text
stringlengths
12
1.05M
repo_name
stringlengths
5
86
path
stringlengths
4
191
language
stringclasses
1 value
license
stringclasses
15 values
size
int32
12
1.05M
keyword
listlengths
1
23
text_hash
stringlengths
64
64
import re from .torque import Torque __all__ = ('SlurmTorque',) class SlurmTorque(Torque): """ A CLI job executor for Slurm's Torque compatibility mode. This differs from real torque CLI in that -x command line is not available so job status needs to be parsed from qstat table instead of XML. """ def get_status(self, job_ids=None): return 'qstat' def parse_status(self, status, job_ids): rval = {} for line in status.strip().splitlines(): if line.startswith("Job ID"): continue line_parts = re.compile("\s+").split(line) if len(line_parts) < 5: continue id = line_parts[0] state = line_parts[4] if id in job_ids: # map PBS job states to Galaxy job states. rval[id] = self._get_job_state(state) return rval
ssorgatem/pulsar
pulsar/managers/util/cli/job/slurm_torque.py
Python
apache-2.0
905
[ "Galaxy" ]
6d02c5a4b80c644c5b7cbdd882879e919a39d6484f3b501d4857124d881c38e4
#!/usr/bin/env python # Copyright 2014-2018 The PySCF Developers. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # # Author: Qiming Sun <osirpt.sun@gmail.com> # '''Wave Function Stability Analysis Ref. JCP, 66, 3045 JCP, 104, 9047 See also tddft/rhf.py and scf/newton_ah.py ''' import numpy import scipy from functools import reduce from pyscf import lib from pyscf.lib import logger from pyscf.scf import hf, hf_symm, uhf_symm from pyscf.scf import _response_functions from pyscf.soscf import newton_ah def rhf_stability(mf, internal=True, external=False, verbose=None): ''' Stability analysis for RHF/RKS method. Args: mf : RHF or RKS object Kwargs: internal : bool Internal stability, within the RHF space. external : bool External stability. Including the RHF -> UHF and real -> complex stability analysis. Returns: New orbitals that are more close to the stable condition. The return value includes two set of orbitals. The first corresponds to the internal stability and the second corresponds to the external stability. ''' mo_i = mo_e = None if internal: mo_i = rhf_internal(mf, verbose=verbose) if external: mo_e = rhf_external(mf, verbose=verbose) return mo_i, mo_e def uhf_stability(mf, internal=True, external=False, verbose=None): ''' Stability analysis for RHF/RKS method. Args: mf : UHF or UKS object Kwargs: internal : bool Internal stability, within the UHF space. external : bool External stability. Including the UHF -> GHF and real -> complex stability analysis. Returns: New orbitals that are more close to the stable condition. The return value includes two set of orbitals. The first corresponds to the internal stability and the second corresponds to the external stability. ''' mo_i = mo_e = None if internal: mo_i = uhf_internal(mf, verbose=verbose) if external: mo_e = uhf_external(mf, verbose=verbose) return mo_i, mo_e def rohf_stability(mf, internal=True, external=False, verbose=None): ''' Stability analysis for ROHF/ROKS method. Args: mf : ROHF or ROKS object Kwargs: internal : bool Internal stability, within the RHF space. external : bool External stability. It is not available in current version. Returns: The return value includes two set of orbitals which are more close to the required stable condition. ''' mo_i = mo_e = None if internal: mo_i = rohf_internal(mf, verbose=verbose) if external: mo_e = rohf_external(mf, verbose=verbose) return mo_i, mo_e def ghf_stability(mf, verbose=None): log = logger.new_logger(mf, verbose) with_symmetry = True g, hop, hdiag = newton_ah.gen_g_hop_ghf(mf, mf.mo_coeff, mf.mo_occ, with_symmetry=with_symmetry) hdiag *= 2 def precond(dx, e, x0): hdiagd = hdiag - e hdiagd[abs(hdiagd)<1e-8] = 1e-8 return dx/hdiagd def hessian_x(x): # See comments in function rhf_internal return hop(x).real * 2 x0 = numpy.zeros_like(g) x0[g!=0] = 1. / hdiag[g!=0] if not with_symmetry: # allow to break point group symmetry x0[numpy.argmin(hdiag)] = 1 e, v = lib.davidson(hessian_x, x0, precond, tol=1e-4, verbose=log) if e < -1e-5: log.note('GHF wavefunction has an internal instability') mo = _rotate_mo(mf.mo_coeff, mf.mo_occ, v) else: log.note('GHF wavefunction is stable in the internal stability analysis') mo = mf.mo_coeff return mo def rhf_internal(mf, with_symmetry=True, verbose=None): log = logger.new_logger(mf, verbose) g, hop, hdiag = newton_ah.gen_g_hop_rhf(mf, mf.mo_coeff, mf.mo_occ, with_symmetry=with_symmetry) hdiag *= 2 def precond(dx, e, x0): hdiagd = hdiag - e hdiagd[abs(hdiagd)<1e-8] = 1e-8 return dx/hdiagd # The results of hop(x) corresponds to a displacement that reduces # gradients g. It is the vir-occ block of the matrix vector product # (Hessian*x). The occ-vir block equals to x2.T.conj(). The overall # Hessian for internal reotation is x2 + x2.T.conj(). This is # the reason we apply (.real * 2) below def hessian_x(x): return hop(x).real * 2 x0 = numpy.zeros_like(g) x0[g!=0] = 1. / hdiag[g!=0] if not with_symmetry: # allow to break point group symmetry x0[numpy.argmin(hdiag)] = 1 e, v = lib.davidson(hessian_x, x0, precond, tol=1e-4, verbose=log) if e < -1e-5: log.note('RHF/RKS wavefunction has an internal instability') mo = _rotate_mo(mf.mo_coeff, mf.mo_occ, v) else: log.note('RHF/RKS wavefunction is stable in the internal stability analysis') mo = mf.mo_coeff return mo def _rotate_mo(mo_coeff, mo_occ, dx): dr = hf.unpack_uniq_var(dx, mo_occ) u = newton_ah.expmat(dr) return numpy.dot(mo_coeff, u) def _gen_hop_rhf_external(mf, with_symmetry=True, verbose=None): mol = mf.mol mo_coeff = mf.mo_coeff mo_occ = mf.mo_occ occidx = numpy.where(mo_occ==2)[0] viridx = numpy.where(mo_occ==0)[0] nocc = len(occidx) nvir = len(viridx) orbv = mo_coeff[:,viridx] orbo = mo_coeff[:,occidx] if with_symmetry and mol.symmetry: orbsym = hf_symm.get_orbsym(mol, mo_coeff) sym_forbid = orbsym[viridx].reshape(-1,1) != orbsym[occidx] h1e = mf.get_hcore() dm0 = mf.make_rdm1(mo_coeff, mo_occ) fock_ao = h1e + mf.get_veff(mol, dm0) fock = reduce(numpy.dot, (mo_coeff.conj().T, fock_ao, mo_coeff)) foo = fock[occidx[:,None],occidx] fvv = fock[viridx[:,None],viridx] hdiag = fvv.diagonal().reshape(-1,1) - foo.diagonal() if with_symmetry and mol.symmetry: hdiag[sym_forbid] = 0 hdiag = hdiag.ravel() vrespz = mf.gen_response(singlet=None, hermi=2) def hop_real2complex(x1): x1 = x1.reshape(nvir,nocc) if with_symmetry and mol.symmetry: x1 = x1.copy() x1[sym_forbid] = 0 x2 = numpy.einsum('ps,sq->pq', fvv, x1) x2-= numpy.einsum('ps,rp->rs', foo, x1) d1 = reduce(numpy.dot, (orbv, x1*2, orbo.conj().T)) dm1 = d1 - d1.conj().T # No Coulomb and fxc contribution for anti-hermitian DM v1 = vrespz(dm1) x2 += reduce(numpy.dot, (orbv.conj().T, v1, orbo)) if with_symmetry and mol.symmetry: x2[sym_forbid] = 0 return x2.ravel() vresp1 = mf.gen_response(singlet=False, hermi=1) def hop_rhf2uhf(x1): from pyscf.dft import numint # See also rhf.TDA triplet excitation x1 = x1.reshape(nvir,nocc) if with_symmetry and mol.symmetry: x1 = x1.copy() x1[sym_forbid] = 0 x2 = numpy.einsum('ps,sq->pq', fvv, x1) x2-= numpy.einsum('ps,rp->rs', foo, x1) d1 = reduce(numpy.dot, (orbv, x1*2, orbo.conj().T)) dm1 = d1 + d1.conj().T v1ao = vresp1(dm1) x2 += reduce(numpy.dot, (orbv.conj().T, v1ao, orbo)) if with_symmetry and mol.symmetry: x2[sym_forbid] = 0 return x2.real.ravel() return hop_real2complex, hdiag, hop_rhf2uhf, hdiag def rhf_external(mf, with_symmetry=True, verbose=None): log = logger.new_logger(mf, verbose) hop1, hdiag1, hop2, hdiag2 = _gen_hop_rhf_external(mf, with_symmetry) def precond(dx, e, x0): hdiagd = hdiag1 - e hdiagd[abs(hdiagd)<1e-8] = 1e-8 return dx/hdiagd x0 = numpy.zeros_like(hdiag1) x0[hdiag1>1e-5] = 1. / hdiag1[hdiag1>1e-5] if not with_symmetry: # allow to break point group symmetry x0[numpy.argmin(hdiag1)] = 1 e1, v1 = lib.davidson(hop1, x0, precond, tol=1e-4, verbose=log) if e1 < -1e-5: log.note('RHF/RKS wavefunction has a real -> complex instability') else: log.note('RHF/RKS wavefunction is stable in the real -> complex stability analysis') def precond(dx, e, x0): hdiagd = hdiag2 - e hdiagd[abs(hdiagd)<1e-8] = 1e-8 return dx/hdiagd x0 = v1 e3, v3 = lib.davidson(hop2, x0, precond, tol=1e-4, verbose=log) if e3 < -1e-5: log.note('RHF/RKS wavefunction has a RHF/RKS -> UHF/UKS instability.') mo = (_rotate_mo(mf.mo_coeff, mf.mo_occ, v3), mf.mo_coeff) else: log.note('RHF/RKS wavefunction is stable in the RHF/RKS -> UHF/UKS stability analysis') mo = (mf.mo_coeff, mf.mo_coeff) return mo def rohf_internal(mf, with_symmetry=True, verbose=None): log = logger.new_logger(mf, verbose) g, hop, hdiag = newton_ah.gen_g_hop_rohf(mf, mf.mo_coeff, mf.mo_occ, with_symmetry=with_symmetry) hdiag *= 2 def precond(dx, e, x0): hdiagd = hdiag - e hdiagd[abs(hdiagd)<1e-8] = 1e-8 return dx/hdiagd def hessian_x(x): # See comments in function rhf_internal return hop(x).real * 2 x0 = numpy.zeros_like(g) x0[g!=0] = 1. / hdiag[g!=0] if not with_symmetry: # allow to break point group symmetry x0[numpy.argmin(hdiag)] = 1 e, v = lib.davidson(hessian_x, x0, precond, tol=1e-4, verbose=log) if e < -1e-5: log.note('ROHF wavefunction has an internal instability.') mo = _rotate_mo(mf.mo_coeff, mf.mo_occ, v) else: log.note('ROHF wavefunction is stable in the internal stability analysis') mo = mf.mo_coeff return mo def rohf_external(mf, with_symmetry=True, verbose=None): raise NotImplementedError def uhf_internal(mf, with_symmetry=True, verbose=None): log = logger.new_logger(mf, verbose) g, hop, hdiag = newton_ah.gen_g_hop_uhf(mf, mf.mo_coeff, mf.mo_occ, with_symmetry=with_symmetry) hdiag *= 2 def precond(dx, e, x0): hdiagd = hdiag - e hdiagd[abs(hdiagd)<1e-8] = 1e-8 return dx/hdiagd def hessian_x(x): # See comments in function rhf_internal return hop(x).real * 2 x0 = numpy.zeros_like(g) x0[g!=0] = 1. / hdiag[g!=0] if not with_symmetry: # allow to break point group symmetry x0[numpy.argmin(hdiag)] = 1 e, v = lib.davidson(hessian_x, x0, precond, tol=1e-4, verbose=log) if e < -1e-5: log.note('UHF/UKS wavefunction has an internal instability.') nocca = numpy.count_nonzero(mf.mo_occ[0]> 0) nvira = numpy.count_nonzero(mf.mo_occ[0]==0) mo = (_rotate_mo(mf.mo_coeff[0], mf.mo_occ[0], v[:nocca*nvira]), _rotate_mo(mf.mo_coeff[1], mf.mo_occ[1], v[nocca*nvira:])) else: log.note('UHF/UKS wavefunction is stable in the internal stability analysis') mo = mf.mo_coeff return mo def _gen_hop_uhf_external(mf, with_symmetry=True, verbose=None): mol = mf.mol mo_coeff = mf.mo_coeff mo_energy = mf.mo_energy mo_occ = mf.mo_occ occidxa = numpy.where(mo_occ[0]>0)[0] occidxb = numpy.where(mo_occ[1]>0)[0] viridxa = numpy.where(mo_occ[0]==0)[0] viridxb = numpy.where(mo_occ[1]==0)[0] nocca = len(occidxa) noccb = len(occidxb) nvira = len(viridxa) nvirb = len(viridxb) orboa = mo_coeff[0][:,occidxa] orbob = mo_coeff[1][:,occidxb] orbva = mo_coeff[0][:,viridxa] orbvb = mo_coeff[1][:,viridxb] if with_symmetry and mol.symmetry: orbsyma, orbsymb = uhf_symm.get_orbsym(mol, mo_coeff) sym_forbida = orbsyma[viridxa].reshape(-1,1) != orbsyma[occidxa] sym_forbidb = orbsymb[viridxb].reshape(-1,1) != orbsymb[occidxb] sym_forbid1 = numpy.hstack((sym_forbida.ravel(), sym_forbidb.ravel())) h1e = mf.get_hcore() dm0 = mf.make_rdm1(mo_coeff, mo_occ) fock_ao = h1e + mf.get_veff(mol, dm0) focka = reduce(numpy.dot, (mo_coeff[0].conj().T, fock_ao[0], mo_coeff[0])) fockb = reduce(numpy.dot, (mo_coeff[1].conj().T, fock_ao[1], mo_coeff[1])) fooa = focka[occidxa[:,None],occidxa] fvva = focka[viridxa[:,None],viridxa] foob = fockb[occidxb[:,None],occidxb] fvvb = fockb[viridxb[:,None],viridxb] h_diaga =(focka[viridxa,viridxa].reshape(-1,1) - focka[occidxa,occidxa]) h_diagb =(fockb[viridxb,viridxb].reshape(-1,1) - fockb[occidxb,occidxb]) hdiag1 = numpy.hstack((h_diaga.reshape(-1), h_diagb.reshape(-1))) if with_symmetry and mol.symmetry: hdiag1[sym_forbid1] = 0 mem_now = lib.current_memory()[0] max_memory = max(2000, mf.max_memory*.8-mem_now) vrespz = mf.gen_response(with_j=False, hermi=2) def hop_real2complex(x1): if with_symmetry and mol.symmetry: x1 = x1.copy() x1[sym_forbid1] = 0 x1a = x1[:nvira*nocca].reshape(nvira,nocca) x1b = x1[nvira*nocca:].reshape(nvirb,noccb) x2a = numpy.einsum('pr,rq->pq', fvva, x1a) x2a-= numpy.einsum('sq,ps->pq', fooa, x1a) x2b = numpy.einsum('pr,rq->pq', fvvb, x1b) x2b-= numpy.einsum('qs,ps->pq', foob, x1b) d1a = reduce(numpy.dot, (orbva, x1a, orboa.conj().T)) d1b = reduce(numpy.dot, (orbvb, x1b, orbob.conj().T)) dm1 = numpy.array((d1a-d1a.conj().T, d1b-d1b.conj().T)) v1 = vrespz(dm1) x2a += reduce(numpy.dot, (orbva.conj().T, v1[0], orboa)) x2b += reduce(numpy.dot, (orbvb.conj().T, v1[1], orbob)) x2 = numpy.hstack((x2a.ravel(), x2b.ravel())) if with_symmetry and mol.symmetry: x2[sym_forbid1] = 0 return x2 if with_symmetry and mol.symmetry: orbsyma, orbsymb = uhf_symm.get_orbsym(mol, mo_coeff) sym_forbidab = orbsyma[viridxa].reshape(-1,1) != orbsymb[occidxb] sym_forbidba = orbsymb[viridxb].reshape(-1,1) != orbsyma[occidxa] sym_forbid2 = numpy.hstack((sym_forbidab.ravel(), sym_forbidba.ravel())) hdiagab = fvva.diagonal().reshape(-1,1) - foob.diagonal() hdiagba = fvvb.diagonal().reshape(-1,1) - fooa.diagonal() hdiag2 = numpy.hstack((hdiagab.ravel(), hdiagba.ravel())) if with_symmetry and mol.symmetry: hdiag2[sym_forbid2] = 0 vresp1 = mf.gen_response(with_j=False, hermi=0) # Spin flip GHF solution is not considered def hop_uhf2ghf(x1): if with_symmetry and mol.symmetry: x1 = x1.copy() x1[sym_forbid2] = 0 x1ab = x1[:nvira*noccb].reshape(nvira,noccb) x1ba = x1[nvira*noccb:].reshape(nvirb,nocca) x2ab = numpy.einsum('pr,rq->pq', fvva, x1ab) x2ab-= numpy.einsum('sq,ps->pq', foob, x1ab) x2ba = numpy.einsum('pr,rq->pq', fvvb, x1ba) x2ba-= numpy.einsum('qs,ps->pq', fooa, x1ba) d1ab = reduce(numpy.dot, (orbva, x1ab, orbob.conj().T)) d1ba = reduce(numpy.dot, (orbvb, x1ba, orboa.conj().T)) dm1 = numpy.array((d1ab+d1ba.conj().T, d1ba+d1ab.conj().T)) v1 = vresp1(dm1) x2ab += reduce(numpy.dot, (orbva.conj().T, v1[0], orbob)) x2ba += reduce(numpy.dot, (orbvb.conj().T, v1[1], orboa)) x2 = numpy.hstack((x2ab.real.ravel(), x2ba.real.ravel())) if with_symmetry and mol.symmetry: x2[sym_forbid2] = 0 return x2 return hop_real2complex, hdiag1, hop_uhf2ghf, hdiag2 def uhf_external(mf, with_symmetry=True, verbose=None): log = logger.new_logger(mf, verbose) hop1, hdiag1, hop2, hdiag2 = _gen_hop_uhf_external(mf, with_symmetry) def precond(dx, e, x0): hdiagd = hdiag1 - e hdiagd[abs(hdiagd)<1e-8] = 1e-8 return dx/hdiagd x0 = numpy.zeros_like(hdiag1) x0[hdiag1>1e-5] = 1. / hdiag1[hdiag1>1e-5] if not with_symmetry: # allow to break point group symmetry x0[numpy.argmin(hdiag1)] = 1 e1, v = lib.davidson(hop1, x0, precond, tol=1e-4, verbose=log) if e1 < -1e-5: log.note('UHF/UKS wavefunction has a real -> complex instability') else: log.note('UHF/UKS wavefunction is stable in the real -> complex stability analysis') def precond(dx, e, x0): hdiagd = hdiag2 - e hdiagd[abs(hdiagd)<1e-8] = 1e-8 return dx/hdiagd x0 = numpy.zeros_like(hdiag2) x0[hdiag2>1e-5] = 1. / hdiag2[hdiag2>1e-5] if not with_symmetry: # allow to break point group symmetry x0[numpy.argmin(hdiag2)] = 1 e3, v = lib.davidson(hop2, x0, precond, tol=1e-4, verbose=log) log.debug('uhf_external: lowest eigs of H = %s', e3) mo = scipy.linalg.block_diag(*mf.mo_coeff) if e3 < -1e-5: log.note('UHF/UKS wavefunction has an UHF/UKS -> GHF/GKS instability.') occidxa = numpy.where(mf.mo_occ[0]> 0)[0] viridxa = numpy.where(mf.mo_occ[0]==0)[0] occidxb = numpy.where(mf.mo_occ[1]> 0)[0] viridxb = numpy.where(mf.mo_occ[1]==0)[0] nocca = len(occidxa) nvira = len(viridxa) noccb = len(occidxb) nvirb = len(viridxb) nmo = nocca + nvira dx = numpy.zeros((nmo*2,nmo*2)) dx[viridxa[:,None],nmo+occidxb] = v[:nvira*noccb].reshape(nvira,noccb) dx[nmo+viridxb[:,None],occidxa] = v[nvira*noccb:].reshape(nvirb,nocca) u = newton_ah.expmat(dx - dx.conj().T) mo = numpy.dot(mo, u) mo = numpy.hstack([mo[:,:nocca], mo[:,nmo:nmo+noccb], mo[:,nocca:nmo], mo[:,nmo+noccb:]]) else: log.note('UHF/UKS wavefunction is stable in the UHF/UKS -> GHF/GKS stability analysis') return mo if __name__ == '__main__': from pyscf import gto, scf, dft mol = gto.M(atom='O 0 0 0; O 0 0 1.2222', basis='631g*') mf = scf.RHF(mol).run() rhf_stability(mf, True, True, verbose=4) mf = dft.RKS(mol).run(level_shift=.2) rhf_stability(mf, True, True, verbose=4) mf = scf.UHF(mol).run() mo1 = uhf_stability(mf, True, True, verbose=4)[0] mf = scf.newton(mf).run(mo1, mf.mo_occ) uhf_stability(mf, True, False, verbose=4) mf = scf.newton(scf.UHF(mol)).run() uhf_stability(mf, True, False, verbose=4) mol.spin = 2 mf = scf.UHF(mol).run() uhf_stability(mf, True, True, verbose=4) mf = dft.UKS(mol).run() uhf_stability(mf, True, True, verbose=4) mol = gto.M(atom=''' O1 O2 1 1.2227 O3 1 1.2227 2 114.0451 ''', basis = '631g*') mf = scf.RHF(mol).run() rhf_stability(mf, True, True, verbose=4) mf = scf.UHF(mol).run() mo1 = uhf_stability(mf, True, True, verbose=4)[0] mf = scf.newton(scf.UHF(mol)).run() uhf_stability(mf, True, True, verbose=4)
gkc1000/pyscf
pyscf/scf/stability.py
Python
apache-2.0
19,152
[ "PySCF" ]
8abd85aa78721287001e5bbf1dbe844f359f87948f17c991fd0e9f09d450cf96
# -*- coding: utf-8 -*- # Copyright 2007-2016 The HyperSpy developers # # This file is part of HyperSpy. # # HyperSpy is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # HyperSpy is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with HyperSpy. If not, see <http://www.gnu.org/licenses/>. __doc__ = """ Components that can be used to define a 1D model for e.g. curve fitting. There are some components that are only useful for one particular kind of signal and therefore their name are preceded by the signal name: eg. eels_cl_edge. Writing a new template is really easy, just edit _template.py and maybe take a look to the other components. For more details see each component docstring. ==================================================================== """ from hyperspy._components.arctan import Arctan from hyperspy._components.bleasdale import Bleasdale from hyperspy._components.heaviside import HeavisideStep from hyperspy._components.eels_double_power_law import DoublePowerLaw from hyperspy._components.eels_cl_edge import EELSCLEdge from hyperspy._components.error_function import Erf from hyperspy._components.exponential import Exponential from hyperspy._components.gaussian import Gaussian from hyperspy._components.gaussianhf import GaussianHF from hyperspy._components.logistic import Logistic from hyperspy._components.lorentzian import Lorentzian from hyperspy._components.offset import Offset from hyperspy._components.power_law import PowerLaw from hyperspy._components.pes_see import SEE from hyperspy._components.rc import RC from hyperspy._components.eels_vignetting import Vignetting from hyperspy._components.voigt import Voigt from hyperspy._components.scalable_fixed_pattern import ScalableFixedPattern from hyperspy._components.skew_normal import SkewNormal from hyperspy._components.polynomial import Polynomial from hyperspy._components.pes_core_line_shape import PESCoreLineShape from hyperspy._components.volume_plasmon_drude import VolumePlasmonDrude from hyperspy._components.expression import Expression # Generating the documentation # Grab all the currently defined globals and make a copy of the keys # (can't use it directly, as the size changes) _keys = [key for key in globals().keys()] # For every key in alphabetically sorted order for key in sorted(_keys): # if it does not start with a "_" if not key.startswith('_'): # get the component class (or function) component = eval(key) # If the component has documentation, grab the first 43 characters of # the first line of the documentation. Else just use two dots ("..") second_part = '..' if component.__doc__ is None else \ component.__doc__.split('\n')[0][:43] + '..' # append the component name (up to 25 characters + one space) and the # start of the documentation as one line to the current doc __doc__ += key[:25] + ' ' * (26 - len(key)) + second_part + '\n' # delete all the temporary things from the namespace once done # so that they don't show up in the auto-complete del key, _keys, component, second_part
francisco-dlp/hyperspy
hyperspy/components1d.py
Python
gpl-3.0
3,552
[ "Gaussian" ]
58ad9cfbc21e36cc72cad2cfe2bae764e67e687a5865a5d8c69c855ec40a726e
# asciixmas # December 1989 Larry Bartz Indianapolis, IN # # $Id$ # # I'm dreaming of an ascii character-based monochrome Christmas, # Just like the ones I used to know! # Via a full duplex communications channel, # At 9600 bits per second, # Even though it's kinda slow. # # I'm dreaming of an ascii character-based monochrome Christmas, # With ev'ry C program I write! # May your screen be merry and bright! # And may all your Christmases be amber or green, # (for reduced eyestrain and improved visibility)! # # # Notes on the Python version: # I used a couple of `try...except curses.error' to get around some functions # returning ERR. The errors come from using wrapping functions to fill # windows to the last character cell. The C version doesn't have this problem, # it simply ignores any return values. # import curses import sys FROMWHO = "Thomas Gellekum <tg@FreeBSD.org>" def set_color(win, color): if curses.has_colors(): n = color + 1 curses.init_pair(n, color, my_bg) win.attroff(curses.A_COLOR) win.attron(curses.color_pair(n)) def unset_color(win): if curses.has_colors(): win.attrset(curses.color_pair(0)) def look_out(msecs): curses.napms(msecs) if stdscr.getch() != -1: curses.beep() sys.exit(0) def boxit(): for y in range(0, 20): stdscr.addch(y, 7, ord('|')) for x in range(8, 80): stdscr.addch(19, x, ord('_')) for x in range(0, 80): stdscr.addch(22, x, ord('_')) return def seas(): stdscr.addch(4, 1, ord('S')) stdscr.addch(6, 1, ord('E')) stdscr.addch(8, 1, ord('A')) stdscr.addch(10, 1, ord('S')) stdscr.addch(12, 1, ord('O')) stdscr.addch(14, 1, ord('N')) stdscr.addch(16, 1, ord("'")) stdscr.addch(18, 1, ord('S')) return def greet(): stdscr.addch(3, 5, ord('G')) stdscr.addch(5, 5, ord('R')) stdscr.addch(7, 5, ord('E')) stdscr.addch(9, 5, ord('E')) stdscr.addch(11, 5, ord('T')) stdscr.addch(13, 5, ord('I')) stdscr.addch(15, 5, ord('N')) stdscr.addch(17, 5, ord('G')) stdscr.addch(19, 5, ord('S')) return def fromwho(): stdscr.addstr(21, 13, FROMWHO) return def tree(): set_color(treescrn, curses.COLOR_GREEN) treescrn.addch(1, 11, ord('/')) treescrn.addch(2, 11, ord('/')) treescrn.addch(3, 10, ord('/')) treescrn.addch(4, 9, ord('/')) treescrn.addch(5, 9, ord('/')) treescrn.addch(6, 8, ord('/')) treescrn.addch(7, 7, ord('/')) treescrn.addch(8, 6, ord('/')) treescrn.addch(9, 6, ord('/')) treescrn.addch(10, 5, ord('/')) treescrn.addch(11, 3, ord('/')) treescrn.addch(12, 2, ord('/')) treescrn.addch(1, 13, ord('\\')) treescrn.addch(2, 13, ord('\\')) treescrn.addch(3, 14, ord('\\')) treescrn.addch(4, 15, ord('\\')) treescrn.addch(5, 15, ord('\\')) treescrn.addch(6, 16, ord('\\')) treescrn.addch(7, 17, ord('\\')) treescrn.addch(8, 18, ord('\\')) treescrn.addch(9, 18, ord('\\')) treescrn.addch(10, 19, ord('\\')) treescrn.addch(11, 21, ord('\\')) treescrn.addch(12, 22, ord('\\')) treescrn.addch(4, 10, ord('_')) treescrn.addch(4, 14, ord('_')) treescrn.addch(8, 7, ord('_')) treescrn.addch(8, 17, ord('_')) treescrn.addstr(13, 0, "//////////// \\\\\\\\\\\\\\\\\\\\\\\\") treescrn.addstr(14, 11, "| |") treescrn.addstr(15, 11, "|_|") unset_color(treescrn) treescrn.refresh() w_del_msg.refresh() return def balls(): treescrn.overlay(treescrn2) set_color(treescrn2, curses.COLOR_BLUE) treescrn2.addch(3, 9, ord('@')) treescrn2.addch(3, 15, ord('@')) treescrn2.addch(4, 8, ord('@')) treescrn2.addch(4, 16, ord('@')) treescrn2.addch(5, 7, ord('@')) treescrn2.addch(5, 17, ord('@')) treescrn2.addch(7, 6, ord('@')) treescrn2.addch(7, 18, ord('@')) treescrn2.addch(8, 5, ord('@')) treescrn2.addch(8, 19, ord('@')) treescrn2.addch(10, 4, ord('@')) treescrn2.addch(10, 20, ord('@')) treescrn2.addch(11, 2, ord('@')) treescrn2.addch(11, 22, ord('@')) treescrn2.addch(12, 1, ord('@')) treescrn2.addch(12, 23, ord('@')) unset_color(treescrn2) treescrn2.refresh() w_del_msg.refresh() return def star(): treescrn2.attrset(curses.A_BOLD | curses.A_BLINK) set_color(treescrn2, curses.COLOR_YELLOW) treescrn2.addch(0, 12, ord('*')) treescrn2.standend() unset_color(treescrn2) treescrn2.refresh() w_del_msg.refresh() return def strng1(): treescrn2.attrset(curses.A_BOLD | curses.A_BLINK) set_color(treescrn2, curses.COLOR_WHITE) treescrn2.addch(3, 13, ord('\'')) treescrn2.addch(3, 12, ord(':')) treescrn2.addch(3, 11, ord('.')) treescrn2.attroff(curses.A_BOLD | curses.A_BLINK) unset_color(treescrn2) treescrn2.refresh() w_del_msg.refresh() return def strng2(): treescrn2.attrset(curses.A_BOLD | curses.A_BLINK) set_color(treescrn2, curses.COLOR_WHITE) treescrn2.addch(5, 14, ord('\'')) treescrn2.addch(5, 13, ord(':')) treescrn2.addch(5, 12, ord('.')) treescrn2.addch(5, 11, ord(',')) treescrn2.addch(6, 10, ord('\'')) treescrn2.addch(6, 9, ord(':')) treescrn2.attroff(curses.A_BOLD | curses.A_BLINK) unset_color(treescrn2) treescrn2.refresh() w_del_msg.refresh() return def strng3(): treescrn2.attrset(curses.A_BOLD | curses.A_BLINK) set_color(treescrn2, curses.COLOR_WHITE) treescrn2.addch(7, 16, ord('\'')) treescrn2.addch(7, 15, ord(':')) treescrn2.addch(7, 14, ord('.')) treescrn2.addch(7, 13, ord(',')) treescrn2.addch(8, 12, ord('\'')) treescrn2.addch(8, 11, ord(':')) treescrn2.addch(8, 10, ord('.')) treescrn2.addch(8, 9, ord(',')) treescrn2.attroff(curses.A_BOLD | curses.A_BLINK) unset_color(treescrn2) treescrn2.refresh() w_del_msg.refresh() return def strng4(): treescrn2.attrset(curses.A_BOLD | curses.A_BLINK) set_color(treescrn2, curses.COLOR_WHITE) treescrn2.addch(9, 17, ord('\'')) treescrn2.addch(9, 16, ord(':')) treescrn2.addch(9, 15, ord('.')) treescrn2.addch(9, 14, ord(',')) treescrn2.addch(10, 13, ord('\'')) treescrn2.addch(10, 12, ord(':')) treescrn2.addch(10, 11, ord('.')) treescrn2.addch(10, 10, ord(',')) treescrn2.addch(11, 9, ord('\'')) treescrn2.addch(11, 8, ord(':')) treescrn2.addch(11, 7, ord('.')) treescrn2.addch(11, 6, ord(',')) treescrn2.addch(12, 5, ord('\'')) treescrn2.attroff(curses.A_BOLD | curses.A_BLINK) unset_color(treescrn2) treescrn2.refresh() w_del_msg.refresh() return def strng5(): treescrn2.attrset(curses.A_BOLD | curses.A_BLINK) set_color(treescrn2, curses.COLOR_WHITE) treescrn2.addch(11, 19, ord('\'')) treescrn2.addch(11, 18, ord(':')) treescrn2.addch(11, 17, ord('.')) treescrn2.addch(11, 16, ord(',')) treescrn2.addch(12, 15, ord('\'')) treescrn2.addch(12, 14, ord(':')) treescrn2.addch(12, 13, ord('.')) treescrn2.addch(12, 12, ord(',')) treescrn2.attroff(curses.A_BOLD | curses.A_BLINK) unset_color(treescrn2) # save a fully lit tree treescrn2.overlay(treescrn) treescrn2.refresh() w_del_msg.refresh() return def blinkit(): treescrn8.touchwin() for cycle in range(5): if cycle == 0: treescrn3.overlay(treescrn8) treescrn8.refresh() w_del_msg.refresh() break elif cycle == 1: treescrn4.overlay(treescrn8) treescrn8.refresh() w_del_msg.refresh() break elif cycle == 2: treescrn5.overlay(treescrn8) treescrn8.refresh() w_del_msg.refresh() break elif cycle == 3: treescrn6.overlay(treescrn8) treescrn8.refresh() w_del_msg.refresh() break elif cycle == 4: treescrn7.overlay(treescrn8) treescrn8.refresh() w_del_msg.refresh() break treescrn8.touchwin() # ALL ON treescrn.overlay(treescrn8) treescrn8.refresh() w_del_msg.refresh() return def deer_step(win, y, x): win.mvwin(y, x) win.refresh() w_del_msg.refresh() look_out(5) def reindeer(): y_pos = 0 for x_pos in range(70, 62, -1): if x_pos < 66: y_pos = 1 for looper in range(0, 4): dotdeer0.addch(y_pos, x_pos, ord('.')) dotdeer0.refresh() w_del_msg.refresh() dotdeer0.erase() dotdeer0.refresh() w_del_msg.refresh() look_out(50) y_pos = 2 for x_pos in range(x_pos - 1, 50, -1): for looper in range(0, 4): if x_pos < 56: y_pos = 3 try: stardeer0.addch(y_pos, x_pos, ord('*')) except curses.error: pass stardeer0.refresh() w_del_msg.refresh() stardeer0.erase() stardeer0.refresh() w_del_msg.refresh() else: dotdeer0.addch(y_pos, x_pos, ord('*')) dotdeer0.refresh() w_del_msg.refresh() dotdeer0.erase() dotdeer0.refresh() w_del_msg.refresh() x_pos = 58 for y_pos in range(2, 5): lildeer0.touchwin() lildeer0.refresh() w_del_msg.refresh() for looper in range(0, 4): deer_step(lildeer3, y_pos, x_pos) deer_step(lildeer2, y_pos, x_pos) deer_step(lildeer1, y_pos, x_pos) deer_step(lildeer2, y_pos, x_pos) deer_step(lildeer3, y_pos, x_pos) lildeer0.touchwin() lildeer0.refresh() w_del_msg.refresh() x_pos -= 2 x_pos = 35 for y_pos in range(5, 10): middeer0.touchwin() middeer0.refresh() w_del_msg.refresh() for looper in range(2): deer_step(middeer3, y_pos, x_pos) deer_step(middeer2, y_pos, x_pos) deer_step(middeer1, y_pos, x_pos) deer_step(middeer2, y_pos, x_pos) deer_step(middeer3, y_pos, x_pos) middeer0.touchwin() middeer0.refresh() w_del_msg.refresh() x_pos -= 3 look_out(300) y_pos = 1 for x_pos in range(8, 16): deer_step(bigdeer4, y_pos, x_pos) deer_step(bigdeer3, y_pos, x_pos) deer_step(bigdeer2, y_pos, x_pos) deer_step(bigdeer1, y_pos, x_pos) deer_step(bigdeer2, y_pos, x_pos) deer_step(bigdeer3, y_pos, x_pos) deer_step(bigdeer4, y_pos, x_pos) deer_step(bigdeer0, y_pos, x_pos) x_pos -= 1 for looper in range(0, 6): deer_step(lookdeer4, y_pos, x_pos) deer_step(lookdeer3, y_pos, x_pos) deer_step(lookdeer2, y_pos, x_pos) deer_step(lookdeer1, y_pos, x_pos) deer_step(lookdeer2, y_pos, x_pos) deer_step(lookdeer3, y_pos, x_pos) deer_step(lookdeer4, y_pos, x_pos) deer_step(lookdeer0, y_pos, x_pos) for y_pos in range(y_pos, 10): for looper in range(0, 2): deer_step(bigdeer4, y_pos, x_pos) deer_step(bigdeer3, y_pos, x_pos) deer_step(bigdeer2, y_pos, x_pos) deer_step(bigdeer1, y_pos, x_pos) deer_step(bigdeer2, y_pos, x_pos) deer_step(bigdeer3, y_pos, x_pos) deer_step(bigdeer4, y_pos, x_pos) deer_step(bigdeer0, y_pos, x_pos) y_pos -= 1 deer_step(lookdeer3, y_pos, x_pos) return def main(win): global stdscr stdscr = win global my_bg, y_pos, x_pos global treescrn, treescrn2, treescrn3, treescrn4 global treescrn5, treescrn6, treescrn7, treescrn8 global dotdeer0, stardeer0 global lildeer0, lildeer1, lildeer2, lildeer3 global middeer0, middeer1, middeer2, middeer3 global bigdeer0, bigdeer1, bigdeer2, bigdeer3, bigdeer4 global lookdeer0, lookdeer1, lookdeer2, lookdeer3, lookdeer4 global w_holiday, w_del_msg my_bg = curses.COLOR_BLACK # curses.curs_set(0) treescrn = curses.newwin(16, 27, 3, 53) treescrn2 = curses.newwin(16, 27, 3, 53) treescrn3 = curses.newwin(16, 27, 3, 53) treescrn4 = curses.newwin(16, 27, 3, 53) treescrn5 = curses.newwin(16, 27, 3, 53) treescrn6 = curses.newwin(16, 27, 3, 53) treescrn7 = curses.newwin(16, 27, 3, 53) treescrn8 = curses.newwin(16, 27, 3, 53) dotdeer0 = curses.newwin(3, 71, 0, 8) stardeer0 = curses.newwin(4, 56, 0, 8) lildeer0 = curses.newwin(7, 53, 0, 8) lildeer1 = curses.newwin(2, 4, 0, 0) lildeer2 = curses.newwin(2, 4, 0, 0) lildeer3 = curses.newwin(2, 4, 0, 0) middeer0 = curses.newwin(15, 42, 0, 8) middeer1 = curses.newwin(3, 7, 0, 0) middeer2 = curses.newwin(3, 7, 0, 0) middeer3 = curses.newwin(3, 7, 0, 0) bigdeer0 = curses.newwin(10, 23, 0, 0) bigdeer1 = curses.newwin(10, 23, 0, 0) bigdeer2 = curses.newwin(10, 23, 0, 0) bigdeer3 = curses.newwin(10, 23, 0, 0) bigdeer4 = curses.newwin(10, 23, 0, 0) lookdeer0 = curses.newwin(10, 25, 0, 0) lookdeer1 = curses.newwin(10, 25, 0, 0) lookdeer2 = curses.newwin(10, 25, 0, 0) lookdeer3 = curses.newwin(10, 25, 0, 0) lookdeer4 = curses.newwin(10, 25, 0, 0) w_holiday = curses.newwin(1, 27, 3, 27) w_del_msg = curses.newwin(1, 20, 23, 60) try: w_del_msg.addstr(0, 0, "Hit any key to quit") except curses.error: pass try: w_holiday.addstr(0, 0, "H A P P Y H O L I D A Y S") except curses.error: pass # set up the windows for our various reindeer lildeer1.addch(0, 0, ord('V')) lildeer1.addch(1, 0, ord('@')) lildeer1.addch(1, 1, ord('<')) lildeer1.addch(1, 2, ord('>')) try: lildeer1.addch(1, 3, ord('~')) except curses.error: pass lildeer2.addch(0, 0, ord('V')) lildeer2.addch(1, 0, ord('@')) lildeer2.addch(1, 1, ord('|')) lildeer2.addch(1, 2, ord('|')) try: lildeer2.addch(1, 3, ord('~')) except curses.error: pass lildeer3.addch(0, 0, ord('V')) lildeer3.addch(1, 0, ord('@')) lildeer3.addch(1, 1, ord('>')) lildeer3.addch(1, 2, ord('<')) try: lildeer2.addch(1, 3, ord('~')) # XXX except curses.error: pass middeer1.addch(0, 2, ord('y')) middeer1.addch(0, 3, ord('y')) middeer1.addch(1, 2, ord('0')) middeer1.addch(1, 3, ord('(')) middeer1.addch(1, 4, ord('=')) middeer1.addch(1, 5, ord(')')) middeer1.addch(1, 6, ord('~')) middeer1.addch(2, 3, ord('\\')) middeer1.addch(2, 5, ord('/')) middeer2.addch(0, 2, ord('y')) middeer2.addch(0, 3, ord('y')) middeer2.addch(1, 2, ord('0')) middeer2.addch(1, 3, ord('(')) middeer2.addch(1, 4, ord('=')) middeer2.addch(1, 5, ord(')')) middeer2.addch(1, 6, ord('~')) middeer2.addch(2, 3, ord('|')) middeer2.addch(2, 5, ord('|')) middeer3.addch(0, 2, ord('y')) middeer3.addch(0, 3, ord('y')) middeer3.addch(1, 2, ord('0')) middeer3.addch(1, 3, ord('(')) middeer3.addch(1, 4, ord('=')) middeer3.addch(1, 5, ord(')')) middeer3.addch(1, 6, ord('~')) middeer3.addch(2, 3, ord('/')) middeer3.addch(2, 5, ord('\\')) bigdeer1.addch(0, 17, ord('\\')) bigdeer1.addch(0, 18, ord('/')) bigdeer1.addch(0, 19, ord('\\')) bigdeer1.addch(0, 20, ord('/')) bigdeer1.addch(1, 18, ord('\\')) bigdeer1.addch(1, 20, ord('/')) bigdeer1.addch(2, 19, ord('|')) bigdeer1.addch(2, 20, ord('_')) bigdeer1.addch(3, 18, ord('/')) bigdeer1.addch(3, 19, ord('^')) bigdeer1.addch(3, 20, ord('0')) bigdeer1.addch(3, 21, ord('\\')) bigdeer1.addch(4, 17, ord('/')) bigdeer1.addch(4, 18, ord('/')) bigdeer1.addch(4, 19, ord('\\')) bigdeer1.addch(4, 22, ord('\\')) bigdeer1.addstr(5, 7, "^~~~~~~~~// ~~U") bigdeer1.addstr(6, 7, "( \\_____( /") # )) bigdeer1.addstr(7, 8, "( ) /") bigdeer1.addstr(8, 9, "\\\\ /") bigdeer1.addstr(9, 11, "\\>/>") bigdeer2.addch(0, 17, ord('\\')) bigdeer2.addch(0, 18, ord('/')) bigdeer2.addch(0, 19, ord('\\')) bigdeer2.addch(0, 20, ord('/')) bigdeer2.addch(1, 18, ord('\\')) bigdeer2.addch(1, 20, ord('/')) bigdeer2.addch(2, 19, ord('|')) bigdeer2.addch(2, 20, ord('_')) bigdeer2.addch(3, 18, ord('/')) bigdeer2.addch(3, 19, ord('^')) bigdeer2.addch(3, 20, ord('0')) bigdeer2.addch(3, 21, ord('\\')) bigdeer2.addch(4, 17, ord('/')) bigdeer2.addch(4, 18, ord('/')) bigdeer2.addch(4, 19, ord('\\')) bigdeer2.addch(4, 22, ord('\\')) bigdeer2.addstr(5, 7, "^~~~~~~~~// ~~U") bigdeer2.addstr(6, 7, "(( )____( /") # )) bigdeer2.addstr(7, 7, "( / |") bigdeer2.addstr(8, 8, "\\/ |") bigdeer2.addstr(9, 9, "|> |>") bigdeer3.addch(0, 17, ord('\\')) bigdeer3.addch(0, 18, ord('/')) bigdeer3.addch(0, 19, ord('\\')) bigdeer3.addch(0, 20, ord('/')) bigdeer3.addch(1, 18, ord('\\')) bigdeer3.addch(1, 20, ord('/')) bigdeer3.addch(2, 19, ord('|')) bigdeer3.addch(2, 20, ord('_')) bigdeer3.addch(3, 18, ord('/')) bigdeer3.addch(3, 19, ord('^')) bigdeer3.addch(3, 20, ord('0')) bigdeer3.addch(3, 21, ord('\\')) bigdeer3.addch(4, 17, ord('/')) bigdeer3.addch(4, 18, ord('/')) bigdeer3.addch(4, 19, ord('\\')) bigdeer3.addch(4, 22, ord('\\')) bigdeer3.addstr(5, 7, "^~~~~~~~~// ~~U") bigdeer3.addstr(6, 6, "( ()_____( /") # )) bigdeer3.addstr(7, 6, "/ / /") bigdeer3.addstr(8, 5, "|/ \\") bigdeer3.addstr(9, 5, "/> \\>") bigdeer4.addch(0, 17, ord('\\')) bigdeer4.addch(0, 18, ord('/')) bigdeer4.addch(0, 19, ord('\\')) bigdeer4.addch(0, 20, ord('/')) bigdeer4.addch(1, 18, ord('\\')) bigdeer4.addch(1, 20, ord('/')) bigdeer4.addch(2, 19, ord('|')) bigdeer4.addch(2, 20, ord('_')) bigdeer4.addch(3, 18, ord('/')) bigdeer4.addch(3, 19, ord('^')) bigdeer4.addch(3, 20, ord('0')) bigdeer4.addch(3, 21, ord('\\')) bigdeer4.addch(4, 17, ord('/')) bigdeer4.addch(4, 18, ord('/')) bigdeer4.addch(4, 19, ord('\\')) bigdeer4.addch(4, 22, ord('\\')) bigdeer4.addstr(5, 7, "^~~~~~~~~// ~~U") bigdeer4.addstr(6, 6, "( )______( /") # ) bigdeer4.addstr(7, 5, "(/ \\") # ) bigdeer4.addstr(8, 0, "v___= ----^") lookdeer1.addstr(0, 16, "\\/ \\/") lookdeer1.addstr(1, 17, "\\Y/ \\Y/") lookdeer1.addstr(2, 19, "\\=/") lookdeer1.addstr(3, 17, "^\\o o/^") lookdeer1.addstr(4, 17, "//( )") lookdeer1.addstr(5, 7, "^~~~~~~~~// \\O/") lookdeer1.addstr(6, 7, "( \\_____( /") # )) lookdeer1.addstr(7, 8, "( ) /") lookdeer1.addstr(8, 9, "\\\\ /") lookdeer1.addstr(9, 11, "\\>/>") lookdeer2.addstr(0, 16, "\\/ \\/") lookdeer2.addstr(1, 17, "\\Y/ \\Y/") lookdeer2.addstr(2, 19, "\\=/") lookdeer2.addstr(3, 17, "^\\o o/^") lookdeer2.addstr(4, 17, "//( )") lookdeer2.addstr(5, 7, "^~~~~~~~~// \\O/") lookdeer2.addstr(6, 7, "(( )____( /") # )) lookdeer2.addstr(7, 7, "( / |") lookdeer2.addstr(8, 8, "\\/ |") lookdeer2.addstr(9, 9, "|> |>") lookdeer3.addstr(0, 16, "\\/ \\/") lookdeer3.addstr(1, 17, "\\Y/ \\Y/") lookdeer3.addstr(2, 19, "\\=/") lookdeer3.addstr(3, 17, "^\\o o/^") lookdeer3.addstr(4, 17, "//( )") lookdeer3.addstr(5, 7, "^~~~~~~~~// \\O/") lookdeer3.addstr(6, 6, "( ()_____( /") # )) lookdeer3.addstr(7, 6, "/ / /") lookdeer3.addstr(8, 5, "|/ \\") lookdeer3.addstr(9, 5, "/> \\>") lookdeer4.addstr(0, 16, "\\/ \\/") lookdeer4.addstr(1, 17, "\\Y/ \\Y/") lookdeer4.addstr(2, 19, "\\=/") lookdeer4.addstr(3, 17, "^\\o o/^") lookdeer4.addstr(4, 17, "//( )") lookdeer4.addstr(5, 7, "^~~~~~~~~// \\O/") lookdeer4.addstr(6, 6, "( )______( /") # ) lookdeer4.addstr(7, 5, "(/ \\") # ) lookdeer4.addstr(8, 0, "v___= ----^") ############################################### curses.cbreak() stdscr.nodelay(1) while 1: stdscr.clear() treescrn.erase() w_del_msg.touchwin() treescrn.touchwin() treescrn2.erase() treescrn2.touchwin() treescrn8.erase() treescrn8.touchwin() stdscr.refresh() look_out(150) boxit() stdscr.refresh() look_out(150) seas() stdscr.refresh() greet() stdscr.refresh() look_out(150) fromwho() stdscr.refresh() look_out(150) tree() look_out(150) balls() look_out(150) star() look_out(150) strng1() strng2() strng3() strng4() strng5() # set up the windows for our blinking trees # # treescrn3 treescrn.overlay(treescrn3) # balls treescrn3.addch(4, 18, ord(' ')) treescrn3.addch(7, 6, ord(' ')) treescrn3.addch(8, 19, ord(' ')) treescrn3.addch(11, 22, ord(' ')) # star treescrn3.addch(0, 12, ord('*')) # strng1 treescrn3.addch(3, 11, ord(' ')) # strng2 treescrn3.addch(5, 13, ord(' ')) treescrn3.addch(6, 10, ord(' ')) # strng3 treescrn3.addch(7, 16, ord(' ')) treescrn3.addch(7, 14, ord(' ')) # strng4 treescrn3.addch(10, 13, ord(' ')) treescrn3.addch(10, 10, ord(' ')) treescrn3.addch(11, 8, ord(' ')) # strng5 treescrn3.addch(11, 18, ord(' ')) treescrn3.addch(12, 13, ord(' ')) # treescrn4 treescrn.overlay(treescrn4) # balls treescrn4.addch(3, 9, ord(' ')) treescrn4.addch(4, 16, ord(' ')) treescrn4.addch(7, 6, ord(' ')) treescrn4.addch(8, 19, ord(' ')) treescrn4.addch(11, 2, ord(' ')) treescrn4.addch(12, 23, ord(' ')) # star treescrn4.standout() treescrn4.addch(0, 12, ord('*')) treescrn4.standend() # strng1 treescrn4.addch(3, 13, ord(' ')) # strng2 # strng3 treescrn4.addch(7, 15, ord(' ')) treescrn4.addch(8, 11, ord(' ')) # strng4 treescrn4.addch(9, 16, ord(' ')) treescrn4.addch(10, 12, ord(' ')) treescrn4.addch(11, 8, ord(' ')) # strng5 treescrn4.addch(11, 18, ord(' ')) treescrn4.addch(12, 14, ord(' ')) # treescrn5 treescrn.overlay(treescrn5) # balls treescrn5.addch(3, 15, ord(' ')) treescrn5.addch(10, 20, ord(' ')) treescrn5.addch(12, 1, ord(' ')) # star treescrn5.addch(0, 12, ord(' ')) # strng1 treescrn5.addch(3, 11, ord(' ')) # strng2 treescrn5.addch(5, 12, ord(' ')) # strng3 treescrn5.addch(7, 14, ord(' ')) treescrn5.addch(8, 10, ord(' ')) # strng4 treescrn5.addch(9, 15, ord(' ')) treescrn5.addch(10, 11, ord(' ')) treescrn5.addch(11, 7, ord(' ')) # strng5 treescrn5.addch(11, 17, ord(' ')) treescrn5.addch(12, 13, ord(' ')) # treescrn6 treescrn.overlay(treescrn6) # balls treescrn6.addch(6, 7, ord(' ')) treescrn6.addch(7, 18, ord(' ')) treescrn6.addch(10, 4, ord(' ')) treescrn6.addch(11, 23, ord(' ')) # star treescrn6.standout() treescrn6.addch(0, 12, ord('*')) treescrn6.standend() # strng1 # strng2 treescrn6.addch(5, 11, ord(' ')) # strng3 treescrn6.addch(7, 13, ord(' ')) treescrn6.addch(8, 9, ord(' ')) # strng4 treescrn6.addch(9, 14, ord(' ')) treescrn6.addch(10, 10, ord(' ')) treescrn6.addch(11, 6, ord(' ')) # strng5 treescrn6.addch(11, 16, ord(' ')) treescrn6.addch(12, 12, ord(' ')) # treescrn7 treescrn.overlay(treescrn7) # balls treescrn7.addch(3, 15, ord(' ')) treescrn7.addch(6, 7, ord(' ')) treescrn7.addch(7, 18, ord(' ')) treescrn7.addch(10, 4, ord(' ')) treescrn7.addch(11, 22, ord(' ')) # star treescrn7.addch(0, 12, ord('*')) # strng1 treescrn7.addch(3, 12, ord(' ')) # strng2 treescrn7.addch(5, 13, ord(' ')) treescrn7.addch(6, 9, ord(' ')) # strng3 treescrn7.addch(7, 15, ord(' ')) treescrn7.addch(8, 11, ord(' ')) # strng4 treescrn7.addch(9, 16, ord(' ')) treescrn7.addch(10, 12, ord(' ')) treescrn7.addch(11, 8, ord(' ')) # strng5 treescrn7.addch(11, 18, ord(' ')) treescrn7.addch(12, 14, ord(' ')) look_out(150) reindeer() w_holiday.touchwin() w_holiday.refresh() w_del_msg.refresh() look_out(500) for i in range(0, 20): blinkit() curses.wrapper(main)
teeple/pns_server
work/install/Python-2.7.4/Demo/curses/xmas.py
Python
gpl-2.0
25,446
[ "Amber" ]
b12576cf11d4b3c462884198a09cd45828431f7fc8061906c69acda6748b16a5
from six import assertRaisesRegex from unittest import TestCase from tempfile import mkstemp from os import close, unlink, write from contextlib import contextmanager from pysam import CHARD_CLIP, CMATCH from dark.reads import Read, ReadFilter from dark.sam import ( PaddedSAM, SAMFilter, UnequalReferenceLengthError, UnknownReference, InvalidSAM, samReferencesToStr, _hardClip) # These tests actually use the filesystem to read files. That's due to the API # to pysam and the fact that it calls a C function to open files, so we can't # mock Python's 'open' method. Hence the following context manager. @contextmanager def dataFile(data): """ Create a context manager to store data in a temporary file and later remove it. """ fd, filename = mkstemp() write(fd, data.encode('utf-8')) close(fd) yield filename unlink(filename) class TestSAMFilter(TestCase): """ Test the SAMFilter class. """ def testUnknownReferences(self): """ Passing an unknown reference id to the referenceLengths method must result in an UnknownReference exception. """ data = '\n'.join([ '@SQ SN:id1 LN:90', '@SQ SN:id2 LN:90', ]).replace(' ', '\t') with dataFile(data) as filename: sam = SAMFilter(filename, referenceIds={'unknown'}) error = ("^Reference 'unknown' is not present in the " "SAM/BAM file\\.$") assertRaisesRegex(self, UnknownReference, error, sam.referenceLengths) def testStoreQueryIds(self): """ If we request that query ids are saved, they must be. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 2=2X2M * 0 0 TCTAGG 123456', 'query2 0 ref1 2 60 2= * 0 0 TC XY', 'query2 0 ref1 2 60 2= * 0 0 TC XY', ]).replace(' ', '\t') with dataFile(data) as filename: sf = SAMFilter(filename, storeQueryIds=True) list(sf.alignments()) self.assertEqual({'query1', 'query2'}, sf.queryIds) def testAlignmentCount(self): """ When all queries have been yielded, the alignment count must be as expected. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 2=2X2M * 0 0 TCTAGG 123456', 'query2 0 ref1 2 60 2= * 0 0 TC XY', ]).replace(' ', '\t') with dataFile(data) as filename: sf = SAMFilter(filename) list(sf.alignments()) self.assertEqual(2, sf.alignmentCount) def testMinLength(self): """ A request for reads that are only longer than a certain value should result in the expected result. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 2=2X2M * 0 0 TCTAGG ZZZZZZ', 'query2 0 ref1 2 60 2= * 0 0 TC ZZ', ]).replace(' ', '\t') with dataFile(data) as filename: filterRead = ReadFilter(minLength=6).filter sf = SAMFilter(filename, filterRead=filterRead) (alignment,) = list(sf.alignments()) self.assertEqual('query1', alignment.query_name) def testDropSecondary(self): """ Dropping matches flagged as secondary must give the expected result. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 2=2X2M * 0 0 TCTAGG ZZZZZZ', 'query2 256 ref1 2 60 2= * 0 0 TC ZZ', ]).replace(' ', '\t') with dataFile(data) as filename: sf = SAMFilter(filename, dropSecondary=True) (alignment,) = list(sf.alignments()) self.assertEqual('query1', alignment.query_name) def testDropSupplementary(self): """ Dropping matches flagged as supplementary must give the expected result. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 2=2X2M * 0 0 TCTAGG ZZZZZZ', 'query2 2048 ref1 2 60 2= * 0 0 TC ZZ', ]).replace(' ', '\t') with dataFile(data) as filename: sf = SAMFilter(filename, dropSupplementary=True) (alignment,) = list(sf.alignments()) self.assertEqual('query1', alignment.query_name) def testDropDuplicates(self): """ Dropping matches flagged as optical or PCR duplicates must give the expected result. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 2=2X2M * 0 0 TCTAGG ZZZZZZ', 'query2 1024 ref1 2 60 2= * 0 0 TC ZZ', ]).replace(' ', '\t') with dataFile(data) as filename: sf = SAMFilter(filename, dropDuplicates=True) (alignment,) = list(sf.alignments()) self.assertEqual('query1', alignment.query_name) def testKeepQualityControlFailures(self): """ Keeping matches flagged as quality control failures must give the expected result. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 2=2X2M * 0 0 TCTAGG ZZZZZZ', 'query2 512 ref1 4 60 2= * 0 0 TC ZZ', ]).replace(' ', '\t') with dataFile(data) as filename: sf = SAMFilter(filename, keepQCFailures=True) (alignment1, alignment2) = list(sf.alignments()) self.assertEqual('query1', alignment1.query_name) self.assertEqual('query2', alignment2.query_name) def testMinScoreNoScores(self): """ A request for reads with alignment scores no lower than a given value must produce an empty result when no alignments have scores. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 2=2X2M * 0 0 TCTAGG ZZZZZZ', 'query2 0 ref1 2 60 2= * 0 0 TC ZZ', ]).replace(' ', '\t') with dataFile(data) as filename: sf = SAMFilter(filename, minScore=6) self.assertEqual([], list(sf.alignments())) def testMinScore(self): """ A request for reads with alignment scores no lower than a given value must produce the expected result when some alignments have scores. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 2=2X2M * 0 0 TCTAGG ZZZZZZ AS:i:10', 'query2 0 ref1 2 60 2= * 0 0 TC ZZ', 'query3 0 ref1 2 60 2=2X2M * 0 0 TCTAGG ZZZZZZ AS:i:3', ]).replace(' ', '\t') with dataFile(data) as filename: sf = SAMFilter(filename, minScore=6) (alignment,) = list(sf.alignments()) self.assertEqual('query1', alignment.query_name) def testMaxScoreNoScores(self): """ A request for reads with alignment scores no higher than a given value must produce an empty result when no alignments have scores. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 2=2X2M * 0 0 TCTAGG ZZZZZZ', 'query2 0 ref1 2 60 2= * 0 0 TC ZZ', 'query3 0 ref1 2 60 2=2X2M * 0 0 TCTAGG ZZZZZZ', ]).replace(' ', '\t') with dataFile(data) as filename: sf = SAMFilter(filename, maxScore=6) self.assertEqual([], list(sf.alignments())) def testMaxScore(self): """ A request for reads with alignment scores no higher than a given value must produce the expected result when some alignments have scores. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 2=2X2M * 0 0 TCTAGG ZZZZZZ AS:i:10', 'query2 0 ref1 2 60 2= * 0 0 TC ZZ', 'query3 0 ref1 2 60 2=2X2M * 0 0 TCTAGG ZZZZZZ AS:i:3', ]).replace(' ', '\t') with dataFile(data) as filename: sf = SAMFilter(filename, maxScore=6) (alignment,) = list(sf.alignments()) self.assertEqual('query3', alignment.query_name) def testMinAndMaxScore(self): """ A request for reads with alignment scores no lower or higher than given values must produce the expected result. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 2=2X2M * 0 0 TCTAGG ZZZZZZ AS:i:10', 'query2 0 ref1 2 60 2=2X2M * 0 0 TCTAGG ZZZZZZ AS:i:12', 'query3 0 ref1 2 60 2= * 0 0 TC ZZ', 'query4 0 ref1 2 60 2=2X2M * 0 0 TCTAGG ZZZZZZ AS:i:3', 'query5 0 ref1 2 60 2=2X2M * 0 0 TCTAGG ZZZZZZ AS:i:2', ]).replace(' ', '\t') with dataFile(data) as filename: sf = SAMFilter(filename, minScore=3, maxScore=10) (alignment1, alignment2) = list(sf.alignments()) self.assertEqual('query1', alignment1.query_name) self.assertEqual('query4', alignment2.query_name) def testCloseButNoCIGAR(self): """ An unmapped query with no CIGAR string must be passed through unchanged if dropUnmapped is not specified. """ data = '\n'.join([ '@SQ SN:ref LN:10', 'query1 4 * 0 0 * * 0 0 TCTAGG ZZZZZZ', ]).replace(' ', '\t') with dataFile(data) as filename: sf = SAMFilter(filename) (alignment,) = list(sf.alignments()) self.assertEqual('query1', alignment.query_name) self.assertEqual('TCTAGG', alignment.query_sequence) self.assertEqual('ZZZZZZ', ''.join( map(lambda x: chr(x + 33), alignment.query_qualities))) def testNoQuality(self): """ If an alignment has * for the quality string, the filter must return an alignment with a C{None} quality value. """ data = '\n'.join([ '@SQ SN:ref LN:10', 'query1 4 * 0 0 6M * 0 0 TCTAGG *', ]).replace(' ', '\t') with dataFile(data) as filename: sf = SAMFilter(filename) (alignment,) = list(sf.alignments()) self.assertEqual('query1', alignment.query_name) self.assertEqual('TCTAGG', alignment.query_sequence) self.assertIsNone(alignment.query_qualities) class TestPaddedSAM(TestCase): """ Test the PaddedSAM class. """ # In reading the tests below, it is important to remember that the start # position (in the reference) of the match in SAM format is 1-based. This # is the 4th field in the non-header SAM lines (i.e., those that don't # start with @). If you look at the code in ../dark/sam.py, pysam provides # a 'reference_start' attribute that is 0-based. def testUnequalReferenceLengths(self): """ Passing no reference ids when the references have different lengths must result in an UnequalReferenceLengthError exception. """ data = '\n'.join([ '@SQ SN:id1 LN:90', '@SQ SN:id2 LN:91', ]).replace(' ', '\t') with dataFile(data) as filename: error = ('^Your 2 SAM/BAM file reference sequence lengths ' '\\(id1=90, id2=91\\) are not all identical\\.$') assertRaisesRegex(self, UnequalReferenceLengthError, error, PaddedSAM, SAMFilter(filename)) def testQueryTooLong(self): """ If the query sequence is longer than the total of the lengths in the CIGAR operations, a ValueError must be raised. """ # This test just returns. It used to be possible to reach the # "Query ... not fully consumed when parsing CIGAR string." # ValueError in sam.py, prior to the fix of # https://github.com/acorg/dark-matter/issues/630 but it is not # possible to get a CIGAR string that has a different total length # from the sequence length through to our code in sam.py because # pysam catches the error. I'm leaving this test here because it # documents that the error checked for in sam.py cannot currently # be reached and the test may become useful. For now it just returns. return data = '\n'.join([ '@SQ SN:ref1 LN:90', 'query1 0 ref1 1 60 4M * 0 0 TCTAGG ZZZZZZ', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) error = ('^Query TCTAGG not fully consumed when parsing CIGAR ' 'string\\.') assertRaisesRegex(self, ValueError, error, list, ps.queries()) def testAllMMatch(self): """ A simple all-'M' match must result in the expected padded sequence. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 6M * 0 0 TCTAGG ZZZZZZ', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read,) = list(ps.queries()) self.assertEqual(Read('query1', '-TCTAGG---', '!ZZZZZZ!!!'), read) def testMixedMatch(self): """ A match that is a mix of M, =, and X must result in the expected padded sequence. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 2=2X2M * 0 0 TCTAGG ZZZZZZ', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read,) = list(ps.queries()) self.assertEqual(Read('query1', '-TCTAGG---', '!ZZZZZZ!!!'), read) def testHardClipLeft(self): """ A simple all-'M' match with a hard clip left must result in the expected padded sequence. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 10H6M * 0 0 TCTAGG ZZZZZZ', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read,) = list(ps.queries()) self.assertEqual(Read('query1', '-TCTAGG---', '!ZZZZZZ!!!'), read) def testHardClipRight(self): """ A simple all-'M' match with a hard clip right must result in the expected padded sequence. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 6M10H * 0 0 TCTAGG ZZZZZZ', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read,) = list(ps.queries()) self.assertEqual(Read('query1', '-TCTAGG---', '!ZZZZZZ!!!'), read) def testRcNeeded(self): """ A reverse-complemented match (flag = 16) when rcNeeded=True is passed must result in the expected (reverse complemented) padded sequence and reversed quality string. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 16 ref1 2 60 6M * 0 0 TCTAGG 123456', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read,) = list(ps.queries(rcNeeded=True)) self.assertEqual(Read('query1', '-CCTAGA---', '!654321!!!'), read) def testRcSuffix(self): """ A reverse-complemented sequence should have the rcSuffix string added to its id when an rcSuffix value is passed. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 16 ref1 2 60 6M * 0 0 TCTAGG 123456', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read,) = list(ps.queries(rcSuffix='-rc', rcNeeded=True)) self.assertEqual(Read('query1-rc', '-CCTAGA---', '!654321!!!'), read) def testQuerySoftClipLeft(self): """ A match with a soft-clipped region that does not extend to the left of the reference must result in the expected padded sequence. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 4 60 2S4M * 0 0 TCTAGG ZZZZZZ', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read,) = list(ps.queries()) self.assertEqual(Read('query1', '-TCTAGG---', '!ZZZZZZ!!!'), read) def testQuerySoftClipReachesLeftEdge(self): """ A match with a soft-clipped region that reaches to the left edge of the reference must result in the expected padded sequence. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 5 60 4S2M * 0 0 TCTAGG ZZZZZZ', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read,) = list(ps.queries()) self.assertEqual(Read('query1', 'TCTAGG----', 'ZZZZZZ!!!!'), read) def testQuerySoftClipProtrudesLeft(self): """ A match with a soft-clipped region that extends to the left of the reference must result in the expected padded sequence. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 4S2M * 0 0 TCTAGG ZZZZZZ', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read,) = list(ps.queries()) self.assertEqual(Read('query1', 'AGG-------', 'ZZZ!!!!!!!'), read) def testKF414679SoftClipLeft(self): """ Test for a case that wasn't working. """ seq = ('GCCATGCAGTGGAACTCCACAGCATTCCACCAAGCTCTGC' 'AGAATCCCAAAGTCAGGGGTTTGTATCTTCTTGCTGGTGGC') quality = ('ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ' 'ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ') data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 5 60 18S63M * 0 0 %s %s' % (seq, quality), ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read,) = list(ps.queries()) self.assertEqual(Read('query1', seq[14:], quality[14:]), read) def testQuerySoftClipRight(self): """ A match with a soft-clipped region that does not extend to the right of the reference must result in the expected padded sequence. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 4 60 4M2S * 0 0 TCTAGG ZZZZZZ', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read,) = list(ps.queries()) self.assertEqual(Read('query1', '---TCTAGG-', '!!!ZZZZZZ!'), read) def testQuerySoftClipReachesRightEdge(self): """ A match with a soft-clipped region that reaches to the right edge of the reference must result in the expected padded sequence. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 5 60 2M4S * 0 0 TCTAGG ZZZZZZ', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read,) = list(ps.queries()) self.assertEqual(Read('query1', '----TCTAGG', '!!!!ZZZZZZ'), read) def testQuerySoftClipProtrudesRight(self): """ A match with a soft-clipped region that extends to the right of the reference must result in the expected padded sequence. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 6 60 2M4S * 0 0 TCTAGG ZZZZZZ', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read,) = list(ps.queries()) self.assertEqual(Read('query1', '-----TCTAG', '!!!!!ZZZZZ'), read) def testQuerySoftClipProtrudesBothSides(self): """ A match with a soft-clipped region that extends to both the left and right of the reference must result in the expected padded sequence. