.isValid(): return None return Color(q.red(), q.green(), q.blue(), q.alpha()) # Guard flags CURRENT_GUARD = 0x1 class QColorDialogEx(QColorDialog): """ A custom QColorDialog which emits a custom finished signal. """ #: A signal emitted at the end of the 'done' method. This works #: around the standard QColorDialog behavior which emits the #: 'colorSelected' signal *after* the 'finished' signal. reallyFinished = Signal(int) def done(self, result): """ A reimplemented done method. This method emits the 'reallyFinished' signal on completion. """ super(QColorDialogEx, self).done(result) self.reallyFinished.emit(result) class QtColorDialog(QtToolkitDialog, ProxyColorDialog): """ A Qt implementation of an Enaml ProxyColorDialog. """ #: A reference to the widget created by the proxy. widget = Typed(QColorDialogEx) #: Cyclic notification guard. This a bitfield of multiple guards. _guard = Int(0) def create_widget(self): """ Create the underlying QColorDialog. """ self.widget = QColorDialogEx(self.parent_widget()) def init_widget(self): """ Initialize the underlying widget. """ # Do not call super(...) as it connects the standard 'finished' # signal. This widget uses the custom 'reallyFinished' signal. d = self.declaration self.set_title(d.title) self.set_current_color(d.current_color) self.set_show_alpha(d.show_alpha) self.set_show_buttons(d.show_buttons) widget = self.widget widget.currentColorChanged.connect(self.on_current_color_changed) widget.colorSelected.connect(self.on_color_selected) widget.reallyFinished.connect(self.on_finished) #-------------------------------------------------------------------------- # Utility Methods #-------------------------------------------------------------------------- def get_default_title(self): """ Get the default window title for the color dialog. """ return u'Select Color' #-------------------------------------------------------------------------- # Signal Handlers #-------------------------------------------------------------------------- def on_current_color_changed(self, qcolor): """ Handle the 'currentColorChanged' signal from the widget. """ d = self.declaration if d is not None: self._guard |= CURRENT_GUARD try: d.current_color = color_from_qcolor(qcolor) finally: self._guard &= ~CURRENT_GUARD def on_color_selected(self, qcolor): """ Handle the 'colorSelected' signal from the widget. """ d = self.declaration if d is not None: d.selected_color = color_from_qcolor(qcolor) #-------------------------------------------------------------------------- # ProxyColorDialog API #-------------------------------------------------------------------------- @staticmethod def custom_count(): """ Get the number of available custom colors. """ return QColorDialog.customCount() @staticmethod def custom_color(index): """ Get the custom color for the given index. """ qrgb = QColorDialog.customColor(index) return color_from_qcolor(QColor.fromRgba(qrgb)) @staticmethod def set_custom_color(index, color): """ Set the custom color for the given index. """ QColorDialog.setCustomColor(index, color.argb) def set_current_color(self, color): """ Set the current color for the underlying widget. """ if not self._guard & CURRENT_GUARD: if color is not None: qcolor = QColor.fromRgba(color.argb) else: qcolor = QColor() self.widget.setCurrentColor(qcolor) def set_show_alpha(self, show): """ Set the show alpha option on the underlying widget. """ widget = self.widget opt = widget.options() if show: opt |= QColorDialog.ShowAlphaChannel else: opt &= ~QColorDialog.ShowAlphaChannel widget.setOptions(opt) def set_show_buttons(self, show): """ Set the show buttons option on the underlying widget. """ widget = self.widget opt = widget.options() if show: opt &= ~QColorDialog.NoButtons else: opt |= QColorDialog.NoButtons widget.setOptions(opt)
30.168478
79
0.558278
from atom.api import Int, Typed from enaml.colors import Color from enaml.widgets.color_dialog import ProxyColorDialog from .QtCore import Signal from .QtGui import QColor, QColorDialog from .qt_toolkit_dialog import QtToolkitDialog def color_from_qcolor(q): if not q.isValid(): return None return Color(q.red(), q.green(), q.blue(), q.alpha()) CURRENT_GUARD = 0x1 class QColorDialogEx(QColorDialog): reallyFinished = Signal(int) def done(self, result): super(QColorDialogEx, self).done(result) self.reallyFinished.emit(result) class QtColorDialog(QtToolkitDialog, ProxyColorDialog): widget = Typed(QColorDialogEx) _guard = Int(0) def create_widget(self): self.widget = QColorDialogEx(self.parent_widget()) def init_widget(self): d = self.declaration self.set_title(d.title) self.set_current_color(d.current_color) self.set_show_alpha(d.show_alpha) self.set_show_buttons(d.show_buttons) widget = self.widget widget.currentColorChanged.connect(self.on_current_color_changed) widget.colorSelected.connect(self.on_color_selected) widget.reallyFinished.connect(self.on_finished) def get_default_title(self): return u'Select Color' def on_current_color_changed(self, qcolor): d = self.declaration if d is not None: self._guard |= CURRENT_GUARD try: d.current_color = color_from_qcolor(qcolor) finally: self._guard &= ~CURRENT_GUARD def on_color_selected(self, qcolor): d = self.declaration if d is not None: d.selected_color = color_from_qcolor(qcolor) @staticmethod def custom_count(): return QColorDialog.customCount() @staticmethod def custom_color(index): qrgb = QColorDialog.customColor(index) return color_from_qcolor(QColor.fromRgba(qrgb)) @staticmethod def set_custom_color(index, color): QColorDialog.setCustomColor(index, color.argb) def set_current_color(self, color): if not self._guard & CURRENT_GUARD: if color is not None: qcolor = QColor.fromRgba(color.argb) else: qcolor = QColor() self.widget.setCurrentColor(qcolor) def set_show_alpha(self, show): widget = self.widget opt = widget.options() if show: opt |= QColorDialog.ShowAlphaChannel else: opt &= ~QColorDialog.ShowAlphaChannel widget.setOptions(opt) def set_show_buttons(self, show): widget = self.widget opt = widget.options() if show: opt &= ~QColorDialog.NoButtons else: opt |= QColorDialog.NoButtons widget.setOptions(opt)
true
true
f726390a2fc316670d945fcf0adc8da8f7980de8
5,007
py
Python
JSONLibrary/JSONLibraryKeywords.py
Rezzas/robotframework-jsonlibrary
d0db2b20f729e69e37364527ae60f7be22dff1d4
[ "Unlicense" ]
null
null
null
JSONLibrary/JSONLibraryKeywords.py
Rezzas/robotframework-jsonlibrary
d0db2b20f729e69e37364527ae60f7be22dff1d4
[ "Unlicense" ]
null
null
null
JSONLibrary/JSONLibraryKeywords.py
Rezzas/robotframework-jsonlibrary
d0db2b20f729e69e37364527ae60f7be22dff1d4
[ "Unlicense" ]
null
null
null
# -*- coding: utf-8 -*- import json import os.path from robot.api import logger from robot.api.deco import keyword from jsonpath_rw import Index, Fields #from jsonpath_rw_ext import parse from jsonpath_ng.ext import parse from .version import VERSION __author__ = 'Traitanit Huangsri' __email__ = 'traitanit.hua@gmail.com' __version__ = VERSION class JSONLibraryKeywords(object): ROBOT_EXIT_ON_FAILURE = True @keyword('Load JSON From File') def load_json_from_file(self, file_name): """Load JSON from file. Return json as a dictionary object. Arguments: - file_name: absolute json file name Return json object (list or dictionary) Examples: | ${result}= | Load Json From File | /path/to/file.json | """ logger.debug("Check if file exists") if os.path.isfile(file_name) is False: logger.error("JSON file: " + file_name + " not found") raise IOError with open(file_name) as json_file: data = json.load(json_file) return data @keyword('Add Object To Json') def add_object_to_json(self, json_object, json_path, object_to_add): """Add an dictionary or list object to json object using json_path Arguments: - json_object: json as a dictionary object. - json_path: jsonpath expression - object_to_add: dictionary or list object to add to json_object which is matched by json_path Return new json object. Examples: | ${dict}= | Create Dictionary | latitude=13.1234 | longitude=130.1234 | | ${json}= | Add Object To Json | ${json} | $..address | ${dict} | """ json_path_expr = parse(json_path) for match in json_path_expr.find(json_object): if type(match.value) is dict: match.value.update(object_to_add) if type(match.value) is list: match.value.append(object_to_add) return json_object @keyword('Get Value From Json') def get_value_from_json(self, json_object, json_path): """Get Value From JSON using JSONPath Arguments: - json_object: json as a dictionary object. - json_path: jsonpath expression Return array of values Examples: | ${values}= | Get Value From Json | ${json} | $..phone_number | """ json_path_expr = parse(json_path) return [match.value for match in json_path_expr.find(json_object)] @keyword('Update Value To Json') def update_value_to_json(self, json_object, json_path, new_value): """Update value to JSON using JSONPath Arguments: - json_object: json as a dictionary object. - json_path: jsonpath expression - new_value: value to update Return new json_object Examples: | ${json_object}= | Update Value To Json | ${json} | $..address.streetAddress | Ratchadapisek Road | """ json_path_expr = parse(json_path) for match in json_path_expr.find(json_object): path = match.path if isinstance(path, Index): match.context.value[match.path.index] = new_value elif isinstance(path, Fields): match.context.value[match.path.fields[0]] = new_value return json_object @keyword('Delete Object From Json') def delete_object_from_json(self, json_object, json_path): """Delete Object From JSON using json_path Arguments: - json_object: json as a dictionary object. - json_path: jsonpath expression Return new json_object Examples: | ${json_object}= | Delete Object From Json | ${json} | $..address.streetAddress | """ json_path_expr = parse(json_path) for match in json_path_expr.find(json_object): path = match.path if isinstance(path, Index): del(match.context.value[match.path.index]) elif isinstance(path, Fields): del(match.context.value[match.path.fields[0]]) return json_object @keyword('Convert JSON To String') def convert_json_to_string(self, json_object): """Convert JSON object to string Arguments: - json_object: json as a dictionary object. Return new json_string Examples: | ${json_str}= | Convert JSON To String | ${json_obj} | """ return json.dumps(json_object) @keyword('Convert String to JSON') def convert_string_to_json(self, json_string): """Convert String to JSON object Arguments: - json_string: JSON string Return new json_object Examples: | ${json_object}= | Convert String to JSON | ${json_string} | """ return json.loads(json_string)
32.512987
113
0.607749
import json import os.path from robot.api import logger from robot.api.deco import keyword from jsonpath_rw import Index, Fields from jsonpath_ng.ext import parse from .version import VERSION __author__ = 'Traitanit Huangsri' __email__ = 'traitanit.hua@gmail.com' __version__ = VERSION class JSONLibraryKeywords(object): ROBOT_EXIT_ON_FAILURE = True @keyword('Load JSON From File') def load_json_from_file(self, file_name): logger.debug("Check if file exists") if os.path.isfile(file_name) is False: logger.error("JSON file: " + file_name + " not found") raise IOError with open(file_name) as json_file: data = json.load(json_file) return data @keyword('Add Object To Json') def add_object_to_json(self, json_object, json_path, object_to_add): json_path_expr = parse(json_path) for match in json_path_expr.find(json_object): if type(match.value) is dict: match.value.update(object_to_add) if type(match.value) is list: match.value.append(object_to_add) return json_object @keyword('Get Value From Json') def get_value_from_json(self, json_object, json_path): json_path_expr = parse(json_path) return [match.value for match in json_path_expr.find(json_object)] @keyword('Update Value To Json') def update_value_to_json(self, json_object, json_path, new_value): json_path_expr = parse(json_path) for match in json_path_expr.find(json_object): path = match.path if isinstance(path, Index): match.context.value[match.path.index] = new_value elif isinstance(path, Fields): match.context.value[match.path.fields[0]] = new_value return json_object @keyword('Delete Object From Json') def delete_object_from_json(self, json_object, json_path): json_path_expr = parse(json_path) for match in json_path_expr.find(json_object): path = match.path if isinstance(path, Index): del(match.context.value[match.path.index]) elif isinstance(path, Fields): del(match.context.value[match.path.fields[0]]) return json_object @keyword('Convert JSON To String') def convert_json_to_string(self, json_object): return json.dumps(json_object) @keyword('Convert String to JSON') def convert_string_to_json(self, json_string): return json.loads(json_string)
true
true
f7263995555ef87a94a1d3d6fc18898696a9f9f5
4,522
py
Python
plugin/entity/zettel.py
tbouska/mkdocs-zettelkasten
3638ee8028462e98aa088dd075a929e11f6fe882
[ "MIT" ]
null
null
null
plugin/entity/zettel.py
tbouska/mkdocs-zettelkasten
3638ee8028462e98aa088dd075a929e11f6fe882
[ "MIT" ]
7
2021-11-25T07:59:16.000Z
2021-11-29T18:37:29.000Z
plugin/entity/zettel.py
tbouska/mkdocs-zettelkasten
3638ee8028462e98aa088dd075a929e11f6fe882
[ "MIT" ]
null
null
null
import datetime import os import re import yaml from pathlib import Path from plugin.patterns import WIKI_LINK, MD_LINK from plugin.gitutil import GitUtil class Zettel: def __init__(self, abs_src_path): self.id = 0 self.title = "" self.path = abs_src_path self.backlinks = [] self.links = [] self._parse_file() def _parse_file(self): header = [] is_reading_header = False is_reading_body = False alternative_title = "" try: with open(self.path, encoding="utf-8-sig", errors="strict") as f: while line := f.readline(): if line.strip() == "---": if not is_reading_header and not is_reading_body: is_reading_header = True continue elif not is_reading_body: is_reading_header = False is_reading_body = True continue else: break if is_reading_header: header.append(line) if is_reading_body: if line.lstrip().startswith("# "): alternative_title = line.strip()[2:] match_wiki_link = WIKI_LINK.finditer(line) match_md_link = MD_LINK.finditer(line) for m in match_wiki_link: self.links.append(m.groupdict()["url"]) for m in match_md_link: self.links.append(m.groupdict()["url"]) meta = yaml.load("".join(header), Loader=yaml.FullLoader) except OSError: raise ValueError("File is not in zettel format") except ValueError: raise ValueError("File is not in zettel format") except AttributeError: raise ValueError("File is not in zettel format") self._set_metadata(meta, alternative_title) def _set_metadata(self, meta, alternative_title): if not meta or "id" not in meta.keys(): raise ValueError("File is not in zettel format") else: self.id = meta["id"] if "title" in meta.keys(): self.title = meta["title"] elif alternative_title: print("Using alternative title " + self.path) self.title = alternative_title else: self.title = self._get_title_from_filename() self._set_last_update_date(meta) def _get_title_from_filename(self): title = Path(self.path).stem title = re.sub(r"^\d{14}", "", title) title = title.replace("_", " ").replace("-", " ") title = " ".join(title.split()) title = title.strip() title = title.capitalize() return title def _set_last_update_date(self, meta): date = "" if "last_update" in meta.keys(): date = _get_date_from_string(meta["last_update"]) if not date and "date" in meta.keys(): date = _get_date_from_string(meta["date"]) if not date: date = _get_date_from_string(self.id) if not date: date = datetime.datetime.today() if "//github.com" in self.path or "//gitlab.com" in self.path: git = GitUtil() revision_date = git.get_revision_date_for_file(self.path) else: revision_date = datetime.datetime.fromtimestamp(os.path.getmtime(self.path)) if revision_date.timestamp() > date.timestamp(): date = revision_date self.last_update_date = date.strftime("%Y-%m-%d") def add_backlinks(self, sources): def is_valid(source): return ( self.path != source.abs_src_path and source not in self.backlinks and source.is_zettel ) self.backlinks = [s for s in sources if is_valid(s)] def _get_date_from_string(string): string = str(string) try: date = datetime.datetime.strptime(string, "%Y-%m-%d %H:%M:%S") except ValueError: try: date = datetime.datetime.strptime(string, "%Y%m%d%H%M%S") except ValueError: try: date = datetime.datetime.fromisoformat(string) except ValueError: date = "" return date
31.84507
88
0.534277
import datetime import os import re import yaml from pathlib import Path from plugin.patterns import WIKI_LINK, MD_LINK from plugin.gitutil import GitUtil class Zettel: def __init__(self, abs_src_path): self.id = 0 self.title = "" self.path = abs_src_path self.backlinks = [] self.links = [] self._parse_file() def _parse_file(self): header = [] is_reading_header = False is_reading_body = False alternative_title = "" try: with open(self.path, encoding="utf-8-sig", errors="strict") as f: while line := f.readline(): if line.strip() == "---": if not is_reading_header and not is_reading_body: is_reading_header = True continue elif not is_reading_body: is_reading_header = False is_reading_body = True continue else: break if is_reading_header: header.append(line) if is_reading_body: if line.lstrip().startswith("# "): alternative_title = line.strip()[2:] match_wiki_link = WIKI_LINK.finditer(line) match_md_link = MD_LINK.finditer(line) for m in match_wiki_link: self.links.append(m.groupdict()["url"]) for m in match_md_link: self.links.append(m.groupdict()["url"]) meta = yaml.load("".join(header), Loader=yaml.FullLoader) except OSError: raise ValueError("File is not in zettel format") except ValueError: raise ValueError("File is not in zettel format") except AttributeError: raise ValueError("File is not in zettel format") self._set_metadata(meta, alternative_title) def _set_metadata(self, meta, alternative_title): if not meta or "id" not in meta.keys(): raise ValueError("File is not in zettel format") else: self.id = meta["id"] if "title" in meta.keys(): self.title = meta["title"] elif alternative_title: print("Using alternative title " + self.path) self.title = alternative_title else: self.title = self._get_title_from_filename() self._set_last_update_date(meta) def _get_title_from_filename(self): title = Path(self.path).stem title = re.sub(r"^\d{14}", "", title) title = title.replace("_", " ").replace("-", " ") title = " ".join(title.split()) title = title.strip() title = title.capitalize() return title def _set_last_update_date(self, meta): date = "" if "last_update" in meta.keys(): date = _get_date_from_string(meta["last_update"]) if not date and "date" in meta.keys(): date = _get_date_from_string(meta["date"]) if not date: date = _get_date_from_string(self.id) if not date: date = datetime.datetime.today() if "//github.com" in self.path or "//gitlab.com" in self.path: git = GitUtil() revision_date = git.get_revision_date_for_file(self.path) else: revision_date = datetime.datetime.fromtimestamp(os.path.getmtime(self.path)) if revision_date.timestamp() > date.timestamp(): date = revision_date self.last_update_date = date.strftime("%Y-%m-%d") def add_backlinks(self, sources): def is_valid(source): return ( self.path != source.abs_src_path and source not in self.backlinks and source.is_zettel ) self.backlinks = [s for s in sources if is_valid(s)] def _get_date_from_string(string): string = str(string) try: date = datetime.datetime.strptime(string, "%Y-%m-%d %H:%M:%S") except ValueError: try: date = datetime.datetime.strptime(string, "%Y%m%d%H%M%S") except ValueError: try: date = datetime.datetime.fromisoformat(string) except ValueError: date = "" return date
true
true
f72639a5ff51641e1d986f7c27245a78928e246f
4,440
py
Python
src/utils/data_loader.py
TheBlueHawk/RANLP21-70
3d329a6d385fac4e8664cb1bb88a29411befb767
[ "MIT" ]
null
null
null
src/utils/data_loader.py
TheBlueHawk/RANLP21-70
3d329a6d385fac4e8664cb1bb88a29411befb767
[ "MIT" ]
null
null
null
src/utils/data_loader.py
TheBlueHawk/RANLP21-70
3d329a6d385fac4e8664cb1bb88a29411befb767
[ "MIT" ]
null
null
null
# -*- coding: utf-8 -*- # @Author : William # @Project : TextGAN-william # @FileName : data_loader.py # @Time : Created at 2019-05-31 # @Blog : http://zhiweil.ml/ # @Description : # Copyrights (C) 2018. All Rights Reserved. import random from torch.utils.data import Dataset, DataLoader from utils.text_process import * class GANDataset(Dataset): def __init__(self, data): self.data = data def __getitem__(self, index): return self.data[index] def __len__(self): return len(self.data) class GenDataIter: def __init__(self, samples, if_test_data=False, shuffle=None): self.batch_size = cfg.batch_size self.max_seq_len = cfg.max_seq_len self.start_letter = cfg.start_letter self.shuffle = cfg.data_shuffle if not shuffle else shuffle if cfg.if_real_data: self.word2idx_dict, self.idx2word_dict = load_dict(cfg.dataset) if if_test_data: # used for the classifier self.word2idx_dict, self.idx2word_dict = load_test_dict(cfg.dataset) self.loader = DataLoader( dataset=GANDataset(self.__read_data__(samples)), batch_size=self.batch_size, shuffle=self.shuffle, drop_last=True) self.input = self._all_data_('input') self.target = self._all_data_('target') def __read_data__(self, samples): """ input: same as target, but start with start_letter. """ # global all_data if isinstance(samples, torch.Tensor): # Tensor inp, target = self.prepare(samples) all_data = [{'input': i, 'target': t} for (i, t) in zip(inp, target)] elif isinstance(samples, str): # filename inp, target = self.load_data(samples) all_data = [{'input': i, 'target': t} for (i, t) in zip(inp, target)] else: all_data = None return all_data def random_batch(self): """Randomly choose a batch from loader, please note that the data should not be shuffled.""" idx = random.randint(0, len(self.loader) - 1) return list(self.loader)[idx] def _all_data_(self, col): return torch.cat([data[col].unsqueeze(0) for data in self.loader.dataset.data], 0) @staticmethod def prepare(samples, gpu=False): """Add start_letter to samples as inp, target same as samples""" inp = torch.zeros(samples.size()).long() target = samples inp[:, 0] = cfg.start_letter inp[:, 1:] = target[:, :cfg.max_seq_len - 1] #print(f"dataloader inp: {inp[0][:]}") #print(f"dataloader target: {target[0][:]}") if gpu: return inp.cuda(), target.cuda() return inp, target def load_data(self, filename): """Load real data from local file""" self.tokens = get_tokenlized(filename) samples_index = tokens_to_tensor(self.tokens, self.word2idx_dict) return self.prepare(samples_index) class DisDataIter: def __init__(self, pos_samples, neg_samples, shuffle=None): self.batch_size = cfg.batch_size self.max_seq_len = cfg.max_seq_len self.start_letter = cfg.start_letter self.shuffle = cfg.data_shuffle if not shuffle else shuffle self.loader = DataLoader( dataset=GANDataset(self.__read_data__(pos_samples, neg_samples)), batch_size=self.batch_size, shuffle=self.shuffle, drop_last=True) def __read_data__(self, pos_samples, neg_samples): """ input: same as target, but start with start_letter. """ inp, target = self.prepare(pos_samples, neg_samples) all_data = [{'input': i, 'target': t} for (i, t) in zip(inp, target)] return all_data def random_batch(self): idx = random.randint(0, len(self.loader) - 1) return list(self.loader)[idx] def prepare(self, pos_samples, neg_samples, gpu=False): """Build inp and target""" inp = torch.cat((pos_samples, neg_samples), dim=0).long().detach() # !!!need .detach() target = torch.ones(inp.size(0)).long() target[pos_samples.size(0):] = 0 # shuffle perm = torch.randperm(inp.size(0)) inp = inp[perm] target = target[perm] if gpu: return inp.cuda(), target.cuda() return inp, target
33.89313
100
0.611486
import random from torch.utils.data import Dataset, DataLoader from utils.text_process import * class GANDataset(Dataset): def __init__(self, data): self.data = data def __getitem__(self, index): return self.data[index] def __len__(self): return len(self.data) class GenDataIter: def __init__(self, samples, if_test_data=False, shuffle=None): self.batch_size = cfg.batch_size self.max_seq_len = cfg.max_seq_len self.start_letter = cfg.start_letter self.shuffle = cfg.data_shuffle if not shuffle else shuffle if cfg.if_real_data: self.word2idx_dict, self.idx2word_dict = load_dict(cfg.dataset) if if_test_data: self.word2idx_dict, self.idx2word_dict = load_test_dict(cfg.dataset) self.loader = DataLoader( dataset=GANDataset(self.__read_data__(samples)), batch_size=self.batch_size, shuffle=self.shuffle, drop_last=True) self.input = self._all_data_('input') self.target = self._all_data_('target') def __read_data__(self, samples): if isinstance(samples, torch.Tensor): inp, target = self.prepare(samples) all_data = [{'input': i, 'target': t} for (i, t) in zip(inp, target)] elif isinstance(samples, str): inp, target = self.load_data(samples) all_data = [{'input': i, 'target': t} for (i, t) in zip(inp, target)] else: all_data = None return all_data def random_batch(self): idx = random.randint(0, len(self.loader) - 1) return list(self.loader)[idx] def _all_data_(self, col): return torch.cat([data[col].unsqueeze(0) for data in self.loader.dataset.data], 0) @staticmethod def prepare(samples, gpu=False): inp = torch.zeros(samples.size()).long() target = samples inp[:, 0] = cfg.start_letter inp[:, 1:] = target[:, :cfg.max_seq_len - 1] if gpu: return inp.cuda(), target.cuda() return inp, target def load_data(self, filename): self.tokens = get_tokenlized(filename) samples_index = tokens_to_tensor(self.tokens, self.word2idx_dict) return self.prepare(samples_index) class DisDataIter: def __init__(self, pos_samples, neg_samples, shuffle=None): self.batch_size = cfg.batch_size self.max_seq_len = cfg.max_seq_len self.start_letter = cfg.start_letter self.shuffle = cfg.data_shuffle if not shuffle else shuffle self.loader = DataLoader( dataset=GANDataset(self.__read_data__(pos_samples, neg_samples)), batch_size=self.batch_size, shuffle=self.shuffle, drop_last=True) def __read_data__(self, pos_samples, neg_samples): inp, target = self.prepare(pos_samples, neg_samples) all_data = [{'input': i, 'target': t} for (i, t) in zip(inp, target)] return all_data def random_batch(self): idx = random.randint(0, len(self.loader) - 1) return list(self.loader)[idx] def prepare(self, pos_samples, neg_samples, gpu=False): inp = torch.cat((pos_samples, neg_samples), dim=0).long().detach() target = torch.ones(inp.size(0)).long() target[pos_samples.size(0):] = 0 perm = torch.randperm(inp.size(0)) inp = inp[perm] target = target[perm] if gpu: return inp.cuda(), target.cuda() return inp, target
true
true
f7263b27e2f8e5f7ffa8f4a9687f2edbb569a9d1
598
py
Python
plotly/validators/mesh3d/colorbar/tickfont/_family.py
gnestor/plotly.py
a8ae062795ddbf9867b8578fe6d9e244948c15ff
[ "MIT" ]
12
2020-04-18T18:10:22.000Z
2021-12-06T10:11:15.000Z
plotly/validators/mesh3d/colorbar/tickfont/_family.py
gnestor/plotly.py
a8ae062795ddbf9867b8578fe6d9e244948c15ff
[ "MIT" ]
27
2020-04-28T21:23:12.000Z
2021-06-25T15:36:38.000Z
plotly/validators/mesh3d/colorbar/tickfont/_family.py
gnestor/plotly.py
a8ae062795ddbf9867b8578fe6d9e244948c15ff
[ "MIT" ]
6
2020-04-18T23:07:08.000Z
2021-11-18T07:53:06.000Z
import _plotly_utils.basevalidators class FamilyValidator(_plotly_utils.basevalidators.StringValidator): def __init__( self, plotly_name='family', parent_name='mesh3d.colorbar.tickfont', **kwargs ): super(FamilyValidator, self).__init__( plotly_name=plotly_name, parent_name=parent_name, edit_type=kwargs.pop('edit_type', 'colorbars'), no_blank=kwargs.pop('no_blank', True), role=kwargs.pop('role', 'style'), strict=kwargs.pop('strict', True), **kwargs )
28.47619
68
0.602007
import _plotly_utils.basevalidators class FamilyValidator(_plotly_utils.basevalidators.StringValidator): def __init__( self, plotly_name='family', parent_name='mesh3d.colorbar.tickfont', **kwargs ): super(FamilyValidator, self).__init__( plotly_name=plotly_name, parent_name=parent_name, edit_type=kwargs.pop('edit_type', 'colorbars'), no_blank=kwargs.pop('no_blank', True), role=kwargs.pop('role', 'style'), strict=kwargs.pop('strict', True), **kwargs )
true
true
f7263b5df5fb3177603ae56acb9d953605d88e9b
1,670
py
Python
dtypes/radix_sort.py
jay-tyler/data-structures
b4f4bcb091cf4be4c4cc29d8a687af3d063090f5
[ "MIT" ]
2
2015-08-25T02:51:47.000Z
2019-11-03T20:00:16.000Z
dtypes/radix_sort.py
jay-tyler/data-structures
b4f4bcb091cf4be4c4cc29d8a687af3d063090f5
[ "MIT" ]
9
2015-09-19T20:51:14.000Z
2015-09-28T07:06:50.000Z
dtypes/radix_sort.py
jay-tyler/data-structures
b4f4bcb091cf4be4c4cc29d8a687af3d063090f5
[ "MIT" ]
1
2020-04-22T21:24:36.000Z
2020-04-22T21:24:36.000Z
def radsort(unslist): """Returns a sorted list. Accepts only a list containing positive integers.""" # find max for iterative solution maxval = max(unslist) ntimes = len(str(maxval)) slist = unslist[:] for n in range(ntimes): # Making radix bins bins = [[] for _ in range(10)] # Place each list item in appropriate bin for i, item in enumerate(slist): inspecting = slist[i] digval = _get_nth_digit(inspecting, n) bins[digval].append(inspecting) slist = [] # Flatten bins to list for bin in bins: slist.extend(bin) return slist def _get_nth_digit(num, n): """For a positive integer, get the value at the nth digit; indexing starts at 0""" return ((num % (10 ** (n + 1))) - (num % (10 ** n))) // 10 ** n if __name__ == "__main__": """Test time performance for best and worst cases""" import time size = 1000 # Best case: when all numbers in the list have the same number of digits. good_list = range(size + 1) start = time.time() for i in range(1000): radsort(good_list) stop = time.time() best_time = (stop - start) # Worst case: When there is one very large outlier. bad_list = [1 for _ in range(size)] + [10**10] start = time.time() for i in range(1000): radsort(bad_list) stop = time.time() worst_time = (stop - start) print "Best case is {} times better than worst for n=1000\n".format( worst_time/best_time) print "Best case: {0:.{1}f} ms\nWorst case: {2:.{3}f} ms".format( best_time, 5, worst_time, 5)
27.377049
77
0.58982
def radsort(unslist): """Returns a sorted list. Accepts only a list containing positive integers.""" maxval = max(unslist) ntimes = len(str(maxval)) slist = unslist[:] for n in range(ntimes): bins = [[] for _ in range(10)] for i, item in enumerate(slist): inspecting = slist[i] digval = _get_nth_digit(inspecting, n) bins[digval].append(inspecting) slist = [] for bin in bins: slist.extend(bin) return slist def _get_nth_digit(num, n): """For a positive integer, get the value at the nth digit; indexing starts at 0""" return ((num % (10 ** (n + 1))) - (num % (10 ** n))) // 10 ** n if __name__ == "__main__": """Test time performance for best and worst cases""" import time size = 1000 good_list = range(size + 1) start = time.time() for i in range(1000): radsort(good_list) stop = time.time() best_time = (stop - start) bad_list = [1 for _ in range(size)] + [10**10] start = time.time() for i in range(1000): radsort(bad_list) stop = time.time() worst_time = (stop - start) print "Best case is {} times better than worst for n=1000\n".format( worst_time/best_time) print "Best case: {0:.{1}f} ms\nWorst case: {2:.{3}f} ms".format( best_time, 5, worst_time, 5)
false
true
f7263ccf5a3a003b21440cf38813ca5d254016b4
15,637
py
Python
meshrcnn/modeling/roi_heads/roi_heads.py
hsk9767/mesh_rcnn_copy
6dd4d9ea8af33c03a084e34c7d16eeaddfe924ae
[ "BSD-3-Clause" ]
7
2020-03-06T20:49:36.000Z
2022-03-09T11:09:31.000Z
meshrcnn/modeling/roi_heads/roi_heads.py
hsk9767/mesh_rcnn_copy
6dd4d9ea8af33c03a084e34c7d16eeaddfe924ae
[ "BSD-3-Clause" ]
null
null
null
meshrcnn/modeling/roi_heads/roi_heads.py
hsk9767/mesh_rcnn_copy
6dd4d9ea8af33c03a084e34c7d16eeaddfe924ae
[ "BSD-3-Clause" ]
2
2020-04-14T02:14:25.000Z
2020-05-06T14:35:41.000Z
# Copyright (c) Facebook, Inc. and its affiliates. All Rights Reserved from typing import Dict import torch from detectron2.layers import ShapeSpec, cat from detectron2.modeling import ROI_HEADS_REGISTRY from detectron2.modeling.poolers import ROIPooler from detectron2.modeling.roi_heads.fast_rcnn import FastRCNNOutputLayers, FastRCNNOutputs from detectron2.modeling.roi_heads.roi_heads import StandardROIHeads, select_foreground_proposals from pytorch3d.ops import cubify from pytorch3d.structures import Meshes from pytorch3d.utils import ico_sphere from meshrcnn.modeling.roi_heads.mask_head import mask_rcnn_loss from meshrcnn.modeling.roi_heads.mesh_head import ( build_mesh_head, mesh_rcnn_inference, mesh_rcnn_loss, ) from meshrcnn.modeling.roi_heads.voxel_head import ( build_voxel_head, voxel_rcnn_inference, voxel_rcnn_loss, ) from meshrcnn.modeling.roi_heads.z_head import build_z_head, z_rcnn_inference, z_rcnn_loss from meshrcnn.utils import vis as vis_utils @ROI_HEADS_REGISTRY.register() class MeshRCNNROIHeads(StandardROIHeads): """ The ROI specific heads for Mesh R-CNN """ def __init__(self, cfg, input_shape: Dict[str, ShapeSpec]): super().__init__(cfg, input_shape) self._init_z_head(cfg, input_shape) self._init_voxel_head(cfg, input_shape) self._init_mesh_head(cfg, input_shape) # If MODEL.VIS_MINIBATCH is True we store minibatch targets # for visualization purposes self._vis = cfg.MODEL.VIS_MINIBATCH self._misc = {} self._vis_dir = cfg.OUTPUT_DIR def _init_z_head(self, cfg, input_shape): # fmt: off self.zpred_on = cfg.MODEL.ZPRED_ON if not self.zpred_on: return z_pooler_resolution = cfg.MODEL.ROI_Z_HEAD.POOLER_RESOLUTION z_pooler_scales = tuple(1.0 / input_shape[k].stride for k in self.in_features) z_sampling_ratio = cfg.MODEL.ROI_Z_HEAD.POOLER_SAMPLING_RATIO z_pooler_type = cfg.MODEL.ROI_Z_HEAD.POOLER_TYPE # fmt: on self.z_loss_weight = cfg.MODEL.ROI_Z_HEAD.Z_REG_WEIGHT self.z_smooth_l1_beta = cfg.MODEL.ROI_Z_HEAD.SMOOTH_L1_BETA in_channels = [input_shape[f].channels for f in self.in_features][0] self.z_pooler = ROIPooler( output_size=z_pooler_resolution, scales=z_pooler_scales, sampling_ratio=z_sampling_ratio, pooler_type=z_pooler_type, ) shape = ShapeSpec( channels=in_channels, width=z_pooler_resolution, height=z_pooler_resolution ) self.z_head = build_z_head(cfg, shape) def _init_voxel_head(self, cfg, input_shape): # fmt: off self.voxel_on = cfg.MODEL.VOXEL_ON if not self.voxel_on: return voxel_pooler_resolution = cfg.MODEL.ROI_VOXEL_HEAD.POOLER_RESOLUTION voxel_pooler_scales = tuple(1.0 / input_shape[k].stride for k in self.in_features) voxel_sampling_ratio = cfg.MODEL.ROI_VOXEL_HEAD.POOLER_SAMPLING_RATIO voxel_pooler_type = cfg.MODEL.ROI_VOXEL_HEAD.POOLER_TYPE # fmt: on self.voxel_loss_weight = cfg.MODEL.ROI_VOXEL_HEAD.LOSS_WEIGHT self.cls_agnostic_voxel = cfg.MODEL.ROI_VOXEL_HEAD.CLS_AGNOSTIC_VOXEL self.cubify_thresh = cfg.MODEL.ROI_VOXEL_HEAD.CUBIFY_THRESH in_channels = [input_shape[f].channels for f in self.in_features][0] self.voxel_pooler = ROIPooler( output_size=voxel_pooler_resolution, scales=voxel_pooler_scales, sampling_ratio=voxel_sampling_ratio, pooler_type=voxel_pooler_type, ) shape = ShapeSpec( channels=in_channels, width=voxel_pooler_resolution, height=voxel_pooler_resolution ) self.voxel_head = build_voxel_head(cfg, shape) def _init_mesh_head(self, cfg, input_shape): # fmt: off self.mesh_on = cfg.MODEL.MESH_ON if not self.mesh_on: return mesh_pooler_resolution = cfg.MODEL.ROI_MESH_HEAD.POOLER_RESOLUTION mesh_pooler_scales = tuple(1.0 / input_shape[k].stride for k in self.in_features) mesh_sampling_ratio = cfg.MODEL.ROI_MESH_HEAD.POOLER_SAMPLING_RATIO mesh_pooler_type = cfg.MODEL.ROI_MESH_HEAD.POOLER_TYPE # fmt: on self.chamfer_loss_weight = cfg.MODEL.ROI_MESH_HEAD.CHAMFER_LOSS_WEIGHT self.normals_loss_weight = cfg.MODEL.ROI_MESH_HEAD.NORMALS_LOSS_WEIGHT self.edge_loss_weight = cfg.MODEL.ROI_MESH_HEAD.EDGE_LOSS_WEIGHT self.gt_num_samples = cfg.MODEL.ROI_MESH_HEAD.GT_NUM_SAMPLES self.pred_num_samples = cfg.MODEL.ROI_MESH_HEAD.PRED_NUM_SAMPLES self.gt_coord_thresh = cfg.MODEL.ROI_MESH_HEAD.GT_COORD_THRESH self.ico_sphere_level = cfg.MODEL.ROI_MESH_HEAD.ICO_SPHERE_LEVEL in_channels = [input_shape[f].channels for f in self.in_features][0] self.mesh_pooler = ROIPooler( output_size=mesh_pooler_resolution, scales=mesh_pooler_scales, sampling_ratio=mesh_sampling_ratio, pooler_type=mesh_pooler_type, ) self.mesh_head = build_mesh_head( cfg, ShapeSpec( channels=in_channels, height=mesh_pooler_resolution, width=mesh_pooler_resolution ), ) def forward(self, images, features, proposals, targets=None): """ See :class:`ROIHeads.forward`. """ if self._vis: self._misc["images"] = images del images if self.training: proposals = self.label_and_sample_proposals(proposals, targets) del targets if self._vis: self._misc["proposals"] = proposals if self.training: losses = self._forward_box(features, proposals) # During training the proposals used by the box head are # used by the z, mask, voxel & mesh head. losses.update(self._forward_z(features, proposals)) losses.update(self._forward_mask(features, proposals)) losses.update(self._forward_shape(features, proposals)) # print minibatch examples if self._vis: vis_utils.visualize_minibatch(self._misc["images"], self._misc, self._vis_dir, True) return [], losses else: pred_instances = self._forward_box(features, proposals) # During inference cascaded prediction is used: the mask and keypoints heads are only # applied to the top scoring box detections. pred_instances = self.forward_with_given_boxes(features, pred_instances) return pred_instances, {} def forward_with_given_boxes(self, features, instances): """ Use the given boxes in `instances` to produce other (non-box) per-ROI outputs. Args: features: same as in `forward()` instances (list[Instances]): instances to predict other outputs. Expect the keys "pred_boxes" and "pred_classes" to exist. Returns: instances (Instances): the same `Instances` object, with extra fields such as `pred_masks` or `pred_voxels`. """ assert not self.training assert instances[0].has("pred_boxes") and instances[0].has("pred_classes") instances = self._forward_z(features, instances) instances = self._forward_mask(features, instances) instances = self._forward_shape(features, instances) return instances def _forward_z(self, features, instances): """ Forward logic of the z prediction branch. """ if not self.zpred_on: return {} if self.training else instances features = [features[f] for f in self.in_features] if self.training: # The loss is only defined on positive proposals. proposals, _ = select_foreground_proposals(instances, self.num_classes) proposal_boxes = [x.proposal_boxes for x in proposals] z_features = self.z_pooler(features, proposal_boxes) z_pred = self.z_head(z_features) src_boxes = cat([p.tensor for p in proposal_boxes]) loss_z_reg = z_rcnn_loss( z_pred, proposals, src_boxes, loss_weight=self.z_loss_weight, smooth_l1_beta=self.z_smooth_l1_beta, ) return {"loss_z_reg": loss_z_reg} else: pred_boxes = [x.pred_boxes for x in instances] z_features = self.z_pooler(features, pred_boxes) z_pred = self.z_head(z_features) z_rcnn_inference(z_pred, instances) return instances def _forward_mask(self, features, instances): """ Forward logic of the mask prediction branch. Args: features (dict[str,Tensor]): mapping from names to backbone features instances (list[Instances]): the per-image instances to train/predict masks. In training, they can be the proposals. In inference, they can be the predicted boxes. Returns: In training, a dict of losses. In inference, update `instances` with new fields "pred_masks" and return it. """ if not self.mask_on: return {} if self.training else instances features = [features[f] for f in self.in_features] if self.training: # The loss is only defined on positive proposals. proposals, _ = select_foreground_proposals(instances, self.num_classes) proposal_boxes = [x.proposal_boxes for x in proposals] mask_features = self.mask_pooler(features, proposal_boxes) mask_logits = self.mask_head.layers(mask_features) loss_mask, target_masks = mask_rcnn_loss(mask_logits, proposals) if self._vis: self._misc["target_masks"] = target_masks self._misc["fg_proposals"] = proposals return {"loss_mask": loss_mask} else: pred_boxes = [x.pred_boxes for x in instances] mask_features = self.mask_pooler(features, pred_boxes) return self.mask_head(mask_features, instances) def _forward_shape(self, features, instances): """ Forward logic for the voxel and mesh refinement branch. Args: features (list[Tensor]): #level input features for voxel prediction instances (list[Instances]): the per-image instances to train/predict meshes. In training, they can be the proposals. In inference, they can be the predicted boxes. Returns: In training, a dict of losses. In inference, update `instances` with new fields "pred_voxels" & "pred_meshes" and return it. """ if not self.voxel_on and not self.mesh_on: return {} if self.training else instances features = [features[f] for f in self.in_features] if self.training: # The loss is only defined on positive proposals. proposals, _ = select_foreground_proposals(instances, self.num_classes) proposal_boxes = [x.proposal_boxes for x in proposals] losses = {} if self.voxel_on: voxel_features = self.voxel_pooler(features, proposal_boxes) voxel_logits = self.voxel_head(voxel_features) loss_voxel, target_voxels = voxel_rcnn_loss( voxel_logits, proposals, loss_weight=self.voxel_loss_weight ) losses.update({"loss_voxel": loss_voxel}) if self._vis: self._misc["target_voxels"] = target_voxels if self.cls_agnostic_voxel: with torch.no_grad(): vox_in = voxel_logits.sigmoid().squeeze(1) # (N, V, V, V) init_mesh = cubify(vox_in, self.cubify_thresh) # 1 else: raise ValueError("No support for class specific predictions") if self.mesh_on: mesh_features = self.mesh_pooler(features, proposal_boxes) if not self.voxel_on: if mesh_features.shape[0] > 0: init_mesh = ico_sphere(self.ico_sphere_level, mesh_features.device) init_mesh = init_mesh.extend(mesh_features.shape[0]) else: init_mesh = Meshes(verts=[], faces=[]) pred_meshes = self.mesh_head(mesh_features, init_mesh) # loss weights loss_weights = { "chamfer": self.chamfer_loss_weight, "normals": self.normals_loss_weight, "edge": self.edge_loss_weight, } if not pred_meshes[0].isempty(): loss_chamfer, loss_normals, loss_edge, target_meshes = mesh_rcnn_loss( pred_meshes, proposals, loss_weights=loss_weights, gt_num_samples=self.gt_num_samples, pred_num_samples=self.pred_num_samples, gt_coord_thresh=self.gt_coord_thresh, ) if self._vis: self._misc["init_meshes"] = init_mesh self._misc["target_meshes"] = target_meshes else: loss_chamfer = sum(k.sum() for k in self.mesh_head.parameters()) * 0.0 loss_normals = sum(k.sum() for k in self.mesh_head.parameters()) * 0.0 loss_edge = sum(k.sum() for k in self.mesh_head.parameters()) * 0.0 losses.update( { "loss_chamfer": loss_chamfer, "loss_normals": loss_normals, "loss_edge": loss_edge, } ) return losses else: pred_boxes = [x.pred_boxes for x in instances] if self.voxel_on: voxel_features = self.voxel_pooler(features, pred_boxes) voxel_logits = self.voxel_head(voxel_features) voxel_rcnn_inference(voxel_logits, instances) if self.cls_agnostic_voxel: with torch.no_grad(): vox_in = voxel_logits.sigmoid().squeeze(1) # (N, V, V, V) init_mesh = cubify(vox_in, self.cubify_thresh) # 1 else: raise ValueError("No support for class specific predictions") if self.mesh_on: mesh_features = self.mesh_pooler(features, pred_boxes) if not self.voxel_on: if mesh_features.shape[0] > 0: init_mesh = ico_sphere(self.ico_sphere_level, mesh_features.device) init_mesh = init_mesh.extend(mesh_features.shape[0]) else: init_mesh = Meshes(verts=[], faces=[]) pred_meshes = self.mesh_head(mesh_features, init_mesh) mesh_rcnn_inference(pred_meshes[-1], instances) else: assert self.voxel_on mesh_rcnn_inference(init_mesh, instances) return instances
42.841096
105
0.616039
from typing import Dict import torch from detectron2.layers import ShapeSpec, cat from detectron2.modeling import ROI_HEADS_REGISTRY from detectron2.modeling.poolers import ROIPooler from detectron2.modeling.roi_heads.fast_rcnn import FastRCNNOutputLayers, FastRCNNOutputs from detectron2.modeling.roi_heads.roi_heads import StandardROIHeads, select_foreground_proposals from pytorch3d.ops import cubify from pytorch3d.structures import Meshes from pytorch3d.utils import ico_sphere from meshrcnn.modeling.roi_heads.mask_head import mask_rcnn_loss from meshrcnn.modeling.roi_heads.mesh_head import ( build_mesh_head, mesh_rcnn_inference, mesh_rcnn_loss, ) from meshrcnn.modeling.roi_heads.voxel_head import ( build_voxel_head, voxel_rcnn_inference, voxel_rcnn_loss, ) from meshrcnn.modeling.roi_heads.z_head import build_z_head, z_rcnn_inference, z_rcnn_loss from meshrcnn.utils import vis as vis_utils @ROI_HEADS_REGISTRY.register() class MeshRCNNROIHeads(StandardROIHeads): def __init__(self, cfg, input_shape: Dict[str, ShapeSpec]): super().__init__(cfg, input_shape) self._init_z_head(cfg, input_shape) self._init_voxel_head(cfg, input_shape) self._init_mesh_head(cfg, input_shape) self._vis = cfg.MODEL.VIS_MINIBATCH self._misc = {} self._vis_dir = cfg.OUTPUT_DIR def _init_z_head(self, cfg, input_shape): self.zpred_on = cfg.MODEL.ZPRED_ON if not self.zpred_on: return z_pooler_resolution = cfg.MODEL.ROI_Z_HEAD.POOLER_RESOLUTION z_pooler_scales = tuple(1.0 / input_shape[k].stride for k in self.in_features) z_sampling_ratio = cfg.MODEL.ROI_Z_HEAD.POOLER_SAMPLING_RATIO z_pooler_type = cfg.MODEL.ROI_Z_HEAD.POOLER_TYPE self.z_loss_weight = cfg.MODEL.ROI_Z_HEAD.Z_REG_WEIGHT self.z_smooth_l1_beta = cfg.MODEL.ROI_Z_HEAD.SMOOTH_L1_BETA in_channels = [input_shape[f].channels for f in self.in_features][0] self.z_pooler = ROIPooler( output_size=z_pooler_resolution, scales=z_pooler_scales, sampling_ratio=z_sampling_ratio, pooler_type=z_pooler_type, ) shape = ShapeSpec( channels=in_channels, width=z_pooler_resolution, height=z_pooler_resolution ) self.z_head = build_z_head(cfg, shape) def _init_voxel_head(self, cfg, input_shape): self.voxel_on = cfg.MODEL.VOXEL_ON if not self.voxel_on: return voxel_pooler_resolution = cfg.MODEL.ROI_VOXEL_HEAD.POOLER_RESOLUTION voxel_pooler_scales = tuple(1.0 / input_shape[k].stride for k in self.in_features) voxel_sampling_ratio = cfg.MODEL.ROI_VOXEL_HEAD.POOLER_SAMPLING_RATIO voxel_pooler_type = cfg.MODEL.ROI_VOXEL_HEAD.POOLER_TYPE self.voxel_loss_weight = cfg.MODEL.ROI_VOXEL_HEAD.LOSS_WEIGHT self.cls_agnostic_voxel = cfg.MODEL.ROI_VOXEL_HEAD.CLS_AGNOSTIC_VOXEL self.cubify_thresh = cfg.MODEL.ROI_VOXEL_HEAD.CUBIFY_THRESH in_channels = [input_shape[f].channels for f in self.in_features][0] self.voxel_pooler = ROIPooler( output_size=voxel_pooler_resolution, scales=voxel_pooler_scales, sampling_ratio=voxel_sampling_ratio, pooler_type=voxel_pooler_type, ) shape = ShapeSpec( channels=in_channels, width=voxel_pooler_resolution, height=voxel_pooler_resolution ) self.voxel_head = build_voxel_head(cfg, shape) def _init_mesh_head(self, cfg, input_shape): self.mesh_on = cfg.MODEL.MESH_ON if not self.mesh_on: return mesh_pooler_resolution = cfg.MODEL.ROI_MESH_HEAD.POOLER_RESOLUTION mesh_pooler_scales = tuple(1.0 / input_shape[k].stride for k in self.in_features) mesh_sampling_ratio = cfg.MODEL.ROI_MESH_HEAD.POOLER_SAMPLING_RATIO mesh_pooler_type = cfg.MODEL.ROI_MESH_HEAD.POOLER_TYPE self.chamfer_loss_weight = cfg.MODEL.ROI_MESH_HEAD.CHAMFER_LOSS_WEIGHT self.normals_loss_weight = cfg.MODEL.ROI_MESH_HEAD.NORMALS_LOSS_WEIGHT self.edge_loss_weight = cfg.MODEL.ROI_MESH_HEAD.EDGE_LOSS_WEIGHT self.gt_num_samples = cfg.MODEL.ROI_MESH_HEAD.GT_NUM_SAMPLES self.pred_num_samples = cfg.MODEL.ROI_MESH_HEAD.PRED_NUM_SAMPLES self.gt_coord_thresh = cfg.MODEL.ROI_MESH_HEAD.GT_COORD_THRESH self.ico_sphere_level = cfg.MODEL.ROI_MESH_HEAD.ICO_SPHERE_LEVEL in_channels = [input_shape[f].channels for f in self.in_features][0] self.mesh_pooler = ROIPooler( output_size=mesh_pooler_resolution, scales=mesh_pooler_scales, sampling_ratio=mesh_sampling_ratio, pooler_type=mesh_pooler_type, ) self.mesh_head = build_mesh_head( cfg, ShapeSpec( channels=in_channels, height=mesh_pooler_resolution, width=mesh_pooler_resolution ), ) def forward(self, images, features, proposals, targets=None): if self._vis: self._misc["images"] = images del images if self.training: proposals = self.label_and_sample_proposals(proposals, targets) del targets if self._vis: self._misc["proposals"] = proposals if self.training: losses = self._forward_box(features, proposals) losses.update(self._forward_z(features, proposals)) losses.update(self._forward_mask(features, proposals)) losses.update(self._forward_shape(features, proposals)) if self._vis: vis_utils.visualize_minibatch(self._misc["images"], self._misc, self._vis_dir, True) return [], losses else: pred_instances = self._forward_box(features, proposals) pred_instances = self.forward_with_given_boxes(features, pred_instances) return pred_instances, {} def forward_with_given_boxes(self, features, instances): assert not self.training assert instances[0].has("pred_boxes") and instances[0].has("pred_classes") instances = self._forward_z(features, instances) instances = self._forward_mask(features, instances) instances = self._forward_shape(features, instances) return instances def _forward_z(self, features, instances): if not self.zpred_on: return {} if self.training else instances features = [features[f] for f in self.in_features] if self.training: proposals, _ = select_foreground_proposals(instances, self.num_classes) proposal_boxes = [x.proposal_boxes for x in proposals] z_features = self.z_pooler(features, proposal_boxes) z_pred = self.z_head(z_features) src_boxes = cat([p.tensor for p in proposal_boxes]) loss_z_reg = z_rcnn_loss( z_pred, proposals, src_boxes, loss_weight=self.z_loss_weight, smooth_l1_beta=self.z_smooth_l1_beta, ) return {"loss_z_reg": loss_z_reg} else: pred_boxes = [x.pred_boxes for x in instances] z_features = self.z_pooler(features, pred_boxes) z_pred = self.z_head(z_features) z_rcnn_inference(z_pred, instances) return instances def _forward_mask(self, features, instances): if not self.mask_on: return {} if self.training else instances features = [features[f] for f in self.in_features] if self.training: proposals, _ = select_foreground_proposals(instances, self.num_classes) proposal_boxes = [x.proposal_boxes for x in proposals] mask_features = self.mask_pooler(features, proposal_boxes) mask_logits = self.mask_head.layers(mask_features) loss_mask, target_masks = mask_rcnn_loss(mask_logits, proposals) if self._vis: self._misc["target_masks"] = target_masks self._misc["fg_proposals"] = proposals return {"loss_mask": loss_mask} else: pred_boxes = [x.pred_boxes for x in instances] mask_features = self.mask_pooler(features, pred_boxes) return self.mask_head(mask_features, instances) def _forward_shape(self, features, instances): if not self.voxel_on and not self.mesh_on: return {} if self.training else instances features = [features[f] for f in self.in_features] if self.training: proposals, _ = select_foreground_proposals(instances, self.num_classes) proposal_boxes = [x.proposal_boxes for x in proposals] losses = {} if self.voxel_on: voxel_features = self.voxel_pooler(features, proposal_boxes) voxel_logits = self.voxel_head(voxel_features) loss_voxel, target_voxels = voxel_rcnn_loss( voxel_logits, proposals, loss_weight=self.voxel_loss_weight ) losses.update({"loss_voxel": loss_voxel}) if self._vis: self._misc["target_voxels"] = target_voxels if self.cls_agnostic_voxel: with torch.no_grad(): vox_in = voxel_logits.sigmoid().squeeze(1) init_mesh = cubify(vox_in, self.cubify_thresh) else: raise ValueError("No support for class specific predictions") if self.mesh_on: mesh_features = self.mesh_pooler(features, proposal_boxes) if not self.voxel_on: if mesh_features.shape[0] > 0: init_mesh = ico_sphere(self.ico_sphere_level, mesh_features.device) init_mesh = init_mesh.extend(mesh_features.shape[0]) else: init_mesh = Meshes(verts=[], faces=[]) pred_meshes = self.mesh_head(mesh_features, init_mesh) loss_weights = { "chamfer": self.chamfer_loss_weight, "normals": self.normals_loss_weight, "edge": self.edge_loss_weight, } if not pred_meshes[0].isempty(): loss_chamfer, loss_normals, loss_edge, target_meshes = mesh_rcnn_loss( pred_meshes, proposals, loss_weights=loss_weights, gt_num_samples=self.gt_num_samples, pred_num_samples=self.pred_num_samples, gt_coord_thresh=self.gt_coord_thresh, ) if self._vis: self._misc["init_meshes"] = init_mesh self._misc["target_meshes"] = target_meshes else: loss_chamfer = sum(k.sum() for k in self.mesh_head.parameters()) * 0.0 loss_normals = sum(k.sum() for k in self.mesh_head.parameters()) * 0.0 loss_edge = sum(k.sum() for k in self.mesh_head.parameters()) * 0.0 losses.update( { "loss_chamfer": loss_chamfer, "loss_normals": loss_normals, "loss_edge": loss_edge, } ) return losses else: pred_boxes = [x.pred_boxes for x in instances] if self.voxel_on: voxel_features = self.voxel_pooler(features, pred_boxes) voxel_logits = self.voxel_head(voxel_features) voxel_rcnn_inference(voxel_logits, instances) if self.cls_agnostic_voxel: with torch.no_grad(): vox_in = voxel_logits.sigmoid().squeeze(1) init_mesh = cubify(vox_in, self.cubify_thresh) else: raise ValueError("No support for class specific predictions") if self.mesh_on: mesh_features = self.mesh_pooler(features, pred_boxes) if not self.voxel_on: if mesh_features.shape[0] > 0: init_mesh = ico_sphere(self.ico_sphere_level, mesh_features.device) init_mesh = init_mesh.extend(mesh_features.shape[0]) else: init_mesh = Meshes(verts=[], faces=[]) pred_meshes = self.mesh_head(mesh_features, init_mesh) mesh_rcnn_inference(pred_meshes[-1], instances) else: assert self.voxel_on mesh_rcnn_inference(init_mesh, instances) return instances
true
true
f7263d836807e256e08d31435e58c1ede32bac68
718
py
Python
Class1/ex7_YAML_JSON_read.py
karimjamali/Class-1
64a97e143dd0a9bd0e177481a6a858638bfd3766
[ "Apache-2.0" ]
null
null
null
Class1/ex7_YAML_JSON_read.py
karimjamali/Class-1
64a97e143dd0a9bd0e177481a6a858638bfd3766
[ "Apache-2.0" ]
null
null
null
Class1/ex7_YAML_JSON_read.py
karimjamali/Class-1
64a97e143dd0a9bd0e177481a6a858638bfd3766
[ "Apache-2.0" ]
null
null
null
#!/usr/bin/env/python import yaml import json from pprint import pprint def output_format(my_list, my_str): # Make the output format easier to read # ''' print "Converting from " , my_str ,"FORMAT" print "#" * 30 pprint (my_list) def main(): #my_dict={'karim':'32','yasmine':'26','amine':'1','dad':'76','mum':'67'} yaml_output="yaml_output.yml" json_output="json_output.json" json_list=[] yaml_list=[] with open(yaml_output,"r") as f: yaml_list=yaml.load(f) with open(json_output,"r") as f: json_list=json.load(f) print "JSON_LIST: ", output_format(json_list,'JSON') print "YAML_LIST: ",output_format(yaml_list,'YAML') if __name__ == '__main__': main()
17.512195
72
0.650418
import yaml import json from pprint import pprint def output_format(my_list, my_str): print "Converting from " , my_str ,"FORMAT" print "#" * 30 pprint (my_list) def main(): #my_dict={'karim':'32','yasmine':'26','amine':'1','dad':'76','mum':'67'} yaml_output="yaml_output.yml" json_output="json_output.json" json_list=[] yaml_list=[] with open(yaml_output,"r") as f: yaml_list=yaml.load(f) with open(json_output,"r") as f: json_list=json.load(f) print "JSON_LIST: ", output_format(json_list,'JSON') print "YAML_LIST: ",output_format(yaml_list,'YAML') if __name__ == '__main__': main()
false
true
f7263d929de143ba1a7546baa19c897e7ec8745c
18,460
py
Python
cybergis_compute_client/CyberGISCompute.py
alexandermichels/cybergis-compute-python-sdk
6e7790a627368d0031582fe44a58fdb514868950
[ "Apache-2.0" ]
null
null
null
cybergis_compute_client/CyberGISCompute.py
alexandermichels/cybergis-compute-python-sdk
6e7790a627368d0031582fe44a58fdb514868950
[ "Apache-2.0" ]
null
null
null
cybergis_compute_client/CyberGISCompute.py
alexandermichels/cybergis-compute-python-sdk
6e7790a627368d0031582fe44a58fdb514868950
[ "Apache-2.0" ]
null
null
null
""" This module exposes CyberGISCompute class which creates a CyberGISCompute object that serves as an entry point to the CyberGISX environment from a Python/Jupyter notebook. All interactions with the High Performance Computing (HPC) backend are performed using this object. Example: cybergis = CyberGISCompute(url='localhost', port='3030', protocol='HTTP', isJupyter=False) """ from .Client import * from .Job import * from .UI import * import base64 import os from IPython.display import display, Markdown, Javascript class CyberGISCompute: """ CyberGISCompute class An inteface that handles all interactions with the HPC backend Attributes: client (Client object) : Initialized using url(str), protocol(str), port(str) and suffix(str) jupyterhubApiToken (string) : jupyterhub's REST API token that can be used to authenticate the user (https://jhubdocs.readthedocs.io/en/latest/jupyterhub/docs/source/rest.html) username (string) : username isJupyter (boolean) : set to True if you are working in a jupyter environment. If you are working in a simple Python environment then set to False ui (UI) : Serves as entry point to UI functionality job (Job) : Serves as entry point to access job interactions recentDownloadPath (str) : Gets the most recent download path from globus jupyterhubHost (str) : static variable that stores the path to jupyterhubHost """ # static variable jupyterhubHost = None job = None def __init__(self, url="cgjobsup.cigi.illinois.edu", port=443, protocol='HTTPS', suffix="", isJupyter=True): """ Initializes instance CyberGISCompute using inputs from the client Args: url (str) : url that needs to be accessed port (str) : port of the Jupyter or Python interface protocol (str) : Typically HTTP or HTTPS suffix (str) : specify version. For e.g v2 isJupyter(booleans) : set to True if you are using Jupyter environment Returns: (obj) : this CyberGISCompute """ self.client = Client(url=url, protocol=protocol, port=port, suffix=suffix) self.jupyterhubApiToken = None self.username = None self.isJupyter = isJupyter self.ui = UI(self) if isJupyter: self.enable_jupyter() # job self.job = None self.recentDownloadPath = None def login(self, manualLogin=True): """ Authenticates the client's jupyterhubApiToken and gives them access to CyberGISCompute features Args: manualLogin (boolean) : set to True if env variable and file login modes are not available Returns : None """ if self.jupyterhubApiToken is not None: print('🎯 Logged in as ' + self.username) return # login via env variable envToken = os.getenv('JUPYTERHUB_API_TOKEN') if envToken is not None: print('💻 Found system token') try: token = base64.b64encode((self.jupyterhubHost + '@' + envToken).encode('ascii')).decode('utf-8') res = self.client.request('GET', '/user', {"jupyterhubApiToken": token}) self.jupyterhubApiToken = token self.username = res['username'] return self.login() except: print('❌ Failed to login via system token') # login via file if path.exists('./cybergis_compute_user.json'): with open(os.path.abspath('cybergis_compute_user.json')) as f: user = json.load(f) token = user['token'] print('📃 Found "cybergis_compute_user.json"') try: res = self.client.request('GET', '/user', {"jupyterhubApiToken": token}) self.jupyterhubApiToken = token self.username = res['username'] return self.login() except: print('❌ Failed to login via token JSON file') print('NOTE: if you want to login as another user, please remove this file') elif manualLogin: if self.isJupyter: if (self.jupyterhubHost is not None): import getpass print('📢 Please go to Control Panel -> Token, request a new API token') token = getpass.getpass('enter your API token here') token = base64.b64encode((self.jupyterhubHost + '@' + token).encode('ascii')).decode('utf-8') try: res = self.client.request('GET', '/user', {"jupyterhubApiToken": token}) self.jupyterhubApiToken = token self.username = res['username'] with open('./cybergis_compute_user.json', 'w') as json_file: json.dump({"token": token}, json_file) return self.login() except: print('❌ Failed to login via user input') else: print('❌ You might not be working on a web browser or enabled JavaScript') else: print('❌ Enable Jupyter using .enable_jupyter() before you login') else: print('❌ Not logged in. To enable more features, use .login()') def create_job(self, maintainer='community_contribution', hpc=None, hpcUsername=None, hpcPassword=None, printJob=True): """ Creates a job object Initializes instance CyberGISCompute using inputs from the client Args: maintainer (str) : Pre-packaged programs which can be configured and controlled remotely and behave as a bridge between user and HPC backends hpc(str) : HPC backend that is being accessed. For e.g 'keeling_community' hpcUsername (str) : username for HPC backend hpcPassword (str) : password for HPC backend printJob (str) : prints the Job infortmation if set to True Returns: (Job) : The new job instance that was initialized """ self.login() return Job(maintainer=maintainer, hpc=hpc, id=None, hpcUsername=hpcUsername, hpcPassword=hpcPassword, client=self.client, isJupyter=self.isJupyter, jupyterhubApiToken=self.jupyterhubApiToken, printJob=printJob) def get_job_by_id(self, id=None): """ Returns Job object with the specified id Args: id(int) : Job id Returns (Job) : Job object with the specified id otherwise None """ self.login() jobs = self.client.request('GET', '/user/job', {"jupyterhubApiToken": self.jupyterhubApiToken}) token = None for job in jobs['job']: if (job['id'] == id): token = job['secretToken'] if (token is None): print('❌ job with id ' + id + ' was not found') return Job(secretToken=token, client=self.client, id=id, isJupyter=self.isJupyter, jupyterhubApiToken=self.jupyterhubApiToken) def get_slurm_usage(self, raw=False): """ prints slurm usage Args: raw(boolean) : set to True if you want the raw output Returns (JSON) : Raw output if raw=True otherwise its printed or displayed directly into the interface """ self.login() usage = self.client.request('GET', '/user/slurm-usage?format={}'.format(not raw), {"jupyterhubApiToken": self.jupyterhubApiToken}) if raw: return usage display(Markdown("Nodes: {}<br>Allocated CPUs: {}<br>Total CPU Time: {}<br>Memory Utilized: {}<br>Total Allocated Memory: {}<br>Total Walltime: {}".format( usage['nodes'], usage['cpus'], usage['cpuTime'], usage['memory'], usage['memoryUsage'], usage['walltime']))) def list_job(self, raw=False): """ prints a list of jobs that were submitted Args: raw (boolean) : set to True if you want the raw output Returns (JSON) : Raw output if raw=True otherwise its printed or displayed into the interface """ self.login() if self.jupyterhubApiToken is None: print('❌ please login') jobs = self.client.request('GET', '/user/job', {"jupyterhubApiToken": self.jupyterhubApiToken}) if raw: return jobs headers = ['id', 'hpc', 'executableFolder', 'dataFolder', 'resultFolder', 'param', 'slurm', 'userId', 'maintainer', 'createdAt'] data = [] for job in jobs['job']: data.append([ job['id'], job['hpc'], job['executableFolder'], job['dataFolder'], job['resultFolder'], json.dumps(job['param']), json.dumps(job['slurm']), job['userId'], job['maintainer'], job['createdAt'], ]) if self.isJupyter: if len(data) == 0: print('empty') return display(HTML(tabulate(data, headers, numalign='left', stralign='left', colalign=('left', 'left'), tablefmt='html').replace('<td>', '<td style="text-align:left">').replace('<th>', '<th style="text-align:left">'))) else: print(tabulate(data, headers, tablefmt="presto")) def list_hpc(self, raw=False): """ prints a list of hpc resources that the server supports Args: raw (boolean) : set to True if you want the raw output Returns (JSON) : Raw output if raw=True otherwise its printed or displayed directly into the interface """ hpc = self.client.request('GET', '/hpc')['hpc'] if raw: return hpc headers = ['hpc', 'ip', 'port', 'is_community_account'] data = [] for i in hpc: data.append([ i, hpc[i]['ip'], hpc[i]['port'], hpc[i]['is_community_account'] ]) if self.isJupyter: if len(data) == 0: print('empty') return display(HTML(tabulate(data, headers, numalign='left', stralign='left', colalign=('left', 'left'), tablefmt='html').replace('<td>', '<td style="text-align:left">').replace('<th>', '<th style="text-align:left">'))) else: print(tabulate(data, headers, tablefmt="presto")) def list_container(self, raw=False): """ prints a list of containers that the server supports Args: raw (boolean) : set to True if you want the raw output Returns (JSON) : Raw output if raw=True otherwise its printed or displayed directly into the interface """ container = self.client.request('GET', '/container')['container'] if raw: return container headers = ['container name', 'dockerfile', 'dockerhub'] data = [] for i in container: data.append([ i, container[i]['dockerfile'], container[i]['dockerhub'] ]) if self.isJupyter: if len(data) == 0: print('empty') return display(HTML(tabulate(data, headers, numalign='left', stralign='left', colalign=('left', 'left'), tablefmt='html').replace('<td>', '<td style="text-align:left">').replace('<th>', '<th style="text-align:left">'))) else: print(tabulate(data, headers, tablefmt="presto")) def list_git(self, raw=False): """ prints a list of Git projects that the server supports Args: raw (boolean) : set to True if you want the raw output Returns (JSON) : Raw output if raw=True otherwise its printed or displayed directly into the interface """ git = self.client.request('GET', '/git')['git'] if raw: return git headers = ['link', 'name', 'container', 'repository', 'commit'] data = [] for i in git: data.append([ 'git://' + i, git[i]['name'], git[i]['container'], git[i]['repository'], git[i]['commit'] if 'commit' in git[i] else 'NONE', ]) if self.isJupyter: if len(data) == 0: print('empty') return display(HTML(tabulate(data, headers, numalign='left', stralign='left', colalign=('left', 'left'), tablefmt='html').replace('<td>', '<td style="text-align:left">').replace('<th>', '<th style="text-align:left">'))) else: print(tabulate(data, headers, tablefmt="presto")) def list_maintainer(self, raw=False): """ prints a list of maintainers that the server supports Args: raw (boolean) : set to True if you want the raw output Returns (JSON) : Raw output if raw=True otherwise its printed or displayed directly into the interface """ maintainers = self.client.request('GET', '/maintainer')['maintainer'] if raw: return maintainers headers = ['maintainer', 'hpc', 'default_hpc', 'job_pool_capacity', 'executable_folder->from_user', 'executable_folder->must_have'] data = [] for i in maintainers: maintainer = maintainers[i] from_user = 'not specified' if 'executable_folder' in maintainer: from_user = maintainer['executable_folder']['from_user'] must_have = 'not specified' if 'executable_folder' in maintainer: if 'file_config' in maintainer['executable_folder']: if 'must_have' in maintainer['executable_folder']['file_config']: must_have = maintainer['executable_folder']['file_config']['must_have'] data.append([ i, maintainer['hpc'], maintainer['default_hpc'], maintainer['job_pool_capacity'], from_user, must_have ]) if self.isJupyter: if len(data) == 0: print('empty') return display(HTML(tabulate(data, headers, numalign='left', stralign='left', colalign=('left', 'left'), tablefmt='html').replace('<td>', '<td style="text-align:left">').replace('<th>', '<th style="text-align:left">'))) else: print(tabulate(data, headers, tablefmt="presto")) # Integrated functions def list_info(self, list_maintainer=False, list_container=False): """ calls list_git, list_hpc, list_job with options to call list_maintainer and list_container Args: list_maintainer (boolean) : set to True if you want to call list_maintainer list_container (boolean) : set to True of you want to call list Returns None """ print('📦 Git repositories:') self.list_git() print('🖥 HPC endpoints:') self.list_hpc() if self.is_login(): print('📮 Submitted jobs:') self.list_job() if list_container: print('🗳 Containers:') self.list_container() if list_maintainer: print('🤖 Maintainers:') self.list_maintainer() def create_job_by_ui(self, defaultJob="hello_world", defaultDataFolder="./", defaultRemoteResultFolder=None): """ Displays the job submission UI Args: defaultJob (str) : Stores the default job that shows up on the UI defaultDataFolder (str) : Stores the default input folder that shows up on the UI defaultRemoteResultFolder (str) : Stores the default output folder that shows up on the UI Returns: None """ self.ui.defaultJobName = defaultJob self.ui.defaultDataFolder = defaultDataFolder if defaultRemoteResultFolder is not None: self.ui.defaultRemoteResultFolder = defaultRemoteResultFolder if defaultRemoteResultFolder[0] == '/' else '/' + defaultRemoteResultFolder self.ui.render() def get_latest_created_job(self): """ Return the current job instance Args: None Returns: (JOB) : Latest Job object instance """ return self.job # helper functions def enable_jupyter(self): """ sets up jupyter environment in jupyterhubHost Args: None Returns: None """ self.isJupyter = True # get jupyter variable url = os.getenv('JUPYTER_INSTANCE_URL') if url is not None: CyberGISCompute.jupyterhubHost = url.replace('https://', '').replace('http://', '') else: display(Javascript('IPython.notebook.kernel.execute(`CyberGISCompute.jupyterhubHost = "${window.location.host}"`);')) def get_user_jupyter_globus(self): """ Return the current job instance Args: None Returns: (JOB) : Latest Job object instance """ return self.client.request('GET', '/user/jupyter-globus', {"jupyterhubApiToken": self.jupyterhubApiToken}) def is_login(self): """ Checks whether jupyterhubApi token exists or not Args: None Returns: (boolean) : jupyterhubAPI existence check """ return self.jupyterhubApiToken is not None
