qid int64 2 112k | question stringlengths 61 6.7k | positives listlengths 1 1 | negatives listlengths 1 10 |
|---|---|---|---|
9,815 | <p>Bacteriophages have sequences which often do not have specific sites for restriction enzymes of bacteria to cut at and so can attack the bacteria.</p>
<p>Wouldn't it be better if bacteria had something "universal" like an enzyme that simply cuts the nucleotide sequence "randomly"? Is there any particular advantage of cutting at only a few restriction sites?</p>
| [
{
"answer_id": 9816,
"pm_score": 4,
"text": "<p>Such universal restriction enzymes would be very dangerous to leave lying around even if contained within a vacuole. Remember that bacteria are prokaryotes and have no nuclear membrane to protect their DNA.</p>\n\n<p>The analogy would be having a burglar a... | [
{
"answer_id": 9818,
"pm_score": 2,
"text": "<p>Notice that viral DNA is not the only foreign DNA that a bacterial can meet during its bacterial adventures. Plasmids, conjugated DNA and DNA inserted by transformation exist, and it may confer ecological advantages. Because of that, even if the enzymes wo... |
9,990 | <p>Is there any reason why AUG is the initiation codon?
Can’t translation start with different codons?</p>
| [
{
"answer_id": 10000,
"pm_score": 5,
"text": "<p>A good question (if a little mixed up on transcription vs. translation!)</p>\n\n<p>AUG is not always the start codon, but whatever the codon is it will always code for Methionine (or fMet, but still a variation on Met), even if the codon codes for a diffe... | [
{
"answer_id": 9996,
"pm_score": 2,
"text": "<p>First of all, it is the <em>coding sequence</em>, the open reading frame (ORF), and not the gene that starts with an AUG. Also, there are actually quite a few ORFs that start with different initiation codons, they are just the exceptions rather than the no... |
10,042 | <p>The human genome project released it's first complete genome nearly ten years ago. Since then many species have also been sequenced. </p>
<p>I am trying to find a list of completed (and possibly ongoing/initiated) projects sequencing other species along with some very basic summary data such as number of genes (divided amongst the sex chromosomes and autosomes), length of DNA, number of chromosomes etc.</p>
<p>This is for a presentation I am giving at a conference and would make a nice addition to my talk.</p>
| [
{
"answer_id": 10043,
"pm_score": 3,
"text": "<p>The <a href=\"http://www.genomesonline.org/\" rel=\"nofollow\">GOLD database (Genomes Online DB)</a> contains data on the sequencing status, and also some stats (number of chromosomes, genome size) -- but this extra data is not available for all species.<... | [
{
"answer_id": 10044,
"pm_score": 1,
"text": "<p>The <a href=\"https://genome10k.soe.ucsc.edu/\" rel=\"nofollow\">Genome 10K project</a>, in their words \"aims to assemble a genomic zoo—a collection of DNA sequences representing the genomes of 10,000 vertebrate species, approximately one for every verte... |
10,120 | <p>On the high-wavelength side of things, we see almost-infrared as reddish, with a slight tinge of magenta. On the low side, we see violet fading into the same magenta color. Why is that? </p>
<p>You can see it clearly on any hue chart. There's an unbroken flow from one to the other, even though the wavelengths are literally as far apart as they can be while still remaining visible.</p>
<p>I understand that color vision is limited due to several biological factors(cone receptivity, absorption, etc), but why do the colors on both side fade into each other? Is it just our brain making things "neat" and continuous?</p>
| [
{
"answer_id": 10121,
"pm_score": 3,
"text": "<p>Basically. You are most likely looking at the electromagnetic spectrum, which is linear and conveniently makes sense... except for magenta.</p>\n\n<p>Colors as we perceive them are additive and made up of Red, Green, and Blue; this is opposed to subtract... | [
{
"answer_id": 14041,
"pm_score": 1,
"text": "<p>The question has an invalid premise. Namely, that the UV light looks like magenta/purple. It is not the case. While it it true that approaching UV end the perceived color becomes more purple (because the red protoreceptors have a second maximum there), mo... |
10,210 | <p>Most plants do not have centrioles, so what organelle enables them to multiply?</p>
| [
{
"answer_id": 10254,
"pm_score": 4,
"text": "<p>There are many different ways to make a spindle in plant cells: </p>\n\n<blockquote>\n <p>Mitotic spindles may be organized at centriolar centrosomes (only in final divisions of spermatogenesis), polar organizers (POs), plastid MTOCs, or nuclear envelope... | [
{
"answer_id": 10232,
"pm_score": 2,
"text": "<p>Plant cells without centrioles build special vesicles from their Golgi apparatus which are important for cell division.</p>\n\n<p><a href=\"http://preuniversity.grkraj.org/html/2_CELL_DIVISION.htm\" rel=\"nofollow\">This</a> website has a nice comparison ... |
10,664 | <p>Simple terminology question:</p>
<ul>
<li>Is there a hard boundary between <em>in vitro</em> and <em>ex vivo</em>?</li>
<li>Is there a hard boundary between <em>in vivo</em> and <em>ex vivo</em>?</li>
</ul>
<p>Suppose a sensory neuron is electrically recorded in the following settings:</p>
<ol>
<li>Surgically accessing through the animal's skin, and patch-clamped,</li>
<li>Tissue surrounding the neuron is almost separated, but still dangling from the larger part of the animal, and patch-clamped,</li>
<li>Same as above, but the slight dangling connection is cut,</li>
<li>The sensory neuron is isolated and put in an artificially oxygenated medium</li>
</ol>
<p>The sensory neuron is assumed to have purely feedforward signal, and is perfectly healthy in all conditions. Which conditions, if any, are <em>in vivo</em>, <em>in vitro</em>, or <em>ex vivo</em>? (Feel free to propose better hypothetical experiments. I know this example is not the best.)</p>
<p>Am I the only one confused about these terminologies?</p>
| [
{
"answer_id": 10666,
"pm_score": 4,
"text": "<p><em>Ex vivo</em> simply means \"outside the normal, living organism\", whereas <em>in vitro</em> means \"within glass\", usually in a cultured system. They are not exactly same as there is no need for the work to be done in a culture system, although bot... | [
{
"answer_id": 10667,
"pm_score": 2,
"text": "<p>(Not only) <a href=\"http://en.wikipedia.org/wiki/In_vivo\" rel=\"nofollow\">Wikipedia</a> states that <em>in vitro</em> and <em>in vivo</em> have a very hard boundary between them. I something is studied in the context of an organism, without being extra... |
10,688 | <p><a href="http://en.wikipedia.org/wiki/Animal_echolocation" rel="noreferrer">Echolocation</a> is the ability to obtain spatial information of the surroundings from echos generated by the animal. There are bats and other vertebrates that naturally use it.</p>
<p>I was wondering if this is limited to vertebrates, or if there are examples among the invertebrate, especially insects.</p>
| [
{
"answer_id": 10704,
"pm_score": 4,
"text": "<p>Some moth actually do use clicks for their own echolocation: \"Noctuid moths (Noctuidae) are the only group of invertebrates for whom echolocation was\ndemonstrated\":</p>\n\n<ul>\n<li><a href=\"http://www.lapshin.iitp.ru/lapsh98e.pdf\">Lapshin & Voro... | [
{
"answer_id": 10702,
"pm_score": 1,
"text": "<p>As far as I can tell, the answer is no. It's hard to prove a negative so the best I can do is that none of the articles in the literature I've been able to comb through have any mention of invertebrates at all. What I can give you is that <a href=\"http... |
10,762 | <p>I have spent months as a student working on trying to form a tricky protein crystal. But I have never actually had explained to me why the structure will be useful. Once elucidated, what can we potentially learn from the structure in terms of biological significance?</p>
<p>Are there examples of drugs, or treatments that have only been made possible because of a known crystal structure?</p>
<p>Generally speaking, why do people spend so much money on synchrotrons, laboratories, robots and so on, for a protein structure?</p>
| [
{
"answer_id": 10775,
"pm_score": 5,
"text": "<p><a href=\"http://rcsb.org/pdb/home/home.do\" rel=\"nofollow noreferrer\">Protein structures</a>, which can be obtained from protein crystals or from concentrated solutions of pure protein via NMR, are arguably the primary source of knowledge that we have ... | [
{
"answer_id": 10767,
"pm_score": 3,
"text": "<p>I always wondered this myself, but the structure of a protein can end up being quite important for a number of reasons. Most relate to the fact that protein function often depends on specific domains, and while a protein may have multiple functional dom... |
10,843 | <p>I'm designing a set of primers and reading about the principles of primer design one of which is:</p>
<blockquote>
<p>GC Clamp: The presence of G or C bases within the last five bases from
the 3' end of primers (GC clamp) helps promote specific binding at the
3' end due to the stronger bonding of G and C bases. More than 3 G's
or C's should be avoided in the last 5 bases at the 3' end of the
primer.</p>
</blockquote>
<p>From <a href="http://www.premierbiosoft.com/tech_notes/PCR_Primer_Design.html">here</a>.</p>
<p>My question is how essential is it to have a GC clamp?</p>
| [
{
"answer_id": 10876,
"pm_score": 4,
"text": "<p>It's hard to provide an objective answer. If you have a decent length and good complexity, even a single terminal 3' <code>G</code> or <code>C</code> would do. Of course, one has to take into account the primer's overall <code>GC:AT</code> ratio and thing... | [
{
"answer_id": 10886,
"pm_score": 2,
"text": "<p>I will offer my own (empirical) account of primer design. A GC-clamp aids in specificity of the priming and therefore contributes to the overall efficiency of the PCR reaction. In the past, I have (out of necessity) designed primers that had both too much... |
13,665 | <p>Me and some friends are interested in opinions for the following:</p>
<p><strong><em>Conjecture</em></strong></p>
<blockquote>
<p>The maximum number of species must be limited by the maximum
combinatorial/permutational space that can be occupied by DNA. Thus if
there is a maximum physical genome size this is what will determine
the maximum number of species that can possibly exist.</p>
</blockquote>
<p><strong><em>Explanation</em></strong></p>
<p>E.G. say maximum number of DNA base pairs able to fit in a genome was $3$, each base pair can be one of either ${A,G,T,C}$. Then there are $4^3 = 64$ possible combinations of genomes. Extrapolate to genome sizes of $x$ base pairs, then there are $4^x$ combinations.</p>
<p><strong><em>Questions</em></strong></p>
<p>Would it be possible to claim that the underlying "blueprint" that codes for living diversity sets the <em>absolute maximum</em> for the total "diversity space"? </p>
<p>**Does it make sense to define the total number of species life can achieve with the simple function:</p>
<p>$S < 4^x$, where X is the maximum genome size measured in DNA base pairs?**</p>
<p><strong><em>Notable Comments</em></strong></p>
<blockquote>
<p>@Shigeta: for $S<4^x$ the combinations involved quickly dwarf the
number of atoms in the universe at ~10^80.</p>
<p>@rg255: Even at this simplification of: $S<20^{x/3}$ there are
$1.024e+13$ possible combinations with just 10 codons, many many more
than there is likely species in the world.</p>
</blockquote>
| [
{
"answer_id": 13679,
"pm_score": 4,
"text": "<p>Yes, we can say the number of species is limited as you conjecture. However, quick estimation shows that the limitation has no apparent usefulness:</p>\n\n<p>A reasonable estimate of the <a href=\"https://en.wikipedia.org/wiki/Genome#Genome_size\">larges... | [
{
"answer_id": 13667,
"pm_score": 3,
"text": "<p>That's an interesting conjecture about the total amount of genetic variation that is possible. I would modify a few things. First, since the size of genomes varies greatly among organisms (from <a href=\"http://www.genomesize.com/prokaryotes/\" rel=\"nofo... |
13,853 | <p>The question of complexity is classic in the very first lectures of evolutionary biology where the teacher usually tries to tell the students that complexity does not necessarily increase and that humans are not more complex than other organisms.</p>
<p>My questions are:</p>
<ul>
<li>Why does complexity tend to increase through evolutionary time?</li>
<li>What are the different hypotheses to explain this pattern?</li>
</ul>
<p>When writing "Mass extinction" on google image, we find many graphs displaying the number of families (or other taxa) through evolutionary times with the five mass extinctions. What would it look like to draw such graph replacing the family richness in the y-axis by :</p>
<ul>
<li>Mean complexity among all living things?</li>
<li>Complexity of the most complex taxon?</li>
</ul>
<hr>
<p>I suppose that anyone who wishes to answer to this post will necessarily need to define the words "complexity". He or she might define it in terms of number of genes, number of metabolic pathways, length of DNA sequence, number of cell types, some kind of index taken from information theory. When asking my questions I had in mind a definition close to "number of genes" or "number of metabolic pathways".</p>
| [
{
"answer_id": 13860,
"pm_score": 4,
"text": "<p>This is actually a very interesting yet difficult question to give a single precise answer to. I will try and summarize for you a \"meta answer\":</p>\n\n<p><strong><em>Complexity Science</em></strong> Some consider complexity not to be a Biological topic... | [
{
"answer_id": 14758,
"pm_score": -1,
"text": "<p>Biology arises when some molecules begin copying themselves with a certain amount of error: not too much error, or there would be no heritability; but SOME error, or else there would be no evolution at all. Copying, copying, a few molecules become a mult... |
13,924 | <p><strong>Question:</strong></p>
<p>Given that with genetic engineering we can customize organisms as bio-weapons. Which species have the most worrying potential to be weaponized for mass destruction?</p>
<p><strong>Background:</strong></p>
<blockquote>
<p><a href="http://en.wikipedia.org/wiki/Biological_warfare" rel="noreferrer"><strong><em>Biological warfare</em></strong></a> — is the use of biological toxins or infectious agents such as bacteria, viruses, and
fungi with intent to kill or incapacitate humans, animals or plants as
an act of war.</p>
</blockquote>
<p><strong>Examples:</strong></p>
<blockquote>
<p><strong>E.G. bio-weapon species:</strong> <a href="http://en.wikipedia.org/wiki/Anthrax#History" rel="noreferrer"><em>Anthrax fungus</em></a> - was first tested as a biological warfare agent by Unit 731 of
the Japanese Kwantung Army in Manchuria during the 1930s; some of this
testing involved intentional infection of prisoners of war, thousands
of whom died. Anthrax, designated at the time as Agent N, was also
investigated by the Allies in the 1940s.</p>
<p><strong>E.G. bio-weapon vector:</strong> <a href="http://www.telegraph.co.uk/news/worldnews/europe/italy/1510482/Nazis-tried-to-halt-Allies-in-Italy-with-malaria-epidemic-attack.html" rel="noreferrer"><em>Anopheles labranchiae (malarial mosquito)</em></a> - According to Prof Frank Snowden, a history professor at Yale
University whose book The Conquest of Malaria in Italy draws on
American archives and the diaries of Italian soldiers, the scheme was
orchestrated in the autumn of 1943 by Erich Martini, a medical
entomologist, Nazi Party member and friend of the SS commander
Heinrich Himmler.</p>
</blockquote>
| [
{
"answer_id": 13951,
"pm_score": 4,
