chunk_id string | chunk string |
|---|---|
9a5e6cd28aad9b3982063052a853dbb2_12 | The viral load of RV positive samples were quantified by qRT-PCR as described in the manuscript published by Lu and coworkers [10] . The Eurogentec One-Step Reverse Transcriptase qPCR kit was used for preparation of the master mix as described above. The primerset |
9a5e6cd28aad9b3982063052a853dbb2_13 | HRSV-AF F 669-695 ctgtgatagarttccaacaaaagaaca [8, 9] HRSV-AF F 718-745 agttacacctgcattaacactaaattcc [8, 9] HRSV-BN N 435-458 ggctccagaatataggcatgattc [8, 9] HRSV-BN N 480-508 tggttattacaagaagagcagctatacacagt [8, 9] MGB probes and probe, located in 5'UTR, were added to a final concentration of 1 μM and 0.1 μM, respectiv... |
9a5e6cd28aad9b3982063052a853dbb2_14 | completed. (37.5%) men, with a median age of 29 (range 9 -46 years). Age and gender was missing for 2 participants of the second group. In total, 52% of the participants were between 20-30 years old. Only 6% were younger than 20 years old and 3% were older than 70 years. In totality, 80 patients (78.4%) were already fe... |
9a5e6cd28aad9b3982063052a853dbb2_15 | In a first part of the study, we collected 70 EBCs. Screening of the EBCs for 14 respiratory viruses (Table 2) , showed 5 RV (7.1%) positive samples (Table 3 ). In a second part, we collected 32 EBCs from patients that presented themselves to their general practitioner. Two of these EBCs were positive for one of the 14... |
9a5e6cd28aad9b3982063052a853dbb2_16 | EBC and the NS was confirmed for only 1 sample: sample 71, which tested positive for RV in both the EBC and the NS. For sample 81, RV was detected in the NS and analysis of the EBC demonstrated an InfB infection. |
9a5e6cd28aad9b3982063052a853dbb2_17 | For EBC samples that were collected in the fall and winter of 2009/2010, measurements with the ECoVent in (Table 3 , sample 81) was positive for InfB when using the RTube™ in combination with the EcoVent. In theory, the viral generation rate (number of viral RNA copies exhaled per minute) can be predicted by quantifica... |
9a5e6cd28aad9b3982063052a853dbb2_18 | Collection of exhaled breath condensates is a novel and non-invasive method for obtaining samples of the upper respiratory tract. The collection of EBC is easy to perform and can be conducted in a home environment. This method is much more agreeable for the patient when compared to the unpleasant and invasive collectio... |
9a5e6cd28aad9b3982063052a853dbb2_19 | Until now, this is the study with the largest subset of volunteers that investigated EBC as a specimen for the detection of respiratory viruses. Previous studies reported the inclusion of a limited subset of participants and investigated the presence of a limited number of viruses in the breath samples. The study perfo... |
9a5e6cd28aad9b3982063052a853dbb2_20 | presumed that they were already recovering from the infection and were no longer exhaling the virus. For common cold infections it is suggested that a person may already be infectious for 1 or 2 days before experiencing any symptoms. However, in a second part of our study we started collecting EBCs in parallel with nas... |
9a5e6cd28aad9b3982063052a853dbb2_21 | positive NS may have possibly suffered from an upper airway infection whereas EBC positive volunteers may have experienced a more advanced, lower respiratory tract infection. However, the effect of nasal inhalation on EBC collection, guiding formed particles in the upper respiratory tract to the lower compartments, in ... |
9a5e6cd28aad9b3982063052a853dbb2_22 | shivering and muscle pain whereas this symptom was not indicated by any patient of the EBC positive group. In all groups fever, headache, watering eyes, stuffed nose, frequent sneezing, sore throat and coughing were reported. |
9a5e6cd28aad9b3982063052a853dbb2_23 | Volunteers were not diagnosed with other pathogens before participation in the study. Since we did not test these samples for other than viral pathogens, we can not exclude the possibility that some of the negative NS are positive for bacteria or other pathogens causing respiratory illness. Recently, one study reported... |