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 4 60 5S5M5S * 0 0 TCTAGGCTGACTAAG ZZZZZZZZZZZZZZZ', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read,) = list(ps.queries()) self.assertEqual(Read('query1', 'TAGGCTGACT', 'ZZZZZZZZZZ'), read) def testQueryHardClipAndSoftClipProtrudesBothSides(self): """ A match with a soft-clipped region that extends to both the left and right of the reference must result in the expected padded sequence when hard clipping is also indicated by the CIGAR string. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 4 0 3H5S5M4S5H * 0 0 TCTAGGCTGACTAA ZZZZZZZZZZZZZZ', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read,) = list(ps.queries()) self.assertEqual(Read('query1', 'TAGGCTGACT', 'ZZZZZZZZZZ'), read) def testReferenceInsertion(self): """ An insertion into the reference must result in the expected padded sequence and the expected value in the referenceInsertions dictionary. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 2M2I2M * 0 0 TCTAGG ZZZZZZ', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read,) = list(ps.queries()) self.assertEqual(Read('query1', '-TCGG-----', '!ZZZZ!!!!!'), read) self.assertEqual( { 'query1': [(3, 'TA')], }, ps.referenceInsertions) def testPrimaryAndSecondaryReferenceInsertion(self): """ A primary and secondary insertion into the reference (of the same query) must result in the expected padded sequences and the expected value in the referenceInsertions dictionary. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 2M2I2M * 0 0 TCTAGG ZZZZZZ', 'query1 256 ref1 4 60 2M3I1M * 0 0 * *', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read1, read2) = list(ps.queries()) self.assertEqual(Read('query1', '-TCGG-----', '!ZZZZ!!!!!'), read1) self.assertEqual(Read('query1/1', '---TCG----', '!!!ZZZ!!!!'), read2) self.assertEqual( { 'query1': [(3, 'TA')], 'query1/1': [(5, 'TAG')], }, ps.referenceInsertions) def testReferenceDeletion(self): """ An deletion of reference bases must result in the expected padded sequence (with Ns inserted for the deleted reference bases). """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 2M2D4M * 0 0 TCTAGG ZZZZZZ', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read,) = list(ps.queries()) self.assertEqual(Read('query1', '-TCNNTAGG-', '!ZZ!!ZZZZ!'), read) def testReferenceDeletionAlternateChars(self): """ An deletion of reference bases must result in the expected padded sequence (with the passed query insertion character and unknown quality character) when queryInsertionChar and unknownQualityChar arguments are passed. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 2M2D4M * 0 0 TCTAGG ZZZZZZ', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read,) = list(ps.queries(queryInsertionChar='?', unknownQualityChar='+')) self.assertEqual(Read('query1', '-TC??TAGG-', '+ZZ++ZZZZ+'), read) def testReferenceSkip(self): """ An skip of reference bases must result in the expected padded sequence with the passed unknown quality character when the unknownQualityChar argument is passed. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 2M2N4M * 0 0 TCTAGG ZZZZZZ', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read,) = list(ps.queries(unknownQualityChar='.')) self.assertEqual(Read('query1', '-TCNNTAGG-', '.ZZ..ZZZZ.'), read) def testReferenceSkipAlternateChars(self): """ An skip of reference bases must result in the expected padded sequence (with the passed query insertion character and unknown quality character) when queryInsertionChar and unknownQualityChar arguments are passed. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 2M2N4M * 0 0 TCTAGG ZZZZZZ', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read,) = list(ps.queries(queryInsertionChar='X', unknownQualityChar='+')) self.assertEqual(Read('query1', '-TCXXTAGG-', '+ZZ++ZZZZ+'), read) def testMixedMatchSpecificReferenceButNoMatches(self): """ A request for reads aligned against a reference that exists but that has no matches must result in an empty list. """ data = '\n'.join([ '@SQ SN:ref1 LN:15', '@SQ SN:ref2 LN:15', 'query1 0 ref1 2 60 2=2X2M * 0 0 TCTAGG ZZZZZZ', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename, referenceIds={'ref2'})) self.assertEqual([], list(ps.queries())) def testMixedMatchSpecificReference(self): """ A match that is a mix of M, =, and X must result in the expected padded sequence when a reference sequence is specified. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', '@SQ SN:ref2 LN:10', 'query1 0 ref1 2 60 2=2X2M * 0 0 TCTAGG ZZZZZZ', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename, referenceIds={'ref1'})) (read,) = list(ps.queries()) self.assertEqual(Read('query1', '-TCTAGG---', '!ZZZZZZ!!!'), read) def testMinLength(self): """ A request for reads that are only longer than a certain value should result in the expected result. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 2=2X2M * 0 0 TCTAGG ZZZZZZ', 'query2 0 ref1 2 60 2= * 0 0 TC ZZ', ]).replace(' ', '\t') with dataFile(data) as filename: filterRead = ReadFilter(minLength=6).filter ps = PaddedSAM(SAMFilter(filename, filterRead=filterRead)) (read,) = list(ps.queries()) self.assertEqual(Read('query1', '-TCTAGG---', '!ZZZZZZ!!!'), read) def testDropSecondary(self): """ Dropping matches flagged as secondary must give the expected result. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 2=2X2M * 0 0 TCTAGG ZZZZZZ', 'query2 256 ref1 2 60 2= * 0 0 TC ZZ', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename, dropSecondary=True)) (read,) = list(ps.queries()) self.assertEqual(Read('query1', '-TCTAGG---', '!ZZZZZZ!!!'), read) def testDropSupplementary(self): """ Dropping matches flagged as supplementary must give the expected result. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 2=2X2M * 0 0 TCTAGG ZZZZZZ', 'query2 2048 ref1 2 60 2= * 0 0 TC ZZ', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename, dropSupplementary=True)) (read,) = list(ps.queries()) self.assertEqual(Read('query1', '-TCTAGG---', '!ZZZZZZ!!!'), read) def testDropDuplicates(self): """ Dropping matches flagged as optical or PCR duplicates must give the expected result. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 2=2X2M * 0 0 TCTAGG ZZZZZZ', 'query2 1024 ref1 2 60 2= * 0 0 TC ZZ', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename, dropDuplicates=True)) (read,) = list(ps.queries()) self.assertEqual(Read('query1', '-TCTAGG---', '!ZZZZZZ!!!'), read) def testAllowDuplicateIds(self): """ It must be possible to allow duplicate ids (in this case due to a secondary match). """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 2=2X2M * 0 0 TCTAGG ZZZZZZ', 'query1 0 ref1 3 60 2= * 0 0 TC ZZ', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read1, read2) = list(ps.queries(allowDuplicateIds=True)) self.assertEqual(Read('query1', '-TCTAGG---', '!ZZZZZZ!!!'), read1) self.assertEqual(Read('query1', '--TC------', '!!ZZ!!!!!!'), read2) def testDuplicateIdDisambiguation(self): """ Duplicate ids must be disambiguated if allowDuplicateIds is not given. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 2=2X2M * 0 0 TCTAGG ZZZZZZ', 'query1 0 ref1 3 60 2= * 0 0 TC ZZ', 'query1 0 ref1 5 60 2S2= * 0 0 TCGA ZZZZ', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read1, read2, read3) = list(ps.queries()) self.assertEqual(Read('query1', '-TCTAGG---', '!ZZZZZZ!!!'), read1) self.assertEqual(Read('query1/1', '--TC------', '!!ZZ!!!!!!'), read2) self.assertEqual(Read('query1/2', '--TCGA----', '!!ZZZZ!!!!'), read3) def testKeepQualityControlFailures(self): """ Keeping matches flagged as quality control failures must give the expected result. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 2=2X2M * 0 0 TCTAGG ZZZZZZ', 'query2 512 ref1 4 60 2= * 0 0 TC ZZ', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename, keepQCFailures=True)) (read1, read2) = list(ps.queries()) self.assertEqual(Read('query1', '-TCTAGG---', '!ZZZZZZ!!!'), read1) self.assertEqual(Read('query2', '---TC-----', '!!!ZZ!!!!!'), read2) def testSecondaryWithNoPreviousSequence(self): """ A secondary match with a '*' seq that is not preceeded by a query with a sequence must result in a ValueError being raised. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query 256 ref1 3 60 4M * 0 0 * *', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) error = ('^pysam produced an alignment \\(number 1\\) with no ' 'query sequence without previously giving an alignment ' 'with a sequence\\.$') queries = ps.queries() assertRaisesRegex(self, InvalidSAM, error, list, queries) def testSecondaryWithNoSequence(self): """ A secondary match with a '*' seq must result in the sequence from the previous query being used. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 3M * 0 0 TCT ZZZ', 'query2 0 ref1 2 60 4M * 0 0 TCTA ZZZZ', 'query2 256 ref1 6 60 4M * 0 0 * *', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read1, read2, read3) = list(ps.queries()) self.assertEqual(Read('query1', '-TCT------', '!ZZZ!!!!!!'), read1) self.assertEqual(Read('query2', '-TCTA-----', '!ZZZZ!!!!!'), read2) self.assertEqual(Read('query2/1', '-----TCTA-', '!!!!!ZZZZ!'), read3) def testSupplementaryWithNoPreviousSequence(self): """ A supplementary match with a '*' seq that is not preceeded by a query with a sequence must result in a ValueError being raised. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query 2048 ref1 3 60 4M * 0 0 * *', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) error = ('^pysam produced an alignment \\(number 1\\) with no ' 'query sequence without previously giving an alignment ' 'with a sequence\\.$') queries = ps.queries() assertRaisesRegex(self, InvalidSAM, error, list, queries) def testSupplementaryWithNoSequence(self): """ A supplementary match with a '*' seq must result in the sequence from the previous query being used. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 3M * 0 0 TCT ZZZ', 'query2 0 ref1 2 60 4M * 0 0 TCTA ZZZZ', 'query2 2048 ref1 6 60 4M * 0 0 * *', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read1, read2, read3) = list(ps.queries()) self.assertEqual(Read('query1', '-TCT------', '!ZZZ!!!!!!'), read1) self.assertEqual(Read('query2', '-TCTA-----', '!ZZZZ!!!!!'), read2) self.assertEqual(Read('query2/1', '-----TCTA-', '!!!!!ZZZZ!'), read3) def testNotSecondaryAndNotSupplementaryWithNoSequence(self): """ An alignment with a '*' seq that is not secondary or supplementary must result in a ValueError being raised. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query 0 ref1 3 60 4M * 0 0 * *', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) error = ('^pysam produced an alignment \\(number 1\\) with no ' 'query sequence without previously giving an alignment ' 'with a sequence\\.$') queries = ps.queries() assertRaisesRegex(self, InvalidSAM, error, list, queries) def testAlsoYieldAlignments(self): """ A request for queries with their pysam alignments should have the expected result. """ data = '\n'.join([ '@SQ SN:ref1 LN:10', 'query1 0 ref1 2 60 2=2X2M * 0 0 TCTAGG 123456', 'query2 0 ref1 2 60 2= * 0 0 TC 78', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read1, read2) = list(ps.queries(addAlignment=True)) self.assertEqual(Read('query1', '-TCTAGG---', '!123456!!!'), read1) self.assertEqual('TCTAGG', read1.alignment.query_sequence) self.assertEqual('123456', ''.join( map(lambda x: chr(x + 33), read1.alignment.query_qualities))) self.assertEqual(Read('query2', '-TC-------', '!78!!!!!!!'), read2) self.assertEqual('TC', read2.alignment.query_sequence) self.assertEqual('78', ''.join( map(lambda x: chr(x + 33), read2.alignment.query_qualities))) def testHardClippingInCIGARButQueryNotHardClipped(self): """ As documented in https://github.com/acorg/dark-matter/issues/630 we must deal correctly with a case in which the CIGAR string says a query is hard-clipped but the query sequence in the SAM file actually isn't. This can be due to a prior alignment with a soft clip, in which case the full query sequence has to be given before the secondary alignment with the hard clip. """ data = '\n'.join([ '@SQ SN:Chimp-D00220 LN:8', '@SQ SN:D-AM494716 LN:8', '@SQ SN:D-XXX LN:8', '@SQ SN:Chimp-YYY LN:8', 'query1 0 Chimp-D00220 1 0 3S5M * 0 0 TTTTGGTT 12345678', 'query1 256 D-AM494716 1 0 3H5M * 0 0 * *', 'query1 256 D-XXX 1 0 5H3M * 0 0 * *', 'query1 0 Chimp-YYY 1 0 8M * 0 0 * *', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read1, read2, read3, read4) = list(ps.queries(addAlignment=True)) self.assertEqual(Read('query1', 'TGGTT---', '45678!!!'), read1) self.assertEqual('TTTTGGTT', read1.alignment.query_sequence) self.assertEqual(Read('query1/1', 'TGGTT---', '45678!!!'), read2) self.assertEqual('TGGTT', read2.alignment.query_sequence) self.assertEqual(Read('query1/2', 'GTT-----', '678!!!!!'), read3) self.assertEqual('GTT', read3.alignment.query_sequence) self.assertEqual(Read('query1/3', 'TTTTGGTT', '12345678'), read4) self.assertEqual('TTTTGGTT', read4.alignment.query_sequence) def testSecondaryAlignmentHasQuery(self): """ If the first alignment of a query is against a reference that is not wanted, a subsequent secondary alignment (SAM flag = 256) must have the original query and quality strings (even though these are only present in the SAM as * characters and the query is None when it comes back from pysam). """ data = '\n'.join([ '@SQ SN:ref1 LN:10', '@SQ SN:ref2 LN:10', 'query1 0 ref1 2 60 2=2X2M * 0 0 TCTAGG ZZZZZZ', 'query1 256 ref2 2 60 2=2X2M * 0 0 * *', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read1, read2) = list(ps.queries(addAlignment=True)) self.assertEqual(Read('query1', '-TCTAGG---', '!ZZZZZZ!!!'), read1) self.assertEqual('ref1', read1.alignment.reference_name) self.assertEqual(Read('query1/1', '-TCTAGG---', '!ZZZZZZ!!!'), read2) self.assertEqual('ref2', read2.alignment.reference_name) def testSupplementaryAlignmentHasQuery(self): """ If the first alignment of a query is against a reference that is not wanted, a subsequent supplementary alignment (SAM flag = 2048) must have the original query and quality strings (even though these are only present in the SAM as * characters and the query is None when it comes back from pysam). """ data = '\n'.join([ '@SQ SN:ref1 LN:10', '@SQ SN:ref2 LN:10', 'query1 0 ref1 2 60 2=2X2M * 0 0 TCTAGG ZZZZZZ', 'query1 2048 ref2 2 60 2=2X2M * 0 0 * *', ]).replace(' ', '\t') with dataFile(data) as filename: ps = PaddedSAM(SAMFilter(filename)) (read1, read2) = list(ps.queries(addAlignment=True)) self.assertEqual(Read('query1', '-TCTAGG---', '!ZZZZZZ!!!'), read1) self.assertEqual('ref1', read1.alignment.reference_name) self.assertEqual(Read('query1/1', '-TCTAGG---', '!ZZZZZZ!!!'), read2) self.assertEqual('ref2', read2.alignment.reference_name) class TestSamReferencesToStr(TestCase): """ Test the samReferencesToStr function. """ def testSimple(self): """ The referencesToStr method must return the expected string. """ data = '\n'.join([ '@SQ SN:id1 LN:90', '@SQ SN:id2 LN:91', ]).replace(' ', '\t') with dataFile(data) as filename: self.assertEqual('id1 (length 90)\nid2 (length 91)', samReferencesToStr(filename)) def testIndent(self): """ The referencesToStr method must return the expected string when passed an indent. """ data = '\n'.join([ '@SQ SN:id1 LN:90', '@SQ SN:id2 LN:91', ]).replace(' ', '\t') with dataFile(data) as filename: self.assertEqual(' id1 (length 90)\n id2 (length 91)', samReferencesToStr(filename, indent=2)) class TestHardClip(TestCase): """ Test the _hardClip function. """ def testHardClipInMiddle(self): """ If hard clipping is given as an operation not at the beginning or end of the sequence, a ValueError must be raised. """ error = ( '^Invalid CIGAR tuples .* contains hard-clipping operation ' 'that is neither at the start nor the end of the sequence\\.$') assertRaisesRegex( self, ValueError, error, _hardClip, 'CGT', '123', ((CMATCH, 1), (CHARD_CLIP, 1), (CMATCH, 1),)) def testThreeHardClips(self): """ If hard clipping is specified more than twice, a ValueError must be raised. """ error = ('^Invalid CIGAR tuples .* specifies hard-clipping 3 times ' '\\(2 is the maximum\\).$') assertRaisesRegex( self, ValueError, error, _hardClip, 'CGT', '123', ((CHARD_CLIP, 1), (CHARD_CLIP, 1), (CHARD_CLIP, 1),)) def testNoClip(self): """ If no hard clipping is indicated, the function must return the original sequence. """ self.assertEqual(('CGT', '123', False), _hardClip('CGT', '123', ((CMATCH, 3),))) def testClipLeft(self): """ If hard clipping on the left is indicated, and has not been done, the function must return the expected sequence. """ self.assertEqual( ('CGT', '456', True), _hardClip('CAACGT', '123456', ((CHARD_CLIP, 3), (CMATCH, 3),))) def testClipRight(self): """ If hard clipping on the right is indicated, and has not been done, the function must return the expected sequence. """ self.assertEqual( ('CA', '12', True), _hardClip('CAACGT', '123456', ((CMATCH, 2), (CHARD_CLIP, 4),))) def testClipBoth(self): """ If hard clipping on the left and right is indicated, and has not been done, the function must return the expected sequence. """ self.assertEqual( ('AA', '23', True), _hardClip('CAACGT', '123456', ((CHARD_CLIP, 1), (CMATCH, 2), (CHARD_CLIP, 3),))) def testClipLeftAlreadyDone(self): """ If hard clipping on the left is indicated, and has already been done, the function must return the expected sequence. """ self.assertEqual( ('CGT', '123', False), _hardClip('CGT', '123', ((CHARD_CLIP, 3), (CMATCH, 3),))) def testClipRightAlreadyDone(self): """ If hard clipping on the right is indicated, and has already been done, the function must return the expected sequence. """ self.assertEqual( ('CA', '12', False), _hardClip('CA', '12', ((CMATCH, 2), (CHARD_CLIP, 4),))) def testClipBothAlreadyDone(self): """ If hard clipping on the left and right is indicated, and has already been done, the function must return the expected sequence. """ self.assertEqual( ('AA', '12', False), _hardClip('AA', '12', ((CHARD_CLIP, 1), (CMATCH, 2), (CHARD_CLIP, 3),)))
terrycojones/dark-matter
test/test_sam.py
Python
mit
45,018
[ "pysam" ]
5b68ab0d24d25142d4d8997eec32e48bd42ad1ed194eb176a67bb39ba4bfc6e3
# Copyright 2019 DeepMind Technologies Limited and Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # https://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """GAN modules.""" import collections import math import sonnet as snt import tensorflow.compat.v1 as tf from cs_gan import utils class GAN(object): """Standard generative adversarial network setup. The aim of the generator is to generate samples which fool a discriminator. Does not make any assumptions about the discriminator and generator loss functions. Trained module components: * discriminator * generator For the standard GAN algorithm, generator_inputs is a vector of noise (either Gaussian or uniform). """ def __init__(self, discriminator, generator, num_z_iters=None, z_step_size=None, z_project_method=None, optimisation_cost_weight=None): """Constructs the module. Args: discriminator: The discriminator network. A sonnet module. See `nets.py`. generator: The generator network. A sonnet module. For examples, see `nets.py`. num_z_iters: an integer, the number of latent optimisation steps. z_step_size: an integer, latent optimisation step size. z_project_method: the method for projecting latent after optimisation, a string from {'norm', 'clip'}. optimisation_cost_weight: a float, how much to penalise the distance of z moved by latent optimisation. """ self._discriminator = discriminator self.generator = generator self.num_z_iters = num_z_iters self.z_project_method = z_project_method if z_step_size: self._log_step_size_module = snt.TrainableVariable( [], initializers={'w': tf.constant_initializer(math.log(z_step_size))}) self.z_step_size = tf.exp(self._log_step_size_module()) self._optimisation_cost_weight = optimisation_cost_weight def connect(self, data, generator_inputs): """Connects the components and returns the losses, outputs and debug ops. Args: data: a `tf.Tensor`: `[batch_size, ...]`. There are no constraints on the rank of this tensor, but it has to be compatible with the shapes expected by the discriminator. generator_inputs: a `tf.Tensor`: `[g_in_batch_size, ...]`. It does not have to have the same batch size as the `data` tensor. There are not constraints on the rank of this tensor, but it has to be compatible with the shapes the generator network supports as inputs. Returns: An `ModelOutputs` instance. """ samples, optimised_z = utils.optimise_and_sample( generator_inputs, self, data, is_training=True) optimisation_cost = utils.get_optimisation_cost(generator_inputs, optimised_z) # Pass in the labels to the discriminator in case we are using a # discriminator which makes use of labels. The labels can be None. disc_data_logits = self._discriminator(data) disc_sample_logits = self._discriminator(samples) disc_data_loss = utils.cross_entropy_loss( disc_data_logits, tf.ones(tf.shape(disc_data_logits[:, 0]), dtype=tf.int32)) disc_sample_loss = utils.cross_entropy_loss( disc_sample_logits, tf.zeros(tf.shape(disc_sample_logits[:, 0]), dtype=tf.int32)) disc_loss = disc_data_loss + disc_sample_loss generator_loss = utils.cross_entropy_loss( disc_sample_logits, tf.ones(tf.shape(disc_sample_logits[:, 0]), dtype=tf.int32)) optimization_components = self._build_optimization_components( discriminator_loss=disc_loss, generator_loss=generator_loss, optimisation_cost=optimisation_cost) debug_ops = {} debug_ops['disc_data_loss'] = disc_data_loss debug_ops['disc_sample_loss'] = disc_sample_loss debug_ops['disc_loss'] = disc_loss debug_ops['gen_loss'] = generator_loss debug_ops['opt_cost'] = optimisation_cost if hasattr(self, 'z_step_size'): debug_ops['z_step_size'] = self.z_step_size return utils.ModelOutputs( optimization_components, debug_ops) def gen_loss_fn(self, data, samples): """Generator loss as latent optimisation's error function.""" del data disc_sample_logits = self._discriminator(samples) generator_loss = utils.cross_entropy_loss( disc_sample_logits, tf.ones(tf.shape(disc_sample_logits[:, 0]), dtype=tf.int32)) return generator_loss def _build_optimization_components( self, generator_loss=None, discriminator_loss=None, optimisation_cost=None): """Create the optimization components for this module.""" discriminator_vars = _get_and_check_variables(self._discriminator) generator_vars = _get_and_check_variables(self.generator) if hasattr(self, '_log_step_size_module'): step_vars = _get_and_check_variables(self._log_step_size_module) generator_vars += step_vars optimization_components = collections.OrderedDict() optimization_components['disc'] = utils.OptimizationComponent( discriminator_loss, discriminator_vars) if self._optimisation_cost_weight: generator_loss += self._optimisation_cost_weight * optimisation_cost optimization_components['gen'] = utils.OptimizationComponent( generator_loss, generator_vars) return optimization_components def get_variables(self): disc_vars = _get_and_check_variables(self._discriminator) gen_vars = _get_and_check_variables(self.generator) return disc_vars, gen_vars def _get_and_check_variables(module): module_variables = module.get_all_variables() if not module_variables: raise ValueError( 'Module {} has no variables! Variables needed for training.'.format( module.module_name)) # TensorFlow optimizers require lists to be passed in. return list(module_variables)
deepmind/deepmind-research
cs_gan/gan.py
Python
apache-2.0
6,384
[ "Gaussian" ]
25a3c621cabfc064457b585c105e7be51def91c5422b60cd3f4c74784088d355
# (c) 2012, Michael DeHaan <michael.dehaan@gmail.com> # # This file is part of Ansible # # Ansible is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # Ansible is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with Ansible. If not, see <http://www.gnu.org/licenses/>. from __future__ import (absolute_import, division, print_function) __metaclass__ = type import ast import sys from ansible.compat.six import string_types from ansible.compat.six.moves import builtins from ansible import constants as C from ansible.plugins import filter_loader, test_loader try: from __main__ import display except ImportError: from ansible.utils.display import Display display = Display() def safe_eval(expr, locals={}, include_exceptions=False): ''' This is intended for allowing things like: with_items: a_list_variable Where Jinja2 would return a string but we do not want to allow it to call functions (outside of Jinja2, where the env is constrained). If the input data to this function came from an untrusted (remote) source, it should first be run through _clean_data_struct() to ensure the data is further sanitized prior to evaluation. Based on: http://stackoverflow.com/questions/12523516/using-ast-and-whitelists-to-make-pythons-eval-safe ''' # define certain JSON types # eg. JSON booleans are unknown to python eval() JSON_TYPES = { 'false': False, 'null': None, 'true': True, } # this is the whitelist of AST nodes we are going to # allow in the evaluation. Any node type other than # those listed here will raise an exception in our custom # visitor class defined below. SAFE_NODES = set( ( ast.Add, ast.BinOp, ast.Call, ast.Compare, ast.Dict, ast.Div, ast.Expression, ast.List, ast.Load, ast.Mult, ast.Num, ast.Name, ast.Str, ast.Sub, ast.Tuple, ast.UnaryOp, ) ) # AST node types were expanded after 2.6 if sys.version_info[:2] >= (2, 7): SAFE_NODES.update( set( (ast.Set,) ) ) # And in Python 3.4 too if sys.version_info[:2] >= (3, 4): SAFE_NODES.update( set( (ast.NameConstant,) ) ) filter_list = [] for filter in filter_loader.all(): filter_list.extend(filter.filters().keys()) test_list = [] for test in test_loader.all(): test_list.extend(test.tests().keys()) CALL_WHITELIST = C.DEFAULT_CALLABLE_WHITELIST + filter_list + test_list class CleansingNodeVisitor(ast.NodeVisitor): def generic_visit(self, node, inside_call=False): if type(node) not in SAFE_NODES: raise Exception("invalid expression (%s)" % expr) elif isinstance(node, ast.Call): inside_call = True elif isinstance(node, ast.Name) and inside_call: if hasattr(builtins, node.id) and node.id not in CALL_WHITELIST: raise Exception("invalid function: %s" % node.id) # iterate over all child nodes for child_node in ast.iter_child_nodes(node): self.generic_visit(child_node, inside_call) if not isinstance(expr, string_types): # already templated to a datastructure, perhaps? if include_exceptions: return (expr, None) return expr cnv = CleansingNodeVisitor() try: parsed_tree = ast.parse(expr, mode='eval') cnv.visit(parsed_tree) compiled = compile(parsed_tree, expr, 'eval') result = eval(compiled, JSON_TYPES, dict(locals)) if include_exceptions: return (result, None) else: return result except SyntaxError as e: # special handling for syntax errors, we just return # the expression string back as-is to support late evaluation if include_exceptions: return (expr, None) return expr except Exception as e: display.warning('Exception in safe_eval() on expr: %s (%s)' % (expr, e)) if include_exceptions: return (expr, e) return expr
wkeeling/ansible
lib/ansible/template/safe_eval.py
Python
gpl-3.0
4,814
[ "VisIt" ]
6397c3eef0a90da12135bf9fb54e3d804283d4dfda12438a2002cbca6788a874
# # @BEGIN LICENSE # # Psi4: an open-source quantum chemistry software package # # Copyright (c) 2007-2022 The Psi4 Developers. # # The copyrights for code used from other parties are included in # the corresponding files. # # This file is part of Psi4. # # Psi4 is free software; you can redistribute it and/or modify # it under the terms of the GNU Lesser General Public License as published by # the Free Software Foundation, version 3. # # Psi4 is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Lesser General Public License for more details. # # You should have received a copy of the GNU Lesser General Public License along # with Psi4; if not, write to the Free Software Foundation, Inc., # 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA. # # @END LICENSE # """Module with commands building :py:class:`~basislist.BasisFamily` objects for Pople and other non-Dunning orbital basis sets. Some plausible fitting basis sets are supplied as defaults. """ from .basislist import * def load_basfam_other(): # Pople basis_sto3g = BasisFamily('STO-3G', zeta=1) basis_sto6g = BasisFamily('STO-6G', zeta=1) basis_321g = BasisFamily('3-21G', zeta=1) basisfamily_list.append(basis_sto3g) basisfamily_list.append(basis_sto6g) basisfamily_list.append(basis_321g) basis_631g = BasisFamily('6-31G', zeta=2) basis_631g_d_ = BasisFamily('6-31G(d)', zeta=2) basis_631g_d_p_ = BasisFamily('6-31G(d,p)', zeta=2) basis_631gs = BasisFamily('6-31G*', '6-31g_d_', zeta=2) basis_631gss = BasisFamily('6-31G**', '6-31g_d_p_', zeta=2) basis_631pg = BasisFamily('6-31+G', zeta=2) basis_631pg_d_ = BasisFamily('6-31+G(d)', zeta=2) basis_631pg_d_p_ = BasisFamily('6-31+G(d,p)', zeta=2) basis_631pgs = BasisFamily('6-31+G*', '6-31pg_d_', zeta=2) basis_631pgss = BasisFamily('6-31+G**', '6-31pg_d_p_', zeta=2) basis_631ppg = BasisFamily('6-31++G', zeta=2) basis_631ppg_d_ = BasisFamily('6-31++G(d)', zeta=2) basis_631ppg_d_p_ = BasisFamily('6-31++G(d,p)', zeta=2) basis_631ppgs = BasisFamily('6-31++G*', '6-31ppg_d_', zeta=2) basis_631ppgss = BasisFamily('6-31++G**', '6-31ppg_d_p_', zeta=2) basisfamily_list.append(basis_631g) basisfamily_list.append(basis_631g_d_) basisfamily_list.append(basis_631g_d_p_) basisfamily_list.append(basis_631gs) basisfamily_list.append(basis_631gss) basisfamily_list.append(basis_631pg) basisfamily_list.append(basis_631pg_d_) basisfamily_list.append(basis_631pg_d_p_) basisfamily_list.append(basis_631pgs) basisfamily_list.append(basis_631pgss) basisfamily_list.append(basis_631ppg) basisfamily_list.append(basis_631ppg_d_) basisfamily_list.append(basis_631ppg_d_p_) basisfamily_list.append(basis_631ppgs) basisfamily_list.append(basis_631ppgss) basis_6311g = BasisFamily('6-311G', zeta=3) basis_6311g_d_ = BasisFamily('6-311G(d)', zeta=3) basis_6311g_d_p_ = BasisFamily('6-311G(d,p)', zeta=3) basis_6311gs = BasisFamily('6-311G*', '6-311g_d_', zeta=3) basis_6311gss = BasisFamily('6-311G**', '6-311g_d_p_', zeta=3) basis_6311g_2d_ = BasisFamily('6-311G(2d)', zeta=3) basis_6311g_2d_p_ = BasisFamily('6-311G(2d,p)', zeta=3) basis_6311g_2d_2p_ = BasisFamily('6-311G(2d,2p)', zeta=3) basis_6311g_2df_ = BasisFamily('6-311G(2df)', zeta=3) basis_6311g_2df_p_ = BasisFamily('6-311G(2df,p)', zeta=3) basis_6311g_2df_2p_ = BasisFamily('6-311G(2df,2p)', zeta=3) basis_6311g_2df_2pd_ = BasisFamily('6-311G(2df,2pd)', zeta=3) basis_6311g_3df_ = BasisFamily('6-311G(3df)', zeta=3) basis_6311g_3df_p_ = BasisFamily('6-311G(3df,p)', zeta=3) basis_6311g_3df_2p_ = BasisFamily('6-311G(3df,2p)', zeta=3) basis_6311g_3df_2pd_ = BasisFamily('6-311G(3df,2pd)', zeta=3) basis_6311g_3df_3pd_ = BasisFamily('6-311G(3df,3pd)', zeta=3) basisfamily_list.append(basis_6311g) basisfamily_list.append(basis_6311g_d_) basisfamily_list.append(basis_6311g_d_p_) basisfamily_list.append(basis_6311gs) basisfamily_list.append(basis_6311gss) basisfamily_list.append(basis_6311g_2d_) basisfamily_list.append(basis_6311g_2d_p_) basisfamily_list.append(basis_6311g_2d_2p_) basisfamily_list.append(basis_6311g_2df_) basisfamily_list.append(basis_6311g_2df_p_) basisfamily_list.append(basis_6311g_2df_2p_) basisfamily_list.append(basis_6311g_2df_2pd_) basisfamily_list.append(basis_6311g_3df_) basisfamily_list.append(basis_6311g_3df_p_) basisfamily_list.append(basis_6311g_3df_2p_) basisfamily_list.append(basis_6311g_3df_2pd_) basisfamily_list.append(basis_6311g_3df_3pd_) basis_6311pg = BasisFamily('6-311+G', zeta=3) basis_6311pg_d_ = BasisFamily('6-311+G(d)', zeta=3) basis_6311pg_d_p_ = BasisFamily('6-311+G(d,p)', zeta=3) basis_6311pgs = BasisFamily('6-311+G*', '6-311pg_d_', zeta=3) basis_6311pgss = BasisFamily('6-311+G**', '6-311pg_d_p_', zeta=3) basis_6311pg_2d_ = BasisFamily('6-311+G(2d)', zeta=3) basis_6311pg_2d_p_ = BasisFamily('6-311+G(2d,p)', zeta=3) basis_6311pg_2d_2p_ = BasisFamily('6-311+G(2d,2p)', zeta=3) basis_6311pg_2df_ = BasisFamily('6-311+G(2df)', zeta=3) basis_6311pg_2df_p_ = BasisFamily('6-311+G(2df,p)', zeta=3) basis_6311pg_2df_2p_ = BasisFamily('6-311+G(2df,2p)', zeta=3) basis_6311pg_2df_2pd_ = BasisFamily('6-311+G(2df,2pd)', zeta=3) basis_6311pg_3df_ = BasisFamily('6-311+G(3df)', zeta=3) basis_6311pg_3df_p_ = BasisFamily('6-311+G(3df,p)', zeta=3) basis_6311pg_3df_2p_ = BasisFamily('6-311+G(3df,2p)', zeta=3) basis_6311pg_3df_2pd_ = BasisFamily('6-311+G(3df,2pd)', zeta=3) basis_6311pg_3df_3pd_ = BasisFamily('6-311+G(3df,3pd)', zeta=3) basisfamily_list.append(basis_6311pg) basisfamily_list.append(basis_6311pg_d_) basisfamily_list.append(basis_6311pg_d_p_) basisfamily_list.append(basis_6311pgs) basisfamily_list.append(basis_6311pgss) basisfamily_list.append(basis_6311pg_2d_) basisfamily_list.append(basis_6311pg_2d_p_) basisfamily_list.append(basis_6311pg_2d_2p_) basisfamily_list.append(basis_6311pg_2df_) basisfamily_list.append(basis_6311pg_2df_p_) basisfamily_list.append(basis_6311pg_2df_2p_) basisfamily_list.append(basis_6311pg_2df_2pd_) basisfamily_list.append(basis_6311pg_3df_) basisfamily_list.append(basis_6311pg_3df_p_) basisfamily_list.append(basis_6311pg_3df_2p_) basisfamily_list.append(basis_6311pg_3df_2pd_) basisfamily_list.append(basis_6311pg_3df_3pd_) basis_6311ppg = BasisFamily('6-311++G', zeta=3) basis_6311ppg_d_ = BasisFamily('6-311++G(d)', zeta=3) basis_6311ppg_d_p_ = BasisFamily('6-311++G(d,p)', zeta=3) basis_6311ppgs = BasisFamily('6-311++G*', '6-311ppg_d_', zeta=3) basis_6311ppgss = BasisFamily('6-311++G**', '6-311ppg_d_p_', zeta=3) basis_6311ppg_2d_ = BasisFamily('6-311++G(2d)', zeta=3) basis_6311ppg_2d_p_ = BasisFamily('6-311++G(2d,p)', zeta=3) basis_6311ppg_2d_2p_ = BasisFamily('6-311++G(2d,2p)', zeta=3) basis_6311ppg_2df_ = BasisFamily('6-311++G(2df)', zeta=3) basis_6311ppg_2df_p_ = BasisFamily('6-311++G(2df,p)', zeta=3) basis_6311ppg_2df_2p_ = BasisFamily('6-311++G(2df,2p)', zeta=3) basis_6311ppg_2df_2pd_ = BasisFamily('6-311++G(2df,2pd)', zeta=3) basis_6311ppg_3df_ = BasisFamily('6-311++G(3df)', zeta=3) basis_6311ppg_3df_p_ = BasisFamily('6-311++G(3df,p)', zeta=3) basis_6311ppg_3df_2p_ = BasisFamily('6-311++G(3df,2p)', zeta=3) basis_6311ppg_3df_2pd_ = BasisFamily('6-311++G(3df,2pd)', zeta=3) basis_6311ppg_3df_3pd_ = BasisFamily('6-311++G(3df,3pd)', zeta=3) basisfamily_list.append(basis_6311ppg) basisfamily_list.append(basis_6311ppg_d_) basisfamily_list.append(basis_6311ppg_d_p_) basisfamily_list.append(basis_6311ppgs) basisfamily_list.append(basis_6311ppgss) basisfamily_list.append(basis_6311ppg_2d_) basisfamily_list.append(basis_6311ppg_2d_p_) basisfamily_list.append(basis_6311ppg_2d_2p_) basisfamily_list.append(basis_6311ppg_2df_) basisfamily_list.append(basis_6311ppg_2df_p_) basisfamily_list.append(basis_6311ppg_2df_2p_) basisfamily_list.append(basis_6311ppg_2df_2pd_) basisfamily_list.append(basis_6311ppg_3df_) basisfamily_list.append(basis_6311ppg_3df_p_) basisfamily_list.append(basis_6311ppg_3df_2p_) basisfamily_list.append(basis_6311ppg_3df_2pd_) basisfamily_list.append(basis_6311ppg_3df_3pd_) # Ahlrichs basis_def2sv_p_ = BasisFamily('def2-SV(P)', zeta=2) basis_def2msvp = BasisFamily('def2-mSVP', zeta=2) basis_def2svp = BasisFamily('def2-SVP', zeta=2) basis_def2svpd = BasisFamily('def2-SVPD', zeta=2) basis_def2tzvp = BasisFamily('def2-TZVP', zeta=3) basis_def2tzvpd = BasisFamily('def2-TZVPD', zeta=3) basis_def2tzvpp = BasisFamily('def2-TZVPP', zeta=3) basis_def2tzvppd = BasisFamily('def2-TZVPPD', zeta=3) basis_def2qzvp = BasisFamily('def2-QZVP', zeta=4) basis_def2qzvpd = BasisFamily('def2-QZVPD', zeta=4) basis_def2qzvpp = BasisFamily('def2-QZVPP', zeta=4) basis_def2qzvppd = BasisFamily('def2-QZVPPD', zeta=4) basis_def2sv_p_.add_jfit('def2-universal-JFIT') basis_def2msvp.add_jfit('def2-universal-JFIT') basis_def2svp.add_jfit('def2-universal-JFIT') basis_def2svpd.add_jfit('def2-universal-JFIT') basis_def2tzvp.add_jfit('def2-universal-JFIT') basis_def2tzvpd.add_jfit('def2-universal-JFIT') basis_def2tzvpp.add_jfit('def2-universal-JFIT') basis_def2tzvppd.add_jfit('def2-universal-JFIT') basis_def2qzvp.add_jfit('def2-universal-JFIT') basis_def2qzvpd.add_jfit('def2-universal-JFIT') basis_def2qzvpp.add_jfit('def2-universal-JFIT') basis_def2qzvppd.add_jfit('def2-universal-JFIT') basis_def2sv_p_.add_jkfit('def2-universal-JKFIT') basis_def2msvp.add_jkfit('def2-universal-JKFIT') basis_def2svp.add_jkfit('def2-universal-JKFIT') basis_def2svpd.add_jkfit('def2-universal-JKFIT') basis_def2tzvp.add_jkfit('def2-universal-JKFIT') basis_def2tzvpd.add_jkfit('def2-universal-JKFIT') basis_def2tzvpp.add_jkfit('def2-universal-JKFIT') basis_def2tzvppd.add_jkfit('def2-universal-JKFIT') basis_def2qzvp.add_jkfit('def2-universal-JKFIT') basis_def2qzvpd.add_jkfit('def2-universal-JKFIT') basis_def2qzvpp.add_jkfit('def2-universal-JKFIT') basis_def2qzvppd.add_jkfit('def2-universal-JKFIT') basis_def2sv_p_.add_rifit('def2-SV(P)-RI') basis_def2msvp.add_rifit('def2-SVP-RI') basis_def2svp.add_rifit('def2-SVP-RI') basis_def2svpd.add_rifit('def2-SVPD-RI') basis_def2tzvp.add_rifit('def2-TZVP-RI') basis_def2tzvpd.add_rifit('def2-TZVPD-RI') basis_def2tzvpp.add_rifit('def2-TZVPP-RI') basis_def2tzvppd.add_rifit('def2-TZVPPD-RI') basis_def2qzvp.add_rifit('def2-QZVP-RI') # basis_def2qzvpd.add_rifit('') basis_def2qzvpp.add_rifit('def2-QZVPP-RI') basis_def2qzvppd.add_rifit('def2-QZVPPD-RI') # def2sv_p_ too small for add_guess basis_def2svp.add_guess('def2-SV(P)') basis_def2svpd.add_guess('def2-SV(P)') basis_def2tzvp.add_guess('def2-SV(P)') basis_def2tzvpd.add_guess('def2-SV(P)') basis_def2tzvpp.add_guess('def2-SV(P)') basis_def2tzvppd.add_guess('def2-SV(P)') basis_def2qzvp.add_guess('def2-SV(P)') basis_def2qzvpd.add_guess('def2-SV(P)') basis_def2qzvpp.add_guess('def2-SV(P)') basis_def2qzvppd.add_guess('def2-SV(P)') basisfamily_list.append(basis_def2sv_p_) basisfamily_list.append(basis_def2msvp) basisfamily_list.append(basis_def2svp) basisfamily_list.append(basis_def2svpd) basisfamily_list.append(basis_def2tzvp) basisfamily_list.append(basis_def2tzvpd) basisfamily_list.append(basis_def2tzvpp) basisfamily_list.append(basis_def2tzvppd) basisfamily_list.append(basis_def2qzvp) basisfamily_list.append(basis_def2qzvpd) basisfamily_list.append(basis_def2qzvpp) basisfamily_list.append(basis_def2qzvppd) # Jensen basis_augpcseg0 = BasisFamily('aug-pcseg-0', zeta=1) basis_augpcseg1 = BasisFamily('aug-pcseg-1', zeta=2) basis_augpcseg2 = BasisFamily('aug-pcseg-2', zeta=3) basis_augpcseg3 = BasisFamily('aug-pcseg-3', zeta=4) basis_augpcseg4 = BasisFamily('aug-pcseg-4', zeta=5) basis_augpcsseg0 = BasisFamily('aug-pcSseg-0', zeta=1) basis_augpcsseg1 = BasisFamily('aug-pcSseg-1', zeta=2) basis_augpcsseg2 = BasisFamily('aug-pcSseg-2', zeta=3) basis_augpcsseg3 = BasisFamily('aug-pcSseg-3', zeta=4) basis_augpcsseg4 = BasisFamily('aug-pcSseg-4', zeta=5) basis_pcseg0 = BasisFamily('pcseg-0', zeta=1) basis_pcseg1 = BasisFamily('pcseg-1', zeta=2) basis_pcseg2 = BasisFamily('pcseg-2', zeta=3) basis_pcseg3 = BasisFamily('pcseg-3', zeta=4) basis_pcseg4 = BasisFamily('pcseg-4', zeta=5) basis_pcsseg0 = BasisFamily('pcSseg-0', zeta=1) basis_pcsseg1 = BasisFamily('pcSseg-1', zeta=2) basis_pcsseg2 = BasisFamily('pcSseg-2', zeta=3) basis_pcsseg3 = BasisFamily('pcSseg-3', zeta=4) basis_pcsseg4 = BasisFamily('pcSseg-4', zeta=5) # Here lie practical (non-validated) fitting bases for # Jensen orbital basis sets basis_augpcseg0.add_jfit('def2-universal-JFIT') basis_augpcseg1.add_jfit('def2-universal-JFIT') basis_augpcseg2.add_jfit('def2-universal-JFIT') basis_augpcseg3.add_jfit('def2-universal-JFIT') basis_augpcsseg0.add_jfit('def2-universal-JFIT') basis_augpcsseg1.add_jfit('def2-universal-JFIT') basis_augpcsseg2.add_jfit('def2-universal-JFIT') basis_augpcsseg3.add_jfit('def2-universal-JFIT') basis_pcseg0.add_jfit('def2-universal-JFIT') basis_pcseg1.add_jfit('def2-universal-JFIT') basis_pcseg2.add_jfit('def2-universal-JFIT') basis_pcseg3.add_jfit('def2-universal-JFIT') basis_pcsseg0.add_jfit('def2-universal-JFIT') basis_pcsseg1.add_jfit('def2-universal-JFIT') basis_pcsseg2.add_jfit('def2-universal-JFIT') basis_pcsseg3.add_jfit('def2-universal-JFIT') basis_augpcseg0.add_jkfit('def2-universal-JKFIT') basis_augpcseg1.add_jkfit('def2-universal-JKFIT') basis_augpcseg2.add_jkfit('def2-universal-JKFIT') basis_augpcseg3.add_jkfit('def2-universal-JKFIT') basis_augpcseg4.add_jkfit('aug-cc-pV5Z-JKFIT') basis_augpcsseg0.add_jkfit('def2-universal-JKFIT') basis_augpcsseg1.add_jkfit('def2-universal-JKFIT') basis_augpcsseg2.add_jkfit('def2-universal-JKFIT') basis_augpcsseg3.add_jkfit('def2-universal-JKFIT') basis_augpcsseg4.add_jkfit('aug-cc-pV5Z-JKFIT') basis_pcseg0.add_jkfit('def2-universal-JKFIT') basis_pcseg1.add_jkfit('def2-universal-JKFIT') basis_pcseg2.add_jkfit('def2-universal-JKFIT') basis_pcseg3.add_jkfit('def2-universal-JKFIT') basis_pcseg4.add_jkfit('cc-pV5Z-JKFIT') basis_pcsseg0.add_jkfit('def2-universal-JKFIT') basis_pcsseg1.add_jkfit('def2-universal-JKFIT') basis_pcsseg2.add_jkfit('def2-universal-JKFIT') basis_pcsseg3.add_jkfit('def2-universal-JKFIT') basis_pcsseg4.add_jkfit('cc-pV5Z-JKFIT') basis_augpcseg0.add_rifit('def2-SV(P)-RI') basis_augpcseg1.add_rifit('def2-SVPD-RI') basis_augpcseg2.add_rifit('def2-TZVPPD-RI') basis_augpcseg3.add_rifit('def2-QZVPPD-RI') basis_augpcseg4.add_rifit('aug-cc-pV5Z-RI') basis_augpcsseg0.add_rifit('def2-SV(P)-RI') basis_augpcsseg1.add_rifit('def2-SVPD-RI') basis_augpcsseg2.add_rifit('def2-TZVPPD-RI') basis_augpcsseg3.add_rifit('def2-QZVPPD-RI') basis_augpcsseg4.add_rifit('aug-cc-pwCV5Z-RI') basis_pcseg0.add_rifit('def2-SV(P)-RI') basis_pcseg1.add_rifit('def2-SVP-RI') basis_pcseg2.add_rifit('def2-TZVPP-RI') basis_pcseg3.add_rifit('def2-QZVPP-RI') basis_pcseg4.add_rifit('cc-pV5Z-RI') basis_pcsseg0.add_rifit('def2-SV(P)-RI') basis_pcsseg1.add_rifit('def2-SVP-RI') basis_pcsseg2.add_rifit('def2-TZVPP-RI') basis_pcsseg3.add_rifit('def2-QZVPP-RI') basis_pcsseg4.add_rifit('cc-pwCV5Z-RI') basis_augpcseg0.add_guess('pcseg-0') basis_augpcseg1.add_guess('pcseg-0') basis_augpcseg2.add_guess('pcseg-0') basis_augpcseg3.add_guess('pcseg-0') basis_augpcseg4.add_guess('pcseg-0') basis_augpcsseg0.add_guess('pcseg-0') basis_augpcsseg1.add_guess('pcseg-0') basis_augpcsseg2.add_guess('pcseg-0') basis_augpcsseg3.add_guess('pcseg-0') basis_augpcsseg4.add_guess('pcseg-0') # pcseg0 too small for add_guess basis_pcseg1.add_guess('pcseg-0') basis_pcseg2.add_guess('pcseg-0') basis_pcseg3.add_guess('pcseg-0') basis_pcseg4.add_guess('pcseg-0') basis_pcsseg0.add_guess('pcseg-0') basis_pcsseg1.add_guess('pcseg-0') basis_pcsseg2.add_guess('pcseg-0') basis_pcsseg3.add_guess('pcseg-0') basis_pcsseg4.add_guess('pcseg-0') basisfamily_list.append(basis_augpcseg0) basisfamily_list.append(basis_augpcseg1) basisfamily_list.append(basis_augpcseg2) basisfamily_list.append(basis_augpcseg3) basisfamily_list.append(basis_augpcseg4) basisfamily_list.append(basis_augpcsseg0) basisfamily_list.append(basis_augpcsseg1) basisfamily_list.append(basis_augpcsseg2) basisfamily_list.append(basis_augpcsseg3) basisfamily_list.append(basis_augpcsseg4) basisfamily_list.append(basis_pcseg0) basisfamily_list.append(basis_pcseg1) basisfamily_list.append(basis_pcseg2) basisfamily_list.append(basis_pcseg3) basisfamily_list.append(basis_pcseg4) basisfamily_list.append(basis_pcsseg0) basisfamily_list.append(basis_pcsseg1) basisfamily_list.append(basis_pcsseg2) basisfamily_list.append(basis_pcsseg3) basisfamily_list.append(basis_pcsseg4) # Minix basis_minix = BasisFamily('minix', zeta=2) basis_minix.add_jfit('def2-universal-JFIT') basis_minix.add_jkfit('def2-universal-JKFIT') basis_minix.add_rifit('def2-SVP-RI') # mixix too small for add_guess basisfamily_list.append(basis_minix) # Others basis_dz = BasisFamily('DZ') basis_dzp = BasisFamily('DZP') basis_dzvp = BasisFamily('DZVP') basis_psi3dzp = BasisFamily('psi3-DZP') basis_psi3tz2p = BasisFamily('psi3-TZ2P') basis_psi3tz2pf = BasisFamily('psi3-TZ2PF') basis_sadlejlpoldl = BasisFamily('sadlej-lpol-dl') basis_sadlejlpolds = BasisFamily('sadlej-lpol-ds') basis_sadlejlpolfl = BasisFamily('sadlej-lpol-fl') basis_sadlejlpolfs = BasisFamily('sadlej-lpol-fs') basisfamily_list.append(basis_dz) basisfamily_list.append(basis_dzp) basisfamily_list.append(basis_dzvp) basisfamily_list.append(basis_psi3dzp) basisfamily_list.append(basis_psi3tz2p) basisfamily_list.append(basis_psi3tz2pf) basisfamily_list.append(basis_sadlejlpoldl) basisfamily_list.append(basis_sadlejlpolds) basisfamily_list.append(basis_sadlejlpolfl) basisfamily_list.append(basis_sadlejlpolfs) # Here lie practical (non-validated) fitting bases for # Pople orbital basis sets basis_sto3g.add_jkfit('def2-universal-jkfit') basis_sto3g.add_rifit('def2-svp-ri') basis_sto6g.add_jkfit('def2-universal-jkfit') basis_sto6g.add_rifit('def2-svp-ri') # sto3g too small for add_guess basis_321g.add_jkfit('def2-universal-jkfit') basis_321g.add_rifit('def2-svp-ri') # 321g too small for add_guess basis_631g.add_jkfit('cc-pvdz-jkfit') basis_631g_d_.add_jkfit('cc-pvdz-jkfit') basis_631g_d_p_.add_jkfit('cc-pvdz-jkfit') basis_631gs.add_jkfit('cc-pvdz-jkfit') basis_631gss.add_jkfit('cc-pvdz-jkfit') basis_631g.add_rifit('cc-pvdz-ri') basis_631g_d_.add_rifit('cc-pvdz-ri') basis_631g_d_p_.add_rifit('cc-pvdz-ri') basis_631gs.add_rifit('cc-pvdz-ri') basis_631gss.add_rifit('cc-pvdz-ri') basis_631g.add_guess('3-21g') basis_631g_d_.add_guess('3-21g') basis_631g_d_p_.add_guess('3-21g') basis_631gs.add_guess('3-21g') basis_631gss.add_guess('3-21g') basis_631pg.add_jkfit('heavy-aug-cc-pvdz-jkfit') basis_631pg_d_.add_jkfit('heavy-aug-cc-pvdz-jkfit') basis_631pg_d_p_.add_jkfit('heavy-aug-cc-pvdz-jkfit') basis_631pgs.add_jkfit('heavy-aug-cc-pvdz-jkfit') basis_631pgss.add_jkfit('heavy-aug-cc-pvdz-jkfit') basis_631pg.add_rifit('heavy-aug-cc-pvdz-ri') basis_631pg_d_.add_rifit('heavy-aug-cc-pvdz-ri') basis_631pg_d_p_.add_rifit('heavy-aug-cc-pvdz-ri') basis_631pgs.add_rifit('heavy-aug-cc-pvdz-ri') basis_631pgss.add_rifit('heavy-aug-cc-pvdz-ri') basis_631pg.add_guess('3-21g') basis_631pg_d_.add_guess('3-21g') basis_631pg_d_p_.add_guess('3-21g') basis_631pgs.add_guess('3-21g') basis_631pgss.add_guess('3-21g') basis_631ppg.add_jkfit('aug-cc-pvdz-jkfit') basis_631ppg_d_.add_jkfit('aug-cc-pvdz-jkfit') basis_631ppg_d_p_.add_jkfit('aug-cc-pvdz-jkfit') basis_631ppgs.add_jkfit('aug-cc-pvdz-jkfit') basis_631ppgss.add_jkfit('aug-cc-pvdz-jkfit') basis_631ppg.add_rifit('aug-cc-pvdz-ri') basis_631ppg_d_.add_rifit('aug-cc-pvdz-ri') basis_631ppg_d_p_.add_rifit('aug-cc-pvdz-ri') basis_631ppgs.add_rifit('aug-cc-pvdz-ri') basis_631ppgss.add_rifit('aug-cc-pvdz-ri') basis_631ppg.add_guess('3-21g') basis_631ppg_d_.add_guess('3-21g') basis_631ppg_d_p_.add_guess('3-21g') basis_631ppgs.add_guess('3-21g') basis_631ppgss.add_guess('3-21g') basis_6311g.add_jkfit('cc-pvtz-jkfit') basis_6311g_d_.add_jkfit('cc-pvtz-jkfit') basis_6311g_d_p_.add_jkfit('cc-pvtz-jkfit') basis_6311gs.add_jkfit('cc-pvtz-jkfit') basis_6311gss.add_jkfit('cc-pvtz-jkfit') basis_6311g_2d_.add_jkfit('cc-pvtz-jkfit') basis_6311g_2d_p_.add_jkfit('cc-pvtz-jkfit') basis_6311g_2d_2p_.add_jkfit('cc-pvtz-jkfit') basis_6311g_2df_.add_jkfit('cc-pvtz-jkfit') basis_6311g_2df_p_.add_jkfit('cc-pvtz-jkfit') basis_6311g_2df_2p_.add_jkfit('cc-pvtz-jkfit') basis_6311g_2df_2pd_.add_jkfit('cc-pvtz-jkfit') basis_6311g_3df_.add_jkfit('cc-pvtz-jkfit') basis_6311g_3df_p_.add_jkfit('cc-pvtz-jkfit') basis_6311g_3df_2p_.add_jkfit('cc-pvtz-jkfit') basis_6311g_3df_2pd_.add_jkfit('cc-pvtz-jkfit') basis_6311g_3df_3pd_.add_jkfit('cc-pvtz-jkfit') basis_6311g.add_rifit('cc-pvtz-ri') basis_6311g_d_.add_rifit('cc-pvtz-ri') basis_6311g_d_p_.add_rifit('cc-pvtz-ri') basis_6311gs.add_rifit('cc-pvtz-ri') basis_6311gss.add_rifit('cc-pvtz-ri') basis_6311g_2d_.add_rifit('cc-pvtz-ri') basis_6311g_2d_p_.add_rifit('cc-pvtz-ri') basis_6311g_2d_2p_.add_rifit('cc-pvtz-ri') basis_6311g_2df_.add_rifit('cc-pvtz-ri') basis_6311g_2df_p_.add_rifit('cc-pvtz-ri') basis_6311g_2df_2p_.add_rifit('cc-pvtz-ri') basis_6311g_2df_2pd_.add_rifit('cc-pvtz-ri') basis_6311g_3df_.add_rifit('cc-pvtz-ri') basis_6311g_3df_p_.add_rifit('cc-pvtz-ri') basis_6311g_3df_2p_.add_rifit('cc-pvtz-ri') basis_6311g_3df_2pd_.add_rifit('cc-pvtz-ri') basis_6311g_3df_3pd_.add_rifit('cc-pvtz-ri') basis_6311g.add_guess('3-21g') basis_6311g_d_.add_guess('3-21g') basis_6311g_d_p_.add_guess('3-21g') basis_6311gs.add_guess('3-21g') basis_6311gss.add_guess('3-21g') basis_6311g_2d_.add_guess('3-21g') basis_6311g_2d_p_.add_guess('3-21g') basis_6311g_2d_2p_.add_guess('3-21g') basis_6311g_2df_.add_guess('3-21g') basis_6311g_2df_p_.add_guess('3-21g') basis_6311g_2df_2p_.add_guess('3-21g') basis_6311g_2df_2pd_.add_guess('3-21g') basis_6311g_3df_.add_guess('3-21g') basis_6311g_3df_p_.add_guess('3-21g') basis_6311g_3df_2p_.add_guess('3-21g') basis_6311g_3df_2pd_.add_guess('3-21g') basis_6311g_3df_3pd_.add_guess('3-21g') basis_6311pg.add_jkfit('heavy-aug-cc-pvtz-jkfit') basis_6311pg_d_.add_jkfit('heavy-aug-cc-pvtz-jkfit') basis_6311pg_d_p_.add_jkfit('heavy-aug-cc-pvtz-jkfit') basis_6311pgs.add_jkfit('heavy-aug-cc-pvtz-jkfit') basis_6311pgss.add_jkfit('heavy-aug-cc-pvtz-jkfit') basis_6311pg_2d_.add_jkfit('heavy-aug-cc-pvtz-jkfit') basis_6311pg_2d_p_.add_jkfit('heavy-aug-cc-pvtz-jkfit') basis_6311pg_2d_2p_.add_jkfit('heavy-aug-cc-pvtz-jkfit') basis_6311pg_2df_.add_jkfit('heavy-aug-cc-pvtz-jkfit') basis_6311pg_2df_p_.add_jkfit('heavy-aug-cc-pvtz-jkfit') basis_6311pg_2df_2p_.add_jkfit('heavy-aug-cc-pvtz-jkfit') basis_6311pg_2df_2pd_.add_jkfit('heavy-aug-cc-pvtz-jkfit') basis_6311pg_3df_.add_jkfit('heavy-aug-cc-pvtz-jkfit') basis_6311pg_3df_p_.add_jkfit('heavy-aug-cc-pvtz-jkfit') basis_6311pg_3df_2p_.add_jkfit('heavy-aug-cc-pvtz-jkfit') basis_6311pg_3df_2pd_.add_jkfit('heavy-aug-cc-pvtz-jkfit') basis_6311pg_3df_3pd_.add_jkfit('heavy-aug-cc-pvtz-jkfit') basis_6311pg.add_rifit('heavy-aug-cc-pvtz-ri') basis_6311pg_d_.add_rifit('heavy-aug-cc-pvtz-ri') basis_6311pg_d_p_.add_rifit('heavy-aug-cc-pvtz-ri') basis_6311pgs.add_rifit('heavy-aug-cc-pvtz-ri') basis_6311pgss.add_rifit('heavy-aug-cc-pvtz-ri') basis_6311pg_2d_.add_rifit('heavy-aug-cc-pvtz-ri') basis_6311pg_2d_p_.add_rifit('heavy-aug-cc-pvtz-ri') basis_6311pg_2d_2p_.add_rifit('heavy-aug-cc-pvtz-ri') basis_6311pg_2df_.add_rifit('heavy-aug-cc-pvtz-ri') basis_6311pg_2df_p_.add_rifit('heavy-aug-cc-pvtz-ri') basis_6311pg_2df_2p_.add_rifit('heavy-aug-cc-pvtz-ri') basis_6311pg_2df_2pd_.add_rifit('heavy-aug-cc-pvtz-ri') basis_6311pg_3df_.add_rifit('heavy-aug-cc-pvtz-ri') basis_6311pg_3df_p_.add_rifit('heavy-aug-cc-pvtz-ri') basis_6311pg_3df_2p_.add_rifit('heavy-aug-cc-pvtz-ri') basis_6311pg_3df_2pd_.add_rifit('heavy-aug-cc-pvtz-ri') basis_6311pg_3df_3pd_.add_rifit('heavy-aug-cc-pvtz-ri') basis_6311pg.add_guess('3-21g') basis_6311pg_d_.add_guess('3-21g') basis_6311pg_d_p_.add_guess('3-21g') basis_6311pgs.add_guess('3-21g') basis_6311pgss.add_guess('3-21g') basis_6311pg_2d_.add_guess('3-21g') basis_6311pg_2d_p_.add_guess('3-21g') basis_6311pg_2d_2p_.add_guess('3-21g') basis_6311pg_2df_.add_guess('3-21g') basis_6311pg_2df_p_.add_guess('3-21g') basis_6311pg_2df_2p_.add_guess('3-21g') basis_6311pg_2df_2pd_.add_guess('3-21g') basis_6311pg_3df_.add_guess('3-21g') basis_6311pg_3df_p_.add_guess('3-21g') basis_6311pg_3df_2p_.add_guess('3-21g') basis_6311pg_3df_2pd_.add_guess('3-21g') basis_6311pg_3df_3pd_.add_guess('3-21g') basis_6311ppg.add_jkfit('aug-cc-pvtz-jkfit') basis_6311ppg_d_.add_jkfit('aug-cc-pvtz-jkfit') basis_6311ppg_d_p_.add_jkfit('aug-cc-pvtz-jkfit') basis_6311ppgs.add_jkfit('aug-cc-pvtz-jkfit') basis_6311ppgss.add_jkfit('aug-cc-pvtz-jkfit') basis_6311ppg_2d_.add_jkfit('aug-cc-pvtz-jkfit') basis_6311ppg_2d_p_.add_jkfit('aug-cc-pvtz-jkfit') basis_6311ppg_2d_2p_.add_jkfit('aug-cc-pvtz-jkfit') basis_6311ppg_2df_.add_jkfit('aug-cc-pvtz-jkfit') basis_6311ppg_2df_p_.add_jkfit('aug-cc-pvtz-jkfit') basis_6311ppg_2df_2p_.add_jkfit('aug-cc-pvtz-jkfit') basis_6311ppg_2df_2pd_.add_jkfit('aug-cc-pvtz-jkfit') basis_6311ppg_3df_.add_jkfit('aug-cc-pvtz-jkfit') basis_6311ppg_3df_p_.add_jkfit('aug-cc-pvtz-jkfit') basis_6311ppg_3df_2p_.add_jkfit('aug-cc-pvtz-jkfit') basis_6311ppg_3df_2pd_.add_jkfit('aug-cc-pvtz-jkfit') basis_6311ppg_3df_3pd_.add_jkfit('aug-cc-pvtz-jkfit') basis_6311ppg.add_rifit('aug-cc-pvtz-ri') basis_6311ppg_d_.add_rifit('aug-cc-pvtz-ri') basis_6311ppg_d_p_.add_rifit('aug-cc-pvtz-ri') basis_6311ppgs.add_rifit('aug-cc-pvtz-ri') basis_6311ppgss.add_rifit('aug-cc-pvtz-ri') basis_6311ppg_2d_.add_rifit('aug-cc-pvtz-ri') basis_6311ppg_2d_p_.add_rifit('aug-cc-pvtz-ri') basis_6311ppg_2d_2p_.add_rifit('aug-cc-pvtz-ri') basis_6311ppg_2df_.add_rifit('aug-cc-pvtz-ri') basis_6311ppg_2df_p_.add_rifit('aug-cc-pvtz-ri') basis_6311ppg_2df_2p_.add_rifit('aug-cc-pvtz-ri') basis_6311ppg_2df_2pd_.add_rifit('aug-cc-pvtz-ri') basis_6311ppg_3df_.add_rifit('aug-cc-pvtz-ri') basis_6311ppg_3df_p_.add_rifit('aug-cc-pvtz-ri') basis_6311ppg_3df_2p_.add_rifit('aug-cc-pvtz-ri') basis_6311ppg_3df_2pd_.add_rifit('aug-cc-pvtz-ri') basis_6311ppg_3df_3pd_.add_rifit('aug-cc-pvtz-ri') basis_6311ppg.add_guess('3-21g') basis_6311ppg_d_.add_guess('3-21g') basis_6311ppg_d_p_.add_guess('3-21g') basis_6311ppgs.add_guess('3-21g') basis_6311ppgss.add_guess('3-21g') basis_6311ppg_2d_.add_guess('3-21g') basis_6311ppg_2d_p_.add_guess('3-21g') basis_6311ppg_2d_2p_.add_guess('3-21g') basis_6311ppg_2df_.add_guess('3-21g') basis_6311ppg_2df_p_.add_guess('3-21g') basis_6311ppg_2df_2p_.add_guess('3-21g') basis_6311ppg_2df_2pd_.add_guess('3-21g') basis_6311ppg_3df_.add_guess('3-21g') basis_6311ppg_3df_p_.add_guess('3-21g') basis_6311ppg_3df_2p_.add_guess('3-21g') basis_6311ppg_3df_2pd_.add_guess('3-21g') basis_6311ppg_3df_3pd_.add_guess('3-21g') # Petersson's nZaPa-NR basis sets basis_2zapa_nr = BasisFamily('2zapa-nr',zeta=2) basis_3zapa_nr = BasisFamily('3zapa-nr',zeta=3) basis_4zapa_nr = BasisFamily('4zapa-nr',zeta=4) basis_5zapa_nr = BasisFamily('5zapa-nr',zeta=5) basis_6zapa_nr = BasisFamily('6zapa-nr',zeta=6) basis_7zapa_nr = BasisFamily('7zapa-nr',zeta=7) # fitting sets for nZaPa-NR # Dunnings zeta+1 to be safe, tested on water dimer # the full aug-JKFIT is possibly too much #--------SCF-JKFIT error for nZaPa-NR # results for GS energies of water dimer: # delta_jk = E_conv - E_DFJK # ZaPa zeta 2 : delta_jk = -0.000009 # ZaPa zeta 3 : delta_jk = -0.000002 # ZaPa zeta 4 : delta_jk = -0.000002 # ZaPa zeta 5 : delta_jk = -0.000002 # ZaPa zeta 6 : delta_jk = 0.000000 # ZaPa zeta 7 : delta_jk = 0.000000 basis_2zapa_nr.add_jkfit('aug-cc-pvtz-jkfit') basis_3zapa_nr.add_jkfit('aug-cc-pvqz-jkfit') basis_4zapa_nr.add_jkfit('aug-cc-pv5z-jkfit') basis_5zapa_nr.add_jkfit('aug-cc-pv5z-jkfit') basis_6zapa_nr.add_jkfit('aug-cc-pv6z-ri') basis_7zapa_nr.add_jkfit('aug-cc-pv6z-ri') basis_2zapa_nr.add_rifit('aug-cc-pvtz-ri') basis_3zapa_nr.add_rifit('aug-cc-pvqz-ri') basis_4zapa_nr.add_rifit('aug-cc-pv5z-ri') basis_5zapa_nr.add_rifit('aug-cc-pv6z-ri') basis_6zapa_nr.add_rifit('aug-cc-pv6z-ri') basis_7zapa_nr.add_rifit('aug-cc-pv6z-ri') basis_2zapa_nr.add_guess('pcseg-0') basis_3zapa_nr.add_guess('pcseg-0') basis_4zapa_nr.add_guess('pcseg-0') basis_5zapa_nr.add_guess('pcseg-0') basis_6zapa_nr.add_guess('pcseg-0') basis_7zapa_nr.add_guess('pcseg-0') basisfamily_list.append(basis_2zapa_nr) basisfamily_list.append(basis_3zapa_nr) basisfamily_list.append(basis_4zapa_nr) basisfamily_list.append(basis_5zapa_nr) basisfamily_list.append(basis_6zapa_nr) basisfamily_list.append(basis_7zapa_nr) # F12 basis sets basis_cc_pvdz_f12 = BasisFamily('cc-pvdz-f12',zeta=2) basis_cc_pvtz_f12 = BasisFamily('cc-pvtz-f12',zeta=3) basis_cc_pvqz_f12 = BasisFamily('cc-pvqz-f12',zeta=4) # basis_cc_pv5z_f12 = BasisFamily('cc-pV5Z-F12') # ORCA manual suggests for F12 basis sets Dunning's zeta+1 basis_cc_pvdz_f12.add_jkfit('cc-pvtz-jkfit') basis_cc_pvtz_f12.add_jkfit('cc-pvqz-jkfit') basis_cc_pvqz_f12.add_jkfit('cc-pv5z-jkfit') basis_cc_pvdz_f12.add_rifit('cc-pvtz-ri') basis_cc_pvtz_f12.add_rifit('cc-pvqz-ri') basis_cc_pvqz_f12.add_rifit('cc-pv5z-ri') basis_cc_pvdz_f12.add_guess('pcseg-0') basis_cc_pvtz_f12.add_guess('pcseg-0') basis_cc_pvqz_f12.add_guess('pcseg-0') basisfamily_list.append(basis_cc_pvqz_f12) basisfamily_list.append(basis_cc_pvtz_f12) basisfamily_list.append(basis_cc_pvqz_f12) # basisfamily_list.append(basis_cc_pv5z_f12) # Point fix for dzvp basis set ; default def2-qzvpp-jkfit # was not giving correct result for iodine-containing molecules. basis_dzvp.add_jfit('dgauss-dzvp-autoabs') basis_dzvp.add_jkfit('dgauss-dzvp-mix') basis_dzvp.add_rifit('dgauss-dzvp-autoaux')
psi4/psi4
psi4/driver/qcdb/basislistother.py
Python
lgpl-3.0
32,066
[ "ORCA", "Psi4" ]
77929127012ab222a7499557bbdb52c85cb14c95060cf6facc0744ac198bc5d8
