qid int64 2 112k | question stringlengths 61 6.7k | positives listlengths 1 1 | negatives listlengths 1 10 |
|---|---|---|---|
10,742 | <p><a href="https://en.wikipedia.org/wiki/Kin_selection#Hamilton.27s_rule" rel="nofollow noreferrer">Hamilton's rule</a> states that if $rB>C$ then a gene giving altruistic behaviour will increase in frequency in the population. What would happen if $rB=C$? Will an individual perform the altruistic act?</p>
| [
{
"answer_id": 10756,
"pm_score": 4,
"text": "<p>I agree with @Amory in the sense that Hamilton's rule is not a rule that applies to each specific individual and explain their behavior (or other traits). The Hamilton's rule describe the direction (and not the dynamic) of how a social traits evolve. A so... | [
{
"answer_id": 10751,
"pm_score": 2,
"text": "<p>As far as I understand it, Hamilton's \"rule\" isn't really meant to apply individually, it's meant as a way of thinking about kin selection and altruism that can be reduced to individual cases. The reality is that B and C can rarely, if ever, be easily ... |
10,846 | <p>Do red blood cells have no MHC? (I have often heard that they do not.)</p>
<p>If so why are they not destroyed by immune cells?</p>
| [
{
"answer_id": 10847,
"pm_score": 5,
"text": "<p>They <a href=\"http://pathmicro.med.sc.edu/bowers/mhc.htm\">do not</a>, at least not normally or noticeably. MHC I occurs on all nucleated cells, and red blood cells do not have nuclei. If they did indeed have MHC on them, blood transfusions would be as... | [
{
"answer_id": 24525,
"pm_score": 2,
"text": "<p>There are other histocompatibility antigens on the surface of blood cells, e.g. A, B, Rh, etc... (There are probably a lot more which change less by person to person, so they have lower effect on the outcome of blood transfusion.) These antigens can be re... |
10,901 | <p>If the sole known function of a gene is to activate a transcription factor, would that gene also be considered a transcription factor, or is there a word for such genes that are further upstream on the transcription activation cascade?</p>
| [
{
"answer_id": 10902,
"pm_score": 4,
"text": "<p>Yes. For an example, see <a href=\"http://www.bu.edu/nf-kb/gene-resources/target-genes/\">this list of targets of NF-kB</a> (a transcription factor). Many other transcription factors are included there. As for a TF that does <em>nothing</em> except act... | [
{
"answer_id": 10903,
"pm_score": 3,
"text": "<p>From the <a href=\"http://en.wikipedia.org/wiki/Transcription_factor\">wikipedia</a> article on TFs:</p>\n\n<blockquote>\n <p>In molecular biology and genetics, a transcription factor (sometimes called a sequence-specific DNA-binding factor) is a protein... |
10,923 | <p>I'm currently working on some ribozyme binding, and I'm looking for a tool that will essentially analyze the regions of the degree of complementarity in two sequences in order to extrapolate efficiency of binding. After thinking about it, I'm essentially looking for "the opposite" of BLAST, in that BLAST looks for regions of <em>similarity</em> in sequences in the <em>same</em> orientation, while I'm looking for regions of <em>complementarity</em> in sequence in the <em>opposite</em> orientation. </p>
<p><strong>Does such a tool exist?</strong></p>
<p><strong>EDIT 1</strong></p>
<p>To clarify, I'm looking for a tool that can detect the most optimal regions of complementarity in two sequences when both are aligned as such:</p>
<blockquote>
<p>5' TCGAAUAACTCGTCUGAUGAGUCGCUGAAAUGCGACGAAACCGTTAACGGA 3'</p>
<p>3' GTTTTACGCAAAGCAGCGTAAAGTCGCTGAGTAGTCACTTTAATGAC 5'</p>
</blockquote>
| [
{
"answer_id": 10928,
"pm_score": 3,
"text": "<p>I'm not sure this is what you need since the sequences you posted are not actually complementary as far as I can tell. However, <a href=\"https://www.ebi.ac.uk/~guy/exonerate/\" rel=\"nofollow\"><code>exonerate</code></a> is one of the most powerful tools... | [
{
"answer_id": 10948,
"pm_score": 2,
"text": "<p>You could try using a tool to estimate the binding affinities of the two sequences, i.e. OligoCalc</p>\n\n<p><a href=\"http://www.basic.northwestern.edu/biotools/OligoCalc.html\" rel=\"nofollow\">http://www.basic.northwestern.edu/biotools/OligoCalc.html</... |
10,934 | <p>In <a href="http://www.bbc.co.uk/news/health-24567412" rel="nofollow">this BBC news article</a> a study shows that during sleep brain cells shrink to open up the gaps between neurons and allow fluid to wash the brain clean. But do the cells shrink and undergo the whole procedure during REM sleep and lucid dreaming?</p>
| [
{
"answer_id": 10928,
"pm_score": 3,
"text": "<p>I'm not sure this is what you need since the sequences you posted are not actually complementary as far as I can tell. However, <a href=\"https://www.ebi.ac.uk/~guy/exonerate/\" rel=\"nofollow\"><code>exonerate</code></a> is one of the most powerful tools... | [
{
"answer_id": 10948,
"pm_score": 2,
"text": "<p>You could try using a tool to estimate the binding affinities of the two sequences, i.e. OligoCalc</p>\n\n<p><a href=\"http://www.basic.northwestern.edu/biotools/OligoCalc.html\" rel=\"nofollow\">http://www.basic.northwestern.edu/biotools/OligoCalc.html</... |
11,171 | <p>I heard a point, that all (human) body atoms are recycled withing short period like few years. Recycled means "old" atoms are replaced by "new" ones during metabolism, leaving only structure unchanged.</p>
<p>But this looks contradicting with knowledge about DNA. DNA molecule looks unchanged and the fate of all it's atoms looks known. </p>
<p>Yes I know there are some spontaneous damages which are repaired, but most of DNA atoms remain in place. Even during cell division, 50% of atoms goes to one of the descendant cells. I.e. they don't go outisde body.</p>
<p>So, if the point is wrong concerning DNA atoms, then may it is wrong at all?</p>
| [
{
"answer_id": 11196,
"pm_score": 4,
"text": "<p><a href=\"http://en.wikipedia.org/wiki/Rudolph_Schoenheimer\" rel=\"noreferrer\">Rudolf Shoenheimer</a> and <a href=\"http://en.wikipedia.org/wiki/David_Rittenberg\" rel=\"noreferrer\">David Rittenberg</a> were key figures in introducing the isotopic trac... | [
{
"answer_id": 11179,
"pm_score": 2,
"text": "<p>I think you're right. DNA contradicts the notion of \"total mass turnover.\" So the point is not generally correct. Of course, <em>how</em> incorrect the statement is reflected by the mass ratio of DNA to non-DNA components -- most all of those other comp... |
11,186 | <p>that contracts rapidly, in 10 seconds or less, by .5mm or more, when bombarded by electrons as from a cathode ray tube? or expands? could either be living tissue or dead organic matter. thanks! </p>
| [
{
"answer_id": 11196,
"pm_score": 4,
"text": "<p><a href=\"http://en.wikipedia.org/wiki/Rudolph_Schoenheimer\" rel=\"noreferrer\">Rudolf Shoenheimer</a> and <a href=\"http://en.wikipedia.org/wiki/David_Rittenberg\" rel=\"noreferrer\">David Rittenberg</a> were key figures in introducing the isotopic trac... | [
{
"answer_id": 11179,
"pm_score": 2,
"text": "<p>I think you're right. DNA contradicts the notion of \"total mass turnover.\" So the point is not generally correct. Of course, <em>how</em> incorrect the statement is reflected by the mass ratio of DNA to non-DNA components -- most all of those other comp... |
11,219 | <p>There are lots of questions about how and why there is genetic variation between organisms of the same species, but I haven't been able to find a numerical value for the expected amount of genetic variation.</p>
<p>Let's say we have two different samples of MRSA252. We sequence these samples and get the full genomes of ~3 million base pairs each. What percentage of these bases would we expect to be different (assuming there is no sequencing error)? I figure it will be about 1%, but I haven't been able to find a source.</p>
<p>I'm sure the answer will depend on the specific species, but I'm looking for a ballpark figure for bacteria. An academic source would be much appreciated.</p>
| [
{
"answer_id": 11196,
"pm_score": 4,
"text": "<p><a href=\"http://en.wikipedia.org/wiki/Rudolph_Schoenheimer\" rel=\"noreferrer\">Rudolf Shoenheimer</a> and <a href=\"http://en.wikipedia.org/wiki/David_Rittenberg\" rel=\"noreferrer\">David Rittenberg</a> were key figures in introducing the isotopic trac... | [
{
"answer_id": 11179,
"pm_score": 2,
"text": "<p>I think you're right. DNA contradicts the notion of \"total mass turnover.\" So the point is not generally correct. Of course, <em>how</em> incorrect the statement is reflected by the mass ratio of DNA to non-DNA components -- most all of those other comp... |
11,244 | <p>I'm reading a study (full text <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2695983/" rel="nofollow noreferrer">here</a>) that examine the dynamic of nuclear translocation of a transcription factor in budding yeast, in response of calcium stress. They found that it occurs in bursts, which distribution of durations is plotted on this normalized histogram:</p>
<p><img src="https://i.stack.imgur.com/CKN4k.png" alt="burst duration distribution"></p>
<p>In the text they say:</p>
<blockquote>
<p>Normalized histograms, $h(t)$, of total burst duration at two calcium concentrations are both well-fit by $h(t)=te^{-t/\tau}$, with $\tau$ = 70 sec (black line).</p>
</blockquote>
<p>And also</p>
<blockquote>
<p>This distribution was consistent with two rate-limiting stochastic steps, each with a timescale of ~70 sec.</p>
</blockquote>
<p>Can someone explain me the second sentence cited?</p>
| [
{
"answer_id": 11307,
"pm_score": 3,
"text": "<p>WYSIWYG is almost there, but you need one more piece of information to make this explicit. </p>\n\n<p>The distribution cited in the paper is $h(t)\\propto te^{-t/\\tau}$ (we're going to ignore normalizing constants today). We can recognize this as a parti... | [
{
"answer_id": 11299,
"pm_score": 1,
"text": "<p>Well.. First assume the chemical reactions to be a <a href=\"http://en.wikipedia.org/wiki/Poisson_process\" rel=\"nofollow\">Poisson's process</a> (which is a right stochastic approximation for processes such as chemical reactions and radioactive decay et... |
11,263 | <p>There are a bunch of <a href="https://en.wikipedia.org/wiki/List_of_sequence_alignment_software" rel="noreferrer">different alignment tools out there</a>, and I don't want to get bogged down in the maths behind them as this not only between software but varies from software version to version.</p>
<p>There are two main divides in the programs; some use local alignments and others use global alignments. My question is threefold:</p>
<ul>
<li>What are the fundamental differences between the two?</li>
<li>What are the advantages and disadvantages of each?</li>
<li>When should one use either a global or local sequence alignment?</li>
</ul>
| [
{
"answer_id": 11280,
"pm_score": 6,
"text": "<p>The very basic difference between a local and a global alignments is that in a local alignment, you try to match your query with a substring (a portion) of your subject (reference). Whereas in a global alignment you perform an end to end alignment with th... | [
{
"answer_id": 11271,
"pm_score": 3,
"text": "<p>Global alignment is when you take the entirety of both sequences into consideration when finding alignments, whereas in local you may only take a small portion into account. This sounds confusing so here an example:</p>\n\n<p>Let's say you have a large re... |
11,286 | <p>Why is ATP the most prevalent form of chemical energy storage and utilization in most cells?</p>
| [
{
"answer_id": 14044,
"pm_score": 6,
"text": "<p>I really like this question as it is such a fundamental underpinning of all life on the planet, yet there is such sparsity of actual information on its origins and why selection rewarded ATP use over anything else. Here I am talking generally since no spe... | [
{
"answer_id": 50928,
"pm_score": 4,
"text": "<p>I don’t like this sort of question because I don’t think it can really be answered and I’m very suspicious of arguments that seem to claim ATP is the only or even the best solution to the problem. Nature generally demonstrates that there is more than one ... |
11,291 | <p>I read in Campbell that </p>
<blockquote>
<p>....splicing and poly A tail addition may also occur while transcription is still under way.</p>
</blockquote>
<p>How can the poly(A) tail be added while transcription is still going on?</p>
| [
{
"answer_id": 14044,
"pm_score": 6,
"text": "<p>I really like this question as it is such a fundamental underpinning of all life on the planet, yet there is such sparsity of actual information on its origins and why selection rewarded ATP use over anything else. Here I am talking generally since no spe... | [
{
"answer_id": 50928,
"pm_score": 4,
"text": "<p>I don’t like this sort of question because I don’t think it can really be answered and I’m very suspicious of arguments that seem to claim ATP is the only or even the best solution to the problem. Nature generally demonstrates that there is more than one ... |
13,455 | <p>I know that salt is used as preservative as it dehydrates microbes. Is there any other advantage like - altering pH or inactivating microbial enzymes ?</p>
| [
{
"answer_id": 13458,
"pm_score": 3,
"text": "<p>High salt environments are strongly hypertonic and disrupt the osmotic gradients of cells. Excess salt gets forced in (disrupting function) and cell water gets drawn out. </p>\n\n<p>In simpler terms, it dehydrates them.</p>\n\n<p>This link has more info... | [
{
"answer_id": 20159,
"pm_score": 2,
"text": "<p>Another factor involved is the effect that high salt concentrations have on the 3-D structure of proteins. At higher than \"normal\" concentrations of salt, many proteins will fold differently and no longer be in their \"active\" form. Since all biologica... |
13,486 | <p>I am always so confused whether to do a chi square test or a t test in the sums given by my biostats teacher. Does anyone have a simple rule to decide this?</p>
| [
{
"answer_id": 13491,
"pm_score": 6,
"text": "<p>This is a very subtle question and I encourage you to read the Wikipedia articles on these different subjects (t-test, chi-squared test, p-value, etc) because the authors worked hard to combat common misconceptions about these commonly used statistical te... | [
{
"answer_id": 13497,
"pm_score": 3,
"text": "<p><strong>Additional Info</strong></p>\n\n<p><em><strong>T-test</em></strong></p>\n\n<p>As A.Kennard said t-test is applied when the random variable is normally distributed. How to know what is normally distributed is a relevant question. Regular measures w... |
13,489 | <p>Which of the following methods would yield the most purified protein fraction?</p>
<p>A. Salt precipitation</p>
<p>B. Charge separation</p>
<p>C. Affinity purification</p>
<p>The first one is the most commonly used, is it the best ?</p>
| [
{
"answer_id": 13492,
"pm_score": 3,
"text": "<p>The choice of strategy for protein purification of course varies by application. As @A.Kennart points out, affinity chromatography is the most popular right now. It can be expensive. If you have an expression system for a recombinant protein its more c... | [
{
"answer_id": 13490,
"pm_score": 2,
"text": "<p>In my protein purification experience, affinity purification is the most selective purification strategy. This makes sense because affinity tends to be very specific, and only one protein should in theory be preferentially separated by the column. Think h... |
13,641 | <p>What does "Niche Complementarity" mean?</p>
<hr>
<p>On <a href="http://www.encyclo.co.uk/define/Niche%20complementarity" rel="nofollow noreferrer">this</a> website they define "Niche Complementarity" as:</p>
<blockquote>
<p>The tendency for coexisting species which occupy a similar position along one niche dimension</p>
</blockquote>
<p>I don't quite understand this definition. The tendency to do what?</p>
<hr>
<p>Notes:</p>
<ul>