41.483146
224
0.551842
from .Client import * from .Job import * from .UI import * import base64 import os from IPython.display import display, Markdown, Javascript class CyberGISCompute: jupyterhubHost = None job = None def __init__(self, url="cgjobsup.cigi.illinois.edu", port=443, protocol='HTTPS', suffix="", isJupyter=True): self.client = Client(url=url, protocol=protocol, port=port, suffix=suffix) self.jupyterhubApiToken = None self.username = None self.isJupyter = isJupyter self.ui = UI(self) if isJupyter: self.enable_jupyter() self.job = None self.recentDownloadPath = None def login(self, manualLogin=True): if self.jupyterhubApiToken is not None: print('🎯 Logged in as ' + self.username) return envToken = os.getenv('JUPYTERHUB_API_TOKEN') if envToken is not None: print('💻 Found system token') try: token = base64.b64encode((self.jupyterhubHost + '@' + envToken).encode('ascii')).decode('utf-8') res = self.client.request('GET', '/user', {"jupyterhubApiToken": token}) self.jupyterhubApiToken = token self.username = res['username'] return self.login() except: print('❌ Failed to login via system token') if path.exists('./cybergis_compute_user.json'): with open(os.path.abspath('cybergis_compute_user.json')) as f: user = json.load(f) token = user['token'] print('📃 Found "cybergis_compute_user.json"') try: res = self.client.request('GET', '/user', {"jupyterhubApiToken": token}) self.jupyterhubApiToken = token self.username = res['username'] return self.login() except: print('❌ Failed to login via token JSON file') print('NOTE: if you want to login as another user, please remove this file') elif manualLogin: if self.isJupyter: if (self.jupyterhubHost is not None): import getpass print('📢 Please go to Control Panel -> Token, request a new API token') token = getpass.getpass('enter your API token here') token = base64.b64encode((self.jupyterhubHost + '@' + token).encode('ascii')).decode('utf-8') try: res = self.client.request('GET', '/user', {"jupyterhubApiToken": token}) self.jupyterhubApiToken = token self.username = res['username'] with open('./cybergis_compute_user.json', 'w') as json_file: json.dump({"token": token}, json_file) return self.login() except: print('❌ Failed to login via user input') else: print('❌ You might not be working on a web browser or enabled JavaScript') else: print('❌ Enable Jupyter using .enable_jupyter() before you login') else: print('❌ Not logged in. To enable more features, use .login()') def create_job(self, maintainer='community_contribution', hpc=None, hpcUsername=None, hpcPassword=None, printJob=True): self.login() return Job(maintainer=maintainer, hpc=hpc, id=None, hpcUsername=hpcUsername, hpcPassword=hpcPassword, client=self.client, isJupyter=self.isJupyter, jupyterhubApiToken=self.jupyterhubApiToken, printJob=printJob) def get_job_by_id(self, id=None): self.login() jobs = self.client.request('GET', '/user/job', {"jupyterhubApiToken": self.jupyterhubApiToken}) token = None for job in jobs['job']: if (job['id'] == id): token = job['secretToken'] if (token is None): print('❌ job with id ' + id + ' was not found') return Job(secretToken=token, client=self.client, id=id, isJupyter=self.isJupyter, jupyterhubApiToken=self.jupyterhubApiToken) def get_slurm_usage(self, raw=False): self.login() usage = self.client.request('GET', '/user/slurm-usage?format={}'.format(not raw), {"jupyterhubApiToken": self.jupyterhubApiToken}) if raw: return usage display(Markdown("Nodes: {}<br>Allocated CPUs: {}<br>Total CPU Time: {}<br>Memory Utilized: {}<br>Total Allocated Memory: {}<br>Total Walltime: {}".format( usage['nodes'], usage['cpus'], usage['cpuTime'], usage['memory'], usage['memoryUsage'], usage['walltime']))) def list_job(self, raw=False): self.login() if self.jupyterhubApiToken is None: print('❌ please login') jobs = self.client.request('GET', '/user/job', {"jupyterhubApiToken": self.jupyterhubApiToken}) if raw: return jobs headers = ['id', 'hpc', 'executableFolder', 'dataFolder', 'resultFolder', 'param', 'slurm', 'userId', 'maintainer', 'createdAt'] data = [] for job in jobs['job']: data.append([ job['id'], job['hpc'], job['executableFolder'], job['dataFolder'], job['resultFolder'], json.dumps(job['param']), json.dumps(job['slurm']), job['userId'], job['maintainer'], job['createdAt'], ]) if self.isJupyter: if len(data) == 0: print('empty') return display(HTML(tabulate(data, headers, numalign='left', stralign='left', colalign=('left', 'left'), tablefmt='html').replace('<td>', '<td style="text-align:left">').replace('<th>', '<th style="text-align:left">'))) else: print(tabulate(data, headers, tablefmt="presto")) def list_hpc(self, raw=False): hpc = self.client.request('GET', '/hpc')['hpc'] if raw: return hpc headers = ['hpc', 'ip', 'port', 'is_community_account'] data = [] for i in hpc: data.append([ i, hpc[i]['ip'], hpc[i]['port'], hpc[i]['is_community_account'] ]) if self.isJupyter: if len(data) == 0: print('empty') return display(HTML(tabulate(data, headers, numalign='left', stralign='left', colalign=('left', 'left'), tablefmt='html').replace('<td>', '<td style="text-align:left">').replace('<th>', '<th style="text-align:left">'))) else: print(tabulate(data, headers, tablefmt="presto")) def list_container(self, raw=False): container = self.client.request('GET', '/container')['container'] if raw: return container headers = ['container name', 'dockerfile', 'dockerhub'] data = [] for i in container: data.append([ i, container[i]['dockerfile'], container[i]['dockerhub'] ]) if self.isJupyter: if len(data) == 0: print('empty') return display(HTML(tabulate(data, headers, numalign='left', stralign='left', colalign=('left', 'left'), tablefmt='html').replace('<td>', '<td style="text-align:left">').replace('<th>', '<th style="text-align:left">'))) else: print(tabulate(data, headers, tablefmt="presto")) def list_git(self, raw=False): git = self.client.request('GET', '/git')['git'] if raw: return git headers = ['link', 'name', 'container', 'repository', 'commit'] data = [] for i in git: data.append([ 'git://' + i, git[i]['name'], git[i]['container'], git[i]['repository'], git[i]['commit'] if 'commit' in git[i] else 'NONE', ]) if self.isJupyter: if len(data) == 0: print('empty') return display(HTML(tabulate(data, headers, numalign='left', stralign='left', colalign=('left', 'left'), tablefmt='html').replace('<td>', '<td style="text-align:left">').replace('<th>', '<th style="text-align:left">'))) else: print(tabulate(data, headers, tablefmt="presto")) def list_maintainer(self, raw=False): maintainers = self.client.request('GET', '/maintainer')['maintainer'] if raw: return maintainers headers = ['maintainer', 'hpc', 'default_hpc', 'job_pool_capacity', 'executable_folder->from_user', 'executable_folder->must_have'] data = [] for i in maintainers: maintainer = maintainers[i] from_user = 'not specified' if 'executable_folder' in maintainer: from_user = maintainer['executable_folder']['from_user'] must_have = 'not specified' if 'executable_folder' in maintainer: if 'file_config' in maintainer['executable_folder']: if 'must_have' in maintainer['executable_folder']['file_config']: must_have = maintainer['executable_folder']['file_config']['must_have'] data.append([ i, maintainer['hpc'], maintainer['default_hpc'], maintainer['job_pool_capacity'], from_user, must_have ]) if self.isJupyter: if len(data) == 0: print('empty') return display(HTML(tabulate(data, headers, numalign='left', stralign='left', colalign=('left', 'left'), tablefmt='html').replace('<td>', '<td style="text-align:left">').replace('<th>', '<th style="text-align:left">'))) else: print(tabulate(data, headers, tablefmt="presto")) def list_info(self, list_maintainer=False, list_container=False): print('📦 Git repositories:') self.list_git() print('🖥 HPC endpoints:') self.list_hpc() if self.is_login(): print('📮 Submitted jobs:') self.list_job() if list_container: print('🗳 Containers:') self.list_container() if list_maintainer: print('🤖 Maintainers:') self.list_maintainer() def create_job_by_ui(self, defaultJob="hello_world", defaultDataFolder="./", defaultRemoteResultFolder=None): self.ui.defaultJobName = defaultJob self.ui.defaultDataFolder = defaultDataFolder if defaultRemoteResultFolder is not None: self.ui.defaultRemoteResultFolder = defaultRemoteResultFolder if defaultRemoteResultFolder[0] == '/' else '/' + defaultRemoteResultFolder self.ui.render() def get_latest_created_job(self): return self.job def enable_jupyter(self): self.isJupyter = True url = os.getenv('JUPYTER_INSTANCE_URL') if url is not None: CyberGISCompute.jupyterhubHost = url.replace('https://', '').replace('http://', '') else: display(Javascript('IPython.notebook.kernel.execute(`CyberGISCompute.jupyterhubHost = "${window.location.host}"`);')) def get_user_jupyter_globus(self): return self.client.request('GET', '/user/jupyter-globus', {"jupyterhubApiToken": self.jupyterhubApiToken}) def is_login(self): return self.jupyterhubApiToken is not None
true
true
f7263dc3cc4e9a52a26c9b3cc1c629cd0270750c
5,184
py
Python
cvat/apps/dataset_manager/tests/test_annotation.py
TOsmanov/cvat
71f94afd769d84c3fb3e3c720e26d927a47bb27b
[ "Intel", "MIT" ]
1
2019-12-09T13:53:36.000Z
2019-12-09T13:53:36.000Z
cvat/apps/dataset_manager/tests/test_annotation.py
TOsmanov/cvat
71f94afd769d84c3fb3e3c720e26d927a47bb27b
[ "Intel", "MIT" ]
null
null
null
cvat/apps/dataset_manager/tests/test_annotation.py
TOsmanov/cvat
71f94afd769d84c3fb3e3c720e26d927a47bb27b
[ "Intel", "MIT" ]
null
null
null
# Copyright (C) 2020 Intel Corporation # # SPDX-License-Identifier: MIT from cvat.apps.dataset_manager.annotation import TrackManager from unittest import TestCase class TrackManagerTest(TestCase): def _check_interpolation(self, track): interpolated = TrackManager.get_interpolated_shapes(track, 0, 7) self.assertEqual(len(interpolated), 6) self.assertTrue(interpolated[0]["keyframe"]) self.assertFalse(interpolated[1]["keyframe"]) self.assertTrue(interpolated[2]["keyframe"]) self.assertTrue(interpolated[3]["keyframe"]) self.assertFalse(interpolated[4]["keyframe"]) self.assertFalse(interpolated[5]["keyframe"]) def test_point_interpolation(self): track = { "frame": 0, "label_id": 0, "group": None, "source": "manual", "attributes": [], "shapes": [ { "frame": 0, "points": [1.0, 2.0], "type": "points", "occluded": False, "outside": False, "attributes": [] }, { "frame": 2, "attributes": [], "points": [3.0, 4.0, 5.0, 6.0], "type": "points", "occluded": False, "outside": True }, { "frame": 4, "attributes": [], "points": [3.0, 4.0, 5.0, 6.0], "type": "points", "occluded": False, "outside": False }, ] } self._check_interpolation(track) def test_polygon_interpolation(self): track = { "frame": 0, "label_id": 0, "group": None, "attributes": [], "source": "manual", "shapes": [ { "frame": 0, "points": [1.0, 2.0, 3.0, 4.0, 5.0, 2.0], "type": "polygon", "occluded": False, "outside": False, "attributes": [] }, { "frame": 2, "attributes": [], "points": [3.0, 4.0, 5.0, 6.0, 7.0, 6.0, 4.0, 5.0], "type": "polygon", "occluded": False, "outside": True }, { "frame": 4, "attributes": [], "points": [3.0, 4.0, 5.0, 6.0, 7.0, 6.0, 4.0, 5.0], "type": "polygon", "occluded": False, "outside": False }, ] } self._check_interpolation(track) def test_bbox_interpolation(self): track = { "frame": 0, "label_id": 0, "group": None, "attributes": [], "source": "manual", "shapes": [ { "frame": 0, "points": [1.0, 2.0, 3.0, 4.0], "type": "rectangle", "occluded": False, "outside": False, "attributes": [] }, { "frame": 2, "attributes": [], "points": [3.0, 4.0, 5.0, 6.0], "type": "rectangle", "occluded": False, "outside": True }, { "frame": 4, "attributes": [], "points": [3.0, 4.0, 5.0, 6.0], "type": "rectangle", "occluded": False, "outside": False }, ] } self._check_interpolation(track) def test_line_interpolation(self): track = { "frame": 0, "label_id": 0, "group": None, "attributes": [], "source": "manual", "shapes": [ { "frame": 0, "points": [1.0, 2.0, 3.0, 4.0, 5.0, 6.0], "type": "polyline", "occluded": False, "outside": False, "attributes": [] }, { "frame": 2, "attributes": [], "points": [3.0, 4.0, 5.0, 6.0], "type": "polyline", "occluded": False, "outside": True }, { "frame": 4, "attributes": [], "points": [3.0, 4.0, 5.0, 6.0], "type": "polyline", "occluded": False, "outside": False }, ] } self._check_interpolation(track)
30.494118
72
0.342593
from cvat.apps.dataset_manager.annotation import TrackManager from unittest import TestCase class TrackManagerTest(TestCase): def _check_interpolation(self, track): interpolated = TrackManager.get_interpolated_shapes(track, 0, 7) self.assertEqual(len(interpolated), 6) self.assertTrue(interpolated[0]["keyframe"]) self.assertFalse(interpolated[1]["keyframe"]) self.assertTrue(interpolated[2]["keyframe"]) self.assertTrue(interpolated[3]["keyframe"]) self.assertFalse(interpolated[4]["keyframe"]) self.assertFalse(interpolated[5]["keyframe"]) def test_point_interpolation(self): track = { "frame": 0, "label_id": 0, "group": None, "source": "manual", "attributes": [], "shapes": [ { "frame": 0, "points": [1.0, 2.0], "type": "points", "occluded": False, "outside": False, "attributes": [] }, { "frame": 2, "attributes": [], "points": [3.0, 4.0, 5.0, 6.0], "type": "points", "occluded": False, "outside": True }, { "frame": 4, "attributes": [], "points": [3.0, 4.0, 5.0, 6.0], "type": "points", "occluded": False, "outside": False }, ] } self._check_interpolation(track) def test_polygon_interpolation(self): track = { "frame": 0, "label_id": 0, "group": None, "attributes": [], "source": "manual", "shapes": [ { "frame": 0, "points": [1.0, 2.0, 3.0, 4.0, 5.0, 2.0], "type": "polygon", "occluded": False, "outside": False, "attributes": [] }, { "frame": 2, "attributes": [], "points": [3.0, 4.0, 5.0, 6.0, 7.0, 6.0, 4.0, 5.0], "type": "polygon", "occluded": False, "outside": True }, { "frame": 4, "attributes": [], "points": [3.0, 4.0, 5.0, 6.0, 7.0, 6.0, 4.0, 5.0], "type": "polygon", "occluded": False, "outside": False }, ] } self._check_interpolation(track) def test_bbox_interpolation(self): track = { "frame": 0, "label_id": 0, "group": None, "attributes": [], "source": "manual", "shapes": [ { "frame": 0, "points": [1.0, 2.0, 3.0, 4.0], "type": "rectangle", "occluded": False, "outside": False, "attributes": [] }, { "frame": 2, "attributes": [], "points": [3.0, 4.0, 5.0, 6.0], "type": "rectangle", "occluded": False, "outside": True }, { "frame": 4, "attributes": [], "points": [3.0, 4.0, 5.0, 6.0], "type": "rectangle", "occluded": False, "outside": False }, ] } self._check_interpolation(track) def test_line_interpolation(self): track = { "frame": 0, "label_id": 0, "group": None, "attributes": [], "source": "manual", "shapes": [ { "frame": 0, "points": [1.0, 2.0, 3.0, 4.0, 5.0, 6.0], "type": "polyline", "occluded": False, "outside": False, "attributes": [] }, { "frame": 2, "attributes": [], "points": [3.0, 4.0, 5.0, 6.0], "type": "polyline", "occluded": False, "outside": True }, { "frame": 4, "attributes": [], "points": [3.0, 4.0, 5.0, 6.0], "type": "polyline", "occluded": False, "outside": False }, ] } self._check_interpolation(track)
true
true
f7263deac95f43b73909d3038f4d4488fa2639d4
997
py
Python
Part-03-Understanding-Software-Crafting-Your-Own-Tools/models/edx-platform/lms/djangoapps/bulk_email/migrations/0006_course_mode_targets.py
osoco/better-ways-of-thinking-about-software
83e70d23c873509e22362a09a10d3510e10f6992
[ "MIT" ]
3
2021-12-15T04:58:18.000Z
2022-02-06T12:15:37.000Z
Part-03-Understanding-Software-Crafting-Your-Own-Tools/models/edx-platform/lms/djangoapps/bulk_email/migrations/0006_course_mode_targets.py
osoco/better-ways-of-thinking-about-software
83e70d23c873509e22362a09a10d3510e10f6992
[ "MIT" ]
null
null
null
Part-03-Understanding-Software-Crafting-Your-Own-Tools/models/edx-platform/lms/djangoapps/bulk_email/migrations/0006_course_mode_targets.py
osoco/better-ways-of-thinking-about-software
83e70d23c873509e22362a09a10d3510e10f6992
[ "MIT" ]
1
2019-01-02T14:38:50.000Z
2019-01-02T14:38:50.000Z
from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('course_modes', '0007_coursemode_bulk_sku'), ('bulk_email', '0005_move_target_data'), ] operations = [ migrations.CreateModel( name='CourseModeTarget', fields=[ ('target_ptr', models.OneToOneField(parent_link=True, auto_created=True, primary_key=True, serialize=False, to='bulk_email.Target', on_delete=models.CASCADE)), ('track', models.ForeignKey(to='course_modes.CourseMode', on_delete=models.CASCADE)), ], bases=('bulk_email.target',), ), migrations.AlterField( model_name='target', name='target_type', field=models.CharField(max_length=64, choices=[('myself', 'Myself'), ('staff', 'Staff and instructors'), ('learners', 'All students'), ('cohort', 'Specific cohort'), ('track', 'Specific course mode')]), ), ]
38.346154
214
0.609829
from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('course_modes', '0007_coursemode_bulk_sku'), ('bulk_email', '0005_move_target_data'), ] operations = [ migrations.CreateModel( name='CourseModeTarget', fields=[ ('target_ptr', models.OneToOneField(parent_link=True, auto_created=True, primary_key=True, serialize=False, to='bulk_email.Target', on_delete=models.CASCADE)), ('track', models.ForeignKey(to='course_modes.CourseMode', on_delete=models.CASCADE)), ], bases=('bulk_email.target',), ), migrations.AlterField( model_name='target', name='target_type', field=models.CharField(max_length=64, choices=[('myself', 'Myself'), ('staff', 'Staff and instructors'), ('learners', 'All students'), ('cohort', 'Specific cohort'), ('track', 'Specific course mode')]), ), ]
true
true
f7263e61252a6c08d784082742fd67b173531d8d
195
py
Python
examples/PythonToDo/models/domain_objects/UserModel.py
PqES/ArchPython
142b02f2c7fff9a3fb375a338af2de2e688f4004
[ "MIT" ]
6
2020-07-13T23:41:49.000Z
2022-02-01T21:02:46.000Z
examples/PythonToDo/models/domain_objects/UserModel.py
LimaEduardo/ArchPython
5a81d0c79d7933f06c26175b1958d604b4c248df
[ "MIT" ]
null
null
null
examples/PythonToDo/models/domain_objects/UserModel.py
LimaEduardo/ArchPython
5a81d0c79d7933f06c26175b1958d604b4c248df
[ "MIT" ]
1
2020-09-07T13:04:25.000Z
2020-09-07T13:04:25.000Z
class UserModel: def __init__(self, name = None, login = None, password = None): self.id = None self.name = name self.login = login self.password = password
21.666667
67
0.584615
class UserModel: def __init__(self, name = None, login = None, password = None): self.id = None self.name = name self.login = login self.password = password
true
true
f7263f6c62c388fe49d7af215f78c0b7c0576dd0
191
py
Python
chatbot_tutorial/urls.py
abdulmuizzf/django-bot-server-tutorial
3f9d69bb848ed70e664503aac2c968416b7a891d
[ "MIT" ]
null
null
null
chatbot_tutorial/urls.py
abdulmuizzf/django-bot-server-tutorial
3f9d69bb848ed70e664503aac2c968416b7a891d
[ "MIT" ]
null
null
null
chatbot_tutorial/urls.py
abdulmuizzf/django-bot-server-tutorial
3f9d69bb848ed70e664503aac2c968416b7a891d
[ "MIT" ]
null
null
null
from django.conf.urls import include from django.urls import path from django.contrib import admin urlpatterns = [ path('', include('chat.urls')), path('admin/', admin.site.urls), ]
21.222222
36
0.706806
from django.conf.urls import include from django.urls import path from django.contrib import admin urlpatterns = [ path('', include('chat.urls')), path('admin/', admin.site.urls), ]
true
true
f7263fda03fe7c55336dc033a79f684a23583ecb
3,647
py
Python
circular_cylinder/figures/plot.py
J-Massey/postproc
4552b0ad79072f5d217cf62632c08617ea3d2d82
[ "MIT" ]
null
null
null
circular_cylinder/figures/plot.py
J-Massey/postproc
4552b0ad79072f5d217cf62632c08617ea3d2d82
[ "MIT" ]
null
null
null
circular_cylinder/figures/plot.py
J-Massey/postproc
4552b0ad79072f5d217cf62632c08617ea3d2d82
[ "MIT" ]
null
null
null
import matplotlib.pyplot as plt import seaborn as sns import numpy as np from itertools import product import os from mpl_toolkits.axes_grid1 import make_axes_locatable from matplotlib import ticker, cm from mpl_toolkits.axes_grid1 import make_axes_locatable from matplotlib.ticker import FormatStrFormatter from matplotlib.colors import LinearSegmentedColormap from matplotlib.colors import BoundaryNorm colors = sns.color_palette("husl", 4) plt.style.use(['science', 'grid']) def plot_loss(epochs, cost, fn='cost.pdf'): fig, ax = plt.subplots(figsize=(5, 3)) ax.tick_params(bottom="on", top="on", right="on", which='both', direction='in', length=2) ax.set_xlabel(r"Epochs") ax.set_ylabel(r'$L_2$ loss') ax.plot_fill(np.linspace(0, epochs, len(cost)), cost, label=r'$L_{2}$') ax.legend() plt.savefig(fn) plt.show() def plot_model(cd_hat, fos, Y, fn='model.pdf'): fig, ax = plt.subplots(figsize=(5, 3)) ax.tick_params(bottom="on", top="on", right="on", which='both', direction='in', length=2) ax.set_xlabel(r"$t/D$") ax.set_ylabel(r'$C_{D_f}$') ax.plot_fill(fos['t'], Y, label=r'Ground truth') ax.plot_fill(fos['t'], cd_hat, label=r'$\hat{C_{D_f}}$') ax.legend() plt.savefig(fn) plt.show() def plot_BL_corruption(): fig, ax = plt.subplots(figsize=(5, 5)) ax.set_xlabel(r'$x_n$') ax.set_ylabel(r'$y_n$', rotation=0) # Define grid D = 32 eps = 2 r = D / 2 x, y = np.arange(-D, D + 1, 1), np.arange(-D, D + 1, 1) X, Y = np.meshgrid(x, y) # Body coordinates theta = np.linspace(0, 2 * np.pi, int(D * np.pi)) Bx, By = r * np.cos(theta), r * np.sin(theta) ax.plot_fill(Bx, By, color='k', linewidth=2., label=r'Hard body boundary') Bepx, Bepy = (r + eps) * np.cos(theta), (r + eps) * np.sin(theta) ax.plot_fill(Bepx, Bepy, c='blue', linewidth=0.5, label=r'$D+\epsilon$') # Distance function from eps away from body edge dis = np.sqrt(X ** 2 + Y ** 2) # Cmap definition bs = iter((np.array([14, 15.8, 18.7, 22]) - 4.5) / D) colours = [(0, 'midnightblue'), (next(bs), 'midnightblue'), (next(bs), 'red'), (next(bs), 'green'), (next(bs), 'royalblue'), (1, 'royalblue')] cmap = LinearSegmentedColormap.from_list('corruption', colours, 256) cs = ax.imshow(dis, zorder=0, aspect="auto", extent=(-D, D, -D, D), cmap=cmap, interpolation='bicubic') make_axes_locatable(ax) divider = make_axes_locatable(ax) ax_cb = divider.new_horizontal(size="5%", pad=0.05) fig.add_axes(ax_cb) cbar = plt.colorbar(cs, cax=ax_cb, ticks=[8, 16.4, 21, 32], extend='max') # ax_cb.yaxis.tick_right() cbar.ax.set_yticklabels([r'$\vec{b}$', r'$\vec{b}*\vec{f}$', r'$d|_{n \approx 0}$', r'$\vec{f}$']) cbar.ax.tick_params(which='both', size=0) ax.legend() plt.savefig('../figures/bl_corruption.pdf', dpi=300) plt.close() def plot_pressure(): data_root = '/home/masseyjmo/Workspace/Lotus/projects/cylinder_dns/validation' p = np.loadtxt(os.path.join(data_root, 'fort.10'), unpack=True) p = np.mean(p, axis=1) fig, ax = plt.subplots(figsize=(4, 4)) ax.tick_params(bottom="on", top="on", right="on", which='both', direction='in', length=2) ax.set_xlabel(r"$\theta$") ax.set_ylabel(r'$C_{p}$') ax.scatter(np.linspace(0, np.pi / 2, len(p)), p * 2, label=r'Pressure distribution', color='k', marker='+') ax.set_ylim(-2, 1) ax.legend() plt.savefig('pressure_theta.pdf') plt.show() if __name__ == "__main__": plot_BL_corruption()
34.084112
111
0.619139
import matplotlib.pyplot as plt import seaborn as sns import numpy as np from itertools import product import os from mpl_toolkits.axes_grid1 import make_axes_locatable from matplotlib import ticker, cm from mpl_toolkits.axes_grid1 import make_axes_locatable from matplotlib.ticker import FormatStrFormatter from matplotlib.colors import LinearSegmentedColormap from matplotlib.colors import BoundaryNorm colors = sns.color_palette("husl", 4) plt.style.use(['science', 'grid']) def plot_loss(epochs, cost, fn='cost.pdf'): fig, ax = plt.subplots(figsize=(5, 3)) ax.tick_params(bottom="on", top="on", right="on", which='both', direction='in', length=2) ax.set_xlabel(r"Epochs") ax.set_ylabel(r'$L_2$ loss') ax.plot_fill(np.linspace(0, epochs, len(cost)), cost, label=r'$L_{2}$') ax.legend() plt.savefig(fn) plt.show() def plot_model(cd_hat, fos, Y, fn='model.pdf'): fig, ax = plt.subplots(figsize=(5, 3)) ax.tick_params(bottom="on", top="on", right="on", which='both', direction='in', length=2) ax.set_xlabel(r"$t/D$") ax.set_ylabel(r'$C_{D_f}$') ax.plot_fill(fos['t'], Y, label=r'Ground truth') ax.plot_fill(fos['t'], cd_hat, label=r'$\hat{C_{D_f}}$') ax.legend() plt.savefig(fn) plt.show() def plot_BL_corruption(): fig, ax = plt.subplots(figsize=(5, 5)) ax.set_xlabel(r'$x_n$') ax.set_ylabel(r'$y_n$', rotation=0) D = 32 eps = 2 r = D / 2 x, y = np.arange(-D, D + 1, 1), np.arange(-D, D + 1, 1) X, Y = np.meshgrid(x, y) theta = np.linspace(0, 2 * np.pi, int(D * np.pi)) Bx, By = r * np.cos(theta), r * np.sin(theta) ax.plot_fill(Bx, By, color='k', linewidth=2., label=r'Hard body boundary') Bepx, Bepy = (r + eps) * np.cos(theta), (r + eps) * np.sin(theta) ax.plot_fill(Bepx, Bepy, c='blue', linewidth=0.5, label=r'$D+\epsilon$') dis = np.sqrt(X ** 2 + Y ** 2) bs = iter((np.array([14, 15.8, 18.7, 22]) - 4.5) / D) colours = [(0, 'midnightblue'), (next(bs), 'midnightblue'), (next(bs), 'red'), (next(bs), 'green'), (next(bs), 'royalblue'), (1, 'royalblue')] cmap = LinearSegmentedColormap.from_list('corruption', colours, 256) cs = ax.imshow(dis, zorder=0, aspect="auto", extent=(-D, D, -D, D), cmap=cmap, interpolation='bicubic') make_axes_locatable(ax) divider = make_axes_locatable(ax) ax_cb = divider.new_horizontal(size="5%", pad=0.05) fig.add_axes(ax_cb) cbar = plt.colorbar(cs, cax=ax_cb, ticks=[8, 16.4, 21, 32], extend='max') cbar.ax.set_yticklabels([r'$\vec{b}$', r'$\vec{b}*\vec{f}$', r'$d|_{n \approx 0}$', r'$\vec{f}$']) cbar.ax.tick_params(which='both', size=0) ax.legend() plt.savefig('../figures/bl_corruption.pdf', dpi=300) plt.close() def plot_pressure(): data_root = '/home/masseyjmo/Workspace/Lotus/projects/cylinder_dns/validation' p = np.loadtxt(os.path.join(data_root, 'fort.10'), unpack=True) p = np.mean(p, axis=1) fig, ax = plt.subplots(figsize=(4, 4)) ax.tick_params(bottom="on", top="on", right="on", which='both', direction='in', length=2) ax.set_xlabel(r"$\theta$") ax.set_ylabel(r'$C_{p}$') ax.scatter(np.linspace(0, np.pi / 2, len(p)), p * 2, label=r'Pressure distribution', color='k', marker='+') ax.set_ylim(-2, 1) ax.legend() plt.savefig('pressure_theta.pdf') plt.show() if __name__ == "__main__": plot_BL_corruption()
true
true
f7263ff6a3d742c589e550267ff561f470351035
36,853
py
Python
python/istio_api/mesh/v1alpha1/config_pb2.py
selmanj/api
6166b45d34e2ef8915225b2f849855b5d28fc4f9
[ "Apache-2.0" ]
null
null
null
python/istio_api/mesh/v1alpha1/config_pb2.py
selmanj/api
6166b45d34e2ef8915225b2f849855b5d28fc4f9
[ "Apache-2.0" ]
null
null
null
python/istio_api/mesh/v1alpha1/config_pb2.py
selmanj/api
6166b45d34e2ef8915225b2f849855b5d28fc4f9
[ "Apache-2.0" ]
null
null
null
# -*- coding: utf-8 -*- # Generated by the protocol buffer compiler. DO NOT EDIT! # source: mesh/v1alpha1/config.proto import sys _b=sys.version_info[0]<3 and (lambda x:x) or (lambda x:x.encode('latin1')) from google.protobuf.internal import enum_type_wrapper from google.protobuf import descriptor as _descriptor from google.protobuf import message as _message from google.protobuf import reflection as _reflection from google.protobuf import symbol_database as _symbol_database # @@protoc_insertion_point(imports) _sym_db = _symbol_database.Default() from google.protobuf import duration_pb2 as google_dot_protobuf_dot_duration__pb2 from google.protobuf import wrappers_pb2 as google_dot_protobuf_dot_wrappers__pb2 from mesh.v1alpha1 import proxy_pb2 as mesh_dot_v1alpha1_dot_proxy__pb2 from networking.v1alpha3 import destination_rule_pb2 as networking_dot_v1alpha3_dot_destination__rule__pb2 DESCRIPTOR = _descriptor.FileDescriptor( name='mesh/v1alpha1/config.proto', package='istio.mesh.v1alpha1', syntax='proto3', serialized_options=_b('Z\032istio.io/api/mesh/v1alpha1'), serialized_pb=_b('\n\x1amesh/v1alpha1/config.proto\x12\x13istio.mesh.v1alpha1\x1a\x1egoogle/protobuf/duration.proto\x1a\x1egoogle/protobuf/wrappers.proto\x1a\x19mesh/v1alpha1/proxy.proto\x1a*networking/v1alpha3/destination_rule.proto\"\x8f\x13\n\nMeshConfig\x12\x1a\n\x12mixer_check_server\x18\x01 \x01(\t\x12\x1b\n\x13mixer_report_server\x18\x02 \x01(\t\x12\x1d\n\x15\x64isable_policy_checks\x18\x03 \x01(\x08\x12\"\n\x1a\x64isable_mixer_http_reports\x18\x30 \x01(\x08\x12\x1e\n\x16policy_check_fail_open\x18\x19 \x01(\x08\x12-\n%sidecar_to_telemetry_session_affinity\x18\x1e \x01(\x08\x12\x19\n\x11proxy_listen_port\x18\x04 \x01(\x05\x12\x17\n\x0fproxy_http_port\x18\x05 \x01(\x05\x12\x32\n\x0f\x63onnect_timeout\x18\x06 \x01(\x0b\x32\x19.google.protobuf.Duration\x12=\n\x1aprotocol_detection_timeout\x18* \x01(\x0b\x32\x19.google.protobuf.Duration\x12\x61\n\rtcp_keepalive\x18\x1c \x01(\x0b\x32J.istio.networking.v1alpha3.ConnectionPoolSettings.TCPSettings.TcpKeepalive\x12\x15\n\ringress_class\x18\x07 \x01(\t\x12\x17\n\x0fingress_service\x18\x08 \x01(\t\x12V\n\x17ingress_controller_mode\x18\t \x01(\x0e\x32\x35.istio.mesh.v1alpha1.MeshConfig.IngressControllerMode\x12\x43\n\x0b\x61uth_policy\x18\n \x01(\x0e\x32*.istio.mesh.v1alpha1.MeshConfig.AuthPolicyB\x02\x18\x01\x12\x38\n\x11rds_refresh_delay\x18\x0b \x01(\x0b\x32\x19.google.protobuf.DurationB\x02\x18\x01\x12\x16\n\x0e\x65nable_tracing\x18\x0c \x01(\x08\x12\x17\n\x0f\x61\x63\x63\x65ss_log_file\x18\r \x01(\t\x12\x19\n\x11\x61\x63\x63\x65ss_log_format\x18\x18 \x01(\t\x12N\n\x13\x61\x63\x63\x65ss_log_encoding\x18\x1b \x01(\x0e\x32\x31.istio.mesh.v1alpha1.MeshConfig.AccessLogEncoding\x12\'\n\x1f\x65nable_envoy_access_log_service\x18( \x01(\x08\x12\x38\n\x0e\x64\x65\x66\x61ult_config\x18\x0e \x01(\x0b\x32 .istio.mesh.v1alpha1.ProxyConfig\x12\x19\n\rmixer_address\x18\x10 \x01(\tB\x02\x18\x01\x12V\n\x17outbound_traffic_policy\x18\x11 \x01(\x0b\x32\x35.istio.mesh.v1alpha1.MeshConfig.OutboundTrafficPolicy\x12\'\n\x1f\x65nable_client_side_policy_check\x18\x13 \x01(\x08\x12\x18\n\x0csds_uds_path\x18\x14 \x01(\tB\x02\x18\x01\x12\x38\n\x11sds_refresh_delay\x18\x15 \x01(\x0b\x32\x19.google.protobuf.DurationB\x02\x18\x01\x12\x39\n\x0e\x63onfig_sources\x18\x16 \x03(\x0b\x32!.istio.mesh.v1alpha1.ConfigSource\x12\x34\n\x10\x65nable_auto_mtls\x18+ \x01(\x0b\x32\x1a.google.protobuf.BoolValue\x12\x1e\n\x16\x65nable_sds_token_mount\x18\x17 \x01(\x08\x12\x1a\n\x12sds_use_k8s_sa_jwt\x18\x1d \x01(\x08\x12\x14\n\x0ctrust_domain\x18\x1a \x01(\t\x12\x1c\n\x14trust_domain_aliases\x18. \x03(\t\x12!\n\x19\x64\x65\x66\x61ult_service_export_to\x18\x1f \x03(\t\x12)\n!default_virtual_service_export_to\x18 \x03(\t\x12*\n\"default_destination_rule_export_to\x18! \x03(\t\x12\x16\n\x0eroot_namespace\x18\" \x01(\t\x12S\n\x13locality_lb_setting\x18# \x01(\x0b\x32\x36.istio.networking.v1alpha3.LocalityLoadBalancerSetting\x12\x33\n\x10\x64ns_refresh_rate\x18$ \x01(\x0b\x32\x19.google.protobuf.Duration\x12\x1c\n\x14\x64isable_report_batch\x18% \x01(\x08\x12 \n\x18report_batch_max_entries\x18& \x01(\r\x12\x38\n\x15report_batch_max_time\x18\' \x01(\x0b\x32\x19.google.protobuf.Duration\x12J\n\x11h2_upgrade_policy\x18) \x01(\x0e\x32/.istio.mesh.v1alpha1.MeshConfig.H2UpgradePolicy\x12!\n\x19inbound_cluster_stat_name\x18, \x01(\t\x12\"\n\x1aoutbound_cluster_stat_name\x18- \x01(\t\x12\x36\n\x0c\x63\x65rtificates\x18/ \x03(\x0b\x32 .istio.mesh.v1alpha1.Certificate\x1a\xa7\x01\n\x15OutboundTrafficPolicy\x12H\n\x04mode\x18\x01 \x01(\x0e\x32:.istio.mesh.v1alpha1.MeshConfig.OutboundTrafficPolicy.Mode\"D\n\x04Mode\x12\x11\n\rREGISTRY_ONLY\x10\x00\x12\r\n\tALLOW_ANY\x10\x01\"\x04\x08\x02\x10\x02*\x14VIRTUAL_SERVICE_ONLY\"9\n\x15IngressControllerMode\x12\x07\n\x03OFF\x10\x00\x12\x0b\n\x07\x44\x45\x46\x41ULT\x10\x01\x12\n\n\x06STRICT\x10\x02\"&\n\nAuthPolicy\x12\x08\n\x04NONE\x10\x00\x12\x0e\n\nMUTUAL_TLS\x10\x01\"\'\n\x11\x41\x63\x63\x65ssLogEncoding\x12\x08\n\x04TEXT\x10\x00\x12\x08\n\x04JSON\x10\x01\"2\n\x0fH2UpgradePolicy\x12\x12\n\x0e\x44O_NOT_UPGRADE\x10\x00\x12\x0b\n\x07UPGRADE\x10\x01J\x04\x08\x0f\x10\x10J\x04\x08\x12\x10\x13\"\x9a\x01\n\x0c\x43onfigSource\x12\x0f\n\x07\x61\x64\x64ress\x18\x01 \x01(\t\x12<\n\x0ctls_settings\x18\x02 \x01(\x0b\x32&.istio.networking.v1alpha3.TLSSettings\x12;\n\x14subscribed_resources\x18\x03 \x03(\x0e\x32\x1d.istio.mesh.v1alpha1.Resource\"5\n\x0b\x43\x65rtificate\x12\x13\n\x0bsecret_name\x18\x01 \x01(\t\x12\x11\n\tdns_names\x18\x02 \x03(\t* \n\x08Resource\x12\x14\n\x10SERVICE_REGISTRY\x10\x00\x42\x1cZ\x1aistio.io/api/mesh/v1alpha1b\x06proto3') , dependencies=[google_dot_protobuf_dot_duration__pb2.DESCRIPTOR,google_dot_protobuf_dot_wrappers__pb2.DESCRIPTOR,mesh_dot_v1alpha1_dot_proxy__pb2.DESCRIPTOR,networking_dot_v1alpha3_dot_destination__rule__pb2.DESCRIPTOR,]) _RESOURCE = _descriptor.EnumDescriptor( name='Resource', full_name='istio.mesh.v1alpha1.Resource', filename=None, file=DESCRIPTOR, values=[ _descriptor.EnumValueDescriptor( name='SERVICE_REGISTRY', index=0, number=0, serialized_options=None, type=None), ], containing_type=None, serialized_options=None, serialized_start=2848, serialized_end=2880, ) _sym_db.RegisterEnumDescriptor(_RESOURCE) Resource = enum_type_wrapper.EnumTypeWrapper(_RESOURCE) SERVICE_REGISTRY = 0 _MESHCONFIG_OUTBOUNDTRAFFICPOLICY_MODE = _descriptor.EnumDescriptor( name='Mode', full_name='istio.mesh.v1alpha1.MeshConfig.OutboundTrafficPolicy.Mode', filename=None, file=DESCRIPTOR, values=[ _descriptor.EnumValueDescriptor( name='REGISTRY_ONLY', index=0, number=0, serialized_options=None, type=None), _descriptor.EnumValueDescriptor( name='ALLOW_ANY', index=1, number=1, serialized_options=None, type=None), ], containing_type=None, serialized_options=None, serialized_start=2362, serialized_end=2430, ) _sym_db.RegisterEnumDescriptor(_MESHCONFIG_OUTBOUNDTRAFFICPOLICY_MODE) _MESHCONFIG_INGRESSCONTROLLERMODE = _descriptor.EnumDescriptor( name='IngressControllerMode', full_name='istio.mesh.v1alpha1.MeshConfig.IngressControllerMode', filename=None, file=DESCRIPTOR, values=[ _descriptor.EnumValueDescriptor( name='OFF', index=0, number=0, serialized_options=None, type=None), _descriptor.EnumValueDescriptor( name='DEFAULT', index=1, number=1, serialized_options=None, type=None), _descriptor.EnumValueDescriptor( name='STRICT', index=2, number=2, serialized_options=None, type=None), ], containing_type=None, serialized_options=None, serialized_start=2432, serialized_end=2489, ) _sym_db.RegisterEnumDescriptor(_MESHCONFIG_INGRESSCONTROLLERMODE) _MESHCONFIG_AUTHPOLICY = _descriptor.EnumDescriptor( name='AuthPolicy', full_name='istio.mesh.v1alpha1.MeshConfig.AuthPolicy', filename=None, file=DESCRIPTOR, values=[ _descriptor.EnumValueDescriptor( name='NONE', index=0, number=0, serialized_options=None, type=None), _descriptor.EnumValueDescriptor( name='MUTUAL_TLS', index=1, number=1, serialized_options=None, type=None), ], containing_type=None, serialized_options=None, serialized_start=2491, serialized_end=2529, ) _sym_db.RegisterEnumDescriptor(_MESHCONFIG_AUTHPOLICY) _MESHCONFIG_ACCESSLOGENCODING = _descriptor.EnumDescriptor( name='AccessLogEncoding', full_name='istio.mesh.v1alpha1.MeshConfig.AccessLogEncoding', filename=None, file=DESCRIPTOR, values=[ _descriptor.EnumValueDescriptor( name='TEXT', index=0, number=0, serialized_options=None, type=None), _descriptor.EnumValueDescriptor( name='JSON', index=1, number=1, serialized_options=None, type=None), ], containing_type=None, serialized_options=None, serialized_start=2531, serialized_end=2570, ) _sym_db.RegisterEnumDescriptor(_MESHCONFIG_ACCESSLOGENCODING) _MESHCONFIG_H2UPGRADEPOLICY = _descriptor.EnumDescriptor( name='H2UpgradePolicy', full_name='istio.mesh.v1alpha1.MeshConfig.H2UpgradePolicy', filename=None, file=DESCRIPTOR, values=[ _descriptor.EnumValueDescriptor( name='DO_NOT_UPGRADE', index=0, number=0, serialized_options=None, type=None), _descriptor.EnumValueDescriptor( name='UPGRADE', index=1, number=1, serialized_options=None, type=None), ], containing_type=None, serialized_options=None, serialized_start=2572, serialized_end=2622, ) _sym_db.RegisterEnumDescriptor(_MESHCONFIG_H2UPGRADEPOLICY) _MESHCONFIG_OUTBOUNDTRAFFICPOLICY = _descriptor.Descriptor( name='OutboundTrafficPolicy', full_name='istio.mesh.v1alpha1.MeshConfig.OutboundTrafficPolicy', filename=None, file=DESCRIPTOR, containing_type=None, fields=[ _descriptor.FieldDescriptor( name='mode', full_name='istio.mesh.v1alpha1.MeshConfig.OutboundTrafficPolicy.mode', index=0, number=1, type=14, cpp_type=8, label=1, has_default_value=False, default_value=0, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), ], extensions=[ ], nested_types=[], enum_types=[ _MESHCONFIG_OUTBOUNDTRAFFICPOLICY_MODE, ], serialized_options=None, is_extendable=False, syntax='proto3', extension_ranges=[], oneofs=[ ], serialized_start=2263, serialized_end=2430, ) _MESHCONFIG = _descriptor.Descriptor( name='MeshConfig', full_name='istio.mesh.v1alpha1.MeshConfig', filename=None, file=DESCRIPTOR, containing_type=None, fields=[ _descriptor.FieldDescriptor( name='mixer_check_server', full_name='istio.mesh.v1alpha1.MeshConfig.mixer_check_server', index=0, number=1, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='mixer_report_server', full_name='istio.mesh.v1alpha1.MeshConfig.mixer_report_server', index=1, number=2, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='disable_policy_checks', full_name='istio.mesh.v1alpha1.MeshConfig.disable_policy_checks', index=2, number=3, type=8, cpp_type=7, label=1, has_default_value=False, default_value=False, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='disable_mixer_http_reports', full_name='istio.mesh.v1alpha1.MeshConfig.disable_mixer_http_reports', index=3, number=48, type=8, cpp_type=7, label=1, has_default_value=False, default_value=False, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='policy_check_fail_open', full_name='istio.mesh.v1alpha1.MeshConfig.policy_check_fail_open', index=4, number=25, type=8, cpp_type=7, label=1, has_default_value=False, default_value=False, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='sidecar_to_telemetry_session_affinity', full_name='istio.mesh.v1alpha1.MeshConfig.sidecar_to_telemetry_session_affinity', index=5, number=30, type=8, cpp_type=7, label=1, has_default_value=False, default_value=False, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='proxy_listen_port', full_name='istio.mesh.v1alpha1.MeshConfig.proxy_listen_port', index=6, number=4, type=5, cpp_type=1, label=1, has_default_value=False, default_value=0, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='proxy_http_port', full_name='istio.mesh.v1alpha1.MeshConfig.proxy_http_port', index=7, number=5, type=5, cpp_type=1, label=1, has_default_value=False, default_value=0, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='connect_timeout', full_name='istio.mesh.v1alpha1.MeshConfig.connect_timeout', index=8, number=6, type=11, cpp_type=10, label=1, has_default_value=False, default_value=None, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='protocol_detection_timeout', full_name='istio.mesh.v1alpha1.MeshConfig.protocol_detection_timeout', index=9, number=42, type=11, cpp_type=10, label=1, has_default_value=False, default_value=None, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='tcp_keepalive', full_name='istio.mesh.v1alpha1.MeshConfig.tcp_keepalive', index=10, number=28, type=11, cpp_type=10, label=1, has_default_value=False, default_value=None, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='ingress_class', full_name='istio.mesh.v1alpha1.MeshConfig.ingress_class', index=11, number=7, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='ingress_service', full_name='istio.mesh.v1alpha1.MeshConfig.ingress_service', index=12, number=8, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='ingress_controller_mode', full_name='istio.mesh.v1alpha1.MeshConfig.ingress_controller_mode', index=13, number=9, type=14, cpp_type=8, label=1, has_default_value=False, default_value=0, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='auth_policy', full_name='istio.mesh.v1alpha1.MeshConfig.auth_policy', index=14, number=10, type=14, cpp_type=8, label=1, has_default_value=False, default_value=0, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=_b('\030\001'), file=DESCRIPTOR), _descriptor.FieldDescriptor( name='rds_refresh_delay', full_name='istio.mesh.v1alpha1.MeshConfig.rds_refresh_delay', index=15, number=11, type=11, cpp_type=10, label=1, has_default_value=False, default_value=None, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=_b('\030\001'), file=DESCRIPTOR), _descriptor.FieldDescriptor( name='enable_tracing', full_name='istio.mesh.v1alpha1.MeshConfig.enable_tracing', index=16, number=12, type=8, cpp_type=7, label=1, has_default_value=False, default_value=False, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='access_log_file', full_name='istio.mesh.v1alpha1.MeshConfig.access_log_file', index=17, number=13, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='access_log_format', full_name='istio.mesh.v1alpha1.MeshConfig.access_log_format', index=18, number=24, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='access_log_encoding', full_name='istio.mesh.v1alpha1.MeshConfig.access_log_encoding', index=19, number=27, type=14, cpp_type=8, label=1, has_default_value=False, default_value=0, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='enable_envoy_access_log_service', full_name='istio.mesh.v1alpha1.MeshConfig.enable_envoy_access_log_service', index=20, number=40, type=8, cpp_type=7, label=1, has_default_value=False, default_value=False, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='default_config', full_name='istio.mesh.v1alpha1.MeshConfig.default_config', index=21, number=14, type=11, cpp_type=10, label=1, has_default_value=False, default_value=None, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='mixer_address', full_name='istio.mesh.v1alpha1.MeshConfig.mixer_address', index=22, number=16, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=_b('\030\001'), file=DESCRIPTOR), _descriptor.FieldDescriptor( name='outbound_traffic_policy', full_name='istio.mesh.v1alpha1.MeshConfig.outbound_traffic_policy', index=23, number=17, type=11, cpp_type=10, label=1, has_default_value=False, default_value=None, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='enable_client_side_policy_check', full_name='istio.mesh.v1alpha1.MeshConfig.enable_client_side_policy_check', index=24, number=19, type=8, cpp_type=7, label=1, has_default_value=False, default_value=False, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='sds_uds_path', full_name='istio.mesh.v1alpha1.MeshConfig.sds_uds_path', index=25, number=20, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=_b('\030\001'), file=DESCRIPTOR), _descriptor.FieldDescriptor( name='sds_refresh_delay', full_name='istio.mesh.v1alpha1.MeshConfig.sds_refresh_delay', index=26, number=21, type=11, cpp_type=10, label=1, has_default_value=False, default_value=None, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=_b('\030\001'), file=DESCRIPTOR), _descriptor.FieldDescriptor( name='config_sources', full_name='istio.mesh.v1alpha1.MeshConfig.config_sources', index=27, number=22, type=11, cpp_type=10, label=3, has_default_value=False, default_value=[], message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='enable_auto_mtls', full_name='istio.mesh.v1alpha1.MeshConfig.enable_auto_mtls', index=28, number=43, type=11, cpp_type=10, label=1, has_default_value=False, default_value=None, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='enable_sds_token_mount', full_name='istio.mesh.v1alpha1.MeshConfig.enable_sds_token_mount', index=29, number=23, type=8, cpp_type=7, label=1, has_default_value=False, default_value=False, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='sds_use_k8s_sa_jwt', full_name='istio.mesh.v1alpha1.MeshConfig.sds_use_k8s_sa_jwt', index=30, number=29, type=8, cpp_type=7, label=1, has_default_value=False, default_value=False, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='trust_domain', full_name='istio.mesh.v1alpha1.MeshConfig.trust_domain', index=31, number=26, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='trust_domain_aliases', full_name='istio.mesh.v1alpha1.MeshConfig.trust_domain_aliases', index=32, number=46, type=9, cpp_type=9, label=3, has_default_value=False, default_value=[], message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='default_service_export_to', full_name='istio.mesh.v1alpha1.MeshConfig.default_service_export_to', index=33, number=31, type=9, cpp_type=9, label=3, has_default_value=False, default_value=[], message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='default_virtual_service_export_to', full_name='istio.mesh.v1alpha1.MeshConfig.default_virtual_service_export_to', index=34, number=32, type=9, cpp_type=9, label=3, has_default_value=False, default_value=[], message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='default_destination_rule_export_to', full_name='istio.mesh.v1alpha1.MeshConfig.default_destination_rule_export_to', index=35, number=33, type=9, cpp_type=9, label=3, has_default_value=False, default_value=[], message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='root_namespace', full_name='istio.mesh.v1alpha1.MeshConfig.root_namespace', index=36, number=34, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='locality_lb_setting', full_name='istio.mesh.v1alpha1.MeshConfig.locality_lb_setting', index=37, number=35, type=11, cpp_type=10, label=1, has_default_value=False, default_value=None, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='dns_refresh_rate', full_name='istio.mesh.v1alpha1.MeshConfig.dns_refresh_rate', index=38, number=36, type=11, cpp_type=10, label=1, has_default_value=False, default_value=None, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='disable_report_batch', full_name='istio.mesh.v1alpha1.MeshConfig.disable_report_batch', index=39, number=37, type=8, cpp_type=7, label=1, has_default_value=False, default_value=False, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='report_batch_max_entries', full_name='istio.mesh.v1alpha1.MeshConfig.report_batch_max_entries', index=40, number=38, type=13, cpp_type=3, label=1, has_default_value=False, default_value=0, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='report_batch_max_time', full_name='istio.mesh.v1alpha1.MeshConfig.report_batch_max_time', index=41, number=39, type=11, cpp_type=10, label=1, has_default_value=False, default_value=None, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='h2_upgrade_policy', full_name='istio.mesh.v1alpha1.MeshConfig.h2_upgrade_policy', index=42, number=41, type=14, cpp_type=8, label=1, has_default_value=False, default_value=0, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='inbound_cluster_stat_name', full_name='istio.mesh.v1alpha1.MeshConfig.inbound_cluster_stat_name', index=43, number=44, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='outbound_cluster_stat_name', full_name='istio.mesh.v1alpha1.MeshConfig.outbound_cluster_stat_name', index=44, number=45, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='certificates', full_name='istio.mesh.v1alpha1.MeshConfig.certificates', index=45, number=47, type=11, cpp_type=10, label=3, has_default_value=False, default_value=[], message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), ], extensions=[ ], nested_types=[_MESHCONFIG_OUTBOUNDTRAFFICPOLICY, ], enum_types=[ _MESHCONFIG_INGRESSCONTROLLERMODE, _MESHCONFIG_AUTHPOLICY, _MESHCONFIG_ACCESSLOGENCODING, _MESHCONFIG_H2UPGRADEPOLICY, ], serialized_options=None, is_extendable=False, syntax='proto3', extension_ranges=[], oneofs=[ ], serialized_start=187, serialized_end=2634, ) _CONFIGSOURCE = _descriptor.Descriptor( name='ConfigSource', full_name='istio.mesh.v1alpha1.ConfigSource', filename=None, file=DESCRIPTOR, containing_type=None, fields=[ _descriptor.FieldDescriptor( name='address', full_name='istio.mesh.v1alpha1.ConfigSource.address', index=0, number=1, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='tls_settings', full_name='istio.mesh.v1alpha1.ConfigSource.tls_settings', index=1, number=2, type=11, cpp_type=10, label=1, has_default_value=False, default_value=None, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='subscribed_resources', full_name='istio.mesh.v1alpha1.ConfigSource.subscribed_resources', index=2, number=3, type=14, cpp_type=8, label=3, has_default_value=False, default_value=[], message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), ], extensions=[ ], nested_types=[], enum_types=[ ], serialized_options=None, is_extendable=False, syntax='proto3', extension_ranges=[], oneofs=[ ], serialized_start=2637, serialized_end=2791, ) _CERTIFICATE = _descriptor.Descriptor( name='Certificate', full_name='istio.mesh.v1alpha1.Certificate', filename=None, file=DESCRIPTOR, containing_type=None, fields=[ _descriptor.FieldDescriptor( name='secret_name', full_name='istio.mesh.v1alpha1.Certificate.secret_name', index=0, number=1, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='dns_names', full_name='istio.mesh.v1alpha1.Certificate.dns_names', index=1, number=2, type=9, cpp_type=9, label=3, has_default_value=False, default_value=[], message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), ], extensions=[ ], nested_types=[], enum_types=[ ], serialized_options=None, is_extendable=False, syntax='proto3', extension_ranges=[], oneofs=[ ], serialized_start=2793, serialized_end=2846, ) _MESHCONFIG_OUTBOUNDTRAFFICPOLICY.fields_by_name['mode'].enum_type = _MESHCONFIG_OUTBOUNDTRAFFICPOLICY_MODE _MESHCONFIG_OUTBOUNDTRAFFICPOLICY.containing_type = _MESHCONFIG _MESHCONFIG_OUTBOUNDTRAFFICPOLICY_MODE.containing_type = _MESHCONFIG_OUTBOUNDTRAFFICPOLICY _MESHCONFIG.fields_by_name['connect_timeout'].message_type = google_dot_protobuf_dot_duration__pb2._DURATION _MESHCONFIG.fields_by_name['protocol_detection_timeout'].message_type = google_dot_protobuf_dot_duration__pb2._DURATION _MESHCONFIG.fields_by_name['tcp_keepalive'].message_type = networking_dot_v1alpha3_dot_destination__rule__pb2._CONNECTIONPOOLSETTINGS_TCPSETTINGS_TCPKEEPALIVE _MESHCONFIG.fields_by_name['ingress_controller_mode'].enum_type = _MESHCONFIG_INGRESSCONTROLLERMODE _MESHCONFIG.fields_by_name['auth_policy'].enum_type = _MESHCONFIG_AUTHPOLICY _MESHCONFIG.fields_by_name['rds_refresh_delay'].message_type = google_dot_protobuf_dot_duration__pb2._DURATION _MESHCONFIG.fields_by_name['access_log_encoding'].enum_type = _MESHCONFIG_ACCESSLOGENCODING _MESHCONFIG.fields_by_name['default_config'].message_type = mesh_dot_v1alpha1_dot_proxy__pb2._PROXYCONFIG _MESHCONFIG.fields_by_name['outbound_traffic_policy'].message_type = _MESHCONFIG_OUTBOUNDTRAFFICPOLICY _MESHCONFIG.fields_by_name['sds_refresh_delay'].message_type = google_dot_protobuf_dot_duration__pb2._DURATION _MESHCONFIG.fields_by_name['config_sources'].message_type = _CONFIGSOURCE _MESHCONFIG.fields_by_name['enable_auto_mtls'].message_type = google_dot_protobuf_dot_wrappers__pb2._BOOLVALUE _MESHCONFIG.fields_by_name['locality_lb_setting'].message_type = networking_dot_v1alpha3_dot_destination__rule__pb2._LOCALITYLOADBALANCERSETTING _MESHCONFIG.fields_by_name['dns_refresh_rate'].message_type = google_dot_protobuf_dot_duration__pb2._DURATION _MESHCONFIG.fields_by_name['report_batch_max_time'].message_type = google_dot_protobuf_dot_duration__pb2._DURATION _MESHCONFIG.fields_by_name['h2_upgrade_policy'].enum_type = _MESHCONFIG_H2UPGRADEPOLICY _MESHCONFIG.fields_by_name['certificates'].message_type = _CERTIFICATE _MESHCONFIG_INGRESSCONTROLLERMODE.containing_type = _MESHCONFIG _MESHCONFIG_AUTHPOLICY.containing_type = _MESHCONFIG _MESHCONFIG_ACCESSLOGENCODING.containing_type = _MESHCONFIG _MESHCONFIG_H2UPGRADEPOLICY.containing_type = _MESHCONFIG _CONFIGSOURCE.fields_by_name['tls_settings'].message_type = networking_dot_v1alpha3_dot_destination__rule__pb2._TLSSETTINGS _CONFIGSOURCE.fields_by_name['subscribed_resources'].enum_type = _RESOURCE DESCRIPTOR.message_types_by_name['MeshConfig'] = _MESHCONFIG DESCRIPTOR.message_types_by_name['ConfigSource'] = _CONFIGSOURCE DESCRIPTOR.message_types_by_name['Certificate'] = _CERTIFICATE DESCRIPTOR.enum_types_by_name['Resource'] = _RESOURCE _sym_db.RegisterFileDescriptor(DESCRIPTOR) MeshConfig = _reflection.GeneratedProtocolMessageType('MeshConfig', (_message.Message,), { 'OutboundTrafficPolicy' : _reflection.GeneratedProtocolMessageType('OutboundTrafficPolicy', (_message.Message,), { 'DESCRIPTOR' : _MESHCONFIG_OUTBOUNDTRAFFICPOLICY, '__module__' : 'mesh.v1alpha1.config_pb2' # @@protoc_insertion_point(class_scope:istio.mesh.v1alpha1.MeshConfig.OutboundTrafficPolicy) }) , 'DESCRIPTOR' : _MESHCONFIG, '__module__' : 'mesh.v1alpha1.config_pb2' # @@protoc_insertion_point(class_scope:istio.mesh.v1alpha1.MeshConfig) }) _sym_db.RegisterMessage(MeshConfig) _sym_db.RegisterMessage(MeshConfig.OutboundTrafficPolicy) ConfigSource = _reflection.GeneratedProtocolMessageType('ConfigSource', (_message.Message,), { 'DESCRIPTOR' : _CONFIGSOURCE, '__module__' : 'mesh.v1alpha1.config_pb2' # @@protoc_insertion_point(class_scope:istio.mesh.v1alpha1.ConfigSource) }) _sym_db.RegisterMessage(ConfigSource) Certificate = _reflection.GeneratedProtocolMessageType('Certificate', (_message.Message,), { 'DESCRIPTOR' : _CERTIFICATE, '__module__' : 'mesh.v1alpha1.config_pb2' # @@protoc_insertion_point(class_scope:istio.mesh.v1alpha1.Certificate) }) _sym_db.RegisterMessage(Certificate) DESCRIPTOR._options = None _MESHCONFIG.fields_by_name['auth_policy']._options = None _MESHCONFIG.fields_by_name['rds_refresh_delay']._options = None _MESHCONFIG.fields_by_name['mixer_address']._options = None _MESHCONFIG.fields_by_name['sds_uds_path']._options = None _MESHCONFIG.fields_by_name['sds_refresh_delay']._options = None # @@protoc_insertion_point(module_scope)
52.57204
4,551
0.7674