9a5e6cd28aad9b3982063052a853dbb2_24 | larger particles. Possibly, the lower detection rate can partly be explained by the fact that the RTube™ is manufactured in polypropylene and does not possess a virus attracting and filtering feature like the aforementioned materials. |
9a5e6cd28aad9b3982063052a853dbb2_25 | The qRT-PCR developed by Lu and coworkers for the detection of RV, did not allow the assessment of the viral load present in the EBC samples [10] . Also for 4 NS, the viral titer remained undetermined, probably due to the limited sensitivity of the assay. For diagnosis, more sensitive methods might be necessary to dete... |
9a5e6cd28aad9b3982063052a853dbb2_26 | Also person-dependent factors, such as the number of particles produced, the exhaled volume and the age of the patient, have been suggested to play an important role for exhalation of viral particles. The participants that were recruited in the study of Fabian and coworkers were 12 years of age and older [12] . For hos... |
9a5e6cd28aad9b3982063052a853dbb2_27 | For influenza, an exhaled generation rate of <3.2 to 20 influenza RNA copies per minute was predicted by quantifying the virus aerosols that impacted on a removable Teflon filter of a collection mask [12] . We used the RTube™ in combination with the ECoVent, that allowed the registration of additional ventilation param... |
9a5e6cd28aad9b3982063052a853dbb2_28 | Although an inventive, new and promising method, EBC collected by the RTube™ does not appear to be appropriate for diagnosis of respiratory infections. Nonetheless, this method may provide an alternative for current sample procurement for epidemiological studies of circulating viruses. This technique also confirms the ... |
9a5e6cd28aad9b3982063052a853dbb2_29 | In addition, EBC collection from patients during respiratory infections may be further investigated for biomarker patterns. In calves that were experimentally infected with bovine RSV, an increase in leukotriene B 4 , indicating oxidative stress, was observed. This increased level was also associated with the developme... |
9a5e6cd28aad9b3982063052a853dbb2_30 | condensates of individuals experiencing a viral infection might imply interesting findings towards the identification of markers reflecting inflammation or antiviral protection. This may contribute to the biomarker profiles established for diseases like asthma and COPD, for which viral infections are suggested to trigg... |
9cac61f0d3c65a74ddd079765b2d8769_0 | Community-acquired pneumonia in children — a changing spectrum of disease
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5608782/
SHA: eecb946b106a94f26a79a964f0160e8e16f79f42
Authors: le Roux, David M.; Zar, Heather J.
Date: 2017-09-21
DOI: 10.1007/s00247-017-3827-8
License: cc-by |
9cac61f0d3c65a74ddd079765b2d8769_1 | Abstract: Pneumonia remains the leading cause of death in children outside the neonatal period, despite advances in prevention and management. Over the last 20 years, there has been a substantial decrease in the incidence of childhood pneumonia and pneumonia-associated mortality. New conjugate vaccines against Haemophi... |
9cac61f0d3c65a74ddd079765b2d8769_2 | Text: Pneumonia has been the leading cause of death in children younger than 5 years for decades. Although there have been substantial decreases in overall child mortality and in pneumonia-specific mortality, pneumonia remains the major single cause of death in children outside the neonatal period, causing approximatel... |
9cac61f0d3c65a74ddd079765b2d8769_3 | outcome in children. |
9cac61f0d3c65a74ddd079765b2d8769_4 | The overall burden of childhood pneumonia has been reduced substantially over the last decade, despite an increase in the global childhood population from 605 million in 2000 to 664 million in 2015 [2] . Recent data suggest that there has been a 25% decrease in the incidence of pneumonia, from 0.29 episodes per child y... |
