text
stringlengths
12
1.05M
repo_name
stringlengths
5
86
path
stringlengths
4
191
language
stringclasses
1 value
license
stringclasses
15 values
size
int32
12
1.05M
keyword
listlengths
1
23
text_hash
stringlengths
64
64
# -*- coding: utf-8 -*- # Copyright 2009 James Hensman and Michael Dewar # Licensed under the Gnu General Public license, see COPYING import numpy as np import sys sys.path.append('../src') from pyvb import nodes,Network def PCA_missing_data(plot=True): #Principal Component Analysis, with randomly missing data q = 2 #latent dimension d = 5 #observation dimension N = 200 niters = 200 Nmissing = 100 true_W = np.random.randn(d,q) true_Z = np.random.randn(N,q) true_mean = np.random.randn(d,1) true_prec = 20. Xdata_full = np.dot(true_Z,true_W.T) + true_mean.T Xdata_observed = Xdata_full + np.random.randn(N,d)*np.sqrt(1./true_prec) #erase some data missing_index_i = np.argsort(np.random.randn(N))[:Nmissing] missing_index_j = np.random.multinomial(1,np.ones(d)/d,Nmissing).nonzero()[1] Xdata = Xdata_observed.copy() Xdata[missing_index_i,missing_index_j] = np.nan #set up the problem... Ws = [nodes.Gaussian(d,np.zeros((d,1)),np.eye(d)*1e-3) for i in range(q)] W = nodes.hstack(Ws) Mu = nodes.Gaussian(d,np.zeros((d,1)),np.eye(d)*1e-3) Beta = nodes.Gamma(d,1e-3,1e-3) Zs = [nodes.Gaussian(q,np.zeros((q,1)),np.eye(q)) for i in range(N)] Xs = [nodes.Gaussian(d,W*z+Mu,Beta) for z in Zs] [xnode.observe(xval.reshape(d,1)) for xnode,xval in zip(Xs,Xdata)] #make a network object net = Network() net.addnode(W) net.fetch_network()# automagically fetches all of the other nodes... #infer! net.learn(100) #plot if plot: import pylab import hinton #compare true and learned W Qtrue,Rtrue = np.linalg.qr(true_W) Qlearn,Rlearn = np.linalg.qr(W.pass_down_Ex()) pylab.figure();pylab.title('True W') hinton.hinton(Qtrue) pylab.figure();pylab.title('E[W]') hinton.hinton(Qlearn) if q==2:#plot the latent variables pylab.figure();pylab.title('true Z') pylab.scatter(true_Z[:,0],true_Z[:,1],50,true_Z[:,0]) pylab.figure();pylab.title('learned Z') learned_Z = np.hstack([z.pass_down_Ex() for z in Zs]).T pylab.scatter(learned_Z[:,0],learned_Z[:,1],50,true_Z[:,0]) #recovered X mean X_rec = np.hstack([x.pass_down_Ex() for x in Xs]).T #Recovered X Variance #slight hack here - set q variance of observed nodes to zeros (it should be random...) for x in Xs: if x.observed: x.qcov *=0 var_rec = np.vstack([np.diag(x.qcov) for x in Xs]) + 1./np.diag(Beta.pass_down_Ex()) #plot each recovered signal in a separate figure for i in range(d): pylab.figure();pylab.title('recovered_signal '+str(i)) pylab.plot(Xdata_full[:,i],'g',marker='.',label='True') # 'true' values of missing data (without noise) pylab.plot(X_rec[:,i],'b',label='Recovered') # recovered mising data values pylab.plot(Xdata[:,i],'k',marker='o',linewidth=2,label='Observed') # with noise, and holes where we took out values pylab.legend() volume_x = np.hstack((np.arange(len(Xs)),np.arange(len(Xs))[::-1])) volume_y = np.hstack((X_rec[:,i]+2*np.sqrt(var_rec[:,i]), X_rec[:,i][::-1]-2*np.sqrt(var_rec[:,i])[::-1])) pylab.fill(volume_x,volume_y,'b',alpha=0.3) print '\nBeta' print true_prec,Beta.pass_down_Ex()[0,0] print '\nMu' print np.hstack((true_mean,Mu.pass_down_Ex())) pylab.show() if __name__=='__main__': PCA_missing_data(True)
jameshensman/pyvb
examples/PCA_missing_data.py
Python
gpl-3.0
3,264
[ "Gaussian" ]
905b65c0c64a26bb697c65d26f7a0de86df1c75c0dcf8aa18a9de286ff01540e
import chardet import codecs import os import re class Clippings(object): def __init__(self, source, dest=None): ''' Prepares the import and store it into the 'clippings' dict. ''' self.source = source self.dest = self._get_default_dest() if dest is None else dest self.book_author_couples = () self.clippings = [] self._fetch() def _get_default_dest(self): ''' When no destination is specified, output to <InputFilename>.html ''' source_full_path = os.path.realpath(self.source) dirname, filename_with_ext = os.path.split(source_full_path) filename = os.path.splitext(filename_with_ext)[0] default_destination = os.path.join(dirname, filename + '.html') return default_destination def _fetch(self): ''' Imports clippings and book_author_couples from the source file ''' clippings = ClippingsIterator(self.source) for clipping in clippings: # Only highlights if clipping["type"] == "Highlight": self.clippings.append(clipping) # will be useful in the HTML to group by book/author self.book_author_couples = set((clipping['book'], clipping['author']) for clipping in self.clippings) def export_to_html(self): ''' Output the clippings dict to HTML, using a Jinja2 template ''' from jinja2 import Environment, PackageLoader # available from pip env = Environment(loader=PackageLoader('whoarder', 'templates'), autoescape=True, extensions=['jinja2.ext.autoescape']) template = env.get_template('template1.html') render = template.render(clippings=self.clippings, book_author_couples=self.book_author_couples) with open(self.dest, mode='w', encoding='utf-8') as output: output.write(render) class ClippingsIterator(object): ''' Iterator that abstracts the Kindle format and spits a dict per clipping. A 'clipping' can be either a Highlight or a Note, and is (as far as I know, on my Kindle) a succession of five lines (see ex. and regexes below): - Lines 1 & 2 contain metadata - Line 3 is empty - Line 4 is the clipping - Line 5 is the separator Example: <book> (<author_last_name>, <author_first_name>) - Your <type> on Page <page> | Location <locs>-<loce> | Added on <date> <contents> ========== ''' _clipping_separator = '==========\n' _clipping_line1 = re.compile(r''' ^(?P<book>.*) # Le Petit Prince \ \((?P<author>.*)\)$ # (De Saint-Exupery, Antoine) ''', re.VERBOSE | re.IGNORECASE) _clipping_line2 = re.compile(r''' ^-\ Your\ (?P<type>\w*) # Your Highlight \ (?:on\ )?(?P<page>Unnumbered\ Page|Page\ .*) # on Page 42 \ \|\ (?:on\ )?Location\ (?P<location>.*) # | Location 123-321 \ \|\ Added\ on\ (?P<date>.*)$ # | Added on... ''', re.VERBOSE | re.IGNORECASE) def __init__(self, source): detected_encoding = _detect_encoding(source) self.source_file = open(source, mode='r', encoding=detected_encoding) def __iter__(self): return self def __next__(self): clipping_buffer = [] count = 1 while True: if count > 5: raise InvalidFormatException('''Input file doesn't seem to be a clippings file, separators are missing or damaged''') if self.source_file.closed: raise StopIteration line = self.source_file.readline() if not line: self.source_file.close() raise StopIteration elif line != self._clipping_separator: # Kindle writes a FEFF BOM at the start of each clipping # (i.e. every 6 lines), which is clearly wrong. We strip it. if line[0] == "\ufeff": line = line.replace("\ufeff", "") clipping_buffer.append(line.strip()) count += 1 else: break if 'Page' not in clipping_buffer[1] and 'page' not in clipping_buffer[1]: clipping_buffer[1] = re.sub(r'(- Your .*?) (.*)', r'\1 on Unnumbered Page | \2', clipping_buffer[1]) try: line_dict = self._clipping_line1.search(clipping_buffer[0]).groupdict() line_dic2 = self._clipping_line2.search(clipping_buffer[1]).groupdict() line_dict.update(line_dic2) line_dict['contents'] = clipping_buffer[3] return line_dict except AttributeError: print("Failed to import the following note, please report to https://github.com/ronjouch/whoarder :\n {0}\n".format(clipping_buffer)) return self.__next__() def _detect_encoding(source): ''' Returns the encoding of the source file, using chardet. ''' rawdata = open(source, "rb").read() # chardet detects UTF-8 with BOM as 'UTF-8' (I don't know why), i.e. # fails to notify us about the BOM, resulting in a string prepended # with \ufeff, so we manually detect and set the utf-8-sig encoding if rawdata.startswith(codecs.BOM_UTF8): detected_encoding = 'utf-8-sig' else: result = chardet.detect(rawdata) detected_encoding = result['encoding'] return detected_encoding class InvalidFormatException(Exception): pass
rejuvyesh/whoarder
whoarder/clippings.py
Python
mit
5,790
[ "FEFF" ]
ff2507a623511705aa53c775aadef2c2c218583d620aeaa50b9425e9a85ca30e
#!/usr/bin/env vpython # Copyright 2020 The Chromium Authors. All rights reserved. # Use of this source code is governed by a BSD-style license that can be # found in the LICENSE file. """Wrapper for running gpu integration tests on Fuchsia devices.""" import argparse import logging import os import shutil import subprocess import sys import tempfile import time from gpu_tests import path_util sys.path.insert(0, os.path.join(path_util.GetChromiumSrcDir(), 'build', 'fuchsia')) from common_args import (AddCommonArgs, ConfigureLogging, GetDeploymentTargetForArgs) from symbolizer import RunSymbolizer def main(): parser = argparse.ArgumentParser() AddCommonArgs(parser) args, gpu_test_args = parser.parse_known_args() ConfigureLogging(args) # If output directory is not set, assume the script is being launched # from the output directory. if not args.output_directory: args.output_directory = os.getcwd() # Create a temporary log file that Telemetry will look to use to build # an artifact when tests fail. temp_log_file = False if not args.system_log_file: args.system_log_file = os.path.join(tempfile.mkdtemp(), 'system-log') temp_log_file = True package_names = ['web_engine', 'web_engine_shell'] web_engine_dir = os.path.join(args.output_directory, 'gen', 'fuchsia', 'engine') gpu_script = [ os.path.join(path_util.GetChromiumSrcDir(), 'content', 'test', 'gpu', 'run_gpu_integration_test.py') ] # Pass all other arguments to the gpu integration tests. gpu_script.extend(gpu_test_args) try: with GetDeploymentTargetForArgs(args) as target: target.Start() _, fuchsia_ssh_port = target._GetEndpoint() gpu_script.extend(['--fuchsia-ssh-config-dir', args.output_directory]) gpu_script.extend(['--fuchsia-ssh-port', str(fuchsia_ssh_port)]) gpu_script.extend(['--fuchsia-system-log-file', args.system_log_file]) # Set up logging of WebEngine listener = target.RunCommandPiped(['log_listener'], stdout=subprocess.PIPE, stderr=subprocess.STDOUT) build_ids_paths = map( lambda package_name: os.path.join( web_engine_dir, package_name, 'ids.txt'), package_names) symbolizer = RunSymbolizer(listener.stdout, open(args.system_log_file, 'w'), build_ids_paths) # Keep the Amber repository live while the test runs. with target.GetAmberRepo(): # Install necessary packages on the device. far_files = map( lambda package_name: os.path.join( web_engine_dir, package_name, package_name + '.far'), package_names) target.InstallPackage(far_files) return subprocess.call(gpu_script) finally: if temp_log_file: shutil.rmtree(os.path.dirname(args.system_log_file)) if __name__ == '__main__': sys.exit(main())
endlessm/chromium-browser
content/test/gpu/run_gpu_integration_test_fuchsia.py
Python
bsd-3-clause
3,076
[ "Amber" ]
e6399bc79217941d183d3fefc0d9e3576b19e11c1bcbde2d0c13def9bf5cfcba
""" Synfirechain-like example """ #!/usr/bin/python import os import spynnaker.pyNN as p import spynnaker_external_devices_plugin.pyNN as q import numpy, pylab p.setup(timestep=1.0, min_delay = 1.0, max_delay = 144.0) nNeurons = 3 # number of neurons in each population max_delay = 50 cell_params_lif = {'cm' : 0.25, # nF 'i_offset' : 0.0, 'tau_m' : 20.0, 'tau_refrac': 2.0, 'tau_syn_E' : 5.0, 'tau_syn_I' : 5.0, 'v_reset' : -70.0, 'v_rest' : -65.0, 'v_thresh' : -50.0 } populations = list() projections = list() weight_to_spike = 2.0 delay = 3 delays = list() loopConnections = list() for i in range(0, nNeurons): delays.append(float(delay)) singleConnection = (i, ((i + 1) % nNeurons), weight_to_spike, delay) loopConnections.append(singleConnection) injectionConnection = [(0, 0, weight_to_spike, 1)] spikeArray = {'spike_times': [[0]]} populations.append(p.Population(nNeurons, p.IF_curr_exp, cell_params_lif, label='spikes_out')) populations.append(p.Population(1, p.SpikeSourceArray, spikeArray, label='inputSpikes_1')) projections.append(p.Projection(populations[0], populations[0], p.FromListConnector(loopConnections))) projections.append(p.Projection(populations[1], populations[0], p.FromListConnector(injectionConnection))) populations[0].record() q.activate_live_output_for(populations[0]) #populations[0].set_constraint(p.PlacerChipAndCoreConstraint(0,0,2)) #populations[1].set_constraint(p.PlacerChipAndCoreConstraint(0,0,3)) run_time = 10 print "Running for {} ms".format(run_time) p.run(run_time) v = None gsyn = None spikes = None spikes = populations[0].getSpikes(compatible_output=True) print "The number of spikes in pop 0 is", len(spikes) if spikes is not None: #print spikes pylab.figure() pylab.plot([i[1] for i in spikes], [i[0] for i in spikes], ".") pylab.ylabel('neuron id') pylab.xlabel('Time/ms') pylab.xlim(0,run_time) pylab.ylim(-1,2) pylab.title('spikes') pylab.show() else: print "No spikes received" p.end()
svadams/SpinnIOTest
examples/live_packet_output_synfire_chain.py
Python
gpl-3.0
2,220
[ "NEURON" ]
2b513f8091d5d7014bfa29656c846fe641dafa6056cc9a4324e6a63529c56809
# This file is part of the Minecraft Overviewer. # # Minecraft Overviewer is free software: you can redistribute it and/or # modify it under the terms of the GNU General Public License as published # by the Free Software Foundation, either version 3 of the License, or (at # your option) any later version. # # Minecraft Overviewer is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General # Public License for more details. # # You should have received a copy of the GNU General Public License along # with the Overviewer. If not, see <http://www.gnu.org/licenses/>. from collections import OrderedDict import sys import imp import os import os.path import zipfile from io import BytesIO import math from random import randint import numpy from PIL import Image, ImageEnhance, ImageOps, ImageDraw import logging import functools from . import util BLOCKTEX = "assets/minecraft/textures/block/" # global variables to collate information in @material decorators blockmap_generators = {} known_blocks = set() used_datas = set() max_blockid = 0 max_data = 0 transparent_blocks = set() solid_blocks = set() fluid_blocks = set() nospawn_blocks = set() nodata_blocks = set() # This is here for circular import reasons. # Please don't ask, I choose to repress these memories. # ... okay fine I'll tell you. # Initialising the C extension requires access to the globals above. # Due to the circular import, this wouldn't work, unless we reload the # module in the C extension or just move the import below its dependencies. from .c_overviewer import alpha_over class TextureException(Exception): "To be thrown when a texture is not found." pass color_map = ["white", "orange", "magenta", "light_blue", "yellow", "lime", "pink", "gray", "light_gray", "cyan", "purple", "blue", "brown", "green", "red", "black"] ## ## Textures object ## class Textures(object): """An object that generates a set of block sprites to use while rendering. It accepts a background color, north direction, and local textures path. """ def __init__(self, texturepath=None, bgcolor=(26, 26, 26, 0), northdirection=0): self.bgcolor = bgcolor self.rotation = northdirection self.find_file_local_path = texturepath # not yet configurable self.texture_size = 24 self.texture_dimensions = (self.texture_size, self.texture_size) # this is set in in generate() self.generated = False # see load_image_texture() self.texture_cache = {} # once we find a jarfile that contains a texture, we cache the ZipFile object here self.jars = OrderedDict() ## ## pickle support ## def __getstate__(self): # we must get rid of the huge image lists, and other images attributes = self.__dict__.copy() for attr in ['blockmap', 'biome_grass_texture', 'watertexture', 'lavatexture', 'firetexture', 'portaltexture', 'lightcolor', 'grasscolor', 'foliagecolor', 'watercolor', 'texture_cache']: try: del attributes[attr] except KeyError: pass attributes['jars'] = OrderedDict() return attributes def __setstate__(self, attrs): # regenerate textures, if needed for attr, val in list(attrs.items()): setattr(self, attr, val) self.texture_cache = {} if self.generated: self.generate() ## ## The big one: generate() ## def generate(self): # Make sure we have the foliage/grasscolor images available try: self.load_foliage_color() self.load_grass_color() except TextureException as e: logging.error( "Your system is missing either assets/minecraft/textures/colormap/foliage.png " "or assets/minecraft/textures/colormap/grass.png. Either complement your " "resource pack with these texture files, or install the vanilla Minecraft " "client to use as a fallback.") raise e # generate biome grass mask self.biome_grass_texture = self.build_block(self.load_image_texture("assets/minecraft/textures/block/grass_block_top.png"), self.load_image_texture("assets/minecraft/textures/block/grass_block_side_overlay.png")) # generate the blocks global blockmap_generators global known_blocks, used_datas self.blockmap = [None] * max_blockid * max_data for (blockid, data), texgen in list(blockmap_generators.items()): tex = texgen(self, blockid, data) self.blockmap[blockid * max_data + data] = self.generate_texture_tuple(tex) if self.texture_size != 24: # rescale biome grass self.biome_grass_texture = self.biome_grass_texture.resize(self.texture_dimensions, Image.ANTIALIAS) # rescale the rest for i, tex in enumerate(blockmap): if tex is None: continue block = tex[0] scaled_block = block.resize(self.texture_dimensions, Image.ANTIALIAS) blockmap[i] = self.generate_texture_tuple(scaled_block) self.generated = True ## ## Helpers for opening textures ## def find_file(self, filename, mode="rb", verbose=False): """Searches for the given file and returns an open handle to it. This searches the following locations in this order: * In the directory textures_path given in the initializer if not already open * In an already open resource pack or client jar file * In the resource pack given by textures_path * The program dir (same dir as overviewer.py) for extracted textures * On Darwin, in /Applications/Minecraft for extracted textures * Inside a minecraft client jar. Client jars are searched for in the following location depending on platform: * On Windows, at %APPDATA%/.minecraft/versions/ * On Darwin, at $HOME/Library/Application Support/minecraft/versions * at $HOME/.minecraft/versions/ Only the latest non-snapshot version >1.6 is used * The overviewer_core/data/textures dir """ if verbose: logging.info("Starting search for {0}".format(filename)) # Look for the file is stored in with the overviewer # installation. We include a few files that aren't included with Minecraft # textures. This used to be for things such as water and lava, since # they were generated by the game and not stored as images. Nowdays I # believe that's not true, but we still have a few files distributed # with overviewer. # Do this first so we don't try all .jar files for stuff like "water.png" programdir = util.get_program_path() if verbose: logging.info("Looking for texture in overviewer_core/data/textures") path = os.path.join(programdir, "overviewer_core", "data", "textures", filename) if os.path.isfile(path): if verbose: logging.info("Found %s in '%s'", filename, path) return open(path, mode) elif hasattr(sys, "frozen") or imp.is_frozen("__main__"): # windows special case, when the package dir doesn't exist path = os.path.join(programdir, "textures", filename) if os.path.isfile(path): if verbose: logging.info("Found %s in '%s'", filename, path) return open(path, mode) # A texture path was given on the command line. Search this location # for the file first. if self.find_file_local_path: if (self.find_file_local_path not in self.jars and os.path.isfile(self.find_file_local_path)): # Must be a resource pack. Look for the requested file within # it. try: pack = zipfile.ZipFile(self.find_file_local_path) # pack.getinfo() will raise KeyError if the file is # not found. pack.getinfo(filename) if verbose: logging.info("Found %s in '%s'", filename, self.find_file_local_path) self.jars[self.find_file_local_path] = pack # ok cool now move this to the start so we pick it first self.jars.move_to_end(self.find_file_local_path, last=False) return pack.open(filename) except (zipfile.BadZipfile, KeyError, IOError): pass elif os.path.isdir(self.find_file_local_path): full_path = os.path.join(self.find_file_local_path, filename) if os.path.isfile(full_path): if verbose: logging.info("Found %s in '%s'", filename, full_path) return open(full_path, mode) # We already have some jars open, better use them. if len(self.jars) > 0: for jarpath in self.jars: try: jar = self.jars[jarpath] jar.getinfo(filename) if verbose: logging.info("Found (cached) %s in '%s'", filename, jarpath) return jar.open(filename) except (KeyError, IOError) as e: pass # If we haven't returned at this point, then the requested file was NOT # found in the user-specified texture path or resource pack. if verbose: logging.info("Did not find the file in specified texture path") # Look in the location of the overviewer executable for the given path path = os.path.join(programdir, filename) if os.path.isfile(path): if verbose: logging.info("Found %s in '%s'", filename, path) return open(path, mode) if sys.platform.startswith("darwin"): path = os.path.join("/Applications/Minecraft", filename) if os.path.isfile(path): if verbose: logging.info("Found %s in '%s'", filename, path) return open(path, mode) if verbose: logging.info("Did not find the file in overviewer executable directory") if verbose: logging.info("Looking for installed minecraft jar files...") # Find an installed minecraft client jar and look in it for the texture # file we need. versiondir = "" if "APPDATA" in os.environ and sys.platform.startswith("win"): versiondir = os.path.join(os.environ['APPDATA'], ".minecraft", "versions") elif "HOME" in os.environ: # For linux: versiondir = os.path.join(os.environ['HOME'], ".minecraft", "versions") if not os.path.exists(versiondir) and sys.platform.startswith("darwin"): # For Mac: versiondir = os.path.join(os.environ['HOME'], "Library", "Application Support", "minecraft", "versions") try: if verbose: logging.info("Looking in the following directory: \"%s\"" % versiondir) versions = os.listdir(versiondir) if verbose: logging.info("Found these versions: {0}".format(versions)) except OSError: # Directory doesn't exist? Ignore it. It will find no versions and # fall through the checks below to the error at the bottom of the # method. versions = [] available_versions = [] for version in versions: # Look for the latest non-snapshot that is at least 1.8. This # version is only compatible with >=1.8, and we cannot in general # tell if a snapshot is more or less recent than a release. # Allow two component names such as "1.8" and three component names # such as "1.8.1" if version.count(".") not in (1,2): continue try: versionparts = [int(x) for x in version.split(".")] except ValueError: continue if versionparts < [1,8]: continue available_versions.append(versionparts) available_versions.sort(reverse=True) if not available_versions: if verbose: logging.info("Did not find any non-snapshot minecraft jars >=1.8.0") while(available_versions): most_recent_version = available_versions.pop(0) if verbose: logging.info("Trying {0}. Searching it for the file...".format(".".join(str(x) for x in most_recent_version))) jarname = ".".join(str(x) for x in most_recent_version) jarpath = os.path.join(versiondir, jarname, jarname + ".jar") if os.path.isfile(jarpath): try: jar = zipfile.ZipFile(jarpath) jar.getinfo(filename) if verbose: logging.info("Found %s in '%s'", filename, jarpath) self.jars[jarpath] = jar return jar.open(filename) except (KeyError, IOError) as e: pass except (zipfile.BadZipFile) as e: logging.warning("Your jar {0} is corrupted, I'll be skipping it, but you " "should probably look into that.".format(jarpath)) if verbose: logging.info("Did not find file {0} in jar {1}".format(filename, jarpath)) raise TextureException("Could not find the textures while searching for '{0}'. Try specifying the 'texturepath' option in your config file.\nSet it to the path to a Minecraft Resource pack.\nAlternately, install the Minecraft client (which includes textures)\nAlso see <http://docs.overviewer.org/en/latest/running/#installing-the-textures>\n(Remember, this version of Overviewer requires a 1.17-compatible resource pack)\n(Also note that I won't automatically use snapshots; you'll have to use the texturepath option to use a snapshot jar)".format(filename)) def load_image_texture(self, filename): # Textures may be animated or in a different resolution than 16x16. # This method will always return a 16x16 image img = self.load_image(filename) w,h = img.size if w != h: img = img.crop((0,0,w,w)) if w != 16: img = img.resize((16, 16), Image.ANTIALIAS) self.texture_cache[filename] = img return img def load_image(self, filename): """Returns an image object""" try: img = self.texture_cache[filename] if isinstance(img, Exception): # Did we cache an exception? raise img # Okay then, raise it. return img except KeyError: pass try: fileobj = self.find_file(filename, verbose=logging.getLogger().isEnabledFor(logging.DEBUG)) except (TextureException, IOError) as e: # We cache when our good friend find_file can't find # a texture, so that we do not repeatedly search for it. self.texture_cache[filename] = e raise e buffer = BytesIO(fileobj.read()) try: img = Image.open(buffer).convert("RGBA") except IOError: raise TextureException("The texture {} appears to be corrupted. Please fix it. Run " "Overviewer in verbose mode (-v) to find out where I loaded " "that file from.".format(filename)) self.texture_cache[filename] = img return img def load_water(self): """Special-case function for loading water.""" watertexture = getattr(self, "watertexture", None) if watertexture: return watertexture watertexture = self.load_image_texture("assets/minecraft/textures/block/water_still.png") self.watertexture = watertexture return watertexture def load_lava(self): """Special-case function for loading lava.""" lavatexture = getattr(self, "lavatexture", None) if lavatexture: return lavatexture lavatexture = self.load_image_texture("assets/minecraft/textures/block/lava_still.png") self.lavatexture = lavatexture return lavatexture def load_portal(self): """Special-case function for loading portal.""" portaltexture = getattr(self, "portaltexture", None) if portaltexture: return portaltexture portaltexture = self.load_image_texture("assets/minecraft/textures/block/nether_portal.png") self.portaltexture = portaltexture return portaltexture def load_light_color(self): """Helper function to load the light color texture.""" if hasattr(self, "lightcolor"): return self.lightcolor try: lightcolor = list(self.load_image("light_normal.png").getdata()) except Exception: logging.warning("Light color image could not be found.") lightcolor = None self.lightcolor = lightcolor return lightcolor def load_grass_color(self): """Helper function to load the grass color texture.""" if not hasattr(self, "grasscolor"): self.grasscolor = list(self.load_image("assets/minecraft/textures/colormap/grass.png").getdata()) return self.grasscolor def load_foliage_color(self): """Helper function to load the foliage color texture.""" if not hasattr(self, "foliagecolor"): self.foliagecolor = list(self.load_image("assets/minecraft/textures/colormap/foliage.png").getdata()) return self.foliagecolor #I guess "watercolor" is wrong. But I can't correct as my texture pack don't define water color. def load_water_color(self): """Helper function to load the water color texture.""" if not hasattr(self, "watercolor"): self.watercolor = list(self.load_image("watercolor.png").getdata()) return self.watercolor def _split_terrain(self, terrain): """Builds and returns a length 256 array of each 16x16 chunk of texture. """ textures = [] (terrain_width, terrain_height) = terrain.size texture_resolution = terrain_width / 16 for y in range(16): for x in range(16): left = x*texture_resolution upper = y*texture_resolution right = left+texture_resolution lower = upper+texture_resolution region = terrain.transform( (16, 16), Image.EXTENT, (left,upper,right,lower), Image.BICUBIC) textures.append(region) return textures ## ## Image Transformation Functions ## @staticmethod def transform_image_top(img): """Takes a PIL image and rotates it left 45 degrees and shrinks the y axis by a factor of 2. Returns the resulting image, which will be 24x12 pixels """ # Resize to 17x17, since the diagonal is approximately 24 pixels, a nice # even number that can be split in half twice img = img.resize((17, 17), Image.ANTIALIAS) # Build the Affine transformation matrix for this perspective transform = numpy.matrix(numpy.identity(3)) # Translate up and left, since rotations are about the origin transform *= numpy.matrix([[1,0,8.5],[0,1,8.5],[0,0,1]]) # Rotate 45 degrees ratio = math.cos(math.pi/4) #transform *= numpy.matrix("[0.707,-0.707,0;0.707,0.707,0;0,0,1]") transform *= numpy.matrix([[ratio,-ratio,0],[ratio,ratio,0],[0,0,1]]) # Translate back down and right transform *= numpy.matrix([[1,0,-12],[0,1,-12],[0,0,1]]) # scale the image down by a factor of 2 transform *= numpy.matrix("[1,0,0;0,2,0;0,0,1]") transform = numpy.array(transform)[:2,:].ravel().tolist() newimg = img.transform((24,12), Image.AFFINE, transform) return newimg @staticmethod def transform_image_side(img): """Takes an image and shears it for the left side of the cube (reflect for the right side)""" # Size of the cube side before shear img = img.resize((12,12), Image.ANTIALIAS) # Apply shear transform = numpy.matrix(numpy.identity(3)) transform *= numpy.matrix("[1,0,0;-0.5,1,0;0,0,1]") transform = numpy.array(transform)[:2,:].ravel().tolist() newimg = img.transform((12,18), Image.AFFINE, transform) return newimg @staticmethod def transform_image_slope(img): """Takes an image and shears it in the shape of a slope going up in the -y direction (reflect for +x direction). Used for minetracks""" # Take the same size as trasform_image_side img = img.resize((12,12), Image.ANTIALIAS) # Apply shear transform = numpy.matrix(numpy.identity(3)) transform *= numpy.matrix("[0.75,-0.5,3;0.25,0.5,-3;0,0,1]") transform = numpy.array(transform)[:2,:].ravel().tolist() newimg = img.transform((24,24), Image.AFFINE, transform) return newimg @staticmethod def transform_image_angle(img, angle): """Takes an image an shears it in arbitrary angle with the axis of rotation being vertical. WARNING! Don't use angle = pi/2 (or multiplies), it will return a blank image (or maybe garbage). NOTE: angle is in the image not in game, so for the left side of a block angle = 30 degree. """ # Take the same size as trasform_image_side img = img.resize((12,12), Image.ANTIALIAS) # some values cos_angle = math.cos(angle) sin_angle = math.sin(angle) # function_x and function_y are used to keep the result image in the # same position, and constant_x and constant_y are the coordinates # for the center for angle = 0. constant_x = 6. constant_y = 6. function_x = 6.*(1-cos_angle) function_y = -6*sin_angle big_term = ( (sin_angle * (function_x + constant_x)) - cos_angle* (function_y + constant_y))/cos_angle # The numpy array is not really used, but is helpful to # see the matrix used for the transformation. transform = numpy.array([[1./cos_angle, 0, -(function_x + constant_x)/cos_angle], [-sin_angle/(cos_angle), 1., big_term ], [0, 0, 1.]]) transform = tuple(transform[0]) + tuple(transform[1]) newimg = img.transform((24,24), Image.AFFINE, transform) return newimg def build_block(self, top, side): """From a top texture and a side texture, build a block image. top and side should be 16x16 image objects. Returns a 24x24 image """ img = Image.new("RGBA", (24,24), self.bgcolor) original_texture = top.copy() top = self.transform_image_top(top) if not side: alpha_over(img, top, (0,0), top) return img side = self.transform_image_side(side) otherside = side.transpose(Image.FLIP_LEFT_RIGHT) # Darken the sides slightly. These methods also affect the alpha layer, # so save them first (we don't want to "darken" the alpha layer making # the block transparent) sidealpha = side.split()[3] side = ImageEnhance.Brightness(side).enhance(0.9) side.putalpha(sidealpha) othersidealpha = otherside.split()[3] otherside = ImageEnhance.Brightness(otherside).enhance(0.8) otherside.putalpha(othersidealpha) alpha_over(img, top, (0,0), top) alpha_over(img, side, (0,6), side) alpha_over(img, otherside, (12,6), otherside) # Manually touch up 6 pixels that leave a gap because of how the # shearing works out. This makes the blocks perfectly tessellate-able for x,y in [(13,23), (17,21), (21,19)]: # Copy a pixel to x,y from x-1,y img.putpixel((x,y), img.getpixel((x-1,y))) for x,y in [(3,4), (7,2), (11,0)]: # Copy a pixel to x,y from x+1,y img.putpixel((x,y), img.getpixel((x+1,y))) return img def build_slab_block(self, top, side, upper): """From a top texture and a side texture, build a slab block image. top and side should be 16x16 image objects. Returns a 24x24 image """ # cut the side texture in half mask = side.crop((0,8,16,16)) side = Image.new(side.mode, side.size, self.bgcolor) alpha_over(side, mask,(0,0,16,8), mask) # plain slab top = self.transform_image_top(top) side = self.transform_image_side(side) otherside = side.transpose(Image.FLIP_LEFT_RIGHT) sidealpha = side.split()[3] side = ImageEnhance.Brightness(side).enhance(0.9) side.putalpha(sidealpha) othersidealpha = otherside.split()[3] otherside = ImageEnhance.Brightness(otherside).enhance(0.8) otherside.putalpha(othersidealpha) # upside down slab delta = 0 if upper: delta = 6 img = Image.new("RGBA", (24,24), self.bgcolor) alpha_over(img, side, (0,12 - delta), side) alpha_over(img, otherside, (12,12 - delta), otherside) alpha_over(img, top, (0,6 - delta), top) # Manually touch up 6 pixels that leave a gap because of how the # shearing works out. This makes the blocks perfectly tessellate-able if upper: for x,y in [(3,4), (7,2), (11,0)]: # Copy a pixel to x,y from x+1,y img.putpixel((x,y), img.getpixel((x+1,y))) for x,y in [(13,17), (17,15), (21,13)]: # Copy a pixel to x,y from x-1,y img.putpixel((x,y), img.getpixel((x-1,y))) else: for x,y in [(3,10), (7,8), (11,6)]: # Copy a pixel to x,y from x+1,y img.putpixel((x,y), img.getpixel((x+1,y))) for x,y in [(13,23), (17,21), (21,19)]: # Copy a pixel to x,y from x-1,y img.putpixel((x,y), img.getpixel((x-1,y))) return img def build_full_block(self, top, side1, side2, side3, side4, bottom=None): """From a top texture, a bottom texture and 4 different side textures, build a full block with four differnts faces. All images should be 16x16 image objects. Returns a 24x24 image. Can be used to render any block. side1 is in the -y face of the cube (top left, east) side2 is in the +x (top right, south) side3 is in the -x (bottom left, north) side4 is in the +y (bottom right, west) A non transparent block uses top, side 3 and side 4. If top is a tuple then first item is the top image and the second item is an increment (integer) from 0 to 16 (pixels in the original minecraft texture). This increment will be used to crop the side images and to paste the top image increment pixels lower, so if you use an increment of 8, it will draw a half-block. NOTE: this method uses the bottom of the texture image (as done in minecraft with beds and cakes) """ increment = 0 if isinstance(top, tuple): increment = int(round((top[1] / 16.)*12.)) # range increment in the block height in pixels (half texture size) crop_height = increment top = top[0] if side1 is not None: side1 = side1.copy() ImageDraw.Draw(side1).rectangle((0, 0,16,crop_height),outline=(0,0,0,0),fill=(0,0,0,0)) if side2 is not None: side2 = side2.copy() ImageDraw.Draw(side2).rectangle((0, 0,16,crop_height),outline=(0,0,0,0),fill=(0,0,0,0)) if side3 is not None: side3 = side3.copy() ImageDraw.Draw(side3).rectangle((0, 0,16,crop_height),outline=(0,0,0,0),fill=(0,0,0,0)) if side4 is not None: side4 = side4.copy() ImageDraw.Draw(side4).rectangle((0, 0,16,crop_height),outline=(0,0,0,0),fill=(0,0,0,0)) img = Image.new("RGBA", (24,24), self.bgcolor) # first back sides if side1 is not None : side1 = self.transform_image_side(side1) side1 = side1.transpose(Image.FLIP_LEFT_RIGHT) # Darken this side. sidealpha = side1.split()[3] side1 = ImageEnhance.Brightness(side1).enhance(0.9) side1.putalpha(sidealpha) alpha_over(img, side1, (0,0), side1) if side2 is not None : side2 = self.transform_image_side(side2) # Darken this side. sidealpha2 = side2.split()[3] side2 = ImageEnhance.Brightness(side2).enhance(0.8) side2.putalpha(sidealpha2) alpha_over(img, side2, (12,0), side2) if bottom is not None : bottom = self.transform_image_top(bottom) alpha_over(img, bottom, (0,12), bottom) # front sides if side3 is not None : side3 = self.transform_image_side(side3) # Darken this side sidealpha = side3.split()[3] side3 = ImageEnhance.Brightness(side3).enhance(0.9) side3.putalpha(sidealpha) alpha_over(img, side3, (0,6), side3) if side4 is not None : side4 = self.transform_image_side(side4) side4 = side4.transpose(Image.FLIP_LEFT_RIGHT) # Darken this side sidealpha = side4.split()[3] side4 = ImageEnhance.Brightness(side4).enhance(0.8) side4.putalpha(sidealpha) alpha_over(img, side4, (12,6), side4) if top is not None : top = self.transform_image_top(top) alpha_over(img, top, (0, increment), top) # Manually touch up 6 pixels that leave a gap because of how the # shearing works out. This makes the blocks perfectly tessellate-able for x,y in [(13,23), (17,21), (21,19)]: # Copy a pixel to x,y from x-1,y img.putpixel((x,y), img.getpixel((x-1,y))) for x,y in [(3,4), (7,2), (11,0)]: # Copy a pixel to x,y from x+1,y img.putpixel((x,y), img.getpixel((x+1,y))) return img def build_axis_block(self, top, side, data): """ Build an block with Axis property. data = {'y': 0, 'x': 1, 'z': 2}[axis] """ def draw_x(): return self.build_full_block(side.rotate(90), None, None, top, side.rotate(90)) def draw_y(): return self.build_full_block(side, None, None, side.rotate(270), top) draw_funcs = [draw_x, draw_y] if data == 0: # up return self.build_block(top, side) elif data == 1: # x return draw_funcs[(self.rotation + 0) % len(draw_funcs)]() elif data == 2: # y return draw_funcs[(self.rotation + 1) % len(draw_funcs)]() def build_sprite(self, side): """From a side texture, create a sprite-like texture such as those used for spiderwebs or flowers.""" img = Image.new("RGBA", (24,24), self.bgcolor) side = self.transform_image_side(side) otherside = side.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, side, (6,3), side) alpha_over(img, otherside, (6,3), otherside) return img def build_billboard(self, tex): """From a texture, create a billboard-like texture such as those used for tall grass or melon stems. """ img = Image.new("RGBA", (24,24), self.bgcolor) front = tex.resize((14, 12), Image.ANTIALIAS) alpha_over(img, front, (5,9)) return img def generate_opaque_mask(self, img): """ Takes the alpha channel of the image and generates a mask (used for lighting the block) that deprecates values of alpha smallers than 50, and sets every other value to 255. """ alpha = img.split()[3] return alpha.point(lambda a: int(min(a, 25.5) * 10)) def tint_texture(self, im, c): # apparently converting to grayscale drops the alpha channel? i = ImageOps.colorize(ImageOps.grayscale(im), (0,0,0), c) i.putalpha(im.split()[3]); # copy the alpha band back in. assuming RGBA return i def generate_texture_tuple(self, img): """ This takes an image and returns the needed tuple for the blockmap array.""" if img is None: return None return (img, self.generate_opaque_mask(img)) ## ## The other big one: @material and associated framework ## # the material registration decorator def material(blockid=[], data=[0], **kwargs): # mapping from property name to the set to store them in properties = {"transparent" : transparent_blocks, "solid" : solid_blocks, "fluid" : fluid_blocks, "nospawn" : nospawn_blocks, "nodata" : nodata_blocks} # make sure blockid and data are iterable try: iter(blockid) except Exception: blockid = [blockid,] try: iter(data) except Exception: data = [data,] def inner_material(func): global blockmap_generators global max_data, max_blockid # create a wrapper function with a known signature @functools.wraps(func) def func_wrapper(texobj, blockid, data): return func(texobj, blockid, data) used_datas.update(data) if max(data) >= max_data: max_data = max(data) + 1 for block in blockid: # set the property sets appropriately known_blocks.update([block]) if block >= max_blockid: max_blockid = block + 1 for prop in properties: try: if block in kwargs.get(prop, []): properties[prop].update([block]) except TypeError: if kwargs.get(prop, False): properties[prop].update([block]) # populate blockmap_generators with our function for d in data: blockmap_generators[(block, d)] = func_wrapper return func_wrapper return inner_material # shortcut function for pure blocks, default to solid, nodata def block(blockid=[], top_image=None, side_image=None, **kwargs): new_kwargs = {'solid' : True, 'nodata' : True} new_kwargs.update(kwargs) if top_image is None: raise ValueError("top_image was not provided") if side_image is None: side_image = top_image @material(blockid=blockid, **new_kwargs) def inner_block(self, unused_id, unused_data): return self.build_block(self.load_image_texture(top_image), self.load_image_texture(side_image)) return inner_block # shortcut function for sprite blocks, defaults to transparent, nodata def sprite(blockid=[], imagename=None, **kwargs): new_kwargs = {'transparent' : True, 'nodata' : True} new_kwargs.update(kwargs) if imagename is None: raise ValueError("imagename was not provided") @material(blockid=blockid, **new_kwargs) def inner_sprite(self, unused_id, unused_data): return self.build_sprite(self.load_image_texture(imagename)) return inner_sprite # shortcut function for billboard blocks, defaults to transparent, nodata def billboard(blockid=[], imagename=None, **kwargs): new_kwargs = {'transparent' : True, 'nodata' : True} new_kwargs.update(kwargs) if imagename is None: raise ValueError("imagename was not provided") @material(blockid=blockid, **new_kwargs) def inner_billboard(self, unused_id, unused_data): return self.build_billboard(self.load_image_texture(imagename)) return inner_billboard ## ## and finally: actual texture definitions ## # stone @material(blockid=1, data=list(range(7)), solid=True) def stone(self, blockid, data): if data == 0: # regular old-school stone img = self.load_image_texture("assets/minecraft/textures/block/stone.png") elif data == 1: # granite img = self.load_image_texture("assets/minecraft/textures/block/granite.png") elif data == 2: # polished granite img = self.load_image_texture("assets/minecraft/textures/block/polished_granite.png") elif data == 3: # diorite img = self.load_image_texture("assets/minecraft/textures/block/diorite.png") elif data == 4: # polished diorite img = self.load_image_texture("assets/minecraft/textures/block/polished_diorite.png") elif data == 5: # andesite img = self.load_image_texture("assets/minecraft/textures/block/andesite.png") elif data == 6: # polished andesite img = self.load_image_texture("assets/minecraft/textures/block/polished_andesite.png") return self.build_block(img, img) @material(blockid=2, data=list(range(11))+[0x10,], solid=True) def grass(self, blockid, data): # 0x10 bit means SNOW side_img = self.load_image_texture("assets/minecraft/textures/block/grass_block_side.png") if data & 0x10: side_img = self.load_image_texture("assets/minecraft/textures/block/grass_block_snow.png") img = self.build_block(self.load_image_texture("assets/minecraft/textures/block/grass_block_top.png"), side_img) if not data & 0x10: alpha_over(img, self.biome_grass_texture, (0, 0), self.biome_grass_texture) return img # dirt @material(blockid=3, data=list(range(3)), solid=True) def dirt_blocks(self, blockid, data): texture_map = [{"top": "dirt", "side": "dirt"}, # Normal {"top": "coarse_dirt", "side": "coarse_dirt"}, # Coarse {"top": "podzol_top", "side": "podzol_side"}] # Podzol top_img = self.load_image_texture("assets/minecraft/textures/block/%s.png" % texture_map[data]["top"]) side_img = self.load_image_texture("assets/minecraft/textures/block/%s.png" % texture_map[data]["side"]) return self.build_block(top_img, side_img) # cobblestone block(blockid=4, top_image="assets/minecraft/textures/block/cobblestone.png") # wooden planks @material(blockid=5, data=list(range(8)), solid=True) def wooden_planks(self, blockid, data): if data == 0: # normal return self.build_block(self.load_image_texture("assets/minecraft/textures/block/oak_planks.png"), self.load_image_texture("assets/minecraft/textures/block/oak_planks.png")) if data == 1: # pine return self.build_block(self.load_image_texture("assets/minecraft/textures/block/spruce_planks.png"),self.load_image_texture("assets/minecraft/textures/block/spruce_planks.png")) if data == 2: # birch return self.build_block(self.load_image_texture("assets/minecraft/textures/block/birch_planks.png"),self.load_image_texture("assets/minecraft/textures/block/birch_planks.png")) if data == 3: # jungle wood return self.build_block(self.load_image_texture("assets/minecraft/textures/block/jungle_planks.png"),self.load_image_texture("assets/minecraft/textures/block/jungle_planks.png")) if data == 4: # acacia return self.build_block(self.load_image_texture("assets/minecraft/textures/block/acacia_planks.png"),self.load_image_texture("assets/minecraft/textures/block/acacia_planks.png")) if data == 5: # dark oak return self.build_block(self.load_image_texture("assets/minecraft/textures/block/dark_oak_planks.png"),self.load_image_texture("assets/minecraft/textures/block/dark_oak_planks.png")) if data == 6: # crimson return self.build_block(self.load_image_texture("assets/minecraft/textures/block/crimson_planks.png"),self.load_image_texture("assets/minecraft/textures/block/crimson_planks.png")) if data == 7: # warped return self.build_block(self.load_image_texture("assets/minecraft/textures/block/warped_planks.png"),self.load_image_texture("assets/minecraft/textures/block/warped_planks.png")) @material(blockid=6, data=list(range(16)), transparent=True) def saplings(self, blockid, data): # usual saplings tex = self.load_image_texture("assets/minecraft/textures/block/oak_sapling.png") if data & 0x3 == 1: # spruce sapling tex = self.load_image_texture("assets/minecraft/textures/block/spruce_sapling.png") elif data & 0x3 == 2: # birch sapling tex = self.load_image_texture("assets/minecraft/textures/block/birch_sapling.png") elif data & 0x3 == 3: # jungle sapling tex = self.load_image_texture("assets/minecraft/textures/block/jungle_sapling.png") elif data & 0x3 == 4: # acacia sapling tex = self.load_image_texture("assets/minecraft/textures/block/acacia_sapling.png") elif data & 0x3 == 5: # dark oak/roofed oak/big oak sapling tex = self.load_image_texture("assets/minecraft/textures/block/dark_oak_sapling.png") return self.build_sprite(tex) sprite(blockid=11385, imagename="assets/minecraft/textures/block/oak_sapling.png") sprite(blockid=11386, imagename="assets/minecraft/textures/block/spruce_sapling.png") sprite(blockid=11387, imagename="assets/minecraft/textures/block/birch_sapling.png") sprite(blockid=11388, imagename="assets/minecraft/textures/block/jungle_sapling.png") sprite(blockid=11389, imagename="assets/minecraft/textures/block/acacia_sapling.png") sprite(blockid=11390, imagename="assets/minecraft/textures/block/dark_oak_sapling.png") sprite(blockid=11413, imagename="assets/minecraft/textures/block/bamboo_stage0.png") # bedrock block(blockid=7, top_image="assets/minecraft/textures/block/bedrock.png") # water, glass, and ice (no inner surfaces) # uses pseudo-ancildata found in iterate.c @material(blockid=[8, 9, 20, 79, 95], data=list(range(512)), fluid=(8, 9), transparent=True, nospawn=True, solid=(79, 20, 95)) def no_inner_surfaces(self, blockid, data): if blockid == 8 or blockid == 9: texture = self.load_water() elif blockid == 20: texture = self.load_image_texture("assets/minecraft/textures/block/glass.png") elif blockid == 95: texture = self.load_image_texture("assets/minecraft/textures/block/%s_stained_glass.png" % color_map[data & 0x0f]) else: texture = self.load_image_texture("assets/minecraft/textures/block/ice.png") # now that we've used the lower 4 bits to get color, shift down to get the 5 bits that encode face hiding if not (blockid == 8 or blockid == 9): # water doesn't have a shifted pseudodata data = data >> 4 if (data & 0b10000) == 16: top = texture else: top = None if (data & 0b0001) == 1: side1 = texture # top left else: side1 = None if (data & 0b1000) == 8: side2 = texture # top right else: side2 = None if (data & 0b0010) == 2: side3 = texture # bottom left else: side3 = None if (data & 0b0100) == 4: side4 = texture # bottom right else: side4 = None # if nothing shown do not draw at all if top is None and side3 is None and side4 is None: return None img = self.build_full_block(top,None,None,side3,side4) return img @material(blockid=[10, 11], data=list(range(16)), fluid=True, transparent=False, nospawn=True) def lava(self, blockid, data): lavatex = self.load_lava() return self.build_block(lavatex, lavatex) # sand @material(blockid=12, data=list(range(2)), solid=True) def sand_blocks(self, blockid, data): if data == 0: # normal img = self.build_block(self.load_image_texture("assets/minecraft/textures/block/sand.png"), self.load_image_texture("assets/minecraft/textures/block/sand.png")) if data == 1: # red img = self.build_block(self.load_image_texture("assets/minecraft/textures/block/red_sand.png"), self.load_image_texture("assets/minecraft/textures/block/red_sand.png")) return img # gravel block(blockid=13, top_image="assets/minecraft/textures/block/gravel.png") # gold ore block(blockid=14, top_image="assets/minecraft/textures/block/gold_ore.png") # iron ore block(blockid=15, top_image="assets/minecraft/textures/block/iron_ore.png") # coal ore block(blockid=16, top_image="assets/minecraft/textures/block/coal_ore.png") @material(blockid=[17, 162, 11306, 11307, 11308, 11309, 11310, 11311, 1008, 1009], data=list(range(12)), solid=True) def wood(self, blockid, data): # extract orientation and wood type frorm data bits wood_type = data & 3 wood_orientation = data & 12 if self.rotation == 1: if wood_orientation == 4: wood_orientation = 8 elif wood_orientation == 8: wood_orientation = 4 elif self.rotation == 3: if wood_orientation == 4: wood_orientation = 8 elif wood_orientation == 8: wood_orientation = 4 # dictionary of blockid : { wood_type : (top, side) } wood_tex = { 17: { 0: ("oak_log_top.png", "oak_log.png"), 1: ("spruce_log_top.png", "spruce_log.png"), 2: ("birch_log_top.png", "birch_log.png"), 3: ("jungle_log_top.png", "jungle_log.png"), }, 162: { 0: ("acacia_log_top.png", "acacia_log.png"), 1: ("dark_oak_log_top.png", "dark_oak_log.png"), }, 11306: { 0: ("stripped_oak_log_top.png", "stripped_oak_log.png"), 1: ("stripped_spruce_log_top.png", "stripped_spruce_log.png"), 2: ("stripped_birch_log_top.png", "stripped_birch_log.png"), 3: ("stripped_jungle_log_top.png", "stripped_jungle_log.png"), }, 11307: { 0: ("stripped_acacia_log_top.png", "stripped_acacia_log.png"), 1: ("stripped_dark_oak_log_top.png", "stripped_dark_oak_log.png"), }, 11308: { 0: ("oak_log.png", None), 1: ("spruce_log.png", None), 2: ("birch_log.png", None), 3: ("jungle_log.png", None), }, 11309: { 0: ("acacia_log.png", None), 1: ("dark_oak_log.png", None), }, 11310: { 0: ("stripped_oak_log.png", None), 1: ("stripped_spruce_log.png", None), 2: ("stripped_birch_log.png", None), 3: ("stripped_jungle_log.png", None), }, 11311: { 0: ("stripped_acacia_log.png", None), 1: ("stripped_dark_oak_log.png", None), }, 1008: { 0: ("warped_stem_top.png", "warped_stem.png"), 1: ("warped_stem_top.png", "stripped_warped_stem.png"), 2: ("crimson_stem_top.png", "crimson_stem.png"), 3: ("crimson_stem_top.png", "stripped_crimson_stem.png"), }, 1009: { 0: ("warped_stem.png", None), 1: ("stripped_warped_stem.png", None), 2: ("crimson_stem.png", None), 3: ("stripped_crimson_stem.png", None), } } top_f, side_f = wood_tex[blockid].get(wood_type, wood_tex[blockid][0]) if not side_f: side_f = top_f top = self.load_image_texture(BLOCKTEX + top_f) side = self.load_image_texture(BLOCKTEX + side_f) # choose orientation and paste textures if wood_orientation == 0: return self.build_block(top, side) elif wood_orientation == 4: # east-west orientation return self.build_full_block(side.rotate(90), None, None, top, side.rotate(90)) elif wood_orientation == 8: # north-south orientation return self.build_full_block(side, None, None, side.rotate(270), top) @material(blockid=[18, 161], data=list(range(16)), transparent=True, solid=True) def leaves(self, blockid, data): # mask out the bits 4 and 8 # they are used for player placed and check-for-decay blocks data = data & 0x7 t = self.load_image_texture("assets/minecraft/textures/block/oak_leaves.png") if (blockid, data) == (18, 1): # pine! t = self.load_image_texture("assets/minecraft/textures/block/spruce_leaves.png") elif (blockid, data) == (18, 2): # birth tree t = self.load_image_texture("assets/minecraft/textures/block/birch_leaves.png") elif (blockid, data) == (18, 3): # jungle tree t = self.load_image_texture("assets/minecraft/textures/block/jungle_leaves.png") elif (blockid, data) == (161, 4): # acacia tree t = self.load_image_texture("assets/minecraft/textures/block/acacia_leaves.png") elif (blockid, data) == (161, 5): t = self.load_image_texture("assets/minecraft/textures/block/dark_oak_leaves.png") elif (blockid, data) == (18, 6): t = self.load_image_texture("assets/minecraft/textures/block/flowering_azalea_leaves.png") elif (blockid, data) == (18, 7): t = self.load_image_texture("assets/minecraft/textures/block/azalea_leaves.png") return self.build_block(t, t) # sponge block(blockid=19, top_image="assets/minecraft/textures/block/sponge.png") # lapis lazuli ore block(blockid=21, top_image="assets/minecraft/textures/block/lapis_ore.png") # lapis lazuli block block(blockid=22, top_image="assets/minecraft/textures/block/lapis_block.png") # dispenser, dropper, furnace, blast furnace, and smoker @material(blockid=[23, 61, 158, 11362, 11364], data=list(range(14)), solid=True) def furnaces(self, blockid, data): # first, do the rotation if needed # Masked as bit 4 indicates whether the block is lit/triggered or not if self.rotation in [1, 2, 3] and data & 0b111 in [2, 3, 4, 5]: rotation_map = {1: {2: 5, 3: 4, 4: 2, 5: 3}, 2: {2: 3, 3: 2, 4: 5, 5: 4}, 3: {2: 4, 3: 5, 4: 3, 5: 2}} data = data & 0b1000 | rotation_map[self.rotation][data & 0b111] # Rotation angles for top texture using data & 0b111 as an index top_rotation_map = [0, 0, 180, 0, 270, 90, 0, 0] # Dispenser texture_map = {23: {'top': 'furnace_top', 'side': 'furnace_side', 'front': 'dispenser_front', 'top_vert': 'dispenser_front_vertical'}, # Furnace 61: {'top': 'furnace_top', 'side': 'furnace_side', 'front': 'furnace_front', 'front_on': 'furnace_front_on'}, # Dropper 158: {'top': 'furnace_top', 'side': 'furnace_side', 'front': 'dropper_front', 'top_vert': 'dropper_front_vertical'}, # Blast furance 11362: {'top': 'blast_furnace_top', 'side': 'blast_furnace_side', 'front': 'blast_furnace_front', 'front_on': 'blast_furnace_front_on'}, # Smoker 11364: {'top': 'smoker_top', 'side': 'smoker_side', 'front': 'smoker_front', 'front_on': 'smoker_front_on'}} if data & 0b111 in [0, 1] and 'top_vert' in texture_map[blockid]: # Block has a special top texture when it faces up/down # This also affects which texture is used for the sides/front top_name = 'top_vert' if data & 0b111 == 1 else 'top' side_name = 'top' front_name = 'top' else: top_name = 'top' side_name = 'side' # Use block's lit/on front texture if it is defined & bit 4 is set # Note: Some front_on texture images have multiple frames, # but load_image_texture() crops this appropriately # as long as the image width is 16px if data & 0b1000 == 8 and 'front_on' in texture_map[blockid]: front_name = 'front_on' else: front_name = 'front' top = self.load_image_texture("assets/minecraft/textures/block/%s.png" % texture_map[blockid][top_name]).copy() top = top.rotate(top_rotation_map[data & 0b111]) side = self.load_image_texture("assets/minecraft/textures/block/%s.png" % texture_map[blockid][side_name]) front = self.load_image_texture("assets/minecraft/textures/block/%s.png" % texture_map[blockid][front_name]) if data & 0b111 == 3: # pointing west return self.build_full_block(top, None, None, side, front) elif data & 0b111 == 4: # pointing north return self.build_full_block(top, None, None, front, side) else: # in any other direction the front can't be seen return self.build_full_block(top, None, None, side, side) # sandstone @material(blockid=24, data=list(range(3)), solid=True) def sandstone(self, blockid, data): top = self.load_image_texture("assets/minecraft/textures/block/sandstone_top.png") if data == 0: # normal return self.build_block(top, self.load_image_texture("assets/minecraft/textures/block/sandstone.png")) if data == 1: # hieroglyphic return self.build_block(top, self.load_image_texture("assets/minecraft/textures/block/chiseled_sandstone.png")) if data == 2: # soft return self.build_block(top, self.load_image_texture("assets/minecraft/textures/block/cut_sandstone.png")) # red sandstone @material(blockid=179, data=list(range(3)), solid=True) def sandstone(self, blockid, data): top = self.load_image_texture("assets/minecraft/textures/block/red_sandstone_top.png") if data == 0: # normal side = self.load_image_texture("assets/minecraft/textures/block/red_sandstone.png") return self.build_full_block(top, None, None, side, side, self.load_image_texture("assets/minecraft/textures/block/red_sandstone_bottom.png") ) if data == 1: # hieroglyphic return self.build_block(top, self.load_image_texture("assets/minecraft/textures/block/chiseled_red_sandstone.png")) if data == 2: # soft return self.build_block(top, self.load_image_texture("assets/minecraft/textures/block/cut_red_sandstone.png")) # note block block(blockid=25, top_image="assets/minecraft/textures/block/note_block.png") # Bed @material(blockid=26, data=list(range(256)), transparent=True, nospawn=True) def bed(self, blockid, data): # Bits 1-2 Rotation # Bit 3 Occupancy, no impact on appearance # Bit 4 Foot/Head of bed (0 = foot, 1 = head) # Bits 5-8 Color # first get rotation done # Masked to not clobber block head/foot & color info data = data & 0b11111100 | ((self.rotation + (data & 0b11)) % 4) bed_texture = self.load_image("assets/minecraft/textures/entity/bed/%s.png" % color_map[data >> 4]) increment = 8 left_face = None right_face = None top_face = None if data & 0x8 == 0x8: # head of the bed top = bed_texture.copy().crop((6, 6, 22, 22)) # Composing the side side = Image.new("RGBA", (16, 16), self.bgcolor) side_part1 = bed_texture.copy().crop((0, 6, 6, 22)).rotate(90, expand=True) # foot of the bed side_part2 = bed_texture.copy().crop((53, 3, 56, 6)) side_part2_f = side_part2.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(side, side_part1, (0, 7), side_part1) alpha_over(side, side_part2, (0, 13), side_part2) end = Image.new("RGBA", (16, 16), self.bgcolor) end_part = bed_texture.copy().crop((6, 0, 22, 6)).rotate(180) alpha_over(end, end_part, (0, 7), end_part) alpha_over(end, side_part2, (0, 13), side_part2) alpha_over(end, side_part2_f, (13, 13), side_part2_f) if data & 0x03 == 0x00: # South top_face = top.rotate(180) left_face = side.transpose(Image.FLIP_LEFT_RIGHT) right_face = end elif data & 0x03 == 0x01: # West top_face = top.rotate(90) left_face = end right_face = side.transpose(Image.FLIP_LEFT_RIGHT) elif data & 0x03 == 0x02: # North top_face = top left_face = side elif data & 0x03 == 0x03: # East top_face = top.rotate(270) right_face = side else: # foot of the bed top = bed_texture.copy().crop((6, 28, 22, 44)) side = Image.new("RGBA", (16, 16), self.bgcolor) side_part1 = bed_texture.copy().crop((0, 28, 6, 44)).rotate(90, expand=True) side_part2 = bed_texture.copy().crop((53, 3, 56, 6)) side_part2_f = side_part2.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(side, side_part1, (0, 7), side_part1) alpha_over(side, side_part2, (13, 13), side_part2) end = Image.new("RGBA", (16, 16), self.bgcolor) end_part = bed_texture.copy().crop((22, 22, 38, 28)).rotate(180) alpha_over(end, end_part, (0, 7), end_part) alpha_over(end, side_part2, (0, 13), side_part2) alpha_over(end, side_part2_f, (13, 13), side_part2_f) if data & 0x03 == 0x00: # South top_face = top.rotate(180) left_face = side.transpose(Image.FLIP_LEFT_RIGHT) elif data & 0x03 == 0x01: # West top_face = top.rotate(90) right_face = side.transpose(Image.FLIP_LEFT_RIGHT) elif data & 0x03 == 0x02: # North top_face = top left_face = side right_face = end elif data & 0x03 == 0x03: # East top_face = top.rotate(270) left_face = end right_face = side top_face = (top_face, increment) return self.build_full_block(top_face, None, None, left_face, right_face) # powered, detector, activator and normal rails @material(blockid=[27, 28, 66, 157], data=list(range(14)), transparent=True) def rails(self, blockid, data): # first, do rotation # Masked to not clobber powered rail on/off info # Ascending and flat straight if self.rotation == 1: if (data & 0b0111) == 0: data = data & 0b1000 | 1 elif (data & 0b0111) == 1: data = data & 0b1000 | 0 elif (data & 0b0111) == 2: data = data & 0b1000 | 5 elif (data & 0b0111) == 3: data = data & 0b1000 | 4 elif (data & 0b0111) == 4: data = data & 0b1000 | 2 elif (data & 0b0111) == 5: data = data & 0b1000 | 3 elif self.rotation == 2: if (data & 0b0111) == 2: data = data & 0b1000 | 3 elif (data & 0b0111) == 3: data = data & 0b1000 | 2 elif (data & 0b0111) == 4: data = data & 0b1000 | 5 elif (data & 0b0111) == 5: data = data & 0b1000 | 4 elif self.rotation == 3: if (data & 0b0111) == 0: data = data & 0b1000 | 1 elif (data & 0b0111) == 1: data = data & 0b1000 | 0 elif (data & 0b0111) == 2: data = data & 0b1000 | 4 elif (data & 0b0111) == 3: data = data & 0b1000 | 5 elif (data & 0b0111) == 4: data = data & 0b1000 | 3 elif (data & 0b0111) == 5: data = data & 0b1000 | 2 if blockid == 66: # normal minetrack only #Corners if self.rotation == 1: if data == 6: data = 7 elif data == 7: data = 8 elif data == 8: data = 6 elif data == 9: data = 9 elif self.rotation == 2: if data == 6: data = 8 elif data == 7: data = 9 elif data == 8: data = 6 elif data == 9: data = 7 elif self.rotation == 3: if data == 6: data = 9 elif data == 7: data = 6 elif data == 8: data = 8 elif data == 9: data = 7 img = Image.new("RGBA", (24,24), self.bgcolor) if blockid == 27: # powered rail if data & 0x8 == 0: # unpowered raw_straight = self.load_image_texture("assets/minecraft/textures/block/powered_rail.png") raw_corner = self.load_image_texture("assets/minecraft/textures/block/rail_corner.png") # they don't exist but make the code # much simplier elif data & 0x8 == 0x8: # powered raw_straight = self.load_image_texture("assets/minecraft/textures/block/powered_rail_on.png") raw_corner = self.load_image_texture("assets/minecraft/textures/block/rail_corner.png") # leave corners for code simplicity # filter the 'powered' bit data = data & 0x7 elif blockid == 28: # detector rail raw_straight = self.load_image_texture("assets/minecraft/textures/block/detector_rail.png") raw_corner = self.load_image_texture("assets/minecraft/textures/block/rail_corner.png") # leave corners for code simplicity elif blockid == 66: # normal rail raw_straight = self.load_image_texture("assets/minecraft/textures/block/rail.png") raw_corner = self.load_image_texture("assets/minecraft/textures/block/rail_corner.png") elif blockid == 157: # activator rail if data & 0x8 == 0: # unpowered raw_straight = self.load_image_texture("assets/minecraft/textures/block/activator_rail.png") raw_corner = self.load_image_texture("assets/minecraft/textures/block/rail_corner.png") # they don't exist but make the code # much simplier elif data & 0x8 == 0x8: # powered raw_straight = self.load_image_texture("assets/minecraft/textures/block/activator_rail_on.png") raw_corner = self.load_image_texture("assets/minecraft/textures/block/rail_corner.png") # leave corners for code simplicity # filter the 'powered' bit data = data & 0x7 ## use transform_image to scale and shear if data == 0: track = self.transform_image_top(raw_straight) alpha_over(img, track, (0,12), track) elif data == 6: track = self.transform_image_top(raw_corner) alpha_over(img, track, (0,12), track) elif data == 7: track = self.transform_image_top(raw_corner.rotate(270)) alpha_over(img, track, (0,12), track) elif data == 8: # flip track = self.transform_image_top(raw_corner.transpose(Image.FLIP_TOP_BOTTOM).rotate(90)) alpha_over(img, track, (0,12), track) elif data == 9: track = self.transform_image_top(raw_corner.transpose(Image.FLIP_TOP_BOTTOM)) alpha_over(img, track, (0,12), track) elif data == 1: track = self.transform_image_top(raw_straight.rotate(90)) alpha_over(img, track, (0,12), track) #slopes elif data == 2: # slope going up in +x direction track = self.transform_image_slope(raw_straight) track = track.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, track, (2,0), track) # the 2 pixels move is needed to fit with the adjacent tracks elif data == 3: # slope going up in -x direction # tracks are sprites, in this case we are seeing the "side" of # the sprite, so draw a line to make it beautiful. ImageDraw.Draw(img).line([(11,11),(23,17)],fill=(164,164,164)) # grey from track texture (exterior grey). # the track doesn't start from image corners, be carefull drawing the line! elif data == 4: # slope going up in -y direction track = self.transform_image_slope(raw_straight) alpha_over(img, track, (0,0), track) elif data == 5: # slope going up in +y direction # same as "data == 3" ImageDraw.Draw(img).line([(1,17),(12,11)],fill=(164,164,164)) return img # sticky and normal piston body @material(blockid=[29, 33], data=[0, 1, 2, 3, 4, 5, 8, 9, 10, 11, 12, 13], transparent=True, solid=True, nospawn=True) def piston(self, blockid, data): # first, rotation # Masked to not clobber block head/foot info if self.rotation in [1, 2, 3] and (data & 0b111) in [2, 3, 4, 5]: rotation_map = {1: {2: 5, 3: 4, 4: 2, 5: 3}, 2: {2: 3, 3: 2, 4: 5, 5: 4}, 3: {2: 4, 3: 5, 4: 3, 5: 2}} data = (data & 0b1000) | rotation_map[self.rotation][data & 0b111] if blockid == 29: # sticky piston_t = self.load_image_texture("assets/minecraft/textures/block/piston_top_sticky.png").copy() else: # normal piston_t = self.load_image_texture("assets/minecraft/textures/block/piston_top.png").copy() # other textures side_t = self.load_image_texture("assets/minecraft/textures/block/piston_side.png").copy() back_t = self.load_image_texture("assets/minecraft/textures/block/piston_bottom.png").copy() interior_t = self.load_image_texture("assets/minecraft/textures/block/piston_inner.png").copy() if data & 0x08 == 0x08: # pushed out, non full blocks, tricky stuff # remove piston texture from piston body ImageDraw.Draw(side_t).rectangle((0, 0, 16, 3), outline=(0, 0, 0, 0), fill=(0, 0, 0, 0)) if data & 0x07 == 0x0: # down side_t = side_t.rotate(180) img = self.build_full_block(back_t, None, None, side_t, side_t) elif data & 0x07 == 0x1: # up img = self.build_full_block((interior_t, 4), None, None, side_t, side_t) elif data & 0x07 == 0x2: # north img = self.build_full_block(side_t, None, None, side_t.rotate(90), back_t) elif data & 0x07 == 0x3: # south img = self.build_full_block(side_t.rotate(180), None, None, side_t.rotate(270), None) temp = self.transform_image_side(interior_t) temp = temp.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, temp, (9, 4), temp) elif data & 0x07 == 0x4: # west img = self.build_full_block(side_t.rotate(90), None, None, None, side_t.rotate(270)) temp = self.transform_image_side(interior_t) alpha_over(img, temp, (3, 4), temp) elif data & 0x07 == 0x5: # east img = self.build_full_block(side_t.rotate(270), None, None, back_t, side_t.rotate(90)) else: # pushed in, normal full blocks, easy stuff if data & 0x07 == 0x0: # down side_t = side_t.rotate(180) img = self.build_full_block(back_t, None, None, side_t, side_t) elif data & 0x07 == 0x1: # up img = self.build_full_block(piston_t, None, None, side_t, side_t) elif data & 0x07 == 0x2: # north img = self.build_full_block(side_t, None, None, side_t.rotate(90), back_t) elif data & 0x07 == 0x3: # south img = self.build_full_block(side_t.rotate(180), None, None, side_t.rotate(270), piston_t) elif data & 0x07 == 0x4: # west img = self.build_full_block(side_t.rotate(90), None, None, piston_t, side_t.rotate(270)) elif data & 0x07 == 0x5: # east img = self.build_full_block(side_t.rotate(270), None, None, back_t, side_t.rotate(90)) return img # sticky and normal piston shaft @material(blockid=34, data=[0, 1, 2, 3, 4, 5, 8, 9, 10, 11, 12, 13], transparent=True, nospawn=True) def piston_extension(self, blockid, data): # first, rotation # Masked to not clobber block head/foot info if self.rotation in [1, 2, 3] and (data & 0b111) in [2, 3, 4, 5]: rotation_map = {1: {2: 5, 3: 4, 4: 2, 5: 3}, 2: {2: 3, 3: 2, 4: 5, 5: 4}, 3: {2: 4, 3: 5, 4: 3, 5: 2}} data = (data & 0b1000) | rotation_map[self.rotation][data & 0b111] if data & 0x8 == 0x8: # sticky piston_t = self.load_image_texture("assets/minecraft/textures/block/piston_top_sticky.png").copy() else: # normal piston_t = self.load_image_texture("assets/minecraft/textures/block/piston_top.png").copy() # other textures side_t = self.load_image_texture("assets/minecraft/textures/block/piston_side.png").copy() back_t = self.load_image_texture("assets/minecraft/textures/block/piston_top.png").copy() # crop piston body ImageDraw.Draw(side_t).rectangle((0, 4, 16, 16), outline=(0, 0, 0, 0), fill=(0, 0, 0, 0)) # generate the horizontal piston extension stick h_stick = Image.new("RGBA", (24, 24), self.bgcolor) temp = self.transform_image_side(side_t) alpha_over(h_stick, temp, (1, 7), temp) temp = self.transform_image_top(side_t.rotate(90)) alpha_over(h_stick, temp, (1, 1), temp) # Darken it sidealpha = h_stick.split()[3] h_stick = ImageEnhance.Brightness(h_stick).enhance(0.85) h_stick.putalpha(sidealpha) # generate the vertical piston extension stick v_stick = Image.new("RGBA", (24, 24), self.bgcolor) temp = self.transform_image_side(side_t.rotate(90)) alpha_over(v_stick, temp, (12, 6), temp) temp = temp.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(v_stick, temp, (1, 6), temp) # Darken it sidealpha = v_stick.split()[3] v_stick = ImageEnhance.Brightness(v_stick).enhance(0.85) v_stick.putalpha(sidealpha) # Piston orientation is stored in the 3 first bits if data & 0x07 == 0x0: # down side_t = side_t.rotate(180) img = self.build_full_block((back_t, 12), None, None, side_t, side_t) alpha_over(img, v_stick, (0, -3), v_stick) elif data & 0x07 == 0x1: # up img = Image.new("RGBA", (24, 24), self.bgcolor) img2 = self.build_full_block(piston_t, None, None, side_t, side_t) alpha_over(img, v_stick, (0, 4), v_stick) alpha_over(img, img2, (0, 0), img2) elif data & 0x07 == 0x2: # north img = self.build_full_block(side_t, None, None, side_t.rotate(90), None) temp = self.transform_image_side(back_t).transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, temp, (2, 2), temp) alpha_over(img, h_stick, (6, 3), h_stick) elif data & 0x07 == 0x3: # south img = Image.new("RGBA", (24, 24), self.bgcolor) img2 = self.build_full_block(side_t.rotate(180), None, None, side_t.rotate(270), piston_t) alpha_over(img, h_stick, (0, 0), h_stick) alpha_over(img, img2, (0, 0), img2) elif data & 0x07 == 0x4: # west img = self.build_full_block(side_t.rotate(90), None, None, piston_t, side_t.rotate(270)) h_stick = h_stick.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, h_stick, (0, 0), h_stick) elif data & 0x07 == 0x5: # east img = Image.new("RGBA", (24, 24), self.bgcolor) img2 = self.build_full_block(side_t.rotate(270), None, None, None, side_t.rotate(90)) h_stick = h_stick.transpose(Image.FLIP_LEFT_RIGHT) temp = self.transform_image_side(back_t) alpha_over(img2, temp, (10, 2), temp) alpha_over(img, img2, (0, 0), img2) alpha_over(img, h_stick, (-3, 2), h_stick) return img # cobweb sprite(blockid=30, imagename="assets/minecraft/textures/block/cobweb.png", nospawn=True) @material(blockid=31, data=list(range(3)), transparent=True) def tall_grass(self, blockid, data): if data == 0: # dead shrub texture = self.load_image_texture("assets/minecraft/textures/block/dead_bush.png") elif data == 1: # tall grass texture = self.load_image_texture("assets/minecraft/textures/block/grass.png") elif data == 2: # fern texture = self.load_image_texture("assets/minecraft/textures/block/fern.png") return self.build_billboard(texture) # dead bush billboard(blockid=32, imagename="assets/minecraft/textures/block/dead_bush.png") @material(blockid=35, data=list(range(16)), solid=True) def wool(self, blockid, data): texture = self.load_image_texture("assets/minecraft/textures/block/%s_wool.png" % color_map[data]) return self.build_block(texture, texture) # dandelion sprite(blockid=37, imagename="assets/minecraft/textures/block/dandelion.png") # flowers @material(blockid=38, data=list(range(13)), transparent=True) def flower(self, blockid, data): flower_map = ["poppy", "blue_orchid", "allium", "azure_bluet", "red_tulip", "orange_tulip", "white_tulip", "pink_tulip", "oxeye_daisy", "dandelion", "wither_rose", "cornflower", "lily_of_the_valley"] texture = self.load_image_texture("assets/minecraft/textures/block/%s.png" % flower_map[data]) return self.build_billboard(texture) # brown mushroom sprite(blockid=39, imagename="assets/minecraft/textures/block/brown_mushroom.png") # red mushroom sprite(blockid=40, imagename="assets/minecraft/textures/block/red_mushroom.png") # warped fungus sprite(blockid=1016, imagename="assets/minecraft/textures/block/warped_fungus.png") # crimson fungus sprite(blockid=1017, imagename="assets/minecraft/textures/block/crimson_fungus.png") # warped roots sprite(blockid=1018, imagename="assets/minecraft/textures/block/warped_roots.png") # crimson roots sprite(blockid=1019, imagename="assets/minecraft/textures/block/crimson_roots.png") # block of gold block(blockid=41, top_image="assets/minecraft/textures/block/gold_block.png") # block of iron block(blockid=42, top_image="assets/minecraft/textures/block/iron_block.png") # double slabs and slabs # these wooden slabs are unobtainable without cheating, they are still # here because lots of pre-1.3 worlds use this blocks, add prismarine slabs @material(blockid=[43, 44, 181, 182, 204, 205] + list(range(11340, 11359)) + list(range(1027, 1030)) + list(range(1072, 1080)) + list(range(1103, 1107)), data=list(range(16)), transparent=[44, 182, 205] + list(range(11340, 11359)) + list(range(1027, 1030)) + list(range(1072, 1080)) + list(range(1103, 1107)), solid=True) def slabs(self, blockid, data): if blockid == 44 or blockid == 182: texture = data & 7 else: # data > 8 are special double slabs texture = data if blockid == 44 or blockid == 43: if texture== 0: # stone slab top = self.load_image_texture("assets/minecraft/textures/block/stone.png") side = self.load_image_texture("assets/minecraft/textures/block/stone.png") elif texture== 1: # sandstone slab top = self.load_image_texture("assets/minecraft/textures/block/sandstone_top.png") side = self.load_image_texture("assets/minecraft/textures/block/sandstone.png") elif texture== 2: # wooden slab top = side = self.load_image_texture("assets/minecraft/textures/block/oak_planks.png") elif texture== 3: # cobblestone slab top = side = self.load_image_texture("assets/minecraft/textures/block/cobblestone.png") elif texture== 4: # brick top = side = self.load_image_texture("assets/minecraft/textures/block/bricks.png") elif texture== 5: # stone brick top = side = self.load_image_texture("assets/minecraft/textures/block/stone_bricks.png") elif texture== 6: # nether brick slab top = side = self.load_image_texture("assets/minecraft/textures/block/nether_bricks.png") elif texture== 7: #quartz top = side = self.load_image_texture("assets/minecraft/textures/block/quartz_block_side.png") elif texture== 8: # special stone double slab with top texture only top = side = self.load_image_texture("assets/minecraft/textures/block/smooth_stone.png") elif texture== 9: # special sandstone double slab with top texture only top = side = self.load_image_texture("assets/minecraft/textures/block/sandstone_top.png") else: return None elif blockid == 182: # single red sandstone slab if texture == 0: top = self.load_image_texture("assets/minecraft/textures/block/red_sandstone_top.png") side = self.load_image_texture("assets/minecraft/textures/block/red_sandstone.png") else: return None elif blockid == 181: # double red sandstone slab if texture == 0: # red sandstone top = self.load_image_texture("assets/minecraft/textures/block/red_sandstone_top.png") side = self.load_image_texture("assets/minecraft/textures/block/red_sandstone.png") elif texture == 8: # 'full' red sandstone (smooth) top = side = self.load_image_texture("assets/minecraft/textures/block/red_sandstone_top.png"); else: return None elif blockid == 204 or blockid == 205: # purpur slab (single=205 double=204) top = side = self.load_image_texture("assets/minecraft/textures/block/purpur_block.png"); elif blockid == 11340: # prismarine slabs top = side = self.load_image_texture("assets/minecraft/textures/block/prismarine.png").copy() elif blockid == 11341: # dark prismarine slabs top = side = self.load_image_texture("assets/minecraft/textures/block/dark_prismarine.png").copy() elif blockid == 11342: # prismarine brick slabs top = side = self.load_image_texture("assets/minecraft/textures/block/prismarine_bricks.png").copy() elif blockid == 11343: # andesite slabs top = side = self.load_image_texture("assets/minecraft/textures/block/andesite.png").copy() elif blockid == 11344: # diorite slabs top = side = self.load_image_texture("assets/minecraft/textures/block/diorite.png").copy() elif blockid == 11345: # granite slabs top = side = self.load_image_texture("assets/minecraft/textures/block/granite.png").copy() elif blockid == 11346: # polished andesite slabs top = side = self.load_image_texture("assets/minecraft/textures/block/polished_andesite.png").copy() elif blockid == 11347: # polished diorite slabs top = side = self.load_image_texture("assets/minecraft/textures/block/polished_diorite.png").copy() elif blockid == 11348: # polished granite slabs top = side = self.load_image_texture("assets/minecraft/textures/block/polished_granite.png").copy() elif blockid == 11349: # red nether brick slab top = side = self.load_image_texture("assets/minecraft/textures/block/red_nether_bricks.png").copy() elif blockid == 11350: # smooth sandstone slab top = side = self.load_image_texture("assets/minecraft/textures/block/sandstone_top.png").copy() elif blockid == 11351: # cut sandstone slab top = side = self.load_image_texture("assets/minecraft/textures/block/cut_sandstone.png").copy() elif blockid == 11352: # smooth red sandstone slab top = side = self.load_image_texture("assets/minecraft/textures/block/red_sandstone_top.png").copy() elif blockid == 11353: # cut red sandstone slab top = side = self.load_image_texture("assets/minecraft/textures/block/cut_red_sandstone.png").copy() elif blockid == 11354: # end_stone_brick_slab top = side = self.load_image_texture("assets/minecraft/textures/block/end_stone_bricks.png").copy() elif blockid == 11355: # mossy_cobblestone_slab top = side = self.load_image_texture("assets/minecraft/textures/block/mossy_cobblestone.png").copy() elif blockid == 11356: # mossy_stone_brick_slab top = side = self.load_image_texture("assets/minecraft/textures/block/mossy_stone_bricks.png").copy() elif blockid == 11357: # smooth_quartz_slab top = side = self.load_image_texture("assets/minecraft/textures/block/quartz_block_bottom.png").copy() elif blockid == 11358: # smooth_stone_slab top = self.load_image_texture("assets/minecraft/textures/block/smooth_stone.png").copy() side = self.load_image_texture("assets/minecraft/textures/block/smooth_stone_slab_side.png").copy() elif blockid == 1027: # blackstone_slab top = side = self.load_image_texture("assets/minecraft/textures/block/blackstone.png").copy() elif blockid == 1028: # polished_blackstone_slab top = side = self.load_image_texture("assets/minecraft/textures/block/polished_blackstone.png").copy() elif blockid == 1029: # polished_blackstone_brick_slab top = side = self.load_image_texture("assets/minecraft/textures/block/polished_blackstone_bricks.png").copy() elif blockid in range(1072, 1080): copper_tex = { 1072: "assets/minecraft/textures/block/cut_copper.png", 1076: "assets/minecraft/textures/block/cut_copper.png", 1073: "assets/minecraft/textures/block/exposed_cut_copper.png", 1077: "assets/minecraft/textures/block/exposed_cut_copper.png", 1074: "assets/minecraft/textures/block/weathered_cut_copper.png", 1078: "assets/minecraft/textures/block/weathered_cut_copper.png", 1075: "assets/minecraft/textures/block/oxidized_cut_copper.png", 1079: "assets/minecraft/textures/block/oxidized_cut_copper.png", } top = side = self.load_image_texture(copper_tex[blockid]).copy() elif blockid in range(1103, 1107): deepslate_tex = { 1103: "assets/minecraft/textures/block/cobbled_deepslate.png", 1104: "assets/minecraft/textures/block/polished_deepslate.png", 1105: "assets/minecraft/textures/block/deepslate_bricks.png", 1106: "assets/minecraft/textures/block/deepslate_tiles.png", } top = side = self.load_image_texture(deepslate_tex[blockid]).copy() if blockid == 43 or blockid == 181 or blockid == 204: # double slab return self.build_block(top, side) return self.build_slab_block(top, side, data & 8 == 8); # brick block block(blockid=45, top_image="assets/minecraft/textures/block/bricks.png") # TNT block(blockid=46, top_image="assets/minecraft/textures/block/tnt_top.png", side_image="assets/minecraft/textures/block/tnt_side.png", nospawn=True) # bookshelf block(blockid=47, top_image="assets/minecraft/textures/block/oak_planks.png", side_image="assets/minecraft/textures/block/bookshelf.png") # moss stone block(blockid=48, top_image="assets/minecraft/textures/block/mossy_cobblestone.png") # obsidian block(blockid=49, top_image="assets/minecraft/textures/block/obsidian.png") # torch, redstone torch (off), redstone torch(on), soul_torch @material(blockid=[50, 75, 76, 1039], data=[1, 2, 3, 4, 5], transparent=True) def torches(self, blockid, data): # first, rotations if self.rotation == 1: if data == 1: data = 3 elif data == 2: data = 4 elif data == 3: data = 2 elif data == 4: data = 1 elif self.rotation == 2: if data == 1: data = 2 elif data == 2: data = 1 elif data == 3: data = 4 elif data == 4: data = 3 elif self.rotation == 3: if data == 1: data = 4 elif data == 2: data = 3 elif data == 3: data = 1 elif data == 4: data = 2 # choose the proper texture if blockid == 50: # torch small = self.load_image_texture("assets/minecraft/textures/block/torch.png") elif blockid == 75: # off redstone torch small = self.load_image_texture("assets/minecraft/textures/block/redstone_torch_off.png") elif blockid == 76: # on redstone torch small = self.load_image_texture("assets/minecraft/textures/block/redstone_torch.png") elif blockid == 1039: # soul torch small= self.load_image_texture("assets/minecraft/textures/block/soul_torch.png") # compose a torch bigger than the normal # (better for doing transformations) torch = Image.new("RGBA", (16,16), self.bgcolor) alpha_over(torch,small,(-4,-3)) alpha_over(torch,small,(-5,-2)) alpha_over(torch,small,(-3,-2)) # angle of inclination of the texture rotation = 15 if data == 1: # pointing south torch = torch.rotate(-rotation, Image.NEAREST) # nearest filter is more nitid. img = self.build_full_block(None, None, None, torch, None, None) elif data == 2: # pointing north torch = torch.rotate(rotation, Image.NEAREST) img = self.build_full_block(None, None, torch, None, None, None) elif data == 3: # pointing west torch = torch.rotate(rotation, Image.NEAREST) img = self.build_full_block(None, torch, None, None, None, None) elif data == 4: # pointing east torch = torch.rotate(-rotation, Image.NEAREST) img = self.build_full_block(None, None, None, None, torch, None) elif data == 5: # standing on the floor # compose a "3d torch". img = Image.new("RGBA", (24,24), self.bgcolor) small_crop = small.crop((2,2,14,14)) slice = small_crop.copy() ImageDraw.Draw(slice).rectangle((6,0,12,12),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(slice).rectangle((0,0,4,12),outline=(0,0,0,0),fill=(0,0,0,0)) alpha_over(img, slice, (7,5)) alpha_over(img, small_crop, (6,6)) alpha_over(img, small_crop, (7,6)) alpha_over(img, slice, (7,7)) return img # lantern @material(blockid=[11373, 1038], data=[0, 1], transparent=True) def lantern(self, blockid, data): # get the multipart texture of the lantern if blockid == 11373: inputtexture = self.load_image_texture("assets/minecraft/textures/block/lantern.png") if blockid == 1038: inputtexture = self.load_image_texture("assets/minecraft/textures/block/soul_lantern.png") # # now create a textures, using the parts defined in lantern.json # JSON data for sides # from": [ 5, 1, 5 ], # "to": [11, 8, 11 ], # { "uv": [ 0, 2, 6, 9 ], "texture": "#all" } side_crop = inputtexture.crop((0, 2, 6, 9)) side_slice = side_crop.copy() side_texture = Image.new("RGBA", (16, 16), self.bgcolor) side_texture.paste(side_slice,(5, 8)) # JSON data for top # { "uv": [ 0, 9, 6, 15 ], "texture": "#all" } top_crop = inputtexture.crop((0, 9, 6, 15)) top_slice = top_crop.copy() top_texture = Image.new("RGBA", (16, 16), self.bgcolor) top_texture.paste(top_slice,(5, 5)) # mimic parts of build_full_block, to get an object smaller than a block # build_full_block(self, top, side1, side2, side3, side4, bottom=None): # a non transparent block uses top, side 3 and side 4. img = Image.new("RGBA", (24, 24), self.bgcolor) # prepare the side textures # side3 side3 = self.transform_image_side(side_texture) # Darken this side sidealpha = side3.split()[3] side3 = ImageEnhance.Brightness(side3).enhance(0.9) side3.putalpha(sidealpha) # place the transformed texture hangoff = 0 if data == 1: hangoff = 8 xoff = 4 yoff =- hangoff alpha_over(img, side3, (xoff+0, yoff+6), side3) # side4 side4 = self.transform_image_side(side_texture) side4 = side4.transpose(Image.FLIP_LEFT_RIGHT) # Darken this side sidealpha = side4.split()[3] side4 = ImageEnhance.Brightness(side4).enhance(0.8) side4.putalpha(sidealpha) alpha_over(img, side4, (12-xoff, yoff+6), side4) # top top = self.transform_image_top(top_texture) alpha_over(img, top, (0, 8-hangoff), top) return img # bamboo @material(blockid=11416, transparent=True) def bamboo(self, blockid, data): # get the multipart texture of the lantern inputtexture = self.load_image_texture("assets/minecraft/textures/block/bamboo_stalk.png") # # now create a textures, using the parts defined in bamboo1_age0.json # { "from": [ 7, 0, 7 ], # "to": [ 9, 16, 9 ], # "faces": { # "down": { "uv": [ 13, 4, 15, 6 ], "texture": "#all", "cullface": "down" }, # "up": { "uv": [ 13, 0, 15, 2], "texture": "#all", "cullface": "up" }, # "north": { "uv": [ 0, 0, 2, 16 ], "texture": "#all" }, # "south": { "uv": [ 0, 0, 2, 16 ], "texture": "#all" }, # "west": { "uv": [ 0, 0, 2, 16 ], "texture": "#all" }, # "east": { "uv": [ 0, 0, 2, 16 ], "texture": "#all" } # } # } side_crop = inputtexture.crop((0, 0, 3, 16)) side_slice = side_crop.copy() side_texture = Image.new("RGBA", (16, 16), self.bgcolor) side_texture.paste(side_slice,(0, 0)) # JSON data for top # "up": { "uv": [ 13, 0, 15, 2], "texture": "#all", "cullface": "up" }, top_crop = inputtexture.crop((13, 0, 16, 3)) top_slice = top_crop.copy() top_texture = Image.new("RGBA", (16, 16), self.bgcolor) top_texture.paste(top_slice,(5, 5)) # mimic parts of build_full_block, to get an object smaller than a block # build_full_block(self, top, side1, side2, side3, side4, bottom=None): # a non transparent block uses top, side 3 and side 4. img = Image.new("RGBA", (24, 24), self.bgcolor) # prepare the side textures # side3 side3 = self.transform_image_side(side_texture) # Darken this side sidealpha = side3.split()[3] side3 = ImageEnhance.Brightness(side3).enhance(0.9) side3.putalpha(sidealpha) # place the transformed texture xoff = 3 yoff = 0 alpha_over(img, side3, (4+xoff, yoff), side3) # side4 side4 = self.transform_image_side(side_texture) side4 = side4.transpose(Image.FLIP_LEFT_RIGHT) # Darken this side sidealpha = side4.split()[3] side4 = ImageEnhance.Brightness(side4).enhance(0.8) side4.putalpha(sidealpha) alpha_over(img, side4, (-4+xoff, yoff), side4) # top top = self.transform_image_top(top_texture) alpha_over(img, top, (-4+xoff, -5), top) return img # composter @material(blockid=11417, data=list(range(9)), transparent=True) def composter(self, blockid, data): side = self.load_image_texture("assets/minecraft/textures/block/composter_side.png") top = self.load_image_texture("assets/minecraft/textures/block/composter_top.png") # bottom = self.load_image_texture("assets/minecraft/textures/block/composter_bottom.png") if data == 0: # empty return self.build_full_block(top, side, side, side, side) if data == 8: compost = self.transform_image_top( self.load_image_texture("assets/minecraft/textures/block/composter_ready.png")) else: compost = self.transform_image_top( self.load_image_texture("assets/minecraft/textures/block/composter_compost.png")) nudge = {1: (0, 9), 2: (0, 8), 3: (0, 7), 4: (0, 6), 5: (0, 4), 6: (0, 2), 7: (0, 0), 8: (0, 0)} img = self.build_full_block(None, side, side, None, None) alpha_over(img, compost, nudge[data], compost) img2 = self.build_full_block(top, None, None, side, side) alpha_over(img, img2, (0, 0), img2) return img # fire and soul_fire @material(blockid=[51, 1040], transparent=True) def fire(self, blockid, data): if blockid == 51: textureNS = self.load_image_texture("assets/minecraft/textures/block/fire_0.png") textureEW = self.load_image_texture("assets/minecraft/textures/block/fire_1.png") elif blockid == 1040: textureNS = self.load_image_texture("assets/minecraft/textures/block/soul_fire_0.png") textureEW = self.load_image_texture("assets/minecraft/textures/block/soul_fire_1.png") side1 = self.transform_image_side(textureNS) side2 = self.transform_image_side(textureEW).transpose(Image.FLIP_LEFT_RIGHT) img = Image.new("RGBA", (24,24), self.bgcolor) alpha_over(img, side1, (12,0), side1) alpha_over(img, side2, (0,0), side2) alpha_over(img, side1, (0,6), side1) alpha_over(img, side2, (12,6), side2) return img # monster spawner block(blockid=52, top_image="assets/minecraft/textures/block/spawner.png", transparent=True) # wooden, cobblestone, red brick, stone brick, netherbrick, sandstone, spruce, birch, # jungle, quartz, red sandstone, purper_stairs, crimson_stairs, warped_stairs, (dark) prismarine, # mossy brick and mossy cobblestone, stone smooth_quartz # polished_granite polished_andesite polished_diorite granite diorite andesite end_stone_bricks red_nether_brick stairs # smooth_red_sandstone blackstone polished_blackstone polished_blackstone_brick # also all the copper variants # also all deepslate variants @material(blockid=[53, 67, 108, 109, 114, 128, 134, 135, 136, 156, 163, 164, 180, 203, 509, 510, 11337, 11338, 11339, 11370, 11371, 11374, 11375, 11376, 11377, 11378, 11379, 11380, 11381, 11382, 11383, 11384, 11415, 1030, 1031, 1032, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1099, 1100, 1101, 1102], data=list(range(128)), transparent=True, solid=True, nospawn=True) def stairs(self, blockid, data): # preserve the upside-down bit upside_down = data & 0x4 # find solid quarters within the top or bottom half of the block # NW NE SE SW quarters = [data & 0x8, data & 0x10, data & 0x20, data & 0x40] # rotate the quarters so we can pretend northdirection is always upper-left numpy.roll(quarters, [0,1,3,2][self.rotation]) nw,ne,se,sw = quarters stair_id_to_tex = { 53: "assets/minecraft/textures/block/oak_planks.png", 67: "assets/minecraft/textures/block/cobblestone.png", 108: "assets/minecraft/textures/block/bricks.png", 109: "assets/minecraft/textures/block/stone_bricks.png", 114: "assets/minecraft/textures/block/nether_bricks.png", 128: "assets/minecraft/textures/block/sandstone.png", 134: "assets/minecraft/textures/block/spruce_planks.png", 135: "assets/minecraft/textures/block/birch_planks.png", 136: "assets/minecraft/textures/block/jungle_planks.png", 156: "assets/minecraft/textures/block/quartz_block_side.png", 163: "assets/minecraft/textures/block/acacia_planks.png", 164: "assets/minecraft/textures/block/dark_oak_planks.png", 180: "assets/minecraft/textures/block/red_sandstone.png", 203: "assets/minecraft/textures/block/purpur_block.png", 509: "assets/minecraft/textures/block/crimson_planks.png", 510: "assets/minecraft/textures/block/warped_planks.png", 11337: "assets/minecraft/textures/block/prismarine.png", 11338: "assets/minecraft/textures/block/dark_prismarine.png", 11339: "assets/minecraft/textures/block/prismarine_bricks.png", 11370: "assets/minecraft/textures/block/mossy_stone_bricks.png", 11371: "assets/minecraft/textures/block/mossy_cobblestone.png", 11374: "assets/minecraft/textures/block/sandstone_top.png", 11375: "assets/minecraft/textures/block/quartz_block_side.png", 11376: "assets/minecraft/textures/block/polished_granite.png", 11377: "assets/minecraft/textures/block/polished_diorite.png", 11378: "assets/minecraft/textures/block/polished_andesite.png", 11379: "assets/minecraft/textures/block/stone.png", 11380: "assets/minecraft/textures/block/granite.png", 11381: "assets/minecraft/textures/block/diorite.png", 11382: "assets/minecraft/textures/block/andesite.png", 11383: "assets/minecraft/textures/block/end_stone_bricks.png", 11384: "assets/minecraft/textures/block/red_nether_bricks.png", 11415: "assets/minecraft/textures/block/red_sandstone_top.png", 1030: "assets/minecraft/textures/block/blackstone.png", 1031: "assets/minecraft/textures/block/polished_blackstone.png", 1032: "assets/minecraft/textures/block/polished_blackstone_bricks.png", # Cut copper stairs 1064: "assets/minecraft/textures/block/cut_copper.png", 1065: "assets/minecraft/textures/block/exposed_cut_copper.png", 1066: "assets/minecraft/textures/block/weathered_cut_copper.png", 1067: "assets/minecraft/textures/block/oxidized_cut_copper.png", # Waxed cut copper stairs 1068: "assets/minecraft/textures/block/cut_copper.png", 1069: "assets/minecraft/textures/block/exposed_cut_copper.png", 1070: "assets/minecraft/textures/block/weathered_cut_copper.png", 1071: "assets/minecraft/textures/block/oxidized_cut_copper.png", # Deepslate 1099: "assets/minecraft/textures/block/cobbled_deepslate.png", 1100: "assets/minecraft/textures/block/polished_deepslate.png", 1101: "assets/minecraft/textures/block/deepslate_bricks.png", 1102: "assets/minecraft/textures/block/deepslate_tiles.png", } texture = self.load_image_texture(stair_id_to_tex[blockid]).copy() outside_l = texture.copy() outside_r = texture.copy() inside_l = texture.copy() inside_r = texture.copy() # sandstone, red sandstone, and quartz stairs have special top texture special_tops = { 128: "assets/minecraft/textures/block/sandstone_top.png", 156: "assets/minecraft/textures/block/quartz_block_top.png", 180: "assets/minecraft/textures/block/red_sandstone_top.png", 11375: "assets/minecraft/textures/block/quartz_block_top.png", } if blockid in special_tops: texture = self.load_image_texture(special_tops[blockid]).copy() slab_top = texture.copy() push = 8 if upside_down else 0 def rect(tex,coords): ImageDraw.Draw(tex).rectangle(coords,outline=(0,0,0,0),fill=(0,0,0,0)) # cut out top or bottom half from inner surfaces rect(inside_l, (0,8-push,15,15-push)) rect(inside_r, (0,8-push,15,15-push)) # cut out missing or obstructed quarters from each surface if not nw: rect(outside_l, (0,push,7,7+push)) rect(texture, (0,0,7,7)) if not nw or sw: rect(inside_r, (8,push,15,7+push)) # will be flipped if not ne: rect(texture, (8,0,15,7)) if not ne or nw: rect(inside_l, (0,push,7,7+push)) if not ne or se: rect(inside_r, (0,push,7,7+push)) # will be flipped if not se: rect(outside_r, (0,push,7,7+push)) # will be flipped rect(texture, (8,8,15,15)) if not se or sw: rect(inside_l, (8,push,15,7+push)) if not sw: rect(outside_l, (8,push,15,7+push)) rect(outside_r, (8,push,15,7+push)) # will be flipped rect(texture, (0,8,7,15)) img = Image.new("RGBA", (24,24), self.bgcolor) if upside_down: # top should have no cut-outs after all texture = slab_top else: # render the slab-level surface slab_top = self.transform_image_top(slab_top) alpha_over(img, slab_top, (0,6)) # render inner left surface inside_l = self.transform_image_side(inside_l) # Darken the vertical part of the second step sidealpha = inside_l.split()[3] # darken it a bit more than usual, looks better inside_l = ImageEnhance.Brightness(inside_l).enhance(0.8) inside_l.putalpha(sidealpha) alpha_over(img, inside_l, (6,3)) # render inner right surface inside_r = self.transform_image_side(inside_r).transpose(Image.FLIP_LEFT_RIGHT) # Darken the vertical part of the second step sidealpha = inside_r.split()[3] # darken it a bit more than usual, looks better inside_r = ImageEnhance.Brightness(inside_r).enhance(0.7) inside_r.putalpha(sidealpha) alpha_over(img, inside_r, (6,3)) # render outer surfaces alpha_over(img, self.build_full_block(texture, None, None, outside_l, outside_r)) return img # normal, locked (used in april's fool day), ender and trapped chest # NOTE: locked chest used to be id95 (which is now stained glass) @material(blockid=[54, 130, 146], data=list(range(30)), transparent = True) def chests(self, blockid, data): # the first 3 bits are the orientation as stored in minecraft, # bits 0x8 and 0x10 indicate which half of the double chest is it. # first, do the rotation if needed orientation_data = data & 7 if self.rotation == 1: if orientation_data == 2: data = 5 | (data & 24) elif orientation_data == 3: data = 4 | (data & 24) elif orientation_data == 4: data = 2 | (data & 24) elif orientation_data == 5: data = 3 | (data & 24) elif self.rotation == 2: if orientation_data == 2: data = 3 | (data & 24) elif orientation_data == 3: data = 2 | (data & 24) elif orientation_data == 4: data = 5 | (data & 24) elif orientation_data == 5: data = 4 | (data & 24) elif self.rotation == 3: if orientation_data == 2: data = 4 | (data & 24) elif orientation_data == 3: data = 5 | (data & 24) elif orientation_data == 4: data = 3 | (data & 24) elif orientation_data == 5: data = 2 | (data & 24) if blockid == 130 and not data in [2, 3, 4, 5]: return None # iterate.c will only return the ancil data (without pseudo # ancil data) for locked and ender chests, so only # ancilData = 2,3,4,5 are used for this blockids if data & 24 == 0: if blockid == 130: t = self.load_image("assets/minecraft/textures/entity/chest/ender.png") else: try: t = self.load_image("assets/minecraft/textures/entity/chest/normal.png") except (TextureException, IOError): t = self.load_image("assets/minecraft/textures/entity/chest/chest.png") t = ImageOps.flip(t) # for some reason the 1.15 images are upside down # the textures is no longer in terrain.png, get it from # item/chest.png and get by cropping all the needed stuff if t.size != (64, 64): t = t.resize((64, 64), Image.ANTIALIAS) # top top = t.crop((28, 50, 42, 64)) top.load() # every crop need a load, crop is a lazy operation # see PIL manual img = Image.new("RGBA", (16, 16), self.bgcolor) alpha_over(img, top, (1, 1)) top = img # front front_top = t.crop((42, 45, 56, 50)) front_top.load() front_bottom = t.crop((42, 21, 56, 31)) front_bottom.load() front_lock = t.crop((1, 59, 3, 63)) front_lock.load() front = Image.new("RGBA", (16, 16), self.bgcolor) alpha_over(front, front_top, (1, 1)) alpha_over(front, front_bottom, (1, 5)) alpha_over(front, front_lock, (7, 3)) # left side # left side, right side, and back are essentially the same for # the default texture, we take it anyway just in case other # textures make use of it. side_l_top = t.crop((14, 45, 28, 50)) side_l_top.load() side_l_bottom = t.crop((14, 21, 28, 31)) side_l_bottom.load() side_l = Image.new("RGBA", (16, 16), self.bgcolor) alpha_over(side_l, side_l_top, (1, 1)) alpha_over(side_l, side_l_bottom, (1, 5)) # right side side_r_top = t.crop((28, 45, 42, 50)) side_r_top.load() side_r_bottom = t.crop((28, 21, 42, 31)) side_r_bottom.load() side_r = Image.new("RGBA", (16, 16), self.bgcolor) alpha_over(side_r, side_r_top, (1, 1)) alpha_over(side_r, side_r_bottom, (1, 5)) # back back_top = t.crop((0, 45, 14, 50)) back_top.load() back_bottom = t.crop((0, 21, 14, 31)) back_bottom.load() back = Image.new("RGBA", (16, 16), self.bgcolor) alpha_over(back, back_top, (1, 1)) alpha_over(back, back_bottom, (1, 5)) else: # large chest # the textures is no longer in terrain.png, get it from # item/chest.png and get all the needed stuff t_left = self.load_image("assets/minecraft/textures/entity/chest/normal_left.png") t_right = self.load_image("assets/minecraft/textures/entity/chest/normal_right.png") # for some reason the 1.15 images are upside down t_left = ImageOps.flip(t_left) t_right = ImageOps.flip(t_right) # Top top_left = t_right.crop((29, 50, 44, 64)) top_left.load() top_right = t_left.crop((29, 50, 44, 64)) top_right.load() top = Image.new("RGBA", (32, 16), self.bgcolor) alpha_over(top,top_left, (1, 1)) alpha_over(top,top_right, (16, 1)) # Front front_top_left = t_left.crop((43, 45, 58, 50)) front_top_left.load() front_top_right = t_right.crop((43, 45, 58, 50)) front_top_right.load() front_bottom_left = t_left.crop((43, 21, 58, 31)) front_bottom_left.load() front_bottom_right = t_right.crop((43, 21, 58, 31)) front_bottom_right.load() front_lock = t_left.crop((1, 59, 3, 63)) front_lock.load() front = Image.new("RGBA", (32, 16), self.bgcolor) alpha_over(front, front_top_left, (1, 1)) alpha_over(front, front_top_right, (16, 1)) alpha_over(front, front_bottom_left, (1, 5)) alpha_over(front, front_bottom_right, (16, 5)) alpha_over(front, front_lock, (15, 3)) # Back back_top_left = t_right.crop((14, 45, 29, 50)) back_top_left.load() back_top_right = t_left.crop((14, 45, 29, 50)) back_top_right.load() back_bottom_left = t_right.crop((14, 21, 29, 31)) back_bottom_left.load() back_bottom_right = t_left.crop((14, 21, 29, 31)) back_bottom_right.load() back = Image.new("RGBA", (32, 16), self.bgcolor) alpha_over(back, back_top_left, (1, 1)) alpha_over(back, back_top_right, (16, 1)) alpha_over(back, back_bottom_left, (1, 5)) alpha_over(back, back_bottom_right, (16, 5)) # left side side_l_top = t_left.crop((29, 45, 43, 50)) side_l_top.load() side_l_bottom = t_left.crop((29, 21, 43, 31)) side_l_bottom.load() side_l = Image.new("RGBA", (16, 16), self.bgcolor) alpha_over(side_l, side_l_top, (1, 1)) alpha_over(side_l, side_l_bottom, (1, 5)) # right side side_r_top = t_right.crop((0, 45, 14, 50)) side_r_top.load() side_r_bottom = t_right.crop((0, 21, 14, 31)) side_r_bottom.load() side_r = Image.new("RGBA", (16, 16), self.bgcolor) alpha_over(side_r, side_r_top, (1, 1)) alpha_over(side_r, side_r_bottom, (1, 5)) # double chest, left half if ((data & 24 == 8 and data & 7 in [3, 5]) or (data & 24 == 16 and data & 7 in [2, 4])): top = top.crop((0, 0, 16, 16)) top.load() front = front.crop((0, 0, 16, 16)) front.load() back = back.crop((0, 0, 16, 16)) back.load() #~ side = side_l # double chest, right half elif ((data & 24 == 16 and data & 7 in [3, 5]) or (data & 24 == 8 and data & 7 in [2, 4])): top = top.crop((16, 0, 32, 16)) top.load() front = front.crop((16, 0, 32, 16)) front.load() back = back.crop((16, 0, 32, 16)) back.load() #~ side = side_r else: # just in case return None # compose the final block img = Image.new("RGBA", (24, 24), self.bgcolor) if data & 7 == 2: # north side = self.transform_image_side(side_r) alpha_over(img, side, (1, 7)) back = self.transform_image_side(back) alpha_over(img, back.transpose(Image.FLIP_LEFT_RIGHT), (11, 7)) front = self.transform_image_side(front) top = self.transform_image_top(top.rotate(180)) alpha_over(img, top, (0, 2)) elif data & 7 == 3: # south side = self.transform_image_side(side_l) alpha_over(img, side, (1, 7)) front = self.transform_image_side(front).transpose(Image.FLIP_LEFT_RIGHT) top = self.transform_image_top(top.rotate(180)) alpha_over(img, top, (0, 2)) alpha_over(img, front, (11, 7)) elif data & 7 == 4: # west side = self.transform_image_side(side_r) alpha_over(img, side.transpose(Image.FLIP_LEFT_RIGHT), (11, 7)) front = self.transform_image_side(front) alpha_over(img, front, (1, 7)) top = self.transform_image_top(top.rotate(270)) alpha_over(img, top, (0, 2)) elif data & 7 == 5: # east back = self.transform_image_side(back) side = self.transform_image_side(side_l).transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, side, (11, 7)) alpha_over(img, back, (1, 7)) top = self.transform_image_top(top.rotate(270)) alpha_over(img, top, (0, 2)) else: # just in case img = None return img # redstone wire # uses pseudo-ancildata found in iterate.c @material(blockid=55, data=list(range(128)), transparent=True) def wire(self, blockid, data): if data & 0b1000000 == 64: # powered redstone wire redstone_wire_t = self.load_image_texture("assets/minecraft/textures/block/redstone_dust_line0.png").rotate(90) redstone_wire_t = self.tint_texture(redstone_wire_t,(255,0,0)) redstone_cross_t = self.load_image_texture("assets/minecraft/textures/block/redstone_dust_dot.png") redstone_cross_t = self.tint_texture(redstone_cross_t,(255,0,0)) else: # unpowered redstone wire redstone_wire_t = self.load_image_texture("assets/minecraft/textures/block/redstone_dust_line0.png").rotate(90) redstone_wire_t = self.tint_texture(redstone_wire_t,(48,0,0)) redstone_cross_t = self.load_image_texture("assets/minecraft/textures/block/redstone_dust_dot.png") redstone_cross_t = self.tint_texture(redstone_cross_t,(48,0,0)) # generate an image per redstone direction branch_top_left = redstone_cross_t.copy() ImageDraw.Draw(branch_top_left).rectangle((0,0,4,15),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(branch_top_left).rectangle((11,0,15,15),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(branch_top_left).rectangle((0,11,15,15),outline=(0,0,0,0),fill=(0,0,0,0)) branch_top_right = redstone_cross_t.copy() ImageDraw.Draw(branch_top_right).rectangle((0,0,15,4),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(branch_top_right).rectangle((0,0,4,15),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(branch_top_right).rectangle((0,11,15,15),outline=(0,0,0,0),fill=(0,0,0,0)) branch_bottom_right = redstone_cross_t.copy() ImageDraw.Draw(branch_bottom_right).rectangle((0,0,15,4),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(branch_bottom_right).rectangle((0,0,4,15),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(branch_bottom_right).rectangle((11,0,15,15),outline=(0,0,0,0),fill=(0,0,0,0)) branch_bottom_left = redstone_cross_t.copy() ImageDraw.Draw(branch_bottom_left).rectangle((0,0,15,4),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(branch_bottom_left).rectangle((11,0,15,15),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(branch_bottom_left).rectangle((0,11,15,15),outline=(0,0,0,0),fill=(0,0,0,0)) # generate the bottom texture if data & 0b111111 == 0: bottom = redstone_cross_t.copy() # see iterate.c for where these masks come from has_x = (data & 0b1010) > 0 has_z = (data & 0b0101) > 0 if has_x and has_z: bottom = redstone_cross_t.copy() if has_x: alpha_over(bottom, redstone_wire_t.copy()) if has_z: alpha_over(bottom, redstone_wire_t.copy().rotate(90)) else: if has_x: bottom = redstone_wire_t.copy() elif has_z: bottom = redstone_wire_t.copy().rotate(90) elif data & 0b1111 == 0: bottom = redstone_cross_t.copy() # check for going up redstone wire if data & 0b100000 == 32: side1 = redstone_wire_t.rotate(90) else: side1 = None if data & 0b010000 == 16: side2 = redstone_wire_t.rotate(90) else: side2 = None img = self.build_full_block(None,side1,side2,None,None,bottom) return img # diamond ore block(blockid=56, top_image="assets/minecraft/textures/block/diamond_ore.png") # diamond block block(blockid=57, top_image="assets/minecraft/textures/block/diamond_block.png") # Table blocks with no facing or other properties where sides are not all the same # Includes: Crafting table, fletching table, cartography table, smithing table @material(blockid=[58, 11359, 11360, 11361], solid=True, nodata=True) def block_table(self, blockid, data): block_name = {58: "crafting_table", 11359: "fletching_table", 11360: "cartography_table", 11361: "smithing_table"}[blockid] # Top texture doesn't vary with self.rotation, but texture rotation does top_tex = block_name + "_top" top_rot = [0, 270, 180, 90][self.rotation] # List of side textures from side 1 to 4 for each blockid side_tex_map = {58: ["front", "side", "front", "side"], 11359: ["front", "side", "side", "front"], 11360: ["side3", "side3", "side2", "side1"], 11361: ["front", "side", "side", "front"]}[blockid] # Determine which side textures to use side3_id = [2, 3, 1, 0][self.rotation] side4_id = [3, 1, 0, 2][self.rotation] side3_tex = block_name + "_" + side_tex_map[side3_id] side4_tex = block_name + "_" + side_tex_map[side4_id] tex_path = "assets/minecraft/textures/block" top = self.load_image_texture("{}/{}.png".format(tex_path, top_tex)).copy() side3 = self.load_image_texture("{}/{}.png".format(tex_path, side3_tex)) side4 = self.load_image_texture("{}/{}.png".format(tex_path, side4_tex)).copy() top = top.rotate(top_rot) side4 = side4.transpose(Image.FLIP_LEFT_RIGHT) return self.build_full_block(top, None, None, side3, side4, None) @material(blockid=11366, data=list(range(8)), transparent=True, solid=True, nospawn=True) def lectern(self, blockid, data): # Do rotation, mask to not clobber book data data = data & 0b100 | ((self.rotation + (data & 0b11)) % 4) # Load textures base_raw_t = self.load_image_texture("assets/minecraft/textures/block/lectern_base.png") front_raw_t = self.load_image_texture("assets/minecraft/textures/block/lectern_front.png") side_raw_t = self.load_image_texture("assets/minecraft/textures/block/lectern_sides.png") top_raw_t = self.load_image_texture("assets/minecraft/textures/block/lectern_top.png") def create_tile(img_src, coord_crop, coord_paste, rot): # Takes an image, crops a region, optionally rotates the # texture, then finally pastes it onto a 16x16 image img_out = Image.new("RGBA", (16, 16), self.bgcolor) img_in = img_src.crop(coord_crop) if rot != 0: img_in = img_in.rotate(rot, expand=True) img_out.paste(img_in, coord_paste) return img_out def darken_image(img_src, darken_value): # Takes an image & alters the brightness, leaving alpha intact alpha = img_src.split()[3] img_out = ImageEnhance.Brightness(img_src).enhance(darken_value) img_out.putalpha(alpha) return img_out # Generate base base_top_t = base_raw_t.rotate([0, 270, 180, 90][data & 0b11]) # Front & side textures are one pixel taller than they should be # pre-transformation as otherwise the topmost row of pixels # post-transformation are rather transparent, which results in # a visible gap between the base's sides & top base_front_t = create_tile(base_raw_t, (0, 13, 16, 16), (0, 13), 0) base_side_t = create_tile(base_raw_t, (0, 5, 16, 8), (0, 13), 0) base_side3_t = base_front_t if data & 0b11 == 1 else base_side_t base_side4_t = base_front_t if data & 0b11 == 0 else base_side_t img = self.build_full_block((base_top_t, 14), None, None, base_side3_t, base_side4_t, None) # Generate central pillar side_flip_t = side_raw_t.transpose(Image.FLIP_LEFT_RIGHT) # Define parameters used to obtain the texture for each side pillar_param = [{'img': front_raw_t, 'crop': (8, 4, 16, 16), 'paste': (4, 2), 'rot': 0}, # South {'img': side_raw_t, 'crop': (2, 8, 15, 16), 'paste': (4, 1), 'rot': 270}, # West {'img': front_raw_t, 'crop': (0, 4, 8, 13), 'paste': (4, 5), 'rot': 0}, # North {'img': side_flip_t, 'crop': (2, 8, 15, 16), 'paste': (4, 1), 'rot': 90}] # East # Determine which sides are rendered pillar_side = [pillar_param[(3 - (data & 0b11)) % 4], pillar_param[(2 - (data & 0b11)) % 4]] pillar_side3_t = create_tile(pillar_side[0]['img'], pillar_side[0]['crop'], pillar_side[0]['paste'], pillar_side[0]['rot']) pillar_side4_t = create_tile(pillar_side[1]['img'], pillar_side[1]['crop'], pillar_side[1]['paste'], pillar_side[1]['rot']) pillar_side4_t = pillar_side4_t.transpose(Image.FLIP_LEFT_RIGHT) pillar_side3_t = self.transform_image_side(pillar_side3_t) pillar_side3_t = darken_image(pillar_side3_t, 0.9) pillar_side4_t = self.transform_image_side(pillar_side4_t).transpose(Image.FLIP_LEFT_RIGHT) pillar_side4_t = darken_image(pillar_side4_t, 0.8) alpha_over(img, pillar_side3_t, (3, 4), pillar_side3_t) alpha_over(img, pillar_side4_t, (9, 4), pillar_side4_t) # Generate stand if (data & 0b11) in [0, 1]: # South, West stand_side3_t = create_tile(side_raw_t, (0, 0, 16, 4), (0, 4), 0) stand_side4_t = create_tile(side_raw_t, (0, 4, 13, 8), (0, 0), -22.5) else: # North, East stand_side3_t = create_tile(side_raw_t, (0, 4, 16, 8), (0, 0), 0) stand_side4_t = create_tile(side_raw_t, (0, 4, 13, 8), (0, 0), 22.5) stand_side3_t = self.transform_image_angle(stand_side3_t, math.radians(22.5)) stand_side3_t = darken_image(stand_side3_t, 0.9) stand_side4_t = self.transform_image_side(stand_side4_t).transpose(Image.FLIP_LEFT_RIGHT) stand_side4_t = darken_image(stand_side4_t, 0.8) stand_top_t = create_tile(top_raw_t, (0, 1, 16, 14), (0, 1), 0) if data & 0b100: # Lectern has a book, modify the stand top texture book_raw_t = self.load_image("assets/minecraft/textures/entity/enchanting_table_book.png") book_t = Image.new("RGBA", (14, 10), self.bgcolor) book_part_t = book_raw_t.crop((0, 0, 7, 10)) # Left cover alpha_over(stand_top_t, book_part_t, (1, 3), book_part_t) book_part_t = book_raw_t.crop((15, 0, 22, 10)) # Right cover alpha_over(stand_top_t, book_part_t, (8, 3)) book_part_t = book_raw_t.crop((24, 10, 29, 18)).rotate(180) # Left page alpha_over(stand_top_t, book_part_t, (3, 4), book_part_t) book_part_t = book_raw_t.crop((29, 10, 34, 18)).rotate(180) # Right page alpha_over(stand_top_t, book_part_t, (8, 4), book_part_t) # Perform affine transformation transform_matrix = numpy.matrix(numpy.identity(3)) if (data & 0b11) in [0, 1]: # South, West # Translate: 8 -X, 8 -Y transform_matrix *= numpy.matrix([[1, 0, 8], [0, 1, 8], [0, 0, 1]]) # Rotate 40 degrees clockwise tc = math.cos(math.radians(40)) ts = math.sin(math.radians(40)) transform_matrix *= numpy.matrix([[tc, ts, 0], [-ts, tc, 0], [0, 0, 1]]) # Shear in the Y direction tt = math.tan(math.radians(10)) transform_matrix *= numpy.matrix([[1, 0, 0], [tt, 1, 0], [0, 0, 1]]) # Scale to 70% height & 110% width transform_matrix *= numpy.matrix([[1 / 1.1, 0, 0], [0, 1 / 0.7, 0], [0, 0, 1]]) # Translate: 12 +X, 8 +Y transform_matrix *= numpy.matrix([[1, 0, -12], [0, 1, -8], [0, 0, 1]]) else: # North, East # Translate: 8 -X, 8 -Y transform_matrix *= numpy.matrix([[1, 0, 8], [0, 1, 8], [0, 0, 1]]) # Shear in the X direction tt = math.tan(math.radians(25)) transform_matrix *= numpy.matrix([[1, tt, 0], [0, 1, 0], [0, 0, 1]]) # Scale to 80% height transform_matrix *= numpy.matrix([[1, 0, 0], [0, 1 / 0.8, 0], [0, 0, 1]]) # Rotate 220 degrees clockwise tc = math.cos(math.radians(40 + 180)) ts = math.sin(math.radians(40 + 180)) transform_matrix *= numpy.matrix([[tc, ts, 0], [-ts, tc, 0], [0, 0, 1]]) # Scale to 60% height transform_matrix *= numpy.matrix([[1, 0, 0], [0, 1 / 0.6, 0], [0, 0, 1]]) # Translate: +13 X, +7 Y transform_matrix *= numpy.matrix([[1, 0, -13], [0, 1, -7], [0, 0, 1]]) transform_matrix = numpy.array(transform_matrix)[:2, :].ravel().tolist() stand_top_t = stand_top_t.transform((24, 24), Image.AFFINE, transform_matrix) img_stand = Image.new("RGBA", (24, 24), self.bgcolor) alpha_over(img_stand, stand_side3_t, (-4, 2), stand_side3_t) # Fix some holes alpha_over(img_stand, stand_side3_t, (-3, 3), stand_side3_t) alpha_over(img_stand, stand_side4_t, (12, 5), stand_side4_t) alpha_over(img_stand, stand_top_t, (0, 0), stand_top_t) # Flip the stand if North or South facing if (data & 0b11) in [0, 2]: img_stand = img_stand.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, img_stand, (0, -2), img_stand) return img @material(blockid=11367, data=list(range(4)), solid=True) def loom(self, blockid, data): # Do rotation data = (self.rotation + data) % 4 top_rot = [180, 90, 0, 270][data] side3_tex = "front" if data == 1 else "side" side4_tex = "front" if data == 0 else "side" tex_path = "assets/minecraft/textures/block" top = self.load_image_texture("{}/loom_top.png".format(tex_path)).copy() side3 = self.load_image_texture("{}/loom_{}.png".format(tex_path, side3_tex)) side4 = self.load_image_texture("{}/loom_{}.png".format(tex_path, side4_tex)).copy() top = top.rotate(top_rot) side4 = side4.transpose(Image.FLIP_LEFT_RIGHT) return self.build_full_block(top, None, None, side3, side4, None) @material(blockid=11368, data=list(range(4)), transparent=True, solid=True, nospawn=True) def stonecutter(self, blockid, data): # Do rotation data = (self.rotation + data) % 4 top_t = self.load_image_texture("assets/minecraft/textures/block/stonecutter_top.png").copy() side_t = self.load_image_texture("assets/minecraft/textures/block/stonecutter_side.png") # Stonecutter saw texture contains multiple tiles, since it's # 16px wide rely on load_image_texture() to crop appropriately blade_t = self.load_image_texture("assets/minecraft/textures/block/stonecutter_saw.png").copy() top_t = top_t.rotate([180, 90, 0, 270][data]) img = self.build_full_block((top_t, 7), None, None, side_t, side_t, None) # Add saw blade if data in [0, 2]: blade_t = blade_t.transpose(Image.FLIP_LEFT_RIGHT) blade_t = self.transform_image_side(blade_t) if data in [0, 2]: blade_t = blade_t.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, blade_t, (6, -4), blade_t) return img @material(blockid=11369, data=list(range(12)), transparent=True, solid=True, nospawn=True) def grindstone(self, blockid, data): # Do rotation, mask to not clobber mounting info data = data & 0b1100 | ((self.rotation + (data & 0b11)) % 4) # Load textures side_raw_t = self.load_image_texture("assets/minecraft/textures/block/grindstone_side.png").copy() round_raw_t = self.load_image_texture("assets/minecraft/textures/block/grindstone_round.png").copy() pivot_raw_t = self.load_image_texture("assets/minecraft/textures/block/grindstone_pivot.png").copy() leg_raw_t = self.load_image_texture("assets/minecraft/textures/block/dark_oak_log.png").copy() def create_tile(img_src, coord_crop, coord_paste, scale): # Takes an image, crops a region, optionally scales the # texture, then finally pastes it onto a 16x16 image img_out = Image.new("RGBA", (16, 16), self.bgcolor) img_in = img_src.crop(coord_crop) if scale >= 0 and scale != 1: w, h = img_in.size img_in = img_in.resize((int(w * scale), int(h * scale)), Image.NEAREST) img_out.paste(img_in, coord_paste) return img_out # Set variables defining positions of various parts wall_mounted = bool(data & 0b0100) rot_leg = [0, 270, 0][data >> 2] if wall_mounted: pos_leg = (32, 28) if data & 0b11 in [2, 3] else (10, 18) coord_leg = [(0, 0), (-10, -1), (2, 3)] offset_final = [(2, 1), (-2, 1), (-2, -1), (2, -1)][data & 0b11] else: pos_leg = [(22, 31), (22, 9)][data >> 3] coord_leg = [(0, 0), (-1, 2), (-2, -3)] offset_final = (0, 2 * (data >> 2) - 1) # Create parts # Scale up small parts like pivot & leg to avoid ugly results # when shearing & combining parts, then scale down to original # size just before final image composition scale_factor = 2 side_t = create_tile(side_raw_t, (0, 0, 12, 12), (2, 0), 1) round_ud_t = create_tile(round_raw_t, (0, 0, 8, 12), (4, 2), 1) round_lr_t = create_tile(round_raw_t, (0, 0, 8, 12), (4, 0), 1) pivot_outer_t = create_tile(pivot_raw_t, (0, 0, 6, 6), (2, 2), scale_factor) pivot_lr_t = create_tile(pivot_raw_t, (6, 0, 8, 6), (2, 2), scale_factor) pivot_ud_t = create_tile(pivot_raw_t, (8, 0, 10, 6), (2, 2), scale_factor) leg_outer_t = create_tile(leg_raw_t, (6, 9, 10, 16), (2, 2), scale_factor).rotate(rot_leg) leg_lr_t = create_tile(leg_raw_t, (12, 9, 14, 16), (2, 2), scale_factor).rotate(rot_leg) leg_ud_t = create_tile(leg_raw_t, (2, 6, 4, 10), (2, 2), scale_factor) # Transform to block sides & tops side_t = self.transform_image_side(side_t) round_ud_t = self.transform_image_top(round_ud_t) round_lr_t = self.transform_image_side(round_lr_t).transpose(Image.FLIP_LEFT_RIGHT) pivot_outer_t = self.transform_image_side(pivot_outer_t) pivot_lr_t = self.transform_image_side(pivot_lr_t).transpose(Image.FLIP_LEFT_RIGHT) pivot_ud_t = self.transform_image_top(pivot_ud_t) leg_outer_t = self.transform_image_side(leg_outer_t) if wall_mounted: leg_lr_t = self.transform_image_top(leg_lr_t).transpose(Image.FLIP_LEFT_RIGHT) leg_ud_t = self.transform_image_side(leg_ud_t).transpose(Image.FLIP_LEFT_RIGHT) else: leg_lr_t = self.transform_image_side(leg_lr_t).transpose(Image.FLIP_LEFT_RIGHT) leg_ud_t = self.transform_image_top(leg_ud_t) # Compose leg texture img_leg = Image.new("RGBA", (24 * scale_factor, 24 * scale_factor), self.bgcolor) alpha_over(img_leg, leg_outer_t, coord_leg[0], leg_outer_t) alpha_over(img_leg, leg_lr_t, coord_leg[1], leg_lr_t) alpha_over(img_leg, leg_ud_t, coord_leg[2], leg_ud_t) # Compose pivot texture (& combine with leg) img_pivot = Image.new("RGBA", (24 * scale_factor, 24 * scale_factor), self.bgcolor) alpha_over(img_pivot, pivot_ud_t, (20, 18), pivot_ud_t) alpha_over(img_pivot, pivot_lr_t, (23, 24), pivot_lr_t) # Fix gaps between face edges alpha_over(img_pivot, pivot_lr_t, (24, 24), pivot_lr_t) alpha_over(img_pivot, img_leg, pos_leg, img_leg) alpha_over(img_pivot, pivot_outer_t, (21, 21), pivot_outer_t) if hasattr(Image, "LANCZOS"): # workaround for older Pillow img_pivot = img_pivot.resize((24, 24), Image.LANCZOS) else: img_pivot = img_pivot.resize((24, 24)) # Combine leg, side, round & pivot img = Image.new("RGBA", (24, 24), self.bgcolor) img_final = img.copy() alpha_over(img, img_pivot, (1, -5), img_pivot) alpha_over(img, round_ud_t, (0, 2), round_ud_t) # Fix gaps between face edges alpha_over(img, side_t, (3, 6), side_t) alpha_over(img, round_ud_t, (0, 1), round_ud_t) alpha_over(img, round_lr_t, (10, 6), round_lr_t) alpha_over(img, img_pivot, (-5, -1), img_pivot) if (data & 0b11) in [1, 3]: img = img.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img_final, img, offset_final, img) return img_final # crops with 8 data values (like wheat) @material(blockid=59, data=list(range(8)), transparent=True, nospawn=True) def crops8(self, blockid, data): raw_crop = self.load_image_texture("assets/minecraft/textures/block/wheat_stage%d.png" % data) crop1 = self.transform_image_top(raw_crop) crop2 = self.transform_image_side(raw_crop) crop3 = crop2.transpose(Image.FLIP_LEFT_RIGHT) img = Image.new("RGBA", (24,24), self.bgcolor) alpha_over(img, crop1, (0,12), crop1) alpha_over(img, crop2, (6,3), crop2) alpha_over(img, crop3, (6,3), crop3) return img # farmland and grass path (15/16 blocks) @material(blockid=[60, 208], data=list(range(2)), solid=True, transparent=True, nospawn=True) def farmland(self, blockid, data): if blockid == 60: side = self.load_image_texture("assets/minecraft/textures/block/dirt.png").copy() if data == 0: top = self.load_image_texture("assets/minecraft/textures/block/farmland.png") else: top = self.load_image_texture("assets/minecraft/textures/block/farmland_moist.png") # dirt.png is 16 pixels tall, so we need to crop it before building full block side = side.crop((0, 1, 16, 16)) else: top = self.load_image_texture("assets/minecraft/textures/block/dirt_path_top.png") side = self.load_image_texture("assets/minecraft/textures/block/dirt_path_side.png") # side already has 1 transparent pixel at the top, so it doesn't need to be modified # just shift the top image down 1 pixel return self.build_full_block((top, 1), side, side, side, side) # signposts @material(blockid=[63,11401,11402,11403,11404,11405,11406,12505,12506], data=list(range(16)), transparent=True) def signpost(self, blockid, data): # first rotations if self.rotation == 1: data = (data + 4) % 16 elif self.rotation == 2: data = (data + 8) % 16 elif self.rotation == 3: data = (data + 12) % 16 sign_texture = { # (texture on sign, texture on stick) 63: ("oak_planks.png", "oak_log.png"), 11401: ("oak_planks.png", "oak_log.png"), 11402: ("spruce_planks.png", "spruce_log.png"), 11403: ("birch_planks.png", "birch_log.png"), 11404: ("jungle_planks.png", "jungle_log.png"), 11405: ("acacia_planks.png", "acacia_log.png"), 11406: ("dark_oak_planks.png", "dark_oak_log.png"), 12505: ("crimson_planks.png", "crimson_stem.png"), 12506: ("warped_planks.png", "warped_stem.png"), } texture_path, texture_stick_path = ["assets/minecraft/textures/block/" + x for x in sign_texture[blockid]] texture = self.load_image_texture(texture_path).copy() # cut the planks to the size of a signpost ImageDraw.Draw(texture).rectangle((0,12,15,15),outline=(0,0,0,0),fill=(0,0,0,0)) # If the signpost is looking directly to the image, draw some # random dots, they will look as text. if data in (0,1,2,3,4,5,15): for i in range(15): x = randint(4,11) y = randint(3,7) texture.putpixel((x,y),(0,0,0,255)) # Minecraft uses wood texture for the signpost stick texture_stick = self.load_image_texture(texture_stick_path) texture_stick = texture_stick.resize((12,12), Image.ANTIALIAS) ImageDraw.Draw(texture_stick).rectangle((2,0,12,12),outline=(0,0,0,0),fill=(0,0,0,0)) img = Image.new("RGBA", (24,24), self.bgcolor) # W N ~90 E S ~270 angles = (330.,345.,0.,15.,30.,55.,95.,120.,150.,165.,180.,195.,210.,230.,265.,310.) angle = math.radians(angles[data]) post = self.transform_image_angle(texture, angle) # choose the position of the "3D effect" incrementx = 0 if data in (1,6,7,8,9,14): incrementx = -1 elif data in (3,4,5,11,12,13): incrementx = +1 alpha_over(img, texture_stick,(11, 8),texture_stick) # post2 is a brighter signpost pasted with a small shift, # gives to the signpost some 3D effect. post2 = ImageEnhance.Brightness(post).enhance(1.2) alpha_over(img, post2,(incrementx, -3),post2) alpha_over(img, post, (0,-2), post) return img # wooden and iron door # uses pseudo-ancildata found in iterate.c @material(blockid=[64,71,193,194,195,196,197, 499, 500], data=list(range(32)), transparent=True) def door(self, blockid, data): #Masked to not clobber block top/bottom & swung info if self.rotation == 1: if (data & 0b00011) == 0: data = data & 0b11100 | 1 elif (data & 0b00011) == 1: data = data & 0b11100 | 2 elif (data & 0b00011) == 2: data = data & 0b11100 | 3 elif (data & 0b00011) == 3: data = data & 0b11100 | 0 elif self.rotation == 2: if (data & 0b00011) == 0: data = data & 0b11100 | 2 elif (data & 0b00011) == 1: data = data & 0b11100 | 3 elif (data & 0b00011) == 2: data = data & 0b11100 | 0 elif (data & 0b00011) == 3: data = data & 0b11100 | 1 elif self.rotation == 3: if (data & 0b00011) == 0: data = data & 0b11100 | 3 elif (data & 0b00011) == 1: data = data & 0b11100 | 0 elif (data & 0b00011) == 2: data = data & 0b11100 | 1 elif (data & 0b00011) == 3: data = data & 0b11100 | 2 if data & 0x8 == 0x8: # top of the door if blockid == 64: # classic wood door raw_door = self.load_image_texture("assets/minecraft/textures/block/oak_door_top.png") elif blockid == 71: # iron door raw_door = self.load_image_texture("assets/minecraft/textures/block/iron_door_top.png") elif blockid == 193: # spruce door raw_door = self.load_image_texture("assets/minecraft/textures/block/spruce_door_top.png") elif blockid == 194: # birch door raw_door = self.load_image_texture("assets/minecraft/textures/block/birch_door_top.png") elif blockid == 195: # jungle door raw_door = self.load_image_texture("assets/minecraft/textures/block/jungle_door_top.png") elif blockid == 196: # acacia door raw_door = self.load_image_texture("assets/minecraft/textures/block/acacia_door_top.png") elif blockid == 197: # dark_oak door raw_door = self.load_image_texture("assets/minecraft/textures/block/dark_oak_door_top.png") elif blockid == 499: # crimson door raw_door = self.load_image_texture("assets/minecraft/textures/block/crimson_door_top.png") elif blockid == 500: # warped door raw_door = self.load_image_texture("assets/minecraft/textures/block/warped_door_top.png") else: # bottom of the door if blockid == 64: raw_door = self.load_image_texture("assets/minecraft/textures/block/oak_door_bottom.png") elif blockid == 71: # iron door raw_door = self.load_image_texture("assets/minecraft/textures/block/iron_door_bottom.png") elif blockid == 193: # spruce door raw_door = self.load_image_texture("assets/minecraft/textures/block/spruce_door_bottom.png") elif blockid == 194: # birch door raw_door = self.load_image_texture("assets/minecraft/textures/block/birch_door_bottom.png") elif blockid == 195: # jungle door raw_door = self.load_image_texture("assets/minecraft/textures/block/jungle_door_bottom.png") elif blockid == 196: # acacia door raw_door = self.load_image_texture("assets/minecraft/textures/block/acacia_door_bottom.png") elif blockid == 197: # dark_oak door raw_door = self.load_image_texture("assets/minecraft/textures/block/dark_oak_door_bottom.png") elif blockid == 499: # crimson door raw_door = self.load_image_texture("assets/minecraft/textures/block/crimson_door_bottom.png") elif blockid == 500: # warped door raw_door = self.load_image_texture("assets/minecraft/textures/block/warped_door_bottom.png") # if you want to render all doors as closed, then force # force closed to be True if data & 0x4 == 0x4: closed = False else: closed = True if data & 0x10 == 0x10: # hinge on the left (facing same door direction) hinge_on_left = True else: # hinge on the right (default single door) hinge_on_left = False # mask out the high bits to figure out the orientation img = Image.new("RGBA", (24,24), self.bgcolor) if (data & 0x03) == 0: # facing west when closed if hinge_on_left: if closed: tex = self.transform_image_side(raw_door.transpose(Image.FLIP_LEFT_RIGHT)) alpha_over(img, tex, (0,6), tex) else: # flip first to set the doornob on the correct side tex = self.transform_image_side(raw_door.transpose(Image.FLIP_LEFT_RIGHT)) tex = tex.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, tex, (12,6), tex) else: if closed: tex = self.transform_image_side(raw_door) alpha_over(img, tex, (0,6), tex) else: # flip first to set the doornob on the correct side tex = self.transform_image_side(raw_door.transpose(Image.FLIP_LEFT_RIGHT)) tex = tex.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, tex, (0,0), tex) if (data & 0x03) == 1: # facing north when closed if hinge_on_left: if closed: tex = self.transform_image_side(raw_door).transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, tex, (0,0), tex) else: # flip first to set the doornob on the correct side tex = self.transform_image_side(raw_door) alpha_over(img, tex, (0,6), tex) else: if closed: tex = self.transform_image_side(raw_door).transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, tex, (0,0), tex) else: # flip first to set the doornob on the correct side tex = self.transform_image_side(raw_door) alpha_over(img, tex, (12,0), tex) if (data & 0x03) == 2: # facing east when closed if hinge_on_left: if closed: tex = self.transform_image_side(raw_door) alpha_over(img, tex, (12,0), tex) else: # flip first to set the doornob on the correct side tex = self.transform_image_side(raw_door) tex = tex.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, tex, (0,0), tex) else: if closed: tex = self.transform_image_side(raw_door.transpose(Image.FLIP_LEFT_RIGHT)) alpha_over(img, tex, (12,0), tex) else: # flip first to set the doornob on the correct side tex = self.transform_image_side(raw_door).transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, tex, (12,6), tex) if (data & 0x03) == 3: # facing south when closed if hinge_on_left: if closed: tex = self.transform_image_side(raw_door).transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, tex, (12,6), tex) else: # flip first to set the doornob on the correct side tex = self.transform_image_side(raw_door.transpose(Image.FLIP_LEFT_RIGHT)) alpha_over(img, tex, (12,0), tex) else: if closed: tex = self.transform_image_side(raw_door.transpose(Image.FLIP_LEFT_RIGHT)) tex = tex.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, tex, (12,6), tex) else: # flip first to set the doornob on the correct side tex = self.transform_image_side(raw_door.transpose(Image.FLIP_LEFT_RIGHT)) alpha_over(img, tex, (0,6), tex) return img # ladder @material(blockid=65, data=[2, 3, 4, 5], transparent=True) def ladder(self, blockid, data): # first rotations if self.rotation == 1: if data == 2: data = 5 elif data == 3: data = 4 elif data == 4: data = 2 elif data == 5: data = 3 elif self.rotation == 2: if data == 2: data = 3 elif data == 3: data = 2 elif data == 4: data = 5 elif data == 5: data = 4 elif self.rotation == 3: if data == 2: data = 4 elif data == 3: data = 5 elif data == 4: data = 3 elif data == 5: data = 2 img = Image.new("RGBA", (24,24), self.bgcolor) raw_texture = self.load_image_texture("assets/minecraft/textures/block/ladder.png") if data == 5: # normally this ladder would be obsured by the block it's attached to # but since ladders can apparently be placed on transparent blocks, we # have to render this thing anyway. same for data == 2 tex = self.transform_image_side(raw_texture) alpha_over(img, tex, (0,6), tex) return img if data == 2: tex = self.transform_image_side(raw_texture).transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, tex, (12,6), tex) return img if data == 3: tex = self.transform_image_side(raw_texture).transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, tex, (0,0), tex) return img if data == 4: tex = self.transform_image_side(raw_texture) alpha_over(img, tex, (12,0), tex) return img # wall signs @material(blockid=[68,11407,11408,11409,11410,11411,11412,12507,12508], data=[2, 3, 4, 5], transparent=True) def wall_sign(self, blockid, data): # wall sign # first rotations if self.rotation == 1: if data == 2: data = 5 elif data == 3: data = 4 elif data == 4: data = 2 elif data == 5: data = 3 elif self.rotation == 2: if data == 2: data = 3 elif data == 3: data = 2 elif data == 4: data = 5 elif data == 5: data = 4 elif self.rotation == 3: if data == 2: data = 4 elif data == 3: data = 5 elif data == 4: data = 3 elif data == 5: data = 2 sign_texture = { 68: "oak_planks.png", 11407: "oak_planks.png", 11408: "spruce_planks.png", 11409: "birch_planks.png", 11410: "jungle_planks.png", 11411: "acacia_planks.png", 11412: "dark_oak_planks.png", 12507: "crimson_planks.png", 12508: "warped_planks.png", } texture_path = "assets/minecraft/textures/block/" + sign_texture[blockid] texture = self.load_image_texture(texture_path).copy() # cut the planks to the size of a signpost ImageDraw.Draw(texture).rectangle((0,12,15,15),outline=(0,0,0,0),fill=(0,0,0,0)) # draw some random black dots, they will look as text """ don't draw text at the moment, they are used in blank for decoration if data in (3,4): for i in range(15): x = randint(4,11) y = randint(3,7) texture.putpixel((x,y),(0,0,0,255)) """ img = Image.new("RGBA", (24,24), self.bgcolor) incrementx = 0 if data == 2: # east incrementx = +1 sign = self.build_full_block(None, None, None, None, texture) elif data == 3: # west incrementx = -1 sign = self.build_full_block(None, texture, None, None, None) elif data == 4: # north incrementx = +1 sign = self.build_full_block(None, None, texture, None, None) elif data == 5: # south incrementx = -1 sign = self.build_full_block(None, None, None, texture, None) sign2 = ImageEnhance.Brightness(sign).enhance(1.2) alpha_over(img, sign2,(incrementx, 2),sign2) alpha_over(img, sign, (0,3), sign) return img # levers @material(blockid=69, data=list(range(16)), transparent=True) def levers(self, blockid, data): if data & 8 == 8: powered = True else: powered = False data = data & 7 # first rotations if self.rotation == 1: # on wall levers if data == 1: data = 3 elif data == 2: data = 4 elif data == 3: data = 2 elif data == 4: data = 1 # on floor levers elif data == 5: data = 6 elif data == 6: data = 5 elif self.rotation == 2: if data == 1: data = 2 elif data == 2: data = 1 elif data == 3: data = 4 elif data == 4: data = 3 elif data == 5: data = 5 elif data == 6: data = 6 elif self.rotation == 3: if data == 1: data = 4 elif data == 2: data = 3 elif data == 3: data = 1 elif data == 4: data = 2 elif data == 5: data = 6 elif data == 6: data = 5 # generate the texture for the base of the lever t_base = self.load_image_texture("assets/minecraft/textures/block/stone.png").copy() ImageDraw.Draw(t_base).rectangle((0,0,15,3),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(t_base).rectangle((0,12,15,15),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(t_base).rectangle((0,0,4,15),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(t_base).rectangle((11,0,15,15),outline=(0,0,0,0),fill=(0,0,0,0)) # generate the texture for the stick stick = self.load_image_texture("assets/minecraft/textures/block/lever.png").copy() c_stick = Image.new("RGBA", (16,16), self.bgcolor) tmp = ImageEnhance.Brightness(stick).enhance(0.8) alpha_over(c_stick, tmp, (1,0), tmp) alpha_over(c_stick, stick, (0,0), stick) t_stick = self.transform_image_side(c_stick.rotate(45, Image.NEAREST)) # where the lever will be composed img = Image.new("RGBA", (24,24), self.bgcolor) # wall levers if data == 1: # facing SOUTH # levers can't be placed in transparent blocks, so this # direction is almost invisible return None elif data == 2: # facing NORTH base = self.transform_image_side(t_base) # paste it twice with different brightness to make a fake 3D effect alpha_over(img, base, (12,-1), base) alpha = base.split()[3] base = ImageEnhance.Brightness(base).enhance(0.9) base.putalpha(alpha) alpha_over(img, base, (11,0), base) # paste the lever stick pos = (7,-7) if powered: t_stick = t_stick.transpose(Image.FLIP_TOP_BOTTOM) pos = (7,6) alpha_over(img, t_stick, pos, t_stick) elif data == 3: # facing WEST base = self.transform_image_side(t_base) # paste it twice with different brightness to make a fake 3D effect base = base.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, base, (0,-1), base) alpha = base.split()[3] base = ImageEnhance.Brightness(base).enhance(0.9) base.putalpha(alpha) alpha_over(img, base, (1,0), base) # paste the lever stick t_stick = t_stick.transpose(Image.FLIP_LEFT_RIGHT) pos = (5,-7) if powered: t_stick = t_stick.transpose(Image.FLIP_TOP_BOTTOM) pos = (6,6) alpha_over(img, t_stick, pos, t_stick) elif data == 4: # facing EAST # levers can't be placed in transparent blocks, so this # direction is almost invisible return None # floor levers elif data == 5: # pointing south when off # lever base, fake 3d again base = self.transform_image_top(t_base) alpha = base.split()[3] tmp = ImageEnhance.Brightness(base).enhance(0.8) tmp.putalpha(alpha) alpha_over(img, tmp, (0,12), tmp) alpha_over(img, base, (0,11), base) # lever stick pos = (3,2) if not powered: t_stick = t_stick.transpose(Image.FLIP_LEFT_RIGHT) pos = (11,2) alpha_over(img, t_stick, pos, t_stick) elif data == 6: # pointing east when off # lever base, fake 3d again base = self.transform_image_top(t_base.rotate(90)) alpha = base.split()[3] tmp = ImageEnhance.Brightness(base).enhance(0.8) tmp.putalpha(alpha) alpha_over(img, tmp, (0,12), tmp) alpha_over(img, base, (0,11), base) # lever stick pos = (2,3) if not powered: t_stick = t_stick.transpose(Image.FLIP_LEFT_RIGHT) pos = (10,2) alpha_over(img, t_stick, pos, t_stick) return img # wooden and stone pressure plates, and weighted pressure plates @material(blockid=[70, 72,147,148,11301,11302,11303,11304,11305, 1033,11517,11518], data=[0,1], transparent=True) def pressure_plate(self, blockid, data): texture_name = {70:"assets/minecraft/textures/block/stone.png", # stone 72:"assets/minecraft/textures/block/oak_planks.png", # oak 11301:"assets/minecraft/textures/block/spruce_planks.png", # spruce 11302:"assets/minecraft/textures/block/birch_planks.png", # birch 11303:"assets/minecraft/textures/block/jungle_planks.png", # jungle 11304:"assets/minecraft/textures/block/acacia_planks.png", # acacia 11305:"assets/minecraft/textures/block/dark_oak_planks.png", # dark oak 11517:"assets/minecraft/textures/block/crimson_planks.png", # crimson 11518:"assets/minecraft/textures/block/warped_planks.png", # warped 147:"assets/minecraft/textures/block/gold_block.png", # light golden 148:"assets/minecraft/textures/block/iron_block.png", # heavy iron 1033:"assets/minecraft/textures/block/polished_blackstone.png" }[blockid] t = self.load_image_texture(texture_name).copy() # cut out the outside border, pressure plates are smaller # than a normal block ImageDraw.Draw(t).rectangle((0,0,15,15),outline=(0,0,0,0)) # create the textures and a darker version to make a 3d by # pasting them with an offstet of 1 pixel img = Image.new("RGBA", (24,24), self.bgcolor) top = self.transform_image_top(t) alpha = top.split()[3] topd = ImageEnhance.Brightness(top).enhance(0.8) topd.putalpha(alpha) #show it 3d or 2d if unpressed or pressed if data == 0: alpha_over(img,topd, (0,12),topd) alpha_over(img,top, (0,11),top) elif data == 1: alpha_over(img,top, (0,12),top) return img # normal and glowing redstone ore block(blockid=[73, 74], top_image="assets/minecraft/textures/block/redstone_ore.png") # stone and wood buttons @material(blockid=(77,143,11326,11327,11328,11329,11330,1034,11515,11516), data=list(range(16)), transparent=True) def buttons(self, blockid, data): # 0x8 is set if the button is pressed mask this info and render # it as unpressed data = data & 0x7 if self.rotation == 1: if data == 1: data = 3 elif data == 2: data = 4 elif data == 3: data = 2 elif data == 4: data = 1 elif data == 5: data = 6 elif data == 6: data = 5 elif self.rotation == 2: if data == 1: data = 2 elif data == 2: data = 1 elif data == 3: data = 4 elif data == 4: data = 3 elif self.rotation == 3: if data == 1: data = 4 elif data == 2: data = 3 elif data == 3: data = 1 elif data == 4: data = 2 elif data == 5: data = 6 elif data == 6: data = 5 texturepath = {77:"assets/minecraft/textures/block/stone.png", 143:"assets/minecraft/textures/block/oak_planks.png", 11326:"assets/minecraft/textures/block/spruce_planks.png", 11327:"assets/minecraft/textures/block/birch_planks.png", 11328:"assets/minecraft/textures/block/jungle_planks.png", 11329:"assets/minecraft/textures/block/acacia_planks.png", 11330:"assets/minecraft/textures/block/dark_oak_planks.png", 1034:"assets/minecraft/textures/block/polished_blackstone.png", 11515:"assets/minecraft/textures/block/crimson_planks.png", 11516:"assets/minecraft/textures/block/warped_planks.png" }[blockid] t = self.load_image_texture(texturepath).copy() # generate the texture for the button ImageDraw.Draw(t).rectangle((0,0,15,5),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(t).rectangle((0,10,15,15),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(t).rectangle((0,0,4,15),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(t).rectangle((11,0,15,15),outline=(0,0,0,0),fill=(0,0,0,0)) img = Image.new("RGBA", (24,24), self.bgcolor) if data < 5: button = self.transform_image_side(t) if data == 1: # facing SOUTH # buttons can't be placed in transparent blocks, so this # direction can't be seen return None elif data == 2: # facing NORTH # paste it twice with different brightness to make a 3D effect alpha_over(img, button, (12,-1), button) alpha = button.split()[3] button = ImageEnhance.Brightness(button).enhance(0.9) button.putalpha(alpha) alpha_over(img, button, (11,0), button) elif data == 3: # facing WEST # paste it twice with different brightness to make a 3D effect button = button.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, button, (0,-1), button) alpha = button.split()[3] button = ImageEnhance.Brightness(button).enhance(0.9) button.putalpha(alpha) alpha_over(img, button, (1,0), button) elif data == 4: # facing EAST # buttons can't be placed in transparent blocks, so this # direction can't be seen return None else: if data == 5: # long axis east-west button = self.transform_image_top(t) else: # long axis north-south button = self.transform_image_top(t.rotate(90)) # paste it twice with different brightness to make a 3D effect alpha_over(img, button, (0,12), button) alpha = button.split()[3] button = ImageEnhance.Brightness(button).enhance(0.9) button.putalpha(alpha) alpha_over(img, button, (0,11), button) return img # end rod @material(blockid=198, data=list(range(6)), transparent=True, solid=True) def end_rod(self, blockid, data): tex = self.load_image_texture("assets/minecraft/textures/block/end_rod.png") img = Image.new("RGBA", (24, 24), self.bgcolor) mask = tex.crop((0, 0, 2, 15)) sidetex = Image.new(tex.mode, tex.size, self.bgcolor) alpha_over(sidetex, mask, (14, 0), mask) mask = tex.crop((2, 3, 6, 7)) bottom = Image.new(tex.mode, tex.size, self.bgcolor) alpha_over(bottom, mask, (5, 6), mask) if data == 1 or data == 0: side = self.transform_image_side(sidetex) otherside = side.transpose(Image.FLIP_LEFT_RIGHT) bottom = self.transform_image_top(bottom) if data == 1: # up mask = tex.crop((2, 0, 4, 2)) top = Image.new(tex.mode, tex.size, self.bgcolor) alpha_over(top, mask, (7, 2), mask) top = self.transform_image_top(top) alpha_over(img, bottom, (0, 11), bottom) alpha_over(img, side, (0, 0), side) alpha_over(img, otherside, (11, 0), otherside) alpha_over(img, top, (3, 1), top) elif data == 0: # down alpha_over(img, side, (0, 0), side) alpha_over(img, otherside, (11, 0), otherside) alpha_over(img, bottom, (0, 0), bottom) else: otherside = self.transform_image_top(sidetex) sidetex = sidetex.rotate(90) side = self.transform_image_side(sidetex) bottom = self.transform_image_side(bottom) bottom = bottom.transpose(Image.FLIP_LEFT_RIGHT) def draw_south(): alpha_over(img, bottom, (0, 0), bottom) alpha_over(img, side, (7, 8), side) alpha_over(img, otherside, (-3, 9), otherside) def draw_north(): alpha_over(img, side, (7, 8), side) alpha_over(img, otherside, (-3, 9), otherside) alpha_over(img, bottom, (12, 6), bottom) def draw_west(): _bottom = bottom.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, _bottom, (13, 0), _bottom) _side = side.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, _side, (7, 8), _side) _otherside = otherside.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, _otherside, (4, 9), _otherside) def draw_east(): _side = side.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, _side, (7, 8), _side) _otherside = otherside.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, _otherside, (4, 9), _otherside) _bottom = bottom.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, _bottom, (0, 6), _bottom) draw_funcs = [ draw_south, draw_west, draw_north, draw_east ] if data == 3: # south draw_funcs[self.rotation]() elif data == 2: # north draw_funcs[(self.rotation + 2) % len(draw_funcs)]() elif data == 4: # west draw_funcs[(self.rotation + 1) % len(draw_funcs)]() elif data == 5: # east draw_funcs[(self.rotation + 3) % len(draw_funcs)]() return img # snow @material(blockid=78, data=list(range(1, 9)), transparent=True, solid=True) def snow(self, blockid, data): tex = self.load_image_texture("assets/minecraft/textures/block/snow.png") y = 16 - (data * 2) mask = tex.crop((0, y, 16, 16)) sidetex = Image.new(tex.mode, tex.size, self.bgcolor) alpha_over(sidetex, mask, (0,y,16,16), mask) img = Image.new("RGBA", (24,24), self.bgcolor) top = self.transform_image_top(tex) side = self.transform_image_side(sidetex) otherside = side.transpose(Image.FLIP_LEFT_RIGHT) sidealpha = side.split()[3] side = ImageEnhance.Brightness(side).enhance(0.9) side.putalpha(sidealpha) othersidealpha = otherside.split()[3] otherside = ImageEnhance.Brightness(otherside).enhance(0.8) otherside.putalpha(othersidealpha) alpha_over(img, side, (0, 6), side) alpha_over(img, otherside, (12, 6), otherside) alpha_over(img, top, (0, 12 - int(12 / 8 * data)), top) return img # snow block block(blockid=80, top_image="assets/minecraft/textures/block/snow.png") # cactus @material(blockid=81, data=list(range(15)), transparent=True, solid=True, nospawn=True) def cactus(self, blockid, data): top = self.load_image_texture("assets/minecraft/textures/block/cactus_top.png") side = self.load_image_texture("assets/minecraft/textures/block/cactus_side.png") img = Image.new("RGBA", (24,24), self.bgcolor) top = self.transform_image_top(top) side = self.transform_image_side(side) otherside = side.transpose(Image.FLIP_LEFT_RIGHT) sidealpha = side.split()[3] side = ImageEnhance.Brightness(side).enhance(0.9) side.putalpha(sidealpha) othersidealpha = otherside.split()[3] otherside = ImageEnhance.Brightness(otherside).enhance(0.8) otherside.putalpha(othersidealpha) alpha_over(img, side, (1,6), side) alpha_over(img, otherside, (11,6), otherside) alpha_over(img, top, (0,0), top) return img # clay block block(blockid=82, top_image="assets/minecraft/textures/block/clay.png") # sugar cane @material(blockid=83, data=list(range(16)), transparent=True) def sugar_cane(self, blockid, data): tex = self.load_image_texture("assets/minecraft/textures/block/sugar_cane.png") return self.build_sprite(tex) # jukebox @material(blockid=84, data=list(range(16)), solid=True) def jukebox(self, blockid, data): return self.build_block(self.load_image_texture("assets/minecraft/textures/block/jukebox_top.png"), self.load_image_texture("assets/minecraft/textures/block/note_block.png")) # nether and normal fences @material(blockid=[85, 188, 189, 190, 191, 192, 113, 511, 512], data=list(range(16)), transparent=True, nospawn=True) def fence(self, blockid, data): # create needed images for Big stick fence if blockid == 85: # normal fence fence_top = self.load_image_texture("assets/minecraft/textures/block/oak_planks.png").copy() fence_side = self.load_image_texture("assets/minecraft/textures/block/oak_planks.png").copy() fence_small_side = self.load_image_texture("assets/minecraft/textures/block/oak_planks.png").copy() elif blockid == 188: # spruce fence fence_top = self.load_image_texture("assets/minecraft/textures/block/spruce_planks.png").copy() fence_side = self.load_image_texture("assets/minecraft/textures/block/spruce_planks.png").copy() fence_small_side = self.load_image_texture("assets/minecraft/textures/block/spruce_planks.png").copy() elif blockid == 189: # birch fence fence_top = self.load_image_texture("assets/minecraft/textures/block/birch_planks.png").copy() fence_side = self.load_image_texture("assets/minecraft/textures/block/birch_planks.png").copy() fence_small_side = self.load_image_texture("assets/minecraft/textures/block/birch_planks.png").copy() elif blockid == 190: # jungle fence fence_top = self.load_image_texture("assets/minecraft/textures/block/jungle_planks.png").copy() fence_side = self.load_image_texture("assets/minecraft/textures/block/jungle_planks.png").copy() fence_small_side = self.load_image_texture("assets/minecraft/textures/block/jungle_planks.png").copy() elif blockid == 191: # big/dark oak fence fence_top = self.load_image_texture("assets/minecraft/textures/block/dark_oak_planks.png").copy() fence_side = self.load_image_texture("assets/minecraft/textures/block/dark_oak_planks.png").copy() fence_small_side = self.load_image_texture("assets/minecraft/textures/block/dark_oak_planks.png").copy() elif blockid == 192: # acacia fence fence_top = self.load_image_texture("assets/minecraft/textures/block/acacia_planks.png").copy() fence_side = self.load_image_texture("assets/minecraft/textures/block/acacia_planks.png").copy() fence_small_side = self.load_image_texture("assets/minecraft/textures/block/acacia_planks.png").copy() elif blockid == 511: # crimson_fence fence_top = self.load_image_texture("assets/minecraft/textures/block/crimson_planks.png").copy() fence_side = self.load_image_texture("assets/minecraft/textures/block/crimson_planks.png").copy() fence_small_side = self.load_image_texture("assets/minecraft/textures/block/crimson_planks.png").copy() elif blockid == 512: # warped fence fence_top = self.load_image_texture("assets/minecraft/textures/block/warped_planks.png").copy() fence_side = self.load_image_texture("assets/minecraft/textures/block/warped_planks.png").copy() fence_small_side = self.load_image_texture("assets/minecraft/textures/block/warped_planks.png").copy() else: # netherbrick fence fence_top = self.load_image_texture("assets/minecraft/textures/block/nether_bricks.png").copy() fence_side = self.load_image_texture("assets/minecraft/textures/block/nether_bricks.png").copy() fence_small_side = self.load_image_texture("assets/minecraft/textures/block/nether_bricks.png").copy() # generate the textures of the fence ImageDraw.Draw(fence_top).rectangle((0,0,5,15),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(fence_top).rectangle((10,0,15,15),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(fence_top).rectangle((0,0,15,5),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(fence_top).rectangle((0,10,15,15),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(fence_side).rectangle((0,0,5,15),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(fence_side).rectangle((10,0,15,15),outline=(0,0,0,0),fill=(0,0,0,0)) # Create the sides and the top of the big stick fence_side = self.transform_image_side(fence_side) fence_other_side = fence_side.transpose(Image.FLIP_LEFT_RIGHT) fence_top = self.transform_image_top(fence_top) # Darken the sides slightly. These methods also affect the alpha layer, # so save them first (we don't want to "darken" the alpha layer making # the block transparent) sidealpha = fence_side.split()[3] fence_side = ImageEnhance.Brightness(fence_side).enhance(0.9) fence_side.putalpha(sidealpha) othersidealpha = fence_other_side.split()[3] fence_other_side = ImageEnhance.Brightness(fence_other_side).enhance(0.8) fence_other_side.putalpha(othersidealpha) # Compose the fence big stick fence_big = Image.new("RGBA", (24,24), self.bgcolor) alpha_over(fence_big,fence_side, (5,4),fence_side) alpha_over(fence_big,fence_other_side, (7,4),fence_other_side) alpha_over(fence_big,fence_top, (0,0),fence_top) # Now render the small sticks. # Create needed images ImageDraw.Draw(fence_small_side).rectangle((0,0,15,0),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(fence_small_side).rectangle((0,4,15,6),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(fence_small_side).rectangle((0,10,15,16),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(fence_small_side).rectangle((0,0,4,15),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(fence_small_side).rectangle((11,0,15,15),outline=(0,0,0,0),fill=(0,0,0,0)) # Create the sides and the top of the small sticks fence_small_side = self.transform_image_side(fence_small_side) fence_small_other_side = fence_small_side.transpose(Image.FLIP_LEFT_RIGHT) # Darken the sides slightly. These methods also affect the alpha layer, # so save them first (we don't want to "darken" the alpha layer making # the block transparent) sidealpha = fence_small_other_side.split()[3] fence_small_other_side = ImageEnhance.Brightness(fence_small_other_side).enhance(0.9) fence_small_other_side.putalpha(sidealpha) sidealpha = fence_small_side.split()[3] fence_small_side = ImageEnhance.Brightness(fence_small_side).enhance(0.9) fence_small_side.putalpha(sidealpha) # Create img to compose the fence img = Image.new("RGBA", (24,24), self.bgcolor) # Position of fence small sticks in img. # These postitions are strange because the small sticks of the # fence are at the very left and at the very right of the 16x16 images pos_top_left = (2,3) pos_top_right = (10,3) pos_bottom_right = (10,7) pos_bottom_left = (2,7) # +x axis points top right direction # +y axis points bottom right direction # First compose small sticks in the back of the image, # then big stick and then small sticks in the front. def draw_north(): alpha_over(img, fence_small_side, pos_top_left, fence_small_side) def draw_east(): alpha_over(img, fence_small_other_side, pos_top_right, fence_small_other_side) def draw_south(): alpha_over(img, fence_small_side, pos_bottom_right, fence_small_side) def draw_west(): alpha_over(img, fence_small_other_side, pos_bottom_left, fence_small_other_side) draw_funcs = [draw_north, draw_east, draw_south, draw_west] if (data & 0b0001): draw_funcs[(self.rotation + 0) % len(draw_funcs)]() if (data & 0b0010): draw_funcs[(self.rotation + 1) % len(draw_funcs)]() alpha_over(img, fence_big, (0, 0), fence_big) if (data & 0b0100): draw_funcs[(self.rotation + 2) % len(draw_funcs)]() if (data & 0b1000): draw_funcs[(self.rotation + 3) % len(draw_funcs)]() return img # pumpkin @material(blockid=[86, 91,11300], data=list(range(4)), solid=True) def pumpkin(self, blockid, data): # pumpkins, jack-o-lantern # rotation if self.rotation == 1: if data == 0: data = 1 elif data == 1: data = 2 elif data == 2: data = 3 elif data == 3: data = 0 elif self.rotation == 2: if data == 0: data = 2 elif data == 1: data = 3 elif data == 2: data = 0 elif data == 3: data = 1 elif self.rotation == 3: if data == 0: data = 3 elif data == 1: data = 0 elif data == 2: data = 1 elif data == 3: data = 2 # texture generation top = self.load_image_texture("assets/minecraft/textures/block/pumpkin_top.png") frontName = {86: "assets/minecraft/textures/block/pumpkin_side.png", 91: "assets/minecraft/textures/block/jack_o_lantern.png", 11300: "assets/minecraft/textures/block/carved_pumpkin.png" }[blockid] front = self.load_image_texture(frontName) side = self.load_image_texture("assets/minecraft/textures/block/pumpkin_side.png") if data == 0: # pointing west img = self.build_full_block(top, None, None, side, front) elif data == 1: # pointing north img = self.build_full_block(top, None, None, front, side) else: # in any other direction the front can't be seen img = self.build_full_block(top, None, None, side, side) return img # netherrack block(blockid=87, top_image="assets/minecraft/textures/block/netherrack.png") # soul sand block(blockid=88, top_image="assets/minecraft/textures/block/soul_sand.png") # glowstone block(blockid=89, top_image="assets/minecraft/textures/block/glowstone.png") # shroomlight block(blockid=1011, top_image="assets/minecraft/textures/block/shroomlight.png") # portal @material(blockid=90, data=[1, 2, 4, 5, 8, 10], transparent=True) def portal(self, blockid, data): # no rotations, uses pseudo data portaltexture = self.load_portal() img = Image.new("RGBA", (24,24), self.bgcolor) side = self.transform_image_side(portaltexture) otherside = side.transpose(Image.FLIP_TOP_BOTTOM) if data in (1,4,5): alpha_over(img, side, (5,4), side) if data in (2,8,10): alpha_over(img, otherside, (5,4), otherside) return img # cake! @material(blockid=92, data=list(range(7)), transparent=True, nospawn=True) def cake(self, blockid, data): # cake textures top = self.load_image_texture("assets/minecraft/textures/block/cake_top.png").copy() side = self.load_image_texture("assets/minecraft/textures/block/cake_side.png").copy() fullside = side.copy() inside = self.load_image_texture("assets/minecraft/textures/block/cake_inner.png") img = Image.new("RGBA", (24, 24), self.bgcolor) if data == 0: # unbitten cake top = self.transform_image_top(top) side = self.transform_image_side(side) otherside = side.transpose(Image.FLIP_LEFT_RIGHT) # darken sides slightly sidealpha = side.split()[3] side = ImageEnhance.Brightness(side).enhance(0.9) side.putalpha(sidealpha) othersidealpha = otherside.split()[3] otherside = ImageEnhance.Brightness(otherside).enhance(0.8) otherside.putalpha(othersidealpha) # composite the cake alpha_over(img, side, (1, 6), side) alpha_over(img, otherside, (11, 5), otherside) # workaround, fixes a hole alpha_over(img, otherside, (12, 6), otherside) alpha_over(img, top, (0, 6), top) else: # cut the textures for a bitten cake bite_width = int(14 / 7) # Cake is 14px wide with 7 slices coord = 1 + bite_width * data ImageDraw.Draw(side).rectangle((16 - coord, 0, 16, 16), outline=(0, 0, 0, 0), fill=(0, 0, 0, 0)) ImageDraw.Draw(top).rectangle((0, 0, coord - 1, 16), outline=(0, 0, 0, 0), fill=(0, 0, 0, 0)) # the bitten part of the cake always points to the west # composite the cake for every north orientation if self.rotation == 0: # north top-left # create right side rs = self.transform_image_side(side).transpose(Image.FLIP_LEFT_RIGHT) # create bitten side and its coords deltax = bite_width * data deltay = -1 * data if data in [3, 4, 5, 6]: deltax -= 1 ls = self.transform_image_side(inside) # create top side t = self.transform_image_top(top) # darken sides slightly sidealpha = ls.split()[3] ls = ImageEnhance.Brightness(ls).enhance(0.9) ls.putalpha(sidealpha) othersidealpha = rs.split()[3] rs = ImageEnhance.Brightness(rs).enhance(0.8) rs.putalpha(othersidealpha) # compose the cake alpha_over(img, rs, (12, 6), rs) alpha_over(img, ls, (1 + deltax, 6 + deltay), ls) alpha_over(img, t, (1, 6), t) elif self.rotation == 1: # north top-right # bitten side not shown # create left side ls = self.transform_image_side(side.transpose(Image.FLIP_LEFT_RIGHT)) # create top t = self.transform_image_top(top.rotate(-90)) # create right side rs = self.transform_image_side(fullside).transpose(Image.FLIP_LEFT_RIGHT) # darken sides slightly sidealpha = ls.split()[3] ls = ImageEnhance.Brightness(ls).enhance(0.9) ls.putalpha(sidealpha) othersidealpha = rs.split()[3] rs = ImageEnhance.Brightness(rs).enhance(0.8) rs.putalpha(othersidealpha) # compose the cake alpha_over(img, ls, (2, 6), ls) alpha_over(img, t, (1, 6), t) alpha_over(img, rs, (12, 6), rs) elif self.rotation == 2: # north bottom-right # bitten side not shown # left side ls = self.transform_image_side(fullside) # top t = self.transform_image_top(top.rotate(180)) # right side rs = self.transform_image_side(side.transpose(Image.FLIP_LEFT_RIGHT)) rs = rs.transpose(Image.FLIP_LEFT_RIGHT) # darken sides slightly sidealpha = ls.split()[3] ls = ImageEnhance.Brightness(ls).enhance(0.9) ls.putalpha(sidealpha) othersidealpha = rs.split()[3] rs = ImageEnhance.Brightness(rs).enhance(0.8) rs.putalpha(othersidealpha) # compose the cake alpha_over(img, ls, (2, 6), ls) alpha_over(img, t, (1, 6), t) alpha_over(img, rs, (12, 6), rs) elif self.rotation == 3: # north bottom-left # create left side ls = self.transform_image_side(side) # create top t = self.transform_image_top(top.rotate(90)) # create right side and its coords deltax = 12 - bite_width * data deltay = -1 * data if data in [3, 4, 5, 6]: deltax += 1 rs = self.transform_image_side(inside).transpose(Image.FLIP_LEFT_RIGHT) # darken sides slightly sidealpha = ls.split()[3] ls = ImageEnhance.Brightness(ls).enhance(0.9) ls.putalpha(sidealpha) othersidealpha = rs.split()[3] rs = ImageEnhance.Brightness(rs).enhance(0.8) rs.putalpha(othersidealpha) # compose the cake alpha_over(img, ls, (2, 6), ls) alpha_over(img, t, (1, 6), t) alpha_over(img, rs, (1 + deltax, 6 + deltay), rs) return img # redstone repeaters ON and OFF @material(blockid=[93,94], data=list(range(16)), transparent=True, nospawn=True) def repeater(self, blockid, data): # rotation # Masked to not clobber delay info if self.rotation == 1: if (data & 0b0011) == 0: data = data & 0b1100 | 1 elif (data & 0b0011) == 1: data = data & 0b1100 | 2 elif (data & 0b0011) == 2: data = data & 0b1100 | 3 elif (data & 0b0011) == 3: data = data & 0b1100 | 0 elif self.rotation == 2: if (data & 0b0011) == 0: data = data & 0b1100 | 2 elif (data & 0b0011) == 1: data = data & 0b1100 | 3 elif (data & 0b0011) == 2: data = data & 0b1100 | 0 elif (data & 0b0011) == 3: data = data & 0b1100 | 1 elif self.rotation == 3: if (data & 0b0011) == 0: data = data & 0b1100 | 3 elif (data & 0b0011) == 1: data = data & 0b1100 | 0 elif (data & 0b0011) == 2: data = data & 0b1100 | 1 elif (data & 0b0011) == 3: data = data & 0b1100 | 2 # generate the diode top = self.load_image_texture("assets/minecraft/textures/block/repeater.png") if blockid == 93 else self.load_image_texture("assets/minecraft/textures/block/repeater_on.png") side = self.load_image_texture("assets/minecraft/textures/block/smooth_stone_slab_side.png") increment = 13 if (data & 0x3) == 0: # pointing east pass if (data & 0x3) == 1: # pointing south top = top.rotate(270) if (data & 0x3) == 2: # pointing west top = top.rotate(180) if (data & 0x3) == 3: # pointing north top = top.rotate(90) img = self.build_full_block( (top, increment), None, None, side, side) # compose a "3d" redstone torch t = self.load_image_texture("assets/minecraft/textures/block/redstone_torch_off.png").copy() if blockid == 93 else self.load_image_texture("assets/minecraft/textures/block/redstone_torch.png").copy() torch = Image.new("RGBA", (24,24), self.bgcolor) t_crop = t.crop((2,2,14,14)) slice = t_crop.copy() ImageDraw.Draw(slice).rectangle((6,0,12,12),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(slice).rectangle((0,0,4,12),outline=(0,0,0,0),fill=(0,0,0,0)) alpha_over(torch, slice, (6,4)) alpha_over(torch, t_crop, (5,5)) alpha_over(torch, t_crop, (6,5)) alpha_over(torch, slice, (6,6)) # paste redstone torches everywhere! # the torch is too tall for the repeater, crop the bottom. ImageDraw.Draw(torch).rectangle((0,16,24,24),outline=(0,0,0,0),fill=(0,0,0,0)) # touch up the 3d effect with big rectangles, just in case, for other texture packs ImageDraw.Draw(torch).rectangle((0,24,10,15),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(torch).rectangle((12,15,24,24),outline=(0,0,0,0),fill=(0,0,0,0)) # torch positions for every redstone torch orientation. # # This is a horrible list of torch orientations. I tried to # obtain these orientations by rotating the positions for one # orientation, but pixel rounding is horrible and messes the # torches. if (data & 0x3) == 0: # pointing east if (data & 0xC) == 0: # one tick delay moving_torch = (1,1) static_torch = (-3,-1) elif (data & 0xC) == 4: # two ticks delay moving_torch = (2,2) static_torch = (-3,-1) elif (data & 0xC) == 8: # three ticks delay moving_torch = (3,2) static_torch = (-3,-1) elif (data & 0xC) == 12: # four ticks delay moving_torch = (4,3) static_torch = (-3,-1) elif (data & 0x3) == 1: # pointing south if (data & 0xC) == 0: # one tick delay moving_torch = (1,1) static_torch = (5,-1) elif (data & 0xC) == 4: # two ticks delay moving_torch = (0,2) static_torch = (5,-1) elif (data & 0xC) == 8: # three ticks delay moving_torch = (-1,2) static_torch = (5,-1) elif (data & 0xC) == 12: # four ticks delay moving_torch = (-2,3) static_torch = (5,-1) elif (data & 0x3) == 2: # pointing west if (data & 0xC) == 0: # one tick delay moving_torch = (1,1) static_torch = (5,3) elif (data & 0xC) == 4: # two ticks delay moving_torch = (0,0) static_torch = (5,3) elif (data & 0xC) == 8: # three ticks delay moving_torch = (-1,0) static_torch = (5,3) elif (data & 0xC) == 12: # four ticks delay moving_torch = (-2,-1) static_torch = (5,3) elif (data & 0x3) == 3: # pointing north if (data & 0xC) == 0: # one tick delay moving_torch = (1,1) static_torch = (-3,3) elif (data & 0xC) == 4: # two ticks delay moving_torch = (2,0) static_torch = (-3,3) elif (data & 0xC) == 8: # three ticks delay moving_torch = (3,0) static_torch = (-3,3) elif (data & 0xC) == 12: # four ticks delay moving_torch = (4,-1) static_torch = (-3,3) # this paste order it's ok for east and south orientation # but it's wrong for north and west orientations. But using the # default texture pack the torches are small enough to no overlap. alpha_over(img, torch, static_torch, torch) alpha_over(img, torch, moving_torch, torch) return img # redstone comparator (149 is inactive, 150 is active) @material(blockid=[149,150], data=list(range(16)), transparent=True, nospawn=True) def comparator(self, blockid, data): # rotation # add self.rotation to the lower 2 bits, mod 4 data = data & 0b1100 | (((data & 0b11) + self.rotation) % 4) top = self.load_image_texture("assets/minecraft/textures/block/comparator.png") if blockid == 149 else self.load_image_texture("assets/minecraft/textures/block/comparator_on.png") side = self.load_image_texture("assets/minecraft/textures/block/smooth_stone_slab_side.png") increment = 13 if (data & 0x3) == 0: # pointing north pass static_torch = (-3,-1) torch = ((0,2),(6,-1)) if (data & 0x3) == 1: # pointing east top = top.rotate(270) static_torch = (5,-1) torch = ((-4,-1),(0,2)) if (data & 0x3) == 2: # pointing south top = top.rotate(180) static_torch = (5,3) torch = ((0,-4),(-4,-1)) if (data & 0x3) == 3: # pointing west top = top.rotate(90) static_torch = (-3,3) torch = ((1,-4),(6,-1)) def build_torch(active): # compose a "3d" redstone torch t = self.load_image_texture("assets/minecraft/textures/block/redstone_torch_off.png").copy() if not active else self.load_image_texture("assets/minecraft/textures/block/redstone_torch.png").copy() torch = Image.new("RGBA", (24,24), self.bgcolor) t_crop = t.crop((2,2,14,14)) slice = t_crop.copy() ImageDraw.Draw(slice).rectangle((6,0,12,12),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(slice).rectangle((0,0,4,12),outline=(0,0,0,0),fill=(0,0,0,0)) alpha_over(torch, slice, (6,4)) alpha_over(torch, t_crop, (5,5)) alpha_over(torch, t_crop, (6,5)) alpha_over(torch, slice, (6,6)) return torch active_torch = build_torch(True) inactive_torch = build_torch(False) back_torch = active_torch if (blockid == 150 or data & 0b1000 == 0b1000) else inactive_torch static_torch_img = active_torch if (data & 0b100 == 0b100) else inactive_torch img = self.build_full_block( (top, increment), None, None, side, side) alpha_over(img, static_torch_img, static_torch, static_torch_img) alpha_over(img, back_torch, torch[0], back_torch) alpha_over(img, back_torch, torch[1], back_torch) return img # trapdoor # the trapdoor is looks like a sprite when opened, that's not good @material(blockid=[96,167,11332,11333,11334,11335,11336,12501,12502], data=list(range(16)), transparent=True, nospawn=True) def trapdoor(self, blockid, data): # rotation # Masked to not clobber opened/closed info if self.rotation == 1: if (data & 0b0011) == 0: data = data & 0b1100 | 3 elif (data & 0b0011) == 1: data = data & 0b1100 | 2 elif (data & 0b0011) == 2: data = data & 0b1100 | 0 elif (data & 0b0011) == 3: data = data & 0b1100 | 1 elif self.rotation == 2: if (data & 0b0011) == 0: data = data & 0b1100 | 1 elif (data & 0b0011) == 1: data = data & 0b1100 | 0 elif (data & 0b0011) == 2: data = data & 0b1100 | 3 elif (data & 0b0011) == 3: data = data & 0b1100 | 2 elif self.rotation == 3: if (data & 0b0011) == 0: data = data & 0b1100 | 2 elif (data & 0b0011) == 1: data = data & 0b1100 | 3 elif (data & 0b0011) == 2: data = data & 0b1100 | 1 elif (data & 0b0011) == 3: data = data & 0b1100 | 0 # texture generation texturepath = {96:"assets/minecraft/textures/block/oak_trapdoor.png", 167:"assets/minecraft/textures/block/iron_trapdoor.png", 11332:"assets/minecraft/textures/block/spruce_trapdoor.png", 11333:"assets/minecraft/textures/block/birch_trapdoor.png", 11334:"assets/minecraft/textures/block/jungle_trapdoor.png", 11335:"assets/minecraft/textures/block/acacia_trapdoor.png", 11336:"assets/minecraft/textures/block/dark_oak_trapdoor.png", 12501:"assets/minecraft/textures/block/crimson_trapdoor.png", 12502:"assets/minecraft/textures/block/warped_trapdoor.png", }[blockid] if data & 0x4 == 0x4: # opened trapdoor if data & 0x08 == 0x08: texture = self.load_image_texture(texturepath).transpose(Image.FLIP_TOP_BOTTOM) else: texture = self.load_image_texture(texturepath) if data & 0x3 == 0: # west img = self.build_full_block(None, None, None, None, texture) if data & 0x3 == 1: # east img = self.build_full_block(None, texture, None, None, None) if data & 0x3 == 2: # south img = self.build_full_block(None, None, texture, None, None) if data & 0x3 == 3: # north img = self.build_full_block(None, None, None, texture, None) elif data & 0x4 == 0: # closed trapdoor texture = self.load_image_texture(texturepath) if data & 0x8 == 0x8: # is a top trapdoor img = Image.new("RGBA", (24,24), self.bgcolor) t = self.build_full_block((texture, 12), None, None, texture, texture) alpha_over(img, t, (0,-9),t) else: # is a bottom trapdoor img = self.build_full_block((texture, 12), None, None, texture, texture) return img # block with hidden silverfish (stone, cobblestone and stone brick) @material(blockid=97, data=list(range(3)), solid=True) def hidden_silverfish(self, blockid, data): if data == 0: # stone t = self.load_image_texture("assets/minecraft/textures/block/stone.png") elif data == 1: # cobblestone t = self.load_image_texture("assets/minecraft/textures/block/cobblestone.png") elif data == 2: # stone brick t = self.load_image_texture("assets/minecraft/textures/block/stone_bricks.png") img = self.build_block(t, t) return img # stone brick @material(blockid=98, data=list(range(4)), solid=True) def stone_brick(self, blockid, data): if data == 0: # normal t = self.load_image_texture("assets/minecraft/textures/block/stone_bricks.png") elif data == 1: # mossy t = self.load_image_texture("assets/minecraft/textures/block/mossy_stone_bricks.png") elif data == 2: # cracked t = self.load_image_texture("assets/minecraft/textures/block/cracked_stone_bricks.png") elif data == 3: # "circle" stone brick t = self.load_image_texture("assets/minecraft/textures/block/chiseled_stone_bricks.png") img = self.build_full_block(t, None, None, t, t) return img # huge brown/red mushrooms, and mushroom stems @material(blockid=[99, 100, 139], data=list(range(64)), solid=True) def huge_mushroom(self, blockid, data): # Re-arrange the bits in data based on self.rotation # rotation bit: 654321 # 0 DUENWS # 1 DUNWSE # 2 DUWSEN # 3 DUSENW if self.rotation in [1, 2, 3]: bit_map = {1: [6, 5, 3, 2, 1, 4], 2: [6, 5, 2, 1, 4, 3], 3: [6, 5, 1, 4, 3, 2]} new_data = 0 # Add the ith bit to new_data then shift left one at a time, # re-ordering data's bits in the order specified in bit_map for i in bit_map[self.rotation]: new_data = new_data << 1 new_data |= (data >> (i - 1)) & 1 data = new_data # texture generation texture_map = {99: "brown_mushroom_block", 100: "red_mushroom_block", 139: "mushroom_stem"} cap = self.load_image_texture("assets/minecraft/textures/block/%s.png" % texture_map[blockid]) porous = self.load_image_texture("assets/minecraft/textures/block/mushroom_block_inside.png") # Faces visible after amending data for rotation are: up, West, and South side_up = cap if data & 0b010000 else porous # Up side_west = cap if data & 0b000010 else porous # West side_south = cap if data & 0b000001 else porous # South side_south = side_south.transpose(Image.FLIP_LEFT_RIGHT) return self.build_full_block(side_up, None, None, side_west, side_south) # iron bars and glass pane # TODO glass pane is not a sprite, it has a texture for the side, # at the moment is not used @material(blockid=[101,102, 160], data=list(range(256)), transparent=True, nospawn=True) def panes(self, blockid, data): # no rotation, uses pseudo data if blockid == 101: # iron bars t = self.load_image_texture("assets/minecraft/textures/block/iron_bars.png") elif blockid == 160: t = self.load_image_texture("assets/minecraft/textures/block/%s_stained_glass.png" % color_map[data & 0xf]) else: # glass panes t = self.load_image_texture("assets/minecraft/textures/block/glass.png") left = t.copy() right = t.copy() center = t.copy() # generate the four small pieces of the glass pane ImageDraw.Draw(right).rectangle((0,0,7,15),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(left).rectangle((8,0,15,15),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(center).rectangle((0,0,6,15),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(center).rectangle((9,0,15,15),outline=(0,0,0,0),fill=(0,0,0,0)) up_center = self.transform_image_side(center) up_left = self.transform_image_side(left) up_right = self.transform_image_side(right).transpose(Image.FLIP_TOP_BOTTOM) dw_right = self.transform_image_side(right) dw_left = self.transform_image_side(left).transpose(Image.FLIP_TOP_BOTTOM) # Create img to compose the texture img = Image.new("RGBA", (24,24), self.bgcolor) # +x axis points top right direction # +y axis points bottom right direction # First compose things in the back of the image, # then things in the front. # the lower 4 bits encode color, the upper 4 encode adjencies data = data >> 4 if data == 0: alpha_over(img, up_center, (6, 3), up_center) # center else: def draw_top_left(): alpha_over(img, up_left, (6, 3), up_left) # top left def draw_top_right(): alpha_over(img, up_right, (6, 3), up_right) # top right def draw_bottom_right(): alpha_over(img, dw_right, (6, 3), dw_right) # bottom right def draw_bottom_left(): alpha_over(img, dw_left, (6, 3), dw_left) # bottom left draw_funcs = [draw_top_left, draw_top_right, draw_bottom_right, draw_bottom_left] if (data & 0b0001) == 1: draw_funcs[(self.rotation + 0) % len(draw_funcs)]() if (data & 0b0010) == 2: draw_funcs[(self.rotation + 1) % len(draw_funcs)]() if (data & 0b0100) == 4: draw_funcs[(self.rotation + 2) % len(draw_funcs)]() if (data & 0b1000) == 8: draw_funcs[(self.rotation + 3) % len(draw_funcs)]() return img # melon block(blockid=103, top_image="assets/minecraft/textures/block/melon_top.png", side_image="assets/minecraft/textures/block/melon_side.png", solid=True) # pumpkin and melon stem # TODO To render it as in game needs from pseudo data and ancil data: # once fully grown the stem bends to the melon/pumpkin block, # at the moment only render the growing stem @material(blockid=[104,105], data=list(range(8)), transparent=True) def stem(self, blockid, data): # the ancildata value indicates how much of the texture # is shown. # not fully grown stem or no pumpkin/melon touching it, # straight up stem t = self.load_image_texture("assets/minecraft/textures/block/melon_stem.png").copy() img = Image.new("RGBA", (16,16), self.bgcolor) alpha_over(img, t, (0, int(16 - 16*((data + 1)/8.))), t) img = self.build_sprite(t) if data & 7 == 7: # fully grown stem gets brown color! # there is a conditional in rendermode-normal.c to not # tint the data value 7 img = self.tint_texture(img, (211,169,116)) return img # nether vines billboard(blockid=1012, imagename="assets/minecraft/textures/block/twisting_vines.png") billboard(blockid=1013, imagename="assets/minecraft/textures/block/twisting_vines_plant.png") billboard(blockid=1014, imagename="assets/minecraft/textures/block/weeping_vines.png") billboard(blockid=1015, imagename="assets/minecraft/textures/block/weeping_vines_plant.png") # vines @material(blockid=106, data=list(range(32)), transparent=True, solid=False, nospawn=True) def vines(self, blockid, data): # Re-arrange the bits in data based on self.rotation # rotation bit: 54321 # 0 UENWS # 1 UNWSE # 2 UWSEN # 3 USENW if self.rotation in [1, 2, 3]: bit_map = {1: [5, 3, 2, 1, 4], 2: [5, 2, 1, 4, 3], 3: [5, 1, 4, 3, 2]} new_data = 0 # Add the ith bit to new_data then shift left one at a time, # re-ordering data's bits in the order specified in bit_map for i in bit_map[self.rotation]: new_data = new_data << 1 new_data |= (data >> (i - 1)) & 1 data = new_data # decode data and prepare textures raw_texture = self.load_image_texture("assets/minecraft/textures/block/vine.png") side_up = raw_texture if data & 0b10000 else None # Up side_east = raw_texture if data & 0b01000 else None # East side_north = raw_texture if data & 0b00100 else None # North side_west = raw_texture if data & 0b00010 else None # West side_south = raw_texture if data & 0b00001 else None # South return self.build_full_block(side_up, side_north, side_east, side_west, side_south) # fence gates @material(blockid=[107, 183, 184, 185, 186, 187, 513, 514], data=list(range(8)), transparent=True, nospawn=True) def fence_gate(self, blockid, data): # rotation opened = False if data & 0x4: data = data & 0x3 opened = True if self.rotation == 1: if data == 0: data = 1 elif data == 1: data = 2 elif data == 2: data = 3 elif data == 3: data = 0 elif self.rotation == 2: if data == 0: data = 2 elif data == 1: data = 3 elif data == 2: data = 0 elif data == 3: data = 1 elif self.rotation == 3: if data == 0: data = 3 elif data == 1: data = 0 elif data == 2: data = 1 elif data == 3: data = 2 if opened: data = data | 0x4 # create the closed gate side if blockid == 107: # Oak gate_side = self.load_image_texture("assets/minecraft/textures/block/oak_planks.png").copy() elif blockid == 183: # Spruce gate_side = self.load_image_texture("assets/minecraft/textures/block/spruce_planks.png").copy() elif blockid == 184: # Birch gate_side = self.load_image_texture("assets/minecraft/textures/block/birch_planks.png").copy() elif blockid == 185: # Jungle gate_side = self.load_image_texture("assets/minecraft/textures/block/jungle_planks.png").copy() elif blockid == 186: # Dark Oak gate_side = self.load_image_texture("assets/minecraft/textures/block/dark_oak_planks.png").copy() elif blockid == 187: # Acacia gate_side = self.load_image_texture("assets/minecraft/textures/block/acacia_planks.png").copy() elif blockid == 513: # Crimson gate_side = self.load_image_texture("assets/minecraft/textures/block/crimson_planks.png").copy() elif blockid == 514: # Warped gate_side = self.load_image_texture("assets/minecraft/textures/block/warped_planks.png").copy() else: return None gate_side_draw = ImageDraw.Draw(gate_side) gate_side_draw.rectangle((7,0,15,0),outline=(0,0,0,0),fill=(0,0,0,0)) gate_side_draw.rectangle((7,4,9,6),outline=(0,0,0,0),fill=(0,0,0,0)) gate_side_draw.rectangle((7,10,15,16),outline=(0,0,0,0),fill=(0,0,0,0)) gate_side_draw.rectangle((0,12,15,16),outline=(0,0,0,0),fill=(0,0,0,0)) gate_side_draw.rectangle((0,0,4,15),outline=(0,0,0,0),fill=(0,0,0,0)) gate_side_draw.rectangle((14,0,15,15),outline=(0,0,0,0),fill=(0,0,0,0)) # darken the sides slightly, as with the fences sidealpha = gate_side.split()[3] gate_side = ImageEnhance.Brightness(gate_side).enhance(0.9) gate_side.putalpha(sidealpha) # create the other sides mirror_gate_side = self.transform_image_side(gate_side.transpose(Image.FLIP_LEFT_RIGHT)) gate_side = self.transform_image_side(gate_side) gate_other_side = gate_side.transpose(Image.FLIP_LEFT_RIGHT) mirror_gate_other_side = mirror_gate_side.transpose(Image.FLIP_LEFT_RIGHT) # Create img to compose the fence gate img = Image.new("RGBA", (24,24), self.bgcolor) if data & 0x4: # opened data = data & 0x3 if data == 0: alpha_over(img, gate_side, (2,8), gate_side) alpha_over(img, gate_side, (13,3), gate_side) elif data == 1: alpha_over(img, gate_other_side, (-1,3), gate_other_side) alpha_over(img, gate_other_side, (10,8), gate_other_side) elif data == 2: alpha_over(img, mirror_gate_side, (-1,7), mirror_gate_side) alpha_over(img, mirror_gate_side, (10,2), mirror_gate_side) elif data == 3: alpha_over(img, mirror_gate_other_side, (2,1), mirror_gate_other_side) alpha_over(img, mirror_gate_other_side, (13,7), mirror_gate_other_side) else: # closed # positions for pasting the fence sides, as with fences pos_top_left = (2,3) pos_top_right = (10,3) pos_bottom_right = (10,7) pos_bottom_left = (2,7) if data == 0 or data == 2: alpha_over(img, gate_other_side, pos_top_right, gate_other_side) alpha_over(img, mirror_gate_other_side, pos_bottom_left, mirror_gate_other_side) elif data == 1 or data == 3: alpha_over(img, gate_side, pos_top_left, gate_side) alpha_over(img, mirror_gate_side, pos_bottom_right, mirror_gate_side) return img # mycelium block(blockid=110, top_image="assets/minecraft/textures/block/mycelium_top.png", side_image="assets/minecraft/textures/block/mycelium_side.png") # warped_nylium & crimson_nylium block(blockid=1006, top_image="assets/minecraft/textures/block/warped_nylium.png", side_image="assets/minecraft/textures/block/warped_nylium_side.png") block(blockid=1007, top_image="assets/minecraft/textures/block/crimson_nylium.png", side_image="assets/minecraft/textures/block/crimson_nylium_side.png") # lilypad # At the moment of writing this lilypads has no ancil data and their # orientation depends on their position on the map. So it uses pseudo # ancildata. @material(blockid=111, data=list(range(4)), transparent=True) def lilypad(self, blockid, data): t = self.load_image_texture("assets/minecraft/textures/block/lily_pad.png").copy() if data == 0: t = t.rotate(180) elif data == 1: t = t.rotate(270) elif data == 2: t = t elif data == 3: t = t.rotate(90) return self.build_full_block(None, None, None, None, None, t) # nether bricks @material(blockid=112, data=list(range(3)), solid=True) def nether_bricks(self, blockid, data): if data == 0: # normal t = self.load_image_texture("assets/minecraft/textures/block/nether_bricks.png") elif data == 1: # cracked t = self.load_image_texture("assets/minecraft/textures/block/cracked_nether_bricks.png") elif data == 2: # chiseled t = self.load_image_texture("assets/minecraft/textures/block/chiseled_nether_bricks.png") img = self.build_full_block(t, None, None, t, t) return img # nether wart @material(blockid=115, data=list(range(4)), transparent=True) def nether_wart(self, blockid, data): if data == 0: # just come up t = self.load_image_texture("assets/minecraft/textures/block/nether_wart_stage0.png") elif data in (1, 2): t = self.load_image_texture("assets/minecraft/textures/block/nether_wart_stage1.png") else: # fully grown t = self.load_image_texture("assets/minecraft/textures/block/nether_wart_stage2.png") # use the same technic as tall grass img = self.build_billboard(t) return img # enchantment table # TODO there's no book at the moment @material(blockid=116, transparent=True, nodata=True) def enchantment_table(self, blockid, data): # no book at the moment top = self.load_image_texture("assets/minecraft/textures/block/enchanting_table_top.png") side = self.load_image_texture("assets/minecraft/textures/block/enchanting_table_side.png") img = self.build_full_block((top, 4), None, None, side, side) return img # brewing stand # TODO this is a place holder, is a 2d image pasted @material(blockid=117, data=list(range(5)), transparent=True) def brewing_stand(self, blockid, data): base = self.load_image_texture("assets/minecraft/textures/block/brewing_stand_base.png") img = self.build_full_block(None, None, None, None, None, base) t = self.load_image_texture("assets/minecraft/textures/block/brewing_stand.png") stand = self.build_billboard(t) alpha_over(img,stand,(0,-2)) return img # cauldron @material(blockid=118, data=list(range(16)), transparent=True, solid=True, nospawn=True) def cauldron(self, blockid, data): side = self.load_image_texture("assets/minecraft/textures/block/cauldron_side.png").copy() top = self.load_image_texture("assets/minecraft/textures/block/cauldron_top.png") filltype = (data & (3 << 2)) >> 2 if filltype == 3: water = self.transform_image_top(self.load_image_texture("assets/minecraft/textures/block/powder_snow.png")) elif filltype == 2: water = self.transform_image_top(self.load_image_texture("assets/minecraft/textures/block/lava_still.png")) else: # filltype == 1 or 0 water = self.transform_image_top(self.load_image_texture("water.png")) # Side texture isn't transparent between the feet, so adjust the texture ImageDraw.Draw(side).rectangle((5, 14, 11, 16), outline=(0, 0, 0, 0), fill=(0, 0, 0, 0)) level = (data & 3) if level == 0: # Empty img = self.build_full_block(top, side, side, side, side) else: # Part or fully filled # Is filled in increments of a third, with level indicating how many thirds are filled img = self.build_full_block(None, side, side, None, None) alpha_over(img, water, (0, 12 - level * 4), water) img2 = self.build_full_block(top, None, None, side, side) alpha_over(img, img2, (0, 0), img2) return img # end portal and end_gateway @material(blockid=[119,209], transparent=True, nodata=True) def end_portal(self, blockid, data): img = Image.new("RGBA", (24,24), self.bgcolor) # generate a black texure with white, blue and grey dots resembling stars t = Image.new("RGBA", (16,16), (0,0,0,255)) for color in [(155,155,155,255), (100,255,100,255), (255,255,255,255)]: for i in range(6): x = randint(0,15) y = randint(0,15) t.putpixel((x,y),color) if blockid == 209: # end_gateway return self.build_block(t, t) t = self.transform_image_top(t) alpha_over(img, t, (0,0), t) return img # end portal frame (data range 8 to get all orientations of filled) @material(blockid=120, data=list(range(8)), transparent=True, solid=True, nospawn=True) def end_portal_frame(self, blockid, data): # Do rotation, only seems to affect ender eye & top of frame data = data & 0b100 | ((self.rotation + (data & 0b11)) % 4) top = self.load_image_texture("assets/minecraft/textures/block/end_portal_frame_top.png").copy() top = top.rotate((data % 4) * 90) side = self.load_image_texture("assets/minecraft/textures/block/end_portal_frame_side.png") img = self.build_full_block((top, 4), None, None, side, side) if data & 0x4 == 0x4: # ender eye on it # generate the eye eye_t = self.load_image_texture("assets/minecraft/textures/block/end_portal_frame_eye.png").copy() eye_t_s = eye_t.copy() # cut out from the texture the side and the top of the eye ImageDraw.Draw(eye_t).rectangle((0, 0, 15, 4), outline=(0, 0, 0, 0), fill=(0, 0, 0, 0)) ImageDraw.Draw(eye_t_s).rectangle((0, 4, 15, 15), outline=(0, 0, 0, 0), fill=(0, 0, 0, 0)) # transform images and paste eye = self.transform_image_top(eye_t.rotate((data % 4) * 90)) eye_s = self.transform_image_side(eye_t_s) eye_os = eye_s.