import sys _b=sys.version_info[0]<3 and (lambda x:x) or (lambda x:x.encode('latin1')) from google.protobuf.internal import enum_type_wrapper from google.protobuf import descriptor as _descriptor from google.protobuf import message as _message from google.protobuf import reflection as _reflection from google.protobuf import symbol_database as _symbol_database _sym_db = _symbol_database.Default() from google.protobuf import duration_pb2 as google_dot_protobuf_dot_duration__pb2 from google.protobuf import wrappers_pb2 as google_dot_protobuf_dot_wrappers__pb2 from mesh.v1alpha1 import proxy_pb2 as mesh_dot_v1alpha1_dot_proxy__pb2 from networking.v1alpha3 import destination_rule_pb2 as networking_dot_v1alpha3_dot_destination__rule__pb2 DESCRIPTOR = _descriptor.FileDescriptor( name='mesh/v1alpha1/config.proto', package='istio.mesh.v1alpha1', syntax='proto3', serialized_options=_b('Z\032istio.io/api/mesh/v1alpha1'), serialized_pb=_b('\n\x1amesh/v1alpha1/config.proto\x12\x13istio.mesh.v1alpha1\x1a\x1egoogle/protobuf/duration.proto\x1a\x1egoogle/protobuf/wrappers.proto\x1a\x19mesh/v1alpha1/proxy.proto\x1a*networking/v1alpha3/destination_rule.proto\"\x8f\x13\n\nMeshConfig\x12\x1a\n\x12mixer_check_server\x18\x01 \x01(\t\x12\x1b\n\x13mixer_report_server\x18\x02 \x01(\t\x12\x1d\n\x15\x64isable_policy_checks\x18\x03 \x01(\x08\x12\"\n\x1a\x64isable_mixer_http_reports\x18\x30 \x01(\x08\x12\x1e\n\x16policy_check_fail_open\x18\x19 \x01(\x08\x12-\n%sidecar_to_telemetry_session_affinity\x18\x1e \x01(\x08\x12\x19\n\x11proxy_listen_port\x18\x04 \x01(\x05\x12\x17\n\x0fproxy_http_port\x18\x05 \x01(\x05\x12\x32\n\x0f\x63onnect_timeout\x18\x06 \x01(\x0b\x32\x19.google.protobuf.Duration\x12=\n\x1aprotocol_detection_timeout\x18* \x01(\x0b\x32\x19.google.protobuf.Duration\x12\x61\n\rtcp_keepalive\x18\x1c \x01(\x0b\x32J.istio.networking.v1alpha3.ConnectionPoolSettings.TCPSettings.TcpKeepalive\x12\x15\n\ringress_class\x18\x07 \x01(\t\x12\x17\n\x0fingress_service\x18\x08 \x01(\t\x12V\n\x17ingress_controller_mode\x18\t \x01(\x0e\x32\x35.istio.mesh.v1alpha1.MeshConfig.IngressControllerMode\x12\x43\n\x0b\x61uth_policy\x18\n \x01(\x0e\x32*.istio.mesh.v1alpha1.MeshConfig.AuthPolicyB\x02\x18\x01\x12\x38\n\x11rds_refresh_delay\x18\x0b \x01(\x0b\x32\x19.google.protobuf.DurationB\x02\x18\x01\x12\x16\n\x0e\x65nable_tracing\x18\x0c \x01(\x08\x12\x17\n\x0f\x61\x63\x63\x65ss_log_file\x18\r \x01(\t\x12\x19\n\x11\x61\x63\x63\x65ss_log_format\x18\x18 \x01(\t\x12N\n\x13\x61\x63\x63\x65ss_log_encoding\x18\x1b \x01(\x0e\x32\x31.istio.mesh.v1alpha1.MeshConfig.AccessLogEncoding\x12\'\n\x1f\x65nable_envoy_access_log_service\x18( \x01(\x08\x12\x38\n\x0e\x64\x65\x66\x61ult_config\x18\x0e \x01(\x0b\x32 .istio.mesh.v1alpha1.ProxyConfig\x12\x19\n\rmixer_address\x18\x10 \x01(\tB\x02\x18\x01\x12V\n\x17outbound_traffic_policy\x18\x11 \x01(\x0b\x32\x35.istio.mesh.v1alpha1.MeshConfig.OutboundTrafficPolicy\x12\'\n\x1f\x65nable_client_side_policy_check\x18\x13 \x01(\x08\x12\x18\n\x0csds_uds_path\x18\x14 \x01(\tB\x02\x18\x01\x12\x38\n\x11sds_refresh_delay\x18\x15 \x01(\x0b\x32\x19.google.protobuf.DurationB\x02\x18\x01\x12\x39\n\x0e\x63onfig_sources\x18\x16 \x03(\x0b\x32!.istio.mesh.v1alpha1.ConfigSource\x12\x34\n\x10\x65nable_auto_mtls\x18+ \x01(\x0b\x32\x1a.google.protobuf.BoolValue\x12\x1e\n\x16\x65nable_sds_token_mount\x18\x17 \x01(\x08\x12\x1a\n\x12sds_use_k8s_sa_jwt\x18\x1d \x01(\x08\x12\x14\n\x0ctrust_domain\x18\x1a \x01(\t\x12\x1c\n\x14trust_domain_aliases\x18. \x03(\t\x12!\n\x19\x64\x65\x66\x61ult_service_export_to\x18\x1f \x03(\t\x12)\n!default_virtual_service_export_to\x18 \x03(\t\x12*\n\"default_destination_rule_export_to\x18! \x03(\t\x12\x16\n\x0eroot_namespace\x18\" \x01(\t\x12S\n\x13locality_lb_setting\x18# \x01(\x0b\x32\x36.istio.networking.v1alpha3.LocalityLoadBalancerSetting\x12\x33\n\x10\x64ns_refresh_rate\x18$ \x01(\x0b\x32\x19.google.protobuf.Duration\x12\x1c\n\x14\x64isable_report_batch\x18% \x01(\x08\x12 \n\x18report_batch_max_entries\x18& \x01(\r\x12\x38\n\x15report_batch_max_time\x18\' \x01(\x0b\x32\x19.google.protobuf.Duration\x12J\n\x11h2_upgrade_policy\x18) \x01(\x0e\x32/.istio.mesh.v1alpha1.MeshConfig.H2UpgradePolicy\x12!\n\x19inbound_cluster_stat_name\x18, \x01(\t\x12\"\n\x1aoutbound_cluster_stat_name\x18- \x01(\t\x12\x36\n\x0c\x63\x65rtificates\x18/ \x03(\x0b\x32 .istio.mesh.v1alpha1.Certificate\x1a\xa7\x01\n\x15OutboundTrafficPolicy\x12H\n\x04mode\x18\x01 \x01(\x0e\x32:.istio.mesh.v1alpha1.MeshConfig.OutboundTrafficPolicy.Mode\"D\n\x04Mode\x12\x11\n\rREGISTRY_ONLY\x10\x00\x12\r\n\tALLOW_ANY\x10\x01\"\x04\x08\x02\x10\x02*\x14VIRTUAL_SERVICE_ONLY\"9\n\x15IngressControllerMode\x12\x07\n\x03OFF\x10\x00\x12\x0b\n\x07\x44\x45\x46\x41ULT\x10\x01\x12\n\n\x06STRICT\x10\x02\"&\n\nAuthPolicy\x12\x08\n\x04NONE\x10\x00\x12\x0e\n\nMUTUAL_TLS\x10\x01\"\'\n\x11\x41\x63\x63\x65ssLogEncoding\x12\x08\n\x04TEXT\x10\x00\x12\x08\n\x04JSON\x10\x01\"2\n\x0fH2UpgradePolicy\x12\x12\n\x0e\x44O_NOT_UPGRADE\x10\x00\x12\x0b\n\x07UPGRADE\x10\x01J\x04\x08\x0f\x10\x10J\x04\x08\x12\x10\x13\"\x9a\x01\n\x0c\x43onfigSource\x12\x0f\n\x07\x61\x64\x64ress\x18\x01 \x01(\t\x12<\n\x0ctls_settings\x18\x02 \x01(\x0b\x32&.istio.networking.v1alpha3.TLSSettings\x12;\n\x14subscribed_resources\x18\x03 \x03(\x0e\x32\x1d.istio.mesh.v1alpha1.Resource\"5\n\x0b\x43\x65rtificate\x12\x13\n\x0bsecret_name\x18\x01 \x01(\t\x12\x11\n\tdns_names\x18\x02 \x03(\t* \n\x08Resource\x12\x14\n\x10SERVICE_REGISTRY\x10\x00\x42\x1cZ\x1aistio.io/api/mesh/v1alpha1b\x06proto3') , dependencies=[google_dot_protobuf_dot_duration__pb2.DESCRIPTOR,google_dot_protobuf_dot_wrappers__pb2.DESCRIPTOR,mesh_dot_v1alpha1_dot_proxy__pb2.DESCRIPTOR,networking_dot_v1alpha3_dot_destination__rule__pb2.DESCRIPTOR,]) _RESOURCE = _descriptor.EnumDescriptor( name='Resource', full_name='istio.mesh.v1alpha1.Resource', filename=None, file=DESCRIPTOR, values=[ _descriptor.EnumValueDescriptor( name='SERVICE_REGISTRY', index=0, number=0, serialized_options=None, type=None), ], containing_type=None, serialized_options=None, serialized_start=2848, serialized_end=2880, ) _sym_db.RegisterEnumDescriptor(_RESOURCE) Resource = enum_type_wrapper.EnumTypeWrapper(_RESOURCE) SERVICE_REGISTRY = 0 _MESHCONFIG_OUTBOUNDTRAFFICPOLICY_MODE = _descriptor.EnumDescriptor( name='Mode', full_name='istio.mesh.v1alpha1.MeshConfig.OutboundTrafficPolicy.Mode', filename=None, file=DESCRIPTOR, values=[ _descriptor.EnumValueDescriptor( name='REGISTRY_ONLY', index=0, number=0, serialized_options=None, type=None), _descriptor.EnumValueDescriptor( name='ALLOW_ANY', index=1, number=1, serialized_options=None, type=None), ], containing_type=None, serialized_options=None, serialized_start=2362, serialized_end=2430, ) _sym_db.RegisterEnumDescriptor(_MESHCONFIG_OUTBOUNDTRAFFICPOLICY_MODE) _MESHCONFIG_INGRESSCONTROLLERMODE = _descriptor.EnumDescriptor( name='IngressControllerMode', full_name='istio.mesh.v1alpha1.MeshConfig.IngressControllerMode', filename=None, file=DESCRIPTOR, values=[ _descriptor.EnumValueDescriptor( name='OFF', index=0, number=0, serialized_options=None, type=None), _descriptor.EnumValueDescriptor( name='DEFAULT', index=1, number=1, serialized_options=None, type=None), _descriptor.EnumValueDescriptor( name='STRICT', index=2, number=2, serialized_options=None, type=None), ], containing_type=None, serialized_options=None, serialized_start=2432, serialized_end=2489, ) _sym_db.RegisterEnumDescriptor(_MESHCONFIG_INGRESSCONTROLLERMODE) _MESHCONFIG_AUTHPOLICY = _descriptor.EnumDescriptor( name='AuthPolicy', full_name='istio.mesh.v1alpha1.MeshConfig.AuthPolicy', filename=None, file=DESCRIPTOR, values=[ _descriptor.EnumValueDescriptor( name='NONE', index=0, number=0, serialized_options=None, type=None), _descriptor.EnumValueDescriptor( name='MUTUAL_TLS', index=1, number=1, serialized_options=None, type=None), ], containing_type=None, serialized_options=None, serialized_start=2491, serialized_end=2529, ) _sym_db.RegisterEnumDescriptor(_MESHCONFIG_AUTHPOLICY) _MESHCONFIG_ACCESSLOGENCODING = _descriptor.EnumDescriptor( name='AccessLogEncoding', full_name='istio.mesh.v1alpha1.MeshConfig.AccessLogEncoding', filename=None, file=DESCRIPTOR, values=[ _descriptor.EnumValueDescriptor( name='TEXT', index=0, number=0, serialized_options=None, type=None), _descriptor.EnumValueDescriptor( name='JSON', index=1, number=1, serialized_options=None, type=None), ], containing_type=None, serialized_options=None, serialized_start=2531, serialized_end=2570, ) _sym_db.RegisterEnumDescriptor(_MESHCONFIG_ACCESSLOGENCODING) _MESHCONFIG_H2UPGRADEPOLICY = _descriptor.EnumDescriptor( name='H2UpgradePolicy', full_name='istio.mesh.v1alpha1.MeshConfig.H2UpgradePolicy', filename=None, file=DESCRIPTOR, values=[ _descriptor.EnumValueDescriptor( name='DO_NOT_UPGRADE', index=0, number=0, serialized_options=None, type=None), _descriptor.EnumValueDescriptor( name='UPGRADE', index=1, number=1, serialized_options=None, type=None), ], containing_type=None, serialized_options=None, serialized_start=2572, serialized_end=2622, ) _sym_db.RegisterEnumDescriptor(_MESHCONFIG_H2UPGRADEPOLICY) _MESHCONFIG_OUTBOUNDTRAFFICPOLICY = _descriptor.Descriptor( name='OutboundTrafficPolicy', full_name='istio.mesh.v1alpha1.MeshConfig.OutboundTrafficPolicy', filename=None, file=DESCRIPTOR, containing_type=None, fields=[ _descriptor.FieldDescriptor( name='mode', full_name='istio.mesh.v1alpha1.MeshConfig.OutboundTrafficPolicy.mode', index=0, number=1, type=14, cpp_type=8, label=1, has_default_value=False, default_value=0, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), ], extensions=[ ], nested_types=[], enum_types=[ _MESHCONFIG_OUTBOUNDTRAFFICPOLICY_MODE, ], serialized_options=None, is_extendable=False, syntax='proto3', extension_ranges=[], oneofs=[ ], serialized_start=2263, serialized_end=2430, ) _MESHCONFIG = _descriptor.Descriptor( name='MeshConfig', full_name='istio.mesh.v1alpha1.MeshConfig', filename=None, file=DESCRIPTOR, containing_type=None, fields=[ _descriptor.FieldDescriptor( name='mixer_check_server', full_name='istio.mesh.v1alpha1.MeshConfig.mixer_check_server', index=0, number=1, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='mixer_report_server', full_name='istio.mesh.v1alpha1.MeshConfig.mixer_report_server', index=1, number=2, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='disable_policy_checks', full_name='istio.mesh.v1alpha1.MeshConfig.disable_policy_checks', index=2, number=3, type=8, cpp_type=7, label=1, has_default_value=False, default_value=False, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='disable_mixer_http_reports', full_name='istio.mesh.v1alpha1.MeshConfig.disable_mixer_http_reports', index=3, number=48, type=8, cpp_type=7, label=1, has_default_value=False, default_value=False, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='policy_check_fail_open', full_name='istio.mesh.v1alpha1.MeshConfig.policy_check_fail_open', index=4, number=25, type=8, cpp_type=7, label=1, has_default_value=False, default_value=False, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='sidecar_to_telemetry_session_affinity', full_name='istio.mesh.v1alpha1.MeshConfig.sidecar_to_telemetry_session_affinity', index=5, number=30, type=8, cpp_type=7, label=1, has_default_value=False, default_value=False, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='proxy_listen_port', full_name='istio.mesh.v1alpha1.MeshConfig.proxy_listen_port', index=6, number=4, type=5, cpp_type=1, label=1, has_default_value=False, default_value=0, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='proxy_http_port', full_name='istio.mesh.v1alpha1.MeshConfig.proxy_http_port', index=7, number=5, type=5, cpp_type=1, label=1, has_default_value=False, default_value=0, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='connect_timeout', full_name='istio.mesh.v1alpha1.MeshConfig.connect_timeout', index=8, number=6, type=11, cpp_type=10, label=1, has_default_value=False, default_value=None, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='protocol_detection_timeout', full_name='istio.mesh.v1alpha1.MeshConfig.protocol_detection_timeout', index=9, number=42, type=11, cpp_type=10, label=1, has_default_value=False, default_value=None, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='tcp_keepalive', full_name='istio.mesh.v1alpha1.MeshConfig.tcp_keepalive', index=10, number=28, type=11, cpp_type=10, label=1, has_default_value=False, default_value=None, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='ingress_class', full_name='istio.mesh.v1alpha1.MeshConfig.ingress_class', index=11, number=7, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='ingress_service', full_name='istio.mesh.v1alpha1.MeshConfig.ingress_service', index=12, number=8, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='ingress_controller_mode', full_name='istio.mesh.v1alpha1.MeshConfig.ingress_controller_mode', index=13, number=9, type=14, cpp_type=8, label=1, has_default_value=False, default_value=0, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='auth_policy', full_name='istio.mesh.v1alpha1.MeshConfig.auth_policy', index=14, number=10, type=14, cpp_type=8, label=1, has_default_value=False, default_value=0, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=_b('\030\001'), file=DESCRIPTOR), _descriptor.FieldDescriptor( name='rds_refresh_delay', full_name='istio.mesh.v1alpha1.MeshConfig.rds_refresh_delay', index=15, number=11, type=11, cpp_type=10, label=1, has_default_value=False, default_value=None, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=_b('\030\001'), file=DESCRIPTOR), _descriptor.FieldDescriptor( name='enable_tracing', full_name='istio.mesh.v1alpha1.MeshConfig.enable_tracing', index=16, number=12, type=8, cpp_type=7, label=1, has_default_value=False, default_value=False, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='access_log_file', full_name='istio.mesh.v1alpha1.MeshConfig.access_log_file', index=17, number=13, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='access_log_format', full_name='istio.mesh.v1alpha1.MeshConfig.access_log_format', index=18, number=24, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='access_log_encoding', full_name='istio.mesh.v1alpha1.MeshConfig.access_log_encoding', index=19, number=27, type=14, cpp_type=8, label=1, has_default_value=False, default_value=0, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='enable_envoy_access_log_service', full_name='istio.mesh.v1alpha1.MeshConfig.enable_envoy_access_log_service', index=20, number=40, type=8, cpp_type=7, label=1, has_default_value=False, default_value=False, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='default_config', full_name='istio.mesh.v1alpha1.MeshConfig.default_config', index=21, number=14, type=11, cpp_type=10, label=1, has_default_value=False, default_value=None, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='mixer_address', full_name='istio.mesh.v1alpha1.MeshConfig.mixer_address', index=22, number=16, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=_b('\030\001'), file=DESCRIPTOR), _descriptor.FieldDescriptor( name='outbound_traffic_policy', full_name='istio.mesh.v1alpha1.MeshConfig.outbound_traffic_policy', index=23, number=17, type=11, cpp_type=10, label=1, has_default_value=False, default_value=None, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='enable_client_side_policy_check', full_name='istio.mesh.v1alpha1.MeshConfig.enable_client_side_policy_check', index=24, number=19, type=8, cpp_type=7, label=1, has_default_value=False, default_value=False, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='sds_uds_path', full_name='istio.mesh.v1alpha1.MeshConfig.sds_uds_path', index=25, number=20, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=_b('\030\001'), file=DESCRIPTOR), _descriptor.FieldDescriptor( name='sds_refresh_delay', full_name='istio.mesh.v1alpha1.MeshConfig.sds_refresh_delay', index=26, number=21, type=11, cpp_type=10, label=1, has_default_value=False, default_value=None, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=_b('\030\001'), file=DESCRIPTOR), _descriptor.FieldDescriptor( name='config_sources', full_name='istio.mesh.v1alpha1.MeshConfig.config_sources', index=27, number=22, type=11, cpp_type=10, label=3, has_default_value=False, default_value=[], message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='enable_auto_mtls', full_name='istio.mesh.v1alpha1.MeshConfig.enable_auto_mtls', index=28, number=43, type=11, cpp_type=10, label=1, has_default_value=False, default_value=None, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='enable_sds_token_mount', full_name='istio.mesh.v1alpha1.MeshConfig.enable_sds_token_mount', index=29, number=23, type=8, cpp_type=7, label=1, has_default_value=False, default_value=False, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='sds_use_k8s_sa_jwt', full_name='istio.mesh.v1alpha1.MeshConfig.sds_use_k8s_sa_jwt', index=30, number=29, type=8, cpp_type=7, label=1, has_default_value=False, default_value=False, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='trust_domain', full_name='istio.mesh.v1alpha1.MeshConfig.trust_domain', index=31, number=26, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='trust_domain_aliases', full_name='istio.mesh.v1alpha1.MeshConfig.trust_domain_aliases', index=32, number=46, type=9, cpp_type=9, label=3, has_default_value=False, default_value=[], message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='default_service_export_to', full_name='istio.mesh.v1alpha1.MeshConfig.default_service_export_to', index=33, number=31, type=9, cpp_type=9, label=3, has_default_value=False, default_value=[], message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='default_virtual_service_export_to', full_name='istio.mesh.v1alpha1.MeshConfig.default_virtual_service_export_to', index=34, number=32, type=9, cpp_type=9, label=3, has_default_value=False, default_value=[], message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='default_destination_rule_export_to', full_name='istio.mesh.v1alpha1.MeshConfig.default_destination_rule_export_to', index=35, number=33, type=9, cpp_type=9, label=3, has_default_value=False, default_value=[], message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='root_namespace', full_name='istio.mesh.v1alpha1.MeshConfig.root_namespace', index=36, number=34, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='locality_lb_setting', full_name='istio.mesh.v1alpha1.MeshConfig.locality_lb_setting', index=37, number=35, type=11, cpp_type=10, label=1, has_default_value=False, default_value=None, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='dns_refresh_rate', full_name='istio.mesh.v1alpha1.MeshConfig.dns_refresh_rate', index=38, number=36, type=11, cpp_type=10, label=1, has_default_value=False, default_value=None, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='disable_report_batch', full_name='istio.mesh.v1alpha1.MeshConfig.disable_report_batch', index=39, number=37, type=8, cpp_type=7, label=1, has_default_value=False, default_value=False, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='report_batch_max_entries', full_name='istio.mesh.v1alpha1.MeshConfig.report_batch_max_entries', index=40, number=38, type=13, cpp_type=3, label=1, has_default_value=False, default_value=0, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='report_batch_max_time', full_name='istio.mesh.v1alpha1.MeshConfig.report_batch_max_time', index=41, number=39, type=11, cpp_type=10, label=1, has_default_value=False, default_value=None, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='h2_upgrade_policy', full_name='istio.mesh.v1alpha1.MeshConfig.h2_upgrade_policy', index=42, number=41, type=14, cpp_type=8, label=1, has_default_value=False, default_value=0, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='inbound_cluster_stat_name', full_name='istio.mesh.v1alpha1.MeshConfig.inbound_cluster_stat_name', index=43, number=44, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='outbound_cluster_stat_name', full_name='istio.mesh.v1alpha1.MeshConfig.outbound_cluster_stat_name', index=44, number=45, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='certificates', full_name='istio.mesh.v1alpha1.MeshConfig.certificates', index=45, number=47, type=11, cpp_type=10, label=3, has_default_value=False, default_value=[], message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), ], extensions=[ ], nested_types=[_MESHCONFIG_OUTBOUNDTRAFFICPOLICY, ], enum_types=[ _MESHCONFIG_INGRESSCONTROLLERMODE, _MESHCONFIG_AUTHPOLICY, _MESHCONFIG_ACCESSLOGENCODING, _MESHCONFIG_H2UPGRADEPOLICY, ], serialized_options=None, is_extendable=False, syntax='proto3', extension_ranges=[], oneofs=[ ], serialized_start=187, serialized_end=2634, ) _CONFIGSOURCE = _descriptor.Descriptor( name='ConfigSource', full_name='istio.mesh.v1alpha1.ConfigSource', filename=None, file=DESCRIPTOR, containing_type=None, fields=[ _descriptor.FieldDescriptor( name='address', full_name='istio.mesh.v1alpha1.ConfigSource.address', index=0, number=1, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='tls_settings', full_name='istio.mesh.v1alpha1.ConfigSource.tls_settings', index=1, number=2, type=11, cpp_type=10, label=1, has_default_value=False, default_value=None, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='subscribed_resources', full_name='istio.mesh.v1alpha1.ConfigSource.subscribed_resources', index=2, number=3, type=14, cpp_type=8, label=3, has_default_value=False, default_value=[], message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), ], extensions=[ ], nested_types=[], enum_types=[ ], serialized_options=None, is_extendable=False, syntax='proto3', extension_ranges=[], oneofs=[ ], serialized_start=2637, serialized_end=2791, ) _CERTIFICATE = _descriptor.Descriptor( name='Certificate', full_name='istio.mesh.v1alpha1.Certificate', filename=None, file=DESCRIPTOR, containing_type=None, fields=[ _descriptor.FieldDescriptor( name='secret_name', full_name='istio.mesh.v1alpha1.Certificate.secret_name', index=0, number=1, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='dns_names', full_name='istio.mesh.v1alpha1.Certificate.dns_names', index=1, number=2, type=9, cpp_type=9, label=3, has_default_value=False, default_value=[], message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, serialized_options=None, file=DESCRIPTOR), ], extensions=[ ], nested_types=[], enum_types=[ ], serialized_options=None, is_extendable=False, syntax='proto3', extension_ranges=[], oneofs=[ ], serialized_start=2793, serialized_end=2846, ) _MESHCONFIG_OUTBOUNDTRAFFICPOLICY.fields_by_name['mode'].enum_type = _MESHCONFIG_OUTBOUNDTRAFFICPOLICY_MODE _MESHCONFIG_OUTBOUNDTRAFFICPOLICY.containing_type = _MESHCONFIG _MESHCONFIG_OUTBOUNDTRAFFICPOLICY_MODE.containing_type = _MESHCONFIG_OUTBOUNDTRAFFICPOLICY _MESHCONFIG.fields_by_name['connect_timeout'].message_type = google_dot_protobuf_dot_duration__pb2._DURATION _MESHCONFIG.fields_by_name['protocol_detection_timeout'].message_type = google_dot_protobuf_dot_duration__pb2._DURATION _MESHCONFIG.fields_by_name['tcp_keepalive'].message_type = networking_dot_v1alpha3_dot_destination__rule__pb2._CONNECTIONPOOLSETTINGS_TCPSETTINGS_TCPKEEPALIVE _MESHCONFIG.fields_by_name['ingress_controller_mode'].enum_type = _MESHCONFIG_INGRESSCONTROLLERMODE _MESHCONFIG.fields_by_name['auth_policy'].enum_type = _MESHCONFIG_AUTHPOLICY _MESHCONFIG.fields_by_name['rds_refresh_delay'].message_type = google_dot_protobuf_dot_duration__pb2._DURATION _MESHCONFIG.fields_by_name['access_log_encoding'].enum_type = _MESHCONFIG_ACCESSLOGENCODING _MESHCONFIG.fields_by_name['default_config'].message_type = mesh_dot_v1alpha1_dot_proxy__pb2._PROXYCONFIG _MESHCONFIG.fields_by_name['outbound_traffic_policy'].message_type = _MESHCONFIG_OUTBOUNDTRAFFICPOLICY _MESHCONFIG.fields_by_name['sds_refresh_delay'].message_type = google_dot_protobuf_dot_duration__pb2._DURATION _MESHCONFIG.fields_by_name['config_sources'].message_type = _CONFIGSOURCE _MESHCONFIG.fields_by_name['enable_auto_mtls'].message_type = google_dot_protobuf_dot_wrappers__pb2._BOOLVALUE _MESHCONFIG.fields_by_name['locality_lb_setting'].message_type = networking_dot_v1alpha3_dot_destination__rule__pb2._LOCALITYLOADBALANCERSETTING _MESHCONFIG.fields_by_name['dns_refresh_rate'].message_type = google_dot_protobuf_dot_duration__pb2._DURATION _MESHCONFIG.fields_by_name['report_batch_max_time'].message_type = google_dot_protobuf_dot_duration__pb2._DURATION _MESHCONFIG.fields_by_name['h2_upgrade_policy'].enum_type = _MESHCONFIG_H2UPGRADEPOLICY _MESHCONFIG.fields_by_name['certificates'].message_type = _CERTIFICATE _MESHCONFIG_INGRESSCONTROLLERMODE.containing_type = _MESHCONFIG _MESHCONFIG_AUTHPOLICY.containing_type = _MESHCONFIG _MESHCONFIG_ACCESSLOGENCODING.containing_type = _MESHCONFIG _MESHCONFIG_H2UPGRADEPOLICY.containing_type = _MESHCONFIG _CONFIGSOURCE.fields_by_name['tls_settings'].message_type = networking_dot_v1alpha3_dot_destination__rule__pb2._TLSSETTINGS _CONFIGSOURCE.fields_by_name['subscribed_resources'].enum_type = _RESOURCE DESCRIPTOR.message_types_by_name['MeshConfig'] = _MESHCONFIG DESCRIPTOR.message_types_by_name['ConfigSource'] = _CONFIGSOURCE DESCRIPTOR.message_types_by_name['Certificate'] = _CERTIFICATE DESCRIPTOR.enum_types_by_name['Resource'] = _RESOURCE _sym_db.RegisterFileDescriptor(DESCRIPTOR) MeshConfig = _reflection.GeneratedProtocolMessageType('MeshConfig', (_message.Message,), { 'OutboundTrafficPolicy' : _reflection.GeneratedProtocolMessageType('OutboundTrafficPolicy', (_message.Message,), { 'DESCRIPTOR' : _MESHCONFIG_OUTBOUNDTRAFFICPOLICY, '__module__' : 'mesh.v1alpha1.config_pb2' # @@protoc_insertion_point(class_scope:istio.mesh.v1alpha1.MeshConfig.OutboundTrafficPolicy) }) , 'DESCRIPTOR' : _MESHCONFIG, '__module__' : 'mesh.v1alpha1.config_pb2' # @@protoc_insertion_point(class_scope:istio.mesh.v1alpha1.MeshConfig) }) _sym_db.RegisterMessage(MeshConfig) _sym_db.RegisterMessage(MeshConfig.OutboundTrafficPolicy) ConfigSource = _reflection.GeneratedProtocolMessageType('ConfigSource', (_message.Message,), { 'DESCRIPTOR' : _CONFIGSOURCE, '__module__' : 'mesh.v1alpha1.config_pb2' # @@protoc_insertion_point(class_scope:istio.mesh.v1alpha1.ConfigSource) }) _sym_db.RegisterMessage(ConfigSource) Certificate = _reflection.GeneratedProtocolMessageType('Certificate', (_message.Message,), { 'DESCRIPTOR' : _CERTIFICATE, '__module__' : 'mesh.v1alpha1.config_pb2' # @@protoc_insertion_point(class_scope:istio.mesh.v1alpha1.Certificate) }) _sym_db.RegisterMessage(Certificate) DESCRIPTOR._options = None _MESHCONFIG.fields_by_name['auth_policy']._options = None _MESHCONFIG.fields_by_name['rds_refresh_delay']._options = None _MESHCONFIG.fields_by_name['mixer_address']._options = None _MESHCONFIG.fields_by_name['sds_uds_path']._options = None _MESHCONFIG.fields_by_name['sds_refresh_delay']._options = None # @@protoc_insertion_point(module_scope)
true
true
f72640bdf780be7bf1cfaf80fbf1f6bf7bf0616f
1,758
py
Python
fairseq/modules/fairseq_dropout.py
zhengzx-nlp/REDER
7035e089e4d30b8090a2c3caa937b1e0ba27cedc
[ "MIT" ]
18
2021-11-14T06:34:26.000Z
2022-03-19T07:18:08.000Z
fairseq/modules/fairseq_dropout.py
zhengzx-nlp/REDER
7035e089e4d30b8090a2c3caa937b1e0ba27cedc
[ "MIT" ]
1
2021-12-03T07:23:36.000Z
2021-12-10T08:32:36.000Z
fairseq/modules/fairseq_dropout.py
zhengzx-nlp/REDER
7035e089e4d30b8090a2c3caa937b1e0ba27cedc
[ "MIT" ]
2
2021-12-10T14:20:09.000Z
2022-01-08T09:39:27.000Z
# Copyright (c) Facebook, Inc. and its affiliates. # # This source code is licensed under the MIT license found in the # LICENSE file in the root directory of this source tree. import logging from typing import List, Optional import torch.nn as nn import torch.nn.functional as F logger = logging.getLogger(__name__) class FairseqDropout(nn.Module): def __init__(self, p, module_name=None): super().__init__() self.p = p self.module_name = module_name self.apply_during_inference = False def forward(self, x, inplace: bool = False): if self.training or self.apply_during_inference: return F.dropout(x, p=self.p, training=True, inplace=inplace) else: return x def extra_repr(self) -> str: return 'p={}'.format(self.p) def make_generation_fast_( self, name: str, retain_dropout: bool = False, retain_dropout_modules: Optional[List[str]] = None, **kwargs ): if retain_dropout: if retain_dropout_modules is not None and self.module_name is None: logger.warning( 'Cannot enable dropout during inference for module {} ' 'because module_name was not set'.format(name) ) elif ( retain_dropout_modules is None # if None, apply to all modules or self.module_name in retain_dropout_modules ): logger.info( 'Enabling dropout during inference for module: {}'.format(name) ) self.apply_during_inference = True else: logger.info('Disabling dropout for module: {}'.format(name))
31.392857
83
0.600683
import logging from typing import List, Optional import torch.nn as nn import torch.nn.functional as F logger = logging.getLogger(__name__) class FairseqDropout(nn.Module): def __init__(self, p, module_name=None): super().__init__() self.p = p self.module_name = module_name self.apply_during_inference = False def forward(self, x, inplace: bool = False): if self.training or self.apply_during_inference: return F.dropout(x, p=self.p, training=True, inplace=inplace) else: return x def extra_repr(self) -> str: return 'p={}'.format(self.p) def make_generation_fast_( self, name: str, retain_dropout: bool = False, retain_dropout_modules: Optional[List[str]] = None, **kwargs ): if retain_dropout: if retain_dropout_modules is not None and self.module_name is None: logger.warning( 'Cannot enable dropout during inference for module {} ' 'because module_name was not set'.format(name) ) elif ( retain_dropout_modules is None or self.module_name in retain_dropout_modules ): logger.info( 'Enabling dropout during inference for module: {}'.format(name) ) self.apply_during_inference = True else: logger.info('Disabling dropout for module: {}'.format(name))
true
true
f726415ccf6a26910901b63bb701354b030b9ab9
4,077
py
Python
qa/rpc-tests/test_script_address2.py
jalcantara1983/atixcoin
d3e941bf1dd911c224bb66a3e82bfecf1a5fefe6
[ "MIT" ]
null
null
null
qa/rpc-tests/test_script_address2.py
jalcantara1983/atixcoin
d3e941bf1dd911c224bb66a3e82bfecf1a5fefe6
[ "MIT" ]
null
null
null
qa/rpc-tests/test_script_address2.py
jalcantara1983/atixcoin
d3e941bf1dd911c224bb66a3e82bfecf1a5fefe6
[ "MIT" ]
null
null
null
#!/usr/bin/env python3 # Copyright (c) 2015-2016 The Bitcoin Core developers # Distributed under the MIT software license, see the accompanying # file COPYING or http://www.opensource.org/licenses/mit-license.php. # # Test new Atixcoin multisig prefix functionality. # from test_framework.test_framework import BitcoinTestFramework from test_framework.util import * import decimal class ScriptAddress2Test(BitcoinTestFramework): def __init__(self): super().__init__() self.num_nodes = 3 self.setup_clean_chain = False def setup_network(self): self.nodes = [] self.nodes.append(start_node(0, self.options.tmpdir, [])) self.nodes.append(start_node(1, self.options.tmpdir, [])) self.nodes.append(start_node(2, self.options.tmpdir, [])) connect_nodes(self.nodes[1], 0) connect_nodes(self.nodes[2], 0) self.is_network_split = False self.sync_all() def run_test(self): cnt = self.nodes[0].getblockcount() # Mine some blocks self.nodes[1].generate(100) self.sync_all() if (self.nodes[0].getblockcount() != cnt + 100): raise AssertionError("Failed to mine 100 blocks") addr = self.nodes[0].getnewaddress() addr2 = self.nodes[0].getnewaddress() multisig_addr = self.nodes[0].addmultisigaddress(2, [addr, addr2], "multisigaccount") assert_equal(multisig_addr[0], 'Q') # Send to a new multisig address txid = self.nodes[1].sendtoaddress(multisig_addr, 1) block = self.nodes[1].generate(3) self.sync_all() tx = self.nodes[2].getrawtransaction(txid, 1) dest_addrs = [tx["vout"][0]['scriptPubKey']['addresses'][0], tx["vout"][1]['scriptPubKey']['addresses'][0]] assert(multisig_addr in dest_addrs) # Spend from the new multisig address addr3 = self.nodes[1].getnewaddress() txid = self.nodes[0].sendfrom("multisigaccount", addr3, 0.8) block = self.nodes[0].generate(2) self.sync_all() assert(self.nodes[0].getbalance("multisigaccount", 1) < 0.2) assert(self.nodes[1].listtransactions()[-1]['address'] == addr3) # Send to an old multisig address. The api addmultisigaddress # can only generate a new address so we manually compute # multisig_addr_old beforehand using an old client. priv_keys = ["cU7eeLPKzXeKMeZvnEJhvZZ3tLqVF3XGeo1BbM8dnbmV7pP3Qg89", "cTw7mRhSvTfzqCt6MFgBoTBqwBpYu2rWugisXcwjv4cAASh3iqPt"] addrs = ["mj6gNGRXPXrD69R5ApjcsDerZGrYKSfb6v", "mqET4JA3L7P7FoUjUP3F6m6YsLpCkyzzou"] self.nodes[0].importprivkey(priv_keys[0]) self.nodes[0].importprivkey(priv_keys[1]) multisig_addr_new = self.nodes[0].addmultisigaddress(2, addrs, "multisigaccount2") assert_equal(multisig_addr_new, "QZ974ZrPrmqMmm1PSVp4m8YEgo3bCQZBbe") multisig_addr_old = "2N5nLwYz9qfnGdaFLpPn3gS6oYQbmLTWPjq" ## Let's send to the old address. We can then find it in the ## new address with the new client. So basically the old ## address and the new one are the same thing. txid = self.nodes[1].sendtoaddress(multisig_addr_old, 1) block = self.nodes[1].generate(1) self.sync_all() tx = self.nodes[2].getrawtransaction(txid, 1) dest_addrs = [tx["vout"][0]['scriptPubKey']['addresses'][0], tx["vout"][1]['scriptPubKey']['addresses'][0]] assert(multisig_addr_new in dest_addrs) assert(multisig_addr_old not in dest_addrs) # Spend from the new multisig address addr4 = self.nodes[1].getnewaddress() txid = self.nodes[0].sendfrom("multisigaccount2", addr4, 0.8) block = self.nodes[0].generate(2) self.sync_all() assert(self.nodes[0].getbalance("multisigaccount2", 1) < 0.2) assert(self.nodes[1].listtransactions()[-1]['address'] == addr4) if __name__ == '__main__': ScriptAddress2Test().main()
40.366337
93
0.649497
from test_framework.test_framework import BitcoinTestFramework from test_framework.util import * import decimal class ScriptAddress2Test(BitcoinTestFramework): def __init__(self): super().__init__() self.num_nodes = 3 self.setup_clean_chain = False def setup_network(self): self.nodes = [] self.nodes.append(start_node(0, self.options.tmpdir, [])) self.nodes.append(start_node(1, self.options.tmpdir, [])) self.nodes.append(start_node(2, self.options.tmpdir, [])) connect_nodes(self.nodes[1], 0) connect_nodes(self.nodes[2], 0) self.is_network_split = False self.sync_all() def run_test(self): cnt = self.nodes[0].getblockcount() self.nodes[1].generate(100) self.sync_all() if (self.nodes[0].getblockcount() != cnt + 100): raise AssertionError("Failed to mine 100 blocks") addr = self.nodes[0].getnewaddress() addr2 = self.nodes[0].getnewaddress() multisig_addr = self.nodes[0].addmultisigaddress(2, [addr, addr2], "multisigaccount") assert_equal(multisig_addr[0], 'Q') txid = self.nodes[1].sendtoaddress(multisig_addr, 1) block = self.nodes[1].generate(3) self.sync_all() tx = self.nodes[2].getrawtransaction(txid, 1) dest_addrs = [tx["vout"][0]['scriptPubKey']['addresses'][0], tx["vout"][1]['scriptPubKey']['addresses'][0]] assert(multisig_addr in dest_addrs) addr3 = self.nodes[1].getnewaddress() txid = self.nodes[0].sendfrom("multisigaccount", addr3, 0.8) block = self.nodes[0].generate(2) self.sync_all() assert(self.nodes[0].getbalance("multisigaccount", 1) < 0.2) assert(self.nodes[1].listtransactions()[-1]['address'] == addr3) priv_keys = ["cU7eeLPKzXeKMeZvnEJhvZZ3tLqVF3XGeo1BbM8dnbmV7pP3Qg89", "cTw7mRhSvTfzqCt6MFgBoTBqwBpYu2rWugisXcwjv4cAASh3iqPt"] addrs = ["mj6gNGRXPXrD69R5ApjcsDerZGrYKSfb6v", "mqET4JA3L7P7FoUjUP3F6m6YsLpCkyzzou"] self.nodes[0].importprivkey(priv_keys[0]) self.nodes[0].importprivkey(priv_keys[1]) multisig_addr_new = self.nodes[0].addmultisigaddress(2, addrs, "multisigaccount2") assert_equal(multisig_addr_new, "QZ974ZrPrmqMmm1PSVp4m8YEgo3bCQZBbe") multisig_addr_old = "2N5nLwYz9qfnGdaFLpPn3gS6oYQbmLTWPjq" he old ## address and the new one are the same thing. txid = self.nodes[1].sendtoaddress(multisig_addr_old, 1) block = self.nodes[1].generate(1) self.sync_all() tx = self.nodes[2].getrawtransaction(txid, 1) dest_addrs = [tx["vout"][0]['scriptPubKey']['addresses'][0], tx["vout"][1]['scriptPubKey']['addresses'][0]] assert(multisig_addr_new in dest_addrs) assert(multisig_addr_old not in dest_addrs) # Spend from the new multisig address addr4 = self.nodes[1].getnewaddress() txid = self.nodes[0].sendfrom("multisigaccount2", addr4, 0.8) block = self.nodes[0].generate(2) self.sync_all() assert(self.nodes[0].getbalance("multisigaccount2", 1) < 0.2) assert(self.nodes[1].listtransactions()[-1]['address'] == addr4) if __name__ == '__main__': ScriptAddress2Test().main()
true
true
f7264187ecb771c3ebeca5e866aa88ceae28828f
1,923
py
Python
src/tfchain/polyfill/encoding/ipaddr.py
GlenDC/threefold-wallet-electron
440662a793d98781eb3bbf415ba8a482abed0288
[ "MIT" ]
null
null
null
src/tfchain/polyfill/encoding/ipaddr.py
GlenDC/threefold-wallet-electron
440662a793d98781eb3bbf415ba8a482abed0288
[ "MIT" ]
201
2019-05-20T15:06:05.000Z
2019-07-16T12:48:59.000Z
src/tfchain/polyfill/encoding/ipaddr.py
GlenDC/threefold-wallet-electron
440662a793d98781eb3bbf415ba8a482abed0288
[ "MIT" ]
1
2019-12-20T21:45:39.000Z
2019-12-20T21:45:39.000Z
from tfchain.polyfill.encoding.jsmods.ipaddrjs import api as ipaddrjs import tfchain.polyfill.array as jsarr class IPAddress: def __init__(self, value): if isinstance(value, str): v = None err = None __pragma__("js", "{}", """ try { v = ipaddrjs.parse(value); } catch(e) { err = e; } """) if err != None: raise ValueError("invalid str value {}: {}".format(value, err)) self._value = v elif isinstance(value, (bytes, bytearray)) or jsarr.is_uint8_array(value): v = None err = None __pragma__("js", "{}", """ try { v = ipaddrjs.fromByteArray(value); } catch(e) { err = e; } """) if err != None: raise ValueError("invalid raw value {}: {}".format(value, err)) self._value = v elif isinstance(value, IPAddress): self._value = value.value else: raise TypeError("value {} of type {} is not supported as an IPAddress".format(value, type(value))) @property def value(self): return self._value def is_ipv4(self): result = None v = self._value __pragma__("js", "{}", """ result = v.constructor === ipaddrjs.IPv4; """) return result def is_ipv6(self): result = None v = self._value __pragma__("js", "{}", """ result = v.constructor === ipaddrjs.IPv6; """) return result def __str__(self): return self._value.toString() def str(self): return self.__str__() def bytes(self): v = self._value __pragma__("js", "{}", """ v = new Uint8Array(v.toByteArray()); """) return v
27.869565
110
0.481019
from tfchain.polyfill.encoding.jsmods.ipaddrjs import api as ipaddrjs import tfchain.polyfill.array as jsarr class IPAddress: def __init__(self, value): if isinstance(value, str): v = None err = None __pragma__("js", "{}", """ try { v = ipaddrjs.parse(value); } catch(e) { err = e; } """) if err != None: raise ValueError("invalid str value {}: {}".format(value, err)) self._value = v elif isinstance(value, (bytes, bytearray)) or jsarr.is_uint8_array(value): v = None err = None __pragma__("js", "{}", """ try { v = ipaddrjs.fromByteArray(value); } catch(e) { err = e; } """) if err != None: raise ValueError("invalid raw value {}: {}".format(value, err)) self._value = v elif isinstance(value, IPAddress): self._value = value.value else: raise TypeError("value {} of type {} is not supported as an IPAddress".format(value, type(value))) @property def value(self): return self._value def is_ipv4(self): result = None v = self._value __pragma__("js", "{}", """ result = v.constructor === ipaddrjs.IPv4; """) return result def is_ipv6(self): result = None v = self._value __pragma__("js", "{}", """ result = v.constructor === ipaddrjs.IPv6; """) return result def __str__(self): return self._value.toString() def str(self): return self.__str__() def bytes(self): v = self._value __pragma__("js", "{}", """ v = new Uint8Array(v.toByteArray()); """) return v
true
true
f7264223ea3b2e4a8450d6eba91beec89e57b290
15,290
py
Python
tensorflow/network.py
EricPedley/FCRN-DepthPrediction
93aaed329e9e071c6d5c5a59e77a73a09684b156
[ "BSD-2-Clause" ]
null
null
null
tensorflow/network.py
EricPedley/FCRN-DepthPrediction
93aaed329e9e071c6d5c5a59e77a73a09684b156
[ "BSD-2-Clause" ]
null
null
null
tensorflow/network.py
EricPedley/FCRN-DepthPrediction
93aaed329e9e071c6d5c5a59e77a73a09684b156
[ "BSD-2-Clause" ]
null
null
null
import numpy as np import tensorflow.compat.v1 as tf tf.disable_v2_behavior() # ---------------------------------------------------------------------------------- # Commonly used layers and operations based on ethereon's implementation # https://github.com/ethereon/caffe-tensorflow # Slight modifications may apply. FCRN-specific operations have also been appended. # ---------------------------------------------------------------------------------- # Thanks to *Helisa Dhamo* for the model conversion and integration into TensorFlow. # ---------------------------------------------------------------------------------- DEFAULT_PADDING = 'SAME' def get_incoming_shape(incoming): """ Returns the incoming data shape """ if isinstance(incoming, tf.Tensor): return incoming.get_shape().as_list() elif type(incoming) in [np.array, list, tuple]: return np.shape(incoming) else: raise Exception("Invalid incoming layer.") def interleave(tensors, axis): old_shape = get_incoming_shape(tensors[0])[1:] new_shape = [-1] + old_shape new_shape[axis] *= len(tensors) return tf.reshape(tf.stack(tensors, axis + 1), new_shape) def layer(op): '''Decorator for composable network layers.''' def layer_decorated(self, *args, **kwargs): # Automatically set a name if not provided. name = kwargs.setdefault('name', self.get_unique_name(op.__name__)) # Figure out the layer inputs. if len(self.terminals) == 0: raise RuntimeError('No input variables found for layer %s.' % name) elif len(self.terminals) == 1: layer_input = self.terminals[0] else: layer_input = list(self.terminals) # Perform the operation and get the output. layer_output = op(self, layer_input, *args, **kwargs) # Add to layer LUT. self.layers[name] = layer_output # This output is now the input for the next layer. self.feed(layer_output) # Return self for chained calls. return self return layer_decorated class Network(object): def __init__(self, inputs, batch, keep_prob, is_training, trainable = True): # The input nodes for this network self.inputs = inputs # The current list of terminal nodes self.terminals = [] # Mapping from layer names to layers self.layers = dict(inputs) # If true, the resulting variables are set as trainable self.trainable = trainable self.batch_size = batch self.keep_prob = keep_prob self.is_training = is_training self.setup() def setup(self): '''Construct the network. ''' raise NotImplementedError('Must be implemented by the subclass.') def load(self, data_path, session, ignore_missing=False): '''Load network weights. data_path: The path to the numpy-serialized network weights session: The current TensorFlow session ignore_missing: If true, serialized weights for missing layers are ignored. ''' data_dict = np.load(data_path, encoding='latin1').item() for op_name in data_dict: with tf.variable_scope(op_name, reuse=True): for param_name, data in iter(data_dict[op_name].items()): try: var = tf.get_variable(param_name) session.run(var.assign(data)) except ValueError: if not ignore_missing: raise def feed(self, *args): '''Set the input(s) for the next operation by replacing the terminal nodes. The arguments can be either layer names or the actual layers. ''' assert len(args) != 0 self.terminals = [] for fed_layer in args: if isinstance(fed_layer, str): try: fed_layer = self.layers[fed_layer] except KeyError: raise KeyError('Unknown layer name fed: %s' % fed_layer) self.terminals.append(fed_layer) return self def get_output(self): '''Returns the current network output.''' return self.terminals[-1] def get_layer_output(self, name): return self.layers[name] def get_unique_name(self, prefix): '''Returns an index-suffixed unique name for the given prefix. This is used for auto-generating layer names based on the type-prefix. ''' ident = sum(t.startswith(prefix) for t, _ in self.layers.items()) + 1 return '%s_%d' % (prefix, ident) def make_var(self, name, shape): '''Creates a new TensorFlow variable.''' return tf.get_variable(name, shape, dtype = 'float32', trainable=self.trainable) def validate_padding(self, padding): '''Verifies that the padding is one of the supported ones.''' assert padding in ('SAME', 'VALID') @layer def conv(self, input_data, k_h, k_w, c_o, s_h, s_w, name, relu=True, padding=DEFAULT_PADDING, group=1, biased=True): # Verify that the padding is acceptable self.validate_padding(padding) # Get the number of channels in the input c_i = input_data.get_shape()[-1] if (padding == 'SAME'): input_data = tf.pad(input_data, [[0, 0], [(k_h - 1)//2, (k_h - 1)//2], [(k_w - 1)//2, (k_w - 1)//2], [0, 0]], "CONSTANT") # Verify that the grouping parameter is valid assert c_i % group == 0 assert c_o % group == 0 # Convolution for a given input and kernel convolve = lambda i, k: tf.nn.conv2d(i, k, [1, s_h, s_w, 1], padding='VALID') with tf.variable_scope(name) as scope: kernel = self.make_var('weights', shape=[k_h, k_w, c_i // group, c_o]) if group == 1: # This is the common-case. Convolve the input without any further complications. output = convolve(input_data, kernel) else: # Split the input into groups and then convolve each of them independently input_groups = tf.split(3, group, input_data) kernel_groups = tf.split(3, group, kernel) output_groups = [convolve(i, k) for i, k in zip(input_groups, kernel_groups)] # Concatenate the groups output = tf.concat(3, output_groups) # Add the biases if biased: biases = self.make_var('biases', [c_o]) output = tf.nn.bias_add(output, biases) if relu: # ReLU non-linearity output = tf.nn.relu(output, name=scope.name) return output @layer def relu(self, input_data, name): return tf.nn.relu(input_data, name=name) @layer def max_pool(self, input_data, k_h, k_w, s_h, s_w, name, padding=DEFAULT_PADDING): self.validate_padding(padding) return tf.nn.max_pool(input_data, ksize=[1, k_h, k_w, 1], strides=[1, s_h, s_w, 1], padding=padding, name=name) @layer def avg_pool(self, input_data, k_h, k_w, s_h, s_w, name, padding=DEFAULT_PADDING): self.validate_padding(padding) return tf.nn.avg_pool(input_data, ksize=[1, k_h, k_w, 1], strides=[1, s_h, s_w, 1], padding=padding, name=name) @layer def lrn(self, input_data, radius, alpha, beta, name, bias=1.0): return tf.nn.local_response_normalization(input_data, depth_radius=radius, alpha=alpha, beta=beta, bias=bias, name=name) @layer def concat(self, inputs, axis, name): return tf.concat(concat_dim=axis, values=inputs, name=name) @layer def add(self, inputs, name): return tf.add_n(inputs, name=name) @layer def fc(self, input_data, num_out, name, relu=True): with tf.variable_scope(name) as scope: input_shape = input_data.get_shape() if input_shape.ndims == 4: # The input is spatial. Vectorize it first. dim = 1 for d in input_shape[1:].as_list(): dim *= d feed_in = tf.reshape(input_data, [-1, dim]) else: feed_in, dim = (input_data, input_shape[-1].value) weights = self.make_var('weights', shape=[dim, num_out]) biases = self.make_var('biases', [num_out]) op = tf.nn.relu_layer if relu else tf.nn.xw_plus_b fc = op(feed_in, weights, biases, name=scope.name) return fc @layer def softmax(self, input_data, name): input_shape = map(lambda v: v.value, input_data.get_shape()) if len(input_shape) > 2: # For certain models (like NiN), the singleton spatial dimensions # need to be explicitly squeezed, since they're not broadcast-able # in TensorFlow's NHWC ordering (unlike Caffe's NCHW). if input_shape[1] == 1 and input_shape[2] == 1: input_data = tf.squeeze(input_data, squeeze_dims=[1, 2]) else: raise ValueError('Rank 2 tensor input expected for softmax!') return tf.nn.softmax(input_data, name) @layer def batch_normalization(self, input_data, name, scale_offset=True, relu=False): with tf.variable_scope(name) as scope: shape = [input_data.get_shape()[-1]] pop_mean = tf.get_variable("mean", shape, initializer = tf.constant_initializer(0.0), trainable=False) pop_var = tf.get_variable("variance", shape, initializer = tf.constant_initializer(1.0), trainable=False) epsilon = 1e-4 decay = 0.999 if scale_offset: scale = tf.get_variable("scale", shape, initializer = tf.constant_initializer(1.0)) offset = tf.get_variable("offset", shape, initializer = tf.constant_initializer(0.0)) else: scale, offset = (None, None) if self.is_training: batch_mean, batch_var = tf.nn.moments(input_data, [0, 1, 2]) train_mean = tf.assign(pop_mean, pop_mean * decay + batch_mean * (1 - decay)) train_var = tf.assign(pop_var, pop_var * decay + batch_var * (1 - decay)) with tf.control_dependencies([train_mean, train_var]): output = tf.nn.batch_normalization(input_data, batch_mean, batch_var, offset, scale, epsilon, name = name) else: output = tf.nn.batch_normalization(input_data, pop_mean, pop_var, offset, scale, epsilon, name = name) if relu: output = tf.nn.relu(output) return output @layer def dropout(self, input_data, keep_prob, name): return tf.nn.dropout(input_data, keep_prob, name=name) def unpool_as_conv(self, size, input_data, id, stride = 1, ReLU = False, BN = True): # Model upconvolutions (unpooling + convolution) as interleaving feature # maps of four convolutions (A,B,C,D). Building block for up-projections. # Convolution A (3x3) # -------------------------------------------------- layerName = "layer%s_ConvA" % (id) self.feed(input_data) self.conv( 3, 3, size[3], stride, stride, name = layerName, padding = 'SAME', relu = False) outputA = self.get_output() # Convolution B (2x3) # -------------------------------------------------- layerName = "layer%s_ConvB" % (id) padded_input_B = tf.pad(input_data, [[0, 0], [1, 0], [1, 1], [0, 0]], "CONSTANT") self.feed(padded_input_B) self.conv(2, 3, size[3], stride, stride, name = layerName, padding = 'VALID', relu = False) outputB = self.get_output() # Convolution C (3x2) # -------------------------------------------------- layerName = "layer%s_ConvC" % (id) padded_input_C = tf.pad(input_data, [[0, 0], [1, 1], [1, 0], [0, 0]], "CONSTANT") self.feed(padded_input_C) self.conv(3, 2, size[3], stride, stride, name = layerName, padding = 'VALID', relu = False) outputC = self.get_output() # Convolution D (2x2) # -------------------------------------------------- layerName = "layer%s_ConvD" % (id) padded_input_D = tf.pad(input_data, [[0, 0], [1, 0], [1, 0], [0, 0]], "CONSTANT") self.feed(padded_input_D) self.conv(2, 2, size[3], stride, stride, name = layerName, padding = 'VALID', relu = False) outputD = self.get_output() # Interleaving elements of the four feature maps # -------------------------------------------------- left = interleave([outputA, outputB], axis=1) # columns right = interleave([outputC, outputD], axis=1) # columns Y = interleave([left, right], axis=2) # rows if BN: layerName = "layer%s_BN" % (id) self.feed(Y) self.batch_normalization(name = layerName, scale_offset = True, relu = False) Y = self.get_output() if ReLU: Y = tf.nn.relu(Y, name = layerName) return Y def up_project(self, size, id, stride = 1, BN = True): # Create residual upsampling layer (UpProjection) input_data = self.get_output() # Branch 1 id_br1 = "%s_br1" % (id) # Interleaving Convs of 1st branch out = self.unpool_as_conv(size, input_data, id_br1, stride, ReLU=True, BN=True) # Convolution following the upProjection on the 1st branch layerName = "layer%s_Conv" % (id) self.feed(out) self.conv(size[0], size[1], size[3], stride, stride, name = layerName, relu = False) if BN: layerName = "layer%s_BN" % (id) self.batch_normalization(name = layerName, scale_offset=True, relu = False) # Output of 1st branch branch1_output = self.get_output() # Branch 2 id_br2 = "%s_br2" % (id) # Interleaving convolutions and output of 2nd branch branch2_output = self.unpool_as_conv(size, input_data, id_br2, stride, ReLU=False) # sum branches layerName = "layer%s_Sum" % (id) output = tf.add_n([branch1_output, branch2_output], name = layerName) # ReLU layerName = "layer%s_ReLU" % (id) output = tf.nn.relu(output, name=layerName) self.feed(output) return self
39.205128
133
0.548136
import numpy as np import tensorflow.compat.v1 as tf tf.disable_v2_behavior() # https://github.com/ethereon/caffe-tensorflow # Slight modifications may apply. FCRN-specific operations have also been appended. # ---------------------------------------------------------------------------------- # Thanks to *Helisa Dhamo* for the model conversion and integration into TensorFlow. # ---------------------------------------------------------------------------------- DEFAULT_PADDING = 'SAME' def get_incoming_shape(incoming): if isinstance(incoming, tf.Tensor): return incoming.get_shape().as_list() elif type(incoming) in [np.array, list, tuple]: return np.shape(incoming) else: raise Exception("Invalid incoming layer.") def interleave(tensors, axis): old_shape = get_incoming_shape(tensors[0])[1:] new_shape = [-1] + old_shape new_shape[axis] *= len(tensors) return tf.reshape(tf.stack(tensors, axis + 1), new_shape) def layer(op): def layer_decorated(self, *args, **kwargs): # Automatically set a name if not provided. name = kwargs.setdefault('name', self.get_unique_name(op.__name__)) # Figure out the layer inputs. if len(self.terminals) == 0: raise RuntimeError('No input variables found for layer %s.' % name) elif len(self.terminals) == 1: layer_input = self.terminals[0] else: layer_input = list(self.terminals) # Perform the operation and get the output. layer_output = op(self, layer_input, *args, **kwargs) # Add to layer LUT. self.layers[name] = layer_output # This output is now the input for the next layer. self.feed(layer_output) # Return self for chained calls. return self return layer_decorated class Network(object): def __init__(self, inputs, batch, keep_prob, is_training, trainable = True): # The input nodes for this network self.inputs = inputs # The current list of terminal nodes self.terminals = [] # Mapping from layer names to layers self.layers = dict(inputs) # If true, the resulting variables are set as trainable self.trainable = trainable self.batch_size = batch self.keep_prob = keep_prob self.is_training = is_training self.setup() def setup(self): raise NotImplementedError('Must be implemented by the subclass.') def load(self, data_path, session, ignore_missing=False): data_dict = np.load(data_path, encoding='latin1').item() for op_name in data_dict: with tf.variable_scope(op_name, reuse=True): for param_name, data in iter(data_dict[op_name].items()): try: var = tf.get_variable(param_name) session.run(var.assign(data)) except ValueError: if not ignore_missing: raise def feed(self, *args): assert len(args) != 0 self.terminals = [] for fed_layer in args: if isinstance(fed_layer, str): try: fed_layer = self.layers[fed_layer] except KeyError: raise KeyError('Unknown layer name fed: %s' % fed_layer) self.terminals.append(fed_layer) return self def get_output(self): return self.terminals[-1] def get_layer_output(self, name): return self.layers[name] def get_unique_name(self, prefix): ident = sum(t.startswith(prefix) for t, _ in self.layers.items()) + 1 return '%s_%d' % (prefix, ident) def make_var(self, name, shape): return tf.get_variable(name, shape, dtype = 'float32', trainable=self.trainable) def validate_padding(self, padding): assert padding in ('SAME', 'VALID') @layer def conv(self, input_data, k_h, k_w, c_o, s_h, s_w, name, relu=True, padding=DEFAULT_PADDING, group=1, biased=True): # Verify that the padding is acceptable self.validate_padding(padding) # Get the number of channels in the input c_i = input_data.get_shape()[-1] if (padding == 'SAME'): input_data = tf.pad(input_data, [[0, 0], [(k_h - 1)//2, (k_h - 1)//2], [(k_w - 1)//2, (k_w - 1)//2], [0, 0]], "CONSTANT") # Verify that the grouping parameter is valid assert c_i % group == 0 assert c_o % group == 0 # Convolution for a given input and kernel convolve = lambda i, k: tf.nn.conv2d(i, k, [1, s_h, s_w, 1], padding='VALID') with tf.variable_scope(name) as scope: kernel = self.make_var('weights', shape=[k_h, k_w, c_i // group, c_o]) if group == 1: # This is the common-case. Convolve the input without any further complications. output = convolve(input_data, kernel) else: # Split the input into groups and then convolve each of them independently input_groups = tf.split(3, group, input_data) kernel_groups = tf.split(3, group, kernel) output_groups = [convolve(i, k) for i, k in zip(input_groups, kernel_groups)] # Concatenate the groups output = tf.concat(3, output_groups) # Add the biases if biased: biases = self.make_var('biases', [c_o]) output = tf.nn.bias_add(output, biases) if relu: # ReLU non-linearity output = tf.nn.relu(output, name=scope.name) return output @layer def relu(self, input_data, name): return tf.nn.relu(input_data, name=name) @layer def max_pool(self, input_data, k_h, k_w, s_h, s_w, name, padding=DEFAULT_PADDING): self.validate_padding(padding) return tf.nn.max_pool(input_data, ksize=[1, k_h, k_w, 1], strides=[1, s_h, s_w, 1], padding=padding, name=name) @layer def avg_pool(self, input_data, k_h, k_w, s_h, s_w, name, padding=DEFAULT_PADDING): self.validate_padding(padding) return tf.nn.avg_pool(input_data, ksize=[1, k_h, k_w, 1], strides=[1, s_h, s_w, 1], padding=padding, name=name) @layer def lrn(self, input_data, radius, alpha, beta, name, bias=1.0): return tf.nn.local_response_normalization(input_data, depth_radius=radius, alpha=alpha, beta=beta, bias=bias, name=name) @layer def concat(self, inputs, axis, name): return tf.concat(concat_dim=axis, values=inputs, name=name) @layer def add(self, inputs, name): return tf.add_n(inputs, name=name) @layer def fc(self, input_data, num_out, name, relu=True): with tf.variable_scope(name) as scope: input_shape = input_data.get_shape() if input_shape.ndims == 4: # The input is spatial. Vectorize it first. dim = 1 for d in input_shape[1:].as_list(): dim *= d feed_in = tf.reshape(input_data, [-1, dim]) else: feed_in, dim = (input_data, input_shape[-1].value) weights = self.make_var('weights', shape=[dim, num_out]) biases = self.make_var('biases', [num_out]) op = tf.nn.relu_layer if relu else tf.nn.xw_plus_b fc = op(feed_in, weights, biases, name=scope.name) return fc @layer def softmax(self, input_data, name): input_shape = map(lambda v: v.value, input_data.get_shape()) if len(input_shape) > 2: # For certain models (like NiN), the singleton spatial dimensions # need to be explicitly squeezed, since they're not broadcast-able if input_shape[1] == 1 and input_shape[2] == 1: input_data = tf.squeeze(input_data, squeeze_dims=[1, 2]) else: raise ValueError('Rank 2 tensor input expected for softmax!') return tf.nn.softmax(input_data, name) @layer def batch_normalization(self, input_data, name, scale_offset=True, relu=False): with tf.variable_scope(name) as scope: shape = [input_data.get_shape()[-1]] pop_mean = tf.get_variable("mean", shape, initializer = tf.constant_initializer(0.0), trainable=False) pop_var = tf.get_variable("variance", shape, initializer = tf.constant_initializer(1.0), trainable=False) epsilon = 1e-4 decay = 0.999 if scale_offset: scale = tf.get_variable("scale", shape, initializer = tf.constant_initializer(1.0)) offset = tf.get_variable("offset", shape, initializer = tf.constant_initializer(0.0)) else: scale, offset = (None, None) if self.is_training: batch_mean, batch_var = tf.nn.moments(input_data, [0, 1, 2]) train_mean = tf.assign(pop_mean, pop_mean * decay + batch_mean * (1 - decay)) train_var = tf.assign(pop_var, pop_var * decay + batch_var * (1 - decay)) with tf.control_dependencies([train_mean, train_var]): output = tf.nn.batch_normalization(input_data, batch_mean, batch_var, offset, scale, epsilon, name = name) else: output = tf.nn.batch_normalization(input_data, pop_mean, pop_var, offset, scale, epsilon, name = name) if relu: output = tf.nn.relu(output) return output @layer def dropout(self, input_data, keep_prob, name): return tf.nn.dropout(input_data, keep_prob, name=name) def unpool_as_conv(self, size, input_data, id, stride = 1, ReLU = False, BN = True): layerName = "layer%s_ConvA" % (id) self.feed(input_data) self.conv( 3, 3, size[3], stride, stride, name = layerName, padding = 'SAME', relu = False) outputA = self.get_output() layerName = "layer%s_ConvB" % (id) padded_input_B = tf.pad(input_data, [[0, 0], [1, 0], [1, 1], [0, 0]], "CONSTANT") self.feed(padded_input_B) self.conv(2, 3, size[3], stride, stride, name = layerName, padding = 'VALID', relu = False) outputB = self.get_output() layerName = "layer%s_ConvC" % (id) padded_input_C = tf.pad(input_data, [[0, 0], [1, 1], [1, 0], [0, 0]], "CONSTANT") self.feed(padded_input_C) self.conv(3, 2, size[3], stride, stride, name = layerName, padding = 'VALID', relu = False) outputC = self.get_output() layerName = "layer%s_ConvD" % (id) padded_input_D = tf.pad(input_data, [[0, 0], [1, 0], [1, 0], [0, 0]], "CONSTANT") self.feed(padded_input_D) self.conv(2, 2, size[3], stride, stride, name = layerName, padding = 'VALID', relu = False) outputD = self.get_output() left = interleave([outputA, outputB], axis=1) right = interleave([outputC, outputD], axis=1) Y = interleave([left, right], axis=2) if BN: layerName = "layer%s_BN" % (id) self.feed(Y) self.batch_normalization(name = layerName, scale_offset = True, relu = False) Y = self.get_output() if ReLU: Y = tf.nn.relu(Y, name = layerName) return Y def up_project(self, size, id, stride = 1, BN = True): input_data = self.get_output() id_br1 = "%s_br1" % (id) out = self.unpool_as_conv(size, input_data, id_br1, stride, ReLU=True, BN=True) layerName = "layer%s_Conv" % (id) self.feed(out) self.conv(size[0], size[1], size[3], stride, stride, name = layerName, relu = False) if BN: layerName = "layer%s_BN" % (id) self.batch_normalization(name = layerName, scale_offset=True, relu = False) branch1_output = self.get_output() id_br2 = "%s_br2" % (id) branch2_output = self.unpool_as_conv(size, input_data, id_br2, stride, ReLU=False) layerName = "layer%s_Sum" % (id) output = tf.add_n([branch1_output, branch2_output], name = layerName) layerName = "layer%s_ReLU" % (id) output = tf.nn.relu(output, name=layerName) self.feed(output) return self
true
true
f726433b3c15d6223a75c1dacfab5a53d9b7791b
350
py
Python
app/__init__.py
ppyvras/flask_tutorial
2c73d32c33fb80ef59bee8753500220afdd91cee
[ "MIT" ]
null
null
null
app/__init__.py
ppyvras/flask_tutorial
2c73d32c33fb80ef59bee8753500220afdd91cee
[ "MIT" ]
null
null
null
app/__init__.py
ppyvras/flask_tutorial
2c73d32c33fb80ef59bee8753500220afdd91cee
[ "MIT" ]
null
null
null
from flask import Flask from config import Config from flask_sqlalchemy import SQLAlchemy from flask_migrate import Migrate from flask_login import LoginManager app = Flask(__name__) app.config.from_object(Config) db = SQLAlchemy(app) migrate = Migrate(app, db) login = LoginManager(app) login.login_view = 'login' from app import routes, models
20.588235
39
0.805714
from flask import Flask from config import Config from flask_sqlalchemy import SQLAlchemy from flask_migrate import Migrate from flask_login import LoginManager app = Flask(__name__) app.config.from_object(Config) db = SQLAlchemy(app) migrate = Migrate(app, db) login = LoginManager(app) login.login_view = 'login' from app import routes, models
true
true
f7264465fb955d98f2220ac0a57a91bd63fff024
1,331
py
Python
xlsxwriter/test/comparison/test_cond_format06.py
eddiechapman/XlsxWriter
c636117ab30e64e4b7b824c9105595c42887c2c9
[ "BSD-2-Clause-FreeBSD" ]
2,766
2015-01-02T17:36:42.000Z
2022-03-31T09:23:30.000Z
xlsxwriter/test/comparison/test_cond_format06.py
xiaolanmeng86/XlsxWriter
6c3ea23a410e8216eab8f5751e5544ffb444b3da
[ "BSD-2-Clause-FreeBSD" ]
683
2015-01-03T09:55:02.000Z
2022-03-31T07:18:15.000Z
xlsxwriter/test/comparison/test_cond_format06.py
xiaolanmeng86/XlsxWriter
6c3ea23a410e8216eab8f5751e5544ffb444b3da
[ "BSD-2-Clause-FreeBSD" ]
636
2015-01-05T01:57:08.000Z
2022-03-25T18:42:41.000Z
############################################################################### # # Tests for XlsxWriter. # # Copyright (c), 2013-2021, John McNamara, jmcnamara@cpan.org # from ..excel_comparison_test import ExcelComparisonTest from ...workbook import Workbook class TestCompareXLSXFiles(ExcelComparisonTest): """ Test file created by XlsxWriter against a file created by Excel. """ def setUp(self): self.set_filename('cond_format06.xlsx') def test_create_file(self): """Test the creation of a simple XlsxWriter file with conditional formatting.""" workbook = Workbook(self.got_filename) worksheet = workbook.add_worksheet() format1 = workbook.add_format({ 'pattern': 15, 'fg_color': '#FF0000', 'bg_color': '#FFFF00' }) worksheet.write('A1', 10) worksheet.write('A2', 20) worksheet.write('A3', 30) worksheet.write('A4', 40) worksheet.conditional_format('A1', {'type': 'cell', 'format': format1, 'criteria': '>', 'value': 7, }) workbook.close() self.assertExcelEqual()
26.62
88
0.496619
true
true
f7264528198aeeae3d454c3855027f09c988ee7a
1,793
py
Python
_unittests/ut_special/test_tsp_kohonen.py
mohamedelkansouli/Ensae_py
8bc867bd2081c259c793fadfa8be5dcc7bd1400b
[ "MIT" ]
null
null
null
_unittests/ut_special/test_tsp_kohonen.py
mohamedelkansouli/Ensae_py
8bc867bd2081c259c793fadfa8be5dcc7bd1400b
[ "MIT" ]
null
null
null
_unittests/ut_special/test_tsp_kohonen.py
mohamedelkansouli/Ensae_py
8bc867bd2081c259c793fadfa8be5dcc7bd1400b
[ "MIT" ]
null
null
null
""" @brief test log(time=10s) """ import os import sys import unittest from pyquickhelper.loghelper import fLOG from pyquickhelper.pycode import get_temp_folder, is_travis_or_appveyor try: import src except ImportError: path = os.path.normpath( os.path.abspath( os.path.join( os.path.split(__file__)[0], "..", ".."))) if path not in sys.path: sys.path.append(path) import src from src.ensae_teaching_cs.special.tsp_kohonen import pygame_simulation from src.ensae_teaching_cs.helpers.video_helper import make_video class TestTspKohonen(unittest.TestCase): def test_image_video_kohonen(self): fLOG( __file__, self._testMethodName, OutputPrint=__name__ == "__main__") temp = get_temp_folder(__file__, "temp_image_video_tsp_kohonen") if is_travis_or_appveyor() in ("travis",): # pygame.error: No available video device return import pygame if is_travis_or_appveyor() == "circleci": # os.environ["SDL_VIDEODRIVER"] = "x11" flags = pygame.NOFRAME else: flags = 0 pygame_simulation(pygame, fLOG=fLOG, folder=temp, nb=200 if __name__ == "__main__" else 20, size=(400, 250), flags=flags) files = os.listdir(temp) assert len(files) > 9 png = [os.path.join(temp, _) for _ in files if os.path.splitext(_)[-1] == ".png"] assert len(png) > 0 out = os.path.join(temp, "tsp_kohonen.avi") v = make_video(png, out, size=(200, 125), format="XVID", fps=20) assert v is not None if __name__ == "__main__": unittest.main()
28.015625
72
0.591746
import os import sys import unittest from pyquickhelper.loghelper import fLOG from pyquickhelper.pycode import get_temp_folder, is_travis_or_appveyor try: import src except ImportError: path = os.path.normpath( os.path.abspath( os.path.join( os.path.split(__file__)[0], "..", ".."))) if path not in sys.path: sys.path.append(path) import src from src.ensae_teaching_cs.special.tsp_kohonen import pygame_simulation from src.ensae_teaching_cs.helpers.video_helper import make_video class TestTspKohonen(unittest.TestCase): def test_image_video_kohonen(self): fLOG( __file__, self._testMethodName, OutputPrint=__name__ == "__main__") temp = get_temp_folder(__file__, "temp_image_video_tsp_kohonen") if is_travis_or_appveyor() in ("travis",): return import pygame if is_travis_or_appveyor() == "circleci": flags = pygame.NOFRAME else: flags = 0 pygame_simulation(pygame, fLOG=fLOG, folder=temp, nb=200 if __name__ == "__main__" else 20, size=(400, 250), flags=flags) files = os.listdir(temp) assert len(files) > 9 png = [os.path.join(temp, _) for _ in files if os.path.splitext(_)[-1] == ".png"] assert len(png) > 0 out = os.path.join(temp, "tsp_kohonen.avi") v = make_video(png, out, size=(200, 125), format="XVID", fps=20) assert v is not None if __name__ == "__main__": unittest.main()
true
true
f7264580ec84ba5145f46f58d0d1265932dadf9b
3,505
py
Python
parler/tests/test_query_count.py
Yiling-J/django-parler
23b8ae3348c05d4dded729389cc8129cd03d8c5d
[ "Apache-2.0" ]
1
2020-01-25T05:23:00.000Z
2020-01-25T05:23:00.000Z
parler/tests/test_query_count.py
Yiling-J/django-parler
23b8ae3348c05d4dded729389cc8129cd03d8c5d
[ "Apache-2.0" ]
3
2019-11-02T05:52:07.000Z
2020-06-05T21:56:17.000Z
parler/tests/test_query_count.py
Yiling-J/django-parler
23b8ae3348c05d4dded729389cc8129cd03d8c5d
[ "Apache-2.0" ]
2
2019-06-10T21:45:05.000Z
2019-07-10T17:16:35.000Z
import datetime as dt from django.core.cache import cache from django.utils import translation from django.utils.timezone import now from parler import appsettings from .utils import AppTestCase, override_parler_settings from .testapp.models import SimpleModel, DateTimeModel class QueryCountTests(AppTestCase): """ Test model construction """ @classmethod def setUpClass(cls): super(QueryCountTests, cls).setUpClass() cls.country_list = ( 'Mexico', 'Monaco', 'Morocco', 'Netherlands', 'Norway', 'Poland', 'Portugal', 'Romania', 'Russia', 'South Africa', ) for country in cls.country_list: SimpleModel.objects.create(_current_language=cls.conf_fallback, tr_title=country) DateTimeModel.objects.create(_current_language=cls.conf_fallback, tr_title=country, datetime=now()) #def setUp(self): # cache.clear() def assertNumTranslatedQueries(self, num, qs, language_code=None): # Use default language if available. if language_code is None: language_code = self.conf_fallback # Easier to understand then a oneline lambda # Using str(), not unicode() to be python 3 compatible. def test_qs(): for obj in qs: str(obj.tr_title) # Queryset is not set to a language, the individual models # will default to the currently active project language. with translation.override(language_code): self.assertNumQueries(num, test_qs) def test_uncached_queries(self): """ Test that uncached queries work, albeit slowly. """ with override_parler_settings(PARLER_ENABLE_CACHING=False): self.assertNumTranslatedQueries(1 + len(self.country_list), SimpleModel.objects.all()) def test_iteration_with_non_qs_methods(self): """ Test QuerySet methods that do not return QuerySets of models. """ # We have at least one object created in setUpClass. obj = DateTimeModel.objects.all()[0] self.assertEqual( obj, DateTimeModel.objects.language(self.conf_fallback).all()[0]) # Test iteration through QuerySet of non-model objects. self.assertIsInstance( DateTimeModel.objects.language(self.conf_fallback).dates( 'datetime', 'day')[0], dt.date) def test_prefetch_queries(self): """ Test that .prefetch_related() works """ with override_parler_settings(PARLER_ENABLE_CACHING=False): self.assertNumTranslatedQueries(2, SimpleModel.objects.prefetch_related('translations')) def test_model_cache_queries(self): """ Test that the ``_translations_cache`` works. """ cache.clear() with override_parler_settings(PARLER_ENABLE_CACHING=False): qs = SimpleModel.objects.all() self.assertNumTranslatedQueries(1 + len(self.country_list), qs) self.assertNumTranslatedQueries(0, qs) # All should be cached on the QuerySet and object now. qs = SimpleModel.objects.prefetch_related('translations') self.assertNumTranslatedQueries(2, qs) self.assertNumTranslatedQueries(0, qs) # All should be cached on the QuerySet and object now.