9cac61f0d3c65a74ddd079765b2d8769_5 | Notwithstanding this progress, there remains a disproportionate burden of disease in low-and middle-income countries, where more than 90% of pneumonia cases and deaths occur. The incidence in high-income countries is estimated at 0.015 episodes per child year, compared to 0.22 episodes per child year in low-and middle-... |
9cac61f0d3c65a74ddd079765b2d8769_6 | Childhood pneumonia can also lead to significant morbidity and chronic disease. Early life pneumonia can impair longterm lung health by decreasing lung function [6] . Severe or recurrent pneumonia can have a worse effect on lung function; increasing evidence suggests that chronic obstructive pulmonary disease might be ... |
9cac61f0d3c65a74ddd079765b2d8769_7 | across the life course. |
9cac61f0d3c65a74ddd079765b2d8769_8 | Chest radiologic changes have been considered the gold standard for defining a pneumonia event [11] because clinical findings can be subjective and clinical definitions of pneumonia can be nonspecific. In 2005, to aid in defining outcomes of pneumococcal vaccine studies, the World Health Organization's (WHO) standardiz... |
9cac61f0d3c65a74ddd079765b2d8769_9 | pulmonary parenchymal infiltrate (including "other" infiltrate). |
9cac61f0d3c65a74ddd079765b2d8769_10 | Widespread use of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination has decreased the incidence of radiologic pneumonia. In a review of four randomized controlled trials and two case-control studies of Haemophilus influenzae type B conjugate vaccination in high-burden communitie... |
9cac61f0d3c65a74ddd079765b2d8769_11 | The WHO radiologic case definition was not intended to distinguish bacterial from viral etiology but rather to define a sub-set of pneumonia cases in which pneumococcal infection was considered more likely and to provide a set of standardized definitions through which researchers could achieve broad agreement in report... |
9cac61f0d3c65a74ddd079765b2d8769_12 | WHO-defined alveolar consolidation, as well as those with other abnormal chest radiograph infiltrates and a serum C-reactive protein of at least 40 mg/L [21, 22] . This definition has been shown to have greater sensitivity than the original WHO radiologic definition of primary end-point pneumonia for detecting the burd... |
9cac61f0d3c65a74ddd079765b2d8769_13 | evidence to suggest that pneumococcal conjugate vaccination modifies the radiologic appearance of pneumococcal pneumonia. |
9cac61f0d3c65a74ddd079765b2d8769_14 | Empyema is a rare complication of pneumonia. An increased incidence of empyema in children was noted in some high-income countries following pneumococcal conjugate vaccination-7 introduction, and this was attributed to pneumococcal serotypes not included in pneumococcal conjugate vaccination-7, especially 3 and 19A [24... |
9cac61f0d3c65a74ddd079765b2d8769_15 | children younger than 5 years [28] ; similarly, data from the United Kingdom and Scotland showed substantial reduction in pediatric empyema following pneumococcal conjugate vaccination-13 introduction [29, 30] . |
9cac61f0d3c65a74ddd079765b2d8769_16 | Several national guidelines from high-income countries, as well as the WHO recommendations for low-and middleincome countries, recommend that chest radiography should not be routinely performed in children with ambulatory pneumonia [31] [32] [33] . Indications for chest radiography include hospitalization, severe hypox... |
9cac61f0d3c65a74ddd079765b2d8769_17 | In addition to the effect on radiologic pneumonia, pneumococcal conjugate vaccination reduces the risk of hospitalization from viral-associated pneumonia, probably by reducing bacterial-viral co-infections resulting in severe disease and hospitalization [35] . An analysis of ecological and observational studies of pneu... |
9cac61f0d3c65a74ddd079765b2d8769_18 | A systematic review of etiology studies prior to availability of new conjugate vaccines confirmed S. pneumoniae and H. influenzae type B as the most important bacterial causes of pneumonia, with Staphylococcus aureus and Klebsiella pneumoniae associated with some severe cases. Respiratory syncytial virus was the leadin... |