"text": "<p>There is both a set \"list\" of agents, but more importantly, a set of properties that an organism needs to be in order to be truly worrisome.</p>\n\n<p>First, the list:</p>\n\n<p>The <a href=\"http://www.bt.cdc.gov/agent/agentlist-category.asp\">CDC</a> ... | [
{
"answer_id": 13937,
"pm_score": 2,
"text": "<p>No doubt influenza. The horizontal shift makes it very virulent and only a few mutations allow it to transfer from birds to mammals (as little as two). See <a href=\"http://www.newscientist.com/article/dn23368-china-bird-flu-may-be-two-mutations-from-a-pa... |
13,942 | <p>Transplanted organs from the donor are attacked by antibodies from the recepient. So can't we construct <strong>anti-antibodies and destroy specifically those antibodies which are causing the rejections ?</strong> (Instead of giving immuno suppressants) </p>
<p>Well, I can think of some problems :</p>
<ol>
<li><p>You would have to administer this for life time which is really expensive.</p></li>
<li><p>So, what if anti - antiantibodies were made by the body ? </p></li>
</ol>
<p>Any other problems you can think of ?</p>
| [
{
"answer_id": 13947,
"pm_score": 3,
"text": "<p>The root of the problem in this case are not the antibodies but the antibody producing cells (APC). They are capable of producing vast amounts of antibody, so I doubt that this approach would be successful. The problem with targeting these APCs is, that y... | [
{
"answer_id": 13946,
"pm_score": 2,
"text": "<p>Within an organism, antibodies which bind to other antibodies in the body would be eliminated during <a href=\"http://en.wikipedia.org/wiki/Clonal_selection\" rel=\"nofollow\">clonal selection</a>. They are not made by the body after that period, which i... |
13,944 | <p>Why is histidine an essential amino acid for children but not for adults ? What changes in the body occur which lead to the formation of histidine in adults but not in children ? What causes these changes ?</p>
<p>UPDATE : Source : Campbell Biology</p>
| [
{
"answer_id": 13947,
"pm_score": 3,
"text": "<p>The root of the problem in this case are not the antibodies but the antibody producing cells (APC). They are capable of producing vast amounts of antibody, so I doubt that this approach would be successful. The problem with targeting these APCs is, that y... | [
{
"answer_id": 13946,
"pm_score": 2,
"text": "<p>Within an organism, antibodies which bind to other antibodies in the body would be eliminated during <a href=\"http://en.wikipedia.org/wiki/Clonal_selection\" rel=\"nofollow\">clonal selection</a>. They are not made by the body after that period, which i... |
14,003 | <p>I have been using old style lab book for some time now but with increasing work on computer and storing sequencing results and gel pictures on computer it would be nice to have everything on computer in a form of labbook. </p>
<p>Does any of you uses a good ELN that would be free as I don't think university will be willing to pay for it :)</p>
<p>Thank you for your answers.</p>
| [
{
"answer_id": 14008,
"pm_score": 4,
"text": "<p>I still prefer the good old[tm] Labnotebook. No dependencies on (proprietary) software or a computer. I generate quite some digital data (blots, sequencing etc.) this is stored on the servers of my university. We looked into this in our lab, but discarded... | [
{
"answer_id": 14006,
"pm_score": 0,
"text": "<p>I am not sure what you need.</p>\n\n<p>Probably <a href=\"http://www.libreoffice.org/\" rel=\"nofollow\">Libre Office</a> (a free MS Office like program, including a rich text editor, with image support) will suffice for you.</p>\n"
},
{
"answer_i... |
14,434 | <p>Suppose we wind time back to the instance when life emerged on Earth and let evolution start over again, will human beings or any other kind of self-conscious animals evolve ultimately, inevitably? </p>
<p>Or do these sorts of animals just evolve as a result of some randomness processes in evolution, if so, what's the probability? Is it great or small? </p>
<p>If randomness does exist, then to what degree will it affect our ability to depict evolution? Will we still be able to describe the general trends of evolution, for example, the trend of more and more complicated animals evolving?</p>
| [
{
"answer_id": 14448,
"pm_score": 4,
"text": "<p>Evolution is largely random, because most of the processes that drive evolution are random. A few ideas you should understand to realize why it is so random.</p>\n\n<p>Most people are only aware of natural selection when it comes to evolution, and think t... | [
{
"answer_id": 14435,
"pm_score": 2,
"text": "<p><strong>Problems of epistemology in your question</strong></p>\n\n<p>Two problems of epistemology (which discussion is a matter of philosophy rather than science)</p>\n\n<ol>\n<li><p>The whole question depends on what you consider being random and what yo... |
14,583 | <p>What help does goosebumps do to us? I don't think it helps us noticeably when we are scared or shivering.</p>
| [
{
"answer_id": 14585,
"pm_score": 3,
"text": "<p>As a general rule, you might want to check wikipedia before posting here. On the other hand, I am glad you made me look the answer up. <br/> </p>\n\n<p>Goose-bumps warm you up a little. \"During the formation of goose bumps, the body is warmed from the ... | [
{
"answer_id": 14587,
"pm_score": 2,
"text": "<blockquote>\n <p>\"The formation of goose bumps in humans under stress is a vestigial\n reflex; a possible function in human evolutionary ancestors was to\n raise the body's hair, making the ancestor appear larger and scaring\n off predators. Raising th... |
14,594 | <p>Single nucleotide polymorphism (SNP) or genetic variation in general, by definition are relative to a reference sequence. When we talk about databases of SNP as in ("dbSNP—Database for Single Nucleotide Polymorphisms and Other Classes of Minor Genetic Variation", or "A map of human genome sequence variation containing 1.42 million single nucleotide polymorphisms" -- titles of well known research papers), what is the reference genome? Similarly for defining a "SNP Map/Profile" of a person (in medical genomics), what is the reference genome sequence? Is there a <em>de facto</em> reference, or is it context dependent? There is a sentence "Scientists are trying to identify all the different SNPs in the human genome" at <a href="http://www.cancer.gov/cancertopics/understandingcancer/geneticvariation/page36" rel="nofollow">http://www.cancer.gov/cancertopics/understandingcancer/geneticvariation/page36</a> -
what is the reference genome here?</p>
| [
{
"answer_id": 14585,
"pm_score": 3,
"text": "<p>As a general rule, you might want to check wikipedia before posting here. On the other hand, I am glad you made me look the answer up. <br/> </p>\n\n<p>Goose-bumps warm you up a little. \"During the formation of goose bumps, the body is warmed from the ... | [
{
"answer_id": 14587,
"pm_score": 2,
"text": "<blockquote>\n <p>\"The formation of goose bumps in humans under stress is a vestigial\n reflex; a possible function in human evolutionary ancestors was to\n raise the body's hair, making the ancestor appear larger and scaring\n off predators. Raising th... |
14,696 | <p>I am trying to understand what exactly a phenotype is to try and understand a genetics database. (Ie I don't really know very much about genetics at all)</p>
<p>I've been reading through <a href="http://en.wikipedia.org/wiki/Phenotype" rel="nofollow">wikipedia</a> on what a phenotype is and from what I can gather it is an observable trait which may be impacted by a specific gene.</p>
<p>What I would like to know is if you were looking for the presence of a phenotype such as <code>red hair</code>, would characteristics like <code>not red hair</code> and <code>carrier of red hair</code> also be phenotypes? </p>
<p>For example the following table is named Phenotype,</p>
<pre><code>+------+------------------+
| Code | Description |
+------+------------------+
| RR | Red Hair | this makes sense with my understanding of phenotype
| RN | Red Hair Carrier | this doesnt
| NR | Red Hair Carrier | this doesnt
| NN | No Red Hair | this doesnt
+------+------------------+
</code></pre>
<p>The whole code column looks like it represents a gene not a phenotype</p>
| [
{
"answer_id": 14730,
"pm_score": 4,
"text": "<p>I agree with one of Alan's comments when he says:</p>\n\n<p>\"I think this comes down to whether you include being a carrier of a genetic \"condition\" a part of your phenotype. It's almost a question of semantics\"</p>\n\n<p>To expand on this, I would sa... | [
{
"answer_id": 14698,
"pm_score": 1,
"text": "<p>You say it yourself: The phenotype is the observable trait. So this means if you have red hairs, your hair phenotype is red. The most likely reason for it, the mutation of the melanocortin-1-receptor, is the underlying genotype.\nOr: The phenotype of mous... |
14,957 | <p><a href="http://en.wikipedia.org/wiki/Ronald_Fisher" rel="nofollow">Ronald Fisher</a> discovered what he, with humility, called the <a href="http://en.wikipedia.org/wiki/Fisher%27s_fundamental_theorem_of_natural_selection" rel="nofollow">Fundamental Theorem of Natural Selection</a>. This theorem says (in its modern terminology):</p>
<blockquote>
<p>The rate of increase in the mean fitness of any organism at any time ascribable to natural selection acting through changes in gene frequencies is exactly equal to its genetic variance in fitness at that time.</p>
</blockquote>
<p>As I understand it, it sounds alike the standard equation that we learn in the first class of <em>Introduction to evolutionary biology</em></p>
<p>$$R = S \cdot \frac{V_G}{V_p}$$</p>
<p>In words: the response to selection equals the selection differential times the genetic variance of the trait under consideration divided by the total phenotypic variance of the trait under consideration</p>
<p><strong>But how can we prove/demonstrate that Fisher's fundamental theorem of natural selection holds true?</strong></p>
<p>I don't ask for empirical evidences that support this claim but for a theoretical/mathematical proof/demonstration of this claim.</p>
| [
{
"answer_id": 16025,
"pm_score": 2,
"text": "<p>The following answer is not complete and only give some intuitive grasp on Fisher's fundamental theorem of Natural Selection. A better devlopment can be found in <a href=\"http://rads.stackoverflow.com/amzn/click/0387201912\" rel=\"nofollow\">Ewen's book<... | [
{
"answer_id": 14962,
"pm_score": 1,
"text": "<p>Here's <a href=\"http://www.ias.ac.in/jgenet/Vol74Nos1&2/19.pdf\" rel=\"nofollow\">a paper with an historical bibliography of mathematical analyses in the introduction</a>. </p>\n\n<p>As you can see when you demand a mathematical treatment of somethi... |
15,059 | <p>We inserted an insulin gene from human into bacteria. Will translation of the gene (protein formation) occur in bacteria? If translation occurs then why does it occurs, give a reason for this? </p>
| [
{
"answer_id": 15129,
"pm_score": 4,
"text": "<p>Yes, bacteria will produce human (or any organism's) proteins if you introduce their genetic material but there are a few things to consider.</p>\n\n<p>First, the introns must be removed from the human genetic sequence. Bacteria do not have the machinery ... | [
{
"answer_id": 15060,
"pm_score": 1,
"text": "<p>All the organisms share a common ancestor and have evolved from it. So they share quite the same machinery for transcription and translation. Codons are also interpreted in the same way in almost all the organisms.</p>\n\n<p>So, yes translation should hap... |
15,070 | <p>What would happen if you took the deadliest diseases/viruses in the world and combined them in a single medium (a solution of water or a test subject)? Would the strongest virus defeat the rest or would a new deadly virus be created?</p>
| [
{
"answer_id": 15071,
"pm_score": 4,
"text": "<p>Viruses in the same cell can recombine (although they don't always do). This can happen by crossing-over of the genomic strands or reassortment of genomic segments. Therefore, you can get a new virus out of the fist two. The new one is not necessarily dea... | [
{
"answer_id": 15080,
"pm_score": -1,
"text": "<p>See viruses are made to destroy the host, not other viruses, so putting different types together really wouldn't have much an effect would it? as Manuella answer says, the host cell will simply suffer (or enjoy as he says) with both at once. Viruses don'... |
15,505 | <p>In molecular biology and genetics, a transcription factor is a protein that binds to specific DNA sequences, thereby controlling the flow (or transcription) of genetic information from DNA to messenger RNA.</p>
<p>My question is simply how many transcription factors are there in the genomes of: </p>
<ul>
<li>Humans</li>
<li>Anopheles gambiae (or it's close taxonomic relatives)</li>
<li>Less prioritized: any other species</li>
</ul>
| [
{
"answer_id": 15506,
"pm_score": 4,
"text": "<p><a href=\"http://www.tfcat.ca/\">This</a> is the Curated database of mouse and human transcription factors. And <a href=\"http://genomebiology.com/2009/10/3/R29\">this</a> is the paper in which they describe how they curated the database. In summary, ther... | [
{
"answer_id": 15507,
"pm_score": 2,
"text": "<p>Pretty interesting question. There are a few numbers out, I remember that round about 10% of the human genes are coding for transcription factors (unfortunately I don'T remember the source for that).</p>\n\n<p>This paper from 2002 estimates between 2000 a... |
15,529 | <p>I am not a biologist. Please pardon me, if my question does not make sense.</p>
<p>I am trying to obtain a DNA sequence for pattern analysis in Matlab. I used to generate random sequence <code>randseq</code> in Matlab. However, I am trying to obtain some real dataset. </p>
<p>Any idea where I can obtain the DNA dataset. I am looking at a dataset having <code>acgt</code> patterns</p>
<p>Thanks</p>
<p>EDIT : Thanks a lot guys, I found it here. : <a href="http://www.ncbi.nlm.nih.gov/nucest?term=((human%5BComponent+Accession%5D)+AND+normal+Breast+gene+sequence)+AND+1000%3A10000%5BSequence+Length%5D" rel="nofollow">http://www.ncbi.nlm.nih.gov/nucest?term=((human%5BComponent+Accession%5D)+AND+normal+Breast+gene+sequence)+AND+1000%3A10000%5BSequence+Length%5D</a></p>
| [
{
"answer_id": 15530,
"pm_score": 4,
"text": "<p>There are several nucleotide sequence datbases available. One of the largest is the NCBI GenBank at <a href=\"http://www.ncbi.nlm.nih.gov/genbank/\">http://www.ncbi.nlm.nih.gov/genbank/</a></p>\n\n<p>You may use the search bar at the top to search for nuc... | [
{
"answer_id": 15531,
"pm_score": 2,
"text": "<p>you can download real sequences from GENBANK. You can search model organism(s) or genetic marker(s) and download it in *.fasta or other format. Good luck!</p>\n\n<p><a href=\"http://www.ncbi.nlm.nih.gov/genbank/\" rel=\"nofollow\">http://www.ncbi.nlm.nih.... |
15,553 | <p>What is the evolutionary purpose of the topology of human ears? I understand why the ears may have a funnel-like shape but if the various "hills and valleys" do not amplify incoming sound, what purpose do they have?</p>
| [
{
"answer_id": 15647,
"pm_score": 3,
"text": "<p>Humans do not have the ability to move their outer ear in response to sound. Many animals can do that, and use it to determine the source of the sound waves. Thus, human outer ears are equipped with many \"hills and valleys\". It does not provide amplific... | [
{
"answer_id": 15655,
"pm_score": -1,
"text": "<p>Evolution doesn't have a purpose. In that light, it's quite possible for an ear to be poorly adapted to hearing - which in fact it is compared to other species.</p>\n\n<p>Stereo hearing (two ears, so you can better detect where the sound is coming from) ... |
15,567 | <p>Can a human eat grass and digest it?