34.029126
107
0.633666
import datetime as dt from django.core.cache import cache from django.utils import translation from django.utils.timezone import now from parler import appsettings from .utils import AppTestCase, override_parler_settings from .testapp.models import SimpleModel, DateTimeModel class QueryCountTests(AppTestCase): @classmethod def setUpClass(cls): super(QueryCountTests, cls).setUpClass() cls.country_list = ( 'Mexico', 'Monaco', 'Morocco', 'Netherlands', 'Norway', 'Poland', 'Portugal', 'Romania', 'Russia', 'South Africa', ) for country in cls.country_list: SimpleModel.objects.create(_current_language=cls.conf_fallback, tr_title=country) DateTimeModel.objects.create(_current_language=cls.conf_fallback, tr_title=country, datetime=now()) def assertNumTranslatedQueries(self, num, qs, language_code=None): if language_code is None: language_code = self.conf_fallback def test_qs(): for obj in qs: str(obj.tr_title) with translation.override(language_code): self.assertNumQueries(num, test_qs) def test_uncached_queries(self): with override_parler_settings(PARLER_ENABLE_CACHING=False): self.assertNumTranslatedQueries(1 + len(self.country_list), SimpleModel.objects.all()) def test_iteration_with_non_qs_methods(self): obj = DateTimeModel.objects.all()[0] self.assertEqual( obj, DateTimeModel.objects.language(self.conf_fallback).all()[0]) self.assertIsInstance( DateTimeModel.objects.language(self.conf_fallback).dates( 'datetime', 'day')[0], dt.date) def test_prefetch_queries(self): with override_parler_settings(PARLER_ENABLE_CACHING=False): self.assertNumTranslatedQueries(2, SimpleModel.objects.prefetch_related('translations')) def test_model_cache_queries(self): cache.clear() with override_parler_settings(PARLER_ENABLE_CACHING=False): qs = SimpleModel.objects.all() self.assertNumTranslatedQueries(1 + len(self.country_list), qs) self.assertNumTranslatedQueries(0, qs) qs = SimpleModel.objects.prefetch_related('translations') self.assertNumTranslatedQueries(2, qs) self.assertNumTranslatedQueries(0, qs)
true
true
f72645db2eb553529b0393f9bc851543b325fd14
3,880
py
Python
webots_ros2_universal_robot/webots_ros2_universal_robot/follow_joint_trajectory_client.py
TaoYibo1866/webots_ros2
a72c164825663cebbfd27e0649ea51d3abf9bbed
[ "Apache-2.0" ]
null
null
null
webots_ros2_universal_robot/webots_ros2_universal_robot/follow_joint_trajectory_client.py
TaoYibo1866/webots_ros2
a72c164825663cebbfd27e0649ea51d3abf9bbed
[ "Apache-2.0" ]
6
2019-08-09T08:04:37.000Z
2019-08-14T15:05:35.000Z
webots_ros2_universal_robot/webots_ros2_universal_robot/follow_joint_trajectory_client.py
omichel/webots_ros2
5b59d0b1fbeff4c3f75a447bd152c10853f4691b
[ "Apache-2.0" ]
null
null
null
# Copyright 1996-2021 Cyberbotics Ltd. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Generic client for the FollowJointTrajectory action used for multi-robot demonstration.""" from action_msgs.msg import GoalStatus from control_msgs.action import FollowJointTrajectory from control_msgs.msg import JointTrajectoryControllerState from trajectory_msgs.msg import JointTrajectoryPoint from builtin_interfaces.msg import Duration import rclpy from rclpy.action import ActionClient from rclpy.node import Node class FollowJointTrajectoryClient(Node): def __init__(self, name, prefix): super().__init__(name) self.__client = ActionClient(self, FollowJointTrajectory, prefix + '/follow_joint_trajectory') self.__state_subscriber = self.create_subscription( JointTrajectoryControllerState, prefix + '/state', self.__on_state_received, 1 ) self.__received_states_counter = 0 self.__remaining_iteration = 0 self.__current_trajectory = None self.__get_result_future = None self.__send_goal_future = None def __on_goal_response_callback(self, future): goal_handle = future.result() if not goal_handle.accepted: self.get_logger().info('Goal rejected by action server.') return self.get_logger().info('Goal accepted by action server.') self.__get_result_future = goal_handle.get_result_async() self.__get_result_future.add_done_callback(self.__on_get_result_callback) def __on_get_result_callback(self, future): status = future.result().status if status == GoalStatus.STATUS_SUCCEEDED: self.get_logger().info('Goal succeeded.') else: self.get_logger().info('Goal failed with status: {0}'.format(status)) if self.__remaining_iteration > 0: self.send_goal(self.__current_trajectory, self.__remaining_iteration - 1) else: rclpy.shutdown() def __on_state_received(self, _): self.__received_states_counter += 1 def send_goal(self, trajectory, iteration=1): self.get_logger().info('Waiting for action server to be ready...') self.__client.wait_for_server() # WORKAROUND: The `wait_for_server()` method reports the `joint_trajectory_controller` node is ready even though it # needs a bit more time to get ready to receive commands. while self.__received_states_counter < 1: rclpy.spin_once(self) self.__current_trajectory = trajectory self.__remaining_iteration = iteration - 1 goal_message = FollowJointTrajectory.Goal() goal_message.trajectory.joint_names = trajectory['joint_names'] for point in trajectory['points']: trajectory_point = JointTrajectoryPoint( positions=point['positions'], time_from_start=Duration( sec=point['time_from_start']['sec'], nanosec=point['time_from_start']['nanosec'] ) ) goal_message.trajectory.points.append(trajectory_point) self.get_logger().info('Sending goal request...') self.__send_goal_future = self.__client.send_goal_async( goal_message ) self.__send_goal_future.add_done_callback(self.__on_goal_response_callback)
40
123
0.698711
from action_msgs.msg import GoalStatus from control_msgs.action import FollowJointTrajectory from control_msgs.msg import JointTrajectoryControllerState from trajectory_msgs.msg import JointTrajectoryPoint from builtin_interfaces.msg import Duration import rclpy from rclpy.action import ActionClient from rclpy.node import Node class FollowJointTrajectoryClient(Node): def __init__(self, name, prefix): super().__init__(name) self.__client = ActionClient(self, FollowJointTrajectory, prefix + '/follow_joint_trajectory') self.__state_subscriber = self.create_subscription( JointTrajectoryControllerState, prefix + '/state', self.__on_state_received, 1 ) self.__received_states_counter = 0 self.__remaining_iteration = 0 self.__current_trajectory = None self.__get_result_future = None self.__send_goal_future = None def __on_goal_response_callback(self, future): goal_handle = future.result() if not goal_handle.accepted: self.get_logger().info('Goal rejected by action server.') return self.get_logger().info('Goal accepted by action server.') self.__get_result_future = goal_handle.get_result_async() self.__get_result_future.add_done_callback(self.__on_get_result_callback) def __on_get_result_callback(self, future): status = future.result().status if status == GoalStatus.STATUS_SUCCEEDED: self.get_logger().info('Goal succeeded.') else: self.get_logger().info('Goal failed with status: {0}'.format(status)) if self.__remaining_iteration > 0: self.send_goal(self.__current_trajectory, self.__remaining_iteration - 1) else: rclpy.shutdown() def __on_state_received(self, _): self.__received_states_counter += 1 def send_goal(self, trajectory, iteration=1): self.get_logger().info('Waiting for action server to be ready...') self.__client.wait_for_server() while self.__received_states_counter < 1: rclpy.spin_once(self) self.__current_trajectory = trajectory self.__remaining_iteration = iteration - 1 goal_message = FollowJointTrajectory.Goal() goal_message.trajectory.joint_names = trajectory['joint_names'] for point in trajectory['points']: trajectory_point = JointTrajectoryPoint( positions=point['positions'], time_from_start=Duration( sec=point['time_from_start']['sec'], nanosec=point['time_from_start']['nanosec'] ) ) goal_message.trajectory.points.append(trajectory_point) self.get_logger().info('Sending goal request...') self.__send_goal_future = self.__client.send_goal_async( goal_message ) self.__send_goal_future.add_done_callback(self.__on_goal_response_callback)
true
true
f726466b10a38e592d89b680d7031e520070c599
3,697
py
Python
packages/pytea/pytest/benchmarks/transformers/missing_idx/src/transformers/convert_xlnet_original_tf_checkpoint_to_pytorch.py
lego0901/pytea
8ede650def2e68f4610ba816451d8b9e28f09f76
[ "MIT" ]
12
2021-09-13T18:31:09.000Z
2022-03-31T12:10:28.000Z
packages/pytea/pytest/benchmarks/transformers/missing_idx/src/transformers/convert_xlnet_original_tf_checkpoint_to_pytorch.py
lego0901/pytea
8ede650def2e68f4610ba816451d8b9e28f09f76
[ "MIT" ]
5
2021-12-01T04:34:07.000Z
2022-01-28T08:28:18.000Z
packages/pytea/pytest/benchmarks/transformers/missing_idx/src/transformers/convert_xlnet_original_tf_checkpoint_to_pytorch.py
lego0901/pytea
8ede650def2e68f4610ba816451d8b9e28f09f76
[ "MIT" ]
3
2022-01-18T10:56:05.000Z
2022-01-28T01:46:43.000Z
# coding=utf-8 # Copyright 2018 The HuggingFace Inc. team. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Convert BERT checkpoint.""" import argparse import os import torch from transformers import ( CONFIG_NAME, WEIGHTS_NAME, XLNetConfig, XLNetForQuestionAnswering, XLNetForSequenceClassification, XLNetLMHeadModel, load_tf_weights_in_xlnet, ) from transformers.utils import logging GLUE_TASKS_NUM_LABELS = { "cola": 2, "mnli": 3, "mrpc": 2, "sst-2": 2, "sts-b": 1, "qqp": 2, "qnli": 2, "rte": 2, "wnli": 2, } logging.set_verbosity_info() def convert_xlnet_checkpoint_to_pytorch( tf_checkpoint_path, bert_config_file, pytorch_dump_folder_path, finetuning_task=None ): # Initialise PyTorch model config = XLNetConfig.from_json_file(bert_config_file) finetuning_task = finetuning_task.lower() if finetuning_task is not None else "" if finetuning_task in GLUE_TASKS_NUM_LABELS: print("Building PyTorch XLNetForSequenceClassification model from configuration: {}".format(str(config))) config.finetuning_task = finetuning_task config.num_labels = GLUE_TASKS_NUM_LABELS[finetuning_task] model = XLNetForSequenceClassification(config) elif "squad" in finetuning_task: config.finetuning_task = finetuning_task model = XLNetForQuestionAnswering(config) else: model = XLNetLMHeadModel(config) # Load weights from tf checkpoint load_tf_weights_in_xlnet(model, config, tf_checkpoint_path) # Save pytorch-model pytorch_weights_dump_path = os.path.join(pytorch_dump_folder_path, WEIGHTS_NAME) pytorch_config_dump_path = os.path.join(pytorch_dump_folder_path, CONFIG_NAME) print("Save PyTorch model to {}".format(os.path.abspath(pytorch_weights_dump_path))) torch.save(model.state_dict(), pytorch_weights_dump_path) print("Save configuration file to {}".format(os.path.abspath(pytorch_config_dump_path))) with open(pytorch_config_dump_path, "w", encoding="utf-8") as f: f.write(config.to_json_string()) if __name__ == "__main__": parser = argparse.ArgumentParser() # Required parameters parser.add_argument( "--tf_checkpoint_path", default=None, type=str, required=True, help="Path to the TensorFlow checkpoint path." ) parser.add_argument( "--xlnet_config_file", default=None, type=str, required=True, help="The config json file corresponding to the pre-trained XLNet model. \n" "This specifies the model architecture.", ) parser.add_argument( "--pytorch_dump_folder_path", default=None, type=str, required=True, help="Path to the folder to store the PyTorch model or dataset/vocab.", ) parser.add_argument( "--finetuning_task", default=None, type=str, help="Name of a task on which the XLNet TensorFlow model was fine-tuned", ) args = parser.parse_args() print(args) convert_xlnet_checkpoint_to_pytorch( args.tf_checkpoint_path, args.xlnet_config_file, args.pytorch_dump_folder_path, args.finetuning_task )
32.147826
117
0.712199
import argparse import os import torch from transformers import ( CONFIG_NAME, WEIGHTS_NAME, XLNetConfig, XLNetForQuestionAnswering, XLNetForSequenceClassification, XLNetLMHeadModel, load_tf_weights_in_xlnet, ) from transformers.utils import logging GLUE_TASKS_NUM_LABELS = { "cola": 2, "mnli": 3, "mrpc": 2, "sst-2": 2, "sts-b": 1, "qqp": 2, "qnli": 2, "rte": 2, "wnli": 2, } logging.set_verbosity_info() def convert_xlnet_checkpoint_to_pytorch( tf_checkpoint_path, bert_config_file, pytorch_dump_folder_path, finetuning_task=None ): config = XLNetConfig.from_json_file(bert_config_file) finetuning_task = finetuning_task.lower() if finetuning_task is not None else "" if finetuning_task in GLUE_TASKS_NUM_LABELS: print("Building PyTorch XLNetForSequenceClassification model from configuration: {}".format(str(config))) config.finetuning_task = finetuning_task config.num_labels = GLUE_TASKS_NUM_LABELS[finetuning_task] model = XLNetForSequenceClassification(config) elif "squad" in finetuning_task: config.finetuning_task = finetuning_task model = XLNetForQuestionAnswering(config) else: model = XLNetLMHeadModel(config) load_tf_weights_in_xlnet(model, config, tf_checkpoint_path) pytorch_weights_dump_path = os.path.join(pytorch_dump_folder_path, WEIGHTS_NAME) pytorch_config_dump_path = os.path.join(pytorch_dump_folder_path, CONFIG_NAME) print("Save PyTorch model to {}".format(os.path.abspath(pytorch_weights_dump_path))) torch.save(model.state_dict(), pytorch_weights_dump_path) print("Save configuration file to {}".format(os.path.abspath(pytorch_config_dump_path))) with open(pytorch_config_dump_path, "w", encoding="utf-8") as f: f.write(config.to_json_string()) if __name__ == "__main__": parser = argparse.ArgumentParser() parser.add_argument( "--tf_checkpoint_path", default=None, type=str, required=True, help="Path to the TensorFlow checkpoint path." ) parser.add_argument( "--xlnet_config_file", default=None, type=str, required=True, help="The config json file corresponding to the pre-trained XLNet model. \n" "This specifies the model architecture.", ) parser.add_argument( "--pytorch_dump_folder_path", default=None, type=str, required=True, help="Path to the folder to store the PyTorch model or dataset/vocab.", ) parser.add_argument( "--finetuning_task", default=None, type=str, help="Name of a task on which the XLNet TensorFlow model was fine-tuned", ) args = parser.parse_args() print(args) convert_xlnet_checkpoint_to_pytorch( args.tf_checkpoint_path, args.xlnet_config_file, args.pytorch_dump_folder_path, args.finetuning_task )
true
true
f72646ac93dd6fd9d9c8c4a8152f818f740a9035
2,689
py
Python
tests/test_parsers.py
tos-kamiya/d2vg
72ce1cb900a219f9d7bc3982e234a4498be52d5a
[ "BSD-2-Clause" ]
3
2021-11-17T08:07:50.000Z
2021-12-19T04:35:15.000Z
tests/test_parsers.py
tos-kamiya/d2vg
72ce1cb900a219f9d7bc3982e234a4498be52d5a
[ "BSD-2-Clause" ]
null
null
null
tests/test_parsers.py
tos-kamiya/d2vg
72ce1cb900a219f9d7bc3982e234a4498be52d5a
[ "BSD-2-Clause" ]
null
null
null
import unittest from pathlib import Path import re import tempfile import d2vg class ParserTest(unittest.TestCase): def test_text_file(self): with tempfile.TemporaryDirectory() as tempdir: p = Path(tempdir) / "a.txt" content = "1st line.\n2nd line.\n" p.write_text(content) read_content = d2vg.parsers.read_text_file(str(p)) self.assertEqual(read_content, content) def test_html_file(self): with tempfile.TemporaryDirectory() as tempdir: p = Path(tempdir) / "a.html" content = """<!DOCTYPE html> <html> <body> <p>1st paragraph.</p> <p>2nd paragraph.</p> </body> </html>""" p.write_text(content) read_content = d2vg.parsers.html_parse(str(p)) read_content = re.sub(r"\n+", r"\n", read_content).rstrip() self.assertEqual(read_content, "html\n1st paragraph.\n2nd paragraph.") def test_pdf_file(self): from borb.pdf.canvas.layout.page_layout.multi_column_layout import ( SingleColumnLayout, ) from borb.pdf.canvas.layout.text.paragraph import Paragraph from borb.pdf.document import Document from borb.pdf.page.page import Page from borb.pdf.pdf import PDF with tempfile.TemporaryDirectory() as tempdir: p = Path(tempdir) / "a.pdf" pdf = Document() page = Page() pdf.append_page(page) layout = SingleColumnLayout(page) layout.add(Paragraph("1st paragraph.")) layout.add(Paragraph("2nd paragraph.")) with open(p, "wb") as pdf_file_handle: PDF.dumps(pdf_file_handle, pdf) read_content = d2vg.parsers.pdf_parse(str(p)) read_content = re.sub(r"\n+", r"\n", read_content).rstrip() self.assertEqual(read_content, "1st paragraph.\n2nd paragraph.") # !! not working !! ref: https://stackoverflow.com/questions/58186869/how-to-fix-the-bug-modulenotfounderror-no-module-named-exceptions-when-impo # def test_docx_file(self): # from docx import Document # with tempfile.TemporaryDirectory() as tempdir: # p = Path(tempdir) / 'a.docx' # document = Document() # document.add_paragraph("1st paragraph.") # document.add_paragraph("1st paragraph.") # document.save(str(p)) # read_content = d2vg.parsers.docx_parse(str(p)) # read_content = re.sub(r'\n+', r'\n', read_content).rstrip() # self.assertEqual(read_content, '1st paragraph.\n2nd paragraph.') if __name__ == "__main__": unittest.main()
34.474359
149
0.61138
import unittest from pathlib import Path import re import tempfile import d2vg class ParserTest(unittest.TestCase): def test_text_file(self): with tempfile.TemporaryDirectory() as tempdir: p = Path(tempdir) / "a.txt" content = "1st line.\n2nd line.\n" p.write_text(content) read_content = d2vg.parsers.read_text_file(str(p)) self.assertEqual(read_content, content) def test_html_file(self): with tempfile.TemporaryDirectory() as tempdir: p = Path(tempdir) / "a.html" content = """<!DOCTYPE html> <html> <body> <p>1st paragraph.</p> <p>2nd paragraph.</p> </body> </html>""" p.write_text(content) read_content = d2vg.parsers.html_parse(str(p)) read_content = re.sub(r"\n+", r"\n", read_content).rstrip() self.assertEqual(read_content, "html\n1st paragraph.\n2nd paragraph.") def test_pdf_file(self): from borb.pdf.canvas.layout.page_layout.multi_column_layout import ( SingleColumnLayout, ) from borb.pdf.canvas.layout.text.paragraph import Paragraph from borb.pdf.document import Document from borb.pdf.page.page import Page from borb.pdf.pdf import PDF with tempfile.TemporaryDirectory() as tempdir: p = Path(tempdir) / "a.pdf" pdf = Document() page = Page() pdf.append_page(page) layout = SingleColumnLayout(page) layout.add(Paragraph("1st paragraph.")) layout.add(Paragraph("2nd paragraph.")) with open(p, "wb") as pdf_file_handle: PDF.dumps(pdf_file_handle, pdf) read_content = d2vg.parsers.pdf_parse(str(p)) read_content = re.sub(r"\n+", r"\n", read_content).rstrip() self.assertEqual(read_content, "1st paragraph.\n2nd paragraph.") if __name__ == "__main__": unittest.main()
true
true
f72646f0022b7bc1e1b506d20a786c3a402e9a98
422
py
Python
blog/migrations/0008_post_snippet.py
cs130-w21/15
3e0bfd3662e930e5b67416939a976029ddad6436
[ "Apache-2.0" ]
null
null
null
blog/migrations/0008_post_snippet.py
cs130-w21/15
3e0bfd3662e930e5b67416939a976029ddad6436
[ "Apache-2.0" ]
13
2021-01-14T06:09:55.000Z
2021-03-08T08:56:36.000Z
blog/migrations/0008_post_snippet.py
cs130-w21/15
3e0bfd3662e930e5b67416939a976029ddad6436
[ "Apache-2.0" ]
1
2021-04-07T18:20:21.000Z
2021-04-07T18:20:21.000Z
# Generated by Django 3.1.5 on 2021-03-05 05:59 from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('blog', '0007_auto_20210305_0539'), ] operations = [ migrations.AddField( model_name='post', name='snippet', field=models.CharField(default='Click link below to see more.', max_length=200), ), ]
22.210526
92
0.606635
from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('blog', '0007_auto_20210305_0539'), ] operations = [ migrations.AddField( model_name='post', name='snippet', field=models.CharField(default='Click link below to see more.', max_length=200), ), ]
true
true
f72646f6d0c53d7d935da1ea9870115892eb14ad
4,209
py
Python
ALGOs/LearningRate_Decay.py
iamharshit/ML_works
b0bb53c5a60312719d15e25b727c54cbab65b4af
[ "MIT" ]
1
2016-11-29T04:28:09.000Z
2016-11-29T04:28:09.000Z
ALGOs/LearningRate_Decay.py
iamharshit/ML_works
b0bb53c5a60312719d15e25b727c54cbab65b4af
[ "MIT" ]
null
null
null
ALGOs/LearningRate_Decay.py
iamharshit/ML_works
b0bb53c5a60312719d15e25b727c54cbab65b4af
[ "MIT" ]
null
null
null
#1. class LR_LinearDecay(): ''' Function : -Learning rate decay linearly(a constant factor) after each epoch -Eg. LR= 5, 5.8, 5.6, 5.4, ........ ''' def __init__(self, min_lr=1e-5, max_lr=1e-2, epochs=None): super().__init__() self.min_lr = min_lr self.max_lr = max_lr self.total_iterations = epochs def get_lr(self, epoch_i): '''Return the updated learning rate.''' self.iteration = epoch_i x = self.iteration / self.total_iterations return self.max_lr - (self.max_lr-self.min_lr) * x #2. class LR_StepDecay(): ''' Function : -Learning rate decay stepwise(a varing factor) after every few epochs - Eg. LR= 5, 5, 5, 2.5, 2.5, 2.5, 1.25, 1.25, 1.25, ...... ''' def __init__(self, max_lr=1e-2, step_size=3, decay_factor=2): super().__init__() self.max_lr = max_lr self.step_size = step_size # meaning: update happens after every `step_size` iterations self.decay_factor = decay_factor def get_lr(self, epoch_i): '''Return the updated learning rate.''' self.iteration = epoch_i x = self.iteration / self.step_size return self.max_lr / (self.decay_factor ** int(x) ) #3. class LR_ExponentialDecay(): ''' Function : Learning rate decay exponentially( exp(k*t) ) after each epoch ''' def __init__(self, max_lr=1e-2, decay_factor=0.1): super().__init__() self.max_lr = max_lr self.decay_factor = decay_factor def get_lr(self, epoch_i): '''Return the updated learning rate.''' return self.max_lr / math.exp(self.decay_factor*epoch_i ) #4. class LR_Cyclical(): ''' Function - This implements 2 techniques: 1.Linear annealing(to better converge at minima) 2.Learning rate linear restart(to escape local minima) ''' def __init__(self, min_lr=1e-5, max_lr=1e-2, step_size=10, mode='triangular', gamma=1., scale_fn=None, scale_mode='cycle'): super(CyclicLR, self).__init__() import math self.min_lr = min_lr self.max_lr = max_lr self.step_size = step_size self.mode = mode if scale_fn == None: if(self.mode == 'triangular'): self.scale_fn = lambda x: 1. elif(self.mode == 'triangular2'): self.scale_fn = lambda x: 1/(2.**(x-1)) elif(self.mode == 'exp_range'): self.scale_fn = lambda x: gamma**(x) else: self.scale_fn = scale_fn def get_lr(self, epoch_i): cycle = math.floor(1 + epoch_i/(2*self.step_size)) x = math.abs (epoch_i/self.step_size - 2*cycle + 1) return self.base_lr + (self.max_lr-self.min_lr) * (1-x) * self.scale_fn(cycle) #5. class LR_StochasticGradientDescentWithWarmRestarts(): ''' Function - This implements 2 techniques: 1.Cosine annealing(to better converge at minima) 2.Learning rate sharp restart(to escape local minima) ''' def __init__(self, min_lr, max_lr, epoch_steps=10): self.min_lr = min_lr self.max_lr = max_lr self.epoch_steps = epoch_steps # restarts after every `epoch_steps` no. of epochs self.batch_since_restart = 0 def get_lr(self, epoch_i): '''Calculate the learning rate.''' self.batch_since_restart = epoch_i % epoch_steps fraction_to_restart = self.batch_since_restart / (epoch_steps) return self.min_lr + 0.5 * (self.max_lr - self.min_lr) * (1 + np.cos(fraction_to_restart * np.pi)) ''' Example. >> epoch_n = 50 >> lr = LR_LinearDecay(epochs = epoch_n) >> for epoch_i in range(1,epoch_n+1): learning_rate = lr.get_lr(epoch_i = epoch_i ) '''
30.280576
128
0.549062
class LR_LinearDecay(): ''' Function : -Learning rate decay linearly(a constant factor) after each epoch -Eg. LR= 5, 5.8, 5.6, 5.4, ........ ''' def __init__(self, min_lr=1e-5, max_lr=1e-2, epochs=None): super().__init__() self.min_lr = min_lr self.max_lr = max_lr self.total_iterations = epochs def get_lr(self, epoch_i): '''Return the updated learning rate.''' self.iteration = epoch_i x = self.iteration / self.total_iterations return self.max_lr - (self.max_lr-self.min_lr) * x class LR_StepDecay(): ''' Function : -Learning rate decay stepwise(a varing factor) after every few epochs - Eg. LR= 5, 5, 5, 2.5, 2.5, 2.5, 1.25, 1.25, 1.25, ...... ''' def __init__(self, max_lr=1e-2, step_size=3, decay_factor=2): super().__init__() self.max_lr = max_lr self.step_size = step_size self.decay_factor = decay_factor def get_lr(self, epoch_i): '''Return the updated learning rate.''' self.iteration = epoch_i x = self.iteration / self.step_size return self.max_lr / (self.decay_factor ** int(x) ) class LR_ExponentialDecay(): ''' Function : Learning rate decay exponentially( exp(k*t) ) after each epoch ''' def __init__(self, max_lr=1e-2, decay_factor=0.1): super().__init__() self.max_lr = max_lr self.decay_factor = decay_factor def get_lr(self, epoch_i): '''Return the updated learning rate.''' return self.max_lr / math.exp(self.decay_factor*epoch_i ) class LR_Cyclical(): ''' Function - This implements 2 techniques: 1.Linear annealing(to better converge at minima) 2.Learning rate linear restart(to escape local minima) ''' def __init__(self, min_lr=1e-5, max_lr=1e-2, step_size=10, mode='triangular', gamma=1., scale_fn=None, scale_mode='cycle'): super(CyclicLR, self).__init__() import math self.min_lr = min_lr self.max_lr = max_lr self.step_size = step_size self.mode = mode if scale_fn == None: if(self.mode == 'triangular'): self.scale_fn = lambda x: 1. elif(self.mode == 'triangular2'): self.scale_fn = lambda x: 1/(2.**(x-1)) elif(self.mode == 'exp_range'): self.scale_fn = lambda x: gamma**(x) else: self.scale_fn = scale_fn def get_lr(self, epoch_i): cycle = math.floor(1 + epoch_i/(2*self.step_size)) x = math.abs (epoch_i/self.step_size - 2*cycle + 1) return self.base_lr + (self.max_lr-self.min_lr) * (1-x) * self.scale_fn(cycle) class LR_StochasticGradientDescentWithWarmRestarts(): ''' Function - This implements 2 techniques: 1.Cosine annealing(to better converge at minima) 2.Learning rate sharp restart(to escape local minima) ''' def __init__(self, min_lr, max_lr, epoch_steps=10): self.min_lr = min_lr self.max_lr = max_lr self.epoch_steps = epoch_steps self.batch_since_restart = 0 def get_lr(self, epoch_i): '''Calculate the learning rate.''' self.batch_since_restart = epoch_i % epoch_steps fraction_to_restart = self.batch_since_restart / (epoch_steps) return self.min_lr + 0.5 * (self.max_lr - self.min_lr) * (1 + np.cos(fraction_to_restart * np.pi)) ''' Example. >> epoch_n = 50 >> lr = LR_LinearDecay(epochs = epoch_n) >> for epoch_i in range(1,epoch_n+1): learning_rate = lr.get_lr(epoch_i = epoch_i ) '''
false
true
f7264824f603075011c4ae3509f47ec148f2cec0
12,224
py
Python
tests/test_dates.py
robot2051/dto-digitalmarketplace-utils
e581be6396c12473697398b0ec9d253c564a324b
[ "MIT" ]
null
null
null
tests/test_dates.py
robot2051/dto-digitalmarketplace-utils
e581be6396c12473697398b0ec9d253c564a324b
[ "MIT" ]
null
null
null
tests/test_dates.py
robot2051/dto-digitalmarketplace-utils
e581be6396c12473697398b0ec9d253c564a324b
[ "MIT" ]
null
null
null
# coding: utf-8 import pytest import mock import workdays import datetime import dmutils.dates as dates_package class TestPublishingDates(): def test_get_publishing_dates_formats_time(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2015, 5, 22, 20, 39, 39, 417900) brief = { 'requirementsLength': '1 week', } assert dates_package.datetime.utcnow() == datetime.datetime(2015, 5, 22, 20, 39, 39, 417900) assert dates_package.get_publishing_dates(brief)['closing_time'] == '11:59 pm' def test_get_publishing_dates_for_one_week_briefs_are_correct_if_published_on_a_monday(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2016, 7, 4, 15, 21, 39, 417900) brief = { 'requirementsLength': '1 week', } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 7, 6, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 7, 8, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 7, 11, 23, 59, 59) def test_get_publishing_dates_for_one_week_briefs_are_correct_if_published_on_a_tuesday(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2016, 7, 5, 15, 21, 39, 417900) brief = { 'requirementsLength': '1 week', } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 7, 7, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 7, 11, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 7, 12, 23, 59, 59) def test_get_publishing_dates_for_one_week_briefs_are_correct_if_published_on_a_wednesday(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2016, 7, 6, 15, 21, 39, 417900) brief = { 'requirementsLength': '1 week', } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 7, 8, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 7, 12, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 7, 13, 23, 59, 59) def test_get_publishing_dates_for_one_week_briefs_are_correct_if_published_on_a_thursday(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2016, 7, 7, 15, 21, 39, 417900) brief = { 'requirementsLength': '1 week', } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 7, 11, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 7, 13, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 7, 14, 23, 59, 59) def test_get_publishing_dates_for_one_week_briefs_are_correct_if_published_on_a_friday(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2016, 7, 8, 15, 21, 39, 417900) brief = { 'requirementsLength': '1 week', 'lotSlug': 'digital-specialists' } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 7, 12, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 7, 14, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 7, 15, 23, 59, 59) def test_get_publishing_dates_for_one_week_briefs_are_correct_if_published_on_a_saturday(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2016, 7, 9, 15, 21, 39, 417900) brief = { 'requirementsLength': '1 week', } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 7, 12, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 7, 15, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 7, 16, 23, 59, 59) def test_get_publishing_dates_for_one_week_briefs_are_correct_if_published_on_a_sunday(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2016, 7, 10, 15, 21, 39, 417900) brief = { 'requirementsLength': '1 week', } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 7, 12, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 7, 15, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 7, 17, 23, 59, 59) def test_get_publishing_dates_for_two_week_briefs_are_correct_if_published_on_a_monday(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2016, 7, 4, 15, 21, 39, 417900) brief = { 'requirementsLength': '2 weeks', } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 7, 11, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 7, 15, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 7, 18, 23, 59, 59) def test_get_publishing_dates_for_two_week_briefs_are_correct_if_published_on_a_tuesday(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2016, 7, 5, 15, 21, 39, 417900) brief = { 'requirementsLength': '2 weeks', } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 7, 12, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 7, 18, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 7, 19, 23, 59, 59) def test_get_publishing_dates_for_two_week_briefs_are_correct_if_published_on_a_wednesday(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2016, 7, 6, 15, 21, 39, 417900) brief = { 'requirementsLength': '2 weeks', } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 7, 13, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 7, 19, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 7, 20, 23, 59, 59) def test_get_publishing_dates_for_two_week_briefs_are_correct_if_published_on_a_thursday(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2016, 7, 7, 15, 21, 39, 417900) brief = { 'requirementsLength': '2 weeks', } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 7, 14, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 7, 20, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 7, 21, 23, 59, 59) def test_get_publishing_dates_for_two_week_briefs_are_correct_if_published_on_a_friday(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2016, 7, 8, 15, 21, 39, 417900) brief = { 'requirementsLength': '2 weeks', } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 7, 15, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 7, 21, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 7, 22, 23, 59, 59) def test_get_publishing_dates_for_two_week_briefs_are_correct_if_published_on_a_saturday(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2016, 7, 9, 15, 21, 39, 417900) brief = { 'requirementsLength': '2 weeks', } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 7, 15, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 7, 22, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 7, 23, 23, 59, 59) def test_get_publishing_dates_for_two_week_briefs_are_correct_if_published_on_a_sunday(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2016, 7, 10, 15, 21, 39, 417900) brief = { 'requirementsLength': '2 weeks', } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 7, 15, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 7, 22, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 7, 24, 23, 59, 59) def test_get_publishing_dates_returns_correct_dates_if_brief_is_published_with_no_requirementLength(self): brief = { 'publishedAt': u'2016-01-04T12:00:00.00000Z', } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 1, 11, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 1, 15, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 1, 18, 23, 59, 59) def test_get_publishing_dates_returns_correct_dates_if_brief_is_published_with_1_week_requirementsLength(self): brief = { 'publishedAt': u'2016-01-04T12:00:00.00000Z', 'requirementsLength': '1 week' } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 1, 6, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 1, 8, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 1, 11, 23, 59, 59) def test_get_publishing_dates_returns_correct_dates_if_brief_is_published_with_2_week_requirementsLength(self): brief = { 'publishedAt': u'2016-01-04T12:00:00.00000Z', 'requirementsLength': '2 weeks' } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 1, 11, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 1, 15, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 1, 18, 23, 59, 59) def test_get_publishing_dates_returns_correct_dates_if_published_at_key_is_a_date_object(self): brief = { 'publishedAt': datetime.datetime(2016, 1, 4, 12, 0, 0), } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 1, 11, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 1, 15, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 1, 18, 23, 59, 59)
49.489879
115
0.641525
import pytest import mock import workdays import datetime import dmutils.dates as dates_package class TestPublishingDates(): def test_get_publishing_dates_formats_time(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2015, 5, 22, 20, 39, 39, 417900) brief = { 'requirementsLength': '1 week', } assert dates_package.datetime.utcnow() == datetime.datetime(2015, 5, 22, 20, 39, 39, 417900) assert dates_package.get_publishing_dates(brief)['closing_time'] == '11:59 pm' def test_get_publishing_dates_for_one_week_briefs_are_correct_if_published_on_a_monday(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2016, 7, 4, 15, 21, 39, 417900) brief = { 'requirementsLength': '1 week', } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 7, 6, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 7, 8, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 7, 11, 23, 59, 59) def test_get_publishing_dates_for_one_week_briefs_are_correct_if_published_on_a_tuesday(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2016, 7, 5, 15, 21, 39, 417900) brief = { 'requirementsLength': '1 week', } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 7, 7, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 7, 11, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 7, 12, 23, 59, 59) def test_get_publishing_dates_for_one_week_briefs_are_correct_if_published_on_a_wednesday(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2016, 7, 6, 15, 21, 39, 417900) brief = { 'requirementsLength': '1 week', } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 7, 8, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 7, 12, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 7, 13, 23, 59, 59) def test_get_publishing_dates_for_one_week_briefs_are_correct_if_published_on_a_thursday(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2016, 7, 7, 15, 21, 39, 417900) brief = { 'requirementsLength': '1 week', } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 7, 11, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 7, 13, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 7, 14, 23, 59, 59) def test_get_publishing_dates_for_one_week_briefs_are_correct_if_published_on_a_friday(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2016, 7, 8, 15, 21, 39, 417900) brief = { 'requirementsLength': '1 week', 'lotSlug': 'digital-specialists' } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 7, 12, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 7, 14, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 7, 15, 23, 59, 59) def test_get_publishing_dates_for_one_week_briefs_are_correct_if_published_on_a_saturday(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2016, 7, 9, 15, 21, 39, 417900) brief = { 'requirementsLength': '1 week', } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 7, 12, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 7, 15, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 7, 16, 23, 59, 59) def test_get_publishing_dates_for_one_week_briefs_are_correct_if_published_on_a_sunday(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2016, 7, 10, 15, 21, 39, 417900) brief = { 'requirementsLength': '1 week', } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 7, 12, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 7, 15, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 7, 17, 23, 59, 59) def test_get_publishing_dates_for_two_week_briefs_are_correct_if_published_on_a_monday(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2016, 7, 4, 15, 21, 39, 417900) brief = { 'requirementsLength': '2 weeks', } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 7, 11, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 7, 15, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 7, 18, 23, 59, 59) def test_get_publishing_dates_for_two_week_briefs_are_correct_if_published_on_a_tuesday(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2016, 7, 5, 15, 21, 39, 417900) brief = { 'requirementsLength': '2 weeks', } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 7, 12, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 7, 18, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 7, 19, 23, 59, 59) def test_get_publishing_dates_for_two_week_briefs_are_correct_if_published_on_a_wednesday(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2016, 7, 6, 15, 21, 39, 417900) brief = { 'requirementsLength': '2 weeks', } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 7, 13, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 7, 19, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 7, 20, 23, 59, 59) def test_get_publishing_dates_for_two_week_briefs_are_correct_if_published_on_a_thursday(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2016, 7, 7, 15, 21, 39, 417900) brief = { 'requirementsLength': '2 weeks', } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 7, 14, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 7, 20, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 7, 21, 23, 59, 59) def test_get_publishing_dates_for_two_week_briefs_are_correct_if_published_on_a_friday(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2016, 7, 8, 15, 21, 39, 417900) brief = { 'requirementsLength': '2 weeks', } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 7, 15, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 7, 21, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 7, 22, 23, 59, 59) def test_get_publishing_dates_for_two_week_briefs_are_correct_if_published_on_a_saturday(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2016, 7, 9, 15, 21, 39, 417900) brief = { 'requirementsLength': '2 weeks', } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 7, 15, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 7, 22, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 7, 23, 23, 59, 59) def test_get_publishing_dates_for_two_week_briefs_are_correct_if_published_on_a_sunday(self): with mock.patch('dmutils.dates.datetime') as mock_date: mock_date.utcnow.return_value = datetime.datetime(2016, 7, 10, 15, 21, 39, 417900) brief = { 'requirementsLength': '2 weeks', } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 7, 15, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 7, 22, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 7, 24, 23, 59, 59) def test_get_publishing_dates_returns_correct_dates_if_brief_is_published_with_no_requirementLength(self): brief = { 'publishedAt': u'2016-01-04T12:00:00.00000Z', } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 1, 11, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 1, 15, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 1, 18, 23, 59, 59) def test_get_publishing_dates_returns_correct_dates_if_brief_is_published_with_1_week_requirementsLength(self): brief = { 'publishedAt': u'2016-01-04T12:00:00.00000Z', 'requirementsLength': '1 week' } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 1, 6, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 1, 8, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 1, 11, 23, 59, 59) def test_get_publishing_dates_returns_correct_dates_if_brief_is_published_with_2_week_requirementsLength(self): brief = { 'publishedAt': u'2016-01-04T12:00:00.00000Z', 'requirementsLength': '2 weeks' } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 1, 11, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 1, 15, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 1, 18, 23, 59, 59) def test_get_publishing_dates_returns_correct_dates_if_published_at_key_is_a_date_object(self): brief = { 'publishedAt': datetime.datetime(2016, 1, 4, 12, 0, 0), } dates = dates_package.get_publishing_dates(brief) assert dates['questions_close'] == datetime.datetime(2016, 1, 11, 23, 59, 59) assert dates['answers_close'] == datetime.datetime(2016, 1, 15, 23, 59, 59) assert dates['closing_date'] == datetime.datetime(2016, 1, 18, 23, 59, 59)
true
true
f726488d8cbb6bc2a5748013e73cd7f6e42b06b9
20,570
py
Python
sagemaker-debugger/model_specific_realtime_analysis/bert_attention_head_view/entry_point/data.py
jpmarques19/tensorflwo-test
0ff8b06e0415075c7269820d080284a42595bb2e
[ "Apache-2.0" ]
2,327
2020-03-01T09:47:34.000Z
2021-11-25T12:38:42.000Z
sagemaker-debugger/model_specific_realtime_analysis/bert_attention_head_view/entry_point/data.py
jpmarques19/tensorflwo-test
0ff8b06e0415075c7269820d080284a42595bb2e
[ "Apache-2.0" ]
209
2020-03-01T17:14:12.000Z
2021-11-08T20:35:42.000Z
sagemaker-debugger/model_specific_realtime_analysis/bert_attention_head_view/entry_point/data.py
jpmarques19/tensorflwo-test
0ff8b06e0415075c7269820d080284a42595bb2e
[ "Apache-2.0" ]
686
2020-03-03T17:24:51.000Z
2021-11-25T23:39:12.000Z
# coding=utf-8 # Copyright 2018 The Google AI Language Team Authors and DMLC. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """BERT for QA datasets.""" import collections import multiprocessing as mp import time from functools import partial from mxnet.gluon.data import SimpleDataset from gluonnlp.data.utils import whitespace_splitter import numpy as np __all__ = ['SQuADTransform', '\rocess_dataset'] class SquadExample: """A single training/test example for SQuAD question. For examples without an answer, the start and end position are -1. """ def __init__(self, qas_id, question_text, doc_tokens, example_id, orig_answer_text=None, start_position=None, end_position=None, is_impossible=False): self.qas_id = qas_id self.question_text = question_text self.doc_tokens = doc_tokens self.orig_answer_text = orig_answer_text self.start_position = start_position self.end_position = end_position self.is_impossible = is_impossible self.example_id = example_id def _worker_fn(example, transform): """Function for processing data in worker process.""" feature = transform(example) return feature def preprocess_dataset(dataset, transform, num_workers=8): """Use multiprocessing to perform transform for dataset. Parameters ---------- dataset: dataset-like object Source dataset. transform: callable Transformer function. num_workers: int, default 8 The number of multiprocessing workers to use for data preprocessing. """ worker_fn = partial(_worker_fn, transform=transform) start = time.time() pool = mp.Pool(num_workers) dataset_transform = [] dataset_len = [] for data in pool.map(worker_fn, dataset): if data: for _data in data: dataset_transform.append(_data[:-1]) dataset_len.append(_data[-1]) dataset = SimpleDataset(dataset_transform).transform( lambda x: (x[0], x[1], x[2], x[3], x[4], x[5])) end = time.time() pool.close() print('Done! Transform dataset costs %.2f seconds.' % (end-start)) return dataset, dataset_len class SQuADFeature: """Single feature of a single example transform of the SQuAD question. """ def __init__(self, example_id, qas_id, doc_tokens, doc_span_index, tokens, token_to_orig_map, token_is_max_context, input_ids, valid_length, segment_ids, start_position, end_position, is_impossible): self.example_id = example_id self.qas_id = qas_id self.doc_tokens = doc_tokens self.doc_span_index = doc_span_index self.tokens = tokens self.token_to_orig_map = token_to_orig_map self.token_is_max_context = token_is_max_context self.input_ids = input_ids self.valid_length = valid_length self.segment_ids = segment_ids self.start_position = start_position self.end_position = end_position self.is_impossible = is_impossible class SQuADTransform: """Dataset Transformation for BERT-style QA. The transformation is processed in the following steps: - Convert from gluonnlp.data.SQuAD's record to SquadExample. - Tokenize the question_text in the example. - For examples where the document is too long, use a sliding window to split into multiple features and record whether each token is a maximum context. - Tokenize the split document chunks. - Combine the token of question_text with the token of the document and insert [CLS] and [SEP]. - Generate the start position and end position of the answer. - Generate valid length. E.g: Inputs: question_text: 'When did BBC Japan begin broadcasting?' doc_tokens: ['BBC','Japan','was','a','general','entertainment','channel,', 'which','operated','between','December','2004','and','April', '2006.','It','ceased','operations','after','its','Japanese', 'distributor','folded.'] start_position: 10 end_position: 11 orig_answer_text: 'December 2004' Processed: tokens: ['[CLS]','when','did','bbc','japan','begin','broadcasting','?', '[SEP]','bbc','japan','was','a','general','entertainment','channel', ',','which','operated','between','december','2004','and','april', '2006','.','it','ceased','operations','after','its','japanese', 'distributor','folded','.','[SEP]'] segment_ids: [0,0,0,0,0,0,0,0,0,1,1,1,1,1,1, 1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1] start_position: 20 end_position: 21 valid_length: 36 Because of the sliding window approach taken to scoring documents, a single token can appear in multiple documents. So you need to record whether each token is a maximum context. E.g. Doc: the man went to the store and bought a gallon of milk Span A: the man went to the Span B: to the store and bought Span C: and bought a gallon of ... Now the word 'bought' will have two scores from spans B and C. We only want to consider the score with "maximum context", which we define as the *minimum* of its left and right context (the *sum* of left and right context will always be the same, of course). In the example the maximum context for 'bought' would be span C since it has 1 left context and 3 right context, while span B has 4 left context and 0 right context. Parameters ---------- tokenizer : BERTTokenizer. Tokenizer for the sentences. labels : list of int. List of all label ids for the classification task. max_seq_length : int, default 384 Maximum sequence length of the sentences. doc_stride : int, default 128 When splitting up a long document into chunks, how much stride to take between chunks. max_query_length : int, default 64 The maximum length of the query tokens. is_pad : bool, default True Whether to pad the sentences to maximum length. is_training : bool, default True Whether to run training. do_lookup : bool, default True Whether to do vocabulary lookup for convert tokens to indices. """ def __init__(self, tokenizer, max_seq_length=384, doc_stride=128, max_query_length=64, is_pad=True, is_training=True, do_lookup=True): self.tokenizer = tokenizer self.max_seq_length = max_seq_length self.max_query_length = max_query_length self.doc_stride = doc_stride self.is_pad = is_pad self.is_training = is_training self.do_lookup = do_lookup def _is_whitespace(self, c): if c == ' ' or c == '\t' or c == '\r' or c == '\n' or ord( c) == 0x202F: return True return False def _toSquadExample(self, record): example_id = record[0] qas_id = record[1] question_text = record[2] paragraph_text = record[3] orig_answer_text = record[4][0] if record[4] else '' answer_offset = record[5][0] if record[5] else '' is_impossible = record[6] if len(record) == 7 else False doc_tokens = [] char_to_word_offset = [] prev_is_whitespace = True for c in paragraph_text: if self._is_whitespace(c): prev_is_whitespace = True else: if prev_is_whitespace: doc_tokens.append(c) else: doc_tokens[-1] += c prev_is_whitespace = False char_to_word_offset.append(len(doc_tokens) - 1) start_position = -1 end_position = -1 if self.is_training: if not is_impossible: answer_length = len(orig_answer_text) start_position = char_to_word_offset[answer_offset] end_position = char_to_word_offset[ answer_offset + answer_length - 1] # Only add answers where the text can be exactly recovered from the # document. If this CAN'T happen it's likely due to weird Unicode # stuff so we will just skip the example. # # Note that this means for training mode, every example is NOT # guaranteed to be preserved. actual_text = ' '.join( doc_tokens[start_position:(end_position + 1)]) cleaned_answer_text = ' '.join( whitespace_splitter(orig_answer_text.strip())) if actual_text.find(cleaned_answer_text) == -1: print('Could not find answer: %s vs. %s' % (actual_text, cleaned_answer_text)) return None else: start_position = -1 end_position = -1 orig_answer_text = '' example = SquadExample( qas_id=qas_id, question_text=question_text, doc_tokens=doc_tokens, example_id=example_id, orig_answer_text=orig_answer_text, start_position=start_position, end_position=end_position, is_impossible=is_impossible) return example def _transform(self, *record): example = self._toSquadExample(record) if not example: return None padding = self.tokenizer.vocab.padding_token if self.do_lookup: padding = self.tokenizer.vocab[padding] features = [] query_tokens = self.tokenizer(example.question_text) if len(query_tokens) > self.max_query_length: query_tokens = query_tokens[0:self.max_query_length] tok_to_orig_index = [] orig_to_tok_index = [] all_doc_tokens = [] for (i, token) in enumerate(example.doc_tokens): orig_to_tok_index.append(len(all_doc_tokens)) sub_tokens = self.tokenizer(token) for sub_token in sub_tokens: tok_to_orig_index.append(i) all_doc_tokens.append(sub_token) tok_start_position = None tok_end_position = None if self.is_training and example.is_impossible: tok_start_position = -1 tok_end_position = -1 if self.is_training and not example.is_impossible: tok_start_position = orig_to_tok_index[example.start_position] if example.end_position < len(example.doc_tokens) - 1: tok_end_position = orig_to_tok_index[example.end_position + 1] - 1 else: tok_end_position = len(all_doc_tokens) - 1 (tok_start_position, tok_end_position) = _improve_answer_span( all_doc_tokens, tok_start_position, tok_end_position, self.tokenizer, example.orig_answer_text) # The -3 accounts for [CLS], [SEP] and [SEP] max_tokens_for_doc = self.max_seq_length - len(query_tokens) - 3 # We can have documents that are longer than the maximum sequence length. # To deal with this we do a sliding window approach, where we take chunks # of the up to our max length with a stride of `doc_stride`. _DocSpan = collections.namedtuple( # pylint: disable=invalid-name 'DocSpan', ['start', 'length']) doc_spans = [] start_offset = 0 while start_offset < len(all_doc_tokens): length = len(all_doc_tokens) - start_offset if length > max_tokens_for_doc: length = max_tokens_for_doc doc_spans.append(_DocSpan(start=start_offset, length=length)) if start_offset + length == len(all_doc_tokens): break start_offset += min(length, self.doc_stride) for (doc_span_index, doc_span) in enumerate(doc_spans): tokens = [] token_to_orig_map = {} token_is_max_context = {} segment_ids = [] tokens.append(self.tokenizer.vocab.cls_token) segment_ids.append(0) for token in query_tokens: tokens.append(token) segment_ids.append(0) tokens.append(self.tokenizer.vocab.sep_token) segment_ids.append(0) for i in range(doc_span.length): split_token_index = doc_span.start + i token_to_orig_map[len( tokens)] = tok_to_orig_index[split_token_index] is_max_context = _check_is_max_context( doc_spans, doc_span_index, split_token_index) token_is_max_context[len(tokens)] = is_max_context tokens.append(all_doc_tokens[split_token_index]) segment_ids.append(1) tokens.append(self.tokenizer.vocab.sep_token) segment_ids.append(1) if self.do_lookup: input_ids = self.tokenizer.convert_tokens_to_ids(tokens) else: input_ids = tokens # The mask has 1 for real tokens and 0 for padding tokens. Only real # tokens are attended to. valid_length = len(input_ids) # Zero-pad up to the sequence length. if self.is_pad: while len(input_ids) < self.max_seq_length: input_ids.append(padding) segment_ids.append(padding) assert len(input_ids) == self.max_seq_length assert len(segment_ids) == self.max_seq_length start_position = 0 end_position = 0 if self.is_training and not example.is_impossible: # For training, if our document chunk does not contain an annotation # we throw it out, since there is nothing to predict. doc_start = doc_span.start doc_end = doc_span.start + doc_span.length - 1 out_of_span = False if not (tok_start_position >= doc_start and tok_end_position <= doc_end): out_of_span = True if out_of_span: start_position = 0 end_position = 0 else: doc_offset = len(query_tokens) + 2 start_position = tok_start_position - doc_start + doc_offset end_position = tok_end_position - doc_start + doc_offset if self.is_training and example.is_impossible: start_position = 0 end_position = 0 features.append(SQuADFeature(example_id=example.example_id, qas_id=example.qas_id, doc_tokens=example.doc_tokens, doc_span_index=doc_span_index, tokens=tokens, token_to_orig_map=token_to_orig_map, token_is_max_context=token_is_max_context, input_ids=input_ids, valid_length=valid_length, segment_ids=segment_ids, start_position=start_position, end_position=end_position, is_impossible=example.is_impossible)) return features def __call__(self, record): examples = self._transform(*record) if not examples: return None features = [] for _example in examples: feature = [] feature.append(_example.example_id) feature.append(_example.input_ids) feature.append(_example.segment_ids) feature.append(_example.valid_length) feature.append(_example.start_position) feature.append(_example.end_position) feature.append(len(_example.input_ids)) features.append(feature) return features def _improve_answer_span(doc_tokens, input_start, input_end, tokenizer, orig_answer_text): """Returns tokenized answer spans that better match the annotated answer.""" # The SQuAD annotations are character based. We first project them to # whitespace-tokenized words. But then after WordPiece tokenization, we can # often find a "better match". For example: # # Question: What year was John Smith born? # Context: The leader was John Smith (1895-1943). # Answer: 1895 # # The original whitespace-tokenized answer will be "(1895-1943).". However # after tokenization, our tokens will be "( 1895 - 1943 ) .". So we can match # the exact answer, 1895. # # However, this is not always possible. Consider the following: # # Question: What country is the top exporter of electornics? # Context: The Japanese electronics industry is the lagest in the world. # Answer: Japan # # In this case, the annotator chose "Japan" as a character sub-span of # the word "Japanese". Since our WordPiece tokenizer does not split # "Japanese", we just use "Japanese" as the annotation. This is fairly rare # in SQuAD, but does happen. tok_answer_text = ' '.join(tokenizer(orig_answer_text)) for new_start in range(input_start, input_end + 1): for new_end in range(input_end, new_start - 1, -1): text_span = ' '.join(doc_tokens[new_start:(new_end + 1)]) if text_span == tok_answer_text: return (new_start, new_end) return (input_start, input_end) def _check_is_max_context(doc_spans, cur_span_index, position): """Check if this is the 'max context' doc span for the token.""" # Because of the sliding window approach taken to scoring documents, a single # token can appear in multiple documents. E.g. # Doc: the man went to the store and bought a gallon of milk # Span A: the man went to the # Span B: to the store and bought # Span C: and bought a gallon of # ... # # Now the word 'bought' will have two scores from spans B and C. We only # want to consider the score with "maximum context", which we define as # the *minimum* of its left and right context (the *sum* of left and # right context will always be the same, of course). # # In the example the maximum context for 'bought' would be span C since # it has 1 left context and 3 right context, while span B has 4 left context # and 0 right context. best_score = None best_span_index = None for (span_index, doc_span) in enumerate(doc_spans): end = doc_span.start + doc_span.length - 1 if position < doc_span.start: continue if position > end: continue num_left_context = position - doc_span.start num_right_context = end - position score = min(num_left_context, num_right_context) + \ 0.01 * doc_span.length if best_score is None or score > best_score: best_score = score best_span_index = span_index return cur_span_index == best_span_index
38.958333
84
0.597083