9cac61f0d3c65a74ddd079765b2d8769_19 | More recent meta-analyses of etiology data suggest a changing pathogen profile, with increasing recognition that clinical pneumonia is caused by the sequential or concurrent interaction of more than one organism. Severe disease in particular is often caused by multiple pathogens. With high coverage of pneumococcal conj... |
9cac61f0d3c65a74ddd079765b2d8769_20 | evidence of causal attribution for respiratory syncytial virus, influenza, metapneumovirus and parainfluenza virus [42] . However there was no consistent evidence that many other commonly described viruses, including rhinovirus, adenovirus, bocavirus and coronavirus, were more commonly isolated from cases than from con... |
9cac61f0d3c65a74ddd079765b2d8769_21 | Another etiology is pertussis. In the last decade there has also been a resurgence in pertussis cases, especially in highincome countries [44] . Because pertussis immunity after acellular pertussis vaccination is less long-lasting than immunity after wild-type infection or whole-cell vaccination, many women of child-be... |
9cac61f0d3c65a74ddd079765b2d8769_22 | recent evidence from South Africa (where the acellular vaccine is used) shows an appreciable incidence of pertussis among infants presenting with acute pneumonia: 2% of clinical pneumonia cases among infants enrolled in a birth cohort were caused by pertussis [39] , and 3.7% of infants and young children presenting to ... |
9cac61f0d3c65a74ddd079765b2d8769_23 | Similarly, childhood tuberculosis is a major cause of morbidity and mortality in many low-and middle-income countries, and Mycobacterium tuberculosis has increasingly been recognized as a pathogen in acute pneumonia in children living in high tuberculosis-prevalence settings. Postmortem studies of children dying from a... |
9cac61f0d3c65a74ddd079765b2d8769_24 | Childhood pneumonia and clinically severe disease result from a complex interaction of host and environmental risk factors [37] . Because of the effectiveness of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination for prevention of radiologic and clinical pneumonia, incomplete or ... |
9cac61f0d3c65a74ddd079765b2d8769_25 | (4.5), stunting (2.6) and wasting (2.8) . Household crowding has uniform risk, with odds ratios between 1.9 and 2.3 in both low-and middle-income countries and high-income countries. Indoor air pollution from use of solid or biomass fuels increases odds of pneumonia by 1.6 times; lack of measles vaccination by the end ... |
9cac61f0d3c65a74ddd079765b2d8769_26 | The single strongest risk factor for pneumonia is HIV infection, which is especially prevalent in children in sub-Saharan Africa. HIV-infected children have 6 times increased odds of developing severe pneumonia or of death compared to HIV-uninfected children [52] . Since the effective prevention of mother-to-child tran... |
9cac61f0d3c65a74ddd079765b2d8769_27 | The pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination have been effective tools to decrease pneumonia incidence, severity and mortality [58, 59] . However, equitable coverage and access to vaccines remains sub-optimal. By the end of 2015, Haemophilus influenzae type B conjugate ... |
9cac61f0d3c65a74ddd079765b2d8769_28 | will in low-and middle-income countries to commit to immunization as a priority, social marketing to individuals and communities, strengthening health systems and promoting relevant local research and development innovations [61] . |
9cac61f0d3c65a74ddd079765b2d8769_29 | Maternal vaccination to prevent disease in the youngest infants has been shown to be effective for tetanus, influenza and pertussis [62] . Influenza vaccination during pregnancy is safe, provides reasonable maternal protection against influenza, and also protects infants for a limited period from confirmed influenza in... |
9cac61f0d3c65a74ddd079765b2d8769_30 | Improved access to health care, better nutrition and improved living conditions might contribute to further decreases in childhood pneumonia burden. The WHO Integrated Global Action Plan for diarrhea and pneumonia highlights many opportunities to protect, prevent and treat children [68] . Breastfeeding rates can be imp... |