<li><p>I know what is an ecological niche and therefore what is a niche dimension. There is no need to define this.</p></li>
<li><p>I am particularly interested in the use of this concept in speciation and adaptive radiation.</p></li>
</ul>
| [
{
"answer_id": 13644,
"pm_score": 2,
"text": "<p>As it has been said by @A.kennard in the comments, the definition the OP found is not complete. The full definition on the link he gave (<a href=\"http://www.encyclo.co.uk/meaning-of-Niche%20complementarity\" rel=\"nofollow noreferrer\">here</a>) is:</p>\... | [
{
"answer_id": 14338,
"pm_score": 2,
"text": "<p>There is a really good discussion of this in <a href=\"http://www.nature.com/nature/journal/v456/n7219/full/nature07248.html\" rel=\"nofollow\">Chesson & Kuang</a> <em>Nature</em> 2008, they propose a way to measure niche complementarity accounting fo... |
13,690 | <p><a href="https://en.wikipedia.org/wiki/Calico_cat" rel="nofollow noreferrer">Calico cats</a> are cats that have 3 fur colors and are always female or males two X chromosomes.</p>
<p>I've seen many cats that will have 2 fur colors (one of them is usually white) and another, third, color which is a darker shade of one of the other colors. As exampled in the pictures below (taken from the internet). Are those considered Calico cats?</p>
<p><a href="https://i.stack.imgur.com/V01Sk.jpg" rel="nofollow noreferrer"><img src="https://i.stack.imgur.com/V01Sk.jpg" alt="pic of cat 1" /></a><br />
<sub>(source: <a href="http://i3.mirror.co.uk/incoming/article1381837.ece/ALTERNATES/s615/%C2%A3%C2%A3%C2%A3%20Larry%20the%20Downing%20street%20cat%20fights%20with%20the%20George%20Osborne%20cat%20Freya-1381837" rel="nofollow noreferrer">mirror.co.uk</a>)</sub></p>
<p><img src="https://pressdispensary.co.uk/q991467/images/cat-image-for-press.jpg" alt="pic of cat 2" /></p>
| [
{
"answer_id": 30015,
"pm_score": 4,
"text": "<p>I think you are misunderstanding \"color\" here. When applied to cats, it doesn't literally mean a color shade as used in color theory, but \"coat color\" which can in fact also be a \"coat pattern\". </p>\n\n<p>The cats above are two-colored, not three-c... | [
{
"answer_id": 13772,
"pm_score": 2,
"text": "<p>Tortoiseshell cats (which is the normal name for Calico style cats in Europe) arise due to a gene on the X chromosome. Some patches are ginger, and some tabby due to the deactivation of one X chromosome in each cell at an early stage of development. This ... |
13,700 | <p>I'd like to be able to measure the activity of $\beta$-galactosidase in living cells with simple optical (maybe fluorescence) microscopy. Ideally I'd like to do a minimum of genetic engineering, and use this assay with strains I already have (that have a WT lactose system), i.e. a fluorescent lactose-mimic would be ideal. Additionally, it would be nice if the lifetime of the fluorescent byproduct of $\beta$-gal activity was short, so I could detect a decrease in $\beta$-gal activity as well as an increase. Does such a fluorescent analog exist? I'm hoping to look at the switch from lactose to glucose utilization under the microscope, so I want lactose-using cells to light up and glucose-using cells to be dark, or vice versa. It does not have to be fully quantitative--a qualitative sense is fine. </p>
| [
{
"answer_id": 13736,
"pm_score": 1,
"text": "<p>Here is a <a href=\"http://www.lifetechnologies.com/us/en/home/references/molecular-probes-the-handbook/enzyme-substrates/detecting-glycosidases.html\" rel=\"nofollow\">link</a> to on the Invitrogen/Life Technologies webpage detailing various probes to de... | [
{
"answer_id": 13702,
"pm_score": 1,
"text": "<p>I found <a href=\"http://www.ncbi.nlm.nih.gov/pubmed/19689207\" rel=\"nofollow noreferrer\">this paper</a>.</p>\n<blockquote>\n<p>Zhang GJ <em>et al</em>. (2009) <em>In vivo</em> optical imaging of LacZ expression using lacZ transgenic mice. Assay Drug De... |
13,743 | <p>Why do we need deep sequencing? Why cannot the sequencing technologies read all the nucleotides correctly at the first read? Sorry since this question is too trivial, I don't have a biological background at all, and I have just started doing research in CompBio. Thanks.</p>
| [
{
"answer_id": 13748,
"pm_score": 4,
"text": "<p><strong>Short Answer</strong></p>\n\n<p>In a nutshell, DNA sequencing technology has a limit to how long a stretch of DNA it can read in <em>one go</em>.</p>\n\n<p><strong>Long Answer</strong></p>\n\n<p>So what most commonly occurs is the length of DNA yo... | [
{
"answer_id": 13821,
"pm_score": 1,
"text": "<p>Another important point is that we almost always sequence a population of cells, not just a single cell. Cancer cell populations, for example, can have multiple sub-populations of cells with different genetics (subclones). Deep read sequencing allows us t... |
13,746 | <p>It is tragic, but apparently Killer whales and Dolphins can commit suicide too (e.g. <a href="http://orcaed.wordpress.com/tag/suicide-in-killer-whales/">here</a>)... </p>
<p>This suggests they can become depressed. I wondered whether they were "clinically" depressed like many people are, and what other mental illnesses have been observed in animals in general. </p>
<p><strong>Questions</strong></p>
<ul>
<li>Which mental disorders have been observed in animals? Which animals?</li>
<li>What is the prevalence of these mental disorders in those animals?</li>
<li>Are the causes and treatments of these disorders similar to Humans?</li>
</ul>
<p><strong>Strange thought</strong></p>
<p>Organisms that have not evolved the ability to make "conscious choices" cannot decide to end their life.</p>
| [
{
"answer_id": 13759,
"pm_score": 4,
"text": "<p>You will be hard-pressed to find any scientific data on this question. Psychology in humans is already a difficult study, at times failing to demonstrate results with real scientific rigor. When studying animal psychology, you face another substantial bar... | [
{
"answer_id": 13760,
"pm_score": 0,
"text": "<p>Good question: We know that prion diseases affect the psychology of animals (Scrapie, Mad Cow). But without a doubt genetic regulation of endocrine and neurotransmitter pathways is subject to the same folly as in <em>Homo sapiens</em>. Sorry I can't suppo... |
13,808 | <p>I was recently reading about colinearity in the HOX genes that give an organism its high-level body plan (where the order of the HOX genes on the chromosome follow the head-to-tail order of body segments, such that the head gene comes before the thorax gene, comes before the abdomen gene, etc).</p>
<p>I'm really just a layman interested in this stuff (only completed A & P I), but I was under the impression that the location of genes on a chromosome has no bearing on the expression of those genes or phenotype of the organism -- in other words, that genes can be anywhere on any chromosome.</p>
<p>Do we understand how the order of the HOX genes ends up being expressed as the order of the body segments? Do we know why the positioning of these genes matters when the order of other genes don't?</p>
| [
{
"answer_id": 13940,
"pm_score": 3,
"text": "<p>You might be interested in <a href=\"http://books.google.ch/books?hl=fr&lr=&id=fMTjQCVrsloC&oi=fnd&pg=PA113&dq=Chromatin+architectures+and+Hox+gene+collinearity.&ots=wvuDC8hVc7&sig=rzSkeNbLXzNoYXKRbh2n-8YUoU8&redir_esc=y#v=... | [
{
"answer_id": 13930,
"pm_score": 2,
"text": "<p>Quoting from some parts of <a href=\"http://en.wikipedia.org/wiki/Sean_B._Carroll\" rel=\"nofollow\">Sean Carroll</a>'s book - <a href=\"http://rads.stackoverflow.com/amzn/click/0393327795\" rel=\"nofollow\">Endless forms most beautiful</a>, I have tried ... |
13,819 | <p>Today a colleague of mine asked the following question:</p>
<blockquote>
<p>" Assuming I need to build from 0, a chromosome of a fish, with short reads
but no other reference whatsoever <strong>[de novo assembly]</strong>:</p>
<ul>
<li>how much work is that?</li>
<li>Is there a generic software (like SAMtools) that will align the reads in a
scaffold one can use?</li>
<li>Basically, given a reasonably clear pipeline in terms of software, is it still blood sweat and tears or is it just a matter of getting it on a cluster?"</li>
</ul>
</blockquote>
<p>Very grateful for any suggestions, sources of information, software etc.</p>
| [
{
"answer_id": 13948,
"pm_score": 3,
"text": "<p>If you only want to use only sequencing techniques, you have a problem.</p>\n\n<p>To get a feeling of what kind of results to expect, consider <a href=\"http://www.nature.com/ng/journal/vaop/ncurrent/full/ng.2835.html\" rel=\"nofollow\">this</a> paper pub... | [
{
"answer_id": 13923,
"pm_score": 2,
"text": "<p>You can try looking around biostars.org, which is like stackexchange, but for bioinformatics. </p>\n\n<p>Velvet is one example of a de novo assembler. </p>\n\n<p>But 30 bp is really short, and animals have big genomes (not as tough as lots of plants and... |
13,834 | <p>The title pretty much says it all. It is widely taught that a gene in a eukaryotic system could produce more than one protein due to post-transcriptional modification, but I do not believe I have come across any specific examples of this. Are any such systems known? Or is this more theoretical? </p>
| [
{
"answer_id": 13840,
"pm_score": 4,
"text": "<p>The answer is not simple - @shigeta mentioned a few mechanisms leading to single gene-to-multi protein relationships - and the answer is certainly not short (there are thousands of these genes).</p>\n\n<p>But anyway \"alternative splicing\" seems to be th... | [
{
"answer_id": 13835,
"pm_score": 3,
"text": "<p>There are a large number of ways a protein variant can be produced by post translational modification. The question may seem obvious, but its really quite broad. </p>\n\n<p>I can start this out. I doubt I know all the ways a single transcript can produc... |
13,841 | <p>When the telomerase enzyme is not active the telomere shortens every time the cell duplicates leading to a reproductive limit (<a href="http://en.wikipedia.org/wiki/Hayflick_limit" rel="nofollow">Hayflicks limit</a>).
On one hand this is a believed reason for aging. On the other hand this makes a mutated cell more difficult to acquire cancer, since in order to become cancerous, it would need to mutate such that the telomere enzyme becomes active. </p>
<p>The telomere enzyme is not active in most human cells.
Therefore activating the telomerase enzyme in somatic (body) cells could theoretically decrease aging but would also increase the risk of cancer.</p>
<p>Am I right to assume that in order to avoid aging of humans one would first need to "solve cancer"?</p>
| [
{
"answer_id": 13844,
"pm_score": 4,
"text": "<p>Interesting question. My answer is no, but it requires a rather science-fiction style answer - at least it's beyond current technology, but here goes:</p>\n\n<p><strong>My Assumptions</strong></p>\n\n<p>I make the simplifying assumption that ageing is onl... | [
{
"answer_id": 15244,
"pm_score": 2,
"text": "<p>In short, yes.</p>\n\n<p>The best way to think about ageing is as an accumulation of age-related disorders. Telomere loss is one of many cellular defects that accumulate with age. Other defects include oxidative stress, accumulation of amyloid proteins an... |
13,858 | <p>Orbital frontal cortex is where decisions are made.</p>
<p>What does the word orbital there mean?</p>
<p>I looked around in wikipedia and never find it.</p>
| [
{
"answer_id": 13861,
"pm_score": 4,
"text": "<p><strong>Orbitofrontal cortex</strong>: the area of the cerebral cortex located at the base of the frontal lobes above the <em>orbits</em> (or eye sockets), involved especially in social and emotional behaviour.</p>\n"
}
] | [
{
"answer_id": 13859,
"pm_score": 0,
"text": "<p>Quick search on <a href=\"http://www.etymonline.com/\" rel=\"nofollow noreferrer\">etymonline</a> for <a href=\"http://www.etymonline.com/index.php?allowed_in_frame=0&search=orbital&searchmode=none\" rel=\"nofollow noreferrer\">Orbital</a>:</p>\n<... |
13,867 | <p>I know that species have been classified on basis of reproduction , DNA similarity , niche, etc.</p>
<p><strong>Has there been a classification based on locus of genes ?</strong> What are the drawbacks/shortcomings of classifying this way ?</p>
<p>Isn't it simple to classify on this basis as - a species can have variation at a locus but the position of that locus with respect to a chromosome is fixed in every individual of that species. This fact can eliminate the subjective criteria of DNA similarity.</p>
<p>But I think this isn't valid for bacteria as there is so much recombination going on. </p>
| [
{
"answer_id": 16997,
"pm_score": 3,
"text": "<p>The position of a gene is not always fixed neither within nor between species. There are <a href=\"http://en.wikipedia.org/wiki/Copy-number_variation\" rel=\"nofollow noreferrer\">Copy Number Variation</a> for example. A great part of the variation within... | [
{
"answer_id": 17420,
"pm_score": 1,
"text": "<p>As Remi points out you are generally incorrect but the locality idea is specifically ok. The positions and types of mutations and divergence for specialization in certain genes regardless of their place in the genome is key in determining homology which i... |
13,941 | <p>I understand that one can translate a nucleotide sequence and run PSI-BLAST on the protein (proteins if you take the 6 reading frames), but I'm looking for distant homology for bacterial small RNAs (typically 50-200 nucleotides long and noncoding).</p>
<p>If there is no such resource, what are the main obstacles to this implementation?</p>
| [
{
"answer_id": 13984,
"pm_score": 3,
"text": "<p>First check if your RNA sequences are described by existing covariance models (CMs) available in <a href=\"http://rfam.sanger.ac.uk/\" rel=\"nofollow\">Rfam</a>. You can do this using the <a href=\"http://infernal.janelia.org/\" rel=\"nofollow\">Infernal ... | [
{
"answer_id": 13943,
"pm_score": 2,
"text": "<p>Assuming you are using PSI-BLAST to recruit coding homologous nucleotide sequences to your query nucleotide sequence.</p>\n\n<p>Here's a work-around using PSI-BLAST itself: </p>\n\n<ol>\n<li>Translate your nucleotide sequence into amino acid sequence </li... |
13,964 | <p>Is it possible to spray stem cells on fully grown skeleton to get fully grown humans?</p>
<p>Currently, just read about recent advances, and wondered if something like this is possible.</p>
| [
{
"answer_id": 13965,
"pm_score": 3,
"text": "<p>No.</p>\n\n<p>Very early in the development of an organism, it is just a clump of cells. Then those cells communicate, and determine where they are in the clump, which determines their eventual fate in the full organism. In mammals, for instance, cells ... | [
{
"answer_id": 13969,
"pm_score": 2,
"text": "<p>A skeleton is itself very complicated. It's not just apatite in the shape of a skeleton. The bones have structure, and many have bone marrow. Tiny cells navigate through the bone matrix, keeping it sound. Those cells, and the ones in the marrow, need ... |
13,998 | <p>Can any foreign molecule be non- antigenic ? Can any foreign peptide be non-antigenic ? What is the difference between an antigenic and a non-antigenic peptide ?</p>
| [
{
"answer_id": 16427,
"pm_score": 2,
"text": "<p>Molecules are antigenic if they are able to elicit an immune response. Let's incorrectly equate \"antigenic\" with \"elicits antibody response\". It's conceivable that a molecule might elicit an immune response, but not generate antibodies - this nuance i... | [
{
"answer_id": 14004,
"pm_score": 2,
"text": "<p>Something is antigenic because it acts as an <a href=\"http://en.wikipedia.org/wiki/Antigen\" rel=\"nofollow\">antigen</a> - it binds to an antigen receptor in the immune system (antibody, B-cell receptor, T-cell receptor, etc.). While the concept of \"fo... |
14,000 | <p>I read in Bruce Alberts Molecular Biology of the cell :</p>
<blockquote>
<p>Normal mice,for example, cannot make an immune response against one of their own protein components of the complement system called C5.