import collections import multiprocessing as mp import time from functools import partial from mxnet.gluon.data import SimpleDataset from gluonnlp.data.utils import whitespace_splitter import numpy as np __all__ = ['SQuADTransform', '\rocess_dataset'] class SquadExample: def __init__(self, qas_id, question_text, doc_tokens, example_id, orig_answer_text=None, start_position=None, end_position=None, is_impossible=False): self.qas_id = qas_id self.question_text = question_text self.doc_tokens = doc_tokens self.orig_answer_text = orig_answer_text self.start_position = start_position self.end_position = end_position self.is_impossible = is_impossible self.example_id = example_id def _worker_fn(example, transform): feature = transform(example) return feature def preprocess_dataset(dataset, transform, num_workers=8): worker_fn = partial(_worker_fn, transform=transform) start = time.time() pool = mp.Pool(num_workers) dataset_transform = [] dataset_len = [] for data in pool.map(worker_fn, dataset): if data: for _data in data: dataset_transform.append(_data[:-1]) dataset_len.append(_data[-1]) dataset = SimpleDataset(dataset_transform).transform( lambda x: (x[0], x[1], x[2], x[3], x[4], x[5])) end = time.time() pool.close() print('Done! Transform dataset costs %.2f seconds.' % (end-start)) return dataset, dataset_len class SQuADFeature: def __init__(self, example_id, qas_id, doc_tokens, doc_span_index, tokens, token_to_orig_map, token_is_max_context, input_ids, valid_length, segment_ids, start_position, end_position, is_impossible): self.example_id = example_id self.qas_id = qas_id self.doc_tokens = doc_tokens self.doc_span_index = doc_span_index self.tokens = tokens self.token_to_orig_map = token_to_orig_map self.token_is_max_context = token_is_max_context self.input_ids = input_ids self.valid_length = valid_length self.segment_ids = segment_ids self.start_position = start_position self.end_position = end_position self.is_impossible = is_impossible class SQuADTransform: def __init__(self, tokenizer, max_seq_length=384, doc_stride=128, max_query_length=64, is_pad=True, is_training=True, do_lookup=True): self.tokenizer = tokenizer self.max_seq_length = max_seq_length self.max_query_length = max_query_length self.doc_stride = doc_stride self.is_pad = is_pad self.is_training = is_training self.do_lookup = do_lookup def _is_whitespace(self, c): if c == ' ' or c == '\t' or c == '\r' or c == '\n' or ord( c) == 0x202F: return True return False def _toSquadExample(self, record): example_id = record[0] qas_id = record[1] question_text = record[2] paragraph_text = record[3] orig_answer_text = record[4][0] if record[4] else '' answer_offset = record[5][0] if record[5] else '' is_impossible = record[6] if len(record) == 7 else False doc_tokens = [] char_to_word_offset = [] prev_is_whitespace = True for c in paragraph_text: if self._is_whitespace(c): prev_is_whitespace = True else: if prev_is_whitespace: doc_tokens.append(c) else: doc_tokens[-1] += c prev_is_whitespace = False char_to_word_offset.append(len(doc_tokens) - 1) start_position = -1 end_position = -1 if self.is_training: if not is_impossible: answer_length = len(orig_answer_text) start_position = char_to_word_offset[answer_offset] end_position = char_to_word_offset[ answer_offset + answer_length - 1] actual_text = ' '.join( doc_tokens[start_position:(end_position + 1)]) cleaned_answer_text = ' '.join( whitespace_splitter(orig_answer_text.strip())) if actual_text.find(cleaned_answer_text) == -1: print('Could not find answer: %s vs. %s' % (actual_text, cleaned_answer_text)) return None else: start_position = -1 end_position = -1 orig_answer_text = '' example = SquadExample( qas_id=qas_id, question_text=question_text, doc_tokens=doc_tokens, example_id=example_id, orig_answer_text=orig_answer_text, start_position=start_position, end_position=end_position, is_impossible=is_impossible) return example def _transform(self, *record): example = self._toSquadExample(record) if not example: return None padding = self.tokenizer.vocab.padding_token if self.do_lookup: padding = self.tokenizer.vocab[padding] features = [] query_tokens = self.tokenizer(example.question_text) if len(query_tokens) > self.max_query_length: query_tokens = query_tokens[0:self.max_query_length] tok_to_orig_index = [] orig_to_tok_index = [] all_doc_tokens = [] for (i, token) in enumerate(example.doc_tokens): orig_to_tok_index.append(len(all_doc_tokens)) sub_tokens = self.tokenizer(token) for sub_token in sub_tokens: tok_to_orig_index.append(i) all_doc_tokens.append(sub_token) tok_start_position = None tok_end_position = None if self.is_training and example.is_impossible: tok_start_position = -1 tok_end_position = -1 if self.is_training and not example.is_impossible: tok_start_position = orig_to_tok_index[example.start_position] if example.end_position < len(example.doc_tokens) - 1: tok_end_position = orig_to_tok_index[example.end_position + 1] - 1 else: tok_end_position = len(all_doc_tokens) - 1 (tok_start_position, tok_end_position) = _improve_answer_span( all_doc_tokens, tok_start_position, tok_end_position, self.tokenizer, example.orig_answer_text) max_tokens_for_doc = self.max_seq_length - len(query_tokens) - 3 _DocSpan = collections.namedtuple( 'DocSpan', ['start', 'length']) doc_spans = [] start_offset = 0 while start_offset < len(all_doc_tokens): length = len(all_doc_tokens) - start_offset if length > max_tokens_for_doc: length = max_tokens_for_doc doc_spans.append(_DocSpan(start=start_offset, length=length)) if start_offset + length == len(all_doc_tokens): break start_offset += min(length, self.doc_stride) for (doc_span_index, doc_span) in enumerate(doc_spans): tokens = [] token_to_orig_map = {} token_is_max_context = {} segment_ids = [] tokens.append(self.tokenizer.vocab.cls_token) segment_ids.append(0) for token in query_tokens: tokens.append(token) segment_ids.append(0) tokens.append(self.tokenizer.vocab.sep_token) segment_ids.append(0) for i in range(doc_span.length): split_token_index = doc_span.start + i token_to_orig_map[len( tokens)] = tok_to_orig_index[split_token_index] is_max_context = _check_is_max_context( doc_spans, doc_span_index, split_token_index) token_is_max_context[len(tokens)] = is_max_context tokens.append(all_doc_tokens[split_token_index]) segment_ids.append(1) tokens.append(self.tokenizer.vocab.sep_token) segment_ids.append(1) if self.do_lookup: input_ids = self.tokenizer.convert_tokens_to_ids(tokens) else: input_ids = tokens valid_length = len(input_ids) if self.is_pad: while len(input_ids) < self.max_seq_length: input_ids.append(padding) segment_ids.append(padding) assert len(input_ids) == self.max_seq_length assert len(segment_ids) == self.max_seq_length start_position = 0 end_position = 0 if self.is_training and not example.is_impossible: doc_start = doc_span.start doc_end = doc_span.start + doc_span.length - 1 out_of_span = False if not (tok_start_position >= doc_start and tok_end_position <= doc_end): out_of_span = True if out_of_span: start_position = 0 end_position = 0 else: doc_offset = len(query_tokens) + 2 start_position = tok_start_position - doc_start + doc_offset end_position = tok_end_position - doc_start + doc_offset if self.is_training and example.is_impossible: start_position = 0 end_position = 0 features.append(SQuADFeature(example_id=example.example_id, qas_id=example.qas_id, doc_tokens=example.doc_tokens, doc_span_index=doc_span_index, tokens=tokens, token_to_orig_map=token_to_orig_map, token_is_max_context=token_is_max_context, input_ids=input_ids, valid_length=valid_length, segment_ids=segment_ids, start_position=start_position, end_position=end_position, is_impossible=example.is_impossible)) return features def __call__(self, record): examples = self._transform(*record) if not examples: return None features = [] for _example in examples: feature = [] feature.append(_example.example_id) feature.append(_example.input_ids) feature.append(_example.segment_ids) feature.append(_example.valid_length) feature.append(_example.start_position) feature.append(_example.end_position) feature.append(len(_example.input_ids)) features.append(feature) return features def _improve_answer_span(doc_tokens, input_start, input_end, tokenizer, orig_answer_text): tok_answer_text = ' '.join(tokenizer(orig_answer_text)) for new_start in range(input_start, input_end + 1): for new_end in range(input_end, new_start - 1, -1): text_span = ' '.join(doc_tokens[new_start:(new_end + 1)]) if text_span == tok_answer_text: return (new_start, new_end) return (input_start, input_end) def _check_is_max_context(doc_spans, cur_span_index, position): best_score = None best_span_index = None for (span_index, doc_span) in enumerate(doc_spans): end = doc_span.start + doc_span.length - 1 if position < doc_span.start: continue if position > end: continue num_left_context = position - doc_span.start num_right_context = end - position score = min(num_left_context, num_right_context) + \ 0.01 * doc_span.length if best_score is None or score > best_score: best_score = score best_span_index = span_index return cur_span_index == best_span_index
true
true
f7264918230895dea85690103d818973bdb62a3f
242
py
Python
prefect/aircraftlib/__init__.py
andersy005/brouillons-quotidien
468ebcc3327f96a6eb3a9a26460790c4f34fdc85
[ "MIT" ]
null
null
null
prefect/aircraftlib/__init__.py
andersy005/brouillons-quotidien
468ebcc3327f96a6eb3a9a26460790c4f34fdc85
[ "MIT" ]
null
null
null
prefect/aircraftlib/__init__.py
andersy005/brouillons-quotidien
468ebcc3327f96a6eb3a9a26460790c4f34fdc85
[ "MIT" ]
null
null
null
# flake8: noqa from .analysis import add_airline_info, clean_vector from .database import Database from .openflights import fetch_reference_data from .opensky import fetch_live_aircraft_data from .position import Area, Position, bounding_box
34.571429
52
0.85124
from .analysis import add_airline_info, clean_vector from .database import Database from .openflights import fetch_reference_data from .opensky import fetch_live_aircraft_data from .position import Area, Position, bounding_box
true
true
f726495538536b17d16dcc758c9c8febfb1dc64a
13,874
py
Python
official/vision/beta/configs/retinanet.py
melG81/models
d9ed5232648228ad58b9d50e29d8fe3bb6aa7c4a
[ "Apache-2.0" ]
1
2021-05-12T08:34:32.000Z
2021-05-12T08:34:32.000Z
official/vision/beta/configs/retinanet.py
melG81/models
d9ed5232648228ad58b9d50e29d8fe3bb6aa7c4a
[ "Apache-2.0" ]
null
null
null
official/vision/beta/configs/retinanet.py
melG81/models
d9ed5232648228ad58b9d50e29d8fe3bb6aa7c4a
[ "Apache-2.0" ]
null
null
null
# Copyright 2021 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # Lint as: python3 """RetinaNet configuration definition.""" import os from typing import List, Optional import dataclasses from official.core import config_definitions as cfg from official.core import exp_factory from official.modeling import hyperparams from official.modeling import optimization from official.vision.beta.configs import backbones from official.vision.beta.configs import common from official.vision.beta.configs import decoders # pylint: disable=missing-class-docstring @dataclasses.dataclass class TfExampleDecoder(hyperparams.Config): regenerate_source_id: bool = False @dataclasses.dataclass class TfExampleDecoderLabelMap(hyperparams.Config): regenerate_source_id: bool = False label_map: str = '' @dataclasses.dataclass class DataDecoder(hyperparams.OneOfConfig): type: Optional[str] = 'simple_decoder' simple_decoder: TfExampleDecoder = TfExampleDecoder() label_map_decoder: TfExampleDecoderLabelMap = TfExampleDecoderLabelMap() @dataclasses.dataclass class Parser(hyperparams.Config): num_channels: int = 3 match_threshold: float = 0.5 unmatched_threshold: float = 0.5 aug_rand_hflip: bool = False aug_scale_min: float = 1.0 aug_scale_max: float = 1.0 skip_crowd_during_training: bool = True max_num_instances: int = 100 @dataclasses.dataclass class DataConfig(cfg.DataConfig): """Input config for training.""" input_path: str = '' global_batch_size: int = 0 is_training: bool = False dtype: str = 'bfloat16' decoder: DataDecoder = DataDecoder() parser: Parser = Parser() shuffle_buffer_size: int = 10000 file_type: str = 'tfrecord' @dataclasses.dataclass class Anchor(hyperparams.Config): num_scales: int = 3 aspect_ratios: List[float] = dataclasses.field( default_factory=lambda: [0.5, 1.0, 2.0]) anchor_size: float = 4.0 @dataclasses.dataclass class Losses(hyperparams.Config): focal_loss_alpha: float = 0.25 focal_loss_gamma: float = 1.5 huber_loss_delta: float = 0.1 box_loss_weight: int = 50 l2_weight_decay: float = 0.0 @dataclasses.dataclass class AttributeHead(hyperparams.Config): name: str = '' type: str = 'regression' size: int = 1 @dataclasses.dataclass class RetinaNetHead(hyperparams.Config): num_convs: int = 4 num_filters: int = 256 use_separable_conv: bool = False attribute_heads: Optional[List[AttributeHead]] = None @dataclasses.dataclass class DetectionGenerator(hyperparams.Config): pre_nms_top_k: int = 5000 pre_nms_score_threshold: float = 0.05 nms_iou_threshold: float = 0.5 max_num_detections: int = 100 use_batched_nms: bool = False @dataclasses.dataclass class RetinaNet(hyperparams.Config): num_classes: int = 0 input_size: List[int] = dataclasses.field(default_factory=list) min_level: int = 3 max_level: int = 7 anchor: Anchor = Anchor() backbone: backbones.Backbone = backbones.Backbone( type='resnet', resnet=backbones.ResNet()) decoder: decoders.Decoder = decoders.Decoder( type='fpn', fpn=decoders.FPN()) head: RetinaNetHead = RetinaNetHead() detection_generator: DetectionGenerator = DetectionGenerator() norm_activation: common.NormActivation = common.NormActivation() @dataclasses.dataclass class RetinaNetTask(cfg.TaskConfig): model: RetinaNet = RetinaNet() train_data: DataConfig = DataConfig(is_training=True) validation_data: DataConfig = DataConfig(is_training=False) losses: Losses = Losses() init_checkpoint: Optional[str] = None init_checkpoint_modules: str = 'all' # all or backbone annotation_file: Optional[str] = None per_category_metrics: bool = False @exp_factory.register_config_factory('retinanet') def retinanet() -> cfg.ExperimentConfig: """RetinaNet general config.""" return cfg.ExperimentConfig( task=RetinaNetTask(), restrictions=[ 'task.train_data.is_training != None', 'task.validation_data.is_training != None' ]) COCO_INPUT_PATH_BASE = 'coco' COCO_TRAIN_EXAMPLES = 118287 COCO_VAL_EXAMPLES = 5000 @exp_factory.register_config_factory('retinanet_resnetfpn_coco') def retinanet_resnetfpn_coco() -> cfg.ExperimentConfig: """COCO object detection with RetinaNet.""" train_batch_size = 256 eval_batch_size = 8 steps_per_epoch = COCO_TRAIN_EXAMPLES // train_batch_size config = cfg.ExperimentConfig( runtime=cfg.RuntimeConfig(mixed_precision_dtype='bfloat16'), task=RetinaNetTask( init_checkpoint='gs://cloud-tpu-checkpoints/vision-2.0/resnet50_imagenet/ckpt-28080', init_checkpoint_modules='backbone', annotation_file=os.path.join(COCO_INPUT_PATH_BASE, 'instances_val2017.json'), model=RetinaNet( num_classes=91, input_size=[640, 640, 3], min_level=3, max_level=7), losses=Losses(l2_weight_decay=1e-4), train_data=DataConfig( input_path=os.path.join(COCO_INPUT_PATH_BASE, 'train*'), is_training=True, global_batch_size=train_batch_size, parser=Parser( aug_rand_hflip=True, aug_scale_min=0.5, aug_scale_max=2.0)), validation_data=DataConfig( input_path=os.path.join(COCO_INPUT_PATH_BASE, 'val*'), is_training=False, global_batch_size=eval_batch_size)), trainer=cfg.TrainerConfig( train_steps=72 * steps_per_epoch, validation_steps=COCO_VAL_EXAMPLES // eval_batch_size, validation_interval=steps_per_epoch, steps_per_loop=steps_per_epoch, summary_interval=steps_per_epoch, checkpoint_interval=steps_per_epoch, optimizer_config=optimization.OptimizationConfig({ 'optimizer': { 'type': 'sgd', 'sgd': { 'momentum': 0.9 } }, 'learning_rate': { 'type': 'stepwise', 'stepwise': { 'boundaries': [ 57 * steps_per_epoch, 67 * steps_per_epoch ], 'values': [ 0.32 * train_batch_size / 256.0, 0.032 * train_batch_size / 256.0, 0.0032 * train_batch_size / 256.0 ], } }, 'warmup': { 'type': 'linear', 'linear': { 'warmup_steps': 500, 'warmup_learning_rate': 0.0067 } } })), restrictions=[ 'task.train_data.is_training != None', 'task.validation_data.is_training != None' ]) return config @exp_factory.register_config_factory('retinanet_spinenet_coco') def retinanet_spinenet_coco() -> cfg.ExperimentConfig: """COCO object detection with RetinaNet using SpineNet backbone.""" train_batch_size = 256 eval_batch_size = 8 steps_per_epoch = COCO_TRAIN_EXAMPLES // train_batch_size input_size = 640 config = cfg.ExperimentConfig( runtime=cfg.RuntimeConfig(mixed_precision_dtype='float32'), task=RetinaNetTask( annotation_file=os.path.join(COCO_INPUT_PATH_BASE, 'instances_val2017.json'), model=RetinaNet( backbone=backbones.Backbone( type='spinenet', spinenet=backbones.SpineNet( model_id='49', stochastic_depth_drop_rate=0.2)), decoder=decoders.Decoder( type='identity', identity=decoders.Identity()), anchor=Anchor(anchor_size=3), norm_activation=common.NormActivation( use_sync_bn=True, activation='swish'), num_classes=91, input_size=[input_size, input_size, 3], min_level=3, max_level=7), losses=Losses(l2_weight_decay=4e-5), train_data=DataConfig( input_path=os.path.join(COCO_INPUT_PATH_BASE, 'train*'), is_training=True, global_batch_size=train_batch_size, parser=Parser( aug_rand_hflip=True, aug_scale_min=0.1, aug_scale_max=2.0)), validation_data=DataConfig( input_path=os.path.join(COCO_INPUT_PATH_BASE, 'val*'), is_training=False, global_batch_size=eval_batch_size)), trainer=cfg.TrainerConfig( train_steps=500 * steps_per_epoch, validation_steps=COCO_VAL_EXAMPLES // eval_batch_size, validation_interval=steps_per_epoch, steps_per_loop=steps_per_epoch, summary_interval=steps_per_epoch, checkpoint_interval=steps_per_epoch, optimizer_config=optimization.OptimizationConfig({ 'optimizer': { 'type': 'sgd', 'sgd': { 'momentum': 0.9 } }, 'learning_rate': { 'type': 'stepwise', 'stepwise': { 'boundaries': [ 475 * steps_per_epoch, 490 * steps_per_epoch ], 'values': [ 0.32 * train_batch_size / 256.0, 0.032 * train_batch_size / 256.0, 0.0032 * train_batch_size / 256.0 ], } }, 'warmup': { 'type': 'linear', 'linear': { 'warmup_steps': 2000, 'warmup_learning_rate': 0.0067 } } })), restrictions=[ 'task.train_data.is_training != None', 'task.validation_data.is_training != None' ]) return config @exp_factory.register_config_factory('retinanet_spinenet_mobile_coco') def retinanet_spinenet_mobile_coco() -> cfg.ExperimentConfig: """COCO object detection with RetinaNet using Mobile SpineNet backbone.""" train_batch_size = 256 eval_batch_size = 8 steps_per_epoch = COCO_TRAIN_EXAMPLES // train_batch_size input_size = 384 config = cfg.ExperimentConfig( runtime=cfg.RuntimeConfig(mixed_precision_dtype='float32'), task=RetinaNetTask( annotation_file=os.path.join(COCO_INPUT_PATH_BASE, 'instances_val2017.json'), model=RetinaNet( backbone=backbones.Backbone( type='spinenet_mobile', spinenet_mobile=backbones.SpineNetMobile( model_id='49', stochastic_depth_drop_rate=0.2)), decoder=decoders.Decoder( type='identity', identity=decoders.Identity()), head=RetinaNetHead(num_filters=48, use_separable_conv=True), anchor=Anchor(anchor_size=3), norm_activation=common.NormActivation( use_sync_bn=True, activation='swish'), num_classes=91, input_size=[input_size, input_size, 3], min_level=3, max_level=7), losses=Losses(l2_weight_decay=3e-5), train_data=DataConfig( input_path=os.path.join(COCO_INPUT_PATH_BASE, 'train*'), is_training=True, global_batch_size=train_batch_size, parser=Parser( aug_rand_hflip=True, aug_scale_min=0.1, aug_scale_max=2.0)), validation_data=DataConfig( input_path=os.path.join(COCO_INPUT_PATH_BASE, 'val*'), is_training=False, global_batch_size=eval_batch_size)), trainer=cfg.TrainerConfig( train_steps=600 * steps_per_epoch, validation_steps=COCO_VAL_EXAMPLES // eval_batch_size, validation_interval=steps_per_epoch, steps_per_loop=steps_per_epoch, summary_interval=steps_per_epoch, checkpoint_interval=steps_per_epoch, optimizer_config=optimization.OptimizationConfig({ 'optimizer': { 'type': 'sgd', 'sgd': { 'momentum': 0.9 } }, 'learning_rate': { 'type': 'stepwise', 'stepwise': { 'boundaries': [ 575 * steps_per_epoch, 590 * steps_per_epoch ], 'values': [ 0.32 * train_batch_size / 256.0, 0.032 * train_batch_size / 256.0, 0.0032 * train_batch_size / 256.0 ], } }, 'warmup': { 'type': 'linear', 'linear': { 'warmup_steps': 2000, 'warmup_learning_rate': 0.0067 } } })), restrictions=[ 'task.train_data.is_training != None', 'task.validation_data.is_training != None' ]) return config
35.302799
95
0.605305
import os from typing import List, Optional import dataclasses from official.core import config_definitions as cfg from official.core import exp_factory from official.modeling import hyperparams from official.modeling import optimization from official.vision.beta.configs import backbones from official.vision.beta.configs import common from official.vision.beta.configs import decoders @dataclasses.dataclass class TfExampleDecoder(hyperparams.Config): regenerate_source_id: bool = False @dataclasses.dataclass class TfExampleDecoderLabelMap(hyperparams.Config): regenerate_source_id: bool = False label_map: str = '' @dataclasses.dataclass class DataDecoder(hyperparams.OneOfConfig): type: Optional[str] = 'simple_decoder' simple_decoder: TfExampleDecoder = TfExampleDecoder() label_map_decoder: TfExampleDecoderLabelMap = TfExampleDecoderLabelMap() @dataclasses.dataclass class Parser(hyperparams.Config): num_channels: int = 3 match_threshold: float = 0.5 unmatched_threshold: float = 0.5 aug_rand_hflip: bool = False aug_scale_min: float = 1.0 aug_scale_max: float = 1.0 skip_crowd_during_training: bool = True max_num_instances: int = 100 @dataclasses.dataclass class DataConfig(cfg.DataConfig): input_path: str = '' global_batch_size: int = 0 is_training: bool = False dtype: str = 'bfloat16' decoder: DataDecoder = DataDecoder() parser: Parser = Parser() shuffle_buffer_size: int = 10000 file_type: str = 'tfrecord' @dataclasses.dataclass class Anchor(hyperparams.Config): num_scales: int = 3 aspect_ratios: List[float] = dataclasses.field( default_factory=lambda: [0.5, 1.0, 2.0]) anchor_size: float = 4.0 @dataclasses.dataclass class Losses(hyperparams.Config): focal_loss_alpha: float = 0.25 focal_loss_gamma: float = 1.5 huber_loss_delta: float = 0.1 box_loss_weight: int = 50 l2_weight_decay: float = 0.0 @dataclasses.dataclass class AttributeHead(hyperparams.Config): name: str = '' type: str = 'regression' size: int = 1 @dataclasses.dataclass class RetinaNetHead(hyperparams.Config): num_convs: int = 4 num_filters: int = 256 use_separable_conv: bool = False attribute_heads: Optional[List[AttributeHead]] = None @dataclasses.dataclass class DetectionGenerator(hyperparams.Config): pre_nms_top_k: int = 5000 pre_nms_score_threshold: float = 0.05 nms_iou_threshold: float = 0.5 max_num_detections: int = 100 use_batched_nms: bool = False @dataclasses.dataclass class RetinaNet(hyperparams.Config): num_classes: int = 0 input_size: List[int] = dataclasses.field(default_factory=list) min_level: int = 3 max_level: int = 7 anchor: Anchor = Anchor() backbone: backbones.Backbone = backbones.Backbone( type='resnet', resnet=backbones.ResNet()) decoder: decoders.Decoder = decoders.Decoder( type='fpn', fpn=decoders.FPN()) head: RetinaNetHead = RetinaNetHead() detection_generator: DetectionGenerator = DetectionGenerator() norm_activation: common.NormActivation = common.NormActivation() @dataclasses.dataclass class RetinaNetTask(cfg.TaskConfig): model: RetinaNet = RetinaNet() train_data: DataConfig = DataConfig(is_training=True) validation_data: DataConfig = DataConfig(is_training=False) losses: Losses = Losses() init_checkpoint: Optional[str] = None init_checkpoint_modules: str = 'all' annotation_file: Optional[str] = None per_category_metrics: bool = False @exp_factory.register_config_factory('retinanet') def retinanet() -> cfg.ExperimentConfig: return cfg.ExperimentConfig( task=RetinaNetTask(), restrictions=[ 'task.train_data.is_training != None', 'task.validation_data.is_training != None' ]) COCO_INPUT_PATH_BASE = 'coco' COCO_TRAIN_EXAMPLES = 118287 COCO_VAL_EXAMPLES = 5000 @exp_factory.register_config_factory('retinanet_resnetfpn_coco') def retinanet_resnetfpn_coco() -> cfg.ExperimentConfig: train_batch_size = 256 eval_batch_size = 8 steps_per_epoch = COCO_TRAIN_EXAMPLES // train_batch_size config = cfg.ExperimentConfig( runtime=cfg.RuntimeConfig(mixed_precision_dtype='bfloat16'), task=RetinaNetTask( init_checkpoint='gs://cloud-tpu-checkpoints/vision-2.0/resnet50_imagenet/ckpt-28080', init_checkpoint_modules='backbone', annotation_file=os.path.join(COCO_INPUT_PATH_BASE, 'instances_val2017.json'), model=RetinaNet( num_classes=91, input_size=[640, 640, 3], min_level=3, max_level=7), losses=Losses(l2_weight_decay=1e-4), train_data=DataConfig( input_path=os.path.join(COCO_INPUT_PATH_BASE, 'train*'), is_training=True, global_batch_size=train_batch_size, parser=Parser( aug_rand_hflip=True, aug_scale_min=0.5, aug_scale_max=2.0)), validation_data=DataConfig( input_path=os.path.join(COCO_INPUT_PATH_BASE, 'val*'), is_training=False, global_batch_size=eval_batch_size)), trainer=cfg.TrainerConfig( train_steps=72 * steps_per_epoch, validation_steps=COCO_VAL_EXAMPLES // eval_batch_size, validation_interval=steps_per_epoch, steps_per_loop=steps_per_epoch, summary_interval=steps_per_epoch, checkpoint_interval=steps_per_epoch, optimizer_config=optimization.OptimizationConfig({ 'optimizer': { 'type': 'sgd', 'sgd': { 'momentum': 0.9 } }, 'learning_rate': { 'type': 'stepwise', 'stepwise': { 'boundaries': [ 57 * steps_per_epoch, 67 * steps_per_epoch ], 'values': [ 0.32 * train_batch_size / 256.0, 0.032 * train_batch_size / 256.0, 0.0032 * train_batch_size / 256.0 ], } }, 'warmup': { 'type': 'linear', 'linear': { 'warmup_steps': 500, 'warmup_learning_rate': 0.0067 } } })), restrictions=[ 'task.train_data.is_training != None', 'task.validation_data.is_training != None' ]) return config @exp_factory.register_config_factory('retinanet_spinenet_coco') def retinanet_spinenet_coco() -> cfg.ExperimentConfig: train_batch_size = 256 eval_batch_size = 8 steps_per_epoch = COCO_TRAIN_EXAMPLES // train_batch_size input_size = 640 config = cfg.ExperimentConfig( runtime=cfg.RuntimeConfig(mixed_precision_dtype='float32'), task=RetinaNetTask( annotation_file=os.path.join(COCO_INPUT_PATH_BASE, 'instances_val2017.json'), model=RetinaNet( backbone=backbones.Backbone( type='spinenet', spinenet=backbones.SpineNet( model_id='49', stochastic_depth_drop_rate=0.2)), decoder=decoders.Decoder( type='identity', identity=decoders.Identity()), anchor=Anchor(anchor_size=3), norm_activation=common.NormActivation( use_sync_bn=True, activation='swish'), num_classes=91, input_size=[input_size, input_size, 3], min_level=3, max_level=7), losses=Losses(l2_weight_decay=4e-5), train_data=DataConfig( input_path=os.path.join(COCO_INPUT_PATH_BASE, 'train*'), is_training=True, global_batch_size=train_batch_size, parser=Parser( aug_rand_hflip=True, aug_scale_min=0.1, aug_scale_max=2.0)), validation_data=DataConfig( input_path=os.path.join(COCO_INPUT_PATH_BASE, 'val*'), is_training=False, global_batch_size=eval_batch_size)), trainer=cfg.TrainerConfig( train_steps=500 * steps_per_epoch, validation_steps=COCO_VAL_EXAMPLES // eval_batch_size, validation_interval=steps_per_epoch, steps_per_loop=steps_per_epoch, summary_interval=steps_per_epoch, checkpoint_interval=steps_per_epoch, optimizer_config=optimization.OptimizationConfig({ 'optimizer': { 'type': 'sgd', 'sgd': { 'momentum': 0.9 } }, 'learning_rate': { 'type': 'stepwise', 'stepwise': { 'boundaries': [ 475 * steps_per_epoch, 490 * steps_per_epoch ], 'values': [ 0.32 * train_batch_size / 256.0, 0.032 * train_batch_size / 256.0, 0.0032 * train_batch_size / 256.0 ], } }, 'warmup': { 'type': 'linear', 'linear': { 'warmup_steps': 2000, 'warmup_learning_rate': 0.0067 } } })), restrictions=[ 'task.train_data.is_training != None', 'task.validation_data.is_training != None' ]) return config @exp_factory.register_config_factory('retinanet_spinenet_mobile_coco') def retinanet_spinenet_mobile_coco() -> cfg.ExperimentConfig: train_batch_size = 256 eval_batch_size = 8 steps_per_epoch = COCO_TRAIN_EXAMPLES // train_batch_size input_size = 384 config = cfg.ExperimentConfig( runtime=cfg.RuntimeConfig(mixed_precision_dtype='float32'), task=RetinaNetTask( annotation_file=os.path.join(COCO_INPUT_PATH_BASE, 'instances_val2017.json'), model=RetinaNet( backbone=backbones.Backbone( type='spinenet_mobile', spinenet_mobile=backbones.SpineNetMobile( model_id='49', stochastic_depth_drop_rate=0.2)), decoder=decoders.Decoder( type='identity', identity=decoders.Identity()), head=RetinaNetHead(num_filters=48, use_separable_conv=True), anchor=Anchor(anchor_size=3), norm_activation=common.NormActivation( use_sync_bn=True, activation='swish'), num_classes=91, input_size=[input_size, input_size, 3], min_level=3, max_level=7), losses=Losses(l2_weight_decay=3e-5), train_data=DataConfig( input_path=os.path.join(COCO_INPUT_PATH_BASE, 'train*'), is_training=True, global_batch_size=train_batch_size, parser=Parser( aug_rand_hflip=True, aug_scale_min=0.1, aug_scale_max=2.0)), validation_data=DataConfig( input_path=os.path.join(COCO_INPUT_PATH_BASE, 'val*'), is_training=False, global_batch_size=eval_batch_size)), trainer=cfg.TrainerConfig( train_steps=600 * steps_per_epoch, validation_steps=COCO_VAL_EXAMPLES // eval_batch_size, validation_interval=steps_per_epoch, steps_per_loop=steps_per_epoch, summary_interval=steps_per_epoch, checkpoint_interval=steps_per_epoch, optimizer_config=optimization.OptimizationConfig({ 'optimizer': { 'type': 'sgd', 'sgd': { 'momentum': 0.9 } }, 'learning_rate': { 'type': 'stepwise', 'stepwise': { 'boundaries': [ 575 * steps_per_epoch, 590 * steps_per_epoch ], 'values': [ 0.32 * train_batch_size / 256.0, 0.032 * train_batch_size / 256.0, 0.0032 * train_batch_size / 256.0 ], } }, 'warmup': { 'type': 'linear', 'linear': { 'warmup_steps': 2000, 'warmup_learning_rate': 0.0067 } } })), restrictions=[ 'task.train_data.is_training != None', 'task.validation_data.is_training != None' ]) return config
true
true
f726499b8d6913a5329f1b82ef19ff7b2b6b251b
1,827
py
Python
Arbitrage_Spot/dquant/entrypoint.py
ronaldzgithub/CryptoArbitrage
b4b7a12b7b11f3dcf950f9d2039dad4f1388530b
[ "MIT" ]
1
2021-11-03T06:16:16.000Z
2021-11-03T06:16:16.000Z
Arbitrage_Spot/dquant/entrypoint.py
benno0810/CryptoArbitrage
b4b7a12b7b11f3dcf950f9d2039dad4f1388530b
[ "MIT" ]
null
null
null
Arbitrage_Spot/dquant/entrypoint.py
benno0810/CryptoArbitrage
b4b7a12b7b11f3dcf950f9d2039dad4f1388530b
[ "MIT" ]
2
2021-05-07T09:11:54.000Z
2021-11-27T16:29:10.000Z
import argparse import logging from logging.handlers import RotatingFileHandler from dquant.datafeed import Datafeed class EntryPoint: datafeed = None def exec_command(self, args ): logging.debug('exec_command:%s' % args) if "feed" in args.command: self.datafeed = Datafeed() if args.markets: self.datafeed.init_markets(args.markets.split(",")) self.datafeed._run_loop() return def init_logger(self, args): level = logging.INFO if args.debug: level = logging.DEBUG logging.basicConfig(format='%(asctime)s [%(levelname)s] %(message)s', level=level) Rthandler = RotatingFileHandler('../logs/dquant.log', maxBytes=100 * 1024 * 1024, backupCount=10) Rthandler.setLevel(level) formatter = logging.Formatter('%(asctime)-12s [%(levelname)s] %(message)s') Rthandler.setFormatter(formatter) logging.getLogger('').addHandler(Rthandler) def main(self): parser = argparse.ArgumentParser() parser.add_argument("-d", "--debug", help="debug verbose mode", action="store_true") parser.add_argument("-m", "--markets", type=str, help="markets, example: -mokexusd") parser.add_argument("-s","--strategy",type=str, help="strategy, example:-smaker") parser.add_argument("command", nargs='*', default="watch", help='verb: "feed|exec|rexec"') args = parser.parse_args() self.init_logger(args) self.exec_command(args) print('main end') exit(-1) def main(): entrypoint = EntryPoint() entrypoint.main() if __name__ == "__main__": main()
31.5
105
0.579639
import argparse import logging from logging.handlers import RotatingFileHandler from dquant.datafeed import Datafeed class EntryPoint: datafeed = None def exec_command(self, args ): logging.debug('exec_command:%s' % args) if "feed" in args.command: self.datafeed = Datafeed() if args.markets: self.datafeed.init_markets(args.markets.split(",")) self.datafeed._run_loop() return def init_logger(self, args): level = logging.INFO if args.debug: level = logging.DEBUG logging.basicConfig(format='%(asctime)s [%(levelname)s] %(message)s', level=level) Rthandler = RotatingFileHandler('../logs/dquant.log', maxBytes=100 * 1024 * 1024, backupCount=10) Rthandler.setLevel(level) formatter = logging.Formatter('%(asctime)-12s [%(levelname)s] %(message)s') Rthandler.setFormatter(formatter) logging.getLogger('').addHandler(Rthandler) def main(self): parser = argparse.ArgumentParser() parser.add_argument("-d", "--debug", help="debug verbose mode", action="store_true") parser.add_argument("-m", "--markets", type=str, help="markets, example: -mokexusd") parser.add_argument("-s","--strategy",type=str, help="strategy, example:-smaker") parser.add_argument("command", nargs='*', default="watch", help='verb: "feed|exec|rexec"') args = parser.parse_args() self.init_logger(args) self.exec_command(args) print('main end') exit(-1) def main(): entrypoint = EntryPoint() entrypoint.main() if __name__ == "__main__": main()
true
true
f7264a51c8db2fd5cc7ad9b2720dd04cb72172fd
5,693
py
Python
noval/python/parser/utils.py
bopopescu/NovalIDE
590c2adb69d54fa4a6c9dad5459198be057b1329
[ "MulanPSL-1.0" ]
null
null
null
noval/python/parser/utils.py
bopopescu/NovalIDE
590c2adb69d54fa4a6c9dad5459198be057b1329
[ "MulanPSL-1.0" ]
null
null
null
noval/python/parser/utils.py
bopopescu/NovalIDE
590c2adb69d54fa4a6c9dad5459198be057b1329
[ "MulanPSL-1.0" ]
null
null
null
# -*- coding: utf-8 -*- import os import sys import functools DATABASE_FILE = "version" def MakeDirs(dirname): dirname = os.path.abspath(dirname) dirname = dirname.replace("\\","/") dirnames = dirname.split("/") destdir = "" destdir = os.path.join(dirnames[0] + "/",dirnames[1]) if not os.path.exists(destdir): os.mkdir(destdir) for name in dirnames[2:]: destdir=os.path.join(destdir,name) if not os.path.exists(destdir): os.mkdir(destdir) def get_relative_name(module_path,path_list = sys.path): path = os.path.dirname(module_path) recent_path = '' while True: #when route to sys path or root path,such as / or c:\\,skip the circle if PathsContainPath(path_list,path) or os.path.dirname(path) == path: recent_path = path break path = os.path.dirname(path) path_name = module_path.replace(recent_path + os.sep,'').split('.')[0] if os.name == 'nt': path_name = path_name.replace(os.sep,'/') parts = path_name.split('/') if parts[-1] == "__init__": relative_module_name = '.'.join(parts[0:-1]) is_package = True else: relative_module_name = '.'.join(parts) is_package = False return relative_module_name,is_package def strcmp(str1,str2): i = 0 while i<len(str1) and i<len(str2): if str1[i] != str2[i]: if str1[i] == '_': return 1 elif str2[i] == '_': return -1 outcome = py_cmp(str1[i],str2[i]) return outcome i += 1 return py_cmp(len(str1),len(str2)) def CmpMember(x,y): if strcmp(x.lower() , y.lower()) == 1: return 1 return -1 def CmpMember2(x,y): if x.startswith("_") and not y.startswith("_"): return 1 elif y.startswith("_") and not x.startswith("_"): return -1 if x.lower() > y.lower(): return 1 return -1 def CompareDatabaseVersion_(new_version,old_version): new_verions = new_version.split(".") old_versions = old_version.split(".") for i,v in enumerate(new_verions): if i >= len(old_versions): return 1 if int(v) > int(old_versions[i]): return 1 return 0 def IsNoneOrEmpty(value): if value is None: return True elif value == "": return True return False def IsPython3(): if sys.version_info[0] >= 3: return True return False def IsPython2(): if sys.version_info[0] == 2: return True return False def ComparePath(path1,path2): if os.name == 'nt': path1 = path1.replace("/",os.sep).rstrip(os.sep) path2 = path2.replace("/",os.sep).rstrip(os.sep) return path1.lower() == path2.lower() return path1.rstrip(os.sep) == path2.rstrip(os.sep) def PathsContainPath(path_list,path): if os.name == 'nt': for p in path_list: if ComparePath(p,path): return True return False return path in path_list def CalcVersionValue(ver_str="0.0.0"): """Calculates a version value from the provided dot-formated string 1) SPECIFICATION: Version value calculation AA.BBB.CCC - major values: < 1 (i.e 0.0.85 = 0.850) - minor values: 1 - 999 (i.e 0.1.85 = 1.850) - micro values: >= 1000 (i.e 1.1.85 = 1001.850) @keyword ver_str: Version string to calculate value of """ ver_str = ''.join([char for char in ver_str if char.isdigit() or char == '.']) ver_lvl = ver_str.split(u".") if len(ver_lvl) < 3: return 0 major = int(ver_lvl[0]) * 1000 minor = int(ver_lvl[1]) if len(ver_lvl[2]) <= 2: ver_lvl[2] += u'0' micro = float(ver_lvl[2]) / 1000 return float(major) + float(minor) + micro def CompareCommonVersion(new_version,old_version): ''' 比较通用版本号大小,如果新版本号大于旧版本号返回1,否则返回0,返回0才正常,返回1需要更新 ''' def format_version(version_str): ''' 标准化版本字符串,至少包含3个点.如果是类似x.x的版本则转换为x.x.0之类的 ''' if len(version_str.split('.')) == 2: version_str += ".0" return version_str new_version = format_version(new_version) old_version = format_version(old_version) if CalcVersionValue(new_version) <= CalcVersionValue(old_version): return 0 return 1 def py_sorted(iter_obj,cmp_func): if IsPython2(): sort_obj = sorted(iter_obj, cmp=cmp_func) elif IsPython3(): sort_obj = sorted(iter_obj, key=functools.cmp_to_key(cmp_func)) return sort_obj def py3_cmp(l,r): if r < l: return 1 if l < r: return -1 return 0 #python3没有cmp函数,自己实现一个 if IsPython2(): py_cmp = cmp elif IsPython3(): py_cmp = py3_cmp def LoadDatabaseVersion(database_location): with open(os.path.join(database_location,DATABASE_FILE)) as f: return f.read() def SaveDatabaseVersion(database_location,new_database_version): with open(os.path.join(database_location,DATABASE_FILE),"w") as f: f.write(new_database_version) def NeedRenewDatabase(database_location,new_database_version): if not os.path.exists(os.path.join(database_location,DATABASE_FILE)): return True old_database_version = LoadDatabaseVersion(database_location) if 0 == CompareCommonVersion(new_database_version,old_database_version): return False return True
30.121693
79
0.585456
import os import sys import functools DATABASE_FILE = "version" def MakeDirs(dirname): dirname = os.path.abspath(dirname) dirname = dirname.replace("\\","/") dirnames = dirname.split("/") destdir = "" destdir = os.path.join(dirnames[0] + "/",dirnames[1]) if not os.path.exists(destdir): os.mkdir(destdir) for name in dirnames[2:]: destdir=os.path.join(destdir,name) if not os.path.exists(destdir): os.mkdir(destdir) def get_relative_name(module_path,path_list = sys.path): path = os.path.dirname(module_path) recent_path = '' while True: if PathsContainPath(path_list,path) or os.path.dirname(path) == path: recent_path = path break path = os.path.dirname(path) path_name = module_path.replace(recent_path + os.sep,'').split('.')[0] if os.name == 'nt': path_name = path_name.replace(os.sep,'/') parts = path_name.split('/') if parts[-1] == "__init__": relative_module_name = '.'.join(parts[0:-1]) is_package = True else: relative_module_name = '.'.join(parts) is_package = False return relative_module_name,is_package def strcmp(str1,str2): i = 0 while i<len(str1) and i<len(str2): if str1[i] != str2[i]: if str1[i] == '_': return 1 elif str2[i] == '_': return -1 outcome = py_cmp(str1[i],str2[i]) return outcome i += 1 return py_cmp(len(str1),len(str2)) def CmpMember(x,y): if strcmp(x.lower() , y.lower()) == 1: return 1 return -1 def CmpMember2(x,y): if x.startswith("_") and not y.startswith("_"): return 1 elif y.startswith("_") and not x.startswith("_"): return -1 if x.lower() > y.lower(): return 1 return -1 def CompareDatabaseVersion_(new_version,old_version): new_verions = new_version.split(".") old_versions = old_version.split(".") for i,v in enumerate(new_verions): if i >= len(old_versions): return 1 if int(v) > int(old_versions[i]): return 1 return 0 def IsNoneOrEmpty(value): if value is None: return True elif value == "": return True return False def IsPython3(): if sys.version_info[0] >= 3: return True return False def IsPython2(): if sys.version_info[0] == 2: return True return False def ComparePath(path1,path2): if os.name == 'nt': path1 = path1.replace("/",os.sep).rstrip(os.sep) path2 = path2.replace("/",os.sep).rstrip(os.sep) return path1.lower() == path2.lower() return path1.rstrip(os.sep) == path2.rstrip(os.sep) def PathsContainPath(path_list,path): if os.name == 'nt': for p in path_list: if ComparePath(p,path): return True return False return path in path_list def CalcVersionValue(ver_str="0.0.0"): ver_str = ''.join([char for char in ver_str if char.isdigit() or char == '.']) ver_lvl = ver_str.split(u".") if len(ver_lvl) < 3: return 0 major = int(ver_lvl[0]) * 1000 minor = int(ver_lvl[1]) if len(ver_lvl[2]) <= 2: ver_lvl[2] += u'0' micro = float(ver_lvl[2]) / 1000 return float(major) + float(minor) + micro def CompareCommonVersion(new_version,old_version): def format_version(version_str): if len(version_str.split('.')) == 2: version_str += ".0" return version_str new_version = format_version(new_version) old_version = format_version(old_version) if CalcVersionValue(new_version) <= CalcVersionValue(old_version): return 0 return 1 def py_sorted(iter_obj,cmp_func): if IsPython2(): sort_obj = sorted(iter_obj, cmp=cmp_func) elif IsPython3(): sort_obj = sorted(iter_obj, key=functools.cmp_to_key(cmp_func)) return sort_obj def py3_cmp(l,r): if r < l: return 1 if l < r: return -1 return 0 if IsPython2(): py_cmp = cmp elif IsPython3(): py_cmp = py3_cmp def LoadDatabaseVersion(database_location): with open(os.path.join(database_location,DATABASE_FILE)) as f: return f.read() def SaveDatabaseVersion(database_location,new_database_version): with open(os.path.join(database_location,DATABASE_FILE),"w") as f: f.write(new_database_version) def NeedRenewDatabase(database_location,new_database_version): if not os.path.exists(os.path.join(database_location,DATABASE_FILE)): return True old_database_version = LoadDatabaseVersion(database_location) if 0 == CompareCommonVersion(new_database_version,old_database_version): return False return True
true
true
f7264b00ab45f44826da46ff3c5c64fce9f84f82
219
py
Python
nothing/nothing/doctype/customer_status/test_customer_status.py
libracore/nothing
e334c5a534eb3ec11ad8c77a467fae05f5383af5
[ "MIT" ]
1
2022-01-12T11:20:22.000Z
2022-01-12T11:20:22.000Z
nothing/nothing/doctype/customer_status/test_customer_status.py
libracore/nothing
e334c5a534eb3ec11ad8c77a467fae05f5383af5
[ "MIT" ]
null
null
null
nothing/nothing/doctype/customer_status/test_customer_status.py
libracore/nothing
e334c5a534eb3ec11ad8c77a467fae05f5383af5
[ "MIT" ]
2
2021-05-07T08:01:13.000Z
2021-08-14T22:24:33.000Z
# -*- coding: utf-8 -*- # Copyright (c) 2021, libracore AG and Contributors # See license.txt from __future__ import unicode_literals # import frappe import unittest class TestCustomerStatus(unittest.TestCase): pass
19.909091
51
0.767123
from __future__ import unicode_literals import unittest class TestCustomerStatus(unittest.TestCase): pass
true
true
f7264b4fcfd7aafc1c81e31c2b3afdfb0672a9ba
1,144
py
Python
code/nn.py
arjunchandra/continuous-rl
8f3c655c6a4b2e9d15a6b052e5466c0a75191a08
[ "MIT" ]
17
2019-03-29T18:30:36.000Z
2021-10-17T15:38:22.000Z
code/nn.py
arjunchandra/continuous-rl
8f3c655c6a4b2e9d15a6b052e5466c0a75191a08
[ "MIT" ]
1
2019-04-22T22:40:30.000Z
2019-04-24T21:45:07.000Z
code/nn.py
ctallec/continuous-rl
8f3c655c6a4b2e9d15a6b052e5466c0a75191a08
[ "MIT" ]
5
2019-04-29T16:26:18.000Z
2020-01-23T07:17:49.000Z
"""Some nn utilities.""" import torch from abstract import ParametricFunction def copy_buffer(net: ParametricFunction, target_net: ParametricFunction): """Copy all buffers from net to target_net.""" with torch.no_grad(): for target_buf, buf in zip(target_net.buffers(), net.buffers()): # type: ignore target_buf.copy_(buf) def soft_update(net: ParametricFunction, target_net: ParametricFunction, tau: float): """Soft update of the parameters of target_net with those of net. Precisely theta_targetnet <- tau * theta_targetnet + (1 - tau) * theta_net """ copy_buffer(net, target_net) with torch.no_grad(): for target_param, param in zip(target_net.parameters(), net.parameters()): target_param.add_(1 - tau, param - target_param) def hard_update(net: ParametricFunction, target_net: ParametricFunction): """Hard update (i.e. copy) of the parameters of target_net with those of net.""" copy_buffer(net, target_net) with torch.no_grad(): for target_param, param in zip(target_net.parameters(), net.parameters()): target_param.copy_(param)
40.857143
87
0.701049
import torch from abstract import ParametricFunction def copy_buffer(net: ParametricFunction, target_net: ParametricFunction): with torch.no_grad(): for target_buf, buf in zip(target_net.buffers(), net.buffers()): target_buf.copy_(buf) def soft_update(net: ParametricFunction, target_net: ParametricFunction, tau: float): copy_buffer(net, target_net) with torch.no_grad(): for target_param, param in zip(target_net.parameters(), net.parameters()): target_param.add_(1 - tau, param - target_param) def hard_update(net: ParametricFunction, target_net: ParametricFunction): copy_buffer(net, target_net) with torch.no_grad(): for target_param, param in zip(target_net.parameters(), net.parameters()): target_param.copy_(param)
true
true
f7264b724b3836bde921699ae915f09f3081112e
598
py
Python
driver/forms.py
Mariga123/carpool
f7330634ace2718c2347694b207b9dd49ef6538f
[ "MIT" ]
null
null
null
driver/forms.py
Mariga123/carpool
f7330634ace2718c2347694b207b9dd49ef6538f
[ "MIT" ]
null
null
null
driver/forms.py
Mariga123/carpool
f7330634ace2718c2347694b207b9dd49ef6538f
[ "MIT" ]
null
null
null
from django.contrib.auth.forms import UserCreationForm from django.contrib.auth.models import User from django import forms from .models import * class RegisterForm(UserCreationForm): email = forms.EmailField() class Meta: model = User fields = ['username', 'email', 'password1', 'password2'] class UserUpdateForm(forms.ModelForm): email = forms.EmailField() class Meta: model = User fields = ['email'] class UpdateForm(forms.ModelForm): class Meta: model = Driver fields = ['name', 'bio', 'avatar','contact_info','vehicle']
26
68
0.667224
from django.contrib.auth.forms import UserCreationForm from django.contrib.auth.models import User from django import forms from .models import * class RegisterForm(UserCreationForm): email = forms.EmailField() class Meta: model = User fields = ['username', 'email', 'password1', 'password2'] class UserUpdateForm(forms.ModelForm): email = forms.EmailField() class Meta: model = User fields = ['email'] class UpdateForm(forms.ModelForm): class Meta: model = Driver fields = ['name', 'bio', 'avatar','contact_info','vehicle']
true
true
f7264d89247663cd466f161ae8db1fc4b69e2f6a
946
py
Python
cms/admin/dialog/views.py
emiquelito/django-cms-2.0
721d6aa91925ff46aa0de9f8ea967ca93e73741b
[ "BSD-3-Clause" ]
1
2015-09-28T10:08:14.000Z
2015-09-28T10:08:14.000Z
cms/admin/dialog/views.py
gmurewa/django-cms-2.0
6fab9d93ddcea301a844996f5f0db7edc4883953
[ "BSD-3-Clause" ]
1
2019-11-08T02:38:49.000Z
2019-11-08T02:38:49.000Z
cms/admin/dialog/views.py
gmurewa/django-cms-2.0
6fab9d93ddcea301a844996f5f0db7edc4883953
[ "BSD-3-Clause" ]
null
null
null
from cms.admin.dialog.forms import get_copy_dialog_form from django.shortcuts import render_to_response, get_object_or_404 from django.contrib.admin.views.decorators import staff_member_required from django.http import Http404, HttpResponse from django.conf import settings from cms.models import Page @staff_member_required def get_copy_dialog(request, page_id): if not settings.CMS_PERMISSION or not settings.CMS_MODERATOR: return HttpResponse('') page = get_object_or_404(Page, pk=page_id) target = get_object_or_404(Page, pk=request.REQUEST['target']) if not page.has_change_permission(request) or \ not target.has_add_permission(request): raise Http404 context = { 'dialog_id': 'dialog-copy', 'form': get_copy_dialog_form(request)(), 'callback': request.REQUEST['callback'], } return render_to_response("admin/cms/page/dialog/copy.html", context)
36.384615
73
0.738901
from cms.admin.dialog.forms import get_copy_dialog_form from django.shortcuts import render_to_response, get_object_or_404 from django.contrib.admin.views.decorators import staff_member_required from django.http import Http404, HttpResponse from django.conf import settings from cms.models import Page @staff_member_required def get_copy_dialog(request, page_id): if not settings.CMS_PERMISSION or not settings.CMS_MODERATOR: return HttpResponse('') page = get_object_or_404(Page, pk=page_id) target = get_object_or_404(Page, pk=request.REQUEST['target']) if not page.has_change_permission(request) or \ not target.has_add_permission(request): raise Http404 context = { 'dialog_id': 'dialog-copy', 'form': get_copy_dialog_form(request)(), 'callback': request.REQUEST['callback'], } return render_to_response("admin/cms/page/dialog/copy.html", context)
true
true
f7264ec3c56d15f017cede4fca8175d52c1cacc4
2,219
py
Python
tests/test_user_storage.py
Cerzon/gb_chat
b4f8a6bf62b0971a135fbb2083456193f7a816cb
[ "Apache-2.0" ]
null
null
null
tests/test_user_storage.py
Cerzon/gb_chat
b4f8a6bf62b0971a135fbb2083456193f7a816cb
[ "Apache-2.0" ]
null
null
null
tests/test_user_storage.py
Cerzon/gb_chat
b4f8a6bf62b0971a135fbb2083456193f7a816cb
[ "Apache-2.0" ]
null
null
null
from unittest.mock import MagicMock import pytest from gb_chat.db.user_history_storage import UserHistoryStorage from gb_chat.db.user_storage import (InvalidName, InvalidPassword, UserExists, UserNotFound, UserStorage) from conftest import VALID_PASSWORD, VALID_USERNAME @pytest.fixture def user_history_storage(): return MagicMock(spec_set=UserHistoryStorage) @pytest.fixture def sut(session, user_history_storage): return UserStorage(session, user_history_storage) @pytest.mark.parametrize("username", ["", " ", "user 1", "usr"]) def test_registers_user_raises_when_username_invalid(username, sut): with pytest.raises(InvalidName): sut.register_user(username, VALID_PASSWORD) @pytest.mark.parametrize("password", ["", "qwerty", "password", "passw0rd", "Passw0rd"]) def test_registers_user_raises_when_password_invalid(password, sut): with pytest.raises(InvalidPassword): sut.register_user(VALID_USERNAME, password) def test_registers_user_adds_register_record(sut, user_history_storage): sut.register_user(VALID_USERNAME, VALID_PASSWORD) user_history_storage.add_register_record.assert_called_once() call = user_history_storage.add_register_record.mock_calls[0] user = call.args[0] assert user.username == VALID_USERNAME assert user.password == VALID_PASSWORD @pytest.fixture def sut_with_user(sut): sut.register_user(VALID_USERNAME, VALID_PASSWORD) return sut def test_registers_user_raises_when_same_name(sut_with_user): with pytest.raises(UserExists): sut_with_user.register_user(VALID_USERNAME, "P@ssw0rd111") @pytest.mark.parametrize( "username,password", [(VALID_USERNAME, "pass"), ("user1", VALID_PASSWORD)] ) def test_credentials_invalid(username, password, sut_with_user): assert not sut_with_user.credentials_valid(username, password) def test_get_user_raises_when_no_user_found(sut): with pytest.raises(UserNotFound): sut.get_user_by_name("aaaa") def test_get_user_raises_when_no_user_found(sut_with_user): user = sut_with_user.get_user_by_name(VALID_USERNAME) assert user.username == VALID_USERNAME assert user.password == VALID_PASSWORD
32.15942
88
0.775124
from unittest.mock import MagicMock import pytest from gb_chat.db.user_history_storage import UserHistoryStorage from gb_chat.db.user_storage import (InvalidName, InvalidPassword, UserExists, UserNotFound, UserStorage) from conftest import VALID_PASSWORD, VALID_USERNAME @pytest.fixture def user_history_storage(): return MagicMock(spec_set=UserHistoryStorage) @pytest.fixture def sut(session, user_history_storage): return UserStorage(session, user_history_storage) @pytest.mark.parametrize("username", ["", " ", "user 1", "usr"]) def test_registers_user_raises_when_username_invalid(username, sut): with pytest.raises(InvalidName): sut.register_user(username, VALID_PASSWORD) @pytest.mark.parametrize("password", ["", "qwerty", "password", "passw0rd", "Passw0rd"]) def test_registers_user_raises_when_password_invalid(password, sut): with pytest.raises(InvalidPassword): sut.register_user(VALID_USERNAME, password) def test_registers_user_adds_register_record(sut, user_history_storage): sut.register_user(VALID_USERNAME, VALID_PASSWORD) user_history_storage.add_register_record.assert_called_once() call = user_history_storage.add_register_record.mock_calls[0] user = call.args[0] assert user.username == VALID_USERNAME assert user.password == VALID_PASSWORD @pytest.fixture def sut_with_user(sut): sut.register_user(VALID_USERNAME, VALID_PASSWORD) return sut def test_registers_user_raises_when_same_name(sut_with_user): with pytest.raises(UserExists): sut_with_user.register_user(VALID_USERNAME, "P@ssw0rd111") @pytest.mark.parametrize( "username,password", [(VALID_USERNAME, "pass"), ("user1", VALID_PASSWORD)] ) def test_credentials_invalid(username, password, sut_with_user): assert not sut_with_user.credentials_valid(username, password) def test_get_user_raises_when_no_user_found(sut): with pytest.raises(UserNotFound): sut.get_user_by_name("aaaa") def test_get_user_raises_when_no_user_found(sut_with_user): user = sut_with_user.get_user_by_name(VALID_USERNAME) assert user.username == VALID_USERNAME assert user.password == VALID_PASSWORD
true
true
f7264fe3b301f10852827f18dc032e373e7bf3a4
25,966
py
Python
tests/test_commandline.py
marcelm/cutadapt
c63043e0f43970619bb7f8c1242912c236d60545
[ "MIT" ]
375
2015-01-16T14:04:50.000Z
2022-03-16T02:19:43.000Z
tests/test_commandline.py
marcelm/cutadapt
c63043e0f43970619bb7f8c1242912c236d60545
[ "MIT" ]
589
2015-03-05T20:06:03.000Z
2022-03-29T22:49:56.000Z
tests/test_commandline.py
marcelm/cutadapt
c63043e0f43970619bb7f8c1242912c236d60545
[ "MIT" ]
150
2015-02-10T12:19:40.000Z
2022-03-25T05:06:50.000Z