9cac61f0d3c65a74ddd079765b2d8769_31 | Community-based interventions reduce pneumonia mortality and have the indirect effect of improved-careseeking behavior [58] . If these cost-effective interventions were scaled up, it is estimated that 67% of pneumonia deaths in lowand middle-income countries could be prevented by 2025 [58] . |
9cac61f0d3c65a74ddd079765b2d8769_32 | Case management of pneumonia is a strategy by which severity of disease is classified as severe or non-severe. All children receive early, appropriate oral antibiotics, and severe cases are referred for parenteral antibiotics. When implemented in highburden areas before the availability of conjugate vaccines, case mana... |
9cac61f0d3c65a74ddd079765b2d8769_33 | failure in the placebo group, which was deemed to be non-equivalent to the antibiotic group [75] . Furthermore, because WHO-classified non-severe pneumonia and bronchiolitis might be considered within a spectrum of lower respiratory disease, many children with clinical pneumonia could actually have viral bronchiolitis,... |
9cac61f0d3c65a74ddd079765b2d8769_34 | pneumonia guidelines still recommend antibiotic treatment for all children who meet the WHO pneumonia case definitions [80] . |
9cac61f0d3c65a74ddd079765b2d8769_35 | Use of supplemental oxygen is life-saving, but this is not universally available in low-and middle-income countries; it is estimated that use of supplemental oxygen systems could reduce mortality of children with hypoxic pneumonia by 20% [81] . Identifying systems capacity to increase availability of oxygen in health f... |
9cac61f0d3c65a74ddd079765b2d8769_36 | Much progress has been made in decreasing deaths caused by childhood pneumonia. Improved socioeconomic status and vaccinations, primarily the conjugate vaccines (against Haemophilus influenzae and pneumococcus), have led to substantial reductions in the incidence and severity of childhood pneumonia. Stronger strategies... |
6affe5fdf4b3dbc765ce1e33b3124244_0 | Immunomodulatory Activity and Protective Effects of Polysaccharide from Eupatorium adenophorum Leaf Extract on Highly Pathogenic H5N1 Influenza Infection
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3789439/
SHA: efba2008a6ccf1ad2614aebd79a6a741ea6538b9
Authors: Jin, Yi; Zhang, Yuewei; Wan, Chunyan; Wang, Hongjun; H... |
6affe5fdf4b3dbc765ce1e33b3124244_1 | Abstract: The development of novel broad-spectrum, antiviral agents against H5N1 infection is urgently needed. In this study, we evaluated the immunomodulatory activities and protective effect of Eupatorium adenophorum polysaccharide (EAP) against the highly pathogenic H5N1 subtype influenza virus. EAP treatment signif... |
6affe5fdf4b3dbc765ce1e33b3124244_2 | of novel antiinfluenza agents and benefits of E. adenophorum products. |
6affe5fdf4b3dbc765ce1e33b3124244_3 | Text: Highly pathogenic H5N1 subtype influenza virus can be transmitted directly from poultry to human and cause acute respiratory infections. Pandemic influenza virus H5N1 posed a worldwide threat to the public health because of rapid spread and high pathogenicity [1, 2] . The symptoms in animals or humans infected wi... |
6affe5fdf4b3dbc765ce1e33b3124244_4 | Unfortunately, their benefits have been significantly restricted by drug-resistance and frequent antigenic mutation [5, 6] . Therefore, the development of novel antiinfluenza agents against the H5N1 subtype is very important. |
6affe5fdf4b3dbc765ce1e33b3124244_5 | The invasive plant Eupatorium adenophorum, native to Central America, has a strong ability to adapt to different environments all over the world. This plant first invaded southern Yunnan Province (China) in the 1940s from Burma and Vietnam, and quickly spread across southwestern China throughout the 1950s [7, 8] . Over... |
6affe5fdf4b3dbc765ce1e33b3124244_6 | have been few reports addressing the bioactivity of E. adenophorum polysaccharide (EAP). |