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, eye_s, (5, 5), eye_s) alpha_over(img, eye_os, (9, 5), eye_os) alpha_over(img, eye, (0, 0), eye) return img # end stone block(blockid=121, top_image="assets/minecraft/textures/block/end_stone.png") # dragon egg # NOTE: this isn't a block, but I think it's better than nothing block(blockid=122, top_image="assets/minecraft/textures/block/dragon_egg.png") # inactive redstone lamp block(blockid=123, top_image="assets/minecraft/textures/block/redstone_lamp.png") # active redstone lamp block(blockid=124, top_image="assets/minecraft/textures/block/redstone_lamp_on.png") # daylight sensor. @material(blockid=[151,178], transparent=True) def daylight_sensor(self, blockid, data): if blockid == 151: # daylight sensor top = self.load_image_texture("assets/minecraft/textures/block/daylight_detector_top.png") else: # inverted daylight sensor top = self.load_image_texture("assets/minecraft/textures/block/daylight_detector_inverted_top.png") side = self.load_image_texture("assets/minecraft/textures/block/daylight_detector_side.png") # cut the side texture in half mask = side.crop((0,8,16,16)) side = Image.new(side.mode, side.size, self.bgcolor) alpha_over(side, mask,(0,0,16,8), mask) # plain slab top = self.transform_image_top(top) side = self.transform_image_side(side) otherside = side.transpose(Image.FLIP_LEFT_RIGHT) sidealpha = side.split()[3] side = ImageEnhance.Brightness(side).enhance(0.9) side.putalpha(sidealpha) othersidealpha = otherside.split()[3] otherside = ImageEnhance.Brightness(otherside).enhance(0.8) otherside.putalpha(othersidealpha) img = Image.new("RGBA", (24,24), self.bgcolor) alpha_over(img, side, (0,12), side) alpha_over(img, otherside, (12,12), otherside) alpha_over(img, top, (0,6), top) return img # wooden double and normal slabs # these are the new wooden slabs, blockids 43 44 still have wooden # slabs, but those are unobtainable without cheating @material(blockid=[125, 126], data=list(range(16)), transparent=(44,), solid=True) def wooden_slabs(self, blockid, data): texture = data & 7 if texture== 0: # oak top = side = self.load_image_texture("assets/minecraft/textures/block/oak_planks.png") elif texture== 1: # spruce top = side = self.load_image_texture("assets/minecraft/textures/block/spruce_planks.png") elif texture== 2: # birch top = side = self.load_image_texture("assets/minecraft/textures/block/birch_planks.png") elif texture== 3: # jungle top = side = self.load_image_texture("assets/minecraft/textures/block/jungle_planks.png") elif texture== 4: # acacia top = side = self.load_image_texture("assets/minecraft/textures/block/acacia_planks.png") elif texture== 5: # dark wood top = side = self.load_image_texture("assets/minecraft/textures/block/dark_oak_planks.png") elif texture== 6: # crimson top = side = self.load_image_texture("assets/minecraft/textures/block/crimson_planks.png") elif texture== 7: # warped top = side = self.load_image_texture("assets/minecraft/textures/block/warped_planks.png") else: return None if blockid == 125: # double slab return self.build_block(top, side) return self.build_slab_block(top, side, data & 8 == 8); # emerald ore block(blockid=129, top_image="assets/minecraft/textures/block/emerald_ore.png") # emerald block block(blockid=133, top_image="assets/minecraft/textures/block/emerald_block.png") # cocoa plant @material(blockid=127, data=list(range(12)), transparent=True) def cocoa_plant(self, blockid, data): orientation = data & 3 # rotation if self.rotation == 1: if orientation == 0: orientation = 1 elif orientation == 1: orientation = 2 elif orientation == 2: orientation = 3 elif orientation == 3: orientation = 0 elif self.rotation == 2: if orientation == 0: orientation = 2 elif orientation == 1: orientation = 3 elif orientation == 2: orientation = 0 elif orientation == 3: orientation = 1 elif self.rotation == 3: if orientation == 0: orientation = 3 elif orientation == 1: orientation = 0 elif orientation == 2: orientation = 1 elif orientation == 3: orientation = 2 size = data & 12 if size == 8: # big t = self.load_image_texture("assets/minecraft/textures/block/cocoa_stage2.png") c_left = (0,3) c_right = (8,3) c_top = (5,2) elif size == 4: # normal t = self.load_image_texture("assets/minecraft/textures/block/cocoa_stage1.png") c_left = (-2,2) c_right = (8,2) c_top = (5,2) elif size == 0: # small t = self.load_image_texture("assets/minecraft/textures/block/cocoa_stage0.png") c_left = (-3,2) c_right = (6,2) c_top = (5,2) # let's get every texture piece necessary to do this stalk = t.copy() ImageDraw.Draw(stalk).rectangle((0,0,11,16),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(stalk).rectangle((12,4,16,16),outline=(0,0,0,0),fill=(0,0,0,0)) top = t.copy() # warning! changes with plant size ImageDraw.Draw(top).rectangle((0,7,16,16),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(top).rectangle((7,0,16,6),outline=(0,0,0,0),fill=(0,0,0,0)) side = t.copy() # warning! changes with plant size ImageDraw.Draw(side).rectangle((0,0,6,16),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(side).rectangle((0,0,16,3),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(side).rectangle((0,14,16,16),outline=(0,0,0,0),fill=(0,0,0,0)) # first compose the block of the cocoa plant block = Image.new("RGBA", (24,24), self.bgcolor) tmp = self.transform_image_side(side).transpose(Image.FLIP_LEFT_RIGHT) alpha_over (block, tmp, c_right,tmp) # right side tmp = tmp.transpose(Image.FLIP_LEFT_RIGHT) alpha_over (block, tmp, c_left,tmp) # left side tmp = self.transform_image_top(top) alpha_over(block, tmp, c_top,tmp) if size == 0: # fix a pixel hole block.putpixel((6,9), block.getpixel((6,10))) # compose the cocoa plant img = Image.new("RGBA", (24,24), self.bgcolor) if orientation in (2,3): # south and west tmp = self.transform_image_side(stalk).transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, block,(-1,-2), block) alpha_over(img, tmp, (4,-2), tmp) if orientation == 3: img = img.transpose(Image.FLIP_LEFT_RIGHT) elif orientation in (0,1): # north and east tmp = self.transform_image_side(stalk.transpose(Image.FLIP_LEFT_RIGHT)) alpha_over(img, block,(-1,5), block) alpha_over(img, tmp, (2,12), tmp) if orientation == 0: img = img.transpose(Image.FLIP_LEFT_RIGHT) return img # command block @material(blockid=[137,210,211], solid=True, nodata=True) def command_block(self, blockid, data): if blockid == 210: front = self.load_image_texture("assets/minecraft/textures/block/repeating_command_block_front.png") side = self.load_image_texture("assets/minecraft/textures/block/repeating_command_block_side.png") back = self.load_image_texture("assets/minecraft/textures/block/repeating_command_block_back.png") elif blockid == 211: front = self.load_image_texture("assets/minecraft/textures/block/chain_command_block_front.png") side = self.load_image_texture("assets/minecraft/textures/block/chain_command_block_side.png") back = self.load_image_texture("assets/minecraft/textures/block/chain_command_block_back.png") else: front = self.load_image_texture("assets/minecraft/textures/block/command_block_front.png") side = self.load_image_texture("assets/minecraft/textures/block/command_block_side.png") back = self.load_image_texture("assets/minecraft/textures/block/command_block_back.png") return self.build_full_block(side, side, back, front, side) # beacon block # at the moment of writing this, it seems the beacon block doens't use # the data values @material(blockid=138, transparent=True, nodata = True) def beacon(self, blockid, data): # generate the three pieces of the block t = self.load_image_texture("assets/minecraft/textures/block/glass.png") glass = self.build_block(t,t) t = self.load_image_texture("assets/minecraft/textures/block/obsidian.png") obsidian = self.build_full_block((t,12),None, None, t, t) obsidian = obsidian.resize((20,20), Image.ANTIALIAS) t = self.load_image_texture("assets/minecraft/textures/block/beacon.png") crystal = self.build_block(t,t) crystal = crystal.resize((16,16),Image.ANTIALIAS) # compose the block img = Image.new("RGBA", (24,24), self.bgcolor) alpha_over(img, obsidian, (2, 4), obsidian) alpha_over(img, crystal, (4,3), crystal) alpha_over(img, glass, (0,0), glass) return img # cobblestone and mossy cobblestone walls, chorus plants, mossy stone brick walls # one additional bit of data value added for mossy and cobblestone @material(blockid=[199]+list(range(1792, 1812 + 1)), data=list(range(32)), transparent=True, nospawn=True) def cobblestone_wall(self, blockid, data): walls_id_to_tex = { 199: "assets/minecraft/textures/block/chorus_plant.png", # chorus plants 1792: "assets/minecraft/textures/block/andesite.png", 1793: "assets/minecraft/textures/block/bricks.png", 1794: "assets/minecraft/textures/block/cobblestone.png", 1795: "assets/minecraft/textures/block/diorite.png", 1796: "assets/minecraft/textures/block/end_stone_bricks.png", 1797: "assets/minecraft/textures/block/granite.png", 1798: "assets/minecraft/textures/block/mossy_cobblestone.png", 1799: "assets/minecraft/textures/block/mossy_stone_bricks.png", 1800: "assets/minecraft/textures/block/nether_bricks.png", 1801: "assets/minecraft/textures/block/prismarine.png", 1802: "assets/minecraft/textures/block/red_nether_bricks.png", 1803: "assets/minecraft/textures/block/red_sandstone.png", 1804: "assets/minecraft/textures/block/sandstone.png", 1805: "assets/minecraft/textures/block/stone_bricks.png", 1806: "assets/minecraft/textures/block/blackstone.png", 1807: "assets/minecraft/textures/block/polished_blackstone.png", 1808: "assets/minecraft/textures/block/polished_blackstone_bricks.png", 1809: "assets/minecraft/textures/block/cobbled_deepslate.png", 1810: "assets/minecraft/textures/block/polished_deepslate.png", 1811: "assets/minecraft/textures/block/deepslate_bricks.png", 1812: "assets/minecraft/textures/block/deepslate_tiles.png", } t = self.load_image_texture(walls_id_to_tex[blockid]).copy() wall_pole_top = t.copy() wall_pole_side = t.copy() wall_side_top = t.copy() wall_side = t.copy() # _full is used for walls without pole wall_side_top_full = t.copy() wall_side_full = t.copy() # generate the textures of the wall ImageDraw.Draw(wall_pole_top).rectangle((0,0,3,15),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(wall_pole_top).rectangle((12,0,15,15),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(wall_pole_top).rectangle((0,0,15,3),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(wall_pole_top).rectangle((0,12,15,15),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(wall_pole_side).rectangle((0,0,3,15),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(wall_pole_side).rectangle((12,0,15,15),outline=(0,0,0,0),fill=(0,0,0,0)) # Create the sides and the top of the pole wall_pole_side = self.transform_image_side(wall_pole_side) wall_pole_other_side = wall_pole_side.transpose(Image.FLIP_LEFT_RIGHT) wall_pole_top = self.transform_image_top(wall_pole_top) # Darken the sides slightly. These methods also affect the alpha layer, # so save them first (we don't want to "darken" the alpha layer making # the block transparent) sidealpha = wall_pole_side.split()[3] wall_pole_side = ImageEnhance.Brightness(wall_pole_side).enhance(0.8) wall_pole_side.putalpha(sidealpha) othersidealpha = wall_pole_other_side.split()[3] wall_pole_other_side = ImageEnhance.Brightness(wall_pole_other_side).enhance(0.7) wall_pole_other_side.putalpha(othersidealpha) # Compose the wall pole wall_pole = Image.new("RGBA", (24,24), self.bgcolor) alpha_over(wall_pole,wall_pole_side, (3,4),wall_pole_side) alpha_over(wall_pole,wall_pole_other_side, (9,4),wall_pole_other_side) alpha_over(wall_pole,wall_pole_top, (0,0),wall_pole_top) # create the sides and the top of a wall attached to a pole ImageDraw.Draw(wall_side).rectangle((0,0,15,2),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(wall_side).rectangle((0,0,11,15),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(wall_side_top).rectangle((0,0,11,15),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(wall_side_top).rectangle((0,0,15,4),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(wall_side_top).rectangle((0,11,15,15),outline=(0,0,0,0),fill=(0,0,0,0)) # full version, without pole ImageDraw.Draw(wall_side_full).rectangle((0,0,15,2),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(wall_side_top_full).rectangle((0,4,15,15),outline=(0,0,0,0),fill=(0,0,0,0)) ImageDraw.Draw(wall_side_top_full).rectangle((0,4,15,15),outline=(0,0,0,0),fill=(0,0,0,0)) # compose the sides of a wall atached to a pole tmp = Image.new("RGBA", (24,24), self.bgcolor) wall_side = self.transform_image_side(wall_side) wall_side_top = self.transform_image_top(wall_side_top) # Darken the sides slightly. These methods also affect the alpha layer, # so save them first (we don't want to "darken" the alpha layer making # the block transparent) sidealpha = wall_side.split()[3] wall_side = ImageEnhance.Brightness(wall_side).enhance(0.7) wall_side.putalpha(sidealpha) alpha_over(tmp,wall_side, (0,0),wall_side) alpha_over(tmp,wall_side_top, (-5,3),wall_side_top) wall_side = tmp wall_other_side = wall_side.transpose(Image.FLIP_LEFT_RIGHT) # compose the sides of the full wall tmp = Image.new("RGBA", (24,24), self.bgcolor) wall_side_full = self.transform_image_side(wall_side_full) wall_side_top_full = self.transform_image_top(wall_side_top_full.rotate(90)) # Darken the sides slightly. These methods also affect the alpha layer, # so save them first (we don't want to "darken" the alpha layer making # the block transparent) sidealpha = wall_side_full.split()[3] wall_side_full = ImageEnhance.Brightness(wall_side_full).enhance(0.7) wall_side_full.putalpha(sidealpha) alpha_over(tmp,wall_side_full, (4,0),wall_side_full) alpha_over(tmp,wall_side_top_full, (3,-4),wall_side_top_full) wall_side_full = tmp wall_other_side_full = wall_side_full.transpose(Image.FLIP_LEFT_RIGHT) # Create img to compose the wall img = Image.new("RGBA", (24,24), self.bgcolor) # Position wall imgs around the wall bit stick pos_top_left = (-5,-2) pos_bottom_left = (-8,4) pos_top_right = (5,-3) pos_bottom_right = (7,4) # +x axis points top right direction # +y axis points bottom right direction # There are two special cases for wall without pole. # Normal case: # First compose the walls in the back of the image, # then the pole and then the walls in the front. if (data == 0b1010) or (data == 0b11010): alpha_over(img, wall_other_side_full,(0,2), wall_other_side_full) elif (data == 0b0101) or (data == 0b10101): alpha_over(img, wall_side_full,(0,2), wall_side_full) else: if (data & 0b0001) == 1: alpha_over(img,wall_side, pos_top_left,wall_side) # top left if (data & 0b1000) == 8: alpha_over(img,wall_other_side, pos_top_right,wall_other_side) # top right alpha_over(img,wall_pole,(0,0),wall_pole) if (data & 0b0010) == 2: alpha_over(img,wall_other_side, pos_bottom_left,wall_other_side) # bottom left if (data & 0b0100) == 4: alpha_over(img,wall_side, pos_bottom_right,wall_side) # bottom right return img # carrots, potatoes @material(blockid=[141,142], data=list(range(8)), transparent=True, nospawn=True) def crops4(self, blockid, data): # carrots and potatoes have 8 data, but only 4 visual stages stage = {0:0, 1:0, 2:1, 3:1, 4:2, 5:2, 6:2, 7:3}[data] if blockid == 141: # carrots raw_crop = self.load_image_texture("assets/minecraft/textures/block/carrots_stage%d.png" % stage) else: # potatoes raw_crop = self.load_image_texture("assets/minecraft/textures/block/potatoes_stage%d.png" % stage) crop1 = self.transform_image_top(raw_crop) crop2 = self.transform_image_side(raw_crop) crop3 = crop2.transpose(Image.FLIP_LEFT_RIGHT) img = Image.new("RGBA", (24,24), self.bgcolor) alpha_over(img, crop1, (0,12), crop1) alpha_over(img, crop2, (6,3), crop2) alpha_over(img, crop3, (6,3), crop3) return img # anvils @material(blockid=145, data=list(range(12)), transparent=True, nospawn=True) def anvil(self, blockid, data): # anvils only have two orientations, invert it for rotations 1 and 3 orientation = data & 0x1 if self.rotation in (1, 3): if orientation == 1: orientation = 0 else: orientation = 1 # get the correct textures # the bits 0x4 and 0x8 determine how damaged is the anvil if (data & 0xc) == 0: # non damaged anvil top = self.load_image_texture("assets/minecraft/textures/block/anvil_top.png") elif (data & 0xc) == 0x4: # slightly damaged top = self.load_image_texture("assets/minecraft/textures/block/chipped_anvil_top.png") elif (data & 0xc) == 0x8: # very damaged top = self.load_image_texture("assets/minecraft/textures/block/damaged_anvil_top.png") # everything else use this texture big_side = self.load_image_texture("assets/minecraft/textures/block/anvil.png").copy() small_side = self.load_image_texture("assets/minecraft/textures/block/anvil.png").copy() base = self.load_image_texture("assets/minecraft/textures/block/anvil.png").copy() small_base = self.load_image_texture("assets/minecraft/textures/block/anvil.png").copy() # cut needed patterns ImageDraw.Draw(big_side).rectangle((0, 8, 15, 15), outline=(0, 0, 0, 0), fill=(0, 0, 0, 0)) ImageDraw.Draw(small_side).rectangle((0, 0, 2, 15), outline=(0, 0, 0, 0), fill=(0, 0, 0, 0)) ImageDraw.Draw(small_side).rectangle((13, 0, 15, 15), outline=(0, 0, 0, 0), fill=(0, 0, 0, 0)) ImageDraw.Draw(small_side).rectangle((0, 8, 15, 15), outline=(0, 0, 0, 0), fill=(0, 0, 0, 0)) ImageDraw.Draw(base).rectangle((0, 0, 15, 15), outline=(0, 0, 0, 0)) ImageDraw.Draw(base).rectangle((1, 1, 14, 14), outline=(0, 0, 0, 0)) ImageDraw.Draw(small_base).rectangle((0, 0, 15, 15), outline=(0, 0, 0, 0)) ImageDraw.Draw(small_base).rectangle((1, 1, 14, 14), outline=(0, 0, 0, 0)) ImageDraw.Draw(small_base).rectangle((2, 2, 13, 13), outline=(0, 0, 0, 0)) ImageDraw.Draw(small_base).rectangle((3, 3, 12, 12), outline=(0, 0, 0, 0)) # check orientation and compose the anvil if orientation == 1: # bottom-left top-right top = top.rotate(90) left_side = small_side left_pos = (1, 6) right_side = big_side right_pos = (10, 5) else: # top-left bottom-right right_side = small_side right_pos = (12, 6) left_side = big_side left_pos = (3, 5) img = Image.new("RGBA", (24, 24), self.bgcolor) # darken sides alpha = big_side.split()[3] big_side = ImageEnhance.Brightness(big_side).enhance(0.8) big_side.putalpha(alpha) alpha = small_side.split()[3] small_side = ImageEnhance.Brightness(small_side).enhance(0.9) small_side.putalpha(alpha) alpha = base.split()[3] base_d = ImageEnhance.Brightness(base).enhance(0.8) base_d.putalpha(alpha) # compose base = self.transform_image_top(base) base_d = self.transform_image_top(base_d) small_base = self.transform_image_top(small_base) top = self.transform_image_top(top) alpha_over(img, base_d, (0, 12), base_d) alpha_over(img, base_d, (0, 11), base_d) alpha_over(img, base_d, (0, 10), base_d) alpha_over(img, small_base, (0, 10), small_base) alpha_over(img, top, (0, 1), top) # Fix gap between block edges alpha_over(img, top, (0, 0), top) left_side = self.transform_image_side(left_side) right_side = self.transform_image_side(right_side).transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, left_side, left_pos, left_side) alpha_over(img, right_side, right_pos, right_side) return img # block of redstone block(blockid=152, top_image="assets/minecraft/textures/block/redstone_block.png") # nether quartz ore block(blockid=153, top_image="assets/minecraft/textures/block/nether_quartz_ore.png") # block of quartz @material(blockid=155, data=list(range(5)), solid=True) def quartz_block(self, blockid, data): if data in (0,1): # normal and chiseled quartz block if data == 0: top = self.load_image_texture("assets/minecraft/textures/block/quartz_block_top.png") side = self.load_image_texture("assets/minecraft/textures/block/quartz_block_side.png") else: top = self.load_image_texture("assets/minecraft/textures/block/chiseled_quartz_block_top.png") side = self.load_image_texture("assets/minecraft/textures/block/chiseled_quartz_block.png") return self.build_block(top, side) # pillar quartz block with orientation top = self.load_image_texture("assets/minecraft/textures/block/quartz_pillar_top.png") side = self.load_image_texture("assets/minecraft/textures/block/quartz_pillar.png").copy() if data == 2: # vertical return self.build_block(top, side) elif data == 3: # north-south oriented if self.rotation in (0,2): return self.build_full_block(side.rotate(90), None, None, top, side.rotate(90)) return self.build_full_block(side, None, None, side.rotate(90), top) elif data == 4: # east-west oriented if self.rotation in (0,2): return self.build_full_block(side, None, None, side.rotate(90), top) return self.build_full_block(side.rotate(90), None, None, top, side.rotate(90)) # hopper @material(blockid=154, data=list(range(4)), transparent=True) def hopper(self, blockid, data): #build the top side = self.load_image_texture("assets/minecraft/textures/block/hopper_outside.png") top = self.load_image_texture("assets/minecraft/textures/block/hopper_top.png") bottom = self.load_image_texture("assets/minecraft/textures/block/hopper_inside.png") hop_top = self.build_full_block((top,10), side, side, side, side, side) #build a solid block for mid/top hop_mid = self.build_full_block((top,5), side, side, side, side, side) hop_bot = self.build_block(side,side) hop_mid = hop_mid.resize((17,17),Image.ANTIALIAS) hop_bot = hop_bot.resize((10,10),Image.ANTIALIAS) #compose the final block img = Image.new("RGBA", (24,24), self.bgcolor) alpha_over(img, hop_bot, (7,14), hop_bot) alpha_over(img, hop_mid, (3,3), hop_mid) alpha_over(img, hop_top, (0,-6), hop_top) return img # slime block block(blockid=165, top_image="assets/minecraft/textures/block/slime_block.png") # prismarine block @material(blockid=168, data=list(range(3)), solid=True) def prismarine_block(self, blockid, data): if data == 0: # prismarine t = self.load_image_texture("assets/minecraft/textures/block/prismarine.png") elif data == 1: # prismarine bricks t = self.load_image_texture("assets/minecraft/textures/block/prismarine_bricks.png") elif data == 2: # dark prismarine t = self.load_image_texture("assets/minecraft/textures/block/dark_prismarine.png") img = self.build_block(t, t) return img # sea lantern block(blockid=169, top_image="assets/minecraft/textures/block/sea_lantern.png") # hay block @material(blockid=170, data=list(range(9)), solid=True) def hayblock(self, blockid, data): top = self.load_image_texture("assets/minecraft/textures/block/hay_block_top.png") side = self.load_image_texture("assets/minecraft/textures/block/hay_block_side.png") if self.rotation == 1: if data == 4: data = 8 elif data == 8: data = 4 elif self.rotation == 3: if data == 4: data = 8 elif data == 8: data = 4 # choose orientation and paste textures if data == 4: # east-west orientation return self.build_full_block(side.rotate(90), None, None, top, side.rotate(90)) elif data == 8: # north-south orientation return self.build_full_block(side, None, None, side.rotate(90), top) else: return self.build_block(top, side) # carpet - wool block that's small? @material(blockid=171, data=list(range(17)), transparent=True) def carpet(self, blockid, data): if data < 16: texture = self.load_image_texture("assets/minecraft/textures/block/%s_wool.png" % color_map[data]) elif data == 16: texture = self.load_image_texture("assets/minecraft/textures/block/moss_block.png") return self.build_full_block((texture,15),texture,texture,texture,texture) #clay block block(blockid=172, top_image="assets/minecraft/textures/block/terracotta.png") #stained hardened clay @material(blockid=159, data=list(range(16)), solid=True) def stained_clay(self, blockid, data): texture = self.load_image_texture("assets/minecraft/textures/block/%s_terracotta.png" % color_map[data]) return self.build_block(texture,texture) #coal block block(blockid=173, top_image="assets/minecraft/textures/block/coal_block.png") # packed ice block block(blockid=174, top_image="assets/minecraft/textures/block/packed_ice.png") #blue ice block(blockid=11312, top_image="assets/minecraft/textures/block/blue_ice.png") #smooth stones block(blockid=11313, top_image="assets/minecraft/textures/block/smooth_stone.png") # stone block(blockid=11314, top_image="assets/minecraft/textures/block/sandstone_top.png") # sandstone block(blockid=11315, top_image="assets/minecraft/textures/block/red_sandstone_top.png") # red sandstone #coral blocks block(blockid=11316, top_image="assets/minecraft/textures/block/brain_coral_block.png") block(blockid=11317, top_image="assets/minecraft/textures/block/bubble_coral_block.png") block(blockid=11318, top_image="assets/minecraft/textures/block/fire_coral_block.png") block(blockid=11319, top_image="assets/minecraft/textures/block/horn_coral_block.png") block(blockid=11320, top_image="assets/minecraft/textures/block/tube_coral_block.png") #dead coral blocks block(blockid=11321, top_image="assets/minecraft/textures/block/dead_brain_coral_block.png") block(blockid=11322, top_image="assets/minecraft/textures/block/dead_bubble_coral_block.png") block(blockid=11323, top_image="assets/minecraft/textures/block/dead_fire_coral_block.png") block(blockid=11324, top_image="assets/minecraft/textures/block/dead_horn_coral_block.png") block(blockid=11325, top_image="assets/minecraft/textures/block/dead_tube_coral_block.png") @material(blockid=175, data=list(range(16)), transparent=True) def flower(self, blockid, data): double_plant_map = ["sunflower", "lilac", "tall_grass", "large_fern", "rose_bush", "peony", "peony", "peony"] plant = double_plant_map[data & 0x7] if data & 0x8: part = "top" else: part = "bottom" png = "assets/minecraft/textures/block/%s_%s.png" % (plant,part) texture = self.load_image_texture(png) img = self.build_billboard(texture) #sunflower top if data == 8: bloom_tex = self.load_image_texture("assets/minecraft/textures/block/sunflower_front.png") alpha_over(img, bloom_tex.resize((14, 11), Image.ANTIALIAS), (5,5)) return img # chorus flower @material(blockid=200, data=list(range(6)), solid=True) def chorus_flower(self, blockid, data): # aged 5, dead if data == 5: texture = self.load_image_texture("assets/minecraft/textures/block/chorus_flower_dead.png") else: texture = self.load_image_texture("assets/minecraft/textures/block/chorus_flower.png") return self.build_block(texture,texture) # purpur block block(blockid=201, top_image="assets/minecraft/textures/block/purpur_block.png") # purpur pillar @material(blockid=202, data=list(range(3)), solid=True) def purpur_pillar(self, blockid, data): top=self.load_image_texture("assets/minecraft/textures/block/purpur_pillar_top.png") side=self.load_image_texture("assets/minecraft/textures/block/purpur_pillar.png") return self.build_axis_block(top, side, data) # end brick block(blockid=206, top_image="assets/minecraft/textures/block/end_stone_bricks.png") # frosted ice @material(blockid=212, data=list(range(4)), solid=True) def frosted_ice(self, blockid, data): img = self.load_image_texture("assets/minecraft/textures/block/frosted_ice_%d.png" % data) return self.build_block(img, img) # magma block block(blockid=213, top_image="assets/minecraft/textures/block/magma.png") # nether wart block block(blockid=214, top_image="assets/minecraft/textures/block/nether_wart_block.png") # warped wart block block(blockid=1010, top_image="assets/minecraft/textures/block/warped_wart_block.png") # red nether brick block(blockid=215, top_image="assets/minecraft/textures/block/red_nether_bricks.png") @material(blockid=216, data=list(range(12)), solid=True) def boneblock(self, blockid, data): # extract orientation boneblock_orientation = data & 12 if self.rotation == 1: if boneblock_orientation == 4: boneblock_orientation = 8 elif boneblock_orientation == 8: boneblock_orientation = 4 elif self.rotation == 3: if boneblock_orientation == 4: boneblock_orientation = 8 elif boneblock_orientation == 8: boneblock_orientation = 4 top = self.load_image_texture("assets/minecraft/textures/block/bone_block_top.png") side = self.load_image_texture("assets/minecraft/textures/block/bone_block_side.png") # choose orientation and paste textures if boneblock_orientation == 0: return self.build_block(top, side) elif boneblock_orientation == 4: # east-west orientation return self.build_full_block(side.rotate(90), None, None, top, side.rotate(90)) elif boneblock_orientation == 8: # north-south orientation return self.build_full_block(side, None, None, side.rotate(270), top) # observer @material(blockid=218, data=[0, 1, 2, 3, 4, 5, 8, 9, 10, 11, 12, 13], solid=True, nospawn=True) def observer(self, blockid, data): # Do rotation if self.rotation in [1, 2, 3] and (data & 0b111) in [2, 3, 4, 5]: rotation_map = {1: {2: 5, 3: 4, 4: 2, 5: 3}, 2: {2: 3, 3: 2, 4: 5, 5: 4}, 3: {2: 4, 3: 5, 4: 3, 5: 2}} data = (data & 0b1000) | rotation_map[self.rotation][data & 0b111] front = self.load_image_texture("assets/minecraft/textures/block/observer_front.png") side = self.load_image_texture("assets/minecraft/textures/block/observer_side.png") top = self.load_image_texture("assets/minecraft/textures/block/observer_top.png") file_name_back = "observer_back_on" if data & 0b1000 else "observer_back" back = self.load_image_texture("assets/minecraft/textures/block/%s.png" % file_name_back) if data & 0b0111 == 0: # Down img = self.build_full_block(back, None, None, side.rotate(90), top) elif data & 0b0111 == 1: # Up img = self.build_full_block(front.rotate(180), None, None, side.rotate(90), top.rotate(180)) elif data & 0b0111 == 2: # East img = self.build_full_block(top.rotate(180), None, None, side, back) elif data & 0b0111 == 3: # West img = self.build_full_block(top, None, None, side, front) elif data & 0b0111 == 4: # North img = self.build_full_block(top.rotate(270), None, None, front, side) elif data & 0b0111 == 5: # South img = self.build_full_block(top.rotate(90), None, None, back, side) return img # shulker box @material(blockid=list(range(219, 235)) + [257], data=list(range(6)), solid=True, nospawn=True) def shulker_box(self, blockid, data): # Do rotation if self.rotation in [1, 2, 3] and data in [2, 3, 4, 5]: rotation_map = {1: {2: 5, 3: 4, 4: 2, 5: 3}, 2: {2: 3, 3: 2, 4: 5, 5: 4}, 3: {2: 4, 3: 5, 4: 3, 5: 2}} data = rotation_map[self.rotation][data] if blockid == 257: # Uncolored shulker box file_name = "shulker.png" else: file_name = "shulker_%s.png" % color_map[blockid - 219] shulker_t = self.load_image("assets/minecraft/textures/entity/shulker/%s" % file_name).copy() w, h = shulker_t.size res = w // 4 # Cut out the parts of the shulker texture we need for the box top = shulker_t.crop((res, 0, res * 2, res)) bottom = shulker_t.crop((res * 2, int(res * 1.75), res * 3, int(res * 2.75))) side_top = shulker_t.crop((0, res, res, int(res * 1.75))) side_bottom = shulker_t.crop((0, int(res * 2.75), res, int(res * 3.25))) side = Image.new('RGBA', (res, res)) side.paste(side_top, (0, 0), side_top) side.paste(side_bottom, (0, res // 2), side_bottom) if data == 0: # down side = side.rotate(180) img = self.build_full_block(bottom, None, None, side, side) elif data == 1: # up img = self.build_full_block(top, None, None, side, side) elif data == 2: # east img = self.build_full_block(side, None, None, side.rotate(90), bottom) elif data == 3: # west img = self.build_full_block(side.rotate(180), None, None, side.rotate(270), top) elif data == 4: # north img = self.build_full_block(side.rotate(90), None, None, top, side.rotate(270)) elif data == 5: # south img = self.build_full_block(side.rotate(270), None, None, bottom, side.rotate(90)) return img # structure block @material(blockid=255, data=list(range(4)), solid=True) def structure_block(self, blockid, data): if data == 0: img = self.load_image_texture("assets/minecraft/textures/block/structure_block_save.png") elif data == 1: img = self.load_image_texture("assets/minecraft/textures/block/structure_block_load.png") elif data == 2: img = self.load_image_texture("assets/minecraft/textures/block/structure_block_corner.png") elif data == 3: img = self.load_image_texture("assets/minecraft/textures/block/structure_block_data.png") return self.build_block(img, img) # Jigsaw block @material(blockid=256, data=list(range(6)), solid=True) def jigsaw_block(self, blockid, data): # Do rotation if self.rotation in [1, 2, 3] and data in [2, 3, 4, 5]: rotation_map = {1: {2: 5, 3: 4, 4: 2, 5: 3}, 2: {2: 3, 3: 2, 4: 5, 5: 4}, 3: {2: 4, 3: 5, 4: 3, 5: 2}} data = rotation_map[self.rotation][data] top = self.load_image_texture("assets/minecraft/textures/block/jigsaw_top.png") bottom = self.load_image_texture("assets/minecraft/textures/block/jigsaw_bottom.png") side = self.load_image_texture("assets/minecraft/textures/block/jigsaw_side.png") if data == 0: # Down img = self.build_full_block(bottom.rotate(self.rotation * 90), None, None, side.rotate(180), side.rotate(180)) elif data == 1: # Up img = self.build_full_block(top.rotate(self.rotation * 90), None, None, side, side) elif data == 2: # North img = self.build_full_block(side, None, None, side.rotate(90), bottom.rotate(180)) elif data == 3: # South img = self.build_full_block(side.rotate(180), None, None, side.rotate(270), top.rotate(270)) elif data == 4: # West img = self.build_full_block(side.rotate(90), None, None, top.rotate(180), side.rotate(270)) elif data == 5: # East img = self.build_full_block(side.rotate(270), None, None, bottom.rotate(180), side.rotate(90)) return img # beetroots(207), berry bushes (11505) @material(blockid=[207, 11505], data=list(range(4)), transparent=True, nospawn=True) def crops(self, blockid, data): crops_id_to_tex = { 207: "assets/minecraft/textures/block/beetroots_stage%d.png", 11505: "assets/minecraft/textures/block/sweet_berry_bush_stage%d.png", } raw_crop = self.load_image_texture(crops_id_to_tex[blockid] % data) crop1 = self.transform_image_top(raw_crop) crop2 = self.transform_image_side(raw_crop) crop3 = crop2.transpose(Image.FLIP_LEFT_RIGHT) img = Image.new("RGBA", (24,24), self.bgcolor) alpha_over(img, crop1, (0,12), crop1) alpha_over(img, crop2, (6,3), crop2) alpha_over(img, crop3, (6,3), crop3) return img # Concrete @material(blockid=251, data=list(range(16)), solid=True) def concrete(self, blockid, data): texture = self.load_image_texture("assets/minecraft/textures/block/%s_concrete.png" % color_map[data]) return self.build_block(texture, texture) # Concrete Powder @material(blockid=252, data=list(range(16)), solid=True) def concrete(self, blockid, data): texture = self.load_image_texture("assets/minecraft/textures/block/%s_concrete_powder.png" % color_map[data]) return self.build_block(texture, texture) # Glazed Terracotta @material(blockid=list(range(235, 251)), data=list(range(4)), solid=True) def glazed_terracotta(self, blockid, data): # Do rotation data = (self.rotation + data) % 4 texture = self.load_image_texture("assets/minecraft/textures/block/%s_glazed_terracotta.png" % color_map[blockid - 235]).copy() texture_side4 = texture.transpose(Image.FLIP_LEFT_RIGHT) if data == 0: # South return self.build_full_block(texture, None, None, texture, texture_side4.rotate(270)) elif data == 1: # West return self.build_full_block(texture.rotate(270), None, None, texture.rotate(90), texture_side4.rotate(180)) elif data == 2: # North return self.build_full_block(texture.rotate(180), None, None, texture.rotate(180), texture_side4.rotate(90)) elif data == 3: # East return self.build_full_block(texture.rotate(90), None, None, texture.rotate(270), texture_side4) # dried kelp block @material(blockid=11331, data=[0], solid=True) def sandstone(self, blockid, data): top = self.load_image_texture("assets/minecraft/textures/block/dried_kelp_top.png") return self.build_block(top, self.load_image_texture("assets/minecraft/textures/block/dried_kelp_side.png")) # scaffolding block(blockid=11414, top_image="assets/minecraft/textures/block/scaffolding_top.png", side_image="assets/minecraft/textures/block/scaffolding_side.png", solid=False, transparent=True) # beehive and bee_nest @material(blockid=[11501, 11502], data=list(range(8)), solid=True) def beehivenest(self, blockid, data): if blockid == 11501: #beehive t_top = self.load_image("assets/minecraft/textures/block/beehive_end.png") t_side = self.load_image("assets/minecraft/textures/block/beehive_side.png") t_front = self.load_image("assets/minecraft/textures/block/beehive_front.png") t_front_honey = self.load_image("assets/minecraft/textures/block/beehive_front_honey.png") elif blockid == 11502: #bee_nest t_top = self.load_image("assets/minecraft/textures/block/bee_nest_top.png") t_side = self.load_image("assets/minecraft/textures/block/bee_nest_side.png") t_front = self.load_image("assets/minecraft/textures/block/bee_nest_front.png") t_front_honey = self.load_image("assets/minecraft/textures/block/bee_nest_front_honey.png") if data >= 4: front = t_front_honey else: front = t_front if self.rotation == 0: # rendering north upper-left if data == 0 or data == 4: # south return self.build_full_block(t_top, t_side, t_side, t_side, front) elif data == 1 or data == 5: # west return self.build_full_block(t_top, t_side, t_side, front, t_side) elif data == 2 or data == 6: # north return self.build_full_block(t_top, t_side, front, t_side, t_side) elif data == 3 or data == 7: # east return self.build_full_block(t_top, front, t_side, t_side, t_side) elif self.rotation == 1: # north upper-right if data == 0 or data == 4: # south return self.build_full_block(t_top, t_side, t_side, front, t_side) elif data == 1 or data == 5: # west return self.build_full_block(t_top, t_side, front, t_side, t_side) elif data == 2 or data == 6: # north return self.build_full_block(t_top, front, t_side, t_side, t_side) elif data == 3 or data == 7: # east return self.build_full_block(t_top, t_side, t_side, t_side, front) elif self.rotation == 2: # north lower-right if data == 0 or data == 4: # south return self.build_full_block(t_top, t_side, front, t_side, t_side) elif data == 1 or data == 5: # west return self.build_full_block(t_top, front, t_side, t_side, t_side) elif data == 2 or data == 6: # north return self.build_full_block(t_top, t_side, t_side, t_side, front) elif data == 3 or data == 7: # east return self.build_full_block(t_top, t_side, t_side, front, t_side) elif self.rotation == 3: # north lower-left if data == 0 or data == 4: # south return self.build_full_block(t_top, front, t_side, t_side, t_side) elif data == 1 or data == 5: # west return self.build_full_block(t_top, t_side, t_side, t_side, front) elif data == 2 or data == 6: # north return self.build_full_block(t_top, t_side, t_side, front, t_side) elif data == 3 or data == 7: # east return self.build_full_block(t_top, t_side, front, t_side, t_side) # honeycomb_block block(blockid=11503, top_image="assets/minecraft/textures/block/honeycomb_block.png") # honey_block block(blockid=11504, top_image="assets/minecraft/textures/block/honey_block_top.png", side_image="assets/minecraft/textures/block/honey_block_side.png") # Barrel @material(blockid=11418, data=list(range(12)), solid=True) def barrel(self, blockid, data): t_bottom = self.load_image("assets/minecraft/textures/block/barrel_bottom.png") t_side = self.load_image("assets/minecraft/textures/block/barrel_side.png") if data & 0x01: t_top = self.load_image("assets/minecraft/textures/block/barrel_top_open.png") else: t_top = self.load_image("assets/minecraft/textures/block/barrel_top.png") data = data >> 1 if data == 0: # up return self.build_full_block(t_top, None, None, t_side, t_side) elif data == 1: # down t_side = t_side.rotate(180) return self.build_full_block(t_bottom, None, None, t_side, t_side) elif data == 2: # south return self.build_full_block(t_side.rotate(180), None, None, t_side.rotate(270), t_top) elif data == 3: # east return self.build_full_block(t_side.rotate(270), None, None, t_bottom, t_side.rotate(90)) elif data == 4: # north return self.build_full_block(t_side, None, None, t_side.rotate(90), t_bottom) else: # west return self.build_full_block(t_side.rotate(90), None, None, t_top, t_side.rotate(270)) # Campfire (11506) and soul campfire (1003) @material(blockid=[11506, 1003], data=list(range(8)), solid=True, transparent=True, nospawn=True) def campfire(self, blockid, data): # Do rotation, mask to not clobber lit data data = data & 0b100 | ((self.rotation + (data & 0b11)) % 4) block_name = "campfire" if blockid == 11506 else "soul_campfire" # Load textures # Fire & lit log textures contain multiple tiles, since both are # 16px wide rely on load_image_texture() to crop appropriately fire_raw_t = self.load_image_texture("assets/minecraft/textures/block/" + block_name + "_fire.png") log_raw_t = self.load_image_texture("assets/minecraft/textures/block/campfire_log.png") log_lit_raw_t = self.load_image_texture("assets/minecraft/textures/block/" + block_name + "_log_lit.png") def create_tile(img_src, coord_crop, coord_paste, rot): # Takes an image, crops a region, optionally rotates the # texture, then finally pastes it onto a 16x16 image img_out = Image.new("RGBA", (16, 16), self.bgcolor) img_in = img_src.crop(coord_crop) if rot != 0: img_in = img_in.rotate(rot, expand=True) img_out.paste(img_in, coord_paste) return img_out # Generate bottom bottom_t = log_lit_raw_t if data & 0b100 else log_raw_t bottom_t = create_tile(bottom_t, (0, 8, 16, 14), (0, 5), 0) bottom_t = self.transform_image_top(bottom_t) # Generate two variants of a log: one with a lit side, one without log_t = Image.new("RGBA", (24, 24), self.bgcolor) log_end_t = create_tile(log_raw_t, (0, 4, 4, 8), (12, 6), 0) log_side_t = create_tile(log_raw_t, (0, 0, 16, 4), (0, 6), 0) log_side_lit_t = create_tile(log_lit_raw_t, (0, 0, 16, 4), (0, 6), 0) log_end_t = self.transform_image_side(log_end_t) log_top_t = self.transform_image_top(log_side_t) log_side_t = self.transform_image_side(log_side_t).transpose(Image.FLIP_LEFT_RIGHT) log_side_lit_t = self.transform_image_side(log_side_lit_t).transpose(Image.FLIP_LEFT_RIGHT) alpha_over(log_t, log_top_t, (-2, 2), log_top_t) # Fix some holes at the edges alpha_over(log_t, log_top_t, (-2, 1), log_top_t) log_lit_t = log_t.copy() # Unlit log alpha_over(log_t, log_side_t, (5, 0), log_side_t) alpha_over(log_t, log_end_t, (-7, 0), log_end_t) # Lit log. For unlit fires, just reference the unlit log texture if data & 0b100: alpha_over(log_lit_t, log_side_lit_t, (5, 0), log_side_lit_t) alpha_over(log_lit_t, log_end_t, (-7, 0), log_end_t) else: log_lit_t = log_t # Log parts. Because fire needs to be in the middle of the logs, # split the logs into two parts: Those appearing behind the fire # and those appearing in front of the fire logs_back_t = Image.new("RGBA", (24, 24), self.bgcolor) logs_front_t = Image.new("RGBA", (24, 24), self.bgcolor) # Back logs alpha_over(logs_back_t, log_lit_t, (-1, 7), log_lit_t) log_tmp_t = logs_back_t.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(logs_back_t, log_tmp_t, (1, -3), log_tmp_t) # Front logs alpha_over(logs_front_t, log_t, (7, 10), log_t) # Due to the awkward drawing order, take a small part of the back # logs that need to be drawn on top of the front logs despite # the front logs being drawn last ImageDraw.Draw(log_tmp_t).rectangle((0, 0, 18, 24), outline=(0, 0, 0, 0), fill=(0, 0, 0, 0)) alpha_over(logs_front_t, log_tmp_t, (1, -3), log_tmp_t) log_tmp_t = Image.new("RGBA", (24, 24), self.bgcolor) alpha_over(log_tmp_t, log_lit_t, (7, 10), log_lit_t) log_tmp_t = log_tmp_t.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(logs_front_t, log_tmp_t, (1, -3), log_tmp_t) # Compose final image img = Image.new("RGBA", (24, 24), self.bgcolor) alpha_over(img, bottom_t, (0, 12), bottom_t) alpha_over(img, logs_back_t, (0, 0), logs_back_t) if data & 0b100: fire_t = fire_raw_t.copy() if data & 0b11 in [0, 2]: # North, South fire_t = fire_t.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, fire_t, (4, 4), fire_t) alpha_over(img, logs_front_t, (0, 0), logs_front_t) if data & 0b11 in [0, 2]: # North, South img = img.transpose(Image.FLIP_LEFT_RIGHT) return img # Bell @material(blockid=11507, data=list(range(16)), solid=True, transparent=True, nospawn=True) def bell(self, blockid, data): # Do rotation, mask to not clobber attachment data data = data & 0b1100 | ((self.rotation + (data & 0b11)) % 4) # Load textures bell_raw_t = self.load_image("assets/minecraft/textures/entity/bell/bell_body.png") bar_raw_t = self.load_image_texture("assets/minecraft/textures/block/dark_oak_planks.png") post_raw_t = self.load_image_texture("assets/minecraft/textures/block/stone.png") def create_tile(img_src, coord_crop, coord_paste, rot): # Takes an image, crops a region, optionally rotates the # texture, then finally pastes it onto a 16x16 image img_out = Image.new("RGBA", (16, 16), self.bgcolor) img_in = img_src.crop(coord_crop) if rot != 0: img_in = img_in.rotate(rot, expand=True) img_out.paste(img_in, coord_paste) return img_out # 0 = floor, 1 = ceiling, 2 = single wall, 3 = double wall bell_type = (data & 0b1100) >> 2 # Should the bar/post texture be flipped? Yes if either: # - Attached to floor and East or West facing # - Not attached to floor and North or South facing flip_part = ((bell_type == 0 and data & 0b11 in [1, 3]) or (bell_type != 0 and data & 0b11 in [0, 2])) # Generate bell # Bell side textures varies based on self.rotation bell_sides_idx = [(0 - self.rotation) % 4, (3 - self.rotation) % 4] # Upper sides bell_coord = [x * 6 for x in bell_sides_idx] bell_ul_t = create_tile(bell_raw_t, (bell_coord[0], 6, bell_coord[0] + 6, 13), (5, 4), 180) bell_ur_t = create_tile(bell_raw_t, (bell_coord[1], 6, bell_coord[1] + 6, 13), (5, 4), 180) bell_ul_t = self.transform_image_side(bell_ul_t) bell_ur_t = self.transform_image_side(bell_ur_t.transpose(Image.FLIP_LEFT_RIGHT)) bell_ur_t = bell_ur_t.transpose(Image.FLIP_LEFT_RIGHT) # Lower sides bell_coord = [x * 8 for x in bell_sides_idx] bell_ll_t = create_tile(bell_raw_t, (bell_coord[0], 21, bell_coord[0] + 8, 23), (4, 11), 180) bell_lr_t = create_tile(bell_raw_t, (bell_coord[1], 21, bell_coord[1] + 8, 23), (4, 11), 180) bell_ll_t = self.transform_image_side(bell_ll_t) bell_lr_t = self.transform_image_side(bell_lr_t.transpose(Image.FLIP_LEFT_RIGHT)) bell_lr_t = bell_lr_t.transpose(Image.FLIP_LEFT_RIGHT) # Upper top top_rot = (180 + self.rotation * 90) % 360 bell_ut_t = create_tile(bell_raw_t, (6, 0, 12, 6), (5, 5), top_rot) bell_ut_t = self.transform_image_top(bell_ut_t) # Lower top bell_lt_t = create_tile(bell_raw_t, (8, 13, 16, 21), (4, 4), top_rot) bell_lt_t = self.transform_image_top(bell_lt_t) bell_t = Image.new("RGBA", (24, 24), self.bgcolor) alpha_over(bell_t, bell_lt_t, (0, 8), bell_lt_t) alpha_over(bell_t, bell_ll_t, (3, 4), bell_ll_t) alpha_over(bell_t, bell_lr_t, (9, 4), bell_lr_t) alpha_over(bell_t, bell_ut_t, (0, 3), bell_ut_t) alpha_over(bell_t, bell_ul_t, (4, 4), bell_ul_t) alpha_over(bell_t, bell_ur_t, (8, 4), bell_ur_t) # Generate bar if bell_type == 1: # Ceiling # bar_coord: Left Right Top bar_coord = [(4, 2, 6, 5), (6, 2, 8, 5), (1, 3, 3, 5)] bar_tile_pos = [(7, 1), (7, 1), (7, 7)] bar_over_pos = [(6, 3), (7, 2), (0, 0)] else: # Floor, single wall, double wall # Note: For a single wall bell, the position of the bar # varies based on facing if bell_type == 2 and data & 0b11 in [2, 3]: # Single wall, North/East facing bar_x_sw = 3 bar_l_pos_sw = (6, 7) else: bar_x_sw = 0 bar_l_pos_sw = (4, 8) bar_x = [2, None, bar_x_sw, 0][bell_type] bar_len = [12, None, 13, 16][bell_type] bar_l_pos = [(6, 7), None, bar_l_pos_sw, (4, 8)][bell_type] bar_long_coord = (bar_x, 3, bar_x + bar_len, 5) bar_coord = [(5, 4, 7, 6), bar_long_coord, bar_long_coord] bar_tile_pos = [(2, 1), (bar_x, 1), (bar_x, 7)] bar_over_pos = [bar_l_pos, (7, 3), (0, 1)] bar_l_t = create_tile(bar_raw_t, bar_coord[0], bar_tile_pos[0], 0) bar_r_t = create_tile(bar_raw_t, bar_coord[1], bar_tile_pos[1], 0) bar_t_t = create_tile(bar_raw_t, bar_coord[2], bar_tile_pos[2], 0) bar_l_t = self.transform_image_side(bar_l_t) bar_r_t = self.transform_image_side(bar_r_t.transpose(Image.FLIP_LEFT_RIGHT)) bar_r_t = bar_r_t.transpose(Image.FLIP_LEFT_RIGHT) bar_t_t = self.transform_image_top(bar_t_t) bar_t = Image.new("RGBA", (24, 24), self.bgcolor) alpha_over(bar_t, bar_t_t, bar_over_pos[2], bar_t_t) alpha_over(bar_t, bar_l_t, bar_over_pos[0], bar_l_t) alpha_over(bar_t, bar_r_t, bar_over_pos[1], bar_r_t) if flip_part: bar_t = bar_t.transpose(Image.FLIP_LEFT_RIGHT) # Generate post, only applies to floor attached bell if bell_type == 0: post_l_t = create_tile(post_raw_t, (0, 1, 4, 16), (6, 1), 0) post_r_t = create_tile(post_raw_t, (0, 1, 2, 16), (14, 1), 0) post_t_t = create_tile(post_raw_t, (0, 0, 2, 4), (14, 6), 0) post_l_t = self.transform_image_side(post_l_t) post_r_t = self.transform_image_side(post_r_t.transpose(Image.FLIP_LEFT_RIGHT)) post_r_t = post_r_t.transpose(Image.FLIP_LEFT_RIGHT) post_t_t = self.transform_image_top(post_t_t) post_back_t = Image.new("RGBA", (24, 24), self.bgcolor) post_front_t = Image.new("RGBA", (24, 24), self.bgcolor) alpha_over(post_back_t, post_t_t, (0, 1), post_t_t) alpha_over(post_back_t, post_l_t, (10, 0), post_l_t) alpha_over(post_back_t, post_r_t, (7, 3), post_r_t) alpha_over(post_back_t, post_r_t, (6, 3), post_r_t) # Fix some holes alpha_over(post_front_t, post_back_t, (-10, 5), post_back_t) if flip_part: post_back_t = post_back_t.transpose(Image.FLIP_LEFT_RIGHT) post_front_t = post_front_t.transpose(Image.FLIP_LEFT_RIGHT) img = Image.new("RGBA", (24, 24), self.bgcolor) if bell_type == 0: alpha_over(img, post_back_t, (0, 0), post_back_t) alpha_over(img, bell_t, (0, 0), bell_t) alpha_over(img, bar_t, (0, 0), bar_t) if bell_type == 0: alpha_over(img, post_front_t, (0, 0), post_front_t) return img # Ancient Debris block(blockid=[1000], top_image="assets/minecraft/textures/block/ancient_debris_top.png", side_image="assets/minecraft/textures/block/ancient_debris_side.png") # Basalt @material(blockid=[1001, 1002], data=list(range(3)), solid=True) def basalt(self, blockid, data): block_name = "polished_basalt" if blockid == 1002 else "basalt" top = self.load_image_texture("assets/minecraft/textures/block/" + block_name + "_top.png") side = self.load_image_texture("assets/minecraft/textures/block/" + block_name + "_side.png") return self.build_axis_block(top, side, data) # Blackstone block block(blockid=[1004], top_image="assets/minecraft/textures/block/blackstone_top.png", side_image="assets/minecraft/textures/block/blackstone.png") # Chain @material(blockid=11419, data=list(range(3)), solid=True, transparent=True, nospawn=True) def chain(self, blockid, data): tex = self.load_image_texture("assets/minecraft/textures/block/chain.png") sidetex = Image.new(tex.mode, tex.size, self.bgcolor) mask = tex.crop((0, 0, 6, 16)) alpha_over(sidetex, mask, (5, 0), mask) if data == 0: # y return self.build_sprite(sidetex) else: img = Image.new("RGBA", (24, 24), self.bgcolor) sidetex = sidetex.rotate(90) side = self.transform_image_side(sidetex) otherside = self.transform_image_top(sidetex) def draw_x(): _side = side.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, _side, (6,3), _side) alpha_over(img, otherside, (3,3), otherside) def draw_z(): _otherside = otherside.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, side, (6,3), side) alpha_over(img, _otherside, (0,6), _otherside) draw_funcs = [draw_x, draw_z] if data == 1: # x draw_funcs[self.rotation % len(draw_funcs)]() elif data == 2: # z draw_funcs[(self.rotation + 1) % len(draw_funcs)]() return img # Respawn anchor @material(blockid=1037, data=list(range(5)), solid=True) def respawn_anchor(self, blockid, data): top = self.load_image_texture("assets/minecraft/textures/block/respawn_anchor_top_off.png" if data == 0 else "assets/minecraft/textures/block/respawn_anchor_top.png") side = self.load_image_texture( "assets/minecraft/textures/block/respawn_anchor_side%s.png" % (data)) return self.build_block(top, side) # Netherite block(blockid=[1005], top_image="assets/minecraft/textures/block/netherite_block.png") # soul soil block(blockid=1020, top_image="assets/minecraft/textures/block/soul_soil.png") # nether gold ore block(blockid=1021, top_image="assets/minecraft/textures/block/nether_gold_ore.png") # Solid Nether stone blocks block(blockid=1022, top_image="assets/minecraft/textures/block/polished_blackstone.png") block(blockid=1023, top_image="assets/minecraft/textures/block/chiseled_polished_blackstone.png") block(blockid=1024, top_image="assets/minecraft/textures/block/gilded_blackstone.png") block(blockid=1025, top_image="assets/minecraft/textures/block/cracked_polished_blackstone_bricks.png") block(blockid=1026, top_image="assets/minecraft/textures/block/polished_blackstone_bricks.png") block(blockid=1035, top_image="assets/minecraft/textures/block/crying_obsidian.png") block(blockid=1036, top_image="assets/minecraft/textures/block/lodestone_top.png", side_image="assets/minecraft/textures/block/lodestone_side.png") block(blockid=1041, top_image="assets/minecraft/textures/block/quartz_bricks.png") block(blockid=1042, top_image="assets/minecraft/textures/block/amethyst_block.png") block(blockid=1043, top_image="assets/minecraft/textures/block/raw_iron_block.png") block(blockid=1044, top_image="assets/minecraft/textures/block/raw_gold_block.png") block(blockid=1045, top_image="assets/minecraft/textures/block/budding_amethyst.png") # You have entered the COPPER ZONE block(blockid=[1046, 1050], top_image="assets/minecraft/textures/block/copper_block.png") block(blockid=[1047, 1051], top_image="assets/minecraft/textures/block/exposed_copper.png") block(blockid=[1048, 1052], top_image="assets/minecraft/textures/block/weathered_copper.png") block(blockid=[1049, 1053], top_image="assets/minecraft/textures/block/oxidized_copper.png") # Cut variant block(blockid=[1054, 1058], top_image="assets/minecraft/textures/block/cut_copper.png") block(blockid=[1055, 1059], top_image="assets/minecraft/textures/block/exposed_cut_copper.png") block(blockid=[1056, 1060], top_image="assets/minecraft/textures/block/weathered_cut_copper.png") block(blockid=[1057, 1061], top_image="assets/minecraft/textures/block/oxidized_cut_copper.png") block(blockid=1062, top_image="assets/minecraft/textures/block/raw_copper_block.png") block(blockid=1063, top_image="assets/minecraft/textures/block/copper_ore.png") # You are now leaving the COPPER ZONE block(blockid=1080, top_image="assets/minecraft/textures/block/moss_block.png") block(blockid=1081, top_image="assets/minecraft/textures/block/calcite.png") block(blockid=1082, top_image="assets/minecraft/textures/block/rooted_dirt.png") # deepslate @material(blockid=1083, data=list(range(3)), solid=True) def deepslate(self, blockid, data): top=self.load_image_texture("assets/minecraft/textures/block/deepslate_top.png") side=self.load_image_texture("assets/minecraft/textures/block/deepslate.png") return self.build_axis_block(top, side, data) block(blockid=1084, top_image="assets/minecraft/textures/block/cobbled_deepslate.png") block(blockid=1085, top_image="assets/minecraft/textures/block/polished_deepslate.png") block(blockid=1086, top_image="assets/minecraft/textures/block/deepslate_coal_ore.png") block(blockid=1087, top_image="assets/minecraft/textures/block/deepslate_iron_ore.png") block(blockid=1088, top_image="assets/minecraft/textures/block/deepslate_copper_ore.png") block(blockid=1089, top_image="assets/minecraft/textures/block/deepslate_gold_ore.png") block(blockid=1090, top_image="assets/minecraft/textures/block/deepslate_emerald_ore.png") block(blockid=1091, top_image="assets/minecraft/textures/block/deepslate_lapis_ore.png") block(blockid=1092, top_image="assets/minecraft/textures/block/deepslate_diamond_ore.png") block(blockid=1093, top_image="assets/minecraft/textures/block/deepslate_redstone_ore.png") block(blockid=1094, top_image="assets/minecraft/textures/block/deepslate_bricks.png") block(blockid=1095, top_image="assets/minecraft/textures/block/cracked_deepslate_bricks.png") block(blockid=1096, top_image="assets/minecraft/textures/block/deepslate_tiles.png") block(blockid=1097, top_image="assets/minecraft/textures/block/cracked_deepslate_tiles.png") block(blockid=1098, top_image="assets/minecraft/textures/block/chiseled_deepslate.png") block(blockid=1107, top_image="assets/minecraft/textures/block/dripstone_block.png") block(blockid=1108, top_image="assets/minecraft/textures/block/smooth_basalt.png") block(blockid=1109, top_image="assets/minecraft/textures/block/tuff.png") @material(blockid=1110, data=list(range(16)), transparent=True) def pointed_dripstone(self, blockid, data): up_down = "down" if data & 0b1000 else "up" if (data & 4) == 4: # base tex = self.load_image_texture("assets/minecraft/textures/block/pointed_dripstone_%s_base.png" % (up_down)) elif (data & 3) == 3: # frustum tex = self.load_image_texture("assets/minecraft/textures/block/pointed_dripstone_%s_frustum.png" % (up_down)) elif (data & 2) == 2: # middle tex = self.load_image_texture("assets/minecraft/textures/block/pointed_dripstone_%s_middle.png" % (up_down)) elif (data & 1) == 1: # tip_merge tex = self.load_image_texture("assets/minecraft/textures/block/pointed_dripstone_%s_tip_merge.png" % (up_down)) else: # 0 - tip tex = self.load_image_texture("assets/minecraft/textures/block/pointed_dripstone_%s_tip.png" % (up_down)) return self.build_sprite(tex) block(blockid=1111, top_image="assets/minecraft/textures/block/powder_snow.png") @material(blockid=1112, data=0, transparent=True) def hangings_roots(self, blockid, data): tex = self.load_image_texture("assets/minecraft/textures/block/hanging_roots.png") return self.build_sprite(tex) @material(blockid=[1113, 1114, 1115], data=list(range(6)), transparent=True) def amethyst_bud(self, blockid, data): if blockid == 1113: tex = self.load_image_texture("assets/minecraft/textures/block/small_amethyst_bud.png") elif blockid == 1114: tex = self.load_image_texture("assets/minecraft/textures/block/medium_amethyst_bud.png") elif blockid == 1115: tex = self.load_image_texture("assets/minecraft/textures/block/large_amethyst_bud.png") def draw_north(): rotated = tex.rotate(90) side = self.transform_image_side(rotated) otherside = self.transform_image_top(rotated) otherside = otherside.transpose(Image.FLIP_TOP_BOTTOM) alpha_over(img, side, (6, 3), side) alpha_over(img, otherside, (0, 6), otherside) def draw_south(): rotated = tex.rotate(-90) side = self.transform_image_side(rotated) otherside = self.transform_image_top(rotated) otherside = otherside.transpose(Image.FLIP_TOP_BOTTOM) alpha_over(img, side, (6, 3), side) alpha_over(img, otherside, (0, 6), otherside) def draw_west(): rotated = tex.rotate(-90) side = self.transform_image_side(rotated) side = side.transpose(Image.FLIP_LEFT_RIGHT) otherside = self.transform_image_top(rotated) otherside = otherside.transpose(Image.FLIP_LEFT_RIGHT) otherside = otherside.transpose(Image.FLIP_TOP_BOTTOM) alpha_over(img, side, (6, 3), side) alpha_over(img, otherside, (0, 6), otherside) def draw_east(): rotated = tex.rotate(90) side = self.transform_image_side(rotated) side = side.transpose(Image.FLIP_LEFT_RIGHT) otherside = self.transform_image_top(rotated) otherside = otherside.transpose(Image.FLIP_LEFT_RIGHT) otherside = otherside.transpose(Image.FLIP_TOP_BOTTOM) alpha_over(img, side, (6, 3), side) alpha_over(img, otherside, (0, 6), otherside) draw_funcs = [draw_east, draw_south, draw_west, draw_north] if data == 0: # down tex = tex.transpose(Image.FLIP_TOP_BOTTOM) return self.build_sprite(tex) elif data == 1: # up return self.build_sprite(tex) elif data == 5: # north img = Image.new("RGBA", (24, 24), self.bgcolor) draw_funcs[(self.rotation + 3) % len(draw_funcs)]() return img elif data == 3: # south img = Image.new("RGBA", (24, 24), self.bgcolor) draw_funcs[(self.rotation + 1) % len(draw_funcs)]() return img elif data == 4: # west img = Image.new("RGBA", (24,24), self.bgcolor) draw_funcs[(self.rotation + 2) % len(draw_funcs)]() return img elif data == 2: # east img = Image.new("RGBA", (24, 24), self.bgcolor) draw_funcs[(self.rotation + 0) % len(draw_funcs)]() return img return self.build_sprite(tex) @material(blockid=[1116, 1117], data=list(range(2)), transparent=True) def cave_vines(self, blockid, data): if blockid == 1116: if data == 1: tex = self.load_image_texture("assets/minecraft/textures/block/cave_vines_plant_lit.png") else: tex = self.load_image_texture("assets/minecraft/textures/block/cave_vines_plant.png") elif blockid == 1117: if data == 1: tex = self.load_image_texture("assets/minecraft/textures/block/cave_vines_lit.png") else: tex = self.load_image_texture("assets/minecraft/textures/block/cave_vines.png") return self.build_sprite(tex) @material(blockid=1118, data=list(range(6)), transparent=True, solid=True) def lightning_rod(self, blockid, data): tex = self.load_image_texture("assets/minecraft/textures/block/lightning_rod.png") img = Image.new("RGBA", (24, 24), self.bgcolor) mask = tex.crop((0, 4, 2, 16)) sidetex = Image.new(tex.mode, tex.size, self.bgcolor) alpha_over(sidetex, mask, (14, 4), mask) mask = tex.crop((0, 0, 4, 4)) toptex = Image.new(tex.mode, tex.size, self.bgcolor) alpha_over(toptex, mask, (12, 0), mask) mask = tex.crop((0, 4, 2, 6)) side_toptex = Image.new(tex.mode, tex.size, self.bgcolor) alpha_over(side_toptex, mask, (12, 0), mask) def draw_east(): toptex_rotated = toptex.rotate(90) top_side = self.transform_image_side(toptex_rotated) top_side = top_side.transpose(Image.FLIP_LEFT_RIGHT) top_otherside = self.transform_image_top(toptex) top_otherside = top_otherside.transpose(Image.FLIP_LEFT_RIGHT) top_top = self.transform_image_side(toptex) # top alpha_over(img, top_otherside, (6, 6), top_otherside) # side alpha_over(img, top_side, (8, 7), top_side) alpha_over(img, top_top, (6, 2), top_top) roated_side = sidetex.rotate(90) side = self.transform_image_side(roated_side) side = side.transpose(Image.FLIP_TOP_BOTTOM) otherside = self.transform_image_top(sidetex) otherside = otherside.transpose(Image.FLIP_TOP_BOTTOM) side_top = self.transform_image_side(side_toptex) alpha_over(img, otherside, (-7, 4), otherside) alpha_over(img, side, (5, -1), side) alpha_over(img, side_top, (-2, 9), side_top) def draw_south(): roated_side = sidetex.rotate(90) side = self.transform_image_side(roated_side) otherside = self.transform_image_top(sidetex) alpha_over(img, side, (3, 6), side) alpha_over(img, otherside, (-8, 6), otherside) toptex_rotated = toptex.rotate(90) top_side = self.transform_image_side(toptex_rotated) top_otherside = self.transform_image_top(toptex) top_top = self.transform_image_side(toptex) top_top = top_top.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, top_side, (15, 12), top_side) alpha_over(img, top_otherside, (5, 10), top_otherside) alpha_over(img, top_top, (17, 7), top_top) def draw_west(): roated_side = sidetex.rotate(90) side = self.transform_image_side(roated_side) side = side.transpose(Image.FLIP_LEFT_RIGHT) otherside = self.transform_image_top(sidetex) otherside = otherside.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, side, (10, 6), side) alpha_over(img, otherside, (8, 6), otherside) toptex_rotated = toptex.rotate(90) top_side = self.transform_image_side(toptex_rotated) top_side = top_side.transpose(Image.FLIP_LEFT_RIGHT) top_otherside = self.transform_image_top(toptex) top_otherside = top_otherside.transpose(Image.FLIP_LEFT_RIGHT) top_top = self.transform_image_side(toptex) # top alpha_over(img, top_otherside, (-3, 10), top_otherside) # side alpha_over(img, top_side, (0, 11), top_side) alpha_over(img, top_top, (-3, 7), top_top) def draw_north(): roated_side = sidetex.rotate(90) side = self.transform_image_side(roated_side) otherside = self.transform_image_top(sidetex) alpha_over(img, side, (4, 7), side) alpha_over(img, otherside, (-6, 7), otherside) toptex_rotated = toptex.rotate(90) top_side = self.transform_image_side(toptex_rotated) top_otherside = self.transform_image_top(toptex) top_top = self.transform_image_side(toptex) top_top = top_top.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, top_otherside, (-4, 6), top_otherside) alpha_over(img, top_side, (5, 7), top_side) alpha_over(img, top_top, (8, 3), top_top) draw_funcs = [draw_east, draw_south, draw_west, draw_north] if data == 1: # up side = self.transform_image_side(sidetex) otherside = side.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, side, (0, 6 - 4), side) alpha_over(img, otherside, (12, 6 - 4), otherside) top_top = self.transform_image_top(toptex) top_side = self.transform_image_side(toptex) top_otherside = top_side.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, top_side, (0, 6 - 4), top_side) alpha_over(img, top_otherside, (12, 6 - 4), top_otherside) alpha_over(img, top_top, (0, 5), top_top) elif data == 0: # down toptex_flipped = toptex.transpose(Image.FLIP_TOP_BOTTOM) top_top = self.transform_image_top(toptex) top_side = self.transform_image_side(toptex_flipped) top_otherside = top_side.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, top_side, (0, 6 - 4), top_side) alpha_over(img, top_otherside, (12, 6 - 4), top_otherside) alpha_over(img, top_top, (0, 14), top_top) flipped = sidetex.transpose(Image.FLIP_TOP_BOTTOM) side_top = self.transform_image_top(side_toptex) side = self.transform_image_side(flipped) otherside = side.transpose(Image.FLIP_LEFT_RIGHT) alpha_over(img, side, (0, 6 - 4), side) alpha_over(img, otherside, (12, 6 - 4), otherside) alpha_over(img, side_top, (2, 6), side_top) elif data == 3: # south draw_funcs[(self.rotation + 1) % len(draw_funcs)]() elif data == 4: # west draw_funcs[(self.rotation + 2) % len(draw_funcs)]() elif data == 2: # east draw_funcs[(self.rotation + 0) % len(draw_funcs)]() elif data == 5: # north draw_funcs[(self.rotation + 3) % len(draw_funcs)]() return img @material(blockid=1119, data=list(range(1 << 6)), transparent=True) def glow_lichen(self, blockid, data): tex = self.load_image_texture("assets/minecraft/textures/block/glow_lichen.png") bottom = tex if data & 1 << 0 else None top = tex if data & 1 << 1 else None east = tex if data & 1 << 2 else None south = tex if data & 1 << 3 else None west = tex if data & 1 << 4 else None north = tex if data & 1 << 5 else None if self.rotation == 0: return self.build_full_block(top, north, east, west, south, bottom) elif self.rotation == 1: return self.build_full_block(top, west, north, south, east, bottom) elif self.rotation == 2: return self.build_full_block(top, south, west, east, north, bottom) else: # self.rotation == 3: return self.build_full_block(top, east, south, north, west, bottom) @material(blockid=1120, data=list(range(1)), transparent=True) def spore_blossom(self, blockid, data): leaf = self.load_image_texture("assets/minecraft/textures/block/spore_blossom.png") base = self.load_image_texture("assets/minecraft/textures/block/spore_blossom_base.png") img = Image.new("RGBA", (24, 24), self.bgcolor) side_leaf = self.transform_image_top(leaf) alpha_over(img, side_leaf, (-6, -5), side_leaf) roated_leaf = leaf.rotate(90) side_leaf = self.transform_image_top(roated_leaf) alpha_over(img, side_leaf, (-7, 4), side_leaf) roated_leaf = roated_leaf.rotate(90) side_leaf = self.transform_image_top(roated_leaf) alpha_over(img, side_leaf, (5, 4), side_leaf) roated_leaf = roated_leaf.rotate(90) side_leaf = self.transform_image_top(roated_leaf) alpha_over(img, side_leaf, (5, -5), side_leaf) base_top = self.transform_image_top(base) alpha_over(img, base_top, (0, 0), base_top) return img
overviewer/Minecraft-Overviewer
overviewer_core/textures.py
Python
gpl-3.0
282,304
[ "BLAST", "CRYSTAL" ]
59b726d7e0d802f50bee8286a96f691cf117a7f17d4ed073384db3c5a3b8fb87
from neuron import h,gui from CPG_Network import ReflexNetwork #h.load_file('stdgui.hoc') rc = ReflexNetwork() shape_window = h.PlotShape() shape_window.exec_menu('Show Diam')
penguinscontrol/Spinal-Cord-Modeling
CPG/run_python.py
Python
gpl-2.0
176
[ "NEURON" ]
74aeb04c323d2c8f42df506544a3db439e458f053b3f1b5d63624ac6ac45a3b9
### ### This script can be run with pvpython rather than pvbatch, as it does not ### need mpi. ### ### Purpose: ### ### Generate a static image dataset of volume rendering on the ne cooling data ### ### Example usages (assumes you are in directory with this script): ### ### 1) To run on the coarse mesh with tent-shaped opacity functions ### ### /home/scott/projects/ParaView/build/bin/pvpython volume-vel.py --inputdir "/media/scott/CINEMA FAT/ne-water-cool/coarse" --inputpattern "101results_%d.vtk" --outputdir "/media/scott/CINEMA FAT/ne-water-cool/coarse/Output/vel/tent" --optype "tent" ### ### 2) To run on the coarse mesh with linear opacity functions ### ### /home/scott/projects/ParaView/build/bin/pvpython volume-vel.py --inputdir "/media/scott/CINEMA FAT/ne-water-cool/coarse" --inputpattern "101results_%d.vtk" --outputdir "/media/scott/CINEMA FAT/ne-water-cool/coarse/Output/vel/linear" --optype "linear" ### ### 3) To run on the fine mesh with tent-shaped opacity functions ### ### /home/scott/projects/ParaView/build/bin/pvpython volume-vel.py --inputdir "/media/scott/CINEMA FAT/ne-water-cool/fine" --inputpattern "fine_results_%d.vtk" --outputdir "/media/scott/CINEMA FAT/ne-water-cool/fine/Output/vel/tent" --optype "tent" ### ### 4) To run on the fine mesh with linear opacity functions ### ### /home/scott/projects/ParaView/build/bin/pvpython volume-vel.py --inputdir "/media/scott/CINEMA FAT/ne-water-cool/fine" --inputpattern "fine_results_%d.vtk" --outputdir "/media/scott/CINEMA FAT/ne-water-cool/fine/Output/vel/linear" --optype "linear" ### import sys, os, argparse from paraview.simple import * from paraview import data_exploration as wx #import matplotlib.pyplot as plt ############################################################################### # Helper function to generate the tent functions needed for scalar opacity # function ############################################################################### def createHatFunctions(): baseWidth = 0.20 spacing = baseWidth / 2.0 halfWidth = baseWidth / 2.0 numberCenters = 1.0 / baseWidth centers = [ (baseWidth / 2.0) + (i * baseWidth) for i in range(int(numberCenters)) ] hatFunctions = [] for c in centers: startPoint = c - halfWidth xPoints = [ 0.0, startPoint, startPoint + spacing, startPoint + (2 * spacing), 1.0 ] yPoints = [ 0.0, 0.0, 1.0, 0.0, 0.0 ] hatFunctions.append([xPoints, yPoints]) #plt.plot(xPoints, yPoints, marker='o') #plt.show() return hatFunctions ############################################################################### # This method does all the processing ############################################################################### def doProcessing(inputDir, inputPattern, outputDir, opacityFnType): # ----------------------------------------------------------------------------- # Path to input/output data/directories # ----------------------------------------------------------------------------- files_pattern = os.path.join(inputDir, inputPattern) file_times = range(0, 101) #file_times = [ 80 ] filenames = [ (files_pattern % time) for time in file_times] # ----------------------------------------------------------------------------- # Rendering configuration # ----------------------------------------------------------------------------- resolution = 500 view_size = [resolution, resolution] angle_steps = [15, 15] #angle_steps = [90, 90] distance = 24632.991324377483 rotation_axis = [0.0, 1.0, 0.0] #center_of_rotation = [-1649.1046142578125, -752.328125, 1374.1217346191406] center_of_rotation = [0.0, 0.0, 0.0] view = GetRenderView() view.ViewSize = view_size view.Background = [0.0, 0.0, 0.0] view.OrientationAxesVisibility = 0 view.CenterAxesVisibility = 0 # ----------------------------------------------------------------------------- # Output configuration # ----------------------------------------------------------------------------- fng = wx.FileNameGenerator(outputDir, '{time}/{volumeIdx}/{theta}_{phi}.jpg') exporter = wx.ThreeSixtyImageStackExporter(fng, view, center_of_rotation, distance, rotation_axis, angle_steps) # ----------------------------------------------------------------------------- # Pipeline configuration # ----------------------------------------------------------------------------- # create a new 'Legacy VTK Reader' readerProxy = LegacyVTKReader(FileNames=filenames) # This translation transform is a workaround for a bug in the camera orbiting # calculations made in ThreeSixtyImageStackExporter transform1 = Transform(Input=readerProxy) transform1.Transform = 'Transform' transform1.Transform.Translate = [1649.1046142578125, 752.328125, -1374.1217346191406] # create a new 'Cell Data to Point Data' cellDatatoPointData1 = CellDatatoPointData(Input=transform1) # get color transfer function/color map for 'vel' velLUT = GetColorTransferFunction('vel') velLUT.RGBPoints = [0.0, 0.0, 0.0, 1.0, 15000.0, 1.0, 0.0, 0.0] velLUT.LockScalarRange = 1 velLUT.ColorSpace = 'HSV' velLUT.NanColor = [0.498039, 0.498039, 0.498039] velLUT.ScalarRangeInitialized = 1.0 # get opacity transfer function/opacity map for 'vel' velPWF = GetOpacityTransferFunction('vel') velPWF.Points = [0.0, 0.0, 0.5, 0.0, 15000.0, 1.0, 0.5, 0.0] velPWF.ScalarRangeInitialized = 1 # show data from fine_results_ readerDisplay = Show(transform1) readerDisplay.ColorArrayName = [None, ''] readerDisplay.Opacity = 0.15 readerDisplay.ScalarOpacityUnitDistance = 79.03822718592288 # show data from cellDatatoPointData1 cellDatatoPointData1Display = Show(cellDatatoPointData1) cellDatatoPointData1Display.Representation = 'Volume' cellDatatoPointData1Display.ColorArrayName = ['POINTS', 'vel'] cellDatatoPointData1Display.LookupTable = velLUT cellDatatoPointData1Display.ScalarOpacityFunction = velPWF cellDatatoPointData1Display.ScalarOpacityUnitDistance = 79.03822718592288 # ----------------------------------------------------------------------------- # Batch processing # ----------------------------------------------------------------------------- if opacityFnType == 'tent': hatFunctions = createHatFunctions() Render() for t in range(0, len(file_times), 1): time = file_times[t] GetAnimationScene().TimeKeeper.Time = float(time) UpdatePipeline(time) dataRange = [0.0, 15000.0] print "Moving to timestep ",time,", new data range: ",dataRange for volumeIdx in range(5): curRange = dataRange[1] - dataRange[0] pwfPoints = [] if opacityFnType == 'tent': xPoints = hatFunctions[volumeIdx][0] yPoints = hatFunctions[volumeIdx][1] for i in range(len(xPoints)): pwfPoints.append(dataRange[0] + (xPoints[i] * curRange)) pwfPoints.append(yPoints[i]) pwfPoints.append(0.5) pwfPoints.append(0.0) else: curStep = dataRange[0] + (float(volumeIdx) * (curRange / 5.0)) pwfPoints = [ dataRange[0], 0.0, 0.5, 0.0, curStep, 0.0, 0.5, 0.0, dataRange[1], 1.0, 0.5, 0.0 ] newPwf = CreatePiecewiseFunction( Points=pwfPoints ) cellDatatoPointData1Display.ScalarOpacityFunction = newPwf fng.update_active_arguments(volumeIdx=volumeIdx) fng.update_label_arguments(volumeIdx="Idx") exporter.UpdatePipeline(time) ############################################################################### # Main script entry point ############################################################################### if __name__ == "__main__": description = "Python script to generate volume rendered NE cooling data" parser = argparse.ArgumentParser(description=description) parser.add_argument("--inputdir", type=str, default="", help="Path to directory where input data files exist") parser.add_argument("--inputpattern", type=str, default="", help="String pattern containing %d where pattern should be replaced with numbers") parser.add_argument("--outputdir", type=str, default="", help="Path to directory where cinema dataset should be written") parser.add_argument("--optype", type=str, default="", help="Opacity function type, should be either 'tent' or 'linear'") args = parser.parse_args() doProcessing(args.inputdir, args.inputpattern, args.outputdir, args.optype)
Kitware/cinema
scripts/data_generation/ne-cooling/volume-vel.py
Python
bsd-3-clause
9,113
[ "ParaView", "VTK" ]
772244f566ff0b693391583b9b3fd7810ed1acce3d3b74aba392bac12fd13618
#!/usr/bin/env python # Copyright (C) 2012 Tianyang Li # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License """ remove reads that were aligned >= 2 times and contigs associated with them """ import sys import getopt import pysam from Bio import SeqIO def main(args): contigs, sam, fout_prefix, reads, fmt = None, None, None, None, None try: opts, args = getopt.getopt(args, 'c:s:o:r:f:') except getopt.GetoptError as err: print >> sys.stderr, str(err) sys.exit(1) for opt, arg in opts: if opt == '-c': contigs = arg if opt == '-s': sam = arg if opt == '-o': fout_prefix = arg if opt == '-r': reads = arg if opt == '-f': fmt = arg if contigs == None or sam == None or fout_prefix == None or reads == None: print >> sys.stderr, "missing options" sys.exit(1) read_aln_count = {} for rec in SeqIO.parse(reads, fmt): read_aln_count[rec.id] = [] # TODO: use pysam dup_contig = set([]) with open(fout_prefix + "-good-reads-list", 'w') as good_reads: for read in read_aln_count.keys(): contig_list = read_aln_count[read] if len(contig_list) != 1: more_flg = False if len(contig_list) >= 2: print "#######################" more_flg = True for bad_contig in contig_list: dup_contig.add(bad_contig) if more_flg: print bad_contig else: good_reads.write("%s\n" % read) contig_name = set([]) for rec in SeqIO.parse(contigs, 'fasta'): contig_name.add(rec.id) good_contigs = contig_name - dup_contig with open(fout_prefix + "-good-contigs-list", 'w') as gc_fout: for good_contig in good_contigs: gc_fout.write("%s\n" % good_contig) if __name__ == '__main__': main(sys.argv[1:])
tianyang-li/meta-transcriptome
trans-len/strip_dup_al_reads.py
Python
gpl-3.0
2,598
[ "pysam" ]
fc244d004b46832d2b80d13bfff05a1a448217fb60bb3fadac43d9621446fc53
BISMARK_METH_CODE_TYPE_MAP = { "H": "CHH", "h": "CHH", "X": "CHG", "x": "CHG", "Z": "CpG", "z": "CpG", } def meth_call_for_read(read, overlap=True, min_qual=20): ''' Do methyltaion calling per read. Parameters ---------- read : pysam.AlignedSegment The read from fetch() overlap : bool If it is True, only count the sites in read 2 for overlapped region. min_qual : int The minium quality score to do methyltaion calling. yields ------- int reference ID int position str strand str methylation code Notes ----- * Because of technical problem, call read 2 sites for the overlapped sites instead of read 1 sites. * If the overlapped read 2 sites do not pass min_qual, it won't call read 1 sites instead. ''' if read.is_paired: if read.flag in (99, 147): strand = '+' else: strand = '-' else: if read.is_reverse: strand = '-' else: strand = '+' positions = read.get_reference_positions() is_left = read.reference_start < read.next_reference_start meth_codes = read.get_tag('XM') quals = read.query_qualities for pos, meth_code, qual in zip(positions, meth_codes, quals): if meth_code in BISMARK_METH_CODE_TYPE_MAP and qual>=min_qual: if read.is_paired and overlap and pos>=read.next_reference_start and is_left: continue yield read.reference_id, pos, strand, meth_code def meth_call_by_region(bam_filename, chrom=None, start=None, end=None): ''' Methylation call for a given region. Parameters ---------- bam_filename : str The alignment BAM filename. chrom : str, optional The chromsome name of the region. start : int, optional The start position of the region. end : int, optional The end position of the region. Returns ------- pandas.DataFrame columns is ['chrom', 'pos', 'strand', 'meth_code', 'meth_count', 'total_count']. ''' import pandas as pd import pysam import numpy as np print 'Working on {}:{}-{}'.format(chrom, start, end) with pysam.AlignmentFile(bam_filename) as samfile: tid_chrom_d = {i: d['SN'] for i, d in enumerate(samfile.header['SQ'])} # Values are tuples of meth_count and totoal counts. coor_meth_calls_d = {} for read in samfile.fetch(chrom, start, end): for reference_id, pos, strand, meth_code in meth_call_for_read(read): meth_calls = coor_meth_calls_d.setdefault( (reference_id, pos, strand, meth_code.upper()), [0, 0] ) if meth_code.isupper(): meth_calls[0] += 1 meth_calls[1] += 1 result_df = pd.DataFrame() if coor_meth_calls_d: result_df = pd.DataFrame( coor_meth_calls_d.values(), columns=['meth_count', 'total_count'], index=pd.MultiIndex.from_tuples( coor_meth_calls_d.keys(), names=['chrom', 'pos', 'strand', 'meth_code'] ), dtype=np.uint32, ) result_df.reset_index(inplace=True) result_df['chrom'] = result_df['chrom'].astype(np.uint32) result_df.sort_values(['chrom', 'pos', 'strand'], inplace=True) if start!=None: idx_start = result_df['pos'].searchsorted(start, 'left')[0] result_df = result_df[idx_start:] if end!=None: idx_end = result_df['pos'].searchsorted(end, 'right')[0] result_df = result_df[:idx_end] result_df['chrom'] = result_df['chrom'].replace(tid_chrom_d) return result_df def write_meth_data_by_regions(bam_filename, out_dir, regions, rand_str=''): ''' Write the region methylation calling DataFrame into a file. Parameters ---------- bam_filename : str The alignment BAM filename. out_dir : str The ouput directory. regions : List of tuples A list of (chromosome, start, end). rand_str : str, optional Add the rand_str in the prefix to tempfiles. Notes ----- * The output file is a temp file, and you have to delete it manually. ''' import pandas as pd import tempfile import pysam result_df = pd.DataFrame() for chrom, start, end in regions: result_df = result_df.append(meth_call_by_region(bam_filename, chrom, start, end)) if not result_df.empty: for meth_code in result_df['meth_code'].unique(): meth_type = BISMARK_METH_CODE_TYPE_MAP[meth_code] tmp_df = result_df[result_df['meth_code']==meth_code] tmp_df = tmp_df[['chrom', 'pos', 'strand', 'meth_count', 'total_count']] tmp_df = tmp_df.reset_index(drop=True) # Mirror-seq can only detect CpGs so do not convert non-CpGs. if meth_code=='Z': mirror_seq_conversion(tmp_df) prefix = 'tmp_{0}_'.format(rand_str) suffix = '_{0}'.format(meth_type) f = tempfile.NamedTemporaryFile(dir=out_dir, prefix=prefix, suffix=suffix, delete=False) tmp_df.to_csv(f.name, compression='gzip', index=False) def get_regions_chunks(bam_filename, nts_in_regions=100000000): ''' Iterate regions lists to roughly fit "nts_in_regions". Parameters ---------- bam_filename : str The alignment BAM filename. nts_in_regions : int, optional Number of total nucleotides in an iter of regions. It is an rough number so it is possible to get more than the number. Yields ------ List List of tuples of chromosome, start, and end. ''' import pysam with pysam.AlignmentFile(bam_filename) as samfile: chrom_sizes = [(d['SN'], d['LN']) for d in samfile.header['SQ']] chrom_sizes = sorted(chrom_sizes, key=lambda x: x[1], reverse=True) regions = [] nts = 0 for chrom, size in chrom_sizes: chunk_num = size / nts_in_regions if size % nts_in_regions != 0: chunk_num += 1 start = 0 for i in range(chunk_num): end = min(start + nts_in_regions, size) region_size = end - start nts += region_size regions.append((chrom, start, end)) if nts>nts_in_regions: yield regions nts = 0 regions = [] start = end + 1 if regions: yield regions def parse_to_bed(data_filename, bed_filename, chunksize=1000000): ''' Parse the standard output format to BED format. Parameters ---------- data_filename : str The data filename. bed_filename : str The output BED filename. chunksize : int, optional The chunk size when reading files. ''' import pandas as pd import numpy as np import subprocess import os with open(bed_filename, 'w') as fw: for df in pd.read_csv(data_filename, chunksize=chunksize): df['end'] = df['pos'] + 1 df['thick_start'] = 0 df['thick_end'] = 0 df['meth_ratio'] = df['meth_count'] / df['total_count'] df['score'] = (df['meth_ratio'] * 1000).round().astype(np.uint32) df['name'] = df.apply( lambda r: '{0}/{1}({2:.0%})'.format( r['meth_count'], r['total_count'], r['meth_ratio'] ), axis=1, ) df['rgb'] = df.apply( lambda r: '255,{0:.0f},0'.format(255*r['meth_ratio']), axis=1, ) colnames = [ 'chrom', 'pos', 'end', 'name', 'score', 'strand', 'thick_start', 'thick_end', 'rgb' ] df[colnames].to_csv(fw, sep='\t', index=False, header=False) temp_folder = os.path.dirname(bed_filename) subprocess.check_call(( "sort", "-T", temp_folder, "-k1,1", "-k2,2n", bed_filename, "-o", bed_filename, )) subprocess.check_call(('gzip', '-f', bed_filename)) def mirror_seq_conversion(df): ''' Convert methylation ratios and strands. Parameters ---------- df : pandas.DataFrame with columns - strand, pos, meth_count, and total_count. ''' import pandas as pd pos_series = pd.concat(( df[df['strand']=='+']['pos'] + 1, df[df['strand']=='-']['pos'] - 1, )) df['pos'] = pos_series df['strand'] = df['strand'].replace({'+': '--', '-': '++'}).replace({'--': '-', '++': '+'}) df['meth_count'] = df['total_count'] - df['meth_count'] def merge_n_parse(out_prefix, meth_type, filenames, create_bed_file): ''' The is a shortcut function, which is easier to be used by multiprocessing. Parameters ---------- out_prefix : str The output prefix. meth_type : str The methylation type. Eg: CpG, CHG, and CHH. filenames : str The csv filenames to be mreged. create_bed_file : bool Create a bed file or not. ''' import pandas as pd import os import subprocess full_filename = '{0}_{1}.csv'.format(out_prefix, meth_type) header = True for filename in filenames: pd.read_csv(filename, compression='gzip').to_csv(full_filename, header=header, mode='a', index=False) header = False subprocess.check_call(('gzip', '-f', full_filename)) full_filename += '.gz' if meth_type=='CpG' and create_bed_file: bed_filename = full_filename.replace('.csv.gz', '.bed') parse_to_bed(full_filename, bed_filename) def get_bs_conv_rate(filenames): '''Calculate the bisulfite conversion rate using CHH and CHG methylation tracks. Parameters ---------- filenames : List of str the filenames of non-CpGs. Returns ------- float The estimated bisulfite conversion rate. NOTES ----- 1. Get conversion rate for each non CpGs and average them. 2. The esitmated bisulfite conversion rate is rounded to 2 decimal. 3. Return None if no sites in all files. ''' import pandas as pd import os meth_ratio_sum = 0 count = 0 for filename in filenames: if os.path.exists(filename): for df in pd.read_csv(filename, compression='gzip', usecols=['meth_count', 'total_count'], chunksize=1000000): meth_ratio_sum += (df['meth_count'] / df['total_count']).sum() count += len(df) try: bs_conv_rate = 1 - round(meth_ratio_sum / count, 2) except ZeroDivisionError: bs_conv_rate = None return bs_conv_rate def main(bam_filename, out_prefix, create_bed_file, nts_in_regions=100000000): ''' Run the entire methylation calling. Parameters ---------- bam_filename : str The alignment bam filename. The index file (.bai) must exist in the same folder. out_prefix : str The output file prefix. The output file is <out_prefix>_<METH_TYPE>.h5. create_bed_file : bool Create a bed file or not. nts_in_regions : int, optional Number of total nucleotides in an iter of regions. It is an rough number so it is possible to get more than the number. ''' from multiprocessing import Pool import multiprocessing import subprocess import pysam import os, string, random import pandas as pd print('Wokring on hydroxymethylation calling...') out_dir = os.path.dirname(out_prefix) rand_str = ''.join(random.choice(string.ascii_uppercase + string.digits) for _ in range(8)) p = Pool() for regions in get_regions_chunks(bam_filename, nts_in_regions): p.apply_async( write_meth_data_by_regions, (bam_filename, out_dir, regions, rand_str), ) p.close() p.join() prefix = 'tmp_{0}_'.format(rand_str) meth_type_filenames_dict = {} for filename in os.listdir(os.path.join('.', out_dir)): if not filename.startswith(prefix): continue meth_type = filename.rsplit('_', 1)[-1] filenames = meth_type_filenames_dict.setdefault(meth_type, []) filenames.append(os.path.join(out_dir, filename)) print('Merge files...') p = Pool() for meth_type, filenames in meth_type_filenames_dict.iteritems(): p.apply_async( merge_n_parse, (out_prefix, meth_type, filenames, True), ) p.close() p.join() cpg_filename = '{}_CpG.csv.gz'.format(out_prefix) chg_filename = '{}_CHG.csv.gz'.format(out_prefix) chh_filename = '{}_CHH.csv.gz'.format(out_prefix) # Calculate bisulfite conversion rate. conversion_rate = get_bs_conv_rate([ chg_filename, chh_filename, ]) if conversion_rate is not None: print('Bisuflite conversion rate: {:.0%}'.format(conversion_rate)) else: print('Cannot estimate bisuflite conversion rate.') # Remove tmp files after everthing is done. for filenames in meth_type_filenames_dict.itervalues(): for filename in filenames: os.remove(filename) try: os.remove(chg_filename) except OSError: pass try: os.remove(chh_filename) except OSError: pass print('Done!')
Zymo-Research/mirror-seq
mirror_seq/hmc_calling.py
Python
apache-2.0
13,672
[ "pysam" ]
57b3e755a5b7b6c91c09dbe83e610a174b411cc91a5f01e26c5e315c0e21ffb5
import math import random from test import redis, flushdb NUM_VALUES = 100000 def cdf(x, values): n1 = 0 n2 = 0 for v in values: n1 += 1 if v < x else 0 n2 += 1 if v <= x else 0 return (n1 + n2) / 2.0 / len(values) def run_test_for_dist(redis, distfn): key = distfn.__name__ keydest = key + ':dest' key0 = key + ':0' key1 = key + ':1' testkeys = [key, keydest, key0] redis.tdigest_new(key) redis.tdigest_new(key0) redis.tdigest_new(key1) quantiles = [0.001, 0.01, 0.1, 0.5, 0.9, 0.99, 0.999] values = [] for i in xrange(NUM_VALUES): v = distfn() redis.tdigest_add(key, v, 1) if 0 == i % 2: redis.tdigest_add(key0, v, 1) else: redis.tdigest_add(key1, v, 1) values.append(v) redis.tdigest_merge(keydest, key0, key1) redis.tdigest_merge(key0, key1) values = sorted(values) for k in testkeys: soft_errs = 0 redis.tdigest_meta(k) for i, q in enumerate(quantiles): ix = NUM_VALUES * quantiles[i] - 0.5; idx = int(math.floor(ix)) p = ix - idx; x = values[idx] * (1 - p) + values[idx + 1] * p; estimate_x = float(redis.tdigest_quantile(k, q)[0]) estimate_q = float(redis.tdigest_cdf(k, x)[0]) assert abs(q - estimate_q) < 0.005 if abs(cdf(estimate_x, values) - q) > 0.005: soft_errs += 1 assert soft_errs < 3 def test_uniform(redis, flushdb): def uniform(): return random.uniform(-1, 1) run_test_for_dist(redis, uniform) def test_gaussian(redis, flushdb): def gaussian(): return random.gauss(0, 1) run_test_for_dist(redis, gaussian) def test_beta(redis, flushdb): def beta(): return random.betavariate(2, 2) run_test_for_dist(redis, beta) def test_meta(redis, flushdb): redis.tdigest_new('test_meta0') redis.tdigest_new('test_meta1') redis.tdigest_new('test_meta2', compression=100) m0 = redis.tdigest_meta('test_meta0') m1 = redis.tdigest_meta('test_meta1') m2 = redis.tdigest_meta('test_meta2') assert m0[0] == m1[0] assert m2[0] == 100 assert m0[1] == m1[1] == m2[1] == 0 assert m0[2] == m1[2] == m2[2] for i in xrange(100): redis.tdigest_add('test_meta0', i, 1) redis.tdigest_add('test_meta1', i, 1) redis.tdigest_add('test_meta2', i, 1) m0 = redis.tdigest_meta('test_meta0') m1 = redis.tdigest_meta('test_meta1') m2 = redis.tdigest_meta('test_meta2') assert m0[0] == m1[0] assert m2[0] == 100 assert m0[1] == m1[1] == m2[1] == 100 assert m0[2] == m1[2] == m2[2] for i in xrange(1000): redis.tdigest_add('test_meta0', i, 1) redis.tdigest_add('test_meta1', i, 1) redis.tdigest_add('test_meta2', i, 1) m0 = redis.tdigest_meta('test_meta0') m1 = redis.tdigest_meta('test_meta1') m2 = redis.tdigest_meta('test_meta2') assert m0[0] == m1[0] assert m2[0] == 100 assert m0[1] == m1[1] assert m0[1] > m2[1] assert m0[2] == m1[2] assert m0[2] > m2[2] def test_mem_leak(redis, flushdb): redis.tdigest_new('test_mem_leak0') redis.tdigest_new('test_mem_leak1') for i in xrange(1000): redis.tdigest_add('test_mem_leak0', i, 1) redis.tdigest_add('test_mem_leak1', i, 1) # Compression forces storing < 1000 centroids assert redis.tdigest_meta('test_mem_leak0')[1] < 1000 assert redis.tdigest_meta('test_mem_leak1')[1] < 1000 start_rss_mem = redis.info()['used_memory_rss'] for i in xrange(100000): redis.tdigest_add('test_mem_leak0', i, 1) redis.tdigest_add('test_mem_leak1', i, 1) if i % 1000 == 0: redis.tdigest_cdf('test_mem_leak0', random.randint(100, 1000)) redis.tdigest_cdf('test_mem_leak1', random.randint(100, 1000)) if i % 1000 == 500: redis.tdigest_quantile('test_mem_leak0', 0.4) redis.tdigest_quantile('test_mem_leak1', 0.8) end_rss_mem = redis.info()['used_memory_rss'] # %age difference should be < 1% percent_diff = abs(end_rss_mem - start_rss_mem) / float(end_rss_mem) assert percent_diff < 0.01 def run_persistence_test(redis, reloadfn): redis.tdigest_new('test_aof0') for i in xrange(10): redis.tdigest_add('test_aof0', i, 1) assert redis.client.type('test_aof0') == 't-digest0' reloadfn() assert redis.client.type('test_aof0') == 't-digest0' def test_aof(redis, flushdb): run_persistence_test(redis, redis.reload_from_aof) def test_rdb(redis, flushdb): run_persistence_test(redis, redis.reload_from_rdb)
usmanm/redis-tdigest
test/test_integration.py
Python
mit
4,392
[ "Gaussian" ]
2f0901df3c4d577d3bfac6ae43125d8be36e59f2857a9e1233d21127f2c68601
#! /usr/bin/env python """Unit tests for landlab.io.netcdf module.""" import os import netCDF4 as nc import numpy as np import pytest from numpy.testing import assert_array_equal from landlab import RasterModelGrid from landlab.io.netcdf import NotRasterGridError, write_netcdf from landlab.io.netcdf.read import _get_raster_spacing _TEST_DATA_DIR = os.path.join(os.path.dirname(__file__), "data") def test_netcdf_write_int64_field_netcdf4(tmpdir): """Test write_netcdf with a grid that has an int64 field.""" field = RasterModelGrid((4, 3)) field.add_field("topographic__elevation", np.arange(12, dtype=np.int64), at="node") with tmpdir.as_cwd(): write_netcdf("test.nc", field, format="NETCDF4") root = nc.Dataset("test.nc", "r", format="NETCDF4") for name in ["topographic__elevation"]: assert name in root.variables assert_array_equal( np.reshape(root.variables[name], -1), field.at_node[name] ) assert root.variables[name].dtype == "int64" root.close() def test_netcdf_write_uint8_field_netcdf4(tmpdir): """Test write_netcdf with a grid that has an uint8 field.""" field = RasterModelGrid((4, 3)) field.add_field("topographic__elevation", np.arange(12, dtype=np.uint8), at="node") with tmpdir.as_cwd(): write_netcdf("test.nc", field, format="NETCDF4") root = nc.Dataset("test.nc", "r", format="NETCDF4") for name in ["topographic__elevation"]: assert name in root.variables assert_array_equal( np.reshape(root.variables[name], -1), field.at_node[name] ) assert root.variables[name].dtype == "uint8" root.close() def test_netcdf_write_as_netcdf3_64bit(tmpdir): """Test write_netcdf with output format 64-bit netcdf3.""" from scipy.io import netcdf field = RasterModelGrid((4, 3)) field.add_field("topographic__elevation", np.arange(12.0), at="node") field.add_field("uplift_rate", 2.0 * np.arange(12.0), at="node") with tmpdir.as_cwd(): write_netcdf("test.nc", field, format="NETCDF3_64BIT") f = netcdf.netcdf_file("test.nc", "r") for name in ["topographic__elevation", "uplift_rate"]: assert name in f.variables assert_array_equal( np.reshape(f.variables[name][:], -1), field.at_node[name] ) f.close() def test_netcdf_write_as_netcdf3_classic(tmpdir): """Test write_netcdf with output format classic netcdf3.""" from scipy.io import netcdf field = RasterModelGrid((4, 3)) field.add_field("topographic__elevation", np.arange(12.0), at="node") field.add_field("uplift_rate", 2.0 * np.arange(12.0), at="node") with tmpdir.as_cwd(): write_netcdf("test.nc", field, format="NETCDF3_CLASSIC") f = netcdf.netcdf_file("test.nc", "r") for name in ["topographic__elevation", "uplift_rate"]: assert name in f.variables assert_array_equal( np.reshape(f.variables[name][:], -1), field.at_node[name] ) f.close() def test_netcdf_write(tmpdir): """Test generic write_netcdf.""" field = RasterModelGrid((4, 3)) field.add_field("topographic__elevation", np.arange(12.0), at="node") with tmpdir.as_cwd(): write_netcdf("test.nc", field, format="NETCDF4") root = nc.Dataset("test.nc", "r", format="NETCDF4") assert set(root.dimensions) == set(["ni", "nj", "nt"]) assert len(root.dimensions["ni"]) == 3 assert len(root.dimensions["nj"]) == 4 assert len(root.dimensions["nt"]) == 1 assert root.dimensions["nt"].isunlimited() assert set(root.variables) == set(["x", "y", "topographic__elevation"]) assert_array_equal( np.reshape(root.variables["x"], -1), np.array([0.0, 1.0, 2.0, 0.0, 1.0, 2.0, 0.0, 1.0, 2.0, 0.0, 1.0, 2.0]), ) assert_array_equal( np.reshape(root.variables["y"], -1), np.array([0.0, 0.0, 0.0, 1.0, 1.0, 1.0, 2.0, 2.0, 2.0, 3.0, 3.0, 3.0]), ) assert_array_equal( np.reshape(root.variables["topographic__elevation"], -1), field.at_node["topographic__elevation"], ) root.close() def test_netcdf_write_as_netcdf4_classic(tmpdir): """Test write_netcdf to netcdf4 classic format.""" field = RasterModelGrid((4, 3)) field.add_field("topographic__elevation", np.arange(12.0), at="node") field.add_field("uplift_rate", np.arange(12.0), at="node") with tmpdir.as_cwd(): write_netcdf("test.nc", field, format="NETCDF4_CLASSIC") root = nc.Dataset("test.nc", "r", format="NETCDF4_CLASSIC") for name in ["topographic__elevation", "uplift_rate"]: assert name in root.variables assert_array_equal( np.reshape(root.variables[name], -1), field.at_node[name] ) root.close() def test_netcdf_write_names_keyword_as_list(tmpdir): """Test write_netcdf using a list for the *names* keyword.""" field = RasterModelGrid((4, 3)) field.add_field("topographic__elevation", np.arange(12.0), at="node") field.add_field("uplift_rate", np.arange(12.0), at="node") with tmpdir.as_cwd(): write_netcdf( "test.nc", field, names=["topographic__elevation"], format="NETCDF4" ) root = nc.Dataset("test.nc", "r", format="NETCDF4") assert "topographic__elevation" in root.variables assert "uplift_rate" not in root.variables assert_array_equal( np.reshape(root.variables["topographic__elevation"], -1), field.at_node["topographic__elevation"], ) root.close() def test_netcdf_write_names_keyword_as_str(tmpdir): """Test write_netcdf using a ``str`` for the *names* keyword.""" field = RasterModelGrid((4, 3)) field.add_field("topographic__elevation", np.arange(12.0), at="node") field.add_field("uplift_rate", np.arange(12.0), at="node") with tmpdir.as_cwd(): write_netcdf("test.nc", field, names="uplift_rate", format="NETCDF4") root = nc.Dataset("test.nc", "r", format="NETCDF4") assert "topographic__elevation" not in root.variables assert "uplift_rate" in root.variables assert_array_equal( np.reshape(root.variables["uplift_rate"], -1), field.at_node["uplift_rate"] ) root.close() def test_netcdf_write_names_keyword_as_none(tmpdir): """Test write_netcdf using ``None`` for the *names* keyword.""" field = RasterModelGrid((4, 3)) field.add_field("topographic__elevation", np.arange(12.0), at="node") field.add_field("uplift_rate", np.arange(12.0), at="node") with tmpdir.as_cwd(): write_netcdf("test.nc", field, names=None, format="NETCDF4") root = nc.Dataset("test.nc", "r", format="NETCDF4") for name in ["topographic__elevation", "uplift_rate"]: assert name in root.variables assert_array_equal( np.reshape(root.variables[name], -1), field.at_node[name] ) root.close() def test_2d_unit_spacing(): """Test write_netcdf with a 2D grid with unit spacing.""" (x, y) = np.meshgrid(np.arange(5.0), np.arange(4.0)) spacing = _get_raster_spacing((y, x)) assert spacing == 1.0 def test_2d_non_unit_spacing(): """Test _get_raster_spacing with a 2D grid with non-unit spacing.""" (x, y) = np.meshgrid(np.arange(5.0) * 2, np.arange(4.0) * 2) spacing = _get_raster_spacing((y, x)) assert spacing == 2.0 def test_2d_uneven_spacing_axis_0(): """Test _get_raster_spacing with a 2D grid with uneven spacing in y.""" (x, y) = np.meshgrid(np.logspace(0.0, 2.0, num=5), np.arange(4.0)) with pytest.raises(NotRasterGridError): _get_raster_spacing((y, x)) def test_2d_uneven_spacing_axis_1(): """Test _get_raster_spacing with a 2D grid with uneven spacing in x.""" (x, y) = np.meshgrid(np.arange(4.0), np.logspace(0.0, 2.0, num=5)) with pytest.raises(NotRasterGridError): _get_raster_spacing((y, x)) def test_2d_switched_coords(): """Test _get_raster_spacing with a 2D grid when the spacing is switched.""" (x, y) = np.meshgrid(np.arange(5.0), np.arange(4.0)) spacing = _get_raster_spacing((x, y)) assert spacing == 0.0 def test_1d_unit_spacing(): """Test _get_raster_spacing with a 1D grid with unit spacing.""" spacing = _get_raster_spacing((np.arange(5.0),)) assert spacing == 1.0 def test_1d_non_unit_spacing(): """Test _get_raster_spacing with a 1D grid with non-unit spacing.""" spacing = _get_raster_spacing((np.arange(5.0) * 2,)) assert spacing == 2.0 def test_1d_uneven_spacing(): """Test _get_raster_spacing with a 1D grid with uneven spacing in y.""" with pytest.raises(NotRasterGridError): _get_raster_spacing((np.logspace(0.0, 2.0, num=5),)) def test_netcdf_write_at_cells(tmpdir): """Test write_netcdf using with cell fields""" field = RasterModelGrid((4, 3)) field.add_field( "topographic__elevation", np.arange(field.number_of_cells), at="cell" ) field.add_field("uplift_rate", np.arange(field.number_of_cells), at="cell") with tmpdir.as_cwd(): write_netcdf("test-cells.nc", field, format="NETCDF4") root = nc.Dataset("test-cells.nc", "r", format="NETCDF4") for name in ["topographic__elevation", "uplift_rate"]: assert name in root.variables assert_array_equal( np.reshape(root.variables[name], -1), field.at_cell[name] ) assert set(root.dimensions) == set(["nv", "ni", "nj", "nt"]) assert len(root.dimensions["nv"]) == 4 assert len(root.dimensions["ni"]) == 1 assert len(root.dimensions["nj"]) == 2 assert len(root.dimensions["nt"]) == 1 assert root.dimensions["nt"].isunlimited() assert set(root.variables) == set( ["x_bnds", "y_bnds", "topographic__elevation", "uplift_rate"] ) root.close() def test_write_llc(): pass
landlab/landlab
tests/io/netcdf/test_write_netcdf.py
Python
mit
10,251
[ "NetCDF" ]
39f09920e5f183547afc7993b736f5df529510e6461f59dc41e29263d01186c9
#!/usr/bin/env python # Copyright 2015 The Chromium Authors. All rights reserved. # Use of this source code is governed by a BSD-style license that can be # found in the LICENSE file. import idl_schema import json_parse from js_externs_generator import JsExternsGenerator from datetime import datetime import model import sys import unittest # The contents of a fake idl file. fake_idl = """ // Copyright 2014 The Chromium Authors. All rights reserved. // Use of this source code is governed by a BSD-style license that can be // found in the LICENSE file. // A totally fake API. namespace fakeApi { enum Greek { ALPHA, BETA, GAMMA, DELTA }; dictionary Bar { long num; }; dictionary Baz { DOMString str; long num; boolean b; Greek letter; Greek? optionalLetter; long[] arr; Bar[]? optionalObjArr; Greek[] enumArr; any[] anythingGoes; Bar obj; long? maybe; (DOMString or Greek or long[]) choice; object plainObj; }; callback VoidCallback = void(); callback BazGreekCallback = void(Baz baz, Greek greek); interface Functions { // Does something exciting! And what's more, this is a multiline function // comment! It goes onto multiple lines! // |baz| : The baz to use. static void doSomething(Baz baz, VoidCallback callback); // |callback| : The callback which will most assuredly in all cases be // called; that is, of course, iff such a callback was provided and is // not at all null. static void bazGreek(optional BazGreekCallback callback); [deprecated="Use a new method."] static DOMString returnString(); }; interface Events { // Fired when we realize it's a trap! static void onTrapDetected(Baz baz); }; }; """ # The output we expect from our fake idl file. expected_output = ("""// Copyright %s The Chromium Authors. All rights reserved. // Use of this source code is governed by a BSD-style license that can be // found in the LICENSE file. // This file was generated by: // %s. // NOTE: The format of types has changed. 'FooType' is now // 'chrome.fakeApi.FooType'. // Please run the closure compiler before committing changes. // See https://code.google.com/p/chromium/wiki/ClosureCompilation. /** @fileoverview Externs generated from namespace: fakeApi */ /** * @const */ chrome.fakeApi = {}; /** * @enum {string} * @see https://developer.chrome.com/extensions/fakeApi#type-Greek */ chrome.fakeApi.Greek = { ALPHA: 'ALPHA', BETA: 'BETA', GAMMA: 'GAMMA', DELTA: 'DELTA', }; /** * @typedef {{ * num: number * }} * @see https://developer.chrome.com/extensions/fakeApi#type-Bar */ chrome.fakeApi.Bar; /** * @typedef {{ * str: string, * num: number, * b: boolean, * letter: !chrome.fakeApi.Greek, * optionalLetter: (!chrome.fakeApi.Greek|undefined), * arr: !Array<number>, * optionalObjArr: (!Array<!chrome.fakeApi.Bar>|undefined), * enumArr: !Array<!chrome.fakeApi.Greek>, * anythingGoes: !Array<*>, * obj: !chrome.fakeApi.Bar, * maybe: (number|undefined), * choice: (string|!chrome.fakeApi.Greek|!Array<number>), * plainObj: Object * }} * @see https://developer.chrome.com/extensions/fakeApi#type-Baz */ chrome.fakeApi.Baz; /** * Does something exciting! And what's more, this is a multiline function * comment! It goes onto multiple lines! * @param {!chrome.fakeApi.Baz} baz The baz to use. * @param {function():void} callback * @see https://developer.chrome.com/extensions/fakeApi#method-doSomething */ chrome.fakeApi.doSomething = function(baz, callback) {}; /** * @param {function(!chrome.fakeApi.Baz, !chrome.fakeApi.Greek):void=} callback * The callback which will most assuredly in all cases be called; that is, * of course, iff such a callback was provided and is not at all null. * @see https://developer.chrome.com/extensions/fakeApi#method-bazGreek */ chrome.fakeApi.bazGreek = function(callback) {}; /** * @return {string} * @deprecated Use a new method. * @see https://developer.chrome.com/extensions/fakeApi#method-returnString */ chrome.fakeApi.returnString = function() {}; /** * Fired when we realize it's a trap! * @type {!ChromeEvent} * @see https://developer.chrome.com/extensions/fakeApi#event-onTrapDetected */ chrome.fakeApi.onTrapDetected;""" % (datetime.now().year, sys.argv[0])) fake_json = """// Copyright 2014 The Chromium Authors. All rights reserved. // Use of this source code is governed by a BSD-style license that can be // found in the LICENSE file. [ { "namespace": "fakeJson", "description": "Fake JSON API Stuff", "types": [ { "id": "CrazyEnum", "type": "string", "enum": ["camelCaseEnum", "Non-Characters", "5NumFirst", \ "3Just-plainOld_MEAN"] } ], "functions": [ { "name": "funcWithInlineObj", "type": "function", "parameters": [ { "type": "object", "name": "inlineObj", "description": "Evil inline object! With a super duper duper long\ string description that causes problems!", "properties": { "foo": { "type": "boolean", "optional": "true", "description": "The foo." }, "bar": { "type": "integer", "description": "The bar." }, "baz": { "type": "object", "description": "Inception object.", "properties": { "depth": { "type": "integer" } } } } }, { "name": "callback", "type": "function", "parameters": [ { "type": "object", "name": "returnObj", "properties": { "str": { "type": "string"} } } ], "description": "The callback to this heinous method" } ], "returns": { "type": "object", "properties": { "str": { "type": "string" }, "int": { "type": "number" } } } } ] } ]""" json_expected = ("""// Copyright %s The Chromium Authors. All rights reserved. // Use of this source code is governed by a BSD-style license that can be // found in the LICENSE file. // This file was generated by: // %s. // NOTE: The format of types has changed. 'FooType' is now // 'chrome.fakeJson.FooType'. // Please run the closure compiler before committing changes. // See https://code.google.com/p/chromium/wiki/ClosureCompilation. /** @fileoverview Externs generated from namespace: fakeJson */ /** * @const */ chrome.fakeJson = {}; /** * @enum {string} * @see https://developer.chrome.com/extensions/fakeJson#type-CrazyEnum */ chrome.fakeJson.CrazyEnum = { CAMEL_CASE_ENUM: 'camelCaseEnum', NON_CHARACTERS: 'Non-Characters', _5NUM_FIRST: '5NumFirst', _3JUST_PLAIN_OLD_MEAN: '3Just-plainOld_MEAN', }; /** * @param {{ * foo: (boolean|undefined), * bar: number, * baz: { * depth: number * } * }} inlineObj Evil inline object! With a super duper duper long string * description that causes problems! * @param {function({ * str: string * }):void} callback The callback to this heinous method * @return {{ * str: string, * int: number * }} * @see https://developer.chrome.com/extensions/fakeJson#method-funcWithInlineObj */ chrome.fakeJson.funcWithInlineObj = function(inlineObj, callback) {};""" % (datetime.now().year, sys.argv[0])) class JsExternGeneratorTest(unittest.TestCase): def _GetNamespace(self, fake_content, filename, is_idl): """Returns a namespace object for the given content""" api_def = (idl_schema.Process(fake_content, filename) if is_idl else json_parse.Parse(fake_content)) m = model.Model() return m.AddNamespace(api_def[0], filename) def setUp(self): self.maxDiff = None # Lets us see the full diff when inequal. def testBasic(self): namespace = self._GetNamespace(fake_idl, 'fake_api.idl', True) self.assertMultiLineEqual(expected_output, JsExternsGenerator().Generate(namespace).Render()) def testJsonWithInlineObjects(self): namespace = self._GetNamespace(fake_json, 'fake_api.json', False) self.assertMultiLineEqual(json_expected, JsExternsGenerator().Generate(namespace).Render()) if __name__ == '__main__': unittest.main()
hujiajie/chromium-crosswalk
tools/json_schema_compiler/js_externs_generator_test.py
Python
bsd-3-clause
8,543
[ "exciting" ]
f30350432281ef0cebb247c043c484c86427cd69b6bc03070ed9eb305b93e6e0
import sys import warnings import numpy as np from ase.io.trajectory import Trajectory from ase.constraints import FixedLine, FixAtoms from ase.optimize import QuasiNewton from anh_base import BaseAnalysis class TransAnalysis(BaseAnalysis): """Module for calculate the partition function of rotational modes! """ def __init__( self, an_mode, atoms, an_filename=None, settings={}, log=sys.stdout, ): super(TransAnalysis, self).__init__() self.an_mode = an_mode self.atoms = atoms self.an_filename = an_filename self.settings = settings self.log = log # Checks assert self.an_mode['type'] == 'translation' # settings self.fit_forces = settings.get('fit_forces', False) self.E_max_kT = settings.get('E_max_kT', 5) self.use_forces = settings.get('use_forces', False) self.initialize() def initial_sampling(self): """Start initial sampling of the mode. This can be done before extra samples are introduced. """ # initializing if len(self.an_mode.get('displacements', [])) == 0: self.an_mode['displacements'] = self.get_initial_points( self.settings.get('n_initial', 5)) self.add_displacement_energy(None) # adding ground state while (len(self.an_mode['displacements']) > len(self.an_mode.get('displacement_energies', []))): displacement = self.an_mode['displacements'][ len(self.an_mode['displacement_energies'])] self.add_displacement_energy(displacement) def get_initial_points(self, nsamples): """Get the points to initially calculate the potential energies at. Returns: displacements (list): The displacements along the translational path """ displacements = ( self.an_mode['transition_path_length'] * (np.array(range(0, nsamples)) / (nsamples-1))) return displacements def sample_new_point(self): """Decide what displacement to sample next We take the maximum angle distance between two samples scaled with the exponenital to the average potential energy of the two angles. > exp(avg(E[p0],E[p2])/kT) """ displacements = list(self.an_mode['displacements']) displacement_energies = list(self.an_mode['displacement_energies']) sort_args = np.argsort(displacements) displacements_sorted = np.array([displacements[i] for i in sort_args]) energies = np.array([displacement_energies[i] for i in sort_args]) energies -= np.min(energies) displacements_spacings = [ displacements_sorted[i+1] - displacements_sorted[i] for i in range(len(displacements_sorted)-1)] scaled_displacements_spacings = [ displacements_spacings[i]*np.exp( -(energies[i]+energies[i+1])/(2*self.kT)) for i in range(len(displacements)-1)] arg = np.argmax(scaled_displacements_spacings) # Pick the point in between the two displacements that is the biggest new_displacement = (displacements_sorted[arg] + 0.5*displacements_spacings[arg]) self.an_mode['displacements'] = list( np.hstack((displacements, new_displacement))) self.add_displacement_energy(new_displacement) def add_displacement_energy(self, displacement): """Add the groundstate energy for a displacements along the translational path, and adds it to an_mode['displacement_energies']. Args: displacement (float): How much to follow translational path. """ # Will otherwise do a groundstate calculation at initial positions if displacement: if displacement != self.an_mode['transition_path_length']: self.atoms.set_positions( self.get_translation_positions(displacement)) # Do 1D optimization fix_environment = FixAtoms(mask=[ i not in self.an_mode['indices'] for i in range(len(self.atoms))]) axis_relax = self.an_mode.get('relax_axis') if axis_relax: if self.use_forces: warnings.warn(' '.join([ "relax along axis and force_consistent", "should only be used with ase releases after", "Jan 2017. See", "https://gitlab.com/ase/ase/merge_requests/354" ])) c = [] for i in self.an_mode['indices']: c.append(FixedLine(i, axis_relax)) # Fixing everything that is not the vibrating part c.append(fix_environment) self.atoms.set_constraint(c) # Optimization dyn = QuasiNewton(self.atoms, logfile='/dev/null') dyn.run(fmax=self.settings.get('fmax', 0.05)) self.atoms.set_constraint(fix_environment) if not self.an_mode.get('displacement_energies'): self.an_mode['displacement_energies'] = list() if self.use_forces: e = self.atoms.get_potential_energy(force_consistent=True) # For the forces, we need the projection of the forces # on the normal mode of the rotation at the current angle v_force = self.atoms.get_forces()[ self.an_mode['indices']].reshape(-1) f = float(np.dot( v_force, self.an_mode['mode_tangent'])) if not self.an_mode.get('displacement_forces'): self.an_mode['displacement_forces'] = [f] else: self.an_mode['displacement_forces'].append(f) else: e = self.atoms.get_potential_energy() if self.traj is not None: self.traj.write(self.atoms) self.an_mode['displacement_energies'].append(e) # adding to trajectory: if self.traj is not None: self.traj.write(self.atoms) self.atoms.set_positions(self.groundstate_positions) # save to backup file: if self.an_filename: self.save_to_backup() def get_translation_positions(self, displacement): """Calculate the new positions of the atoms with the vibrational system moving along a linear translational path by a displacements given as an input. Args: displacement (float): The displacement along the translational path Returns: positions (numpy array): The new positions of the atoms with the vibrational system moved along the translational path. """ positions = self.atoms.get_positions() for index in self.an_mode['indices']: positions[index] += displacement*self.an_mode['mode_tangent'] return positions def make_inspection_traj( self, num_displacements=10, filename=None): """Make trajectory file for translational mode to inspect""" if filename is None: filename = self.an_filename+'_inspect.traj' traj = Trajectory(filename, mode='w', atoms=self.atoms) old_pos = self.atoms.positions.copy() calc = self.atoms.get_calculator() self.atoms.set_calculator() displacements = self.get_initial_points(num_displacements) for displacement in displacements: new_pos = self.get_translation_positions(displacement) self.atoms.set_positions(new_pos) traj.write(self.atoms) self.atoms.set_positions(old_pos) self.atoms.set_calculator(calc) traj.close()
keldLundgaard/ase-anharmonics
anh_trans.py
Python
lgpl-2.1
8,043
[ "ASE" ]
d9b9a3d2272ff240b08c1a56c90f3fa93e3dd65b3ad57a5c977f28aca7d7aaec
""" [11/05/2014] Challenge #187 [Intermediate] Finding Time to Reddit https://www.reddit.com/r/dailyprogrammer/comments/2ledaj/11052014_challenge_187_intermediate_finding_time/ #Description: I cover the border of my monitor with post it notes with tasks I have to do during the week. I am very unorganized. Each day I want to find the biggest block of free time to go on to Reddit. But I am not sure when that time is. I am also curious how I spend my days. This challenge you will help me get organized and find that time for me to be on Reddit. #Input: I will give you a listing of the post it notes around my monitor. Each line represents a single post it note. Sorry but they are not in any order but I was at least smart enough to date them and put the times of my daily events. #Output: Get me organized. I need to see my schedule for the week. For each day you must find the 1 block of time that is the most time between events on the post its that I can Reddit. Please help maximize my time on Reddit. Assume my start time at work is the beginning of the first event and my end time at work is the end time of the last event for that day. Then show me my final schedule. And while you are at it show me across the week how many minutes I dedicate to each task with a percentage of time it takes up my time. Hopefully I don't spend most of my time on Reddit. #Challenge Input: 11-6-2014: 05:18 AM to 06:00 AM -- code review 11-9-2014: 08:52 AM to 09:15 AM -- food 11-8-2014: 07:00 PM to 08:05 PM -- meeting 11-8-2014: 05:30 PM to 06:36 PM -- personal appointment 11-6-2014: 02:47 PM to 03:23 PM -- work 11-11-2014: 07:14 AM to 08:32 AM -- meeting 11-11-2014: 11:22 AM to 12:10 PM -- code review 11-8-2014: 01:39 PM to 02:06 PM -- food 11-9-2014: 07:12 AM to 08:06 AM -- meeting 11-9-2014: 02:14 PM to 03:15 PM -- code review 11-8-2014: 05:13 AM to 06:05 AM -- food 11-6-2014: 05:54 PM to 06:17 PM -- personal appointment 11-7-2014: 08:24 AM to 09:23 AM -- personal appointment 11-8-2014: 11:28 AM to 12:44 PM -- meeting 11-7-2014: 09:35 AM to 10:35 AM -- workout 11-9-2014: 10:05 AM to 11:15 AM -- code review 11-11-2014: 05:02 PM to 06:09 PM -- work 11-6-2014: 06:16 AM to 07:32 AM -- food 11-10-2014: 10:08 AM to 11:14 AM -- workout 11-8-2014: 04:33 PM to 05:12 PM -- meeting 11-10-2014: 01:38 PM to 02:10 PM -- workout 11-11-2014: 03:03 PM to 03:40 PM -- food 11-11-2014: 05:03 AM to 06:12 AM -- food 11-9-2014: 09:49 AM to 10:09 AM -- meeting 11-8-2014: 06:49 AM to 07:34 AM -- work 11-7-2014: 07:29 AM to 08:22 AM -- food 11-10-2014: 03:08 PM to 03:29 PM -- code review 11-9-2014: 03:27 PM to 04:39 PM -- food 11-7-2014: 05:38 AM to 06:49 AM -- meeting 11-7-2014: 03:28 PM to 04:06 PM -- code review 11-8-2014: 02:44 PM to 03:35 PM -- meeting 11-6-2014: 08:53 AM to 09:55 AM -- workout 11-11-2014: 02:05 PM to 02:49 PM -- meeting 11-10-2014: 08:29 AM to 09:23 AM -- code review 11-10-2014: 11:09 AM to 11:35 AM -- sales call 11-6-2014: 11:29 AM to 12:18 PM -- code review 11-11-2014: 08:04 AM to 08:45 AM -- work 11-9-2014: 12:27 PM to 01:29 PM -- sales call 11-7-2014: 11:04 AM to 12:07 PM -- code review 11-11-2014: 09:21 AM to 10:37 AM -- food 11-8-2014: 09:34 AM to 10:53 AM -- meeting 11-11-2014: 12:36 PM to 01:30 PM -- meeting 11-10-2014: 05:44 AM to 06:30 AM -- personal appointment 11-6-2014: 04:22 PM to 05:05 PM -- code review 11-6-2014: 01:30 PM to 01:59 PM -- sales call 11-10-2014: 06:54 AM to 07:41 AM -- code review 11-9-2014: 11:56 AM to 12:17 PM -- work 11-10-2014: 12:20 PM to 01:17 PM -- personal appointment 11-8-2014: 07:57 AM to 09:08 AM -- meeting 11-7-2014: 02:34 PM to 03:06 PM -- work 11-9-2014: 05:13 AM to 06:25 AM -- workout 11-11-2014: 04:04 PM to 04:40 PM -- food 11-9-2014: 06:03 AM to 06:26 AM -- code review 11-6-2014: 10:32 AM to 11:22 AM -- sales call 11-6-2014: 07:51 AM to 08:25 AM -- personal appointment 11-7-2014: 01:07 PM to 02:14 PM -- meeting #FAQ: Dates are mm-dd-yyyy #Check this out: If you have ideas for challenges - please visit and post on /r/dailyprogrammer_ideas Check out side bar -- we have an IRC channel. A listing of past challenges and much more. """ def main(): pass if __name__ == "__main__": main()
DayGitH/Python-Challenges
DailyProgrammer/DP20141105B.py
Python
mit
4,469
[ "VisIt" ]
367cdbc31cf721aa943108322dbb7c2e3e36a992aabfbba4903ba39e9c0ac2b0
import os import unittest import vtk, qt, ctk, slicer from slicer.ScriptedLoadableModule import * import logging import glob import sys from subprocess import call import numpy as np import SimpleITK as sitk import sitkUtils # # ImportSubject # class ImportSubject(ScriptedLoadableModule): """Uses ScriptedLoadableModule base class, available at: https://github.com/Slicer/Slicer/blob/master/Base/Python/slicer/ScriptedLoadableModule.py """ def __init__(self, parent): ScriptedLoadableModule.__init__(self, parent) self.parent.title = "ImportSubject" # TODO make this more human readable by adding spaces self.parent.categories = ["Netstim"] self.parent.dependencies = [] self.parent.contributors = ["John Doe (AnyWare Corp.)"] # replace with "Firstname Lastname (Organization)" self.parent.helpText = """ This is an example of scripted loadable module bundled in an extension. It performs a simple thresholding on the input volume and optionally captures a screenshot. """ self.parent.helpText += self.getDefaultModuleDocumentationLink() self.parent.acknowledgementText = """ This file was originally developed by Jean-Christophe Fillion-Robin, Kitware Inc. and Steve Pieper, Isomics, Inc. and was partially funded by NIH grant 3P41RR013218-12S1. """ # replace with organization, grant and thanks. # # ImportSubjectWidget # class ImportSubjectWidget(ScriptedLoadableModuleWidget): """Uses ScriptedLoadableModuleWidget base class, available at: https://github.com/Slicer/Slicer/blob/master/Base/Python/slicer/ScriptedLoadableModule.py """ def setup(self): ScriptedLoadableModuleWidget.setup(self) # Instantiate and connect widgets ... # # Subject Directory Area # self.subjectDirectoryButton = ctk.ctkDirectoryButton() self.subjectDirectoryButton.text = "Select Lead-DBS directory" self.layout.addWidget(self.subjectDirectoryButton) # # Images Area # imagesCollapsibleButton = ctk.ctkCollapsibleButton() imagesCollapsibleButton.text = "Images" self.layout.addWidget(imagesCollapsibleButton) # Layout within the dummy collapsible button imagesFormLayout = qt.QFormLayout(imagesCollapsibleButton) # # select images list # self.imagesList = qt.QListWidget() self.imagesList.setSelectionMode(qt.QAbstractItemView.ExtendedSelection) imagesFormLayout.addRow(self.imagesList) # # Transforms Area # transformsCollapsibleButton = ctk.ctkCollapsibleButton() transformsCollapsibleButton.text = "Transforms" self.layout.addWidget(transformsCollapsibleButton) # Layout within the dummy collapsible button transformsFormLayout = qt.QFormLayout(transformsCollapsibleButton) # converts transforms self.updateTransformButton = qt.QPushButton('Update Transform') self.updateTransformButton.visible = False transformsFormLayout.addRow(self.updateTransformButton) # # check box select transforms # self.transformsList = qt.QListWidget() self.transformsList.setSelectionMode(qt.QAbstractItemView.ExtendedSelection) imagesFormLayout.addRow(self.transformsList) # # Import Button # self.importButton = qt.QPushButton("Import") self.importButton.toolTip = "Import selected options." self.importButton.enabled = True self.layout.addWidget(self.importButton) # connections self.importButton.connect('clicked(bool)', self.onImportButton) self.updateTransformButton.connect('clicked(bool)', self.onUpdateTransformButton) self.subjectDirectoryButton.directoryChanged.connect(self.onSubjectDirectoryChanged) # Add vertical spacer self.layout.addStretch(1) # Refresh Apply button state self.onSubjectDirectoryChanged('.') def cleanup(self): pass def onSubjectDirectoryChanged(self, directory): logic = ImportSubjectLogic() self.imagesList.clear() self.imagesList.addItems(logic.getAvailableModalities(directory)) self.transformsList.clear() self.transformsList.addItems(logic.getAvailableTransforms(directory)) # check for old transform version self.updateTransformButton.visible = logic.ish5Transform(directory) # change subject buton text to subject directory name subjectName = os.path.basename(directory) if self.imagesList.count else "Select Lead-DBS directory" self.subjectDirectoryButton.text = subjectName def onImportButton(self): logic = ImportSubjectLogic() for i in range(self.imagesList.count): if self.imagesList.item(i).isSelected(): logic.importImage(self.subjectDirectoryButton.directory, self.imagesList.item(i).text()) for i in range(self.transformsList.count): if self.transformsList.item(i).isSelected(): logic.importTransform(self.subjectDirectoryButton.directory, self.transformsList.item(i).text()) def onUpdateTransformButton(self): logic = ImportSubjectLogic() directory = self.subjectDirectoryButton.directory logic.updateTranform(directory) # update self.onSubjectDirectoryChanged(directory) # # ImportSubjectLogic # class ImportSubjectLogic(ScriptedLoadableModuleLogic): """This class should implement all the actual computation done by your module. The interface should be such that other python code can import this class and make use of the functionality without requiring an instance of the Widget. Uses ScriptedLoadableModuleLogic base class, available at: https://github.com/Slicer/Slicer/blob/master/Base/Python/slicer/ScriptedLoadableModule.py """ def ish5Transform(self, directory): return os.path.isfile(os.path.join(directory, 'glanatComposite.h5')) def getAvailableModalities(self, directory): modalities = [] listing = glob.glob(os.path.join(directory,'anat_*.nii')) for fileName in listing: fileName = os.path.split(fileName)[-1] # remove directory fileName = os.path.splitext(fileName)[0] # remove extension modality = fileName[5:] # remove 'anat_' modalities.append(modality) return modalities def getAvailableTransforms(self, directory): posibleTransforms = ["glanat0GenericAffine_backup.mat", "glanatComposite.nii.gz", "glanatInverseComposite.nii.gz"] availableTransforms = [pt for pt in posibleTransforms if os.path.isfile(os.path.join(directory,pt))] return availableTransforms def createNodeName(self, directory, fileName): subjectName = os.path.split(os.path.abspath(directory))[-1] fileNameNoExt = os.path.splitext(os.path.splitext(fileName)[0])[0] return subjectName + '_' + fileNameNoExt def importImage(self, directory, fileName): if os.path.splitext(fileName)[-1] != '.nii': fileName = 'anat_' + fileName + '.nii' filePath = os.path.join(directory, fileName) node = slicer.util.loadVolume(filePath, properties={'show':False}) node.SetName(self.createNodeName(directory,fileName)) return node def importTransform(self, directory, fileName): filePath = os.path.join(directory, fileName) if os.path.isfile(filePath): node = slicer.util.loadTransform(filePath) node.SetName(self.createNodeName(directory,fileName)) return node else: return None def importReconstruction(self, directory): pass def updateTranform(self, directory, antsApplyTransformsPath=None): # flatten if not antsApplyTransformsPath: w = qt.QWidget() fd = qt.QFileDialog(w,'AntsApplyTransformsPath') if fd.exec(): antsApplyTransformsPath = fd.selectedFiles()[0] else: return False for transform,reference in zip(['glanatComposite','glanatInverseComposite'],['glanat','anat_t1']): transformFullPath = os.path.join(directory,transform + '.h5') # in case inverse doesnt exist if os.path.isfile(transformFullPath): command = antsApplyTransformsPath + " -r " + os.path.join(directory,reference + '.nii') + " -t " + transformFullPath + " -o [" + os.path.join(directory,transform + '.nii.gz') + ",1] -v 1" commandOut = call(command, env=slicer.util.startupEnvironment(), shell=True) # run antsApplyTransforms os.remove(transformFullPath) return True def runBinaryThresholdImageFilter(self, inputNode, outputNode): # run Simple ITK threshold Filter inputImage = sitkUtils.PullVolumeFromSlicer(inputNode) myFilter = sitk.BinaryThresholdImageFilter() myFilter.SetLowerThreshold(0.5) outputImage = myFilter.Execute(inputImage) sitkUtils.PushVolumeToSlicer(outputImage, outputNode) # run Simple ITK fill holes Filter inputImage = sitkUtils.PullVolumeFromSlicer(outputNode) myFilter = sitk.BinaryFillholeImageFilter() outputImage = myFilter.Execute(inputImage) sitkUtils.PushVolumeToSlicer(outputImage, outputNode) def importSegmentations(self, directory): # look for nifty files in the segmentations subdirectory # load the files and binarize if necesary # add the binary segments to a segmentation node # segmentation to model node listing = glob.glob(os.path.join(directory,'segmentations','*.nii*')) if not listing: return # init segmentation node segmentationNode = slicer.mrmlScene.AddNewNodeByClass('vtkMRMLSegmentationNode') segmentColor = [0] * 4 currentSegment = 0 for filename, i in zip(listing,range(len(listing))): segmentName = os.path.split(filename)[-1].split('.')[0] # name volumeNode = slicer.util.loadVolume(filename, properties={'name': 'tmp'}) # load volume node labelMapNode = slicer.mrmlScene.AddNewNodeByClass('vtkMRMLLabelMapVolumeNode') # init label map node # volume to labelmap if volumeNode.GetImageData().GetScalarType() in [vtk.VTK_FLOAT, vtk.VTK_DOUBLE]: self.runBinaryThresholdImageFilter(volumeNode, labelMapNode) else: slicer.modules.volumes.logic().CreateLabelVolumeFromVolume(slicer.mrmlScene, labelMapNode, volumeNode) # add to segmentation slicer.modules.segmentations.logic().ImportLabelmapToSegmentationNode(labelMapNode, segmentationNode) for s in range(currentSegment, segmentationNode.GetSegmentation().GetNumberOfSegments()): slicer.util.getNode('Labels').GetColor(s+1, segmentColor) # color addedSegment = segmentationNode.GetSegmentation().GetNthSegment(s) addedSegment.SetName(slicer.mrmlScene.GenerateUniqueName(segmentName)) addedSegment.SetColor(segmentColor[:-1]) currentSegment = segmentationNode.GetSegmentation().GetNumberOfSegments() # remove nodes slicer.mrmlScene.RemoveNode(volumeNode) slicer.mrmlScene.RemoveNode(labelMapNode) # add data attributes shNode = slicer.mrmlScene.GetSubjectHierarchyNode() shNode.SetItemAttribute(shNode.GetItemByDataNode(segmentationNode), 'Segment', '1') # segmentation children IDList = vtk.vtkIdList() shNode.GetItemChildren(shNode.GetItemByDataNode(segmentationNode), IDList) for i in range(IDList.GetNumberOfIds()): shNode.SetItemAttribute(IDList.GetId(i), 'Segment', '1') return segmentationNode class ImportSubjectTest(ScriptedLoadableModuleTest): """ This is the test case for your scripted module. Uses ScriptedLoadableModuleTest base class, available at: https://github.com/Slicer/Slicer/blob/master/Base/Python/slicer/ScriptedLoadableModule.py """ def setUp(self): """ Do whatever is needed to reset the state - typically a scene clear will be enough. """ slicer.mrmlScene.Clear(0) def runTest(self): """Run as few or as many tests as needed here. """ self.setUp() self.test_ImportSubject1() def test_ImportSubject1(self): """ Ideally you should have several levels of tests. At the lowest level tests should exercise the functionality of the logic with different inputs (both valid and invalid). At higher levels your tests should emulate the way the user would interact with your code and confirm that it still works the way you intended. One of the most important features of the tests is that it should alert other developers when their changes will have an impact on the behavior of your module. For example, if a developer removes a feature that you depend on, your test should break so they know that the feature is needed. """ self.delayDisplay("Starting the test") # # first, get some data # import SampleData SampleData.downloadFromURL( nodeNames='FA', fileNames='FA.nrrd', uris='http://slicer.kitware.com/midas3/download?items=5767', checksums='SHA256:12d17fba4f2e1f1a843f0757366f28c3f3e1a8bb38836f0de2a32bb1cd476560') self.delayDisplay('Finished with download and loading') volumeNode = slicer.util.getNode(pattern="FA") logic = ImportSubjectLogic() self.assertIsNotNone( logic.hasImageData(volumeNode) ) self.delayDisplay('Test passed!')
andreashorn/lead_dbs
ext_libs/SlicerNetstim/ImportSubject/ImportSubject.py
Python
gpl-3.0
12,976
[ "VTK" ]
0663aaf5a7f0d37bcdd46ab11e01021eedbf71edac39999b90a6d04ac3c84cf7
#!/usr/bin/env python3 # # vdbsetup.py - script for building Vdbench configurations # # Author: Ramon A. Lovato (ramonalovato.com) # For: DeepStorage, LLC (deepstorage.net) # import argparse import os.path import os import re import statistics import textwrap import random import numpy as np import matplotlib as mpl import matplotlib.pyplot as plt import matplotlib.mlab as mlab import pylab from collections import OrderedDict DEFAULT_MAJOR_DELIMITER = " *= *" DEFAULT_MINOR_DELIMITER = " *, *" DEFAULT_MONTE_CARLO_SAMPLES = 200000 DEFAULT_SAMPLE_SCALE = 10000 MAX_RANGE_RETRIES = 10 INPUT_TEMPLATE_CONTENT = """# # vdbsetup input file example # # # General # dedupratio=2 dedupunit=4k compratio=1.5 # # SDs # luns=lun1,lun2,lun3 # Optional: o_direct provided by default # openflags= # # WDs # wdcount=1 xfersize=4k seekpct=100 rdpct=75 percentdisk=100.0 # # RDs # iorate=1000 format=yes elapsed=60 interval=1 threads=2 # # Distribution # hotspotnum=10 hotspotcap=25 hotspotiopct=10 disttype=gaussian # Note: only required if disttype=gaussian distribution=0.75,0.5 """ # # Helper dictionaries for single-entry input parsing. # # Dictionary of validation lambdas. validators = { "dedupratio": lambda v: float(v) >= 0, "compratio": lambda v: float(v) >= 0, "wdcount": lambda v: float(v) > 0, "seekpct": lambda v: 0 <= float(v) <= 100, "rdpct": lambda v: 0 <= float(v) <= 100, "percentdisk": lambda v: 0 <= float(v) <= 100, "iorate": lambda v: float(v) > 0, "format": lambda v: re.match("(yes)|(no)", v.lower()), "threads": lambda v: int(v) > 0, "elapsed": lambda v: int(v) > 0, "interval": lambda v: int(v) > 0, "hotspotnum": lambda v: int(v) >= 0, "hotspotcap": lambda v: 0 <= float(v) <= 100, "hotspotiopct": lambda v: 0 <= float(v) <= 100, "disttype": lambda v: re.match("(even)|(gaussian)|(uniform)", v.lower()) } # Dictionary of processing lambdas. processors = { "dedupratio": lambda v: float(v), "compratio": lambda v: float(v), "wdcount": lambda v: int(v), "seekpct": lambda v: float(v), "rdpct": lambda v: float(v), "percentdisk": lambda v: float(v), "iorate": lambda v: float(v), "format": lambda v: v.lower(), "threads": lambda v: int(v), "elapsed": lambda v: int(v), "interval": lambda v: int(v), "hotspotnum": lambda v: int(v), "hotspotcap": lambda v: float(v), "hotspotiopct": lambda v: float(v), "disttype": lambda v: v.lower() } # Dictionary of custom usage messages. messages = { "dedupratio": 'Key "dedupratio" requires nonnegative value.', "compratio": 'Key "compratio" requires nonnegative value.', "wdcount": 'Key "wdcount" requires positive integer value.', "seekpct": 'Key "seekpct" requires percentage in range [0, 100].', "rdpct": 'Key "rdpct" requires percentage in range [0, 100].', "percentdisk": 'Key "percentdisk" requires single percentage in range [0, 100].', "iorate": 'Key "iorate" requires positive IOPS value.', "format": 'Key "format" must be one of "yes", "no".', "threads": 'Key "threads" requires positive integer queue depth.', "elapsed": 'Key "elapsed" requires positive integer number of seconds.', "interval": 'Key "interval" requires positive integer number of seconds.', "hotspotnum": 'Key "hotspotnum" requires nonnegative integer number of hotspots.', "hotspotcap": 'Key "hotspotcap" requires percentage in range [0, 100].', "hotspotiopct": 'Key "hotspotiopct" requires percentage in range [0, 100].', "disttype": 'Key "disttype" must be one of "even", "gaussian", "uniform".' } multiValidators = { "luns": lambda v: len(v) > 0, "openflags": lambda v: len(v) > 0, "distribution": lambda v: config["disttype"] == "gaussian" and len(v) == 2 and len(list(filter(lambda w: float(w) >= 0, v))) == 2 } multiProcessors = { "luns": lambda v: v, "openflags": lambda v: v, "distribution": lambda v: list(map(float, v)) } multiMessages = { "luns": 'Key "luns" requires at least one LUN', "openflags": 'Key "openflags" requires at least one flag.', '"min,max", such that 0 <= min <= max <= 100.' "distribution": 'Key "distribution" is only valid for Gaussian ' 'distributions, and keys "hotspotnum" and "disttype" must ' 'be set first. Values must be of form ' '"SKEW_STD_DEV,RANGE_STD_DEV", where both standard ' 'deviations are nonnegative floating point values.' } # Uses an OrderedDict because certain parameters must be specified before # other parameters. config = OrderedDict({ # General "dedupratio": None, # Deduplication ratio "dedupunit": None, # Deduplication unit "compratio": None, # Compression ratio # SDs "luns": None, # Luns, list OK # WDs "wdcount": None, # Number of workloads "xfersize": None, # Block size "seekpct": None, # Percent random "rdpct": None, # Percent read (vs. write) "percentdisk": None, # How much of the total disk to use # RDs "iorate": None, # IOPS "format": None, # Pre-format lun "threads": None, # Qeueue depth "elapsed": None, # Duration "interval": None, # Update frequency # Distribution "hotspotnum": None, # Number of hotspots "hotspotcap": None, # Total capacity percent for all hotspots "hotspotiopct": None, # Percent of IO for ALL hotspots "disttype": None # Distribution type: even, gaussian, uniform # # Added inline only if needed # # "openflags": [] # - open flags for SDs # - o_direct provided by default as block devices require it # "distribution": [] # - parameters for the distribution # # Type | Params # ------------------------------------------ # - gaussian | STANDARD_DEVIATION_SKEW, STANDARD_DEVIATION_RANGE }) # # Factories. # # Parent class. class Factory: def __init__(self, name_type="name", name=None, keys=None): self.name_type=name_type self.params = OrderedDict() self.params[name_type] = name for key in keys: self.addKey(key) def addKey(self, key): self.params[key] = None def set(self, key, *values): if not key in self.params: self.addKey(key) if len(values) < 1: raise ValueError('Error: no values passed for key "{}".'.format( key)) elif len(values) == 1: self.params[key] = values[0] else: self.params[key] = values def setName(self, name): self.set(self.name_type, name) def append(self, key, *values): if len(values) == 0: return if not key in self.params: self.set(key, values) else: if not isinstance(self.params[key], list): self.params[key] = [self.params[key]] for v in values: if isinstance(v, list): for w in v: self.params[key].append(w) else: self.params[key].append(v) def toString(self): partials = [] for k, v in self.params.items(): if v == None: raise Exception('Error: key "{}" not assigned (value None).'.format(k)) if isinstance(v, list) or isinstance(v, tuple): if len(v) == 0: raise Exception('Error: key {} has length 0.'.format(k)) if len(v) == 1: partial = "{}={}".format(k, truncate(v[0])) else: partial = "{}=({})".format( k, ",".join([str(truncate(w)) for w in v])) else: partial = "{}={}".format(k, truncate(v)) partials.append(partial) return ",".join(partials) class SDFactory(Factory): def __init__(self): super().__init__(name_type="sd", keys=[ "lun", "openflags" ]) self.set("openflags", ["o_direct"]) def appendOpenFlags(self, *fstrings): # Filter out duplicates, including "o_direct, since it's provided by # default. for f in fstrings: for g in f: if g not in self.params["openflags"]: self.append("openflags", g) class WDFactory(Factory): def __init__(self): super().__init__(name_type="wd", keys=[ "sd", "xfersize", "seekpct", "rdpct" ]) def addRange(self, r): self.set("range", r) class RDFactory(Factory): def __init__(self): super().__init__(name_type="rd", keys=[ "wd", "iorate", "format", "threads", "elapsed", "interval" ]) # # Functions. # # Get CLI arguments. def getArgs(customArgs=None): parser = argparse.ArgumentParser( description="create Vdbench hotspot-distribution configuration files") # Positional. parser.add_argument("inPath", type=str, nargs="?", default=None, help="where to find the input file") parser.add_argument("outPath", type=str, nargs="?", default=None, help="where to output the configuration file") # Optional. parser.add_argument("--make-template", action="store_true", help="create an example input file and exit") parser.add_argument("-v", "--verbose", action="store_true", help="enable verbose mode") parser.add_argument("-gs", "--graph-skews", action="store_true", help="enable graph display of the hotspot skews") parser.add_argument("-gr", "--graph-ranges", action="store_true", help="enale graph display of the hotspots ranges") parser.add_argument("--no-overwrite", action="store_true", help="don't overwrite output file if it already exists") parser.add_argument("--no-shuffle", action="store_true", help="disable random hotspot permutation") parser.add_argument("--header", type=str, help="add a comment header") parser.add_argument("-M", "--major-delimiter", type=str, default=DEFAULT_MAJOR_DELIMITER, help='major delimiter regex used in configuration file (default "{}")'.format( DEFAULT_MAJOR_DELIMITER)) parser.add_argument("-m", "--minor-delimiter", type=str, default=DEFAULT_MINOR_DELIMITER, help='minor delimiter regex used in configuration file (default "{}")'.format( DEFAULT_MINOR_DELIMITER)) parser.add_argument("-c", "--sample-count", type=int, default=DEFAULT_MONTE_CARLO_SAMPLES, help="number of samples to generate when using Monte Carlo method " "to compute distributions (default {}); setting sample size < 10000 " "is strongly discourage".format( DEFAULT_MONTE_CARLO_SAMPLES)) if customArgs: args = parser.parse_args(customArgs) else: args = parser.parse_args() # If make_template is set, we can just return without the extra checks, # since we won't need any of them. if args.make_template: return args # Otherwise, make sure the inPath and outPath were actually set. if not args.inPath or args.inPath == "" or not args.outPath or args.outPath == "": parser.print_help() exit() args.outPath = os.path.realpath(args.outPath) # Verify input file exists. if not os.path.exists(args.inPath): print("Error: input file {} does not exist.".format(args.inPath)) exit() elif not os.path.isfile(args.inPath): print("Error: input path {} is not a valid file.".format(args.inPath)) exit() # Verify output directories exist. os.makedirs(os.path.dirname(args.outPath), exist_ok=True) # Check delimiters. if not args.major_delimiter or len(args.major_delimiter) == 0: print("Error: major delimiter cannot be empty. Using default ({}).".format( DEFAULT_MAJOR_DELIMITER)) args.major_delimiter = DEFAULT_MAJOR_DELIMITER elif not args.minor_delimiter or len(args.minor_delimiter) == 0: print("Error: minor_delimiter cannot be empty, Using default ({}).".format( DEFAULT_MINOR_DELIMITER)) elif args.major_delimiter == args.minor_delimiter: print("Error: major and minor delimiter cannot be the same. Using defaults ({}, {}).".format( DEFAULT_MAJOR_DELIMITER, DEFAULT_MINOR_DELIMITER)) args.major_delimiter = DEFAULT_MAJOR_DELIMITER args.minor_delimiter = DEFAULT_MINOR_DELIMITER # Check sample count. if args.sample_count < 10000: print("Warning: setting sample size < 10000 is strongly discouraged. " "Errors and unspecified behavior may occur.") return args # Parse the input file. def parseInput(inPath, major_del=DEFAULT_MAJOR_DELIMITER, minor_del=DEFAULT_MINOR_DELIMITER, verbose=False): with open(inPath, "r") as inFile: for realLine in inFile: line = realLine.strip() # Comment or empty. if len(line) == 0 or line.startswith("#"): continue tokens = re.split(major_del, line, maxsplit=1) if len(tokens) < 2: printBadLine(line) elif len(tokens[1]) < 1: printBadLine(line, custom="Empty value.") key = tokens[0].lower() values = [stripQuotes(v) for v in re.split(minor_del, tokens[1])] parseLine(key, values, line, config) # Check for incomplete entries. incompletes = [] for k, v in config.items(): if v == None: incompletes.append(k) if (k == "disttype" and v == "gaussian" and not "distribution" in config.keys()): incompletes.append("distribution required when disttype is " "gaussian") if verbose: print("{}={}".format(k, str(v))) if len(incompletes) > 0: print("\nError: input file is missing the following specifications:") for k in incompletes: print(" - {}".format(k)) exit() return config # Evaluate a single input line. def parseLine(key, values, line, config): # Keys for which lists are valid. if key in multiValidators.keys(): parseListHelper(key, values, line, config) else: parseSingleHelper(key, values, line, config) # Nonlist helper for parseLine. def parseSingleHelper(key, values, line, config): if len(values) != 1: printBadLine(line, custom='Key "{}" accepts exactly one value.'.format( key)) value = values[0] # Validate the key exists. validateKey(key, line, config) # Validate the key according to its specific criteria. try: # Short-circuits if key is unchecked. if key in validators.keys() and not validators[key](value): printBadLine(line, custom=messages[key]) except ValueError as e: printBadLine(line, custom=messages[key]) config[key] = (processors[key](value) if key in processors.keys() else value) # List helper for parseLine. def parseListHelper(key, values, line, config): # Distribution and openflags are special and get added only if present. if key == "distribution": if not config["hotspotnum"] or not config["disttype"]: printBadLine(line, custom='Keys "hotspotnum" and "disttype" must be specified before "distribution".') config["distribution"] = None if key == "openflags": config["openflags"] = None # Validate the key exists. validateKey(key, line, config) # Validate the key according to its specific criteria. try: # Short-circuits if key is unchecked. if key in multiValidators.keys() and not multiValidators[key](values): printBadLine(line, custom=multiMessages[key]) except ValueError as e: printBadLine(line, custom=multiMessages[key]) config[key] = (multiProcessors[key](values) if key in multiProcessors.keys() else values) # Validate a key. def validateKey(key, line, config): # Check to make sure the key is recognized. if key not in config: printBadLine(line, "Unrecognized key: {}.".format(key)) # Check to make sure the key isn't a duplicate. if config[key]: printBadLine(line, "Duplicate specification.") # Strip quotes. def stripQuotes(string): if re.match(r"^[\"\'].*[\"\']$", string): return string[1:-1] else: # Nothing to do. return string # Print uninterpretable line error and exit. def printBadLine(line, custom=None): print('Error: bad input line "{}".{}'.format(line, " {}".format(custom) if custom else "")) exit() # Create a header comment block. def makeCommentHeader(header): wrapper = textwrap.TextWrapper( width=70, initial_indent="# ", subsequent_indent="# ", expand_tabs=True, drop_whitespace=True, fix_sentence_endings=False, break_long_words=True, break_on_hyphens=True) return ["#\n"] + wrapper.wrap(header) + ["\n#\n"] # Create general configuration lines. def makeGeneral(config): genList = [] for k in ["dedupratio", "dedupunit", "compratio"]: genList.append("{}={}\n".format(k, truncate(config[k]))) return genList # Create storage definitions. def makeSDs(config): sdList = [] i = 0 for lun in config["luns"]: i += 1 sdf = SDFactory() sdf.setName("sd{}".format(i)) sdf.set("lun", lun) if "openflags" in config: sdf.appendOpenFlags(config["openflags"]) sdList.append(sdf.toString() + "\n") return sdList # Create skews -- percentage of allotted hotspot IO percentage that goes to # each hotspot. def makeSkews(args, config, graph=False): skews = [] mode = config["disttype"] hsCount = config["hotspotnum"] wdCount = config["wdcount"] totalCount = hsCount + wdCount ioPct = config["hotspotiopct"] # Even. if mode == "even": skews = [ioPct / totalCount] * hsCount # Graph if requested. graphSkews(config, mode, skews) # Gaussian elif mode == "gaussian": sigma = config["distribution"][0] skews = makeGaussianSkews(sigma, args.sample_count, hsCount, ioPct) # Graph if requested. graphSkews(config, mode, skews, sigma=sigma) # Uniform elif mode == "uniform": skews = [random.random() for i in range(hsCount)] skewSum = sum(skews) skews = [ioPct * s / skewSum for s in skews] # Graph if requested. graphSkews(config, mode, skews) for s in skews: assert s > 0, "Size 0 skew generated." # Shuffle. if not args.no_shuffle: random.shuffle(skews) return skews # Use Monte Carlo method to determine the skews for the hotspots by generating # sampleCount samples in the Gaussian distribution f(X | mu, sigma^2) and # determining what the probability is of a sample ending up in each bucket. # # @param dev Standard deviation for the normal distribution. # @param sampleCount Number of samples to generate. # @param hSCount Number of hotspots to generate. # @param ioPct Percentage of total IOs to split among skews (ioPct * skew). def makeGaussianSkews(sigma, sampleCount, hsCount, ioPct): # Generate many samples sorted by natural ordering. samples = getGaussianSamples(0.0, sigma, sampleCount) # Determine number of samples in each bucket. buckets = getBucketCounts(samples, -1.0, 1.0, hsCount) # Determine skews. bucketSum = sum(buckets) skews = [ioPct * (b / bucketSum) for b in buckets] return skews # Helper function for the Gaussian sampling procedures that returns the buckets # for a given *sorted* collection of samples. # # @param samples Sorted list of samples to count for the buckets. # @param distMin Minimum sample value we care about. Samples < distMin are # ignored. # @param distMax Maximum sample value we care about. Samples >= distMax are # ignored. # @param bucketCount Number of buckets to generate. # @return List of buckets containing the number of samples in each. def getBucketCounts(samples, distMin, distMax, bucketCount): distRange = abs(distMax - distMin) assert distRange > 0, "distRange = 0" assert bucketCount > 0, "bucketCount = 0" distStride = float(distRange) / bucketCount # Calculate bucket boundaries. We do it this way instead of using # np.arrange because we care more about the list being the right length # than about small floating point errors. bucketBounds = [distMin + (distStride * i) for i in range(bucketCount)] # Sanity check to make sure we generated the right number of buckets. assert len(bucketBounds) == bucketCount, "Generated wrong number of buckets" # Determine number of samples in each bucket. buckets = [] for bucketIt in range(len(bucketBounds)): buckets.append(0) bucketMin = bucketBounds[bucketIt] bucketMax = distMax if bucketIt >= len(bucketBounds)-1 else bucketBounds[bucketIt + 1] # Slow but reliable. buckets[bucketIt] = len(list(filter(lambda s: bucketMin <= s < bucketMax, samples))) return buckets # Helper function for generating a sorted list of samples from a Gaussian # distribution. def getGaussianSamples(mu, sigma, sampleCount): samples = np.random.normal(mu, sigma, sampleCount) samples.sort() return samples # Graph Gaussian skews histogram using matplotlib. # # @param skews Skews to graph. # @param binCount Number of bins for the histogram. # @param mu Mean of the distribution. If None, will be determined automatically # from the mean of samples. # @param sigma Standard deviation of the distribution. If None, will be # determined automatically from the standard deviation of samples. def graphGaussianSkews(skews, binCount, sigma=None): barX = np.arange(len(skews)) barY = np.array(skews) plt.bar(barX, barY, 1, color="blue") plt.draw() # Graph a bar chart of skews using matplotlib. # # @param skews Skews to graph. # @param yLim Max value for y-axis. def graphSkewBars(skews, yLim): x = range(len(skews)) y = np.array(skews) width = 1 plt.bar(x, y, width, color="blue") plt.draw() # Graph the skews distribution using matplotlib. # # @param config Configuration dictionary. # @param mode Distribution type: "gaussian" or "even". # @param skews Skews distribution. # @param sigma Standard deviation of the distribution. def graphSkews(config, mode, skews, sigma=None): plt.figure(1) fig = plt.figure(1) fig.suptitle("Skews - mode: {}".format(mode)) plt.xlabel("Hotspot number") plt.ylabel("Percentage of IOs") graphSkewBars(skews, config['hotspotiopct']) # Graph the ranges distribution histogram using matplotlib. # # @param config Configuration dictionary. # @param ranges Range distribution. # @param skews Skews distribution. def graphRanges(config, ranges, skews): plt.figure(2) fig = plt.figure(2) fig.suptitle("Ranges - mode: {}".format(config["disttype"])) plt.xlabel("Disk location") plt.ylabel("Percentage of IOs") count = config["hotspotnum"] ioPct = config["hotspotiopct"] # Sanity check. assert count == len(ranges) == len(skews), "The number of ranges or skews is incorrect." triplets = [] for i in range(count): x = ranges[i][0] y = skews[i] w = ranges[i][1]-x triplets.append((x, y, w)) triplets.sort(key=lambda t: t[0]) x = np.array([triplets[i][0] for i in range(count)]) y = np.array([triplets[i][1] for i in range(count)]) widths = np.array([triplets[i][2] for i in range(count)]) plt.bar(x, y, widths, color="blue") plt.draw() pylab.xlim([0, 100]) # Use Monte Carlo method to determine the ranges for the hotspots by generating # 2 * sampleCount samples in the Gaussian distribution f(X | mu, sigma^2) and # counting the samples that sit above the mean. # # @param dev Standard deviation for the normal distribution. # @param halfCount One-half the number of samples to generate. This number # will be doubled so that 2 * halfCount samples are generated. # @param hSCount Number of hotspots to generate. # @param capacity Percentage of total capacity to split among all hotspots. def getGaussianRangeComponents(sigma, halfCount, hsCount, capacity, percentDisk): # Calculate sizes via uniform-random sampling. sizes = [random.random() for i in range(hsCount)] partSum = sum(sizes) for i in range(len(sizes)): sizes[i] = capacity * (sizes[i] / partSum) # Calculate positions from a Gaussian distribution. In order to skew # the positions near the beginning of the disk, we generate double the # number of input samples and only count those that are above the mean. sampleCount = 2 * halfCount # Generate many samples sorted by natural ordering. samples = getGaussianSamples(0.0, sigma, sampleCount) buckets = getBucketCounts(samples, 0.0, 1.0, hsCount) buckets.reverse() # Determine start positions. bucketSum = sum(buckets) positions = [] for i in range(hsCount): b = percentDisk * buckets[i] / bucketSum if i > 0: b += positions[i-1] if b < 0.0: b = 0.0 elif b > percentDisk: b = percentDisk positions.append(b) # Sanity check to make sure we generated the same number of sizes and # positions. assert len(sizes) == len(positions) == hsCount, "Generated an unequal number of sizes and positions." return sizes, positions # Helper function for assembling ranges from sizes and positions. def assembleRanges(sizes, positions, hsCount, capacity, percentDisk, noShuffle=False): ranges = [] hsSum = 0 # We deliberately don't break out of the loop early in the event of # overflow. We could do that, but it would result in our generating the # wrong number of ranges, which would cause problems later. Instead, # we let the loop continue, which will generate ranges of size 0 for all # those after the overflow occurred. for i in range(hsCount): r = assembleRangesHelper(ranges, positions[i], sizes[i], capacity, percentDisk, hsSum) ranges.append(r) hsSum += r[1] - r[0] # Need to resort the ranges after each iteration in case we added one # out of order. ranges.sort(key=lambda r: r[0]) if not noShuffle: random.shuffle(ranges) return ranges # Helper for assembleRanges that tries to construct a new range according to # specifications. # # @param ranges Currently allotted ranges. # @param size Size of the range to generate. # @param capacity Maximum size of sum of all hotspots. # @param percentDisk Maximum percent of disk we're allowed to use. # @param hsSum The current sum of all hotspot sizes. def assembleRangesHelper(ranges, position, size, capacity, percentDisk, hsSum): if hsSum + size > capacity: size = capacity - hsSum hsSize = formatRangeVal(size) assert hsSize > 0.0, "Size 0 hotspot generated." hsStart = formatRangeVal(position) hsEnd = formatRangeVal(hsStart + size) if checkRangeConflicts(ranges, hsStart, hsEnd): hsStart = ranges[-1][1] hsEnd = formatRangeVal(hsStart + size) # We exceeded the capacity. Try to insert it at a (uniform) random position. if not checkRangeVals(hsStart, hsEnd, percentDisk): tries = 0 while True: hsStart = formatRangeVal(random.uniform(0.0, percentDisk)) hsEnd = formatRangeVal(hsStart + size) if (checkRangeVals(hsStart, hsEnd, percentDisk) and not checkRangeConflicts(ranges, hsStart, hsEnd)): break tries += 1 if tries >= MAX_RANGE_RETRIES: raise Exception("Error: unable to generate random non-overlapping range within {} tries.".format( MAX_RANGE_RETRIES)) # Sanity check. assert checkRangeVals(hsStart, hsEnd, percentDisk), "Generated an invalid range: ({},{}). Allowed percentage of disk: {}.".format( hsStart, hsEnd, percentDisk) return (hsStart, hsEnd) # Format a range value by truncating it to two decimal places. def formatRangeVal(val): return float(truncate(val)) # Check if range is valid stand-alone, but does not check for conflicts. def checkRangeVals(start, end, percentDisk): return 0.0 <= start < end <= percentDisk # Check for range conflict. # # @param ranges Currently allotted ranges. # @param start Start of range. # @param end End of range. def checkRangeConflicts(ranges, start, end): for r in ranges: if r[0] <= start < r[1] or r[0] <= end < r[1]: return True return False # Make uniform random ranges. def makeUniformRanges(hsCount, hsSpace, percentDisk): sizes = [] positions = [] for i in range(hsCount): sizes.append(random.random()) positions.append(random.uniform(0.0, percentDisk)) positions.sort() sizeSum = sum(sizes) sizes = [hsSpace * s / sizeSum for s in sizes] return assembleRanges(sizes, positions, hsCount, hsSpace, percentDisk) # Create hotspot range distribution. def makeRanges(args, config): ranges = [] mode = config["disttype"] hsCount = config["hotspotnum"] wdCount = config["wdcount"] totalCount = hsCount + wdCount hsSpace = config["hotspotcap"] percentDisk = config["percentdisk"] # Even if mode == "even": width = hsSpace / hsCount freeSpace = percentDisk - hsSpace gapCount = hsCount + 1 gapWidth = freeSpace / gapCount stride = width + gapWidth for i in range(hsCount): start = (i * stride) + gapWidth end = start + width ranges.append((start, end)) # Gaussian elif mode == "gaussian": sigma = config["distribution"][1] sizes, positions = getGaussianRangeComponents(sigma, args.sample_count, hsCount, hsSpace, percentDisk) ranges = assembleRanges(sizes, positions, hsCount, hsSpace, config["percentdisk"], noShuffle=args.no_shuffle) # Uniform random elif mode == "uniform": ranges = makeUniformRanges(hsCount, hsSpace, percentDisk) return ranges # Make workload definitions. def makeWDs(args, config): wdList = [] wdCount = config["wdcount"] hsCount = config["hotspotnum"] percentDisk = config["percentdisk"] skews = makeSkews(args, config) ranges = makeRanges(args, config) # Setup range graph if requested. if args.graph_ranges: graphRanges(config, ranges, skews) total = wdCount + hsCount for i in range(total): wdf = WDFactory() wdf.setName("wd{}".format(i+1)) wdf.set("sd", "sd*") wdf.set("xfersize", config["xfersize"]) wdf.set("seekpct", config["seekpct"]) wdf.set("rdpct", config["rdpct"]) if percentDisk != 100.0: wdf.addRange((0, percentDisk)) # Hotspot. if i >= wdCount: j = i - wdCount - 1 wdf.set("skew", skews[j]) wdf.addRange(ranges[j]) wdList.append(wdf.toString() + "\n") return wdList # Make run definitions. def makeRDs(config): rdList = [] # There's only one RD per file, so the list is more for consistency. rdf = RDFactory() rdf.setName("rd1") rdf.set("wd", "wd*") rdf.set("iorate", config["iorate"]) rdf.set("format", config["format"]) rdf.set("threads", config["threads"]) rdf.set("elapsed", config["elapsed"]) rdf.set("interval", config["interval"]) rdList.append(rdf.toString() + "\n") return rdList # Build the output configuration file. def buildOutput(args, config, verbose=False): outPath = args.outPath if args.no_overwrite and os.path.exists(outPath): i = 0 while os.path.exists(outPath): i += 1 outPath = "{} ({})".format(args.outPath, str(i)) with open(outPath, "w") as outFile: print("\nOutput saved as {}".format(outPath)) if args.header: outFile.writelines(makeCommentHeader(args.header)) # General lines = makeGeneral(config) outFile.writelines(lines) # SDs lines = makeSDs(config) outFile.writelines(lines) # WDs and distribution lines = makeWDs(args, config) outFile.writelines(lines) # RDs lines = makeRDs(config) outFile.writelines(lines) # If the input is a floating point number, truncate it to three decimal places. # If it's an integer (its fractional portion is 0), return it as an integer. # Else return it unchanged. def truncate(f): if isinstance(f, float): if f.is_integer(): return int(f) return "{0:.2f}".format(f) return f # Create an input file template. def makeTemplate(): templatePath = "vdbsetup_input_template.txt" with open(templatePath, "w") as f: f.write(INPUT_TEMPLATE_CONTENT) print('Input file example saved as "{}".'.format(templatePath)) # Main. def main(): args = getArgs() if args.verbose: print("Verbose logging enabled.\n") if args.make_template: try: makeTemplate() except IOError as e: raise e finally: return try: config = parseInput(args.inPath, major_del=args.major_delimiter, minor_del=args.minor_delimiter, verbose=args.verbose) except IOError as e: raise e try: buildOutput(args, config, verbose=args.verbose) except IOError as e: raise e if args.graph_skews or args.graph_ranges: plt.show() if __name__ == "__main__": main()
TheOtherOtherOperation/vdbsetup
vdbsetup.py
Python
mit
34,423
[ "Gaussian" ]
505db2d22187e27df5a4e8e4182a8922634619316585fdc612642bad63250e4e
from electrum_NMC.util import print_error import httplib, urllib import socket import threading import hashlib import json from urlparse import urlparse, parse_qs try: import PyQt4 except Exception: sys.exit("Error: Could not import PyQt4 on Linux systems, you may try 'sudo apt-get install python-qt4'") from PyQt4.QtGui import * from PyQt4.QtCore import * import PyQt4.QtCore as QtCore import PyQt4.QtGui as QtGui import aes import base64 import electrum_NMC from electrum_NMC.plugins import BasePlugin, hook from electrum_NMC.i18n import _ from electrum_NMC_gui.qt import HelpButton, EnterButton class Plugin(BasePlugin): target_host = 'labelectrum.herokuapp.com' encode_password = None def fullname(self): return _('Label Sync') def description(self): return '%s\n\n%s%s%s' % (_("This plugin can sync your labels across multiple Electrum installs by using a remote database to save your data. Labels, transactions ids and addresses are encrypted before they are sent to the remote server. This code might increase the load of your wallet with a few microseconds as it will sync labels on each startup."), _("To get started visit"), " http://labelectrum.herokuapp.com/ ", _(" to sign up for an account.")) def version(self): return "0.2.1" def encode(self, message): encrypted = electrum.bitcoin.aes_encrypt_with_iv(self.encode_password, self.iv, message.encode('utf8')) encoded_message = base64.b64encode(encrypted) return encoded_message def decode(self, message): decoded_message = electrum.bitcoin.aes_decrypt_with_iv(self.encode_password, self.iv, base64.b64decode(message)).decode('utf8') return decoded_message @hook def init_qt(self, gui): self.window = gui.main_window if not self.auth_token(): # First run, throw plugin settings in your face self.load_wallet(self.window.wallet) if self.settings_dialog(): self.set_enabled(True) return True else: self.set_enabled(False) return False @hook def load_wallet(self, wallet): self.wallet = wallet mpk = self.wallet.get_master_public_key() self.encode_password = hashlib.sha1(mpk).digest().encode('hex')[:32] self.iv = hashlib.sha256(self.encode_password).digest()[:16] self.wallet_id = hashlib.sha256(mpk).digest().encode('hex') addresses = [] for account in self.wallet.accounts.values(): for address in account.get_addresses(0): addresses.append(address) self.addresses = addresses if self.auth_token(): # If there is an auth token we can try to actually start syncing threading.Thread(target=self.do_full_pull).start() def auth_token(self): return self.config.get("plugin_label_api_key") def is_available(self): return True def requires_settings(self): return True @hook def set_label(self, item,label, changed): if self.encode_password is None: return if not changed: return try: bundle = {"label": {"external_id": self.encode(item), "text": self.encode(label)}} params = json.dumps(bundle) connection = httplib.HTTPConnection(self.target_host) connection.request("POST", ("/api/wallets/%s/labels.json?auth_token=%s" % (self.wallet_id, self.auth_token())), params, {'Content-Type': 'application/json'}) response = connection.getresponse() if response.reason == httplib.responses[httplib.NOT_FOUND]: return response = json.loads(response.read()) except socket.gaierror as e: print_error('Error connecting to service: %s ' % e) return False def settings_widget(self, window): return EnterButton(_('Settings'), self.settings_dialog) def settings_dialog(self): def check_for_api_key(api_key): if api_key and len(api_key) > 12: self.config.set_key("plugin_label_api_key", str(self.auth_token_edit.text())) self.upload.setEnabled(True) self.download.setEnabled(True) self.accept.setEnabled(True) else: self.upload.setEnabled(False) self.download.setEnabled(False) self.accept.setEnabled(False) d = QDialog() layout = QGridLayout(d) layout.addWidget(QLabel("API Key: "),0,0) self.auth_token_edit = QLineEdit(self.auth_token()) self.auth_token_edit.textChanged.connect(check_for_api_key) layout.addWidget(QLabel("Label sync options: "),2,0) layout.addWidget(self.auth_token_edit, 0,1,1,2) decrypt_key_text = QLineEdit(self.encode_password) decrypt_key_text.setReadOnly(True) layout.addWidget(decrypt_key_text, 1,1) layout.addWidget(QLabel("Decryption key: "),1,0) layout.addWidget(HelpButton("This key can be used on the LabElectrum website to decrypt your data in case you want to review it online."),1,2) self.upload = QPushButton("Force upload") self.upload.clicked.connect(self.full_push) layout.addWidget(self.upload, 2,1) self.download = QPushButton("Force download") self.download.clicked.connect(self.full_pull) layout.addWidget(self.download, 2,2) c = QPushButton(_("Cancel")) c.clicked.connect(d.reject) self.accept = QPushButton(_("Done")) self.accept.clicked.connect(d.accept) layout.addWidget(c,3,1) layout.addWidget(self.accept,3,2) check_for_api_key(self.auth_token()) self.window.labelsChanged.connect(self.done_processing) if d.exec_(): return True else: return False def done_processing(self): QMessageBox.information(None, _("Labels synchronised"), _("Your labels have been synchronised.")) def full_push(self): threading.Thread(target=self.do_full_push).start() def full_pull(self): threading.Thread(target=self.do_full_pull, args=([True])).start() def do_full_push(self): try: bundle = {"labels": {}} for key, value in self.wallet.labels.iteritems(): try: encoded_key = self.encode(key) except: print_error('cannot encode', repr(key)) continue try: encoded_value = self.encode(value) except: print_error('cannot encode', repr(value)) continue bundle["labels"][encoded_key] = encoded_value params = json.dumps(bundle) connection = httplib.HTTPConnection(self.target_host) connection.request("POST", ("/api/wallets/%s/labels/batch.json?auth_token=%s" % (self.wallet_id, self.auth_token())), params, {'Content-Type': 'application/json'}) response = connection.getresponse() if response.reason == httplib.responses[httplib.NOT_FOUND]: print_error('404 error' % e) return try: response = json.loads(response.read()) except ValueError as e: print_error('Error loading labelsync response: %s' % e) return False if "error" in response: print_error('Error loading labelsync response.') return False except socket.gaierror as e: print_error('Error connecting to service: %s ' % e) return False self.window.labelsChanged.emit() def do_full_pull(self, force = False): connection = httplib.HTTPConnection(self.target_host) connection.request("GET", ("/api/wallets/%s/labels.json?auth_token=%s" % (self.wallet_id, self.auth_token())),"", {'Content-Type': 'application/json'}) response = connection.getresponse() if response.status != 200: print_error("Cannot retrieve labels:", response.status, response.reason) return response = json.loads(response.read()) if "error" in response: raise BaseException(_("Could not sync labels: %s" % response["error"])) for label in response: try: key = self.decode(label["external_id"]) except: continue try: value = self.decode(label["text"]) except: continue try: json.dumps(key) json.dumps(value) except: print_error('error: no json', key) continue if force or not self.wallet.labels.get(key): self.wallet.labels[key] = value self.wallet.storage.put('labels', self.wallet.labels) print_error("received %d labels"%len(response)) self.window.labelsChanged.emit()
testalt/electrum-NMC
plugins/labels.py
Python
gpl-3.0
9,152
[ "VisIt" ]
e52447b84b90895c317978c33750ff0f802d9d6a071acacc9061e0eec24b3bff
#-------------------------------------------------------------------------- # Software: InVesalius - Software de Reconstrucao 3D de Imagens Medicas # Copyright: (C) 2001 Centro de Pesquisas Renato Archer # Homepage: http://www.softwarepublico.gov.br # Contact: invesalius@cti.gov.br # License: GNU - GPL 2 (LICENSE.txt/LICENCA.txt) #-------------------------------------------------------------------------- # Este programa e software livre; voce pode redistribui-lo e/ou # modifica-lo sob os termos da Licenca Publica Geral GNU, conforme # publicada pela Free Software Foundation; de acordo com a versao 2 # da Licenca. # # Este programa eh distribuido na expectativa de ser util, mas SEM # QUALQUER GARANTIA; sem mesmo a garantia implicita de # COMERCIALIZACAO ou de ADEQUACAO A QUALQUER PROPOSITO EM # PARTICULAR. Consulte a Licenca Publica Geral GNU para obter mais # detalhes. #-------------------------------------------------------------------------- import os.path import platform import psutil import sys import wx import itertools from invesalius import utils from invesalius import inv_paths #from invesalius.project import Project INVESALIUS_VERSION = "3.1.99997" INVESALIUS_ACTUAL_FORMAT_VERSION = 1.1 #--------------- # Measurements MEASURE_NAME_PATTERN = _("M %d") MEASURE_LINEAR = 101 MEASURE_ANGULAR = 102 DEFAULT_MEASURE_COLOUR = (1,0,0) DEFAULT_MEASURE_BG_COLOUR = (250/255.0, 247/255.0, 218/255.0) DEFAULT_MEASURE_RADIUS = 1 DEFAULT_MEASURE_TYPE = MEASURE_LINEAR PROP_MEASURE = 0.8 STEREO_OFF = _(" Off") STEREO_RED_BLUE = _("Red-blue") STEREO_CRISTAL = _("CristalEyes") STEREO_INTERLACED = _("Interlaced") STEREO_LEFT = _("Left") STEREO_RIGHT = _("Right") STEREO_DRESDEN = _("Dresden") STEREO_CHECKBOARD = _("Checkboard") STEREO_ANAGLYPH = _("Anaglyph") # VTK text TEXT_SIZE_SMALL = 11 TEXT_SIZE = 12 TEXT_SIZE_LARGE = 16 TEXT_SIZE_EXTRA_LARGE = 20 TEXT_SIZE_DIST_NAV = 32 TEXT_COLOUR = (1,1,1) (X,Y) = (0.03, 0.97) (XZ, YZ) = (0.05, 0.93) TEXT_POS_LEFT_UP = (X, Y) #------------------------------------------------------------------ TEXT_POS_LEFT_DOWN = (X, 1-Y) # SetVerticalJustificationToBottom TEXT_POS_LEFT_DOWN_ZERO = (X, 1-YZ) #------------------------------------------------------------------ TEXT_POS_RIGHT_UP = (1-X, Y) # SetJustificationToRight #------------------------------------------------------------------ TEXT_POS_RIGHT_DOWN = (1-X, 1-Y) # SetVerticalJustificationToBottom & # SetJustificationToRight #------------------------------------------------------------------ TEXT_POS_HCENTRE_DOWN = (0.5, 1-Y) # SetJustificationToCentered # ChildrticalJustificationToBottom TEXT_POS_HCENTRE_DOWN_ZERO = (0.5, 1-YZ) #------------------------------------------------------------------ TEXT_POS_HCENTRE_UP = (0.5, Y) # SetJustificationToCentered #------------------------------------------------------------------ TEXT_POS_VCENTRE_RIGHT = (1-X, 0.5) # SetVerticalJustificationToCentered # SetJustificationToRight TEXT_POS_VCENTRE_RIGHT_ZERO = (1-XZ, 0.5) #------------------------------------------------------------------ TEXT_POS_VCENTRE_LEFT = (X, 0.5) # SetVerticalJustificationToCentered #------------------------------------------------------------------ # Slice orientation AXIAL = 1 CORONAL = 2 SAGITAL = 3 VOLUME = 4 SURFACE = 5 AXIAL_STR="AXIAL" CORONAL_STR="CORONAL" SAGITAL_STR="SAGITAL" # Measure type LINEAR = 6 ANGULAR = 7 DENSITY_ELLIPSE = 8 DENSITY_POLYGON = 9 # Colour representing each orientation ORIENTATION_COLOUR = {'AXIAL': (1,0,0), # Red 'CORONAL': (0,1,0), # Green 'SAGITAL': (0,0,1)} # Blue IMPORT_INTERVAL = [_("Keep all slices"), _("Skip 1 for each 2 slices"), _("Skip 2 for each 3 slices"), _("Skip 3 for each 4 slices"), _("Skip 4 for each 5 slices"),_("Skip 5 for each 6 slices")] # Camera according to slice's orientation #CAM_POSITION = {"AXIAL":(0, 0, 1), "CORONAL":(0, -1, 0), "SAGITAL":(1, 0, 0)} #CAM_VIEW_UP = {"AXIAL":(0, 1, 0), "CORONAL":(0, 0, 1), "SAGITAL":(0, 0, 1)} AXIAL_SLICE_CAM_POSITION = {"AXIAL":(0, 0, 1), "CORONAL":(0, -1, 0), "SAGITAL":(1, 0, 0)} AXIAL_SLICE_CAM_VIEW_UP = {"AXIAL":(0, 1, 0), "CORONAL":(0, 0, 1), "SAGITAL":(0, 0, 1)} SAGITAL_SLICE_CAM_POSITION = {"AXIAL":(0, 0, 1), "CORONAL":(0, 1, 0), "SAGITAL":(-1, 0, 0)} SAGITAL_SLICE_CAM_VIEW_UP = {"AXIAL":(0, -1, 0), "CORONAL":(0, 0, 1), "SAGITAL":(0, 0, 1)} CORONAL_SLICE_CAM_POSITION = {"AXIAL":(0, 0, 1), "CORONAL":(0, 1, 0), "SAGITAL":(-1, 0, 0)} CORONAL_SLICE_CAM_VIEW_UP = {"AXIAL":(0, -1, 0), "CORONAL":(0, 0, 1), "SAGITAL":(0, 0, 1)} SLICE_POSITION = {AXIAL:[AXIAL_SLICE_CAM_VIEW_UP, AXIAL_SLICE_CAM_POSITION], SAGITAL:[SAGITAL_SLICE_CAM_VIEW_UP, SAGITAL_SLICE_CAM_POSITION], CORONAL:[CORONAL_SLICE_CAM_VIEW_UP, CORONAL_SLICE_CAM_POSITION]} #Project Status #NEW_PROJECT = 0 #OPEN_PROJECT = 1 #CHANGE_PROJECT = 2 #SAVE_PROJECT = 3 PROJ_NEW = 0 PROJ_OPEN = 1 PROJ_CHANGE = 2 PROJ_CLOSE = 3 PROJ_MAX = 4 #### MODE_RP = 0 MODE_NAVIGATOR = 1 MODE_RADIOLOGY = 2 MODE_ODONTOLOGY = 3 #Crop box sides code AXIAL_RIGHT = 1 AXIAL_LEFT = 2 AXIAL_UPPER = 3 AXIAL_BOTTOM = 4 SAGITAL_RIGHT = 5 SAGITAL_LEFT = 6 SAGITAL_UPPER = 7 SAGITAL_BOTTOM = 8 CORONAL_RIGHT = 9 CORONAL_LEFT = 10 CORONAL_UPPER = 11 CORONAL_BOTTOM = 12 CROP_PAN = 13 #Color Table from Slice #NumberOfColors, SaturationRange, HueRange, ValueRange SLICE_COLOR_TABLE = {_("Default "):(None,(0,0),(0,0),(0,1)), _("Hue"):(None,(1,1),(0,1),(1,1)), _("Saturation"):(None,(0,1),(0.6,0.6),(1,1)), _("Desert"):(256, (1,1), (0, 0.1), (1,1)), _("Rainbow"):(256,(1,1),(0,0.8),(1,1)), _("Ocean"):(256,(1,1),(0.667, 0.5),(1,1)), _("Inverse Gray"):(256, (0, 0), (0, 0), (1,0)), } # Volume view angle VOL_FRONT = wx.NewId() VOL_BACK = wx.NewId() VOL_RIGHT = wx.NewId() VOL_LEFT = wx.NewId() VOL_TOP = wx.NewId() VOL_BOTTOM = wx.NewId() VOL_ISO = wx.NewId() # Camera according to volume's orientation AXIAL_VOLUME_CAM_VIEW_UP = {VOL_FRONT:(0,0,1), VOL_BACK:(0,0,1), VOL_RIGHT:(0,0,1),\ VOL_LEFT:(0,0,1), VOL_TOP:(0,1,0), VOL_BOTTOM:(0,-1,0),\ VOL_ISO:(0,0,1)} AXIAL_VOLUME_CAM_POSITION = {VOL_FRONT:(0,-1,0), VOL_BACK:(0,1,0), VOL_RIGHT:(-1,0,0),\ VOL_LEFT:(1,0,0), VOL_TOP:(0,0,1), VOL_BOTTOM:(0,0,-1),\ VOL_ISO:(0.5,-1,0.5)} SAGITAL_VOLUME_CAM_VIEW_UP = {VOL_FRONT:(0,-1,0), VOL_BACK:(0,-1,0), VOL_RIGHT:(0,-1,1),\ VOL_LEFT:(0,-1,1), VOL_TOP:(1,-1,0), VOL_BOTTOM:(-1,1,0),\ VOL_ISO:(0,-1,0)} SAGITAL_VOLUME_CAM_POSITION = {VOL_FRONT:(-1,0,0), VOL_BACK:(1,0,0), VOL_RIGHT:(0,0,1),\ VOL_LEFT:(0,0,-1), VOL_TOP:(0,-1,0), VOL_BOTTOM:(0,1,0),\ VOL_ISO:(-1,-0.5,-0.5)} CORONAL_VOLUME_CAM_VIEW_UP = {VOL_FRONT:(0,-1,0), VOL_BACK:(0,-1,0), VOL_RIGHT:(0,-1,0),\ VOL_LEFT:(0,-1,0), VOL_TOP:(0,1,0), VOL_BOTTOM:(0,-1,0),\ VOL_ISO:(0,-1,0)} CORONAL_VOLUME_CAM_POSITION = {VOL_FRONT:(0,0,-1), VOL_BACK:(0,0,1), VOL_RIGHT:(-1,0,0),\ VOL_LEFT:(1,0,0), VOL_TOP:(0,-1,0), VOL_BOTTOM:(0,1,0),\ VOL_ISO:(0.5,-0.5,-1)} VOLUME_POSITION = {AXIAL: [AXIAL_VOLUME_CAM_VIEW_UP, AXIAL_VOLUME_CAM_POSITION], SAGITAL: [SAGITAL_VOLUME_CAM_VIEW_UP, SAGITAL_VOLUME_CAM_POSITION], CORONAL: [CORONAL_VOLUME_CAM_VIEW_UP, CORONAL_VOLUME_CAM_POSITION]} # Mask threshold options #proj = Project() #THRESHOLD_RANGE = proj.threshold_modes[_("Bone")] THRESHOLD_RANGE = [0,3033] THRESHOLD_PRESETS_INDEX = _("Bone") THRESHOLD_HUE_RANGE = (0, 0.6667) THRESHOLD_INVALUE = 5000 THRESHOLD_OUTVALUE = 0 # Mask properties MASK_NAME_PATTERN = _("Mask %d") MASK_OPACITY = 0.40 #MASK_OPACITY = 0.35 MASK_COLOUR = [[0.33, 1, 0.33], [1, 1, 0.33], [0.33, 0.91, 1], [1, 0.33, 1], [1, 0.68, 0.33], [1, 0.33, 0.33], [0.33333333333333331, 0.33333333333333331, 1.0], #(1.0, 0.33333333333333331, 0.66666666666666663), [0.74901960784313726, 1.0, 0.0], [0.83529411764705885, 0.33333333333333331, 1.0]]#, #(0.792156862745098, 0.66666666666666663, 1.0), #(1.0, 0.66666666666666663, 0.792156862745098), # too "light" #(0.33333333333333331, 1.0, 0.83529411764705885),#], #(1.0, 0.792156862745098, 0.66666666666666663), #(0.792156862745098, 1.0, 0.66666666666666663), # too "light" #(0.66666666666666663, 0.792156862745098, 1.0)] MEASURE_COLOUR = itertools.cycle([[1, 0, 0], [1, 0.4, 0], [0, 0, 1], [1, 0, 1], [0, 0.6, 0]]) SURFACE_COLOUR = [(0.33, 1, 0.33), (1, 1, 0.33), (0.33, 0.91, 1), (1, 0.33, 1), (1, 0.68, 0.33), (1, 0.33, 0.33), (0.33333333333333331, 0.33333333333333331, 1.0), (1.0, 0.33333333333333331, 0.66666666666666663), (0.74901960784313726, 1.0, 0.0), (0.83529411764705885, 0.33333333333333331, 1.0), (0.792156862745098, 0.66666666666666663, 1.0), (1.0, 0.66666666666666663, 0.792156862745098), (0.33333333333333331, 1.0, 0.83529411764705885), (1.0, 0.792156862745098, 0.66666666666666663), (0.792156862745098, 1.0, 0.66666666666666663), (0.66666666666666663, 0.792156862745098, 1.0)] # Related to slice editor brush BRUSH_CIRCLE = 0 # BRUSH_SQUARE = 1 DEFAULT_BRUSH_FORMAT = BRUSH_CIRCLE BRUSH_DRAW = 0 BRUSH_ERASE = 1 BRUSH_THRESH = 2 BRUSH_THRESH_ERASE = 3 BRUSH_THRESH_ADD_ONLY = 4 BRUSH_THRESH_ERASE_ONLY = 5 DEFAULT_BRUSH_OP = BRUSH_THRESH BRUSH_OP_NAME = [_("Draw"), _("Erase"), _("Threshold")] BRUSH_COLOUR = (0,0,1.0) BRUSH_SIZE = 30 BRUSH_MAX_SIZE = 100 # Surface creation values. Each element's list contains: # 0: imagedata reformat ratio # 1: smooth_iterations # 2: smooth_relaxation_factor # 3: decimate_reduction SURFACE_QUALITY = { _("Low"): (3, 2, 0.3000, 0.4), _("Medium"): (2, 2, 0.3000, 0.4), _("High"): (0, 1, 0.3000, 0.1), _("Optimal *"): (0, 2, 0.3000, 0.4)} DEFAULT_SURFACE_QUALITY = _("Optimal *") SURFACE_QUALITY_LIST = [_("Low"),_("Medium"),_("High"),_("Optimal *")] # Surface properties SURFACE_TRANSPARENCY = 0.0 SURFACE_NAME_PATTERN = _("Surface %d") # Imagedata - window and level presets WINDOW_LEVEL = {_("Abdomen"):(350,50), _("Bone"):(2000, 300), _("Brain posterior fossa"):(120,40), _("Brain"):(80,40), _("Default"):(None, None), #Control class set window and level from DICOM _("Emphysema"):(500,-850), _("Ischemia - Hard, non contrast"):(15,32), _("Ischemia - Soft, non contrast"):(80,20), _("Larynx"):(180, 80), _("Liver"):(2000, -500), _("Lung - Soft"):(1600,-600), _("Lung - Hard"):(1000,-600), _("Mediastinum"):(350,25), _("Manual"):(None, None), #Case the user change window and level _("Pelvis"): (450,50), _("Sinus"):(4000, 400), _("Vasculature - Hard"):(240,80), _("Vasculature - Soft"):(650,160), _("Contour"): (255, 127)} REDUCE_IMAGEDATA_QUALITY = 0 # PATHS FS_ENCODE = sys.getfilesystemencoding() ID_TO_BMP = {VOL_FRONT: [_("Front"), str(inv_paths.ICON_DIR.joinpath("view_front.png"))], VOL_BACK: [_("Back"), str(inv_paths.ICON_DIR.joinpath("view_back.png"))], VOL_TOP: [_("Top"), str(inv_paths.ICON_DIR.joinpath("view_top.png"))], VOL_BOTTOM: [_("Bottom"), str(inv_paths.ICON_DIR.joinpath("view_bottom.png"))], VOL_RIGHT: [_("Right"), str(inv_paths.ICON_DIR.joinpath("view_right.png"))], VOL_LEFT: [_("Left"), str(inv_paths.ICON_DIR.joinpath("view_left.png"))], VOL_ISO:[_("Isometric"), str(inv_paths.ICON_DIR.joinpath("view_isometric.png"))] } # if 1, use vtkVolumeRaycastMapper, if 0, use vtkFixedPointVolumeRayCastMapper TYPE_RAYCASTING_MAPPER = 0 RAYCASTING_FILES = {_("Airways"): "Airways.plist", _("Airways II"): "Airways II.plist", _("Black & White"): "Black & White.plist", _("Bone + Skin"): "Bone + Skin.plist", _("Bone + Skin II"): "Bone + Skin II.plist", _("Dark bone"): "Dark Bone.plist", _("Glossy"): "Glossy.plist", _("Glossy II"): "Glossy II.plist", _("Gold bone"): "Gold Bone.plist", _("High contrast"): "High Contrast.plist", _("Low contrast"): "Low Contrast.plist", _("Soft on white"): "Soft on White.plist", _("Mid contrast"): "Mid Contrast.plist", _("MIP"): "MIP.plist", _("No shading"): "No Shading.plist", _("Pencil"): "Pencil.plist", _("Red on white"): "Red on White.plist", _("Skin on blue"): "Skin On Blue.plist", _("Skin on blue II"): "Skin On Blue II.plist", _("Soft on white"): "Soft on White.plist", _("Soft + Skin"): "Soft + Skin.plist", _("Soft + Skin II"): "Soft + Skin II.plist", _("Soft + Skin III"): "Soft + Skin III.plist", _("Soft on blue"): "Soft On Blue.plist", _("Soft"): "Soft.plist", _("Standard"): "Standard.plist", _("Vascular"): "Vascular.plist", _("Vascular II"): "Vascular II.plist", _("Vascular III"): "Vascular III.plist", _("Vascular IV"): "Vascular IV.plist", _("Yellow bone"): "Yellow Bone.plist"} #RAYCASTING_TYPES = [_(filename.split(".")[0]) for filename in # os.listdir(folder) if # os.path.isfile(os.path.join(folder,filename))] RAYCASTING_TYPES = [_(filename.name.split(".")[0]) for filename in inv_paths.USER_RAYCASTING_PRESETS_DIRECTORY.glob('*') if filename.is_file()] RAYCASTING_TYPES += RAYCASTING_FILES.keys() RAYCASTING_TYPES.append(_(' Off')) RAYCASTING_TYPES.sort() RAYCASTING_OFF_LABEL = _(' Off') RAYCASTING_TOOLS = [_("Cut plane")] # If 0 dont't blur, 1 blur RAYCASTING_WWWL_BLUR = 0 RAYCASTING_PRESETS_FOLDERS = (inv_paths.RAYCASTING_PRESETS_DIRECTORY, inv_paths.USER_RAYCASTING_PRESETS_DIRECTORY) #### #MODE_ZOOM = 0 #"Set Zoom Mode", #MODE_ZOOM_SELECTION = 1 #:"Set Zoom Select Mode", #MODE_ROTATE = 2#:"Set Spin Mode", #MODE_MOVE = 3#:"Set Pan Mode", #MODE_WW_WL = 4#:"Bright and contrast adjustment"} #MODE_LINEAR_MEASURE = 5 # self.states = {0:"Set Zoom Mode", 1:"Set Zoom Select Mode", # 2:"Set Spin Mode", 3:"Set Pan Mode", # 4:"Bright and contrast adjustment"} #ps.Publisher().sendMessage('Set interaction mode %d'% # (MODE_BY_ID[id])) #('Set Editor Mode') #{0:"Set Change Slice Mode"} #### MODE_SLICE_SCROLL = -1 MODE_SLICE_EDITOR = -2 MODE_SLICE_CROSS = -3 ############ FILETYPE_IV = wx.NewId() FILETYPE_RIB = wx.NewId() FILETYPE_STL = wx.NewId() FILETYPE_STL_ASCII = wx.NewId() FILETYPE_VRML = wx.NewId() FILETYPE_OBJ = wx.NewId() FILETYPE_VTP = wx.NewId() FILETYPE_PLY = wx.NewId() FILETYPE_X3D = wx.NewId() FILETYPE_IMAGEDATA = wx.NewId() FILETYPE_BMP = wx.NewId() FILETYPE_JPG = wx.NewId() FILETYPE_PNG = wx.NewId() FILETYPE_PS = wx.NewId() FILETYPE_POV = wx.NewId() FILETYPE_TIF = wx.NewId() IMAGE_TILING = {"1 x 1":(1,1), "1 x 2":(1,2), "1 x 3":(1,3), "1 x 4":(1,4), "2 x 1":(2,1), "2 x 2":(2,2), "2 x 3":(2,3), "2 x 4":(2,4), "3 x 1":(3,1), "3 x 2":(3,2), "3 x 3":(3,3), "3 x 4":(3,4), "4 x 1":(4,1), "4 x 2":(4,2), "4 x 3":(4,3), "4 x 4":(4,4), "4 x 5":(4,5), "5 x 4":(5,4)} VTK_WARNING = 0 #---------------------------------------------------------- [ID_DICOM_IMPORT, ID_PROJECT_OPEN, ID_PROJECT_SAVE_AS, ID_PROJECT_SAVE, ID_PROJECT_CLOSE, ID_EXPORT_SLICE, ID_PROJECT_PROPERTIES, ID_EXPORT_MASK, ID_PROJECT_INFO, ID_SAVE_SCREENSHOT, ID_DICOM_LOAD_NET, ID_PRINT_SCREENSHOT, ID_IMPORT_OTHERS_FILES, ID_PREFERENCES, ID_DICOM_NETWORK, ID_TIFF_JPG_PNG, ID_VIEW_INTERPOLATED, ID_MODE_NAVIGATION, ID_ANALYZE_IMPORT, ID_NIFTI_IMPORT, ID_PARREC_IMPORT, ID_MODE_DBS] = [wx.NewId() for number in range(22)] ID_EXIT = wx.ID_EXIT ID_ABOUT = wx.ID_ABOUT [ID_EDIT_UNDO, ID_EDIT_REDO, ID_EDIT_LIST] =\ [wx.NewId() for number in range(3)] [ID_TOOL_PROJECT, ID_TOOL_LAYOUT, ID_TOOL_OBJECT, ID_TOOL_SLICE] =\ [wx.NewId() for number in range(4)] [ID_TASK_BAR, ID_VIEW_FOUR] =\ [wx.NewId() for number in range(2)] [ID_VIEW_FULL, ID_VIEW_TEXT, ID_VIEW_3D_BACKGROUND] =\ [wx.NewId() for number in range(3)] ID_START = wx.NewId() ID_PLUGINS_SHOW_PATH = wx.NewId() ID_FLIP_X = wx.NewId() ID_FLIP_Y = wx.NewId() ID_FLIP_Z = wx.NewId() ID_SWAP_XY = wx.NewId() ID_SWAP_XZ = wx.NewId() ID_SWAP_YZ = wx.NewId() ID_BOOLEAN_MASK = wx.NewId() ID_CLEAN_MASK = wx.NewId() ID_REORIENT_IMG = wx.NewId() ID_FLOODFILL_MASK = wx.NewId() ID_FILL_HOLE_AUTO = wx.NewId() ID_REMOVE_MASK_PART = wx.NewId() ID_SELECT_MASK_PART = wx.NewId() ID_MANUAL_SEGMENTATION = wx.NewId() ID_WATERSHED_SEGMENTATION = wx.NewId() ID_THRESHOLD_SEGMENTATION = wx.NewId() ID_FLOODFILL_SEGMENTATION = wx.NewId() ID_FLOODFILL_SEGMENTATION = wx.NewId() ID_SEGMENTATION_BRAIN = wx.NewId() ID_CROP_MASK = wx.NewId() ID_DENSITY_MEASURE = wx.NewId() ID_MASK_DENSITY_MEASURE = wx.NewId() ID_CREATE_SURFACE = wx.NewId() ID_CREATE_MASK = wx.NewId() ID_MASK_3D_PREVIEW = wx.NewId() ID_MASK_3D_RELOAD = wx.NewId() ID_MASK_3D_AUTO_RELOAD = wx.NewId() ID_GOTO_SLICE = wx.NewId() ID_GOTO_COORD = wx.NewId() ID_MANUAL_WWWL = wx.NewId() # Tractography with Trekker ID_TREKKER_MASK = wx.NewId() ID_TREKKER_IMG = wx.NewId() ID_TREKKER_FOD = wx.NewId() ID_TREKKER_ACT = wx.NewId() #--------------------------------------------------------- STATE_DEFAULT = 1000 STATE_WL = 1001 STATE_SPIN = 1002 STATE_ZOOM = 1003 STATE_ZOOM_SL = 1004 STATE_PAN = 1005 STATE_ANNOTATE = 1006 STATE_MEASURE_DISTANCE = 1007 STATE_MEASURE_ANGLE = 1008 STATE_MEASURE_DENSITY = 1009 STATE_MEASURE_DENSITY_ELLIPSE = 1010 STATE_MEASURE_DENSITY_POLYGON = 1011 SLICE_STATE_CROSS = 3006 SLICE_STATE_SCROLL = 3007 SLICE_STATE_EDITOR = 3008 SLICE_STATE_WATERSHED = 3009 SLICE_STATE_REORIENT = 3010 SLICE_STATE_MASK_FFILL = 3011 SLICE_STATE_REMOVE_MASK_PARTS = 3012 SLICE_STATE_SELECT_MASK_PARTS = 3013 SLICE_STATE_FFILL_SEGMENTATION = 3014 SLICE_STATE_CROP_MASK = 3015 SLICE_STATE_TRACTS = 3016 VOLUME_STATE_SEED = 2001 # STATE_LINEAR_MEASURE = 3001 # STATE_ANGULAR_MEASURE = 3002 TOOL_STATES = [STATE_WL, STATE_SPIN, STATE_ZOOM, STATE_ZOOM_SL, STATE_PAN, STATE_MEASURE_DISTANCE, STATE_MEASURE_ANGLE, STATE_MEASURE_DENSITY_ELLIPSE, STATE_MEASURE_DENSITY_POLYGON, ] #, STATE_ANNOTATE] TOOL_SLICE_STATES = [SLICE_STATE_CROSS, SLICE_STATE_SCROLL, SLICE_STATE_REORIENT, SLICE_STATE_TRACTS] SLICE_STYLES = TOOL_STATES + TOOL_SLICE_STATES SLICE_STYLES.append(STATE_DEFAULT) SLICE_STYLES.append(SLICE_STATE_EDITOR) SLICE_STYLES.append(SLICE_STATE_WATERSHED) SLICE_STYLES.append(SLICE_STATE_MASK_FFILL) SLICE_STYLES.append(SLICE_STATE_REMOVE_MASK_PARTS) SLICE_STYLES.append(SLICE_STATE_SELECT_MASK_PARTS) SLICE_STYLES.append(SLICE_STATE_FFILL_SEGMENTATION) SLICE_STYLES.append(SLICE_STATE_CROP_MASK) SLICE_STYLES.append(STATE_MEASURE_DENSITY) SLICE_STYLES.append(STATE_MEASURE_DENSITY_ELLIPSE) SLICE_STYLES.append(STATE_MEASURE_DENSITY_POLYGON) STYLE_LEVEL = {SLICE_STATE_EDITOR: 1, SLICE_STATE_WATERSHED: 1, SLICE_STATE_MASK_FFILL: 2, SLICE_STATE_REMOVE_MASK_PARTS: 2, SLICE_STATE_SELECT_MASK_PARTS: 2, SLICE_STATE_FFILL_SEGMENTATION: 2, SLICE_STATE_CROSS: 2, SLICE_STATE_SCROLL: 2, SLICE_STATE_REORIENT: 2, SLICE_STATE_CROP_MASK: 1, STATE_ANNOTATE: 2, STATE_DEFAULT: 0, STATE_MEASURE_ANGLE: 2, STATE_MEASURE_DISTANCE: 2, STATE_MEASURE_DENSITY_ELLIPSE: 2, STATE_MEASURE_DENSITY_POLYGON: 2, STATE_MEASURE_DENSITY: 2, STATE_WL: 2, STATE_SPIN: 2, STATE_ZOOM: 2, STATE_ZOOM_SL: 2, STATE_PAN:2, VOLUME_STATE_SEED:1} #------------ Prefereces options key ------------ RENDERING = 0 SURFACE_INTERPOLATION = 1 LANGUAGE = 2 SLICE_INTERPOLATION = 3 #Correlaction extracted from pyDicom DICOM_ENCODING_TO_PYTHON = { 'None':'iso8859', None:'iso8859', '': 'iso8859', 'ISO_IR 6': 'iso8859', 'ISO_IR 100': 'latin_1', 'ISO 2022 IR 87': 'iso2022_jp', 'ISO 2022 IR 13': 'iso2022_jp', 'ISO 2022 IR 149': 'euc_kr', 'ISO_IR 192': 'UTF8', 'GB18030': 'GB18030', 'ISO_IR 126': 'iso_ir_126', 'ISO_IR 127': 'iso_ir_127', 'ISO_IR 138': 'iso_ir_138', 'ISO_IR 144': 'iso_ir_144', } #-------------------- Projections type ---------------- PROJECTION_NORMAL=0 PROJECTION_MaxIP=1 PROJECTION_MinIP=2 PROJECTION_MeanIP=3 PROJECTION_LMIP=4 PROJECTION_MIDA=5 PROJECTION_CONTOUR_MIP=6 PROJECTION_CONTOUR_LMIP=7 PROJECTION_CONTOUR_MIDA=8 #------------ Projections defaults ------------------ PROJECTION_BORDER_SIZE=1.0 PROJECTION_MIP_SIZE=2 # ------------- Boolean operations ------------------ BOOLEAN_UNION = 1 BOOLEAN_DIFF = 2 BOOLEAN_AND = 3 BOOLEAN_XOR = 4 # -------------- User interface --------------------- # The column order in the marker panel # ID_COLUMN = 0 SESSION_COLUMN = 1 LABEL_COLUMN = 2 TARGET_COLUMN = 3 X_COLUMN = 4 Y_COLUMN = 5 Z_COLUMN = 6 #------------ Navigation defaults ------------------- MARKER_COLOUR = (1.0, 1.0, 0.) MARKER_SIZE = 2 ARROW_MARKER_SIZE = 10 CALIBRATION_TRACKER_SAMPLES = 10 FIDUCIAL_REGISTRATION_ERROR_THRESHOLD = 3.0 SELECT = 0 MTC = 1 FASTRAK = 2 ISOTRAKII = 3 PATRIOT = 4 CAMERA = 5 POLARIS = 6 POLARISP4 = 7 OPTITRACK = 8 ROBOT = 9 DEBUGTRACKRANDOM = 10 DEBUGTRACKAPPROACH = 11 DEFAULT_TRACKER = SELECT NDICOMPORT = b'COM1' TRACKERS = [_("Claron MicronTracker"), _("Polhemus FASTRAK"), _("Polhemus ISOTRAK II"), _("Polhemus PATRIOT"), _("Camera tracker"), _("NDI Polaris"), _("NDI Polaris P4"), _("Optitrack"), _("Robot tracker"), _("Debug tracker (random)"), _("Debug tracker (approach)")] STATIC_REF = 0 DYNAMIC_REF = 1 DEFAULT_REF_MODE = DYNAMIC_REF REF_MODE = [_("Static ref."), _("Dynamic ref.")] FT_SENSOR_MODE = [_("Sensor 3"), _("Sensor 4")] DEFAULT_COIL = SELECT COIL = [_("Select coil:"), _("Neurosoft Figure-8"), _("Magstim 70 mm"), _("Nexstim")] IR1 = wx.NewId() IR2 = wx.NewId() IR3 = wx.NewId() TR1 = wx.NewId() TR2 = wx.NewId() TR3 = wx.NewId() SET = wx.NewId() IMAGE_FIDUCIALS = [ { 'button_id': IR1, 'label': 'LEI', 'fiducial_name': 'LE', 'fiducial_index': 0, 'tip': _("Select left ear in image"), }, { 'button_id': IR2, 'label': 'REI', 'fiducial_name': 'RE', 'fiducial_index': 1, 'tip': _("Select right ear in image"), }, { 'button_id': IR3, 'label': 'NAI', 'fiducial_name': 'NA', 'fiducial_index': 2, 'tip': _("Select nasion in image"), }, ] TRACKER_FIDUCIALS = [ { 'button_id': TR1, 'label': 'LET', 'fiducial_name': 'LE', 'fiducial_index': 0, 'tip': _("Select left ear with spatial tracker"), }, { 'button_id': TR2, 'label': 'RET', 'fiducial_name': 'RE', 'fiducial_index': 1, 'tip': _("Select right ear with spatial tracker"), }, { 'button_id': TR3, 'label': 'NAT', 'fiducial_name': 'NA', 'fiducial_index': 2, 'tip': _("Select nasion with spatial tracker"), }, ] BTNS_IMG_MARKERS = {IR1: {0: 'LEI'}, IR2: {1: 'REI'}, IR3: {2: 'NAI'}} OBJL = wx.NewId() OBJR = wx.NewId() OBJA = wx.NewId() OBJC = wx.NewId() OBJF = wx.NewId() OBJECT_FIDUCIALS = [ { 'fiducial_index': 0, 'button_id': OBJL, 'label': _('Left'), 'tip': _("Select left object fiducial"), }, { 'fiducial_index': 1, 'button_id': OBJR, 'label': _('Right'), 'tip': _("Select right object fiducial"), }, { 'fiducial_index': 2, 'button_id': OBJA, 'label': _('Anterior'), 'tip': _("Select anterior object fiducial"), }, { 'fiducial_index': 3, 'button_id': OBJC, 'label': _('Center'), 'tip': _("Select object center"), }, { 'fiducial_index': 4, 'button_id': OBJF, 'label': _('Fixed'), 'tip': _("Attach sensor to object"), }, ] MTC_PROBE_NAME = "1Probe" MTC_REF_NAME = "2Ref" MTC_OBJ_NAME = "3Coil" # Object tracking ARROW_SCALE = 6 ARROW_UPPER_LIMIT = 15 #COIL_ANGLES_THRESHOLD = 3 * ARROW_SCALE COIL_ANGLES_THRESHOLD = 3 COIL_COORD_THRESHOLD = 3 TIMESTAMP = 2.0 COIL_ANGLE_ARROW_PROJECTION_THRESHOLD = 5 CAM_MODE = True # Tractography visualization N_TRACTS = 200 PEEL_DEPTH = 10 MAX_PEEL_DEPTH = 40 SEED_OFFSET = 30 SEED_RADIUS = 1.5 # Increased the default sleep parameter from 0.1 to 0.15 to decrease CPU load during navigation. SLEEP_NAVIGATION = 0.2 SLEEP_COORDINATES = 0.05 SLEEP_ROBOT = 0.01 BRAIN_OPACITY = 0.6 N_CPU = psutil.cpu_count() # the max_sampling_step can be set to something different as well. Above 100 is probably not necessary TREKKER_CONFIG = {'seed_max': 1, 'step_size': 0.03125, 'min_fod': 0.05, 'probe_quality': 3, 'max_interval': 1, 'min_radius_curvature': 0.625, 'probe_length': 0.15625, 'write_interval': 50, 'numb_threads': '', 'max_length': 250, 'min_length': 10, 'max_sampling_step': 100, 'data_support_exponent': 0.5, 'use_best_init': True, 'init_max_est_trials': 100} MARKER_FILE_MAGICK_STRING = "##INVESALIUS3_MARKER_FILE_" CURRENT_MARKER_FILE_VERSION = 0 WILDCARD_MARKER_FILES = _("Marker scanner coord files (*.mkss)|*.mkss") # Serial port BAUD_RATES = [300, 1200, 2400, 4800, 9600, 19200, 38400, 57600, 115200] BAUD_RATE_DEFAULT_SELECTION = 4 PULSE_DURATION_IN_MILLISECONDS = 0.2 #Robot ROBOT_ElFIN_IP = ['143.107.220.251', '169.254.153.251', '127.0.0.1'] ROBOT_ElFIN_PORT = 10003 ROBOT_MOTIONS = {"normal": 0, "linear out": 1, "arc": 2} ROBOT_HEAD_VELOCITY_THRESHOLD = 10 #mm/s ROBOT_ARC_THRESHOLD_DISTANCE = 100 #mm ROBOT_VERSOR_SCALE_FACTOR = 70 #Robot Working Space is defined as 800mm in Elfin manual. For safety, the value is reduced by 5%. ROBOT_WORKING_SPACE = 760 #mm ROBOT_MOVE_STATE = {"free to move": 0, "in motion": 1009, "waiting for execution": 1013, "error": 1025}
paulojamorim/invesalius3
invesalius/constants.py
Python
gpl-2.0
28,589
[ "VTK" ]
9f3836ccf2098e7857dfc09f615d3a6f5118f722782e2314bc8f96cb1e7fa17e
#!/usr/bin/env python3 #* This file is part of the MOOSE framework #* https://www.mooseframework.org #* #* All rights reserved, see COPYRIGHT for full restrictions #* https://github.com/idaholab/moose/blob/master/COPYRIGHT #* #* Licensed under LGPL 2.1, please see LICENSE for details #* https://www.gnu.org/licenses/lgpl-2.1.html import os from PyQt5.QtWidgets import QFileDialog, QPlainTextEdit, QSizePolicy, QMessageBox from PyQt5 import QtCore from peacock.utils import WidgetUtils from peacock.base.Plugin import Plugin from peacock.utils.RecentlyUsedMenu import RecentlyUsedMenu from .CheckInputWidget import CheckInputWidget from .InputFileEditor import InputFileEditor class InputFileEditorPlugin(InputFileEditor, Plugin): """ The widget to edit the input file. In addition to InputFileEditor, this class adds menus and is available as a Plugin. """ def __init__(self, **kwds): super(InputFileEditorPlugin, self).__init__(**kwds) self.setSizePolicy(QSizePolicy.Preferred, QSizePolicy.Preferred) self._menus_initialized = False self._recently_used_menu = None self._save_action = None self._open_action = None self._save_as_action = None self._clear_action = None self._check_action = None self._view_file = None self.check_widget = CheckInputWidget() self.check_widget.needInputFile.connect(self.writeInputFile) self.check_widget.hide() self.blockChanged.connect(self._updateChanged) self.input_file_view = QPlainTextEdit() self.input_file_view.setReadOnly(True) self.input_file_view.setWindowFlags(QtCore.Qt.Window) self.input_file_view.resize(640, 480) self.has_changed = False self._preferences.addInt("input/maxRecentlyUsed", "Max number of input files", 20, 1, 50, "Set the maximum number of recent input files that have been used.", ) self.setup() def _updateChanged(self, block, tree): self.has_changed = True def _askToSave(self, app_info, reason): if self.has_changed and app_info.valid() and self.tree and self.tree.input_filename and self.tree.incompatibleChanges(app_info): msg = "%s\nYou have unsaved changes in your input file, do you want to save?" % reason reply = QMessageBox.question(self, "Save?", msg, QMessageBox.Save, QMessageBox.Discard) if reply == QMessageBox.Save: self._saveInputFile() def executableInfoChanged(self, app_info): self._askToSave(app_info, "Reloading syntax from executable.") super(InputFileEditorPlugin, self).executableInfoChanged(app_info) self._setMenuStatus() self.has_changed = False def setInputFile(self, input_file): self._askToSave(self.tree.app_info, "Changing input files.") val = super(InputFileEditorPlugin, self).setInputFile(input_file) if self._menus_initialized: path = os.path.abspath(input_file) if os.path.exists(path): self._recently_used_menu.update(path) else: self._recently_used_menu.removeEntry(path) self._setMenuStatus() self.has_changed = False return val def _openInputFile(self): """ Ask the user what input file to open. """ input_name, other = QFileDialog.getOpenFileName(self, "Choose input file", os.getcwd(), "Input File (*.i)") if input_name: input_name = os.path.abspath(input_name) success = self.setInputFile(input_name) if success: self._recently_used_menu.update(input_name) else: self._recently_used_menu.removeEntry(input_name) def _saveInputFile(self): """ Save the current input tree to the current filename. """ self.writeInputFile(self.tree.input_filename) self.has_changed = False def _saveInputFileAs(self): """ Ask the user what file to save the input tree to. """ input_name, other = QFileDialog.getSaveFileName(self, "Choose input file", os.getcwd(), "Input File (*.i)") if input_name: input_name = os.path.abspath(input_name) self.writeInputFile(input_name) self.setInputFile(input_name) self._recently_used_menu.update(input_name) self.has_changed = False def _checkInputFile(self): """ Show the input file check window. """ self.check_widget.show() self.check_widget.check(self.tree.app_info.path) def _viewInputFile(self): """ View the text of the current input tree. """ if self.input_file_view.isVisible(): self.input_file_view.hide() else: data = self.tree.getInputFileString() self.input_file_view.setPlainText(data) self.input_file_view.show() def _clearInputFile(self): self.tree.resetInputFile() self.tree.input_filename = None self.block_tree.setInputTree(self.tree) self.inputFileChanged.emit("") self._setMenuStatus() self.has_changed = False def _setMenuStatus(self): """ Set the status of the menus. """ if not self._menus_initialized: return enabled = self.tree.app_info.valid() if self.tree.input_filename: self._save_action.setEnabled(enabled) else: self._save_action.setEnabled(False) self._save_as_action.setEnabled(enabled) self._open_action.setEnabled(enabled) self._recently_used_menu.setEnabled(enabled) self._clear_action.setEnabled(enabled) self._check_action.setEnabled(enabled) self._view_file.setEnabled(enabled) def addToMenu(self, menu): """ Register the menus specific to the InputTab. Input: menu[QMenu]: The menu to add the items to. """ self._open_action = WidgetUtils.addAction(menu, "Open", self._openInputFile, "Ctrl+O") recentMenu = menu.addMenu("Recently opened") self._recently_used_menu = RecentlyUsedMenu(recentMenu, "input/recentlyUsed", "input/maxRecentlyUsed", 20, ) self._recently_used_menu.selected.connect(self.setInputFile) self._save_action = WidgetUtils.addAction(menu, "Save", self._saveInputFile) self._save_as_action = WidgetUtils.addAction(menu, "Save As", self._saveInputFileAs) self._clear_action = WidgetUtils.addAction(menu, "Clear", self._clearInputFile) self._check_action = WidgetUtils.addAction(menu, "Check", self._checkInputFile, "Ctrl+K") self._view_file = WidgetUtils.addAction(menu, "View current input file", self._viewInputFile, "Ctrl+V", True) self._menus_initialized = True self._setMenuStatus() def closing(self): self.check_widget.cleanup() def clearRecentlyUsed(self): if self._menus_initialized: self._recently_used_menu.clearValues() def onCurrentChanged(self, index): """ This is called when the tab is changed. If the block editor window is open we want to raise it to the front so it doesn't get lost. """ if index == self._index: if self.block_editor: self.block_editor.raise_() if __name__ == "__main__": from PyQt5.QtWidgets import QApplication, QMainWindow from ExecutableInfo import ExecutableInfo import sys if len(sys.argv) != 3: print("Usage: %s <exe> <input file>" % sys.argv[0]) sys.exit(1) qapp = QApplication(sys.argv) main_win = QMainWindow() w = InputFileEditorPlugin() main_win.setCentralWidget(w) exe_info = ExecutableInfo() exe_info.setPath(sys.argv[1]) w.initialize() w.executableInfoChanged(exe_info) w.setInputFile(sys.argv[2]) menubar = main_win.menuBar() menubar.setNativeMenuBar(False) input_menu = menubar.addMenu("Input File") w.addToMenu(input_menu) main_win.show() sys.exit(qapp.exec_())
nuclear-wizard/moose
python/peacock/Input/InputFileEditorPlugin.py
Python
lgpl-2.1
8,363
[ "MOOSE" ]
274f4c1e368d538d80811190421f68d66e4c51c51bc4c9de6362d3525fafe3a3
''' Created on 23/11/2009 @author: brian ''' import logging from numpy import linspace from scipysim.actors import Source, Event, LastEvent class Constant(Source): ''' This actor is a constant value source ''' def __init__(self, out, value=1.0, resolution=10, simulation_time=120, endpoint=False): """ default parameters creates a constant output of 1.0 for 2 minutes (with 10 values per "second") """ super(Constant, self).__init__(output_channel=out, simulation_time=simulation_time) self.resolution = resolution self.endpoint = endpoint self.value = value def process(self): """Create the numbers...""" logging.debug("Running ramp process") tags = linspace(0, self.simulation_time, self.simulation_time * self.resolution, endpoint=self.endpoint) # for now just compute 2 minutes of values [self.output_channel.put(Event(tag, self.value)) for tag in tags] #time.sleep(random.random() * 0.001) # Adding a delay so we can see the async logging.debug("Const process finished adding all data to its output channel") self.stop = True self.output_channel.put(LastEvent(self.simulation_time))
hardbyte/scipy-sim
scipysim/actors/math/constant.py
Python
gpl-3.0
1,242
[ "Brian" ]
c62b3eec572de70647b3dff704574dbb02526ad769e7da25774c7f72e0c24a07