Mutant mice, however, lack the gene encoding C5(but are otherwise
genetically identical to the normal mice) can make a strong immune
response to this blood protein when immunized with it. Natural
immunological tolerance for a particular self molecule persists only
for as long the molecule remains present in the body. If a self
molecule such as C5 is removed, an animal gains the ability to respond
to it after a few weeks or months. Thus, the immune system is
genetically capable of responding to self molecules but learns not to
do so.</p>
</blockquote>
<p>So, why does an immune reaction not happen when a new protein is introduced to patients lacking it ? For example if you give clotting factor to hemophilic patient.</p>
| [
{
"answer_id": 14016,
"pm_score": 3,
"text": "<p>They actually can produce antibodies against the clotting factor (as @Xylo pointed out, many patients do produce the clotting factor that's being replaced, just in insufficient quantity, which lowers a lot the risk of an immune response). The antibodies a... | [
{
"answer_id": 14002,
"pm_score": 2,
"text": "<p>This is a concept of the immune system called \"Immune tolerance\". Basically it makes sure, that you cannot make antibodies against yourself (which would obviously be bad).\nNew antibodies are \"tested\" against the body and if there is an autoreactivity... |
14,062 | <p>What would happen if the phospholipids in the phospholipid bi-layer were reversed, the fatty acid tails now facing outwards and the phosphate heads facing inwards? I'm assuming this will not affect the protein channels, but perhaps the loss of cholesterol in the structure of the bi-layer. Would this then mean that the fluid mosaic model no longer holds? </p>
| [
{
"answer_id": 14066,
"pm_score": 4,
"text": "<p>This would have quite dramatic consequences. The layers are ordered in the way they are, because of their polarity. In the way they are ordered, the hydrophobic tails are inside and directed towards each other, the hydrophilic heads are orientated to the ... | [
{
"answer_id": 14071,
"pm_score": 0,
"text": "<p>If the layer is opposite,then there wont be any cytoplasmic liquid(cytosol) inside the cell, as tail is Hydrophobic.If there is no cytosol,then no function of the cell.Even it becomes difficult to pass substances through the cell when layer is different.<... |
14,126 | <p>Why is it rare for a person to have 2 (or more) infectious diseases (for example: Flu & Cold together at the same time)?</p>
<p>Although it's rare, it happens when the immune system is weak (e.g when patient has both AIDS and Kaposi's sarcoma).</p>
| [
{
"answer_id": 14128,
"pm_score": 4,
"text": "<p>What makes you consider it is rare? It is not at all uncommon to be affected by two infections. Typically I agree we aren't as the number of infectious organisms that we are exposed to which cause a clinical manifestation (i.e. aren't controlled by the im... | [
{
"answer_id": 17769,
"pm_score": 1,
"text": "<p>Secondary infection is not rare at all. I mean consider babies. When they get the cold their immune system is weak and focused on the cold virus and they can get viral pneumonia from the flu very easily for example.</p>\n\n<p>TB is another good example of... |
14,152 | <p>I've been trying to put a phylogeny tree into a scientific paper. This tree includes ~220 species, which is too too large for one page for journal articles (Letter or A4 size). But in my paper it is crucial to show the whole tree on which the among-species distribution of a characteristic is indicated. I have looked up some journal issues but so far haven't found any similarly large phylogeny in one article. How do people usually treat this kind of situation in scientific papers? Could anybody tell me how to do it, or show me examples? Thank you so much.</p>
| [
{
"answer_id": 14337,
"pm_score": 3,
"text": "<p>Also, don't forget that you can deposit your full tree in <a href=\"http://treebase.org/treebase-web/home.html;jsessionid=7568662A0CDC73BD6FCBDF11BDB5E247\" rel=\"nofollow\">treebase</a>. So you can show the collapsed tree in the paper, and give a link to... | [
{
"answer_id": 14156,
"pm_score": 4,
"text": "<p>The simplest way of course is to add it to the supplementary materials. However, 220 species are not that many, you should be able to fit that into a page. You have not shown us your tree so it is kind of hard to give specific advice but I am guessing tha... |
14,252 | <p>What is the type of data you get when analyzing dna of a person? If you want to store them in a database, what type of field you will need (text,number,hex)? And what should be it's length?</p>
| [
{
"answer_id": 14253,
"pm_score": 3,
"text": "<p>Assuming that you are looking at data used to describe the differences for a new individual, as opposed to a human reference genome build:</p>\n\n<p>A <a href=\"http://en.wikipedia.org/wiki/FASTQ_format\" rel=\"nofollow\">fastq</a> file is the typical for... | [
{
"answer_id": 14254,
"pm_score": 0,
"text": "<p>It will be a simple string of text. The length, however, is completely arbitrary and will depend on the source of your sequence data. Anything from 1 to several billion can be a valid sequence length.</p>\n\n<p>We could help more if you explained where th... |
14,327 | <p>The following graphs compare glucose decomposition in yeasts (in anaerobic vs aerobic conditions respectively)</p>
<p>My question is, why doesn't the first one look like a straight line as the second one does? Don't they actually follow similar processes?</p>
<p><img src="https://i.stack.imgur.com/2Y8m6.jpg" alt="enter image description here"></p>
| [
{
"answer_id": 14457,
"pm_score": 3,
"text": "<p>I think the reason as to why glucose concentration is faster in the aerobic case than the anaerobic one, is perfectly explained by Chris. To summarize:- </p>\n\n<blockquote>\n <p>The energy requirement of the organism in both the condition remains more o... | [
{
"answer_id": 14381,
"pm_score": 0,
"text": "<p>I think in anaerobic conditions they are fermenting, what is different from respiration. Respiration produces much more ATP from single molecule of glucose, because the biochemical path is different, involves more steps, each one producing a little energy... |
14,330 | <p>I began reading this paper (<a href="http://www.biomedcentral.com/1471-2105/14/56" rel="nofollow">http://www.biomedcentral.com/1471-2105/14/56</a>) and had a few questions about mass spectrometry terminology that I couldn't find answers to elsewhere. Consider the following line:</p>
<p>"The resulting peptide signals in the LC-MS map are referred to as features while the selection of features for fragmentation with MS/MS is called precursor ion selection."</p>
<p>I'm not sure what an LC-MS map is, so I can't properly understand what features or precursor ion selection are: can someone define these terms for me with examples?</p>
| [
{
"answer_id": 14457,
"pm_score": 3,
"text": "<p>I think the reason as to why glucose concentration is faster in the aerobic case than the anaerobic one, is perfectly explained by Chris. To summarize:- </p>\n\n<blockquote>\n <p>The energy requirement of the organism in both the condition remains more o... | [
{
"answer_id": 14381,
"pm_score": 0,
"text": "<p>I think in anaerobic conditions they are fermenting, what is different from respiration. Respiration produces much more ATP from single molecule of glucose, because the biochemical path is different, involves more steps, each one producing a little energy... |
14,334 | <p>I was reading <a href="https://biology.stackexchange.com/questions/7529/when-does-weak-selection-produce-qualitatively-different-results-from-strong-sel">this question</a> and I failed to fully understand the introductory part of it.</p>
<p>The OP (@Artem Kaznatcheev) says:</p>
<blockquote>
<p>Most analytic models like to assume weak selection because it allows the authors to Taylor expand the selection function and linearize it by dropping terms that are higher order in the stength of selection. </p>
</blockquote>
<p>I don't fully understand it. Can you help me making sense of why assuming weak selection allows one to Taylor expand the selection function. I am hoping someone would answer by presenting a mathematical model that at first does not assume weak selection and show why assuming weak selection allows the use of a Taylor series to linearize the function. I'd like to understand which terms fall down and which terms left with this assumption.</p>
| [
{
"answer_id": 14457,
"pm_score": 3,
"text": "<p>I think the reason as to why glucose concentration is faster in the aerobic case than the anaerobic one, is perfectly explained by Chris. To summarize:- </p>\n\n<blockquote>\n <p>The energy requirement of the organism in both the condition remains more o... | [
{
"answer_id": 14381,
"pm_score": 0,
"text": "<p>I think in anaerobic conditions they are fermenting, what is different from respiration. Respiration produces much more ATP from single molecule of glucose, because the biochemical path is different, involves more steps, each one producing a little energy... |
14,350 | <p>The question is based on an intuition that antibiotic resistance can't come along. This mutation will probably make bacteria less tenacious. Is there any research how AR bacteria compete with normal one in an antibiotic free environment? Because if them generally lose to normal bacteria then AR bacteria is not a big threat and they can't spread to much.</p>
| [
{
"answer_id": 14352,
"pm_score": 4,
"text": "<p>The antibiotic resistance adds to growth cost. In an antibiotic free medium the antibiotic-susceptible strains will outgrow the resistant ones. See <a href=\"http://www.nature.com/nrmicro/journal/v8/n4/abs/nrmicro2319.html\" rel=\"noreferrer\">this</a></p... | [
{
"answer_id": 14362,
"pm_score": 2,
"text": "<p>In short, yes. Perhaps the best way of thinking about antibiotic resistance is not to think of there being 'antibiotic resistance' genes at all, but rather ordinary alleles that are vertically transferred in the typical fashion until at a certain time a d... |
14,472 | <p>My question is related to one of the oldest question in ecology: "What determines global patterns of species richness?". However, I want to focus on one particular part of this question, which has been bothering me for a long time.</p>
<h2>Background information</h2>
<p>One of the most widely recognized ecological patters on Earth, which is found at most scales and in most biological taxa, is the latitudinal diversity gradient (LDG) -- there are more species in the tropics than in the temperate regions, and the further away you move from the tropics, the fewer species you encounter. Furthermore, such pattern exists not only along the latitudinal gradient, but species richness also covaries with altitude in terrestrial environments and depth in marine environments, showing the same diversity gradient!</p>
<p>It seems to be fair to suggest that <strong>energy</strong> should somehow underline all these diversity gradients and create some sort of universal mechanism that would ultimately affect all species richness patterns on Earth. Unfortunately, there is no consensus on questions as grand as this one, but I'm looking for hypothesis that would specifically attempt to explain all three gradients together.</p>
<h2>Question</h2>
<p>Is there a hypothesis that attempts to explain patterns of species richness along all three energy-related environmental gradients <strong>together</strong>: latitude, altitude and depth? If there is, what it's weakness? If there's no such hypothesis, do we have reasons to believe that such a broad link across the three gradients can exist?</p>
<p><em>Please note how I'm trying to emphasize that I don't want you to list all the hypotheses that describe <strong>LDG only</strong>, but rather the three gradients <strong>together</strong>.</em></p>
| [
{
"answer_id": 14480,
"pm_score": 4,
"text": "<p>This is a big question and a very active field of research. I'm not deeply into this litterature, but you should look into the the different scaling relationships (often power laws) that have been described on metabolism vs body size, species-area relatio... | [
{
"answer_id": 14474,
"pm_score": 2,
"text": "<p>I've studied diversity of euglossine bees along altitudinal gradients in amazonian mountains. The references I've read showed no consensus regarding altitude. For some groups, diversity were higher at low altitudes; for other groups, it was in the middle.... |
14,773 | <p>I am reading Murray Microbiology book.</p>
<p>Some facts</p>
<ul>
<li>M. tuberculosis is an intracellular pathogen.</li>
<li>At the time of exposure, M. tuberculosis enters the respiratory airways and infectious particles penetrate to the alveoli where they are phagocytised by alveolar macrophages.</li>
<li>In contrast with most phagocytised bacteria, M. tuberculosis <strong>prevents fusion of the phagosome with lysosomes</strong> (by blocking the specific bridging molecule, early endosomal autoantigen 1 [EEA1]). <strong>NB probably here something relevant</strong></li>
<li>At the same time, the phagosome is able to fuse with other intracellular vesicles, permitting access to nutrients and facilitating intravacuole replication.</li>
<li>Phagocytised bacteria are also able to evade macrophage killing mediated by reactive nitrogen intermediates formed between nitric oxide and superoxide anions by catalytically catabolising the oxidants that are formed.</li>
<li>Dissemination to any body site occurs most commonly in immunocompromised patients, like HIV patient.</li>
</ul>
| [
{
"answer_id": 14822,
"pm_score": 3,
"text": "<p>If you read <a href=\"http://icmr.nic.in/ijmr/2004/1002.pdf\" rel=\"nofollow\">this</a> article, you will find that CD4+ and CD8+ T-cells are probably the major mediators of the immune response against <em>M. tuberculosis</em>. Since HIV severely depletes... | [
{
"answer_id": 14774,
"pm_score": 1,
"text": "<p>I think one reason for greater virulence is the fact that M.tuberculosis <strong>prevents fusion of the phagosome with lysosomes</strong>.</p>\n\n<p>I think this picture is little relevant here</p>\n\n<p><img src=\"https://i.stack.imgur.com/zbfJ0.png\" al... |