6affe5fdf4b3dbc765ce1e33b3124244_7 | The immunomodulating properties and therapeutic potential of a large number of botanical polysaccharides have been reported [11] . Several polysaccharides from Cordyceps militaris, Portulaca oleracea, Gracilaria lemaneiformis, Gyrodinium impudium, and Panax ginseng have been described as efficacious antiinfluenza agent... |
6affe5fdf4b3dbc765ce1e33b3124244_8 | In the present study, we investigated the potential effect of EAP against H5N1 influenza infection in a mouse model. Immune enhancement effects and the innate immune recognition of EAP were also evaluated. Our results suggest the anti-H5N1 effects of EAP offer an alternative strategy for developing antiinfluenza agents... |
6affe5fdf4b3dbc765ce1e33b3124244_9 | Animal and Cells. 8-10-week-old Female BALB/c mice were obtained from Vital River Laboratories (Beijing, China), and the original breeding pairs were purchased from Charles River (Beijing, China). Mice were raised in independent ventilated cages (IVC) and received pathogen-free food and water. Animal treatments were go... |
6affe5fdf4b3dbc765ce1e33b3124244_10 | Yunnan province, China. The leaves were sliced and dried in shade. 100 g dried materials were powdered in a mixer and then filtered with 40 meshes. Leaf powder was extracted by ultrasonic treatment with 1000 mL of distilled water for 45 min. The supernatant was collected and the precipitate resuspended in 1000 mL of di... |
6affe5fdf4b3dbc765ce1e33b3124244_11 | The extract was centrifuged at 3000 g/min for 25 min and concentrated under 80 ∘ C for 8 h to prepare polysaccharide. The supernatant was then deproteinized using the Sevag method, and dialyzed against water for 48 h. The final liquid was mixed with three-fold volume of 95% ethanol (v/v) and centrifuged at 3000 g/min f... |
6affe5fdf4b3dbc765ce1e33b3124244_12 | Assay. Mice were administrated EAP at a dose of 5, 10, 25, or 50 mg/kg body weight, intranasally once daily for 5 days before the challenge. Control mice were administered PBS using the same schedule. Influenza virus stocks were diluted in PBS. Mice were anesthetized with Zotile (Virbac, France) intramuscularly at 15 m... |
6affe5fdf4b3dbc765ce1e33b3124244_13 | 2.6. Plaque Assay. MDCK cells were cultured in DMEM (Hyclone Laboratories, Logan, UT, USA) containing 10% FBS (Hyclone Laboratories), 100 U/mL penicillin, and 100 g/mL streptomycin (Invitrogen, San Diego, CA, USA). Lung tissue supernatant was diluted 10-fold and added to a cell monolayer covered by semisolid agar conta... |
6affe5fdf4b3dbc765ce1e33b3124244_14 | Total RNA from 1 × 10 6 cells or 10 mg lung tissue were prepared by Trizol (Invitrogen) according to the manufacturer's instructions. DNaseItreated RNA (0.2 g) was reverse transcribed into cDNA using random primers. The expression of the hemagglutinin (HA) gene of H5N1 influenza virus was detected by qPCR using the Pow... |
6affe5fdf4b3dbc765ce1e33b3124244_15 | concentration as a standard. |
6affe5fdf4b3dbc765ce1e33b3124244_16 | Relative qPCR was performed for other eight genes: hactin, h IL-6, h IFN-, and hTNF-for A549 cells; mactin, mTLR-2, mTLR-4, mDectin-1, mMR, mIL-6, mIFN-, and mTNF-for Raw264.7 cells. The sequences of primers were shown in Table 1 . The reaction was run with 95 ∘ C for 10 min, followed by 40 cycles of denaturation at 95... |
6affe5fdf4b3dbc765ce1e33b3124244_17 | 2.8. ELISA. IL-6, TNF-, and IFN-levels in lung were tested with ELISA kits (Boster, Wuhan, China) according to the manufacturer's protocol. One gram of lung tissue from each mouse was ground in 1 mL PBS and centrifuged for 20 min at 5000 rpm. The supernatants were collected and diluted 10fold for ELISA. 2.10. Statistic... |
6affe5fdf4b3dbc765ce1e33b3124244_18 | Many botanical polysaccharides exhibit an immunomodulatory effect [11] . To determine the immunomodulatory properties of EAP, we investigated the potential effect of the polysaccharides on A549 and Raw264.7 cells. Cells were treated with various concentrations of EAP (50, 100, 200 g/mL) for 36 h. The mRNA levels of IL-... |
6affe5fdf4b3dbc765ce1e33b3124244_19 | To test whether EAP could protect H5N1 infected mice, mice were treated with EAP at a dose of 5, 10, 25, or 50 mg/kg body weight intranasally once daily for 5 days prior to viral challenge with 120 PFU. Ten mice per group were monitored for 14 days for the survival rate. As shown in Figure 2 (a), all mice receiving PBS... |
