task
stringlengths
0
154k
__index_level_0__
int64
0
39.2k
A round clock only has three hands: hour, minute, second. All hands look identical and move continuously. Moreover, there is no number or reference mark so that the "upright position" is unknown. The clock functions the same as a normal 12-hour analogue clock. Despite the inconvenient design, for most time it is possib...
25,900
Consider a circle where 2n distinct points have been marked on its circumference. A cutting C consists of connecting the 2n points with n line segments, so that no two line segments intersect, including on their end points. The n line segments then cut the circle into n + 1 pieces. Each piece is painted either black or...
25,901
Define M(n) to be the minimum number of matchsticks needed to represent the number n. A number can be represented in digit form or as an expression involving addition and/or multiplication. Also order of operations must be followed, that is multiplication binding tighter than addition. Any other symbols or operations, ...
25,902
Consider a unit circle circle with radius 1 C_0 on the plane that does not enclose the origin. For k\ge 1, a circle C_k is created by scaling and rotating C_{k - 1} with respect to the origin . That is, both the radius and the distance to the origin are scaled by the same factor, and the centre of rotation is the origi...
25,903
Gary and Sally play a game using gold and silver coins arranged into a number of vertical stacks, alternating turns. On Gary's turn he chooses a gold coin and removes it from the game along with any other coins sitting on top. Sally does the same on her turn by removing a silver coin. The first player unable to make a ...
25,904
A contiguous range of positive integers is called a divisible range if all the integers in the range can be arranged in a row such that the n-th term is a multiple of n. For example, the range [6..9] is a divisible range because we can arrange the numbers as 7,6,9,8. In fact, it is the 4th divisible range of length 4, ...
25,905
Let G(n) denote the largest possible area of an n-gon a polygon with n sides contained in the region \{(x, y) \in \Bbb R^2: x^4 \leq y \leq 1\}. For example, G(3) = 1 and G(5)\approx 1.477309771. Find G(101) rounded to nine digits after the decimal point.
25,906
Claire Voyant is a teacher playing a game with a class of students. A fair coin is tossed on the table. All the students can see the outcome of the toss, but Claire cannot. Each student then tells Claire whether the outcome is head or tail. The students may lie, but Claire knows the probability that each individual stu...
25,907
Two players play a game with two piles of stones. The players alternately take stones from one or both piles, subject to: the total number of stones taken is equal to the size of the smallest pile before the move; the move cannot take all the stones from a pile. The player that is unable to move loses. For example, if ...
25,908
Two players play a game with at least two piles of stones. The players alternately take stones from one or more piles, subject to: the total number of stones taken is equal to the size of the smallest pile before the move; the move cannot take all the stones from a pile. The player that is unable to move loses. For exa...
25,909
A driller drills for water. At each iteration the driller chooses a depth d (a positive real number), drills to this depth and then checks if water was found. If so, the process terminates. Otherwise, a new depth is chosen and a new drilling starts from the ground level in a new location nearby. Drilling to depth d tak...
25,910
A permutation \pi of \{1, \dots, n\} can be represented in one-line notation as \pi(1),\ldots,\pi(n) . If all n! permutations are written in lexicographic order then \textrm{rank}(\pi) is the position of \pi in this 1-based list. For example, \text{rank}(2,1,3) = 3 because the six permutations of \{1, 2, 3\} in lexicog...
25,911
A permutation \pi of \{1, \dots, n\} can be represented in one-line notation as \pi(1),\ldots,\pi(n) . If all n! permutations are written in lexicographic order then \textrm{rank}(\pi) is the position of \pi in this 1-based list. For example, \text{rank}(2,1,3) = 3 because the six permutations of \{1, 2, 3\} in lexicog...
25,912
Given a right-angled triangle with integer sides, the smaller angle formed by the two medians drawn on the the two perpendicular sides is denoted by \theta. Let f(\alpha, L) denote the sum of the sides of the right-angled triangle minimizing the absolute difference between \theta and \alpha among all right-angled trian...
25,913
Three epistemologists, known as A, B, and C, are in a room, each wearing a hat with a number on it. They have been informed beforehand that all three numbers are positive and that one of the numbers is the sum of the other two. Once in the room, they can see the numbers on each other's hats but not on their own. Starti...