# -*- coding: utf-8 -*- try: # Python 2.7 from collections import OrderedDict except: # Python 2.6 from gluon.contrib.simplejson.ordered_dict import OrderedDict from gluon import current from gluon.html import * from gluon.storage import Storage from gluon.validators import IS_NOT_EMPTY from s3.s3fields import S3Represent from s3.s3query import FS from s3.s3utils import S3DateTime, s3_auth_user_represent_name, s3_avatar_represent from s3.s3validators import IS_LOCATION_SELECTOR2, IS_ONE_OF from s3.s3widgets import S3LocationSelectorWidget2 from s3.s3forms import S3SQLCustomForm, S3SQLInlineComponent, S3SQLInlineComponentMultiSelectWidget T = current.T s3 = current.response.s3 settings = current.deployment_settings datetime_represent = lambda dt: S3DateTime.datetime_represent(dt, utc=True) """ Template settings for Requests Management - for Philippines """ # ----------------------------------------------------------------------------- # Pre-Populate settings.base.prepopulate = ("Philippines", "default/users") settings.base.system_name = T("Sahana") settings.base.system_name_short = T("Sahana") # ============================================================================= # System Settings # ----------------------------------------------------------------------------- # Authorization Settings # Users can self-register #settings.security.self_registration = False # Users need to verify their email settings.auth.registration_requires_verification = True # Users don't need to be approved #settings.auth.registration_requires_approval = True # Organisation links are either done automatically # - by registering with official domain of Org # or Manually by Call Center staff #settings.auth.registration_requests_organisation = True #settings.auth.registration_organisation_required = True settings.auth.registration_requests_site = False # Uncomment this to allow Admin to see Organisations in user Admin even if the Registration doesn't request this settings.auth.admin_sees_organisation = True # Approval emails get sent to all admins settings.mail.approver = "ADMIN" settings.auth.registration_link_user_to = {"staff": T("Staff")} settings.auth.registration_link_user_to_default = ["staff"] settings.auth.registration_roles = {"organisation_id": ["USER"], } # Terms of Service to be able to Register on the system # uses <template>/views/tos.html settings.auth.terms_of_service = True settings.auth.show_utc_offset = False settings.auth.show_link = False # ----------------------------------------------------------------------------- # Security Policy settings.security.policy = 5 # Apply Controller, Function and Table ACLs settings.security.map = True # Owner Entity settings.auth.person_realm_human_resource_site_then_org = False # ----------------------------------------------------------------------------- # Theme (folder to use for views/layout.html) settings.base.theme = "Philippines" settings.ui.formstyle_row = "bootstrap" settings.ui.formstyle = "bootstrap" #settings.gis.map_height = 600 #settings.gis.map_width = 854 # Uncomment to disable responsive behavior of datatables # - Disabled until tested settings.ui.datatables_responsive = False # ----------------------------------------------------------------------------- # L10n (Localization) settings settings.L10n.languages = OrderedDict([ ("en", "English"), # ("tl", "Tagalog"), ]) # Default Language settings.L10n.default_language = "en" # Default timezone for users settings.L10n.utc_offset = "UTC +0800" # Unsortable 'pretty' date format settings.L10n.date_format = "%d %b %Y" # Number formats (defaults to ISO 31-0) # Decimal separator for numbers (defaults to ,) settings.L10n.decimal_separator = "." # Thousands separator for numbers (defaults to space) settings.L10n.thousands_separator = "," # Uncomment this to Translate CMS Series Names # - we want this on when running s3translate but off in normal usage as we use the English names to lookup icons in render_posts #settings.L10n.translate_cms_series = True # Uncomment this to Translate Location Names #settings.L10n.translate_gis_location = True # Restrict the Location Selector to just certain countries settings.gis.countries = ["PH"] # Until we add support to LocationSelector2 to set dropdowns from LatLons #settings.gis.check_within_parent_boundaries = False # Uncomment to hide Layer Properties tool #settings.gis.layer_properties = False # Uncomment to display the Map Legend as a floating DIV settings.gis.legend = "float" # ----------------------------------------------------------------------------- # Finance settings settings.fin.currencies = { "PHP" : T("Philippine Pesos"), #"EUR" : T("Euros"), #"GBP" : T("Great British Pounds"), #"CHF" : T("Swiss Francs"), "USD" : T("United States Dollars"), } settings.fin.currency_default = "PHP" # ----------------------------------------------------------------------------- # Enable this for a UN-style deployment #settings.ui.cluster = True # Enable this to use the label 'Camp' instead of 'Shelter' #settings.ui.camp = True # ----------------------------------------------------------------------------- # Uncomment to restrict the export formats available #settings.ui.export_formats = ["xls"] settings.ui.update_label = "Edit" # ----------------------------------------------------------------------------- # Summary Pages settings.ui.summary = [#{"common": True, # "name": "cms", # "widgets": [{"method": "cms"}] # }, {"name": "table", "label": "Table", "widgets": [{"method": "datatable"}] }, {"name": "map", "label": "Map", "widgets": [{"method": "map", "ajax_init": True}], }, {"name": "charts", "label": "Reports", "widgets": [{"method": "report", "ajax_init": True}] }, ] settings.search.filter_manager = False # Filter forms - style for Summary pages #def filter_formstyle(row_id, label, widget, comment, hidden=False): # return DIV(label, widget, comment, # _id=row_id, # _class="horiz_filter_form") # ============================================================================= # Module Settings # ----------------------------------------------------------------------------- # Human Resource Management settings.hrm.staff_label = "Contacts" # Uncomment to allow Staff & Volunteers to be registered without an organisation settings.hrm.org_required = False # Uncomment to allow Staff & Volunteers to be registered without an email address settings.hrm.email_required = False # Uncomment to show the Organisation name in HR represents settings.hrm.show_organisation = True # Uncomment to disable Staff experience settings.hrm.staff_experience = False # Uncomment to disable the use of HR Credentials settings.hrm.use_credentials = False # Uncomment to disable the use of HR Skills settings.hrm.use_skills = False # Uncomment to disable the use of HR Teams settings.hrm.teams = False # Uncomment to hide fields in S3AddPersonWidget[2] settings.pr.request_dob = False settings.pr.request_gender = False # ----------------------------------------------------------------------------- # Org #settings.org.site_label = "Office/Shelter/Hospital" settings.org.site_label = "Site" settings.org.site_autocomplete = True # Extra fields to show in Autocomplete Representations settings.org.site_autocomplete_fields = ["location_id$L1", "location_id$L2", "location_id$L3", "location_id$L4", ] # ----------------------------------------------------------------------------- # Project # Uncomment this to use multiple Organisations per project settings.project.multiple_organisations = True # Links to Filtered Components for Donors & Partners #settings.project.organisation_roles = { # 1: T("Host National Society"), # 2: T("Partner"), # 3: T("Donor"), # #4: T("Customer"), # T("Beneficiary")? # #5: T("Supplier"), # 9: T("Partner National Society"), #} # ----------------------------------------------------------------------------- # Notifications # Template for the subject line in update notifications #settings.msg.notify_subject = "$S %s" % T("Notification") settings.msg.notify_subject = "$S Notification" # ----------------------------------------------------------------------------- def currency_represent(v): """ Custom Representation of Currencies """ if v == "USD": return "$" elif v == "EUR": return "€" elif v == "GBP": return "£" else: # e.g. CHF return v # ----------------------------------------------------------------------------- def render_contacts(list_id, item_id, resource, rfields, record): """ Custom dataList item renderer for Contacts on the Profile pages @param list_id: the HTML ID of the list @param item_id: the HTML ID of the item @param resource: the S3Resource to render @param rfields: the S3ResourceFields to render @param record: the record as dict """ record_id = record["hrm_human_resource.id"] item_class = "thumbnail" raw = record._row #author = record["hrm_human_resource.modified_by"] date = record["hrm_human_resource.modified_on"] fullname = record["hrm_human_resource.person_id"] job_title = raw["hrm_human_resource.job_title_id"] or "" if job_title: job_title = "- %s" % record["hrm_human_resource.job_title_id"] #organisation = record["hrm_human_resource.organisation_id"] organisation_id = raw["hrm_human_resource.organisation_id"] #org_url = URL(c="org", f="organisation", args=[organisation_id, "profile"]) pe_id = raw["pr_person.pe_id"] person_id = raw["hrm_human_resource.person_id"] location = record["org_site.location_id"] location_id = raw["org_site.location_id"] location_url = URL(c="gis", f="location", args=[location_id, "profile"]) address = raw["gis_location.addr_street"] or T("no office assigned") email = raw["pr_email_contact.value"] or T("no email address") if isinstance(email, list): email = email[0] phone = raw["pr_phone_contact.value"] or T("no phone number") if isinstance(phone, list): phone = phone[0] db = current.db s3db = current.s3db ltable = s3db.pr_person_user query = (ltable.pe_id == pe_id) row = db(query).select(ltable.user_id, limitby=(0, 1) ).first() if row: # Use Personal Avatar # @ToDo: Optimise by not doing DB lookups (especially duplicate) within render, but doing these in the bulk query avatar = s3_avatar_represent(row.user_id, _class="media-object") else: avatar = IMG(_src=URL(c="static", f="img", args="blank-user.gif"), _class="media-object") # Edit Bar permit = current.auth.s3_has_permission table = db.pr_person if permit("update", table, record_id=person_id): vars = {"refresh": list_id, "record": record_id, } f = current.request.function if f == "organisation" and organisation_id: vars["(organisation)"] = organisation_id edit_url = URL(c="hrm", f="person", args=[person_id, "update.popup"], vars=vars) title_update = current.response.s3.crud_strings.hrm_human_resource.title_update edit_btn = A(I(" ", _class="icon icon-edit"), _href=edit_url, _class="s3_modal", _title=title_update, ) else: edit_btn = "" edit_url = "#" title_update = "" # Deletions failing due to Integrity Errors #if permit("delete", table, record_id=person_id): # delete_btn = A(I(" ", _class="icon icon-trash"), # _class="dl-item-delete", # ) #else: delete_btn = "" edit_bar = DIV(edit_btn, delete_btn, _class="edit-bar fright", ) avatar = A(avatar, _href=edit_url, _class="pull-left s3_modal", _title=title_update, ) # Render the item body = TAG[""](P(fullname, " ", SPAN(job_title), _class="person_pos", ), P(I(_class="icon-phone"), " ", SPAN(phone), " ", I(_class="icon-envelope-alt"), " ", SPAN(email), _class="card_1_line", ), P(I(_class="icon-home"), " ", address, _class="card_manylines", )) item = DIV(DIV(SPAN(" ", _class="card-title"), SPAN(A(location, _href=location_url, ), _class="location-title", ), SPAN(date, _class="date-title", ), edit_bar, _class="card-header", ), DIV(avatar, DIV(DIV(body, # Organisation only needed if displaying elsewhere than org profile # Author confusing with main contact record #DIV(#author, # #" - ", # A(organisation, # _href=org_url, # _class="card-organisation", # ), # _class="card-person", # ), _class="media", ), _class="media-body", ), _class="media", ), #docs, _class=item_class, _id=item_id, ) return item # ----------------------------------------------------------------------------- def quote_unicode(s): """ Quote unicode strings for URLs for Rocket """ chars = [] for char in s: o = ord(char) if o < 128: chars.append(char) else: chars.append(hex(o).replace("0x", "%").upper()) return "".join(chars) # ----------------------------------------------------------------------------- def render_locations(list_id, item_id, resource, rfields, record): """ Custom dataList item renderer for Locations on the Selection Page @param list_id: the HTML ID of the list @param item_id: the HTML ID of the item @param resource: the S3Resource to render @param rfields: the S3ResourceFields to render @param record: the record as dict """ record_id = record["gis_location.id"] item_class = "thumbnail" raw = record._row name = raw["gis_location.name"] level = raw["gis_location.level"] L1 = raw["gis_location.L1"] L2 = raw["gis_location.L2"] L3 = raw["gis_location.L3"] L4 = raw["gis_location.L4"] location_url = URL(c="gis", f="location", args=[record_id, "profile"]) if level == "L1": represent = name if level == "L2": represent = "%s (%s)" % (name, L1) elif level == "L3": represent = "%s (%s, %s)" % (name, L2, L1) elif level == "L4": represent = "%s (%s, %s, %s)" % (name, L3, L2, L1) else: # L0 or specific represent = name # Users don't edit locations # permit = current.auth.s3_has_permission # table = current.db.gis_location # if permit("update", table, record_id=record_id): # edit_btn = A(I(" ", _class="icon icon-edit"), # _href=URL(c="gis", f="location", # args=[record_id, "update.popup"], # vars={"refresh": list_id, # "record": record_id}), # _class="s3_modal", # _title=current.response.s3.crud_strings.gis_location.title_update, # ) # else: # edit_btn = "" # if permit("delete", table, record_id=record_id): # delete_btn = A(I(" ", _class="icon icon-trash"), # _class="dl-item-delete", # ) # else: # delete_btn = "" # edit_bar = DIV(edit_btn, # delete_btn, # _class="edit-bar fright", # ) # Tallies # NB We assume that all records are readable here # Search all sub-locations locations = current.gis.get_children(record_id) locations = [l.id for l in locations] locations.append(record_id) db = current.db s3db = current.s3db stable = s3db.org_site query = (stable.deleted == False) & \ (stable.location_id.belongs(locations)) count = stable.id.count() row = db(query).select(count).first() if row: tally_sites = row[count] else: tally_sites = 0 table = s3db.req_req query = (table.deleted == False) & \ (stable.site_id == table.site_id) & \ (stable.location_id.belongs(locations)) count = table.id.count() row = db(query).select(count).first() if row: tally_reqs = row[count] else: tally_reqs = 0 table = s3db.req_commit query = (table.deleted == False) & \ (table.location_id.belongs(locations)) count = table.id.count() row = db(query).select(count).first() if row: tally_commits = row[count] else: tally_commits = 0 if level == "L4": next_Lx = "" next_Lx_label = "" else: if level == "L0": next_Lx = "L1" next_Lx_label = "Regions" if level == "L1": next_Lx = "L2" next_Lx_label = "Provinces" elif level == "L2": next_Lx = "L3" next_Lx_label = "Municipalities / Cities" elif level == "L3": next_Lx = "L4" next_Lx_label = "Barangays" table = db.gis_location query = (table.deleted == False) & \ (table.level == next_Lx) & \ (table.parent == record_id) count = table.id.count() row = db(query).select(count).first() if row: tally_Lx = row[count] else: tally_Lx = 0 next_url = URL(c="gis", f="location", args=["datalist"], vars={"~.level": next_Lx, "~.parent": record_id, }) next_Lx_label = A(next_Lx_label, _href=next_url, ) next_Lx = SPAN(tally_Lx, _class="badge", ) # Build the icon, if it doesn't already exist filename = "%s.svg" % record_id import os filepath = os.path.join(current.request.folder, "static", "cache", "svg", filename) if not os.path.exists(filepath): gtable = db.gis_location loc = db(gtable.id == record_id).select(gtable.wkt, limitby=(0, 1) ).first() if loc: from s3.s3codecs.svg import S3SVG S3SVG.write_file(filename, loc.wkt) # Render the item item = DIV(DIV(A(IMG(_class="media-object", _src=URL(c="static", f="cache", args=["svg", filename], ) ), _class="pull-left", _href=location_url, ), DIV(SPAN(A(represent, _href=location_url, _class="media-heading" ), ), #edit_bar, _class="card-header-select", ), DIV(P(next_Lx_label, next_Lx, T("Sites"), SPAN(tally_sites, _class="badge", ), T("Requests"), SPAN(tally_reqs, _class="badge", ), T("Donations"), SPAN(tally_commits, _class="badge", ), _class="tally", ), _class="media-body", ), _class="media", ), _class=item_class, _id=item_id, ) return item # ----------------------------------------------------------------------------- def render_locations_profile(list_id, item_id, resource, rfields, record): """ Custom dataList item renderer for Locations on the Profile Page - UNUSED @param list_id: the HTML ID of the list @param item_id: the HTML ID of the item @param resource: the S3Resource to render @param rfields: the S3ResourceFields to render @param record: the record as dict """ record_id = record["gis_location.id"] item_class = "thumbnail" raw = record._row name = record["gis_location.name"] location_url = URL(c="gis", f="location", args=[record_id, "profile"]) # Placeholder to maintain style #logo = DIV(IMG(_class="media-object"), # _class="pull-left") # We don't Edit Locations # Edit Bar # permit = current.auth.s3_has_permission # table = current.db.gis_location # if permit("update", table, record_id=record_id): # vars = {"refresh": list_id, # "record": record_id, # } # f = current.request.function # if f == "organisation" and organisation_id: # vars["(organisation)"] = organisation_id # edit_btn = A(I(" ", _class="icon icon-edit"), # _href=URL(c="gis", f="location", # args=[record_id, "update.popup"], # vars=vars), # _class="s3_modal", # _title=current.response.s3.crud_strings.gis_location.title_update, # ) # else: # edit_btn = "" # if permit("delete", table, record_id=record_id): # delete_btn = A(I(" ", _class="icon icon-trash"), # _class="dl-item-delete", # ) # else: # delete_btn = "" # edit_bar = DIV(edit_btn, # delete_btn, # _class="edit-bar fright", # ) # Render the item item = DIV(DIV(DIV(#SPAN(A(name, # _href=location_url, # ), # _class="location-title"), #" ", #edit_bar, P(A(name, _href=location_url, ), _class="card_comments"), _class="span5"), # card-details _class="row", ), ) return item # ----------------------------------------------------------------------------- def render_sites(list_id, item_id, resource, rfields, record): """ Custom dataList item renderer for Facilities on the Profile pages @param list_id: the HTML ID of the list @param item_id: the HTML ID of the item @param resource: the S3Resource to render @param rfields: the S3ResourceFields to render @param record: the record as dict """ record_id = record["org_facility.id"] item_class = "thumbnail" raw = record._row name = record["org_facility.name"] site_id = raw["org_facility.id"] opening_times = raw["org_facility.opening_times"] or "" author = record["org_facility.modified_by"] date = record["org_facility.modified_on"] organisation = record["org_facility.organisation_id"] organisation_id = raw["org_facility.organisation_id"] location = record["org_facility.location_id"] level = raw["gis_location.level"] if level: location_id = raw["org_facility.location_id"] else: location_id = raw["gis_location.parent"] location_url = URL(c="gis", f="location", args=[location_id, "profile"]) address = raw["gis_location.addr_street"] or "" phone = raw["org_facility.phone1"] or "" facility_type = record["org_site_facility_type.facility_type_id"] comments = record["org_facility.comments"] or "" logo = raw["org_organisation.logo"] site_url = URL(c="org", f="facility", args=[site_id, "profile"]) org_url = URL(c="org", f="organisation", args=[organisation_id, "profile"]) if logo: logo = A(IMG(_src=URL(c="default", f="download", args=[logo]), _class="media-object", ), _href=org_url, _class="pull-left", ) else: logo = DIV(IMG(_class="media-object"), _class="pull-left") facility_status = raw["org_site_status.facility_status"] or "" if facility_status: if facility_status == 1: icon = "thumbs-up-alt" colour = "green" elif facility_status == 2: icon = "thumbs-down-alt" colour = "amber" elif facility_status == 3: icon = "reply-all" colour = "red" elif facility_status == 4: icon = "remove" colour = "red" elif facility_status == 99: icon = "question" colour = "" facility_status = P(#I(_class="icon-%s" % icon), #" ", SPAN("%s: %s" % (T("Status"), record["org_site_status.facility_status"])), " ", _class="card_1_line %s" % colour, ) power_supply_type = raw["org_site_status.power_supply_type"] or "" if power_supply_type: if power_supply_type == 1: icon = "thumbs-up-alt" colour = "green" elif power_supply_type == 2: icon = "cogs" colour = "amber" elif power_supply_type == 98: icon = "question" colour = "amber" elif power_supply_type == 99: icon = "remove" colour = "red" power_supply_type = P(#I(_class="icon-%s" % icon), #" ", SPAN("%s: %s" % (T("Power"), record["org_site_status.power_supply_type"])), " ", _class="card_1_line %s" % colour, ) # Edit Bar permit = current.auth.s3_has_permission table = current.db.org_facility if permit("update", table, record_id=record_id): vars = {"refresh": list_id, "record": record_id, } f = current.request.function if f == "organisation" and organisation_id: vars["(organisation)"] = organisation_id edit_btn = A(I(" ", _class="icon icon-edit"), _href=URL(c="org", f="facility", args=[record_id, "update.popup"], vars=vars), _class="s3_modal", _title=current.response.s3.crud_strings.org_facility.title_update, ) else: edit_btn = "" if permit("delete", table, record_id=record_id): delete_btn = A(I(" ", _class="icon icon-trash"), _class="dl-item-delete", ) else: delete_btn = "" edit_bar = DIV(edit_btn, delete_btn, _class="edit-bar fright", ) # Render the item body = TAG[""](P(I(_class="icon-flag"), " ", SPAN(facility_type), " ", _class="card_1_line", ), P(I(_class="icon-home"), " ", address, _class="card_manylines", ), P(I(_class="icon-time"), " ", SPAN(opening_times), " ", _class="card_1_line", ), P(I(_class="icon-phone"), " ", SPAN(phone), " ", _class="card_1_line", ), facility_status, power_supply_type, P(comments, _class="card_manylines s3-truncate", ), ) item = DIV(DIV(SPAN(A(name, _href=site_url, ), _class="card-title", ), SPAN(A(location, _href=location_url, ), _class="location-title", ), SPAN(date, _class="date-title", ), edit_bar, _class="card-header", ), DIV(logo, DIV(DIV(body, DIV(author, " - ", A(organisation, _href=org_url, _class="card-organisation", ), _class="card-person", ), _class="media", ), _class="media-body", ), _class="media", ), #docs, _class=item_class, _id=item_id, ) return item # ----------------------------------------------------------------------------- def render_organisations(list_id, item_id, resource, rfields, record): """ Custom dataList item renderer for Organisations on the Stakeholder Selection Page @param list_id: the HTML ID of the list @param item_id: the HTML ID of the item @param resource: the S3Resource to render @param rfields: the S3ResourceFields to render @param record: the record as dict """ record_id = record["org_organisation.id"] item_class = "thumbnail span6" # span6 for 2 cols raw = record._row name = record["org_organisation.name"] logo = raw["org_organisation.logo"] phone = raw["org_organisation.phone"] or "" website = raw["org_organisation.website"] or "" if website: website = A(website, _href=website) money = raw["req_organisation_needs.money"] if money: money_details = record["req_organisation_needs.money_details"] money_details = SPAN(XML(money_details), _class="s3-truncate") money_details = P(I(_class="icon icon-dollar"), " ", money_details, _class="card_manylines", ) else: # Include anyway to make cards align money_details = P(I(_class="icon icon-dollar"), " ", _class="card_1_line", ) #time = raw["req_organisation_needs.vol"] #if time: # time_details = record["req_organisation_needs.vol_details"] # time_details = P(I(_class="icon icon-time"), # " ", # XML(time_details), # _class="card_1_line", # ) #else: # time_details = "" org_url = URL(c="org", f="organisation", args=[record_id, "profile"]) if logo: logo = A(IMG(_src=URL(c="default", f="download", args=[logo]), _class="media-object", ), _href=org_url, _class="pull-left", ) else: logo = DIV(IMG(_class="media-object"), _class="pull-left") db = current.db permit = current.auth.s3_has_permission table = db.org_organisation if permit("update", table, record_id=record_id): edit_btn = A(I(" ", _class="icon icon-edit"), _href=URL(c="org", f="organisation", args=[record_id, "update.popup"], vars={"refresh": list_id, "record": record_id}), _class="s3_modal", _title=current.response.s3.crud_strings.org_organisation.title_update, ) else: edit_btn = "" if permit("delete", table, record_id=record_id): delete_btn = A(I(" ", _class="icon icon-trash"), _class="dl-item-delete", ) else: delete_btn = "" edit_bar = DIV(edit_btn, delete_btn, _class="edit-bar fright", ) # Tallies # NB We assume that all records are readable here s3db = current.s3db stable = s3db.org_site query = (stable.deleted == False) & \ (stable.obsolete == False) & \ (stable.organisation_id == record_id) tally_sites = db(query).count() table = s3db.req_req query = (table.deleted == False) & \ (stable.site_id == table.site_id) & \ (stable.organisation_id == record_id) tally_reqs = db(query).count() table = s3db.req_commit query = (table.deleted == False) & \ (table.organisation_id == record_id) tally_commits = db(query).count() # Render the item item = DIV(DIV(logo, DIV(SPAN(A(name, _href=org_url, _class="media-heading" ), ), edit_bar, _class="card-header-select", ), DIV(P(I(_class="icon icon-phone"), " ", phone, _class="card_1_line", ), P(I(_class="icon icon-map"), " ", website, _class="card_1_line", ), money_details, #time_details, P(T("Sites"), SPAN(tally_sites, _class="badge", ), T("Requests"), SPAN(tally_reqs, _class="badge", ), T("Donations"), SPAN(tally_commits, _class="badge", ), _class="tally", ), _class="media-body", ), _class="media", ), _class=item_class, _id=item_id, ) return item # ----------------------------------------------------------------------------- def render_org_needs(list_id, item_id, resource, rfields, record): """ Custom dataList item renderer for Needs - UNUSED @param list_id: the HTML ID of the list @param item_id: the HTML ID of the item @param resource: the S3Resource to render @param rfields: the S3ResourceFields to render @param record: the record as dict """ record_id = record["req_organisation_needs.id"] item_class = "thumbnail" raw = record._row logo = raw["org_organisation.logo"] phone = raw["org_organisation.phone"] or "" website = raw["org_organisation.website"] or "" if website: website = A(website, _href=website) author = record["req_organisation_needs.modified_by"] date = record["req_organisation_needs.modified_on"] money = raw["req_organisation_needs.money"] if money: money_details = record["req_organisation_needs.money_details"] money_details = P(I(_class="icon icon-dollar"), " ", XML(money_details), _class="card_manylines", ) else: money_details = "" time = raw["req_organisation_needs.vol"] if time: time_details = record["req_organisation_needs.vol_details"] time_details = P(I(_class="icon icon-time"), " ", XML(time_details), _class="card_manylines", ) else: time_details = "" org_id = raw["org_organisation.id"] org_url = URL(c="org", f="organisation", args=[org_id, "profile"]) if logo: logo = A(IMG(_src=URL(c="default", f="download", args=[logo]), _class="media-object", ), _href=org_url, _class="pull-left", ) else: logo = DIV(IMG(_class="media-object"), _class="pull-left") permit = current.auth.s3_has_permission table = current.db.req_organisation_needs if permit("update", table, record_id=record_id): edit_btn = A(I(" ", _class="icon icon-edit"), _href=URL(c="req", f="organisation_needs", args=[record_id, "update.popup"], vars={"refresh": list_id, "record": record_id}), _class="s3_modal", _title=current.response.s3.crud_strings.req_organisation_needs.title_update, ) else: edit_btn = "" if permit("delete", table, record_id=record_id): delete_btn = A(I(" ", _class="icon icon-trash"), _class="dl-item-delete", ) else: delete_btn = "" edit_bar = DIV(edit_btn, delete_btn, _class="edit-bar fright", ) if current.request.controller == "org": # Org Profile page - no need to repeat Org Name title = " " else: title = raw["org_organisation.name"] # Render the item item = DIV(DIV(SPAN(title, _class="card-title"), SPAN(author, _class="location-title"), SPAN(date, _class="date-title"), edit_bar, _class="card-header", ), DIV(logo, DIV(P(I(_class="icon icon-phone"), " ", phone, _class="card_1_line", ), P(I(_class="icon icon-map"), " ", website, _class="card_1_line", ), money_details, time_details, _class="media-body", ), _class="media", ), _class=item_class, _id=item_id, ) return item s3.render_org_needs = render_org_needs # ----------------------------------------------------------------------------- def render_site_needs(list_id, item_id, resource, rfields, record): """ Custom dataList item renderer for Needs - UNUSED @param list_id: the HTML ID of the list @param item_id: the HTML ID of the item @param resource: the S3Resource to render @param rfields: the S3ResourceFields to render @param record: the record as dict """ record_id = record["req_site_needs.id"] item_class = "thumbnail" raw = record._row logo = raw["org_organisation.logo"] addresses = raw["gis_location.addr_street"] if addresses: if isinstance(addresses, list): address = addresses[0] else: address = addresses else: address = "" #contact = raw["org_facility.contact"] or "" opening_times = raw["org_facility.opening_times"] or "" phone = raw["org_facility.phone1"] or "" website = raw["org_organisation.website"] or "" if website: website = A(website, _href=website) author = record["req_site_needs.modified_by"] date = record["req_site_needs.modified_on"] #goods = raw["req_site_needs.goods"] #if goods: # goods_details = record["req_site_needs.goods_details"] # goods_details = P(I(_class="icon icon-truck"), # " ", # XML(goods_details), # _class="card_1_line", # ) #else: # goods_details = "" #time = raw["req_site_needs.vol"] #if time: # time_details = record["req_site_needs.vol_details"] # time_details = P(I(_class="icon icon-time"), # " ", # XML(time_details), # _class="card_1_line", # ) #else: # time_details = "" site_url = URL(c="org", f="facility", args=[record_id, "profile"]) if logo: logo = A(IMG(_src=URL(c="default", f="download", args=[logo]), _class="media-object", ), _href=site_url, _class="pull-left", ) else: logo = DIV(IMG(_class="media-object"), _class="pull-left") permit = current.auth.s3_has_permission table = current.db.req_site_needs if permit("update", table, record_id=record_id): edit_btn = A(I(" ", _class="icon icon-edit"), _href=URL(c="req", f="site_needs", args=[record_id, "update.popup"], vars={"refresh": list_id, "record": record_id}), _class="s3_modal", _title=current.response.s3.crud_strings.req_site_needs.title_update, ) else: edit_btn = "" if permit("delete", table, record_id=record_id): delete_btn = A(I(" ", _class="icon icon-trash"), _class="dl-item-delete", ) else: delete_btn = "" edit_bar = DIV(edit_btn, delete_btn, _class="edit-bar fright", ) if current.request.controller == "org": # Site Profile page - no need to repeat Site Name title = " " else: title = raw["org_facility.name"] # Render the item item = DIV(DIV(SPAN(title, _class="card-title"), SPAN(author, _class="location-title"), SPAN(date, _class="date-title"), edit_bar, _class="card-header", ), DIV(logo, DIV(#goods_details, #time_details, P(I(_class="icon icon-home"), " ", address, _class="card_manylines", ), P(I(_class="icon-time"), " ", SPAN(opening_times), " ", _class="card_1_line", ), P(I(_class="icon icon-phone"), " ", phone, _class="card_1_line", ), P(I(_class="icon icon-map"), " ", website, _class="card_1_line", ), P(I(_class="icon icon-user"), " ", contact, _class="card_1_line", ), _class="media-body", ), _class="media", ), _class=item_class, _id=item_id, ) return item s3.render_site_needs = render_site_needs # ----------------------------------------------------------------------------- def customise_gis_location_controller(**attr): """ Customise gis_location controller - Profile Page """ db = current.db s3 = current.response.s3 # Custom PreP standard_prep = s3.prep def custom_prep(r): # Call standard prep if callable(standard_prep): result = standard_prep(r) if not result: return False if r.interactive: s3db = current.s3db table = s3db.gis_location if r.method == "datalist": # Lx selection page # 2-column datalist, 6 rows per page s3.dl_pagelength = 12 s3.dl_rowsize = 2 # Default 5 triggers an AJAX call, we should load all by default s3.dl_pagelength = 17 level = current.request.get_vars.get("~.level", None) if not level: # Just show PH L1s level = "L1" s3.filter = (table.L0 == "Philippines") & (table.level == "L1") parent = current.request.get_vars.get("~.parent", None) if level == "L1": s3.crud_strings["gis_location"].title_list = T("Regions") elif level == "L2": if parent: parent = db(table.id == parent).select(table.name, limitby=(0, 1) ).first().name s3.crud_strings["gis_location"].title_list = T("Provinces in %s") % parent else: s3.crud_strings["gis_location"].title_list = T("Provinces") elif level == "L3": if parent: parent = db(table.id == parent).select(table.name, limitby=(0, 1) ).first().name s3.crud_strings["gis_location"].title_list = T("Municipalities and Cities in %s") % parent else: s3.crud_strings["gis_location"].title_list = T("Municipalities and Cities") elif level == "L4": if parent: parent = db(table.id == parent).select(table.name, limitby=(0, 1) ).first().name s3.crud_strings["gis_location"].title_list = T("Barangays in %s") % parent else: s3.crud_strings["gis_location"].title_list = T("Barangays") list_fields = ["name", "level", "L1", "L2", "L3", "L4", ] s3db.configure("gis_location", filter_widgets = None, list_fields = list_fields, list_layout = render_locations, ) elif r.method == "profile": # Customise tables used by widgets #customise_hrm_human_resource_fields() customise_org_facility_fields() s3db.req_customise_req_fields() s3db.req_customise_commit_fields() # gis_location table (Sub-Locations) table.parent.represent = s3db.gis_LocationRepresent(sep=" | ") list_fields = ["name", "id", ] location = r.record record_id = location.id # Override context as that's a Path default = "~.(location)=%s" % record_id map_widget = dict(label = "Map", type = "map", context = "location", icon = "icon-map", height = 383, width = 568, bbox = {"lat_max" : location.lat_max, "lon_max" : location.lon_max, "lat_min" : location.lat_min, "lon_min" : location.lon_min }, ) #locations_widget = dict(label = "Locations", # insert = False, # #label_create = "Create Location", # type = "datalist", # tablename = "gis_location", # context = "location", # icon = "icon-globe", # # @ToDo: Show as Polygons? # show_on_map = False, # list_layout = render_locations_profile, # ) #needs_widget = dict(label = "Needs", # label_create = "Add New Need", # type = "datalist", # tablename = "req_site_needs", # context = "location", # icon = "icon-hand-up", # multiple = False, # # Would just show up on Sites # show_on_map = False, # list_layout = render_site_needs, # ) reqs_widget = dict(label = "Requests", label_create = "Add New Request", type = "datalist", tablename = "req_req", context = "location", default = default, filter = FS("req_status").belongs([0, 1]), icon = "icon-flag", layer = "Requests", # provided by Catalogue Layer #marker = "request", list_layout = s3db.req_req_list_layout, ) commits_widget = dict(label = "Donations", label_create = "Add New Donation", type = "datalist", tablename = "req_commit", context = "location", default = default, filter = FS("cancel") == False, icon = "icon-truck", show_on_map = False, #layer = "Donations", # provided by Catalogue Layer #marker = "donation", list_layout = s3db.req_commit_list_layout, ) #resources_widget = dict(label = "Resources", # label_create = "Create Resource", # type = "datalist", # tablename = "org_resource", # context = "location", # default = default, # #filter = FS("req_status").belongs([0, 1]), # icon = "icon-wrench", # layer = "Resources", # # provided by Catalogue Layer # #marker = "resource", # list_layout = s3db.org_resource_list_layout, # ) sites_widget = dict(label = "Sites", label_create = "Add New Site", type = "datalist", tablename = "org_facility", context = "location", default = default, filter = FS("obsolete") == False, icon = "icon-home", layer = "Facilities", # provided by Catalogue Layer #marker = "office", list_layout = render_sites, ) # Build the icon, if it doesn't already exist filename = "%s.svg" % record_id import os filepath = os.path.join(current.request.folder, "static", "cache", "svg", filename) if not os.path.exists(filepath): gtable = db.gis_location loc = db(gtable.id == record_id).select(gtable.wkt, limitby=(0, 1) ).first() if loc and loc.wkt: from s3.s3codecs.svg import S3SVG S3SVG.write_file(filename, loc.wkt) if current.auth.s3_has_permission("update", table, record_id=record_id): edit_btn = A(I(_class="icon icon-edit"), _href=URL(c="gis", f="location", args=[record_id, "update.popup"], vars={"refresh": "datalist"}), _class="s3_modal", _title=s3.crud_strings["gis_location"].title_update, ) else: edit_btn = "" name = location.name s3db.configure("gis_location", list_fields = list_fields, profile_title = "%s : %s" % (s3.crud_strings["gis_location"].title_list, name), profile_header = DIV(edit_btn, A(IMG(_class="media-object", _src=URL(c="static", f="cache", args=["svg", filename], ), ), _class="pull-left", #_href=location_url, ), H2(name), _class="profile-header", ), profile_widgets = [reqs_widget, map_widget, commits_widget, #resources_widget, sites_widget, #locations_widget, ], ) return True s3.prep = custom_prep return attr settings.customise_gis_location_controller = customise_gis_location_controller # ----------------------------------------------------------------------------- def customise_hrm_human_resource_fields(): """ Customise hrm_human_resource for Profile widgets and 'more' popups """ s3db = current.s3db table = s3db.hrm_human_resource table.site_id.represent = S3Represent(lookup="org_site") s3db.org_site.location_id.represent = s3db.gis_LocationRepresent(sep=" | ") #table.modified_by.represent = s3_auth_user_represent_name table.modified_on.represent = datetime_represent list_fields = ["person_id", "person_id$pe_id", "organisation_id", "site_id$location_id", "site_id$location_id$addr_street", "job_title_id", "email.value", "phone.value", #"modified_by", "modified_on", ] s3db.configure("hrm_human_resource", list_fields = list_fields, ) # ----------------------------------------------------------------------------- def customise_hrm_human_resource_controller(**attr): """ Customise hrm_human_resource controller - used for 'more' popups """ s3 = current.response.s3 # Custom PreP standard_prep = s3.prep def custom_prep(r): # Call standard prep if callable(standard_prep): result = standard_prep(r) if not result: return False if r.method == "datalist": customise_hrm_human_resource_fields() current.s3db.configure("hrm_human_resource", # Don't include a Create form in 'More' popups listadd = False, list_layout = render_contacts, ) return True s3.prep = custom_prep return attr settings.customise_hrm_human_resource_controller = customise_hrm_human_resource_controller # ----------------------------------------------------------------------------- def customise_hrm_job_title_controller(**attr): s3 = current.response.s3 table = current.s3db.hrm_job_title # Configure fields field = table.organisation_id field.readable = field.writable = False field.default = None # Custom postp standard_postp = s3.postp def custom_postp(r, output): if r.interactive: actions = [dict(label=str(T("Open")), _class="action-btn", url=URL(c="hrm", f="job_title", args=["[id]", "read"])) ] db = current.db auth = current.auth has_permission = auth.s3_has_permission ownership_required = auth.permission.ownership_required s3_accessible_query = auth.s3_accessible_query if has_permission("update", table): action = dict(label=str(T("Edit")), _class="action-btn", url=URL(c="hrm", f="job_title", args=["[id]", "update"]), ) if ownership_required("update", table): # Check which records can be updated query = s3_accessible_query("update", table) rows = db(query).select(table._id) restrict = [] rappend = restrict.append for row in rows: row_id = row.get("id", None) if row_id: rappend(str(row_id)) action["restrict"] = restrict actions.append(action) if has_permission("delete", table): action = dict(label=str(T("Delete")), _class="action-btn", url=URL(c="hrm", f="job_title", args=["[id]", "delete"]), ) if ownership_required("delete", table): # Check which records can be deleted query = s3_accessible_query("delete", table) rows = db(query).select(table._id) restrict = [] rappend = restrict.append for row in rows: row_id = row.get("id", None) if row_id: rappend(str(row_id)) action["restrict"] = restrict actions.append(action) s3.actions = actions if isinstance(output, dict): if "form" in output: output["form"].add_class("hrm_job_title") elif "item" in output and hasattr(output["item"], "add_class"): output["item"].add_class("hrm_job_title") # Call standard postp if callable(standard_postp): output = standard_postp(r, output) return output s3.postp = custom_postp return attr settings.customise_hrm_job_title_controller = customise_hrm_job_title_controller # ----------------------------------------------------------------------------- def customise_org_facility_fields(): """ Customise org_facility for Profile widgets and 'more' popups """ # Truncate comments fields from s3.s3utils import s3_trunk8 s3_trunk8(lines=2) s3db = current.s3db tablename = "org_facility" table = s3db.org_facility table.location_id.represent = s3db.gis_LocationRepresent(sep=" | ") table.modified_by.represent = s3_auth_user_represent_name table.modified_on.represent = datetime_represent field = table.comments field.represent = lambda body: XML(s3_URLise(body)) field.comment = None table.phone1.label = T("Phone") # CRUD strings ADD_FAC = T("Add Site") current.response.s3.crud_strings[tablename] = Storage( label_create = ADD_FAC, title_display = T("Site Details"), title_list = T("Sites"), title_update = T("Edit Site"), label_list_button = T("List Sites"), label_delete_button = T("Delete Site"), msg_record_created = T("Site Added"), msg_record_modified = T("Site Updated"), msg_record_deleted = T("Site Canceled"), msg_list_empty = T("No Sites registered")) list_fields = ["name", "code", "site_facility_type.facility_type_id", "organisation_id", "location_id", "location_id$addr_street", "location_id$level", "location_id$parent", "modified_by", "modified_on", "organisation_id$logo", "opening_times", "human_resource.person_id", #"contact", "phone1", "status.facility_status", "status.power_supply_type", "comments", ] crud_form = S3SQLCustomForm("name", "code", S3SQLInlineComponentMultiSelectWidget( "facility_type", label = T("Facility Type"), field = "facility_type_id", widget = "multiselect", ), "organisation_id", "location_id", "opening_times", # This is too Ugly right now! #S3SQLInlineComponent( # "human_resource_site", # label = T("Focal Point"), # field = ["human_resource_id"], # multiple = False, #), #"contact", "phone1", # This is too Ugly right now! #S3SQLInlineComponent( # "needs", # label = T("Needs"), # multiple = False, #), S3SQLInlineComponent( "status", label = T("Status"), multiple = False, ), "comments", ) s3db.configure(tablename, crud_form = crud_form, list_fields = list_fields, ) # ----------------------------------------------------------------------------- def customise_org_facility_controller(**attr): s3 = current.response.s3 s3db = current.s3db table = s3db.org_facility # Custom PreP standard_prep = s3.prep def custom_prep(r): # Call standard prep if callable(standard_prep): result = standard_prep(r) if not result: return False if r.interactive: customise_org_facility_fields() # Which levels of Hierarchy are we using? levels = current.gis.get_relevant_hierarchy_levels() # Filter from a Profile page? # If so, then default the fields we know get_vars = current.request.get_vars location_id = get_vars.get("~.(location)", None) organisation_id = get_vars.get("~.(organisation)", None) if organisation_id: org_field = table.organisation_id org_field.default = organisation_id org_field.readable = org_field.writable = False location_field = table.location_id if location_id: location_field.default = location_id location_field.readable = location_field.writable = False else: # Don't add new Locations here location_field.comment = None location_field.requires = IS_LOCATION_SELECTOR2(levels=levels) location_field.widget = S3LocationSelectorWidget2(levels=levels, show_address=True, show_map=True) # @ToDo: Proper button if we want this & amend functionality for Bootstrap) #s3.cancel = True if r.method == "datalist": # Site selection page # 2-column datalist, 6 rows per page #s3.dl_pagelength = 12 #s3.dl_rowsize = 2 from s3.s3filter import S3TextFilter, S3OptionsFilter, S3LocationFilter filter_widgets = [ S3LocationFilter("location_id", levels = levels, hidden = True, ), S3OptionsFilter(name = "type", label = T("Type"), field="site_facility_type.facility_type_id", hidden = True, ), S3OptionsFilter(name = "status", label = T("Status"), field = "status.facility_status", hidden = True, ), S3OptionsFilter(name = "power", label = T("Power Supply"), field = "status.power_supply_type", hidden = True, ), ] #get_vars = current.request.get_vars #goods = get_vars.get("needs.goods", None) #vol = get_vars.get("needs.vol", None) #if goods: # needs_fields = ["needs.goods_details"] # s3.crud_strings["org_facility"].title_list = T("Sites where you can Drop-off Goods") #elif vol: # needs_fields = ["needs.vol_details"] # s3.crud_strings["org_facility"].title_list = T("Sites where you can Volunteer your time") #else: # yesno = {True: T("Yes"), False: T("No")} # needs_fields = ["needs.goods_details", "needs.vol_details"] # filter_widgets.insert(0, S3OptionsFilter("needs.goods", # label = T("Drop-off Goods"), # cols = 2, # options = yesno, # multiple = False, # hidden = True, # )) # filter_widgets.insert(1, S3OptionsFilter("needs.vol", # label = T("Volunteer Time"), # cols = 2, # options = yesno, # multiple = False, # hidden = True, # )) filter_widgets.insert(0, S3TextFilter(["name", "code", "comments", ], #+ needs_fields, label = T("Search"))) s3db.configure("org_facility", # Don't include a Create form in 'More' popups listadd = False, list_layout = render_sites, filter_widgets = filter_widgets, ) elif r.method == "profile": # Customise tables used by widgets customise_hrm_human_resource_fields() customise_site_needs_fields(profile=True) s3db.req_customise_req_fields() list_fields = ["name", "id", ] record = r.record record_id = record.id # @ToDo: Center on the Site map_widget = dict(label = "Map", type = "map", context = "site", icon = "icon-map", height = 383, width = 568, ) contacts_widget = dict(label = "Contacts", label_create = "Create Contact", type = "datalist", tablename = "hrm_human_resource", context = "site", create_controller = "pr", create_function = "person", icon = "icon-contact", show_on_map = False, # Since they will show within Sites list_layout = render_contacts, ) reqs_widget = dict(label = "Requests", label_create = "Add New Request", type = "datalist", tablename = "req_req", context = "site", filter = FS("req_status").belongs([0, 1]), icon = "icon-flag", show_on_map = False, # Since they will show within Sites list_layout = s3db.req_req_list_layout, ) commits_widget = dict(label = "Donations", #label_create = "Add New Donation", type = "datalist", tablename = "req_commit", context = "site", filter = FS("cancel") == False, icon = "icon-truck", show_on_map = False, #layer = "Donations", # provided by Catalogue Layer #marker = "donation", list_layout = s3db.req_commit_list_layout, ) if current.auth.s3_has_permission("update", table, record_id=record_id): edit_btn = A(I(_class = "icon icon-edit"), _href=URL(c="org", f="facility", args=[record_id, "update.popup"], vars={"refresh": "datalist"}), _class="s3_modal", _title=s3.crud_strings["org_facility"].title_update, ) else: edit_btn = "" name = record.name code = record.code if code: name_code = "%s - %s" % (name, code) else: name_code = code location = table.location_id.represent(record.location_id) organisation_id = record.organisation_id db = current.db otable = db.org_organisation query = (otable.id == organisation_id) org = db(query).select(otable.name, otable.logo, limitby=(0, 1)).first() if org and org.logo: logo = URL(c="default", f="download", args=[org.logo]) else: # @ToDo: Placeholder logo = "#" # Add primary resource to map # Lookup Marker (type-dependent) ftable = s3db.org_facility ltable = s3db.org_site_facility_type query = (ftable == record_id) & \ (ftable.site_id == ltable.site_id) facility_type = db(query).select(ltable.facility_type_id, limitby = (0, 1) ).first() # Lookup Marker if facility_type: layer_filter = "facility_type.facility_type_id=%s" % \ facility_type.id else: layer_filter = "" marker = current.gis.get_marker(controller = "org", function = "facility", filter = layer_filter) lat = None lon = None gtable = s3db.gis_location query = (r.id == ftable.id) & \ (ftable.location_id == gtable.id) lat_lon = db(query).select(gtable.lat, gtable.lon, limitby = (0,1)).first() if lat_lon: lat = lat_lon["gis_location.lat"] lon = lat_lon["gis_location.lon"] map_widget["lat"] = lat map_widget["lon"] = lon tablename = "org_facility" layer = dict(name = record.name, id = "profile-header-%s-%s" % (tablename, record_id), active = True, tablename = r.tablename, url = "/%s/org/facility.geojson?facility.id=%s" % \ (r.application, record_id), marker = marker, ) s3db.configure(tablename, list_fields = list_fields, profile_title = "%s : %s" % (s3.crud_strings["org_facility"].title_list, name), profile_header = DIV(edit_btn, IMG(_class="media-object", _src=logo, ), H2(name), record.code and P(record.code) or "", P(I(_class="icon-sitemap"), " ", SPAN(org and org.name or current.messages.NONE), " ", _class="card_1_line", ), P(I(_class="icon-globe"), " ", SPAN(location), " ", _class="card_1_line", ), P(record.comments, _class="s3-truncate"), _class="profile-header", ), profile_layers = [layer], profile_widgets = [reqs_widget, map_widget, commits_widget, contacts_widget, ], ) if r.interactive or r.representation == "aadata": # Configure fields #table.code.readable = table.code.writable = False #table.phone1.readable = table.phone1.writable = False table.phone2.readable = table.phone2.writable = False table.email.readable = table.email.writable = False elif r.representation == "geojson": # Don't represent facility_status, but just show integers s3db.org_site_status.facility_status.represent = None return True s3.prep = custom_prep # Custom postp standard_postp = s3.postp def custom_postp(r, output): if r.interactive: if isinstance(output, dict) and \ current.auth.s3_has_permission("create", r.table): # Insert a Button to Create New in Modal output["showadd_btn"] = A(I(_class="icon icon-plus-sign big-add"), _href=URL(c="org", f="facility", args=["create.popup"], vars={"refresh": "datalist"}), _class="btn btn-primary s3_modal", _role="button", _title=T("Add New Site"), ) actions = [dict(label=str(T("Open")), _class="action-btn", url=URL(c="org", f="facility", args=["[id]", "read"])) ] db = current.db auth = current.auth has_permission = auth.s3_has_permission ownership_required = auth.permission.ownership_required s3_accessible_query = auth.s3_accessible_query if has_permission("update", table): action = dict(label=str(T("Edit")), _class="action-btn", url=URL(c="org", f="facility", args=["[id]", "update"]), ) if ownership_required("update", table): # Check which records can be updated query = s3_accessible_query("update", table) rows = db(query).select(table._id) restrict = [] rappend = restrict.append for row in rows: row_id = row.get("id", None) if row_id: rappend(str(row_id)) action["restrict"] = restrict actions.append(action) if has_permission("delete", table): action = dict(label=str(T("Delete")), _class="action-btn", url=URL(c="org", f="facility", args=["[id]", "delete"]), ) if ownership_required("delete", table): # Check which records can be deleted query = s3_accessible_query("delete", table) rows = db(query).select(table._id) restrict = [] rappend = restrict.append for row in rows: row_id = row.get("id", None) if row_id: rappend(str(row_id)) action["restrict"] = restrict actions.append(action) s3.actions = actions if isinstance(output, dict): if "form" in output: output["form"].add_class("org_facility") elif "item" in output and hasattr(output["item"], "add_class"): output["item"].add_class("org_facility") # Call standard postp if callable(standard_postp): output = standard_postp(r, output) return output s3.postp = custom_postp # @ToDo: Don't just hide but prevent building #attr["rheader"] = None return attr settings.customise_org_facility_controller = customise_org_facility_controller # ----------------------------------------------------------------------------- def customise_org_needs_fields(profile=False): # Truncate details field(s) from s3.s3utils import s3_trunk8 s3_trunk8(lines=2) s3db = current.s3db table = s3db.req_organisation_needs table.modified_by.represent = s3_auth_user_represent_name table.modified_on.represent = datetime_represent table.vol.readable = table.vol.writable = False table.vol_details.readable = table.vol_details.writable = False # Hide money_details unless used s3.jquery_ready.append( '''$('#req_organisation_needs_money_details__row').hide() $('#req_organisation_needs_money').change(function(){ $('#req_organisation_needs_money_details__row').toggle($(this).prop('checked')) }).change()''') list_fields = ["id", "organisation_id", # @ToDo: Are these better displayed elsewhere in Profile view? "organisation_id$logo", "organisation_id$phone", "organisation_id$website", "money", "money_details", #"vol", #"vol_details", "modified_on", "modified_by", ] if not profile: list_fields += ["organisation_id$name", ] s3db.configure("req_organisation_needs", list_fields=list_fields, ) return # ----------------------------------------------------------------------------- def customise_req_organisation_needs_controller(**attr): """ Customise req_organisation_needs controller """ customise_org_needs_fields() return attr settings.customise_req_organisation_needs_controller = customise_req_organisation_needs_controller # ----------------------------------------------------------------------------- def customise_org_organisation_controller(**attr): """ Customise org_organisation controller - Profile Page - Requests """ s3 = current.response.s3 # Custom PreP standard_prep = s3.prep def custom_prep(r): # Call standard prep if callable(standard_prep): result = standard_prep(r) if not result: return False if r.interactive or r.representation == "aadata": # Load normal Model s3db = current.s3db table = s3db.org_organisation list_fields = ["id", "name", "logo", "phone", "website", "needs.money", "needs.money_details", #"needs.vol", #"needs.vol_details", ] if r.method == "profile": # Customise tables used by widgets customise_hrm_human_resource_fields() customise_org_facility_fields() customise_org_needs_fields(profile=True) s3db.org_customise_org_resource_fields("profile") contacts_widget = dict(label = "Contacts", label_create = "Create Contact", type = "datalist", tablename = "hrm_human_resource", context = "organisation", create_controller = "pr", create_function = "person", icon = "icon-contact", show_on_map = False, # Since they will show within Offices list_layout = render_contacts, ) map_widget = dict(label = "Map", type = "map", context = "organisation", icon = "icon-map", height = 383, width = 568, ) needs_widget = dict(label = "Needs", label_create = "Add New Need", type = "datalist", tablename = "req_organisation_needs", multiple = False, context = "organisation", icon = "icon-hand-up", show_on_map = False, list_layout = render_org_needs, ) reqs_widget = dict(label = "Requests", label_create = "Add New Request", type = "datalist", tablename = "req_req", context = "organisation", filter = FS("req_status").belongs([0, 1]), icon = "icon-flag", layer = "Requests", # provided by Catalogue Layer #marker = "request", list_layout = s3db.req_req_list_layout, ) #resources_widget = dict(label = "Resources", # label_create = "Create Resource", # type = "datalist", # tablename = "org_resource", # context = "organisation", # #filter = FS("req_status").belongs([0, 1]), # icon = "icon-wrench", # layer = "Resources", # # provided by Catalogue Layer # #marker = "resource", # list_layout = s3db.org_resource_list_layout, # ) commits_widget = dict(label = "Donations", #label_create = "Add New Donation", type = "datalist", tablename = "req_commit", context = "organisation", filter = FS("cancel") == False, icon = "icon-truck", show_on_map = False, #layer = "Donations", # provided by Catalogue Layer #marker = "donation", list_layout = s3db.req_commit_list_layout, ) sites_widget = dict(label = "Sites", label_create = "Add New Site", type = "datalist", tablename = "org_facility", context = "organisation", filter = FS("obsolete") == False, icon = "icon-home", layer = "Facilities", # provided by Catalogue Layer #marker = "office", list_layout = render_sites, ) record = r.record record_id = record.id if current.auth.s3_has_permission("update", table, record_id=record_id): edit_btn = A(I(_class = "icon icon-edit"), _href=URL(c="org", f="organisation", args=[record_id, "update.popup"], vars={"refresh": "datalist"}), _class="s3_modal", _title=s3.crud_strings["org_organisation"].title_update, ) else: edit_btn = "" s3db.configure("org_organisation", profile_title = "%s : %s" % (s3.crud_strings["org_organisation"].title_list, record.name), profile_header = DIV(edit_btn, IMG(_class="media-object", _src=URL(c="default", f="download", args=[record.logo]), ), H2(record.name), _class="profile-header", ), profile_widgets = [reqs_widget, map_widget, # @ToDo: Move to profile_header #needs_widget, #resources_widget, commits_widget, needs_widget, contacts_widget, sites_widget, ] ) elif r.method == "datalist": # Stakeholder selection page # 2-column datalist, 6 rows per page s3.dl_pagelength = 12 s3.dl_rowsize = 2 from s3.s3filter import S3TextFilter, S3OptionsFilter filter_widgets = [ # no other filter widgets here yet? ] # Needs page # Truncate details field(s) from s3.s3utils import s3_trunk8 s3_trunk8(lines=2) get_vars = current.request.get_vars money = get_vars.get("needs.money", None) #vol = get_vars.get("needs.vol", None) if money: needs_fields = ["needs.money_details"] s3.crud_strings["org_organisation"].title_list = T("Organizations soliciting Money") #elif vol: # needs_fields = ["needs.vol_details"] # s3.crud_strings["org_organisation"].title_list = T("Organizations with remote Volunteer opportunities") else: yesno = {True: T("Yes"), False: T("No")} needs_fields = ["needs.money_details", "needs.vol_details"] filter_widgets.insert(0, S3OptionsFilter("needs.money", options = yesno, multiple = False, cols = 2, hidden = True, )) #filter_widgets.insert(1, S3OptionsFilter("needs.vol", # options = yesno, # multiple = False, # cols = 2, # hidden = True, # )) filter_widgets.insert(0, S3TextFilter(["name", "acronym", "website", "comments", ] + needs_fields, label = T("Search"))) ntable = s3db.req_organisation_needs s3db.configure("org_organisation", filter_widgets = filter_widgets ) # Represent used in rendering current.auth.settings.table_user.organisation_id.represent = s3db.org_organisation_represent # Hide fields field = s3db.org_organisation_organisation_type.organisation_type_id field.readable = field.writable = False table.region_id.readable = table.region_id.writable = False table.country.readable = table.country.writable = False table.year.readable = table.year.writable = False # Return to List view after create/update/delete (unless done via Modal) url_next = URL(c="org", f="organisation", args="datalist") s3db.configure("org_organisation", create_next = url_next, delete_next = url_next, update_next = url_next, # We want the Create form to be in a modal, not inline, for consistency listadd = False, list_fields = list_fields, list_layout = render_organisations, ) return True s3.prep = custom_prep # Custom postp standard_postp = s3.postp def custom_postp(r, output): if r.interactive and \ isinstance(output, dict) and \ current.auth.s3_has_permission("create", r.table): # Insert a Button to Create New in Modal output["showadd_btn"] = A(I(_class="icon icon-plus-sign big-add"), _href=URL(c="org", f="organisation", args=["create.popup"], vars={"refresh": "datalist"}), _class="btn btn-primary s3_modal", _role="button", _title=T("Create Organization"), ) # Call standard postp if callable(standard_postp): output = standard_postp(r, output) return output s3.postp = custom_postp return attr settings.customise_org_organisation_controller = customise_org_organisation_controller # ----------------------------------------------------------------------------- def customise_site_needs_fields(profile=False): s3db = current.s3db table = s3db.req_site_needs table.modified_by.represent = s3_auth_user_represent_name table.modified_on.represent = datetime_represent list_fields = ["id", "organisation_id$id", # @ToDo: Are these better displayed elsewhere in Profile view? "organisation_id$name", "organisation_id$logo", "organisation_id$website", "location_id$L1", "location_id$L2", "location_id$L3", "location_id$L4", "location_id$addr_street", "phone1", #"goods", #"goods_details", #"vol", #"vol_details", "modified_on", "modified_by", ] if not profile: list_fields += ["site_id$name"] s3db.configure("req_site_needs", list_fields=list_fields, ) return s3.customise_site_needs_fields = customise_site_needs_fields # ----------------------------------------------------------------------------- def customise_pr_person_controller(**attr): s3db = current.s3db request = current.request s3 = current.response.s3 tablename = "pr_person" table = s3db.pr_person # Custom PreP standard_prep = s3.prep def custom_prep(r): # Call standard prep if callable(standard_prep): result = standard_prep(r) if not result: return False if r.method == "validate": # Can't validate image without the file image_field = s3db.pr_image.image image_field.requires = None if r.interactive or r.representation == "aadata": if request.controller != "default": # CRUD Strings ADD_CONTACT = T("Create Contact") s3.crud_strings[tablename] = Storage( label_create = T("Create Contact"), title_display = T("Contact Details"), title_list = T("Contact Directory"), title_update = T("Edit Contact Details"), label_list_button = T("List Contacts"), label_delete_button = T("Delete Contact"), msg_record_created = T("Contact added"), msg_record_modified = T("Contact details updated"), msg_record_deleted = T("Contact deleted"), msg_list_empty = T("No Contacts currently registered")) MOBILE = settings.get_ui_label_mobile_phone() EMAIL = T("Email") htable = s3db.hrm_human_resource htable.organisation_id.widget = None site_field = htable.site_id represent = S3Represent(lookup="org_site") site_field.represent = represent site_field.requires = IS_ONE_OF(current.db, "org_site.site_id", represent, orderby = "org_site.name") from s3layouts import S3AddResourceLink site_field.comment = S3AddResourceLink(c="org", f="facility", vars={"child": "site_id"}, label=T("Add New Site"), title=T("Site"), tooltip=T("If you don't see the Site in the list, you can add a new one by clicking link 'Add New Site'.")) # ImageCrop widget doesn't currently work within an Inline Form s3db.pr_image.image.widget = None hr_fields = ["organisation_id", "job_title_id", "site_id", "site_contact", ] if r.method in ("create", "update"): # Context from a Profile page?" organisation_id = request.get_vars.get("(organisation)", None) if organisation_id: field = s3db.hrm_human_resource.organisation_id field.default = organisation_id field.readable = field.writable = False hr_fields.remove("organisation_id") s3_sql_custom_fields = [ "first_name", #"middle_name", "last_name", S3SQLInlineComponent( "human_resource", name = "human_resource", label = "", multiple = False, fields = hr_fields, ), S3SQLInlineComponent( "image", name = "image", label = T("Photo"), multiple = False, fields = [("", "image")], filterby = dict(field = "profile", options = [True] ) ), ] list_fields = [(current.messages.ORGANISATION, "human_resource.organisation_id"), "first_name", #"middle_name", "last_name", (T("Job Title"), "human_resource.job_title_id"), (T("Site"), "human_resource.site_id"), (T("Site Contact"), "human_resource.site_contact"), ] # Don't include Email/Phone for unauthenticated users if current.auth.is_logged_in(): list_fields += [(MOBILE, "phone.value"), (EMAIL, "email.value"), ] s3_sql_custom_fields.insert(3, S3SQLInlineComponent( "contact", name = "phone", label = MOBILE, multiple = False, fields = [("", "value")], filterby = dict(field = "contact_method", options = "SMS")), ) s3_sql_custom_fields.insert(3, S3SQLInlineComponent( "contact", name = "email", label = EMAIL, multiple = False, fields = [("", "value")], filterby = dict(field = "contact_method", options = "EMAIL")), ) crud_form = S3SQLCustomForm(*s3_sql_custom_fields) if r.id and request.controller == "default": url_next = URL(c="default", f="person", args=[r.id, "read"]) else: # Return to List view after create/update/delete (unless done via Modal) url_next = URL(c="pr", f="person") s3db.configure(tablename, create_next = url_next, crud_form = crud_form, delete_next = url_next, list_fields = list_fields, # Don't include a Create form in 'More' popups listadd = False if r.method=="datalist" else True, list_layout = render_contacts, update_next = url_next, ) # Move fields to their desired Locations # Disabled as breaks submission of inline_component #i18n = [] #iappend = i18n.append #iappend('''i18n.office="%s"''' % T("Office")) #iappend('''i18n.organisation="%s"''' % T("Organization")) #iappend('''i18n.job_title="%s"''' % T("Job Title")) #i18n = '''\n'''.join(i18n) #s3.js_global.append(i18n) #s3.scripts.append('/%s/static/themes/DRMP/js/contacts.js' % request.application) return True s3.prep = custom_prep # Custom postp standard_postp = s3.postp def custom_postp(r, output): # Call standard postp if callable(standard_postp): output = standard_postp(r, output) if r.interactive and isinstance(output, dict): output["rheader"] = "" actions = [dict(label=str(T("Open")), _class="action-btn", url=URL(c="pr", f="person", args=["[id]", "read"])) ] # All users just get "Open" #db = current.db #auth = current.auth #has_permission = auth.s3_has_permission #ownership_required = auth.permission.ownership_required #s3_accessible_query = auth.s3_accessible_query #if has_permission("update", table): # action = dict(label=str(T("Edit")), # _class="action-btn", # url=URL(c="pr", f="person", # args=["[id]", "update"]), # ) # if ownership_required("update", table): # # Check which records can be updated # query = s3_accessible_query("update", table) # rows = db(query).select(table._id) # restrict = [] # rappend = restrict.append # for row in rows: # row_id = row.get("id", None) # if row_id: # rappend(str(row_id)) # action["restrict"] = restrict # actions.append(action) #if has_permission("delete", table): # action = dict(label=str(T("Delete")), # _class="action-btn", # url=URL(c="pr", f="person", # args=["[id]", "delete"]), # ) # if ownership_required("delete", table): # # Check which records can be deleted # query = s3_accessible_query("delete", table) # rows = db(query).select(table._id) # restrict = [] # rappend = restrict.append # for row in rows: # row_id = row.get("id", None) # if row_id: # rappend(str(row_id)) # action["restrict"] = restrict # actions.append(action) s3.actions = actions if "form" in output: output["form"].add_class("pr_person") elif "item" in output and hasattr(output["item"], "add_class"): output["item"].add_class("pr_person") return output s3.postp = custom_postp return attr settings.customise_pr_person_controller = customise_pr_person_controller # ----------------------------------------------------------------------------- def customise_doc_document_controller(**attr): s3 = current.response.s3 s3db = current.s3db tablename = "doc_document" table = s3db.doc_document # Custom PreP standard_prep = s3.prep def custom_prep(r): # Call standard prep if callable(standard_prep): result = standard_prep(r) # Filter Out Docs from Newsfeed current.response.s3.filter = (table.name != None) if r.interactive: s3.crud_strings[tablename] = Storage( label_create = T("Add Document"), title_display = T("Document"), title_list = T("Documents"), title_update = T("Edit Document"), label_list_button = T("List New Documents"), label_delete_button = T("Remove Documents"), msg_record_created = T("Documents added"), msg_record_modified = T("Documents updated"), msg_record_deleted = T("Documents removed"), msg_list_empty = T("No Documents currently recorded")) # Force added docs to have a name table.name.requires = IS_NOT_EMPTY() list_fields = ["name", "file", "url", "organisation_id", "comments", ] crud_form = S3SQLCustomForm(*list_fields) s3db.configure(tablename, list_fields = list_fields, crud_form = crud_form, ) return True s3.prep = custom_prep return attr settings.customise_doc_document_controller = customise_doc_document_controller # ----------------------------------------------------------------------------- settings.req.req_type = ["Other"] settings.req.requester_label = "Contact" # Uncomment if the User Account logging the Request is NOT normally the Requester settings.req.requester_is_author = False # Uncomment to have Donations include a 'Value' field settings.req.commit_value = True # Uncomment if the User Account logging the Commitment is NOT normally the Committer #settings.req.comittter_is_author = False # Uncomment to allow Donations to be made without a matching Request #settings.req.commit_without_request = True # Set the Requester as being an HR for the Site if no HR record yet & as Site contact if none yet exists settings.req.requester_to_site = True def customise_req_req_controller(**attr): s3 = current.response.s3 # Custom PreP #standard_prep = s3.prep def custom_prep(r): # Call standard prep #if callable(standard_prep): # result = standard_prep(r) s3db = current.s3db if r.component_name == "commit": s3db.req_customise_commit_fields() else: s3db.req_customise_req_fields() if r.method in ("datalist", "datalist.dl"): s3.filter = (r.table.req_status.belongs([0, 1])) elif r.method == "profile": # Customise tables used by widgets s3db.req_customise_commit_fields() customise_org_facility_fields() record = r.record record_id = record.id commits_widget = dict(label = "Donations", label_create = "Add New Donation", type = "datalist", tablename = "req_commit", context = "request", default = "req_id=%s" % record_id, filter = FS("cancel") == False, icon = "icon-truck", show_on_map = False, #layer = "Donations", # provided by Catalogue Layer #marker = "donation", list_layout = s3db.req_commit_list_layout, ) filter = (FS("obsolete") == False) sites_widget = dict(label = "Sites", #label_create = "Add New Site", type = "datalist", tablename = "org_facility", multiple = False, context = "request", filter = filter, icon = "icon-home", layer = "Facilities", # provided by Catalogue Layer #marker = "office", list_layout = render_sites, ) if current.auth.s3_has_permission("update", r.table, record_id=record_id): edit_btn = A(I(_class = "icon icon-edit"), _href=URL(c="req", f="req", args=[record_id, "update.popup"], vars={"refresh": "datalist"}), _class="s3_modal", _title=s3.crud_strings["req_req"].title_update, ) else: edit_btn = "" db = current.db stable = db.org_site query = (stable.site_id == record.site_id) site = db(query).select(stable.name, stable.location_id, stable.organisation_id, limitby=(0, 1) ).first() location = s3db.gis_LocationRepresent(sep=" | ")(site.location_id) otable = db.org_organisation org = db(otable.id == site.organisation_id).select(otable.name, otable.logo, limitby=(0, 1) ).first() if org and org.logo: logo = URL(c="default", f="download", args=[org.logo]) else: # @ToDo: Placeholder logo = "#" s3db.configure("req_req", profile_title = s3.crud_strings["req_req"].title_list, profile_header = DIV(edit_btn, A(IMG(_class="media-object", _src=logo, ), _class="pull-left", #_href=org_url, ), H2(site.name), P(I(_class="icon-sitemap"), " ", SPAN(org and org.name or current.messages.NONE), " ", _class="card_1_line", ), P(I(_class="icon-globe"), " ", SPAN(location), " ", _class="card_1_line", ), P(record.purpose, _class="s3-truncate"), _class="profile-header", ), profile_widgets = [commits_widget, sites_widget, ], ) return True s3.prep = custom_prep # Disable postp s3.postp = None return attr settings.customise_req_req_controller = customise_req_req_controller # ----------------------------------------------------------------------------- def customise_req_commit_controller(**attr): s3 = current.response.s3 # Custom PreP #standard_prep = s3.prep def custom_prep(r): # Call standard prep #if callable(standard_prep): # result = standard_prep(r) current.s3db.req_customise_commit_fields() if r.method in ("datalist", "datalist.dl"): s3.filter = (r.table.cancel != True) return True s3.prep = custom_prep # Disable postp s3.postp = None return attr settings.customise_req_commit_controller = customise_req_commit_controller # ============================================================================= # Modules # Comment/uncomment modules here to disable/enable them settings.modules = OrderedDict([ # Core modules which shouldn't be disabled ("default", Storage( name_nice = "Home", restricted = False, # Use ACLs to control access to this module access = None, # All Users (inc Anonymous) can see this module in the default menu & access the controller module_type = None # This item is not shown in the menu )), ("admin", Storage( name_nice = "Administration", #description = "Site Administration", restricted = True, access = "|1|", # Only Administrators can see this module in the default menu & access the controller module_type = None # This item is handled separately for the menu )), ("appadmin", Storage( name_nice = "Administration", #description = "Site Administration", restricted = True, module_type = None # No Menu )), ("errors", Storage( name_nice = "Ticket Viewer", #description = "Needed for Breadcrumbs", restricted = False, module_type = None # No Menu )), ("sync", Storage( name_nice = "Synchronization", #description = "Synchronization", restricted = True, access = "|1|", # Only Administrators can see this module in the default menu & access the controller module_type = None # This item is handled separately for the menu )), ("translate", Storage( name_nice = "Translation Functionality", #description = "Selective translation of strings based on module.", module_type = None, )), ("gis", Storage( name_nice = "Map", #description = "Situation Awareness & Geospatial Analysis", restricted = True, module_type = 1, # 1st item in the menu )), ("pr", Storage( name_nice = "Persons", #description = "Central point to record details on People", restricted = True, access = "|1|", # Only Administrators can see this module in the default menu (access to controller is possible to all still) module_type = None )), ("org", Storage( name_nice = "Organizations", #description = 'Lists "who is doing what & where". Allows relief agencies to coordinate their activities', restricted = True, module_type = None )), # All modules below here should be possible to disable safely ("hrm", Storage( name_nice = "Contacts", #description = "Human Resources Management", restricted = True, module_type = None, )), ("cms", Storage( name_nice = "Content Management", restricted = True, module_type = None, )), ("doc", Storage( name_nice = "Documents", #description = "A library of digital resources, such as photos, documents and reports", restricted = True, module_type = None, )), ("msg", Storage( name_nice = "Messaging", #description = "Sends & Receives Alerts via Email & SMS", restricted = True, # The user-visible functionality of this module isn't normally required. Rather it's main purpose is to be accessed from other modules. module_type = None, )), #("event", Storage( # name_nice = "Disasters", # #description = "Events", # restricted = True, # module_type = None #)), ("req", Storage( name_nice = "Requests", #description = "Manage requests for supplies, assets, staff or other resources. Matches against Inventories where supplies are requested.", restricted = True, module_type = None, )), #("project", Storage( # name_nice = "Projects", # restricted = True, # module_type = None #)), ("stats", Storage( name_nice = "Statistics", restricted = True, module_type = None )), #("vulnerability", Storage( # name_nice = "Vulnerability", # restricted = True, # module_type = None #)), #("transport", Storage( # name_nice = "Transport", # restricted = True, # module_type = None #)), #("hms", Storage( # name_nice = "Hospitals", # restricted = True, # module_type = None #)), #("cr", Storage( # name_nice = "Shelters", # restricted = True, # module_type = None #)), ("supply", Storage( name_nice = "Supply Chain Management", restricted = True, module_type = None )), ])
devinbalkind/eden
private/templates/Philippines/config.py
Python
mit
128,192
[ "Amber" ]
b00c588d303175fa529f95d9d3a0edc02364f623aa1950b2976a900d74e0c062
""" Integration with native distribution package managers. @since: 0.28 """ # Copyright (C) 2009, Thomas Leonard # See the README file for details, or visit http://0install.net. from zeroinstall import _, logger import os, platform, re, subprocess, sys from zeroinstall.injector import namespaces, model from zeroinstall.support import basedir, portable_rename, intern from zeroinstall.support.tasks import get_loop _dotted_ints = '[0-9]+(?:\.[0-9]+)*' # This matches a version number that would be a valid Zero Install version without modification _zeroinstall_regexp = '(?:%s)(?:-(?:pre|rc|post|)(?:%s))*' % (_dotted_ints, _dotted_ints) # This matches the interesting bits of distribution version numbers # (first matching group is for Java-style 6b17 or 7u9 syntax, or "major") _version_regexp = '(?:[a-z])?({ints}\.?[bu])?({zero})(-r{ints})?'.format(zero = _zeroinstall_regexp, ints = _dotted_ints) _PYTHON_URI = 'http://repo.roscidus.com/python/python' def _set_quick_test(impl, path): """Set impl.quick_test_file and impl.quick_test_mtime from path.""" impl.quick_test_file = path impl.quick_test_mtime = int(os.stat(path).st_mtime) # We try to do updates atomically without locking, but we don't worry too much about # duplicate entries or being a little out of sync with the on-disk copy. class Cache(object): def __init__(self, cache_leaf, source, format): """Maintain a cache file (e.g. ~/.cache/0install.net/injector/$name). If the size or mtime of $source has changed format version if different, reset the cache first. @type cache_leaf: str @type source: str @type format: int""" self.cache_leaf = cache_leaf self.source = source self.format = format self.cache_dir = basedir.save_cache_path(namespaces.config_site, namespaces.config_prog) self.cached_for = {} # Attributes of source when cache was created try: self._load_cache() except Exception as ex: logger.info(_("Failed to load cache (%s). Flushing..."), ex) self.flush() def flush(self): # Wipe the cache try: info = os.stat(self.source) mtime = int(info.st_mtime) size = info.st_size except Exception as ex: logger.warning("Failed to stat %s: %s", self.source, ex) mtime = size = 0 self.cache = {} import tempfile tmp = tempfile.NamedTemporaryFile(mode = 'wt', dir = self.cache_dir, delete = False) tmp.write("mtime=%d\nsize=%d\nformat=%d\n\n" % (mtime, size, self.format)) tmp.close() portable_rename(tmp.name, os.path.join(self.cache_dir, self.cache_leaf)) self._load_cache() # Populate self.cache from our saved cache file. # Throws an exception if the cache doesn't exist or has the wrong format. def _load_cache(self): self.cache = cache = {} with open(os.path.join(self.cache_dir, self.cache_leaf)) as stream: for line in stream: line = line.strip() if not line: break key, value = line.split('=', 1) if key in ('mtime', 'size', 'format'): self.cached_for[key] = int(value) self._check_valid() for line in stream: key, value = line.split('=', 1) cache[key] = value[:-1] # Check the source file hasn't changed since we created the cache def _check_valid(self): info = os.stat(self.source) if self.cached_for['mtime'] != int(info.st_mtime): raise Exception("Modification time of %s has changed" % self.source) if self.cached_for['size'] != info.st_size: raise Exception("Size of %s has changed" % self.source) if self.cached_for.get('format', None) != self.format: raise Exception("Format of cache has changed") def get(self, key): """@type key: str @rtype: str""" try: self._check_valid() except Exception as ex: logger.info(_("Cache needs to be refreshed: %s"), ex) self.flush() return None else: return self.cache.get(key, None) def put(self, key, value): """@type key: str @type value: str""" cache_path = os.path.join(self.cache_dir, self.cache_leaf) self.cache[key] = value try: with open(cache_path, 'a') as stream: stream.write('%s=%s\n' % (key, value)) except Exception as ex: logger.warning("Failed to write to cache %s: %s=%s: %s", cache_path, key, value, ex) def try_cleanup_distro_version(version): """Try to turn a distribution version string into one readable by Zero Install. We do this by stripping off anything we can't parse. @type version: str @return: the part we understood, or None if we couldn't parse anything @rtype: str""" if ':' in version: version = version.split(':')[1] # Skip 'epoch' version = version.replace('_', '-') if '~' in version: version, suffix = version.split('~', 1) if suffix.startswith('pre'): suffix = suffix[3:] suffix = '-pre' + (try_cleanup_distro_version(suffix) or '') else: suffix = '' match = re.match(_version_regexp, version) if match: major, version, revision = match.groups() if major is not None: version = major[:-1].rstrip('.') + '.' + version if revision is not None: version = '%s-%s' % (version, revision[2:]) return version + suffix return None class Distribution(object): """Represents a distribution with which we can integrate. Sub-classes should specialise this to integrate with the package managers of particular distributions. This base class ignores the native package manager. @since: 0.28 @ivar name: the default value for Implementation.distro_name for our implementations @type name: str @ivar system_paths: list of paths to search for binaries (we MUST NOT find 0install launchers, so only include directories where system packages install binaries - e.g. /usr/bin but not /usr/local/bin) @type system_paths: [str] """ name = "fallback" _packagekit = None system_paths = ['/usr/bin', '/bin', '/usr/sbin', '/sbin'] def get_package_info(self, package, factory): """Get information about the given package. Add zero or more implementations using the factory (typically at most two will be added; the currently installed version and the latest available). @param package: package name (e.g. "gimp") @type package: str @param factory: function for creating new DistributionImplementation objects from IDs @type factory: str -> L{model.DistributionImplementation}""" return def get_score(self, distribution): """Indicate how closely the host distribution matches this one. The <package-implementation> with the highest score is passed to L{Distribution.get_package_info}. If several elements get the same score, get_package_info is called for all of them. @param distribution: a distribution name @type distribution: str @return: an integer, or -1 if there is no match at all @rtype: int""" return 0 def get_feed(self, master_feed_url, package_impls): """Generate a feed containing information about distribution packages. This should immediately return a feed containing an implementation for the package if it's already installed. Information about versions that could be installed using the distribution's package manager can be added asynchronously later (see L{fetch_candidates}). @rtype: L{model.ZeroInstallFeed}""" feed = model.ZeroInstallFeed(None) feed.url = 'distribution:' + master_feed_url for item, item_attrs, _depends in package_impls: package = item_attrs.get('package', None) if package is None: raise model.InvalidInterface(_("Missing 'package' attribute on %s") % item) new_impls = [] def factory(id, only_if_missing = False, installed = True): assert id.startswith('package:') if id in feed.implementations: if only_if_missing: return None logger.warning(_("Duplicate ID '%s' for DistributionImplementation"), id) impl = model.DistributionImplementation(feed, id, self, item) feed.implementations[id] = impl new_impls.append(impl) impl.installed = installed impl.metadata = item_attrs if impl.main is None: item_main = item_attrs.get('main', None) if item_main: impl.main = item_main impl.upstream_stability = model.packaged return impl self.get_package_info(package, factory) for impl in new_impls: self.fixup(package, impl) if impl.installed: self.installed_fixup(impl) if master_feed_url == _PYTHON_URI and os.name != "nt": # Hack: we can support Python on platforms with unsupported package managers # by adding the implementation of Python running us now to the list. python_version = '.'.join([str(v) for v in sys.version_info if isinstance(v, int)]) impl_id = 'package:host:python:' + python_version assert impl_id not in feed.implementations impl = model.DistributionImplementation(feed, impl_id, self, distro_name = 'host') impl.installed = True impl.version = model.parse_version(python_version) impl.main = sys.executable or '/usr/bin/python' impl.upstream_stability = model.packaged impl.machine = host_machine # (hopefully) _set_quick_test(impl, sys.executable) feed.implementations[impl_id] = impl elif master_feed_url == 'http://repo.roscidus.com/python/python-gobject' and os.name != "nt": gobject = get_loop().gobject if gobject: # Likewise, we know that there is a native python-gobject available for our Python impl_id = 'package:host:python-gobject:' + '.'.join(str(x) for x in gobject.pygobject_version) assert impl_id not in feed.implementations impl = model.DistributionImplementation(feed, impl_id, self, distro_name = 'host') impl.installed = True impl.version = [list(gobject.pygobject_version)] impl.upstream_stability = model.packaged impl.machine = host_machine # (hopefully) if gobject.__file__.startswith('<'): _set_quick_test(impl, gobject.__path__) # Python 3 else: _set_quick_test(impl, gobject.__file__) # Python 2 feed.implementations[impl_id] = impl return feed def fetch_candidates(self, package_impls): """Collect information about versions we could install using the distribution's package manager. On success, the distribution feed in iface_cache is updated. @return: a L{tasks.Blocker} if the task is in progress, or None if not""" if self.packagekit.available: package_names = [item.getAttribute("package") for item, item_attrs, depends in package_impls] return self.packagekit.fetch_candidates(package_names) @property def packagekit(self): """For use by subclasses. @rtype: L{packagekit.PackageKit}""" if not self._packagekit: from zeroinstall.injector import packagekit self._packagekit = packagekit.PackageKit() return self._packagekit def fixup(self, package, impl): """Some packages require special handling (e.g. Java). This is called for each package that was added by L{get_package_info} after it returns. The default method does nothing. @param package: the name of the package @param impl: the constructed implementation""" pass def installed_fixup(self, impl): """Called when an installed package is added (after L{fixup}), or when installation completes. This is useful to fix up the main value. The default implementation checks that main exists, and searches L{Distribution.system_paths} for it if not. @type impl: L{DistributionImplementation} @since: 1.11""" path = impl.main if not path: return if os.path.isabs(path) and os.path.exists(path): return basename = os.path.basename(path) if os.name == "nt" and not basename.endswith('.exe'): basename += '.exe' for d in self.system_paths: path = os.path.join(d, basename) if os.path.isfile(path): logger.info("Found %s by searching system paths", path) impl.main = path return else: logger.info("Binary '%s' not found in any system path (checked %s)", basename, self.system_paths) def get_score(self, distro_name): """@type distro_name: str @rtype: int""" return int(distro_name == self.name) class WindowsDistribution(Distribution): name = 'Windows' system_paths = [] def get_package_info(self, package, factory): def _is_64bit_windows(): p = sys.platform from win32process import IsWow64Process if p == 'win64' or (p == 'win32' and IsWow64Process()): return True elif p == 'win32': return False else: raise Exception(_("WindowsDistribution may only be used on the Windows platform")) def _read_hklm_reg(key_name, value_name): from win32api import RegOpenKeyEx, RegQueryValueEx, RegCloseKey from win32con import HKEY_LOCAL_MACHINE, KEY_READ KEY_WOW64_64KEY = 0x0100 KEY_WOW64_32KEY = 0x0200 if _is_64bit_windows(): try: key32 = RegOpenKeyEx(HKEY_LOCAL_MACHINE, key_name, 0, KEY_READ | KEY_WOW64_32KEY) (value32, _) = RegQueryValueEx(key32, value_name) RegCloseKey(key32) except: value32 = '' try: key64 = RegOpenKeyEx(HKEY_LOCAL_MACHINE, key_name, 0, KEY_READ | KEY_WOW64_64KEY) (value64, _) = RegQueryValueEx(key64, value_name) RegCloseKey(key64) except: value64 = '' else: try: key32 = RegOpenKeyEx(HKEY_LOCAL_MACHINE, key_name, 0, KEY_READ) (value32, _) = RegQueryValueEx(key32, value_name) RegCloseKey(key32) except: value32 = '' value64 = '' return (value32, value64) def find_java(part, win_version, zero_version): reg_path = r"SOFTWARE\JavaSoft\{part}\{win_version}".format(part = part, win_version = win_version) (java32_home, java64_home) = _read_hklm_reg(reg_path, "JavaHome") for (home, arch) in [(java32_home, 'i486'), (java64_home, 'x86_64')]: if os.path.isfile(home + r"\bin\java.exe"): impl = factory('package:windows:%s:%s:%s' % (package, zero_version, arch)) impl.machine = arch impl.version = model.parse_version(zero_version) impl.upstream_stability = model.packaged impl.main = home + r"\bin\java.exe" _set_quick_test(impl, impl.main) def find_netfx(win_version, zero_version): reg_path = r"SOFTWARE\Microsoft\NET Framework Setup\NDP\{win_version}".format(win_version = win_version) (netfx32_install, netfx64_install) = _read_hklm_reg(reg_path, "Install") for (install, arch) in [(netfx32_install, 'i486'), (netfx64_install, 'x86_64')]: impl = factory('package:windows:%s:%s:%s' % (package, zero_version, arch)) impl.installed = (install == 1) impl.machine = arch impl.version = model.parse_version(zero_version) impl.upstream_stability = model.packaged impl.main = "" # .NET executables do not need a runner on Windows but they need one elsewhere def find_netfx_release(win_version, release_version, zero_version): reg_path = r"SOFTWARE\Microsoft\NET Framework Setup\NDP\{win_version}".format(win_version = win_version) (netfx32_install, netfx64_install) = _read_hklm_reg(reg_path, "Install") (netfx32_release, netfx64_release) = _read_hklm_reg(reg_path, "Release") for (install, release, arch) in [(netfx32_install, netfx32_release, 'i486'), (netfx64_install, netfx64_release, 'x86_64')]: impl = factory('package:windows:%s:%s:%s' % (package, zero_version, arch)) impl.installed = (install == 1 and release != '' and release >= release_version) impl.machine = arch impl.version = model.parse_version(zero_version) impl.upstream_stability = model.packaged impl.main = "" # .NET executables do not need a runner on Windows but they need one elsewhere if package == 'openjdk-6-jre': find_java("Java Runtime Environment", "1.6", '6') elif package == 'openjdk-6-jdk': find_java("Java Development Kit", "1.6", '6') elif package == 'openjdk-7-jre': find_java("Java Runtime Environment", "1.7", '7') elif package == 'openjdk-7-jdk': find_java("Java Development Kit", "1.7", '7') elif package == 'netfx': find_netfx("v2.0.50727", '2.0') find_netfx("v3.0", '3.0') find_netfx("v3.5", '3.5') find_netfx("v4\\Full", '4.0') find_netfx_release("v4\\Full", 378389, '4.5') find_netfx("v5", '5.0') elif package == 'netfx-client': find_netfx("v4\\Client", '4.0') find_netfx_release("v4\\Client", 378389, '4.5') class DarwinDistribution(Distribution): """@since: 1.11""" name = 'Darwin' def get_package_info(self, package, factory): """@type package: str""" def java_home(version, arch): null = os.open(os.devnull, os.O_WRONLY) child = subprocess.Popen(["/usr/libexec/java_home", "--failfast", "--version", version, "--arch", arch], stdout = subprocess.PIPE, stderr = null, universal_newlines = True) home = child.stdout.read().strip() child.stdout.close() child.wait() return home def find_java(part, jvm_version, zero_version): for arch in ['i386', 'x86_64']: home = java_home(jvm_version, arch) if os.path.isfile(home + "/bin/java"): impl = factory('package:darwin:%s:%s:%s' % (package, zero_version, arch)) impl.machine = arch impl.version = model.parse_version(zero_version) impl.upstream_stability = model.packaged impl.main = home + "/bin/java" _set_quick_test(impl, impl.main) if package == 'openjdk-6-jre': find_java("Java Runtime Environment", "1.6", '6') elif package == 'openjdk-6-jdk': find_java("Java Development Kit", "1.6", '6') elif package == 'openjdk-7-jre': find_java("Java Runtime Environment", "1.7", '7') elif package == 'openjdk-7-jdk': find_java("Java Development Kit", "1.7", '7') def get_output(args): child = subprocess.Popen(args, stdout = subprocess.PIPE, universal_newlines = True) return child.communicate()[0] def get_version(program): stdout = get_output([program, "--version"]) return stdout.strip().split('\n')[0].split()[-1] # the last word of the first line def find_program(file): if os.path.isfile(file) and os.access(file, os.X_OK): program_version = try_cleanup_distro_version(get_version(file)) impl = factory('package:darwin:%s:%s' % (package, program_version), True) if impl: impl.installed = True impl.version = model.parse_version(program_version) impl.upstream_stability = model.packaged impl.machine = host_machine # (hopefully) impl.main = file _set_quick_test(impl, impl.main) if package == 'gnupg': find_program("/usr/local/bin/gpg") elif package == 'gnupg2': find_program("/usr/local/bin/gpg2") class CachedDistribution(Distribution): """For distributions where querying the package database is slow (e.g. requires running an external command), we cache the results. @since: 0.39 @deprecated: use Cache instead """ def __init__(self, db_status_file): """@param db_status_file: update the cache when the timestamp of this file changes @type db_status_file: str""" self._status_details = os.stat(db_status_file) self.versions = {} self.cache_dir = basedir.save_cache_path(namespaces.config_site, namespaces.config_prog) try: self._load_cache() except Exception as ex: logger.info(_("Failed to load distribution database cache (%s). Regenerating..."), ex) try: self.generate_cache() self._load_cache() except Exception as ex: logger.warning(_("Failed to regenerate distribution database cache: %s"), ex) def _load_cache(self): """Load {cache_leaf} cache file into self.versions if it is available and up-to-date. Throws an exception if the cache should be (re)created.""" with open(os.path.join(self.cache_dir, self.cache_leaf), 'rt') as stream: cache_version = None for line in stream: if line == '\n': break name, value = line.split(': ') if name == 'mtime' and int(value) != int(self._status_details.st_mtime): raise Exception(_("Modification time of package database file has changed")) if name == 'size' and int(value) != self._status_details.st_size: raise Exception(_("Size of package database file has changed")) if name == 'version': cache_version = int(value) else: raise Exception(_('Invalid cache format (bad header)')) if cache_version is None: raise Exception(_('Old cache format')) versions = self.versions for line in stream: package, version, zi_arch = line[:-1].split('\t') versionarch = (version, intern(zi_arch)) if package not in versions: versions[package] = [versionarch] else: versions[package].append(versionarch) def _write_cache(self, cache): #cache.sort() # Might be useful later; currently we don't care """@type cache: [str]""" import tempfile fd, tmpname = tempfile.mkstemp(prefix = 'zeroinstall-cache-tmp', dir = self.cache_dir) try: stream = os.fdopen(fd, 'wt') stream.write('version: 2\n') stream.write('mtime: %d\n' % int(self._status_details.st_mtime)) stream.write('size: %d\n' % self._status_details.st_size) stream.write('\n') for line in cache: stream.write(line + '\n') stream.close() portable_rename(tmpname, os.path.join(self.cache_dir, self.cache_leaf)) except: os.unlink(tmpname) raise # Maps machine type names used in packages to their Zero Install versions # (updates to this might require changing the reverse Java mapping) _canonical_machine = { 'all' : '*', 'any' : '*', 'noarch' : '*', '(none)' : '*', 'x86_64': 'x86_64', 'amd64': 'x86_64', 'i386': 'i386', 'i486': 'i486', 'i586': 'i586', 'i686': 'i686', 'ppc64': 'ppc64', 'ppc': 'ppc', } def arch_canonicalize_machine(machine_): """@type machine_: str @rtype: str""" machine = machine_.lower() if machine == 'x86': machine = 'i386' elif machine == 'amd64': machine = 'x86_64' elif machine == 'Power Macintosh': machine = 'ppc' elif machine == 'i86pc': machine = 'i686' return machine host_machine = arch_canonicalize_machine(platform.uname()[4]) def canonical_machine(package_machine): """@type package_machine: str @rtype: str""" machine = _canonical_machine.get(package_machine.lower(), None) if machine is None: # Safe default if we can't understand the arch return host_machine.lower() return machine class DebianDistribution(Distribution): """A dpkg-based distribution.""" name = 'Debian' cache_leaf = 'dpkg-status.cache' def __init__(self, dpkg_status): """@type dpkg_status: str""" self.dpkg_cache = Cache('dpkg-status.cache', dpkg_status, 2) self.apt_cache = {} def _query_installed_package(self, package): """@type package: str @rtype: str""" null = os.open(os.devnull, os.O_WRONLY) child = subprocess.Popen(["dpkg-query", "-W", "--showformat=${Version}\t${Architecture}\t${Status}\n", "--", package], stdout = subprocess.PIPE, stderr = null, universal_newlines = True) # Needed for Python 3 os.close(null) stdout, stderr = child.communicate() child.wait() for line in stdout.split('\n'): if not line: continue version, debarch, status = line.split('\t', 2) if not status.endswith(' installed'): continue clean_version = try_cleanup_distro_version(version) if debarch.find("-") != -1: debarch = debarch.split("-")[-1] if clean_version: return '%s\t%s' % (clean_version, canonical_machine(debarch.strip())) else: logger.warning(_("Can't parse distribution version '%(version)s' for package '%(package)s'"), {'version': version, 'package': package}) return '-' def get_package_info(self, package, factory): # Add any already-installed package... """@type package: str""" installed_cached_info = self._get_dpkg_info(package) if installed_cached_info != '-': installed_version, machine = installed_cached_info.split('\t') impl = factory('package:deb:%s:%s:%s' % (package, installed_version, machine)) impl.version = model.parse_version(installed_version) if machine != '*': impl.machine = machine else: installed_version = None # Add any uninstalled candidates (note: only one of these two methods will add anything) # From PackageKit... self.packagekit.get_candidates(package, factory, 'package:deb') # From apt-cache... cached = self.apt_cache.get(package, None) if cached: candidate_version = cached['version'] candidate_arch = cached['arch'] if candidate_version and candidate_version != installed_version: impl = factory('package:deb:%s:%s:%s' % (package, candidate_version, candidate_arch), installed = False) impl.version = model.parse_version(candidate_version) if candidate_arch != '*': impl.machine = candidate_arch impl.download_sources.append(model.DistributionSource(package, cached['size'], needs_confirmation = False)) def fixup(self, package, impl): """@type package: str @type impl: L{zeroinstall.injector.model.DistributionImplementation}""" if impl.id.startswith('package:deb:openjdk-6-jre:') or \ impl.id.startswith('package:deb:openjdk-7-jre:'): # Debian marks all Java versions as pre-releases # See: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=685276 impl.version = model.parse_version(impl.get_version().replace('-pre', '.')) def installed_fixup(self, impl): """@type impl: L{zeroinstall.injector.model.DistributionImplementation}""" # Hack: If we added any Java implementations, find the corresponding JAVA_HOME... if impl.id.startswith('package:deb:openjdk-6-jre:'): java_version = '6-openjdk' elif impl.id.startswith('package:deb:openjdk-7-jre:'): java_version = '7-openjdk' else: return Distribution.installed_fixup(self, impl) # super if impl.machine == 'x86_64': java_arch = 'amd64' else: java_arch = impl.machine java_bin = '/usr/lib/jvm/java-%s-%s/jre/bin/java' % (java_version, java_arch) if not os.path.exists(java_bin): # Try without the arch... java_bin = '/usr/lib/jvm/java-%s/jre/bin/java' % java_version if not os.path.exists(java_bin): logger.info("Java binary not found (%s)", java_bin) if impl.main is None: java_bin = '/usr/bin/java' else: return impl.main = java_bin def _get_dpkg_info(self, package): """@type package: str @rtype: str""" installed_cached_info = self.dpkg_cache.get(package) if installed_cached_info == None: installed_cached_info = self._query_installed_package(package) self.dpkg_cache.put(package, installed_cached_info) return installed_cached_info def fetch_candidates(self, package_impls): """@type master_feed: L{zeroinstall.injector.model.ZeroInstallFeed} @rtype: [L{zeroinstall.support.tasks.Blocker}]""" package_names = [item.getAttribute("package") for item, item_attrs, depends in package_impls] if self.packagekit.available: return self.packagekit.fetch_candidates(package_names) # No PackageKit. Use apt-cache directly. for package in package_names: # Check to see whether we could get a newer version using apt-get try: null = os.open(os.devnull, os.O_WRONLY) child = subprocess.Popen(['apt-cache', 'show', '--no-all-versions', '--', package], stdout = subprocess.PIPE, stderr = null, universal_newlines = True) os.close(null) arch = version = size = None for line in child.stdout: line = line.strip() if line.startswith('Version: '): version = line[9:] version = try_cleanup_distro_version(version) elif line.startswith('Architecture: '): arch = canonical_machine(line[14:].strip()) elif line.startswith('Size: '): size = int(line[6:].strip()) if version and arch: cached = {'version': version, 'arch': arch, 'size': size} else: cached = None child.stdout.close() child.wait() except Exception as ex: logger.warning("'apt-cache show %s' failed: %s", package, ex) cached = None # (multi-arch support? can there be multiple candidates?) self.apt_cache[package] = cached class RPMDistribution(CachedDistribution): """An RPM-based distribution.""" name = 'RPM' cache_leaf = 'rpm-status.cache' def generate_cache(self): cache = [] child = subprocess.Popen(["rpm", "-qa", "--qf=%{NAME}\t%{VERSION}-%{RELEASE}\t%{ARCH}\n"], stdout = subprocess.PIPE, universal_newlines = True) for line in child.stdout: package, version, rpmarch = line.split('\t', 2) if package == 'gpg-pubkey': continue zi_arch = canonical_machine(rpmarch.strip()) clean_version = try_cleanup_distro_version(version) if clean_version: cache.append('%s\t%s\t%s' % (package, clean_version, zi_arch)) else: logger.warning(_("Can't parse distribution version '%(version)s' for package '%(package)s'"), {'version': version, 'package': package}) self._write_cache(cache) child.stdout.close() child.wait() def get_package_info(self, package, factory): # Add installed versions... """@type package: str""" versions = self.versions.get(package, []) for version, machine in versions: impl = factory('package:rpm:%s:%s:%s' % (package, version, machine)) impl.version = model.parse_version(version) if machine != '*': impl.machine = machine # Add any uninstalled candidates found by PackageKit self.packagekit.get_candidates(package, factory, 'package:rpm') def installed_fixup(self, impl): # OpenSUSE uses _, Fedora uses . """@type impl: L{zeroinstall.injector.model.DistributionImplementation}""" impl_id = impl.id.replace('_', '.') # Hack: If we added any Java implementations, find the corresponding JAVA_HOME... if impl_id.startswith('package:rpm:java-1.6.0-openjdk:'): java_version = '1.6.0-openjdk' elif impl_id.startswith('package:rpm:java-1.7.0-openjdk:'): java_version = '1.7.0-openjdk' else: return Distribution.installed_fixup(self, impl) # super # On Fedora, unlike Debian, the arch is x86_64, not amd64 java_bin = '/usr/lib/jvm/jre-%s.%s/bin/java' % (java_version, impl.machine) if not os.path.exists(java_bin): # Try without the arch... java_bin = '/usr/lib/jvm/jre-%s/bin/java' % java_version if not os.path.exists(java_bin): logger.info("Java binary not found (%s)", java_bin) if impl.main is None: java_bin = '/usr/bin/java' else: return impl.main = java_bin def fixup(self, package, impl): # OpenSUSE uses _, Fedora uses . """@type package: str @type impl: L{zeroinstall.injector.model.DistributionImplementation}""" package = package.replace('_', '.') if package in ('java-1.6.0-openjdk', 'java-1.7.0-openjdk', 'java-1.6.0-openjdk-devel', 'java-1.7.0-openjdk-devel'): if impl.version[0][0] == 1: # OpenSUSE uses 1.6 to mean 6 del impl.version[0][0] class SlackDistribution(Distribution): """A Slack-based distribution.""" name = 'Slack' def __init__(self, packages_dir): """@type packages_dir: str""" self._packages_dir = packages_dir def get_package_info(self, package, factory): # Add installed versions... """@type package: str""" for entry in os.listdir(self._packages_dir): name, version, arch, build = entry.rsplit('-', 3) if name == package: zi_arch = canonical_machine(arch) clean_version = try_cleanup_distro_version("%s-%s" % (version, build)) if not clean_version: logger.warning(_("Can't parse distribution version '%(version)s' for package '%(package)s'"), {'version': version, 'package': name}) continue impl = factory('package:slack:%s:%s:%s' % \ (package, clean_version, zi_arch)) impl.version = model.parse_version(clean_version) if zi_arch != '*': impl.machine = zi_arch # Add any uninstalled candidates found by PackageKit self.packagekit.get_candidates(package, factory, 'package:slack') class ArchDistribution(Distribution): """An Arch Linux distribution.""" name = 'Arch' def __init__(self, packages_dir): """@type packages_dir: str""" self._packages_dir = os.path.join(packages_dir, "local") def get_package_info(self, package, factory): # Add installed versions... """@type package: str""" for entry in os.listdir(self._packages_dir): name, version, build = entry.rsplit('-', 2) if name == package: gotarch = False # (read in binary mode to avoid unicode errors in C locale) with open(os.path.join(self._packages_dir, entry, "desc"), 'rb') as stream: for line in stream: if line == b"%ARCH%\n": gotarch = True continue if gotarch: arch = line.strip().decode('utf-8') break zi_arch = canonical_machine(arch) clean_version = try_cleanup_distro_version("%s-%s" % (version, build)) if not clean_version: logger.warning(_("Can't parse distribution version '%(version)s' for package '%(package)s'"), {'version': version, 'package': name}) continue impl = factory('package:arch:%s:%s:%s' % \ (package, clean_version, zi_arch)) impl.version = model.parse_version(clean_version) if zi_arch != '*': impl.machine = zi_arch impl.quick_test_file = os.path.join(self._packages_dir, entry, 'desc') # Add any uninstalled candidates found by PackageKit self.packagekit.get_candidates(package, factory, 'package:arch') class GentooDistribution(Distribution): name = 'Gentoo' def __init__(self, pkgdir): """@type pkgdir: str""" self._pkgdir = pkgdir def get_package_info(self, package, factory): # Add installed versions... """@type package: str""" _version_start_reqexp = '-[0-9]' if package.count('/') != 1: return category, leafname = package.split('/') category_dir = os.path.join(self._pkgdir, category) match_prefix = leafname + '-' if not os.path.isdir(category_dir): return for filename in os.listdir(category_dir): if filename.startswith(match_prefix) and filename[len(match_prefix)].isdigit(): with open(os.path.join(category_dir, filename, 'PF'), 'rt') as stream: name = stream.readline().strip() match = re.search(_version_start_reqexp, name) if match is None: logger.warning(_('Cannot parse version from Gentoo package named "%(name)s"'), {'name': name}) continue else: version = try_cleanup_distro_version(name[match.start() + 1:]) if category == 'app-emulation' and name.startswith('emul-'): __, __, machine, __ = name.split('-', 3) else: with open(os.path.join(category_dir, filename, 'CHOST'), 'rt') as stream: machine, __ = stream.readline().split('-', 1) machine = arch_canonicalize_machine(machine) impl = factory('package:gentoo:%s:%s:%s' % \ (package, version, machine)) impl.version = model.parse_version(version) impl.machine = machine # Add any uninstalled candidates found by PackageKit self.packagekit.get_candidates(package, factory, 'package:gentoo') class PortsDistribution(Distribution): name = 'Ports' system_paths = ['/usr/local/bin'] def __init__(self, pkgdir): """@type pkgdir: str""" self._pkgdir = pkgdir def get_package_info(self, package, factory): """@type package: str""" _name_version_regexp = '^(.+)-([^-]+)$' nameversion = re.compile(_name_version_regexp) for pkgname in os.listdir(self._pkgdir): pkgdir = os.path.join(self._pkgdir, pkgname) if not os.path.isdir(pkgdir): continue #contents = open(os.path.join(pkgdir, '+CONTENTS')).readline().strip() match = nameversion.search(pkgname) if match is None: logger.warning(_('Cannot parse version from Ports package named "%(pkgname)s"'), {'pkgname': pkgname}) continue else: name = match.group(1) if name != package: continue version = try_cleanup_distro_version(match.group(2)) machine = host_machine impl = factory('package:ports:%s:%s:%s' % \ (package, version, machine)) impl.version = model.parse_version(version) impl.machine = machine class MacPortsDistribution(CachedDistribution): system_paths = ['/opt/local/bin'] name = 'MacPorts' def __init__(self, db_status_file): """@type db_status_file: str""" super(MacPortsDistribution, self).__init__(db_status_file) self.darwin = DarwinDistribution() cache_leaf = 'macports-status.cache' def generate_cache(self): cache = [] child = subprocess.Popen(["port", "-v", "installed"], stdout = subprocess.PIPE, universal_newlines = True) for line in child.stdout: if not line.startswith(" "): continue if line.strip().count(" ") > 1: package, version, extra = line.split(None, 2) else: package, version = line.split() extra = "" if not extra.startswith("(active)"): continue version = version.lstrip('@') version = re.sub(r"\+.*", "", version) # strip variants zi_arch = '*' clean_version = try_cleanup_distro_version(version) if clean_version: match = re.match(r" platform='([^' ]*)( \d+)?' archs='([^']*)'", extra) if match: platform, major, archs = match.groups() for arch in archs.split(): zi_arch = canonical_machine(arch) cache.append('%s\t%s\t%s' % (package, clean_version, zi_arch)) else: cache.append('%s\t%s\t%s' % (package, clean_version, zi_arch)) else: logger.warning(_("Can't parse distribution version '%(version)s' for package '%(package)s'"), {'version': version, 'package': package}) self._write_cache(cache) child.stdout.close() child.wait() def get_package_info(self, package, factory): """@type package: str""" self.darwin.get_package_info(package, factory) # Add installed versions... versions = self.versions.get(package, []) for version, machine in versions: impl = factory('package:macports:%s:%s:%s' % (package, version, machine)) impl.version = model.parse_version(version) if machine != '*': impl.machine = machine def get_score(self, distro_name): # We support both sources of packages. # In theory, we should route 'Darwin' package names to DarwinDistribution, and # Mac Ports names to MacPortsDistribution. But since we only use Darwin for Java, # having one object handle both is OK. return int(distro_name in ('Darwin', 'MacPorts')) class CygwinDistribution(CachedDistribution): """A Cygwin-based distribution.""" name = 'Cygwin' cache_leaf = 'cygcheck-status.cache' def generate_cache(self): cache = [] zi_arch = '*' for line in os.popen("cygcheck -c -d"): if line == "Cygwin Package Information\r\n": continue if line == "\n": continue package, version = line.split() if package == "Package" and version == "Version": continue clean_version = try_cleanup_distro_version(version) if clean_version: cache.append('%s\t%s\t%s' % (package, clean_version, zi_arch)) else: logger.warning(_("Can't parse distribution version '%(version)s' for package '%(package)s'"), {'version': version, 'package': package}) self._write_cache(cache) def get_package_info(self, package, factory): # Add installed versions... versions = self.versions.get(package, []) for version, machine in versions: impl = factory('package:cygwin:%s:%s:%s' % (package, version, machine)) impl.version = model.parse_version(version) if machine != '*': impl.machine = machine _host_distribution = None def get_host_distribution(): """Get a Distribution suitable for the host operating system. Calling this twice will return the same object. @rtype: L{Distribution}""" global _host_distribution if not _host_distribution: dpkg_db_status = '/var/lib/dpkg/status' rpm_db_packages = '/var/lib/rpm/Packages' _slack_db = '/var/log/packages' _arch_db = '/var/lib/pacman' _pkg_db = '/var/db/pkg' _macports_db = '/opt/local/var/macports/registry/registry.db' _cygwin_log = '/var/log/setup.log' if sys.prefix == "/sw": dpkg_db_status = os.path.join(sys.prefix, dpkg_db_status) rpm_db_packages = os.path.join(sys.prefix, rpm_db_packages) if os.name == "nt": _host_distribution = WindowsDistribution() elif os.path.isdir(_pkg_db): if sys.platform.startswith("linux"): _host_distribution = GentooDistribution(_pkg_db) elif sys.platform.startswith("freebsd"): _host_distribution = PortsDistribution(_pkg_db) elif os.path.isfile(_macports_db): _host_distribution = MacPortsDistribution(_macports_db) elif os.path.isfile(_cygwin_log) and sys.platform == "cygwin": _host_distribution = CygwinDistribution(_cygwin_log) elif os.access(dpkg_db_status, os.R_OK) \ and os.path.getsize(dpkg_db_status) > 0: _host_distribution = DebianDistribution(dpkg_db_status) elif os.path.isfile(rpm_db_packages): _host_distribution = RPMDistribution(rpm_db_packages) elif os.path.isdir(_slack_db): _host_distribution = SlackDistribution(_slack_db) elif os.path.isdir(_arch_db): _host_distribution = ArchDistribution(_arch_db) elif sys.platform == "darwin": _host_distribution = DarwinDistribution() else: _host_distribution = Distribution() return _host_distribution
afb/0install
zeroinstall/injector/distro.py
Python
lgpl-2.1
40,463
[ "VisIt" ]
fd66d2125e00156fa4d5c1d3512ca08e59289869d9f74786131312c22b4116dc
############################################################################## # Copyright (c) 2013-2018, Lawrence Livermore National Security, LLC. # Produced at the Lawrence Livermore National Laboratory. # # This file is part of Spack. # Created by Todd Gamblin, tgamblin@llnl.gov, All rights reserved. # LLNL-CODE-647188 # # For details, see https://github.com/spack/spack # Please also see the NOTICE and LICENSE files for our notice and the LGPL. # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU Lesser General Public License (as # published by the Free Software Foundation) version 2.1, February 1999. # # This program is distributed in the hope that it will be useful, but # WITHOUT ANY WARRANTY; without even the IMPLIED WARRANTY OF # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the terms and # conditions of the GNU Lesser General Public License for more details. # # You should have received a copy of the GNU Lesser General Public # License along with this program; if not, write to the Free Software # Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA ############################################################################## from spack import * class RAffyexpress(RPackage): """The purpose of this package is to provide a comprehensive and easy-to-use tool for quality assessment and to identify differentially expressed genes in the Affymetrix gene expression data.""" homepage = "https://www.bioconductor.org/packages/AffyExpress/" url = "https://git.bioconductor.org/packages/AffyExpress" version('1.42.0', git='https://git.bioconductor.org/packages/AffyExpress', commit='f5c5cf6173f4419e25f4aeff5e6b705a40abc371') depends_on('r@3.4.0:3.4.9', when='@1.42.0') depends_on('r-affy', type=('build', 'run')) depends_on('r-limma', type=('build', 'run'))
EmreAtes/spack
var/spack/repos/builtin/packages/r-affyexpress/package.py
Python
lgpl-2.1
1,907
[ "Bioconductor" ]
dbdcaef98499e222ccdbefedc591175b8614fde90905780ba88d9b45c34f5a36
#!/usr/bin/python # marina von steinkirch @2014 # steinkirch at gmail ''' This program implements the EM algorithm for a two-class Gaussian mixture model ''' import numpy as np def load_data(datafile_name): data = np.mat(np.loadtxt(datafile_name)) dataT = data.T return dataT def perform_em(X, mu, theta, epsilon): stop = 1.0 n = np.shape(X)[0] P = np.mat(np.zeros((n, len(mu)))) while epsilon - stop < 0: aux_gauss = np.mat(np.zeros((n, len(mu)))) P = e_step(aux_gauss, P, X, n, mu, theta) mu_n, theta_n = m_step(mu, theta, P, X, n) stop = sum(abs(mu_n-mu) + abs(theta_n - theta))/2.0 mu, theta = mu_n, theta_n return mu, theta def e_step(aux_gauss, P, X, n, mu, theta): for i in range(n): aux_gauss[i, :] = np.exp(-1.0 * np.square((X[i, :] - mu)) / 2.0) for j in range(len(mu)): P[:, j] = np.divide(aux_gauss[:, j]*theta[j], aux_gauss[:, 0]*theta[0] + aux_gauss[:, 1]*theta[1]) return P def m_step(mu, theta, P, X, n): for i in range(len(mu)): theta[i] = sum(P[:, i])/n mu[i] = sum(np.multiply(X, P[:, i]))/sum(P[:, i]) return mu, theta def main(): X = load_data('hw5.data') #print(X) epsilon = [1e-2, 1e-3, 1e-4, 1e-5, 1e-6, 1e-7, 1e-8, 1e-9] # we want to test convergence mu = np.array([1.0, 2.0]) theta = np.array([0.33, 0.67]) for e in epsilon: mu_n, theta_n = perform_em(X, mu, theta, e) print '\nFor epsilon = ', e print 'mu = ', mu_n print 'theta = ', theta_n if __name__ == '__main__': main()
bt3gl/Advanced-Machine-Learning
expectation_maximization/em_main.py
Python
mit
1,672
[ "Gaussian" ]
ab1defa1e83226ff92ae2f91078f07bac5b96d1673f58698d79be30f939d7c9a
# Copyright (c) 2012 The Chromium Authors. All rights reserved. # Use of this source code is governed by a BSD-style license that can be # found in the LICENSE file. '''The 'grit build' tool. ''' from __future__ import print_function import collections import codecs import filecmp import getopt import gzip import os import shutil import sys import six from grit import grd_reader from grit import shortcuts from grit import util from grit.format import minifier from grit.node import brotli_util from grit.node import include from grit.node import message from grit.node import structure from grit.tool import interface # It would be cleaner to have each module register itself, but that would # require importing all of them on every run of GRIT. '''Map from <output> node types to modules under grit.format.''' _format_modules = { 'android': 'android_xml', 'c_format': 'c_format', 'chrome_messages_json': 'chrome_messages_json', 'chrome_messages_json_gzip': 'chrome_messages_json', 'data_package': 'data_pack', 'policy_templates': 'policy_templates_json', 'rc_all': 'rc', 'rc_header': 'rc_header', 'rc_nontranslateable': 'rc', 'rc_translateable': 'rc', 'resource_file_map_source': 'resource_map', 'resource_map_header': 'resource_map', 'resource_map_source': 'resource_map', } def GetFormatter(type): modulename = 'grit.format.' + _format_modules[type] __import__(modulename) module = sys.modules[modulename] try: return module.Format except AttributeError: return module.GetFormatter(type) class RcBuilder(interface.Tool): '''A tool that builds RC files and resource header files for compilation. Usage: grit build [-o OUTPUTDIR] [-D NAME[=VAL]]* All output options for this tool are specified in the input file (see 'grit help' for details on how to specify the input file - it is a global option). Options: -a FILE Assert that the given file is an output. There can be multiple "-a" flags listed for multiple outputs. If a "-a" or "--assert-file-list" argument is present, then the list of asserted files must match the output files or the tool will fail. The use-case is for the build system to maintain separate lists of output files and to catch errors if the build system's list and the grit list are out-of-sync. --assert-file-list Provide a file listing multiple asserted output files. There is one file name per line. This acts like specifying each file with "-a" on the command line, but without the possibility of running into OS line-length limits for very long lists. -o OUTPUTDIR Specify what directory output paths are relative to. Defaults to the current directory. -p FILE Specify a file containing a pre-determined mapping from resource names to resource ids which will be used to assign resource ids to those resources. Resources not found in this file will be assigned ids normally. The motivation is to run your app's startup and have it dump the resources it loads, and then pass these via this flag. This will pack startup resources together, thus reducing paging while all other resources are unperturbed. The file should have the format: RESOURCE_ONE_NAME 123 RESOURCE_TWO_NAME 124 -D NAME[=VAL] Specify a C-preprocessor-like define NAME with optional value VAL (defaults to 1) which will be used to control conditional inclusion of resources. -E NAME=VALUE Set environment variable NAME to VALUE (within grit). -f FIRSTIDSFILE Path to a python file that specifies the first id of value to use for resources. A non-empty value here will override the value specified in the <grit> node's first_ids_file. -w ALLOWLISTFILE Path to a file containing the string names of the resources to include. Anything not listed is dropped. -t PLATFORM Specifies the platform the build is targeting; defaults to the value of sys.platform. The value provided via this flag should match what sys.platform would report for your target platform; see grit.node.base.EvaluateCondition. --allowlist-support Generate code to support extracting a resource allowlist from executables. --write-only-new flag If flag is non-0, write output files to a temporary file first, and copy it to the real output only if the new file is different from the old file. This allows some build systems to realize that dependent build steps might be unnecessary, at the cost of comparing the output data at grit time. --depend-on-stamp If specified along with --depfile and --depdir, the depfile generated will depend on a stampfile instead of the first output in the input .grd file. --js-minifier A command to run the Javascript minifier. If not set then Javascript won't be minified. The command should read the original Javascript from standard input, and output the minified Javascript to standard output. A non-zero exit status will be taken as indicating failure. --css-minifier A command to run the CSS minifier. If not set then CSS won't be minified. The command should read the original CSS from standard input, and output the minified CSS to standard output. A non-zero exit status will be taken as indicating failure. --brotli The full path to the brotli executable generated by third_party/brotli/BUILD.gn, required if any entries use compress="brotli". Conditional inclusion of resources only affects the output of files which control which resources get linked into a binary, e.g. it affects .rc files meant for compilation but it does not affect resource header files (that define IDs). This helps ensure that values of IDs stay the same, that all messages are exported to translation interchange files (e.g. XMB files), etc. ''' def ShortDescription(self): return 'A tool that builds RC files for compilation.' def Run(self, opts, args): brotli_util.SetBrotliCommand(None) os.environ['cwd'] = os.getcwd() self.output_directory = '.' first_ids_file = None predetermined_ids_file = None allowlist_filenames = [] assert_output_files = [] target_platform = None depfile = None depdir = None allowlist_support = False write_only_new = False depend_on_stamp = False js_minifier = None css_minifier = None replace_ellipsis = True (own_opts, args) = getopt.getopt( args, 'a:p:o:D:E:f:w:t:', ('depdir=', 'depfile=', 'assert-file-list=', 'help', 'output-all-resource-defines', 'no-output-all-resource-defines', 'no-replace-ellipsis', 'depend-on-stamp', 'js-minifier=', 'css-minifier=', 'write-only-new=', 'allowlist-support', 'brotli=')) for (key, val) in own_opts: if key == '-a': assert_output_files.append(val) elif key == '--assert-file-list': with open(val) as f: assert_output_files += f.read().splitlines() elif key == '-o': self.output_directory = val elif key == '-D': name, val = util.ParseDefine(val) self.defines[name] = val elif key == '-E': (env_name, env_value) = val.split('=', 1) os.environ[env_name] = env_value elif key == '-f': # TODO(joi@chromium.org): Remove this override once change # lands in WebKit.grd to specify the first_ids_file in the # .grd itself. first_ids_file = val elif key == '-w': allowlist_filenames.append(val) elif key == '--no-replace-ellipsis': replace_ellipsis = False elif key == '-p': predetermined_ids_file = val elif key == '-t': target_platform = val elif key == '--depdir': depdir = val elif key == '--depfile': depfile = val elif key == '--write-only-new': write_only_new = val != '0' elif key == '--depend-on-stamp': depend_on_stamp = True elif key == '--js-minifier': js_minifier = val elif key == '--css-minifier': css_minifier = val elif key == '--allowlist-support': allowlist_support = True elif key == '--brotli': brotli_util.SetBrotliCommand([os.path.abspath(val)]) elif key == '--help': self.ShowUsage() sys.exit(0) if len(args): print('This tool takes no tool-specific arguments.') return 2 self.SetOptions(opts) self.VerboseOut('Output directory: %s (absolute path: %s)\n' % (self.output_directory, os.path.abspath(self.output_directory))) if allowlist_filenames: self.allowlist_names = set() for allowlist_filename in allowlist_filenames: self.VerboseOut('Using allowlist: %s\n' % allowlist_filename) allowlist_contents = util.ReadFile(allowlist_filename, 'utf-8') self.allowlist_names.update(allowlist_contents.strip().split('\n')) if js_minifier: minifier.SetJsMinifier(js_minifier) if css_minifier: minifier.SetCssMinifier(css_minifier) self.write_only_new = write_only_new self.res = grd_reader.Parse(opts.input, debug=opts.extra_verbose, first_ids_file=first_ids_file, predetermined_ids_file=predetermined_ids_file, defines=self.defines, target_platform=target_platform) # Set an output context so that conditionals can use defines during the # gathering stage; we use a dummy language here since we are not outputting # a specific language. self.res.SetOutputLanguage('en') self.res.SetAllowlistSupportEnabled(allowlist_support) self.res.RunGatherers() # Replace ... with the single-character version. http://crbug.com/621772 if replace_ellipsis: for node in self.res: if isinstance(node, message.MessageNode): node.SetReplaceEllipsis(True) self.Process() if assert_output_files: if not self.CheckAssertedOutputFiles(assert_output_files): return 2 if depfile and depdir: self.GenerateDepfile(depfile, depdir, first_ids_file, depend_on_stamp) return 0 def __init__(self, defines=None): # Default file-creation function is codecs.open(). Only done to allow # overriding by unit test. self.fo_create = codecs.open # key/value pairs of C-preprocessor like defines that are used for # conditional output of resources self.defines = defines or {} # self.res is a fully-populated resource tree if Run() # has been called, otherwise None. self.res = None # The set of names that are allowlisted to actually be included in the # output. self.allowlist_names = None # Whether to compare outputs to their old contents before writing. self.write_only_new = False @staticmethod def AddAllowlistTags(start_node, allowlist_names): # Walk the tree of nodes added attributes for the nodes that shouldn't # be written into the target files (skip markers). for node in start_node: # Same trick data_pack.py uses to see what nodes actually result in # real items. if (isinstance(node, include.IncludeNode) or isinstance(node, message.MessageNode) or isinstance(node, structure.StructureNode)): text_ids = node.GetTextualIds() # Mark the item to be skipped if it wasn't in the allowlist. if text_ids and text_ids[0] not in allowlist_names: node.SetAllowlistMarkedAsSkip(True) @staticmethod def ProcessNode(node, output_node, outfile): '''Processes a node in-order, calling its formatter before and after recursing to its children. Args: node: grit.node.base.Node subclass output_node: grit.node.io.OutputNode outfile: open filehandle ''' base_dir = util.dirname(output_node.GetOutputFilename()) formatter = GetFormatter(output_node.GetType()) formatted = formatter(node, output_node.GetLanguage(), output_dir=base_dir) # NB: Formatters may be generators or return lists. The writelines API # accepts iterables as a shortcut to calling write directly. That means # you can pass strings (iteration yields characters), but not bytes (as # iteration yields integers). Python 2 worked due to its quirks with # bytes/string implementation, but Python 3 fails. It's also a bit more # inefficient to call write once per character/byte. Handle all of this # ourselves by calling write directly on strings/bytes before falling back # to writelines. if isinstance(formatted, (six.string_types, six.binary_type)): outfile.write(formatted) else: outfile.writelines(formatted) if output_node.GetType() == 'data_package': with open(output_node.GetOutputFilename() + '.info', 'w') as infofile: if node.info: # We terminate with a newline so that when these files are # concatenated later we consistently terminate with a newline so # consumers can account for terminating newlines. infofile.writelines(['\n'.join(node.info), '\n']) @staticmethod def _EncodingForOutputType(output_type): # Microsoft's RC compiler can only deal with single-byte or double-byte # files (no UTF-8), so we make all RC files UTF-16 to support all # character sets. if output_type in ('rc_header', 'resource_file_map_source', 'resource_map_header', 'resource_map_source'): return 'cp1252' if output_type in ('android', 'c_format', 'plist', 'plist_strings', 'doc', 'json', 'android_policy', 'chrome_messages_json', 'chrome_messages_json_gzip', 'policy_templates'): return 'utf_8' # TODO(gfeher) modify here to set utf-8 encoding for admx/adml return 'utf_16' def Process(self): for output in self.res.GetOutputFiles(): output.output_filename = os.path.abspath(os.path.join( self.output_directory, output.GetOutputFilename())) # If there are allowlisted names, tag the tree once up front, this way # while looping through the actual output, it is just an attribute check. if self.allowlist_names: self.AddAllowlistTags(self.res, self.allowlist_names) for output in self.res.GetOutputFiles(): self.VerboseOut('Creating %s...' % output.GetOutputFilename()) # Set the context, for conditional inclusion of resources self.res.SetOutputLanguage(output.GetLanguage()) self.res.SetOutputContext(output.GetContext()) self.res.SetFallbackToDefaultLayout(output.GetFallbackToDefaultLayout()) self.res.SetDefines(self.defines) # Assign IDs only once to ensure that all outputs use the same IDs. if self.res.GetIdMap() is None: self.res.InitializeIds() # Make the output directory if it doesn't exist. self.MakeDirectoriesTo(output.GetOutputFilename()) # Write the results to a temporary file and only overwrite the original # if the file changed. This avoids unnecessary rebuilds. out_filename = output.GetOutputFilename() tmp_filename = out_filename + '.tmp' tmpfile = self.fo_create(tmp_filename, 'wb') output_type = output.GetType() if output_type != 'data_package': encoding = self._EncodingForOutputType(output_type) tmpfile = util.WrapOutputStream(tmpfile, encoding) # Iterate in-order through entire resource tree, calling formatters on # the entry into a node and on exit out of it. with tmpfile: self.ProcessNode(self.res, output, tmpfile) if output_type == 'chrome_messages_json_gzip': gz_filename = tmp_filename + '.gz' with open(tmp_filename, 'rb') as tmpfile, open(gz_filename, 'wb') as f: with gzip.GzipFile(filename='', mode='wb', fileobj=f, mtime=0) as fgz: shutil.copyfileobj(tmpfile, fgz) os.remove(tmp_filename) tmp_filename = gz_filename # Now copy from the temp file back to the real output, but on Windows, # only if the real output doesn't exist or the contents of the file # changed. This prevents identical headers from being written and .cc # files from recompiling (which is painful on Windows). if not os.path.exists(out_filename): os.rename(tmp_filename, out_filename) else: # CHROMIUM SPECIFIC CHANGE. # This clashes with gyp + vstudio, which expect the output timestamp # to change on a rebuild, even if nothing has changed, so only do # it when opted in. if not self.write_only_new: write_file = True else: files_match = filecmp.cmp(out_filename, tmp_filename) write_file = not files_match if write_file: shutil.copy2(tmp_filename, out_filename) os.remove(tmp_filename) self.VerboseOut(' done.\n') # Print warnings if there are any duplicate shortcuts. warnings = shortcuts.GenerateDuplicateShortcutsWarnings( self.res.UberClique(), self.res.GetTcProject()) if warnings: print('\n'.join(warnings)) # Print out any fallback warnings, and missing translation errors, and # exit with an error code if there are missing translations in a non-pseudo # and non-official build. warnings = (self.res.UberClique().MissingTranslationsReport(). encode('ascii', 'replace')) if warnings: self.VerboseOut(warnings) if self.res.UberClique().HasMissingTranslations(): print(self.res.UberClique().missing_translations_) sys.exit(-1) def CheckAssertedOutputFiles(self, assert_output_files): '''Checks that the asserted output files are specified in the given list. Returns true if the asserted files are present. If they are not, returns False and prints the failure. ''' # Compare the absolute path names, sorted. asserted = sorted([os.path.abspath(i) for i in assert_output_files]) actual = sorted([ os.path.abspath(os.path.join(self.output_directory, i.GetOutputFilename())) for i in self.res.GetOutputFiles()]) if asserted != actual: missing = list(set(asserted) - set(actual)) extra = list(set(actual) - set(asserted)) duplicates = [ path for path, count in collections.Counter(actual).items() if count > 1 ] error = '''Asserted file list does not match. Missing output files: %s Extra output files: %s Duplicate actual output files: %s ''' print(error % ('\n'.join(missing), '\n'.join(extra), '\n'.join(duplicates))) return False return True def GenerateDepfile(self, depfile, depdir, first_ids_file, depend_on_stamp): '''Generate a depfile that contains the implicit dependencies of the input grd. The depfile will be in the same format as a makefile, and will contain references to files relative to |depdir|. It will be put in |depfile|. For example, supposing we have three files in a directory src/ src/ blah.grd <- depends on input{1,2}.xtb input1.xtb input2.xtb and we run grit -i blah.grd -o ../out/gen \ --depdir ../out \ --depfile ../out/gen/blah.rd.d from the directory src/ we will generate a depfile ../out/gen/blah.grd.d that has the contents gen/blah.h: ../src/input1.xtb ../src/input2.xtb Where "gen/blah.h" is the first output (Ninja expects the .d file to list the first output in cases where there is more than one). If the flag --depend-on-stamp is specified, "gen/blah.rd.d.stamp" will be used that is 'touched' whenever a new depfile is generated. Note that all paths in the depfile are relative to ../out, the depdir. ''' depfile = os.path.abspath(depfile) depdir = os.path.abspath(depdir) infiles = self.res.GetInputFiles() # We want to trigger a rebuild if the first ids change. if first_ids_file is not None: infiles.append(first_ids_file) if (depend_on_stamp): output_file = depfile + ".stamp" # Touch the stamp file before generating the depfile. with open(output_file, 'a'): os.utime(output_file, None) else: # Get the first output file relative to the depdir. outputs = self.res.GetOutputFiles() output_file = os.path.join(self.output_directory, outputs[0].GetOutputFilename()) output_file = os.path.relpath(output_file, depdir) # The path prefix to prepend to dependencies in the depfile. prefix = os.path.relpath(os.getcwd(), depdir) deps_text = ' '.join([os.path.join(prefix, i) for i in infiles]) depfile_contents = output_file + ': ' + deps_text self.MakeDirectoriesTo(depfile) outfile = self.fo_create(depfile, 'w', encoding='utf-8') outfile.write(depfile_contents) @staticmethod def MakeDirectoriesTo(file): '''Creates directories necessary to contain |file|.''' dir = os.path.split(file)[0] if not os.path.exists(dir): os.makedirs(dir)
chromium/chromium
tools/grit/grit/tool/build.py
Python
bsd-3-clause
22,102
[ "xTB" ]
be67c29e28b7479a538894c53597c0f60dfd46fe9b7a144b2b63fcc7b8640354
import webbrowser import os import socket from urllib.parse import urlparse from plugin import plugin, alias, require FILE_PATH = os.path.abspath(os.path.dirname(__file__)) @require(network=True) @alias("visit website") @plugin("website") class OpenWebsite: """ This plugin will visit a website using some parameters. The user can visit a simple website giving a complete link or inputting the name of the website like the examples: > visit website www.google.com > visit website github > visit website github username You can find a csv file with a list of saved websites at: Jarvis/jarviscli/data/website.csv {Alternatively, you can also use only 'website' instead of 'visit website'} """ def __call__(self, jarvis, link): inputs = link.split(' ') self.main_link = inputs[0] self.complement = False if len(inputs) > 1: self.complement = inputs[1] if self.has_on_saved_links(): webbrowser.open(self.main_link) elif self.verify_link(): webbrowser.open(self.main_link) else: jarvis.say("Sorry, I can't open this link.") def has_on_saved_links(self): websites_csv = \ open(os.path.join(FILE_PATH, "../data/websites.csv"), 'r') for website in websites_csv: website = website.rstrip() # remove newline information = website.split(',') if self.main_link == information[0]: if self.complement: if len(information) > 2: self.main_link = \ information[1] + information[2] + self.complement else: self.main_link = information[1] + self.complement else: self.main_link = information[1] return True return False def verify_link(self): self.fix_link() domain = urlparse(self.main_link).netloc try: socket.getaddrinfo(domain, 80) except socket.gaierror: return False return True def fix_link(self): if not self.main_link.startswith('http'): self.main_link = "https://" + self.main_link
sukeesh/Jarvis
jarviscli/plugins/visit_website.py
Python
mit
2,297
[ "VisIt" ]
9f60cc2e1b6046260cdcabc4b674cd31259d81a0f0a14e010549793c9bcf457b
from __future__ import with_statement import hashlib import os import posixpath import stat import re from fnmatch import filter as fnfilter from fabric.state import output, connections, env from fabric.utils import warn from fabric.context_managers import settings def _format_local(local_path, local_is_path): """Format a path for log output""" if local_is_path: return local_path else: # This allows users to set a name attr on their StringIO objects # just like an open file object would have return getattr(local_path, 'name', '<file obj>') class SFTP(object): """ SFTP helper class, which is also a facade for ssh.SFTPClient. """ def __init__(self, host_string): self.ftp = connections[host_string].open_sftp() # Recall that __getattr__ is the "fallback" attribute getter, and is thus # pretty safe to use for facade-like behavior as we're doing here. def __getattr__(self, attr): return getattr(self.ftp, attr) def isdir(self, path): try: return stat.S_ISDIR(self.ftp.lstat(path).st_mode) except IOError: return False def islink(self, path): try: return stat.S_ISLNK(self.ftp.lstat(path).st_mode) except IOError: return False def exists(self, path): try: self.ftp.lstat(path).st_mode except IOError: return False return True def glob(self, path): from fabric.state import win32 dirpart, pattern = os.path.split(path) rlist = self.ftp.listdir(dirpart) names = fnfilter([f for f in rlist if not f[0] == '.'], pattern) ret = [path] if len(names): s = '/' ret = [dirpart.rstrip(s) + s + name.lstrip(s) for name in names] if not win32: ret = [posixpath.join(dirpart, name) for name in names] return ret def walk(self, top, topdown=True, onerror=None, followlinks=False): from os.path import join # We may not have read permission for top, in which case we can't get a # list of the files the directory contains. os.path.walk always # suppressed the exception then, rather than blow up for a minor reason # when (say) a thousand readable directories are still left to visit. # That logic is copied here. try: # Note that listdir and error are globals in this module due to # earlier import-*. names = self.ftp.listdir(top) except Exception, err: if onerror is not None: onerror(err) return dirs, nondirs = [], [] for name in names: if self.isdir(join(top, name)): dirs.append(name) else: nondirs.append(name) if topdown: yield top, dirs, nondirs for name in dirs: path = join(top, name) if followlinks or not self.islink(path): for x in self.walk(path, topdown, onerror, followlinks): yield x if not topdown: yield top, dirs, nondirs def mkdir(self, path, use_sudo): from fabric.api import sudo, hide if use_sudo: with hide('everything'): sudo('mkdir %s' % path) else: self.ftp.mkdir(path) def get(self, remote_path, local_path, local_is_path, rremote=None): # rremote => relative remote path, so get(/var/log) would result in # this function being called with # remote_path=/var/log/apache2/access.log and # rremote=apache2/access.log rremote = rremote if rremote is not None else remote_path # Handle format string interpolation (e.g. %(dirname)s) path_vars = { 'host': env.host_string.replace(':', '-'), 'basename': os.path.basename(rremote), 'dirname': os.path.dirname(rremote), 'path': rremote } if local_is_path: # Naive fix to issue #711 escaped_path = re.sub(r'(%[^()]*\w)', r'%\1', local_path) local_path = os.path.abspath(escaped_path % path_vars ) # Ensure we give ssh.SFTPCLient a file by prepending and/or # creating local directories as appropriate. dirpath, filepath = os.path.split(local_path) if dirpath and not os.path.exists(dirpath): os.makedirs(dirpath) if os.path.isdir(local_path): local_path = os.path.join(local_path, path_vars['basename']) if output.running: print("[%s] download: %s <- %s" % ( env.host_string, _format_local(local_path, local_is_path), remote_path )) # Warn about overwrites, but keep going if local_is_path and os.path.exists(local_path): msg = "Local file %s already exists and is being overwritten." warn(msg % local_path) # File-like objects: reset to file seek 0 (to ensure full overwrite) # and then use Paramiko's getfo() directly getter = self.ftp.get if not local_is_path: local_path.seek(0) getter = self.ftp.getfo getter(remote_path, local_path) # Return local_path object for posterity. (If mutated, caller will want # to know.) return local_path def get_dir(self, remote_path, local_path): # Decide what needs to be stripped from remote paths so they're all # relative to the given remote_path if os.path.basename(remote_path): strip = os.path.dirname(remote_path) else: strip = os.path.dirname(os.path.dirname(remote_path)) # Store all paths gotten so we can return them when done result = [] # Use our facsimile of os.walk to find all files within remote_path for context, dirs, files in self.walk(remote_path): # Normalize current directory to be relative # E.g. remote_path of /var/log and current dir of /var/log/apache2 # would be turned into just 'apache2' lcontext = rcontext = context.replace(strip, '', 1).lstrip('/') # Prepend local path to that to arrive at the local mirrored # version of this directory. So if local_path was 'mylogs', we'd # end up with 'mylogs/apache2' lcontext = os.path.join(local_path, lcontext) # Download any files in current directory for f in files: # Construct full and relative remote paths to this file rpath = posixpath.join(context, f) rremote = posixpath.join(rcontext, f) # If local_path isn't using a format string that expands to # include its remote path, we need to add it here. if "%(path)s" not in local_path \ and "%(dirname)s" not in local_path: lpath = os.path.join(lcontext, f) # Otherwise, just passthrough local_path to self.get() else: lpath = local_path # Now we can make a call to self.get() with specific file paths # on both ends. result.append(self.get(rpath, lpath, True, rremote)) return result def put(self, local_path, remote_path, use_sudo, mirror_local_mode, mode, local_is_path, temp_dir): from fabric.api import sudo, hide pre = self.ftp.getcwd() pre = pre if pre else '' if local_is_path and self.isdir(remote_path): basename = os.path.basename(local_path) remote_path = posixpath.join(remote_path, basename) if output.running: print("[%s] put: %s -> %s" % ( env.host_string, _format_local(local_path, local_is_path), posixpath.join(pre, remote_path) )) # When using sudo, "bounce" the file through a guaranteed-unique file # path in the default remote CWD (which, typically, the login user will # have write permissions on) in order to sudo(mv) it later. if use_sudo: target_path = remote_path hasher = hashlib.sha1() hasher.update(env.host_string) hasher.update(target_path) remote_path = posixpath.join(temp_dir, hasher.hexdigest()) # Read, ensuring we handle file-like objects correct re: seek pointer putter = self.ftp.put if not local_is_path: old_pointer = local_path.tell() local_path.seek(0) putter = self.ftp.putfo rattrs = putter(local_path, remote_path) if not local_is_path: local_path.seek(old_pointer) # Handle modes if necessary if (local_is_path and mirror_local_mode) or (mode is not None): lmode = os.stat(local_path).st_mode if mirror_local_mode else mode # Cast to octal integer in case of string if isinstance(lmode, basestring): lmode = int(lmode, 8) lmode = lmode & 07777 rmode = rattrs.st_mode # Only bitshift if we actually got an rmode if rmode is not None: rmode = (rmode & 07777) if lmode != rmode: if use_sudo: with hide('everything'): sudo('chmod %o \"%s\"' % (lmode, remote_path)) else: self.ftp.chmod(remote_path, lmode) if use_sudo: # Temporarily nuke 'cwd' so sudo() doesn't "cd" its mv command. # (The target path has already been cwd-ified elsewhere.) with settings(hide('everything'), cwd=""): sudo("mv \"%s\" \"%s\"" % (remote_path, target_path)) # Revert to original remote_path for return value's sake remote_path = target_path return remote_path def put_dir(self, local_path, remote_path, use_sudo, mirror_local_mode, mode, temp_dir): if os.path.basename(local_path): strip = os.path.dirname(local_path) else: strip = os.path.dirname(os.path.dirname(local_path)) remote_paths = [] for context, dirs, files in os.walk(local_path): rcontext = context.replace(strip, '', 1) # normalize pathname separators with POSIX separator rcontext = rcontext.replace(os.sep, '/') rcontext = rcontext.lstrip('/') rcontext = posixpath.join(remote_path, rcontext) if not self.exists(rcontext): self.mkdir(rcontext, use_sudo) for d in dirs: n = posixpath.join(rcontext, d) if not self.exists(n): self.mkdir(n, use_sudo) for f in files: local_path = os.path.join(context, f) n = posixpath.join(rcontext, f) p = self.put(local_path, n, use_sudo, mirror_local_mode, mode, True, temp_dir) remote_paths.append(p) return remote_paths
noslenfa/tdjangorest
uw/lib/python2.7/site-packages/fabric/sftp.py
Python
apache-2.0
11,344
[ "VisIt" ]
ecbc99c2e1b94c678958bf8e73f6f0214eda04b4cac487fbccce8069b5571136
#!/usr/bin/env python # -*- coding: utf-8 -*- """Functional tests using WebTest.""" import datetime as dt import httplib as http import logging import unittest import markupsafe import mock import pytest from nose.tools import * # noqa: F403 import re from django.utils import timezone from addons.wiki.utils import to_mongo_key from framework.auth import exceptions as auth_exc from framework.auth.core import Auth from tests.base import OsfTestCase from tests.base import fake from osf_tests.factories import ( fake_email, AuthUserFactory, NodeFactory, PreprintFactory, PreprintProviderFactory, PrivateLinkFactory, ProjectFactory, RegistrationFactory, SubjectFactory, UserFactory, UnconfirmedUserFactory, UnregUserFactory, ) from osf.utils import permissions from addons.wiki.models import WikiPage, WikiVersion from addons.wiki.tests.factories import WikiFactory, WikiVersionFactory from website import settings, language from addons.osfstorage.models import OsfStorageFile from website.util import web_url_for, api_url_for from api_tests import utils as test_utils logging.getLogger('website.project.model').setLevel(logging.ERROR) def assert_in_html(member, container, **kwargs): """Looks for the specified member in markupsafe-escaped HTML output""" member = markupsafe.escape(member) return assert_in(member, container, **kwargs) def assert_not_in_html(member, container, **kwargs): """Looks for the specified member in markupsafe-escaped HTML output""" member = markupsafe.escape(member) return assert_not_in(member, container, **kwargs) class TestDisabledUser(OsfTestCase): def setUp(self): super(TestDisabledUser, self).setUp() self.user = UserFactory() self.user.set_password('Korben Dallas') self.user.is_disabled = True self.user.save() def test_profile_disabled_returns_401(self): res = self.app.get(self.user.url, expect_errors=True) assert_equal(res.status_code, 410) class TestAnUnregisteredUser(OsfTestCase): def test_cant_see_profile_if_not_logged_in(self): url = web_url_for('profile_view') res = self.app.get(url) res = res.follow() assert_equal(res.status_code, 301) assert_in('/login/', res.headers['Location']) @pytest.mark.enable_bookmark_creation @pytest.mark.enable_quickfiles_creation class TestAUser(OsfTestCase): def setUp(self): super(TestAUser, self).setUp() self.user = AuthUserFactory() self.auth = self.user.auth def test_can_see_profile_url(self): res = self.app.get(self.user.url).maybe_follow() assert_in(self.user.url, res) # `GET /login/` without parameters is redirected to `/dashboard/` page which has `@must_be_logged_in` decorator # if user is not logged in, she/he is further redirected to CAS login page def test_is_redirected_to_cas_if_not_logged_in_at_login_page(self): res = self.app.get('/login/').follow() assert_equal(res.status_code, 302) location = res.headers.get('Location') assert_in('login?service=', location) def test_is_redirected_to_dashboard_if_already_logged_in_at_login_page(self): res = self.app.get('/login/', auth=self.user.auth) assert_equal(res.status_code, 302) assert 'dashboard' in res.headers.get('Location') def test_register_page(self): res = self.app.get('/register/') assert_equal(res.status_code, 200) def test_is_redirected_to_dashboard_if_already_logged_in_at_register_page(self): res = self.app.get('/register/', auth=self.user.auth) assert_equal(res.status_code, 302) assert 'dashboard' in res.headers.get('Location') def test_sees_projects_in_her_dashboard(self): # the user already has a project project = ProjectFactory(creator=self.user) project.add_contributor(self.user) project.save() res = self.app.get('/myprojects/', auth=self.user.auth) assert_in('Projects', res) # Projects heading def test_does_not_see_osffiles_in_user_addon_settings(self): res = self.app.get('/settings/addons/', auth=self.auth, auto_follow=True) assert_not_in('OSF Storage', res) def test_sees_osffiles_in_project_addon_settings(self): project = ProjectFactory(creator=self.user) project.add_contributor( self.user, permissions=permissions.ADMIN, save=True) res = self.app.get('/{0}/addons/'.format(project._primary_key), auth=self.auth, auto_follow=True) assert_in('OSF Storage', res) def test_sees_correct_title_on_dashboard(self): # User goes to dashboard res = self.app.get('/myprojects/', auth=self.auth, auto_follow=True) title = res.html.title.string assert_equal('OSF | My Projects', title) def test_can_see_make_public_button_if_admin(self): # User is a contributor on a project project = ProjectFactory() project.add_contributor( self.user, permissions=permissions.ADMIN, save=True) # User goes to the project page res = self.app.get(project.url, auth=self.auth).maybe_follow() assert_in('Make Public', res) def test_cant_see_make_public_button_if_not_admin(self): # User is a contributor on a project project = ProjectFactory() project.add_contributor( self.user, permissions=permissions.WRITE, save=True) # User goes to the project page res = self.app.get(project.url, auth=self.auth).maybe_follow() assert_not_in('Make Public', res) def test_can_see_make_private_button_if_admin(self): # User is a contributor on a project project = ProjectFactory(is_public=True) project.add_contributor( self.user, permissions=permissions.ADMIN, save=True) # User goes to the project page res = self.app.get(project.url, auth=self.auth).maybe_follow() assert_in('Make Private', res) def test_cant_see_make_private_button_if_not_admin(self): # User is a contributor on a project project = ProjectFactory(is_public=True) project.add_contributor( self.user, permissions=permissions.WRITE, save=True) # User goes to the project page res = self.app.get(project.url, auth=self.auth).maybe_follow() assert_not_in('Make Private', res) def test_sees_logs_on_a_project(self): project = ProjectFactory(is_public=True) # User goes to the project's page res = self.app.get(project.url, auth=self.auth).maybe_follow() # Can see log event assert_in('created', res) def test_no_wiki_content_message(self): project = ProjectFactory(creator=self.user) # Goes to project's wiki, where there is no content res = self.app.get('/{0}/wiki/home/'.format(project._primary_key), auth=self.auth) # Sees a message indicating no content assert_in('Add important information, links, or images here to describe your project.', res) # Sees that edit panel is open by default when home wiki has no content assert_in('panelsUsed: ["view", "menu", "edit"]', res) def test_wiki_content(self): project = ProjectFactory(creator=self.user) wiki_page_name = 'home' wiki_content = 'Kittens' wiki_page = WikiFactory( user=self.user, node=project, ) wiki = WikiVersionFactory( wiki_page=wiki_page, content=wiki_content ) res = self.app.get('/{0}/wiki/{1}/'.format( project._primary_key, wiki_page_name, ), auth=self.auth) assert_not_in('Add important information, links, or images here to describe your project.', res) assert_in(wiki_content, res) assert_in('panelsUsed: ["view", "menu"]', res) def test_wiki_page_name_non_ascii(self): project = ProjectFactory(creator=self.user) non_ascii = to_mongo_key('WöRlÐé') WikiPage.objects.create_for_node(project, 'WöRlÐé', 'new content', Auth(self.user)) wv = WikiVersion.objects.get_for_node(project, non_ascii) assert wv.wiki_page.page_name.upper() == non_ascii.decode('utf-8').upper() def test_noncontributor_cannot_see_wiki_if_no_content(self): user2 = UserFactory() # user2 creates a public project and adds no wiki content project = ProjectFactory(creator=user2, is_public=True) # self navigates to project res = self.app.get(project.url).maybe_follow() # Should not see wiki widget (since non-contributor and no content) assert_not_in('Add important information, links, or images here to describe your project.', res) def test_wiki_does_not_exist(self): project = ProjectFactory(creator=self.user) res = self.app.get('/{0}/wiki/{1}/'.format( project._primary_key, 'not a real page yet', ), auth=self.auth, expect_errors=True) assert_in('Add important information, links, or images here to describe your project.', res) def test_sees_own_profile(self): res = self.app.get('/profile/', auth=self.auth) td1 = res.html.find('td', text=re.compile(r'Public(.*?)Profile')) td2 = td1.find_next_sibling('td') assert_equal(td2.text, self.user.display_absolute_url) def test_sees_another_profile(self): user2 = UserFactory() res = self.app.get(user2.url, auth=self.auth) td1 = res.html.find('td', text=re.compile(r'Public(.*?)Profile')) td2 = td1.find_next_sibling('td') assert_equal(td2.text, user2.display_absolute_url) @pytest.mark.enable_bookmark_creation class TestComponents(OsfTestCase): def setUp(self): super(TestComponents, self).setUp() self.user = AuthUserFactory() self.consolidate_auth = Auth(user=self.user) self.project = ProjectFactory(creator=self.user) self.project.add_contributor(contributor=self.user, auth=self.consolidate_auth) # A non-project componenet self.component = NodeFactory( category='hypothesis', creator=self.user, parent=self.project, ) self.component.save() self.component.set_privacy('public', self.consolidate_auth) self.component.set_privacy('private', self.consolidate_auth) self.project.save() self.project_url = self.project.web_url_for('view_project') def test_sees_parent(self): res = self.app.get(self.component.url, auth=self.user.auth).maybe_follow() parent_title = res.html.find_all('h2', class_='node-parent-title') assert_equal(len(parent_title), 1) assert_in(self.project.title, parent_title[0].text) # Bs4 will handle unescaping HTML here def test_delete_project(self): res = self.app.get( self.component.url + 'settings/', auth=self.user.auth ).maybe_follow() assert_in( 'Delete {0}'.format(self.component.project_or_component), res ) def test_cant_delete_project_if_not_admin(self): non_admin = AuthUserFactory() self.component.add_contributor( non_admin, permissions=permissions.WRITE, auth=self.consolidate_auth, save=True, ) res = self.app.get( self.component.url + 'settings/', auth=non_admin.auth ).maybe_follow() assert_not_in( 'Delete {0}'.format(self.component.project_or_component), res ) def test_can_configure_comments_if_admin(self): res = self.app.get( self.component.url + 'settings/', auth=self.user.auth, ).maybe_follow() assert_in('Commenting', res) def test_cant_configure_comments_if_not_admin(self): non_admin = AuthUserFactory() self.component.add_contributor( non_admin, permissions=permissions.WRITE, auth=self.consolidate_auth, save=True, ) res = self.app.get( self.component.url + 'settings/', auth=non_admin.auth ).maybe_follow() assert_not_in('Commenting', res) def test_components_should_have_component_list(self): res = self.app.get(self.component.url, auth=self.user.auth) assert_in('Components', res) @pytest.mark.enable_bookmark_creation class TestPrivateLinkView(OsfTestCase): def setUp(self): super(TestPrivateLinkView, self).setUp() self.user = AuthUserFactory() # Is NOT a contributor self.project = ProjectFactory(is_public=False) self.link = PrivateLinkFactory(anonymous=True) self.link.nodes.add(self.project) self.link.save() self.project_url = self.project.web_url_for('view_project') def test_anonymous_link_hide_contributor(self): res = self.app.get(self.project_url, {'view_only': self.link.key}) assert_in('Anonymous Contributors', res.body) assert_not_in(self.user.fullname, res) def test_anonymous_link_hides_citations(self): res = self.app.get(self.project_url, {'view_only': self.link.key}) assert_not_in('Citation:', res) def test_no_warning_for_read_only_user_with_valid_link(self): link2 = PrivateLinkFactory(anonymous=False) link2.nodes.add(self.project) link2.save() self.project.add_contributor( self.user, permissions=permissions.READ, save=True, ) res = self.app.get(self.project_url, {'view_only': link2.key}, auth=self.user.auth) assert_not_in( 'is being viewed through a private, view-only link. ' 'Anyone with the link can view this project. Keep ' 'the link safe.', res.body ) def test_no_warning_for_read_only_user_with_invalid_link(self): self.project.add_contributor( self.user, permissions=permissions.READ, save=True, ) res = self.app.get(self.project_url, {'view_only': 'not_valid'}, auth=self.user.auth) assert_not_in( 'is being viewed through a private, view-only link. ' 'Anyone with the link can view this project. Keep ' 'the link safe.', res.body ) @pytest.mark.enable_bookmark_creation @pytest.mark.enable_quickfiles_creation class TestMergingAccounts(OsfTestCase): def setUp(self): super(TestMergingAccounts, self).setUp() self.user = UserFactory.build() self.user.fullname = "tess' test string" self.user.set_password('science') self.user.save() self.dupe = UserFactory.build() self.dupe.set_password('example') self.dupe.save() def test_merged_user_is_not_shown_as_a_contributor(self): project = ProjectFactory(is_public=True) # Both the master and dupe are contributors project.add_contributor(self.dupe, log=False) project.add_contributor(self.user, log=False) project.save() # At the project page, both are listed as contributors res = self.app.get(project.url).maybe_follow() assert_in_html(self.user.fullname, res) assert_in_html(self.dupe.fullname, res) # The accounts are merged self.user.merge_user(self.dupe) self.user.save() # Now only the master user is shown at the project page res = self.app.get(project.url).maybe_follow() assert_in_html(self.user.fullname, res) assert_true(self.dupe.is_merged) assert_not_in(self.dupe.fullname, res) def test_merged_user_has_alert_message_on_profile(self): # Master merges dupe self.user.merge_user(self.dupe) self.user.save() # At the dupe user's profile there is an alert message at the top # indicating that the user is merged res = self.app.get('/profile/{0}/'.format(self.dupe._primary_key)).maybe_follow() assert_in('This account has been merged', res) @pytest.mark.enable_bookmark_creation class TestShortUrls(OsfTestCase): def setUp(self): super(TestShortUrls, self).setUp() self.user = AuthUserFactory() self.auth = self.user.auth self.consolidate_auth = Auth(user=self.user) self.project = ProjectFactory(creator=self.user) # A non-project componenet self.component = NodeFactory(parent=self.project, category='hypothesis', creator=self.user) # Hack: Add some logs to component; should be unnecessary pending # improvements to factories from @rliebz self.component.set_privacy('public', auth=self.consolidate_auth) self.component.set_privacy('private', auth=self.consolidate_auth) self.wiki = WikiFactory( user=self.user, node=self.component, ) def _url_to_body(self, url): return self.app.get( url, auth=self.auth ).maybe_follow( auth=self.auth, ).normal_body def test_project_url(self): assert_equal( self._url_to_body(self.project.deep_url), self._url_to_body(self.project.url), ) def test_component_url(self): assert_equal( self._url_to_body(self.component.deep_url), self._url_to_body(self.component.url), ) def test_wiki_url(self): assert_equal( self._url_to_body(self.wiki.deep_url), self._url_to_body(self.wiki.url), ) @pytest.mark.enable_bookmark_creation @pytest.mark.enable_implicit_clean class TestClaiming(OsfTestCase): def setUp(self): super(TestClaiming, self).setUp() self.referrer = AuthUserFactory() self.project = ProjectFactory(creator=self.referrer, is_public=True) def test_correct_name_shows_in_contributor_list(self): name1, email = fake.name(), fake_email() UnregUserFactory(fullname=name1, email=email) name2, email = fake.name(), fake_email() # Added with different name self.project.add_unregistered_contributor(fullname=name2, email=email, auth=Auth(self.referrer)) self.project.save() res = self.app.get(self.project.url, auth=self.referrer.auth) # Correct name is shown assert_in_html(name2, res) assert_not_in(name1, res) def test_user_can_set_password_on_claim_page(self): name, email = fake.name(), fake_email() new_user = self.project.add_unregistered_contributor( email=email, fullname=name, auth=Auth(self.referrer) ) self.project.save() claim_url = new_user.get_claim_url(self.project._primary_key) res = self.app.get(claim_url) self.project.reload() assert_in('Set Password', res) form = res.forms['setPasswordForm'] #form['username'] = new_user.username #Removed as long as E-mail can't be updated. form['password'] = 'killerqueen' form['password2'] = 'killerqueen' res = form.submit().follow() new_user.reload() assert_true(new_user.check_password('killerqueen')) def test_sees_is_redirected_if_user_already_logged_in(self): name, email = fake.name(), fake_email() new_user = self.project.add_unregistered_contributor( email=email, fullname=name, auth=Auth(self.referrer) ) self.project.save() existing = AuthUserFactory() claim_url = new_user.get_claim_url(self.project._primary_key) # a user is already logged in res = self.app.get(claim_url, auth=existing.auth, expect_errors=True) assert_equal(res.status_code, 302) def test_unregistered_users_names_are_project_specific(self): name1, name2, email = fake.name(), fake.name(), fake_email() project2 = ProjectFactory(creator=self.referrer) # different projects use different names for the same unreg contributor self.project.add_unregistered_contributor( email=email, fullname=name1, auth=Auth(self.referrer) ) self.project.save() project2.add_unregistered_contributor( email=email, fullname=name2, auth=Auth(self.referrer) ) project2.save() self.app.authenticate(*self.referrer.auth) # Each project displays a different name in the contributor list res = self.app.get(self.project.url) assert_in_html(name1, res) res2 = self.app.get(project2.url) assert_in_html(name2, res2) @unittest.skip('as long as E-mails cannot be changed') def test_cannot_set_email_to_a_user_that_already_exists(self): reg_user = UserFactory() name, email = fake.name(), fake_email() new_user = self.project.add_unregistered_contributor( email=email, fullname=name, auth=Auth(self.referrer) ) self.project.save() # Goes to claim url and successfully claims account claim_url = new_user.get_claim_url(self.project._primary_key) res = self.app.get(claim_url) self.project.reload() assert_in('Set Password', res) form = res.forms['setPasswordForm'] # Fills out an email that is the username of another user form['username'] = reg_user.username form['password'] = 'killerqueen' form['password2'] = 'killerqueen' res = form.submit().maybe_follow(expect_errors=True) assert_in( language.ALREADY_REGISTERED.format(email=reg_user.username), res ) def test_correct_display_name_is_shown_at_claim_page(self): original_name = fake.name() unreg = UnregUserFactory(fullname=original_name) different_name = fake.name() new_user = self.project.add_unregistered_contributor( email=unreg.username, fullname=different_name, auth=Auth(self.referrer), ) self.project.save() claim_url = new_user.get_claim_url(self.project._primary_key) res = self.app.get(claim_url) # Correct name (different_name) should be on page assert_in_html(different_name, res) class TestConfirmingEmail(OsfTestCase): def setUp(self): super(TestConfirmingEmail, self).setUp() self.user = UnconfirmedUserFactory() self.confirmation_url = self.user.get_confirmation_url( self.user.username, external=False, ) self.confirmation_token = self.user.get_confirmation_token( self.user.username ) def test_cannot_remove_another_user_email(self): user1 = AuthUserFactory() user2 = AuthUserFactory() url = api_url_for('update_user') header = {'id': user1.username, 'emails': [{'address': user1.username}]} res = self.app.put_json(url, header, auth=user2.auth, expect_errors=True) assert_equal(res.status_code, 403) def test_cannnot_make_primary_email_for_another_user(self): user1 = AuthUserFactory() user2 = AuthUserFactory() email = 'test@cos.io' user1.emails.create(address=email) user1.save() url = api_url_for('update_user') header = {'id': user1.username, 'emails': [{'address': user1.username, 'primary': False, 'confirmed': True}, {'address': email, 'primary': True, 'confirmed': True} ]} res = self.app.put_json(url, header, auth=user2.auth, expect_errors=True) assert_equal(res.status_code, 403) def test_cannnot_add_email_for_another_user(self): user1 = AuthUserFactory() user2 = AuthUserFactory() email = 'test@cos.io' url = api_url_for('update_user') header = {'id': user1.username, 'emails': [{'address': user1.username, 'primary': True, 'confirmed': True}, {'address': email, 'primary': False, 'confirmed': False} ]} res = self.app.put_json(url, header, auth=user2.auth, expect_errors=True) assert_equal(res.status_code, 403) def test_error_page_if_confirm_link_is_used(self): self.user.confirm_email(self.confirmation_token) self.user.save() res = self.app.get(self.confirmation_url, expect_errors=True) assert_in(auth_exc.InvalidTokenError.message_short, res) assert_equal(res.status_code, http.BAD_REQUEST) @pytest.mark.enable_implicit_clean @pytest.mark.enable_bookmark_creation class TestClaimingAsARegisteredUser(OsfTestCase): def setUp(self): super(TestClaimingAsARegisteredUser, self).setUp() self.referrer = AuthUserFactory() self.project = ProjectFactory(creator=self.referrer, is_public=True) name, email = fake.name(), fake_email() self.user = self.project.add_unregistered_contributor( fullname=name, email=email, auth=Auth(user=self.referrer) ) self.project.save() def test_claim_user_registered_with_correct_password(self): reg_user = AuthUserFactory() # NOTE: AuthUserFactory sets password as 'queenfan86' url = self.user.get_claim_url(self.project._primary_key) # Follow to password re-enter page res = self.app.get(url, auth=reg_user.auth).follow(auth=reg_user.auth) # verify that the "Claim Account" form is returned assert_in('Claim Contributor', res.body) form = res.forms['claimContributorForm'] form['password'] = 'queenfan86' res = form.submit(auth=reg_user.auth) res = res.follow(auth=reg_user.auth) self.project.reload() self.user.reload() # user is now a contributor to the project assert_in(reg_user, self.project.contributors) # the unregistered user (self.user) is removed as a contributor, and their assert_not_in(self.user, self.project.contributors) # unclaimed record for the project has been deleted assert_not_in(self.project, self.user.unclaimed_records) def test_claim_user_registered_preprint_with_correct_password(self): preprint = PreprintFactory(creator=self.referrer) name, email = fake.name(), fake_email() unreg_user = preprint.add_unregistered_contributor( fullname=name, email=email, auth=Auth(user=self.referrer) ) reg_user = AuthUserFactory() # NOTE: AuthUserFactory sets password as 'queenfan86' url = unreg_user.get_claim_url(preprint._id) # Follow to password re-enter page res = self.app.get(url, auth=reg_user.auth).follow(auth=reg_user.auth) # verify that the "Claim Account" form is returned assert_in('Claim Contributor', res.body) form = res.forms['claimContributorForm'] form['password'] = 'queenfan86' res = form.submit(auth=reg_user.auth) preprint.reload() unreg_user.reload() # user is now a contributor to the project assert_in(reg_user, preprint.contributors) # the unregistered user (unreg_user) is removed as a contributor, and their assert_not_in(unreg_user, preprint.contributors) # unclaimed record for the project has been deleted assert_not_in(preprint, unreg_user.unclaimed_records) class TestResendConfirmation(OsfTestCase): def setUp(self): super(TestResendConfirmation, self).setUp() self.unconfirmed_user = UnconfirmedUserFactory() self.confirmed_user = UserFactory() self.get_url = web_url_for('resend_confirmation_get') self.post_url = web_url_for('resend_confirmation_post') # test that resend confirmation page is load correctly def test_resend_confirmation_get(self): res = self.app.get(self.get_url) assert_equal(res.status_code, 200) assert_in('Resend Confirmation', res.body) assert_in('resendForm', res.forms) # test that unconfirmed user can receive resend confirmation email @mock.patch('framework.auth.views.mails.send_mail') def test_can_receive_resend_confirmation_email(self, mock_send_mail): # load resend confirmation page and submit email res = self.app.get(self.get_url) form = res.forms['resendForm'] form['email'] = self.unconfirmed_user.unconfirmed_emails[0] res = form.submit() # check email, request and response assert_true(mock_send_mail.called) assert_equal(res.status_code, 200) assert_equal(res.request.path, self.post_url) assert_in_html('If there is an OSF account', res) # test that confirmed user cannot receive resend confirmation email @mock.patch('framework.auth.views.mails.send_mail') def test_cannot_receive_resend_confirmation_email_1(self, mock_send_mail): # load resend confirmation page and submit email res = self.app.get(self.get_url) form = res.forms['resendForm'] form['email'] = self.confirmed_user.emails.first().address res = form.submit() # check email, request and response assert_false(mock_send_mail.called) assert_equal(res.status_code, 200) assert_equal(res.request.path, self.post_url) assert_in_html('has already been confirmed', res) # test that non-existing user cannot receive resend confirmation email @mock.patch('framework.auth.views.mails.send_mail') def test_cannot_receive_resend_confirmation_email_2(self, mock_send_mail): # load resend confirmation page and submit email res = self.app.get(self.get_url) form = res.forms['resendForm'] form['email'] = 'random@random.com' res = form.submit() # check email, request and response assert_false(mock_send_mail.called) assert_equal(res.status_code, 200) assert_equal(res.request.path, self.post_url) assert_in_html('If there is an OSF account', res) # test that user cannot submit resend confirmation request too quickly @mock.patch('framework.auth.views.mails.send_mail') def test_cannot_resend_confirmation_twice_quickly(self, mock_send_mail): # load resend confirmation page and submit email res = self.app.get(self.get_url) form = res.forms['resendForm'] form['email'] = self.unconfirmed_user.email res = form.submit() res = form.submit() # check request and response assert_equal(res.status_code, 200) assert_in_html('Please wait', res) class TestForgotPassword(OsfTestCase): def setUp(self): super(TestForgotPassword, self).setUp() self.user = UserFactory() self.auth_user = AuthUserFactory() self.get_url = web_url_for('forgot_password_get') self.post_url = web_url_for('forgot_password_post') self.user.verification_key_v2 = {} self.user.save() # log users out before they land on forgot password page def test_forgot_password_logs_out_user(self): # visit forgot password link while another user is logged in res = self.app.get(self.get_url, auth=self.auth_user.auth) # check redirection to CAS logout assert_equal(res.status_code, 302) location = res.headers.get('Location') assert_not_in('reauth', location) assert_in('logout?service=', location) assert_in('forgotpassword', location) # test that forgot password page is loaded correctly def test_get_forgot_password(self): res = self.app.get(self.get_url) assert_equal(res.status_code, 200) assert_in('Forgot Password', res.body) assert_in('forgotPasswordForm', res.forms) # test that existing user can receive reset password email @mock.patch('framework.auth.views.mails.send_mail') def test_can_receive_reset_password_email(self, mock_send_mail): # load forgot password page and submit email res = self.app.get(self.get_url) form = res.forms['forgotPasswordForm'] form['forgot_password-email'] = self.user.username res = form.submit() # check mail was sent assert_true(mock_send_mail.called) # check http 200 response assert_equal(res.status_code, 200) # check request URL is /forgotpassword assert_equal(res.request.path, self.post_url) # check push notification assert_in_html('If there is an OSF account', res) assert_not_in_html('Please wait', res) # check verification_key_v2 is set self.user.reload() assert_not_equal(self.user.verification_key_v2, {}) # test that non-existing user cannot receive reset password email @mock.patch('framework.auth.views.mails.send_mail') def test_cannot_receive_reset_password_email(self, mock_send_mail): # load forgot password page and submit email res = self.app.get(self.get_url) form = res.forms['forgotPasswordForm'] form['forgot_password-email'] = 'fake' + self.user.username res = form.submit() # check mail was not sent assert_false(mock_send_mail.called) # check http 200 response assert_equal(res.status_code, 200) # check request URL is /forgotpassword assert_equal(res.request.path, self.post_url) # check push notification assert_in_html('If there is an OSF account', res) assert_not_in_html('Please wait', res) # check verification_key_v2 is not set self.user.reload() assert_equal(self.user.verification_key_v2, {}) # test that non-existing user cannot receive reset password email @mock.patch('framework.auth.views.mails.send_mail') def test_not_active_user_no_reset_password_email(self, mock_send_mail): self.user.disable_account() self.user.save() # load forgot password page and submit email res = self.app.get(self.get_url) form = res.forms['forgotPasswordForm'] form['forgot_password-email'] = self.user.username res = form.submit() # check mail was not sent assert_false(mock_send_mail.called) # check http 200 response assert_equal(res.status_code, 200) # check request URL is /forgotpassword assert_equal(res.request.path, self.post_url) # check push notification assert_in_html('If there is an OSF account', res) assert_not_in_html('Please wait', res) # check verification_key_v2 is not set self.user.reload() assert_equal(self.user.verification_key_v2, {}) # test that user cannot submit forgot password request too quickly @mock.patch('framework.auth.views.mails.send_mail') def test_cannot_reset_password_twice_quickly(self, mock_send_mail): # load forgot password page and submit email res = self.app.get(self.get_url) form = res.forms['forgotPasswordForm'] form['forgot_password-email'] = self.user.username res = form.submit() res = form.submit() # check http 200 response assert_equal(res.status_code, 200) # check push notification assert_in_html('Please wait', res) assert_not_in_html('If there is an OSF account', res) @unittest.skip('Public projects/components are dynamically loaded now.') class TestAUserProfile(OsfTestCase): def setUp(self): OsfTestCase.setUp(self) self.user = AuthUserFactory() self.me = AuthUserFactory() self.project = ProjectFactory(creator=self.me, is_public=True, title=fake.bs()) self.component = NodeFactory(creator=self.me, parent=self.project, is_public=True, title=fake.bs()) # regression test for https://github.com/CenterForOpenScience/osf.io/issues/2623 def test_has_public_projects_and_components(self): # I go to my own profile url = web_url_for('profile_view_id', uid=self.me._primary_key) # I see the title of both my project and component res = self.app.get(url, auth=self.me.auth) assert_in_html(self.component.title, res) assert_in_html(self.project.title, res) # Another user can also see my public project and component url = web_url_for('profile_view_id', uid=self.me._primary_key) # I see the title of both my project and component res = self.app.get(url, auth=self.user.auth) assert_in_html(self.component.title, res) assert_in_html(self.project.title, res) def test_shows_projects_with_many_contributors(self): # My project has many contributors for _ in range(5): user = UserFactory() self.project.add_contributor(user, auth=Auth(self.project.creator), save=True) # I go to my own profile url = web_url_for('profile_view_id', uid=self.me._primary_key) res = self.app.get(url, auth=self.me.auth) # I see '3 more' as a link assert_in('3 more', res) res = res.click('3 more') assert_equal(res.request.path, self.project.url) def test_has_no_public_projects_or_components_on_own_profile(self): # User goes to their profile url = web_url_for('profile_view_id', uid=self.user._id) res = self.app.get(url, auth=self.user.auth) # user has no public components/projects assert_in('You have no public projects', res) assert_in('You have no public components', res) def test_user_no_public_projects_or_components(self): # I go to other user's profile url = web_url_for('profile_view_id', uid=self.user._id) # User has no public components/projects res = self.app.get(url, auth=self.me.auth) assert_in('This user has no public projects', res) assert_in('This user has no public components', res) # regression test def test_does_not_show_registrations(self): project = ProjectFactory(creator=self.user) component = NodeFactory(parent=project, creator=self.user, is_public=False) # User has a registration with public components reg = RegistrationFactory(project=component.parent_node, creator=self.user, is_public=True) for each in reg.nodes: each.is_public = True each.save() # I go to other user's profile url = web_url_for('profile_view_id', uid=self.user._id) # Registration does not appear on profile res = self.app.get(url, auth=self.me.auth) assert_in('This user has no public components', res) assert_not_in(reg.title, res) assert_not_in(reg.nodes[0].title, res) @pytest.mark.enable_bookmark_creation class TestPreprintBannerView(OsfTestCase): def setUp(self): super(TestPreprintBannerView, self).setUp() self.admin = AuthUserFactory() self.write_contrib = AuthUserFactory() self.read_contrib = AuthUserFactory() self.non_contrib = AuthUserFactory() self.provider_one = PreprintProviderFactory() self.project_one = ProjectFactory(creator=self.admin, is_public=True) self.project_one.add_contributor(self.write_contrib, permissions.WRITE) self.project_one.add_contributor(self.read_contrib, permissions.READ) self.subject_one = SubjectFactory() self.preprint = PreprintFactory(creator=self.admin, filename='mgla.pdf', provider=self.provider_one, subjects=[[self.subject_one._id]], project=self.project_one, is_published=True) self.preprint.add_contributor(self.write_contrib, permissions.WRITE) self.preprint.add_contributor(self.read_contrib, permissions.READ) def test_public_project_published_preprint(self): url = self.project_one.web_url_for('view_project') # Admin - preprint res = self.app.get(url, auth=self.admin.auth) assert_in('Has supplemental materials for', res.body) # Write - preprint res = self.app.get(url, auth=self.write_contrib.auth) assert_in('Has supplemental materials for', res.body) # Read - preprint res = self.app.get(url, auth=self.read_contrib.auth) assert_in('Has supplemental materials for', res.body) # Noncontrib - preprint res = self.app.get(url, auth=self.non_contrib.auth) assert_in('Has supplemental materials for', res.body) # Unauthenticated - preprint res = self.app.get(url) assert_in('Has supplemental materials for', res.body) def test_public_project_abandoned_preprint(self): self.preprint.machine_state = 'initial' self.preprint.save() url = self.project_one.web_url_for('view_project') # Admin - preprint res = self.app.get(url, auth=self.admin.auth) assert_not_in('Has supplemental materials for', res.body) # Write - preprint res = self.app.get(url, auth=self.write_contrib.auth) assert_not_in('Has supplemental materials for', res.body) # Read - preprint res = self.app.get(url, auth=self.read_contrib.auth) assert_not_in('Has supplemental materials for', res.body) # Noncontrib - preprint res = self.app.get(url, auth=self.non_contrib.auth) assert_not_in('Has supplemental materials for', res.body) # Unauthenticated - preprint res = self.app.get(url) assert_not_in('Has supplemental materials for', res.body) def test_public_project_deleted_preprint(self): self.preprint.deleted = timezone.now() self.preprint.save() url = self.project_one.web_url_for('view_project') # Admin - preprint res = self.app.get(url, auth=self.admin.auth) assert_not_in('Has supplemental materials for', res.body) # Write - preprint res = self.app.get(url, auth=self.write_contrib.auth) assert_not_in('Has supplemental materials for', res.body) # Read - preprint res = self.app.get(url, auth=self.read_contrib.auth) assert_not_in('Has supplemental materials for', res.body) # Noncontrib - preprint res = self.app.get(url, auth=self.non_contrib.auth) assert_not_in('Has supplemental materials for', res.body) # Unauthenticated - preprint res = self.app.get(url) assert_not_in('Has supplemental materials for', res.body) def test_public_project_private_preprint(self): self.preprint.is_public = False self.preprint.save() url = self.project_one.web_url_for('view_project') # Admin - preprint res = self.app.get(url, auth=self.admin.auth) assert_in('Has supplemental materials for', res.body) # Write - preprint res = self.app.get(url, auth=self.write_contrib.auth) assert_in('Has supplemental materials for', res.body) # Read - preprint res = self.app.get(url, auth=self.read_contrib.auth) assert_in('Has supplemental materials for', res.body) # Noncontrib - preprint res = self.app.get(url, auth=self.non_contrib.auth) assert_not_in('Has supplemental materials for', res.body) # Unauthenticated - preprint res = self.app.get(url) assert_not_in('Has supplemental materials for', res.body) def test_public_project_orphaned_preprint(self): self.preprint.primary_file = None self.preprint.save() url = self.project_one.web_url_for('view_project') # Admin - preprint res = self.app.get(url, auth=self.admin.auth) assert_in('Has supplemental materials for', res.body) # Write - preprint res = self.app.get(url, auth=self.write_contrib.auth) assert_in('Has supplemental materials for', res.body) # Read - preprint res = self.app.get(url, auth=self.read_contrib.auth) assert_in('Has supplemental materials for', res.body) # Noncontrib - preprint res = self.app.get(url, auth=self.non_contrib.auth) assert_not_in('Has supplemental materials for', res.body) # Unauthenticated - preprint res = self.app.get(url) assert_not_in('Has supplemental materials for', res.body) def test_public_project_unpublished_preprint(self): self.preprint.is_published = False self.preprint.save() url = self.project_one.web_url_for('view_project') # Admin - preprint res = self.app.get(url, auth=self.admin.auth) assert_in('Has supplemental materials for', res.body) # Write - preprint res = self.app.get(url, auth=self.write_contrib.auth) assert_in('Has supplemental materials for', res.body) # Read - preprint res = self.app.get(url, auth=self.read_contrib.auth) assert_in('Has supplemental materials for', res.body) # Noncontrib - preprint res = self.app.get(url, auth=self.non_contrib.auth) assert_not_in('Has supplemental materials for', res.body) # Unauthenticated - preprint res = self.app.get(url) assert_not_in('Has supplemental materials for', res.body) def test_public_project_pending_preprint_post_moderation(self): self.preprint.machine_state = 'pending' provider = PreprintProviderFactory(reviews_workflow='post-moderation') self.preprint.provider = provider self.preprint.save() url = self.project_one.web_url_for('view_project') # Admin - preprint res = self.app.get(url, auth=self.admin.auth) assert_in('{}'.format(self.preprint.provider.name), res.body) assert_in('Pending\n', res.body) assert_in('This preprint is publicly available and searchable but is subject to removal by a moderator.', res.body) # Write - preprint res = self.app.get(url, auth=self.write_contrib.auth) assert_in('{}'.format(self.preprint.provider.name), res.body) assert_in('Pending\n', res.body) assert_in('This preprint is publicly available and searchable but is subject to removal by a moderator.', res.body) # Read - preprint res = self.app.get(url, auth=self.read_contrib.auth) assert_in('{}'.format(self.preprint.provider.name), res.body) assert_in('Pending\n', res.body) assert_in('This preprint is publicly available and searchable but is subject to removal by a moderator.', res.body) # Noncontrib - preprint res = self.app.get(url, auth=self.non_contrib.auth) assert_in('on {}'.format(self.preprint.provider.name), res.body) assert_not_in('Pending\n', res.body) assert_not_in('This preprint is publicly available and searchable but is subject to removal by a moderator.', res.body) # Unauthenticated - preprint res = self.app.get(url) assert_in('on {}'.format(self.preprint.provider.name), res.body) assert_not_in('Pending\n', res.body) assert_not_in('This preprint is publicly available and searchable but is subject to removal by a moderator.', res.body) def test_implicit_admins_can_see_project_status(self): project = ProjectFactory(creator=self.admin) component = NodeFactory(creator=self.admin, parent=project) project.add_contributor(self.write_contrib, permissions.ADMIN) project.save() preprint = PreprintFactory(creator=self.admin, filename='mgla.pdf', provider=self.provider_one, subjects=[[self.subject_one._id]], project=component, is_published=True) preprint.machine_state = 'pending' provider = PreprintProviderFactory(reviews_workflow='post-moderation') preprint.provider = provider preprint.save() url = component.web_url_for('view_project') res = self.app.get(url, auth=self.write_contrib.auth) assert_in('{}'.format(preprint.provider.name), res.body) assert_in('Pending\n', res.body) assert_in('This preprint is publicly available and searchable but is subject to removal by a moderator.', res.body) def test_public_project_pending_preprint_pre_moderation(self): self.preprint.machine_state = 'pending' provider = PreprintProviderFactory(reviews_workflow='pre-moderation') self.preprint.provider = provider self.preprint.save() url = self.project_one.web_url_for('view_project') # Admin - preprint res = self.app.get(url, auth=self.admin.auth) assert_in('{}'.format(self.preprint.provider.name), res.body) assert_in('Pending\n', res.body) assert_in('This preprint is not publicly available or searchable until approved by a moderator.', res.body) # Write - preprint res = self.app.get(url, auth=self.write_contrib.auth) assert_in('{}'.format(self.preprint.provider.name), res.body) assert_in('Pending\n', res.body) assert_in('This preprint is not publicly available or searchable until approved by a moderator.', res.body) # Read - preprint res = self.app.get(url, auth=self.read_contrib.auth) assert_in('{}'.format(self.preprint.provider.name), res.body) assert_in('Pending\n', res.body) assert_in('This preprint is not publicly available or searchable until approved by a moderator.', res.body) # Noncontrib - preprint res = self.app.get(url, auth=self.non_contrib.auth) assert_in('{}'.format(self.preprint.provider.name), res.body) assert_not_in('Pending\n', res.body) assert_not_in('This preprint is not publicly available or searchable until approved by a moderator.', res.body) # Unauthenticated - preprint res = self.app.get(url) assert_in('{}'.format(self.preprint.provider.name), res.body) assert_not_in('Pending\n', res.body) assert_not_in('This preprint is not publicly available or searchable until approved by a moderator.', res.body) if __name__ == '__main__': unittest.main()
mattclark/osf.io
tests/test_webtests.py
Python
apache-2.0
50,803
[ "VisIt" ]
7d155725e2c4794bd341eccca7d1c8b4fb0e9b35aab0e4578319745ea25509da
# This file is part of Copernicus # http://www.copernicus-computing.org/ # # Copyright (C) 2011, Sander Pronk, Iman Pouya, Erik Lindahl, and others. # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License version 2 as published # by the Free Software Foundation # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License along # with this program; if not, write to the Free Software Foundation, Inc., # 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA. import sys import os import re import os.path import shutil import shlex import glob import stat import subprocess import logging import time log=logging.getLogger(__name__) from cpc.dataflow import Value from cpc.dataflow import FileValue from cpc.dataflow import IntValue from cpc.dataflow import FloatValue from cpc.dataflow import StringValue from cpc.dataflow import Resources import cpc.command import cpc.util import cpc.lib.gromacs.tune as tune import cpc.lib.gromacs.iterate as iterate from cpc.lib.gromacs import cmds from cpc.lib.gromacs.mdrun import extractConf, TrajFileCollection, MdrunError class PLUMEDError(cpc.util.CpcError): pass def checkErr(stde, rsrc, tpr, persDir): """Check whether an error condition is recoverable. Returns True if there is an issue, False if the error is recoverable""" if not os.path.exists(stde): # we assume it's a worker error return False inf=open(stde, 'r') fatalErr=False OK=True for line in inf: if re.match(r'.*Fatal error.*', line): fatalErr=True log.debug("Found fatal error") OK=False if re.match(r'.*PLUMED ERROR.*', line): fatalErr=True log.debug("Found a PLUMED error.") OK=False if fatalErr: if re.match(r'.*domain decomposition.*', line): # the number of cores is wrong log.debug("Found domain decomp error") confFile=os.path.join(persDir, 'conf.gro') extractConf(tpr, confFile) tune.tune(rsrc, confFile, tpr, persDir, rsrc.max.get('cores')-1) OK=True break inf.close() return not OK def extractData(confout, outDir, persDir, fo): """Concatenate all output data from the partial runs into the end results""" cmdnames = cmds.GromacsCommands() #outputs=dict() # Concatenate stuff confoutPath=os.path.join(outDir, "confout.gro") shutil.copy(confout[0], confoutPath ) #outputs['conf'] = Value(confoutPath, # inp.function.getOutput('conf').getType()) fo.setOut('conf', FileValue(confoutPath)) # fix the xtc files xtcso = sorted(glob.glob(os.path.join(persDir, "run_???", "traj.part*.xtc"))) # cull empty files and duplicate trajectory names xtcs=[] xtcbase=[] for file in xtcso: st=os.stat(file) base=os.path.split(file)[1] if st.st_size>0: if base not in xtcbase: xtcs.append(file) xtcbase.append(base) else: # there already was a file with this name. Overwrite # it because mdrun wasn't aware of it when writing. ind=xtcbase.index(base) xtcs[ind]=file # concatenate them xtcoutname=os.path.join(outDir, "traj.xtc") if len(xtcs) > 0: cmd = cmdnames.trjcat.split() + ["-f"] cmd.extend(xtcs) cmd.extend(["-o", xtcoutname]) stdo=open(os.path.join(persDir,"trjcat_xtc.out"),"w") sp=subprocess.Popen(cmd, stdout=stdo, stderr=subprocess.STDOUT) sp.communicate(None) stdo.close() fo.setOut('xtc', FileValue(xtcoutname)) # do the trrs trrso = sorted(glob.glob(os.path.join(persDir, "run_???", "traj.part*.trr"))) # cull empty files and duplicate trajectory names trrs=[] trrbase=[] for file in trrso: st=os.stat(file) base=os.path.split(file)[1] if st.st_size>0: if base not in trrbase: trrs.append(file) trrbase.append(base) else: # there already was a file with this name. Overwrite # it because mdrun wasn't aware of it when writing. ind=trrbase.index(base) trrs[ind]=file # concatenate them trroutname=os.path.join(outDir, "traj.trr") if len(trrs) > 0: cmd = cmdnames.trjcat + ["-f"] cmd.extend(trrs) cmd.extend(["-o", trroutname]) stdo=open(os.path.join(persDir,"trjcat_trr.out"),"w") sp=subprocess.Popen(cmd, stdout=stdo, stderr=subprocess.STDOUT) sp.communicate(None) stdo.close() fo.setOut('trr', FileValue(trroutname)) # and the edrs edrso = glob.glob(os.path.join(persDir, "run_???", "ener.part*.edr")) # cull empty files and duplicate trajectory names edrs=[] edrbase=[] for file in edrso: st=os.stat(file) base=os.path.split(file)[1] if st.st_size>0: if base not in edrbase: edrs.append(file) edrbase.append(base) else: # there already was a file with this name. Overwrite # it because mdrun wasn't aware of it when writing. ind=edrbase.index(base) edrs[ind]=file edroutname=os.path.join(outDir, "ener.edr") # concatenate them if len(edrs) > 0: cmd = cmdnames.eneconv.split() + ["-f"] cmd.extend(edrs) cmd.extend(["-o", edroutname]) stdo=open(os.path.join(persDir,"eneconv.out"),"w") sp=subprocess.Popen(cmd, stdout=stdo, stderr=subprocess.STDOUT) sp.communicate(None) stdo.close() fo.setOut('edr', FileValue(edroutname)) # do the stdout stdouto = glob.glob(os.path.join(persDir, "run_???", "stdout")) stdoutname=os.path.join(outDir, "stdout") outf=open(stdoutname,"w") for infile in stdouto: inf=open(infile, "r") outf.write(inf.read()) inf.close() outf.write("%s\n"%time.strftime("%a, %d %b %Y %H:%M:%S")) outf.write("%f\n"%time.time()) outf.close() #outputs['stdout'] = Value(stdoutname, # inp.function.getOutput('trr').getType()) fo.setOut('stdout', FileValue(stdoutname)) # do the stderr stderro = glob.glob(os.path.join(persDir, "run_???", "stderr")) stderrname=os.path.join(outDir, "stderr") outf=open(stderrname,"w") for infile in stderro: inf=open(infile, "r") outf.write(inf.read()) inf.close() outf.close() fo.setOut('stderr', FileValue(stderrname)) log.debug("Returning without command.") log.debug("fo.cmds=%s"%str(fo.cmds)) # do the COLVAR file colvaro = glob.glob(os.path.join(persDir, "run_???", "COLVAR")) colvarname=os.path.join(outDir, "COLVAR") outf=open(colvarname,'w') for cvfile in colvaro: inf=open(cvfile,'r') outf.write(inf.read()) inf.close() outf.close() fo.setOut('COLVAR',FileValue(colvarname)) # take the last HILLS file and the bias.dat file hillso = glob.glob(os.path.join(persDir, "run_???", "HILLS")) if len(hillso)>0: hillsname = os.path.join(outDir, "HILLS") outf = open(hillsname,'w') inf = open(hillso[-1],'r') outf.write(inf.read()) inf.close() log.debug("Set the HILLS outfile") fo.setOut('HILLS',FileValue(hillsname)) biaso = glob.glob(os.path.join(persDir, "run_???", "bias.dat")) if len(biaso)>0: biasname = os.path.join(outDir, "bias.dat") outf = open(biasname,'w') inf = open(biaso[-1],'r') outf.write(inf.read()) inf.close() fo.setOut('bias',FileValue(biasname)) def mdrun(inp): if inp.testing(): # if there are no inputs, we're testing wheter the command can run cpc.util.plugin.testCommand("trjcat -version") cpc.util.plugin.testCommand("eneconv -version") cpc.util.plugin.testCommand("gmxdump -version") return persDir=inp.getPersistentDir() outDir=inp.getOutputDir() fo=inp.getFunctionOutput() rsrc=Resources(inp.getInputValue("resources")) rsrcFilename=os.path.join(persDir, 'rsrc.dat') # check whether we need to reinit pers=cpc.dataflow.Persistence(os.path.join(inp.getPersistentDir(), "persistent.dat")) init=False lasttpr=pers.get('lasttpr') newtpr=inp.getInput('tpr') #if inp.getInputValue('tpr').isUpdated(): if newtpr!= lasttpr: lasttpr=newtpr # there was no previous command. # purge the persistent directory, by moving the confout files to a # backup directory log.debug("(Re)initializing mdrun") confout=glob.glob(os.path.join(persDir, "run_???")) if len(confout)>0: backupDir=os.path.join(persDir, "backup") try: os.mkdir(backupDir) except: pass for conf in confout: try: os.rename(conf, os.path.join(backupDir, os.path.split(conf)[-1])) except: pass init=True pers.set('lasttpr', lasttpr) elif inp.cmd is None: return fo if init: if rsrc.max.get('cores') is None: confFile=os.path.join(persDir, 'conf.gro') extractConf(newtpr, confFile) tune.tune(rsrc, confFile, newtpr, persDir) if inp.cmd is not None: log.debug("Canceling commands") fo.cancelPrevCommands() pers.set('initialized', True) else: if rsrc.max.get('cores') is None: rsrc.load(rsrcFilename) if inp.cmd is not None: log.debug("Return code was %s"%str(inp.cmd.getReturncode())) # try to find out whether the run has already finished confout=glob.glob(os.path.join(persDir, "run_???", "confout.part*.gro")) if len(confout) > 0: log.debug("Extracting data. ") # confout exists. we're finished. Concatenate all the runs if # we need to, but first create the output dict extractData(confout, outDir, persDir, fo) return fo else: tfc=TrajFileCollection(persDir) # first check whether we got an error code back if (inp.cmd is not None) and inp.cmd.getReturncode()!=0: # there was a problem. Check the log stde=os.path.join(tfc.getLastDir(), "stderr") if checkErr(stde, rsrc, newtpr, persDir): if os.path.exists(stde): stdef=open(stde, 'r') errmsg=unicode(stdef.read(), errors='ignore') stdef.close() raise MdrunError("Error running mdrun: %s"%errmsg) else: # now check whether any of the last 4 iterations produced # trajectories trajlist=tfc.getTrajList() if len(trajlist) > 4: ret=False for j in range(4): haveTraj=(len(trajlist[-j-1]) > 0) ret=ret or haveTraj #prevtraj[-j-1] if not ret: stde=os.path.join(tfc.getLastDir(), "stderr") if os.path.exists(stde): stdef=open(stde, 'r') errmsg=unicode(stdef.read(), errors='ignore') stdef.close() else: errmsg="" raise MdrunError("Error running mdrun. No trajectories: %s"% errmsg) # Make a new directory with the continuation of this run #newdirname=currundir #"run_%03d"%(i+1) newdirname=tfc.getNewRunDir() try: os.mkdir(newdirname) except OSError: pass tpr=newtpr src=os.path.join(inp.getBaseDir(), tpr) dst=os.path.join(newdirname,"topol.tpr") shutil.copy(src,dst) # handle command line inputs if inp.getInput('cmdline_options') is not None: cmdlineOpts=shlex.split(inp.getInput('cmdline_options')) else: cmdlineOpts=[] if inp.getInput('priority') is not None: prio=inp.getInput('priority') else: prio=0 lastcpt=tfc.getLastCpt() # copy the checkpoint to the new cmd dir if lastcpt is not None: shutil.copy(lastcpt, os.path.join(newdirname,"state.cpt")) # now add to the priority if this run has already been started completed=tfc.getFractionCompleted(tpr) if completed > 0: # now the priority ranges from 1 to 4, depending on how # far along the simulation is. prio += 1+int(3*(completed)) log.debug("Setting new priority to %d because it's in progress"% prio) # we can always add state.cpt, even if it doesn't exist. # include the plumed file here args=["-quiet", "-s", "topol.tpr", "-noappend", "-cpi", "state.cpt", "-rcon", "0.7", "-plumed", "plumed.dat" ] args.extend(cmdlineOpts) # for the new neighbor search scheme in Gromacs 4.6, set this env # variable if lastcpt is not None: shutil.copy(lastcpt, os.path.join(newdirname,"state.cpt")) # any expected output files. newFileNr=tfc.getLastTrajNr()+1 outputFiles=[ "traj.part%04d.xtc"%newFileNr, "traj.part%04d.trr"%newFileNr, "confout.part%04d.gro"%newFileNr, "ener.part%04d.edr"%newFileNr, "dhdl.part%04d.xvg"%newFileNr, "pullx.part%04d.xvg"%newFileNr, "pullf.part%04d.xvg"%newFileNr, "COLVAR", "HILLS", "bias.dat", "state.cpt", "state_prev.cpt" ] log.debug("Expected output files: %s"%outputFiles) cmd=cpc.command.Command(newdirname, "plumed/mdrun",args, minVersion=cpc.command.Version("4.5"), addPriority=prio, outputFiles=outputFiles) if inp.hasInput("resources") and inp.getInput("resources") is not None: #log.debug("resources is %s"%(inp.getInput("resources"))) #rsrc=Resources(inp.getInputValue("resources")) rsrc.updateCmd(cmd) log.debug("Adding command") # copy the plumed file to the run dir plumed_inp=inp.getInput("plumed") log.debug("Adding the PLUMED file: %s"%plumed_inp) src=os.path.join(inp.getBaseDir(),plumed_inp) dst=os.path.join(newdirname,"plumed.dat") # check if we need to restart metadynamics if tfc.lastDir is not None: lasthills=os.path.join(tfc.lastDir,"HILLS") if os.path.isfile(lasthills): plumed_dat=open(plumed_inp,'r').read() log.debug("Adding a RESTART statement to the PLUMED file.") newplumed=re.sub(r"HILLS","HILLS RESTART",plumed_dat) open(dst,"w").write(newplumed) newhills=os.path.join(newdirname,"HILLS") shutil.copy(lasthills,newhills) else: shutil.copy(src,dst) else: shutil.copy(src,dst) fo.addCommand(cmd) if inp.getInputValue('tpr').isUpdated() and inp.cmd is not None: log.debug("Canceling commands") fo.cancelPrevCommands() # and save for further invocations rsrc.save(rsrcFilename) pers.write() return fo def grompp_mdruns(inp): if inp.testing(): # if there are no inputs, we're testing wheter the command can run cpc.util.plugin.testCommand("grompp -version") return pers=cpc.dataflow.Persistence(os.path.join(inp.getPersistentDir(), "persistent.dat")) grompp_inputs = ['mdp','top','conf', 'ndx', 'settings', 'include' ] mdrun_inputs = [ 'priority', 'cmdline_options', 'resources', 'plumed'] inputs = grompp_inputs + mdrun_inputs grompp_outputs = [ 'tpr' ] mdrun_outputs = [ 'conf', 'xtc', 'trr', 'edr','COLVAR','HILLS','bias' ] outputs = grompp_outputs + mdrun_outputs running=0 if(pers.get("running")): running=pers.get("running") it=iterate.iterations(inp, inputs, outputs, pers) out=inp.getFunctionOutput() for i in range(running, it.getN()): gromppInstName="grompp_%d"%i mdrunInstName="mdrun_%d"%i try: out.addInstance(gromppInstName, "gromacs::grompp") except: log.debug("Error: You must import the gromacs module to use this function.") out.addInstance(mdrunInstName, "mdrun") out.addConnection('%s:out.tpr'%gromppInstName, '%s:in.tpr'%mdrunInstName) it.connectOnly(grompp_inputs, grompp_outputs, out, i, gromppInstName) it.connectOnly(mdrun_inputs, mdrun_outputs, out, i, mdrunInstName) running+=1 pers.set("running", running) pers.write() return out def mdruns(inp): if inp.testing(): # if there are no inputs, we're testing wheter the command can run cpc.util.plugin.testCommand("trjcat -version") cpc.util.plugin.testCommand("eneconv -version") cpc.util.plugin.testCommand("gmxdump -version") return pers=cpc.dataflow.Persistence(os.path.join(inp.getPersistentDir(), "persistent.dat")) inputs = ['tpr','priority','cmdline_options','resources','plumed'] outputs = [ 'conf', 'xtc', 'trr', 'edr','COLVAR', 'HILLS', 'bias'] running=0 if(pers.get("running")): running=pers.get("running") it=iterate.iterations(inp, inputs, outputs, pers) out=inp.getFunctionOutput() for i in range(running, it.getN()): instName="mdrun_%d"%i out.addInstance(instName, "mdrun") it.connect(out, i, instName) running+=1 pers.set("running", running) pers.write() return out
gromacs/copernicus
cpc/lib/plumed/mdrun.py
Python
gpl-2.0
18,804
[ "Gromacs" ]
34d28845c51b8a3d199f79621ba9c66c986e28a65ff7fab21621dd377f457251
# This file is part of RMANAGER. # # RMANAGER is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # any later version. # # RMANAGER is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with RMANAGER. If not, see <http://www.gnu.org/licenses/>. ########################################################################################################### # # # RMANAGER additional library # # rename roms files according to their time and date from ocean_time # # Author : Raphael Dussin 2014- # # # ########################################################################################################### import datetime as dt import netCDF4 as nc import numpy as np import os_utils class tagfile(): def __init__(self,filename): self.filein = filename self.fail=False return None def __call__(self,leap=True): # read time in netcdf time, timeunits = self.read_time(self.filein) if self.fail is False: # create the date tag if leap: tag = self.create_tag(time, timeunits) else: tag = self.create_tag_noleap(time, timeunits) # define a new filename self.create_new_filename(tag) # rename file self.rename_file() else: pass return None def read_time(self,filein): ''' read ocean_time variable and units in netcdf file''' try: fid = nc.Dataset(filein,'r') except: print 'could not open file ', filein time = fid.variables['ocean_time'][:] timeunits = fid.variables['ocean_time'].units fid.close() if len(time) > 1: print '>>> error : multiple values in time array\n>>> skipping file ' + filein self.fail=True else: time = time[0] return time, timeunits def create_tag(self,time, timeunits): ''' create a datetime object from reference date and ocean_time''' delta_type = timeunits.split()[0] # RD : assuming units are in the format " something since 1900-01-01 0:00:00 " date_string = timeunits.split()[2] time_string = timeunits.split()[3] ref_string = date_string + ' ' + time_string # handle files written with reference different from 1900-01-01 fmt = '%Y-%m-%d %H:%M:%S' dateref = dt.datetime.strptime(ref_string,fmt) # create a datetime object for current time if delta_type == 'seconds': tag = dateref + dt.timedelta(seconds=time) elif delta_type == 'days': tag = dateref + dt.timedelta(days=time) return tag def create_tag_noleap(self, time, timeunits): ''' create a datetime object from reference date and ocean_time (noleap version)''' # first we need to figure out how many seconds are ellaped between ref_date # and start date of the run delta_type = timeunits.split()[0] date_string = timeunits.split()[2] time_string = timeunits.split()[3] ref_string = date_string + ' ' + time_string fmt = '%Y-%m-%d %H:%M:%S' dateref_dstart = dt.datetime.strptime(ref_string,fmt) if delta_type == 'seconds': seconds_from_init = float(time) elif delta_type == 'days': seconds_from_init = float(time) * 86400. nyear = int(np.floor(seconds_from_init / 365 / 86400)) rm = np.remainder(seconds_from_init,365*86400) ndays = int(np.floor(rm / 86400)) rm2 = np.remainder(rm,86400) nhours = int(np.floor(rm2 / 3600)) rm3 = np.remainder(rm2,3600) nmin = int(np.floor(rm3 / 60)) nsec = int(np.remainder(rm3,60)) # pick a year we are sure is not a leap year fakeref = dt.datetime(1901,1,1,0,0) fakedate = fakeref + dt.timedelta(days=ndays) month = fakedate.month day = fakedate.day tag=dt.datetime(nyear + dateref_dstart.year,month, day, nhours, nmin, nsec) return tag def create_new_filename(self,tag): ''' based on tag, generate a new filename ''' # get rid of full path (if any) filein = self.filein.replace('/',' ').split()[-1] # get the pieces we want to keep in filename filein_wrk = filein.replace('_',' ').split() runname = filein_wrk[0] filetype = filein_wrk[1] # write our new filename self.fileout = runname + '_' + filetype + '_' + tag.isoformat() + '.nc' return None def rename_file(self): ''' call unix command mv ''' # remove filein from full path wrk = self.filein.replace('/',' ').split()[0:-1] # re-create path path = '' for part in wrk: path = path + '/' + part # rename file only if different if self.filein == path + '/' + self.fileout: pass else: os_utils.execute('mv ' + self.filein + ' ' + path + '/' + self.fileout) return None
raphaeldussin/RMANAGER
src/python/libdatetag4roms.py
Python
gpl-3.0
5,309
[ "NetCDF" ]
3ddd9cc6a4ce4bf5c0179eee00f6af1c48b4f01df39aba69f0f9b28415f7e546
""" UI-level acceptance tests for OpenAssessment. """ from __future__ import absolute_import from functools import wraps import os import time import unittest from bok_choy.promise import BrokenPromise, EmptyPromise from bok_choy.web_app_test import WebAppTest import ddt from nose.plugins.attrib import attr from pyinstrument import Profiler from acceptance.auto_auth import AutoAuthPage from acceptance.pages import AssessmentPage, GradePage, StaffAreaPage, SubmissionPage # This value is generally used in jenkins, but not locally PROFILING_ENABLED = os.environ.get('ORA_PROFILING_ENABLED', False) def retry(tries=2, delay=4, backoff=2): """ Retry decorator with exponential backoff. Kwargs: tries (int): Maximum number of times to execute the function. delay (int): Starting delay between retries. backoff (int): Multiplier applied to the delay. """ def _decorator(func): @wraps(func) def _inner(*args, **kwargs): _delay = delay for attempt_num in range(tries): try: return func(*args, **kwargs) except (BrokenPromise, AssertionError) as ex: if attempt_num >= (tries - 1): raise else: print "Test failed with {err}, retrying in {sec} seconds...".format(err=ex, sec=_delay) time.sleep(_delay) _delay *= backoff return _inner return _decorator class OpenAssessmentTest(WebAppTest): """ UI-level acceptance tests for Open Assessment. """ TEST_COURSE_ID = "course-v1:edx+ORA203+course" PROBLEM_LOCATIONS = { 'staff_only': u'courses/{test_course_id}/courseware/' u'61944efb38a349edb140c762c7419b50/415c3ee1b7d04b58a1887a6fe82b31d6/'.format(test_course_id=TEST_COURSE_ID), 'self_only': u'courses/{test_course_id}/courseware/' u'a4dfec19cf9b4a6fb5b18be6ccd9cecc/338a4affb58a45459629e0566291381e/'.format(test_course_id=TEST_COURSE_ID), 'peer_only': u'courses/{test_course_id}/courseware/' u'a4dfec19cf9b4a6fb5b18be6ccd9cecc/417e47b2663a4f79b62dba20b21628c8/'.format(test_course_id=TEST_COURSE_ID), 'student_training': u'courses/{test_course_id}/courseware/' u'676026889c884ac1827688750871c825/5663e9b038434636977a4226d668fe02/'.format(test_course_id=TEST_COURSE_ID), 'file_upload': u'courses/{test_course_id}/courseware/' u'57a3f9d51d424f6cb922f0d69cba868d/bb563abc989340d8806920902f267ca3/'.format(test_course_id=TEST_COURSE_ID), 'full_workflow_staff_override': u'courses/{test_course_id}/courseware/' u'676026889c884ac1827688750871c825/181ea9ff144c4766be44eb8cb360e34f/'.format(test_course_id=TEST_COURSE_ID), 'full_workflow_staff_required': u'courses/{test_course_id}/courseware/' u'8d9584d242b44343bc270ea5ef04ab03/0b0dcc728abe45138c650732af178afb/'.format(test_course_id=TEST_COURSE_ID), 'feedback_only': u'courses/{test_course_id}/courseware/' u'8d9584d242b44343bc270ea5ef04ab03/a2875e0db1454d0b94728b9a7b28000b/'.format(test_course_id=TEST_COURSE_ID), 'multiple_ora': u'courses/{test_course_id}/courseware/' u'3b9aa6e06d8f48818ff6f364b5586f38/b79abd43bb11445486cd1874e6c71a64/'.format(test_course_id=TEST_COURSE_ID), } SUBMISSION = u"This is a test submission." LATEX_SUBMISSION = u"[mathjaxinline]( \int_{0}^{1}xdx )[/mathjaxinline]" OPTIONS_SELECTED = [1, 2] STAFF_OVERRIDE_OPTIONS_SELECTED = [0, 1] STAFF_OVERRIDE_SCORE = 1 STAFF_GRADE_EXISTS = "COMPLETE" STAFF_AREA_SCORE = "Final grade: {} out of 8" STAFF_OVERRIDE_STAFF_AREA_NOT_COMPLETE = "The problem has not been completed." EXPECTED_SCORE = 6 STUDENT_TRAINING_OPTIONS = [ [1, 2], [0, 2] ] TEST_PASSWORD = "test_password" def setUp(self, problem_type, staff=False): """ Configure page objects to test Open Assessment. Args: problem_type (str): The type of problem being tested, used to choose which part of the course to load. staff (bool): If True, runs the test with a staff user (defaults to False). """ super(OpenAssessmentTest, self).setUp() if PROFILING_ENABLED: self.profiler = Profiler(use_signal=False) self.profiler.start() self.problem_loc = self.PROBLEM_LOCATIONS[problem_type] self.auto_auth_page = AutoAuthPage(self.browser, course_id=self.TEST_COURSE_ID, staff=staff) self.submission_page = SubmissionPage(self.browser, self.problem_loc) self.self_asmnt_page = AssessmentPage('self-assessment', self.browser, self.problem_loc) self.peer_asmnt_page = AssessmentPage('peer-assessment', self.browser, self.problem_loc) self.student_training_page = AssessmentPage('student-training', self.browser, self.problem_loc) self.staff_asmnt_page = AssessmentPage('staff-assessment', self.browser, self.problem_loc) self.grade_page = GradePage(self.browser, self.problem_loc) def log_to_file(self): with open('{}-profile.log'.format(self.id()), 'w') as f: f.write(self.profiler.output_text()) def tearDown(self): if PROFILING_ENABLED: self.profiler.stop() self.log_to_file() def login_user(self, learner, email): """ Logs in an already existing user. Args: learner (str): the username of the user. email (str): email address of the user. """ auto_auth_page = AutoAuthPage( self.browser, email=email, password=self.TEST_PASSWORD, username=learner, course_id=self.TEST_COURSE_ID, staff=True ) auto_auth_page.visit() def do_self_assessment(self): """ Creates a user, submits a self assessment, verifies the grade, and returns the username of the learner for which the self assessment was submitted. """ self.auto_auth_page.visit() username, _ = self.auto_auth_page.get_username_and_email() self.submission_page.visit().submit_response(self.SUBMISSION) self.assertTrue(self.submission_page.has_submitted) # Submit a self-assessment self.submit_self_assessment(self.OPTIONS_SELECTED) # Verify the grade self.assertEqual(self.EXPECTED_SCORE, self.grade_page.wait_for_page().score) return username def submit_self_assessment(self, options=OPTIONS_SELECTED): """ Submit a self assessment for the currently logged in student. Do not verify grade. Args: options: the options to select for the self assessment (will use OPTIONS_SELECTED if not specified) """ self.self_asmnt_page.wait_for_page().wait_for_response() self.assertIn(self.SUBMISSION, self.self_asmnt_page.response_text) self.self_asmnt_page.assess(options).wait_for_complete() self.assertTrue(self.self_asmnt_page.is_complete) def _verify_staff_grade_section(self, expected_status): """ Verifies the expected status and message text in the Staff Grade section (as shown to the learner). """ self.staff_asmnt_page.wait_for_page() self.assertEqual("Staff Grade", self.staff_asmnt_page.label) self.staff_asmnt_page.verify_status_value(expected_status) def do_training(self): """ Complete two training examples, satisfying the requirements. """ for example_num, options_selected in enumerate(self.STUDENT_TRAINING_OPTIONS): if example_num > 0: try: self.student_training_page.wait_for_num_completed(example_num) except BrokenPromise: msg = "Did not complete at least {num} student training example(s).".format(num=example_num) self.fail(msg) self.student_training_page.wait_for_page().wait_for_response().assess(options_selected) # Check that we've completed student training try: self.student_training_page.wait_for_complete() except BrokenPromise: self.fail("Student training was not marked complete.") def do_peer_assessment(self, count=1, options=OPTIONS_SELECTED): """ Does the specified number of peer assessments. Args: count: the number of assessments that must be completed (defaults to 1) options: the options to use (defaults to OPTIONS_SELECTED) """ self.peer_asmnt_page.visit() for count_assessed in range(1, count + 1): self.peer_asmnt_page.wait_for_page().wait_for_response().assess(options) self.peer_asmnt_page.wait_for_num_completed(count_assessed) def do_staff_override(self, username, final_score=STAFF_AREA_SCORE.format(STAFF_OVERRIDE_SCORE)): """ Complete a staff assessment (grade override). Args: username: the learner to grade final_score: the expected final score as shown in the staff area (defaults to the staff override score value) """ self.staff_area_page.visit() self.staff_area_page.show_learner(username) self.staff_area_page.expand_learner_report_sections() self.staff_area_page.staff_assess(self.STAFF_OVERRIDE_OPTIONS_SELECTED) self.staff_area_page.verify_learner_final_score(final_score) def do_staff_assessment(self, number_to_assess=0, options_selected=OPTIONS_SELECTED, feedback=None): """ Use staff tools to assess available responses. Args: number_to_assess: the number of submissions to assess. If not provided (or 0), will grade all available submissions. options_selected (dict): the options to choose when grading. Defaults to OPTIONS_SELECTED. feedback (function(feedback_type)): if feedback is set, it will be used as a function that takes one parameter to generate a feedback string. """ self.staff_area_page.visit() self.staff_area_page.click_staff_toolbar_button("staff-grading") # Get the counts before checking out a submission for assessment. start_numbers = self.staff_area_page.available_checked_out_numbers # Check out a submission. self.staff_area_page.expand_staff_grading_section() # Checked out number should increase, ungraded decrease. ungraded = start_numbers[0]-1 checked_out = start_numbers[1]+1 self.staff_area_page.verify_available_checked_out_numbers((ungraded, checked_out)) assessed = 0 while number_to_assess == 0 or assessed < number_to_assess: continue_after = False if number_to_assess-1 == assessed else ungraded > 0 if feedback: self.staff_area_page.provide_criterion_feedback(feedback("criterion")) self.staff_area_page.provide_overall_feedback(feedback("overall")) if options_selected: self.staff_area_page.staff_assess(options_selected, continue_after) assessed += 1 if not continue_after: self.staff_area_page.verify_available_checked_out_numbers((ungraded, checked_out-1)) break else: ungraded -= 1 self.staff_area_page.verify_available_checked_out_numbers((ungraded, checked_out)) def refresh_page(self): """ Helper method that waits for "unsaved changes" warnings to clear before refreshing the page. """ EmptyPromise( lambda: self.browser.execute_script("return window.onbeforeunload === null"), "Unsubmitted changes exist on page." ).fulfill() self.browser.refresh() class SelfAssessmentTest(OpenAssessmentTest): """ Test the self-assessment flow. """ def setUp(self): super(SelfAssessmentTest, self).setUp('self_only') @retry() @attr('acceptance') def test_self_assessment(self): # Submit a response self.do_self_assessment() @retry() @attr('acceptance') def test_latex(self): self.auto_auth_page.visit() self.submission_page.visit() # 'Preview in Latex' button should be disabled at the page load self.assertTrue(self.submission_page.latex_preview_button_is_disabled) # Fill latex expression, & Verify if 'Preview in Latex is enabled' self.submission_page.visit().fill_latex(self.LATEX_SUBMISSION) self.assertFalse(self.submission_page.latex_preview_button_is_disabled) # Click 'Preview in Latex' button & Verify if it was rendered self.submission_page.preview_latex() class StaffAssessmentTest(OpenAssessmentTest): """ Test the staff-assessment flow. """ def setUp(self): super(StaffAssessmentTest, self).setUp('staff_only', staff=True) @retry() @attr('acceptance') def test_staff_assessment(self): # Set up user and navigate to submission page self.auto_auth_page.visit() username, _ = self.auto_auth_page.get_username_and_email() self.submission_page.visit() # Verify that staff grade step is shown initially self._verify_staff_grade_section("NOT AVAILABLE") # User submits a response self.submission_page.submit_response(self.SUBMISSION) self.assertTrue(self.submission_page.has_submitted) # Verify staff grade section appears as expected self._verify_staff_grade_section("NOT AVAILABLE") message_title = self.staff_asmnt_page.open_step().message_title self.assertEqual("Waiting for a Staff Grade", message_title) # Perform staff assessment self.staff_area_page = StaffAreaPage(self.browser, self.problem_loc) self.do_staff_assessment() # Verify staff grade section appears as expected self.staff_asmnt_page.visit() self._verify_staff_grade_section(self.STAFF_GRADE_EXISTS) self.assertEqual(self.EXPECTED_SCORE, self.grade_page.wait_for_page().score) # Verify that staff scores can be overriden self.do_staff_override(username) self.refresh_page() self.assertEqual(self.STAFF_OVERRIDE_SCORE, self.grade_page.wait_for_page().score) class PeerAssessmentTest(OpenAssessmentTest): """ Test the peer-assessment flow. It's complicated to guarantee that a student will both give and receive enough assessments to receive a grade, so we stop once we've given one peer assessment. """ def setUp(self): super(PeerAssessmentTest, self).setUp('peer_only') @retry() @attr('acceptance') def test_peer_assessment(self): # Create a submission for the first student, so there's # at least one submission to assess. self.auto_auth_page.visit() self.submission_page.visit().submit_response(self.SUBMISSION) # Create a submission for the second student self.auto_auth_page.visit() self.submission_page.visit().submit_response(self.SUBMISSION) # Assess the submission (there should be at least one available) self.do_peer_assessment() class StaffOverrideTest(OpenAssessmentTest): """ Test setting a staff override on a problem which requires peer or self assessment. This is used as a base class, as the problem type defined by subclasses must be known in setUp(). """ def __init__(self, *args, **kwargs): super(StaffOverrideTest, self).__init__(*args, **kwargs) self.problem_type = None def setUp(self): if self.problem_type is None: self.fail("Please define self.problem_type in a sub-class") super(StaffOverrideTest, self).setUp(self.problem_type, staff=True) self.staff_area_page = StaffAreaPage(self.browser, self.problem_loc) @retry() @attr('acceptance') def _test_staff_override(self): """ Scenario: staff can override a learner's grade Given I am viewing a new peer assessment problem as a learner And if I create a response to the problem Then there is no Staff Grade section present And if a staff member creates a grade override Then I can see my final grade, even though no peers have assessed me """ # Create a submission self.auto_auth_page.visit() username, _ = self.auto_auth_page.get_username_and_email() self.submission_page.visit().submit_response(self.SUBMISSION) # Staff Grade field should not be visible yet. self.assertFalse(self.staff_asmnt_page.is_browser_on_page()) # Submit a staff override. self.do_staff_override(username) # Refresh the page so the learner sees the Staff Grade section. self.refresh_page() self._verify_staff_grade_section(self.STAFF_GRADE_EXISTS) # Verify the staff override grade self.assertEqual(self.STAFF_OVERRIDE_SCORE, self.grade_page.wait_for_page().score) class StaffOverrideSelfTest(StaffOverrideTest): """ Subclass of StaffOverrideTest for a 'self_only' problem. """ def __init__(self, *args, **kwargs): super(StaffOverrideSelfTest, self).__init__(*args, **kwargs) self.problem_type = 'self_only' @retry() @attr('acceptance') def test_staff_override(self): super(StaffOverrideSelfTest, self)._test_staff_override() class StaffOverridePeerTest(StaffOverrideTest): """ Subclass of StaffOverrideTest for a 'peer_only' problem. """ def __init__(self, *args, **kwargs): super(StaffOverridePeerTest, self).__init__(*args, **kwargs) self.problem_type = 'peer_only' @retry() @attr('acceptance') def test_staff_override(self): super(StaffOverridePeerTest, self)._test_staff_override() class StudentTrainingTest(OpenAssessmentTest): """ Test student training (the "learning to assess" step). """ def setUp(self): super(StudentTrainingTest, self).setUp('student_training') @retry() @attr('acceptance') def test_student_training(self): # Create a submission so we can get to student training self.auto_auth_page.visit() self.submission_page.visit().submit_response(self.SUBMISSION) self.do_training() @ddt.ddt class StaffAreaTest(OpenAssessmentTest): """ Test the staff area. This is testing a problem with "self assessment only". """ def setUp(self): super(StaffAreaTest, self).setUp('self_only', staff=True) self.staff_area_page = StaffAreaPage(self.browser, self.problem_loc) @retry() @attr('acceptance') def test_staff_area_buttons(self): """ Scenario: the staff area buttons should behave correctly Given I am viewing the staff area of an ORA problem Then none of the buttons should be active When I click the "Manage Individual Learners" button Then only the "Manage Individual Learners" button should be active When I click the "View Assignment Statistics" button Then only the "View Assignment Statistics" button should be active When I click the "Staff Info" button again Then none of the buttons should be active """ self.auto_auth_page.visit() self.staff_area_page.visit() self.assertEqual(self.staff_area_page.selected_button_names, []) self.staff_area_page.click_staff_toolbar_button("staff-tools") self.assertEqual(self.staff_area_page.selected_button_names, ["MANAGE INDIVIDUAL LEARNERS"]) self.staff_area_page.click_staff_toolbar_button("staff-info") self.assertEqual(self.staff_area_page.selected_button_names, ["VIEW ASSIGNMENT STATISTICS"]) self.staff_area_page.click_staff_toolbar_button("staff-info") self.assertEqual(self.staff_area_page.selected_button_names, []) @retry() @attr('acceptance') def test_staff_area_panel(self): """ Scenario: the staff area panels should be shown correctly Given I am viewing the staff area of an ORA problem Then none of the panels should be shown When I click a staff button Then only the related panel should be shown When I click the close button in the panel Then none of the panels should be shown """ self.auto_auth_page.visit() self.staff_area_page.visit() # Verify that there is no selected panel initially self.assertEqual(self.staff_area_page.selected_button_names, []) self.assertEqual(self.staff_area_page.visible_staff_panels, []) for panel_name, button_label in [ ("staff-tools", "MANAGE INDIVIDUAL LEARNERS"), ("staff-info", "VIEW ASSIGNMENT STATISTICS"), ]: # Click on the button and verify that the panel has opened self.staff_area_page.click_staff_toolbar_button(panel_name) self.assertEqual(self.staff_area_page.selected_button_names, [button_label]) visible_panels = self.staff_area_page.visible_staff_panels self.assertEqual(1, len(visible_panels)) self.assertIn(u'openassessment__{button_name}'.format(button_name=panel_name), visible_panels[0]) # Click 'Close' and verify that the panel has been closed self.staff_area_page.click_staff_panel_close_button(panel_name) self.assertEqual(self.staff_area_page.selected_button_names, []) self.assertEqual(self.staff_area_page.visible_staff_panels, []) @retry() @attr('acceptance') def test_student_info(self): """ Scenario: staff tools shows learner response information Given I am viewing the staff area of an ORA problem When I search for a learner in staff tools And the learner has submitted a response to an ORA problem with self-assessment And I've made a staff override assessment of the learner Then I see the correct learner information sections """ username = self.do_self_assessment() self.do_staff_override(username) self.staff_area_page.visit() # Click on staff tools and search for user self.staff_area_page.show_learner(username) self.assertEqual( [u"Learner's Response", u"Learner's Self Assessment", u"Staff Assessment for This Learner", u"Learner's Final Grade", u"Submit Assessment Grade Override", u"Remove Submission From Peer Grading"], self.staff_area_page.learner_report_sections ) self.assertNotIn('A response was not found for this learner', self.staff_area_page.learner_report_text) @retry() @attr('acceptance') def test_student_info_no_submission(self): """ Scenario: staff tools indicates if no submission has been received for a given learner Given I am viewing the staff area of an ORA problem And I myself have submitted a response with self-assessment When I search for a learner in staff tools And the learner has not submitted a response to the ORA problem Then I see a message indicating that the learner has not submitted a response And there are no student information sections displayed """ self.auto_auth_page.visit() # This is to catch a bug that existed when the user viewing staff tools had submitted an assessment, # and had a grade stored (TNL-4060). self.do_self_assessment() self.staff_area_page.visit() # Click on staff tools and search for user self.staff_area_page.show_learner('no-submission-learner') self.staff_area_page.verify_learner_report_text('A response was not found for this learner.') @retry() @attr('acceptance') def test_staff_override(self): """ Scenario: staff can override a learner's grade Given I am viewing the staff area of an ORA problem When I search for a learner in staff tools And the learner has submitted a response to an ORA problem with self-assessment Then I can submit a staff override of the self-assessment And I see the updated final score """ username = self.do_self_assessment() self.staff_area_page.visit() # Click on staff tools and search for user self.staff_area_page.show_learner(username) # Check the learner's current score. self.staff_area_page.expand_learner_report_sections() self.staff_area_page.verify_learner_final_score(self.STAFF_AREA_SCORE.format(self.EXPECTED_SCORE)) self.assertEquals( ['CRITERION', 'SELF ASSESSMENT GRADE'], self.staff_area_page.learner_final_score_table_headers ) self.assertEquals( ['Fair - 3 points', 'Good - 3 points'], self.staff_area_page.learner_final_score_table_values ) # Do staff override and wait for final score to change. self.staff_area_page.assess(self.STAFF_OVERRIDE_OPTIONS_SELECTED) # Verify that the new student score is different from the original one. self.staff_area_page.verify_learner_final_score(self.STAFF_AREA_SCORE.format(self.STAFF_OVERRIDE_SCORE)) self.assertEquals( ['CRITERION', 'STAFF GRADE', 'SELF ASSESSMENT GRADE'], self.staff_area_page.learner_final_score_table_headers ) self.assertEquals( [u'Poor - 0 points', u'Fair', u'Fair - 1 point', u'Good'], self.staff_area_page.learner_final_score_table_values ) @retry() @attr('acceptance') def test_cancel_submission(self): """ Scenario: staff can cancel a learner's submission Given I am viewing the staff area of an ORA problem When I search for a learner in staff tools And the learner has submitted a response to an ORA problem with self-assessment Then I can cancel the learner's submission And I see an updated message indicating that the submission has been canceled. """ username = self.do_self_assessment() self.staff_area_page.visit() # Click on staff tools and search for user self.staff_area_page.show_learner(username) # Check the learner's current score. self.staff_area_page.expand_learner_report_sections() self.staff_area_page.verify_learner_final_score(self.STAFF_AREA_SCORE.format(self.EXPECTED_SCORE)) # Cancel the student submission self.staff_area_page.cancel_submission() self.staff_area_page.verify_learner_final_score( "The learner's submission has been removed from peer assessment. " "The learner receives a grade of zero unless you delete the learner's state for the " "problem to allow them to resubmit a response." ) # Verify that the staff override and submission removal sections are now gone. self.assertEqual( [u"Learner's Response", u"Learner's Self Assessment", u"Learner's Final Grade"], self.staff_area_page.learner_report_sections ) # Verify that the Learner Response has been replaced with a message about the removal self.staff_area_page.expand_learner_report_sections() self.assertIn("Learner submission removed", self.staff_area_page.learner_response) @retry() @attr('acceptance') def test_staff_grade_override_cancelled(self): """ Scenario: the staff grade section displays cancelled when the submission is cancelled Given I have created a response and a self-assessment And a staff member creates a grade override and then cancels my submission Then when I refresh the page, the Staff Grade section is marked cancelled And I have no final grade """ username = self.do_self_assessment() # Submit a staff override self.do_staff_override(username) # And cancel the submission self.staff_area_page.expand_learner_report_sections() self.staff_area_page.cancel_submission() # Refresh the page so the learner sees the Staff Grade section shows the submission has been cancelled. self.refresh_page() self._verify_staff_grade_section("CANCELLED") self.assertIsNone(self.grade_page.wait_for_page().score) class FileUploadTest(OpenAssessmentTest): """ Test file upload """ def setUp(self): super(FileUploadTest, self).setUp('file_upload') @retry() @attr('acceptance') def test_file_upload(self): self.auto_auth_page.visit() # trying to upload a unacceptable file self.submission_page.visit() # hide django debug tool, otherwise, it will cover the button on the right side, # which will cause the button non-clickable and tests to fail self.submission_page.hide_django_debug_tool() self.submission_page.select_file(os.path.dirname(os.path.realpath(__file__)) + '/__init__.py') self.assertTrue(self.submission_page.has_file_error) # trying to upload a acceptable file readme = os.path.dirname(os.path.realpath(__file__)) + '/README.rst' self.submission_page.visit().select_file(readme) self.assertFalse(self.submission_page.has_file_error) self.assertTrue(self.submission_page.upload_file_button_is_disabled) self.submission_page.add_file_description(0, 'file description 1') self.assertTrue(self.submission_page.upload_file_button_is_enabled) self.submission_page.upload_file() self.assertTrue(self.submission_page.have_files_uploaded) class FullWorkflowMixin(object): """ Mixin with helper methods and constants for testing a full workflow (training, self assessment, peer assessment, staff override). """ PEER_ASSESSMENT = [0, 0] STAFF_AREA_PEER_ASSESSMENT = ['Poor', u'', u'0', u'5', u'Poor', u'', u'0', u'3'] PEER_ASSESSMENT_SCORE = 0 PEER_ASSESSMENT_STAFF_AREA_SCORE = "Final grade: 0 out of 8" SELF_ASSESSMENT = [2, 3] STAFF_AREA_SELF_ASSESSMENT = ['Good', u'', u'5', u'5', u'Excellent', u'', u'3', u'3'] SUBMITTED_ASSESSMENT = [0, 3] STAFF_AREA_SUBMITTED = ['Poor', u'', u'0', u'5', u'Excellent', u'', u'3', u'3'] def do_submission(self): """ Creates a user and submission. Returns: (str, str): the username and email of the newly created user """ auto_auth_page = AutoAuthPage( self.browser, password=self.TEST_PASSWORD, course_id=self.TEST_COURSE_ID, staff=True ) auto_auth_page.visit() username_email = auto_auth_page.get_username_and_email() self.submission_page.visit().submit_response(self.SUBMISSION) EmptyPromise(self.submission_page.button(".step--student-training").is_focused(), "Student training button should be focused") return username_email def do_submission_training_self_assessment(self): """ Creates a user and then does submission, training, and self assessment. Returns: (str, str): the username and password of the newly created user """ username, email = self.do_submission() EmptyPromise(self.submission_page.button(".step--student-training").is_focused(), "Student training button should be focused") self.submission_page.confirm_feedback_text('Your Response Complete') self.submission_page.confirm_feedback_text('Learn to Assess Responses In Progress (1 of 2)') self.do_training() EmptyPromise(self.submission_page.button(".step--self-assessment").is_focused(), "Self assessment button should be focused") self.submission_page.confirm_feedback_text('Learn to Assess Responses Complete') self.submission_page.confirm_feedback_text('Assess Your Response In Progress') self.submit_self_assessment(self.SELF_ASSESSMENT) EmptyPromise(self.submission_page.button(".step--grade").is_focused(), "Grade button should be focused") self.submission_page.confirm_feedback_text('Assess Your Response Complete') self.submission_page.confirm_feedback_text('Assess Peers In Progress (1 of 1)') return username, email def do_train_self_peer(self, peer_to_grade=True): """ Common functionality for executing training, self, and peer assessment steps. Args: peer_to_grade: boolean, defaults to True. Set to False to have learner complete their required steps, but no peers to submit a grade for learner in return. """ # Create a learner with submission, training, and self assessment completed. learner, learner_email = self.do_submission_training_self_assessment() # Now create a second learner so that learner 1 has someone to assess. # The second learner does all the steps as well (submission, training, self assessment, peer assessment). self.do_submission_training_self_assessment() if peer_to_grade: self.do_peer_assessment(options=self.PEER_ASSESSMENT) # Go back to the first learner to complete her workflow. self.login_user(learner, learner_email) # Learner 1 does peer assessment of learner 2 to complete workflow. self.do_peer_assessment(options=self.SUBMITTED_ASSESSMENT) # Continue grading by other students if necessary to ensure learner has a peer grade. if peer_to_grade: self.verify_submission_has_peer_grade(learner, learner_email) return learner def staff_assessment(self, peer_grades_me=True): """ Do staff assessment workflow """ # Ensure grade is not present, since staff assessment has not been made self.assertIsNone(self.grade_page.wait_for_page().score) # Now do a staff assessment. self.do_staff_assessment(options_selected=self.STAFF_OVERRIDE_OPTIONS_SELECTED) # As an add-on, let's make sure that both submissions (the learner's, and the additional one created # in do_train_self_peer() above) were assessed using staff-grading's "submit and keep going" self.assertEqual(0, self.staff_area_page.available_checked_out_numbers[0]) # At this point, the learner sees the score (1). self.refresh_page() self._verify_staff_grade_section(self.STAFF_GRADE_EXISTS) self.assertEqual(self.STAFF_OVERRIDE_SCORE, self.grade_page.wait_for_page().score) if peer_grades_me: self.verify_grade_entries( [(u"STAFF GRADE - 0 POINTS", u"Poor", u"PEER MEDIAN GRADE", u"Poor", u"PEER 1", u"- POOR", u"YOUR SELF ASSESSMENT", u"Good"), (u"STAFF GRADE - 1 POINT", u"Fair", u"PEER MEDIAN GRADE", u"Poor", u"PEER 1", u"- POOR", u"YOUR SELF ASSESSMENT", u"Excellent")] ) else: self.verify_grade_entries( [(u"STAFF GRADE - 0 POINTS", u"Poor", u'PEER MEDIAN GRADE', u'Waiting for peer reviews', u"YOUR SELF ASSESSMENT", u"Good"), (u"STAFF GRADE - 1 POINT", u"Fair", u'PEER MEDIAN GRADE', u'Waiting for peer reviews', u"YOUR SELF ASSESSMENT", u"Excellent") ] ) def verify_staff_area_fields(self, username, peer_assessments, submitted_assessments, self_assessment): """ Verifies the expected entries in the staff area for peer assessments, submitted assessments, and self assessment. Args: username (str): the username of the learner to check peer_assessments: the expected fields in the peer assessment section submitted_assessments: the expected fields in the submitted assessments section self_assessment: the expected fields in the self assessment section """ self.staff_area_page.visit() self.staff_area_page.show_learner(username) self.staff_area_page.expand_learner_report_sections() self.assertEqual(peer_assessments, self.staff_area_page.status_text('peer__assessments')) self.assertEqual(submitted_assessments, self.staff_area_page.status_text('submitted__assessments')) self.assertEqual(self_assessment, self.staff_area_page.status_text('self__assessments')) def verify_submission_has_peer_grade(self, learner, learner_email, max_attempts=5): """ If learner does not now have a score, it means that "extra" submissions are in the system, and more need to be scored. Create additional learners and have them grade until learner has a grade (stopping after specified max attempts). Args: learner: the learner whose grade will be checked max_attempts: the maximum number of times an additional peer grading should be done """ def peer_grade_exists(): self.staff_area_page.visit() self.staff_area_page.show_learner(learner) return "Peer Assessments for This Learner" in self.staff_area_page.learner_report_sections count = 0 while not peer_grade_exists() and count < max_attempts: count += 1 self.do_submission_training_self_assessment() self.do_peer_assessment(options=self.PEER_ASSESSMENT) self.login_user(learner, learner_email) self.assertTrue( peer_grade_exists(), "Learner still not graded after {} additional attempts".format(max_attempts) ) def verify_grade_entries(self, expected_entries): """ Verify the grade entries as shown in the "Your Grade" section. Args: expected_entries: array of expected entries, with each entry being an tuple consisting of the data for a particular question. Note that order is important. """ for index, expected_entry in enumerate(expected_entries): self.assertEqual(expected_entry, self.grade_page.grade_entry(index)) class MultipleOpenAssessmentMixin(FullWorkflowMixin): """ A Multiple ORA assessment mixin with helper methods and constants for testing a full workflow (training, self assessment, peer assessment, staff override). """ def setup_vertical_index(self, vertical_index): """ Set the vertical index on the page. Each problem has vertical index assigned and has a `vert-{vertical_index}` top level class. Set up vertical index on the page so as to move to a different problem. """ self.submission_page.vertical_index = vertical_index self.self_asmnt_page.vertical_index = vertical_index self.peer_asmnt_page.vertical_index = vertical_index self.student_training_page.vertical_index = vertical_index self.staff_asmnt_page.vertical_index = vertical_index self.grade_page.vertical_index = vertical_index self.staff_area_page.vertical_index = vertical_index def assess_component(self, vertical_index, peer_grades_me=True): """ Assess the complete flow of an open assessment.""" self.setup_vertical_index(vertical_index) self.do_train_self_peer(peer_grades_me) self.staff_assessment(peer_grades_me) class FullWorkflowOverrideTest(OpenAssessmentTest, FullWorkflowMixin): """ Tests of complete workflows, combining multiple required steps together. """ def setUp(self): super(FullWorkflowOverrideTest, self).setUp("full_workflow_staff_override", staff=True) self.staff_area_page = StaffAreaPage(self.browser, self.problem_loc) @retry() @attr('acceptance') def test_staff_override_at_end(self): """ Scenario: complete workflow with staff override at the very end Given that I have created a submission, completed training, and done a self assessment And a second learner has also created a submission, training, and self assessment Then I can assess a learner And when another learner assesses me Then I see my score based on the peer assessment And when a staff member overrides the score Then I see the staff override score And all fields in the staff area tool are correct """ learner = self.do_train_self_peer() # At this point, the learner sees the peer assessment score (0). self.assertEqual(self.PEER_ASSESSMENT_SCORE, self.grade_page.wait_for_page().score) self.verify_staff_area_fields( learner, self.STAFF_AREA_PEER_ASSESSMENT, self.STAFF_AREA_SUBMITTED, self.STAFF_AREA_SELF_ASSESSMENT ) self.staff_area_page.verify_learner_final_score(self.PEER_ASSESSMENT_STAFF_AREA_SCORE) self.assertEquals( ['CRITERION', 'PEER MEDIAN GRADE', 'SELF ASSESSMENT GRADE'], self.staff_area_page.learner_final_score_table_headers ) self.assertEquals( ['Poor - 0 points\nPeer 1 - Poor', 'Good', 'Poor - 0 points\nPeer 1 - Poor', 'Excellent'], self.staff_area_page.learner_final_score_table_values ) self.verify_grade_entries( [(u"PEER MEDIAN GRADE - 0 POINTS", u"Poor", u"PEER 1", u"- POOR", u"YOUR SELF ASSESSMENT", u"Good"), (u"PEER MEDIAN GRADE - 0 POINTS", u"Poor", u"PEER 1", u"- POOR", u"YOUR SELF ASSESSMENT", u"Excellent")] ) # Now do a staff override, changing the score (to 1). self.do_staff_override(learner) self.refresh_page() self._verify_staff_grade_section(self.STAFF_GRADE_EXISTS) self.assertEqual(self.STAFF_OVERRIDE_SCORE, self.grade_page.wait_for_page().score) self.verify_staff_area_fields( learner, self.STAFF_AREA_PEER_ASSESSMENT, self.STAFF_AREA_SUBMITTED, self.STAFF_AREA_SELF_ASSESSMENT ) self.staff_area_page.verify_learner_final_score(self.STAFF_AREA_SCORE.format(self.STAFF_OVERRIDE_SCORE)) self.assertEquals( ['CRITERION', 'STAFF GRADE', 'PEER MEDIAN GRADE', 'SELF ASSESSMENT GRADE'], self.staff_area_page.learner_final_score_table_headers ) self.assertEquals( ['Poor - 0 points', 'Peer 1 - Poor', 'Good', 'Fair - 1 point', 'Peer 1 - Poor', 'Excellent'], self.staff_area_page.learner_final_score_table_values ) self.verify_grade_entries( [(u"STAFF GRADE - 0 POINTS", u"Poor", u"PEER MEDIAN GRADE", u"Poor", u"PEER 1", u"- POOR", u"YOUR SELF ASSESSMENT", u"Good"), (u"STAFF GRADE - 1 POINT", u"Fair", u"PEER MEDIAN GRADE", u"Poor", u"PEER 1", u"- POOR", u"YOUR SELF ASSESSMENT", u"Excellent") ] ) @retry() @attr('acceptance') def test_staff_override_at_beginning(self): """ Scenario: complete workflow with staff override at the very beginning Given that I have created a submission Then I see no score yet And when a staff member creates a grade override Then I see my staff override score And all fields in the staff area tool are correct """ # Create only the initial submission before doing the staff override. learner, learner_email = self.do_submission() # Verify no grade present (and no staff grade section), no assessment information in staff area. self.assertIsNone(self.grade_page.wait_for_page().score) self.assertFalse(self.staff_asmnt_page.is_browser_on_page()) self.verify_staff_area_fields(learner, [], [], []) self.staff_area_page.verify_learner_final_score(self.STAFF_OVERRIDE_STAFF_AREA_NOT_COMPLETE) # Do staff override self.do_staff_override(learner) # Refresh the page so the learner sees the Staff Grade section. self.refresh_page() self._verify_staff_grade_section(self.STAFF_GRADE_EXISTS) # Grade is now visible to the learner despite not having made any assessments self.assertEqual(self.STAFF_OVERRIDE_SCORE, self.grade_page.wait_for_page().score) self.verify_staff_area_fields(learner, [], [], []) self.staff_area_page.verify_learner_final_score(self.STAFF_AREA_SCORE.format(self.STAFF_OVERRIDE_SCORE)) self.assertEquals( ['CRITERION', 'STAFF GRADE', 'PEER MEDIAN GRADE'], self.staff_area_page.learner_final_score_table_headers ) self.assertEquals( [u'Poor - 0 points', u'Waiting for peer reviews', u'Fair - 1 point', u'Waiting for peer reviews'], self.staff_area_page.learner_final_score_table_values ) self.verify_grade_entries( [(u"STAFF GRADE - 0 POINTS", u"Poor", u'PEER MEDIAN GRADE', u'Waiting for peer reviews'), (u"STAFF GRADE - 1 POINT", u"Fair", u'PEER MEDIAN GRADE', u'Waiting for peer reviews') ] ) @ddt.ddt class FullWorkflowRequiredTest(OpenAssessmentTest, FullWorkflowMixin): """ Tests of complete workflows, combining multiple required steps together. """ def setUp(self): super(FullWorkflowRequiredTest, self).setUp("full_workflow_staff_required", staff=True) self.staff_area_page = StaffAreaPage(self.browser, self.problem_loc) @retry() @attr('acceptance') @ddt.data(True, False) def test_train_self_peer_staff(self, peer_grades_me): """ Scenario: complete workflow that included staff required step. Given that I have created a submission, completed training, and done a self assessment And a second learner has also created a submission, training, and self assessment Then I can assess a learner And when another learner assesses me And a staff member submits a score Then I see the staff score And all fields in the staff area tool are correct """ # Using ddt booleans to confirm behavior independent of whether I receive a peer score or not self.do_train_self_peer(peer_grades_me) # Do staff assessment step self.staff_assessment(peer_grades_me) @ddt.ddt class FeedbackOnlyTest(OpenAssessmentTest, FullWorkflowMixin): """ Test for a problem that containing a criterion that only accepts feedback. Will make and verify self and staff assessments. """ def setUp(self): super(FeedbackOnlyTest, self).setUp("feedback_only", staff=True) self.staff_area_page = StaffAreaPage(self.browser, self.problem_loc) def generate_feedback(self, assessment_type, feedback_type): return "{}: {} feedback".format(assessment_type, feedback_type) def assess_feedback(self, self_or_peer=""): if self_or_peer != "self" and self_or_peer != "peer": raise AssertionError("assert_feedback only works for self or peer assessments") page = self.self_asmnt_page if self_or_peer == "self" else self.peer_asmnt_page page.wait_for_page() page.submit_assessment() @retry() @attr('acceptance') def test_feedback_only(self): # Make submission user, pwd = self.do_submission() # Make self assessment self.self_asmnt_page.visit() self.self_asmnt_page.wait_for_page() self.self_asmnt_page.provide_criterion_feedback(self.generate_feedback("self", "criterion")) self.self_asmnt_page.provide_overall_feedback(self.generate_feedback("self", "overall")) self.self_asmnt_page.assess([0]) self.self_asmnt_page.wait_for_complete() self.assertTrue(self.self_asmnt_page.is_complete) # Staff assess all available submissions self.do_staff_assessment( options_selected=[0], # Select the 0-th option (Yes) on the single scored criterion feedback=lambda feedback_type: self.generate_feedback("staff", feedback_type) ) # Verify student-viewable grade report self.refresh_page() self.grade_page.wait_for_page() self.verify_grade_entries( [(u'STAFF GRADE - 1 POINT', u'Yes', u'YOUR SELF ASSESSMENT', u'Yes')] ) for i, assessment_type in enumerate(["staff", "self"]): # Criterion feedback first expected = self.generate_feedback(assessment_type, "criterion") actual = self.grade_page.feedback_entry(1, i) self.assertEqual(actual, expected) # Reported answers 3 and 4 # Then overall expected = self.generate_feedback(assessment_type, "overall") actual = self.grade_page.feedback_entry("feedback", i) self.assertEqual(actual, expected) # Reported answers 5 and 6 # Verify that no reported answers other than the 6 we already verified are present self.assertEqual(self.grade_page.total_reported_answers, 6) # Verify that the feedback-only criterion has no score self.assertEqual(self.grade_page.number_scored_criteria, 1) # Verify feedback appears from all assessments in staff tools self.staff_area_page.show_learner(user) self.staff_area_page.expand_learner_report_sections() self.assertEqual( self.staff_area_page.learner_final_score_table_headers, [u'CRITERION', u'STAFF GRADE', u'SELF ASSESSMENT GRADE'] ) self.assertEqual( self.staff_area_page.learner_final_score_table_values, [u'Yes - 1 point', u'Yes', u'Feedback Recorded', u'Feedback Recorded'] ) self.assertEqual( self.staff_area_page.status_text('staff__assessments')[5], self.generate_feedback("staff", "criterion") ) self.assertEqual( self.staff_area_page.overall_feedback('staff__assessments'), self.generate_feedback("staff", "overall") ) self.assertEqual( self.staff_area_page.status_text('self__assessments')[5], self.generate_feedback("self", "criterion") ) self.assertEqual( self.staff_area_page.overall_feedback('self__assessments'), self.generate_feedback("self", "overall") ) # Verify correct score is shown self.staff_area_page.verify_learner_final_score("Final grade: 1 out of 1") class MultipleOpenAssessmentTest(OpenAssessmentTest, MultipleOpenAssessmentMixin): """ Test the multiple peer-assessment flow. """ def setUp(self): super(MultipleOpenAssessmentTest, self).setUp('multiple_ora') # Staff area page is not present in OpenAssessmentTest base class, so we are adding it here. self.staff_area_page = StaffAreaPage(self.browser, self.problem_loc) @retry() @attr('acceptance') def test_multiple_ora_complete_flow(self): """ Scenario: complete workflow on a unit containing multiple ORA blocks. """ # Each problem has vertical index assigned and has a `vert-{vertical_index}` top level class. # That also means that all pages are being differentiated by their vertical index number that is assigned to # each problem type. We are passing vertical index number and setting it by `self.setup_vertical_index` method # so as to move to a different problem. # Assess first ORA problem, pass the vertical index number self.assess_component(0) # Assess second ORA problem, pass the vertical index number self.assess_component(1) if __name__ == "__main__": # Configure the screenshot directory if 'SCREENSHOT_DIR' not in os.environ: tests_dir = os.path.dirname(__file__) os.environ['SCREENSHOT_DIR'] = os.path.join(tests_dir, 'screenshots') unittest.main()