6affe5fdf4b3dbc765ce1e33b3124244_20 | To determine the viral load in the lung of the infected mice, plaque assays and qPCR were performed. The pulmonary viral titers in the EAP (25 mg/kg) group were significantly lower than the titers in the mice that received PBS at day 3 postinfection (Figures 2(c) and 2(d) ). These data clearly indicate that intranasal ... |
6affe5fdf4b3dbc765ce1e33b3124244_21 | group ( = 0.0599) (Figures 3(g)-3(i) ). These results suggest that EAP increases the IL-6, TNF-, and IFN-production. |
6affe5fdf4b3dbc765ce1e33b3124244_22 | IL-6, TNF-, and IFN-expression at day 3 postinfection was determined by qPCR. In contrast, TNF-mRNA levels following EAP (25 mg/kg) treatment were significantly lower than those in the PBS group (Figure 3(e) ), while IL-6 and IFN-expression were only slightly lower (not significant) (Figures 3(d) and 3(f) ). These resu... |
6affe5fdf4b3dbc765ce1e33b3124244_23 | Excessive inflammation can cause severe lung lesions during H5N1 influenza infection. To evaluate histopathological changes in the lungs of infected mice, tissues of each group at day 3 postinfection were examined. The lungs of PBS treated mice exhibited a severe inflammation response, characterized by interstitial ede... |
6affe5fdf4b3dbc765ce1e33b3124244_24 | Polysaccharides derived from many plants enhance the secretion of cytokines and chemokines, such as TNF-, IL-6, IL-8, and IL-12 [11] . This immunomodulatory effect is mediated mainly through recognition of polysaccharide polymers by several pattern recognition receptors (PRRs). To determine which receptor contributes d... |
6affe5fdf4b3dbc765ce1e33b3124244_25 | Dectin-1 and MR levels were significantly higher, while expression of TLR2 and TLR4 did not change. These data suggest that EAP recognition occurred mainly via the Dectin-1 and MR pathway. |
6affe5fdf4b3dbc765ce1e33b3124244_26 | In this study, we evaluated the immunomodulatory activities and protective effect of EAP against H5N1 influenza infection in a mouse model. To our knowledge, these findings are the first to show the anti-H5N1 effect of EAP. Intranasal administration of EAP prior to H5N1 viral challenge improved survival rates of infect... |
6affe5fdf4b3dbc765ce1e33b3124244_27 | The emergence of new drug-resistant strains resulting from antigenic drift limits the therapeutic benefits of vaccination and antiviral agents in controlling influenza [6, 21, 22] . Thus, development of novel broad-spectrum antiinfluenza strategies is urgently needed. Most botanical polysaccharides are ideal candidates... |
6affe5fdf4b3dbc765ce1e33b3124244_28 | weight) was significantly higher than in mice receiving PBS (50% to 0%). |
6affe5fdf4b3dbc765ce1e33b3124244_29 | In previous reports, high levels of proinflammatory cytokines and chemokines (including TNF-, IL-6 and IFN-) were detected during H5N1 infection [23, 24] . This "cytokine storm" leads to the severe respiratory symptoms and host immune injury. Thus, H5N1-induced cytokine storms are hypothesized to be the main cause of m... |
6affe5fdf4b3dbc765ce1e33b3124244_30 | Evidence-Based Complementary and Alternative Medicine mice deficient in TNF-, TNF-receptor, IL-6, MIP-1 , and IL-1R or steroid-treated, wild-type mice did not have a survival advantage compared with wild-type mice following H5N1 influenza infection [27, 28] . Interestingly, prophylactic treatment of TLR3 agonist PolyIC... |
6affe5fdf4b3dbc765ce1e33b3124244_31 | This likely explains why immunomodulator treatment prior to viral infection results in a better survival rate [26, 30] . In our study, treatment of EAP shortly after infection or 24 h postinfection did not provide a survival advantage (data not show). |
6affe5fdf4b3dbc765ce1e33b3124244_32 | The antiinfluenza properties of IL-6, TNF-, and IFNhave been discussed in many studies, despite their participation in cytokine storms triggered by influenza infection. IL-6 plays an important role in protecting against influenza A virus as it is required for viral clearance and essential for animal survival [31] . TNF... |