Could it be possible to use it as food just like other plants such as wheat or beans?</p>
| [
{
"answer_id": 15570,
"pm_score": 6,
"text": "<p>To elaborate on A random zoologist's answer, the problem is that the human digestive system does not contain any cellulase enzymes. <a href=\"http://en.wikipedia.org/wiki/Cellulase\">Cellulases</a> are a class of enzymes that break down cellulose, the chi... | [
{
"answer_id": 15569,
"pm_score": 3,
"text": "<p>Well, humans can eat grass, but it will not be digested. Cause to digest grass our body needs different kind of enzymes, which lack in humans so they can't digest grass directly although humans can eat grass, but not recommended.</p>\n\n<p>Similarly our b... |
15,576 | <blockquote>
<p>In a given population under Hardy Weinberg equilibrium, 40.0% of men have hemophilia. What is the probability that a random man and random woman will have a daughter with haemophilia?</p>
</blockquote>
<p>I think the answer is 16%, but the answer given is 9.6%. According to Hardy-Weinberg principle, p<sup>2</sup> + 2pq + q<sup>2</sup> = 1. In order to inherit the disease, the mother must either be a carrier of have the disease, which occurs with probability 1-q<sup>2</sup> = 0.72</p>
<p>Therefore, the odds of having a child with the disease is (0.84)(0.4). Since it asks for the probability of a girl, the total must be divided by two, so the answer is 0.168</p>
<p>Where am I wrong?</p>
| [
{
"answer_id": 15580,
"pm_score": 3,
"text": "<p>I make it 8%. Here is my reasoning.</p>\n<p>The gene is X-linked.</p>\n<p>40% mutant males, so freq(mutant allele) = p = 0.4, and freq(wt allele) = q = 0.6</p>\n<p>To get a mutant female we have to have a mutant male parent, probability = 0.4\nOf these ma... | [
{
"answer_id": 31028,
"pm_score": 0,
"text": "<p>Frequency of allele for Haemophilia (q) = 0.4 <br>\nFrequency of normal allele (p) = 0.6 <br></p>\n\n<p>Cross between Heterozygote female and hemophiliac male\nby punnett square:<br>\nProbability of hemophiliac daughter = 0.5 <br>\nP(hemophiliac male) = 0... |
15,814 | <p>I wonder if the thrombus can pass through the brain-blood barrier because I think small molecules like O<sub>2</sub>, CO<sub>2</sub> and ethanol can pass it.
Probably, in some diseases where the permeability of the barrier changes.</p>
<p><strong>Can systemic intravascular thrombosis cause brain infarction?</strong></p>
| [
{
"answer_id": 35069,
"pm_score": 3,
"text": "<p>This question seems to stem from a misunderstanding of the nature of the Blood-Brain-Barrier, the circulatory system of the brain and of thrombi. The BBB is describes differences in the structure of the walls of the blood vessels of the brain, it is not a... | [
{
"answer_id": 16933,
"pm_score": 1,
"text": "<p>The question has a vague term <em>cause</em> which is confusing people here. \nFor me, it means that the event increases the risk of the outcome. \nFor some others, it means the event is a definite factor in resulting in the outcome. \nSo I avoid answerin... |
16,061 | <p>I thought of this question yesterday and it turns out it's surprisingly hard to Google.</p>
| [
{
"answer_id": 16071,
"pm_score": 4,
"text": "<p>Hibernating bears have an ingeneous way of recycling their urine (urea) while they hibernate. Also turtles and frogs in the bottom of ponds deal in unique ways during hibernation.. This should get you started.\nrecycling waste externally is done by rabbit... | [
{
"answer_id": 16062,
"pm_score": 4,
"text": "<p><strong>All</strong> organisms recycle their waste internally. Every cell of every living organisms is constantly breaking things down and re-using the components so produced. But you're presumably wondering about things such as carbon dioxide, urine and ... |
16,272 | <p>I still don't know if the mitochondrion or chloroplast was first? I've looked for it on the internet and in various books but haven't found anything. Does anyone have the answer and a theory which backs up this answer? </p>
| [
{
"answer_id": 16280,
"pm_score": 5,
"text": "<p>Mitochondria evolved before chloroplasts.</p>\n\n<p>We know this because Mitochondria form a monophyletic group: e.g. all life with mitochondria traces back to a single common ancestor (<a href=\"http://www.nature.com/scitable/topicpage/the-origin-of-mito... | [
{
"answer_id": 16274,
"pm_score": 3,
"text": "<p>I do not have a definitive answer but I can argue that mitochondria came into existence before chloroplasts despite the fact that, between their free living ancestors- $\\alpha$-proteobacterium and Cyanobacteria, the latter seems to be older in evolution.... |
16,287 | <p>Why is it inevitable that evolution by mutations alone should be a common cause of evolutionary change in most natural populations? And do you expect mutation-driven evolution to be more common in typical protists or typical prokaryotes? Why? </p>
| [
{
"answer_id": 16280,
"pm_score": 5,
"text": "<p>Mitochondria evolved before chloroplasts.</p>\n\n<p>We know this because Mitochondria form a monophyletic group: e.g. all life with mitochondria traces back to a single common ancestor (<a href=\"http://www.nature.com/scitable/topicpage/the-origin-of-mito... | [
{
"answer_id": 16274,
"pm_score": 3,
"text": "<p>I do not have a definitive answer but I can argue that mitochondria came into existence before chloroplasts despite the fact that, between their free living ancestors- $\\alpha$-proteobacterium and Cyanobacteria, the latter seems to be older in evolution.... |
16,470 | <p>I have recently been involved in collaborations that require me to model the population genetics of eukaryotic populations. I fear I may either be "re-inventing the wheel" or making conceptual mistakes (e.g. simplifying assumptions) in many of the techniques and decisions so far.</p>
<hr>
<p>I would very much appreciate recommendations of books about population/evolutionary genetics or micro evolution to deal with these fears. Preferable criteria are:</p>
<ol>
<li><p>Intuitively introduces key concepts.</p></li>
<li><p>Emphasis on modelling with examples of problems and their solutions.</p></li>
<li><p>Relatively short (I'm planning to read from cover to cover).</p></li>
</ol>
| [
{
"answer_id": 16474,
"pm_score": 6,
"text": "<p><strong>TL;DR</strong></p>\n<p>I'd recommend <a href=\"https://rads.stackoverflow.com/amzn/click/com/0801880092\" rel=\"nofollow noreferrer\" rel=\"nofollow noreferrer\">Population Genetics: A Concise Guide (Gillespie)</a> for an introduction to populatio... | [
{
"answer_id": 16580,
"pm_score": 4,
"text": "<p>@Remi.b's list is excellent, but it should also include <a href=\"http://rads.stackoverflow.com/amzn/click/0801880092\">Gillespie's Population Genetics: A Concise Guide</a>.</p>\n"
},
{
"answer_id": 20116,
"pm_score": 3,
"text": "<p>Not re... |
16,661 | <p>Just like the title says: Strictly from a biological perspective, what is the functional expectation of a human being. </p>
<p>No religious or philosophy-based answers will be accepted, we are talking biology not religion or philosophy. </p>
<p>Answers involving excessive psychology will be frowned upon unless found to be exceedingly insightful. (The brain is a biological entity)</p>
<p>If you are considering claiming this to be too broad or unanswerable consider the hypothetical question "what are the functional expectations of human feet" which can be answered fairly easily by a child with no formal training in biology. In my actual question I simply ask about the feet and the other parts attached to them.</p>
<p>Edit: Originally this question was titled "Strictly from a biological perspective, what is the purpose of a human existence." To clarify the question i have changed it to "Strictly from a biological perspective, what is the functional expectation of a human being." </p>
<p>Despite the concerns raised with the use of the word "purpose" the question was serving its purpose with the answers I am seeing. I did have some reservations about the word "purpose" as well, but I thought I would try it and see what others thought. </p>
<p>So if a human stomach has the overall functional expectation of mechanically and chemically breaking down and digesting food, what would be the overall functional expectation of a human as a whole? I am looking for not so much of psychologically specific functional expectations and more of physical functional expectations.</p>
<p>For instance a house cat's functional expectations are generally considered to be sleeping, eating, reproducing, socializing, hunting, etc. </p>
| [
{
"answer_id": 16663,
"pm_score": 5,
"text": "<p>I will start with a quote from François Jacob, a French geneticist:</p>\n\n<blockquote>\n <p>The sole ambition of a bacterium is to make two bacteria.</p>\n</blockquote>\n\n<p>The same reasoning can be extended to all life on Earth, including humans.</p>... | [
{
"answer_id": 16664,
"pm_score": 2,
"text": "<p>Purpose requires a sentient being to have intent. There is no biological reason to suppose there is any purposeful intent behind life. </p>\n\n<p>If you hold otherwise, perhaps inquire of the fellow or lady or other you suppose is responsible.</p>\n\n<p... |
17,546 | <p>I've seen some articles which came in contradiction with each other.</p>
<p>The first article was talking about flying dinosaurs, dinosaurs with feathers and so on.</p>
<p>A couple of other articles are talking about misconceptions about dinosaurs one of them being that there are no flying dinosaurs but just flying reptiles (from <a href="http://www.scholastic.com/teachers/article/dinosaurs-flying-reptiles">scholastic.com</a> and <a href="http://www.livescience.com/24071-pterodactyl-pteranodon-flying-dinosaurs.html">livescience.com</a>).</p>
<p>So, which one is right?
Also if possible please provide a source for argument.</p>
<p>I cannot find the first article again.</p>
| [
{
"answer_id": 17549,
"pm_score": 7,
"text": "<p>Birds are both flying dinosaurs <em>and</em> flying reptiles. Yes, that's potentially confusing.</p>\n\n<p>To understand the apparent contradiction, you have to understand how modern classification of organisms works (<a href=\"http://www.ucmp.berkeley.ed... | [
{
"answer_id": 17548,
"pm_score": 3,
"text": "<p>I'm not an expert, but I think that you have to be specific about the flying animals to which you are referring. <a href=\"http://en.wikipedia.org/wiki/Pterosaur\">Pterosaurs</a> are not classed as dinosaurs, whereas modern <a href=\"http://en.wikipedia.o... |
17,940 | <p>In the photosynthesis equation:</p>
<p>$$\ce{6CO2 + 6H2O ->[sunlight] C6H12O6 + 6O2}$$</p>
<p>The only place where we have 6 molecules of $\ce{O2}$ is in $\ce{6CO2}$. Then it reacts with $\ce{6H2O}$ to form $\ce{C6H12O6}$ and $\ce{6O2}$ that apparently comes from $\ce{CO2}$. So why do we say that the $\ce{O2}$ produced by plants comes from $\ce{H2O}$ and not $\ce{CO2}$? I don't know if I'm the one who's understanding something wrong or is it the photosynthesis formula which is wrong?</p>
| [
{
"answer_id": 17942,
"pm_score": 5,
"text": "<p>You are missing some knowledge here for sure, photosynthesis is a little complicated at A level, so I will describe it in brief.</p>\n\n<p>During photosynthesis electrons and protons (A hydrogen atom without the electron) are required for a process called... | [
{
"answer_id": 23861,
"pm_score": 4,
"text": "<p><a href=\"http://en.wikipedia.org/wiki/Photosynthesis\" rel=\"noreferrer\">Photosynthesis</a> uses <a href=\"http://en.wikipedia.org/wiki/Chlorophyll\" rel=\"noreferrer\">chlorophyll</a> (or <a href=\"http://en.wikipedia.org/wiki/Bacteriochlorophyll\" rel... |
19,215 | <p>I have read that epimysium is dense regular connective tissue made covering the a muscle like bicep brachi. at the same time we have fascia that is made of dense regular tissue and covers muscles. so are they same or different how can we describe it and differentiate it?</p>
| [
{
"answer_id": 19218,
"pm_score": 3,
"text": "<p>Epimysium is the specialized fascia located at the muscle. </p>\n\n<blockquote>\n <p>Epimysium is a layer of connective tissue, which ensheaths the entire muscle. It is composed of dense irregular connective tissue. It is continuous with fascia and other... | [
{
"answer_id": 19216,
"pm_score": 1,
"text": "<p>As I understand it epimysium is not only fibrous but also contains more elastic fibres than fascia. As such it is more 'loose' than the 'dense' fascia. It lies immediately on the surface of the muscle (epi = on, mysium = muscle) below the fascia. The dee... |
19,380 | <p>I'm writing a novel and i would like to know some of the equipment and techniques involved with modifying a virus.</p>
<p>Is it feasible for a virus to be engineered to only affect certain people? It doesn't have to be possible, only sound like i know what i'm talking about. I have been trying to research the subject but nothing i have found will tell me the basics of what is involved with virus modification.