14,793 | <p>There exist a co-ordinate system from chromosomes like "12p11.3". In this system, first integer range from 1 to 23 i.e it takes homologous chromosomes as a pair. If we want to distinguish among homologous chromosomes, how do we refer to each on of the pair? Is it possible to determine if one chromosome from a pair of homologous chromosomes is from father or mother?</p>
| [
{
"answer_id": 14822,
"pm_score": 3,
"text": "<p>If you read <a href=\"http://icmr.nic.in/ijmr/2004/1002.pdf\" rel=\"nofollow\">this</a> article, you will find that CD4+ and CD8+ T-cells are probably the major mediators of the immune response against <em>M. tuberculosis</em>. Since HIV severely depletes... | [
{
"answer_id": 14774,
"pm_score": 1,
"text": "<p>I think one reason for greater virulence is the fact that M.tuberculosis <strong>prevents fusion of the phagosome with lysosomes</strong>.</p>\n\n<p>I think this picture is little relevant here</p>\n\n<p><img src=\"https://i.stack.imgur.com/zbfJ0.png\" al... |
14,794 | <p>I've seen a number of animals - dogs, cats, squirrels, ducks and geese, etc drink from puddles, some of them were muddy, others had green flora growing under water. Same goes for lakes and rivers. A human would not drink that. Do animals experience gastrointestinal discomfort or can they die from drinking water like that?</p>
<p>At the same time I hear about the problem of "clean water" in 3rd world countries and how diarrhea is the #1 killer of children under 5. </p>
<p><strong>Are humans the only animals that require a certain purity of their drinking water?</strong> Why is it that a dog can drink from a puddle, but a human is likely to get sick from doing the same? Do baby animals get sick from drinking "dirty" water?</p>
| [
{
"answer_id": 19644,
"pm_score": 5,
"text": "<p>I wouldn't say that a human is \"likely\" to get sick by drinking from a puddle, I'd say \"at some risk\". It isn't <em>desperately</em> dangerous, although don't take that as a recommendation. There are many infections you can get from water (bacterial, ... | [
{
"answer_id": 14804,
"pm_score": 3,
"text": "<p>Animals do sometimes experience health problems from microbiologically polluted water. But they drink it, because they probably don't have as many options to choose from as humans have. Additionally, wilderness is very harsh, sick animals get eaten by pre... |
14,893 | <p>When you record a video while pointing the viewfinder towards the screen showing a live preview you create optical feedback: <a href="http://www.youtube.com/watch?v=CTyH_Q82lIw" rel="nofollow">video example</a>. An anoalogous effect occurs when you turn your microphone towards the speaker.</p>
<p>Once you look at your own retina with the same eye, does our brain create a similar effect as recorded in the video? Or could it be something different all together?</p>
<p><sub>Obviously the best way to find out is to 'just go ahead' and see for myself, but it seems as if I don't have the proper conditions to test this at home: The pupil gets too small in the mirror and thus the retina is plain dark. Such an experiment would require eye drops to force widen the pupil and allow for more light onto the retina. </sub></p>
| [
{
"answer_id": 14896,
"pm_score": 3,
"text": "<p>There was an answer posted here and deleted again - which I think has found the error my question. Please undelete it :)</p>\n\n<p>What the eye observes once it glances at the retina is a physically <strong>constant image</strong> of the retina.</p>\n\n<p... | [
{
"answer_id": 14895,
"pm_score": 2,
"text": "<p>You would see your retina and that's all. There would have no \"<a href=\"http://fr.wikipedia.org/wiki/Mise_en_abyme\" rel=\"nofollow noreferrer\">mise-en-abyme</a>\".</p>\n\n<p>In order to experience this feedback loop you describe, you need to see somet... |
14,919 | <p>I have learned (probably in high school?) that hairs turning white is caused by the part of the folicle which produces the pigment dying and being replaced by an air bubble. This sounds very irreversible. </p>
<p>I have long dark brown hair, and since I turned 25, I have had a few white hairs here and there. It is not unusual to find hairs which have a dark tip but are white at the root, which fits the above theory. </p>
<p>But I also have hairs which are the opposite: the lower ten centimeters are pure white, but at some point, there is an abrupt transition to dark brown, and the hair is dark again up to the root. This is all a natural phenomenon, I haven't used dyes or bleaches. </p>
<p>So what makes white hair white, if it can turn back to dark? Why would a single hair turn back? </p>
| [
{
"answer_id": 21174,
"pm_score": 5,
"text": "<p>The pigmentation of hairs is achieved by the follicular melanocytes (specialized pigment cells) at the base of the hair shaft. These cells produce the pigment which is subsequently transported into the cells which produce the hair and integrated into the ... | [
{
"answer_id": 17708,
"pm_score": 3,
"text": "<p>Hair colour is maintained by a pigment called <a href=\"http://en.wikipedia.org/wiki/Melanin\" rel=\"noreferrer\">Melanin</a> which also affects skin colour too. When the melanin content in your hair decreases, it turns grey and eventually white. Multiple... |
15,047 | <p>I've been told that the maximum number of cycles in PCR is between 20 and 30.</p>
<p>Is this true, and what are the reasons for this limitation?</p>
| [
{
"answer_id": 15048,
"pm_score": 4,
"text": "<p>I would draw the line beyond 35, but thats a bit cosmetic. \nThe reasons are manyfold:</p>\n\n<ul>\n<li>due to the exponential fashion of the amplification (ideally)\nreagents are used up at some point</li>\n<li>reagents degrade, this is especially true f... | [
{
"answer_id": 15050,
"pm_score": 3,
"text": "<p><strong>How many cycles of PCR before dNTPs run out?</strong></p>\n\n<p>Assume a 25 μl reaction.</p>\n\n<p>Assume 200 μM dNTPs.</p>\n\n<p>200 μM dNTPs = 200 pmol μl <sup>-1</sup></p>\n\n<p>so in 25 μl reaction, there are 5000 pmol of dNT... |
15,058 | <p>What do you think are the potential drawbacks/weakness of using ORA to explain distinction between two phenotypes.</p>
<p>I identified a few which were the dependencies of DE and the statistical method used to filter the starting DE list.</p>
<p>Any other weakness?</p>
<p>Thanks</p>
| [
{
"answer_id": 15048,
"pm_score": 4,
"text": "<p>I would draw the line beyond 35, but thats a bit cosmetic. \nThe reasons are manyfold:</p>\n\n<ul>\n<li>due to the exponential fashion of the amplification (ideally)\nreagents are used up at some point</li>\n<li>reagents degrade, this is especially true f... | [
{
"answer_id": 15050,
"pm_score": 3,
"text": "<p><strong>How many cycles of PCR before dNTPs run out?</strong></p>\n\n<p>Assume a 25 μl reaction.</p>\n\n<p>Assume 200 μM dNTPs.</p>\n\n<p>200 μM dNTPs = 200 pmol μl <sup>-1</sup></p>\n\n<p>so in 25 μl reaction, there are 5000 pmol of dNT... |
15,165 | <p>The wikipedia entry on the <a href="http://en.wikipedia.org/wiki/Portuguese_Man_o%27_War">Portuguese man o' war</a> says:</p>
<blockquote>
<p>... the Portuguese man o' war is ... not actually a single multicellular organism but a <strong>colonial organism</strong> made up of many highly specialized minute individuals called zooids. These zooids are <strong>attached to one another</strong> and <strong>physiologically integrated</strong> to the extent that they are <strong>incapable of independent survival</strong>. <em>(emphasis added)</em></p>
</blockquote>
<p>This is contradictory. If it's got multiple cells, and those cells are highly specialized to the point of being incapable of surviving on their own, then how does that differ from a multicellular organism? That last sentence seems like it describes the cells in my body.</p>
<p>In fact, the entry <a href="http://en.wikipedia.org/wiki/Colony_%28biology%29">colonial organisms</a> says:</p>
<blockquote>
<p>The difference between a multicellular organism and a colonial organism is that individual organisms from a colony <strong>can, if separated, survive on their own</strong>, while cells from a multicellular life form (e.g., cells from a brain) cannot. <em>(emphasis added)</em></p>
</blockquote>
<p>So, is the Portuguese man o' war a colony or a multicellular organism? And if it's a colony, can its zooids survive independently, the wikipedia text notwithstanding?</p>
| [
{
"answer_id": 15235,
"pm_score": 4,
"text": "<p>Physalia and <a href=\"http://en.wikipedia.org/wiki/Siphonophorae\" rel=\"noreferrer\">Siphonophorans</a> in general are multicellular Metazoans.</p>\n\n<p>But the whole discussion is about modularity on the level of individuals: Siphonophorans are coloni... | [
{
"answer_id": 32968,
"pm_score": 3,
"text": "<p>I think the Wikipedia entry on <a href=\"http://en.wikipedia.org/wiki/Colony_%28biology%29\" rel=\"noreferrer\">Colonies</a> in biology is helpful. It writes:</p>\n\n<blockquote>\n <p>...a colonial organism can be distinguished from a conventional\n mul... |
15,180 | <p>I want to find the conventional phylogenetic tree of human, mouse, C elegans and drosophila, without all the other organisms.
Do you know where can I get it?</p>
<p>thanks,
Noga</p>
| [
{
"answer_id": 15235,
"pm_score": 4,
"text": "<p>Physalia and <a href=\"http://en.wikipedia.org/wiki/Siphonophorae\" rel=\"noreferrer\">Siphonophorans</a> in general are multicellular Metazoans.</p>\n\n<p>But the whole discussion is about modularity on the level of individuals: Siphonophorans are coloni... | [
{
"answer_id": 32968,
"pm_score": 3,
"text": "<p>I think the Wikipedia entry on <a href=\"http://en.wikipedia.org/wiki/Colony_%28biology%29\" rel=\"noreferrer\">Colonies</a> in biology is helpful. It writes:</p>\n\n<blockquote>\n <p>...a colonial organism can be distinguished from a conventional\n mul... |
15,250 | <p>I tested this out with my friends, and I find that after they hold their breath and can't hold it anymore, they exhale air, instead of inhaling air.</p>
<p>Interestingly, they all try to inhale in as much air as possible before starting to hold their breath. When I told them to exhale as much air as possible before starting to hold their breath, they inhaled air after they can't hold it anymore.</p>
<p>It's understandable that when one exhales then holds his breath, he needs air and thus he inhales afterwards. But when one inhales then holds his breath, shouldn't he inhale again after "using up all that air he inhaled before holding hi breath"?</p>
| [
{
"answer_id": 15260,
"pm_score": 4,
"text": "<p>This is more about basic physics than biology. When you hold your breath, you normally take in one last long breath and keep it in as long as possible, Your lungs are therefore already full of gas (remember that the oxygen used by our lungs is only ~22% o... | [
{
"answer_id": 15254,
"pm_score": 2,
"text": "<p>Good question. </p>\n\n<p>If you inhale on top of inhaled air this is more work. There is more dead air, air which is not as useful due to the lower concentration gradient. And we breathe more to exhale carbon dioxide than we require oxygen. Low oxygen le... |
15,415 | <p>My recent post was tagged as unclear so I wanted to re frame my question. Though I am a layman, I would love to read books and find the stuff, if I get an overall picture of intelligence factor. My question is, how come evolutionary mechanism of protecting ones species made them adapt to their environment ? </p>
<p>The answer comes by the genetic mutation, the switch genes and so on. But how are these cells intelligent to cause such mutation ? For instance, cells don't have intelligence of their own, so presented a situation where in you have to see, but have no eyes, or have to walk but have no legs, how come cells know that they have to work against gravity and develop such structures and hollow bones in birds to make the flight easier ? Does it mean that nature is intelligent ? How come matter itself create gravity, space etc., on one side, and creating beings to overcome it ? Isn't the matter altogether ? If that's the case, imagine a thought experiment, where in we all have dangerous predators which are 4D beings. So since our cognitive and visual percepts are just designed to perceive 2 dimensions at a time, we being 3D creatures. So over thousands of years, since we have to live and survive, would we develop a vision that can see 3D ? It would be amazing then. It then means that there is an intelligence factor in nature that tells the creatures how to change ! </p>
<p>Please do answer, and again repeating I want to hear, how Genes know that they have to work against gravity, or develop a particular efficient thing, that can solve the problem. Otherwise it's as if Genes permute infinitely, and then develop all possible models, and only those which serve the purpose will stay. </p>
<p>Please do clarify.
Thanks ! </p>
| [
{
"answer_id": 15423,
"pm_score": 4,
"text": "<p>I think we may be missing a piece from <strong>Darwin's original hypothesis</strong>.</p>\n\n<p>An outline of the first 4 chapters of <a href=\"http://www.literature.org/authors/darwin-charles/the-origin-of-species/index.html\" rel=\"nofollow noreferrer\"... | [
{
"answer_id": 15416,
"pm_score": 3,
"text": "<p>Too long for a comment:</p>\n\n<p>Evolution and mutation has nothing to do with intelligence and is not influenced by the cells itself. It happens by chance and if the mutation turns out to be beneficial (or at least not harmful for the moment) it will be... |
15,448 | <p>After HGP, we are not having many databases which consist of several notepad files of ATCG.... </p>
<p>Can we distinguish quantitatively a given A,T,C and G stretch as DNA or Gene? </p>
| [
{
"answer_id": 15450,
"pm_score": 3,
"text": "<p>I interpret your question as: Given a stretch of DNA sequence, can we determine if it encodes a gene? My summary of the answer would be: \"Sometimes\".</p>\n\n<p>The problem you ask about is called \"Gene prediction\" and is described in some detail by Wi... | [
{
"answer_id": 15459,
"pm_score": 0,
"text": "<blockquote>\n <p>My conviction is that genes are not randomly arranged as a finite\n string. There must be a beautiful organization.</p>\n</blockquote>\n\n<p>In bacteria, you will have a whole series of genes required for a pathway all next to each other,... |
15,532 | <p>I am thinking of why some patients do not have natural immunity after exposure to the A-B toxin of diphthria.