Stanford-Online/edx-ora2
test/acceptance/tests.py
Python
agpl-3.0
52,571
[ "VisIt" ]
65db6cf122d7a9d24c5888db895da0e27af397fce1dfa6ddf1659a0ac9f46de0
# # This Juno application runs my site (http://brianreily.com). # # It has been modified for added comments and improved readability. # If you are interested in the full project for this site (i.e. with # templates, static file setup, etc.), see my Github repository for it: # http://github.com/breily/brianreily.com # from juno import * # Initialize the database, and set Juno to run the SCGI server init({'db_location': 'brian.db', 'mode': 'scgi'}) # Represents software with READMEs/repositories Project = model('Project', name = 'string', about = 'string', # Short description readme = 'string', # Location of the README repo = 'string', # URL of Github repository status = 'int', # Current/Completed/Old # Replace the built in __repr__ with a more # descriptive version of it. __repr__ = lambda self: '<Project: %s>' %self.name) # Represents shorter pieces of code (without READMEs/repositories) Code = model('Code', name = 'string', about = 'string', # Short description gist_id = 'int', # ID of the Github Gist __repr__ = lambda self: '<Code: %s>' %self.name) # Redirect these two URLs to the home page; I didn't want separate list pages assign(['/project/', '/code/'], '/') # The home page - lists all Project and Code items @get('/') def home(web): projects = find(Project).all() # Retrieve Project items code = find(Code).all() # Retrieve Code items # Render the main template, while splitting Projects based on status template('main.html', { 'current_projects': [p for p in projects if p.status == 0], 'complete_projects': [p for p in projects if p.status == 1], 'incomplete_projects': [p for p in projects if p.status == 2], 'code': code }) # Currently checks for Project existence and returns the README @get('/project/:name/') def project(web, name): # Check if a project with a similar/same name exists # This just uses SQLAlchemy's filter() function proj = find(Project).filter(Project.name.like('%' + name + '%')).all() # If not found, return a 404 if len(proj) == 0: return notfound("That Project (%s) cannot be found" %name) # Return the README file, as plain text yield_file(proj[0].readme, type='text/plain') # Currently checks for Code existence, and renders the generic Code template @get('/code/:name/') def code(web, name): # Same as in project function c = find(Code).filter(Code.name.like('%' + name + '%')).all() if len(c) == 0: return notfound("That Code (%s) cannot be found" %name) # Render the generic code template (which has javascript to insert the Gist) template('code.html', { 'c': c[0] }) # Run Juno if __name__ == '__main__': run()
breily/juno
doc/examples/basic_site.py
Python
mit
3,013
[ "Brian" ]
6d5edf4aae28b00dde4c735705ed6edd01ba55bf65a67a92f25fbf31a5fda7d7
# convert -scale 30% /tmp/sim/*.png /tmp/balls6.gif from random import random from collections import defaultdict import numpy as np, datetime import sys, numpy.linalg as lin from mayavi import mlab G = np.array([0.0, 0.0, -0.8]) m = 0.1 B = 8 # top EPS = 0.1 BOUND_DAMPING = -0.6 class Simulation: def __init__(self): self.r = 0.2 self.rvec = np.ones(B) * self.r self.dt = 0.1 self.balls = [] self.cor = 0.5 self.mmax = 2.0-self.r self.mmin = 0.0+self.r def init(self): for b in range(B): v = np.array([0.0, 0.0, 0.0]) p = np.array([np.random.rand(), np.random.rand(), np.random.rand()]) f = 5*np.array([np.random.rand(), np.random.rand(), np.random.rand()]) self.balls.append({'x':p, 'f':f, 'v': v, 'i': b}) def computeForces(self, i): if (i==0): for j,b in enumerate(self.balls): b['f'] = b['f'] + (G * m) else: for b in self.balls: b['f'] = G * m def integrate(self): for j,p in enumerate(self.balls): p['v'] += self.dt*(p['f']/m) p['x'] += self.dt*p['v'] if p['x'][0]-EPS < 0: p['v'][0] *= BOUND_DAMPING p['x'][0] = 0 if p['x'][0]+EPS > 2.0: p['v'][0] *= BOUND_DAMPING p['x'][0] = 2.0-EPS if p['x'][1]-EPS < 0: p['v'][1] *= BOUND_DAMPING p['x'][1] = 0 if p['x'][1]+EPS > 2.0: p['v'][1] *= BOUND_DAMPING p['x'][1] = 2.0-EPS if p['x'][2]-EPS < 0: p['v'][2] *= BOUND_DAMPING p['x'][2] = 0 if p['x'][2]+EPS > 2.0: p['v'][2] *= BOUND_DAMPING p['x'][2] = 2.0-EPS vDone = {} for j,b in enumerate(self.balls): for other in self.balls: if (other['i'] != b['i'] and b['i'] not in vDone and other['i'] not in vDone): dist = lin.norm(other['x']-b['x']) if (dist < (2*self.r)): #print ('collision') vrel = b['v']-other['v'] n = (other['x']-b['x']) / dist vnorm = np.dot(vrel,n)*n #print (vnorm) b['v'] = b['v'] - vnorm other['v'] = other['v'] + vnorm vDone[b['i']] = 1 vDone[other['i']] = 1 def update(self,i): self.computeForces(i) self.integrate() def display(self, i): mlab.options.offscreen = True ball_vect = [[b['x'][0],b['x'][1],b['x'][2]] for b in self.balls] ball_vect = np.array(ball_vect) fig = mlab.figure(figure=None, fgcolor=(0., 0., 0.), bgcolor=(1, 1, 1), engine=None) color=(0.2, 0.4, 0.5) mlab.points3d(ball_vect[:,0], ball_vect[:,1], ball_vect[:,2], self.rvec, color=color, colormap = 'gnuplot', scale_factor=1, figure=fig) mlab.points3d(0, 0, 0, 0.1, color=(1,0,0), scale_factor=1.0) BS = 2.0 mlab.plot3d([0.0,0.0],[0.0, 0.0],[0.0, BS], color=(0,0,0), tube_radius=None, figure=fig) mlab.plot3d([0.0,BS],[0.0, 0.0],[0.0, 0.0], color=(1,0,0), tube_radius=None, figure=fig) mlab.plot3d([0.0,0.0],[0.0, BS],[0.0, 0.0], color=(0,1,0), tube_radius=None, figure=fig) mlab.plot3d([0.0,0.0],[0.0, BS],[BS, BS], color=(0,0,0), tube_radius=None, figure=fig) mlab.plot3d([0.0,BS],[0.0,0.0],[BS,BS], color=(0,0,0), tube_radius=None, figure=fig) mlab.plot3d([BS,BS],[0.0,BS],[BS,BS], color=(0,0,0), tube_radius=None, figure=fig) mlab.plot3d([BS,0],[BS,BS],[BS,BS], color=(0,0,0), tube_radius=None, figure=fig) mlab.plot3d([0,0],[BS,BS],[BS,0], color=(0,0,0), tube_radius=None, figure=fig) mlab.plot3d([BS,BS],[0.0,0.0],[0.0,BS], color=(0,0,0), tube_radius=None, figure=fig) mlab.plot3d([BS,BS],[0.0,BS],[0.0,0.0], color=(0,0,0), tube_radius=None, figure=fig) mlab.plot3d([BS,0.0],[BS,BS],[0.0,0.0], color=(0,0,0), tube_radius=None, figure=fig) mlab.plot3d([BS,BS],[BS,BS],[0.0,BS], color=(0,0,0), tube_radius=None, figure=fig) mlab.view(azimuth=50, elevation=80, focalpoint=[1, 1, 1], distance=8.0, figure=fig) mlab.savefig(filename='/tmp/sim/out-%02d.png' % i) #exit() if __name__ == '__main__': s = Simulation() s.init() for i in range(40): s.update(i) s.display(i) #exit()
burakbayramli/dersblog
compscieng/compscieng_bpp30sim/sim.py
Python
gpl-3.0
4,829
[ "Mayavi" ]
493cbb2003fb1b5763aedce62e2e937448c00a4aa07a3615d193126c2bc265de
from graphql.core.language.ast import Field, Name, SelectionSet from graphql.core.language.parser import parse from graphql.core.language.visitor import visit, Visitor, REMOVE, BREAK from fixtures import KITCHEN_SINK def test_allows_for_editing_on_enter(): ast = parse('{ a, b, c { a, b, c } }', no_location=True) class TestVisitor(Visitor): def enter(self, node, *args): if isinstance(node, Field) and node.name.value == 'b': return REMOVE edited_ast = visit(ast, TestVisitor()) assert ast == parse('{ a, b, c { a, b, c } }', no_location=True) assert edited_ast == parse('{ a, c { a, c } }', no_location=True) def test_allows_for_editing_on_leave(): ast = parse('{ a, b, c { a, b, c } }', no_location=True) class TestVisitor(Visitor): def leave(self, node, *args): if isinstance(node, Field) and node.name.value == 'b': return REMOVE edited_ast = visit(ast, TestVisitor()) assert ast == parse('{ a, b, c { a, b, c } }', no_location=True) assert edited_ast == parse('{ a, c { a, c } }', no_location=True) def test_visits_edited_node(): added_field = Field(name=Name(value='__typename')) ast = parse('{ a { x } }') class TestVisitor(Visitor): def __init__(self): self.did_visit_added_field = False def enter(self, node, *args): if isinstance(node, Field) and node.name.value == 'a': selection_set = node.selection_set selections = [] if selection_set: selections = selection_set.selections new_selection_set = SelectionSet(selections=[added_field] + selections) return Field(name=None, selection_set=new_selection_set) if node is added_field: self.did_visit_added_field = True visitor = TestVisitor() visit(ast, visitor) assert visitor.did_visit_added_field def test_allows_skipping_a_subtree(): visited = [] ast = parse('{ a, b { x }, c }') class TestVisitor(Visitor): def enter(self, node, *args): visited.append(['enter', type(node).__name__, getattr(node, 'value', None)]) if isinstance(node, Field) and node.name.value == 'b': return False def leave(self, node, *args): visited.append(['leave', type(node).__name__, getattr(node, 'value', None)]) visit(ast, TestVisitor()) assert visited == [ [ 'enter', 'Document', None ], [ 'enter', 'OperationDefinition', None ], [ 'enter', 'SelectionSet', None ], [ 'enter', 'Field', None ], [ 'enter', 'Name', 'a' ], [ 'leave', 'Name', 'a' ], [ 'leave', 'Field', None ], [ 'enter', 'Field', None ], [ 'enter', 'Field', None ], [ 'enter', 'Name', 'c' ], [ 'leave', 'Name', 'c' ], [ 'leave', 'Field', None ], [ 'leave', 'SelectionSet', None ], [ 'leave', 'OperationDefinition', None ], [ 'leave', 'Document', None ], ] def test_allows_early_exit_while_visiting(): visited = [] ast = parse('{ a, b { x }, c }') class TestVisitor(Visitor): def enter(self, node, *args): visited.append(['enter', type(node).__name__, getattr(node, 'value', None)]) if isinstance(node, Name) and node.value == 'x': return BREAK def leave(self, node, *args): visited.append(['leave', type(node).__name__, getattr(node, 'value', None)]) visit(ast, TestVisitor()) assert visited == [ [ 'enter', 'Document', None ], [ 'enter', 'OperationDefinition', None ], [ 'enter', 'SelectionSet', None ], [ 'enter', 'Field', None ], [ 'enter', 'Name', 'a' ], [ 'leave', 'Name', 'a' ], [ 'leave', 'Field', None ], [ 'enter', 'Field', None ], [ 'enter', 'Name', 'b' ], [ 'leave', 'Name', 'b' ], [ 'enter', 'SelectionSet', None ], [ 'enter', 'Field', None ], [ 'enter', 'Name', 'x' ], ] def test_allows_a_named_functions_visitor_api(): visited = [] ast = parse('{ a, b { x }, c }') class TestVisitor(Visitor): def enter_Name(self, node, *args): visited.append(['enter', type(node).__name__, getattr(node, 'value', None)]) def enter_SelectionSet(self, node, *args): visited.append(['enter', type(node).__name__, getattr(node, 'value', None)]) def leave_SelectionSet(self, node, *args): visited.append(['leave', type(node).__name__, getattr(node, 'value', None)]) visit(ast, TestVisitor()) assert visited == [ [ 'enter', 'SelectionSet', None ], [ 'enter', 'Name', 'a' ], [ 'enter', 'Name', 'b' ], [ 'enter', 'SelectionSet', None ], [ 'enter', 'Name', 'x' ], [ 'leave', 'SelectionSet', None ], [ 'enter', 'Name', 'c' ], [ 'leave', 'SelectionSet', None ], ] def test_visits_kitchen_sink(): visited = [] ast = parse(KITCHEN_SINK) class TestVisitor(Visitor): def enter(self, node, key, parent, *args): kind = parent and type(parent).__name__ if kind == 'list': kind = None visited.append(['enter', type(node).__name__, key, kind]) def leave(self, node, key, parent, *args): kind = parent and type(parent).__name__ if kind == 'list': kind = None visited.append(['leave', type(node).__name__, key, kind]) visit(ast, TestVisitor()) assert visited == [ [ 'enter', 'Document', None, None ], [ 'enter', 'OperationDefinition', 0, None ], [ 'enter', 'Name', 'name', 'OperationDefinition' ], [ 'leave', 'Name', 'name', 'OperationDefinition' ], [ 'enter', 'VariableDefinition', 0, None ], [ 'enter', 'Variable', 'variable', 'VariableDefinition' ], [ 'enter', 'Name', 'name', 'Variable' ], [ 'leave', 'Name', 'name', 'Variable' ], [ 'leave', 'Variable', 'variable', 'VariableDefinition' ], [ 'enter', 'NamedType', 'type', 'VariableDefinition' ], [ 'enter', 'Name', 'name', 'NamedType' ], [ 'leave', 'Name', 'name', 'NamedType' ], [ 'leave', 'NamedType', 'type', 'VariableDefinition' ], [ 'leave', 'VariableDefinition', 0, None ], [ 'enter', 'VariableDefinition', 1, None ], [ 'enter', 'Variable', 'variable', 'VariableDefinition' ], [ 'enter', 'Name', 'name', 'Variable' ], [ 'leave', 'Name', 'name', 'Variable' ], [ 'leave', 'Variable', 'variable', 'VariableDefinition' ], [ 'enter', 'NamedType', 'type', 'VariableDefinition' ], [ 'enter', 'Name', 'name', 'NamedType' ], [ 'leave', 'Name', 'name', 'NamedType' ], [ 'leave', 'NamedType', 'type', 'VariableDefinition' ], [ 'enter', 'EnumValue', 'default_value', 'VariableDefinition' ], [ 'leave', 'EnumValue', 'default_value', 'VariableDefinition' ], [ 'leave', 'VariableDefinition', 1, None ], [ 'enter', 'SelectionSet', 'selection_set', 'OperationDefinition' ], [ 'enter', 'Field', 0, None ], [ 'enter', 'Name', 'alias', 'Field' ], [ 'leave', 'Name', 'alias', 'Field' ], [ 'enter', 'Name', 'name', 'Field' ], [ 'leave', 'Name', 'name', 'Field' ], [ 'enter', 'Argument', 0, None ], [ 'enter', 'Name', 'name', 'Argument' ], [ 'leave', 'Name', 'name', 'Argument' ], [ 'enter', 'ListValue', 'value', 'Argument' ], [ 'enter', 'IntValue', 0, None ], [ 'leave', 'IntValue', 0, None ], [ 'enter', 'IntValue', 1, None ], [ 'leave', 'IntValue', 1, None ], [ 'leave', 'ListValue', 'value', 'Argument' ], [ 'leave', 'Argument', 0, None ], [ 'enter', 'SelectionSet', 'selection_set', 'Field' ], [ 'enter', 'Field', 0, None ], [ 'enter', 'Name', 'name', 'Field' ], [ 'leave', 'Name', 'name', 'Field' ], [ 'leave', 'Field', 0, None ], [ 'enter', 'InlineFragment', 1, None ], [ 'enter', 'NamedType', 'type_condition', 'InlineFragment' ], [ 'enter', 'Name', 'name', 'NamedType' ], [ 'leave', 'Name', 'name', 'NamedType' ], [ 'leave', 'NamedType', 'type_condition', 'InlineFragment' ], [ 'enter', 'Directive', 0, None ], [ 'enter', 'Name', 'name', 'Directive' ], [ 'leave', 'Name', 'name', 'Directive' ], [ 'leave', 'Directive', 0, None ], [ 'enter', 'SelectionSet', 'selection_set', 'InlineFragment' ], [ 'enter', 'Field', 0, None ], [ 'enter', 'Name', 'name', 'Field' ], [ 'leave', 'Name', 'name', 'Field' ], [ 'enter', 'SelectionSet', 'selection_set', 'Field' ], [ 'enter', 'Field', 0, None ], [ 'enter', 'Name', 'name', 'Field' ], [ 'leave', 'Name', 'name', 'Field' ], [ 'leave', 'Field', 0, None ], [ 'enter', 'Field', 1, None ], [ 'enter', 'Name', 'alias', 'Field' ], [ 'leave', 'Name', 'alias', 'Field' ], [ 'enter', 'Name', 'name', 'Field' ], [ 'leave', 'Name', 'name', 'Field' ], [ 'enter', 'Argument', 0, None ], [ 'enter', 'Name', 'name', 'Argument' ], [ 'leave', 'Name', 'name', 'Argument' ], [ 'enter', 'IntValue', 'value', 'Argument' ], [ 'leave', 'IntValue', 'value', 'Argument' ], [ 'leave', 'Argument', 0, None ], [ 'enter', 'Argument', 1, None ], [ 'enter', 'Name', 'name', 'Argument' ], [ 'leave', 'Name', 'name', 'Argument' ], [ 'enter', 'Variable', 'value', 'Argument' ], [ 'enter', 'Name', 'name', 'Variable' ], [ 'leave', 'Name', 'name', 'Variable' ], [ 'leave', 'Variable', 'value', 'Argument' ], [ 'leave', 'Argument', 1, None ], [ 'enter', 'Directive', 0, None ], [ 'enter', 'Name', 'name', 'Directive' ], [ 'leave', 'Name', 'name', 'Directive' ], [ 'enter', 'Argument', 0, None ], [ 'enter', 'Name', 'name', 'Argument' ], [ 'leave', 'Name', 'name', 'Argument' ], [ 'enter', 'Variable', 'value', 'Argument' ], [ 'enter', 'Name', 'name', 'Variable' ], [ 'leave', 'Name', 'name', 'Variable' ], [ 'leave', 'Variable', 'value', 'Argument' ], [ 'leave', 'Argument', 0, None ], [ 'leave', 'Directive', 0, None ], [ 'enter', 'SelectionSet', 'selection_set', 'Field' ], [ 'enter', 'Field', 0, None ], [ 'enter', 'Name', 'name', 'Field' ], [ 'leave', 'Name', 'name', 'Field' ], [ 'leave', 'Field', 0, None ], [ 'enter', 'FragmentSpread', 1, None ], [ 'enter', 'Name', 'name', 'FragmentSpread' ], [ 'leave', 'Name', 'name', 'FragmentSpread' ], [ 'leave', 'FragmentSpread', 1, None ], [ 'leave', 'SelectionSet', 'selection_set', 'Field' ], [ 'leave', 'Field', 1, None ], [ 'leave', 'SelectionSet', 'selection_set', 'Field' ], [ 'leave', 'Field', 0, None ], [ 'leave', 'SelectionSet', 'selection_set', 'InlineFragment' ], [ 'leave', 'InlineFragment', 1, None ], [ 'leave', 'SelectionSet', 'selection_set', 'Field' ], [ 'leave', 'Field', 0, None ], [ 'leave', 'SelectionSet', 'selection_set', 'OperationDefinition' ], [ 'leave', 'OperationDefinition', 0, None ], [ 'enter', 'OperationDefinition', 1, None ], [ 'enter', 'Name', 'name', 'OperationDefinition' ], [ 'leave', 'Name', 'name', 'OperationDefinition' ], [ 'enter', 'SelectionSet', 'selection_set', 'OperationDefinition' ], [ 'enter', 'Field', 0, None ], [ 'enter', 'Name', 'name', 'Field' ], [ 'leave', 'Name', 'name', 'Field' ], [ 'enter', 'Argument', 0, None ], [ 'enter', 'Name', 'name', 'Argument' ], [ 'leave', 'Name', 'name', 'Argument' ], [ 'enter', 'IntValue', 'value', 'Argument' ], [ 'leave', 'IntValue', 'value', 'Argument' ], [ 'leave', 'Argument', 0, None ], [ 'enter', 'Directive', 0, None ], [ 'enter', 'Name', 'name', 'Directive' ], [ 'leave', 'Name', 'name', 'Directive' ], [ 'leave', 'Directive', 0, None ], [ 'enter', 'SelectionSet', 'selection_set', 'Field' ], [ 'enter', 'Field', 0, None ], [ 'enter', 'Name', 'name', 'Field' ], [ 'leave', 'Name', 'name', 'Field' ], [ 'enter', 'SelectionSet', 'selection_set', 'Field' ], [ 'enter', 'Field', 0, None ], [ 'enter', 'Name', 'name', 'Field' ], [ 'leave', 'Name', 'name', 'Field' ], [ 'leave', 'Field', 0, None ], [ 'leave', 'SelectionSet', 'selection_set', 'Field' ], [ 'leave', 'Field', 0, None ], [ 'leave', 'SelectionSet', 'selection_set', 'Field' ], [ 'leave', 'Field', 0, None ], [ 'leave', 'SelectionSet', 'selection_set', 'OperationDefinition' ], [ 'leave', 'OperationDefinition', 1, None ], [ 'enter', 'FragmentDefinition', 2, None ], [ 'enter', 'Name', 'name', 'FragmentDefinition' ], [ 'leave', 'Name', 'name', 'FragmentDefinition' ], [ 'enter', 'NamedType', 'type_condition', 'FragmentDefinition' ], [ 'enter', 'Name', 'name', 'NamedType' ], [ 'leave', 'Name', 'name', 'NamedType' ], [ 'leave', 'NamedType', 'type_condition', 'FragmentDefinition' ], [ 'enter', 'SelectionSet', 'selection_set', 'FragmentDefinition' ], [ 'enter', 'Field', 0, None ], [ 'enter', 'Name', 'name', 'Field' ], [ 'leave', 'Name', 'name', 'Field' ], [ 'enter', 'Argument', 0, None ], [ 'enter', 'Name', 'name', 'Argument' ], [ 'leave', 'Name', 'name', 'Argument' ], [ 'enter', 'Variable', 'value', 'Argument' ], [ 'enter', 'Name', 'name', 'Variable' ], [ 'leave', 'Name', 'name', 'Variable' ], [ 'leave', 'Variable', 'value', 'Argument' ], [ 'leave', 'Argument', 0, None ], [ 'enter', 'Argument', 1, None ], [ 'enter', 'Name', 'name', 'Argument' ], [ 'leave', 'Name', 'name', 'Argument' ], [ 'enter', 'Variable', 'value', 'Argument' ], [ 'enter', 'Name', 'name', 'Variable' ], [ 'leave', 'Name', 'name', 'Variable' ], [ 'leave', 'Variable', 'value', 'Argument' ], [ 'leave', 'Argument', 1, None ], [ 'enter', 'Argument', 2, None ], [ 'enter', 'Name', 'name', 'Argument' ], [ 'leave', 'Name', 'name', 'Argument' ], [ 'enter', 'ObjectValue', 'value', 'Argument' ], [ 'enter', 'ObjectField', 0, None ], [ 'enter', 'Name', 'name', 'ObjectField' ], [ 'leave', 'Name', 'name', 'ObjectField' ], [ 'enter', 'StringValue', 'value', 'ObjectField' ], [ 'leave', 'StringValue', 'value', 'ObjectField' ], [ 'leave', 'ObjectField', 0, None ], [ 'leave', 'ObjectValue', 'value', 'Argument' ], [ 'leave', 'Argument', 2, None ], [ 'leave', 'Field', 0, None ], [ 'leave', 'SelectionSet', 'selection_set', 'FragmentDefinition' ], [ 'leave', 'FragmentDefinition', 2, None ], [ 'enter', 'OperationDefinition', 3, None ], [ 'enter', 'SelectionSet', 'selection_set', 'OperationDefinition' ], [ 'enter', 'Field', 0, None ], [ 'enter', 'Name', 'name', 'Field' ], [ 'leave', 'Name', 'name', 'Field' ], [ 'enter', 'Argument', 0, None ], [ 'enter', 'Name', 'name', 'Argument' ], [ 'leave', 'Name', 'name', 'Argument' ], [ 'enter', 'BooleanValue', 'value', 'Argument' ], [ 'leave', 'BooleanValue', 'value', 'Argument' ], [ 'leave', 'Argument', 0, None ], [ 'enter', 'Argument', 1, None ], [ 'enter', 'Name', 'name', 'Argument' ], [ 'leave', 'Name', 'name', 'Argument' ], [ 'enter', 'BooleanValue', 'value', 'Argument' ], [ 'leave', 'BooleanValue', 'value', 'Argument' ], [ 'leave', 'Argument', 1, None ], [ 'leave', 'Field', 0, None ], [ 'enter', 'Field', 1, None ], [ 'enter', 'Name', 'name', 'Field' ], [ 'leave', 'Name', 'name', 'Field' ], [ 'leave', 'Field', 1, None ], [ 'leave', 'SelectionSet', 'selection_set', 'OperationDefinition' ], [ 'leave', 'OperationDefinition', 3, None ], [ 'leave', 'Document', None, None ] ]
gabriel-laet/graphql-py
tests/core_language/test_visitor.py
Python
mit
16,608
[ "VisIt" ]
77c3c4785344e2a217864ca9aac60195a2c95046f60407280d421b3f716b3cf5
from datetime import datetime from werkzeug.security import generate_password_hash, check_password_hash from . import login_manager from flask_sqlalchemy import SQLAlchemy import enum #TODO mixin created_at, modified_at print('Initializing database') db = SQLAlchemy() # A registered user class User(db.Model): __tablename__ = 'user' id = db.Column(db.Integer, primary_key=True) username = db.Column(db.String(80), unique=True) email = db.Column(db.String(80), unique=True) password_hash = db.Column(db.String(128)) registration_date = db.Column(db.DateTime(), default=datetime.utcnow) last_seen = db.Column(db.DateTime(), default=datetime.utcnow) # The events a user has created and has the right to modify events_created = db.relationship('Event', back_populates='creator', lazy='joined') # The events a user has subscribed to subscriptions = db.relationship('Subscription', back_populates='user', lazy='joined') @property def subscription_ids(self): #poly-orm rewrite return [ s.event.id for s in self.subscriptions ] def __init__(self, username, password, email=None): self.username = username self.password = password self.email = email def __repr__(self): return '<User {}: {}>'.format(self.id, self.username) @property def password(self): raise AttributeError('password is not a readable attribute') @password.setter def password(self, password): self.password_hash = generate_password_hash(password) def verify_password(self, password): return check_password_hash(self.password_hash, password) def visit(self): self.last_seen = datetime.utcnow() db.session.add(self) def is_authenticated(self): return True def is_active(self): return True @property def is_anonymous(self): return False def get_id(self): return str(self.id) @login_manager.user_loader def load_user(user_id): return User.query.get(int(user_id)) # returns the timedelta as a string (currently english) # if it is less than a minute, returns "now" # if the timedelta is negative, returns "already passed" def timedelta_to_string(rem): def with_word(num, singular, multiple): if num < 0: return '' elif num == 1: return str(num) + ' ' + singular + ' ' else: return str(num) + ' ' + multiple + ' ' if rem.seconds < 60: return 'now' if rem.days < 0: return 'already passed' (minutes, _) = divmod(rem.seconds, 60) (hours, minutes) = divmod(minutes, 60) s = with_word(rem.days, 'day', 'days') s += with_word(hours, 'hour', 'hours') s += with_word(minutes, 'minute', 'minutes') return s.strip() # An event (aka calendar entry) class Event(db.Model): __tablename__ = 'event' id = db.Column(db.Integer, primary_key=True) event_date = db.Column(db.DateTime()) name = db.Column(db.String(80)) description = db.Column(db.Text) # The creator of this particular event creator_id = db.Column(db.Integer, db.ForeignKey('user.id')) creator = db.relationship('User', back_populates='events_created', lazy='joined') # All the users which have subscribed to this event subscriptions = db.relationship('Subscription', back_populates='event', lazy='joined') def __init__(self, event_date, name, description, user_id): self.event_date = event_date self.name = name self.description = description self.creator_id = user_id def __repr__(self): return '<Event {}: {}>'.format(self.id, self.name, self.event_date) @property def remaining_time(self): now = datetime.now() return timedelta_to_string(self.event_date - now) class Commitment(enum.Enum): yes = 'yes' no = 'no' maybe = 'maybe' # A subscription of a user to an event. M to N relation class Subscription(db.Model): __tablename__ = 'subscription' id = db.Column(db.Integer, primary_key=True) user_id = db.Column(db.Integer, db.ForeignKey('user.id')) user = db.relationship('User', back_populates='subscriptions', lazy='joined') event_id = db.Column(db.Integer, db.ForeignKey('event.id')) event = db.relationship('Event', back_populates='subscriptions', lazy='joined') # Whether the user actively takes part in the event or not commitment = db.Column(db.Enum('Yes', 'No', 'Maybe')) # Each user can add a comment (for example the role he is going to play in the event) comment = db.Column(db.Text) def __init__(self, user_id, event_id): self.user_id = user_id self.event_id = event_id self.commitment = 'Yes' def __repr__(self): return '<Subscr {}: {} to {}>'.format(self.id, self.user.username, self.event.name)
alexd2580/evelyn
evelyn/models.py
Python
mit
4,893
[ "VisIt" ]
fac638299b80ede284d5a10a0e6c6213ca76b208b5b780bd02d3fa1a07f2e99c
from ovito import * from ovito.io import * node = import_file("../../files/CFG/shear.void.120.cfg") ptype_property = node.source.particle_type assert(len(ptype_property.type_list) == 3) assert(ptype_property.type_list[0].id == 1) print(ptype_property.type_list[0].id) print(ptype_property.type_list[0].color) print(ptype_property.type_list[0].name) print(ptype_property.type_list[0].radius) print(ptype_property.array)
srinath-chakravarthy/ovito
tests/scripts/test_suite/particle_type.py
Python
gpl-3.0
423
[ "OVITO" ]
888745454aa8548fa01408444bbc8f2909db388875e40f7b5e6fd4f2506e08cd
""" ################################################################################ # Copyright (c) 2003, Pfizer # Copyright (c) 2001, Cayce Ullman. # Copyright (c) 2001, Brian Matthews. # # All rights reserved. # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions are met: # Redistributions of source code must retain the above copyright notice, this # list of conditions and the following disclaimer. # # Redistributions in binary form must reproduce the above copyright notice, # this list of conditions and the following disclaimer in the documentation # and/or other materials provided with the distribution. # # Neither the name of actzero, inc. nor the names of its contributors may # be used to endorse or promote products derived from this software without # specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" # AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE # IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE # ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE FOR # ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES # (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; # LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND # ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT # (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS # SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. # ################################################################################ """ ident = '$Id: Types.py,v 1.19 2005/02/22 04:29:43 warnes Exp $' from version import __version__ from __future__ import nested_scopes import UserList import base64 import cgi import urllib import copy import re import time from types import * # SOAPpy modules from Errors import * from NS import NS from Utilities import encodeHexString, cleanDate from Config import Config ############################################################################### # Utility functions ############################################################################### def isPrivate(name): return name[0]=='_' def isPublic(name): return name[0]!='_' ############################################################################### # Types and Wrappers ############################################################################### class anyType: _validURIs = (NS.XSD, NS.XSD2, NS.XSD3, NS.ENC) def __init__(self, data = None, name = None, typed = 1, attrs = None): if self.__class__ == anyType: raise Error, "anyType can't be instantiated directly" if type(name) in (ListType, TupleType): self._ns, self._name = name else: self._ns = self._validURIs[0] self._name = name self._typed = typed self._attrs = {} self._cache = None self._type = self._typeName() self._data = self._checkValueSpace(data) if attrs != None: self._setAttrs(attrs) def __str__(self): if hasattr(self,'_name') and self._name: return "<%s %s at %d>" % (self.__class__, self._name, id(self)) return "<%s at %d>" % (self.__class__, id(self)) __repr__ = __str__ def _checkValueSpace(self, data): return data def _marshalData(self): return str(self._data) def _marshalAttrs(self, ns_map, builder): a = '' for attr, value in self._attrs.items(): ns, n = builder.genns(ns_map, attr[0]) a += n + ' %s%s="%s"' % \ (ns, attr[1], cgi.escape(str(value), 1)) return a def _fixAttr(self, attr): if type(attr) in (StringType, UnicodeType): attr = (None, attr) elif type(attr) == ListType: attr = tuple(attr) elif type(attr) != TupleType: raise AttributeError, "invalid attribute type" if len(attr) != 2: raise AttributeError, "invalid attribute length" if type(attr[0]) not in (NoneType, StringType, UnicodeType): raise AttributeError, "invalid attribute namespace URI type" return attr def _getAttr(self, attr): attr = self._fixAttr(attr) try: return self._attrs[attr] except: return None def _setAttr(self, attr, value): attr = self._fixAttr(attr) if type(value) is StringType: value = unicode(value) self._attrs[attr] = value def _setAttrs(self, attrs): if type(attrs) in (ListType, TupleType): for i in range(0, len(attrs), 2): self._setAttr(attrs[i], attrs[i + 1]) return if type(attrs) == DictType: d = attrs elif isinstance(attrs, anyType): d = attrs._attrs else: raise AttributeError, "invalid attribute type" for attr, value in d.items(): self._setAttr(attr, value) def _setMustUnderstand(self, val): self._setAttr((NS.ENV, "mustUnderstand"), val) def _getMustUnderstand(self): return self._getAttr((NS.ENV, "mustUnderstand")) def _setActor(self, val): self._setAttr((NS.ENV, "actor"), val) def _getActor(self): return self._getAttr((NS.ENV, "actor")) def _typeName(self): return self.__class__.__name__[:-4] def _validNamespaceURI(self, URI, strict): if not hasattr(self, '_typed') or not self._typed: return None if URI in self._validURIs: return URI if not strict: return self._ns raise AttributeError, \ "not a valid namespace for type %s" % self._type class voidType(anyType): pass class stringType(anyType): def _checkValueSpace(self, data): if data == None: raise ValueError, "must supply initial %s value" % self._type if type(data) not in (StringType, UnicodeType): raise AttributeError, "invalid %s type:" % self._type return data class untypedType(stringType): def __init__(self, data = None, name = None, attrs = None): stringType.__init__(self, data, name, 0, attrs) class IDType(stringType): pass class NCNameType(stringType): pass class NameType(stringType): pass class ENTITYType(stringType): pass class IDREFType(stringType): pass class languageType(stringType): pass class NMTOKENType(stringType): pass class QNameType(stringType): pass class tokenType(anyType): _validURIs = (NS.XSD2, NS.XSD3) __invalidre = '[\n\t]|^ | $| ' def _checkValueSpace(self, data): if data == None: raise ValueError, "must supply initial %s value" % self._type if type(data) not in (StringType, UnicodeType): raise AttributeError, "invalid %s type" % self._type if type(self.__invalidre) == StringType: self.__invalidre = re.compile(self.__invalidre) if self.__invalidre.search(data): raise ValueError, "invalid %s value" % self._type return data class normalizedStringType(anyType): _validURIs = (NS.XSD3,) __invalidre = '[\n\r\t]' def _checkValueSpace(self, data): if data == None: raise ValueError, "must supply initial %s value" % self._type if type(data) not in (StringType, UnicodeType): raise AttributeError, "invalid %s type" % self._type if type(self.__invalidre) == StringType: self.__invalidre = re.compile(self.__invalidre) if self.__invalidre.search(data): raise ValueError, "invalid %s value" % self._type return data class CDATAType(normalizedStringType): _validURIs = (NS.XSD2,) class booleanType(anyType): def __int__(self): return self._data __nonzero__ = __int__ def _marshalData(self): return ['false', 'true'][self._data] def _checkValueSpace(self, data): if data == None: raise ValueError, "must supply initial %s value" % self._type if data in (0, '0', 'false', ''): return 0 if data in (1, '1', 'true'): return 1 raise ValueError, "invalid %s value" % self._type class decimalType(anyType): def _checkValueSpace(self, data): if data == None: raise ValueError, "must supply initial %s value" % self._type if type(data) not in (IntType, LongType, FloatType): raise Error, "invalid %s value" % self._type return data class floatType(anyType): def _checkValueSpace(self, data): if data == None: raise ValueError, "must supply initial %s value" % self._type if type(data) not in (IntType, LongType, FloatType) or \ data < -3.4028234663852886E+38 or \ data > 3.4028234663852886E+38: raise ValueError, "invalid %s value: %s" % (self._type, repr(data)) return data def _marshalData(self): return "%.18g" % self._data # More precision class doubleType(anyType): def _checkValueSpace(self, data): if data == None: raise ValueError, "must supply initial %s value" % self._type if type(data) not in (IntType, LongType, FloatType) or \ data < -1.7976931348623158E+308 or \ data > 1.7976931348623157E+308: raise ValueError, "invalid %s value: %s" % (self._type, repr(data)) return data def _marshalData(self): return "%.18g" % self._data # More precision class durationType(anyType): _validURIs = (NS.XSD3,) def _checkValueSpace(self, data): if data == None: raise ValueError, "must supply initial %s value" % self._type try: # A tuple or a scalar is OK, but make them into a list if type(data) == TupleType: data = list(data) elif type(data) != ListType: data = [data] if len(data) > 6: raise Exception, "too many values" # Now check the types of all the components, and find # the first nonzero element along the way. f = -1 for i in range(len(data)): if data[i] == None: data[i] = 0 continue if type(data[i]) not in \ (IntType, LongType, FloatType): raise Exception, "element %d a bad type" % i if data[i] and f == -1: f = i # If they're all 0, just use zero seconds. if f == -1: self._cache = 'PT0S' return (0,) * 6 # Make sure only the last nonzero element has a decimal fraction # and only the first element is negative. d = -1 for i in range(f, len(data)): if data[i]: if d != -1: raise Exception, \ "all except the last nonzero element must be " \ "integers" if data[i] < 0 and i > f: raise Exception, \ "only the first nonzero element can be negative" elif data[i] != long(data[i]): d = i # Pad the list on the left if necessary. if len(data) < 6: n = 6 - len(data) f += n d += n data = [0] * n + data # Save index of the first nonzero element and the decimal # element for _marshalData. self.__firstnonzero = f self.__decimal = d except Exception, e: raise ValueError, "invalid %s value - %s" % (self._type, e) return tuple(data) def _marshalData(self): if self._cache == None: d = self._data t = 0 if d[self.__firstnonzero] < 0: s = '-P' else: s = 'P' t = 0 for i in range(self.__firstnonzero, len(d)): if d[i]: if i > 2 and not t: s += 'T' t = 1 if self.__decimal == i: s += "%g" % abs(d[i]) else: s += "%d" % long(abs(d[i])) s += ['Y', 'M', 'D', 'H', 'M', 'S'][i] self._cache = s return self._cache class timeDurationType(durationType): _validURIs = (NS.XSD, NS.XSD2, NS.ENC) class dateTimeType(anyType): _validURIs = (NS.XSD3,) def _checkValueSpace(self, data): try: if data == None: data = time.time() if (type(data) in (IntType, LongType)): data = list(time.gmtime(data)[:6]) elif (type(data) == FloatType): f = data - int(data) data = list(time.gmtime(int(data))[:6]) data[5] += f elif type(data) in (ListType, TupleType): if len(data) < 6: raise Exception, "not enough values" if len(data) > 9: raise Exception, "too many values" data = list(data[:6]) cleanDate(data) else: raise Exception, "invalid type" except Exception, e: raise ValueError, "invalid %s value - %s" % (self._type, e) return tuple(data) def _marshalData(self): if self._cache == None: d = self._data s = "%04d-%02d-%02dT%02d:%02d:%02d" % ((abs(d[0]),) + d[1:]) if d[0] < 0: s = '-' + s f = d[5] - int(d[5]) if f != 0: s += ("%g" % f)[1:] s += 'Z' self._cache = s return self._cache class recurringInstantType(anyType): _validURIs = (NS.XSD,) def _checkValueSpace(self, data): try: if data == None: data = list(time.gmtime(time.time())[:6]) if (type(data) in (IntType, LongType)): data = list(time.gmtime(data)[:6]) elif (type(data) == FloatType): f = data - int(data) data = list(time.gmtime(int(data))[:6]) data[5] += f elif type(data) in (ListType, TupleType): if len(data) < 1: raise Exception, "not enough values" if len(data) > 9: raise Exception, "too many values" data = list(data[:6]) if len(data) < 6: data += [0] * (6 - len(data)) f = len(data) for i in range(f): if data[i] == None: if f < i: raise Exception, \ "only leftmost elements can be none" else: f = i break cleanDate(data, f) else: raise Exception, "invalid type" except Exception, e: raise ValueError, "invalid %s value - %s" % (self._type, e) return tuple(data) def _marshalData(self): if self._cache == None: d = self._data e = list(d) neg = '' if not e[0]: e[0] = '--' else: if e[0] < 0: neg = '-' e[0] = abs(e[0]) if e[0] < 100: e[0] = '-' + "%02d" % e[0] else: e[0] = "%04d" % e[0] for i in range(1, len(e)): if e[i] == None or (i < 3 and e[i] == 0): e[i] = '-' else: if e[i] < 0: neg = '-' e[i] = abs(e[i]) e[i] = "%02d" % e[i] if d[5]: f = abs(d[5] - int(d[5])) if f: e[5] += ("%g" % f)[1:] s = "%s%s-%s-%sT%s:%s:%sZ" % ((neg,) + tuple(e)) self._cache = s return self._cache class timeInstantType(dateTimeType): _validURIs = (NS.XSD, NS.XSD2, NS.ENC) class timePeriodType(dateTimeType): _validURIs = (NS.XSD2, NS.ENC) class timeType(anyType): def _checkValueSpace(self, data): try: if data == None: data = time.gmtime(time.time())[3:6] elif (type(data) == FloatType): f = data - int(data) data = list(time.gmtime(int(data))[3:6]) data[2] += f elif type(data) in (IntType, LongType): data = time.gmtime(data)[3:6] elif type(data) in (ListType, TupleType): if len(data) == 9: data = data[3:6] elif len(data) > 3: raise Exception, "too many values" data = [None, None, None] + list(data) if len(data) < 6: data += [0] * (6 - len(data)) cleanDate(data, 3) data = data[3:] else: raise Exception, "invalid type" except Exception, e: raise ValueError, "invalid %s value - %s" % (self._type, e) return tuple(data) def _marshalData(self): if self._cache == None: d = self._data s = '' s = time.strftime("%H:%M:%S", (0, 0, 0) + d + (0, 0, -1)) f = d[2] - int(d[2]) if f != 0: s += ("%g" % f)[1:] s += 'Z' self._cache = s return self._cache class dateType(anyType): def _checkValueSpace(self, data): try: if data == None: data = time.gmtime(time.time())[0:3] elif type(data) in (IntType, LongType, FloatType): data = time.gmtime(data)[0:3] elif type(data) in (ListType, TupleType): if len(data) == 9: data = data[0:3] elif len(data) > 3: raise Exception, "too many values" data = list(data) if len(data) < 3: data += [1, 1, 1][len(data):] data += [0, 0, 0] cleanDate(data) data = data[:3] else: raise Exception, "invalid type" except Exception, e: raise ValueError, "invalid %s value - %s" % (self._type, e) return tuple(data) def _marshalData(self): if self._cache == None: d = self._data s = "%04d-%02d-%02dZ" % ((abs(d[0]),) + d[1:]) if d[0] < 0: s = '-' + s self._cache = s return self._cache class gYearMonthType(anyType): _validURIs = (NS.XSD3,) def _checkValueSpace(self, data): try: if data == None: data = time.gmtime(time.time())[0:2] elif type(data) in (IntType, LongType, FloatType): data = time.gmtime(data)[0:2] elif type(data) in (ListType, TupleType): if len(data) == 9: data = data[0:2] elif len(data) > 2: raise Exception, "too many values" data = list(data) if len(data) < 2: data += [1, 1][len(data):] data += [1, 0, 0, 0] cleanDate(data) data = data[:2] else: raise Exception, "invalid type" except Exception, e: raise ValueError, "invalid %s value - %s" % (self._type, e) return tuple(data) def _marshalData(self): if self._cache == None: d = self._data s = "%04d-%02dZ" % ((abs(d[0]),) + d[1:]) if d[0] < 0: s = '-' + s self._cache = s return self._cache class gYearType(anyType): _validURIs = (NS.XSD3,) def _checkValueSpace(self, data): try: if data == None: data = time.gmtime(time.time())[0:1] elif type(data) in (IntType, LongType, FloatType): data = [data] if type(data) in (ListType, TupleType): if len(data) == 9: data = data[0:1] elif len(data) < 1: raise Exception, "too few values" elif len(data) > 1: raise Exception, "too many values" if type(data[0]) == FloatType: try: s = int(data[0]) except: s = long(data[0]) if s != data[0]: raise Exception, "not integral" data = [s] elif type(data[0]) not in (IntType, LongType): raise Exception, "bad type" else: raise Exception, "invalid type" except Exception, e: raise ValueError, "invalid %s value - %s" % (self._type, e) return data[0] def _marshalData(self): if self._cache == None: d = self._data s = "%04dZ" % abs(d) if d < 0: s = '-' + s self._cache = s return self._cache class centuryType(anyType): _validURIs = (NS.XSD2, NS.ENC) def _checkValueSpace(self, data): try: if data == None: data = time.gmtime(time.time())[0:1] / 100 elif type(data) in (IntType, LongType, FloatType): data = [data] if type(data) in (ListType, TupleType): if len(data) == 9: data = data[0:1] / 100 elif len(data) < 1: raise Exception, "too few values" elif len(data) > 1: raise Exception, "too many values" if type(data[0]) == FloatType: try: s = int(data[0]) except: s = long(data[0]) if s != data[0]: raise Exception, "not integral" data = [s] elif type(data[0]) not in (IntType, LongType): raise Exception, "bad type" else: raise Exception, "invalid type" except Exception, e: raise ValueError, "invalid %s value - %s" % (self._type, e) return data[0] def _marshalData(self): if self._cache == None: d = self._data s = "%02dZ" % abs(d) if d < 0: s = '-' + s self._cache = s return self._cache class yearType(gYearType): _validURIs = (NS.XSD2, NS.ENC) class gMonthDayType(anyType): _validURIs = (NS.XSD3,) def _checkValueSpace(self, data): try: if data == None: data = time.gmtime(time.time())[1:3] elif type(data) in (IntType, LongType, FloatType): data = time.gmtime(data)[1:3] elif type(data) in (ListType, TupleType): if len(data) == 9: data = data[0:2] elif len(data) > 2: raise Exception, "too many values" data = list(data) if len(data) < 2: data += [1, 1][len(data):] data = [0] + data + [0, 0, 0] cleanDate(data, 1) data = data[1:3] else: raise Exception, "invalid type" except Exception, e: raise ValueError, "invalid %s value - %s" % (self._type, e) return tuple(data) def _marshalData(self): if self._cache == None: self._cache = "--%02d-%02dZ" % self._data return self._cache class recurringDateType(gMonthDayType): _validURIs = (NS.XSD2, NS.ENC) class gMonthType(anyType): _validURIs = (NS.XSD3,) def _checkValueSpace(self, data): try: if data == None: data = time.gmtime(time.time())[1:2] elif type(data) in (IntType, LongType, FloatType): data = [data] if type(data) in (ListType, TupleType): if len(data) == 9: data = data[1:2] elif len(data) < 1: raise Exception, "too few values" elif len(data) > 1: raise Exception, "too many values" if type(data[0]) == FloatType: try: s = int(data[0]) except: s = long(data[0]) if s != data[0]: raise Exception, "not integral" data = [s] elif type(data[0]) not in (IntType, LongType): raise Exception, "bad type" if data[0] < 1 or data[0] > 12: raise Exception, "bad value" else: raise Exception, "invalid type" except Exception, e: raise ValueError, "invalid %s value - %s" % (self._type, e) return data[0] def _marshalData(self): if self._cache == None: self._cache = "--%02d--Z" % self._data return self._cache class monthType(gMonthType): _validURIs = (NS.XSD2, NS.ENC) class gDayType(anyType): _validURIs = (NS.XSD3,) def _checkValueSpace(self, data): try: if data == None: data = time.gmtime(time.time())[2:3] elif type(data) in (IntType, LongType, FloatType): data = [data] if type(data) in (ListType, TupleType): if len(data) == 9: data = data[2:3] elif len(data) < 1: raise Exception, "too few values" elif len(data) > 1: raise Exception, "too many values" if type(data[0]) == FloatType: try: s = int(data[0]) except: s = long(data[0]) if s != data[0]: raise Exception, "not integral" data = [s] elif type(data[0]) not in (IntType, LongType): raise Exception, "bad type" if data[0] < 1 or data[0] > 31: raise Exception, "bad value" else: raise Exception, "invalid type" except Exception, e: raise ValueError, "invalid %s value - %s" % (self._type, e) return data[0] def _marshalData(self): if self._cache == None: self._cache = "---%02dZ" % self._data return self._cache class recurringDayType(gDayType): _validURIs = (NS.XSD2, NS.ENC) class hexBinaryType(anyType): _validURIs = (NS.XSD3,) def _checkValueSpace(self, data): if data == None: raise ValueError, "must supply initial %s value" % self._type if type(data) not in (StringType, UnicodeType): raise AttributeError, "invalid %s type" % self._type return data def _marshalData(self): if self._cache == None: self._cache = encodeHexString(self._data) return self._cache class base64BinaryType(anyType): _validURIs = (NS.XSD3,) def _checkValueSpace(self, data): if data == None: raise ValueError, "must supply initial %s value" % self._type if type(data) not in (StringType, UnicodeType): raise AttributeError, "invalid %s type" % self._type return data def _marshalData(self): if self._cache == None: self._cache = base64.encodestring(self._data) return self._cache class base64Type(base64BinaryType): _validURIs = (NS.ENC,) class binaryType(anyType): _validURIs = (NS.XSD, NS.ENC) def __init__(self, data, name = None, typed = 1, encoding = 'base64', attrs = None): anyType.__init__(self, data, name, typed, attrs) self._setAttr('encoding', encoding) def _marshalData(self): if self._cache == None: if self._getAttr((None, 'encoding')) == 'base64': self._cache = base64.encodestring(self._data) else: self._cache = encodeHexString(self._data) return self._cache def _checkValueSpace(self, data): if data == None: raise ValueError, "must supply initial %s value" % self._type if type(data) not in (StringType, UnicodeType): raise AttributeError, "invalid %s type" % self._type return data def _setAttr(self, attr, value): attr = self._fixAttr(attr) if attr[1] == 'encoding': if attr[0] != None or value not in ('base64', 'hex'): raise AttributeError, "invalid encoding" self._cache = None anyType._setAttr(self, attr, value) class anyURIType(anyType): _validURIs = (NS.XSD3,) def _checkValueSpace(self, data): if data == None: raise ValueError, "must supply initial %s value" % self._type if type(data) not in (StringType, UnicodeType): raise AttributeError, "invalid %s type" % self._type return data def _marshalData(self): if self._cache == None: self._cache = urllib.quote(self._data) return self._cache class uriType(anyURIType): _validURIs = (NS.XSD,) class uriReferenceType(anyURIType): _validURIs = (NS.XSD2,) class NOTATIONType(anyType): def __init__(self, data, name = None, typed = 1, attrs = None): if self.__class__ == NOTATIONType: raise Error, "a NOTATION can't be instantiated directly" anyType.__init__(self, data, name, typed, attrs) class ENTITIESType(anyType): def _checkValueSpace(self, data): if data == None: raise ValueError, "must supply initial %s value" % self._type if type(data) in (StringType, UnicodeType): return (data,) if type(data) not in (ListType, TupleType) or \ filter (lambda x: type(x) not in (StringType, UnicodeType), data): raise AttributeError, "invalid %s type" % self._type return data def _marshalData(self): return ' '.join(self._data) class IDREFSType(ENTITIESType): pass class NMTOKENSType(ENTITIESType): pass class integerType(anyType): def _checkValueSpace(self, data): if data == None: raise ValueError, "must supply initial %s value" % self._type if type(data) not in (IntType, LongType): raise ValueError, "invalid %s value" % self._type return data class nonPositiveIntegerType(anyType): _validURIs = (NS.XSD2, NS.XSD3, NS.ENC) def _checkValueSpace(self, data): if data == None: raise ValueError, "must supply initial %s value" % self._type if type(data) not in (IntType, LongType) or data > 0: raise ValueError, "invalid %s value" % self._type return data class non_Positive_IntegerType(nonPositiveIntegerType): _validURIs = (NS.XSD,) def _typeName(self): return 'non-positive-integer' class negativeIntegerType(anyType): _validURIs = (NS.XSD2, NS.XSD3, NS.ENC) def _checkValueSpace(self, data): if data == None: raise ValueError, "must supply initial %s value" % self._type if type(data) not in (IntType, LongType) or data >= 0: raise ValueError, "invalid %s value" % self._type return data class negative_IntegerType(negativeIntegerType): _validURIs = (NS.XSD,) def _typeName(self): return 'negative-integer' class longType(anyType): _validURIs = (NS.XSD2, NS.XSD3, NS.ENC) def _checkValueSpace(self, data): if data == None: raise ValueError, "must supply initial %s value" % self._type if type(data) not in (IntType, LongType) or \ data < -9223372036854775808L or \ data > 9223372036854775807L: raise ValueError, "invalid %s value" % self._type return data class intType(anyType): _validURIs = (NS.XSD2, NS.XSD3, NS.ENC) def _checkValueSpace(self, data): if data == None: raise ValueError, "must supply initial %s value" % self._type if type(data) not in (IntType, LongType) or \ data < -2147483648L or \ data > 2147483647: raise ValueError, "invalid %s value" % self._type return data class shortType(anyType): _validURIs = (NS.XSD2, NS.XSD3, NS.ENC) def _checkValueSpace(self, data): if data == None: raise ValueError, "must supply initial %s value" % self._type if type(data) not in (IntType, LongType) or \ data < -32768 or \ data > 32767: raise ValueError, "invalid %s value" % self._type return data class byteType(anyType): _validURIs = (NS.XSD2, NS.XSD3, NS.ENC) def _checkValueSpace(self, data): if data == None: raise ValueError, "must supply initial %s value" % self._type if type(data) not in (IntType, LongType) or \ data < -128 or \ data > 127: raise ValueError, "invalid %s value" % self._type return data class nonNegativeIntegerType(anyType): _validURIs = (NS.XSD2, NS.XSD3, NS.ENC) def _checkValueSpace(self, data): if data == None: raise ValueError, "must supply initial %s value" % self._type if type(data) not in (IntType, LongType) or data < 0: raise ValueError, "invalid %s value" % self._type return data class non_Negative_IntegerType(nonNegativeIntegerType): _validURIs = (NS.XSD,) def _typeName(self): return 'non-negative-integer' class unsignedLongType(anyType): _validURIs = (NS.XSD2, NS.XSD3, NS.ENC) def _checkValueSpace(self, data): if data == None: raise ValueError, "must supply initial %s value" % self._type if type(data) not in (IntType, LongType) or \ data < 0 or \ data > 18446744073709551615L: raise ValueError, "invalid %s value" % self._type return data class unsignedIntType(anyType): _validURIs = (NS.XSD2, NS.XSD3, NS.ENC) def _checkValueSpace(self, data): if data == None: raise ValueError, "must supply initial %s value" % self._type if type(data) not in (IntType, LongType) or \ data < 0 or \ data > 4294967295L: raise ValueError, "invalid %s value" % self._type return data class unsignedShortType(anyType): _validURIs = (NS.XSD2, NS.XSD3, NS.ENC) def _checkValueSpace(self, data): if data == None: raise ValueError, "must supply initial %s value" % self._type if type(data) not in (IntType, LongType) or \ data < 0 or \ data > 65535: raise ValueError, "invalid %s value" % self._type return data class unsignedByteType(anyType): _validURIs = (NS.XSD2, NS.XSD3, NS.ENC) def _checkValueSpace(self, data): if data == None: raise ValueError, "must supply initial %s value" % self._type if type(data) not in (IntType, LongType) or \ data < 0 or \ data > 255: raise ValueError, "invalid %s value" % self._type return data class positiveIntegerType(anyType): _validURIs = (NS.XSD2, NS.XSD3, NS.ENC) def _checkValueSpace(self, data): if data == None: raise ValueError, "must supply initial %s value" % self._type if type(data) not in (IntType, LongType) or data <= 0: raise ValueError, "invalid %s value" % self._type return data class positive_IntegerType(positiveIntegerType): _validURIs = (NS.XSD,) def _typeName(self): return 'positive-integer' # Now compound types class compoundType(anyType): def __init__(self, data = None, name = None, typed = 1, attrs = None): if self.__class__ == compoundType: raise Error, "a compound can't be instantiated directly" anyType.__init__(self, data, name, typed, attrs) self._keyord = [] if type(data) == DictType: self.__dict__.update(data) def _aslist(self, item=None): if item is not None: return self.__dict__[self._keyord[item]] else: return map( lambda x: self.__dict__[x], self._keyord) def _asdict(self, item=None, encoding=Config.dict_encoding): if item is not None: if type(item) in (UnicodeType,StringType): item = item.encode(encoding) return self.__dict__[item] else: retval = {} def fun(x): retval[x.encode(encoding)] = self.__dict__[x] if hasattr(self, '_keyord'): map( fun, self._keyord) else: for name in dir(self): if isPublic(name): retval[name] = getattr(self,name) return retval def __getitem__(self, item): if type(item) == IntType: return self.__dict__[self._keyord[item]] else: return getattr(self, item) def __len__(self): return len(self._keyord) def __nonzero__(self): return 1 def _keys(self): return filter(lambda x: x[0] != '_', self.__dict__.keys()) def _addItem(self, name, value, attrs = None): if name in self._keyord: if type(self.__dict__[name]) != ListType: self.__dict__[name] = [self.__dict__[name]] self.__dict__[name].append(value) else: self.__dict__[name] = value self._keyord.append(name) def _placeItem(self, name, value, pos, subpos = 0, attrs = None): if subpos == 0 and type(self.__dict__[name]) != ListType: self.__dict__[name] = value else: self.__dict__[name][subpos] = value self._keyord[pos] = name def _getItemAsList(self, name, default = []): try: d = self.__dict__[name] except: return default if type(d) == ListType: return d return [d] def __str__(self): return anyType.__str__(self) + ": " + str(self._asdict()) def __repr__(self): return self.__str__() class structType(compoundType): pass class headerType(structType): _validURIs = (NS.ENV,) def __init__(self, data = None, typed = 1, attrs = None): structType.__init__(self, data, "Header", typed, attrs) class bodyType(structType): _validURIs = (NS.ENV,) def __init__(self, data = None, typed = 1, attrs = None): structType.__init__(self, data, "Body", typed, attrs) class arrayType(UserList.UserList, compoundType): def __init__(self, data = None, name = None, attrs = None, offset = 0, rank = None, asize = 0, elemsname = None): if data: if type(data) not in (ListType, TupleType): raise Error, "Data must be a sequence" UserList.UserList.__init__(self, data) compoundType.__init__(self, data, name, 0, attrs) self._elemsname = elemsname or "item" if data == None: self._rank = rank # According to 5.4.2.2 in the SOAP spec, each element in a # sparse array must have a position. _posstate keeps track of # whether we've seen a position or not. It's possible values # are: # -1 No elements have been added, so the state is indeterminate # 0 An element without a position has been added, so no # elements can have positions # 1 An element with a position has been added, so all elements # must have positions self._posstate = -1 self._full = 0 if asize in ('', None): asize = '0' self._dims = map (lambda x: int(x), str(asize).split(',')) self._dims.reverse() # It's easier to work with this way self._poss = [0] * len(self._dims) # This will end up # reversed too for i in range(len(self._dims)): if self._dims[i] < 0 or \ self._dims[i] == 0 and len(self._dims) > 1: raise TypeError, "invalid Array dimensions" if offset > 0: self._poss[i] = offset % self._dims[i] offset = int(offset / self._dims[i]) # Don't break out of the loop if offset is 0 so we test all the # dimensions for > 0. if offset: raise AttributeError, "invalid Array offset" a = [None] * self._dims[0] for i in range(1, len(self._dims)): b = [] for j in range(self._dims[i]): b.append(copy.deepcopy(a)) a = b self.data = a def _aslist(self, item=None): if item is not None: return self.data[int(item)] else: return self.data def _asdict(self, item=None, encoding=Config.dict_encoding): if item is not None: if type(item) in (UnicodeType,StringType): item = item.encode(encoding) return self.data[int(item)] else: retval = {} def fun(x): retval[str(x).encode(encoding)] = self.data[x] map( fun, range(len(self.data)) ) return retval def __getitem__(self, item): try: return self.data[int(item)] except ValueError: return getattr(self, item) def __len__(self): return len(self.data) def __nonzero__(self): return 1 def __str__(self): return anyType.__str__(self) + ": " + str(self._aslist()) def _keys(self): return filter(lambda x: x[0] != '_', self.__dict__.keys()) def _addItem(self, name, value, attrs): if self._full: raise ValueError, "Array is full" pos = attrs.get((NS.ENC, 'position')) if pos != None: if self._posstate == 0: raise AttributeError, \ "all elements in a sparse Array must have a " \ "position attribute" self._posstate = 1 try: if pos[0] == '[' and pos[-1] == ']': pos = map (lambda x: int(x), pos[1:-1].split(',')) pos.reverse() if len(pos) == 1: pos = pos[0] curpos = [0] * len(self._dims) for i in range(len(self._dims)): curpos[i] = pos % self._dims[i] pos = int(pos / self._dims[i]) if pos == 0: break if pos: raise Exception elif len(pos) != len(self._dims): raise Exception else: for i in range(len(self._dims)): if pos[i] >= self._dims[i]: raise Exception curpos = pos else: raise Exception except: raise AttributeError, \ "invalid Array element position %s" % str(pos) else: if self._posstate == 1: raise AttributeError, \ "only elements in a sparse Array may have a " \ "position attribute" self._posstate = 0 curpos = self._poss a = self.data for i in range(len(self._dims) - 1, 0, -1): a = a[curpos[i]] if curpos[0] >= len(a): a += [None] * (len(a) - curpos[0] + 1) a[curpos[0]] = value if pos == None: self._poss[0] += 1 for i in range(len(self._dims) - 1): if self._poss[i] < self._dims[i]: break self._poss[i] = 0 self._poss[i + 1] += 1 if self._dims[-1] and self._poss[-1] >= self._dims[-1]: #self._full = 1 #FIXME: why is this occuring? pass def _placeItem(self, name, value, pos, subpos, attrs = None): curpos = [0] * len(self._dims) for i in range(len(self._dims)): if self._dims[i] == 0: curpos[0] = pos break curpos[i] = pos % self._dims[i] pos = int(pos / self._dims[i]) if pos == 0: break if self._dims[i] != 0 and pos: raise Error, "array index out of range" a = self.data for i in range(len(self._dims) - 1, 0, -1): a = a[curpos[i]] if curpos[0] >= len(a): a += [None] * (len(a) - curpos[0] + 1) a[curpos[0]] = value class typedArrayType(arrayType): def __init__(self, data = None, name = None, typed = None, attrs = None, offset = 0, rank = None, asize = 0, elemsname = None, complexType = 0): arrayType.__init__(self, data, name, attrs, offset, rank, asize, elemsname) self._typed = 1 self._type = typed self._complexType = complexType class faultType(structType, Error): def __init__(self, faultcode = "", faultstring = "", detail = None): self.faultcode = faultcode self.faultstring = faultstring if detail != None: self.detail = detail structType.__init__(self, None, 0) def _setDetail(self, detail = None): if detail != None: self.detail = detail else: try: del self.detail except AttributeError: pass def __repr__(self): if getattr(self, 'detail', None) != None: return "<Fault %s: %s: %s>" % (self.faultcode, self.faultstring, self.detail) else: return "<Fault %s: %s>" % (self.faultcode, self.faultstring) __str__ = __repr__ def __call__(self): return (self.faultcode, self.faultstring, self.detail) class SOAPException(Exception): def __init__(self, code="", string="", detail=None): self.value = ("SOAPpy SOAP Exception", code, string, detail) self.code = code self.string = string self.detail = detail def __str__(self): return repr(self.value) class RequiredHeaderMismatch(Exception): def __init__(self, value): self.value = value def __str__(self): return repr(self.value) class MethodNotFound(Exception): def __init__(self, value): (val, detail) = value.split(":") self.value = val self.detail = detail def __str__(self): return repr(self.value, self.detail) class AuthorizationFailed(Exception): def __init__(self, value): self.value = value def __str__(self): return repr(self.value) class MethodFailed(Exception): def __init__(self, value): self.value = value def __str__(self): return repr(self.value) ####### # Convert complex SOAPpy objects to native python equivalents ####### def simplify(object, level=0): """ Convert the SOAPpy objects and thier contents to simple python types. This function recursively converts the passed 'container' object, and all public subobjects. (Private subobjects have names that start with '_'.) Conversions: - faultType --> raise python exception - arrayType --> array - compoundType --> dictionary """ if level > 10: return object if isinstance( object, faultType ): if object.faultstring == "Required Header Misunderstood": raise RequiredHeaderMismatch(object.detail) elif object.faultstring == "Method Not Found": raise MethodNotFound(object.detail) elif object.faultstring == "Authorization Failed": raise AuthorizationFailed(object.detail) elif object.faultstring == "Method Failed": raise MethodFailed(object.detail) else: se = SOAPException(object.faultcode, object.faultstring, object.detail) raise se elif isinstance( object, arrayType ): data = object._aslist() for k in range(len(data)): data[k] = simplify(data[k], level=level+1) return data elif isinstance( object, compoundType ) or isinstance(object, structType): data = object._asdict() for k in data.keys(): if isPublic(k): data[k] = simplify(data[k], level=level+1) return data elif type(object)==DictType: for k in object.keys(): if isPublic(k): object[k] = simplify(object[k]) return object elif type(object)==list: for k in range(len(object)): object[k] = simplify(object[k]) return object else: return object def simplify_contents(object, level=0): """ Convert the contents of SOAPpy objects to simple python types. This function recursively converts the sub-objects contained in a 'container' object to simple python types. Conversions: - faultType --> raise python exception - arrayType --> array - compoundType --> dictionary """ if level>10: return object if isinstance( object, faultType ): for k in object._keys(): if isPublic(k): setattr(object, k, simplify(object[k], level=level+1)) raise object elif isinstance( object, arrayType ): data = object._aslist() for k in range(len(data)): object[k] = simplify(data[k], level=level+1) elif isinstance(object, structType): data = object._asdict() for k in data.keys(): if isPublic(k): setattr(object, k, simplify(data[k], level=level+1)) elif isinstance( object, compoundType ) : data = object._asdict() for k in data.keys(): if isPublic(k): object[k] = simplify(data[k], level=level+1) elif type(object)==DictType: for k in object.keys(): if isPublic(k): object[k] = simplify(object[k]) elif type(object)==list: for k in range(len(object)): object[k] = simplify(object[k]) return object
audaciouscode/Books-Mac-OS-X
Export Plugins/WhatsOnMyBookShelf Exporter/SOAPpy/Types.py
Python
mit
51,871
[ "Brian" ]
068dd60d06b64699e19ef4c5554e91eb2188d9dbf91492a6aee95e29cfa324e7
"""Analyze python import statements.""" from __future__ import absolute_import, print_function import ast import os import uuid from lib.util import ( display, ApplicationError, ) VIRTUAL_PACKAGES = set([ 'ansible.module_utils.six', ]) def get_python_module_utils_imports(compile_targets): """Return a dictionary of module_utils names mapped to sets of python file paths. :type compile_targets: list[TestTarget] :rtype: dict[str, set[str]] """ module_utils = enumerate_module_utils() virtual_utils = set(m for m in module_utils if any(m.startswith('%s.' % v) for v in VIRTUAL_PACKAGES)) module_utils -= virtual_utils imports_by_target_path = {} for target in compile_targets: imports_by_target_path[target.path] = extract_python_module_utils_imports(target.path, module_utils) def recurse_import(import_name, depth=0, seen=None): """Recursively expand module_utils imports from module_utils files. :type import_name: str :type depth: int :type seen: set[str] | None :rtype set[str] """ display.info('module_utils import: %s%s' % (' ' * depth, import_name), verbosity=4) if seen is None: seen = set([import_name]) results = set([import_name]) # virtual packages depend on the modules they contain instead of the reverse if import_name in VIRTUAL_PACKAGES: for sub_import in sorted(virtual_utils): if sub_import.startswith('%s.' % import_name): if sub_import in seen: continue seen.add(sub_import) matches = sorted(recurse_import(sub_import, depth + 1, seen)) for result in matches: results.add(result) import_path = os.path.join('lib/', '%s.py' % import_name.replace('.', '/')) if import_path not in imports_by_target_path: import_path = os.path.join('lib/', import_name.replace('.', '/'), '__init__.py') if import_path not in imports_by_target_path: raise ApplicationError('Cannot determine path for module_utils import: %s' % import_name) # process imports in reverse so the deepest imports come first for name in sorted(imports_by_target_path[import_path], reverse=True): if name in virtual_utils: continue if name in seen: continue seen.add(name) matches = sorted(recurse_import(name, depth + 1, seen)) for result in matches: results.add(result) return results for module_util in module_utils: # recurse over module_utils imports while excluding self module_util_imports = recurse_import(module_util) module_util_imports.remove(module_util) # add recursive imports to all path entries which import this module_util for target_path in imports_by_target_path: if module_util in imports_by_target_path[target_path]: for module_util_import in sorted(module_util_imports): if module_util_import not in imports_by_target_path[target_path]: display.info('%s inherits import %s via %s' % (target_path, module_util_import, module_util), verbosity=6) imports_by_target_path[target_path].add(module_util_import) imports = dict([(module_util, set()) for module_util in module_utils | virtual_utils]) for target_path in imports_by_target_path: for module_util in imports_by_target_path[target_path]: imports[module_util].add(target_path) # for purposes of mapping module_utils to paths, treat imports of virtual utils the same as the parent package for virtual_util in virtual_utils: parent_package = '.'.join(virtual_util.split('.')[:-1]) imports[virtual_util] = imports[parent_package] display.info('%s reports imports from parent package %s' % (virtual_util, parent_package), verbosity=6) for module_util in sorted(imports): if not len(imports[module_util]): display.warning('No imports found which use the "%s" module_util.' % module_util) return imports def enumerate_module_utils(): """Return a list of available module_utils imports. :rtype: set[str] """ module_utils = [] base_path = 'lib/ansible/module_utils' for root, _, file_names in os.walk(base_path): for file_name in file_names: path = os.path.join(root, file_name) name, ext = os.path.splitext(file_name) if path == 'lib/ansible/module_utils/__init__.py': continue if ext != '.py': continue if name == '__init__': module_util = root else: module_util = os.path.join(root, name) module_utils.append(module_util[4:].replace('/', '.')) return set(module_utils) def extract_python_module_utils_imports(path, module_utils): """Return a list of module_utils imports found in the specified source file. :type path: str :type module_utils: set[str] :rtype: set[str] """ with open(path, 'r') as module_fd: code = module_fd.read() try: tree = ast.parse(code) except SyntaxError as ex: # Setting the full path to the filename results in only the filename being given for str(ex). # As a work-around, set the filename to a UUID and replace it in the final string output with the actual path. ex.filename = str(uuid.uuid4()) error = str(ex).replace(ex.filename, path) raise ApplicationError('AST parse error: %s' % error) finder = ModuleUtilFinder(path, module_utils) finder.visit(tree) return finder.imports class ModuleUtilFinder(ast.NodeVisitor): """AST visitor to find valid module_utils imports.""" def __init__(self, path, module_utils): """Return a list of module_utils imports found in the specified source file. :type path: str :type module_utils: set[str] """ self.path = path self.module_utils = module_utils self.imports = set() # implicitly import parent package if path.endswith('/__init__.py'): path = os.path.split(path)[0] if path.startswith('lib/ansible/module_utils/'): package = os.path.split(path)[0].replace('/', '.')[4:] if package != 'ansible.module_utils' and package not in VIRTUAL_PACKAGES: self.add_import(package, 0) # noinspection PyPep8Naming # pylint: disable=locally-disabled, invalid-name def visit_Import(self, node): """ :type node: ast.Import """ self.generic_visit(node) for alias in node.names: if alias.name.startswith('ansible.module_utils.'): # import ansible.module_utils.MODULE[.MODULE] self.add_import(alias.name, node.lineno) # noinspection PyPep8Naming # pylint: disable=locally-disabled, invalid-name def visit_ImportFrom(self, node): """ :type node: ast.ImportFrom """ self.generic_visit(node) if not node.module: return if node.module == 'ansible.module_utils' or node.module.startswith('ansible.module_utils.'): for alias in node.names: # from ansible.module_utils import MODULE[, MODULE] # from ansible.module_utils.MODULE[.MODULE] import MODULE[, MODULE] self.add_import('%s.%s' % (node.module, alias.name), node.lineno) def add_import(self, name, line_number): """ :type name: str :type line_number: int """ import_name = name while len(name) > len('ansible.module_utils.'): if name in self.module_utils: if name not in self.imports: display.info('%s:%d imports module_utils: %s' % (self.path, line_number, name), verbosity=5) self.imports.add(name) return # duplicate imports are ignored name = '.'.join(name.split('.')[:-1]) if self.path.startswith('test/'): return # invalid imports in tests are ignored raise ApplicationError('%s:%d Invalid module_utils import: %s' % (self.path, line_number, import_name))
bjolivot/ansible
test/runner/lib/import_analysis.py
Python
gpl-3.0
8,577
[ "VisIt" ]
c39ccdc30d64b0e8514a55371d798ce90c45852ec9cbb395ca73955605de1f68
############################################################################## # Copyright (c) 2013-2017, Lawrence Livermore National Security, LLC. # Produced at the Lawrence Livermore National Laboratory. # # This file is part of Spack. # Created by Todd Gamblin, tgamblin@llnl.gov, All rights reserved. # LLNL-CODE-647188 # # For details, see https://github.com/spack/spack # Please also see the NOTICE and LICENSE files for our notice and the LGPL. # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU Lesser General Public License (as # published by the Free Software Foundation) version 2.1, February 1999. # # This program is distributed in the hope that it will be useful, but # WITHOUT ANY WARRANTY; without even the IMPLIED WARRANTY OF # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the terms and # conditions of the GNU Lesser General Public License for more details. # # You should have received a copy of the GNU Lesser General Public # License along with this program; if not, write to the Free Software # Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA ############################################################################## """ This module has methods for parsing names and versions of packages from URLs. The idea is to allow package creators to supply nothing more than the download location of the package, and figure out version and name information from there. **Example:** when spack is given the following URL: https://www.hdfgroup.org/ftp/HDF/releases/HDF4.2.12/src/hdf-4.2.12.tar.gz It can figure out that the package name is ``hdf``, and that it is at version ``4.2.12``. This is useful for making the creation of packages simple: a user just supplies a URL and skeleton code is generated automatically. Spack can also figure out that it can most likely download 4.2.6 at this URL: https://www.hdfgroup.org/ftp/HDF/releases/HDF4.2.6/src/hdf-4.2.6.tar.gz This is useful if a user asks for a package at a particular version number; spack doesn't need anyone to tell it where to get the tarball even though it's never been told about that version before. """ import os import re from six import StringIO from six.moves.urllib.parse import urlsplit, urlunsplit import llnl.util.tty as tty from llnl.util.tty.color import colorize import spack.error import spack.util.compression as comp from spack.version import Version # # Note: We call the input to most of these functions a "path" but the functions # work on paths and URLs. There's not a good word for both of these, but # "path" seemed like the most generic term. # def find_list_url(url): """Finds a good list URL for the supplied URL. By default, returns the dirname of the archive path. Provides special treatment for the following websites, which have a unique list URL different from the dirname of the download URL: ========= ======================================================= GitHub https://github.com/<repo>/<name>/releases GitLab https://gitlab.\*/<repo>/<name>/tags BitBucket https://bitbucket.org/<repo>/<name>/downloads/?tab=tags CRAN https://\*.r-project.org/src/contrib/Archive/<name> ========= ======================================================= Parameters: url (str): The download URL for the package Returns: str: The list URL for the package """ url_types = [ # GitHub # e.g. https://github.com/llnl/callpath/archive/v1.0.1.tar.gz (r'(.*github\.com/[^/]+/[^/]+)', lambda m: m.group(1) + '/releases'), # GitLab # e.g. https://gitlab.dkrz.de/k202009/libaec/uploads/631e85bcf877c2dcaca9b2e6d6526339/libaec-1.0.0.tar.gz (r'(.*gitlab[^/]+/[^/]+/[^/]+)', lambda m: m.group(1) + '/tags'), # BitBucket # e.g. https://bitbucket.org/eigen/eigen/get/3.3.3.tar.bz2 (r'(.*bitbucket.org/[^/]+/[^/]+)', lambda m: m.group(1) + '/downloads/?tab=tags'), # CRAN # e.g. https://cran.r-project.org/src/contrib/Rcpp_0.12.9.tar.gz # e.g. https://cloud.r-project.org/src/contrib/rgl_0.98.1.tar.gz (r'(.*\.r-project\.org/src/contrib)/([^_]+)', lambda m: m.group(1) + '/Archive/' + m.group(2)), ] for pattern, fun in url_types: match = re.search(pattern, url) if match: return fun(match) else: return os.path.dirname(url) def strip_query_and_fragment(path): try: components = urlsplit(path) stripped = components[:3] + (None, None) query, frag = components[3:5] suffix = '' if query: suffix += '?' + query if frag: suffix += '#' + frag return (urlunsplit(stripped), suffix) except ValueError: tty.debug("Got error parsing path %s" % path) return (path, '') # Ignore URL parse errors here def strip_version_suffixes(path): """Some tarballs contain extraneous information after the version: * ``bowtie2-2.2.5-source`` * ``libevent-2.0.21-stable`` * ``cuda_8.0.44_linux.run`` These strings are not part of the version number and should be ignored. This function strips those suffixes off and returns the remaining string. The goal is that the version is always the last thing in ``path``: * ``bowtie2-2.2.5`` * ``libevent-2.0.21`` * ``cuda_8.0.44`` Args: path (str): The filename or URL for the package Returns: str: The ``path`` with any extraneous suffixes removed """ # NOTE: This could be done with complicated regexes in parse_version_offset # NOTE: The problem is that we would have to add these regexes to the end # NOTE: of every single version regex. Easier to just strip them off # NOTE: permanently suffix_regexes = [ # Download type '[Ii]nstall', 'all', 'src(_0)?', '[Ss]ources?', 'file', 'full', 'single', 'public', 'with[a-zA-Z_-]+', 'bin', 'binary', 'run', '[Uu]niversal', 'jar', 'complete', 'dynamic', 'oss', 'gem', 'tar', 'sh', # Download version 'release', 'stable', '[Ff]inal', 'rel', 'orig', 'dist', '\+', # License 'gpl', # Arch # Needs to come before and after OS, appears in both orders 'ia32', 'intel', 'amd64', 'x64', 'x86_64', 'x86', 'i[36]86', 'ppc64(le)?', 'armv?(7l|6l|64)', # OS '[Ll]inux(_64)?', '[Uu]ni?x', '[Ss]un[Oo][Ss]', '[Mm]ac[Oo][Ss][Xx]?', '[Oo][Ss][Xx]', '[Dd]arwin(64)?', '[Aa]pple', '[Ww]indows', '[Ww]in(64|32)?', '[Cc]ygwin(64|32)?', '[Mm]ingw', # Arch # Needs to come before and after OS, appears in both orders 'ia32', 'intel', 'amd64', 'x64', 'x86_64', 'x86', 'i[36]86', 'ppc64(le)?', 'armv?(7l|6l|64)?', # PyPI '[._-]py[23].*\.whl', '[._-]cp[23].*\.whl', '[._-]win.*\.exe', ] for regex in suffix_regexes: # Remove the suffix from the end of the path # This may be done multiple times path = re.sub(r'[._-]?' + regex + '$', '', path) return path def strip_name_suffixes(path, version): """Most tarballs contain a package name followed by a version number. However, some also contain extraneous information in-between the name and version: * ``rgb-1.0.6`` * ``converge_install_2.3.16`` * ``jpegsrc.v9b`` These strings are not part of the package name and should be ignored. This function strips the version number and any extraneous suffixes off and returns the remaining string. The goal is that the name is always the last thing in ``path``: * ``rgb`` * ``converge`` * ``jpeg`` Args: path (str): The filename or URL for the package version (str): The version detected for this URL Returns: str: The ``path`` with any extraneous suffixes removed """ # NOTE: This could be done with complicated regexes in parse_name_offset # NOTE: The problem is that we would have to add these regexes to every # NOTE: single name regex. Easier to just strip them off permanently suffix_regexes = [ # Strip off the version and anything after it # name-ver # name_ver # name.ver r'[._-]v?' + str(version) + '.*', # namever str(version) + '.*', # Download type 'install', 'src', '(open)?[Ss]ources?', '[._-]archive', '[._-]std', # Download version 'release', 'snapshot', 'distrib', # VCS '0\+bzr', # License 'gpl', ] for regex in suffix_regexes: # Remove the suffix from the end of the path # This may be done multiple times path = re.sub('[._-]?' + regex + '$', '', path) return path def split_url_extension(path): """Some URLs have a query string, e.g.: 1. https://github.com/losalamos/CLAMR/blob/packages/PowerParser_v2.0.7.tgz?raw=true 2. http://www.apache.org/dyn/closer.cgi?path=/cassandra/1.2.0/apache-cassandra-1.2.0-rc2-bin.tar.gz 3. https://gitlab.kitware.com/vtk/vtk/repository/archive.tar.bz2?ref=v7.0.0 In (1), the query string needs to be stripped to get at the extension, but in (2) & (3), the filename is IN a single final query argument. This strips the URL into three pieces: ``prefix``, ``ext``, and ``suffix``. The suffix contains anything that was stripped off the URL to get at the file extension. In (1), it will be ``'?raw=true'``, but in (2), it will be empty. In (3) the suffix is a parameter that follows after the file extension, e.g.: 1. ``('https://github.com/losalamos/CLAMR/blob/packages/PowerParser_v2.0.7', '.tgz', '?raw=true')`` 2. ``('http://www.apache.org/dyn/closer.cgi?path=/cassandra/1.2.0/apache-cassandra-1.2.0-rc2-bin', '.tar.gz', None)`` 3. ``('https://gitlab.kitware.com/vtk/vtk/repository/archive', '.tar.bz2', '?ref=v7.0.0')`` """ prefix, ext, suffix = path, '', '' # Strip off sourceforge download suffix. # e.g. https://sourceforge.net/projects/glew/files/glew/2.0.0/glew-2.0.0.tgz/download match = re.search(r'(.*(?:sourceforge\.net|sf\.net)/.*)(/download)$', path) if match: prefix, suffix = match.groups() ext = comp.extension(prefix) if ext is not None: prefix = comp.strip_extension(prefix) else: prefix, suf = strip_query_and_fragment(prefix) ext = comp.extension(prefix) prefix = comp.strip_extension(prefix) suffix = suf + suffix if ext is None: ext = '' return prefix, ext, suffix def determine_url_file_extension(path): """This returns the type of archive a URL refers to. This is sometimes confusing because of URLs like: (1) https://github.com/petdance/ack/tarball/1.93_02 Where the URL doesn't actually contain the filename. We need to know what type it is so that we can appropriately name files in mirrors. """ match = re.search(r'github.com/.+/(zip|tar)ball/', path) if match: if match.group(1) == 'zip': return 'zip' elif match.group(1) == 'tar': return 'tar.gz' prefix, ext, suffix = split_url_extension(path) return ext def parse_version_offset(path): """Try to extract a version string from a filename or URL. Args: path (str): The filename or URL for the package Returns: tuple of (Version, int, int, int, str): A tuple containing: version of the package, first index of version, length of version string, the index of the matching regex the matching regex Raises: UndetectableVersionError: If the URL does not match any regexes """ original_path = path # path: The prefix of the URL, everything before the ext and suffix # ext: The file extension # suffix: Any kind of query string that begins with a '?' path, ext, suffix = split_url_extension(path) # stem: Everything from path after the final '/' original_stem = os.path.basename(path) # Try to strip off anything after the version number stem = strip_version_suffixes(original_stem) # Assumptions: # # 1. version always comes after the name # 2. separators include '-', '_', and '.' # 3. names can contain A-Z, a-z, 0-9, '+', separators # 4. versions can contain A-Z, a-z, 0-9, separators # 5. versions always start with a digit # 6. versions are often prefixed by a 'v' character # 7. separators are most reliable to determine name/version boundaries # List of the following format: # # [ # (regex, string), # ... # ] # # The first regex that matches string will be used to determine # the version of the package. Thefore, hyperspecific regexes should # come first while generic, catch-all regexes should come last. # With that said, regular expressions are slow, so if possible, put # ones that only catch one or two URLs at the bottom. version_regexes = [ # 1st Pass: Simplest case # Assume name contains no digits and version contains no letters # e.g. libpng-1.6.27 (r'^[a-zA-Z+._-]+[._-]v?(\d[\d._-]*)$', stem), # 2nd Pass: Version only # Assume version contains no letters # ver # e.g. 3.2.7, 7.0.2-7, v3.3.0, v1_6_3 (r'^v?(\d[\d._-]*)$', stem), # 3rd Pass: No separator characters are used # Assume name contains no digits # namever # e.g. turbolinux702, nauty26r7 (r'^[a-zA-Z+]*(\d[\da-zA-Z]*)$', stem), # 4th Pass: A single separator character is used # Assume name contains no digits # name-name-ver-ver # e.g. panda-2016-03-07, gts-snapshot-121130, cdd-061a (r'^[a-zA-Z+-]*(\d[\da-zA-Z-]*)$', stem), # name_name_ver_ver # e.g. tinyxml_2_6_2, boost_1_55_0, tbb2017_20161128, v1_6_3 (r'^[a-zA-Z+_]*(\d[\da-zA-Z_]*)$', stem), # name.name.ver.ver # e.g. prank.source.150803, jpegsrc.v9b, atlas3.11.34, geant4.10.01.p03 (r'^[a-zA-Z+.]*(\d[\da-zA-Z.]*)$', stem), # 5th Pass: Two separator characters are used # Name may contain digits, version may contain letters # name-name-ver.ver # e.g. m4-1.4.17, gmp-6.0.0a, launchmon-v1.0.2 (r'^[a-zA-Z\d+-]+-v?(\d[\da-zA-Z.]*)$', stem), # name-name-ver_ver # e.g. icu4c-57_1 (r'^[a-zA-Z\d+-]+-v?(\d[\da-zA-Z_]*)$', stem), # name_name_ver.ver # e.g. superlu_dist_4.1, pexsi_v0.9.0 (r'^[a-zA-Z\d+_]+_v?(\d[\da-zA-Z.]*)$', stem), # name_name.ver.ver # e.g. fer_source.v696 (r'^[a-zA-Z\d+_]+\.v?(\d[\da-zA-Z.]*)$', stem), # name-name-ver.ver-ver.ver # e.g. sowing-1.1.23-p1, bib2xhtml-v3.0-15-gf506, 4.6.3-alpha04 (r'^(?:[a-zA-Z\d+-]+-)?v?(\d[\da-zA-Z.-]*)$', stem), # namever.ver-ver.ver # e.g. go1.4-bootstrap-20161024 (r'^[a-zA-Z+]+v?(\d[\da-zA-Z.-]*)$', stem), # 6th Pass: All three separator characters are used # Name may contain digits, version may contain letters # name_name-ver.ver # e.g. the_silver_searcher-0.32.0, sphinx_rtd_theme-0.1.10a0 (r'^[a-zA-Z\d+_]+-v?(\d[\da-zA-Z.]*)$', stem), # name.name_ver.ver-ver.ver # e.g. TH.data_1.0-8, XML_3.98-1.4 (r'^[a-zA-Z\d+.]+_v?(\d[\da-zA-Z.-]*)$', stem), # name-name-ver.ver_ver.ver # e.g. pypar-2.1.5_108 (r'^[a-zA-Z\d+-]+-v?(\d[\da-zA-Z._]*)$', stem), # name.name_name-ver.ver # e.g. tap.py-1.6, backports.ssl_match_hostname-3.5.0.1 (r'^[a-zA-Z\d+._]+-v?(\d[\da-zA-Z.]*)$', stem), # name-namever.ver_ver.ver # e.g. STAR-CCM+11.06.010_02 (r'^[a-zA-Z+-]+(\d[\da-zA-Z._]*)$', stem), # 7th Pass: Specific VCS # bazaar # e.g. libvterm-0+bzr681 (r'bzr(\d[\da-zA-Z._-]*)$', stem), # 8th Pass: Version in path # github.com/repo/name/releases/download/vver/name # e.g. https://github.com/nextflow-io/nextflow/releases/download/v0.20.1/nextflow (r'github\.com/[^/]+/[^/]+/releases/download/[a-zA-Z+._-]*v?(\d[\da-zA-Z._-]*)/', path), # noqa # 9th Pass: Query strings # e.g. http://gitlab.cosma.dur.ac.uk/swift/swiftsim/repository/archive.tar.gz?ref=v0.3.0 (r'\?ref=[a-zA-Z+._-]*v?(\d[\da-zA-Z._-]*)$', suffix), # e.g. http://apps.fz-juelich.de/jsc/sionlib/download.php?version=1.7.1 (r'\?version=v?(\d[\da-zA-Z._-]*)$', suffix), # e.g. http://slepc.upv.es/download/download.php?filename=slepc-3.6.2.tar.gz (r'\?filename=[a-zA-Z\d+-]+-v?(\d[\da-zA-Z.]*)$', stem), # e.g. http://wwwpub.zih.tu-dresden.de/%7Emlieber/dcount/dcount.php?package=otf&get=OTF-1.12.5salmon.tar.gz (r'\?package=[a-zA-Z\d+-]+&get=[a-zA-Z\d+-]+-v?(\d[\da-zA-Z.]*)$', stem), # noqa ] for i, version_regex in enumerate(version_regexes): regex, match_string = version_regex match = re.search(regex, match_string) if match and match.group(1) is not None: version = match.group(1) start = match.start(1) # If we matched from the stem or suffix, we need to add offset offset = 0 if match_string is stem: offset = len(path) - len(original_stem) elif match_string is suffix: offset = len(path) if ext: offset += len(ext) + 1 # .tar.gz is converted to tar.gz start += offset return version, start, len(version), i, regex raise UndetectableVersionError(original_path) def parse_version(path): """Try to extract a version string from a filename or URL. Args: path (str): The filename or URL for the package Returns: spack.version.Version: The version of the package Raises: UndetectableVersionError: If the URL does not match any regexes """ version, start, length, i, regex = parse_version_offset(path) return Version(version) def parse_name_offset(path, v=None): """Try to determine the name of a package from its filename or URL. Args: path (str): The filename or URL for the package v (str): The version of the package Returns: tuple of (str, int, int, int, str): A tuple containing: name of the package, first index of name, length of name, the index of the matching regex the matching regex Raises: UndetectableNameError: If the URL does not match any regexes """ original_path = path # We really need to know the version of the package # This helps us prevent collisions between the name and version if v is None: try: v = parse_version(path) except UndetectableVersionError: # Not all URLs contain a version. We still want to be able # to determine a name if possible. v = 'unknown' # path: The prefix of the URL, everything before the ext and suffix # ext: The file extension # suffix: Any kind of query string that begins with a '?' path, ext, suffix = split_url_extension(path) # stem: Everything from path after the final '/' original_stem = os.path.basename(path) # Try to strip off anything after the package name stem = strip_name_suffixes(original_stem, v) # List of the following format: # # [ # (regex, string), # ... # ] # # The first regex that matches string will be used to determine # the name of the package. Thefore, hyperspecific regexes should # come first while generic, catch-all regexes should come last. # With that said, regular expressions are slow, so if possible, put # ones that only catch one or two URLs at the bottom. name_regexes = [ # 1st Pass: Common repositories # GitHub: github.com/repo/name/ # e.g. https://github.com/nco/nco/archive/4.6.2.tar.gz (r'github\.com/[^/]+/([^/]+)', path), # GitLab: gitlab.*/repo/name/ # e.g. http://gitlab.cosma.dur.ac.uk/swift/swiftsim/repository/archive.tar.gz?ref=v0.3.0 (r'gitlab[^/]+/[^/]+/([^/]+)', path), # Bitbucket: bitbucket.org/repo/name/ # e.g. https://bitbucket.org/glotzer/hoomd-blue/get/v1.3.3.tar.bz2 (r'bitbucket\.org/[^/]+/([^/]+)', path), # PyPI: pypi.(python.org|io)/packages/source/first-letter/name/ # e.g. https://pypi.python.org/packages/source/m/mpmath/mpmath-all-0.19.tar.gz # e.g. https://pypi.io/packages/source/b/backports.ssl_match_hostname/backports.ssl_match_hostname-3.5.0.1.tar.gz (r'pypi\.(?:python\.org|io)/packages/source/[A-Za-z\d]/([^/]+)', path), # 2nd Pass: Query strings # ?filename=name-ver.ver # e.g. http://slepc.upv.es/download/download.php?filename=slepc-3.6.2.tar.gz (r'\?filename=([A-Za-z\d+-]+)$', stem), # ?package=name # e.g. http://wwwpub.zih.tu-dresden.de/%7Emlieber/dcount/dcount.php?package=otf&get=OTF-1.12.5salmon.tar.gz (r'\?package=([A-Za-z\d+-]+)', stem), # download.php # e.g. http://apps.fz-juelich.de/jsc/sionlib/download.php?version=1.7.1 (r'([^/]+)/download.php$', path), # 3rd Pass: Name followed by version in archive (r'^([A-Za-z\d+\._-]+)$', stem), ] for i, name_regex in enumerate(name_regexes): regex, match_string = name_regex match = re.search(regex, match_string) if match: name = match.group(1) start = match.start(1) # If we matched from the stem or suffix, we need to add offset offset = 0 if match_string is stem: offset = len(path) - len(original_stem) elif match_string is suffix: offset = len(path) if ext: offset += len(ext) + 1 # .tar.gz is converted to tar.gz start += offset return name, start, len(name), i, regex raise UndetectableNameError(original_path) def parse_name(path, ver=None): """Try to determine the name of a package from its filename or URL. Args: path (str): The filename or URL for the package ver (str): The version of the package Returns: str: The name of the package Raises: UndetectableNameError: If the URL does not match any regexes """ name, start, length, i, regex = parse_name_offset(path, ver) return name def parse_name_and_version(path): """Try to determine the name of a package and extract its version from its filename or URL. Args: path (str): The filename or URL for the package Returns: tuple of (str, Version)A tuple containing: The name of the package The version of the package Raises: UndetectableVersionError: If the URL does not match any regexes UndetectableNameError: If the URL does not match any regexes """ ver = parse_version(path) name = parse_name(path, ver) return (name, ver) def insensitize(string): """Change upper and lowercase letters to be case insensitive in the provided string. e.g., 'a' becomes '[Aa]', 'B' becomes '[bB]', etc. Use for building regexes.""" def to_ins(match): char = match.group(1) return '[%s%s]' % (char.lower(), char.upper()) return re.sub(r'([a-zA-Z])', to_ins, string) def cumsum(elts, init=0, fn=lambda x: x): """Return cumulative sum of result of fn on each element in elts.""" sums = [] s = init for i, e in enumerate(elts): sums.append(s) s += fn(e) return sums def find_all(substring, string): """Returns a list containing the indices of every occurrence of substring in string.""" occurrences = [] index = 0 while index < len(string): index = string.find(substring, index) if index == -1: break occurrences.append(index) index += len(substring) return occurrences def substitution_offsets(path): """This returns offsets for substituting versions and names in the provided path. It is a helper for :func:`substitute_version`. """ # Get name and version offsets try: ver, vs, vl, vi, vregex = parse_version_offset(path) name, ns, nl, ni, nregex = parse_name_offset(path, ver) except UndetectableNameError: return (None, -1, -1, (), ver, vs, vl, (vs,)) except UndetectableVersionError: try: name, ns, nl, ni, nregex = parse_name_offset(path) return (name, ns, nl, (ns,), None, -1, -1, ()) except UndetectableNameError: return (None, -1, -1, (), None, -1, -1, ()) # Find the index of every occurrence of name and ver in path name_offsets = find_all(name, path) ver_offsets = find_all(ver, path) return (name, ns, nl, name_offsets, ver, vs, vl, ver_offsets) def wildcard_version(path): """Find the version in the supplied path, and return a regular expression that will match this path with any version in its place. """ # Get version so we can replace it with a wildcard version = parse_version(path) # Split path by versions vparts = path.split(str(version)) # Replace each version with a generic capture group to find versions # and escape everything else so it's not interpreted as a regex result = '(\d.*)'.join(re.escape(vp) for vp in vparts) return result def substitute_version(path, new_version): """Given a URL or archive name, find the version in the path and substitute the new version for it. Replace all occurrences of the version *if* they don't overlap with the package name. Simple example: .. code-block:: python substitute_version('http://www.mr511.de/software/libelf-0.8.13.tar.gz', '2.9.3') >>> 'http://www.mr511.de/software/libelf-2.9.3.tar.gz' Complex example: .. code-block:: python substitute_version('https://www.hdfgroup.org/ftp/HDF/releases/HDF4.2.12/src/hdf-4.2.12.tar.gz', '2.3') >>> 'https://www.hdfgroup.org/ftp/HDF/releases/HDF2.3/src/hdf-2.3.tar.gz' """ (name, ns, nl, noffs, ver, vs, vl, voffs) = substitution_offsets(path) new_path = '' last = 0 for vo in voffs: new_path += path[last:vo] new_path += str(new_version) last = vo + vl new_path += path[last:] return new_path def color_url(path, **kwargs): """Color the parts of the url according to Spack's parsing. Colors are: | Cyan: The version found by :func:`parse_version_offset`. | Red: The name found by :func:`parse_name_offset`. | Green: Instances of version string from :func:`substitute_version`. | Magenta: Instances of the name (protected from substitution). Args: path (str): The filename or URL for the package errors (bool): Append parse errors at end of string. subs (bool): Color substitutions as well as parsed name/version. """ errors = kwargs.get('errors', False) subs = kwargs.get('subs', False) (name, ns, nl, noffs, ver, vs, vl, voffs) = substitution_offsets(path) nends = [no + nl - 1 for no in noffs] vends = [vo + vl - 1 for vo in voffs] nerr = verr = 0 out = StringIO() for i in range(len(path)): if i == vs: out.write('@c') verr += 1 elif i == ns: out.write('@r') nerr += 1 elif subs: if i in voffs: out.write('@g') elif i in noffs: out.write('@m') out.write(path[i]) if i == vs + vl - 1: out.write('@.') verr += 1 elif i == ns + nl - 1: out.write('@.') nerr += 1 elif subs: if i in vends or i in nends: out.write('@.') if errors: if nerr == 0: out.write(" @r{[no name]}") if verr == 0: out.write(" @r{[no version]}") if nerr == 1: out.write(" @r{[incomplete name]}") if verr == 1: out.write(" @r{[incomplete version]}") return colorize(out.getvalue()) class UrlParseError(spack.error.SpackError): """Raised when the URL module can't parse something correctly.""" def __init__(self, msg, path): super(UrlParseError, self).__init__(msg) self.path = path class UndetectableVersionError(UrlParseError): """Raised when we can't parse a version from a string.""" def __init__(self, path): super(UndetectableVersionError, self).__init__( "Couldn't detect version in: " + path, path) class UndetectableNameError(UrlParseError): """Raised when we can't parse a package name from a string.""" def __init__(self, path): super(UndetectableNameError, self).__init__( "Couldn't parse package name in: " + path, path)
skosukhin/spack
lib/spack/spack/url.py
Python
lgpl-2.1
29,938
[ "HOOMD-blue", "VTK" ]
aaae56526771c58d1659ab4042bd52cb6775715cf2593e4f186965fb04661b45
from __future__ import division, print_function from CompyledFunc import CompyledFunc from copy import deepcopy from frozendict import frozendict from HelpyFuncs.SymPy import is_non_atomic_sympy_expr, sympy_xreplace from HelpyFuncs.Dicts import combine_dict_and_kwargs, merge_dicts_ignoring_dup_keys_and_none_values from HelpyFuncs.zzz import shift_time_subscripts from itertools import product from MathDict import exp as exp_math_dict, MathDict from MathFunc import MathFunc from numpy.linalg import inv, slogdet from pprint import pprint from scipy.stats import uniform, multivariate_normal from sympy import exp, log, pi, pprint as sympy_print from sympy.matrices import BlockMatrix, det, Matrix DO_NOTHING_FUNC = lambda *args, **kwargs: None SELF_FUNC = lambda x: x ZERO_FUNC = lambda *args, **kwargs: .0 class PDF(MathFunc): def __init__(self, family='', var_names_and_syms={}, param={}, cond={}, scope={}, neg_log_dens_func=DO_NOTHING_FUNC, norm_func=DO_NOTHING_FUNC, max_func=DO_NOTHING_FUNC, marg_func=DO_NOTHING_FUNC, cond_func=DO_NOTHING_FUNC, sample_func=DO_NOTHING_FUNC, compile=False): self.Family = family self.Param = param if hasattr(self, 'Mapping'): dens = self.Mapping else: self.NegLogDensFunc = neg_log_dens_func neg_log_dens = neg_log_dens_func(self, var_names_and_syms) if self.is_discrete_finite(): dens = exp_math_dict(-neg_log_dens) else: dens = exp(-neg_log_dens) MathFunc.__init__(self, var_names_and_syms=var_names_and_syms, mapping=dens, param=param, cond=cond, scope=scope, compile=compile) self.NormFunc = norm_func self.MaxFunc = max_func self.MargFunc = marg_func self.CondFunc = cond_func self.SampleFunc = sample_func def is_discrete_finite(self): return self.Family == 'DiscreteFinite' def is_one(self): return self.Family == 'One' def is_uniform(self): return self.Family == 'Uniform' def is_gaussian(self): return self.Family == 'Gaussian' def at(self, var_and_param_names_and_values={}, **kw_var_and_param_names_and_values): var_and_param_names_and_values =\ combine_dict_and_kwargs(var_and_param_names_and_values, kw_var_and_param_names_and_values) cond = deepcopy(self.Cond) # just to be careful scope = deepcopy(self.Scope) # just to be careful param = self.Param.copy() syms_and_values = {} for var, value in var_and_param_names_and_values.items(): if var in self.Vars: if var in cond: cond[var] = value if var in scope: scope[var] = value syms_and_values[self.Vars[var]] = value if var in param: try: syms_and_values[param[var]] = value except: pass param[var] = value cond = sympy_xreplace(cond, syms_and_values) scope = sympy_xreplace(scope, syms_and_values) self.CompyledFunc = None # remove compiled version because many things can be changing if self.is_discrete_finite(): neg_log_p = {} s = set(var_and_param_names_and_values) s_items = set(var_and_param_names_and_values.items()) for var_values___frozen_dict, mapping_value in param['NegLogP'].items(): other_items___dict = dict(set(var_values___frozen_dict.items()) - s_items) if not (set(other_items___dict) & s): neg_log_p[frozendict(set(var_values___frozen_dict.items()) - set(cond.items()))] =\ sympy_xreplace(mapping_value, syms_and_values) return DiscreteFinitePMF(var_names_and_syms=self.Vars.copy(), p_or_neg_log_p=neg_log_p, p=False, cond=cond, scope=scope) else: pdf = self.copy() pdf.Cond = cond pdf.Scope = scope pdf.Param = sympy_xreplace(param, syms_and_values) #print(pdf.Mapping) #print(syms_and_values) #print(type(syms_and_values.keys().pop())) pdf.Mapping = sympy_xreplace(pdf.Mapping, syms_and_values) return pdf def norm(self): return self.NormFunc(self) def max(self, **kwargs): return self.MaxFunc(self, **kwargs) def marg(self, *marginalized_vars): return self.MargFunc(self, *marginalized_vars) def cond(self, cond={}, **kw_cond): cond = combine_dict_and_kwargs(cond, kw_cond) return self.CondFunc(self, cond) def sample(self, num_samples=1): return self.SampleFunc(self, num_samples) def __mul__(self, probability_density_function_to_multiply): return product_of_2_PDFs(self, probability_density_function_to_multiply) def __rmul__(self, probability_density_function_to_multiply): return product_of_2_PDFs(probability_density_function_to_multiply, self) def multiply(self, *probability_density_functions_to_multiply): pdf = self.copy() for pdf_to_multiply in probability_density_functions_to_multiply: pdf = pdf.__mul__(pdf_to_multiply) return pdf def pprint(self): discrete = self.is_discrete_finite() if discrete: print('DISCRETE FINITE MASS FUNCTION') print('_____________________________') else: print('CONTINUOUS DENSITY FUNCTION') print('___________________________') print('FAMILY:', self.Family) print("VARIABLES' SYMBOLS:") pprint(self.Vars) print('CONDITION:') pprint(self.Cond) print('SCOPE:') pprint(self.Scope) if not discrete: print('PARAMETERS:') pprint(self.Param) print('DENSITY:') else: print('MASS:') d = self() sympy_print(d) if discrete: print(' sum =', sum(d.values())) def shift_time_subscripts(self, t): pdf = self.copy() pdf.Vars = shift_time_subscripts(pdf.Vars, t) pdf.Cond = shift_time_subscripts(pdf.Cond, t) pdf.Scope = shift_time_subscripts(pdf.Scope, t) pdf.Param = shift_time_subscripts(pdf.Param, t) return pdf def p_from_neg_log_p(expr_or_dict): if hasattr(expr_or_dict, 'keys'): probs___math_dict = MathDict() for k, v in expr_or_dict.items(): probs___math_dict[k] = exp(-v) return probs___math_dict else: return exp(-expr_or_dict) def product_of_2_PDFs(pdf0, pdf1): families = (pdf0.Family, pdf1.Family) if families == ('DiscreteFinite', 'DiscreteFinite'): return product_of_2_DiscreteFinitePMFs(pdf0, pdf1) elif pdf0.is_discrete_finite(): return product_of_DiscreteFinitePMF_and_continuousPDF(pdf0, pdf1) elif pdf1.is_discrete_finite(): return product_of_DiscreteFinitePMF_and_continuousPDF(pdf1, pdf0) elif families == ('One', 'Gaussian'): return product_of_OnePDF_and_GaussPDF(pdf0, pdf1) elif families == ('Gaussian', 'One'): return product_of_OnePDF_and_GaussPDF(pdf1, pdf0) elif families == ('Gaussian', 'Gaussian'): return product_of_2_GaussPDFs(pdf0, pdf1) class DiscreteFinitePMF(PDF): def __init__(self, var_names_and_syms={}, p_or_neg_log_p={}, p=True, cond={}, scope={}): non_none_scope = {var: value for var, value in scope.items() if value is not None} if p: f = lambda x: -log(x) else: f = lambda x: x p_or_neg_log_p = MathDict({var_values___frozen_dict: f(func_value) for var_values___frozen_dict, func_value in p_or_neg_log_p.items() if set(var_values___frozen_dict.items()) >= set(non_none_scope.items())}) PDF.__init__(self, family='DiscreteFinite', var_names_and_syms=var_names_and_syms, param=dict(NegLogP=p_or_neg_log_p), cond=cond, scope=non_none_scope, neg_log_dens_func=discrete_finite_neg_log_mass, norm_func=discrete_finite_norm, max_func=discrete_finite_max, marg_func=discrete_finite_marg, cond_func=discrete_finite_cond, sample_func=DO_NOTHING_FUNC) def allclose(self, *PMFs, **kwargs): for pmf in PMFs: if not ((self.Vars == pmf.Vars) and (self.Cond == pmf.Cond) and (self.Scope == pmf.Scope) and self.Param['NegLogP'].allclose(pmf.Param['NegLogP'], **kwargs)): return False return True def discrete_finite_neg_log_mass(pmf, var_names_and_values={}): v = var_names_and_values.copy() for var, value in var_names_and_values.items(): if (value is None) or is_non_atomic_sympy_expr(value): del v[var] s0 = set(v.items()) d = MathDict(()) for var_names_and_values___frozen_dict, func_value in pmf.Param['NegLogP'].items(): spare_var_values = dict(s0 - set(var_names_and_values___frozen_dict.items())) s = set(spare_var_values.keys()) if not(s) or (s and not(s & set(var_names_and_values___frozen_dict))): d[var_names_and_values___frozen_dict] = sympy_xreplace(func_value, var_names_and_values) return d def discrete_finite_norm(pmf): pmf = pmf.copy() pmf.Param['NegLogP'] = pmf.Param['NegLogP'].copy() neg_log_p = pmf.Param['NegLogP'] condition_sums = {} for var_values___frozen_dict, function_value in neg_log_p.items(): condition_instance = pmf.CondInstances[var_values___frozen_dict] if condition_instance in condition_sums: condition_sums[condition_instance] += exp(-function_value) else: condition_sums[condition_instance] = exp(-function_value) for var_values___frozen_dict in neg_log_p: pmf.Param['NegLogP'][var_values___frozen_dict] +=\ log(condition_sums[pmf.CondInstances[var_values___frozen_dict]]) return pmf def discrete_finite_max(pmf, leave_unoptimized=None): neg_log_p = pmf.Param['NegLogP'] if leave_unoptimized: comparison_bases = {} conditioned_and_unoptimized_vars = set(pmf.Cond) | set(leave_unoptimized) for var_names_and_values___frozen_dict in neg_log_p: comparison_basis = {} for var in (set(var_names_and_values___frozen_dict) & conditioned_and_unoptimized_vars): comparison_basis[var] = var_names_and_values___frozen_dict[var] comparison_bases[var_names_and_values___frozen_dict] = frozendict(comparison_basis) else: comparison_bases = pmf.CondInstances neg_log_mins = {} for var_names_and_values___frozen_dict, func_value in neg_log_p.items(): comparison_basis = comparison_bases[var_names_and_values___frozen_dict] if comparison_basis in neg_log_mins: neg_log_mins[comparison_basis] = min(neg_log_mins[comparison_basis], func_value) else: neg_log_mins[comparison_basis] = func_value optims = {} for var_names_and_values___frozen_dict, func_value in neg_log_p.items(): if func_value <= neg_log_mins[comparison_bases[var_names_and_values___frozen_dict]]: optims[var_names_and_values___frozen_dict] = func_value return DiscreteFinitePMF(var_names_and_syms=pmf.Vars.copy(), p_or_neg_log_p=optims, p=False, cond=pmf.Cond.copy(), scope=pmf.Scope.copy()) def discrete_finite_marg(pmf, *marginalized_vars): var_symbols = pmf.Vars.copy() mappings = pmf.Param['NegLogP'].copy() for marginalized_var in marginalized_vars: del var_symbols[marginalized_var] d = {} for var_values___frozen_dict, mapping_value in mappings.items(): marginalized_var_value = var_values___frozen_dict[marginalized_var] fd = frozendict(set(var_values___frozen_dict.items()) - {(marginalized_var, marginalized_var_value)}) if fd in d: d[fd] += exp(-mapping_value) else: d[fd] = exp(-mapping_value) mappings = {k: -log(v) for k, v in d.items()} return DiscreteFinitePMF(var_symbols, mappings, cond=deepcopy(pmf.Cond), scope=deepcopy(pmf.Scope), p=False) def discrete_finite_cond(pmf, cond={}, **kw_cond): cond = combine_dict_and_kwargs(cond, kw_cond) mappings = pmf.Param['NegLogP'].copy() d = {} s0 = set(cond.items()) for var_values___frozen_dict, mapping_value in mappings.items(): s = set(var_values___frozen_dict.items()) if s >= s0: d[frozendict(s - s0)] = mapping_value new_cond = deepcopy(pmf.Cond) new_cond.update(cond) scope = deepcopy(pmf.Scope) for var in cond: del scope[var] return DiscreteFinitePMF(pmf.Vars.copy(), d, cond=new_cond, scope=scope, p=False) class OnePMF(DiscreteFinitePMF): def __init__(self, var_names_and_syms={}, var_names_and_values=set(), cond={}): DiscreteFinitePMF.__init__(self, var_names_and_syms=var_names_and_syms, p_or_neg_log_p={item: 1. for item in var_names_and_values}, p=True, cond=cond) class OnePDF(PDF): def __init__(self, cond={}): PDF.__init__(self, family='One', var_names_and_syms={}, param={}, cond=cond, scope={}, neg_log_dens_func=ZERO_FUNC, norm_func=SELF_FUNC, max_func=SELF_FUNC, marg_func=SELF_FUNC, cond_func=DO_NOTHING_FUNC, sample_func=DO_NOTHING_FUNC) def uniform_density_function(var_symbols, parameters, cond={}, scope={}): return PDF('Uniform', deepcopy(var_symbols), deepcopy(parameters), uniform_density, uniform_normalization, lambda *args, **kwargs: None, uniform_marginalization, uniform_conditioning, uniform_sampling, deepcopy(cond), deepcopy(scope)) def uniform_density(var_symbols, parameters): d = 1. return d def uniform_normalization(): return 0 def uniform_marginalization(): return 0 def uniform_conditioning(): return 0 def uniform_sampling(): return 0 class GaussPDF(PDF): def __init__(self, var_names_and_syms={}, param={}, cond={}, scope={}, compile=False): self.Vars = var_names_and_syms self.Param = param self.PreProcessed = False self.VarList = None self.NumVars = None self.VarVector = None self.NumDims = None self.Mean = None self.DemeanedVarVector = None self.Cov = None self.LogDetCov = None self.InvCov = None if compile: self.preprocess() PDF.__init__(self, family='Gaussian', var_names_and_syms=var_names_and_syms, param=param, cond=cond, scope=scope, neg_log_dens_func=gauss_neg_log_dens, norm_func=DO_NOTHING_FUNC, max_func=gauss_max, marg_func=gauss_marg, cond_func=gauss_cond, sample_func=gauss_sample, compile=compile) def preprocess(self): self.VarList = tuple(self.Vars) self.NumVars = len(self.VarList) self.VarVector = BlockMatrix((tuple(self.Vars[var] for var in self.VarList),)) self.NumDims = self.VarVector.shape[1] self.Mean = BlockMatrix((tuple(self.Param[('Mean', var)] for var in self.VarList),)) self.DemeanedVarVector = self.VarVector - self.Mean cov = [self.NumVars * [None] for _ in range(self.NumVars)] # careful not to create same mutable object for i in range(self.NumVars): for j in range(i): if ('Cov', self.VarList[i], self.VarList[j]) in self.Param: cov[i][j] = self.Param[('Cov', self.VarList[i], self.VarList[j])] cov[j][i] = cov[i][j].T else: cov[j][i] = self.Param[('Cov', self.VarList[j], self.VarList[i])] cov[i][j] = cov[j][i].T cov[i][i] = self.Param[('Cov', self.VarList[i])] self.Cov = BlockMatrix(cov) try: cov = CompyledFunc(var_names_and_syms={}, dict_or_expr=self.Cov)() sign, self.LogDetCov = slogdet(cov) self.LogDetCov *= sign self.InvCov = inv(cov) except: pass self.PreProcessed = True def gauss_neg_log_dens(pdf, var_and_param_names_and_values={}, **kw_var_and_param_names_and_values): var_and_param_names_and_values = combine_dict_and_kwargs(var_and_param_names_and_values, kw_var_and_param_names_and_values) if not pdf.PreProcessed: pdf.preprocess() if pdf.LogDetCov is None: neg_log_dens = (pdf.NumDims * log(2 * pi) + log(det(pdf.Cov)) + det(pdf.DemeanedVarVector * pdf.Cov.inverse() * pdf.DemeanedVarVector.T)) / 2 else: neg_log_dens = (pdf.NumDims * log(2 * pi) + pdf.LogDetCov + det(pdf.DemeanedVarVector * Matrix(pdf.InvCov) * pdf.DemeanedVarVector.T)) / 2 return sympy_xreplace(neg_log_dens, var_and_param_names_and_values) def gauss_max(pdf): pdf = pdf.copy() for var, value in pdf.Scope.items(): if value is None: pdf.Scope[var] = pdf.Param[('Mean', var)] return pdf def gauss_marg(pdf, *marginalized_vars): var_names_and_syms = pdf.Vars.copy() scope = pdf.Scope.copy() param = pdf.Param.copy() for marginalized_var in marginalized_vars: del var_names_and_syms[marginalized_var] del scope[marginalized_var] p = param.copy() for k in p: if marginalized_var in k: del param[k] if scope: return GaussPDF(var_names_and_syms=var_names_and_syms, param=param, cond=pdf.Cond.copy(), scope=scope) else: return OnePDF(cond=pdf.Cond.copy()) def gauss_cond(pdf, cond={}, **kw_cond): cond = combine_dict_and_kwargs(cond, kw_cond) new_cond = pdf.Cond.copy() new_cond.update(cond) scope = pdf.Scope.copy() for var in cond: del scope[var] point_cond = {} for var, value in cond.items(): if value is not None: point_cond[pdf.Vars[var]] = value cond_vars = tuple(cond) num_cond_vars = len(cond_vars) scope_vars = tuple(set(pdf.VarsList) - set(cond)) num_scope_vars = len(scope_vars) x_c = BlockMatrix((tuple(pdf.Vars[cond_var] for cond_var in cond_vars),)) m_c = BlockMatrix((tuple(pdf.Param[('Mean', cond_var)] for cond_var in cond_vars),)) m_s = BlockMatrix((tuple(pdf.Param[('Mean', scope_var)] for scope_var in scope_vars),)) S_c = [num_cond_vars * [None] for _ in range(num_cond_vars)] # careful not to create same mutable object for i in range(num_cond_vars): for j in range(i): if ('Cov', cond_vars[i], cond_vars[j]) in pdf.Param: S_c[i][j] = pdf.Param[('Cov', cond_vars[i], cond_vars[j])] S_c[j][i] = S_c[i][j].T else: S_c[j][i] = pdf.Param[('Cov', cond_vars[j], cond_vars[i])] S_c[i][j] = S_c[j][i].T S_c[i][i] = pdf.Param[('Cov', cond_vars[i])] S_c = BlockMatrix(S_c) S_s = [num_scope_vars * [None] for _ in range(num_scope_vars)] # careful not to create same mutable object for i in range(num_scope_vars): for j in range(i): if ('Cov', scope_vars[i], scope_vars[j]) in pdf.Param: S_s[i][j] = pdf.Param[('Cov', scope_vars[i], scope_vars[j])] S_s[j][i] = S_s[i][j].T else: S_s[j][i] = pdf.Param[('Cov', scope_vars[j], scope_vars[i])] S_s[i][j] = S_s[j][i].T S_s[i][i] = pdf.Param[('Cov', scope_vars[i])] S_s = BlockMatrix(S_s) S_cs = [num_scope_vars * [None] for _ in range(num_cond_vars)] # careful not to create same mutable object for i, j in product(range(num_cond_vars), range(num_scope_vars)): if ('Cov', cond_vars[i], scope_vars[j]) in pdf.Param: S_cs[i][j] = pdf.Param[('Cov', cond_vars[i], scope_vars[j])] else: S_cs[i][j] = pdf.Param[('Cov', scope_vars[j], cond_vars[i])].T S_cs = BlockMatrix(S_cs) S_sc = S_cs.T m = (m_s + (x_c - m_c) * S_c.inverse() * S_cs).xreplace(point_cond) S = S_s - S_sc * S_c.inverse() * S_cs param = {} index_ranges_from = [] index_ranges_to = [] k = 0 for i in range(num_scope_vars): l = k + pdf.Vars[scope_vars[i]].shape[1] index_ranges_from += [k] index_ranges_to += [l] param[('Mean', scope_vars[i])] = m[0, index_ranges_from[i]:index_ranges_to[i]] for j in range(i): param[('Cov', scope_vars[j], scope_vars[i])] =\ S[index_ranges_from[j]:index_ranges_to[j], index_ranges_from[i]:index_ranges_to[i]] param[('Cov', scope_vars[i])] =\ S[index_ranges_from[i]:index_ranges_to[i], index_ranges_from[i]:index_ranges_to[i]] k = l return GaussPDF(var_names_and_syms=pdf.Vars.copy(), param=param, cond=new_cond, scope=scope) def gauss_sample(gaussian_pdf, num_samples): # scope_vars # for scope # # scope_vars = tuple(gaussian_pdf.Scope) # # num_scope_vars = len(scope_vars) # m = [] # S = [num_scope_vars * [None] for _ in range(num_scope_vars)] # careful not to create same mutable object # for i in range(num_scope_vars): # m += [gaussian_pdf.Param[('mean', scope_vars[i])]] # for j in range(i): # if ('cov', scope_vars[i], scope_vars[j]) in gaussian_pdf.Param: # S[i][j] = gaussian_pdf.Param[('cov', scope_vars[i], scope_vars[j])] # S[j][i] = S[i][j].T # else: # S[j][i] = gaussian_pdf.Param[('cov', scope_vars[j], scope_vars[i])] # S[i][j] = S[j][i].T # S[i][i] = gaussian_pdf.Param[('cov', scope_vars[i])] # m = BlockMatrix([m]).as_explicit().tolist()[0] # S = BlockMatrix(S).as_explicit().tolist() # X = multivariate_normal(m, S) # samples = X.rvs(num_samples) # densities = X.pdf(samples) # mappings = {} # for i in range(num_samples): # fd = {} # k = 0 # for j in range(num_scope_vars): # scope_var = scope_vars[j] # l = k + gaussian_pdf.Vars[scope_var].shape[1] # fd[scope_var] = samples[i, k:l] # mappings[FrozenDict(fd)] = densities[i] return 0 #discrete_finite_mass_function(deepcopy(gaussian_pdf.Vars), dict(NegLogP=mappings), # deepcopy(gaussian_pdf.Cond)) def product_of_2_DiscreteFinitePMFs(pmf0, pmf1): cond = merge_dicts_ignoring_dup_keys_and_none_values(pmf0.Cond, pmf1.Cond) scope = merge_dicts_ignoring_dup_keys_and_none_values(pmf0.Scope, pmf1.Scope) for var in (set(cond) & set(scope)): del cond[var] var_names_and_syms = merge_dicts_ignoring_dup_keys_and_none_values(pmf0.Vars, pmf1.Vars) neg_log_p0 = pmf0.Param['NegLogP'].copy() neg_log_p1 = pmf1.Param['NegLogP'].copy() neg_log_p = {} for item_0, item_1 in product(neg_log_p0.items(), neg_log_p1.items()): var_names_and_values_0___frozen_dict, func_value_0 = item_0 var_names_and_values_1___frozen_dict, func_value_1 = item_1 same_vars_same_values = True for var in (set(var_names_and_values_0___frozen_dict) & set(var_names_and_values_1___frozen_dict)): if not (var_names_and_values_0___frozen_dict[var] == var_names_and_values_1___frozen_dict[var]): same_vars_same_values = False break if same_vars_same_values: neg_log_p[frozendict(set(var_names_and_values_0___frozen_dict.items()) | set(var_names_and_values_1___frozen_dict.items()))] = func_value_0 + func_value_1 return DiscreteFinitePMF(var_names_and_syms=var_names_and_syms, p_or_neg_log_p=neg_log_p, p=False, cond=cond, scope=scope) def product_of_DiscreteFinitePMF_and_continuousPDF(pmf, pdf): cond = merge_dicts_ignoring_dup_keys_and_none_values(pmf.Cond, pdf.Cond) scope = merge_dicts_ignoring_dup_keys_and_none_values(pmf.Scope, pdf.Scope) for var in (set(cond) & set(scope)): del cond[var] var_names_and_symbols = merge_dicts_ignoring_dup_keys_and_none_values(pmf.Vars, pdf.Vars) neg_log_p = {} for var_names_and_values___frozen_dict, func_value in pmf.Param['NegLogP'].items(): neg_log_p[var_names_and_values___frozen_dict] = func_value - log(pdf.Mapping) return DiscreteFinitePMF(var_names_and_syms=var_names_and_symbols, p_or_neg_log_p=neg_log_p, p=False, cond=cond, scope=scope) def product_of_OnePDF_and_GaussPDF(one_pdf, gauss_pdf): cond = merge_dicts_ignoring_dup_keys_and_none_values(gauss_pdf.Cond, one_pdf.Cond) scope = merge_dicts_ignoring_dup_keys_and_none_values(gauss_pdf.Scope, one_pdf.Scope) for var in (set(cond) & set(scope)): del cond[var] var_names_and_symbols = merge_dicts_ignoring_dup_keys_and_none_values(gauss_pdf.Vars, one_pdf.Vars) return GaussPDF(var_names_and_syms=var_names_and_symbols, param=gauss_pdf.Param.copy(), cond=cond, scope=scope) def product_of_2_GaussPDFs(pdf0, pdf1): cond = merge_dicts_ignoring_dup_keys_and_none_values(pdf0.Cond, pdf1.Cond) scope = merge_dicts_ignoring_dup_keys_and_none_values(pdf0.Scope, pdf1.Scope) for var in (set(cond) & set(scope)): del cond[var] var_names_and_symbols = merge_dicts_ignoring_dup_keys_and_none_values(pdf0.Vars, pdf1.Vars) param = {} return GaussPDF(var_names_and_syms=var_names_and_symbols, param=param, cond=cond, scope=scope)
MBALearnsToCode/ProbabPy
ProbabPy/__init__.py
Python
mit
26,081
[ "Gaussian" ]
16ce3701790d69aff34e339a9c33064cdd2524568599bb8eba0a9effe2f969dd
# -*- coding: utf-8 -*- # #Created on Mon Apr 10 11:34:50 2017 # #author: Elina Thibeau-Sutre # from .base import BaseMixture from .base import _log_normal_matrix from .base import _full_covariance_matrices from .base import _spherical_covariance_matrices from .initializations import initialize_log_assignements,initialize_mcw import numpy as np from scipy.misc import logsumexp class GaussianMixture(BaseMixture): """ Gaussian Mixture Model Representation of a Gaussian mixture model probability distribution. This class allows to estimate the parameters of a Gaussian mixture distribution. Parameters ---------- n_components : int, defaults to 1. Number of clusters used. init : str, defaults to 'kmeans'. Method used in order to perform the initialization, must be in ['random', 'plus', 'AF_KMC', 'kmeans']. reg_covar : float, defaults to 1e-6 In order to avoid null covariances this float is added to the diagonal of covariance matrices. type_init : str, defaults to 'resp'. The algorithm is initialized using this data (responsibilities if 'resp' or means, covariances and weights if 'mcw'). Attributes ---------- name : str The name of the method : 'GMM' cov : array of floats (n_components,dim,dim) Contains the computed covariance matrices of the mixture. means : array of floats (n_components,dim) Contains the computed means of the mixture. log_weights : array of floats (n_components,) Contains the logarithm of the mixing coefficient of each cluster. iter : int The number of iterations computed with the method fit() convergence_criterion_data : array of floats (iter,) Stores the value of the convergence criterion computed with data on which the model is fitted. convergence_criterion_test : array of floats (iter,) | if _early_stopping only Stores the value of the convergence criterion computed with test data if it exists. _is_initialized : bool Ensures that the method _initialize() has been used before using other methods such as score() or predict_log_assignements(). Raises ------ ValueError : if the parameters are inconsistent, for example if the cluster number is negative, init_type is not in ['resp','mcw']... References ---------- 'Pattern Recognition and Machine Learning', Bishop """ def __init__(self, n_components=1,covariance_type="full",init="kmeans", reg_covar=1e-6,type_init='resp',n_jobs=1): super(GaussianMixture, self).__init__() self.name = 'GMM' self.n_components = n_components self.covariance_type = covariance_type self.init = init self.type_init = type_init self.reg_covar = reg_covar self.n_jobs = n_jobs self._is_initialized = False self.iter = 0 self.convergence_criterion_data = [] self.convergence_criterion_test = [] self._check_common_parameters() self._check_parameters() def _check_parameters(self): if self.init not in ['random', 'random_sk', 'plus', 'kmeans', 'AF_KMC']: raise ValueError("Invalid value for 'init': %s " "'init' should be in " "['random', 'random_sk', 'plus', 'kmeans', 'AF_KMC']" % self.init) if self.covariance_type not in ['full','spherical']: raise ValueError("Invalid value for 'init': %s " "'covariance_type' should be in " "['full', 'spherical']" % self.covariance_type) if self.init == 'random_sk' and self.type_init=='mcw': raise ValueError("random_sk is only compatible with" "type_init = resp") def _initialize(self,points_data,points_test=None): """ This method initializes the Gaussian Mixture by setting the values of the means, covariances and weights. Parameters ---------- points_data : an array (n_points,dim) Data on which the model is fitted. points_test: an array (n_points,dim) | Optional Data used to do early stopping (avoid overfitting) """ if self.type_init=='resp': log_assignements = initialize_log_assignements(self.init,self.n_components,points_data,points_test, self.covariance_type) self._step_M(points_data,log_assignements) elif self.type_init=='mcw': means,cov,log_weights = initialize_mcw(self.init,self.n_components,points_data,points_test, self.covariance_type) self.means = means self.cov = cov self.log_weights = log_weights elif self.type_init=='kmeans': self._initialize_cov(points_data) self._is_initialized = True def _step_E(self, points): """ In this step the algorithm evaluates the responsibilities of each points in each cluster Parameters ---------- points : an array (n_points,dim) Returns ------- log_resp: an array (n_points,n_components) an array containing the logarithm of the responsibilities. log_prob_norm : an array (n_points,) logarithm of the probability of each sample in points """ log_normal_matrix = _log_normal_matrix(points,self.means,self.cov,self.covariance_type,self.n_jobs) log_product = log_normal_matrix + self.log_weights[:,np.newaxis].T log_prob_norm = logsumexp(log_product,axis=1) log_resp = log_product - log_prob_norm[:,np.newaxis] return log_prob_norm,log_resp def _step_M(self,points,log_assignements): """ In this step the algorithm updates the values of the parameters (means, covariances, alpha, beta, nu). Parameters ---------- points : an array (n_points,dim) log_resp: an array (n_points,n_components) an array containing the logarithm of the responsibilities. """ n_points,dim = points.shape assignements = np.exp(log_assignements) #Phase 1: product = np.dot(assignements.T,points) weights = np.sum(assignements,axis=0) + 10 * np.finfo(assignements.dtype).eps self.means = product / weights[:,np.newaxis] #Phase 2: if self.covariance_type=="full": self.cov = _full_covariance_matrices(points,self.means,weights,assignements,self.reg_covar,self.n_jobs) elif self.covariance_type=="spherical": self.cov = _spherical_covariance_matrices(points,self.means,weights,assignements,self.reg_covar,self.n_jobs) #Phase 3: self.log_weights = logsumexp(log_assignements, axis=0) - np.log(n_points) def _convergence_criterion_simplified(self,points,_,log_prob_norm): """ Compute the log likelihood. Parameters ---------- points : an array (n_points,dim) log_prob_norm : an array (n_points,) logarithm of the probability of each sample in points Returns ------- result : float the log likelihood """ return np.sum(log_prob_norm) def _convergence_criterion(self,points,_,log_prob_norm): """ Compute the log likelihood. Parameters ---------- points : an array (n_points,dim) log_prob_norm : an array (n_points,) logarithm of the probability of each sample in points Returns ------- result : float the log likelihood """ return np.sum(log_prob_norm) def _get_parameters(self): return (self.log_weights, self.means, self.cov) def _set_parameters(self, params,verbose=True): self.log_weights, self.means, self.cov = params if self.n_components != len(self.means) and verbose: print('The number of components changed') self.n_components = len(self.means) def _limiting_model(self,points): n_points,dim = points.shape log_resp = self.predict_log_resp(points) _,n_components = log_resp.shape exist = np.zeros(n_components) for i in range(n_points): for j in range(n_components): if np.argmax(log_resp[i])==j: exist[j] = 1 idx_existing = np.where(exist==1) log_weights = self.log_weights[idx_existing] means = self.means[idx_existing] cov = self.cov[idx_existing] params = (log_weights, means, cov) return params
14thibea/megamix
megamix/batch/GMM.py
Python
apache-2.0
9,537
[ "Gaussian" ]
cb0d5d3128b65483c95087aca27fb9732d09fe520a85d15165f68b9c0c31d67d
# -*- coding: utf-8 -*- # Copyright 2007-2020 The HyperSpy developers # # This file is part of HyperSpy. # # HyperSpy is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # HyperSpy is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with HyperSpy. If not, see <http://www.gnu.org/licenses/>. import gc import numpy as np import pytest import hyperspy.api as hs from hyperspy import components1d from hyperspy.decorators import lazifyTestClass def teardown_module(module): """ Run a garbage collection cycle at the end of the test of this module to avoid any memory issue when continuing running the test suite. """ gc.collect() @lazifyTestClass class TestRemoveBackground1DGaussian: def setup_method(self, method): gaussian = components1d.Gaussian() gaussian.A.value = 10 gaussian.centre.value = 10 gaussian.sigma.value = 1 self.signal = hs.signals.Signal1D( gaussian.function(np.arange(0, 20, 0.02))) self.signal.axes_manager[0].scale = 0.01 @pytest.mark.parametrize('binning', (True, False)) @pytest.mark.parametrize('fast', [False, True]) @pytest.mark.parametrize('return_model', [False, True]) def test_background_remove(self, binning, fast, return_model): signal = self.signal signal.metadata.Signal.binned = binning out = signal.remove_background( signal_range=(None, None), background_type='Gaussian', fast=fast, return_model=return_model) if return_model: s1 = out[0] model = out[1] assert np.allclose(model.chisq.data, 0.0) assert np.allclose(model.as_signal().data, signal.data) else: s1 = out assert np.allclose(s1.data, np.zeros_like(s1.data)) def test_background_remove_navigation(self): # Check it calculate the chisq s2 = hs.stack([self.signal]*2) (s, model) = s2.remove_background( signal_range=(None, None), background_type='Gaussian', fast=True, return_model=True) assert np.allclose(model.chisq.data, np.array([0.0, 0.0])) assert np.allclose(model.as_signal().data, s2.data) assert np.allclose(s.data, np.zeros_like(s.data)) @lazifyTestClass class TestRemoveBackground1DLorentzian: def setup_method(self, method): lorentzian = components1d.Lorentzian() lorentzian.A.value = 10 lorentzian.centre.value = 10 lorentzian.gamma.value = 1 self.signal = hs.signals.Signal1D( lorentzian.function(np.arange(0, 20, 0.03))) self.signal.axes_manager[0].scale = 0.01 self.signal.metadata.Signal.binned = False def test_background_remove_lorentzian(self): # Fast is not accurate s1 = self.signal.remove_background( signal_range=(None, None), background_type='Lorentzian') assert np.allclose(np.zeros(len(s1.data)), s1.data, atol=0.2) def test_background_remove_lorentzian_full_fit(self): s1 = self.signal.remove_background( signal_range=(None, None), background_type='Lorentzian', fast=False) assert np.allclose(s1.data, np.zeros(len(s1.data))) @lazifyTestClass class TestRemoveBackground1DPowerLaw: def setup_method(self, method): pl = components1d.PowerLaw() pl.A.value = 1e10 pl.r.value = 3 self.signal = hs.signals.Signal1D(pl.function(np.arange(100, 200))) self.signal.axes_manager[0].offset = 100 self.signal.metadata.Signal.binned = False self.signal_noisy = self.signal.deepcopy() self.signal_noisy.add_gaussian_noise(1) self.atol = 0.04 * abs(self.signal.data).max() self.atol_zero_fill = 0.04 * abs(self.signal.isig[10:].data).max() def test_background_remove_pl(self): s1 = self.signal.remove_background( signal_range=(None, None), background_type='PowerLaw') # since we compare to zero, rtol can't be used (see np.allclose doc) assert np.allclose(s1.data, np.zeros(len(s1.data)), atol=self.atol) assert s1.axes_manager.navigation_dimension == 0 def test_background_remove_pl_zero(self): s1 = self.signal_noisy.remove_background( signal_range=(110.0, 190.0), background_type='PowerLaw', zero_fill=True) # since we compare to zero, rtol can't be used (see np.allclose doc) assert np.allclose(s1.isig[10:], np.zeros(len(s1.data[10:])), atol=self.atol_zero_fill) assert np.allclose(s1.data[:10], np.zeros(10)) def test_background_remove_pl_int(self): self.signal.change_dtype("int") s1 = self.signal.remove_background( signal_range=(None, None), background_type='PowerLaw') # since we compare to zero, rtol can't be used (see np.allclose doc) assert np.allclose(s1.data, np.zeros(len(s1.data)), atol=self.atol) def test_background_remove_pl_int_zero(self): self.signal_noisy.change_dtype("int") s1 = self.signal_noisy.remove_background( signal_range=(110.0, 190.0), background_type='PowerLaw', zero_fill=True) # since we compare to zero, rtol can't be used (see np.allclose doc) assert np.allclose(s1.isig[10:], np.zeros(len(s1.data[10:])), atol=self.atol_zero_fill) assert np.allclose(s1.data[:10], np.zeros(10)) @lazifyTestClass class TestRemoveBackground1DSkewNormal: def setup_method(self, method): skewnormal = components1d.SkewNormal() skewnormal.A.value = 3 skewnormal.x0.value = 1 skewnormal.scale.value = 2 skewnormal.shape.value = 10 self.signal = hs.signals.Signal1D( skewnormal.function(np.arange(0, 10, 0.01))) self.signal.axes_manager[0].scale = 0.01 self.signal.metadata.Signal.binned = False def test_background_remove_skewnormal(self): # Fast is not accurate s1 = self.signal.remove_background( signal_range=(None, None), background_type='SkewNormal') assert np.allclose(np.zeros(len(s1.data)), s1.data, atol=0.2) def test_background_remove_skewnormal_full_fit(self): s1 = self.signal.remove_background( signal_range=(None, None), background_type='SkewNormal', fast=False) assert np.allclose(s1.data, np.zeros(len(s1.data))) @lazifyTestClass class TestRemoveBackground1DVoigt: def setup_method(self, method): voigt = components1d.Voigt(legacy=False) voigt.area.value = 5 voigt.centre.value = 10 voigt.gamma.value = 0.2 voigt.sigma.value = 0.5 self.signal = hs.signals.Signal1D( voigt.function(np.arange(0, 20, 0.03))) self.signal.axes_manager[0].scale = 0.01 self.signal.metadata.Signal.binned = False def test_background_remove_voigt(self): # resort to fast=False as estimator guesses only Gaussian width s1 = self.signal.remove_background( signal_range=(None, None), background_type='Voigt', fast=False) assert np.allclose(np.zeros(len(s1.data)), s1.data) def test_background_remove_voigt_full_fit(self): s1 = self.signal.remove_background( signal_range=(None, None), background_type='Voigt', fast=False) assert np.allclose(s1.data, np.zeros(len(s1.data))) @lazifyTestClass class TestRemoveBackground1DExponential: def setup_method(self, method): exponential = components1d.Exponential() exponential.A.value = 12500. exponential.tau.value = 168. self.signal = hs.signals.Signal1D( exponential.function(np.arange(100, 200, 0.02))) self.signal.axes_manager[0].scale = 0.01 self.signal.metadata.Signal.binned = False self.atol = 0.04 * abs(self.signal.data).max() def test_background_remove_exponential(self): # Fast is not accurate s1 = self.signal.remove_background( signal_range=(None, None), background_type='Exponential') assert np.allclose(np.zeros(len(s1.data)), s1.data, atol=self.atol) def test_background_remove_exponential_full_fit(self): s1 = self.signal.remove_background( signal_range=(None, None), background_type='Exponential', fast=False) assert np.allclose(s1.data, np.zeros(len(s1.data))) def compare_axes_manager_metadata(s0, s1): assert s0.data.shape == s1.data.shape assert s0.axes_manager.shape == s1.axes_manager.shape for iaxis in range(len(s0.axes_manager._axes)): a0, a1 = s0.axes_manager[iaxis], s1.axes_manager[iaxis] assert a0.name == a1.name assert a0.units == a1.units assert a0.scale == a1.scale assert a0.offset == a1.offset assert s0.metadata.General.title == s1.metadata.General.title @pytest.mark.parametrize('nav_dim', [0, 1]) @pytest.mark.parametrize('fast', [True, False]) @pytest.mark.parametrize('zero_fill', [True, False]) @pytest.mark.parametrize('show_progressbar', [True, False]) @pytest.mark.parametrize('plot_remainder', [True, False]) @pytest.mark.parametrize('background_type', ['Doniach', 'Gaussian', 'Lorentzian', 'Polynomial', 'Power Law', 'Offset', 'SkewNormal', 'SplitVoigt', 'Voigt']) def test_remove_background_metadata_axes_manager_copy(nav_dim, fast, zero_fill, show_progressbar, plot_remainder, background_type): if nav_dim == 0: if background_type == ('Voigt'): # speeds up the test s = hs.signals.Signal1D(np.hstack((np.arange(10, 50), np.arange(10, 50)[::-1]))) else: s = hs.signals.Signal1D(np.arange(10, 100)[::-1]) else: if background_type == ('Voigt'): # avoids warning s = hs.signals.Signal1D( np.tile(np.exp(np.arange(0, 100)[::-1]), (2, 1))) else: s = hs.signals.Signal1D(np.arange(10, 210)[::-1].reshape(2, 100)) s.axes_manager[0].name = 'axis0' s.axes_manager[0].units = 'units0' s.axes_manager[0].scale = 0.9 s.axes_manager[0].offset = 1. s.metadata.General.title = "atitle" s_r = s.remove_background(signal_range=(2, 50), fast=fast, zero_fill=zero_fill, show_progressbar=show_progressbar, plot_remainder=plot_remainder, background_type=background_type) compare_axes_manager_metadata(s, s_r) assert s_r.data.shape == s.data.shape
dnjohnstone/hyperspy
hyperspy/tests/signal/test_remove_background.py
Python
gpl-3.0
11,665
[ "Gaussian" ]
3967bd158e6a833c6263b0aec293dbe1318eaabfd4d53eba418d618f31aae6ef
from basesynapse import BaseSynapse import numpy as np import pycuda.gpuarray as garray from pycuda.tools import dtype_to_ctype import pycuda.driver as cuda from pycuda.compiler import SourceModule cuda_src = """ __global__ void alpha_synapse( int num, %(type)s dt, int *spike, int *Pre, %(type)s *Ar, %(type)s *Ad, %(type)s *Gmax, %(type)s *a0, %(type)s *a1, %(type)s *a2, %(type)s *cond ) { int tid = threadIdx.x + blockIdx.x*blockDim.x; int tot_threads = gridDim.x * blockDim.x; int pre; %(type)s ar,ad,gmax; %(type)s old_a[3]; %(type)s new_a[3]; for( int i=tid; i<num; i+=tot_threads ){ // copy data from global memory to register ar = Ar[i]; ad = Ad[i]; pre = Pre[i]; gmax = Gmax[i]; old_a[0] = a0[i]; old_a[1] = a1[i]; old_a[2] = a2[i]; // update the alpha function new_a[0] = fmax( 0., old_a[0] + dt*old_a[1] ); new_a[1] = old_a[1] + dt*old_a[2]; if( spike[pre] ) new_a[1] += ar*ad; new_a[2] = -( ar+ad )*old_a[1] - ar*ad*old_a[0]; // copy data from register to the global memory a0[i] = new_a[0]; a1[i] = new_a[1]; a2[i] = new_a[2]; cond[i] = new_a[0]*gmax; } return; } """ class AlphaSynapse(BaseSynapse): def __init__( self, s_dict, synapse_state, dt, debug=False): self.debug = debug self.dt = dt self.num = len( s_dict['id'] ) self.pre = garray.to_gpu( np.asarray( s_dict['pre'], dtype=np.int32 )) self.ar = garray.to_gpu( np.asarray( s_dict['ar'], dtype=np.float64 )) self.ad = garray.to_gpu( np.asarray( s_dict['ad'], dtype=np.float64 )) self.gmax = garray.to_gpu( np.asarray( s_dict['gmax'], dtype=np.float64 )) self.a0 = garray.zeros( (self.num,), dtype=np.float64 ) self.a1 = garray.zeros( (self.num,), dtype=np.float64 ) self.a2 = garray.zeros( (self.num,), dtype=np.float64 ) self.cond = synapse_state self.update = self.get_gpu_kernel() @property def synapse_class(self): return int(0) def update_state(self, buffer, st = None): self.update.prepared_async_call( self.gpu_grid,\ self.gpu_block,\ st,\ self.num,\ self.dt,\ buffer.spike_buffer.gpudata,\ self.pre.gpudata,\ self.ar.gpudata,\ self.ad.gpudata,\ self.gmax.gpudata,\ self.a0.gpudata,\ self.a1.gpudata,\ self.a2.gpudata,\ self.cond) def get_gpu_kernel(self): self.gpu_block = (128,1,1) self.gpu_grid = (min( 6*cuda.Context.get_device().MULTIPROCESSOR_COUNT,\ (self.num-1)/self.gpu_block[0] + 1), 1) # cuda_src = open('./alpha_synapse.cu','r') mod = SourceModule( \ cuda_src % {"type": dtype_to_ctype(np.float64)},\ options=["--ptxas-options=-v"]) func = mod.get_function("alpha_synapse") func.prepare('idPPPPPPPPP')# [ np.int32, # syn_num # np.float64, # dt # np.intp, # spike list # np.intp, # pre-synaptic neuron list # np.intp, # ar array # np.intp, # ad array # np.intp, # gmax array # np.intp, # a0 array # np.intp, # a1 array # np.intp, # a2 array # np.intp ] ) # cond array return func
cerrno/neurokernel
neurokernel/LPU/synapses/AlphaSynapse.py
Python
bsd-3-clause
3,696
[ "NEURON" ]
4156b595165fb7611a63949244068a182205ba37d45b39ed12f9471caf38957c
## \file ## \ingroup tutorial_roofit ## \notebook ## Multidimensional models: complete example with use of conditional pdf with per-event errors ## ## \macro_code ## ## \date February 2018 ## \authors Clemens Lange, Wouter Verkerke (C++ version) import ROOT # B-physics pdf with per-event Gaussian resolution # ---------------------------------------------------------------------------------------------- # Observables dt = ROOT.RooRealVar("dt", "dt", -10, 10) dterr = ROOT.RooRealVar("dterr", "per-event error on dt", 0.01, 10) # Build a gaussian resolution model scaled by the per-error = # gauss(dt,bias,sigma*dterr) bias = ROOT.RooRealVar("bias", "bias", 0, -10, 10) sigma = ROOT.RooRealVar( "sigma", "per-event error scale factor", 1, 0.1, 10) gm = ROOT.RooGaussModel( "gm1", "gauss model scaled bt per-event error", dt, bias, sigma, dterr) # Construct decay(dt) (x) gauss1(dt|dterr) tau = ROOT.RooRealVar("tau", "tau", 1.548) decay_gm = ROOT.RooDecay("decay_gm", "decay", dt, tau, gm, ROOT.RooDecay.DoubleSided) # Construct fake 'external' data with per-event error # ------------------------------------------------------------------------------------------------------ # Use landau pdf to get somewhat realistic distribution with long tail pdfDtErr = ROOT.RooLandau("pdfDtErr", "pdfDtErr", dterr, ROOT.RooFit.RooConst( 1), ROOT.RooFit.RooConst(0.25)) expDataDterr = pdfDtErr.generate(ROOT.RooArgSet(dterr), 10000) # Sample data from conditional decay_gm(dt|dterr) # --------------------------------------------------------------------------------------------- # Specify external dataset with dterr values to use decay_dm as # conditional pdf data = decay_gm.generate(ROOT.RooArgSet( dt), ROOT.RooFit.ProtoData(expDataDterr)) # Fit conditional decay_dm(dt|dterr) # --------------------------------------------------------------------- # Specify dterr as conditional observable decay_gm.fitTo(data, ROOT.RooFit.ConditionalObservables( ROOT.RooArgSet(dterr))) # Plot conditional decay_dm(dt|dterr) # --------------------------------------------------------------------- # Make two-dimensional plot of conditional pdf in (dt,dterr) hh_decay = decay_gm.createHistogram("hh_decay", dt, ROOT.RooFit.Binning( 50), ROOT.RooFit.YVar(dterr, ROOT.RooFit.Binning(50))) hh_decay.SetLineColor(ROOT.kBlue) # Plot decay_gm(dt|dterr) at various values of dterr frame = dt.frame(ROOT.RooFit.Title( "Slices of decay(dt|dterr) at various dterr")) for ibin in range(0, 100, 20): dterr.setBin(ibin) decay_gm.plotOn(frame, ROOT.RooFit.Normalization(5.)) # Make projection of data an dt frame2 = dt.frame(ROOT.RooFit.Title("Projection of decay(dt|dterr) on dt")) data.plotOn(frame2) # Make projection of decay(dt|dterr) on dt. # # Instead of integrating out dterr, a weighted average of curves # at values dterr_i as given in the external dataset. # (The kTRUE argument bins the data before projection to speed up the process) decay_gm.plotOn(frame2, ROOT.RooFit.ProjWData(expDataDterr, ROOT.kTRUE)) # Draw all frames on canvas c = ROOT.TCanvas("rf306_condpereventerrors", "rf306_condperventerrors", 1200, 400) c.Divide(3) c.cd(1) ROOT.gPad.SetLeftMargin(0.20) hh_decay.GetZaxis().SetTitleOffset(2.5) hh_decay.Draw("surf") c.cd(2) ROOT.gPad.SetLeftMargin(0.15) frame.GetYaxis().SetTitleOffset(1.6) frame.Draw() c.cd(3) ROOT.gPad.SetLeftMargin(0.15) frame2.GetYaxis().SetTitleOffset(1.6) frame2.Draw() c.SaveAs("rf306_condpereventerrors.png")
root-mirror/root
tutorials/roofit/rf306_condpereventerrors.py
Python
lgpl-2.1
3,522
[ "Gaussian" ]
ee1c2935a3336882d9f9a79c35e379e78541b85efe64df67c9070d75b84bd594
# # Copyright (C) 2013-2019 The ESPResSo project # # This file is part of ESPResSo. # # ESPResSo is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # ESPResSo is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # import unittest as ut import unittest_decorators as utx import numpy as np import espressomd # Dihedral interaction needs more rigorous tests. # The geometry checked here is rather simple and special. # I also found that as the dihedral angle approaches to 0, the simulation # values deviate from the analytic values by roughly 10%. def rotate_vector(v, k, phi): """Rotates vector v around unit vector k by angle phi. Uses Rodrigues' rotation formula.""" vrot = v * np.cos(phi) + np.cross(k, v) * \ np.sin(phi) + k * np.dot(k, v) * (1.0 - np.cos(phi)) return vrot def dihedral_potential(k, phi, n, phase): if phi == -1: return 0 else: return k * (1 - np.cos(n * phi - phase)) def dihedral_force(k, n, phase, p1, p2, p3, p4): v12 = p2 - p1 v23 = p3 - p2 v34 = p4 - p3 v12Xv23 = np.cross(v12, v23) l_v12Xv23 = np.linalg.norm(v12Xv23) v23Xv34 = np.cross(v23, v34) l_v23Xv34 = np.linalg.norm(v23Xv34) # if dihedral angle is not defined, no forces if l_v12Xv23 <= 1e-8 or l_v23Xv34 <= 1e-8: return 0, 0, 0 else: cosphi = np.abs(np.dot(v12Xv23, v23Xv34)) / (l_v12Xv23 * l_v23Xv34) phi = np.arccos(cosphi) f1 = (v23Xv34 - cosphi * v12Xv23) / l_v12Xv23 f4 = (v12Xv23 - cosphi * v23Xv34) / l_v23Xv34 v23Xf1 = np.cross(v23, f1) v23Xf4 = np.cross(v23, f4) v34Xf4 = np.cross(v34, f4) v12Xf1 = np.cross(v12, f1) coeff = -k * n * np.sin(n * phi - phase) / np.sin(phi) force1 = coeff * v23Xf1 force2 = coeff * (v34Xf4 - v12Xf1 - v23Xf1) force3 = coeff * (v12Xf1 - v23Xf4 - v34Xf4) return force1, force2, force3 class InteractionsBondedTest(ut.TestCase): system = espressomd.System(box_l=[1.0, 1.0, 1.0]) np.random.seed(seed=42) box_l = 10. start_pos = [5., 5., 5.] axis = np.array([1., 0., 0.]) axis /= np.linalg.norm(axis) rel_pos_1 = np.array([0., 1., 0.]) rel_pos_2 = np.array([0., 0., 1.]) def setUp(self): self.system.box_l = [self.box_l] * 3 self.system.cell_system.skin = 0.4 self.system.time_step = .1 self.system.part.add(pos=4 * [self.start_pos], type=4 * [0]) def tearDown(self): self.system.part.clear() # Analytical Expression def dihedral_angle(self, p1, p2, p3, p4): """ Calculate the dihedral angle phi based on particles' position p1, p2, p3, p4. """ v12 = p2 - p1 v23 = p3 - p2 v34 = p4 - p3 v12Xv23 = np.cross(v12, v23) l_v12Xv23 = np.linalg.norm(v12Xv23) v23Xv34 = np.cross(v23, v34) l_v23Xv34 = np.linalg.norm(v23Xv34) # if dihedral angle is not defined, phi := -1. if l_v12Xv23 <= 1e-8 or l_v23Xv34 <= 1e-8: return -1 else: cosphi = np.abs(np.dot(v12Xv23, v23Xv34)) / ( l_v12Xv23 * l_v23Xv34) return np.arccos(cosphi) # Test Dihedral Angle def test_dihedral(self): p0, p1, p2, p3 = self.system.part.all() dh_k = 1 dh_phase = np.pi / 6 dh_n = 1 dh = espressomd.interactions.Dihedral( bend=dh_k, mult=dh_n, phase=dh_phase) self.system.bonded_inter.add(dh) p1.add_bond((dh, p0, p2, p3)) p2.pos = p1.pos + [1, 0, 0] N = 111 d_phi = np.pi / (N * 4) for i in range(N): p0.pos = p1.pos + \ rotate_vector(self.rel_pos_1, self.axis, i * d_phi) p3.pos = p2.pos + \ rotate_vector(self.rel_pos_2, self.axis, -i * d_phi) self.system.integrator.run(recalc_forces=True, steps=0) # Calculate energies E_sim = self.system.analysis.energy()["bonded"] phi = self.dihedral_angle(p0.pos, p1.pos, p2.pos, p3.pos) E_ref = dihedral_potential(dh_k, phi, dh_n, dh_phase) # Calculate forces f2_sim = p1.f _, f2_ref, _ = dihedral_force(dh_k, dh_n, dh_phase, p0.pos, p1.pos, p2.pos, p3.pos) # Check that energies match, ... np.testing.assert_almost_equal(E_sim, E_ref) # and has correct value. f2_sim_copy = np.copy(f2_sim) np.testing.assert_almost_equal(f2_sim_copy, f2_ref) # Test Tabulated Dihedral Angle @utx.skipIfMissingFeatures(["TABULATED"]) def test_tabulated_dihedral(self): p0, p1, p2, p3 = self.system.part.all() N = 111 d_phi = 2 * np.pi / N # tabulated values for the range [0, 2*pi] tab_energy = [np.cos(i * d_phi) for i in range(N + 1)] tab_force = [np.cos(i * d_phi) for i in range(N + 1)] dihedral_tabulated = espressomd.interactions.TabulatedDihedral( energy=tab_energy, force=tab_force) self.system.bonded_inter.add(dihedral_tabulated) p1.add_bond((dihedral_tabulated, p0, p2, p3)) p2.pos = p1.pos + [1, 0, 0] # check stored parameters interaction_id = len(self.system.bonded_inter) - 1 tabulated = self.system.bonded_inter[interaction_id] np.testing.assert_allclose(tabulated.params['force'], tab_force) np.testing.assert_allclose(tabulated.params['energy'], tab_energy) np.testing.assert_almost_equal(tabulated.params['min'], 0.) np.testing.assert_almost_equal(tabulated.params['max'], 2 * np.pi) # measure at half the angular resolution to observe interpolation for i in range(2 * N - 1): # increase dihedral angle by d_phi (phi ~ 0 at i = 0) p0.pos = p1.pos + \ rotate_vector(self.rel_pos_1, self.axis, -i * d_phi / 4) p3.pos = p2.pos + \ rotate_vector(self.rel_pos_1, self.axis, i * d_phi / 4) self.system.integrator.run(recalc_forces=True, steps=0) # Calculate energies E_sim = self.system.analysis.energy()["bonded"] # Get tabulated values j = i // 2 if i % 2 == 0: E_ref = tab_energy[j] else: E_ref = (tab_energy[j] + tab_energy[j + 1]) / 2.0 # Check that energies match, ... np.testing.assert_almost_equal(E_sim, E_ref) if __name__ == '__main__': ut.main()
espressomd/espresso
testsuite/python/interactions_dihedral.py
Python
gpl-3.0
7,112
[ "ESPResSo" ]
13acd50dff9eb943ce122dc0d69c5d9c12ab840cd51373e4e3490dbd337b12de
# # @BEGIN LICENSE # # Psi4: an open-source quantum chemistry software package # # Copyright (c) 2007-2017 The Psi4 Developers. # # The copyrights for code used from other parties are included in # the corresponding files. # # This file is part of Psi4. # # Psi4 is free software; you can redistribute it and/or modify # it under the terms of the GNU Lesser General Public License as published by # the Free Software Foundation, version 3. # # Psi4 is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Lesser General Public License for more details. # # You should have received a copy of the GNU Lesser General Public License along # with Psi4; if not, write to the Free Software Foundation, Inc., # 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA. # # @END LICENSE # """ | Database (Truhlar) of non-hydrogen-transfer barrier height reactions. | Geometries and Reaction energies from Truhlar and coworkers at site http://t1.chem.umn.edu/misc/database_group/database_therm_bh/non_H.htm. - **cp** ``'off'`` - **rlxd** ``'off'`` - **subset** - ``'small'`` - ``'large'`` """ import re import qcdb # <<< NHTBH Database Module >>> dbse = 'NHTBH' isOS = 'true' # <<< Database Members >>> HRXN = range(1, 39) HRXN_SM = [3, 4, 31, 32] HRXN_LG = [36] # <<< Chemical Systems Involved >>> RXNM = {} # reaction matrix of reagent contributions per reaction ACTV = {} # order of active reagents per reaction ACTV['%s-%s' % (dbse, 1)] = ['%s-%s-reagent' % (dbse, 'H' ), '%s-%s-reagent' % (dbse, 'N2O' ), '%s-%s-reagent' % (dbse, 'N2OHts') ] RXNM['%s-%s' % (dbse, 1)] = dict(zip(ACTV['%s-%s' % (dbse, 1)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 2)] = ['%s-%s-reagent' % (dbse, 'OH' ), '%s-%s-reagent' % (dbse, 'N2' ), '%s-%s-reagent' % (dbse, 'N2OHts') ] RXNM['%s-%s' % (dbse, 2)] = dict(zip(ACTV['%s-%s' % (dbse, 2)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 3)] = ['%s-%s-reagent' % (dbse, 'H' ), '%s-%s-reagent' % (dbse, 'HF' ), '%s-%s-reagent' % (dbse, 'HFHts') ] RXNM['%s-%s' % (dbse, 3)] = dict(zip(ACTV['%s-%s' % (dbse, 3)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 4)] = ['%s-%s-reagent' % (dbse, 'H' ), '%s-%s-reagent' % (dbse, 'HF' ), '%s-%s-reagent' % (dbse, 'HFHts') ] RXNM['%s-%s' % (dbse, 4)] = dict(zip(ACTV['%s-%s' % (dbse, 4)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 5)] = ['%s-%s-reagent' % (dbse, 'H' ), '%s-%s-reagent' % (dbse, 'HCl' ), '%s-%s-reagent' % (dbse, 'HClHts') ] RXNM['%s-%s' % (dbse, 5)] = dict(zip(ACTV['%s-%s' % (dbse, 5)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 6)] = ['%s-%s-reagent' % (dbse, 'H' ), '%s-%s-reagent' % (dbse, 'HCl' ), '%s-%s-reagent' % (dbse, 'HClHts') ] RXNM['%s-%s' % (dbse, 6)] = dict(zip(ACTV['%s-%s' % (dbse, 6)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 7)] = ['%s-%s-reagent' % (dbse, 'H' ), '%s-%s-reagent' % (dbse, 'CH3F' ), '%s-%s-reagent' % (dbse, 'HFCH3ts') ] RXNM['%s-%s' % (dbse, 7)] = dict(zip(ACTV['%s-%s' % (dbse, 7)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 8)] = ['%s-%s-reagent' % (dbse, 'HF' ), '%s-%s-reagent' % (dbse, 'CH3' ), '%s-%s-reagent' % (dbse, 'HFCH3ts') ] RXNM['%s-%s' % (dbse, 8)] = dict(zip(ACTV['%s-%s' % (dbse, 8)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 9)] = ['%s-%s-reagent' % (dbse, 'H' ), '%s-%s-reagent' % (dbse, 'F2' ), '%s-%s-reagent' % (dbse, 'HF2ts') ] RXNM['%s-%s' % (dbse, 9)] = dict(zip(ACTV['%s-%s' % (dbse, 9)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 10)] = ['%s-%s-reagent' % (dbse, 'HF' ), '%s-%s-reagent' % (dbse, 'F' ), '%s-%s-reagent' % (dbse, 'HF2ts') ] RXNM['%s-%s' % (dbse, 10)] = dict(zip(ACTV['%s-%s' % (dbse, 10)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 11)] = ['%s-%s-reagent' % (dbse, 'CH3' ), '%s-%s-reagent' % (dbse, 'ClF' ), '%s-%s-reagent' % (dbse, 'CH3FClts') ] RXNM['%s-%s' % (dbse, 11)] = dict(zip(ACTV['%s-%s' % (dbse, 11)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 12)] = ['%s-%s-reagent' % (dbse, 'CH3F' ), '%s-%s-reagent' % (dbse, 'Cl' ), '%s-%s-reagent' % (dbse, 'CH3FClts') ] RXNM['%s-%s' % (dbse, 12)] = dict(zip(ACTV['%s-%s' % (dbse, 12)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 13)] = ['%s-%s-reagent' % (dbse, 'F_anion'), '%s-%s-reagent' % (dbse, 'CH3F' ), '%s-%s-reagent' % (dbse, 'FCH3Fts') ] RXNM['%s-%s' % (dbse, 13)] = dict(zip(ACTV['%s-%s' % (dbse, 13)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 14)] = ['%s-%s-reagent' % (dbse, 'F_anion'), '%s-%s-reagent' % (dbse, 'CH3F' ), '%s-%s-reagent' % (dbse, 'FCH3Fts') ] RXNM['%s-%s' % (dbse, 14)] = dict(zip(ACTV['%s-%s' % (dbse, 14)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 15)] = ['%s-%s-reagent' % (dbse, 'FCH3Fcomp'), '%s-%s-reagent' % (dbse, 'FCH3Fts' ) ] RXNM['%s-%s' % (dbse, 15)] = dict(zip(ACTV['%s-%s' % (dbse, 15)], [-1, +1])) ACTV['%s-%s' % (dbse, 16)] = ['%s-%s-reagent' % (dbse, 'FCH3Fcomp'), '%s-%s-reagent' % (dbse, 'FCH3Fts' ) ] RXNM['%s-%s' % (dbse, 16)] = dict(zip(ACTV['%s-%s' % (dbse, 16)], [-1, +1])) ACTV['%s-%s' % (dbse, 17)] = ['%s-%s-reagent' % (dbse, 'Cl_anion' ), '%s-%s-reagent' % (dbse, 'CH3Cl' ), '%s-%s-reagent' % (dbse, 'ClCH3Clts') ] RXNM['%s-%s' % (dbse, 17)] = dict(zip(ACTV['%s-%s' % (dbse, 17)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 18)] = ['%s-%s-reagent' % (dbse, 'Cl_anion' ), '%s-%s-reagent' % (dbse, 'CH3Cl' ), '%s-%s-reagent' % (dbse, 'ClCH3Clts') ] RXNM['%s-%s' % (dbse, 18)] = dict(zip(ACTV['%s-%s' % (dbse, 18)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 19)] = ['%s-%s-reagent' % (dbse, 'ClCH3Clcomp'), '%s-%s-reagent' % (dbse, 'ClCH3Clts' ) ] RXNM['%s-%s' % (dbse, 19)] = dict(zip(ACTV['%s-%s' % (dbse, 19)], [-1, +1])) ACTV['%s-%s' % (dbse, 20)] = ['%s-%s-reagent' % (dbse, 'ClCH3Clcomp'), '%s-%s-reagent' % (dbse, 'ClCH3Clts' ) ] RXNM['%s-%s' % (dbse, 20)] = dict(zip(ACTV['%s-%s' % (dbse, 20)], [-1, +1])) ACTV['%s-%s' % (dbse, 21)] = ['%s-%s-reagent' % (dbse, 'F_anion' ), '%s-%s-reagent' % (dbse, 'CH3Cl' ), '%s-%s-reagent' % (dbse, 'FCH3Clts') ] RXNM['%s-%s' % (dbse, 21)] = dict(zip(ACTV['%s-%s' % (dbse, 21)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 22)] = ['%s-%s-reagent' % (dbse, 'CH3F'), '%s-%s-reagent' % (dbse, 'Cl_anion'), '%s-%s-reagent' % (dbse, 'FCH3Clts') ] RXNM['%s-%s' % (dbse, 22)] = dict(zip(ACTV['%s-%s' % (dbse, 22)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 23)] = ['%s-%s-reagent' % (dbse, 'FCH3Clcomp1'), '%s-%s-reagent' % (dbse, 'FCH3Clts' ) ] RXNM['%s-%s' % (dbse, 23)] = dict(zip(ACTV['%s-%s' % (dbse, 23)], [-1, +1])) ACTV['%s-%s' % (dbse, 24)] = ['%s-%s-reagent' % (dbse, 'FCH3Clcomp2'), '%s-%s-reagent' % (dbse, 'FCH3Clts' ) ] RXNM['%s-%s' % (dbse, 24)] = dict(zip(ACTV['%s-%s' % (dbse, 24)], [-1, +1])) ACTV['%s-%s' % (dbse, 25)] = ['%s-%s-reagent' % (dbse, 'OH_anion'), '%s-%s-reagent' % (dbse, 'CH3F' ), '%s-%s-reagent' % (dbse, 'HOCH3Fts') ] RXNM['%s-%s' % (dbse, 25)] = dict(zip(ACTV['%s-%s' % (dbse, 25)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 26)] = ['%s-%s-reagent' % (dbse, 'CH3OH' ), '%s-%s-reagent' % (dbse, 'F_anion' ), '%s-%s-reagent' % (dbse, 'HOCH3Fts') ] RXNM['%s-%s' % (dbse, 26)] = dict(zip(ACTV['%s-%s' % (dbse, 26)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 27)] = ['%s-%s-reagent' % (dbse, 'HOCH3Fcomp2'), '%s-%s-reagent' % (dbse, 'HOCH3Fts' ) ] RXNM['%s-%s' % (dbse, 27)] = dict(zip(ACTV['%s-%s' % (dbse, 27)], [-1, +1])) ACTV['%s-%s' % (dbse, 28)] = ['%s-%s-reagent' % (dbse, 'HOCH3Fcomp1'), '%s-%s-reagent' % (dbse, 'HOCH3Fts' ) ] RXNM['%s-%s' % (dbse, 28)] = dict(zip(ACTV['%s-%s' % (dbse, 28)], [-1, +1])) ACTV['%s-%s' % (dbse, 29)] = ['%s-%s-reagent' % (dbse, 'H' ), '%s-%s-reagent' % (dbse, 'N2' ), '%s-%s-reagent' % (dbse, 'HN2ts') ] RXNM['%s-%s' % (dbse, 29)] = dict(zip(ACTV['%s-%s' % (dbse, 29)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 30)] = ['%s-%s-reagent' % (dbse, 'HN2' ), '%s-%s-reagent' % (dbse, 'HN2ts') ] RXNM['%s-%s' % (dbse, 30)] = dict(zip(ACTV['%s-%s' % (dbse, 30)], [-1, +1])) ACTV['%s-%s' % (dbse, 31)] = ['%s-%s-reagent' % (dbse, 'H' ), '%s-%s-reagent' % (dbse, 'CO' ), '%s-%s-reagent' % (dbse, 'HCOts') ] RXNM['%s-%s' % (dbse, 31)] = dict(zip(ACTV['%s-%s' % (dbse, 31)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 32)] = ['%s-%s-reagent' % (dbse, 'HCO' ), '%s-%s-reagent' % (dbse, 'HCOts') ] RXNM['%s-%s' % (dbse, 32)] = dict(zip(ACTV['%s-%s' % (dbse, 32)], [-1, +1])) ACTV['%s-%s' % (dbse, 33)] = ['%s-%s-reagent' % (dbse, 'H' ), '%s-%s-reagent' % (dbse, 'C2H4' ), '%s-%s-reagent' % (dbse, 'C2H5ts') ] RXNM['%s-%s' % (dbse, 33)] = dict(zip(ACTV['%s-%s' % (dbse, 33)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 34)] = ['%s-%s-reagent' % (dbse, 'C2H5' ), '%s-%s-reagent' % (dbse, 'C2H5ts') ] RXNM['%s-%s' % (dbse, 34)] = dict(zip(ACTV['%s-%s' % (dbse, 34)], [-1, +1])) ACTV['%s-%s' % (dbse, 35)] = ['%s-%s-reagent' % (dbse, 'CH3' ), '%s-%s-reagent' % (dbse, 'C2H4' ), '%s-%s-reagent' % (dbse, 'C3H7ts') ] RXNM['%s-%s' % (dbse, 35)] = dict(zip(ACTV['%s-%s' % (dbse, 35)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 36)] = ['%s-%s-reagent' % (dbse, 'C3H7' ), '%s-%s-reagent' % (dbse, 'C3H7ts') ] RXNM['%s-%s' % (dbse, 36)] = dict(zip(ACTV['%s-%s' % (dbse, 36)], [-1, +1])) ACTV['%s-%s' % (dbse, 37)] = ['%s-%s-reagent' % (dbse, 'HCN' ), '%s-%s-reagent' % (dbse, 'HCNts') ] RXNM['%s-%s' % (dbse, 37)] = dict(zip(ACTV['%s-%s' % (dbse, 37)], [-1, +1])) ACTV['%s-%s' % (dbse, 38)] = ['%s-%s-reagent' % (dbse, 'HNC' ), '%s-%s-reagent' % (dbse, 'HCNts') ] RXNM['%s-%s' % (dbse, 38)] = dict(zip(ACTV['%s-%s' % (dbse, 38)], [-1, +1])) # <<< Reference Values >>> BIND = {} BIND['%s-%s' % (dbse, 1)] = 18.14 BIND['%s-%s' % (dbse, 2)] = 83.22 BIND['%s-%s' % (dbse, 3)] = 42.18 BIND['%s-%s' % (dbse, 4)] = 42.18 BIND['%s-%s' % (dbse, 5)] = 18.00 BIND['%s-%s' % (dbse, 6)] = 18.00 BIND['%s-%s' % (dbse, 7)] = 30.38 BIND['%s-%s' % (dbse, 8)] = 57.02 BIND['%s-%s' % (dbse, 9)] = 2.27 BIND['%s-%s' % (dbse, 10)] = 106.18 BIND['%s-%s' % (dbse, 11)] = 7.43 BIND['%s-%s' % (dbse, 12)] = 60.17 BIND['%s-%s' % (dbse, 13)] = -0.34 BIND['%s-%s' % (dbse, 14)] = -0.34 BIND['%s-%s' % (dbse, 15)] = 13.38 BIND['%s-%s' % (dbse, 16)] = 13.38 BIND['%s-%s' % (dbse, 17)] = 3.10 BIND['%s-%s' % (dbse, 18)] = 3.10 BIND['%s-%s' % (dbse, 19)] = 13.61 BIND['%s-%s' % (dbse, 20)] = 13.61 BIND['%s-%s' % (dbse, 21)] = -12.54 BIND['%s-%s' % (dbse, 22)] = 20.11 BIND['%s-%s' % (dbse, 23)] = 2.89 BIND['%s-%s' % (dbse, 24)] = 29.62 BIND['%s-%s' % (dbse, 25)] = -2.78 BIND['%s-%s' % (dbse, 26)] = 17.33 BIND['%s-%s' % (dbse, 27)] = 10.96 BIND['%s-%s' % (dbse, 28)] = 47.20 BIND['%s-%s' % (dbse, 29)] = 14.69 BIND['%s-%s' % (dbse, 30)] = 10.72 BIND['%s-%s' % (dbse, 31)] = 3.17 BIND['%s-%s' % (dbse, 32)] = 22.68 BIND['%s-%s' % (dbse, 33)] = 1.72 BIND['%s-%s' % (dbse, 34)] = 41.75 BIND['%s-%s' % (dbse, 35)] = 6.85 BIND['%s-%s' % (dbse, 36)] = 32.97 BIND['%s-%s' % (dbse, 37)] = 48.16 BIND['%s-%s' % (dbse, 38)] = 33.11 # <<< Comment Lines >>> TAGL = {} TAGL['%s-%s' % (dbse, 1)] = '{ H + N2O <-- [HN2O] } --> OH + N2' TAGL['%s-%s' % (dbse, 2)] = 'H + N2O <-- { [HN2O] --> OH + N2 }' TAGL['%s-%s' % (dbse, 3)] = '{ H + FH <-- [HFH] } --> HF + H' TAGL['%s-%s' % (dbse, 4)] = 'H + FH <-- { [HFH] --> HF + H }' TAGL['%s-%s' % (dbse, 5)] = '{ H + ClH <-- [HClH] } --> HCl + H' TAGL['%s-%s' % (dbse, 6)] = 'H + ClH <-- { [HClH] --> HCl + H }' TAGL['%s-%s' % (dbse, 7)] = '{ H + FCH3 <-- [HFCH3] } --> HF + CH3' TAGL['%s-%s' % (dbse, 8)] = 'H + FCH3 <-- { [HFCH3] --> HF + CH3 }' TAGL['%s-%s' % (dbse, 9)] = '{ H + F2 <-- [HF2] } --> HF + F' TAGL['%s-%s' % (dbse, 10)] = 'H + F2 <-- { [HF2] --> HF + F }' TAGL['%s-%s' % (dbse, 11)] = '{ CH3 + FCl <-- [CH3FCl] } --> CH3F + Cl' TAGL['%s-%s' % (dbse, 12)] = 'CH3 + FCl <-- { [CH3FCl] --> CH3F + Cl }' TAGL['%s-%s' % (dbse, 13)] = '{ F- + CH3F <-- [FCH3F-] } --> FCH3 + F-' TAGL['%s-%s' % (dbse, 14)] = 'F- + CH3F <-- { [FCH3F-] --> FCH3 + F- }' TAGL['%s-%s' % (dbse, 15)] = '{ F- ... CH3F <-- [FCH3F-] } --> FCH3 ... F-' TAGL['%s-%s' % (dbse, 16)] = 'F- ... CH3F <-- { [FCH3F-] --> FCH3 ... F- }' TAGL['%s-%s' % (dbse, 17)] = '{ Cl- + CH3Cl <-- [ClCH3Cl-] } --> ClCH3 + Cl-' TAGL['%s-%s' % (dbse, 18)] = 'Cl- + CH3Cl <-- { [ClCH3Cl-] --> ClCH3 + Cl- }' TAGL['%s-%s' % (dbse, 19)] = '{ Cl- ... CH3Cl <-- [ClCH3Cl-] } --> ClCH3 ... Cl-' TAGL['%s-%s' % (dbse, 20)] = 'Cl- ... CH3Cl <-- { [ClCH3Cl-] --> ClCH3 ... Cl- }' TAGL['%s-%s' % (dbse, 21)] = '{ F- + CH3Cl <-- [FCH3Cl-] } --> FCH3 + Cl-' TAGL['%s-%s' % (dbse, 22)] = 'F- + CH3Cl <-- { [FCH3Cl-] --> FCH3 + Cl- }' TAGL['%s-%s' % (dbse, 23)] = '{ F- ... CH3Cl <-- [FCH3Cl-] } --> FCH3 ... Cl-' TAGL['%s-%s' % (dbse, 24)] = 'F- ... CH3Cl <-- { [FCH3Cl-] --> FCH3 ... Cl- }' TAGL['%s-%s' % (dbse, 25)] = '{ OH- + CH3F <-- [OHCH3F-] } --> HOCH3 + F-' TAGL['%s-%s' % (dbse, 26)] = 'OH- + CH3F <-- { [OHCH3F-] --> HOCH3 + F- }' TAGL['%s-%s' % (dbse, 27)] = '{ OH- ... CH3F <-- [OHCH3F-] } --> HOCH3 ... F-' TAGL['%s-%s' % (dbse, 28)] = 'OH- ... CH3F <-- { [OHCH3F-] --> HOCH3 ... F- }' TAGL['%s-%s' % (dbse, 29)] = '{ H + N2 <-- [HN2] } --> HN2' TAGL['%s-%s' % (dbse, 30)] = 'H + N2 <-- { [HN2] --> HN2 }' TAGL['%s-%s' % (dbse, 31)] = '{ H + CO <-- [HCO] } --> HCO' TAGL['%s-%s' % (dbse, 32)] = 'H + CO <-- { [HCO] --> HCO }' TAGL['%s-%s' % (dbse, 33)] = '{ H + C2H4 <-- [HC2H4] } --> CH3CH2' TAGL['%s-%s' % (dbse, 34)] = 'H + C2H4 <-- { [HC2H4] --> CH3CH2 }' TAGL['%s-%s' % (dbse, 35)] = '{ CH3 + C2H4 <-- [CH3C2H4] } --> CH3CH2CH2' TAGL['%s-%s' % (dbse, 36)] = 'CH3 + C2H4 <-- { [CH3C2H4] --> CH3CH2CH2 }' TAGL['%s-%s' % (dbse, 37)] = '{ HCN <-- [HCN] } --> HNC' TAGL['%s-%s' % (dbse, 38)] = 'HCN <-- { [HCN] --> HNC }' TAGL['%s-%s-reagent' % (dbse, 'C2H4' )] = 'Ethene' TAGL['%s-%s-reagent' % (dbse, 'C2H5ts' )] = 'Transition State of H + C2H4 <--> CH3CH2' TAGL['%s-%s-reagent' % (dbse, 'C2H5' )] = 'C2H5' TAGL['%s-%s-reagent' % (dbse, 'C3H7ts' )] = 'Transition State of CH3 + C2H4 <--> CH3CH2CH2' TAGL['%s-%s-reagent' % (dbse, 'C3H7' )] = 'C3H7' TAGL['%s-%s-reagent' % (dbse, 'CH3Cl' )] = 'CH3Cl' TAGL['%s-%s-reagent' % (dbse, 'CH3FClts' )] = 'Transition State of CH3 + FCL <--> CH3F + Cl' TAGL['%s-%s-reagent' % (dbse, 'CH3F' )] = 'CH3F' TAGL['%s-%s-reagent' % (dbse, 'CH3OH' )] = 'Methanol' TAGL['%s-%s-reagent' % (dbse, 'CH3' )] = 'CH3' TAGL['%s-%s-reagent' % (dbse, 'ClCH3Clcomp')] = 'Complex of Cl- + CH3Cl' TAGL['%s-%s-reagent' % (dbse, 'ClCH3Clts' )] = 'Transition State of Cl- + CH3Cl <--> ClCH3 + Cl-' TAGL['%s-%s-reagent' % (dbse, 'ClF' )] = 'ClF' TAGL['%s-%s-reagent' % (dbse, 'Cl_anion' )] = 'Chloride Anion' TAGL['%s-%s-reagent' % (dbse, 'Cl' )] = 'Chlorine Atom' TAGL['%s-%s-reagent' % (dbse, 'CO' )] = 'Carbon Monoxide' TAGL['%s-%s-reagent' % (dbse, 'F2' )] = 'Fluorine Molecule' TAGL['%s-%s-reagent' % (dbse, 'FCH3Clcomp1')] = 'Complex of F- + CH3Cl' TAGL['%s-%s-reagent' % (dbse, 'FCH3Clcomp2')] = 'Complex of FCH3 + Cl-' TAGL['%s-%s-reagent' % (dbse, 'FCH3Clts' )] = 'Transition State of F- + CH3Cl <--> FCH3 + Cl-' TAGL['%s-%s-reagent' % (dbse, 'FCH3Fcomp' )] = 'Complex of F- + CH3F' TAGL['%s-%s-reagent' % (dbse, 'FCH3Fts' )] = 'Transition State of F- CH3F <--> FCH3 + F-' TAGL['%s-%s-reagent' % (dbse, 'F_anion' )] = 'Fluoride Anion' TAGL['%s-%s-reagent' % (dbse, 'F' )] = 'Fluorine Atom' TAGL['%s-%s-reagent' % (dbse, 'HClHts' )] = 'Transition State of H + ClH <--> HCl + H' TAGL['%s-%s-reagent' % (dbse, 'HCl' )] = 'Hydrogen Chloride' TAGL['%s-%s-reagent' % (dbse, 'HCNts' )] = 'Transition State of HCN <--> HNC' TAGL['%s-%s-reagent' % (dbse, 'HCN' )] = 'Hydrogen Cyanide' TAGL['%s-%s-reagent' % (dbse, 'HCOts' )] = 'Transition State of H + CO <--> HCO' TAGL['%s-%s-reagent' % (dbse, 'HCO' )] = 'HCO' TAGL['%s-%s-reagent' % (dbse, 'HF2ts' )] = 'Transition State of H + F2 <--> HF + F' TAGL['%s-%s-reagent' % (dbse, 'HFCH3ts' )] = 'Transition State of H + FCH3 <--> HF + CH3' TAGL['%s-%s-reagent' % (dbse, 'HFHts' )] = 'Transition State of H + FH <--> HF + H' TAGL['%s-%s-reagent' % (dbse, 'HF' )] = 'Hydrogen Fluoride' TAGL['%s-%s-reagent' % (dbse, 'HN2ts' )] = 'Transition State of H + N2 <--> HN2' TAGL['%s-%s-reagent' % (dbse, 'HN2' )] = 'HN2' TAGL['%s-%s-reagent' % (dbse, 'HNC' )] = 'HNC' TAGL['%s-%s-reagent' % (dbse, 'HOCH3Fcomp1')] = 'Complex of HOCH3 + F-' TAGL['%s-%s-reagent' % (dbse, 'HOCH3Fcomp2')] = 'Complex of OH- + CH3F' TAGL['%s-%s-reagent' % (dbse, 'HOCH3Fts' )] = 'Transition State of OH- + CH3F <--> HOCH3 + F-' TAGL['%s-%s-reagent' % (dbse, 'H' )] = 'Hydrogen Atom' TAGL['%s-%s-reagent' % (dbse, 'N2OHts' )] = 'Transition State of H + N2O <--> OH + N2' TAGL['%s-%s-reagent' % (dbse, 'N2O' )] = 'N2O' TAGL['%s-%s-reagent' % (dbse, 'N2' )] = 'Nitrogen Molecule' TAGL['%s-%s-reagent' % (dbse, 'OH_anion' )] = 'Hydroxide Anion' TAGL['%s-%s-reagent' % (dbse, 'OH' )] = 'OH' # <<< Geometry Specification Strings >>> GEOS = {} GEOS['%s-%s-reagent' % (dbse, 'C2H4')] = qcdb.Molecule(""" 0 1 C 0.00000000 0.00000000 0.66559300 C 0.00000000 -0.00000000 -0.66559300 H 0.00000000 0.92149500 1.23166800 H 0.00000000 -0.92149500 1.23166800 H 0.00000000 0.92149500 -1.23166800 H 0.00000000 -0.92149500 -1.23166800 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'C2H5ts')] = qcdb.Molecule(""" 0 2 C -0.56787700 0.00005100 -0.21895800 C 0.75113900 -0.00003600 0.04193200 H -1.49388400 -0.00048800 1.53176500 H -1.10169100 0.92065100 -0.40862600 H -1.10202200 -0.92023400 -0.40911000 H 1.29912800 -0.92234400 0.17376300 H 1.29889900 0.92232500 0.17436300 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'C2H5')] = qcdb.Molecule(""" 0 2 C -0.25871900 -0.81682900 0.00000000 C -0.25098700 0.67419100 0.00000000 H 0.75883000 -1.22593900 0.00000000 H -0.75883000 -1.21386600 0.88341900 H -0.75883000 -1.21386600 -0.88341900 H -0.17002100 1.22593900 -0.92432000 H -0.17002100 1.22593900 0.92432000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'C3H7ts')] = qcdb.Molecule(""" 0 2 C -0.47213200 0.64593300 -0.00004300 C -1.38261700 -0.36388500 -0.00000200 H -0.23204400 1.16457500 -0.91726400 H -0.23234200 1.16475900 0.91716900 H -1.72712800 -0.80981000 0.92251900 H -1.72693600 -0.81013100 -0.92243500 C 1.61201500 -0.24218900 0.00003500 H 2.19518200 0.66867100 -0.00126900 H 1.58942300 -0.80961900 -0.91863200 H 1.59024500 -0.80759800 0.91996900 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'C3H7')] = qcdb.Molecule(""" 0 2 C 1.20844000 -0.28718900 0.00005700 C -0.06535900 0.57613200 -0.00005700 C -1.31478700 -0.23951800 -0.00001100 H 1.24136900 -0.92839500 0.88123400 H 1.24139400 -0.92858600 -0.88098000 H 2.10187100 0.33872700 0.00000000 H -0.04821800 1.22685100 -0.87708900 H -0.04827200 1.22703700 0.87683400 H -1.72914600 -0.61577100 0.92443500 H -1.72876300 -0.61641500 -0.92436900 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'CH3Cl')] = qcdb.Molecule(""" 0 1 C 0.00000000 0.00000000 -1.12588600 Cl 0.00000000 0.00000000 0.65683000 H 0.00000000 1.02799300 -1.47026400 H 0.89026800 -0.51399700 -1.47026400 H -0.89026800 -0.51399700 -1.47026400 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'CH3FClts')] = qcdb.Molecule(""" 0 2 Cl 1.45474900 -0.00123700 -0.00004000 F -0.32358700 0.00463100 0.00012400 C -2.38741800 -0.00214700 -0.00007300 H -2.49508600 -0.85536100 -0.64940400 H -2.49731300 -0.13867300 1.06313900 H -2.50153700 0.98626900 -0.41373400 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'CH3F')] = qcdb.Molecule(""" 0 1 C -0.63207400 0.00000100 -0.00000000 F 0.74911700 0.00000200 -0.00000200 H -0.98318200 -0.33848900 0.97262500 H -0.98322200 1.01155300 -0.19317200 H -0.98320300 -0.67308400 -0.77943700 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'CH3OH')] = qcdb.Molecule(""" 0 1 C -0.04642300 0.66306900 0.00000000 O -0.04642300 -0.75506300 0.00000000 H -1.08695600 0.97593800 0.00000000 H 0.86059200 -1.05703900 0.00000000 H 0.43814500 1.07159400 0.88953900 H 0.43814500 1.07159400 -0.88953900 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'CH3')] = qcdb.Molecule(""" 0 2 C 0.00000000 0.00000000 0.00000000 H 1.07731727 0.00000000 0.00000000 H -0.53865863 0.93298412 0.00000000 H -0.53865863 -0.93298412 -0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'ClCH3Clcomp')] = qcdb.Molecule(""" -1 1 Cl 0.00000000 0.00000000 -2.38473500 C 0.00000000 0.00000000 -0.56633100 H 0.00000000 1.02506600 -0.22437900 H -0.88773400 -0.51253300 -0.22437900 H 0.88773400 -0.51253300 -0.22437900 Cl 0.00000000 0.00000000 2.62421300 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'ClCH3Clts')] = qcdb.Molecule(""" -1 1 Cl 2.32258100 -0.00013200 0.00014000 C -0.00008500 0.00049100 -0.00050900 H 0.00007700 -0.74429000 -0.76760500 H -0.00032000 -0.29144300 1.02802100 H 0.00008100 1.03721800 -0.26195900 Cl -2.32254200 -0.00012900 0.00013000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'ClF')] = qcdb.Molecule(""" 0 1 F 0.00000000 0.00000000 0.00000000 Cl 1.63033021 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'Cl_anion')] = qcdb.Molecule(""" -1 1 Cl 0.00000000 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'Cl')] = qcdb.Molecule(""" 0 2 Cl 0.00000000 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'CO')] = qcdb.Molecule(""" 0 1 O 0.00000000 0.00000000 0.00000000 C 1.12960815 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'F2')] = qcdb.Molecule(""" 0 1 F 0.00000000 0.00000000 0.00000000 F 1.39520410 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'FCH3Clcomp1')] = qcdb.Molecule(""" -1 1 Cl 0.00000000 0.00000000 1.62313800 C 0.00000000 0.00000000 -0.22735800 H 0.00000000 1.02632100 -0.55514100 H 0.88882000 -0.51316000 -0.55514100 H -0.88882000 -0.51316000 -0.55514100 F 0.00000000 0.00000000 -2.72930800 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'FCH3Clcomp2')] = qcdb.Molecule(""" -1 1 F 0.00000000 0.00000000 -2.64853900 C 0.00000000 0.00000000 -1.24017000 H 0.00000000 1.02471900 -0.88640600 H -0.88743200 -0.51235900 -0.88640600 H 0.88743200 -0.51235900 -0.88640600 Cl 0.00000000 0.00000000 1.99629900 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'FCH3Clts')] = qcdb.Molecule(""" -1 1 F 0.00000000 0.00000000 -2.53792900 C 0.00000000 0.00000000 -0.48837200 H 0.00000000 1.06208700 -0.61497200 H -0.91979500 -0.53104400 -0.61497200 H 0.91979500 -0.53104400 -0.61497200 Cl 0.00000000 0.00000000 1.62450100 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'FCH3Fcomp')] = qcdb.Molecule(""" -1 1 F 0.00000000 0.00000000 -1.84762600 C 0.00000000 0.00000000 -0.42187300 H 0.00000000 1.02358100 -0.07384300 H -0.88644700 -0.51179100 -0.07384300 H 0.88644700 -0.51179100 -0.07384300 F 0.00000000 0.00000000 2.15348900 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'FCH3Fts')] = qcdb.Molecule(""" -1 1 F 0.00309800 -0.01889200 -0.01545600 C -0.00014900 -0.00014000 1.80785700 H 1.06944900 0.00170800 1.80976100 H -0.53660700 0.92513300 1.79693500 H -0.53260100 -0.92778300 1.81705800 F -0.00319100 0.01997400 3.63184500 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'F_anion')] = qcdb.Molecule(""" -1 1 F 0.00000000 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'F')] = qcdb.Molecule(""" 0 2 F 0.00000000 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'HClHts')] = qcdb.Molecule(""" 0 2 H 0.00000000 0.00000000 1.48580000 Cl 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 -1.48580000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'HCl')] = qcdb.Molecule(""" 0 1 Cl 0.00000000 0.00000000 0.00000000 H 1.27444789 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'HCNts')] = qcdb.Molecule(""" 0 1 C 0.08031900 0.62025800 0.00000000 N 0.08031900 -0.56809500 0.00000000 H -1.04414800 0.25512100 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'HCN')] = qcdb.Molecule(""" 0 1 C 0.00000000 0.00000000 -0.50036500 N 0.00000000 0.00000000 0.65264000 H 0.00000000 0.00000000 -1.56629100 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'HCOts')] = qcdb.Molecule(""" 0 2 H -1.52086400 1.38882900 0.00000000 C 0.10863300 0.54932900 0.00000000 O 0.10863300 -0.58560100 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'HCO')] = qcdb.Molecule(""" 0 2 H -0.00905700 0.00000000 -0.00708600 C -0.00703500 0.00000000 1.10967800 O 0.95604000 0.00000000 1.78565600 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'HF2ts')] = qcdb.Molecule(""" 0 2 H 0.00000000 0.00000000 -2.23127300 F 0.00000000 0.00000000 -0.61621800 F 0.00000000 0.00000000 0.86413800 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'HFCH3ts')] = qcdb.Molecule(""" 0 2 H -0.03976400 0.00000000 0.04410600 F -0.04932100 0.00000000 1.28255400 C -0.06154400 0.00000000 2.95115700 H 0.99049700 0.00000000 3.19427500 H -0.59007000 0.91235500 3.18348100 H -0.59007000 -0.91235500 3.18348100 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'HFHts')] = qcdb.Molecule(""" 0 2 H 0.00000000 0.00000000 1.13721700 F 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 -1.13721700 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'HF')] = qcdb.Molecule(""" 0 1 F 0.00000000 0.00000000 0.00000000 H 0.91538107 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'HN2ts')] = qcdb.Molecule(""" 0 2 N 0.00000000 0.00000000 0.00000000 N 1.12281100 0.00000000 0.00000000 H 1.78433286 1.26844651 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'HN2')] = qcdb.Molecule(""" 0 2 N 0.00000000 0.00000000 0.00000000 N 1.17820000 0.00000000 0.00000000 H 1.64496947 0.93663681 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'HNC')] = qcdb.Molecule(""" 0 1 C 0.00000000 0.00000000 -0.73724800 N 0.00000000 0.00000000 0.43208900 H 0.00000000 0.00000000 1.42696000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'HOCH3Fcomp1')] = qcdb.Molecule(""" -1 1 C -1.29799700 -0.38951800 -0.00003400 O -0.47722300 0.72802100 0.00005400 H -2.35192200 -0.08023200 -0.00863900 H -1.14085300 -1.03582100 -0.87810100 H -1.15317800 -1.02751300 0.88635900 H 0.51058000 0.37116000 0.00024300 F 1.74901600 -0.19051700 -0.00001000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'HOCH3Fcomp2')] = qcdb.Molecule(""" -1 1 F 0.00037100 -2.46834000 0.02139000 C -0.27664200 -1.07441800 -0.00269000 H 0.64929000 -0.51650000 -0.00901600 H -0.84198900 -0.84711900 -0.89707500 H -0.85102800 -0.82658900 0.88141700 O -0.30171300 1.58252400 -0.20654400 H -0.60511200 2.49243400 -0.16430500 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'HOCH3Fts')] = qcdb.Molecule(""" -1 1 F 0.02253600 -0.00745300 0.00552900 C -0.01842000 0.00503700 1.76492500 H 1.04805000 0.00524000 1.85414600 H -0.54781900 0.93470700 1.79222400 H -0.54895500 -0.92343300 1.80576200 O 0.00126500 0.01920000 3.75059900 H -0.92676300 0.03161500 3.99758100 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'H')] = qcdb.Molecule(""" 0 2 H 0.00000000 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'N2OHts')] = qcdb.Molecule(""" 0 2 H -0.30328600 -1.93071200 0.00000000 O -0.86100600 -0.62152600 0.00000000 N 0.00000000 0.25702700 0.00000000 N 1.02733300 0.72910400 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'N2O')] = qcdb.Molecule(""" 0 1 N 0.00000000 0.00000000 0.00000000 N 1.12056262 0.00000000 0.00000000 O 2.30761092 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'N2')] = qcdb.Molecule(""" 0 1 N 0.00000000 0.00000000 0.00000000 N 1.09710935 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'OH_anion')] = qcdb.Molecule(""" -1 1 O 0.00000000 0.00000000 0.00000000 H 0.96204317 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'OH')] = qcdb.Molecule(""" 0 2 O 0.00000000 0.00000000 0.00000000 H 0.96889819 0.00000000 0.00000000 units angstrom """) ######################################################################### # <<< Supplementary Quantum Chemical Results >>> DATA = {} DATA['NUCLEAR REPULSION ENERGY'] = {} DATA['NUCLEAR REPULSION ENERGY']['NHTBH-H-reagent' ] = 0.00000000 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-N2O-reagent' ] = 60.94607766 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-N2OHts-reagent' ] = 65.68644495 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-OH-reagent' ] = 4.36931115 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-N2-reagent' ] = 23.63454766 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-HF-reagent' ] = 5.20285489 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-HFHts-reagent' ] = 8.60854029 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-HCl-reagent' ] = 7.05875275 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-HClHts-reagent' ] = 12.28739648 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-CH3F-reagent' ] = 37.42304655 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-HFCH3ts-reagent' ] = 38.79779200 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-CH3-reagent' ] = 9.69236444 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-F2-reagent' ] = 30.72192369 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-HF2ts-reagent' ] = 33.44223409 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-F-reagent' ] = 0.00000000 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-ClF-reagent' ] = 49.66117442 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-CH3FClts-reagent' ] = 95.59999471 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-Cl-reagent' ] = 0.00000000 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-F_anion-reagent' ] = 0.00000000 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-FCH3Fts-reagent' ] = 66.36618410 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-FCH3Fcomp-reagent' ] = 64.36230187 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-Cl_anion-reagent' ] = 0.00000000 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-CH3Cl-reagent' ] = 51.37857642 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-ClCH3Clts-reagent' ] = 110.27962403 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-ClCH3Clcomp-reagent' ] = 107.04230687 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-FCH3Clts-reagent' ] = 86.10066616 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-FCH3Clcomp1-reagent' ] = 86.07639241 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-FCH3Clcomp2-reagent' ] = 79.90981772 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-OH_anion-reagent' ] = 4.40044460 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-HOCH3Fts-reagent' ] = 69.00558005 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-CH3OH-reagent' ] = 40.39337431 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-HOCH3Fcomp2-reagent' ] = 67.43072234 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-HOCH3Fcomp1-reagent' ] = 73.17394204 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-HN2ts-reagent' ] = 27.37488066 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-HN2-reagent' ] = 27.50439999 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-CO-reagent' ] = 22.48612142 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-HCOts-reagent' ] = 25.76648888 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-HCO-reagent' ] = 26.50985233 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-C2H4-reagent' ] = 33.42351838 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-C2H5ts-reagent' ] = 36.85248528 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-C2H5-reagent' ] = 36.97781691 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-C3H7ts-reagent' ] = 70.26842595 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-C3H7-reagent' ] = 75.86161869 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-HCN-reagent' ] = 23.92417344 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-HCNts-reagent' ] = 24.04634812 DATA['NUCLEAR REPULSION ENERGY']['NHTBH-HNC-reagent' ] = 24.19729155
rmcgibbo/psi4public
psi4/share/psi4/databases/NHTBH.py
Python
lgpl-3.0
36,605
[ "Psi4" ]
287a4fa46aa04a735eee98a06d12711cb09f256461c9d4adc5107cd32dc722d8
#!/usr/bin/env python # Copyright (c) 2012 The Chromium Authors. All rights reserved. # Use of this source code is governed by a BSD-style license that can be # found in the LICENSE file. """Makes sure that all files contain proper licensing information.""" import optparse import os.path import subprocess import sys def PrintUsage(): print """Usage: python checklicenses.py [--root <root>] [tocheck] --root Specifies the repository root. This defaults to "../.." relative to the script file. This will be correct given the normal location of the script in "<root>/tools/checklicenses". --ignore-suppressions Ignores path-specific license whitelist. Useful when trying to remove a suppression/whitelist entry. tocheck Specifies the directory, relative to root, to check. This defaults to "." so it checks everything. Examples: python checklicenses.py python checklicenses.py --root ~/chromium/src third_party""" WHITELISTED_LICENSES = [ 'Apache (v2.0)', 'Apache (v2.0) BSD (2 clause)', 'Apache (v2.0) GPL (v2)', 'Apple MIT', # https://fedoraproject.org/wiki/Licensing/Apple_MIT_License 'APSL (v2)', 'APSL (v2) BSD (4 clause)', 'BSD', 'BSD (2 clause)', 'BSD (2 clause) MIT/X11 (BSD like)', 'BSD (3 clause)', 'BSD (3 clause) ISC', 'BSD (3 clause) LGPL (v2 or later)', 'BSD (3 clause) LGPL (v2.1 or later)', 'BSD (3 clause) MIT/X11 (BSD like)', 'BSD (4 clause)', 'BSD-like', # TODO(phajdan.jr): Make licensecheck not print BSD-like twice. 'BSD-like MIT/X11 (BSD like)', 'BSL (v1.0)', 'GPL (v2 or later) with Bison parser exception', 'GPL (v2 or later) with libtool exception', 'GPL (v3 or later) with Bison parser exception', 'GPL with Bison parser exception', 'ISC', 'LGPL', 'LGPL (v2)', 'LGPL (v2 or later)', 'LGPL (v2.1)', 'LGPL (v3 or later)', # TODO(phajdan.jr): Make licensecheck convert that comma to a dot. 'LGPL (v2,1 or later)', 'LGPL (v2.1 or later)', 'MPL (v1.0) LGPL (v2 or later)', 'MPL (v1.1)', 'MPL (v1.1) BSD-like', 'MPL (v1.1) BSD-like GPL (unversioned/unknown version)', 'MPL (v1.1,) BSD (3 clause) GPL (unversioned/unknown version) ' 'LGPL (v2.1 or later)', 'MPL (v1.1) GPL (unversioned/unknown version)', 'MPL (v2.0)', # TODO(phajdan.jr): Make licensecheck not print the comma after 1.1. 'MPL (v1.1,) GPL (unversioned/unknown version) LGPL (v2 or later)', 'MPL (v1.1,) GPL (unversioned/unknown version) LGPL (v2.1 or later)', 'MIT/X11 (BSD like)', 'Ms-PL', 'Public domain', 'Public domain BSD', 'Public domain BSD (3 clause)', 'Public domain BSD-like', 'Public domain LGPL (v2.1 or later)', 'libpng', 'zlib/libpng', 'SGI Free Software License B', 'University of Illinois/NCSA Open Source License (BSD like)', ] PATH_SPECIFIC_WHITELISTED_LICENSES = { 'base/hash.cc': [ # http://crbug.com/98100 'UNKNOWN', ], 'base/third_party/icu': [ # http://crbug.com/98087 'UNKNOWN', ], # http://code.google.com/p/google-breakpad/issues/detail?id=450 'breakpad/src': [ 'UNKNOWN', ], 'chrome/common/extensions/docs/examples': [ # http://crbug.com/98092 'UNKNOWN', ], 'chrome/test/data/gpu/vt': [ 'UNKNOWN', ], 'chrome/test/data/layout_tests/LayoutTests': [ 'UNKNOWN', ], 'courgette/third_party/bsdiff_create.cc': [ # http://crbug.com/98095 'UNKNOWN', ], 'data/mozilla_js_tests': [ 'UNKNOWN', ], 'data/page_cycler': [ 'UNKNOWN', 'GPL (v2 or later)', ], 'data/tab_switching': [ 'UNKNOWN', ], 'googleurl': [ # http://code.google.com/p/google-url/issues/detail?id=15 'UNKNOWN', ], 'native_client': [ # http://crbug.com/98099 'UNKNOWN', ], 'native_client/toolchain': [ 'BSD GPL (v2 or later)', 'BSD (2 clause) GPL (v2 or later)', 'BSD (3 clause) GPL (v2 or later)', 'BSL (v1.0) GPL', 'BSL (v1.0) GPL (v3.1)', 'GPL', 'GPL (unversioned/unknown version)', 'GPL (v2)', 'GPL (v2 or later)', 'GPL (v3.1)', 'GPL (v3 or later)', ], 'net/tools/spdyshark': [ 'GPL (v2 or later)', 'UNKNOWN', ], # http://crbug.com/98107 'ppapi/c/documentation/check.sh': [ 'UNKNOWN', ], 'ppapi/cpp/documentation/check.sh': [ 'UNKNOWN', ], 'ppapi/lib/gl/include': [ 'UNKNOWN', ], 'ppapi/native_client/tests/earth/earth_image.inc': [ 'UNKNOWN', ], 'third_party/WebKit': [ 'UNKNOWN', ], 'third_party/WebKit/Websites/webkit.org/blog/wp-content/plugins/' 'akismet/akismet.php': [ 'GPL (v2 or later)' ], 'third_party/WebKit/Source/JavaScriptCore/tests/mozilla': [ 'GPL', 'GPL (v2 or later)', 'GPL (unversioned/unknown version)', ], 'third_party/active_doc': [ # http://crbug.com/98113 'UNKNOWN', ], # http://code.google.com/p/angleproject/issues/detail?id=217 'third_party/angle': [ 'UNKNOWN', ], 'third_party/bsdiff/mbsdiff.cc': [ 'UNKNOWN', ], 'third_party/bzip2': [ 'UNKNOWN', ], 'third_party/cld/encodings/compact_lang_det': [ # http://crbug.com/98120 'UNKNOWN', ], # Not used. http://crbug.com/156020 # Using third_party/cros_dbus_cplusplus/cros_dbus_cplusplus.gyp instead. 'third_party/cros_dbus_cplusplus/source/autogen.sh': [ 'UNKNOWN', ], # Included in the source tree but not built. http://crbug.com/156020 'third_party/cros_dbus_cplusplus/source/examples': [ 'UNKNOWN', ], 'third_party/devscripts': [ 'GPL (v2 or later)', ], 'third_party/expat/files/lib': [ # http://crbug.com/98121 'UNKNOWN', ], 'third_party/ffmpeg': [ 'GPL', 'GPL (v2)', 'GPL (v2 or later)', 'UNKNOWN', # http://crbug.com/98123 ], 'third_party/findbugs/doc': [ # http://crbug.com/157206 'UNKNOWN', ], 'third_party/freetype2': [ # http://crbug.com/177319 'UNKNOWN', ], 'third_party/gles2_book': [ # http://crbug.com/98130 'UNKNOWN', ], 'third_party/gles2_conform/GTF_ES': [ # http://crbug.com/98131 'UNKNOWN', ], 'third_party/harfbuzz': [ # http://crbug.com/98133 'UNKNOWN', ], 'third_party/hunspell': [ # http://crbug.com/98134 'UNKNOWN', ], 'third_party/hyphen/hyphen.tex': [ # http://crbug.com/157375 'UNKNOWN', ], 'third_party/iccjpeg': [ # http://crbug.com/98137 'UNKNOWN', ], 'third_party/icu': [ # http://crbug.com/98301 'UNKNOWN', ], 'third_party/jemalloc': [ # http://crbug.com/98302 'UNKNOWN', ], 'third_party/lcov': [ # http://crbug.com/98304 'UNKNOWN', ], 'third_party/lcov/contrib/galaxy/genflat.pl': [ 'GPL (v2 or later)', ], 'third_party/lcov-1.9/contrib/galaxy/genflat.pl': [ 'GPL (v2 or later)', ], 'third_party/libevent': [ # http://crbug.com/98309 'UNKNOWN', ], 'third_party/libjingle/source/talk': [ # http://crbug.com/98310 'UNKNOWN', ], 'third_party/libjingle/source_internal/talk': [ # http://crbug.com/98310 'UNKNOWN', ], 'third_party/libjpeg': [ # http://crbug.com/98313 'UNKNOWN', ], 'third_party/libjpeg_turbo': [ # http://crbug.com/98314 'UNKNOWN', ], 'third_party/libpng': [ # http://crbug.com/98318 'UNKNOWN', ], # The following files lack license headers, but are trivial. 'third_party/libusb/src/libusb/os/poll_posix.h': [ 'UNKNOWN', ], 'third_party/libusb/src/libusb/version.h': [ 'UNKNOWN', ], 'third_party/libusb/src/autogen.sh': [ 'UNKNOWN', ], 'third_party/libusb/src/config.h': [ 'UNKNOWN', ], 'third_party/libusb/src/msvc/config.h': [ 'UNKNOWN', ], 'third_party/libvpx/source': [ # http://crbug.com/98319 'UNKNOWN', ], 'third_party/libvpx/source/libvpx/examples/includes': [ 'GPL (v2 or later)', ], 'third_party/libwebp': [ # http://crbug.com/98448 'UNKNOWN', ], 'third_party/libxml': [ 'UNKNOWN', ], 'third_party/libxslt': [ 'UNKNOWN', ], 'third_party/lzma_sdk': [ 'UNKNOWN', ], 'third_party/mesa/MesaLib': [ 'GPL (v2)', 'GPL (v3 or later)', 'MIT/X11 (BSD like) GPL (v3 or later) with Bison parser exception', 'UNKNOWN', # http://crbug.com/98450 ], 'third_party/modp_b64': [ 'UNKNOWN', ], 'third_party/npapi/npspy/extern/java': [ 'GPL (unversioned/unknown version)', ], 'third_party/openssl': [ # http://crbug.com/98451 'UNKNOWN', ], 'third_party/ots/tools/ttf-checksum.py': [ # http://code.google.com/p/ots/issues/detail?id=2 'UNKNOWN', ], 'third_party/molokocacao': [ # http://crbug.com/98453 'UNKNOWN', ], 'third_party/npapi/npspy': [ 'UNKNOWN', ], 'third_party/ocmock/OCMock': [ # http://crbug.com/98454 'UNKNOWN', ], 'third_party/opus/src': [ # http://crbug.com/156738 'UNKNOWN', ], 'third_party/ply/__init__.py': [ 'UNKNOWN', ], 'third_party/protobuf': [ # http://crbug.com/98455 'UNKNOWN', ], 'third_party/pylib': [ 'UNKNOWN', ], 'third_party/scons-2.0.1/engine/SCons': [ # http://crbug.com/98462 'UNKNOWN', ], 'third_party/simplejson': [ 'UNKNOWN', ], 'third_party/skia': [ # http://crbug.com/98463 'UNKNOWN', ], 'third_party/snappy/src': [ # http://crbug.com/98464 'UNKNOWN', ], 'third_party/smhasher/src': [ # http://crbug.com/98465 'UNKNOWN', ], 'third_party/sqlite': [ 'UNKNOWN', ], 'third_party/swig/Lib/linkruntime.c': [ # http://crbug.com/98585 'UNKNOWN', ], 'third_party/talloc': [ 'GPL (v3 or later)', 'UNKNOWN', # http://crbug.com/98588 ], 'third_party/tcmalloc': [ 'UNKNOWN', # http://crbug.com/98589 ], 'third_party/tlslite': [ 'UNKNOWN', ], 'third_party/webdriver': [ # http://crbug.com/98590 'UNKNOWN', ], 'third_party/webrtc': [ # http://crbug.com/98592 'UNKNOWN', ], 'third_party/xdg-utils': [ # http://crbug.com/98593 'UNKNOWN', ], 'third_party/yasm/source': [ # http://crbug.com/98594 'UNKNOWN', ], 'third_party/zlib/contrib/minizip': [ 'UNKNOWN', ], 'third_party/zlib/trees.h': [ 'UNKNOWN', ], 'tools/dromaeo_benchmark_runner/dromaeo_benchmark_runner.py': [ 'UNKNOWN', ], 'tools/emacs': [ # http://crbug.com/98595 'UNKNOWN', ], 'tools/grit/grit/node/custom/__init__.py': [ 'UNKNOWN', ], 'tools/gyp/test': [ 'UNKNOWN', ], 'tools/histograms': [ 'UNKNOWN', ], 'tools/memory_watcher': [ 'UNKNOWN', ], 'tools/playback_benchmark': [ 'UNKNOWN', ], 'tools/python/google/__init__.py': [ 'UNKNOWN', ], 'tools/site_compare': [ 'UNKNOWN', ], 'tools/stats_viewer/Properties/AssemblyInfo.cs': [ 'UNKNOWN', ], 'tools/symsrc/pefile.py': [ 'UNKNOWN', ], 'v8/test/cctest': [ # http://crbug.com/98597 'UNKNOWN', ], 'webkit/data/ico_decoder': [ 'UNKNOWN', ], } def check_licenses(options, args): # Figure out which directory we have to check. if len(args) == 0: # No directory to check specified, use the repository root. start_dir = options.base_directory elif len(args) == 1: # Directory specified. Start here. It's supposed to be relative to the # base directory. start_dir = os.path.abspath(os.path.join(options.base_directory, args[0])) else: # More than one argument, we don't handle this. PrintUsage() return 1 print "Using base directory:", options.base_directory print "Checking:", start_dir print licensecheck_path = os.path.abspath(os.path.join(options.base_directory, 'third_party', 'devscripts', 'licensecheck.pl')) licensecheck = subprocess.Popen([licensecheck_path, '-l', '100', '-r', start_dir], stdout=subprocess.PIPE, stderr=subprocess.PIPE) stdout, stderr = licensecheck.communicate() if options.verbose: print '----------- licensecheck stdout -----------' print stdout print '--------- end licensecheck stdout ---------' if licensecheck.returncode != 0 or stderr: print '----------- licensecheck stderr -----------' print stderr print '--------- end licensecheck stderr ---------' print "\nFAILED\n" return 1 success = True for line in stdout.splitlines(): filename, license = line.split(':', 1) filename = os.path.relpath(filename.strip(), options.base_directory) # All files in the build output directory are generated one way or another. # There's no need to check them. if filename.startswith('out/') or filename.startswith('sconsbuild/'): continue # For now we're just interested in the license. license = license.replace('*No copyright*', '').strip() # Skip generated files. if 'GENERATED FILE' in license: continue if license in WHITELISTED_LICENSES: continue if not options.ignore_suppressions: found_path_specific = False for prefix in PATH_SPECIFIC_WHITELISTED_LICENSES: if (filename.startswith(prefix) and license in PATH_SPECIFIC_WHITELISTED_LICENSES[prefix]): found_path_specific = True break if found_path_specific: continue print "'%s' has non-whitelisted license '%s'" % (filename, license) success = False if success: print "\nSUCCESS\n" return 0 else: print "\nFAILED\n" print "Please read", print "http://www.chromium.org/developers/adding-3rd-party-libraries" print "for more info how to handle the failure." print print "Please respect OWNERS of checklicenses.py. Changes violating" print "this requirement may be reverted." return 1 def main(): default_root = os.path.abspath( os.path.join(os.path.dirname(__file__), '..', '..')) option_parser = optparse.OptionParser() option_parser.add_option('--root', default=default_root, dest='base_directory', help='Specifies the repository root. This defaults ' 'to "../.." relative to the script file, which ' 'will normally be the repository root.') option_parser.add_option('-v', '--verbose', action='store_true', default=False, help='Print debug logging') option_parser.add_option('--ignore-suppressions', action='store_true', default=False, help='Ignore path-specific license whitelist.') options, args = option_parser.parse_args() return check_licenses(options, args) if '__main__' == __name__: sys.exit(main())