import subprocess import sys import os from io import StringIO, BytesIO import dnaio import pytest from cutadapt.__main__ import main from utils import assert_files_equal, datapath, cutpath # pytest.mark.timeout will not fail even if pytest-timeout is not installed try: import pytest_timeout as _unused except ImportError: # pragma: no cover raise ImportError("pytest_timeout needs to be installed") del _unused def test_does_not_close_stdout(): main([datapath("small.fastq")]) assert not sys.stdout.closed def test_help(): with pytest.raises(SystemExit) as e: main(["--help"]) assert e.value.args[0] == 0 def test_unknown_file_format(tmp_path): path = tmp_path / "unknown_format.txt" path.write_text("raw text") with pytest.raises(SystemExit): main([str(path)]) def test_cores_negative(): with pytest.raises(SystemExit) as e: main(["--cores=-1", datapath("simple.fasta")]) assert e.value.args[0] == 2 # "cannot be negative" def test_quiet_and_report(): with pytest.raises(SystemExit) as e: main(["--quiet", "--report=minimal", datapath("simple.fasta")]) assert e.value.args[0] == 2 # "Options --quiet and --report cannot be used at the same time" @pytest.mark.parametrize("args", [ ("--discard-trimmed", "--discard-untrimmed"), ("--discard-trimmed", "--untrimmed-output", os.devnull), ("--discard-untrimmed", "--untrimmed-output", os.devnull), ]) def test_only_one_of_discard_trimmed_discard_untrimmed_untrimmed_output(args): with pytest.raises(SystemExit) as e: main(["-o", os.devnull, *args, datapath("small.fastq")]) assert e.value.args[0] == 2 def test_debug(): main(["--debug", "--", datapath("small.fastq")]) def test_debug_trace(): main(["--debug", "--debug", "-a", "ACGT", datapath("small.fastq")]) def test_example(run): run('-N -b ADAPTER', 'example.fa', 'example.fa') def test_compressed_fasta(run): run("", "simple.fasta", "simple.fasta.gz") def test_small(run): run('-a TTAGACATATCTCCGTCG', 'small.fastq', 'small.fastq') def test_empty(run, cores): """empty input""" run("--cores {} -a TTAGACATATCTCCGTCG".format(cores), "empty.fastq", "empty.fastq") def test_newlines(run): """DOS/Windows newlines""" run('-e 0.12 -a TTAGACATATCTCCGTCG', 'dos.fastq', 'dos.fastq') def test_lowercase(run): """lowercase adapter""" run('-a ttagacatatctccgtcg', 'lowercase.fastq', 'small.fastq') def test_rest(run, tmp_path, cores): """-r/--rest-file""" rest = tmp_path / "rest.tmp" run(['--cores', str(cores), '-b', 'ADAPTER', '-N', '-r', rest], "rest.fa", "rest.fa") assert_files_equal(datapath('rest.txt'), rest) def test_restfront(run, tmp_path): path = tmp_path / "rest.txt" run(['-g', 'ADAPTER', '-N', '-r', path], "restfront.fa", "rest.fa") assert_files_equal(datapath('restfront.txt'), path) def test_discard(run): """--discard""" run("-b TTAGACATATCTCCGTCG --discard", "discard.fastq", "small.fastq") def test_discard_untrimmed(run): """--discard-untrimmed""" run('-b CAAGAT --discard-untrimmed', 'discard-untrimmed.fastq', 'small.fastq') def test_extensiontxtgz(run): """automatic recognition of "_sequence.txt.gz" extension""" run("-b TTAGACATATCTCCGTCG", "s_1_sequence.txt", "s_1_sequence.txt.gz") def test_minimum_length(run): """-m/--minimum-length""" stats = run("-m 5 -a TTAGACATATCTCCGTCG", "minlen.fa", "lengths.fa") assert stats.written_bp[0] == 45 assert stats.written == 6 def test_too_short(run, tmp_path, cores): too_short_path = tmp_path / 'tooshort.fa' stats = run([ "--cores", str(cores), "-m", "5", "-a", "TTAGACATATCTCCGTCG", "--too-short-output", too_short_path ], "minlen.fa", "lengths.fa") assert_files_equal(datapath('tooshort.fa'), too_short_path) assert stats.filtered["too_short"] == 5 @pytest.mark.parametrize("redirect", (False, True)) def test_too_short_statistics(redirect): args = ["-a", "TTAGACATATCTCCGTCG", "-m", "24", "-o", os.devnull, datapath("small.fastq")] if redirect: args[:0] = ["--too-short-output", os.devnull] stats = main(args) assert stats.with_adapters[0] == 2 assert stats.written == 2 assert stats.written_bp[0] == 58 assert stats.filtered["too_short"] == 1 def test_maximum_length(run): """-M/--maximum-length""" run("-M 5 -a TTAGACATATCTCCGTCG", "maxlen.fa", "lengths.fa") def test_too_long(run, tmp_path, cores): """--too-long-output""" too_long_path = tmp_path / 'toolong.fa' stats = run([ "--cores", str(cores), "-M", "5", "-a", "TTAGACATATCTCCGTCG", "--too-long-output", too_long_path ], "maxlen.fa", "lengths.fa") assert_files_equal(datapath('toolong.fa'), too_long_path) assert stats.filtered["too_long"] == 5 def test_length_tag(run): """454 data; -n and --length-tag""" run("-n 3 -e 0.1 --length-tag length= " "-b TGAGACACGCAACAGGGGAAAGGCAAGGCACACAGGGGATAGG " "-b TCCATCTCATCCCTGCGTGTCCCATCTGTTCCCTCCCTGTCTCA", '454.fa', '454.fa') @pytest.mark.parametrize("length", list(range(3, 11))) def test_overlap_a(tmp_path, length): """-O/--overlap with -a""" adapter = "catatctccg" record = ">read\nGAGACCATTCCAATG" + adapter[:length] + '\n' input = tmp_path / "overlap.fasta" input.write_text(record) if length < 7: expected = record else: expected = '>read\nGAGACCATTCCAATG\n' output = tmp_path / "overlap-trimmed.fasta" main(["-O", "7", "-e", "0", "-a", adapter, "-o", str(output), str(input)]) assert expected == output.read_text() def test_overlap_b(run): """-O/--overlap with -b""" run("-O 10 -b TTAGACATATCTCCGTCG", "overlapb.fa", "overlapb.fa") def test_trim_n(run): run("--trim-n", "trim-n.fasta", "trim-n.fasta") def test_qualtrim(run): """-q with low qualities""" run("-q 10 -a XXXXXX", "lowqual.fastq", "lowqual.fastq") def test_qualbase(run): """-q with low qualities, using ascii(quality+64) encoding""" run("-q 10 --quality-base 64 -a XXXXXX", "illumina64.fastq", "illumina64.fastq") def test_quality_trim_only(run): """only trim qualities, do not remove adapters""" run("-q 10 --quality-base 64", "illumina64.fastq", "illumina64.fastq") def test_twoadapters(run): """two adapters""" run("-a AATTTCAGGAATT -a GTTCTCTAGTTCT", "twoadapters.fasta", "twoadapters.fasta") def test_polya(run): """poly-A tails""" run("-m 24 -O 10 -a AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA", "polya.fasta", "polya.fasta") def test_polya_brace_notation(run): """poly-A tails""" run("-m 24 -O 10 -a A{35}", "polya.fasta", "polya.fasta") # the same as --action=none def test_no_trim(run): run("--no-trim --discard-untrimmed -a CCCTAGTTAAAC", 'no-trim.fastq', 'small.fastq') def test_action_none(run): run("--action=none --discard-untrimmed -a CCCTAGTTAAAC", 'no-trim.fastq', 'small.fastq') # the same as --action=mask def test_mask_adapter(run): """mask adapter with N (reads maintain the same length)""" run("-b CAAG -n 3 --mask-adapter", "anywhere_repeat.fastq", "anywhere_repeat.fastq") def test_action_mask(run): """mask adapter with N (reads maintain the same length)""" run("-b CAAG -n 3 --action=mask", "anywhere_repeat.fastq", "anywhere_repeat.fastq") def test_action_lowercase(run): run("-b CAAG -n 3 --action=lowercase", "action_lowercase.fasta", "action_lowercase.fasta") def test_action_retain(run): run("-g GGTTAACC -a CAAG --action=retain", "action_retain.fasta", "action_retain.fasta") def test_action_retain_times(): with pytest.raises(SystemExit): main(["-a", "ACGT", "--times=2", "--action=retain", datapath("small.fastq")]) def test_gz_multiblock(run): """compressed gz file with multiple blocks (created by concatenating two .gz files)""" run("-b TTAGACATATCTCCGTCG", "small.fastq", "multiblock.fastq.gz") def test_read_wildcard(run): """test wildcards in reads""" run("--match-read-wildcards -b ACGTACGT", "wildcard.fa", "wildcard.fa") @pytest.mark.parametrize("adapter_type,expected", [ ("-a", "wildcard_adapter.fa"), ("-b", "wildcard_adapter_anywhere.fa"), ]) def test_adapter_wildcard(adapter_type, expected, run, tmp_path, cores): """wildcards in adapter""" wildcard_path = tmp_path / "wildcards.txt" run([ "--cores", str(cores), "--wildcard-file", wildcard_path, adapter_type, "ACGTNNNACGT" ], expected, "wildcard_adapter.fa") with open(wildcard_path) as wct: lines = wct.readlines() lines = [line.strip() for line in lines] assert lines == ["AAA 1", "GGG 2", "CCC 3b", "TTT 4b"] def test_wildcard_N(run): """test 'N' wildcard matching with no allowed errors""" run("-e 0 -a GGGGGGG --match-read-wildcards", "wildcardN.fa", "wildcardN.fa") def test_illumina_adapter_wildcard(run): run("-a VCCGAMCYUCKHRKDCUBBCNUWNSGHCGU", "illumina.fastq", "illumina.fastq.gz") def test_adapter_front(run): """test adapter in front""" run("--front ADAPTER -N", "examplefront.fa", "example.fa") def test_literal_N(run): """test matching literal 'N's""" run("-N -e 0.2 -a NNNNNNNNNNNNNN", "trimN3.fasta", "trimN3.fasta") def test_literal_N2(run): run("-N -O 1 -g NNNNNNNNNNNNNN", "trimN5.fasta", "trimN5.fasta") def test_literal_N_brace_notation(run): """test matching literal 'N's""" run("-N -e 0.2 -a N{14}", "trimN3.fasta", "trimN3.fasta") def test_literal_N2_brace_notation(run): run("-N -O 1 -g N{14}", "trimN5.fasta", "trimN5.fasta") def test_anchored_front(run): run("-g ^FRONTADAPT -N", "anchored.fasta", "anchored.fasta") def test_anchored_front_ellipsis_notation(run): run("-a ^FRONTADAPT... -N", "anchored.fasta", "anchored.fasta") def test_anchored_back(run): run("-a BACKADAPTER$ -N", "anchored-back.fasta", "anchored-back.fasta") def test_anchored_back_ellipsis_notation(run): run("-a ...BACKADAPTER$ -N", "anchored-back.fasta", "anchored-back.fasta") def test_anchored_back_no_indels(run): run("-a BACKADAPTER$ -N --no-indels", "anchored-back.fasta", "anchored-back.fasta") def test_no_indels(run): run('-a TTAGACATAT -g GAGATTGCCA --no-indels', 'no_indels.fasta', 'no_indels.fasta') def test_ellipsis_notation(run): run('-a ...TTAGACATAT -g GAGATTGCCA --no-indels', 'no_indels.fasta', 'no_indels.fasta') def test_issue_46(run, tmp_path): """issue 46 - IndexError with --wildcard-file""" run("--anywhere=AACGTN --wildcard-file={}".format( tmp_path / "wildcards.txt"), "issue46.fasta", "issue46.fasta") def test_strip_suffix(run): run("--strip-suffix _sequence -a XXXXXXX", "stripped.fasta", "simple.fasta") def test_info_file(run, tmp_path, cores): # The true adapter sequence in the illumina.fastq.gz data set is # GCCTAACTTCTTAGACTGCCTTAAGGACGT (fourth base is different from the sequence shown here) info_path = tmp_path / "info.txt" run(["--cores", str(cores), "--info-file", info_path, "-a", "adapt=GCCGAACTTCTTAGACTGCCTTAAGGACGT"], "illumina.fastq", "illumina.fastq.gz") assert_files_equal(cutpath("illumina.info.txt"), info_path, ignore_trailing_space=True) def test_info_file_times(run, tmp_path, cores): info_path = tmp_path / "info.txt" run(["--cores", str(cores), "--info-file", info_path, "--times", "2", "-a", "adapt=GCCGAACTTCTTA", "-a", "adapt2=GACTGCCTTAAGGACGT"], "illumina5.fastq", "illumina5.fastq") assert_files_equal(cutpath('illumina5.info.txt'), info_path, ignore_trailing_space=True) def test_info_file_fasta(run, tmp_path, cores): info_path = tmp_path / "info.txt" # Just make sure that it runs run(["--cores", str(cores), "--info-file", info_path, "-a", "TTAGACATAT", "-g", "GAGATTGCCA", "--no-indels"], "no_indels.fasta", "no_indels.fasta") def test_info_file_revcomp(run, tmp_path): info_path = tmp_path / "info-rc.txt" main([ "--info-file", str(info_path), "-a", "adapt=GAGTCG", "--revcomp", "--rename={header}", "-o", str(tmp_path / "out.fasta"), datapath("info-rc.fasta") ]) assert_files_equal(cutpath("info-rc.txt"), info_path) def test_named_adapter(run): run("-a MY_ADAPTER=GCCGAACTTCTTAGACTGCCTTAAGGACGT", "illumina.fastq", "illumina.fastq.gz") def test_adapter_with_u(run): run("-a GCCGAACUUCUUAGACUGCCUUAAGGACGU", "illumina.fastq", "illumina.fastq.gz") def test_bzip2_input(run, cores): run(["--cores", str(cores), "-a", "TTAGACATATCTCCGTCG"], "small.fastq", "small.fastq.bz2") @pytest.mark.parametrize("extension", ["bz2", "xz", "gz"]) def test_compressed_output(tmp_path, cores, extension): out_path = str(tmp_path / ("small.fastq." + extension)) params = [ "--cores", str(cores), "-a", "TTAGACATATCTCCGTCG", "-o", out_path, datapath("small.fastq")] main(params) def test_bzip2_multiblock(run): run("-b TTAGACATATCTCCGTCG", "small.fastq", "multiblock.fastq.bz2") def test_xz(run): run('-b TTAGACATATCTCCGTCG', 'small.fastq', 'small.fastq.xz') def test_no_args(): with pytest.raises(SystemExit): main([]) def test_two_fastqs(): with pytest.raises(SystemExit): main([datapath('paired.1.fastq'), datapath('paired.2.fastq')]) def test_anchored_no_indels(run): """anchored 5' adapter, mismatches only (no indels)""" run('-g ^TTAGACATAT --no-indels -e 0.1', 'anchored_no_indels.fasta', 'anchored_no_indels.fasta') def test_anchored_no_indels_wildcard_read(run): """anchored 5' adapter, mismatches only (no indels), but wildcards in the read count as matches""" run('-g ^TTAGACATAT --match-read-wildcards --no-indels -e 0.1', 'anchored_no_indels_wildcard.fasta', 'anchored_no_indels.fasta') def test_anchored_no_indels_wildcard_adapt(run): """anchored 5' adapter, mismatches only (no indels), but wildcards in the adapter count as matches""" run('-g ^TTAGACANAT --no-indels -e 0.12', 'anchored_no_indels.fasta', 'anchored_no_indels.fasta') def test_non_iupac_characters(run): with pytest.raises(SystemExit): main(['-a', 'ZACGT', datapath('small.fastq')]) def test_unconditional_cut_front(run): run('-u 5', 'unconditional-front.fastq', 'small.fastq') def test_unconditional_cut_back(run): run('-u -5', 'unconditional-back.fastq', 'small.fastq') def test_unconditional_cut_both(run): run('-u -5 -u 5', 'unconditional-both.fastq', 'small.fastq') def test_unconditional_cut_too_many_commas(): with pytest.raises(SystemExit): main(["-u", "5,7,8", datapath("small.fastq")]) def test_unconditional_cut_invalid_number(): with pytest.raises(SystemExit): main(["-u", "a,b", datapath("small.fastq")]) def test_untrimmed_output(run, cores, tmp_path): path = tmp_path / "untrimmed.fastq" stats = run(["--cores", str(cores), "-a", "TTAGACATATCTCCGTCG", "--untrimmed-output", path], "small.trimmed.fastq", "small.fastq") assert_files_equal(cutpath("small.untrimmed.fastq"), path) assert stats.with_adapters[0] == 2 assert stats.written == 2 assert stats.written_bp[0] == 46 def test_adapter_file(run): run('-a file:' + datapath('adapter.fasta'), 'illumina.fastq', 'illumina.fastq.gz') def test_adapter_file_5p_anchored(run): run('-N -g file:' + datapath('prefix-adapter.fasta'), 'anchored.fasta', 'anchored.fasta') def test_adapter_file_3p_anchored(run): run('-N -a file:' + datapath('suffix-adapter.fasta'), 'anchored-back.fasta', 'anchored-back.fasta') def test_adapter_file_5p_anchored_no_indels(run): run('-N --no-indels -g file:' + datapath('prefix-adapter.fasta'), 'anchored.fasta', 'anchored.fasta') def test_adapter_file_3p_anchored_no_indels(run): run('-N --no-indels -a file:' + datapath('suffix-adapter.fasta'), 'anchored-back.fasta', 'anchored-back.fasta') def test_adapter_file_empty_name(run): run('-N -a file:' + datapath('adapter-empty-name.fasta'), 'illumina.fastq', 'illumina.fastq.gz') @pytest.mark.parametrize("ext", ["", ".gz"]) def test_demultiplex(cores, tmp_path, ext): multiout = str(tmp_path / 'tmp-demulti.{name}.fasta') + ext params = [ '--cores', str(cores), '-a', 'first=AATTTCAGGAATT', '-a', 'second=GTTCTCTAGTTCT', '-o', multiout, datapath('twoadapters.fasta'), ] main(params) for name in ("first", "second", "unknown"): actual = multiout.format(name=name) if ext == ".gz": subprocess.run(["gzip", "-d", actual], check=True) actual = actual[:-3] expected = cutpath("twoadapters.{name}.fasta".format(name=name)) assert_files_equal(expected, actual) def test_multiple_fake_anchored_adapters(run): run("-g ^CGTCCGAAGTAGC -g ^ATTGCCCTAG " "-a TTCCATGCAGCATT$ -a CCAGTCCCCCC$ " "-a GCCGAACTTCTTAGACTGCCTTAAGGACGT", "illumina.fastq", "illumina.fastq.gz") def test_multiple_prefix_adapters(run): run("-g ^GTACGGATTGTTCAGTA -g ^TATTAAGCTCATTC", "multiprefix.fasta", "multi.fasta") def test_multiple_prefix_adapters_noindels(run): run("--no-indels -g ^GTACGGATTGTTCAGTA -g ^TATTAAGCTCATTC", "multiprefix.fasta", "multi.fasta") def test_multiple_suffix_adapters_noindels(run): run("--no-indels -a CGTGATTATCTTGC$ -a CCTATTAGTGGTTGAAC$", "multisuffix.fasta", "multi.fasta") def test_max_n(run): assert run('--max-n 0', 'maxn0.fasta', 'maxn.fasta').filtered["too_many_n"] == 4 assert run('--max-n 1', 'maxn1.fasta', 'maxn.fasta').filtered["too_many_n"] == 2 assert run('--max-n 2', 'maxn2.fasta', 'maxn.fasta').filtered["too_many_n"] == 1 assert run('--max-n 0.2', 'maxn0.2.fasta', 'maxn.fasta').filtered["too_many_n"] == 3 assert run('--max-n 0.4', 'maxn0.4.fasta', 'maxn.fasta').filtered["too_many_n"] == 2 def test_quiet_is_quiet(): captured_standard_output = StringIO() captured_standard_error = StringIO() setattr(captured_standard_output, "buffer", BytesIO()) setattr(captured_standard_error, "buffer", BytesIO()) old_stdout = sys.stdout old_stderr = sys.stderr try: sys.stdout = captured_standard_output sys.stderr = captured_standard_error main(['-o', os.devnull, '--quiet', datapath('small.fastq')]) finally: sys.stdout = old_stdout sys.stderr = old_stderr assert captured_standard_output.getvalue() == '' assert captured_standard_error.getvalue() == '' assert getattr(captured_standard_output, "buffer").getvalue() == b'' assert getattr(captured_standard_output, "buffer").getvalue() == b'' def test_x_brace_notation(): main(['-o', os.devnull, '--quiet', '-a', 'X{5}', datapath('small.fastq')]) def test_nextseq(run): run('--nextseq-trim 22', 'nextseq.fastq', 'nextseq.fastq') def test_linked_explicitly_anchored(run): run('-a ^AAAAAAAAAA...TTTTTTTTTT', 'linked.fasta', 'linked.fasta') def test_linked_multiple(run): run('-a ^AAAAAAAAAA...TTTTTTTTTT -a ^AAAAAAAAAA...GCGCGCGCGC', 'linked.fasta', 'linked.fasta') def test_linked_both_anchored(run): run('-a ^AAAAAAAAAA...TTTTT$', 'linked-anchored.fasta', 'linked.fasta') def test_linked_5p_not_anchored(run): run('-g AAAAAAAAAA...TTTTTTTTTT', 'linked-not-anchored.fasta', 'linked.fasta') def test_linked_discard_untrimmed(run): run('-a ^AAAAAAAAAA...TTTTTTTTTT --discard-untrimmed', 'linked-discard.fasta', 'linked.fasta') def test_linked_discard_untrimmed_g(run): run('-g AAAAAAAAAA...TTTTTTTTTT --discard-untrimmed', 'linked-discard-g.fasta', 'linked.fasta') def test_linked_lowercase(run): run('-a ^AACCGGTTTT...GGGGGGG$ -a ^AAAA...TTTT$ --times=2 --action=lowercase', 'linked-lowercase.fasta', 'linked.fasta') def test_linked_info_file(tmp_path): info_path = tmp_path / 'info.txt' main(['-a linkedadapter=^AAAAAAAAAA...TTTTTTTTTT', '--info-file', str(info_path), '-o', str(tmp_path / 'out.fasta'), datapath('linked.fasta')]) assert_files_equal(cutpath('linked-info.txt'), info_path, ignore_trailing_space=True) def test_linked_anywhere(): with pytest.raises(SystemExit): main(['-b', 'AAA...TTT', datapath('linked.fasta')]) def test_anywhere_anchored_5p(): with pytest.raises(SystemExit): main(['-b', '^AAA', datapath('small.fastq')]) def test_anywhere_anchored_3p(): with pytest.raises(SystemExit): main(['-b', 'TTT$', datapath('small.fastq')]) def test_fasta(run): run('-a TTAGACATATCTCCGTCG', 'small.fasta', 'small.fastq') def test_fasta_no_trim(run): run([], 'small-no-trim.fasta', 'small.fastq') def test_length(run): run('--length 5', 'shortened.fastq', 'small.fastq') def test_negative_length(run): run('--length -5', 'shortened-negative.fastq', 'small.fastq') @pytest.mark.timeout(0.5) def test_issue_296(tmp_path): # Hang when using both --no-trim and --info-file together info_path = tmp_path / 'info.txt' reads_path = tmp_path / 'reads.fasta' out_path = tmp_path / 'out.fasta' reads_path.write_text(">read\nCACAAA\n") main([ "--info-file", str(info_path), "--no-trim", "-g", "TTTCAC", "-o", str(out_path), str(reads_path), ]) # Output should be unchanged because of --no-trim assert_files_equal(reads_path, out_path) def test_xadapter(run): run('-g XTCCGAATAGA', 'xadapter.fasta', 'xadapterx.fasta') def test_adapterx(run): run('-a TCCGAATAGAX', 'adapterx.fasta', 'xadapterx.fasta') def test_discard_casava(run): stats = run('--discard-casava', 'casava.fastq', 'casava.fastq') assert stats.filtered["casava_filtered"] == 1 def test_underscore(run): """File name ending in _fastq.gz (issue #275)""" run('-b TTAGACATATCTCCGTCG', 'small.fastq', 'underscore_fastq.gz') def test_cores_autodetect(run): # Just make sure that it runs; functionality is not tested run('--cores 0 -b TTAGACATATCTCCGTCG', 'small.fastq', 'underscore_fastq.gz') def test_write_compressed_fastq(cores, tmp_path): main(['--cores', str(cores), '-o', str(tmp_path / 'out.fastq.gz'), datapath('small.fastq')]) def test_minimal_report(run): run('-b TTAGACATATCTCCGTCG --report=minimal', 'small.fastq', 'small.fastq') def test_paired_separate(run): """test separate trimming of paired-end reads""" run("-a TTAGACATAT", "paired-separate.1.fastq", "paired.1.fastq") run("-a CAGTGGAGTA", "paired-separate.2.fastq", "paired.2.fastq") def test_empty_read_with_wildcard_in_adapter(run): run("-g CWC", "empty.fastq", "empty.fastq") def test_print_progress_to_tty(tmp_path, mocker): mocker.patch("cutadapt.utils.sys.stderr").isatty.return_value = True main(["-o", str(tmp_path / "out.fastq"), datapath("small.fastq")]) def test_adapter_order(run): run("-g ^AAACC -a CCGGG", "adapterorder-ga.fasta", "adapterorder.fasta") run("-a CCGGG -g ^AAACC", "adapterorder-ag.fasta", "adapterorder.fasta") def test_reverse_complement_no_rc_suffix(run, tmp_path): out_path = tmp_path / "out.fastq" main([ "-o", str(out_path), "--revcomp", "--no-index", "--rename", "{header}", "-g", "^TTATTTGTCT", "-g", "^TCCGCACTGG", datapath("revcomp.1.fastq") ]) with dnaio.open(out_path) as f: reads = list(f) assert len(reads) == 6 assert reads[1].name == "read2/1" assert reads[1].sequence == "ACCATCCGATATGTCTAATGTGGCCTGTTG" def test_reverse_complement_normalized(run): stats = run( "--revcomp --no-index -g ^TTATTTGTCT -g ^TCCGCACTGG", "revcomp-single-normalize.fastq", "revcomp.1.fastq", ) assert stats.n == 6 assert stats.reverse_complemented == 2 def test_reverse_complement_and_info_file(run, tmp_path, cores): info_path = str(tmp_path / "info.txt") run( [ "--revcomp", "--no-index", "-g", "^TTATTTGTCT", "-g", "^TCCGCACTGG", "--info-file", info_path, ], "revcomp-single-normalize.fastq", "revcomp.1.fastq", ) with open(info_path) as f: lines = f.readlines() assert len(lines) == 6 assert lines[0].split("\t")[0] == "read1/1" assert lines[1].split("\t")[0] == "read2/1 rc" def test_max_expected_errors(run, cores): stats = run("--max-ee=0.9", "maxee.fastq", "maxee.fastq") assert stats.filtered["too_many_expected_errors"] == 2 def test_max_expected_errors_fasta(tmp_path): path = tmp_path / "input.fasta" path.write_text(">read\nACGTACGT\n") main(["--max-ee=0.001", "-o", os.devnull, str(path)]) def test_warn_if_en_dashes_used(): with pytest.raises(SystemExit): main(["–q", "25", "-o", os.devnull, "in.fastq"]) @pytest.mark.parametrize("opt", ["-y", "--suffix"]) def test_suffix(opt, run): """-y/--suffix parameter""" run([opt, ' {name}', '-e', '0', '-a', 'OnlyT=TTTTTTTT', '-a', 'OnlyG=GGGGGGGG'], "suffix.fastq", "suffix.fastq") @pytest.mark.parametrize("opt", ["--prefix", "--suffix"]) def test_rename_cannot_be_combined_with_other_renaming_options(opt): with pytest.raises(SystemExit): main([opt, "something", "--rename='{id} {comment} extrainfo'", "-o", os.devnull, datapath("empty.fastq")]) def test_rename(run): run([ "--rename={id}_{cut_suffix} {header} {adapter_name}", "--cut=-4", "-a", "OnlyT=TTTTTT", "-a", "OnlyG=GGGGGG", ], "rename.fastq", "suffix.fastq") @pytest.mark.skip("This has not been fixed") def test_terminates_correctly_on_error_in_subprocess(tmp_path): params = [ "-j", "2", "-o", str(tmp_path / "out.fastq.gz"), datapath("format-error.fastq"), ] with pytest.raises(SystemExit): main(params)
31.359903
116
0.655973
import subprocess import sys import os from io import StringIO, BytesIO import dnaio import pytest from cutadapt.__main__ import main from utils import assert_files_equal, datapath, cutpath try: import pytest_timeout as _unused except ImportError: raise ImportError("pytest_timeout needs to be installed") del _unused def test_does_not_close_stdout(): main([datapath("small.fastq")]) assert not sys.stdout.closed def test_help(): with pytest.raises(SystemExit) as e: main(["--help"]) assert e.value.args[0] == 0 def test_unknown_file_format(tmp_path): path = tmp_path / "unknown_format.txt" path.write_text("raw text") with pytest.raises(SystemExit): main([str(path)]) def test_cores_negative(): with pytest.raises(SystemExit) as e: main(["--cores=-1", datapath("simple.fasta")]) assert e.value.args[0] == 2 def test_quiet_and_report(): with pytest.raises(SystemExit) as e: main(["--quiet", "--report=minimal", datapath("simple.fasta")]) assert e.value.args[0] == 2 @pytest.mark.parametrize("args", [ ("--discard-trimmed", "--discard-untrimmed"), ("--discard-trimmed", "--untrimmed-output", os.devnull), ("--discard-untrimmed", "--untrimmed-output", os.devnull), ]) def test_only_one_of_discard_trimmed_discard_untrimmed_untrimmed_output(args): with pytest.raises(SystemExit) as e: main(["-o", os.devnull, *args, datapath("small.fastq")]) assert e.value.args[0] == 2 def test_debug(): main(["--debug", "--", datapath("small.fastq")]) def test_debug_trace(): main(["--debug", "--debug", "-a", "ACGT", datapath("small.fastq")]) def test_example(run): run('-N -b ADAPTER', 'example.fa', 'example.fa') def test_compressed_fasta(run): run("", "simple.fasta", "simple.fasta.gz") def test_small(run): run('-a TTAGACATATCTCCGTCG', 'small.fastq', 'small.fastq') def test_empty(run, cores): run("--cores {} -a TTAGACATATCTCCGTCG".format(cores), "empty.fastq", "empty.fastq") def test_newlines(run): run('-e 0.12 -a TTAGACATATCTCCGTCG', 'dos.fastq', 'dos.fastq') def test_lowercase(run): run('-a ttagacatatctccgtcg', 'lowercase.fastq', 'small.fastq') def test_rest(run, tmp_path, cores): rest = tmp_path / "rest.tmp" run(['--cores', str(cores), '-b', 'ADAPTER', '-N', '-r', rest], "rest.fa", "rest.fa") assert_files_equal(datapath('rest.txt'), rest) def test_restfront(run, tmp_path): path = tmp_path / "rest.txt" run(['-g', 'ADAPTER', '-N', '-r', path], "restfront.fa", "rest.fa") assert_files_equal(datapath('restfront.txt'), path) def test_discard(run): run("-b TTAGACATATCTCCGTCG --discard", "discard.fastq", "small.fastq") def test_discard_untrimmed(run): run('-b CAAGAT --discard-untrimmed', 'discard-untrimmed.fastq', 'small.fastq') def test_extensiontxtgz(run): run("-b TTAGACATATCTCCGTCG", "s_1_sequence.txt", "s_1_sequence.txt.gz") def test_minimum_length(run): stats = run("-m 5 -a TTAGACATATCTCCGTCG", "minlen.fa", "lengths.fa") assert stats.written_bp[0] == 45 assert stats.written == 6 def test_too_short(run, tmp_path, cores): too_short_path = tmp_path / 'tooshort.fa' stats = run([ "--cores", str(cores), "-m", "5", "-a", "TTAGACATATCTCCGTCG", "--too-short-output", too_short_path ], "minlen.fa", "lengths.fa") assert_files_equal(datapath('tooshort.fa'), too_short_path) assert stats.filtered["too_short"] == 5 @pytest.mark.parametrize("redirect", (False, True)) def test_too_short_statistics(redirect): args = ["-a", "TTAGACATATCTCCGTCG", "-m", "24", "-o", os.devnull, datapath("small.fastq")] if redirect: args[:0] = ["--too-short-output", os.devnull] stats = main(args) assert stats.with_adapters[0] == 2 assert stats.written == 2 assert stats.written_bp[0] == 58 assert stats.filtered["too_short"] == 1 def test_maximum_length(run): run("-M 5 -a TTAGACATATCTCCGTCG", "maxlen.fa", "lengths.fa") def test_too_long(run, tmp_path, cores): too_long_path = tmp_path / 'toolong.fa' stats = run([ "--cores", str(cores), "-M", "5", "-a", "TTAGACATATCTCCGTCG", "--too-long-output", too_long_path ], "maxlen.fa", "lengths.fa") assert_files_equal(datapath('toolong.fa'), too_long_path) assert stats.filtered["too_long"] == 5 def test_length_tag(run): run("-n 3 -e 0.1 --length-tag length= " "-b TGAGACACGCAACAGGGGAAAGGCAAGGCACACAGGGGATAGG " "-b TCCATCTCATCCCTGCGTGTCCCATCTGTTCCCTCCCTGTCTCA", '454.fa', '454.fa') @pytest.mark.parametrize("length", list(range(3, 11))) def test_overlap_a(tmp_path, length): adapter = "catatctccg" record = ">read\nGAGACCATTCCAATG" + adapter[:length] + '\n' input = tmp_path / "overlap.fasta" input.write_text(record) if length < 7: expected = record else: expected = '>read\nGAGACCATTCCAATG\n' output = tmp_path / "overlap-trimmed.fasta" main(["-O", "7", "-e", "0", "-a", adapter, "-o", str(output), str(input)]) assert expected == output.read_text() def test_overlap_b(run): run("-O 10 -b TTAGACATATCTCCGTCG", "overlapb.fa", "overlapb.fa") def test_trim_n(run): run("--trim-n", "trim-n.fasta", "trim-n.fasta") def test_qualtrim(run): run("-q 10 -a XXXXXX", "lowqual.fastq", "lowqual.fastq") def test_qualbase(run): run("-q 10 --quality-base 64 -a XXXXXX", "illumina64.fastq", "illumina64.fastq") def test_quality_trim_only(run): run("-q 10 --quality-base 64", "illumina64.fastq", "illumina64.fastq") def test_twoadapters(run): run("-a AATTTCAGGAATT -a GTTCTCTAGTTCT", "twoadapters.fasta", "twoadapters.fasta") def test_polya(run): run("-m 24 -O 10 -a AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA", "polya.fasta", "polya.fasta") def test_polya_brace_notation(run): run("-m 24 -O 10 -a A{35}", "polya.fasta", "polya.fasta") def test_no_trim(run): run("--no-trim --discard-untrimmed -a CCCTAGTTAAAC", 'no-trim.fastq', 'small.fastq') def test_action_none(run): run("--action=none --discard-untrimmed -a CCCTAGTTAAAC", 'no-trim.fastq', 'small.fastq') def test_mask_adapter(run): run("-b CAAG -n 3 --mask-adapter", "anywhere_repeat.fastq", "anywhere_repeat.fastq") def test_action_mask(run): run("-b CAAG -n 3 --action=mask", "anywhere_repeat.fastq", "anywhere_repeat.fastq") def test_action_lowercase(run): run("-b CAAG -n 3 --action=lowercase", "action_lowercase.fasta", "action_lowercase.fasta") def test_action_retain(run): run("-g GGTTAACC -a CAAG --action=retain", "action_retain.fasta", "action_retain.fasta") def test_action_retain_times(): with pytest.raises(SystemExit): main(["-a", "ACGT", "--times=2", "--action=retain", datapath("small.fastq")]) def test_gz_multiblock(run): run("-b TTAGACATATCTCCGTCG", "small.fastq", "multiblock.fastq.gz") def test_read_wildcard(run): run("--match-read-wildcards -b ACGTACGT", "wildcard.fa", "wildcard.fa") @pytest.mark.parametrize("adapter_type,expected", [ ("-a", "wildcard_adapter.fa"), ("-b", "wildcard_adapter_anywhere.fa"), ]) def test_adapter_wildcard(adapter_type, expected, run, tmp_path, cores): wildcard_path = tmp_path / "wildcards.txt" run([ "--cores", str(cores), "--wildcard-file", wildcard_path, adapter_type, "ACGTNNNACGT" ], expected, "wildcard_adapter.fa") with open(wildcard_path) as wct: lines = wct.readlines() lines = [line.strip() for line in lines] assert lines == ["AAA 1", "GGG 2", "CCC 3b", "TTT 4b"] def test_wildcard_N(run): run("-e 0 -a GGGGGGG --match-read-wildcards", "wildcardN.fa", "wildcardN.fa") def test_illumina_adapter_wildcard(run): run("-a VCCGAMCYUCKHRKDCUBBCNUWNSGHCGU", "illumina.fastq", "illumina.fastq.gz") def test_adapter_front(run): run("--front ADAPTER -N", "examplefront.fa", "example.fa") def test_literal_N(run): run("-N -e 0.2 -a NNNNNNNNNNNNNN", "trimN3.fasta", "trimN3.fasta") def test_literal_N2(run): run("-N -O 1 -g NNNNNNNNNNNNNN", "trimN5.fasta", "trimN5.fasta") def test_literal_N_brace_notation(run): run("-N -e 0.2 -a N{14}", "trimN3.fasta", "trimN3.fasta") def test_literal_N2_brace_notation(run): run("-N -O 1 -g N{14}", "trimN5.fasta", "trimN5.fasta") def test_anchored_front(run): run("-g ^FRONTADAPT -N", "anchored.fasta", "anchored.fasta") def test_anchored_front_ellipsis_notation(run): run("-a ^FRONTADAPT... -N", "anchored.fasta", "anchored.fasta") def test_anchored_back(run): run("-a BACKADAPTER$ -N", "anchored-back.fasta", "anchored-back.fasta") def test_anchored_back_ellipsis_notation(run): run("-a ...BACKADAPTER$ -N", "anchored-back.fasta", "anchored-back.fasta") def test_anchored_back_no_indels(run): run("-a BACKADAPTER$ -N --no-indels", "anchored-back.fasta", "anchored-back.fasta") def test_no_indels(run): run('-a TTAGACATAT -g GAGATTGCCA --no-indels', 'no_indels.fasta', 'no_indels.fasta') def test_ellipsis_notation(run): run('-a ...TTAGACATAT -g GAGATTGCCA --no-indels', 'no_indels.fasta', 'no_indels.fasta') def test_issue_46(run, tmp_path): run("--anywhere=AACGTN --wildcard-file={}".format( tmp_path / "wildcards.txt"), "issue46.fasta", "issue46.fasta") def test_strip_suffix(run): run("--strip-suffix _sequence -a XXXXXXX", "stripped.fasta", "simple.fasta") def test_info_file(run, tmp_path, cores): info_path = tmp_path / "info.txt" run(["--cores", str(cores), "--info-file", info_path, "-a", "adapt=GCCGAACTTCTTAGACTGCCTTAAGGACGT"], "illumina.fastq", "illumina.fastq.gz") assert_files_equal(cutpath("illumina.info.txt"), info_path, ignore_trailing_space=True) def test_info_file_times(run, tmp_path, cores): info_path = tmp_path / "info.txt" run(["--cores", str(cores), "--info-file", info_path, "--times", "2", "-a", "adapt=GCCGAACTTCTTA", "-a", "adapt2=GACTGCCTTAAGGACGT"], "illumina5.fastq", "illumina5.fastq") assert_files_equal(cutpath('illumina5.info.txt'), info_path, ignore_trailing_space=True) def test_info_file_fasta(run, tmp_path, cores): info_path = tmp_path / "info.txt" run(["--cores", str(cores), "--info-file", info_path, "-a", "TTAGACATAT", "-g", "GAGATTGCCA", "--no-indels"], "no_indels.fasta", "no_indels.fasta") def test_info_file_revcomp(run, tmp_path): info_path = tmp_path / "info-rc.txt" main([ "--info-file", str(info_path), "-a", "adapt=GAGTCG", "--revcomp", "--rename={header}", "-o", str(tmp_path / "out.fasta"), datapath("info-rc.fasta") ]) assert_files_equal(cutpath("info-rc.txt"), info_path) def test_named_adapter(run): run("-a MY_ADAPTER=GCCGAACTTCTTAGACTGCCTTAAGGACGT", "illumina.fastq", "illumina.fastq.gz") def test_adapter_with_u(run): run("-a GCCGAACUUCUUAGACUGCCUUAAGGACGU", "illumina.fastq", "illumina.fastq.gz") def test_bzip2_input(run, cores): run(["--cores", str(cores), "-a", "TTAGACATATCTCCGTCG"], "small.fastq", "small.fastq.bz2") @pytest.mark.parametrize("extension", ["bz2", "xz", "gz"]) def test_compressed_output(tmp_path, cores, extension): out_path = str(tmp_path / ("small.fastq." + extension)) params = [ "--cores", str(cores), "-a", "TTAGACATATCTCCGTCG", "-o", out_path, datapath("small.fastq")] main(params) def test_bzip2_multiblock(run): run("-b TTAGACATATCTCCGTCG", "small.fastq", "multiblock.fastq.bz2") def test_xz(run): run('-b TTAGACATATCTCCGTCG', 'small.fastq', 'small.fastq.xz') def test_no_args(): with pytest.raises(SystemExit): main([]) def test_two_fastqs(): with pytest.raises(SystemExit): main([datapath('paired.1.fastq'), datapath('paired.2.fastq')]) def test_anchored_no_indels(run): run('-g ^TTAGACATAT --no-indels -e 0.1', 'anchored_no_indels.fasta', 'anchored_no_indels.fasta') def test_anchored_no_indels_wildcard_read(run): run('-g ^TTAGACATAT --match-read-wildcards --no-indels -e 0.1', 'anchored_no_indels_wildcard.fasta', 'anchored_no_indels.fasta') def test_anchored_no_indels_wildcard_adapt(run): run('-g ^TTAGACANAT --no-indels -e 0.12', 'anchored_no_indels.fasta', 'anchored_no_indels.fasta') def test_non_iupac_characters(run): with pytest.raises(SystemExit): main(['-a', 'ZACGT', datapath('small.fastq')]) def test_unconditional_cut_front(run): run('-u 5', 'unconditional-front.fastq', 'small.fastq') def test_unconditional_cut_back(run): run('-u -5', 'unconditional-back.fastq', 'small.fastq') def test_unconditional_cut_both(run): run('-u -5 -u 5', 'unconditional-both.fastq', 'small.fastq') def test_unconditional_cut_too_many_commas(): with pytest.raises(SystemExit): main(["-u", "5,7,8", datapath("small.fastq")]) def test_unconditional_cut_invalid_number(): with pytest.raises(SystemExit): main(["-u", "a,b", datapath("small.fastq")]) def test_untrimmed_output(run, cores, tmp_path): path = tmp_path / "untrimmed.fastq" stats = run(["--cores", str(cores), "-a", "TTAGACATATCTCCGTCG", "--untrimmed-output", path], "small.trimmed.fastq", "small.fastq") assert_files_equal(cutpath("small.untrimmed.fastq"), path) assert stats.with_adapters[0] == 2 assert stats.written == 2 assert stats.written_bp[0] == 46 def test_adapter_file(run): run('-a file:' + datapath('adapter.fasta'), 'illumina.fastq', 'illumina.fastq.gz') def test_adapter_file_5p_anchored(run): run('-N -g file:' + datapath('prefix-adapter.fasta'), 'anchored.fasta', 'anchored.fasta') def test_adapter_file_3p_anchored(run): run('-N -a file:' + datapath('suffix-adapter.fasta'), 'anchored-back.fasta', 'anchored-back.fasta') def test_adapter_file_5p_anchored_no_indels(run): run('-N --no-indels -g file:' + datapath('prefix-adapter.fasta'), 'anchored.fasta', 'anchored.fasta') def test_adapter_file_3p_anchored_no_indels(run): run('-N --no-indels -a file:' + datapath('suffix-adapter.fasta'), 'anchored-back.fasta', 'anchored-back.fasta') def test_adapter_file_empty_name(run): run('-N -a file:' + datapath('adapter-empty-name.fasta'), 'illumina.fastq', 'illumina.fastq.gz') @pytest.mark.parametrize("ext", ["", ".gz"]) def test_demultiplex(cores, tmp_path, ext): multiout = str(tmp_path / 'tmp-demulti.{name}.fasta') + ext params = [ '--cores', str(cores), '-a', 'first=AATTTCAGGAATT', '-a', 'second=GTTCTCTAGTTCT', '-o', multiout, datapath('twoadapters.fasta'), ] main(params) for name in ("first", "second", "unknown"): actual = multiout.format(name=name) if ext == ".gz": subprocess.run(["gzip", "-d", actual], check=True) actual = actual[:-3] expected = cutpath("twoadapters.{name}.fasta".format(name=name)) assert_files_equal(expected, actual) def test_multiple_fake_anchored_adapters(run): run("-g ^CGTCCGAAGTAGC -g ^ATTGCCCTAG " "-a TTCCATGCAGCATT$ -a CCAGTCCCCCC$ " "-a GCCGAACTTCTTAGACTGCCTTAAGGACGT", "illumina.fastq", "illumina.fastq.gz") def test_multiple_prefix_adapters(run): run("-g ^GTACGGATTGTTCAGTA -g ^TATTAAGCTCATTC", "multiprefix.fasta", "multi.fasta") def test_multiple_prefix_adapters_noindels(run): run("--no-indels -g ^GTACGGATTGTTCAGTA -g ^TATTAAGCTCATTC", "multiprefix.fasta", "multi.fasta") def test_multiple_suffix_adapters_noindels(run): run("--no-indels -a CGTGATTATCTTGC$ -a CCTATTAGTGGTTGAAC$", "multisuffix.fasta", "multi.fasta") def test_max_n(run): assert run('--max-n 0', 'maxn0.fasta', 'maxn.fasta').filtered["too_many_n"] == 4 assert run('--max-n 1', 'maxn1.fasta', 'maxn.fasta').filtered["too_many_n"] == 2 assert run('--max-n 2', 'maxn2.fasta', 'maxn.fasta').filtered["too_many_n"] == 1 assert run('--max-n 0.2', 'maxn0.2.fasta', 'maxn.fasta').filtered["too_many_n"] == 3 assert run('--max-n 0.4', 'maxn0.4.fasta', 'maxn.fasta').filtered["too_many_n"] == 2 def test_quiet_is_quiet(): captured_standard_output = StringIO() captured_standard_error = StringIO() setattr(captured_standard_output, "buffer", BytesIO()) setattr(captured_standard_error, "buffer", BytesIO()) old_stdout = sys.stdout old_stderr = sys.stderr try: sys.stdout = captured_standard_output sys.stderr = captured_standard_error main(['-o', os.devnull, '--quiet', datapath('small.fastq')]) finally: sys.stdout = old_stdout sys.stderr = old_stderr assert captured_standard_output.getvalue() == '' assert captured_standard_error.getvalue() == '' assert getattr(captured_standard_output, "buffer").getvalue() == b'' assert getattr(captured_standard_output, "buffer").getvalue() == b'' def test_x_brace_notation(): main(['-o', os.devnull, '--quiet', '-a', 'X{5}', datapath('small.fastq')]) def test_nextseq(run): run('--nextseq-trim 22', 'nextseq.fastq', 'nextseq.fastq') def test_linked_explicitly_anchored(run): run('-a ^AAAAAAAAAA...TTTTTTTTTT', 'linked.fasta', 'linked.fasta') def test_linked_multiple(run): run('-a ^AAAAAAAAAA...TTTTTTTTTT -a ^AAAAAAAAAA...GCGCGCGCGC', 'linked.fasta', 'linked.fasta') def test_linked_both_anchored(run): run('-a ^AAAAAAAAAA...TTTTT$', 'linked-anchored.fasta', 'linked.fasta') def test_linked_5p_not_anchored(run): run('-g AAAAAAAAAA...TTTTTTTTTT', 'linked-not-anchored.fasta', 'linked.fasta') def test_linked_discard_untrimmed(run): run('-a ^AAAAAAAAAA...TTTTTTTTTT --discard-untrimmed', 'linked-discard.fasta', 'linked.fasta') def test_linked_discard_untrimmed_g(run): run('-g AAAAAAAAAA...TTTTTTTTTT --discard-untrimmed', 'linked-discard-g.fasta', 'linked.fasta') def test_linked_lowercase(run): run('-a ^AACCGGTTTT...GGGGGGG$ -a ^AAAA...TTTT$ --times=2 --action=lowercase', 'linked-lowercase.fasta', 'linked.fasta') def test_linked_info_file(tmp_path): info_path = tmp_path / 'info.txt' main(['-a linkedadapter=^AAAAAAAAAA...TTTTTTTTTT', '--info-file', str(info_path), '-o', str(tmp_path / 'out.fasta'), datapath('linked.fasta')]) assert_files_equal(cutpath('linked-info.txt'), info_path, ignore_trailing_space=True) def test_linked_anywhere(): with pytest.raises(SystemExit): main(['-b', 'AAA...TTT', datapath('linked.fasta')]) def test_anywhere_anchored_5p(): with pytest.raises(SystemExit): main(['-b', '^AAA', datapath('small.fastq')]) def test_anywhere_anchored_3p(): with pytest.raises(SystemExit): main(['-b', 'TTT$', datapath('small.fastq')]) def test_fasta(run): run('-a TTAGACATATCTCCGTCG', 'small.fasta', 'small.fastq') def test_fasta_no_trim(run): run([], 'small-no-trim.fasta', 'small.fastq') def test_length(run): run('--length 5', 'shortened.fastq', 'small.fastq') def test_negative_length(run): run('--length -5', 'shortened-negative.fastq', 'small.fastq') @pytest.mark.timeout(0.5) def test_issue_296(tmp_path): info_path = tmp_path / 'info.txt' reads_path = tmp_path / 'reads.fasta' out_path = tmp_path / 'out.fasta' reads_path.write_text(">read\nCACAAA\n") main([ "--info-file", str(info_path), "--no-trim", "-g", "TTTCAC", "-o", str(out_path), str(reads_path), ]) assert_files_equal(reads_path, out_path) def test_xadapter(run): run('-g XTCCGAATAGA', 'xadapter.fasta', 'xadapterx.fasta') def test_adapterx(run): run('-a TCCGAATAGAX', 'adapterx.fasta', 'xadapterx.fasta') def test_discard_casava(run): stats = run('--discard-casava', 'casava.fastq', 'casava.fastq') assert stats.filtered["casava_filtered"] == 1 def test_underscore(run): run('-b TTAGACATATCTCCGTCG', 'small.fastq', 'underscore_fastq.gz') def test_cores_autodetect(run): run('--cores 0 -b TTAGACATATCTCCGTCG', 'small.fastq', 'underscore_fastq.gz') def test_write_compressed_fastq(cores, tmp_path): main(['--cores', str(cores), '-o', str(tmp_path / 'out.fastq.gz'), datapath('small.fastq')]) def test_minimal_report(run): run('-b TTAGACATATCTCCGTCG --report=minimal', 'small.fastq', 'small.fastq') def test_paired_separate(run): run("-a TTAGACATAT", "paired-separate.1.fastq", "paired.1.fastq") run("-a CAGTGGAGTA", "paired-separate.2.fastq", "paired.2.fastq") def test_empty_read_with_wildcard_in_adapter(run): run("-g CWC", "empty.fastq", "empty.fastq") def test_print_progress_to_tty(tmp_path, mocker): mocker.patch("cutadapt.utils.sys.stderr").isatty.return_value = True main(["-o", str(tmp_path / "out.fastq"), datapath("small.fastq")]) def test_adapter_order(run): run("-g ^AAACC -a CCGGG", "adapterorder-ga.fasta", "adapterorder.fasta") run("-a CCGGG -g ^AAACC", "adapterorder-ag.fasta", "adapterorder.fasta") def test_reverse_complement_no_rc_suffix(run, tmp_path): out_path = tmp_path / "out.fastq" main([ "-o", str(out_path), "--revcomp", "--no-index", "--rename", "{header}", "-g", "^TTATTTGTCT", "-g", "^TCCGCACTGG", datapath("revcomp.1.fastq") ]) with dnaio.open(out_path) as f: reads = list(f) assert len(reads) == 6 assert reads[1].name == "read2/1" assert reads[1].sequence == "ACCATCCGATATGTCTAATGTGGCCTGTTG" def test_reverse_complement_normalized(run): stats = run( "--revcomp --no-index -g ^TTATTTGTCT -g ^TCCGCACTGG", "revcomp-single-normalize.fastq", "revcomp.1.fastq", ) assert stats.n == 6 assert stats.reverse_complemented == 2 def test_reverse_complement_and_info_file(run, tmp_path, cores): info_path = str(tmp_path / "info.txt") run( [ "--revcomp", "--no-index", "-g", "^TTATTTGTCT", "-g", "^TCCGCACTGG", "--info-file", info_path, ], "revcomp-single-normalize.fastq", "revcomp.1.fastq", ) with open(info_path) as f: lines = f.readlines() assert len(lines) == 6 assert lines[0].split("\t")[0] == "read1/1" assert lines[1].split("\t")[0] == "read2/1 rc" def test_max_expected_errors(run, cores): stats = run("--max-ee=0.9", "maxee.fastq", "maxee.fastq") assert stats.filtered["too_many_expected_errors"] == 2 def test_max_expected_errors_fasta(tmp_path): path = tmp_path / "input.fasta" path.write_text(">read\nACGTACGT\n") main(["--max-ee=0.001", "-o", os.devnull, str(path)]) def test_warn_if_en_dashes_used(): with pytest.raises(SystemExit): main(["–q", "25", "-o", os.devnull, "in.fastq"]) @pytest.mark.parametrize("opt", ["-y", "--suffix"]) def test_suffix(opt, run): run([opt, ' {name}', '-e', '0', '-a', 'OnlyT=TTTTTTTT', '-a', 'OnlyG=GGGGGGGG'], "suffix.fastq", "suffix.fastq") @pytest.mark.parametrize("opt", ["--prefix", "--suffix"]) def test_rename_cannot_be_combined_with_other_renaming_options(opt): with pytest.raises(SystemExit): main([opt, "something", "--rename='{id} {comment} extrainfo'", "-o", os.devnull, datapath("empty.fastq")]) def test_rename(run): run([ "--rename={id}_{cut_suffix} {header} {adapter_name}", "--cut=-4", "-a", "OnlyT=TTTTTT", "-a", "OnlyG=GGGGGG", ], "rename.fastq", "suffix.fastq") @pytest.mark.skip("This has not been fixed") def test_terminates_correctly_on_error_in_subprocess(tmp_path): params = [ "-j", "2", "-o", str(tmp_path / "out.fastq.gz"), datapath("format-error.fastq"), ] with pytest.raises(SystemExit): main(params)
true
true
f726506396cd55e3c14fcaaeebe3a90d09e1dcf1
851
py
Python
tests/cupy_tests/core_tests/test_syncdetect.py
svlandeg/cupy
484e007d5bf58a0445af2f6e7aa3fdfe0fcc2363
[ "MIT" ]
6,180
2016-11-01T14:22:30.000Z
2022-03-31T08:39:20.000Z
tests/cupy_tests/core_tests/test_syncdetect.py
svlandeg/cupy
484e007d5bf58a0445af2f6e7aa3fdfe0fcc2363
[ "MIT" ]
6,281
2016-12-22T07:42:31.000Z
2022-03-31T19:57:02.000Z
tests/cupy_tests/core_tests/test_syncdetect.py
svlandeg/cupy
484e007d5bf58a0445af2f6e7aa3fdfe0fcc2363
[ "MIT" ]
829
2017-02-23T05:46:12.000Z
2022-03-27T17:40:03.000Z
import unittest import pytest import cupy import cupyx class TestSyncDetect(unittest.TestCase): def test_disallowed(self): a = cupy.array([2, 3]) with cupyx.allow_synchronize(False): with pytest.raises(cupyx.DeviceSynchronized): a.get() def test_allowed(self): a = cupy.array([2, 3]) with cupyx.allow_synchronize(True): a.get() def test_nested_disallowed(self): a = cupy.array([2, 3]) with cupyx.allow_synchronize(True): with cupyx.allow_synchronize(False): with pytest.raises(cupyx.DeviceSynchronized): a.get() def test_nested_allowed(self): a = cupy.array([2, 3]) with cupyx.allow_synchronize(False): with cupyx.allow_synchronize(True): a.get()
25.029412
61
0.591069
import unittest import pytest import cupy import cupyx class TestSyncDetect(unittest.TestCase): def test_disallowed(self): a = cupy.array([2, 3]) with cupyx.allow_synchronize(False): with pytest.raises(cupyx.DeviceSynchronized): a.get() def test_allowed(self): a = cupy.array([2, 3]) with cupyx.allow_synchronize(True): a.get() def test_nested_disallowed(self): a = cupy.array([2, 3]) with cupyx.allow_synchronize(True): with cupyx.allow_synchronize(False): with pytest.raises(cupyx.DeviceSynchronized): a.get() def test_nested_allowed(self): a = cupy.array([2, 3]) with cupyx.allow_synchronize(False): with cupyx.allow_synchronize(True): a.get()
true
true
f72650f004500bff57f9152bebe02c0607cf7d24
567
py
Python
BOJ14405.py
INYEONGKIM/BOJ
5e83d77a92d18b0d20d26645c7cfe4ba3e2d25bc
[ "MIT" ]
2
2019-03-05T15:42:46.000Z
2019-07-24T15:52:36.000Z
BOJ14405.py
INYEONGKIM/BOJ
5e83d77a92d18b0d20d26645c7cfe4ba3e2d25bc
[ "MIT" ]
null
null
null
BOJ14405.py
INYEONGKIM/BOJ
5e83d77a92d18b0d20d26645c7cfe4ba3e2d25bc
[ "MIT" ]
null
null
null
s=input();f=True try: while s!="": if s[0]=="p": t=s[:2] if t=="pi": s=s[2:] else: f=False; break elif s[0]=="k": t=s[:2] if t=="ka": s=s[2:] else: f=False; break elif s[0]=="c": t=s[:3] if t=="chu": s=s[3:] else: f=False; break else: f=False; break except: f=False if f: print("YES") else: print("NO")
18.9
30
0.294533
s=input();f=True try: while s!="": if s[0]=="p": t=s[:2] if t=="pi": s=s[2:] else: f=False; break elif s[0]=="k": t=s[:2] if t=="ka": s=s[2:] else: f=False; break elif s[0]=="c": t=s[:3] if t=="chu": s=s[3:] else: f=False; break else: f=False; break except: f=False if f: print("YES") else: print("NO")
true
true
f726518fe0feae8b103c50e15118f179206e6821
374
py
Python
build/check_obstacle/catkin_generated/pkg.installspace.context.pc.py
EurobotMDX/eurobot_2020_odroid_cam
ddd9a17d53899f1c615816fd74512c112ecad188
[ "MIT" ]
4
2019-10-26T18:48:51.000Z
2020-02-27T19:31:36.000Z
build/check_obstacle/catkin_generated/pkg.installspace.context.pc.py
EurobotMDX/eurobot_2020_odroid_cam
ddd9a17d53899f1c615816fd74512c112ecad188
[ "MIT" ]
null
null
null
build/check_obstacle/catkin_generated/pkg.installspace.context.pc.py
EurobotMDX/eurobot_2020_odroid_cam
ddd9a17d53899f1c615816fd74512c112ecad188
[ "MIT" ]
1
2019-10-26T18:50:48.000Z
2019-10-26T18:50:48.000Z
# generated from catkin/cmake/template/pkg.context.pc.in CATKIN_PACKAGE_PREFIX = "" PROJECT_PKG_CONFIG_INCLUDE_DIRS = "".split(';') if "" != "" else [] PROJECT_CATKIN_DEPENDS = "".replace(';', ' ') PKG_CONFIG_LIBRARIES_WITH_PREFIX = "".split(';') if "" != "" else [] PROJECT_NAME = "check_obstacle" PROJECT_SPACE_DIR = "/home/ros/lidar_ws/install" PROJECT_VERSION = "0.0.0"
41.555556
68
0.705882
CATKIN_PACKAGE_PREFIX = "" PROJECT_PKG_CONFIG_INCLUDE_DIRS = "".split(';') if "" != "" else [] PROJECT_CATKIN_DEPENDS = "".replace(';', ' ') PKG_CONFIG_LIBRARIES_WITH_PREFIX = "".split(';') if "" != "" else [] PROJECT_NAME = "check_obstacle" PROJECT_SPACE_DIR = "/home/ros/lidar_ws/install" PROJECT_VERSION = "0.0.0"
true
true
f7265193a85ba6ceeb41dc4f556930b01622c5a0
2,456
py
Python
python/paddle/fluid/tests/unittests/ir/inference/test_identity_scale_clean_pass.py
L-Net-1992/Paddle
4d0ca02ba56760b456f3d4b42a538555b9b6c307
[ "Apache-2.0" ]
11
2016-08-29T07:43:26.000Z
2016-08-29T07:51:24.000Z
python/paddle/fluid/tests/unittests/ir/inference/test_identity_scale_clean_pass.py
L-Net-1992/Paddle
4d0ca02ba56760b456f3d4b42a538555b9b6c307
[ "Apache-2.0" ]
null
null
null
python/paddle/fluid/tests/unittests/ir/inference/test_identity_scale_clean_pass.py
L-Net-1992/Paddle
4d0ca02ba56760b456f3d4b42a538555b9b6c307
[ "Apache-2.0" ]
1
2021-12-09T08:59:17.000Z
2021-12-09T08:59:17.000Z
# Copyright (c) 2022 PaddlePaddle Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import numpy as np from auto_scan_test import PassAutoScanTest from program_config import TensorConfig, ProgramConfig, OpConfig import paddle.inference as paddle_infer import unittest import hypothesis.strategies as st class TestIdentityScaleCleanPass(PassAutoScanTest): def sample_predictor_configs(self, program_config): config = self.create_trt_inference_config() config.enable_tensorrt_engine( max_batch_size=8, workspace_size=0, min_subgraph_size=0, precision_mode=paddle_infer.PrecisionType.Float32, use_static=False, use_calib_mode=False) yield config, ['relu'], (1e-5, 1e-5) def sample_program_config(self, draw): bias_after_scale = draw(st.booleans()) n = draw(st.integers(min_value=1, max_value=4)) c = draw(st.integers(min_value=1, max_value=20)) h = draw(st.integers(min_value=1, max_value=20)) w = draw(st.integers(min_value=1, max_value=20)) relu_op = OpConfig("relu", inputs={"X": ["relu_x"]}, outputs={"Out": ["relu_out"]}) scale_op = OpConfig("scale", inputs={"X": ["relu_out"]}, outputs={"Out": ["scale_out"]}, bias=0., scale=1., bias_after_scale=True) program_config = ProgramConfig( ops=[relu_op, scale_op], weights={}, inputs={"relu_x": TensorConfig(shape=[n, c, h, w])}, outputs=["scale_out"]) return program_config def test(self): self.run_and_statis(max_examples=25, passes=["identity_scale_op_clean_pass"]) if __name__ == "__main__": unittest.main()
37.212121
74
0.623779
import numpy as np from auto_scan_test import PassAutoScanTest from program_config import TensorConfig, ProgramConfig, OpConfig import paddle.inference as paddle_infer import unittest import hypothesis.strategies as st class TestIdentityScaleCleanPass(PassAutoScanTest): def sample_predictor_configs(self, program_config): config = self.create_trt_inference_config() config.enable_tensorrt_engine( max_batch_size=8, workspace_size=0, min_subgraph_size=0, precision_mode=paddle_infer.PrecisionType.Float32, use_static=False, use_calib_mode=False) yield config, ['relu'], (1e-5, 1e-5) def sample_program_config(self, draw): bias_after_scale = draw(st.booleans()) n = draw(st.integers(min_value=1, max_value=4)) c = draw(st.integers(min_value=1, max_value=20)) h = draw(st.integers(min_value=1, max_value=20)) w = draw(st.integers(min_value=1, max_value=20)) relu_op = OpConfig("relu", inputs={"X": ["relu_x"]}, outputs={"Out": ["relu_out"]}) scale_op = OpConfig("scale", inputs={"X": ["relu_out"]}, outputs={"Out": ["scale_out"]}, bias=0., scale=1., bias_after_scale=True) program_config = ProgramConfig( ops=[relu_op, scale_op], weights={}, inputs={"relu_x": TensorConfig(shape=[n, c, h, w])}, outputs=["scale_out"]) return program_config def test(self): self.run_and_statis(max_examples=25, passes=["identity_scale_op_clean_pass"]) if __name__ == "__main__": unittest.main()
true
true
f72651d2708561bc7a3f8b8ff37df2a1572eaac2
15,984
py
Python
LSTM for language modeling/Question2_Part_1_To_2.py
sotudian/Natural-Language-Processing
61ba2ac78e440683519d2121ca2b29a17277e46b
[ "Apache-2.0" ]
null
null
null
LSTM for language modeling/Question2_Part_1_To_2.py
sotudian/Natural-Language-Processing
61ba2ac78e440683519d2121ca2b29a17277e46b
[ "Apache-2.0" ]
null
null
null
LSTM for language modeling/Question2_Part_1_To_2.py
sotudian/Natural-Language-Processing
61ba2ac78e440683519d2121ca2b29a17277e46b
[ "Apache-2.0" ]
null
null
null
#!/usr/bin/env python3 # -*- coding: utf-8 -*- """ Train the language model on texts from the file pride And Prejudice. Before using it to train the language model, you need to first sentence segment, then tokenize, then lower case each line of the file using Spacy. Append start-of-sentence token ’<s>’ and end-of-sentence ’</s>’ token to each sentence and put each sentence in its own line. Use only words that appear more than once in this corpus and assign UNK tokens for the rest; you may also need to pad sentences that are shorter than 5. Train the language model and save the trained model. Generate 10 examples of text from it, starting from ’<s>’ token and ending at ’</s>’ token. @author: shahab Sotudian """ import re import pickle import random import numpy as np import pandas as pd import torch import torch.nn as nn import torch.nn.functional as F import nltk from nltk.tokenize import sent_tokenize, word_tokenize from nltk.lm.preprocessing import pad_both_ends from collections import Counter import math # Functions ###########================------------------- ''' ############################################################ #### Piazza calculate Preplexity net.cuda() net.eval() H = 0 TOTAL_PROBs = 1 with torch.no_grad(): for Test_Sentence in Test_1_Preprocessed_Pride_Text_Perplexity: H += len(Test_Sentence) # Calculate for each sentence Total_prob_Sentence = 1 for i,word in enumerate(Test_Sentence): if i == len(Test_Sentence)-1: continue else: if i==0: h = net.init_hidden(1) h = tuple([each.data for each in h]) else: h = h_new x = np.array([[word2idx[word]]]) inputs = torch.from_numpy(x) inputs = inputs.cuda() out, h_new = net(inputs, h) # get the token probabilities p = F.softmax(out, dim=1).data p = p.cpu() p = p.numpy() p = p.reshape(p.shape[1],) Prob_next_Word = p[word2idx[Test_Sentence[i+1]]] # P(w4|w1,w2,w3) Total_prob_Sentence = Prob_next_Word * Total_prob_Sentence TOTAL_PROBs = TOTAL_PROBs * Total_prob_Sentence Preplexity = (1/TOTAL_PROBs)**(1/float(H)) ############################################################ ''' def NLP_PreProcessing(text_main): # sentence segmenting sentences = nltk.sent_tokenize(text_main) # Tokenization + lower casing Tokenized_sentences = [word_tokenize(S.lower()) for S in sentences] # Padding Pad_Tokenized_sentences = [list(pad_both_ends(TS, n=2)) for TS in Tokenized_sentences] return Pad_Tokenized_sentences def NLP_PreProcessing_Test(text_main): # Tokenization + lower casing Tokenized_sentences = word_tokenize(text_main.lower()) # Padding Pad_Tokenized_sentences = [list(pad_both_ends(Tokenized_sentences, n=2))] return Pad_Tokenized_sentences def Equal_seq(text, seq_len): sequences = [] if len(text) > seq_len: for i in range(seq_len, (len(text)+1)): seq = text[i-seq_len:i] sequences.append(seq) else: sequences = [['_PAD']*(seq_len-len(text)) + text ] return sequences def get_batches(arr_x, arr_y, batch_size): # iterate through the arrays prv = 0 for n in range(batch_size, arr_x.shape[0], batch_size): x = arr_x[prv:n,:] y = arr_y[prv:n,:] prv = n yield x, y class WordLSTM(nn.Module): def __init__(self, n_hidden=256, n_layers=4, drop_prob=0.3, lr=0.001): super().__init__() self.drop_prob = drop_prob self.n_layers = n_layers self.n_hidden = n_hidden self.lr = lr self.emb_layer = nn.Embedding(vocab_size, 200) ## define the LSTM self.lstm = nn.LSTM(200, n_hidden, n_layers, dropout=drop_prob, batch_first=True) ## define a dropout layer self.dropout = nn.Dropout(drop_prob) ## define the fully-connected layer self.fc = nn.Linear(n_hidden, vocab_size) def forward(self, x, hidden): ''' Forward pass through the network. These inputs are x, and the hidden/cell state `hidden`. ''' ## pass input through embedding layer embedded = self.emb_layer(x) ## Get the outputs and the new hidden state from the lstm lstm_output, hidden = self.lstm(embedded, hidden) ## pass through a dropout layer out = self.dropout(lstm_output) #out = out.contiguous().view(-1, self.n_hidden) out = out.reshape(-1, self.n_hidden) ## put "out" through the fully-connected layer out = self.fc(out) # return the final output and the hidden state return out, hidden def init_hidden(self, batch_size): ''' initializes hidden state ''' # Create two new tensors with sizes n_layers x batch_size x n_hidden, # initialized to zero, for hidden state and cell state of LSTM weight = next(self.parameters()).data # if GPU is available if (torch.cuda.is_available()): hidden = (weight.new(self.n_layers, batch_size, self.n_hidden).zero_().cuda(), weight.new(self.n_layers, batch_size, self.n_hidden).zero_().cuda()) # if GPU is not available else: hidden = (weight.new(self.n_layers, batch_size, self.n_hidden).zero_(), weight.new(self.n_layers, batch_size, self.n_hidden).zero_()) return hidden def train(net, epochs, batch_size, lr, clip, print_every,XX,YY): # optimizer opt = torch.optim.Adam(net.parameters(), lr=lr) # loss criterion = nn.CrossEntropyLoss() # push model to GPU net.cuda() counter = 0 net.train() for e in range(epochs): # initialize hidden state h = net.init_hidden(batch_size) for x, y in get_batches(XX, YY, batch_size): counter+= 1 # convert numpy arrays to PyTorch arrays inputs, targets = torch.from_numpy(x), torch.from_numpy(y) # push tensors to GPU inputs, targets = inputs.cuda(), targets.cuda() # detach hidden states h = tuple([each.data for each in h]) # zero accumulated gradients net.zero_grad() # get the output from the model output, h = net(inputs, h) # calculate the loss and perform backprop loss = criterion(output, targets.view(-1)) # back-propagate error loss.backward() # `clip_grad_norm` helps prevent the exploding gradient problem in RNNs / LSTMs. nn.utils.clip_grad_norm_(net.parameters(), clip) # update weigths opt.step() if counter % print_every == 0: print("Epoch: {}/{}...".format(e+1, epochs), "Step: {}...".format(counter)) def predict(net, tkn, h=None, word2idx_Inp = None, idx2word_Inp =None ): # tensor inputs x = np.array([[word2idx_Inp[tkn]]]) inputs = torch.from_numpy(x) # push to GPU inputs = inputs.cuda() # detach hidden state from history h = tuple([each.data for each in h]) # get the output of the model out, h = net(inputs, h) # get the token probabilities p = F.softmax(out, dim=1).data p = p.cpu() p = p.numpy() p = p.reshape(p.shape[1],) # get indices of top 3 values top_n_idx = p.argsort()[-3:][::-1] # randomly select one of the three indices sampled_token_index = top_n_idx[random.sample([0,1,2],1)[0]] # return the encoded value of the predicted char and the hidden state return idx2word_Inp[sampled_token_index], h # function to generate text def sample(net, size, prime="<s>",word2idx_Inp = None, idx2word_Inp =None ): # push to GPU net.cuda() net.eval() # batch size is 1 h = net.init_hidden(1) toks = prime.split() # predict next token for t in prime.split(): token, h = predict(net, t, h,word2idx_Inp,idx2word_Inp) toks.append(token) # predict subsequent tokens if size == '</s>': while(token!='</s>'): token, h = predict(net, toks[-1], h,word2idx_Inp,idx2word_Inp) toks.append(token) else: for i in range(size-1): token, h = predict(net, toks[-1], h,word2idx_Inp,idx2word_Inp) toks.append(token) return ' '.join(toks) def Testing(net, batch_size,Test_X,Test_Y): net.eval() criterion = nn.CrossEntropyLoss() # initialize hidden state h = net.init_hidden(batch_size) test_loss = 0. with torch.no_grad(): for x, y in get_batches(Test_X, Test_Y, batch_size): # convert numpy arrays to PyTorch arrays inputs, targets = torch.from_numpy(x), torch.from_numpy(y) # push tensors to GPU inputs, targets = inputs.cuda(), targets.cuda() # detach hidden states h = tuple([each.data for each in h]) # get the output from the model output, h = net(inputs, h) test_loss += criterion(output, targets.view(-1)).item() test_loss = test_loss / ((len(Test_X) // batch_size)+1) print('-' * 40) print('Test loss {:5.2f} ------ Test perplexity {:8.2f}'.format(test_loss, math.exp(test_loss))) print('-' * 40) class WordLSTM_with_Glove(nn.Module): def __init__(self, n_hidden=256, n_layers=4, drop_prob=0.3, lr=0.001): super().__init__() self.drop_prob = drop_prob self.n_layers = n_layers self.n_hidden = n_hidden self.lr = lr self.emb_layer = nn.Embedding(vocab_size_Q6,100, padding_idx=0) self.emb_layer.weight.data.copy_(torch.from_numpy(embedding_matrix)) self.emb_layer.weight.requires_grad = False ## freeze embeddings ''' self.emb_layer = nn.Embedding(vocab_size_Q6,100) self.emb_layer.weight = nn.Parameter(torch.from_numpy(embedding_matrix).float()) ''' ## define the LSTM self.lstm = nn.LSTM(100, n_hidden, n_layers, dropout=drop_prob, batch_first=True) ## define a dropout layer self.dropout = nn.Dropout(drop_prob) ## define the fully-connected layer self.fc = nn.Linear(n_hidden, vocab_size_Q6) def forward(self, x, hidden): ''' Forward pass through the network. These inputs are x, and the hidden/cell state `hidden`. ''' ## pass input through embedding layer embedded = self.emb_layer(x) ## Get the outputs and the new hidden state from the lstm lstm_output, hidden = self.lstm(embedded, hidden) ## pass through a dropout layer out = self.dropout(lstm_output) #out = out.contiguous().view(-1, self.n_hidden) out = out.reshape(-1, self.n_hidden) ## put "out" through the fully-connected layer out = self.fc(out) # return the final output and the hidden state return out, hidden def init_hidden(self, batch_size): ''' initializes hidden state ''' # Create two new tensors with sizes n_layers x batch_size x n_hidden, # initialized to zero, for hidden state and cell state of LSTM weight = next(self.parameters()).data # if GPU is available if (torch.cuda.is_available()): hidden = (weight.new(self.n_layers, batch_size, self.n_hidden).zero_().cuda(), weight.new(self.n_layers, batch_size, self.n_hidden).zero_().cuda()) # if GPU is not available else: hidden = (weight.new(self.n_layers, batch_size, self.n_hidden).zero_(), weight.new(self.n_layers, batch_size, self.n_hidden).zero_()) return hidden # Data ###########================------------------- with open('prideAndPrejudice.txt') as f: Pride_Text = [line.rstrip() for line in f] # Q2.1 ###########================------------------- # sentence segmenting + lower casing + Tokenization + Padding using function NLP_PreProcessing Preprocessed_Pride_Text = [] for t in range(len(Pride_Text)): Preprocessed_Pride_Text = Preprocessed_Pride_Text + NLP_PreProcessing(Pride_Text[t]) Length_of_Sequences = 5 Pride_Text_Equal_seqs_L5 = sum([Equal_seq(i,Length_of_Sequences) for i in Preprocessed_Pride_Text], []) del t,f # Create Vocab words = Counter() for i, sentence in enumerate(Preprocessed_Pride_Text): for word in sentence: words.update([word]) words = {k:v for k,v in words.items() if v>1} # Removing the words that only appear once del i,sentence,word words = sorted(words, key=words.get, reverse=True) # Sorting the words words = ['_PAD','_UNK'] + words word2idx = {o:i for i,o in enumerate(words)} idx2word = {i:o for i,o in enumerate(words)} # Looking up the mapping dictionary and assigning the index to the respective words Pride_Text_Equal_seqs_INDICES_L5 =[] for i, sentence in enumerate(Pride_Text_Equal_seqs_L5): Pride_Text_Equal_seqs_INDICES_L5.append([word2idx[word] if word in word2idx else word2idx['_UNK'] for word in sentence]) del i, sentence X = [] Y = [] for S in Pride_Text_Equal_seqs_INDICES_L5: X.append(S[:-1]) Y.append(S[1:]) x_int_L5 = np.array(X) y_int_L5 = np.array(Y) vocab_size = len(word2idx) # Train Or Load LSTM Do_want_To_Train = 0 batch_size = 320 epochs=20 lr=0.001 if Do_want_To_Train == 1: net1 = WordLSTM() # instantiate the model net1.cuda() # push the model to GPU train(net1, epochs, batch_size, lr, 1, 50,x_int_L5,y_int_L5) # train the model torch.save(net1, 'Q2_Part_1_Network.pt') else: net1 = torch.load('Q2_Part_1_Network.pt') net1.eval() print(net1) # Generate text for i in range(10): print('=======================================') print("- Example "+str(i+1)+": ",sample(net1, size='</s>' , prime="<s>", word2idx_Inp = word2idx, idx2word_Inp =idx2word ),'\n') del X,Y,i,S,Do_want_To_Train print('=' * 60) # Q2.2 ###########================------------------- with open('test_1.txt') as f: test_1 = [line.rstrip() for line in f] # sentence segmenting + lower casing + Tokenization + Padding using function NLP_PreProcessing_Test Test_1_Preprocessed_Pride_Text = [] for t in range(len(test_1)): Test_1_Preprocessed_Pride_Text = Test_1_Preprocessed_Pride_Text + NLP_PreProcessing_Test((test_1[t])[4:-5]) Test_1_Pride_Text_Equal_seqs = sum([Equal_seq(i,Length_of_Sequences) for i in Test_1_Preprocessed_Pride_Text], []) del t,f # Looking up the mapping dictionary and assigning the index to the respective words Test_1_Pride_Text_Equal_seqs_INDICES =[] for i, sentence in enumerate(Test_1_Pride_Text_Equal_seqs): Test_1_Pride_Text_Equal_seqs_INDICES.append([word2idx[word] if word in word2idx else word2idx['_UNK'] for word in sentence]) del i, sentence Test_1_X = [] Test_1_Y = [] for S in Test_1_Pride_Text_Equal_seqs_INDICES: Test_1_X.append(S[:-1]) Test_1_Y.append(S[1:]) Test_1_x_int = np.array(Test_1_X) Test_1_y_int = np.array(Test_1_Y) del Test_1_X,Test_1_Y,S # Calculate Perplexity Testing(net1, batch_size ,Test_1_x_int,Test_1_y_int) del Pride_Text,Length_of_Sequences
29.820896
132
0.603478