from __future__ import print_function, division from os.path import join import tempfile import shutil from io import BytesIO try: from subprocess import STDOUT, CalledProcessError from sympy.core.compatibility import check_output except ImportError: pass from sympy.utilities.exceptions import SymPyDeprecationWarning from sympy.utilities.misc import find_executable from .latex import latex from sympy.utilities.decorator import doctest_depends_on @doctest_depends_on(exe=('latex', 'dvipng'), modules=('pyglet',), disable_viewers=('evince', 'gimp', 'superior-dvi-viewer')) def preview(expr, output='png', viewer=None, euler=True, packages=(), filename=None, outputbuffer=None, preamble=None, dvioptions=None, outputTexFile=None, **latex_settings): r""" View expression or LaTeX markup in PNG, DVI, PostScript or PDF form. If the expr argument is an expression, it will be exported to LaTeX and then compiled using the available TeX distribution. The first argument, 'expr', may also be a LaTeX string. The function will then run the appropriate viewer for the given output format or use the user defined one. By default png output is generated. By default pretty Euler fonts are used for typesetting (they were used to typeset the well known "Concrete Mathematics" book). For that to work, you need the 'eulervm.sty' LaTeX style (in Debian/Ubuntu, install the texlive-fonts-extra package). If you prefer default AMS fonts or your system lacks 'eulervm' LaTeX package then unset the 'euler' keyword argument. To use viewer auto-detection, lets say for 'png' output, issue >>> from sympy import symbols, preview, Symbol >>> x, y = symbols("x,y") >>> preview(x + y, output='png') This will choose 'pyglet' by default. To select a different one, do >>> preview(x + y, output='png', viewer='gimp') The 'png' format is considered special. For all other formats the rules are slightly different. As an example we will take 'dvi' output format. If you would run >>> preview(x + y, output='dvi') then 'view' will look for available 'dvi' viewers on your system (predefined in the function, so it will try evince, first, then kdvi and xdvi). If nothing is found you will need to set the viewer explicitly. >>> preview(x + y, output='dvi', viewer='superior-dvi-viewer') This will skip auto-detection and will run user specified 'superior-dvi-viewer'. If 'view' fails to find it on your system it will gracefully raise an exception. You may also enter 'file' for the viewer argument. Doing so will cause this function to return a file object in read-only mode, if 'filename' is unset. However, if it was set, then 'preview' writes the genereted file to this filename instead. There is also support for writing to a BytesIO like object, which needs to be passed to the 'outputbuffer' argument. >>> from io import BytesIO >>> obj = BytesIO() >>> preview(x + y, output='png', viewer='BytesIO', ... outputbuffer=obj) The LaTeX preamble can be customized by setting the 'preamble' keyword argument. This can be used, e.g., to set a different font size, use a custom documentclass or import certain set of LaTeX packages. >>> preamble = "\\documentclass[10pt]{article}\n" \ ... "\\usepackage{amsmath,amsfonts}\\begin{document}" >>> preview(x + y, output='png', preamble=preamble) If the value of 'output' is different from 'dvi' then command line options can be set ('dvioptions' argument) for the execution of the 'dvi'+output conversion tool. These options have to be in the form of a list of strings (see subprocess.Popen). Additional keyword args will be passed to the latex call, e.g., the symbol_names flag. >>> phidd = Symbol('phidd') >>> preview(phidd, symbol_names={phidd:r'\ddot{\varphi}'}) For post-processing the generated TeX File can be written to a file by passing the desired filename to the 'outputTexFile' keyword argument. To write the TeX code to a file named "sample.tex" and run the default png viewer to display the resulting bitmap, do >>> preview(x + y, outputTexFile="sample.tex") """ special = [ 'pyglet' ] if viewer is None: if output == "png": viewer = "pyglet" else: # sorted in order from most pretty to most ugly # very discussable, but indeed 'gv' looks awful :) # TODO add candidates for windows to list candidates = { "dvi": [ "evince", "okular", "kdvi", "xdvi" ], "ps": [ "evince", "okular", "gsview", "gv" ], "pdf": [ "evince", "okular", "kpdf", "acroread", "xpdf", "gv" ], } try: for candidate in candidates[output]: path = find_executable(candidate) if path is not None: viewer = path break else: raise SystemError( "No viewers found for '%s' output format." % output) except KeyError: raise SystemError("Invalid output format: %s" % output) else: if viewer == "file": if filename is None: SymPyDeprecationWarning(feature="Using viewer=\"file\" without a " "specified filename", deprecated_since_version="0.7.3", useinstead="viewer=\"file\" and filename=\"desiredname\"", issue=3919).warn() elif viewer == "StringIO": SymPyDeprecationWarning(feature="The preview() viewer StringIO", useinstead="BytesIO", deprecated_since_version="0.7.4", issue=3984).warn() viewer = "BytesIO" if outputbuffer is None: raise ValueError("outputbuffer has to be a BytesIO " "compatible object if viewer=\"StringIO\"") elif viewer == "BytesIO": if outputbuffer is None: raise ValueError("outputbuffer has to be a BytesIO " "compatible object if viewer=\"BytesIO\"") elif viewer not in special and not find_executable(viewer): raise SystemError("Unrecognized viewer: %s" % viewer) if preamble is None: actual_packages = packages + ("amsmath", "amsfonts") if euler: actual_packages += ("euler",) package_includes = "\n" + "\n".join(["\\usepackage{%s}" % p for p in actual_packages]) preamble = r"""\documentclass[12pt]{article} \pagestyle{empty} %s \begin{document} """ % (package_includes) else: if len(packages) > 0: raise ValueError("The \"packages\" keyword must not be set if a " "custom LaTeX preamble was specified") latex_main = preamble + '\n%s\n\n' + r"\end{document}" if isinstance(expr, str): latex_string = expr else: latex_string = latex(expr, mode='inline', **latex_settings) try: workdir = tempfile.mkdtemp() with open(join(workdir, 'texput.tex'), 'w') as fh: fh.write(latex_main % latex_string) if outputTexFile is not None: shutil.copyfile(join(workdir, 'texput.tex'), outputTexFile) if not find_executable('latex'): raise RuntimeError("latex program is not installed") try: check_output(['latex', '-halt-on-error', '-interaction=nonstopmode', 'texput.tex'], cwd=workdir, stderr=STDOUT) except CalledProcessError as e: raise RuntimeError( "'latex' exited abnormally with the following output:\n%s" % e.output) if output != "dvi": defaultoptions = { "ps": [], "pdf": [], "png": ["-T", "tight", "-z", "9", "--truecolor"] } commandend = { "ps": ["-o", "texput.ps", "texput.dvi"], "pdf": ["texput.dvi", "texput.pdf"], "png": ["-o", "texput.png", "texput.dvi"] } cmd = ["dvi" + output] if not find_executable(cmd[0]): raise RuntimeError("%s is not installed" % cmd[0]) try: if dvioptions is not None: cmd.extend(dvioptions) else: cmd.extend(defaultoptions[output]) cmd.extend(commandend[output]) except KeyError: raise SystemError("Invalid output format: %s" % output) try: check_output(cmd, cwd=workdir, stderr=STDOUT) except CalledProcessError as e: raise RuntimeError( "'%s' exited abnormally with the following output:\n%s" % (' '.join(cmd), e.output)) src = "texput.%s" % (output) if viewer == "file": if filename is None: buffer = BytesIO() with open(join(workdir, src), 'rb') as fh: buffer.write(fh.read()) return buffer else: shutil.move(join(workdir,src), filename) elif viewer == "BytesIO": with open(join(workdir, src), 'rb') as fh: outputbuffer.write(fh.read()) elif viewer == "pyglet": try: from pyglet import window, image, gl from pyglet.window import key except ImportError: raise ImportError("pyglet is required for preview.\n visit http://www.pyglet.org/") if output == "png": from pyglet.image.codecs.png import PNGImageDecoder img = image.load(join(workdir, src), decoder=PNGImageDecoder()) else: raise SystemError("pyglet preview works only for 'png' files.") offset = 25 win = window.Window( width=img.width + 2*offset, height=img.height + 2*offset, caption="sympy", resizable=False ) win.set_vsync(False) try: def on_close(): win.has_exit = True win.on_close = on_close def on_key_press(symbol, modifiers): if symbol in [key.Q, key.ESCAPE]: on_close() win.on_key_press = on_key_press def on_expose(): gl.glClearColor(1.0, 1.0, 1.0, 1.0) gl.glClear(gl.GL_COLOR_BUFFER_BIT) img.blit( (win.width - img.width) / 2, (win.height - img.height) / 2 ) win.on_expose = on_expose while not win.has_exit: win.dispatch_events() win.flip() except KeyboardInterrupt: pass win.close() else: try: check_output([viewer, src], cwd=workdir, stderr=STDOUT) except CalledProcessError as e: raise RuntimeError( "'%s %s' exited abnormally with the following output:\n%s" % (viewer, src, e.output)) finally: try: shutil.rmtree(workdir) # delete directory except OSError as e: if e.errno != 2: # code 2 - no such file or directory raise
hrashk/sympy
sympy/printing/preview.py
Python
bsd-3-clause
11,827
[ "VisIt" ]
56c63caefdb6b8c0cf7f2c7107b9ff8345717068d170c03f37339d94754f8d3e
# -*- Mode: python; tab-width: 4; indent-tabs-mode:nil; coding: utf-8 -*- # vim: tabstop=4 expandtab shiftwidth=4 softtabstop=4 # # MDAnalysis --- http://www.mdanalysis.org # Copyright (c) 2006-2016 The MDAnalysis Development Team and contributors # (see the file AUTHORS for the full list of names) # # Released under the GNU Public Licence, v2 or any higher version # # Please cite your use of MDAnalysis in published work: # # R. J. Gowers, M. Linke, J. Barnoud, T. J. E. Reddy, M. N. Melo, S. L. Seyler, # D. L. Dotson, J. Domanski, S. Buchoux, I. M. Kenney, and O. Beckstein. # MDAnalysis: A Python package for the rapid analysis of molecular dynamics # simulations. In S. Benthall and S. Rostrup editors, Proceedings of the 15th # Python in Science Conference, pages 102-109, Austin, TX, 2016. SciPy. # # N. Michaud-Agrawal, E. J. Denning, T. B. Woolf, and O. Beckstein. # MDAnalysis: A Toolkit for the Analysis of Molecular Dynamics Simulations. # J. Comput. Chem. 32 (2011), 2319--2327, doi:10.1002/jcc.21787 # """ GAMESS Topology Parser ====================== .. versionadded:: 0.9.1 Reads a GAMESS_ output file (also Firefly_ and `GAMESS-UK`_) and pulls element information from it. Symmetrical assembly is read (not symmetry element!). Atom names are read from the GAMESS section. Any information about residues or segments will not be populated. .. _GAMESS: http://www.msg.ameslab.gov/gamess/ .. _Firefly: http://classic.chem.msu.su/gran/gamess/index.html .. _`GAMESS-UK`: http://www.cfs.dl.ac.uk/ Classes ------- .. autoclass:: GMSParser :members: :inherited-members: """ from __future__ import absolute_import import re import numpy as np from . import guessers from ..lib.util import openany from .base import TopologyReaderBase from ..core.topology import Topology from ..core.topologyattrs import ( Atomids, Atomnames, Atomtypes, Masses, Resids, Resnums, Segids, AtomAttr, ) class AtomicCharges(AtomAttr): attrname = 'atomiccharges' singular = 'atomiccharge' per_object = 'atom' class GMSParser(TopologyReaderBase): """GAMESS_ topology parser. Creates the following Attributes: - names - atomic charges Guesses: - types - masses .. versionadded:: 0.9.1 """ format = 'GMS' def parse(self): """Read list of atoms from a GAMESS file.""" names = [] at_charges = [] with openany(self.filename, 'rt') as inf: while True: line = inf.readline() if not line: raise EOFError if re.match(r'^\s+ATOM\s+ATOMIC\s+COORDINATES\s*\(BOHR\).*',\ line): break line = inf.readline() # skip while True: line = inf.readline() _m = re.match(\ r'^\s*([A-Za-z_][A-Za-z_0-9]*)\s+([0-9]+\.[0-9]+)\s+(\-?[0-9]+\.[0-9]+)\s+(\-?[0-9]+\.[0-9]+)\s+(\-?[0-9]+\.[0-9]+).*', line) if _m is None: break name = _m.group(1) at_charge = int(float(_m.group(2))) names.append(name) at_charges.append(at_charge) #TODO: may be use coordinates info from _m.group(3-5) ?? atomtypes = guessers.guess_types(names) masses = guessers.guess_masses(atomtypes) n_atoms = len(names) attrs = [ Atomids(np.arange(n_atoms) + 1), Atomnames(np.array(names, dtype=object)), AtomicCharges(np.array(at_charges, dtype=np.int32)), Atomtypes(atomtypes, guessed=True), Masses(masses, guessed=True), Resids(np.array([1])), Resnums(np.array([1])), Segids(np.array(['SYSTEM'], dtype=object)), ] top = Topology(n_atoms, 1, 1, attrs=attrs) return top
alejob/mdanalysis
package/MDAnalysis/topology/GMSParser.py
Python
gpl-2.0
3,946
[ "GAMESS", "MDAnalysis" ]
2610f9166f9dde3a5eb6432f706caff3d886c7894b49c9850df672273da15423
# ------------------------------------------------------------------------- # Name: Waterdemand module # Purpose: # # Author: PB # # Created: 15/07/2016 # Copyright: (c) PB 2016 # ------------------------------------------------------------------------- import numpy as np from cwatm.management_modules import globals from cwatm.management_modules.replace_pcr import npareatotal, npareamaximum from cwatm.management_modules.data_handling import returnBool, binding, cbinding, loadmap, divideValues, checkOption, npareaaverage, readnetcdf2 from cwatm.hydrological_modules.water_demand.domestic import waterdemand_domestic from cwatm.hydrological_modules.water_demand.industry import waterdemand_industry from cwatm.hydrological_modules.water_demand.livestock import waterdemand_livestock from cwatm.hydrological_modules.water_demand.irrigation import waterdemand_irrigation from cwatm.hydrological_modules.water_demand.environmental_need import waterdemand_environmental_need #PB1507 from cwatm.management_modules.data_handling import * class water_demand: """ WATERDEMAND calculating water demand - Industrial, domenstic based on precalculated maps Agricultural water demand based on water need by plants **Global variables** ==================== ================================================================================ ========= Variable [self.var] Description Unit ==================== ================================================================================ ========= readAvlStorGroundwat same as storGroundwater but equal to 0 when inferior to a treshold m nonFossilGroundwater groundwater abstraction which is sustainable and not using fossil resources m waterbalance_module waterBodyID lakes/reservoirs map with a single ID for each lake/reservoir -- compress_LR boolean map as mask map for compressing lake/reservoir -- decompress_LR boolean map as mask map for decompressing lake/reservoir -- MtoM3C conversion factor from m to m3 (compressed map) -- MtoM3 Coefficient to change units -- lakeVolumeM3C compressed map of lake volume m3 lakeStorageC m3 reservoirStorageM3C lakeResStorageC lakeResStorage waterBodyTypCTemp InvDtSec cellArea Cell area [m²] of each simulated mesh smalllakeVolumeM3 smalllakeStorage act_SurfaceWaterAbst fracVegCover Fraction of area covered by the corresponding landcover type addtoevapotrans M3toM Coefficient to change units -- act_irrConsumption actual irrgation water consumption m channelStorage act_bigLakeResAbst act_smallLakeResAbst returnFlow modflowPumpingM modflowTopography modflowDepth2 leakageC domesticDemand pot_domesticConsumpt dom_efficiency demand_unit envFlow industryDemand pot_industryConsumpt ind_efficiency unmetDemandPaddy unmetDemandNonpaddy unmetDemand efficiencyPaddy efficiencyNonpaddy returnfractionIrr irrDemand totalIrrDemand livestockDemand pot_livestockConsump liv_efficiency allocSegments swAbstractionFractio modflowPumping leakage pumping nonIrrReturnFlowFrac nonIrruse act_indDemand act_domDemand act_livDemand nonIrrDemand totalWaterDemand act_irrWithdrawal act_nonIrrWithdrawal act_totalWaterWithdr act_indConsumption act_domConsumption act_livConsumption act_nonIrrConsumptio act_totalIrrConsumpt act_totalWaterConsum returnflowIrr pot_nonIrrConsumptio readAvlChannelStorag reservoir_command_ar leakageC_daily leakageC_daily_segme pot_GroundwaterAbstr renewableAvlWater act_irrNonpaddyWithd act_irrPaddyWithdraw act_irrPaddyDemand act_irrNonpaddyDeman act_indWithdrawal act_domWithdrawal act_livWithdrawal waterDemandLost ==================== ================================================================================ ========= **Functions** """ def __init__(self, model): self.var = model.var self.model = model self.domestic = waterdemand_domestic(model) self.industry = waterdemand_industry(model) self.livestock = waterdemand_livestock(model) self.irrigation = waterdemand_irrigation(model) self.environmental_need = waterdemand_environmental_need(model) def initial(self): """ Initial part of the water demand module Set the water allocation """ if checkOption('includeWaterDemand'): self.domestic.initial() self.industry.initial() self.livestock.initial() self.irrigation.initial() self.environmental_need.initial() # if waterdemand is fixed: self.var.waterdemandFixed = False if "waterdemandFixed" in binding: if returnBool('waterdemandFixed'): self.var.waterdemandFixed = True self.var.waterdemandFixedYear = loadmap('waterdemandFixedYear') #if 'usingAllocSegments' in binding: # if checkOption('usingAllocSegments'): # self.var.allocSegments = loadmap('allocSegments').astype(np.int) # self.var.segmentArea = np.where(self.var.allocSegments > 0, npareatotal(self.var.cellArea, self.var.allocSegments), self.var.cellArea) # ------------------------------------------- # partitioningGroundSurfaceAbstraction # partitioning abstraction sources: groundwater and surface water # partitioning based on local average baseflow (m3/s) and upstream average discharge (m3/s) # estimates of fractions of groundwater and surface water abstractions swAbstractionFraction = loadmap('swAbstractionFrac') if swAbstractionFraction < 0: averageBaseflowInput = loadmap('averageBaseflow') averageDischargeInput = loadmap('averageDischarge') # convert baseflow from m to m3/s if returnBool('baseflowInM'): averageBaseflowInput = averageBaseflowInput * self.var.cellArea * self.var.InvDtSec if checkOption('usingAllocSegments'): averageBaseflowInput = np.where(self.var.allocSegments > 0, npareaaverage(averageBaseflowInput, self.var.allocSegments), averageBaseflowInput) # averageUpstreamInput = np.where(self.var.allocSegments > 0, npareamaximum(averageDischargeInput, self.var.allocSegments), averageDischargeInput) swAbstractionFraction = np.maximum(0.0, np.minimum(1.0, averageDischargeInput / np.maximum(1e-20, averageDischargeInput + averageBaseflowInput))) swAbstractionFraction = np.minimum(1.0, np.maximum(0.0, swAbstractionFraction)) self.var.swAbstractionFraction = globals.inZero.copy() for No in range(4): self.var.swAbstractionFraction += self.var.fracVegCover[No] * swAbstractionFraction for No in range(4, 6): self.var.swAbstractionFraction += self.var.fracVegCover[No] self.var.demand_unit = True if "demand_unit" in binding: self.var.demand_unit = returnBool('demand_unit') # allocation zone # regular grid inside the 2d array # inner grid size inner = 1 if "allocation_area" in binding: inner = int(loadmap('allocation_area')) latldd, lonldd, cell, invcellldd, rows, cols = readCoord(cbinding('Ldd')) try: filename = os.path.splitext(cbinding('Ldd'))[0] + '.nc' cut0, cut1, cut2, cut3 = mapattrNetCDF(filename, check=False) except: cut0, cut1, cut2, cut3 = mapattrTiff(gdal.Open(filename, GA_ReadOnly)) arr = np.kron(np.arange(rows // inner * cols // inner).reshape((rows // inner, cols // inner)), np.ones((inner, inner))) arr = arr[cut2:cut3, cut0:cut1].astype(int) self.var.allocation_zone = compressArray(arr) self.var.modflowPumping = globals.inZero.copy() self.var.modflowPumpingM = globals.inZero.copy() self.var.modflowDepth2 = 0 self.var.modflowTopography = 0 self.var.leakage = globals.inZero.copy() self.var.pumping = globals.inZero.copy() else: # no water demand self.var.nonIrrReturnFlowFraction = globals.inZero.copy() self.var.nonFossilGroundwaterAbs = globals.inZero.copy() self.var.nonIrruse = globals.inZero.copy() self.var.act_indDemand = globals.inZero.copy() self.var.act_domDemand = globals.inZero.copy() self.var.act_livDemand = globals.inZero.copy() self.var.nonIrrDemand = globals.inZero.copy() self.var.totalIrrDemand = globals.inZero.copy() self.var.totalWaterDemand = globals.inZero.copy() self.var.act_irrWithdrawal = globals.inZero.copy() self.var.act_nonIrrWithdrawal = globals.inZero.copy() self.var.act_totalWaterWithdrawal = globals.inZero.copy() self.var.act_indConsumption = globals.inZero.copy() self.var.act_domConsumption = globals.inZero.copy() self.var.act_livConsumption = globals.inZero.copy() self.var.act_nonIrrConsumption = globals.inZero.copy() self.var.act_totalIrrConsumption = globals.inZero.copy() self.var.act_totalWaterConsumption = globals.inZero.copy() self.var.unmetDemand = globals.inZero.copy() self.var.addtoevapotrans = globals.inZero.copy() self.var.returnflowIrr = globals.inZero.copy() self.var.returnFlow = globals.inZero.copy() self.var.unmetDemandPaddy = globals.inZero.copy() self.var.unmetDemandNonpaddy = globals.inZero.copy() self.var.ind_efficiency = 1. self.var.dom_efficiency = 1. self.var.liv_efficiency = 1 self.var.modflowPumping = 0 self.var.modflowDepth2 = 0 self.var.modflowTopography = 0 self.var.act_bigLakeResAbst = globals.inZero.copy() self.var.leakage = globals.inZero.copy() self.var.pumping = globals.inZero.copy() self.var.unmet_lost = 0 def dynamic(self): """ Dynamic part of the water demand module * calculate the fraction of water from surface water vs. groundwater * get non-Irrigation water demand and its return flow fraction """ if checkOption('includeWaterDemand'): # for debugging of a specific date #if (globals.dateVar['curr'] >= 137): # ii =1 # ---------------------------------------------------- # WATER DEMAND # Fix year of water demand on predefined year wd_date = globals.dateVar['currDate'] if self.var.waterdemandFixed: wd_date = wd_date.replace(day = 1) wd_date = wd_date.replace(year = self.var.waterdemandFixedYear) self.domestic.dynamic(wd_date) self.industry.dynamic(wd_date) self.livestock.dynamic(wd_date) self.irrigation.dynamic() self.environmental_need.dynamic() if globals.dateVar['newStart'] or globals.dateVar['newMonth']: # total (potential) non irrigation water demand self.var.nonIrrDemand = self.var.domesticDemand + self.var.industryDemand + self.var.livestockDemand self.var.pot_nonIrrConsumption = np.minimum(self.var.nonIrrDemand, self.var.pot_domesticConsumption + self.var.pot_industryConsumption + self.var.pot_livestockConsumption) # fraction of return flow from domestic and industrial water demand self.var.nonIrrReturnFlowFraction = divideValues((self.var.nonIrrDemand - self.var.pot_nonIrrConsumption), self.var.nonIrrDemand) # non-irrg fracs in nonIrrDemand frac_industry = divideValues(self.var.industryDemand, self.var.nonIrrDemand) frac_domestic = divideValues(self.var.domesticDemand, self.var.nonIrrDemand) frac_livestock = divideValues(self.var.livestockDemand, self.var.nonIrrDemand) # Sum up water demand # totalDemand [m]: total maximum (potential) water demand: irrigation and non irrigation totalDemand = self.var.nonIrrDemand + self.var.totalIrrDemand # in [m] # ---------------------------------------------------- # WATER AVAILABILITY # to avoid small values and to avoid surface water abstractions from dry channels (>= 0.01mm) #self.var.readAvlChannelStorageM = np.where(self.var.channelStorage < (0.0005 * self.var.cellArea), 0., self.var.channelStorage) # in [m3] # conversion m3 -> m # minus environmental flow self.var.readAvlChannelStorageM = np.maximum(0.,self.var.channelStorage * self.var.M3toM - self.var.envFlow) # in [m] #------------------------------------- # WATER DEMAND vs. WATER AVAILABILITY #------------------------------------- # surface water abstraction that can be extracted to fulfill totalDemand # - based on ChannelStorage and swAbstractionFraction * totalDemand # sum up potential surface water abstraction (no groundwater abstraction under water and sealed area) pot_SurfaceAbstract = totalDemand * self.var.swAbstractionFraction # only local surface water abstraction is allowed (network is only within a cell) self.var.act_SurfaceWaterAbstract = np.minimum(self.var.readAvlChannelStorageM, pot_SurfaceAbstract) self.var.act_channelAbst = self.var.act_SurfaceWaterAbstract.copy() # if surface water is not sufficient it is taken from groundwater if checkOption('includeWaterBodies'): # water that is still needed from surface water remainNeed = np.maximum(pot_SurfaceAbstract - self.var.act_SurfaceWaterAbstract, 0) # first from big Lakes and reservoirs, big lakes cover several gridcells # collect all water demand from lake pixels of the same id remainNeedBig = npareatotal(remainNeed, self.var.waterBodyID) # not only the lakes and reservoirs but the command areas around water bodies e.g. here a buffer remainNeedBig = npareatotal(remainNeed, self.var.waterBodyBuffer) remainNeedBigC = np.compress(self.var.compress_LR, remainNeedBig) # Storage of a big lake lakeResStorageC = np.where(self.var.waterBodyTypCTemp == 0, 0., np.where(self.var.waterBodyTypCTemp == 1, self.var.lakeStorageC, self.var.reservoirStorageM3C)) / self.var.MtoM3C minlake = np.maximum(0., 0.98*lakeResStorageC) #reasonable but arbitrary limit act_bigLakeAbstC = np.minimum(minlake , remainNeedBigC) # substract from both, because it is sorted by self.var.waterBodyTypCTemp self.var.lakeStorageC = self.var.lakeStorageC - act_bigLakeAbstC * self.var.MtoM3C self.var.lakeVolumeM3C = self.var.lakeVolumeM3C - act_bigLakeAbstC * self.var.MtoM3C self.var.reservoirStorageM3C = self.var.reservoirStorageM3C - act_bigLakeAbstC * self.var.MtoM3C # and from the combined one for waterbalance issues self.var.lakeResStorageC = self.var.lakeResStorageC - act_bigLakeAbstC * self.var.MtoM3C self.var.lakeResStorage = globals.inZero.copy() np.put(self.var.lakeResStorage, self.var.decompress_LR, self.var.lakeResStorageC) bigLakesFactorC = divideValues(act_bigLakeAbstC , remainNeedBigC) # and back to the big array bigLakesFactor = globals.inZero.copy() np.put(bigLakesFactor, self.var.decompress_LR, bigLakesFactorC) #bigLakesFactorAllaroundlake = npareamaximum(bigLakesFactor, self.var.waterBodyID) bigLakesFactorAllaroundlake = npareamaximum(bigLakesFactor, self.var.waterBodyBuffer) # abstraction from big lakes is partioned to the users around the lake self.var.act_bigLakeResAbst = remainNeed * bigLakesFactorAllaroundlake # remaining need is used from small lakes remainNeed1 = remainNeed * (1 - bigLakesFactorAllaroundlake) #minlake = np.maximum(0.,self.var.smalllakeStorage - self.var.minsmalllakeStorage) * self.var.M3toM if returnBool('useSmallLakes'): minlake = np.maximum(0.,0.98 * self.var.smalllakeStorage) * self.var.M3toM self.var.act_smallLakeResAbst = np.minimum(minlake, remainNeed1) #self.var.actLakeResAbst = np.minimum(0.5 * self.var.smalllakeStorageM3 * self.var.M3toM, remainNeed) # act_smallLakesres is substracted from small lakes storage self.var.smalllakeVolumeM3 = self.var.smalllakeVolumeM3 - self.var.act_smallLakeResAbst * self.var.MtoM3 self.var.smalllakeStorage = self.var.smalllakeStorage - self.var.act_smallLakeResAbst * self.var.MtoM3 else: self.var.act_smallLakeResAbst = 0 # available surface water is from river network + large/small lake & reservoirs self.var.act_SurfaceWaterAbstract = self.var.act_SurfaceWaterAbstract + self.var.act_bigLakeResAbst + self.var.act_smallLakeResAbst # check for rounding issues self.var.act_SurfaceWaterAbstract = np.minimum(totalDemand,self.var.act_SurfaceWaterAbstract) # remaining is taken from groundwater if possible remainNeed2 = pot_SurfaceAbstract - self.var.act_SurfaceWaterAbstract if 'using_reservoir_command_areas' in binding: if checkOption('using_reservoir_command_areas'): # checkOption('usingAllocSegments2'): # ABOUT # # The command area of a reservoir is the area that can receive water from this reservoir, through canals or other means. # Performed above, each cell has attempted to satisfy its demands with local water using in-cell channel, lake, and reservoir storage. # The remaining demand within each command area is totaled and requested from the associated reservoir. # The reservoir offers this water up to a daily maximum relating to the available storage in the reservoir, defined in the Reservoir_releases_input_file. # # SETTINGS FILE AND INPUTS # -Activating # In the OPTIONS section towards the beginning of the settings file, add/set # using_reservoir_command_areas = True # - Command areas raster map # Anywhere after the OPTIONS section (in WATERDEMAND, for example), add/set reservoir_command_areas to a path holding... # information about the command areas. This Command areas raster map should assign the same positive integer coding to each cell within the same segment. # All other cells must Nan values, or values <= 0. # -Optional inputs # # Anywhere after the OPTIONS section, add/set Reservoir_releases_input_file to a path holding information about irrigation releases. # This should be a raster map (netCDF) of 366 values determining the maximum fraction of available storage to be used for meeting water demand... # in the associated command area on the day of the year. If this is not included, a value of 0.01 will be assumed, # i.e. 1% of the reservoir storage can be at most released into the command area on each day. ## Command area total demand # # The remaining demand within each command area [M3] is put into a map where each cell in the command area holds this total demand demand_Segment = np.where(self.var.reservoir_command_areas > 0, npareatotal(remainNeed2 * self.var.cellArea, self.var.reservoir_command_areas), 0) # [M3] ## Reservoir associated with the Command Area # # If there is more than one reservoir in a command area, the storage of the reservoir with maximum storage in this time-step is chosen. # The map resStorageTotal_alloc holds this maximum reservoir storage within a command area in all cells within that command area reservoirStorageM3 = globals.inZero.copy() np.put(reservoirStorageM3, self.var.decompress_LR, self.var.reservoirStorageM3C) resStorageTotal_alloc = np.where(self.var.reservoir_command_areas > 0, npareamaximum(reservoirStorageM3, self.var.reservoir_command_areas), 0) # [M3] # In the map resStorageTotal_allocC, the maximum storage from each allocation segment is held in all reservoir cells within that allocation segment. # We now correct to remove the reservoirs that are not this maximum-storage-reservoir for the command area. resStorageTotal_allocC = np.compress(self.var.compress_LR, resStorageTotal_alloc) resStorageTotal_allocC = np.multiply(resStorageTotal_allocC == self.var.reservoirStorageM3C, resStorageTotal_allocC) # The rules for the maximum amount of water to be released for irrigation are found for the chosen maximum-storage reservoir in each command area day_of_year = globals.dateVar['currDate'].timetuple().tm_yday if 'Reservoir_releases_input_file' in binding: resStorage_maxFracForIrrigation = readnetcdf2('Reservoir_releases_input_file', day_of_year, useDaily='DOY', value='Fraction of Volume') else: resStorage_maxFracForIrrigation = 0.01 + globals.inZero.copy() # resStorage_maxFracForIrrigationC holds the fractional rules found for each reservoir, so we must null those that are not the maximum-storage reservoirs resStorage_maxFracForIrrigationC = np.compress(self.var.compress_LR, resStorage_maxFracForIrrigation) resStorage_maxFracForIrrigationC = np.multiply( resStorageTotal_allocC == self.var.reservoirStorageM3C, resStorage_maxFracForIrrigationC) np.put(resStorage_maxFracForIrrigation, self.var.decompress_LR, resStorage_maxFracForIrrigationC) resStorage_maxFracForIrrigation_CA = np.where(self.var.reservoir_command_areas > 0, npareamaximum(resStorage_maxFracForIrrigation, self.var.reservoir_command_areas), 0) if 'Water_conveyance_efficiency' in binding: Water_conveyance_efficiency = loadmap('Water_conveyance_efficiency') else: Water_conveyance_efficiency = 1.0 act_bigLakeResAbst_alloc = np.minimum(resStorage_maxFracForIrrigation_CA * resStorageTotal_alloc, demand_Segment / Water_conveyance_efficiency) # [M3] ResAbstractFactor = np.where(resStorageTotal_alloc > 0, divideValues(act_bigLakeResAbst_alloc, resStorageTotal_alloc), 0) # fraction of water abstracted versus water available for total segment reservoir volumes # Compressed version needs to be corrected as above ResAbstractFactorC = np.compress(self.var.compress_LR, ResAbstractFactor) ResAbstractFactorC = np.multiply(resStorageTotal_allocC == self.var.reservoirStorageM3C, ResAbstractFactorC) self.var.lakeStorageC -= self.var.reservoirStorageM3C * ResAbstractFactorC self.var.lakeVolumeM3C -= self.var.reservoirStorageM3C * ResAbstractFactorC self.var.lakeResStorageC -= self.var.reservoirStorageM3C * ResAbstractFactorC self.var.reservoirStorageM3C -= self.var.reservoirStorageM3C * ResAbstractFactorC self.var.lakeResStorage = globals.inZero.copy() np.put(self.var.lakeResStorage, self.var.decompress_LR, self.var.lakeResStorageC) metRemainSegment = np.where(demand_Segment > 0, divideValues(act_bigLakeResAbst_alloc * Water_conveyance_efficiency, demand_Segment), 0) # by definition <= 1 self.var.leakageC_daily = resStorageTotal_allocC * ResAbstractFactorC * ( 1 - Water_conveyance_efficiency) self.var.leakageC += self.var.leakageC_daily self.var.leakageC_daily_segments = np.sum(self.var.leakageC_daily) + globals.inZero self.var.act_bigLakeResAbst += remainNeed2 * metRemainSegment self.var.act_SurfaceWaterAbstract += remainNeed2 * metRemainSegment ## End of using_reservoir_command_areas # remaining is taken from groundwater if possible self.var.pot_GroundwaterAbstract = totalDemand - self.var.act_SurfaceWaterAbstract self.var.nonFossilGroundwaterAbs = np.maximum(0.,np.minimum(self.var.readAvlStorGroundwater, self.var.pot_GroundwaterAbstract)) # calculate renewableAvlWater_local (non-fossil groundwater and channel) - environmental flow #self.var.renewableAvlWater_local = self.var.readAvlStorGroundwater + self.var.readAvlChannelStorageM # if limitAbstraction from groundwater is True # fossil gwAbstraction and water demand may be reduced # variable to reduce/limit groundwater abstraction (> 0 if limitAbstraction = True) if checkOption('limitAbstraction'): # real surface water abstraction can be lower, because not all demand can be done from surface water act_swAbstractionFraction = divideValues(self.var.act_SurfaceWaterAbstract, totalDemand) # Fossil groundwater abstraction is not allowed # allocation rule here: domestic& industry > irrigation > paddy # non-irrgated water demand: adjusted (and maybe increased) by gwabstration factor # if nonirrgated water demand is higher than actual growndwater abstraction (wwhat is needed and what is stored in gw) act_nonIrrWithdrawalGW = self.var.nonIrrDemand * (1 - act_swAbstractionFraction) act_nonIrrWithdrawalGW = np.where(act_nonIrrWithdrawalGW > self.var.nonFossilGroundwaterAbs, self.var.nonFossilGroundwaterAbs, act_nonIrrWithdrawalGW) act_nonIrrWithdrawalSW = act_swAbstractionFraction * self.var.nonIrrDemand self.var.act_nonIrrWithdrawal = act_nonIrrWithdrawalSW + act_nonIrrWithdrawalGW # irrigated water demand: act_irrWithdrawalGW = self.var.totalIrrDemand * (1 - act_swAbstractionFraction) act_irrWithdrawalGW = np.minimum(self.var.nonFossilGroundwaterAbs - act_nonIrrWithdrawalGW, act_irrWithdrawalGW) act_irrWithdrawalSW = act_swAbstractionFraction * self.var.totalIrrDemand self.var.act_irrWithdrawal = act_irrWithdrawalSW + act_irrWithdrawalGW # (nonpaddy) act_irrnonpaddyGW = self.var.fracVegCover[3] * (1 - act_swAbstractionFraction) * self.var.irrDemand[3] act_irrnonpaddyGW = np.minimum(self.var.nonFossilGroundwaterAbs - act_nonIrrWithdrawalGW, act_irrnonpaddyGW) act_irrnonpaddySW = self.var.fracVegCover[3] * act_swAbstractionFraction * self.var.irrDemand[3] self.var.act_irrNonpaddyWithdrawal = act_irrnonpaddySW + act_irrnonpaddyGW # (paddy) act_irrpaddyGW = self.var.fracVegCover[2] * (1 - act_swAbstractionFraction) * self.var.irrDemand[2] act_irrpaddyGW = np.minimum(self.var.nonFossilGroundwaterAbs - act_nonIrrWithdrawalGW - act_irrnonpaddyGW, act_irrpaddyGW) act_irrpaddySW = self.var.fracVegCover[2] * act_swAbstractionFraction * self.var.irrDemand[2] self.var.act_irrPaddyWithdrawal = act_irrpaddySW + act_irrpaddyGW act_gw = act_nonIrrWithdrawalGW + act_irrWithdrawalGW # todo: is act_irrWithdrawal needed to be replaced? Check later!! # consumption - irrigation (without loss) = demand * efficiency (back to non fraction value) ## back to non fraction values # self.var.act_irrWithdrawal[2] = divideValues(self.var.act_irrPaddyWithdrawal, self.var.fracVegCover[2]) #self.var.act_irrWithdrawal[3] = divideValues(self.var.act_irrNonpaddyWithdrawal, self.var.fracVegCover[3]) ## consumption - irrigation (without loss) = demand * efficiency # calculate act_ water demand, because irr demand has still demand from previous day included # if the demand from previous day is not fulfilled it is taken to the next day and so on # if we do not correct we double account each day the demand from previous days self.var.act_irrPaddyDemand = np.maximum(0, self.var.irrPaddyDemand - self.var.unmetDemandPaddy) self.var.act_irrNonpaddyDemand = np.maximum(0, self.var.irrNonpaddyDemand - self.var.unmetDemandNonpaddy) # unmet is either pot_GroundwaterAbstract - self.var.nonFossilGroundwaterAbs or demand - withdrawal self.var.unmetDemand = (self.var.totalIrrDemand - self.var.act_irrWithdrawal) + (self.var.nonIrrDemand - self.var.act_nonIrrWithdrawal) self.var.unmetDemandPaddy = self.var.irrPaddyDemand - self.var.act_irrPaddyDemand self.var.unmetDemandNonpaddy = self.var.irrNonpaddyDemand - self.var.act_irrNonpaddyDemand else: # Fossil groundwater abstractions are allowed (act = pot) self.var.unmetDemand = self.var.pot_GroundwaterAbstract - self.var.nonFossilGroundwaterAbs # using allocation from abstraction zone # this might be a regualr grid e.g. 2x2 for 0.5 deg left_sf = self.var.readAvlChannelStorageM - self.var.act_channelAbst # sum demand, surface water - local used, groundwater - local use, not satisfied for allocation zone zoneDemand = npareatotal(self.var.unmetDemand,self.var.allocation_zone) zone_sf_avail = npareatotal(left_sf, self.var.allocation_zone) # zone abstraction is minimum of availability and demand zone_sf_abstraction = np.minimum(zoneDemand,zone_sf_avail) # water taken from surface zone and allocated to cell demand cell_sf_abstraction = np.maximum(0.,divideValues(left_sf,zone_sf_avail) * zone_sf_abstraction) cell_sf_allocation = np.maximum(0.,divideValues(self.var.unmetDemand, zoneDemand) * zone_sf_abstraction) # sum up with other abstraction self.var.act_SurfaceWaterAbstract = self.var.act_SurfaceWaterAbstract + cell_sf_abstraction self.var.act_channelAbst = self.var.act_channelAbst + cell_sf_abstraction # new potential groundwater abstraction self.var.pot_GroundwaterAbstract = np.maximum(0.,self.var.pot_GroundwaterAbstract - cell_sf_allocation) left_gw_demand = np.maximum(0.,self.var.pot_GroundwaterAbstract - self.var.nonFossilGroundwaterAbs) left_gw_avail = self.var.readAvlStorGroundwater - self.var.nonFossilGroundwaterAbs zone_gw_avail = npareatotal(left_gw_avail, self.var.allocation_zone) # for groundwater substract demand which is fulfilled by surface zone, calc abstraction and what is left. #zone_gw_demand = npareatotal(left_gw_demand, self.var.allocation_zone) zone_gw_demand = zoneDemand - zone_sf_abstraction zone_gw_abstraction = np.minimum(zone_gw_demand,zone_gw_avail) #zone_unmetdemand = np.maximum(0., zone_gw_demand - zone_gw_abstraction) # water taken from groundwater zone and allocated to cell demand cell_gw_abstraction = np.maximum(0.,divideValues(left_gw_avail,zone_gw_avail) * zone_gw_abstraction) cell_gw_allocation = np.maximum(0.,divideValues(left_gw_demand,zone_gw_demand) * zone_gw_abstraction) self.var.unmetDemand = np.maximum(0.,left_gw_demand - cell_gw_allocation) self.var.nonFossilGroundwaterAbs = self.var.nonFossilGroundwaterAbs + cell_gw_abstraction #self.var.unmetDemand = self.var.pot_GroundwaterAbstract - self.var.nonFossilGroundwaterAbs ## end of zonal abstraction # unmet demand is again checked for water from channels and abstraction from surface is increased #channelAbs2 = np.minimum(self.var.readAvlChannelStorageM - self.var.act_channelAbst, self.var.unmetDemand) #self.var.act_SurfaceWaterAbstract = self.var.act_SurfaceWaterAbstract + channelAbs2 #self.var.act_channelAbst = self.var.act_channelAbst + channelAbs2 #self.var.unmetDemand = self.var.unmetDemand - channelAbs2 #self.var.pot_GroundwaterAbstract = self.var.pot_GroundwaterAbstract - channelAbs2 self.var.act_nonIrrWithdrawal = self.var.nonIrrDemand self.var.act_irrWithdrawal = self.var.totalIrrDemand act_gw = self.var.pot_GroundwaterAbstract self.var.act_irrNonpaddyWithdrawal = self.var.fracVegCover[3] * self.var.irrDemand[3] self.var.act_irrPaddyWithdrawal = self.var.fracVegCover[2] * self.var.irrDemand[2] ## End of limit extraction if, then self.var.act_irrConsumption[2] = divideValues(self.var.act_irrPaddyWithdrawal, self.var.fracVegCover[2]) * self.var.efficiencyPaddy self.var.act_irrConsumption[3] = divideValues(self.var.act_irrNonpaddyWithdrawal, self.var.fracVegCover[3]) * self.var.efficiencyNonpaddy self.var.pumping = act_gw if 'demand2pumping' in binding: if checkOption('demand2pumping'): self.var.modflowPumpingM += act_gw self.var.act_indWithdrawal = frac_industry * self.var.act_nonIrrWithdrawal self.var.act_domWithdrawal = frac_domestic * self.var.act_nonIrrWithdrawal self.var.act_livWithdrawal = frac_livestock * self.var.act_nonIrrWithdrawal self.var.act_indConsumption = self.var.ind_efficiency * self.var.act_indWithdrawal self.var.act_domConsumption = self.var.dom_efficiency * self.var.act_domWithdrawal self.var.act_livConsumption = self.var.liv_efficiency * self.var.act_livWithdrawal self.var.act_nonIrrConsumption = self.var.act_domConsumption + self.var.act_indConsumption + self.var.act_livConsumption self.var.act_totalIrrConsumption = self.var.fracVegCover[2] * self.var.act_irrConsumption[2] + self.var.fracVegCover[3] * self.var.act_irrConsumption[3] self.var.act_paddyConsumption = self.var.fracVegCover[2] * self.var.act_irrConsumption[2] self.var.act_nonpaddyConsumption = self.var.fracVegCover[3] * self.var.act_irrConsumption[3] self.var.totalWaterDemand = self.var.fracVegCover[2] * self.var.irrDemand[2] + self.var.fracVegCover[3] * self.var.irrDemand[3] + self.var.nonIrrDemand self.var.act_totalWaterWithdrawal = self.var.act_nonIrrWithdrawal + self.var.act_irrWithdrawal self.var.act_totalWaterConsumption = self.var.act_nonIrrConsumption + self.var.act_totalIrrConsumption # --- calculate return flow #Sum up loss - difference between withdrawn and consumed - split into return flow and evaporation sumIrrLoss = self.var.act_irrWithdrawal - self.var.act_totalIrrConsumption self.var.returnflowIrr = self.var.returnfractionIrr * sumIrrLoss self.var.addtoevapotrans = (1- self.var.returnfractionIrr) * sumIrrLoss self.var.returnflowNonIrr = self.var.nonIrrReturnFlowFraction * self.var.act_nonIrrWithdrawal # limit return flow to not put all fossil groundwater back into the system, because # it can lead to higher river discharge than without water demand, as water is taken from fossil groundwater (out of system) unmet_div_ww = 1. - np.minimum(1, divideValues(self.var.unmetDemand, self.var.act_totalWaterWithdrawal)) self.var.unmet_lost = ( self.var.returnflowIrr + self.var.returnflowNonIrr + self.var.addtoevapotrans) * (1-unmet_div_ww) #self.var.waterDemandLost = self.var.act_totalWaterConsumption + self.var.addtoevapotrans self.var.unmet_lostirr = ( self.var.returnflowIrr + self.var.addtoevapotrans) * (1-unmet_div_ww) self.var.unmet_lostNonirr = self.var.returnflowNonIrr * (1-unmet_div_ww) self.var.returnflowIrr = self.var.returnflowIrr * unmet_div_ww self.var.addtoevapotrans = self.var.addtoevapotrans * unmet_div_ww self.var.returnflowNonIrr = self.var.returnflowNonIrr * unmet_div_ww # returnflow to river and to evapotranspiration self.var.returnFlow = self.var.returnflowIrr + self.var.returnflowNonIrr self.var.waterabstraction = self.var.nonFossilGroundwaterAbs + self.var.unmetDemand + self.var.act_SurfaceWaterAbstract self.model.waterbalance_module.waterBalanceCheck( [self.var.act_irrWithdrawal], # In [self.var.act_totalIrrConsumption,self.var.unmet_lostirr,self.var.addtoevapotrans,self.var.returnflowIrr], # Out [globals.inZero], [globals.inZero], "Waterdemand5a", False) self.model.waterbalance_module.waterBalanceCheck( [self.var.act_nonIrrWithdrawal], # In [self.var.act_nonIrrConsumption , self.var.returnflowNonIrr, self.var.unmet_lostNonirr], # Out [globals.inZero], [globals.inZero], "Waterdemand5b", False) self.model.waterbalance_module.waterBalanceCheck( [self.var.ind_efficiency * frac_industry * self.var.act_nonIrrWithdrawal], # In [self.var.act_indConsumption], # Out [globals.inZero], [globals.inZero], "Waterdemand5c", False) self.model.waterbalance_module.waterBalanceCheck( [ self.var.act_indWithdrawal], # In [self.var.act_indConsumption/ self.var.ind_efficiency], # Out [globals.inZero], [globals.inZero], "Waterdemand5d", False) # ---------------------------------------------------------------- if checkOption('calcWaterBalance'): self.model.waterbalance_module.waterBalanceCheck( [self.var.act_irrWithdrawal], # In [self.var.act_totalIrrConsumption, self.var.returnflowIrr,self.var.unmet_lostirr,self.var.addtoevapotrans], # Out [globals.inZero], [globals.inZero], "Waterlossdemand1", False) self.model.waterbalance_module.waterBalanceCheck( [self.var.nonIrrDemand, self.var.totalIrrDemand], # In [self.var.nonFossilGroundwaterAbs, self.var.unmetDemand, self.var.act_SurfaceWaterAbstract], # Out [globals.inZero], [globals.inZero], "Waterdemand1", False) if checkOption('includeWaterBodies'): self.model.waterbalance_module.waterBalanceCheck( [self.var.act_SurfaceWaterAbstract], # In [ self.var.act_bigLakeResAbst,self.var.act_smallLakeResAbst, self.var.act_channelAbst], # Out [globals.inZero], [globals.inZero], "Waterdemand1b", False) self.model.waterbalance_module.waterBalanceCheck( [self.var.nonFossilGroundwaterAbs, self.var.unmetDemand, self.var.act_SurfaceWaterAbstract], # In [self.var.act_totalWaterWithdrawal], # Out [globals.inZero], [globals.inZero], "Waterdemand2", False) self.model.waterbalance_module.waterBalanceCheck( [self.var.act_totalWaterWithdrawal], # In [self.var.act_irrPaddyWithdrawal, self.var.act_irrNonpaddyWithdrawal, self.var.act_nonIrrWithdrawal], # Out [globals.inZero], [globals.inZero], "Waterdemand3", False) self.model.waterbalance_module.waterBalanceCheck( [self.var.act_totalWaterWithdrawal], # In [self.var.act_totalIrrConsumption, self.var.act_nonIrrConsumption, self.var.addtoevapotrans, self.var.returnflowIrr, self.var.returnflowNonIrr, self.var.unmet_lost], # Out [globals.inZero], [globals.inZero], "Waterdemand4", False) self.model.waterbalance_module.waterBalanceCheck( [self.var.act_totalWaterWithdrawal], # In [self.var.act_totalIrrConsumption, self.var.act_nonIrrConsumption, self.var.addtoevapotrans, self.var.returnFlow, self.var.unmet_lost ], # Out [globals.inZero], [globals.inZero], "Waterdemand5", False) self.model.waterbalance_module.waterBalanceCheck( [self.var.act_totalWaterWithdrawal], # In [self.var.waterabstraction], # Out [globals.inZero], [globals.inZero], "Waterdemand level1", False)
CWatM/CWatM
cwatm/hydrological_modules/water_demand/water_demand.py
Python
gpl-3.0
52,255
[ "NetCDF" ]
69cda85a640966890de11b70cfdce53fb60babf50e0769f70fe00f9beac77441
from setuptools import setup setup(name='gmshtoparticles', version='0.1', description='Transforms a .msh file generated with Gmsh into a particles centered inside each triangle or quad element. Outputs a .csv file description and .vtk/.vtu visualization set of files', url='https://github.com/IaPCS/gmsh-to-nodes/', author='Patrick Diehl, Ilyass Tabiai', author_email='me@diehlpk.de, ilyass.tabiai@gmail.com', license='GPL-3.0', packages=['gmshtoparticles'], zip_safe=False )
IaPCS/gmsh-to-nodes
setup.py
Python
gpl-3.0
526
[ "VTK" ]
77800d466430e5b7d577d2280d744c00b92aa83961cfa22b115c89a84ef73a43
# -*- coding: utf-8 -*- """ SpykeDemo.py creates a Layer of neurons and a connection matrix and steps it through several iterations with an injected current. Created on Sun Oct 04 23:26:52 2015 This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 3 of the License, or any later version. @author: Corey Hart """ from SpykeArchitecture import * L = layer(100,0.1) # 100 neurons with a maximum connection weight of 0.1 recordIdx = {} recordTimes = {} recordNeurons = {} #initial neuron objects for l in xrange(len(L.neurons)): recordNeurons[l] = list() # store original weight matrix w = np.zeros((100,100)) for el in xrange(100): for el2 in xrange(100): w[el,el2] = L.cnxns.weights[el,el2] # original weights #loop through time index for l in xrange(50): L.update(10.0) # global drive = 10.0 fired = [] for num_n,n in enumerate(L.neurons): if n.spike == True: fired.append(num_n) recordNeurons[num_n].append(n.time) recordIdx[l] = fired # dictionary of neurons that have fired, indexed by time index. recordTimes[n.time] = fired L.cnxns.update(recordTimes,n.time,n.dt,6.25, [0.1,1.0,0.5],learning_rule = 'STDP')
DrSpyke/Spyke
SpykeDemo.py
Python
gpl-2.0
1,335
[ "NEURON" ]
a384d2be2b8c432250d31404fe8e78fe03908d84ff19a0d68b4e287e7671b018
# coding: utf-8 # Copyright (c) Pymatgen Development Team. # Distributed under the terms of the MIT License. """Setup.py for pymatgen.""" import sys import platform from setuptools import setup, find_packages, Extension from setuptools.command.build_ext import build_ext as _build_ext class build_ext(_build_ext): """Extension builder that checks for numpy before install.""" def finalize_options(self): """Override finalize_options.""" _build_ext.finalize_options(self) # Prevent numpy from thinking it is still in its setup process: import builtins if hasattr(builtins, '__NUMPY_SETUP__'): del builtins.__NUMPY_SETUP__ import importlib import numpy importlib.reload(numpy) self.include_dirs.append(numpy.get_include()) extra_link_args = [] if sys.platform.startswith('win') and platform.machine().endswith('64'): extra_link_args.append('-Wl,--allow-multiple-definition') cpp_extra_link_args = extra_link_args cpp_extra_compile_args = ["-Wno-cpp", "-Wno-unused-function", "-O2", "-march=native", '-std=c++0x'] if sys.platform.startswith('darwin'): cpp_extra_compile_args.append("-stdlib=libc++") cpp_extra_link_args = ["-O2", "-march=native", '-stdlib=libc++'] # https://docs.microsoft.com/en-us/cpp/build/reference/compiler-options-listed-alphabetically?view=vs-2017 if sys.platform.startswith('win'): cpp_extra_compile_args = ['/w', '/O2', '/std:c++0x'] cpp_extra_link_args = extra_link_args long_desc = """ Official docs: [http://pymatgen.org](http://pymatgen.org/) Pymatgen (Python Materials Genomics) is a robust, open-source Python library for materials analysis. These are some of the main features: 1. Highly flexible classes for the representation of Element, Site, Molecule, Structure objects. 2. Extensive input/output support, including support for [VASP](http://cms.mpi.univie.ac.at/vasp/), [ABINIT](http://www.abinit.org/), CIF, Gaussian, XYZ, and many other file formats. 3. Powerful analysis tools, including generation of phase diagrams, Pourbaix diagrams, diffusion analyses, reactions, etc. 4. Electronic structure analyses, such as density of states and band structure. 5. Integration with the Materials Project REST API. Pymatgen is free to use. However, we also welcome your help to improve this library by making your own contributions. These contributions can be in the form of additional tools or modules you develop, or feature requests and bug reports. Please report any bugs and issues at pymatgen's [Github page] (https://github.com/materialsproject/pymatgen). For help with any pymatgen issues, please use the [Discourse page](https://discuss.matsci.org/c/pymatgen). Why use pymatgen? ================= There are many materials analysis codes out there, both commerical and free, but pymatgen offer several advantages: 1. **It is (fairly) robust.** Pymatgen is used by thousands of researchers, and is the analysis code powering the [Materials Project](https://www.materialsproject.org). The analysis it produces survives rigorous scrutiny every single day. Bugs tend to be found and corrected quickly. Pymatgen also uses [CircleCI](https://circleci.com) and [Appveyor](https://www.appveyor.com/) for continuous integration on the Linux and Windows platforms, respectively, which ensures that every commit passes a comprehensive suite of unittests. 2. **It is well documented.** A fairly comprehensive documentation has been written to help you get to grips with it quickly. 3. **It is open.** You are free to use and contribute to pymatgen. It also means that pymatgen is continuously being improved. We will attribute any code you contribute to any publication you specify. Contributing to pymatgen means your research becomes more visible, which translates to greater impact. 4. **It is fast.** Many of the core numerical methods in pymatgen have been optimized by vectorizing in numpy/scipy. This means that coordinate manipulations are extremely fast and are in fact comparable to codes written in other languages. Pymatgen also comes with a complete system for handling periodic boundary conditions. 5. **It will be around.** Pymatgen is not a pet research project. It is used in the well-established Materials Project. It is also actively being developed and maintained by the [Materials Virtual Lab](https://www.materialsvirtuallab.org), the ABINIT group and many other research groups. With effect from version 2019.1.1, pymatgen only supports Python 3.x. Users who require Python 2.7 should install pymatgen v2018.x. """ setup( name="pymatgen", packages=find_packages(), version="2020.4.2", cmdclass={'build_ext': build_ext}, setup_requires=['numpy>=1.14.3', 'setuptools>=18.0'], python_requires='>=3.6', install_requires=["numpy>=1.14.3", "requests", "ruamel.yaml>=0.15.6", "monty>=3.0.2", "scipy>=1.0.1", "pydispatcher>=2.0.5", "tabulate", "spglib>=1.9.9.44", "networkx>=2.2", "matplotlib>=1.5", "palettable>=3.1.1", "sympy", "pandas", "plotly>=4.5.0"], extras_require={ "provenance": ["pybtex"], "ase": ["ase>=3.3"], "vis": ["vtk>=6.0.0"], "abinit": ["netcdf4"], ':python_version < "3.7"': [ "dataclasses>=0.6", ]}, package_data={ "pymatgen.core": ["*.json", "py.typed"], "pymatgen.analysis": ["*.yaml", "*.json", "*.csv"], "pymatgen.analysis.chemenv.coordination_environments.coordination_geometries_files": ["*.txt", "*.json"], "pymatgen.analysis.chemenv.coordination_environments.strategy_files": ["*.json"], "pymatgen.analysis.magnetism": ["*.json", "*.yaml"], "pymatgen.analysis.structure_prediction": ["data/*.json", "*.yaml"], "pymatgen.io": ["*.yaml"], "pymatgen.io.vasp": ["*.yaml", "*.json"], "pymatgen.io.lammps": ["templates/*.*", "*.yaml"], "pymatgen.io.feff": ["*.yaml"], "pymatgen.symmetry": ["*.yaml", "*.json", "*.sqlite"], "pymatgen.entries": ["*.yaml"], "pymatgen.vis": ["ElementColorSchemes.yaml"], "pymatgen.command_line": ["OxideTersoffPotentials"], "pymatgen.analysis.defects": ["*.json"], "pymatgen.analysis.diffraction": ["*.json"], "pymatgen.util": ["structures/*.json"]}, author="Pymatgen Development Team", author_email="ongsp@eng.ucsd.edu", maintainer="Shyue Ping Ong, Matthew Horton", maintainer_email="ongsp@eng.ucsd.edu, mkhorton@lbl.gov", url="http://www.pymatgen.org", license="MIT", description="Python Materials Genomics is a robust materials " "analysis code that defines core object representations for " "structures and molecules with support for many electronic " "structure codes. It is currently the core analysis code " "powering the Materials Project " "(https://www.materialsproject.org).", long_description=long_desc, long_description_content_type='text/markdown', keywords=["VASP", "gaussian", "ABINIT", "nwchem", "qchem", "materials", "science", "project", "electronic", "structure", "analysis", "phase", "diagrams", "crystal"], classifiers=[ "Programming Language :: Python :: 3", "Programming Language :: Python :: 3.5", "Programming Language :: Python :: 3.6", "Programming Language :: Python :: 3.7", "Development Status :: 4 - Beta", "Intended Audience :: Science/Research", "License :: OSI Approved :: MIT License", "Operating System :: OS Independent", "Topic :: Scientific/Engineering :: Information Analysis", "Topic :: Scientific/Engineering :: Physics", "Topic :: Scientific/Engineering :: Chemistry", "Topic :: Software Development :: Libraries :: Python Modules" ], ext_modules=[Extension("pymatgen.optimization.linear_assignment", ["pymatgen/optimization/linear_assignment.c"], extra_link_args=extra_link_args), Extension("pymatgen.util.coord_cython", ["pymatgen/util/coord_cython.c"], extra_link_args=extra_link_args), Extension("pymatgen.optimization.neighbors", ["pymatgen/optimization/neighbors.cpp"], extra_compile_args=cpp_extra_compile_args, extra_link_args=cpp_extra_link_args, language='c++')], entry_points={ 'console_scripts': [ 'pmg = pymatgen.cli.pmg:main', 'feff_input_generation = pymatgen.cli.feff_input_generation:main', 'feff_plot_cross_section = pymatgen.cli.feff_plot_cross_section:main', 'feff_plot_dos = pymatgen.cli.feff_plot_dos:main', 'gaussian_analyzer = pymatgen.cli.gaussian_analyzer:main', 'get_environment = pymatgen.cli.get_environment:main', ] } )
gVallverdu/pymatgen