zcbenz/cefode-chromium
tools/checklicenses/checklicenses.py
Python
bsd-3-clause
15,813
[ "Galaxy" ]
811fed8698b6ab34ba1d0be5755a23d3e3dbce6a55d08992fd8ea559a0f56b54
""" :copyright: (c) 2014 Building Energy Inc :license: see LICENSE for more details. """ from salad.steps.everything import * from lettuce import step from django.core.urlresolvers import reverse from landing.features.steps import * @step(u'I visit the home page') def i_visit_the_home_page(step): world.browser.visit(django_url(reverse("seed:home"))) @step(u'I go to the jasmine unit tests for the SEED') def given_i_go_to_the_jasmine_unit_tests_for_the_SEED(step): world.browser.visit(django_url(reverse("seed:angular_js_tests"))) @step(u'I should see that the tests passed') def then_i_should_see_that_the_tests_passed(step): time.sleep(2) try: assert world.browser.is_element_present_by_css(".passingAlert.bar") except: time.sleep(50) assert len(world.browser.find_by_css(".passingAlert.bar")) > 0 @step(u'When I visit the projects page') def when_i_visit_the_projects_page(step): world.browser.visit(django_url(reverse("seed:home")) + "#/projects") @step(u'Then I should see my projects') def then_i_should_see_my_projects(step): assert world.browser.is_text_present('Projects') assert world.browser.is_text_present('my project') @step(u'And I have a project') def and_i_have_a_project(step): Project.objects.create( name="my project", super_organization_id=world.org.id, owner=world.user ) @step(u'And I have a dataset') def and_i_have_a_dataset(step): ImportRecord.objects.create( name='dataset 1', super_organization=world.org, owner=world.user ) @step(u'When I visit the dataset page') def when_i_visit_the_dataset_page(step): world.browser.visit(django_url(reverse("seed:home")) + "#/data") @step(u'And I delete a dataset') def and_i_delete_a_dataset(step): delete_icon = world.browser.find_by_css('.delete_link') delete_icon.click() alert = world.browser.get_alert() alert.accept() @step(u'Then I should see no datasets') def then_i_should_see_no_datasets(step): number_of_datasets = len(world.browser.find_by_css('.import_row')) number_of_datasets = len(world.browser.find_by_css('.import_row')) number_of_datasets = len(world.browser.find_by_css('.import_row')) assert number_of_datasets == 0
buildingenergy/buildingenergy-platform
seed/features/steps.py
Python
apache-2.0
2,282
[ "VisIt" ]
9d2ff3b7eb112457dc3596839bf56e38cec4975d8d493e5163db2de73ba758bf
#!/usr/bin/env python3 ################################################################ # copyright (c) 2017,2018 by William R. Pearson and The Rector & # Visitors of the University of Virginia */ ################################################################ # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, # software distributed under this License is distributed on an "AS # IS" BASIS, WITHOUT WRRANTIES OR CONDITIONS OF ANY KIND, either # express or implied. See the License for the specific language # governing permissions and limitations under the License. ################################################################ ################################################################ # annot_blast_btop4.py --query query.file --ann_script ann_pfam_www.pl --include_doms blast_tab_btop_file ################################################################ # annot_blast_btop4.py associates domain annotation information and # subalignment scores with a blast tabular (-outfmt 6 or -outfmt 7) # file that contains the raw score and the BTOP alignment encoding # This file can be generated from "blastp/n" or "blast_formatter" # using the command: # blast_formatter -archive blast_output.asn -outfmt '7 qseqid sseqid pident length mismatch gapopen qstart qend sstart send evalue bitscore score btop' > blast_output.tab_annot # # If the BTOP field or query_file is not available, the script # produces domain content without sub-alignment scores. ################################################################ ## 2-Dec-2019 # added --have_qslen, --raw_score/--no_raw_score # made more robust to multiple HSPs when using --ann_file # ################################################################ ## 4-Nov-2018 # add --include_doms, which adds a new field with the coordinates of # the domains in the protein (independent of alignment) # ################################################################ ## 21-July-2018 # include sequence length (actually alignment end) to produce NODOM's (no NODOM's without length). # ################################################################ ## 13-Jan-2017 # modified to provide query/subject coordinates and identities if no # query sequence -- does not decrement for reverse-complement fastx/blastx DNA ################################################################ ## 16-Nov-2015 # modify to allow multi-query blast searches ################################################################ ## 19-Dec-2015 # add -q_annot_script to annotate query sequence # import argparse import fileinput import sys import re import shutil import subprocess from math import log # read lines of the form: # gi|121694|sp|P20432.1|GSTT1_DROME gi|121694|sp|P20432|GSTT1_DROME 100.00 209 0 0 1 209 1 209 6e-156 433 1113 209 # gi|121694|sp|P20432.1|GSTT1_DROME gi|1170090|sp|P04907|GSTF3_MAIZE 26.77 198 123 7 4 185 6 197 2e-08 51.2 121 FL1YG ... 1NKRA1YW1 # gi|121694|sp|P20432.1|GSTT1_DROME gi|81174731|sp|P0ACA5|SSPA_ECO57 39.66 58 32 2 43 100 49 103 8e-06 43.9 102 EDFLLI ... V-I-NEQS3FM # gi|121694|sp|P20432.1|GSTT1_DROME gi|121695|sp|P12653|GSTF1_MAIZE 27.62 181 107 7 32 203 34 199 9e-05 40.8 94 LI1LF ... N-1AS1CLLM1 # and report the domain content ala -m 8CC def init_blosum62(): # ncbi_blaa -- list of amino acids ncbi_blaa = "A R N D C Q E G H I L K M F P S T W Y V B Z X *".split(' ') # blosum62: 2D dict of scoring matrix values blosum62 = {} blosum62['A'] = dict(zip(ncbi_blaa,[ 4,-1,-2,-2, 0,-1,-1, 0,-2,-1,-1,-1,-1,-2,-1, 1, 0,-3,-2, 0,-2,-1, 0,-4])) blosum62['R'] = dict(zip(ncbi_blaa,[-1, 5, 0,-2,-3, 1, 0,-2, 0,-3,-2, 2,-1,-3,-2,-1,-1,-3,-2,-3,-1, 0,-1,-4])) blosum62['N'] = dict(zip(ncbi_blaa,[-2, 0, 6, 1,-3, 0, 0, 0, 1,-3,-3, 0,-2,-3,-2, 1, 0,-4,-2,-3, 3, 0,-1,-4])) blosum62['D'] = dict(zip(ncbi_blaa,[-2,-2, 1, 6,-3, 0, 2,-1,-1,-3,-4,-1,-3,-3,-1,0,-1,-4,-3,-3,4,1,-1,-4])) blosum62['C'] = dict(zip(ncbi_blaa,[ 0,-3,-3,-3, 9,-3,-4,-3,-3,-1,-1,-3,-1,-2,-3,-1,-1,-2,-2,-1,-3,-3,-2,-4])) blosum62['Q'] = dict(zip(ncbi_blaa,[-1, 1, 0, 0,-3, 5, 2,-2, 0,-3,-2,1,0,-3,-1,0,-1,-2,-1,-2,0,3,-1,-4])) blosum62['E'] = dict(zip(ncbi_blaa,[-1, 0, 0, 2,-4, 2, 5,-2, 0,-3,-3,1,-2,-3,-1,0,-1,-3,-2,-2,1,4,-1,-4])) blosum62['G'] = dict(zip(ncbi_blaa,[ 0,-2, 0,-1,-3,-2,-2, 6,-2,-4,-4,-2,-3,-3,-2,0,-2,-2,-3,-3,-1,-2,-1,-4])) blosum62['H'] = dict(zip(ncbi_blaa,[-2, 0, 1,-1,-3, 0, 0,-2, 8,-3,-3,-1,-2,-1,-2,-1,-2,-2,2,-3,0,0,-1,-4])) blosum62['I'] = dict(zip(ncbi_blaa,[-1,-3,-3,-3,-1,-3,-3,-4,-3,4,2,-3,1,0,-3,-2,-1,-3,-1,3,-3,-3,-1,-4])) blosum62['L'] = dict(zip(ncbi_blaa,[-1,-2,-3,-4,-1,-2,-3,-4,-3,2,4,-2,2,0,-3,-2,-1,-2,-1,1,-4,-3,-1,-4])) blosum62['K'] = dict(zip(ncbi_blaa,[-1, 2, 0,-1,-3, 1, 1,-2,-1,-3,-2,5,-1,-3,-1,0,-1,-3,-2,-2,0,1,-1,-4])) blosum62['M'] = dict(zip(ncbi_blaa,[-1,-1,-2,-3,-1, 0,-2,-3,-2,1,2,-1,5,0,-2,-1,-1,-1,-1,1,-3,-1,-1,-4])) blosum62['F'] = dict(zip(ncbi_blaa,[-2,-3,-3,-3,-2,-3,-3,-3,-1,0,0,-3,0,6,-4,-2,-2,1,3,-1,-3,-3,-1,-4])) blosum62['P'] = dict(zip(ncbi_blaa,[-1,-2,-2,-1,-3,-1,-1,-2,-2,-3,-3,-1,-2,-4,7,-1,-1,-4,-3,-2,-2,-1,-2,-4])) blosum62['S'] = dict(zip(ncbi_blaa,[ 1,-1, 1, 0,-1, 0, 0, 0,-1,-2,-2,0,-1,-2,-1,4,1,-3,-2,-2,0,0,0,-4])) blosum62['T'] = dict(zip(ncbi_blaa,[ 0,-1, 0,-1,-1,-1,-1,-2,-2,-1,-1,-1,-1,-2,-1,1,5,-2,-2,0,-1,-1,0,-4])) blosum62['W'] = dict(zip(ncbi_blaa,[-3 -3,-4,-4,-2,-2,-3,-2,-2,-3,-2,-3,-1,1,-4,-3,-2,11,2,-3,-4,-3,-2,-4])) blosum62['Y'] = dict(zip(ncbi_blaa,[-2,-2,-2,-3,-2,-1,-2,-3, 2,-1,-1,-2,-1,3,-3,-2,-2,2,7,-1,-3,-2,-1,-4])) blosum62['V'] = dict(zip(ncbi_blaa,[ 0,-3,-3,-3,-1,-2,-2,-3,-3,3,1,-2,1,-1,-2,-2,0,-3,-1,4,-3,-2,-1,-4])) blosum62['B'] = dict(zip(ncbi_blaa,[-2,-1, 3, 4,-3, 0, 1,-1, 0,-3,-4,0,-3,-3,-2,0,-1,-4,-3,-3, 4, 1,-1,-4])) blosum62['Z'] = dict(zip(ncbi_blaa,[-1, 0, 0, 1,-3, 3, 4,-2, 0,-3,-3,1,-1,-3,-1,0,-1,-3,-2,-2,1,4,-1,-4])) blosum62['X'] = dict(zip(ncbi_blaa,[ 0,-1,-1,-1,-2,-1,-1,-1,-1,-1,-1,-1,-1,-1,-2,0,0,-2,-1,-1,-1,-1,-1,-4])) blosum62['*'] = dict(zip(ncbi_blaa,[-4,-4,-4,-4,-4,-4,-4,-4,-4,-4,-4,-4,-4,-4,-4,-4,-4,-4,-4,-4,-4,-4,-4,1])) if (len(blosum62.keys()) != len(ncbi_blaa)): sys.stderr.write(" blosum62 length mismatch %d != %d\n" %(len(blosum62), len(ncbi_blaa))) print(' '.join(ncbi_blaa),file=sys.stderr) print(' '.join(blosum62.keys()),file=sys.stderr) exit(1) blosum62_diag = {x:blosum62[x][x] for x in ncbi_blaa} return (blosum62, blosum62_diag, -11, -1) ################ # read_annots (\@hit_list) # input: hit_entry['s_seq_id, etc'], target # output: modified $hit_entry['domains'] # modified $hit_entry['sites'] # # extend to make robust to multiple hits on the same subject def read_annots(Reader): target_set = {} current_domain = "" hit_ix = 0 seq_domains = [] seq_sites = [] subj_domains = {} for line in Reader: if (line[0]=='='): continue line = line.strip("\n") # check for header if (line[0] == '>'): if (current_domain): # previous domains/sites have already been found and parsed if (current_domain not in target_set): target_set[current_domain] = {} target_set[current_domain]['domains'] = [ d for d in seq_domains ] # previous domains target_set[current_domain]['sites'] = [ s for s in seq_sites ] # previous sites else: sys.stderr.write("*** phase error: %s duplicate\n"%(current_domain)) seq_domains = []; # current domains seq_sites = []; # current sites current_domain = line.split(' ')[0][1:] else: # check for data a_fields = line.split('\t') a_fields[0]=int(a_fields[0]) if (a_fields[1] == '-'): a_fields[2]=int(a_fields[2]) annot_info = dict(zip(('d_pos','type','d_end','descr'), a_fields)) re_df=re.compile(r' :(\d+)$') annot_info['descr'] = re_df.sub(r'~\1',annot_info['descr']) seq_domains.append(annot_info) else: annot_info = dict(zip(('d_pos','type', 'd_val', 'descr', a_fields))) annot_info['d_end'] = annot_info['d_pos'] seq_sites.append(annot_info) Reader.close() # get the last one if (current_domain): # previous domains/sites have already been found and parsed if (current_domain not in target_set): target_set[current_domain] = {} target_set[current_domain]['domains'] = [ d for d in seq_domains ] # previous domains target_set[current_domain]['sites'] = [ s for s in seq_sites ] # previous sites # else: # sys.stderr.write("*** phase error: %s duplicate\n"%(current_domain)) return target_set ################ # merge_annots(hit_r): # # take different annotations in hit_r and put them in one list # def merge_annots(hit_r): merged_annots = [] if ('q_aligned_domains' in hit_r): for annot in hit_r['q_aligned_domains']: annot['target']=1 merged_annots.append(annot) if ('aligned_domains' in hit_r): for annot in hit_r['aligned_domains']: annot['target']=0 merged_annots.append(annot) merged_annots = sorted(merged_annots, key=lambda x: x['qa_start']) return(merged_annots) ################ # get_file_annots(file_name) # def get_file_annots(file_name, hit_list): with open(file_name,'r') as Reader: ann_set = read_annots(Reader) return ann_set ################ # get_script_annots(script_name, hit_list) # # set up stdin/stdout pipe to send in hit list info and read results # def get_script_annots(script_name, hit_list, key_list): seq_set = {} proc = subprocess.Popen(script_name, stdin=subprocess.PIPE, stdout=subprocess.PIPE, shell=True, encoding='utf-8') for hit in hit_list: (seq_id, seq_len) = (hit[key_list[0]],hit[key_list[1]]) if (seq_id not in seq_set): proc.stdin.write(("%s\t%s\n"%(seq_id,seq_len))) proc.stdin.close() while (proc.returncode is None): proc.poll() return read_annots(proc.stdout) ################ # # link_annots(hit_list, annot_set) # # put 'domains' and 'sites' into each hit in the hit list # def link_annots(hit_list, annot_set): for hit in hit_list: seqid = hit['s_seq_id'] if (seqid in annot_set): if ('domains' in annot_set[seqid]): hit['domains']=annot_set[seqid]['domains'] if ('sites' in annot_set[seqid]): hit['sites']=annot_set[seqid]['sites'] # input: a blast BTOP string of the form: "1VA160TS7KG10RK27" # returns a list_ref of tokens: (1, "VA", 60, "TS", 7, "KG, 10, "RK", 27) # def decode_btop(btop_str): tokens = re.split(r'(\d+)',btop_str) # split with capture returns both strings between and separator (\d+) if not tokens[0]: tokens = tokens[1:] out_tokens = [] for token in tokens: if re.match(r'\d+',token): out_tokens.append(token) else: mis_tokens = re.split(r'(..)',token) # split with capture for mis in mis_tokens: if (mis): out_tokens.append(mis) return out_tokens def parse_query_lib(query_file): query_seqs = {} with open(query_file,"r") as qfd: header='' seq_data='' for line in qfd: line = line.strip("\n") if (line[0]=='>'): if (header): # save existing sequence seq_data = '' + seq_data query_seqs[header]=seq_data header = line[1:].split(' ')[0] else: line = re.sub(r'[^A-Za-z]','',line) seq_data += line.upper() # save last entry if (header): query_seqs[header]=seq_data return query_seqs # given: (1) a query sequence; (2) an encoded alignment; (3) a scoring matrix # calculate: # (1) the overall score # (2) a per residue dictionary of scores and mappings from query -> subject # (2) a per residue dictionary of scores and mappings from subject -> query # def alignment_score(query_r, hit, matrix_2d, matrix_diag, g_open, g_ext): query_start, subj_start = (int(hit['q_start']),int(hit['s_start'])) btop_align_r = decode_btop(hit['BTOP']) hit['btop_align'] = btop_align_r q_map = [] s_map = [] gap0, gap1 = (0 ,0) q_ix = query_start - 1 # start from zero s_ix = subj_start - 1 score, m_score = (0, 0) seq0, seq1 = ("","") for btop in btop_align_r: if (re.search(r'^\d+$',btop)): # matching query sequence, add it up for i in range(0,int(btop)): res = query_r[q_ix] score += matrix_diag[res] q_map.append({'s':score, 'y_ix':s_ix, 'res':res}) s_map.append({'s':score, 'y_ix':q_ix, 'res':res}) q_ix += 1 s_ix += 1 else: seq0, seq1 = (btop[0],btop[1]) if (re.search(r'\-',btop)): # is there a gap? if (seq0 == '-'): # is it in query? if gap0: # are we in a gap? score += g_ext else: score += g_open+g_ext gap0 = True # 'y_ix':-1 indicates alignment to gap s_map.append({'s':score, 'y_ix':-1, 'res':seq1}) s_ix += 1 else: # gap is in subject if gap1: score += g_ext else: score += g_open+g_ext gap1 = True # 'y_ix':-1 indicates alignment to gap q_map.append({'s':score, 'y_ix':-1, 'res':seq0}) q_ix += 1 else: # mismatch, not gap score += matrix_2d[seq0][seq1] gap1=gap0 = False q_map.append({'s':score, 'y_ix':s_ix, 'res':seq0}) s_map.append({'s':score, 'y_ix':q_ix, 'res':seq1}) q_ix += 1 s_ix += 1 return score, q_map, s_map ################################################################ # sub_alignment_stats -- calculate stats for ONE domain entry # given x_map, xa_start, xa_end where x=q/s depending on target # domain_r : domain boundaries # # calculate a score, identity and boundaries in both sequences and return values # def one_sub_alignment_stats(domain_r, x_map, y_map, xa_start, xa_end, ya_start, ya_end): td_start, td_end = (domain_r['d_pos'],domain_r['d_end']) if (td_end < xa_start or td_start > xa_end): return 0 if (td_start < xa_start): td_start = xa_start if (td_end > xa_end): td_end = xa_end td_start -= xa_start td_end -= xa_start left_score = 0 if (td_start>0) : left_score = x_map[td_start-1]['s'] score = x_map[td_end]['s'] - left_score # map[] coordinates are 0-based # ya_start = x_map[td_start]['y_ix']+1 # ya_end = x_map[td_end]['y_ix']+1 #### identity calculation: n_len = 0 n_id = 0 for xi in range(td_start, td_end+1): this_x = x_map[xi] x_res=this_x['res'] if (this_x['y_ix'] >= 0): n_len += 1 y_res = y_map[this_x['y_ix']-ya_start+1]['res'] if (x_res.upper() == y_res.upper()): n_id += 1 ident = float(n_id)/float(n_len) return score, ident, td_start+xa_start-1, td_end+xa_start-1, x_map[td_start]['y_ix'], x_map[td_end]['y_ix'] ################ # get domain scores, idents, boundaries for list of domains # def do_sub_alignment_stats(domain_list, x_map, y_map, xa_start, xa_end, ya_start, ya_end, keys_str): aligned_doms = [] for domain in domain_list: subalign_data = one_sub_alignment_stats(domain, x_map, y_map, xa_start, xa_end, ya_start, ya_end) if (subalign_data and len(subalign_data)==6): sub_data = dict(zip(keys_str,subalign_data)) for k in ('type','descr'): sub_data[k] = domain[k] aligned_doms.append(sub_data) return(aligned_doms) #### # print raw domain info: # |DX:%d-%d;C=dom_info|XD:%d-%d:C=dom_info # def format_dom_info(q_dom_r, dom_r): dom_str = "" for dom in q_dom_r: dom_str += "|DX:%d-%d;C=%s"%(dom['d_pos'],dom['d_end'], dom['descr']) for dom in dom_r: dom_str += "|XD:%d-%d;C=%s"%(dom['d_pos'],dom['d_end'], dom['descr']) return dom_str def format_annot_info(annot_list_r, hit): annot_str = ""; # two types of annotations, domains and sites. score_scale = hit['score']/hit['raw_score'] for annot_r in (annot_list_r ): if (annot_r['type'] == '-'): fsub_score = annot_r['score']/hit['raw_score'] ns_score, s_bit = (int(annot_r['score'] * score_scale + 0.5), fsub_score * hit['bits']) qval = 0.0 if (hit['evalue'] == 0.0): if (s_bit > 50.0): qval = 3000.0 else: qval = -10.0 * (2.0*log(400.0) + s_bit)/log(10.0) else: qval = -10.0*log(hit['evalue'])*fsub_score/log(10.0) if qval < 0.0: qval = 0.0 rx_str = 'XR' if (annot_r['target']): rx_str = "RX" annot_str += ';'.join(("|%s:%d-%d:%d-%d:s=%d"%(rx_str, annot_r['qa_start']+1,annot_r['qa_end']+1, annot_r['sa_start']+1,annot_r['sa_end']+1,ns_score), "b=%.1f"%(s_bit),"I=%.3f"%(annot_r['ident']), "Q=%.1f"%(qval),"C=%s"%(annot_r['descr']))) else: # site annotation ann_type = annot_r['type']; site_str = "|%cX"%(ann_type) if (annot_r['target'] == 1): site_str = "|X%c"%(ann_type) elif (annot_r['target'] == 2): site_str = "|%c%c"%(ann_type, ann_type) annot_str += "%s:"%(site_str) annot_str += "%d%s%s%d%s"%(annot_r['qa_pos'], annot_r['q_res'], annot_r['m_symb'], annot_r['sa_pos'], annot_r['s_res']) return annot_str def main(args): blosum62, blosum62_diag, g_open, g_ext = init_blosum62() if (args.query_file): # query_lib_r has a set of query sequences query_lib_r = parse_query_lib(args.query_file) else: sys.stderr.write("--query required\n") exit(1) tab_fields = "q_seqid s_seqid percid alen mismatch gopen q_start q_end s_start s_end evalue bits BTOP".split(' ') int_fields = "alen mismatch gopen q_start q_end s_start s_end".split(' ') float_fields = "percid evalue bits score".split(' ') if (args.have_qslen): tab_fields = "q_seqid q_len s_seqid s_len percid alen mismatch gopen q_start q_end s_start s_end evalue bits BTOP".split(' ') int_fields = "q_len s_len alen mismatch gopen q_start q_end s_start s_end".split(' ') # the fields that are displayed are listed here. By default, all fields except score and BTOP are displayed. out_tab_fields = tab_fields[0:-1] in_tab_fields = tab_fields[0:-1] if (args.raw_out): out_tab_fields.append("raw_score") if (args.raw_in): in_tab_fields.append("score") ## always add BTOP in_tab_fields.append("BTOP") tab_fields = in_tab_fields if (args.out_fields): out_tab_fields = out_fields.split(" ") header_lines = [] next_line = "" have_data = False hit_list = [] q_hit_list = [] for line in fileinput.input(args.files): if (line[0] == '#'): if (have_data): next_line = line have_data = False break else: header_lines.append(line) continue have_data = True line = line.strip('\n') if (line): this_data = dict(zip(tab_fields, line.split("\t"))) for k in this_data.keys(): if (k in int_fields): this_data[k] = int(this_data[k]) if (k in float_fields): this_data[k] = float(this_data[k]) hit_list.append(this_data) # get the query annotations q_hit_list = [] if (args.q_ann_file): q_seqid = hit_list[0]['q_seqid'] q_hit_list.append({'s_seq_id':q_seqid, 's_end':len(query_lib_r[q_seqid])}) q_annots = get_file_annots(args.q_ann_file, q_hit_list) link_annots(q_hit_list, q_annots) elif (args.q_ann_script): args.q_ann_script = re.sub(r'\+',' ',args.q_ann_script) if (args.q_ann_script and shutil.which(args.q_ann_script.split(" ")[0])): q_seqid = hit_list[0]['q_seqid'] q_hit_list.append({'s_seq_id':q_seqid, 's_end':len(query_lib_r[q_seqid])}) q_annots = get_script_annots(args.q_ann_script, q_hit_list, ['s_seq_id','s_end']) link_annots(q_hit_list, q_annots) # get the subject annotations # first set up the list with sequence lengths if (args.ann_file or args.ann_script): s_len = 100000 for hit in hit_list: hit['s_seq_id']=hit['s_seqid'] if (not args.have_qslen): hit['s_end']=s_len if (args.ann_file): s_annots = get_file_annots(args.ann_file, hit_list) link_annots(hit_list, s_annots) elif (args.ann_script): args.ann_script = re.sub(r'\+',' ',args.ann_script) if (shutil.which(args.ann_script.split(" ")[0])): s_annots = get_script_annots(args.ann_script, hit_list,['s_seq_id','s_end']) link_annots(hit_list, s_annots) for line in header_lines: print(line, end='') header_lines = [next_line] # now get query annotation if available for hit in hit_list: list_covered = [] # If I have an encoded aligment {BTOP} and a query sequence query_lib_r && query_lib_r[hit['q_seqid']] # then I can calculate sub-alignment scores if ('BTOP' in hit and query_lib_r and hit['q_seqid'] in query_lib_r): # calculate raw_score and mappings hit['raw_score'], q_map, s_map = alignment_score(query_lib_r[hit['q_seqid']], hit,blosum62, blosum62_diag, g_open, g_ext) if ('score' not in hit): hit['score'] = hit['raw_score'] # calculate sub-alignment scores in subject/library coordinates if ('domains' in hit and len(hit['domains'])>0): hit['aligned_domains'] = do_sub_alignment_stats(hit['domains'], s_map, q_map, hit['s_start'],hit['s_end'],hit['q_start'],hit['q_end'], ('score','ident','sa_start', 'sa_end', 'qa_start', 'qa_end')) # calculate sub-alignment scores in query coordinates if (len(q_hit_list) > 0 and 'domains' in q_hit_list[0] and len(q_hit_list[0]['domains'])>0): hit['q_aligned_domains'] = do_sub_alignment_stats(q_hit_list[0]['domains'], q_map, s_map, hit['q_start'],hit['q_end'],hit['s_start'],hit['s_end'], ('score','ident','qa_start', 'qa_end', 'sa_start', 'sa_end')) ################ ## final output display print("\t".join([str(hit[x]) for x in out_tab_fields]),end='') # show fields from original blast tabular file merged_annots_r = merge_annots(hit) # merge the four possible annotation lists into one. if (len(merged_annots_r)>0): print("\t"+format_annot_info(merged_annots_r, hit),end='') if (args.dom_info): if (len(q_hit_list) > 0 and 'domains' in q_hit_list[0]): print("\t"+format_dom_info(q_hit_list[0]['domains'], hit['domains']),end='') else: print("\t"+format_dom_info([], hit['domains']),end='') elif (len(list_covered)>0): print("\t" + ";".join(list_covered)) if (args.dom_info): print("\t"+format_dom_info(q_hit_list[0]['domains'], hit['domains']),end='') print() for line in header_lines: print(line,end="") if __name__ == '__main__': print('# ' + ' '.join(sys.argv)) parser=argparse.ArgumentParser(description='annot_blast_btop4.py : annotate blast tabular format with BTOP ') # not implemented # parser.add_argument('--matrix', help='scoring matrix',dest='matrix',action='store',default='BL62') parser.add_argument('--ann_script', help='script for subject annotations',dest='ann_script',action='store') parser.add_argument('--q_ann_script', help='script for query annotations',dest='q_ann_script',action='store') parser.add_argument('--ann_file', help='subject annotation file',dest='ann_file',action='store') parser.add_argument('--q_ann_file', help='query annotation file',dest='q_ann_file',action='store') parser.add_argument('--have_qslen', help='query/subject lenghts in tab file',dest='have_qslen',action='store_true',default=False) parser.add_argument('--dom_info', help='show unaligned domain coordinates',dest='dom_info',action='store_true',default=False) parser.add_argument('--sub2query', help='get query annots from self-subject',dest='sub_query',action='store_true',default=False) parser.add_argument('--query', help='file of query sequences',dest='query_file',action='store') parser.add_argument('--out_fields', help='names/order of output fields',dest='out_fields',action='store') parser.add_argument('--raw_score', help='raw score after bit score',dest='raw_in',action='store_true',default=True) parser.add_argument('--no_raw_score', help='raw score after bit score',dest='raw_in',action='store_false', default=True) parser.add_argument('--no-raw_score', help='raw score after bit score',dest='raw_in',action='store_false', default=True) parser.add_argument('--raw_score_out', help='display raw score',dest='raw_out',action='store_true',default=False) parser.add_argument('files', metavar='FILE', help='Blast tabular BTOP files to read', nargs='*') args=parser.parse_args() main(args)
uwbmrb/BMRB-API
server/wsgi/bmrbapi/submodules/fasta36/scripts/annot_blast_btop4.py
Python
gpl-3.0
27,071
[ "BLAST" ]
78e5d1991c2303bc1067fc5c896e76e3e50d6f19f5722097c4f8d1994a90cd5c
#!/usr/bin/python #This is a program for count Gene on Ensemble data "process subsection", #Author: Maurizio Polano, mauriziopolano@blu.it #Last revision: 03/06/2014 import subprocess import os,os.path import sys import time import re from optparse import OptionParser def main(): # select inupt parser = OptionParser() parser = OptionParser(usage="usage: %prog -i [files ID,ID,ID] -d [directory ] -l list file id -h help ", version="%prog 1.0") parser.add_option("-d", "--dir", dest="PosDir",type="string",help=" write input file: %prg -i: Please insert the name the Path of the results files [REQUIRED]") parser.add_option("-i", "--ID", dest="id_name",type="string",help=" write input file: %prg -i: Please insert the ID files [REQUIRED]") parser.add_option("-l", "--list", dest="file_id",type="string",help=" write input file: %prg -i: Please insert the file contain ID") (options, args) = parser.parse_args(args=None, values=None) if not os.path.exists("Count"): os.makedirs("Count") if not os.path.exists("Count"): os.makedirs("Count") if not os.path.exists("de"): os.makedirs("de") options, args = parser.parse_args() if options.id_name: ID = options.id_name.split(",") fileh = open("_count.ense.sh","w") for i in ID: ctr = options.PosDir+i+"_ens_sort.bam" cmd01 = 'samtools sort -no %s de/%s.subset.tmp |samtools view -|/illumina/software/PY276/bin/htseq-count --mode=intersection-nonempty --stranded=yes --type=exon --idattr=gene_id - /home/sbsuser/databases/bowtie2_ens/Homo_sapiens.GRCh37.72.gtf > Count/%s.count.out'%(ctr,i,i) print >> fileh, cmd01 fileh.close() if options.file_id: fileh = open("_count.ense.sh","w") with open(options.file_id) as p: for i in p: lines = i.strip("\n") ctr = options.PosDir+lines+"_ens_sort.bam" cmd01 = 'samtools sort -no %s de/%s.subset.tmp |samtools view -|/illumina/software/PY276/bin/htseq-count --mode=intersection-nonempty --stranded=yes --type=exon --idattr=gene_id - /home/sbsuser/databases/bowtie2_ens/Homo_sapiens.GRCh37.72.gtf > Count/%s.count.out'%(ctr,lines,lines) print >> fileh, cmd01 fileh.close() if __name__ == "__main__": main()
bioinfo-dirty-jobs/Scriptechunks
Count_ensemble.py
Python
mit
2,237
[ "HTSeq" ]
53a17a38b4c244a1964cf5308fdb56e381cbb6091892b8b30febd06793a0cb97
#!/usr/bin/env python # -*- coding: UTF-8 -*- """ Plot AMIGO style Gene Ontology graph using Graphviz. """ import os import os.path as op import sys sys.path.insert(0, op.join(op.dirname(__file__), "..")) from goatools.obo_parser import GODag, GraphEngines if __name__ == "__main__": import optparse p = optparse.OptionParser("%prog [obo_file]", description=__doc__) p.add_option( "--description", dest="desc", help="Write term descriptions to stdout from the obo file specified in args", action="store_true", ) p.add_option( "--term", dest="term", help="Write the parents and children of the query term", action="store", type="string", default=None, ) p.add_option( "--engine", default="pygraphviz", choices=GraphEngines, help="Graph plot engine, must be one of {} [default: %default]".format( "|".join(GraphEngines) ), ) p.add_option( "--gml", action="store_true", help="Write GML output (for Cytoscape) [default: %default]", ) p.add_option( "--disable-draw-parents", action="store_false", dest="draw_parents", help="Do not draw parents of the query term", ) p.add_option( "--disable-draw-children", action="store_false", dest="draw_children", help="Do not draw children of the query term", ) p.add_option( "--output", "-o", default="GO_lineage.pdf", help="Output filename, suffix is image format, common formats e.g. pdf|svg|png|jpg|... [default: %default]", ) p.add_option( "--dpi", default=96, type="int", help="Output figure dpi, ignored by vector image formats like svg and pdf [default: %default]", ) p.set_defaults(draw_parents=True) p.set_defaults(draw_children=True) opts, args = p.parse_args() if not args: obo_file = "go-basic.obo" else: obo_file = args[0] assert os.path.exists(obo_file), "file %s not found!" % obo_file g = GODag(obo_file) if opts.desc: g.write_dag() # run a test case if opts.term is not None: rec = g.query_term(opts.term, verbose=True) g.draw_lineage( [rec], dpi=opts.dpi, engine=opts.engine, gml=opts.gml, output=opts.output, draw_parents=opts.draw_parents, draw_children=opts.draw_children, )
tanghaibao/goatools
scripts/plot_go_term.py
Python
bsd-2-clause
2,575
[ "Cytoscape" ]
4a413f38c420d16335ee5584ece7af38ea1e6457c184a4e6f2953c3991c44ff8
import numpy as np from ase import Atom, Atoms from ase.parallel import rank from gpaw import GPAW from gpaw.test import equal try: calc = GPAW('NaCl.gpw') NaCl = calc.get_atoms() e = NaCl.get_potential_energy() niter = None except IOError: h = 0.21 # gridspacing a = [6.5, 6.5, 7.7] # unit cell d = 2.3608 # experimental bond length NaCl = Atoms([Atom('Na', [0, 0, 0]), Atom('Cl', [0, 0, d])], pbc=False, cell=a) NaCl.center() calc = GPAW(h=h, xc='LDA', nbands=5, lmax=0, setups={'Na': '1'}, convergence={'eigenstates': 1e-6}, spinpol=1) NaCl.set_calculator(calc) e = NaCl.get_potential_energy() niter = calc.get_number_of_iterations() calc.write('NaCl.gpw') dv = NaCl.get_volume() / calc.get_number_of_grid_points().prod() nt1 = calc.get_pseudo_density(gridrefinement=1) Zt1 = nt1.sum() * dv nt2 = calc.get_pseudo_density(gridrefinement=2) Zt2 = nt2.sum() * dv / 8 print 'Integral of pseudo density:', Zt1, Zt2 equal(Zt1, Zt2, 1e-12) for gridrefinement in [1, 2, 4]: n = calc.get_all_electron_density(gridrefinement=gridrefinement) Z = n.sum() * dv / gridrefinement**3 print 'Integral of all-electron density:', Z equal(Z, 28, 1e-5) energy_tolerance = 0.0004 niter_tolerance = 0 equal(e, -4.908677, energy_tolerance)
robwarm/gpaw-symm
gpaw/test/aedensity.py
Python
gpl-3.0
1,366
[ "ASE", "GPAW" ]
9402e9c1722ae167d0960472214aa499984e76891187183abe38847e995e5c75
""" Module for reading Gaussian cube files, which have become one of the standard file formats for volumetric data in quantum chemistry and solid state physics software packages (VASP being an exception). Some basic info about cube files (abridged info from http://paulbourke.net/dataformats/cube/ by Paul Bourke) The file consists of a header which includes the atom information and the size as well as orientation of the volumetric data. The first two lines of the header are comments. The third line has the number of atoms included in the file followed by the position of the origin of the volumetric data. The next three lines give the number of voxels along each axis (x, y, z) followed by the axis vector. The last section in the header is one line for each atom consisting of 5 numbers, the first is the atom number, the second is the charge, and the last three are the x,y,z coordinates of the atom center. The volumetric data is straightforward, one floating point number for each volumetric element. Example In the following example the volumetric data is a 40 by 40 by 40 grid, each voxel is 0.283459 units wide and the volume is aligned with the coordinate axis. There are three atoms. CPMD CUBE FILE. OUTER LOOP: X, MIDDLE LOOP: Y, INNER LOOP: Z 3 0.000000 0.000000 0.000000 40 0.283459 0.000000 0.000000 40 0.000000 0.283459 0.000000 40 0.000000 0.000000 0.283459 8 0.000000 5.570575 5.669178 5.593517 1 0.000000 5.562867 5.669178 7.428055 1 0.000000 7.340606 5.669178 5.111259 -0.25568E-04 0.59213E-05 0.81068E-05 0.10868E-04 0.11313E-04 0.35999E-05 : : : : : : : : : : : : : : : : : : In this case there will be 40 x 40 x 40 floating point values : : : : : : : : : : : : : : : : : : """ import numpy as np from monty.io import zopen from pymatgen.core.sites import Site from pymatgen.core.structure import Structure from pymatgen.core.units import bohr_to_angstrom # TODO: can multiprocessing be incorporated without causing issues during drone assimilation? class Cube: """ Class to read Gaussian cube file formats for volumetric data. Cube files are, by default, written in atomic units, and this class assumes that convention. """ def __init__(self, fname): """ Initialize the cube object and store the data as self.data Args: fname (str): filename of the cube to read """ f = zopen(fname, "rt") # skip header lines for i in range(2): f.readline() # number of atoms followed by the position of the origin of the volumetric data line = f.readline().split() self.natoms = int(line[0]) self.origin = np.array(list(map(float, line[1:]))) # The number of voxels along each axis (x, y, z) followed by the axis vector. line = f.readline().split() self.NX = int(line[0]) self.X = np.array([bohr_to_angstrom * float(l) for l in line[1:]]) self.dX = np.linalg.norm(self.X) line = f.readline().split() self.NY = int(line[0]) self.Y = np.array([bohr_to_angstrom * float(l) for l in line[1:]]) self.dY = np.linalg.norm(self.Y) line = f.readline().split() self.NZ = int(line[0]) self.Z = np.array([bohr_to_angstrom * float(l) for l in line[1:]]) self.dZ = np.linalg.norm(self.Z) self.voxel_volume = abs(np.dot(np.cross(self.X, self.Y), self.Z)) self.volume = abs(np.dot(np.cross(self.X.dot(self.NZ), self.Y.dot(self.NY)), self.Z.dot(self.NZ))) # The last section in the header is one line for each atom consisting of 5 numbers, # the first is the atom number, second is charge, # the last three are the x,y,z coordinates of the atom center. self.sites = [] for i in range(self.natoms): line = f.readline().split() self.sites.append(Site(line[0], np.multiply(bohr_to_angstrom, list(map(float, line[2:]))))) self.structure = Structure( lattice=[self.X * self.NX, self.Y * self.NY, self.Z * self.NZ], species=[s.specie for s in self.sites], coords=[s.coords for s in self.sites], coords_are_cartesian=True, ) # Volumetric data self.data = np.reshape(np.array(f.read().split()).astype(float), (self.NX, self.NY, self.NZ)) def mask_sphere(self, radius, cx, cy, cz): """ Create a mask for a sphere with radius=radius, centered at cx, cy, cz. Args: radius: (float) of the mask (in Angstroms) cx, cy, cz: (float) the fractional coordinates of the center of the sphere """ dx, dy, dz = ( np.floor(radius / np.linalg.norm(self.X)).astype(int), np.floor(radius / np.linalg.norm(self.Y)).astype(int), np.floor(radius / np.linalg.norm(self.Z)).astype(int), ) gcd = max(np.gcd(dx, dy), np.gcd(dy, dz), np.gcd(dx, dz)) sx, sy, sz = dx // gcd, dy // gcd, dz // gcd r = min(dx, dy, dz) x0, y0, z0 = int(np.round(self.NX * cx)), int(np.round(self.NY * cy)), int(np.round(self.NZ * cz)) centerx, centery, centerz = self.NX // 2, self.NY // 2, self.NZ // 2 a = np.roll(self.data, (centerx - x0, centery - y0, centerz - z0)) i, j, k = np.indices(a.shape, sparse=True) a = np.sqrt((sx * i - sx * centerx) ** 2 + (sy * j - sy * centery) ** 2 + (sz * k - sz * centerz) ** 2) indices = a > r a[indices] = 0 return a def get_atomic_site_averages(self, atomic_site_radii): """ Get the average value around each atomic site. Args: atomic_site_radii (dict): dictionary determining the cutoff radius (in Angstroms) for averaging around atomic sites (e.g. {'Li': 0.97, 'B': 0.77, ...}. If not provided, then the returns: Array of site averages, [Average around site 1, Average around site 2, ...] """ return [self._get_atomic_site_average(s, atomic_site_radii[s.species_string]) for s in self.structure.sites] def _get_atomic_site_average(self, site, radius): """ Helper function for get_atomic_site_averages. Args: site: Site in the structure around which to get the average radius: (float) the atomic_site_radius (in Angstroms) for given atomic species returns: Average around the atomic site """ mask = self.mask_sphere(radius, *site.frac_coords) return np.sum(self.data * mask) / np.count_nonzero(mask) def get_atomic_site_totals(self, atomic_site_radii): """ Get the integrated total in a sphere around each atomic site. Args: atomic_site_radii (dict): dictionary determining the cutoff radius (in Angstroms) for averaging around atomic sites (e.g. {'Li': 0.97, 'B': 0.77, ...}. If not provided, then the returns: Array of site averages, [Average around site 1, Average around site 2, ...] """ return [self._get_atomic_site_total(s, atomic_site_radii[s.species_string]) for s in self.structure.sites] def _get_atomic_site_total(self, site, radius): """ Helper function for get_atomic_site_averages. Args: site: Site in the structure around which to get the total radius: (float) the atomic_site_radius (in Angstroms) for given atomic species returns: Average around the atomic site """ mask = self.mask_sphere(radius, *site.frac_coords) return np.sum(self.data * mask) def get_axis_grid(self, ind): """ Modified from pymatgen.io.vasp.outputs Returns the grid for a particular axis. Args: ind (int): Axis index. """ ng = self.data.shape num_pts = ng[ind] lengths = self.structure.lattice.abc return [i / num_pts * lengths[ind] for i in range(num_pts)] def get_average_along_axis(self, ind): """ Modified from pymatgen.io.vasp.outputs Get the averaged total of the volumetric data a certain axis direction. For example, useful for visualizing Hartree Potentials. Args: ind (int): Index of axis. Returns: Average total along axis """ ng = self.data.shape m = self.data if ind == 0: total = np.sum(np.sum(m, axis=1), 1) elif ind == 1: total = np.sum(np.sum(m, axis=0), 1) else: total = np.sum(np.sum(m, axis=0), 0) return total / ng[(ind + 1) % 3] / ng[(ind + 2) % 3]
materialsproject/pymatgen
pymatgen/io/cube.py
Python
mit
9,239
[ "CPMD", "Gaussian", "VASP", "pymatgen" ]
0468a5c82210f75022f1e696375bf0593e512201413a994fca1223c658e81f8d
# # @BEGIN LICENSE # # Psi4: an open-source quantum chemistry software package # # Copyright (c) 2007-2021 The Psi4 Developers. # # The copyrights for code used from other parties are included in # the corresponding files. # # This file is part of Psi4. # # Psi4 is free software; you can redistribute it and/or modify # it under the terms of the GNU Lesser General Public License as published by # the Free Software Foundation, version 3. # # Psi4 is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Lesser General Public License for more details. # # You should have received a copy of the GNU Lesser General Public License along # with Psi4; if not, write to the Free Software Foundation, Inc., # 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA. # # @END LICENSE # """Module with functions for Psi4/Cfour interface. Portions that require calls to Boost Python psi4 module are here, otherwise in qcdb module. Also calls to qcdb module are here and not elsewhere in driver. Organizationally, this module isolates qcdb code from psi4 code. """ import os import re import sys import uuid import shutil import inspect import subprocess from psi4.driver import qcdb from psi4.driver import p4util from psi4.driver.molutil import * from psi4.driver.p4util.exceptions import * # never import driver, wrappers, or aliases into this file P4C4_INFO = {} def run_cfour(name, **kwargs): """Function that prepares environment and input files for a calculation calling Stanton and Gauss's CFOUR code. Also processes results back into Psi4 format. This function is not called directly but is instead called by :py:func:`~psi4.energy` or :py:func:`~psi4.optimize` when a Cfour method is requested (through *name* argument). In order to function correctly, the Cfour executable ``xcfour`` must be present in :envvar:`PATH` or :envvar:`PSIPATH`. .. hlist:: :columns: 1 * Many :ref:`PSI Variables <apdx:cfour_psivar>` extracted from the Cfour output * Python dictionary of associated file constants accessible as ``P4C4_INFO['zmat']``, ``P4C4_INFO['output']``, ``P4C4_INFO['grd']``, *etc.* :type name: str :param name: ``'c4-scf'`` || ``'c4-ccsd(t)'`` || ``'cfour'`` || etc. First argument, usually unlabeled. Indicates the computational method to be applied to the system. :type keep: :ref:`boolean <op_py_boolean>` :param keep: ``'on'`` || |dl| ``'off'`` |dr| Indicates whether to delete the Cfour scratch directory upon completion of the Cfour job. :type path: str :param path: Indicates path to Cfour scratch directory (with respect to Psi4 scratch directory). Otherwise, the default is a subdirectory within the Psi4 scratch directory. If specified, GENBAS and/or ZMAT within will be used. :type genbas: str :param genbas: Indicates that contents should be used for GENBAS file. GENBAS is a complicated topic. It is quite unnecessary if the molecule is from a molecule {...} block and basis is set through |Psifours| BASIS keyword. In that case, a GENBAS is written from LibMints and all is well. Otherwise, a GENBAS is looked for in the usual places: PSIPATH, PATH, PSIDATADIR/basis. If path kwarg is specified, also looks there preferentially for a GENBAS. Can also specify GENBAS within an input file through a string and setting the genbas kwarg. Note that due to the input parser's aggression, blank lines need to be replaced by the text blankline. """ lowername = name.lower() internal_p4c4_info = {} return_wfn = kwargs.pop('return_wfn', False) # Make sure the molecule the user provided is the active one molecule = kwargs.pop('molecule', core.get_active_molecule()) molecule.update_geometry() optstash = p4util.OptionsState( ['CFOUR', 'TRANSLATE_PSI4']) # Determine calling function and hence dertype calledby = inspect.stack()[1][3] dertype = ['energy', 'gradient', 'hessian'].index(calledby) #print('I am %s called by %s called by %s.\n' % # (inspect.stack()[0][3], inspect.stack()[1][3], inspect.stack()[2][3])) # Save submission directory current_directory = os.getcwd() # Move into job scratch directory psioh = core.IOManager.shared_object() psio = core.IO.shared_object() os.chdir(psioh.get_default_path()) # Construct and move into cfour subdirectory of job scratch directory cfour_tmpdir = kwargs['path'] if 'path' in kwargs else \ 'psi.' + str(os.getpid()) + '.' + psio.get_default_namespace() + \ '.cfour.' + str(uuid.uuid4())[:8] if not os.path.exists(cfour_tmpdir): os.mkdir(cfour_tmpdir) os.chdir(cfour_tmpdir) # Find environment by merging PSIPATH and PATH environment variables lenv = { 'PATH': ':'.join([os.path.abspath(x) for x in os.environ.get('PSIPATH', '').split(':') if x != '']) + \ ':' + os.environ.get('PATH') + \ ':' + core.get_datadir() + '/basis', 'GENBAS_PATH': core.get_datadir() + '/basis', 'CFOUR_NUM_CORES': os.environ.get('CFOUR_NUM_CORES'), 'MKL_NUM_THREADS': os.environ.get('MKL_NUM_THREADS'), 'OMP_NUM_THREADS': os.environ.get('OMP_NUM_THREADS'), 'LD_LIBRARY_PATH': os.environ.get('LD_LIBRARY_PATH') } if 'path' in kwargs: lenv['PATH'] = kwargs['path'] + ':' + lenv['PATH'] # Filter out None values as subprocess will fault on them lenv = {k: v for k, v in lenv.items() if v is not None} # Load the GENBAS file genbas_path = qcdb.search_file('GENBAS', lenv['GENBAS_PATH']) if genbas_path: try: shutil.copy2(genbas_path, psioh.get_default_path() + cfour_tmpdir) except shutil.Error: # should only fail if src and dest equivalent pass core.print_out("\n GENBAS loaded from %s\n" % (genbas_path)) core.print_out(" CFOUR to be run from %s\n" % (psioh.get_default_path() + cfour_tmpdir)) else: message = """ GENBAS file for CFOUR interface not found. Either: [1] Supply a GENBAS by placing it in PATH or PSIPATH [1a] Use cfour {} block with molecule and basis directives. [1b] Use molecule {} block and CFOUR_BASIS keyword. [2] Allow Psi4's internal basis sets to convert to GENBAS [2a] Use molecule {} block and BASIS keyword. """ core.print_out(message) core.print_out(' Search path that was tried:\n') core.print_out(lenv['PATH'].replace(':', ', ')) # Generate the ZMAT input file in scratch if 'path' in kwargs and os.path.isfile('ZMAT'): core.print_out(" ZMAT loaded from %s\n" % (psioh.get_default_path() + kwargs['path'] + '/ZMAT')) else: with open('ZMAT', 'w') as cfour_infile: cfour_infile.write(write_zmat(lowername, dertype, molecule)) internal_p4c4_info['zmat'] = open('ZMAT', 'r').read() #core.print_out('\n====== Begin ZMAT input for CFOUR ======\n') #core.print_out(open('ZMAT', 'r').read()) #core.print_out('======= End ZMAT input for CFOUR =======\n\n') #print('\n====== Begin ZMAT input for CFOUR ======') #print(open('ZMAT', 'r').read()) #print('======= End ZMAT input for CFOUR =======\n') if 'genbas' in kwargs: with open('GENBAS', 'w') as cfour_basfile: cfour_basfile.write(kwargs['genbas'].replace('\nblankline\n', '\n\n')) core.print_out(' GENBAS loaded from kwargs string\n') # Close psi4 output file and reopen with filehandle print('output in', current_directory + '/' + core.outfile_name()) pathfill = '' if os.path.isabs(core.outfile_name()) else current_directory + os.path.sep # Handle threading # OMP_NUM_THREADS from env is in lenv from above # threads from psi4 -n (core.get_num_threads()) is ignored # CFOUR_OMP_NUM_THREADS psi4 option takes precedence, handled below if core.has_option_changed('CFOUR', 'CFOUR_OMP_NUM_THREADS') == True: lenv['OMP_NUM_THREADS'] = str(core.get_option('CFOUR', 'CFOUR_OMP_NUM_THREADS')) #print("""\n\n<<<<< RUNNING CFOUR ... >>>>>\n\n""") # Call executable xcfour, directing cfour output to the psi4 output file cfour_executable = kwargs['c4exec'] if 'c4exec' in kwargs else 'xcfour' try: retcode = subprocess.Popen([cfour_executable], bufsize=0, stdout=subprocess.PIPE, env=lenv) except OSError as e: sys.stderr.write('Program %s not found in path or execution failed: %s\n' % (cfour_executable, e.strerror)) message = ('Program %s not found in path or execution failed: %s\n' % (cfour_executable, e.strerror)) raise ValidationError(message) c4out = '' while True: data = retcode.stdout.readline() data = data.decode('utf-8') if not data: break core.print_out(data) c4out += data internal_p4c4_info['output'] = c4out c4files = {} core.print_out('\n') for item in ['GRD', 'FCMFINAL', 'DIPOL']: try: with open(psioh.get_default_path() + cfour_tmpdir + '/' + item, 'r') as handle: c4files[item] = handle.read() core.print_out(' CFOUR scratch file %s has been read\n' % (item)) core.print_out('%s\n' % c4files[item]) internal_p4c4_info[item.lower()] = c4files[item] except IOError: pass core.print_out('\n') if molecule.name() == 'blank_molecule_psi4_yo': qcdbmolecule = None else: molecule.update_geometry() qcdbmolecule = qcdb.Molecule(molecule.create_psi4_string_from_molecule()) qcdbmolecule.update_geometry() # c4mol, if it exists, is dinky, just a clue to geometry of cfour results psivar, c4grad, c4mol = qcdb.cfour.harvest(qcdbmolecule, c4out, **c4files) # Absorb results into psi4 data structures for key in psivar.keys(): core.set_variable(key.upper(), float(psivar[key])) if qcdbmolecule is None and c4mol is not None: molecule = geometry(c4mol.create_psi4_string_from_molecule(), name='blank_molecule_psi4_yo') molecule.update_geometry() # This case arises when no Molecule going into calc (cfour {} block) but want # to know the orientation at which grad, properties, etc. are returned (c4mol). # c4mol is dinky, w/o chg, mult, dummies and retains name # blank_molecule_psi4_yo so as to not interfere with future cfour {} blocks if c4grad is not None: mat = core.Matrix.from_list(c4grad) core.set_gradient(mat) #print ' <<< [3] C4-GRD-GRAD >>>' #mat.print() # exit(1) # # Things needed core.so module to do # collect c4out string # read GRD # read FCMFINAL # see if theres an active molecule # # Things delegatable to qcdb # parsing c4out # reading GRD and FCMFINAL strings # reconciling p4 and c4 molecules (orient) # reconciling c4out and GRD and FCMFINAL results # transforming frame of results back to p4 # # Things run_cfour needs to have back # psivar # qcdb.Molecule of c4? # coordinates? # gradient in p4 frame # # Process the cfour output # psivar, c4coord, c4grad = qcdb.cfour.cfour_harvest(c4out) # for key in psivar.keys(): # core.set_variable(key.upper(), float(psivar[key])) # # # Awful Hack - Go Away TODO # if c4grad: # molecule = core.get_active_molecule() # molecule.update_geometry() # # if molecule.name() == 'blank_molecule_psi4_yo': # p4grad = c4grad # p4coord = c4coord # else: # qcdbmolecule = qcdb.Molecule(molecule.create_psi4_string_from_molecule()) # #p4grad = qcdbmolecule.deorient_array_from_cfour(c4coord, c4grad) # #p4coord = qcdbmolecule.deorient_array_from_cfour(c4coord, c4coord) # # with open(psioh.get_default_path() + cfour_tmpdir + '/GRD', 'r') as cfour_grdfile: # c4outgrd = cfour_grdfile.read() # print('GRD\n',c4outgrd) # c4coordGRD, c4gradGRD = qcdb.cfour.cfour_harvest_files(qcdbmolecule, grd=c4outgrd) # # p4mat = core.Matrix.from_list(p4grad) # core.set_gradient(p4mat) # print(' <<< P4 PSIVAR >>>') # for item in psivar: # print(' %30s %16.8f' % (item, psivar[item])) #print(' <<< P4 COORD >>>') #for item in p4coord: # print(' %16.8f %16.8f %16.8f' % (item[0], item[1], item[2])) # print(' <<< P4 GRAD >>>') # for item in c4grad: # print(' %16.8f %16.8f %16.8f' % (item[0], item[1], item[2])) # Clean up cfour scratch directory unless user instructs otherwise keep = yes.match(str(kwargs['keep'])) if 'keep' in kwargs else False os.chdir('..') try: if keep or ('path' in kwargs): core.print_out('\n CFOUR scratch files have been kept in %s\n' % (psioh.get_default_path() + cfour_tmpdir)) else: shutil.rmtree(cfour_tmpdir) except OSError as e: print('Unable to remove CFOUR temporary directory %s' % e, file=sys.stderr) exit(1) # Return to submission directory and reopen output file os.chdir(current_directory) core.print_out('\n') p4util.banner(' Cfour %s %s Results ' % (name.lower(), calledby.capitalize())) core.print_variables() if c4grad is not None: core.get_gradient().print_out() core.print_out('\n') p4util.banner(' Cfour %s %s Results ' % (name.lower(), calledby.capitalize())) core.print_variables() if c4grad is not None: core.get_gradient().print_out() # Quit if Cfour threw error if 'CFOUR ERROR CODE' in core.variables(): raise ValidationError("""Cfour exited abnormally.""") P4C4_INFO.clear() P4C4_INFO.update(internal_p4c4_info) optstash.restore() # new skeleton wavefunction w/mol, highest-SCF basis (just to choose one), & not energy # Feb 2017 hack. Could get proper basis in skel wfn even if not through p4 basis kw gobas = core.get_global_option('BASIS') if core.get_global_option('BASIS') else 'sto-3g' basis = core.BasisSet.build(molecule, "ORBITAL", gobas) if basis.has_ECP(): raise ValidationError("""ECPs not hooked up for Cfour""") wfn = core.Wavefunction(molecule, basis) optstash.restore() if dertype == 0: finalquantity = psivar['CURRENT ENERGY'] elif dertype == 1: finalquantity = core.get_gradient() wfn.set_gradient(finalquantity) if finalquantity.rows(0) < 20: core.print_out('CURRENT GRADIENT') finalquantity.print_out() elif dertype == 2: pass #finalquantity = finalhessian #wfn.set_hessian(finalquantity) #if finalquantity.rows(0) < 20: # core.print_out('CURRENT HESSIAN') # finalquantity.print_out() return wfn def cfour_list(): """Form list of Cfour :py:func:`~driver.energy` arguments.""" return qcdb.cfour.cfour_list() def cfour_gradient_list(): """Form list of Cfour analytic :py:func:`~driver.gradient` arguments.""" return qcdb.cfour.cfour_gradient_list() def cfour_hessian_list(): """Form list of Cfour analytic :py:func:`~driver.gradient` arguments.""" return qcdb.cfour.cfour_hessian_list() def cfour_psivar_list(): """Form dictionary of :ref:`PSI Variables <apdx:cfour_psivar>` set by Cfour methods.""" return qcdb.cfour.cfour_psivar_list() def write_zmat(name, dertype, molecule): """Returns string with contents of Cfour ZMAT file as gathered from active molecule, current keyword settings, and cfour {...} block. """ # Handle memory mem = int(0.000001 * core.get_memory()) if mem == 524: memcmd, memkw = '', {} else: memcmd, memkw = qcdb.cfour.muster_memory(mem) # Handle molecule and basis set if molecule.name() == 'blank_molecule_psi4_yo': molcmd, molkw = '', {} bascmd, baskw = '', {} core.set_local_option('CFOUR', 'TRANSLATE_PSI4', False) else: molecule.update_geometry() #print(molecule.create_psi4_string_from_molecule()) qcdbmolecule = qcdb.Molecule(molecule.create_psi4_string_from_molecule()) qcdbmolecule.tagline = molecule.name() molcmd, molkw = qcdbmolecule.format_molecule_for_cfour() if core.get_global_option('BASIS') == '': bascmd, baskw = '', {} else: user_pg = molecule.schoenflies_symbol() molecule.reset_point_group('c1') # need basis printed for *every* atom qbs = core.BasisSet.build(molecule, "BASIS", core.get_global_option('BASIS')) if qbs.has_ECP(): raise ValidationError("""ECPs not hooked up for Cfour""") with open('GENBAS', 'w') as cfour_basfile: cfour_basfile.write(qbs.genbas()) core.print_out(' GENBAS loaded from Psi4 LibMints for basis %s\n' % (core.get_global_option('BASIS'))) molecule.reset_point_group(user_pg) molecule.update_geometry() bascmd, baskw = qcdbmolecule.format_basis_for_cfour(qbs.has_puream()) # Handle psi4 keywords implying cfour keyword values if core.get_option('CFOUR', 'TRANSLATE_PSI4'): psicmd, psikw = qcdb.cfour.muster_psi4options(p4util.prepare_options_for_modules(changedOnly=True)) else: psicmd, psikw = '', {} # Handle calc type and quantum chemical method mdccmd, mdckw = qcdb.cfour.muster_modelchem(name, dertype) # Handle calc type and quantum chemical method mdccmd, mdckw = qcdb.cfour.muster_modelchem(name, dertype) # Handle driver vs input/default keyword reconciliation userkw = p4util.prepare_options_for_modules() userkw = qcdb.options.reconcile_options(userkw, memkw) userkw = qcdb.options.reconcile_options(userkw, molkw) userkw = qcdb.options.reconcile_options(userkw, baskw) userkw = qcdb.options.reconcile_options(userkw, psikw) userkw = qcdb.options.reconcile_options(userkw, mdckw) # Handle conversion of psi4 keyword structure into cfour format optcmd = qcdb.options.prepare_options_for_cfour(userkw) # Handle text to be passed untouched to cfour litcmd = core.get_global_option('LITERAL_CFOUR') # Assemble ZMAT pieces zmat = memcmd + molcmd + optcmd + mdccmd + psicmd + bascmd + litcmd if len(re.findall(r'^\*(ACES2|CFOUR|CRAPS)\(', zmat, re.MULTILINE)) != 1: core.print_out('\n Faulty ZMAT constructed:\n%s' % (zmat)) raise ValidationError(""" Multiple *CFOUR(...) blocks in input. This usually arises because molecule or options are specified both the psi4 way through molecule {...} and set ... and the cfour way through cfour {...}.""") return zmat
jturney/psi4
psi4/driver/procrouting/interface_cfour.py
Python
lgpl-3.0
19,085
[ "CFOUR", "Psi4" ]
15974d2861457440bf4005d0cbda6e1c3732e5a9ddb491b9c54cd1612300ebe6
# # gPrime - A web-based genealogy program # # Copyright (C) 2007-2012 Brian G. Matherly # Copyright (C) 2009 Gary Burton # Copyright (C) 2010 Jakim Friant # Copyright (C) 2010 Nick Hall # Copyright (C) 2013-2014 Paul Franklin # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; either version 2 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program; if not, write to the Free Software # Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA. # """Reports/Text Reports/Tag Report""" #------------------------------------------------------------------------ # # standard python modules # #------------------------------------------------------------------------ #------------------------------------------------------------------------ # # Gprime modules # #------------------------------------------------------------------------ from gprime.const import LOCALE as glocale _ = glocale.translation.gettext from gprime.plug.menu import EnumeratedListOption from gprime.plug.report import Report from gprime.plug.report import utils from gprime.plug.report import MenuReportOptions from gprime.plug.report import stdoptions from gprime.plug.docgen import (IndexMark, FontStyle, ParagraphStyle, TableStyle, TableCellStyle, FONT_SANS_SERIF, INDEX_TYPE_TOC, PARA_ALIGN_CENTER) from gprime.lib import NoteType, UrlType from gprime.filters import GenericFilterFactory, rules from gprime.errors import ReportError from gprime.utils.db import get_participant_from_event from gprime.display.place import displayer as _pd from gprime.proxy import LivingProxyDb, CacheProxyDb #------------------------------------------------------------------------ # # TagReport # #------------------------------------------------------------------------ class TagReport(Report): """ Tag Report """ def __init__(self, database, options, user): """ Create the TagReport object that produces the report. The arguments are: database - the GRAMPS database instance options - instance of the Options class for this report user - a gen.user.User() instance This report needs the following parameters (class variables) that come in the options class. tag - The tag each object must match to be included. name_format - Preferred format to display names of people incl_private - Whether to include private data living_people - How to handle living people years_past_death - Consider as living this many years after death """ Report.__init__(self, database, options, user) menu = options.menu lang = menu.get_option_by_name('trans').get_value() rlocale = self.set_locale(lang) stdoptions.run_private_data_option(self, menu) living_opt = stdoptions.run_living_people_option(self, menu, rlocale) self.database = CacheProxyDb(self.database) self._lv = menu.get_option_by_name('living_people').get_value() for (value, description) in living_opt.get_items(xml_items=True): if value == self._lv: living_desc = self._(description) break self.living_desc = self._("(Living people: %(option_name)s)" ) % {'option_name' : living_desc} self.tag = menu.get_option_by_name('tag').get_value() if not self.tag: raise ReportError( _('Tag Report'), _('You must first create a tag before running this report.')) stdoptions.run_name_format_option(self, menu) def write_report(self): self.doc.start_paragraph("TR-Title") # feature request 2356: avoid genitive form title = self._("Tag Report for %s Items") % self.tag mark = IndexMark(title, INDEX_TYPE_TOC, 1) self.doc.write_text(title, mark) self.doc.end_paragraph() if self._lv != LivingProxyDb.MODE_INCLUDE_ALL: self.doc.start_paragraph("TR-ReportSubtitle") self.doc.write_text(self.living_desc) self.doc.end_paragraph() self.write_people() self.write_families() self.write_events() self.write_places() self.write_notes() self.write_media() self.write_repositories() self.write_sources() self.write_citations() def write_people(self): """ write the people associated with the tag """ plist = self.database.iter_person_handles() filter_class = GenericFilterFactory('Person') a_filter = filter_class() a_filter.add_rule(rules.person.HasTag([self.tag])) ind_list = a_filter.apply(self.database, plist) if not ind_list: return self.doc.start_paragraph("TR-Heading") header = self._("People") mark = IndexMark(header, INDEX_TYPE_TOC, 2) self.doc.write_text(header, mark) self.doc.end_paragraph() self.doc.start_table('PeopleTable', 'TR-Table') self.doc.start_row() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Id")) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Name")) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Birth")) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Death")) self.doc.end_paragraph() self.doc.end_cell() self.doc.end_row() for person_handle in ind_list: person = self.database.get_person_from_handle(person_handle) self.doc.start_row() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') self.doc.write_text(person.get_gid()) self.doc.end_paragraph() self.doc.end_cell() name = self._name_display.display(person) mark = utils.get_person_mark(self.database, person) self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') self.doc.write_text(name, mark) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') birth_ref = person.get_birth_ref() if birth_ref: event = self.database.get_event_from_handle(birth_ref.ref) self.doc.write_text(self._get_date(event.get_date_object())) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') death_ref = person.get_death_ref() if death_ref: event = self.database.get_event_from_handle(death_ref.ref) self.doc.write_text(self._get_date(event.get_date_object())) self.doc.end_paragraph() self.doc.end_cell() self.doc.end_row() self.doc.end_table() def write_families(self): """ write the families associated with the tag """ flist = self.database.iter_family_handles() filter_class = GenericFilterFactory('Family') a_filter = filter_class() a_filter.add_rule(rules.family.HasTag([self.tag])) fam_list = a_filter.apply(self.database, flist) if not fam_list: return self.doc.start_paragraph("TR-Heading") header = self._("Families") mark = IndexMark(header, INDEX_TYPE_TOC, 2) self.doc.write_text(header, mark) self.doc.end_paragraph() self.doc.start_table('FamilyTable', 'TR-Table') self.doc.start_row() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Id")) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Father")) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Mother")) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Relationship")) self.doc.end_paragraph() self.doc.end_cell() self.doc.end_row() for family_handle in fam_list: family = self.database.get_family_from_handle(family_handle) self.doc.start_row() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') self.doc.write_text(family.get_gid()) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') father_handle = family.get_father_handle() if father_handle: father = self.database.get_person_from_handle(father_handle) mark = utils.get_person_mark(self.database, father) self.doc.write_text(self._name_display.display(father), mark) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') mother_handle = family.get_mother_handle() if mother_handle: mother = self.database.get_person_from_handle(mother_handle) mark = utils.get_person_mark(self.database, mother) self.doc.write_text(self._name_display.display(mother), mark) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') relation = family.get_relationship() self.doc.write_text(str(relation)) self.doc.end_paragraph() self.doc.end_cell() self.doc.end_row() self.doc.end_table() def write_events(self): """ write the events associated with the tag """ elist = self.database.get_event_handles() filter_class = GenericFilterFactory('Event') a_filter = filter_class() a_filter.add_rule(rules.event.HasTag([self.tag])) event_list = a_filter.apply(self.database, elist) if not event_list: return self.doc.start_paragraph("TR-Heading") header = self._("Events") mark = IndexMark(header, INDEX_TYPE_TOC, 2) self.doc.write_text(header, mark) self.doc.end_paragraph() self.doc.start_table('EventTable', 'TR-Table') self.doc.start_row() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Id")) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Type")) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Participants")) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Date")) self.doc.end_paragraph() self.doc.end_cell() self.doc.end_row() for event_handle in event_list: event = self.database.get_event_from_handle(event_handle) self.doc.start_row() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') self.doc.write_text(event.get_gid()) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') self.doc.write_text(self._(self._get_type(event.get_type()))) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') self.doc.write_text(get_participant_from_event(self.database, event_handle)) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') date = self._get_date(event.get_date_object()) if date: self.doc.write_text(date) self.doc.end_paragraph() self.doc.end_cell() self.doc.end_row() self.doc.end_table() def write_places(self): """ write the places associated with the tag """ plist = self.database.get_place_handles() filter_class = GenericFilterFactory('Place') a_filter = filter_class() a_filter.add_rule(rules.place.HasTag([self.tag])) place_list = a_filter.apply(self.database, plist) if not place_list: return self.doc.start_paragraph("TR-Heading") header = self._("Places") mark = IndexMark(header, INDEX_TYPE_TOC, 2) self.doc.write_text(header, mark) self.doc.end_paragraph() self.doc.start_table('PlaceTable', 'TR-Table') self.doc.start_row() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Id")) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Title")) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Name")) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Type")) self.doc.end_paragraph() self.doc.end_cell() self.doc.end_row() for place_handle in place_list: place = self.database.get_place_from_handle(place_handle) place_title = _pd.display(self.database, place) self.doc.start_row() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') self.doc.write_text(place.get_gid()) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') self.doc.write_text(place_title) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') self.doc.write_text(place.get_name()) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') self.doc.write_text(str(place.get_type())) self.doc.end_paragraph() self.doc.end_cell() self.doc.end_row() self.doc.end_table() def write_notes(self): """ write the notes associated with the tag """ nlist = self.database.get_note_handles() filter_class = GenericFilterFactory('Note') a_filter = filter_class() a_filter.add_rule(rules.note.HasTag([self.tag])) note_list = a_filter.apply(self.database, nlist) if not note_list: return self.doc.start_paragraph("TR-Heading") header = self._("Notes") mark = IndexMark(header, INDEX_TYPE_TOC, 2) self.doc.write_text(header, mark) self.doc.end_paragraph() self.doc.start_table('NoteTable', 'TR-Table') self.doc.start_row() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Id")) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Type")) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell', 2) self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Text")) self.doc.end_paragraph() self.doc.end_cell() self.doc.end_row() for note_handle in note_list: note = self.database.get_note_from_handle(note_handle) self.doc.start_row() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') self.doc.write_text(note.get_gid()) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') note_type = note.get_type() self.doc.write_text(str(note_type)) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell', 2) self.doc.write_styled_note( note.get_styledtext(), note.get_format(), 'TR-Note', contains_html=((note.get_type() == NoteType.HTML_CODE))) self.doc.end_cell() self.doc.end_row() self.doc.end_table() def write_media(self): """ write the media associated with the tag """ mlist = self.database.get_media_handles(sort_handles=True) filter_class = GenericFilterFactory('Media') a_filter = filter_class() a_filter.add_rule(rules.media.HasTag([self.tag])) media_list = a_filter.apply(self.database, mlist) if not media_list: return self.doc.start_paragraph("TR-Heading") header = self._("Media") mark = IndexMark(header, INDEX_TYPE_TOC, 2) self.doc.write_text(header, mark) self.doc.end_paragraph() self.doc.start_table('MediaTable', 'TR-Table') self.doc.start_row() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Id")) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Title")) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Type")) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Date")) self.doc.end_paragraph() self.doc.end_cell() self.doc.end_row() for media_handle in media_list: media = self.database.get_media_from_handle(media_handle) self.doc.start_row() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') self.doc.write_text(media.get_gid()) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') title = media.get_description() self.doc.write_text(str(title)) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') mime_type = media.get_mime_type() self.doc.write_text(str(mime_type)) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') date = self._get_date(media.get_date_object()) if date: self.doc.write_text(date) self.doc.end_paragraph() self.doc.end_cell() self.doc.end_row() self.doc.end_table() def write_repositories(self): """ write the repositories associated with the tag """ rlist = self.database.get_repository_handles() filter_class = GenericFilterFactory('Repository') a_filter = filter_class() a_filter.add_rule(rules.repository.HasTag([self.tag])) repo_list = a_filter.apply(self.database, rlist) if not repo_list: return self.doc.start_paragraph("TR-Heading") header = self._("Repositories") mark = IndexMark(header, INDEX_TYPE_TOC, 2) self.doc.write_text(header, mark) self.doc.end_paragraph() self.doc.start_table('ReopTable', 'TR-Table') self.doc.start_row() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Id")) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Name")) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Type")) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Email Address")) self.doc.end_paragraph() self.doc.end_cell() self.doc.end_row() for repo_handle in repo_list: repo = self.database.get_repository_from_handle(repo_handle) self.doc.start_row() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') self.doc.write_text(repo.get_gid()) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') self.doc.write_text(repo.get_name()) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') self.doc.write_text(str(repo.get_type())) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') home_page = '' for url in repo.get_url_list(): if url.get_type() == UrlType.EMAIL: home_page = url.get_path() break self.doc.write_text(home_page) self.doc.end_paragraph() self.doc.end_cell() self.doc.end_row() self.doc.end_table() def write_sources(self): """ write the sources associated with the tag """ slist = self.database.get_source_handles(sort_handles=True) filter_class = GenericFilterFactory('Source') a_filter = filter_class() a_filter.add_rule(rules.source.HasTag([self.tag])) source_list = a_filter.apply(self.database, slist) if not source_list: return self.doc.start_paragraph("TR-Heading") header = self._("Source") mark = IndexMark(header, INDEX_TYPE_TOC, 2) self.doc.write_text(header, mark) self.doc.end_paragraph() self.doc.start_table('SourceTable', 'TR-Table') self.doc.start_row() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Id")) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Title")) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Author")) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Publication Information")) self.doc.end_paragraph() self.doc.end_cell() self.doc.end_row() for source_handle in source_list: source = self.database.get_source_from_handle(source_handle) self.doc.start_row() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') self.doc.write_text(source.get_gid()) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') self.doc.write_text(source.get_title()) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') self.doc.write_text(source.get_author()) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') self.doc.write_text(source.get_publication_info()) self.doc.end_paragraph() self.doc.end_cell() self.doc.end_row() self.doc.end_table() def write_citations(self): """ write the citations associated with the tag """ clist = self.database.get_citation_handles(sort_handles=True) filter_class = GenericFilterFactory('Citation') a_filter = filter_class() a_filter.add_rule(rules.citation.HasTag([self.tag])) citation_list = a_filter.apply(self.database, clist) if not citation_list: return self.doc.start_paragraph("TR-Heading") header = self._("Citations") mark = IndexMark(header, INDEX_TYPE_TOC, 2) self.doc.write_text(header, mark) self.doc.end_paragraph() self.doc.start_table('CitationTable', 'TR-Table') self.doc.start_row() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Id")) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Volume/Page")) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Date")) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal-Bold') self.doc.write_text(self._("Source")) self.doc.end_paragraph() self.doc.end_cell() self.doc.end_row() for citation_handle in citation_list: citation = self.database.get_citation_from_handle(citation_handle) self.doc.start_row() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') self.doc.write_text(citation.get_gid()) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') self.doc.write_text(citation.get_page()) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') date = self._get_date(citation.get_date_object()) if date: self.doc.write_text(date) self.doc.end_paragraph() self.doc.end_cell() self.doc.start_cell('TR-TableCell') self.doc.start_paragraph('TR-Normal') source_handle = citation.get_reference_handle() source = self.database.get_source_from_handle(source_handle) self.doc.write_text(source.get_title()) self.doc.end_paragraph() self.doc.end_cell() self.doc.end_row() self.doc.end_table() #------------------------------------------------------------------------ # # TagOptions # #------------------------------------------------------------------------ class TagOptions(MenuReportOptions): """ Options for the Tag Report """ def __init__(self, name, dbase): self.__db = dbase MenuReportOptions.__init__(self, name, dbase) def get_subject(self): """ Return a string that describes the subject of the report. """ return self.__tag_option.get_value() def add_menu_options(self, menu): """ Add options to the menu for the tag report. """ category_name = _("Report Options") all_tags = [] for handle in self.__db.get_tag_handles(sort_handles=True): tag = self.__db.get_tag_from_handle(handle) all_tags.append(tag.get_name()) if len(all_tags) > 0: self.__tag_option = EnumeratedListOption(_('Tag'), all_tags[0]) for tag_name in all_tags: self.__tag_option.add_item(tag_name, tag_name) else: self.__tag_option = EnumeratedListOption(_('Tag'), '') self.__tag_option.add_item('', '') self.__tag_option.set_help(_("The tag to use for the report")) menu.add_option(category_name, "tag", self.__tag_option) stdoptions.add_name_format_option(menu, category_name) stdoptions.add_private_data_option(menu, category_name) stdoptions.add_living_people_option(menu, category_name) stdoptions.add_localization_option(menu, category_name) def make_default_style(self, default_style): """Make the default output style for the Tag Report.""" # Paragraph Styles font = FontStyle() font.set_size(16) font.set_type_face(FONT_SANS_SERIF) font.set_bold(1) para = ParagraphStyle() para.set_header_level(1) para.set_top_margin(utils.pt2cm(3)) para.set_bottom_margin(utils.pt2cm(3)) para.set_font(font) para.set_alignment(PARA_ALIGN_CENTER) para.set_description(_("The style used for the title of the page.")) default_style.add_paragraph_style("TR-Title", para) font = FontStyle() font.set(face=FONT_SANS_SERIF, size=12, bold=1) para = ParagraphStyle() para.set_header_level(1) para.set_top_margin(utils.pt2cm(3)) para.set_bottom_margin(utils.pt2cm(3)) para.set_font(font) para.set_alignment(PARA_ALIGN_CENTER) para.set_description(_('The style used for the subtitle.')) default_style.add_paragraph_style("TR-ReportSubtitle", para) font = FontStyle() font.set(face=FONT_SANS_SERIF, size=14, italic=1) para = ParagraphStyle() para.set_font(font) para.set_header_level(2) para.set_top_margin(0.25) para.set_bottom_margin(0.25) para.set_description(_('The style used for the section headers.')) default_style.add_paragraph_style("TR-Heading", para) font = FontStyle() font.set_size(12) para = ParagraphStyle() para.set(first_indent=-0.75, lmargin=.75) para.set_font(font) para.set_top_margin(utils.pt2cm(3)) para.set_bottom_margin(utils.pt2cm(3)) para.set_description(_('The basic style used for the text display.')) default_style.add_paragraph_style("TR-Normal", para) font = FontStyle() font.set_size(12) font.set_bold(True) para = ParagraphStyle() para.set(first_indent=-0.75, lmargin=.75) para.set_font(font) para.set_top_margin(utils.pt2cm(3)) para.set_bottom_margin(utils.pt2cm(3)) para.set_description(_('The basic style used for table headings.')) default_style.add_paragraph_style("TR-Normal-Bold", para) para = ParagraphStyle() para.set(first_indent=-0.75, lmargin=.75) para.set_top_margin(utils.pt2cm(3)) para.set_bottom_margin(utils.pt2cm(3)) para.set_description(_('The basic style used for the note display.')) default_style.add_paragraph_style("TR-Note", para) #Table Styles cell = TableCellStyle() default_style.add_cell_style('TR-TableCell', cell) table = TableStyle() table.set_width(100) table.set_columns(4) table.set_column_width(0, 10) table.set_column_width(1, 30) table.set_column_width(2, 30) table.set_column_width(3, 30) default_style.add_table_style('TR-Table', table)
sam-m888/gprime
gprime/plugins/textreport/tagreport.py
Python
gpl-2.0
34,619
[ "Brian" ]
da6ef88e02fd8a369acfd26bde4625465c6b470e88eb1105f2a3abb7b804ae5b
""" simple, elegant templating (part of web.py) Template design: Template string is split into tokens and the tokens are combined into nodes. Parse tree is a nodelist. TextNode and ExpressionNode are simple nodes and for-loop, if-loop etc are block nodes, which contain multiple child nodes. Each node can emit some python string. python string emitted by the root node is validated for safeeval and executed using python in the given environment. Enough care is taken to make sure the generated code and the template has line to line match, so that the error messages can point to exact line number in template. (It doesn't work in some cases still.) Grammar: template -> defwith sections defwith -> '$def with (' arguments ')' | '' sections -> section* section -> block | assignment | line assignment -> '$ ' <assignment expression> line -> (text|expr)* text -> <any characters other than $> expr -> '$' pyexpr | '$(' pyexpr ')' | '${' pyexpr '}' pyexpr -> <python expression> """ from __future__ import print_function from io import open __all__ = [ "Template", "Render", "render", "frender", "ParseError", "SecurityError", "test" ] import tokenize import os import sys import glob import re import warnings import ast from .utils import storage, safeunicode, safestr, re_compile from .webapi import config from .net import websafe from .py3helpers import PY2, iteritems if PY2: from UserDict import DictMixin # Make a new-style class class MutableMapping(object, DictMixin): pass else: from collections import MutableMapping def splitline(text): r""" Splits the given text at newline. >>> splitline('foo\nbar') ('foo\n', 'bar') >>> splitline('foo') ('foo', '') >>> splitline('') ('', '') """ index = text.find('\n') + 1 if index: return text[:index], text[index:] else: return text, '' class Parser: """Parser Base. """ def __init__(self): self.statement_nodes = STATEMENT_NODES self.keywords = KEYWORDS def parse(self, text, name="<template>"): self.text = text self.name = name defwith, text = self.read_defwith(text) suite = self.read_suite(text) return DefwithNode(defwith, suite) def read_defwith(self, text): if text.startswith('$def with'): defwith, text = splitline(text) defwith = defwith[1:].strip() # strip $ and spaces return defwith, text else: return '', text def read_section(self, text): r"""Reads one section from the given text. section -> block | assignment | line >>> read_section = Parser().read_section >>> read_section('foo\nbar\n') (<line: [t'foo\n']>, 'bar\n') >>> read_section('$ a = b + 1\nfoo\n') (<assignment: 'a = b + 1'>, 'foo\n') read_section('$for in range(10):\n hello $i\nfoo) """ if text.lstrip(' ').startswith('$'): index = text.index('$') begin_indent, text2 = text[:index], text[index+1:] ahead = self.python_lookahead(text2) if ahead == 'var': return self.read_var(text2) elif ahead in self.statement_nodes: return self.read_block_section(text2, begin_indent) elif ahead in self.keywords: return self.read_keyword(text2) elif ahead.strip() == '': # assignments starts with a space after $ # ex: $ a = b + 2 return self.read_assignment(text2) return self.readline(text) def read_var(self, text): r"""Reads a var statement. >>> read_var = Parser().read_var >>> read_var('var x=10\nfoo') (<var: x = 10>, 'foo') >>> read_var('var x: hello $name\nfoo') (<var: x = join_(u'hello ', escape_(name, True))>, 'foo') """ line, text = splitline(text) tokens = self.python_tokens(line) if len(tokens) < 4: raise SyntaxError('Invalid var statement') name = tokens[1] sep = tokens[2] value = line.split(sep, 1)[1].strip() if sep == '=': pass # no need to process value elif sep == ':': #@@ Hack for backward-compatability if tokens[3] == '\n': # multi-line var statement block, text = self.read_indented_block(text, ' ') lines = [self.readline(x)[0] for x in block.splitlines()] nodes = [] for x in lines: nodes.extend(x.nodes) nodes.append(TextNode('\n')) else: # single-line var statement linenode, _ = self.readline(value) nodes = linenode.nodes parts = [node.emit('') for node in nodes] value = "join_(%s)" % ", ".join(parts) else: raise SyntaxError('Invalid var statement') return VarNode(name, value), text def read_suite(self, text): r"""Reads section by section till end of text. >>> read_suite = Parser().read_suite >>> read_suite('hello $name\nfoo\n') [<line: [t'hello ', $name, t'\n']>, <line: [t'foo\n']>] """ sections = [] while text: section, text = self.read_section(text) sections.append(section) return SuiteNode(sections) def readline(self, text): r"""Reads one line from the text. Newline is supressed if the line ends with \. >>> readline = Parser().readline >>> readline('hello $name!\nbye!') (<line: [t'hello ', $name, t'!\n']>, 'bye!') >>> readline('hello $name!\\\nbye!') (<line: [t'hello ', $name, t'!']>, 'bye!') >>> readline('$f()\n\n') (<line: [$f(), t'\n']>, '\n') """ line, text = splitline(text) # supress new line if line ends with \ if line.endswith('\\\n'): line = line[:-2] nodes = [] while line: node, line = self.read_node(line) nodes.append(node) return LineNode(nodes), text def read_node(self, text): r"""Reads a node from the given text and returns the node and remaining text. >>> read_node = Parser().read_node >>> read_node('hello $name') (t'hello ', '$name') >>> read_node('$name') ($name, '') """ if text.startswith('$$'): return TextNode('$'), text[2:] elif text.startswith('$#'): # comment line, text = splitline(text) return TextNode('\n'), text elif text.startswith('$'): text = text[1:] # strip $ if text.startswith(':'): escape = False text = text[1:] # strip : else: escape = True return self.read_expr(text, escape=escape) else: return self.read_text(text) def read_text(self, text): r"""Reads a text node from the given text. >>> read_text = Parser().read_text >>> read_text('hello $name') (t'hello ', '$name') """ index = text.find('$') if index < 0: return TextNode(text), '' else: return TextNode(text[:index]), text[index:] def read_keyword(self, text): line, text = splitline(text) return StatementNode(line.strip() + "\n"), text def read_expr(self, text, escape=True): """Reads a python expression from the text and returns the expression and remaining text. expr -> simple_expr | paren_expr simple_expr -> id extended_expr extended_expr -> attr_access | paren_expr extended_expr | '' attr_access -> dot id extended_expr paren_expr -> [ tokens ] | ( tokens ) | { tokens } >>> read_expr = Parser().read_expr >>> read_expr("name") ($name, '') >>> read_expr("a.b and c") ($a.b, ' and c') >>> read_expr("a. b") ($a, '. b') >>> read_expr("name</h1>") ($name, '</h1>') >>> read_expr("(limit)ing") ($(limit), 'ing') >>> read_expr('a[1, 2][:3].f(1+2, "weird string[).", 3 + 4) done.') ($a[1, 2][:3].f(1+2, "weird string[).", 3 + 4), ' done.') """ def simple_expr(): identifier() extended_expr() def identifier(): next(tokens) def extended_expr(): lookahead = tokens.lookahead() if lookahead is None: return elif lookahead.value == '.': attr_access() elif lookahead.value in parens: paren_expr() extended_expr() else: return def attr_access(): from token import NAME # python token constants dot = tokens.lookahead() if tokens.lookahead2().type == NAME: next(tokens) # consume dot identifier() extended_expr() def paren_expr(): begin = next(tokens).value end = parens[begin] while True: if tokens.lookahead().value in parens: paren_expr() else: t = next(tokens) if t.value == end: break return parens = { "(": ")", "[": "]", "{": "}" } def get_tokens(text): """tokenize text using python tokenizer. Python tokenizer ignores spaces, but they might be important in some cases. This function introduces dummy space tokens when it identifies any ignored space. Each token is a storage object containing type, value, begin and end. """ i = iter([text]) readline = lambda: next(i) end = None for t in tokenize.generate_tokens(readline): t = storage(type=t[0], value=t[1], begin=t[2], end=t[3]) if end is not None and end != t.begin: _, x1 = end _, x2 = t.begin yield storage(type=-1, value=text[x1:x2], begin=end, end=t.begin) end = t.end yield t class BetterIter: """Iterator like object with 2 support for 2 look aheads.""" def __init__(self, items): self.iteritems = iter(items) self.items = [] self.position = 0 self.current_item = None def lookahead(self): if len(self.items) <= self.position: self.items.append(self._next()) return self.items[self.position] def _next(self): try: return next(self.iteritems) except StopIteration: return None def lookahead2(self): if len(self.items) <= self.position+1: self.items.append(self._next()) return self.items[self.position+1] def __next__(self): self.current_item = self.lookahead() self.position += 1 return self.current_item next = __next__ #Needed for Py2 compatibility tokens = BetterIter(get_tokens(text)) if tokens.lookahead().value in parens: paren_expr() else: simple_expr() row, col = tokens.current_item.end return ExpressionNode(text[:col], escape=escape), text[col:] def read_assignment(self, text): r"""Reads assignment statement from text. >>> read_assignment = Parser().read_assignment >>> read_assignment('a = b + 1\nfoo') (<assignment: 'a = b + 1'>, 'foo') """ line, text = splitline(text) return AssignmentNode(line.strip()), text def python_lookahead(self, text): """Returns the first python token from the given text. >>> python_lookahead = Parser().python_lookahead >>> python_lookahead('for i in range(10):') 'for' >>> python_lookahead('else:') 'else' >>> python_lookahead(' x = 1') ' ' """ i = iter([text]) readline = lambda: next(i) tokens = tokenize.generate_tokens(readline) return next(tokens)[1] def python_tokens(self, text): i = iter([text]) readline = lambda: next(i) tokens = tokenize.generate_tokens(readline) return [t[1] for t in tokens] def read_indented_block(self, text, indent): r"""Read a block of text. A block is what typically follows a for or it statement. It can be in the same line as that of the statement or an indented block. >>> read_indented_block = Parser().read_indented_block >>> read_indented_block(' a\n b\nc', ' ') ('a\nb\n', 'c') >>> read_indented_block(' a\n b\n c\nd', ' ') ('a\n b\nc\n', 'd') >>> read_indented_block(' a\n\n b\nc', ' ') ('a\n\n b\n', 'c') """ if indent == '': return '', text block = "" while text: line, text2 = splitline(text) if line.strip() == "": block += '\n' elif line.startswith(indent): block += line[len(indent):] else: break text = text2 return block, text def read_statement(self, text): r"""Reads a python statement. >>> read_statement = Parser().read_statement >>> read_statement('for i in range(10): hello $name') ('for i in range(10):', ' hello $name') """ tok = PythonTokenizer(text) tok.consume_till(':') return text[:tok.index], text[tok.index:] def read_block_section(self, text, begin_indent=''): r""" >>> read_block_section = Parser().read_block_section >>> read_block_section('for i in range(10): hello $i\nfoo') (<block: 'for i in range(10):', [<line: [t'hello ', $i, t'\n']>]>, 'foo') >>> read_block_section('for i in range(10):\n hello $i\n foo', begin_indent=' ') (<block: 'for i in range(10):', [<line: [t'hello ', $i, t'\n']>]>, ' foo') >>> read_block_section('for i in range(10):\n hello $i\nfoo') (<block: 'for i in range(10):', [<line: [t'hello ', $i, t'\n']>]>, 'foo') """ line, text = splitline(text) stmt, line = self.read_statement(line) keyword = self.python_lookahead(stmt) # if there is some thing left in the line if line.strip(): block = line.lstrip() else: def find_indent(text): rx = re_compile(' +') match = rx.match(text) first_indent = match and match.group(0) return first_indent or "" # find the indentation of the block by looking at the first line first_indent = find_indent(text)[len(begin_indent):] #TODO: fix this special case if keyword == "code": indent = begin_indent + first_indent else: indent = begin_indent + min(first_indent, INDENT) block, text = self.read_indented_block(text, indent) return self.create_block_node(keyword, stmt, block, begin_indent), text def create_block_node(self, keyword, stmt, block, begin_indent): if keyword in self.statement_nodes: return self.statement_nodes[keyword](stmt, block, begin_indent) else: raise ParseError('Unknown statement: %s' % repr(keyword)) class PythonTokenizer: """Utility wrapper over python tokenizer.""" def __init__(self, text): self.text = text i = iter([text]) readline = lambda: next(i) self.tokens = tokenize.generate_tokens(readline) self.index = 0 def consume_till(self, delim): """Consumes tokens till colon. >>> tok = PythonTokenizer('for i in range(10): hello $i') >>> tok.consume_till(':') >>> tok.text[:tok.index] 'for i in range(10):' >>> tok.text[tok.index:] ' hello $i' """ try: while True: t = next(self) if t.value == delim: break elif t.value == '(': self.consume_till(')') elif t.value == '[': self.consume_till(']') elif t.value == '{': self.consume_till('}') # if end of line is found, it is an exception. # Since there is no easy way to report the line number, # leave the error reporting to the python parser later #@@ This should be fixed. if t.value == '\n': break except: #raise ParseError, "Expected %s, found end of line." % repr(delim) # raising ParseError doesn't show the line number. # if this error is ignored, then it will be caught when compiling the python code. return def __next__(self): type, t, begin, end, line = next(self.tokens) row, col = end self.index = col return storage(type=type, value=t, begin=begin, end=end) next = __next__ #needed for Py2 compatibility class DefwithNode: def __init__(self, defwith, suite): if defwith: self.defwith = defwith.replace('with', '__template__') + ':' # offset 4 lines. for encoding, __lineoffset__, loop and self. self.defwith += "\n __lineoffset__ = -4" else: self.defwith = 'def __template__():' # offset 4 lines for encoding, __template__, __lineoffset__, loop and self. self.defwith += "\n __lineoffset__ = -5" self.defwith += "\n loop = ForLoop()" self.defwith += "\n self = TemplateResult(); extend_ = self.extend" self.suite = suite self.end = "\n return self" def emit(self, indent): encoding = "# coding: utf-8\n" return encoding + self.defwith + self.suite.emit(indent + INDENT) + self.end def __repr__(self): return "<defwith: %s, %s>" % (self.defwith, self.suite) class TextNode: def __init__(self, value): self.value = value def emit(self, indent, begin_indent=''): return repr(safeunicode(self.value)) def __repr__(self): return 't' + repr(self.value) class ExpressionNode: def __init__(self, value, escape=True): self.value = value.strip() # convert ${...} to $(...) if value.startswith('{') and value.endswith('}'): self.value = '(' + self.value[1:-1] + ')' self.escape = escape def emit(self, indent, begin_indent=''): return 'escape_(%s, %s)' % (self.value, bool(self.escape)) def __repr__(self): if self.escape: escape = '' else: escape = ':' return "$%s%s" % (escape, self.value) class AssignmentNode: def __init__(self, code): self.code = code def emit(self, indent, begin_indent=''): return indent + self.code + "\n" def __repr__(self): return "<assignment: %s>" % repr(self.code) class LineNode: def __init__(self, nodes): self.nodes = nodes def emit(self, indent, text_indent='', name=''): text = [node.emit('') for node in self.nodes] if text_indent: text = [repr(text_indent)] + text return indent + "extend_([%s])\n" % ", ".join(text) def __repr__(self): return "<line: %s>" % repr(self.nodes) INDENT = ' ' # 4 spaces class BlockNode: def __init__(self, stmt, block, begin_indent=''): self.stmt = stmt self.suite = Parser().read_suite(block) self.begin_indent = begin_indent def emit(self, indent, text_indent=''): text_indent = self.begin_indent + text_indent out = indent + self.stmt + self.suite.emit(indent + INDENT, text_indent) return out def __repr__(self): return "<block: %s, %s>" % (repr(self.stmt), repr(self.suite)) class ForNode(BlockNode): def __init__(self, stmt, block, begin_indent=''): self.original_stmt = stmt tok = PythonTokenizer(stmt) tok.consume_till('in') a = stmt[:tok.index] # for i in b = stmt[tok.index:-1] # rest of for stmt excluding : stmt = a + ' loop.setup(' + b.strip() + '):' BlockNode.__init__(self, stmt, block, begin_indent) def __repr__(self): return "<block: %s, %s>" % (repr(self.original_stmt), repr(self.suite)) class CodeNode: def __init__(self, stmt, block, begin_indent=''): # compensate one line for $code: self.code = "\n" + block def emit(self, indent, text_indent=''): import re rx = re.compile('^', re.M) return rx.sub(indent, self.code).rstrip(' ') def __repr__(self): return "<code: %s>" % repr(self.code) class StatementNode: def __init__(self, stmt): self.stmt = stmt def emit(self, indent, begin_indent=''): return indent + self.stmt def __repr__(self): return "<stmt: %s>" % repr(self.stmt) class IfNode(BlockNode): pass class ElseNode(BlockNode): pass class ElifNode(BlockNode): pass class DefNode(BlockNode): def __init__(self, *a, **kw): BlockNode.__init__(self, *a, **kw) code = CodeNode("", "") code.code = "self = TemplateResult(); extend_ = self.extend\n" self.suite.sections.insert(0, code) code = CodeNode("", "") code.code = "return self\n" self.suite.sections.append(code) def emit(self, indent, text_indent=''): text_indent = self.begin_indent + text_indent out = indent + self.stmt + self.suite.emit(indent + INDENT, text_indent) return indent + "__lineoffset__ -= 3\n" + out class VarNode: def __init__(self, name, value): self.name = name self.value = value def emit(self, indent, text_indent): return indent + "self[%s] = %s\n" % (repr(self.name), self.value) def __repr__(self): return "<var: %s = %s>" % (self.name, self.value) class SuiteNode: """Suite is a list of sections.""" def __init__(self, sections): self.sections = sections def emit(self, indent, text_indent=''): return "\n" + "".join([s.emit(indent, text_indent) for s in self.sections]) def __repr__(self): return repr(self.sections) STATEMENT_NODES = { 'for': ForNode, 'while': BlockNode, 'if': IfNode, 'elif': ElifNode, 'else': ElseNode, 'def': DefNode, 'code': CodeNode } KEYWORDS = [ "pass", "break", "continue", "return" ] TEMPLATE_BUILTIN_NAMES = [ "dict", "enumerate", "float", "int", "bool", "list", "long", "reversed", "set", "slice", "tuple", "xrange", "abs", "all", "any", "callable", "chr", "cmp", "divmod", "filter", "hex", "id", "isinstance", "iter", "len", "max", "min", "oct", "ord", "pow", "range", "True", "False", "None", "__import__", # some c-libraries like datetime requires __import__ to present in the namespace ] if PY2: import __builtin__ as builtins else: import builtins TEMPLATE_BUILTINS = dict([(name, getattr(builtins, name)) for name in TEMPLATE_BUILTIN_NAMES if name in builtins.__dict__]) class ForLoop: """ Wrapper for expression in for stament to support loop.xxx helpers. >>> loop = ForLoop() >>> for x in loop.setup(['a', 'b', 'c']): ... print(loop.index, loop.revindex, loop.parity, x) ... 1 3 odd a 2 2 even b 3 1 odd c >>> loop.index Traceback (most recent call last): ... AttributeError: index """ def __init__(self): self._ctx = None def __getattr__(self, name): if self._ctx is None: raise AttributeError(name) else: return getattr(self._ctx, name) def setup(self, seq): self._push() return self._ctx.setup(seq) def _push(self): self._ctx = ForLoopContext(self, self._ctx) def _pop(self): self._ctx = self._ctx.parent class ForLoopContext: """Stackable context for ForLoop to support nested for loops. """ def __init__(self, forloop, parent): self._forloop = forloop self.parent = parent def setup(self, seq): try: self.length = len(seq) except: self.length = 0 self.index = 0 for a in seq: self.index += 1 yield a self._forloop._pop() index0 = property(lambda self: self.index-1) first = property(lambda self: self.index == 1) last = property(lambda self: self.index == self.length) odd = property(lambda self: self.index % 2 == 1) even = property(lambda self: self.index % 2 == 0) parity = property(lambda self: ['odd', 'even'][self.even]) revindex0 = property(lambda self: self.length - self.index) revindex = property(lambda self: self.length - self.index + 1) class BaseTemplate: def __init__(self, code, filename, filter, globals, builtins): self.filename = filename self.filter = filter self._globals = globals self._builtins = builtins if code: self.t = self._compile(code) else: self.t = lambda: '' def _compile(self, code): env = self.make_env(self._globals or {}, self._builtins) exec(code, env) #__template__ is a global function declared when executing "code" return env['__template__'] def __call__(self, *a, **kw): __hidetraceback__ = True return self.t(*a, **kw) def make_env(self, globals, builtins): return dict(globals, __builtins__=builtins, ForLoop=ForLoop, TemplateResult=TemplateResult, escape_=self._escape, join_=self._join ) def _join(self, *items): return u"".join(items) def _escape(self, value, escape=False): if value is None: value = '' value = safeunicode(value) if escape and self.filter: value = self.filter(value) return value class Template(BaseTemplate): CONTENT_TYPES = { '.html' : 'text/html; charset=utf-8', '.xhtml' : 'application/xhtml+xml; charset=utf-8', '.txt' : 'text/plain', } FILTERS = { '.html': websafe, '.xhtml': websafe, '.xml': websafe } globals = {} def __init__(self, text, filename='<template>', filter=None, globals=None, builtins=None, extensions=None): self.extensions = extensions or [] text = Template.normalize_text(text) code = self.compile_template(text, filename) _, ext = os.path.splitext(filename) filter = filter or self.FILTERS.get(ext, None) self.content_type = self.CONTENT_TYPES.get(ext, None) if globals is None: globals = self.globals if builtins is None: builtins = TEMPLATE_BUILTINS BaseTemplate.__init__(self, code=code, filename=filename, filter=filter, globals=globals, builtins=builtins) def normalize_text(text): """Normalizes template text by correcting \r\n, tabs and BOM chars.""" text = text.replace('\r\n', '\n').replace('\r', '\n').expandtabs() if not text.endswith('\n'): text += '\n' # ignore BOM chars at the begining of template BOM = '\xef\xbb\xbf' if isinstance(text, str) and text.startswith(BOM): text = text[len(BOM):] # support fort \$ for backward-compatibility text = text.replace(r'\$', '$$') return text normalize_text = staticmethod(normalize_text) def __call__(self, *a, **kw): __hidetraceback__ = True from . import webapi as web if 'headers' in web.ctx and self.content_type: web.header('Content-Type', self.content_type, unique=True) return BaseTemplate.__call__(self, *a, **kw) def generate_code(text, filename, parser=None): # parse the text parser = parser or Parser() rootnode = parser.parse(text, filename) # generate python code from the parse tree code = rootnode.emit(indent="").strip() return safestr(code) generate_code = staticmethod(generate_code) def create_parser(self): p = Parser() for ext in self.extensions: p = ext(p) return p def compile_template(self, template_string, filename): code = Template.generate_code(template_string, filename, parser=self.create_parser()) def get_source_line(filename, lineno): try: lines = open(filename, encoding='utf-8').read().splitlines() return lines[lineno] except: return None try: # compile the code first to report the errors, if any, with the filename compiled_code = compile(code, filename, 'exec') except SyntaxError as err: # display template line that caused the error along with the traceback. # this works in Py3 but not Py2, duh ? TODO err.msg += '\n\nTemplate traceback:\n File %s, line %s\n %s' % \ (repr(err.filename), err.lineno, get_source_line(err.filename, err.lineno-1)) raise # make sure code is safe ast_node = ast.parse(code, filename) SafeVisitor().walk(ast_node, filename) return compiled_code class CompiledTemplate(Template): def __init__(self, f, filename): Template.__init__(self, '', filename) self.t = f def compile_template(self, *a): return None def _compile(self, *a): return None class Render: """The most preferred way of using templates. render = web.template.render('templates') print render.foo() Optional parameter can be `base` can be used to pass output of every template through the base template. render = web.template.render('templates', base='layout') """ def __init__(self, loc='templates', cache=None, base=None, **keywords): self._loc = loc self._keywords = keywords if cache is None: cache = not config.get('debug', False) if cache: self._cache = {} else: self._cache = None if base and not hasattr(base, '__call__'): # make base a function, so that it can be passed to sub-renders self._base = lambda page: self._template(base)(page) else: self._base = base def _add_global(self, obj, name=None): """Add a global to this rendering instance.""" if 'globals' not in self._keywords: self._keywords['globals'] = {} if not name: name = obj.__name__ self._keywords['globals'][name] = obj def _lookup(self, name): path = os.path.join(self._loc, name) if os.path.isdir(path): return 'dir', path else: path = self._findfile(path) if path: return 'file', path else: return 'none', None def _load_template(self, name): kind, path = self._lookup(name) if kind == 'dir': return Render(path, cache=self._cache is not None, base=self._base, **self._keywords) elif kind == 'file': return Template(open(path, encoding='utf-8').read(), filename=path, **self._keywords) else: raise AttributeError("No template named " + name) def _findfile(self, path_prefix): p = [f for f in glob.glob(path_prefix + '.*') if not f.endswith('~')] # skip backup files p.sort() # sort the matches for deterministic order # support templates without extension (#364) # When no templates are found and a file is found with the exact name, use it. if not p and os.path.exists(path_prefix): p = [path_prefix] return p and p[0] def _template(self, name): if self._cache is not None: if name not in self._cache: self._cache[name] = self._load_template(name) return self._cache[name] else: return self._load_template(name) def __getattr__(self, name): t = self._template(name) if self._base and isinstance(t, Template): def template(*a, **kw): return self._base(t(*a, **kw)) return template else: return self._template(name) class GAE_Render(Render): # Render gets over-written. make a copy here. super = Render def __init__(self, loc, *a, **kw): GAE_Render.super.__init__(self, loc, *a, **kw) import types if isinstance(loc, types.ModuleType): self.mod = loc else: name = loc.rstrip('/').replace('/', '.') self.mod = __import__(name, None, None, ['x']) self.mod.__dict__.update(kw.get('builtins', TEMPLATE_BUILTINS)) self.mod.__dict__.update(Template.globals) self.mod.__dict__.update(kw.get('globals', {})) def _load_template(self, name): t = getattr(self.mod, name) import types if isinstance(t, types.ModuleType): return GAE_Render(t, cache=self._cache is not None, base=self._base, **self._keywords) else: return t render = Render # setup render for Google App Engine. try: from google import appengine render = Render = GAE_Render except ImportError: pass def frender(path, **keywords): """Creates a template from the given file path. """ return Template(open(path, encoding='utf-8').read(), filename=path, **keywords) def compile_templates(root): """Compiles templates to python code.""" re_start = re_compile('^', re.M) for dirpath, dirnames, filenames in os.walk(root): filenames = [f for f in filenames if not f.startswith('.') and not f.endswith('~') and not f.startswith('__init__.py')] for d in dirnames[:]: if d.startswith('.'): dirnames.remove(d) # don't visit this dir out = open(os.path.join(dirpath, '__init__.py'), 'w', encoding='utf-8') out.write('from web.template import CompiledTemplate, ForLoop, TemplateResult\n\n') if dirnames: out.write("import " + ", ".join(dirnames)) out.write("\n") for f in filenames: path = os.path.join(dirpath, f) if '.' in f: name, _ = f.split('.', 1) else: name = f text = open(path, encoding='utf-8').read() text = Template.normalize_text(text) code = Template.generate_code(text, path) code = code.replace("__template__", name, 1) out.write(code) out.write('\n\n') out.write('%s = CompiledTemplate(%s, %s)\n' % (name, name, repr(path))) out.write("join_ = %s._join; escape_ = %s._escape\n\n" % (name, name)) # create template to make sure it compiles t = Template(open(path, encoding='utf-8').read(), path) out.close() class ParseError(Exception): pass class SecurityError(Exception): """The template seems to be trying to do something naughty.""" pass ALLOWED_AST_NODES = ['Interactive', 'Expression', 'Suite', 'FunctionDef', 'ClassDef', 'Return', 'Delete', 'Assign', 'AugAssign', 'alias', #'Print', 'Repr', 'For', 'While', 'If', 'With', 'comprehension','NameConstant', 'arg', #'Raise', 'TryExcept', 'TryFinally', 'Assert', 'Import', #'ImportFrom', 'Exec', 'Global', 'Expr', 'Pass', 'Break', 'Continue', 'BoolOp', 'BinOp', 'UnaryOp', 'Lambda', 'IfExp', 'Dict', 'Module', 'arguments', 'keyword', 'Set', 'ListComp', 'SetComp', 'DictComp', 'GeneratorExp', 'Yield', 'Compare', 'Call', 'Num', 'Str', 'Attribute', 'Subscript', 'Name', 'List', 'Tuple', 'Load', 'Store', 'Del', 'AugLoad', 'AugStore', 'Param', 'Ellipsis', 'Slice', 'ExtSlice', 'Index', 'And', 'Or', 'Add', 'Sub', 'Mult', 'Div', 'Mod', 'Pow', 'LShift', 'RShift', 'BitOr', 'BitXor', 'BitAnd', 'FloorDiv', 'Invert', 'Not', 'UAdd', 'USub', 'Eq', 'NotEq', 'Lt', 'LtE', 'Gt', 'GtE', 'Is', 'IsNot', 'In', 'NotIn', 'ExceptHandler'] class SafeVisitor(ast.NodeVisitor): """ Make sure code is safe by walking through the AST. Code considered unsafe if: * it has restricted AST nodes (only nodes defined in ALLOWED_AST_NODES are allowed) * it is trying to assign to attributes * it is trying to access resricted attributes Adopted from http://www.zafar.se/bkz/uploads/safe.txt (public domain, Babar K. Zafar) * Using ast rather than compiler tree, for jython and Py3 support since Py2.6 * Simplified with ast.NodeVisitor class """ def __init__(self, *args, **kwargs): "Initialize visitor by generating callbacks for all AST node types." super(SafeVisitor, self).__init__(*args, **kwargs) self.errors = [] def walk(self, tree, filename): "Validate each node in AST and raise SecurityError if the code is not safe." self.filename = filename self.visit(tree) if self.errors: raise SecurityError('\n'.join([str(err) for err in self.errors])) def generic_visit(self, node): nodename = type(node).__name__ if nodename not in ALLOWED_AST_NODES: self.fail_name(node, nodename) super(SafeVisitor, self).generic_visit(node) def visit_Attribute(self, node): attrname = self.get_node_attr(node) if self.is_unallowed_attr(attrname): self.fail_attribute(node, attrname) super(SafeVisitor, self).generic_visit(node) def visit_Assign(self, node): self.check_assign_targets(node) def visit_AugAssign(self, node): self.check_assign_target(node) def check_assign_targets(self, node): for target in node.targets: self.check_assign_target(target) super(SafeVisitor, self).generic_visit(node) def check_assign_target(self, targetnode): targetname = type(targetnode).__name__ if targetname == "Attribute": attrname = self.get_node_attr(targetnode) self.fail_attribute(targetnode, attrname) # failure modes def fail_name(self, node, nodename): lineno = self.get_node_lineno(node) e = SecurityError("%s:%d - execution of '%s' statements is denied" % (self.filename, lineno, nodename)) self.errors.append(e) def fail_attribute(self, node, attrname): lineno = self.get_node_lineno(node) e = SecurityError("%s:%d - access to attribute '%s' is denied" % (self.filename, lineno, attrname)) self.errors.append(e) # helpers def is_unallowed_attr(self, name): return name.startswith('_') \ or name.startswith('func_') \ or name.startswith('im_') def get_node_attr(self, node): return 'attr' in node._fields and node.attr or None def get_node_lineno(self, node): return (node.lineno) and node.lineno or 0 class TemplateResult(MutableMapping): """Dictionary like object for storing template output. The result of a template execution is usally a string, but sometimes it contains attributes set using $var. This class provides a simple dictionary like interface for storing the output of the template and the attributes. The output is stored with a special key __body__. Convering the the TemplateResult to string or unicode returns the value of __body__. When the template is in execution, the output is generated part by part and those parts are combined at the end. Parts are added to the TemplateResult by calling the `extend` method and the parts are combined seemlessly when __body__ is accessed. >>> d = TemplateResult(__body__='hello, world', x='foo') >>> print(d) hello, world >>> d.x 'foo' >>> d = TemplateResult() >>> d.extend([u'hello', u'world']) >>> d <TemplateResult: {'__body__': u'helloworld'}> """ def __init__(self, *a, **kw): self.__dict__["_d"] = dict(*a, **kw) self._d.setdefault("__body__", u'') self.__dict__['_parts'] = [] self.__dict__["extend"] = self._parts.extend self._d.setdefault("__body__", None) def keys(self): return self._d.keys() def _prepare_body(self): """Prepare value of __body__ by joining parts. """ if self._parts: value = u"".join(self._parts) self._parts[:] = [] body = self._d.get('__body__') if body: self._d['__body__'] = body + value else: self._d['__body__'] = value def __getitem__(self, name): if name == "__body__": self._prepare_body() return self._d[name] def __setitem__(self, name, value): if name == "__body__": self._prepare_body() return self._d.__setitem__(name, value) def __delitem__(self, name): if name == "__body__": self._prepare_body() return self._d.__delitem__(name) def __getattr__(self, key): try: return self[key] except KeyError as k: raise AttributeError(k) def __setattr__(self, key, value): self[key] = value def __delattr__(self, key): try: del self[key] except KeyError as k: raise AttributeError(k) def __unicode__(self): self._prepare_body() return self["__body__"] def __str__(self): self._prepare_body() if PY2: return self["__body__"].encode('utf-8') else: return self["__body__"] def __repr__(self): self._prepare_body() return "<TemplateResult: %s>" % self._d def __len__(self): return self._d.__len__() def __iter__(self): for i in self._d.__iter__(): if i == "__body__": self._prepare_body() yield i def test(): r"""Doctest for testing template module. Define a utility function to run template test. >>> class TestResult: ... def __init__(self, t): self.t = t ... def __getattr__(self, name): return getattr(self.t, name) ... def __repr__(self): return repr(unicode(self.t) if PY2 else str(self.t)) ... >>> def t(code, **keywords): ... tmpl = Template(code, **keywords) ... return lambda *a, **kw: TestResult(tmpl(*a, **kw)) ... Simple tests. >>> t('1')() u'1\n' >>> t('$def with ()\n1')() u'1\n' >>> t('$def with (a)\n$a')(1) u'1\n' >>> t('$def with (a=0)\n$a')(1) u'1\n' >>> t('$def with (a=0)\n$a')(a=1) u'1\n' Test complicated expressions. >>> t('$def with (x)\n$x.upper()')('hello') u'HELLO\n' >>> t('$(2 * 3 + 4 * 5)')() u'26\n' >>> t('${2 * 3 + 4 * 5}')() u'26\n' >>> t('$def with (limit)\nkeep $(limit)ing.')('go') u'keep going.\n' >>> t('$def with (a)\n$a.b[0]')(storage(b=[1])) u'1\n' Test html escaping. >>> t('$def with (x)\n$x', filename='a.html')('<html>') u'&lt;html&gt;\n' >>> t('$def with (x)\n$x', filename='a.txt')('<html>') u'<html>\n' Test if, for and while. >>> t('$if 1: 1')() u'1\n' >>> t('$if 1:\n 1')() u'1\n' >>> t('$if 1:\n 1\\')() u'1' >>> t('$if 0: 0\n$elif 1: 1')() u'1\n' >>> t('$if 0: 0\n$elif None: 0\n$else: 1')() u'1\n' >>> t('$if 0 < 1 and 1 < 2: 1')() u'1\n' >>> t('$for x in [1, 2, 3]: $x')() u'1\n2\n3\n' >>> t('$def with (d)\n$for k, v in d.items(): $k')({1: 1}) u'1\n' >>> t('$for x in [1, 2, 3]:\n\t$x')() u' 1\n 2\n 3\n' >>> t('$def with (a)\n$while a and a.pop():1')([1, 2, 3]) u'1\n1\n1\n' The space after : must be ignored. >>> t('$if True: foo')() u'foo\n' Test loop.xxx. >>> t("$for i in range(5):$loop.index, $loop.parity")() u'1, odd\n2, even\n3, odd\n4, even\n5, odd\n' >>> t("$for i in range(2):\n $for j in range(2):$loop.parent.parity $loop.parity")() u'odd odd\nodd even\neven odd\neven even\n' Test assignment. >>> t('$ a = 1\n$a')() u'1\n' >>> t('$ a = [1]\n$a[0]')() u'1\n' >>> t('$ a = {1: 1}\n$list(a.keys())[0]')() u'1\n' >>> t('$ a = []\n$if not a: 1')() u'1\n' >>> t('$ a = {}\n$if not a: 1')() u'1\n' >>> t('$ a = -1\n$a')() u'-1\n' >>> t('$ a = "1"\n$a')() u'1\n' Test comments. >>> t('$# 0')() u'\n' >>> t('hello$#comment1\nhello$#comment2')() u'hello\nhello\n' >>> t('$#comment0\nhello$#comment1\nhello$#comment2')() u'\nhello\nhello\n' Test unicode. >>> t('$def with (a)\n$a')(u'\u203d') u'\u203d\n' >>> t(u'$def with (a)\n$a $:a')(u'\u203d') u'\u203d \u203d\n' >>> t(u'$def with ()\nfoo')() u'foo\n' >>> def f(x): return x ... >>> t(u'$def with (f)\n$:f("x")')(f) u'x\n' >>> t('$def with (f)\n$:f("x")')(f) u'x\n' Test dollar escaping. >>> t("Stop, $$money isn't evaluated.")() u"Stop, $money isn't evaluated.\n" >>> t("Stop, \$money isn't evaluated.")() u"Stop, $money isn't evaluated.\n" Test space sensitivity. >>> t('$def with (x)\n$x')(1) u'1\n' >>> t('$def with(x ,y)\n$x')(1, 1) u'1\n' >>> t('$(1 + 2*3 + 4)')() u'11\n' Make sure globals are working. >>> t('$x')() Traceback (most recent call last): ... NameError: global name 'x' is not defined >>> t('$x', globals={'x': 1})() u'1\n' Can't change globals. >>> t('$ x = 2\n$x', globals={'x': 1})() u'2\n' >>> t('$ x = x + 1\n$x', globals={'x': 1})() Traceback (most recent call last): ... UnboundLocalError: local variable 'x' referenced before assignment Make sure builtins are customizable. >>> t('$min(1, 2)')() u'1\n' >>> t('$min(1, 2)', builtins={})() Traceback (most recent call last): ... NameError: global name 'min' is not defined Test vars. >>> x = t('$var x: 1')() >>> x.x u'1' >>> x = t('$var x = 1')() >>> x.x 1 >>> x = t('$var x: \n foo\n bar')() >>> x.x u'foo\nbar\n' Test BOM chars. >>> t('\xef\xbb\xbf$def with(x)\n$x')('foo') u'foo\n' Test for with weird cases. >>> t('$for i in range(10)[1:5]:\n $i')() u'1\n2\n3\n4\n' >>> t("$for k, v in sorted({'a': 1, 'b': 2}.items()):\n $k $v", globals={'sorted':sorted})() u'a 1\nb 2\n' Test for syntax error. >>> try: ... t("$for k, v in ({'a': 1, 'b': 2}.items():\n $k $v")() ... except SyntaxError: ... print("OK") ... else: ... print("Expected SyntaxError") ... OK Test datetime. >>> import datetime >>> t("$def with (date)\n$date.strftime('%m %Y')")(datetime.datetime(2009, 1, 1)) u'01 2009\n' """ pass if __name__ == "__main__": import sys if '--compile' in sys.argv: compile_templates(sys.argv[2]) else: import doctest doctest.testmod()
bobintetley/asm3
src/web039/template.py
Python
gpl-3.0
50,611
[ "VisIt" ]
245c50fa610319ef405649cfd2fcf9defe0b2ebe2806e108064a4d688c38e64c
from gpaw import GPAW print('state LDA PBE') for name in ['ferro', 'anti', 'non']: calc = GPAW(name + '.gpw', txt=None) atoms = calc.get_atoms() eLDA = atoms.get_potential_energy() deltaxc = calc.get_xc_difference('PBE') ePBE = eLDA + deltaxc if name == 'ferro': eLDA0 = eLDA ePBE0 = ePBE eLDA -= eLDA0 ePBE -= ePBE0 print('%-5s: %7.3f eV %7.3f eV' % (name, eLDA, ePBE))
robwarm/gpaw-symm
doc/exercises/iron/PBE.py
Python
gpl-3.0
450
[ "GPAW" ]
2deb12f6327821b3d9e8f30d1ce0e1ff318449e1767362cc804e9944292f2ed3
# # Copyright (C) 2010-2019 The ESPResSo project # Copyright (C) 2002,2003,2004,2005,2006,2007,2008,2009,2010 # Max-Planck-Institute for Polymer Research, Theory Group # # This file is part of ESPResSo. # # ESPResSo is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # ESPResSo is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # import espressomd from espressomd import electrostatics, electrostatic_extensions, assert_features from espressomd.shapes import Wall import numpy assert_features(["ELECTROSTATICS", "MASS", "LENNARD_JONES"]) system = espressomd.System(box_l=[1.0, 1.0, 1.0]) system.seed = system.cell_system.get_state()['n_nodes'] * [1234] numpy.random.seed(system.seed) print("\n--->Setup system") # System parameters n_part = 500 n_ionpairs = n_part / 2 density = 1.1138 time_step = 0.001823 temp = 1198.3 gamma = 50 #l_bjerrum = 0.885^2 * e^2/(4*pi*epsilon_0*k_B*T) l_bjerrum = 130878.0 / temp num_steps_equilibration = 3000 num_configs = 500 integ_steps_per_config = 100 # Particle parameters types = {"Cl": 0, "Na": 1, "Electrode": 2} numbers = {"Cl": n_ionpairs, "Na": n_ionpairs} charges = {"Cl": -1.0, "Na": 1.0} lj_sigmas = {"Cl": 3.85, "Na": 2.52, "Electrode": 3.37} lj_epsilons = {"Cl": 192.45, "Na": 17.44, "Electrode": 24.72} lj_cuts = {"Cl": 3.0 * lj_sigmas["Cl"], "Na": 3.0 * lj_sigmas["Na"], "Electrode": 3.0 * lj_sigmas["Electrode"]} masses = {"Cl": 35.453, "Na": 22.99, "Electrode": 12.01} # Setup System box_l = (n_ionpairs * sum(masses.values()) / density)**(1. / 3.) box_z = box_l + 2.0 * (lj_sigmas["Electrode"]) box_volume = box_l * box_l * box_z elc_gap = box_z * 0.15 system.box_l = [box_l, box_l, box_z + elc_gap] system.periodicity = [True, True, True] system.time_step = time_step system.cell_system.skin = 0.3 system.thermostat.set_langevin(kT=temp, gamma=gamma, seed=42) # Uniform electric field between two parallel plates # E = V/d in units of V/m # E = V/d/k_b*e in units of eV/m Ez = 15 / (8.61733e-5 * box_z) # in units of eV/m # Walls system.constraints.add(shape=Wall(dist=0, normal=[0, 0, 1]), particle_type=types["Electrode"]) system.constraints.add(shape=Wall(dist=-box_z, normal=[0, 0, -1]), particle_type=types["Electrode"]) # Place particles for i in range(int(n_ionpairs)): p = numpy.random.random(3) * box_l p[2] += lj_sigmas["Electrode"] system.part.add(id=len(system.part), type=types["Cl"], pos=p, q=charges["Cl"], mass=masses["Cl"]) for i in range(int(n_ionpairs)): p = numpy.random.random(3) * box_l p[2] += lj_sigmas["Electrode"] system.part.add(id=len(system.part), type=types["Na"], pos=p, q=charges["Na"], mass=masses["Na"]) # Lennard-Jones interactions parameters def combination_rule_epsilon(rule, eps1, eps2): if rule == "Lorentz": return (eps1 * eps2)**0.5 else: return ValueError("No combination rule defined") def combination_rule_sigma(rule, sig1, sig2): if rule == "Berthelot": return (sig1 + sig2) * 0.5 else: return ValueError("No combination rule defined") for s in [["Cl", "Na"], ["Cl", "Cl"], ["Na", "Na"], ["Na", "Electrode"], ["Cl", "Electrode"]]: lj_sig = combination_rule_sigma( "Berthelot", lj_sigmas[s[0]], lj_sigmas[s[1]]) lj_cut = combination_rule_sigma("Berthelot", lj_cuts[s[0]], lj_cuts[s[1]]) lj_eps = combination_rule_epsilon( "Lorentz", lj_epsilons[s[0]], lj_epsilons[s[1]]) system.non_bonded_inter[types[s[0]], types[s[1]]].lennard_jones.set_params( epsilon=lj_eps, sigma=lj_sig, cutoff=lj_cut, shift="auto") energy = system.analysis.energy() print("Before Minimization: E_total=", energy['total']) system.minimize_energy.init( f_max=10, gamma=50.0, max_steps=1000, max_displacement=0.2) system.minimize_energy.minimize() energy = system.analysis.energy() print("After Minimization: E_total=", energy['total']) print("\n--->Tuning Electrostatics") p3m = electrostatics.P3M(prefactor=l_bjerrum, accuracy=1e-2) system.actors.add(p3m) elc = electrostatic_extensions.ELC(gap_size=elc_gap, maxPWerror=1e-3) system.actors.add(elc) for p in system.part: p.ext_force = [0, 0, p.q * Ez] print("\n--->Temperature Equilibration") system.time = 0.0 for i in range(int(num_steps_equilibration / 100)): energy = system.analysis.energy() temp_measured = energy['kinetic'] / ((3.0 / 2.0) * n_part) print("t={0:.1f}, E_total={1:.2f}, E_coulomb={2:.2f}, T_cur={3:.4f}" .format(system.time, energy['total'], energy['coulomb'], temp_measured)) system.integrator.run(100) print("\n--->Integration") bins = 100 z_dens_na = numpy.zeros(bins) z_dens_cl = numpy.zeros(bins) system.time = 0.0 cnt = 0 for i in range(num_configs): temp_measured = system.analysis.energy()['kinetic'] / ((3. / 2.) * n_part) print("t={0:.1f}, E_total={1:.2f}, E_coulomb={2:.2f}, T_cur={3:.4f}" .format(system.time, system.analysis.energy()['total'], system.analysis.energy()['coulomb'], temp_measured)) system.integrator.run(integ_steps_per_config) for p in system.part: bz = int(p.pos[2] / box_z * bins) if p.type == types["Na"]: z_dens_na[bz] += 1.0 elif p.type == types["Cl"]: z_dens_cl[bz] += 1.0 cnt += 1 print("\n--->Analysis") # Average / Normalize with Volume z_dens_na /= (cnt * box_volume / bins) z_dens_cl /= (cnt * box_volume / bins) z_values = numpy.linspace(0, box_l, num=bins) res = numpy.column_stack((z_values, z_dens_na, z_dens_cl)) numpy.savetxt("z_density.data", res, header="#z rho_na(z) rho_cl(z)") print("\n--->Written z_density.data") print("\n--->Done")
psci2195/espresso-ffans
doc/tutorials/02-charged_system/scripts/nacl_units_confined.py
Python
gpl-3.0
6,242
[ "ESPResSo" ]
9ccba70f156505e0395c192c05a57905d15ea132e8c201819dcfa6cafce5f298
# # @BEGIN LICENSE # # Psi4: an open-source quantum chemistry software package # # Copyright (c) 2007-2017 The Psi4 Developers. # # The copyrights for code used from other parties are included in # the corresponding files. # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; either version 2 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License along # with this program; if not, write to the Free Software Foundation, Inc., # 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA. # # @END LICENSE # """Elemental masses (most common isotope), symbols, and atomic numbers from psi4. """ _temp_element = ["GHOST", "HYDROGEN", "HELIUM", "LITHIUM", "BERYLLIUM", "BORON", "CARBON", "NITROGEN", "OXYGEN", "FLUORINE", "NEON", "SODIUM", "MAGNESIUM", "ALUMINUM", "SILICON", "PHOSPHORUS", "SULFUR", "CHLORINE", "ARGON", "POTASSIUM", "CALCIUM", "SCANDIUM", "TITANIUM", "VANADIUM", "CHROMIUM", "MANGANESE", "IRON", "COBALT", "NICKEL", "COPPER", "ZINC", "GALLIUM", "GERMANIUM", "ARSENIC", "SELENIUM", "BROMINE", "KRYPTON", "RUBIDIUM", "STRONTIUM", "YTTRIUM", "ZIRCONIUM", "NIOBIUM", "MOLYBDENUM", "TECHNETIUM", "RUTHENIUM", "RHODIUM", "PALLADIUM", "SILVER", "CADMIUM", "INDIUM", "TIN", "ANTIMONY", "TELLURIUM", "IODINE", "XENON", "CESIUM", "BARIUM", "LANTHANUM", "CERIUM", "PRASEODYMIUM", "NEODYMIUM", "PROMETHIUM", "SAMARIUM", "EUROPIUM", "GADOLINIUM", "TERBIUM", "DYSPROSIUM", "HOLMIUM", "ERBIUM", "THULIUM", "YTTERBIUM", "LUTETIUM", "HAFNIUM", "TANTALUM", "TUNGSTEN", "RHENIUM", "OSMIUM", "IRIDIUM", "PLATINUM", "GOLD", "MERCURY", "THALLIUM", "LEAD", "BISMUTH", "POLONIUM", "ASTATINE", "RADON", "FRANCIUM", "RADIUM", "ACTINIUM", "THORIUM", "PROTACTINIUM", "URANIUM", "NEPTUNIUM", "PLUTONIUM", "AMERICIUM", "CURIUM", "BERKELIUM", "CALIFORNIUM", "EINSTEINIUM", "FERMIUM", "MENDELEVIUM", "NOBELIUM", "LAWRENCIUM", "RUTHERFORDIUM", "DUBNIUM", "SEABORGIUM", "BOHRIUM"] _temp_symbol = ["X", "H", "HE", "LI", "BE", "B", "C", "N", "O", "F", "NE", "NA", "MG", "AL", "SI", "P", "S", "CL", "AR", "K", "CA", "SC", "TI", "V", "CR", "MN", "FE", "CO", "NI", "CU", "ZN", "GA", "GE", "AS", "SE", "BR", "KR", "RB", "SR", "Y", "ZR", "NB", "MO", "TC", "RU", "RH", "PD", "AG", "CD", "IN", "SN", "SB", "TE", "I", "XE", "CS", "BA", "LA", "CE", "PR", "ND", "PM", "SM", "EU", "GD", "TB", "DY", "HO", "ER", "TM", "YB", "LU", "HF", "TA", "W", "RE", "OS", "IR", "PT", "AU", "HG", "TL", "PB", "BI", "PO", "AT", "RN", "FR", "RA", "AC", "TH", "PA", "U", "NP", "PU", "AM", "CM", "BK", "CF", "ES", "FM", "MD", "NO", "LR", "RF", "DB", "SG", "BH", "HS", "MT", "DS", "RG", "UUB", "UUT", "UUQ", "UUP", "UUH", "UUS", "UUO"] _temp_z = list(range(0, 108)) _temp_mass = [ 0., 1.00782503207, 4.00260325415, 7.016004548, 9.012182201, 11.009305406, 12, 14.00307400478, 15.99491461956, 18.998403224, 19.99244017542, 22.98976928087, 23.985041699, 26.981538627, 27.97692653246, 30.973761629, 31.972070999, 34.968852682, 39.96238312251, 38.963706679, 39.962590983, 44.955911909, 47.947946281, 50.943959507, 51.940507472, 54.938045141, 55.934937475, 58.933195048, 57.935342907, 62.929597474, 63.929142222, 68.925573587, 73.921177767, 74.921596478, 79.916521271, 78.918337087, 85.910610729, 84.911789737, 87.905612124, 88.905848295, 89.904704416, 92.906378058, 97.905408169, 98.906254747, 101.904349312, 102.905504292, 105.903485715, 106.90509682, 113.90335854, 114.903878484, 119.902194676, 120.903815686, 129.906224399, 126.904472681, 131.904153457, 132.905451932, 137.905247237, 138.906353267, 139.905438706, 140.907652769, 141.907723297, 144.912749023, 151.919732425, 152.921230339, 157.924103912, 158.925346757, 163.929174751, 164.93032207, 165.930293061, 168.93421325, 173.938862089, 174.940771819, 179.946549953, 180.947995763, 183.950931188, 186.955753109, 191.96148069, 192.96292643, 194.964791134, 196.966568662, 201.970643011, 204.974427541, 207.976652071, 208.980398734, 208.982430435, 210.987496271, 222.017577738, 222.01755173, 228.031070292, 227.027752127, 232.038055325, 231.03588399, 238.050788247, 237.048173444, 242.058742611, 243.06138108, 247.07035354, 247.07030708, 251.079586788, 252.082978512, 257.095104724, 258.098431319, 255.093241131, 260.105504, 263.112547, 255.107398, 259.114500, 262.122892, 263.128558, 265.136151, 281.162061, 272.153615, 283.171792, 283.176451, 285.183698, 287.191186, 292.199786, 291.206564, 293.214670] _temp_iso_symbol = [ "H", "H1", "H2", "D", "H3", "T", "H4", "H5", "H6", "H7", "HE", "HE3", "HE4", "HE5", "HE6", "HE7", "HE8", "HE9", "HE10", "LI", "LI3", "LI4", "LI5", "LI6", "LI7", "LI8", "LI9", "LI10", "LI11", "LI12", "BE", "BE5", "BE6", "BE7", "BE8", "BE9", "BE10", "BE11", "BE12", "BE13", "BE14", "BE15", "BE16", "B", "B6", "B7", "B8", "B9", "B10", "B11", "B12", "B13", "B14", "B15", "B16", "B17", "B18", "B19", "C", "C8", "C9", "C10", "C11", "C12", "C13", "C14", "C15", "C16", "C17", "C18", "C19", "C20", "C21", "C22", "N", "N10", "N11", "N12", "N13", "N14", "N15", "N16", "N17", "N18", "N19", "N20", "N21", "N22", "N23", "N24", "N25", "O", "O12", "O13", "O14", "O15", "O16", "O17", "O18", "O19", "O20", "O21", "O22", "O23", "O24", "O25", "O26", "O27", "O28", "F", "F14", "F15", "F16", "F17", "F18", "F19", "F20", "F21", "F22", "F23", "F24", "F25", "F26", "F27", "F28", "F29", "F30", "F31", "NE", "NE16", "NE17", "NE18", "NE19", "NE20", "NE21", "NE22", "NE23", "NE24", "NE25", "NE26", "NE27", "NE28", "NE29", "NE30", "NE31", "NE32", "NE33", "NE34", "NA", "NA18", "NA19", "NA20", "NA21", "NA22", "NA23", "NA24", "NA25", "NA26", "NA27", "NA28", "NA29", "NA30", "NA31", "NA32", "NA33", "NA34", "NA35", "NA36", "NA37", "MG", "MG19", "MG20", "MG21", "MG22", "MG23", "MG24", "MG25", "MG26", "MG27", "MG28", "MG29", "MG30", "MG31", "MG32", "MG33", "MG34", "MG35", "MG36", "MG37", "MG38", "MG39", "MG40", "AL", "AL21", "AL22", "AL23", "AL24", "AL25", "AL26", "AL27", "AL28", "AL29", "AL30", "AL31", "AL32", "AL33", "AL34", "AL35", "AL36", "AL37", "AL38", "AL39", "AL40", "AL41", "AL42", "SI", "SI22", "SI23", "SI24", "SI25", "SI26", "SI27", "SI28", "SI29", "SI30", "SI31", "SI32", "SI33", "SI34", "SI35", "SI36", "SI37", "SI38", "SI39", "SI40", "SI41", "SI42", "SI43", "SI44", "P", "P24", "P25", "P26", "P27", "P28", "P29", "P30", "P31", "P32", "P33", "P34", "P35", "P36", "P37", "P38", "P39", "P40", "P41", "P42", "P43", "P44", "P45", "P46", "S", "S26", "S27", "S28", "S29", "S30", "S31", "S32", "S33", "S34", "S35", "S36", "S37", "S38", "S39", "S40", "S41", "S42", "S43", "S44", "S45", "S46", "S47", "S48", "S49", "CL", "CL28", "CL29", "CL30", "CL31", "CL32", "CL33", "CL34", "CL35", "CL36", "CL37", "CL38", "CL39", "CL40", "CL41", "CL42", "CL43", "CL44", "CL45", "CL46", "CL47", "CL48", "CL49", "CL50", "CL51", "AR", "AR30", "AR31", "AR32", "AR33", "AR34", "AR35", "AR36", "AR37", "AR38", "AR39", "AR40", "AR41", "AR42", "AR43", "AR44", "AR45", "AR46", "AR47", "AR48", "AR49", "AR50", "AR51", "AR52", "AR53", "K", "K32", "K33", "K34", "K35", "K36", "K37", "K38", "K39", "K40", "K41", "K42", "K43", "K44", "K45", "K46", "K47", "K48", "K49", "K50", "K51", "K52", "K53", "K54", "K55", "CA", "CA34", "CA35", "CA36", "CA37", "CA38", "CA39", "CA40", "CA41", "CA42", "CA43", "CA44", "CA45", "CA46", "CA47", "CA48", "CA49", "CA50", "CA51", "CA52", "CA53", "CA54", "CA55", "CA56", "CA57", "SC", "SC36", "SC37", "SC38", "SC39", "SC40", "SC41", "SC42", "SC43", "SC44", "SC45", "SC46", "SC47", "SC48", "SC49", "SC50", "SC51", "SC52", "SC53", "SC54", "SC55", "SC56", "SC57", "SC58", "SC59", "SC60", "TI", "TI38", "TI39", "TI40", "TI41", "TI42", "TI43", "TI44", "TI45", "TI46", "TI47", "TI48", "TI49", "TI50", "TI51", "TI52", "TI53", "TI54", "TI55", "TI56", "TI57", "TI58", "TI59", "TI60", "TI61", "TI62", "TI63", "V", "V40", "V41", "V42", "V43", "V44", "V45", "V46", "V47", "V48", "V49", "V50", "V51", "V52", "V53", "V54", "V55", "V56", "V57", "V58", "V59", "V60", "V61", "V62", "V63", "V64", "V65", "CR", "CR42", "CR43", "CR44", "CR45", "CR46", "CR47", "CR48", "CR49", "CR50", "CR51", "CR52", "CR53", "CR54", "CR55", "CR56", "CR57", "CR58", "CR59", "CR60", "CR61", "CR62", "CR63", "CR64", "CR65", "CR66", "CR67", "MN", "MN44", "MN45", "MN46", "MN47", "MN48", "MN49", "MN50", "MN51", "MN52", "MN53", "MN54", "MN55", "MN56", "MN57", "MN58", "MN59", "MN60", "MN61", "MN62", "MN63", "MN64", "MN65", "MN66", "MN67", "MN68", "MN69", "FE", "FE45", "FE46", "FE47", "FE48", "FE49", "FE50", "FE51", "FE52", "FE53", "FE54", "FE55", "FE56", "FE57", "FE58", "FE59", "FE60", "FE61", "FE62", "FE63", "FE64", "FE65", "FE66", "FE67", "FE68", "FE69", "FE70", "FE71", "FE72", "CO", "CO47", "CO48", "CO49", "CO50", "CO51", "CO52", "CO53", "CO54", "CO55", "CO56", "CO57", "CO58", "CO59", "CO60", "CO61", "CO62", "CO63", "CO64", "CO65", "CO66", "CO67", "CO68", "CO69", "CO70", "CO71", "CO72", "CO73", "CO74", "CO75", "NI", "NI48", "NI49", "NI50", "NI51", "NI52", "NI53", "NI54", "NI55", "NI56", "NI57", "NI58", "NI59", "NI60", "NI61", "NI62", "NI63", "NI64", "NI65", "NI66", "NI67", "NI68", "NI69", "NI70", "NI71", "NI72", "NI73", "NI74", "NI75", "NI76", "NI77", "NI78", "CU", "CU52", "CU53", "CU54", "CU55", "CU56", "CU57", "CU58", "CU59", "CU60", "CU61", "CU62", "CU63", "CU64", "CU65", "CU66", "CU67", "CU68", "CU69", "CU70", "CU71", "CU72", "CU73", "CU74", "CU75", "CU76", "CU77", "CU78", "CU79", "CU80", "ZN", "ZN54", "ZN55", "ZN56", "ZN57", "ZN58", "ZN59", "ZN60", "ZN61", "ZN62", "ZN63", "ZN64", "ZN65", "ZN66", "ZN67", "ZN68", "ZN69", "ZN70", "ZN71", "ZN72", "ZN73", "ZN74", "ZN75", "ZN76", "ZN77", "ZN78", "ZN79", "ZN80", "ZN81", "ZN82", "ZN83", "GA", "GA56", "GA57", "GA58", "GA59", "GA60", "GA61", "GA62", "GA63", "GA64", "GA65", "GA66", "GA67", "GA68", "GA69", "GA70", "GA71", "GA72", "GA73", "GA74", "GA75", "GA76", "GA77", "GA78", "GA79", "GA80", "GA81", "GA82", "GA83", "GA84", "GA85", "GA86", "GE", "GE58", "GE59", "GE60", "GE61", "GE62", "GE63", "GE64", "GE65", "GE66", "GE67", "GE68", "GE69", "GE70", "GE71", "GE72", "GE73", "GE74", "GE75", "GE76", "GE77", "GE78", "GE79", "GE80", "GE81", "GE82", "GE83", "GE84", "GE85", "GE86", "GE87", "GE88", "GE89", "AS", "AS60", "AS61", "AS62", "AS63", "AS64", "AS65", "AS66", "AS67", "AS68", "AS69", "AS70", "AS71", "AS72", "AS73", "AS74", "AS75", "AS76", "AS77", "AS78", "AS79", "AS80", "AS81", "AS82", "AS83", "AS84", "AS85", "AS86", "AS87", "AS88", "AS89", "AS90", "AS91", "AS92", "SE", "SE65", "SE66", "SE67", "SE68", "SE69", "SE70", "SE71", "SE72", "SE73", "SE74", "SE75", "SE76", "SE77", "SE78", "SE79", "SE80", "SE81", "SE82", "SE83", "SE84", "SE85", "SE86", "SE87", "SE88", "SE89", "SE90", "SE91", "SE92", "SE93", "SE94", "BR", "BR67", "BR68", "BR69", "BR70", "BR71", "BR72", "BR73", "BR74", "BR75", "BR76", "BR77", "BR78", "BR79", "BR80", "BR81", "BR82", "BR83", "BR84", "BR85", "BR86", "BR87", "BR88", "BR89", "BR90", "BR91", "BR92", "BR93", "BR94", "BR95", "BR96", "BR97", "KR", "KR69", "KR70", "KR71", "KR72", "KR73", "KR74", "KR75", "KR76", "KR77", "KR78", "KR79", "KR80", "KR81", "KR82", "KR83", "KR84", "KR85", "KR86", "KR87", "KR88", "KR89", "KR90", "KR91", "KR92", "KR93", "KR94", "KR95", "KR96", "KR97", "KR98", "KR99", "KR100", "RB", "RB71", "RB72", "RB73", "RB74", "RB75", "RB76", "RB77", "RB78", "RB79", "RB80", "RB81", "RB82", "RB83", "RB84", "RB85", "RB86", "RB87", "RB88", "RB89", "RB90", "RB91", "RB92", "RB93", "RB94", "RB95", "RB96", "RB97", "RB98", "RB99", "RB100", "RB101", "RB102", "SR", "SR73", "SR74", "SR75", "SR76", "SR77", "SR78", "SR79", "SR80", "SR81", "SR82", "SR83", "SR84", "SR85", "SR86", "SR87", "SR88", "SR89", "SR90", "SR91", "SR92", "SR93", "SR94", "SR95", "SR96", "SR97", "SR98", "SR99", "SR100", "SR101", "SR102", "SR103", "SR104", "SR105", "Y", "Y76", "Y77", "Y78", "Y79", "Y80", "Y81", "Y82", "Y83", "Y84", "Y85", "Y86", "Y87", "Y88", "Y89", "Y90", "Y91", "Y92", "Y93", "Y94", "Y95", "Y96", "Y97", "Y98", "Y99", "Y100", "Y101", "Y102", "Y103", "Y104", "Y105", "Y106", "Y107", "Y108", "ZR", "ZR78", "ZR79", "ZR80", "ZR81", "ZR82", "ZR83", "ZR84", "ZR85", "ZR86", "ZR87", "ZR88", "ZR89", "ZR90", "ZR91", "ZR92", "ZR93", "ZR94", "ZR95", "ZR96", "ZR97", "ZR98", "ZR99", "ZR100", "ZR101", "ZR102", "ZR103", "ZR104", "ZR105", "ZR106", "ZR107", "ZR108", "ZR109", "ZR110", "NB", "NB81", "NB82", "NB83", "NB84", "NB85", "NB86", "NB87", "NB88", "NB89", "NB90", "NB91", "NB92", "NB93", "NB94", "NB95", "NB96", "NB97", "NB98", "NB99", "NB100", "NB101", "NB102", "NB103", "NB104", "NB105", "NB106", "NB107", "NB108", "NB109", "NB110", "NB111", "NB112", "NB113", "MO", "MO83", "MO84", "MO85", "MO86", "MO87", "MO88", "MO89", "MO90", "MO91", "MO92", "MO93", "MO94", "MO95", "MO96", "MO97", "MO98", "MO99", "MO100", "MO101", "MO102", "MO103", "MO104", "MO105", "MO106", "MO107", "MO108", "MO109", "MO110", "MO111", "MO112", "MO113", "MO114", "MO115", "TC", "TC85", "TC86", "TC87", "TC88", "TC89", "TC90", "TC91", "TC92", "TC93", "TC94", "TC95", "TC96", "TC97", "TC98", "TC99", "TC100", "TC101", "TC102", "TC103", "TC104", "TC105", "TC106", "TC107", "TC108", "TC109", "TC110", "TC111", "TC112", "TC113", "TC114", "TC115", "TC116", "TC117", "TC118", "RU", "RU87", "RU88", "RU89", "RU90", "RU91", "RU92", "RU93", "RU94", "RU95", "RU96", "RU97", "RU98", "RU99", "RU100", "RU101", "RU102", "RU103", "RU104", "RU105", "RU106", "RU107", "RU108", "RU109", "RU110", "RU111", "RU112", "RU113", "RU114", "RU115", "RU116", "RU117", "RU118", "RU119", "RU120", "RH", "RH89", "RH90", "RH91", "RH92", "RH93", "RH94", "RH95", "RH96", "RH97", "RH98", "RH99", "RH100", "RH101", "RH102", "RH103", "RH104", "RH105", "RH106", "RH107", "RH108", "RH109", "RH110", "RH111", "RH112", "RH113", "RH114", "RH115", "RH116", "RH117", "RH118", "RH119", "RH120", "RH121", "RH122", "PD", "PD91", "PD92", "PD93", "PD94", "PD95", "PD96", "PD97", "PD98", "PD99", "PD100", "PD101", "PD102", "PD103", "PD104", "PD105", "PD106", "PD107", "PD108", "PD109", "PD110", "PD111", "PD112", "PD113", "PD114", "PD115", "PD116", "PD117", "PD118", "PD119", "PD120", "PD121", "PD122", "PD123", "PD124", "AG", "AG93", "AG94", "AG95", "AG96", "AG97", "AG98", "AG99", "AG100", "AG101", "AG102", "AG103", "AG104", "AG105", "AG106", "AG107", "AG108", "AG109", "AG110", "AG111", "AG112", "AG113", "AG114", "AG115", "AG116", "AG117", "AG118", "AG119", "AG120", "AG121", "AG122", "AG123", "AG124", "AG125", "AG126", "AG127", "AG128", "AG129", "AG130", "CD", "CD95", "CD96", "CD97", "CD98", "CD99", "CD100", "CD101", "CD102", "CD103", "CD104", "CD105", "CD106", "CD107", "CD108", "CD109", "CD110", "CD111", "CD112", "CD113", "CD114", "CD115", "CD116", "CD117", "CD118", "CD119", "CD120", "CD121", "CD122", "CD123", "CD124", "CD125", "CD126", "CD127", "CD128", "CD129", "CD130", "CD131", "CD132", "IN", "IN97", "IN98", "IN99", "IN100", "IN101", "IN102", "IN103", "IN104", "IN105", "IN106", "IN107", "IN108", "IN109", "IN110", "IN111", "IN112", "IN113", "IN114", "IN115", "IN116", "IN117", "IN118", "IN119", "IN120", "IN121", "IN122", "IN123", "IN124", "IN125", "IN126", "IN127", "IN128", "IN129", "IN130", "IN131", "IN132", "IN133", "IN134", "IN135", "SN", "SN99", "SN100", "SN101", "SN102", "SN103", "SN104", "SN105", "SN106", "SN107", "SN108", "SN109", "SN110", "SN111", "SN112", "SN113", "SN114", "SN115", "SN116", "SN117", "SN118", "SN119", "SN120", "SN121", "SN122", "SN123", "SN124", "SN125", "SN126", "SN127", "SN128", "SN129", "SN130", "SN131", "SN132", "SN133", "SN134", "SN135", "SN136", "SN137", "SB", "SB103", "SB104", "SB105", "SB106", "SB107", "SB108", "SB109", "SB110", "SB111", "SB112", "SB113", "SB114", "SB115", "SB116", "SB117", "SB118", "SB119", "SB120", "SB121", "SB122", "SB123", "SB124", "SB125", "SB126", "SB127", "SB128", "SB129", "SB130", "SB131", "SB132", "SB133", "SB134", "SB135", "SB136", "SB137", "SB138", "SB139", "TE", "TE105", "TE106", "TE107", "TE108", "TE109", "TE110", "TE111", "TE112", "TE113", "TE114", "TE115", "TE116", "TE117", "TE118", "TE119", "TE120", "TE121", "TE122", "TE123", "TE124", "TE125", "TE126", "TE127", "TE128", "TE129", "TE130", "TE131", "TE132", "TE133", "TE134", "TE135", "TE136", "TE137", "TE138", "TE139", "TE140", "TE141", "TE142", "I", "I108", "I109", "I110", "I111", "I112", "I113", "I114", "I115", "I116", "I117", "I118", "I119", "I120", "I121", "I122", "I123", "I124", "I125", "I126", "I127", "I128", "I129", "I130", "I131", "I132", "I133", "I134", "I135", "I136", "I137", "I138", "I139", "I140", "I141", "I142", "I143", "I144", "XE", "XE110", "XE111", "XE112", "XE113", "XE114", "XE115", "XE116", "XE117", "XE118", "XE119", "XE120", "XE121", "XE122", "XE123", "XE124", "XE125", "XE126", "XE127", "XE128", "XE129", "XE130", "XE131", "XE132", "XE133", "XE134", "XE135", "XE136", "XE137", "XE138", "XE139", "XE140", "XE141", "XE142", "XE143", "XE144", "XE145", "XE146", "XE147", "CS", "CS112", "CS113", "CS114", "CS115", "CS116", "CS117", "CS118", "CS119", "CS120", "CS121", "CS122", "CS123", "CS124", "CS125", "CS126", "CS127", "CS128", "CS129", "CS130", "CS131", "CS132", "CS133", "CS134", "CS135", "CS136", "CS137", "CS138", "CS139", "CS140", "CS141", "CS142", "CS143", "CS144", "CS145", "CS146", "CS147", "CS148", "CS149", "CS150", "CS151", "BA", "BA114", "BA115", "BA116", "BA117", "BA118", "BA119", "BA120", "BA121", "BA122", "BA123", "BA124", "BA125", "BA126", "BA127", "BA128", "BA129", "BA130", "BA131", "BA132", "BA133", "BA134", "BA135", "BA136", "BA137", "BA138", "BA139", "BA140", "BA141", "BA142", "BA143", "BA144", "BA145", "BA146", "BA147", "BA148", "BA149", "BA150", "BA151", "BA152", "BA153", "LA", "LA117", "LA118", "LA119", "LA120", "LA121", "LA122", "LA123", "LA124", "LA125", "LA126", "LA127", "LA128", "LA129", "LA130", "LA131", "LA132", "LA133", "LA134", "LA135", "LA136", "LA137", "LA138", "LA139", "LA140", "LA141", "LA142", "LA143", "LA144", "LA145", "LA146", "LA147", "LA148", "LA149", "LA150", "LA151", "LA152", "LA153", "LA154", "LA155", "CE", "CE119", "CE120", "CE121", "CE122", "CE123", "CE124", "CE125", "CE126", "CE127", "CE128", "CE129", "CE130", "CE131", "CE132", "CE133", "CE134", "CE135", "CE136", "CE137", "CE138", "CE139", "CE140", "CE141", "CE142", "CE143", "CE144", "CE145", "CE146", "CE147", "CE148", "CE149", "CE150", "CE151", "CE152", "CE153", "CE154", "CE155", "CE156", "CE157", "PR", "PR121", "PR122", "PR123", "PR124", "PR125", "PR126", "PR127", "PR128", "PR129", "PR130", "PR131", "PR132", "PR133", "PR134", "PR135", "PR136", "PR137", "PR138", "PR139", "PR140", "PR141", "PR142", "PR143", "PR144", "PR145", "PR146", "PR147", "PR148", "PR149", "PR150", "PR151", "PR152", "PR153", "PR154", "PR155", "PR156", "PR157", "PR158", "PR159", "ND", "ND124", "ND125", "ND126", "ND127", "ND128", "ND129", "ND130", "ND131", "ND132", "ND133", "ND134", "ND135", "ND136", "ND137", "ND138", "ND139", "ND140", "ND141", "ND142", "ND143", "ND144", "ND145", "ND146", "ND147", "ND148", "ND149", "ND150", "ND151", "ND152", "ND153", "ND154", "ND155", "ND156", "ND157", "ND158", "ND159", "ND160", "ND161", "PM", "PM126", "PM127", "PM128", "PM129", "PM130", "PM131", "PM132", "PM133", "PM134", "PM135", "PM136", "PM137", "PM138", "PM139", "PM140", "PM141", "PM142", "PM143", "PM144", "PM145", "PM146", "PM147", "PM148", "PM149", "PM150", "PM151", "PM152", "PM153", "PM154", "PM155", "PM156", "PM157", "PM158", "PM159", "PM160", "PM161", "PM162", "PM163", "SM", "SM128", "SM129", "SM130", "SM131", "SM132", "SM133", "SM134", "SM135", "SM136", "SM137", "SM138", "SM139", "SM140", "SM141", "SM142", "SM143", "SM144", "SM145", "SM146", "SM147", "SM148", "SM149", "SM150", "SM151", "SM152", "SM153", "SM154", "SM155", "SM156", "SM157", "SM158", "SM159", "SM160", "SM161", "SM162", "SM163", "SM164", "SM165", "EU", "EU130", "EU131", "EU132", "EU133", "EU134", "EU135", "EU136", "EU137", "EU138", "EU139", "EU140", "EU141", "EU142", "EU143", "EU144", "EU145", "EU146", "EU147", "EU148", "EU149", "EU150", "EU151", "EU152", "EU153", "EU154", "EU155", "EU156", "EU157", "EU158", "EU159", "EU160", "EU161", "EU162", "EU163", "EU164", "EU165", "EU166", "EU167", "GD", "GD134", "GD135", "GD136", "GD137", "GD138", "GD139", "GD140", "GD141", "GD142", "GD143", "GD144", "GD145", "GD146", "GD147", "GD148", "GD149", "GD150", "GD151", "GD152", "GD153", "GD154", "GD155", "GD156", "GD157", "GD158", "GD159", "GD160", "GD161", "GD162", "GD163", "GD164", "GD165", "GD166", "GD167", "GD168", "GD169", "TB", "TB136", "TB137", "TB138", "TB139", "TB140", "TB141", "TB142", "TB143", "TB144", "TB145", "TB146", "TB147", "TB148", "TB149", "TB150", "TB151", "TB152", "TB153", "TB154", "TB155", "TB156", "TB157", "TB158", "TB159", "TB160", "TB161", "TB162", "TB163", "TB164", "TB165", "TB166", "TB167", "TB168", "TB169", "TB170", "TB171", "DY", "DY138", "DY139", "DY140", "DY141", "DY142", "DY143", "DY144", "DY145", "DY146", "DY147", "DY148", "DY149", "DY150", "DY151", "DY152", "DY153", "DY154", "DY155", "DY156", "DY157", "DY158", "DY159", "DY160", "DY161", "DY162", "DY163", "DY164", "DY165", "DY166", "DY167", "DY168", "DY169", "DY170", "DY171", "DY172", "DY173", "HO", "HO140", "HO141", "HO142", "HO143", "HO144", "HO145", "HO146", "HO147", "HO148", "HO149", "HO150", "HO151", "HO152", "HO153", "HO154", "HO155", "HO156", "HO157", "HO158", "HO159", "HO160", "HO161", "HO162", "HO163", "HO164", "HO165", "HO166", "HO167", "HO168", "HO169", "HO170", "HO171", "HO172", "HO173", "HO174", "HO175", "ER", "ER143", "ER144", "ER145", "ER146", "ER147", "ER148", "ER149", "ER150", "ER151", "ER152", "ER153", "ER154", "ER155", "ER156", "ER157", "ER158", "ER159", "ER160", "ER161", "ER162", "ER163", "ER164", "ER165", "ER166", "ER167", "ER168", "ER169", "ER170", "ER171", "ER172", "ER173", "ER174", "ER175", "ER176", "ER177", "TM", "TM145", "TM146", "TM147", "TM148", "TM149", "TM150", "TM151", "TM152", "TM153", "TM154", "TM155", "TM156", "TM157", "TM158", "TM159", "TM160", "TM161", "TM162", "TM163", "TM164", "TM165", "TM166", "TM167", "TM168", "TM169", "TM170", "TM171", "TM172", "TM173", "TM174", "TM175", "TM176", "TM177", "TM178", "TM179", "YB", "YB148", "YB149", "YB150", "YB151", "YB152", "YB153", "YB154", "YB155", "YB156", "YB157", "YB158", "YB159", "YB160", "YB161", "YB162", "YB163", "YB164", "YB165", "YB166", "YB167", "YB168", "YB169", "YB170", "YB171", "YB172", "YB173", "YB174", "YB175", "YB176", "YB177", "YB178", "YB179", "YB180", "YB181", "LU", "LU150", "LU151", "LU152", "LU153", "LU154", "LU155", "LU156", "LU157", "LU158", "LU159", "LU160", "LU161", "LU162", "LU163", "LU164", "LU165", "LU166", "LU167", "LU168", "LU169", "LU170", "LU171", "LU172", "LU173", "LU174", "LU175", "LU176", "LU177", "LU178", "LU179", "LU180", "LU181", "LU182", "LU183", "LU184", "HF", "HF153", "HF154", "HF155", "HF156", "HF157", "HF158", "HF159", "HF160", "HF161", "HF162", "HF163", "HF164", "HF165", "HF166", "HF167", "HF168", "HF169", "HF170", "HF171", "HF172", "HF173", "HF174", "HF175", "HF176", "HF177", "HF178", "HF179", "HF180", "HF181", "HF182", "HF183", "HF184", "HF185", "HF186", "HF187", "HF188", "TA", "TA155", "TA156", "TA157", "TA158", "TA159", "TA160", "TA161", "TA162", "TA163", "TA164", "TA165", "TA166", "TA167", "TA168", "TA169", "TA170", "TA171", "TA172", "TA173", "TA174", "TA175", "TA176", "TA177", "TA178", "TA179", "TA180", "TA181", "TA182", "TA183", "TA184", "TA185", "TA186", "TA187", "TA188", "TA189", "TA190", "W", "W158", "W159", "W160", "W161", "W162", "W163", "W164", "W165", "W166", "W167", "W168", "W169", "W170", "W171", "W172", "W173", "W174", "W175", "W176", "W177", "W178", "W179", "W180", "W181", "W182", "W183", "W184", "W185", "W186", "W187", "W188", "W189", "W190", "W191", "W192", "RE", "RE160", "RE161", "RE162", "RE163", "RE164", "RE165", "RE166", "RE167", "RE168", "RE169", "RE170", "RE171", "RE172", "RE173", "RE174", "RE175", "RE176", "RE177", "RE178", "RE179", "RE180", "RE181", "RE182", "RE183", "RE184", "RE185", "RE186", "RE187", "RE188", "RE189", "RE190", "RE191", "RE192", "RE193", "RE194", "OS", "OS162", "OS163", "OS164", "OS165", "OS166", "OS167", "OS168", "OS169", "OS170", "OS171", "OS172", "OS173", "OS174", "OS175", "OS176", "OS177", "OS178", "OS179", "OS180", "OS181", "OS182", "OS183", "OS184", "OS185", "OS186", "OS187", "OS188", "OS189", "OS190", "OS191", "OS192", "OS193", "OS194", "OS195", "OS196", "IR", "IR164", "IR165", "IR166", "IR167", "IR168", "IR169", "IR170", "IR171", "IR172", "IR173", "IR174", "IR175", "IR176", "IR177", "IR178", "IR179", "IR180", "IR181", "IR182", "IR183", "IR184", "IR185", "IR186", "IR187", "IR188", "IR189", "IR190", "IR191", "IR192", "IR193", "IR194", "IR195", "IR196", "IR197", "IR198", "IR199", "PT", "PT166", "PT167", "PT168", "PT169", "PT170", "PT171", "PT172", "PT173", "PT174", "PT175", "PT176", "PT177", "PT178", "PT179", "PT180", "PT181", "PT182", "PT183", "PT184", "PT185", "PT186", "PT187", "PT188", "PT189", "PT190", "PT191", "PT192", "PT193", "PT194", "PT195", "PT196", "PT197", "PT198", "PT199", "PT200", "PT201", "PT202", "AU", "AU169", "AU170", "AU171", "AU172", "AU173", "AU174", "AU175", "AU176", "AU177", "AU178", "AU179", "AU180", "AU181", "AU182", "AU183", "AU184", "AU185", "AU186", "AU187", "AU188", "AU189", "AU190", "AU191", "AU192", "AU193", "AU194", "AU195", "AU196", "AU197", "AU198", "AU199", "AU200", "AU201", "AU202", "AU203", "AU204", "AU205", "HG", "HG171", "HG172", "HG173", "HG174", "HG175", "HG176", "HG177", "HG178", "HG179", "HG180", "HG181", "HG182", "HG183", "HG184", "HG185", "HG186", "HG187", "HG188", "HG189", "HG190", "HG191", "HG192", "HG193", "HG194", "HG195", "HG196", "HG197", "HG198", "HG199", "HG200", "HG201", "HG202", "HG203", "HG204", "HG205", "HG206", "HG207", "HG208", "HG209", "HG210", "TL", "TL176", "TL177", "TL178", "TL179", "TL180", "TL181", "TL182", "TL183", "TL184", "TL185", "TL186", "TL187", "TL188", "TL189", "TL190", "TL191", "TL192", "TL193", "TL194", "TL195", "TL196", "TL197", "TL198", "TL199", "TL200", "TL201", "TL202", "TL203", "TL204", "TL205", "TL206", "TL207", "TL208", "TL209", "TL210", "TL211", "TL212", "PB", "PB178", "PB179", "PB180", "PB181", "PB182", "PB183", "PB184", "PB185", "PB186", "PB187", "PB188", "PB189", "PB190", "PB191", "PB192", "PB193", "PB194", "PB195", "PB196", "PB197", "PB198", "PB199", "PB200", "PB201", "PB202", "PB203", "PB204", "PB205", "PB206", "PB207", "PB208", "PB209", "PB210", "PB211", "PB212", "PB213", "PB214", "PB215", "BI", "BI184", "BI185", "BI186", "BI187", "BI188", "BI189", "BI190", "BI191", "BI192", "BI193", "BI194", "BI195", "BI196", "BI197", "BI198", "BI199", "BI200", "BI201", "BI202", "BI203", "BI204", "BI205", "BI206", "BI207", "BI208", "BI209", "BI210", "BI211", "BI212", "BI213", "BI214", "BI215", "BI216", "BI217", "BI218", "PO", "PO188", "PO189", "PO190", "PO191", "PO192", "PO193", "PO194", "PO195", "PO196", "PO197", "PO198", "PO199", "PO200", "PO201", "PO202", "PO203", "PO204", "PO205", "PO206", "PO207", "PO208", "PO209", "PO210", "PO211", "PO212", "PO213", "PO214", "PO215", "PO216", "PO217", "PO218", "PO219", "PO220", "AT", "AT193", "AT194", "AT195", "AT196", "AT197", "AT198", "AT199", "AT200", "AT201", "AT202", "AT203", "AT204", "AT205", "AT206", "AT207", "AT208", "AT209", "AT210", "AT211", "AT212", "AT213", "AT214", "AT215", "AT216", "AT217", "AT218", "AT219", "AT220", "AT221", "AT222", "AT223", "RN", "RN195", "RN196", "RN197", "RN198", "RN199", "RN200", "RN201", "RN202", "RN203", "RN204", "RN205", "RN206", "RN207", "RN208", "RN209", "RN210", "RN211", "RN212", "RN213", "RN214", "RN215", "RN216", "RN217", "RN218", "RN219", "RN220", "RN221", "RN222", "RN223", "RN224", "RN225", "RN226", "RN227", "RN228", "FR", "FR199", "FR200", "FR201", "FR202", "FR203", "FR204", "FR205", "FR206", "FR207", "FR208", "FR209", "FR210", "FR211", "FR212", "FR213", "FR214", "FR215", "FR216", "FR217", "FR218", "FR219", "FR220", "FR221", "FR222", "FR223", "FR224", "FR225", "FR226", "FR227", "FR228", "FR229", "FR230", "FR231", "FR232", "RA", "RA202", "RA203", "RA204", "RA205", "RA206", "RA207", "RA208", "RA209", "RA210", "RA211", "RA212", "RA213", "RA214", "RA215", "RA216", "RA217", "RA218", "RA219", "RA220", "RA221", "RA222", "RA223", "RA224", "RA225", "RA226", "RA227", "RA228", "RA229", "RA230", "RA231", "RA232", "RA233", "RA234", "AC", "AC206", "AC207", "AC208", "AC209", "AC210", "AC211", "AC212", "AC213", "AC214", "AC215", "AC216", "AC217", "AC218", "AC219", "AC220", "AC221", "AC222", "AC223", "AC224", "AC225", "AC226", "AC227", "AC228", "AC229", "AC230", "AC231", "AC232", "AC233", "AC234", "AC235", "AC236", "TH", "TH209", "TH210", "TH211", "TH212", "TH213", "TH214", "TH215", "TH216", "TH217", "TH218", "TH219", "TH220", "TH221", "TH222", "TH223", "TH224", "TH225", "TH226", "TH227", "TH228", "TH229", "TH230", "TH231", "TH232", "TH233", "TH234", "TH235", "TH236", "TH237", "TH238", "PA", "PA212", "PA213", "PA214", "PA215", "PA216", "PA217", "PA218", "PA219", "PA220", "PA221", "PA222", "PA223", "PA224", "PA225", "PA226", "PA227", "PA228", "PA229", "PA230", "PA231", "PA232", "PA233", "PA234", "PA235", "PA236", "PA237", "PA238", "PA239", "PA240", "U", "U217", "U218", "U219", "U220", "U221", "U222", "U223", "U224", "U225", "U226", "U227", "U228", "U229", "U230", "U231", "U232", "U233", "U234", "U235", "U236", "U237", "U238", "U239", "U240", "U241", "U242", "NP", "NP225", "NP226", "NP227", "NP228", "NP229", "NP230", "NP231", "NP232", "NP233", "NP234", "NP235", "NP236", "NP237", "NP238", "NP239", "NP240", "NP241", "NP242", "NP243", "NP244", "PU", "PU228", "PU229", "PU230", "PU231", "PU232", "PU233", "PU234", "PU235", "PU236", "PU237", "PU238", "PU239", "PU240", "PU241", "PU242", "PU243", "PU244", "PU245", "PU246", "PU247", "AM", "AM231", "AM232", "AM233", "AM234", "AM235", "AM236", "AM237", "AM238", "AM239", "AM240", "AM241", "AM242", "AM243", "AM244", "AM245", "AM246", "AM247", "AM248", "AM249", "CM", "CM233", "CM234", "CM235", "CM236", "CM237", "CM238", "CM239", "CM240", "CM241", "CM242", "CM243", "CM244", "CM245", "CM246", "CM247", "CM248", "CM249", "CM250", "CM251", "CM252", "BK", "BK235", "BK236", "BK237", "BK238", "BK239", "BK240", "BK241", "BK242", "BK243", "BK244", "BK245", "BK246", "BK247", "BK248", "BK249", "BK250", "BK251", "BK252", "BK253", "BK254", "CF", "CF237", "CF238", "CF239", "CF240", "CF241", "CF242", "CF243", "CF244", "CF245", "CF246", "CF247", "CF248", "CF249", "CF250", "CF251", "CF252", "CF253", "CF254", "CF255", "CF256", "ES", "ES240", "ES241", "ES242", "ES243", "ES244", "ES245", "ES246", "ES247", "ES248", "ES249", "ES250", "ES251", "ES252", "ES253", "ES254", "ES255", "ES256", "ES257", "ES258", "FM", "FM242", "FM243", "FM244", "FM245", "FM246", "FM247", "FM248", "FM249", "FM250", "FM251", "FM252", "FM253", "FM254", "FM255", "FM256", "FM257", "FM258", "FM259", "FM260", "MD", "MD245", "MD246", "MD247", "MD248", "MD249", "MD250", "MD251", "MD252", "MD253", "MD254", "MD255", "MD256", "MD257", "MD258", "MD259", "MD260", "MD261", "MD262", "NO", "NO248", "NO249", "NO250", "NO251", "NO252", "NO253", "NO254", "NO255", "NO256", "NO257", "NO258", "NO259", "NO260", "NO261", "NO262", "NO263", "NO264", "LR", "LR251", "LR252", "LR253", "LR254", "LR255", "LR256", "LR257", "LR258", "LR259", "LR260", "LR261", "LR262", "LR263", "LR264", "LR265", "LR266", "RF", "RF253", "RF254", "RF255", "RF256", "RF257", "RF258", "RF259", "RF260", "RF261", "RF262", "RF263", "RF264", "RF265", "RF266", "RF267", "RF268", "DB", "DB255", "DB256", "DB257", "DB258", "DB259", "DB260", "DB261", "DB262", "DB263", "DB264", "DB265", "DB266", "DB267", "DB268", "DB269", "DB270", "SG", "SG258", "SG259", "SG260", "SG261", "SG262", "SG263", "SG264", "SG265", "SG266", "SG267", "SG268", "SG269", "SG270", "SG271", "SG272", "SG273", "BH", "BH260", "BH261", "BH262", "BH263", "BH264", "BH265", "BH266", "BH267", "BH268", "BH269", "BH270", "BH271", "BH272", "BH273", "BH274", "BH275", "HS", "HS263", "HS264", "HS265", "HS266", "HS267", "HS268", "HS269", "HS270", "HS271", "HS272", "HS273", "HS274", "HS275", "HS276", "HS277", "MT", "MT265", "MT266", "MT267", "MT268", "MT269", "MT270", "MT271", "MT272", "MT273", "MT274", "MT275", "MT276", "MT277", "MT278", "MT279", "DS", "DS267", "DS268", "DS269", "DS270", "DS271", "DS272", "DS273", "DS274", "DS275", "DS276", "DS277", "DS278", "DS279", "DS280", "DS281", "RG", "RG272", "RG273", "RG274", "RG275", "RG276", "RG277", "RG278", "RG279", "RG280", "RG281", "RG282", "RG283", "UUB", "UUB277", "UUB278", "UUB279", "UUB280", "UUB281", "UUB282", "UUB283", "UUB284", "UUB285", "UUT", "UUT283", "UUT284", "UUT285", "UUT286", "UUT287", "UUQ", "UUQ285", "UUQ286", "UUQ287", "UUQ288", "UUQ289", "UUP", "UUP287", "UUP288", "UUP289", "UUP290", "UUP291", "UUH", "UUH289", "UUH290", "UUH291", "UUH292", "UUS", "UUS291", "UUS292", "UUO", "UUO293"] _temp_iso_mass = [ 1.00782503207, 1.00782503207, 2.01410177785, 2.01410177785, 3.01604927767, 3.01604927767, 4.027806424, 5.035311488, 6.044942594, 7.052749, 4.00260325415, 3.01602931914, 4.00260325415, 5.012223624, 6.018889124, 7.028020618, 8.033921897, 9.043950286, 10.052398837, 7.016004548, 3.030775, 4.027185558, 5.0125378, 6.015122794, 7.016004548, 8.022487362, 9.026789505, 10.035481259, 11.043797715, 12.053780, 9.012182201, 5.040790, 6.019726317, 7.016929828, 8.005305103, 9.012182201, 10.013533818, 11.021657749, 12.026920737, 13.035693007, 14.04289292, 15.053460, 16.061920, 11.009305406, 6.046810, 7.029917901, 8.024607233, 9.013328782, 10.012936992, 11.009305406, 12.014352104, 13.017780217, 14.025404009, 15.031103021, 16.039808829, 17.046989906, 18.056170, 19.063730, 12, 8.037675025, 9.031036689, 10.016853228, 11.011433613, 12, 13.00335483778, 14.0032419887, 15.010599256, 16.014701252, 17.022586116, 18.026759354, 19.034805018, 20.040319754, 21.049340, 22.057200, 14.00307400478, 10.041653674, 11.026090956, 12.018613197, 13.005738609, 14.00307400478, 15.00010889823, 16.006101658, 17.008450261, 18.014078959, 19.017028697, 20.023365807, 21.02710824, 22.034394934, 23.041220, 24.051040, 25.060660, 15.99491461956, 12.034404895, 13.024812213, 14.00859625, 15.003065617, 15.99491461956, 16.999131703, 17.999161001, 19.00358013, 20.004076742, 21.008655886, 22.009966947, 23.015687659, 24.020472917, 25.029460, 26.038340, 27.048260, 28.057810, 18.998403224, 14.035060, 15.018009103, 16.011465724, 17.002095237, 18.000937956, 18.998403224, 19.999981315, 20.999948951, 22.002998815, 23.003574631, 24.008115485, 25.012101747, 26.019615555, 27.026760086, 28.035670, 29.043260, 30.052500, 31.060429, 19.99244017542, 16.025761262, 17.017671504, 18.005708213, 19.001880248, 19.99244017542, 20.993846684, 21.991385113, 22.994466904, 23.993610779, 24.997736888, 26.000461206, 27.007589903, 28.012071575, 29.019385933, 30.024801045, 31.033110, 32.040020, 33.049380, 34.057028, 22.98976928087, 18.025969, 19.013877499, 20.007351328, 20.997655206, 21.994436425, 22.98976928087, 23.990962782, 24.989953968, 25.992633, 26.994076788, 27.998938, 29.002861, 30.008976, 31.013585452, 32.02046656, 33.026719756, 34.035170, 35.042493, 36.051480, 37.059340, 23.985041699, 19.03547, 20.018862545, 21.01171291, 21.999573843, 22.994123669, 23.985041699, 24.985836917, 25.982592929, 26.984340585, 27.983876825, 28.9886, 29.990434, 30.996546, 31.998975, 33.005254, 34.009456424, 35.017340, 36.023000, 37.031400, 38.037570, 39.046772, 40.053930, 26.981538627, 21.028040, 22.019520, 23.007267432, 23.999938865, 24.990428095, 25.986891692, 26.981538627, 27.981910306, 28.980445046, 29.982960256, 30.983946619, 31.988124489, 32.990843336, 33.996851837, 34.999860235, 36.006207204, 37.01067782, 38.017231021, 39.02297, 40.031450, 41.038330, 42.046890, 27.97692653246, 22.034530, 23.025520, 24.011545616, 25.004105574, 25.992329921, 26.986704905, 27.97692653246, 28.9764947, 29.973770171, 30.975363226999998, 31.974148082, 32.97800022, 33.978575524, 34.984583575, 35.986599477, 36.99293608, 37.995633601, 39.002070013, 40.005869121, 41.01456, 42.019790, 43.028660, 44.035260, 30.973761629, 24.034350, 25.020260, 26.011780, 26.999230236, 27.992314761, 28.981800606, 29.978313789, 30.973761629, 31.973907274, 32.971725543, 33.973636257, 34.973314117, 35.97825968, 36.979608946, 37.984156827, 38.986179475, 39.991296951, 40.994335435, 42.001007913, 43.00619, 44.012990, 45.019220, 46.027380, 31.972070999, 26.027880, 27.018833, 28.004372763, 28.996608049, 29.984903249, 30.979554728, 31.972070999, 32.971458759, 33.967866902, 34.969032161, 35.96708076, 36.971125567, 37.971163317, 38.975134306, 39.975451728, 40.979582149, 41.981022419, 42.98715479, 43.99021339, 44.996508112, 46.000750, 47.008590, 48.014170, 49.023619, 34.968852682, 28.028510, 29.014110, 30.004770, 30.992413086, 31.985689901, 32.977451887, 33.973762819, 34.968852682, 35.968306981, 36.965902591, 37.968010425, 38.968008164, 39.970415472, 40.970684525, 41.973254804, 42.974054403, 43.978281071, 44.980286886, 45.98421004, 46.988710, 47.994950, 49.000320, 50.007840, 51.014490, 39.96238312251, 30.021560, 31.012123, 31.997637984, 32.989925709, 33.980271244, 34.975257585, 35.967545105, 36.96677632, 37.962732394, 38.964313231, 39.96238312251, 40.964500611, 41.963045736, 42.965636056, 43.964924033, 44.968039956, 45.968094129, 46.972186792, 47.974540, 48.980520, 49.984430, 50.991630, 51.996780, 53.004940, 38.963706679, 32.021920, 33.007260, 33.998410, 34.988009692, 35.981292235, 36.973375889, 37.969081184, 38.963706679, 39.963998475, 40.961825762, 41.96240281, 42.96071554, 43.961556804, 44.960699493, 45.961976864, 46.961678473, 47.965513535, 48.967450928, 49.972783355, 50.976380, 51.982610, 52.987120, 53.994200, 54.999710, 39.962590983, 34.014120, 35.004940, 35.993087063, 36.985870269, 37.976318452, 38.970719725, 39.962590983, 40.962278062, 41.958618014, 42.958766628, 43.955481754, 44.956186566, 45.953692587, 46.954546006, 47.952534177, 48.955674148, 49.957518962, 50.961499214, 51.9651, 52.970050, 53.974350, 54.980550, 55.985570, 56.992356, 44.955911909, 36.014920, 37.003050, 37.994700, 38.984790002, 39.977967407, 40.969251125, 41.965516429, 42.961150658, 43.959402752, 44.955911909, 45.95517189, 46.952407508, 47.952231468, 48.950023975, 49.952187685, 50.953603368, 51.956675468, 52.959610, 53.963264561, 54.968243949, 55.972870, 56.977790, 57.983710, 58.989220, 59.995710, 47.947946281, 38.009770, 39.001610, 39.990498838, 40.983145, 41.973030902, 42.968522499, 43.959690069, 44.958125616, 45.952631555, 46.951763088, 47.947946281, 48.947869982, 49.944791194, 50.946614955, 51.946897311, 52.949727171, 53.951052401, 54.955265056, 55.958199639, 56.963989137, 57.966970, 58.972930, 59.976760, 60.983200, 61.987490, 62.994420, 50.943959507, 40.011090, 40.999780, 41.991230, 42.980650, 43.97411, 44.965775808, 45.960200481, 46.95490894, 47.952253707, 48.948516101, 49.947158485, 50.943959507, 51.944775479, 52.944337979, 53.946439854, 54.947233701, 55.950530966, 56.952561432, 57.956834136, 58.960207407, 59.965026862, 60.968480, 61.973780, 62.977550, 63.983470, 64.987920, 51.940507472, 42.006430, 42.997710, 43.985549, 44.97964, 45.968358635, 46.962900046, 47.954031716, 48.951335721, 49.946044205, 50.944767431, 51.940507472, 52.940649386, 53.938880395, 54.940839672, 55.940653139, 56.943613013, 57.944353129, 58.948586367, 59.950076033, 60.954717204, 61.95661319, 62.961860, 63.964410, 64.970160, 65.973380, 66.979550, 54.938045141, 44.006870, 44.994510, 45.986720, 46.976100, 47.96852, 48.959618005, 49.95423823, 50.948210787, 51.945565464, 52.941290117, 53.940358854, 54.938045141, 55.93890491, 56.938285378, 57.939981549, 58.940440237, 59.942911246, 60.944652638, 61.94842822, 62.95023999, 63.95424909, 64.956336065, 65.961080, 66.964140, 67.969300, 68.972840, 55.934937475, 45.014578, 46.000810, 46.992890, 47.980504, 48.973610, 49.962988982, 50.956819538, 51.948113875, 52.945307942, 53.939610501, 54.938293357, 55.934937475, 56.935393969, 57.933275558, 58.934875464, 59.934071683, 60.936745281, 61.936767442, 62.940369091, 63.941201265, 64.94538027, 65.946780638, 66.950947244, 67.9537, 68.958780, 69.961460, 70.966720, 71.969620, 58.933195048, 47.011490, 48.001760, 48.989720, 49.981540, 50.970720, 51.963590, 52.954218896, 53.948459635, 54.941999029, 55.939839278, 56.936291373, 57.935752814, 58.933195048, 59.933817059, 60.932475763, 61.934050563, 62.933611611, 63.935809908, 64.93647846, 65.939762004, 66.940889529, 67.944873058, 68.94632, 69.951, 70.9529, 71.957810, 72.960240, 73.965380, 74.968330, 57.935342907, 48.019750, 49.009660, 49.995930, 50.987720, 51.975680, 52.968470, 53.957905495, 54.951330251, 55.942132022, 56.939793526, 57.935342907, 58.934346705, 59.930786372, 60.931056033, 61.928345115, 62.929669374, 63.927965959, 64.930084304, 65.929139334, 66.931569414, 67.931868789, 68.935610269, 69.9365, 70.940736283, 71.942092682, 72.946470, 73.948070, 74.952870, 75.955330, 76.960550, 77.963180, 62.929597474, 51.997180, 52.985550, 53.976710, 54.966050, 55.958560, 56.949211078, 57.944538499, 58.939498028, 59.93736503, 60.933457821, 61.932583745, 62.929597474, 63.929764183, 64.927789485, 65.928868813, 66.927730314, 67.929610889, 68.929429269, 69.932392343, 70.932676833, 71.935820307, 72.936675282, 73.939874862, 74.9419, 75.945275026, 76.947850, 77.951960, 78.954560, 79.960870, 63.929142222, 53.992950, 54.983980, 55.972380, 56.964788, 57.954591555, 58.949263764, 59.941827035, 60.939510635, 61.934329764, 62.933211566, 63.929142222, 64.929240984, 65.926033419, 66.927127345, 67.924844154, 68.926550281, 69.925319274, 70.927721599, 71.926857951, 72.929779104, 73.929458609, 74.932936741, 75.93329357, 76.936958967, 77.938440216, 78.942652, 79.944342348, 80.950480, 81.954420, 82.961030, 68.925573587, 55.994910, 56.982930, 57.974250, 58.963370, 59.957060, 60.949446287, 61.944175238, 62.939294196, 63.936838747, 64.932734754, 65.93158901, 66.928201703, 67.927980084, 68.925573587, 69.926021972, 70.924701349, 71.926366268, 72.925174682, 73.926945762, 74.926500246, 75.928827626, 76.9291543, 77.93160818, 78.93289326, 79.936515781, 80.937752355, 81.942990, 82.946980, 83.952650, 84.957000, 85.963120, 73.921177767, 57.991010, 58.981750, 59.970190, 60.963790, 61.954650, 62.949640, 63.941653, 64.939436406, 65.933843453, 66.93273407, 67.92809424, 68.927964533, 69.924247381, 70.924950954, 71.922075815, 72.923458945, 73.921177767, 74.922858948, 75.921402557, 76.923548591, 77.922852739, 78.925400995, 79.925372392, 80.928820467, 81.929549725, 82.934620, 83.937470, 84.943030, 85.946490, 86.952510, 87.956910, 88.963830, 74.921596478, 59.993130, 60.980620, 61.973200, 62.963690, 63.957572, 64.949564, 65.94471, 66.939186071, 67.936769069, 68.932273675, 69.930924826, 70.927112428, 71.926752283, 72.923824844, 73.923928692, 74.921596478, 75.922394021, 76.920647286, 77.921827281, 78.920947934, 79.922533816, 80.922132287, 81.924504067, 82.924980024, 83.929058, 84.932020, 85.936500, 86.939900, 87.944940, 88.949390, 89.955500, 90.960430, 91.966800, 79.916521271, 64.964660, 65.955210, 66.950090, 67.941798, 68.939557817, 69.933390644, 70.932241822, 71.927112352, 72.926765345, 73.922476436, 74.922523368, 75.919213597, 76.919914038, 77.91730909, 78.918499098, 79.916521271, 80.917992474, 81.916699401, 82.919118473, 83.918462354, 84.922245053, 85.924271579, 86.928521358, 87.931423998, 88.936450, 89.939960, 90.945960, 91.949920, 92.956290, 93.960490, 78.918337087, 66.964790, 67.958516, 68.950106, 69.944792, 70.93874, 71.936644572, 72.931691524, 73.929891034, 74.925776207, 75.924541469, 76.921379082, 77.921145706, 78.918337087, 79.918529296, 80.916290563, 81.916804119, 82.915180421, 83.916478974, 84.915608403, 85.918797577, 86.920711324, 87.924065926, 88.926385334, 89.930627737, 90.933968095, 91.939258714, 92.943050, 93.948680, 94.952870, 95.958530, 96.962800, 85.910610729, 68.965180, 69.955259, 70.949625738, 71.942092038, 72.939289195, 73.933084369, 74.930945746, 75.925910078, 76.92467, 77.920364783, 78.920082431, 79.916378965, 80.916592015, 81.9134836, 82.914136099, 83.911506687, 84.912527331, 85.910610729, 86.913354862, 87.914446969, 88.917630581, 89.919516555, 90.923445215, 91.92615621, 92.931274357, 93.934360, 94.939840, 95.943070, 96.948560, 97.951910, 98.957600, 99.961140, 84.911789737, 70.965320, 71.959080, 72.950561, 73.944264751, 74.93857, 75.935072226, 76.930408, 77.928141, 78.92398946, 79.92251925, 80.918995913, 81.918208598, 82.915109701, 83.914384821, 84.911789737, 85.911167419, 86.909180526, 87.911315588, 88.912278016, 89.914801694, 90.916536958, 91.9197289, 92.922041876, 93.926404946, 94.929302889, 95.934272637, 96.937351916, 97.941790668, 98.945379283, 99.949870, 100.953196445, 101.958870, 87.905612124, 72.965970, 73.956310, 74.949949568, 75.941766782, 76.937944782, 77.93218, 78.929708, 79.924521013, 80.923211846, 81.918401639, 82.917556701, 83.913425275, 84.912932803, 85.909260204, 86.908877124, 87.905612124, 88.907450675, 89.907737888, 90.910203095, 91.911037858, 92.914025634, 93.915361312, 94.919358766, 95.921696802, 96.926152923, 97.928452934, 98.933240926, 99.935351911, 100.940517888, 101.943018987, 102.948950, 103.952330, 104.958580, 88.905848295, 75.958450, 76.949645, 77.943610, 78.937351634, 79.93428, 80.929127468, 81.926792451, 82.922354243, 83.920388264, 84.916433039, 85.914885576, 86.91087573, 87.909501146, 88.905848295, 89.907151886, 90.907304791, 91.908949143, 92.909582713, 93.911595245, 94.912820621, 95.915891343, 96.918133995, 97.92220302, 98.924636204, 99.927756586, 100.93031385, 101.933555695, 102.936730, 103.941050, 104.944870, 105.949790, 106.954140, 107.959480, 89.904704416, 77.955230, 78.949160, 79.9404, 80.937210026, 81.931087, 82.928653801, 83.923250, 84.921471182, 85.916473591, 86.914816252, 87.910226904, 88.9088895, 89.904704416, 90.905645767, 91.905040847, 92.906476006, 93.906315192, 94.9080426, 95.908273386, 96.910953109, 97.912734892, 98.916512106, 99.917761889, 100.921140415, 101.922981285, 102.926599606, 103.928780, 104.933050, 105.935910, 106.940750, 107.943960, 108.949240, 109.952870, 92.906378058, 80.949030, 81.943130, 82.936705382, 83.933570, 84.927912447, 85.925038326, 86.920361108, 87.918332163, 88.913418245, 89.911264845, 90.906996243, 91.907193888, 92.906378058, 93.907283888, 94.906835792, 95.908100647, 96.908098556, 97.910328412, 98.911618375, 99.914181619, 100.915252025, 101.918037614, 102.919143842, 103.922464701, 104.923936545, 105.927970, 106.930310, 107.934840, 108.937630, 109.942440, 110.945650, 111.950830, 112.954700, 97.905408169, 82.948740, 83.940090, 84.936550, 85.930695904, 86.927326502, 87.921953241, 88.919480009, 89.913936896, 90.911750194, 91.906810991, 92.90681261, 93.905088269, 94.905842129, 95.904679477, 96.906021465, 97.905408169, 98.90771187, 99.907477336, 100.910347001, 101.91029736, 102.913207142, 103.913763625, 104.91697461, 105.918136802, 106.921692604, 107.923453, 108.927810, 109.929730, 110.934410, 111.936840, 112.941880, 113.944920, 114.950290, 98.906254747, 84.948830, 85.942880, 86.936530, 87.932678, 88.927167, 89.923556564, 90.918427639, 91.915260166, 92.910248984, 93.909657002, 94.907657084, 95.907871383, 96.906365358, 97.907215966, 98.906254747, 99.90765778, 100.907314659, 101.909215019, 102.909181351, 103.911447454, 104.911660566, 105.914357927, 106.915079572, 107.918461226, 108.919982665, 109.923820483, 110.92569283, 111.929146493, 112.931590, 113.935880, 114.938690, 115.943370, 116.946480, 117.951480, 101.904349312, 86.949180, 87.940260, 88.936110, 89.929890, 90.926292, 91.920120, 92.917052034, 93.911359711, 94.910412929, 95.907597835, 96.9075547, 97.905287132, 98.905939302, 99.904219476, 100.905582087, 101.904349312, 102.906323847, 103.905432701, 104.907752866, 105.907329433, 106.909905089, 107.910173465, 108.913203233, 109.914136041, 110.917696, 111.918965, 112.922487194, 113.924281, 114.928686173, 115.930810, 116.935580, 117.937820, 118.942840, 119.945310, 102.905504292, 88.948837, 89.942870, 90.936550, 91.931980, 92.925740, 93.921698, 94.91589874, 95.914460631, 96.911336797, 97.910708158, 98.908132104, 99.90812155, 100.906163625, 101.906843196, 102.905504292, 103.906655518, 104.905693821, 105.907287135, 106.906748423, 107.908728018, 108.908737289, 109.911136411, 110.911585913, 111.914394159, 112.915530627, 113.918806, 114.920334, 115.924062, 116.925980, 117.930070, 118.932110, 119.936410, 120.938720, 121.943210, 105.903485715, 90.949110, 91.940420, 92.935910, 93.928770, 94.924690, 95.918164359, 96.916479073, 97.912720902, 98.911767833, 99.908505886, 100.908289242, 101.905608544, 102.906087307, 103.904035834, 104.90508492, 105.903485715, 106.905133481, 107.903891701, 108.905950451, 109.905153254, 110.907670734, 111.907314058, 112.910152908, 113.910362638, 114.913683824, 115.914158662, 116.917841338, 117.9189843, 118.923110, 119.924691878, 120.928870, 121.930550, 122.934930, 123.936880, 106.90509682, 92.949780, 93.942780, 94.935480, 95.930680, 96.923972412, 97.921566201, 98.917597178, 99.916104255, 100.912802233, 101.911685, 102.90897272, 103.908629157, 104.906528661, 105.906668921, 106.90509682, 107.905955556, 108.904752292, 109.906107231, 110.905291157, 111.907004814, 112.906566579, 113.908803704, 114.908762698, 115.911359933, 116.911684562, 117.914582768, 118.915665059, 119.918787384, 120.919848046, 121.923530, 122.924900, 123.928640, 124.930430, 125.934500, 126.936770, 127.941170, 128.943690, 129.950448, 113.90335854, 94.949870, 95.939770, 96.934940, 97.927395546, 98.925010, 99.920289525, 100.918681538, 101.914462258, 102.913419246, 103.909849475, 104.909467905, 105.90645941, 106.906617928, 107.904183683, 108.904982293, 109.90300207, 110.904178107, 111.902757809, 112.904401662, 113.90335854, 114.905430969, 115.904755809, 116.907218618, 117.90691453, 118.909921597, 119.909850129, 120.912977363, 121.913332432, 122.917002999, 123.917647616, 124.92124637, 125.922353321, 126.926443864, 127.927762285, 128.932150, 129.933901937, 130.940670, 131.945550, 114.903878484, 96.949540, 97.942140, 98.934220, 99.931110851, 100.926340, 101.924090238, 102.919914188, 103.918296171, 104.91467354, 105.913465411, 106.9102951, 107.90969818, 108.907150507, 109.907165274, 110.905103278, 111.905532331, 112.904057761, 113.904913876, 114.903878484, 115.905259703, 116.904513564, 117.906354367, 118.90584535, 119.907959608, 120.907845822, 121.91027601, 122.910438276, 123.913175231, 124.913600588, 125.916463857, 126.917353091, 127.920172328, 128.92169698, 129.924970049, 130.926851767, 131.93299026, 132.937810, 133.944150, 134.949330, 119.902194676, 98.949330, 99.939044343, 100.936060, 101.930295324, 102.928100, 103.923143223, 104.921349437, 105.91688062, 106.915644329, 107.911925378, 108.911283214, 109.907842791, 110.90773446, 111.904818207, 112.905170577, 113.902778869, 114.903342397, 115.90174053, 116.902951656, 117.901603167, 118.90330763, 119.902194676, 120.90423548, 121.903439046, 122.905720838, 123.905273946, 124.907784125, 125.90765328, 126.910360024, 127.910536624, 128.913479, 129.913967295, 130.916999769, 131.917815713, 132.923829249, 133.928291765, 134.934730, 135.939340, 136.945990, 120.903815686, 102.939690, 103.936472, 104.931486348, 105.928791, 106.924150, 107.922160, 108.918132426, 109.916753, 110.913163, 111.912398009, 112.909371672, 113.909269, 114.906598, 115.906793629, 116.904835941, 117.905528731, 118.903942009, 119.905072427, 120.903815686, 121.905173651, 122.90421397, 123.905935743, 124.905253818, 125.90724748, 126.906923609, 127.909169001, 128.909148442, 129.911656324, 130.911982275, 131.914466896, 132.91525163, 133.920379744, 134.925165771, 135.930350, 136.935310, 137.940790, 138.945980, 129.906224399, 104.943640, 105.937504237, 106.935006, 107.929444597, 108.927415515, 109.922407316, 110.921110692, 111.917013672, 112.915891, 113.912089, 114.911902, 115.90846, 116.908644719, 117.905827581, 118.906403645, 119.904020222, 120.904936424, 121.903043898, 122.904270029, 123.902817896, 124.904430731, 125.903311696, 126.905226336, 127.904463056, 128.906598238, 129.906224399, 130.908523864, 131.90855316, 132.910955306, 133.911368737, 134.916448592, 135.920101246, 136.925322954, 137.929220, 138.934730, 139.938850, 140.944650, 141.949080, 126.904472681, 107.943475, 108.938149417, 109.935242, 110.930276, 111.927970, 112.923640583, 113.921850, 114.918048, 115.916808633, 116.91365, 117.913074, 118.910074, 119.910048173, 120.907366811, 121.907589284, 122.905588965, 123.906209852, 124.904630164, 125.905624153, 126.904472681, 127.905809443, 128.904987722, 129.906674247, 130.906124609, 131.907997381, 132.907796939, 133.909744465, 134.910048121, 135.914653993, 136.91787084, 137.922349591, 138.926099478, 139.931000, 140.935030, 141.940180, 142.944560, 143.949990, 131.904153457, 109.944278068, 110.941602, 111.935623112, 112.933341174, 113.927980306, 114.92629392, 115.921581087, 116.920358735, 117.916178655, 118.915410688, 119.911784244, 120.911461829, 121.908367632, 122.90848191, 123.905893003, 124.906395464, 125.904273634, 126.905183723, 127.903531275, 128.904779435, 129.903508007, 130.905082362, 131.904153457, 132.905910722, 133.905394464, 134.907227495, 135.907218794, 136.911562125, 137.913954475, 138.918792936, 139.921640943, 140.926648049, 141.92970959, 142.935110, 143.938510, 144.944070, 145.947750, 146.953560, 132.905451932, 111.950301, 112.944493274, 113.941450, 114.935910, 115.933367, 116.928670701, 117.926559494, 118.922377304, 119.920677253, 120.917229209, 121.916113434, 122.912996036, 123.912257798, 124.90972827, 125.909451977, 126.907417525, 127.907748866, 128.906064426, 129.906708552, 130.905463926, 131.90643426, 132.905451932, 133.906718475, 134.905977008, 135.907311576, 136.907089473, 137.911016704, 138.913363999, 139.917282354, 140.920045752, 141.924298927, 142.92735175, 143.932076914, 144.93552617, 145.940289423, 146.944155008, 147.949218153, 148.952930, 149.958170, 150.962190, 137.905247237, 113.950675405, 114.947370, 115.941380, 116.938499, 117.933040, 118.930659661, 119.926044974, 120.924054499, 121.919904, 122.918781036, 123.915093603, 124.914472912, 125.911250177, 126.911093797, 127.908317698, 128.908679439, 129.906320811, 130.906941118, 131.905061288, 132.90600749, 133.904508383, 134.905688591, 135.904575945, 136.905827384, 137.905247237, 138.908841341, 139.910604505, 140.914411009, 141.91645341, 142.920626719, 143.922952853, 144.927627032, 145.930219572, 146.934945, 147.937720047, 148.942580, 149.945680, 150.950810, 151.954270, 152.959610, 138.906353267, 116.950068, 117.946730, 118.940990, 119.938070, 120.933010, 121.930710, 122.926240, 123.924574275, 124.920816034, 125.919512667, 126.916375448, 127.915585177, 128.912692815, 129.912368724, 130.91007, 131.910101145, 132.908218, 133.908514011, 134.906976844, 135.907635536, 136.906493598, 137.90711193, 138.906353267, 139.909477645, 140.910962152, 141.91407913, 142.91606272, 143.919599647, 144.921645401, 145.92579346, 146.928235284, 147.932228868, 148.934734, 149.938770, 150.941720, 151.946250, 152.949620, 153.954500, 154.958350, 139.905438706, 118.952760, 119.946640, 120.943420, 121.937910, 122.935400, 123.930410, 124.928440, 125.923971, 126.922731, 127.918911, 128.918102, 129.914736, 130.914422, 131.911460487, 132.91151502, 133.908924821, 134.909151396, 135.907172422, 136.907805577, 137.905991321, 138.906652651, 139.905438706, 140.90827627, 141.909244205, 142.91238591, 143.913647336, 144.917233135, 145.918759009, 146.922673954, 147.92443241, 148.928399883, 149.930408931, 150.933976196, 151.936540, 152.940580, 153.943420, 154.948040, 155.951260, 156.956340, 140.907652769, 120.955364, 121.951810, 122.945960, 123.942960, 124.937830, 125.935310, 126.930830, 127.928791, 128.925095, 129.92359, 130.920259, 131.919255, 132.916330532, 133.915711737, 134.913111745, 135.912691611, 136.910705455, 137.910754636, 138.908938399, 139.909075874, 140.907652769, 141.910044806, 142.910816926, 143.913305245, 144.9145117, 145.917644336, 146.918995992, 147.922135026, 148.923717651, 149.926672997, 150.928318618, 151.931499225, 152.933838905, 153.937518153, 154.940120, 155.944270, 156.947430, 157.951980, 158.955500, 141.907723297, 123.952230, 124.948880, 125.943220, 126.940500, 127.935390, 128.933188, 129.928506, 130.927247, 131.923321237, 132.922348, 133.918790181, 134.91818116, 135.914976035, 136.914567137, 137.911949961, 138.911978288, 139.909552, 140.909609854, 141.907723297, 142.90981429, 143.910087274, 144.912573636, 145.913116939, 146.916100441, 147.916893288, 148.920148842, 149.920890888, 150.923828929, 151.924682219, 152.927698232, 153.929477307, 154.932932, 155.935018114, 156.939030, 157.941600, 158.946090, 159.949090, 160.953880, 144.912749023, 125.957520, 126.951630, 127.948420, 128.943160, 129.940450, 130.935870, 131.933750, 132.929782, 133.928353, 134.924876, 135.923565829, 136.920479493, 137.919548281, 138.916804082, 139.916041789, 140.913555054, 141.912874471, 142.910932616, 143.912590843, 144.912749023, 145.914696305, 146.915138545, 147.917474618, 148.918334155, 149.920983561, 150.921206973, 151.923496795, 152.924116889, 153.926463943, 154.928101267, 155.931056736, 156.933039369, 157.936561407, 158.938970, 159.942990, 160.945860, 161.950290, 162.953680, 151.919732425, 127.958080, 128.954640, 129.948920, 130.946110, 131.940690, 132.938670, 133.933970, 134.93252, 135.928275527, 136.926971746, 137.923243961, 138.922296605, 139.918994687, 140.918476488, 141.915197641, 142.914628338, 143.911999478, 144.913410353, 145.9130409, 146.914897923, 147.914822674, 148.917184735, 149.917275539, 150.919932409, 151.919732425, 152.922097356, 153.922209273, 154.924640161, 155.925527887, 156.928358717, 157.929991317, 158.933211271, 159.935140, 160.938830, 161.941220, 162.945360, 163.948280, 164.952980, 152.921230339, 129.963569, 130.957753, 131.954370, 132.949240, 133.946510, 134.941820, 135.939600, 136.935570, 137.933709, 138.92979228, 139.928087607, 140.92493072, 141.923434945, 142.920297509, 143.918816823, 144.916265237, 145.917205817, 146.916746111, 147.918085895, 148.917931238, 149.919701819, 150.919850161, 151.921744534, 152.921230339, 153.922979237, 154.92289326, 155.924752249, 156.925423647, 157.927845302, 158.929088861, 159.931971, 160.933680, 161.937040, 162.939210, 163.942990, 164.945720, 165.949970, 166.953210, 157.924103912, 133.955370, 134.952570, 135.947340, 136.945020, 137.940120, 138.938240, 139.933674, 140.932126, 141.928116, 142.92674951, 143.922963, 144.921709252, 145.918310608, 146.91909442, 147.918114524, 148.919340915, 149.918658876, 150.920348482, 151.919790996, 152.921749543, 153.920865598, 154.922622022, 155.922122743, 156.923960135, 157.924103912, 158.926388658, 159.927054146, 160.929669211, 161.930984751, 162.933990, 163.935860, 164.939380, 165.941600, 166.945570, 167.948360, 168.952870, 158.925346757, 135.961380, 136.955980, 137.953160, 138.948290, 139.945805049, 140.941448, 141.938744, 142.935121, 143.933045, 144.929274, 145.927246584, 146.924044585, 147.924271701, 148.923245909, 149.923659686, 150.923102543, 151.924074438, 152.923434588, 153.924678019, 154.923505236, 155.924747213, 156.924024604, 157.925413137, 158.925346757, 159.927167606, 160.927569919, 161.929488234, 162.930647536, 163.933350838, 164.934880, 165.937991959, 166.940050, 167.943640, 168.946220, 169.950250, 170.953300, 163.929174751, 137.962490, 138.959540, 139.954010, 140.951350, 141.946366, 142.943830, 143.939254, 144.937425, 145.932845369, 146.9310915, 147.927149831, 148.927304787, 149.925585184, 150.926184601, 151.9247183, 152.92576467, 153.924424457, 154.925753775, 155.92428311, 156.925466095, 157.924409487, 158.925739214, 159.925197517, 160.926933364, 161.926798447, 162.928731159, 163.929174751, 164.931703333, 165.932806741, 166.935655462, 167.937128769, 168.940307614, 169.942390, 170.946200, 171.948760, 172.953000, 164.93032207, 139.968539, 140.963098, 141.959770, 142.954610, 143.951480, 144.947200, 145.944640, 146.940056, 147.937718, 148.933774771, 149.933496182, 150.931688142, 151.931713714, 152.930198789, 153.930601579, 154.929103491, 155.929839, 156.928256188, 157.928941007, 158.927711959, 159.928729478, 160.927854776, 161.929095504, 162.928733903, 163.930233507, 164.93032207, 165.932284162, 166.933132633, 167.935515708, 168.936872273, 169.939618929, 170.94146515, 171.944820, 172.947290, 173.951150, 174.954050, 165.930293061, 142.966340, 143.960380, 144.957390, 145.952000, 146.949490, 147.944550, 148.942306, 149.937913839, 150.937448903, 151.935050389, 152.935063492, 153.932783081, 154.933208949, 155.931064698, 156.931916, 157.929893474, 158.930684066, 159.929083292, 160.929995309, 161.928778264, 162.930032749, 163.929200229, 164.930726003, 165.930293061, 166.932048159, 167.932370224, 168.934590364, 169.935464312, 170.938029808, 171.939356113, 172.942400, 173.944230, 174.947770, 175.950080, 176.954050, 168.93421325, 144.970073, 145.966425, 146.960961, 147.957840, 148.952720, 149.949960, 150.94548349, 151.944422, 152.942012112, 153.941567808, 154.939199459, 155.938979933, 156.936973, 157.936979525, 158.934975, 159.935262801, 160.933549, 161.933994682, 162.932651124, 163.93356, 164.932435492, 165.933554131, 166.932851622, 167.934172776, 168.93421325, 169.935801397, 170.93642944, 171.938400044, 172.939603607, 173.942168605, 174.943836853, 175.946994685, 176.949040, 177.952640, 178.955340, 173.938862089, 147.967420, 148.964040, 149.958420, 150.955400769, 151.950288919, 152.949480, 153.946393928, 154.945782332, 155.942818215, 156.942627848, 157.939865617, 158.940050099, 159.937552344, 160.937901678, 161.93576821, 162.936334305, 163.934489416, 164.935279, 165.933882042, 166.934949605, 167.933896895, 168.935189802, 169.934761837, 170.936325799, 171.936381469, 172.938210787, 173.938862089, 174.94127645, 175.942571683, 176.945260822, 177.94664668, 178.950170, 179.952330, 180.956150, 174.940771819, 149.973228, 150.967577, 151.964120, 152.958767331, 153.957522, 154.954316216, 155.953032523, 156.9500983, 157.949313283, 158.946628776, 159.946033, 160.943572, 161.943277288, 162.941179, 163.941339, 164.939406724, 165.939859, 166.93827, 167.938739111, 168.937651439, 169.938474968, 170.937913136, 171.939085669, 172.938930602, 173.94033748, 174.940771819, 175.94268631, 176.943758055, 177.945954559, 178.947327443, 179.94988116, 180.951970, 181.955040, 182.957570, 183.960910, 179.946549953, 152.970690, 153.964860, 154.963390, 155.959364025, 156.958396, 157.954799366, 158.95399487, 159.950684379, 160.950274844, 161.947210498, 162.947089, 163.944367284, 164.944567, 165.94218, 166.9426, 167.940568, 168.941259, 169.939609, 170.940492, 171.939448301, 172.940513, 173.940046178, 174.941509181, 175.941408631, 176.943220651, 177.943698766, 178.945816145, 179.946549953, 180.949101246, 181.950554096, 182.953530439, 183.955446515, 184.958820, 185.960890, 186.964590, 187.966850, 180.947995763, 154.974592, 155.972303, 156.968192445, 157.966699, 158.963018173, 159.961486056, 160.958417, 161.957291859, 162.954330271, 163.953534, 164.950772514, 165.950512, 166.948093, 167.948047, 168.946011, 169.946175, 170.944476, 171.944895, 172.94375, 173.944454, 174.943737, 175.944857, 176.944472403, 177.945778221, 178.945929535, 179.947464831, 180.947995763, 181.950151849, 182.951372616, 183.954007966, 184.955559375, 185.958552023, 186.960530, 187.963700, 188.965830, 189.969230, 183.950931188, 157.974562, 158.972918, 159.968478805, 160.967357, 161.963497417, 162.962523542, 163.958954382, 164.958279949, 165.955027253, 166.954816014, 167.951808394, 168.95177879, 169.949228482, 170.949451, 171.947292, 172.947689, 173.946079, 174.946717, 175.945634, 176.946643, 177.945876236, 178.947070447, 179.946704459, 180.948197248, 181.948204156, 182.950222951, 183.950931188, 184.953419264, 185.954364127, 186.957160466, 187.958489105, 188.961912868, 189.963181378, 190.966600, 191.968170, 186.955753109, 159.982115, 160.977589119, 161.976002, 162.972080535, 163.970323, 164.967088557, 165.965808, 166.962601, 167.961572608, 168.958791096, 169.958220071, 170.955716, 171.955422961, 172.953243, 173.953115, 174.951381, 175.951623, 176.950328, 177.950989, 178.949987641, 179.950789084, 180.950067916, 181.95121008, 182.950819841, 183.952520756, 184.952954982, 185.954986084, 186.955753109, 187.958114438, 188.959229007, 189.961817977, 190.963125242, 191.965960, 192.967470, 193.970420, 191.96148069, 161.984431, 162.982690, 163.978035649, 164.976762, 165.972690753, 166.971547969, 167.967803678, 168.96701927, 169.963577028, 170.963184819, 171.960023303, 172.959808409, 173.957062202, 174.956945835, 175.954806, 176.954965324, 177.953251241, 178.953816017, 179.952378803, 180.953244, 181.952110186, 182.953126102, 183.952489071, 184.954042265, 185.953838158, 186.955750458, 187.955838228, 188.95814747, 189.958447048, 190.960929718, 191.96148069, 192.964151563, 193.965182083, 194.968126661, 195.969639333, 192.96292643, 163.992201, 164.987520, 165.985824, 166.981665156, 167.979881, 168.976294942, 169.974965, 170.971626042, 171.970456, 172.967501739, 173.966861045, 174.964112895, 175.963648688, 176.9613015, 177.961082, 178.959122266, 179.959229446, 180.957625297, 181.958076296, 182.956846458, 183.957476, 184.956698, 185.957946104, 186.957363361, 187.958853121, 188.958718935, 189.960545968, 190.960594046, 191.962605012, 192.96292643, 193.965078378, 194.965979573, 195.968396542, 196.969653285, 197.972280, 198.973804583, 194.964791134, 165.994855, 166.992979, 167.988150742, 168.986715, 169.982495289, 170.981244542, 171.977347128, 172.976444754, 173.972818767, 174.972420552, 175.968944622, 176.968469481, 177.965648724, 178.965363404, 179.963031477, 180.963097285, 181.961170656, 182.961596703, 183.959922251, 184.960619, 185.959350813, 186.960587, 187.959395391, 188.960833686, 189.959931655, 190.961676661, 191.961038005, 192.962987401, 193.962680253, 194.964791134, 195.964951521, 196.967340182, 197.96789279, 198.970593094, 199.971440677, 200.974512868, 201.975740, 196.966568662, 168.998080, 169.996122, 170.991878881, 171.990035, 172.98623738, 173.984761, 174.981274107, 175.980099, 176.976864908, 177.97603192, 178.973212812, 179.972521124, 180.970079048, 181.969617874, 182.967593034, 183.967451524, 184.965789411, 185.965952703, 186.964567541, 187.965323661, 188.963948286, 189.964700339, 190.963704225, 191.964812953, 192.964149715, 193.96536525, 194.96503464, 195.966569813, 196.966568662, 197.968242303, 198.968765193, 199.970725647, 200.97165724, 201.973805838, 202.975154542, 203.977724, 204.979870, 201.970643011, 171.003760, 171.998832686, 172.997242, 173.992863695, 174.99142327, 175.98735458, 176.986279158, 177.982483143, 178.981833861, 179.978266394, 180.977819311, 181.974689964, 182.974449841, 183.971713051, 184.971899086, 185.96936179, 186.969814236, 187.967577049, 188.968190034, 189.966322449, 190.967157105, 191.965634327, 192.966665421, 193.965439409, 194.966720113, 195.965832649, 196.967212908, 197.966769032, 198.968279932, 199.968326004, 200.970302268, 201.970643011, 202.972872484, 203.973493933, 204.976073386, 205.977514066, 206.982588545, 207.985940, 208.991040, 209.994510, 204.974427541, 176.000590, 176.996427286, 177.994897, 178.991089082, 179.989906, 180.986257447, 181.985667104, 182.982192802, 183.981873122, 184.978791305, 185.978325, 186.975905897, 187.976009782, 188.973588428, 189.973877149, 190.971786154, 191.972225, 192.970672, 193.9712, 194.969774335, 195.970481151, 196.969574511, 197.970483495, 198.969877, 199.970962672, 200.970818891, 201.972105808, 202.97234422, 203.973863522, 204.974427541, 205.97611032, 206.977419429, 207.9820187, 208.985358952, 209.990073689, 210.993477, 211.998228, 207.976652071, 178.003830191, 179.002150, 179.997918173, 180.996623958, 181.992671842, 182.991874629, 183.988142339, 184.987609944, 185.984238945, 186.98391837, 187.980874338, 188.980807, 189.978081517, 190.978265, 191.975785171, 192.976173234, 193.97401207, 194.97454205, 195.972774109, 196.973431124, 197.972033959, 198.97291665, 199.971826675, 200.972884511, 201.972159133, 202.973390521, 203.973043589, 204.974481755, 205.974465278, 206.975896887, 207.976652071, 208.98109012, 209.984188527, 210.988736964, 211.991897543, 212.996581499, 213.999805408, 215.004807, 208.980398734, 184.001124, 184.997625, 185.996597625, 186.993157835, 187.992265154, 188.989199012, 189.988295129, 190.985786119, 191.985457954, 192.982959771, 193.98283396, 194.980650737, 195.980666509, 196.978864454, 197.979206, 198.977671961, 199.978131829, 200.977009036, 201.977742324, 202.976876001, 203.977812736, 204.977389366, 205.97849913, 206.978470679, 207.979742196, 208.980398734, 209.984120371, 210.98726946, 211.991285724, 212.994384666, 213.998711539, 215.001769776, 216.006305943, 217.009470, 218.014316, 208.982430435, 187.999422048, 188.998480562, 189.995101185, 190.994574485, 191.991335149, 192.991025275, 193.988185606, 194.988110728, 195.98553458, 196.98565963, 197.983388616, 198.983666063, 199.981798604, 200.982259764, 201.980757541, 202.981420103, 203.980318121, 204.981203322, 205.980481099, 206.981593173, 207.981245702, 208.982430435, 209.982873673, 210.986653154, 211.988867969, 212.99285728, 213.99520135, 214.999419988, 216.001915035, 217.006334796, 218.008973037, 219.013744, 220.016602, 210.987496271, 192.999843112, 193.998725085, 194.996268098, 195.995788077, 196.993189215, 197.992837202, 198.990532254, 199.990351264, 200.988416999, 201.988630236, 202.986941984, 203.987251326, 204.986074483, 205.986667036, 206.985783502, 207.986589977, 208.986173143, 209.98714771, 210.987496271, 211.990744771, 212.992936646, 213.996371733, 214.99865257, 216.002423257, 217.004718822, 218.008694336, 219.011161691, 220.015407682, 221.018050, 222.022330, 223.025190, 222.017577738, 195.005437696, 196.002115223, 197.001584351, 197.998678663, 198.998370297, 199.9956993, 200.995628335, 201.993263492, 202.993386687, 203.99142874, 204.991718799, 205.990214104, 206.990734225, 207.98964247, 208.990414742, 209.989696216, 210.990600523, 211.990703529, 212.993882668, 213.995362554, 214.998745483, 216.00027437, 217.003927675, 218.005601256, 219.009480204, 220.011393981, 221.015536782, 222.017577738, 223.021790, 224.024090, 225.028440, 226.030890, 227.035407, 228.037986, 222.01755173, 199.007258147, 200.00657249, 201.003860867, 202.003372847, 203.000924647, 204.000653204, 204.99859396, 205.998666066, 206.996949414, 207.997138783, 208.995953555, 209.996407738, 210.995536544, 211.996202244, 212.996189081, 213.998971145, 215.000341497, 216.00319799, 217.004631951, 218.007578322, 219.009252149, 220.012327405, 221.014254762, 222.01755173, 223.019735857, 224.023249951, 225.025565414, 226.029386231, 227.031835938, 228.035729, 229.038450228, 230.042510, 231.045440, 232.049772, 228.031070292, 202.009890686, 203.009271619, 204.006499668, 205.00626857, 206.00382727, 207.003798105, 208.00183994, 209.001991373, 210.000494978, 211.000897987, 211.999794499, 213.000383959, 214.000107894, 215.002719834, 216.003533035, 217.006320327, 218.00714023, 219.010085078, 220.011028384, 221.013917338, 222.01537453, 223.018502171, 224.020211821, 225.023611564, 226.025409823, 227.029177842, 228.031070292, 229.034957577, 230.037056394, 231.041220, 232.043638, 233.048060, 234.050704, 227.027752127, 206.01450498, 207.011949748, 208.011551551, 209.009494863, 210.009435986, 211.007734835, 212.007813822, 213.006607643, 214.006901798, 215.006453625, 216.008720075, 217.009346914, 218.011641453, 219.012420389, 220.014762979, 221.015591248, 222.017843851, 223.019137468, 224.021722866, 225.023229585, 226.026098089, 227.027752127, 228.031021112, 229.033015243, 230.036294178, 231.038558786, 232.042027438, 233.044550, 234.048420, 235.051232, 236.055296, 232.038055325, 209.017715682, 210.015075342, 211.014928413, 212.012980288, 213.01301014, 214.01149977, 215.01173033, 216.011062115, 217.013114328, 218.013284499, 219.015536895, 220.015747762, 221.018183674, 222.018468121, 223.020811448, 224.021466895, 225.023951021, 226.024903069, 227.02770407, 228.028741127, 229.03176243, 230.033133843, 231.036304343, 232.038055325, 233.041581843, 234.04360123, 235.047510074, 236.049870, 237.053894, 238.056496, 231.03588399, 212.023204138, 213.02110934, 214.020918417, 215.019185865, 216.019109564, 217.018323986, 218.020041889, 219.019883143, 220.021875303, 221.021877983, 222.023742, 223.023962273, 224.025625738, 225.026130678, 226.027947753, 227.028805072, 228.031051376, 229.032096793, 230.034540754, 231.03588399, 232.038591592, 233.040247277, 234.043308058, 235.045443615, 236.048681284, 237.051145659, 238.05450271, 239.057260, 240.060980, 238.050788247, 217.024368791, 218.023535671, 219.02491916, 220.024723, 221.026399, 222.026086, 223.0277386, 224.027604778, 225.029390717, 226.029338702, 227.031156367, 228.031374006, 229.033505939, 230.033939784, 231.036293704, 232.037156152, 233.039635207, 234.040952088, 235.043929918, 236.045568006, 237.048730184, 238.050788247, 239.054293299, 240.056591988, 241.060330, 242.062931, 237.048173444, 225.033913933, 226.035145, 227.034956789, 228.036180, 229.036263808, 230.037827597, 231.038245085, 232.040108, 233.040740546, 234.042895038, 235.044063267, 236.0465696, 237.048173444, 238.050946405, 239.052939025, 240.056162182, 241.058252431, 242.06164118, 243.064279, 244.067850, 242.058742611, 228.038742328, 229.040150212, 230.039649886, 231.041101107, 232.041187097, 233.042997375, 234.043317076, 235.04528605, 236.046057964, 237.048409658, 238.049559894, 239.052163381, 240.053813545, 241.056851456, 242.058742611, 243.062003092, 244.064203907, 245.067747154, 246.070204627, 247.074070, 243.06138108, 231.045560, 232.046590, 233.046348, 234.047809, 235.047946, 236.049579, 237.049996, 238.051984324, 239.053024479, 240.055300179, 241.056829144, 242.059549159, 243.06138108, 244.064284847, 245.066452114, 246.069774619, 247.072093, 248.075752, 249.078480, 247.07035354, 233.050771232, 234.050159841, 235.051434, 236.051413, 237.052901, 238.053028697, 239.054957, 240.055529539, 241.057653001, 242.058835824, 243.061389114, 244.062752578, 245.065491249, 246.067223662, 247.07035354, 248.072348508, 249.075953413, 250.078356959, 251.082284605, 252.084870, 247.07030708, 235.056580, 236.057330, 237.057003, 238.058281, 239.058279, 240.059759, 241.060230, 242.061981, 243.063007572, 244.065180774, 245.066361616, 246.068672947, 247.07030708, 248.073086, 249.074986657, 250.07831652, 251.080760172, 252.084310, 253.086880, 254.090600, 251.079586788, 237.062070, 238.061410, 239.062422, 240.062302, 241.063726, 242.063701552, 243.065427, 244.066000689, 245.068048612, 246.068805309, 247.071000589, 248.072184861, 249.074853537, 250.076406066, 251.079586788, 252.081625846, 253.085133145, 254.087322909, 255.091046, 256.093440, 252.082978512, 240.068920, 241.068538, 242.069745, 243.069548, 244.070883, 245.071324, 246.072896, 247.073656, 248.075471, 249.076411, 250.078612, 251.079992142, 252.082978512, 253.084824697, 254.088022021, 255.090273122, 256.093598, 257.095979, 258.099520, 257.095104724, 242.073430, 243.074353, 244.074084, 245.075385, 246.075299023, 247.076847, 248.077194714, 249.079034, 250.079521264, 251.081575017, 252.082466855, 253.085185236, 254.08685422, 255.089962202, 256.091773117, 257.095104724, 258.097076, 259.100595, 260.102678, 258.098431319, 245.080829, 246.081886, 247.081635, 248.082823, 249.083013, 250.084420, 251.084839, 252.086560, 253.087280, 254.089656, 255.091082705, 256.094059025, 257.095541368, 258.098431319, 259.100509, 260.103652, 261.105721, 262.108865, 255.093241131, 248.086596, 249.087833, 250.087510, 251.089012, 252.088976521, 253.090678, 254.090955253, 255.093241131, 256.094282666, 257.09687719, 258.098207, 259.101031, 260.102643, 261.105749, 262.107301, 263.110552, 264.112345, 260.105504, 251.094360, 252.095371, 253.095210, 254.096454, 255.096681, 256.098629, 257.099555, 258.101814, 259.102901, 260.105504, 261.106883, 262.109634, 263.111293, 264.114038, 265.115839, 266.119305, 263.112547, 253.100689, 254.100184, 255.101340, 256.101166194, 257.102990, 258.103489, 259.105637, 260.106440, 261.108766556, 262.109925, 263.112547, 264.113985, 265.116704, 266.117956, 267.121529, 268.123644, 255.107398, 255.107398, 256.108127, 257.107722, 258.109231, 259.109610, 260.111300, 261.112056, 262.114084, 263.114988, 264.117404, 265.118601, 266.121029, 267.122377, 268.125445, 269.127460, 270.130712, 259.114500, 258.113168, 259.114500, 260.114422071, 261.116117, 262.116398, 263.118322, 264.118931, 265.121114693, 266.122065, 267.124425, 268.125606, 269.128755, 270.130329, 271.133472, 272.135158, 273.138220, 262.122892, 260.121970, 261.121664, 262.122892, 263.123035, 264.124604, 265.125147, 266.126942, 267.127650, 268.129755, 269.130694, 270.133616, 271.135179, 272.138032, 273.139618, 274.142440, 275.144250, 263.128558, 263.128558, 264.128394885, 265.130085, 266.130097, 267.131789, 268.132162, 269.134056, 270.134650, 271.137657, 272.139052, 273.141986, 274.143131, 275.145952, 276.147208, 277.149841, 265.136151, 265.136151, 266.137299, 267.137307, 268.138728, 269.139055, 270.140657, 271.141139, 272.143738, 273.144913, 274.147492, 275.148647, 276.151156, 277.152420, 278.154812, 279.156193, 281.162061, 267.144341, 268.143795, 269.145124, 270.144720, 271.146062, 272.146317, 273.148863, 274.149492, 275.152176, 276.153034, 277.155647, 278.156469, 279.158861, 280.159795, 281.162061, 272.153615, 272.153615, 273.153682, 274.155713, 275.156142, 276.158493, 277.159519, 278.161604, 279.162468, 280.164473, 281.165372, 282.167486, 283.168415, 283.171792, 277.163943, 278.164312, 279.166546, 280.167039, 281.169286, 282.169765, 283.171792, 284.172384, 285.174105, 283.176451, 283.176451, 284.178080, 285.178732, 286.180481, 287.181045, 285.183698, 285.183698, 286.183855, 287.185599, 288.185689, 289.187279, 287.191186, 287.191186, 288.192492, 289.192715, 290.194141, 291.194384, 292.199786, 289.198862, 290.198590, 291.200011, 292.199786, 291.206564, 291.206564, 292.207549, 293.214670, 293.214670] el2mass = dict(zip(_temp_symbol, _temp_mass)) el2mass["GH"] = 0. # note that ghost atoms in Cfour have mass 100. eliso2mass = dict(zip(_temp_iso_symbol, _temp_iso_mass)) # encompasses el2mass eliso2mass["GH"] = 0. # note that ghost atoms in Cfour have mass 100. # encompasses el2mass #eliso2mass["X0"] = 0. # probably needed, just checking el2z = dict(zip(_temp_symbol, _temp_z)) el2z["GH"] = 0 z2mass = dict(zip(_temp_z, _temp_mass)) z2el = dict(zip(_temp_z, _temp_symbol)) z2element = dict(zip(_temp_z, _temp_element))
andysim/psi4
psi4/driver/qcdb/periodictable.py
Python
gpl-2.0
78,238
[ "CFOUR", "Psi4" ]
1e01e0d48fd3eea5fdde0ab748f30282a37bd18d7bb51d6ac5f9d136973e32ae
import dryscrape import sqlalchemy import time import re import os import numpy as np import pandas as pd project_dir = '/Users/mdelhey/rice-scrape/' YEAR_SCRAPE = '2013' TERM_SCRAPE = 'Spring' dbuser = 'mdelhey' dbname = 'ricedb' dbhost = 'localhost' tbl_out = 't_courses_raw2' tbl_action = 'replace' # replace / append / fail f_out = 'data/courses_tmp.csv' # Boilerplate os.chdir(project_dir) from helpers import try_row_scrape try: __file__ except: __file__ = 'repl' # Create pandas df data_cols = ['courseid', 'yearterm', 'year', 'term', 'crn', 'course', 'title', 'faculty', 'meeting', 'credits', 'enrolled', 'raw'] data = pd.DataFrame(None, columns=data_cols) # set up a web scraping session sess = dryscrape.Session(base_url = 'http://courses.rice.edu/') # we don't need images sess.set_attribute('auto_load_images', False) # visit courses.rice.edu sess.visit('/') # visit full course page print '[%s] Visiting courses.rice.edu (Year: %s, Term: %s)' % (__file__, YEAR_SCRAPE, TERM_SCRAPE) if TERM_SCRAPE == 'Fall': p_term = str(int(YEAR_SCRAPE) + 1) + '10' if TERM_SCRAPE == 'Spring': p_term = str(int(YEAR_SCRAPE)) + '20' if TERM_SCRAPE == 'Summer': p_term = str(int(YEAR_SCRAPE)) + '30' sess.visit('/admweb/!SWKSCAT.cat?p_action=QUERY&p_term=%s&p_name=STATIC' % p_term) #sess.render('tmp.png') # get a list of all crn's print "[%s] Getting all CRN's" % (__file__) classes = [] for c in sess.xpath('//*[@id="container"]/div[3]/table/tbody/tr[*]/td[1]/a'): classes.append(c.text()) classes = classes[0:100] # time scrape start_time = time.time() # Loop through all print '[%s] Scraping %i classes' % (__file__, len(classes)) for idx,c in enumerate(classes): if ((idx % 50) == 0): print '[%s] ... Class %i' % (__file__, idx) # get link, navigate to it link = '/admweb/!SWKSCAT.cat?p_action=COURSE&p_term=%s&p_crn=%s' % (p_term, c) sess.visit(link) # grab data: term, course, enrolled, instructors, etc. row = { i: None for i in data.columns } row['yearterm'] = YEAR_SCRAPE + ' ' + TERM_SCRAPE row['term'] = TERM_SCRAPE row['year'] = YEAR_SCRAPE row['crn'] = c row['courseid'] = row['yearterm'] + '_' + str(row['crn']) row['course'] = try_row_scrape('//*[@id="container"]/div[3]/div/table/tbody/tr[1]/td[2]', sess) row['title'] = try_row_scrape('//*[@id="container"]/div[3]/div/table/tbody/tr[1]/td[3]', sess) row['faculty'] = try_row_scrape('//*[@id="container"]/div[3]/div/table/tbody/tr[2]/td[3]', sess) row['meeting'] = try_row_scrape('//*[@id="container"]/div[3]/div/table/tbody/tr[3]/td[3]', sess) row['credits'] = try_row_scrape('//*[@id="container"]/div[3]/div/table/tbody/tr[1]/td[4]', sess) row['enrolled'] = try_row_scrape('//*[contains(text(), "Enrolled")]', sess) row['raw'] = try_row_scrape('//*[@id="container"]/div[3]/div', sess) # append row data = data.append(row, ignore_index=True) print '[%s] scrape took %.2f minutes' % (__file__, (time.time() - start_time)/60) print '[%s] saving csv to %s' % (__file__, f_out) data.to_csv(f_out, index=False) print '[%s] saving (action = %s) to postgres (table = %s)' % (__file__, tbl_action, tbl_out) rdb_con = sqlalchemy.create_engine('postgresql://%s@%s/%s' % (dbuser, dbhost, dbname)) data.to_sql(tbl_out, rdb_con, if_exists = tbl_action, index = False)
mdelhey/rice-scrape
scrape/scrape_courses.py
Python
mit
3,405
[ "VisIt" ]
9fc31aeac8ea5981309fcaabbd09252ad2b069aed99333409e35468561bcc3cf
"""A thorough test of polling PAIR sockets.""" # # Copyright (c) 2010 Brian E. Granger # # This file is part of pyzmq. # # pyzmq is free software; you can redistribute it and/or modify it under # the terms of the Lesser GNU General Public License as published by # the Free Software Foundation; either version 3 of the License, or # (at your option) any later version. # # pyzmq is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # Lesser GNU General Public License for more details. # # You should have received a copy of the Lesser GNU General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. import time import zmq print "Running polling tests for PAIR sockets..." addr = 'tcp://127.0.0.1:5555' ctx = zmq.Context() s1 = ctx.socket(zmq.PAIR) s2 = ctx.socket(zmq.PAIR) s1.bind(addr) s2.connect(addr) # Sleep to allow sockets to connect. time.sleep(1.0) poller = zmq.Poller() poller.register(s1, zmq.POLLIN|zmq.POLLOUT) poller.register(s2, zmq.POLLIN|zmq.POLLOUT) # Now make sure that both are send ready. socks = dict(poller.poll()) assert socks[s1] == zmq.POLLOUT assert socks[s2] == zmq.POLLOUT # Now do a send on both, wait and test for zmq.POLLOUT|zmq.POLLIN s1.send('msg1') s2.send('msg2') time.sleep(1.0) socks = dict(poller.poll()) assert socks[s1] == zmq.POLLOUT|zmq.POLLIN assert socks[s2] == zmq.POLLOUT|zmq.POLLIN # Make sure that both are in POLLOUT after recv. s1.recv() s2.recv() socks = dict(poller.poll()) assert socks[s1] == zmq.POLLOUT assert socks[s2] == zmq.POLLOUT poller.unregister(s1) poller.unregister(s2) # Wait for everything to finish. time.sleep(1.0) print "Finished."