import re import pickle import random import numpy as np import pandas as pd import torch import torch.nn as nn import torch.nn.functional as F import nltk from nltk.tokenize import sent_tokenize, word_tokenize from nltk.lm.preprocessing import pad_both_ends from collections import Counter import math ces = [list(pad_both_ends(Tokenized_sentences, n=2))] return Pad_Tokenized_sentences def Equal_seq(text, seq_len): sequences = [] if len(text) > seq_len: for i in range(seq_len, (len(text)+1)): seq = text[i-seq_len:i] sequences.append(seq) else: sequences = [['_PAD']*(seq_len-len(text)) + text ] return sequences def get_batches(arr_x, arr_y, batch_size): prv = 0 for n in range(batch_size, arr_x.shape[0], batch_size): x = arr_x[prv:n,:] y = arr_y[prv:n,:] prv = n yield x, y class WordLSTM(nn.Module): def __init__(self, n_hidden=256, n_layers=4, drop_prob=0.3, lr=0.001): super().__init__() self.drop_prob = drop_prob self.n_layers = n_layers self.n_hidden = n_hidden self.lr = lr self.emb_layer = nn.Embedding(vocab_size, 200) m = nn.LSTM(200, n_hidden, n_layers, dropout=drop_prob, batch_first=True) nn.Dropout(drop_prob) den, vocab_size) def forward(self, x, hidden): ) n) tm_output) out = out.reshape(-1, self.n_hidden) return out, hidden def init_hidden(self, batch_size): weight = next(self.parameters()).data if (torch.cuda.is_available()): hidden = (weight.new(self.n_layers, batch_size, self.n_hidden).zero_().cuda(), weight.new(self.n_layers, batch_size, self.n_hidden).zero_().cuda()) else: hidden = (weight.new(self.n_layers, batch_size, self.n_hidden).zero_(), weight.new(self.n_layers, batch_size, self.n_hidden).zero_()) return hidden def train(net, epochs, batch_size, lr, clip, print_every,XX,YY): opt = torch.optim.Adam(net.parameters(), lr=lr) criterion = nn.CrossEntropyLoss() net.cuda() counter = 0 net.train() for e in range(epochs): h = net.init_hidden(batch_size) for x, y in get_batches(XX, YY, batch_size): counter+= 1 inputs, targets = torch.from_numpy(x), torch.from_numpy(y) inputs, targets = inputs.cuda(), targets.cuda() h = tuple([each.data for each in h]) net.zero_grad() output, h = net(inputs, h) loss = criterion(output, targets.view(-1)) loss.backward() nn.utils.clip_grad_norm_(net.parameters(), clip) opt.step() if counter % print_every == 0: print("Epoch: {}/{}...".format(e+1, epochs), "Step: {}...".format(counter)) def predict(net, tkn, h=None, word2idx_Inp = None, idx2word_Inp =None ): x = np.array([[word2idx_Inp[tkn]]]) inputs = torch.from_numpy(x) inputs = inputs.cuda() h = tuple([each.data for each in h]) out, h = net(inputs, h) p = F.softmax(out, dim=1).data p = p.cpu() p = p.numpy() p = p.reshape(p.shape[1],) top_n_idx = p.argsort()[-3:][::-1] sampled_token_index = top_n_idx[random.sample([0,1,2],1)[0]] return idx2word_Inp[sampled_token_index], h def sample(net, size, prime="<s>",word2idx_Inp = None, idx2word_Inp =None ): net.cuda() net.eval() h = net.init_hidden(1) toks = prime.split() for t in prime.split(): token, h = predict(net, t, h,word2idx_Inp,idx2word_Inp) toks.append(token) if size == '</s>': while(token!='</s>'): token, h = predict(net, toks[-1], h,word2idx_Inp,idx2word_Inp) toks.append(token) else: for i in range(size-1): token, h = predict(net, toks[-1], h,word2idx_Inp,idx2word_Inp) toks.append(token) return ' '.join(toks) def Testing(net, batch_size,Test_X,Test_Y): net.eval() criterion = nn.CrossEntropyLoss() h = net.init_hidden(batch_size) test_loss = 0. with torch.no_grad(): for x, y in get_batches(Test_X, Test_Y, batch_size): inputs, targets = torch.from_numpy(x), torch.from_numpy(y) inputs, targets = inputs.cuda(), targets.cuda() h = tuple([each.data for each in h]) output, h = net(inputs, h) test_loss += criterion(output, targets.view(-1)).item() test_loss = test_loss / ((len(Test_X) // batch_size)+1) print('-' * 40) print('Test loss {:5.2f} ------ Test perplexity {:8.2f}'.format(test_loss, math.exp(test_loss))) print('-' * 40) class WordLSTM_with_Glove(nn.Module): def __init__(self, n_hidden=256, n_layers=4, drop_prob=0.3, lr=0.001): super().__init__() self.drop_prob = drop_prob self.n_layers = n_layers self.n_hidden = n_hidden self.lr = lr self.emb_layer = nn.Embedding(vocab_size_Q6,100, padding_idx=0) self.emb_layer.weight.data.copy_(torch.from_numpy(embedding_matrix)) self.emb_layer.weight.requires_grad = False n_hidden, n_layers, dropout=drop_prob, batch_first=True) nn.Dropout(drop_prob) den, vocab_size_Q6) def forward(self, x, hidden): ) n) tm_output) out = out.reshape(-1, self.n_hidden) return out, hidden def init_hidden(self, batch_size): weight = next(self.parameters()).data if (torch.cuda.is_available()): hidden = (weight.new(self.n_layers, batch_size, self.n_hidden).zero_().cuda(), weight.new(self.n_layers, batch_size, self.n_hidden).zero_().cuda()) else: hidden = (weight.new(self.n_layers, batch_size, self.n_hidden).zero_(), weight.new(self.n_layers, batch_size, self.n_hidden).zero_()) return hidden rd2idx[word] if word in word2idx else word2idx['_UNK'] for word in sentence]) del i, sentence X = [] Y = [] for S in Pride_Text_Equal_seqs_INDICES_L5: X.append(S[:-1]) Y.append(S[1:]) x_int_L5 = np.array(X) y_int_L5 = np.array(Y) vocab_size = len(word2idx) Do_want_To_Train = 0 batch_size = 320 epochs=20 lr=0.001 if Do_want_To_Train == 1: net1 = WordLSTM() net1.cuda() train(net1, epochs, batch_size, lr, 1, 50,x_int_L5,y_int_L5) torch.save(net1, 'Q2_Part_1_Network.pt') else: net1 = torch.load('Q2_Part_1_Network.pt') net1.eval() print(net1) for i in range(10): print('=======================================') print("- Example "+str(i+1)+": ",sample(net1, size='</s>' , prime="<s>", word2idx_Inp = word2idx, idx2word_Inp =idx2word ),'\n') del X,Y,i,S,Do_want_To_Train print('=' * 60) e(Test_1_Pride_Text_Equal_seqs): Test_1_Pride_Text_Equal_seqs_INDICES.append([word2idx[word] if word in word2idx else word2idx['_UNK'] for word in sentence]) del i, sentence Test_1_X = [] Test_1_Y = [] for S in Test_1_Pride_Text_Equal_seqs_INDICES: Test_1_X.append(S[:-1]) Test_1_Y.append(S[1:]) Test_1_x_int = np.array(Test_1_X) Test_1_y_int = np.array(Test_1_Y) del Test_1_X,Test_1_Y,S Testing(net1, batch_size ,Test_1_x_int,Test_1_y_int) del Pride_Text,Length_of_Sequences
true
true
f72654a975ae6f6f07f9c0a9f4ef3e7ceecfc94a
488
py
Python
AssetsApp/migrations/0010_alter_assetscategories_datetime_added.py
Kayarn-Mechatronics/Octello
45f4f73c764ca816918c31ef3ae4889740a68802
[ "Apache-2.0" ]
null
null
null
AssetsApp/migrations/0010_alter_assetscategories_datetime_added.py
Kayarn-Mechatronics/Octello
45f4f73c764ca816918c31ef3ae4889740a68802
[ "Apache-2.0" ]
null
null
null
AssetsApp/migrations/0010_alter_assetscategories_datetime_added.py
Kayarn-Mechatronics/Octello
45f4f73c764ca816918c31ef3ae4889740a68802
[ "Apache-2.0" ]
null
null
null
# Generated by Django 3.2.5 on 2021-09-08 01:39 import datetime from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('AssetsApp', '0009_alter_assetscategories_datetime_added'), ] operations = [ migrations.AlterField( model_name='assetscategories', name='datetime_added', field=models.DateTimeField(default=datetime.datetime(2021, 9, 8, 1, 37, 53, 844688)), ), ]
24.4
97
0.647541
import datetime from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('AssetsApp', '0009_alter_assetscategories_datetime_added'), ] operations = [ migrations.AlterField( model_name='assetscategories', name='datetime_added', field=models.DateTimeField(default=datetime.datetime(2021, 9, 8, 1, 37, 53, 844688)), ), ]
true
true
f72656c4b0c210ce9367e4cf253ca9a70c73fd41
5,884
py
Python
Jumpscale/clients/oauth/OauthInstance.py
threefoldtech/JumpscaleX
5fb073a82aeb0e66fc7d9660c45a1e31bc094bfa
[ "Apache-2.0" ]
2
2019-05-09T07:21:25.000Z
2019-08-05T06:37:53.000Z
Jumpscale/clients/oauth/OauthInstance.py
threefoldtech/JumpscaleX
5fb073a82aeb0e66fc7d9660c45a1e31bc094bfa
[ "Apache-2.0" ]
664
2018-12-19T12:43:44.000Z
2019-08-23T04:24:42.000Z
Jumpscale/clients/oauth/OauthInstance.py
threefoldtech/jumpscale10
5fb073a82aeb0e66fc7d9660c45a1e31bc094bfa
[ "Apache-2.0" ]
7
2019-05-03T07:14:37.000Z
2019-08-05T12:36:52.000Z
import urllib.request import urllib.parse import urllib.error import string import requests import time import random from Jumpscale import j JSConfigClient = j.application.JSBaseConfigClass class OauthClient(JSConfigClient): _SCHEMATEXT = """ @url = jumpscale.oauth.client name* = "" (S) addr = "" (S) accesstokenaddr = "" (S) client_id = "" (S) secret_ = "" (S) scope = "" (S) redirect_url = "" (S) user_info_url = "" (S) logout_url = "" (S) client_instance = "github" (S) """ def _init(self): self.addr = self.addr self.accesstokenaddr = self.accesstokenaddr self.client_id = self.client_id self.secret = self.secret_ self.scope = self.scope self.redirect_url = self.redirect_url self.user_info_url = self.user_info_url self.logout_url = self.logout_url self.client_instance = self.client_instance self._client = None self.instance = "main" @property def client(self): if self._client: return self._client if self.client_instance in ("itsyouonline", "itsyou.online"): self._client = ItsYouOnline( self.addr, self.accesstokenaddr, self.client_id, self.secret, self.scope, self.redirect_url, self.user_info_url, self.logout_url, self.instance, ) else: self._client = OauthInstance( self.addr, self.accesstokenaddr, self.client_id, self.secret, self.scope, self.redirect_url, self.user_info_url, self.logout_url, self.instance, ) return self._client class AuthError(Exception): def _init(self): pass class UserInfo(object): def _init(self, username, emailaddress, groups): self.username = username self.emailaddress = emailaddress self.groups = groups class OauthInstance: def __init__( self, addr, accesstokenaddr, client_id, secret, scope, redirect_url, user_info_url, logout_url, instance ): if not addr: raise RuntimeError("Failed to get oauth instance, no address provided") else: self.addr = addr self.client_id = client_id self.scope = scope self.redirect_url = redirect_url self.accesstokenaddress = accesstokenaddr self.secret = secret self.user_info_url = user_info_url self.logout_url = logout_url self.state = "".join(random.choice(string.ascii_uppercase + string.digits) for _ in range(30)) @property def url(self): params = { "client_id": self.client_id, "redirect_uri": self.redirect_url, "state": self.state, "response_type": "code", } if self.scope: params.update({"scope": self.scope}) return "%s?%s" % (self.addr, urllib.parse.urlencode(params)) def getAccessToken(self, code, state): payload = { "code": code, "client_id": self.client_id, "client_secret": self.secret, "redirect_uri": self.redirect_url, "grant_type": "authorization_code", "state": state, } result = requests.post(self.accesstokenaddress, data=payload, headers={"Accept": "application/json"}) if not result.ok or "error" in result.json(): msg = result.json()["error"] self._log_error(msg) raise AuthError(msg) return result.json() def getUserInfo(self, accesstoken): params = {"access_token": accesstoken["access_token"]} userinforesp = requests.get(self.user_info_url, params=params) if not userinforesp.ok: msg = "Failed to get user details" self._log_error(msg) raise AuthError(msg) userinfo = userinforesp.json() return UserInfo(userinfo["login"], userinfo["email"], ["user"]) class ItsYouOnline(OauthInstance): def __init__( self, addr, accesstokenaddr, client_id, secret, scope, redirect_url, user_info_url, logout_url, instance ): OauthInstance.__init__( self, addr, accesstokenaddr, client_id, secret, scope, redirect_url, user_info_url, logout_url, instance ) def getAccessToken(self): return j.clients.itsyouonline.jwt_get(self.client_id, self.secret) def getUserInfo(self, accesstoken): import jose import jose.jwt jwt = accesstoken headers = {"Authorization": "bearer %s" % jwt} jwtdata = jose.jwt.get_unverified_claims(jwt) scopes = jwtdata["scope"] requestedscopes = set(self.scope.split(",")) if set(jwtdata["scope"]).intersection(requestedscopes) != requestedscopes: msg = "Failed to get the requested scope for %s" % self.client_id raise AuthError(msg) username = jwtdata["username"] userinfourl = self.user_info_url.rstrip("/") + "/%s/info" % username userinforesp = requests.get(userinfourl, headers=headers) if not userinforesp.ok: msg = "Failed to get user details" raise AuthError(msg) groups = ["user"] for scope in scopes: parts = scope.split(":") if len(parts) == 3 and parts[:2] == ["user", "memberof"]: groups.append(parts[-1].split(".")[-1]) userinfo = userinforesp.json() return UserInfo(userinfo["username"], userinfo["emailaddresses"][0]["emailaddress"], groups)
31.978261
116
0.579708
import urllib.request import urllib.parse import urllib.error import string import requests import time import random from Jumpscale import j JSConfigClient = j.application.JSBaseConfigClass class OauthClient(JSConfigClient): _SCHEMATEXT = """ @url = jumpscale.oauth.client name* = "" (S) addr = "" (S) accesstokenaddr = "" (S) client_id = "" (S) secret_ = "" (S) scope = "" (S) redirect_url = "" (S) user_info_url = "" (S) logout_url = "" (S) client_instance = "github" (S) """ def _init(self): self.addr = self.addr self.accesstokenaddr = self.accesstokenaddr self.client_id = self.client_id self.secret = self.secret_ self.scope = self.scope self.redirect_url = self.redirect_url self.user_info_url = self.user_info_url self.logout_url = self.logout_url self.client_instance = self.client_instance self._client = None self.instance = "main" @property def client(self): if self._client: return self._client if self.client_instance in ("itsyouonline", "itsyou.online"): self._client = ItsYouOnline( self.addr, self.accesstokenaddr, self.client_id, self.secret, self.scope, self.redirect_url, self.user_info_url, self.logout_url, self.instance, ) else: self._client = OauthInstance( self.addr, self.accesstokenaddr, self.client_id, self.secret, self.scope, self.redirect_url, self.user_info_url, self.logout_url, self.instance, ) return self._client class AuthError(Exception): def _init(self): pass class UserInfo(object): def _init(self, username, emailaddress, groups): self.username = username self.emailaddress = emailaddress self.groups = groups class OauthInstance: def __init__( self, addr, accesstokenaddr, client_id, secret, scope, redirect_url, user_info_url, logout_url, instance ): if not addr: raise RuntimeError("Failed to get oauth instance, no address provided") else: self.addr = addr self.client_id = client_id self.scope = scope self.redirect_url = redirect_url self.accesstokenaddress = accesstokenaddr self.secret = secret self.user_info_url = user_info_url self.logout_url = logout_url self.state = "".join(random.choice(string.ascii_uppercase + string.digits) for _ in range(30)) @property def url(self): params = { "client_id": self.client_id, "redirect_uri": self.redirect_url, "state": self.state, "response_type": "code", } if self.scope: params.update({"scope": self.scope}) return "%s?%s" % (self.addr, urllib.parse.urlencode(params)) def getAccessToken(self, code, state): payload = { "code": code, "client_id": self.client_id, "client_secret": self.secret, "redirect_uri": self.redirect_url, "grant_type": "authorization_code", "state": state, } result = requests.post(self.accesstokenaddress, data=payload, headers={"Accept": "application/json"}) if not result.ok or "error" in result.json(): msg = result.json()["error"] self._log_error(msg) raise AuthError(msg) return result.json() def getUserInfo(self, accesstoken): params = {"access_token": accesstoken["access_token"]} userinforesp = requests.get(self.user_info_url, params=params) if not userinforesp.ok: msg = "Failed to get user details" self._log_error(msg) raise AuthError(msg) userinfo = userinforesp.json() return UserInfo(userinfo["login"], userinfo["email"], ["user"]) class ItsYouOnline(OauthInstance): def __init__( self, addr, accesstokenaddr, client_id, secret, scope, redirect_url, user_info_url, logout_url, instance ): OauthInstance.__init__( self, addr, accesstokenaddr, client_id, secret, scope, redirect_url, user_info_url, logout_url, instance ) def getAccessToken(self): return j.clients.itsyouonline.jwt_get(self.client_id, self.secret) def getUserInfo(self, accesstoken): import jose import jose.jwt jwt = accesstoken headers = {"Authorization": "bearer %s" % jwt} jwtdata = jose.jwt.get_unverified_claims(jwt) scopes = jwtdata["scope"] requestedscopes = set(self.scope.split(",")) if set(jwtdata["scope"]).intersection(requestedscopes) != requestedscopes: msg = "Failed to get the requested scope for %s" % self.client_id raise AuthError(msg) username = jwtdata["username"] userinfourl = self.user_info_url.rstrip("/") + "/%s/info" % username userinforesp = requests.get(userinfourl, headers=headers) if not userinforesp.ok: msg = "Failed to get user details" raise AuthError(msg) groups = ["user"] for scope in scopes: parts = scope.split(":") if len(parts) == 3 and parts[:2] == ["user", "memberof"]: groups.append(parts[-1].split(".")[-1]) userinfo = userinforesp.json() return UserInfo(userinfo["username"], userinfo["emailaddresses"][0]["emailaddress"], groups)
true
true
f7265773512670aeae3bd3c088b90f7348f9d8d0
6,363
py
Python
dump_teacher_hiddens.py
ChenRocks/Distill-BERT-Textgen
a3b0b22ce16febc4d3ffdbd8791ea3374110a892
[ "MIT" ]
111
2020-05-05T04:34:10.000Z
2022-02-20T17:04:56.000Z
dump_teacher_hiddens.py
ChenRocks/Distill-BERT-Textgen
a3b0b22ce16febc4d3ffdbd8791ea3374110a892
[ "MIT" ]
5
2020-06-06T12:45:52.000Z
2021-03-16T13:22:37.000Z
dump_teacher_hiddens.py
ChenRocks/Distill-BERT-Textgen
a3b0b22ce16febc4d3ffdbd8791ea3374110a892
[ "MIT" ]
17
2020-05-07T07:43:05.000Z
2022-01-19T11:33:33.000Z
""" Copyright (c) Microsoft Corporation. Licensed under the MIT license. precompute hidden states of CMLM teacher to speedup KD training """ import argparse import io import os import shelve import numpy as np import torch from torch.utils.data import Dataset, DataLoader from tqdm import tqdm from pytorch_pretrained_bert import BertTokenizer from toolz.sandbox import unzip from cmlm.model import BertForSeq2seq from cmlm.data import convert_token_to_bert, CLS, SEP, MASK def tensor_dumps(tensor): with io.BytesIO() as writer: np.save(writer, tensor.cpu().numpy().astype(np.float16), allow_pickle=False) dump = writer.getvalue() return dump def gather_hiddens(hiddens, masks): outputs = [] for hid, mask in zip(hiddens.split(1, dim=1), masks.split(1, dim=1)): if mask.sum().item() == 0: continue mask = mask.unsqueeze(-1).expand_as(hid) outputs.append(hid.masked_select(mask)) output = torch.stack(outputs, dim=0) return output class BertSampleDataset(Dataset): def __init__(self, corpus_path, tokenizer, num_samples=7): self.db = shelve.open(corpus_path, 'r') self.ids = [] for i, ex in self.db.items(): if len(ex['src']) + len(ex['tgt']) + 3 <= 512: self.ids.append(i) self.toker = tokenizer self.num_samples = num_samples def __len__(self): return len(self.ids) def __getitem__(self, i): id_ = self.ids[i] example = self.db[id_] features = convert_example(example['src'], example['tgt'], self.toker, self.num_samples) return (id_, ) + features def convert_example(src, tgt, toker, num_samples): src = [convert_token_to_bert(tok) for tok in src] tgt = [convert_token_to_bert(tok) for tok in tgt] + [SEP] # build the random masks tgt_len = len(tgt) if tgt_len <= num_samples: masks = torch.eye(tgt_len).byte() num_samples = tgt_len else: mask_inds = [list(range(i, tgt_len, num_samples)) for i in range(num_samples)] masks = torch.zeros(num_samples, tgt_len).byte() for i, indices in enumerate(mask_inds): for j in indices: masks.data[i, j] = 1 assert (masks.sum(dim=0) != torch.ones(tgt_len).long()).sum().item() == 0 assert masks.sum().item() == tgt_len masks = torch.cat([torch.zeros(num_samples, len(src)+2).byte(), masks], dim=1) # make BERT inputs input_ids = toker.convert_tokens_to_ids([CLS] + src + [SEP] + tgt) mask_id = toker.convert_tokens_to_ids([MASK])[0] input_ids = torch.tensor([input_ids for _ in range(num_samples)]) input_ids.data.masked_fill_(masks, mask_id) token_ids = torch.tensor([[0] * (len(src) + 2) + [1] * len(tgt) for _ in range(num_samples)]) return input_ids, token_ids, masks def batch_features(features): ids, all_input_ids, all_token_ids, all_masks = map(list, unzip(features)) batch_size = sum(input_ids.size(0) for input_ids in all_input_ids) max_len = max(input_ids.size(1) for input_ids in all_input_ids) input_ids = torch.zeros(batch_size, max_len).long() token_ids = torch.zeros(batch_size, max_len).long() attn_mask = torch.zeros(batch_size, max_len).long() i = 0 for inp, tok in zip(all_input_ids, all_token_ids): block, len_ = inp.size() input_ids.data[i: i+block, :len_] = inp.data token_ids.data[i: i+block, :len_] = tok.data attn_mask.data[i: i+block, :len_].fill_(1) i += block return ids, input_ids, token_ids, attn_mask, all_masks def process_batch(batch, bert, toker, num_samples=7): input_ids, token_ids, attn_mask, all_masks = batch input_ids = input_ids.cuda() token_ids = token_ids.cuda() attn_mask = attn_mask.cuda() hiddens, _ = bert.bert(input_ids, token_ids, attn_mask, output_all_encoded_layers=False) hiddens = bert.cls.predictions.transform(hiddens) i = 0 outputs = [] for masks in all_masks: block, len_ = masks.size() hids = hiddens[i:i+block, :len_, :] masks = masks.cuda() outputs.append(gather_hiddens(hids, masks)) i += block return outputs def build_db_batched(corpus, out_db, bert, toker, batch_size=8): dataset = BertSampleDataset(corpus, toker) loader = DataLoader(dataset, batch_size=batch_size, num_workers=4, collate_fn=batch_features) with tqdm(desc='computing BERT features', total=len(dataset)) as pbar: for ids, *batch in loader: outputs = process_batch(batch, bert, toker) for id_, output in zip(ids, outputs): out_db[id_] = tensor_dumps(output) pbar.update(len(ids)) def main(opts): # load BERT state_dict = torch.load(opts.ckpt) vsize = state_dict['cls.predictions.decoder.weight'].size(0) bert = BertForSeq2seq.from_pretrained(opts.bert).eval().half().cuda() bert.update_output_layer_by_size(vsize) bert.load_state_dict(state_dict) toker = BertTokenizer.from_pretrained(opts.bert, do_lower_case='uncased' in opts.bert) # save the final projection layer linear = torch.nn.Linear(bert.config.hidden_size, bert.config.vocab_size) linear.weight.data = state_dict['cls.predictions.decoder.weight'] linear.bias.data = state_dict['cls.predictions.bias'] os.makedirs(opts.output) torch.save(linear, f'{opts.output}/linear.pt') # create DB with shelve.open(f'{opts.output}/db') as out_db, \ torch.no_grad(): build_db_batched(opts.db, out_db, bert, toker) if __name__ == '__main__': parser = argparse.ArgumentParser() parser.add_argument('--bert', required=True, choices=['bert-base-uncased', 'bert-base-multilingual-cased'], help='BERT model') parser.add_argument('--ckpt', required=True, help='BERT checkpoint') parser.add_argument('--db', required=True, help='dataset to compute') parser.add_argument('--output', required=True, help='path to dump output') args = parser.parse_args() main(args)
35.949153
79
0.636964
import argparse import io import os import shelve import numpy as np import torch from torch.utils.data import Dataset, DataLoader from tqdm import tqdm from pytorch_pretrained_bert import BertTokenizer from toolz.sandbox import unzip from cmlm.model import BertForSeq2seq from cmlm.data import convert_token_to_bert, CLS, SEP, MASK def tensor_dumps(tensor): with io.BytesIO() as writer: np.save(writer, tensor.cpu().numpy().astype(np.float16), allow_pickle=False) dump = writer.getvalue() return dump def gather_hiddens(hiddens, masks): outputs = [] for hid, mask in zip(hiddens.split(1, dim=1), masks.split(1, dim=1)): if mask.sum().item() == 0: continue mask = mask.unsqueeze(-1).expand_as(hid) outputs.append(hid.masked_select(mask)) output = torch.stack(outputs, dim=0) return output class BertSampleDataset(Dataset): def __init__(self, corpus_path, tokenizer, num_samples=7): self.db = shelve.open(corpus_path, 'r') self.ids = [] for i, ex in self.db.items(): if len(ex['src']) + len(ex['tgt']) + 3 <= 512: self.ids.append(i) self.toker = tokenizer self.num_samples = num_samples def __len__(self): return len(self.ids) def __getitem__(self, i): id_ = self.ids[i] example = self.db[id_] features = convert_example(example['src'], example['tgt'], self.toker, self.num_samples) return (id_, ) + features def convert_example(src, tgt, toker, num_samples): src = [convert_token_to_bert(tok) for tok in src] tgt = [convert_token_to_bert(tok) for tok in tgt] + [SEP] tgt_len = len(tgt) if tgt_len <= num_samples: masks = torch.eye(tgt_len).byte() num_samples = tgt_len else: mask_inds = [list(range(i, tgt_len, num_samples)) for i in range(num_samples)] masks = torch.zeros(num_samples, tgt_len).byte() for i, indices in enumerate(mask_inds): for j in indices: masks.data[i, j] = 1 assert (masks.sum(dim=0) != torch.ones(tgt_len).long()).sum().item() == 0 assert masks.sum().item() == tgt_len masks = torch.cat([torch.zeros(num_samples, len(src)+2).byte(), masks], dim=1) input_ids = toker.convert_tokens_to_ids([CLS] + src + [SEP] + tgt) mask_id = toker.convert_tokens_to_ids([MASK])[0] input_ids = torch.tensor([input_ids for _ in range(num_samples)]) input_ids.data.masked_fill_(masks, mask_id) token_ids = torch.tensor([[0] * (len(src) + 2) + [1] * len(tgt) for _ in range(num_samples)]) return input_ids, token_ids, masks def batch_features(features): ids, all_input_ids, all_token_ids, all_masks = map(list, unzip(features)) batch_size = sum(input_ids.size(0) for input_ids in all_input_ids) max_len = max(input_ids.size(1) for input_ids in all_input_ids) input_ids = torch.zeros(batch_size, max_len).long() token_ids = torch.zeros(batch_size, max_len).long() attn_mask = torch.zeros(batch_size, max_len).long() i = 0 for inp, tok in zip(all_input_ids, all_token_ids): block, len_ = inp.size() input_ids.data[i: i+block, :len_] = inp.data token_ids.data[i: i+block, :len_] = tok.data attn_mask.data[i: i+block, :len_].fill_(1) i += block return ids, input_ids, token_ids, attn_mask, all_masks def process_batch(batch, bert, toker, num_samples=7): input_ids, token_ids, attn_mask, all_masks = batch input_ids = input_ids.cuda() token_ids = token_ids.cuda() attn_mask = attn_mask.cuda() hiddens, _ = bert.bert(input_ids, token_ids, attn_mask, output_all_encoded_layers=False) hiddens = bert.cls.predictions.transform(hiddens) i = 0 outputs = [] for masks in all_masks: block, len_ = masks.size() hids = hiddens[i:i+block, :len_, :] masks = masks.cuda() outputs.append(gather_hiddens(hids, masks)) i += block return outputs def build_db_batched(corpus, out_db, bert, toker, batch_size=8): dataset = BertSampleDataset(corpus, toker) loader = DataLoader(dataset, batch_size=batch_size, num_workers=4, collate_fn=batch_features) with tqdm(desc='computing BERT features', total=len(dataset)) as pbar: for ids, *batch in loader: outputs = process_batch(batch, bert, toker) for id_, output in zip(ids, outputs): out_db[id_] = tensor_dumps(output) pbar.update(len(ids)) def main(opts): state_dict = torch.load(opts.ckpt) vsize = state_dict['cls.predictions.decoder.weight'].size(0) bert = BertForSeq2seq.from_pretrained(opts.bert).eval().half().cuda() bert.update_output_layer_by_size(vsize) bert.load_state_dict(state_dict) toker = BertTokenizer.from_pretrained(opts.bert, do_lower_case='uncased' in opts.bert) linear = torch.nn.Linear(bert.config.hidden_size, bert.config.vocab_size) linear.weight.data = state_dict['cls.predictions.decoder.weight'] linear.bias.data = state_dict['cls.predictions.bias'] os.makedirs(opts.output) torch.save(linear, f'{opts.output}/linear.pt') with shelve.open(f'{opts.output}/db') as out_db, \ torch.no_grad(): build_db_batched(opts.db, out_db, bert, toker) if __name__ == '__main__': parser = argparse.ArgumentParser() parser.add_argument('--bert', required=True, choices=['bert-base-uncased', 'bert-base-multilingual-cased'], help='BERT model') parser.add_argument('--ckpt', required=True, help='BERT checkpoint') parser.add_argument('--db', required=True, help='dataset to compute') parser.add_argument('--output', required=True, help='path to dump output') args = parser.parse_args() main(args)
true
true
f72658a22e37eca598653ef574062e41fecd324c
1,652
py
Python
test/vanilla/Expected/AcceptanceTests/NonStringEnums/nonstringenums/models/_non_string_enums_client_enums.py
tasherif-msft/autorest.python
5b0121bcfa802aedaeda36990e8bcaa2b7e26b14
[ "MIT" ]
null
null
null
test/vanilla/Expected/AcceptanceTests/NonStringEnums/nonstringenums/models/_non_string_enums_client_enums.py
tasherif-msft/autorest.python
5b0121bcfa802aedaeda36990e8bcaa2b7e26b14
[ "MIT" ]
null
null
null
test/vanilla/Expected/AcceptanceTests/NonStringEnums/nonstringenums/models/_non_string_enums_client_enums.py
tasherif-msft/autorest.python
5b0121bcfa802aedaeda36990e8bcaa2b7e26b14
[ "MIT" ]
null
null
null
# coding=utf-8 # -------------------------------------------------------------------------- # Copyright (c) Microsoft Corporation. All rights reserved. # Licensed under the MIT License. See License.txt in the project root for license information. # Code generated by Microsoft (R) AutoRest Code Generator. # Changes may cause incorrect behavior and will be lost if the code is regenerated. # -------------------------------------------------------------------------- from enum import Enum, EnumMeta from six import with_metaclass class _CaseInsensitiveEnumMeta(EnumMeta): def __getitem__(self, name): return super().__getitem__(name.upper()) def __getattr__(cls, name): """Return the enum member matching `name` We use __getattr__ instead of descriptors or inserting into the enum class' __dict__ in order to support `name` and `value` being both properties for enum members (which live in the class' __dict__) and enum members themselves. """ try: return cls._member_map_[name.upper()] except KeyError: raise AttributeError(name) class FloatEnum(with_metaclass(_CaseInsensitiveEnumMeta, float, Enum)): """List of float enums """ TWO_HUNDRED4 = 200.4 FOUR_HUNDRED_THREE4 = 403.4 FOUR_HUNDRED_FIVE3 = 405.3 FOUR_HUNDRED_SIX2 = 406.2 FOUR_HUNDRED_TWENTY_NINE1 = 429.1 class IntEnum(with_metaclass(_CaseInsensitiveEnumMeta, int, Enum)): """List of integer enums """ TWO_HUNDRED = 200 FOUR_HUNDRED_THREE = 403 FOUR_HUNDRED_FIVE = 405 FOUR_HUNDRED_SIX = 406 FOUR_HUNDRED_TWENTY_NINE = 429
34.416667
94
0.640436
from enum import Enum, EnumMeta from six import with_metaclass class _CaseInsensitiveEnumMeta(EnumMeta): def __getitem__(self, name): return super().__getitem__(name.upper()) def __getattr__(cls, name): try: return cls._member_map_[name.upper()] except KeyError: raise AttributeError(name) class FloatEnum(with_metaclass(_CaseInsensitiveEnumMeta, float, Enum)): TWO_HUNDRED4 = 200.4 FOUR_HUNDRED_THREE4 = 403.4 FOUR_HUNDRED_FIVE3 = 405.3 FOUR_HUNDRED_SIX2 = 406.2 FOUR_HUNDRED_TWENTY_NINE1 = 429.1 class IntEnum(with_metaclass(_CaseInsensitiveEnumMeta, int, Enum)): TWO_HUNDRED = 200 FOUR_HUNDRED_THREE = 403 FOUR_HUNDRED_FIVE = 405 FOUR_HUNDRED_SIX = 406 FOUR_HUNDRED_TWENTY_NINE = 429
true
true
f72658a883e0ec8dce8892d634b7105d4bac6c3d
354
py
Python
algorithm/challenges/geanytest.py
rishabhiitbhu/hackerrank
acc300851c81a29472177f15fd8b56ebebe853ea
[ "MIT" ]
null
null
null
algorithm/challenges/geanytest.py
rishabhiitbhu/hackerrank
acc300851c81a29472177f15fd8b56ebebe853ea
[ "MIT" ]
null
null
null
algorithm/challenges/geanytest.py
rishabhiitbhu/hackerrank
acc300851c81a29472177f15fd8b56ebebe853ea
[ "MIT" ]
1
2020-01-30T06:47:09.000Z
2020-01-30T06:47:09.000Z
t = int(input().strip()) for i in range(t): n,c,m = input().strip().split(' ') n,c,m = [int(n),int(c),int(m)] tot_choc=n//c wrap=tot_choc #print(tot_choc, wrap) while wrap >= m: extra_choc = wrap//m wrap-=m*extra_choc wrap+=extra_choc tot_choc+= extra_choc print(tot_choc)
25.285714
39
0.516949
t = int(input().strip()) for i in range(t): n,c,m = input().strip().split(' ') n,c,m = [int(n),int(c),int(m)] tot_choc=n//c wrap=tot_choc while wrap >= m: extra_choc = wrap//m wrap-=m*extra_choc wrap+=extra_choc tot_choc+= extra_choc print(tot_choc)
true
true
f72658e3bad5fe570677617b549a92f97f742c6b
8,745
py
Python
selfdrive/car/hyundai/carcontroller.py
janpoo6427/openpilot_xx979xx
189764c2ad1d6610165876a0462ba0eb896ac500
[ "MIT" ]
null
null
null
selfdrive/car/hyundai/carcontroller.py
janpoo6427/openpilot_xx979xx
189764c2ad1d6610165876a0462ba0eb896ac500
[ "MIT" ]
null
null
null
selfdrive/car/hyundai/carcontroller.py
janpoo6427/openpilot_xx979xx
189764c2ad1d6610165876a0462ba0eb896ac500
[ "MIT" ]
2
2020-09-27T20:46:34.000Z
2020-10-15T01:01:57.000Z
from cereal import car from common.numpy_fast import clip from selfdrive.car import apply_std_steer_torque_limits from selfdrive.car.hyundai.hyundaican import create_lkas11, create_clu11, create_lfa_mfa, \ create_scc11, create_scc12, create_mdps12, \ create_scc13, create_scc14 from selfdrive.car.hyundai.values import Buttons, SteerLimitParams, CAR from opendbc.can.packer import CANPacker from selfdrive.config import Conversions as CV VisualAlert = car.CarControl.HUDControl.VisualAlert min_set_speed = 30 * CV.KPH_TO_MS # Accel limits ACCEL_HYST_GAP = 0.02 # don't change accel command for small oscilalitons within this value ACCEL_MAX = 1.5 # 1.5 m/s2 ACCEL_MIN = -3.0 # 3 m/s2 ACCEL_SCALE = max(ACCEL_MAX, -ACCEL_MIN) def accel_hysteresis(accel, accel_steady): # for small accel oscillations within ACCEL_HYST_GAP, don't change the accel command if accel > accel_steady + ACCEL_HYST_GAP: accel_steady = accel - ACCEL_HYST_GAP elif accel < accel_steady - ACCEL_HYST_GAP: accel_steady = accel + ACCEL_HYST_GAP accel = accel_steady return accel, accel_steady def process_hud_alert(enabled, fingerprint, visual_alert, left_lane, right_lane, left_lane_depart, right_lane_depart, button_on): sys_warning = (visual_alert == VisualAlert.steerRequired) # initialize to no line visible sys_state = 1 if not button_on: lane_visible = 0 if left_lane and right_lane or sys_warning: #HUD alert only display when LKAS status is active if enabled or sys_warning: sys_state = 3 else: sys_state = 4 elif left_lane: sys_state = 5 elif right_lane: sys_state = 6 # initialize to no warnings left_lane_warning = 0 right_lane_warning = 0 if left_lane_depart: left_lane_warning = 1 if fingerprint in [CAR.HYUNDAI_GENESIS, CAR.GENESIS_G90, CAR.GENESIS_G80] else 2 if right_lane_depart: right_lane_warning = 1 if fingerprint in [CAR.HYUNDAI_GENESIS, CAR.GENESIS_G90, CAR.GENESIS_G80] else 2 return sys_warning, sys_state, left_lane_warning, right_lane_warning class CarController(): def __init__(self, dbc_name, CP, VM): self.car_fingerprint = CP.carFingerprint self.packer = CANPacker(dbc_name) self.accel_steady = 0 self.apply_steer_last = 0 self.steer_rate_limited = False self.lkas11_cnt = 0 self.scc12_cnt = 0 self.resume_cnt = 0 self.last_resume_frame = 0 self.last_lead_distance = 0 self.turning_signal_timer = 0 self.lkas_button_on = True self.longcontrol = CP.openpilotLongitudinalControl self.scc_live = not CP.radarOffCan def update(self, enabled, CS, frame, actuators, pcm_cancel_cmd, visual_alert, left_lane, right_lane, left_lane_depart, right_lane_depart, set_speed, lead_visible): # *** compute control surfaces *** # gas and brake apply_accel = actuators.gas - actuators.brake apply_accel, self.accel_steady = accel_hysteresis(apply_accel, self.accel_steady) apply_accel = clip(apply_accel * ACCEL_SCALE, ACCEL_MIN, ACCEL_MAX) # Steering Torque new_steer = actuators.steer * SteerLimitParams.STEER_MAX apply_steer = apply_std_steer_torque_limits(new_steer, self.apply_steer_last, CS.out.steeringTorque, SteerLimitParams) self.steer_rate_limited = new_steer != apply_steer # disable if steer angle reach 90 deg, otherwise mdps fault in some models # temporarily disable steering when LKAS button off lkas_active = enabled and abs(CS.out.steeringAngle) < 90. and self.lkas_button_on # fix for Genesis hard fault at low speed if CS.out.vEgo < 60 * CV.KPH_TO_MS and self.car_fingerprint == CAR.HYUNDAI_GENESIS and not CS.mdps_bus: lkas_active = 0 # Disable steering while turning blinker on and speed below 60 kph if CS.out.leftBlinker or CS.out.rightBlinker: if self.car_fingerprint not in [CAR.KIA_OPTIMA, CAR.KIA_OPTIMA_H]: self.turning_signal_timer = 100 # Disable for 1.0 Seconds after blinker turned off elif CS.left_blinker_flash or CS.right_blinker_flash: # Optima has blinker flash signal only self.turning_signal_timer = 100 if self.turning_indicator_alert: # set and clear by interface lkas_active = 0 if self.turning_signal_timer > 0: self.turning_signal_timer -= 1 if not lkas_active: apply_steer = 0 self.apply_accel_last = apply_accel self.apply_steer_last = apply_steer sys_warning, sys_state, left_lane_warning, right_lane_warning =\ process_hud_alert(lkas_active, self.car_fingerprint, visual_alert, left_lane, right_lane, left_lane_depart, right_lane_depart, self.lkas_button_on) clu11_speed = CS.clu11["CF_Clu_Vanz"] enabled_speed = 38 if CS.is_set_speed_in_mph else 60 if clu11_speed > enabled_speed or not lkas_active: enabled_speed = clu11_speed if set_speed < min_set_speed: set_speed = min_set_speed set_speed *= CV.MS_TO_MPH if CS.is_set_speed_in_mph else CV.MS_TO_KPH if frame == 0: # initialize counts from last received count signals self.lkas11_cnt = CS.lkas11["CF_Lkas_MsgCount"] self.scc12_cnt = CS.scc12["CR_VSM_Alive"] + 1 if not CS.no_radar else 0 #TODO: fix this # self.prev_scc_cnt = CS.scc11["AliveCounterACC"] # self.scc_update_frame = frame # check if SCC is alive # if frame % 7 == 0: # if CS.scc11["AliveCounterACC"] == self.prev_scc_cnt: # if frame - self.scc_update_frame > 20 and self.scc_live: # self.scc_live = False # else: # self.scc_live = True # self.prev_scc_cnt = CS.scc11["AliveCounterACC"] # self.scc_update_frame = frame self.prev_scc_cnt = CS.scc11["AliveCounterACC"] self.lkas11_cnt = (self.lkas11_cnt + 1) % 0x10 self.scc12_cnt %= 0xF can_sends = [] can_sends.append(create_lkas11(self.packer, frame, self.car_fingerprint, apply_steer, lkas_active, CS.lkas11, sys_warning, sys_state, enabled, left_lane, right_lane, left_lane_warning, right_lane_warning, 0)) if CS.mdps_bus or CS.scc_bus == 1: # send lkas11 bus 1 if mdps or scc is on bus 1 can_sends.append(create_lkas11(self.packer, frame, self.car_fingerprint, apply_steer, lkas_active, CS.lkas11, sys_warning, sys_state, enabled, left_lane, right_lane, left_lane_warning, right_lane_warning, 1)) if frame % 2 and CS.mdps_bus: # send clu11 to mdps if it is not on bus 0 can_sends.append(create_clu11(self.packer, frame, CS.mdps_bus, CS.clu11, Buttons.NONE, enabled_speed)) if pcm_cancel_cmd and self.longcontrol: can_sends.append(create_clu11(self.packer, frame, CS.scc_bus, CS.clu11, Buttons.CANCEL, clu11_speed)) elif CS.mdps_bus: # send mdps12 to LKAS to prevent LKAS error if no cancel cmd can_sends.append(create_mdps12(self.packer, frame, CS.mdps12)) # send scc to car if longcontrol enabled and SCC not on bus 0 or ont live if self.longcontrol and (CS.scc_bus or not self.scc_live) and frame % 2 == 0: can_sends.append(create_scc12(self.packer, apply_accel, enabled, self.scc12_cnt, self.scc_live, CS.scc12)) can_sends.append(create_scc11(self.packer, frame, enabled, set_speed, lead_visible, self.scc_live, CS.scc11)) if CS.has_scc13 and frame % 20 == 0: can_sends.append(create_scc13(self.packer, CS.scc13)) if CS.has_scc14: can_sends.append(create_scc14(self.packer, enabled, CS.scc14)) self.scc12_cnt += 1 if CS.out.cruiseState.standstill: # run only first time when the car stopped if self.last_lead_distance == 0: # get the lead distance from the Radar self.last_lead_distance = CS.lead_distance self.resume_cnt = 0 # when lead car starts moving, create 6 RES msgs elif CS.lead_distance != self.last_lead_distance and (frame - self.last_resume_frame) > 5: can_sends.append(create_clu11(self.packer, frame, CS.scc_bus, CS.clu11, Buttons.RES_ACCEL, clu11_speed)) self.resume_cnt += 1 # interval after 6 msgs if self.resume_cnt > 5: self.last_resume_frame = frame self.resume_cnt = 0 # reset lead distnce after the car starts moving elif self.last_lead_distance != 0: self.last_lead_distance = 0 # 20 Hz LFA MFA message if frame % 5 == 0 and self.car_fingerprint in [CAR.SONATA, CAR.PALISADE, CAR.SONATA_H, CAR.SANTA_FE]: can_sends.append(create_lfa_mfa(self.packer, frame, enabled)) return can_sends
42.658537
122
0.705432
from cereal import car from common.numpy_fast import clip from selfdrive.car import apply_std_steer_torque_limits from selfdrive.car.hyundai.hyundaican import create_lkas11, create_clu11, create_lfa_mfa, \ create_scc11, create_scc12, create_mdps12, \ create_scc13, create_scc14 from selfdrive.car.hyundai.values import Buttons, SteerLimitParams, CAR from opendbc.can.packer import CANPacker from selfdrive.config import Conversions as CV VisualAlert = car.CarControl.HUDControl.VisualAlert min_set_speed = 30 * CV.KPH_TO_MS ACCEL_HYST_GAP = 0.02 ACCEL_MAX = 1.5 # 1.5 m/s2 ACCEL_MIN = -3.0 # 3 m/s2 ACCEL_SCALE = max(ACCEL_MAX, -ACCEL_MIN) def accel_hysteresis(accel, accel_steady): # for small accel oscillations within ACCEL_HYST_GAP, don't change the accel command if accel > accel_steady + ACCEL_HYST_GAP: accel_steady = accel - ACCEL_HYST_GAP elif accel < accel_steady - ACCEL_HYST_GAP: accel_steady = accel + ACCEL_HYST_GAP accel = accel_steady return accel, accel_steady def process_hud_alert(enabled, fingerprint, visual_alert, left_lane, right_lane, left_lane_depart, right_lane_depart, button_on): sys_warning = (visual_alert == VisualAlert.steerRequired) sys_state = 1 if not button_on: lane_visible = 0 if left_lane and right_lane or sys_warning: if enabled or sys_warning: sys_state = 3 else: sys_state = 4 elif left_lane: sys_state = 5 elif right_lane: sys_state = 6 left_lane_warning = 0 right_lane_warning = 0 if left_lane_depart: left_lane_warning = 1 if fingerprint in [CAR.HYUNDAI_GENESIS, CAR.GENESIS_G90, CAR.GENESIS_G80] else 2 if right_lane_depart: right_lane_warning = 1 if fingerprint in [CAR.HYUNDAI_GENESIS, CAR.GENESIS_G90, CAR.GENESIS_G80] else 2 return sys_warning, sys_state, left_lane_warning, right_lane_warning class CarController(): def __init__(self, dbc_name, CP, VM): self.car_fingerprint = CP.carFingerprint self.packer = CANPacker(dbc_name) self.accel_steady = 0 self.apply_steer_last = 0 self.steer_rate_limited = False self.lkas11_cnt = 0 self.scc12_cnt = 0 self.resume_cnt = 0 self.last_resume_frame = 0 self.last_lead_distance = 0 self.turning_signal_timer = 0 self.lkas_button_on = True self.longcontrol = CP.openpilotLongitudinalControl self.scc_live = not CP.radarOffCan def update(self, enabled, CS, frame, actuators, pcm_cancel_cmd, visual_alert, left_lane, right_lane, left_lane_depart, right_lane_depart, set_speed, lead_visible): apply_accel = actuators.gas - actuators.brake apply_accel, self.accel_steady = accel_hysteresis(apply_accel, self.accel_steady) apply_accel = clip(apply_accel * ACCEL_SCALE, ACCEL_MIN, ACCEL_MAX) new_steer = actuators.steer * SteerLimitParams.STEER_MAX apply_steer = apply_std_steer_torque_limits(new_steer, self.apply_steer_last, CS.out.steeringTorque, SteerLimitParams) self.steer_rate_limited = new_steer != apply_steer lkas_active = enabled and abs(CS.out.steeringAngle) < 90. and self.lkas_button_on if CS.out.vEgo < 60 * CV.KPH_TO_MS and self.car_fingerprint == CAR.HYUNDAI_GENESIS and not CS.mdps_bus: lkas_active = 0 if CS.out.leftBlinker or CS.out.rightBlinker: if self.car_fingerprint not in [CAR.KIA_OPTIMA, CAR.KIA_OPTIMA_H]: self.turning_signal_timer = 100 elif CS.left_blinker_flash or CS.right_blinker_flash: self.turning_signal_timer = 100 if self.turning_indicator_alert: lkas_active = 0 if self.turning_signal_timer > 0: self.turning_signal_timer -= 1 if not lkas_active: apply_steer = 0 self.apply_accel_last = apply_accel self.apply_steer_last = apply_steer sys_warning, sys_state, left_lane_warning, right_lane_warning =\ process_hud_alert(lkas_active, self.car_fingerprint, visual_alert, left_lane, right_lane, left_lane_depart, right_lane_depart, self.lkas_button_on) clu11_speed = CS.clu11["CF_Clu_Vanz"] enabled_speed = 38 if CS.is_set_speed_in_mph else 60 if clu11_speed > enabled_speed or not lkas_active: enabled_speed = clu11_speed if set_speed < min_set_speed: set_speed = min_set_speed set_speed *= CV.MS_TO_MPH if CS.is_set_speed_in_mph else CV.MS_TO_KPH if frame == 0: self.lkas11_cnt = CS.lkas11["CF_Lkas_MsgCount"] self.scc12_cnt = CS.scc12["CR_VSM_Alive"] + 1 if not CS.no_radar else 0 self.prev_scc_cnt = CS.scc11["AliveCounterACC"] self.lkas11_cnt = (self.lkas11_cnt + 1) % 0x10 self.scc12_cnt %= 0xF can_sends = [] can_sends.append(create_lkas11(self.packer, frame, self.car_fingerprint, apply_steer, lkas_active, CS.lkas11, sys_warning, sys_state, enabled, left_lane, right_lane, left_lane_warning, right_lane_warning, 0)) if CS.mdps_bus or CS.scc_bus == 1: can_sends.append(create_lkas11(self.packer, frame, self.car_fingerprint, apply_steer, lkas_active, CS.lkas11, sys_warning, sys_state, enabled, left_lane, right_lane, left_lane_warning, right_lane_warning, 1)) if frame % 2 and CS.mdps_bus: can_sends.append(create_clu11(self.packer, frame, CS.mdps_bus, CS.clu11, Buttons.NONE, enabled_speed)) if pcm_cancel_cmd and self.longcontrol: can_sends.append(create_clu11(self.packer, frame, CS.scc_bus, CS.clu11, Buttons.CANCEL, clu11_speed)) elif CS.mdps_bus: can_sends.append(create_mdps12(self.packer, frame, CS.mdps12)) if self.longcontrol and (CS.scc_bus or not self.scc_live) and frame % 2 == 0: can_sends.append(create_scc12(self.packer, apply_accel, enabled, self.scc12_cnt, self.scc_live, CS.scc12)) can_sends.append(create_scc11(self.packer, frame, enabled, set_speed, lead_visible, self.scc_live, CS.scc11)) if CS.has_scc13 and frame % 20 == 0: can_sends.append(create_scc13(self.packer, CS.scc13)) if CS.has_scc14: can_sends.append(create_scc14(self.packer, enabled, CS.scc14)) self.scc12_cnt += 1 if CS.out.cruiseState.standstill: if self.last_lead_distance == 0: self.last_lead_distance = CS.lead_distance self.resume_cnt = 0 elif CS.lead_distance != self.last_lead_distance and (frame - self.last_resume_frame) > 5: can_sends.append(create_clu11(self.packer, frame, CS.scc_bus, CS.clu11, Buttons.RES_ACCEL, clu11_speed)) self.resume_cnt += 1 if self.resume_cnt > 5: self.last_resume_frame = frame self.resume_cnt = 0 elif self.last_lead_distance != 0: self.last_lead_distance = 0 if frame % 5 == 0 and self.car_fingerprint in [CAR.SONATA, CAR.PALISADE, CAR.SONATA_H, CAR.SANTA_FE]: can_sends.append(create_lfa_mfa(self.packer, frame, enabled)) return can_sends
true
true
f7265a0b69f2307625509d7efc09f1872f2f80c4
8,067
py
Python
trading-with-python/util/trendy.py
mikimaus78/ml_monorepo
b2c2627ff0e86e27f6829170d0dac168d8e5783b
[ "BSD-3-Clause" ]
51
2019-02-01T19:43:37.000Z
2022-03-16T09:07:03.000Z
trading-with-python/util/trendy.py
mikimaus78/ml_monorepo
b2c2627ff0e86e27f6829170d0dac168d8e5783b
[ "BSD-3-Clause" ]
2
2019-02-23T18:54:22.000Z
2019-11-09T01:30:32.000Z
trading-with-python/util/trendy.py
mikimaus78/ml_monorepo
b2c2627ff0e86e27f6829170d0dac168d8e5783b
[ "BSD-3-Clause" ]
35
2019-02-08T02:00:31.000Z
2022-03-01T23:17:00.000Z
import numpy as np from filter import movingaverage def gentrends(x, window=1/3.0, charts=True): """ Returns a Pandas dataframe with support and resistance lines. :param x: One-dimensional data set :param window: How long the trendlines should be. If window < 1, then it will be taken as a percentage of the size of the data :param charts: Boolean value saying whether to print chart to screen """ import numpy as np import pandas.io.data as pd x = np.array(x) if window < 1: window = int(window * len(x)) max1 = np.where(x == max(x))[0][0] # find the index of the abs max min1 = np.where(x == min(x))[0][0] # find the index of the abs min # First the max if max1 + window > len(x): max2 = max(x[0:(max1 - window)]) else: max2 = max(x[(max1 + window):]) # Now the min if min1 - window < 0: min2 = min(x[(min1 + window):]) else: min2 = min(x[0:(min1 - window)]) # Now find the indices of the secondary extrema max2 = np.where(x == max2)[0][0] # find the index of the 2nd max min2 = np.where(x == min2)[0][0] # find the index of the 2nd min # Create & extend the lines maxslope = (x[max1] - x[max2]) / (max1 - max2) # slope between max points minslope = (x[min1] - x[min2]) / (min1 - min2) # slope between min points a_max = x[max1] - (maxslope * max1) # y-intercept for max trendline a_min = x[min1] - (minslope * min1) # y-intercept for min trendline b_max = x[max1] + (maxslope * (len(x) - max1)) # extend to last data pt b_min = x[min1] + (minslope * (len(x) - min1)) # extend to last data point maxline = np.linspace(a_max, b_max, len(x)) # Y values between max's minline = np.linspace(a_min, b_min, len(x)) # Y values between min's # OUTPUT trends = np.transpose(np.array((x, maxline, minline))) trends = pd.DataFrame(trends, index=np.arange(0, len(x)), columns=['Data', 'Max Line', 'Min Line']) if charts is True: from matplotlib.pyplot import plot, grid, show, figure figure() plot(trends) grid() show() return trends, maxslope, minslope def segtrends(x, segments=2, charts=True, window=7): """ Turn minitrends to iterative process more easily adaptable to implementation in simple trading systems; allows backtesting functionality. :param x: One-dimensional data set :param window: How long the trendlines should be. If window < 1, then it will be taken as a percentage of the size of the data :param charts: Boolean value saying whether to print chart to screen """ import numpy as np y = np.array(x) n=len(y) movy = movingaverage(y, window) # Implement trendlines and Find the indexes of these maxima in the data segments = int(segments) maxima = np.ones(segments) minima = np.ones(segments) x_maxima = np.ones(segments) x_minima = np.ones(segments) segsize = int(len(y)/segments) for i in range(1, segments+1): ind2 = i*segsize ind1 = ind2 - segsize seg = y[ind1:ind2] maxima[i-1] = max(seg) minima[i-1] = min(seg) x_maxima[i-1] = ind1 + (np.where(seg == maxima[i-1])[0][0]) x_minima[i-1] = ind1 + (np.where(seg == minima[i-1])[0][0]) if charts: import matplotlib.pyplot as plt plt.plot(y) plt.grid(True) for i in range(0, segments-1): maxslope = (maxima[i+1] - maxima[i]) / (x_maxima[i+1] - x_maxima[i]) a_max = maxima[i] - (maxslope * x_maxima[i]) b_max = maxima[i] + (maxslope * (len(y) - x_maxima[i])) maxline = np.linspace(a_max, b_max, len(y)) minslope = (minima[i+1] - minima[i]) / (x_minima[i+1] - x_minima[i]) a_min = minima[i] - (minslope * x_minima[i]) b_min = minima[i] + (minslope * (len(y) - x_minima[i])) minline = np.linspace(a_min, b_min, len(y)) if charts: #plt.plot(maxline, 'g') #plt.plot(minline, 'r') pass if charts: plt.plot(range(n), movy, 'b') plt.plot(x_maxima, maxima, 'g') plt.plot(x_minima, minima, 'r') plt.show() # OUTPUT return x_maxima, maxima, x_minima, minima def minitrends(x, window=20, charts=True): """ Turn minitrends to iterative process more easily adaptable to implementation in simple trading systems; allows backtesting functionality. :param x: One-dimensional data set :param window: How long the trendlines should be. If window < 1, then it will be taken as a percentage of the size of the data :param charts: Boolean value saying whether to print chart to screen """ import numpy as np y = np.array(x) if window < 1: # if window is given as fraction of data length window = float(window) window = int(window * len(y)) x = np.arange(0, len(y)) dy = y[window:] - y[:-window] crit = dy[:-1] * dy[1:] < 0 # Find whether max's or min's maxi = (y[x[crit]] - y[x[crit] + window] > 0) & \ (y[x[crit]] - y[x[crit] - window] > 0) * 1 mini = (y[x[crit]] - y[x[crit] + window] < 0) & \ (y[x[crit]] - y[x[crit] - window] < 0) * 1 maxi = maxi.astype(float) mini = mini.astype(float) maxi[maxi == 0] = np.nan mini[mini == 0] = np.nan xmax = x[crit] * maxi xmax = xmax[~np.isnan(xmax)] xmax = xmax.astype(int) xmin = x[crit] * mini xmin = xmin[~np.isnan(xmin)] xmin = xmin.astype(int) # See if better max or min in region yMax = np.array([]) xMax = np.array([]) for i in xmax: indx = np.where(xmax == i)[0][0] + 1 try: Y = y[i:xmax[indx]] yMax = np.append(yMax, Y.max()) xMax = np.append(xMax, np.where(y == yMax[-1])[0][0]) except: pass yMin = np.array([]) xMin = np.array([]) for i in xmin: indx = np.where(xmin == i)[0][0] + 1 try: Y = y[i:xmin[indx]] yMin = np.append(yMin, Y.min()) xMin = np.append(xMin, np.where(y == yMin[-1])[0][0]) except: pass if y[-1] > yMax[-1]: yMax = np.append(yMax, y[-1]) xMax = np.append(xMax, x[-1]) if y[0] not in yMax: yMax = np.insert(yMax, 0, y[0]) xMax = np.insert(xMax, 0, x[0]) if y[-1] < yMin[-1]: yMin = np.append(yMin, y[-1]) xMin = np.append(xMin, x[-1]) if y[0] not in yMin: yMin = np.insert(yMin, 0, y[0]) xMin = np.insert(xMin, 0, x[0]) # Plot results if desired if charts is True: from matplotlib.pyplot import plot, show, grid plot(x, y) plot(xMax, yMax, '-o') plot(xMin, yMin, '-o') grid(True) show() # Return arrays of critical points return xMax, yMax, xMin, yMin def iterlines(x, window=30, charts=True): """ Turn minitrends to iterative process more easily adaptable to implementation in simple trading systems; allows backtesting functionality. :param x: One-dimensional data set :param window: How long the trendlines should be. If window < 1, then it will be taken as a percentage of the size of the data :param charts: Boolean value saying whether to print chart to screen """ import numpy as np x = np.array(x) n = len(x) if window < 1: window = int(window * n) sigs = np.zeros(n, dtype=float) i = window while i != n: if x[i] > max(x[i-window:i]): sigs[i] = 1 elif x[i] < min(x[i-window:i]): sigs[i] = -1 i += 1 xmin = np.where(sigs == -1.0)[0] xmax = np.where(sigs == 1.0)[0] ymin = x[xmin] ymax = x[xmax] if charts is True: from matplotlib.pyplot import plot, grid, show plot(x) plot(xmin, ymin, 'ro') plot(xmax, ymax, 'go') grid(True) show() return sigs
32.792683
79
0.567497
import numpy as np from filter import movingaverage def gentrends(x, window=1/3.0, charts=True): import numpy as np import pandas.io.data as pd x = np.array(x) if window < 1: window = int(window * len(x)) max1 = np.where(x == max(x))[0][0] min1 = np.where(x == min(x))[0][0] if max1 + window > len(x): max2 = max(x[0:(max1 - window)]) else: max2 = max(x[(max1 + window):]) if min1 - window < 0: min2 = min(x[(min1 + window):]) else: min2 = min(x[0:(min1 - window)]) max2 = np.where(x == max2)[0][0] min2 = np.where(x == min2)[0][0] maxslope = (x[max1] - x[max2]) / (max1 - max2) minslope = (x[min1] - x[min2]) / (min1 - min2) a_max = x[max1] - (maxslope * max1) a_min = x[min1] - (minslope * min1) b_max = x[max1] + (maxslope * (len(x) - max1)) b_min = x[min1] + (minslope * (len(x) - min1)) maxline = np.linspace(a_max, b_max, len(x)) minline = np.linspace(a_min, b_min, len(x)) # Y values between min's trends = np.transpose(np.array((x, maxline, minline))) trends = pd.DataFrame(trends, index=np.arange(0, len(x)), columns=['Data', 'Max Line', 'Min Line']) if charts is True: from matplotlib.pyplot import plot, grid, show, figure figure() plot(trends) grid() show() return trends, maxslope, minslope def segtrends(x, segments=2, charts=True, window=7): import numpy as np y = np.array(x) n=len(y) movy = movingaverage(y, window) segments = int(segments) maxima = np.ones(segments) minima = np.ones(segments) x_maxima = np.ones(segments) x_minima = np.ones(segments) segsize = int(len(y)/segments) for i in range(1, segments+1): ind2 = i*segsize ind1 = ind2 - segsize seg = y[ind1:ind2] maxima[i-1] = max(seg) minima[i-1] = min(seg) x_maxima[i-1] = ind1 + (np.where(seg == maxima[i-1])[0][0]) x_minima[i-1] = ind1 + (np.where(seg == minima[i-1])[0][0]) if charts: import matplotlib.pyplot as plt plt.plot(y) plt.grid(True) for i in range(0, segments-1): maxslope = (maxima[i+1] - maxima[i]) / (x_maxima[i+1] - x_maxima[i]) a_max = maxima[i] - (maxslope * x_maxima[i]) b_max = maxima[i] + (maxslope * (len(y) - x_maxima[i])) maxline = np.linspace(a_max, b_max, len(y)) minslope = (minima[i+1] - minima[i]) / (x_minima[i+1] - x_minima[i]) a_min = minima[i] - (minslope * x_minima[i]) b_min = minima[i] + (minslope * (len(y) - x_minima[i])) minline = np.linspace(a_min, b_min, len(y)) if charts: pass if charts: plt.plot(range(n), movy, 'b') plt.plot(x_maxima, maxima, 'g') plt.plot(x_minima, minima, 'r') plt.show() return x_maxima, maxima, x_minima, minima def minitrends(x, window=20, charts=True): import numpy as np y = np.array(x) if window < 1: window = float(window) window = int(window * len(y)) x = np.arange(0, len(y)) dy = y[window:] - y[:-window] crit = dy[:-1] * dy[1:] < 0 maxi = (y[x[crit]] - y[x[crit] + window] > 0) & \ (y[x[crit]] - y[x[crit] - window] > 0) * 1 mini = (y[x[crit]] - y[x[crit] + window] < 0) & \ (y[x[crit]] - y[x[crit] - window] < 0) * 1 maxi = maxi.astype(float) mini = mini.astype(float) maxi[maxi == 0] = np.nan mini[mini == 0] = np.nan xmax = x[crit] * maxi xmax = xmax[~np.isnan(xmax)] xmax = xmax.astype(int) xmin = x[crit] * mini xmin = xmin[~np.isnan(xmin)] xmin = xmin.astype(int) yMax = np.array([]) xMax = np.array([]) for i in xmax: indx = np.where(xmax == i)[0][0] + 1 try: Y = y[i:xmax[indx]] yMax = np.append(yMax, Y.max()) xMax = np.append(xMax, np.where(y == yMax[-1])[0][0]) except: pass yMin = np.array([]) xMin = np.array([]) for i in xmin: indx = np.where(xmin == i)[0][0] + 1 try: Y = y[i:xmin[indx]] yMin = np.append(yMin, Y.min()) xMin = np.append(xMin, np.where(y == yMin[-1])[0][0]) except: pass if y[-1] > yMax[-1]: yMax = np.append(yMax, y[-1]) xMax = np.append(xMax, x[-1]) if y[0] not in yMax: yMax = np.insert(yMax, 0, y[0]) xMax = np.insert(xMax, 0, x[0]) if y[-1] < yMin[-1]: yMin = np.append(yMin, y[-1]) xMin = np.append(xMin, x[-1]) if y[0] not in yMin: yMin = np.insert(yMin, 0, y[0]) xMin = np.insert(xMin, 0, x[0]) if charts is True: from matplotlib.pyplot import plot, show, grid plot(x, y) plot(xMax, yMax, '-o') plot(xMin, yMin, '-o') grid(True) show() return xMax, yMax, xMin, yMin def iterlines(x, window=30, charts=True): import numpy as np x = np.array(x) n = len(x) if window < 1: window = int(window * n) sigs = np.zeros(n, dtype=float) i = window while i != n: if x[i] > max(x[i-window:i]): sigs[i] = 1 elif x[i] < min(x[i-window:i]): sigs[i] = -1 i += 1 xmin = np.where(sigs == -1.0)[0] xmax = np.where(sigs == 1.0)[0] ymin = x[xmin] ymax = x[xmax] if charts is True: from matplotlib.pyplot import plot, grid, show plot(x) plot(xmin, ymin, 'ro') plot(xmax, ymax, 'go') grid(True) show() return sigs
true
true
f7265b61b492e4080f0306586bfd4421f042a4b1
9,483
py
Python
gamestonk_terminal/stocks/insider/openinsider_view.py
jbushago/GamestonkTerminal
73a2b419664bf62bbdc59aa8402c8cd6a913a518
[ "MIT" ]
1
2022-03-15T13:05:40.000Z
2022-03-15T13:05:40.000Z
gamestonk_terminal/stocks/insider/openinsider_view.py
jbushago/GamestonkTerminal
73a2b419664bf62bbdc59aa8402c8cd6a913a518
[ "MIT" ]
null
null
null
gamestonk_terminal/stocks/insider/openinsider_view.py
jbushago/GamestonkTerminal
73a2b419664bf62bbdc59aa8402c8cd6a913a518
[ "MIT" ]
null
null
null