6affe5fdf4b3dbc765ce1e33b3124244_33 | levels were slightly lower, while TNF-production was significantly lower than that of PBS group. Regarding the excessive inflammation induced by H5N1 virus, massive secretion of mediators contributes to lung injury rather than an antiviral response. Therefore, the timing of EAP treatment as a prophylactic agent is very... |
6affe5fdf4b3dbc765ce1e33b3124244_34 | The immunomodulatory activities of botanical polysaccharides are thought to be mediated by several PRRs [11] . In this study, we examined the mRNA levels of TLR2, TLR4, Dectin-1, and MR after EAP treatment. EAP was found to upregulate Dectin-1 and MR mRNA expressions significantly both in vivo and in vitro. Our hypothe... |
6affe5fdf4b3dbc765ce1e33b3124244_35 | In conclusion, our study demonstrates that EAP leaf extract is a prophylactic and immune enhancement agent against H5N1 influenza virus infection. Treatment with EAP effectively inhibits H5N1 viral replication and improves animal survival. This approach offers an alternative strategy for antiinfluenza immunomodulatory ... |
7ade6ed0693867cc37ff07e283690136_0 | A 3-year prospective study of the epidemiology of acute respiratory viral infections in hospitalized children in Shenzhen, China
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4181804/
SHA: ef5fe7296ec8baf90d974cf5737af0da3ed403ea
Authors: He, Ying; Lin, Guang-Yu; Wang, Qiong; Cai, Xiao-Ying; Zhang, Yin-Hui; Lin, Chua... |
7ade6ed0693867cc37ff07e283690136_1 | Abstract: BACKGROUND: The epidemiology of local viral etiologies is essential for the management of viral respiratory tract infections. Limited data are available in China to describe the epidemiology of viral respiratory infections, especially in small–medium cities and rural areas. OBJECTIVES: To determine the viral ... |
7ade6ed0693867cc37ff07e283690136_2 | 302 cases (31·1%), and dual viral infection was dominant. RSV, HRV and IAV were the most frequent viral agents involved in co-infection. On the whole, the obvious seasonal peaks mainly from March to May were observed with peak strength varying from 1 year to another. CONCLUSIONS: This study provides a basic profile of ... |
7ade6ed0693867cc37ff07e283690136_3 | Text: Acute respiratory tract infections (ARTIs) are a persistent and pervasive public health problem in both developed and developing countries. They cause a great burden of disease worldwide. Especially in developing countries including China, ARTIs, mainly pneumonia, are the leading cause of death among children und... |
7ade6ed0693867cc37ff07e283690136_4 | discovered in human respiratory tract specimens. Among them, some have been identified to be causative pathogens of ARTIs. 1, 4, 5 Currently, there are no approved vaccines or medications available for most of the respiratory viruses. 1 A better understanding of the epidemiology of viral respiratory tract infections in... |
7ade6ed0693867cc37ff07e283690136_5 | the epidemiology of ARTIs have recently been reported in big cities such as Beijing, Shanghai and Hong Kong, [13] [14] [15] [16] the epidemic characteristics of viruses in ARTIs are still not well established all around China, especially in other cities and rural areas. |
7ade6ed0693867cc37ff07e283690136_6 | Shenzhen is the largest migratory city of China with high population density and population mobility. It is located in southern China at 22°27 0 -22°52 0 N and 113°46 0 -114°37 0 E, immediately north of Hong Kong, with a typical subtropical monsoon climate. The annual average temperature and relative humidity of Shenzh... |
7ade6ed0693867cc37ff07e283690136_7 | A consecutive 3-year prospective study from July 2007 to June 2010 was conducted in Shenzhen, a coastal city neighboring Hong Kong. Four hospitals including a children's hospital were chosen for the study. Selected patients with ARTIs admitted to the pediatric wards were enrolled. The inclusion criteria were as follows... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.