takluyver/pyzmq
examples/poll/pair.py
Python
lgpl-3.0
1,813
[ "Brian" ]
4c84cb8f9311d8d12ad5a0eb332d9cca2fede899b612d5257653f5e5290d1821
# # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # Okinawa Institute of Science and Technology, Japan. # # This script runs on STEPS 2.x http://steps.sourceforge.net # # H Anwar, I Hepburn, H Nedelescu, W Chen and E De Schutter # Stochastic calcium mechanisms cause dendritic calcium spike variability # J Neuroscience 2013 # # constants_withampa.py : provides a set of parameters and other constants # for the synaptically-induced dendritic ca burst model in the above study. # It is intended that this file is not altered. # # Script authors: Haroon Anwar and Iain Hepburn # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # import math # # # # # # # # # # # # # # # # SIMULATION CONTROLS # # # # # # # # # # # # # EF_DT = 2.0e-5 # The EField dt NTIMEPOINTS = 25001 TIMECONVERTER = 2.0e-5 NITER = 1 ############################PARAMETERS################################ init_pot = -60e-3 TEMPERATURE = 34.0 Q10 = 3 # Faraday constant: unit of FARADAY is C/mol # Source: http://physics.nist.gov/cgi-bin/cuu/Value?f 24/2/2012 FARADAY = 96485.3365 # Molar Gas Constant: unit of R is J/mol K # Source: http://physics.nist.gov/cgi-bin/cuu/Value?r 24/2/2012 R = 8.3144621 # Avogadro constant: unit of AVOGADRO is /mol # Source: http://physics.nist.gov/cgi-bin/cuu/Value?na 24/2/2012 AVOGADRO = 6.02214129e23 # Elementary charge: unit of E_CHARGE is C # Source: http://physics.nist.gov/cgi-bin/cuu/Value?e 24/2/2012 E_CHARGE = 1.602176565e-19 #FOR MSLO, THERE IS A NEW VALUE FOR Qt wrt to 25 degC Qt = math.pow(Q10, ((TEMPERATURE-23)/10)) Qt_mslo = math.pow(Q10, ((TEMPERATURE-25)/10)) ########## BULK RESISTIVITY ########## Ra = 235.7*1.0e-2 ########## MEMBRANE CAPACITANCE ########## memb_capac = 1.5e-2 ########## CaP channels density & permiability per channel ########## # CaP_P is permiability per channel (m3/s) # CaP_ro is channel/surface area (/m2) # P in Ca Dynamics model is 0.95e-4 cm/s --> 0.95e-6 m/s CaP_P = 2.5e-20 CaP_ro = 3.8e13 ##########CaP channel parameters #################### #Units (mV) vhalfm = -29.458 cvm = 8.429 def minf_cap(V): #Units (mV) vhalfm = -29.458 cvm = 8.429 vshift = 0.0 return (1.0/(1.0 + math.exp(-(V-vhalfm-vshift)/cvm))) def tau_cap(V): vshift = 0.0 if (V-vshift) >= -40: return (0.2702 + 1.1622 * math.exp(-(V+26.798-vshift)*(V+26.798-vshift)/164.19)) else: return (0.6923 * math.exp((V-vshift)/1089.372)) def alpha_cap(V): return (minf_cap(V)/tau_cap(V)) def beta_cap(V): return ((1.0-minf_cap(V))/tau_cap(V)) ## Intitial conditions CaP_m0_p = 0.92402 CaP_m1_p = 0.073988 CaP_m2_p = 0.0019748 CaP_m3_p = 1.7569e-05 ########## CaT channels density & permiability per channel ########## # CaT_P is permiability per channel (m3/s) # CaT_ro is channel/surface area (/m2) # P in Ca Dynamics model is 6.2e-6 cm/s -->6.2e-8 m/s # P in Ca Dynamics model with ampa is 3.24e-6 cm/s --> 3.24e-8 m/s CaT_P = 1.65e-20 CaT_ro = 1.9636e12 #CaT_ro = 3.7576e12 (previously used value in model with no ampa) def minf_cat(V): #Units (mV) vhalfm = -52.0 cvm = -5.0 vshift = 0.0 return (1.0/(1.0 + math.exp((V-vhalfm-vshift)/cvm))) def taum_cat(V): vshift = 0.0 if V > -90.0: return (1.0 + 1.0 / (math.exp((V+40.0-vshift)/9.0) + math.exp(-(V+102.0-vshift)/18.0))) else: return 1.0 def hinf_cat(V): vhalfh = -72.0 cvh = 7.0 vshift = 0.0 return (1.0/(1.0 + math.exp((V-vhalfh-vshift)/cvh))) def tauh_cat(V): vshift = 0.0 return (15.0 + 1.0 / (math.exp((V+32.0-vshift)/7.0))) def alpham_cat(V): return (minf_cat(V)/taum_cat(V)) def betam_cat(V): return ((1-minf_cat(V))/taum_cat(V)) def alphah_cat(V): return (hinf_cat(V)/tauh_cat(V)) def betah_cat(V): return ((1-hinf_cat(V))/tauh_cat(V)) ## Initial conditions CaT_m0h0_p = 0.58661 CaT_m1h0_p = 0.23687 CaT_m2h0_p = 0.023912 CaT_m0h1_p = 0.10564 CaT_m1h1_p = 0.042658 CaT_m2h1_p = 0.0043063 ########## BK channels density & conductance per channel ########## # Total conductance = BK_G (conductance/channel) * BK_ro (channel/surface area) # BK in Ca Dynamics model is 4.25e-2 S/cm2 --> 4.25e2 S/m2 BK_G = 2.1e-10 BK_ro = 2.0238e12 BK_rev = -77e-3 ######### BK channel parameters ###################### #Units (1) Qo = 0.73 Qc = -0.67 #Units (/s) pf0 = 2.39 pf1 = 5.4918 pf2 = 24.6205 pf3 = 142.4546 pf4 = 211.0220 pb0 = 3936 pb1 = 687.3251 pb2 = 234.5875 pb3 = 103.2204 pb4 = 11.6581 #Units(/M) k1 = 1.0e6 #Units(/s) onoffrate = 1.0e3 L0 = 1806 #Units (M) Kc = 8.63e-6 Ko = 0.6563e-6 c_01 = 4.*k1*onoffrate*Qt_mslo c_12 = 3.*k1*onoffrate*Qt_mslo c_23 = 2.*k1*onoffrate*Qt_mslo c_34 = 1.*k1*onoffrate*Qt_mslo o_01 = 4.*k1*onoffrate*Qt_mslo o_12 = 3.*k1*onoffrate*Qt_mslo o_23 = 2.*k1*onoffrate*Qt_mslo o_34 = 1.*k1*onoffrate*Qt_mslo c_10 = 1.*Kc*k1*onoffrate*Qt_mslo c_21 = 2.*Kc*k1*onoffrate*Qt_mslo c_32 = 3.*Kc*k1*onoffrate*Qt_mslo c_43 = 4.*Kc*k1*onoffrate*Qt_mslo o_10 = 1.*Ko*k1*onoffrate*Qt_mslo o_21 = 2.*Ko*k1*onoffrate*Qt_mslo o_32 = 3.*Ko*k1*onoffrate*Qt_mslo o_43 = 4.*Ko*k1*onoffrate*Qt_mslo f_0 = lambda mV: pf0*Qt_mslo*(math.exp((Qo* FARADAY* mV) / (R* (TEMPERATURE + 273.15)))) f_1 = lambda mV: pf1*Qt_mslo*(math.exp((Qo* FARADAY* mV) / (R* (TEMPERATURE + 273.15)))) f_2 = lambda mV: pf2*Qt_mslo*(math.exp((Qo* FARADAY* mV) / (R* (TEMPERATURE + 273.15)))) f_3 = lambda mV: pf3*Qt_mslo*(math.exp((Qo* FARADAY* mV) / (R* (TEMPERATURE + 273.15)))) f_4 = lambda mV: pf4*Qt_mslo*(math.exp((Qo* FARADAY* mV) / (R* (TEMPERATURE + 273.15)))) b_0 = lambda mV: pb0*Qt_mslo*(math.exp((Qc* FARADAY* mV) / (R* (TEMPERATURE + 273.15)))) b_1 = lambda mV: pb1*Qt_mslo*(math.exp((Qc* FARADAY* mV) / (R* (TEMPERATURE + 273.15)))) b_2 = lambda mV: pb2*Qt_mslo*(math.exp((Qc* FARADAY* mV) / (R* (TEMPERATURE + 273.15)))) b_3 = lambda mV: pb3*Qt_mslo*(math.exp((Qc* FARADAY* mV) / (R* (TEMPERATURE + 273.15)))) b_4 = lambda mV: pb4*Qt_mslo*(math.exp((Qc* FARADAY* mV) / (R* (TEMPERATURE + 273.15)))) # Initial conditions BK_C0_p= 0.99997 BK_C1_p= 4.3619e-07 BK_C2_p= 4.1713e-09 BK_C3_p= 4.4449e-11 BK_C4_p= 6.3132e-14 BK_O0_p= 2.5202e-05 BK_O1_p= 1.1765e-06 BK_O2_p= 6.6148e-08 BK_O3_p= 2.4392e-09 BK_O4_p= 4.0981e-11 ########## SK channel density & conductance per channel ############# # Total conductance = SK_G (conductance/channel) * SK_ro (channel/surface area) # SK in Ca Dynamics model is 3.1e-4 S/cm2 --> 3.1 S/m2 SK_G = 1.0e-11 SK_ro = 31.0e10 SK_rev = -77e-3 ######### SK channel parameters ################### #Units (/s) invc1 = 80 invc2 = 80 invc3 = 200 invo1 = 1000 invo2 = 100 diro1 = 160 diro2 = 1200 #Units ( /s M) dirc2 = 200e6 dirc3 = 160e6 dirc4 = 80e6 invc1_t = invc1*Qt invc2_t = invc2*Qt invc3_t = invc3*Qt invo1_t = invo1*Qt invo2_t = invo2*Qt diro1_t = diro1*Qt diro2_t = diro2*Qt dirc2_t = dirc2*Qt/3.0 dirc3_t = dirc3*Qt/3.0 dirc4_t = dirc4*Qt/3.0 # Intital conditions SK_C1_p= 0.96256 SK_C2_p= 0.036096 SK_C3_p= 0.0010829 SK_C4_p= 6.4973e-06 SK_O1_p= 0.00017326 SK_O2_p= 7.7967e-05 ######## AMPA rate constants ############## #Total conductance = 20nS, 30nS and 40nS ---> 20e-9 S, 30e-9 S and 40e-9 S #Single AMPA receptor conductance (Hausser and Roth 1997; Momiyama et al. 2003; Tanaka et al. 2005) - 7-8 pS #Units (S) AMPA_G = 7e-12 AMPA_TotalG = 40e-9 #Units (1) AMPA_receptors = AMPA_TotalG/AMPA_G #Units (V) AMPA_rev = 0e3 #Units (/s M) rb = 13e6 #Units (/s) ru1 = 0.0059e3 ru2 = 86e3 ro = 2.7e3 rc = 0.2e3 rd = 0.9e3 rr = 0.064e3 ######### leak current channel density & conductance per channel ######## # Total conductance = 1e-6 S/cm2 --> 1e-2 S/m2 L_G = 4.0e-14 L_ro = 25.0e10 L_rev = -61e-3 ######### Pump parameters ################### P_f_kcst = 3e9 P_b_kcst = 1.75e4 P_k_kcst = 7.255e4 ############################CALCIUM BUFFERING MODEL################################ ########## Ca concentrations ######### Ca_oconc = 2e-3 Ca_iconc = 45e-9 ########## Mg concentrations ######### Mg_conc = 590e-6 ########## Buffer concentrations ############# iCBsf_conc = 27.704e-6 iCBCaf_conc = 2.6372e-6 iCBsCa_conc= 1.5148e-6 iCBCaCa_conc= 0.14420e-6 CBsf_conc= 110.82e-6 CBCaf_conc= 10.549e-6 CBsCa_conc= 6.0595e-6 CBCaCa_conc= 0.57682e-6 PV_conc= 3.2066e-6 PVCa_conc= 16.252e-6 PVMg_conc= 60.541e-6 # Diffusion constant of Calcium DCST = 0.223e-9 # Diffusion constant of Calbindin (CB) DCB = 0.028e-9 # Diffusion constant of Parvalbumin (PV) DPV = 0.043e-9 #iCBsf-fast iCBsf1_f_kcst = 4.35e7 iCBsf1_b_kcst = 35.8 #iCBsCa iCBsCa_f_kcst = 0.55e7 iCBsCa_b_kcst = 2.6 #iCBsf_slow iCBsf2_f_kcst = 0.55e7 iCBsf2_b_kcst = 2.6 #iCBCaf iCBCaf_f_kcst = 4.35e7 iCBCaf_b_kcst = 35.8 #CBsf-fast CBsf1_f_kcst = 4.35e7 CBsf1_b_kcst = 35.8 #CBsCa CBsCa_f_kcst = 0.55e7 CBsCa_b_kcst = 2.6 #CBsf_slow CBsf2_f_kcst = 0.55e7 CBsf2_b_kcst = 2.6 #CBCaf CBCaf_f_kcst = 4.35e7 CBCaf_b_kcst = 35.8 #PVca PVca_f_kcst = 10.7e7 PVca_b_kcst = 0.95 #PVmg PVmg_f_kcst = 0.8e6 PVmg_b_kcst = 25 # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # #
CNS-OIST/STEPS_Example
publication_models/API_1/Anwar_J Neurosci_2013/extra/constants_withampa.py
Python
gpl-2.0
9,093
[ "Avogadro" ]
10e500a725629751c1ea30f7c10f3fc08bbf81861821fd4c1b7a422f5310539f
""" A Galaxy wrapper script for corrector-1.0 Peter Li - GigaScience and BGI-HK """ import optparse import os import shutil import subprocess import sys import tempfile import fnmatch def stop_err(msg): sys.stderr.write(msg) sys.exit() def cleanup_before_exit(tmp_dir): if tmp_dir and os.path.exists(tmp_dir): shutil.rmtree(tmp_dir) def html_report_from_directory(html_out, dir): html_out.write('<html>\n<head>\n</head>\n<body>\n<font face="arial">\n<p>Corrector outputs</p>\n<p/>\n') for dirname, dirnames, filenames in os.walk(dir): # Link supplementary documents in HTML file for file in filenames: if fnmatch.fnmatch(file, '*pair_*'): continue else: html_out.write('<p><a href="%s">%s</a></p>\n' % (file, file)) html_out.write('</font>\n</body>\n</html>\n') def main(): thread_num = 4 # Parse command line parser = optparse.OptionParser() # List of mandatory inputs and params parser.add_option("-i", "--filelist", dest="filelist") parser.add_option("-r", "--freq", dest="freq") parser.add_option("-n", "--kmer_index", dest="kmer_index") parser.add_option("-k", "--start_cutoff", dest="start_cutoff") parser.add_option("-e", "--end_cutoff", dest="end_cutoff") parser.add_option("-d", "--delta", dest="delta") parser.add_option("-s", "--seed_length", dest="seed_length") # Removed from galaxy interface to keep under own control # parser.add_option("-t", "--thread_num", dest="thread_num") parser.add_option("", "--file_format", dest="file_format") # Outputs for reads parser.add_option("", "--corrected_forward", dest="corrected_forward") parser.add_option("", "--corrected_reverse", dest="corrected_reverse") parser.add_option("", "--corr_filelist", dest="corr_filelist") opts, args = parser.parse_args() # Temp directory for data processing tmp_dir = tempfile.mkdtemp(prefix="tmp-corrector-") print tmp_dir # Set up command line call cmd = "Corrector_v1.0 -i %s -r %s -n %s -k %s -e %s -d %s -s %s -t %s -f %s -l 1 -g 0" % (opts.filelist, opts.freq, opts.kmer_index, opts.start_cutoff, opts.end_cutoff, opts.delta, opts.seed_length, thread_num, opts.file_format) print "Command: ", cmd # Execute Corrector try: tmp_out_file = tempfile.NamedTemporaryFile(dir=tmp_dir).name tmp_stdout = open(tmp_out_file, 'w') # Contains Corrector stdout log tmp_err_file = tempfile.NamedTemporaryFile(dir=tmp_dir).name tmp_stderr = open(tmp_err_file, 'w') # Perform Corrector call proc = subprocess.Popen(args=cmd, shell=True, cwd=tmp_dir, stdout=tmp_stdout, stderr=tmp_stderr) returncode = proc.wait() # Read tool stdout into galaxy stdout f = open(tmp_out_file) lines = f.readlines() for line in lines: sys.stdout.write(line) f.close() # get stderr, allowing for case where it's very large tmp_stderr = open(tmp_err_file, 'r') stderr = '' buffsize = 1048576 try: while True: stderr += tmp_stderr.read(buffsize) if not stderr or len(stderr) % buffsize != 0: break except OverflowError: pass tmp_stdout.close() tmp_stderr.close() # if returncode != 0: # raise Exception, stderr except Exception, e: raise Exception, 'Problem performing Corrector process: ' + str(e) # Need to move and rename files for galaxy for display multiple files filelist = open(opts.filelist) # # Read file paths in read.lst pair_index = 1 for path in filelist: # Read corrected forward and reverse files into outputs source = path.rstrip() + ".corr" if pair_index == 1: corrected_forward_in = open(opts.corrected_forward, 'w') file_out = open(source, 'r') data = file_out.read() corrected_forward_in.write(data) corrected_forward_in.close() file_out.close() if pair_index == 2: corrected_reverse_in = open(opts.corrected_reverse, 'w') file_out = open(source, 'r') data = file_out.read() corrected_reverse_in.write(data) corrected_reverse_in.close() file_out.close() pair_index += 1 if pair_index == 3: pair_index = 1 filelist.close() # Create corrected file list corrected_files_in = open(opts.corr_filelist, 'w') corrected_files_in.write(opts.corrected_forward + "\n") corrected_files_in.write(opts.corrected_reverse + "\n") corrected_files_in.close() # Clean up temp files cleanup_before_exit(tmp_dir) # Check results in output file if os.path.getsize(opts.corrected_forward) > 0: sys.stdout.write('Status complete') else: stop_err("The output is empty") if __name__ == "__main__": main()
gigascience/galaxy-bgisoap
tools/corrector1/corrector1_wrapper.py
Python
gpl-3.0
5,068
[ "Galaxy" ]
f431dcac8ba6e5dfc6685a3328e6cb2225df7196d40df8824b6ff5d0ece87ae3
# -*- coding: utf-8 -*- import os import logging import unittest from riboplot import config, ribocore # use testing configuration CFG = config.TestingConfig() logging.disable(logging.CRITICAL) # reference_orfs were obtained manually (UGENE, ORF finder) REFERENCE_ORFS = [{'start': 45, 'stop': 203, 'sequence': 'ATGATTGAGAGGGACGGCCGGGGGCATTCGTATTGCGCCGCTAGAGGTGAAATTCTTGGACCGGCGCAAGACGGACGAAAGCGAAAGCATTTGCCAAGAATGTTTTCATTAATCAAGAACGAAAGTCGGAGGTTCGAAGACGATCAGATACCGTCGTAG'}, {'start': 219, 'stop': 254, 'sequence': 'ATGCCGACCCGCGATCCGGCGGCGTTATTCCCATGA'}, {'start': 251, 'stop': 328, 'sequence': 'ATGACCCGCCGGGCAGCGTGCGGGAAACCACGAGTCTTTGGGTTCCGGGGGGAGTATGGTTGCAAAGCTGAAACTTAA'}, {'start': 306, 'stop': 374, 'sequence': 'ATGGTTGCAAAGCTGAAACTTAAAGGAATTGACGGAAGGGCACCACCAGGAGTGGAGCCTGCGGCTTAA'}, {'start': 465, 'stop': 512, 'sequence': 'ATGGCCGTTCTTAGTTGGTGGAGCGATTTGTCTGGTTCATTCCGATAA'}, {'start': 529, 'stop': 945, 'sequence': 'ATGCTAAATAGTTACGCGGCCCCGCGCGGTCGGCGTCCCAACTTCTTAGAGGGACAAGTGGCGTTCAGCCACGCGAGATGGAGCAATAACAGGTCTGTGATGCCCTTAGATGTCCGGGGCTGCACGCGCGCCACAATGGGCGGATCAACGTGTGCCTACCCTGCGCCGAGAGGCGCGGGTAACCCGTTGAACCCCGCTCGTGATTGGGACTGGGGCTTGAAACTGTTTCCCATCAACGAGGAATTCCCAGTAAGCGCAGGTCATAAGCTTGCGTTGATTAAGTCCCTGCCCTTTGTACACACCGCCCGTCGCTACTACCGATTGGATGGTTTAGTGAGGTCCTCGGATCGGCCCCGCCGGGGCTCCTCGCCGGGCCCTGGCGGAGCGCCGAGAAGACGATCAAACTTGATCCTCTAG'}, {'start': 606, 'stop': 617, 'sequence': 'ATGGAGCAATAA'}, {'start': 638, 'stop': 718, 'sequence': 'ATGTCCGGGGCTGCACGCGCGCCACAATGGGCGGATCAACGTGTGCCTACCCTGCGCCGAGAGGCGCGGGTAACCCGTTGA'}, {'start': 854, 'stop': 862, 'sequence': 'ATGGTTTAG'}] class BamTestCase(unittest.TestCase): """Check if all arguments sent on the command line are valid.""" def test_is_bam_valid(self): """Test if BAM file is valid.""" valid = ribocore.is_bam_valid(CFG.RIBO_FILE) self.assertTrue(valid) # test with a FASTA file (which is not BAM) self.assertRaises(ValueError, ribocore.is_bam_valid, CFG.TRANSCRIPTOME_FASTA) def test_bam_has_index(self): """Check if BAM file has an index.""" # RPF file has an index has_index = ribocore.bam_has_index(CFG.RIBO_FILE) self.assertTrue(has_index) # RNA file doesn't have an index has_index = ribocore.bam_has_index(CFG.RNA_FILE) self.assertFalse(has_index) def test_create_bam_index(self): """Index a BAM file.""" ribocore.create_bam_index(CFG.RNA_FILE) # check if index exists has_index = ribocore.bam_has_index(CFG.RNA_FILE) self.assertTrue(has_index) # remove index os.remove('{}.bai'.format(CFG.RNA_FILE)) class FastaTestCase(unittest.TestCase): def test_is_fasta_valid(self): """A valid FASTA file can be opened with pysam.FastaFile.""" self.assertTrue(ribocore.is_fasta_valid(CFG.TRANSCRIPTOME_FASTA)) def test_get_fasta_records(self): """Given a transcriptome fasta file and a transcript name, it should \ be possible to get the sequence and length of a given transcript. """ record = ribocore.get_fasta_records(CFG.TRANSCRIPTOME_FASTA, [CFG.TRANSCRIPT_NAME]) self.assertEqual(len(record[CFG.TRANSCRIPT_NAME]['sequence']), CFG.TRANSCRIPT_LENGTH) def test_get_fasta_record(self): """Get a single FASTA record from a transcriptome.""" record = ribocore.get_fasta_record(fasta_file=CFG.TRANSCRIPTOME_FASTA, transcript_name=CFG.TRANSCRIPT_NAME) self.assertEqual(record[CFG.TRANSCRIPT_NAME], CFG.TRANSCRIPT_SEQUENCE) self.assertEqual(len(record[CFG.TRANSCRIPT_NAME]), CFG.TRANSCRIPT_LENGTH) class RiboCoreTestCase(unittest.TestCase): def test_get_three_frame_orfs(self): """Get ORFs in frames 1, 2 and 3.""" orfs = ribocore.get_three_frame_orfs(sequence=CFG.TRANSCRIPT_SEQUENCE, starts=['ATG'], stops=['TAG', 'TAA', 'TGA']) # function should return the same ORFs as reference self.assertEqual(len(orfs), len(REFERENCE_ORFS)) for item in orfs: self.assertTrue(item in REFERENCE_ORFS) def test_get_longest_orf(self): """Get the longest ORF from a list.""" # longest ORF in reference is sequence with start 529 longest_orf = ribocore.get_longest_orf(REFERENCE_ORFS) self.assertEqual(longest_orf['start'], 529) def test_read_lengths_offsets(self): """If multiple read lengths, offsets given check if they are valid i.e., Each read length must have a corresponding offset. """
vimalkumarvelayudhan/riboplot
tests/test_ribocore.py
Python
bsd-3-clause
4,785
[ "pysam" ]
b212199096329107709a7c2d3ca7ae84b2c681e1712fd6ff50cf6232a7e04cdc
# coding: utf-8 """ Vericred API Vericred's API allows you to search for Health Plans that a specific doctor accepts. ## Getting Started Visit our [Developer Portal](https://developers.vericred.com) to create an account. Once you have created an account, you can create one Application for Production and another for our Sandbox (select the appropriate Plan when you create the Application). ## SDKs Our API follows standard REST conventions, so you can use any HTTP client to integrate with us. You will likely find it easier to use one of our [autogenerated SDKs](https://github.com/vericred/?query=vericred-), which we make available for several common programming languages. ## Authentication To authenticate, pass the API Key you created in the Developer Portal as a `Vericred-Api-Key` header. `curl -H 'Vericred-Api-Key: YOUR_KEY' "https://api.vericred.com/providers?search_term=Foo&zip_code=11215"` ## Versioning Vericred's API default to the latest version. However, if you need a specific version, you can request it with an `Accept-Version` header. The current version is `v3`. Previous versions are `v1` and `v2`. `curl -H 'Vericred-Api-Key: YOUR_KEY' -H 'Accept-Version: v2' "https://api.vericred.com/providers?search_term=Foo&zip_code=11215"` ## Pagination Endpoints that accept `page` and `per_page` parameters are paginated. They expose four additional fields that contain data about your position in the response, namely `Total`, `Per-Page`, `Link`, and `Page` as described in [RFC-5988](https://tools.ietf.org/html/rfc5988). For example, to display 5 results per page and view the second page of a `GET` to `/networks`, your final request would be `GET /networks?....page=2&per_page=5`. ## Sideloading When we return multiple levels of an object graph (e.g. `Provider`s and their `State`s we sideload the associated data. In this example, we would provide an Array of `State`s and a `state_id` for each provider. This is done primarily to reduce the payload size since many of the `Provider`s will share a `State` ``` { providers: [{ id: 1, state_id: 1}, { id: 2, state_id: 1 }], states: [{ id: 1, code: 'NY' }] } ``` If you need the second level of the object graph, you can just match the corresponding id. ## Selecting specific data All endpoints allow you to specify which fields you would like to return. This allows you to limit the response to contain only the data you need. For example, let's take a request that returns the following JSON by default ``` { provider: { id: 1, name: 'John', phone: '1234567890', field_we_dont_care_about: 'value_we_dont_care_about' }, states: [{ id: 1, name: 'New York', code: 'NY', field_we_dont_care_about: 'value_we_dont_care_about' }] } ``` To limit our results to only return the fields we care about, we specify the `select` query string parameter for the corresponding fields in the JSON document. In this case, we want to select `name` and `phone` from the `provider` key, so we would add the parameters `select=provider.name,provider.phone`. We also want the `name` and `code` from the `states` key, so we would add the parameters `select=states.name,states.code`. The id field of each document is always returned whether or not it is requested. Our final request would be `GET /providers/12345?select=provider.name,provider.phone,states.name,states.code` The response would be ``` { provider: { id: 1, name: 'John', phone: '1234567890' }, states: [{ id: 1, name: 'New York', code: 'NY' }] } ``` ## Benefits summary format Benefit cost-share strings are formatted to capture: * Network tiers * Compound or conditional cost-share * Limits on the cost-share * Benefit-specific maximum out-of-pocket costs **Example #1** As an example, we would represent [this Summary of Benefits &amp; Coverage](https://s3.amazonaws.com/vericred-data/SBC/2017/33602TX0780032.pdf) as: * **Hospital stay facility fees**: - Network Provider: `$400 copay/admit plus 20% coinsurance` - Out-of-Network Provider: `$1,500 copay/admit plus 50% coinsurance` - Vericred's format for this benefit: `In-Network: $400 before deductible then 20% after deductible / Out-of-Network: $1,500 before deductible then 50% after deductible` * **Rehabilitation services:** - Network Provider: `20% coinsurance` - Out-of-Network Provider: `50% coinsurance` - Limitations & Exceptions: `35 visit maximum per benefit period combined with Chiropractic care.` - Vericred's format for this benefit: `In-Network: 20% after deductible / Out-of-Network: 50% after deductible | limit: 35 visit(s) per Benefit Period` **Example #2** In [this other Summary of Benefits &amp; Coverage](https://s3.amazonaws.com/vericred-data/SBC/2017/40733CA0110568.pdf), the **specialty_drugs** cost-share has a maximum out-of-pocket for in-network pharmacies. * **Specialty drugs:** - Network Provider: `40% coinsurance up to a $500 maximum for up to a 30 day supply` - Out-of-Network Provider `Not covered` - Vericred's format for this benefit: `In-Network: 40% after deductible, up to $500 per script / Out-of-Network: 100%` **BNF** Here's a description of the benefits summary string, represented as a context-free grammar: ``` root ::= coverage coverage ::= (simple_coverage | tiered_coverage) (space pipe space coverage_modifier)? tiered_coverage ::= tier (space slash space tier)* tier ::= tier_name colon space (tier_coverage | not_applicable) tier_coverage ::= simple_coverage (space (then | or | and) space simple_coverage)* tier_limitation? simple_coverage ::= (pre_coverage_limitation space)? coverage_amount (space post_coverage_limitation)? (comma? space coverage_condition)? coverage_modifier ::= limit_condition colon space (((simple_coverage | simple_limitation) (semicolon space see_carrier_documentation)?) | see_carrier_documentation | waived_if_admitted | shared_across_tiers) waived_if_admitted ::= ("copay" space)? "waived if admitted" simple_limitation ::= pre_coverage_limitation space "copay applies" tier_name ::= "In-Network-Tier-2" | "Out-of-Network" | "In-Network" limit_condition ::= "limit" | "condition" tier_limitation ::= comma space "up to" space (currency | (integer space time_unit plural?)) (space post_coverage_limitation)? coverage_amount ::= currency | unlimited | included | unknown | percentage | (digits space (treatment_unit | time_unit) plural?) pre_coverage_limitation ::= first space digits space time_unit plural? post_coverage_limitation ::= (((then space currency) | "per condition") space)? "per" space (treatment_unit | (integer space time_unit) | time_unit) plural? coverage_condition ::= ("before deductible" | "after deductible" | "penalty" | allowance | "in-state" | "out-of-state") (space allowance)? allowance ::= upto_allowance | after_allowance upto_allowance ::= "up to" space (currency space)? "allowance" after_allowance ::= "after" space (currency space)? "allowance" see_carrier_documentation ::= "see carrier documentation for more information" shared_across_tiers ::= "shared across all tiers" unknown ::= "unknown" unlimited ::= /[uU]nlimited/ included ::= /[iI]ncluded in [mM]edical/ time_unit ::= /[hH]our/ | (((/[cC]alendar/ | /[cC]ontract/) space)? /[yY]ear/) | /[mM]onth/ | /[dD]ay/ | /[wW]eek/ | /[vV]isit/ | /[lL]ifetime/ | ((((/[bB]enefit/ plural?) | /[eE]ligibility/) space)? /[pP]eriod/) treatment_unit ::= /[pP]erson/ | /[gG]roup/ | /[cC]ondition/ | /[sS]cript/ | /[vV]isit/ | /[eE]xam/ | /[iI]tem/ | /[sS]tay/ | /[tT]reatment/ | /[aA]dmission/ | /[eE]pisode/ comma ::= "," colon ::= ":" semicolon ::= ";" pipe ::= "|" slash ::= "/" plural ::= "(s)" | "s" then ::= "then" | ("," space) | space or ::= "or" and ::= "and" not_applicable ::= "Not Applicable" | "N/A" | "NA" first ::= "first" currency ::= "$" number percentage ::= number "%" number ::= float | integer float ::= digits "." digits integer ::= /[0-9]/+ (comma_int | under_int)* comma_int ::= ("," /[0-9]/*3) !"_" under_int ::= ("_" /[0-9]/*3) !"," digits ::= /[0-9]/+ ("_" /[0-9]/+)* space ::= /[ \t]/+ ``` OpenAPI spec version: 1.0.0 Generated by: https://github.com/swagger-api/swagger-codegen.git Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. """ from pprint import pformat from six import iteritems import re class ProvidersGeocodeResponse(object): """ NOTE: This class is auto generated by the swagger code generator program. Do not edit the class manually. """ def __init__(self, meta=None, providers=None): """ ProvidersGeocodeResponse - a model defined in Swagger :param dict swaggerTypes: The key is attribute name and the value is attribute type. :param dict attributeMap: The key is attribute name and the value is json key in definition. """ self.swagger_types = { 'meta': 'Meta', 'providers': 'list[Provider]' } self.attribute_map = { 'meta': 'meta', 'providers': 'providers' } self._meta = meta self._providers = providers @property def meta(self): """ Gets the meta of this ProvidersGeocodeResponse. Meta-data :return: The meta of this ProvidersGeocodeResponse. :rtype: Meta """ return self._meta @meta.setter def meta(self, meta): """ Sets the meta of this ProvidersGeocodeResponse. Meta-data :param meta: The meta of this ProvidersGeocodeResponse. :type: Meta """ self._meta = meta @property def providers(self): """ Gets the providers of this ProvidersGeocodeResponse. Providers that fit the requested criterion. :return: The providers of this ProvidersGeocodeResponse. :rtype: list[Provider] """ return self._providers @providers.setter def providers(self, providers): """ Sets the providers of this ProvidersGeocodeResponse. Providers that fit the requested criterion. :param providers: The providers of this ProvidersGeocodeResponse. :type: list[Provider] """ self._providers = providers def to_dict(self): """ Returns the model properties as a dict """ result = {} for attr, _ in iteritems(self.swagger_types): value = getattr(self, attr) if isinstance(value, list): result[attr] = list(map( lambda x: x.to_dict() if hasattr(x, "to_dict") else x, value )) elif hasattr(value, "to_dict"): result[attr] = value.to_dict() elif isinstance(value, dict): result[attr] = dict(map( lambda item: (item[0], item[1].to_dict()) if hasattr(item[1], "to_dict") else item, value.items() )) else: result[attr] = value return result def to_str(self): """ Returns the string representation of the model """ return pformat(self.to_dict()) def __repr__(self): """ For `print` and `pprint` """ return self.to_str() def __eq__(self, other): """ Returns true if both objects are equal """ return self.__dict__ == other.__dict__ def __ne__(self, other): """ Returns true if both objects are not equal """ return not self == other
vericred/vericred-python
vericred_client/models/providers_geocode_response.py
Python
apache-2.0
12,870
[ "VisIt" ]
16c723949bf291aced74853c3b293ffac08968a0f65f18064045cdf73ac63b42
#### import the simple module from the paraview from paraview.simple import * #### disable automatic camera reset on 'Show' paraview.simple._DisableFirstRenderCameraReset() # create a new 'XML Unstructured Grid Reader' xMLUnstructuredGridReader1 = XMLUnstructuredGridReader(FileName=['/raid/home/ksansom/caseFiles/mri/VWI_proj/case4/fluent_dsa/vtk_out/calc_test_node_stats.vtu']) xMLUnstructuredGridReader1.PointArrayStatus = ['WSS', 'WSSG', 'absolute_pressure', 'TAWSS', 'TAWSSG', 'OSI', 'velocity'] # create a new 'XML Unstructured Grid Reader' xMLUnstructuredGridReader2 = XMLUnstructuredGridReader(FileName=['/raid/home/ksansom/caseFiles/mri/VWI_proj/case4/fluent_dsa/vtk_out/calc_test_node.vtu']) xMLUnstructuredGridReader2.PointArrayStatus = ['absolute_pressure', 'velocity', 'x_velocity', 'x_wall_shear', 'y_velocity', 'y_wall_shear', 'z_velocity', 'z_wall_shear', 'WSS', 'x_WSS_grad', 'y_WSS_grad', 'z_WSS_grad', 'WSSG'] # get animation scene animationScene1 = GetAnimationScene() # update animation scene based on data timesteps animationScene1.UpdateAnimationUsingDataTimeSteps() # get active view renderView1 = GetActiveViewOrCreate('RenderView') # uncomment following to set a specific view size # renderView1.ViewSize = [928, 595] # reset view to fit data renderView1.ResetCamera() # get color transfer function/color map for 'OSI' oSILUT = GetColorTransferFunction('OSI') # get opacity transfer function/opacity map for 'OSI' oSIPWF = GetOpacityTransferFunction('OSI') # show data in view xMLUnstructuredGridReader1Display = Show(xMLUnstructuredGridReader1, renderView1) # trace defaults for the display properties. xMLUnstructuredGridReader1Display.Representation = 'Surface' xMLUnstructuredGridReader1Display.ColorArrayName = ['POINTS', 'OSI'] xMLUnstructuredGridReader1Display.LookupTable = oSILUT xMLUnstructuredGridReader1Display.OSPRayScaleArray = 'OSI' xMLUnstructuredGridReader1Display.OSPRayScaleFunction = 'PiecewiseFunction' xMLUnstructuredGridReader1Display.SelectOrientationVectors = 'velocity' xMLUnstructuredGridReader1Display.ScaleFactor = 0.002641490660607815 xMLUnstructuredGridReader1Display.SelectScaleArray = 'OSI' xMLUnstructuredGridReader1Display.GlyphType = 'Arrow' xMLUnstructuredGridReader1Display.GlyphTableIndexArray = 'OSI' xMLUnstructuredGridReader1Display.DataAxesGrid = 'GridAxesRepresentation' xMLUnstructuredGridReader1Display.PolarAxes = 'PolarAxesRepresentation' xMLUnstructuredGridReader1Display.ScalarOpacityFunction = oSIPWF xMLUnstructuredGridReader1Display.ScalarOpacityUnitDistance = 0.0006752548306746431 xMLUnstructuredGridReader1Display.GaussianRadius = 0.0013207453303039074 xMLUnstructuredGridReader1Display.SetScaleArray = ['POINTS', 'OSI'] xMLUnstructuredGridReader1Display.ScaleTransferFunction = 'PiecewiseFunction' xMLUnstructuredGridReader1Display.OpacityArray = ['POINTS', 'OSI'] xMLUnstructuredGridReader1Display.OpacityTransferFunction = 'PiecewiseFunction' # reset view to fit data renderView1.ResetCamera() # show color bar/color legend xMLUnstructuredGridReader1Display.SetScalarBarVisibility(renderView1, True) # get color transfer function/color map for 'WSSG' wSSGLUT = GetColorTransferFunction('WSSG') # get opacity transfer function/opacity map for 'WSSG' wSSGPWF = GetOpacityTransferFunction('WSSG') # show data in view xMLUnstructuredGridReader2Display = Show(xMLUnstructuredGridReader2, renderView1) # trace defaults for the display properties. xMLUnstructuredGridReader2Display.Representation = 'Surface' xMLUnstructuredGridReader2Display.ColorArrayName = ['POINTS', 'WSSG'] xMLUnstructuredGridReader2Display.LookupTable = wSSGLUT xMLUnstructuredGridReader2Display.OSPRayScaleArray = 'WSSG' xMLUnstructuredGridReader2Display.OSPRayScaleFunction = 'PiecewiseFunction' xMLUnstructuredGridReader2Display.SelectOrientationVectors = 'velocity' xMLUnstructuredGridReader2Display.ScaleFactor = 0.002641490660607815 xMLUnstructuredGridReader2Display.SelectScaleArray = 'WSSG' xMLUnstructuredGridReader2Display.GlyphType = 'Arrow' xMLUnstructuredGridReader2Display.GlyphTableIndexArray = 'WSSG' xMLUnstructuredGridReader2Display.DataAxesGrid = 'GridAxesRepresentation' xMLUnstructuredGridReader2Display.PolarAxes = 'PolarAxesRepresentation' xMLUnstructuredGridReader2Display.ScalarOpacityFunction = wSSGPWF xMLUnstructuredGridReader2Display.ScalarOpacityUnitDistance = 0.0006752548306746431 xMLUnstructuredGridReader2Display.GaussianRadius = 0.0013207453303039074 xMLUnstructuredGridReader2Display.SetScaleArray = ['POINTS', 'WSSG'] xMLUnstructuredGridReader2Display.ScaleTransferFunction = 'PiecewiseFunction' xMLUnstructuredGridReader2Display.OpacityArray = ['POINTS', 'WSSG'] xMLUnstructuredGridReader2Display.OpacityTransferFunction = 'PiecewiseFunction' # show color bar/color legend xMLUnstructuredGridReader2Display.SetScalarBarVisibility(renderView1, True) # show data in view xMLUnstructuredGridReader2Display = Show(xMLUnstructuredGridReader2, renderView1) # hide color bar/color legend xMLUnstructuredGridReader2Display.SetScalarBarVisibility(renderView1, False) # hide data in view Hide(xMLUnstructuredGridReader1, renderView1) # Apply a preset using its name. Note this may not work as expected when presets have duplicate names. wSSGLUT.ApplyPreset('Preset', True) # Apply a preset using its name. Note this may not work as expected when presets have duplicate names. wSSGPWF.ApplyPreset('Preset', True) # Apply a preset using its name. Note this may not work as expected when presets have duplicate names. wSSGLUT.ApplyPreset('Preset', True) # Apply a preset using its name. Note this may not work as expected when presets have duplicate names. wSSGPWF.ApplyPreset('Preset', True) # set active source SetActiveSource(xMLUnstructuredGridReader1) # Apply a preset using its name. Note this may not work as expected when presets have duplicate names. oSILUT.ApplyPreset('Preset', True) # Apply a preset using its name. Note this may not work as expected when presets have duplicate names. oSIPWF.ApplyPreset('Preset', True) # create a new 'Extract Surface' extractSurface1 = ExtractSurface(Input=xMLUnstructuredGridReader1) # show data in view extractSurface1Display = Show(extractSurface1, renderView1) # trace defaults for the display properties. extractSurface1Display.Representation = 'Surface' extractSurface1Display.ColorArrayName = ['POINTS', 'OSI'] extractSurface1Display.LookupTable = oSILUT extractSurface1Display.OSPRayScaleArray = 'OSI' extractSurface1Display.OSPRayScaleFunction = 'PiecewiseFunction' extractSurface1Display.SelectOrientationVectors = 'velocity' extractSurface1Display.ScaleFactor = 0.002641490660607815 extractSurface1Display.SelectScaleArray = 'OSI' extractSurface1Display.GlyphType = 'Arrow' extractSurface1Display.GlyphTableIndexArray = 'OSI' extractSurface1Display.DataAxesGrid = 'GridAxesRepresentation' extractSurface1Display.PolarAxes = 'PolarAxesRepresentation' extractSurface1Display.GaussianRadius = 0.0013207453303039074 extractSurface1Display.SetScaleArray = ['POINTS', 'OSI'] extractSurface1Display.ScaleTransferFunction = 'PiecewiseFunction' extractSurface1Display.OpacityArray = ['POINTS', 'OSI'] extractSurface1Display.OpacityTransferFunction = 'PiecewiseFunction' # hide data in view Hide(xMLUnstructuredGridReader1, renderView1) # hide color bar/color legend extractSurface1Display.SetScalarBarVisibility(renderView1, False) # Hide the scalar bar for this color map if no visible data is colored by it. HideScalarBarIfNotNeeded(oSILUT, renderView1) # hide data in view Hide(extractSurface1, renderView1) # hide data in view Hide(xMLUnstructuredGridReader1, renderView1) # hide data in view Hide(xMLUnstructuredGridReader2, renderView1) # create a new 'Clip' clip1 = Clip(Input=xMLUnstructuredGridReader1) clip1.ClipType = 'Plane' clip1.Scalars = ['POINTS', 'OSI'] clip1.Value = -8.963760541398452 # init the 'Plane' selected for 'ClipType' clip1.ClipType.Origin = [0.019185381077859477, 0.008678421124464417, 0.019721650218845817] clip1.ClipType.Normal = [-0.9140283519495734, -0.03315688808077104, 0.40429295393952386] # toggle 3D widget visibility (only when running from the GUI) Show3DWidgets(proxy=clip1.ClipType) # show data in view clip1Display = Show(clip1, renderView1) # trace defaults for the display properties. clip1Display.Representation = 'Surface' clip1Display.ColorArrayName = ['POINTS', 'OSI'] clip1Display.LookupTable = oSILUT clip1Display.OSPRayScaleArray = 'OSI' clip1Display.OSPRayScaleFunction = 'PiecewiseFunction' clip1Display.SelectOrientationVectors = 'velocity' clip1Display.ScaleFactor = 0.0012495411559939385 clip1Display.SelectScaleArray = 'OSI' clip1Display.GlyphType = 'Arrow' clip1Display.GlyphTableIndexArray = 'OSI' clip1Display.DataAxesGrid = 'GridAxesRepresentation' clip1Display.PolarAxes = 'PolarAxesRepresentation' clip1Display.ScalarOpacityFunction = oSIPWF clip1Display.ScalarOpacityUnitDistance = 0.0004738466035644152 clip1Display.GaussianRadius = 0.0006247705779969693 clip1Display.SetScaleArray = ['POINTS', 'OSI'] clip1Display.ScaleTransferFunction = 'PiecewiseFunction' clip1Display.OpacityArray = ['POINTS', 'OSI'] clip1Display.OpacityTransferFunction = 'PiecewiseFunction' # hide color bar/color legend clip1Display.SetScalarBarVisibility(renderView1, False) # hide data in view Hide(clip1, renderView1) # create a new 'Clip' clip2 = Clip(Input=clip1) clip2.ClipType = 'Plane' clip2.Scalars = ['POINTS', 'OSI'] clip2.Value = -4.334532492423367 # init the 'Plane' selected for 'ClipType' clip2.ClipType.Origin = [0.016463510161933183, 0.013672129568797606, 0.020951286955119792] clip2.ClipType.Normal = [-0.14808092203454595, -0.9422076182376612, -0.30052761048581295] # toggle 3D widget visibility (only when running from the GUI) Show3DWidgets(proxy=clip2.ClipType) # show data in view clip2Display = Show(clip2, renderView1) # trace defaults for the display properties. clip2Display.Representation = 'Surface' clip2Display.ColorArrayName = ['POINTS', 'OSI'] clip2Display.LookupTable = oSILUT clip2Display.OSPRayScaleArray = 'OSI' clip2Display.OSPRayScaleFunction = 'PiecewiseFunction' clip2Display.SelectOrientationVectors = 'velocity' clip2Display.ScaleFactor = 0.0012495411559939385 clip2Display.SelectScaleArray = 'OSI' clip2Display.GlyphType = 'Arrow' clip2Display.GlyphTableIndexArray = 'OSI' clip2Display.DataAxesGrid = 'GridAxesRepresentation' clip2Display.PolarAxes = 'PolarAxesRepresentation' clip2Display.ScalarOpacityFunction = oSIPWF clip2Display.ScalarOpacityUnitDistance = 0.0004570996202003559 clip2Display.GaussianRadius = 0.0006247705779969693 clip2Display.SetScaleArray = ['POINTS', 'OSI'] clip2Display.ScaleTransferFunction = 'PiecewiseFunction' clip2Display.OpacityArray = ['POINTS', 'OSI'] clip2Display.OpacityTransferFunction = 'PiecewiseFunction' # hide color bar/color legend clip2Display.SetScalarBarVisibility(renderView1, False) # hide data in view Hide(clip2, renderView1) # create a new 'Clip' clip3 = Clip(Input=clip2) clip3.ClipType = 'Plane' clip3.Scalars = ['POINTS', 'OSI'] clip3.Value = -4.334532492423367 # init the 'Plane' selected for 'ClipType' clip3.ClipType.Origin = [0.016711021877632924, 0.009538794369297741, 0.02097712830393285] clip3.ClipType.Normal = [-0.2022641960827218, 0.8606682429625938, -0.46726798578405937] # toggle 3D widget visibility (only when running from the GUI) Show3DWidgets(proxy=clip3.ClipType) # show data in view clip3Display = Show(clip3, renderView1) # trace defaults for the display properties. clip3Display.Representation = 'Surface' clip3Display.ColorArrayName = ['POINTS', 'OSI'] clip3Display.LookupTable = oSILUT clip3Display.OSPRayScaleArray = 'OSI' clip3Display.OSPRayScaleFunction = 'PiecewiseFunction' clip3Display.SelectOrientationVectors = 'velocity' clip3Display.ScaleFactor = 0.0012495411559939385 clip3Display.SelectScaleArray = 'OSI' clip3Display.GlyphType = 'Arrow' clip3Display.GlyphTableIndexArray = 'OSI' clip3Display.DataAxesGrid = 'GridAxesRepresentation' clip3Display.PolarAxes = 'PolarAxesRepresentation' clip3Display.ScalarOpacityFunction = oSIPWF clip3Display.ScalarOpacityUnitDistance = 0.0004945866681605259 clip3Display.GaussianRadius = 0.0006247705779969693 clip3Display.SetScaleArray = ['POINTS', 'OSI'] clip3Display.ScaleTransferFunction = 'PiecewiseFunction' clip3Display.OpacityArray = ['POINTS', 'OSI'] clip3Display.OpacityTransferFunction = 'PiecewiseFunction' # hide color bar/color legend clip3Display.SetScalarBarVisibility(renderView1, False) # hide data in view Hide(clip3, renderView1) # create a new 'Clip' clip4 = Clip(Input=clip3) clip4.ClipType = 'Plane' clip4.Scalars = ['POINTS', 'OSI'] clip4.Value = -0.22316894760113207 # init the 'Plane' selected for 'ClipType' clip4.ClipType.Origin = [0.013133594821495129, 0.009304044349573848, 0.020326088763650343] clip4.ClipType.Normal = [0.5663667872989001, 0.8238781757097235, 0.02129351624181657] # toggle 3D widget visibility (only when running from the GUI) Show3DWidgets(proxy=clip4.ClipType) # show data in view clip4Display = Show(clip4, renderView1) # trace defaults for the display properties. clip4Display.Representation = 'Surface' clip4Display.ColorArrayName = ['POINTS', 'OSI'] clip4Display.LookupTable = oSILUT clip4Display.OSPRayScaleArray = 'OSI' clip4Display.OSPRayScaleFunction = 'PiecewiseFunction' clip4Display.SelectOrientationVectors = 'velocity' clip4Display.ScaleFactor = 0.0007063730619847775 clip4Display.SelectScaleArray = 'OSI' clip4Display.GlyphType = 'Arrow' clip4Display.GlyphTableIndexArray = 'OSI' clip4Display.DataAxesGrid = 'GridAxesRepresentation' clip4Display.PolarAxes = 'PolarAxesRepresentation' clip4Display.ScalarOpacityFunction = oSIPWF clip4Display.ScalarOpacityUnitDistance = 0.00037060974906745676 clip4Display.GaussianRadius = 0.00035318653099238875 clip4Display.SetScaleArray = ['POINTS', 'OSI'] clip4Display.ScaleTransferFunction = 'PiecewiseFunction' clip4Display.OpacityArray = ['POINTS', 'OSI'] clip4Display.OpacityTransferFunction = 'PiecewiseFunction' # hide color bar/color legend clip4Display.SetScalarBarVisibility(renderView1, False) # hide data in view Hide(clip4, renderView1) # create a new 'Clip' clip5 = Clip(Input=clip4) clip5.ClipType = 'Cylinder' clip5.Scalars = ['POINTS', 'OSI'] clip5.Value = -0.22316894760113207 # init the 'Plane' selected for 'ClipType' clip5.ClipType.Center = [0.018777387893322797, 0.01057777265095785, 0.021172440223998248] clip5.ClipType.Axis = [0.36272981418484473, 0.7899369662882306, -0.4943952580605674] clip5.ClipType.Radius = 0.0021806721886416867 # toggle 3D widget visibility (only when running from the GUI) Show3DWidgets(proxy=clip5.ClipType) # show data in view clip5Display = Show(clip5, renderView1) # trace defaults for the display properties. clip5Display.Representation = 'Surface' clip5Display.ColorArrayName = ['POINTS', 'OSI'] clip5Display.LookupTable = oSILUT clip5Display.OSPRayScaleArray = 'OSI' clip5Display.OSPRayScaleFunction = 'PiecewiseFunction' clip5Display.SelectOrientationVectors = 'velocity' clip5Display.ScaleFactor = 0.0005240732803940773 clip5Display.SelectScaleArray = 'OSI' clip5Display.GlyphType = 'Arrow' clip5Display.GlyphTableIndexArray = 'OSI' clip5Display.DataAxesGrid = 'GridAxesRepresentation' clip5Display.PolarAxes = 'PolarAxesRepresentation' clip5Display.ScalarOpacityFunction = oSIPWF clip5Display.ScalarOpacityUnitDistance = 0.0003557483835107667 clip5Display.GaussianRadius = 0.00026203664019703866 clip5Display.SetScaleArray = ['POINTS', 'OSI'] clip5Display.ScaleTransferFunction = 'PiecewiseFunction' clip5Display.OpacityArray = ['POINTS', 'OSI'] clip5Display.OpacityTransferFunction = 'PiecewiseFunction' # hide color bar/color legend clip5Display.SetScalarBarVisibility(renderView1, False) # Rescale transfer function oSILUT.RescaleTransferFunction(0.0, 0.5) # Rescale transfer function oSIPWF.RescaleTransferFunction(0.0, 0.5) # hide data in view Hide(clip5, renderView1) # create a new 'Slice' slice1 = Slice(Input=clip5) slice1.SliceType = 'Plane' slice1.SliceOffsetValues = [0.0] # init the 'Plane' selected for 'SliceType' slice1.SliceType.Origin = [0.01406339196240306, 0.011922889508895057, 0.02007914092262216] slice1.SliceType.Normal = [0.9166910278672833, -0.3166687289041705, 0.2437180246962479] # toggle 3D widget visibility (only when running from the GUI) Show3DWidgets(proxy=slice1.SliceType) # show data in view slice1Display = Show(slice1, renderView1) # trace defaults for the display properties. slice1Display.Representation = 'Surface' slice1Display.ColorArrayName = ['POINTS', 'OSI'] slice1Display.LookupTable = oSILUT slice1Display.OSPRayScaleArray = 'OSI' slice1Display.OSPRayScaleFunction = 'PiecewiseFunction' slice1Display.SelectOrientationVectors = 'velocity' slice1Display.ScaleFactor = 0.00044556772336363794 slice1Display.SelectScaleArray = 'OSI' slice1Display.GlyphType = 'Arrow' slice1Display.GlyphTableIndexArray = 'OSI' slice1Display.DataAxesGrid = 'GridAxesRepresentation' slice1Display.PolarAxes = 'PolarAxesRepresentation' slice1Display.GaussianRadius = 0.00022278386168181897 slice1Display.SetScaleArray = ['POINTS', 'OSI'] slice1Display.ScaleTransferFunction = 'PiecewiseFunction' slice1Display.OpacityArray = ['POINTS', 'OSI'] slice1Display.OpacityTransferFunction = 'PiecewiseFunction' # hide color bar/color legend slice1Display.SetScalarBarVisibility(renderView1, False) # toggle 3D widget visibility (only when running from the GUI) Hide3DWidgets(proxy=slice1.SliceType) # hide data in view Hide(slice1, renderView1) # create a new 'Tube' tube1 = Tube(Input=slice1) tube1.Scalars = ['POINTS', 'OSI'] tube1.Vectors = ['POINTS', 'velocity'] tube1.Radius = 5.0e-5 tube1.Capping = 0 tube1.NumberofSides = 8 # show data in view tube1Display = Show(tube1, renderView1) # trace defaults for the display properties. tube1Display.Representation = 'Surface' tube1Display.ColorArrayName = ['POINTS', 'OSI'] tube1Display.LookupTable = oSILUT tube1Display.OSPRayScaleArray = 'OSI' tube1Display.OSPRayScaleFunction = 'PiecewiseFunction' tube1Display.SelectOrientationVectors = 'velocity' tube1Display.ScaleFactor = 0.0004555660299956799 tube1Display.SelectScaleArray = 'OSI' tube1Display.GlyphType = 'Arrow' tube1Display.GlyphTableIndexArray = 'OSI' tube1Display.DataAxesGrid = 'GridAxesRepresentation' tube1Display.PolarAxes = 'PolarAxesRepresentation' tube1Display.GaussianRadius = 0.00022778301499783995 tube1Display.SetScaleArray = ['POINTS', 'OSI'] tube1Display.ScaleTransferFunction = 'PiecewiseFunction' tube1Display.OpacityArray = ['POINTS', 'OSI'] tube1Display.OpacityTransferFunction = 'PiecewiseFunction' # hide color bar/color legend tube1Display.SetScalarBarVisibility(renderView1, False) # set active source SetActiveSource(slice1) # reset view to fit data renderView1.ResetCamera() # create a new 'Clip' clip6 = Clip(Input=xMLUnstructuredGridReader2) clip6.ClipType = 'Plane' clip6.Scalars = ['POINTS', 'OSI'] # init the 'Plane' selected for 'ClipType' clip6.ClipType.Origin = clip1.ClipType.Origin clip6.ClipType.Normal = clip1.ClipType.Normal # toggle 3D widget visibility (only when running from the GUI) Show3DWidgets(proxy=clip6.ClipType) # show data in view clip6Display = Show(clip6, renderView1) # trace defaults for the display properties. clip6Display.Representation = 'Surface' clip6Display.ColorArrayName = ['POINTS', 'WSSG'] clip6Display.LookupTable = wSSGLUT clip6Display.OSPRayScaleArray = 'WSSG' clip6Display.OSPRayScaleFunction = 'PiecewiseFunction' clip6Display.SelectOrientationVectors = 'velocity' clip6Display.ScaleFactor = 0.0012495411559939385 clip6Display.SelectScaleArray = 'WSSG' clip6Display.GlyphType = 'Arrow' clip6Display.GlyphTableIndexArray = 'WSSG' clip6Display.DataAxesGrid = 'GridAxesRepresentation' clip6Display.PolarAxes = 'PolarAxesRepresentation' clip6Display.ScalarOpacityFunction = wSSGPWF clip6Display.ScalarOpacityUnitDistance = 0.0004738466035644152 clip6Display.GaussianRadius = 0.0006247705779969693 clip6Display.SetScaleArray = ['POINTS', 'WSSG'] clip6Display.ScaleTransferFunction = 'PiecewiseFunction' clip6Display.OpacityArray = ['POINTS', 'WSSG'] clip6Display.OpacityTransferFunction = 'PiecewiseFunction' # hide color bar/color legend clip6Display.SetScalarBarVisibility(renderView1, False) # hide data in view Hide(clip6, renderView1) # create a new 'Clip' clip7 = Clip(Input=clip6) clip7.ClipType = 'Plane' clip7.Scalars = ['POINTS', 'WSSG'] clip7.Value = clip3.Value # init the 'Plane' selected for 'ClipType' clip7.ClipType.Origin = clip2.ClipType.Origin clip7.ClipType.Normal = clip2.ClipType.Normal # toggle 3D widget visibility (only when running from the GUI) Show3DWidgets(proxy=clip7.ClipType) # show data in view clip7Display = Show(clip7, renderView1) # trace defaults for the display properties. clip7Display.Representation = 'Surface' clip7Display.ColorArrayName = ['POINTS', 'WSSG'] clip7Display.LookupTable = wSSGLUT clip7Display.OSPRayScaleArray = 'WSSG' clip7Display.OSPRayScaleFunction = 'PiecewiseFunction' clip7Display.SelectOrientationVectors = 'velocity' clip7Display.ScaleFactor = 0.0012495411559939385 clip7Display.SelectScaleArray = 'WSSG' clip7Display.GlyphType = 'Arrow' clip7Display.GlyphTableIndexArray = 'WSSG' clip7Display.DataAxesGrid = 'GridAxesRepresentation' clip7Display.PolarAxes = 'PolarAxesRepresentation' clip7Display.ScalarOpacityFunction = wSSGPWF clip7Display.ScalarOpacityUnitDistance = 0.0004570996202003559 clip7Display.GaussianRadius = 0.0006247705779969693 clip7Display.SetScaleArray = ['POINTS', 'WSSG'] clip7Display.ScaleTransferFunction = 'PiecewiseFunction' clip7Display.OpacityArray = ['POINTS', 'WSSG'] clip7Display.OpacityTransferFunction = 'PiecewiseFunction' # hide color bar/color legend clip7Display.SetScalarBarVisibility(renderView1, False) # hide data in view Hide(clip7, renderView1) # create a new 'Clip' clip8 = Clip(Input=clip7) clip8.ClipType = 'Plane' clip8.Scalars = ['POINTS', 'WSSG'] clip8.Value = clip4.Value # init the 'Plane' selected for 'ClipType' clip8.ClipType.Origin = clip3.ClipType.Origin clip8.ClipType.Normal = clip3.ClipType.Normal # toggle 3D widget visibility (only when running from the GUI) Show3DWidgets(proxy=clip8.ClipType) # show data in view clip8Display = Show(clip8, renderView1) # trace defaults for the display properties. clip8Display.Representation = 'Surface' clip8Display.ColorArrayName = ['POINTS', 'WSSG'] clip8Display.LookupTable = wSSGLUT clip8Display.OSPRayScaleArray = 'WSSG' clip8Display.OSPRayScaleFunction = 'PiecewiseFunction' clip8Display.SelectOrientationVectors = 'velocity' clip8Display.ScaleFactor = 0.0012495411559939385 clip8Display.SelectScaleArray = 'WSSG' clip8Display.GlyphType = 'Arrow' clip8Display.GlyphTableIndexArray = 'WSSG' clip8Display.DataAxesGrid = 'GridAxesRepresentation' clip8Display.PolarAxes = 'PolarAxesRepresentation' clip8Display.ScalarOpacityFunction = wSSGPWF clip8Display.ScalarOpacityUnitDistance = 0.0004945866681605259 clip8Display.GaussianRadius = 0.0006247705779969693 clip8Display.SetScaleArray = ['POINTS', 'WSSG'] clip8Display.ScaleTransferFunction = 'PiecewiseFunction' clip8Display.OpacityArray = ['POINTS', 'WSSG'] clip8Display.OpacityTransferFunction = 'PiecewiseFunction' # hide color bar/color legend clip8Display.SetScalarBarVisibility(renderView1, False) # hide data in view Hide(clip8, renderView1) # create a new 'Clip' clip9 = Clip(Input=clip8) clip9.ClipType = 'Plane' clip9.Scalars = ['POINTS', 'WSSG'] clip9.Value = 12858.09077513687 # init the 'Plane' selected for 'ClipType' clip9.ClipType.Origin = clip4.ClipType.Origin clip9.ClipType.Normal = clip4.ClipType.Normal # toggle 3D widget visibility (only when running from the GUI) Show3DWidgets(proxy=clip9.ClipType) # show data in view clip9Display = Show(clip9, renderView1) # trace defaults for the display properties. clip9Display.Representation = 'Surface' clip9Display.ColorArrayName = ['POINTS', 'WSSG'] clip9Display.LookupTable = wSSGLUT clip9Display.OSPRayScaleArray = 'WSSG' clip9Display.OSPRayScaleFunction = 'PiecewiseFunction' clip9Display.SelectOrientationVectors = 'velocity' clip9Display.ScaleFactor = 0.0007063730619847775 clip9Display.SelectScaleArray = 'WSSG' clip9Display.GlyphType = 'Arrow' clip9Display.GlyphTableIndexArray = 'WSSG' clip9Display.DataAxesGrid = 'GridAxesRepresentation' clip9Display.PolarAxes = 'PolarAxesRepresentation' clip9Display.ScalarOpacityFunction = wSSGPWF clip9Display.ScalarOpacityUnitDistance = 0.00037060974906745676 clip9Display.GaussianRadius = 0.00035318653099238875 clip9Display.SetScaleArray = ['POINTS', 'WSSG'] clip9Display.ScaleTransferFunction = 'PiecewiseFunction' clip9Display.OpacityArray = ['POINTS', 'WSSG'] clip9Display.OpacityTransferFunction = 'PiecewiseFunction' # hide color bar/color legend clip9Display.SetScalarBarVisibility(renderView1, False) # hide data in view Hide(clip9, renderView1) # create a new 'Clip' clip10 = Clip(Input=clip9) clip10.ClipType = 'Cylinder' clip10.Scalars = ['POINTS', 'WSSG'] clip10.Value = clip5.Value # init the 'Plane' selected for 'ClipType' clip10.ClipType.Center = clip5.ClipType.Center clip10.ClipType.Axis = clip5.ClipType.Axis clip10.ClipType.Radius = clip5.ClipType.Radius # toggle 3D widget visibility (only when running from the GUI) Show3DWidgets(proxy=clip10.ClipType) # show data in view clip10Display = Show(clip10, renderView1) # trace defaults for the display properties. clip10Display.Representation = 'Surface' clip10Display.ColorArrayName = ['POINTS', 'WSSG'] clip10Display.LookupTable = wSSGLUT clip10Display.OSPRayScaleArray = 'WSSG' clip10Display.OSPRayScaleFunction = 'PiecewiseFunction' clip10Display.SelectOrientationVectors = 'velocity' clip10Display.ScaleFactor = 0.0005240732803940773 clip10Display.SelectScaleArray = 'WSSG' clip10Display.GlyphType = 'Arrow' clip10Display.GlyphTableIndexArray = 'WSSG' clip10Display.DataAxesGrid = 'GridAxesRepresentation' clip10Display.PolarAxes = 'PolarAxesRepresentation' clip10Display.ScalarOpacityFunction = wSSGPWF clip10Display.ScalarOpacityUnitDistance = 0.0003557483835107667 clip10Display.GaussianRadius = 0.00026203664019703866 clip10Display.SetScaleArray = ['POINTS', 'WSSG'] clip10Display.ScaleTransferFunction = 'PiecewiseFunction' clip10Display.OpacityArray = ['POINTS', 'WSSG'] clip10Display.OpacityTransferFunction = 'PiecewiseFunction' # hide color bar/color legend clip10Display.SetScalarBarVisibility(renderView1, False) # Rescale transfer function oSILUT.RescaleTransferFunction(0.0, 0.5) # Rescale transfer function oSIPWF.RescaleTransferFunction(0.0, 0.5) # hide data in view Hide(clip10, renderView1) # create a new 'Slice' slice2 = Slice(Input=clip10) slice2.SliceType = 'Plane' slice2.SliceOffsetValues = [0.0] # init the 'Plane' selected for 'SliceType' slice2.SliceType.Origin = slice1.SliceType.Origin slice2.SliceType.Normal = slice1.SliceType.Normal # toggle 3D widget visibility (only when running from the GUI) Show3DWidgets(proxy=slice2.SliceType) # show data in view slice2Display = Show(slice2, renderView1) # trace defaults for the display properties. slice2Display.Representation = 'Surface' slice2Display.ColorArrayName = ['POINTS', 'WSSG'] slice2Display.LookupTable = wSSGLUT slice2Display.OSPRayScaleArray = 'WSSG' slice2Display.OSPRayScaleFunction = 'PiecewiseFunction' slice2Display.SelectOrientationVectors = 'velocity' slice2Display.ScaleFactor = 0.00044556772336363794 slice2Display.SelectScaleArray = 'WSSG' slice2Display.GlyphType = 'Arrow' slice2Display.GlyphTableIndexArray = 'WSSG' slice2Display.DataAxesGrid = 'GridAxesRepresentation' slice2Display.PolarAxes = 'PolarAxesRepresentation' slice2Display.GaussianRadius = 0.00022278386168181897 slice2Display.SetScaleArray = ['POINTS', 'WSSG'] slice2Display.ScaleTransferFunction = 'PiecewiseFunction' slice2Display.OpacityArray = ['POINTS', 'WSSG'] slice2Display.OpacityTransferFunction = 'PiecewiseFunction' # hide color bar/color legend slice2Display.SetScalarBarVisibility(renderView1, False) # toggle 3D widget visibility (only when running from the GUI) Hide3DWidgets(proxy=slice2.SliceType) # hide data in view Hide(slice2, renderView1) # create a new 'Tube' tube2 = Tube(Input=slice2) tube2.Scalars = ['POINTS', 'WSSG'] tube2.Vectors = ['POINTS', 'velocity'] tube2.Radius = 4.4556772336363794e-05 # show data in view tube2Display = Show(tube2, renderView1) # trace defaults for the display properties. tube2Display.Representation = 'Surface' tube2Display.ColorArrayName = ['POINTS', 'WSSG'] tube2Display.LookupTable = wSSGLUT tube2Display.OSPRayScaleArray = 'WSSG' tube2Display.OSPRayScaleFunction = 'PiecewiseFunction' tube2Display.SelectOrientationVectors = 'velocity' tube2Display.ScaleFactor = 0.0004555660299956799 tube2Display.SelectScaleArray = 'WSSG' tube2Display.GlyphType = 'Arrow' tube2Display.GlyphTableIndexArray = 'WSSG' tube2Display.DataAxesGrid = 'GridAxesRepresentation' tube2Display.PolarAxes = 'PolarAxesRepresentation' tube2Display.GaussianRadius = 0.00022778301499783995 tube2Display.SetScaleArray = ['POINTS', 'WSSG'] tube2Display.ScaleTransferFunction = 'PiecewiseFunction' tube2Display.OpacityArray = ['POINTS', 'WSSG'] tube2Display.OpacityTransferFunction = 'PiecewiseFunction' # hide color bar/color legend tube2Display.SetScalarBarVisibility(renderView1, False) # set active source SetActiveSource(slice2) # reset view to fit data renderView1.ResetCamera() # set active source SetActiveSource(xMLUnstructuredGridReader1) # show data in view xMLUnstructuredGridReader1Display = Show(xMLUnstructuredGridReader1, renderView1) # show color bar/color legend xMLUnstructuredGridReader1Display.SetScalarBarVisibility(renderView1, True) # reset view to fit data renderView1.ResetCamera() ReloadFiles(xMLUnstructuredGridReader1) # hide data in view Hide(xMLUnstructuredGridReader1, renderView1) #### saving camera placements for all active views # current camera placement for renderView1 renderView1.CameraPosition = [-0.050332399782713755, 0.031944983002028124, 0.005757153247374316] renderView1.CameraFocalPoint = [0.020720326341688633, 0.010470669716596603, 0.010644147405400872] renderView1.CameraViewUp = [0.004949270345919701, 0.2374388307550575, 0.9713898838122179] renderView1.CameraParallelScale = 0.0030018986837840496 #### uncomment the following to render all views # RenderAllViews() # alternatively, if you want to write images, you can use SaveScreenshot(...).
kayarre/Tools
vtk/paraview_case4_2.py
Python
bsd-2-clause
30,397
[ "ParaView" ]
a5ee0baff2c1046596623d02cac06973464722fb1f4a9462ef4f6b7b255b2c40
#!/usr/bin/python # # Created on Aug 25, 2016 # @author: Gaurav Rastogi (grastogi@avinetworks.com) # Eric Anderson (eanderson@avinetworks.com) # module_check: supported # # # This file is part of Ansible # # Ansible is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # Ansible is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with Ansible. If not, see <http://www.gnu.org/licenses/>. # ANSIBLE_METADATA = {'metadata_version': '1.1', 'status': ['preview'], 'supported_by': 'community'} DOCUMENTATION = ''' --- module: avi_scheduler author: Gaurav Rastogi (grastogi@avinetworks.com) short_description: Module for setup of Scheduler Avi RESTful Object description: - This module is used to configure Scheduler object - more examples at U(https://github.com/avinetworks/devops) requirements: [ avisdk ] version_added: "2.4" options: state: description: - The state that should be applied on the entity. default: present choices: ["absent","present"] backup_config_ref: description: - Backup configuration to be executed by this scheduler. - It is a reference to an object of type backupconfiguration. enabled: description: - Boolean flag to set enabled. - Default value when not specified in API or module is interpreted by Avi Controller as True. end_date_time: description: - Scheduler end date and time. frequency: description: - Frequency at which custom scheduler will run. - Allowed values are 0-60. frequency_unit: description: - Unit at which custom scheduler will run. - Enum options - SCHEDULER_FREQUENCY_UNIT_MIN, SCHEDULER_FREQUENCY_UNIT_HOUR, SCHEDULER_FREQUENCY_UNIT_DAY, SCHEDULER_FREQUENCY_UNIT_WEEK, - SCHEDULER_FREQUENCY_UNIT_MONTH. name: description: - Name of scheduler. required: true run_mode: description: - Scheduler run mode. - Enum options - RUN_MODE_PERIODIC, RUN_MODE_AT, RUN_MODE_NOW. run_script_ref: description: - Control script to be executed by this scheduler. - It is a reference to an object of type alertscriptconfig. scheduler_action: description: - Define scheduler action. - Enum options - SCHEDULER_ACTION_RUN_A_SCRIPT, SCHEDULER_ACTION_BACKUP. - Default value when not specified in API or module is interpreted by Avi Controller as SCHEDULER_ACTION_BACKUP. start_date_time: description: - Scheduler start date and time. tenant_ref: description: - It is a reference to an object of type tenant. url: description: - Avi controller URL of the object. uuid: description: - Unique object identifier of the object. extends_documentation_fragment: - avi ''' EXAMPLES = """ - name: Example to create Scheduler object avi_scheduler: controller: 10.10.25.42 username: admin password: something state: present name: sample_scheduler """ RETURN = ''' obj: description: Scheduler (api/scheduler) object returned: success, changed type: dict ''' from ansible.module_utils.basic import AnsibleModule try: from ansible.module_utils.avi import ( avi_common_argument_spec, HAS_AVI, avi_ansible_api) except ImportError: HAS_AVI = False def main(): argument_specs = dict( state=dict(default='present', choices=['absent', 'present']), backup_config_ref=dict(type='str',), enabled=dict(type='bool',), end_date_time=dict(type='str',), frequency=dict(type='int',), frequency_unit=dict(type='str',), name=dict(type='str', required=True), run_mode=dict(type='str',), run_script_ref=dict(type='str',), scheduler_action=dict(type='str',), start_date_time=dict(type='str',), tenant_ref=dict(type='str',), url=dict(type='str',), uuid=dict(type='str',), ) argument_specs.update(avi_common_argument_spec()) module = AnsibleModule( argument_spec=argument_specs, supports_check_mode=True) if not HAS_AVI: return module.fail_json(msg=( 'Avi python API SDK (avisdk>=17.1) is not installed. ' 'For more details visit https://github.com/avinetworks/sdk.')) return avi_ansible_api(module, 'scheduler', set([])) if __name__ == '__main__': main()
e-gob/plataforma-kioscos-autoatencion
scripts/ansible-play/.venv/lib/python2.7/site-packages/ansible/modules/network/avi/avi_scheduler.py
Python
bsd-3-clause
5,098
[ "VisIt" ]
8658e992a6acccedc8e347e11e08fa1204a5ddde766878be5a83f6a9b64959c0
import os from ase.test import NotAvailable from ase.lattice import bulk from ase.calculators.calculator import kpts2mp from ase.calculators.elk import ELK atoms = bulk('Al', 'bcc', a=4.0) # save ELK_SPECIES_PATH ELK_SPECIES_PATH = os.environ.get('ELK_SPECIES_PATH', None) if ELK_SPECIES_PATH is None: raise NotAvailable('ELK_SPECIES_PATH not set.') # find rmt of the default species sfile = os.path.join(os.environ['ELK_SPECIES_PATH'], 'elk.in') assert os.path.exists(sfile) slines = open(sfile, 'r').readlines() rmt_orig = {} for name in ['Al']: found = False for n, line in enumerate(slines): if line.find("'" + name + "'") > -1: begline = n - 1 for n, line in enumerate(slines[begline:]): if not line.strip(): # first empty line endline = n found = True break assert found # split needed because H is defined with comments rmt_orig[name] = float(slines[begline + 3].split()[0].strip()) assert rmt_orig['Al'] == 2.2 # 2.2 Bohr default # test1 # generate species with custom rmt 2.1 rmt = {'Al': 2.1} label = 'rmt2.1' atomsrmt = atoms.copy() os.environ['ELK_SPECIES_PATH'] = ELK_SPECIES_PATH atomsrmt.calc = ELK(tasks=0, label=label, rmt=rmt) # minimal calc atomsrmt.get_potential_energy() del atomsrmt.calc del atomsrmt # hack ELK_SPECIES_PATH to use custom species os.environ['ELK_SPECIES_PATH'] = os.path.abspath(label) + '/' # run calculation calc = ELK(tasks=0, label=label, rgkmax=4.0, kpts=tuple(kpts2mp(atoms, 2.0, even=True))) atoms.set_calculator(calc) e1 = atoms.get_potential_energy() # test2 # generate species with custom rmt 2.1 rmt = {'Al': -0.1} label = 'rmt0.1m' atomsrmt = atoms.copy() os.environ['ELK_SPECIES_PATH'] = ELK_SPECIES_PATH atomsrmt.calc = ELK(tasks=0, label=label, rmt=rmt) # minimal calc atomsrmt.get_potential_energy() del atomsrmt.calc del atomsrmt # hack ELK_SPECIES_PATH to use custom species os.environ['ELK_SPECIES_PATH'] = os.path.abspath(label) + '/' # run calculation calc = ELK(tasks=0, label=label, rgkmax=4.0, kpts=tuple(kpts2mp(atoms, 2.0, even=True))) atoms.set_calculator(calc) e2 = atoms.get_potential_energy() # restore ELK_SPECIES_PATH os.environ['ELK_SPECIES_PATH'] = ELK_SPECIES_PATH assert abs(e1 - e2) < 1.0e-4
askhl/ase
ase/test/elk/Al_rmt.py
Python
gpl-2.0
2,300
[ "ASE", "Elk" ]
b00529d423dc59d7aca5514bea0292f89968c07501312eb3b51f675747337beb
""" This module contains code for generating toy examples """ # This software is distributed under BSD 3-clause license (see LICENSE file). # # Authors: Soeren Sonnenburg import sys import parse import random from numpy.random import randn from numpy import ones, concatenate, array, transpose from esvm.mldata import DatasetFileFASTA, init_datasetfile from esvm.mldata_arff import DatasetFileARFF class MotifDataDef(object): motif = '' numseq = 0 seqlenmin = 0 seqlenmax = 0 posstart = 0 posend = 0 mutrate = 0.0 ################################################################################ # data generation functions def motifgen(motif, numseq, seqlenmin, seqlenmax, posstart, posend, mutrate): """Generate sequences with a particular motif at a particular location. Also allow a possible mutation rate of the motif. """ metadata = 'motifgen(%s,%d,%d,%d,%d,%d,%1.2f)' % (motif, numseq, seqlenmin, seqlenmax, posstart, posend, mutrate) acgt='acgt' seqlist = [] for i in xrange(0,numseq): str=[] ; seqlen=random.randint(seqlenmin,seqlenmax) ; for l in xrange(0,seqlen): str.append(acgt[random.randint(0,3)]) pos=random.randint(posstart,posend) ; for l in xrange(0,len(motif)): if (random.random()>=mutrate) and (pos+l<seqlen) and (pos+l>=0): str[pos+l]=motif[l] seqlist.append(''.join(str).upper()) return metadata, seqlist def cloudgen(numpoint, numfeat, fracpos, width): """Generate two Gaussian point clouds, centered around one and minus one.""" numpos = int(round(fracpos*numpoint)) numneg = numpoint - numpos metadata = 'cloudgen(%d,%d,%d,%3.2f)' % (numpos, numneg, numfeat, width) datapos = ones((numfeat, numpos)) + width*randn(numfeat, numpos) dataneg = -ones((numfeat, numneg)) + width*randn(numfeat, numneg) pointcloud = concatenate((datapos,dataneg),axis=1) labels = concatenate((ones(numpos),-ones(numneg))) return metadata, pointcloud, labels ################################################################################ # ARFF functions def arffwrite_real(filename, numpoint, numfeat, fracpos=0.5, width=1.0): """Write an ARFF file containing a vectorial dataset""" #import arff (metadata, pointcloud, labels) = cloudgen(numpoint, numfeat, fracpos, width) fp = init_datasetfile(filename,'vec') fp.comment = metadata fp.dataname = 'pointcloud' fp.writelines(pointcloud,labels) def arffwrite_sequence(filename,p, n): """Write an ARFF file containing a sequence dataset""" #import arff (metadatapos,seqlistpos) = motifgen(p.motif, p.numseq, p.seqlenmin, p.seqlenmax, p.posstart, p.posend, p.mutrate) (metadataneg,seqlistneg) = motifgen(n.motif, n.numseq, n.seqlenmin, n.seqlenmax, n.posstart, n.posend, n.mutrate) labels = concatenate((ones(len(seqlistpos)),-ones(len(seqlistneg)))) seqlist = seqlistpos + seqlistneg fp = init_datasetfile(filename,'seq') fp.comment = metadatapos+' '+metadataneg fp.dataname = 'motif' fp.writelines(seqlist,labels) def arffread(kernelname,datafilename): """Decide based on kernelname whether to read a sequence or vectorial file""" if kernelname == 'gauss' or kernelname == 'linear' or kernelname == 'poly' or kernelname == None: fp = init_datasetfile(datafilename,'vec') elif kernelname == 'wd' or kernelname == 'localalign' or kernelname == 'localimprove'\ or kernelname == 'spec' or kernelname == 'cumspec': fp = init_datasetfile(datafilename,'seq') elif kernelname == 'spec2' or kernelname == 'cumspec2': fp = init_datasetfile(datafilename,'mseq') else: print 'Unknown kernel in arffread' return fp.readlines() ################################################################################ # fasta functions def fastawrite_sequence(filename,p): """Write a FASTA file containing a sequence dataset""" import arff (metadata,seqlist) = motifgen(p.motif, p.numseq, p.seqlenmin, p.seqlenmax, p.posstart, p.posend, p.mutrate) labels = ones(len(seqlist)) fp = init_datasetfile(filename,'seq') fp.writelines(seqlist,labels) def fastaread(fnamepos,fnameneg=None): """Read two fasta files, the first positive, the second negative""" fpos = init_datasetfile(fnamepos,'seq') (fa1,lab1) = fpos.readlines() if fnameneg is not None: fneg = init_datasetfile(fnameneg,'seq') (fa2,lab2) = fneg.readlines() print 'positive: %d, negative %d' % (len(fa1),len(fa2)) all_labels = concatenate((ones(len(fa1)),-ones(len(fa2)))) all_examples = fa1 + fa2 else: all_examples = fa1 all_labels = ones(len(fa1)) return all_examples, all_labels
besser82/shogun
applications/easysvm/esvm/datafuncs.py
Python
bsd-3-clause
4,836
[ "Gaussian" ]
99ad70e3863dfb6e73774ce2d6e679d5178ce4b91d73a9f511179e2595b2d26b
""" Author: Ang Ming Liang Please run the following command before running the script wget -q https://raw.githubusercontent.com/sayantanauddy/vae_lightning/main/data.py or curl https://raw.githubusercontent.com/sayantanauddy/vae_lightning/main/data.py > data.py Then, make sure to get your kaggle.json from kaggle.com then run mkdir /root/.kaggle cp kaggle.json /root/.kaggle/kaggle.json chmod 600 /root/.kaggle/kaggle.json rm kaggle.json to copy kaggle.json into a folder first """ import torch import torch.nn as nn import torch.nn.functional as F import torchvision.transforms as transforms from pytorch_lightning import LightningModule, Trainer from data import CelebADataModule from argparse import ArgumentParser IMAGE_SIZE = 64 CROP = 128 DATA_PATH = "kaggle" trans = [] trans.append(transforms.RandomHorizontalFlip()) if CROP > 0: trans.append(transforms.CenterCrop(CROP)) trans.append(transforms.Resize(IMAGE_SIZE)) trans.append(transforms.ToTensor()) transform = transforms.Compose(trans) class VAE(LightningModule): """ Standard VAE with Gaussian Prior and approx posterior. """ def __init__( self, input_height: int, hidden_dims = None, in_channels = 3, enc_out_dim: int = 512, kl_coeff: float = 0.1, latent_dim: int = 256, lr: float = 1e-4 ): """ Args: input_height: height of the images enc_type: option between resnet18 or resnet50 first_conv: use standard kernel_size 7, stride 2 at start or replace it with kernel_size 3, stride 1 conv maxpool1: use standard maxpool to reduce spatial dim of feat by a factor of 2 enc_out_dim: set according to the out_channel count of encoder used (512 for resnet18, 2048 for resnet50) kl_coeff: coefficient for kl term of the loss latent_dim: dim of latent space lr: learning rate for Adam """ super(VAE, self).__init__() self.save_hyperparameters() self.lr = lr self.kl_coeff = kl_coeff self.enc_out_dim = enc_out_dim self.latent_dim = latent_dim self.input_height = input_height modules = [] if hidden_dims is None: hidden_dims = [32, 64, 128, 256, 512] # Build Encoder for h_dim in hidden_dims: modules.append( nn.Sequential( nn.Conv2d(in_channels, out_channels=h_dim, kernel_size= 3, stride= 2, padding = 1), nn.BatchNorm2d(h_dim), nn.LeakyReLU()) ) in_channels = h_dim self.encoder = nn.Sequential(*modules) self.fc_mu = nn.Linear(hidden_dims[-1]*4, latent_dim) self.fc_var = nn.Linear(hidden_dims[-1]*4, latent_dim) # Build Decoder modules = [] self.decoder_input = nn.Linear(latent_dim, hidden_dims[-1] * 4) hidden_dims.reverse() for i in range(len(hidden_dims) - 1): modules.append( nn.Sequential( nn.ConvTranspose2d(hidden_dims[i], hidden_dims[i + 1], kernel_size=3, stride = 2, padding=1, output_padding=1), nn.BatchNorm2d(hidden_dims[i + 1]), nn.LeakyReLU()) ) self.decoder = nn.Sequential(*modules) self.final_layer = nn.Sequential( nn.ConvTranspose2d(hidden_dims[-1], hidden_dims[-1], kernel_size=3, stride=2, padding=1, output_padding=1), nn.BatchNorm2d(hidden_dims[-1]), nn.LeakyReLU(), nn.Conv2d(hidden_dims[-1], out_channels= 3, kernel_size= 3, padding= 1), nn.Sigmoid()) @staticmethod def pretrained_weights_available(): return list(VAE.pretrained_urls.keys()) def from_pretrained(self, checkpoint_name): if checkpoint_name not in VAE.pretrained_urls: raise KeyError(str(checkpoint_name) + ' not present in pretrained weights.') return self.load_from_checkpoint(VAE.pretrained_urls[checkpoint_name], strict=False) def forward(self, x): mu, log_var = self.encode(x) p, q, z = self.sample(mu, log_var) return self.decode(z) def encode(self, x): x = self.encoder(x) x = torch.flatten(x, start_dim=1) mu = self.fc_mu(x) log_var = self.fc_var(x) return mu, log_var def _run_step(self, x): mu, log_var = self.encode(x) p, q, z = self.sample(mu, log_var) return z, self.decode(z), p, q def decode(self, z): result = self.decoder_input(z) result = result.view(-1, 512, 2, 2) result = self.decoder(result) result = self.final_layer(result) return result def sample(self, mu, log_var): std = torch.exp(log_var / 2) p = torch.distributions.Normal(torch.zeros_like(mu), torch.ones_like(std)) q = torch.distributions.Normal(mu, std) z = q.rsample() return p, q, z def step(self, batch, batch_idx): x, y = batch z, x_hat, p, q = self._run_step(x) recon_loss = F.mse_loss(x_hat, x, reduction='mean') log_qz = q.log_prob(z) log_pz = p.log_prob(z) kl = log_qz - log_pz kl = kl.mean() kl *= self.kl_coeff loss = kl + recon_loss logs = { "recon_loss": recon_loss, "kl": kl, "loss": loss, } return loss, logs def training_step(self, batch, batch_idx): loss, logs = self.step(batch, batch_idx) self.log_dict({f"train_{k}": v for k, v in logs.items()}, on_step=True, on_epoch=False) return loss def validation_step(self, batch, batch_idx): loss, logs = self.step(batch, batch_idx) self.log_dict({f"val_{k}": v for k, v in logs.items()}) return loss def configure_optimizers(self): return torch.optim.Adam(self.parameters(), lr=self.lr) if __name__ == "__main__": parser = ArgumentParser(description='Hyperparameters for our experiments') parser.add_argument('--latent-dim', type=int, default=256, help="size of latent dim for our vae") parser.add_argument('--epochs', type=int, default=50, help="num epochs") parser.add_argument('--gpus', type=int, default=1, help="gpus, if no gpu set to 0, to run on all gpus set to -1") parser.add_argument('--bs', type=int, default=500, help="batch size") parser.add_argument('--kl-coeff', type=int, default=5, help="kl coeff aka beta term in the elbo loss function") parser.add_argument('--lr', type=int, default=0.01, help="learning rate") hparams = parser.parse_args() m = VAE(input_height=IMAGE_SIZE, latent_dim=hparams.latent_dim, kl_coeff=hparams.kl_coeff, lr=hparams.lr) runner = Trainer(gpus = hparams.gpus, max_epochs = hparams.epochs) dm = CelebADataModule(data_dir=DATA_PATH, target_type='attr', train_transform=transform, val_transform=transform, download=True, batch_size=hparams.bs) runner.fit(m, datamodule=dm) torch.save(m.state_dict(), "vae-celeba-conv.ckpt")
probml/pyprobml
vae/standalone/vae_celeba_lightning.py
Python
mit
7,878
[ "Gaussian" ]
2c5634aa58705e0a2db08f94108adc35fae311dee26ed3b711930ed0850a570a
import time import random def cls(): for i in range(200): print("") def cool(): wn = random.randrange(0,27) if wn == 1: return "█ Now under New Management! █" #Avg line to line distance: 56 elif wn == 2: return "█ Kappa! █" #Unfortunately, We're using prng to generate these "Random" numbers. Seems like we get the same number a couple times. elif wn == 3: return "█ Now with more sayings! █" elif wn == 4: return "█ Plot twist! █" elif wn == 5: return "█ Totally not a virus, Trust me i'm a dolphin! █" elif wn == 6: return "█ Now On GitHub! █" elif wn == 7: return "█ Unsupported! █" elif wn == 8: return "█ 01110111 01101111 01110111 00100001 █" elif wn == 9: return "█ >Install Gentoo! █" elif wn == 10: return "█ Welcome to the botnet! █" elif wn == 11: return "█ Now with Blast Processing! █" elif wn == 12: return "█ Your version of Flash Player is out of date! █" elif wn == 13: return "█ Uses UTF-8 Encoding! █" elif wn == 14: return "█ No Easter Eggs! █" elif wn == 15: return "█Pleasehelpmeivebeentrappedwritingwittylinesforthepastmon█" elif wn == 16: return "█ Ignore that! █" elif wn == 17: return "█ Made With GameMaker! █" elif wn == 18: return "█ I'm really hoping that SOEvm will be finished soon █" elif wn == 19: return "█ EOF inside string starting at line 891743 █" elif wn == 20: return "█ Everything probably still works! █" elif wn == 21: return "█Symmet---------------------|----------------------rical!█" elif wn == 22: return "█ IT'S SNOWING OUTSIDE GUYS! █" elif wn == 23: return "█ a day old meme █" elif wn == 24: return "█ Oh, FiddleSticks! █" elif wn == 25: return "█ @echo off █" elif wn == 26: return "█ Coded in Batch! █" else: return "█ Unimplemented! █" def load(): cls() print("▄████████████████████████████████████████████████████████▄") print("█▀ ▀█") print("█ PySOE DEV █") print("█ (Python Simulated Operating System Enviroment) █") print("█ v0.03a █") print("█ Updated on 12/11/16 █") print(cool()) print("█▄ ▄█") print("▀████████████████████████████████████████████████████████▀") for i in range(7): print("") print("Type '-help' to get started.") print("") funct() def funct(): func = input() if func == "-listcommands" or func == "-help": print("-listcommands: Lists Commands") print("-help: Lists Commands") print("-time: Shows System Time") print("-ver or -version: Shows OS version") print("-print or -pr: Prints to display") print("-prog or -programs: Lists all available installed programs") print("-ext or -extras: Extra side commands") print("-inst or -install: Installs a new program into your program list.") print("") funct() elif func == "-time": print(time.asctime()) print("") funct() elif func == "-inst" or func == "-install": print("") print("Welcome to the Program Installer.") print("") print("Please make sure you have the program you want to install in the same directory as pysoe_shell.py") print("") print("What is the name of the program you will install? (Case Sensitive!) or type 'Cancel to cancel.") print("") inst = input("-inst: ") if inst == "cancel" or inst == "Cancel": print() funct() else: f = open("progs.txt","a",encoding='utf-7') f.write("\n") f.write(inst) f.flush() print("") print("Completed Installation Successfully!") print("") funct() elif func == "-ver" or func == "-version": print("PySOE v0.03a Created on 12/11/16") print("") funct() elif func == "-print" or func == "-pr": print1 = input("-pr: ") print("") print(print1) print("") funct() elif func == "-prog" or func == "-programs": print("") print("Your installed programs are:") f = open("progs.txt") print(f.read()) print("") print("Run a program? Y/N") print("") progprompt = input(">") if progprompt == "y" or progprompt == "Y": print("") print("Input a program name (Case Sensitive) or type 'Cancel' to cancel.") prog = input(">") if prog == "cancel" or prog == "Cancel": funct() else: print("") print("Now Loading",prog) time.sleep(2) __import__(prog) elif progprompt == "n" or progprompt == "N": print("") funct() else: print("Unsupported command!") funct() elif func == "-ext" or func == "-extras": print("") print("Extra commands are:") print("-beep or -boop: Beep") print("-his or -history: History of PYOS") print("") funct() elif func == "-beep" or func == "-boop": import winsound print("") Freq = input("Enter Frequency in Hertz: ") Dur = input("Enter Length in Milliseconds: ") winsound.Beep(int(Freq),int(Dur)) print("") print("done") print("") funct() elif func == "-his" or func == "-history": print("") print(" The History of PySOE (Python Simulated Operating System Environment)") print("") print("-------------------------------------------------------------------------------------------") print(" The first beginnings of PySOE started somewhere around October of 2015") print(" The first version didn't have much, just a fake login screen and") print(" a fake loading screen. There were only three commands. These commands inclue") print(" -help, -commands, and -ver. Those were all carried over. This program was") print(" started in my High School's Computer Science club while I was bored") print(" This 'OS' is heavily inspired by DOS, PC-DOS, and MS-DOS which is very") print(" evident by my functions that I have made. Most of them come from various") print(" DOS'. The first program written for PySOE was 'PYGraph' by Carson Goodwin") print(" which was not originally written for PySOE, but was adapted after v0.02c was") print(" published to GitHub. This is the most important parts of the whole history of PySOE.") print(" Hopefully many changes will come to this, most likely repurposing this High School Project") print("") print("-------------------------------------------------------------------------------------------") funct() else: print("bad sytnax") print("") funct() load()
LTEGaming/PySOE
Main-Dev/pysoe_shell.py
Python
bsd-3-clause
8,782
[ "BLAST" ]
3cac434f080151afadd41a425395cddf7b5745341b00d0c80347e526e5f11fa5
#!/usr/bin/python2 """ run bowtie with specified parameter file """ import subprocess from logging import getLogger import os import shlex import argparse import csv from glob import glob from multiprocessing.pool import ThreadPool logger = getLogger('pijp.bowtie_wrapper') def build_bowtie_command(fastq_file, index_file, number_of_threads, output_dir, extra_params): base_fastq = os.path.splitext(os.path.basename(fastq_file))[0] samfile = os.path.join(output_dir, base_fastq + ".sam") ## no-hd means no header lines. ## -p is for the number of rows. bowtie_cmd = "bowtie2 -p {0} {1} -x {2} -U {3} -S {4} ".format(number_of_threads, extra_params, index_file, fastq_file, samfile) return bowtie_cmd def run_cmd((cmd,fastq_file)): """ Run the command, and return the stderr. """ logger.info("ran : " + cmd) pro = subprocess.Popen(cmd, shell=True, stderr = subprocess.PIPE) (x, stderr) = pro.communicate() assert (pro.returncode == 0 ), "bowtie error %d : %s" % (pro.returncode, stderr) new_row = ( [fastq_file] + get_stats(stderr.splitlines()) ) logger.info("finished : " + cmd) return new_row def main(input_files, index_file, number_of_threads, output_dir, bowtie_report_name,extra_params,procs=10): report = [] ht_col2 = [] base_names = [] cmds = [] for fastq_file in input_files: base_names += [os.path.splitext(os.path.basename(fastq_file))[0]] # we need base_names for heading the matrix file. bt2_cmd = build_bowtie_command(fastq_file, index_file, number_of_threads, output_dir, extra_params) cmds.append((bt2_cmd,fastq_file)) ht_col1 = "\n".join(base_names) pool = ThreadPool(int(procs)) results = pool.map(run_cmd, cmds) for res in results: htout = "\t".join(res) ht_col2.append(htout) matrix_header = "\t".join(['#sample','total', 'not_aligned', 'aligned_once', 'multi_aligned', '% mapped']) + "\n" matrix = "\n".join(ht_col2) filename = os.path.join(output_dir, bowtie_report_name) with open(filename, 'wb') as f: f.write(matrix_header) f.write(matrix) def get_stats(bt_stderr): ## Write all warnings to log, and skip them. # For millions of warnings this takes too long.. #while bt_stderr[0].startswith("Warning"): # logger.info("BOWTIE : " + bt_stderr[0]) # bt_stderr.pop(0) if len(bt_stderr) > 5: logger.info("Bowtie probably had {0} warnings [e.g. read too small]".format(len(bt_stderr)-4)) bt_stderr = bt_stderr[-5:] if int(bt_stderr[0].split()[0]) != 0 : total = str(int(bt_stderr[0].split()[0])) not_aligned = str(int(bt_stderr[1].split()[0])) aligned = str(int(bt_stderr[2].split()[0])) multi_aligned = str(int(bt_stderr[3].split()[0])) mapped_percent = bt_stderr[4].split()[0] return [total, not_aligned, aligned, multi_aligned, mapped_percent] else: return ['0','0','0','0','0']
yanailab/CEL-Seq-pipeline
bowtie_wrapper.py
Python
gpl-3.0
3,008
[ "Bowtie" ]
6a849f9529c68686ea38660523fbabd6d0feb90a5b63935b473f4ebb011c29d3
# coding: utf-8 from __future__ import unicode_literals import copy import glob import json import os from unittest import TestCase import unittest from pymatgen import Molecule from pymatgen.io.qchemio import QcTask, QcInput, QcOutput __author__ = 'xiaohuiqu' test_dir = os.path.join(os.path.dirname(__file__), "..", "..", "..", 'test_files', "molecules") coords = [[0.000000, 0.000000, 0.000000], [0.000000, 0.000000, 1.089000], [1.026719, 0.000000, -0.363000], [-0.513360, -0.889165, -0.363000], [-0.513360, 0.889165, -0.363000]] mol = Molecule(["C", "H", "H", "H", "Cl"], coords) coords2 = [[0.0, 0.0, -2.4], [0.0, 0.0, 0.0], [0.0, 0.0, 2.4]] heavy_mol = Molecule(["Br", "Cd", "Br"], coords2) coords3 = [[2.632273, -0.313504, -0.750376], [3.268182, -0.937310, -0.431464], [2.184198, -0.753305, -1.469059]] water_mol = Molecule(["O", "H", "H"], coords3) class TestQcTask(TestCase): def elementary_io_verify(self, text, qctask): self.to_and_from_dict_verify(qctask) self.from_string_verify(contents=text, ref_dict=qctask.as_dict()) def to_and_from_dict_verify(self, qctask): """ Helper function. This function should be called in each specific test. """ d1 = qctask.as_dict() qc2 = QcTask.from_dict(d1) d2 = qc2.as_dict() self.assertEqual(d1, d2) def from_string_verify(self, contents, ref_dict): qctask = QcTask.from_string(contents) d2 = qctask.as_dict() self.assertEqual(ref_dict, d2) def test_read_zmatrix(self): contents = '''$moLEcule 1 2 S C 1 1.726563 H 2 1.085845 1 119.580615 C 2 1.423404 1 114.230851 3 -180.000000 0 H 4 1.084884 2 122.286346 1 -180.000000 0 C 4 1.381259 2 112.717365 1 0.000000 0 H 6 1.084731 4 127.143779 2 -180.000000 0 C 6 1.415867 4 110.076147 2 0.000000 0 F 8 1.292591 6 124.884374 4 -180.000000 0 $end $reM BASIS = 6-31+G* EXCHANGE = B3LYP jobtype = freq $end ''' qctask = QcTask.from_string(contents) ans = '''$molecule 1 2 S 0.00000000 0.00000000 0.00000000 C 0.00000000 0.00000000 1.72656300 H -0.94431813 0.00000000 2.26258784 C 1.29800105 -0.00000002 2.31074808 H 1.45002821 -0.00000002 3.38492732 C 2.30733813 -0.00000003 1.36781908 H 3.37622632 -0.00000005 1.55253338 C 1.75466906 -0.00000003 0.06427152 F 2.44231414 -0.00000004 -1.03023099 $end $rem jobtype = freq exchange = b3lyp basis = 6-31+g* $end ''' ans_tokens = ans.split('\n') ans_text_part = ans_tokens[:2] + ans_tokens[11:] ans_coords_part = ans_tokens[2:11] converted_tokens = str(qctask).split('\n') converted_text_part = converted_tokens[:2] + converted_tokens[11:] converted_coords_part = converted_tokens[2:11] self.assertEqual(ans_text_part, converted_text_part) for ans_coords, converted_coords in zip(ans_coords_part, converted_coords_part): ans_coords_tokens = ans_coords.split() converted_coords_tokens = converted_coords.split() self.assertEqual(ans_coords_tokens[0], converted_coords_tokens[0]) xyz1 = ans_coords_tokens[1:] xyz2 = converted_coords_tokens[1:] for t1, t2 in zip(xyz1, xyz2): self.assertTrue(abs(float(t1)-float(t2)) < 0.0001) def test_no_mol(self): ans = '''$comment Test Methane $end $molecule -1 2 read $end $rem jobtype = sp exchange = b3lyp basis = 6-31+g* $end ''' qctask = QcTask(molecule="READ", title="Test Methane", exchange="B3LYP", jobtype="SP", charge=-1, spin_multiplicity=2, basis_set="6-31+G*") self.assertEqual(str(qctask), ans) self.elementary_io_verify(ans, qctask) def test_simple_basis_str(self): ans = '''$comment Test Methane $end $molecule 0 1 C 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 1.08900000 H 1.02671900 0.00000000 -0.36300000 H -0.51336000 -0.88916500 -0.36300000 Cl -0.51336000 0.88916500 -0.36300000 $end $rem jobtype = sp exchange = b3lyp basis = 6-31+g* $end ''' qctask = QcTask(mol, title="Test Methane", exchange="B3LYP", jobtype="SP", basis_set="6-31+G*") self.assertEqual(str(qctask), ans) self.elementary_io_verify(ans, qctask) def test_fragmented_molecule(self): mol1 = copy.deepcopy(mol) mol1.set_charge_and_spin(1, 2) mol2 = copy.deepcopy(water_mol) mol2.set_charge_and_spin(-1, 2) qctask = QcTask([mol1, mol2], title="Test Fragments", exchange="B3LYP", jobtype="bsse", charge=0, spin_multiplicity=3, basis_set="6-31++G**") ans = """$comment Test Fragments $end $molecule 0 3 -- 1 2 C 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 1.08900000 H 1.02671900 0.00000000 -0.36300000 H -0.51336000 -0.88916500 -0.36300000 Cl -0.51336000 0.88916500 -0.36300000 -- -1 2 O 2.63227300 -0.31350400 -0.75037600 H 3.26818200 -0.93731000 -0.43146400 H 2.18419800 -0.75330500 -1.46905900 $end $rem jobtype = bsse exchange = b3lyp basis = 6-31++g** $end """ self.assertEqual(str(qctask), ans) self.elementary_io_verify(ans, qctask) def test_mixed_basis_str(self): qctask = QcTask(mol, title="Test Methane", exchange="B3LYP", jobtype="SP", basis_set=[("C", "6-311G*"), ("H", "6-31g(d,p)"), ("H", "6-31g(d,p)"), ("H", "6-31g*"), ("cl", "6-31+g*")]) ans_mixed = """$comment Test Methane $end $molecule 0 1 C 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 1.08900000 H 1.02671900 0.00000000 -0.36300000 H -0.51336000 -0.88916500 -0.36300000 Cl -0.51336000 0.88916500 -0.36300000 $end $rem jobtype = sp exchange = b3lyp basis = mixed $end $basis C 1 6-311g* **** H 2 6-31g(d,p) **** H 3 6-31g(d,p) **** H 4 6-31g* **** Cl 5 6-31+g* **** $end """ self.assertEqual(ans_mixed, str(qctask)) self.elementary_io_verify(ans_mixed, qctask) qctask.set_basis_set("6-31+G*") ans_simple = """$comment Test Methane $end $molecule 0 1 C 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 1.08900000 H 1.02671900 0.00000000 -0.36300000 H -0.51336000 -0.88916500 -0.36300000 Cl -0.51336000 0.88916500 -0.36300000 $end $rem jobtype = sp exchange = b3lyp basis = 6-31+g* $end """ self.assertEqual(str(qctask), ans_simple) qctask.set_basis_set([("C", "6-311G*"), ("H", "6-31g(d,p)"), ("H", "6-31g(d,p)"), ("H", "6-31g*"), ("cl", "6-31+g*")]) self.assertEqual(str(qctask), ans_mixed) self.elementary_io_verify(ans_mixed, qctask) def test_partial_hessian(self): qcinp1 = QcInput.from_file(os.path.join(test_dir, "partial_hessian.qcinp")) ans = """$molecule 0 1 C -1.76827000 0.46495000 0.28695000 O 1.78497000 -0.42034000 -0.39845000 H -0.77736000 0.78961000 0.66548000 H -1.75896000 0.46604000 -0.82239000 H -2.54983000 1.16313000 0.65101000 H -1.98693000 -0.55892000 0.65381000 H 2.14698000 -0.07173000 0.45530000 H 1.25596000 -1.21510000 -0.13726000 $end $rem jobtype = freq exchange = b3lyp basis = 6-31g* n_sol = 3 phess = true $end $alist 3 7 8 $end """ self.assertEqual(ans, str(qcinp1)) self.elementary_io_verify(ans, qcinp1.jobs[0]) qcinp1.jobs[0].params["rem"]["jobtype"] = "sp" qcinp1.jobs[0].params["rem"]["phess"] = 3 qcinp1.jobs[0].set_partial_hessian_atoms([2, 3, 4, 5, 6]) ans = """$molecule 0 1 C -1.76827000 0.46495000 0.28695000 O 1.78497000 -0.42034000 -0.39845000 H -0.77736000 0.78961000 0.66548000 H -1.75896000 0.46604000 -0.82239000 H -2.54983000 1.16313000 0.65101000 H -1.98693000 -0.55892000 0.65381000 H 2.14698000 -0.07173000 0.45530000 H 1.25596000 -1.21510000 -0.13726000 $end $rem jobtype = freq exchange = b3lyp basis = 6-31g* n_sol = 5 phess = True $end $alist 2 3 4 5 6 $end """ self.assertEqual(ans, str(qcinp1)) def test_basis2_mixed(self): qcinp1 = QcInput.from_file(os.path.join(test_dir, "basis2_mixed.inp")) ans = """$molecule 0 1 C -1.76827000 0.46495000 0.28695000 O 1.78497000 -0.42034000 -0.39845000 H -0.77736000 0.78961000 0.66548000 H -1.75896000 0.46604000 -0.82239000 H -2.54983000 1.16313000 0.65101000 H -1.98693000 -0.55892000 0.65381000 H 2.14698000 -0.07173000 0.45530000 H 1.25596000 -1.21510000 -0.13726000 $end $rem jobtype = sp exchange = b3lyp basis = mixed basis2 = basis2_mixed purecart = 1111 $end $basis C 1 6-311+g(3df) **** O 2 aug-cc-pvtz **** H 3 6-31g* **** H 4 6-31g* **** H 5 6-31g* **** H 6 6-31g* **** H 7 cc-pvdz **** H 8 cc-pvdz **** $end $basis2 C 1 sto-3g **** O 2 sto-3g **** H 3 sto-3g **** H 4 sto-3g **** H 5 sto-3g **** H 6 sto-3g **** H 7 sto-3g **** H 8 sto-3g **** $end """ self.assertEqual(str(qcinp1), ans) self.elementary_io_verify(ans, qcinp1.jobs[0]) basis2 = qcinp1.jobs[0].params["basis2"] qcinp2 = copy.deepcopy(qcinp1) qcinp2.jobs[0].set_basis2("3-21g") self.assertEqual(qcinp2.jobs[0].params["rem"]["basis2"], "3-21g") self.assertFalse("basis2" in qcinp2.jobs[0].params) qcinp2.jobs[0].set_basis2(basis2) self.assertEqual(str(qcinp2), ans) def test_aux_basis_str(self): ans_gen = '''$comment Test Methane $end $molecule 0 1 C 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 1.08900000 H 1.02671900 0.00000000 -0.36300000 H -0.51336000 -0.88916500 -0.36300000 Cl -0.51336000 0.88916500 -0.36300000 $end $rem jobtype = freq exchange = xygjos basis = gen aux_basis = gen $end $aux_basis C rimp2-cc-pvdz **** Cl rimp2-aug-cc-pvdz **** H rimp2-cc-pvdz **** $end $basis C 6-31g* **** Cl 6-31+g* **** H 6-31g* **** $end ''' qctask = QcTask(mol, title="Test Methane", exchange="xygjos", jobtype="Freq", basis_set={"C": "6-31G*", "h": "6-31g*", "CL": "6-31+g*"}, aux_basis_set={"c": "rimp2-cc-pvdz", "H": "rimp2-cc-pvdz", "Cl": "rimp2-aug-cc-pvdz"}) self.assertEqual(str(qctask), ans_gen) self.elementary_io_verify(ans_gen, qctask) qctask.set_auxiliary_basis_set([("C", "aug-cc-pvdz"), ("H", "cc-pvdz"), ("H", "cc-pvdz"), ("H", "cc-pvdz"), ("cl", "rimp2-aug-cc-pvdz")]) ans_mixed_aux = """$comment Test Methane $end $molecule 0 1 C 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 1.08900000 H 1.02671900 0.00000000 -0.36300000 H -0.51336000 -0.88916500 -0.36300000 Cl -0.51336000 0.88916500 -0.36300000 $end $rem jobtype = freq exchange = xygjos basis = gen aux_basis = mixed $end $aux_basis C 1 aug-cc-pvdz **** H 2 cc-pvdz **** H 3 cc-pvdz **** H 4 cc-pvdz **** Cl 5 rimp2-aug-cc-pvdz **** $end $basis C 6-31g* **** Cl 6-31+g* **** H 6-31g* **** $end """ self.assertEqual(ans_mixed_aux, str(qctask)) self.elementary_io_verify(ans_mixed_aux, qctask) qctask.set_basis_set("6-31+G*") qctask.set_auxiliary_basis_set("rimp2-cc-pvdz") ans_simple = """$comment Test Methane $end $molecule 0 1 C 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 1.08900000 H 1.02671900 0.00000000 -0.36300000 H -0.51336000 -0.88916500 -0.36300000 Cl -0.51336000 0.88916500 -0.36300000 $end $rem jobtype = freq exchange = xygjos basis = 6-31+g* aux_basis = rimp2-cc-pvdz $end """ self.assertEqual(ans_simple, str(qctask)) self.elementary_io_verify(ans_simple, qctask) qctask.set_basis_set({"C": "6-31G*", "h": "6-31g*", "CL": "6-31+g*"}) qctask.set_auxiliary_basis_set([("C", "aug-cc-pvdz"), ("H", "cc-pvdz"), ("H", "cc-pvdz"), ("H", "cc-pvdz"), ("cl", "rimp2-aug-cc-pvdz")]) self.assertEqual(ans_mixed_aux, str(qctask)) self.elementary_io_verify(ans_mixed_aux, qctask) def test_ecp_str(self): ans = '''$comment Test ECP $end $molecule 0 1 Br 0.00000000 0.00000000 -2.40000000 Cd 0.00000000 0.00000000 0.00000000 Br 0.00000000 0.00000000 2.40000000 $end $rem jobtype = opt exchange = b3lyp basis = gen ecp = gen $end $basis Br srlc **** Cd srsc **** $end $ecp Br srlc **** Cd srsc **** $end ''' qctask = QcTask(heavy_mol, title="Test ECP", exchange="B3LYP", jobtype="Opt", basis_set={"Br": "srlc", "Cd": "srsc"}, ecp={"Br": "SrlC", "Cd": "srsc"}) self.assertEqual(str(qctask), ans) self.elementary_io_verify(ans, qctask) def test_set_memory(self): ans = '''$comment Test Methane $end $molecule 0 1 C 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 1.08900000 H 1.02671900 0.00000000 -0.36300000 H -0.51336000 -0.88916500 -0.36300000 Cl -0.51336000 0.88916500 -0.36300000 $end $rem jobtype = sp exchange = b3lyp basis = 6-31+g* mem_static = 500 mem_total = 18000 $end ''' qctask = QcTask(mol, title="Test Methane", exchange="B3LYP", jobtype="SP", basis_set="6-31+G*") qctask.set_memory(total=18000, static=500) self.assertEqual(str(qctask), ans) self.elementary_io_verify(ans, qctask) def test_set_max_num_of_scratch_files(self): ans = '''$comment Test Methane $end $molecule 0 1 C 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 1.08900000 H 1.02671900 0.00000000 -0.36300000 H -0.51336000 -0.88916500 -0.36300000 Cl -0.51336000 0.88916500 -0.36300000 $end $rem jobtype = sp exchange = b3lyp basis = 6-31+g* max_sub_file_num = 500 $end ''' qctask = QcTask(mol, title="Test Methane", exchange="B3LYP", jobtype="SP", basis_set="6-31+G*") qctask.set_max_num_of_scratch_files(500) self.assertEqual(str(qctask), ans) self.elementary_io_verify(ans, qctask) def test_set_max_scf_iterations(self): ans = '''$comment Test Methane $end $molecule 0 1 C 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 1.08900000 H 1.02671900 0.00000000 -0.36300000 H -0.51336000 -0.88916500 -0.36300000 Cl -0.51336000 0.88916500 -0.36300000 $end $rem jobtype = sp exchange = b3lyp basis = 6-31+g* max_scf_cycles = 100 scf_algorithm = diis_gdm $end ''' qctask = QcTask(mol, title="Test Methane", exchange="B3LYP", jobtype="SP", basis_set="6-31+G*") qctask.set_scf_algorithm_and_iterations(algorithm="diis_gdm", iterations=100) self.assertEqual(str(qctask), ans) self.elementary_io_verify(ans, qctask) def test_set_scf_convergence_threshold(self): ans = '''$comment Test Methane $end $molecule 0 1 C 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 1.08900000 H 1.02671900 0.00000000 -0.36300000 H -0.51336000 -0.88916500 -0.36300000 Cl -0.51336000 0.88916500 -0.36300000 $end $rem jobtype = sp exchange = b3lyp basis = 6-31+g* scf_convergence = 8 $end ''' qctask = QcTask(mol, title="Test Methane", exchange="B3LYP", jobtype="SP", basis_set="6-31+G*") qctask.set_scf_convergence_threshold(exponent=8) self.assertEqual(str(qctask), ans) self.elementary_io_verify(ans, qctask) def test_set_integral_threshold(self): ans = '''$comment Test Methane $end $molecule 0 1 C 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 1.08900000 H 1.02671900 0.00000000 -0.36300000 H -0.51336000 -0.88916500 -0.36300000 Cl -0.51336000 0.88916500 -0.36300000 $end $rem jobtype = sp exchange = b3lyp basis = 6-31+g* thresh = 14 $end ''' qctask = QcTask(mol, title="Test Methane", exchange="B3LYP", jobtype="SP", basis_set="6-31+G*") qctask.set_integral_threshold(thresh=14) self.assertEqual(str(qctask), ans) self.elementary_io_verify(ans, qctask) def test_set_dft_grid(self): ans = '''$comment Test Methane $end $molecule 0 1 C 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 1.08900000 H 1.02671900 0.00000000 -0.36300000 H -0.51336000 -0.88916500 -0.36300000 Cl -0.51336000 0.88916500 -0.36300000 $end $rem jobtype = sp exchange = b3lyp basis = 6-31+g* xc_grid = 000110000590 $end ''' qctask = QcTask(mol, title="Test Methane", exchange="B3LYP", jobtype="SP", basis_set="6-31+G*") qctask.set_dft_grid(radical_points=110, angular_points=590) self.assertEqual(str(qctask), ans) self.elementary_io_verify(ans, qctask) def test_set_scf_initial_guess(self): ans = '''$comment Test Methane $end $molecule 0 1 C 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 1.08900000 H 1.02671900 0.00000000 -0.36300000 H -0.51336000 -0.88916500 -0.36300000 Cl -0.51336000 0.88916500 -0.36300000 $end $rem jobtype = sp exchange = b3lyp basis = 6-31+g* scf_guess = gwh $end ''' qctask = QcTask(mol, title="Test Methane", exchange="B3LYP", jobtype="SP", basis_set="6-31+G*") qctask.set_scf_initial_guess("GWH") self.assertEqual(str(qctask), ans) self.elementary_io_verify(ans, qctask) def test_geom_opt_max_cycles(self): ans = '''$comment Test Methane $end $molecule 1 2 C 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 1.08900000 H 1.02671900 0.00000000 -0.36300000 H -0.51336000 -0.88916500 -0.36300000 Cl -0.51336000 0.88916500 -0.36300000 $end $rem jobtype = sp exchange = b3lyp basis = 6-31+g* geom_opt_max_cycles = 100 $end ''' qctask = QcTask(mol, title="Test Methane", exchange="B3LYP", jobtype="SP", charge=1, spin_multiplicity=2, basis_set="6-31+G*") qctask.set_geom_max_iterations(100) self.assertEqual(str(qctask), ans) self.elementary_io_verify(ans, qctask) def test_set_geom_opt_coords_type(self): ans = '''$comment Test Methane $end $molecule 0 1 C 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 1.08900000 H 1.02671900 0.00000000 -0.36300000 H -0.51336000 -0.88916500 -0.36300000 Cl -0.51336000 0.88916500 -0.36300000 $end $rem jobtype = sp exchange = b3lyp basis = 6-31+g* geom_opt_coords = 0 $end ''' qctask = QcTask(mol, title="Test Methane", exchange="B3LYP", jobtype="SP", basis_set="6-31+G*") qctask.set_geom_opt_coords_type("cartesian") self.assertEqual(str(qctask), ans) self.elementary_io_verify(ans, qctask) def test_scale_geom_opt_threshold(self): ans = '''$comment Test Methane $end $molecule 0 1 C 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 1.08900000 H 1.02671900 0.00000000 -0.36300000 H -0.51336000 -0.88916500 -0.36300000 Cl -0.51336000 0.88916500 -0.36300000 $end $rem jobtype = sp exchange = b3lyp basis = 6-31+g* geom_opt_tol_displacement = 120 geom_opt_tol_energy = 10 geom_opt_tol_gradient = 30 $end ''' qctask = QcTask(mol, title="Test Methane", exchange="B3LYP", jobtype="SP", basis_set="6-31+G*") qctask.scale_geom_opt_threshold(gradient=0.1, displacement=0.1, energy=0.1) self.assertEqual(str(qctask), ans) self.elementary_io_verify(ans, qctask) def test_set_geom_opt_use_gdiis(self): ans = '''$comment Test Methane $end $molecule 0 1 C 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 1.08900000 H 1.02671900 0.00000000 -0.36300000 H -0.51336000 -0.88916500 -0.36300000 Cl -0.51336000 0.88916500 -0.36300000 $end $rem jobtype = sp exchange = b3lyp basis = 6-31+g* geom_opt_max_diis = -1 $end ''' qctask = QcTask(mol, title="Test Methane", exchange="B3LYP", jobtype="SP", basis_set="6-31+G*") qctask.set_geom_opt_use_gdiis() self.assertEqual(str(qctask), ans) self.elementary_io_verify(ans, qctask) def test_disable_symmetry(self): ans = '''$comment Test Methane $end $molecule 0 1 C 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 1.08900000 H 1.02671900 0.00000000 -0.36300000 H -0.51336000 -0.88916500 -0.36300000 Cl -0.51336000 0.88916500 -0.36300000 $end $rem jobtype = sp exchange = b3lyp basis = 6-31+g* sym_ignore = True symmetry = False $end ''' qctask = QcTask(mol, title="Test Methane", exchange="B3LYP", jobtype="SP", basis_set="6-31+G*") qctask.disable_symmetry() self.assertEqual(str(qctask), ans) self.elementary_io_verify(ans, qctask) def test_use_cosmo(self): ans = '''$comment Test Methane $end $molecule 0 1 C 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 1.08900000 H 1.02671900 0.00000000 -0.36300000 H -0.51336000 -0.88916500 -0.36300000 Cl -0.51336000 0.88916500 -0.36300000 $end $rem jobtype = sp exchange = b3lyp basis = 6-31+g* solvent_dielectric = 35.0 solvent_method = cosmo $end ''' qctask = QcTask(mol, title="Test Methane", exchange="B3LYP", jobtype="SP", basis_set="6-31+G*") qctask.use_cosmo(dielectric_constant=35.0) self.assertEqual(str(qctask), ans) self.elementary_io_verify(ans, qctask) def test_wrap_comment(self): ans = '''$comment 5_2_2_methoxyethoxy_ethoxy_6_nitro_1_3_dihydro_2_1_3_benzothiadiazole singlet neutral B3lYP/6-31+G* geometry optimization $end $molecule 0 1 C 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 1.08900000 H 1.02671900 0.00000000 -0.36300000 H -0.51336000 -0.88916500 -0.36300000 Cl -0.51336000 0.88916500 -0.36300000 $end $rem jobtype = sp exchange = b3lyp basis = 6-31+g* $end ''' qctask = QcTask(mol, title=" 5_2_2_methoxyethoxy_ethoxy_6_nitro_1_3_dihydro_2_1_3_benzothiadiazole singlet " "neutral B3lYP/6-31+G* geometry optimization", exchange="B3LYP", jobtype="SP", basis_set="6-31+G*") self.assertEqual(str(qctask), ans) self.elementary_io_verify(ans, qctask) title = ''' MgBPh42 singlet neutral PBE-D3/6-31+G* geometry optimization <SCF Fix Strategy>{ "current_method_id": 1, "methods": [ "increase_iter", "diis_gdm", "gwh", "rca", "gdm", "core+gdm" ] }</SCF Fix Strategy>''' ans = '''$comment MgBPh42 singlet neutral PBE-D3/6-31+G* geometry optimization <SCF Fix Strategy>{ "current_method_id": 1, "methods": [ "increase_iter", "diis_gdm", "gwh", "rca", "gdm", "core+gdm" ] }</SCF Fix Strategy> $end $molecule 0 1 C 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 1.08900000 H 1.02671900 0.00000000 -0.36300000 H -0.51336000 -0.88916500 -0.36300000 Cl -0.51336000 0.88916500 -0.36300000 $end $rem jobtype = sp exchange = b3lyp basis = 6-31+g* $end ''' qctask = QcTask(mol, title=title, exchange="B3LYP", jobtype="SP", basis_set="6-31+G*") self.assertEqual(str(qctask), ans) self.elementary_io_verify(ans, qctask) title = " 5_2_2_methoxyethoxy_ethoxy_6_nitro_1_3_dihydro_2_1_3_benzothiadiazole singlet neutral " \ "B3lYP/6-31+G* geometry optimization" + \ '''<SCF Fix Strategy>{ "current_method_id": 1, "methods": [ "increase_iter", "diis_gdm", "gwh", "rca", "gdm", "core+gdm" ] }</SCF Fix Strategy>''' qctask = QcTask(mol, title=title, exchange="B3LYP", jobtype="SP", basis_set="6-31+G*") self.elementary_io_verify(str(qctask), qctask) def test_use_pcm(self): ans = '''$comment Test Methane $end $molecule 0 1 C 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 1.08900000 H 1.02671900 0.00000000 -0.36300000 H -0.51336000 -0.88916500 -0.36300000 Cl -0.51336000 0.88916500 -0.36300000 $end $rem jobtype = sp exchange = b3lyp basis = 6-31+g* solvent_method = pcm $end $pcm radii uff theory ssvpe vdwscale 1.1 $end $pcm_solvent dielectric 78.3553 $end ''' qctask = QcTask(mol, title="Test Methane", exchange="B3LYP", jobtype="SP", basis_set="6-31+G*") qctask.use_pcm() self.assertEqual(str(qctask), ans) self.elementary_io_verify(ans, qctask) qctask = QcTask(mol, title="Test Methane", exchange="B3LYP", jobtype="SP", basis_set="6-31+G*") qctask.use_pcm(pcm_params={"Radii": "FF", "Theory": "CPCM", "SASrad": 1.5, "HPoints": 1202}, solvent_params={"Dielectric": 20.0, "Temperature": 300.75, "NSolventAtoms": 2, "SolventAtom": [[8, 1, 186, 1.30], [1, 2, 187, 1.01]]}, radii_force_field="OPLSAA") ans = '''$comment Test Methane $end $molecule 0 1 C 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 1.08900000 H 1.02671900 0.00000000 -0.36300000 H -0.51336000 -0.88916500 -0.36300000 Cl -0.51336000 0.88916500 -0.36300000 $end $rem jobtype = sp exchange = b3lyp basis = 6-31+g* force_fied = oplsaa solvent_method = pcm $end $pcm hpoints 1202 radii bondi sasrad 1.5 theory cpcm vdwscale 1.1 $end $pcm_solvent dielectric 20.0 nsolventatoms 2 solventatom 8 1 186 1.30 solventatom 1 2 187 1.01 temperature 300.75 $end ''' self.assertEqual(str(qctask), ans) self.elementary_io_verify(ans, qctask) def test_ghost_atoms(self): qctask = QcTask(mol, charge=0, spin_multiplicity=1, exchange="B3LYP", ghost_atoms=[2, 4]) ans = """$molecule 0 1 C 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 1.08900000 @H 1.02671900 0.00000000 -0.36300000 H -0.51336000 -0.88916500 -0.36300000 @Cl -0.51336000 0.88916500 -0.36300000 $end $rem jobtype = sp exchange = b3lyp basis = 6-31+g* $end """ self.assertEqual(str(qctask), ans) self.elementary_io_verify(ans, qctask) mol1 = copy.deepcopy(mol) mol1.set_charge_and_spin(1, 2) mol2 = copy.deepcopy(water_mol) mol2.set_charge_and_spin(-1, 2) qctask = QcTask([mol1, mol2], title="Test Fragments", exchange="B3LYP", jobtype="bsse", charge=0, spin_multiplicity=3, basis_set="6-31++G**", ghost_atoms=[1, 2, 3, 5]) self.elementary_io_verify(str(qctask), qctask) qctask = QcTask(mol, charge=0, spin_multiplicity=2, exchange="B3LYP", ghost_atoms=[2]) self.assertEqual(qctask.spin_multiplicity, 2) class TestQcInput(TestCase): def test_str_and_from_string(self): ans = '''$comment Test Methane Opt $end $molecule 0 1 C 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 1.08900000 H 1.02671900 0.00000000 -0.36300000 H -0.51336000 -0.88916500 -0.36300000 Cl -0.51336000 0.88916500 -0.36300000 $end $rem jobtype = opt exchange = b3lyp basis = 6-31+g* $end @@@ $comment Test Methane Frequency $end $molecule read $end $rem jobtype = freq exchange = b3lyp basis = 6-31+g* $end @@@ $comment Test Methane Single Point Energy $end $molecule read $end $rem jobtype = sp exchange = b3lyp basis = 6-311+g(3df,2p) $end ''' qctask1 = QcTask(mol, title="Test Methane Opt", exchange="B3LYP", jobtype="Opt", basis_set="6-31+G*") qctask2 = QcTask(molecule="read", title="Test Methane Frequency", exchange="B3LYP", jobtype="Freq", basis_set="6-31+G*") qctask3 = QcTask(title="Test Methane Single Point Energy", exchange="B3LYP", jobtype="SP", basis_set="6-311+G(3df,2p)") qcinp1 = QcInput(jobs=[qctask1, qctask2, qctask3]) self.assertEqual(str(qcinp1), ans) qcinp2 = QcInput.from_string(ans) self.assertEqual(qcinp1.as_dict(), qcinp2.as_dict()) qcinp_mgbf4 = QcInput.from_file(os.path.join(test_dir, "MgBF4_b_overalpped.qcinp")) self.assertEqual(qcinp_mgbf4.jobs[0].ghost_atoms, [0]) def test_to_and_from_dict(self): qctask1 = QcTask(mol, title="Test Methane Opt", exchange="B3LYP", jobtype="Opt", basis_set="6-31+G*") qctask2 = QcTask(molecule="read", title="Test Methane Frequency", exchange="B3LYP", jobtype="Freq", basis_set="6-31+G*") qctask3 = QcTask(title="Test Methane Single Point Energy", exchange="B3LYP", jobtype="SP", basis_set="6-311+G(3df,2p)") qcinp1 = QcInput(jobs=[qctask1, qctask2, qctask3]) d1 = qcinp1.as_dict() qcinp2 = QcInput.from_dict(d1) d2 = qcinp2.as_dict() self.assertEqual(d1, d2) class TestQcOutput(TestCase): def test_energy(self): ref_energies_text = ''' { "hf-rimp2.qcout": { "RIMP2": -2726.6860779805256, "SCF": -2721.541435904716 }, "hf_b3lyp.qcout": { "SCF": -2733.1747178920828 }, "hf_ccsd(t).qcout": { "CCSD": -2726.7627121001865, "CCSD(T)": -2726.8283514003333, "MP2": -2726.685664155242, "SCF": -2721.5414360843106 }, "hf_cosmo.qcout": { "SCF": -2721.1752937496067 }, "hf_hf.qcout": { "SCF": -2721.541435904716 }, "hf_lxygjos.qcout": { "SCF": -2724.0769973875713, "XYGJ-OS": -2726.3445157759393 }, "hf_mosmp2.qcout": { "MOS-MP2": -2725.302538779482, "SCF": -2721.541435904716 }, "hf_mp2.qcout": { "MP2": -2726.685661962005, "SCF": -2721.541435904716 }, "hf_pcm.qcout": { "SCF": -2720.703940318968 }, "hf_qcisd(t).qcout": { "QCISD": -2726.7853751012344, "QCISD(T)": -2726.8346541282745, "SCF": -2721.5414360843106 }, "hf_riccsd(t).qcout": { "CCSD": -2726.7641790658904, "CCSD(T)": -2726.829853468723, "MP2": -2726.6860802173014, "SCF": -2721.5414360843106 }, "hf_tpssh.qcout": { "SCF": -2732.938974944255 }, "hf_xyg3.qcout": { "SCF": -2728.769906036435, "XYG3": -2731.0640917605806 }, "hf_xygjos.qcout": { "SCF": -2724.0769973875713, "XYGJ-OS": -2726.3447230967517 } }''' ref_energies = json.loads(ref_energies_text) parsed_energies = dict() # noinspection PyUnresolvedReferences for filename in glob.glob(os.path.join(test_dir, "qchem_energies", "*.qcout")): molname = os.path.basename(filename) qcout = QcOutput(filename) d = dict(qcout.data[0]["energies"]) parsed_energies[molname] = d self.assertEqual(sorted(ref_energies.keys()), sorted(parsed_energies.keys())) mols = sorted(ref_energies.keys()) for molname in mols: self.assertEqual(sorted(ref_energies[molname].keys()), sorted(parsed_energies[molname].keys())) methods = sorted(ref_energies[molname].keys()) for method in methods: self.assertAlmostEqual(ref_energies[molname][method], parsed_energies[molname][method]) def test_unable_to_determine_lambda_in_geom_opt(self): filename = os.path.join(test_dir, "unable_to_determine_lambda_in_geom_opt.qcout") qcout = QcOutput(filename) self.assertTrue(qcout.data[0]['has_error']) self.assertEqual(qcout.data[0]['errors'], ['Lamda Determination Failed', 'Geometry optimization failed']) def test_geom_opt(self): filename = os.path.join(test_dir, "thiophene_wfs_5_carboxyl.qcout") qcout = QcOutput(filename) self.assertEqual(qcout.data[0]["jobtype"], "opt") ans_energies = [('SCF', -20179.88483906483), ('SCF', -20180.120269846386), ('SCF', -20180.14892206486), ('SCF', -20180.150026022537), ('SCF', -20180.15020789526), ('SCF', -20180.150206202714)] self.assertEqual(qcout.data[0]["energies"], ans_energies) ans_mol1 = '''Full Formula (H4 C5 S1 O2) Reduced Formula: H4C5SO2 Charge = -1, Spin Mult = 2 Sites (12) 0 C 0.158839 -0.165379 0.000059 1 C -0.520531 -1.366720 0.000349 2 C -1.930811 -1.198460 -0.000041 3 C -2.297971 0.127429 -0.000691 4 S -0.938312 1.189630 0.000400 5 H -0.014720 -2.325340 0.000549 6 H -2.641720 -2.017721 -0.000161 7 H -3.301032 0.535659 -0.001261 8 C 1.603079 0.076231 -0.000101 9 O 2.131988 1.173581 -0.000330 10 O 2.322109 -1.079218 -0.000021 11 H 3.262059 -0.820188 -0.000171''' ans_mol_last = '''Full Formula (H4 C5 S1 O2) Reduced Formula: H4C5SO2 Charge = -1, Spin Mult = 2 Sites (12) 0 C 0.194695 -0.158362 -0.001887 1 C -0.535373 -1.381241 -0.001073 2 C -1.927071 -1.199274 -0.000052 3 C -2.332651 0.131916 0.000329 4 S -0.942111 1.224916 -0.001267 5 H -0.038260 -2.345185 -0.001256 6 H -2.636299 -2.025939 0.000620 7 H -3.339756 0.529895 0.001288 8 C 1.579982 0.071245 -0.002733 9 O 2.196383 1.165675 -0.000178 10 O 2.352341 -1.114671 0.001634 11 H 3.261096 -0.769470 0.003158''' self.assertEqual(qcout.data[0]["molecules"][0].__str__(), ans_mol1) self.assertEqual(str(qcout.data[0]["molecules"][-1]), ans_mol_last) self.assertFalse(qcout.data[0]["has_error"]) ans_gradient = [{'max_gradient': 0.07996, 'gradients': [(-0.0623076, -0.0157774, -2.05e-05), (0.0260287, 0.0289157, -6e-06), (-0.015738, 0.0103583, 1.87e-05), (0.0260219, -0.0028, -1.36e-05), (-0.0043158, -0.0245896, 2.83e-05), (4.8e-05, 0.000782, 1.3e-06), (0.0014679, 0.0020277, 3.9e-06), (0.0010437, -1.29e-05, -1.04e-05), (0.0799585, 0.0204159, 1e-06), (-0.0320357, -0.0421461, 2.1e-06), (-0.0237691, 0.0247526, -4.6e-06), (0.0035975, -0.0019264, -3e-07)], 'rms_gradient': 0.02244}, {'max_gradient': 0.02721, 'gradients': [(-0.0195677, -0.0008468, -3.2e-06), (0.0106798, 0.0039494, 1.11e-05), (-0.0086473, -0.0012624, -8.1e-06), (0.0065018, 0.0033749, 5e-07), (0.0002581, -0.0060831, 7.2e-06), (-0.0004373, -0.000504, 1.4e-06), (0.0003216, 0.0001059, -9e-07), (-0.000814, -5.03e-05, 3e-07), (0.0272109, 0.001408, -2.06e-05), (-0.0086971, -0.009251, 8.3e-06), (-0.0080925, 0.0112191, 2.9e-06), (0.0012838, -0.0020597, 1.1e-06)], 'rms_gradient': 0.007037}, {'max_gradient': 0.003444, 'gradients': [(0.0021606, 0.0013094, -1.68e-05), (0.0005757, -0.0002616, -1e-05), (2.73e-05, -0.0002868, 1.5e-05), (0.0001088, 0.0006944, -1.23e-05), (0.0006912, -0.0006523, 6.1e-06), (-0.0004191, -9.32e-05, -1.3e-06), (0.0002288, 3.98e-05, 1.8e-06), (-8.99e-05, -0.0002338, -3.2e-06), (1.95e-05, -0.0034439, 7.08e-05), (-0.0008228, -9.18e-05, -2.77e-05), (-0.0018054, 0.0034031, -2.21e-05), (-0.0006747, -0.0003834, -3e-07)], 'rms_gradient': 0.001008}, {'max_gradient': 0.002367, 'gradients': [(-0.0001646, 0.0006149, 4.17e-05), (-0.0004516, -0.0003116, 1.28e-05), (0.0003366, -3.27e-05, -1.59e-05), (-0.0003164, 0.0001775, 1.37e-05), (0.0001399, -0.0001201, -6.9e-06), (-0.0001374, -1.58e-05, 9e-07), (-1.19e-05, -3.93e-05, -3.3e-06), (-1.76e-05, -0.0001233, 5.1e-06), (9.73e-05, -0.0023668, -0.0001609), (0.0006998, 0.0009023, 6.31e-05), (-0.0002169, 0.0014874, 4.95e-05), (4.28e-05, -0.0001724, 2e-07)], 'rms_gradient': 0.0005339}, {'max_gradient': 0.001246, 'gradients': [(-6.88e-05, 0.0001757, -8.32e-05), (-0.0002264, -0.0001306, -1.93e-05), (0.0001526, -1.39e-05, 2.05e-05), (-0.0001401, 3.8e-06, -2.05e-05), (1.52e-05, 0.0001152, 8e-06), (2.01e-05, -3.69e-05, -1e-06), (-3.62e-05, -3.51e-05, 5.5e-06), (1.01e-05, -1.23e-05, -6.8e-06), (9.73e-05, -0.0012462, 0.0003246), (0.0003926, 0.0008331, -0.0001269), (-0.0002294, 0.000281, -0.0001009), (1.3e-05, 6.61e-05, 0.0)], 'rms_gradient': 0.0002814}, {'max_gradient': 0.0006359, 'gradients': [(0.0001036, -0.0001339, 0.0001633), (0.0001003, 6.98e-05, 3.43e-05), (-8.28e-05, 1.1e-05, -3.31e-05), (6.2e-05, -0.0001068, 3.41e-05), (-5.02e-05, 0.0001346, -1.18e-05), (8.72e-05, -7.3e-06, 1.5e-06), (-1.7e-05, 4.9e-06, -1.05e-05), (1.29e-05, 5.9e-05, 1.26e-05), (-0.0001059, -5.4e-06, -0.0006359), (-1.48e-05, 0.0002152, 0.0002469), (-0.0001335, -0.0003534, 0.0001988), (3.83e-05, 0.0001124, -1e-07)], 'rms_gradient': 0.0001535}] self.assertEqual(qcout.data[0]["gradients"], ans_gradient) ans_inp = '''$molecule -1 2 C 0.15884000 -0.16538000 0.00006000 C -0.52053000 -1.36672000 0.00035000 C -1.93081000 -1.19846000 -0.00004000 C -2.29797000 0.12743000 -0.00069000 S -0.93831000 1.18963000 0.00040000 H -0.01472000 -2.32534000 0.00055000 H -2.64172000 -2.01772000 -0.00016000 H -3.30103000 0.53566000 -0.00126000 C 1.60308000 0.07623000 -0.00010000 O 2.13199000 1.17358000 -0.00033000 O 2.32211000 -1.07922000 -0.00002000 H 3.26206000 -0.82019000 -0.00017000 $end $rem jobtype = opt exchange = b3lyp basis = 6-31+g* $end ''' self.assertEqual(str(qcout.data[0]['input']), ans_inp) self.assertTrue(qcout.data[0]['gracefully_terminated']) ans_scf_iter = [[(-743.3130310589, 0.0561), (-741.3557302205, 0.00841), (-740.7031048846, 0.0157), (-741.5589873953, 0.00303), (-741.5918010434, 0.00118), (-741.5966923809, 0.000332), (-741.5970287119, 0.000158), (-741.5971282029, 4.38e-05), (-741.5971448077, 2.17e-05), (-741.5971501973, 7.7e-06), (-741.5971533576, 5.05e-06), (-741.5971541122, 2.7e-06), (-741.5971544119, 9.48e-07), (-741.5971544408, 2.61e-07), (-741.5971544436, 1.21e-07), (-741.5971544441, 5.45e-08), (-741.5971544442, 1.77e-08), (-741.5971544442, 7.79e-09)], [(-741.5552794274, 0.00265), (-741.6048574279, 0.000515), (-741.6037290502, 0.000807), (-741.6056978336, 0.000188), (-741.6057976553, 4.78e-05), (-741.6058045572, 1.54e-05), (-741.6058057373, 4.51e-06), (-741.6058061671, 2.91e-06), (-741.6058062822, 8.32e-07), (-741.6058063435, 7.17e-07), (-741.6058063636, 1.97e-07), (-741.6058063662, 5.03e-08), (-741.6058063666, 3.35e-08), (-741.6058063666, 1.24e-08), (-741.6058063666, 5.25e-09)], [(-741.6023833754, 0.0013), (-741.6065067966, 0.000305), (-741.6057886337, 0.000559), (-741.6068434004, 7.61e-05), (-741.6068555361, 3.4e-05), (-741.6068589376, 5.66e-06), (-741.6068591778, 2.95e-06), (-741.60685927, 1.27e-06), (-741.6068592962, 4.82e-07), (-741.6068593106, 3.84e-07), (-741.6068593157, 9.23e-08), (-741.6068593162, 2.49e-08), (-741.6068593163, 1.52e-08), (-741.6068593163, 5.71e-09)], [(-741.6012175391, 0.000209), (-741.6068794773, 7.2e-05), (-741.606851035, 0.000117), (-741.606899078, 1.53e-05), (-741.6068997567, 6.01e-06), (-741.6068998747, 1.68e-06), (-741.6068998849, 5.32e-07), (-741.6068998857, 2.76e-07), (-741.606899886, 6.41e-08), (-741.606899886, 3.08e-08), (-741.606899886, 9.5e-09)], [(-741.6067290885, 0.0001), (-741.6069044268, 2.64e-05), (-741.6068991026, 5.29e-05), (-741.6069065234, 3.51e-06), (-741.6069065452, 2.49e-06), (-741.6069065686, 3.57e-07), (-741.6069065693, 2.59e-07), (-741.6069065696, 7.05e-08), (-741.6069065696, 4.44e-08), (-741.6069065697, 1.52e-08), (-741.6069065697, 8.17e-09)], [(-741.6074251344, 0.000129), (-741.6069044127, 2.43e-05), (-741.6068998551, 4.95e-05), (-741.6069064294, 4.49e-06), (-741.606906478, 2.77e-06), (-741.6069065049, 5.85e-07), (-741.6069065068, 2.74e-07), (-741.6069065073, 6.99e-08), (-741.6069065074, 3.37e-08), (-741.6069065075, 1.89e-08), (-741.6069065075, 7.38e-09)]] self.assertEqual(qcout.data[0]['scf_iteration_energies'], ans_scf_iter) def test_multiple_step_job(self): filename = os.path.join(test_dir, "CdBr2.qcout") qcout = QcOutput(filename) self.assertEqual(len(qcout.data), 3) self.assertEqual(qcout.data[0]['jobtype'], 'opt') self.assertEqual(qcout.data[1]['jobtype'], 'freq') ans_thermo_corr_text = ''' { "Rotational Enthalpy": 0.025714259, "Rotational Entropy": 0.000833523586, "Total Enthalpy": 0.199729978, "Total Entropy": 0.003218965579, "Translational Enthalpy": 0.038549707, "Translational Entropy": 0.001851513374, "Vibrational Enthalpy": 0.109795116, "Vibrational Entropy": 0.000533928619, "ZPE": 0.039330241, "Zero point vibrational energy": 0.039330241, "gas constant (RT)": 0.025714259 }''' ans_thermo_corr = json.loads(ans_thermo_corr_text) self.assertEqual(sorted(qcout.data[1]['corrections'].keys()), sorted(ans_thermo_corr.keys())) for k, ref in ans_thermo_corr.items(): self.assertAlmostEqual(qcout.data[1]['corrections'][k], ref) self.assertEqual(len(qcout.data[1]['molecules']), 1) ans_mol1 = '''Full Formula (Cd1 Br2) Reduced Formula: CdBr2 Charge = 0, Spin Mult = 1 Sites (3) 0 Br 0.000000 0.000000 -2.453720 1 Cd 0.000000 0.000000 0.000000 2 Br 0.000000 0.000000 2.453720''' self.assertEqual(str(qcout.data[1]['molecules'][0]), ans_mol1) self.assertFalse(qcout.data[1]['has_error']) self.assertEqual(qcout.data[1]['gradients'], []) ans_inp = '''$molecule read $end $rem jobtype = freq exchange = b3lyp basis = gen ecp = gen max_scf_cycles = 100 scf_guess = gwh $end $basis Br srlc **** Cd srsc **** $end $ecp Br srlc **** Cd srsc **** $end ''' self.assertEqual(str(qcout.data[1]['input']), ans_inp) ans_freq = [{'vib_mode': ((0.17, -0.475, 0.0), (-0.236, 0.659, 0.0), (0.17, -0.475, 0.0)), 'frequency': 61.36}, {'vib_mode': ((-0.475, -0.17, 0.0), (0.659, 0.236, 0.0), (-0.475, -0.17, 0.0)), 'frequency': 61.36}, {'vib_mode': ((0.0, 0.0, 0.707), (0.0, 0.0, 0.0), (0.0, 0.0, -0.707)), 'frequency': 199.94}, {'vib_mode': ((0.0, 0.0, -0.505), (0.0, 0.0, 0.7), (0.0, 0.0, -0.505)), 'frequency': 311.74}] self.assertEqual(qcout.data[1]['frequencies'], ans_freq) self.assertEqual(qcout.data[2]['energies'], [('SCF', -5296.720321211475)]) ans_scf_iter_ene = [[(-176.9147092199, 0.779), (-156.8236033975, 0.115), (-152.9396694452, 0.157), (-183.2743425778, 0.138), (-182.2994943574, 0.142), (-181.990425533, 0.143), (-182.1690180647, 0.142), (-106.6454708618, 0.239), (-193.8056267625, 0.0432), (-193.0854096948, 0.0455), (-194.6340538334, 0.0062), (-194.6495072245, 0.00205), (-194.6508787796, 0.000189), (-194.6508984743, 2.18e-05), (-194.6508986262, 2.17e-06)]] self.assertEqual(qcout.data[2]['scf_iteration_energies'], ans_scf_iter_ene) def test_solvent_method(self): filename = os.path.join(test_dir, "thiophene_wfs_5_carboxyl.qcout") qcout = QcOutput(filename) self.assertEqual(qcout.data[0]["solvent_method"], "NA") filename = os.path.join(test_dir, "qchem_energies", "hf_cosmo.qcout") qcout = QcOutput(filename) self.assertEqual(qcout.data[0]["solvent_method"], "cosmo") filename = os.path.join(test_dir, "qchem_energies", "hf_pcm.qcout") qcout = QcOutput(filename) self.assertEqual(qcout.data[0]["solvent_method"], "pcm") def test_failed_message(self): scf_file = os.path.join(test_dir, "hf.qcout") scf_qcout = QcOutput(scf_file) self.assertTrue(scf_qcout.data[0]['has_error']) self.assertEqual(scf_qcout.data[0]['errors'], ['Bad SCF convergence', 'Molecular charge is not found', 'Geometry optimization failed']) geom_file = os.path.join(test_dir, "hf_opt_failed.qcout") geom_qcout = QcOutput(geom_file) self.assertTrue(geom_qcout.data[0]['has_error']) self.assertEqual(geom_qcout.data[0]['errors'], ['Geometry optimization failed']) def test_abnormal_exit(self): no_reading_file = os.path.join(test_dir, "no_reading.qcout") no_reading_qcout = QcOutput(no_reading_file) self.assertTrue(no_reading_qcout.data[0]['has_error']) self.assertEqual(no_reading_qcout.data[0]['errors'], ['Exit Code 134', 'Molecular charge is not found', 'No input text', 'Bad SCF convergence']) exit_code_134_file = os.path.join(test_dir, "exit_code_134.qcout") ec134_qcout = QcOutput(exit_code_134_file) self.assertTrue(ec134_qcout.data[0]['has_error']) self.assertEqual(ec134_qcout.data[0]['errors'], ['Exit Code 134', 'Molecular charge is not found', 'Bad SCF convergence']) def test_chelp_and_mulliken_charges(self): filename = os.path.join(test_dir, 'chelpg_charges.qcout') qcout = QcOutput(filename) mulliken_charges = [0.393961, -0.281545, 0.066432, 0.019364, -0.186041, -0.16007, 0.315659, 0.30631, 0.064257, 0.056438, -0.17695, 0.16976, -0.13326, -0.131853, -0.178711, 0.163697, 0.170148, 0.143329, 0.152702, 0.152929, 0.170475, -0.451542, -0.441554, -0.709834, -0.592718, 0.20506, 0.211043, 0.204389, 0.546173, -0.414558, 0.346511] self.assertEqual(qcout.data[0]['charges']['mulliken'], mulliken_charges) chelpg_charges = [0.399404, -0.277179, -0.057502, -0.110085, -0.07107, -0.274987, 0.475781, 0.423117, -0.054079, -0.101424, -0.05793, 0.115179, -0.116069, -0.10949, -0.06664, 0.161442, 0.135438, 0.158081, 0.125881, 0.125324, 0.115863, -0.425251, -0.42309, -0.602375, -0.458844, 0.140267, 0.139084, 0.139995, 0.698011, -0.487911, 0.341061] self.assertEqual(qcout.data[0]['charges']['chelpg'], chelpg_charges) def test_no_message_scf_opt_fail(self): so_failfile = os.path.join(test_dir, 'scf_opt_no_message_fail.qcout') so_failqcout = QcOutput(so_failfile) self.assertTrue(so_failqcout.data[0]['has_error']) self.assertEqual(so_failqcout.data[0]['errors'], ['Exit Code 134', 'Molecular charge is not found', 'Bad SCF convergence', 'Geometry optimization failed']) o_failfile = os.path.join(test_dir, 'opt_fail_no_message.qcout') o_failqcout = QcOutput(o_failfile) self.assertEqual(o_failqcout.data[0]['errors'], ['Geometry optimization failed']) s_failfile = os.path.join(test_dir, 'scf_no_message_fail.qcout') s_failqcout = QcOutput(s_failfile) self.assertEqual(s_failqcout.data[0]['errors'], ['Exit Code 134', 'Molecular charge is not found', 'Bad SCF convergence']) so_successfile = os.path.join(test_dir, 'thiophene_wfs_5_carboxyl.qcout') so_successqcout = QcOutput(so_successfile) self.assertFalse(so_successqcout.data[0]['has_error']) def test_negative_eigen(self): filename = os.path.join(test_dir, "negative_eigen.qcout") qcout = QcOutput(filename) self.assertTrue(qcout.data[0]['has_error']) self.assertEqual(qcout.data[0]["errors"], ['Negative Eigen', 'Molecular charge is not found', 'Bad SCF convergence', 'Geometry optimization failed']) def test_insufficient_memory(self): filename = os.path.join(test_dir, "insufficient_memory.qcout") qcout = QcOutput(filename) self.assertTrue(qcout.data[0]['has_error']) self.assertEqual(qcout.data[0]['errors'], ['Insufficient static memory', 'Molecular charge is not found', 'Bad SCF convergence', 'Geometry optimization failed']) def test_freq_seg_too_small(self): filename = os.path.join(test_dir, "freq_seg_too_small.qcout") qcout = QcOutput(filename) self.assertTrue(qcout.data[0]['has_error']) self.assertEqual(qcout.data[0]['errors'], ['Freq Job Too Small', 'Exit Code 134']) def test_not_enough_total_memory(self): filename = os.path.join(test_dir, "not_enough_total_memory.qcout") qcout = QcOutput(filename) self.assertTrue(qcout.data[1]['has_error']) self.assertEqual(qcout.data[1]["errors"], ['Not Enough Total Memory', 'Exit Code 134']) def test_killed(self): filename = os.path.join(test_dir, "killed.qcout") qcout = QcOutput(filename) self.assertFalse(qcout.data[0]["has_error"]) self.assertTrue(qcout.data[1]["has_error"]) self.assertEqual(qcout.data[1]["errors"], ['Killed', 'Molecular charge is not found', 'Bad SCF convergence']) def test_gdm_scf(self): filename = os.path.join(test_dir, "gmd_scf.qcout") qcout = QcOutput(filename) self.assertTrue(qcout.data[0]['has_error']) self.assertEqual(qcout.data[0]['errors'], ['Exit Code 134', 'Bad SCF convergence', 'Geometry optimization failed']) self.assertEqual(len(qcout.data[0]['scf_iteration_energies']), 2) self.assertEqual(len(qcout.data[0]['scf_iteration_energies'][-1]), 192) self.assertAlmostEqual(qcout.data[0]['scf_iteration_energies'][-1][-1][0], -1944.945908459, 5) def test_crazy_scf_values(self): filename = os.path.join(test_dir, "crazy_scf_values.qcout") qcout = QcOutput(filename) ans = [(-28556254.06737586, 6.49e-06), (-28556254.067382727, 9.45e-06), (-28556254.067382865, 6.14e-06)] self.assertEqual(qcout.data[0]["scf_iteration_energies"][-1][-3:], ans) def test_crowd_gradient_number(self): filename = os.path.join(test_dir, "crowd_gradient_number.qcout") qcout = QcOutput(filename) self.assertEqual(qcout.data[0]['gradients'][0]['gradients'], [(-0.0307525, 0.0206536, -0.0396255), (0.0008938, -0.000609, 0.0082746), (0.042143, -0.0240514, 0.0380298), (-0.0843578, 0.0002757, 0.0884924), (0.0356689, -0.0444656, -0.0710646), (-0.0190554, -0.0308886, -0.0297994), (0.0470543, -0.0263915, -0.0690973), (-0.0297801, 0.0296872, -0.0104344), (0.0504581, -0.0014272, 0.0262245), (-0.0927323, 0.0750046, 0.0128003), (0.0183242, -0.0084638, 0.0127388), (-0.0083989, 0.0111579, -0.0002461), (-0.0316941, 267.34455, 878.3493251), (0.017459, 0.0487124, -0.0276365), (-0.3699134, 0.0110442, 0.0260809), (0.363931, 0.24044, 0.5192852), (0.026669, -0.0284192, -0.0347528), (0.0047475, 0.0049706, 0.0148794), (-0.077804, 0.003402, 0.000852), (-6772.1697035, -267.4471902, -878.585931), (-0.0029556, -0.0616073, -0.0180577), (-0.0001915, 0.0021213, 0.0006193), (0.0320436, -0.0073456, -0.01509), (0.0155112, -0.0035725, 0.0015675), (-0.0034309, 0.0170739, 0.0074455), (-0.0088735, -0.0129874, 0.0092329), (-0.0271963, -0.0258714, 0.0246954), (0.0025065, 0.0062934, 0.0209733), (0.0152829, -0.0080239, -0.018902), (0.0461304, 0.0071952, 0.0012227), (-0.0272755, -0.0280053, 0.0325455), (0.0122118, 0.027816, -0.0167773), (0.0168893, -0.0014211, 0.0039917), (-0.0048723, 0.0026667, -0.0159952), (-0.1840467, -0.1425887, -0.3235801), (0.015975, -0.0922797, 0.0640925), (0.0267234, 0.1031154, -0.0299014), (-0.0175591, 0.0081813, -0.0165425), (0.0119225, 0.0113174, 0.0154056), (0.0138491, 0.0083436, 0.0188022), (-0.0151146, -0.0015971, -0.0054462)]) def test_nbo_charges(self): filename = os.path.join(test_dir, "quinoxaline_anion.qcout") qcout = QcOutput(filename) ans = [-0.29291, -0.29807, 0.12715, 0.12715, -0.29807, -0.29291, 0.21284, 0.22287, 0.22287, 0.21284, -0.10866, -0.10866, 0.19699, -0.5602, -0.5602, 0.19699] self.assertEqual(qcout.data[0]["charges"]["nbo"], ans) filename = os.path.join(test_dir, "tfsi_nbo.qcout") qcout = QcOutput(filename) ans = [2.2274, 2.23584, -0.94183, -0.94575, -0.94719, -0.9423, 0.86201, 0.85672, -0.35698, -0.35373, -0.35782, -0.35647, -0.35646, -0.35787, -1.26555] self.assertEqual(qcout.data[0]["charges"]["nbo"], ans) filename = os.path.join(test_dir, "crowd_nbo_charges.qcout") qcout = QcOutput(filename) self.assertEqual( qcout.data[0]["charges"]["nbo"], [-0.33917, -0.6104, -0.15912, -0.17751, -0.61817, -0.3357, 0.24671, 0.19942, 0.19325, 0.2362, 0.23982, 0.21985, 0.2305, 0.20444, 0.23179, 0.20491, 0.85965, -0.59655, -0.59561, -0.14789, -0.13859, -0.32712, -0.33359, 0.21602, 0.22383, 0.2123, 0.22759, 0.2507, 0.20098, 0.18631, 0.24945, 0.19709, 0.20274, -0.34831, -0.56307, -0.14572, -0.1431, -0.55866, -0.3572, 0.22695, 0.21983, 0.1963, 0.20977, 0.22298, 0.20875, 0.21081, 0.19586, 0.24708, 0.20067, -0.34288, -0.55793, -0.16806, -0.15609, -0.56464, -0.34695, 0.22555, 0.20417, 0.206, 0.20825, 0.22409, 0.25415, 0.20977, 0.18976, 0.24647, 0.1993, -0.33605, -0.59395, -0.15985, -0.18024, -0.60646, -0.32742, 0.22909, 0.19347, 0.21872, 0.2203, 0.23518, 0.25185, 0.23523, 0.18666, 0.22737, 0.2205, -0.35902, -0.56138, -0.14552, -0.14903, -0.55491, -0.3493, 0.22826, 0.21789, 0.19075, 0.20898, 0.21343, 0.21715, 0.20794, 0.19695, 0.2429, 0.18482, -0.33943, -0.55659, -0.16437, -0.14503, -0.56155, -0.34131, 0.22339, 0.20483, 0.19376, 0.23395, 0.20784, 0.2096, 0.21945, 0.19192, 0.23089, 0.20493, -0.32963, -0.56949, -0.1446, -0.15244, -0.55482, -0.34848, 0.22802, 0.20471, 0.19704, 0.20744, 0.22332, 0.2206, 0.20734, 0.18871, 0.22907, 0.20741, -0.33856, -0.564, -0.16575, -0.17422, -0.56032, -0.3426, 0.22585, 0.20169, 0.20529, 0.20836, 0.21329, 0.25353, 0.23374, 0.19306, 0.23582, 0.20196, -0.34069, -0.56522, -0.17228, -0.17503, -0.55505, -0.34264, 0.22696, 0.19604, 0.20515, 0.23964, 0.2437, 0.2111, 0.21204, 0.19975, 0.2347, 0.18835, -0.34324, -0.55184, -0.16086, -0.15907, -0.56319, -0.3384, 0.23866, 0.19808, 0.19728, 0.20205, 0.24698, 0.21416, 0.20398, 0.20475, 0.2265, 0.20141, -0.34339, -0.56344, -0.14955, -0.14878, -0.55906, -0.34506, 0.23937, 0.20027, 0.19671, 0.2085, 0.21693, 0.22164, 0.20863, 0.20703, 0.22889, 0.1916]) def test_simple_aimd(self): filename = os.path.join(test_dir, "h2o_aimd.qcout") qcout = QcOutput(filename) self.assertEqual(len(qcout.data[0]["molecules"]), 11) def test_homo_lumo(self): filename = os.path.join(test_dir, "quinoxaline_anion.qcout") qcout = QcOutput(filename) for a, b in zip(qcout.data[0]["HOMO/LUMOs"][-1], [1.00682120282, 2.80277253758]): self.assertAlmostEqual(a, b, 5) filename = os.path.join(test_dir, "qchem_energies", "hf_ccsd(t).qcout") qcout = QcOutput(filename) self.assertEqual(qcout.data[0]["HOMO/LUMOs"], [[-17.74182227672, 5.2245857011200005], [-17.74182227672, 5.2245857011200005]]) filename = os.path.join(test_dir, "crowd_gradient_number.qcout") qcout = QcOutput(filename) self.assertEqual(qcout.data[0]["HOMO/LUMOs"], [[-5.74160199446, -4.544301104620001], [-4.9796832463800005, -4.2993986498800005], [-4.7619921755, -3.8095937404000004]]) def test_bsse(self): filename = os.path.join(test_dir, "bsse.qcout") qcout = QcOutput(filename) self.assertAlmostEqual(qcout.data[0]["bsse"], -0.164210762949, 5) self.assertEqual(qcout.data[0]["jobtype"], "bsse") def test_hirshfeld_charge(self): filename = os.path.join(test_dir, "hirshfeld_population.qcout") qcout = QcOutput(filename) self.assertEqual(qcout.data[0]["charges"]["hirshfeld"], [-0.286309, 0.143134, 0.143176]) self.assertFalse(qcout.data[0]["has_error"]) def test_ghost_atoms(self): filename = os.path.join(test_dir, "ghost_atoms.qcout") qcout = QcOutput(filename) elements = [a.specie.symbol for a in qcout.data[-1]["molecules"][-1].sites] self.assertEqual(elements, ['O', 'H', 'H', 'C', 'H', 'H', 'H', 'H']) filename = os.path.join(test_dir, "MgBF4_b_overalpped.qcout") qcout = QcOutput(filename) self.assertEqual(qcout.data[0]["input"].ghost_atoms, [0]) def test_final_energy(self): filename = os.path.join(test_dir, "thiophene_wfs_5_carboxyl.qcout") qcout = QcOutput(filename) self.assertEqual(qcout.final_energy, -20180.150206202714) def test_final_structure(self): filename = os.path.join(test_dir, "thiophene_wfs_5_carboxyl.qcout") qcout = QcOutput(filename) ans = '''Full Formula (H4 C5 S1 O2) Reduced Formula: H4C5SO2 Charge = -1, Spin Mult = 2 Sites (12) 0 C 0.194695 -0.158362 -0.001887 1 C -0.535373 -1.381241 -0.001073 2 C -1.927071 -1.199274 -0.000052 3 C -2.332651 0.131916 0.000329 4 S -0.942111 1.224916 -0.001267 5 H -0.038260 -2.345185 -0.001256 6 H -2.636299 -2.025939 0.000620 7 H -3.339756 0.529895 0.001288 8 C 1.579982 0.071245 -0.002733 9 O 2.196383 1.165675 -0.000178 10 O 2.352341 -1.114671 0.001634 11 H 3.261096 -0.769470 0.003158''' self.assertEqual(qcout.final_structure.__str__(), ans) if __name__ == "__main__": unittest.main()
Dioptas/pymatgen
pymatgen/io/tests/test_qchemio.py
Python
mit
71,957
[ "pymatgen" ]
a33bf0539f3e676063b9f278dc14c3d41d6e77e27e7462628afac1ae07085a3c
import os import numpy from pyproj import Proj from netCDF4 import Dataset from trefoil.netcdf.variable import CoordinateVariable, BoundsCoordinateVariable from trefoil.netcdf.variable import SpatialCoordinateVariable, SpatialCoordinateVariables from trefoil.geometry.bbox import BBox def test_coordinate_variable_length(): data = numpy.arange(10) variable = CoordinateVariable(data) assert len(variable) == data.shape[0] def test_range_functions(): data = numpy.arange(10) variable = CoordinateVariable(data) value_range = (2, 5) indices = variable.indices_for_range(*value_range) assert indices == value_range assert numpy.array_equal(variable.slice_by_range(*value_range), data[2:6]) # Test values in reverse order data = data[::-1] variable = CoordinateVariable(data) indices = variable.indices_for_range(*value_range) size = len(variable) - 1 assert indices == (size - value_range[1], size - value_range[0]) assert numpy.array_equal(variable.slice_by_range(*value_range), data[4:8]) # Test value range much larger than data value_range = (-100, 100) variable = CoordinateVariable(numpy.arange(1, 11)) indices = variable.indices_for_range(*value_range) assert indices == (0, len(variable) - 1) data = numpy.arange(20,40) variable = CoordinateVariable(data) # Test out of range assert variable.indices_for_range(0, 10) == (0, 0) assert numpy.array_equal(variable.slice_by_range(0, 10), numpy.array([])) #Test partial overlap assert numpy.array_equal(variable.slice_by_range(10, 30), numpy.arange(20, 31)) assert variable.indices_for_range(40, 50) == (variable.values.size-1, variable.values.size-1) assert numpy.array_equal(variable.slice_by_range(40, 50), numpy.array([])) def test_window_for_bbox(): coords = SpatialCoordinateVariables.from_bbox(BBox([-124, 82, -122, 90], Proj(init='epsg:4326')), 20, 20) window = coords.get_window_for_bbox(BBox([-123.9, 82.4, -122.1, 89.6])) assert window.x_slice == slice(1, 19) assert window.y_slice == slice(1, 19) def test_BoundsCoordinateVariable(): bounds = numpy.array(((0, 1), (1, 2))) variable = BoundsCoordinateVariable(bounds) outvarname = 'test_bounds' outfilename = 'test.nc' try: with Dataset(outfilename, 'w') as target_ds: variable.add_to_dataset(target_ds, outvarname) assert '_bnds' in target_ds.dimensions assert outvarname in target_ds.dimensions assert outvarname in target_ds.variables assert numpy.array_equal(target_ds.variables[outvarname][:], bounds) finally: if os.path.exists(outfilename): os.remove(outfilename) def test_SpatialCoordinateVariable(): # Ascending variable = SpatialCoordinateVariable(numpy.arange(10)) assert numpy.array_equal(variable.edges, numpy.arange(11) - 0.5) # Descending variable = SpatialCoordinateVariable(numpy.arange(9, -1, -1)) assert numpy.array_equal(variable.edges, numpy.arange(10, -1, -1) - 0.5) outvarname = 'lat' outfilename = 'test.nc' try: with Dataset(outfilename, 'w') as target_ds: variable.add_to_dataset(target_ds, outvarname) assert outvarname in target_ds.dimensions assert outvarname in target_ds.variables assert numpy.array_equal(target_ds.variables[outvarname][:], variable.values) finally: if os.path.exists(outfilename): os.remove(outfilename) def test_SpatialCoordinateVariables_bbox(): proj = Proj(init='EPSG:4326') bbox = BBox((10.5, 5, 110.5, 55), projection=proj) coords = SpatialCoordinateVariables.from_bbox(bbox, 10, 5) assert coords.bbox.as_list() == bbox.as_list() def test_SpatialCoordinateVariables_slice_by_bbox(): lat = SpatialCoordinateVariable(numpy.arange(19, -1, -1)) lon = SpatialCoordinateVariable(numpy.arange(10)) proj = Proj(init='EPSG:4326') coords = SpatialCoordinateVariables(lon, lat, proj) subset = coords.slice_by_bbox(BBox((1.75, 3.7, 6.2, 16.7), proj)) assert numpy.array_equal(subset.x.values, numpy.arange(2, 6)) assert subset.x.values[0] == 2 assert subset.x.values[-1] == 5 assert subset.y.values[0] == 16 assert subset.y.values[-1] == 4 def test_SpatialCoordinateVariables_add_to_dataset(): lat = SpatialCoordinateVariable(numpy.arange(19, -1, -1)) lon = SpatialCoordinateVariable(numpy.arange(10)) coords = SpatialCoordinateVariables(lon, lat, Proj(init='EPSG:4326')) lat_varname = 'lat' lon_varname = 'lon' outfilename = 'test.nc' try: with Dataset(outfilename, 'w') as target_ds: coords.add_to_dataset(target_ds, lon_varname, lat_varname) assert lat_varname in target_ds.dimensions assert lat_varname in target_ds.variables assert len(target_ds.dimensions[lat_varname]) == lat.values.size assert numpy.array_equal(lat.values, target_ds.variables[lat_varname][:]) assert lon_varname in target_ds.dimensions assert lon_varname in target_ds.variables assert len(target_ds.dimensions[lon_varname]) == lon.values.size assert numpy.array_equal(lon.values, target_ds.variables[lon_varname][:]) finally: if os.path.exists(outfilename): os.remove(outfilename)
consbio/clover
trefoil/netcdf/tests/test_variable.py
Python
bsd-3-clause
5,577
[ "NetCDF" ]
9bda6e7cfd9d046212d2c2991b9c9d4a916bb20fc9bf971f6d0ce0556118bb1f
""" Test for StorageManagement clients """ # pylint: disable=protected-access,missing-docstring,invalid-name import unittest from mock import MagicMock, patch from DIRAC import S_OK, S_ERROR from DIRAC.StorageManagementSystem.Client.StorageManagerClient import getFilesToStage from DIRAC.DataManagementSystem.Client.test.mock_DM import dm_mock import errno mockObjectSE1 = MagicMock() mockObjectSE1.getFileMetadata.return_value = S_OK( {'Successful':{'/a/lfn/1.txt':{'Accessible':False}}, 'Failed':{}} ) mockObjectSE1.getStatus.return_value = S_OK( {'DiskSE': False, 'TapeSE':True} ) mockObjectSE2 = MagicMock() mockObjectSE2.getFileMetadata.return_value = S_OK( {'Successful':{'/a/lfn/2.txt':{'Cached':1, 'Accessible':True}}, 'Failed':{}} ) mockObjectSE2.getStatus.return_value = S_OK( {'DiskSE': False, 'TapeSE':True} ) mockObjectSE3 = MagicMock() mockObjectSE3.getFileMetadata.return_value = S_OK( {'Successful':{}, 'Failed':{'/a/lfn/2.txt': 'error'}} ) mockObjectSE3.getStatus.return_value = S_OK( {'DiskSE': False, 'TapeSE':True} ) mockObjectSE4 = MagicMock() mockObjectSE4.getFileMetadata.return_value = S_OK( {'Successful':{}, 'Failed':{'/a/lfn/2.txt': S_ERROR( errno.ENOENT, '' )['Message']}} ) mockObjectSE4.getStatus.return_value = S_OK( {'DiskSE': False, 'TapeSE':True} ) mockObjectSE5 = MagicMock() mockObjectSE5.getFileMetadata.return_value = S_OK( {'Successful':{'/a/lfn/1.txt':{'Accessible':False}}, 'Failed':{}} ) mockObjectSE5.getStatus.return_value = S_OK( {'DiskSE': True, 'TapeSE':False} ) mockObjectSE6 = MagicMock() mockObjectSE6.getFileMetadata.return_value = S_OK( {'Successful':{'/a/lfn/2.txt':{'Cached':0, 'Accessible':False}}, 'Failed':{}} ) mockObjectSE6.getStatus.return_value = S_OK( {'DiskSE': False, 'TapeSE':True} ) mockObjectDMSHelper = MagicMock() mockObjectDMSHelper.getLocalSiteForSE.return_value = S_OK( 'mySite' ) mockObjectDMSHelper.getSitesForSE.return_value = S_OK( ['mySite'] ) class ClientsTestCase( unittest.TestCase ): """ Base class for the clients test cases """ def setUp( self ): from DIRAC import gLogger gLogger.setLevel( 'DEBUG' ) def tearDown( self ): pass ############################################################################# class StorageManagerSuccess( ClientsTestCase ): @patch( "DIRAC.StorageManagementSystem.Client.StorageManagerClient.DataManager", return_value = dm_mock ) @patch( "DIRAC.StorageManagementSystem.Client.StorageManagerClient.StorageElement", return_value = mockObjectSE1 ) def test_getFilesToStage_withFilesToStage( self, _patch, _patched ): """ Test where the StorageElement mock will return files offline """ res = getFilesToStage( ['/a/lfn/1.txt'], checkOnlyTapeSEs = False ) self.assertTrue( res['OK'] ) self.assertEqual( res['Value']['onlineLFNs'], [] ) self.assertIn( res['Value']['offlineLFNs'], [{'SE1':['/a/lfn/1.txt']}, {'SE2':['/a/lfn/1.txt']}] ) self.assertEqual( res['Value']['absentLFNs'], {} ) self.assertEqual( res['Value']['failedLFNs'], [] ) @patch( "DIRAC.StorageManagementSystem.Client.StorageManagerClient.DataManager", return_value = dm_mock ) @patch( "DIRAC.StorageManagementSystem.Client.StorageManagerClient.StorageElement", return_value = mockObjectSE2 ) def test_getFilesToStage_noFilesToStage( self, _patch, _patched ): """ Test where the StorageElement mock will return files online """ res = getFilesToStage( ['/a/lfn/2.txt'], checkOnlyTapeSEs = False ) self.assertTrue( res['OK'] ) self.assertEqual( res['Value']['onlineLFNs'], ['/a/lfn/2.txt'] ) self.assertEqual( res['Value']['offlineLFNs'], {} ) self.assertEqual( res['Value']['absentLFNs'], {} ) self.assertEqual( res['Value']['failedLFNs'], [] ) @patch( "DIRAC.StorageManagementSystem.Client.StorageManagerClient.DataManager", return_value = dm_mock ) @patch( "DIRAC.StorageManagementSystem.Client.StorageManagerClient.StorageElement", return_value = mockObjectSE3 ) def test_getFilesToStage_seErrors( self, _patch, _patched ): """ Test where the StorageElement will return failure """ res = getFilesToStage( ['/a/lfn/2.txt'], checkOnlyTapeSEs = False ) self.assertTrue( res['OK'] ) self.assertEqual( res['Value']['onlineLFNs'], [] ) self.assertEqual( res['Value']['offlineLFNs'], {} ) self.assertEqual( res['Value']['absentLFNs'], {} ) self.assertEqual( res['Value']['failedLFNs'], ['/a/lfn/2.txt'] ) @patch( "DIRAC.StorageManagementSystem.Client.StorageManagerClient.DataManager", return_value = dm_mock ) @patch( "DIRAC.StorageManagementSystem.Client.StorageManagerClient.StorageElement", return_value = mockObjectSE4 ) def test_getFilesToStage_noSuchFile( self, _patch, _patched ): """ Test where the StorageElement will return file is absent """ res = getFilesToStage( ['/a/lfn/2.txt'], checkOnlyTapeSEs = False ) self.assertTrue( res['OK'] ) self.assertEqual( res['Value']['onlineLFNs'], [] ) self.assertEqual( res['Value']['offlineLFNs'], {} ) self.assertEqual( res['Value']['absentLFNs'], {'/a/lfn/2.txt': 'No such file or directory ( 2 : File not at SE2)'} ) self.assertEqual( res['Value']['failedLFNs'], [] ) @patch( "DIRAC.StorageManagementSystem.Client.StorageManagerClient.DataManager", return_value = dm_mock ) @patch( "DIRAC.StorageManagementSystem.Client.StorageManagerClient.StorageElement", return_value = mockObjectSE5 ) def test_getFilesToStage_fileInaccessibleAtDisk( self, _patch, _patched ): """ Test where the StorageElement will return file is unavailable at a Disk SE """ res = getFilesToStage( ['/a/lfn/1.txt'], checkOnlyTapeSEs = False ) self.assertTrue( res['OK'] ) self.assertEqual( res['Value']['onlineLFNs'], [] ) self.assertEqual( res['Value']['offlineLFNs'], {} ) self.assertEqual( res['Value']['absentLFNs'], {} ) self.assertEqual( res['Value']['failedLFNs'], ['/a/lfn/1.txt'] ) @patch( "DIRAC.StorageManagementSystem.Client.StorageManagerClient.DataManager", return_value = dm_mock ) @patch( "DIRAC.StorageManagementSystem.Client.StorageManagerClient.StorageElement", return_value = mockObjectSE2 ) def test_getFilesToStage_tapeSEOnly_1( self, _patch, _patched ): """ Test where the StorageElement will return file is available """ res = getFilesToStage( ['/a/lfn/2.txt'], checkOnlyTapeSEs = True ) self.assertTrue( res['OK'] ) self.assertEqual( res['Value']['onlineLFNs'], ['/a/lfn/2.txt'] ) self.assertEqual( res['Value']['offlineLFNs'], {} ) self.assertEqual( res['Value']['absentLFNs'], {} ) self.assertEqual( res['Value']['failedLFNs'], [] ) @patch( "DIRAC.StorageManagementSystem.Client.StorageManagerClient.DataManager", return_value = dm_mock ) @patch( "DIRAC.StorageManagementSystem.Client.StorageManagerClient.StorageElement", return_value = mockObjectSE6 ) def test_getFilesToStage_tapeSEOnly_2( self, _patch, _patched ): """ Test where the StorageElement will return file is at offline at tape """ with patch( "DIRAC.StorageManagementSystem.Client.StorageManagerClient.random.choice", new=MagicMock( return_value='SERandom' )): res = getFilesToStage( ['/a/lfn/2.txt'], checkOnlyTapeSEs = True ) self.assertTrue( res['OK'] ) self.assertEqual( res['Value']['onlineLFNs'], [] ) self.assertEqual( res['Value']['offlineLFNs'], {'SERandom': ['/a/lfn/2.txt']} ) self.assertEqual( res['Value']['absentLFNs'], {} ) self.assertEqual( res['Value']['failedLFNs'], [] ) if __name__ == '__main__': suite = unittest.defaultTestLoader.loadTestsFromTestCase( ClientsTestCase ) suite.addTest( unittest.defaultTestLoader.loadTestsFromTestCase( StorageManagerSuccess ) ) testResult = unittest.TextTestRunner( verbosity = 2 ).run( suite )
andresailer/DIRAC
StorageManagementSystem/Client/test/Test_Client_StorageManagementSystem.py
Python
gpl-3.0
8,186
[ "DIRAC" ]
4baab3197a4c1fd4632401e3ea3926c040fdb05f87d7b527b4d35905839226f2
""" @file bible/model.py @author Brian Kim @brief definition of bible objects Language, Version, Chapter, Verse """ from flask.ext.sqlalchemy import SQLAlchemy db = SQLAlchemy() class Language(db.Model): abbr = db.Column(db.String(5), primary_key=True) name = db.Column(db.String(32)) def __init__(self,abbr,name): self.abbr = abbr self.name = name def __repr__(self): return '<Language %s>' % self def __str__(self): return '%s (%s)' % (self.name,self.abbr) def __iter__(self): yield (u'abbr', self.abbr) yield (u'name', self.name) class Version(db.Model): lang_id = db.Column(db.Integer, db.ForeignKey('language.abbr')) lang = db.relationship('Language',backref=db.backref('versions',lazy='dynamic')) abbr = db.Column(db.String(5), primary_key=True) name = db.Column(db.String(32)) def chapters(self): return self.lang.chapters() def __init__(self,lang,abbr,name): self.lang = lang self.abbr = abbr self.name = name def __repr__(self): return '<Translation %s>' % self def __str__(self): return '%s (%s)' % (self.name,self.abbr) def __iter__(self): yield (u'abbr', self.abbr) yield (u'name', self.name) yield (u'lang', self.lang.abbr) class Book(db.Model): lang_id = db.Column(db.Integer, db.ForeignKey('language.abbr')) lang = db.relationship('Language',backref=db.backref('books',lazy='dynamic')) abbr = db.Column(db.String(5), primary_key=True) name = db.Column(db.String(32)) numch = db.Column(db.Integer) def __init__(self,lang,abbr,name,numch): self.lang = lang self.abbr = abbr self.name = name self.numch = numch def __repr__(self): return '<Book %s>' % self def __str__(self): return '%s (%s)' % (self.name,self.abbr) def __iter__(self): yield (u'abbr', self.abbr) yield (u'name', self.name) yield (u'lang', self.lang.abbr) yield (u'numch', self.numch) class Chapter(db.Model): id = db.Column(db.Integer,primary_key=True) version_id = db.Column(db.String(5), db.ForeignKey('version.abbr')) book_id = db.Column(db.String(5), db.ForeignKey('book.abbr')) number = db.Column(db.Integer) version = db.relationship('Version',backref=db.backref('chapters',lazy='dynamic')) book = db.relationship('Book',backref=db.backref('chapters',lazy='dynamic')) def __init__(self,v,b,num): self.version = v self.book = b self.number = num def __repr__(self): return '<Chapter %s>' % self def __str__(self): return '%s %s %i' % (self.version.abbr,self.book.abbr,self.number) def __iter__(self): yield (u'version',self.version.abbr) yield (u'book',self.book.abbr) yield (u'number',self.number) yield (u'verses',[ dict(x) for x in self.verses.all() ]) class Verse(db.Model): id = db.Column(db.Integer,primary_key=True) ch_id = db.Column(db.Integer, db.ForeignKey('chapter.id')) number = db.Column(db.Integer) text = db.Column(db.String(1024,convert_unicode=True)) chapter = db.relationship('Chapter',backref=db.backref('verses',lazy='dynamic')) def __init__(self,ch,num,txt): self.chapter = ch self.number = num self.text = txt def __repr__(self): return '<Verse %s>' % self def __str__(self): return '%s:%i' % (self.chapter,self.number) def __iter__(self): yield (u'chapter',str(self.chapter)) yield (u'number',self.number) yield (u'text',self.text)
briansan/bible
bible/model.py
Python
bsd-2-clause
3,446
[ "Brian" ]
349910da542da8e2499d991122aacc19940b8352490d84d7ce1d478b99c02742
#modified to work with python3 ############################## import operator import random from collections import defaultdict from functools import reduce ###Stats and math functions def weighted_sampler(pop_dict): """randomly sample a dictionary's keys based on weights stored as values example: m = {'a':3, 'b':2, 'c':5} samps = [weighted_sampler(m) for _ in range(1000)] #samps should be a ~ 300, b ~ 200, and c ~ 500 >>> samps.count('a') 304 >>> samps.count('b') 211 >>> samps.count('c') 485 of course, being a random sampler your results will vary""" ch = random.random() * sum(pop_dict.values()) f = sorted(pop_dict.keys()) for i, w in enumerate([pop_dict[x] for x in f]): ch -= w if ch < 0: return f[i] def choose(n,k): '''implements binomial coefficient function see: https://en.wikipedia.org/wiki/Binomial_coefficient performance not tested on really large values''' return reduce(lambda a,b: a*(n-b)/(b+1),range(k),1) def sampler(pop, size, replacement=False): '''a quick re-implementation of the python random sampler that allows for sampling with or without replacement (pythons builtin only allows without replacement)''' if replacement: return [random.choice(pop) for i in range(size)] else: return random.sample(pop, size) def rank(x): '''returns the sample rank of the elements in a list''' out={} idx=0 for i in x: out[idx] = i idx+=1 p1 = (j[0] for j in sorted(sort_dict_by_val(out), key=lambda s: s[1])) p2 = list(range(len(x))) idx=0 for i in p1: p2[i] = idx idx+=1 return p2 def order(x): '''returns the sample indeces that would return the list in sorted order ie: x = (4,3,406,5) sorted(x) == [x[i] for i in order(x)]''' out={} idx=0 for i in x: out[idx] = i idx+=1 p1 = [j[0] for j in sorted(sort_dict_by_val(out), key=lambda s: s[1])] return p1 ###Useful functions for bioinformatics ###NOTE: biopython offers more robust versions, but sometimes you just def revcom (s): '''returns the reverse complement of a DNA sequence string only accepts ACGT, upper or lowercase''' trans = str.maketrans('atcgATCG', 'tagcTAGC') rv_s = s[::-1] #strange python string reversal, it works! rv_comp_s = rv_s.translate(trans) return rv_comp_s def get_fasta(file_name): '''read a properly formated fasta and return a dict with key=readname and value=sequence reads the whole file in''' d = [i.strip() for i in open(file_name,'r')] out={} for i in d: if i.startswith('>'): curr_seq = i[1:] out[curr_seq] = [] else: out[curr_seq].append(i) for i in out: out[i] = ''.join(out[i]) return out def get_fasta_buffer(file_name): '''An efficient fasta reader that is buffered and therefore useful for big fasta files. It returns each fasta one by as a tuple -> (name, sequence). ''' file_iter = open(file_name) current_seq = [] # a dummy, needed to get through the 1st read only for line in file_iter: if not line.startswith('>'): current_seq.append(line.strip()) else: if len(current_seq) != 0: yield (current_name, ''.join(current_seq)) current_name = line[1:].strip() current_seq = [] yield (current_name, ''.join(current_seq)) print_fasta = lambda s: ('>'+i+'\n' + s[i] for i in s) ###Set functions def intersection(sets): """Get the intersection of all input sets""" if all((type(i)==type(set()) for i in sets)): return reduce(set.intersection, sets) else: sets = list(map(set, sets)) return reduce(set.intersection, sets) def union(sets): """Get the union of all input sets""" if all((type(i)==type(set()) for i in sets)): return reduce(set.union, sets) else: sets = list(map(set, sets)) return reduce(set.union, sets) def join(seqs): """Join any input sequences that support concatenation""" return reduce(operator.concat, seqs) #Misc def get_file(filename, splitchar = 'NA', buffered = False): if not buffered: if splitchar == 'NA': return [i.strip().split() for i in open(filename)] else: return [i.strip().split(splitchar) for i in open(filename)] else: if splitchar == 'NA': return (i.strip().split() for i in open(filename)) else: return (i.strip().split(splitchar) for i in open(filename)) def sort_dict_by_val(aDict): '''returns a list of tuples sorted by the dict values''' return sorted(iter(aDict.items()), key=lambda k_v: (k_v[1],k_v[0])) def pairwise(li): '''a convienience function that produces all pairwise comparisons from a list''' for i in range(len(li)): j = i+1 while j < len(li): yield (li[i], li[j]) j += 1 def count_all(xlist, proportions=False): '''Count all the items in a list, return a dict with the item as key and counts as value. If proportions are set to True, the values are the proportions not counts''' out = defaultdict(int) for i in xlist: out[i]+=1 if proportions: out2 = {} tot_sz = float(sum(out.values())) for i in out: out2[i] = out[i] / tot_sz return out2 else: return out
flag0010/python_common
old_versions/common3.py
Python
mit
5,604
[ "Biopython" ]
a65757b5ff5feda69ac7d6d513a87c7e8a94d8f641efacc326cd004f99c4a07b
from __future__ import print_function from builtins import range import sys sys.path.insert(1,"../../../") import h2o from tests import pyunit_utils import random from h2o.estimators.gbm import H2OGradientBoostingEstimator def cv_cars_gbm(): # read in the dataset and construct training set (and validation set) cars = h2o.import_file(path=pyunit_utils.locate("smalldata/junit/cars_20mpg.csv")) # choose the type model-building exercise (multinomial classification or regression). 0:regression, 1:binomial, # 2:multinomial problem = 1 #random.sample(list(range(3)),1)[0] # pick the predictors and response column, along with the correct distribution predictors = ["displacement","power","weight","acceleration","year"] if problem == 1 : response_col = "economy_20mpg" distribution = "bernoulli" cars[response_col] = cars[response_col].asfactor() elif problem == 2 : response_col = "cylinders" distribution = "multinomial" cars[response_col] = cars[response_col].asfactor() else : response_col = "economy" distribution = "gaussian" print("Distribution: {0}".format(distribution)) print("Response column: {0}".format(response_col)) ## cross-validation # 1. check that cv metrics are the same over repeated "Modulo" runs nfolds = random.randint(3,10) gbm1 = H2OGradientBoostingEstimator(nfolds=nfolds, distribution=distribution, ntrees=5, fold_assignment="Modulo") gbm1.train(x=predictors, y=response_col, training_frame=cars) gbm2 = H2OGradientBoostingEstimator(nfolds=nfolds, distribution=distribution, ntrees=5, fold_assignment="Modulo") gbm2.train(x=predictors, y=response_col, training_frame=cars) pyunit_utils.check_models(gbm1, gbm2, True) # 2. check that cv metrics are different over repeated "Random" runs nfolds = random.randint(3,10) gbm1 = H2OGradientBoostingEstimator(nfolds=nfolds, distribution=distribution, ntrees=5, fold_assignment="Random") gbm1.train(x=predictors, y=response_col, training_frame=cars) gbm2 = H2OGradientBoostingEstimator(nfolds=nfolds, distribution=distribution, ntrees=5, fold_assignment="Random") gbm2.train(x=predictors, y=response_col, training_frame=cars) try: pyunit_utils.check_models(gbm1, gbm2, True) assert False, "Expected models to be different over repeated Random runs" except AssertionError: assert True # 3. folds_column num_folds = random.randint(2,5) fold_assignments = h2o.H2OFrame([[random.randint(0,num_folds-1)] for f in range(cars.nrow)]) fold_assignments.set_names(["fold_assignments"]) cars = cars.cbind(fold_assignments) gbm = H2OGradientBoostingEstimator(distribution=distribution, ntrees=5, keep_cross_validation_predictions=True) gbm.train(x=predictors, y=response_col, training_frame=cars, fold_column="fold_assignments") num_cv_models = len(gbm._model_json['output']['cross_validation_models']) assert num_cv_models==num_folds, "Expected {0} cross-validation models, but got " \ "{1}".format(num_folds, num_cv_models) cv_model1 = h2o.get_model(gbm._model_json['output']['cross_validation_models'][0]['name']) cv_model2 = h2o.get_model(gbm._model_json['output']['cross_validation_models'][1]['name']) # 4. keep_cross_validation_predictions cv_predictions = gbm1._model_json['output']['cross_validation_predictions'] assert cv_predictions is None, "Expected cross-validation predictions to be None, but got {0}".format(cv_predictions) cv_predictions = gbm._model_json['output']['cross_validation_predictions'] assert len(cv_predictions)==num_folds, "Expected the same number of cross-validation predictions " \ "as folds, but got {0}".format(len(cv_predictions)) ## boundary cases # 1. nfolds = number of observations (leave-one-out cross-validation) gbm = H2OGradientBoostingEstimator(nfolds=cars.nrow, distribution=distribution,ntrees=5, fold_assignment="Modulo") gbm.train(x=predictors, y=response_col, training_frame=cars) # 2. nfolds = 0 gbm1 = H2OGradientBoostingEstimator(nfolds=0, distribution=distribution, ntrees=5) gbm1.train(x=predictors, y=response_col,training_frame=cars) # check that this is equivalent to no nfolds gbm2 = H2OGradientBoostingEstimator(distribution=distribution, ntrees=5) gbm2.train(x=predictors, y=response_col, training_frame=cars) pyunit_utils.check_models(gbm1, gbm2) # 3. cross-validation and regular validation attempted gbm = H2OGradientBoostingEstimator(nfolds=random.randint(3,10), ntrees=5, distribution=distribution) gbm.train(x=predictors, y=response_col, training_frame=cars, validation_frame=cars) ## error cases # 1. nfolds == 1 or < 0 try: gbm = H2OGradientBoostingEstimator(nfolds=random.sample([-1,1],1)[0], ntrees=5, distribution=distribution) gbm.train(x=predictors, y=response_col, training_frame=cars) assert False, "Expected model-build to fail when nfolds is 1 or < 0" except EnvironmentError: assert True # 2. more folds than observations try: gbm = H2OGradientBoostingEstimator(nfolds=cars.nrow+1, distribution=distribution, ntrees=5, fold_assignment="Modulo") gbm.train(x=predictors, y=response_col, training_frame=cars) assert False, "Expected model-build to fail when nfolds > nobs" except EnvironmentError: assert True # 3. fold_column and nfolds both specified try: gbm = H2OGradientBoostingEstimator(nfolds=3, ntrees=5, distribution=distribution) gbm.train(x=predictors, y=response_col, training_frame=cars, fold_column="fold_assignments") assert False, "Expected model-build to fail when fold_column and nfolds both specified" except EnvironmentError: assert True # 4. fold_column and fold_assignment both specified try: gbm = H2OGradientBoostingEstimator(ntrees=5, fold_assignment="Random", distribution=distribution) gbm.train(x=predictors, y=response_col, training_frame=cars, fold_column="fold_assignments") assert False, "Expected model-build to fail when fold_column and fold_assignment both specified" except EnvironmentError: assert True if __name__ == "__main__": pyunit_utils.standalone_test(cv_cars_gbm) else: cv_cars_gbm()
YzPaul3/h2o-3
h2o-py/tests/testdir_algos/gbm/pyunit_cv_cars_gbm.py
Python
apache-2.0
7,071
[ "Gaussian" ]
34aa8d062d85b2fba451351db4f1711176d997aa280c448ad1bd6904c2c1cdd6
# ============================================================================ # # Copyright (C) 2007-2010 Conceptive Engineering bvba. All rights reserved. # www.conceptive.be / project-camelot@conceptive.be # # This file is part of the Camelot Library. # # This file may be used under the terms of the GNU General Public # License version 2.0 as published by the Free Software Foundation # and appearing in the file license.txt included in the packaging of # this file. Please review this information to ensure GNU # General Public Licensing requirements will be met. # # If you are unsure which license is appropriate for your use, please # visit www.python-camelot.com or contact project-camelot@conceptive.be # # This file is provided AS IS with NO WARRANTY OF ANY KIND, INCLUDING THE # WARRANTY OF DESIGN, MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE. # # For use of this library in commercial applications, please contact # project-camelot@conceptive.be # # ============================================================================ """Validator classes validate data before their GUI representation is closed by the user. The validator class also takes care of informing the user where the data is invalid. This prevents the user from entering invalid data into the model or flushing it to the database."""