setup.py
Python
mit
9,220
[ "ABINIT", "ASE", "CRYSTAL", "FEFF", "Gaussian", "LAMMPS", "NWChem", "VASP", "VTK", "pymatgen" ]
ad9e7528aed142aff31ba13d14b530f3e99396b8ec8c3911e5b0d6555b7667db
#! /usr/bin/env python import math, sys, os , platform from collections import Iterable from optparse import OptionParser import pybel2 import openbabel as op import numpy as np # http://openbabel.org/dev-api/classOpenBabel_1_1OBMol.shtml Molecule=pybel2.Molecule Atom=pybel2.Atom Bond=pybel2.Bond def pqrbug(filename): # Bug in Openbabel for PQR format reader # Return the string for the file, which can be read by: # pybel.readstring('pqr',pqrbug(filename)). # ob.OBConversion().ReadString(obmol, string) # BUG has been removed in Mac version. f=open(filename); lines=f.readlines(); out="" for line in lines: if line[:6]=="ATOM " or line[:6]=="HETATM": newline=line # Bug in Openbabel 2.3.2 windows version # Mac have exclude the error, only for window if (platform.system()=="Windows"): newline=newline[:-3]+'\n'; # Br ->B error in PQR format.. if (line[12:15]==" Br"): newline=newline[:12]+"Br "+newline[15:] if (line[12:15]==" Cl"): newline=newline[:12]+"Cl "+newline[15:] if (line[12:15]==" Na"): newline=newline[:12]+"Na "+newline[15:] if (line[12:15]==" Mg"): newline=newline[:12]+"Mg "+newline[15:] out+=newline else: out+=line; f.close() return out; def pqrx_reader(filename, lastlen=12, columns=1): # read the pqrx/pqra/pqrta file containing atomic data # Return (pqr_string, atomic_data_list). # atomic_data_list is many lists saving multi-types data! # This function should *not* be used with pqrbug function! if (lastlen<=0 or columns<1): raise ValueError("Error last len or column number!"); exit(1) f=open(filename); lines=f.readlines(); out="" # Initial output data in a list # In this list, each column data as a children list. outdata=[]; for i in range(columns): outdata.append([]); # Deal with each line for line in lines: if line[:6]=="ATOM " or line[:6]=="HETATM": # Split the data and pqr data in a line. newline=line.rstrip('\n') newline=newline.rstrip('\r') data=newline[-lastlen:]; newline=newline[:-lastlen]+'\n' # Set the data datas=data.strip().split() if (len(datas)!=columns): raise ValueError("Given column number not the same to the data!"); exit(1); for i in range(columns): outdata[i].append(datas[i]) # Mac have exclude the error, only for window if (platform.system()=="Windows"): newline=newline[:-3]+'\n'; # Br ->B error in PQR format.. if (line[12:15]==" Br"): newline=newline[:12]+"Br "+newline[15:] if (line[12:15]==" Cl"): newline=newline[:12]+"Cl "+newline[15:] if (line[12:15]==" Na"): newline=newline[:12]+"Na "+newline[15:] if (line[12:15]==" Mg"): newline=newline[:12]+"Mg "+newline[15:] out+=newline else: out+=line; f.close() return (out,outdata); def calcdipoleAtoms(*atoms): # give many atom as input # Best method for list of atoms should calcdipoleAtoms(*Atomlist) if (len(atoms)<= 0): raise TypeError("Errors: No Input Atoms!") return 0.0 # if giving a list of atoms. if (isinstance(atoms[0],list)): atoms=atoms[0] if (not isinstance(atoms[0],Atom)): raise TypeError("Errors: Input should be Atom!") return 0.0 dx=0.0;dy=0.0;dz=0.0 for atom in atoms: coor=atom.coords charge=atom.partialcharge dx+=coor[0]*charge dy+=coor[1]*charge dz+=coor[2]*charge dipole=math.sqrt(pow(dx,2)+pow(dy,2)+pow(dz,2)) return dipole def calcdipoleBond(bond): # Give a bond as input bgn=bond.bgn end=bond.end bgncoor=bgn.coords bgncharge=bgn.partialcharge endcoor=end.coords endcharge=end.partialcharge dipole=math.sqrt(pow((bgncharge*bgncoor[0]+endcharge*endcoor[0]),2) +pow((bgncharge*bgncoor[1]+endcharge*endcoor[1]),2) +pow((bgncharge*bgncoor[2]+endcharge*endcoor[2]),2)); return dipole def atomnumBondPair(bond): # Return bond atoms atomic number pair, such as C-O return (6,7) return tuple(sorted([bond.bgn.atomicnum,bond.end.atomicnum])) def atomNumHyd(atom): # Return Atom's (atomic number, hydribazation) pair. return (atom.atomicnum,atom.hyb) def distance(atom1,atom2): # Return distance between two atoms. return atom1.OBAtom.GetDistance(atom2.OBAtom); def MolInfo(mol,printInfo=True): # Ruturn a list containing molecular information/features smile=mol.write('smi').strip().split()[0] dipole=calcdipoleAtoms(*mol.atoms) TNatms=mol.OBMol.NumAtoms(); HEatms=mol.OBMol.NumHvyAtoms(); Hatms=mol.OBMol.NumAtoms()-mol.OBMol.NumHvyAtoms(); TNbnds=mol.OBMol.NumBonds(); moldesc=mol.calcdesc() sbnds=int(moldesc['sbonds']); dbnds=int(moldesc['dbonds']); tbnds=int(moldesc['tbonds']); abnds=int(moldesc['abonds']); if (printInfo): print "Mol Formula:",mol.formula print "Mol Weight:",mol.molwt print "Mol SMILE:",smile print "Mol dipole:",dipole; print "Total Atoms number:", TNatms; print "Heavy Atom number:", HEatms; print "Hydrogen number:", Hatms; print "Bond number:", TNbnds; print "Single Bond number:",sbnds print "Double Bond number:",dbnds print "Triple Bond number:",tbnds print "Aromatic Bond number:",abnds return [mol.formula,mol.molwt,smile,dipole,TNatms,HEatms,Hatms,TNbnds,sbnds,dbnds,tbnds,abnds] def descVar(*args): # Return [max, min, sum, average, std] for given data if (isinstance(args[0],list)): args=args[0] mx=max(args) mi=min(args) sumall=math.fsum(args) aver=sumall/len(args) var= math.fsum((pow(x-aver,2) for x in args)) /(len(args)) std=math.sqrt(var) return (mx,mi,sumall,aver,std) def featureDict2List(ftype, fdict): # Arrange data in a fdict to the sequence as giving list ftype(saving keys) # if in key:value, the value is a list, it will expand to several data for this key in the final list. features=[] for f in ftype: if (isinstance(fdict[f],Iterable)): features+=list(fdict[f]) else: features.append(fdict[f]) return features def CalcDataElementFeature(mol,data): # Calculate Element based Features based on data and molecule # data should based on atom, with same sequence elements=[1,6,7,8,9,15,16,17,35,53] atomsnum=[atom.atomicnum for atom in mol]; pcdict={}; pcdesc={} fdata=map(float,data); for ele in elements: pcdict[ele]=[] for i in range(len(atomsnum)): pcdict[atomsnum[i]].append(fdata[i]); for ele in elements: if (len(pcdict[ele])>0): pcdesc[ele]=descVar(pcdict[ele]) else: pcdesc[ele]=descVar([0.0]) # Data Value Max, Min, Sum, Average, Std: # For H,C,N,O,F,P,S,Cl,Br,I # Element Partial Charge Max, Min, Sum, Average, Std: return list(descVar(fdata))+featureDict2List(elements,pcdesc) def CalcFeatures(mol,printInfo=True): atoms=mol.atoms; atomshyb=[atomNumHyd(atom) for atom in atoms]; bonds=mol.bonds; # H,C,N,O,F,P,S,Cl,Br,I elements=[1,6,7,8,9,15,16,17,35,53] # molecule molinfo=MolInfo(mol,printInfo=printInfo); elecounts={} for ele in elements: elecounts[ele]=0 for atom in mol: an=atom.atomicnum elecounts[an]=elecounts.get(an,0)+1 # partial charge acDict={}; #for sum element pcharge acDictAbs={}; pcs=[atom.partialcharge for atom in mol] pcsAbs=[abs(pc) for pc in pcs] pcdict={} #for saving each atom pcharge in a element key pcdesc={} #for saving Max/min.. for a element pcAbsdict={} pcAbsdesc={} for ele in elements: pcdict[ele]=[] pcAbsdict[ele]=[] acDict[ele]=0.0 acDictAbs[ele]=0.0 for atom in mol: an=atom.atomicnum pcdict[an].append(atom.partialcharge) pcAbsdict[an].append(abs(atom.partialcharge)) acDict[an]=acDict.get(an,0.0)+atom.partialcharge; acDictAbs[an]=acDictAbs.get(an,0.0)+abs(atom.partialcharge); for ele in elements: if (len(pcdict[ele])>0): pcdesc[ele]=descVar(pcdict[ele]) pcAbsdesc[ele]=descVar(pcAbsdict[ele]) else: pcdesc[ele]=descVar([0.0]) pcAbsdesc[ele]=descVar([0.0]) elePCfeatures=featureDict2List(elements,acDict)+featureDict2List(elements,acDictAbs)+featureDict2List(elements,pcdesc)+featureDict2List(elements,pcAbsdesc) if (printInfo): # mol feature print "Partial Charge Max, Min, Sum, Average, Std:",descVar(pcs) print "Abs Partial Charge Max, Min, Sum, Average, Std:",descVar(pcsAbs) # element feature print "Element Partial Charge:",acDict print "Element Abs Partial Charge:",acDictAbs print "Element Partial Charge Max, Min, Sum, Average, Std:",pcdesc print "Abs Element Partial Charge Max, Min, Sum, Average, Std:",pcAbsdesc # hybridization EleHyb={} for atom in mol: ehyb=atomNumHyd(atom) if (ehyb[0] is 6): if (ehyb[1] is 1): EleHyb["C1"]=EleHyb.get("C1",0)+1 elif (ehyb[1] is 2): EleHyb["C2"]=EleHyb.get("C2",0)+1 elif (ehyb[1] is 3): EleHyb["C3"]=EleHyb.get("C3",0)+1 if (ehyb[0] is 7): if (ehyb[1] is 1): EleHyb["N1"]=EleHyb.get("N1",0)+1 elif (ehyb[1] is 2): EleHyb["N2"]=EleHyb.get("N2",0)+1 elif (ehyb[1] is 3): EleHyb["N3"]=EleHyb.get("N3",0)+1 if (ehyb[0] is 8): if (ehyb[1] is 1): EleHyb["O1"]=EleHyb.get("O1",0)+1 elif (ehyb[1] is 2): EleHyb["O2"]=EleHyb.get("O2",0)+1 elif (ehyb[1] is 3): EleHyb["O3"]=EleHyb.get("O3",0)+1 if (ehyb[0] is 16): if (ehyb[1] is 1): EleHyb["S1"]=EleHyb.get("S1",0)+1 elif (ehyb[1] is 2): EleHyb["S2"]=EleHyb.get("S2",0)+1 elif (ehyb[1] is 3): EleHyb["S3"]=EleHyb.get("S3",0)+1 hybtypes=["C1","C2","C3","N1","N2","N3","O1","O2","O3","S1","S2","S3"]; hybcount={} for t in hybtypes: hybcount[t]=EleHyb.get(t,0) hybfeatures=featureDict2List(hybtypes,hybcount) if (printInfo): #print "Element Hybridization:",EleHyb print "Element Hybridization count:",hybcount # dipole dipoles= [calcdipoleBond(bond) for bond in mol.bonds] bndpair= [atomnumBondPair(bond) for bond in mol.bonds ] bpd={} for i in range(len(dipoles)): dp=dipoles[i] bp=bndpair[i] if not bpd.has_key(bp): bpd[bp]=[] bpd[bp].append(dp) bpneed=[(1,6),(1,7),(1,8),(1,16),(6,6),(6,7),(6,8),(6,9),(6,15),(6,16),(6,17),(6,35),(6,53), (7,8),(8,15),(8,16),(15,16),(16,16)] bpddesc={} for bpn in bpneed: bpddesc[bpn]=descVar(bpd.get(bpn,[0.0])) dipolefeautures=featureDict2List(bpneed,bpddesc) if printInfo: # mol feature print "Bond Dipoles Max, Min, Sum, Average, Std:", descVar(dipoles) # element feature print "Bond Atom Pair Dipoles Max, Min, Sum, Average, Std:",bpddesc # Mol Formula, Mol Weight, Mol SMILE, Mol dipole, Total Atoms number, Heavy Atom number, Hydrogen number, # Bond number, Single Bond number, Double Bond number, Triple Bond number, Aromatic Bond number (molinfo) # For H,C,N,O,F,P,S,Cl,Br,I (elecounts) # Element number # Partial Charge, Abs Partial Charge, Bond Dipoles: Max, Min, Sum, Average, Std (descVar(pcs)+descVar(pcsAbs)+descVar(dipoles)) # # For H,C,N,O,F,P,S,Cl,Br,I (elePCfeatures) # Element Partial Charge # Element Abs Partial Charge # Element Partial Charge Max, Min, Sum, Average, Std # Abs Element Partial Charge Max, Min, Sum, Average, Std # # For ["C1","C2","C3","N1","N2","N3","O1","O2","O3","S1","S2","S3"] (hybfeatures) # Element Hybridization count # # For [(1,6),(1,7),(1,8),(1,16),(6,6),(6,7),(6,8),(6,9),(6,15),(6,16),(6,17),(6,35),(6,53),(7,8),(8,15),(8,16),(15,16),(16,16)] # For HC,HN,HO,HS,CC,CN,CO,CF,CP,CS,CCl,CBr,CI,NO,OP,OS,PO,SS (dipolefeautures) # Bond Atom Pair Dipoles Max, Min, Sum, Average, Std outlist=molinfo+featureDict2List(elements, elecounts)+list(descVar(pcs))+list(descVar(pcsAbs))+list(descVar(dipoles)) \ +elePCfeatures+hybfeatures+dipolefeautures if printInfo:print outlist return [ str(f) for f in outlist ] def featureString(): # 12 mol feature fstr="Mol_Formula Mol_Weight Mol_SMILE Mol_dipole Total_Atoms_number Heavy_Atom_number Hydrogen_number " fstr+="Bond_number Single_Bond_number Double_Bond_number Triple_Bond_number Aromatic_Bond_number " # 10 element partial charge feature for i in ["H","C","N","O","F","P","S","Cl","Br","I"]: fstr+=(i+"_"+"num"+" ") # 15 mol feature for i in ["PartCharge","AbsPartCharge","Bond_Dipole"]: for j in ["Max","Min","Sum","Aver","Std"]: fstr+=(i+"_"+j+" ") # 120 element partial charge feature for i in ["H","C","N","O","F","P","S","Cl","Br","I"]: fstr+=(i+"_"+"PC"+" ") for i in ["H","C","N","O","F","P","S","Cl","Br","I"]: fstr+=(i+"_"+"APC"+" ") for i in ["H","C","N","O","F","P","S","Cl","Br","I"]: for j in ["Max","Min","Sum","Aver","Std"]: fstr+=(i+"_"+"PC"+"_"+j+" ") for i in ["H","C","N","O","F","P","S","Cl","Br","I"]: for j in ["Max","Min","Sum","Aver","Std"]: fstr+=(i+"_"+"APC"+"_"+j+" ") # 12 hybrid feature for i in ["C1","C2","C3","N1","N2","N3","O1","O2","O3","S1","S2","S3"]: fstr+=(i+"_"+"Hyb"+" ") # 90 atom pair bond dipole feature for i in [ "HC","HN","HO","HS","CC","CN","CO","CF","CP","CS","CCl","CBr","CI","NO","OP","OS","PO","SS"]: for j in ["Max","Min","Sum","Aver","Std"]: fstr+=(i+"_"+"DP"+"_"+j+" ") #print fstr return fstr if __name__ =="__main__": helpdes='''Calculate features of molecules based on Pybel and Openbabel. # For one file, use -i option to assign the input file; # For many files, use -m option to assign a file containing file name without extension. # -f option can assign the file format. It must be given when using -m option. # Without -f option and using -i option, the format will be deduced based on file extension. # -t option will print the title for features.''' parser = OptionParser(description=helpdes) parser.add_option("-i", "--input", action="store", dest="input", default="", help="Read input data from input file") parser.add_option("-m", "--multi", action="store", dest="multi", default="", help="File containing file name without extension, format must be assigned!") parser.add_option("--prefix", action="store", dest="prefixname", default="", help="Perfix part of file name before id read from -m file") parser.add_option("--mid", action="store", dest="midname", default="", help="Middle part of file name between id read from -m file and -f format extension") parser.add_option("-f", "--format", action="store", dest="format", default="", help="Input file format") parser.add_option("-o", "--output", action="store", dest="output", default="", help="The output file to save result") parser.add_option("-t", "--title", action="store_true", dest="title", default=False, help="Print the feature title") (options, args) = parser.parse_args() if (len(sys.argv)<2): print "Please assign an input file or a file containing all file prefix!" parser.print_help() #parser.print_description() #parser.print_usage() exit(1) # Let the stdout to an output file! stdout=sys.stdout if (options.output!=""): ftmp=open(options.output,'w'); sys.stdout=ftmp datas=[] #savine extra mol datas extrastring="" #saving extra title string # Using a simple input molecule file if (options.input != "" and options.multi == ""): filename=options.input fnamelist=os.path.splitext(filename) # set format fformat=options.format if (fformat==""): fformat=fnamelist[1][1:] fformat=fformat.lower() extradatacolumn=0 if (fformat=='pqrt' or fformat=='pqra' or fformat=='pqrx'): extradatacolumn=1 elif (fformat=='pqrta'): extradatacolumn=2 for datanum in range(0,extradatacolumn): for i in ["Max","Min","Sum","Aver","Std"]: extrastring+=(i+"_"+"data"+str(datanum+1)+" ") for i in ["H","C","N","O","F","P","S","Cl","Br","I"]: for j in ["Max","Min","Sum","Aver","Std"]: extrastring+=(i+"_"+"data"+str(datanum+1)+"_"+j+" ") # Print header if (options.title): print featureString()+extrastring # Special for pqr related format if (fformat=="pqr"): mol=pybel2.readstring('pqr',pqrbug(filename)); elif (fformat=="pqra" or fformat=="pqrx" or fformat=="pqrt"): molstr,datas=pqrx_reader(filename, lastlen=12*extradatacolumn, columns=extradatacolumn); mol=pybel2.readstring('pqr',molstr); elif (fformat=="pqrta"): molstr,datas=pqrx_reader(filename, lastlen=12*extradatacolumn, columns=extradatacolumn); mol=pybel2.readstring('pqr',molstr); else: mol=pybel2.readfile(fformat,filename).next(); # Calculate general features features=CalcFeatures(mol,printInfo=False) # Calculate extra features based on input data file dataout=[] #saving extra output features for data in datas: dataout+=CalcDataElementFeature(mol,data) features+=dataout print fnamelist[0]+" "+" ".join(map(str,features)) # Compound id in a file to process batch elif (options.multi != "" and options.format != ""): fin=open(options.multi) flist=fin.readlines() fin.close() fformat=options.format fformat=fformat.lower() extradatacolumn=0 if (fformat=='pqrt' or fformat=='pqra' or fformat=='pqrx'): extradatacolumn=1 elif (fformat=='pqrta'): extradatacolumn=2 for datanum in range(0,extradatacolumn): for i in ["Max","Min","Sum","Aver","Std"]: extrastring+=(i+"_"+"data"+str(datanum+1)+" ") for i in ["H","C","N","O","F","P","S","Cl","Br","I"]: for j in ["Max","Min","Sum","Aver","Std"]: extrastring+=(i+"_"+"data"+str(datanum+1)+"_"+j+" ") # Print header if (options.title): print featureString()+extrastring for f in flist: try: filename=options.prefixname+f.strip()+options.midname+"."+fformat if (fformat=="pqr"): mol=pybel2.readstring('pqr',pqrbug(filename)); elif (fformat=="pqra" or fformat=="pqrx" or fformat=="pqrt"): molstr,datas=pqrx_reader(filename, lastlen=12*extradatacolumn, columns=extradatacolumn); mol=pybel2.readstring('pqr',molstr); elif (fformat=="pqrta"): molstr,datas=pqrx_reader(filename, lastlen=12*extradatacolumn, columns=extradatacolumn); mol=pybel2.readstring('pqr',molstr); else: mol=pybel2.readfile(fformat,filename).next(); # Calculate general features features=CalcFeatures(mol,printInfo=False) # Calculate extra features based on input data file dataout=[] #saving extra output features for data in datas: dataout+=CalcDataElementFeature(mol,data) features+=dataout print f.strip()+" "+" ".join(map(str,features)) except IOError: print f.strip() else: raise ValueError("No input file!") exit(1) sys.stdout=stdout; if (options.output!=""):ftmp.close()
platinhom/CADDHom
python/molecule/OBabel/pybel_feature.py
Python
gpl-2.0
18,144
[ "Pybel" ]
b9d12280a21c0807d7f77f8c6f65ca15a88de554e8f283a41e3aef2c5a924551
# $HeadURL$ """ Cache for the Plotting service plots """ __RCSID__ = "$Id$" import os import os.path import time import threading from DIRAC import S_OK, S_ERROR, gLogger, rootPath from DIRAC.Core.Utilities.DictCache import DictCache from DIRAC.Core.Utilities import Time from DIRAC.Core.Utilities.Graphs import graph class PlotCache: def __init__( self, plotsLocation = False ): self.plotsLocation = plotsLocation self.alive = True self.__graphCache = DictCache( deleteFunction = _deleteGraph ) self.__graphLifeTime = 600 self.purgeThread = threading.Thread( target = self.purgeExpired ) self.purgeThread.start() def setPlotsLocation( self, plotsDir ): self.plotsLocation = plotsDir for plot in os.listdir( self.plotsLocation ): if plot.find( ".png" ) > 0: plotLocation = "%s/%s" % ( self.plotsLocation, plot ) gLogger.verbose( "Purging %s" % plotLocation ) os.unlink( plotLocation ) def purgeExpired( self ): while self.alive: time.sleep( self.__graphLifeTime ) self.__graphCache.purgeExpired() def getPlot( self, plotHash, plotData, plotMetadata, subplotMetadata ): """ Get plot from the cache if exists, else generate it """ plotDict = self.__graphCache.get( plotHash ) if plotDict == False: basePlotFileName = "%s/%s.png" % ( self.plotsLocation, plotHash ) if subplotMetadata: retVal = graph( plotData, basePlotFileName, plotMetadata, metadata = subplotMetadata ) else: retVal = graph( plotData, basePlotFileName, plotMetadata ) if not retVal[ 'OK' ]: return retVal plotDict = retVal[ 'Value' ] if plotDict[ 'plot' ]: plotDict[ 'plot' ] = os.path.basename( basePlotFileName ) self.__graphCache.add( plotHash, self.__graphLifeTime, plotDict ) return S_OK( plotDict ) def getPlotData( self, plotFileName ): filename = "%s/%s" % ( self.plotsLocation, plotFileName ) try: fd = file( filename, "rb" ) data = fd.read() fd.close() except Exception, v: return S_ERROR( "Can't open file %s: %s" % ( plotFileName, str( v ) ) ) return S_OK( data ) def _deleteGraph( plotDict ): try: for key in plotDict: value = plotDict[ key ] if value and os.path.isfile( value ): os.unlink( value ) except: pass gPlotCache = PlotCache()
calancha/DIRAC
FrameworkSystem/Service/PlotCache.py
Python
gpl-3.0
2,388
[ "DIRAC" ]
400e1f876497612ad5d398315f762fa27418bd6588ec1f85d479572f8f189d73
""" PilotCommand The PilotCommand class is a command class to know about present pilots efficiency. """ from __future__ import absolute_import from __future__ import division from __future__ import print_function __RCSID__ = '$Id$' from DIRAC import S_OK, S_ERROR from DIRAC.ConfigurationSystem.Client.Helpers.Resources import getSites, getCESiteMapping from DIRAC.ResourceStatusSystem.Command.Command import Command from DIRAC.ResourceStatusSystem.Client.ResourceManagementClient import ResourceManagementClient from DIRAC.WorkloadManagementSystem.Client.PilotManagerClient import PilotManagerClient class PilotCommand(Command): """ Pilot "master" Command. """ def __init__(self, args=None, clients=None): super(PilotCommand, self).__init__(args, clients) if 'Pilots' in self.apis: self.pilots = self.apis['Pilots'] else: self.pilots = PilotManagerClient() if 'ResourceManagementClient' in self.apis: self.rmClient = self.apis['ResourceManagementClient'] else: self.rmClient = ResourceManagementClient() def _storeCommand(self, result): """ Stores the results of doNew method on the database. """ for pilotDict in result: resQuery = self.rmClient.addOrModifyPilotCache(site=pilotDict['Site'], cE=pilotDict['CE'], vO=pilotDict.get('OwnerGroup', None), pilotsPerJob=pilotDict['PilotsPerJob'], pilotJobEff=pilotDict['PilotJobEff'], status=pilotDict['Status']) if not resQuery['OK']: return resQuery return S_OK() def _prepareCommand(self): """ JobCommand requires one arguments: - name : <str> """ self.log.debug("_prepareCommand: args:", self.args) if 'name' not in self.args: return S_ERROR('"name" not found in self.args') name = self.args['name'] if 'element' not in self.args: return S_ERROR('element is missing') element = self.args['element'] if 'vO' not in self.args: return S_ERROR('_prepareCommand: "vO" not found in self.args') vo = self.args['vO'] if element not in ['Site', 'Resource']: return S_ERROR('"%s" is not Site nor Resource' % element) return S_OK((element, name, vo)) def doNew(self, masterParams=None): self.log.debug('PilotCommand doNew') if masterParams is not None: element, name = masterParams else: params = self._prepareCommand() if not params['OK']: return params element, name = params['Value'] wmsDict = {} if element == 'Site': wmsDict = {'GridSite': name} elif element == 'Resource': wmsDict = {'ExpandSite': name} else: # You should never see this error return S_ERROR('"%s" is not Site nor Resource' % element) if element == 'Resource': pilotsResultPivot = self.pilots.getGroupedPilotSummary({}, ['GridSite', 'DestinationSite', 'OwnerGroup']) elif element == 'Site': pilotsResultPivot = self.pilots.getGroupedPilotSummary({}, ['GridSite', 'OwnerGroup']) else: # You should never see this error return S_ERROR('"%s" is not Site nor Resource' % element) if not pilotsResultPivot['OK']: return pilotsResultPivot pilotsResults = pilotsResultPivot['Value'] if 'ParameterNames' not in pilotsResults: return S_ERROR('Wrong result dictionary, missing "ParameterNames"') params = pilotsResults['ParameterNames'] if 'Records' not in pilotsResults: return S_ERROR('Wrong formed result dictionary, missing "Records"') records = pilotsResults['Records'] uniformResult = [] for record in records: # This returns a dictionary with the following keys: # 'Site', 'CE', 'Submitted', 'Ready', 'Scheduled', 'Waiting', 'Running', # 'Done', 'Aborted', 'Done_Empty', 'Aborted_Hour', 'Total', 'PilotsPerJob', # 'PilotJobEff', 'Status', 'InMask' pilotDict = dict(zip(params, record)) pilotDict['PilotsPerJob'] = float(pilotDict['PilotsPerJob']) pilotDict['PilotJobEff'] = float(pilotDict['PilotJobEff']) uniformResult.append(pilotDict) storeRes = self._storeCommand(uniformResult) if not storeRes['OK']: return storeRes return S_OK(uniformResult) def doCache(self): self.log.debug('PilotCommand doCache') params = self._prepareCommand() if not params['OK']: return params element, name, vo = params['Value'] if element == 'Site': # WMS returns Site entries with CE = 'Multiple' site, ce = name, 'Multiple' elif element == 'Resource': site, ce = None, name else: # You should never see this error return S_ERROR('"%s" is not Site nor Resource' % element) result = self.rmClient.selectPilotCache(site=site, cE=ce) if result['OK']: result = S_OK([dict(zip(result['Columns'], res)) for res in result['Value']]) self.log.debug("PilotCommand doCache result: ", result) return result def doMaster(self): self.log.debug('PilotCommand doMaster') siteNames = getSites() if not siteNames['OK']: return siteNames siteNames = siteNames['Value'] res = getCESiteMapping() if not res['OK']: return res ces = list(res['Value']) pilotResults = self.doNew(('Site', siteNames)) if not pilotResults['OK']: self.metrics['failed'].append(pilotResults['Message']) pilotResults = self.doNew(('Resource', ces)) if not pilotResults['OK']: self.metrics['failed'].append(pilotResults['Message']) return S_OK(self.metrics)
yujikato/DIRAC
src/DIRAC/ResourceStatusSystem/Command/PilotCommand.py
Python
gpl-3.0
5,800
[ "DIRAC" ]
154042b7cb2afb7c0af35d93793286e4cda6e62cdae391646334d3451eaab8b2
""" The controllers module provides different controller classes, applicable to different simulations. A controller object's job is to control simulations- At a high level a controller objects accepts a list of parameters and chromosomes and (usually) returns corresponding simulation data. This is implemented polymporphically in subclasses. Each controller class must therefore provide a run method, which is used by the evaluator to run a simulation. A controller must be able to accept simulation parameters (chromosomes) from the evaluator. The evaluator is therefore only concerned with assigining fitness to chromosomes. On the whole this allows for deep modularization - as long as the user can provide a controller which will (for instance) reutrn sample and time arrays for arbitrary chromosome and parameter lists a range of evaluators would be able to utilise it. """ import os import subprocess import math class __Controller(): """ Controller base class """ def run(self, candidates, parameters): """ At a high level - accepts a list of parameters and chromosomes and (usually) returns corresponding simulation data. This is implemented polymporphically in subclasses. """ raise NotImplementedError("Valid controller requires run method!") class CLIController(__Controller): """ Control simulations via command line arguments executed through the Python os module. """ def __init__(self,cli_argument): self.cli_argument = cli_argument def run(self, candidates, parameters, fitness_filename='evaluations'): #"Run simulation" for chromosome in candidates: self.chromosome=chromosome self.parameters=parameters #actually unneeded #this manipulation is slightly messy, done for conversion of chromosome #into something that can be executed on the shell chromosome_str = ''.join(str(e)+' ' for e in chromosome) cla = self.cli_argument+' '+fitness_filename+' '+chromosome_str print(cla) subprocess.call(cla, shell=True) class NrnProject(__Controller): """ Run an nrnproject simulation based on optimizer parameters.""" def __init__(self, nrnproject_path, db_path, exp_id=None): self.sim_main_path=os.path.join(nrnproject_path, 'src/simrunner.py') self.nrnproject_path=nrnproject_path self.db_path=db_path self.exp_id=exp_id def __generate_cla(self): sim_var_string = self.__generate_sim_var_string() cla='python '+ self.sim_main_path + sim_var_string return cla def __generate_sim_var_string(self): sim_var_string='' for i in enumerate(self.parameters): sim_var_string+= ' "sim_var[\'' + i[1] +'\'] = ' + str(self.chromosome[i[0]]) + '\"' if self.exp_id !=None: sim_var_string+= ' "sim_var[\'exp_id\'] ='+ str(self.exp_id) + '\"' return sim_var_string def run(self, candidates, parameters): #"""Run simulations""" import sqldbutils exp_data_array=[] for chromosome in candidates: self.chromosome=chromosome self.parameters=parameters exp_id = sqldbutils.generate_exp_ids(self.db_path) cla=self.__generate_cla() os.chdir(self.nrnproject_path+'/src/') #there should be a smarter way os.system(cla) print(self.db_path) print(exp_id) exp_data=sqldbutils.sim_data(self.db_path,exp_id) exp_data_array.append(exp_data) return exp_data_array class __CondorContext(object): """Context for Condor-based grid""" def __init__(self, host, username, password, port): self.messagehost=ssh_utils.host(host,username, password,port) def __split_list(self, alist, wanted_parts=1): length = len(alist) return [ alist[i*length // wanted_parts: (i+1)*length // wanted_parts] for i in range(wanted_parts) ] def __prepare_candidates(self,candidates,candidates_per_job=1): #Split candidate list into smaller ones (jobs): #and make a job list if optimizer_params.candidates_in_job != None: candidates_in_job=optimizer_params.candidates_in_job else: candidates_in_job=candidates_per_job num_candidates=len(candidates) ids=range(num_candidates) enumerated_candidates=zip(candidates,ids) num_jobs=num_candidates/candidates_in_job self.num_jobs=num_jobs self.job_list=self.__split_list(enumerated_candidates,wanted_parts=self.num_jobs) def __make_job_file(self,job,job_number): #write the header: filepath = os.path.join(self.tmpdir, 'run' + str(job_number) + '.sh') run_shell = open(filepath, 'w') run_shell.write('#!/bin/bash\n') run_shell.write('reldir=`dirname $0`\n') run_shell.write('cd $reldir\n') run_shell.write('directory=`pwd`\n') run_shell.write('pndirectory=$directory\n') run_shell.write('#Untar the file:\n') run_shell.write('/bin/tar xzf ./portable-neuron.tar.gz\n') tarfile_name=optimizer_params.tarred_nrnproj run_shell.write('/bin/tar xzf ./'+tarfile_name+'\n') #CandidateData_list=[] for enumerated_candidate in job: chromosome = enumerated_candidate[0] candidate_info = CandidateData(chromosome) exp_id = enumerated_candidate[1] candidate_info.set_exp_id(exp_id) candidate_info.set_job_num(job_number) self.CandidateData_list.append(candidate_info) nproj = controllers.NrnProjSimRun(optimizer_params.project_path, chromosome) run_shell.write('#issue the commands\n') run_shell.write('$pndirectory/pnpython.sh \ $directory/src/simrunner.py "sim_var[\'exp_id\'] \ = ' + str(exp_id) + '\" ' + '"sim_var[\'''dbname''\'] \ = \'outputdb' + str(job_number) + '.sqlite\'"' + nproj.sim_var_string + '\n') run_shell.write('echo \'done\'\n') run_shell.write('cp $directory/sims/outputdb' + str(job_number) + '.sqlite $directory\n') #self.CandidateData_list=CandidateData_list run_shell.close() def __make_submit_file(self): """ write the condor submit files""" filepath = os.path.join(self.tmpdir, 'submitfile.submit') submit_file=open(filepath,'w') submit_file.write('universe = vanilla\n') submit_file.write('log = pneuron.log\n') submit_file.write('Error = err.$(Process)\n') submit_file.write('Output = out.$(Process)\n') submit_file.write('requirements = GLIBC == "2.11"\n') tarfile_name=optimizer_params.tarred_nrnproj submit_file.write('transfer_input_files = portable-neuron.tar.gz,'+tarfile_name+'\n') submit_file.write('should_transfer_files = yes\n') submit_file.write('when_to_transfer_output = on_exit_or_evict\n') #this is where you have to do the clever stuff: for shellno in range(self.num_jobs): submit_file.write('executable = run'+str(shellno)+'.sh\n') submit_file.write('queue\n') #finally close the submit file submit_file.close() def __build_condor_files(self,candidates,parameters,candidates_per_job=100): #prepare list of candidates to be farmed on grid: self.__prepare_candidates(candidates,candidates_per_job=100) #make the job files (shell scripts to be executed on the execute nodes) job_number=0 #run shell script number for job in self.job_list: self.__make_job_file(job,job_number) job_number+=1 #now make the submit file self.__make_submit_file() def __delete_remote_files(self,host): import ssh_utils command='rm -rf ./*' ssh_utils.issue_command(host, command) def __put_multiple_files(self,host,filelist,localdir='/',remotedir='/'): import ssh_utils for file in filelist: localpath=os.path.join(localdir,file) remotepath=os.path.join(remotedir,file) ssh_utils.put_file(host,localpath,remotepath) class NrnProjectCondor(NrnProject): """ Run NrnProject-based simulations on a Condor-managed federated system """ def __init__(self,host,username,password,port=80, local_analysis=False,candidates_per_job=100): super(NrnProjectCondor,self).__init__() #other things like the number of nodes to divide the work onto and #host connection parameters need to go into this constructor #the more I think about it the less this seems like a good idea #though if local_analysis: self.run=self.__local_run else: self.run=self.__remote_run__ #make a context which provides grid utilities self.context=__CondorContext(host,username,password,port) self.cpj=candidates_per_job def __condor_run(self,candidates,parameters): """ Run simulations on grid and analyse data locally (???I'm quite confused here...there is a mistake somewhere as the name doesn't match the description - which method is which?) Once each generation has finished, all data is pulled to local workstation in form of sqlite databases (1 database per job) and these are analysed and the fitness estimated sequentially the fitness array is then returned. """ import time import ssh_utils #Build submit and runx.sh files, exp_id now corresponds #to position in chromosome and fitness arrays self.context.__build_condor_files(candidates,parameters, candidates_per_job=self.cpj) #This is a file handling block.. #delete everything in the ssh_utilse directory you're about to put files in self.__delete_remote_files__() filelist=os.listdir(self.tmpdir) #copy local files over, some stuff is missing here as it needs to be an attribute in the condor context self.__put_multiple_files(filelist,localdir=self.tmpdir) filelist=os.listdir(self.portableswdir) #copy portable software files over: self.__put_multiple_files(filelist,localdir=self.portableswdir) #issue a command to the message host to issue commands to the grid: ssh_utils.issue_command(context.messagehost, 'export PATH=/opt/Condor/release/bin:$PATH\ncondor_submit submitfile.submit') #make a list of the database files we need: self.jobdbnames=[] for job_num in range(self.num_jobs): jobdbname='outputdb'+str(job_num)+'.sqlite' self.jobdbnames.append(jobdbname) #wait till we know file exists: dbs_created=False pulled_dbs=[] # list of databases which have been extracted from remote server while (dbs_created==False): print('waiting..') time.sleep(20) print('checking if dbs created:') command='ls' remote_filelist=ssh_utils.issue_command(self.messagehost, command) for jobdbname in self.jobdbnames: db_exists=jobdbname+'\n' in remote_filelist if (db_exists==False): print(jobdbname+' has not been generated') dbs_created=False elif db_exists==True and jobdbname not in pulled_dbs: print(jobdbname+' has been generated') remotefile=optimizer_params.remotedir+jobdbname localpath=os.path.join(self.datadir,str(self.generation)+jobdbname) ssh_utils.get_file(self.messagehost,remotefile,localpath) pulled_dbs.append(jobdbname) #so that it is not extracted more than once #here pop-in the fitness evaluation if len(pulled_dbs)==len(self.jobdbnames): dbs_created=True #this block can be simplified, it need simply return exp_data containers fitness=[] for CandidateData in self.CandidateData_list: job_num = CandidateData.job_num dbname=str(self.generation)+'outputdb'+str(job_num)+'.sqlite' dbpath=os.path.join(self.datadir,dbname) exp_id=CandidateData.exp_id connection=sqldbutils.db_connect(dbpath) #establish a database connection query='SELECT numerical_value\ FROM output_params WHERE experiment_id=\ '+str(exp_id)+' AND parameter="fitness"' exp_fitness=sqldbutils.execute_query(connection,query) exp_fitness=exp_fitness.fetchall() exp_fitness=exp_fitness[0][0] print('Fitness:') print(exp_fitness) fitness.append(exp_fitness) self.generation+=1 return fitness ###ignore this for now### def __local_evaluate(self,candidates,args): import time analysis self.CandidateData_list=[] analysis_var=self.analysis_var #Build submitfile.submit and runx.sh files: self.__buil_condor_files(candidates) #exp_id now corresponds to position in chromosome/fitness array fitness=[] #submit the jobs to the grid os.chdir(self.tmpdir) os.system('condor_submit submitfile.submit') #wait till you know file exists: dbs_created=False while (dbs_created==False): print('checking if dbs created:') for job_num in range(self.num_jobs): jobdbname='outputdb'+str(job_num)+'.sqlite' jobdbpath=os.path.join(self.datadir,jobdbname) print(jobdbpath) db_exists=os.path.exists(jobdbpath) if (db_exists==False): time.sleep(60) dbs_created=False break dbs_created=True for CandidateData in self.CandidateData_list: job_num = CandidateData.job_num dbname='/outputdb'+str(job_num)+'.sqlite' dbpath=self.datadir+dbname exp_id=CandidateData.exp_id exp_data=sqldbutils.sim_data(dbpath,exp_id) analysis=analysis.IClampAnalysis(exp_data.samples,exp_data.t,analysis_var,5000,10000) exp_fitness=analysis.evaluate_fitness(self.targets,self.weights,cost_function=analysis.normalised_cost_function) fitness.append(exp_fitness) for job_num in range(self.num_jobs): jobdbname='outputdb'+str(job_num)+'.sqlite' jobdbpath=os.path.join(self.datadir,jobdbname) print(jobdbpath) os.remove(jobdbpath) return fitness class SineWaveController(__Controller): """ Simple sine wave generator which takes a number of variables ('amp', 'period', 'offset') and produces an output based on these. """ def __init__(self, sim_time, dt): self.sim_time = sim_time self.dt = dt def run_individual(self, sim_var, gen_plot=False, show_plot=False): """ Run an individual simulation. The candidate data has been flattened into the sim_var dict. The sim_var dict contains parameter:value key value pairs, which are applied to the model before it is simulated. """ print(">> Running individual: %s"%(sim_var)) import numpy as np t = 0 times = [] volts = [] while t <= self.sim_time: v = sim_var['offset'] + (sim_var['amp'] * (math.sin( 2*math.pi * t/sim_var['period']))) times.append(t) volts.append(v) t += self.dt if gen_plot: from matplotlib import pyplot as plt info = "" for key in sim_var.keys(): info+="%s=%s "%(key, sim_var[key]) plt.plot(times,volts, label=info) plt.legend(loc='upper center', bbox_to_anchor=(0.5, -0.05), fancybox=True, shadow=True, ncol=1) if show_plot: plt.show() return np.array(times), np.array(volts) def run(self,candidates,parameters): """ Run simulation for each candidate This run method will loop through each candidate and run the simulation corresponding to its parameter values. It will populate an array called traces with the resulting voltage traces for the simulation and return it. """ traces = [] for candidate in candidates: sim_var = dict(zip(parameters,candidate)) t,v = self.run_individual(sim_var) traces.append([t,v]) return traces
vellamike/neurotune
neurotune/controllers.py
Python
bsd-3-clause
17,830
[ "NEURON" ]
2ce68aa3babc85e70e722695cc13b853e45912f5e7fcdff5fef0702c5ff3e570
''' PathwayGenie (c) GeneGenie Bioinformatics Ltd. 2018 PathwayGenie is licensed under the MIT License. To view a copy of this license, visit <http://opensource.org/licenses/MIT/>. @author: neilswainston ''' # pylint: disable=no-member # pylint: disable=too-many-arguments import RNA def run(cmd, sequences, temp, dangles, energy_gap=None, bp_x=None, bp_y=None): '''Runs ViennaRNA.''' sequences = [str(seq) for seq in sequences] if cmd == 'mfe': return _mfe(sequences, temp, dangles) if cmd == 'subopt': return _subopt(sequences, energy_gap, temp, dangles) if cmd == 'energy': return _energy(sequences, bp_x, bp_y, temp, dangles) return None def _mfe(sequences, temp=37.0, dangles='some'): '''mfe.''' model = RNA.md() model.temperature = temp model.dangles = _get_dangles(dangles) result = RNA.fold_compound(sequences[0], model).mfe() bp_x, bp_y = _get_numbered_pairs(result[0]) if bp_x and bp_y: return [result[1]], [bp_x], [bp_y] return [0.0], [[]], [[]] def _subopt(sequences, energy_gap, temp=37.0, dangles='some'): '''subopt.''' model = RNA.md() model.temperature = temp model.dangles = _get_dangles(dangles) results = \ RNA.fold_compound('&'.join(sequences), model).subopt(int(energy_gap)) energies = [] bp_xs = [] bp_ys = [] for result in results: bp_x, bp_y = _get_numbered_pairs(result.structure) if bp_x and bp_y: energies.append(result.energy) bp_xs.append(bp_x) bp_ys.append(bp_y) return energies, bp_xs, bp_ys def _energy(sequences, bp_x, bp_y, temp=37.0, dangles='some'): '''energy.''' model = RNA.md() model.temperature = temp model.dangles = _get_dangles(dangles) sequence = '&'.join(sequences) structure = _get_brackets([len(seq) for seq in sequences], bp_x, bp_y) return RNA.fold_compound(sequence, model).eval_structure(structure) def _get_dangles(dangles): '''Get dangles.''' return 0 if dangles == 'none' else 1 if dangles == 'some' else 2 def _get_numbered_pairs(bracket_str): '''_get_numbered_pairs''' bracket_count = bracket_str.count(')') if not bracket_count: return [None, None] bp_x = [] bp_y = [None for _ in range(bracket_count)] last_nt_x = [] strand_num = 0 for pos, letter in enumerate(bracket_str): if letter == '(': bp_x.append(pos - strand_num) last_nt_x.append(pos - strand_num) elif letter == ')': nt_x = last_nt_x.pop() nt_x_pos = bp_x.index(nt_x) bp_y[nt_x_pos] = pos - strand_num elif letter == '&': strand_num += 1 return [[pos + 1 for pos in bp_x], [pos + 1 for pos in bp_y]] def _get_brackets(seq_lens, bp_x, bp_y): '''_get_brackets''' bp_x = [pos - 1 for pos in bp_x] bp_y = [pos - 1 for pos in bp_y] brackets = [] counter = 0 for seq_len in seq_lens: for pos in range(counter, seq_len + counter): if pos in bp_x: brackets.append('(') elif pos in bp_y: brackets.append(')') else: brackets.append('.') counter += seq_len return ''.join(brackets)
neilswainston/PathwayGenie
parts_genie/vienna_utils.py
Python
mit
3,317
[ "VisIt" ]
93f387907354379e3b3e501da41e6c41f4be0ce5970d3c70155cee68073aa894
# -*- coding: utf-8 -*- """ Unitary Event (UE) analysis is a statistical method to analyze in a time resolved manner excess spike correlation between simultaneously recorded neurons by comparing the empirical spike coincidences (precision of a few ms) to the expected number based on the firing rates of the neurons (see :cite:`unitary_event_analysis-Gruen99_67`). Background ---------- It has been proposed that cortical neurons organize dynamically into functional groups (“cell assemblies”) by the temporal structure of their joint spiking activity. The Unitary Events analysis method detects conspicuous patterns of synchronous spike activity among simultaneously recorded single neurons. The statistical significance of a pattern is evaluated by comparing the empirical number of occurrences to the number expected given the firing rates of the neurons. Key elements of the method are the proper formulation of the null hypothesis and the derivation of the corresponding count distribution of synchronous spike events used in the significance test. The analysis is performed in a sliding window manner and yields a time-resolved measure of significant spike synchrony. For further reading, see :cite:`unitary_event_analysis-Riehle97_1950,unitary_event_analysis-Gruen02_43,\ unitary_event_analysis-Gruen02_81,unitary_event_analysis-Gruen03,\ unitary_event_analysis-Gruen09_1126,unitary_event_analysis-Gruen99_67`. Tutorial -------- :doc:`View tutorial <../tutorials/unitary_event_analysis>` Run tutorial interactively: .. image:: https://mybinder.org/badge.svg :target: https://mybinder.org/v2/gh/NeuralEnsemble/elephant/master ?filepath=doc/tutorials/unitary_event_analysis.ipynb .. current_module elephant.unitary_event_analysis Functions overview ------------------ .. autosummary:: :toctree: toctree/unitary_event_analysis/ jointJ_window_analysis :copyright: Copyright 2015-2020 by the Elephant team, see `doc/authors.rst`. :license: Modified BSD, see LICENSE.txt for details. """ from __future__ import division, print_function, unicode_literals import sys import warnings import neo import numpy as np import quantities as pq import scipy import elephant.conversion as conv from elephant.utils import is_binary __all__ = [ "hash_from_pattern", "inverse_hash_from_pattern", "n_emp_mat", "n_emp_mat_sum_trial", "n_exp_mat", "n_exp_mat_sum_trial", "gen_pval_anal", "jointJ", "jointJ_window_analysis" ] def hash_from_pattern(m, base=2): """ Calculate for a spike pattern or a matrix of spike patterns (provide each pattern as a column) composed of N neurons a unique number. Parameters ---------- m: np.ndarray or list 2-dim ndarray spike patterns represented as a binary matrix (i.e., matrix of 0's and 1's). Rows and columns correspond to patterns and neurons, respectively. base: integer The base for hashes calculation. Default is 2. Returns ------- np.ndarray An array containing the hash values of each pattern, shape: (number of patterns). Raises ------ ValueError If matrix `m` has wrong orientation. Examples -------- With `base=2`, the hash of `[0, 1, 1]` is `0*2^2 + 1*2^1 + 1*2^0 = 3`. >>> import numpy as np >>> hash_from_pattern([0, 1, 1]) 3 >>> import numpy as np >>> m = np.array([[0, 1, 0, 0, 1, 1, 0, 1], ... [0, 0, 1, 0, 1, 0, 1, 1], ... [0, 0, 0, 1, 0, 1, 1, 1]]) >>> hash_from_pattern(m) array([0, 4, 2, 1, 6, 5, 3, 7]) """ m = np.asarray(m) n_neurons = m.shape[0] # check the entries of the matrix if not is_binary(m): raise ValueError('Patterns should be binary: 0 or 1') # generate the representation # don't use numpy - it's upperbounded by int64 powers = [base ** x for x in range(n_neurons)][::-1] # calculate the binary number by use of scalar product return np.dot(powers, m) def inverse_hash_from_pattern(h, N, base=2): """ Calculate the binary spike patterns (matrix) from hash values `h`. Parameters ---------- h: list of int Array-like of integer hash values of length of the number of patterns. N: integer The number of neurons. base: integer The base, used to generate the hash values. Default is 2. Returns ------- m: (N, P) np.ndarray A matrix of shape: (N, number of patterns) Raises ------ ValueError If the hash is not compatible with the number of neurons. The hash value should not be larger than the largest possible hash number with the given number of neurons (e.g. for N = 2, max(hash) = 2^1 + 2^0 = 3, or for N = 4, max(hash) = 2^3 + 2^2 + 2^1 + 2^0 = 15). Examples --------- >>> import numpy as np >>> h = np.array([3, 7]) >>> N = 4 >>> inverse_hash_from_pattern(h, N) array([[1, 1], [1, 1], [0, 1], [0, 0]]) """ h = np.asarray(h) # this will cast to object type if h > int64 if sys.version_info < (3,): integer_types = (int, long) else: integer_types = (int,) if not all(isinstance(v, integer_types) for v in h.tolist()): # .tolist() is necessary because np.int[64] is not int raise ValueError("hash values should be integers") # check if the hash values are not greater than the greatest possible # value for N neurons with the given base powers = np.array([base ** x for x in range(N)])[::-1] if any(h > sum(powers)): raise ValueError( "hash value is not compatible with the number of neurons N") m = h // np.expand_dims(powers, axis=1) m %= base # m is a binary matrix now m = m.astype(int) # convert object to int if the hash was > int64 return m def n_emp_mat(mat, pattern_hash, base=2): """ Count the occurrences of spike coincidence patterns in the given spike trains. Parameters ---------- mat : (N, M) np.ndarray Binned spike trains of N neurons. Rows and columns correspond to neurons and temporal bins, respectively. pattern_hash: list of int List of hash values, representing the spike coincidence patterns of which occurrences are counted. base: integer The base, used to generate the hash values. Default is 2. Returns ------- N_emp: np.ndarray The number of occurrences of the given patterns in the given spiketrains. indices: list of list List of lists of int. Indices indexing the bins where the given spike patterns are found in `mat`. Same length as `pattern_hash`. `indices[i] = N_emp[i] = pattern_hash[i]` Raises ------ ValueError If `mat` is not a binary matrix. Examples -------- >>> mat = np.array([[1, 0, 0, 1, 1], ... [1, 0, 0, 1, 0]]) >>> pattern_hash = np.array([1,3]) >>> n_emp, n_emp_indices = n_emp_mat(mat, pattern_hash) >>> print(n_emp) [ 0. 2.] >>> print(n_emp_indices) [array([]), array([0, 3])] """ # check if the mat is zero-one matrix if not is_binary(mat): raise ValueError("entries of mat should be either one or zero") h = hash_from_pattern(mat, base=base) N_emp = np.zeros(len(pattern_hash)) indices = [] for idx_ph, ph in enumerate(pattern_hash): indices_tmp = np.where(h == ph)[0] indices.append(indices_tmp) N_emp[idx_ph] = len(indices_tmp) return N_emp, indices def n_emp_mat_sum_trial(mat, pattern_hash): """ Calculate empirical number of observed patterns, summed across trials. Parameters ---------- mat: np.ndarray Binned spike trains are represented as a binary matrix (i.e., matrix of 0's and 1's), segmented into trials. Trials should contain an identical number of neurons and an identical number of time bins. the entries are zero or one 0-axis --> trials 1-axis --> neurons 2-axis --> time bins pattern_hash: list of int Array of hash values of length of the number of patterns. Returns ------- N_emp: np.ndarray The number of occurences of the given spike patterns in the given spike trains, summed across trials. Same length as `pattern_hash`. idx_trials: list of int List of indices of `mat` for each trial in which the specific pattern has been observed. 0-axis --> trial 1-axis --> list of indices for the chosen trial per entry of `pattern_hash` Raises ------ ValueError If `mat` has the wrong orientation. If `mat` is not a binary matrix. Examples --------- >>> mat = np.array([[[1, 1, 1, 1, 0], ... [0, 1, 1, 1, 0], ... [0, 1, 1, 0, 1]], ... [[1, 1, 1, 1, 1], ... [0, 1, 1, 1, 1], ... [1, 1, 0, 1, 0]]]) >>> pattern_hash = np.array([4,6]) >>> n_emp_sum_trial, n_emp_sum_trial_idx = \ ... n_emp_mat_sum_trial(mat, pattern_hash) >>> n_emp_sum_trial array([ 1., 3.]) >>> n_emp_sum_trial_idx [[array([0]), array([3])], [array([], dtype=int64), array([2, 4])]] """ num_patt = len(pattern_hash) N_emp = np.zeros(num_patt) idx_trials = [] # check if the mat is zero-one matrix if not is_binary(mat): raise ValueError("entries of mat should be either one or zero") for mat_tr in mat: N_emp_tmp, indices_tmp = n_emp_mat(mat_tr, pattern_hash, base=2) idx_trials.append(indices_tmp) N_emp += N_emp_tmp return N_emp, idx_trials def _n_exp_mat_analytic(mat, pattern_hash): """ Calculates the expected joint probability for each spike pattern analytically. """ marg_prob = np.mean(mat, 1, dtype=float) # marg_prob needs to be a column vector, so we # build a two dimensional array with 1 column # and len(marg_prob) rows marg_prob = np.expand_dims(marg_prob, axis=1) n_neurons = mat.shape[0] m = inverse_hash_from_pattern(pattern_hash, n_neurons) nrep = m.shape[1] # multipyling the marginal probability of neurons with regard to the # pattern pmat = np.multiply(m, np.tile(marg_prob, (1, nrep))) + \ np.multiply(1 - m, np.tile(1 - marg_prob, (1, nrep))) return np.prod(pmat, axis=0) * float(mat.shape[1]) def _n_exp_mat_surrogate(mat, pattern_hash, n_surr=1): """ Calculates the expected joint probability for each spike pattern with spike time randomization surrogate """ if len(pattern_hash) > 1: raise ValueError('surrogate method works only for one pattern!') N_exp_array = np.zeros(n_surr) for rz_idx, rz in enumerate(np.arange(n_surr)): # row-wise shuffling all elements of zero-one matrix mat_surr = np.copy(mat) [np.random.shuffle(row) for row in mat_surr] N_exp_array[rz_idx] = n_emp_mat(mat_surr, pattern_hash)[0][0] return N_exp_array def n_exp_mat(mat, pattern_hash, method='analytic', n_surr=1): """ Calculates the expected joint probability for each spike pattern. Parameters ---------- mat: np.ndarray The entries are in the range [0, 1]. The only possibility when the entries are floating point values is when the `mat` is calculated with the flag `analytic_TrialAverage` in `n_exp_mat_sum_trial()`. Otherwise, the entries are binary. 0-axis --> neurons 1-axis --> time bins pattern_hash: list of int List of hash values, length: number of patterns method: {'analytic', 'surr'}, optional The method with which the expectation is calculated. 'analytic' -- > analytically 'surr' -- > with surrogates (spike time randomization) Default is 'analytic'. n_surr: int number of surrogates for constructing the distribution of expected joint probability. Default is 1 and this number is needed only when method = 'surr' Returns ------- np.ndarray if method is 'analytic': An array containing the expected joint probability of each pattern, shape: (number of patterns,) if method is 'surr': 0-axis --> different realizations, length = number of surrogates 1-axis --> patterns Raises ------ ValueError If `mat` has the wrong orientation. Examples -------- >>> mat = np.array([[1, 1, 1, 1], ... [0, 1, 0, 1], ... [0, 0, 1, 0]]) >>> pattern_hash = np.array([5,6]) >>> n_exp_anal = n_exp_mat(mat, pattern_hash, method='analytic') >>> n_exp_anal [ 0.5 1.5 ] >>> n_exp_surr = n_exp_mat(mat, pattern_hash, method='surr', n_surr=5000) >>> print(n_exp_surr) [[ 1. 1.] [ 2. 0.] [ 2. 0.] ..., [ 2. 0.] [ 2. 0.] [ 1. 1.]] """ # check if the mat is in the range [0, 1] if not np.all((mat >= 0) & (mat <= 1)): raise ValueError("entries of mat should be in range [0, 1]") if method == 'analytic': return _n_exp_mat_analytic(mat, pattern_hash) if method == 'surr': return _n_exp_mat_surrogate(mat, pattern_hash, n_surr=n_surr) def n_exp_mat_sum_trial(mat, pattern_hash, method='analytic_TrialByTrial', n_surr=1): """ Calculates the expected joint probability for each spike pattern sum over trials. Parameters ---------- mat: np.ndarray Binned spike trains represented as a binary matrix (i.e., matrix of 0's and 1's), segmented into trials. Trials should contain an identical number of neurons and an identical number of time bins. The entries of mat should be a list of a list where 0-axis is trials and 1-axis is neurons. 0-axis --> trials 1-axis --> neurons 2-axis --> time bins pattern_hash: list of int List of hash values, length: number of patterns method: str method with which the unitary events whould be computed 'analytic_TrialByTrial' -- > calculate the expectency (analytically) on each trial, then sum over all trials. 'analytic_TrialAverage' -- > calculate the expectency by averaging over trials. (cf. Gruen et al. 2003) 'surrogate_TrialByTrial' -- > calculate the distribution of expected coincidences by spike time randomzation in each trial and sum over trials. Default is 'analytic_trialByTrial'. n_surr: int, optional The number of surrogate to be used. Default is 1. Returns ------- n_exp: np.ndarray An array containing the expected joint probability of each pattern summed over trials,shape: (number of patterns,) Raises ------ ValueError If `method` is not one of the specified above. Examples -------- >>> mat = np.array([[[1, 1, 1, 1, 0], ... [0, 1, 1, 1, 0], ... [0, 1, 1, 0, 1]], ... [[1, 1, 1, 1, 1], ... [0, 1, 1, 1, 1], ... [1, 1, 0, 1, 0]]]) >>> pattern_hash = np.array([5,6]) >>> n_exp_anal = n_exp_mat_sum_trial(mat, pattern_hash) >>> print(n_exp_anal) array([ 1.56, 2.56]) """ if method == 'analytic_TrialByTrial': n_exp = np.zeros(len(pattern_hash)) for mat_tr in mat: n_exp += n_exp_mat(mat_tr, pattern_hash, method='analytic') elif method == 'analytic_TrialAverage': n_exp = n_exp_mat( np.mean(mat, axis=0), pattern_hash, method='analytic') * mat.shape[0] elif method == 'surrogate_TrialByTrial': n_exp = np.zeros(n_surr) for mat_tr in mat: n_exp += n_exp_mat(mat_tr, pattern_hash, method='surr', n_surr=n_surr) else: raise ValueError( "The method only works on the zero_one matrix at the moment") return n_exp def gen_pval_anal(mat, pattern_hash, method='analytic_TrialByTrial', n_surr=1): """ Compute the expected coincidences and a function to calculate the p-value for the given empirical coincidences. This function generates a poisson distribution with the expected value calculated by `mat`. It returns a function that gets the empirical coincidences, `n_emp`, and calculates a p-value as the area under the poisson distribution from `n_emp` to infinity. Parameters ---------- mat: np.ndarray Binned spike trains represented as a binary matrix (i.e., matrix of 0's and 1's), segmented into trials. Trials should contain an identical number of neurons and an identical number of time bins. The entries of mat should be a list of a list where 0-axis is trials and 1-axis is neurons. 