I think the A-B exotoxin is the key factor causing this disease and should trigger memory cells to form.</p>
<p>DT has both local and systemic effects.
Locally, its action on epithelial cells leads to necrosis and inflammation, forming a pseudomembrane composed of a coagulum of fibrin, leukocytes and cellular debris.
Absorption and circulation of DT allow binding throughout the body.
Local effects produce pseudomembrane.</p>
<p>The major impact of transduction in pathogens is the introduction and stable inheritance of virulence genes such as those coding for toxins.
C diphtheriae is lysogenic with a phage containing the diphtheria toxin gene.
Diphtheria toxin is produced by C diphtheriae only when infected with a bacteriophage that integrates the toxin-encoding genetic elements into the bacteria</p>
<p>The toxicity for intact cells depends on toxin binding and uptake.
In other words, the net effect of the toxin depends on the function of the target protein and the function of the cell.
B subunit binds to receptors that regulate cell growth and differentiation, thus exploiting a normal cell function.
A subunit inhibits protein synthesis.
B subunit binding determines cell susceptibility.
Absorption and circulation of DT allow binding throughout the body.
<strong>I think this uptake does not occur sufficiently with patients without natural immunity stimulation</strong>.</p>
<p>I think the reason for no natural immunity for some patients after <strong>toxin exposure is that the host does not stimulate enough adaptive immunity and no memory cells are built</strong>.
Again, this is because the bacteria has little invasive capacity.
Diphtheria is due to the local and systemic effects of DT with potent cytotoxic features.
The uptake of the toxin varies also among some patients.
So other patients have probably more local effects.
This would explain partially why the adaptive immunity is not triggered.</p>
<p>Diphtheria toxin is antigenic itself.
So it can stimulate the production of protective antitoxin antibodies during natural infection.
In those patients without development of natural immunity, A subunit fails to bind EF-2, probably.</p>
<p>One reason is that the toxin does not get into bloodstream in 6-8% cases, and so natural immunity is developed.
So there is too low effective dose of diphtheria for some patients to invade the epithelium and trigger the adaptive immune response and create memory cells.</p>
<p>Sources: Murray Microbiology, Sherris Microbiology and Jawetz Microbiology.</p>
<p><strong>Why do 6-8% of diphtheria patients not develop natural immunity after being infected?</strong></p>
| [
{
"answer_id": 16029,
"pm_score": 3,
"text": "<p>There are two other, but rather exotic possibilites which explain why people do not develop immunity after an diphtheria infection. These are unlikely to get to 6-8% of the cases which @Masi writes, but I am missing the reference here.</p>\n\n<p>The first... | [
{
"answer_id": 16016,
"pm_score": 1,
"text": "<p>In this article they look at the development of natural immunity to diptheria in those who were vaccinated. I could not find any studies on people who had acquired it naturally. \n<a href=\"http://www.sciencedirect.com/science/article/pii/S0264410X9700148... |
15,544 | <p>Why do cells vary in shape and function when they have the same genome and the same organelles. For example: why do all cells have nuclei but red blood cell's don't; why can't the cells of a eye perform the function of the tongue; and the list goes on and on. If you say it is because of gene regulation, so then how does the RNA know to transcribe the specific genes that are necessary to that particular cell?</p>
| [
{
"answer_id": 15545,
"pm_score": 5,
"text": "<p>Because cells are not only characterized by by their genetic material and other interior components, but also by the genes they express. Cells have to fulfill multiple different functions to be able to build complex multicellular organisms. Differently ex... | [
{
"answer_id": 39398,
"pm_score": -1,
"text": "<p>Despite of the fact that all cells have the same genome, not all the genes contained in the cell nuclei are functional. During embryonic development, cells are subjected constantly to division and differentiation processes; this means that in the earlies... |
15,683 | <p>When I did a research, most of the sources say that <strong>orca</strong> is <strong>one of</strong> the fastest. But I could not find a source that says it is actually the fastest. </p>
<p>Some sources say that <strong>Dall's porpoises</strong> rival orcas in speed. And there are other kinds of porpoises and dolphins that comes into question.</p>
<p>Is there any scientific research with measurements? Or does anyone have any detailed knowledge about this topic?</p>
<p>(Also it would be nice to know top 10 fastest marine mammals, so the question becomes: what are the fastest marine mammals?)</p>
<p>Note: This scientific research might be difficult to conduct also so you can explain the situation as well.</p>
| [
{
"answer_id": 17601,
"pm_score": 4,
"text": "<p><a href=\"http://www.elasmo-research.org/education/topics/r_haulin%27_bass.htm\" rel=\"nofollow\">This article</a> by R. Aiden Martin doesn't have citations, but is a great read with a lot of detail on observations and mechanics of animals moving in water... | [
{
"answer_id": 15684,
"pm_score": 3,
"text": "<p>According to the <a href=\"http://marinebio.org/oceans/marine-mammals.asp\" rel=\"noreferrer\">MarineBio conservation society</a>, the fastest marine mammal is the <a href=\"http://marinebio.org/species.asp?id=32%20Common%20Dolphin\" rel=\"noreferrer\">Co... |
15,712 | <p>Say I cough on my table, then someone else touches it and picks up something I've got... how is it that these things can live outside the body, how long can they manage it, and how long is generally 'safe' to consider something no longer carrying these germs?</p>
| [
{
"answer_id": 15717,
"pm_score": 3,
"text": "<p>It depends entirely on the environment the virus or bacterium is in and also the size of it. </p>\n\n<p><strong>Virus</strong></p>\n\n<p>With regards to viruses, the most important thing is typically whether or not the virus has an outer membrane or envel... | [
{
"answer_id": 15714,
"pm_score": 1,
"text": "<p>Viruses really take to heart the idea of \"quantity, not quality.\" Like animals and plants, viruses and bacteria are a <strong>Completely</strong> different ball game (even more so than animals and plants). </p>\n\n<p>As you maybe know, you have bacteria... |
15,928 | <p>I would imagine the bacterial genome is highly conserved and limited in its space, but maybe I am wrong.</p>
<p>If you were to take a strain of antibiotic resistant bacteria and kept them isolated, but fed well and so forth, how long would it take for them to lose their resistance? A year? A decade? 100 years? 1000 years? At some point it seems like that trait would disappear, but I have no feeling for how long. Please support your answer with a relevant citation.</p>
<p>EDIT:</p>
<p>My purpose is simple: I am thinking about a strategy for dealing with antibiotic resistance. If we were to ban them across the entire world (could be impossible) how long would we need to wait before they would be usable again. If it was a matter of years, then we could almost do a rotation of existing antibiotics (if we had enough) because I would rather not live in post-antiobitic world.</p>
| [
{
"answer_id": 15930,
"pm_score": 4,
"text": "<p>Antibiotic resistances in bacteria is commonly encoded by extrachromosomal DNA, the plasmids. These are circular pieces of DNA, which are much smaller than the hosts genome and which replicate independently from it. See the image from the <a href=\"http:/... | [
{
"answer_id": 15931,
"pm_score": 2,
"text": "<p>Lab strains of <em>E. coli</em> have been in use for many decades now. They have all retained a large number of genes encoding subunits of the flagellar apparatus and the chemotaxis system which confer absolutely no advantage under normal culture conditio... |
15,937 | <p>While I know that in nature, carnivorous animals are poorly suited to eat plants (largely due to having sharp teeth, not grinding teeth, as far as I know), I was wondering if, in an emergency situation such as imminent starvation, <strong>could a carnivorous animal such as a wolf survive <em>solely</em> on plant life</strong>, maybe requiring it to be ground up before hand? <strong>Could an herbivore survive on meat, if the meat was prepared in a manner that would allow the herbivore to eat it?</strong> Would a wild animal voluntarily consume food that it is not suited for if it would stave off certain death, or would it require force feeding or training?</p>
<p>Also, I am interested in the other side of this question: <em>if an animal cannot safely consume food outside of its normal diet</em> (carnivore eating plants, herbivores consuming meat), <strong>what negative effects would this action have on the animal?</strong></p>
<p><em>Just a note, this is purely a hypothetical question, and I am only asking out of curiosity. I am in no way planning on doing this, nor do I advise anyone else doing this if there is a high chance of it harming the animal.</em></p>
| [
{
"answer_id": 15951,
"pm_score": 4,
"text": "<p>This is kind of a weird/trick question. How long do you want the animal to live? If the lifespan is shortened or compromised does that fit.... Obligate carnivores (cats, dogs) do eat plant material. In the wild cats mainly eat grass to get rid of hai... | [
{
"answer_id": 23660,
"pm_score": 2,
"text": "<p>I think that the distinction between carnivores and herbivores contains a gray area with a spectrum of omnivores in-between. Bears are placed in the order of carnivores, but are definitely truly omnivores <a href=\"http://www.nhptv.org/natureworks/nwep10b... |
15,959 | <p>We know that everybody's DNA pattern is different in the world. Then how can ´we transfer blood from one person to another person and this person can survive ?</p>
| [
{
"answer_id": 15960,
"pm_score": 4,
"text": "<p>A few components to my answer.</p>\n\n<ol>\n<li>Red blood cells do not contain a nucleus, therefore, they do not harbour DNA.</li>\n<li>The major determinant of blood compatibility is the blood antigen. There are only 4 types: O, A, B, AB. This is genetic... | [
{
"answer_id": 15964,
"pm_score": 2,
"text": "<p>Because one's DNA doesn't have to exactly match another person at all 3 billion locations for the transfusion to be successful. As it turns out, there are only a few proteins that determine whether a person's blood is a match to someone else's. And as i... |
16,388 | <p>I am currently studying biology and would like to know why enzymes work best in a particular narrow range of pH (the so-called pH optimum).</p>
<p>Unlike temperature change, I do not think this has much to do with energy. Do pH-related changes in enzymatic activity have anything to do with the active site? </p>
| [
{
"answer_id": 16390,
"pm_score": 3,
"text": "<p>Enzymes have a more or less narrow optimal pH at which they work, depending on the conditions of their environment. Pepsin for example is active in the stomach which is pretty acidic and has an optimal pH of 2.0, while Trypsin, which is active in the smal... | [
{
"answer_id": 16396,
"pm_score": 1,
"text": "<p>Enzyme function is largely determined by its 3-D shape. Enzyme shape is affected by pH among a couple other things. The enzyme only retains its optimal shape at the optimal pH, as you creep outside of it the enzymes shape changes and hence so does its fun... |
16,403 | <p>Within a single species, how does the relative number of cells in the body relate to the relative size of the organism?</p>
<p>Let's say we take two humans, one of them is 6 feet tall and the other one is 5 feet tall. They have similar BMI, age, physical condition, genetic background (aside from height) and are the same sex.</p>
<p>Does the tall one have more cells? Or does he have bigger cells?</p>
<p><strong><em>PS:</em></strong> Ideally, answers should be backed up by appropriate sources.</p>
<p><strong><em>PPS:</em></strong> While I'm grateful to everyone for the very nice answers I got, I should point out that I'm waiting for an answer which includes references to accept it.</p>
| [
{
"answer_id": 16407,
"pm_score": 4,
"text": "<p>This is really the most fundamental concept of Cell Biology, so good question. If you look at the size of a any cell from a whale and compare it to the size of any of cells from a mouse, they are in fact quite similar, despite the extreme difference in th... | [
{
"answer_id": 16406,
"pm_score": 0,
"text": "<p>The taller person has more cells. Most cells can only lengthen up to a certain point. Whilst the neuronal cells will be longer and likely some others, the rest of the cells will just be of larger number. </p>\n"
},
{
"answer_id": 16421,
"pm_sc... |
16,503 | <p>I have a basic question about evolution, for which I never found an answer. I understand how evolution works if we focus on one specific organ or trait. With each generation, some organism is more likely to reproduce, so the trait that leads to success gets more frequent. My problem is understanding how all the traits can evolve simultaneously. </p>
<p>Looking back to our ancestors, we evolved many different kinds of adaptations (in unrelated areas like eyesight, kidney efficiency or a healthy fear of predators, digestion of certain nutrients, balanced walking etc.).
Natural selection can only work with what's there, so mutations are important. But if mutations are rare, it seems unlikely that many (thousands of) properties of organisms get improved in a single generation. You'd need to get very lucky to randomly improve all the genes responsible for it.</p>
<p>So, if we look back to our ancestors again, did they just improve on a single or a handful of traits in each generation? In that case we would need hundreds of generations before we have improved somewhat on each "front". By then, the other properties could "drift" back to a not-so-advantageous version. (This was supposing that each generation improves on a random trait, as opposed to long sequences of generations each improving on the same).