25,914
Three friends attempt to collectively choose one of n options, labeled 1,\dots,n, based upon their individual preferences. They choose option i if for every alternative option j at least two of the three friends prefer i over j. If no such option i exists they fail to reach an agreement. Define P(n) to be the probabili...
25,915
An infant's toy consists of n cups, labelled C_1,\dots,C_n in increasing order of size. The cups may be stacked in various combinations and orientations to form towers. The cups are shaped such that the following means of stacking are possible: Nesting: C_k may sit snugly inside C_{k+1}. Base-to-base: C_{k+2} or C_{k-2...
25,916
A clock sequence is a periodic sequence of positive integers that can be broken into contiguous segments such that the sum of the n-th segment is equal to n. For example, the sequence 1\ 2\ 3\ 4\ 3\ 2\ 1\ 2\ 3\ 4\ 3\ 2\ 1\ 2\ 3\ 4\ 3\ 2\ 1\ \cdots is a clock sequence with period 6, as it can be broken into 1\Big |2\Big...
25,917
An L-expression is defined as any one of the following: a natural number; the symbol A; the symbol Z; the symbol S; a pair of L-expressions u, v, which is written as u(v). An L-expression can be transformed according to the following rules: A(x) \to x + 1 for any natural number x; Z(u)(v) \to v for any L-expressions u,...
25,918
An L-expression is defined as any one of the following: a natural number; the symbol A; the symbol Z; the symbol S; a pair of L-expressions u, v, which is written as u(v). An L-expression can be transformed according to the following rules: A(x) \to x + 1 for any natural number x; Z(u)(v) \to v for any L-expressions u,...
25,919
An irrational number x can be uniquely expressed as a continued fraction [a_0; a_1,a_2,a_3,\dots]: x=a_{0}+\cfrac{1}{a_1+\cfrac{1}{a_2+\cfrac{1}{a_3+{_\ddots}}}} where a_0 is an integer and a_1,a_2,a_3,\dots are positive integers. Define k_j(x) to be the geometric mean of a_1,a_2,\dots,a_j. That is, k_j(x)=(a_1a_2 \cd...
25,920
Let s_n be the n-th positive integer that does not contain three consecutive ones in its binary representation. For example, s_1 = 1 and s_7 = 8. Define F(N) to be the sum of n^2 for all n\leq N where s_n is odd. You are given F(10)=199. Find F(10^{16}) giving your answer modulo 10^9+7.
25,921
The numbers from 1 to 12 can be arranged into a 3 \times 4 matrix in either row-major or column-major order: R=\begin{pmatrix} 1 & 2 & 3 & 4\\ 5 & 6 & 7 & 8\\ 9 & 10 & 11 & 12\end{pmatrix}, C=\begin{pmatrix} 1 & 4 & 7 & 10\\ 2 & 5 & 8 & 11\\ 3 & 6 & 9 & 12\end{pmatrix} By swapping two entries at a time, at least 8 swap...
25,922
For a given integer R consider all primitive Pythagorean triangles that can fit inside, without touching, a circle with radius R. Define F(R) to be the largest inradius of those triangles. You are given F(100) = 36. Find F(10^{18}).
25,923
The function s(n) is defined recursively for positive integers by s(1) = 1 and s(n+1) = \big(s(n) - 1\big)^3 +2 for n\geq 1. The sequence begins: s(1) = 1, s(2) = 2, s(3) = 3, s(4) = 10, \ldots. For positive integers N, define T(N) = \sum_{a=1}^N \sum_{b=1}^N \gcd\Big(s\big(s(a)\big), s\big(s(b)\big)\Big). You are gi...
25,924
Let P(n) be the number of permutations of \{1,2,3,\ldots,2n\} such that: 1. There is no ascending subsequence with more than n+1 elements, and 2. There is no descending subsequence with more than two elements. Note that subsequences need not be contiguous. For example, the permutation (4,1,3,2) is not counted because i...
25,925
The sequence s_n is defined by s_1 = 102022661 and s_n = s_{n-1}^2 \bmod {998388889} for n > 1. Let a_n = s_{2n - 1} and b_n = s_{2n} for n=1,2,... Define an N \times N matrix whose values are M_{i,j} = a_i + b_j. Let A(N) be the minimal path sum from M_{1,1} (top left) to M_{N,N} (bottom right), where each step is eit...