0-axis --> trials 1-axis --> neurons 2-axis --> time bins pattern_hash: list of int List of hash values, length: number of patterns method: string method with which the unitary events whould be computed 'analytic_TrialByTrial' -- > calculate the expectency (analytically) on each trial, then sum over all trials. ''analytic_TrialAverage' -- > calculate the expectency by averaging over trials. Default is 'analytic_trialByTrial' (cf. Gruen et al. 2003) n_surr: integer, optional number of surrogate to be used Default is 1 Returns -------- pval_anal: callable The function that calculates the p-value for the given empirical coincidences. n_exp: list List of expected coincidences. Raises ------ ValueError If `method` is not one of the specified above. Examples -------- >>> mat = np.array([[[1, 1, 1, 1, 0], ... [0, 1, 1, 1, 0], ... [0, 1, 1, 0, 1]], ... [[1, 1, 1, 1, 1], ... [0, 1, 1, 1, 1], ... [1, 1, 0, 1, 0]]]) >>> pattern_hash = np.array([5, 6]) >>> pval_anal, n_exp = gen_pval_anal(mat, pattern_hash) >>> n_exp array([ 1.56, 2.56]) """ if method == 'analytic_TrialByTrial' or method == 'analytic_TrialAverage': n_exp = n_exp_mat_sum_trial(mat, pattern_hash, method=method) def pval(n_emp): p = 1. - scipy.special.gammaincc(n_emp, n_exp) return p elif method == 'surrogate_TrialByTrial': n_exp = n_exp_mat_sum_trial( mat, pattern_hash, method=method, n_surr=n_surr) def pval(n_emp): hist = np.bincount(np.int64(n_exp)) exp_dist = hist / float(np.sum(hist)) if len(n_emp) > 1: raise ValueError('In surrogate method the p_value can be' 'calculated only for one pattern!') return np.sum(exp_dist[int(n_emp[0]):]) else: raise ValueError("Method is not allowed: {method}".format( method=method)) return pval, n_exp def jointJ(p_val): """ Surprise measurement. Logarithmic transformation of joint-p-value into surprise measure for better visualization as the highly significant events are indicated by very low joint-p-values. Parameters ---------- p_val: list of float List of p-values of statistical tests for different pattern. Returns ------- Js: list of float List of surprise measures. Examples -------- >>> p_val = np.array([0.31271072, 0.01175031]) >>> jointJ(p_val) array([0.3419968 , 1.92481736]) """ p_arr = np.asarray(p_val) Js = np.log10(1 - p_arr) - np.log10(p_arr) return Js def _rate_mat_avg_trial(mat): """ Calculates the average firing rate of each neurons across trials. """ n_trials, n_neurons, n_bins = np.shape(mat) psth = np.zeros(n_neurons, dtype=np.float32) for tr, mat_tr in enumerate(mat): psth += np.sum(mat_tr, axis=1) return psth / (n_bins * n_trials) def _bintime(t, bin_size): """ Change the real time to `bin_size` units. """ t_dl = t.rescale('ms').magnitude bin_size_dl = bin_size.rescale('ms').magnitude return np.floor(np.array(t_dl) / bin_size_dl).astype(int) def _winpos(t_start, t_stop, winsize, winstep, position='left-edge'): """ Calculate the position of the analysis window. """ t_start_dl = t_start.rescale('ms').magnitude t_stop_dl = t_stop.rescale('ms').magnitude winsize_dl = winsize.rescale('ms').magnitude winstep_dl = winstep.rescale('ms').magnitude # left side of the window time if position == 'left-edge': ts_winpos = np.arange( t_start_dl, t_stop_dl - winsize_dl + winstep_dl, winstep_dl) * pq.ms else: raise ValueError( 'the current version only returns left-edge of the window') return ts_winpos def _UE(mat, pattern_hash, method='analytic_TrialByTrial', n_surr=1): """ Return the default results of unitary events analysis (Surprise, empirical coincidences and index of where it happened in the given mat, n_exp and average rate of neurons) """ rate_avg = _rate_mat_avg_trial(mat) n_emp, indices = n_emp_mat_sum_trial(mat, pattern_hash) if method == 'surrogate_TrialByTrial': dist_exp, n_exp = gen_pval_anal( mat, pattern_hash, method, n_surr=n_surr) n_exp = np.mean(n_exp) elif method == 'analytic_TrialByTrial' or \ method == 'analytic_TrialAverage': dist_exp, n_exp = gen_pval_anal(mat, pattern_hash, method) pval = dist_exp(n_emp) Js = jointJ(pval) return Js, rate_avg, n_exp, n_emp, indices def jointJ_window_analysis( data, bin_size, winsize, winstep, pattern_hash, method='analytic_TrialByTrial', t_start=None, t_stop=None, binary=True, n_surr=100): """ Calculates the joint surprise in a sliding window fashion. Implementation is based on :cite:`unitary_event_analysis-Gruen99_67`. Parameters ---------- data : list A list of spike trains (`neo.SpikeTrain` objects) in different trials: 0-axis --> Trials 1-axis --> Neurons 2-axis --> Spike times bin_size : pq.Quantity The size of bins for discretizing spike trains. winsize : pq.Quantity The size of the window of analysis. winstep : pq.Quantity The size of the window step. pattern_hash : list of int list of interested patterns in hash values (see `hash_from_pattern` and `inverse_hash_from_pattern` functions) method : str The method with which the unitary events whould be computed 'analytic_TrialByTrial' -- > calculate the expectency (analytically) on each trial, then sum over all trials. 'analytic_TrialAverage' -- > calculate the expectency by averaging over trials (cf. Gruen et al. 2003). 'surrogate_TrialByTrial' -- > calculate the distribution of expected coincidences by spike time randomzation in each trial and sum over trials. Default is 'analytic_trialByTrial' t_start : float or pq.Quantity, optional The start time to use for the time points. If not specified, retrieved from the `t_start` attribute of spiketrains. t_stop : float or pq.Quantity, optional The start time to use for the time points. If not specified, retrieved from the `t_stop` attribute of spiketrains. n_surr : int, optional The number of surrogates to be used. Default is 100. Returns ------- dict The values of each key has the shape of different pattern hash --> 0-axis different window --> 1-axis Js: list of float JointSurprise of different given patterns within each window. indices: list of list of int A list of indices of pattern within each window. n_emp: list of int The empirical number of each observed pattern. n_exp: list of float The expected number of each pattern. rate_avg: list of float The average firing rate of each neuron. Raises ------ ValueError If `data` is not in the format, specified above. NotImplementedError If `binary` is not True. The method works only with binary matrices at the moment. Warns ----- UserWarning The ratio between `winsize` or `winstep` and `bin_size` is not an integer. """ if not isinstance(data[0][0], neo.SpikeTrain): raise ValueError( "structure of the data is not correct: 0-axis should be trials, " "1-axis units and 2-axis neo spike trains") if t_start is None: t_start = data[0][0].t_start.rescale('ms') if t_stop is None: t_stop = data[0][0].t_stop.rescale('ms') # position of all windows (left edges) t_winpos = _winpos(t_start, t_stop, winsize, winstep, position='left-edge') t_winpos_bintime = _bintime(t_winpos, bin_size) winsize_bintime = _bintime(winsize, bin_size) winstep_bintime = _bintime(winstep, bin_size) if winsize_bintime * bin_size != winsize: warnings.warn("The ratio between the winsize ({winsize}) and the " "bin_size ({bin_size}) is not an integer".format( winsize=winsize, bin_size=bin_size)) if winstep_bintime * bin_size != winstep: warnings.warn("The ratio between the winstep ({winstep}) and the " "bin_size ({bin_size}) is not an integer".format( winstep=winstep, bin_size=bin_size)) num_tr, N = np.shape(data)[:2] n_bins = int((t_stop - t_start) / bin_size) mat_tr_unit_spt = np.zeros((len(data), N, n_bins)) for tr, sts in enumerate(data): sts = list(sts) bs = conv.BinnedSpikeTrain( sts, t_start=t_start, t_stop=t_stop, bin_size=bin_size) if binary is True: mat = bs.to_bool_array() else: raise NotImplementedError( "The method works only with binary matrices at the moment") mat_tr_unit_spt[tr] = mat num_win = len(t_winpos) Js_win, n_exp_win, n_emp_win = (np.zeros(num_win) for _ in range(3)) rate_avg = np.zeros((num_win, N)) indices_win = {} for i in range(num_tr): indices_win['trial' + str(i)] = [] for i, win_pos in enumerate(t_winpos_bintime): mat_win = mat_tr_unit_spt[:, :, win_pos:win_pos + winsize_bintime] if method == 'surrogate_TrialByTrial': Js_win[i], rate_avg[i], n_exp_win[i], n_emp_win[ i], indices_lst = _UE( mat_win, pattern_hash, method, n_surr=n_surr) else: Js_win[i], rate_avg[i], n_exp_win[i], n_emp_win[ i], indices_lst = _UE(mat_win, pattern_hash, method) for j in range(num_tr): if len(indices_lst[j][0]) > 0: indices_win[ 'trial' + str(j)] = np.append( indices_win['trial' + str(j)], indices_lst[j][0] + win_pos) return {'Js': Js_win, 'indices': indices_win, 'n_emp': n_emp_win, 'n_exp': n_exp_win, 'rate_avg': rate_avg / bin_size}
alperyeg/elephant
elephant/unitary_event_analysis.py
Python
bsd-3-clause
28,001
[ "NEURON" ]
05d30f6eaf7a6268d866dacdba24f472c197a96e3caefc60fb2849e0f48d00a7
import numpy as np from ase import Atoms from gpaw import GPAW from gpaw.wavefunctions.pw import PW from gpaw.test import equal bulk = Atoms('Li', pbc=True) k = 4 calc = GPAW(mode=PW(200), kpts=(k, k, k), eigensolver='rmm-diis') bulk.set_calculator(calc) e = [] niter = [] A = [2.6, 2.65, 2.7, 2.75, 2.8] for a in A: bulk.set_cell((a, a, a)) e.append(bulk.get_potential_energy()) a = np.roots(np.polyder(np.polyfit(A, e, 2), 1))[0] print 'a =', a equal(a, 2.65247379609, 0.001)
robwarm/gpaw-symm
gpaw/test/pw/bulk.py
Python
gpl-3.0
488
[ "ASE", "GPAW" ]
bc3361a389c903f40dcc01dc485614ef74cf0727452bb2753b7f16f403236e9f
import time, sys import numpy as np import matplotlib.pyplot as plt sys.path.append('../../') from py2Periodic.physics import twoLayerQG from numpy import pi params = { 'f0' : 1.0e-4, 'Lx' : 1.0e6, 'beta' : 1.5e-11, 'defRadius' : 1.5e4, 'H1' : 500.0, 'H2' : 2000.0, 'U1' : 2.5e-2, 'U2' : 0.0, 'bottomDrag' : 1.0e-7, 'nx' : 128, 'dt' : 5.0e3, 'visc' : 4.0e8, 'viscOrder' : 4.0, 'timeStepper': 'AB3', 'nThreads' : 4, 'useFilter' : False, } # Create the two-layer model qg = twoLayerQG.model(**params) qg.describe_model() # Initial condition: Ro = 1.0e-3 f0 = 1.0e-4 q1 = Ro*f0*np.random.standard_normal(qg.physVarShape) q2 = Ro*f0*np.random.standard_normal(qg.physVarShape) qg.set_q1_and_q2(q1, q2) # Gaussian hill topography (x0, y0) = (qg.Lx/2.0, qg.Ly/2.0) rTop = qg.Lx/20.0 h = 0.1*qg.H2*np.exp( -( (qg.x-x0)**2.0 + (qg.y-y0)**2.0 )/(2.0*rTop**2.0) ) qg.set_topography(h) # Run a loop nt = 1e3 for ii in np.arange(0, 1e3): qg.step_nSteps(nSteps=nt, dnLog=nt) qg.update_state_variables() fig = plt.figure('Perturbation vorticity', figsize=(8, 8)); plt.clf() plt.subplot(221); plt.imshow(qg.q1) plt.subplot(222); plt.imshow(qg.q2) plt.subplot(223); plt.imshow(np.abs(qg.soln[0:qg.ny//2, :, 0])) plt.subplot(224); plt.imshow(np.abs(qg.soln[0:qg.ny//2, :, 1])) plt.pause(0.01), plt.draw() print("Close the plot to end the program") plt.show()
glwagner/py2Periodic
tests/twoLayerQG/testTwoLayerTopography.py
Python
mit
1,545
[ "Gaussian" ]
7dd55bea08f080aca4f4d7d2b819460d7e559f3ba0689103ef3795721d337a06
# $ ipython --gui=wx # In [1]: %run visualization/plot-2.py # In [2]: plot("z_dual_1.norms") from mayavi import mlab import numpy import re def mycolor(x): """Returns a color vector (a triple of floats) based on x, where x is in the range [0, 1]. """ lut = [ [ 0, 0, 0, 255], [ 1, 0, 0, 255], [ 2, 0, 0, 255], [ 4, 0, 0, 255], [ 5, 0, 0, 255], [ 6, 0, 0, 255], [ 8, 0, 0, 255], [ 9, 0, 0, 255], [ 10, 0, 0, 255], [ 12, 0, 0, 255], [ 14, 0, 0, 255], [ 16, 0, 0, 255], [ 17, 0, 0, 255], [ 18, 0, 0, 255], [ 20, 0, 0, 255], [ 21, 0, 0, 255], [ 23, 0, 0, 255], [ 24, 0, 0, 255], [ 26, 0, 0, 255], [ 27, 0, 0, 255], [ 28, 0, 0, 255], [ 29, 0, 0, 255], [ 31, 0, 0, 255], [ 32, 0, 0, 255], [ 33, 0, 0, 255], [ 35, 0, 0, 255], [ 36, 0, 0, 255], [ 37, 0, 0, 255], [ 39, 0, 0, 255], [ 40, 0, 0, 255], [ 42, 0, 0, 255], [ 43, 0, 0, 255], [ 46, 0, 0, 255], [ 47, 0, 0, 255], [ 48, 0, 0, 255], [ 50, 0, 0, 255], [ 51, 0, 0, 255], [ 53, 0, 0, 255], [ 54, 0, 0, 255], [ 55, 0, 0, 255], [ 56, 0, 0, 255], [ 58, 0, 0, 255], [ 59, 0, 0, 255], [ 60, 0, 0, 255], [ 62, 0, 0, 255], [ 63, 0, 0, 255], [ 65, 0, 0, 255], [ 66, 0, 0, 255], [ 68, 0, 0, 255], [ 69, 0, 0, 255], [ 70, 0, 0, 255], [ 71, 0, 0, 255], [ 73, 0, 0, 255], [ 74, 0, 0, 255], [ 77, 0, 0, 255], [ 78, 0, 0, 255], [ 80, 0, 0, 255], [ 81, 0, 0, 255], [ 82, 0, 0, 255], [ 84, 0, 0, 255], [ 85, 0, 0, 255], [ 86, 0, 0, 255], [ 88, 0, 0, 255], [ 89, 0, 0, 255], [ 91, 0, 0, 255], [ 93, 0, 0, 255], [ 95, 0, 0, 255], [ 96, 0, 0, 255], [ 97, 0, 0, 255], [ 98, 0, 0, 255], [100, 0, 0, 255], [101, 0, 0, 255], [102, 0, 0, 255], [104, 0, 0, 255], [105, 0, 0, 255], [108, 0, 0, 255], [110, 0, 0, 255], [111, 0, 0, 255], [113, 0, 0, 255], [114, 0, 0, 255], [115, 0, 0, 255], [116, 0, 0, 255], [118, 0, 0, 255], [119, 0, 0, 255], [120, 0, 0, 255], [122, 0, 0, 255], [123, 0, 0, 255], [124, 0, 0, 255], [126, 0, 0, 255], [127, 0, 0, 255], [128, 0, 0, 255], [130, 0, 0, 255], [131, 0, 0, 255], [133, 0, 0, 255], [134, 0, 0, 255], [135, 0, 0, 255], [138, 0, 0, 255], [140, 0, 0, 255], [140, 0, 0, 255], [142, 0, 0, 255], [143, 0, 0, 255], [145, 0, 0, 255], [146, 0, 0, 255], [147, 0, 0, 255], [149, 0, 0, 255], [150, 0, 0, 255], [152, 0, 0, 255], [153, 0, 0, 255], [155, 0, 0, 255], [156, 0, 0, 255], [157, 0, 0, 255], [158, 0, 0, 255], [160, 0, 0, 255], [161, 0, 0, 255], [162, 0, 0, 255], [164, 0, 0, 255], [165, 0, 0, 255], [167, 0, 0, 255], [169, 0, 0, 255], [170, 0, 0, 255], [172, 0, 0, 255], [173, 0, 0, 255], [175, 1, 0, 255], [176, 3, 0, 255], [177, 4, 0, 255], [179, 6, 0, 255], [180, 8, 0, 255], [182, 10, 0, 255], [183, 13, 0, 255], [185, 16, 0, 255], [187, 17, 0, 255], [188, 19, 0, 255], [189, 20, 0, 255], [191, 22, 0, 255], [192, 24, 0, 255], [194, 26, 0, 255], [195, 28, 0, 255], [197, 30, 0, 255], [198, 32, 0, 255], [200, 34, 0, 255], [202, 36, 0, 255], [203, 38, 0, 255], [205, 40, 0, 255], [206, 42, 0, 255], [207, 44, 0, 255], [209, 46, 0, 255], [210, 48, 0, 255], [211, 49, 0, 255], [212, 51, 0, 255], [214, 52, 0, 255], [215, 54, 0, 255], [217, 56, 0, 255], [218, 58, 0, 255], [220, 60, 0, 255], [221, 61, 0, 255], [222, 63, 0, 255], [224, 65, 0, 255], [225, 67, 0, 255], [226, 68, 0, 255], [227, 70, 0, 255], [229, 72, 0, 255], [232, 76, 0, 255], [233, 77, 0, 255], [234, 79, 0, 255], [236, 81, 0, 255], [237, 83, 0, 255], [239, 85, 0, 255], [240, 86, 0, 255], [241, 88, 0, 255], [242, 89, 0, 255], [244, 91, 0, 255], [245, 93, 0, 255], [247, 95, 0, 255], [248, 97, 0, 255], [249, 99, 0, 255], [251, 101, 0, 255], [252, 102, 0, 255], [253, 103, 0, 255], [255, 105, 0, 255], [255, 107, 0, 255], [255, 109, 0, 255], [255, 111, 0, 255], [255, 114, 0, 255], [255, 117, 0, 255], [255, 118, 0, 255], [255, 120, 0, 255], [255, 121, 0, 255], [255, 123, 0, 255], [255, 125, 0, 255], [255, 127, 0, 255], [255, 129, 0, 255], [255, 131, 0, 255], [255, 133, 1, 255], [255, 136, 8, 255], [255, 137, 11, 255], [255, 139, 15, 255], [255, 141, 19, 255], [255, 143, 22, 255], [255, 145, 26, 255], [255, 146, 30, 255], [255, 148, 34, 255], [255, 150, 37, 255], [255, 152, 41, 255], [255, 154, 47, 255], [255, 157, 52, 255], [255, 159, 55, 255], [255, 161, 59, 255], [255, 162, 63, 255], [255, 164, 67, 255], [255, 166, 70, 255], [255, 168, 74, 255], [255, 170, 78, 255], [255, 171, 81, 255], [255, 173, 85, 255], [255, 174, 89, 255], [255, 176, 93, 255], [255, 178, 96, 255], [255, 180, 100, 255], [255, 182, 103, 255], [255, 184, 107, 255], [255, 186, 110, 255], [255, 187, 114, 255], [255, 188, 118, 255], [255, 190, 122, 255], [255, 192, 126, 255], [255, 196, 133, 255], [255, 198, 137, 255], [255, 200, 140, 255], [255, 202, 144, 255], [255, 203, 148, 255], [255, 205, 152, 255], [255, 206, 155, 255], [255, 208, 158, 255], [255, 210, 162, 255], [255, 212, 166, 255], [255, 214, 169, 255], [255, 216, 173, 255], [255, 217, 177, 255], [255, 219, 181, 255], [255, 221, 184, 255], [255, 222, 188, 255], [255, 224, 192, 255], [255, 226, 195, 255], [255, 228, 199, 255], [255, 229, 203, 255], [255, 231, 206, 255], [255, 234, 212, 255], [255, 237, 217, 255], [255, 238, 221, 255], [255, 240, 225, 255], [255, 242, 228, 255], [255, 244, 232, 255], [255, 245, 236, 255], [255, 247, 240, 255], [255, 249, 243, 255], [255, 251, 247, 255] ] if(x < 0 or x > 1): raise Exception("illegal scale") i = int(x*255) return (lut[i][0]/255., lut[i][1]/255., lut[i][2]/255.) def stratify(number_bins, norms, *args): """Stratify the lists by norms into number_bins strata. The args contain the centers and the widths, i.e. args <- center_i, center_j, width_i, width_j. The function returns a tuple (norms, centers) of the stratified result. """ length = len(norms) for i in range(len(args)): if len(args[i]) != length: print(norms) print(i) print(args[i]) raise Exception("All lengths have to match") min_norm = numpy.amin(norms) max_norm = numpy.amax(norms) def bound(i): return min_norm+i*(max_norm-min_norm)/float(number_bins) args_stratified = [ [ [] for j in range(number_bins) ] for i in range(len(args)) ] norms_stratified = [ [] for i in range(number_bins) ] print("stratifying into {:d} bins".format(number_bins)) for i in range(len(norms)): found_bin = False for j in range(number_bins): if norms[i] >= bound(j) and norms[i] < bound(j+1): for k in range(len(args)): args_stratified[k][j].append(args[k][i]) norms_stratified[j].append(norms[i]) found_bin = True break if not found_bin: for k in range(len(args)): args_stratified[k][number_bins-1].append(args[k][i]) norms_stratified[j].append(norms[i]) # for i in range(number_bins): # print("{:d} norm [{:1.2f},{:1.2f})".format( # len(args_stratified[0][i]), bound(i), bound(i+1))) result = [ norms_stratified ] for arg in args_stratified: result.append(arg) return result def read_squares(fd, start, end=None): """Reads a norms file from a call to spamm_tree_print_leaves_2d_symm(). """ # Use readline() with a length argument so we can tell whether the # file as reached EOF. LINE_LENGTH = 1000 i = [] j = [] width_i = [] width_j = [] norm = [] re_matrix_square = re.compile("^\s*([0-9.eEdD+-]+)" + "\s+([0-9.eEdD+-]+)" + "\s+([0-9]+)" + "\s+([0-9]+)" + "\s+([0-9.eEdD+-]+)$") while True: line = fd.readline(LINE_LENGTH) if len(line) == 0: return None if start.search(line): matrix_name = line.rstrip() break line = fd.readline() block_size = int(line) while True: old_position = fd.tell() line = fd.readline(LINE_LENGTH) if len(line) == 0: break if end != None: if end.search(line): fd.seek(old_position) break result = re_matrix_square.search(line) i.append(float(result.group(1))) j.append(float(result.group(2))) width_i.append(int(result.group(3))) width_j.append(int(result.group(4))) norm.append(float(result.group(5))) print("loaded {:d} matrix squares from {:s}".format(len(i), matrix_name)) result = (block_size, i, j, width_i, width_j, norm) #print(result) return result def read_cubes(fd, start, end=None): """Reads a norms file from a call to spamm_tree_print_leaves_2d_symm(). """ # Use readline() with a length argument so we can tell whether the # file as reached EOF. LINE_LENGTH = 1000 i = [] j = [] k = [] width_i = [] width_j = [] width_k = [] norm = [] re_product_cube = re.compile("^\s*([0-9.eEdD+-]+)" + "\s+([0-9.eEdD+-]+)" + "\s+([0-9.eEdD+-]+)" + "\s+([0-9]+)" + "\s+([0-9]+)" + "\s+([0-9]+)" + "\s+([0-9.eEdD+-]+)$") while True: line = fd.readline(LINE_LENGTH) if len(line) == 0: return None if start.search(line): matrix_name = line.rstrip() break line = fd.readline() block_size = int(line) while True: old_position = fd.tell() line = fd.readline(LINE_LENGTH) if len(line) == 0: break if end != None: if end.search(line): fd.seek(old_position) break result = re_product_cube.search(line) i.append(float(result.group(1))) j.append(float(result.group(2))) k.append(float(result.group(3))) width_i.append(int(result.group(4))) width_j.append(int(result.group(5))) width_k.append(int(result.group(6))) norm.append(float(result.group(7))) print("loaded {:d} product cubes from {:s}".format(len(i), matrix_name)) return (i, j, k, width_i, width_j, width_k, norm) @mlab.show def plot(filename, number_bins=6): """Plot the cubes from a file. The cubes are stratified into number_bins norm bins. The transparency of the cubes is set depending on which norm bin the cube is in. """ re_matrix_A = re.compile("^\s*Matrix A$") re_matrix_B = re.compile("^\s*Matrix B$") re_matrix_C = re.compile("^\s*Matrix C$") re_product_space = re.compile("^\s*Product Space$") fd = open(filename) (block_size, A_i, A_j, A_width_i, A_width_j, A_norm) = read_squares(fd, re_matrix_A, end=re_matrix_B) (block_size, B_i, B_j, B_width_i, B_width_j, B_norm) = read_squares(fd, re_matrix_B, end=re_matrix_C) (block_size, C_i, C_j, C_width_i, C_width_j, C_norm) = read_squares(fd, re_matrix_C, end=re_product_space) (prod_i, prod_j, prod_k, prod_width_i, prod_width_j, prod_width_k, prod_norm) = read_cubes(fd, re_product_space) # Get the current figure. figure = mlab.gcf() # Get the engine. engine = mlab.get_engine() # Clean the figure. mlab.clf() # Turn off rendering (for performance). figure.scene.disable_render = True # Tune background color. figure.scene.background = (1., 1., 1.) # Stratify matrix squares. (norms_stratified, A_i_stratified, A_j_stratified, A_width_i_stratified, A_width_j_stratified) = stratify(number_bins, A_norm, A_i, A_j, A_width_i, A_width_j) # Add matrices. print("Plotting matrix A") for i in range(number_bins): if len(A_i_stratified[i]) > 0: points = mlab.points3d(A_i_stratified[i], [1 for j in range(len(A_i_stratified[i]))], A_j_stratified[i], mode='cube', color=(0.0, 0.5019607843137255, 0.5019607843137255), scale_factor=1, opacity=0.5*(i+1)/float(number_bins)) points.glyph.glyph_source.glyph_source.x_length = block_size points.glyph.glyph_source.glyph_source.y_length = 0 points.glyph.glyph_source.glyph_source.z_length = block_size (norms_stratified, B_i_stratified, B_j_stratified, B_width_i_stratified, B_width_j_stratified) = stratify(number_bins, B_norm, B_i, B_j, B_width_i, B_width_j) # Add matrices. print("Plotting matrix B") for i in range(number_bins): if len(B_i_stratified[i]) > 0: points = mlab.points3d([1 for j in range(len(B_i_stratified[i]))], B_j_stratified[i], B_i_stratified[i], mode='cube', color=(0.5019607843137255, 0.0, 0.0), scale_factor=1, opacity=0.5*(i+1)/float(number_bins)) points.glyph.glyph_source.glyph_source.x_length = 0 points.glyph.glyph_source.glyph_source.y_length = block_size points.glyph.glyph_source.glyph_source.z_length = block_size (norms_stratified, C_i_stratified, C_j_stratified, C_width_i_stratified, C_width_j_stratified) = stratify(number_bins, C_norm, C_i, C_j, C_width_i, C_width_j) # Add matrices. print("Plotting matrix C") for i in range(number_bins): if len(C_i_stratified[i]) > 0: points = mlab.points3d(C_i_stratified[i], C_j_stratified[i], [1 for j in range(len(C_i_stratified[i]))], mode='cube', color=(0.5019607843137255, 0.0, 0.5019607843137255), scale_factor=1, opacity=0.5*(i+1)/float(number_bins)) points.glyph.glyph_source.glyph_source.x_length = block_size points.glyph.glyph_source.glyph_source.y_length = block_size points.glyph.glyph_source.glyph_source.z_length = 0 # Stratify cubes by norm. (norms_stratified, prod_i_stratified, prod_j_stratified, prod_k_stratified) = stratify( number_bins, prod_norm, prod_i, prod_j, prod_k) # Add cubes. print("Plotting product cubes") for i in range(number_bins): if len(prod_i_stratified[i]) > 0: points = mlab.points3d(prod_i_stratified[i], prod_j_stratified[i], prod_k_stratified[i], mode='cube', color=(0.2,.2,.2), scale_factor=1, opacity=0.75*(i+1)/float(number_bins)) points.glyph.glyph_source.glyph_source.x_length = block_size points.glyph.glyph_source.glyph_source.y_length = block_size points.glyph.glyph_source.glyph_source.z_length = block_size i_max = max(numpy.amax(prod_i), numpy.amax(prod_j), numpy.amax(prod_k))+block_size/2 print("i_max = {:e}".format(i_max)) # Insert fake invisible data-set for axes. mlab.points3d([1, i_max], [1, i_max], [1, i_max], mode='cube', scale_factor=0) #mlab.axes(xlabel="i", ylabel="j", zlabel="k", extent=[1, xmax, 1, xmax, 1, xmax]) # Box around the whole thing. mlab.outline(extent=[1, i_max, 1, i_max, 1, i_max]) outline = engine.scenes[0].children[-1].children[0].children[1] outline.actor.property.color = (0, 0, 0) outline.actor.property.line_width = 2 # Add axes. from mayavi.modules.axes import Axes axes = Axes() engine.add_module(axes, obj=None) axes.axes.label_format = '%-3.0f' axes.axes.width = 2 axes.axes.x_label = 'i' axes.axes.y_label = 'j' axes.axes.z_label = 'k' axes.label_text_property.color = (0, 0, 0) axes.label_text_property.opacity = 0.0 axes.label_text_property.shadow = True axes.label_text_property.shadow_offset = numpy.array([ 1, -1]) axes.property.color = (0, 0, 0) axes.property.display_location = 'background' axes.title_text_property.color = (0, 0, 0) axes.title_text_property.shadow_offset = numpy.array([ 1, -1]) figure.scene.disable_render = False figure.scene.camera.compute_view_plane_normal() import os.path #------------------------------------------------------------------------------------------------------- #./spammsand_invsqrt 33_x8_11_S.mm 1.d-1 1.d-3 1.d-1 1.d-1 D U R b=16 # figure.scene.isometric_view() # png_filename = os.path.splitext(filename)[0] + "_isov.png" # print("Saving image to " + png_filename) # figure.scene.save(png_filename,size=(1024,1024)) # figure.scene.camera.position = [2381.7518163797836, 2526.3678093421449, 2530.13269951962] # figure.scene.camera.focal_point = [440.00000000000028, 440.0000000000029, 439.99999999999733] # figure.scene.camera.view_angle = 30.0 # figure.scene.camera.view_up = [-0.4189314063923294, -0.41776697205346547, 0.80620545383879905] # figure.scene.camera.clipping_range = [1986.7866107311997, 5491.0522577990569] # figure.scene.camera.compute_view_plane_normal() # figure.scene.render() # png_filename = os.path.splitext(filename)[0] + "_cant_x.png" # print("Saving image to " + png_filename) # figure.scene.save(png_filename,size=(1024,1024)) #./spammsand_invsqrt water_500_to_6-311gss.mm 1.d-2 1.d-4 1.d-1 0.d0 D U R figure.scene.camera.position = [35816.735234550884, 38331.094829602851, 41443.525860211055] figure.scene.camera.focal_point = [2614.1156973829502, 2621.6382407405645, -241.34477379674968] figure.scene.camera.view_angle = 30.0 figure.scene.camera.view_up = [-0.45361775222697864, -0.4654155004102597, 0.76001272807921516] figure.scene.camera.clipping_range = [26313.825398895184, 87716.669164634935] figure.scene.camera.compute_view_plane_normal() figure.scene.render() png_filename = os.path.splitext(filename)[0] + "_cant_x.png" print("Saving image to " + png_filename) figure.scene.save(png_filename,size=(768,768)) #./spammsand_invsqrt water_100_to_6-311gss.mm 1.d-1 1.d-3 1.d-1 1.d-1 D U R # figure.scene.isometric_view() # png_filename = os.path.splitext(filename)[0] + "_isov.png" # print("Saving image to " + png_filename) # figure.scene.save(png_filename,size=(1024,1024)) # figure.scene.camera.position = [7131.7121897731495, 7525.4214914466402, 8101.2951483680154] # figure.scene.camera.focal_point = [1702.818579072205, 1686.6399910935772, 1285.485703136407] # figure.scene.camera.view_angle = 30.0 # figure.scene.camera.view_up = [-0.45361775222697859, -0.46541550041025964, 0.76001272807921505] # figure.scene.camera.clipping_range = [5042.9256084193876, 17324.211816361931] # figure.scene.camera.compute_view_plane_normal() # figure.scene.render() # png_filename = os.path.splitext(filename)[0] + "_cant_x.png" # print("Saving image to " + png_filename) # figure.scene.save(png_filename,size=(1024,1024)) #------------------------------------------------------------------------------------------------------- # ./spammsand_invsqrt bcsstk14.mtx 1.d-2 1.d-4 1.d-1 0.d0 D U R # figure.scene.camera.position = [1045.203726965188, 1039.2064081296085, 6702.5003353789853] # figure.scene.camera.focal_point = [874.472594413058, 898.76786979832445, 939.79123074155348] # figure.scene.camera.view_angle = 30.0 # figure.scene.camera.view_up = [-0.70042965936561086, -0.71270269865532587, 0.038120278204521671] # figure.scene.camera.clipping_range = [3849.5157839671483, 8271.9264727908048] # figure.scene.camera.compute_view_plane_normal() # png_filename = os.path.splitext(filename)[0] + "_x_zoomview.png" # print("Saving image to " + png_filename) # figure.scene.save(png_filename) # figure.scene.camera.position = [2030.6693081026092, 2031.6946128119116, 2101.6583772785889] # figure.scene.camera.focal_point = [904.5, 904.5, 904.5] # figure.scene.camera.view_angle = 30.0 # figure.scene.camera.view_up = [-0.4254783969169838, -0.42401748949585194, 0.79948564862578286] # figure.scene.camera.clipping_range = [5.9413455805998874, 5941.3455805998874] # figure.scene.camera.compute_view_plane_normal() # figure.scene.render() # png_filename = os.path.splitext(filename)[0] + "_y_zoomview.png" # print("Saving image to " + png_filename) # figure.scene.save(png_filename) #------------------------------------------------------------------------------------------------------- # Turn rendering back on. # Save the figure to file. # import os.path # png_filename = os.path.splitext(filename)[0] + ".png" # print("Saving image to " + png_filename) # figure.scene.save(png_filename)
FreeON/spammpack
spammsand/visualization/plot-2.py
Python
bsd-3-clause
24,103
[ "Mayavi" ]
0946fc64eb57e449d5dd7ffc64ff8d1e91104d25b14c36c789a9dc1eb3bb179d
# -*- coding: utf-8 -*- ''' Copyright (c) 2018 by Tobias Houska This file is part of Statistical Parameter Optimization Tool for Python(SPOTPY). :author: Tobias Houska ''' from . import _algorithm from .. import analyser class list_sampler(_algorithm): """ This class holds the List sampler, which samples from a given spotpy database """ _excluded_parameter_classes = () def __init__(self, *args, **kwargs): """ Input ---------- spot_setup: class model: function Should be callable with a parameter combination of the parameter-function and return an list of simulation results (as long as evaluation list) parameter: function When called, it should return a random parameter combination. Which can be e.g. uniform or Gaussian objectivefunction: function Should return the objectivefunction for a given list of a model simulation and observation. evaluation: function Should return the true values as return by the model. dbname: str * Name of the database where parameter, objectivefunction value and simulation results will be saved. dbformat: str * ram: fast suited for short sampling time. no file will be created and results are saved in an array. * csv: A csv file will be created, which you can import afterwards. parallel: str * seq: Sequentiel sampling (default): Normal iterations on one core of your cpu. * mpi: Message Passing Interface: Parallel computing on cluster pcs (recommended for unix os). save_sim: boolean * True: Simulation results will be saved * False: Simulation results will not be saved """ kwargs['algorithm_name'] = 'List Sampler' super(list_sampler, self).__init__(*args, **kwargs) def sample(self, repetitions=None): """ Parameters ---------- Optional: repetitions: int maximum number of function evaluations allowed during sampling If not given number if iterations will be determined based on given list """ parameters = analyser.load_csv_parameter_results(self.dbname) self.dbname=self.dbname+'list' if not repetitions: repetitions=len(parameters) self.set_repetiton(repetitions) # Initialization print('Starting the List sampler with '+str(repetitions)+ ' repetitions...') param_generator = ((rep, list(parameters[rep])) for rep in range(int(repetitions))) for rep, randompar, simulations in self.repeat(param_generator): # A function that calculates the fitness of the run and the manages the database self.postprocessing(rep, list(randompar), simulations) self.final_call()
thouska/spotpy
spotpy/algorithms/list_sampler.py
Python
mit
3,003
[ "Gaussian" ]
65eabddea901838ed9d187a057b93ec11d3fb6fe630b443f957a389020df76e6
# ---------------------------------------------------------------------------- # Copyright (c) 2013--, scikit-bio development team. # # Distributed under the terms of the Modified BSD License. # # The full license is in the file COPYING.txt, distributed with this software. # ---------------------------------------------------------------------------- from __future__ import absolute_import, division, print_function from future.standard_library import hooks with hooks(): from itertools import zip_longest from re import compile as re_compile from collections import Counter, defaultdict from unittest import TestCase, main import numpy as np import numpy.testing as npt from skbio import ( BiologicalSequence, NucleotideSequence, DNASequence, RNASequence, ProteinSequence) from skbio.sequence import BiologicalSequenceError class BiologicalSequenceTests(TestCase): def setUp(self): self.b1 = BiologicalSequence('GATTACA', quality=range(7)) self.b2 = BiologicalSequence( 'ACCGGTACC', id="test-seq-2", description="A test sequence") self.b3 = BiologicalSequence( 'GREG', id="test-seq-3", description="A protein sequence") self.b4 = BiologicalSequence( 'PRTEIN', id="test-seq-4") self.b5 = BiologicalSequence( 'LLPRTEIN', description="some description") self.b6 = BiologicalSequence('ACGTACGTACGT') self.b7 = BiologicalSequence('..--..', quality=range(6)) self.b8 = BiologicalSequence('HE..--..LLO', id='hello', description='gapped hello', quality=range(11)) def test_init_varied_input(self): # init as string b = BiologicalSequence('ACCGGXZY') self.assertEqual(str(b), 'ACCGGXZY') self.assertEqual(b.id, "") self.assertEqual(b.description, "") # init as string with optional values b = BiologicalSequence( 'ACCGGXZY', 'test-seq-1', 'The first test sequence') self.assertEqual(str(b), 'ACCGGXZY') self.assertEqual(b.id, "test-seq-1") self.assertEqual(b.description, "The first test sequence") # test init as a different string b = BiologicalSequence('WRRTY') self.assertEqual(str(b), 'WRRTY') # init as list b = BiologicalSequence(list('ACCGGXZY')) self.assertEqual(str(b), 'ACCGGXZY') self.assertEqual(b.id, "") self.assertEqual(b.description, "") # init as tuple b = BiologicalSequence(tuple('ACCGGXZY')) self.assertEqual(str(b), 'ACCGGXZY') self.assertEqual(b.id, "") self.assertEqual(b.description, "") def test_init_with_validation(self): self.assertRaises(BiologicalSequenceError, BiologicalSequence, "ACC", validate=True) try: # no error raised when only allow characters are passed BiologicalSequence("..--..", validate=True) except BiologicalSequenceError: self.assertTrue(False) def test_init_with_invalid_quality(self): # invalid dtype with self.assertRaises(TypeError): BiologicalSequence('ACGT', quality=[2, 3, 4.1, 5]) # wrong number of dimensions (2-D) with self.assertRaisesRegexp(BiologicalSequenceError, '1-D'): BiologicalSequence('ACGT', quality=[[2, 3], [4, 5]]) # wrong number of elements with self.assertRaisesRegexp(BiologicalSequenceError, '\(3\).*\(4\)'): BiologicalSequence('ACGT', quality=[2, 3, 4]) # negatives with self.assertRaisesRegexp(BiologicalSequenceError, 'quality scores.*greater than.*zero'): BiologicalSequence('ACGT', quality=[2, 3, -1, 4]) def test_contains(self): self.assertTrue('G' in self.b1) self.assertFalse('g' in self.b1) def test_eq_and_ne(self): self.assertTrue(self.b1 == self.b1) self.assertTrue(self.b2 == self.b2) self.assertTrue(self.b3 == self.b3) self.assertTrue(self.b1 != self.b3) self.assertTrue(self.b1 != self.b2) self.assertTrue(self.b2 != self.b3) # identicial sequences of the same type are equal, even if they have # different ids, descriptions, and/or quality self.assertTrue( BiologicalSequence('ACGT') == BiologicalSequence('ACGT')) self.assertTrue( BiologicalSequence('ACGT', id='a') == BiologicalSequence('ACGT', id='b')) self.assertTrue( BiologicalSequence('ACGT', description='c') == BiologicalSequence('ACGT', description='d')) self.assertTrue( BiologicalSequence('ACGT', id='a', description='c') == BiologicalSequence('ACGT', id='b', description='d')) self.assertTrue( BiologicalSequence('ACGT', id='a', description='c', quality=[1, 2, 3, 4]) == BiologicalSequence('ACGT', id='b', description='d', quality=[5, 6, 7, 8])) # different type causes sequences to not be equal self.assertFalse( BiologicalSequence('ACGT') == NucleotideSequence('ACGT')) def test_getitem(self): # use equals method to ensure that id, description, and sliced # quality are correctly propagated to the resulting sequence self.assertTrue(self.b1[0].equals( BiologicalSequence('G', quality=(0,)))) self.assertTrue(self.b1[:].equals( BiologicalSequence('GATTACA', quality=range(7)))) self.assertTrue(self.b1[::-1].equals( BiologicalSequence('ACATTAG', quality=range(7)[::-1]))) # test a sequence without quality scores b = BiologicalSequence('ACGT', id='foo', description='bar') self.assertTrue(b[2:].equals( BiologicalSequence('GT', id='foo', description='bar'))) self.assertTrue(b[2].equals( BiologicalSequence('G', id='foo', description='bar'))) def test_getitem_indices(self): # no ordering, repeated items self.assertTrue(self.b1[[3, 5, 4, 0, 5, 0]].equals( BiologicalSequence('TCAGCG', quality=(3, 5, 4, 0, 5, 0)))) # empty list self.assertTrue(self.b1[[]].equals(BiologicalSequence('', quality=()))) # empty tuple self.assertTrue(self.b1[()].equals(BiologicalSequence('', quality=()))) # single item self.assertTrue( self.b1[[2]].equals(BiologicalSequence('T', quality=(2,)))) # negatives self.assertTrue(self.b1[[2, -2, 4]].equals( BiologicalSequence('TCA', quality=(2, 5, 4)))) # tuple self.assertTrue(self.b1[1, 2, 3].equals( BiologicalSequence('ATT', quality=(1, 2, 3)))) self.assertTrue(self.b1[(1, 2, 3)].equals( BiologicalSequence('ATT', quality=(1, 2, 3)))) # test a sequence without quality scores self.assertTrue(self.b2[5, 4, 1].equals( BiologicalSequence('TGC', id='test-seq-2', description='A test sequence'))) def test_getitem_wrong_type(self): with self.assertRaises(TypeError): self.b1['1'] def test_getitem_out_of_range(self): # seq with quality with self.assertRaises(IndexError): self.b1[42] with self.assertRaises(IndexError): self.b1[[1, 0, 23, 3]] # seq without quality with self.assertRaises(IndexError): self.b2[43] with self.assertRaises(IndexError): self.b2[[2, 3, 22, 1]] def test_hash(self): self.assertTrue(isinstance(hash(self.b1), int)) def test_iter(self): b1_iter = iter(self.b1) for actual, expected in zip(b1_iter, "GATTACA"): self.assertEqual(actual, expected) self.assertRaises(StopIteration, lambda: next(b1_iter)) def _compare_k_words_results(self, observed, expected): for obs, exp in zip_longest(observed, expected, fillvalue=None): # use equals to compare quality, id, description, sequence, and # type self.assertTrue(obs.equals(exp)) def test_k_words_overlapping_true(self): expected = [ BiologicalSequence('G', quality=[0]), BiologicalSequence('A', quality=[1]), BiologicalSequence('T', quality=[2]), BiologicalSequence('T', quality=[3]), BiologicalSequence('A', quality=[4]), BiologicalSequence('C', quality=[5]), BiologicalSequence('A', quality=[6]) ] self._compare_k_words_results( self.b1.k_words(1, overlapping=True), expected) expected = [ BiologicalSequence('GA', quality=[0, 1]), BiologicalSequence('AT', quality=[1, 2]), BiologicalSequence('TT', quality=[2, 3]), BiologicalSequence('TA', quality=[3, 4]), BiologicalSequence('AC', quality=[4, 5]), BiologicalSequence('CA', quality=[5, 6]) ] self._compare_k_words_results( self.b1.k_words(2, overlapping=True), expected) expected = [ BiologicalSequence('GAT', quality=[0, 1, 2]), BiologicalSequence('ATT', quality=[1, 2, 3]), BiologicalSequence('TTA', quality=[2, 3, 4]), BiologicalSequence('TAC', quality=[3, 4, 5]), BiologicalSequence('ACA', quality=[4, 5, 6]) ] self._compare_k_words_results( self.b1.k_words(3, overlapping=True), expected) expected = [ BiologicalSequence('GATTACA', quality=[0, 1, 2, 3, 4, 5, 6]) ] self._compare_k_words_results( self.b1.k_words(7, overlapping=True), expected) self.assertEqual(list(self.b1.k_words(8, overlapping=True)), []) def test_k_words_overlapping_false(self): expected = [ BiologicalSequence('G', quality=[0]), BiologicalSequence('A', quality=[1]), BiologicalSequence('T', quality=[2]), BiologicalSequence('T', quality=[3]), BiologicalSequence('A', quality=[4]), BiologicalSequence('C', quality=[5]), BiologicalSequence('A', quality=[6]) ] self._compare_k_words_results( self.b1.k_words(1, overlapping=False), expected) expected = [ BiologicalSequence('GA', quality=[0, 1]), BiologicalSequence('TT', quality=[2, 3]), BiologicalSequence('AC', quality=[4, 5]) ] self._compare_k_words_results( self.b1.k_words(2, overlapping=False), expected) expected = [ BiologicalSequence('GAT', quality=[0, 1, 2]), BiologicalSequence('TAC', quality=[3, 4, 5]) ] self._compare_k_words_results( self.b1.k_words(3, overlapping=False), expected) expected = [ BiologicalSequence('GATTACA', quality=[0, 1, 2, 3, 4, 5, 6]) ] self._compare_k_words_results( self.b1.k_words(7, overlapping=False), expected) self.assertEqual(list(self.b1.k_words(8, overlapping=False)), []) def test_k_words_invalid_k(self): with self.assertRaises(ValueError): list(self.b1.k_words(0)) with self.assertRaises(ValueError): list(self.b1.k_words(-42)) def test_k_words_different_sequences(self): expected = [ BiologicalSequence('HE.', quality=[0, 1, 2], id='hello', description='gapped hello'), BiologicalSequence('.--', quality=[3, 4, 5], id='hello', description='gapped hello'), BiologicalSequence('..L', quality=[6, 7, 8], id='hello', description='gapped hello') ] self._compare_k_words_results( self.b8.k_words(3, overlapping=False), expected) b = BiologicalSequence('') self.assertEqual(list(b.k_words(3)), []) def test_k_word_counts(self): # overlapping = True expected = Counter('GATTACA') self.assertEqual(self.b1.k_word_counts(1, overlapping=True), expected) expected = Counter(['GAT', 'ATT', 'TTA', 'TAC', 'ACA']) self.assertEqual(self.b1.k_word_counts(3, overlapping=True), expected) # overlapping = False expected = Counter(['GAT', 'TAC']) self.assertEqual(self.b1.k_word_counts(3, overlapping=False), expected) expected = Counter(['GATTACA']) self.assertEqual(self.b1.k_word_counts(7, overlapping=False), expected) def test_k_word_frequencies(self): # overlapping = True expected = defaultdict(int) expected['A'] = 3/7. expected['C'] = 1/7. expected['G'] = 1/7. expected['T'] = 2/7. self.assertEqual(self.b1.k_word_frequencies(1, overlapping=True), expected) expected = defaultdict(int) expected['GAT'] = 1/5. expected['ATT'] = 1/5. expected['TTA'] = 1/5. expected['TAC'] = 1/5. expected['ACA'] = 1/5. self.assertEqual(self.b1.k_word_frequencies(3, overlapping=True), expected) # overlapping = False expected = defaultdict(int) expected['GAT'] = 1/2. expected['TAC'] = 1/2. self.assertEqual(self.b1.k_word_frequencies(3, overlapping=False), expected) expected = defaultdict(int) expected['GATTACA'] = 1.0 self.assertEqual(self.b1.k_word_frequencies(7, overlapping=False), expected) expected = defaultdict(int) empty = BiologicalSequence('') self.assertEqual(empty.k_word_frequencies(1, overlapping=False), expected) def test_len(self): self.assertEqual(len(self.b1), 7) self.assertEqual(len(self.b2), 9) self.assertEqual(len(self.b3), 4) def test_repr(self): self.assertEqual(repr(self.b1), "<BiologicalSequence: GATTACA (length: 7)>") self.assertEqual(repr(self.b6), "<BiologicalSequence: ACGTACGTAC... (length: 12)>") def test_reversed(self): b1_reversed = reversed(self.b1) for actual, expected in zip(b1_reversed, "ACATTAG"): self.assertEqual(actual, expected) self.assertRaises(StopIteration, lambda: next(b1_reversed)) def test_str(self): self.assertEqual(str(self.b1), "GATTACA") self.assertEqual(str(self.b2), "ACCGGTACC") self.assertEqual(str(self.b3), "GREG") def test_alphabet(self): self.assertEqual(self.b1.alphabet(), set()) def test_gap_alphabet(self): self.assertEqual(self.b1.gap_alphabet(), set('-.')) def test_sequence(self): self.assertEqual(self.b1.sequence, "GATTACA") self.assertEqual(self.b2.sequence, "ACCGGTACC") self.assertEqual(self.b3.sequence, "GREG") def test_id(self): self.assertEqual(self.b1.id, "") self.assertEqual(self.b2.id, "test-seq-2") self.assertEqual(self.b3.id, "test-seq-3") def test_description(self): self.assertEqual(self.b1.description, "") self.assertEqual(self.b2.description, "A test sequence") self.assertEqual(self.b3.description, "A protein sequence") def test_quality(self): a = BiologicalSequence('ACA', quality=(22, 22, 1)) # should get back a read-only numpy array of int dtype self.assertIsInstance(a.quality, np.ndarray) self.assertEqual(a.quality.dtype, np.int) npt.assert_equal(a.quality, np.array((22, 22, 1))) # test that we can't mutate the quality scores with self.assertRaises(ValueError): a.quality[1] = 42 # test that we can't set the property with self.assertRaises(AttributeError): a.quality = (22, 22, 42) def test_quality_not_provided(self): b = BiologicalSequence('ACA') self.assertIs(b.quality, None) def test_quality_scalar(self): b = BiologicalSequence('G', quality=2) self.assertIsInstance(b.quality, np.ndarray) self.assertEqual(b.quality.dtype, np.int) self.assertEqual(b.quality.shape, (1,)) npt.assert_equal(b.quality, np.array([2])) def test_quality_empty(self): b = BiologicalSequence('', quality=[]) self.assertIsInstance(b.quality, np.ndarray) self.assertEqual(b.quality.dtype, np.int) self.assertEqual(b.quality.shape, (0,)) npt.assert_equal(b.quality, np.array([])) def test_quality_no_copy(self): qual = np.array([22, 22, 1]) a = BiologicalSequence('ACA', quality=qual) self.assertIs(a.quality, qual) with self.assertRaises(ValueError): a.quality[1] = 42 with self.assertRaises(ValueError): qual[1] = 42 def test_has_quality(self): a = BiologicalSequence('ACA', quality=(5, 4, 67)) self.assertTrue(a.has_quality()) b = BiologicalSequence('ACA') self.assertFalse(b.has_quality()) def test_copy_default_behavior(self): # minimal sequence, sequence with all optional attributes present, and # a subclass of BiologicalSequence for seq in self.b6, self.b8, RNASequence('ACGU', id='rna seq'): copy = seq.copy() self.assertTrue(seq.equals(copy)) self.assertFalse(seq is copy) def test_copy_update_single_attribute(self): copy = self.b8.copy(id='new id') self.assertFalse(self.b8 is copy) # they don't compare equal when we compare all attributes... self.assertFalse(self.b8.equals(copy)) # ...but they *do* compare equal when we ignore id, as that was the # only attribute that changed self.assertTrue(self.b8.equals(copy, ignore=['id'])) # id should be what we specified in the copy call... self.assertEqual(copy.id, 'new id') # ..and shouldn't have changed on the original sequence self.assertEqual(self.b8.id, 'hello') def test_copy_update_multiple_attributes(self): copy = self.b8.copy(id='new id', quality=range(20, 25), sequence='ACGTA', description='new desc') self.assertFalse(self.b8 is copy) self.assertFalse(self.b8.equals(copy)) # attributes should be what we specified in the copy call... self.assertEqual(copy.id, 'new id') npt.assert_equal(copy.quality, np.array([20, 21, 22, 23, 24])) self.assertEqual(copy.sequence, 'ACGTA') self.assertEqual(copy.description, 'new desc') # ..and shouldn't have changed on the original sequence self.assertEqual(self.b8.id, 'hello') npt.assert_equal(self.b8.quality, range(11)) self.assertEqual(self.b8.sequence, 'HE..--..LLO') self.assertEqual(self.b8.description, 'gapped hello') def test_copy_invalid_kwargs(self): with self.assertRaises(TypeError): self.b2.copy(id='bar', unrecognized_kwarg='baz') def test_copy_extra_non_attribute_kwargs(self): # test that we can pass through additional kwargs to the constructor # that aren't related to biological sequence attributes (i.e., they # aren't state that has to be copied) # create an invalid DNA sequence a = DNASequence('FOO', description='foo') # should be able to copy it b/c validate defaults to False b = a.copy() self.assertTrue(a.equals(b)) self.assertFalse(a is b) # specifying validate should raise an error when the copy is # instantiated with self.assertRaises(BiologicalSequenceError): a.copy(validate=True) def test_equals_true(self): # sequences match, all other attributes are not provided self.assertTrue( BiologicalSequence('ACGT').equals(BiologicalSequence('ACGT'))) # all attributes are provided and match a = BiologicalSequence('ACGT', id='foo', description='abc', quality=[1, 2, 3, 4]) b = BiologicalSequence('ACGT', id='foo', description='abc', quality=[1, 2, 3, 4]) self.assertTrue(a.equals(b)) # ignore type a = BiologicalSequence('ACGT') b = DNASequence('ACGT') self.assertTrue(a.equals(b, ignore=['type'])) # ignore id a = BiologicalSequence('ACGT', id='foo') b = BiologicalSequence('ACGT', id='bar') self.assertTrue(a.equals(b, ignore=['id'])) # ignore description a = BiologicalSequence('ACGT', description='foo') b = BiologicalSequence('ACGT', description='bar') self.assertTrue(a.equals(b, ignore=['description'])) # ignore quality a = BiologicalSequence('ACGT', quality=[1, 2, 3, 4]) b = BiologicalSequence('ACGT', quality=[5, 6, 7, 8]) self.assertTrue(a.equals(b, ignore=['quality'])) # ignore sequence a = BiologicalSequence('ACGA') b = BiologicalSequence('ACGT') self.assertTrue(a.equals(b, ignore=['sequence'])) # ignore everything a = BiologicalSequence('ACGA', id='foo', description='abc', quality=[1, 2, 3, 4]) b = DNASequence('ACGT', id='bar', description='def', quality=[5, 6, 7, 8]) self.assertTrue(a.equals(b, ignore=['quality', 'description', 'id', 'sequence', 'type'])) def test_equals_false(self): # type mismatch a = BiologicalSequence('ACGT', id='foo', description='abc', quality=[1, 2, 3, 4]) b = NucleotideSequence('ACGT', id='bar', description='def', quality=[5, 6, 7, 8]) self.assertFalse(a.equals(b, ignore=['quality', 'description', 'id'])) # id mismatch a = BiologicalSequence('ACGT', id='foo') b = BiologicalSequence('ACGT', id='bar') self.assertFalse(a.equals(b)) # description mismatch a = BiologicalSequence('ACGT', description='foo') b = BiologicalSequence('ACGT', description='bar') self.assertFalse(a.equals(b)) # quality mismatch (both provided) a = BiologicalSequence('ACGT', quality=[1, 2, 3, 4]) b = BiologicalSequence('ACGT', quality=[1, 2, 3, 5]) self.assertFalse(a.equals(b)) # quality mismatch (one provided) a = BiologicalSequence('ACGT', quality=[1, 2, 3, 4]) b = BiologicalSequence('ACGT') self.assertFalse(a.equals(b)) # sequence mismatch a = BiologicalSequence('ACGT') b = BiologicalSequence('TGCA') self.assertFalse(a.equals(b)) def test_count(self): self.assertEqual(self.b1.count('A'), 3) self.assertEqual(self.b1.count('T'), 2) self.assertEqual(self.b1.count('TT'), 1) def test_degap(self): # use equals method to ensure that id, description, and filtered # quality are correctly propagated to the resulting sequence # no filtering, has quality self.assertTrue(self.b1.degap().equals(self.b1)) # no filtering, doesn't have quality self.assertTrue(self.b2.degap().equals(self.b2)) # everything is filtered, has quality self.assertTrue(self.b7.degap().equals( BiologicalSequence('', quality=[]))) # some filtering, has quality self.assertTrue(self.b8.degap().equals( BiologicalSequence('HELLO', id='hello', description='gapped hello', quality=[0, 1, 8, 9, 10]))) def test_distance(self): # note that test_hamming_distance covers default behavior more # extensively self.assertEqual(self.b1.distance(self.b1), 0.0) self.assertEqual(self.b1.distance(BiologicalSequence('GATTACC')), 1./7) def dumb_distance(x, y): return 42 self.assertEqual( self.b1.distance(self.b1, distance_fn=dumb_distance), 42) def test_distance_unequal_length(self): # Hamming distance (default) requires that sequences are of equal # length with self.assertRaises(BiologicalSequenceError): self.b1.distance(self.b2) # alternate distance functions don't have that requirement (unless # it's implemented within the provided distance function) def dumb_distance(x, y): return 42 self.assertEqual( self.b1.distance(self.b2, distance_fn=dumb_distance), 42) def test_fraction_diff(self): self.assertEqual(self.b1.fraction_diff(self.b1), 0., 5) self.assertEqual( self.b1.fraction_diff(BiologicalSequence('GATTACC')), 1. / 7., 5) def test_fraction_same(self): self.assertAlmostEqual(self.b1.fraction_same(self.b1), 1., 5) self.assertAlmostEqual( self.b1.fraction_same(BiologicalSequence('GATTACC')), 6. / 7., 5) def test_gap_maps(self): # in sequence with no gaps, the gap_maps are identical self.assertEqual(self.b1.gap_maps(), ([0, 1, 2, 3, 4, 5, 6], [0, 1, 2, 3, 4, 5, 6])) # in sequence with all gaps, the map of degapped to gapped is the empty # list (bc its length is 0), and the map of gapped to degapped is all # None self.assertEqual(self.b7.gap_maps(), ([], [None, None, None, None, None, None])) self.assertEqual(self.b8.gap_maps(), ([0, 1, 8, 9, 10], [0, 1, None, None, None, None, None, None, 2, 3, 4])) # example from the gap_maps doc string self.assertEqual(BiologicalSequence('-ACCGA-TA-').gap_maps(), ([1, 2, 3, 4, 5, 7, 8], [None, 0, 1, 2, 3, 4, None, 5, 6, None])) def test_gap_vector(self): self.assertEqual(self.b1.gap_vector(), [False] * len(self.b1)) self.assertEqual(self.b7.gap_vector(), [True] * len(self.b7)) self.assertEqual(self.b8.gap_vector(), [False, False, True, True, True, True, True, True, False, False, False]) def test_unsupported_characters(self): self.assertEqual(self.b1.unsupported_characters(), set('GATC')) self.assertEqual(self.b7.unsupported_characters(), set()) def test_has_unsupported_characters(self): self.assertTrue(self.b1.has_unsupported_characters()) self.assertFalse(self.b7.has_unsupported_characters()) def test_index(self): """ index functions as expected """ self.assertEqual(self.b1.index('G'), 0) self.assertEqual(self.b1.index('A'), 1) self.assertEqual(self.b1.index('AC'), 4) self.assertRaises(ValueError, self.b1.index, 'x') def test_is_gap(self): self.assertTrue(self.b1.is_gap('.')) self.assertTrue(self.b1.is_gap('-')) self.assertFalse(self.b1.is_gap('A')) self.assertFalse(self.b1.is_gap('x')) self.assertFalse(self.b1.is_gap(' ')) self.assertFalse(self.b1.is_gap('')) def test_is_gapped(self): self.assertFalse(self.b1.is_gapped()) self.assertFalse(self.b2.is_gapped()) self.assertTrue(self.b7.is_gapped()) self.assertTrue(self.b8.is_gapped()) def test_is_valid(self): self.assertFalse(self.b1.is_valid()) self.assertTrue(self.b7.is_valid()) def test_to_fasta(self): self.assertEqual(self.b1.to_fasta(), ">\nGATTACA\n") self.assertEqual(self.b1.to_fasta(terminal_character=""), ">\nGATTACA") self.assertEqual(self.b2.to_fasta(), ">test-seq-2 A test sequence\nACCGGTACC\n") self.assertEqual(self.b3.to_fasta(), ">test-seq-3 A protein sequence\nGREG\n") self.assertEqual(self.b4.to_fasta(), ">test-seq-4\nPRTEIN\n") self.assertEqual(self.b5.to_fasta(), "> some description\nLLPRTEIN\n") # alt parameters self.assertEqual(self.b2.to_fasta(field_delimiter=":"), ">test-seq-2:A test sequence\nACCGGTACC\n") self.assertEqual(self.b2.to_fasta(terminal_character="!"), ">test-seq-2 A test sequence\nACCGGTACC!") self.assertEqual( self.b2.to_fasta(field_delimiter=":", terminal_character="!"), ">test-seq-2:A test sequence\nACCGGTACC!") def test_upper(self): b = NucleotideSequence('GAt.ACa-', id='x', description='42', quality=range(8)) expected = NucleotideSequence('GAT.ACA-', id='x', description='42', quality=range(8)) # use equals method to ensure that id, description, and quality are # correctly propagated to the resulting sequence self.assertTrue(b.upper().equals(expected)) def test_lower(self): b = NucleotideSequence('GAt.ACa-', id='x', description='42', quality=range(8)) expected = NucleotideSequence('gat.aca-', id='x', description='42', quality=range(8)) # use equals method to ensure that id, description, and quality are # correctly propagated to the resulting sequence self.assertTrue(b.lower().equals(expected)) def test_regex_iter(self): pat = re_compile('(T+A)(CA)') obs = list(self.b1.regex_iter(pat)) exp = [(2, 5, 'TTA'), (5, 7, 'CA')] self.assertEqual(obs, exp) obs = list(self.b1.regex_iter(pat, retrieve_group_0=True)) exp = [(2, 7, 'TTACA'), (2, 5, 'TTA'), (5, 7, 'CA')] self.assertEqual(obs, exp) def test_find_features_nonexistent_feature_type(self): with