Or were there always some super lucky organisms that randomly got an improvement on almost all different traits? But just having some of those super lucky ones is not enough. The good traits don't guarantee success, just improve the odds. So we'd need many very lucky ones in each generation.</p>
<p>Has anyone calculated or simulated how the adaptation for many different traits can happen <em>simultaneously</em>?</p>
| [
{
"answer_id": 16504,
"pm_score": 4,
"text": "<blockquote>\n <p>Has anyone calculated or simulated how the adaptation for many different traits can happen simultaneously?</p>\n</blockquote>\n\n<p>There are a lots of studies on the subject but I don't fully understand what is your issue. So I'll try to ... | [
{
"answer_id": 16507,
"pm_score": 2,
"text": "<p>I think the main issue you have is in this paragraph:</p>\n\n<blockquote>\n <p>But if mutations are rare, it seems unlikely that many (thousands of) properties of organisms get improved in a single generation. You'd need to get very lucky to randomly imp... |
16,517 | <p>I just got struck by curiosity now: Intuition says no, but I've never had confirmation of it. </p>
| [
{
"answer_id": 16529,
"pm_score": 4,
"text": "<p>As @terdon comments, dormant organisms can survive in vacuum. This includes lichens, bacteria, and even an animal: the ever-amazing and adorable tardigrade (<a href=\"http://dx.doi.org/10.1016/j.cub.2008.06.048\" rel=\"noreferrer\">Jönnson et al 2008</a>)... | [
{
"answer_id": 16519,
"pm_score": 3,
"text": "<p>No, it is not. Or at least not in the form we know life. The reason is that water (which is essential for life) boils at low pressures at room temperature. This makes life impossible in the form we live it on earth.</p>\n"
},
{
"answer_id": 16660,... |
16,577 | <p>I was recently working on getting a statistical model of a DNA sequence. To do this I found that understanding evolution quantitatively seems to be quite important. I would really appreciate any book recommendations on the basics of evolution.</p>
<p>I come from an Electrical Engineering background and have a limited knowledge of evolution and biology.</p>
| [
{
"answer_id": 16579,
"pm_score": 4,
"text": "<p>You either want a introductory book in evolutionary biology or a book that offers mathematical models of evolutionary processes.</p>\n\n<p>In my first class of evolutionary biology I had this textbook: <a href=\"http://rads.stackoverflow.com/amzn/click/08... | [
{
"answer_id": 16698,
"pm_score": 2,
"text": "<p>I really good intro to evolution book is The Evolution of Vertebrate Design by Leonard Radinski. </p>\n\n<p>Also, for a more math based approach you could look into Narrow Roads of Gene Land. These are collected papers of W.D Hamilton. </p>\n"
},
{
... |
16,626 | <p>It occurred to me (while urinating) that this would seem to be selected against because water is a scarce resource. Why are we constantly losing water we don't need to through urination? What is it about the chemistry of urine and the waste products eliminated that make urination necessary as opposed to eliminating them through defecation and recovering the water on the way out?</p>
| [
{
"answer_id": 16628,
"pm_score": 5,
"text": "<p>It is probably true that toilets and other resting-ish area are always a great place to think about biology, I agree <span class=\"math-container\">$\\ddot \\smile$</span>.</p>\n\n<p><strong>Why do we urinate?</strong></p>\n\n<p>In short, urine contains t... | [
{
"answer_id": 23357,
"pm_score": 2,
"text": "<p>As I have already mentioned in my <a href=\"https://biology.stackexchange.com/a/23354/3703\">other post</a>, the most important role of urea synthesis by humans is blood pH regulation and urine concentration, so it is not just about excreting a waste prod... |
16,709 | <p>we know that cytoplasm of cells are filled with water molecules and other hydrophilic molecules so my question is why the water of cytosol doesn't dissolve the ionic part of the lipid bilayer or why it doesn't dissolve the proteins and enzymes which are most polar and ionic and they still form structures,organelle and function and suspended in water?</p>
| [
{
"answer_id": 16712,
"pm_score": 3,
"text": "<p>Many cell components are not simply hydrophobic or hydrophilic, but have dual affinities. Proteins typically have structures which result in the interior of the protein being hydrophobic and the exterior, which is exposed to the water in the cytosol, bein... | [
{
"answer_id": 16722,
"pm_score": 1,
"text": "<p><strong>ADDENDUM</strong></p>\n\n<p>Water can disrupt the intramolecular hydrogen bonds by bonding to the donors/acceptors. However, water in many cases can also act like a bridge and stabilize the protein structures. As already pointed out by jarlemag, t... |
16,741 | <p>Disregarding hypoxia, what is the minimum air pressure that the human body can tolerate?</p>
<p>(i.e. at what air pressure would the blood start to boil, or skin start to burst, or whatever else might happen that would kill you but isn't related to oxygen?)</p>
| [
{
"answer_id": 40505,
"pm_score": 5,
"text": "<p>Disregarding hypoxia, the lowest atmospheric pressure the human body can withstand is around 6 percent sea level pressure, or 61.8 millibars, below that pressure the water and blood in your body starts to boil. <a href=\"https://en.wikipedia.org/wiki/Harr... | [
{
"answer_id": 16742,
"pm_score": 2,
"text": "<p>At sea level, where atmospheric pressure is 1 atm and oxygen is about 21% the partial pressure of oxygen is enough to saturate hemoglobin.</p>\n\n<p>The lowest tolerable pressure of air is about 0.47 atm (475 millibars of atmospheric pressure) - recorded ... |
16,919 | <p>I am inquisitive to know about how a person contracts AIDS.
Among the common masses it's still the belief that having sex with multiple partners causes the disease but that is not the case when read online that it can come only from persons carrying the virus.</p>
<p>So, if a person (male or female) is carrying the virus (HIV positive) does it mean that he/she is suffering from the disease or the person may be carrying the HIV disease and still be free from AIDS. If so how did this chain reaction of spreading the virus start?</p>
<p>Also is it true that immune systems of some rare people in this world can fight with this disease.</p>
| [
{
"answer_id": 16920,
"pm_score": 4,
"text": "<p>You read right: it can only come from people already infected through:</p>\n\n<ul>\n<li>sexual contact</li>\n<li>contact with an infected person's body fluids (blood transfusions), although not all fluids carry HIV (saliva, tears)</li>\n<li>from mother to... | [
{
"answer_id": 16959,
"pm_score": 3,
"text": "<p>Being HIV+ and having AIDS are slightly different terminologies:</p>\n\n<p>If the virus is detectable in an individual by existing medical techniques he/she is called HIV+. </p>\n\n<p>A HIV+ person is said to have progressed to AIDS only when the CD4+ T-l... |
16,922 | <p>Let's take a quote from Wikipedia about zebroids.</p>
<blockquote>
<p>Donkeys are closely related to zebras and both animals belong to the horse family. These zebra donkey hybrids are very rare. In South Africa, they occur where zebras and donkeys are found in proximity to each other. Like mules, however, they are generally genetically unable to breed, due to an odd number of chromosomes disrupting meiosis.</p>
</blockquote>
<p>First, if I understand meiosis, the resulting cells don't actually end up with half the number of chromosomes, but closer to a full set of halves of chromosomes. How is the meiotic process disrupted?</p>
<p>Then, </p>
<blockquote>
<p>A donkey has 62 chromosomes; the zebra has between 32 and 46 chromosomes.</p>
</blockquote>
<p>Apparently this difference doesn't obstruct producing (infertile) offspring. How comes the process of recombination of such vastly different number of chromosomes in gametes is viable? What happens to chromosomes that don't find their 'pair'?</p>
<p>And then,</p>
<blockquote>
<p>Horses have 64 chromosomes, while most zebroids end up with 54 chromosomes.</p>
</blockquote>
<p>54 is an even number. How comes zebroids can't just normally produce fertile offspring with other zebroids of the same number of chromosomes?</p>
| [
{
"answer_id": 16946,
"pm_score": 4,
"text": "<p>A critical step in meiosis is the formation of tetrads. In diploid organisms like donkeys, they have a paternal version and a maternal version of each chromosome. Two chromosomes 2, for instance. During prophase 1, these two \"matching\" or homologous chr... | [
{
"answer_id": 68228,
"pm_score": 1,
"text": "<p>I am a little bit out of practice but i researched the genetics of the horse tribe during the 1990s at the start of the Internet.\nMale hybrids of the diverse equine species are all infertile.\nHowever, a fairly large number of fertile female mules have b... |
17,085 | <p>In a class that I'm taking we were presented 3 types of stem cells.</p>
<ol>
<li>Adult stem cells which come from bone marrow</li>
<li>Embryonic stem cells which come from embryos</li>
<li>Embryonic germ cells which come from testes</li>
</ol>
<p>I understand that adult stem cells are a bit more specialized than embryonic stem cells, but I'm confused why embryonic germ cells are considered stem cells. From Wikipedia, the definition of stem cells is:</p>
<blockquote>
<p>Undifferentiated biological cells that can differentiate into
specialized cells and can divide (through mitosis) to produce more
stem cells</p>
</blockquote>
<p>But from my limited understanding of biology embryonic germ cells can't specialize into any other cells unless they fuse with another gamete, so why would they be considered stem cells? What am I missing here?</p>
| [
{
"answer_id": 39601,
"pm_score": 3,
"text": "<p>The difference in designation is the timing of the foundation of the cell line and the tissue that it was sourced from.</p>\n\n<p>Embryonic Stem Cells are harvested from the inner cell mass of a Blastocyst around day 5 post fertilization. This is the firs... | [
{
"answer_id": 39595,
"pm_score": 1,
"text": "<p>Adult stem cells don't always come from bone marrow. In any or most adult tissues still have stem cells exist. Stem cell doesn't only mean it can specialize into other cells. Any cell, if it has self-renew ability and never grows old, can be called stem c... |
17,100 | <p>I understand that someones genetic makeup at an allele is usually denoted as (AA,Aa,aa).</p>
<p>That means that instead of an A-T pair you get a C-G pair on none, 1 or 2 copies.</p>
<p>Now, what exactly happens when you have a tri-allele (as in blood type). Are they looking at two base positions? Or is it instead of an A -> C mutation, you get something weirder like an A->G mutation (and thus you need to account for directionality) etc?</p>
<p>Thanks!</p>
| [
{
"answer_id": 17102,
"pm_score": 3,
"text": "<p>All of these things happen, but triallelic SNPs (single nucleotide polymorphisms) refer to the case where a single specific base in the genome may have one of three bases. e.g.: A/G/C </p>\n\n<p>Cases where more than one base in a sequence that changes. ... | [
{
"answer_id": 17103,
"pm_score": 3,
"text": "<blockquote>\n <p>I understand that someones genetic makeup at an allele is usually\n denoted as (AA,Aa,aa).</p>\n</blockquote>\n\n<p>No. That's what you learn in high school, because it's easy, and because it's what Mendel worked out for the 7 traits he s... |
17,147 | <p>The post-apocalyptic science fiction novel <a href="http://en.wikipedia.org/wiki/Dark_Universe_%28novel%29" rel="nofollow">Dark Universe</a> by Daniel F. Galouye has some plants living inside bunkers that use infrared light for photosynthesis. There are <a href="http://blog.physicsworld.com/tag/plants/" rel="nofollow">speculations</a> that extraterrestrial plants might use the same trick on planets orbiting red dwarfs and that their leaves would be totally black. Would this type of photosynthesis be possible and are there any plants on low-light environments from Earth that might do this already?</p>
| [
{
"answer_id": 59089,
"pm_score": 3,
"text": "<p>There is an algea that uses IR: </p>\n\n<p>The newfound pigment, dubbed chlorophyll f, absorbs light most efficiently at a wavelength around 706 nanometers, just beyond the red end of the visible spectrum, researchers report online August 19 in Science. T... | [
{
"answer_id": 17150,
"pm_score": 2,
"text": "<p>I would hardly ever say never where biology is concerned. In this case that utilizing red rather than blue light for a plant would require many of the basic assumptions of photosynthesis in terrestrial plants to be revised, but since we're talking about ... |
17,265 | <p>Let first state that I understand natural selection. I am not asking if evolution happened. I see evolution as a fact, but I do not assume the <strong>current</strong> theory of natural selection as fact.</p>
<p>I wonder if there has been enough "time", or number of generations, needed to create enough mutations that lead to the known genetic complexity of all species today (or even just until dinosaurs), since the Last Universal Ancestor.</p>
<p>Is it possible to prove, or estimate this time?</p>
<p>Note: There was obviously enough time for evolution to occur. My question is if, the known mechanisms of mutation and theory of natural selection, are enough to justify the evolution in this amount of time.</p>
| [
{
"answer_id": 17285,
"pm_score": 5,
"text": "<p>The evolution to the current state of life on earth has occurred through some <a href=\"http://www.bbc.co.uk/nature/history_of_the_earth\">3.8 billion years</a>. During this time it has gone from the most basic forms of life, simple self-replicating units... | [
{
"answer_id": 17281,
"pm_score": 2,
"text": "<p>What's your average contemporary DNA pol error rate? Something like 10^-9 errors per bp? Your average prokaryote generation time is maybe something like 10 days. LUCA is thought to be about 3.5 billion years old. However, it would be expected that DNA pol... |
17,361 | <blockquote>
<p>Neurons were kept in a physiological solution. During the resting
phase, the membrane potential in the axoplasm of neurons was negative
compared to the extracellular space and a potential difference of -70
mV was observed in this phase. Neurons were then treated in two
different experiments with either gamma-amino butyric acid (GABA; an
inhibitory neurotransmitter) or glutamate (an excitatory
neurotransmitter) and the membrane potentials were recorded. Choose
the correct statement/s:</p>
<p>(A) The resting membrane potential of -70 mV would not change with
either GABA or glutamate treatments.</p>
<p>(B) The membrane potential would be even more negative than resting
phase with GABA treatment.</p>
<p>(C) The membrane potential would be positive when the neuron was
exposed to glutamate.</p>
<p>(D) The membrane potential would be more negative than resting
potential after glutamate treatment.</p>
</blockquote>
<p>I feel, since, glutamate is excitatory, so resting potential should decrease when exposed to glutamate and increase when exposed to GABA. So (A)&(D) automatically gets eliminated and (B) is correct answer. I am confused at (C)</p>
| [
{
"answer_id": 17474,
"pm_score": 3,
"text": "<p>It is more correct to call it \"resting potential difference\" (like your question), because electrical potential is relative, not absolute.</p>\n\n<p>That phrasing exposes a crucial point: The difference of <em>what</em>? Cell cytoplasms are negatively c... | [
{
"answer_id": 17402,
"pm_score": 2,
"text": "<p>I believe C is also correct. The excitatory neurotransmitters open $\\ce{Na}$ channels which makes the cell membrane more permeable to sodium as compared to potasium and therefore the equilibrium membrane potential would be much closer to the nernst poten... |
17,457 | <p>Let's say you're a 23-year-old man who impregnates a woman. Will your genes be the same if you were to impregnate another woman at age 35? Will your genes in those 12 years have changed/mutated/become smarter? </p>
| [
{
"answer_id": 17464,
"pm_score": 5,
"text": "<p>Yes, there are some differences between the gametes that a parent produces at different ages!</p>\n\n<p><strong>Mutations in the germline during mitosis</strong></p>\n\n<p>Every time a cell replicates some mutations may occur (even through <a href=\"http:... | [
{
"answer_id": 17459,
"pm_score": 2,
"text": "<p>Genes can get mutated in one's lifetime. They gene altering agents are mutagens. Some common mutagens are X-ray, UV-ray, tobacco. </p>\n\n<p>Recent studies have yielded results which state that some behavioral actions may cause gene mutations.</p>\n\n<p>S... |
17,511 | <p>This is my first question here, so I apologize for all mistakes I could have possibly made.</p>
<p>I'm a high school student in East-Central Europe and I need to complete some research for a biology contest (asking for advice is accepted, so I'm not cheating). My task is to analyze the influence of certain environmental factors (temperature etc., it's not that important for my question) on the activity of bees. The method is pretty simple: once a week I record the entrance to the bee hive (I do it on four hives), play it in slow-mo (It's impossible to count them properly without doing so) and simply count the number of bees entering or leaving.</p>
<p>Problem is, I don't know how long the observation should take. I play it in like X1/8, you need to play it twice (entering/leaving), so it takes a lot of time to gather one piece of information for a certain day. Till now I've been doing it for one minute - and there seems to be some kind of pattern to their activity analyzed that way. Yet, I'm not sure if it's actually eligible. I can't do the observation for hours - I still need to learn and have other duties.</p>
<p>So, what should I do? Could anyone give me some advice? Is one minute (several, like 6 times a day per hive) legitimate enough?</p>
<p>Thank you in advance.</p>
| [
{
"answer_id": 17518,
"pm_score": 3,
"text": "<p>I'm no expert at this but these are some of the things that I would consider thinking about. How practical is it for you to count the total number of bees in the hive, based on lets say hive weight or the number of bees on one rack in the hive (then multi... | [
{
"answer_id": 17512,
"pm_score": 3,
"text": "<p>One thing that's certain is that the activity of bees varies according to time of day, so more important than <em>how long</em> you record for is probably <em>at what time</em> you record. If you always record at the same time of day, this should allow a ... |
17,524 | <h1>My Data</h1>
<p>I have a 23andMe file listing SNPs in the form:</p>
<p><code>rsid chromosome position genotype
rsXXXXX 1 PPPPPP CT
rsXXXXX 1 PPPPPP GG
</code></p>
<p>Fields are TAB-separated and each line corresponds to a single SNP. For each SNP, four fields of data are supplied. </p>
<ol>
<li>An identifier (an rsid or an internal id)</li>
<li>Its location on the reference genome.