25,926
The sequence a_n is defined by a_1=1, and then recursively for n\geq1: \begin{align*} a_{2n} &=2a_n\\ a_{2n+1} &=a_n-3a_{n+1} \end{align*} The first ten terms are 1, 2, -5, 4, 17, -10, -17, 8, -47, 34. Define \displaystyle S(N) = \sum_{n=1}^N a_n. You are given S(10) = -13 Find S(10^{12}).
25,927
We call a triangle fortunate if it has integral sides and at least one of its vertices has the property that the distance from it to the triangle's orthocentre is exactly half the distance from the same vertex to the triangle's circumcentre . Triangle ABC above is an example of a fortunate triangle with sides (6,7,8). ...
25,928
For a positive integer n we define \tau(n) to be the count of the divisors of n. For example, the divisors of 12 are \{1,2,3,4,6,12\} and so \tau(12) = 6. A positive integer n is a tau number if it is divisible by \tau(n). For example \tau(12)=6 and 6 divides 12 so 12 is a tau number. Let m(k) be the smallest tau numbe...
25,929
Consider the following recurrence relation: \begin{align} a_0 &= \frac{\sqrt 5 + 1}2\\ a_{n+1} &= \dfrac{a_n(a_n^4 + 10a_n^2 + 5)}{5a_n^4 + 10a_n^2 + 1} \end{align} Note that a_0 is the golden ratio . a_n can always be written in the form \dfrac{p_n\sqrt{5}+1}{q_n}, where p_n and q_n are positive integers. Let s(n)=p_n...
25,930
A Young diagram is a finite collection of (equally-sized) squares in a grid-like arrangement of rows and columns, such that the left-most squares of all rows are aligned vertically; the top squares of all columns are aligned horizontally; the rows are non-increasing in size as we move top to bottom; the columns are non...
25,931
Counting DNA Nucleotides Description: A Rapid Introduction to Molecular Biology Figure 1 . A 1900 drawing by Edmund Wilson of onion cells at different stages of mitosis. The sample has been dyed, causing chromatin in the cells (which soaks up the dye) to appear in greater contrast to the rest of the cell. Figur...
25,932
Transcribing DNA into RNA Description: The Second Nucleic Acid Figure 1 . Structural differences between RNA and DNA In “Counting DNA Nucleotides” , we described the primary structure of a nucleic acid as a polymer of nucleotide units, and we mentioned that the omnipresent nucleic acid DNA is compose...
25,933
Complementing a Strand of DNA Description: The Secondary and Tertiary Structures of DNA Figure 1 . Base pairing across the two strands of DNA. Figure 2 . The double helix of DNA on the molecular scale. In “Counting DNA Nucleotides” , we introduced nucleic acids , and we saw that the primary structure o...
25,934
Rabbits and Recurrence Relations Description: Wascally Wabbits Figure 1 . The growth of Fibonacci's rabbit population for the first six months. Figure 2 . Erosion at Lake Mungo in New South Wales, which was initiated by European rabbits in the 19th Century. Courtesy Pierre Pouliquin. In 1202, Leonardo of P...
25,935
Computing GC Content Description: Identifying Unknown DNA Quickly Figure 1 . The table above was computed from a large number of English words and shows for any letter the frequency with which it appears in those words. These frequencies can be used to reliably identify a piece of English text and differentiate it ...
25,936
Counting Point Mutations Description: Evolution as a Sequence of Mistakes Figure 1 . A point mutation in DNA changing a C-G pair to an A-T pair. A mutation is simply a mistake that occurs during the creation or copying of a nucleic acid , in particular DNA . Because nucleic acids are vital to cellular fu...
25,937
Mendel's First Law Description: Introduction to Mendelian Inheritance Figure 1 . A Punnett square representing the possible outcomes of crossing a heterozygous organism (Yy) with a homozygous recessive organism (yy); here, the dominant allele Y corresponds to yellow pea pods, and the recessive allele y corresponds ...