self.assertRaises(ValueError): list(self.b1.find_features('purine_run')) class NucelotideSequenceTests(TestCase): def setUp(self): self.empty = NucleotideSequence('') self.b1 = NucleotideSequence('GATTACA') self.b2 = NucleotideSequence( 'ACCGGUACC', id="test-seq-2", description="A test sequence") def test_alphabet(self): exp = { 'A', 'C', 'B', 'D', 'G', 'H', 'K', 'M', 'N', 'S', 'R', 'U', 'T', 'W', 'V', 'Y', 'a', 'c', 'b', 'd', 'g', 'h', 'k', 'm', 'n', 's', 'r', 'u', 't', 'w', 'v', 'y' } # Test calling from an instance and purely static context. self.assertEqual(self.b1.alphabet(), exp) self.assertEqual(NucleotideSequence.alphabet(), exp) def test_gap_alphabet(self): self.assertEqual(self.b1.gap_alphabet(), set('-.')) def test_complement_map(self): exp = {} self.assertEqual(self.b1.complement_map(), exp) self.assertEqual(NucleotideSequence.complement_map(), exp) def test_iupac_standard_characters(self): exp = set("ACGTUacgtu") self.assertEqual(self.b1.iupac_standard_characters(), exp) self.assertEqual(NucleotideSequence.iupac_standard_characters(), exp) def test_iupac_degeneracies(self): exp = { # upper 'B': set(['C', 'U', 'T', 'G']), 'D': set(['A', 'U', 'T', 'G']), 'H': set(['A', 'C', 'U', 'T']), 'K': set(['U', 'T', 'G']), 'M': set(['A', 'C']), 'N': set(['A', 'C', 'U', 'T', 'G']), 'S': set(['C', 'G']), 'R': set(['A', 'G']), 'W': set(['A', 'U', 'T']), 'V': set(['A', 'C', 'G']), 'Y': set(['C', 'U', 'T']), # lower 'b': set(['c', 'u', 't', 'g']), 'd': set(['a', 'u', 't', 'g']), 'h': set(['a', 'c', 'u', 't']), 'k': set(['u', 't', 'g']), 'm': set(['a', 'c']), 'n': set(['a', 'c', 'u', 't', 'g']), 's': set(['c', 'g']), 'r': set(['a', 'g']), 'w': set(['a', 'u', 't']), 'v': set(['a', 'c', 'g']), 'y': set(['c', 'u', 't']) } self.assertEqual(self.b1.iupac_degeneracies(), exp) self.assertEqual(NucleotideSequence.iupac_degeneracies(), exp) # Test that we can modify a copy of the mapping without altering the # canonical representation. degen = NucleotideSequence.iupac_degeneracies() degen.update({'V': set("BRO"), 'Z': set("ZORRO")}) self.assertNotEqual(degen, exp) self.assertEqual(NucleotideSequence.iupac_degeneracies(), exp) def test_iupac_degenerate_characters(self): exp = set(['B', 'D', 'H', 'K', 'M', 'N', 'S', 'R', 'W', 'V', 'Y', 'b', 'd', 'h', 'k', 'm', 'n', 's', 'r', 'w', 'v', 'y']) self.assertEqual(self.b1.iupac_degenerate_characters(), exp) self.assertEqual(NucleotideSequence.iupac_degenerate_characters(), exp) def test_iupac_characters(self): exp = { 'A', 'C', 'B', 'D', 'G', 'H', 'K', 'M', 'N', 'S', 'R', 'U', 'T', 'W', 'V', 'Y', 'a', 'c', 'b', 'd', 'g', 'h', 'k', 'm', 'n', 's', 'r', 'u', 't', 'w', 'v', 'y' } self.assertEqual(self.b1.iupac_characters(), exp) self.assertEqual(NucleotideSequence.iupac_characters(), exp) def test_complement(self): self.assertRaises(BiologicalSequenceError, self.b1.complement) def test_reverse_complement(self): self.assertRaises(BiologicalSequenceError, self.b1.reverse_complement) def test_is_reverse_complement(self): self.assertRaises(BiologicalSequenceError, self.b1.is_reverse_complement, self.b1) def test_nondegenerates_invalid(self): with self.assertRaises(BiologicalSequenceError): list(NucleotideSequence('AZA').nondegenerates()) def test_nondegenerates_empty(self): self.assertEqual(list(self.empty.nondegenerates()), [self.empty]) def test_nondegenerates_no_degens(self): self.assertEqual(list(self.b1.nondegenerates()), [self.b1]) def test_nondegenerates_all_degens(self): # Same chars. exp = [NucleotideSequence('CC'), NucleotideSequence('CG'), NucleotideSequence('GC'), NucleotideSequence('GG')] # Sort based on sequence string, as order is not guaranteed. obs = sorted(NucleotideSequence('SS').nondegenerates(), key=str) self.assertEqual(obs, exp) # Different chars. exp = [NucleotideSequence('AC'), NucleotideSequence('AG'), NucleotideSequence('GC'), NucleotideSequence('GG')] obs = sorted(NucleotideSequence('RS').nondegenerates(), key=str) self.assertEqual(obs, exp) # Odd number of chars. obs = list(NucleotideSequence('NNN').nondegenerates()) self.assertEqual(len(obs), 5**3) def test_nondegenerates_mixed_degens(self): exp = [NucleotideSequence('AGC'), NucleotideSequence('AGT'), NucleotideSequence('AGU'), NucleotideSequence('GGC'), NucleotideSequence('GGT'), NucleotideSequence('GGU')] obs = sorted(NucleotideSequence('RGY').nondegenerates(), key=str) self.assertEqual(obs, exp) def test_nondegenerates_gap_mixed_case(self): exp = [NucleotideSequence('-A.a'), NucleotideSequence('-A.c'), NucleotideSequence('-C.a'), NucleotideSequence('-C.c')] obs = sorted(NucleotideSequence('-M.m').nondegenerates(), key=str) self.assertEqual(obs, exp) def test_find_features(self): exp = [(0, 2, 'GA'), (4, 5, 'A'), (6, 7, 'A')] obs = list(self.b1.find_features('purine_run')) self.assertEqual(obs, exp) exp = [(2, 4, 'TT'), (5, 6, 'C')] obs = list(self.b1.find_features('pyrimidine_run')) self.assertEqual(obs, exp) exp = [(0, 1, 'A'), (3, 5, 'GG'), (6, 7, 'A')] obs = list(self.b2.find_features('purine_run')) self.assertEqual(obs, exp) exp = [(1, 3, 'CC'), (5, 6, 'U'), (7, 9, 'CC')] obs = list(self.b2.find_features('pyrimidine_run')) self.assertEqual(obs, exp) def test_find_features_min_length(self): exp = [(0, 2, 'GA')] obs = list(self.b1.find_features('purine_run', 2)) self.assertEqual(obs, exp) exp = [(2, 4, 'TT')] obs = list(self.b1.find_features('pyrimidine_run', 2)) self.assertEqual(obs, exp) exp = [(3, 5, 'GG')] obs = list(self.b2.find_features('purine_run', 2)) self.assertEqual(obs, exp) exp = [(1, 3, 'CC'), (7, 9, 'CC')] obs = list(self.b2.find_features('pyrimidine_run', 2)) self.assertEqual(obs, exp) def test_find_features_no_feature_type(self): with self.assertRaises(ValueError): list(self.b1.find_features('nonexistent_feature_type')) def test_nondegenerates_propagate_optional_properties(self): seq = NucleotideSequence('RS', id='foo', description='bar', quality=[42, 999]) exp = [ NucleotideSequence('AC', id='foo', description='bar', quality=[42, 999]), NucleotideSequence('AG', id='foo', description='bar', quality=[42, 999]), NucleotideSequence('GC', id='foo', description='bar', quality=[42, 999]), NucleotideSequence('GG', id='foo', description='bar', quality=[42, 999]) ] obs = sorted(seq.nondegenerates(), key=str) for o, e in zip(obs, exp): # use equals method to ensure that id, description, and quality are # correctly propagated to the resulting sequence self.assertTrue(o.equals(e)) class DNASequenceTests(TestCase): def setUp(self): self.empty = DNASequence('') self.b1 = DNASequence('GATTACA') self.b2 = DNASequence('ACCGGTACC', id="test-seq-2", description="A test sequence", quality=range(9)) self.b3 = DNASequence( 'ACCGGUACC', id="bad-seq-1", description="Not a DNA sequence") self.b4 = DNASequence( 'MRWSYKVHDBN', id="degen", description="All of the degenerate bases") self.b5 = DNASequence('.G--ATTAC-A...') def test_alphabet(self): exp = { 'A', 'C', 'B', 'D', 'G', 'H', 'K', 'M', 'N', 'S', 'R', 'T', 'W', 'V', 'Y', 'a', 'c', 'b', 'd', 'g', 'h', 'k', 'm', 'n', 's', 'r', 't', 'w', 'v', 'y' } self.assertEqual(self.b1.alphabet(), exp) self.assertEqual(DNASequence.alphabet(), exp) def test_gap_alphabet(self): self.assertEqual(self.b1.gap_alphabet(), set('-.')) def test_complement_map(self): exp = { '-': '-', '.': '.', 'A': 'T', 'C': 'G', 'B': 'V', 'D': 'H', 'G': 'C', 'H': 'D', 'K': 'M', 'M': 'K', 'N': 'N', 'S': 'S', 'R': 'Y', 'T': 'A', 'W': 'W', 'V': 'B', 'Y': 'R', 'a': 't', 'c': 'g', 'b': 'v', 'd': 'h', 'g': 'c', 'h': 'd', 'k': 'm', 'm': 'k', 'n': 'n', 's': 's', 'r': 'y', 't': 'a', 'w': 'w', 'v': 'b', 'y': 'r' } self.assertEqual(self.b1.complement_map(), exp) self.assertEqual(DNASequence.complement_map(), exp) def test_iupac_standard_characters(self): exp = set("ACGTacgt") self.assertEqual(self.b1.iupac_standard_characters(), exp) self.assertEqual(DNASequence.iupac_standard_characters(), exp) def test_iupac_degeneracies(self): exp = { 'B': set(['C', 'T', 'G']), 'D': set(['A', 'T', 'G']), 'H': set(['A', 'C', 'T']), 'K': set(['T', 'G']), 'M': set(['A', 'C']), 'N': set(['A', 'C', 'T', 'G']), 'S': set(['C', 'G']), 'R': set(['A', 'G']), 'W': set(['A', 'T']), 'V': set(['A', 'C', 'G']), 'Y': set(['C', 'T']), 'b': set(['c', 't', 'g']), 'd': set(['a', 't', 'g']), 'h': set(['a', 'c', 't']), 'k': set(['t', 'g']), 'm': set(['a', 'c']), 'n': set(['a', 'c', 't', 'g']), 's': set(['c', 'g']), 'r': set(['a', 'g']), 'w': set(['a', 't']), 'v': set(['a', 'c', 'g']), 'y': set(['c', 't']) } self.assertEqual(self.b1.iupac_degeneracies(), exp) self.assertEqual(DNASequence.iupac_degeneracies(), exp) def test_iupac_degenerate_characters(self): exp = set(['B', 'D', 'H', 'K', 'M', 'N', 'S', 'R', 'W', 'V', 'Y', 'b', 'd', 'h', 'k', 'm', 'n', 's', 'r', 'w', 'v', 'y']) self.assertEqual(self.b1.iupac_degenerate_characters(), exp) self.assertEqual(DNASequence.iupac_degenerate_characters(), exp) def test_iupac_characters(self): exp = { 'A', 'C', 'B', 'D', 'G', 'H', 'K', 'M', 'N', 'S', 'R', 'T', 'W', 'V', 'Y', 'a', 'c', 'b', 'd', 'g', 'h', 'k', 'm', 'n', 's', 'r', 't', 'w', 'v', 'y' } self.assertEqual(self.b1.iupac_characters(), exp) self.assertEqual(DNASequence.iupac_characters(), exp) def test_complement(self): # use equals method to ensure that id, description, and quality are # correctly propagated to the resulting sequence self.assertTrue(self.b1.complement().equals(DNASequence("CTAATGT"))) self.assertTrue(self.b2.complement().equals( DNASequence("TGGCCATGG", id="test-seq-2", description="A test sequence", quality=range(9)))) self.assertRaises(BiologicalSequenceError, self.b3.complement) self.assertTrue(self.b4.complement().equals( DNASequence("KYWSRMBDHVN", id="degen", description="All of the degenerate bases"))) self.assertTrue(self.b5.complement().equals( DNASequence(".C--TAATG-T..."))) def test_reverse_complement(self): # use equals method to ensure that id, description, and (reversed) # quality scores are correctly propagated to the resulting sequence self.assertTrue(self.b1.reverse_complement().equals( DNASequence("TGTAATC"))) self.assertTrue(self.b2.reverse_complement().equals( DNASequence("GGTACCGGT", id="test-seq-2", description="A test sequence", quality=range(9)[::-1]))) self.assertRaises(BiologicalSequenceError, self.b3.reverse_complement) self.assertTrue(self.b4.reverse_complement().equals( DNASequence("NVHDBMRSWYK", id="degen", description="All of the degenerate bases"))) def test_unsupported_characters(self): self.assertEqual(self.b1.unsupported_characters(), set()) self.assertEqual(self.b2.unsupported_characters(), set()) self.assertEqual(self.b3.unsupported_characters(), set('U')) self.assertEqual(self.b4.unsupported_characters(), set()) def test_has_unsupported_characters(self): self.assertFalse(self.b1.has_unsupported_characters()) self.assertFalse(self.b2.has_unsupported_characters()) self.assertTrue(self.b3.has_unsupported_characters()) self.assertFalse(self.b4.has_unsupported_characters()) def test_is_reverse_complement(self): self.assertFalse(self.b1.is_reverse_complement(self.b1)) # id, description, and quality scores should be ignored (only sequence # data and type should be compared) self.assertTrue(self.b1.is_reverse_complement( DNASequence('TGTAATC', quality=range(7)))) self.assertTrue( self.b4.is_reverse_complement(DNASequence('NVHDBMRSWYK'))) def test_nondegenerates_invalid(self): with self.assertRaises(BiologicalSequenceError): list(DNASequence('AZA').nondegenerates()) def test_nondegenerates_empty(self): self.assertEqual(list(self.empty.nondegenerates()), [self.empty]) def test_nondegenerates_no_degens(self): self.assertEqual(list(self.b1.nondegenerates()), [self.b1]) def test_nondegenerates_all_degens(self): # Same chars. exp = [DNASequence('CC'), DNASequence('CG'), DNASequence('GC'), DNASequence('GG')] # Sort based on sequence string, as order is not guaranteed. obs = sorted(DNASequence('SS').nondegenerates(), key=str) self.assertEqual(obs, exp) # Different chars. exp = [DNASequence('AC'), DNASequence('AG'), DNASequence('GC'), DNASequence('GG')] obs = sorted(DNASequence('RS').nondegenerates(), key=str) self.assertEqual(obs, exp) # Odd number of chars. obs = list(DNASequence('NNN').nondegenerates()) self.assertEqual(len(obs), 4**3) def test_nondegenerates_mixed_degens(self): exp = [DNASequence('AGC'), DNASequence('AGT'), DNASequence('GGC'), DNASequence('GGT')] obs = sorted(DNASequence('RGY').nondegenerates(), key=str) self.assertEqual(obs, exp) def test_nondegenerates_gap_mixed_case(self): exp = [DNASequence('-A.a'), DNASequence('-A.c'), DNASequence('-C.a'), DNASequence('-C.c')] obs = sorted(DNASequence('-M.m').nondegenerates(), key=str) self.assertEqual(obs, exp) class RNASequenceTests(TestCase): def setUp(self): self.empty = RNASequence('') self.b1 = RNASequence('GAUUACA') self.b2 = RNASequence('ACCGGUACC', id="test-seq-2", description="A test sequence", quality=range(9)) self.b3 = RNASequence( 'ACCGGTACC', id="bad-seq-1", description="Not a RNA sequence") self.b4 = RNASequence( 'MRWSYKVHDBN', id="degen", description="All of the degenerate bases") self.b5 = RNASequence('.G--AUUAC-A...') def test_alphabet(self): exp = { 'A', 'C', 'B', 'D', 'G', 'H', 'K', 'M', 'N', 'S', 'R', 'U', 'W', 'V', 'Y', 'a', 'c', 'b', 'd', 'g', 'h', 'k', 'm', 'n', 's', 'r', 'u', 'w', 'v', 'y' } self.assertEqual(self.b1.alphabet(), exp) self.assertEqual(RNASequence.alphabet(), exp) def test_gap_alphabet(self): self.assertEqual(self.b1.gap_alphabet(), set('-.')) def test_complement_map(self): exp = { '-': '-', '.': '.', 'A': 'U', 'C': 'G', 'B': 'V', 'D': 'H', 'G': 'C', 'H': 'D', 'K': 'M', 'M': 'K', 'N': 'N', 'S': 'S', 'R': 'Y', 'U': 'A', 'W': 'W', 'V': 'B', 'Y': 'R', 'a': 'u', 'c': 'g', 'b': 'v', 'd': 'h', 'g': 'c', 'h': 'd', 'k': 'm', 'm': 'k', 'n': 'n', 's': 's', 'r': 'y', 'u': 'a', 'w': 'w', 'v': 'b', 'y': 'r' } self.assertEqual(self.b1.complement_map(), exp) self.assertEqual(RNASequence.complement_map(), exp) def test_iupac_standard_characters(self): exp = set("ACGUacgu") self.assertEqual(self.b1.iupac_standard_characters(), exp) self.assertEqual(RNASequence.iupac_standard_characters(), exp) def test_iupac_degeneracies(self): exp = { 'B': set(['C', 'U', 'G']), 'D': set(['A', 'U', 'G']), 'H': set(['A', 'C', 'U']), 'K': set(['U', 'G']), 'M': set(['A', 'C']), 'N': set(['A', 'C', 'U', 'G']), 'S': set(['C', 'G']), 'R': set(['A', 'G']), 'W': set(['A', 'U']), 'V': set(['A', 'C', 'G']), 'Y': set(['C', 'U']), 'b': set(['c', 'u', 'g']), 'd': set(['a', 'u', 'g']), 'h': set(['a', 'c', 'u']), 'k': set(['u', 'g']), 'm': set(['a', 'c']), 'n': set(['a', 'c', 'u', 'g']), 's': set(['c', 'g']), 'r': set(['a', 'g']), 'w': set(['a', 'u']), 'v': set(['a', 'c', 'g']), 'y': set(['c', 'u']) } self.assertEqual(self.b1.iupac_degeneracies(), exp) self.assertEqual(RNASequence.iupac_degeneracies(), exp) def test_iupac_degenerate_characters(self): exp = set(['B', 'D', 'H', 'K', 'M', 'N', 'S', 'R', 'W', 'V', 'Y', 'b', 'd', 'h', 'k', 'm', 'n', 's', 'r', 'w', 'v', 'y']) self.assertEqual(self.b1.iupac_degenerate_characters(), exp) self.assertEqual(RNASequence.iupac_degenerate_characters(), exp) def test_iupac_characters(self): exp = { 'A', 'C', 'B', 'D', 'G', 'H', 'K', 'M', 'N', 'S', 'R', 'U', 'W', 'V', 'Y', 'a', 'c', 'b', 'd', 'g', 'h', 'k', 'm', 'n', 's', 'r', 'u', 'w', 'v', 'y' } self.assertEqual(self.b1.iupac_characters(), exp) self.assertEqual(RNASequence.iupac_characters(), exp) def test_complement(self): # use equals method to ensure that id, description, and quality are # correctly propagated to the resulting sequence self.assertTrue(self.b1.complement().equals(RNASequence("CUAAUGU"))) self.assertTrue(self.b2.complement().equals( RNASequence("UGGCCAUGG", id="test-seq-2", description="A test sequence", quality=range(9)))) self.assertRaises(BiologicalSequenceError, self.b3.complement) self.assertTrue(self.b4.complement().equals( RNASequence("KYWSRMBDHVN", id="degen", description="All of the degenerate bases"))) self.assertTrue(self.b5.complement().equals( RNASequence(".C--UAAUG-U..."))) def test_reverse_complement(self): # use equals method to ensure that id, description, and (reversed) # quality scores are correctly propagated to the resulting sequence self.assertTrue(self.b1.reverse_complement().equals( RNASequence("UGUAAUC"))) self.assertTrue(self.b2.reverse_complement().equals( RNASequence("GGUACCGGU", id="test-seq-2", description="A test sequence", quality=range(9)[::-1]))) self.assertRaises(BiologicalSequenceError, self.b3.reverse_complement) self.assertTrue(self.b4.reverse_complement().equals( RNASequence("NVHDBMRSWYK", id="degen", description="All of the degenerate bases"))) def test_unsupported_characters(self): self.assertEqual(self.b1.unsupported_characters(), set()) self.assertEqual(self.b2.unsupported_characters(), set()) self.assertEqual(self.b3.unsupported_characters(), set('T')) self.assertEqual(self.b4.unsupported_characters(), set()) def test_has_unsupported_characters(self): self.assertFalse(self.b1.has_unsupported_characters()) self.assertFalse(self.b2.has_unsupported_characters()) self.assertTrue(self.b3.has_unsupported_characters()) self.assertFalse(self.b4.has_unsupported_characters()) def test_is_reverse_complement(self): self.assertFalse(self.b1.is_reverse_complement(self.b1)) # id, description, and quality scores should be ignored (only sequence # data and type should be compared) self.assertTrue(self.b1.is_reverse_complement( RNASequence('UGUAAUC', quality=range(7)))) self.assertTrue( self.b4.is_reverse_complement(RNASequence('NVHDBMRSWYK'))) def test_nondegenerates_invalid(self): with self.assertRaises(BiologicalSequenceError): list(RNASequence('AZA').nondegenerates()) def test_nondegenerates_empty(self): self.assertEqual(list(self.empty.nondegenerates()), [self.empty]) def test_nondegenerates_no_degens(self): self.assertEqual(list(self.b1.nondegenerates()), [self.b1]) def test_nondegenerates_all_degens(self): # Same chars. exp = [RNASequence('CC'), RNASequence('CG'), RNASequence('GC'), RNASequence('GG')] # Sort based on sequence string, as order is not guaranteed. obs = sorted(RNASequence('SS').nondegenerates(), key=str) self.assertEqual(obs, exp) # Different chars. exp = [RNASequence('AC'), RNASequence('AG'), RNASequence('GC'), RNASequence('GG')] obs = sorted(RNASequence('RS').nondegenerates(), key=str) self.assertEqual(obs, exp) # Odd number of chars. obs = list(RNASequence('NNN').nondegenerates()) self.assertEqual(len(obs), 4**3) def test_nondegenerates_mixed_degens(self): exp = [RNASequence('AGC'), RNASequence('AGU'), RNASequence('GGC'), RNASequence('GGU')] obs = sorted(RNASequence('RGY').nondegenerates(), key=str) self.assertEqual(obs, exp) def test_nondegenerates_gap_mixed_case(self): exp = [RNASequence('-A.a'), RNASequence('-A.c'), RNASequence('-C.a'), RNASequence('-C.c')] obs = sorted(RNASequence('-M.m').nondegenerates(), key=str) self.assertEqual(obs, exp) class ProteinSequenceTests(TestCase): def setUp(self): self.empty = ProteinSequence('') self.p1 = ProteinSequence('GREG') self.p2 = ProteinSequence( 'PRTEINSEQNCE', id="test-seq-2", description="A test sequence") self.p3 = ProteinSequence( 'PROTEIN', id="bad-seq-1", description="Not a protein sequence") def test_alphabet(self): exp = { 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'K', 'L', 'M', 'N', 'P', 'Q', 'R', 'S', 'T', 'V', 'W', 'X', 'Y', 'Z', 'a', 'b', 'c', 'd', 'e', 'f', 'g', 'h', 'i', 'k', 'l', 'm', 'n', 'p', 'q', 'r', 's', 't', 'v', 'w', 'x', 'y', 'z' } self.assertEqual(self.p1.alphabet(), exp) self.assertEqual(ProteinSequence.alphabet(), exp) def test_gap_alphabet(self): self.assertEqual(self.p1.gap_alphabet(), set('-.')) def test_iupac_standard_characters(self): exp = set("ACDEFGHIKLMNPQRSTVWYacdefghiklmnpqrstvwy") self.assertEqual(self.p1.iupac_standard_characters(), exp) self.assertEqual(ProteinSequence.iupac_standard_characters(), exp) def test_iupac_degeneracies(self): exp = { 'B': set(['D', 'N']), 'Z': set(['E', 'Q']), 'X': set(['A', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'K', 'L', 'M', 'N', 'P', 'Q', 'R', 'S', 'T', 'V', 'W', 'Y']), 'b': set(['d', 'n']), 'z': set(['e', 'q']), 'x': set(['a', 'c', 'd', 'e', 'f', 'g', 'h', 'i', 'k', 'l', 'm', 'n', 'p', 'q', 'r', 's', 't', 'v', 'w', 'y']), } self.assertEqual(self.p1.iupac_degeneracies(), exp) self.assertEqual(ProteinSequence.iupac_degeneracies(), exp) def test_iupac_degenerate_characters(self): exp = set(['B', 'X', 'Z', 'b', 'x', 'z']) self.assertEqual(self.p1.iupac_degenerate_characters(), exp) self.assertEqual(ProteinSequence.iupac_degenerate_characters(), exp) def test_iupac_characters(self): exp = { 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'K', 'L', 'M', 'N', 'P', 'Q', 'R', 'S', 'T', 'V', 'W', 'X', 'Y', 'Z', 'a', 'b', 'c', 'd', 'e', 'f', 'g', 'h', 'i', 'k', 'l', 'm', 'n', 'p', 'q', 'r', 's', 't', 'v', 'w', 'x', 'y', 'z' } self.assertEqual(self.p1.iupac_characters(), exp) self.assertEqual(ProteinSequence.iupac_characters(), exp) def test_nondegenerates(self): exp = [ProteinSequence('AD'), ProteinSequence('AN')] # Sort based on sequence string, as order is not guaranteed. obs = sorted(ProteinSequence('AB').nondegenerates(), key=str) self.assertEqual(obs, exp) if __name__ == "__main__": main()
Kleptobismol/scikit-bio
skbio/sequence/tests/test_sequence.py
Python
bsd-3-clause
56,349
[ "scikit-bio" ]
278d9eaf95c56c0c1c0b9b35cc369837e872090170b43bbf5636f735cf77a668
#-*- coding: utf8 # Author: David C. Lambert [dcl -at- panix -dot- com] # Copyright(c) 2013 # License: Simple BSD """The :mod:`random_layer` module implements Random Layer transformers. Random layers are arrays of hidden unit activations that are random functions of input activation values (dot products for simple activation functions, distances from prototypes for radial basis functions). They are used in the implementation of Extreme Learning Machines (ELMs), but can be used as a general input mapping. """ from abc import ABCMeta, abstractmethod from math import sqrt import numpy as np import scipy.sparse as sp from scipy.spatial.distance import cdist, pdist, squareform from sklearn.metrics import pairwise_distances from sklearn.utils import check_random_state, atleast2d_or_csr from sklearn.utils.extmath import safe_sparse_dot from sklearn.base import BaseEstimator, TransformerMixin __all__ = ['RandomLayer', 'MLPRandomLayer', 'RBFRandomLayer', 'GRBFRandomLayer', ] class BaseRandomLayer(BaseEstimator, TransformerMixin): """Abstract Base Class for random layers""" __metaclass__ = ABCMeta _internal_activation_funcs = dict() @classmethod def activation_func_names(cls): """Get list of internal activation function names""" return cls._internal_activation_funcs.keys() # take n_hidden and random_state, init components_ and # input_activations_ def __init__(self, n_hidden=20, random_state=0, activation_func=None, activation_args=None): self.n_hidden = n_hidden self.random_state = random_state self.activation_func = activation_func self.activation_args = activation_args self.components_ = dict() self.input_activations_ = None # keyword args for internally defined funcs self._extra_args = dict() @abstractmethod def _generate_components(self, X): """Generate components of hidden layer given X""" @abstractmethod def _compute_input_activations(self, X): """Compute input activations given X""" # compute input activations and pass them # through the hidden layer transfer functions # to compute the transform def _compute_hidden_activations(self, X): """Compute hidden activations given X""" self._compute_input_activations(X) acts = self.input_activations_ if (callable(self.activation_func)): args_dict = self.activation_args if (self.activation_args) else {} X_new = self.activation_func(acts, **args_dict) else: func_name = self.activation_func func = self._internal_activation_funcs[func_name] X_new = func(acts, **self._extra_args) return X_new # perform fit by generating random components based # on the input array def fit(self, X, y=None): """Generate a random hidden layer. Parameters ---------- X : {array-like, sparse matrix} of shape [n_samples, n_features] Training set: only the shape is used to generate random component values for hidden units y : is not used: placeholder to allow for usage in a Pipeline. Returns ------- self """ X = atleast2d_or_csr(X) self._generate_components(X) return self # perform transformation by calling compute_hidden_activations # (which will normally call compute_input_activations first) def transform(self, X, y=None): """Generate the random hidden layer's activations given X as input. Parameters ---------- X : {array-like, sparse matrix}, shape [n_samples, n_features] Data to transform y : is not used: placeholder to allow for usage in a Pipeline. Returns ------- X_new : numpy array of shape [n_samples, n_components] """ X = atleast2d_or_csr(X) if (self.components_ is None): raise ValueError('No components initialized') return self._compute_hidden_activations(X) class RandomLayer(BaseRandomLayer): """RandomLayer is a transformer that creates a feature mapping of the inputs that corresponds to a layer of hidden units with randomly generated components. The transformed values are a specified function of input activations that are a weighted combination of dot product (multilayer perceptron) and distance (rbf) activations: input_activation = alpha * mlp_activation + (1-alpha) * rbf_activation mlp_activation(x) = dot(x, weights) + bias rbf_activation(x) = rbf_width * ||x - center||/radius alpha and rbf_width are specified by the user weights and biases are taken from normal distribution of mean 0 and sd of 1 centers are taken uniformly from the bounding hyperrectangle of the inputs, and radii are max(||x-c||)/sqrt(n_centers*2) The input activation is transformed by a transfer function that defaults to numpy.tanh if not specified, but can be any callable that returns an array of the same shape as its argument (the input activation array, of shape [n_samples, n_hidden]). Functions provided are 'sine', 'tanh', 'tribas', 'inv_tribas', 'sigmoid', 'hardlim', 'softlim', 'gaussian', 'multiquadric', or 'inv_multiquadric'. Parameters ---------- `n_hidden` : int, optional (default=20) Number of units to generate `alpha` : float, optional (default=0.5) Mixing coefficient for distance and dot product input activations: activation = alpha*mlp_activation + (1-alpha)*rbf_width*rbf_activation `rbf_width` : float, optional (default=1.0) multiplier on rbf_activation `user_components`: dictionary, optional (default=None) dictionary containing values for components that woud otherwise be randomly generated. Valid key/value pairs are as follows: 'radii' : array-like of shape [n_hidden] 'centers': array-like of shape [n_hidden, n_features] 'biases' : array-like of shape [n_hidden] 'weights': array-like of shape [n_features, n_hidden] `activation_func` : {callable, string} optional (default='tanh') Function used to transform input activation It must be one of 'tanh', 'sine', 'tribas', 'inv_tribas', 'sigmoid', 'hardlim', 'softlim', 'gaussian', 'multiquadric', 'inv_multiquadric' or a callable. If None is given, 'tanh' will be used. If a callable is given, it will be used to compute the activations. `activation_args` : dictionary, optional (default=None) Supplies keyword arguments for a callable activation_func `random_state` : int, RandomState instance or None (default=None) Control the pseudo random number generator used to generate the hidden unit weights at fit time. Attributes ---------- `input_activations_` : numpy array of shape [n_samples, n_hidden] Array containing dot(x, hidden_weights) + bias for all samples `components_` : dictionary containing two keys: `bias_weights_` : numpy array of shape [n_hidden] `hidden_weights_` : numpy array of shape [n_features, n_hidden] See Also -------- """ # triangular activation function _tribas = (lambda x: np.clip(1.0 - np.fabs(x), 0.0, 1.0)) # inverse triangular activation function _inv_tribas = (lambda x: np.clip(np.fabs(x), 0.0, 1.0)) # sigmoid activation function _sigmoid = (lambda x: 1.0/(1.0 + np.exp(-x))) # hard limit activation function _hardlim = (lambda x: np.array(x > 0.0, dtype=float)) _softlim = (lambda x: np.clip(x, 0.0, 1.0)) # gaussian RBF _gaussian = (lambda x: np.exp(-pow(x, 2.0))) # multiquadric RBF _multiquadric = (lambda x: np.sqrt(1.0 + pow(x, 2.0))) # inverse multiquadric RBF _inv_multiquadric = (lambda x: 1.0/(np.sqrt(1.0 + pow(x, 2.0)))) # internal activation function table _internal_activation_funcs = {'sine': np.sin, 'tanh': np.tanh, 'tribas': _tribas, 'inv_tribas': _inv_tribas, 'sigmoid': _sigmoid, 'softlim': _softlim, 'hardlim': _hardlim, 'gaussian': _gaussian, 'multiquadric': _multiquadric, 'inv_multiquadric': _inv_multiquadric, } def __init__(self, n_hidden=20, alpha=0.5, random_state=None, activation_func='tanh', activation_args=None, user_components=None, rbf_width=1.0): super(RandomLayer, self).__init__(n_hidden=n_hidden, random_state=random_state, activation_func=activation_func, activation_args=activation_args) if (isinstance(self.activation_func, str)): func_names = self._internal_activation_funcs.keys() if (self.activation_func not in func_names): msg = "unknown activation function '%s'" % self.activation_func raise ValueError(msg) self.alpha = alpha self.rbf_width = rbf_width self.user_components = user_components self._use_mlp_input = (self.alpha != 0.0) self._use_rbf_input = (self.alpha != 1.0) def _get_user_components(self, key): """Look for given user component""" try: return self.user_components[key] except (TypeError, KeyError): return None def _compute_radii(self): """Generate RBF radii""" # use supplied radii if present radii = self._get_user_components('radii') # compute radii if (radii is None): centers = self.components_['centers'] n_centers = centers.shape[0] max_dist = np.max(pairwise_distances(centers)) radii = np.ones(n_centers) * max_dist/sqrt(2.0 * n_centers) self.components_['radii'] = radii def _compute_centers(self, X, sparse, rs): """Generate RBF centers""" # use supplied centers if present centers = self._get_user_components('centers') # use points taken uniformly from the bounding # hyperrectangle if (centers is None): n_features = X.shape[1] if (sparse): fxr = xrange(n_features) cols = [X.getcol(i) for i in fxr] min_dtype = X.dtype.type(1.0e10) sp_min = lambda col: np.minimum(min_dtype, np.min(col.data)) min_Xs = np.array(map(sp_min, cols)) max_dtype = X.dtype.type(-1.0e10) sp_max = lambda col: np.maximum(max_dtype, np.max(col.data)) max_Xs = np.array(map(sp_max, cols)) else: min_Xs = X.min(axis=0) max_Xs = X.max(axis=0) spans = max_Xs - min_Xs ctrs_size = (self.n_hidden, n_features) centers = min_Xs + spans * rs.uniform(0.0, 1.0, ctrs_size) self.components_['centers'] = centers def _compute_biases(self, rs): """Generate MLP biases""" # use supplied biases if present biases = self._get_user_components('biases') if (biases is None): b_size = self.n_hidden biases = rs.normal(size=b_size) self.components_['biases'] = biases def _compute_weights(self, X, rs): """Generate MLP weights""" # use supplied weights if present weights = self._get_user_components('weights') if (weights is None): n_features = X.shape[1] hw_size = (n_features, self.n_hidden) weights = rs.normal(size=hw_size) self.components_['weights'] = weights def _generate_components(self, X): """Generate components of hidden layer given X""" rs = check_random_state(self.random_state) if (self._use_mlp_input): self._compute_biases(rs) self._compute_weights(X, rs) if (self._use_rbf_input): self._compute_centers(X, sp.issparse(X), rs) self._compute_radii() def _compute_input_activations(self, X): """Compute input activations given X""" n_samples = X.shape[0] mlp_acts = np.zeros((n_samples, self.n_hidden)) if (self._use_mlp_input): b = self.components_['biases'] w = self.components_['weights'] mlp_acts = self.alpha * (safe_sparse_dot(X, w) + b) rbf_acts = np.zeros((n_samples, self.n_hidden)) if (self._use_rbf_input): radii = self.components_['radii'] centers = self.components_['centers'] scale = self.rbf_width * (1.0 - self.alpha) rbf_acts = scale * cdist(X, centers)/radii self.input_activations_ = mlp_acts + rbf_acts class MLPRandomLayer(RandomLayer): """Wrapper for RandomLayer with alpha (mixing coefficient) set to 1.0 for MLP activations only""" def __init__(self, n_hidden=20, random_state=None, activation_func='tanh', activation_args=None, weights=None, biases=None): user_components = {'weights': weights, 'biases': biases} super(MLPRandomLayer, self).__init__(n_hidden=n_hidden, random_state=random_state, activation_func=activation_func, activation_args=activation_args, user_components=user_components, alpha=1.0) class RBFRandomLayer(RandomLayer): """Wrapper for RandomLayer with alpha (mixing coefficient) set to 0.0 for RBF activations only""" def __init__(self, n_hidden=20, random_state=None, activation_func='gaussian', activation_args=None, centers=None, radii=None, rbf_width=1.0): user_components = {'centers': centers, 'radii': radii} super(RBFRandomLayer, self).__init__(n_hidden=n_hidden, random_state=random_state, activation_func=activation_func, activation_args=activation_args, user_components=user_components, rbf_width=rbf_width, alpha=0.0) class GRBFRandomLayer(RBFRandomLayer): """Random Generalized RBF Hidden Layer transformer Creates a layer of radial basis function units where: f(a), s.t. a = ||x-c||/r with c the unit center and f() is exp(-gamma * a^tau) where tau and r are computed based on [1] Parameters ---------- `n_hidden` : int, optional (default=20) Number of units to generate, ignored if centers are provided `grbf_lambda` : float, optional (default=0.05) GRBF shape parameter `gamma` : {int, float} optional (default=1.0) Width multiplier for GRBF distance argument `centers` : array of shape (n_hidden, n_features), optional (default=None) If provided, overrides internal computation of the centers `radii` : array of shape (n_hidden), optional (default=None) If provided, overrides internal computation of the radii `use_exemplars` : bool, optional (default=False) If True, uses random examples from the input to determine the RBF centers, ignored if centers are provided `random_state` : int or RandomState instance, optional (default=None) Control the pseudo random number generator used to generate the centers at fit time, ignored if centers are provided Attributes ---------- `components_` : dictionary containing two keys: `radii_` : numpy array of shape [n_hidden] `centers_` : numpy array of shape [n_hidden, n_features] `input_activations_` : numpy array of shape [n_samples, n_hidden] Array containing ||x-c||/r for all samples See Also -------- ELMRegressor, ELMClassifier, SimpleELMRegressor, SimpleELMClassifier, SimpleRandomLayer References ---------- .. [1] Fernandez-Navarro, et al, "MELM-GRBF: a modified version of the extreme learning machine for generalized radial basis function neural networks", Neurocomputing 74 (2011), 2502-2510 """ # def _grbf(acts, taus): # """GRBF activation function""" # return np.exp(np.exp(-pow(acts, taus))) _grbf = (lambda acts, taus: np.exp(np.exp(-pow(acts, taus)))) _internal_activation_funcs = {'grbf': _grbf} def __init__(self, n_hidden=20, grbf_lambda=0.001, centers=None, radii=None, random_state=None): super(GRBFRandomLayer, self).__init__(n_hidden=n_hidden, activation_func='grbf', centers=centers, radii=radii, random_state=random_state) self.grbf_lambda = grbf_lambda self.dN_vals = None self.dF_vals = None self.tau_vals = None # get centers from superclass, then calculate tau_vals # according to ref [1] def _compute_centers(self, X, sparse, rs): """Generate centers, then compute tau, dF and dN vals""" super(GRBFRandomLayer, self)._compute_centers(X, sparse, rs) centers = self.components_['centers'] sorted_distances = np.sort(squareform(pdist(centers))) self.dF_vals = sorted_distances[:, -1] self.dN_vals = sorted_distances[:, 1]/100.0 #self.dN_vals = 0.0002 * np.ones(self.dF_vals.shape) tauNum = np.log(np.log(self.grbf_lambda) / np.log(1.0 - self.grbf_lambda)) tauDenom = np.log(self.dF_vals/self.dN_vals) self.tau_vals = tauNum/tauDenom self._extra_args['taus'] = self.tau_vals # get radii according to ref [1] def _compute_radii(self): """Generate radii""" denom = pow(-np.log(self.grbf_lambda), 1.0/self.tau_vals) self.components_['radii'] = self.dF_vals/denom
ashishbaghudana/mthesis-ashish
resources/tees/Utils/Libraries/PythonELM/random_layer.py
Python
mit
18,828
[ "Gaussian" ]
26318986f16c89ee5ea3c6b356471999c3afbad256050cfec6b1b21ad545ed08
""" Using otagrum ============= """ # %% import openturns as ot import pyAgrum as gum from matplotlib import pylab as plt import otagrum # %% def showDot(dotstring): try: # fails outside notebook import pyAgrum.lib.notebook as gnb gnb.showDot(dotstring) except ImportError: import pydotplus as dot from io import BytesIO g = dot.graph_from_dot_data(dotstring) with BytesIO() as f: f.write(g.create_png()) f.seek(0) img = plt.imread(f) fig = plt.imshow(img) fig.axes.axis('off') plt.show() # %% # Creating the CBN structure # We begin by creating the CBN that will be used throughout this example. # # To do so, we need a NamedDAG structure... # %% dag = gum.DAG() # %% mapping = {} mapping['A'] = dag.addNode() # Add node A mapping['B'] = dag.addNode() # Add node B mapping['C'] = dag.addNode() # Add node C mapping['D'] = dag.addNode() # Add node D # %% dag.addArc(mapping['A'], mapping['C']) # Arc A -> C dag.addArc(mapping['B'], mapping['C']) # Arc B -> C dag.addArc(mapping['C'], mapping['D']) # Arc C -> D # %% dag # %% structure = otagrum.NamedDAG(dag, list(mapping.keys())) # %% showDot(structure.toDot()) # %% # Parameters of the CBN ... and a collection of marginals and local conditional copulas. # %% m_list = [ot.Uniform(0.0, 1.0) for i in range(structure.getSize())] # Local marginals lcc_list = [] # Local Conditional Copulas for i in range( structure.getSize() ): dim_lcc = structure.getParents(i).getSize() + 1 R = ot.CorrelationMatrix(dim_lcc) for j in range(dim_lcc): for k in range(j): R[j, k] = 0.6 lcc_list.append( ot.Normal([0.0]*dim_lcc, [1.0]*dim_lcc, R).getCopula() ) # %% # Now that we have a NamedDAG structure and a collection of local conditional copulas, we can construct a CBN. # %% cbn = otagrum.ContinuousBayesianNetwork(structure, m_list, lcc_list) # %% # Having a CBN, we can now sample from it. # %% ot.RandomGenerator.SetSeed(10) # Set random seed sample = cbn.getSample(1000) train = sample[:-100] test = sample[-100:] # %% # Learning the structure with continuous PC: # Now that we have data, we can use it to learn the structure with the continuous PC algorithm. # %% learner = otagrum.ContinuousPC(sample, maxConditioningSetSize=5, alpha=0.1) # %% # We first learn the skeleton, that is the undirected structure. # %% skeleton = learner.learnSkeleton() # %% skeleton # %% # Then we look for the v-structures, leading to a Partially Directed Acyclic Graph (PDAG) # %% pdag = learner.learnPDAG() # %% pdag # %% # Finally, the remaining edges are oriented by propagating constraints # %% ndag = learner.learnDAG() # %% showDot(ndag.toDot()) # %% # The true structure has been recovered. # Learning with continuous MIIC # Otagrum provides another learning algorithm to learn the structure: the continuous MIIC algorithm. # %% learner = otagrum.ContinuousMIIC(sample) # %% # This algorithm relies on the computing of mutual information which is done through the copula function. Hence, a copula model for the data is needed. The continuous MIIC algorithm can make use of Gaussian copulas (parametric) or Bernstein copulas (non-parametric) to compute mutual information. Moreover, due to finite sampling size, the mutual information estimators need to be corrected. Two kind of correction are provided: NoCorr (no correction) or Naive (a fixed correction is substracted from the raw mutual information estimators). Those behaviours can be changed as follows: # %% #learner.setCMode(otagrum.CorrectedMutualInformation.CModeTypes_Bernstein) # By default learner.setCMode(otagrum.CorrectedMutualInformation.CModeTypes_Gaussian) # To use Gaussian copulas learner.setKMode(otagrum.CorrectedMutualInformation.KModeTypes_Naive) # By default #learner.setKMode(otagrum.CorrectedMutualInformation.KModeTypes_NoCorr) # To use the raw estimators learner.setAlpha(0.01) # Set the correction value for the Naive behaviour, it is set to 0.01 by default # %% # As with PC algorithm we can learn the skeleton, PDAG and DAG using # %% skeleton = learner.learnSkeleton() # %% skeleton # %% pdag = learner.learnPDAG() # %% pdag # %% dag = learner.learnDAG() # %% showDot(dag.toDot()) # %% # Learning parameters # Bernstein copulas are used to learn the local conditional copulas associated to each node # %% m_list = [] lcc_list = [] for i in range(train.getDimension()): m_list.append(ot.UniformFactory().build(train.getMarginal(i))) indices = [i] + [int(n) for n in ndag.getParents(i)] dim_lcc = len(indices) if dim_lcc == 1: bernsteinCopula = ot.IndependentCopula(1) elif dim_lcc > 1: K = otagrum.ContinuousTTest.GetK(len(train), dim_lcc) bernsteinCopula = ot.EmpiricalBernsteinCopula(train.getMarginal(indices), K, False) lcc_list.append(bernsteinCopula) # %% # We can now create the learned CBN # %% lcbn = otagrum.ContinuousBayesianNetwork(ndag, m_list, lcc_list) # Learned CBN # %% # And compare the mean loglikelihood between the true and the learned models # %% def compute_mean_LL(cbn, test): ll = 0 for t in test: ll += cbn.computeLogPDF(t) ll /= len(test) return ll # %% true_LL = compute_mean_LL(cbn, test) print(true_LL) # %% exp_LL = compute_mean_LL(lcbn, test) print(exp_LL)
openturns/otagrum
python/doc/examples/plot_using_otagrum.py
Python
lgpl-3.0
5,402
[ "Gaussian" ]
60a5ce495dcb73bc9505e73fd28483fc85b93618c2c079ea962c5decca909be3
#!/usr/bin/env python # Copyright (c) 2012 ARM Limited # All rights reserved # # The license below extends only to copyright in the software and shall # not be construed as granting a license to any other intellectual # property including but not limited to intellectual property relating # to a hardware implementation of the functionality of the software # licensed hereunder. You may use the software subject to the license # terms below provided that you ensure that this notice is replicated # unmodified and in its entirety in all distributions of the software, # modified or unmodified, in source code or in binary form. # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions are # met: redistributions of source code must retain the above copyright # notice, this list of conditions and the following disclaimer; # redistributions in binary form must reproduce the above copyright # notice, this list of conditions and the following disclaimer in the # documentation and/or other materials provided with the distribution; # neither the name of the copyright holders nor the names of its # contributors may be used to endorse or promote products derived from # this software without specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS # "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT # LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR # A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT # OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, # SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT # LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, # DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY # THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT # (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE # OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. # # Authors: Ali Saidi # # This python code is used to migrate checkpoints that were created in one # version of the simulator to newer version. As features are added or bugs are # fixed some of the state that needs to be checkpointed can change. If you have # many historic checkpoints that you use, manually editing them to fix them is # both time consuming and error-prone. # This script provides a way to migrate checkpoints to the newer repository in # a programatic way. It can be imported into another script or used on the # command line. From the command line the script will either migrate every # checkpoint it finds recursively (-r option) or a single checkpoint. When a # change is made to the gem5 repository that breaks previous checkpoints a # from_N() method should be implemented here and the gem5CheckpointVersion # variable in src/sim/serialize.hh should be incremented. For each version # between the checkpoints current version and the new version the from_N() # method will be run, passing in a ConfigParser object which contains the open # file. As these operations can be isa specific the method can verify the isa # and use regexes to find the correct sections that need to be updated. import ConfigParser import sys, os import os.path as osp # An example of a translator def from_0(cpt): if cpt.get('root','isa') == 'arm': for sec in cpt.sections(): import re # Search for all the execution contexts if re.search('.*sys.*\.cpu.*\.x.\..*', sec): # Update each one mr = cpt.get(sec, 'miscRegs').split() #mr.insert(21,0) #mr.insert(26,0) cpt.set(sec, 'miscRegs', ' '.join(str(x) for x in mr)) # The backing store supporting the memories in the system has changed # in that it is now stored globally per address range. As a result the # actual storage is separate from the memory controllers themselves. def from_1(cpt): for sec in cpt.sections(): import re # Search for a physical memory if re.search('.*sys.*\.physmem$', sec): # Add the number of stores attribute to the global physmem cpt.set(sec, 'nbr_of_stores', '1') # Get the filename and size as this is moving to the # specific backing store mem_filename = cpt.get(sec, 'filename') mem_size = cpt.get(sec, '_size') cpt.remove_option(sec, 'filename') cpt.remove_option(sec, '_size') # Get the name so that we can create the new section system_name = str(sec).split('.')[0] section_name = system_name + '.physmem.store0' cpt.add_section(section_name) cpt.set(section_name, 'store_id', '0') cpt.set(section_name, 'range_size', mem_size) cpt.set(section_name, 'filename', mem_filename) elif re.search('.*sys.*\.\w*mem$', sec): # Due to the lack of information about a start address, # this migration only works if there is a single memory in # the system, thus starting at 0 raise ValueError("more than one memory detected (" + sec + ")") def from_2(cpt): for sec in cpt.sections(): import re # Search for a CPUs if re.search('.*sys.*cpu', sec): try: junk = cpt.get(sec, 'instCnt') cpt.set(sec, '_pid', '0') except ConfigParser.NoOptionError: pass # The ISA is now a separate SimObject, which means that we serialize # it in a separate section instead of as a part of the ThreadContext. def from_3(cpt): isa = cpt.get('root','isa') isa_fields = { "alpha" : ( "fpcr", "uniq", "lock_flag", "lock_addr", "ipr" ), "arm" : ( "miscRegs" ), "sparc" : ( "asi", "tick", "fprs", "gsr", "softint", "tick_cmpr", "stick", "stick_cmpr", "tpc", "tnpc", "tstate", "tt", "tba", "pstate", "tl", "pil", "cwp", "gl", "hpstate", "htstate", "hintp", "htba", "hstick_cmpr", "strandStatusReg", "fsr", "priContext", "secContext", "partId", "lsuCtrlReg", "scratchPad", "cpu_mondo_head", "cpu_mondo_tail", "dev_mondo_head", "dev_mondo_tail", "res_error_head", "res_error_tail", "nres_error_head", "nres_error_tail", "tick_intr_sched", "cpu", "tc_num", "tick_cmp", "stick_cmp", "hstick_cmp"), "x86" : ( "regVal" ), } isa_fields = isa_fields.get(isa, []) isa_sections = [] for sec in cpt.sections(): import re re_cpu_match = re.match('^(.*sys.*\.cpu[^.]*)\.xc\.(.+)$', sec) # Search for all the execution contexts if not re_cpu_match: continue if re_cpu_match.group(2) != "0": # This shouldn't happen as we didn't support checkpointing # of in-order and O3 CPUs. raise ValueError("Don't know how to migrate multi-threaded CPUs " "from version 1") isa_section = [] for fspec in isa_fields: for (key, value) in cpt.items(sec, raw=True): if key in isa_fields: isa_section.append((key, value)) name = "%s.isa" % re_cpu_match.group(1) isa_sections.append((name, isa_section)) for (key, value) in isa_section: cpt.remove_option(sec, key) for (sec, options) in isa_sections: # Some intermediate versions of gem5 have empty ISA sections # (after we made the ISA a SimObject, but before we started to # serialize into a separate ISA section). if not cpt.has_section(sec): cpt.add_section(sec) else: if cpt.items(sec): raise ValueError("Unexpected populated ISA section in old " "checkpoint") for (key, value) in options: cpt.set(sec, key, value) # Version 5 of the checkpoint format removes the MISCREG_CPSR_MODE # register from the ARM register file. def from_4(cpt): if cpt.get('root','isa') == 'arm': for sec in cpt.sections(): import re # Search for all ISA sections if re.search('.*sys.*\.cpu.*\.isa', sec): mr = cpt.get(sec, 'miscRegs').split() # Remove MISCREG_CPSR_MODE del mr[137] cpt.set(sec, 'miscRegs', ' '.join(str(x) for x in mr)) # Version 6 of the checkpoint format adds tlb to x86 checkpoints def from_5(cpt): if cpt.get('root','isa') == 'x86': for sec in cpt.sections(): import re # Search for all ISA sections if re.search('.*sys.*\.cpu.*\.dtb$', sec): cpt.set(sec, '_size', '0') cpt.set(sec, 'lruSeq', '0') if re.search('.*sys.*\.cpu.*\.itb$', sec): cpt.set(sec, '_size', '0') cpt.set(sec, 'lruSeq', '0') else: print "ISA is not x86" migrations = [] migrations.append(from_0) migrations.append(from_1) migrations.append(from_2) migrations.append(from_3) migrations.append(from_4) migrations.append(from_5) verbose_print = False def verboseprint(*args): if not verbose_print: return for arg in args: print arg, print def process_file(path, **kwargs): if not osp.isfile(path): import errno raise IOError(ennro.ENOENT, "No such file", path) verboseprint("Processing file %s...." % path) if kwargs.get('backup', True): import shutil shutil.copyfile(path, path + '.bak') cpt = ConfigParser.SafeConfigParser() # gem5 is case sensitive with paramaters cpt.optionxform = str # Read the current data cpt_file = file(path, 'r') cpt.readfp(cpt_file) cpt_file.close() # Make sure we know what we're starting from if not cpt.has_option('root','cpt_ver'): raise LookupError("cannot determine version of checkpoint") cpt_ver = cpt.getint('root','cpt_ver') # If the current checkpoint is longer than the migrations list, we have a problem # and someone didn't update this file if cpt_ver > len(migrations): raise ValueError("upgrade script is too old and needs updating") verboseprint("\t...file is at version %#x" % cpt_ver) if cpt_ver == len(migrations): verboseprint("\t...nothing to do") return # Walk through every function from now until the end fixing the checkpoint for v in xrange(cpt_ver,len(migrations)): verboseprint("\t...migrating to version %#x" % (v + 1)) migrations[v](cpt) cpt.set('root','cpt_ver', str(v + 1)) # Write the old data back verboseprint("\t...completed") cpt.write(file(path, 'w')) if __name__ == '__main__': from optparse import OptionParser parser = OptionParser("usage: %prog [options] <filename or directory>") parser.add_option("-r", "--recurse", action="store_true", help="Recurse through all subdirectories modifying "\ "each checkpoint that is found") parser.add_option("-N", "--no-backup", action="store_false", dest="backup", default=True, help="Do no backup each checkpoint before modifying it") parser.add_option("-v", "--verbose", action="store_true", help="Print out debugging information as") (options, args) = parser.parse_args() if len(args) != 1: parser.error("You must specify a checkpoint file to modify or a "\ "directory of checkpoints to recursively update") verbose_print = options.verbose # Deal with shell variables and ~ path = osp.expandvars(osp.expanduser(args[0])) # Process a single file if we have it if osp.isfile(path): process_file(path, **vars(options)) # Process an entire directory elif osp.isdir(path): cpt_file = osp.join(path, 'm5.cpt') if options.recurse: # Visit very file and see if it matches for root,dirs,files in os.walk(path): for name in files: if name == 'm5.cpt': process_file(osp.join(root,name), **vars(options)) for dir in dirs: pass # Maybe someone passed a cpt.XXXXXXX directory and not m5.cpt elif osp.isfile(cpt_file): process_file(cpt_file, **vars(options)) else: print "Error: checkpoint file not found at in %s " % path, print "and recurse not specified" sys.exit(1) sys.exit(0)
prodromou87/gem5
util/cpt_upgrader.py
Python
bsd-3-clause
12,954
[ "VisIt" ]
245c973228a71047459f52d51f6cc4bddd5b4bedf77b42b1130973b8ce3768e8
# -*- coding: utf-8 -*- # Dioptas - GUI program for fast processing of 2D X-ray diffraction data # Principal author: Clemens Prescher (clemens.prescher@gmail.com) # Copyright (C) 2014-2019 GSECARS, University of Chicago, USA # Copyright (C) 2015-2018 Institute for Geology and Mineralogy, University of Cologne, Germany # Copyright (C) 2019-2020 DESY, Hamburg, Germany # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. import numpy as np s2pi = np.sqrt(2 * np.pi) def gaussian(x, amplitude=1.0, center=0.0, sigma=1.0): """1 dimensional gaussian: gaussian(x, amplitude, center, sigma) """ return (amplitude / (s2pi * sigma)) * np.exp(-(1.0 * x - center) ** 2 / (2 * sigma ** 2))
Dioptas/Dioptas
dioptas/model/util/PeakShapes.py
Python
gpl-3.0
1,283
[ "Gaussian" ]
4749e9516f934e0fc3b6b35d3cc8d20e11accc4a294915518cb36bbcd1e34360