<ul>
<li>The chromosome it is located on.</li>
<li>The position within the chromosome is is located on.</li>
</ul></li>
<li>The genotype call oriented with respect to the plus strand on the human reference sequence.</li>
</ol>
<p>The reference genome is the human assembly build 37 (also known as Annotation Release 104).</p>
<h1>My Question</h1>
<p>How do I merge the SNPs into the reference genome?</p>
<p>For example, take the first line in my SNP file:</p>
<p><code>rsXXXXX 1 PPPPPP CT</code></p>
<h3>Part 1</h3>
<p>I can see that I need to replace the nucleotide at position PPPPPP on chomosome 1 of the reference genome with a nucleotide from the genotype field, but which nucleotide am I supposed to use? C or T? And why?</p>
<h3>Part 2</h3>
<p>Where am I supposed to start counting from on the reference genome? Looking at chromosome 1 of the human assembly build 37, the first ~10,000 characters (excluding the first line description) are <code>N</code>. Is the first N number 1? eg. If PPPPPP was 100,000 would I replace the 100,000th character in the reference genome with the correct nucleotide from <strong>Part 1</strong> of this question? Or should I start counting from the first non-N character in the fasta file?</p>
| [
{
"answer_id": 17530,
"pm_score": 3,
"text": "<p>First, you need to know which genome sequence does the SNP file refer to. They must have mentioned the reference sequence that they used. </p>\n\n<p>As others mentioned the case of <code>CT</code> is heterozygosity. If you just want to mark the changes th... | [
{
"answer_id": 17525,
"pm_score": 0,
"text": "<p>Genetics 101, you have 2 copies of all your DNA at every position, one copy from your mother, one from your father. So for the \"CT\" one, you have one copy with a C, and one with a T.</p>\n\n<p>And yea, it's normal for the first several thousand, or mil... |
17,558 | <p>Nitrogen and Phosphorus are usually the limiting nutrient for plants, especially for algae. Phosphorus is used for DNA, ATP and phospholipids, and Nitrogen is used for pretty much every protein a cell might want to produce. That is, their need for biological processes is not tied specifically to photosynthesis: anything that lives is going to need them, pretty much for anything it might want to do. It would make sense for them to be a limiting nutrient for almost anything that's trying to grow, plant or animal.</p>
<p>Yet for animals the limiting "nutrient" seems to always be energy, ie: food. Why aren't animals limited by lack of nutrients in the same way that plants are? Obviously animals need these nutrients, too. Or to reverse the question, why do plants need so much more phosphorus/nitrogen than animals do?</p>
<p>My best guess is that an animal's digestion of plant material is relatively inefficient energy-wise but relatively efficient nutrient-wise. So for an animal to eat enough food to have sufficient energy to survive, it's probably eaten more than enough Nitrogen and Phosphorus for its needs. But I'm just guessing and I can't find any data that would back up that guess.</p>
| [
{
"answer_id": 17588,
"pm_score": 3,
"text": "<p><strong>Phosphorus</strong></p>\n\n<p>Your suggestion that if we are meeting our calorific requirement we will be getting enough is true for phosphorus.\nMost foods contain lots of phosphorus. The maximum dietary requirement occurs during adolescent growt... | [
{
"answer_id": 17574,
"pm_score": -1,
"text": "<p>Off the top of my head:</p>\n\n<ul>\n<li><strong>Plants are photosynthetic so have unlimited access to energy.</strong> If an animal had unlimited access to energy it would likely have Nitrogen or Phosphorous or something else as the limiting nutrient. <... |
17,571 | <p>Biology is so exciting! Answering a question leads to thousand more questions! There is no limit to how much one kind find out about a phenomena…</p>
<p>So I have always wondered how someone can decide that it is time to publish some fixed amount of research they have done. How do biologists decide when to publish a paper? How do biologists know that results are sufficient enough for a publication?</p>
| [
{
"answer_id": 17575,
"pm_score": 2,
"text": "<p>I agree with all the responses so far; however I thought I should add that to publish a paper in a decent internationally peer-reviwed journal, more often than not, a paper has to tell a story, ideally a novel story and not just the same data that has bee... | [
{
"answer_id": 17572,
"pm_score": 2,
"text": "<p>When you do science you start with a question or a hypothesis. How is Gene A regulated? Or \"does hormone B have an effect on the immune system\". Or whatever.</p>\n\n<p>Then you start by thinking how you can prove or disprove your question/hypothesis wit... |
17,611 | <p>The definition of entomology says it is the science of studying insects. </p>
<p>I know spiders are not insects but does entomology include studying spiders as well?</p>
<p>Otherwise is there any name to the science of studying spiders (class <em>Arachnida</em>)?</p>
| [
{
"answer_id": 17612,
"pm_score": 4,
"text": "<p>Spiders are part of a taxon called <a href=\"http://en.wikipedia.org/wiki/Arachnid\" rel=\"nofollow\">Arachnida</a>. Arachnida also contain scorpions, Oppiliones, acari, … The science of arachnids is logically called <a href=\"http://en.wikipedia.org/wiki... | [
{
"answer_id": 39044,
"pm_score": 0,
"text": "<p>As a general rule no. Spiders and other arachnids generally tend to have their own field of study called arachnology.</p>\n"
},
{
"answer_id": 85715,
"pm_score": 0,
"text": "<p>The term entomology is derived from the Greek words Entomo (\"... |
17,728 | <p>1: There seem to be cases where coma patients with a non-active brain (i.e. flat EEG) have regained full consciousness. => Apparently memory and knowledge are stored independent of brain activity.</p>
<p>2: There seem to be animals (e.g. hamsters) that can be frozen to complete organic inactivity and will regain full functionality after being thawed. => Apparently the stored memory does not depend on blood flow and other support.</p>
<p>3: From this I assume that quickly cooling a human brain to a temperature low enough to avoid decomposition would preserve the state of that brain that corresponds to that human's memories, knowledge, cogntivie abilities, and maybe consciousness at the time of cooling. => With the proper technology that "content" is theoretically retrievable.</p>
<p>Q: <strong>How long would that state remain after death in a brain left at room temperature?</strong></p>
<p>Or in other words: How long does it take for decomposition to destroy memory?</p>
<hr>
<p>Addendum:</p>
<p>The fact that the stored memory may not be accessible with current means is not relevant to my question. We cannot access the information stored in <a href="http://en.wikipedia.org/wiki/Linear_A">Linear A</a>, but this unretrievability does not delete the information.</p>
| [
{
"answer_id": 17822,
"pm_score": 6,
"text": "<p>There are multiple levels of memory, some of which would die immediately, some of which would take some time. So the answer is: it depends; some immediately, some only very slowly.</p>\n\n<p>At the highest level, the current neuronal firing state of the b... | [
{
"answer_id": 17750,
"pm_score": 3,
"text": "<p>Once the thermodynamically irreversible processes we call brain-death have occurred both memories and the machinery to retrieve them are lost. </p>\n\n<p>This is not an answer but a cavil with the premise of the question. Challenges that do not destroy th... |
17,763 | <p>Since DNA is double stranded and each strand is complementary to the other, the codons on each strand will come out to be different after transcription(depending on the reading frame). Does this mean "each strand of DNA" codes for different set of proteins?</p>
| [
{
"answer_id": 17776,
"pm_score": 3,
"text": "<p>My understanding is that the antisense DNA strand (3'-5') makes the (sense) mRNA hence protein coding DNA strand where as the sense DNA strand (5'-3') is the non-proteins coding DNA strand. Hence the sense DNA produces antisense non-coding RNA, which ulti... | [
{
"answer_id": 17764,
"pm_score": 1,
"text": "<p>DNA is not always double stranded. Anyway, typically, you have islands of protein-coding genes in both strands in all six frames, i.e. a set of genes in the forward strand, then a set of genes in the reverse strand, then again a set of genes in the forwar... |
19,032 | <p>How is the fluoride in toothpaste absorbed by our body? Does the tooth absorb the molecule directly, or is it absorbed by the mouth?</p>
<p>The answers to <a href="https://biology.stackexchange.com/questions/7019/what-nutrients-can-humans-absorb-in-the-mouth">this question</a> suggest that some materials can be absorbed by the mouth, but fluoride is absent. Additionally, many municipalities <a href="http://en.wikipedia.org/wiki/Water_fluoridation" rel="nofollow noreferrer">add fluoride to tap water</a> which I should imagine is actually absorbed in the stomach by a different mechanism than that of toothpaste.</p>
<p>Note that toothpaste generally comes with stern warnings <a href="https://web.archive.org/web/20140730000400/http://blog.younglivingcircle.com/wp-content/uploads/2013/02/Toothpaste-Warning-Label-Toxic.jpg" rel="nofollow noreferrer">not to swallow</a>. Looking at the ingredients it seems the only thing that may be harmful is the fluoride itself. Therefore I <em>suspect</em> that toothpaste has a much higher fluoride concentration than tap water, which supports the notion that its fluoride is absorbed by a different mechanism than tap water.</p>
| [
{
"answer_id": 19045,
"pm_score": 5,
"text": "<p>The chemical mechanism by which fluoride protects teeth is the <a href=\"//en.wikipedia.org/wiki/Remineralisation_of_teeth\">remineralization</a> of hydroxyapatite $\\ce{Ca5(PO4)3(OH)}$ in the tooth enamel into fluorapatite $\\ce{Ca5(PO4)3F}$:</p>\n\n<p>$... | [
{
"answer_id": 19034,
"pm_score": 3,
"text": "<p>Fluoride is absorbed mostly in the stomach and small intestine.</p>\n\n<blockquote>\n <p>Several aspects of fluoride metabolism - including gastric absorption, distribution and renal excretion - are pH-dependent because the coefficient of permeability of... |
19,053 | <p><a href="http://f1000.com/prime/reports/m/3/2/" rel="nofollow">http://f1000.com/prime/reports/m/3/2/</a></p>
<blockquote>
<p>"Filaggrin is a highly abundant protein expressed in the uppermost part of the epidermis that is critical to the formation and hydration of the stratum corneum—the outermost dead cell layers responsible for the barrier function of the skin. Filaggrin deficiency leads to a 'leaky' skin barrier that allows higher than normal water loss (explaining the dry, scaly skin), as well as allowing entry of allergens through the epidermis where they trigger inflammatory and allergic immune responses (atopic eczema and allergies)."</p>
</blockquote>
<p>Not that such a supplement exists, but is it biologically possible to treat filaggrin deficiency with something taken orally?</p>
| [
{
"answer_id": 19127,
"pm_score": 3,
"text": "<p>Direct replacement of a protein through oral supplementation is extremely unlikely. Our digestive tract is designed to break down proteins into their constituent amino acids. </p>\n\n<p>In the stomach pepsin breaks proteins into polypeptides which then pa... | [
{
"answer_id": 19054,
"pm_score": 2,
"text": "<p>I highly doubt it. <a href=\"http://en.wikipedia.org/wiki/Filaggrin\" rel=\"nofollow\">Filaggrin</a> is a human protein which is expressed in the skin and stored as profilaggrin. The profilaggrin has a molecular weight of about 350 kDa (which is rather bi... |
19,055 | <p>A simple question (I could not find it on internet): What is Pan for in pan-caspase? Is it any different from the term 'caspase' ?</p>
| [
{
"answer_id": 19127,
"pm_score": 3,
"text": "<p>Direct replacement of a protein through oral supplementation is extremely unlikely. Our digestive tract is designed to break down proteins into their constituent amino acids. </p>\n\n<p>In the stomach pepsin breaks proteins into polypeptides which then pa... | [
{
"answer_id": 19054,
"pm_score": 2,
"text": "<p>I highly doubt it. <a href=\"http://en.wikipedia.org/wiki/Filaggrin\" rel=\"nofollow\">Filaggrin</a> is a human protein which is expressed in the skin and stored as profilaggrin. The profilaggrin has a molecular weight of about 350 kDa (which is rather bi... |
19,073 | <p>Have 2 organisms ever been introduced to create a symbiotic relationship that doesn't occur in their natural environment?</p>
| [
{
"answer_id": 19127,
"pm_score": 3,
"text": "<p>Direct replacement of a protein through oral supplementation is extremely unlikely. Our digestive tract is designed to break down proteins into their constituent amino acids. </p>\n\n<p>In the stomach pepsin breaks proteins into polypeptides which then pa... | [
{
"answer_id": 19054,
"pm_score": 2,
"text": "<p>I highly doubt it. <a href=\"http://en.wikipedia.org/wiki/Filaggrin\" rel=\"nofollow\">Filaggrin</a> is a human protein which is expressed in the skin and stored as profilaggrin. The profilaggrin has a molecular weight of about 350 kDa (which is rather bi... |
19,417 | <p>I heard that some point mutations in proteins are OK, like from alanine to glycine (I'm not sure, it's just an example), some will change the protein significantly. I want to understand deeper but don't know the right keyword. I have tried some but none of them works. Can you give me a good keyword to start searching? Thank you.</p>
| [
{
"answer_id": 19434,
"pm_score": 3,
"text": "<p>As others have said, although certain amino acid substitutions are considered to be conservative, the effect of a particular substitution will very much depend upon the context. Here are some examples:</p>\n\n<p><a href=\"http://www.bioc.uzh.ch/plueckthun... | [
{
"answer_id": 19419,
"pm_score": 2,
"text": "<p>I think you are referring to the concept of conserved substitution, which tends not to change the property/function (<a href=\"http://en.wikipedia.org/wiki/Sequence_alignment\" rel=\"nofollow\">http://en.wikipedia.org/wiki/Sequence_alignment</a>) of a pro... |
19,438 | <p>If I squash an insect and it produces red "juice", does it always mean it is a blood-sucking type of insect? Or do some insects have red "juice" themselves, so the color is red on its own and not caused by sucking higher animal's blood?</p>
<p>I squashed a small fly-like insect recently, it produced a red stain, so I am wondering if the stain come from the insect itself or if it has to be some other animal's blood.</p>
| [
{
"answer_id": 19439,