Thanks.</p>
| [
{
"answer_id": 19386,
"pm_score": 3,
"text": "<p>Yes, it is possible and probably you won't need many literary artifices to make it work.</p>\n\n<p>Essentially <a href=\"http://en.wikipedia.org/wiki/Virus\" rel=\"nofollow\">viruses</a> are what is technically called \"obligate intracellular parasites\".... | [
{
"answer_id": 19399,
"pm_score": 2,
"text": "<p>Virus is a non-living but infectious structure consisting of a nucleic acid core and envelope covering. The envelope is what determines target specificity. </p>\n\n<p>If you are genetically engineering, lets say a retrovirus (which if you are writing a sc... |
19,429 | <p>In most of the signaling pathways the activated receptor when activates Protein Kinase through the action of secondary messenger, then these protein kinases almost always phosphorylate on the specific Serine, Threonine, or Tyrosine amino acid residues? what is the reason of phosphorylating specifically these amino acid residues. why not other than these amino acid residues are choosen for phosphorylation ? </p>
| [
{
"answer_id": 19432,
"pm_score": 4,
"text": "<p>Phosphorylation requires a nucleophile and hydroxyl oxygen acts like one. Serine, theronine and tyrosine get phosphorylated on the free <strong>OH</strong> group in their side chains. </p>\n\n<p>Nitrogen, in some cases also can act as a nucleophile. In ca... | [
{
"answer_id": 19431,
"pm_score": 2,
"text": "<p>Those residues are phosphorylated because they have a free hydroxyl group available to be bonded to a phosphate. Many other resides can be modified, like acetylation of lysines, but only those residues are chemically compatible with <em>reversible</em> p... |
19,436 | <p>I am working on a project and I'm trying to find data on the position of genes and heterochromatin binding sites such as <a href="http://en.wikipedia.org/wiki/Heterochromatin_protein_1" rel="nofollow">HP1</a> in <em>Drosophila melanogaster.</em> Is this information available for the <a href="http://dgrp.gnets.ncsu.edu/" rel="nofollow">DGRP</a> lines? Would I be able to measure the distance between a gene and its nearest binding site from such data?</p>
| [
{
"answer_id": 19432,
"pm_score": 4,
"text": "<p>Phosphorylation requires a nucleophile and hydroxyl oxygen acts like one. Serine, theronine and tyrosine get phosphorylated on the free <strong>OH</strong> group in their side chains. </p>\n\n<p>Nitrogen, in some cases also can act as a nucleophile. In ca... | [
{
"answer_id": 19431,
"pm_score": 2,
"text": "<p>Those residues are phosphorylated because they have a free hydroxyl group available to be bonded to a phosphate. Many other resides can be modified, like acetylation of lysines, but only those residues are chemically compatible with <em>reversible</em> p... |
19,990 | <p>I am a computer science student, focusing on machine learning applications. I have been always interested in biology but I lack any training in it. Now, I had an idea that I could introduce myself to biology more by buying a microscope, and doing some small (still serious, if possible) experiments.</p>
<p>Now, the problem one I am facing is what kind of microscope should I get? Preferred answer would outline what kind of research is possible to do with such and such microscope, and what is the typical price range for the system.</p>
<p>If there are any safety (e.g. does any of the UV leak from fluorescence microscopes?) or ethical concerns I would like to hear about them too. Thanks!</p>
| [
{
"answer_id": 19991,
"pm_score": 4,
"text": "<p>This really depends on the application you have in mind. As with other precision instruments there is a huge range of qualities and applications. \nIf you just want brigth field illumination and look at relatively big things ( approx 100 microns) then you... | [
{
"answer_id": 19992,
"pm_score": 3,
"text": "<p>I agree with @Jeremias Brand's answer. </p>\n\n<p>Pretty much you will have to forget about fluorescence microscopy... you can probably find some dusty old one on eBay in your price range, but it probably won't be any good.</p>\n\n<p>However, the good new... |
20,177 | <p>I barely know anything about biology and realize that this might be a stupid question, but I'll ask anyway! I know that species "transform" into other species through the process of evolution. Many species around today still co-exist with the species in which they evolved from, right? Actually, is it correct to say that all species coexist with some common ancestor? </p>
<p>Anyway, my question is; if the monkeys that we evolved from are still around today, then where are all the in-between species. Are there still early humans, like Neanderthal's or Hominids or what have you still roaming around some where?</p>
<p>If all early forms of humans are gone, is it because the more modern humans had a greater evolutionary advantage? But wouldn't these less modernized humans have those same advantages over the less evolved monkeys? </p>
| [
{
"answer_id": 20179,
"pm_score": 4,
"text": "<p>This is a common misconception about evolution, many skeptics ask something along the lines of \"If humans evolved from monkeys, why are there still monkeys?\" The answer is that evolution is not a linear process of one species becoming the next species b... | [
{
"answer_id": 20184,
"pm_score": 1,
"text": "<blockquote>\n <p>If all early forms of humans are gone, is it because the more modern\n humans had a greater evolutionary advantage?</p>\n</blockquote>\n\n<p>If you take an environment where species dwell, three things could have happened:</p>\n\n<ul>\n<l... |
20,541 | <p>Fat people have a large amount of calories (energy) stored, but I have noticed all time when they do physical activities they get tired fast in comparison to fit people - why does this happen? </p>
| [
{
"answer_id": 20636,
"pm_score": 5,
"text": "<p>Fatigue on exercise is proportional to unmet demand for oxygen and glucose (sugar/fuel).</p>\n\n<p>In people who are \"fat\":</p>\n\n<ul>\n<li><p>They typically do less exercise. Therefore their cardiovascular system is not conditioned with the heart bein... | [
{
"answer_id": 20544,
"pm_score": 2,
"text": "<p>Fat people have a large amount of body cells which need a large supply of oxygen from the blood.Heart beats at some constant rate and it has some upper limit to which it can supply blood. In fat people the same sized heart and same volume of blood needs t... |
21,200 | <p>When we humans look around, we pan smoothly from one side to the other. Birds on the other hand seem to point their head in one direction for a while, then abruptly point their head in another direction and stay in the new position for a while. Then they continue with the abrupt movement. Why is that?</p>
| [
{
"answer_id": 21202,
"pm_score": 5,
"text": "<p>Most species of birds have 2 foveas, the <strong>temporal fovea</strong> and the <strong>central fovea</strong>. </p>\n\n<blockquote>\n <p>temporal fovea, which is like ours in the sense that it looks straight\n ahead and offers binocular vision (i.e. t... | [
{
"answer_id": 28341,
"pm_score": 4,
"text": "<p>Many birds, especially <a href=\"https://en.wikipedia.org/wiki/Bird_vision#Diurnal_birds_of_prey\" rel=\"nofollow noreferrer\">birds of prey and owls</a>, have eyes that are proportionally much larger than that of similar-size mammals. Most birds are only... |
21,212 | <p>In most popular medical dramas, when a patient has a cardiac arrest and "flatlines" the doctors many times use a defibrillator to "shock the heart back into rhythm'. I know that actually, the proper protocol is CPR and epinephrine (if possible), and that you should shock rhythms such as ventricular fibrillation. But why doesn't shocking the heart in asystole help? </p>
<p>If anyone could please explain, that'd be great.</p>
| [
{
"answer_id": 21213,
"pm_score": 5,
"text": "<p>In layman's terms: an Asystole is not affected by the electric shocks of a defibrillator. A defibrillator is used when the heart goes in fibrillations because it actually CAUSES an asystole. The idea is that you basically reset the heart to a blank state ... | [
{
"answer_id": 21240,
"pm_score": 3,
"text": "<p>The heart has nerve cells which are supposed to fire synchronously. This is what allows the heart to pump effectively. Fibrillation is when nerve cells (or the cardiac cells themselves, which have some \"pacemaker\" activity) are firing asynchronously, wh... |
21,215 | <p>The TL;DR version</p>
<p>Is there a fast way to determine what the cell environment of a particular cell (E.g RBC) is? (in terms of solute/ionic concentration)</p>
<hr>
<p>I'm not sure if the question belongs here, but hear me out. I was doing revision and I kept coming across the line "put the cell in a solution which has the same solute/ionic concentration to prevent the cell from bursting or shrinking"</p>
<p>I get that concept, basically it's sort of replicating the internal environment of the cell with the buffer/solution so that the cell feels "at home." </p>
<p>Then my question is, how does one go about finding out how much exactly for each cell? I would think different cells have different internal environments and I don't believe that scientists actually just have stock solutions of buffers ranging from 0.00001M to 100M and trying every single solution until they find the perfect concentration.</p>
| [
{
"answer_id": 21213,
"pm_score": 5,
"text": "<p>In layman's terms: an Asystole is not affected by the electric shocks of a defibrillator. A defibrillator is used when the heart goes in fibrillations because it actually CAUSES an asystole. The idea is that you basically reset the heart to a blank state ... | [
{
"answer_id": 21240,
"pm_score": 3,
"text": "<p>The heart has nerve cells which are supposed to fire synchronously. This is what allows the heart to pump effectively. Fibrillation is when nerve cells (or the cardiac cells themselves, which have some \"pacemaker\" activity) are firing asynchronously, wh... |
21,533 | <p>If I were to count my father, my grandfather, my great-grandfather, and so on up till, say chimps, or the most common ancestor, or whatever that suits the more accurate answer, how many humans would there have been in my direct lineage?</p>
<p>And would it be almost the same for every human being currently living?</p>
| [
{
"answer_id": 21536,
"pm_score": 6,
"text": "<p>A quick back-of-the-envelope answer to the number of generations that have passed since the estimated human-chimp split would be to divide the the split, approximately 7 million years ago (<a href=\"http://www.pnas.org/content/109/39/15716\" rel=\"norefer... | [
{
"answer_id": 21538,
"pm_score": 2,
"text": "<p>Everyone on earth shares a single most common recent ancestor around 3500 years ago (<a href=\"http://www.nature.com/nature/journal/v431/n7008/abs/nature02842.html\" rel=\"nofollow\">source</a>), and given the vast depth of time between this ancestor and ... |
21,772 | <p>Arthropods have 6 or more limbs and arthropods with 6 limbs appear to move faster than arthropods with 8 limbs so I wonder whether this might have something to do with fast and efficient locomotion. But, this is just a guess. I wonder what the official explanation is, if it exists.</p>
| [
{
"answer_id": 21776,
"pm_score": 7,
"text": "<p><strong>Number of legs in terrestrial vertebrates</strong></p>\n\n<p>Not only do mammals have four legs but actually all terrestrial vertebrates (which include mammals) have four legs. There are slight exceptions though as some lineages have lost their le... | [
{
"answer_id": 21782,
"pm_score": 4,
"text": "<p>I think I might interpret your question as asking, not just why don't mammals have more than four limbs, but why arthropods have more variety. Insects have six, but others have eight, ten, or more.</p>\n\n<p>Partly there are just many more species of art... |
21,986 | <p>I'm trying to think about how two neurons communicate, typically shown in pictures as an electric pulse traveling along a long, thin connective tissue.</p>
<p><em>Is this depiction somewhat accurate, and if so, what happens if both neurons fire at the same time on that connection?</em></p>
<p>Perhaps the connections are one-way, or they can facilitate pulses going in opposite directions at the same time, or perhaps it's something different all-together. It'd be interesting to have this explained, at least vaguely. </p>
| [
{
"answer_id": 21992,
"pm_score": 3,
"text": "<blockquote>\n <p>Are neural connections one-way?</p>\n</blockquote>\n\n<p>Yes. Action potentials travel only from dendrites towards axon.</p>\n\n<blockquote>\n <p>typically shown in pictures as an electric pulse traveling along a long, thin connective tis... | [
{
"answer_id": 21994,
"pm_score": 1,
"text": "<p>First of all, let me clear up a small confusion: a connective tissue is a histological term and isn't relevant to this question :) Check <a href=\"https://en.wikipedia.org/wiki/Connective_tissue\" rel=\"nofollow noreferrer\">https://en.wikipedia.org/wiki/... |
22,005 | <p>I've stumbled upon the article "Telmisartan Treatment of Refractory Proteinuria in a Dog."* What is refractory proteinuria?</p>
<p><sup>
*Bugbee AC1, Coleman AE, Wang A, Woolcock AD, Brown SA. J Vet Intern Med. 2014 Sep 30. doi: 10.1111/jvim.12471. [Epub ahead of print]
</sup></p>
| [
{
"answer_id": 21992,
"pm_score": 3,
"text": "<blockquote>\n <p>Are neural connections one-way?</p>\n</blockquote>\n\n<p>Yes. Action potentials travel only from dendrites towards axon.</p>\n\n<blockquote>\n <p>typically shown in pictures as an electric pulse traveling along a long, thin connective tis... | [
{
"answer_id": 21994,
"pm_score": 1,
"text": "<p>First of all, let me clear up a small confusion: a connective tissue is a histological term and isn't relevant to this question :) Check <a href=\"https://en.wikipedia.org/wiki/Connective_tissue\" rel=\"nofollow noreferrer\">https://en.wikipedia.org/wiki/... |
22,022 | <p>I have a follow-up question about an in-lecture question (this is not a homework question). As you can see I have already answered the question and the question is closed to further submissions. </p>
<p><img src="https://i.stack.imgur.com/A7Yv9.png" alt="enter image description here"></p>
<p>In any case, this is my reasoning. </p>
<p>The male has the genotype Gg and BB. Fur color is incompletely dominant so to have black fur this implies the male has the genotype BB not Bb (which would likely be gray). </p>
<p>The female has genotype Gg and Bb because as the question states, the female is doubly heterozygotic. </p>
<p>The two have a FEMALE offspring - this is critical. This means that the male "donates" a copy of his X chromosome to the offspring. Now if the question had asked about a male offspring, then that would mean the male had donated a copy of his Y chromosome instead, and the male would have no "say" in the male progeny's eye color. </p>
<p>So the probability of green eyes between a cross of Gg with Gg is 3/4. </p>
<p>The probability of black fur between a cross of BB and Bb is 1/2 given that there is incomplete dominance. </p>
<p>So the probability of both events occurring simultaneously is 3/4 * 1/2 = 3/8 = 0.375. </p>
<p>Is this correct? Or should I account for the "female" offspring part and half the answer? </p>
| [
{
"answer_id": 21992,
"pm_score": 3,
"text": "<blockquote>\n <p>Are neural connections one-way?</p>\n</blockquote>\n\n<p>Yes. Action potentials travel only from dendrites towards axon.</p>\n\n<blockquote>\n <p>typically shown in pictures as an electric pulse traveling along a long, thin connective tis... | [
{
"answer_id": 21994,
"pm_score": 1,
"text": "<p>First of all, let me clear up a small confusion: a connective tissue is a histological term and isn't relevant to this question :) Check <a href=\"https://en.wikipedia.org/wiki/Connective_tissue\" rel=\"nofollow noreferrer\">https://en.wikipedia.org/wiki/... |
23,115 | <p>I read the following statement in <a href="http://www.ibtimes.com.au/top-10-factors-why-hiv-vaccine-or-cure-very-difficult-medical-researchers-create-1314253" rel="nofollow">this article</a>: </p>
<blockquote>
<p>Vaccines are designed to protect against invaders that are encountered
rarely - not all the time</p>
</blockquote>
<p><strong>Is it true? If yes, why?</strong></p>
| [
{
"answer_id": 23118,
"pm_score": 4,
"text": "<p>Not true. Vaccines were initially made for the highly contagious diseases that used to cause epidemics (which obviously means they were not <em>rare</em>). </p>\n\n<p>The efficacy of a vaccine depends on multiple factors which includes adaptability of the... | [
{
"answer_id": 23120,
"pm_score": 2,
"text": "<p>The source article had several major errors in it. I wouldn't trust any of it.</p>\n\n<blockquote>\n <p>Vaccines are designed to protect against invaders that are encountered rarely - not all the time.</p>\n</blockquote>\n\n<p>This is one of the major er... |
23,189 | <p>I read the following on <a href="http://en.wikipedia.org/wiki/Advanced_glycation_end-product" rel="nofollow">wikipedia</a>:</p>
<blockquote>
<p>There is, however, no agent known that can break down the most common
AGE, glucosepane, which appears 10 to 1,000 times more common in human
tissue than any other cross-linking AGE.</p>
</blockquote>
<p>(AGEs are related to oxidative stress, aging and chronic diseases.)</p>
<p>I was wondering maybe the article is out of date, and there is a glucosepane cross-link breaker available. Do you know anything of that, or a current research which aims to find that?</p>
| [
{
"answer_id": 27928,
"pm_score": 3,
"text": "<p>Unfortunately at this time, there are no known glucosepane breakers which can feasibly be used in a living organism. There is a small (very small) amount of research being done on the topic by Yale university in cooperation with the SENS foundation, but ... | [
{
"answer_id": 34202,
"pm_score": 1,
"text": "<p>The problem is the glucosepane bond is very strong, hence the molecules which would break this bond need be necessarily toxic and damaging to other molecules in the body. Glucosepane breakers already exist, but they are too toxic, and perhaps all will ne... |
23,273 | <p>From what I know, the main function of red blood cells (RBCs) is hemoglobin transport. So, why do we need cells packed with hemoglobin: why can't it travel freely in the bloodstream? </p>
<p>My own thoughts were: </p>
<p>1) Having hemoglobin packed into cells means it can be released where it's most needed. For example, when we are exercising, our muscles need more oxygen, so more erythrocytes release their oxygen in the muscle tissue. </p>
<p>2) The diameter of a capillary is much bigger than a single protein molecule's diameter, but comparable to a cell's diameter. So, when cells are traveling through a capillary, all of them are close to its walls. However, when free molecules are traveling through it, some of them are close to the walls, while the others are in the "middle". I figured, those in the "middle" can't exchange oxygen with the surrounding tissues. So, red blood cells make gas exchange more effective. </p>
<p>Do you think any of this makes sense? Why in reality do RBCs exist? </p>
<p>Any insight or book recommendations would be very appreciated:) </p>
| [
{
"answer_id": 23278,
"pm_score": 5,
"text": "<blockquote>\n <p>Hemoglobin molecules used to manufacture these products are not\n contained by a red cell membrane, and when released into the\n vasculature, these molecules rapidly scavenge nitric oxide.This can\n result in systemic vasoconstriction, ... | [
{
"answer_id": 23275,
"pm_score": 3,
"text": "<p>This is a well worded question. There are more reasons than the following but the most apparent is hemoglobin production and its transport. The erythrocyte is a cell whose structure is optimal for its function-the production and transport of hemoglobin.</... |
23,693 | <p>The little amount of body hair humans have don't seem to be of much use for keeping warm.