import os import mimetypes import copy import tempfile import shutil import logging import json from django.core.urlresolvers import reverse from django.core.exceptions import ObjectDoesNotExist, SuspiciousFileOperation from django.http import HttpResponseRedirect from django.shortcuts import redirect from django.contrib.sites.models import Site from rest_framework.pagination import PageNumberPagination from rest_framework.views import APIView from rest_framework.response import Response from rest_framework import generics, status from rest_framework.request import Request from rest_framework.exceptions import ValidationError, NotAuthenticated, PermissionDenied, NotFound from hs_core import hydroshare from hs_core.models import AbstractResource from hs_core.hydroshare.utils import get_resource_by_shortkey, get_resource_types from hs_core.views import utils as view_utils from hs_core.views.utils import ACTION_TO_AUTHORIZE from hs_core.views import serializers from hs_core.views import pagination from hs_core.hydroshare.utils import get_file_storage, resource_modified from hs_core.serialization import GenericResourceMeta, HsDeserializationDependencyException, \ HsDeserializationException from hs_core.hydroshare.hs_bagit import create_bag_files logger = logging.getLogger(__name__) # Mixins class ResourceToListItemMixin(object): def resourceToResourceListItem(self, r): site_url = hydroshare.utils.current_site_url() bag_url = site_url + AbstractResource.bag_url(r.short_id) science_metadata_url = site_url + reverse('get_update_science_metadata', args=[r.short_id]) resource_map_url = site_url + reverse('get_resource_map', args=[r.short_id]) resource_url = site_url + r.get_absolute_url() resource_list_item = serializers.ResourceListItem(resource_type=r.resource_type, resource_id=r.short_id, resource_title=r.metadata.title.value, creator=r.first_creator.name, public=r.raccess.public, discoverable=r.raccess.discoverable, shareable=r.raccess.shareable, immutable=r.raccess.immutable, published=r.raccess.published, date_created=r.created, date_last_updated=r.updated, bag_url=bag_url, science_metadata_url=science_metadata_url, resource_map_url=resource_map_url, resource_url=resource_url) return resource_list_item class ResourceFileToListItemMixin(object): def resourceFileToListItem(self, f): url = hydroshare.utils.current_site_url() + f.resource_file.url fsize = f.resource_file.size mimetype = mimetypes.guess_type(url) if mimetype[0]: ftype = mimetype[0] else: ftype = repr(None) resource_file_info_item = serializers.ResourceFileItem(url=url, size=fsize, content_type=ftype) return resource_file_info_item class ResourceTypes(generics.ListAPIView): """ Get a list of resource types REST URL: hsapi/resourceTypes HTTP method: GET example return JSON format for GET /hsapi/resourceTypes (note response will consist of only one page): [ { "resource_type": "GenericResource" }, { "resource_type": "RasterResource" }, { "resource_type": "RefTimeSeries" }, { "resource_type": "TimeSeriesResource" }, { "resource_type": "NetcdfResource" }, { "resource_type": "ModelProgramResource" }, { "resource_type": "ModelInstanceResource" }, { "resource_type": "ToolResource" }, { "resource_type": "SWATModelInstanceResource" } ] """ pagination_class = pagination.SmallDatumPagination def get(self, request): return self.list(request) def get_queryset(self): return [serializers.ResourceType(resource_type=rtype.__name__) for rtype in get_resource_types()] def get_serializer_class(self): return serializers.ResourceTypesSerializer class ResourceList(ResourceToListItemMixin, generics.ListAPIView): """ Get a list of resources based on the following filter query parameters DEPRECATED: See GET /resource/ in CreateResource For an anonymous user, all public resources will be listed. For any authenticated user with no other query parameters provided in the request, all resources that are viewable by the user will be listed. REST URL: hsapi/resourceList/{query parameters} HTTP method: GET Supported query parameters (all are optional): :type owner: str :type types: list of resource type class names :type from_date: str (e.g., 2015-04-01) :type to_date: str (e.g., 2015-05-01) :type edit_permission: bool :param owner: (optional) - to get a list of resources owned by a specified username :param types: (optional) - to get a list of resources of the specified resource types :param from_date: (optional) - to get a list of resources created on or after this date :param to_date: (optional) - to get a list of resources created on or before this date :param edit_permission: (optional) - to get a list of resources for which the authorised user has edit permission :rtype: json string :return: a paginated list of resources with data for resource id, title, resource type, creator, public, date created, date last updated, resource bag url path, and science metadata url path example return JSON format for GET /hsapi/resourceList: { "count":n "next": link to next page "previous": link to previous page "results":[ {"resource_type": resource type, "resource_title": resource title, "resource_id": resource id, "creator": creator name, "date_created": date resource created, "date_last_updated": date resource last updated, "public": true or false, "discoverable": true or false, "shareable": true or false, "immutable": true or false, "published": true or false, "bag_url": link to bag file, "science_metadata_url": link to science metadata, "resource_url": link to resource landing HTML page}, {"resource_type": resource type, "resource_title": resource title, "resource_id": resource id, "creator": creator name, "date_created": date resource created, "date_last_updated": date resource last updated, "public": true or false, "discoverable": true or false, "shareable": true or false, "immutable": true or false, "published": true or false, "bag_url": link to bag file, "science_metadata_url": link to science metadata, "resource_url": link to resource landing HTML page}, ] } """ pagination_class = PageNumberPagination def get(self, request): return self.list(request) # needed for list of resources def get_queryset(self): resource_list_request_validator = serializers.ResourceListRequestValidator( data=self.request.query_params) if not resource_list_request_validator.is_valid(): raise ValidationError(detail=resource_list_request_validator.errors) filter_parms = resource_list_request_validator.validated_data filter_parms['user'] = (self.request.user if self.request.user.is_authenticated() else None) if len(filter_parms['type']) == 0: filter_parms['type'] = None else: filter_parms['type'] = list(filter_parms['type']) filter_parms['public'] = not self.request.user.is_authenticated() filtered_res_list = [] for r in hydroshare.get_resource_list(**filter_parms): resource_list_item = self.resourceToResourceListItem(r) filtered_res_list.append(resource_list_item) return filtered_res_list def get_serializer_class(self): return serializers.ResourceListItemSerializer class CheckTaskStatus(generics.RetrieveAPIView): def get(self, request, task_id): url = reverse('rest_check_task_status', kwargs={'task_id': task_id}) return HttpResponseRedirect(url) class ResourceReadUpdateDelete(ResourceToListItemMixin, generics.RetrieveUpdateDestroyAPIView): """ Read, update, or delete a resource REST URL: hsapi/resource/{pk} HTTP method: GET :return: (on success): The resource in zipped BagIt format. REST URL: hsapi/resource/{pk} HTTP method: DELETE :return: (on success): JSON string of the format: {'resource_id':pk} REST URL: hsapi/resource/{pk} HTTP method: PUT :return: (on success): JSON string of the format: {'resource_id':pk} :type str :param pk: resource id :rtype: JSON string for http methods DELETE and PUT, and resource file data bytes for GET :raises: NotFound: return JSON format: {'detail': 'No resource was found for resource id':pk} PermissionDenied: return JSON format: {'detail': 'You do not have permission to perform this action.'} ValidationError: return JSON format: {parameter-1': ['error message-1'], 'parameter-2': ['error message-2'], .. } :raises: ValidationError: return json format: {'parameter-1':['error message-1'], 'parameter-2': ['error message-2'], .. } """ pagination_class = PageNumberPagination allowed_methods = ('GET', 'PUT', 'DELETE') def get(self, request, pk): """ Get resource in zipped BagIt format """ res, _, _ = view_utils.authorize(request, pk, needed_permission=ACTION_TO_AUTHORIZE.VIEW_RESOURCE) site_url = hydroshare.utils.current_site_url() if res.resource_type.lower() == "reftimeseriesresource": # if res is RefTimeSeriesResource bag_url = site_url + reverse('rest_download_refts_resource_bag', kwargs={'shortkey': pk}) else: bag_url = site_url + reverse('rest_download', kwargs={'path': 'bags/{}.zip'.format(pk)}) return HttpResponseRedirect(bag_url) def put(self, request, pk): # TODO: update resource - involves overwriting a resource from the provided bag file raise NotImplementedError() def delete(self, request, pk): # only resource owners are allowed to delete view_utils.authorize(request, pk, needed_permission=ACTION_TO_AUTHORIZE.DELETE_RESOURCE) hydroshare.delete_resource(pk) # spec says we need return the id of the resource that got deleted - otherwise would # have used status code 204 and not 200 return Response(data={'resource_id': pk}, status=status.HTTP_200_OK) def get_serializer_class(self): return serializers.ResourceListItemSerializer class ResourceListCreate(ResourceToListItemMixin, generics.ListCreateAPIView): """ Create a new resource or list existing resources REST URL: hsapi/resource/ HTTP method: POST Request data payload parameters: :type resource_type: str :type title: str :type edit_users: str :type edit_groups: str :type view_users: str :type view_groups: str :param resource_type: resource type name :param title: (optional) title of the resource (default value: 'Untitled resource') :param edit_users: (optional) list of comma separated usernames that should have edit permission for the resource :param edit_groups: (optional) list of comma separated group names that should have edit permission for the resource :param view_users: (optional) list of comma separated usernames that should have view permission for the resource :param view_groups: (optional) list of comma separated group names that should have view permission for the resource :param metadata: (optional) data for any valid metadata element including resource specific metadata elements can be passed as json string: example (passing data for the 'Coverage' element): [{'coverage':{'type': 'period', 'start': '01/01/2000', 'end': '12/12/2010'}}, ...] Note: the parameter 'metadata' can't be used for passing data for the following core metadata elements: Title, Description (abstract), Subject (keyword), Date, Publisher, Type, Format :param extra_metadata: (optional) data for any user-defined key/value pair metadata elements of the resource can be passed as json string example : {'Outlet Point Latitude': '40', 'Outlet Point Longitude': '-110'} :return: id and type of the resource created :rtype: json string of the format: {'resource-id':id, 'resource_type': resource type} :raises: NotAuthenticated: return json format: {'detail': 'Authentication credentials were not provided.'} ValidationError: return json format: {parameter-1':['error message-1'], 'parameter-2': ['error message-2'], .. } REST URL: hsapi/resource/ HTTP method: GET Supported query parameters (all are optional): :type owner: str :type types: list of resource type class names :type from_date: str (e.g., 2015-04-01) :type to_date: str (e.g., 2015-05-01) :type edit_permission: bool :param owner: (optional) - to get a list of resources owned by a specified username :param types: (optional) - to get a list of resources of the specified resource types :param from_date: (optional) - to get a list of resources created on or after this date :param to_date: (optional) - to get a list of resources created on or before this date :param edit_permission: (optional) - to get a list of resources for which the authorised user has edit permission :rtype: json string :return: a paginated list of resources with data for resource id, title, resource type, creator, public, date created, date last updated, resource bag url path, and science metadata url path example return JSON format for GET /hsapi/resourceList: { "count":n "next": link to next page "previous": link to previous page "results":[ {"resource_type": resource type, "resource_title": resource title, "resource_id": resource id, "creator": creator name, "date_created": date resource created, "date_last_updated": date resource last updated, "public": true or false, "discoverable": true or false, "shareable": true or false, "immutable": true or false, "published": true or false, "bag_url": link to bag file, "science_metadata_url": link to science metadata, "resource_url": link to resource landing HTML page}, {"resource_type": resource type, "resource_title": resource title, "resource_id": resource id, "creator": creator name, "date_created": date resource created, "date_last_updated": date resource last updated, "public": true or false, "discoverable": true or false, "shareable": true or false, "immutable": true or false, "published": true or false, "bag_url": link to bag file, "science_metadata_url": link to science metadata, "resource_url": link to resource landing HTML page}, ] } """ def initialize_request(self, request, *args, **kwargs): """ Hack to work around the following issue in django-rest-framework: https://github.com/tomchristie/django-rest-framework/issues/3951 Couch: This issue was recently closed (10/12/2016, 2 days before this writing) and is slated to be incorporated in the Django REST API 3.5.0 release. At that time, we should remove this hack. :param request: :param args: :param kwargs: :return: """ if not isinstance(request, Request): # Don't deep copy the file data as it may contain an open file handle old_file_data = copy.copy(request.FILES) old_post_data = copy.deepcopy(request.POST) request = super(ResourceListCreate, self).initialize_request(request, *args, **kwargs) request.POST.update(old_post_data) request.FILES.update(old_file_data) return request # Couch: This is called explicitly in the overrided create() method and thus this # declaration does nothing. Thus, it can be changed to whatever is convenient. # Currently, it is convenient to use the listing serializer instead, so that # it will be the default output serializer. # def get_serializer_class(self): # return serializers.ResourceCreateRequestValidator def post(self, request): return self.create(request) # Override the create() method from the CreateAPIView class def create(self, request, *args, **kwargs): if not request.user.is_authenticated(): raise NotAuthenticated() resource_create_request_validator = serializers.ResourceCreateRequestValidator( data=request.data) if not resource_create_request_validator.is_valid(): raise ValidationError(detail=resource_create_request_validator.errors) validated_request_data = resource_create_request_validator.validated_data resource_type = validated_request_data['resource_type'] res_title = validated_request_data.get('title', 'Untitled resource') keywords = validated_request_data.get('keywords', None) abstract = validated_request_data.get('abstract', None) metadata = validated_request_data.get('metadata', None) extra_metadata = validated_request_data.get('extra_metadata', None) num_files = len(request.FILES) # TODO: (Couch) reconsider whether multiple file upload should be # supported when multipart bug fixed. if num_files > 0: if num_files > 1: raise ValidationError(detail={'file': 'Multiple file upload is not allowed on ' 'resource creation. Add additional files ' 'after the resource is created.'}) # Place files into format expected by hydroshare.utils.resource_pre_create_actions and # hydroshare.create_resource, i.e. a tuple of # django.core.files.uploadedfile.TemporaryUploadedFile objects. files = [request.FILES['file'], ] else: files = [] if metadata is not None: metadata = json.loads(metadata) _validate_metadata(metadata) if extra_metadata is not None: extra_metadata = json.loads(extra_metadata) # TODO: validate extra metadata here try: _, res_title, metadata, _ = hydroshare.utils.resource_pre_create_actions( resource_type=resource_type, resource_title=res_title, page_redirect_url_key=None, files=files, metadata=metadata, **kwargs) except Exception as ex: error_msg = {'resource': "Resource creation failed. %s" % ex.message} raise ValidationError(detail=error_msg) try: resource = hydroshare.create_resource( resource_type=resource_type, owner=request.user, title=res_title, edit_users=validated_request_data.get('edit_users', None), view_users=validated_request_data.get('view_users', None), edit_groups=validated_request_data.get('edit_groups', None), view_groups=validated_request_data.get('view_groups', None), keywords=keywords, metadata=metadata, extra_metadata=extra_metadata, files=files ) if abstract: resource.metadata.create_element('description', abstract=abstract) except Exception as ex: error_msg = {'resource': "Resource creation failed. %s" % ex.message} raise ValidationError(detail=error_msg) response_data = {'resource_type': resource_type, 'resource_id': resource.short_id} return Response(data=response_data, status=status.HTTP_201_CREATED) pagination_class = PageNumberPagination def get(self, request): return self.list(request) # needed for list of resources # copied from ResourceList def get_queryset(self): resource_list_request_validator = serializers.ResourceListRequestValidator( data=self.request.query_params) if not resource_list_request_validator.is_valid(): raise ValidationError(detail=resource_list_request_validator.errors) filter_parms = resource_list_request_validator.validated_data filter_parms['user'] = (self.request.user if self.request.user.is_authenticated() else None) if len(filter_parms['type']) == 0: filter_parms['type'] = None else: filter_parms['type'] = list(filter_parms['type']) filter_parms['public'] = not self.request.user.is_authenticated() filtered_res_list = [] for r in hydroshare.get_resource_list(**filter_parms): resource_list_item = self.resourceToResourceListItem(r) filtered_res_list.append(resource_list_item) return filtered_res_list # covers serialization of output from GET request def get_serializer_class(self): return serializers.ResourceListItemSerializer class SystemMetadataRetrieve(ResourceToListItemMixin, APIView): """ Retrieve resource system metadata REST URL: hsapi/sysmeta/{pk} HTTP method: GET :type pk: str :param pk: id of the resource :return: system metadata as JSON string :rtype: str :raises: NotFound: return JSON format: {'detail': 'No resource was found for resource id:pk'} PermissionDenied: return JSON format: {'detail': 'You do not have permission to perform this action.'} example return JSON format for GET hsapi/sysmeta/<RESOURCE_ID>: { "resource_type": resource type, "resource_title": resource title, "resource_id": resource id, "creator": creator user name, "date_created": date resource created, "date_last_updated": date resource last updated, "public": true or false, "discoverable": true or false, "shareable": true or false, "immutable": true or false, "published": true or false, "bag_url": link to bag file, "science_metadata_url": link to science metadata } """ allowed_methods = ('GET',) def get(self, request, pk): """ Get resource system metadata, as well as URLs to the bag and science metadata """ res, _, _ = view_utils.authorize(request, pk, needed_permission=ACTION_TO_AUTHORIZE.VIEW_METADATA) ser = self.get_serializer_class()(self.resourceToResourceListItem(res)) return Response(data=ser.data, status=status.HTTP_200_OK) def get_serializer_class(self): return serializers.ResourceListItemSerializer class AccessRulesUpdate(APIView): """ Set access rules for a resource REST URL: hsapi/resource/{pk}/access DEPRECATED: hsapi/resource/accessRules/{pk} HTTP method: PUT :type pk: str :param pk: id of the resource :return: No content. Status code will 200 (OK) """ # TODO: (Couch) Need GET as well. allowed_methods = ('PUT',) def put(self, request, pk): """ Update access rules """ # only resource owners are allowed to change resource flags (e.g., public) view_utils.authorize(request, pk, needed_permission=ACTION_TO_AUTHORIZE.SET_RESOURCE_FLAG) access_rules_validator = serializers.AccessRulesRequestValidator(data=request.data) if not access_rules_validator.is_valid(): raise ValidationError(detail=access_rules_validator.errors) validated_request_data = access_rules_validator.validated_data res = get_resource_by_shortkey(pk) res.raccess.public = validated_request_data['public'] res.raccess.save() return Response(data={'resource_id': pk}, status=status.HTTP_200_OK) class ScienceMetadataRetrieveUpdate(APIView): """ Retrieve resource science metadata REST URL: hsapi/scimeta/{pk} HTTP method: GET :type pk: str :param pk: id of the resource :return: science metadata as XML document :rtype: str :raises: NotFound: return json format: {'detail': 'No resource was found for resource id:pk'} PermissionDenied: return json format: {'detail': 'You do not have permission to perform this action.'} REST URL: hsapi/scimeta/{pk} HTTP method: PUT :type pk: str :param pk: id of the resource :type metadata: json :param metadata: resource metadata :return: resource id :rtype: json of the format: {'resource_id':pk} :raises: NotFound: return json format: {'detail': 'No resource was found for resource id':pk} PermissionDenied: return json format: {'detail': 'You do not have permission to perform this action.'} ValidationError: return json format: {parameter-1': ['error message-1'], 'parameter-2': ['error message-2'], .. } """ ACCEPT_FORMATS = ('application/xml', 'application/rdf+xml') allowed_methods = ('GET', 'PUT') def get(self, request, pk): view_utils.authorize(request, pk, needed_permission=ACTION_TO_AUTHORIZE.VIEW_METADATA) scimeta_url = hydroshare.utils.current_site_url() + AbstractResource.scimeta_url(pk) return redirect(scimeta_url) def put(self, request, pk): # Update science metadata based on resourcemetadata.xml uploaded resource, authorized, user = view_utils.authorize( request, pk, needed_permission=ACTION_TO_AUTHORIZE.EDIT_RESOURCE, raises_exception=False) if not authorized: raise PermissionDenied() files = request.FILES.values() if len(files) == 0: error_msg = {'file': 'No resourcemetadata.xml file was found to update resource ' 'metadata.'} raise ValidationError(detail=error_msg) elif len(files) > 1: error_msg = {'file': ('More than one file was found. Only one file, named ' 'resourcemetadata.xml, ' 'can be used to update resource metadata.')} raise ValidationError(detail=error_msg) scimeta = files[0] if scimeta.content_type not in self.ACCEPT_FORMATS: error_msg = {'file': ("Uploaded file has content type {t}, " "but only these types are accepted: {e}.").format( t=scimeta.content_type, e=",".join(self.ACCEPT_FORMATS))} raise ValidationError(detail=error_msg) expect = 'resourcemetadata.xml' if scimeta.name != expect: error_msg = {'file': "Uploaded file has name {n}, but expected {e}.".format( n=scimeta.name, e=expect)} raise ValidationError(detail=error_msg) # Temp directory to store resourcemetadata.xml tmp_dir = tempfile.mkdtemp() try: # Fake the bag structure so that GenericResourceMeta.read_metadata_from_resource_bag # can read and validate the system and science metadata for us. bag_data_path = os.path.join(tmp_dir, 'data') os.mkdir(bag_data_path) # Copy new science metadata to bag data path scimeta_path = os.path.join(bag_data_path, 'resourcemetadata.xml') shutil.copy(scimeta.temporary_file_path(), scimeta_path) # Copy existing resource map to bag data path # (use a file-like object as the file may be in iRODS, so we can't # just copy it to a local path) resmeta_path = os.path.join(bag_data_path, 'resourcemap.xml') with open(resmeta_path, 'wb') as resmeta: storage = get_file_storage() resmeta_irods = storage.open(AbstractResource.sysmeta_path(pk)) shutil.copyfileobj(resmeta_irods, resmeta) resmeta_irods.close() try: # Read resource system and science metadata domain = Site.objects.get_current().domain rm = GenericResourceMeta.read_metadata_from_resource_bag(tmp_dir, hydroshare_host=domain) # Update resource metadata rm.write_metadata_to_resource(resource, update_title=True, update_keywords=True) create_bag_files(resource) except HsDeserializationDependencyException as e: msg = ("HsDeserializationDependencyException encountered when updating " "science metadata for resource {pk}; depedent resource was {dep}.") msg = msg.format(pk=pk, dep=e.dependency_resource_id) logger.error(msg) raise ValidationError(detail=msg) except HsDeserializationException as e: raise ValidationError(detail=e.message) resource_modified(resource, request.user, overwrite_bag=False) return Response(data={'resource_id': pk}, status=status.HTTP_202_ACCEPTED) finally: shutil.rmtree(tmp_dir) class ResourceMapRetrieve(APIView): """ Retrieve resource map REST URL: hsapi/resource/{pk}/map HTTP method: GET :type pk: str :param pk: id of the resource :return: resource map as XML document :rtype: str :raises: NotFound: return json format: {'detail': 'No resource was found for resource id:pk'} PermissionDenied: return json format: {'detail': 'You do not have permission to perform this action.'} """ allowed_methods = ('GET') def get(self, request, pk): view_utils.authorize(request, pk, needed_permission=ACTION_TO_AUTHORIZE.VIEW_METADATA) resmap_url = hydroshare.utils.current_site_url() + AbstractResource.resmap_url(pk) return redirect(resmap_url) class ResourceFileCRUD(APIView): """ Retrieve, add, update or delete a resource file REST URL: hsapi/resource/{pk}/files/{filename} HTTP method: GET :type pk: str :type filename: str :param pk: resource id :param filename: name of the file to retrieve/download :return: resource file data :rtype: file data bytes REST URL: POST hsapi/resource/{pk}/files/ UNUSED: See ResourceFileListCreate for details. HTTP method: POST Request post data: file data (required) :type pk: str :param pk: resource id :return: id of the resource and name of the file added :rtype: json string of format: {'resource_id':pk, 'file_name': name of the file added} REST URL: hsapi/resource/{pk}/files/{filename} HTTP method: PUT :type pk: str :type filename: str :param pk: resource id :param filename: name of the file to update :return: id of the resource and name of the file :rtype: json string of format: {'resource_id':pk, 'file_name': name of the file updates} REST URL: hsapi/resource/{pk}/files/{filename} HTTP method: DELETE :type pk: str :type filename: str :param pk: resource id :param filename: name of the file to delete :return: id of the resource and name of the file :rtype: json string of format: {'resource_id':pk, 'file_name': name of the file deleted} :raises: NotFound: return json format: {'detail': 'No resource was found for resource id':pk} PermissionDenied: return json format: {'detail': 'You do not have permission to perform this action.'} ValidationError: return json format: {'parameter-1':['error message-1'], 'parameter-2': ['error message-2'], .. } """ allowed_methods = ('GET', 'POST', 'PUT', 'DELETE') def initialize_request(self, request, *args, **kwargs): """ Hack to work around the following issue in django-rest-framework: https://github.com/tomchristie/django-rest-framework/issues/3951 Couch: This issue was recently closed (10/12/2016, 2 days before this writing) and is slated to be incorporated in the Django REST API 3.5.0 release. At that time, we should remove this hack. :param request: :param args: :param kwargs: :return: """ if not isinstance(request, Request): # Don't deep copy the file data as it may contain an open file handle old_file_data = copy.copy(request.FILES) old_post_data = copy.deepcopy(request.POST) request = super(ResourceFileCRUD, self).initialize_request(request, *args, **kwargs) request.POST.update(old_post_data) request.FILES.update(old_file_data) return request def get(self, request, pk, pathname): resource, _, _ = view_utils.authorize( request, pk, needed_permission=ACTION_TO_AUTHORIZE.VIEW_RESOURCE) if not resource.supports_folders and '/' in pathname: return Response("Resource type does not support folders", status.HTTP_403_FORBIDDEN) try: view_utils.irods_path_is_allowed(pathname) except (ValidationError, SuspiciousFileOperation) as ex: return Response(ex.message, status_code=status.HTTP_400_BAD_REQUEST) try: f = hydroshare.get_resource_file(pk, pathname) except ObjectDoesNotExist: err_msg = 'File with file name {file_name} does not exist for resource with ' \ 'resource id {res_id}'.format(file_name=pathname, res_id=pk) raise NotFound(detail=err_msg) # redirects to django_irods/views.download function # use new internal url for rest call # TODO: (Couch) Migrate model (with a "data migration") so that this hack is not needed. redirect_url = f.url.replace('django_irods/download/', 'django_irods/rest_download/') return HttpResponseRedirect(redirect_url) def post(self, request, pk, pathname): """ Add a file to a resource. :param request: :param pk: Primary key of the resource (i.e. resource short ID) :param pathname: the path to the containing folder in the folder hierarchy :return: Leaving out pathname in the URI calls a different class function in ResourceFileListCreate that stores in the root directory instead. """ resource, _, _ = view_utils.authorize(request, pk, needed_permission=ACTION_TO_AUTHORIZE.EDIT_RESOURCE) resource_files = request.FILES.values() if len(resource_files) == 0: error_msg = {'file': 'No file was found to add to the resource.'} raise ValidationError(detail=error_msg) elif len(resource_files) > 1: error_msg = {'file': 'More than one file was found. Only one file can be ' 'added at a time.'} raise ValidationError(detail=error_msg) # TODO: (Brian) I know there has been some discussion when to validate a file # I agree that we should not validate and extract metadata as part of the file add api # Once we have a decision, I will change this implementation accordingly. In that case # we have to implement additional rest endpoints for file validation and extraction. try: hydroshare.utils.resource_file_add_pre_process(resource=resource, files=[resource_files[0]], user=request.user, extract_metadata=True) except (hydroshare.utils.ResourceFileSizeException, hydroshare.utils.ResourceFileValidationException, Exception) as ex: error_msg = {'file': 'Adding file to resource failed. %s' % ex.message} raise ValidationError(detail=error_msg) try: res_file_objects = hydroshare.utils.resource_file_add_process(resource=resource, files=[resource_files[0]], folder=pathname, user=request.user, extract_metadata=True) except (hydroshare.utils.ResourceFileValidationException, Exception) as ex: error_msg = {'file': 'Adding file to resource failed. %s' % ex.message} raise ValidationError(detail=error_msg) # prepare response data file_name = os.path.basename(res_file_objects[0].resource_file.name) response_data = {'resource_id': pk, 'file_name': file_name} resource_modified(resource, request.user, overwrite_bag=False) return Response(data=response_data, status=status.HTTP_201_CREATED) def delete(self, request, pk, pathname): resource, _, user = view_utils.authorize( request, pk, needed_permission=ACTION_TO_AUTHORIZE.EDIT_RESOURCE) if not resource.supports_folders and '/' in pathname: return Response("Resource type does not support folders", status.HTTP_403_FORBIDDEN) try: view_utils.irods_path_is_allowed(pathname) # check for hacking attempts except (ValidationError, SuspiciousFileOperation) as ex: return Response(ex.message, status=status.HTTP_400_BAD_REQUEST) try: hydroshare.delete_resource_file(pk, pathname, user) except ObjectDoesNotExist as ex: # matching file not found raise NotFound(detail=ex.message) # prepare response data response_data = {'resource_id': pk, 'file_name': pathname} resource_modified(resource, request.user, overwrite_bag=False) return Response(data=response_data, status=status.HTTP_200_OK) def put(self, request, pk, pathname): # TODO: (Brian) Currently we do not have this action for the front end. Will implement # in the next iteration. Implement only after we have a decision on when to validate a file raise NotImplementedError() class ResourceFileListCreate(ResourceFileToListItemMixin, generics.ListCreateAPIView): """ Create a resource file or retrieve a list of resource files REST URL: hsapi/resource/{pk}/files/ DEPRECATED: hsapi/resource/{pk}/file_list/ HTTP method: GET :type pk: str :type filename: str :param pk: resource id :param filename: name of the file to retrieve/download :return: JSON representation of list of files of the form: REST URL: POST hsapi/resource/{pk}/files/ HTTP method: POST Request post data: file data (required) :type pk: str :param pk: resource id :return: id of the resource and name of the file added :rtype: json string of format: {'resource_id':pk, 'file_name': name of the file added} { "count": 2, "next": null, "previous": null, "results": [ { "url": "http://mill24.cep.unc.edu/django_irods/ download/bd88d2a152894134928c587d38cf0272/data/contents/ mytest_resource/text_file.txt", "size": 21, "content_type": "text/plain" }, { "url": "http://mill24.cep.unc.edu/django_irods/download/ bd88d2a152894134928c587d38cf0272/data/contents/mytest_resource/a_directory/cea.tif", "size": 270993, "content_type": "image/tiff" } ] } :raises: NotFound: return json format: {'detail': 'No resource was found for resource id':pk} PermissionDenied: return json format: {'detail': 'You do not have permission to perform this action.'} """ allowed_methods = ('GET', 'POST') def initialize_request(self, request, *args, **kwargs): """ Hack to work around the following issue in django-rest-framework: https://github.com/tomchristie/django-rest-framework/issues/3951 Couch: This issue was recently closed (10/12/2016, 2 days before this writing) and is slated to be incorporated in the Django REST API 3.5.0 release. At that time, we should remove this hack. :param request: :param args: :param kwargs: :return: """ if not isinstance(request, Request): # Don't deep copy the file data as it may contain an open file handle old_file_data = copy.copy(request.FILES) old_post_data = copy.deepcopy(request.POST) request = super(ResourceFileListCreate, self).initialize_request( request, *args, **kwargs) request.POST.update(old_post_data) request.FILES.update(old_file_data) return request def get(self, request, pk): """ Get a listing of files within a resource. :param request: :param pk: Primary key of the resource (i.e. resource short ID) :return: """ return self.list(request) def get_queryset(self): resource, _, _ = view_utils.authorize(self.request, self.kwargs['pk'], needed_permission=ACTION_TO_AUTHORIZE.VIEW_RESOURCE) resource_file_info_list = [] for f in resource.files.all(): resource_file_info_list.append(self.resourceFileToListItem(f)) return resource_file_info_list def get_serializer_class(self): return serializers.ResourceFileSerializer def post(self, request, pk): """ Add a file to a resource. :param request: :param pk: Primary key of the resource (i.e. resource short ID) :return: """ resource, _, _ = view_utils.authorize(request, pk, needed_permission=ACTION_TO_AUTHORIZE.EDIT_RESOURCE) resource_files = request.FILES.values() if len(resource_files) == 0: error_msg = {'file': 'No file was found to add to the resource.'} raise ValidationError(detail=error_msg) elif len(resource_files) > 1: error_msg = {'file': 'More than one file was found. Only one file can be ' 'added at a time.'} raise ValidationError(detail=error_msg) # TODO: (Brian) I know there has been some discussion when to validate a file # I agree that we should not validate and extract metadata as part of the file add api # Once we have a decision, I will change this implementation accordingly. In that case # we have to implement additional rest endpoints for file validation and extraction. try: hydroshare.utils.resource_file_add_pre_process(resource=resource, files=[resource_files[0]], user=request.user, extract_metadata=True) except (hydroshare.utils.ResourceFileSizeException, hydroshare.utils.ResourceFileValidationException, Exception) as ex: error_msg = {'file': 'Adding file to resource failed. %s' % ex.message} raise ValidationError(detail=error_msg) try: res_file_objects = hydroshare.utils.resource_file_add_process(resource=resource, files=[resource_files[0]], user=request.user, extract_metadata=True) except (hydroshare.utils.ResourceFileValidationException, Exception) as ex: error_msg = {'file': 'Adding file to resource failed. %s' % ex.message} raise ValidationError(detail=error_msg) # prepare response data file_name = os.path.basename(res_file_objects[0].resource_file.name) response_data = {'resource_id': pk, 'file_name': file_name} resource_modified(resource, request.user, overwrite_bag=False) return Response(data=response_data, status=status.HTTP_201_CREATED) def _validate_metadata(metadata_list): """ Make sure the metadata_list does not have data for the following core metadata elements. Exception is raised if any of the following elements is present in metadata_list: title - (endpoint has a title parameter which should be used for specifying resource title) subject (keyword) - (endpoint has a keywords parameter which should be used for specifying resource keywords) description (abstract)- (endpoint has a abstract parameter which should be used for specifying resource abstract) publisher - this element is created upon resource publication format - this element is created by the system based on the resource content files date - this element is created by the system type - this element is created by the system :param metadata_list: list of dicts each representing data for a specific metadata element :return: """ err_message = "Metadata validation failed. Metadata element '{}' was found in value passed " \ "for parameter 'metadata'. Though it's a valid element it can't be passed " \ "as part of 'metadata' parameter." for element in metadata_list: # here k is the name of the element # v is a dict of all element attributes/field names and field values k, v = element.items()[0] if k.lower() in ('title', 'subject', 'description', 'publisher', 'format', 'date', 'type'): err_message = err_message.format(k.lower()) raise ValidationError(detail=err_message)
FescueFungiShare/hydroshare
hs_core/views/resource_rest_api.py
Python
bsd-3-clause
48,034
[ "Brian" ]
3ec6b78fa4bf94835401dd5b0c0856c894a347abc7066123a1c928f7c63d08e0
""" Backports. Mostly from scikit-learn """ import numpy as np from scipy import linalg ############################################################################### # For scikit-learn < 0.14 def _pinvh(a, cond=None, rcond=None, lower=True): """Compute the (Moore-Penrose) pseudo-inverse of a hermetian matrix. Calculate a generalized inverse of a symmetric matrix using its eigenvalue decomposition and including all 'large' eigenvalues. Parameters ---------- a : array, shape (N, N) Real symmetric or complex hermetian matrix to be pseudo-inverted cond, rcond : float or None Cutoff for 'small' eigenvalues. Singular values smaller than rcond * largest_eigenvalue are considered zero. If None or -1, suitable machine precision is used. lower : boolean Whether the pertinent array data is taken from the lower or upper triangle of a. (Default: lower) Returns ------- B : array, shape (N, N) Raises ------ LinAlgError If eigenvalue does not converge Examples -------- >>> import numpy as np >>> a = np.random.randn(9, 6) >>> a = np.dot(a, a.T) >>> B = _pinvh(a) >>> np.allclose(a, np.dot(a, np.dot(B, a))) True >>> np.allclose(B, np.dot(B, np.dot(a, B))) True """ a = np.asarray_chkfinite(a) s, u = linalg.eigh(a, lower=lower) if rcond is not None: cond = rcond if cond in [None, -1]: t = u.dtype.char.lower() factor = {'f': 1E3, 'd': 1E6} cond = factor[t] * np.finfo(t).eps # unlike svd case, eigh can lead to negative eigenvalues above_cutoff = (abs(s) > cond * np.max(abs(s))) psigma_diag = np.zeros_like(s) psigma_diag[above_cutoff] = 1.0 / s[above_cutoff] return np.dot(u * psigma_diag, np.conjugate(u).T) try: from sklearn.utils.extmath import pinvh except ImportError: pinvh = _pinvh def _log_multivariate_normal_density_diag(X, means=0.0, covars=1.0): """Compute Gaussian log-density at X for a diagonal model""" n_samples, n_dim = X.shape lpr = -0.5 * (n_dim * np.log(2 * np.pi) + np.sum(np.log(covars), 1) + np.sum((means ** 2) / covars, 1) - 2 * np.dot(X, (means / covars).T) + np.dot(X ** 2, (1.0 / covars).T)) return lpr def _log_multivariate_normal_density_spherical(X, means=0.0, covars=1.0): """Compute Gaussian log-density at X for a spherical model""" cv = covars.copy() if covars.ndim == 1: cv = cv[:, np.newaxis] if covars.shape[1] == 1: cv = np.tile(cv, (1, X.shape[-1])) return _log_multivariate_normal_density_diag(X, means, cv) def _log_multivariate_normal_density_tied(X, means, covars): """Compute Gaussian log-density at X for a tied model""" n_samples, n_dim = X.shape icv = pinvh(covars) lpr = -0.5 * (n_dim * np.log(2 * np.pi) + np.log(linalg.det(covars) + 0.1) + np.sum(X * np.dot(X, icv), 1)[:, np.newaxis] - 2 * np.dot(np.dot(X, icv), means.T) + np.sum(means * np.dot(means, icv), 1)) return lpr def _log_multivariate_normal_density_full(X, means, covars, min_covar=1.e-7): """Log probability for full covariance matrices. """ n_samples, n_dim = X.shape nmix = len(means) log_prob = np.empty((n_samples, nmix)) for c, (mu, cv) in enumerate(zip(means, covars)): try: cv_chol = linalg.cholesky(cv, lower=True) except linalg.LinAlgError: # The model is most probably stuck in a component with too # few observations, we need to reinitialize this components cv_chol = linalg.cholesky(cv + min_covar * np.eye(n_dim), lower=True) cv_log_det = 2 * np.sum(np.log(np.diagonal(cv_chol))) cv_sol = linalg.solve_triangular(cv_chol, (X - mu).T, lower=True).T log_prob[:, c] = - .5 * (np.sum(cv_sol ** 2, axis=1) + n_dim * np.log(2 * np.pi) + cv_log_det) return log_prob def _log_multivariate_normal_density(X, means, covars, covariance_type='diag'): """Compute the log probability under a multivariate Gaussian distribution. Parameters ---------- X : array_like, shape (n_samples, n_features) List of n_features-dimensional data points. Each row corresponds to a single data point. means : array_like, shape (n_components, n_features) List of n_features-dimensional mean vectors for n_components Gaussians. Each row corresponds to a single mean vector. covars : array_like List of n_components covariance parameters for each Gaussian. The shape depends on `covariance_type`: (n_components, n_features) if 'spherical', (n_features, n_features) if 'tied', (n_components, n_features) if 'diag', (n_components, n_features, n_features) if 'full' covariance_type : string Type of the covariance parameters. Must be one of 'spherical', 'tied', 'diag', 'full'. Defaults to 'diag'. Returns ------- lpr : array_like, shape (n_samples, n_components) Array containing the log probabilities of each data point in X under each of the n_components multivariate Gaussian distributions. """ log_multivariate_normal_density_dict = { 'spherical': _log_multivariate_normal_density_spherical, 'tied': _log_multivariate_normal_density_tied, 'diag': _log_multivariate_normal_density_diag, 'full': _log_multivariate_normal_density_full} return log_multivariate_normal_density_dict[covariance_type]( X, means, covars) try: from sklearn.mixture import log_multivariate_normal_density except ImportError: # New in 0.14 log_multivariate_normal_density = _log_multivariate_normal_density def _distribute_covar_matrix_to_match_covariance_type( tied_cv, covariance_type, n_components): """Create all the covariance matrices from a given template """ if covariance_type == 'spherical': cv = np.tile(tied_cv.mean() * np.ones(tied_cv.shape[1]), (n_components, 1)) elif covariance_type == 'tied': cv = tied_cv elif covariance_type == 'diag': cv = np.tile(np.diag(tied_cv), (n_components, 1)) elif covariance_type == 'full': cv = np.tile(tied_cv, (n_components, 1, 1)) else: raise ValueError("covariance_type must be one of " + "'spherical', 'tied', 'diag', 'full'") return cv try: from sklearn.mixture import _distribute_covar_matrix_to_match_covariance_type except ImportError: # New in 0.14 distribute_covar_matrix_to_match_covariance_type =\ _distribute_covar_matrix_to_match_covariance_type
emmaggie/hmmlearn
hmmlearn/utils/fixes.py
Python
bsd-3-clause
6,917
[ "Gaussian" ]
f90d527c8386cbb5458998411d0e2c1e84b5f17e13f57bdd12a66952441d7162
"""Mixture model for matrix completion""" from typing import Tuple import numpy as np from scipy.special import logsumexp from common import GaussianMixture from scipy.special import logsumexp from scipy.stats import multivariate_normal def log_pdf_multivariate_gauss(x, mu, cov): #assert(mu.shape[0] > mu.shape[1]), 'mu must be a row vector' #assert(x.shape[0] > x.shape[1]), 'x must be a row vector' #assert(cov.shape[0] == cov.shape[1]), 'covariance matrix must be square' #assert(mu.shape[0] == cov.shape[0]), 'cov_mat and mu_vec must have the same dimensions' #assert(mu.shape[0] == x.shape[0]), 'mu and x must have the same dimensions' logdet = (1/2)*len(mu)*np.log(cov) #invcov = 1/cov[0,0]*np.eye(len(mu)) # np.linalg.inv(cov)# cov/cov[0,0] xmu = x-mu part1 = np.log(1) - (len(mu)/2)*np.log(2* np.pi) - logdet #part2 = (-1/2) * xmu.T.dot(invcov).dot(xmu) part2 = (-1/2) * xmu.dot(xmu) / cov return part1 + part2 def pdf_multivariate_gauss(x, mu, cov): #assert(mu.shape[0] > mu.shape[1]), 'mu must be a row vector' #assert(x.shape[0] > x.shape[1]), 'x must be a row vector' assert(cov.shape[0] == cov.shape[1]), 'covariance matrix must be square' assert(mu.shape[0] == cov.shape[0]), 'cov_mat and mu_vec must have the same dimensions' assert(mu.shape[0] == x.shape[0]), 'mu and x must have the same dimensions' part1 = 1 / ( ((2* np.pi)**(len(mu)/2)) * (np.linalg.det(cov)**(1/2)) ) part2 = (-1/2) * ((x-mu).T.dot(np.linalg.inv(cov))).dot((x-mu)) return float(part1 * np.exp(part2)) def Gaussian(X, mu, var): return pdf_multivariate_gauss(X,mu,var) #return multivariate_normal.pdf(X, mean=mu, cov=np.eye(mu.shape[0])*var) # from multiprocessing.dummy import Pool as ThreadPool # pool = ThreadPool(8) def estep(X: np.ndarray, mixture: GaussianMixture) -> Tuple[np.ndarray, float]: """E-step: Softly assigns each datapoint to a gaussian component Args: X: (n, d) array holding the data, with incomplete entries (set to 0) mixture: the current gaussian mixture Returns: np.ndarray: (n, K) array holding the soft counts for all components for all examples float: log-likelihood of the assignment """ softcounts = np.zeros((X.shape[0], mixture.mu.shape[0])) nz = X != 0 cus = {} for n in range(X.shape[0]): cus[n] = X[n, nz[n]] nzcount = np.count_nonzero(X, axis=1) for k in range(mixture.mu.shape[0]): softcounts[:,k] += np.log(mixture.p[k] + 1e-16) for n in range(X.shape[0]): if(nzcount[n] != 0): idx = nz[n] row = cus[n] rowmu = mixture.mu[k, idx] #rowvar = mixture.var[k]*np.eye(row.shape[0]) rowvar = mixture.var[k] l = log_pdf_multivariate_gauss(row, rowmu, rowvar) softcounts[n,k] += l denominator = logsumexp(softcounts, axis=1) log_likelihood = np.sum(denominator) denominator = denominator.repeat(mixture.mu.shape[0]).reshape((X.shape[0], mixture.mu.shape[0])) post = np.exp(softcounts-denominator) return (post, log_likelihood) def mstep(X: np.ndarray, post: np.ndarray, mixture: GaussianMixture, min_variance: float = .25) -> GaussianMixture: """M-step: Updates the gaussian mixture by maximizing the log-likelihood of the weighted dataset Args: X: (n, d) array holding the data, with incomplete entries (set to 0) post: (n, K) array holding the soft counts for all components for all examples mixture: the current gaussian mixture min_variance: the minimum variance for each gaussian Returns: GaussianMixture: the new gaussian mixture """ new_mus = np.zeros((post.shape[1], X.shape[1])) new_mus_d = np.zeros((post.shape[1], X.shape[1])) new_vars = np.zeros((post.shape[1], )) new_ps = np.zeros((post.shape[1], )) nz = X != 0 zero_one_by_l = np.where(X != 0, 1, 0) for k in range(post.shape[1]): new_vars[k] = 0 post_all_k = post[:,k] for l in range(X.shape[1]): prob_cu = post_all_k * zero_one_by_l[:,l] new_mus_d[k,l] += np.sum(prob_cu) if (new_mus_d[k,l] >= 1): x_all_l = X[:,l] new_mus[k,l] = np.sum(prob_cu * x_all_l) / new_mus_d[k,l] else: new_mus[k,l] = mixture.mu[k,l] denominator = 0 new_vars[k] = 0 for u in range(X.shape[0]): denominator += np.count_nonzero(X[u,:]) * post[u,k] w = zero_one_by_l[u,:] #np.where(X[u,:] != 0, 1, 0) new_vars[k] += np.sum(post[u,k] * w * (X[u,:] - new_mus[k,:])**2) new_vars[k] /= denominator if(new_vars[k] < 0.25): new_vars[k] = 0.25 new_ps[k] += np.sum(post_all_k) / X.shape[0] return GaussianMixture(new_mus, new_vars, new_ps) def run(X: np.ndarray, mixture: GaussianMixture, post: np.ndarray) -> Tuple[GaussianMixture, np.ndarray, float]: """Runs the mixture model Args: X: (n, d) array holding the data post: (n, K) array holding the soft counts for all components for all examples Returns: GaussianMixture: the new gaussian mixture np.ndarray: (n, K) array holding the soft counts for all components for all examples float: log-likelihood of the current assignment """ #print(mixture) old_log_likelihood = None max_steps = 1000 converged = False while((not converged) and (max_steps > 0)): print('e', end='', flush=True) post, new_log_likelihood = estep(X, mixture) print('m', end='', flush=True) mixture = mstep(X, post, mixture) if(old_log_likelihood == None): old_log_likelihood = new_log_likelihood else: diff = new_log_likelihood - old_log_likelihood margin = 1e-6 * np.abs(new_log_likelihood) #print(diff, margin) if(diff <= margin): converged = True old_log_likelihood = new_log_likelihood max_steps -= 1 return mixture, post, old_log_likelihood def fill_matrix(X: np.ndarray, mixture: GaussianMixture) -> np.ndarray: """Fills an incomplete matrix according to a mixture model Args: X: (n, d) array of incomplete data (incomplete entries =0) mixture: a mixture of gaussians Returns np.ndarray: a (n, d) array with completed data """ softcounts = np.zeros((X.shape[0], mixture.mu.shape[0])) nz = X != 0 cus = {} for n in range(X.shape[0]): cus[n] = X[n, nz[n]] nzcount = np.count_nonzero(X, axis=1) for k in range(mixture.mu.shape[0]): softcounts[:,k] += np.log(mixture.p[k] + 1e-16) for n in range(X.shape[0]): if(nzcount[n] != 0): idx = nz[n] row = cus[n] rowmu = mixture.mu[k, idx] #rowvar = mixture.var[k]*np.eye(row.shape[0]) rowvar = mixture.var[k] l = log_pdf_multivariate_gauss(row, rowmu, rowvar) softcounts[n,k] += l denominator = logsumexp(softcounts, axis=1) denominator = denominator.repeat(mixture.mu.shape[0]).reshape((X.shape[0], mixture.mu.shape[0])) post = np.exp(softcounts-denominator) Xstar = np.copy(X) for u in range(X.shape[0]): for l in range(X.shape[1]): if(X[u,l] == 0): Xstar[u,l] = np.sum(post[u,:] * mixture.mu[:,l]) return Xstar
xunilrj/sandbox
courses/MITx/MITx 6.86x Machine Learning with Python-From Linear Models to Deep Learning/project4/netflix/em.py
Python
apache-2.0
7,765
[ "Gaussian" ]
2b8c5bfbf5b94357dfd1f1c4d2936500a44405c2933fb6293fd729be7415dbe1
#!/usr/bin/python # # Copyright 2012 Google Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Performs client tasks for testing IMAP OAuth2 authentication. To use this script, you'll need to have registered with Google as an OAuth application and obtained an OAuth client ID and client secret. See http://code.google.com/apis/accounts/docs/OAuth2.html for instructions on registering and for documentation of the APIs invoked by this code. This script has 3 modes of operation. 1. The first mode is used to generate and authorize an OAuth2 token, the first step in logging in via OAuth2. oauth2 --user=xxx@gmail.com \ --client_id=1038[...].apps.googleusercontent.com \ --client_secret=VWFn8LIKAMC-MsjBMhJeOplZ \ --generate_oauth2_token The script will converse with Google and generate an oauth request token, then present you with a URL you should visit in your browser to authorize the token. Once you get the verification code from the Google website, enter it into the script to get your OAuth access token. The output from this command will contain the access token, a refresh token, and some metadata about the tokens. The access token can be used until it expires, and the refresh token lasts indefinitely, so you should record these values for reuse. 2. The script will generate new access tokens using a refresh token. oauth2 --user=xxx@gmail.com \ --client_id=1038[...].apps.googleusercontent.com \ --client_secret=VWFn8LIKAMC-MsjBMhJeOplZ \ --refresh_token=1/Yzm6MRy4q1xi7Dx2DuWXNgT6s37OrP_DW_IoyTum4YA 3. The script will generate an OAuth2 string that can be fed directly to IMAP or SMTP. This is triggered with the --generate_oauth2_string option. oauth2 --generate_oauth2_string --user=xxx@gmail.com \ --access_token=ya29.AGy[...]ezLg The output of this mode will be a base64-encoded string. To use it, connect to a IMAPFE and pass it as the second argument to the AUTHENTICATE command. a AUTHENTICATE XOAUTH2 a9sha9sfs[...]9dfja929dk== """ import base64 import imaplib import json from optparse import OptionParser import smtplib import sys import urllib def SetupOptionParser(): # Usage message is the module's docstring. parser = OptionParser(usage=__doc__) parser.add_option('--generate_oauth2_token', action='store_true', dest='generate_oauth2_token', help='generates an OAuth2 token for testing') parser.add_option('--generate_oauth2_string', action='store_true', dest='generate_oauth2_string', help='generates an initial client response string for ' 'OAuth2') parser.add_option('--client_id', default=None, help='Client ID of the application that is authenticating. ' 'See OAuth2 documentation for details.') parser.add_option('--client_secret', default=None, help='Client secret of the application that is ' 'authenticating. See OAuth2 documentation for ' 'details.') parser.add_option('--access_token', default=None, help='OAuth2 access token') parser.add_option('--refresh_token', default=None, help='OAuth2 refresh token') parser.add_option('--scope', default='https://mail.google.com/', help='scope for the access token. Multiple scopes can be ' 'listed separated by spaces with the whole argument ' 'quoted.') parser.add_option('--test_imap_authentication', action='store_true', dest='test_imap_authentication', help='attempts to authenticate to IMAP') parser.add_option('--test_smtp_authentication', action='store_true', dest='test_smtp_authentication', help='attempts to authenticate to SMTP') parser.add_option('--user', default=None, help='email address of user whose account is being ' 'accessed') return parser # The URL root for accessing Google Accounts. GOOGLE_ACCOUNTS_BASE_URL = 'https://accounts.google.com' # Hardcoded dummy redirect URI for non-web apps. REDIRECT_URI = 'REDIRECTURI FOR YOUR APP' def AccountsUrl(command): """Generates the Google Accounts URL. Args: command: The command to execute. Returns: A URL for the given command. """ return '%s/%s' % (GOOGLE_ACCOUNTS_BASE_URL, command) def UrlEscape(text): # See OAUTH 5.1 for a definition of which characters need to be escaped. return urllib.quote(text, safe='~-._') def UrlUnescape(text): # See OAUTH 5.1 for a definition of which characters need to be escaped. return urllib.unquote(text) def FormatUrlParams(params): """Formats parameters into a URL query string. Args: params: A key-value map. Returns: A URL query string version of the given parameters. """ param_fragments = [] for param in sorted(params.iteritems(), key=lambda x: x[0]): param_fragments.append('%s=%s' % (param[0], UrlEscape(param[1]))) return '&'.join(param_fragments) def GeneratePermissionUrl(client_id,useremail, scope='https://mail.google.com/ https://www.googleapis.com/auth/userinfo.profile https://www.googleapis.com/auth/userinfo.email'): """Generates the URL for authorizing access. This uses the "OAuth2 for Installed Applications" flow described at https://developers.google.com/accounts/docs/OAuth2InstalledApp Args: client_id: Client ID obtained by registering your app. scope: scope for access token, e.g. 'https://mail.google.com' Returns: A URL that the user should visit in their browser. """ params = {} params['client_id'] = client_id params['redirect_uri'] = REDIRECT_URI params['scope'] = scope params['state'] = useremail params['response_type'] = 'code' return '%s?%s' % (AccountsUrl('o/oauth2/auth'), FormatUrlParams(params)) def AuthorizeTokens(client_id, client_secret, authorization_code): """Obtains OAuth access token and refresh token. This uses the application portion of the "OAuth2 for Installed Applications" flow at https://developers.google.com/accounts/docs/OAuth2InstalledApp#handlingtheresponse Args: client_id: Client ID obtained by registering your app. client_secret: Client secret obtained by registering your app. authorization_code: code generated by Google Accounts after user grants permission. Returns: The decoded response from the Google Accounts server, as a dict. Expected fields include 'access_token', 'expires_in', and 'refresh_token'. """ params = {} params['client_id'] = client_id params['client_secret'] = client_secret params['code'] = authorization_code params['redirect_uri'] = REDIRECT_URI params['grant_type'] = 'authorization_code' request_url = AccountsUrl('o/oauth2/token') response = urllib.urlopen(request_url, urllib.urlencode(params)).read() return json.loads(response) def RefreshToken(client_id, client_secret, refresh_token): """Obtains a new token given a refresh token. See https://developers.google.com/accounts/docs/OAuth2InstalledApp#refresh Args: client_id: Client ID obtained by registering your app. client_secret: Client secret obtained by registering your app. refresh_token: A previously-obtained refresh token. Returns: The decoded response from the Google Accounts server, as a dict. Expected fields include 'access_token', 'expires_in', and 'refresh_token'. """ params = {} params['client_id'] = client_id params['client_secret'] = client_secret params['refresh_token'] = refresh_token params['grant_type'] = 'refresh_token' request_url = AccountsUrl('o/oauth2/token') response = urllib.urlopen(request_url, urllib.urlencode(params)).read() return json.loads(response) def GenerateOAuth2String(username, access_token, base64_encode=True): """Generates an IMAP OAuth2 authentication string. See https://developers.google.com/google-apps/gmail/oauth2_overview Args: username: the username (email address) of the account to authenticate access_token: An OAuth2 access token. base64_encode: Whether to base64-encode the output. Returns: The SASL argument for the OAuth2 mechanism. """ auth_string = 'user=%s\1auth=Bearer %s\1\1' % (username, access_token) if base64_encode: auth_string = base64.b64encode(auth_string) return auth_string def TestImapAuthentication(user, auth_string): """Authenticates to IMAP with the given auth_string. Prints a debug trace of the attempted IMAP connection. Args: user: The Gmail username (full email address) auth_string: A valid OAuth2 string, as returned by GenerateOAuth2String. Must not be base64-encoded, since imaplib does its own base64-encoding. """ print imap_conn = imaplib.IMAP4_SSL('imap.gmail.com') imap_conn.debug = 4 imap_conn.authenticate('XOAUTH2', lambda x: auth_string) imap_conn.select('INBOX') def TestSmtpAuthentication(user, auth_string): """Authenticates to SMTP with the given auth_string. Args: user: The Gmail username (full email address) auth_string: A valid OAuth2 string, not base64-encoded, as returned by GenerateOAuth2String. """ print smtp_conn = smtplib.SMTP('smtp.gmail.com', 587) smtp_conn.set_debuglevel(True) smtp_conn.ehlo('test') smtp_conn.starttls() smtp_conn.docmd('AUTH', 'XOAUTH2 ' + base64.b64encode(auth_string)) def RequireOptions(options, *args): missing = [arg for arg in args if getattr(options, arg) is None] if missing: print 'Missing options: %s' % ' '.join(missing) sys.exit(-1) def main(argv): options_parser = SetupOptionParser() (options, args) = options_parser.parse_args() if options.refresh_token: RequireOptions(options, 'client_id', 'client_secret') response = RefreshToken(options.client_id, options.client_secret, options.refresh_token) print 'Access Token: %s' % response['access_token'] print 'Access Token Expiration Seconds: %s' % response['expires_in'] elif options.generate_oauth2_string: RequireOptions(options, 'user', 'access_token') print ('OAuth2 argument:\n' + GenerateOAuth2String(options.user, options.access_token)) elif options.generate_oauth2_token: RequireOptions(options, 'client_id', 'client_secret') print 'To authorize token, visit this url and follow the directions:' print ' %s' % GeneratePermissionUrl(options.client_id, options.scope) authorization_code = raw_input('Enter verification code: ') response = AuthorizeTokens(options.client_id, options.client_secret, authorization_code) print 'Refresh Token: %s' % response['refresh_token'] print 'Access Token: %s' % response['access_token'] print 'Access Token Expiration Seconds: %s' % response['expires_in'] elif options.test_imap_authentication: RequireOptions(options, 'user', 'access_token') TestImapAuthentication(options.user, GenerateOAuth2String(options.user, options.access_token, base64_encode=False)) elif options.test_smtp_authentication: RequireOptions(options, 'user', 'access_token') TestSmtpAuthentication(options.user, GenerateOAuth2String(options.user, options.access_token, base64_encode=False)) else: options_parser.print_help() print 'Nothing to do, exiting.' return