"pm_score": 5,
"text": "<p>No - <a href=\"http://en.wikipedia.org/wiki/Blood#Invertebrates\" rel=\"noreferrer\">invertebrates don't have "blood" though they do have hemolymph</a>. Hemolymph flows around the body cavity, rather than through vessels such as veins and capill... | [
{
"answer_id": 19440,
"pm_score": 3,
"text": "<p>Insects do not have blood as we know it from the higher animals. They have a kind of, which is called <a href=\"http://en.wikipedia.org/wiki/Hemolymph\">hemolymph</a> and is, compared to human a mixture of blood and the lymphatic fluid. The most important... |
19,466 | <p>Maybe I'm confused by the term "codominance", but I wondering if codominance only occurs with two dominant alleles. </p>
<p>Can two recessive alleles produce codominance in an individual?</p>
<p>Likewise, can two recessive alleles produce incomplete dominance?</p>
| [
{
"answer_id": 19475,
"pm_score": 3,
"text": "<p>An allele is not dominant or recessive by itself. It is dominant or recessive compared to another allele. Therefore, if you consider one locus (position on a sequence) that has two alleles (bi-allelic locus), you cannot have two dominant or two recessive ... | [
{
"answer_id": 19467,
"pm_score": 1,
"text": "<p>When two alleles show codiminance, they are not described as dominant or recessive relative to each other. They are simply codiminant to each other. The same applies to incomplete dominance.</p>\n\n<p>Note that all these terms are relative to the alleles ... |
19,525 | <p>I recently attended an awake brain surgery for deep brain stimulation and it seemed to me that only the skin surrounding the drilled hole got local anaesthesia. I know that the brain itself does not have nociceptors, but what about the skull? And how does this compare to other bones in the body? Would you feel a hole being drilled in your skull? Would you feel your leg being chopped off if the surrounding tissue was numbed? </p>
| [
{
"answer_id": 20275,
"pm_score": 3,
"text": "<p>Thanks for your answer Alexandria,</p>\n\n<p>As you didn't seem entirely confident about the innervation in the skull bone, I ended up asking the neurosurgeon, and she indeed only anaesthetises the skin surrounding the drill hole and the subcutaneous tiss... | [
{
"answer_id": 19733,
"pm_score": 2,
"text": "<p>Yes, bones can be innervated. I say \"can be\" because although I'm not certain that ALL are, I know that most are. \"Innervation\" is your key word to learning more about the presence or absence of nerves reaching to any body part. Googling \"are bones i... |
19,692 | <p>It is known from theoretician in the field of kin selection that kin selection (inclusive fitness theory) and group selection are actually two sides of the same coin. In other words, these two concepts are actually only one single process.</p>
<p><strong>Questions</strong></p>
<ul>
<li>Is group selection equivalent to kin selection for any evolutionary game or exclusively for the prisoner's dilemna?</li>
<li>Can you please provide an intuitive explanation of why kin- and group-selection are the same thing?</li>
</ul>
| [
{
"answer_id": 31378,
"pm_score": 4,
"text": "<p>First of all, there is a very heated debate about this in the field of social evolution at present, and you aren't likely to get a conclusive answer. One theorist may give you one answer, but another will vehemently disagree. I'll start by logically answe... | [
{
"answer_id": 26436,
"pm_score": 1,
"text": "<p>Regarding the equivalence of MLS and kin selection, here is how I see the equivalence between these two approaches to selection. \nMLS says that cooperation is favored when the response to\nbetween-group selection outweighs within-group selection. Price's... |
19,707 | <p>I'm looking for a surface, that will be impassable for ant's yet not poisonous or easily decaying.</p>
<p>One idea is water - they really can't cross that. But water easily dries and is quite uncomfortable.</p>
<p>Is there something their legs will find uncomfortable? Something spiky for example?</p>
| [
{
"answer_id": 19739,
"pm_score": 3,
"text": "<p>Fluon is a substance that people use to make artificial ant nests. It is similar to teflon in property and fluon coated surfaces are too slippery for ants to cross. See <a href=\"http://krungkuene.org/ameisen_page/fluon.html\" rel=\"nofollow\">here</a>.</... | [
{
"answer_id": 19710,
"pm_score": 3,
"text": "<p>I've found that ants do not walk through petroleum jelly. It is also convenient, as it isn't too messy, and can be whatever shape you want. I use it to keep ants from climbing into my hummingbird feeders. Make sure the area you treat is wider than the ant... |
19,760 | <p>The problem I've always had with evolution is the actual lack of variation between animals. More specifically, the lack of observable gradual change between species.</p>
<p>Take for example the hammerhead shark. It obviously has a strong connection with a normal shark, but where's the "half-hammerhead" shark? Where's the species that only has a SLIGHTLY wider head?</p>
<p>I really doubt that a single mutation on a normal shark resulted in a head shaped like that, it had to happen gradually. Right? As far as I understand, evolution works by random mutation in a child being somehow slightly beneficial to that animal so it get's to live longer and reproduce more, eventually resulting in it's genetic material in dominating the inferior ones before it. But if it was for whatever reason beneficial to have a slightly wider head, why don't all the sharks have slightly wider heads now? On the other hand, if it wasn't beneficial, how come the hammerhead still exists?</p>
<p>Furthermore, I feel like some characteristics of a certain animal can't really have gradual benefits. There's a lizard that shoots blood out of it's eyes. The original ancestor certainly didn't, and I'm sure that if it's child only bled slightly from it's eyes it wouldn't really help if much in life. So for it to actually become beneficial, it seems to me that there had to be a ton of lizards that had a disadvantage of bleeding slightly. In fact, there had to be so many that they evolved even further in the same direction and kept doing that until they bled so much it's an actual benefit (sorry for this turning so gross). So why did the inbetweeners survive long enough to evolve even more, and why did they THEN die out?</p>
| [
{
"answer_id": 19769,
"pm_score": 5,
"text": "<blockquote>\n <p>More specifically, the lack of observable gradual change between species.</p>\n</blockquote>\n\n<p>Most significant phenotype differences occur over several thousand generations, which means several thousand years on up. While we certainly... | [
{
"answer_id": 19761,
"pm_score": 2,
"text": "<p>This sounds like a very basic question in evolutionary biology that often ask for a very long answer. But I think that you may get the answer you're looking for just if we ask you back how many inbetweeners would you expect to exist between the hammerhead... |
19,767 | <p>With supercomputers doing calculation in petaflops ($10^{15}$ Calculations per Second), have we crossed the speed of Human Brain?</p>
| [
{
"answer_id": 31304,
"pm_score": 5,
"text": "<p>There's a very big difference between doing the calculations needed to simulate the human brain (or any animal brain - we can do a fairly decent job on <em>C. elegans</em>), and doing computations. While a basic leaky integrate & fire model is fairly... | [
{
"answer_id": 19768,
"pm_score": 5,
"text": "<p>I will just show the statistics of last attempt to mimic the brain process.</p>\n\n<p>In 2011 fastest computer in Japan was launched: </p>\n\n<h2><strong>K computer OR SPARC64 VIIIfx 2.0GHz</strong></h2>\n\n<p>Features:</p>\n\n<ul>\n<li><strong>Manufactur... |
19,850 | <p>What causes the noise when you crack a joint? Is joint cracking harmful? </p>
| [
{
"answer_id": 19851,
"pm_score": 7,
"text": "<p>The exact mechanism is unclear. Here are some possible causes:</p>\n\n<ul>\n<li>rapid collapsing of cavities inside the joint [1];</li>\n<li>rapid ligament stretching [1];</li>\n<li>breaking of intra-articular adhesions [1];</li>\n<li>escaping gases from ... | [
{
"answer_id": 19868,
"pm_score": 4,
"text": "<p>Is joint-cracking harmful? No. Donald Unger was told by his mother that he'd get arthritis if he cracked his knuckles so he cracked his left knuckles every day for 60 years but never his right knuckles. He had no arthritis or any other problems in eithe... |
19,918 | <p>I'm writing a novel in which the main character's perception and thought processes are sped up considerably, in essence slowing down the world around him. To others, it seems like his reactions are far faster than normal. Of course, there's a fantasy explanation for this in the story, but it led me to wonder exactly what limits the speed of human perception and reasoning in the real world.</p>
<p>From what I know, the speed at which we perceive events appears to be a constant. What exactly determines that rate? Is it possible to change it? Is it possible that different people perceive things at different speeds?</p>
| [
{
"answer_id": 19923,
"pm_score": 5,
"text": "<h2><strong>Flicker Fusion Threshold:</strong></h2>\n\n<p>The wikipedia definition:</p>\n\n<blockquote>\n <p><strong>It is defined as the frequency at which an intermittent light stimulus appears to be completely steady to the average human observer.</stron... | [
{
"answer_id": 19925,
"pm_score": 2,
"text": "<p>The limitations are of several natures: cognitive once the signal has arrived in the brain, but also physical within the eye e.g. for vision.</p>\n\n<p>For vision, the crucial bit is to transform changes of incoming light into an electrical signal. It is ... |
20,067 | <p>Has the human species changed since first defined as homo sapiens sapiens?</p>
<p>I'm asking this question partly because I'm wondering how we might evolve next.</p>
| [
{
"answer_id": 20071,
"pm_score": 4,
"text": "<p>We continue to evolve all the time: <a href=\"http://www.npr.org/2013/09/27/226837803/modern-humans-still-evolving-and-faster-than-ever\" rel=\"nofollow noreferrer\">http://www.npr.org/2013/09/27/226837803/modern-humans-still-evolving-and-faster-than-ever... | [
{
"answer_id": 55859,
"pm_score": 0,
"text": "<blockquote>\n <p>An additional question is, are we evolving in a positive or negative\n way stronger vs weaker.</p>\n</blockquote>\n\n<p>That would depend on what you consider week or strong. All evolution really cares about is how many babies do you succ... |
20,078 | <p>This is a quote from <a href="http://onlinelibrary.wiley.com/doi/10.1111/ibi.12158/abstract">Dey et al 2014</a>:</p>
<blockquote>
<p>Hatching asynchrony is thought to be adaptive because...</p>
</blockquote>
<p>What exactly does adaptive mean here? Does it mean hatching asynchrony has fitness benefits? Or does it mean hatching asynchrony is likely to be selected for?</p>
| [
{
"answer_id": 20142,
"pm_score": 4,
"text": "<p>A trait is said to be adaptive when it causes fitness to increase. Fitness is generally understood as the (relative) contribution to future generations in terms of offspring or genes. The trait is selected for by the environment and hence increases fitnes... | [
{
"answer_id": 20080,
"pm_score": 3,
"text": "<p>The question is probably more complicated than it seems because, if I am not wrong, the word adaptation here is understood at the group level.</p>\n\n<p><strong>Definitions of adaptation</strong></p>\n\n<p>Unfortunately, there is not such thing as a singl... |
20,109 | <p>DNA is charged negative because of its phosphate backbone. Since charges need to be balanced (so that there are no charges building up somewhere), what is the positive charge which neutralizes this negative charge?</p>
| [
{
"answer_id": 20112,
"pm_score": 5,
"text": "<p>DNA in the body is not available as a free molecule, it is organized around DNA binding proteins, mostly the <a href=\"http://en.wikipedia.org/wiki/Histone_octamer\" rel=\"nofollow noreferrer\">histone octamers</a>. These proteins carry positive charges (... | [
{
"answer_id": 20111,
"pm_score": 2,
"text": "<p>Your cells have a high concentration of sodium ions that are positive. Other important cations are potassium and calcium. Additionally, many amino acids are positively charged at physiological pH. DNA is not the only source of negative charge in your body... |
20,174 | <p>Let's say I go to the gym and lift some weights an hour. During this time my arms will grow due to the "pump" -- the extra blood rushing in to feed the muscles. For example, I've measured about 2-3 centimeters increase just in the diameter of the upper arm (bicep+tricep).</p>
<p>But where did this blood come from? Also, if my arms got bigger, since I'm the same weight that means some part of my body must have gotten smaller, right?</p>
| [
{
"answer_id": 20182,
"pm_score": 5,
"text": "<p>The blood comes from the body's reservoirs:</p>\n\n<ul>\n<li>spleen (mostly erythrocytes) [1]</li>\n<li>liver [2]</li>\n<li>veins (probably the most important blood resevoir as they contain 50-60 % of the volume) [3]</li>\n</ul>\n\n<p>In pathological situ... | [
{
"answer_id": 20178,
"pm_score": 2,
"text": "<p>If you stand up too quickly, you get a head rush. One way to counteract the symptoms of the head rush is to contract your leg muscles really intensely. This forces blood out of your legs and into the rest of your circulation, including your head. This is ... |
20,191 | <p>There appears to be a lot of material on the internet claiming that viruses can be only seen with electron microscopes, and not with light microscopes. To the contrary, for example <a href="http://www.nature.com/nature/journal/v162/n4111/abs/162251a0.html">this old paper published in Nature</a> states that viruses <em>can be seen</em> using phase-contrast (light) microscopy. Who's correct? What is the smallest thing I can see using a phase-contrast microscope?</p>
| [
{
"answer_id": 20192,
"pm_score": 4,
"text": "<p>It is true for most viruses. They have a size of roughly 1/100 of bacteria (or smaller), so they are too small to be seen in light microscopy. According to <a href=\"http://en.wikipedia.org/wiki/Optical_microscope\" rel=\"noreferrer\">Wikipedia</a> the ma... | [
{
"answer_id": 56225,
"pm_score": 2,
"text": "<p>It is true generally but it's not an absolutely truth. </p>\n\n<p>There is a group of giant viruses which can be seen under the traditional light microscope - such as the <strong>pandoravirous</strong> - which its size is about 1000 nano-meters. </p>\n\n<... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.