kurtraschke/camelot
camelot/admin/validator/__init__.py
Python
gpl-2.0
1,346
[ "VisIt" ]
afcbb20db1d318f71b9eff2e128e075dd3e69ce56ad163164f6f6a5ecf6a542d
""" Tests for the Piwik template tags and filters. """ from django.contrib.auth.models import User from django.http import HttpRequest from django.template import Context from django.test.utils import override_settings from analytical.templatetags.piwik import PiwikNode from analytical.tests.utils import TagTestCase from analytical.utils import AnalyticalException @override_settings(PIWIK_DOMAIN_PATH='example.com', PIWIK_SITE_ID='345') class PiwikTagTestCase(TagTestCase): """ Tests for the ``piwik`` template tag. """ def test_tag(self): r = self.render_tag('piwik', 'piwik') self.assertTrue('"//example.com/"' in r, r) self.assertTrue("_paq.push(['setSiteId', 345]);" in r, r) self.assertTrue('img src="//example.com/piwik.php?idsite=345"' in r, r) def test_node(self): r = PiwikNode().render(Context({})) self.assertTrue('"//example.com/";' in r, r) self.assertTrue("_paq.push(['setSiteId', 345]);" in r, r) self.assertTrue('img src="//example.com/piwik.php?idsite=345"' in r, r) @override_settings(PIWIK_DOMAIN_PATH='example.com/piwik', PIWIK_SITE_ID='345') def test_domain_path_valid(self): r = self.render_tag('piwik', 'piwik') self.assertTrue('"//example.com/piwik/"' in r, r) @override_settings(PIWIK_DOMAIN_PATH='example.com:1234', PIWIK_SITE_ID='345') def test_domain_port_valid(self): r = self.render_tag('piwik', 'piwik') self.assertTrue('"//example.com:1234/";' in r, r) @override_settings(PIWIK_DOMAIN_PATH='example.com:1234/piwik', PIWIK_SITE_ID='345') def test_domain_port_path_valid(self): r = self.render_tag('piwik', 'piwik') self.assertTrue('"//example.com:1234/piwik/"' in r, r) @override_settings(PIWIK_DOMAIN_PATH=None) def test_no_domain(self): self.assertRaises(AnalyticalException, PiwikNode) @override_settings(PIWIK_SITE_ID=None) def test_no_siteid(self): self.assertRaises(AnalyticalException, PiwikNode) @override_settings(PIWIK_SITE_ID='x') def test_siteid_not_a_number(self): self.assertRaises(AnalyticalException, PiwikNode) @override_settings(PIWIK_DOMAIN_PATH='http://www.example.com') def test_domain_protocol_invalid(self): self.assertRaises(AnalyticalException, PiwikNode) @override_settings(PIWIK_DOMAIN_PATH='example.com/') def test_domain_slash_invalid(self): self.assertRaises(AnalyticalException, PiwikNode) @override_settings(PIWIK_DOMAIN_PATH='example.com:123:456') def test_domain_multi_port(self): self.assertRaises(AnalyticalException, PiwikNode) @override_settings(PIWIK_DOMAIN_PATH='example.com:') def test_domain_incomplete_port(self): self.assertRaises(AnalyticalException, PiwikNode) @override_settings(PIWIK_DOMAIN_PATH='example.com:/piwik') def test_domain_uri_incomplete_port(self): self.assertRaises(AnalyticalException, PiwikNode) @override_settings(PIWIK_DOMAIN_PATH='example.com:12df') def test_domain_port_invalid(self): self.assertRaises(AnalyticalException, PiwikNode) @override_settings(ANALYTICAL_INTERNAL_IPS=['1.1.1.1']) def test_render_internal_ip(self): req = HttpRequest() req.META['REMOTE_ADDR'] = '1.1.1.1' context = Context({'request': req}) r = PiwikNode().render(context) self.assertTrue(r.startswith( '<!-- Piwik disabled on internal IP address'), r) self.assertTrue(r.endswith('-->'), r) def test_uservars(self): context = Context({'piwik_vars': [(1, 'foo', 'foo_val'), (2, 'bar', 'bar_val', 'page'), (3, 'spam', 'spam_val', 'visit')]}) r = PiwikNode().render(context) msg = 'Incorrect Piwik custom variable rendering. Expected:\n%s\nIn:\n%s' for var_code in ['_paq.push(["setCustomVariable", 1, "foo", "foo_val", "page"]);', '_paq.push(["setCustomVariable", 2, "bar", "bar_val", "page"]);', '_paq.push(["setCustomVariable", 3, "spam", "spam_val", "visit"]);']: self.assertIn(var_code, r, msg % (var_code, r)) @override_settings(ANALYTICAL_AUTO_IDENTIFY=True) def test_default_usertrack(self): context = Context({ 'user': User(username='BDFL', first_name='Guido', last_name='van Rossum') }) r = PiwikNode().render(context) msg = 'Incorrect Piwik user tracking rendering.\nNot found:\n%s\nIn:\n%s' var_code = '_paq.push(["setUserId", "BDFL"]);' self.assertIn(var_code, r, msg % (var_code, r)) def test_piwik_usertrack(self): context = Context({ 'piwik_identity': 'BDFL' }) r = PiwikNode().render(context) msg = 'Incorrect Piwik user tracking rendering.\nNot found:\n%s\nIn:\n%s' var_code = '_paq.push(["setUserId", "BDFL"]);' self.assertIn(var_code, r, msg % (var_code, r)) def test_analytical_usertrack(self): context = Context({ 'analytical_identity': 'BDFL' }) r = PiwikNode().render(context) msg = 'Incorrect Piwik user tracking rendering.\nNot found:\n%s\nIn:\n%s' var_code = '_paq.push(["setUserId", "BDFL"]);' self.assertIn(var_code, r, msg % (var_code, r)) @override_settings(ANALYTICAL_AUTO_IDENTIFY=True) def test_disable_usertrack(self): context = Context({ 'user': User(username='BDFL', first_name='Guido', last_name='van Rossum'), 'piwik_identity': None }) r = PiwikNode().render(context) msg = 'Incorrect Piwik user tracking rendering.\nFound:\n%s\nIn:\n%s' var_code = '_paq.push(["setUserId", "BDFL"]);' self.assertNotIn(var_code, r, msg % (var_code, r)) @override_settings(PIWIK_DISABLE_COOKIES=True) def test_disable_cookies(self): r = PiwikNode().render(Context({})) self.assertTrue("_paq.push(['disableCookies']);" in r, r)
pjdelport/django-analytical
analytical/tests/test_tag_piwik.py
Python
mit
6,215
[ "VisIt" ]
87a64819cb5d3cf0f4e925132d7d136c29aacf81cbec05cfa0f1dc1efff34481
from behave import when from django.core.management import execute_from_command_line from selenium import webdriver def before_all(context): context.browser = webdriver.Firefox() context.browser.implicitly_wait(1) context.server_url = 'http://localhost:8081' execute_from_command_line(['manage.py', 'loaddata', 'test_initial_data.json']) def after_all(context): context.browser.quit() @when(u'I visit the "{link}" page') def get_url(context, link=''): url = u'/'.join([context.server_url, link.strip('/')]) context.browser.get(url) # def before_feature(context, feature): # pass # def after_feature(context, feature): # pass
evili/django-jenkins-plugin
src/test/resources/org/jenkinsci/plugins/django/simple_test_project/bdd_tests/features/environment.py
Python
apache-2.0
697
[ "VisIt" ]
6bd4324987fe2841ab49b0fb02e333571e24f0e801830050b4c04e8731bdd85b
""" Views for user API """ from django.shortcuts import redirect from django.utils import dateparse from rest_framework import generics, views from rest_framework.decorators import api_view from rest_framework.response import Response from opaque_keys.edx.keys import UsageKey from opaque_keys import InvalidKeyError from courseware.access import is_mobile_available_for_user from courseware.model_data import FieldDataCache from courseware.module_render import get_module_for_descriptor from courseware.views import get_current_child, save_positions_recursively_up from student.models import CourseEnrollment, User from xblock.fields import Scope from xblock.runtime import KeyValueStore from xmodule.modulestore.django import modulestore from xmodule.modulestore.exceptions import ItemNotFoundError from .serializers import CourseEnrollmentSerializer, UserSerializer from .. import errors from ..utils import mobile_view, mobile_course_access @mobile_view(is_user=True) class UserDetail(generics.RetrieveAPIView): """ **Use Case** Get information about the specified user and access other resources the user has permissions for. Users are redirected to this endpoint after logging in. You can use the **course_enrollments** value in the response to get a list of courses the user is enrolled in. **Example request**: GET /api/mobile/v0.5/users/{username} **Response Values** * id: The ID of the user. * username: The username of the currently logged in user. * email: The email address of the currently logged in user. * name: The full name of the currently logged in user. * course_enrollments: The URI to list the courses the currently logged in user is enrolled in. """ queryset = ( User.objects.all() .select_related('profile', 'course_enrollments') ) serializer_class = UserSerializer lookup_field = 'username' @mobile_view(is_user=True) class UserCourseStatus(views.APIView): """ **Use Case** Get or update the ID of the module that the specified user last visited in the specified course. **Example request**: GET /api/mobile/v0.5/users/{username}/course_status_info/{course_id} PATCH /api/mobile/v0.5/users/{username}/course_status_info/{course_id} body: last_visited_module_id={module_id} modification_date={date} The modification_date is optional. If it is present, the update will only take effect if the modification_date is later than the modification_date saved on the server. **Response Values** * last_visited_module_id: The ID of the last module visited by the user in the course. * last_visited_module_path: The ID of the modules in the path from the last visited module to the course module. """ http_method_names = ["get", "patch"] def _last_visited_module_path(self, request, course): """ Returns the path from the last module visited by the current user in the given course up to the course module. If there is no such visit, the first item deep enough down the course tree is used. """ field_data_cache = FieldDataCache.cache_for_descriptor_descendents( course.id, request.user, course, depth=2) course_module = get_module_for_descriptor(request.user, request, course, field_data_cache, course.id) path = [course_module] chapter = get_current_child(course_module, min_depth=2) if chapter is not None: path.append(chapter) section = get_current_child(chapter, min_depth=1) if section is not None: path.append(section) path.reverse() return path def _get_course_info(self, request, course): """ Returns the course status """ path = self._last_visited_module_path(request, course) path_ids = [unicode(module.location) for module in path] return Response({ "last_visited_module_id": path_ids[0], "last_visited_module_path": path_ids, }) def _update_last_visited_module_id(self, request, course, module_key, modification_date): """ Saves the module id if the found modification_date is less recent than the passed modification date """ field_data_cache = FieldDataCache.cache_for_descriptor_descendents( course.id, request.user, course, depth=2) try: module_descriptor = modulestore().get_item(module_key) except ItemNotFoundError: return Response(errors.ERROR_INVALID_MODULE_ID, status=400) module = get_module_for_descriptor(request.user, request, module_descriptor, field_data_cache, course.id) if modification_date: key = KeyValueStore.Key( scope=Scope.user_state, user_id=request.user.id, block_scope_id=course.location, field_name=None ) student_module = field_data_cache.find(key) if student_module: original_store_date = student_module.modified if modification_date < original_store_date: # old modification date so skip update return self._get_course_info(request, course) save_positions_recursively_up(request.user, request, field_data_cache, module) return self._get_course_info(request, course) @mobile_course_access(depth=2) def get(self, request, course, *args, **kwargs): # pylint: disable=unused-argument """ Get the ID of the module that the specified user last visited in the specified course. """ return self._get_course_info(request, course) @mobile_course_access(depth=2) def patch(self, request, course, *args, **kwargs): # pylint: disable=unused-argument """ Update the ID of the module that the specified user last visited in the specified course. """ module_id = request.DATA.get("last_visited_module_id") modification_date_string = request.DATA.get("modification_date") modification_date = None if modification_date_string: modification_date = dateparse.parse_datetime(modification_date_string) if not modification_date or not modification_date.tzinfo: return Response(errors.ERROR_INVALID_MODIFICATION_DATE, status=400) if module_id: try: module_key = UsageKey.from_string(module_id) except InvalidKeyError: return Response(errors.ERROR_INVALID_MODULE_ID, status=400) return self._update_last_visited_module_id(request, course, module_key, modification_date) else: # The arguments are optional, so if there's no argument just succeed return self._get_course_info(request, course) @mobile_view(is_user=True) class UserCourseEnrollmentsList(generics.ListAPIView): """ **Use Case** Get information about the courses the currently logged in user is enrolled in. **Example request**: GET /api/mobile/v0.5/users/{username}/course_enrollments/ **Response Values** * created: The date the course was created. * mode: The type of certificate registration for this course: honor or certified. * is_active: Whether the course is currently active; true or false. * certificate: Information about the user's earned certificate in the course. * url: URL to the downloadable version of the certificate, if exists. * course: A collection of data about the course: * course_about: The URI to get the data for the course About page. * course_updates: The URI to get data for course updates. * number: The course number. * org: The organization that created the course. * video_outline: The URI to get the list of all vides the user can access in the course. * id: The unique ID of the course. * subscription_id: A unique "clean" (alphanumeric with '_') ID of the course. * latest_updates: Reserved for future use. * end: The end date of the course. * name: The name of the course. * course_handouts: The URI to get data for course handouts. * start: The data and time the course starts. * course_image: The path to the course image. """ queryset = CourseEnrollment.objects.all() serializer_class = CourseEnrollmentSerializer lookup_field = 'username' def get_queryset(self): enrollments = self.queryset.filter( user__username=self.kwargs['username'], is_active=True ).order_by('created').reverse() return [ enrollment for enrollment in enrollments if enrollment.course and is_mobile_available_for_user(self.request.user, enrollment.course) ] @api_view(["GET"]) @mobile_view() def my_user_info(request): """ Redirect to the currently-logged-in user's info page """ return redirect("user-detail", username=request.user.username)
dkarakats/edx-platform
lms/djangoapps/mobile_api/users/views.py
Python
agpl-3.0
9,370
[ "VisIt" ]
c3197a749acf29bafed67be21e7e279ab5939da697f28aea0bd11514896c938a
######################################################################## # Author : Andrei Tsaregorodtsev ######################################################################## """ Utilities for managing DIRAC configuration: getCEsFromCS getUnusedGridCEs getUnusedGridSEs getSiteUpdates getSEUpdates """ __RCSID__ = "$Id$" import re import socket from urlparse import urlparse from DIRAC import gConfig, gLogger, S_OK, S_ERROR from DIRAC.Core.Utilities import List from DIRAC.Core.Utilities.Grid import getBdiiCEInfo, getBdiiSEInfo, ldapService from DIRAC.Core.Utilities.SitesDIRACGOCDBmapping import getDIRACSiteName, getDIRACSesForHostName from DIRAC.ConfigurationSystem.Client.Helpers.Path import cfgPath from DIRAC.ConfigurationSystem.Client.Helpers.Registry import getVOs, getVOOption from DIRAC.ConfigurationSystem.Client.PathFinder import getDatabaseSection def getGridVOs(): """ Get all the VOMS VO names served by this DIRAC service """ voNames = [] result = getVOs() if not result['OK']: return result else: vos = result['Value'] for vo in vos: vomsVO = getVOOption(vo, "VOMSName") if vomsVO: voNames.append(vomsVO) return S_OK(voNames) def getCEsFromCS(): """ Get all the CEs defined in the CS """ knownCEs = [] result = gConfig.getSections('/Resources/Sites') if not result['OK']: return result grids = result['Value'] for grid in grids: result = gConfig.getSections('/Resources/Sites/%s' % grid) if not result['OK']: return result sites = result['Value'] for site in sites: opt = gConfig.getOptionsDict('/Resources/Sites/%s/%s' % (grid, site))['Value'] ces = List.fromChar(opt.get('CE', '')) knownCEs += ces return S_OK(knownCEs) def getSEsFromCS(protocol='srm'): """ Get all the SEs defined in the CS """ knownSEs = {} result = gConfig.getSections('/Resources/StorageElements') if not result['OK']: return result ses = result['Value'] for se in ses: seSection = '/Resources/StorageElements/%s' % se result = gConfig.getSections(seSection) if not result['OK']: continue accesses = result['Value'] for access in accesses: seProtocol = gConfig.getValue(cfgPath(seSection, access, 'Protocol'), '') if seProtocol.lower() == protocol.lower() or protocol == 'any': host = gConfig.getValue(cfgPath(seSection, access, 'Host'), '') knownSEs.setdefault(host, []) knownSEs[host].append(se) else: continue return S_OK(knownSEs) def getGridCEs(vo, bdiiInfo=None, ceBlackList=None, hostURL=None, glue2=False): """ Get all the CEs available for a given VO and having queues in Production state """ knownCEs = set() if ceBlackList is not None: knownCEs = knownCEs.union(set(ceBlackList)) ceBdiiDict = bdiiInfo if bdiiInfo is None: result = getBdiiCEInfo(vo, host=hostURL, glue2=glue2) if not result['OK']: return result ceBdiiDict = result['Value'] siteDict = {} for site in ceBdiiDict: siteCEs = set(ceBdiiDict[site]['CEs'].keys()) newCEs = siteCEs - knownCEs if not newCEs: continue ceFullDict = {} for ce in newCEs: ceDict = {} ceInfo = ceBdiiDict[site]['CEs'][ce] ceType = 'Unknown' ceDict['Queues'] = [] for queue in ceInfo['Queues']: queueStatus = ceInfo['Queues'][queue].get('GlueCEStateStatus', 'UnknownStatus') if 'production' in queueStatus.lower(): ceType = ceInfo['Queues'][queue].get('GlueCEImplementationName', '') ceDict['Queues'].append(queue) if not ceDict['Queues']: continue ceDict['CEType'] = ceType ceDict['GOCSite'] = site ceDict['CEID'] = ce systemName = ceInfo.get('GlueHostOperatingSystemName', 'Unknown') systemVersion = ceInfo.get('GlueHostOperatingSystemVersion', 'Unknown') systemRelease = ceInfo.get('GlueHostOperatingSystemRelease', 'Unknown') ceDict['System'] = (systemName, systemVersion, systemRelease) ceFullDict[ce] = ceDict siteDict[site] = ceFullDict result = S_OK(siteDict) result['BdiiInfo'] = ceBdiiDict return result def getSiteUpdates(vo, bdiiInfo=None, log=None): """ Get all the necessary updates for the already defined sites and CEs """ def addToChangeSet(entry, changeSet): """ Inner function to update changeSet with entry (a tuple) :param tuple entry: entry to add to changeSet :param set changeSet: set collecting stuff to change """ _section, _option, value, new_value = entry if new_value and new_value != value: changeSet.add(entry) if log is None: log = gLogger ceBdiiDict = bdiiInfo if bdiiInfo is None: result = getBdiiCEInfo(vo) if not result['OK']: return result ceBdiiDict = result['Value'] changeSet = set() for site in ceBdiiDict: result = getDIRACSiteName(site) if not result['OK']: continue siteNames = result['Value'] for siteName in siteNames: siteSection = cfgPath('/Resources', 'Sites', siteName.split('.')[0], siteName) result = gConfig.getOptionsDict(siteSection) if not result['OK']: continue siteDict = result['Value'] # Current CS values coor = siteDict.get('Coordinates', 'Unknown') mail = siteDict.get('Mail', 'Unknown').replace(' ', '') description = siteDict.get('Description', 'Unknown') description = description.replace(' ,', ',') longitude = ceBdiiDict[site].get('GlueSiteLongitude', '').strip() latitude = ceBdiiDict[site].get('GlueSiteLatitude', '').strip() # Current BDII value newcoor = '' if longitude and latitude: newcoor = "%s:%s" % (longitude, latitude) newmail = ceBdiiDict[site].get('GlueSiteSysAdminContact', '').replace('mailto:', '').strip() newdescription = ceBdiiDict[site].get('GlueSiteDescription', '').strip() newdescription = ", ".join([line.strip() for line in newdescription.split(",")]) # Adding site data to the changes list addToChangeSet((siteSection, 'Coordinates', coor, newcoor), changeSet) addToChangeSet((siteSection, 'Mail', mail, newmail), changeSet) addToChangeSet((siteSection, 'Description', description, newdescription), changeSet) ces = gConfig.getValue(cfgPath(siteSection, 'CE'), []) for ce in ces: ceSection = cfgPath(siteSection, 'CEs', ce) ceDict = {} result = gConfig.getOptionsDict(ceSection) if result['OK']: ceDict = result['Value'] else: if ceBdiiDict[site]['CEs'].get(ce, None): log.notice("Adding new CE", "%s to site %s/%s" % (ce, siteName, site)) ceInfo = ceBdiiDict[site]['CEs'].get(ce, None) if ceInfo is None: ceType = ceDict.get('CEType', '') continue # Current CS CE info arch = ceDict.get('architecture', 'Unknown') OS = ceDict.get('OS', 'Unknown') si00 = ceDict.get('SI00', 'Unknown') ceType = ceDict.get('CEType', 'Unknown') ram = ceDict.get('MaxRAM', 'Unknown') submissionMode = ceDict.get('SubmissionMode', 'Unknown') # Current BDII CE info newarch = ceBdiiDict[site]['CEs'][ce].get('GlueHostArchitecturePlatformType', '').strip() systemName = ceInfo.get('GlueHostOperatingSystemName', '').strip() systemVersion = ceInfo.get('GlueHostOperatingSystemVersion', '').strip() systemRelease = ceInfo.get('GlueHostOperatingSystemRelease', '').strip() newOS = '' if systemName and systemVersion and systemRelease: newOS = '_'.join((systemName, systemVersion, systemRelease)) newsi00 = ceInfo.get('GlueHostBenchmarkSI00', '').strip() newCEType = 'Unknown' for queue in ceInfo['Queues']: queueDict = ceInfo['Queues'][queue] newCEType = queueDict.get('GlueCEImplementationName', '').strip() if newCEType: break if newCEType == 'ARC-CE': newCEType = 'ARC' newSubmissionMode = None if newCEType in ['ARC', 'CREAM']: newSubmissionMode = "Direct" newRAM = ceInfo.get('GlueHostMainMemoryRAMSize', '').strip() # Protect from unreasonable values if newRAM and int(newRAM) > 150000: newRAM = '' # Adding CE data to the change list addToChangeSet((ceSection, 'architecture', arch, newarch), changeSet) addToChangeSet((ceSection, 'OS', OS, newOS), changeSet) addToChangeSet((ceSection, 'SI00', si00, newsi00), changeSet) addToChangeSet((ceSection, 'CEType', ceType, newCEType), changeSet) addToChangeSet((ceSection, 'MaxRAM', ram, newRAM), changeSet) if submissionMode == "Unknown" and newSubmissionMode: addToChangeSet((ceSection, 'SubmissionMode', submissionMode, newSubmissionMode), changeSet) queues = ceInfo['Queues'].keys() for queue in queues: queueInfo = ceInfo['Queues'][queue] queueStatus = queueInfo['GlueCEStateStatus'] queueSection = cfgPath(ceSection, 'Queues', queue) queueDict = {} result = gConfig.getOptionsDict(queueSection) if result['OK']: queueDict = result['Value'] else: if queueStatus.lower() == "production": log.notice("Adding new queue", "%s to CE %s" % (queue, ce)) else: continue # Current CS queue info maxCPUTime = queueDict.get('maxCPUTime', 'Unknown') si00 = queueDict.get('SI00', 'Unknown') maxTotalJobs = queueDict.get('MaxTotalJobs', 'Unknown') # Current BDII queue info newMaxCPUTime = queueInfo.get('GlueCEPolicyMaxCPUTime', '') if newMaxCPUTime == "4" * len(newMaxCPUTime) or newMaxCPUTime == "9" * len(newMaxCPUTime): newMaxCPUTime = '' wallTime = queueInfo.get('GlueCEPolicyMaxWallClockTime', '') if wallTime == "4" * len(wallTime) or wallTime == "9" * len(wallTime): wallTime = '' if wallTime and int(wallTime) > 0: if not newMaxCPUTime: newMaxCPUTime = str(int(0.8 * int(wallTime))) else: if int(wallTime) <= int(newMaxCPUTime): newMaxCPUTime = str(int(0.8 * int(wallTime))) newSI00 = '' caps = queueInfo.get('GlueCECapability', []) if isinstance(caps, basestring): caps = [caps] for cap in caps: if 'CPUScalingReferenceSI00' in cap: newSI00 = cap.split('=')[-1] # Adding queue info to the CS addToChangeSet((queueSection, 'maxCPUTime', maxCPUTime, newMaxCPUTime), changeSet) addToChangeSet((queueSection, 'SI00', si00, newSI00), changeSet) if maxTotalJobs == "Unknown": newTotalJobs = min(1000, int(int(queueInfo.get('GlueCEInfoTotalCPUs', 0)) / 2)) newWaitingJobs = max(2, int(newTotalJobs * 0.1)) newTotalJobs = str(newTotalJobs) newWaitingJobs = str(newWaitingJobs) addToChangeSet((queueSection, 'MaxTotalJobs', '', newTotalJobs), changeSet) addToChangeSet((queueSection, 'MaxWaitingJobs', '', newWaitingJobs), changeSet) # Updating eligible VO list VOs = set() if queueDict.get('VO', ''): VOs = set([q.strip() for q in queueDict.get('VO', '').split(',') if q]) if vo not in VOs: VOs.add(vo) VOs = list(VOs) newVOs = ','.join(VOs) addToChangeSet((queueSection, 'VO', '', newVOs), changeSet) return S_OK(changeSet) def getGridSEs(vo, bdiiInfo=None, seBlackList=None): """ Get all the SEs available for a given VO """ seBdiiDict = bdiiInfo if bdiiInfo is None: result = getBdiiSEInfo(vo) if not result['OK']: return result seBdiiDict = result['Value'] knownSEs = set() if seBlackList is not None: knownSEs = knownSEs.union(set(seBlackList)) siteDict = {} for site in seBdiiDict: for gridSE in seBdiiDict[site]['SEs']: seDict = seBdiiDict[site]['SEs'][gridSE] # if "lhcb" in seDict['GlueSAName']: # print '+'*80 # print gridSE # for k,v in seDict.items(): # print k,'\t',v if gridSE not in knownSEs: siteDict.setdefault(site, {}) if isinstance(seDict['GlueSAAccessControlBaseRule'], list): voList = [re.sub('^VO:', '', s) for s in seDict['GlueSAAccessControlBaseRule']] else: voList = [re.sub('^VO:', '', seDict['GlueSAAccessControlBaseRule'])] siteDict[site][gridSE] = {'GridSite': seDict['GlueSiteUniqueID'], 'BackendType': seDict['GlueSEImplementationName'], 'Description': seDict.get('GlueSEName', '-'), 'VOs': voList } result = S_OK(siteDict) result['BdiiInfo'] = seBdiiDict return result def getGridSRMs(vo, bdiiInfo=None, srmBlackList=None, unUsed=False): result = ldapService(serviceType='SRM', vo=vo) if not result['OK']: return result srmBdiiDict = result['Value'] knownSRMs = set() if srmBlackList is not None: knownSRMs = knownSRMs.union(set(srmBlackList)) siteSRMDict = {} for srm in srmBdiiDict: srm = dict(srm) endPoint = srm.get('GlueServiceEndpoint', '') srmHost = '' if endPoint: srmHost = urlparse(endPoint).hostname if not srmHost: continue if srmHost in knownSRMs: continue if unUsed: result = getDIRACSesForHostName(srmHost) if not result['OK']: return result diracSEs = result['Value'] if diracSEs: # If it is a known SRM and only new SRMs are requested, continue continue site = srm.get('GlueForeignKey', '').replace('GlueSiteUniqueID=', '') siteSRMDict.setdefault(site, {}) siteSRMDict[site][srmHost] = srm if bdiiInfo is None: result = getBdiiSEInfo(vo) if not result['OK']: return result seBdiiDict = dict(result['Value']) else: seBdiiDict = dict(bdiiInfo) srmSeDict = {} for site in siteSRMDict: srms = siteSRMDict[site].keys() for srm in srms: if seBdiiDict.get(site, {}).get('SEs', {}).get(srm, {}): srmSeDict.setdefault(site, {}) srmSeDict[site].setdefault(srm, {}) srmSeDict[site][srm]['SRM'] = siteSRMDict[site][srm] srmSeDict[site][srm]['SE'] = seBdiiDict[site]['SEs'][srm] return S_OK(srmSeDict) def getSRMUpdates(vo, bdiiInfo=None): changeSet = set() def addToChangeSet(entry, changeSet): _section, _option, value, new_value = entry if new_value and new_value != value: changeSet.add(entry) result = getGridSRMs(vo, bdiiInfo=bdiiInfo) if not result['OK']: return result srmBdiiDict = result['Value'] result = getSEsFromCS() if not result['OK']: return result seDict = result['Value'] result = getVOs() if result['OK']: csVOs = set(result['Value']) else: csVOs = set([vo]) for seHost, diracSE in seDict.items(): seSection = '/Resources/StorageElements/%s' % diracSE[0] # Look up existing values first description = gConfig.getValue(cfgPath(seSection, 'Description'), 'Unknown') backend = gConfig.getValue(cfgPath(seSection, 'BackendType'), 'Unknown') vos = gConfig.getValue(cfgPath(seSection, 'VO'), 'Unknown').replace(' ', '') size = gConfig.getValue(cfgPath(seSection, 'TotalSize'), 'Unknown') # Look up current BDII values srmDict = {} seBdiiDict = {} for site in srmBdiiDict: if seHost in srmBdiiDict[site]: srmDict = srmBdiiDict[site][seHost]['SRM'] seBdiiDict = srmBdiiDict[site][seHost]['SE'] break if not srmDict or not seBdiiDict: continue newDescription = seBdiiDict.get('GlueSEName', 'Unknown') newBackend = seBdiiDict.get('GlueSEImplementationName', 'Unknown') newSize = seBdiiDict.get('GlueSESizeTotal', 'Unknown') addToChangeSet((seSection, 'Description', description, newDescription), changeSet) addToChangeSet((seSection, 'BackendType', backend, newBackend), changeSet) addToChangeSet((seSection, 'TotalSize', size, newSize), changeSet) # Evaluate VOs if no space token defined, otherwise this is VO specific spaceToken = '' for i in range(1, 10): protocol = gConfig.getValue(cfgPath(seSection, 'AccessProtocol.%d' % i, 'Protocol'), '') if protocol.lower() == 'srm': spaceToken = gConfig.getValue(cfgPath(seSection, 'AccessProtocol.%d' % i, 'SpaceToken'), '') break if not spaceToken: bdiiVOs = srmDict.get('GlueServiceAccessControlBaseRule', []) bdiiVOs = set([re.sub('^VO:', '', rule) for rule in bdiiVOs]) seVOs = csVOs.intersection(bdiiVOs) newVOs = ','.join(seVOs) addToChangeSet((seSection, 'VO', vos, newVOs), changeSet) return S_OK(changeSet) def getDBParameters(fullname): """ Retrieve Database parameters from CS fullname should be of the form <System>/<DBname> defaultHost is the host to return if the option is not found in the CS. Not used as the method will fail if it cannot be found defaultPort is the port to return if the option is not found in the CS defaultUser is the user to return if the option is not found in the CS. Not usePassword is the password to return if the option is not found in the CS. Not used as the method will fail if it cannot be found defaultDB is the db to return if the option is not found in the CS. Not used as the method will fail if it cannot be found defaultQueueSize is the QueueSize to return if the option is not found in the CS Returns a dictionary with the keys: 'host', 'port', 'user', 'password', 'db' and 'queueSize' """ cs_path = getDatabaseSection(fullname) parameters = {} result = gConfig.getOption(cs_path + '/Host') if not result['OK']: # No host name found, try at the common place result = gConfig.getOption('/Systems/Databases/Host') if not result['OK']: return S_ERROR('Failed to get the configuration parameter: Host') dbHost = result['Value'] # Check if the host is the local one and then set it to 'localhost' to use # a socket connection if dbHost != 'localhost': localHostName = socket.getfqdn() if localHostName == dbHost: dbHost = 'localhost' parameters['Host'] = dbHost # Mysql standard dbPort = 3306 result = gConfig.getOption(cs_path + '/Port') if not result['OK']: # No individual port number found, try at the common place result = gConfig.getOption('/Systems/Databases/Port') if result['OK']: dbPort = int(result['Value']) else: dbPort = int(result['Value']) parameters['Port'] = dbPort result = gConfig.getOption(cs_path + '/User') if not result['OK']: # No individual user name found, try at the common place result = gConfig.getOption('/Systems/Databases/User') if not result['OK']: return S_ERROR('Failed to get the configuration parameter: User') dbUser = result['Value'] parameters['User'] = dbUser result = gConfig.getOption(cs_path + '/Password') if not result['OK']: # No individual password found, try at the common place result = gConfig.getOption('/Systems/Databases/Password') if not result['OK']: return S_ERROR('Failed to get the configuration parameter: Password') dbPass = result['Value'] parameters['Password'] = dbPass result = gConfig.getOption(cs_path + '/DBName') if not result['OK']: return S_ERROR('Failed to get the configuration parameter: DBName') dbName = result['Value'] parameters['DBName'] = dbName return S_OK(parameters) def getElasticDBParameters(fullname): """ Retrieve Database parameters from CS fullname should be of the form <System>/<DBname> """ cs_path = getDatabaseSection(fullname) parameters = {} result = gConfig.getOption(cs_path + '/Host') if not result['OK']: # No host name found, try at the common place result = gConfig.getOption('/Systems/NoSQLDatabases/Host') if not result['OK']: gLogger.warn("Failed to get the configuration parameter: Host. Using localhost") dbHost = 'localhost' else: dbHost = result['Value'] else: dbHost = result['Value'] # Check if the host is the local one and then set it to 'localhost' to use # a socket connection if dbHost != 'localhost': localHostName = socket.getfqdn() if localHostName == dbHost: dbHost = 'localhost' parameters['Host'] = dbHost # Elasticsearch standard port result = gConfig.getOption(cs_path + '/Port') if not result['OK']: # No individual port number found, try at the common place result = gConfig.getOption('/Systems/NoSQLDatabases/Port') if not result['OK']: gLogger.warn("No configuration parameter set for Port, assuming URL points to right location") dbPort = None else: dbPort = int(result['Value']) else: dbPort = int(result['Value']) parameters['Port'] = dbPort result = gConfig.getOption(cs_path + '/User') if not result['OK']: # No individual user name found, try at the common place result = gConfig.getOption('/Systems/NoSQLDatabases/User') if not result['OK']: gLogger.warn("Failed to get the configuration parameter: User. Assuming no user/password is provided/needed") dbUser = None else: dbUser = result['Value'] else: dbUser = result['Value'] parameters['User'] = dbUser result = gConfig.getOption(cs_path + '/Password') if not result['OK']: # No individual password found, try at the common place result = gConfig.getOption('/Systems/NoSQLDatabases/Password') if not result['OK']: gLogger.warn("Failed to get the configuration parameter: Password. Assuming no user/password is provided/needed") dbPass = None else: dbPass = result['Value'] else: dbPass = result['Value'] parameters['Password'] = dbPass result = gConfig.getOption(cs_path + '/SSL') if not result['OK']: # No SSL option found, try at the common place result = gConfig.getOption('/Systems/NoSQLDatabases/SSL') if not result['OK']: gLogger.warn("Failed to get the configuration parameter: SSL. Assuming SSL is needed") ssl = True else: ssl = False if result['Value'].lower() in ('false', 'no', 'n') else True else: ssl = False if result['Value'].lower() in ('false', 'no', 'n') else True parameters['SSL'] = ssl return S_OK(parameters)
andresailer/DIRAC
ConfigurationSystem/Client/Utilities.py
Python
gpl-3.0
22,730
[ "DIRAC" ]
10fa5dd1293a86c5aeffc22e3fd9593353b88f9c0c7839a87cbd4923ab179f3b
import base64 import json import os from contextlib import closing from urllib.parse import urlparse, parse_qs from django.conf import settings from django.core.exceptions import ImproperlyConfigured from django.utils.timezone import datetime from django.shortcuts import reverse from django.test import override_settings from django.test.client import RequestFactory from badgrsocialauth.models import Saml2Configuration, Saml2Account from badgrsocialauth.views import auto_provision, saml2_client_for, create_saml_config_for from badgrsocialauth.utils import set_session_authcode, set_session_badgr_app, userdata_from_saml_assertion from badgeuser.models import CachedEmailAddress, BadgeUser from mainsite.models import BadgrApp from mainsite.tests import BadgrTestCase from mainsite import TOP_DIR from mainsite.utils import set_url_query_params from saml2 import config, saml, BINDING_SOAP, BINDING_HTTP_REDIRECT, BINDING_HTTP_POST from saml2.authn_context import authn_context_class_ref # TODO: Revert to library code once library is fixed for python3 # from saml2.metadata import create_metadata_string from badgrsocialauth.saml2_utils import create_metadata_string from saml2.saml import AuthnContext, AuthnStatement, NAME_FORMAT_URI, NAMEID_FORMAT_PERSISTENT, \ NAME_FORMAT_BASIC, AUTHN_PASSWORD_PROTECTED from saml2.server import Server from saml2.s_utils import MissingValue class SAML2Tests(BadgrTestCase): def setUp(self): super(SAML2Tests, self).setUp() self.test_files_path = os.path.join(TOP_DIR, 'apps', 'badgrsocialauth', 'testfiles') self.idp_metadata_for_sp_config_path = os.path.join(self.test_files_path, 'idp-metadata-for-saml2configuration.xml') with open(self.idp_metadata_for_sp_config_path, 'r') as f: metadata_xml = f.read() self.config = Saml2Configuration.objects.create( metadata_conf_url="http://example.com", slug="saml2.test", cached_metadata=metadata_xml ) self.badgr_app = BadgrApp.objects.create( ui_login_redirect="https://example.com", ui_signup_failure_redirect='https://example.com/fail' ) self.badgr_app.is_default = True self.badgr_app.save() self.ipd_cert_path = os.path.join(self.test_files_path, 'idp-test-cert.pem') self.ipd_key_path = os.path.join(self.test_files_path, 'idp-test-key.pem') self.sp_acs_location = 'http://localhost:8000/account/saml2/{}/acs/'.format(self.config.slug) def _skip_if_xmlsec_binary_missing(self): xmlsec_binary_path = getattr(settings, 'XMLSEC_BINARY_PATH', None) if xmlsec_binary_path is None: self.skipTest("SKIPPING: In order to test XML Signing, XMLSEC_BINARY_PATH to xmlsec1 must be configured.") def _initiate_login(self, idp_name, badgr_app, user=None): # Sets a BadgrApp in the session for later redirect, allows setting of a session authcode url = set_url_query_params(reverse('socialaccount_login'), provider=idp_name) if user is not None: self.client.force_authenticate(user=user) preflight_response = self.client.get( reverse('v2_api_user_socialaccount_connect') + '?provider={}'.format(idp_name) ) location = urlparse(preflight_response.data['result']['url']) url = '?'.join([location.path, location.query]) # strip server info from location return self.client.get(url, HTTP_REFERER=badgr_app.ui_login_redirect) def test_signed_authn_request_option_creates_signed_metadata(self): self._skip_if_xmlsec_binary_missing() self.config.use_signed_authn_request = True self.config.save() with override_settings( SAML_KEY_FILE=self.ipd_key_path, SAML_CERT_FILE=self.ipd_cert_path): saml_client, config = saml2_client_for(self.config) self.assertTrue(saml_client.authn_requests_signed) self.assertNotEqual(saml_client.sec.sec_backend, None) def test_signed_authn_request_option_returns_self_posting_form_populated_with_signed_metadata(self): self._skip_if_xmlsec_binary_missing() self.config.use_signed_authn_request = True self.config.save() with override_settings( SAML_KEY_FILE=self.ipd_key_path, SAML_CERT_FILE=self.ipd_cert_path): authn_request = self.config url = '/account/sociallogin?provider=' + authn_request.slug redirect_url = '/account/saml2/' + authn_request.slug + '/' response = self.client.get(url, follow=True) intermediate_url, intermediate_url_status = response.redirect_chain[0] # login redirect to saml2 login self.assertEqual(intermediate_url, redirect_url) self.assertEqual(intermediate_url_status, 302) # self populated form generated with metadata file from self.ipd_metadata_path self.assertEqual(response.status_code, 200) # changing attribute location of element md:SingleSignOnService necessitates updating this value self.assertIsNot( response.content.find(b'<form action="https://example.com/saml2/idp/SSOService.php" method="post">'), -1) self.assertIsNot( response.content.find(b'<input type="hidden" name="SAMLRequest" value="'), -1) def test_create_saml2_client(self): Saml2Configuration.objects.create(metadata_conf_url="http://example.com", cached_metadata="<xml></xml>", slug="saml2.test2") client = saml2_client_for("saml2.test2") self.assertNotEqual(client, None) def test_oauth_to_saml2_redirection_flow(self): resp = self.client.get('/account/sociallogin?provider=' + self.config.slug) self.assertEqual(resp.status_code, 302) self.assertEqual(resp.url, '/account/saml2/{}/'.format(self.config.slug)) def test_login_with_registered_saml2_account(self): email = "test123@example.com" first_name = "firsty" last_name = "lastington" new_user = BadgeUser.objects.create( email=email, first_name=first_name, last_name=last_name, ) # Auto verify emails cached_email = CachedEmailAddress.objects.get(email=email) cached_email.verified = True cached_email.save() Saml2Account.objects.create(config=self.config, user=new_user, uuid=email) badgr_app = BadgrApp.objects.create(ui_login_redirect="example.com", cors='example.com') resp = auto_provision(None, [email], first_name, last_name, self.config) self.assertEqual(resp.status_code, 302) resp = self.client.get(resp.url) self.assertEqual(resp.status_code, 302) self.assertIn("authToken", resp.url) def test_login_with_unregistered_saml2_account(self): email = "test456@example.com" first_name = "firsty" last_name = "lastington" badgr_app = self.badgr_app resp = auto_provision(None, [email], first_name, last_name, self.config) self.assertEqual(resp.status_code, 302) resp = self.client.get(resp.url) self.assertEqual(resp.status_code, 302) resp = self.client.get(resp.url) self.assertEqual(resp.status_code, 302) self.assertIn("authToken", resp.url) def test_login_with_email_variant(self): email = "testemail@example.com" first_name = "firsty" last_name = "lastington" resp = auto_provision(None, [email], first_name, last_name, self.config) self.assertEqual(resp.status_code, 302) resp = self.client.get(resp.url) self.assertEqual(resp.status_code, 302) resp = self.client.get(resp.url) self.assertEqual(resp.status_code, 302) self.assertIn("authToken", resp.url) email = "testEMAIL@example.com" resp = auto_provision(None, [email], first_name, last_name, self.config) self.assertIn("authcode", resp.url) def test_saml2_login_with_conflicts(self): email = "test8679@example.com" email2 = "test234425@example.com" first_name = "firsty" last_name = "lastington" idp_name = self.config.slug badgr_app = self.badgr_app # email does not exist resp = auto_provision( None, ["different425@example.com"], first_name, last_name, self.config ) self.assertEqual(resp.status_code, 302) resp = self.client.get(resp.url) self.assertEqual(resp.status_code, 302) resp = self.client.get(resp.url) self.assertEqual(resp.status_code, 302) self.assertIn("authToken", resp.url) self.assertEqual(Saml2Account.objects.all().count(), 1) email_address = CachedEmailAddress.objects.get(email='different425@example.com') self.assertTrue(email_address.verified) self.assertTrue(email_address.primary) # email exists, but is unverified BadgeUser.objects.create( email=email, first_name=first_name, last_name=last_name, send_confirmation=False ) resp = auto_provision(None, [email], first_name, last_name, self.config) self.assertEqual(resp.status_code, 302) resp = self.client.get(resp.url) self.assertEqual(resp.status_code, 302) self.assertIn("authToken", resp.url) email_address = CachedEmailAddress.objects.get(email=email) self.assertTrue(email_address.verified) self.assertTrue(email_address.primary) # Can auto provision again resp = auto_provision(None, [email], first_name, last_name, self.config) self.assertEqual(resp.status_code, 302) resp = self.client.get(resp.url) self.assertEqual(resp.status_code, 302) self.assertIn("authToken", resp.url) # email exists, but is verified BadgeUser.objects.create( email=email2, first_name=first_name, last_name=last_name, send_confirmation=False ) cachedemail = CachedEmailAddress.objects.get(email=email2) cachedemail.verified = True cachedemail.save() saml_account_count = Saml2Account.objects.count() self._initiate_login(idp_name, badgr_app) resp = auto_provision(None, [email2], first_name, last_name, self.config) self.assertEqual(resp.status_code, 302) resp = self.client.get(resp.url) self.assertEqual(resp.status_code, 302) self.assertIn("authError=Could+not", resp.url) self.assertIn(self.config.slug, resp.url) self.assertEqual(saml_account_count, Saml2Account.objects.count(), "A Saml2Account must not have been created.") resp = self.client.get(resp.url) self.assertIn(self.config.slug, resp.url, "Query params are included in the response all the way back to the UI") def test_add_samlaccount_to_existing_user(self): # email exists, but is verified email = 'exampleuser@example.com' test_user = self.setup_user( email=email, token_scope='rw:profile rw:issuer rw:backpack' ) preflight_response = self.client.get( reverse('v2_api_user_socialaccount_connect') + '?provider={}'.format(self.config.slug) ) self.assertEqual(preflight_response.status_code, 200) location = urlparse(preflight_response.data['result']['url']) authcode = parse_qs(location.query)['authCode'][0] location = '?'.join([location.path, location.query]) # the location now includes an auth code self.client.logout() response = self.client.get(location) self.assertEqual(response.status_code, 302) location = response._headers['location'][1] response = self.client.get(location) self.assertEqual(response.status_code, 302) # Can auto provision again rf = RequestFactory() fake_request = rf.post( reverse('assertion_consumer_service', kwargs={'idp_name': self.config.slug}), {'saml_assertion': 'very fake'} ) fake_request.session = dict() set_session_authcode(fake_request, authcode) resp = auto_provision( fake_request, [email], test_user.first_name, test_user.last_name, self.config ) self.assertEqual(resp.status_code, 302) resp = self.client.get(resp.url) self.assertEqual(resp.status_code, 302) resp = self.client.get(resp.url) self.assertEqual(resp.status_code, 302) self.assertIn("authToken", resp.url) account = Saml2Account.objects.get(user=test_user) def get_idp_config(self, meta=None): metadata_sp_1 = os.path.join(self.test_files_path, 'metadata_sp_1.xml') metadata_sp_2 = os.path.join(self.test_files_path, 'metadata_sp_2.xml') vo_metadata = os.path.join(self.test_files_path, 'vo_metadata.xml') attribute_map_dir = os.path.join(self.test_files_path, 'attributemaps') BASE = "http://localhost:8088" local_metadata = {"local": [metadata_sp_1, metadata_sp_2, vo_metadata]} metadata_source = local_metadata if meta is None else {'inline': [meta]} return { "entityid": "urn:mace:example.com:saml:roland:idp", "name": "Rolands IdP", "service": { "idp": { "endpoints": { "single_sign_on_service": [ ("%s/sso" % BASE, BINDING_HTTP_REDIRECT)], "single_logout_service": [ ("%s/slo" % BASE, BINDING_SOAP), ("%s/slop" % BASE, BINDING_HTTP_POST)] }, "policy": { "default": { "lifetime": {"minutes": 15}, "attribute_restrictions": None, # means all I have "name_form": NAME_FORMAT_URI, }, self.sp_acs_location: { "lifetime": {"minutes": 5}, "nameid_format": NAMEID_FORMAT_PERSISTENT, }, "https://example.com/sp": { "lifetime": {"minutes": 5}, "nameid_format": NAMEID_FORMAT_PERSISTENT, "name_form": NAME_FORMAT_BASIC } }, }, }, "debug": 1, "key_file": self.ipd_key_path, "cert_file": self.ipd_cert_path, "xmlsec_binary": getattr(settings, 'XMLSEC_BINARY_PATH', None), "metadata": metadata_source, "attribute_map_dir": attribute_map_dir, "organization": { "name": "Exempel AB", "display_name": [("Exempel AB", "se"), ("Example Co.", "en")], "url": "http://www.example.com/roland", }, "contact_person": [ { "given_name": "John", "sur_name": "Smith", "email_address": ["john.smith@example.com"], "contact_type": "technical", }, ], } def get_authn_response(self, idp_config, identity): with closing(SamlServer(idp_config)) as server: name_id = server.ident.transient_nameid( "urn:mace:example.com:saml:roland:idp", "id12") authn_context_ref = authn_context_class_ref(AUTHN_PASSWORD_PROTECTED) authn_context = AuthnContext(authn_context_class_ref=authn_context_ref) locality = saml.SubjectLocality() locality.address = "172.31.25.30" authn_statement = AuthnStatement( subject_locality=locality, authn_instant=datetime.now().isoformat(), authn_context=authn_context, session_index="id12" ) return server.create_authn_response( identity, "id12", # in_response_to self.sp_acs_location, # consumer_url. config.sp.endpoints.assertion_consumer_service:["acs_endpoint"] self.sp_acs_location, # sp_entity_id name_id=name_id, sign_assertion=True, sign_response=True, authn_statement=authn_statement ) def test_saml2_create_account(self): self._skip_if_xmlsec_binary_missing() self.config.use_signed_authn_request = True self.config.save() with override_settings(SAML_KEY_FILE=self.ipd_key_path, SAML_CERT_FILE=self.ipd_cert_path): saml2config = self.config sp_config = config.SPConfig() sp_config.load(create_saml_config_for(saml2config)) sp_metadata = create_metadata_string('', config=sp_config, sign=True) idp_config = self.get_idp_config(sp_metadata) identity = {"eduPersonAffiliation": ["staff", "member"], "surName": ["Jeter"], "givenName": ["Derek"], "mail": ["foo@gmail.com"], "title": ["shortstop"]} authn_response = self.get_authn_response(idp_config, identity) base64_encoded_response_metadata = base64.b64encode(authn_response.encode('utf-8')) base_64_utf8_response_metadata = base64_encoded_response_metadata.decode('utf-8') response = self.client.post( reverse('assertion_consumer_service', kwargs={'idp_name': self.config.slug}), {'SAMLResponse': base_64_utf8_response_metadata} ) self.assertEqual(response.status_code, 302) location = response._headers['location'][1] response = self.client.get(location) self.assertEqual(Saml2Account.objects.count(), 1) self.assertEqual(CachedEmailAddress.objects.count(), 1) self.assertEqual(BadgeUser.objects.count(), 1) def test_saml2_create_account_multiple_emails(self): self._skip_if_xmlsec_binary_missing() self.config.use_signed_authn_request = True self.config.save() with override_settings(SAML_KEY_FILE=self.ipd_key_path, SAML_CERT_FILE=self.ipd_cert_path): saml2config = self.config sp_config = config.SPConfig() sp_config.load(create_saml_config_for(saml2config)) sp_metadata = create_metadata_string('', config=sp_config, sign=True) idp_config = self.get_idp_config(sp_metadata) identity = {"eduPersonAffiliation": ["staff", "member"], "surName": ["Jeter"], "givenName": ["Derek"], "mail": ["foo@gmail.com", "foo2@gmail.com"], "title": ["shortstop"]} authn_response = self.get_authn_response(idp_config, identity) base64_encoded_response_metadata = base64.b64encode(authn_response.encode('utf-8')) base_64_utf8_response_metadata = base64_encoded_response_metadata.decode('utf-8') response = self.client.post( reverse('assertion_consumer_service', kwargs={'idp_name': self.config.slug}), {'SAMLResponse': base_64_utf8_response_metadata} ) self.assertEqual(response.status_code, 302) location = response._headers['location'][1] response = self.client.get(location) self.assertEqual(Saml2Account.objects.count(), 1) self.assertEqual(CachedEmailAddress.objects.count(), 2) self.assertEqual(BadgeUser.objects.count(), 1) def test_saml2_create_account_multiple_email_assertions(self): self._skip_if_xmlsec_binary_missing() self.config.use_signed_authn_request = True self.config.save() with override_settings(SAML_KEY_FILE=self.ipd_key_path, SAML_CERT_FILE=self.ipd_cert_path): saml2config = self.config sp_config = config.SPConfig() sp_config.load(create_saml_config_for(saml2config)) sp_metadata = create_metadata_string('', config=sp_config, sign=True) idp_config = self.get_idp_config(sp_metadata) identity = {"eduPersonAffiliation": ["staff", "member"], "surName": ["Jeter"], "givenName": ["Derek"], "mail": ["foo@gmail.com", "foo2@gmail.com"], "email": ["foo3@gmail.com"], "title": ["shortstop"]} authn_response = self.get_authn_response(idp_config, identity) base64_encoded_response_metadata = base64.b64encode(authn_response.encode('utf-8')) base_64_utf8_response_metadata = base64_encoded_response_metadata.decode('utf-8') response = self.client.post( reverse('assertion_consumer_service', kwargs={'idp_name': self.config.slug}), {'SAMLResponse': base_64_utf8_response_metadata} ) self.assertEqual(response.status_code, 302) location = response._headers['location'][1] response = self.client.get(location) self.assertEqual(Saml2Account.objects.count(), 1) self.assertEqual(CachedEmailAddress.objects.count(), 3) self.assertEqual(BadgeUser.objects.count(), 1) def test_saml2_create_account_multiple_email_already_taken(self): self._skip_if_xmlsec_binary_missing() self.config.use_signed_authn_request = True self.config.save() email = 'exampleuser@example.com' t_user = self.setup_user( email=email, token_scope='rw:profile rw:issuer rw:backpack' ) with override_settings(SAML_KEY_FILE=self.ipd_key_path, SAML_CERT_FILE=self.ipd_cert_path): saml2config = self.config sp_config = config.SPConfig() sp_config.load(create_saml_config_for(saml2config)) sp_metadata = create_metadata_string('', config=sp_config, sign=True) idp_config = self.get_idp_config(sp_metadata) identity = {"eduPersonAffiliation": ["staff", "member"], "surName": ["Jeter"], "givenName": ["Derek"], "mail": ["foo@gmail.com", "foo2@gmail.com"], "email": ["exampleuser@example.com"], "title": ["shortstop"]} authn_response = self.get_authn_response(idp_config, identity) base64_encoded_response_metadata = base64.b64encode(authn_response.encode('utf-8')) base_64_utf8_response_metadata = base64_encoded_response_metadata.decode('utf-8') response = self.client.post( reverse('assertion_consumer_service', kwargs={'idp_name': self.config.slug}), {'SAMLResponse': base_64_utf8_response_metadata} ) self.assertEqual(response.status_code, 302) location = response._headers['location'][1] response = self.client.get(location) self.assertEqual(Saml2Account.objects.count(), 0) self.assertEqual(CachedEmailAddress.objects.count(), 1) self.assertEqual(BadgeUser.objects.count(), 1) def test_add_samlaccount_to_existing_user_with_varying_email(self): email = 'exampleuser@example.com' t_user = self.setup_user( email=email, token_scope='rw:profile rw:issuer rw:backpack' ) preflight_response = self.client.get( reverse('v2_api_user_socialaccount_connect') + '?provider={}'.format(self.config.slug) ) self.assertEqual(preflight_response.status_code, 200) location = urlparse(preflight_response.data['result']['url']) authcode = parse_qs(location.query)['authCode'][0] location = '?'.join([location.path, location.query]) # the location now includes an auth code self.client.logout() response = self.client.get(location) self.assertEqual(response.status_code, 302) location = response._headers['location'][1] response = self.client.get(location) self.assertEqual(response.status_code, 302) # Can auto provision again rf = RequestFactory() fake_request = rf.post( reverse('assertion_consumer_service', kwargs={'idp_name': self.config.slug}), {'saml_assertion': 'very fake'} ) email2 = 'exampleuser_alt@example.com' resp = auto_provision(fake_request, [email2], t_user.first_name, t_user.last_name, self.config) self.assertEqual(resp.status_code, 302) fake_request.session = dict() set_session_authcode(fake_request, authcode) set_session_badgr_app(fake_request, self.badgr_app) fake_request.session['idp_name'] = self.config.slug resp = self.client.get(resp.url) self.assertEqual(resp.status_code, 302) self.assertIn("authToken", resp.url) self.assertIn(self.badgr_app.ui_login_redirect, resp.url) Saml2Account.objects.get(user=t_user) # There is a Saml account associated with the user. CachedEmailAddress.objects.get(email=email2, user=t_user, verified=True, primary=False) # User has the email. email3 = 'exampleuser_moredifferent@example.com' resp = auto_provision(fake_request, [email2, email3], t_user.first_name, t_user.last_name, self.config) CachedEmailAddress.objects.get(email=email3, user=t_user, verified=True, primary=False) # User has new email. def test_can_extract_custom_userdata(self): self.config.custom_settings = json.dumps({ 'first_name': ['customMyClientFirstName'] }) self.config.save() reloaded_config = Saml2Configuration.objects.get(pk=self.config.pk) self.assertEqual(reloaded_config.custom_settings_data['email'], [], "default is set to an empty list") self.assertEqual(reloaded_config.custom_settings_data['first_name'], ['customMyClientFirstName']) fake_saml_assertion = { 'emailaddress': ['moe@example.com'], 'LastName': 'McMoe', 'customMyClientFirstName': ['Moe'] } self.assertEqual( userdata_from_saml_assertion(fake_saml_assertion, 'email', config=reloaded_config), fake_saml_assertion['emailaddress'][0] ) self.assertEqual( userdata_from_saml_assertion(fake_saml_assertion, 'first_name', config=reloaded_config), fake_saml_assertion['customMyClientFirstName'][0] ) self.assertEqual( userdata_from_saml_assertion(fake_saml_assertion, 'last_name', config=reloaded_config), fake_saml_assertion['LastName'] ) class SamlServer(Server): def __int__(self, kwargs): super(SamlServer, self).__init__(**kwargs) def create_authn_response(self, identity, in_response_to, destination, sp_entity_id, name_id_policy=None, userid=None, name_id=None, authn=None, issuer=None, sign_response=None, sign_assertion=None, encrypt_cert_advice=None, encrypt_cert_assertion=None, encrypt_assertion=None, encrypt_assertion_self_contained=True, encrypted_advice_attributes=False, pefim=False, sign_alg=None, digest_alg=None, session_not_on_or_after=None, **kwargs): """ Constructs an AuthenticationResponse :param identity: Information about an user :param in_response_to: The identifier of the authentication request this response is an answer to. :param destination: Where the response should be sent :param sp_entity_id: The entity identifier of the Service Provider :param name_id_policy: How the NameID should be constructed :param userid: The subject identifier :param name_id: The identifier of the subject. A saml.NameID instance. :param authn: Dictionary with information about the authentication context :param issuer: Issuer of the response :param sign_assertion: Whether the assertion should be signed or not. :param sign_response: Whether the response should be signed or not. :param encrypt_assertion: True if assertions should be encrypted. :param encrypt_assertion_self_contained: True if all encrypted assertions should have alla namespaces selfcontained. :param encrypted_advice_attributes: True if assertions in the advice element should be encrypted. :param encrypt_cert_advice: Certificate to be used for encryption of assertions in the advice element. :param encrypt_cert_assertion: Certificate to be used for encryption of assertions. :param sign_assertion: True if assertions should be signed. :param pefim: True if a response according to the PEFIM profile should be created. :return: A response instance """ try: args = self.gather_authn_response_args( sp_entity_id, name_id_policy=name_id_policy, userid=userid, name_id=name_id, sign_response=sign_response, sign_assertion=sign_assertion, encrypt_cert_advice=encrypt_cert_advice, encrypt_cert_assertion=encrypt_cert_assertion, encrypt_assertion=encrypt_assertion, encrypt_assertion_self_contained =encrypt_assertion_self_contained, encrypted_advice_attributes=encrypted_advice_attributes, pefim=pefim, **kwargs) # authn statement is not returned from gather_authn_response_args() # make sure to include it in args if it was passed in initially if 'authn_statement' in kwargs: args['authn_statement'] = kwargs['authn_statement'] except IOError as exc: response = self.create_error_response(in_response_to, destination, sp_entity_id, exc, name_id) return ("%s" % response).split("\n") try: _authn = authn if (sign_assertion or sign_response) and \ self.sec.cert_handler.generate_cert(): with self.lock: self.sec.cert_handler.update_cert(True) return self._authn_response( in_response_to, destination, sp_entity_id, identity, authn=_authn, issuer=issuer, pefim=pefim, sign_alg=sign_alg, digest_alg=digest_alg, session_not_on_or_after=session_not_on_or_after, **args) return self._authn_response( in_response_to, destination, sp_entity_id, identity, authn=_authn, issuer=issuer, pefim=pefim, sign_alg=sign_alg, digest_alg=digest_alg, session_not_on_or_after=session_not_on_or_after, **args) except MissingValue as exc: return self.create_error_response(in_response_to, destination, sp_entity_id, exc, name_id)
concentricsky/badgr-server
apps/badgrsocialauth/tests/test_saml2.py
Python
agpl-3.0
31,708
[ "MOE" ]
023c2d700c70fdbcd27729b1200efd1d80b6372343e8acd67a306f87540976ef
# coding=utf-8 # Copyright 2022 The Uncertainty Baselines Authors. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Ensemble of SNGP models on CIFAR. This script only performs evaluation, not training. We recommend training ensembles by launching independent runs of `sngp.py` over different seeds. """ import os from absl import app from absl import flags from absl import logging import edward2 as ed import numpy as np import robustness_metrics as rm import tensorflow as tf import tensorflow_datasets as tfds import uncertainty_baselines as ub import ood_utils # local file import from baselines.cifar import utils # local file import from baselines.cifar flags.DEFINE_string('checkpoint_dir', None, 'The directory where the model weights are stored.') flags.mark_flag_as_required('checkpoint_dir') flags.DEFINE_integer('ensemble_size', 10, 'The number of models to ensemble.') flags.DEFINE_integer( 'total_batch_size', 256, 'The total train (and test) batch size, split across all devices.') # SNGP ensemble flags flags.DEFINE_float( 'gp_mean_field_factor_ensemble', 0.0005, 'The tunable multiplicative factor used in the mean-field approximation ' 'for the posterior mean of softmax Gaussian process. If -1 then use ' 'posterior mode instead of posterior mean.') # Dropout flags flags.DEFINE_bool('use_filterwise_dropout', True, 'Whether to use filterwise dropout for the hidden layers.') flags.DEFINE_bool('use_mc_dropout', False, 'Whether to use Monte Carlo dropout for the hidden layers.') flags.DEFINE_float('dropout_rate', 0.1, 'Dropout rate.') # SNGP flags. flags.DEFINE_bool('use_spec_norm', True, 'Whether to apply spectral normalization.') flags.DEFINE_bool('use_gp_layer', True, 'Whether to use Gaussian process as the output layer.') # Spectral normalization flags. flags.DEFINE_integer( 'spec_norm_iteration', 1, 'Number of power iterations to perform for estimating ' 'the spectral norm of weight matrices.') flags.DEFINE_float('spec_norm_bound', 6., 'Upper bound to spectral norm of weight matrices.') # Gaussian process flags. flags.DEFINE_float('gp_bias', 0., 'The bias term for GP layer.') flags.DEFINE_float( 'gp_scale', 1., 'The length-scale parameter for the RBF kernel of the GP layer.') flags.DEFINE_integer( 'gp_input_dim', -1, 'The dimension to reduce the neural network input for the GP layer ' '(via random Gaussian projection which preserves distance by the ' ' Johnson-Lindenstrauss lemma). If -1, no dimension reduction.') flags.DEFINE_integer( 'gp_hidden_dim', 1024, 'The hidden dimension of the GP layer, which corresponds to the number of ' 'random features used for the approximation.') flags.DEFINE_bool( 'gp_input_normalization', False, 'Whether to normalize the input using LayerNorm for GP layer.' 'This is similar to automatic relevance determination (ARD) in the classic ' 'GP learning.') flags.DEFINE_string( 'gp_random_feature_type', 'orf', 'The type of random feature to use. One of "rff" (random fourier feature), ' '"orf" (orthogonal random feature).') flags.DEFINE_float('gp_cov_ridge_penalty', 1., 'Ridge penalty parameter for GP posterior covariance.') flags.DEFINE_float( 'gp_cov_discount_factor', -1., 'The discount factor to compute the moving average of precision matrix' 'across epochs. If -1 then compute the exact precision matrix within the ' 'latest epoch.') # OOD flags. flags.DEFINE_bool('eval_on_ood', False, 'Whether to run OOD evaluation on specified OOD datasets.') flags.DEFINE_list('ood_dataset', 'cifar100,svhn_cropped', 'list of OOD datasets to evaluate on.') flags.DEFINE_bool('dempster_shafer_ood', False, 'Wheter to use DempsterShafer Uncertainty score.') FLAGS = flags.FLAGS def main(argv): del argv # unused arg if not FLAGS.use_gpu: raise ValueError('Only GPU is currently supported.') if FLAGS.num_cores > 1: raise ValueError('Only a single accelerator is currently supported.') tf.random.set_seed(FLAGS.seed) tf.io.gfile.makedirs(FLAGS.output_dir) ds_info = tfds.builder(FLAGS.dataset).info batch_size = FLAGS.total_batch_size steps_per_eval = ds_info.splits['test'].num_examples // batch_size num_classes = ds_info.features['label'].num_classes data_dir = FLAGS.data_dir dataset_builder = ub.datasets.get( FLAGS.dataset, data_dir=data_dir, download_data=FLAGS.download_data, split=tfds.Split.TEST, drop_remainder=FLAGS.drop_remainder_for_eval) dataset = dataset_builder.load(batch_size=batch_size) test_datasets = {'clean': dataset} if FLAGS.eval_on_ood: ood_dataset_names = FLAGS.ood_dataset ood_datasets, steps_per_ood = ood_utils.load_ood_datasets( ood_dataset_names, dataset_builder, 1. - FLAGS.train_proportion, batch_size, drop_remainder=FLAGS.drop_remainder_for_eval) test_datasets.update(ood_datasets) extra_kwargs = {} if FLAGS.dataset == 'cifar100': data_dir = FLAGS.cifar100_c_path corruption_types, _ = utils.load_corrupted_test_info(FLAGS.dataset) for corruption_type in corruption_types: for severity in range(1, 6): dataset = ub.datasets.get( f'{FLAGS.dataset}_corrupted', corruption_type=corruption_type, data_dir=data_dir, severity=severity, split=tfds.Split.TEST, drop_remainder=FLAGS.drop_remainder_for_eval, **extra_kwargs).load(batch_size=batch_size) test_datasets[f'{corruption_type}_{severity}'] = dataset model = ub.models.wide_resnet_sngp( input_shape=ds_info.features['image'].shape, batch_size=FLAGS.total_batch_size // FLAGS.num_cores, depth=28, width_multiplier=10, num_classes=num_classes, l2=0., use_mc_dropout=FLAGS.use_mc_dropout, use_filterwise_dropout=FLAGS.use_filterwise_dropout, dropout_rate=FLAGS.dropout_rate, use_gp_layer=FLAGS.use_gp_layer, gp_input_dim=FLAGS.gp_input_dim, gp_hidden_dim=FLAGS.gp_hidden_dim, gp_scale=FLAGS.gp_scale, gp_bias=FLAGS.gp_bias, gp_input_normalization=FLAGS.gp_input_normalization, gp_random_feature_type=FLAGS.gp_random_feature_type, gp_cov_discount_factor=FLAGS.gp_cov_discount_factor, gp_cov_ridge_penalty=FLAGS.gp_cov_ridge_penalty, use_spec_norm=FLAGS.use_spec_norm, spec_norm_iteration=FLAGS.spec_norm_iteration, spec_norm_bound=FLAGS.spec_norm_bound) logging.info('Model input shape: %s', model.input_shape) logging.info('Model output shape: %s', model.output_shape) logging.info('Model number of weights: %s', model.count_params()) # Search for checkpoints from their index file; then remove the index suffix. ensemble_filenames = tf.io.gfile.glob(os.path.join(FLAGS.checkpoint_dir, '**/*.index')) # Only apply ensemble on the models with the same model architecture ensemble_filenames0 = [ filename for filename in ensemble_filenames if f'use_gp_layer:{FLAGS.use_gp_layer}' in filename and f'use_spec_norm:{FLAGS.use_spec_norm}' in filename ] np.random.seed(FLAGS.seed) ensemble_filenames = np.random.choice( ensemble_filenames0, FLAGS.ensemble_size, replace=True) ensemble_filenames = [filename[:-6] for filename in ensemble_filenames] ensemble_size = len(ensemble_filenames) logging.info('Ensemble size: %s', ensemble_size) logging.info('Ensemble filenames: %s', ensemble_filenames) logging.info('Ensemble number of weights: %s', ensemble_size * model.count_params()) logging.info('Ensemble filenames: %s', str(ensemble_filenames)) checkpoint = tf.train.Checkpoint(model=model) # Write model predictions to files. num_datasets = len(test_datasets) for m, ensemble_filename in enumerate(ensemble_filenames): checkpoint.restore(ensemble_filename) for n, (name, test_dataset) in enumerate(test_datasets.items()): filename = '{dataset}_{member}.npy'.format( dataset=name.replace('/', '_'), member=m) # ood dataset name has '/' filename = os.path.join(FLAGS.output_dir, filename) if not tf.io.gfile.exists(filename): logits = [] test_iterator = iter(test_dataset) steps = steps_per_eval if 'ood/' not in name else steps_per_ood[name] for _ in range(steps): features = next(test_iterator)['features'] # pytype: disable=unsupported-operands logits_member = model(features, training=False) if isinstance(logits_member, (list, tuple)): # If model returns a tuple of (logits, covmat), extract both logits_member, covmat_member = logits_member logits_member = ed.layers.utils.mean_field_logits( logits_member, covmat_member, FLAGS.gp_mean_field_factor_ensemble) logits.append(logits_member) logits = tf.concat(logits, axis=0) with tf.io.gfile.GFile(filename, 'w') as f: np.save(f, logits.numpy()) percent = (m * num_datasets + (n + 1)) / (ensemble_size * num_datasets) message = ('{:.1%} completion for prediction: ensemble member {:d}/{:d}. ' 'Dataset {:d}/{:d}'.format(percent, m + 1, ensemble_size, n + 1, num_datasets)) logging.info(message) metrics = { 'test/negative_log_likelihood': tf.keras.metrics.Mean(), 'test/gibbs_cross_entropy': tf.keras.metrics.Mean(), 'test/accuracy': tf.keras.metrics.SparseCategoricalAccuracy(), 'test/ece': rm.metrics.ExpectedCalibrationError( num_bins=FLAGS.num_bins), } if FLAGS.eval_on_ood: ood_metrics = ood_utils.create_ood_metrics(ood_dataset_names) metrics.update(ood_metrics) corrupt_metrics = {} for name in test_datasets: corrupt_metrics['test/nll_{}'.format(name)] = tf.keras.metrics.Mean() corrupt_metrics['test/accuracy_{}'.format(name)] = ( tf.keras.metrics.SparseCategoricalAccuracy()) corrupt_metrics['test/ece_{}'.format(name)] = ( rm.metrics.ExpectedCalibrationError(num_bins=FLAGS.num_bins)) # Evaluate model predictions. for n, (name, test_dataset) in enumerate(test_datasets.items()): logits_dataset = [] for m in range(ensemble_size): filename = '{dataset}_{member}.npy'.format( dataset=name.replace('/', '_'), member=m) # ood dataset name has '/' filename = os.path.join(FLAGS.output_dir, filename) with tf.io.gfile.GFile(filename, 'rb') as f: logits_dataset.append(np.load(f)) logits_dataset = tf.convert_to_tensor(logits_dataset) test_iterator = iter(test_dataset) steps = steps_per_eval if 'ood/' not in name else steps_per_ood[name] for step in range(steps): inputs = next(test_iterator) labels = inputs['labels'] # pytype: disable=unsupported-operands logits = logits_dataset[:, (step*batch_size):((step+1)*batch_size)] labels = tf.cast(labels, tf.int32) negative_log_likelihood_metric = rm.metrics.EnsembleCrossEntropy() negative_log_likelihood_metric.add_batch(logits, labels=labels) negative_log_likelihood = list( negative_log_likelihood_metric.result().values())[0] per_probs = tf.nn.softmax(logits) probs = tf.reduce_mean(per_probs, axis=0) logits_mean = tf.reduce_mean(logits, axis=0) if name == 'clean': gibbs_ce_metric = rm.metrics.GibbsCrossEntropy() gibbs_ce_metric.add_batch(logits, labels=labels) gibbs_ce = list(gibbs_ce_metric.result().values())[0] metrics['test/negative_log_likelihood'].update_state( negative_log_likelihood) metrics['test/gibbs_cross_entropy'].update_state(gibbs_ce) metrics['test/accuracy'].update_state(labels, probs) metrics['test/ece'].add_batch(probs, label=labels) elif name.startswith('ood/'): ood_labels = 1 - inputs['is_in_distribution'] # pytype: disable=unsupported-operands if FLAGS.dempster_shafer_ood: ood_scores = ood_utils.DempsterShaferUncertainty(logits_mean) else: ood_scores = 1 - tf.reduce_max(probs, axis=-1) for metric_name, metric in metrics.items(): if name in metric_name: metric.update_state(ood_labels, ood_scores) else: corrupt_metrics['test/nll_{}'.format(name)].update_state( negative_log_likelihood) corrupt_metrics['test/accuracy_{}'.format(name)].update_state( labels, probs) corrupt_metrics['test/ece_{}'.format(name)].add_batch( probs, label=labels) message = ('{:.1%} completion for evaluation: dataset {:d}/{:d}'.format( (n + 1) / num_datasets, n + 1, num_datasets)) logging.info(message) corrupt_results = utils.aggregate_corrupt_metrics(corrupt_metrics, corruption_types) total_results = {name: metric.result() for name, metric in metrics.items()} total_results.update(corrupt_results) # Metrics from Robustness Metrics (like ECE) will return a dict with a # single key/value, instead of a scalar. total_results = { k: (list(v.values())[0] if isinstance(v, dict) else v) for k, v in total_results.items() } logging.info('Metrics: %s', total_results) if __name__ == '__main__': app.run(main)
google/uncertainty-baselines
baselines/cifar/sngp_ensemble.py
Python
apache-2.0
14,238
[ "Gaussian" ]
3938496d5d92b8fa53271c234b2f68137be31b56760259652f9b4ef7cd1f1f00
# $HeadURL$ """ Queries BDII for unknown CE. Queries BDII for CE information and puts it to CS. """ __RCSID__ = "$Id$" from DIRAC import S_OK, S_ERROR, gConfig from DIRAC.Core.Base.AgentModule import AgentModule from DIRAC.Core.Utilities import List from DIRAC.Core.Utilities.Grid import ldapSite, ldapCluster, ldapCE, ldapCEState from DIRAC.FrameworkSystem.Client.NotificationClient import NotificationClient from DIRAC.ConfigurationSystem.Client.CSAPI import CSAPI from DIRAC.Core.Security.ProxyInfo import getProxyInfo, formatProxyInfoAsString from DIRAC.ConfigurationSystem.Client.Helpers.Path import cfgPath from DIRAC.ConfigurationSystem.Client.Helpers.CSGlobals import getVO from DIRAC.ConfigurationSystem.Client.Helpers.Resources import Resources class CE2CSAgent( AgentModule ): addressTo = '' addressFrom = '' voName = '' subject = "CE2CSAgent" alternativeBDIIs = [] def initialize( self ): # TODO: Have no default and if no mail is found then use the diracAdmin group # and resolve all associated mail addresses. self.addressTo = self.am_getOption( 'MailTo', self.addressTo ) self.addressFrom = self.am_getOption( 'MailFrom', self.addressFrom ) # Create a list of alternative bdii urls self.alternativeBDIIs = self.am_getOption( 'AlternativeBDIIs', [] ) # Check if the bdii url is appended by a port number, if not append the default 2170 for index, url in enumerate( self.alternativeBDIIs ): if not url.split( ':' )[-1].isdigit(): self.alternativeBDIIs[index] += ':2170' if self.addressTo and self.addressFrom: self.log.info( "MailTo", self.addressTo ) self.log.info( "MailFrom", self.addressFrom ) if self.alternativeBDIIs : self.log.info( "AlternativeBDII URLs:", self.alternativeBDIIs ) self.subject = "CE2CSAgent" # This sets the Default Proxy to used as that defined under # /Operations/Shifter/TestManager # the shifterProxy option in the Configuration can be used to change this default. self.am_setOption( 'shifterProxy', 'TestManager' ) self.voName = self.am_getOption( 'VirtualOrganization', [] ) if not self.voName: vo = getVO() if vo: self.voName = [ vo ] if self.voName: self.log.info( "Agent will manage VO(s) %s" % self.voName ) else: self.log.fatal( "VirtualOrganization option not defined for agent" ) return S_ERROR() self.csAPI = CSAPI() return self.csAPI.initialize() def execute( self ): self.log.info( "Start Execution" ) result = getProxyInfo() if not result['OK']: return result infoDict = result[ 'Value' ] self.log.info( formatProxyInfoAsString( infoDict ) ) # Get a "fresh" copy of the CS data result = self.csAPI.downloadCSData() if not result['OK']: self.log.warn( "Could not download a fresh copy of the CS data", result[ 'Message' ] ) self.__lookForCE() self.__infoFromCE() self.log.info( "End Execution" ) return S_OK() def __checkAlternativeBDIISite( self, fun, *args ): if self.alternativeBDIIs: self.log.warn( "Trying to use alternative BDII sites" ) for site in self.alternativeBDIIs : self.log.info( "Trying to contact alternative BDII", site ) if len( args ) == 1 : result = fun( args[0], host = site ) elif len( args ) == 2 : result = fun( args[0], vo = args[1], host = site ) if not result['OK'] : self.log.error ( "Problem contacting alternative BDII", result['Message'] ) elif result['OK'] : return result self.log.warn( "Also checking alternative BDII sites failed" ) return result def __lookForCE( self ): knownCEs = self.am_getOption( 'BannedCEs', [] ) resources = Resources( self.voName ) result = resources.getEligibleResources( 'Computing', {'CEType':['LCG','CREAM'] } ) if not result['OK']: return grids = result['Value'] for grid in grids: result = gConfig.getSections( '/Resources/Sites/%s' % grid ) if not result['OK']: return sites = result['Value'] for site in sites: opt = gConfig.getOptionsDict( '/Resources/Sites/%s/%s' % ( grid, site ) )['Value'] ces = List.fromChar( opt.get( 'CE', '' ) ) knownCEs += ces response = '' for vo in self.voName: self.log.info( "Check for available CEs for VO", vo ) response = ldapCEState( '', vo ) if not response['OK']: self.log.error( "Error during BDII request", response['Message'] ) response = self.__checkAlternativeBDIISite( ldapCEState, '', vo ) return response newCEs = {} for queue in response['Value']: try: queueName = queue['GlueCEUniqueID'] except: continue ceName = queueName.split( ":" )[0] if not ceName in knownCEs: newCEs[ceName] = None self.log.debug( "New CE", ceName ) body = "" possibleNewSites = [] for ce in newCEs.iterkeys(): response = ldapCluster( ce ) if not response['OK']: self.log.warn( "Error during BDII request", response['Message'] ) response = self.__checkAlternativeBDIISite( ldapCluster, ce ) continue clusters = response['Value'] if len( clusters ) != 1: self.log.warn( "Error in cluster length", " CE %s Length %d" % ( ce, len( clusters ) ) ) if len( clusters ) == 0: continue cluster = clusters[0] fkey = cluster.get( 'GlueForeignKey', [] ) if type( fkey ) == type( '' ): fkey = [fkey] nameBDII = None for entry in fkey: if entry.count( 'GlueSiteUniqueID' ): nameBDII = entry.split( '=' )[1] break if not nameBDII: continue ceString = "CE: %s, GOCDB Name: %s" % ( ce, nameBDII ) self.log.info( ceString ) response = ldapCE( ce ) if not response['OK']: self.log.warn( "Error during BDII request", response['Message'] ) response = self.__checkAlternativeBDIISite( ldapCE, ce ) continue ceInfos = response['Value'] if len( ceInfos ): ceInfo = ceInfos[0] systemName = ceInfo.get( 'GlueHostOperatingSystemName', 'Unknown' ) systemVersion = ceInfo.get( 'GlueHostOperatingSystemVersion', 'Unknown' ) systemRelease = ceInfo.get( 'GlueHostOperatingSystemRelease', 'Unknown' ) else: systemName = "Unknown" systemVersion = "Unknown" systemRelease = "Unknown" osString = "SystemName: %s, SystemVersion: %s, SystemRelease: %s" % ( systemName, systemVersion, systemRelease ) self.log.info( osString ) response = ldapCEState( ce, vo ) if not response['OK']: self.log.warn( "Error during BDII request", response['Message'] ) response = self.__checkAlternativeBDIISite( ldapCEState, ce, vo ) continue newCEString = "\n\n%s\n%s" % ( ceString, osString ) usefull = False ceStates = response['Value'] for ceState in ceStates: queueName = ceState.get( 'GlueCEUniqueID', 'UnknownName' ) queueStatus = ceState.get( 'GlueCEStateStatus', 'UnknownStatus' ) queueString = "%s %s" % ( queueName, queueStatus ) self.log.info( queueString ) newCEString += "\n%s" % queueString if queueStatus.count( 'Production' ): usefull = True if usefull: body += newCEString possibleNewSites.append( 'dirac-admin-add-site DIRACSiteName %s %s' % ( nameBDII, ce ) ) if body: body = "We are glad to inform You about new CE(s) possibly suitable for %s:\n" % vo + body body += "\n\nTo suppress information about CE add its name to BannedCEs list." for possibleNewSite in possibleNewSites: body = "%s\n%s" % ( body, possibleNewSite ) self.log.info( body ) if self.addressTo and self.addressFrom: notification = NotificationClient() result = notification.sendMail( self.addressTo, self.subject, body, self.addressFrom, localAttempt = False ) return S_OK() def __infoFromCE( self ): sitesSection = cfgPath( 'Resources', 'Sites' ) result = gConfig.getSections( sitesSection ) if not result['OK']: return grids = result['Value'] changed = False body = "" for grid in grids: gridSection = cfgPath( sitesSection, grid ) result = gConfig.getSections( gridSection ) if not result['OK']: return sites = result['Value'] for site in sites: siteSection = cfgPath( gridSection, site ) opt = gConfig.getOptionsDict( siteSection )['Value'] name = opt.get( 'Name', '' ) if name: coor = opt.get( 'Coordinates', 'Unknown' ) mail = opt.get( 'Mail', 'Unknown' ) result = ldapSite( name ) if not result['OK']: self.log.warn( "BDII site %s: %s" % ( name, result['Message'] ) ) result = self.__checkAlternativeBDIISite( ldapSite, name ) if result['OK']: bdiiSites = result['Value'] if len( bdiiSites ) == 0: self.log.warn( name, "Error in BDII: leng = 0" ) else: if not len( bdiiSites ) == 1: self.log.warn( name, "Warning in BDII: leng = %d" % len( bdiiSites ) ) bdiiSite = bdiiSites[0] try: longitude = bdiiSite['GlueSiteLongitude'] latitude = bdiiSite['GlueSiteLatitude'] newcoor = "%s:%s" % ( longitude, latitude ) except: self.log.warn( "Error in BDII coordinates" ) newcoor = "Unknown" try: newmail = bdiiSite['GlueSiteSysAdminContact'].split( ":" )[-1].strip() except: self.log.warn( "Error in BDII mail" ) newmail = "Unknown" self.log.debug( "%s %s %s" % ( name, newcoor, newmail ) ) if newcoor != coor: self.log.info( "%s" % ( name ), "%s -> %s" % ( coor, newcoor ) ) if coor == 'Unknown': self.csAPI.setOption( cfgPath( siteSection, 'Coordinates' ), newcoor ) else: self.csAPI.modifyValue( cfgPath( siteSection, 'Coordinates' ), newcoor ) changed = True if newmail != mail: self.log.info( "%s" % ( name ), "%s -> %s" % ( mail, newmail ) ) if mail == 'Unknown': self.csAPI.setOption( cfgPath( siteSection, 'Mail' ), newmail ) else: self.csAPI.modifyValue( cfgPath( siteSection, 'Mail' ), newmail ) changed = True ceList = List.fromChar( opt.get( 'CE', '' ) ) if not ceList: self.log.warn( site, 'Empty site list' ) continue # result = gConfig.getSections( cfgPath( siteSection,'CEs' ) # if not result['OK']: # self.log.debug( "Section CEs:", result['Message'] ) for ce in ceList: ceSection = cfgPath( siteSection, 'CEs', ce ) result = gConfig.getOptionsDict( ceSection ) if not result['OK']: self.log.debug( "Section CE", result['Message'] ) wnTmpDir = 'Unknown' arch = 'Unknown' os = 'Unknown' si00 = 'Unknown' pilot = 'Unknown' ceType = 'Unknown' else: ceopt = result['Value'] wnTmpDir = ceopt.get( 'wnTmpDir', 'Unknown' ) arch = ceopt.get( 'architecture', 'Unknown' ) os = ceopt.get( 'OS', 'Unknown' ) si00 = ceopt.get( 'SI00', 'Unknown' ) pilot = ceopt.get( 'Pilot', 'Unknown' ) ceType = ceopt.get( 'CEType', 'Unknown' ) result = ldapCE( ce ) if not result['OK']: self.log.warn( 'Error in BDII for %s' % ce, result['Message'] ) result = self.__checkAlternativeBDIISite( ldapCE, ce ) continue try: bdiiCE = result['Value'][0] except: self.log.warn( 'Error in BDII for %s' % ce, result ) bdiiCE = None if bdiiCE: try: newWNTmpDir = bdiiCE['GlueSubClusterWNTmpDir'] except: newWNTmpDir = 'Unknown' if wnTmpDir != newWNTmpDir and newWNTmpDir != 'Unknown': section = cfgPath( ceSection, 'wnTmpDir' ) self.log.info( section, " -> ".join( ( wnTmpDir, newWNTmpDir ) ) ) if wnTmpDir == 'Unknown': self.csAPI.setOption( section, newWNTmpDir ) else: self.csAPI.modifyValue( section, newWNTmpDir ) changed = True try: newArch = bdiiCE['GlueHostArchitecturePlatformType'] except: newArch = 'Unknown' if arch != newArch and newArch != 'Unknown': section = cfgPath( ceSection, 'architecture' ) self.log.info( section, " -> ".join( ( arch, newArch ) ) ) if arch == 'Unknown': self.csAPI.setOption( section, newArch ) else: self.csAPI.modifyValue( section, newArch ) changed = True try: newOS = '_'.join( ( bdiiCE['GlueHostOperatingSystemName'], bdiiCE['GlueHostOperatingSystemVersion'], bdiiCE['GlueHostOperatingSystemRelease'] ) ) except: newOS = 'Unknown' if os != newOS and newOS != 'Unknown': section = cfgPath( ceSection, 'OS' ) self.log.info( section, " -> ".join( ( os, newOS ) ) ) if os == 'Unknown': self.csAPI.setOption( section, newOS ) else: self.csAPI.modifyValue( section, newOS ) changed = True body = body + "OS was changed %s -> %s for %s at %s\n" % ( os, newOS, ce, site ) try: newSI00 = bdiiCE['GlueHostBenchmarkSI00'] except: newSI00 = 'Unknown' if si00 != newSI00 and newSI00 != 'Unknown': section = cfgPath( ceSection, 'SI00' ) self.log.info( section, " -> ".join( ( si00, newSI00 ) ) ) if si00 == 'Unknown': self.csAPI.setOption( section, newSI00 ) else: self.csAPI.modifyValue( section, newSI00 ) changed = True try: rte = bdiiCE['GlueHostApplicationSoftwareRunTimeEnvironment'] for vo in self.voName: if vo.lower() == 'lhcb': if 'VO-lhcb-pilot' in rte: newPilot = 'True' else: newPilot = 'False' else: newPilot = 'Unknown' except: newPilot = 'Unknown' if pilot != newPilot and newPilot != 'Unknown': section = cfgPath( ceSection, 'Pilot' ) self.log.info( section, " -> ".join( ( pilot, newPilot ) ) ) if pilot == 'Unknown': self.csAPI.setOption( section, newPilot ) else: self.csAPI.modifyValue( section, newPilot ) changed = True newVO = '' for vo in self.voName: result = ldapCEState( ce, vo ) #getBDIICEVOView if not result['OK']: self.log.warn( 'Error in BDII for queue %s' % ce, result['Message'] ) result = self.__checkAlternativeBDIISite( ldapCEState, ce, vo ) continue try: queues = result['Value'] except: self.log.warn( 'Error in BDII for queue %s' % ce, result['Massage'] ) continue newCEType = 'Unknown' for queue in queues: try: queueType = queue['GlueCEImplementationName'] except: queueType = 'Unknown' if newCEType == 'Unknown': newCEType = queueType else: if queueType != newCEType: self.log.warn( 'Error in BDII for CE %s ' % ce, 'different CE types %s %s' % ( newCEType, queueType ) ) if newCEType=='ARC-CE': newCEType = 'ARC' if ceType != newCEType and newCEType != 'Unknown': section = cfgPath( ceSection, 'CEType' ) self.log.info( section, " -> ".join( ( ceType, newCEType ) ) ) if ceType == 'Unknown': self.csAPI.setOption( section, newCEType ) else: self.csAPI.modifyValue( section, newCEType ) changed = True for queue in queues: try: queueName = queue['GlueCEUniqueID'].split( '/' )[-1] except: self.log.warn( 'Error in queueName ', queue ) continue try: newMaxCPUTime = queue['GlueCEPolicyMaxCPUTime'] except: newMaxCPUTime = None newSI00 = None try: caps = queue['GlueCECapability'] if type( caps ) == type( '' ): caps = [caps] for cap in caps: if cap.count( 'CPUScalingReferenceSI00' ): newSI00 = cap.split( '=' )[-1] except: newSI00 = None queueSection = cfgPath( ceSection, 'Queues', queueName ) result = gConfig.getOptionsDict( queueSection ) if not result['OK']: self.log.warn( "Section Queues", result['Message'] ) maxCPUTime = 'Unknown' si00 = 'Unknown' allowedVOs = [''] else: queueOpt = result['Value'] maxCPUTime = queueOpt.get( 'maxCPUTime', 'Unknown' ) si00 = queueOpt.get( 'SI00', 'Unknown' ) if newVO == '': # Remember previous iteration, if none - read from conf allowedVOs = queueOpt.get( 'VO', '' ).split( "," ) else: # Else use newVO, as it can contain changes, which aren't in conf yet allowedVOs = newVO.split( "," ) if newMaxCPUTime and ( maxCPUTime != newMaxCPUTime ): section = cfgPath( queueSection, 'maxCPUTime' ) self.log.info( section, " -> ".join( ( maxCPUTime, newMaxCPUTime ) ) ) if maxCPUTime == 'Unknown': self.csAPI.setOption( section, newMaxCPUTime ) else: self.csAPI.modifyValue( section, newMaxCPUTime ) changed = True if newSI00 and ( si00 != newSI00 ): section = cfgPath( queueSection, 'SI00' ) self.log.info( section, " -> ".join( ( si00, newSI00 ) ) ) if si00 == 'Unknown': self.csAPI.setOption( section, newSI00 ) else: self.csAPI.modifyValue( section, newSI00 ) changed = True modifyVO = True # Flag saying if we need VO option to change newVO = '' if allowedVOs != ['']: for allowedVO in allowedVOs: allowedVO = allowedVO.strip() # Get rid of spaces newVO += allowedVO if allowedVO == vo: # Current VO has been already in list newVO = '' modifyVO = False # Don't change anything break # Skip next 'if', proceed to next VO newVO += ', ' if modifyVO: section = cfgPath( queueSection, 'VO' ) newVO += vo self.log.info( section, " -> ".join( ( '%s' % allowedVOs, newVO ) ) ) if allowedVOs == ['']: self.csAPI.setOption( section, newVO ) else: self.csAPI.modifyValue( section, newVO ) changed = True if changed: self.log.info( body ) if body and self.addressTo and self.addressFrom: notification = NotificationClient() result = notification.sendMail( self.addressTo, self.subject, body, self.addressFrom, localAttempt = False ) return self.csAPI.commit() else: self.log.info( "No changes found" ) return S_OK()
sposs/DIRAC
ConfigurationSystem/Agent/CE2CSAgent.py
Python
gpl-3.0
21,176
[ "DIRAC" ]
7a70372462b087e24cda662162a4c50b5df8777bd83d61b980a77bf0a255f25e
#!/usr/bin/env python # -*- coding: utf-8 -*- # freeseer - vga/presentation capture software # # Copyright (C) 2011, 2013 Free and Open Source Software Learning Centre # http://fosslc.org # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # For support, questions, suggestions or any other inquiries, visit: # http://wiki.github.com/Freeseer/freeseer/ import unittest from freeseer.framework.config.persist import JSONConfigStorage from freeseer.tests.framework.config.persist import ConfigStorageTest initial_config = '''\ { "this_section": { "option1": "othello", "option2": "0" } }\ ''' after_config = '''\ { "this_section": { "option1": "something_new", "option2": "10" } }\ ''' class TestJSONConfigStorage(ConfigStorageTest, unittest.TestCase): """Tests that JSONConfigStorage works with a generic Config subclass.""" CONFIG_STORAGE_CLASS = JSONConfigStorage INITIAL_LOAD_CONFIG = initial_config AFTER_STORE_CONFIG = after_config
Freeseer/freeseer
src/freeseer/tests/framework/config/persist/test_jsonstorage.py
Python
gpl-3.0
1,605
[ "VisIt" ]
cd9e2d388489a9d3617b797f64a94be2e051d6ca972286a2136731399d4f6545
# #@BEGIN LICENSE # # PSI4: an ab initio quantum chemistry software package # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; either version 2 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License along # with this program; if not, write to the Free Software Foundation, Inc., # 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA. # #@END LICENSE # """ | Database (Truhlar) of several classes of noncovalent interactions. | Geometries from Truhlar and coworkers at site http://comp.chem.umn.edu/database_noncov/noncovalent.htm | Reference energies from Truhlar and coworkers at site http://comp.chem.umn.edu/database_noncov/noncovalent.htm | First comprehensive citation JPCA 109 5656 (2005). - **cp** ``'off'`` || ``'on'`` - **rlxd** ``'off'`` || ``'on'`` - **benchmark** - ``'<benchmark_name>'`` <Reference>. - |dl| ``'<default_benchmark_name>'`` |dr| <Reference>. - **subset** - ``'small'`` 3: HF-HF, He-Ne, HCCH-HCCH - ``'large'`` 1: BzBz_PD - ``'HB6'`` hydrogen-bonded - ``'CT7'`` charge-transfer - ``'DI6'`` dipole-interacting - ``'WI7'`` weakly interacting - ``'PPS5'`` pi-pi stacking """ import qcdb # <<< NCB31 Database Module >>> dbse = 'NCB31' # <<< Database Members >>> HRXN_SM = ['HB6-2', 'WI7-1', 'PPS5-1'] HRXN_LG = ['PPS5-5'] HB6 = ['HB6-1', 'HB6-2', 'HB6-3', 'HB6-4', 'HB6-5', 'HB6-6'] CT7 = ['CT7-1', 'CT7-2', 'CT7-3', 'CT7-4', 'CT7-5', 'CT7-6', 'CT7-7'] DI6 = ['DI6-1', 'DI6-2', 'DI6-3', 'DI6-4', 'DI6-5', 'DI6-6'] WI7 = ['WI7-1', 'WI7-2', 'WI7-3', 'WI7-4', 'WI7-5', 'WI7-6', 'WI7-7'] PPS5 = ['PPS5-1', 'PPS5-2', 'PPS5-3', 'PPS5-4', 'PPS5-5'] HRXN = sum([HB6, CT7, DI6, WI7, PPS5], []) # <<< Chemical Systems Involved >>> RXNM = {} # reaction matrix of reagent contributions per reaction RXNM_CPRLX = {} # reaction matrix of reagent contributions per reaction for counterpoise- and deformation-corrected ACTV = {} # order of active reagents per reaction ACTV_CP = {} # order of active reagents per counterpoise-corrected reaction ACTV_SA = {} # order of active reagents for non-supramolecular calculations ACTV_RLX = {} # order of active reagents for deformation-corrected reaction ACTV_CPRLX = {} # order of active reagents for counterpoise- and deformation-corrected reaction hold = {} hold['CT7-1'] = ['C2H4', 'F2'] hold['CT7-2'] = ['NH3', 'F2'] hold['CT7-3'] = ['HCCH', 'ClF'] hold['CT7-4'] = ['HCN', 'ClF'] hold['CT7-5'] = ['NH3', 'Cl2'] hold['CT7-6'] = ['H2O', 'ClF'] hold['CT7-7'] = ['NH3', 'ClF'] hold['DI6-1'] = ['H2S', 'H2S'] hold['DI6-2'] = ['HCl', 'HCl'] hold['DI6-3'] = ['HCl', 'H2S'] hold['DI6-4'] = ['CH3Cl', 'HCl'] hold['DI6-5'] = ['HCN', 'CH3SH'] hold['DI6-6'] = ['CH3SH', 'HCl'] hold['HB6-1'] = ['NH3', 'NH3'] hold['HB6-2'] = ['HF', 'HF'] hold['HB6-3'] = ['H2O', 'H2O'] hold['HB6-4'] = ['NH3', 'H2O'] hold['HB6-5'] = ['HCONH2', 'HCONH2'] hold['HB6-6'] = ['HCOOH', 'HCOOH'] hold['PPS5-1'] = ['HCCH', 'HCCH'] hold['PPS5-2'] = ['C2H4', 'C2H4'] hold['PPS5-3'] = ['Bz', 'Bz'] hold['PPS5-4'] = ['Bz', 'Bz'] hold['PPS5-5'] = ['Bz', 'Bz'] hold['WI7-1'] = ['He', 'Ne'] hold['WI7-2'] = ['He', 'Ar'] hold['WI7-3'] = ['Ne', 'Ne'] hold['WI7-4'] = ['Ne', 'Ar'] hold['WI7-5'] = ['CH4', 'Ne'] hold['WI7-6'] = ['Bz', 'Ne'] hold['WI7-7'] = ['CH4', 'CH4'] for rxn in HRXN: RXNM[ '%s-%s' % (dbse, rxn)] = {'%s-%s-dimer' % (dbse, rxn) : +1, '%s-%s-monoA-CP' % (dbse, rxn) : -1, '%s-%s-monoB-CP' % (dbse, rxn) : -1, '%s-%s-monoA-unCP' % (dbse, rxn) : -1, '%s-%s-monoB-unCP' % (dbse, rxn) : -1, '%s-%s-mono-RLX' % (dbse, hold[rxn][0]) : -1, '%s-%s-mono-RLX' % (dbse, hold[rxn][1]) : -1 } RXNM_CPRLX['%s-%s' % (dbse, rxn)] = {'%s-%s-dimer' % (dbse, rxn) : +1, '%s-%s-monoA-CP' % (dbse, rxn) : -1, '%s-%s-monoB-CP' % (dbse, rxn) : -1, '%s-%s-monoA-unCP' % (dbse, rxn) : +1, '%s-%s-monoB-unCP' % (dbse, rxn) : +1, '%s-%s-mono-RLX' % (dbse, hold[rxn][0]) : -1, '%s-%s-mono-RLX' % (dbse, hold[rxn][1]) : -1 } ACTV_SA[ '%s-%s' % (dbse, rxn)] = ['%s-%s-dimer' % (dbse, rxn) ] ACTV[ '%s-%s' % (dbse, rxn)] = ['%s-%s-dimer' % (dbse, rxn), '%s-%s-monoA-unCP' % (dbse, rxn), '%s-%s-monoB-unCP' % (dbse, rxn) ] ACTV_CP[ '%s-%s' % (dbse, rxn)] = ['%s-%s-dimer' % (dbse, rxn), '%s-%s-monoA-CP' % (dbse, rxn), '%s-%s-monoB-CP' % (dbse, rxn) ] ACTV_RLX[ '%s-%s' % (dbse, rxn)] = ['%s-%s-dimer' % (dbse, rxn), '%s-%s-mono-RLX' % (dbse, hold[rxn][0]), '%s-%s-mono-RLX' % (dbse, hold[rxn][1]) ] ACTV_CPRLX['%s-%s' % (dbse, rxn)] = ['%s-%s-dimer' % (dbse, rxn), '%s-%s-monoA-CP' % (dbse, rxn), '%s-%s-monoB-CP' % (dbse, rxn), '%s-%s-monoA-unCP' % (dbse, rxn), '%s-%s-monoB-unCP' % (dbse, rxn), '%s-%s-mono-RLX' % (dbse, hold[rxn][0]), '%s-%s-mono-RLX' % (dbse, hold[rxn][1]) ] # <<< Reference Values [kcal/mol] >>> BIND = {} nan = float('NaN') BIND['%s-%s' % (dbse, 'CT7-1' )] = -1.06 BIND['%s-%s' % (dbse, 'CT7-2' )] = -1.81 BIND['%s-%s' % (dbse, 'CT7-3' )] = -3.81 BIND['%s-%s' % (dbse, 'CT7-4' )] = -4.86 BIND['%s-%s' % (dbse, 'CT7-5' )] = -4.88 BIND['%s-%s' % (dbse, 'CT7-6' )] = -5.36 BIND['%s-%s' % (dbse, 'CT7-7' )] = -10.62 BIND['%s-%s' % (dbse, 'DI6-1' )] = -1.66 BIND['%s-%s' % (dbse, 'DI6-2' )] = -2.01 BIND['%s-%s' % (dbse, 'DI6-3' )] = -3.35 BIND['%s-%s' % (dbse, 'DI6-4' )] = -3.55 BIND['%s-%s' % (dbse, 'DI6-5' )] = -3.59 BIND['%s-%s' % (dbse, 'DI6-6' )] = -4.16 BIND['%s-%s' % (dbse, 'HB6-1' )] = -3.15 BIND['%s-%s' % (dbse, 'HB6-2' )] = -4.57 BIND['%s-%s' % (dbse, 'HB6-3' )] = -4.97 BIND['%s-%s' % (dbse, 'HB6-4' )] = -6.41 BIND['%s-%s' % (dbse, 'HB6-5' )] = -14.94 BIND['%s-%s' % (dbse, 'HB6-6' )] = -16.15 BIND['%s-%s' % (dbse, 'PPS5-1' )] = -1.34 BIND['%s-%s' % (dbse, 'PPS5-2' )] = -1.42 BIND['%s-%s' % (dbse, 'PPS5-3' )] = -1.81 BIND['%s-%s' % (dbse, 'PPS5-4' )] = -2.74 BIND['%s-%s' % (dbse, 'PPS5-5' )] = -2.78 BIND['%s-%s' % (dbse, 'WI7-1' )] = -0.04 BIND['%s-%s' % (dbse, 'WI7-2' )] = -0.06 BIND['%s-%s' % (dbse, 'WI7-3' )] = -0.08 BIND['%s-%s' % (dbse, 'WI7-4' )] = -0.13 BIND['%s-%s' % (dbse, 'WI7-5' )] = -0.22 BIND['%s-%s' % (dbse, 'WI7-6' )] = -0.47 BIND['%s-%s' % (dbse, 'WI7-7' )] = -0.51 # <<< Comment Lines >>> TAGL = {} TAGL['%s-%s' % (dbse, 'CT7-1' )] = """Ethene-Fluorine Molecule Complex (C2H4-F2) """ TAGL['%s-%s-dimer' % (dbse, 'CT7-1' )] = """Dimer from Ethene-Fluorine Molecule Complex (C2H4-F2) """ TAGL['%s-%s-monoA-CP' % (dbse, 'CT7-1' )] = """Monomer A from Ethene-Fluorine Molecule Complex (C2H4-F2) """ TAGL['%s-%s-monoB-CP' % (dbse, 'CT7-1' )] = """Monomer B from Ethene-Fluorine Molecule Complex (C2H4-F2) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'CT7-1' )] = """Monomer A from Ethene-Fluorine Molecule Complex (C2H4-F2) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'CT7-1' )] = """Monomer B from Ethene-Fluorine Molecule Complex (C2H4-F2) """ TAGL['%s-%s' % (dbse, 'CT7-2' )] = """Ammonia-Fluorine Molecule Complex (NH3-F2) """ TAGL['%s-%s-dimer' % (dbse, 'CT7-2' )] = """Dimer from Ammonia-Fluorine Molecule Complex (NH3-F2) """ TAGL['%s-%s-monoA-CP' % (dbse, 'CT7-2' )] = """Monomer A from Ammonia-Fluorine Molecule Complex (NH3-F2) """ TAGL['%s-%s-monoB-CP' % (dbse, 'CT7-2' )] = """Monomer B from Ammonia-Fluorine Molecule Complex (NH3-F2) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'CT7-2' )] = """Monomer A from Ammonia-Fluorine Molecule Complex (NH3-F2) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'CT7-2' )] = """Monomer B from Ammonia-Fluorine Molecule Complex (NH3-F2) """ TAGL['%s-%s' % (dbse, 'CT7-3' )] = """Ethine-Chlorine Monofluoride Complex (HCCH-ClF) """ TAGL['%s-%s-dimer' % (dbse, 'CT7-3' )] = """Dimer from Ethine-Chlorine Monofluoride Complex (HCCH-ClF) """ TAGL['%s-%s-monoA-CP' % (dbse, 'CT7-3' )] = """Monomer A from Ethine-Chlorine Monofluoride Complex (HCCH-ClF) """ TAGL['%s-%s-monoB-CP' % (dbse, 'CT7-3' )] = """Monomer B from Ethine-Chlorine Monofluoride Complex (HCCH-ClF) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'CT7-3' )] = """Monomer A from Ethine-Chlorine Monofluoride Complex (HCCH-ClF) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'CT7-3' )] = """Monomer B from Ethine-Chlorine Monofluoride Complex (HCCH-ClF) """ TAGL['%s-%s' % (dbse, 'CT7-4' )] = """Hydrogen Cyanide-Chlorine Monofluoride Complex (HCN-ClF) """ TAGL['%s-%s-dimer' % (dbse, 'CT7-4' )] = """Dimer from Hydrogen Cyanide-Chlorine Monofluoride Complex (HCN-ClF) """ TAGL['%s-%s-monoA-CP' % (dbse, 'CT7-4' )] = """Monomer A from Hydrogen Cyanide-Chlorine Monofluoride Complex (HCN-ClF) """ TAGL['%s-%s-monoB-CP' % (dbse, 'CT7-4' )] = """Monomer B from Hydrogen Cyanide-Chlorine Monofluoride Complex (HCN-ClF) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'CT7-4' )] = """Monomer A from Hydrogen Cyanide-Chlorine Monofluoride Complex (HCN-ClF) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'CT7-4' )] = """Monomer B from Hydrogen Cyanide-Chlorine Monofluoride Complex (HCN-ClF) """ TAGL['%s-%s' % (dbse, 'CT7-5' )] = """Ammonia-Chlorine Molecule (NH3-Cl2) """ TAGL['%s-%s-dimer' % (dbse, 'CT7-5' )] = """Dimer from Ammonia-Chlorine Molecule (NH3-Cl2) """ TAGL['%s-%s-monoA-CP' % (dbse, 'CT7-5' )] = """Monomer A from Ammonia-Chlorine Molecule (NH3-Cl2) """ TAGL['%s-%s-monoB-CP' % (dbse, 'CT7-5' )] = """Monomer B from Ammonia-Chlorine Molecule (NH3-Cl2) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'CT7-5' )] = """Monomer A from Ammonia-Chlorine Molecule (NH3-Cl2) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'CT7-5' )] = """Monomer B from Ammonia-Chlorine Molecule (NH3-Cl2) """ TAGL['%s-%s' % (dbse, 'CT7-6' )] = """Water-Chlorine Monofluoride Complex (H2O-ClF) """ TAGL['%s-%s-dimer' % (dbse, 'CT7-6' )] = """Dimer from Water-Chlorine Monofluoride Complex (H2O-ClF) """ TAGL['%s-%s-monoA-CP' % (dbse, 'CT7-6' )] = """Monomer A from Water-Chlorine Monofluoride Complex (H2O-ClF) """ TAGL['%s-%s-monoB-CP' % (dbse, 'CT7-6' )] = """Monomer B from Water-Chlorine Monofluoride Complex (H2O-ClF) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'CT7-6' )] = """Monomer A from Water-Chlorine Monofluoride Complex (H2O-ClF) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'CT7-6' )] = """Monomer B from Water-Chlorine Monofluoride Complex (H2O-ClF) """ TAGL['%s-%s' % (dbse, 'CT7-7' )] = """Ammonia-Chlorine Monofluoride Complex (NH3-ClF) """ TAGL['%s-%s-dimer' % (dbse, 'CT7-7' )] = """Dimer from Ammonia-Chlorine Monofluoride Complex (NH3-ClF) """ TAGL['%s-%s-monoA-CP' % (dbse, 'CT7-7' )] = """Monomer A from Ammonia-Chlorine Monofluoride Complex (NH3-ClF) """ TAGL['%s-%s-monoB-CP' % (dbse, 'CT7-7' )] = """Monomer B from Ammonia-Chlorine Monofluoride Complex (NH3-ClF) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'CT7-7' )] = """Monomer A from Ammonia-Chlorine Monofluoride Complex (NH3-ClF) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'CT7-7' )] = """Monomer B from Ammonia-Chlorine Monofluoride Complex (NH3-ClF) """ TAGL['%s-%s' % (dbse, 'DI6-1' )] = """Hydrogen Sulfide Dimer (H2S-H2S) """ TAGL['%s-%s-dimer' % (dbse, 'DI6-1' )] = """Dimer from Hydrogen Sulfide Dimer (H2S-H2S) """ TAGL['%s-%s-monoA-CP' % (dbse, 'DI6-1' )] = """Monomer A from Hydrogen Sulfide Dimer (H2S-H2S) """ TAGL['%s-%s-monoB-CP' % (dbse, 'DI6-1' )] = """Monomer B from Hydrogen Sulfide Dimer (H2S-H2S) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'DI6-1' )] = """Monomer A from Hydrogen Sulfide Dimer (H2S-H2S) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'DI6-1' )] = """Monomer B from Hydrogen Sulfide Dimer (H2S-H2S) """ TAGL['%s-%s' % (dbse, 'DI6-2' )] = """Hydrogen Chloride Dimer (HCl-HCl) """ TAGL['%s-%s-dimer' % (dbse, 'DI6-2' )] = """Dimer from Hydrogen Chloride Dimer (HCl-HCl) """ TAGL['%s-%s-monoA-CP' % (dbse, 'DI6-2' )] = """Monomer A from Hydrogen Chloride Dimer (HCl-HCl) """ TAGL['%s-%s-monoB-CP' % (dbse, 'DI6-2' )] = """Monomer B from Hydrogen Chloride Dimer (HCl-HCl) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'DI6-2' )] = """Monomer A from Hydrogen Chloride Dimer (HCl-HCl) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'DI6-2' )] = """Monomer B from Hydrogen Chloride Dimer (HCl-HCl) """ TAGL['%s-%s' % (dbse, 'DI6-3' )] = """Hydrogen Chloride-Hydrogen Sulfide Complex (HCl-H2S) """ TAGL['%s-%s-dimer' % (dbse, 'DI6-3' )] = """Dimer from Hydrogen Chloride-Hydrogen Sulfide Complex (HCl-H2S) """ TAGL['%s-%s-monoA-CP' % (dbse, 'DI6-3' )] = """Monomer A from Hydrogen Chloride-Hydrogen Sulfide Complex (HCl-H2S) """ TAGL['%s-%s-monoB-CP' % (dbse, 'DI6-3' )] = """Monomer B from Hydrogen Chloride-Hydrogen Sulfide Complex (HCl-H2S) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'DI6-3' )] = """Monomer A from Hydrogen Chloride-Hydrogen Sulfide Complex (HCl-H2S) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'DI6-3' )] = """Monomer B from Hydrogen Chloride-Hydrogen Sulfide Complex (HCl-H2S) """ TAGL['%s-%s' % (dbse, 'DI6-4' )] = """Methyl Chloride-Hydrogen Chloride (CH3Cl-HCl) """ TAGL['%s-%s-dimer' % (dbse, 'DI6-4' )] = """Dimer from Methyl Chloride-Hydrogen Chloride (CH3Cl-HCl) """ TAGL['%s-%s-monoA-CP' % (dbse, 'DI6-4' )] = """Monomer A from Methyl Chloride-Hydrogen Chloride (CH3Cl-HCl) """ TAGL['%s-%s-monoB-CP' % (dbse, 'DI6-4' )] = """Monomer B from Methyl Chloride-Hydrogen Chloride (CH3Cl-HCl) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'DI6-4' )] = """Monomer A from Methyl Chloride-Hydrogen Chloride (CH3Cl-HCl) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'DI6-4' )] = """Monomer B from Methyl Chloride-Hydrogen Chloride (CH3Cl-HCl) """ TAGL['%s-%s' % (dbse, 'DI6-5' )] = """Hydrogen Cyanide-Methanethiol (HCN-CH3SH) """ TAGL['%s-%s-dimer' % (dbse, 'DI6-5' )] = """Dimer from Hydrogen Cyanide-Methanethiol (HCN-CH3SH) """ TAGL['%s-%s-monoA-CP' % (dbse, 'DI6-5' )] = """Monomer A from Hydrogen Cyanide-Methanethiol (HCN-CH3SH) """ TAGL['%s-%s-monoB-CP' % (dbse, 'DI6-5' )] = """Monomer B from Hydrogen Cyanide-Methanethiol (HCN-CH3SH) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'DI6-5' )] = """Monomer A from Hydrogen Cyanide-Methanethiol (HCN-CH3SH) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'DI6-5' )] = """Monomer B from Hydrogen Cyanide-Methanethiol (HCN-CH3SH) """ TAGL['%s-%s' % (dbse, 'DI6-6' )] = """Methanethiol-Hydrogen Chloride Complex (CH3SH-HCl) """ TAGL['%s-%s-dimer' % (dbse, 'DI6-6' )] = """Dimer from Methanethiol-Hydrogen Chloride Complex (CH3SH-HCl) """ TAGL['%s-%s-monoA-CP' % (dbse, 'DI6-6' )] = """Monomer A from Methanethiol-Hydrogen Chloride Complex (CH3SH-HCl) """ TAGL['%s-%s-monoB-CP' % (dbse, 'DI6-6' )] = """Monomer B from Methanethiol-Hydrogen Chloride Complex (CH3SH-HCl) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'DI6-6' )] = """Monomer A from Methanethiol-Hydrogen Chloride Complex (CH3SH-HCl) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'DI6-6' )] = """Monomer B from Methanethiol-Hydrogen Chloride Complex (CH3SH-HCl) """ TAGL['%s-%s' % (dbse, 'HB6-1' )] = """Ammonia Dimer (NH3-NH3) """ TAGL['%s-%s-dimer' % (dbse, 'HB6-1' )] = """Dimer from Ammonia Dimer (NH3-NH3) """ TAGL['%s-%s-monoA-CP' % (dbse, 'HB6-1' )] = """Monomer A from Ammonia Dimer (NH3-NH3) """ TAGL['%s-%s-monoB-CP' % (dbse, 'HB6-1' )] = """Monomer B from Ammonia Dimer (NH3-NH3) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'HB6-1' )] = """Monomer A from Ammonia Dimer (NH3-NH3) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'HB6-1' )] = """Monomer B from Ammonia Dimer (NH3-NH3) """ TAGL['%s-%s' % (dbse, 'HB6-2' )] = """Hydrogen Fluoride Dimer (HF-HF) """ TAGL['%s-%s-dimer' % (dbse, 'HB6-2' )] = """Dimer from Hydrogen Fluoride Dimer (HF-HF) """ TAGL['%s-%s-monoA-CP' % (dbse, 'HB6-2' )] = """Monomer A from Hydrogen Fluoride Dimer (HF-HF) """ TAGL['%s-%s-monoB-CP' % (dbse, 'HB6-2' )] = """Monomer B from Hydrogen Fluoride Dimer (HF-HF) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'HB6-2' )] = """Monomer A from Hydrogen Fluoride Dimer (HF-HF) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'HB6-2' )] = """Monomer B from Hydrogen Fluoride Dimer (HF-HF) """ TAGL['%s-%s' % (dbse, 'HB6-3' )] = """Water Dimer (H2O-H2O) """ TAGL['%s-%s-dimer' % (dbse, 'HB6-3' )] = """Dimer from Water Dimer (H2O-H2O) """ TAGL['%s-%s-monoA-CP' % (dbse, 'HB6-3' )] = """Monomer A from Water Dimer (H2O-H2O) """ TAGL['%s-%s-monoB-CP' % (dbse, 'HB6-3' )] = """Monomer B from Water Dimer (H2O-H2O) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'HB6-3' )] = """Monomer A from Water Dimer (H2O-H2O) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'HB6-3' )] = """Monomer B from Water Dimer (H2O-H2O) """ TAGL['%s-%s' % (dbse, 'HB6-4' )] = """Ammonia-Water Complex (NH3-H2O) """ TAGL['%s-%s-dimer' % (dbse, 'HB6-4' )] = """Dimer from Ammonia-Water Complex (NH3-H2O) """ TAGL['%s-%s-monoA-CP' % (dbse, 'HB6-4' )] = """Monomer A from Ammonia-Water Complex (NH3-H2O) """ TAGL['%s-%s-monoB-CP' % (dbse, 'HB6-4' )] = """Monomer B from Ammonia-Water Complex (NH3-H2O) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'HB6-4' )] = """Monomer A from Ammonia-Water Complex (NH3-H2O) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'HB6-4' )] = """Monomer B from Ammonia-Water Complex (NH3-H2O) """ TAGL['%s-%s' % (dbse, 'HB6-5' )] = """Formamide Dimer (HCONH2-HCONH2) """ TAGL['%s-%s-dimer' % (dbse, 'HB6-5' )] = """Dimer from Formamide Dimer (HCONH2-HCONH2) """ TAGL['%s-%s-monoA-CP' % (dbse, 'HB6-5' )] = """Monomer A from Formamide Dimer (HCONH2-HCONH2) """ TAGL['%s-%s-monoB-CP' % (dbse, 'HB6-5' )] = """Monomer B from Formamide Dimer (HCONH2-HCONH2) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'HB6-5' )] = """Monomer A from Formamide Dimer (HCONH2-HCONH2) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'HB6-5' )] = """Monomer B from Formamide Dimer (HCONH2-HCONH2) """ TAGL['%s-%s' % (dbse, 'HB6-6' )] = """Formic Acid Dimer (HCOOH-HCOOH) """ TAGL['%s-%s-dimer' % (dbse, 'HB6-6' )] = """Dimer from Formic Acid Dimer (HCOOH-HCOOH) """ TAGL['%s-%s-monoA-CP' % (dbse, 'HB6-6' )] = """Monomer A from Formic Acid Dimer (HCOOH-HCOOH) """ TAGL['%s-%s-monoB-CP' % (dbse, 'HB6-6' )] = """Monomer B from Formic Acid Dimer (HCOOH-HCOOH) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'HB6-6' )] = """Monomer A from Formic Acid Dimer (HCOOH-HCOOH) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'HB6-6' )] = """Monomer B from Formic Acid Dimer (HCOOH-HCOOH) """ TAGL['%s-%s' % (dbse, 'PPS5-1' )] = """Ethine Dimer (HCCH-HCCH) """ TAGL['%s-%s-dimer' % (dbse, 'PPS5-1' )] = """Dimer from Ethine Dimer (HCCH-HCCH) """ TAGL['%s-%s-monoA-CP' % (dbse, 'PPS5-1' )] = """Monomer A from Ethine Dimer (HCCH-HCCH) """ TAGL['%s-%s-monoB-CP' % (dbse, 'PPS5-1' )] = """Monomer B from Ethine Dimer (HCCH-HCCH) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'PPS5-1' )] = """Monomer A from Ethine Dimer (HCCH-HCCH) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'PPS5-1' )] = """Monomer B from Ethine Dimer (HCCH-HCCH) """ TAGL['%s-%s' % (dbse, 'PPS5-2' )] = """Ethene Dimer (C2H4-C2H4) """ TAGL['%s-%s-dimer' % (dbse, 'PPS5-2' )] = """Dimer from Ethene Dimer (C2H4-C2H4) """ TAGL['%s-%s-monoA-CP' % (dbse, 'PPS5-2' )] = """Monomer A from Ethene Dimer (C2H4-C2H4) """ TAGL['%s-%s-monoB-CP' % (dbse, 'PPS5-2' )] = """Monomer B from Ethene Dimer (C2H4-C2H4) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'PPS5-2' )] = """Monomer A from Ethene Dimer (C2H4-C2H4) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'PPS5-2' )] = """Monomer B from Ethene Dimer (C2H4-C2H4) """ TAGL['%s-%s' % (dbse, 'PPS5-3' )] = """Sandwich Benzene Dimer (BzBz_S) """ TAGL['%s-%s-dimer' % (dbse, 'PPS5-3' )] = """Dimer from Sandwich Benzene Dimer (BzBz_S) """ TAGL['%s-%s-monoA-CP' % (dbse, 'PPS5-3' )] = """Monomer A from Sandwich Benzene Dimer (BzBz_S) """ TAGL['%s-%s-monoB-CP' % (dbse, 'PPS5-3' )] = """Monomer B from Sandwich Benzene Dimer (BzBz_S) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'PPS5-3' )] = """Monomer A from Sandwich Benzene Dimer (BzBz_S) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'PPS5-3' )] = """Monomer B from Sandwich Benzene Dimer (BzBz_S) """ TAGL['%s-%s' % (dbse, 'PPS5-4' )] = """T-Shaped Benzene Dimer (BzBz_T) """ TAGL['%s-%s-dimer' % (dbse, 'PPS5-4' )] = """Dimer from T-Shaped Benzene Dimer (BzBz_T) """ TAGL['%s-%s-monoA-CP' % (dbse, 'PPS5-4' )] = """Monomer A from T-Shaped Benzene Dimer (BzBz_T) """ TAGL['%s-%s-monoB-CP' % (dbse, 'PPS5-4' )] = """Monomer B from T-Shaped Benzene Dimer (BzBz_T) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'PPS5-4' )] = """Monomer A from T-Shaped Benzene Dimer (BzBz_T) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'PPS5-4' )] = """Monomer B from T-Shaped Benzene Dimer (BzBz_T) """ TAGL['%s-%s' % (dbse, 'PPS5-5' )] = """Parallel-Displaced Benzene Dimer (BzBz_PD) """ TAGL['%s-%s-dimer' % (dbse, 'PPS5-5' )] = """Dimer from Parallel-Displaced Benzene Dimer (BzBz_PD) """ TAGL['%s-%s-monoA-CP' % (dbse, 'PPS5-5' )] = """Monomer A from Parallel-Displaced Benzene Dimer (BzBz_PD) """ TAGL['%s-%s-monoB-CP' % (dbse, 'PPS5-5' )] = """Monomer B from Parallel-Displaced Benzene Dimer (BzBz_PD) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'PPS5-5' )] = """Monomer A from Parallel-Displaced Benzene Dimer (BzBz_PD) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'PPS5-5' )] = """Monomer B from Parallel-Displaced Benzene Dimer (BzBz_PD) """ TAGL['%s-%s' % (dbse, 'WI7-1' )] = """Helium-Neon Complex (He-Ne) """ TAGL['%s-%s-dimer' % (dbse, 'WI7-1' )] = """Dimer from Helium-Neon Complex (He-Ne) """ TAGL['%s-%s-monoA-CP' % (dbse, 'WI7-1' )] = """Monomer A from Helium-Neon Complex (He-Ne) """ TAGL['%s-%s-monoB-CP' % (dbse, 'WI7-1' )] = """Monomer B from Helium-Neon Complex (He-Ne) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'WI7-1' )] = """Monomer A from Helium-Neon Complex (He-Ne) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'WI7-1' )] = """Monomer B from Helium-Neon Complex (He-Ne) """ TAGL['%s-%s' % (dbse, 'WI7-2' )] = """Helium-Argon Complex (He-Ar) """ TAGL['%s-%s-dimer' % (dbse, 'WI7-2' )] = """Dimer from Helium-Argon Complex (He-Ar) """ TAGL['%s-%s-monoA-CP' % (dbse, 'WI7-2' )] = """Monomer A from Helium-Argon Complex (He-Ar) """ TAGL['%s-%s-monoB-CP' % (dbse, 'WI7-2' )] = """Monomer B from Helium-Argon Complex (He-Ar) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'WI7-2' )] = """Monomer A from Helium-Argon Complex (He-Ar) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'WI7-2' )] = """Monomer B from Helium-Argon Complex (He-Ar) """ TAGL['%s-%s' % (dbse, 'WI7-3' )] = """Neon Dimer (Ne-Ne) """ TAGL['%s-%s-dimer' % (dbse, 'WI7-3' )] = """Dimer from Neon Dimer (Ne-Ne) """ TAGL['%s-%s-monoA-CP' % (dbse, 'WI7-3' )] = """Monomer A from Neon Dimer (Ne-Ne) """ TAGL['%s-%s-monoB-CP' % (dbse, 'WI7-3' )] = """Monomer B from Neon Dimer (Ne-Ne) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'WI7-3' )] = """Monomer A from Neon Dimer (Ne-Ne) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'WI7-3' )] = """Monomer B from Neon Dimer (Ne-Ne) """ TAGL['%s-%s' % (dbse, 'WI7-4' )] = """Neon-Argon Complex (Ne-Ar) """ TAGL['%s-%s-dimer' % (dbse, 'WI7-4' )] = """Dimer from Neon-Argon Complex (Ne-Ar) """ TAGL['%s-%s-monoA-CP' % (dbse, 'WI7-4' )] = """Monomer A from Neon-Argon Complex (Ne-Ar) """ TAGL['%s-%s-monoB-CP' % (dbse, 'WI7-4' )] = """Monomer B from Neon-Argon Complex (Ne-Ar) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'WI7-4' )] = """Monomer A from Neon-Argon Complex (Ne-Ar) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'WI7-4' )] = """Monomer B from Neon-Argon Complex (Ne-Ar) """ TAGL['%s-%s' % (dbse, 'WI7-5' )] = """Methane-Neon Complex (CH4-Ne) """ TAGL['%s-%s-dimer' % (dbse, 'WI7-5' )] = """Dimer from Methane-Neon Complex (CH4-Ne) """ TAGL['%s-%s-monoA-CP' % (dbse, 'WI7-5' )] = """Monomer A from Methane-Neon Complex (CH4-Ne) """ TAGL['%s-%s-monoB-CP' % (dbse, 'WI7-5' )] = """Monomer B from Methane-Neon Complex (CH4-Ne) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'WI7-5' )] = """Monomer A from Methane-Neon Complex (CH4-Ne) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'WI7-5' )] = """Monomer B from Methane-Neon Complex (CH4-Ne) """ TAGL['%s-%s' % (dbse, 'WI7-6' )] = """Benzene-Neon Complex (Bz-Ne) """ TAGL['%s-%s-dimer' % (dbse, 'WI7-6' )] = """Dimer from Benzene-Neon Complex (Bz-Ne) """ TAGL['%s-%s-monoA-CP' % (dbse, 'WI7-6' )] = """Monomer A from Benzene-Neon Complex (Bz-Ne) """ TAGL['%s-%s-monoB-CP' % (dbse, 'WI7-6' )] = """Monomer B from Benzene-Neon Complex (Bz-Ne) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'WI7-6' )] = """Monomer A from Benzene-Neon Complex (Bz-Ne) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'WI7-6' )] = """Monomer B from Benzene-Neon Complex (Bz-Ne) """ TAGL['%s-%s' % (dbse, 'WI7-7' )] = """Methane Dimer (CH4-CH4) """ TAGL['%s-%s-dimer' % (dbse, 'WI7-7' )] = """Dimer from Methane Dimer (CH4-CH4) """ TAGL['%s-%s-monoA-CP' % (dbse, 'WI7-7' )] = """Monomer A from Methane Dimer (CH4-CH4) """ TAGL['%s-%s-monoB-CP' % (dbse, 'WI7-7' )] = """Monomer B from Methane Dimer (CH4-CH4) """ TAGL['%s-%s-monoA-unCP' % (dbse, 'WI7-7' )] = """Monomer A from Methane Dimer (CH4-CH4) """ TAGL['%s-%s-monoB-unCP' % (dbse, 'WI7-7' )] = """Monomer B from Methane Dimer (CH4-CH4) """ TAGL['%s-%s-mono-RLX' % (dbse, 'HCCH' )] = """Ethine Relaxed Monomer """ TAGL['%s-%s-mono-RLX' % (dbse, 'C2H4' )] = """Ethene Relaxed Monomer """ TAGL['%s-%s-mono-RLX' % (dbse, 'Bz' )] = """Benzene Relaxed Monomer """ TAGL['%s-%s-mono-RLX' % (dbse, 'CH3Cl' )] = """Methyl Chloride Relaxed Monomer """ TAGL['%s-%s-mono-RLX' % (dbse, 'CH3SH' )] = """Methanethiol Relaxed Monomer """ TAGL['%s-%s-mono-RLX' % (dbse, 'CH4' )] = """Methane Relaxed Monomer """ TAGL['%s-%s-mono-RLX' % (dbse, 'F2' )] = """Fluorine Molecule Relaxed Monomer """ TAGL['%s-%s-mono-RLX' % (dbse, 'H2O' )] = """Water Relaxed Monomer """ TAGL['%s-%s-mono-RLX' % (dbse, 'H2S' )] = """Hydrogen Sulfide Relaxed Monomer """ TAGL['%s-%s-mono-RLX' % (dbse, 'HCl' )] = """Hydrogen Chloride Relaxed Monomer """ TAGL['%s-%s-mono-RLX' % (dbse, 'HCN' )] = """Hydrogen Cyanide Relaxed Monomer """ TAGL['%s-%s-mono-RLX' % (dbse, 'HCONH2' )] = """Formamide Relaxed Monomer """ TAGL['%s-%s-mono-RLX' % (dbse, 'HCOOH' )] = """Formic Acid Relaxed Monomer """ TAGL['%s-%s-mono-RLX' % (dbse, 'He' )] = """Helium Relaxed Monomer """ TAGL['%s-%s-mono-RLX' % (dbse, 'Ne' )] = """Neon Relaxed Monomer """ TAGL['%s-%s-mono-RLX' % (dbse, 'Ar' )] = """Argon Relaxed Monomer """ TAGL['%s-%s-mono-RLX' % (dbse, 'HF' )] = """Hydrogen Fluoride Relaxed Monomer """ TAGL['%s-%s-mono-RLX' % (dbse, 'NH3' )] = """Ammonia Relaxed Monomer """ # <<< Geometry Specification Strings >>> GEOS = {} GEOS['%s-%s-%s' % (dbse, 'CT7-1', 'dimer')] = qcdb.Molecule(""" 0 1 C 0.00000000 -2.19285000 -0.66839500 C -0.00000000 -2.19286000 0.66839500 H -0.92518700 -2.19231600 -1.23398200 H 0.92518700 -2.19232500 -1.23398300 H -0.92518700 -2.19232000 1.23398200 H 0.92518700 -2.19231100 1.23398200 -- 0 1 F 0.00000000 0.78568800 0.00000000 F 0.00000000 2.20564800 0.00000100 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'CT7-2', 'dimer')] = qcdb.Molecule(""" 0 1 N 0.00000000 0.00000000 -2.14998500 H 0.00000000 0.93965200 -2.53440100 H 0.81376200 -0.46982600 -2.53440100 H -0.81376200 -0.46982600 -2.53440100 -- 0 1 F 0.00000000 0.00000000 0.54577100 F 0.00000000 0.00000000 1.97124000 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'CT7-3', 'dimer')] = qcdb.Molecule(""" 0 1 H 0.00000000 1.67189100 -2.21255500 C 0.00000000 0.60529300 -2.19955900 C 0.00000000 -0.60529300 -2.19955900 H 0.00000000 -1.67189100 -2.21255500 -- 0 1 Cl 0.00000000 -0.00000000 0.61188000 F 0.00000000 -0.00000000 2.26865100 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'CT7-4', 'dimer')] = qcdb.Molecule(""" 0 1 N 0.00000000 0.00000000 -1.83951900 C 0.00000000 0.00000000 -2.99573100 H 0.00000000 0.00000000 -4.06502600 -- 0 1 F -0.00000000 0.00000000 2.42592000 Cl -0.00000000 0.00000000 0.76957400 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'CT7-5', 'dimer')] = qcdb.Molecule(""" 0 1 N 0.00000000 0.00000000 -2.83845100 H 0.00000000 0.94268700 -3.21538300 H 0.81639100 -0.47134300 -3.21538300 H -0.81639100 -0.47134300 -3.21538300 -- 0 1 Cl 0.00000000 0.00000000 -0.15004400 Cl 0.00000000 0.00000000 1.88623900 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'CT7-6', 'dimer')] = qcdb.Molecule(""" 0 1 O 2.23981900 0.00002700 -0.08823100 H 2.60088700 0.76196300 0.37705500 H 2.60108700 -0.76172700 0.37719400 -- 0 1 Cl -0.31586800 -0.00006600 -0.01691400 F -1.97230800 0.00007400 0.02657000 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'CT7-7', 'dimer')] = qcdb.Molecule(""" 0 1 N 0.00000000 0.00000000 -2.05789900 H 0.00000000 0.94960500 -2.41448800 H 0.82238200 -0.47480300 -2.41448800 H -0.82238200 -0.47480300 -2.41448800 -- 0 1 Cl 0.00000000 0.00000000 0.24385500 F 0.00000000 0.00000000 1.94480300 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'DI6-1', 'dimer')] = qcdb.Molecule(""" 0 1 S -2.03099600 0.10323300 -0.00078200 H -1.93402000 -0.81846200 0.96967600 H -1.94045000 -0.83661600 -0.95429900 -- 0 1 S 2.07983800 -0.08511200 0.00018100 H 2.33915400 1.23101900 -0.00221400 H 0.75384800 0.13412100 -0.00353700 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'DI6-2', 'dimer')] = qcdb.Molecule(""" 0 1 Cl 1.86082400 -0.06541100 -0.00006800 H 1.75394100 1.21098100 0.00034100 -- 0 1 Cl -1.92526600 0.00557100 -0.00009700 H -0.65842700 -0.19370300 0.00247600 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'DI6-3', 'dimer')] = qcdb.Molecule(""" 0 1 Cl -1.91163600 -0.00001100 0.00349800 H -0.62731700 -0.00005800 -0.10405100 -- 0 1 S 1.84252900 0.00001300 -0.10154300 H 1.82277900 -0.96181000 0.83465000 H 1.82187700 0.96186000 0.83462200 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'DI6-4', 'dimer')] = qcdb.Molecule(""" 0 1 C -1.49512800 1.12579900 -0.00000200 Cl -1.40247600 -0.66254400 0.00013900 H -0.48106900 1.51836100 -0.00121600 H -2.02718100 1.43516300 0.89531200 H -2.02924000 1.43492300 -0.89417200 -- 0 1 Cl 2.13960800 0.03729800 -0.00013800 H 0.97700200 -0.51405400 0.00007200 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'DI6-5', 'dimer')] = qcdb.Molecule(""" 0 1 C 1.99644300 0.05718500 -0.00648300 N 2.98021800 0.65834500 0.10945000 H 1.07234100 -0.48518900 -0.10641600 -- 0 1 S -1.51439900 -0.79999400 -0.11697900 C -1.57014400 1.01297400 0.01160700 H -1.55457900 -1.05260000 1.20049200 H -1.54556000 1.39238100 -1.01019600 H -0.70866100 1.40255300 0.55309700 H -2.49314500 1.33992300 0.48665400 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'DI6-6', 'dimer')] = qcdb.Molecule(""" 0 1 C -1.44764800 1.15564900 0.01851300 S -1.41459500 -0.65984600 -0.08354400 H -1.46628400 1.51681600 -1.00988000 H -0.55297100 1.53526500 0.51001200 H -2.34423900 1.49773300 0.53186300 H -1.37736100 -0.89092100 1.23821400 -- 0 1 Cl 2.12576600 0.02408100 0.00315600 H 0.92223800 -0.44463500 -0.09824700 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'HB6-1', 'dimer')] = qcdb.Molecule(""" 0 1 N 1.57522500 0.00008500 -0.04260700 H 2.13110800 0.81394900 -0.28661400 H 1.49645000 -0.00293600 0.97025700 H 2.13172100 -0.81189200 -0.29145300 -- 0 1 N -1.68824500 0.00008300 0.10484800 H -2.12640300 -0.81268000 -0.31731000 H -2.12744200 0.81184200 -0.31815800 H -0.71429700 0.00054300 -0.19240700 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'HB6-2', 'dimer')] = qcdb.Molecule(""" 0 1 F 1.32373600 -0.09022600 -0.00000700 H 1.74043700 0.73339000 0.00001300 -- 0 1 F -1.45719500 0.01925700 -0.00001100 H -0.53931000 -0.09466400 0.00014500 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'HB6-3', 'dimer')] = qcdb.Molecule(""" 0 1 O 1.53175000 0.00592200 -0.12088000 H 0.57596800 -0.00524900 0.02496600 H 1.90624900 -0.03756100 0.76321800 -- 0 1 O -1.39622600 -0.00499000 0.10676600 H -1.78937200 -0.74228300 -0.37100900 H -1.77703700 0.77763800 -0.30426400 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'HB6-4', 'dimer')] = qcdb.Molecule(""" 0 1 N -1.39559100 -0.02156400 0.00003700 H -1.62981100 0.96109600 -0.10622400 H -1.86276700 -0.51254400 -0.75597400 H -1.83354700 -0.33077000 0.86230700 -- 0 1 O 1.56850100 0.10589200 0.00000500 H 0.60673600 -0.03396200 -0.00062800 H 1.94051900 -0.78000500 0.00022200 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'HB6-5', 'dimer')] = qcdb.Molecule(""" 0 1 O -1.14108700 1.44521200 0.00000000 C -0.06175400 2.03094700 0.00000000 H -0.01368700 3.13016900 0.00000000 N 1.14108700 1.43587700 0.00000000 H 1.21768600 0.41652700 0.00000000 H 1.97144600 2.00209500 0.00000000 -- 0 1 O 1.14108700 -1.44521200 0.00000000 C 0.06175400 -2.03094700 0.00000000 H 0.01368700 -3.13016900 0.00000000 N -1.14108700 -1.43587700 0.00000000 H -1.21768600 -0.41652700 0.00000000 H -1.97144600 -2.00209500 0.00000000 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'HB6-6', 'dimer')] = qcdb.Molecule(""" 0 1 C -0.12023400 1.91407000 0.00000000 H -0.16729500 3.00701800 0.00000000 O -1.12185700 1.22098200 0.00000000 O 1.12185700 1.48048900 0.00000000 H 1.12758200 0.48902400 0.00000000 -- 0 1 O 1.12185700 -1.22098200 0.00000000 C 0.12023400 -1.91407000 0.00000000 O -1.12185700 -1.48048900 0.00000000 H -1.12758200 -0.48902400 0.00000000 H 0.16729500 -3.00701800 0.00000000 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'PPS5-1', 'dimer')] = qcdb.Molecule(""" 0 1 C -0.41254600 1.67817500 0.00000000 C 0.41254600 2.56162700 0.00000000 H -1.13202600 0.89080900 0.00000000 H 1.13465100 3.34577000 0.00000000 -- 0 1 C 0.41254600 -1.67817500 0.00000000 C -0.41254600 -2.56162700 0.00000000 H 1.13202600 -0.89080900 0.00000000 H -1.13465100 -3.34577000 0.00000000 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'PPS5-2', 'dimer')] = qcdb.Molecule(""" 0 1 C 1.85776800 0.47280300 0.47242500 C 1.85776800 -0.47280300 -0.47242500 H 0.93377200 0.87468800 0.87406300 H 2.78381800 0.87170900 0.87155600 H 2.78381800 -0.87170900 -0.87155600 H 0.93377200 -0.87468800 -0.87406300 -- 0 1 C -1.85776800 0.47280300 -0.47242500 C -1.85776800 -0.47280300 0.47242500 H -2.78381800 0.87170900 -0.87155600 H -0.93377200 0.87468800 -0.87406300 H -0.93377200 -0.87468800 0.87406300 H -2.78381800 -0.87170900 0.87155600 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'PPS5-3', 'dimer')] = qcdb.Molecule(""" 0 1 C 0.00000000 1.95000000 1.39150000 H 0.00000000 1.95000000 2.47150000 C 1.20507435 1.95000000 0.69575000 H 2.14038179 1.95000000 1.23575000 C 1.20507435 1.95000000 -0.69575000 H 2.14038179 1.95000000 -1.23575000 C -0.00000000 1.95000000 -1.39150000 H -0.00000000 1.95000000 -2.47150000 C -1.20507435 1.95000000 -0.69575000 H -2.14038179 1.95000000 -1.23575000 C -1.20507435 1.95000000 0.69575000 H -2.14038179 1.95000000 1.23575000 -- 0 1 C -1.20507435 -1.95000000 -0.69575000 H -2.14038179 -1.95000000 -1.23575000 C -0.00000000 -1.95000000 -1.39150000 H -0.00000000 -1.95000000 -2.47150000 C 1.20507435 -1.95000000 -0.69575000 H 2.14038179 -1.95000000 -1.23575000 C 1.20507435 -1.95000000 0.69575000 H 2.14038179 -1.95000000 1.23575000 C -0.00000000 -1.95000000 1.39150000 H -0.00000000 -1.95000000 2.47150000 C -1.20507435 -1.95000000 0.69575000 H -2.14038179 -1.95000000 1.23575000 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'PPS5-4', 'dimer')] = qcdb.Molecule(""" 0 1 C 1.39150000 -0.00000000 2.49575000 H 2.47150000 -0.00000000 2.49575000 C 0.69575000 1.20507435 2.49575000 H 1.23575000 2.14038179 2.49575000 C 0.69575000 -1.20507435 2.49575000 H 1.23575000 -2.14038179 2.49575000 C -0.69575000 1.20507435 2.49575000 H -1.23575000 2.14038179 2.49575000 C -0.69575000 -1.20507435 2.49575000 H -1.23575000 -2.14038179 2.49575000 C -1.39150000 -0.00000000 2.49575000 H -2.47150000 -0.00000000 2.49575000 -- 0 1 C 0.00000000 0.00000000 -1.10425000 C -0.00000000 -1.20507435 -1.80000000 H -0.00000000 -2.14038179 -1.26000000 H 0.00000000 0.00000000 -0.02425000 C -0.00000000 -1.20507435 -3.19150000 H -0.00000000 -2.14038179 -3.73150000 C -0.00000000 0.00000000 -3.88725000 H -0.00000000 0.00000000 -4.96725000 C -0.00000000 1.20507435 -3.19150000 H 0.00000000 2.14038179 -3.73150000 C 0.00000000 1.20507435 -1.80000000 H 0.00000000 2.14038179 -1.26000000 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'PPS5-5', 'dimer')] = qcdb.Molecule(""" 0 1 C -0.80000000 1.80000000 1.39150000 H -0.80000000 1.80000000 2.47150000 C 0.40507435 1.80000000 0.69575000 H 1.34038179 1.80000000 1.23575000 C -2.00507435 1.80000000 0.69575000 H -2.94038179 1.80000000 1.23575000 C 0.40507435 1.80000000 -0.69575000 H 1.34038179 1.80000000 -1.23575000 C -2.00507435 1.80000000 -0.69575000 H -2.94038179 1.80000000 -1.23575000 C -0.80000000 1.80000000 -1.39150000 H -0.80000000 1.80000000 -2.47150000 -- 0 1 C 0.80000000 -1.80000000 -1.39150000 C 2.00507435 -1.80000000 -0.69575000 H 2.94038179 -1.80000000 -1.23575000 H 0.80000000 -1.80000000 -2.47150000 C 2.00507435 -1.80000000 0.69575000 H 2.94038179 -1.80000000 1.23575000 C 0.80000000 -1.80000000 1.39150000 H 0.80000000 -1.80000000 2.47150000 C -0.40507435 -1.80000000 0.69575000 H -1.34038179 -1.80000000 1.23575000 C -0.40507435 -1.80000000 -0.69575000 H -1.34038179 -1.80000000 -1.23575000 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'WI7-1', 'dimer')] = qcdb.Molecule(""" 0 1 He 0.00000000 0.00000000 0.00000000 -- 0 1 Ne 3.03100000 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'WI7-2', 'dimer')] = qcdb.Molecule(""" 0 1 He 0.00000000 0.00000000 0.00000000 -- 0 1 Ar 3.48000000 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'WI7-3', 'dimer')] = qcdb.Molecule(""" 0 1 Ne 0.00000000 0.00000000 0.00000000 -- 0 1 Ne 3.09100000 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'WI7-4', 'dimer')] = qcdb.Molecule(""" 0 1 Ne 0.00000000 0.00000000 0.00000000 -- 0 1 Ar 3.48900000 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'WI7-5', 'dimer')] = qcdb.Molecule(""" 0 1 Ne 0.00070500 -0.03504900 -1.74260200 -- 0 1 C -0.00070500 0.03504800 1.74257700 H -0.00115700 0.05752400 2.83186300 H -0.02121400 1.05430800 1.35836800 H -0.87960700 -0.50371400 1.39016200 H 0.89915700 -0.46792400 1.39016200 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'WI7-6', 'dimer')] = qcdb.Molecule(""" 0 1 C 0.00000000 1.39566300 -0.61935100 C -1.20868000 0.69783100 -0.61935100 C -1.20868000 -0.69783100 -0.61935100 C -0.00000000 -1.39566300 -0.61935100 C 1.20868000 -0.69783100 -0.61935100 C 1.20868000 0.69783100 -0.61935100 H 0.00000000 2.48003700 -0.61754900 H -2.14777500 1.24001800 -0.61754900 H -2.14777500 -1.24001800 -0.61754900 H -0.00000000 -2.48003700 -0.61754900 H 2.14777500 -1.24001800 -0.61754900 H 2.14777500 1.24001800 -0.61754900 -- 0 1 Ne 0.00000000 0.00000000 2.60019400 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'WI7-7', 'dimer')] = qcdb.Molecule(""" 0 1 C -0.00000000 0.00000000 1.80727900 H -0.00000000 1.02664300 1.44240000 H -0.88909900 -0.51332200 1.44240000 H -0.00000000 0.00000000 2.89684300 H 0.88909900 -0.51332200 1.44240000 -- 0 1 C -0.00000000 -0.00000000 -1.80727900 H 0.88909900 0.51332200 -1.44240000 H -0.00000000 -0.00000000 -2.89684300 H -0.88909900 0.51332200 -1.44240000 H -0.00000000 -1.02664300 -1.44240000 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'HCCH', 'mono-RLX')] = qcdb.Molecule(""" 0 1 C 0.00000400 -0.60420400 0.00000000 C 0.00000400 0.60419800 0.00000000 H 0.00679500 -1.67012800 0.00000000 H -0.00683900 1.67016300 0.00000000 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'C2H4', 'mono-RLX')] = qcdb.Molecule(""" 0 1 C 0.00000000 0.00000000 0.66807800 C 0.00000000 0.00000000 -0.66807800 H 0.00000000 0.92453300 1.23491900 H 0.00000000 -0.92453300 1.23491900 H 0.00000000 0.92453300 -1.23491900 H 0.00000000 -0.92453300 -1.23491900 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'Bz', 'mono-RLX')] = qcdb.Molecule(""" 0 1 C 0.00000000 1.39567100 -0.61715800 C -1.20868600 0.69783500 -0.61715800 C -1.20868600 -0.69783500 -0.61715800 C 0.00000000 -1.39567100 -0.61715800 C 1.20868600 -0.69783500 -0.61715800 C 1.20868600 0.69783500 -0.61715800 H 0.00000000 2.47987600 -0.61699800 H -2.14763600 1.23993800 -0.61699800 H -2.14763600 -1.23993800 -0.61699800 H 0.00000000 -2.47987600 -0.61699800 H 2.14763600 -1.23993800 -0.61699800 H 2.14763600 1.23993800 -0.61699800 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'CH3Cl', 'mono-RLX')] = qcdb.Molecule(""" 0 1 C 0.00000000 0.00000000 -1.12626800 Cl 0.00000000 0.00000000 0.65820600 H 0.00000000 1.03097000 -1.47059600 H 0.89284600 -0.51548500 -1.47059600 H -0.89284600 -0.51548500 -1.47059600 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'CH3SH', 'mono-RLX')] = qcdb.Molecule(""" 0 1 C -0.04788200 1.15150600 0.00000000 S -0.04788200 -0.66495900 0.00000000 H 1.28433700 -0.82104700 0.00000000 H -1.09471300 1.45662100 0.00000000 H 0.43188500 1.54736900 0.89371000 H 0.43188500 1.54736900 -0.89371000 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'CH4', 'mono-RLX')] = qcdb.Molecule(""" 0 1 C 0.00000000 0.00000000 0.00000000 H 0.00000000 -1.08947061 0.00000000 H -1.02716274 0.36315688 0.00000000 H 0.34238759 0.36315688 0.96841832 H 0.34238759 0.36315688 -0.96841832 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'F2', 'mono-RLX')] = qcdb.Molecule(""" 0 1 F 0.00000000 0.00000000 1.41423000 F 0.00000000 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'H2O', 'mono-RLX')] = qcdb.Molecule(""" 0 1 O 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 0.96183119 H 0.00000000 0.93357861 -0.23140921 O units angstrom """) GEOS['%s-%s-%s' % (dbse, 'H2S', 'mono-RLX')] = qcdb.Molecule(""" 0 1 S 0.00000000 0.00000000 0.10389400 H 0.00000000 0.96116200 -0.83115300 H 0.00000000 -0.96116200 -0.83115300 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'HCl', 'mono-RLX')] = qcdb.Molecule(""" 0 1 Cl 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 1.27907275 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'HCN', 'mono-RLX')] = qcdb.Molecule(""" 0 1 C 0.00000000 0.00000000 -0.50103200 N 0.00000000 0.00000000 0.65706900 H 0.00000000 0.00000000 -1.57005300 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'HCONH2', 'mono-RLX')] = qcdb.Molecule(""" 0 1 C -0.16068500 0.38839900 -0.00053800 O -1.19570500 -0.24639200 0.00018900 N 1.08330000 -0.15841900 -0.00029100 H -0.13991800 1.49035000 0.00139300 H 1.18225800 -1.16041500 0.00111600 H 1.90431600 0.41973500 0.00124500 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'HCOOH', 'mono-RLX')] = qcdb.Molecule(""" 0 1 C -0.13470200 0.40125100 -0.00024900 O -1.13426200 -0.26458200 0.00006900 O 1.11868000 -0.09107500 0.00005600 H -0.10761700 1.49546500 0.00051300 H 1.04048400 -1.05771400 -0.00002000 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'He', 'mono-RLX')] = qcdb.Molecule(""" 0 1 He 0.00000000 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'Ne', 'mono-RLX')] = qcdb.Molecule(""" 0 1 Ne 0.00000000 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'Ar', 'mono-RLX')] = qcdb.Molecule(""" 0 1 Ar 0.00000000 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'HF', 'mono-RLX')] = qcdb.Molecule(""" 0 1 F 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 0.92073754 units angstrom """) GEOS['%s-%s-%s' % (dbse, 'NH3', 'mono-RLX')] = qcdb.Molecule(""" 0 1 N 0.00000000 0.00000000 0.11501300 H 0.00000000 0.93975200 -0.26836400 H 0.81385000 -0.46987600 -0.26836400 H -0.81385000 -0.46987600 -0.26836400 units angstrom """) # <<< Derived Geometry Strings >>> for rxn in HRXN: GEOS['%s-%s-monoA-unCP' % (dbse, rxn)] = GEOS['%s-%s-dimer' % (dbse, rxn)].extract_fragments(1) GEOS['%s-%s-monoB-unCP' % (dbse, rxn)] = GEOS['%s-%s-dimer' % (dbse, rxn)].extract_fragments(2) GEOS['%s-%s-monoA-CP' % (dbse, rxn)] = GEOS['%s-%s-dimer' % (dbse, rxn)].extract_fragments(1, 2) GEOS['%s-%s-monoB-CP' % (dbse, rxn)] = GEOS['%s-%s-dimer' % (dbse, rxn)].extract_fragments(2, 1)
spring01/libPSI
lib/databases/NCB31.py
Python
gpl-2.0
53,417
[ "Psi4" ]
a06c8d4f46aa29d441f5641ef36f8a82a17c8e4b82cf77e1f4b103d051bfde34
# coding: utf-8 # Copyright (c) Pymatgen Development Team. # Distributed under the terms of the MIT License. from __future__ import division, unicode_literals """ Development script to test the algorithms of all the model coordination environments """ __author__ = "David Waroquiers" __copyright__ = "Copyright 2012, The Materials Project" __version__ = "2.0" __maintainer__ = "David Waroquiers" __email__ = "david.waroquiers@gmail.com" __date__ = "Feb 20, 2016" from pymatgen.analysis.chemenv.coordination_environments.coordination_geometry_finder import LocalGeometryFinder from pymatgen.analysis.chemenv.coordination_environments.coordination_geometry_finder import AbstractGeometry from pymatgen.analysis.chemenv.coordination_environments.coordination_geometries import AllCoordinationGeometries from math import factorial import itertools from random import shuffle if __name__ == "__main__": allcg = AllCoordinationGeometries() test = input('Standard ("s", all permutations for cn <= 6, 500 random permutations for cn > 6) or on demand') if test == "s": perms_def = "standard" elif test == "o": perms_def = "on_demand" else: try: nperms = int(test) perms_def = "ndefined" except Exception: perms_def = "on_demand" for coordination in range(1, 13): print("IN COORDINATION {:d}".format(coordination)) symbol_name_mapping = allcg.get_symbol_name_mapping(coordination=coordination) if perms_def == "standard": if coordination > 6: test = "500" else: test = "all" elif perms_def == "ndefined": test = nperms else: test = input( 'Enter if you want to test all possible permutations ("all" or "a") or a given number of random permutations (i.e. "25")' ) myindices = range(coordination) if test == "all" or test == "a": perms_type = "all" perms_iterator = itertools.permutations(myindices) nperms = factorial(coordination) else: perms_type = "explicit" try: nperms = int(test) except Exception: raise ValueError("Could not turn {} into integer ...".format(test)) perms_iterator = [] for ii in range(nperms): shuffle(myindices) perms_iterator.append(list(myindices)) for cg_symbol, cg_name in symbol_name_mapping.items(): cg = allcg[cg_symbol] if cg.deactivate: continue print("Testing {} ({})".format(cg_symbol, cg_name)) cg = allcg[cg_symbol] if cg.points is None: continue lgf = LocalGeometryFinder() lgf.setup_parameters(structure_refinement=lgf.STRUCTURE_REFINEMENT_NONE) # Reinitialize the itertools permutations if perms_type == "all": perms_iterator = itertools.permutations(myindices) # Loop on the permutations iperm = 1 for indices_perm in perms_iterator: lgf.setup_test_perfect_environment( cg_symbol, indices=indices_perm, randomness=True, max_random_dist=0.1, random_translation=True, random_rotation=True, random_scale=True, ) lgf.perfect_geometry = AbstractGeometry.from_cg(cg=cg) points_perfect = lgf.perfect_geometry.points_wocs_ctwocc() print("Perm # {:d}/{:d} : ".format(iperm, nperms), indices_perm) algos_results = [] for algo in cg.algorithms: if algo.algorithm_type == "EXPLICIT_PERMUTATIONS": results = lgf.coordination_geometry_symmetry_measures( coordination_geometry=cg, points_perfect=points_perfect ) # raise ValueError('Do something for the explicit ones ... (these should anyway be by far ok!)') else: results = lgf.coordination_geometry_symmetry_measures_separation_plane( coordination_geometry=cg, separation_plane_algo=algo, points_perfect=points_perfect ) algos_results.append(min(results[0])) if not min(results[0]) < 1.5: print("Following is not close to 0.0 ...") input(results) print(" => ", algos_results) iperm += 1
gmatteo/pymatgen
dev_scripts/chemenv/test_algos_all_geoms.py
Python
mit
4,792
[ "pymatgen" ]
53f1bb00b57477e91cb0adda282c511759d7d317c1eb9eae9eb44faddd8a6ed4
""" This file can be downloaded and used to create a .txt file containing only the accession numbers from the ghost-tree.nwk that you plan to use for your analyses. You must have skbio installed. http://scikit-bio.org/ If you aren't familiar with skbio, make sure to check it out on its own, too! You will then use "ghost_tree_tips.txt" output file containing the accession numbers to filter your .biom table so that it contains only the OTUs that are in the ghost-tree.nwk that you are using. http://qiime.org/scripts/filter_otus_from_otu_table.html Use the required arguments and the following two optional arguments: -e, --otu_ids_to_exclude_fp (provide the text file containing OTU ids to exclude) --negate_ids_to_exclude (this will keep OTUs in otu_ids_to_exclude_fp, rather than discard them) """ from skbio import TreeNode ghosttree = TreeNode.read("ghost_tree_97_80clusters_from_alpha_release.nwk", convert_underscores=False) # your file goes here output = open("ghost_tree_tips_underscore_fix.txt", "w") for node in ghosttree.tips(): output.write(str(node.name)+"\n") output.close()
JTFouquier/ghost-tree
helper_files/get_otus_from_ghost_tree.py
Python
bsd-3-clause
1,130
[ "scikit-bio" ]
477dc4e883bfcc13a062a596a4b65cd030081855fa3c1d8cb1bd3dace5b75671
""" Fourier Aliasing ================ Here, we show that we can view the Fourier transform as an infinitely repeat set of replicates (aliases, *s.t.* :math:`Ш(\nu/t_{dw})*\tilde{f}(\nu)`) and view any of those aliases (of width :math:`SW=1/t_{dw}`) that we choose. """ # from JF noteobok sec:fourier_aliasing_test from pylab import * from pyspecdata import * from pyspecdata.fourier.ft_shift import _get_ft_dt fl = figlist_var() t = r_[-10:10:512j] t -= t[argmin(abs(t))] # to be sure that an index exactly equals zero data = nddata(empty_like(t,dtype = complex128),[-1],['t']).setaxis('t',t) data.set_units('t','s') # set the units to s, which are automatically converted to Hz upon FT sigma = 1.0 data = data.fromaxis('t',lambda x: complex128(exp(-x**2/2./sigma**2))) test_non_integral = False data.ft('t',shift = test_non_integral)# this is required for the non-integral shift! print(data.other_info) print("is it safe?",data.get_ft_prop('t',['freq','not','aliased'])) fl.next('ft') fl.plot(data, alpha=0.5) fl.plot(data.runcopy(imag), alpha=0.5) expand_x() expand_y() print("what is the initial desired startpoint?",data.get_prop("FT_start_time")) # https://matplotlib.org/3.2.1/api/_as_gen/matplotlib.pyplot.plot.html default_plot_kwargs = dict(alpha=0.3, lw=2, mew=2, ms=8, marker='o', ls='none') print("-----------------------") print("starting standard") forplot = data.copy() # keep and re-use the gaussian print("what is the initial desired startpoint?",forplot.get_prop("FT_start_time")) forplot.ift('t') #forplot = forplot['t':(-2,2)] t_start = forplot.getaxis('t')[0] fl.next('ift') fl.plot(forplot,label = '$t_{start}$: standard %0.2fs'%t_start,**default_plot_kwargs) if test_non_integral: fl.next('ift -- non-integral') fl.plot(forplot,label = '$t_{start}$: standard %0.2fs'%t_start,**default_plot_kwargs) #fl.plot(forplot.runcopy(imag),label = 'I: standard',**default_plot_kwargs) dt = diff(forplot.getaxis('t')[r_[0,1]]).item() print("and what is the actual first t index (t_start) after I ift?: ", end=' ') print("t_start is",t_start,"and dt is",dt) symbols = iter(['d','x','s','o']) for this_integer in [2,-250,1000]: print("-----------------------") print("starting integral shift for",this_integer) forplot = data.copy() # keep and re-use the gaussian print("what is the initial desired startpoint?",forplot.get_ft_prop('t',"start_time")) new_startpoint = t_start + this_integer * dt print("now, I try to reset the startpoint to",new_startpoint) print("my dt",dt,"_get_ft_dt",_get_ft_dt(data,'t')) forplot.ft_clear_startpoints('t',t = new_startpoint,f = 'current') print("is it safe?",data.get_ft_prop('t',['freq','not','aliased'])) fl.next('ift') forplot.ift('t') print("And the actual t startpoint after ift? ",forplot.getaxis('t')[0]) print("the difference between the two?",forplot.getaxis('t')[0] - forplot.get_ft_prop('t',"start_time")) default_plot_kwargs['marker'] = next(symbols) fl.plot(forplot,label = '$t_{start}$: shifted by %0.0fpts $\\rightarrow$ %0.2fs'%(this_integer,new_startpoint),**default_plot_kwargs) print("-----------------------") #fl.plot(forplot.runcopy(imag),label = 'I: integral shifted',**default_plot_kwargs) expand_x() expand_y() if test_non_integral: symbols = iter(['d','x','s','o']) for this_float in [0.5,0.25,10.75]: print("-----------------------") print("starting non-integral shift for",this_float) forplot = data.copy() # keep and re-use the gaussian print("what is the initial desired startpoint?",forplot.get_ft_prop('t',"start_time")) print("is it safe?",data.get_ft_prop('t',['freq','not','aliased'])) new_startpoint = t_start + this_float * dt print("now, I try to reset the startpoint to",new_startpoint) forplot.ft_clear_startpoints('t',t = new_startpoint,f = 'current') fl.next('ift -- non-integral') print("is it safe?",data.get_ft_prop('t',['freq','not','aliased'])) forplot.ift('t') print("And the actual t startpoint after ift? ",forplot.getaxis('t')[0]) print("the difference between the two?",forplot.getaxis('t')[0] - forplot.get_ft_prop('t',"start_time")) default_plot_kwargs['marker'] = next(symbols) default_plot_kwargs['markersize'] = 10.0 fl.plot(forplot,label = '$t_{start}$: shifted by %0.0fpts $\\rightarrow$ %0.2fs'%(this_float,new_startpoint),**default_plot_kwargs) #fl.plot(forplot.runcopy(imag),label = 'I: integral shifted',**default_plot_kwargs) #{{{ these are manually set for a nice view of the peak of the gaussian xlim(-1,1) ylim(0.9,1.04) #}}} fl.show('interpolation_test_150824.pdf')
jmfranck/pyspecdata
docs/_downloads/54c91e6b35ea86f52bd26d115eb9b78b/fourier_aliasing.py
Python
bsd-3-clause
4,725
[ "Gaussian" ]
b5308235206e214fa0da7211eae64104974d287ac41ffbe187dd0c9e560d16a1
# (C) British Crown Copyright 2010 - 2017, Met Office # # This file is part of Iris. # # Iris is free software: you can redistribute it and/or modify it under # the terms of the GNU Lesser General Public License as published by the # Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # Iris is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Lesser General Public License for more details. # # You should have received a copy of the GNU Lesser General Public License # along with Iris. If not, see <http://www.gnu.org/licenses/>. from __future__ import (absolute_import, division, print_function) from six.moves import (filter, input, map, range, zip) # noqa import six # import iris tests first so that some things can be initialised before importing anything else import iris.tests as tests import cartopy.crs as ccrs import cf_units import numpy as np import numpy.ma as ma import iris import iris.analysis.cartography import iris.analysis.maths import iris.coord_systems import iris.coords import iris.cube import iris.tests.stock # Run tests in no graphics mode if matplotlib is not available. if tests.MPL_AVAILABLE: import matplotlib import matplotlib.pyplot as plt class TestAnalysisCubeCoordComparison(tests.IrisTest): def assertComparisonDict(self, comparison_dict, reference_filename): string = '' for key in sorted(comparison_dict): coord_groups = comparison_dict[key] string += ('%40s ' % key) names = [[coord.name() if coord is not None else 'None' for coord in coords] for coords in coord_groups] string += str(sorted(names)) string += '\n' self.assertString(string, reference_filename) def test_coord_comparison(self): cube1 = iris.cube.Cube(np.zeros((41, 41))) lonlat_cs = iris.coord_systems.GeogCS(6371229) lon_points1 = -180 + 4.5 * np.arange(41, dtype=np.float32) lat_points = -90 + 4.5 * np.arange(41, dtype=np.float32) cube1.add_dim_coord(iris.coords.DimCoord(lon_points1, 'longitude', units='degrees', coord_system=lonlat_cs), 0) cube1.add_dim_coord(iris.coords.DimCoord(lat_points, 'latitude', units='degrees', coord_system=lonlat_cs), 1) cube1.add_aux_coord(iris.coords.AuxCoord(0, long_name='z')) cube1.add_aux_coord(iris.coords.AuxCoord(['foobar'], long_name='f', units='no_unit')) cube2 = iris.cube.Cube(np.zeros((41, 41, 5))) lonlat_cs = iris.coord_systems.GeogCS(6371229) lon_points2 = -160 + 4.5 * np.arange(41, dtype=np.float32) cube2.add_dim_coord(iris.coords.DimCoord(lon_points2, 'longitude', units='degrees', coord_system=lonlat_cs), 0) cube2.add_dim_coord(iris.coords.DimCoord(lat_points, 'latitude', units='degrees', coord_system=lonlat_cs), 1) cube2.add_dim_coord(iris.coords.DimCoord([5, 7, 9, 11, 13], long_name='z'), 2) cube3 = cube1.copy() lon = cube3.coord("longitude") lat = cube3.coord("latitude") cube3.remove_coord(lon) cube3.remove_coord(lat) cube3.add_dim_coord(lon, 1) cube3.add_dim_coord(lat, 0) cube3.coord('z').points = [20] cube4 = cube2.copy() lon = cube4.coord("longitude") lat = cube4.coord("latitude") cube4.remove_coord(lon) cube4.remove_coord(lat) cube4.add_dim_coord(lon, 1) cube4.add_dim_coord(lat, 0) # Test when coords are the same object lon = cube1.coord('longitude') lat = cube1.coord('latitude') cube5 = iris.cube.Cube(np.zeros((41, 41))) cube5.add_dim_coord(lon, 0) cube5.add_dim_coord(lat, 1) coord_comparison = iris.analysis.coord_comparison self.assertComparisonDict(coord_comparison(cube1, cube1), ('analysis', 'coord_comparison', 'cube1_cube1.txt')) self.assertComparisonDict(coord_comparison(cube1, cube2), ('analysis', 'coord_comparison', 'cube1_cube2.txt')) self.assertComparisonDict(coord_comparison(cube1, cube3), ('analysis', 'coord_comparison', 'cube1_cube3.txt')) self.assertComparisonDict(coord_comparison(cube1, cube4), ('analysis', 'coord_comparison', 'cube1_cube4.txt')) self.assertComparisonDict(coord_comparison(cube1, cube5), ('analysis', 'coord_comparison', 'cube1_cube5.txt')) self.assertComparisonDict(coord_comparison(cube2, cube3), ('analysis', 'coord_comparison', 'cube2_cube3.txt')) self.assertComparisonDict(coord_comparison(cube2, cube4), ('analysis', 'coord_comparison', 'cube2_cube4.txt')) self.assertComparisonDict(coord_comparison(cube2, cube5), ('analysis', 'coord_comparison', 'cube2_cube5.txt')) self.assertComparisonDict(coord_comparison(cube3, cube4), ('analysis', 'coord_comparison', 'cube3_cube4.txt')) self.assertComparisonDict(coord_comparison(cube3, cube5), ('analysis', 'coord_comparison', 'cube3_cube5.txt')) self.assertComparisonDict(coord_comparison(cube4, cube5), ('analysis', 'coord_comparison', 'cube4_cube5.txt')) self.assertComparisonDict(coord_comparison(cube1, cube1, cube1), ('analysis', 'coord_comparison', 'cube1_cube1_cube1.txt')) self.assertComparisonDict(coord_comparison(cube1, cube2, cube1), ('analysis', 'coord_comparison', 'cube1_cube2_cube1.txt')) # get a coord comparison result and check that we are getting back what was expected coord_group = coord_comparison(cube1, cube2)['grouped_coords'][0] self.assertIsInstance(coord_group, iris.analysis._CoordGroup) self.assertIsInstance(list(coord_group)[0], iris.coords.Coord) class TestAnalysisWeights(tests.IrisTest): def test_weighted_mean_little(self): data = np.array([[1, 2, 3], [4, 5, 6], [7, 8, 9]], dtype=np.float32) weights = np.array([[9, 8, 7], [6, 5, 4], [3, 2, 1]], dtype=np.float32) cube = iris.cube.Cube(data, long_name="test_data", units="1") hcs = iris.coord_systems.GeogCS(6371229) lat_coord = iris.coords.DimCoord(np.array([1, 2, 3], dtype=np.float32), long_name="lat", units="1", coord_system=hcs) lon_coord = iris.coords.DimCoord(np.array([1, 2, 3], dtype=np.float32), long_name="lon", units="1", coord_system=hcs) cube.add_dim_coord(lat_coord, 0) cube.add_dim_coord(lon_coord, 1) cube.add_aux_coord(iris.coords.AuxCoord(np.arange(3, dtype=np.float32), long_name="dummy", units=1), 1) self.assertCML(cube, ('analysis', 'weighted_mean_source.cml')) a = cube.collapsed('lat', iris.analysis.MEAN, weights=weights) # np.ma.average doesn't apply type promotion rules in some versions, # and instead makes the result type float64. To ignore that case we # fix up the dtype here if it is promotable from float32. We still want # to catch cases where there is a loss of precision however. if a.dtype > np.float32: cast_data = a.data.astype(np.float32) a.data = cast_data self.assertCMLApproxData(a, ('analysis', 'weighted_mean_lat.cml')) b = cube.collapsed(lon_coord, iris.analysis.MEAN, weights=weights) if b.dtype > np.float32: cast_data = b.data.astype(np.float32) b.data = cast_data b.data = np.asarray(b.data) self.assertCMLApproxData(b, ('analysis', 'weighted_mean_lon.cml')) self.assertEqual(b.coord('dummy').shape, (1, )) # test collapsing multiple coordinates (and the fact that one of the coordinates isn't the same coordinate instance as on the cube) c = cube.collapsed([lat_coord[:], lon_coord], iris.analysis.MEAN, weights=weights) if c.dtype > np.float32: cast_data = c.data.astype(np.float32) c.data = cast_data self.assertCMLApproxData(c, ('analysis', 'weighted_mean_latlon.cml')) self.assertEqual(c.coord('dummy').shape, (1, )) # Check new coord bounds - made from points self.assertArrayEqual(c.coord('lat').bounds, [[1, 3]]) # Check new coord bounds - made from bounds cube.coord('lat').bounds = [[0.5, 1.5], [1.5, 2.5], [2.5, 3.5]] c = cube.collapsed(['lat', 'lon'], iris.analysis.MEAN, weights=weights) self.assertArrayEqual(c.coord('lat').bounds, [[0.5, 3.5]]) cube.coord('lat').bounds = None # Check there was no residual change self.assertCML(cube, ('analysis', 'weighted_mean_source.cml')) @tests.skip_data def test_weighted_mean(self): ### compare with pp_area_avg - which collapses both lat and lon # # pp = ppa('/data/local/dataZoo/PP/simple_pp/global.pp', 0) # print, pp_area(pp, /box) # print, pp_area_avg(pp, /box) #287.927 # ;gives an answer of 287.927 # ### e = iris.tests.stock.simple_pp() self.assertCML(e, ('analysis', 'weighted_mean_original.cml')) e.coord('latitude').guess_bounds() e.coord('longitude').guess_bounds() area_weights = iris.analysis.cartography.area_weights(e) e.coord('latitude').bounds = None e.coord('longitude').bounds = None f, collapsed_area_weights = e.collapsed('latitude', iris.analysis.MEAN, weights=area_weights, returned=True) g = f.collapsed('longitude', iris.analysis.MEAN, weights=collapsed_area_weights) # check it's a 0d, scalar cube self.assertEqual(g.shape, ()) # check the value - pp_area_avg's result of 287.927 differs by factor of 1.00002959 np.testing.assert_approx_equal(g.data, 287.935, significant=5) #check we get summed weights even if we don't give any h, summed_weights = e.collapsed('latitude', iris.analysis.MEAN, returned=True) assert(summed_weights is not None) # Check there was no residual change e.coord('latitude').bounds = None e.coord('longitude').bounds = None self.assertCML(e, ('analysis', 'weighted_mean_original.cml')) # Test collapsing of missing coord self.assertRaises(iris.exceptions.CoordinateNotFoundError, e.collapsed, 'platitude', iris.analysis.MEAN) # Test collpasing of non data coord self.assertRaises(iris.exceptions.CoordinateCollapseError, e.collapsed, 'pressure', iris.analysis.MEAN) @tests.skip_data class TestAnalysisBasic(tests.IrisTest): def setUp(self): file = tests.get_data_path(('PP', 'aPProt1', 'rotatedMHtimecube.pp')) cubes = iris.load(file) self.cube = cubes[0] self.assertCML(self.cube, ('analysis', 'original.cml')) def _common(self, name, aggregate, original_name='original_common.cml', *args, **kwargs): self.cube.data = self.cube.data.astype(np.float64) self.assertCML(self.cube, ('analysis', original_name)) a = self.cube.collapsed('grid_latitude', aggregate) self.assertCMLApproxData(a, ('analysis', '%s_latitude.cml' % name), *args, **kwargs) b = a.collapsed('grid_longitude', aggregate) self.assertCMLApproxData(b, ('analysis', '%s_latitude_longitude.cml' % name), *args, **kwargs) c = self.cube.collapsed(['grid_latitude', 'grid_longitude'], aggregate) self.assertCMLApproxData(c, ('analysis', '%s_latitude_longitude_1call.cml' % name), *args, **kwargs) # Check there was no residual change self.assertCML(self.cube, ('analysis', original_name)) def test_mean(self): self._common('mean', iris.analysis.MEAN, rtol=1e-05) def test_std_dev(self): # as the numbers are so high, trim off some trailing digits & compare to 0dp self._common('std_dev', iris.analysis.STD_DEV, rtol=1e-05) def test_hmean(self): # harmonic mean requires data > 0 self.cube.data *= self.cube.data self._common('hmean', iris.analysis.HMEAN, 'original_hmean.cml', rtol=1e-05) def test_gmean(self): self._common('gmean', iris.analysis.GMEAN, rtol=1e-05) def test_variance(self): # as the numbers are so high, trim off some trailing digits & compare to 0dp self._common('variance', iris.analysis.VARIANCE, rtol=1e-05) def test_median(self): self._common('median', iris.analysis.MEDIAN) def test_sum(self): # as the numbers are so high, trim off some trailing digits & compare to 0dp self._common('sum', iris.analysis.SUM, rtol=1e-05) def test_max(self): self._common('max', iris.analysis.MAX) def test_min(self): self._common('min', iris.analysis.MIN) def test_rms(self): self._common('rms', iris.analysis.RMS) def test_duplicate_coords(self): self.assertRaises(ValueError, tests.stock.track_1d, duplicate_x=True) class TestMissingData(tests.IrisTest): def setUp(self): self.cube_with_nan = tests.stock.simple_2d() data = self.cube_with_nan.data.astype(np.float32) self.cube_with_nan.data = data.copy() self.cube_with_nan.data[1, 0] = np.nan self.cube_with_nan.data[2, 2] = np.nan self.cube_with_nan.data[2, 3] = np.nan self.cube_with_mask = tests.stock.simple_2d() self.cube_with_mask.data = ma.array(self.cube_with_nan.data, mask=np.isnan(self.cube_with_nan.data)) def test_max(self): cube = self.cube_with_nan.collapsed('foo', iris.analysis.MAX) np.testing.assert_array_equal(cube.data, np.array([3, np.nan, np.nan])) cube = self.cube_with_mask.collapsed('foo', iris.analysis.MAX) np.testing.assert_array_equal(cube.data, np.array([3, 7, 9])) def test_min(self): cube = self.cube_with_nan.collapsed('foo', iris.analysis.MIN) np.testing.assert_array_equal(cube.data, np.array([0, np.nan, np.nan])) cube = self.cube_with_mask.collapsed('foo', iris.analysis.MIN) np.testing.assert_array_equal(cube.data, np.array([0, 5, 8])) def test_sum(self): cube = self.cube_with_nan.collapsed('foo', iris.analysis.SUM) np.testing.assert_array_equal(cube.data, np.array([6, np.nan, np.nan])) cube = self.cube_with_mask.collapsed('foo', iris.analysis.SUM) np.testing.assert_array_equal(cube.data, np.array([6, 18, 17])) class TestAggregator_mdtol_keyword(tests.IrisTest): def setUp(self): data = ma.array([[1, 2], [4, 5]], dtype=np.float32, mask=[[False, True], [False, True]]) cube = iris.cube.Cube(data, long_name="test_data", units="1") lat_coord = iris.coords.DimCoord(np.array([1, 2], dtype=np.float32), long_name="lat", units="1") lon_coord = iris.coords.DimCoord(np.array([3, 4], dtype=np.float32), long_name="lon", units="1") cube.add_dim_coord(lat_coord, 0) cube.add_dim_coord(lon_coord, 1) self.cube = cube def test_single_coord_no_mdtol(self): collapsed = self.cube.collapsed( self.cube.coord('lat'), iris.analysis.MEAN) t = ma.array([2.5, 5.], mask=[False, True]) self.assertMaskedArrayEqual(collapsed.data, t) def test_single_coord_mdtol(self): self.cube.data.mask = np.array([[False, True], [False, False]]) collapsed = self.cube.collapsed( self.cube.coord('lat'), iris.analysis.MEAN, mdtol=0.5) t = ma.array([2.5, 5], mask=[False, False]) self.assertMaskedArrayEqual(collapsed.data, t) def test_single_coord_mdtol_alt(self): self.cube.data.mask = np.array([[False, True], [False, False]]) collapsed = self.cube.collapsed( self.cube.coord('lat'), iris.analysis.MEAN, mdtol=0.4) t = ma.array([2.5, 5], mask=[False, True]) self.assertMaskedArrayEqual(collapsed.data, t) def test_multi_coord_no_mdtol(self): collapsed = self.cube.collapsed( [self.cube.coord('lat'), self.cube.coord('lon')], iris.analysis.MEAN) t = np.array(2.5) self.assertArrayEqual(collapsed.data, t) def test_multi_coord_mdtol(self): collapsed = self.cube.collapsed( [self.cube.coord('lat'), self.cube.coord('lon')], iris.analysis.MEAN, mdtol=0.4) t = ma.array(2.5, mask=True) self.assertMaskedArrayEqual(collapsed.data, t) class TestAggregators(tests.IrisTest): def _check_collapsed_percentile(self, cube, percents, collapse_coord, expected_result, CML_filename=None, **kwargs): expected_result = np.array(expected_result, dtype=np.float32) result = cube.collapsed(collapse_coord, iris.analysis.PERCENTILE, percent=percents, **kwargs) np.testing.assert_array_almost_equal(result.data, expected_result) if CML_filename is not None: self.assertCML(result, ('analysis', CML_filename), checksum=False) def _check_percentile(self, data, axis, percents, expected_result, **kwargs): result = iris.analysis._percentile(data, axis, percents, **kwargs) np.testing.assert_array_almost_equal(result, expected_result) def test_percentile_1d_25_percent(self): cube = tests.stock.simple_1d() self._check_collapsed_percentile( cube, 25, 'foo', 2.5, CML_filename='first_quartile_foo_1d.cml') def test_percentile_1d_75_percent(self): cube = tests.stock.simple_1d() self._check_collapsed_percentile( cube, 75, 'foo', 7.5, CML_filename='third_quartile_foo_1d.cml') def test_fast_percentile_1d_25_percent(self): cube = tests.stock.simple_1d() self._check_collapsed_percentile( cube, 25, 'foo', 2.5, fast_percentile_method=True, CML_filename='first_quartile_foo_1d_fast_percentile.cml') def test_fast_percentile_1d_75_percent(self): cube = tests.stock.simple_1d() self._check_collapsed_percentile( cube, 75, 'foo', 7.5, fast_percentile_method=True, CML_filename='third_quartile_foo_1d_fast_percentile.cml') def test_percentile_2d_single_coord(self): cube = tests.stock.simple_2d() self._check_collapsed_percentile( cube, 25, 'foo', [0.75, 4.75, 8.75], CML_filename='first_quartile_foo_2d.cml') def test_percentile_2d_two_coords(self): cube = tests.stock.simple_2d() self._check_collapsed_percentile( cube, 25, ['foo', 'bar'], [2.75], CML_filename='first_quartile_foo_bar_2d.cml') def test_fast_percentile_2d_single_coord(self): cube = tests.stock.simple_2d() self._check_collapsed_percentile( cube, 25, 'foo', [0.75, 4.75, 8.75], fast_percentile_method=True, CML_filename='first_quartile_foo_2d_fast_percentile.cml') def test_fast_percentile_2d_two_coords(self): cube = tests.stock.simple_2d() self._check_collapsed_percentile( cube, 25, ['foo', 'bar'], [2.75], fast_percentile_method=True, CML_filename='first_quartile_foo_bar_2d_fast_percentile.cml') def test_percentile_3d(self): array_3d = np.arange(24, dtype=np.int32).reshape((2, 3, 4)) expected_result = np.array([[6., 7., 8., 9.], [10., 11., 12., 13.], [14., 15., 16., 17.]], dtype=np.float32) self._check_percentile(array_3d, 0, 50, expected_result) def test_fast_percentile_3d(self): array_3d = np.arange(24, dtype=np.int32).reshape((2, 3, 4)) expected_result = np.array([[6., 7., 8., 9.], [10., 11., 12., 13.], [14., 15., 16., 17.]], dtype=np.float32) self._check_percentile(array_3d, 0, 50, expected_result, fast_percentile_method=True) def test_percentile_3d_axis_one(self): array_3d = np.arange(24, dtype=np.int32).reshape((2, 3, 4)) expected_result = np.array([[4., 5., 6., 7.], [16., 17., 18., 19.]], dtype=np.float32) self._check_percentile(array_3d, 1, 50, expected_result) def test_fast_percentile_3d_axis_one(self): array_3d = np.arange(24, dtype=np.int32).reshape((2, 3, 4)) expected_result = np.array([[4., 5., 6., 7.], [16., 17., 18., 19.]], dtype=np.float32) self._check_percentile(array_3d, 1, 50, expected_result, fast_percentile_method=True) def test_percentile_3d_axis_two(self): array_3d = np.arange(24, dtype=np.int32).reshape((2, 3, 4)) expected_result = np.array([[1.5, 5.5, 9.5], [13.5, 17.5, 21.5]], dtype=np.float32) self._check_percentile(array_3d, 2, 50, expected_result) def test_fast_percentile_3d_axis_two(self): array_3d = np.arange(24, dtype=np.int32).reshape((2, 3, 4)) expected_result = np.array([[1.5, 5.5, 9.5], [13.5, 17.5, 21.5]], dtype=np.float32) self._check_percentile(array_3d, 2, 50, expected_result, fast_percentile_method=True) def test_percentile_3d_masked(self): cube = tests.stock.simple_3d_mask() expected_result = [[12., 13., 14., 15.], [16., 17., 18., 19.], [20., 18., 19., 20.]] self._check_collapsed_percentile( cube, 75, 'wibble', expected_result, CML_filename='last_quartile_foo_3d_masked.cml') def test_fast_percentile_3d_masked(self): cube = tests.stock.simple_3d_mask() msg = 'Cannot use fast np.percentile method with masked array.' with self.assertRaisesRegexp(TypeError, msg): cube.collapsed('wibble', iris.analysis.PERCENTILE, percent=75, fast_percentile_method=True) def test_percentile_3d_notmasked(self): cube = tests.stock.simple_3d() expected_result = [[9., 10., 11., 12.], [13., 14., 15., 16.], [17., 18., 19., 20.]] self._check_collapsed_percentile( cube, 75, 'wibble', expected_result, CML_filename='last_quartile_foo_3d_notmasked.cml') def test_fast_percentile_3d_notmasked(self): cube = tests.stock.simple_3d() expected_result = [[9., 10., 11., 12.], [13., 14., 15., 16.], [17., 18., 19., 20.]] self._check_collapsed_percentile( cube, 75, 'wibble', expected_result, fast_percentile_method=True, CML_filename='last_quartile_foo_3d_notmasked_fast_percentile.cml') def test_proportion(self): cube = tests.stock.simple_1d() r = cube.data >= 5 gt5 = cube.collapsed('foo', iris.analysis.PROPORTION, function=lambda val: val >= 5) np.testing.assert_array_almost_equal(gt5.data, np.array([6 / 11.])) self.assertCML(gt5, ('analysis', 'proportion_foo_1d.cml'), checksum=False) def test_proportion_2d(self): cube = tests.stock.simple_2d() gt6 = cube.collapsed('foo', iris.analysis.PROPORTION, function=lambda val: val >= 6) np.testing.assert_array_almost_equal(gt6.data, np.array([0, 0.5, 1], dtype=np.float32)) self.assertCML(gt6, ('analysis', 'proportion_foo_2d.cml'), checksum=False) gt6 = cube.collapsed('bar', iris.analysis.PROPORTION, function=lambda val: val >= 6) np.testing.assert_array_almost_equal(gt6.data, np.array([1 / 3, 1 / 3, 2 / 3, 2 / 3], dtype=np.float32)) self.assertCML(gt6, ('analysis', 'proportion_bar_2d.cml'), checksum=False) gt6 = cube.collapsed(('foo', 'bar'), iris.analysis.PROPORTION, function=lambda val: val >= 6) np.testing.assert_array_almost_equal(gt6.data, np.array([0.5], dtype=np.float32)) self.assertCML(gt6, ('analysis', 'proportion_foo_bar_2d.cml'), checksum=False) # mask the data cube.data = ma.array(cube.data, mask=cube.data % 2) cube.data.mask[1, 2] = True gt6_masked = cube.collapsed('bar', iris.analysis.PROPORTION, function=lambda val: val >= 6) np.testing.assert_array_almost_equal(gt6_masked.data, ma.array([1 / 3, None, 1 / 2, None], mask=[False, True, False, True], dtype=np.float32)) self.assertCML(gt6_masked, ('analysis', 'proportion_foo_2d_masked.cml'), checksum=False) def test_count(self): cube = tests.stock.simple_1d() gt5 = cube.collapsed('foo', iris.analysis.COUNT, function=lambda val: val >= 5) np.testing.assert_array_almost_equal(gt5.data, np.array([6])) gt5.data = gt5.data.astype('i8') self.assertCML(gt5, ('analysis', 'count_foo_1d.cml'), checksum=False) def test_count_2d(self): cube = tests.stock.simple_2d() gt6 = cube.collapsed('foo', iris.analysis.COUNT, function=lambda val: val >= 6) np.testing.assert_array_almost_equal(gt6.data, np.array([0, 2, 4], dtype=np.float32)) gt6.data = gt6.data.astype('i8') self.assertCML(gt6, ('analysis', 'count_foo_2d.cml'), checksum=False) gt6 = cube.collapsed('bar', iris.analysis.COUNT, function=lambda val: val >= 6) np.testing.assert_array_almost_equal(gt6.data, np.array([1, 1, 2, 2], dtype=np.float32)) gt6.data = gt6.data.astype('i8') self.assertCML(gt6, ('analysis', 'count_bar_2d.cml'), checksum=False) gt6 = cube.collapsed(('foo', 'bar'), iris.analysis.COUNT, function=lambda val: val >= 6) np.testing.assert_array_almost_equal(gt6.data, np.array([6], dtype=np.float32)) gt6.data = gt6.data.astype('i8') self.assertCML(gt6, ('analysis', 'count_foo_bar_2d.cml'), checksum=False) def test_weighted_sum_consistency(self): # weighted sum with unit weights should be the same as a sum cube = tests.stock.simple_1d() normal_sum = cube.collapsed('foo', iris.analysis.SUM) weights = np.ones_like(cube.data) weighted_sum = cube.collapsed('foo', iris.analysis.SUM, weights=weights) self.assertArrayAlmostEqual(normal_sum.data, weighted_sum.data) def test_weighted_sum_1d(self): # verify 1d weighted sum is correct cube = tests.stock.simple_1d() weights = np.array([.05, .05, .1, .1, .2, .3, .2, .1, .1, .05, .05]) result = cube.collapsed('foo', iris.analysis.SUM, weights=weights) self.assertAlmostEqual(result.data, 6.5) self.assertCML(result, ('analysis', 'sum_weighted_1d.cml'), checksum=False) def test_weighted_sum_2d(self): # verify 2d weighted sum is correct cube = tests.stock.simple_2d() weights = np.array([.3, .4, .3]) weights = iris.util.broadcast_to_shape(weights, cube.shape, [0]) result = cube.collapsed('bar', iris.analysis.SUM, weights=weights) self.assertArrayAlmostEqual(result.data, np.array([4., 5., 6., 7.])) self.assertCML(result, ('analysis', 'sum_weighted_2d.cml'), checksum=False) def test_weighted_rms(self): cube = tests.stock.simple_2d() # modify cube data so that the results are nice numbers cube.data = np.array([[4, 7, 10, 8], [21, 30, 12, 24], [14, 16, 20, 8]], dtype=np.float64) weights = np.array([[1, 4, 3, 2], [6, 4.5, 1.5, 3], [2, 1, 1.5, 0.5]], dtype=np.float64) expected_result = np.array([8.0, 24.0, 16.0]) result = cube.collapsed('foo', iris.analysis.RMS, weights=weights) self.assertArrayAlmostEqual(result.data, expected_result) self.assertCML(result, ('analysis', 'rms_weighted_2d.cml'), checksum=False) @tests.skip_data class TestRotatedPole(tests.IrisTest): def _check_both_conversions(self, cube, index): rlons, rlats = iris.analysis.cartography.get_xy_grids(cube) rcs = cube.coord_system('RotatedGeogCS') x, y = iris.analysis.cartography.unrotate_pole( rlons, rlats, rcs.grid_north_pole_longitude, rcs.grid_north_pole_latitude) self.assertDataAlmostEqual(x, ('analysis', 'rotated_pole.{}.x.json'.format(index))) self.assertDataAlmostEqual(y, ('analysis', 'rotated_pole.{}.y.json'.format(index))) self.assertDataAlmostEqual(rlons, ('analysis', 'rotated_pole.{}.rlon.json'.format(index))) self.assertDataAlmostEqual(rlats, ('analysis', 'rotated_pole.{}.rlat.json'.format(index))) def test_all(self): path = tests.get_data_path(('PP', 'ukVorog', 'ukv_orog_refonly.pp')) master_cube = iris.load_cube(path) # Check overall behaviour. cube = master_cube[::10, ::10] self._check_both_conversions(cube, 0) # Check numerical stability. cube = master_cube[210:238, 424:450] self._check_both_conversions(cube, 1) def test_unrotate_nd(self): rlons = np.array([[350., 352.], [350., 352.]]) rlats = np.array([[-5., -0.], [-4., -1.]]) resx, resy = iris.analysis.cartography.unrotate_pole(rlons, rlats, 178.0, 38.0) # Solutions derived by proj4 direct. solx = np.array([[-16.42176094, -14.85892262], [-16.71055023, -14.58434624]]) soly = np.array([[ 46.00724251, 51.29188893], [ 46.98728486, 50.30706042]]) self.assertArrayAlmostEqual(resx, solx) self.assertArrayAlmostEqual(resy, soly) def test_unrotate_1d(self): rlons = np.array([350., 352., 354., 356.]) rlats = np.array([-5., -0., 5., 10.]) resx, resy = iris.analysis.cartography.unrotate_pole( rlons.flatten(), rlats.flatten(), 178.0, 38.0) # Solutions derived by proj4 direct. solx = np.array([-16.42176094, -14.85892262, -12.88946157, -10.35078336]) soly = np.array([46.00724251, 51.29188893, 56.55031485, 61.77015703]) self.assertArrayAlmostEqual(resx, solx) self.assertArrayAlmostEqual(resy, soly) def test_rotate_nd(self): rlons = np.array([[350., 351.], [352., 353.]]) rlats = np.array([[10., 15.], [20., 25.]]) resx, resy = iris.analysis.cartography.rotate_pole(rlons, rlats, 20., 80.) # Solutions derived by proj4 direct. solx = np.array([[148.69672569, 149.24727087], [149.79067025, 150.31754368]]) soly = np.array([[18.60905789, 23.67749384], [28.74419024, 33.8087963 ]]) self.assertArrayAlmostEqual(resx, solx) self.assertArrayAlmostEqual(resy, soly) def test_rotate_1d(self): rlons = np.array([350., 351., 352., 353.]) rlats = np.array([10., 15., 20., 25.]) resx, resy = iris.analysis.cartography.rotate_pole(rlons.flatten(), rlats.flatten(), 20., 80.) # Solutions derived by proj4 direct. solx = np.array([148.69672569, 149.24727087, 149.79067025, 150.31754368]) soly = np.array([18.60905789, 23.67749384, 28.74419024, 33.8087963 ]) self.assertArrayAlmostEqual(resx, solx) self.assertArrayAlmostEqual(resy, soly) @tests.skip_data class TestAreaWeights(tests.IrisTest): def test_area_weights(self): small_cube = iris.tests.stock.simple_pp() # Get offset, subsampled region: small enough to test against literals small_cube = small_cube[10:, 35:] small_cube = small_cube[::8, ::8] small_cube = small_cube[:5, :4] # pre-check non-data properties self.assertCML(small_cube, ('analysis', 'areaweights_original.cml'), checksum=False) # check area-weights values small_cube.coord('latitude').guess_bounds() small_cube.coord('longitude').guess_bounds() area_weights = iris.analysis.cartography.area_weights(small_cube) expected_results = np.array( [[3.11955866e+12, 3.11956008e+12, 3.11955866e+12, 3.11956008e+12], [5.21951065e+12, 5.21951303e+12, 5.21951065e+12, 5.21951303e+12], [6.68991281e+12, 6.68991585e+12, 6.68991281e+12, 6.68991585e+12], [7.35341305e+12, 7.35341640e+12, 7.35341305e+12, 7.35341640e+12], [7.12998335e+12, 7.12998660e+12, 7.12998335e+12, 7.12998660e+12]], dtype=np.float64) self.assertArrayAllClose(area_weights, expected_results, rtol=1e-8) # Check there was no residual change small_cube.coord('latitude').bounds = None small_cube.coord('longitude').bounds = None self.assertCML(small_cube, ('analysis', 'areaweights_original.cml'), checksum=False) @tests.skip_data class TestAreaWeightGeneration(tests.IrisTest): def setUp(self): self.cube = iris.tests.stock.realistic_4d() def test_area_weights_std(self): # weights for stock 4d data weights = iris.analysis.cartography.area_weights(self.cube) self.assertEqual(weights.shape, self.cube.shape) def test_area_weights_order(self): # weights for data with dimensions in a different order order = [3, 2, 1, 0] # (lon, lat, level, time) self.cube.transpose(order) weights = iris.analysis.cartography.area_weights(self.cube) self.assertEqual(weights.shape, self.cube.shape) def test_area_weights_non_adjacent(self): # weights for cube with non-adjacent latitude/longitude dimensions order = [0, 3, 1, 2] # (time, lon, level, lat) self.cube.transpose(order) weights = iris.analysis.cartography.area_weights(self.cube) self.assertEqual(weights.shape, self.cube.shape) def test_area_weights_scalar_latitude(self): # weights for cube with a scalar latitude dimension cube = self.cube[:, :, 0, :] weights = iris.analysis.cartography.area_weights(cube) self.assertEqual(weights.shape, cube.shape) def test_area_weights_scalar_longitude(self): # weights for cube with a scalar longitude dimension cube = self.cube[:, :, :, 0] weights = iris.analysis.cartography.area_weights(cube) self.assertEqual(weights.shape, cube.shape) def test_area_weights_scalar(self): # weights for cube with scalar latitude and longitude dimensions cube = self.cube[:, :, 0, 0] weights = iris.analysis.cartography.area_weights(cube) self.assertEqual(weights.shape, cube.shape) def test_area_weights_singleton_latitude(self): # singleton (1-point) latitude dimension cube = self.cube[:, :, 0:1, :] weights = iris.analysis.cartography.area_weights(cube) self.assertEqual(weights.shape, cube.shape) def test_area_weights_singleton_longitude(self): # singleton (1-point) longitude dimension cube = self.cube[:, :, :, 0:1] weights = iris.analysis.cartography.area_weights(cube) self.assertEqual(weights.shape, cube.shape) def test_area_weights_singletons(self): # singleton (1-point) latitude and longitude dimensions cube = self.cube[:, :, 0:1, 0:1] weights = iris.analysis.cartography.area_weights(cube) self.assertEqual(weights.shape, cube.shape) def test_area_weights_normalized(self): # normalized area weights must sum to one over lat/lon dimensions. weights = iris.analysis.cartography.area_weights(self.cube, normalize=True) sumweights = weights.sum(axis=3).sum(axis=2) # sum over lon and lat self.assertArrayAlmostEqual(sumweights, 1) def test_area_weights_non_contiguous(self): # Slice the cube so that we have non-contiguous longitude # bounds. ind = (0, 1, 2, -3, -2, -1) cube = self.cube[..., ind] weights = iris.analysis.cartography.area_weights(cube) expected = iris.analysis.cartography.area_weights(self.cube)[..., ind] self.assertArrayEqual(weights, expected) def test_area_weights_no_lon_bounds(self): self.cube.coord('grid_longitude').bounds = None with self.assertRaises(ValueError): iris.analysis.cartography.area_weights(self.cube) def test_area_weights_no_lat_bounds(self): self.cube.coord('grid_latitude').bounds = None with self.assertRaises(ValueError): iris.analysis.cartography.area_weights(self.cube) @tests.skip_data class TestLatitudeWeightGeneration(tests.IrisTest): def setUp(self): path = iris.tests.get_data_path(['NetCDF', 'rotated', 'xyt', 'small_rotPole_precipitation.nc']) self.cube = iris.load_cube(path) self.cube_dim_lat = self.cube.copy() self.cube_dim_lat.remove_coord('latitude') self.cube_dim_lat.remove_coord('longitude') # The 2d cubes are unrealistic, you would not want to weight by # anything other than grid latitude in real-world scenarios. However, # the technical details are suitable for testing purposes, providing # a nice analog for a 2d latitude coordinate from a curvilinear grid. self.cube_aux_lat = self.cube.copy() self.cube_aux_lat.remove_coord('grid_latitude') self.cube_aux_lat.remove_coord('grid_longitude') self.lat1d = self.cube.coord('grid_latitude').points self.lat2d = self.cube.coord('latitude').points def test_cosine_latitude_weights_range(self): # check the range of returned values, needs a cube that spans the full # latitude range lat_coord = iris.coords.DimCoord(np.linspace(-90, 90, 73), standard_name='latitude', units=cf_units.Unit('degrees_north')) cube = iris.cube.Cube(np.ones([73], dtype=np.float64), long_name='test_cube', units='1') cube.add_dim_coord(lat_coord, 0) weights = iris.analysis.cartography.cosine_latitude_weights(cube) self.assertTrue(weights.max() <= 1) self.assertTrue(weights.min() >= 0) def test_cosine_latitude_weights_0d(self): # 0d latitude dimension (scalar coordinate) weights = iris.analysis.cartography.cosine_latitude_weights( self.cube_dim_lat[:, 0, :]) self.assertEqual(weights.shape, self.cube_dim_lat[:, 0, :].shape) self.assertAlmostEqual(weights[0, 0], np.cos(np.deg2rad(self.lat1d[0]))) def test_cosine_latitude_weights_1d_singleton(self): # singleton (1-point) 1d latitude coordinate (time, lat, lon) cube = self.cube_dim_lat[:, 0:1, :] weights = iris.analysis.cartography.cosine_latitude_weights(cube) self.assertEqual(weights.shape, cube.shape) self.assertAlmostEqual(weights[0, 0, 0], np.cos(np.deg2rad(self.lat1d[0]))) def test_cosine_latitude_weights_1d(self): # 1d latitude coordinate (time, lat, lon) weights = iris.analysis.cartography.cosine_latitude_weights( self.cube_dim_lat) self.assertEqual(weights.shape, self.cube.shape) self.assertArrayAlmostEqual(weights[0, :, 0], np.cos(np.deg2rad(self.lat1d))) def test_cosine_latitude_weights_1d_latitude_first(self): # 1d latitude coordinate with latitude first (lat, time, lon) order = [1, 0, 2] # (lat, time, lon) self.cube_dim_lat.transpose(order) weights = iris.analysis.cartography.cosine_latitude_weights( self.cube_dim_lat) self.assertEqual(weights.shape, self.cube_dim_lat.shape) self.assertArrayAlmostEqual(weights[:, 0, 0], np.cos(np.deg2rad(self.lat1d))) def test_cosine_latitude_weights_1d_latitude_last(self): # 1d latitude coordinate with latitude last (time, lon, lat) order = [0, 2, 1] # (time, lon, lat) self.cube_dim_lat.transpose(order) weights = iris.analysis.cartography.cosine_latitude_weights( self.cube_dim_lat) self.assertEqual(weights.shape, self.cube_dim_lat.shape) self.assertArrayAlmostEqual(weights[0, 0, :], np.cos(np.deg2rad(self.lat1d))) def test_cosine_latitude_weights_2d_singleton1(self): # 2d latitude coordinate with first dimension singleton cube = self.cube_aux_lat[:, 0:1, :] weights = iris.analysis.cartography.cosine_latitude_weights(cube) self.assertEqual(weights.shape, cube.shape) self.assertArrayAlmostEqual(weights[0, :, :], np.cos(np.deg2rad(self.lat2d[0:1, :]))) def test_cosine_latitude_weights_2d_singleton2(self): # 2d latitude coordinate with second dimension singleton cube = self.cube_aux_lat[:, :, 0:1] weights = iris.analysis.cartography.cosine_latitude_weights(cube) self.assertEqual(weights.shape, cube.shape) self.assertArrayAlmostEqual(weights[0, :, :], np.cos(np.deg2rad(self.lat2d[:, 0:1]))) def test_cosine_latitude_weights_2d_singleton3(self): # 2d latitude coordinate with both dimensions singleton cube = self.cube_aux_lat[:, 0:1, 0:1] weights = iris.analysis.cartography.cosine_latitude_weights(cube) self.assertEqual(weights.shape, cube.shape) self.assertArrayAlmostEqual(weights[0, :, :], np.cos(np.deg2rad(self.lat2d[0:1, 0:1]))) def test_cosine_latitude_weights_2d(self): # 2d latitude coordinate (time, lat, lon) weights = iris.analysis.cartography.cosine_latitude_weights( self.cube_aux_lat) self.assertEqual(weights.shape, self.cube_aux_lat.shape) self.assertArrayAlmostEqual(weights[0, :, :], np.cos(np.deg2rad(self.lat2d))) def test_cosine_latitude_weights_2d_latitude_first(self): # 2d latitude coordinate with latitude first (lat, time, lon) order = [1, 0, 2] # (lat, time, lon) self.cube_aux_lat.transpose(order) weights = iris.analysis.cartography.cosine_latitude_weights( self.cube_aux_lat) self.assertEqual(weights.shape, self.cube_aux_lat.shape) self.assertArrayAlmostEqual(weights[:, 0, :], np.cos(np.deg2rad(self.lat2d))) def test_cosine_latitude_weights_2d_latitude_last(self): # 2d latitude coordinate with latitude last (time, lon, lat) order = [0, 2, 1] # (time, lon, lat) self.cube_aux_lat.transpose(order) weights = iris.analysis.cartography.cosine_latitude_weights( self.cube_aux_lat) self.assertEqual(weights.shape, self.cube_aux_lat.shape) self.assertArrayAlmostEqual(weights[0, :, :], np.cos(np.deg2rad(self.lat2d.T))) def test_cosine_latitude_weights_no_latitude(self): # no coordinate identified as latitude self.cube_dim_lat.remove_coord('grid_latitude') with self.assertRaises(ValueError): weights = iris.analysis.cartography.cosine_latitude_weights( self.cube_dim_lat) def test_cosine_latitude_weights_multiple_latitude(self): # two coordinates identified as latitude with self.assertRaises(ValueError): weights = iris.analysis.cartography.cosine_latitude_weights( self.cube) class TestRollingWindow(tests.IrisTest): def setUp(self): # XXX Comes from test_aggregated_by cube = iris.cube.Cube(np.array([[6, 10, 12, 18], [8, 12, 14, 20], [18, 12, 10, 6]]), long_name='temperature', units='kelvin') cube.add_dim_coord(iris.coords.DimCoord(np.array([0, 5, 10], dtype=np.float64), 'latitude', units='degrees'), 0) cube.add_dim_coord(iris.coords.DimCoord(np.array([0, 2, 4, 6], dtype=np.float64), 'longitude', units='degrees'), 1) self.cube = cube def test_non_mean_operator(self): res_cube = self.cube.rolling_window('longitude', iris.analysis.MAX, window=2) expected_result = np.array([[10, 12, 18], [12, 14, 20], [18, 12, 10]], dtype=np.float64) self.assertArrayEqual(expected_result, res_cube.data) def test_longitude_simple(self): res_cube = self.cube.rolling_window('longitude', iris.analysis.MEAN, window=2) expected_result = np.array([[ 8., 11., 15.], [ 10., 13., 17.], [ 15., 11., 8.]], dtype=np.float64) self.assertArrayEqual(expected_result, res_cube.data) self.assertCML(res_cube, ('analysis', 'rolling_window', 'simple_longitude.cml')) self.assertRaises(ValueError, self.cube.rolling_window, 'longitude', iris.analysis.MEAN, window=0) def test_longitude_masked(self): self.cube.data = ma.array(self.cube.data, mask=[[True, True, True, True], [True, False, True, True], [False, False, False, False]]) res_cube = self.cube.rolling_window('longitude', iris.analysis.MEAN, window=2) expected_result = np.ma.array([[-99., -99., -99.], [12., 12., -99.], [15., 11., 8.]], mask=[[True, True, True], [False, False, True], [False, False, False]], dtype=np.float64) self.assertMaskedArrayEqual(expected_result, res_cube.data) def test_longitude_circular(self): cube = self.cube cube.coord('longitude').circular = True self.assertRaises(iris.exceptions.NotYetImplementedError, self.cube.rolling_window, 'longitude', iris.analysis.MEAN, window=0) def test_different_length_windows(self): res_cube = self.cube.rolling_window('longitude', iris.analysis.MEAN, window=4) expected_result = np.array([[ 11.5], [ 13.5], [ 11.5]], dtype=np.float64) self.assertArrayEqual(expected_result, res_cube.data) self.assertCML(res_cube, ('analysis', 'rolling_window', 'size_4_longitude.cml')) # Window too long: self.assertRaises(ValueError, self.cube.rolling_window, 'longitude', iris.analysis.MEAN, window=6) # Window too small: self.assertRaises(ValueError, self.cube.rolling_window, 'longitude', iris.analysis.MEAN, window=0) def test_bad_coordinate(self): self.assertRaises(KeyError, self.cube.rolling_window, 'wibble', iris.analysis.MEAN, window=0) def test_latitude_simple(self): res_cube = self.cube.rolling_window('latitude', iris.analysis.MEAN, window=2) expected_result = np.array([[ 7., 11., 13., 19.], [ 13., 12., 12., 13.]], dtype=np.float64) self.assertArrayEqual(expected_result, res_cube.data) self.assertCML(res_cube, ('analysis', 'rolling_window', 'simple_latitude.cml')) def test_mean_with_weights_consistency(self): # equal weights should be the same as the mean with no weights wts = np.array([0.5, 0.5], dtype=np.float64) res_cube = self.cube.rolling_window('longitude', iris.analysis.MEAN, window=2, weights=wts) expected_result = self.cube.rolling_window('longitude', iris.analysis.MEAN, window=2) self.assertArrayEqual(expected_result.data, res_cube.data) def test_mean_with_weights(self): # rolling window mean with weights wts = np.array([0.1, 0.6, 0.3], dtype=np.float64) res_cube = self.cube.rolling_window('longitude', iris.analysis.MEAN, window=3, weights=wts) expected_result = np.array([[10.2, 13.6], [12.2, 15.6], [12.0, 9.0]], dtype=np.float64) # use almost equal to compare floats self.assertArrayAlmostEqual(expected_result, res_cube.data) if __name__ == "__main__": tests.main()
QuLogic/iris
lib/iris/tests/test_analysis.py
Python
gpl-3.0
50,394
[ "NetCDF" ]
a0b0626648f826d3ec06d17fd3c9a994451243c319c6c35eb79d70d02a5bf272
# minimal.py --- # Upi Bhalla, NCBS Bangalore 2013. # # Commentary: # # Testing system for loading in arbitrary multiscale models based on # model definition files. # This version has a minimal model with Ca in all 3 compartments, # and CaM (just one step) in SPINE and PSD, with a nominal product Ca.CaM. # In this diffusionOnly version there is no reaction. To be more precise, # the loaded in minimal.g model has the Ca-binding reaction, but it is # deleted when the file is loaded in. # Incoming Ca from synaptic events comes to the PSD. # # This program is free software; you can redistribute it and/or # modify it under the terms of the GNU General Public License as # published by the Free Software Foundation; either version 3, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU # General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program; see the file COPYING. If not, write to # the Free Software Foundation, Inc., 51 Franklin Street, Fifth # Floor, Boston, MA 02110-1301, USA. # # Code: import sys sys.path.append('../../python') import os os.environ['NUMPTHREADS'] = '1' import math import moose import proto18 EREST_ACT = -70e-3 def loadElec(): library = moose.Neutral( '/library' ) moose.setCwe( '/library' ) proto18.make_Ca() proto18.make_Ca_conc() proto18.make_K_AHP() proto18.make_K_C() proto18.make_Na() proto18.make_K_DR() proto18.make_K_A() proto18.make_glu() proto18.make_NMDA() proto18.make_Ca_NMDA() proto18.make_NMDA_Ca_conc() proto18.make_axon() model = moose.Neutral( '/model' ) cellId = moose.loadModel( 'ca1_asym.p', '/model/elec', "hsolve" ) return cellId def addPlot( objpath, field, plot ): #assert moose.exists( objpath ) if ( moose.exists( objpath ) ): tab = moose.Table( '/graphs/' + plot ) obj = moose.element( objpath ) moose.connect( tab, 'requestOut', obj, field ) def dumpPlots( fname ): if ( os.path.exists( fname ) ): os.remove( fname ) for x in moose.wildcardFind( '/graphs/#[ISA=Table]' ): moose.element( x[0] ).xplot( fname, x[0].name ) for x in moose.wildcardFind( '/graphs/elec/#[ISA=Table]' ): moose.element( x[0] ).xplot( fname, x[0].name + '_e' ) def moveCompt( path, oldParent, newParent ): meshEntries = moose.element( newParent.path + '/mesh' ) # Set up vol messaging from new compts to all their child objects. for x in moose.wildcardFind( path + '/##[ISA=PoolBase]' ): moose.connect( meshEntries, 'mesh', x, 'mesh', 'OneToOne' ) #print 'path = ', path, ', oldparent = ', oldParent.path orig = moose.element( path ) moose.move( orig, newParent ) moose.delete( moose.vec( oldParent.path ) ) chem = moose.element( '/model/chem' ) moose.move( newParent, chem ) def loadChem( neuroCompt, spineCompt, psdCompt ): # We need the compartments to come in with a volume of 1 to match the # original CubeMesh. assert( neuroCompt.volume == 1.0 ) assert( spineCompt.volume == 1.0 ) assert( psdCompt.volume == 1.0 ) assert( neuroCompt.mesh.num == 1 ) print 'volume = ', neuroCompt.mesh[0].volume #assert( neuroCompt.mesh[0].volume == 1.0 ) #an unfortunate mismatch # So we'll have to resize the volumes of the current compartments to the # new ones. modelId = moose.loadModel( 'diffonly.g', '/model', 'ee' ) #moose.le( '/model/model' ) #moose.le( '/model/model/kinetics' ) #moose.le( '/model/model/kinetics/PSD' ) #moose.le( '/model/model/kinetics/SPINE' ) moose.delete( moose.vec( '/model/model/kinetics/PSD/kreac' ) ) moose.delete( moose.vec( '/model/model/kinetics/SPINE/kreac' ) ) #moose.le( '/model/model/kinetics/PSD' ) #moose.le( '/model/model/kinetics/SPINE' ) pCaCaM = moose.element( '/model/model/kinetics/PSD/Ca_CaM' ) pCaCaM.concInit = 0.001 dCaCaM = moose.element( '/model/model/kinetics/PSD/Ca_CaM' ) sCaCaM = moose.element( '/model/model/kinetics/SPINE/Ca_CaM' ) print "CaCaM.concInit[p,s,d] = ", pCaCaM.concInit, sCaCaM.concInit, dCaCaM.concInit #moose.delete( moose.vec( '/model/model/kinetics/SPINE/Ca_CaM' ) ) #CaCaM2 = moose.element( '/model/model/kinetics/SPINE/Ca_CaM' ) #CaCaM2.concInit = 0.001 chem = moose.element( '/model/model' ) chem.name = 'chem' oldS = moose.element( '/model/chem/compartment_1' ) oldP = moose.element( '/model/chem/compartment_2' ) oldN = moose.element( '/model/chem/kinetics' ) print 'oldvols[p,s,d] = ', oldP.volume, oldS.volume, oldN.volume print 'newvols[p,s,d] = ', psdCompt.mesh[0].volume, spineCompt.mesh[0].volume, neuroCompt.mesh[0].volume oldN.volume = neuroCompt.mesh[0].volume oldS.volume = spineCompt.mesh[0].volume oldP.volume = psdCompt.mesh[0].volume print 'after redoing vols' print "CaCaM.concInit[p,s,d] = ", pCaCaM.concInit, sCaCaM.concInit, dCaCaM.concInit moveCompt( '/model/chem/kinetics/SPINE', oldS, spineCompt ) moveCompt( '/model/chem/kinetics/PSD', oldP, psdCompt ) # Need to do the DEND last because the oldN is /kinetics, # and it will be deleted. moveCompt( '/model/chem/kinetics/DEND', oldN, neuroCompt ) print 'after moving to new compts' print "CaCaM.concInit[p,s,d] = ", pCaCaM.concInit, sCaCaM.concInit, dCaCaM.concInit def makeNeuroMeshModel(): diffLength = 20e-6 # But we only want diffusion over part of the model. numSyn = 13 elec = loadElec() synInput = moose.SpikeGen( '/model/elec/synInput' ) synInput.refractT = 47e-3 synInput.threshold = -1.0 synInput.edgeTriggered = 0 synInput.Vm( 0 ) synInput.refractT = 47e-3 for i in range( numSyn ): name = '/model/elec/spine_head_14_' + str( i + 1 ) r = moose.element( name + '/glu' ) r.synapse.num = 1 syn = moose.element( r.path + '/synapse' ) moose.connect( synInput, 'spikeOut', syn, 'addSpike', 'Single' ) syn.weight = 0.2 * i * ( numSyn - 1 - i ) syn.delay = i * 1.0e-3 neuroCompt = moose.NeuroMesh( '/model/neuroMesh' ) #print 'neuroMeshvolume = ', neuroCompt.mesh[0].volume neuroCompt.separateSpines = 1 neuroCompt.diffLength = diffLength neuroCompt.geometryPolicy = 'cylinder' spineCompt = moose.SpineMesh( '/model/spineMesh' ) #print 'spineMeshvolume = ', spineCompt.mesh[0].volume moose.connect( neuroCompt, 'spineListOut', spineCompt, 'spineList', 'OneToOne' ) psdCompt = moose.PsdMesh( '/model/psdMesh' ) #print 'psdMeshvolume = ', psdCompt.mesh[0].volume moose.connect( neuroCompt, 'psdListOut', psdCompt, 'psdList', 'OneToOne' ) loadChem( neuroCompt, spineCompt, psdCompt ) # Put in the solvers, see how they fare. nmksolve = moose.GslStoich( '/model/chem/neuroMesh/ksolve' ) nmksolve.path = '/model/chem/neuroMesh/##' nmksolve.compartment = moose.element( '/model/chem/neuroMesh' ) nmksolve.method = 'rk5' nm = moose.element( '/model/chem/neuroMesh/mesh' ) moose.connect( nm, 'remesh', nmksolve, 'remesh' ) #print "neuron: nv=", nmksolve.numLocalVoxels, ", nav=", nmksolve.numAllVoxels, nmksolve.numVarPools, nmksolve.numAllPools #print 'setting up smksolve' smksolve = moose.GslStoich( '/model/chem/spineMesh/ksolve' ) smksolve.path = '/model/chem/spineMesh/##' smksolve.compartment = moose.element( '/model/chem/spineMesh' ) smksolve.method = 'rk5' sm = moose.element( '/model/chem/spineMesh/mesh' ) moose.connect( sm, 'remesh', smksolve, 'remesh' ) #print "spine: nv=", smksolve.numLocalVoxels, ", nav=", smksolve.numAllVoxels, smksolve.numVarPools, smksolve.numAllPools # #print 'setting up pmksolve' pmksolve = moose.GslStoich( '/model/chem/psdMesh/ksolve' ) pmksolve.path = '/model/chem/psdMesh/##' pmksolve.compartment = moose.element( '/model/chem/psdMesh' ) pmksolve.method = 'rk5' pm = moose.element( '/model/chem/psdMesh/mesh' ) moose.connect( pm, 'remesh', pmksolve, 'remesh' ) #print "psd: nv=", pmksolve.numLocalVoxels, ", nav=", pmksolve.numAllVoxels, pmksolve.numVarPools, pmksolve.numAllPools # print 'neuroMeshvolume = ', neuroCompt.mesh[0].volume #print 'Assigning the cell model' # Now to set up the model. #neuroCompt.cell = elec neuroCompt.cellPortion( elec, '/model/elec/lat_14_#,/model/elec/spine_neck#,/model/elec/spine_head#' ) """ ns = neuroCompt.numSegments #assert( ns == 11 ) # dend, 5x (shaft+head) ndc = neuroCompt.numDiffCompts #print 'numDiffCompts = ', ndc assert( ndc == 145 ) ndc = neuroCompt.mesh.num #print 'NeuroMeshNum = ', ndc assert( ndc == 145 ) sdc = spineCompt.mesh.num #print 'SpineMeshNum = ', sdc assert( sdc == 13 ) pdc = psdCompt.mesh.num #print 'PsdMeshNum = ', pdc assert( pdc == 13 ) """ mesh = moose.vec( '/model/chem/neuroMesh/mesh' ) #for i in range( ndc ): # print 's[', i, '] = ', mesh[i].volume mesh2 = moose.vec( '/model/chem/spineMesh/mesh' ) # for i in range( sdc ): # print 's[', i, '] = ', mesh2[i].volume #print 'numPSD = ', moose.element( '/model/chem/psdMesh/mesh' ).localNumField mesh = moose.vec( '/model/chem/psdMesh/mesh' ) #print 'psd mesh.volume = ', mesh.volume #for i in range( pdc ): # print 's[', i, '] = ', mesh[i].volume # # We need to use the spine solver as the master for the purposes of # these calculations. This will handle the diffusion calculations # between head and dendrite, and between head and PSD. smksolve.addJunction( nmksolve ) #print "spine: nv=", smksolve.numLocalVoxels, ", nav=", smksolve.numAllVoxels, smksolve.numVarPools, smksolve.numAllPools smksolve.addJunction( pmksolve ) #print "psd: nv=", pmksolve.numLocalVoxels, ", nav=", pmksolve.numAllVoxels, pmksolve.numVarPools, pmksolve.numAllPools ndc = neuroCompt.numDiffCompts #print 'numDiffCompts = ', ndc assert( ndc == 13 ) ndc = neuroCompt.mesh.num #print 'NeuroMeshNum = ', ndc assert( ndc == 13 ) sdc = spineCompt.mesh.num #print 'SpineMeshNum = ', sdc assert( sdc == 13 ) pdc = psdCompt.mesh.num #print 'PsdMeshNum = ', pdc assert( pdc == 13 ) """ print 'neuroCompt' for i in range( ndc ): print i, neuroCompt.stencilIndex[i] print i, neuroCompt.stencilRate[i] print 'spineCompt' for i in range( sdc * 3 ): print i, spineCompt.stencilIndex[i] print i, spineCompt.stencilRate[i] print 'psdCompt' for i in range( pdc ): print i, psdCompt.stencilIndex[i] print i, psdCompt.stencilRate[i] print 'Spine parents:' pavoxel = spineCompt.parentVoxel for i in range( sdc ): print i, pavoxel[i] """ # oddly, numLocalFields does not work. #moose.le( '/model/chem/neuroMesh' ) ca = moose.element( '/model/chem/neuroMesh/DEND/Ca' ) assert( ca.lastDimension == ndc ) """ CaNpsd = moose.vec( '/model/chem/psdMesh/PSD/PP1_PSD/CaN' ) print 'numCaN in PSD = ', CaNpsd.nInit, ', vol = ', CaNpsd.volume CaNspine = moose.vec( '/model/chem/spineMesh/SPINE/CaN_BULK/CaN' ) print 'numCaN in spine = ', CaNspine.nInit, ', vol = ', CaNspine.volume """ # set up adaptors aCa = moose.Adaptor( '/model/chem/psdMesh/adaptCa', pdc ) adaptCa = moose.vec( '/model/chem/psdMesh/adaptCa' ) chemCa = moose.vec( '/model/chem/psdMesh/PSD/Ca' ) assert( len( adaptCa ) == pdc ) assert( len( chemCa ) == pdc ) for i in range( pdc ): path = '/model/elec/spine_head_14_' + str( i + 1 ) + '/NMDA_Ca_conc' elecCa = moose.element( path ) moose.connect( elecCa, 'concOut', adaptCa[i], 'input', 'Single' ) moose.connect( adaptCa, 'outputSrc', chemCa, 'setConc', 'OneToOne' ) adaptCa.inputOffset = 0.0 # adaptCa.outputOffset = 80e-6 # 80 nM offset in chem. adaptCa.scale = 1e-5 # 520 to 0.0052 mM #print adaptCa.outputOffset #print adaptCa.scale def makeElecPlots(): graphs = moose.Neutral( '/graphs' ) elec = moose.Neutral( '/graphs/elec' ) addPlot( '/model/elec/soma', 'getVm', 'elec/somaVm' ) addPlot( '/model/elec/soma/Ca_conc', 'getCa', 'elec/somaCa' ) addPlot( '/model/elec/basal_3', 'getVm', 'elec/basal3Vm' ) addPlot( '/model/elec/apical_14', 'getVm', 'elec/apical_14Vm' ) addPlot( '/model/elec/apical_14/Ca_conc', 'getCa', 'elec/apical_14Ca' ) addPlot( '/model/elec/spine_head_14_7', 'getVm', 'elec/spine_7Vm' ) addPlot( '/model/elec/spine_head_14_7/NMDA_Ca_conc', 'getCa', 'elec/spine_7Ca' ) addPlot( '/model/elec/spine_head_14_13/NMDA_Ca_conc', 'getCa', 'elec/spine_13Ca' ) def makeChemPlots(): spineMesh = moose.element( '/model/chem/spineMesh' ) middleSpine = 6 midSpineVoxel = spineMesh.parentVoxel[middleSpine] graphs = moose.Neutral( '/graphs' ) addPlot( '/model/chem/psdMesh/PSD/Ca[0]', 'getConc', 'pCa0' ) addPlot( '/model/chem/psdMesh/PSD/Ca[6]', 'getConc', 'pCa6' ) addPlot( '/model/chem/psdMesh/PSD/Ca[12]', 'getConc', 'pCa12' ) addPlot( '/model/chem/spineMesh/SPINE/Ca[0]', 'getConc', 'sCa0' ) addPlot( '/model/chem/spineMesh/SPINE/Ca[6]', 'getConc', 'sCa6' ) addPlot( '/model/chem/spineMesh/SPINE/Ca[12]', 'getConc', 'sCa12' ) addPlot( '/model/chem/neuroMesh/DEND/Ca[0]', 'getConc', 'dend0Ca' ) addPlot( '/model/chem/neuroMesh/DEND/Ca[' + str( midSpineVoxel ) + ']', 'getConc', 'dendMidCa' ) addPlot( '/model/chem/neuroMesh/DEND/Ca[' + str( midSpineVoxel+2 ) + ']', 'getConc', 'dendMid2' ) addPlot( '/model/chem/neuroMesh/DEND/Ca[' + str( midSpineVoxel+4 ) + ']', 'getConc', 'dendMid4' ) addPlot( '/model/chem/neuroMesh/DEND/Ca[' + str( midSpineVoxel+6 ) + ']', 'getConc', 'dendMid6' ) addPlot( '/model/chem/neuroMesh/DEND/Ca[144]', 'getConc', 'dend144Ca' ) addPlot( '/model/chem/psdMesh/PSD/CaM[0]', 'getConc', 'pCaM0' ) addPlot( '/model/chem/psdMesh/PSD/CaM[6]', 'getConc', 'pCaM6' ) addPlot( '/model/chem/psdMesh/PSD/CaM[12]', 'getConc', 'pCaM12' ) addPlot( '/model/chem/spineMesh/SPINE/CaM[0]', 'getConc', 'sCaM0' ) addPlot( '/model/chem/spineMesh/SPINE/CaM[6]', 'getConc', 'sCaM6' ) addPlot( '/model/chem/spineMesh/SPINE/CaM[12]', 'getConc', 'sCaM12' ) addPlot( '/model/chem/psdMesh/PSD/Ca_CaM[0]', 'getConc', 'pCaCaM0' ) addPlot( '/model/chem/psdMesh/PSD/Ca_CaM[6]', 'getConc', 'pCaCaM6' ) addPlot( '/model/chem/psdMesh/PSD/Ca_CaM[12]', 'getConc', 'pCaCaM12' ) addPlot( '/model/chem/spineMesh/SPINE/Ca_CaM[0]', 'getConc', 'sCaCaM0' ) addPlot( '/model/chem/spineMesh/SPINE/Ca_CaM[6]', 'getConc', 'sCaCaM6' ) addPlot( '/model/chem/spineMesh/SPINE/Ca_CaM[12]', 'getConc', 'sCaCaM12' ) addPlot( '/model/chem/neuroMesh/DEND/Ca_CaM[0]', 'getConc', 'dCaCaM0' ) addPlot( '/model/chem/neuroMesh/DEND/Ca_CaM[' + str( midSpineVoxel ) + ']', 'getConc', 'dendMidCaCaM' ) addPlot( '/model/chem/neuroMesh/DEND/Ca_CaM[144]', 'getConc', 'dCaCaM144' ) def testNeuroMeshMultiscale(): elecDt = 50e-6 chemDt = 1e-4 plotDt = 5e-4 plotName = 'diffonly.plot' makeNeuroMeshModel() """ for i in moose.wildcardFind( '/model/chem/##[ISA=PoolBase]' ): if ( i[0].diffConst > 0 ): grandpaname = i.parent[0].parent.name + '/' paname = i.parent[0].name + '/' print grandpaname + paname + i[0].name, i[0].diffConst moose.le( '/model/chem/spineMesh/ksolve' ) print 'Neighbors:' for t in moose.element( '/model/chem/spineMesh/ksolve/junction' ).neighbors['masterJunction']: print 'masterJunction <-', t.path for t in moose.wildcardFind( '/model/chem/#Mesh/ksolve' ): k = moose.element( t[0] ) print k.path + ' localVoxels=', k.numLocalVoxels, ', allVoxels= ', k.numAllVoxels """ makeChemPlots() makeElecPlots() moose.setClock( 0, elecDt ) moose.setClock( 1, elecDt ) moose.setClock( 2, elecDt ) moose.setClock( 5, chemDt ) moose.setClock( 6, chemDt ) moose.setClock( 7, plotDt ) moose.setClock( 8, plotDt ) moose.useClock( 0, '/model/elec/##[ISA=Compartment]', 'init' ) moose.useClock( 1, '/model/elec/##[ISA=SpikeGen]', 'process' ) moose.useClock( 2, '/model/elec/##[ISA=ChanBase],/model/##[ISA=SynBase],/model/##[ISA=CaConc]','process') moose.useClock( 5, '/model/chem/##[ISA=PoolBase],/model/##[ISA=ReacBase],/model/##[ISA=EnzBase]', 'process' ) moose.useClock( 6, '/model/chem/##[ISA=Adaptor]', 'process' ) moose.useClock( 7, '/graphs/#', 'process' ) moose.useClock( 8, '/graphs/elec/#', 'process' ) moose.useClock( 5, '/model/chem/#Mesh/ksolve', 'init' ) moose.useClock( 6, '/model/chem/#Mesh/ksolve', 'process' ) hsolve = moose.HSolve( '/model/elec/hsolve' ) moose.useClock( 1, '/model/elec/hsolve', 'process' ) hsolve.dt = elecDt hsolve.target = '/model/elec/compt' moose.reinit() moose.reinit() """ print 'pre' eca = moose.vec( '/model/chem/psdMesh/PSD/CaM/Ca' ) for i in range( 3 ): print eca[i].concInit, eca[i].conc, eca[i].nInit, eca[i].n, eca[i].volume print 'dend' eca = moose.vec( '/model/chem/neuroMesh/DEND/Ca' ) for i in ( 0, 1, 2, 30, 60, 90, 120, 144 ): print i, eca[i].concInit, eca[i].conc, eca[i].nInit, eca[i].n, eca[i].volume print 'PSD' eca = moose.vec( '/model/chem/psdMesh/PSD/CaM/Ca' ) for i in range( 3 ): print eca[i].concInit, eca[i].conc, eca[i].nInit, eca[i].n, eca[i].volume print 'spine' eca = moose.vec( '/model/chem/spineMesh/SPINE/CaM/Ca' ) for i in range( 3 ): print eca[i].concInit, eca[i].conc, eca[i].nInit, eca[i].n, eca[i].volume """ moose.start( 0.5 ) dumpPlots( plotName ) print 'All done' def main(): testNeuroMeshMultiscale() if __name__ == '__main__': main() # # loadMulti.py ends here.