Our Simian cousins on the other hand sport thick furs.</p>
<p>At which point during the species evolution and why did humans lose their fur?</p>
| [
{
"answer_id": 23707,
"pm_score": 6,
"text": "<p>This is an interesting question, and there are a number hypotheses available to explain this phenomenon. The short answer (as far as I can say after my literature search) is that we don't know the answer for sure. The long version follows below.</p>\n\n<p... | [
{
"answer_id": 38952,
"pm_score": 0,
"text": "<p>Surely the simplest explanation is that hair is a \"necessary evil\"; a not terribly good compromise, but the best that evolution could come up with. Hair is very expensive biologically; it requires large amounts of energy both to produce and to maintain,... |
23,725 | <p>I always assumed colds ran on a 'no tagbacks' principle: once it's out of your system, it takes a while before you can get a cold again. Is there any truth to this, or can rhinoviruses hit you at any time?</p>
| [
{
"answer_id": 23743,
"pm_score": 4,
"text": "<p>The short answer is no, there is no minimum time between two colds. The reasons for this are different.</p>\n\n<p>Mostly it has to do with the viruses which cause the common cold. There is a bunch of them causing what we call a cold, including rhinoviruse... | [
{
"answer_id": 23729,
"pm_score": 0,
"text": "<p>Just like that while a cell is infected with a virus, other virus can not enter that cell\nAs long as your body has not fully recovered and did not acquire full health so not be affected by another cold. The experience in cell culture and virus replicatio... |
23,992 | <p>I was just eating a rather rare steak when I started wondering whether eating foods cooked was something I would instinctively want to do if the practice hadn't been taught to me.</p>
<p>So, is cooking food an evolved behavior, inspired by nutritional value or health benefits, or is it a practice learned, and passed down through culture alone?</p>
| [
{
"answer_id": 24609,
"pm_score": 3,
"text": "<p>Cooked food is a learnt trait rather than an evolutionary one. On a certain psychological level its a society norm so you would be hard pressed to find an individual who wouldn't mind eating completely raw meat/steak.</p>\n\n<p>But, say if you chuck a few... | [
{
"answer_id": 98048,
"pm_score": 2,
"text": "<p>Its almost certainly instinctual, humans along with other great apes (any many other animals) show a preference for cooked foods over raw in testing, the number that prefer it increases drastically if they are have sampled cooked foods before. So it is li... |
24,305 | <p>I read on Wikipedia about this: </p>
<p><a href="http://en.wikipedia.org/wiki/King_cobra#Venom" rel="nofollow">King Cobra - Wikipedia</a></p>
<p>In Thailand, a concoction of alcohol and the ground root of turmeric is ingested, which has been clinically shown to create a strong resilience against the venom of the king cobra, and other snakes with neurotoxic venom. </p>
<p>Though, I have been in the village parts of India where King Cobra is frequently encountered, I have never heard of this knowledge.</p>
<p>Can somebody please explain the scientific basis of this statement and possible reasons for this?</p>
<p>[PS]: Can somebody also please create a tag for "Snakes"?</p>
| [
{
"answer_id": 24306,
"pm_score": 3,
"text": "<p>Well, turmerin, the compound in turmeric has been medically proven to help neutralize venom from King Cobras in snakes (<a href=\"http://jcpronline.com/final/098457ck.pdf\" rel=\"nofollow\">reference1</a>, <a href=\"http://www.ncbi.nlm.nih.gov/pubmed/1440... | [
{
"answer_id": 24308,
"pm_score": 2,
"text": "<p>As The Last Word said turmeric is a suggested medicine for cobra bites in India,also Bromelain found in Pineapple and Papain in Papaya fruit are also suggested medicines by folks. Although they are unaware of these chemicals they do use these fruits for v... |
26,120 | <p>I am working on 20% SDS PAGE. I want to know optimum polymerization time for 20% resolving gel and 6% stacking gel. If I increase the time then would it affect the band pattern?</p>
| [
{
"answer_id": 26144,
"pm_score": 3,
"text": "<p>APS and TEMED concentrations matter a lot. Even with that standardized, your polyacrylamide on the shelf is losing reactive groups as we speak. Who know how long it sat in the warehouse? It all adds up to the fact that the minimum required time is practic... | [
{
"answer_id": 26124,
"pm_score": 2,
"text": "<p>The polymerization time is strongly dependent on APS and TEMED concentrations. I do not think that the increased time for polymerization would somehow influence the division of the proteins in negative way. Actually the time varies from 20 min to 1 h, but... |
28,163 | <p>Why scientific names of animals & plants are made difficult to spell & remember? </p>
<p>Mango: it is easy to spell.</p>
<p>Corvus splendens: it is difficult to spell</p>
| [
{
"answer_id": 28166,
"pm_score": 4,
"text": "<p>The reason scientific names are difficult to remember is because the scientific names are given in Latin. There are rules to be followed when naming a organism. That the name must be in the form of <em>Genus species</em> is one of those rules.</p>\n\n<p>F... | [
{
"answer_id": 28201,
"pm_score": 1,
"text": "<p>The question bares a resentment to awkward sounding Latin names. It is unfortunate, since there is surely logic in Latin nomenclature.., but admittedly it is also unfortunately a steep learning curve to learning some Latin. Anyway, having one gold standa... |
28,243 | <p>I'm wondering about a few technicalities of crossover in meiosis. The point of crossover is to create new chromosomes that don't have the same allele combinations as the original two chromosomes. Usually, the chromosomes are cut at the same place on both chromosomes, and each piece is then stitched to that place on the other. This is to avoid unequal recombination, a scenario in which one chromosome has several instances of a gene and the other no instance at all. I'm wondering how the molecular machinery knows where to cut. </p>
<p>So here's my question: How does the molecular machinery choose where to cut a chromosome for recombination?</p>
<p>This question has two parts: At what type of place does it occur (does the machinery choose a completely random place, regardless of where genes start and end, does it just cut at the start of genes, or does it do something else)? Given that it happens at this type of place (e.g. start of a gene), how does it decide that it will cut here (the start of this gene) and not there (the start of that gene)?</p>
| [
{
"answer_id": 28335,
"pm_score": 4,
"text": "<p>The question is very broad and complicated, since the situation may differ in prokaryotes and eukaryotes. Nevertheless, I'm citing a good paper that is closely related to your question:</p>\n\n<blockquote>\n <p>Studies in yeast show that initiation of re... | [
{
"answer_id": 28336,
"pm_score": 3,
"text": "<p>In humans and mice anyway ,a lot of it boils down to the recognition of a specific sequence that marks recombination hotspots by <em>PRDM9</em>.\n<a href=\"http://www.sciencemag.org/content/327/5967/836\" rel=\"nofollow noreferrer\">http://www.sciencemag.... |
30,029 | <p>Based on my understanding from <a href="http://en.wikipedia.org/wiki/Genetic_code#RNA_codon_table" rel="nofollow">wikipedia</a>, there is the (RNA) start codon AUG and the stop codons UAA, UGA, UAG. AUG can also encode Methionine, I'm assuming if it appears in the middle of a mRNA sequence. </p>
<p>But is there a chemical reason there are both start and stop codons? Eg, if I only had a stop codon, would that also imply the next codon was start? Are there cases where there is a stop codon and the next codon isn't start?</p>
| [
{
"answer_id": 30041,
"pm_score": 4,
"text": "<p>Start and stop codons are instructions for the ribosome to start and stop protein synthesis, respectively.</p>\n\n<p>The region between the start and stop codon (inclusive of them) is called ORF (open reading frame) or sometimes CDS (Coding sequence). </p... | [
{
"answer_id": 30030,
"pm_score": 2,
"text": "<p>Not all the RNA is to be translated into proteins. Actually most of it is for regulation and sometimes unknown use. There are non coding regions before the start codon and after the stop codon. Hence the need for both.</p>\n"
},
{
"answer_id": 300... |
30,145 | <p>Almost all of the papers about bioinformatics, I faced with the high-throughput word, but I could not find any explanation about it (I think it is so easy to understand and that's why anyone explains it but I could not do it ) . Is there anyone who can explain me what do they mean by high-throughput ? Thanks in advance. </p>
| [
{
"answer_id": 30146,
"pm_score": 4,
"text": "<p>High-throughput sequencing specifically refers to sequencing techniques like Illumina that allow you to sequence massive amounts of DNA at once (hundreds of thousands of strands), as opposed to older techniques such as cloning the cDNA in plasmids, follow... | [
{
"answer_id": 30149,
"pm_score": 3,
"text": "<p>High-throughput, as indicated by canadianer in their comments refers to amount of data that is processed by the system. Though the answer by CactusWoman would be correct for the case of DNA sequencing, high-throughput is not really confined to that domain... |
30,362 | <p>I live in central Massachusetts, and have begun seeing robins, as we generally do in early March. The temperature is well below normal, though, and three feet of snow are covering the still-frozen ground from which they usually feed. We were expecting them to arrive late, when conditions would seem more conducive to survival. </p>
<p>What triggers their migration process?</p>
| [
{
"answer_id": 30586,
"pm_score": 3,
"text": "<p>I don't know about the specific cues that American robins use for migration. This species is also both a short range (e.g. between states or to lower altitudes) and long range migrant (e.g. Florida & Mexico), so the cues that they use can probably dif... | [
{
"answer_id": 30364,
"pm_score": 2,
"text": "<p>I'm not a specialist in this area, but I would guess that the length of day-light periods compared to night time could be a good trigger. This is quite independent of the weather, is quite constant (even though length of days is known to have changed thro... |
30,600 | <p>I recently noticed that it is hard to focus on blue light sources, especially at night. When observing a blue light source, e.g. a neon sign, it looks somewhat blurry. A sign with a different colour right beside it looks sharp.</p>
<p>I already know about the three kinds of cone cells in the human eye (I'm not a biologist) with their spectral sensitivity peaks in in short (S, 420–440 nm), middle (M, 530–540 nm), and long (L, 560–580 nm) light wavelengths [1]. But does the spectral sensitivity correlate with focus? Or does our eye lens refract blue light in a different way?</p>
<p>When I screw up my eyes looking at a blue light, it becomes less blurry, but then all the other colours are blurred.</p>
<p>[1] <a href="http://en.wikipedia.org/wiki/Cone_cell#/media/File:Cones_SMJ2_E.svg" rel="noreferrer">http://en.wikipedia.org/wiki/Cone_cell#/media/File:Cones_SMJ2_E.svg</a></p>
| [
{
"answer_id": 30602,
"pm_score": 4,
"text": "<p>The same thing happens in photography when you see an image with colorful shadows of objects on it - this is called chromatic aberration. Check <a href=\"http://en.wikipedia.org/wiki/Chromatic_aberration\" rel=\"noreferrer\">this</a> wiki page if you're n... | [
{
"answer_id": 30601,
"pm_score": 2,
"text": "<p>Light is scattered by gas molecules in air. The shorter the wavelength of light, the more it is scattered by the atmosphere. Because it has a shorter wavelength, blue light is scattered ten times more than red light. One reason is that\nblue light has a f... |
30,685 | <p>Is there any situation anatomically, where a human could understand the speech of others perfectly, without any capabilities of speech themselves, but would retain the ability to whistle with a tune?</p>
<p>I was led to believe that the larynx is the most important thing for creating the sounds in speech, however I don't know if a damaged larynx would necessarily <a href="https://biology.stackexchange.com/questions/30598/can-someone-who-cannot-talk-still-whistle">not allow someone to speak</a>.</p>
<p>I would suggest someone who has no tongue cannot speak coherently, however I would imagine that the tongue is instrumental (pardon the pun) in creating a range of sounds whilst whistling.</p>
<p>Is there perhaps a part of the brain that could be affected in order to stop someone speaking? Or would this also mean the person could not understand speech either?</p>
| [
{
"answer_id": 30687,
"pm_score": 3,
"text": "<p><strong>Short answer(s)</strong><br>\nSomeone with a damaged larynx may still speak with the use of a speech aid (electronic larynx). </p>\n\n<p>The ability to understand speech does not necessarily mean one can speak normally. There are neurological diso... | [
{
"answer_id": 30694,
"pm_score": 2,
"text": "<p>Speech is generated by generating a frequency spectrum with the vocal folds, and then filtering it with the upper vocal tract. Whistling is done by blowing air over shaped tongue and lips.</p>\n\n<p>So, give someone a <a href=\"http://en.wikipedia.org/wi... |
30,810 | <p>I'm looking for a good, understandable and simple explanation about protein folding, mechanisms and function, and their relationship with enzymes. </p>
<p>I understand that the protein is a polypeptidic chain, I know its composition, but the part that I really can't figure out is "the folding of proteins", I mean "How a straight polypeptid chain turns into a complex folded structure?"</p>
| [
{
"answer_id": 30814,
"pm_score": 4,
"text": "<p>Okay, so for introduction the 4 levels of protein structure (each level influences the levels after it):</p>\n\n<ul>\n<li>primary (1st): the order of amino acids.</li>\n<li>secondary (2nd): alpha-helicies and beta-sheets</li>\n<li>tertiary (3rd): complex ... | [
{
"answer_id": 30820,
"pm_score": 0,
"text": "<p>All the information can be found here:</p>\n\n<p><a href=\"http://www.ncbi.nlm.nih.gov/books/NBK21054/\" rel=\"nofollow\">http://www.ncbi.nlm.nih.gov/books/NBK21054/</a></p>\n\n<p>The whole book is there, you simply have to search whichever part interests... |
30,883 | <p>So when dietary fats are in the small intestine, they are emulsified by bile salts in order for action by lipases to occur. Lipases degrade the triacylglycerols into monoacylglycerols, diacylglycerols, free fatty acids, and glycerol, and these are taken up by intestinal epithelial cells. Once taken up, these are reformed into triacylglycerols. <br>
My question: why do these have to be broken down in order to be absorbed, and what is the driving force for reformation of triacylglycerols once absorbed?</p>
| [
{
"answer_id": 31020,
"pm_score": 4,
"text": "<p>Your question does not have a clear answer yet, as stated in <em>Metabolic regulation: a human perspective / Keith N. Frayn. – 3rd ed (2010)</em> on page 39.</p>\n\n<blockquote>\n <p>There is still debate about how fatty acids cross cell membranes.</p>\n... | [
{
"answer_id": 31032,
"pm_score": 2,
"text": "<p>I'd like to just add on with some more detail. According to <a href=\"http://advan.physiology.org/content/34/2/44\" rel=\"nofollow\">this</a>, gastric lipase cleaves 15-20% of fatty acids in the stomach. The rest is completed in the duodenum by lipases ... |
31,740 | <p>I am a student of 10th grade, and I eagerly want to learn biology. What is the difference between respiration and breathing?</p>
| [
{
"answer_id": 31759,
"pm_score": 5,
"text": "<p>There are two uses of the term respiration: <a href=\"http://en.m.wikipedia.org/wiki/Respiration_%28physiology%29\" rel=\"nofollow noreferrer\">physiological respiration</a> and <a href=\"http://en.m.wikipedia.org/wiki/Cellular_respiration\" rel=\"nofollo... | [
{
"answer_id": 31743,
"pm_score": 2,