25,938
Translating RNA into Protein Description: The Genetic Code Figure 1 . The human hemoglobin molecule consists of 4 polypeptide chains; α subunits are shown in red and β subunits are shown in blue Just as nucleic acids are polymers of nucleotides , proteins are chains of smaller molecules called amino aci...
25,939
Finding a Motif in DNA Description: Combing Through the Haystack Figure 1 . The human chromosomes stained with a probe for Alu elements, shown in green. Finding the same interval of DNA in the genomes of two different organisms (often taken from different species) is highly suggestive that the interval has th...
25,940
Consensus and Profile Description: Finding a Most Likely Common Ancestor In “Counting Point Mutations” , we calculated the minimum number of symbol mismatches between two strings of equal length to model the problem of finding the minimum number of point mutations occurring on the evolutionary path between two hom...
25,941
Mortal Fibonacci Rabbits Description: Wabbit Season Figure 1 . A c.1905 photo from Australia of a cart loaded to the hilt with rabbit skins. Figure 2 . Western Australia's rabbit fence is actually not the longest fence in the world as the sign claims. That honor goes to a 3,500 mile fence in southeastern Austr...
25,942
Overlap Graphs Description: A Brief Introduction to Graph Theory Networks arise everywhere in the practical world, especially in biology. Networks are prevalent in popular applications such as modeling the spread of disease, but the extent of network applications spreads far beyond popular science. Our first quest...
25,943
Calculating Expected Offspring Description: The Need for Averages Averages arise everywhere. In sports, we want to project the average number of games that a team is expected to win; in gambling, we want to project the average losses incurred playing blackjack; in business, companies want to calculate their average...
25,944
Finding a Shared Motif Description: Searching Through the Haystack In “Finding a Motif in DNA” , we searched a given genetic string for a motif ; however, this problem assumed that we know the motif in advance. In practice, biologists often do not know exactly what they are looking for. Rather, they must hunt th...
25,945
Independent Alleles Description: Mendel's Second Law Figure 1 . Mendel's second law dictates that every one of the 16 possible assignments of parental alleles is equally likely. The Punnett square for two factors therefore places each of these assignments in a cell of a 4 X 4 table. The probability of an offspring'...
25,946
Finding a Protein Motif Description: Motif Implies Function Figure 1 . The human cyclophilin family, as represented by the structures of the isomerase domains of some of its members. As mentioned in “Translating RNA into Protein” , proteins perform every practical function in the cell . A structural and fun...
25,947
Inferring mRNA from Protein Description: Pitfalls of Reversing Translation When researchers discover a new protein , they would like to infer the strand of mRNA from which this protein could have been translated , thus allowing them to locate genes associated with this protein on the genome . Unfortunately,...
25,948
Open Reading Frames Description: Transcription May Begin Anywhere Figure 1 . Schematic image of the particular ORF with start and stop codons shown. In “Transcribing DNA into RNA” , we discussed the transcription of DNA into RNA , and in “Translating RNA into Protein” , we examined the translation of R...
25,949
Enumerating Gene Orders Description: Rearrangements Power Large-Scale Genomic Changes Figure 1 . Similar regions in mouse and human chromosomes. Image credit: U.S. Department of Energy Human Genome Program Point mutations can create changes in populations of organisms from the same species, but they lack the p...
25,950
Calculating Protein Mass Description: Chaining the Amino Acids Figure 1 . Formation of a peptide bond Figure 2 . Outermost acids In “Translating RNA into Protein” , we examined the translation of RNA into an amino acid chain for the construction of a protein . When two amino acids link together, th...
25,951
Locating Restriction Sites Description: The Billion-Year War Figure 1 . DNA cleaved by EcoRV restriction enzyme The war between viruses and bacteria has been waged for over a billion years. Viruses called bacteriophages (or simply phages) require a bacterial host to propagate, and so they must somehow infiltr...
25,952
RNA Splicing Description: Genes are Discontiguous Figure 1 . The elongation of a pre-mRNA by RNAP as it moves down the template strand of DNA. Figure 2 . RNA is identical to the coding strand except for the replacement of thymine with uracil. In “Transcribing DNA into RNA” , we mentioned that a strand o...