import itertools import logging import os import textwrap from typing import List import numpy as np import pandas as pd import requests from bs4 import BeautifulSoup from gamestonk_terminal.decorators import log_start_end from gamestonk_terminal.helper_funcs import ( export_data, patch_pandas_text_adjustment, print_rich_table, ) from gamestonk_terminal.rich_config import console from gamestonk_terminal.stocks.insider.openinsider_model import ( get_open_insider_data, get_open_insider_link, ) from gamestonk_terminal import rich_config logger = logging.getLogger(__name__) d_open_insider = { "lcb": "latest-cluster-buys", "lpsb": "latest-penny-stock-buys", "lit": "latest-insider-trading", "lip": "insider-purchases", "blip": "latest-insider-purchases-25k", "blop": "latest-officer-purchases-25k", "blcp": "latest-ceo-cfo-purchases-25k", "lis": "insider-sales", "blis": "latest-insider-sales-100k", "blos": "latest-officer-sales-100k", "blcs": "latest-ceo-cfo-sales-100k", "topt": "top-officer-purchases-of-the-day", "toppw": "top-officer-purchases-of-the-week", "toppm": "top-officer-purchases-of-the-month", "tipt": "top-insider-purchases-of-the-day", "tippw": "top-insider-purchases-of-the-week", "tippm": "top-insider-purchases-of-the-month", "tist": "top-insider-sales-of-the-day", "tispw": "top-insider-sales-of-the-week", "tispm": "top-insider-sales-of-the-month", } d_notes = { "A": "A: Amended filing", "D": "D: Derivative transaction in filing (usually option exercise)", "E": "E: Error detected in filing", "M": "M: Multiple transactions in filing; earliest reported transaction date & weighted average transaction price", } d_trade_types = { "S - Sale": "[red]S - Sale: Sale of securities on an exchange or to another person[/red]", "S - Sale+OE": "[yellow]S - Sale+OE: Sale of securities " "on an exchange or to another person (after option exercise)[/yellow]", "F - Tax": "[magenta]F - Tax: Payment of exercise price or " "tax liability using portion of securities received from the company[/magenta]", "P - Purchase": "[green]P - Purchase: Purchase of securities on " "an exchange or from another person[/green]", } def lambda_red_highlight(values) -> List[str]: """Red highlight Parameters ---------- values : List[str] dataframe values to color Returns ---------- List[str] colored dataframes values """ return [f"[red]{val}[/red]" for val in values] def lambda_yellow_highlight(values) -> List[str]: """Yellow highlight Parameters ---------- values : List[str] dataframe values to color Returns ---------- List[str] colored dataframes values """ return [f"[yellow]{val}[/yellow]" for val in values] def lambda_magenta_highlight(values): """Magenta highlight Parameters ---------- values : List[str] dataframe values to color Returns ---------- List[str] colored dataframes values """ return [f"[magenta]{val}[/magenta]" for val in values] def lambda_green_highlight(values): """Green highlight Parameters ---------- values : List[str] dataframe values to color Returns ---------- List[str] colored dataframes values """ return [f"[green]{val}[/green]" for val in values] @log_start_end(log=logger) def print_insider_data(type_insider: str, limit: int = 10, export: str = ""): """Print insider data Parameters ---------- type_insider: str Insider type of data limit: int Limit of data rows to display export: str Export data format """ response = requests.get(f"http://openinsider.com/{d_open_insider[type_insider]}") soup = BeautifulSoup(response.text, "html.parser") table = soup.find("table", {"class": "tinytable"}) if not table: console.print("No insider information found", "\n") return table_rows = table.find_all("tr") res = [] for tr in table_rows: td = tr.find_all("td") row = [tr.text.strip() for tr in td if tr.text.strip()] res.append(row) df = pd.DataFrame(res).dropna().head(n=limit) columns = [ "X", "Filing Date", "Trade Date", "Ticker", "Company Name", "Industry" if type_insider == "lcb" else "Insider Name", "Title", "Trade Type", "Price", "Qty", "Owned", "Diff Own", "Value", ] if df.shape[1] == 13: df.columns = columns else: df.columns = columns[1:] df["Filing Date"] = df["Filing Date"].apply( lambda x: "\n".join(textwrap.wrap(x, width=10)) if isinstance(x, str) else x ) df["Company Name"] = df["Company Name"].apply( lambda x: "\n".join(textwrap.wrap(x, width=20)) if isinstance(x, str) else x ) df["Title"] = df["Title"].apply( lambda x: "\n".join(textwrap.wrap(x, width=10)) if isinstance(x, str) else x ) if type_insider == "lcb": df["Industry"] = df["Industry"].apply( lambda x: "\n".join(textwrap.wrap(x, width=20)) if isinstance(x, str) else x ) else: df["Insider Name"] = df["Insider Name"].apply( lambda x: "\n".join(textwrap.wrap(x, width=20)) if isinstance(x, str) else x ) print_rich_table( df, headers=[x.title() for x in df.columns], show_index=False, title="Insider Data", ) export_data(export, os.path.dirname(os.path.abspath(__file__)), type_insider, df) if df.shape[1] == 13: l_chars = [list(chars) for chars in df["X"].values] l_uchars = np.unique(list(itertools.chain(*l_chars))) for char in l_uchars: console.print(d_notes[char]) console.print("") @log_start_end(log=logger) def print_insider_filter( preset_loaded: str, ticker: str, limit: int = 10, links: bool = False, export: str = "", ): """Print insider filter based on loaded preset. [Source: OpenInsider] Parameters ---------- preset_loaded : str Loaded preset filter ticker : str Stock ticker limit : int Limit of rows of data to display links : bool Flag to show hyperlinks export : str Format to export data """ if ticker: link = f"http://openinsider.com/screener?s={ticker}" else: link = get_open_insider_link(preset_loaded) if not link: console.print("") return df_insider = get_open_insider_data(link, has_company_name=bool(not ticker)) df_insider_orig = df_insider.copy() if df_insider.empty: console.print("No insider data found\n") return if links: df_insider = df_insider[["Ticker Link", "Insider Link", "Filing Link"]].head( limit ) else: df_insider = df_insider.drop( columns=["Filing Link", "Ticker Link", "Insider Link"] ).head(limit) if rich_config.USE_COLOR and not links: if not df_insider[df_insider["Trade Type"] == "S - Sale"].empty: df_insider[df_insider["Trade Type"] == "S - Sale"] = df_insider[ df_insider["Trade Type"] == "S - Sale" ].apply(lambda_red_highlight) if not df_insider[df_insider["Trade Type"] == "S - Sale+OE"].empty: df_insider[df_insider["Trade Type"] == "S - Sale+OE"] = df_insider[ df_insider["Trade Type"] == "S - Sale+OE" ].apply(lambda_yellow_highlight) if not df_insider[df_insider["Trade Type"] == "F - Tax"].empty: df_insider[df_insider["Trade Type"] == "F - Tax"] = df_insider[ df_insider["Trade Type"] == "F - Tax" ].apply(lambda_magenta_highlight) if not df_insider[df_insider["Trade Type"] == "P - Purchase"].empty: df_insider[df_insider["Trade Type"] == "P - Purchase"] = df_insider[ df_insider["Trade Type"] == "P - Purchase" ].apply(lambda_green_highlight) patch_pandas_text_adjustment() pd.set_option("display.max_colwidth", 0) pd.set_option("display.max_rows", None) # needs to be done because table is too large :( df_insider = df_insider.drop(columns=["Filing Date", "Trade Type"]) else: # needs to be done because table is too large :( df_insider = df_insider.drop(columns=["Filing Date"]) console.print("") print_rich_table( df_insider, headers=[x.title() for x in df_insider.columns], title="Insider filtered", ) if export: if preset_loaded: cmd = "filter" if ticker: cmd = "lis" export_data(export, os.path.dirname(os.path.abspath(__file__)), cmd, df_insider) if not links: l_chars = [list(chars) for chars in df_insider_orig["X"].values] l_uchars = np.unique(list(itertools.chain(*l_chars))) console.print("") for char in l_uchars: console.print(d_notes[char]) l_tradetype = df_insider_orig["Trade Type"].values l_utradetype = np.unique(l_tradetype) console.print("") for tradetype in l_utradetype: console.print(d_trade_types[tradetype]) console.print("")
29.178462
119
0.605505
import itertools import logging import os import textwrap from typing import List import numpy as np import pandas as pd import requests from bs4 import BeautifulSoup from gamestonk_terminal.decorators import log_start_end from gamestonk_terminal.helper_funcs import ( export_data, patch_pandas_text_adjustment, print_rich_table, ) from gamestonk_terminal.rich_config import console from gamestonk_terminal.stocks.insider.openinsider_model import ( get_open_insider_data, get_open_insider_link, ) from gamestonk_terminal import rich_config logger = logging.getLogger(__name__) d_open_insider = { "lcb": "latest-cluster-buys", "lpsb": "latest-penny-stock-buys", "lit": "latest-insider-trading", "lip": "insider-purchases", "blip": "latest-insider-purchases-25k", "blop": "latest-officer-purchases-25k", "blcp": "latest-ceo-cfo-purchases-25k", "lis": "insider-sales", "blis": "latest-insider-sales-100k", "blos": "latest-officer-sales-100k", "blcs": "latest-ceo-cfo-sales-100k", "topt": "top-officer-purchases-of-the-day", "toppw": "top-officer-purchases-of-the-week", "toppm": "top-officer-purchases-of-the-month", "tipt": "top-insider-purchases-of-the-day", "tippw": "top-insider-purchases-of-the-week", "tippm": "top-insider-purchases-of-the-month", "tist": "top-insider-sales-of-the-day", "tispw": "top-insider-sales-of-the-week", "tispm": "top-insider-sales-of-the-month", } d_notes = { "A": "A: Amended filing", "D": "D: Derivative transaction in filing (usually option exercise)", "E": "E: Error detected in filing", "M": "M: Multiple transactions in filing; earliest reported transaction date & weighted average transaction price", } d_trade_types = { "S - Sale": "[red]S - Sale: Sale of securities on an exchange or to another person[/red]", "S - Sale+OE": "[yellow]S - Sale+OE: Sale of securities " "on an exchange or to another person (after option exercise)[/yellow]", "F - Tax": "[magenta]F - Tax: Payment of exercise price or " "tax liability using portion of securities received from the company[/magenta]", "P - Purchase": "[green]P - Purchase: Purchase of securities on " "an exchange or from another person[/green]", } def lambda_red_highlight(values) -> List[str]: return [f"[red]{val}[/red]" for val in values] def lambda_yellow_highlight(values) -> List[str]: return [f"[yellow]{val}[/yellow]" for val in values] def lambda_magenta_highlight(values): return [f"[magenta]{val}[/magenta]" for val in values] def lambda_green_highlight(values): return [f"[green]{val}[/green]" for val in values] @log_start_end(log=logger) def print_insider_data(type_insider: str, limit: int = 10, export: str = ""): response = requests.get(f"http://openinsider.com/{d_open_insider[type_insider]}") soup = BeautifulSoup(response.text, "html.parser") table = soup.find("table", {"class": "tinytable"}) if not table: console.print("No insider information found", "\n") return table_rows = table.find_all("tr") res = [] for tr in table_rows: td = tr.find_all("td") row = [tr.text.strip() for tr in td if tr.text.strip()] res.append(row) df = pd.DataFrame(res).dropna().head(n=limit) columns = [ "X", "Filing Date", "Trade Date", "Ticker", "Company Name", "Industry" if type_insider == "lcb" else "Insider Name", "Title", "Trade Type", "Price", "Qty", "Owned", "Diff Own", "Value", ] if df.shape[1] == 13: df.columns = columns else: df.columns = columns[1:] df["Filing Date"] = df["Filing Date"].apply( lambda x: "\n".join(textwrap.wrap(x, width=10)) if isinstance(x, str) else x ) df["Company Name"] = df["Company Name"].apply( lambda x: "\n".join(textwrap.wrap(x, width=20)) if isinstance(x, str) else x ) df["Title"] = df["Title"].apply( lambda x: "\n".join(textwrap.wrap(x, width=10)) if isinstance(x, str) else x ) if type_insider == "lcb": df["Industry"] = df["Industry"].apply( lambda x: "\n".join(textwrap.wrap(x, width=20)) if isinstance(x, str) else x ) else: df["Insider Name"] = df["Insider Name"].apply( lambda x: "\n".join(textwrap.wrap(x, width=20)) if isinstance(x, str) else x ) print_rich_table( df, headers=[x.title() for x in df.columns], show_index=False, title="Insider Data", ) export_data(export, os.path.dirname(os.path.abspath(__file__)), type_insider, df) if df.shape[1] == 13: l_chars = [list(chars) for chars in df["X"].values] l_uchars = np.unique(list(itertools.chain(*l_chars))) for char in l_uchars: console.print(d_notes[char]) console.print("") @log_start_end(log=logger) def print_insider_filter( preset_loaded: str, ticker: str, limit: int = 10, links: bool = False, export: str = "", ): if ticker: link = f"http://openinsider.com/screener?s={ticker}" else: link = get_open_insider_link(preset_loaded) if not link: console.print("") return df_insider = get_open_insider_data(link, has_company_name=bool(not ticker)) df_insider_orig = df_insider.copy() if df_insider.empty: console.print("No insider data found\n") return if links: df_insider = df_insider[["Ticker Link", "Insider Link", "Filing Link"]].head( limit ) else: df_insider = df_insider.drop( columns=["Filing Link", "Ticker Link", "Insider Link"] ).head(limit) if rich_config.USE_COLOR and not links: if not df_insider[df_insider["Trade Type"] == "S - Sale"].empty: df_insider[df_insider["Trade Type"] == "S - Sale"] = df_insider[ df_insider["Trade Type"] == "S - Sale" ].apply(lambda_red_highlight) if not df_insider[df_insider["Trade Type"] == "S - Sale+OE"].empty: df_insider[df_insider["Trade Type"] == "S - Sale+OE"] = df_insider[ df_insider["Trade Type"] == "S - Sale+OE" ].apply(lambda_yellow_highlight) if not df_insider[df_insider["Trade Type"] == "F - Tax"].empty: df_insider[df_insider["Trade Type"] == "F - Tax"] = df_insider[ df_insider["Trade Type"] == "F - Tax" ].apply(lambda_magenta_highlight) if not df_insider[df_insider["Trade Type"] == "P - Purchase"].empty: df_insider[df_insider["Trade Type"] == "P - Purchase"] = df_insider[ df_insider["Trade Type"] == "P - Purchase" ].apply(lambda_green_highlight) patch_pandas_text_adjustment() pd.set_option("display.max_colwidth", 0) pd.set_option("display.max_rows", None) df_insider = df_insider.drop(columns=["Filing Date", "Trade Type"]) else: df_insider = df_insider.drop(columns=["Filing Date"]) console.print("") print_rich_table( df_insider, headers=[x.title() for x in df_insider.columns], title="Insider filtered", ) if export: if preset_loaded: cmd = "filter" if ticker: cmd = "lis" export_data(export, os.path.dirname(os.path.abspath(__file__)), cmd, df_insider) if not links: l_chars = [list(chars) for chars in df_insider_orig["X"].values] l_uchars = np.unique(list(itertools.chain(*l_chars))) console.print("") for char in l_uchars: console.print(d_notes[char]) l_tradetype = df_insider_orig["Trade Type"].values l_utradetype = np.unique(l_tradetype) console.print("") for tradetype in l_utradetype: console.print(d_trade_types[tradetype]) console.print("")
true
true
f7265be4393da76c22754da75898052c8a4b8c71
831
py
Python
src/cpp/qpsolver/cvxopt/examples/doc/chap8/conelp.py
Hap-Hugh/quicksel
10eee90b759638d5c54ba19994ae8e36e90e12b8
[ "Apache-2.0" ]
15
2020-07-07T16:32:53.000Z
2022-03-16T14:23:23.000Z
src/cpp/qpsolver/cvxopt/examples/doc/chap8/conelp.py
Hap-Hugh/quicksel
10eee90b759638d5c54ba19994ae8e36e90e12b8
[ "Apache-2.0" ]
2
2020-09-02T15:25:39.000Z
2020-09-24T08:37:18.000Z
src/cpp/qpsolver/cvxopt/examples/doc/chap8/conelp.py
Hap-Hugh/quicksel
10eee90b759638d5c54ba19994ae8e36e90e12b8
[ "Apache-2.0" ]
6
2020-08-14T22:02:07.000Z
2021-03-31T07:08:29.000Z
# The small linear cone program of section 8.1 (Linear cone programs). from cvxopt import matrix, solvers c = matrix([-6., -4., -5.]) G = matrix([[ 16., 7., 24., -8., 8., -1., 0., -1., 0., 0., 7., -5., 1., -5., 1., -7., 1., -7., -4.], [-14., 2., 7., -13., -18., 3., 0., 0., -1., 0., 3., 13., -6., 13., 12., -10., -6., -10., -28.], [ 5., 0., -15., 12., -6., 17., 0., 0., 0., -1., 9., 6., -6., 6., -7., -7., -6., -7., -11.]]) h = matrix( [ -3., 5., 12., -2., -14., -13., 10., 0., 0., 0., 68., -30., -19., -30., 99., 23., -19., 23., 10.] ) dims = {'l': 2, 'q': [4, 4], 's': [3]} sol = solvers.conelp(c, G, h, dims) print("\nStatus: " + sol['status']) print("\nx = \n") print(sol['x']) print("\nz = \n") print(sol['z'])
39.571429
75
0.361011
from cvxopt import matrix, solvers c = matrix([-6., -4., -5.]) G = matrix([[ 16., 7., 24., -8., 8., -1., 0., -1., 0., 0., 7., -5., 1., -5., 1., -7., 1., -7., -4.], [-14., 2., 7., -13., -18., 3., 0., 0., -1., 0., 3., 13., -6., 13., 12., -10., -6., -10., -28.], [ 5., 0., -15., 12., -6., 17., 0., 0., 0., -1., 9., 6., -6., 6., -7., -7., -6., -7., -11.]]) h = matrix( [ -3., 5., 12., -2., -14., -13., 10., 0., 0., 0., 68., -30., -19., -30., 99., 23., -19., 23., 10.] ) dims = {'l': 2, 'q': [4, 4], 's': [3]} sol = solvers.conelp(c, G, h, dims) print("\nStatus: " + sol['status']) print("\nx = \n") print(sol['x']) print("\nz = \n") print(sol['z'])
true
true
f7265c3d05c95935872b8f725e78bb38be5404e8
9,800
py
Python
stacker/tests/test_plan.py
DomainGroupOSS/stacker
88b71bc5cfcbbf7957245d821434b95801230425
[ "BSD-2-Clause" ]
1
2018-07-17T11:23:47.000Z
2018-07-17T11:23:47.000Z
stacker/tests/test_plan.py
DomainGroupOSS/stacker
88b71bc5cfcbbf7957245d821434b95801230425
[ "BSD-2-Clause" ]
null
null
null
stacker/tests/test_plan.py
DomainGroupOSS/stacker
88b71bc5cfcbbf7957245d821434b95801230425
[ "BSD-2-Clause" ]
1
2020-02-29T04:49:04.000Z
2020-02-29T04:49:04.000Z
from __future__ import print_function from __future__ import division from __future__ import absolute_import from builtins import range import os import shutil import tempfile import unittest import mock from stacker.context import Context, Config from stacker.dag import walk from stacker.util import stack_template_key_name from stacker.lookups.registry import ( register_lookup_handler, unregister_lookup_handler, ) from stacker.plan import ( Step, build_plan, ) from stacker.exceptions import ( CancelExecution, GraphError, PlanFailed, ) from stacker.status import ( SUBMITTED, COMPLETE, SKIPPED, FAILED, ) from stacker.stack import Stack from .factories import generate_definition count = 0 class TestStep(unittest.TestCase): def setUp(self): stack = mock.MagicMock() stack.name = "stack" stack.fqn = "namespace-stack" self.step = Step(stack=stack, fn=None) def test_status(self): self.assertFalse(self.step.submitted) self.assertFalse(self.step.completed) self.step.submit() self.assertEqual(self.step.status, SUBMITTED) self.assertTrue(self.step.submitted) self.assertFalse(self.step.completed) self.step.complete() self.assertEqual(self.step.status, COMPLETE) self.assertNotEqual(self.step.status, SUBMITTED) self.assertTrue(self.step.submitted) self.assertTrue(self.step.completed) self.assertNotEqual(self.step.status, True) self.assertNotEqual(self.step.status, False) self.assertNotEqual(self.step.status, 'banana') class TestPlan(unittest.TestCase): def setUp(self): self.count = 0 self.config = Config({"namespace": "namespace"}) self.context = Context(config=self.config) register_lookup_handler("noop", lambda **kwargs: "test") def tearDown(self): unregister_lookup_handler("noop") def test_plan(self): vpc = Stack( definition=generate_definition('vpc', 1), context=self.context) bastion = Stack( definition=generate_definition('bastion', 1, requires=[vpc.name]), context=self.context) plan = build_plan(description="Test", steps=[ Step(vpc, fn=None), Step(bastion, fn=None)]) self.assertEqual(plan.graph.to_dict(), { 'bastion.1': set(['vpc.1']), 'vpc.1': set([])}) def test_execute_plan(self): vpc = Stack( definition=generate_definition('vpc', 1), context=self.context) bastion = Stack( definition=generate_definition('bastion', 1, requires=[vpc.name]), context=self.context) calls = [] def fn(stack, status=None): calls.append(stack.fqn) return COMPLETE plan = build_plan( description="Test", steps=[Step(vpc, fn), Step(bastion, fn)]) plan.execute(walk) self.assertEquals(calls, ['namespace-vpc.1', 'namespace-bastion.1']) def test_execute_plan_filtered(self): vpc = Stack( definition=generate_definition('vpc', 1), context=self.context) db = Stack( definition=generate_definition('db', 1, requires=[vpc.name]), context=self.context) app = Stack( definition=generate_definition('app', 1, requires=[db.name]), context=self.context) calls = [] def fn(stack, status=None): calls.append(stack.fqn) return COMPLETE plan = build_plan( description="Test", steps=[Step(vpc, fn), Step(db, fn), Step(app, fn)], targets=['db.1']) plan.execute(walk) self.assertEquals(calls, [ 'namespace-vpc.1', 'namespace-db.1']) def test_execute_plan_exception(self): vpc = Stack( definition=generate_definition('vpc', 1), context=self.context) bastion = Stack( definition=generate_definition('bastion', 1, requires=[vpc.name]), context=self.context) calls = [] def fn(stack, status=None): calls.append(stack.fqn) if stack.name == vpc_step.name: raise ValueError('Boom') return COMPLETE vpc_step = Step(vpc, fn) bastion_step = Step(bastion, fn) plan = build_plan(description="Test", steps=[vpc_step, bastion_step]) with self.assertRaises(PlanFailed): plan.execute(walk) self.assertEquals(calls, ['namespace-vpc.1']) self.assertEquals(vpc_step.status, FAILED) def test_execute_plan_skipped(self): vpc = Stack( definition=generate_definition('vpc', 1), context=self.context) bastion = Stack( definition=generate_definition('bastion', 1, requires=[vpc.name]), context=self.context) calls = [] def fn(stack, status=None): calls.append(stack.fqn) if stack.fqn == vpc_step.name: return SKIPPED return COMPLETE vpc_step = Step(vpc, fn) bastion_step = Step(bastion, fn) plan = build_plan(description="Test", steps=[vpc_step, bastion_step]) plan.execute(walk) self.assertEquals(calls, ['namespace-vpc.1', 'namespace-bastion.1']) def test_execute_plan_failed(self): vpc = Stack( definition=generate_definition('vpc', 1), context=self.context) bastion = Stack( definition=generate_definition('bastion', 1, requires=[vpc.name]), context=self.context) db = Stack( definition=generate_definition('db', 1), context=self.context) calls = [] def fn(stack, status=None): calls.append(stack.fqn) if stack.name == vpc_step.name: return FAILED return COMPLETE vpc_step = Step(vpc, fn) bastion_step = Step(bastion, fn) db_step = Step(db, fn) plan = build_plan(description="Test", steps=[ vpc_step, bastion_step, db_step]) with self.assertRaises(PlanFailed): plan.execute(walk) calls.sort() self.assertEquals(calls, ['namespace-db.1', 'namespace-vpc.1']) def test_execute_plan_cancelled(self): vpc = Stack( definition=generate_definition('vpc', 1), context=self.context) bastion = Stack( definition=generate_definition('bastion', 1, requires=[vpc.name]), context=self.context) calls = [] def fn(stack, status=None): calls.append(stack.fqn) if stack.fqn == vpc_step.name: raise CancelExecution return COMPLETE vpc_step = Step(vpc, fn) bastion_step = Step(bastion, fn) plan = build_plan(description="Test", steps=[ vpc_step, bastion_step]) plan.execute(walk) self.assertEquals(calls, ['namespace-vpc.1', 'namespace-bastion.1']) def test_build_plan_missing_dependency(self): bastion = Stack( definition=generate_definition( 'bastion', 1, requires=['vpc.1']), context=self.context) with self.assertRaises(GraphError) as expected: build_plan(description="Test", steps=[Step(bastion, None)]) message_starts = ( "Error detected when adding 'vpc.1' " "as a dependency of 'bastion.1':" ) message_contains = "dependent node vpc.1 does not exist" self.assertTrue(str(expected.exception).startswith(message_starts)) self.assertTrue(message_contains in str(expected.exception)) def test_build_plan_cyclic_dependencies(self): vpc = Stack( definition=generate_definition( 'vpc', 1), context=self.context) db = Stack( definition=generate_definition( 'db', 1, requires=['app.1']), context=self.context) app = Stack( definition=generate_definition( 'app', 1, requires=['db.1']), context=self.context) with self.assertRaises(GraphError) as expected: build_plan( description="Test", steps=[Step(vpc, None), Step(db, None), Step(app, None)]) message = ("Error detected when adding 'db.1' " "as a dependency of 'app.1': graph is " "not acyclic") self.assertEqual(str(expected.exception), message) def test_dump(self, *args): requires = None steps = [] for i in range(5): overrides = { "variables": { "PublicSubnets": "1", "SshKeyName": "1", "PrivateSubnets": "1", "Random": "${noop something}", }, "requires": requires, } stack = Stack( definition=generate_definition('vpc', i, **overrides), context=self.context) requires = [stack.name] steps += [Step(stack, None)] plan = build_plan(description="Test", steps=steps) tmp_dir = tempfile.mkdtemp() try: plan.dump(tmp_dir, context=self.context) for step in plan.steps: template_path = os.path.join( tmp_dir, stack_template_key_name(step.stack.blueprint)) self.assertTrue(os.path.isfile(template_path)) finally: shutil.rmtree(tmp_dir)
30.434783
78
0.580408
from __future__ import print_function from __future__ import division from __future__ import absolute_import from builtins import range import os import shutil import tempfile import unittest import mock from stacker.context import Context, Config from stacker.dag import walk from stacker.util import stack_template_key_name from stacker.lookups.registry import ( register_lookup_handler, unregister_lookup_handler, ) from stacker.plan import ( Step, build_plan, ) from stacker.exceptions import ( CancelExecution, GraphError, PlanFailed, ) from stacker.status import ( SUBMITTED, COMPLETE, SKIPPED, FAILED, ) from stacker.stack import Stack from .factories import generate_definition count = 0 class TestStep(unittest.TestCase): def setUp(self): stack = mock.MagicMock() stack.name = "stack" stack.fqn = "namespace-stack" self.step = Step(stack=stack, fn=None) def test_status(self): self.assertFalse(self.step.submitted) self.assertFalse(self.step.completed) self.step.submit() self.assertEqual(self.step.status, SUBMITTED) self.assertTrue(self.step.submitted) self.assertFalse(self.step.completed) self.step.complete() self.assertEqual(self.step.status, COMPLETE) self.assertNotEqual(self.step.status, SUBMITTED) self.assertTrue(self.step.submitted) self.assertTrue(self.step.completed) self.assertNotEqual(self.step.status, True) self.assertNotEqual(self.step.status, False) self.assertNotEqual(self.step.status, 'banana') class TestPlan(unittest.TestCase): def setUp(self): self.count = 0 self.config = Config({"namespace": "namespace"}) self.context = Context(config=self.config) register_lookup_handler("noop", lambda **kwargs: "test") def tearDown(self): unregister_lookup_handler("noop") def test_plan(self): vpc = Stack( definition=generate_definition('vpc', 1), context=self.context) bastion = Stack( definition=generate_definition('bastion', 1, requires=[vpc.name]), context=self.context) plan = build_plan(description="Test", steps=[ Step(vpc, fn=None), Step(bastion, fn=None)]) self.assertEqual(plan.graph.to_dict(), { 'bastion.1': set(['vpc.1']), 'vpc.1': set([])}) def test_execute_plan(self): vpc = Stack( definition=generate_definition('vpc', 1), context=self.context) bastion = Stack( definition=generate_definition('bastion', 1, requires=[vpc.name]), context=self.context) calls = [] def fn(stack, status=None): calls.append(stack.fqn) return COMPLETE plan = build_plan( description="Test", steps=[Step(vpc, fn), Step(bastion, fn)]) plan.execute(walk) self.assertEquals(calls, ['namespace-vpc.1', 'namespace-bastion.1']) def test_execute_plan_filtered(self): vpc = Stack( definition=generate_definition('vpc', 1), context=self.context) db = Stack( definition=generate_definition('db', 1, requires=[vpc.name]), context=self.context) app = Stack( definition=generate_definition('app', 1, requires=[db.name]), context=self.context) calls = [] def fn(stack, status=None): calls.append(stack.fqn) return COMPLETE plan = build_plan( description="Test", steps=[Step(vpc, fn), Step(db, fn), Step(app, fn)], targets=['db.1']) plan.execute(walk) self.assertEquals(calls, [ 'namespace-vpc.1', 'namespace-db.1']) def test_execute_plan_exception(self): vpc = Stack( definition=generate_definition('vpc', 1), context=self.context) bastion = Stack( definition=generate_definition('bastion', 1, requires=[vpc.name]), context=self.context) calls = [] def fn(stack, status=None): calls.append(stack.fqn) if stack.name == vpc_step.name: raise ValueError('Boom') return COMPLETE vpc_step = Step(vpc, fn) bastion_step = Step(bastion, fn) plan = build_plan(description="Test", steps=[vpc_step, bastion_step]) with self.assertRaises(PlanFailed): plan.execute(walk) self.assertEquals(calls, ['namespace-vpc.1']) self.assertEquals(vpc_step.status, FAILED) def test_execute_plan_skipped(self): vpc = Stack( definition=generate_definition('vpc', 1), context=self.context) bastion = Stack( definition=generate_definition('bastion', 1, requires=[vpc.name]), context=self.context) calls = [] def fn(stack, status=None): calls.append(stack.fqn) if stack.fqn == vpc_step.name: return SKIPPED return COMPLETE vpc_step = Step(vpc, fn) bastion_step = Step(bastion, fn) plan = build_plan(description="Test", steps=[vpc_step, bastion_step]) plan.execute(walk) self.assertEquals(calls, ['namespace-vpc.1', 'namespace-bastion.1']) def test_execute_plan_failed(self): vpc = Stack( definition=generate_definition('vpc', 1), context=self.context) bastion = Stack( definition=generate_definition('bastion', 1, requires=[vpc.name]), context=self.context) db = Stack( definition=generate_definition('db', 1), context=self.context) calls = [] def fn(stack, status=None): calls.append(stack.fqn) if stack.name == vpc_step.name: return FAILED return COMPLETE vpc_step = Step(vpc, fn) bastion_step = Step(bastion, fn) db_step = Step(db, fn) plan = build_plan(description="Test", steps=[ vpc_step, bastion_step, db_step]) with self.assertRaises(PlanFailed): plan.execute(walk) calls.sort() self.assertEquals(calls, ['namespace-db.1', 'namespace-vpc.1']) def test_execute_plan_cancelled(self): vpc = Stack( definition=generate_definition('vpc', 1), context=self.context) bastion = Stack( definition=generate_definition('bastion', 1, requires=[vpc.name]), context=self.context) calls = [] def fn(stack, status=None): calls.append(stack.fqn) if stack.fqn == vpc_step.name: raise CancelExecution return COMPLETE vpc_step = Step(vpc, fn) bastion_step = Step(bastion, fn) plan = build_plan(description="Test", steps=[ vpc_step, bastion_step]) plan.execute(walk) self.assertEquals(calls, ['namespace-vpc.1', 'namespace-bastion.1']) def test_build_plan_missing_dependency(self): bastion = Stack( definition=generate_definition( 'bastion', 1, requires=['vpc.1']), context=self.context) with self.assertRaises(GraphError) as expected: build_plan(description="Test", steps=[Step(bastion, None)]) message_starts = ( "Error detected when adding 'vpc.1' " "as a dependency of 'bastion.1':" ) message_contains = "dependent node vpc.1 does not exist" self.assertTrue(str(expected.exception).startswith(message_starts)) self.assertTrue(message_contains in str(expected.exception)) def test_build_plan_cyclic_dependencies(self): vpc = Stack( definition=generate_definition( 'vpc', 1), context=self.context) db = Stack( definition=generate_definition( 'db', 1, requires=['app.1']), context=self.context) app = Stack( definition=generate_definition( 'app', 1, requires=['db.1']), context=self.context) with self.assertRaises(GraphError) as expected: build_plan( description="Test", steps=[Step(vpc, None), Step(db, None), Step(app, None)]) message = ("Error detected when adding 'db.1' " "as a dependency of 'app.1': graph is " "not acyclic") self.assertEqual(str(expected.exception), message) def test_dump(self, *args): requires = None steps = [] for i in range(5): overrides = { "variables": { "PublicSubnets": "1", "SshKeyName": "1", "PrivateSubnets": "1", "Random": "${noop something}", }, "requires": requires, } stack = Stack( definition=generate_definition('vpc', i, **overrides), context=self.context) requires = [stack.name] steps += [Step(stack, None)] plan = build_plan(description="Test", steps=steps) tmp_dir = tempfile.mkdtemp() try: plan.dump(tmp_dir, context=self.context) for step in plan.steps: template_path = os.path.join( tmp_dir, stack_template_key_name(step.stack.blueprint)) self.assertTrue(os.path.isfile(template_path)) finally: shutil.rmtree(tmp_dir)
true
true
f7265c6925ef94f77153adae115c2e78a7324353
3,058
py
Python
over_roasted/settings.py
xmedinavei/over_roasted_app
c5b9525c6435d5d2285d86961eb8674108f2c88c
[ "MIT" ]
null
null
null
over_roasted/settings.py
xmedinavei/over_roasted_app
c5b9525c6435d5d2285d86961eb8674108f2c88c
[ "MIT" ]
null
null
null
over_roasted/settings.py
xmedinavei/over_roasted_app
c5b9525c6435d5d2285d86961eb8674108f2c88c
[ "MIT" ]
null
null
null
from pathlib import Path import django_heroku # Build paths inside the project like this: BASE_DIR / 'subdir'. BASE_DIR = Path(__file__).resolve().parent.parent # Quick-start development settings - unsuitable for production # See https://docs.djangoproject.com/en/3.1/howto/deployment/checklist/ # SECURITY WARNING: keep the secret key used in production secret! SECRET_KEY = '3+7ekm6aghztb!h1b@xcvvjid8$o%rb7bb3bha446)d1pk573*' # SECURITY WARNING: don't run with debug turned on in production! DEBUG = True ALLOWED_HOSTS = ['*'] # Application definition INSTALLED_APPS = [ # Django 'django.contrib.admin', 'django.contrib.auth', 'django.contrib.contenttypes', 'django.contrib.sessions', 'django.contrib.messages', 'django.contrib.staticfiles', # Local apps 'users', 'recipes', # Third-party apps 'django_extensions', ] MIDDLEWARE = [ 'django.middleware.security.SecurityMiddleware', 'django.contrib.sessions.middleware.SessionMiddleware', 'django.middleware.common.CommonMiddleware', 'django.middleware.csrf.CsrfViewMiddleware', 'django.contrib.auth.middleware.AuthenticationMiddleware', 'django.contrib.messages.middleware.MessageMiddleware', 'django.middleware.clickjacking.XFrameOptionsMiddleware', ] ROOT_URLCONF = 'over_roasted.urls' TEMPLATES = [ { 'BACKEND': 'django.template.backends.django.DjangoTemplates', 'DIRS': [BASE_DIR.joinpath('templates')], 'APP_DIRS': True, 'OPTIONS': { 'context_processors': [ 'django.template.context_processors.debug', 'django.template.context_processors.request', 'django.contrib.auth.context_processors.auth', 'django.contrib.messages.context_processors.messages', ], }, }, ] WSGI_APPLICATION = 'over_roasted.wsgi.application' # Database # https://docs.djangoproject.com/en/3.1/ref/settings/#databases DATABASES = { 'default': { 'ENGINE': 'django.db.backends.sqlite3', 'NAME': BASE_DIR / 'db.sqlite3', } } # Password validation # https://docs.djangoproject.com/en/3.1/ref/settings/#auth-password-validators AUTH_PASSWORD_VALIDATORS = [ { 'NAME': 'django.contrib.auth.password_validation.UserAttributeSimilarityValidator', }, { 'NAME': 'django.contrib.auth.password_validation.MinimumLengthValidator', }, { 'NAME': 'django.contrib.auth.password_validation.CommonPasswordValidator', }, { 'NAME': 'django.contrib.auth.password_validation.NumericPasswordValidator', }, ] # Internationalization # https://docs.djangoproject.com/en/3.1/topics/i18n/ LANGUAGE_CODE = 'en-us' TIME_ZONE = 'UTC' USE_I18N = True USE_L10N = True USE_TZ = True # Static files (CSS, JavaScript, Images) # https://docs.djangoproject.com/en/3.1/howto/static-files/ STATIC_URL = '/static/' LOGIN_URL = '/users/login/' LOGIN_REDIRECT_URL = '/recipes/' LOGOUT_REDIRECT_URL = LOGIN_URL django_heroku.settings(locals())
24.66129
91
0.692283
from pathlib import Path import django_heroku BASE_DIR = Path(__file__).resolve().parent.parent SECRET_KEY = '3+7ekm6aghztb!h1b@xcvvjid8$o%rb7bb3bha446)d1pk573*' DEBUG = True ALLOWED_HOSTS = ['*'] # Application definition INSTALLED_APPS = [ # Django 'django.contrib.admin', 'django.contrib.auth', 'django.contrib.contenttypes', 'django.contrib.sessions', 'django.contrib.messages', 'django.contrib.staticfiles', # Local apps 'users', 'recipes', # Third-party apps 'django_extensions', ] MIDDLEWARE = [ 'django.middleware.security.SecurityMiddleware', 'django.contrib.sessions.middleware.SessionMiddleware', 'django.middleware.common.CommonMiddleware', 'django.middleware.csrf.CsrfViewMiddleware', 'django.contrib.auth.middleware.AuthenticationMiddleware', 'django.contrib.messages.middleware.MessageMiddleware', 'django.middleware.clickjacking.XFrameOptionsMiddleware', ] ROOT_URLCONF = 'over_roasted.urls' TEMPLATES = [ { 'BACKEND': 'django.template.backends.django.DjangoTemplates', 'DIRS': [BASE_DIR.joinpath('templates')], 'APP_DIRS': True, 'OPTIONS': { 'context_processors': [ 'django.template.context_processors.debug', 'django.template.context_processors.request', 'django.contrib.auth.context_processors.auth', 'django.contrib.messages.context_processors.messages', ], }, }, ] WSGI_APPLICATION = 'over_roasted.wsgi.application' # Database # https://docs.djangoproject.com/en/3.1/ref/settings/#databases DATABASES = { 'default': { 'ENGINE': 'django.db.backends.sqlite3', 'NAME': BASE_DIR / 'db.sqlite3', } } # Password validation # https://docs.djangoproject.com/en/3.1/ref/settings/#auth-password-validators AUTH_PASSWORD_VALIDATORS = [ { 'NAME': 'django.contrib.auth.password_validation.UserAttributeSimilarityValidator', }, { 'NAME': 'django.contrib.auth.password_validation.MinimumLengthValidator', }, { 'NAME': 'django.contrib.auth.password_validation.CommonPasswordValidator', }, { 'NAME': 'django.contrib.auth.password_validation.NumericPasswordValidator', }, ] # Internationalization # https://docs.djangoproject.com/en/3.1/topics/i18n/ LANGUAGE_CODE = 'en-us' TIME_ZONE = 'UTC' USE_I18N = True USE_L10N = True USE_TZ = True # Static files (CSS, JavaScript, Images) # https://docs.djangoproject.com/en/3.1/howto/static-files/ STATIC_URL = '/static/' LOGIN_URL = '/users/login/' LOGIN_REDIRECT_URL = '/recipes/' LOGOUT_REDIRECT_URL = LOGIN_URL django_heroku.settings(locals())
true
true
f7265d7477ff3fba1b5e7f80d15d88b7c11ed07e
1,092
py
Python
examples/finalterm-shell-integration.py
davidbrochart/python-prompt-toolkit
8498692b31671fee7c5a426300a9df2ee290eae2
[ "BSD-3-Clause" ]
2
2020-04-12T01:23:25.000Z
2021-05-22T13:46:00.000Z
examples/finalterm-shell-integration.py
davidbrochart/python-prompt-toolkit
8498692b31671fee7c5a426300a9df2ee290eae2
[ "BSD-3-Clause" ]
null
null
null
examples/finalterm-shell-integration.py
davidbrochart/python-prompt-toolkit
8498692b31671fee7c5a426300a9df2ee290eae2
[ "BSD-3-Clause" ]
2
2016-12-30T23:57:44.000Z
2021-05-22T13:50:21.000Z
#!/usr/bin/env python """ Mark the start and end of the prompt with Final term (iterm2) escape sequences. See: https://iterm2.com/finalterm.html """ from __future__ import unicode_literals from prompt_toolkit import prompt from prompt_toolkit.token import Token import sys BEFORE_PROMPT = '\033]133;A\a' AFTER_PROMPT = '\033]133;B\a' BEFORE_OUTPUT = '\033]133;C\a' AFTER_OUTPUT = '\033]133;D;{command_status}\a' # command_status is the command status, 0-255 def get_prompt_tokens(cli): # Generate the tokens for the prompt. # Important: use the `ZeroWidthEscape` token only if you are sure that # writing this as raw text to the output will not introduce any # cursor movements. return [ (Token.ZeroWidthEscape, BEFORE_PROMPT), (Token, 'Say something: # '), (Token.ZeroWidthEscape, AFTER_PROMPT), ] if __name__ == '__main__': answer = prompt(get_prompt_tokens=get_prompt_tokens) sys.stdout.write(BEFORE_OUTPUT) print('You said: %s' % answer) sys.stdout.write(AFTER_OUTPUT.format(command_status=0))
29.513514
92
0.701465
from __future__ import unicode_literals from prompt_toolkit import prompt from prompt_toolkit.token import Token import sys BEFORE_PROMPT = '\033]133;A\a' AFTER_PROMPT = '\033]133;B\a' BEFORE_OUTPUT = '\033]133;C\a' AFTER_OUTPUT = '\033]133;D;{command_status}\a' def get_prompt_tokens(cli): return [ (Token.ZeroWidthEscape, BEFORE_PROMPT), (Token, 'Say something: # '), (Token.ZeroWidthEscape, AFTER_PROMPT), ] if __name__ == '__main__': answer = prompt(get_prompt_tokens=get_prompt_tokens) sys.stdout.write(BEFORE_OUTPUT) print('You said: %s' % answer) sys.stdout.write(AFTER_OUTPUT.format(command_status=0))
true
true
f7265e08d1ad65a2a3c1ac2d5369c00df1bea063
2,164
py
Python
tests/unit/utils/pyxb_utils.py
MaxTakahashi/hammr
cfe593ccfdddb7f98185e561feed6a40a866b585
[ "Apache-2.0" ]
null
null
null
tests/unit/utils/pyxb_utils.py
MaxTakahashi/hammr
cfe593ccfdddb7f98185e561feed6a40a866b585
[ "Apache-2.0" ]
null
null
null
tests/unit/utils/pyxb_utils.py
MaxTakahashi/hammr
cfe593ccfdddb7f98185e561feed6a40a866b585
[ "Apache-2.0" ]
null
null
null
# Copyright 2007-2017 UShareSoft SAS, All rights reserved # # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. # When anonymous type are used inside uforge.xsd, anonymous type such as "CTD_ANON_238" will be created inside uforge.py. # We can't use directly these types in unit test for mocking otherwise unit tests may failed each time the uforge.xsd # is slightly modified. # So to avoid that, the type to used is retrieved dynamically using the PyXB internal attributes. # This method returns the type of the element in a list attributes # Example of use: # regionType = get_pyXB_anon_type_for_list(regions.regionEntities) # region = regionType() # regions.regionEntities.append(region) def get_pyXB_anon_type_for_list_attrb(list_attrb): return list_attrb._PluralBinding__elementBinding._element__typeDefinition # When anonymous type are used inside uforge.xsd, anonymous type such as "CTD_ANON_238" will be created inside uforge.py. # We can't use directly these types in unit test for mocking otherwise unit tests may failed each time the uforge.xsd # is slightly modified. # So to avoid that, the type to used is retrieved dynamically using the PyXB internal attributes. # This method returns the type of the attribute "attrb_name" in the "attrb_holder" object # Example of use: # flavorType = get_pyXB_anon_type_for_list(flavors.flavor) # flavor = flavorType() # flavors.flavor.append(flavor) def get_pyXB_anon_type_for_simple_attrb(attrb_holder, attrb_name): return getattr(attrb_holder, "_" + type( attrb_holder).__name__ + "__" + attrb_name)._ElementDeclaration__elementBinding._element__typeDefinition
55.487179
121
0.77634
# is slightly modified. # So to avoid that, the type to used is retrieved dynamically using the PyXB internal attributes. # This method returns the type of the element in a list attributes # Example of use: # regionType = get_pyXB_anon_type_for_list(regions.regionEntities) # region = regionType() # regions.regionEntities.append(region) def get_pyXB_anon_type_for_list_attrb(list_attrb): return list_attrb._PluralBinding__elementBinding._element__typeDefinition # When anonymous type are used inside uforge.xsd, anonymous type such as "CTD_ANON_238" will be created inside uforge.py. # We can't use directly these types in unit test for mocking otherwise unit tests may failed each time the uforge.xsd def get_pyXB_anon_type_for_simple_attrb(attrb_holder, attrb_name): return getattr(attrb_holder, "_" + type( attrb_holder).__name__ + "__" + attrb_name)._ElementDeclaration__elementBinding._element__typeDefinition
true
true
f7265e3a53380992aefc3e1f0e5022e3b36f9db4
4,782
py
Python
ADSref.py
SimonJMurphy/ADSref
c144d077d622987c42d5cf8d9d111afa04073af2
[ "MIT" ]
2
2021-01-14T10:13:32.000Z
2021-01-31T23:51:09.000Z
ADSref.py
SimonJMurphy/ADSref
c144d077d622987c42d5cf8d9d111afa04073af2
[ "MIT" ]
null
null
null
ADSref.py
SimonJMurphy/ADSref
c144d077d622987c42d5cf8d9d111afa04073af2
[ "MIT" ]
null
null
null
import ads ads.config.token = 'my token' import numpy as np # Filenames ## Enter the filename for first-author publications here: first_author = "first_author.bib" ## Enter the filename for cd-authored publications here: co_author = "co_author.bib" # Function Declarations def extract_bibcodes(filename): """Takes a .bib filename, looks for bibcodes on the first line of each entry, and parses into a list.""" f = open(filename) full_list = f.readlines() bibcodes = [] # drop yCat, arxiv, PhDT, and other non-refereed entries # Workaround, since I couldn't get the API to accept property:refereed or property=refereed to work when searching exclude = ['arXiv','tmp','yCat','PhDT','AAS','ASPC','BSRSL','conf','EPJWC','IAUFM','IAUGA','IAUS','hst','iue','jwst','spzr','prop'] for line in full_list: if line[0] == "@": if not any(x in line for x in exclude): bibcodes.append(line.split("{")[1].replace(",\n","")) return bibcodes def author_format(authors): if len(authors) == 1: a = authors[0] elif len(authors) == 2: a = authors[0] + " \& " + authors[1] else: a = authors[0] + ' et al.' return a def journal_name(bibcode): return bibcode.split(".")[0][4:].replace("&","\&") def adsurl(bibcode): return 'https://ui.adsabs.harvard.edu/abs/' + bibcode def latex_title_greek(title): greek_dict = {"α":r"$\alpha$", "β":r"$\beta$", "γ":r"$\gamma$", "δ":r"$\delta$", "ε":r"$\epsilon$", "ζ":r"$\zeta$", "η":r"$\eta$", "ι":r"$\iota$", "θ":r"$\theta$", "κ":r"$\kappa$", "λ":r"$\lambda$", "μ":r"$\mu$", "ν":r"$\nu$", "ξ":r"$\xi$", "π":r"$\pi$", "ρ":r"$\rho$", "σ":r"$\sigma$", "τ":r"$\tau$", "φ":r"$\phi$", "χ":r"$\chi$", "ψ":r"$\psi$", "ω":r"$\omega$"} for key in greek_dict.keys(): title = title.replace(key, greek_dict[key]) return title def citation_formatter(cites): if cites is None: return "" elif cites == 0: return "" else: if cites < 10: return f"Cited: \\phantom" + "{1}" + f"{cites}" else: return f"Cited: {cites}" def latex_strings(paper_list): output = [] n = len(paper_list) for i,p in enumerate(paper_list): title = p.title[0] entry = "\\textbf{" + f"{n-i}" + "}. " + '\\' + 'href{' + adsurl(p.bibcode) + "}{" + f"{latex_title_greek(title)}" + "}" + "\\\\" entry += author_format(p.author) entry += f" ({p.year}) " entry += journal_name(p.bibcode) entry += f" {p.volume}," entry += f" {p.page[0]}." entry += ' \\hspace*{\\fill}' + citation_formatter(p.citation_count) + "\\vspace{1mm}" + "\\\\" output.append(entry) output[0] = "\\noindent " + output[0] return output def export_latex(filename,latex_string_list): f = open(filename,"w") for line in latex_string_list: f.write(line+"\n") f.close() return "Saved." # Parse bibcodes print("Parsing bibcodes...") bibcodes = extract_bibcodes(first_author) co_bibcodes = extract_bibcodes(co_author) # Search for papers and their attributes from bibcodes print("Querying the ADS API for paper metadata... This may take a while if there are many entries...") papers = [list(ads.SearchQuery(bibcode=bibcode, fl=['bibcode', 'title', 'author', 'year', 'volume', 'page', 'citation_count']))[0] for bibcode in bibcodes] co_papers = [list(ads.SearchQuery(bibcode=bibcode, fl=['bibcode', 'title', 'author', 'year', 'volume', 'page', 'citation_count']))[0] for bibcode in co_bibcodes] # Remove Errata ## Because Ew. And if anyone cares about the paper content they'll discover errata when they visit the ADS pages. print("Dropping Errata, Corrigenda...") for p in papers: if "Erratum" in p.title[0] or "Corrigendum" in p.title[0]: papers.remove(p) for p in co_papers: if "Erratum" in p.title[0] or "Corrigendum" in p.title[0]: co_papers.remove(p) # Sum citations first_author_cites = 0 co_author_cites = 0 for p in papers: if p.citation_count is not None: first_author_cites += p.citation_count for p in co_papers: if p.citation_count is not None: co_author_cites += p.citation_count # Compile LaTeX string print("Compiling LaTeX strings...") output = latex_strings(papers) co_output = latex_strings(co_papers) # Export to LaTeX print("Exporting to LaTeX...") export_latex("first_author.tex",output) export_latex("co_author.tex",co_output) print(f"\nThere are {len(papers)} first-author papers, and {len(co_papers)} co-authored papers.") print(f"They have a total of {first_author_cites} and {co_author_cites} citations, respectively.") print("\n\n.tex files prepared. Now run:\n") print("\t pdflatex publications.tex\n\n\n")
32.97931
367
0.622961
import ads ads.config.token = 'my token' import numpy as np en(filename) full_list = f.readlines() bibcodes = [] exclude = ['arXiv','tmp','yCat','PhDT','AAS','ASPC','BSRSL','conf','EPJWC','IAUFM','IAUGA','IAUS','hst','iue','jwst','spzr','prop'] for line in full_list: if line[0] == "@": if not any(x in line for x in exclude): bibcodes.append(line.split("{")[1].replace(",\n","")) return bibcodes def author_format(authors): if len(authors) == 1: a = authors[0] elif len(authors) == 2: a = authors[0] + " \& " + authors[1] else: a = authors[0] + ' et al.' return a def journal_name(bibcode): return bibcode.split(".")[0][4:].replace("&","\&") def adsurl(bibcode): return 'https://ui.adsabs.harvard.edu/abs/' + bibcode def latex_title_greek(title): greek_dict = {"α":r"$\alpha$", "β":r"$\beta$", "γ":r"$\gamma$", "δ":r"$\delta$", "ε":r"$\epsilon$", "ζ":r"$\zeta$", "η":r"$\eta$", "ι":r"$\iota$", "θ":r"$\theta$", "κ":r"$\kappa$", "λ":r"$\lambda$", "μ":r"$\mu$", "ν":r"$\nu$", "ξ":r"$\xi$", "π":r"$\pi$", "ρ":r"$\rho$", "σ":r"$\sigma$", "τ":r"$\tau$", "φ":r"$\phi$", "χ":r"$\chi$", "ψ":r"$\psi$", "ω":r"$\omega$"} for key in greek_dict.keys(): title = title.replace(key, greek_dict[key]) return title def citation_formatter(cites): if cites is None: return "" elif cites == 0: return "" else: if cites < 10: return f"Cited: \\phantom" + "{1}" + f"{cites}" else: return f"Cited: {cites}" def latex_strings(paper_list): output = [] n = len(paper_list) for i,p in enumerate(paper_list): title = p.title[0] entry = "\\textbf{" + f"{n-i}" + "}. " + '\\' + 'href{' + adsurl(p.bibcode) + "}{" + f"{latex_title_greek(title)}" + "}" + "\\\\" entry += author_format(p.author) entry += f" ({p.year}) " entry += journal_name(p.bibcode) entry += f" {p.volume}," entry += f" {p.page[0]}." entry += ' \\hspace*{\\fill}' + citation_formatter(p.citation_count) + "\\vspace{1mm}" + "\\\\" output.append(entry) output[0] = "\\noindent " + output[0] return output def export_latex(filename,latex_string_list): f = open(filename,"w") for line in latex_string_list: f.write(line+"\n") f.close() return "Saved." # Parse bibcodes print("Parsing bibcodes...") bibcodes = extract_bibcodes(first_author) co_bibcodes = extract_bibcodes(co_author) # Search for papers and their attributes from bibcodes print("Querying the ADS API for paper metadata... This may take a while if there are many entries...") papers = [list(ads.SearchQuery(bibcode=bibcode, fl=['bibcode', 'title', 'author', 'year', 'volume', 'page', 'citation_count']))[0] for bibcode in bibcodes] co_papers = [list(ads.SearchQuery(bibcode=bibcode, fl=['bibcode', 'title', 'author', 'year', 'volume', 'page', 'citation_count']))[0] for bibcode in co_bibcodes] # Remove Errata ## Because Ew. And if anyone cares about the paper content they'll discover errata when they visit the ADS pages. print("Dropping Errata, Corrigenda...") for p in papers: if "Erratum" in p.title[0] or "Corrigendum" in p.title[0]: papers.remove(p) for p in co_papers: if "Erratum" in p.title[0] or "Corrigendum" in p.title[0]: co_papers.remove(p) first_author_cites = 0 co_author_cites = 0 for p in papers: if p.citation_count is not None: first_author_cites += p.citation_count for p in co_papers: if p.citation_count is not None: co_author_cites += p.citation_count print("Compiling LaTeX strings...") output = latex_strings(papers) co_output = latex_strings(co_papers) print("Exporting to LaTeX...") export_latex("first_author.tex",output) export_latex("co_author.tex",co_output) print(f"\nThere are {len(papers)} first-author papers, and {len(co_papers)} co-authored papers.") print(f"They have a total of {first_author_cites} and {co_author_cites} citations, respectively.") print("\n\n.tex files prepared. Now run:\n") print("\t pdflatex publications.tex\n\n\n")
true
true
f7265e57b6d0c1d7e79981da52b990daf420ccab
7,670
py
Python
tests/test_breadcrumbs.py
PavloKapyshin/paka.breadcrumbs
ae57d1a0d609ab39f81c4b0b44d6f7081602b079
[ "BSD-3-Clause" ]
1
2018-10-28T03:02:03.000Z
2018-10-28T03:02:03.000Z
tests/test_breadcrumbs.py
PavloKapyshin/paka.breadcrumbs
ae57d1a0d609ab39f81c4b0b44d6f7081602b079
[ "BSD-3-Clause" ]
null
null
null
tests/test_breadcrumbs.py
PavloKapyshin/paka.breadcrumbs
ae57d1a0d609ab39f81c4b0b44d6f7081602b079
[ "BSD-3-Clause" ]
null
null
null
# -*- coding: utf-8 -*- from __future__ import unicode_literals import unittest try: from itertools import zip_longest except ImportError: from itertools import izip_longest as zip_longest from paka.breadcrumbs import Bread, Crumb class BreadcrumbsTest(unittest.TestCase): def setUp(self): self.site_name = "Some site Name" def test_breadcrumbs_can_be_converted_to_list(self): crumbs = list(Bread(self.site_name)) self.assertGreater(len(crumbs), 0) def test_breadcrumbs_can_be_indexed(self): self.assertIsInstance(Bread(self.site_name)[0], Crumb) def test_default_site_crumb(self): crumb, = Bread(self.site_name) self.assertEqual(crumb.label, self.site_name) self.assertEqual(crumb.heading, self.site_name) self.assertEqual(crumb.url_path, "/") self.assertEqual(crumb.extra, {}) def test_changed_site_url_path(self): url_path = "/some/other/" crumb, = Bread(self.site_name, url_path=url_path) self.assertEqual(crumb.url_path, url_path) def test_changed_site_heading(self): heading = "something different" crumb, = Bread(self.site_name, heading=heading) self.assertEqual(crumb.label, self.site_name) self.assertEqual(crumb.heading, heading) def test_changed_site_extra(self): extra = {"a": 1, "b": 2} crumb, = Bread(self.site_name, extra=extra) self.assertEqual(crumb.extra, extra) def test_adding_is_done_in_correct_order(self): bcrumbs = Bread(self.site_name) label, heading, url_path, extra = "Label", "Heading", "/test/", {1: 2} bcrumbs.add(label, heading=heading, url_path=url_path, extra=extra) site_crumb, test_crumb = bcrumbs self.assertEqual(site_crumb.label, self.site_name) self.assertEqual(site_crumb.heading, self.site_name) self.assertEqual(site_crumb.url_path, "/") self.assertEqual(site_crumb.extra, {}) self.assertEqual(test_crumb.label, label) self.assertEqual(test_crumb.heading, heading) self.assertEqual(test_crumb.url_path, url_path) self.assertEqual(test_crumb.extra, extra) def test_adding_defaults(self): label = "some label" bcrumbs = Bread(self.site_name) bcrumbs.add(label) test_crumb = bcrumbs[1] self.assertEqual(test_crumb.label, label) self.assertEqual(test_crumb.heading, label) self.assertIsNone(test_crumb.url_path) self.assertEqual(test_crumb.extra, {}) def test_adding_crumb(self): expected_crumb = Crumb( "Crumb here", heading="H", url_path="url", extra={1: 2}) bcrumbs = Bread(self.site_name) bcrumbs.add_crumb(expected_crumb) site_crumb, test_crumb = bcrumbs self.assertEqual(expected_crumb, test_crumb) def test_from_crumb(self): expected_crumb = Crumb( "Crumb here", heading="H", url_path="url", extra={1: 2}) bcrumbs = Bread.from_crumb(expected_crumb) crumb, = bcrumbs self.assertEqual(expected_crumb, crumb) def test_from_crumbs(self): crumbs = ( Crumb(self.site_name, extra={1: "one"}, url_path="/"), Crumb("Second", url_path="/second/"), Crumb("Third")) bcrumbs = Bread.from_crumbs(crumbs) for expected, actual in zip_longest(crumbs, bcrumbs): self.assertEqual(expected, actual) def test_from_empty_crumbs(self): with self.assertRaises(ValueError): Bread.from_crumbs(()) class BreadcrumbsTitleTest(unittest.TestCase): def setUp(self): from markupsafe import Markup from mako.template import Template self.markup_class = Markup self.template_class = Template self.site_name = "Some site Name" def test_getting_title_with_one_crumb(self): bcrumbs = Bread(self.site_name) result = bcrumbs.get_title("←") self.assertEqual(result, self.site_name) self.assertIsInstance(result, self.markup_class) def test_getting_title_with_several_crumbs(self): bcrumbs = Bread(self.site_name) bcrumbs.add("Subsection", heading="something", url_path="/sub") bcrumbs.add("<sub-sub>", heading="Subsubsection", url_path="/sub/sub") bcrumbs.add("here") cases = ( ("sep", "here sep &lt;sub-sub&gt; sep Subsection sep {}"), ("←", "here ← &lt;sub-sub&gt; ← Subsection ← {}"), ("<", "here &lt; &lt;sub-sub&gt; &lt; Subsection &lt; {}"), ( "&lt;", "here &amp;lt; &lt;sub-sub&gt; " "&amp;lt; Subsection &amp;lt; {}"), ( self.markup_class("&lt;"), "here &lt; &lt;sub-sub&gt; &lt; Subsection &lt; {}")) for sep, tmpl in cases: result = bcrumbs.get_title(sep) self.assertIsInstance(result, self.markup_class) self.assertEqual(result, tmpl.format(self.site_name)) def test_template_rendering(self): bcrumbs = Bread(self.site_name) bcrumbs.add("Subsection", heading="something", url_path="/sub") bcrumbs.add("<sub-sub>", heading="Subsubsection", url_path="/sub/sub") bcrumbs.add("here") title = bcrumbs.get_title("<") expected = ( "<title>here &lt; &lt;sub-sub&gt; &lt; Subsection " "&lt; {}</title>").format(self.site_name) template_string = "<title>${title}</title>" self.assertEqual( self.template_class( template_string, default_filters=["h"]).render(title=title), expected) self.assertEqual( self.template_class(template_string).render(title=title), expected) class CrumbTest(unittest.TestCase): def test_empty_url_path_results_in_none(self): crumb = Crumb("label", url_path="") self.assertIsNone(crumb.url_path) def test_equality_defaults(self): args, kwargs = ("a", ), {} crumb_a = Crumb(*args, **kwargs) crumb_b = Crumb(*args, **kwargs) self.assertEqual(crumb_a, crumb_b) def test_equality_same_kwargs(self): kwargs = { "label": "Some label", "url_path": "/url/path", "heading": "Same", "extra": {0: 1}} crumb_a = Crumb(**kwargs) crumb_b = Crumb(**kwargs) self.assertEqual(crumb_a, crumb_b) def test_equality_different_label(self): same_kwargs = { "url_path": "/url/path", "heading": "Same", "extra": {1: 2}} crumb_a = Crumb(label="a", **same_kwargs) crumb_b = Crumb(label="b", **same_kwargs) self.assertNotEqual(crumb_a, crumb_b) def test_equality_different_url_path(self): same_kwargs = { "label": "Same", "heading": "Same too", "extra": {3: 4}} crumb_a = Crumb(url_path="a", **same_kwargs) crumb_b = Crumb(url_path="b", **same_kwargs) self.assertNotEqual(crumb_a, crumb_b) def test_equality_different_heading(self): same_kwargs = { "url_path": "/url/path", "label": "Same", "extra": {5: 6}} crumb_a = Crumb(heading="a", **same_kwargs) crumb_b = Crumb(heading="b", **same_kwargs) self.assertNotEqual(crumb_a, crumb_b) def test_equality_different_extra(self): same_kwargs = { "url_path": "/url/path", "heading": "Same", "label": "Same too"} crumb_a = Crumb(extra={"a": 1}, **same_kwargs) crumb_b = Crumb(extra={"b": 2}, **same_kwargs) self.assertNotEqual(crumb_a, crumb_b)
36.52381
78
0.619426
from __future__ import unicode_literals import unittest try: from itertools import zip_longest except ImportError: from itertools import izip_longest as zip_longest from paka.breadcrumbs import Bread, Crumb class BreadcrumbsTest(unittest.TestCase): def setUp(self): self.site_name = "Some site Name" def test_breadcrumbs_can_be_converted_to_list(self): crumbs = list(Bread(self.site_name)) self.assertGreater(len(crumbs), 0) def test_breadcrumbs_can_be_indexed(self): self.assertIsInstance(Bread(self.site_name)[0], Crumb) def test_default_site_crumb(self): crumb, = Bread(self.site_name) self.assertEqual(crumb.label, self.site_name) self.assertEqual(crumb.heading, self.site_name) self.assertEqual(crumb.url_path, "/") self.assertEqual(crumb.extra, {}) def test_changed_site_url_path(self): url_path = "/some/other/" crumb, = Bread(self.site_name, url_path=url_path) self.assertEqual(crumb.url_path, url_path) def test_changed_site_heading(self): heading = "something different" crumb, = Bread(self.site_name, heading=heading) self.assertEqual(crumb.label, self.site_name) self.assertEqual(crumb.heading, heading) def test_changed_site_extra(self): extra = {"a": 1, "b": 2} crumb, = Bread(self.site_name, extra=extra) self.assertEqual(crumb.extra, extra) def test_adding_is_done_in_correct_order(self): bcrumbs = Bread(self.site_name) label, heading, url_path, extra = "Label", "Heading", "/test/", {1: 2} bcrumbs.add(label, heading=heading, url_path=url_path, extra=extra) site_crumb, test_crumb = bcrumbs self.assertEqual(site_crumb.label, self.site_name) self.assertEqual(site_crumb.heading, self.site_name) self.assertEqual(site_crumb.url_path, "/") self.assertEqual(site_crumb.extra, {}) self.assertEqual(test_crumb.label, label) self.assertEqual(test_crumb.heading, heading) self.assertEqual(test_crumb.url_path, url_path) self.assertEqual(test_crumb.extra, extra) def test_adding_defaults(self): label = "some label" bcrumbs = Bread(self.site_name) bcrumbs.add(label) test_crumb = bcrumbs[1] self.assertEqual(test_crumb.label, label) self.assertEqual(test_crumb.heading, label) self.assertIsNone(test_crumb.url_path) self.assertEqual(test_crumb.extra, {}) def test_adding_crumb(self): expected_crumb = Crumb( "Crumb here", heading="H", url_path="url", extra={1: 2}) bcrumbs = Bread(self.site_name) bcrumbs.add_crumb(expected_crumb) site_crumb, test_crumb = bcrumbs self.assertEqual(expected_crumb, test_crumb) def test_from_crumb(self): expected_crumb = Crumb( "Crumb here", heading="H", url_path="url", extra={1: 2}) bcrumbs = Bread.from_crumb(expected_crumb) crumb, = bcrumbs self.assertEqual(expected_crumb, crumb) def test_from_crumbs(self): crumbs = ( Crumb(self.site_name, extra={1: "one"}, url_path="/"), Crumb("Second", url_path="/second/"), Crumb("Third")) bcrumbs = Bread.from_crumbs(crumbs) for expected, actual in zip_longest(crumbs, bcrumbs): self.assertEqual(expected, actual) def test_from_empty_crumbs(self): with self.assertRaises(ValueError): Bread.from_crumbs(()) class BreadcrumbsTitleTest(unittest.TestCase): def setUp(self): from markupsafe import Markup from mako.template import Template self.markup_class = Markup self.template_class = Template self.site_name = "Some site Name" def test_getting_title_with_one_crumb(self): bcrumbs = Bread(self.site_name) result = bcrumbs.get_title("←") self.assertEqual(result, self.site_name) self.assertIsInstance(result, self.markup_class) def test_getting_title_with_several_crumbs(self): bcrumbs = Bread(self.site_name) bcrumbs.add("Subsection", heading="something", url_path="/sub") bcrumbs.add("<sub-sub>", heading="Subsubsection", url_path="/sub/sub") bcrumbs.add("here") cases = ( ("sep", "here sep &lt;sub-sub&gt; sep Subsection sep {}"), ("←", "here ← &lt;sub-sub&gt; ← Subsection ← {}"), ("<", "here &lt; &lt;sub-sub&gt; &lt; Subsection &lt; {}"), ( "&lt;", "here &amp;lt; &lt;sub-sub&gt; " "&amp;lt; Subsection &amp;lt; {}"), ( self.markup_class("&lt;"), "here &lt; &lt;sub-sub&gt; &lt; Subsection &lt; {}")) for sep, tmpl in cases: result = bcrumbs.get_title(sep) self.assertIsInstance(result, self.markup_class) self.assertEqual(result, tmpl.format(self.site_name)) def test_template_rendering(self): bcrumbs = Bread(self.site_name) bcrumbs.add("Subsection", heading="something", url_path="/sub") bcrumbs.add("<sub-sub>", heading="Subsubsection", url_path="/sub/sub") bcrumbs.add("here") title = bcrumbs.get_title("<") expected = ( "<title>here &lt; &lt;sub-sub&gt; &lt; Subsection " "&lt; {}</title>").format(self.site_name) template_string = "<title>${title}</title>" self.assertEqual( self.template_class( template_string, default_filters=["h"]).render(title=title), expected) self.assertEqual( self.template_class(template_string).render(title=title), expected) class CrumbTest(unittest.TestCase): def test_empty_url_path_results_in_none(self): crumb = Crumb("label", url_path="") self.assertIsNone(crumb.url_path) def test_equality_defaults(self): args, kwargs = ("a", ), {} crumb_a = Crumb(*args, **kwargs) crumb_b = Crumb(*args, **kwargs) self.assertEqual(crumb_a, crumb_b) def test_equality_same_kwargs(self): kwargs = { "label": "Some label", "url_path": "/url/path", "heading": "Same", "extra": {0: 1}} crumb_a = Crumb(**kwargs) crumb_b = Crumb(**kwargs) self.assertEqual(crumb_a, crumb_b) def test_equality_different_label(self): same_kwargs = { "url_path": "/url/path", "heading": "Same", "extra": {1: 2}} crumb_a = Crumb(label="a", **same_kwargs) crumb_b = Crumb(label="b", **same_kwargs) self.assertNotEqual(crumb_a, crumb_b) def test_equality_different_url_path(self): same_kwargs = { "label": "Same", "heading": "Same too", "extra": {3: 4}} crumb_a = Crumb(url_path="a", **same_kwargs) crumb_b = Crumb(url_path="b", **same_kwargs) self.assertNotEqual(crumb_a, crumb_b) def test_equality_different_heading(self): same_kwargs = { "url_path": "/url/path", "label": "Same", "extra": {5: 6}} crumb_a = Crumb(heading="a", **same_kwargs) crumb_b = Crumb(heading="b", **same_kwargs) self.assertNotEqual(crumb_a, crumb_b) def test_equality_different_extra(self): same_kwargs = { "url_path": "/url/path", "heading": "Same", "label": "Same too"} crumb_a = Crumb(extra={"a": 1}, **same_kwargs) crumb_b = Crumb(extra={"b": 2}, **same_kwargs) self.assertNotEqual(crumb_a, crumb_b)
true
true