"text": "<p>To my limited knowledge, I believe respiration is the chemical process of the body converting glucose and oxygen into energy, whereas breathing is the physical process of inhaling oxygen and exhaling carbon dioxide. Breathing is somewhat like an \"externa... |
34,066 | <p>I have attempted a few searches for a list of origins of replication for plasmids in <em>E. coli</em>, but I was only able to find a list of origins, but not their individual sequences. The available plasmid maps are often extremely vague on where exactly do the origins start or end, and in any case it would be extremely tedious to collate a list of origins in order to determine the exact origin of replication of a plasmid. </p>
<p>Is there a database of origins of replication available anywhere that would allow one to perform BLAST searches on the plasmid sequence in order to obtain the compatability group of the plasmid, in cases where the plasmid's origin of replication is not specified? </p>
| [
{
"answer_id": 35078,
"pm_score": 3,
"text": "<p><a href=\"http://wishart.biology.ualberta.ca/PlasMapper/\" rel=\"nofollow\">Plasmapper</a> Is quite good a recognizing common origins of replication. You will have to look up compatibility yourself. It is what I usually use when confronted with unnannotat... | [
{
"answer_id": 34142,
"pm_score": 0,
"text": "<p>There must be some such information, because at the lab we are using the SnapGene software, and it is able to recognize the Ori sequences (and all other sequences). Since it is proprietary software, I doubt they would disclose their list, but others might... |
34,620 | <h2>Disclaimer: This question is NOT about challenging the safety or efficacy of vaccines. It is only asking for tips on providing credible references that may show harmful effects of vaccination, if any.</h2>
<p>In my French class, we were asked to debate an issue in current events. My topic is vaccines in children or adults. </p>
<p>The challenging part is that I was assigned to argue <strong>against</strong> vaccination, and I have to back up my arguments with credible sources (not blogs) that are in French. Hopefully some of you could point me towards some links to articles or research papers in French.</p>
<h2>Please avoid discussion on safety and efficacy of vaccines, including local and global policies on their use. I just need help with this topic for my French class</h2>
| [
{
"answer_id": 34621,
"pm_score": 4,
"text": "<p>I wish you good luck, as 99.99% of the anecdotal claims out there that conclude vaccination is bad are based on unfounded rumors. </p>\n\n<p>Note that much of the negative public opinion is based on a fraudulent (and retracted) paper by <a href=\"http://w... | [
{
"answer_id": 34622,
"pm_score": 2,
"text": "<p>The Wakefield study has <a href=\"http://www.nytimes.com/2015/02/02/us/a-discredited-vaccine-studys-continuing-impact-on-public-health.html\" rel=\"nofollow\">collapsed as fraud</a>, and there are no credible sources that make persuasive scientific argume... |
34,889 | <p>Last year I read a course in biology. During that course I learnt that Protozoa like Lamblia intestinalis or Entamoeba hystolitica form <em>cysts</em> in unfavourable conditions.</p>
<p>This year I read a course in microbiology. I learnt that bacteria like Clostridium perfringens or Bacillus anthracis form <em>spores</em> in unfavourable conditions. So far so good. But then I learnt that prokaryotic Borrelia burgdorferi can form a <em>cyst</em>, not a spore.</p>
<p>Firstly, I would highly appreciate any comments that would cast some light on these terms.</p>
<p>Secondly, I would also like to know if the spore inside, say, B.anthracis is the same organism as B.anthracis that produced the spore. Does a spore and the bacteria that produced it have the same DNA sequence? In other words, <strong>if I were a sporeforming bacteria, would my spore be myself, my bodypart or my child?</strong></p>
| [
{
"answer_id": 34898,
"pm_score": 3,
"text": "<p>The bacterial spores you are referring to are called endospores. The spore is formed during unfavorable conditions, by duplication of the bacterial chromosomes, and consequent envelopment by various membranes and protective coatings (while still within th... | [
{
"answer_id": 34923,
"pm_score": 1,
"text": "<p>dd3 summed up the 1st part of your q nicely.....now 'bout the second part...<a href=\"http://en.wikipedia.org/wiki/Bacterial_spore\" rel=\"nofollow\">bacterial spore-s</a> (<strong>not necessarily endospores only...but akinets & spores produced by act... |
35,036 | <p>Is it even possible that plants with non-green leaves have chlorophyll, and do such non-green leaved plants carry out photosynthesis? </p>
| [
{
"answer_id": 35047,
"pm_score": 4,
"text": "<p>Yes, it is possible, but not necessarily the case.</p>\n\n<p><strong>Non-green leaves with chlorophyl</strong>: There are leaves that don't appear green, but do have chlorophyl and therefore can conduct photosynthesis. (See, for instance, <a href=\"https:... | [
{
"answer_id": 35038,
"pm_score": 2,
"text": "<p><a href=\"http://www.nytimes.com/2013/07/23/science/how-does-a-plant-with-red-leaves-support-itself-without-green-chlorophyll.html\" rel=\"nofollow\">They do have chlorophyll</a>, at least in general. There are a couple very rare exceptions, but if it can... |
35,180 | <p>The heart is a vital organ in our body, as it drives blood circulation. I was wondering if a heart keeps beating if it is separated from the body? If yes, then why?</p>
| [
{
"answer_id": 35182,
"pm_score": 6,
"text": "<p><strong>Short version</strong>\nThe heart has the ability to beat independently of the brain as long as it has oxygen. The heart will eventually stop beating as all bodily systems begin to stop working shortly after brain death. Remember the heart can be... | [
{
"answer_id": 35181,
"pm_score": 4,
"text": "<p><a href=\"http://onlinelibrary.wiley.com/store/10.1113/jphysiol.2004.060731/asset/jphysiol.2004.060731.pdf?v=1&t=iauo2601&s=4ebc14d9a457dfba30a37e922efbb5b577b0e188\" rel=\"noreferrer\">Sydney Ringer showed in 1882</a> that when the heart, when se... |
35,851 | <p>Ten years ago, I emailed a prominent lung specialist with my suggestion for a treatment for Tuberculosis. His lack of response led me to believe that the idea had no merit whatsoever – but I had no idea what the failings might be. I still don’t and I’m hoping someone will enlighten me as to why this is not worth exploring.</p>
<p>The idea is based upon the fact that Mycobacterium Tuberculosis is aerobic – in fact Wikipedia states it “requires high levels of oxygen”. I’d heard that the TB “Sanatoriums” used to practice the treatment of breaking ribs on one side to collapse that lung and “rest” it. It seemed to me that this resting was actually starving the bacterium of Oxygen and killing the infestation.</p>
<p>My suggestion is that we take advantage of having two lungs by inserting a pair of breathing tubes into the respiratory tract and into the head of the two bronchi: it may be necessary to use ultrasound or other imaging to accurately position the tubes.</p>
<p>We feed pure Nitrogen into one tube, and 40/60 Oxygen/Nitrogen into the other – double Oxygen concentration. The patient therefore receives all their Oxygen requirements through one lung. After some period of time, when we judge that the bacteria in the “starved” lung are all dead, we switch the supplies to the 2 tubes and treat the other lung.</p>
<p>Can anyone see why this idea is so flawed?</p>
| [
{
"answer_id": 35853,
"pm_score": 6,
"text": "<ul>\n<li>High oxygen concentration can be deleterious; it can induce oxidative\ndamage.</li>\n<li>The systemic blood circulation would supply oxygen to the\n\"oxygen-deprived\" lung.</li>\n<li>Moreover, <em>Mycobacteria</em> <a href=\"http://journals.plos.o... | [
{
"answer_id": 35873,
"pm_score": 2,
"text": "<p>The most evident problem I can see for this TB treatment is that mycobacteria can survive without oxygen. Latent TB (a person is infected but doesn't have active TB) is one of the major problem in the treatment of TB and one-third of the world's populatio... |
36,291 | <p>From Wikipedia:</p>
<p>The Lotka–Volterra equations, also known as the predator–prey equations, are a pair of first-order, non-linear, differential equations frequently used to describe the dynamics of biological systems in which two species interact, one as a predator and the other as prey. The populations change through time according to the pair of equations:</p>
<p>\begin{align}
\frac{dx}{dt} = \alpha x - \beta x y \\
\frac{dy}{dt} = \delta x y - \gamma y
\end{align}</p>
<p><img src="https://i.stack.imgur.com/Ocuoy.png" alt="enter image description here"></p>
<p>This looks very similar to how Insulin and Glucose interact with each other in the body.
<img src="https://i.stack.imgur.com/V3jq2.png" alt="enter image description here"></p>
<p>Glucose uptake release insulin and glucagon offsets the effect of insulin through glycogenesis.</p>
<p>Can the Glucose-Insulin dynamic be described as Lotka Volterra?</p>
| [
{
"answer_id": 36383,
"pm_score": 4,
"text": "<p>Is the standard Lotka-Volterra (LV) model an <em>exact</em> fit for insulin-glucose (IG) dynamics? No. Can a similar model built on the same principles capture most of the essential features of the IG dynamics? <em>Absolutely</em>.</p>\n\n<h1>How to captu... | [
{
"answer_id": 36369,
"pm_score": 2,
"text": "<p>Interpreting your question as \"would the Lotka-Volterra predator-prey model be a good model for the glucose-insulin system?\" my answer is \"no\". The predator-prey equations capture assumptions about how prey and predator interact with each other, and h... |
36,620 | <p>It seems kind of anti-productive in terms of survival for a plant to produce an addictive chemical as that plant will constantly be sought after by animals that ingest it. In this instance, I'm looking for a possible general & inclusive answer here that would describe most plants that make this. Not a specific instance (although if provided as an example would be a plus).</p>
<p>To appreciate the scope of this is terms of number of plants producing potentially addictive compounds - see this compendium:</p>
<p><a href="https://en.m.wikipedia.org/wiki/List_of_psychoactive_plants" rel="noreferrer">compendium of botanicals reported to produce toxic, physchoactive or addictive compounds</a></p>
| [
{
"answer_id": 36624,
"pm_score": 7,
"text": "<p>It's a matter of perspective. Most of the chemicals that are addictive to <em>us humans</em> (particularly alkaloids), and may be addictive for some other animals as well, are also insecticides. Lots of plants that we consider poisonous are good food for ... | [
{
"answer_id": 36625,
"pm_score": 5,
"text": "<p>As someone commented earlier, chemicals such as nicotine and morphine were products of evolution meant to repel animals. It is explained in more details in this article <a href=\"http://rspb.royalsocietypublishing.org/content/275/1640/1231\" rel=\"norefer... |
36,723 | <p>In the book <em>Genetic Entropy & the Mystery of the Genome</em> the author says that the genome cannot be old because the genome is "decaying". Decay is a very subjective term, but in this case he means that the fitness of humans is going down not up. Is it true that our genome is decaying over time, and that the fitness of humans is decreasing? Here is a quote from the book, that might explain his argument: </p>
<blockquote>
<p>Kondrashov, an evolutionist who is an expert on this subject, has advised me that virtually all the human geneticists he knows agree that man is degenerating genetically. The most definitive findings were published in 2010 in the Proceedings of the National Academy of Science by Lynch.4 That paper indicates human fitness is declining at 3–5% per generation.There is really no debate on current human genetic degeneration.</p>
</blockquote>
<p>Perhaps this more shines more enlightenment in my question. This idea of human fitness going "down" is my main concern. Essentially, in his book he claims that because we are going "down" (meaning fitness is declining) not "up" (whatever that means) our genome must therefore be young. If I understand the issue correctly, mutations "create new information" by creating different proteins or leading to an abnormal protein products. However, I thought that the force of natural selection should be strong enough to get a rid of those genes that are so and so responsible for our fitness declining.</p>
<p><a href="http://www.basfeijen.nl/evolution/docs/Genetic%20Entropy%20&%20The%20Mystery%20of%20the%20Genome.pdf" rel="nofollow">Sanford, John C., and John R. Baumgardner. Genetic Entropy & the Mystery of the Genome. Waterloo, NY: FMS Publications, 2008. Print.</a></p>
<p>Feel free to point me to similar questions that may been helpful or are similar to this one.</p>
| [
{
"answer_id": 36731,
"pm_score": 4,
"text": "<p>If I understand the question correctly, you are asking why random mutations (most of the non-silent ones are deleterious) cannot create information and improve the overall fitness of the organism. </p>\n\n<p>This is a common creationist statement, and has... | [
{
"answer_id": 36751,
"pm_score": 2,
"text": "<p><em>A small addition to what March Ho has mentioned in their answer.</em></p>\n\n<hr>\n\n<p><strong>Fitness is not absolute</strong>; it is dependent on the present environment. Fitness has no meaning when the selection factor is not defined.</p>\n\n<p>Yo... |
37,182 | <p>Across from me there is a large flick of Pigeons and Ravens that like to nest on the roof. They swoop and dive and fly all over. Sometimes the whole flock lifts off at once. My question is, how do they avoid running into each other? Certainly they can't see every bird around them, can they?</p>
| [
{
"answer_id": 37185,
"pm_score": 4,
"text": "<p>They can't see all the birds that are around them as some are hidden behind the others. However, I don't think there is anything so extraordinary; they watch around, have good reflexes and can change direction very abruptly. There is no need for some kind... | [
{
"answer_id": 37246,
"pm_score": 2,
"text": "<p>When they are flying together as a flock, they anticipate the flock's behavior and react accordingly. earthsky.org/earth/how-do-flocking-birds-move-in-unison </p>\n\n<p>And when they are just flying around, but not in a flock, the concept is the same as ... |
37,240 | <p>I'm an electronics engineering student and I am going to use a sensor that detects infra-red emitted by birds that invade rice paddies. </p>
<p>Do birds emit infra-red radiation?</p>
| [
{
"answer_id": 37241,
"pm_score": 5,
"text": "<p><strong>Short answer</strong><br>\nBirds emit infrared.</p>\n\n<p><strong>Background</strong><br>\nObjects with a temperature higher than the background emit detectable <a href=\"https://en.wikipedia.org/wiki/Infrared\" rel=\"noreferrer\">infrared</a> (IR... | [
{
"answer_id": 37244,
"pm_score": 2,
"text": "<p>Dinosaurs is a very broad term which includes both the ancestors of birds as well as modern reptiles. But that analogy stretches as far to say that a bird is a modern dinosaur and a reptile is a modern dinosaur but a bird is not a reptile. Both of their a... |
38,627 | <p>I have a plenty of <a href="https://en.wikipedia.org/wiki/FASTQ_format" rel="nofollow">FASTQ files</a> (FASTQ is a standard for storing the output of high-throughput sequencing instruments such as the Illumina Genome Analyzer) and need to convert them to <a href="http://www.ensembl.org/info/website/upload/gff.html" rel="nofollow">GTF</a> format (gtf - file format used to hold information about gene structure which significant feature is that it is validatable: given a sequence and a GTF file, one can check that the format is correct. This significantly reduces problems with the interchange of data between groups).</p>
<p>I assume that (if those formats are popular files' standards) there must exist some software that easily converts information from <code>FASTQ</code> files to <code>GTF</code> file.