25,953
Enumerating k-mers Lexicographically Description: Organizing Strings When cataloguing a collection of genetic strings , we should have an established system by which to organize them. The standard method is to organize strings as they would appear in a dictionary, so that "APPLE" precedes "APRON", which in turn co...
25,954
Longest Increasing Subsequence Description: A Simple Measure of Gene Order Similarity In “Enumerating Gene Orders” , we started talking about comparing the order of genes on a chromosome taken from two different species and moved around by rearrangements throughout the course of evolution. One very simple w...
25,955
Genome Assembly as Shortest Superstring Description: Introduction to Genome Sequencing Figure 1 . Fragment Assembly works by blasting many copies of the same genome into smaller, identifiable reads, which are then used to computationally assemble one copy of the genome. Recall from “Computing GC Content” that...
25,956
Perfect Matchings and RNA Secondary Structures Description: Introduction to RNA Folding Figure 1 . A hairpin loop is formed when consecutive elements from two different regions of an RNA molecule base pair. (Courtesy: Sakurambo, Wikimedia Commons User) Because RNA is single-stranded, you may have wondered if ...
25,957
Partial Permutations Description: Partial Gene Orderings Similar species will share many of the same genes , possibly with modifications. Thus, we can compare two genomes by analyzing the orderings of their genes, then inferring which rearrangements have separated the genes. In “Enumerating Gene Orders” , we...
25,958
Introduction to Random Strings Description: Modeling Random Genomes We already know that the genome is not just a random strand of nucleotides; recall from “Finding a Motif in DNA” that motifs recur commonly across individuals and species. If a DNA motif occurs in many different organisms, then chances are ...
25,959
Enumerating Oriented Gene Orderings Description: Synteny Blocks Have Orientations In “Enumerating Gene Orders” , we introduced synteny blocks for two different species, which are very similar areas of two species genomes that have been flipped and moved around by rearrangements . In that problem, we used the ...
25,960
Finding a Spliced Motif Description: Motifs Are Rarely Contiguous In “Finding a Motif in DNA” , we searched for occurrences of a motif as a substring of a larger database genetic string . However, because a DNA strand coding for a protein is often interspersed with introns (see “RNA Splicing” ), we need a...
25,961
Transitions and Transversions Description: Certain Point Mutations are More Common Figure 1 . Illustration of transitions and transversions. Point mutations occurring in DNA can be divided into two types: transitions and transversions . A transition substitutes one purine for another ( $\textrm{A} \left...
25,962
Completing a Tree Description: The Tree of Life Figure 1 . A phylogeny illustrating proposed evolutionary relationships among the three domains of life: Bacteria, Archaea, and Eukaryota. "As buds give rise by growth to fresh buds, and these, if vigorous, branch out and overtop on all sides many a feebler branch...
25,963
Catalan Numbers and RNA Secondary Structures Description: The Human Knot Figure 1 . Knot fun. Courtesy El Photo Studio. Figure 2 . This pseudoknot was formed when bonding occurred at the endpoints of overlapping intervals [1,3] and [2, 4]. (Courtesy: Sakurambo, Wikimedia Commons User) You may have had the ...
25,964
Error Correction in Reads Description: Genome Sequencing Isn't Perfect In “Genome Assembly as Shortest Superstring” , we introduce the problem of assembling a genome from a collection of reads . Even though genome sequencing is a multi-billion dollar enterprise, sequencing machines that identify reads still p...
25,965
Counting Phylogenetic Ancestors Description: Culling the Forest Figure 1 . Trees come in lots of different shapes. In “Completing a Tree” , we introduced the tree for the purposes of constructing phylogenies . Yet the definition of tree as a connected graph with no cycles produces a huge class of different ...
25,966
k-Mer Composition Description: Generalizing GC-Content Figure 1 . The 2-mer composition of TTGATTACCTTATTTGATCATTACACATTGTACGCTTGTGTCAAAATATCACATGTGCCT A length $k$ substring of a genetic string is commonly called a k-mer . A genetic string of length $n$ can be seen as composed of $n-k+1$ overlapping...
25,967
Speeding Up Motif Finding Description: Shortening the Motif Search In “Finding a Motif in DNA” , we discussed the problem of searching a genome for a known motif . Because of the large scale of eukaryotic genomes, we need to accomplish this computational task as efficiently as possible. The standard method f...