dilawar/moose-full
moose-examples/snippets/MULTI/diffusionOnly.py
Python
gpl-2.0
17,109
[ "MOOSE", "NEURON" ]
690e53b178d491f852f16981cfdb5ff38f29530554c6dc391ff51271eeaffdad
#!/usr/bin/env python """ Program to show the monte carlo error estimate of the polarization correction operation, assuming a value and uncertainty for polarizer and flipper efficiencies. """ n = 100000 err = 5 Ic = 100000 doplot = False import numpy,math,pylab import reflectometry.reduction as reflred eff = reflred.PolarizationEfficiency() # Seed polarizer/flipper efficiencies from a gaussian distribution eff.ff = numpy.random.normal(0.95,0.01*err,n) eff.fp = numpy.random.normal(0.90,0.01*err,n) eff.rf = numpy.random.normal(0.95,0.01*err,n) eff.rp = numpy.random.normal(0.90,0.01*err,n) eff.Ic = numpy.random.normal(Ic,numpy.sqrt(Ic),n) data = reflred.PolarizedData() for V,v in [(data.pp,Ic), (data.pm,Ic/5), (data.mp,Ic/5), (data.mm,Ic)]: V.v = numpy.ones(n)*v V.variance = V.v # Variance is poisson variance V.v = numpy.random.normal(V.v,V.dv) # Randomize inputs eff(data) # Apply polarization efficiency correction to data for plt,d,label,E in [(221,data.pp,'++',Ic), (222,data.pm,'+-',Ic/5), (223,data.mp,'-+',Ic/5), (224,data.mm,'--',Ic)]: if doplot: pylab.subplot(plt) pylab.hist(d.v) pylab.legend(['%s %0.2f (%0.2f)'%(label,pylab.mean(d.v),pylab.std(d.v))]) print "%s measurement uncertainty %.2f, corrected uncertainty %.3f, value %.3f"\ %(label,math.sqrt(E),pylab.std(d.v),numpy.mean(d.v)) if doplot: pylab.show()
reflectometry/osrefl
osrefl/loaders/reduction/examples/polcorerr.py
Python
bsd-3-clause
1,461
[ "Gaussian" ]
9f85f9e91a30514513f5e42b4b3f89bc2906b77368178855220e849236662c7c
<<<<<<< HEAD <<<<<<< HEAD import base64 import re import os import sys import urllib.request, urllib.parse, urllib.error PY3 = sys.version_info[0] == 3 if PY3: from io import StringIO str = str else: from io import StringIO try: import json except ImportError: import simplejson as json from .rest import ErrorResponse, RESTClient, params_to_urlencoded from .session import BaseSession, DropboxSession, DropboxOAuth2Session def format_path(path): """Normalize path for use with the Dropbox API. This function turns multiple adjacent slashes into single slashes, then ensures that there's a leading slash but not a trailing slash. """ if not path: return path path = re.sub(r'/+', '/', path) if path == '/': return ("" if isinstance(path, str) else "") else: return '/' + path.strip('/') class DropboxClient(object): """ This class lets you make Dropbox API calls. You'll need to obtain an OAuth 2 access token first. You can get an access token using either :class:`DropboxOAuth2Flow` or :class:`DropboxOAuth2FlowNoRedirect`. All of the API call methods can raise a :class:`dropbox.rest.ErrorResponse` exception if the server returns a non-200 or invalid HTTP response. Note that a 401 return status at any point indicates that the access token you're using is no longer valid and the user must be put through the OAuth 2 authorization flow again. """ def __init__(self, oauth2_access_token, locale=None, rest_client=None): """Construct a ``DropboxClient`` instance. Parameters oauth2_access_token An OAuth 2 access token (string). For backwards compatibility this may also be a DropboxSession object (see :meth:`create_oauth2_access_token()`). locale The locale of the user of your application. For example "en" or "en_US". Some API calls return localized data and error messages; this setting tells the server which locale to use. By default, the server uses "en_US". rest_client Optional :class:`dropbox.rest.RESTClient`-like object to use for making requests. """ if rest_client is None: rest_client = RESTClient if isinstance(oauth2_access_token, str): if not _OAUTH2_ACCESS_TOKEN_PATTERN.match(oauth2_access_token): raise ValueError("invalid format for oauth2_access_token: %r" % (oauth2_access_token,)) self.session = DropboxOAuth2Session(oauth2_access_token, locale) elif isinstance(oauth2_access_token, DropboxSession): # Backwards compatibility with OAuth 1 if locale is not None: raise ValueError("The 'locale' parameter to DropboxClient is only useful " "when also passing in an OAuth 2 access token") self.session = oauth2_access_token else: raise ValueError("'oauth2_access_token' must either be a string or a DropboxSession") self.rest_client = rest_client def request(self, target, params=None, method='POST', content_server=False, notification_server=False): """ An internal method that builds the url, headers, and params for a Dropbox API request. It is exposed if you need to make API calls not implemented in this library or if you need to debug requests. Parameters target The target URL with leading slash (e.g. '/files'). params A dictionary of parameters to add to the request. method An HTTP method (e.g. 'GET' or 'POST'). content_server A boolean indicating whether the request is to the API content server, for example to fetch the contents of a file rather than its metadata. notification_server A boolean indicating whether the request is to the API notification server, for example for longpolling. Returns A tuple of ``(url, params, headers)`` that should be used to make the request. OAuth will be added as needed within these fields. """ assert method in ['GET','POST', 'PUT'], "Only 'GET', 'POST', and 'PUT' are allowed." assert not (content_server and notification_server), \ "Cannot construct request simultaneously for content and notification servers." if params is None: params = {} if content_server: host = self.session.API_CONTENT_HOST elif notification_server: host = self.session.API_NOTIFICATION_HOST else: host = self.session.API_HOST base = self.session.build_url(host, target) headers, params = self.session.build_access_headers(method, base, params) if method in ('GET', 'PUT'): url = self.session.build_url(host, target, params) else: url = self.session.build_url(host, target) return url, params, headers def account_info(self): """Retrieve information about the user's account. Returns A dictionary containing account information. For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#account-info """ url, params, headers = self.request("/account/info", method='GET') return self.rest_client.GET(url, headers) def disable_access_token(self): """ Disable the access token that this ``DropboxClient`` is using. If this call succeeds, further API calls using this object will fail. """ url, params, headers = self.request("/disable_access_token", method='POST') return self.rest_client.POST(url, params, headers) def create_oauth2_access_token(self): """ If this ``DropboxClient`` was created with an OAuth 1 access token, this method can be used to create an equivalent OAuth 2 access token. This can be used to upgrade your app's existing access tokens from OAuth 1 to OAuth 2. Example:: from dropbox.client import DropboxClient from dropbox.session import DropboxSession session = DropboxSession(APP_KEY, APP_SECRET) access_key, access_secret = '123abc', 'xyz456' # Previously obtained OAuth 1 credentials session.set_token(access_key, access_secret) client = DropboxClient(session) token = client.create_oauth2_access_token() # Optionally, create a new client using the new token new_client = DropboxClient(token) """ if not isinstance(self.session, DropboxSession): raise ValueError("This call requires a DropboxClient that is configured with an " "OAuth 1 access token.") url, params, headers = self.request("/oauth2/token_from_oauth1", method='POST') r = self.rest_client.POST(url, params, headers) return r['access_token'] def get_chunked_uploader(self, file_obj, length): """Creates a :class:`ChunkedUploader` to upload the given file-like object. Parameters file_obj The file-like object which is the source of the data being uploaded. length The number of bytes to upload. The expected use of this function is as follows:: bigFile = open("data.txt", 'rb') uploader = myclient.get_chunked_uploader(bigFile, size) print "uploading: ", size while uploader.offset < size: try: upload = uploader.upload_chunked() except rest.ErrorResponse, e: # perform error handling and retry logic uploader.finish('/bigFile.txt') The SDK leaves the error handling and retry logic to the developer to implement, as the exact requirements will depend on the application involved. """ return ChunkedUploader(self, file_obj, length) def upload_chunk(self, file_obj, length=None, offset=0, upload_id=None): """Uploads a single chunk of data from a string or file-like object. The majority of users should use the :class:`ChunkedUploader` object, which provides a simpler interface to the chunked_upload API endpoint. Parameters file_obj The source of the chunk to upload; a file-like object or a string. length This argument is ignored but still present for backward compatibility reasons. offset The byte offset to which this source data corresponds in the original file. upload_id The upload identifier for which this chunk should be uploaded, returned by a previous call, or None to start a new upload. Returns A dictionary containing the keys: upload_id A string used to identify the upload for subsequent calls to :meth:`upload_chunk()` and :meth:`commit_chunked_upload()`. offset The offset at which the next upload should be applied. expires The time after which this partial upload is invalid. """ params = dict() if upload_id: params['upload_id'] = upload_id params['offset'] = offset url, ignored_params, headers = self.request("/chunked_upload", params, method='PUT', content_server=True) try: reply = self.rest_client.PUT(url, file_obj, headers) return reply['offset'], reply['upload_id'] except ErrorResponse as e: raise e def commit_chunked_upload(self, full_path, upload_id, overwrite=False, parent_rev=None): """Commit the previously uploaded chunks for the given path. Parameters full_path The full path to which the chunks are uploaded, *including the file name*. If the destination folder does not yet exist, it will be created. upload_id The chunked upload identifier, previously returned from upload_chunk. overwrite Whether to overwrite an existing file at the given path. (Default ``False``.) If overwrite is False and a file already exists there, Dropbox will rename the upload to make sure it doesn't overwrite anything. You need to check the metadata returned for the new name. This field should only be True if your intent is to potentially clobber changes to a file that you don't know about. parent_rev Optional rev field from the 'parent' of this upload. If your intent is to update the file at the given path, you should pass the parent_rev parameter set to the rev value from the most recent metadata you have of the existing file at that path. If the server has a more recent version of the file at the specified path, it will automatically rename your uploaded file, spinning off a conflict. Using this parameter effectively causes the overwrite parameter to be ignored. The file will always be overwritten if you send the most recent parent_rev, and it will never be overwritten if you send a less recent one. Returns A dictionary containing the metadata of the newly committed file. For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#commit-chunked-upload """ params = { 'upload_id': upload_id, 'overwrite': overwrite, } if parent_rev is not None: params['parent_rev'] = parent_rev url, params, headers = self.request("/commit_chunked_upload/%s" % full_path, params, content_server=True) return self.rest_client.POST(url, params, headers) def put_file(self, full_path, file_obj, overwrite=False, parent_rev=None): """Upload a file. A typical use case would be as follows:: f = open('working-draft.txt', 'rb') response = client.put_file('/magnum-opus.txt', f) print "uploaded:", response which would return the metadata of the uploaded file, similar to:: { 'bytes': 77, 'icon': 'page_white_text', 'is_dir': False, 'mime_type': 'text/plain', 'modified': 'Wed, 20 Jul 2011 22:04:50 +0000', 'path': '/magnum-opus.txt', 'rev': '362e2029684fe', 'revision': 221922, 'root': 'dropbox', 'size': '77 bytes', 'thumb_exists': False } Parameters full_path The full path to upload the file to, *including the file name*. If the destination folder does not yet exist, it will be created. file_obj A file-like object to upload. If you would like, you can pass a string as file_obj. overwrite Whether to overwrite an existing file at the given path. (Default ``False``.) If overwrite is False and a file already exists there, Dropbox will rename the upload to make sure it doesn't overwrite anything. You need to check the metadata returned for the new name. This field should only be True if your intent is to potentially clobber changes to a file that you don't know about. parent_rev Optional rev field from the 'parent' of this upload. If your intent is to update the file at the given path, you should pass the parent_rev parameter set to the rev value from the most recent metadata you have of the existing file at that path. If the server has a more recent version of the file at the specified path, it will automatically rename your uploaded file, spinning off a conflict. Using this parameter effectively causes the overwrite parameter to be ignored. The file will always be overwritten if you send the most recent parent_rev, and it will never be overwritten if you send a less recent one. Returns A dictionary containing the metadata of the newly uploaded file. For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#files-put Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 503: User over quota. """ path = "/files_put/%s%s" % (self.session.root, format_path(full_path)) params = { 'overwrite': bool(overwrite), } if parent_rev is not None: params['parent_rev'] = parent_rev url, params, headers = self.request(path, params, method='PUT', content_server=True) return self.rest_client.PUT(url, file_obj, headers) def get_file(self, from_path, rev=None, start=None, length=None): """Download a file. Example:: out = open('magnum-opus.txt', 'wb') with client.get_file('/magnum-opus.txt') as f: out.write(f.read()) which would download the file ``magnum-opus.txt`` and write the contents into the file ``magnum-opus.txt`` on the local filesystem. Parameters from_path The path to the file to be downloaded. rev Optional previous rev value of the file to be downloaded. start Optional byte value from which to start downloading. length Optional length in bytes for partially downloading the file. If ``length`` is specified but ``start`` is not, then the last ``length`` bytes will be downloaded. Returns A :class:`dropbox.rest.RESTResponse` that is the HTTP response for the API request. It is a file-like object that can be read from. You must call ``close()`` when you're done. Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 404: No file was found at the given path, or the file that was there was deleted. - 200: Request was okay but response was malformed in some way. """ path = "/files/%s%s" % (self.session.root, format_path(from_path)) params = {} if rev is not None: params['rev'] = rev url, params, headers = self.request(path, params, method='GET', content_server=True) if start is not None: if length: headers['Range'] = 'bytes=%s-%s' % (start, start + length - 1) else: headers['Range'] = 'bytes=%s-' % start elif length is not None: headers['Range'] = 'bytes=-%s' % length return self.rest_client.request("GET", url, headers=headers, raw_response=True) def get_file_and_metadata(self, from_path, rev=None): """Download a file alongwith its metadata. Acts as a thin wrapper around get_file() (see :meth:`get_file()` comments for more details) A typical usage looks like this:: out = open('magnum-opus.txt', 'wb') f, metadata = client.get_file_and_metadata('/magnum-opus.txt') with f: out.write(f.read()) Parameters from_path The path to the file to be downloaded. rev Optional previous rev value of the file to be downloaded. Returns A pair of ``(response, metadata)``: response A :class:`dropbox.rest.RESTResponse` that is the HTTP response for the API request. It is a file-like object that can be read from. You must call ``close()`` when you're done. metadata A dictionary containing the metadata of the file (see https://www.dropbox.com/developers/core/docs#metadata for details). Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 404: No file was found at the given path, or the file that was there was deleted. - 200: Request was okay but response was malformed in some way. """ file_res = self.get_file(from_path, rev) metadata = DropboxClient.__parse_metadata_as_dict(file_res) return file_res, metadata @staticmethod def __parse_metadata_as_dict(dropbox_raw_response): # Parses file metadata from a raw dropbox HTTP response, raising a # dropbox.rest.ErrorResponse if parsing fails. metadata = None for header, header_val in dropbox_raw_response.getheaders().items(): if header.lower() == 'x-dropbox-metadata': try: metadata = json.loads(header_val) except ValueError: raise ErrorResponse(dropbox_raw_response) if not metadata: raise ErrorResponse(dropbox_raw_response) return metadata def delta(self, cursor=None, path_prefix=None, include_media_info=False): """A way of letting you keep up with changes to files and folders in a user's Dropbox. You can periodically call delta() to get a list of "delta entries", which are instructions on how to update your local state to match the server's state. Parameters cursor On the first call, omit this argument (or pass in ``None``). On subsequent calls, pass in the ``cursor`` string returned by the previous call. path_prefix If provided, results will be limited to files and folders whose paths are equal to or under ``path_prefix``. The ``path_prefix`` is fixed for a given cursor. Whatever ``path_prefix`` you use on the first ``delta()`` must also be passed in on subsequent calls that use the returned cursor. include_media_info If True, delta will return additional media info for photos and videos (the time a photo was taken, the GPS coordinates of a photo, etc.). There is a delay between when a file is uploaded to Dropbox and when this information is available; delta will only include a file in the changelist once its media info is ready. The value you use on the first ``delta()`` must also be passed in on subsequent calls that use the returned cursor. Returns A dict with four keys: entries A list of "delta entries" (described below). reset If ``True``, you should your local state to be an empty folder before processing the list of delta entries. This is only ``True`` only in rare situations. cursor A string that is used to keep track of your current state. On the next call to delta(), pass in this value to return entries that were recorded since the cursor was returned. has_more If ``True``, then there are more entries available; you can call delta() again immediately to retrieve those entries. If ``False``, then wait at least 5 minutes (preferably longer) before checking again. Delta Entries: Each entry is a 2-item list of one of following forms: - [*path*, *metadata*]: Indicates that there is a file/folder at the given path. You should add the entry to your local path. (The *metadata* value is the same as what would be returned by the ``metadata()`` call.) - If the new entry includes parent folders that don't yet exist in your local state, create those parent folders in your local state. You will eventually get entries for those parent folders. - If the new entry is a file, replace whatever your local state has at *path* with the new entry. - If the new entry is a folder, check what your local state has at *path*. If it's a file, replace it with the new entry. If it's a folder, apply the new *metadata* to the folder, but do not modify the folder's children. - [*path*, ``None``]: Indicates that there is no file/folder at the *path* on Dropbox. To update your local state to match, delete whatever is at *path*, including any children (you will sometimes also get "delete" delta entries for the children, but this is not guaranteed). If your local state doesn't have anything at *path*, ignore this entry. Remember: Dropbox treats file names in a case-insensitive but case-preserving way. To facilitate this, the *path* strings above are lower-cased versions of the actual path. The *metadata* dicts have the original, case-preserved path. """ path = "/delta" params = {'include_media_info': include_media_info} if cursor is not None: params['cursor'] = cursor if path_prefix is not None: params['path_prefix'] = path_prefix url, params, headers = self.request(path, params) return self.rest_client.POST(url, params, headers) def longpoll_delta(self, cursor, timeout=None): """A long-poll endpoint to wait for changes on an account. In conjunction with :meth:`delta()`, this call gives you a low-latency way to monitor an account for file changes. Note that this call goes to ``api-notify.dropbox.com`` instead of ``api.dropbox.com``. Unlike most other API endpoints, this call does not require OAuth authentication. The passed-in cursor can only be acquired via an authenticated call to :meth:`delta()`. Parameters cursor A delta cursor as returned from a call to :meth:`delta()`. Note that a cursor returned from a call to :meth:`delta()` with ``include_media_info=True`` is incompatible with ``longpoll_delta()`` and an error will be returned. timeout An optional integer indicating a timeout, in seconds. The default value is 30 seconds, which is also the minimum allowed value. The maximum is 480 seconds. The request will block for at most this length of time, plus up to 90 seconds of random jitter added to avoid the thundering herd problem. Care should be taken when using this parameter, as some network infrastructure does not support long timeouts. Returns The connection will block until there are changes available or a timeout occurs. The response will be a dictionary that looks like the following example:: {"changes": false, "backoff": 60} For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#longpoll-delta Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (generally due to an invalid parameter; check e.error for details). """ path = "/longpoll_delta" params = {'cursor': cursor} if timeout is not None: params['timeout'] = timeout url, params, headers = self.request(path, params, method='GET', notification_server=True) return self.rest_client.GET(url, headers) def create_copy_ref(self, from_path): """Creates and returns a copy ref for a specific file. The copy ref can be used to instantly copy that file to the Dropbox of another account. Parameters path The path to the file for a copy ref to be created on. Returns A dictionary that looks like the following example:: {"expires": "Fri, 31 Jan 2042 21:01:05 +0000", "copy_ref": "z1X6ATl6aWtzOGq0c3g5Ng"} """ path = "/copy_ref/%s%s" % (self.session.root, format_path(from_path)) url, params, headers = self.request(path, {}, method='GET') return self.rest_client.GET(url, headers) def add_copy_ref(self, copy_ref, to_path): """Adds the file referenced by the copy ref to the specified path Parameters copy_ref A copy ref string that was returned from a create_copy_ref call. The copy_ref can be created from any other Dropbox account, or from the same account. path The path to where the file will be created. Returns A dictionary containing the metadata of the new copy of the file. """ path = "/fileops/copy" params = {'from_copy_ref': copy_ref, 'to_path': format_path(to_path), 'root': self.session.root} url, params, headers = self.request(path, params) return self.rest_client.POST(url, params, headers) def file_copy(self, from_path, to_path): """Copy a file or folder to a new location. Parameters from_path The path to the file or folder to be copied. to_path The destination path of the file or folder to be copied. This parameter should include the destination filename (e.g. from_path: '/test.txt', to_path: '/dir/test.txt'). If there's already a file at the to_path it will raise an ErrorResponse. Returns A dictionary containing the metadata of the new copy of the file or folder. For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#fileops-copy Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 403: An invalid copy operation was attempted (e.g. there is already a file at the given destination, or trying to copy a shared folder). - 404: No file was found at given from_path. - 503: User over storage quota. """ params = {'root': self.session.root, 'from_path': format_path(from_path), 'to_path': format_path(to_path), } url, params, headers = self.request("/fileops/copy", params) return self.rest_client.POST(url, params, headers) def file_create_folder(self, path): """Create a folder. Parameters path The path of the new folder. Returns A dictionary containing the metadata of the newly created folder. For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#fileops-create-folder Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 403: A folder at that path already exists. """ params = {'root': self.session.root, 'path': format_path(path)} url, params, headers = self.request("/fileops/create_folder", params) return self.rest_client.POST(url, params, headers) def file_delete(self, path): """Delete a file or folder. Parameters path The path of the file or folder. Returns A dictionary containing the metadata of the just deleted file. For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#fileops-delete Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 404: No file was found at the given path. """ params = {'root': self.session.root, 'path': format_path(path)} url, params, headers = self.request("/fileops/delete", params) return self.rest_client.POST(url, params, headers) def file_move(self, from_path, to_path): """Move a file or folder to a new location. Parameters from_path The path to the file or folder to be moved. to_path The destination path of the file or folder to be moved. This parameter should include the destination filename (e.g. if ``from_path`` is ``'/test.txt'``, ``to_path`` might be ``'/dir/test.txt'``). If there's already a file at the ``to_path`` it will raise an ErrorResponse. Returns A dictionary containing the metadata of the new copy of the file or folder. For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#fileops-move Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 403: An invalid move operation was attempted (e.g. there is already a file at the given destination, or moving a shared folder into a shared folder). - 404: No file was found at given from_path. - 503: User over storage quota. """ params = {'root': self.session.root, 'from_path': format_path(from_path), 'to_path': format_path(to_path)} url, params, headers = self.request("/fileops/move", params) return self.rest_client.POST(url, params, headers) def metadata(self, path, list=True, file_limit=25000, hash=None, rev=None, include_deleted=False, include_media_info=False): """Retrieve metadata for a file or folder. A typical use would be:: folder_metadata = client.metadata('/') print "metadata:", folder_metadata which would return the metadata of the root folder. This will look something like:: { 'bytes': 0, 'contents': [ { 'bytes': 0, 'icon': 'folder', 'is_dir': True, 'modified': 'Thu, 25 Aug 2011 00:03:15 +0000', 'path': '/Sample Folder', 'rev': '803beb471', 'revision': 8, 'root': 'dropbox', 'size': '0 bytes', 'thumb_exists': False }, { 'bytes': 77, 'icon': 'page_white_text', 'is_dir': False, 'mime_type': 'text/plain', 'modified': 'Wed, 20 Jul 2011 22:04:50 +0000', 'path': '/magnum-opus.txt', 'rev': '362e2029684fe', 'revision': 221922, 'root': 'dropbox', 'size': '77 bytes', 'thumb_exists': False } ], 'hash': 'efdac89c4da886a9cece1927e6c22977', 'icon': 'folder', 'is_dir': True, 'path': '/', 'root': 'app_folder', 'size': '0 bytes', 'thumb_exists': False } In this example, the root folder contains two things: ``Sample Folder``, which is a folder, and ``/magnum-opus.txt``, which is a text file 77 bytes long Parameters path The path to the file or folder. list Whether to list all contained files (only applies when path refers to a folder). file_limit The maximum number of file entries to return within a folder. If the number of files in the folder exceeds this limit, an exception is raised. The server will return at max 25,000 files within a folder. hash Every folder listing has a hash parameter attached that can then be passed back into this function later to save on bandwidth. Rather than returning an unchanged folder's contents, the server will instead return a 304. rev Optional revision of the file to retrieve the metadata for. This parameter only applies for files. If omitted, you'll receive the most recent revision metadata. include_deleted When listing contained files, include files that have been deleted. include_media_info If True, includes additional media info for photos and videos if available (the time a photo was taken, the GPS coordinates of a photo, etc.). Returns A dictionary containing the metadata of the file or folder (and contained files if appropriate). For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#metadata Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 304: Current folder hash matches hash parameters, so contents are unchanged. - 400: Bad request (may be due to many things; check e.error for details). - 404: No file was found at given path. - 406: Too many file entries to return. """ path = "/metadata/%s%s" % (self.session.root, format_path(path)) params = {'file_limit': file_limit, 'list': 'true', 'include_deleted': include_deleted, 'include_media_info': include_media_info, } if not list: params['list'] = 'false' if hash is not None: params['hash'] = hash if rev: params['rev'] = rev url, params, headers = self.request(path, params, method='GET') return self.rest_client.GET(url, headers) def thumbnail(self, from_path, size='m', format='JPEG'): """Download a thumbnail for an image. Parameters from_path The path to the file to be thumbnailed. size A string specifying the desired thumbnail size. Currently supported sizes: ``"xs"`` (32x32), ``"s"`` (64x64), ``"m"`` (128x128), ``"l``" (640x480), ``"xl"`` (1024x768). Check https://www.dropbox.com/developers/core/docs#thumbnails for more details. format The image format the server should use for the returned thumbnail data. Either ``"JPEG"`` or ``"PNG"``. Returns A :class:`dropbox.rest.RESTResponse` that is the HTTP response for the API request. It is a file-like object that can be read from. You must call ``close()`` when you're done. Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 404: No file was found at the given from_path, or files of that type cannot be thumbnailed. - 415: Image is invalid and cannot be thumbnailed. """ assert format in ['JPEG', 'PNG'], \ "expected a thumbnail format of 'JPEG' or 'PNG', got %s" % format path = "/thumbnails/%s%s" % (self.session.root, format_path(from_path)) url, params, headers = self.request(path, {'size': size, 'format': format}, method='GET', content_server=True) return self.rest_client.request("GET", url, headers=headers, raw_response=True) def thumbnail_and_metadata(self, from_path, size='m', format='JPEG'): """Download a thumbnail for an image alongwith its metadata. Acts as a thin wrapper around thumbnail() (see :meth:`thumbnail()` comments for more details) Parameters from_path The path to the file to be thumbnailed. size A string specifying the desired thumbnail size. See :meth:`thumbnail()` for details. format The image format the server should use for the returned thumbnail data. Either ``"JPEG"`` or ``"PNG"``. Returns A pair of ``(response, metadata)``: response A :class:`dropbox.rest.RESTResponse` that is the HTTP response for the API request. It is a file-like object that can be read from. You must call ``close()`` when you're done. metadata A dictionary containing the metadata of the file whose thumbnail was downloaded (see https://www.dropbox.com/developers/core/docs#metadata for details). Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 404: No file was found at the given from_path, or files of that type cannot be thumbnailed. - 415: Image is invalid and cannot be thumbnailed. - 200: Request was okay but response was malformed in some way. """ thumbnail_res = self.thumbnail(from_path, size, format) metadata = DropboxClient.__parse_metadata_as_dict(thumbnail_res) return thumbnail_res, metadata def search(self, path, query, file_limit=1000, include_deleted=False): """Search folder for filenames matching query. Parameters path The folder to search within. query The query to search on (minimum 3 characters). file_limit The maximum number of file entries to return within a folder. The server will return at max 1,000 files. include_deleted Whether to include deleted files in search results. Returns A list of the metadata of all matching files (up to file_limit entries). For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#search Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). """ path = "/search/%s%s" % (self.session.root, format_path(path)) params = { 'query': query, 'file_limit': file_limit, 'include_deleted': include_deleted, } url, params, headers = self.request(path, params) return self.rest_client.POST(url, params, headers) def revisions(self, path, rev_limit=1000): """Retrieve revisions of a file. Parameters path The file to fetch revisions for. Note that revisions are not available for folders. rev_limit The maximum number of file entries to return within a folder. The server will return at max 1,000 revisions. Returns A list of the metadata of all matching files (up to rev_limit entries). For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#revisions Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 404: No revisions were found at the given path. """ path = "/revisions/%s%s" % (self.session.root, format_path(path)) params = { 'rev_limit': rev_limit, } url, params, headers = self.request(path, params, method='GET') return self.rest_client.GET(url, headers) def restore(self, path, rev): """Restore a file to a previous revision. Parameters path The file to restore. Note that folders can't be restored. rev A previous rev value of the file to be restored to. Returns A dictionary containing the metadata of the newly restored file. For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#restore Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 404: Unable to find the file at the given revision. """ path = "/restore/%s%s" % (self.session.root, format_path(path)) params = { 'rev': rev, } url, params, headers = self.request(path, params) return self.rest_client.POST(url, params, headers) def media(self, path): """Get a temporary unauthenticated URL for a media file. All of Dropbox's API methods require OAuth, which may cause problems in situations where an application expects to be able to hit a URL multiple times (for example, a media player seeking around a video file). This method creates a time-limited URL that can be accessed without any authentication, and returns that to you, along with an expiration time. Parameters path The file to return a URL for. Folders are not supported. Returns A dictionary that looks like the following example:: {'url': 'https://dl.dropboxusercontent.com/1/view/abcdefghijk/example', 'expires': 'Thu, 16 Sep 2011 01:01:25 +0000'} For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#media Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 404: Unable to find the file at the given path. """ path = "/media/%s%s" % (self.session.root, format_path(path)) url, params, headers = self.request(path, method='GET') return self.rest_client.GET(url, headers) def share(self, path, short_url=True): """Create a shareable link to a file or folder. Shareable links created on Dropbox are time-limited, but don't require any authentication, so they can be given out freely. The time limit should allow at least a day of shareability, though users have the ability to disable a link from their account if they like. Parameters path The file or folder to share. Returns A dictionary that looks like the following example:: {'url': u'https://db.tt/c0mFuu1Y', 'expires': 'Tue, 01 Jan 2030 00:00:00 +0000'} For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#shares Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 404: Unable to find the file at the given path. """ path = "/shares/%s%s" % (self.session.root, format_path(path)) params = { 'short_url': short_url, } url, params, headers = self.request(path, params, method='GET') return self.rest_client.GET(url, headers) class ChunkedUploader(object): """Contains the logic around a chunked upload, which uploads a large file to Dropbox via the /chunked_upload endpoint. """ def __init__(self, client, file_obj, length): self.client = client self.offset = 0 self.upload_id = None self.last_block = None self.file_obj = file_obj self.target_length = length def upload_chunked(self, chunk_size = 4 * 1024 * 1024): """Uploads data from this ChunkedUploader's file_obj in chunks, until an error occurs. Throws an exception when an error occurs, and can be called again to resume the upload. Parameters chunk_size The number of bytes to put in each chunk. (Default 4 MB.) """ while self.offset < self.target_length: next_chunk_size = min(chunk_size, self.target_length - self.offset) if self.last_block == None: self.last_block = self.file_obj.read(next_chunk_size) try: (self.offset, self.upload_id) = self.client.upload_chunk( StringIO(self.last_block), next_chunk_size, self.offset, self.upload_id) self.last_block = None except ErrorResponse as e: # Handle the case where the server tells us our offset is wrong. must_reraise = True if e.status == 400: reply = e.body if "offset" in reply and reply['offset'] != 0 and reply['offset'] > self.offset: self.last_block = None self.offset = reply['offset'] must_reraise = False if must_reraise: raise def finish(self, path, overwrite=False, parent_rev=None): """Commits the bytes uploaded by this ChunkedUploader to a file in the users dropbox. Parameters path The full path of the file in the Dropbox. overwrite Whether to overwrite an existing file at the given path. (Default ``False``.) If overwrite is False and a file already exists there, Dropbox will rename the upload to make sure it doesn't overwrite anything. You need to check the metadata returned for the new name. This field should only be True if your intent is to potentially clobber changes to a file that you don't know about. parent_rev Optional rev field from the 'parent' of this upload. If your intent is to update the file at the given path, you should pass the parent_rev parameter set to the rev value from the most recent metadata you have of the existing file at that path. If the server has a more recent version of the file at the specified path, it will automatically rename your uploaded file, spinning off a conflict. Using this parameter effectively causes the overwrite parameter to be ignored. The file will always be overwritten if you send the most recent parent_rev, and it will never be overwritten if you send a less recent one. """ path = "/commit_chunked_upload/%s%s" % (self.client.session.root, format_path(path)) params = dict( overwrite = bool(overwrite), upload_id = self.upload_id ) if parent_rev is not None: params['parent_rev'] = parent_rev url, params, headers = self.client.request(path, params, content_server=True) return self.client.rest_client.POST(url, params, headers) # Allow access of ChunkedUploader via DropboxClient for backwards compatibility. DropboxClient.ChunkedUploader = ChunkedUploader class DropboxOAuth2FlowBase(object): def __init__(self, consumer_key, consumer_secret, locale=None, rest_client=RESTClient): self.consumer_key = consumer_key self.consumer_secret = consumer_secret self.locale = locale self.rest_client = rest_client def _get_authorize_url(self, redirect_uri, state): params = dict(response_type='code', client_id=self.consumer_key) if redirect_uri is not None: params['redirect_uri'] = redirect_uri if state is not None: params['state'] = state return self.build_url(BaseSession.WEB_HOST, '/oauth2/authorize', params) def _finish(self, code, redirect_uri): url = self.build_url(BaseSession.API_HOST, '/oauth2/token') params = {'grant_type': 'authorization_code', 'code': code, 'client_id': self.consumer_key, 'client_secret': self.consumer_secret, } if self.locale is not None: params['locale'] = self.locale if redirect_uri is not None: params['redirect_uri'] = redirect_uri response = self.rest_client.POST(url, params=params) access_token = response["access_token"] user_id = response["uid"] return access_token, user_id def build_path(self, target, params=None): """Build the path component for an API URL. This method urlencodes the parameters, adds them to the end of the target url, and puts a marker for the API version in front. Parameters target A target url (e.g. '/files') to build upon. params Optional dictionary of parameters (name to value). Returns The path and parameters components of an API URL. """ if sys.version_info < (3,) and type(target) == str: target = target.encode("utf8") target_path = urllib.parse.quote(target) params = params or {} params = params.copy() if self.locale: params['locale'] = self.locale if params: query_string = params_to_urlencoded(params) return "/%s%s?%s" % (BaseSession.API_VERSION, target_path, query_string) else: return "/%s%s" % (BaseSession.API_VERSION, target_path) def build_url(self, host, target, params=None): """Build an API URL. This method adds scheme and hostname to the path returned from build_path. Parameters target A target url (e.g. '/files') to build upon. params Optional dictionary of parameters (name to value). Returns The full API URL. """ return "https://%s%s" % (host, self.build_path(target, params)) class DropboxOAuth2FlowNoRedirect(DropboxOAuth2FlowBase): """ OAuth 2 authorization helper for apps that can't provide a redirect URI (such as the command-line example apps). Example:: from dropbox.client import DropboxOAuth2FlowNoRedirect, DropboxClient from dropbox import rest as dbrest auth_flow = DropboxOAuth2FlowNoRedirect(APP_KEY, APP_SECRET) authorize_url = auth_flow.start() print "1. Go to: " + authorize_url print "2. Click \\"Allow\\" (you might have to log in first)." print "3. Copy the authorization code." auth_code = raw_input("Enter the authorization code here: ").strip() try: access_token, user_id = auth_flow.finish(auth_code) except dbrest.ErrorResponse, e: print('Error: %s' % (e,)) return c = DropboxClient(access_token) """ def __init__(self, consumer_key, consumer_secret, locale=None, rest_client=None): """ Construct an instance. Parameters consumer_key Your API app's "app key" consumer_secret Your API app's "app secret" locale The locale of the user of your application. For example "en" or "en_US". Some API calls return localized data and error messages; this setting tells the server which locale to use. By default, the server uses "en_US". rest_client Optional :class:`dropbox.rest.RESTClient`-like object to use for making requests. """ if rest_client is None: rest_client = RESTClient super(DropboxOAuth2FlowNoRedirect, self).__init__(consumer_key, consumer_secret, locale, rest_client) def start(self): """ Starts the OAuth 2 authorization process. Returns The URL for a page on Dropbox's website. This page will let the user "approve" your app, which gives your app permission to access the user's Dropbox account. Tell the user to visit this URL and approve your app. """ return self._get_authorize_url(None, None) def finish(self, code): """ If the user approves your app, they will be presented with an "authorization code". Have the user copy/paste that authorization code into your app and then call this method to get an access token. Parameters code The authorization code shown to the user when they approved your app. Returns A pair of ``(access_token, user_id)``. ``access_token`` is a string that can be passed to DropboxClient. ``user_id`` is the Dropbox user ID (string) of the user that just approved your app. Raises The same exceptions as :meth:`DropboxOAuth2Flow.finish()`. """ return self._finish(code, None) class DropboxOAuth2Flow(DropboxOAuth2FlowBase): """ OAuth 2 authorization helper. Use this for web apps. OAuth 2 has a two-step authorization process. The first step is having the user authorize your app. The second involves getting an OAuth 2 access token from Dropbox. Example:: from dropbox.client import DropboxOAuth2Flow, DropboxClient def get_dropbox_auth_flow(web_app_session): redirect_uri = "https://my-web-server.org/dropbox-auth-finish") return DropboxOAuth2Flow(APP_KEY, APP_SECRET, redirect_uri, web_app_session, "dropbox-auth-csrf-token") # URL handler for /dropbox-auth-start def dropbox_auth_start(web_app_session, request): authorize_url = get_dropbox_auth_flow(web_app_session).start() redirect_to(authorize_url) # URL handler for /dropbox-auth-finish def dropbox_auth_finish(web_app_session, request): try: access_token, user_id, url_state = \\ get_dropbox_auth_flow(web_app_session).finish(request.query_params) except DropboxOAuth2Flow.BadRequestException, e: http_status(400) except DropboxOAuth2Flow.BadStateException, e: # Start the auth flow again. redirect_to("/dropbox-auth-start") except DropboxOAuth2Flow.CsrfException, e: http_status(403) except DropboxOAuth2Flow.NotApprovedException, e: flash('Not approved? Why not?') return redirect_to("/home") except DropboxOAuth2Flow.ProviderException, e: logger.log("Auth error: %s" % (e,)) http_status(403) """ def __init__(self, consumer_key, consumer_secret, redirect_uri, session, csrf_token_session_key, locale=None, rest_client=None): """ Construct an instance. Parameters consumer_key Your API app's "app key". consumer_secret Your API app's "app secret". redirect_uri The URI that the Dropbox server will redirect the user to after the user finishes authorizing your app. This URI must be HTTPS-based and pre-registered with the Dropbox servers, though localhost URIs are allowed without pre-registration and can be either HTTP or HTTPS. session A dict-like object that represents the current user's web session (will be used to save the CSRF token). csrf_token_session_key The key to use when storing the CSRF token in the session (for example: "dropbox-auth-csrf-token"). locale The locale of the user of your application. For example "en" or "en_US". Some API calls return localized data and error messages; this setting tells the server which locale to use. By default, the server uses "en_US". rest_client Optional :class:`dropbox.rest.RESTClient`-like object to use for making requests. """ if rest_client is None: rest_client = RESTClient super(DropboxOAuth2Flow, self).__init__(consumer_key, consumer_secret, locale, rest_client) self.redirect_uri = redirect_uri self.session = session self.csrf_token_session_key = csrf_token_session_key def start(self, url_state=None): """ Starts the OAuth 2 authorization process. This function builds an "authorization URL". You should redirect your user's browser to this URL, which will give them an opportunity to grant your app access to their Dropbox account. When the user completes this process, they will be automatically redirected to the ``redirect_uri`` you passed in to the constructor. This function will also save a CSRF token to ``session[csrf_token_session_key]`` (as provided to the constructor). This CSRF token will be checked on :meth:`finish()` to prevent request forgery. Parameters url_state Any data that you would like to keep in the URL through the authorization process. This exact value will be returned to you by :meth:`finish()`. Returns The URL for a page on Dropbox's website. This page will let the user "approve" your app, which gives your app permission to access the user's Dropbox account. Tell the user to visit this URL and approve your app. """ csrf_token = base64.urlsafe_b64encode(os.urandom(16)) state = csrf_token if url_state is not None: state += "|" + url_state self.session[self.csrf_token_session_key] = csrf_token return self._get_authorize_url(self.redirect_uri, state) def finish(self, query_params): """ Call this after the user has visited the authorize URL (see :meth:`start()`), approved your app and was redirected to your redirect URI. Parameters query_params The query parameters on the GET request to your redirect URI. Returns A tuple of ``(access_token, user_id, url_state)``. ``access_token`` can be used to construct a :class:`DropboxClient`. ``user_id`` is the Dropbox user ID (string) of the user that just approved your app. ``url_state`` is the value you originally passed in to :meth:`start()`. Raises :class:`BadRequestException` If the redirect URL was missing parameters or if the given parameters were not valid. :class:`BadStateException` If there's no CSRF token in the session. :class:`CsrfException` If the ``'state'`` query parameter doesn't contain the CSRF token from the user's session. :class:`NotApprovedException` If the user chose not to approve your app. :class:`ProviderException` If Dropbox redirected to your redirect URI with some unexpected error identifier and error message. """ csrf_token_from_session = self.session[self.csrf_token_session_key] # Check well-formedness of request. state = query_params.get('state') if state is None: raise self.BadRequestException("Missing query parameter 'state'.") error = query_params.get('error') error_description = query_params.get('error_description') code = query_params.get('code') if error is not None and code is not None: raise self.BadRequestException("Query parameters 'code' and 'error' are both set; " " only one must be set.") if error is None and code is None: raise self.BadRequestException("Neither query parameter 'code' or 'error' is set.") # Check CSRF token if csrf_token_from_session is None: raise self.BadStateError("Missing CSRF token in session.") if len(csrf_token_from_session) <= 20: raise AssertionError("CSRF token unexpectedly short: %r" % (csrf_token_from_session,)) split_pos = state.find('|') if split_pos < 0: given_csrf_token = state url_state = None else: given_csrf_token = state[0:split_pos] url_state = state[split_pos+1:] if not _safe_equals(csrf_token_from_session, given_csrf_token): raise self.CsrfException("expected %r, got %r" % (csrf_token_from_session, given_csrf_token)) del self.session[self.csrf_token_session_key] # Check for error identifier if error is not None: if error == 'access_denied': # The user clicked "Deny" if error_description is None: raise self.NotApprovedException("No additional description from Dropbox") else: raise self.NotApprovedException("Additional description from Dropbox: " + error_description) else: # All other errors full_message = error if error_description is not None: full_message += ": " + error_description raise self.ProviderError(full_message) # If everything went ok, make the network call to get an access token. access_token, user_id = self._finish(code, self.redirect_uri) return access_token, user_id, url_state class BadRequestException(Exception): """ Thrown if the redirect URL was missing parameters or if the given parameters were not valid. The recommended action is to show an HTTP 400 error page. """ pass class BadStateException(Exception): """ Thrown if all the parameters are correct, but there's no CSRF token in the session. This probably means that the session expired. The recommended action is to redirect the user's browser to try the approval process again. """ pass class CsrfException(Exception): """ Thrown if the given 'state' parameter doesn't contain the CSRF token from the user's session. This is blocked to prevent CSRF attacks. The recommended action is to respond with an HTTP 403 error page. """ pass class NotApprovedException(Exception): """ The user chose not to approve your app. """ pass class ProviderException(Exception): """ Dropbox redirected to your redirect URI with some unexpected error identifier and error message. The recommended action is to log the error, tell the user something went wrong, and let them try again. """ pass def _safe_equals(a, b): if len(a) != len(b): return False res = 0 for ca, cb in zip(a, b): res |= ord(ca) ^ ord(cb) return res == 0 _OAUTH2_ACCESS_TOKEN_PATTERN = re.compile(r'\A[-_~/A-Za-z0-9\.\+]+=*\Z') # From the "Bearer" token spec, RFC 6750. ======= import base64 import re import os import sys import urllib.request, urllib.parse, urllib.error PY3 = sys.version_info[0] == 3 if PY3: from io import StringIO str = str else: from io import StringIO try: import json except ImportError: import simplejson as json from .rest import ErrorResponse, RESTClient, params_to_urlencoded from .session import BaseSession, DropboxSession, DropboxOAuth2Session def format_path(path): """Normalize path for use with the Dropbox API. This function turns multiple adjacent slashes into single slashes, then ensures that there's a leading slash but not a trailing slash. """ if not path: return path path = re.sub(r'/+', '/', path) if path == '/': return ("" if isinstance(path, str) else "") else: return '/' + path.strip('/') class DropboxClient(object): """ This class lets you make Dropbox API calls. You'll need to obtain an OAuth 2 access token first. You can get an access token using either :class:`DropboxOAuth2Flow` or :class:`DropboxOAuth2FlowNoRedirect`. All of the API call methods can raise a :class:`dropbox.rest.ErrorResponse` exception if the server returns a non-200 or invalid HTTP response. Note that a 401 return status at any point indicates that the access token you're using is no longer valid and the user must be put through the OAuth 2 authorization flow again. """ def __init__(self, oauth2_access_token, locale=None, rest_client=None): """Construct a ``DropboxClient`` instance. Parameters oauth2_access_token An OAuth 2 access token (string). For backwards compatibility this may also be a DropboxSession object (see :meth:`create_oauth2_access_token()`). locale The locale of the user of your application. For example "en" or "en_US". Some API calls return localized data and error messages; this setting tells the server which locale to use. By default, the server uses "en_US". rest_client Optional :class:`dropbox.rest.RESTClient`-like object to use for making requests. """ if rest_client is None: rest_client = RESTClient if isinstance(oauth2_access_token, str): if not _OAUTH2_ACCESS_TOKEN_PATTERN.match(oauth2_access_token): raise ValueError("invalid format for oauth2_access_token: %r" % (oauth2_access_token,)) self.session = DropboxOAuth2Session(oauth2_access_token, locale) elif isinstance(oauth2_access_token, DropboxSession): # Backwards compatibility with OAuth 1 if locale is not None: raise ValueError("The 'locale' parameter to DropboxClient is only useful " "when also passing in an OAuth 2 access token") self.session = oauth2_access_token else: raise ValueError("'oauth2_access_token' must either be a string or a DropboxSession") self.rest_client = rest_client def request(self, target, params=None, method='POST', content_server=False, notification_server=False): """ An internal method that builds the url, headers, and params for a Dropbox API request. It is exposed if you need to make API calls not implemented in this library or if you need to debug requests. Parameters target The target URL with leading slash (e.g. '/files'). params A dictionary of parameters to add to the request. method An HTTP method (e.g. 'GET' or 'POST'). content_server A boolean indicating whether the request is to the API content server, for example to fetch the contents of a file rather than its metadata. notification_server A boolean indicating whether the request is to the API notification server, for example for longpolling. Returns A tuple of ``(url, params, headers)`` that should be used to make the request. OAuth will be added as needed within these fields. """ assert method in ['GET','POST', 'PUT'], "Only 'GET', 'POST', and 'PUT' are allowed." assert not (content_server and notification_server), \ "Cannot construct request simultaneously for content and notification servers." if params is None: params = {} if content_server: host = self.session.API_CONTENT_HOST elif notification_server: host = self.session.API_NOTIFICATION_HOST else: host = self.session.API_HOST base = self.session.build_url(host, target) headers, params = self.session.build_access_headers(method, base, params) if method in ('GET', 'PUT'): url = self.session.build_url(host, target, params) else: url = self.session.build_url(host, target) return url, params, headers def account_info(self): """Retrieve information about the user's account. Returns A dictionary containing account information. For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#account-info """ url, params, headers = self.request("/account/info", method='GET') return self.rest_client.GET(url, headers) def disable_access_token(self): """ Disable the access token that this ``DropboxClient`` is using. If this call succeeds, further API calls using this object will fail. """ url, params, headers = self.request("/disable_access_token", method='POST') return self.rest_client.POST(url, params, headers) def create_oauth2_access_token(self): """ If this ``DropboxClient`` was created with an OAuth 1 access token, this method can be used to create an equivalent OAuth 2 access token. This can be used to upgrade your app's existing access tokens from OAuth 1 to OAuth 2. Example:: from dropbox.client import DropboxClient from dropbox.session import DropboxSession session = DropboxSession(APP_KEY, APP_SECRET) access_key, access_secret = '123abc', 'xyz456' # Previously obtained OAuth 1 credentials session.set_token(access_key, access_secret) client = DropboxClient(session) token = client.create_oauth2_access_token() # Optionally, create a new client using the new token new_client = DropboxClient(token) """ if not isinstance(self.session, DropboxSession): raise ValueError("This call requires a DropboxClient that is configured with an " "OAuth 1 access token.") url, params, headers = self.request("/oauth2/token_from_oauth1", method='POST') r = self.rest_client.POST(url, params, headers) return r['access_token'] def get_chunked_uploader(self, file_obj, length): """Creates a :class:`ChunkedUploader` to upload the given file-like object. Parameters file_obj The file-like object which is the source of the data being uploaded. length The number of bytes to upload. The expected use of this function is as follows:: bigFile = open("data.txt", 'rb') uploader = myclient.get_chunked_uploader(bigFile, size) print "uploading: ", size while uploader.offset < size: try: upload = uploader.upload_chunked() except rest.ErrorResponse, e: # perform error handling and retry logic uploader.finish('/bigFile.txt') The SDK leaves the error handling and retry logic to the developer to implement, as the exact requirements will depend on the application involved. """ return ChunkedUploader(self, file_obj, length) def upload_chunk(self, file_obj, length=None, offset=0, upload_id=None): """Uploads a single chunk of data from a string or file-like object. The majority of users should use the :class:`ChunkedUploader` object, which provides a simpler interface to the chunked_upload API endpoint. Parameters file_obj The source of the chunk to upload; a file-like object or a string. length This argument is ignored but still present for backward compatibility reasons. offset The byte offset to which this source data corresponds in the original file. upload_id The upload identifier for which this chunk should be uploaded, returned by a previous call, or None to start a new upload. Returns A dictionary containing the keys: upload_id A string used to identify the upload for subsequent calls to :meth:`upload_chunk()` and :meth:`commit_chunked_upload()`. offset The offset at which the next upload should be applied. expires The time after which this partial upload is invalid. """ params = dict() if upload_id: params['upload_id'] = upload_id params['offset'] = offset url, ignored_params, headers = self.request("/chunked_upload", params, method='PUT', content_server=True) try: reply = self.rest_client.PUT(url, file_obj, headers) return reply['offset'], reply['upload_id'] except ErrorResponse as e: raise e def commit_chunked_upload(self, full_path, upload_id, overwrite=False, parent_rev=None): """Commit the previously uploaded chunks for the given path. Parameters full_path The full path to which the chunks are uploaded, *including the file name*. If the destination folder does not yet exist, it will be created. upload_id The chunked upload identifier, previously returned from upload_chunk. overwrite Whether to overwrite an existing file at the given path. (Default ``False``.) If overwrite is False and a file already exists there, Dropbox will rename the upload to make sure it doesn't overwrite anything. You need to check the metadata returned for the new name. This field should only be True if your intent is to potentially clobber changes to a file that you don't know about. parent_rev Optional rev field from the 'parent' of this upload. If your intent is to update the file at the given path, you should pass the parent_rev parameter set to the rev value from the most recent metadata you have of the existing file at that path. If the server has a more recent version of the file at the specified path, it will automatically rename your uploaded file, spinning off a conflict. Using this parameter effectively causes the overwrite parameter to be ignored. The file will always be overwritten if you send the most recent parent_rev, and it will never be overwritten if you send a less recent one. Returns A dictionary containing the metadata of the newly committed file. For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#commit-chunked-upload """ params = { 'upload_id': upload_id, 'overwrite': overwrite, } if parent_rev is not None: params['parent_rev'] = parent_rev url, params, headers = self.request("/commit_chunked_upload/%s" % full_path, params, content_server=True) return self.rest_client.POST(url, params, headers) def put_file(self, full_path, file_obj, overwrite=False, parent_rev=None): """Upload a file. A typical use case would be as follows:: f = open('working-draft.txt', 'rb') response = client.put_file('/magnum-opus.txt', f) print "uploaded:", response which would return the metadata of the uploaded file, similar to:: { 'bytes': 77, 'icon': 'page_white_text', 'is_dir': False, 'mime_type': 'text/plain', 'modified': 'Wed, 20 Jul 2011 22:04:50 +0000', 'path': '/magnum-opus.txt', 'rev': '362e2029684fe', 'revision': 221922, 'root': 'dropbox', 'size': '77 bytes', 'thumb_exists': False } Parameters full_path The full path to upload the file to, *including the file name*. If the destination folder does not yet exist, it will be created. file_obj A file-like object to upload. If you would like, you can pass a string as file_obj. overwrite Whether to overwrite an existing file at the given path. (Default ``False``.) If overwrite is False and a file already exists there, Dropbox will rename the upload to make sure it doesn't overwrite anything. You need to check the metadata returned for the new name. This field should only be True if your intent is to potentially clobber changes to a file that you don't know about. parent_rev Optional rev field from the 'parent' of this upload. If your intent is to update the file at the given path, you should pass the parent_rev parameter set to the rev value from the most recent metadata you have of the existing file at that path. If the server has a more recent version of the file at the specified path, it will automatically rename your uploaded file, spinning off a conflict. Using this parameter effectively causes the overwrite parameter to be ignored. The file will always be overwritten if you send the most recent parent_rev, and it will never be overwritten if you send a less recent one. Returns A dictionary containing the metadata of the newly uploaded file. For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#files-put Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 503: User over quota. """ path = "/files_put/%s%s" % (self.session.root, format_path(full_path)) params = { 'overwrite': bool(overwrite), } if parent_rev is not None: params['parent_rev'] = parent_rev url, params, headers = self.request(path, params, method='PUT', content_server=True) return self.rest_client.PUT(url, file_obj, headers) def get_file(self, from_path, rev=None, start=None, length=None): """Download a file. Example:: out = open('magnum-opus.txt', 'wb') with client.get_file('/magnum-opus.txt') as f: out.write(f.read()) which would download the file ``magnum-opus.txt`` and write the contents into the file ``magnum-opus.txt`` on the local filesystem. Parameters from_path The path to the file to be downloaded. rev Optional previous rev value of the file to be downloaded. start Optional byte value from which to start downloading. length Optional length in bytes for partially downloading the file. If ``length`` is specified but ``start`` is not, then the last ``length`` bytes will be downloaded. Returns A :class:`dropbox.rest.RESTResponse` that is the HTTP response for the API request. It is a file-like object that can be read from. You must call ``close()`` when you're done. Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 404: No file was found at the given path, or the file that was there was deleted. - 200: Request was okay but response was malformed in some way. """ path = "/files/%s%s" % (self.session.root, format_path(from_path)) params = {} if rev is not None: params['rev'] = rev url, params, headers = self.request(path, params, method='GET', content_server=True) if start is not None: if length: headers['Range'] = 'bytes=%s-%s' % (start, start + length - 1) else: headers['Range'] = 'bytes=%s-' % start elif length is not None: headers['Range'] = 'bytes=-%s' % length return self.rest_client.request("GET", url, headers=headers, raw_response=True) def get_file_and_metadata(self, from_path, rev=None): """Download a file alongwith its metadata. Acts as a thin wrapper around get_file() (see :meth:`get_file()` comments for more details) A typical usage looks like this:: out = open('magnum-opus.txt', 'wb') f, metadata = client.get_file_and_metadata('/magnum-opus.txt') with f: out.write(f.read()) Parameters from_path The path to the file to be downloaded. rev Optional previous rev value of the file to be downloaded. Returns A pair of ``(response, metadata)``: response A :class:`dropbox.rest.RESTResponse` that is the HTTP response for the API request. It is a file-like object that can be read from. You must call ``close()`` when you're done. metadata A dictionary containing the metadata of the file (see https://www.dropbox.com/developers/core/docs#metadata for details). Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 404: No file was found at the given path, or the file that was there was deleted. - 200: Request was okay but response was malformed in some way. """ file_res = self.get_file(from_path, rev) metadata = DropboxClient.__parse_metadata_as_dict(file_res) return file_res, metadata @staticmethod def __parse_metadata_as_dict(dropbox_raw_response): # Parses file metadata from a raw dropbox HTTP response, raising a # dropbox.rest.ErrorResponse if parsing fails. metadata = None for header, header_val in dropbox_raw_response.getheaders().items(): if header.lower() == 'x-dropbox-metadata': try: metadata = json.loads(header_val) except ValueError: raise ErrorResponse(dropbox_raw_response) if not metadata: raise ErrorResponse(dropbox_raw_response) return metadata def delta(self, cursor=None, path_prefix=None, include_media_info=False): """A way of letting you keep up with changes to files and folders in a user's Dropbox. You can periodically call delta() to get a list of "delta entries", which are instructions on how to update your local state to match the server's state. Parameters cursor On the first call, omit this argument (or pass in ``None``). On subsequent calls, pass in the ``cursor`` string returned by the previous call. path_prefix If provided, results will be limited to files and folders whose paths are equal to or under ``path_prefix``. The ``path_prefix`` is fixed for a given cursor. Whatever ``path_prefix`` you use on the first ``delta()`` must also be passed in on subsequent calls that use the returned cursor. include_media_info If True, delta will return additional media info for photos and videos (the time a photo was taken, the GPS coordinates of a photo, etc.). There is a delay between when a file is uploaded to Dropbox and when this information is available; delta will only include a file in the changelist once its media info is ready. The value you use on the first ``delta()`` must also be passed in on subsequent calls that use the returned cursor. Returns A dict with four keys: entries A list of "delta entries" (described below). reset If ``True``, you should your local state to be an empty folder before processing the list of delta entries. This is only ``True`` only in rare situations. cursor A string that is used to keep track of your current state. On the next call to delta(), pass in this value to return entries that were recorded since the cursor was returned. has_more If ``True``, then there are more entries available; you can call delta() again immediately to retrieve those entries. If ``False``, then wait at least 5 minutes (preferably longer) before checking again. Delta Entries: Each entry is a 2-item list of one of following forms: - [*path*, *metadata*]: Indicates that there is a file/folder at the given path. You should add the entry to your local path. (The *metadata* value is the same as what would be returned by the ``metadata()`` call.) - If the new entry includes parent folders that don't yet exist in your local state, create those parent folders in your local state. You will eventually get entries for those parent folders. - If the new entry is a file, replace whatever your local state has at *path* with the new entry. - If the new entry is a folder, check what your local state has at *path*. If it's a file, replace it with the new entry. If it's a folder, apply the new *metadata* to the folder, but do not modify the folder's children. - [*path*, ``None``]: Indicates that there is no file/folder at the *path* on Dropbox. To update your local state to match, delete whatever is at *path*, including any children (you will sometimes also get "delete" delta entries for the children, but this is not guaranteed). If your local state doesn't have anything at *path*, ignore this entry. Remember: Dropbox treats file names in a case-insensitive but case-preserving way. To facilitate this, the *path* strings above are lower-cased versions of the actual path. The *metadata* dicts have the original, case-preserved path. """ path = "/delta" params = {'include_media_info': include_media_info} if cursor is not None: params['cursor'] = cursor if path_prefix is not None: params['path_prefix'] = path_prefix url, params, headers = self.request(path, params) return self.rest_client.POST(url, params, headers) def longpoll_delta(self, cursor, timeout=None): """A long-poll endpoint to wait for changes on an account. In conjunction with :meth:`delta()`, this call gives you a low-latency way to monitor an account for file changes. Note that this call goes to ``api-notify.dropbox.com`` instead of ``api.dropbox.com``. Unlike most other API endpoints, this call does not require OAuth authentication. The passed-in cursor can only be acquired via an authenticated call to :meth:`delta()`. Parameters cursor A delta cursor as returned from a call to :meth:`delta()`. Note that a cursor returned from a call to :meth:`delta()` with ``include_media_info=True`` is incompatible with ``longpoll_delta()`` and an error will be returned. timeout An optional integer indicating a timeout, in seconds. The default value is 30 seconds, which is also the minimum allowed value. The maximum is 480 seconds. The request will block for at most this length of time, plus up to 90 seconds of random jitter added to avoid the thundering herd problem. Care should be taken when using this parameter, as some network infrastructure does not support long timeouts. Returns The connection will block until there are changes available or a timeout occurs. The response will be a dictionary that looks like the following example:: {"changes": false, "backoff": 60} For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#longpoll-delta Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (generally due to an invalid parameter; check e.error for details). """ path = "/longpoll_delta" params = {'cursor': cursor} if timeout is not None: params['timeout'] = timeout url, params, headers = self.request(path, params, method='GET', notification_server=True) return self.rest_client.GET(url, headers) def create_copy_ref(self, from_path): """Creates and returns a copy ref for a specific file. The copy ref can be used to instantly copy that file to the Dropbox of another account. Parameters path The path to the file for a copy ref to be created on. Returns A dictionary that looks like the following example:: {"expires": "Fri, 31 Jan 2042 21:01:05 +0000", "copy_ref": "z1X6ATl6aWtzOGq0c3g5Ng"} """ path = "/copy_ref/%s%s" % (self.session.root, format_path(from_path)) url, params, headers = self.request(path, {}, method='GET') return self.rest_client.GET(url, headers) def add_copy_ref(self, copy_ref, to_path): """Adds the file referenced by the copy ref to the specified path Parameters copy_ref A copy ref string that was returned from a create_copy_ref call. The copy_ref can be created from any other Dropbox account, or from the same account. path The path to where the file will be created. Returns A dictionary containing the metadata of the new copy of the file. """ path = "/fileops/copy" params = {'from_copy_ref': copy_ref, 'to_path': format_path(to_path), 'root': self.session.root} url, params, headers = self.request(path, params) return self.rest_client.POST(url, params, headers) def file_copy(self, from_path, to_path): """Copy a file or folder to a new location. Parameters from_path The path to the file or folder to be copied. to_path The destination path of the file or folder to be copied. This parameter should include the destination filename (e.g. from_path: '/test.txt', to_path: '/dir/test.txt'). If there's already a file at the to_path it will raise an ErrorResponse. Returns A dictionary containing the metadata of the new copy of the file or folder. For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#fileops-copy Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 403: An invalid copy operation was attempted (e.g. there is already a file at the given destination, or trying to copy a shared folder). - 404: No file was found at given from_path. - 503: User over storage quota. """ params = {'root': self.session.root, 'from_path': format_path(from_path), 'to_path': format_path(to_path), } url, params, headers = self.request("/fileops/copy", params) return self.rest_client.POST(url, params, headers) def file_create_folder(self, path): """Create a folder. Parameters path The path of the new folder. Returns A dictionary containing the metadata of the newly created folder. For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#fileops-create-folder Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 403: A folder at that path already exists. """ params = {'root': self.session.root, 'path': format_path(path)} url, params, headers = self.request("/fileops/create_folder", params) return self.rest_client.POST(url, params, headers) def file_delete(self, path): """Delete a file or folder. Parameters path The path of the file or folder. Returns A dictionary containing the metadata of the just deleted file. For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#fileops-delete Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 404: No file was found at the given path. """ params = {'root': self.session.root, 'path': format_path(path)} url, params, headers = self.request("/fileops/delete", params) return self.rest_client.POST(url, params, headers) def file_move(self, from_path, to_path): """Move a file or folder to a new location. Parameters from_path The path to the file or folder to be moved. to_path The destination path of the file or folder to be moved. This parameter should include the destination filename (e.g. if ``from_path`` is ``'/test.txt'``, ``to_path`` might be ``'/dir/test.txt'``). If there's already a file at the ``to_path`` it will raise an ErrorResponse. Returns A dictionary containing the metadata of the new copy of the file or folder. For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#fileops-move Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 403: An invalid move operation was attempted (e.g. there is already a file at the given destination, or moving a shared folder into a shared folder). - 404: No file was found at given from_path. - 503: User over storage quota. """ params = {'root': self.session.root, 'from_path': format_path(from_path), 'to_path': format_path(to_path)} url, params, headers = self.request("/fileops/move", params) return self.rest_client.POST(url, params, headers) def metadata(self, path, list=True, file_limit=25000, hash=None, rev=None, include_deleted=False, include_media_info=False): """Retrieve metadata for a file or folder. A typical use would be:: folder_metadata = client.metadata('/') print "metadata:", folder_metadata which would return the metadata of the root folder. This will look something like:: { 'bytes': 0, 'contents': [ { 'bytes': 0, 'icon': 'folder', 'is_dir': True, 'modified': 'Thu, 25 Aug 2011 00:03:15 +0000', 'path': '/Sample Folder', 'rev': '803beb471', 'revision': 8, 'root': 'dropbox', 'size': '0 bytes', 'thumb_exists': False }, { 'bytes': 77, 'icon': 'page_white_text', 'is_dir': False, 'mime_type': 'text/plain', 'modified': 'Wed, 20 Jul 2011 22:04:50 +0000', 'path': '/magnum-opus.txt', 'rev': '362e2029684fe', 'revision': 221922, 'root': 'dropbox', 'size': '77 bytes', 'thumb_exists': False } ], 'hash': 'efdac89c4da886a9cece1927e6c22977', 'icon': 'folder', 'is_dir': True, 'path': '/', 'root': 'app_folder', 'size': '0 bytes', 'thumb_exists': False } In this example, the root folder contains two things: ``Sample Folder``, which is a folder, and ``/magnum-opus.txt``, which is a text file 77 bytes long Parameters path The path to the file or folder. list Whether to list all contained files (only applies when path refers to a folder). file_limit The maximum number of file entries to return within a folder. If the number of files in the folder exceeds this limit, an exception is raised. The server will return at max 25,000 files within a folder. hash Every folder listing has a hash parameter attached that can then be passed back into this function later to save on bandwidth. Rather than returning an unchanged folder's contents, the server will instead return a 304. rev Optional revision of the file to retrieve the metadata for. This parameter only applies for files. If omitted, you'll receive the most recent revision metadata. include_deleted When listing contained files, include files that have been deleted. include_media_info If True, includes additional media info for photos and videos if available (the time a photo was taken, the GPS coordinates of a photo, etc.). Returns A dictionary containing the metadata of the file or folder (and contained files if appropriate). For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#metadata Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 304: Current folder hash matches hash parameters, so contents are unchanged. - 400: Bad request (may be due to many things; check e.error for details). - 404: No file was found at given path. - 406: Too many file entries to return. """ path = "/metadata/%s%s" % (self.session.root, format_path(path)) params = {'file_limit': file_limit, 'list': 'true', 'include_deleted': include_deleted, 'include_media_info': include_media_info, } if not list: params['list'] = 'false' if hash is not None: params['hash'] = hash if rev: params['rev'] = rev url, params, headers = self.request(path, params, method='GET') return self.rest_client.GET(url, headers) def thumbnail(self, from_path, size='m', format='JPEG'): """Download a thumbnail for an image. Parameters from_path The path to the file to be thumbnailed. size A string specifying the desired thumbnail size. Currently supported sizes: ``"xs"`` (32x32), ``"s"`` (64x64), ``"m"`` (128x128), ``"l``" (640x480), ``"xl"`` (1024x768). Check https://www.dropbox.com/developers/core/docs#thumbnails for more details. format The image format the server should use for the returned thumbnail data. Either ``"JPEG"`` or ``"PNG"``. Returns A :class:`dropbox.rest.RESTResponse` that is the HTTP response for the API request. It is a file-like object that can be read from. You must call ``close()`` when you're done. Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 404: No file was found at the given from_path, or files of that type cannot be thumbnailed. - 415: Image is invalid and cannot be thumbnailed. """ assert format in ['JPEG', 'PNG'], \ "expected a thumbnail format of 'JPEG' or 'PNG', got %s" % format path = "/thumbnails/%s%s" % (self.session.root, format_path(from_path)) url, params, headers = self.request(path, {'size': size, 'format': format}, method='GET', content_server=True) return self.rest_client.request("GET", url, headers=headers, raw_response=True) def thumbnail_and_metadata(self, from_path, size='m', format='JPEG'): """Download a thumbnail for an image alongwith its metadata. Acts as a thin wrapper around thumbnail() (see :meth:`thumbnail()` comments for more details) Parameters from_path The path to the file to be thumbnailed. size A string specifying the desired thumbnail size. See :meth:`thumbnail()` for details. format The image format the server should use for the returned thumbnail data. Either ``"JPEG"`` or ``"PNG"``. Returns A pair of ``(response, metadata)``: response A :class:`dropbox.rest.RESTResponse` that is the HTTP response for the API request. It is a file-like object that can be read from. You must call ``close()`` when you're done. metadata A dictionary containing the metadata of the file whose thumbnail was downloaded (see https://www.dropbox.com/developers/core/docs#metadata for details). Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 404: No file was found at the given from_path, or files of that type cannot be thumbnailed. - 415: Image is invalid and cannot be thumbnailed. - 200: Request was okay but response was malformed in some way. """ thumbnail_res = self.thumbnail(from_path, size, format) metadata = DropboxClient.__parse_metadata_as_dict(thumbnail_res) return thumbnail_res, metadata def search(self, path, query, file_limit=1000, include_deleted=False): """Search folder for filenames matching query. Parameters path The folder to search within. query The query to search on (minimum 3 characters). file_limit The maximum number of file entries to return within a folder. The server will return at max 1,000 files. include_deleted Whether to include deleted files in search results. Returns A list of the metadata of all matching files (up to file_limit entries). For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#search Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). """ path = "/search/%s%s" % (self.session.root, format_path(path)) params = { 'query': query, 'file_limit': file_limit, 'include_deleted': include_deleted, } url, params, headers = self.request(path, params) return self.rest_client.POST(url, params, headers) def revisions(self, path, rev_limit=1000): """Retrieve revisions of a file. Parameters path The file to fetch revisions for. Note that revisions are not available for folders. rev_limit The maximum number of file entries to return within a folder. The server will return at max 1,000 revisions. Returns A list of the metadata of all matching files (up to rev_limit entries). For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#revisions Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 404: No revisions were found at the given path. """ path = "/revisions/%s%s" % (self.session.root, format_path(path)) params = { 'rev_limit': rev_limit, } url, params, headers = self.request(path, params, method='GET') return self.rest_client.GET(url, headers) def restore(self, path, rev): """Restore a file to a previous revision. Parameters path The file to restore. Note that folders can't be restored. rev A previous rev value of the file to be restored to. Returns A dictionary containing the metadata of the newly restored file. For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#restore Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 404: Unable to find the file at the given revision. """ path = "/restore/%s%s" % (self.session.root, format_path(path)) params = { 'rev': rev, } url, params, headers = self.request(path, params) return self.rest_client.POST(url, params, headers) def media(self, path): """Get a temporary unauthenticated URL for a media file. All of Dropbox's API methods require OAuth, which may cause problems in situations where an application expects to be able to hit a URL multiple times (for example, a media player seeking around a video file). This method creates a time-limited URL that can be accessed without any authentication, and returns that to you, along with an expiration time. Parameters path The file to return a URL for. Folders are not supported. Returns A dictionary that looks like the following example:: {'url': 'https://dl.dropboxusercontent.com/1/view/abcdefghijk/example', 'expires': 'Thu, 16 Sep 2011 01:01:25 +0000'} For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#media Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 404: Unable to find the file at the given path. """ path = "/media/%s%s" % (self.session.root, format_path(path)) url, params, headers = self.request(path, method='GET') return self.rest_client.GET(url, headers) def share(self, path, short_url=True): """Create a shareable link to a file or folder. Shareable links created on Dropbox are time-limited, but don't require any authentication, so they can be given out freely. The time limit should allow at least a day of shareability, though users have the ability to disable a link from their account if they like. Parameters path The file or folder to share. Returns A dictionary that looks like the following example:: {'url': u'https://db.tt/c0mFuu1Y', 'expires': 'Tue, 01 Jan 2030 00:00:00 +0000'} For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#shares Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 404: Unable to find the file at the given path. """ path = "/shares/%s%s" % (self.session.root, format_path(path)) params = { 'short_url': short_url, } url, params, headers = self.request(path, params, method='GET') return self.rest_client.GET(url, headers) class ChunkedUploader(object): """Contains the logic around a chunked upload, which uploads a large file to Dropbox via the /chunked_upload endpoint. """ def __init__(self, client, file_obj, length): self.client = client self.offset = 0 self.upload_id = None self.last_block = None self.file_obj = file_obj self.target_length = length def upload_chunked(self, chunk_size = 4 * 1024 * 1024): """Uploads data from this ChunkedUploader's file_obj in chunks, until an error occurs. Throws an exception when an error occurs, and can be called again to resume the upload. Parameters chunk_size The number of bytes to put in each chunk. (Default 4 MB.) """ while self.offset < self.target_length: next_chunk_size = min(chunk_size, self.target_length - self.offset) if self.last_block == None: self.last_block = self.file_obj.read(next_chunk_size) try: (self.offset, self.upload_id) = self.client.upload_chunk( StringIO(self.last_block), next_chunk_size, self.offset, self.upload_id) self.last_block = None except ErrorResponse as e: # Handle the case where the server tells us our offset is wrong. must_reraise = True if e.status == 400: reply = e.body if "offset" in reply and reply['offset'] != 0 and reply['offset'] > self.offset: self.last_block = None self.offset = reply['offset'] must_reraise = False if must_reraise: raise def finish(self, path, overwrite=False, parent_rev=None): """Commits the bytes uploaded by this ChunkedUploader to a file in the users dropbox. Parameters path The full path of the file in the Dropbox. overwrite Whether to overwrite an existing file at the given path. (Default ``False``.) If overwrite is False and a file already exists there, Dropbox will rename the upload to make sure it doesn't overwrite anything. You need to check the metadata returned for the new name. This field should only be True if your intent is to potentially clobber changes to a file that you don't know about. parent_rev Optional rev field from the 'parent' of this upload. If your intent is to update the file at the given path, you should pass the parent_rev parameter set to the rev value from the most recent metadata you have of the existing file at that path. If the server has a more recent version of the file at the specified path, it will automatically rename your uploaded file, spinning off a conflict. Using this parameter effectively causes the overwrite parameter to be ignored. The file will always be overwritten if you send the most recent parent_rev, and it will never be overwritten if you send a less recent one. """ path = "/commit_chunked_upload/%s%s" % (self.client.session.root, format_path(path)) params = dict( overwrite = bool(overwrite), upload_id = self.upload_id ) if parent_rev is not None: params['parent_rev'] = parent_rev url, params, headers = self.client.request(path, params, content_server=True) return self.client.rest_client.POST(url, params, headers) # Allow access of ChunkedUploader via DropboxClient for backwards compatibility. DropboxClient.ChunkedUploader = ChunkedUploader class DropboxOAuth2FlowBase(object): def __init__(self, consumer_key, consumer_secret, locale=None, rest_client=RESTClient): self.consumer_key = consumer_key self.consumer_secret = consumer_secret self.locale = locale self.rest_client = rest_client def _get_authorize_url(self, redirect_uri, state): params = dict(response_type='code', client_id=self.consumer_key) if redirect_uri is not None: params['redirect_uri'] = redirect_uri if state is not None: params['state'] = state return self.build_url(BaseSession.WEB_HOST, '/oauth2/authorize', params) def _finish(self, code, redirect_uri): url = self.build_url(BaseSession.API_HOST, '/oauth2/token') params = {'grant_type': 'authorization_code', 'code': code, 'client_id': self.consumer_key, 'client_secret': self.consumer_secret, } if self.locale is not None: params['locale'] = self.locale if redirect_uri is not None: params['redirect_uri'] = redirect_uri response = self.rest_client.POST(url, params=params) access_token = response["access_token"] user_id = response["uid"] return access_token, user_id def build_path(self, target, params=None): """Build the path component for an API URL. This method urlencodes the parameters, adds them to the end of the target url, and puts a marker for the API version in front. Parameters target A target url (e.g. '/files') to build upon. params Optional dictionary of parameters (name to value). Returns The path and parameters components of an API URL. """ if sys.version_info < (3,) and type(target) == str: target = target.encode("utf8") target_path = urllib.parse.quote(target) params = params or {} params = params.copy() if self.locale: params['locale'] = self.locale if params: query_string = params_to_urlencoded(params) return "/%s%s?%s" % (BaseSession.API_VERSION, target_path, query_string) else: return "/%s%s" % (BaseSession.API_VERSION, target_path) def build_url(self, host, target, params=None): """Build an API URL. This method adds scheme and hostname to the path returned from build_path. Parameters target A target url (e.g. '/files') to build upon. params Optional dictionary of parameters (name to value). Returns The full API URL. """ return "https://%s%s" % (host, self.build_path(target, params)) class DropboxOAuth2FlowNoRedirect(DropboxOAuth2FlowBase): """ OAuth 2 authorization helper for apps that can't provide a redirect URI (such as the command-line example apps). Example:: from dropbox.client import DropboxOAuth2FlowNoRedirect, DropboxClient from dropbox import rest as dbrest auth_flow = DropboxOAuth2FlowNoRedirect(APP_KEY, APP_SECRET) authorize_url = auth_flow.start() print "1. Go to: " + authorize_url print "2. Click \\"Allow\\" (you might have to log in first)." print "3. Copy the authorization code." auth_code = raw_input("Enter the authorization code here: ").strip() try: access_token, user_id = auth_flow.finish(auth_code) except dbrest.ErrorResponse, e: print('Error: %s' % (e,)) return c = DropboxClient(access_token) """ def __init__(self, consumer_key, consumer_secret, locale=None, rest_client=None): """ Construct an instance. Parameters consumer_key Your API app's "app key" consumer_secret Your API app's "app secret" locale The locale of the user of your application. For example "en" or "en_US". Some API calls return localized data and error messages; this setting tells the server which locale to use. By default, the server uses "en_US". rest_client Optional :class:`dropbox.rest.RESTClient`-like object to use for making requests. """ if rest_client is None: rest_client = RESTClient super(DropboxOAuth2FlowNoRedirect, self).__init__(consumer_key, consumer_secret, locale, rest_client) def start(self): """ Starts the OAuth 2 authorization process. Returns The URL for a page on Dropbox's website. This page will let the user "approve" your app, which gives your app permission to access the user's Dropbox account. Tell the user to visit this URL and approve your app. """ return self._get_authorize_url(None, None) def finish(self, code): """ If the user approves your app, they will be presented with an "authorization code". Have the user copy/paste that authorization code into your app and then call this method to get an access token. Parameters code The authorization code shown to the user when they approved your app. Returns A pair of ``(access_token, user_id)``. ``access_token`` is a string that can be passed to DropboxClient. ``user_id`` is the Dropbox user ID (string) of the user that just approved your app. Raises The same exceptions as :meth:`DropboxOAuth2Flow.finish()`. """ return self._finish(code, None) class DropboxOAuth2Flow(DropboxOAuth2FlowBase): """ OAuth 2 authorization helper. Use this for web apps. OAuth 2 has a two-step authorization process. The first step is having the user authorize your app. The second involves getting an OAuth 2 access token from Dropbox. Example:: from dropbox.client import DropboxOAuth2Flow, DropboxClient def get_dropbox_auth_flow(web_app_session): redirect_uri = "https://my-web-server.org/dropbox-auth-finish") return DropboxOAuth2Flow(APP_KEY, APP_SECRET, redirect_uri, web_app_session, "dropbox-auth-csrf-token") # URL handler for /dropbox-auth-start def dropbox_auth_start(web_app_session, request): authorize_url = get_dropbox_auth_flow(web_app_session).start() redirect_to(authorize_url) # URL handler for /dropbox-auth-finish def dropbox_auth_finish(web_app_session, request): try: access_token, user_id, url_state = \\ get_dropbox_auth_flow(web_app_session).finish(request.query_params) except DropboxOAuth2Flow.BadRequestException, e: http_status(400) except DropboxOAuth2Flow.BadStateException, e: # Start the auth flow again. redirect_to("/dropbox-auth-start") except DropboxOAuth2Flow.CsrfException, e: http_status(403) except DropboxOAuth2Flow.NotApprovedException, e: flash('Not approved? Why not?') return redirect_to("/home") except DropboxOAuth2Flow.ProviderException, e: logger.log("Auth error: %s" % (e,)) http_status(403) """ def __init__(self, consumer_key, consumer_secret, redirect_uri, session, csrf_token_session_key, locale=None, rest_client=None): """ Construct an instance. Parameters consumer_key Your API app's "app key". consumer_secret Your API app's "app secret". redirect_uri The URI that the Dropbox server will redirect the user to after the user finishes authorizing your app. This URI must be HTTPS-based and pre-registered with the Dropbox servers, though localhost URIs are allowed without pre-registration and can be either HTTP or HTTPS. session A dict-like object that represents the current user's web session (will be used to save the CSRF token). csrf_token_session_key The key to use when storing the CSRF token in the session (for example: "dropbox-auth-csrf-token"). locale The locale of the user of your application. For example "en" or "en_US". Some API calls return localized data and error messages; this setting tells the server which locale to use. By default, the server uses "en_US". rest_client Optional :class:`dropbox.rest.RESTClient`-like object to use for making requests. """ if rest_client is None: rest_client = RESTClient super(DropboxOAuth2Flow, self).__init__(consumer_key, consumer_secret, locale, rest_client) self.redirect_uri = redirect_uri self.session = session self.csrf_token_session_key = csrf_token_session_key def start(self, url_state=None): """ Starts the OAuth 2 authorization process. This function builds an "authorization URL". You should redirect your user's browser to this URL, which will give them an opportunity to grant your app access to their Dropbox account. When the user completes this process, they will be automatically redirected to the ``redirect_uri`` you passed in to the constructor. This function will also save a CSRF token to ``session[csrf_token_session_key]`` (as provided to the constructor). This CSRF token will be checked on :meth:`finish()` to prevent request forgery. Parameters url_state Any data that you would like to keep in the URL through the authorization process. This exact value will be returned to you by :meth:`finish()`. Returns The URL for a page on Dropbox's website. This page will let the user "approve" your app, which gives your app permission to access the user's Dropbox account. Tell the user to visit this URL and approve your app. """ csrf_token = base64.urlsafe_b64encode(os.urandom(16)) state = csrf_token if url_state is not None: state += "|" + url_state self.session[self.csrf_token_session_key] = csrf_token return self._get_authorize_url(self.redirect_uri, state) def finish(self, query_params): """ Call this after the user has visited the authorize URL (see :meth:`start()`), approved your app and was redirected to your redirect URI. Parameters query_params The query parameters on the GET request to your redirect URI. Returns A tuple of ``(access_token, user_id, url_state)``. ``access_token`` can be used to construct a :class:`DropboxClient`. ``user_id`` is the Dropbox user ID (string) of the user that just approved your app. ``url_state`` is the value you originally passed in to :meth:`start()`. Raises :class:`BadRequestException` If the redirect URL was missing parameters or if the given parameters were not valid. :class:`BadStateException` If there's no CSRF token in the session. :class:`CsrfException` If the ``'state'`` query parameter doesn't contain the CSRF token from the user's session. :class:`NotApprovedException` If the user chose not to approve your app. :class:`ProviderException` If Dropbox redirected to your redirect URI with some unexpected error identifier and error message. """ csrf_token_from_session = self.session[self.csrf_token_session_key] # Check well-formedness of request. state = query_params.get('state') if state is None: raise self.BadRequestException("Missing query parameter 'state'.") error = query_params.get('error') error_description = query_params.get('error_description') code = query_params.get('code') if error is not None and code is not None: raise self.BadRequestException("Query parameters 'code' and 'error' are both set; " " only one must be set.") if error is None and code is None: raise self.BadRequestException("Neither query parameter 'code' or 'error' is set.") # Check CSRF token if csrf_token_from_session is None: raise self.BadStateError("Missing CSRF token in session.") if len(csrf_token_from_session) <= 20: raise AssertionError("CSRF token unexpectedly short: %r" % (csrf_token_from_session,)) split_pos = state.find('|') if split_pos < 0: given_csrf_token = state url_state = None else: given_csrf_token = state[0:split_pos] url_state = state[split_pos+1:] if not _safe_equals(csrf_token_from_session, given_csrf_token): raise self.CsrfException("expected %r, got %r" % (csrf_token_from_session, given_csrf_token)) del self.session[self.csrf_token_session_key] # Check for error identifier if error is not None: if error == 'access_denied': # The user clicked "Deny" if error_description is None: raise self.NotApprovedException("No additional description from Dropbox") else: raise self.NotApprovedException("Additional description from Dropbox: " + error_description) else: # All other errors full_message = error if error_description is not None: full_message += ": " + error_description raise self.ProviderError(full_message) # If everything went ok, make the network call to get an access token. access_token, user_id = self._finish(code, self.redirect_uri) return access_token, user_id, url_state class BadRequestException(Exception): """ Thrown if the redirect URL was missing parameters or if the given parameters were not valid. The recommended action is to show an HTTP 400 error page. """ pass class BadStateException(Exception): """ Thrown if all the parameters are correct, but there's no CSRF token in the session. This probably means that the session expired. The recommended action is to redirect the user's browser to try the approval process again. """ pass class CsrfException(Exception): """ Thrown if the given 'state' parameter doesn't contain the CSRF token from the user's session. This is blocked to prevent CSRF attacks. The recommended action is to respond with an HTTP 403 error page. """ pass class NotApprovedException(Exception): """ The user chose not to approve your app. """ pass class ProviderException(Exception): """ Dropbox redirected to your redirect URI with some unexpected error identifier and error message. The recommended action is to log the error, tell the user something went wrong, and let them try again. """ pass def _safe_equals(a, b): if len(a) != len(b): return False res = 0 for ca, cb in zip(a, b): res |= ord(ca) ^ ord(cb) return res == 0 _OAUTH2_ACCESS_TOKEN_PATTERN = re.compile(r'\A[-_~/A-Za-z0-9\.\+]+=*\Z') # From the "Bearer" token spec, RFC 6750. >>>>>>> b875702c9c06ab5012e52ff4337439b03918f453 ======= import base64 import re import os import sys import urllib.request, urllib.parse, urllib.error PY3 = sys.version_info[0] == 3 if PY3: from io import StringIO str = str else: from io import StringIO try: import json except ImportError: import simplejson as json from .rest import ErrorResponse, RESTClient, params_to_urlencoded from .session import BaseSession, DropboxSession, DropboxOAuth2Session def format_path(path): """Normalize path for use with the Dropbox API. This function turns multiple adjacent slashes into single slashes, then ensures that there's a leading slash but not a trailing slash. """ if not path: return path path = re.sub(r'/+', '/', path) if path == '/': return ("" if isinstance(path, str) else "") else: return '/' + path.strip('/') class DropboxClient(object): """ This class lets you make Dropbox API calls. You'll need to obtain an OAuth 2 access token first. You can get an access token using either :class:`DropboxOAuth2Flow` or :class:`DropboxOAuth2FlowNoRedirect`. All of the API call methods can raise a :class:`dropbox.rest.ErrorResponse` exception if the server returns a non-200 or invalid HTTP response. Note that a 401 return status at any point indicates that the access token you're using is no longer valid and the user must be put through the OAuth 2 authorization flow again. """ def __init__(self, oauth2_access_token, locale=None, rest_client=None): """Construct a ``DropboxClient`` instance. Parameters oauth2_access_token An OAuth 2 access token (string). For backwards compatibility this may also be a DropboxSession object (see :meth:`create_oauth2_access_token()`). locale The locale of the user of your application. For example "en" or "en_US". Some API calls return localized data and error messages; this setting tells the server which locale to use. By default, the server uses "en_US". rest_client Optional :class:`dropbox.rest.RESTClient`-like object to use for making requests. """ if rest_client is None: rest_client = RESTClient if isinstance(oauth2_access_token, str): if not _OAUTH2_ACCESS_TOKEN_PATTERN.match(oauth2_access_token): raise ValueError("invalid format for oauth2_access_token: %r" % (oauth2_access_token,)) self.session = DropboxOAuth2Session(oauth2_access_token, locale) elif isinstance(oauth2_access_token, DropboxSession): # Backwards compatibility with OAuth 1 if locale is not None: raise ValueError("The 'locale' parameter to DropboxClient is only useful " "when also passing in an OAuth 2 access token") self.session = oauth2_access_token else: raise ValueError("'oauth2_access_token' must either be a string or a DropboxSession") self.rest_client = rest_client def request(self, target, params=None, method='POST', content_server=False, notification_server=False): """ An internal method that builds the url, headers, and params for a Dropbox API request. It is exposed if you need to make API calls not implemented in this library or if you need to debug requests. Parameters target The target URL with leading slash (e.g. '/files'). params A dictionary of parameters to add to the request. method An HTTP method (e.g. 'GET' or 'POST'). content_server A boolean indicating whether the request is to the API content server, for example to fetch the contents of a file rather than its metadata. notification_server A boolean indicating whether the request is to the API notification server, for example for longpolling. Returns A tuple of ``(url, params, headers)`` that should be used to make the request. OAuth will be added as needed within these fields. """ assert method in ['GET','POST', 'PUT'], "Only 'GET', 'POST', and 'PUT' are allowed." assert not (content_server and notification_server), \ "Cannot construct request simultaneously for content and notification servers." if params is None: params = {} if content_server: host = self.session.API_CONTENT_HOST elif notification_server: host = self.session.API_NOTIFICATION_HOST else: host = self.session.API_HOST base = self.session.build_url(host, target) headers, params = self.session.build_access_headers(method, base, params) if method in ('GET', 'PUT'): url = self.session.build_url(host, target, params) else: url = self.session.build_url(host, target) return url, params, headers def account_info(self): """Retrieve information about the user's account. Returns A dictionary containing account information. For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#account-info """ url, params, headers = self.request("/account/info", method='GET') return self.rest_client.GET(url, headers) def disable_access_token(self): """ Disable the access token that this ``DropboxClient`` is using. If this call succeeds, further API calls using this object will fail. """ url, params, headers = self.request("/disable_access_token", method='POST') return self.rest_client.POST(url, params, headers) def create_oauth2_access_token(self): """ If this ``DropboxClient`` was created with an OAuth 1 access token, this method can be used to create an equivalent OAuth 2 access token. This can be used to upgrade your app's existing access tokens from OAuth 1 to OAuth 2. Example:: from dropbox.client import DropboxClient from dropbox.session import DropboxSession session = DropboxSession(APP_KEY, APP_SECRET) access_key, access_secret = '123abc', 'xyz456' # Previously obtained OAuth 1 credentials session.set_token(access_key, access_secret) client = DropboxClient(session) token = client.create_oauth2_access_token() # Optionally, create a new client using the new token new_client = DropboxClient(token) """ if not isinstance(self.session, DropboxSession): raise ValueError("This call requires a DropboxClient that is configured with an " "OAuth 1 access token.") url, params, headers = self.request("/oauth2/token_from_oauth1", method='POST') r = self.rest_client.POST(url, params, headers) return r['access_token'] def get_chunked_uploader(self, file_obj, length): """Creates a :class:`ChunkedUploader` to upload the given file-like object. Parameters file_obj The file-like object which is the source of the data being uploaded. length The number of bytes to upload. The expected use of this function is as follows:: bigFile = open("data.txt", 'rb') uploader = myclient.get_chunked_uploader(bigFile, size) print "uploading: ", size while uploader.offset < size: try: upload = uploader.upload_chunked() except rest.ErrorResponse, e: # perform error handling and retry logic uploader.finish('/bigFile.txt') The SDK leaves the error handling and retry logic to the developer to implement, as the exact requirements will depend on the application involved. """ return ChunkedUploader(self, file_obj, length) def upload_chunk(self, file_obj, length=None, offset=0, upload_id=None): """Uploads a single chunk of data from a string or file-like object. The majority of users should use the :class:`ChunkedUploader` object, which provides a simpler interface to the chunked_upload API endpoint. Parameters file_obj The source of the chunk to upload; a file-like object or a string. length This argument is ignored but still present for backward compatibility reasons. offset The byte offset to which this source data corresponds in the original file. upload_id The upload identifier for which this chunk should be uploaded, returned by a previous call, or None to start a new upload. Returns A dictionary containing the keys: upload_id A string used to identify the upload for subsequent calls to :meth:`upload_chunk()` and :meth:`commit_chunked_upload()`. offset The offset at which the next upload should be applied. expires The time after which this partial upload is invalid. """ params = dict() if upload_id: params['upload_id'] = upload_id params['offset'] = offset url, ignored_params, headers = self.request("/chunked_upload", params, method='PUT', content_server=True) try: reply = self.rest_client.PUT(url, file_obj, headers) return reply['offset'], reply['upload_id'] except ErrorResponse as e: raise e def commit_chunked_upload(self, full_path, upload_id, overwrite=False, parent_rev=None): """Commit the previously uploaded chunks for the given path. Parameters full_path The full path to which the chunks are uploaded, *including the file name*. If the destination folder does not yet exist, it will be created. upload_id The chunked upload identifier, previously returned from upload_chunk. overwrite Whether to overwrite an existing file at the given path. (Default ``False``.) If overwrite is False and a file already exists there, Dropbox will rename the upload to make sure it doesn't overwrite anything. You need to check the metadata returned for the new name. This field should only be True if your intent is to potentially clobber changes to a file that you don't know about. parent_rev Optional rev field from the 'parent' of this upload. If your intent is to update the file at the given path, you should pass the parent_rev parameter set to the rev value from the most recent metadata you have of the existing file at that path. If the server has a more recent version of the file at the specified path, it will automatically rename your uploaded file, spinning off a conflict. Using this parameter effectively causes the overwrite parameter to be ignored. The file will always be overwritten if you send the most recent parent_rev, and it will never be overwritten if you send a less recent one. Returns A dictionary containing the metadata of the newly committed file. For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#commit-chunked-upload """ params = { 'upload_id': upload_id, 'overwrite': overwrite, } if parent_rev is not None: params['parent_rev'] = parent_rev url, params, headers = self.request("/commit_chunked_upload/%s" % full_path, params, content_server=True) return self.rest_client.POST(url, params, headers) def put_file(self, full_path, file_obj, overwrite=False, parent_rev=None): """Upload a file. A typical use case would be as follows:: f = open('working-draft.txt', 'rb') response = client.put_file('/magnum-opus.txt', f) print "uploaded:", response which would return the metadata of the uploaded file, similar to:: { 'bytes': 77, 'icon': 'page_white_text', 'is_dir': False, 'mime_type': 'text/plain', 'modified': 'Wed, 20 Jul 2011 22:04:50 +0000', 'path': '/magnum-opus.txt', 'rev': '362e2029684fe', 'revision': 221922, 'root': 'dropbox', 'size': '77 bytes', 'thumb_exists': False } Parameters full_path The full path to upload the file to, *including the file name*. If the destination folder does not yet exist, it will be created. file_obj A file-like object to upload. If you would like, you can pass a string as file_obj. overwrite Whether to overwrite an existing file at the given path. (Default ``False``.) If overwrite is False and a file already exists there, Dropbox will rename the upload to make sure it doesn't overwrite anything. You need to check the metadata returned for the new name. This field should only be True if your intent is to potentially clobber changes to a file that you don't know about. parent_rev Optional rev field from the 'parent' of this upload. If your intent is to update the file at the given path, you should pass the parent_rev parameter set to the rev value from the most recent metadata you have of the existing file at that path. If the server has a more recent version of the file at the specified path, it will automatically rename your uploaded file, spinning off a conflict. Using this parameter effectively causes the overwrite parameter to be ignored. The file will always be overwritten if you send the most recent parent_rev, and it will never be overwritten if you send a less recent one. Returns A dictionary containing the metadata of the newly uploaded file. For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#files-put Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 503: User over quota. """ path = "/files_put/%s%s" % (self.session.root, format_path(full_path)) params = { 'overwrite': bool(overwrite), } if parent_rev is not None: params['parent_rev'] = parent_rev url, params, headers = self.request(path, params, method='PUT', content_server=True) return self.rest_client.PUT(url, file_obj, headers) def get_file(self, from_path, rev=None, start=None, length=None): """Download a file. Example:: out = open('magnum-opus.txt', 'wb') with client.get_file('/magnum-opus.txt') as f: out.write(f.read()) which would download the file ``magnum-opus.txt`` and write the contents into the file ``magnum-opus.txt`` on the local filesystem. Parameters from_path The path to the file to be downloaded. rev Optional previous rev value of the file to be downloaded. start Optional byte value from which to start downloading. length Optional length in bytes for partially downloading the file. If ``length`` is specified but ``start`` is not, then the last ``length`` bytes will be downloaded. Returns A :class:`dropbox.rest.RESTResponse` that is the HTTP response for the API request. It is a file-like object that can be read from. You must call ``close()`` when you're done. Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 404: No file was found at the given path, or the file that was there was deleted. - 200: Request was okay but response was malformed in some way. """ path = "/files/%s%s" % (self.session.root, format_path(from_path)) params = {} if rev is not None: params['rev'] = rev url, params, headers = self.request(path, params, method='GET', content_server=True) if start is not None: if length: headers['Range'] = 'bytes=%s-%s' % (start, start + length - 1) else: headers['Range'] = 'bytes=%s-' % start elif length is not None: headers['Range'] = 'bytes=-%s' % length return self.rest_client.request("GET", url, headers=headers, raw_response=True) def get_file_and_metadata(self, from_path, rev=None): """Download a file alongwith its metadata. Acts as a thin wrapper around get_file() (see :meth:`get_file()` comments for more details) A typical usage looks like this:: out = open('magnum-opus.txt', 'wb') f, metadata = client.get_file_and_metadata('/magnum-opus.txt') with f: out.write(f.read()) Parameters from_path The path to the file to be downloaded. rev Optional previous rev value of the file to be downloaded. Returns A pair of ``(response, metadata)``: response A :class:`dropbox.rest.RESTResponse` that is the HTTP response for the API request. It is a file-like object that can be read from. You must call ``close()`` when you're done. metadata A dictionary containing the metadata of the file (see https://www.dropbox.com/developers/core/docs#metadata for details). Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 404: No file was found at the given path, or the file that was there was deleted. - 200: Request was okay but response was malformed in some way. """ file_res = self.get_file(from_path, rev) metadata = DropboxClient.__parse_metadata_as_dict(file_res) return file_res, metadata @staticmethod def __parse_metadata_as_dict(dropbox_raw_response): # Parses file metadata from a raw dropbox HTTP response, raising a # dropbox.rest.ErrorResponse if parsing fails. metadata = None for header, header_val in dropbox_raw_response.getheaders().items(): if header.lower() == 'x-dropbox-metadata': try: metadata = json.loads(header_val) except ValueError: raise ErrorResponse(dropbox_raw_response) if not metadata: raise ErrorResponse(dropbox_raw_response) return metadata def delta(self, cursor=None, path_prefix=None, include_media_info=False): """A way of letting you keep up with changes to files and folders in a user's Dropbox. You can periodically call delta() to get a list of "delta entries", which are instructions on how to update your local state to match the server's state. Parameters cursor On the first call, omit this argument (or pass in ``None``). On subsequent calls, pass in the ``cursor`` string returned by the previous call. path_prefix If provided, results will be limited to files and folders whose paths are equal to or under ``path_prefix``. The ``path_prefix`` is fixed for a given cursor. Whatever ``path_prefix`` you use on the first ``delta()`` must also be passed in on subsequent calls that use the returned cursor. include_media_info If True, delta will return additional media info for photos and videos (the time a photo was taken, the GPS coordinates of a photo, etc.). There is a delay between when a file is uploaded to Dropbox and when this information is available; delta will only include a file in the changelist once its media info is ready. The value you use on the first ``delta()`` must also be passed in on subsequent calls that use the returned cursor. Returns A dict with four keys: entries A list of "delta entries" (described below). reset If ``True``, you should your local state to be an empty folder before processing the list of delta entries. This is only ``True`` only in rare situations. cursor A string that is used to keep track of your current state. On the next call to delta(), pass in this value to return entries that were recorded since the cursor was returned. has_more If ``True``, then there are more entries available; you can call delta() again immediately to retrieve those entries. If ``False``, then wait at least 5 minutes (preferably longer) before checking again. Delta Entries: Each entry is a 2-item list of one of following forms: - [*path*, *metadata*]: Indicates that there is a file/folder at the given path. You should add the entry to your local path. (The *metadata* value is the same as what would be returned by the ``metadata()`` call.) - If the new entry includes parent folders that don't yet exist in your local state, create those parent folders in your local state. You will eventually get entries for those parent folders. - If the new entry is a file, replace whatever your local state has at *path* with the new entry. - If the new entry is a folder, check what your local state has at *path*. If it's a file, replace it with the new entry. If it's a folder, apply the new *metadata* to the folder, but do not modify the folder's children. - [*path*, ``None``]: Indicates that there is no file/folder at the *path* on Dropbox. To update your local state to match, delete whatever is at *path*, including any children (you will sometimes also get "delete" delta entries for the children, but this is not guaranteed). If your local state doesn't have anything at *path*, ignore this entry. Remember: Dropbox treats file names in a case-insensitive but case-preserving way. To facilitate this, the *path* strings above are lower-cased versions of the actual path. The *metadata* dicts have the original, case-preserved path. """ path = "/delta" params = {'include_media_info': include_media_info} if cursor is not None: params['cursor'] = cursor if path_prefix is not None: params['path_prefix'] = path_prefix url, params, headers = self.request(path, params) return self.rest_client.POST(url, params, headers) def longpoll_delta(self, cursor, timeout=None): """A long-poll endpoint to wait for changes on an account. In conjunction with :meth:`delta()`, this call gives you a low-latency way to monitor an account for file changes. Note that this call goes to ``api-notify.dropbox.com`` instead of ``api.dropbox.com``. Unlike most other API endpoints, this call does not require OAuth authentication. The passed-in cursor can only be acquired via an authenticated call to :meth:`delta()`. Parameters cursor A delta cursor as returned from a call to :meth:`delta()`. Note that a cursor returned from a call to :meth:`delta()` with ``include_media_info=True`` is incompatible with ``longpoll_delta()`` and an error will be returned. timeout An optional integer indicating a timeout, in seconds. The default value is 30 seconds, which is also the minimum allowed value. The maximum is 480 seconds. The request will block for at most this length of time, plus up to 90 seconds of random jitter added to avoid the thundering herd problem. Care should be taken when using this parameter, as some network infrastructure does not support long timeouts. Returns The connection will block until there are changes available or a timeout occurs. The response will be a dictionary that looks like the following example:: {"changes": false, "backoff": 60} For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#longpoll-delta Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (generally due to an invalid parameter; check e.error for details). """ path = "/longpoll_delta" params = {'cursor': cursor} if timeout is not None: params['timeout'] = timeout url, params, headers = self.request(path, params, method='GET', notification_server=True) return self.rest_client.GET(url, headers) def create_copy_ref(self, from_path): """Creates and returns a copy ref for a specific file. The copy ref can be used to instantly copy that file to the Dropbox of another account. Parameters path The path to the file for a copy ref to be created on. Returns A dictionary that looks like the following example:: {"expires": "Fri, 31 Jan 2042 21:01:05 +0000", "copy_ref": "z1X6ATl6aWtzOGq0c3g5Ng"} """ path = "/copy_ref/%s%s" % (self.session.root, format_path(from_path)) url, params, headers = self.request(path, {}, method='GET') return self.rest_client.GET(url, headers) def add_copy_ref(self, copy_ref, to_path): """Adds the file referenced by the copy ref to the specified path Parameters copy_ref A copy ref string that was returned from a create_copy_ref call. The copy_ref can be created from any other Dropbox account, or from the same account. path The path to where the file will be created. Returns A dictionary containing the metadata of the new copy of the file. """ path = "/fileops/copy" params = {'from_copy_ref': copy_ref, 'to_path': format_path(to_path), 'root': self.session.root} url, params, headers = self.request(path, params) return self.rest_client.POST(url, params, headers) def file_copy(self, from_path, to_path): """Copy a file or folder to a new location. Parameters from_path The path to the file or folder to be copied. to_path The destination path of the file or folder to be copied. This parameter should include the destination filename (e.g. from_path: '/test.txt', to_path: '/dir/test.txt'). If there's already a file at the to_path it will raise an ErrorResponse. Returns A dictionary containing the metadata of the new copy of the file or folder. For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#fileops-copy Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 403: An invalid copy operation was attempted (e.g. there is already a file at the given destination, or trying to copy a shared folder). - 404: No file was found at given from_path. - 503: User over storage quota. """ params = {'root': self.session.root, 'from_path': format_path(from_path), 'to_path': format_path(to_path), } url, params, headers = self.request("/fileops/copy", params) return self.rest_client.POST(url, params, headers) def file_create_folder(self, path): """Create a folder. Parameters path The path of the new folder. Returns A dictionary containing the metadata of the newly created folder. For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#fileops-create-folder Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 403: A folder at that path already exists. """ params = {'root': self.session.root, 'path': format_path(path)} url, params, headers = self.request("/fileops/create_folder", params) return self.rest_client.POST(url, params, headers) def file_delete(self, path): """Delete a file or folder. Parameters path The path of the file or folder. Returns A dictionary containing the metadata of the just deleted file. For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#fileops-delete Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 404: No file was found at the given path. """ params = {'root': self.session.root, 'path': format_path(path)} url, params, headers = self.request("/fileops/delete", params) return self.rest_client.POST(url, params, headers) def file_move(self, from_path, to_path): """Move a file or folder to a new location. Parameters from_path The path to the file or folder to be moved. to_path The destination path of the file or folder to be moved. This parameter should include the destination filename (e.g. if ``from_path`` is ``'/test.txt'``, ``to_path`` might be ``'/dir/test.txt'``). If there's already a file at the ``to_path`` it will raise an ErrorResponse. Returns A dictionary containing the metadata of the new copy of the file or folder. For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#fileops-move Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 403: An invalid move operation was attempted (e.g. there is already a file at the given destination, or moving a shared folder into a shared folder). - 404: No file was found at given from_path. - 503: User over storage quota. """ params = {'root': self.session.root, 'from_path': format_path(from_path), 'to_path': format_path(to_path)} url, params, headers = self.request("/fileops/move", params) return self.rest_client.POST(url, params, headers) def metadata(self, path, list=True, file_limit=25000, hash=None, rev=None, include_deleted=False, include_media_info=False): """Retrieve metadata for a file or folder. A typical use would be:: folder_metadata = client.metadata('/') print "metadata:", folder_metadata which would return the metadata of the root folder. This will look something like:: { 'bytes': 0, 'contents': [ { 'bytes': 0, 'icon': 'folder', 'is_dir': True, 'modified': 'Thu, 25 Aug 2011 00:03:15 +0000', 'path': '/Sample Folder', 'rev': '803beb471', 'revision': 8, 'root': 'dropbox', 'size': '0 bytes', 'thumb_exists': False }, { 'bytes': 77, 'icon': 'page_white_text', 'is_dir': False, 'mime_type': 'text/plain', 'modified': 'Wed, 20 Jul 2011 22:04:50 +0000', 'path': '/magnum-opus.txt', 'rev': '362e2029684fe', 'revision': 221922, 'root': 'dropbox', 'size': '77 bytes', 'thumb_exists': False } ], 'hash': 'efdac89c4da886a9cece1927e6c22977', 'icon': 'folder', 'is_dir': True, 'path': '/', 'root': 'app_folder', 'size': '0 bytes', 'thumb_exists': False } In this example, the root folder contains two things: ``Sample Folder``, which is a folder, and ``/magnum-opus.txt``, which is a text file 77 bytes long Parameters path The path to the file or folder. list Whether to list all contained files (only applies when path refers to a folder). file_limit The maximum number of file entries to return within a folder. If the number of files in the folder exceeds this limit, an exception is raised. The server will return at max 25,000 files within a folder. hash Every folder listing has a hash parameter attached that can then be passed back into this function later to save on bandwidth. Rather than returning an unchanged folder's contents, the server will instead return a 304. rev Optional revision of the file to retrieve the metadata for. This parameter only applies for files. If omitted, you'll receive the most recent revision metadata. include_deleted When listing contained files, include files that have been deleted. include_media_info If True, includes additional media info for photos and videos if available (the time a photo was taken, the GPS coordinates of a photo, etc.). Returns A dictionary containing the metadata of the file or folder (and contained files if appropriate). For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#metadata Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 304: Current folder hash matches hash parameters, so contents are unchanged. - 400: Bad request (may be due to many things; check e.error for details). - 404: No file was found at given path. - 406: Too many file entries to return. """ path = "/metadata/%s%s" % (self.session.root, format_path(path)) params = {'file_limit': file_limit, 'list': 'true', 'include_deleted': include_deleted, 'include_media_info': include_media_info, } if not list: params['list'] = 'false' if hash is not None: params['hash'] = hash if rev: params['rev'] = rev url, params, headers = self.request(path, params, method='GET') return self.rest_client.GET(url, headers) def thumbnail(self, from_path, size='m', format='JPEG'): """Download a thumbnail for an image. Parameters from_path The path to the file to be thumbnailed. size A string specifying the desired thumbnail size. Currently supported sizes: ``"xs"`` (32x32), ``"s"`` (64x64), ``"m"`` (128x128), ``"l``" (640x480), ``"xl"`` (1024x768). Check https://www.dropbox.com/developers/core/docs#thumbnails for more details. format The image format the server should use for the returned thumbnail data. Either ``"JPEG"`` or ``"PNG"``. Returns A :class:`dropbox.rest.RESTResponse` that is the HTTP response for the API request. It is a file-like object that can be read from. You must call ``close()`` when you're done. Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 404: No file was found at the given from_path, or files of that type cannot be thumbnailed. - 415: Image is invalid and cannot be thumbnailed. """ assert format in ['JPEG', 'PNG'], \ "expected a thumbnail format of 'JPEG' or 'PNG', got %s" % format path = "/thumbnails/%s%s" % (self.session.root, format_path(from_path)) url, params, headers = self.request(path, {'size': size, 'format': format}, method='GET', content_server=True) return self.rest_client.request("GET", url, headers=headers, raw_response=True) def thumbnail_and_metadata(self, from_path, size='m', format='JPEG'): """Download a thumbnail for an image alongwith its metadata. Acts as a thin wrapper around thumbnail() (see :meth:`thumbnail()` comments for more details) Parameters from_path The path to the file to be thumbnailed. size A string specifying the desired thumbnail size. See :meth:`thumbnail()` for details. format The image format the server should use for the returned thumbnail data. Either ``"JPEG"`` or ``"PNG"``. Returns A pair of ``(response, metadata)``: response A :class:`dropbox.rest.RESTResponse` that is the HTTP response for the API request. It is a file-like object that can be read from. You must call ``close()`` when you're done. metadata A dictionary containing the metadata of the file whose thumbnail was downloaded (see https://www.dropbox.com/developers/core/docs#metadata for details). Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 404: No file was found at the given from_path, or files of that type cannot be thumbnailed. - 415: Image is invalid and cannot be thumbnailed. - 200: Request was okay but response was malformed in some way. """ thumbnail_res = self.thumbnail(from_path, size, format) metadata = DropboxClient.__parse_metadata_as_dict(thumbnail_res) return thumbnail_res, metadata def search(self, path, query, file_limit=1000, include_deleted=False): """Search folder for filenames matching query. Parameters path The folder to search within. query The query to search on (minimum 3 characters). file_limit The maximum number of file entries to return within a folder. The server will return at max 1,000 files. include_deleted Whether to include deleted files in search results. Returns A list of the metadata of all matching files (up to file_limit entries). For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#search Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). """ path = "/search/%s%s" % (self.session.root, format_path(path)) params = { 'query': query, 'file_limit': file_limit, 'include_deleted': include_deleted, } url, params, headers = self.request(path, params) return self.rest_client.POST(url, params, headers) def revisions(self, path, rev_limit=1000): """Retrieve revisions of a file. Parameters path The file to fetch revisions for. Note that revisions are not available for folders. rev_limit The maximum number of file entries to return within a folder. The server will return at max 1,000 revisions. Returns A list of the metadata of all matching files (up to rev_limit entries). For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#revisions Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 404: No revisions were found at the given path. """ path = "/revisions/%s%s" % (self.session.root, format_path(path)) params = { 'rev_limit': rev_limit, } url, params, headers = self.request(path, params, method='GET') return self.rest_client.GET(url, headers) def restore(self, path, rev): """Restore a file to a previous revision. Parameters path The file to restore. Note that folders can't be restored. rev A previous rev value of the file to be restored to. Returns A dictionary containing the metadata of the newly restored file. For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#restore Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 404: Unable to find the file at the given revision. """ path = "/restore/%s%s" % (self.session.root, format_path(path)) params = { 'rev': rev, } url, params, headers = self.request(path, params) return self.rest_client.POST(url, params, headers) def media(self, path): """Get a temporary unauthenticated URL for a media file. All of Dropbox's API methods require OAuth, which may cause problems in situations where an application expects to be able to hit a URL multiple times (for example, a media player seeking around a video file). This method creates a time-limited URL that can be accessed without any authentication, and returns that to you, along with an expiration time. Parameters path The file to return a URL for. Folders are not supported. Returns A dictionary that looks like the following example:: {'url': 'https://dl.dropboxusercontent.com/1/view/abcdefghijk/example', 'expires': 'Thu, 16 Sep 2011 01:01:25 +0000'} For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#media Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 404: Unable to find the file at the given path. """ path = "/media/%s%s" % (self.session.root, format_path(path)) url, params, headers = self.request(path, method='GET') return self.rest_client.GET(url, headers) def share(self, path, short_url=True): """Create a shareable link to a file or folder. Shareable links created on Dropbox are time-limited, but don't require any authentication, so they can be given out freely. The time limit should allow at least a day of shareability, though users have the ability to disable a link from their account if they like. Parameters path The file or folder to share. Returns A dictionary that looks like the following example:: {'url': u'https://db.tt/c0mFuu1Y', 'expires': 'Tue, 01 Jan 2030 00:00:00 +0000'} For a detailed description of what this call returns, visit: https://www.dropbox.com/developers/core/docs#shares Raises A :class:`dropbox.rest.ErrorResponse` with an HTTP status of: - 400: Bad request (may be due to many things; check e.error for details). - 404: Unable to find the file at the given path. """ path = "/shares/%s%s" % (self.session.root, format_path(path)) params = { 'short_url': short_url, } url, params, headers = self.request(path, params, method='GET') return self.rest_client.GET(url, headers) class ChunkedUploader(object): """Contains the logic around a chunked upload, which uploads a large file to Dropbox via the /chunked_upload endpoint. """ def __init__(self, client, file_obj, length): self.client = client self.offset = 0 self.upload_id = None self.last_block = None self.file_obj = file_obj self.target_length = length def upload_chunked(self, chunk_size = 4 * 1024 * 1024): """Uploads data from this ChunkedUploader's file_obj in chunks, until an error occurs. Throws an exception when an error occurs, and can be called again to resume the upload. Parameters chunk_size The number of bytes to put in each chunk. (Default 4 MB.) """ while self.offset < self.target_length: next_chunk_size = min(chunk_size, self.target_length - self.offset) if self.last_block == None: self.last_block = self.file_obj.read(next_chunk_size) try: (self.offset, self.upload_id) = self.client.upload_chunk( StringIO(self.last_block), next_chunk_size, self.offset, self.upload_id) self.last_block = None except ErrorResponse as e: # Handle the case where the server tells us our offset is wrong. must_reraise = True if e.status == 400: reply = e.body if "offset" in reply and reply['offset'] != 0 and reply['offset'] > self.offset: self.last_block = None self.offset = reply['offset'] must_reraise = False if must_reraise: raise def finish(self, path, overwrite=False, parent_rev=None): """Commits the bytes uploaded by this ChunkedUploader to a file in the users dropbox. Parameters path The full path of the file in the Dropbox. overwrite Whether to overwrite an existing file at the given path. (Default ``False``.) If overwrite is False and a file already exists there, Dropbox will rename the upload to make sure it doesn't overwrite anything. You need to check the metadata returned for the new name. This field should only be True if your intent is to potentially clobber changes to a file that you don't know about. parent_rev Optional rev field from the 'parent' of this upload. If your intent is to update the file at the given path, you should pass the parent_rev parameter set to the rev value from the most recent metadata you have of the existing file at that path. If the server has a more recent version of the file at the specified path, it will automatically rename your uploaded file, spinning off a conflict. Using this parameter effectively causes the overwrite parameter to be ignored. The file will always be overwritten if you send the most recent parent_rev, and it will never be overwritten if you send a less recent one. """ path = "/commit_chunked_upload/%s%s" % (self.client.session.root, format_path(path)) params = dict( overwrite = bool(overwrite), upload_id = self.upload_id ) if parent_rev is not None: params['parent_rev'] = parent_rev url, params, headers = self.client.request(path, params, content_server=True) return self.client.rest_client.POST(url, params, headers) # Allow access of ChunkedUploader via DropboxClient for backwards compatibility. DropboxClient.ChunkedUploader = ChunkedUploader class DropboxOAuth2FlowBase(object): def __init__(self, consumer_key, consumer_secret, locale=None, rest_client=RESTClient): self.consumer_key = consumer_key self.consumer_secret = consumer_secret self.locale = locale self.rest_client = rest_client def _get_authorize_url(self, redirect_uri, state): params = dict(response_type='code', client_id=self.consumer_key) if redirect_uri is not None: params['redirect_uri'] = redirect_uri if state is not None: params['state'] = state return self.build_url(BaseSession.WEB_HOST, '/oauth2/authorize', params) def _finish(self, code, redirect_uri): url = self.build_url(BaseSession.API_HOST, '/oauth2/token') params = {'grant_type': 'authorization_code', 'code': code, 'client_id': self.consumer_key, 'client_secret': self.consumer_secret, } if self.locale is not None: params['locale'] = self.locale if redirect_uri is not None: params['redirect_uri'] = redirect_uri response = self.rest_client.POST(url, params=params) access_token = response["access_token"] user_id = response["uid"] return access_token, user_id def build_path(self, target, params=None): """Build the path component for an API URL. This method urlencodes the parameters, adds them to the end of the target url, and puts a marker for the API version in front. Parameters target A target url (e.g. '/files') to build upon. params Optional dictionary of parameters (name to value). Returns The path and parameters components of an API URL. """ if sys.version_info < (3,) and type(target) == str: target = target.encode("utf8") target_path = urllib.parse.quote(target) params = params or {} params = params.copy() if self.locale: params['locale'] = self.locale if params: query_string = params_to_urlencoded(params) return "/%s%s?%s" % (BaseSession.API_VERSION, target_path, query_string) else: return "/%s%s" % (BaseSession.API_VERSION, target_path) def build_url(self, host, target, params=None): """Build an API URL. This method adds scheme and hostname to the path returned from build_path. Parameters target A target url (e.g. '/files') to build upon. params Optional dictionary of parameters (name to value). Returns The full API URL. """ return "https://%s%s" % (host, self.build_path(target, params)) class DropboxOAuth2FlowNoRedirect(DropboxOAuth2FlowBase): """ OAuth 2 authorization helper for apps that can't provide a redirect URI (such as the command-line example apps). Example:: from dropbox.client import DropboxOAuth2FlowNoRedirect, DropboxClient from dropbox import rest as dbrest auth_flow = DropboxOAuth2FlowNoRedirect(APP_KEY, APP_SECRET) authorize_url = auth_flow.start() print "1. Go to: " + authorize_url print "2. Click \\"Allow\\" (you might have to log in first)." print "3. Copy the authorization code." auth_code = raw_input("Enter the authorization code here: ").strip() try: access_token, user_id = auth_flow.finish(auth_code) except dbrest.ErrorResponse, e: print('Error: %s' % (e,)) return c = DropboxClient(access_token) """ def __init__(self, consumer_key, consumer_secret, locale=None, rest_client=None): """ Construct an instance. Parameters consumer_key Your API app's "app key" consumer_secret Your API app's "app secret" locale The locale of the user of your application. For example "en" or "en_US". Some API calls return localized data and error messages; this setting tells the server which locale to use. By default, the server uses "en_US". rest_client Optional :class:`dropbox.rest.RESTClient`-like object to use for making requests. """ if rest_client is None: rest_client = RESTClient super(DropboxOAuth2FlowNoRedirect, self).__init__(consumer_key, consumer_secret, locale, rest_client) def start(self): """ Starts the OAuth 2 authorization process. Returns The URL for a page on Dropbox's website. This page will let the user "approve" your app, which gives your app permission to access the user's Dropbox account. Tell the user to visit this URL and approve your app. """ return self._get_authorize_url(None, None) def finish(self, code): """ If the user approves your app, they will be presented with an "authorization code". Have the user copy/paste that authorization code into your app and then call this method to get an access token. Parameters code The authorization code shown to the user when they approved your app. Returns A pair of ``(access_token, user_id)``. ``access_token`` is a string that can be passed to DropboxClient. ``user_id`` is the Dropbox user ID (string) of the user that just approved your app. Raises The same exceptions as :meth:`DropboxOAuth2Flow.finish()`. """ return self._finish(code, None) class DropboxOAuth2Flow(DropboxOAuth2FlowBase): """ OAuth 2 authorization helper. Use this for web apps. OAuth 2 has a two-step authorization process. The first step is having the user authorize your app. The second involves getting an OAuth 2 access token from Dropbox. Example:: from dropbox.client import DropboxOAuth2Flow, DropboxClient def get_dropbox_auth_flow(web_app_session): redirect_uri = "https://my-web-server.org/dropbox-auth-finish") return DropboxOAuth2Flow(APP_KEY, APP_SECRET, redirect_uri, web_app_session, "dropbox-auth-csrf-token") # URL handler for /dropbox-auth-start def dropbox_auth_start(web_app_session, request): authorize_url = get_dropbox_auth_flow(web_app_session).start() redirect_to(authorize_url) # URL handler for /dropbox-auth-finish def dropbox_auth_finish(web_app_session, request): try: access_token, user_id, url_state = \\ get_dropbox_auth_flow(web_app_session).finish(request.query_params) except DropboxOAuth2Flow.BadRequestException, e: http_status(400) except DropboxOAuth2Flow.BadStateException, e: # Start the auth flow again. redirect_to("/dropbox-auth-start") except DropboxOAuth2Flow.CsrfException, e: http_status(403) except DropboxOAuth2Flow.NotApprovedException, e: flash('Not approved? Why not?') return redirect_to("/home") except DropboxOAuth2Flow.ProviderException, e: logger.log("Auth error: %s" % (e,)) http_status(403) """ def __init__(self, consumer_key, consumer_secret, redirect_uri, session, csrf_token_session_key, locale=None, rest_client=None): """ Construct an instance. Parameters consumer_key Your API app's "app key". consumer_secret Your API app's "app secret". redirect_uri The URI that the Dropbox server will redirect the user to after the user finishes authorizing your app. This URI must be HTTPS-based and pre-registered with the Dropbox servers, though localhost URIs are allowed without pre-registration and can be either HTTP or HTTPS. session A dict-like object that represents the current user's web session (will be used to save the CSRF token). csrf_token_session_key The key to use when storing the CSRF token in the session (for example: "dropbox-auth-csrf-token"). locale The locale of the user of your application. For example "en" or "en_US". Some API calls return localized data and error messages; this setting tells the server which locale to use. By default, the server uses "en_US". rest_client Optional :class:`dropbox.rest.RESTClient`-like object to use for making requests. """ if rest_client is None: rest_client = RESTClient super(DropboxOAuth2Flow, self).__init__(consumer_key, consumer_secret, locale, rest_client) self.redirect_uri = redirect_uri self.session = session self.csrf_token_session_key = csrf_token_session_key def start(self, url_state=None): """ Starts the OAuth 2 authorization process. This function builds an "authorization URL". You should redirect your user's browser to this URL, which will give them an opportunity to grant your app access to their Dropbox account. When the user completes this process, they will be automatically redirected to the ``redirect_uri`` you passed in to the constructor. This function will also save a CSRF token to ``session[csrf_token_session_key]`` (as provided to the constructor). This CSRF token will be checked on :meth:`finish()` to prevent request forgery. Parameters url_state Any data that you would like to keep in the URL through the authorization process. This exact value will be returned to you by :meth:`finish()`. Returns The URL for a page on Dropbox's website. This page will let the user "approve" your app, which gives your app permission to access the user's Dropbox account. Tell the user to visit this URL and approve your app. """ csrf_token = base64.urlsafe_b64encode(os.urandom(16)) state = csrf_token if url_state is not None: state += "|" + url_state self.session[self.csrf_token_session_key] = csrf_token return self._get_authorize_url(self.redirect_uri, state) def finish(self, query_params): """ Call this after the user has visited the authorize URL (see :meth:`start()`), approved your app and was redirected to your redirect URI. Parameters query_params The query parameters on the GET request to your redirect URI. Returns A tuple of ``(access_token, user_id, url_state)``. ``access_token`` can be used to construct a :class:`DropboxClient`. ``user_id`` is the Dropbox user ID (string) of the user that just approved your app. ``url_state`` is the value you originally passed in to :meth:`start()`. Raises :class:`BadRequestException` If the redirect URL was missing parameters or if the given parameters were not valid. :class:`BadStateException` If there's no CSRF token in the session. :class:`CsrfException` If the ``'state'`` query parameter doesn't contain the CSRF token from the user's session. :class:`NotApprovedException` If the user chose not to approve your app. :class:`ProviderException` If Dropbox redirected to your redirect URI with some unexpected error identifier and error message. """ csrf_token_from_session = self.session[self.csrf_token_session_key] # Check well-formedness of request. state = query_params.get('state') if state is None: raise self.BadRequestException("Missing query parameter 'state'.") error = query_params.get('error') error_description = query_params.get('error_description') code = query_params.get('code') if error is not None and code is not None: raise self.BadRequestException("Query parameters 'code' and 'error' are both set; " " only one must be set.") if error is None and code is None: raise self.BadRequestException("Neither query parameter 'code' or 'error' is set.") # Check CSRF token if csrf_token_from_session is None: raise self.BadStateError("Missing CSRF token in session.") if len(csrf_token_from_session) <= 20: raise AssertionError("CSRF token unexpectedly short: %r" % (csrf_token_from_session,)) split_pos = state.find('|') if split_pos < 0: given_csrf_token = state url_state = None else: given_csrf_token = state[0:split_pos] url_state = state[split_pos+1:] if not _safe_equals(csrf_token_from_session, given_csrf_token): raise self.CsrfException("expected %r, got %r" % (csrf_token_from_session, given_csrf_token)) del self.session[self.csrf_token_session_key] # Check for error identifier if error is not None: if error == 'access_denied': # The user clicked "Deny" if error_description is None: raise self.NotApprovedException("No additional description from Dropbox") else: raise self.NotApprovedException("Additional description from Dropbox: " + error_description) else: # All other errors full_message = error if error_description is not None: full_message += ": " + error_description raise self.ProviderError(full_message) # If everything went ok, make the network call to get an access token. access_token, user_id = self._finish(code, self.redirect_uri) return access_token, user_id, url_state class BadRequestException(Exception): """ Thrown if the redirect URL was missing parameters or if the given parameters were not valid. The recommended action is to show an HTTP 400 error page. """ pass class BadStateException(Exception): """ Thrown if all the parameters are correct, but there's no CSRF token in the session. This probably means that the session expired. The recommended action is to redirect the user's browser to try the approval process again. """ pass class CsrfException(Exception): """ Thrown if the given 'state' parameter doesn't contain the CSRF token from the user's session. This is blocked to prevent CSRF attacks. The recommended action is to respond with an HTTP 403 error page. """ pass class NotApprovedException(Exception): """ The user chose not to approve your app. """ pass class ProviderException(Exception): """ Dropbox redirected to your redirect URI with some unexpected error identifier and error message. The recommended action is to log the error, tell the user something went wrong, and let them try again. """ pass def _safe_equals(a, b): if len(a) != len(b): return False res = 0 for ca, cb in zip(a, b): res |= ord(ca) ^ ord(cb) return res == 0 _OAUTH2_ACCESS_TOKEN_PATTERN = re.compile(r'\A[-_~/A-Za-z0-9\.\+]+=*\Z') # From the "Bearer" token spec, RFC 6750. >>>>>>> b875702c9c06ab5012e52ff4337439b03918f453
ArcherSys/ArcherSys
archersys/Lib/site-packages/dropbox/client.py
Python
mit
202,937
[ "VisIt" ]
aebe852c6f83f4d8cde7897ea51ac9981062c9e87e201dd15cb453194559b606
import os.path as osp from mastic.system import System, SystemType, AssociationType, Association from rdkit import Chem from mastic.interfaces.rdkit import RDKitMoleculeWrapper trypsin_dir = osp.expanduser("~/Dropbox/lab/trypsin") ben_pdb_path = osp.join(trypsin_dir, "BEN_Hs.pdb") BEN_rdkit = Chem.MolFromPDBFile(ben_pdb_path, removeHs=False, sanitize=False) BEN_rdkit_wrapper = RDKitMoleculeWrapper(BEN_rdkit, mol_name="BEN") print("making molecule type for benzamidine") BENType = BEN_rdkit_wrapper.make_molecule_type(find_features=True) BEN_coords = BEN_rdkit_wrapper.get_conformer_coords(0) member_coords = [BEN_coords] member_types = [BENType] system_attrs = {'name' : 'benzamidine-system'} BenzamidineSystemType = SystemType("BenzamidineSystemType", member_types=member_types, **system_attrs) MockAssocType = AssociationType('MockAssocType', system_type=BenzamidineSystemType, selection_map={0 : None}, selection_types=[None], name='uuuhhhh') BenzamidineSystemType.add_association_type(MockAssocType) bensys = BenzamidineSystemType.to_system(member_coords) molecule = bensys.molecules[0] association = bensys.associations[0]
salotz/mast
prototypes/system_example.py
Python
mit
1,341
[ "RDKit" ]
463992978c6a657d3ff22418442d911ed4e8443e021cdac08993a37db2912e84
#!/usr/bin/env python import os, argparse, tempfile, operator, pickle from collections import defaultdict import pybedtools, pysam def rev_comp(str): """ Given a DNA string, returns the reverse complement >>> rev_comp("AATTGGCC") 'GGCCAATT' """ rev_dic = {'A':'T','G':'C','C':'G','T':'A'} return ''.join([rev_dic[i] for i in str[::-1]]) def get_kmers(file_path): """ Counts the number of occurences of each sequence in a FASTA file and returns a dictionary with the format {sequence:count}, e.g. {'AATTCC':5} Note: Ignores anything with Ns in, and treats all DNA as uppercase (i.e. not repeatmasked) """ kmers = defaultdict(int) with open(file_path,'r') as fasta: for i in fasta: if i[0] != ">": if 'N' not in i: kmers[i.strip().upper()] +=1 return kmers def generate_6mer_bed(bam_file, gdict): """ Loads data from a BAM file, and prints the 6-mers from the 5' ends of the reads as a BED file to a temp file, returns the file path of this temp file """ outfile = tempfile.NamedTemporaryFile(delete=False) samfile = pysam.AlignmentFile(bam_file, "rb") for i in samfile: # Ignore unmapped reads if not i.is_unmapped: chrom = samfile.getrname(i.reference_id) if chrom in list(gdict.keys()): # Determine which end of the read is the 5' end if i.is_reverse: strand = "-" startbp, endbp = i.reference_end - 3, i.reference_end + 3 else: strand = "+" startbp, endbp = i.reference_start - 3, i.reference_start + 3 if startbp > 0 and endbp < gdict[chrom]: print("\t".join((str(i) for i in (chrom, startbp, endbp, 0, 0, strand))), file=outfile) outfile.close() return outfile.name def genome_dic(g_file): """ Make a dictionary of chromosome sizes from a .chrom.sizes file e.g. {chrom_name:chrom_size} """ gdict = {} with open(g_file) as ifile: for i in ifile: i = i.split() gdict[i[0]] = int(i[1]) return gdict if __name__ == "__main__": parser = argparse.ArgumentParser(description='Calculates the 6-mer 5\' insertion bias for a NGS dataset') parser.add_argument("regions", help="BED file of the regions you want to exclude from calculating the bias. This is usually the DHSs.") parser.add_argument("reads", help="The sorted, indexed BAM file containing the DNase-seq data") parser.add_argument("genome_sequence", help="The sorted, indexed FASTA file containing the genome sequence") parser.add_argument("genome_size", help="The .chrom.sizes file containing chromosome sizes generated using something like \"mysql --user=genome --host=genome-mysql.cse.ucsc.edu -A -e \"select chrom, size from hg19.chromInfo\" > hg19.chrom.sizes\"") parser.add_argument("output", help="output file prefix to write the observed/expected ratios to (will append .txt and .pickle)") args = parser.parse_args() test_bam = args.reads test_bed = args.regions genome_sequence = args.genome_sequence genome = args.genome_size outfile = args.output # First, pull all the 6mers surrounding 5' ends print("Determining transposition sites (roughly 60s per 1E6 reads)...") bed_file_for_6mers = generate_6mer_bed(test_bam, genome_dic(genome)) all_6mers = pybedtools.BedTool(bed_file_for_6mers) # Can't guarantee peaks are sorted, so sort them peaks = pybedtools.BedTool(test_bed) peaks = peaks.sort() # Get the transposition sites outside of the peaks only print("Filtering for those outside peaks") bg_6mers = all_6mers.intersect(peaks,v=True) print("Generating shuffled background") shuf_bg_6mers = bg_6mers.shuffle(g=genome, noOverlapping=True, excl=peaks.fn) print("Generating FASTA file for 6mers...") genome_fasta = pybedtools.BedTool(genome_sequence) observed_cuts = bg_6mers.sequence(fi=genome_fasta) print("Generating FASTA file for shuffled 6mers...") shuffled_cuts = shuf_bg_6mers.sequence(fi=genome_fasta) print("Getting 6mers for observed...") observed = get_kmers(observed_cuts.seqfn) print("Getting 6mers for shuffled...") expected = get_kmers(shuffled_cuts.seqfn) print("Calculating...") enriched = {i:observed[i]/float(expected[i]) for i in list(observed.keys())} print("Dumping bias txt file...") with open(outfile + ".txt", 'w') as ofile: for i in sorted(list(enriched.items()), key=operator.itemgetter(1)): print("\t".join(map(str,i)), file=ofile) print("Writing bias pickle file...") totalsum = float(sum(enriched.values())) whatdic = {key:{'forward':val/totalsum,'reverse':enriched[rev_comp(key)]/totalsum} for key,val in enriched.items()} with open(outfile + ".pickle", "w") as bias_file: pickle.dump(whatdic,bias_file) os.remove(bed_file_for_6mers)
jpiper/pyDNase
pyDNase/scripts/dnase_bias_estimator.py
Python
mit
4,662
[ "pysam" ]
77f7d12ff3332794c6170121914566e4a5de511f014019ed0bcf9080475f3f74
#(c) 2012 Massachusetts Institute of Technology. All Rights Reserved # Code written by: Maksim Imakaev (imakaev@mit.edu) #TODO:(MIU) Write tests for this module! """ Binned data - analysis of HiC, binned to resolution. Concepts -------- class Binned Data allows low-level manipulation of multiple HiC datasets, binned to the same resolution from the same genome. When working with multiple datasets, all the filters will be synchronized, so only bins present in all datasets will be considered for the analysis. Removal of bins from one dataset will remove them from the others. E.g. removing 1% of bins with lowest # of count might remove more than 1% of total bins, when working with 2 or more datasets. Class has significant knowledge about filters that have been applied. If an essential filter was not applied, it will throw an exception; if advised filter is not applied, it will throw a warning. However, it does not guarantee dependencies, and you have to think yourself. Most of the methods have an optional "force" argument that will ignore dependencies. We provide example scripts that show ideal protocols for certain types of the analysis, but they don't cover the realm of all possible manipulations that can be performed with this class. Input data ---------- method :py:func:`SimpleLoad <binnedData.simpleLoad>` may be used to load the data. It automatically checks for possible genome length mismatch. This method works best with h5dict files, created by fragmentHiC. In this case you just need to supply the filename. It can also accept any dictionary-like object with the following keys, where all but "heatmap" is optional. * ["heatmap"] : all-by-all heatmap * ["singles"] : vector of SS reads, optional * ["frags"] : number of rsites per bin, optional * ["resolution"] : resolution All information about the genome, including GC content and restriction sites, can be obtained from the Genome class. Genomic tracks can be loaded using an automated parser that accepts bigWig files and fixed step wiggle files. See documentation for :py:func:`experimentalBinnedData.loadWigFile` that describes exactly how the data is averaged and parsed. Variables --------- self.dataDict - dictionary with heatmaps; keys are provided when loading the data. self.singlesDict - dictionary with SS read vectors. Keys are the same. self.fragsDict - dictionary with fragment density data self.trackDict - dictionary with genomic tracks, such as GC content. Custom tracks should be added here. self.biasDict - dictionary with biases as calculated by iterative correction (incomplete) self.PCDict - dictionary with principal components of each datasets. Keys as in dataDict self.EigEict - dictionary with eigenvectors for each dataset. Keys as in datadict. Hierarchy of filters -------------------- This hierarchy attempts to connect all logical dependencies between filters into one diagram. This includes both biological dependencies and programming dependencies. As a result, it's incomplete and might be not 100% accurate. Generally filters from the next group should be applied after filters from previous groups, if any. Examples of the logic are below: * First, apply filters that don't depend on counts, i.e. remove diagonal and low-coverage bins. * Second, remove regions with poor coverage; do this before chaining heatmaps with other filters. * Fake translocations before truncating trans, as translocations are very high-count regions, and truncTrans will truncate them, not actuall trans reads * Faking reads currently requires zeros to be removed. This will be changed later * Fake cis counts after truncating trans, so that they don't get faked with extremely high-count outliers in a trans-map * Perform iterative correction after all the filters are applied * Preform PCA after IC of trans data, and with zeros removed 1. Remove Diagonal, removeBySequencedCount 2. RemovePoorRegions, RemoveStandalone (this two filters are not transitive) 3. fakeTranslocations 4. truncTrans 5. fakeCis 6. iterative correction (does not require removeZeros) 7. removeZeros 8. PCA (Requires removeZeros) 9. RestoreZeros Besides that, filter dependencies are: * Faking reads requires: removeZeros * PCA requires: removeZeros, fakeCis * IC with SS requires: no previous iterative corrections, no removed cis reads * IC recommends removal of poor regions Other filter dependencies, including advised but not required filters, will be issued as warnings during runtime of a program. ------------------------------------------------------------------------------- API documentation ----------------- """ import os from mirnylib import numutils import warnings from mirnylib.numutils import PCA, EIG, correct, \ ultracorrectSymmetricWithVector, isInteger, \ observedOverExpected, ultracorrect, adaptiveSmoothing, \ removeDiagonals, fillDiagonal from mirnylib.genome import Genome import numpy as np from math import exp from mirnylib.h5dict import h5dict from scipy.stats.stats import spearmanr from mirnylib.numutils import fakeCisImpl class binnedData(object): """Base class to work with binned data, the most documented and robust part of the code. Further classes for other analysis are inherited from this class. """ def __init__(self, resolution, genome, readChrms=["#", "X"]): """ self.__init__ - initializes an empty dataset. This method sets up a Genome object and resolution. Genome object specifies genome version and inclusion/exclusion of sex chromosomes. Parameters ---------- resolution : int Resolution of all datasets genome : genome Folder or Genome object """ if type(genome) == str: self.genome = Genome(genomePath=genome, readChrms=readChrms) else: self.genome = genome assert hasattr(self.genome, "chrmCount") if resolution is not None: self.resolution = resolution self.chromosomes = self.genome.chrmLens self.genome.setResolution(self.resolution) self._initChromosomes() self.dataDict = {} self.biasDict = {} self.trackDict = {} self.singlesDict = {} self.fragsDict = {} self.PCDict = {} self.EigDict = {} self.eigEigenvalueDict = {} self.PCAEigenvalueDict = {} self.dicts = [self.trackDict, self.biasDict, self.singlesDict, self.fragsDict] self.eigDicts = [self.PCDict, self.EigDict] self._loadGC() self.appliedOperations = {} def _initChromosomes(self): "internal: loads mappings from the genome class based on resolution" self.chromosomeStarts = self.genome.chrmStartsBinCont self.centromerePositions = self.genome.cntrMidsBinCont self.chromosomeEnds = self.genome.chrmEndsBinCont self.trackLength = self.genome.numBins self.chromosomeCount = self.genome.chrmCount self.chromosomeIndex = self.genome.chrmIdxBinCont self.positionIndex = self.genome.posBinCont self.armIndex = self.chromosomeIndex * 2 + \ np.array(self.positionIndex > self.genome.cntrMids [self.chromosomeIndex], int) def _giveMask(self): "Returns index of all bins with non-zero read counts" self.mask = np.ones(len(self.dataDict.values()[0]), np.bool) for data in self.dataDict.values(): datasum = np.sum(data, axis=0) datamask = datasum > 0 self.mask *= datamask return self.mask def _giveMask2D(self): """Returns outer product of _giveMask with itself, i.e. bins with possibly non-zero counts""" self._giveMask() self.mask2D = self.mask[:, None] * self.mask[None, :] return self.mask2D def _loadGC(self): "loads GC content at given resolution" self.trackDict["GC"] = np.concatenate(self.genome.GCBin) def _checkItertiveCorrectionError(self): """internal method for checking if iterative correction might be bad to apply""" for value in self.dataDict.values(): if isInteger(value) == True: s = np.sum(value, axis=0) sums = np.sort(s[s != 0]) if sums[0] < 100: error = int(100. / np.sqrt(sums[0])) message1 = "Lowest 5 sums of an array rows are: " + \ str(sums[:5]) warnings.warn("\n%s\nIterative correction will lead to \ about %d %% relative error for certain columns" % (message1, error)) if sums[0] < 5: raise StandardError("Iterative correction is \ very dangerous. Use force=true to override.") else: s = np.sum(value > 0, axis=0) sums = np.sort(s[s != 0]) if sums[0] < min(100, len(value) / 2): error = int(100. / np.sqrt(sums[0])) print "Got floating-point array for correction. Rows with \ 5 least entrees are:", sums[:5] warnings.warn("\nIterative correction might lead to about\ %d %% relative error for certain columns" % error) if sums[0] < 4: raise StandardError("Iterative correction is \ very dangerous. Use force=true to override.") def _checkAppliedOperations(self, neededKeys=[], advicedKeys=[], excludedKeys=[]): "Internal method to check if all needed operations were applied" if (True in [i in self.appliedOperations for i in excludedKeys]): print "Operations that are not allowed:", excludedKeys print "applied operations: ", self.appliedOperations print "use 'force = True' to override this message" raise StandardError("Prohibited filter was applied") if (False in [i in self.appliedOperations for i in neededKeys]): print "needed operations:", neededKeys print "applied operations:", self.appliedOperations print "use 'force = True' to override this message" raise StandardError("Critical filter not applied") if (False in [i in self.appliedOperations for i in advicedKeys]): print "Adviced operations:", advicedKeys print "Applied operations:", self.appliedOperations warnings.warn("\nNot all adviced filters applied") def _recoverOriginalReads(self, key): """Attempts to recover original read counts from the data If data is integer, returns data. If not, attepts to revert iterative correction and return original copy. This method does not modify the dataset! """ data = self.dataDict[key] if "Corrected" not in self.appliedOperations: if isInteger(data): return data else: warnings.warn("Data was not corrected, but is not integer") return None else: if key not in self.biasDict: warnings.warn("Correction was applied, " "but bias information is missing!") return None bias = self.biasDict[key] data1 = data * bias[:, None] data1 *= bias[None, :] if isInteger(data1): return data1 else: warnings.warn("Attempted recovery of reads, but " "data is not integer") return None def simpleLoad(self, in_data, name, chromosomeOrder=None): """Loads data from h5dict file or dict-like object Parameters ---------- in_data : str or dict-like h5dict filename or dictionary-like object with input data, stored under the key "heatmap", and a vector of SS reads, stored under the key "singles". name : str Key under which to store dataset in self.dataDict chromosomeOrder : None or list If file to load is a byChromosome map, use this to define chromosome order """ if type(in_data) == str: path = os.path.abspath(os.path.expanduser(in_data)) if os.path.exists(path) == False: raise IOError("HDF5 dict do not exist, %s" % path) alldata = h5dict(path, mode="r") else: alldata = in_data if type(alldata) == h5dict: if ("0 0" in alldata.keys()) and ("heatmap" not in alldata.keys()): if chromosomeOrder != None: chromosomes = chromosomeOrder else: chromosomes = xrange(self.chromosomeCount) datas = [] for i in chromosomes: datas.append(np.concatenate([alldata["{0} {1}".format(i, j)] for j in chromosomes], axis=1)) newdata = {"heatmap": np.concatenate(datas)} for i in alldata.keys(): newdata[i] = alldata[i] alldata = newdata self.dataDict[name] = np.asarray(alldata["heatmap"], dtype=np.double) try: self.singlesDict[name] = alldata["singles"] except: print "No SS reads found" try: if len(alldata["frags"]) == self.genome.numBins: self.fragsDict[name] = alldata["frags"] else: print "Different bin number in frag dict" except: pass if "resolution" in alldata: if self.resolution != alldata["resolution"]: print "resolution mismatch!!!" print "--------------> Bye <-------------" raise StandardError("Resolution mismatch! ") if self.genome.numBins != len(alldata["heatmap"]): print "Genome length mismatch!!!" print "source genome", len(alldata["heatmap"]) print "our genome", self.genome.numBins print "Check for readChrms parameter when you identify the genome" raise StandardError("Genome size mismatch! ") def export(self, name, outFilename, byChromosome=False, **kwargs): """ Exports current heatmaps and SS files to an h5dict. Parameters ---------- name : str Key for the dataset to export outFilename : str Where to export byChromosome : bool or "cis" or "all" save by chromosome heatmaps. Ignore SS reads. True means "all" """ if "out_filename" in kwargs.keys(): raise ValueError("out_filename replaced with outFilename!") if name not in self.dataDict: raise ValueError("No data {name}".format(name=name)) toexport = {} if byChromosome is False: toexport["heatmap"] = self.dataDict[name] if name in self.singlesDict: toexport["singles"] = self.singlesDict[name] if name in self.fragsDict: toexport["frags"] = self.fragsDict[name] else: hm = self.dataDict[name] for i in xrange(self.genome.chrmCount): for j in xrange(self.genome.chrmCount): if (byChromosome == "cis") and (i != j): continue st1 = self.chromosomeStarts[i] end1 = self.chromosomeEnds[i] st2 = self.chromosomeStarts[j] end2 = self.chromosomeEnds[j] toexport["{0} {1}".format(i, j)] = hm[st1:end1, st2:end2] toexport["resolution"] = self.resolution toexport["genome"] = self.genome.folderName toexport["binNumber"] = len(self.chromosomeIndex) toexport["genomeIdxToLabel"] = self.genome.idx2label toexport["chromosomeStarts"] = self.chromosomeStarts toexport["chromosomeIndex"] = self.chromosomeIndex toexport["positionIndex"] = self.positionIndex myh5dict = h5dict(outFilename, mode="w") myh5dict.update(toexport) def removeDiagonal(self, m=1): """Removes all bins on a diagonal, and bins that are up to m away from the diagonal, including m. By default, removes all bins touching the diagonal. Parameters ---------- m : int, optional Number of bins to remove """ for i in self.dataDict.keys(): self.dataDict[i] = np.asarray( self.dataDict[i], dtype=np.double, order="C") removeDiagonals(self.dataDict[i], m) self.appliedOperations["RemovedDiagonal"] = True self.removedDiagonalValue = m def removeStandalone(self, offset=3): """removes standalone groups of bins (groups of less-than-offset bins) Parameters ---------- offset : int Maximum length of group of bins to be removed """ diffs = np.diff(np.array(np.r_[False, self._giveMask(), False], int)) begins = np.nonzero(diffs == 1)[0] ends = np.nonzero(diffs == -1)[0] beginsmask = (ends - begins) <= offset newbegins = begins[beginsmask] newends = ends[beginsmask] print "removing %d standalone bins" % np.sum(newends - newbegins) mask = self._giveMask() for i in xrange(len(newbegins)): mask[newbegins[i]:newends[i]] = False mask2D = mask[:, None] * mask[None, :] antimask = np.nonzero(mask2D.flat == False)[0] for i in self.dataDict.values(): i.flat[antimask] = 0 self.appliedOperations["RemovedStandalone"] = True def removeBySequencedCount(self, sequencedFraction=0.5): """ Removes bins that have less than sequencedFraction*resolution sequenced counts. This filters bins by percent of sequenced counts, and also removes the last bin if it's very short. .. note:: this is not equivalent to mapability Parameters ---------- sequencedFraction: float, optional, 0<x<1 Fraction of the bin that needs to be sequenced in order to keep the bin """ self._checkAppliedOperations(excludedKeys="RemovedZeros") binCutoff = int(self.resolution * sequencedFraction) sequenced = np.concatenate(self.genome.mappedBasesBin) mask = sequenced < binCutoff nzmask = np.zeros( len(mask), bool) # mask of regions with non-zero counts for i in self.dataDict.values(): sumData = np.sum(i[mask], axis=1) > 0 nzmask[mask] = nzmask[mask] + sumData i[mask, :] = 0 i[:, mask] = 0 print "Removing %d bins with <%lf %% coverage by sequenced reads" % \ ((nzmask > 0).sum(), 100 * sequencedFraction) self.appliedOperations["RemovedUnsequenced"] = True pass def removePoorRegions(self, names=None, cutoff=2, coverage=False, trans=False): """Removes "cutoff" percent of bins with least counts Parameters ---------- names : list of str List of datasets to perform the filter. All by default. cutoff : int, 0<cutoff<100 Percent of lowest-counts bins to be removed """ statmask = np.zeros(len(self.dataDict.values()[0]), np.bool) mask = np.ones(len(self.dataDict.values()[0]), np.bool) if names is None: names = self.dataDict.keys() for i in names: data = self.dataDict[i] if trans: data = data.copy() data[self.chromosomeIndex[:, None] == self.chromosomeIndex[None, :]] = 0 datasum = np.sum(data, axis=0) datamask = datasum > 0 mask *= datamask if coverage == False: countsum = np.sum(data, axis=0) elif coverage == True: countsum = np.sum(data > 0, axis=0) else: raise ValueError("coverage is true or false!") newmask = countsum >= np.percentile(countsum[datamask], cutoff) mask *= newmask statmask[(newmask == False) * (datamask == True)] = True print "removed {0} poor bins".format(statmask.sum()) inds = np.nonzero(mask == False) for i in self.dataDict.values(): i[inds, :] = 0 i[:, inds] = 0 self.appliedOperations["RemovedPoor"] = True def truncTrans(self, high=0.0005): """Truncates trans contacts to remove blowouts Parameters ---------- high : float, 0<high<1, optional Fraction of top trans interactions to be removed """ for i in self.dataDict.keys(): data = self.dataDict[i] transmask = self.chromosomeIndex[:, None] != self.chromosomeIndex[None, :] lim = np.percentile(data[transmask], 100. * (1 - high)) print "dataset %s truncated at %lf" % (i, lim) tdata = data[transmask] tdata[tdata > lim] = lim self.dataDict[i][transmask] = tdata self.appliedOperations["TruncedTrans"] = True def removeCis(self): "sets to zero all cis contacts" mask = self.chromosomeIndex[:, None] == self.chromosomeIndex[None, :] for i in self.dataDict.keys(): self.dataDict[i][mask] = 0 self.appliedOperations["RemovedCis"] = True print("All cis counts set to zero") def fakeCisOnce(self, mask="CisCounts", silent=False): """Used to fake cis counts or any other region with random trans counts. If extra mask is supplied, it is used instead of cis counts. This method draws fake contact once. Use fakeCis() for iterative self-consistent faking of cis. Parameters ---------- mask : NxN boolean array or "CisCounts" Mask of elements to be faked. If set to "CisCounts", cis counts will be faked When mask is used, cis elements are NOT faked. silent : bool Do not print anything """ #TODO (MIU): check this method! if silent == False: print("All cis counts are substituted with matching trans count") for key in self.dataDict.keys(): data = np.asarray(self.dataDict[key], order="C", dtype=float) if mask == "CisCounts": _mask = np.array(self.chromosomeIndex[:, None] == self.chromosomeIndex[None, :], int, order="C") else: assert mask.shape == self.dataDict.values()[0].shape _mask = np.array(mask, dtype=int, order="C") _mask[self.chromosomeIndex[:, None] == self.chromosomeIndex[None, :]] = 2 s = np.abs(np.sum(data, axis=0)) <= 1e-10 _mask[:, s] = 2 _mask[s, :] = 2 _mask = np.asarray(_mask, dtype=np.int64) fakeCisImpl(data, _mask) self.dataDict[key] = data self.appliedOperations["RemovedCis"] = True self.appliedOperations["FakedCis"] = True def fakeCis(self, force=False, mask="CisCounts"): """This method fakes cis contacts in an interative way It is done to achieve faking cis contacts that is independent of normalization of the data. Parameters ---------- Force : bool (optional) Set this to avoid checks for iterative correction mask : see fakeCisOnce """ self.removeCis() self.iterativeCorrectWithoutSS(force=force) self.fakeCisOnce(silent=True, mask=mask) self.iterativeCorrectWithoutSS(force=force) self.fakeCisOnce(silent=True, mask=mask) self.iterativeCorrectWithoutSS(force=force) print("All cis counts are substituted with faked counts") print("Data is iteratively corrected as a part of faking cis counts") def fakeTranslocations(self, translocationRegions): """ This method fakes reads corresponding to a translocation. Parameters ---------- translocationRegions: list of tuples List of tuples (chr1,start1,end1,chr2,start2,end2), masking a high-count region around visible translocation. If end1/end2 is None, it is treated as length of chromosome. So, use (chr1,0,None,chr2,0,None) to remove inter-chromosomal interaction entirely. """ self._checkAppliedOperations(excludedKeys="RemovedZeros") mask = np.zeros((self.genome.numBins, self.genome.numBins), int) resolution = self.genome.resolution for i in translocationRegions: st1 = self.genome.chrmStartsBinCont[i[0]] st2 = self.genome.chrmStartsBinCont[i[3]] beg1 = st1 + i[1] / resolution if i[2] is not None: end1 = st1 + i[2] / resolution + 1 else: end1 = self.genome.chrmEndsBinCont[i[0]] beg2 = st2 + i[4] / resolution if i[5] is not None: end2 = st2 + i[5] / resolution + 1 else: end2 = self.genome.chrmEndsBinCont[i[3]] mask[beg1:end1, beg2:end2] = 1 mask[beg2:end2, beg1:end1] = 1 self.fakeCisOnce(mask) def correct(self, names=None): """performs single correction without SS Parameters ---------- names : list of str or None Keys of datasets to be corrected. If none, all are corrected. """ self.iterativeCorrectWithoutSS(names, M=1) def iterativeCorrectWithoutSS(self, names=None, M=None, force=False, tolerance=1e-5): """performs iterative correction without SS Parameters ---------- names : list of str or None, optional Keys of datasets to be corrected. By default, all are corrected. M : int, optional Number of iterations to perform. force : bool, optional Ignore warnings and pre-requisite filters """ if force == False: self._checkItertiveCorrectionError() self._checkAppliedOperations(advicedKeys=[ "RemovedDiagonal", "RemovedPoor"]) if names is None: names = self.dataDict.keys() for i in names: data, dummy, bias = ultracorrectSymmetricWithVector( self.dataDict[i], M=M, tolerance=tolerance) self.dataDict[i] = data self.biasDict[i] = bias if i in self.singlesDict: self.singlesDict[i] = self.singlesDict[i] / bias.astype(float) self.appliedOperations["Corrected"] = True def adaptiveSmoothing(self, smoothness, useOriginalReads="try", names=None, rawReadDict=None): """ Performs adaptive smoothing of Hi-C datasets. Adaptive smoothing attempts to smooth low-count, "sparce" part of a Hi-C matrix, while keeping the contrast in a high-count "diagonal" part of the matrix. It does it by blurring each bin pair value into a gaussian, which should encoumpass at least **smoothness** raw reads. However, only half of reads from each bin pair is counted into this gaussian, while full reads from neighboring bin pairs are counted. To summarize: If a bin pair contains #>2*smoothness reads, it is kept intact. If a bin pair contains #<2*smoothness reads, reads around bin pair are counted, and a bin pair is smoothed to a circle (gaussian), containing smoothness - (#/2) reads. A standalone read in a sparce part of a matrix is smoothed to a circle (gaussian) that encoumpasses smoothness reads. .. note:: This algorithm can smooth any heatmap, e.g. corrected one. However, ideally it needs to know raw reads to correctly leverage the contribution from different bins. By default, it attempts to recover raw reads. However, it can do so only after single iterative correction. If used after fakeCis method, it won't use raw reads, unless provided externally. .. warning:: Note that if you provide raw reads externally, you would need to make a copy of dataDict prior to filtering the data, not just a reference to it. Like >>>for i in keys: dataCopy[i] = self.dataDict[i].copy() Parameters ---------- smoothness : float, positive. Often >1. Parameter of smoothness as described above useOriginalReads : bool or "try" If True, requires to recover original reads for smoothness If False, treats heatmap data as reads If "try", attempts to recover original reads; otherwise proceeds with heatmap data. rawReadDict : dict A copy of self.dataDict with raw reads """ if names is None: names = self.dataDict.keys() mask2D = self._giveMask2D() #If diagonal was removed, we should remember about it! if hasattr(self, "removedDiagonalValue"): removeDiagonals(mask2D, self.removedDiagonalValue) for name in names: data = self.dataDict[name] if useOriginalReads is not False: if rawReadDict is not None: #raw reads provided externally reads = rawReadDict[name] else: #recovering raw reads reads = self._recoverOriginalReads(name) if reads is None: #failed to recover reads if useOriginalReads == True: raise RuntimeError("Cannot recover original reads!") else: #raw reads were not requested reads = None if reads is None: reads = data # Feed this to adaptive smoothing smoothed = np.zeros_like(data, dtype=float) N = self.chromosomeCount for i in xrange(N): for j in xrange(N): st1 = self.chromosomeStarts[i] st2 = self.chromosomeStarts[j] end1 = self.chromosomeEnds[i] end2 = self.chromosomeEnds[j] cur = data[st1:end1, st2:end2] curReads = reads[st1:end1, st2:end2] curMask = mask2D[st1:end1, st2:end2] s = adaptiveSmoothing(matrix=cur, cutoff=smoothness, alpha=0.5, mask=curMask, originalCounts=curReads) smoothed[st1:end1, st2:end2] = s self.dataDict[name] = smoothed self.appliedOperations["Smoothed"] = True def removeChromosome(self, chromNum): """removes certain chromosome from all tracks and heatmaps, setting all values to zero Parameters ---------- chromNum : int Number of chromosome to be removed """ beg = self.genome.chrmStartsBinCont[chromNum] end = self.genome.chrmEndsBinCont[chromNum] for i in self.dataDict.values(): i[beg:end] = 0 i[:, beg:end] = 0 for mydict in self.dicts: for value in mydict.values(): value[beg:end] = 0 for mydict in self.eigDicts: for value in mydict.values(): value[beg:end] = 0 def removeZeros(self, zerosMask=None): """removes bins with zero counts keeps chromosome starts, ends, etc. consistent Parameters ---------- zerosMask : length N array or None, optional If provided, this method removes a defined set of bins By default, it removes bins with zero # counts. """ if zerosMask is not None: s = zerosMask else: s = np.sum(self._giveMask2D(), axis=0) > 0 for i in self.dataDict.values(): s *= (np.sum(i, axis=0) > 0) indices = np.zeros(len(s), int) count = 0 for i in xrange(len(indices)): if s[i] == True: indices[i] = count count += 1 else: indices[i] = count indices = np.r_[indices, indices[-1] + 1] N = len(self.positionIndex) for i in self.dataDict.keys(): a = self.dataDict[i] if len(a) != N: raise ValueError("Wrong dimensions of data %i: \ %d instead of %d" % (i, len(a), N)) b = a[:, s] c = b[s, :] self.dataDict[i] = c for mydict in self.dicts: for key in mydict.keys(): if len(mydict[key]) != N: raise ValueError("Wrong dimensions of data {0}: {1} instead of {2}".format(key, len(mydict[key]), N)) mydict[key] = mydict[key][s] for mydict in self.eigDicts: for key in mydict.keys(): mydict[key] = mydict[key][:, s] if len(mydict[key][0]) != N: raise ValueError("Wrong dimensions of data %i: \ %d instead of %d" % (key, len(mydict[key][0]), N)) self.chromosomeIndex = self.chromosomeIndex[s] self.positionIndex = self.positionIndex[s] self.armIndex = self.armIndex[s] self.chromosomeEnds = indices[self.chromosomeEnds] self.chromosomeStarts = indices[self.chromosomeStarts] self.centromerePositions = indices[self.centromerePositions] self.removeZerosMask = s if self.appliedOperations.get("RemovedZeros", False) == True: warnings.warn("\nYou're removing zeros twice. \ You can't restore zeros now!") self.appliedOperations["RemovedZeros"] = True self.genome.setResolution(-1) return s def restoreZeros(self, value=np.NAN): """Restores zeros that were removed by removeZeros command. .. warning:: You can restore zeros only if you used removeZeros once. Parameters ---------- value : number-like, optional. Value to fill in missing regions. By default, NAN. """ if not hasattr(self, "removeZerosMask"): raise StandardError("Zeros have not been removed!") s = self.removeZerosMask N = len(s) for i in self.dataDict.keys(): a = self.dataDict[i] self.dataDict[i] = np.zeros((N, N), dtype=a.dtype) * value tmp = np.zeros((N, len(a)), dtype=a.dtype) * value tmp[s, :] = a self.dataDict[i][:, s] = tmp for mydict in self.dicts: for key in mydict.keys(): a = mydict[key] mydict[key] = np.zeros(N, dtype=a.dtype) * value mydict[key][s] = a for mydict in self.eigDicts: #print mydict for key in mydict.keys(): a = mydict[key] mydict[key] = np.zeros((len(a), N), dtype=a.dtype) * value mydict[key][:, s] = a self.genome.setResolution(self.resolution) self._initChromosomes() self.appliedOperations["RemovedZeros"] = False def doPCA(self, force=False): """performs PCA on the data creates dictionary self.PCADict with results Last column of PC matrix is first PC, second to last - second, etc. Returns ------- Dictionary of principal component matrices for different datasets """ neededKeys = ["RemovedZeros", "Corrected", "FakedCis"] advicedKeys = ["TruncedTrans", "RemovedPoor"] if force == False: self._checkAppliedOperations(neededKeys, advicedKeys) for i in self.dataDict.keys(): currentPCA, eigenvalues = PCA(self.dataDict[i]) self.PCAEigenvalueDict[i] = eigenvalues for j in xrange(len(currentPCA)): if spearmanr(currentPCA[j], self.trackDict["GC"])[0] < 0: currentPCA[j] = -currentPCA[j] self.PCDict[i] = currentPCA return self.PCDict def doEig(self, numPCs=3, force=False): """performs eigenvector expansion on the data creates dictionary self.EigDict with results Last row of the eigenvector matrix is the largest eigenvector, etc. Returns ------- Dictionary of eigenvector matrices for different datasets """ neededKeys = ["RemovedZeros", "Corrected", "FakedCis"] advicedKeys = ["TruncedTrans", "RemovedPoor"] if force == False: self._checkAppliedOperations(neededKeys, advicedKeys) for i in self.dataDict.keys(): currentEIG, eigenvalues = EIG(self.dataDict[i], numPCs=numPCs) self.eigEigenvalueDict[i] = eigenvalues for j in xrange(len(currentEIG)): if spearmanr(currentEIG[j], self.trackDict["GC"])[0] < 0: currentEIG[j] = -currentEIG[j] self.EigDict[i] = currentEIG return self.EigDict def doCisPCADomains( self, numPCs=3, swapFirstTwoPCs=False, useArms=True, corrFunction=lambda x, y: spearmanr(x, y)[0], domainFunction="default"): """Calculates A-B compartments based on cis data. All PCs are oriented to have positive correlation with GC. Writes the main result (PCs) in the self.PCADict dictionary. Additionally, returns correlation coefficients with GC; by chromosome. Parameters ---------- numPCs : int, optional Number of PCs to compute swapFirstTwoPCs : bool, by default False Swap first and second PC if second has higher correlation with GC useArms : bool, by default True Use individual arms, not chromosomes corr function : function, default: spearmanr Function to compute correlation with GC. Accepts two arrays, returns correlation domain function : function, optional Function to calculate principal components of a square matrix. Accepts: N by N matrix returns: numPCs by N matrix Default does iterative correction, then observed over expected. Then IC Then calculates correlation matrix. Then calculates PCA of correlation matrix. other options: metaphasePaper (like in Naumova, Science 2013) .. note:: Main output of this function is written to self.PCADict Returns ------- corrdict,lengthdict Dictionaries with keys for each dataset. Values of corrdict contains an M x numPCs array with correlation coefficient for each chromosome (or arm) with non-zero length. Values of lengthdict contain lengthds of chromosomes/arms. These dictionaries can be used to calculate average correlation coefficient by chromosome (or by arm). """ corr = corrFunction if (type(domainFunction) == str): domainFunction = domainFunction.lower() if domainFunction in ["metaphasepaper", "default", "lieberman", "erez", "geoff", "lieberman+", "erez+"]: fname = domainFunction def domainFunction(chrom): #orig = chrom.copy() M = len(chrom.flat) toclip = 100 * min(0.999, (M - 10.) / M) removeDiagonals(chrom, 1) chrom = ultracorrect(chrom) chrom = observedOverExpected(chrom) chrom = np.clip(chrom, -1e10, np.percentile(chrom, toclip)) for i in [-1, 0, 1]: fillDiagonal(chrom, 1, i) if fname in ["default", "lieberman+", "erez+"]: #upgrade of (Lieberman 2009) # does IC, then OoE, then IC, then corrcoef, then PCA chrom = ultracorrect(chrom) chrom = np.corrcoef(chrom) PCs = PCA(chrom, numPCs)[0] return PCs elif fname in ["lieberman", "erez"]: #slight upgrade of (Lieberman 2009) # does IC, then OoE, then corrcoef, then PCA chrom = np.corrcoef(chrom) PCs = PCA(chrom, numPCs)[0] return PCs elif fname in ["metaphasepaper", "geoff"]: chrom = ultracorrect(chrom) PCs = EIG(chrom, numPCs)[0] return PCs else: raise if domainFunction in ["lieberman-", "erez-"]: #simplest function presented in (Lieberman 2009) #Closest to (Lieberman 2009) that we could do def domainFunction(chrom): removeDiagonals(chrom, 1) chrom = observedOverExpected(chrom) chrom = np.corrcoef(chrom) PCs = PCA(chrom, numPCs)[0] return PCs corrdict, lengthdict = {}, {} #dict of per-chromosome correlation coefficients for key in self.dataDict.keys(): corrdict[key] = [] lengthdict[key] = [] dataset = self.dataDict[key] N = len(dataset) PCArray = np.zeros((3, N)) for chrom in xrange(len(self.chromosomeStarts)): if useArms == False: begs = (self.chromosomeStarts[chrom],) ends = (self.chromosomeEnds[chrom],) else: begs = (self.chromosomeStarts[chrom], self.centromerePositions[chrom]) ends = (self.centromerePositions[chrom], self.chromosomeEnds[chrom]) for end, beg in map(None, ends, begs): if end - beg < 5: continue chrom = dataset[beg:end, beg:end] GC = self.trackDict["GC"][beg:end] PCs = domainFunction(chrom) for PC in PCs: if corr(PC, GC) < 0: PC *= -1 if swapFirstTwoPCs == True: if corr(PCs[0], GC) < corr(PCs[1], GC): p0, p1 = PCs[0].copy(), PCs[1].copy() PCs[0], PCs[1] = p1, p0 corrdict[key].append(tuple([corr(i, GC) for i in PCs])) lengthdict[key].append(end - beg) PCArray[:, beg:end] = PCs self.PCDict[key] = PCArray return corrdict, lengthdict def cisToTrans(self, mode="All", filename="GM-all"): """ Calculates cis-to-trans ratio. "All" - treating SS as trans reads "Dummy" - fake SS reads proportional to cis reads with the same total sum "Matrix" - use heatmap only """ data = self.dataDict[filename] cismap = self.chromosomeIndex[:, None] == self.chromosomeIndex[None, :] cissums = np.sum(cismap * data, axis=0) allsums = np.sum(data, axis=0) if mode.lower() == "all": cissums += self.singlesDict[filename] allsums += self.singlesDict[filename] elif mode.lower() == "dummy": sm = np.mean(self.singlesDict[filename]) fakesm = cissums * sm / np.mean(cissums) cissums += fakesm allsums += fakesm elif mode.lower() == "matrix": pass else: raise return cissums / allsums class binnedDataAnalysis(binnedData): """ Class containing experimental features and data analysis scripts """ def plotScaling(self, name, label="BLA", color=None, plotUnit=1000000): "plots scaling of a heatmap,treating arms separately" import matplotlib.pyplot as plt data = self.dataDict[name] bins = numutils.logbins( 2, self.genome.maxChrmArm / self.resolution, 1.17) s = np.sum(data, axis=0) > 0 mask = s[:, None] * s[None, :] chroms = [] masks = [] for i in xrange(self.chromosomeCount): beg = self.chromosomeStarts[i] end = self.centromerePositions[i] chroms.append(data[beg:end, beg:end]) masks.append(mask[beg:end, beg:end]) beg = self.centromerePositions[i] end = self.chromosomeEnds[i] chroms.append(data[beg:end, beg:end]) masks.append(mask[beg:end, beg:end]) observed = [] expected = [] for i in xrange(len(bins) - 1): low = bins[i] high = bins[i + 1] obs = 0 exp = 0 for j in xrange(len(chroms)): if low > len(chroms[j]): continue high2 = min(high, len(chroms[j])) for k in xrange(low, high2): obs += np.sum(np.diag(chroms[j], k)) exp += np.sum(np.diag(masks[j], k)) observed.append(obs) expected.append(exp) observed = np.array(observed, float) expected = np.array(expected, float) values = observed / expected bins = np.array(bins, float) bins2 = 0.5 * (bins[:-1] + bins[1:]) norm = np.sum(values * (bins[1:] - bins[:-1]) * ( self.resolution / float(plotUnit))) args = [self.resolution * bins2 / plotUnit, values / (1. * norm)] if color is not None: args.append(color) plt.plot(*args, label=label, linewidth=2) def averageTransMap(self, name, **kwargs): "plots and returns average inter-chromosomal inter-arm map" import matplotlib.pyplot as plt from mirnylib.plotting import removeBorder data = self.dataDict[name] avarms = np.zeros((80, 80)) avmasks = np.zeros((80, 80)) discardCutoff = 10 for i in xrange(self.chromosomeCount): print i for j in xrange(self.chromosomeCount): for k in [-1, 1]: for l in [-1, 1]: if i == j: continue cenbeg1 = self.chromosomeStarts[i] + \ self.genome.cntrStarts[i] / self.resolution cenbeg2 = self.chromosomeStarts[j] + \ self.genome.cntrStarts[j] / self.resolution cenend1 = self.chromosomeStarts[i] + \ self.genome.cntrEnds[i] / self.resolution cenend2 = self.chromosomeStarts[j] + \ self.genome.cntrEnds[j] / self.resolution beg1 = self.chromosomeStarts[i] beg2 = self.chromosomeStarts[j] end1 = self.chromosomeEnds[i] end2 = self.chromosomeEnds[j] if k == 1: bx = cenbeg1 ex = beg1 - 1 dx = -1 else: bx = cenend1 ex = end1 dx = 1 if l == 1: by = cenbeg2 ey = beg2 - 1 dy = -1 else: by = cenend2 ey = end2 dy = 1 if abs(bx - ex) < discardCutoff: continue if bx < 0: bx = None if ex < 0: ex = None if abs(by - ey) < discardCutoff: continue if by < 0: by = None if ey < 0: ey = None arms = data[bx:ex:dx, by:ey:dy] assert max(arms.shape) <= self.genome.maxChrmArm / \ self.genome.resolution + 2 mx = np.sum(arms, axis=0) my = np.sum(arms, axis=1) maskx = mx == 0 masky = my == 0 mask = (maskx[None, :] + masky[:, None]) == False maskf = np.array(mask, float) mlenx = (np.abs(np.sum(mask, axis=0)) > 1e-20).sum() mleny = (np.abs(np.sum(mask, axis=1)) > 1e-20).sum() if min(mlenx, mleny) < discardCutoff: continue add = numutils.zoomOut(arms, avarms.shape) assert np.abs((arms.sum() - add.sum( )) / arms.sum()) < 0.02 addmask = numutils.zoomOut(maskf, avarms.shape) avarms += add avmasks += addmask avarms /= np.mean(avarms) data = avarms / avmasks data /= np.mean(data) plt.imshow(np.log(numutils.trunc( data)), cmap="jet", interpolation="nearest", **kwargs) removeBorder() return np.log(numutils.trunc(data)) def perArmCorrelation(self, data1, data2, doByArms=[]): """does inter-chromosomal spearman correlation of two vectors for each chromosomes separately. Averages over chromosomes with weight of chromosomal length For chromosomes in "doByArms" treats arms as separatre chromosomes returns average Spearman r correlation """ cr = 0 ln = 0 for i in xrange(self.chromosomeCount): if i in doByArms: beg = self.chromosomeStarts[i] end = self.centromerePositions[i] if end > beg: cr += (abs(spearmanr(data1[beg:end], data2[beg:end] )[0])) * (end - beg) ln += (end - beg) print spearmanr(data1[beg:end], data2[beg:end])[0] beg = self.centromerePositions[i] end = self.chromosomeEnds[i] if end > beg: cr += (abs(spearmanr(data1[beg:end], data2[beg:end] )[0])) * (end - beg) ln += (end - beg) print spearmanr(data1[beg:end], data2[beg:end])[0] else: beg = self.chromosomeStarts[i] end = self.chromosomeEnds[i] if end > beg: cr += (abs(spearmanr(data1[beg:end], data2[beg:end] )[0])) * (end - beg) ln += (end - beg) return cr / ln def divideOutAveragesPerChromosome(self): "divides each interchromosomal map by it's mean value" mask2D = self._giveMask2D() for chrom1 in xrange(self.chromosomeCount): for chrom2 in xrange(self.chromosomeCount): for i in self.dataDict.keys(): value = self.dataDict[i] submatrix = value[self.chromosomeStarts[chrom1]: self.chromosomeEnds[chrom1], self.chromosomeStarts[chrom2]: self.chromosomeEnds[chrom2]] masksum = np.sum( mask2D[self.chromosomeStarts[chrom1]: self.chromosomeEnds[chrom1], self.chromosomeStarts[chrom2]: self.chromosomeEnds[chrom2]]) valuesum = np.sum(submatrix) mean = valuesum / masksum submatrix /= mean def interchromosomalValues(self, filename="GM-all", returnAll=False): """returns average inter-chromosome-interaction values, ordered always the same way""" values = self.chromosomeIndex[:, None] + \ self.chromosomeCount * self.chromosomeIndex[None, :] values[self.chromosomeIndex[:, None] == self.chromosomeIndex[None, :]] = self.chromosomeCount * self.chromosomeCount - 1 #mat_img(values) uv = np.sort(np.unique(values))[1:-1] probs = np.bincount( values.ravel(), weights=self.dataDict[filename].ravel()) counts = np.bincount(values.ravel()) if returnAll == False: return probs[uv] / counts[uv] else: probs[self.chromosomeCount * self.chromosomeCount - 1] = 0 values = probs / counts values[counts == 0] = 0 #mat_img(values.reshape((22,22))) return values.reshape((self.chromosomeCount, self.chromosomeCount)) class experimentalBinnedData(binnedData): "Contains some poorly-implemented new features" def projectOnEigenvalues(self, eigenvectors=[0]): """ Calculates projection of the data on a set of eigenvectors. This is used to calculate heatmaps, reconstructed from eigenvectors. Parameters ---------- eigenvectors : list of non-negative ints, optional Zero-based indices of eigenvectors, to project onto By default projects on the first eigenvector Returns ------- Puts resulting data in dataDict under DATANAME_projected key """ for name in self.dataDict.keys(): if name not in self.EigDict: raise RuntimeError("Calculate eigenvectors first!") PCs = self.EigDict[name] if max(eigenvectors) >= len(PCs): raise RuntimeError("Not enough eigenvectors." "Increase numPCs in doEig()") PCs = PCs[eigenvectors] eigenvalues = self.eigEigenvalueDict[name][eigenvectors] proj = reduce(lambda x, y: x + y, [PCs[i][:, None] * PCs[i][None, :] * \ eigenvalues[i] for i in xrange(len(PCs))]) mask = PCs[0] != 0 mask = mask[:, None] * mask[None, :] # maks of non-zero elements data = self.dataDict[name] datamean = np.mean(data[mask]) proj[mask] += datamean self.dataDict[name + "_projected"] = proj def emulateCis(self): """if you want to have fun creating syntetic data, this emulates cis contacts. adjust cis/trans ratio in the C code""" from scipy import weave transmap = self.chromosomeIndex[:, None] == self.chromosomeIndex[None, :] len(transmap) for i in self.dataDict.keys(): data = self.dataDict[i] * 1. N = len(data) N code = r""" #line 1427 "binnedData.py" using namespace std; for (int i = 0; i < N; i++) { for (int j = 0; j<N; j++) { if (transmap[N * i + j] == 1) { data[N * i + j] = data[N * i +j] * 300 /(abs(i-j) + \ 0.5); } } } """ support = """ #include <math.h> """ weave.inline(code, ['transmap', 'data', "N"], extra_compile_args=['-march=native -malign-double'], support_code=support) self.dataDict[i] = data self.removedCis = False self.fakedCis = False def fakeMissing(self): """fakes megabases that have no reads. For cis reads fakes with cis reads at the same distance. For trans fakes with random trans read at the same diagonal. """ from scipy import weave for i in self.dataDict.keys(): data = self.dataDict[i] * 1. sm = np.sum(data, axis=0) > 0 mask = sm[:, None] * sm[None, :] transmask = np.array(self.chromosomeIndex[:, None] == self.chromosomeIndex[None, :], int) #mat_img(transmask) N = len(data) N, transmask, mask # to remove warning code = r""" #line 1467 "binnedData.py" using namespace std; for (int i = 0; i < N; i++) { for (int j = i; j<N; j++) { if ((MASK2(i,j) == 0) ) { for (int ss = 0; ss < 401; ss++) { int k = 0; int s = rand() % (N - (j-i)); if ((mask[s * N + s + j - i] == 1) &&\ ((transmask[s * N + s + j - i] ==\ transmask[i * N + j]) || (ss > 200)) ) { data[i * N + j] = data[s * N + s + j - i]; data[j * N + i] = data[s * N + s + j - i]; break; } if (ss == 400) {printf("Cannot fake one point... \ skipping %d %d \n",i,j);} } } } } """ support = """ #include <math.h> """ for _ in xrange(5): weave.inline(code, ['transmask', 'mask', 'data', "N"], extra_compile_args=['-march=native' ' -malign-double -O3'], support_code=support) data = correct(data) self.dataDict[i] = data #mat_img(self.dataDict[i]>0) def iterativeCorrectByTrans(self, names=None): """performs iterative correction by trans data only, corrects cis also Parameters ---------- names : list of str or None, optional Keys of datasets to be corrected. By default, all are corrected. """ self.appliedOperations["Corrected"] = True if names is None: names = self.dataDict.keys() self.transmap = self.chromosomeIndex[:, None] != self.chromosomeIndex[None, :] #mat_img(self.transmap) for i in names: data = self.dataDict[i] self.dataDict[i], self.biasDict[i] = \ numutils.ultracorrectSymmetricByMask(data, self.transmap, M=None) try: self.singlesDict[i] /= self.biasDict[i] except: print "bla" def loadWigFile(self, filenames, label, control=None, wigFileType="Auto", functionToAverage=np.log, internalResolution=1000): byChromosome = self.genome.parseAnyWigFile(filenames=filenames, control=control, wigFileType=wigFileType, functionToAverage=functionToAverage, internalResolution=internalResolution) self.trackDict[label] = np.concatenate(byChromosome) def loadErezEigenvector1MB(self, erezFolder): "Loads Erez chromatin domain eigenvector for HindIII" if self.resolution != 1000000: raise StandardError("Erez eigenvector is only at 1MB resolution") if self.genome.folderName != "hg18": raise StandardError("Erez eigenvector is for hg18 only!") folder = os.path.join(erezFolder, "GM-combined.ctgDATA1.ctgDATA1." "1000000bp.hm.eigenvector.tab") folder2 = os.path.join(erezFolder, "GM-combined.ctgDATA1.ctgDATA1." "1000000bp.hm.eigenvector2.tab") eigenvector = np.zeros(self.genome.numBins, float) for chrom in range(1, 24): filename = folder.replace("DATA1", str(chrom)) if chrom in [4, 5]: filename = folder2.replace("DATA1", str(chrom)) mydata = np.array([[float(j) for j in i.split( )] for i in open(filename).readlines()]) eigenvector[self.genome.chrmStartsBinCont[chrom - 1] + np.array(mydata[:, 1], int)] = mydata[:, 2] self.trackDict["Erez"] = eigenvector def loadTanayDomains(self): "domains, extracted from Tanay paper image" if self.genome.folderName != "hg18": raise StandardError("Tanay domains work only with hg18") data = """0 - 17, 1 - 13.5, 2 - 6.5, 0 - 2, 2 - 2; x - 6.5, 0 - 6,\ 1 - 13.5, 0 - 1.5, 1 - 14.5 1 - 8.5, 0 - 2.5, 1 - 14, 2 - 6; 0 - 1.5, 2 - 11.5, 1 - 35 1 - 14, 0-6, 2 - 11; 2 - 4.5, 1 - 5, 0 - 4, 1 -20.5, 0 - 2 0 - 3, 2 - 14; 2 - 5, 1 - 42 2 - 16; 2 - 7, 0 - 3, 1 - 18.5, 0 - 1, 1 - 13, 0 - 2.5 0 - 2, 1 - 6.5, 0 - 7.5, 2 - 4; 2 - 6, 1 - 31 0 - 2, 1 - 11, 2 - 7; 2 - 7.5, 1 - 5, 0 - 3, 1 - 19 2 - 9.5, 0 - 1, 2 - 5; 2 - 4, 1 - 27.5, 0 - 2.5 2 - 11.5, 0 - 2.5, x - 2.5; x - 5, 2 - 8, 0 - 3.5, 1 - 9, 0 - 6 2 - 13.5; 2 - 9, 0 - 3, 1 - 6, 0 - 3.5, 1 - 10.5 0 - 3.5, 2 - 15; 2 - 1, 0 - 7.5, 1 - 13, 0 - 1.5, 1 - 4 0 - 4, 2 - 8; 2 - 2, 0 - 5, 2 - 2.5, 1 - 13, 0 - 6.5, 1 - 3.5 x - 5.5; 2 - 8.5, 0 - 1, 2 - 7, 1 - 16 x - 5.5; 2 - 14.5, 0 - 6, 2 - 3, 1 - 2.5, 2 - 1, 0 - 3 x - 5.5; 2 - 6, 0 - 3.5, 2 - 1.5, 0 - 11.5, 2 - 5.5 0 - 11, 2 - 1; x - 2.5, 2 - 6.5, 0 - 3, 2 - 2, 0 - 3.5 0 - 4, 2 - 1.5, 0 - 1.5; 0 - 19 2 - 5; 2 - 20 0 - 9.5, x - 1.5; x - 1, 2 - 2, 0 - 8.5 0 - 2, 2 - 7; 0 - 8, 2 - 2, 0 - 1 x - 0.5; 2 - 8.5, 0 - 3 x - 4; 0 -12 x - 1.5, 1 - 13, 2 - 5.5; 2 - 2, 1 - 29""" chroms = [i.split(";") for i in data.split("\n")] result = [] for chrom in chroms: result.append([]) cur = result[-1] for arm in chrom: for enrty in arm.split(","): spentry = enrty.split("-") if "x" in spentry[0]: value = -1 else: value = int(spentry[0]) cur += ([value] * int(2 * float(spentry[1]))) cur += [-1] * 2 #lenses = [len(i) for i in result] domains = np.zeros(self.genome.numBins, int) for i in xrange(self.genome.chrmCount): for j in xrange((self.genome.chrmLens[i] / self.resolution)): domains[self.genome.chrmStartsBinCont[i] + j] = \ result[i][(j * len(result[i]) / ((self.genome.chrmLens[i] / self.resolution)))] self.trackDict['TanayDomains'] = domains
bxlab/HiFive_Paper
Scripts/HiCLib/mirnylab-hiclib-460c3fbc0f72/src/hiclib/binnedData.py
Python
bsd-3-clause
64,389
[ "Gaussian" ]
6c2c5e49ca350894a58e66149f788b5ccba90d78183be202d092d5c8c02fff74
# # Copyright 2016 The BigDL Authors. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # from bigdl.orca.data.pandas.preprocessing import read_csv from bigdl.orca.data.pandas.preprocessing import read_json from bigdl.orca.data.pandas.preprocessing import read_parquet
intel-analytics/BigDL
python/orca/src/bigdl/orca/data/pandas/__init__.py
Python
apache-2.0
766
[ "ORCA" ]
01726e1cb8f70987a116d40dc8c8ae9a67b305156b835c0e957e2c31d06a7d60
"""Forest of trees-based ensemble methods Those methods include random forests and extremely randomized trees. The module structure is the following: - The ``BaseForest`` base class implements a common ``fit`` method for all the estimators in the module. The ``fit`` method of the base ``Forest`` class calls the ``fit`` method of each sub-estimator on random samples (with replacement, a.k.a. bootstrap) of the training set. The init of the sub-estimator is further delegated to the ``BaseEnsemble`` constructor. - The ``ForestClassifier`` and ``ForestRegressor`` base classes further implement the prediction logic by computing an average of the predicted outcomes of the sub-estimators. - The ``RandomForestClassifier`` and ``RandomForestRegressor`` derived classes provide the user with concrete implementations of the forest ensemble method using classical, deterministic ``DecisionTreeClassifier`` and ``DecisionTreeRegressor`` as sub-estimator implementations. - The ``ExtraTreesClassifier`` and ``ExtraTreesRegressor`` derived classes provide the user with concrete implementations of the forest ensemble method using the extremely randomized trees ``ExtraTreeClassifier`` and ``ExtraTreeRegressor`` as sub-estimator implementations. Single and multi-output problems are both handled. """ # Authors: Gilles Louppe <g.louppe@gmail.com> # Brian Holt <bdholt1@gmail.com> # Joly Arnaud <arnaud.v.joly@gmail.com> # Fares Hedayati <fares.hedayati@gmail.com> # # License: BSD 3 clause from __future__ import division import warnings from warnings import warn from abc import ABCMeta, abstractmethod import numpy as np from scipy.sparse import issparse from scipy.sparse import hstack as sparse_hstack from ..base import ClassifierMixin, RegressorMixin from ..externals.joblib import Parallel, delayed from ..externals import six from ..feature_selection.from_model import _LearntSelectorMixin from ..metrics import r2_score from ..preprocessing import OneHotEncoder from ..tree import (DecisionTreeClassifier, DecisionTreeRegressor, ExtraTreeClassifier, ExtraTreeRegressor) from ..tree._tree import DTYPE, DOUBLE from ..utils import check_random_state, check_array, compute_sample_weight from ..exceptions import DataConversionWarning, NotFittedError from .base import BaseEnsemble, _partition_estimators from ..utils.fixes import bincount from ..utils.multiclass import check_classification_targets __all__ = ["RandomForestClassifier", "RandomForestRegressor", "ExtraTreesClassifier", "ExtraTreesRegressor", "RandomTreesEmbedding"] MAX_INT = np.iinfo(np.int32).max def _generate_sample_indices(random_state, n_samples): """Private function used to _parallel_build_trees function.""" random_instance = check_random_state(random_state) sample_indices = random_instance.randint(0, n_samples, n_samples) return sample_indices def _generate_unsampled_indices(random_state, n_samples): """Private function used to forest._set_oob_score function.""" sample_indices = _generate_sample_indices(random_state, n_samples) sample_counts = bincount(sample_indices, minlength=n_samples) unsampled_mask = sample_counts == 0 indices_range = np.arange(n_samples) unsampled_indices = indices_range[unsampled_mask] return unsampled_indices def _parallel_build_trees(tree, forest, X, y, sample_weight, tree_idx, n_trees, verbose=0, class_weight=None): """Private function used to fit a single tree in parallel.""" if verbose > 1: print("building tree %d of %d" % (tree_idx + 1, n_trees)) if forest.bootstrap: n_samples = X.shape[0] if sample_weight is None: curr_sample_weight = np.ones((n_samples,), dtype=np.float64) else: curr_sample_weight = sample_weight.copy() indices = _generate_sample_indices(tree.random_state, n_samples) sample_counts = bincount(indices, minlength=n_samples) curr_sample_weight *= sample_counts if class_weight == 'subsample': with warnings.catch_warnings(): warnings.simplefilter('ignore', DeprecationWarning) curr_sample_weight *= compute_sample_weight('auto', y, indices) elif class_weight == 'balanced_subsample': curr_sample_weight *= compute_sample_weight('balanced', y, indices) tree.fit(X, y, sample_weight=curr_sample_weight, check_input=False) else: tree.fit(X, y, sample_weight=sample_weight, check_input=False) return tree def _parallel_helper(obj, methodname, *args, **kwargs): """Private helper to workaround Python 2 pickle limitations""" return getattr(obj, methodname)(*args, **kwargs) class BaseForest(six.with_metaclass(ABCMeta, BaseEnsemble, _LearntSelectorMixin)): """Base class for forests of trees. Warning: This class should not be used directly. Use derived classes instead. """ @abstractmethod def __init__(self, base_estimator, n_estimators=10, estimator_params=tuple(), bootstrap=False, oob_score=False, n_jobs=1, random_state=None, verbose=0, warm_start=False, class_weight=None): super(BaseForest, self).__init__( base_estimator=base_estimator, n_estimators=n_estimators, estimator_params=estimator_params) self.bootstrap = bootstrap self.oob_score = oob_score self.n_jobs = n_jobs self.random_state = random_state self.verbose = verbose self.warm_start = warm_start self.class_weight = class_weight def apply(self, X): """Apply trees in the forest to X, return leaf indices. Parameters ---------- X : array-like or sparse matrix, shape = [n_samples, n_features] The input samples. Internally, it will be converted to ``dtype=np.float32`` and if a sparse matrix is provided to a sparse ``csr_matrix``. Returns ------- X_leaves : array_like, shape = [n_samples, n_estimators] For each datapoint x in X and for each tree in the forest, return the index of the leaf x ends up in. """ X = self._validate_X_predict(X) results = Parallel(n_jobs=self.n_jobs, verbose=self.verbose, backend="threading")( delayed(_parallel_helper)(tree, 'apply', X, check_input=False) for tree in self.estimators_) return np.array(results).T def decision_path(self, X): """Return the decision path in the forest Parameters ---------- X : array-like or sparse matrix, shape = [n_samples, n_features] The input samples. Internally, it will be converted to ``dtype=np.float32`` and if a sparse matrix is provided to a sparse ``csr_matrix``. Returns ------- indicator : sparse csr array, shape = [n_samples, n_nodes] Return a node indicator matrix where non zero elements indicates that the samples goes through the nodes. n_nodes_ptr : array of size (n_estimators + 1, ) The columns from indicator[n_nodes_ptr[i]:n_nodes_ptr[i+1]] gives the indicator value for the i-th estimator. """ X = self._validate_X_predict(X) indicators = Parallel(n_jobs=self.n_jobs, verbose=self.verbose, backend="threading")( delayed(_parallel_helper)(tree, 'decision_path', X, check_input=False) for tree in self.estimators_) n_nodes = [0] n_nodes.extend([i.shape[1] for i in indicators]) n_nodes_ptr = np.array(n_nodes).cumsum() return sparse_hstack(indicators).tocsr(), n_nodes_ptr def fit(self, X, y, sample_weight=None): """Build a forest of trees from the training set (X, y). Parameters ---------- X : array-like or sparse matrix of shape = [n_samples, n_features] The training input samples. Internally, it will be converted to ``dtype=np.float32`` and if a sparse matrix is provided to a sparse ``csc_matrix``. y : array-like, shape = [n_samples] or [n_samples, n_outputs] The target values (class labels in classification, real numbers in regression). sample_weight : array-like, shape = [n_samples] or None Sample weights. If None, then samples are equally weighted. Splits that would create child nodes with net zero or negative weight are ignored while searching for a split in each node. In the case of classification, splits are also ignored if they would result in any single class carrying a negative weight in either child node. Returns ------- self : object Returns self. """ # Validate or convert input data X = check_array(X, accept_sparse="csc", dtype=DTYPE) y = check_array(y, accept_sparse='csc', ensure_2d=False, dtype=None) if issparse(X): # Pre-sort indices to avoid that each individual tree of the # ensemble sorts the indices. X.sort_indices() # Remap output n_samples, self.n_features_ = X.shape y = np.atleast_1d(y) if y.ndim == 2 and y.shape[1] == 1: warn("A column-vector y was passed when a 1d array was" " expected. Please change the shape of y to " "(n_samples,), for example using ravel().", DataConversionWarning, stacklevel=2) if y.ndim == 1: # reshape is necessary to preserve the data contiguity against vs # [:, np.newaxis] that does not. y = np.reshape(y, (-1, 1)) self.n_outputs_ = y.shape[1] y, expanded_class_weight = self._validate_y_class_weight(y) if getattr(y, "dtype", None) != DOUBLE or not y.flags.contiguous: y = np.ascontiguousarray(y, dtype=DOUBLE) if expanded_class_weight is not None: if sample_weight is not None: sample_weight = sample_weight * expanded_class_weight else: sample_weight = expanded_class_weight # Check parameters self._validate_estimator() if not self.bootstrap and self.oob_score: raise ValueError("Out of bag estimation only available" " if bootstrap=True") random_state = check_random_state(self.random_state) if not self.warm_start: # Free allocated memory, if any self.estimators_ = [] n_more_estimators = self.n_estimators - len(self.estimators_) if n_more_estimators < 0: raise ValueError('n_estimators=%d must be larger or equal to ' 'len(estimators_)=%d when warm_start==True' % (self.n_estimators, len(self.estimators_))) elif n_more_estimators == 0: warn("Warm-start fitting without increasing n_estimators does not " "fit new trees.") else: if self.warm_start and len(self.estimators_) > 0: # We draw from the random state to get the random state we # would have got if we hadn't used a warm_start. random_state.randint(MAX_INT, size=len(self.estimators_)) trees = [] for i in range(n_more_estimators): tree = self._make_estimator(append=False) tree.set_params(random_state=random_state.randint(MAX_INT)) trees.append(tree) # Parallel loop: we use the threading backend as the Cython code # for fitting the trees is internally releasing the Python GIL # making threading always more efficient than multiprocessing in # that case. trees = Parallel(n_jobs=self.n_jobs, verbose=self.verbose, backend="threading")( delayed(_parallel_build_trees)( t, self, X, y, sample_weight, i, len(trees), verbose=self.verbose, class_weight=self.class_weight) for i, t in enumerate(trees)) # Collect newly grown trees self.estimators_.extend(trees) if self.oob_score: self._set_oob_score(X, y) # Decapsulate classes_ attributes if hasattr(self, "classes_") and self.n_outputs_ == 1: self.n_classes_ = self.n_classes_[0] self.classes_ = self.classes_[0] return self @abstractmethod def _set_oob_score(self, X, y): """Calculate out of bag predictions and score.""" def _validate_y_class_weight(self, y): # Default implementation return y, None def _validate_X_predict(self, X): """Validate X whenever one tries to predict, apply, predict_proba""" if self.estimators_ is None or len(self.estimators_) == 0: raise NotFittedError("Estimator not fitted, " "call `fit` before exploiting the model.") return self.estimators_[0]._validate_X_predict(X, check_input=True) @property def feature_importances_(self): """Return the feature importances (the higher, the more important the feature). Returns ------- feature_importances_ : array, shape = [n_features] """ if self.estimators_ is None or len(self.estimators_) == 0: raise NotFittedError("Estimator not fitted, " "call `fit` before `feature_importances_`.") all_importances = Parallel(n_jobs=self.n_jobs, backend="threading")( delayed(getattr)(tree, 'feature_importances_') for tree in self.estimators_) return sum(all_importances) / len(self.estimators_) class ForestClassifier(six.with_metaclass(ABCMeta, BaseForest, ClassifierMixin)): """Base class for forest of trees-based classifiers. Warning: This class should not be used directly. Use derived classes instead. """ @abstractmethod def __init__(self, base_estimator, n_estimators=10, estimator_params=tuple(), bootstrap=False, oob_score=False, n_jobs=1, random_state=None, verbose=0, warm_start=False, class_weight=None): super(ForestClassifier, self).__init__( base_estimator, n_estimators=n_estimators, estimator_params=estimator_params, bootstrap=bootstrap, oob_score=oob_score, n_jobs=n_jobs, random_state=random_state, verbose=verbose, warm_start=warm_start, class_weight=class_weight) def _set_oob_score(self, X, y): """Compute out-of-bag score""" X = check_array(X, dtype=DTYPE, accept_sparse='csr') n_classes_ = self.n_classes_ n_samples = y.shape[0] oob_decision_function = [] oob_score = 0.0 predictions = [] for k in range(self.n_outputs_): predictions.append(np.zeros((n_samples, n_classes_[k]))) for estimator in self.estimators_: unsampled_indices = _generate_unsampled_indices( estimator.random_state, n_samples) p_estimator = estimator.predict_proba(X[unsampled_indices, :], check_input=False) if self.n_outputs_ == 1: p_estimator = [p_estimator] for k in range(self.n_outputs_): predictions[k][unsampled_indices, :] += p_estimator[k] for k in range(self.n_outputs_): if (predictions[k].sum(axis=1) == 0).any(): warn("Some inputs do not have OOB scores. " "This probably means too few trees were used " "to compute any reliable oob estimates.") decision = (predictions[k] / predictions[k].sum(axis=1)[:, np.newaxis]) oob_decision_function.append(decision) oob_score += np.mean(y[:, k] == np.argmax(predictions[k], axis=1), axis=0) if self.n_outputs_ == 1: self.oob_decision_function_ = oob_decision_function[0] else: self.oob_decision_function_ = oob_decision_function self.oob_score_ = oob_score / self.n_outputs_ def _validate_y_class_weight(self, y): check_classification_targets(y) y = np.copy(y) expanded_class_weight = None if self.class_weight is not None: y_original = np.copy(y) self.classes_ = [] self.n_classes_ = [] y_store_unique_indices = np.zeros(y.shape, dtype=np.int) for k in range(self.n_outputs_): classes_k, y_store_unique_indices[:, k] = np.unique(y[:, k], return_inverse=True) self.classes_.append(classes_k) self.n_classes_.append(classes_k.shape[0]) y = y_store_unique_indices if self.class_weight is not None: valid_presets = ('auto', 'balanced', 'subsample', 'balanced_subsample') if isinstance(self.class_weight, six.string_types): if self.class_weight not in valid_presets: raise ValueError('Valid presets for class_weight include ' '"balanced" and "balanced_subsample". Given "%s".' % self.class_weight) if self.class_weight == "subsample": warn("class_weight='subsample' is deprecated in 0.17 and" "will be removed in 0.19. It was replaced by " "class_weight='balanced_subsample' using the balanced" "strategy.", DeprecationWarning) if self.warm_start: warn('class_weight presets "balanced" or "balanced_subsample" are ' 'not recommended for warm_start if the fitted data ' 'differs from the full dataset. In order to use ' '"balanced" weights, use compute_class_weight("balanced", ' 'classes, y). In place of y you can use a large ' 'enough sample of the full training set target to ' 'properly estimate the class frequency ' 'distributions. Pass the resulting weights as the ' 'class_weight parameter.') if (self.class_weight not in ['subsample', 'balanced_subsample'] or not self.bootstrap): if self.class_weight == 'subsample': class_weight = 'auto' elif self.class_weight == "balanced_subsample": class_weight = "balanced" else: class_weight = self.class_weight with warnings.catch_warnings(): if class_weight == "auto": warnings.simplefilter('ignore', DeprecationWarning) expanded_class_weight = compute_sample_weight(class_weight, y_original) return y, expanded_class_weight def predict(self, X): """Predict class for X. The predicted class of an input sample is a vote by the trees in the forest, weighted by their probability estimates. That is, the predicted class is the one with highest mean probability estimate across the trees. Parameters ---------- X : array-like or sparse matrix of shape = [n_samples, n_features] The input samples. Internally, it will be converted to ``dtype=np.float32`` and if a sparse matrix is provided to a sparse ``csr_matrix``. Returns ------- y : array of shape = [n_samples] or [n_samples, n_outputs] The predicted classes. """ proba = self.predict_proba(X) if self.n_outputs_ == 1: return self.classes_.take(np.argmax(proba, axis=1), axis=0) else: n_samples = proba[0].shape[0] predictions = np.zeros((n_samples, self.n_outputs_)) for k in range(self.n_outputs_): predictions[:, k] = self.classes_[k].take(np.argmax(proba[k], axis=1), axis=0) return predictions def predict_proba(self, X): """Predict class probabilities for X. The predicted class probabilities of an input sample is computed as the mean predicted class probabilities of the trees in the forest. The class probability of a single tree is the fraction of samples of the same class in a leaf. Parameters ---------- X : array-like or sparse matrix of shape = [n_samples, n_features] The input samples. Internally, it will be converted to ``dtype=np.float32`` and if a sparse matrix is provided to a sparse ``csr_matrix``. Returns ------- p : array of shape = [n_samples, n_classes], or a list of n_outputs such arrays if n_outputs > 1. The class probabilities of the input samples. The order of the classes corresponds to that in the attribute `classes_`. """ # Check data X = self._validate_X_predict(X) # Assign chunk of trees to jobs n_jobs, _, _ = _partition_estimators(self.n_estimators, self.n_jobs) # Parallel loop all_proba = Parallel(n_jobs=n_jobs, verbose=self.verbose, backend="threading")( delayed(_parallel_helper)(e, 'predict_proba', X, check_input=False) for e in self.estimators_) # Reduce proba = all_proba[0] if self.n_outputs_ == 1: for j in range(1, len(all_proba)): proba += all_proba[j] proba /= len(self.estimators_) else: for j in range(1, len(all_proba)): for k in range(self.n_outputs_): proba[k] += all_proba[j][k] for k in range(self.n_outputs_): proba[k] /= self.n_estimators return proba def predict_log_proba(self, X): """Predict class log-probabilities for X. The predicted class log-probabilities of an input sample is computed as the log of the mean predicted class probabilities of the trees in the forest. Parameters ---------- X : array-like or sparse matrix of shape = [n_samples, n_features] The input samples. Internally, it will be converted to ``dtype=np.float32`` and if a sparse matrix is provided to a sparse ``csr_matrix``. Returns ------- p : array of shape = [n_samples, n_classes], or a list of n_outputs such arrays if n_outputs > 1. The class probabilities of the input samples. The order of the classes corresponds to that in the attribute `classes_`. """ proba = self.predict_proba(X) if self.n_outputs_ == 1: return np.log(proba) else: for k in range(self.n_outputs_): proba[k] = np.log(proba[k]) return proba class ForestRegressor(six.with_metaclass(ABCMeta, BaseForest, RegressorMixin)): """Base class for forest of trees-based regressors. Warning: This class should not be used directly. Use derived classes instead. """ @abstractmethod def __init__(self, base_estimator, n_estimators=10, estimator_params=tuple(), bootstrap=False, oob_score=False, n_jobs=1, random_state=None, verbose=0, warm_start=False): super(ForestRegressor, self).__init__( base_estimator, n_estimators=n_estimators, estimator_params=estimator_params, bootstrap=bootstrap, oob_score=oob_score, n_jobs=n_jobs, random_state=random_state, verbose=verbose, warm_start=warm_start) def predict(self, X): """Predict regression target for X. The predicted regression target of an input sample is computed as the mean predicted regression targets of the trees in the forest. Parameters ---------- X : array-like or sparse matrix of shape = [n_samples, n_features] The input samples. Internally, it will be converted to ``dtype=np.float32`` and if a sparse matrix is provided to a sparse ``csr_matrix``. Returns ------- y : array of shape = [n_samples] or [n_samples, n_outputs] The predicted values. """ # Check data X = self._validate_X_predict(X) # Assign chunk of trees to jobs n_jobs, _, _ = _partition_estimators(self.n_estimators, self.n_jobs) # Parallel loop all_y_hat = Parallel(n_jobs=n_jobs, verbose=self.verbose, backend="threading")( delayed(_parallel_helper)(e, 'predict', X, check_input=False) for e in self.estimators_) # Reduce y_hat = sum(all_y_hat) / len(self.estimators_) return y_hat def _set_oob_score(self, X, y): """Compute out-of-bag scores""" X = check_array(X, dtype=DTYPE, accept_sparse='csr') n_samples = y.shape[0] predictions = np.zeros((n_samples, self.n_outputs_)) n_predictions = np.zeros((n_samples, self.n_outputs_)) for estimator in self.estimators_: unsampled_indices = _generate_unsampled_indices( estimator.random_state, n_samples) p_estimator = estimator.predict( X[unsampled_indices, :], check_input=False) if self.n_outputs_ == 1: p_estimator = p_estimator[:, np.newaxis] predictions[unsampled_indices, :] += p_estimator n_predictions[unsampled_indices, :] += 1 if (n_predictions == 0).any(): warn("Some inputs do not have OOB scores. " "This probably means too few trees were used " "to compute any reliable oob estimates.") n_predictions[n_predictions == 0] = 1 predictions /= n_predictions self.oob_prediction_ = predictions if self.n_outputs_ == 1: self.oob_prediction_ = \ self.oob_prediction_.reshape((n_samples, )) self.oob_score_ = 0.0 for k in range(self.n_outputs_): self.oob_score_ += r2_score(y[:, k], predictions[:, k]) self.oob_score_ /= self.n_outputs_ class RandomForestClassifier(ForestClassifier): """A random forest classifier. A random forest is a meta estimator that fits a number of decision tree classifiers on various sub-samples of the dataset and use averaging to improve the predictive accuracy and control over-fitting. The sub-sample size is always the same as the original input sample size but the samples are drawn with replacement if `bootstrap=True` (default). Read more in the :ref:`User Guide <forest>`. Parameters ---------- n_estimators : integer, optional (default=10) The number of trees in the forest. criterion : string, optional (default="gini") The function to measure the quality of a split. Supported criteria are "gini" for the Gini impurity and "entropy" for the information gain. Note: this parameter is tree-specific. max_features : int, float, string or None, optional (default="auto") The number of features to consider when looking for the best split: - If int, then consider `max_features` features at each split. - If float, then `max_features` is a percentage and `int(max_features * n_features)` features are considered at each split. - If "auto", then `max_features=sqrt(n_features)`. - If "sqrt", then `max_features=sqrt(n_features)` (same as "auto"). - If "log2", then `max_features=log2(n_features)`. - If None, then `max_features=n_features`. Note: the search for a split does not stop until at least one valid partition of the node samples is found, even if it requires to effectively inspect more than ``max_features`` features. max_depth : integer or None, optional (default=None) The maximum depth of the tree. If None, then nodes are expanded until all leaves are pure or until all leaves contain less than min_samples_split samples. Ignored if ``max_leaf_nodes`` is not None. min_samples_split : int, float, optional (default=2) The minimum number of samples required to split an internal node: - If int, then consider `min_samples_split` as the minimum number. - If float, then `min_samples_split` is a percentage and `ceil(min_samples_split * n_samples)` are the minimum number of samples for each split. min_samples_leaf : int, float, optional (default=1) The minimum number of samples required to be at a leaf node: - If int, then consider `min_samples_leaf` as the minimum number. - If float, then `min_samples_leaf` is a percentage and `ceil(min_samples_leaf * n_samples)` are the minimum number of samples for each node. min_weight_fraction_leaf : float, optional (default=0.) The minimum weighted fraction of the input samples required to be at a leaf node. max_leaf_nodes : int or None, optional (default=None) Grow trees with ``max_leaf_nodes`` in best-first fashion. Best nodes are defined as relative reduction in impurity. If None then unlimited number of leaf nodes. If not None then ``max_depth`` will be ignored. bootstrap : boolean, optional (default=True) Whether bootstrap samples are used when building trees. oob_score : bool Whether to use out-of-bag samples to estimate the generalization accuracy. n_jobs : integer, optional (default=1) The number of jobs to run in parallel for both `fit` and `predict`. If -1, then the number of jobs is set to the number of cores. random_state : int, RandomState instance or None, optional (default=None) If int, random_state is the seed used by the random number generator; If RandomState instance, random_state is the random number generator; If None, the random number generator is the RandomState instance used by `np.random`. verbose : int, optional (default=0) Controls the verbosity of the tree building process. warm_start : bool, optional (default=False) When set to ``True``, reuse the solution of the previous call to fit and add more estimators to the ensemble, otherwise, just fit a whole new forest. class_weight : dict, list of dicts, "balanced", "balanced_subsample" or None, optional Weights associated with classes in the form ``{class_label: weight}``. If not given, all classes are supposed to have weight one. For multi-output problems, a list of dicts can be provided in the same order as the columns of y. The "balanced" mode uses the values of y to automatically adjust weights inversely proportional to class frequencies in the input data as ``n_samples / (n_classes * np.bincount(y))`` The "balanced_subsample" mode is the same as "balanced" except that weights are computed based on the bootstrap sample for every tree grown. For multi-output, the weights of each column of y will be multiplied. Note that these weights will be multiplied with sample_weight (passed through the fit method) if sample_weight is specified. Attributes ---------- estimators_ : list of DecisionTreeClassifier The collection of fitted sub-estimators. classes_ : array of shape = [n_classes] or a list of such arrays The classes labels (single output problem), or a list of arrays of class labels (multi-output problem). n_classes_ : int or list The number of classes (single output problem), or a list containing the number of classes for each output (multi-output problem). n_features_ : int The number of features when ``fit`` is performed. n_outputs_ : int The number of outputs when ``fit`` is performed. feature_importances_ : array of shape = [n_features] The feature importances (the higher, the more important the feature). oob_score_ : float Score of the training dataset obtained using an out-of-bag estimate. oob_decision_function_ : array of shape = [n_samples, n_classes] Decision function computed with out-of-bag estimate on the training set. If n_estimators is small it might be possible that a data point was never left out during the bootstrap. In this case, `oob_decision_function_` might contain NaN. References ---------- .. [1] L. Breiman, "Random Forests", Machine Learning, 45(1), 5-32, 2001. See also -------- DecisionTreeClassifier, ExtraTreesClassifier """ def __init__(self, n_estimators=10, criterion="gini", max_depth=None, min_samples_split=2, min_samples_leaf=1, min_weight_fraction_leaf=0., max_features="auto", max_leaf_nodes=None, bootstrap=True, oob_score=False, n_jobs=1, random_state=None, verbose=0, warm_start=False, class_weight=None): super(RandomForestClassifier, self).__init__( base_estimator=DecisionTreeClassifier(), n_estimators=n_estimators, estimator_params=("criterion", "max_depth", "min_samples_split", "min_samples_leaf", "min_weight_fraction_leaf", "max_features", "max_leaf_nodes", "random_state"), bootstrap=bootstrap, oob_score=oob_score, n_jobs=n_jobs, random_state=random_state, verbose=verbose, warm_start=warm_start, class_weight=class_weight) self.criterion = criterion self.max_depth = max_depth self.min_samples_split = min_samples_split self.min_samples_leaf = min_samples_leaf self.min_weight_fraction_leaf = min_weight_fraction_leaf self.max_features = max_features self.max_leaf_nodes = max_leaf_nodes class RandomForestRegressor(ForestRegressor): """A random forest regressor. A random forest is a meta estimator that fits a number of classifying decision trees on various sub-samples of the dataset and use averaging to improve the predictive accuracy and control over-fitting. The sub-sample size is always the same as the original input sample size but the samples are drawn with replacement if `bootstrap=True` (default). Read more in the :ref:`User Guide <forest>`. Parameters ---------- n_estimators : integer, optional (default=10) The number of trees in the forest. criterion : string, optional (default="mse") The function to measure the quality of a split. The only supported criterion is "mse" for the mean squared error. max_features : int, float, string or None, optional (default="auto") The number of features to consider when looking for the best split: - If int, then consider `max_features` features at each split. - If float, then `max_features` is a percentage and `int(max_features * n_features)` features are considered at each split. - If "auto", then `max_features=n_features`. - If "sqrt", then `max_features=sqrt(n_features)`. - If "log2", then `max_features=log2(n_features)`. - If None, then `max_features=n_features`. Note: the search for a split does not stop until at least one valid partition of the node samples is found, even if it requires to effectively inspect more than ``max_features`` features. max_depth : integer or None, optional (default=None) The maximum depth of the tree. If None, then nodes are expanded until all leaves are pure or until all leaves contain less than min_samples_split samples. Ignored if ``max_leaf_nodes`` is not None. min_samples_split : int, float, optional (default=2) The minimum number of samples required to split an internal node: - If int, then consider `min_samples_split` as the minimum number. - If float, then `min_samples_split` is a percentage and `ceil(min_samples_split * n_samples)` are the minimum number of samples for each split. min_samples_leaf : int, float, optional (default=1) The minimum number of samples required to be at a leaf node: - If int, then consider `min_samples_leaf` as the minimum number. - If float, then `min_samples_leaf` is a percentage and `ceil(min_samples_leaf * n_samples)` are the minimum number of samples for each node. min_weight_fraction_leaf : float, optional (default=0.) The minimum weighted fraction of the input samples required to be at a leaf node. max_leaf_nodes : int or None, optional (default=None) Grow trees with ``max_leaf_nodes`` in best-first fashion. Best nodes are defined as relative reduction in impurity. If None then unlimited number of leaf nodes. If not None then ``max_depth`` will be ignored. bootstrap : boolean, optional (default=True) Whether bootstrap samples are used when building trees. oob_score : bool, optional (default=False) whether to use out-of-bag samples to estimate the R^2 on unseen data. n_jobs : integer, optional (default=1) The number of jobs to run in parallel for both `fit` and `predict`. If -1, then the number of jobs is set to the number of cores. random_state : int, RandomState instance or None, optional (default=None) If int, random_state is the seed used by the random number generator; If RandomState instance, random_state is the random number generator; If None, the random number generator is the RandomState instance used by `np.random`. verbose : int, optional (default=0) Controls the verbosity of the tree building process. warm_start : bool, optional (default=False) When set to ``True``, reuse the solution of the previous call to fit and add more estimators to the ensemble, otherwise, just fit a whole new forest. Attributes ---------- estimators_ : list of DecisionTreeRegressor The collection of fitted sub-estimators. feature_importances_ : array of shape = [n_features] The feature importances (the higher, the more important the feature). n_features_ : int The number of features when ``fit`` is performed. n_outputs_ : int The number of outputs when ``fit`` is performed. oob_score_ : float Score of the training dataset obtained using an out-of-bag estimate. oob_prediction_ : array of shape = [n_samples] Prediction computed with out-of-bag estimate on the training set. References ---------- .. [1] L. Breiman, "Random Forests", Machine Learning, 45(1), 5-32, 2001. See also -------- DecisionTreeRegressor, ExtraTreesRegressor """ def __init__(self, n_estimators=10, criterion="mse", max_depth=None, min_samples_split=2, min_samples_leaf=1, min_weight_fraction_leaf=0., max_features="auto", max_leaf_nodes=None, bootstrap=True, oob_score=False, n_jobs=1, random_state=None, verbose=0, warm_start=False): super(RandomForestRegressor, self).__init__( base_estimator=DecisionTreeRegressor(), n_estimators=n_estimators, estimator_params=("criterion", "max_depth", "min_samples_split", "min_samples_leaf", "min_weight_fraction_leaf", "max_features", "max_leaf_nodes", "random_state"), bootstrap=bootstrap, oob_score=oob_score, n_jobs=n_jobs, random_state=random_state, verbose=verbose, warm_start=warm_start) self.criterion = criterion self.max_depth = max_depth self.min_samples_split = min_samples_split self.min_samples_leaf = min_samples_leaf self.min_weight_fraction_leaf = min_weight_fraction_leaf self.max_features = max_features self.max_leaf_nodes = max_leaf_nodes class ExtraTreesClassifier(ForestClassifier): """An extra-trees classifier. This class implements a meta estimator that fits a number of randomized decision trees (a.k.a. extra-trees) on various sub-samples of the dataset and use averaging to improve the predictive accuracy and control over-fitting. Read more in the :ref:`User Guide <forest>`. Parameters ---------- n_estimators : integer, optional (default=10) The number of trees in the forest. criterion : string, optional (default="gini") The function to measure the quality of a split. Supported criteria are "gini" for the Gini impurity and "entropy" for the information gain. max_features : int, float, string or None, optional (default="auto") The number of features to consider when looking for the best split: - If int, then consider `max_features` features at each split. - If float, then `max_features` is a percentage and `int(max_features * n_features)` features are considered at each split. - If "auto", then `max_features=sqrt(n_features)`. - If "sqrt", then `max_features=sqrt(n_features)`. - If "log2", then `max_features=log2(n_features)`. - If None, then `max_features=n_features`. Note: the search for a split does not stop until at least one valid partition of the node samples is found, even if it requires to effectively inspect more than ``max_features`` features. max_depth : integer or None, optional (default=None) The maximum depth of the tree. If None, then nodes are expanded until all leaves are pure or until all leaves contain less than min_samples_split samples. Ignored if ``max_leaf_nodes`` is not None. min_samples_split : int, float, optional (default=2) The minimum number of samples required to split an internal node: - If int, then consider `min_samples_split` as the minimum number. - If float, then `min_samples_split` is a percentage and `ceil(min_samples_split * n_samples)` are the minimum number of samples for each split. min_samples_leaf : int, float, optional (default=1) The minimum number of samples required to be at a leaf node: - If int, then consider `min_samples_leaf` as the minimum number. - If float, then `min_samples_leaf` is a percentage and `ceil(min_samples_leaf * n_samples)` are the minimum number of samples for each node. min_weight_fraction_leaf : float, optional (default=0.) The minimum weighted fraction of the input samples required to be at a leaf node. max_leaf_nodes : int or None, optional (default=None) Grow trees with ``max_leaf_nodes`` in best-first fashion. Best nodes are defined as relative reduction in impurity. If None then unlimited number of leaf nodes. If not None then ``max_depth`` will be ignored. bootstrap : boolean, optional (default=False) Whether bootstrap samples are used when building trees. oob_score : bool, optional (default=False) Whether to use out-of-bag samples to estimate the generalization accuracy. n_jobs : integer, optional (default=1) The number of jobs to run in parallel for both `fit` and `predict`. If -1, then the number of jobs is set to the number of cores. random_state : int, RandomState instance or None, optional (default=None) If int, random_state is the seed used by the random number generator; If RandomState instance, random_state is the random number generator; If None, the random number generator is the RandomState instance used by `np.random`. verbose : int, optional (default=0) Controls the verbosity of the tree building process. warm_start : bool, optional (default=False) When set to ``True``, reuse the solution of the previous call to fit and add more estimators to the ensemble, otherwise, just fit a whole new forest. class_weight : dict, list of dicts, "balanced", "balanced_subsample" or None, optional Weights associated with classes in the form ``{class_label: weight}``. If not given, all classes are supposed to have weight one. For multi-output problems, a list of dicts can be provided in the same order as the columns of y. The "balanced" mode uses the values of y to automatically adjust weights inversely proportional to class frequencies in the input data as ``n_samples / (n_classes * np.bincount(y))`` The "balanced_subsample" mode is the same as "balanced" except that weights are computed based on the bootstrap sample for every tree grown. For multi-output, the weights of each column of y will be multiplied. Note that these weights will be multiplied with sample_weight (passed through the fit method) if sample_weight is specified. Attributes ---------- estimators_ : list of DecisionTreeClassifier The collection of fitted sub-estimators. classes_ : array of shape = [n_classes] or a list of such arrays The classes labels (single output problem), or a list of arrays of class labels (multi-output problem). n_classes_ : int or list The number of classes (single output problem), or a list containing the number of classes for each output (multi-output problem). feature_importances_ : array of shape = [n_features] The feature importances (the higher, the more important the feature). n_features_ : int The number of features when ``fit`` is performed. n_outputs_ : int The number of outputs when ``fit`` is performed. oob_score_ : float Score of the training dataset obtained using an out-of-bag estimate. oob_decision_function_ : array of shape = [n_samples, n_classes] Decision function computed with out-of-bag estimate on the training set. If n_estimators is small it might be possible that a data point was never left out during the bootstrap. In this case, `oob_decision_function_` might contain NaN. References ---------- .. [1] P. Geurts, D. Ernst., and L. Wehenkel, "Extremely randomized trees", Machine Learning, 63(1), 3-42, 2006. See also -------- sklearn.tree.ExtraTreeClassifier : Base classifier for this ensemble. RandomForestClassifier : Ensemble Classifier based on trees with optimal splits. """ def __init__(self, n_estimators=10, criterion="gini", max_depth=None, min_samples_split=2, min_samples_leaf=1, min_weight_fraction_leaf=0., max_features="auto", max_leaf_nodes=None, bootstrap=False, oob_score=False, n_jobs=1, random_state=None, verbose=0, warm_start=False, class_weight=None): super(ExtraTreesClassifier, self).__init__( base_estimator=ExtraTreeClassifier(), n_estimators=n_estimators, estimator_params=("criterion", "max_depth", "min_samples_split", "min_samples_leaf", "min_weight_fraction_leaf", "max_features", "max_leaf_nodes", "random_state"), bootstrap=bootstrap, oob_score=oob_score, n_jobs=n_jobs, random_state=random_state, verbose=verbose, warm_start=warm_start, class_weight=class_weight) self.criterion = criterion self.max_depth = max_depth self.min_samples_split = min_samples_split self.min_samples_leaf = min_samples_leaf self.min_weight_fraction_leaf = min_weight_fraction_leaf self.max_features = max_features self.max_leaf_nodes = max_leaf_nodes class ExtraTreesRegressor(ForestRegressor): """An extra-trees regressor. This class implements a meta estimator that fits a number of randomized decision trees (a.k.a. extra-trees) on various sub-samples of the dataset and use averaging to improve the predictive accuracy and control over-fitting. Read more in the :ref:`User Guide <forest>`. Parameters ---------- n_estimators : integer, optional (default=10) The number of trees in the forest. criterion : string, optional (default="mse") The function to measure the quality of a split. The only supported criterion is "mse" for the mean squared error. max_features : int, float, string or None, optional (default="auto") The number of features to consider when looking for the best split: - If int, then consider `max_features` features at each split. - If float, then `max_features` is a percentage and `int(max_features * n_features)` features are considered at each split. - If "auto", then `max_features=n_features`. - If "sqrt", then `max_features=sqrt(n_features)`. - If "log2", then `max_features=log2(n_features)`. - If None, then `max_features=n_features`. Note: the search for a split does not stop until at least one valid partition of the node samples is found, even if it requires to effectively inspect more than ``max_features`` features. max_depth : integer or None, optional (default=None) The maximum depth of the tree. If None, then nodes are expanded until all leaves are pure or until all leaves contain less than min_samples_split samples. Ignored if ``max_leaf_nodes`` is not None. min_samples_split : int, float, optional (default=2) The minimum number of samples required to split an internal node: - If int, then consider `min_samples_split` as the minimum number. - If float, then `min_samples_split` is a percentage and `ceil(min_samples_split * n_samples)` are the minimum number of samples for each split. min_samples_leaf : int, float, optional (default=1) The minimum number of samples required to be at a leaf node: - If int, then consider `min_samples_leaf` as the minimum number. - If float, then `min_samples_leaf` is a percentage and `ceil(min_samples_leaf * n_samples)` are the minimum number of samples for each node. min_weight_fraction_leaf : float, optional (default=0.) The minimum weighted fraction of the input samples required to be at a leaf node. max_leaf_nodes : int or None, optional (default=None) Grow trees with ``max_leaf_nodes`` in best-first fashion. Best nodes are defined as relative reduction in impurity. If None then unlimited number of leaf nodes. If not None then ``max_depth`` will be ignored. bootstrap : boolean, optional (default=False) Whether bootstrap samples are used when building trees. oob_score : bool, optional (default=False) Whether to use out-of-bag samples to estimate the R^2 on unseen data. n_jobs : integer, optional (default=1) The number of jobs to run in parallel for both `fit` and `predict`. If -1, then the number of jobs is set to the number of cores. random_state : int, RandomState instance or None, optional (default=None) If int, random_state is the seed used by the random number generator; If RandomState instance, random_state is the random number generator; If None, the random number generator is the RandomState instance used by `np.random`. verbose : int, optional (default=0) Controls the verbosity of the tree building process. warm_start : bool, optional (default=False) When set to ``True``, reuse the solution of the previous call to fit and add more estimators to the ensemble, otherwise, just fit a whole new forest. Attributes ---------- estimators_ : list of DecisionTreeRegressor The collection of fitted sub-estimators. feature_importances_ : array of shape = [n_features] The feature importances (the higher, the more important the feature). n_features_ : int The number of features. n_outputs_ : int The number of outputs. oob_score_ : float Score of the training dataset obtained using an out-of-bag estimate. oob_prediction_ : array of shape = [n_samples] Prediction computed with out-of-bag estimate on the training set. References ---------- .. [1] P. Geurts, D. Ernst., and L. Wehenkel, "Extremely randomized trees", Machine Learning, 63(1), 3-42, 2006. See also -------- sklearn.tree.ExtraTreeRegressor: Base estimator for this ensemble. RandomForestRegressor: Ensemble regressor using trees with optimal splits. """ def __init__(self, n_estimators=10, criterion="mse", max_depth=None, min_samples_split=2, min_samples_leaf=1, min_weight_fraction_leaf=0., max_features="auto", max_leaf_nodes=None, bootstrap=False, oob_score=False, n_jobs=1, random_state=None, verbose=0, warm_start=False): super(ExtraTreesRegressor, self).__init__( base_estimator=ExtraTreeRegressor(), n_estimators=n_estimators, estimator_params=("criterion", "max_depth", "min_samples_split", "min_samples_leaf", "min_weight_fraction_leaf", "max_features", "max_leaf_nodes", "random_state"), bootstrap=bootstrap, oob_score=oob_score, n_jobs=n_jobs, random_state=random_state, verbose=verbose, warm_start=warm_start) self.criterion = criterion self.max_depth = max_depth self.min_samples_split = min_samples_split self.min_samples_leaf = min_samples_leaf self.min_weight_fraction_leaf = min_weight_fraction_leaf self.max_features = max_features self.max_leaf_nodes = max_leaf_nodes class RandomTreesEmbedding(BaseForest): """An ensemble of totally random trees. An unsupervised transformation of a dataset to a high-dimensional sparse representation. A datapoint is coded according to which leaf of each tree it is sorted into. Using a one-hot encoding of the leaves, this leads to a binary coding with as many ones as there are trees in the forest. The dimensionality of the resulting representation is ``n_out <= n_estimators * max_leaf_nodes``. If ``max_leaf_nodes == None``, the number of leaf nodes is at most ``n_estimators * 2 ** max_depth``. Read more in the :ref:`User Guide <random_trees_embedding>`. Parameters ---------- n_estimators : int Number of trees in the forest. max_depth : int The maximum depth of each tree. If None, then nodes are expanded until all leaves are pure or until all leaves contain less than min_samples_split samples. Ignored if ``max_leaf_nodes`` is not None. min_samples_split : int, float, optional (default=2) The minimum number of samples required to split an internal node: - If int, then consider `min_samples_split` as the minimum number. - If float, then `min_samples_split` is a percentage and `ceil(min_samples_split * n_samples)` is the minimum number of samples for each split. min_samples_leaf : int, float, optional (default=1) The minimum number of samples required to be at a leaf node: - If int, then consider `min_samples_leaf` as the minimum number. - If float, then `min_samples_leaf` is a percentage and `ceil(min_samples_leaf * n_samples)` is the minimum number of samples for each node. min_weight_fraction_leaf : float, optional (default=0.) The minimum weighted fraction of the input samples required to be at a leaf node. max_leaf_nodes : int or None, optional (default=None) Grow trees with ``max_leaf_nodes`` in best-first fashion. Best nodes are defined as relative reduction in impurity. If None then unlimited number of leaf nodes. If not None then ``max_depth`` will be ignored. sparse_output : bool, optional (default=True) Whether or not to return a sparse CSR matrix, as default behavior, or to return a dense array compatible with dense pipeline operators. n_jobs : integer, optional (default=1) The number of jobs to run in parallel for both `fit` and `predict`. If -1, then the number of jobs is set to the number of cores. random_state : int, RandomState instance or None, optional (default=None) If int, random_state is the seed used by the random number generator; If RandomState instance, random_state is the random number generator; If None, the random number generator is the RandomState instance used by `np.random`. verbose : int, optional (default=0) Controls the verbosity of the tree building process. warm_start : bool, optional (default=False) When set to ``True``, reuse the solution of the previous call to fit and add more estimators to the ensemble, otherwise, just fit a whole new forest. Attributes ---------- estimators_ : list of DecisionTreeClassifier The collection of fitted sub-estimators. References ---------- .. [1] P. Geurts, D. Ernst., and L. Wehenkel, "Extremely randomized trees", Machine Learning, 63(1), 3-42, 2006. .. [2] Moosmann, F. and Triggs, B. and Jurie, F. "Fast discriminative visual codebooks using randomized clustering forests" NIPS 2007 """ def __init__(self, n_estimators=10, max_depth=5, min_samples_split=2, min_samples_leaf=1, min_weight_fraction_leaf=0., max_leaf_nodes=None, sparse_output=True, n_jobs=1, random_state=None, verbose=0, warm_start=False): super(RandomTreesEmbedding, self).__init__( base_estimator=ExtraTreeRegressor(), n_estimators=n_estimators, estimator_params=("criterion", "max_depth", "min_samples_split", "min_samples_leaf", "min_weight_fraction_leaf", "max_features", "max_leaf_nodes", "random_state"), bootstrap=False, oob_score=False, n_jobs=n_jobs, random_state=random_state, verbose=verbose, warm_start=warm_start) self.criterion = 'mse' self.max_depth = max_depth self.min_samples_split = min_samples_split self.min_samples_leaf = min_samples_leaf self.min_weight_fraction_leaf = min_weight_fraction_leaf self.max_features = 1 self.max_leaf_nodes = max_leaf_nodes self.sparse_output = sparse_output def _set_oob_score(self, X, y): raise NotImplementedError("OOB score not supported by tree embedding") def fit(self, X, y=None, sample_weight=None): """Fit estimator. Parameters ---------- X : array-like or sparse matrix, shape=(n_samples, n_features) The input samples. Use ``dtype=np.float32`` for maximum efficiency. Sparse matrices are also supported, use sparse ``csc_matrix`` for maximum efficiency. Returns ------- self : object Returns self. """ self.fit_transform(X, y, sample_weight=sample_weight) return self def fit_transform(self, X, y=None, sample_weight=None): """Fit estimator and transform dataset. Parameters ---------- X : array-like or sparse matrix, shape=(n_samples, n_features) Input data used to build forests. Use ``dtype=np.float32`` for maximum efficiency. Returns ------- X_transformed : sparse matrix, shape=(n_samples, n_out) Transformed dataset. """ # ensure_2d=False because there are actually unit test checking we fail # for 1d. X = check_array(X, accept_sparse=['csc'], ensure_2d=False) if issparse(X): # Pre-sort indices to avoid that each individual tree of the # ensemble sorts the indices. X.sort_indices() rnd = check_random_state(self.random_state) y = rnd.uniform(size=X.shape[0]) super(RandomTreesEmbedding, self).fit(X, y, sample_weight=sample_weight) self.one_hot_encoder_ = OneHotEncoder(sparse=self.sparse_output) return self.one_hot_encoder_.fit_transform(self.apply(X)) def transform(self, X): """Transform dataset. Parameters ---------- X : array-like or sparse matrix, shape=(n_samples, n_features) Input data to be transformed. Use ``dtype=np.float32`` for maximum efficiency. Sparse matrices are also supported, use sparse ``csr_matrix`` for maximum efficiency. Returns ------- X_transformed : sparse matrix, shape=(n_samples, n_out) Transformed dataset. """ return self.one_hot_encoder_.transform(self.apply(X))
kashif/scikit-learn
sklearn/ensemble/forest.py
Python
bsd-3-clause
64,796
[ "Brian" ]
fb80c4c7414f1f4034854b3abdf695ef25b0193f44fb08a230602df33f3b7de9