Did anyone hear about any such (is possible open-source) software? I am familiar with <code>R statistical package</code> and <code>SAS</code> and can learn <code>Python</code> on a fly.</p>
<p>Thanks for any help.</p>
| [
{
"answer_id": 38638,
"pm_score": 4,
"text": "<p>You should really read about both these file formats. As <a href=\"https://biology.stackexchange.com/a/38628/3340\">swbarnes mentioned</a>, FASTQ and GTF hold different kind of information. <a href=\"http://www.ensembl.org/info/website/upload/gff.html\" r... | [
{
"answer_id": 38628,
"pm_score": 2,
"text": "<p>A fastq contains sequences. A gtf contains coordinates of where features like exons fall in a reference sequence. You can't interconvert them, that makes no sense.</p>\n"
},
{
"answer_id": 38630,
"pm_score": 2,
"text": "<p>Your question ... |
39,626 | <p>Imagine I am preparing food -- just about to put it into a microwave oven -- and some of it falls on the floor. Assuming it got some bacteria or other organisms (viruses?) on it, will the microwave processing disinfect it? What about worm eggs? As I understand, any living organism, given enough exposure to microwaves, degenerates. Is this true?</p>
| [
{
"answer_id": 39653,
"pm_score": 5,
"text": "<p>Microwave ovens can indeed kill bacteria in food by heating them to high temperatures. For example, <a href=\"http://www.scielo.br/scielo.php?pid=S1516-89132005000800010&script=sci_arttext\" rel=\"noreferrer\">this article</a> found that microwave hea... | [
{
"answer_id": 39630,
"pm_score": 2,
"text": "<p>I'm no expert, and this is more of a physics answer rather than biology. The microwaves will not reach all of the food. This is why you get hot and cold spots. The rotating plate mitigates this to some extent, but not all of the food will receive a blast.... |
41,342 | <p>I'm looking at amino acid abbreviations and on every site I visit, asparagine and glutamine have two different abbreviations. Is there a reason for this? Do they represent different forms of the amino acid that may have different properties?</p>
<p>I'm looking at the abbreviations on this site as an example:
<a href="http://www.hgmd.cf.ac.uk/docs/cd_amino.html" rel="nofollow">http://www.hgmd.cf.ac.uk/docs/cd_amino.html</a></p>
<p>On the page, asparagine has an abbreviation of 'N' and an abbreviation of 'B'. The abbreviation 'B' doesn't correspond to a codon so why is it there? </p>
<p>Glutamine also has two abbreviations ('Q' and 'Z'). The abbreviation 'Z' doesn't correspond to a codon either.</p>
| [
{
"answer_id": 41350,
"pm_score": 4,
"text": "<p>The abbreviation Asx (B) is used if it is uncertain whether the amino acid at a given position in a peptide sequence is Asparagine or Aspartate. Similarly, Glx (Z) is used when there is uncertainty between Glutamine / Glutamate. </p>\n\n<p>These two pairs... | [
{
"answer_id": 41344,
"pm_score": 1,
"text": "<p>The reason is simple: These are two different amino acids with different side chains. They look very similar, but they are not:</p>\n\n<p><a href=\"https://i.stack.imgur.com/6vSGR.png\" rel=\"nofollow noreferrer\"><img src=\"https://i.stack.imgur.com/6vSG... |
42,413 | <p>What is the number of ATP molecules formed during the photosynthetic processes which consume 8 molecules of $\text{H}_2\text{O}$ due to noncyclic electron transport and subsequent photophosphorylation?</p>
<p>Assume that quinone cycle facilitates the transfer 4H<sup>+</sup> to the lumen of thylakoid membrane for every two electrons passing through electron transport system and one ATP is formed for every 3H<sup>+</sup> moving down the proton gradient by the mediation of F<sub>0</sub>F<sub>1</sub>-ATPase </p>
<p><strong>MY ATTEMPT</strong>: In the lumen, due to hydrolysis 16 H<sup>+</sup> are formed. Due to quinone cycle 32 H<sup>+</sup> are taken from stroma and transferred to the lumen and NADP<sup>+</sup> takes 48 H<sup>+</sup> so in stroma there is deficiency of 80 and there are only 48 H<sup>+</sup> in the lumen. If I assume that if there were initially hundred H<sup>+</sup> on both sides then after non cyclic transport inside the lumen there are 148 H<sup>+</sup> and in stroma there are 20 H<sup>+</sup> so to have equilibrium then there should be 84 H<sup>+</sup> on both side so total 64 H<sup>+</sup> should travel then I am getting 64/3 ATP which is wrong. <strong>Where I am going wrong?</strong></p>
<p>Screenshot of question paper <a href="https://i.stack.imgur.com/yLwW2.jpg" rel="nofollow noreferrer"><img src="https://i.stack.imgur.com/yLwW2.jpg" alt="enter image description here"></a></p>
| [
{
"answer_id": 43189,
"pm_score": 3,
"text": "<p><a href=\"https://i.stack.imgur.com/Zfjg9.jpg\" rel=\"nofollow noreferrer\"><img src=\"https://i.stack.imgur.com/Zfjg9.jpg\" alt=\"diagram for non-cyclic photophosphorylation from "Pradeep's: A textbook of Biology for Class XI\"></a></p>\n\n<p>So... | [
{
"answer_id": 43199,
"pm_score": 2,
"text": "<p><strong>I think we can look at it like this</strong>\n<a href=\"https://i.stack.imgur.com/v9NNh.jpg\" rel=\"nofollow noreferrer\"><img src=\"https://i.stack.imgur.com/v9NNh.jpg\" alt=\"enter image description here\"></a></p>\n\n<p>Your noncyclic pathway l... |
43,063 | <p>Our body contains many different types of cells and each of those cells have their own DNA (correct me if wrong) like skin cells their own DNA that makes them skin cells instead of muscle cells.</p>
<p>So my question is what DNA does a human pass down in a sperm or egg cell? Is it a specialised DNA imprint from which our whole body can be created? </p>
| [
{
"answer_id": 43071,
"pm_score": 4,
"text": "<p>Most cells in a human body contain a complete set of the genome, which is two sets of 23 chromosomes. Having two of each chromosome is called <a href=\"https://en.m.wikipedia.org/wiki/Ploidy\" rel=\"nofollow noreferrer\"><em>diploidy</em></a>. </p>\n\n<p>... | [
{
"answer_id": 43247,
"pm_score": 0,
"text": "<p>Ideally, DNA itself is the same in DNA-containing cell types. Cell type depends on expression, which depends on epigenetics. I.e. histone modification, DNA methylation, and few other mechanisms.</p>\n\n<p>Also, epigenetics is the mechanism for gene expres... |
43,549 | <blockquote>
<p>Chargaff's rules states that DNA from any cell of all organisms should have a 1:1 ratio (base Pair Rule) of pyrimidine and purine bases and, more specifically, that the amount of guanine is equal to cytosine and the amount of adenine is equal to thymine.</p>
</blockquote>
<p><a href="https://en.wikipedia.org/wiki/Chargaff's_rules#Relative_proportions_.28.25.29_of_bases_in_DNA" rel="nofollow noreferrer"><img src="https://i.stack.imgur.com/qiXKx.png" alt="Statistics of different organism"></a></p>
<p>As in the table $A \ne T$ and $C \ne G$.
So I was wondering if Chargaff's rule is really applicable?</p>
| [
{
"answer_id": 43555,
"pm_score": 5,
"text": "<p>In addition to Remi.b's answer, it should be noted that the phage <a href=\"https://en.wikipedia.org/wiki/Phi_X_174\">Phi X 174</a> is the only organism in your list which significantly deviates from Chargaff's Rule (by more than 1-2 percentage points for... | [
{
"answer_id": 43550,
"pm_score": 3,
"text": "<p><strong>Does Chargaff's rule hold true on these data?</strong></p>\n\n<p>From the table:</p>\n\n<ul>\n<li><p>Ratios A/T and G/C are close to 1 with an extreme at 0.77 and 1.05.</p></li>\n<li><p>Ratios A/G and T/C are quite far away from 1, with several ex... |
43,695 | <p>Crocodiles have supposedly remained unchanged for millions of years, and several other species are considered as <a href="https://en.wikipedia.org/wiki/Living_fossil#Examples">"living fossils"</a>. <strong><em>How do such species remain so constant over time given that they will have had so much time to accumulate new mutations?</em></strong></p>
| [
{
"answer_id": 43696,
"pm_score": 6,
"text": "<p><strong><a href=\"http://evolution.berkeley.edu/evolibrary/article/0_0_0/evo_14\" rel=\"nofollow noreferrer\">Evolution is a process of change by four mechanisms</a>; mutation, migration, drift, and selection.</strong></p>\n\n<p>You are correct in thinkin... | [
{
"answer_id": 43716,
"pm_score": 4,
"text": "<p><a href=\"https://en.wikipedia.org/wiki/Crocodylomorpha\" rel=\"nofollow noreferrer\">Crocodylomorpha</a> were actually once a lot more varied than they are today, so their group isn't immune to change or evolution.\n<a href=\"https://i.stack.imgur.com/dJ... |
44,839 | <p>In the first stage of glycolysis, the two molecules of ATP are broken down into 2 ADPs + 2 Pi through hydrolysis, then in the second stage of glycolysis they are phosphorilazed to obtain 2 ATPs. How can this process happen twice to yield 4 molecules of ATP if we only have 2 ADPs to begin with? </p>
<p>Note: I'm not asking why the process happens twice, since it's easy to see that the Fructose-1,6-biphosphate is being broken down into two Glyceraldehyde phosphate molecules. I'm asking how can the process of producing two ATPs happen twice if we only broke down two ATP molecules into ADP. </p>
| [
{
"answer_id": 44848,
"pm_score": 2,
"text": "<p>There are many other sources of ADP in the cell: various proteins that use ATP as an energy source hydrolyze it to form ADP + phosphate, thereby extracting energy. This ADP can then be re-phosphorylated by glycolysis to form ATP again. If glycolysis did n... | [
{
"answer_id": 50654,
"pm_score": 0,
"text": "<p>It may help if I suggest two ways of looking at the situation.</p>\n\n<ol>\n<li>The first way, which tries to reflect your line of thinking (as I understand it), looks at the situation as two reactions being needed to maintain ADP in the cell. The first r... |
44,930 | <p>From the Scott Freeman textbook Biological Science 4th Edition:
<a href="http://rads.stackoverflow.com/amzn/click/0321598202" rel="nofollow noreferrer">https://www.amazon.com/Biological-Science-4th-Scott-Freeman/dp/0321598202</a>,</p>
<p>Multiple allelism is defined as "the existence of more than two alleles of the same gene within a population." </p>
<p>Polymorphism is defined as "the occurrence of more than two distinct phenotypes of a trait in a population." </p>
<p>I don't really understand the difference - unless it means that two alleles may not result in two different phenotypes?</p>
<p>Additionally, another definition of polymorphism also in the textbook was "the existence of more than one allele at a certain genetic locus." </p>
<p>What does this mean? I was under the impression that all genes had at least two alleles.</p>
| [
{
"answer_id": 45576,
"pm_score": 3,
"text": "<p>The term polymorphism is broad and can have different meanings. Here are your definitions</p>\n<blockquote>\n<p>Multiple Allelism: The existence of more than two alleles of the same gene within a population.</p>\n<p>Polymorphism: the occurrence of more th... | [
{
"answer_id": 54456,
"pm_score": 1,
"text": "<p>This answer refers to polymorphism within genetics (for clarification), which as far as I know is the more common use of the term (but that could just be because I'm a geneticist).</p>\n\n<p>Polymorphism in general refers to genetic variation of traits wi... |
44,946 | <p>I was reading <a href="http://www.nature.com/nrg/journal/v15/n6/full/nrg3734.html" rel="nofollow">Karlsson et al. (2014)</a> and I came into this:</p>
<blockquote>
<p>A selected variant that increases rapidly in frequency in the past ~250,000 years can be detected as an unusual reduction in genetic diversity.</p>
</blockquote>
<p>I realised that I do not know how to infer a specific allele frequency over time <strong>within a given species</strong>.</p>
<p>I tried to googled some keyword but was flooded by other concepts. Could you please direct me to some appropriate documentation/kewords?</p>
| [
{
"answer_id": 45576,
"pm_score": 3,
"text": "<p>The term polymorphism is broad and can have different meanings. Here are your definitions</p>\n<blockquote>\n<p>Multiple Allelism: The existence of more than two alleles of the same gene within a population.</p>\n<p>Polymorphism: the occurrence of more th... | [
{
"answer_id": 54456,
"pm_score": 1,
"text": "<p>This answer refers to polymorphism within genetics (for clarification), which as far as I know is the more common use of the term (but that could just be because I'm a geneticist).</p>\n\n<p>Polymorphism in general refers to genetic variation of traits wi... |
45,275 | <p>I have downloaded human chromosome's data from <a href="ftp://hgdownload.cse.ucsc.edu/goldenPath/hg38/chromosomes/" rel="nofollow noreferrer">UCSC FTP</a>. Some part is in small alphabets and some is in large alphabets. Does it show the coding and non-coding region?</p>
<p>Here is an example from the file I just downloaded:</p>
<pre><code>gagaatcccttgaacccgggaggcggagcttgctgtgagccgagatcgca
ccactgcactccagcctgggtgacagagccagactccgtctcaaaataaa
taaataaataaataaataaaAAAGAAAAAGGTTAATACAACATTAAAGAA
CAAGAATTAATATAGCtttttttttttttttttttttttgagacctagtc
tcactctgttgcccaggctggagggcagtggcatgatctcagctcactgc
aacctccgcctcccgggttcaggcgattctcctgcctcagcctcccgaat
aggtgggattacaggcgtgcaccaccatgcctactttttgtatttttagt
agagacggggtttcactatgttggccaggctggtgtcgaactcttgacct
caagtgatctgcctgccttggcctcccaaagtgctgggatgacaggtgtg
agccactgcacctggccTAATATAGCTTTAATAGAAAAGGAGCTAATACA
AGCTTAGAATAATAAACTTTATGCAGACTTACTGAAACAAACAGTCAATG
CAACCTTAACCAAACAGGAATTGATAACAGTTTAATAAAAAAGCTAATAC
CACTTGAATAGAATATATCTTACTACAACCTTCATAAGAAAAACAACTAA
TAcactttgggagaccgaggcaggcagatcacgaggtcaggagatcgaga
ccatggtgaaaccccgcctctactaaaaatacaaaaaaattagcctggca
</code></pre>
<ul>
<li><p>Second strange thing is to see it beginning with sequence like NNNN. Like here it is:</p>
<p><code>>chrX
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
ctaaccctaaccctaaccctaaccctaaccctaaccctCTGaaagtggac
ctatcagcaggatgtgggtgggagcagattagagaataaaagcagactgc</code></p></li>
</ul>
<p>So the question is two fold:</p>
<ol>
<li>What is the difference between upper and lower case in nucleotide fasta sequences?</li>
<li>What are the repeating <code>N</code> characters denoting?</li>
</ol>
| [
{
"answer_id": 45304,
"pm_score": 4,
"text": "<p>The FTP download files are documented on the UCSC site (from which they also may be downloaded from a web browser). The page for the human genome is <a href=\"http://hgdownload.soe.ucsc.edu/goldenPath/hg38/bigZips/\" rel=\"nofollow noreferrer\">http://hgd... | [
{
"answer_id": 45276,
"pm_score": 2,
"text": "<p>Sequence in caps are usually regions of interest, such as exons. N in the DNA alphabet refers to \"unknown nucleotide\" It can refer to any of A/T/C/G when the actual underlying base is unknown.</p>\n"
},
{
"answer_id": 45277,
"pm_score": 3,
... |
45,502 | <p>Is it possible to feel pain in some part of a body, but that the cause of the pain is situated elsewhere in the body? For example, somebody feels pain in his toe, but it turns out that this pain is not signaled by nerves in his toe, but caused by a damaged nerve in the spinal cord, or somewhere in the brain.</p>
| [
{
"answer_id": 45505,
"pm_score": 5,
"text": "<p>Yes, this is pretty common. Examples include </p>\n\n<ul>\n<li>sciatica, pain felt down the back of a leg to the foot, from irritation to components of the sciatic nerve but commonly at the level of the <a href=\"http://www.spine-health.com/conditions/sp... | [
{
"answer_id": 45503,
"pm_score": 3,
"text": "<p>An example of pain evoked by distant sites in the body is <a href=\"http://www.mayoclinic.org/symptoms/shoulder-pain/basics/definition/sym-20050696\" rel=\"nofollow noreferrer\"><strong>referred pain</strong></a>. It's <a href=\"https://en.wikipedia.org/... |