25,968
Finding a Shared Spliced Motif Description: Locating Motifs Despite Introns In “Finding a Shared Motif” , we discussed searching through a database containing multiple genetic strings to find a longest common substring of these strings, which served as a motif shared by the two strings. However, as we saw in...
25,969
Ordering Strings of Varying Length Lexicographically Description: Organizing Strings of Different Lengths In “Enumerating k-mers Lexicographically” , we introduced the lexicographic order for strings of the same length constructed from some ordered underlying alphabet . However, our experience with dictionarie...
25,970
Maximum Matchings and RNA Secondary Structures Description: Breaking the Bonds In “Perfect Matchings and RNA Secondary Structures” , we considered a problem that required us to assume that every possible nucleotide is involved in base pairing to induce an RNA secondary structure . Yet the only way this could...
25,971
Creating a Distance Matrix Description: Introduction to Distance-Based Phylogeny A number of different approaches are used to build phylogenies , each one featuring its own computational strengths and weaknesses. One of these measures is distance-based phylogeny , which constructs a tree from evolutionary dista...
25,972
Reversal Distance Description: Rearrangements Power Large-Scale Genomic Changes Perhaps the most common type of genome rearrangement is an inversion , which flips an entire interval of DNA found on the same chromosome . As in the case of calculating Hamming distance (see “Counting Point Mutations” ), we would...
25,973
Matching Random Motifs Description: More Random Strings In “Introduction to Random Strings” , we discussed searching for motifs in large genomes , in which random occurrences of the motif are possible. Our aim is to quantify just how frequently random motifs occur. One class of motifs of interest are promot...
25,974
Counting Subsets Description: Characters and SNPs A character is any feature (genetic, physical, etc.) that divides a collection of organisms into two separate groups. One commonly used genetic character is the possession of a single-nucleotide polymorphism , or SNP. In a process called genotyping , the SNP m...
25,975
Introduction to Alternative Splicing Description: The Baby and the Bathwater Figure 1 . Alternative splicing induces different protein isoforms. In “RNA Splicing” , we described the process by which the exons are spliced out from a molecule of pre-mRNA and reassembled to yield a final mRNA for the purpos...
25,976
Edit Distance Description: Point Mutations Include Insertions and Deletions In “Counting Point Mutations” , we saw that Hamming distance gave us a preliminary notion of the evolutionary distance between two DNA strings by counting the minimum number of single nucleotide substitutions that could have occurred ...
25,977
Expected Number of Restriction Sites Description: A Shot in the Dark In “Locating Restriction Sites” , we first familiarized ourselves with restriction enzymes . Recall that these enzymes are used by bacteria to cut through both strands of viral DNA , thus disarming the virus: the viral DNA locations where these ...
25,978
Motzkin Numbers and RNA Secondary Structures Description: The Dirty Truth About Mathematics Parties In “Catalan Numbers and RNA Secondary Structures” , we talked about counting the number of ways for an even number of people to shake hands at a party without crossing hands. However, in the real world, parties only...
25,979
Distances in Trees Description: Paths in Trees For any two nodes of a tree , a unique path connects the nodes; more specifically, there is a unique path connecting any pair of leaves . Why must this be the case? If more than one path connected two nodes, then they would necessarily form a cycle, which would v...
25,980
Interleaving Two Motifs Description: Two Motifs, One Gene Recall that in “Finding a Shared Spliced Motif” , we found the longest motif that could have been shared by two genetic strings , allowing for the motif to be split onto multiple exons in the process. As a result, we needed to find a longest common su...
25,981
Introduction to Set Operations Description: Forming New Sets Just as numbers can be added, subtracted, and multiplied, we can manipulate sets in certain basic ways. The natural operations on sets are to combine their elements , to find those elements common to both sets, and to determine which elements belong to...
25,982
Sorting by Reversals Description: Reconstructing Evolutionary Histories When we calculate the Hamming distance between two genetic strings , we can easily infer a collection of point mutations that occurred on the evolutionary path between the two strings by simply examining the mismatched symbols. However, wh...