45,744 | <p>I've been reading through 'The Selfish Gene' by Dawkins. At a few places in the book he states that incest is damaging because it would give a very high chance of lethal recessive genes becoming active due to the high probability of both children having the gene compared to one child and one stranger from the same species.</p>
<p>However, this leaves me with the question why lethal genes would evolve in the first place. The only reason I can think of is that these genes have some secondary purpose and survive natural selection because of that.</p>
<p>Is this simply the entire story or are there things that I'm missing? It seems to me that the having possibility of getting healthy offspring from incest is beneficial to a species, if only because finding a mate would be easier, so those secondary effects would have to be pretty good.</p>
<p>Also I'd be curious if any research has been done which has found examples of side effects of these lethal genes that would make them preferable.</p>
| [
{
"answer_id": 45750,
"pm_score": 5,
"text": "<p>Lethal genes evolve simply because of random deleterious mutations and absence of strong selection. </p>\n\n<p><strong>Recessive lethal genes</strong></p>\n\n<p>Random mutations can make a gene product non-functional or reduce its activity. However, in di... | [
{
"answer_id": 45748,
"pm_score": 2,
"text": "<p>This is just loose terminology. By ‘lethal gene’ Dawkins means an essential gene with a mutation that renders it inactive. With a recessive gene, the one ‘good’ copy in the heterozygote provides enough gene-product to allow survival, in contrast to the si... |
46,265 | <p>In a TV series I've been watching The Last Ship, - <em>spoiler alert</em> - a scientist develops a cure for himself for a virus, but actually continues to remain a carrier, and sort of weaponizes the virus accidentally, killing 3 billion people. In response, another scientist develops a cure for that virus, a vaccine, and eventually makes <em>that</em> contagious by close contact as well, based on data gathered from the lungs of the scientist that infected/vaccinated himself with the weaponized version. </p>
<p>The science behind this might be totally ridiculous, or potentially realistic / possible I don't know. Is this possible? Can a vaccine / cure to a virus be engineered into a contagious version, to cure everyone in a chain reaction?</p>
| [
{
"answer_id": 46270,
"pm_score": 4,
"text": "<p>Fun question!</p>\n\n<p>I think that to make a transmissable (\"contagious\") antiviral vector, you would need to design a virus that can infect people and that codes for something like an antiviral drug compound, which targets specific viral proteins. </... | [
{
"answer_id": 78464,
"pm_score": 0,
"text": "<p>Definitely possible, assuming you have access to sci-fi technology.</p>\n\n<p>Consider a virus specifically rigged to produce epitopes (the immunizer) matching pathogenic infections. It has to survive in its host while causing negligible damage and having... |
46,424 | <p>I own a small lake. Give or take it is about 50 meters wide and 100 meters long (or 160 feet wide, 320 feet long), with a max depth of around 2 meters / 6.5 feet. One third of the lake is surrounded by forest, the rest is grass / small enclaves of tress. The lake absorbes only rainwater from the surrounding residential area. There is a small outlet towards a much larger lake close by. The lake was recently dredge to remove many years of plantlife that had almost turned it into a swamp. </p>
<p>The lake has a large number of mosquitoes. There is also quite many frogs and a few birds that live near the lake. </p>
<p><strong>What can I do to decrease the amount of mosquitoes in the lake?</strong> </p>
<p>For example, can I set up certain nesting boxes that will attract birds or bats that will eat a large number of mosquitoes? </p>
<p>Can I release certain fish that thrive on mosquites?</p>
<p>It is in Scandinavia. </p>
<p>EDIT</p>
<p>The shorelines are sharp and most of the vegatation has recently been removed. The lake was recently completely emptied and about 2 meters (or more) of vegatation and soil was removed. The lake has previously been contaminated which was cleaned away. I guess this means that a very large part of the ecosystem has been removed, a few fish did manage to survive, but not very many. </p>
| [
{
"answer_id": 46429,
"pm_score": 6,
"text": "<p>There are a number of environmentally destructive methods that would be effective, including draining the lake, covering the surface with a continuous layer of oil, or adding toxins to the water, but I'm assuming you're looking for a method that will have... | [
{
"answer_id": 46428,
"pm_score": 3,
"text": "<p>Don't salinate the lake. It'll be a nightmare to maintain.</p>\n\n<p>The 'standard' biocontrol measure is to release 'mosquitofish', but outside their native range they're almost as good at killing native mosquito-eating fish as they are at eating mosquit... |
47,944 | <p>What I mean: does the human cell have 46 of these: </p>
<p><a href="https://i.stack.imgur.com/KXa9S.jpg" rel="noreferrer"><img src="https://i.stack.imgur.com/KXa9S.jpg" alt="Double chromosome"></a></p>
<p>or 46 of these:</p>
<p><a href="https://i.stack.imgur.com/uIqgj.png" rel="noreferrer"><img src="https://i.stack.imgur.com/uIqgj.png" alt="simple chromosome"></a></p>
<p>Thank you in advance.</p>
| [
{
"answer_id": 47970,
"pm_score": 4,
"text": "<p>Your first picture shows a chromosome that has been (1) condensed and (2) undergone DNA replication. During G1 interphase (normal cell activity; not dividing), your chromosomes actually do not look like either of the pictures. They look more like a mass o... | [
{
"answer_id": 47950,
"pm_score": -1,
"text": "<p>Answer: Both are images of chromosomes. Before a cell divides, we have 46 structures of Image 1. After cell division, we have 46 structures of Image 2 in each daughter cell. They are structures of chromosomes at different phases of cell division.</p>\n\n... |
48,179 | <p>I was asked this question in my latest exam. I think the answer is Glycogen because ATP doesn't store energy for a long time so it isn't the ACTUAL storage of energy. Some classmates argue that in muscles there are other substances, not only glycogen, that are used to produce ATP. In the process of contraction ATP is required so, they say, the question needs the answer to be ATP. Could someone please clarify this discrepancy?</p>
| [
{
"answer_id": 48180,
"pm_score": 4,
"text": "<p>This is a typical MCQ which in order to answer you have to have been at somebody’s lectures or be able to read his mind. The antithesis of education! Cells don’t store energy like car batteries. </p>\n\n<p>Glycogen in muscle is a store of carbohydrate. It... | [
{
"answer_id": 48187,
"pm_score": 3,
"text": "<p>If you are only given glycogen and ATP as choices, then glycogen is the correct answer. The reason for this is, that muscle cells need ATP also for other very important processes (such as keeping the membrane potential stable and preventing cramps). Thus,... |
48,900 | <p>I've tallied the number of glands in a plant this year and last year. My full data set has about 20 plants in it (I've reproduced the data from 10 of the plants here). I want to show that the plants this year have had consistently lower gland counts than they did last year, but I don't want to bog readers down with too many data points in their faces. What kind of graph/chart should I use to best show this trend? </p>
<pre><code> Gland Count
PlantID 2015 2016
1 22.92 19.50
2 11.67 7.12
3 19.67 15.33
4 22.33 12.00
5 20.92 18.58
6 25.83 23.83
7 25.67 32.17
8 22.83 17.00
9 28.42 26.25
10 17.92 16.92
</code></pre>
| [
{
"answer_id": 48955,
"pm_score": 3,
"text": "<p>One solution is to plot exactly the data you are trying to describe - the delta in your values.</p>\n\n<p>Consider a bar-plot (with confidence/error bars) showing the plant number along the x-axis and the y-axis showing the change in count with +ve and -v... | [
{
"answer_id": 48903,
"pm_score": 1,
"text": "<p>Ensure that the visualization will not be misleading (if you intend to use visualization to argue in favor of a consistent reduction):</p>\n\n<ul>\n<li>Count the number of plants, where the Gland Count would be lower in 2016 than in 2015 (to ensure that i... |
49,180 | <p>I know all about how the fossil record shows more human-like species coming about over time, and how modern testing proves we have genetic similarities with other animals.</p>
<p>All that says is we have similar genetic blueprints to animals in the past and present. How do we know these similarities are caused by having a common ancestor?</p>
| [
{
"answer_id": 49183,
"pm_score": 6,
"text": "<p>We don't <em>know</em>, and we never will. Science doesn't work that way. But evolution is the simplest hypothesis that is both <a href=\"https://en.wikipedia.org/wiki/Falsifiability\">falsifiable</a> and consistent with <em>lots</em> of experimental data... | [
{
"answer_id": 49193,
"pm_score": 3,
"text": "<p>It is vanishingly unlikely that when DNA sequences which are thousands and thousands of bases long are identical between two creatures, that those sequences have no common origin.</p>\n\n<p>That's like saying, \"Your Honor, I didn't pirate that Justin Bie... |
49,303 | <p>I have watched a talk by Mikko Hypponen (CEO of the security company F-Secure) called <a href="http://sms.cam.ac.uk/media/1649555" rel="nofollow noreferrer">Silicon Plague</a>. There, roughly at minute 51 of the talk, he mentions a computer code that is supposed to be able to infect DNA.</p>
<p>I was googling and found the <a href="http://pastebin.com/9vN1ACMH" rel="nofollow noreferrer">corresponding article</a> posted ~2.5 years, and some <a href="http://pastebin.com/NiQc55rr" rel="nofollow noreferrer">c++ codes</a>. Let me cite:</p>
<pre><code> The computer code, written in C++, hosts the DNA sequence of M.mycoides
JCVI-syn1.0. At runtime it acts as follows:
1) Preparing the DNA sequence of M.mycoides JCVI-syn1.0 in the memory,
(with slightly modified watermarks).
2) Encoding own file-content in base32. The base32 code is then encoded in
JCVI's DNA-encoded alphabet.
3) This representation of its digital form is then copied to a
watermark of the bacteria's genome in memory. With this, a fully
functional bacterial DNA sequence including the digital code is
generated.
4) Next, it searches for FASTA-files on the computer, which are text-based
representations of DNA sequences, commonly used by many DNA sequence
libraries.
5) For each FASTA-file, it replaces the original DNA with the bacterial
DNA containing the digital form of the computer code.
The code has a classical self-replication mechanism as well, to eventually
end up on a computer in a microbiology-laboratory with the ability of
creating DNA out of digital genomes (such as laboratories by the JCVI).
</code></pre>
<p>As far as I understand, the program tries to go into biology-lab computers with genome files, and modify the content with some content of itself. This sounds scary. Unfortunately, I'm not at the level yet where I would understand whether that could work (undergraduate student), so my question is: Does that idea work? Could there really be a computer virus that infects DNA?</p>
| [
{
"answer_id": 49304,
"pm_score": 5,
"text": "<p>As I understand from your post, the computer virus you are talking about is modifying database (FASTA files) in genetics. That would have a pretty bad impact on research in genetics and medicine.</p>\n\n<p>If one uses such a database to synthesize/edit se... | [
{
"answer_id": 49314,
"pm_score": 2,
"text": "<p>This is very silly.</p>\n\n<p>All the computer virus is doing is corrupting a text file in a computer database. </p>\n\n<p>If someone uses the information in the corrupt file to synthesize actual DNA to modify a living organism, the agent is the human. Th... |
50,528 | <p>Today, August 8th, is <a href="http://www.overshootday.org/">Earth Overshoot Day</a> (EOD) for 2016, the day when humanity supposedly has consumed the natural resources available from the planet for the year 2016; we're now running a deficit, somehow. At least if your believe the calculations of the <a href="http://www.footprintnetwork.org/en/index.php/GFN/">Global Footprint Network</a> (GFN), the think tank behind this concept. EOD is well reported by media every year, and perhaps it does some good as an ecology awareness thing. But is the idea scientifically sound?</p>
<p>EOD is based on the <em>ecological footprint</em> concept. The ecological footprint of a person (measured in hectares) is the area of the earth required to extract the natural resources needed to sustain that person: to grow crops, keep farm animals, obtain natural resources for consumables, etc. It's a very complex thing to calculate, and of course people argue about what the correct formula should be. One <a href="https://wattsupwiththat.com/2010/08/26/ecological-footprints-a-good-idea-gone-bad/">article by Willis Eschenbach (2010)</a> goes into some depth and argues that the formula used by GFN vastly overestimates the footprint. I don't know who is right, but it does seem like the footprint is very difficult to estimate, so we should probably be careful with drawing strong conclusions.</p>
<p>But I have a more fundamental problem with EOD. Regardless of how it's calculated, the claim that we have today "overshot" our yearly earth-budget, at 8 months out of 12, means that we are consuming about 1.5 of the available food and natural resources available; or that the footprint of humanity is 1.5 Earths. This is not some kind of parable: GFN really claims that we have <em>exhausted</em> our natural resources, by a wide margin, and that this has been going on since the 1970's.</p>
<p>My question is, <em>what are we all living on then?</em></p>
<p>As of today there should be no more food around, or any other natural-derived product for that matter. If GFNs estimate is correct, shouldn't humanity be long dead? Shouldn't we expect 1/3 of the earth's "surplus" population to die off pretty quickly? Doesn't the fact that we're not dead prove that EOD is wrong? Isn't it physically impossible for our total footprint to exceed 1 Earth?</p>
<hr>
<p><strong>EDIT:</strong> Nice to see that this question stirred a lot of debate! :) I think several answers bring up one key point that resolves the problem: GFN defines the footprint not as the <em>actual</em> area required for production at present (which must be < 1 Earth), but the area required for <em>sustainable</em> production (which is larger). Exactly how the sustainable area is defined is still mysterious to me, but I guess it is at least theoretically possible.</p>
| [
{
"answer_id": 50535,
"pm_score": 6,
"text": "<p><strong>TL;DR: it's a simplified measure of sustainability, but accurate enough to be useful for public engagement</strong> </p>\n\n<p>EOD is hosted and calculated by <a href=\"http://www.footprintnetwork.org/en/index.php/GFN/\">Global Footprint Network</... | [
{
"answer_id": 50531,
"pm_score": 2,
"text": "<p>Technically, an overshoot means the amount by which a certain dynamic variable shoots above its final steady state value. So, to know overshoot, you need to know the steady state. In this case, as you said, the steady state is just predicted and not reall... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.