25,983
Inferring Protein from Spectrum Description: Introduction to Mass Spectrometry In “Calculating Protein Mass” , we briefly mentioned an analytic chemical method called mass spectrometry , which aims to measure the mass-to-charge ratio of a particle or a molecule. In a mass spectrometer, a sample is vaporized (turne...
25,984
Introduction to Pattern Matching Description: If At First You Don't Succeed... We introduced the problem of finding a motif in a genetic string in “Finding a Motif in DNA” . More commonly, we will have a collection of motifs that we may wish to find in a larger string, for example when searching a genome for ...
25,985
Comparing Spectra with the Spectral Convolution Description: Comparing Spectra Suppose you have two mass spectra , and you want to check if they both were obtained from the same protein ; you will need some notion of spectra similarity. The simplest possible metric would be to count the number of peaks in the mass...
25,986
Creating a Character Table Description: Introduction to Character-Based Phylogeny Before the modern genetics revolution, phylogenies were constructed from physical characters resulting from direct structural comparison of taxa . A great deal of analysis relied on the fossil record, as fossils provided the only...
25,987
Constructing a De Bruijn Graph Description: Wading Through the Reads Because we use multiple copies of the genome to generate and identify reads for the purposes of fragment assembly , the total length of all reads will be much longer than the genome itself. This begs the definition of read coverage as the av...
25,988
Edit Distance Alignment Description: Reconstructing Edit Distance In “Counting Point Mutations” , the calculation of Hamming distance gave us a clear way to model the sequence of point mutations transforming one genetic string into another. By simply writing one string directly over the other, we could count...
25,989
Inferring Peptide from Full Spectrum Description: Ions Galore In “Inferring Protein from Spectrum” , we inferred a protein string from a list of b-ions . In practice, biologists have no way of distinguishing between b-ions and y-ions in the simplified spectrum of a peptide . However, we will often possess a...
25,990
Independent Segregation of Chromosomes Description: Mendel's Work Examined Mendel's laws of heredity were initially ignored, as only 11 papers have been found that cite his paper between its publication in 1865 and 1900. One reason for Mendel's lack of popularity is that information did not move quite so readily ...
25,991
Finding Disjoint Motifs in a Gene Description: Disjoint Motifs In this problem, we will consider an algorithmic (but not particularly practical) variant of motif finding for multiple motifs. Say we have two motifs corresponding to the coding regions of genes , and we want to know whether these motifs can be fou...
25,992
Finding the Longest Multiple Repeat Description: Long Repeats We saw in “Introduction to Pattern Matching” that a data structure commonly used to encode the relationships among a collection of strings was the trie , which is particularly useful when the strings represent a collection of patterns that we wis...
25,993
Newick Format with Edge Weights Description: Weighting the Tree A vital goal of creating phylogenies is to quantify a molecular clock that indicates the amount of evolutionary time separating two members of the phylogeny. To this end, we will assign numbers to the edges of a tree so that the number assigned t...
25,994
Wobble Bonding and RNA Secondary Structures Description: Don't Look Down We have discussed the problem of counting RNA secondary structures in previous problems. In this problem, we will add some assumptions to those used in “Motzkin Numbers and RNA Secondary Structures” to provide ourselves with an ultimatel...
25,995
Counting Disease Carriers Description: Genetic Drift and the Hardy-Weinberg Principle Mendel's laws of segregation and independent assortment are excellent for the study of individual organisms and their progeny, but they say nothing about how alleles move through a population over time. Our first question is:...
25,996
Creating a Character Table from Genetic Strings Description: Phylogeny from Genetic Characters In “Creating a Character Table” , we introduced the character table as a way of representing a number of characters simultaneously. In that problem, we found a character table representing an unrooted binary tree o...
25,997
Counting Optimal Alignments Description: Beware of Alignment Inference In “Edit Distance Alignment” , we introduced the concept of an alignment of two genetic strings having differing lengths with respect to edit distance . This provided us with a way of visualizing a specific collection of symbol substitution...
25,998
Counting Unrooted Binary Trees Description: Counting Trees A natural question is to be able to count the total number of distinct unrooted binary trees having $n$ leaves, where each leaf is labeled by some taxon . Before we can count all these trees, however, we need to have a notion of when two such trees a...
25,999