codeanu/flask-login-oauth2
modules/oauth2.py
Python
bsd-3-clause
12,286
[ "VisIt" ]
43abe0d819291ec4948b377aca4cdbc5ed67d6769de97640f6af86f2386afee7
############################################################################## # Copyright (c) 2013-2017, Lawrence Livermore National Security, LLC. # Produced at the Lawrence Livermore National Laboratory. # # This file is part of Spack. # Created by Todd Gamblin, tgamblin@llnl.gov, All rights reserved. # LLNL-CODE-647188 # # For details, see https://github.com/spack/spack # Please also see the NOTICE and LICENSE files for our notice and the LGPL. # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU Lesser General Public License (as # published by the Free Software Foundation) version 2.1, February 1999. # # This program is distributed in the hope that it will be useful, but # WITHOUT ANY WARRANTY; without even the IMPLIED WARRANTY OF # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the terms and # conditions of the GNU Lesser General Public License for more details. # # You should have received a copy of the GNU Lesser General Public # License along with this program; if not, write to the Free Software # Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA ############################################################################## from spack import * class Gromacs(CMakePackage): """GROMACS (GROningen MAchine for Chemical Simulations) is a molecular dynamics package primarily designed for simulations of proteins, lipids and nucleic acids. It was originally developed in the Biophysical Chemistry department of University of Groningen, and is now maintained by contributors in universities and research centers across the world. GROMACS is one of the fastest and most popular software packages available and can run on CPUs as well as GPUs. It is free, open source released under the GNU General Public License. Starting from version 4.6, GROMACS is released under the GNU Lesser General Public License. """ homepage = 'http://www.gromacs.org' url = 'http://ftp.gromacs.org/gromacs/gromacs-5.1.2.tar.gz' version('2016.4', '19c8b5c85f3ec62df79d2249a3c272f8') version('2016.3', 'e9e3a41bd123b52fbcc6b32d09f8202b') version('5.1.4', 'ba2e34d59b3982603b4935d650c08040') version('5.1.2', '614d0be372f1a6f1f36382b7a6fcab98') version('develop', git='https://github.com/gromacs/gromacs', branch='master') variant('mpi', default=True, description='Activate MPI support') variant('shared', default=True, description='Enables the build of shared libraries') variant( 'double', default=False, description='Produces a double precision version of the executables') variant('plumed', default=False, description='Enable PLUMED support') variant('cuda', default=False, description='Enable CUDA support') variant('build_type', default='RelWithDebInfo', description='The build type to build', values=('Debug', 'Release', 'RelWithDebInfo', 'MinSizeRel', 'Reference', 'RelWithAssert', 'Profile')) depends_on('mpi', when='+mpi') depends_on('plumed+mpi', when='+plumed+mpi') depends_on('plumed~mpi', when='+plumed~mpi') depends_on('fftw') depends_on('cmake@2.8.8:', type='build') depends_on('cuda', when='+cuda') def patch(self): if '+plumed' in self.spec: self.spec['plumed'].package.apply_patch(self) def cmake_args(self): options = [] if '+mpi' in self.spec: options.append('-DGMX_MPI:BOOL=ON') if '+double' in self.spec: options.append('-DGMX_DOUBLE:BOOL=ON') if '~shared' in self.spec: options.append('-DBUILD_SHARED_LIBS:BOOL=OFF') if '+cuda' in self.spec: options.append('-DGMX_GPU:BOOL=ON') options.append('-DCUDA_TOOLKIT_ROOT_DIR:STRING=' + self.spec['cuda'].prefix) return options
skosukhin/spack
var/spack/repos/builtin/packages/gromacs/package.py
Python
lgpl-2.1
3,939
[ "Gromacs" ]
f928db7daea4b4478b8089c14e17980fc1d38d8c1f207ac61757fcd5b271b103
# coding: utf-8 # Copyright (c) Materials Virtual Lab # Distributed under the terms of the BSD License. from __future__ import division, print_function, unicode_literals, \ absolute_import import numpy as np import pandas as pd from pymatgen import Element from veidt.potential.abstract import Potential from veidt.potential.processing import pool_from, convert_docs from veidt.describer.atomic_describer import BispectrumCoefficients from veidt.potential.lammps.calcs import EnergyForceStress class SNAPotential(Potential): """ This class implements Spectral Neighbor Analysis Potential. """ pair_style = 'pair_style snap' pair_coeff = 'pair_coeff * * {coeff_file} {elements} {param_file} {specie}' def __init__(self, model, name=None): """ Initialize the SNAPotential Potential with atomic describer and model, which are used to generate the Bispectrum coefficients features for structures and to train the parameters. Args: model (Model): Model to perform supervised learning with atomic descriptos as features and properties as targets. name (str): Name of force field. """ self.name = name if name else 'SNAPotential' self.model = model self.specie = None def train(self, train_structures, energies, forces, stresses=None, **kwargs): """ Training data with model. Args: train_structures ([Structure]): The list of Pymatgen Structure object. energies ([float]): The list of total energies of each structure in structures list. energies ([float]): List of total energies of each structure in structures list. forces ([np.array]): List of (m, 3) forces array of each structure with m atoms in structures list. m can be varied with each single structure case. stresses (list): List of (6, ) virial stresses of each structure in structures list. """ train_pool = pool_from(train_structures, energies, forces, stresses) _, df = convert_docs(train_pool) ytrain = df['y_orig'] / df['n'] self.model.fit(inputs=train_structures, outputs=ytrain, **kwargs) self.specie = Element(train_structures[0].symbol_set[0]) def evaluate(self, test_structures, ref_energies, ref_forces, ref_stresses): """ Evaluate energies, forces and stresses of structures with trained interatomic potential. Args: test_structures ([Structure]): List of Pymatgen Structure Objects. ref_energies ([float]): List of DFT-calculated total energies of each structure in structures list. ref_forces ([np.array]): List of DFT-calculated (m, 3) forces of each structure with m atoms in structures list. m can be varied with each single structure case. ref_stresses (list): List of DFT-calculated (6, ) viriral stresses of each structure in structures list. """ predict_pool = pool_from(test_structures, ref_energies, ref_forces, ref_stresses) _, df_orig = convert_docs(predict_pool) _, df_predict = convert_docs(pool_from(test_structures)) outputs = self.model.predict(inputs=test_structures, override=True) df_predict['y_orig'] = df_predict['n'] * outputs return df_orig, df_predict def predict(self, structure): """ Predict energy, forces and stresses of the structure. Args: structure (Structure): Pymatgen Structure object. Returns: energy, forces, stress """ # outputs = self.model.predict([structure]) # energy = outputs[0] # forces = outputs[1:].reshape(len(structure), 3) calculator = EnergyForceStress(ff_settings=self) energy, forces, stress = calculator.calculate(structures=[structure])[0] return energy, forces, stress def write_param(self): """ Write parameter and coefficient file to perform lammps calculation. """ if not self.specie: raise ValueError("No specie given!") param_file = '{}.snapparam'.format(self.name) coeff_file = '{}.snapcoeff'.format(self.name) model = self.model # ncoeff = len(model.coef) describer = self.model.describer profile = describer.element_profile elements = [element.symbol for element in sorted([Element(e) for e in profile.keys()])] ne = len(elements) nbc = len(describer.subscripts) if describer.quadratic: nbc += int((1 + nbc) * nbc / 2) tjm = describer.twojmax diag = describer.diagonalstyle # assert ncoeff == ne * (nbc + 1),\ # '{} coefficients given. '.format(ncoeff) + \ # '{} ({} * ({} + 1)) '.format(ne * (nbc + 1), ne, nbc) + \ # 'coefficients expected ' + \ # 'for twojmax={} and diagonalstyle={}.'.format(tjm, diag) coeff_lines = [] coeff_lines.append('{} {}'.format(ne, nbc + 1)) for element, coeff in zip(elements, np.split(model.coef, ne)): coeff_lines.append('{} {} {}'.format(element, profile[element]['r'], profile[element]['w'])) coeff_lines.extend([str(c) for c in coeff]) with open(coeff_file, 'w') as f: f.write('\n'.join(coeff_lines)) param_lines = [] keys = ['rcutfac', 'twojmax', 'rfac0', 'rmin0', 'diagonalstyle'] param_lines.extend(['{} {}'.format(k, getattr(describer, k)) for k in keys]) param_lines.append('quadraticflag {}'.format(int(describer.quadratic))) param_lines.append('bzeroflag 0') with open(param_file, 'w') as f: f.write('\n'.join(param_lines)) pair_coeff = self.pair_coeff.format(elements=' '.join(elements), specie=self.specie.name, coeff_file=coeff_file, param_file=param_file) ff_settings = [self.pair_style, pair_coeff] return ff_settings def save(self, filename): """ Save parameters of the potential. Args: filename (str): The file to store parameters of potential. Returns: (str) """ self.model.save(filename=filename) return filename
czhengsci/veidt
veidt/potential/snap.py
Python
bsd-3-clause
6,745
[ "LAMMPS", "pymatgen" ]
7cc01bdcce2cbd34d6c7a28c05e2ea96940241cc42adaa356fae03be7caf0ffd
# -*- coding: utf-8 -*- from __future__ import absolute_import import numpy as np from roppy.sample import sample2D, sample2DU, sample2DV from roppy.depth import sdepth class Section(object): """Class for handling sections in a ROMS grid The section is defined by a sequence of nodes, supposedly quite close The endpoints of the section are nodes The grid information is defined by a grid object having attributes h, pm, pn, hc, Cs_r, Cs_w, Vtransform with the ROMS variables of the same netCDF names Defined by sequences of grid coordinates of section nodes """ def __init__(self, grid, X, Y): self.grid = grid # Vertices, in subgrid coordinates self.X = X self.Y = Y # Section size self.L = len(self.X) # Number of nodes self.N = len(self.grid.Cs_r) # Topography self.h = sample2D( self.grid.h, self.X, self.Y, mask=self.grid.mask_rho, undef_value=1.0 ) # Metric pm = sample2D(self.grid.pm, self.X, self.Y) pn = sample2D(self.grid.pn, self.X, self.Y) dX = 2 * (X[1:] - X[:-1]) / (pm[:-1] + pm[1:]) # unit = meter dY = 2 * (Y[1:] - Y[:-1]) / (pn[:-1] + pn[1:]) # Assume spacing is close enough to approximate distance self.dS = np.sqrt(dX * dX + dY * dY) # Cumulative distance self.S = np.concatenate(([0], np.add.accumulate(self.dS))) # Weights for trapez integration (linear interpolation) self.W = 0.5 * np.concatenate( ([self.dS[0]], self.dS[:-1] + self.dS[1:], [self.dS[-1]]) ) # nx, ny = dY, -dX # norm = np.sqrt(nx*nx + ny*ny) # self.nx, self.ny = nx/norm, ny/norm # Vertical structure self.z_r = sdepth( self.h, self.grid.hc, self.grid.Cs_r, stagger="rho", Vtransform=self.grid.Vtransform, ) self.z_w = sdepth( self.h, self.grid.hc, self.grid.Cs_w, stagger="w", Vtransform=self.grid.Vtransform, ) self.dZ = self.z_w[1:, :] - self.z_w[:-1, :] self.Area = self.dZ * self.W def __len__(self): return self.L def sample2D(self, F): """Sample a horizontal field at rho poins with shape (Mp, Lp)""" return sample2D(F, self.X, self.Y, mask=self.grid.mask_rho) def sample3D(self, F): """Sample a 3D field in rho-points with shape (N,Mp,Lp)""" # Not masked ?? Fsec = np.zeros((self.N, self.L)) for k in range(self.N): Fsec[k, :] = sample2D(F[k, :, :], self.X, self.Y, mask=self.grid.mask_rho) return Fsec def linear_section(i0, i1, j0, j1, grd): """Make a linear section between rho-points Makes a section similar to romstools' tools.transect Returns a section object """ if abs(i1 - i0) >= abs(j0 - j1): # Work horizontally if i0 < i1: X = np.arange(i0, i1 + 1) elif i0 > i1: X = np.arange(i0, i1 - 1, -1) else: # i0 = i1 and j0 = j1 raise ValueError("Section reduced to a point") slope = float(j1 - j0) / (i1 - i0) Y = j0 + slope * (X - i0) else: # Work vertically if j0 < j1: Y = np.arange(j0, j1 + 1) else: Y = np.arange(j0, j1 - 1, -1) slope = float(i1 - i0) / (j1 - j0) X = i0 + slope * (Y - j0) return Section(grd, X, Y)
bjornaa/roppy
roppy/section.py
Python
mit
3,550
[ "NetCDF" ]
ecf80360922e32b32b41c6388c2b0eada571ec1885136faf56fca7fd158538c9
#!/usr/bin/env python # -*- coding: utf-8 -*- import vtk def main(): colors = vtk.vtkNamedColors() lineColor = colors.GetColor3d("peacock") modelColor = colors.GetColor3d("silver") backgroundColor = colors.GetColor3d("wheat") modelSource = vtk.vtkSphereSource() plane = vtk.vtkPlane() cutter = vtk.vtkCutter() cutter.SetInputConnection(modelSource.GetOutputPort()) cutter.SetCutFunction(plane) cutter.GenerateValues(10, -.5, .5) modelMapper = vtk.vtkPolyDataMapper() modelMapper.SetInputConnection(modelSource.GetOutputPort()) model = vtk.vtkActor() model.SetMapper(modelMapper) model.GetProperty().SetDiffuseColor(modelColor) model.GetProperty().SetInterpolationToFlat() stripper = vtk.vtkStripper() stripper.SetInputConnection(cutter.GetOutputPort()) stripper.JoinContiguousSegmentsOn() linesMapper = vtk.vtkPolyDataMapper() linesMapper.SetInputConnection(stripper.GetOutputPort()) lines = vtk.vtkActor() lines.SetMapper(linesMapper) lines.GetProperty().SetDiffuseColor(lineColor) lines.GetProperty().SetLineWidth(3.) renderer = vtk.vtkRenderer() renderWindow = vtk.vtkRenderWindow() renderWindow.AddRenderer(renderer) renderWindow.SetSize(640, 480) interactor = vtk.vtkRenderWindowInteractor() interactor.SetRenderWindow(renderWindow) # Add the actors to the renderer. renderer.AddActor(model) renderer.AddActor(lines) renderer.SetBackground(backgroundColor) # This starts the event loop and as a side effect causes an # initial render. renderWindow.Render() interactor.Start() # Extract the lines from the polydata. numberOfLines = cutter.GetOutput().GetNumberOfLines() print("-----------Lines without using vtkStripper") print("There are {0} lines in the polydata".format(numberOfLines)) numberOfLines = stripper.GetOutput().GetNumberOfLines() points = stripper.GetOutput().GetPoints() cells = stripper.GetOutput().GetLines() cells.InitTraversal() print("-----------Lines using vtkStripper") print("There are {0} lines in the polydata".format(numberOfLines)) indices = vtk.vtkIdList() lineCount = 0 while cells.GetNextCell(indices): print("Line {0}:".format(lineCount)) for i in range(indices.GetNumberOfIds()): point = points.GetPoint(indices.GetId(i)) print("\t({0:0.6f} ,{1:0.6f}, {2:0.6f})".format(point[0], point[1], point[2])) lineCount += 1 if __name__ == "__main__": main()
lorensen/VTKExamples
src/Python/PolyData/ExtractPolyLinesFromPolyData.py
Python
apache-2.0
2,569
[ "VTK" ]
2f92fe1e6681bce8e89d6f6eaea68f786ad6be6c26bb2bf07a07151338c49fef
# # Copyright (c) 2009-2015, Jack Poulson # All rights reserved. # # This file is part of Elemental and is under the BSD 2-Clause License, # which can be found in the LICENSE file in the root directory, or at # http://opensource.org/licenses/BSD-2-Clause # import El n0 = 25 n1 = 25 numLambdas = 3 startLambda = 0 endLambda = 1 display = False worldRank = El.mpi.WorldRank() worldSize = El.mpi.WorldSize() # Place two 2D finite-difference matrices next to each other # and make the last column dense def ConcatFD2D(N0,N1): A = El.DistSparseMatrix() height = N0*N1 width = 2*N0*N1 A.Resize(height,width) localHeight = A.LocalHeight() A.Reserve(11*localHeight) for sLoc in xrange(localHeight): s = A.GlobalRow(sLoc) x0 = s % N0 x1 = s / N0 sRel = s + N0*N1 A.QueueLocalUpdate( sLoc, s, 11 ) A.QueueLocalUpdate( sLoc, sRel, -20 ) if x0 > 0: A.QueueLocalUpdate( sLoc, s-1, -1 ) A.QueueLocalUpdate( sLoc, sRel-1, -17 ) if x0+1 < N0: A.QueueLocalUpdate( sLoc, s+1, 2 ) A.QueueLocalUpdate( sLoc, sRel+1, -20 ) if x1 > 0: A.QueueLocalUpdate( sLoc, s-N0, -30 ) A.QueueLocalUpdate( sLoc, sRel-N0, -3 ) if x1+1 < N1: A.QueueLocalUpdate( sLoc, s+N0, 4 ) A.QueueLocalUpdate( sLoc, sRel+N0, 3 ) # The dense last column A.QueueLocalUpdate( sLoc, width-1, -10/height ); A.ProcessQueues() return A A = ConcatFD2D(n0,n1) b = El.DistMultiVec() El.Gaussian( b, n0*n1, 1 ) if display: El.Display( A, "A" ) El.Display( A[0:n0*n1,0:n0*n1], "AL" ) El.Display( A[0:n0*n1,n0*n1:2*n0*n1], "AR" ) El.Display( b, "b" ) ctrl = El.BPDNCtrl_d() ctrl.ipmCtrl.mehrotraCtrl.time = True ctrl.ipmCtrl.mehrotraCtrl.progress = True ctrl.ipmCtrl.mehrotraCtrl.solveCtrl.progress = True for j in xrange(0,numLambdas): lambd = startLambda + j*(endLambda-startLambda)/(numLambdas-1.) if worldRank == 0: print "lambda =", lambd startBPDN = El.mpi.Time() x = El.BPDN( A, b, lambd, ctrl ) endBPDN = El.mpi.Time() if worldRank == 0: print "BPDN time:", endBPDN-startBPDN, "seconds" if display: El.Display( x, "x" ) xOneNorm = El.EntrywiseNorm( x, 1 ) e = El.DistMultiVec() El.Copy( b, e ) El.Multiply( El.NORMAL, -1., A, x, 1., e ) if display: El.Display( e, "e" ) eTwoNorm = El.Nrm2( e ) if worldRank == 0: print "|| x ||_1 =", xOneNorm print "|| A x - b ||_2 =", eTwoNorm # Require the user to press a button before the figures are closed El.Finalize() if worldSize == 1: raw_input('Press Enter to exit')
mcopik/Elemental
examples/interface/BPDN.py
Python
bsd-3-clause
2,579
[ "Gaussian" ]
b14bbe0ef1cf43282d256a5879f581554aa2a7fed7ba37cc6d01462b2472edac
# -*- coding: utf-8 -*- from __future__ import absolute_import import random from .node import Input, Output, Neuron class Network(dict): ''' A network composed of input, neuron, and output nodes. It can be modeled as a unidirectional directed graph with edge weights. ''' def __init__(self): ''' Create an empty network. ''' super(Network, self).__init__() self.weights = {} @property def inputs(self): ''' Network input nodes. ''' return dict((k, self[k]) for k in self if isinstance(self[k], Input)) @property def outputs(self): ''' Network output nodes. ''' return dict((k, self[k]) for k in self if isinstance(self[k], Output)) @property def neurons(self): ''' Network neuron nodes. ''' return dict((k, self[k]) for k in self if isinstance(self[k], Neuron)) def connect(self, source, target, weight=None): ''' Connect two nodes. ''' weight = weight or random.uniform(-1.0, 1.0) self.weights[(source, target)] = weight def get_inputs(self, node): ''' Get input connections for the given node. ''' if node not in self.keys(): # XXX error? return [] return sorted( [k for k in self.weights if k[1] == node], key=lambda k: k[0]) def get_outputs(self, node): ''' Get output connections for the given node. ''' if node not in self.keys(): # XXX error? return [] return sorted( [k for k in self.weights if k[0] == node], key=lambda k: k[1])
CtrlC-Root/cse5526
spark/network.py
Python
mit
1,768
[ "NEURON" ]
5224f60d62ce73de4fde9bf70486dfa7ac2df643d11f5b91627ce5621bd6d426
# # Author: Travis Oliphant 2002-2011 with contributions from # SciPy Developers 2004-2011 # from scipy._lib._util import getfullargspec_no_self as _getfullargspec import sys import keyword import re import types import warnings import inspect from itertools import zip_longest from collections import namedtuple from scipy._lib import doccer from scipy._lib._util import _lazywhere from ._distr_params import distcont, distdiscrete from scipy._lib._util import check_random_state from scipy.special import (comb, chndtr, entr, xlogy, ive) # for root finding for continuous distribution ppf, and max likelihood # estimation from scipy import optimize # for functions of continuous distributions (e.g. moments, entropy, cdf) from scipy import integrate # to approximate the pdf of a continuous distribution given its cdf from scipy.misc import derivative # for scipy.stats.entropy. Attempts to import just that function or file # have cause import problems from scipy import stats from numpy import (arange, putmask, ravel, ones, shape, ndarray, zeros, floor, logical_and, log, sqrt, place, argmax, vectorize, asarray, nan, inf, isinf, NINF, empty) import numpy as np from ._constants import _XMAX # These are the docstring parts used for substitution in specific # distribution docstrings docheaders = {'methods': """\nMethods\n-------\n""", 'notes': """\nNotes\n-----\n""", 'examples': """\nExamples\n--------\n"""} _doc_rvs = """\ rvs(%(shapes)s, loc=0, scale=1, size=1, random_state=None) Random variates. """ _doc_pdf = """\ pdf(x, %(shapes)s, loc=0, scale=1) Probability density function. """ _doc_logpdf = """\ logpdf(x, %(shapes)s, loc=0, scale=1) Log of the probability density function. """ _doc_pmf = """\ pmf(k, %(shapes)s, loc=0, scale=1) Probability mass function. """ _doc_logpmf = """\ logpmf(k, %(shapes)s, loc=0, scale=1) Log of the probability mass function. """ _doc_cdf = """\ cdf(x, %(shapes)s, loc=0, scale=1) Cumulative distribution function. """ _doc_logcdf = """\ logcdf(x, %(shapes)s, loc=0, scale=1) Log of the cumulative distribution function. """ _doc_sf = """\ sf(x, %(shapes)s, loc=0, scale=1) Survival function (also defined as ``1 - cdf``, but `sf` is sometimes more accurate). """ _doc_logsf = """\ logsf(x, %(shapes)s, loc=0, scale=1) Log of the survival function. """ _doc_ppf = """\ ppf(q, %(shapes)s, loc=0, scale=1) Percent point function (inverse of ``cdf`` --- percentiles). """ _doc_isf = """\ isf(q, %(shapes)s, loc=0, scale=1) Inverse survival function (inverse of ``sf``). """ _doc_moment = """\ moment(order, %(shapes)s, loc=0, scale=1) Non-central moment of the specified order. """ _doc_stats = """\ stats(%(shapes)s, loc=0, scale=1, moments='mv') Mean('m'), variance('v'), skew('s'), and/or kurtosis('k'). """ _doc_entropy = """\ entropy(%(shapes)s, loc=0, scale=1) (Differential) entropy of the RV. """ _doc_fit = """\ fit(data) Parameter estimates for generic data. See `scipy.stats.rv_continuous.fit <https://docs.scipy.org/doc/scipy/reference/generated/scipy.stats.rv_continuous.fit.html#scipy.stats.rv_continuous.fit>`__ for detailed documentation of the keyword arguments. """ _doc_expect = """\ expect(func, args=(%(shapes_)s), loc=0, scale=1, lb=None, ub=None, conditional=False, **kwds) Expected value of a function (of one argument) with respect to the distribution. """ _doc_expect_discrete = """\ expect(func, args=(%(shapes_)s), loc=0, lb=None, ub=None, conditional=False) Expected value of a function (of one argument) with respect to the distribution. """ _doc_median = """\ median(%(shapes)s, loc=0, scale=1) Median of the distribution. """ _doc_mean = """\ mean(%(shapes)s, loc=0, scale=1) Mean of the distribution. """ _doc_var = """\ var(%(shapes)s, loc=0, scale=1) Variance of the distribution. """ _doc_std = """\ std(%(shapes)s, loc=0, scale=1) Standard deviation of the distribution. """ _doc_interval = """\ interval(confidence, %(shapes)s, loc=0, scale=1) Confidence interval with equal areas around the median. """ _doc_allmethods = ''.join([docheaders['methods'], _doc_rvs, _doc_pdf, _doc_logpdf, _doc_cdf, _doc_logcdf, _doc_sf, _doc_logsf, _doc_ppf, _doc_isf, _doc_moment, _doc_stats, _doc_entropy, _doc_fit, _doc_expect, _doc_median, _doc_mean, _doc_var, _doc_std, _doc_interval]) _doc_default_longsummary = """\ As an instance of the `rv_continuous` class, `%(name)s` object inherits from it a collection of generic methods (see below for the full list), and completes them with details specific for this particular distribution. """ _doc_default_frozen_note = """ Alternatively, the object may be called (as a function) to fix the shape, location, and scale parameters returning a "frozen" continuous RV object: rv = %(name)s(%(shapes)s, loc=0, scale=1) - Frozen RV object with the same methods but holding the given shape, location, and scale fixed. """ _doc_default_example = """\ Examples -------- >>> from scipy.stats import %(name)s >>> import matplotlib.pyplot as plt >>> fig, ax = plt.subplots(1, 1) Calculate the first four moments: %(set_vals_stmt)s >>> mean, var, skew, kurt = %(name)s.stats(%(shapes)s, moments='mvsk') Display the probability density function (``pdf``): >>> x = np.linspace(%(name)s.ppf(0.01, %(shapes)s), ... %(name)s.ppf(0.99, %(shapes)s), 100) >>> ax.plot(x, %(name)s.pdf(x, %(shapes)s), ... 'r-', lw=5, alpha=0.6, label='%(name)s pdf') Alternatively, the distribution object can be called (as a function) to fix the shape, location and scale parameters. This returns a "frozen" RV object holding the given parameters fixed. Freeze the distribution and display the frozen ``pdf``: >>> rv = %(name)s(%(shapes)s) >>> ax.plot(x, rv.pdf(x), 'k-', lw=2, label='frozen pdf') Check accuracy of ``cdf`` and ``ppf``: >>> vals = %(name)s.ppf([0.001, 0.5, 0.999], %(shapes)s) >>> np.allclose([0.001, 0.5, 0.999], %(name)s.cdf(vals, %(shapes)s)) True Generate random numbers: >>> r = %(name)s.rvs(%(shapes)s, size=1000) And compare the histogram: >>> ax.hist(r, density=True, histtype='stepfilled', alpha=0.2) >>> ax.legend(loc='best', frameon=False) >>> plt.show() """ _doc_default_locscale = """\ The probability density above is defined in the "standardized" form. To shift and/or scale the distribution use the ``loc`` and ``scale`` parameters. Specifically, ``%(name)s.pdf(x, %(shapes)s, loc, scale)`` is identically equivalent to ``%(name)s.pdf(y, %(shapes)s) / scale`` with ``y = (x - loc) / scale``. Note that shifting the location of a distribution does not make it a "noncentral" distribution; noncentral generalizations of some distributions are available in separate classes. """ _doc_default = ''.join([_doc_default_longsummary, _doc_allmethods, '\n', _doc_default_example]) _doc_default_before_notes = ''.join([_doc_default_longsummary, _doc_allmethods]) docdict = { 'rvs': _doc_rvs, 'pdf': _doc_pdf, 'logpdf': _doc_logpdf, 'cdf': _doc_cdf, 'logcdf': _doc_logcdf, 'sf': _doc_sf, 'logsf': _doc_logsf, 'ppf': _doc_ppf, 'isf': _doc_isf, 'stats': _doc_stats, 'entropy': _doc_entropy, 'fit': _doc_fit, 'moment': _doc_moment, 'expect': _doc_expect, 'interval': _doc_interval, 'mean': _doc_mean, 'std': _doc_std, 'var': _doc_var, 'median': _doc_median, 'allmethods': _doc_allmethods, 'longsummary': _doc_default_longsummary, 'frozennote': _doc_default_frozen_note, 'example': _doc_default_example, 'default': _doc_default, 'before_notes': _doc_default_before_notes, 'after_notes': _doc_default_locscale } # Reuse common content between continuous and discrete docs, change some # minor bits. docdict_discrete = docdict.copy() docdict_discrete['pmf'] = _doc_pmf docdict_discrete['logpmf'] = _doc_logpmf docdict_discrete['expect'] = _doc_expect_discrete _doc_disc_methods = ['rvs', 'pmf', 'logpmf', 'cdf', 'logcdf', 'sf', 'logsf', 'ppf', 'isf', 'stats', 'entropy', 'expect', 'median', 'mean', 'var', 'std', 'interval'] for obj in _doc_disc_methods: docdict_discrete[obj] = docdict_discrete[obj].replace(', scale=1', '') _doc_disc_methods_err_varname = ['cdf', 'logcdf', 'sf', 'logsf'] for obj in _doc_disc_methods_err_varname: docdict_discrete[obj] = docdict_discrete[obj].replace('(x, ', '(k, ') docdict_discrete.pop('pdf') docdict_discrete.pop('logpdf') _doc_allmethods = ''.join([docdict_discrete[obj] for obj in _doc_disc_methods]) docdict_discrete['allmethods'] = docheaders['methods'] + _doc_allmethods docdict_discrete['longsummary'] = _doc_default_longsummary.replace( 'rv_continuous', 'rv_discrete') _doc_default_frozen_note = """ Alternatively, the object may be called (as a function) to fix the shape and location parameters returning a "frozen" discrete RV object: rv = %(name)s(%(shapes)s, loc=0) - Frozen RV object with the same methods but holding the given shape and location fixed. """ docdict_discrete['frozennote'] = _doc_default_frozen_note _doc_default_discrete_example = """\ Examples -------- >>> from scipy.stats import %(name)s >>> import matplotlib.pyplot as plt >>> fig, ax = plt.subplots(1, 1) Calculate the first four moments: %(set_vals_stmt)s >>> mean, var, skew, kurt = %(name)s.stats(%(shapes)s, moments='mvsk') Display the probability mass function (``pmf``): >>> x = np.arange(%(name)s.ppf(0.01, %(shapes)s), ... %(name)s.ppf(0.99, %(shapes)s)) >>> ax.plot(x, %(name)s.pmf(x, %(shapes)s), 'bo', ms=8, label='%(name)s pmf') >>> ax.vlines(x, 0, %(name)s.pmf(x, %(shapes)s), colors='b', lw=5, alpha=0.5) Alternatively, the distribution object can be called (as a function) to fix the shape and location. This returns a "frozen" RV object holding the given parameters fixed. Freeze the distribution and display the frozen ``pmf``: >>> rv = %(name)s(%(shapes)s) >>> ax.vlines(x, 0, rv.pmf(x), colors='k', linestyles='-', lw=1, ... label='frozen pmf') >>> ax.legend(loc='best', frameon=False) >>> plt.show() Check accuracy of ``cdf`` and ``ppf``: >>> prob = %(name)s.cdf(x, %(shapes)s) >>> np.allclose(x, %(name)s.ppf(prob, %(shapes)s)) True Generate random numbers: >>> r = %(name)s.rvs(%(shapes)s, size=1000) """ _doc_default_discrete_locscale = """\ The probability mass function above is defined in the "standardized" form. To shift distribution use the ``loc`` parameter. Specifically, ``%(name)s.pmf(k, %(shapes)s, loc)`` is identically equivalent to ``%(name)s.pmf(k - loc, %(shapes)s)``. """ docdict_discrete['example'] = _doc_default_discrete_example docdict_discrete['after_notes'] = _doc_default_discrete_locscale _doc_default_before_notes = ''.join([docdict_discrete['longsummary'], docdict_discrete['allmethods']]) docdict_discrete['before_notes'] = _doc_default_before_notes _doc_default_disc = ''.join([docdict_discrete['longsummary'], docdict_discrete['allmethods'], docdict_discrete['frozennote'], docdict_discrete['example']]) docdict_discrete['default'] = _doc_default_disc # clean up all the separate docstring elements, we do not need them anymore for obj in [s for s in dir() if s.startswith('_doc_')]: exec('del ' + obj) del obj def _moment(data, n, mu=None): if mu is None: mu = data.mean() return ((data - mu)**n).mean() def _moment_from_stats(n, mu, mu2, g1, g2, moment_func, args): if (n == 0): return 1.0 elif (n == 1): if mu is None: val = moment_func(1, *args) else: val = mu elif (n == 2): if mu2 is None or mu is None: val = moment_func(2, *args) else: val = mu2 + mu*mu elif (n == 3): if g1 is None or mu2 is None or mu is None: val = moment_func(3, *args) else: mu3 = g1 * np.power(mu2, 1.5) # 3rd central moment val = mu3+3*mu*mu2+mu*mu*mu # 3rd non-central moment elif (n == 4): if g1 is None or g2 is None or mu2 is None or mu is None: val = moment_func(4, *args) else: mu4 = (g2+3.0)*(mu2**2.0) # 4th central moment mu3 = g1*np.power(mu2, 1.5) # 3rd central moment val = mu4+4*mu*mu3+6*mu*mu*mu2+mu*mu*mu*mu else: val = moment_func(n, *args) return val def _skew(data): """ skew is third central moment / variance**(1.5) """ data = np.ravel(data) mu = data.mean() m2 = ((data - mu)**2).mean() m3 = ((data - mu)**3).mean() return m3 / np.power(m2, 1.5) def _kurtosis(data): """kurtosis is fourth central moment / variance**2 - 3.""" data = np.ravel(data) mu = data.mean() m2 = ((data - mu)**2).mean() m4 = ((data - mu)**4).mean() return m4 / m2**2 - 3 def _fit_determine_optimizer(optimizer): if not callable(optimizer) and isinstance(optimizer, str): if not optimizer.startswith('fmin_'): optimizer = "fmin_"+optimizer if optimizer == 'fmin_': optimizer = 'fmin' try: optimizer = getattr(optimize, optimizer) except AttributeError as e: raise ValueError("%s is not a valid optimizer" % optimizer) from e return optimizer # Frozen RV class class rv_frozen: def __init__(self, dist, *args, **kwds): self.args = args self.kwds = kwds # create a new instance self.dist = dist.__class__(**dist._updated_ctor_param()) shapes, _, _ = self.dist._parse_args(*args, **kwds) self.a, self.b = self.dist._get_support(*shapes) @property def random_state(self): return self.dist._random_state @random_state.setter def random_state(self, seed): self.dist._random_state = check_random_state(seed) def pdf(self, x): # raises AttributeError in frozen discrete distribution return self.dist.pdf(x, *self.args, **self.kwds) def logpdf(self, x): return self.dist.logpdf(x, *self.args, **self.kwds) def cdf(self, x): return self.dist.cdf(x, *self.args, **self.kwds) def logcdf(self, x): return self.dist.logcdf(x, *self.args, **self.kwds) def ppf(self, q): return self.dist.ppf(q, *self.args, **self.kwds) def isf(self, q): return self.dist.isf(q, *self.args, **self.kwds) def rvs(self, size=None, random_state=None): kwds = self.kwds.copy() kwds.update({'size': size, 'random_state': random_state}) return self.dist.rvs(*self.args, **kwds) def sf(self, x): return self.dist.sf(x, *self.args, **self.kwds) def logsf(self, x): return self.dist.logsf(x, *self.args, **self.kwds) def stats(self, moments='mv'): kwds = self.kwds.copy() kwds.update({'moments': moments}) return self.dist.stats(*self.args, **kwds) def median(self): return self.dist.median(*self.args, **self.kwds) def mean(self): return self.dist.mean(*self.args, **self.kwds) def var(self): return self.dist.var(*self.args, **self.kwds) def std(self): return self.dist.std(*self.args, **self.kwds) def moment(self, order=None, **kwds): return self.dist.moment(order, *self.args, **self.kwds, **kwds) def entropy(self): return self.dist.entropy(*self.args, **self.kwds) def pmf(self, k): return self.dist.pmf(k, *self.args, **self.kwds) def logpmf(self, k): return self.dist.logpmf(k, *self.args, **self.kwds) def interval(self, confidence=None, **kwds): return self.dist.interval(confidence, *self.args, **self.kwds, **kwds) def expect(self, func=None, lb=None, ub=None, conditional=False, **kwds): # expect method only accepts shape parameters as positional args # hence convert self.args, self.kwds, also loc/scale # See the .expect method docstrings for the meaning of # other parameters. a, loc, scale = self.dist._parse_args(*self.args, **self.kwds) if isinstance(self.dist, rv_discrete): return self.dist.expect(func, a, loc, lb, ub, conditional, **kwds) else: return self.dist.expect(func, a, loc, scale, lb, ub, conditional, **kwds) def support(self): return self.dist.support(*self.args, **self.kwds) def argsreduce(cond, *args): """Clean arguments to: 1. Ensure all arguments are iterable (arrays of dimension at least one 2. If cond != True and size > 1, ravel(args[i]) where ravel(condition) is True, in 1D. Return list of processed arguments. Examples -------- >>> rng = np.random.default_rng() >>> A = rng.random((4, 5)) >>> B = 2 >>> C = rng.random((1, 5)) >>> cond = np.ones(A.shape) >>> [A1, B1, C1] = argsreduce(cond, A, B, C) >>> A1.shape (4, 5) >>> B1.shape (1,) >>> C1.shape (1, 5) >>> cond[2,:] = 0 >>> [A1, B1, C1] = argsreduce(cond, A, B, C) >>> A1.shape (15,) >>> B1.shape (1,) >>> C1.shape (15,) """ # some distributions assume arguments are iterable. newargs = np.atleast_1d(*args) # np.atleast_1d returns an array if only one argument, or a list of arrays # if more than one argument. if not isinstance(newargs, list): newargs = [newargs, ] if np.all(cond): # broadcast arrays with cond *newargs, cond = np.broadcast_arrays(*newargs, cond) return [arg.ravel() for arg in newargs] s = cond.shape # np.extract returns flattened arrays, which are not broadcastable together # unless they are either the same size or size == 1. return [(arg if np.size(arg) == 1 else np.extract(cond, np.broadcast_to(arg, s))) for arg in newargs] parse_arg_template = """ def _parse_args(self, %(shape_arg_str)s %(locscale_in)s): return (%(shape_arg_str)s), %(locscale_out)s def _parse_args_rvs(self, %(shape_arg_str)s %(locscale_in)s, size=None): return self._argcheck_rvs(%(shape_arg_str)s %(locscale_out)s, size=size) def _parse_args_stats(self, %(shape_arg_str)s %(locscale_in)s, moments='mv'): return (%(shape_arg_str)s), %(locscale_out)s, moments """ # Both the continuous and discrete distributions depend on ncx2. # The function name ncx2 is an abbreviation for noncentral chi squared. def _ncx2_log_pdf(x, df, nc): # We use (xs**2 + ns**2)/2 = (xs - ns)**2/2 + xs*ns, and include the # factor of exp(-xs*ns) into the ive function to improve numerical # stability at large values of xs. See also `rice.pdf`. df2 = df/2.0 - 1.0 xs, ns = np.sqrt(x), np.sqrt(nc) res = xlogy(df2/2.0, x/nc) - 0.5*(xs - ns)**2 corr = ive(df2, xs*ns) / 2.0 # Return res + np.log(corr) avoiding np.log(0) return _lazywhere( corr > 0, (res, corr), f=lambda r, c: r + np.log(c), fillvalue=-np.inf) def _ncx2_pdf(x, df, nc): # Copy of _ncx2_log_pdf avoiding np.log(0) when corr = 0 df2 = df/2.0 - 1.0 xs, ns = np.sqrt(x), np.sqrt(nc) res = xlogy(df2/2.0, x/nc) - 0.5*(xs - ns)**2 corr = ive(df2, xs*ns) / 2.0 return np.exp(res) * corr def _ncx2_cdf(x, df, nc): return chndtr(x, df, nc) class rv_generic: """Class which encapsulates common functionality between rv_discrete and rv_continuous. """ def __init__(self, seed=None): super().__init__() # figure out if _stats signature has 'moments' keyword sig = _getfullargspec(self._stats) self._stats_has_moments = ((sig.varkw is not None) or ('moments' in sig.args) or ('moments' in sig.kwonlyargs)) self._random_state = check_random_state(seed) # For historical reasons, `size` was made an attribute that was read # inside _rvs(). The code is being changed so that 'size' # is an argument # to self._rvs(). However some external (non-SciPy) distributions # have not # been updated. Maintain backwards compatibility by checking if # the self._rvs() signature has the 'size' keyword, or a **kwarg, # and if not set self._size inside self.rvs() # before calling self._rvs(). argspec = inspect.getfullargspec(self._rvs) self._rvs_uses_size_attribute = (argspec.varkw is None and 'size' not in argspec.args and 'size' not in argspec.kwonlyargs) # Warn on first use only self._rvs_size_warned = False @property def random_state(self): """Get or set the generator object for generating random variates. If `seed` is None (or `np.random`), the `numpy.random.RandomState` singleton is used. If `seed` is an int, a new ``RandomState`` instance is used, seeded with `seed`. If `seed` is already a ``Generator`` or ``RandomState`` instance then that instance is used. """ return self._random_state @random_state.setter def random_state(self, seed): self._random_state = check_random_state(seed) def __setstate__(self, state): try: self.__dict__.update(state) # attaches the dynamically created methods on each instance. # if a subclass overrides rv_generic.__setstate__, or implements # it's own _attach_methods, then it must make sure that # _attach_argparser_methods is called. self._attach_methods() except ValueError: # reconstitute an old pickle scipy<1.6, that contains # (_ctor_param, random_state) as state self._ctor_param = state[0] self._random_state = state[1] self.__init__() def _attach_methods(self): """Attaches dynamically created methods to the rv_* instance. This method must be overridden by subclasses, and must itself call _attach_argparser_methods. This method is called in __init__ in subclasses, and in __setstate__ """ raise NotImplementedError def _attach_argparser_methods(self): """ Generates the argument-parsing functions dynamically and attaches them to the instance. Should be called from `_attach_methods`, typically in __init__ and during unpickling (__setstate__) """ ns = {} exec(self._parse_arg_template, ns) # NB: attach to the instance, not class for name in ['_parse_args', '_parse_args_stats', '_parse_args_rvs']: setattr(self, name, types.MethodType(ns[name], self)) def _construct_argparser( self, meths_to_inspect, locscale_in, locscale_out): """Construct the parser string for the shape arguments. This method should be called in __init__ of a class for each distribution. It creates the `_parse_arg_template` attribute that is then used by `_attach_argparser_methods` to dynamically create and attach the `_parse_args`, `_parse_args_stats`, `_parse_args_rvs` methods to the instance. If self.shapes is a non-empty string, interprets it as a comma-separated list of shape parameters. Otherwise inspects the call signatures of `meths_to_inspect` and constructs the argument-parsing functions from these. In this case also sets `shapes` and `numargs`. """ if self.shapes: # sanitize the user-supplied shapes if not isinstance(self.shapes, str): raise TypeError('shapes must be a string.') shapes = self.shapes.replace(',', ' ').split() for field in shapes: if keyword.iskeyword(field): raise SyntaxError('keywords cannot be used as shapes.') if not re.match('^[_a-zA-Z][_a-zA-Z0-9]*$', field): raise SyntaxError( 'shapes must be valid python identifiers') else: # find out the call signatures (_pdf, _cdf etc), deduce shape # arguments. Generic methods only have 'self, x', any further args # are shapes. shapes_list = [] for meth in meths_to_inspect: shapes_args = _getfullargspec(meth) # NB does not contain self args = shapes_args.args[1:] # peel off 'x', too if args: shapes_list.append(args) # *args or **kwargs are not allowed w/automatic shapes if shapes_args.varargs is not None: raise TypeError( '*args are not allowed w/out explicit shapes') if shapes_args.varkw is not None: raise TypeError( '**kwds are not allowed w/out explicit shapes') if shapes_args.kwonlyargs: raise TypeError( 'kwonly args are not allowed w/out explicit shapes') if shapes_args.defaults is not None: raise TypeError('defaults are not allowed for shapes') if shapes_list: shapes = shapes_list[0] # make sure the signatures are consistent for item in shapes_list: if item != shapes: raise TypeError('Shape arguments are inconsistent.') else: shapes = [] # have the arguments, construct the method from template shapes_str = ', '.join(shapes) + ', ' if shapes else '' # NB: not None dct = dict(shape_arg_str=shapes_str, locscale_in=locscale_in, locscale_out=locscale_out, ) # this string is used by _attach_argparser_methods self._parse_arg_template = parse_arg_template % dct self.shapes = ', '.join(shapes) if shapes else None if not hasattr(self, 'numargs'): # allows more general subclassing with *args self.numargs = len(shapes) def _construct_doc(self, docdict, shapes_vals=None): """Construct the instance docstring with string substitutions.""" tempdict = docdict.copy() tempdict['name'] = self.name or 'distname' tempdict['shapes'] = self.shapes or '' if shapes_vals is None: shapes_vals = () vals = ', '.join('%.3g' % val for val in shapes_vals) tempdict['vals'] = vals tempdict['shapes_'] = self.shapes or '' if self.shapes and self.numargs == 1: tempdict['shapes_'] += ',' if self.shapes: tempdict['set_vals_stmt'] = '>>> %s = %s' % (self.shapes, vals) else: tempdict['set_vals_stmt'] = '' if self.shapes is None: # remove shapes from call parameters if there are none for item in ['default', 'before_notes']: tempdict[item] = tempdict[item].replace( "\n%(shapes)s : array_like\n shape parameters", "") for i in range(2): if self.shapes is None: # necessary because we use %(shapes)s in two forms (w w/o ", ") self.__doc__ = self.__doc__.replace("%(shapes)s, ", "") try: self.__doc__ = doccer.docformat(self.__doc__, tempdict) except TypeError as e: raise Exception("Unable to construct docstring for " "distribution \"%s\": %s" % (self.name, repr(e))) from e # correct for empty shapes self.__doc__ = self.__doc__.replace('(, ', '(').replace(', )', ')') def _construct_default_doc(self, longname=None, extradoc=None, docdict=None, discrete='continuous'): """Construct instance docstring from the default template.""" if longname is None: longname = 'A' if extradoc is None: extradoc = '' if extradoc.startswith('\n\n'): extradoc = extradoc[2:] self.__doc__ = ''.join(['%s %s random variable.' % (longname, discrete), '\n\n%(before_notes)s\n', docheaders['notes'], extradoc, '\n%(example)s']) self._construct_doc(docdict) def freeze(self, *args, **kwds): """Freeze the distribution for the given arguments. Parameters ---------- arg1, arg2, arg3,... : array_like The shape parameter(s) for the distribution. Should include all the non-optional arguments, may include ``loc`` and ``scale``. Returns ------- rv_frozen : rv_frozen instance The frozen distribution. """ return rv_frozen(self, *args, **kwds) def __call__(self, *args, **kwds): return self.freeze(*args, **kwds) __call__.__doc__ = freeze.__doc__ # The actual calculation functions (no basic checking need be done) # If these are defined, the others won't be looked at. # Otherwise, the other set can be defined. def _stats(self, *args, **kwds): return None, None, None, None # Noncentral moments (also known as the moment about the origin). # Expressed in LaTeX, munp would be $\mu'_{n}$, i.e. "mu-sub-n-prime". # The primed mu is a widely used notation for the noncentral moment. def _munp(self, n, *args): # Silence floating point warnings from integration. with np.errstate(all='ignore'): vals = self.generic_moment(n, *args) return vals def _argcheck_rvs(self, *args, **kwargs): # Handle broadcasting and size validation of the rvs method. # Subclasses should not have to override this method. # The rule is that if `size` is not None, then `size` gives the # shape of the result (integer values of `size` are treated as # tuples with length 1; i.e. `size=3` is the same as `size=(3,)`.) # # `args` is expected to contain the shape parameters (if any), the # location and the scale in a flat tuple (e.g. if there are two # shape parameters `a` and `b`, `args` will be `(a, b, loc, scale)`). # The only keyword argument expected is 'size'. size = kwargs.get('size', None) all_bcast = np.broadcast_arrays(*args) def squeeze_left(a): while a.ndim > 0 and a.shape[0] == 1: a = a[0] return a # Eliminate trivial leading dimensions. In the convention # used by numpy's random variate generators, trivial leading # dimensions are effectively ignored. In other words, when `size` # is given, trivial leading dimensions of the broadcast parameters # in excess of the number of dimensions in size are ignored, e.g. # >>> np.random.normal([[1, 3, 5]], [[[[0.01]]]], size=3) # array([ 1.00104267, 3.00422496, 4.99799278]) # If `size` is not given, the exact broadcast shape is preserved: # >>> np.random.normal([[1, 3, 5]], [[[[0.01]]]]) # array([[[[ 1.00862899, 3.00061431, 4.99867122]]]]) # all_bcast = [squeeze_left(a) for a in all_bcast] bcast_shape = all_bcast[0].shape bcast_ndim = all_bcast[0].ndim if size is None: size_ = bcast_shape else: size_ = tuple(np.atleast_1d(size)) # Check compatibility of size_ with the broadcast shape of all # the parameters. This check is intended to be consistent with # how the numpy random variate generators (e.g. np.random.normal, # np.random.beta) handle their arguments. The rule is that, if size # is given, it determines the shape of the output. Broadcasting # can't change the output size. # This is the standard broadcasting convention of extending the # shape with fewer dimensions with enough dimensions of length 1 # so that the two shapes have the same number of dimensions. ndiff = bcast_ndim - len(size_) if ndiff < 0: bcast_shape = (1,)*(-ndiff) + bcast_shape elif ndiff > 0: size_ = (1,)*ndiff + size_ # This compatibility test is not standard. In "regular" broadcasting, # two shapes are compatible if for each dimension, the lengths are the # same or one of the lengths is 1. Here, the length of a dimension in # size_ must not be less than the corresponding length in bcast_shape. ok = all([bcdim == 1 or bcdim == szdim for (bcdim, szdim) in zip(bcast_shape, size_)]) if not ok: raise ValueError("size does not match the broadcast shape of " "the parameters. %s, %s, %s" % (size, size_, bcast_shape)) param_bcast = all_bcast[:-2] loc_bcast = all_bcast[-2] scale_bcast = all_bcast[-1] return param_bcast, loc_bcast, scale_bcast, size_ # These are the methods you must define (standard form functions) # NB: generic _pdf, _logpdf, _cdf are different for # rv_continuous and rv_discrete hence are defined in there def _argcheck(self, *args): """Default check for correct values on args and keywords. Returns condition array of 1's where arguments are correct and 0's where they are not. """ cond = 1 for arg in args: cond = logical_and(cond, (asarray(arg) > 0)) return cond def _get_support(self, *args, **kwargs): """Return the support of the (unscaled, unshifted) distribution. *Must* be overridden by distributions which have support dependent upon the shape parameters of the distribution. Any such override *must not* set or change any of the class members, as these members are shared amongst all instances of the distribution. Parameters ---------- arg1, arg2, ... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information). Returns ------- a, b : numeric (float, or int or +/-np.inf) end-points of the distribution's support for the specified shape parameters. """ return self.a, self.b def _support_mask(self, x, *args): a, b = self._get_support(*args) with np.errstate(invalid='ignore'): return (a <= x) & (x <= b) def _open_support_mask(self, x, *args): a, b = self._get_support(*args) with np.errstate(invalid='ignore'): return (a < x) & (x < b) def _rvs(self, *args, size=None, random_state=None): # This method must handle size being a tuple, and it must # properly broadcast *args and size. size might be # an empty tuple, which means a scalar random variate is to be # generated. # Use basic inverse cdf algorithm for RV generation as default. U = random_state.uniform(size=size) Y = self._ppf(U, *args) return Y def _logcdf(self, x, *args): with np.errstate(divide='ignore'): return log(self._cdf(x, *args)) def _sf(self, x, *args): return 1.0-self._cdf(x, *args) def _logsf(self, x, *args): with np.errstate(divide='ignore'): return log(self._sf(x, *args)) def _ppf(self, q, *args): return self._ppfvec(q, *args) def _isf(self, q, *args): return self._ppf(1.0-q, *args) # use correct _ppf for subclasses # These are actually called, and should not be overwritten if you # want to keep error checking. def rvs(self, *args, **kwds): """Random variates of given type. Parameters ---------- arg1, arg2, arg3,... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information). loc : array_like, optional Location parameter (default=0). scale : array_like, optional Scale parameter (default=1). size : int or tuple of ints, optional Defining number of random variates (default is 1). random_state : {None, int, `numpy.random.Generator`, `numpy.random.RandomState`}, optional If `seed` is None (or `np.random`), the `numpy.random.RandomState` singleton is used. If `seed` is an int, a new ``RandomState`` instance is used, seeded with `seed`. If `seed` is already a ``Generator`` or ``RandomState`` instance then that instance is used. Returns ------- rvs : ndarray or scalar Random variates of given `size`. """ discrete = kwds.pop('discrete', None) rndm = kwds.pop('random_state', None) args, loc, scale, size = self._parse_args_rvs(*args, **kwds) cond = logical_and(self._argcheck(*args), (scale >= 0)) if not np.all(cond): message = ("Domain error in arguments. The `scale` parameter must " "be positive for all distributions; see the " "distribution documentation for other restrictions.") raise ValueError(message) if np.all(scale == 0): return loc*ones(size, 'd') # extra gymnastics needed for a custom random_state if rndm is not None: random_state_saved = self._random_state random_state = check_random_state(rndm) else: random_state = self._random_state # Maintain backwards compatibility by setting self._size # for distributions that still need it. if self._rvs_uses_size_attribute: if not self._rvs_size_warned: warnings.warn( f'The signature of {self._rvs} does not contain ' f'a "size" keyword. Such signatures are deprecated.', np.VisibleDeprecationWarning) self._rvs_size_warned = True self._size = size self._random_state = random_state vals = self._rvs(*args) else: vals = self._rvs(*args, size=size, random_state=random_state) vals = vals * scale + loc # do not forget to restore the _random_state if rndm is not None: self._random_state = random_state_saved # Cast to int if discrete if discrete: if size == (): vals = int(vals) else: vals = vals.astype(int) return vals def stats(self, *args, **kwds): """Some statistics of the given RV. Parameters ---------- arg1, arg2, arg3,... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information) loc : array_like, optional location parameter (default=0) scale : array_like, optional (continuous RVs only) scale parameter (default=1) moments : str, optional composed of letters ['mvsk'] defining which moments to compute: 'm' = mean, 'v' = variance, 's' = (Fisher's) skew, 'k' = (Fisher's) kurtosis. (default is 'mv') Returns ------- stats : sequence of requested moments. """ args, loc, scale, moments = self._parse_args_stats(*args, **kwds) # scale = 1 by construction for discrete RVs loc, scale = map(asarray, (loc, scale)) args = tuple(map(asarray, args)) cond = self._argcheck(*args) & (scale > 0) & (loc == loc) output = [] default = np.full(shape(cond), fill_value=self.badvalue) # Use only entries that are valid in calculation if np.any(cond): goodargs = argsreduce(cond, *(args+(scale, loc))) scale, loc, goodargs = goodargs[-2], goodargs[-1], goodargs[:-2] if self._stats_has_moments: mu, mu2, g1, g2 = self._stats(*goodargs, **{'moments': moments}) else: mu, mu2, g1, g2 = self._stats(*goodargs) if 'm' in moments: if mu is None: mu = self._munp(1, *goodargs) out0 = default.copy() place(out0, cond, mu * scale + loc) output.append(out0) if 'v' in moments: if mu2 is None: mu2p = self._munp(2, *goodargs) if mu is None: mu = self._munp(1, *goodargs) # if mean is inf then var is also inf with np.errstate(invalid='ignore'): mu2 = np.where(~np.isinf(mu), mu2p - mu**2, np.inf) out0 = default.copy() place(out0, cond, mu2 * scale * scale) output.append(out0) if 's' in moments: if g1 is None: mu3p = self._munp(3, *goodargs) if mu is None: mu = self._munp(1, *goodargs) if mu2 is None: mu2p = self._munp(2, *goodargs) mu2 = mu2p - mu * mu with np.errstate(invalid='ignore'): mu3 = (-mu*mu - 3*mu2)*mu + mu3p g1 = mu3 / np.power(mu2, 1.5) out0 = default.copy() place(out0, cond, g1) output.append(out0) if 'k' in moments: if g2 is None: mu4p = self._munp(4, *goodargs) if mu is None: mu = self._munp(1, *goodargs) if mu2 is None: mu2p = self._munp(2, *goodargs) mu2 = mu2p - mu * mu if g1 is None: mu3 = None else: # (mu2**1.5) breaks down for nan and inf mu3 = g1 * np.power(mu2, 1.5) if mu3 is None: mu3p = self._munp(3, *goodargs) with np.errstate(invalid='ignore'): mu3 = (-mu * mu - 3 * mu2) * mu + mu3p with np.errstate(invalid='ignore'): mu4 = ((-mu**2 - 6*mu2) * mu - 4*mu3)*mu + mu4p g2 = mu4 / mu2**2.0 - 3.0 out0 = default.copy() place(out0, cond, g2) output.append(out0) else: # no valid args output = [default.copy() for _ in moments] if len(output) == 1: return output[0] else: return tuple(output) def entropy(self, *args, **kwds): """Differential entropy of the RV. Parameters ---------- arg1, arg2, arg3,... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information). loc : array_like, optional Location parameter (default=0). scale : array_like, optional (continuous distributions only). Scale parameter (default=1). Notes ----- Entropy is defined base `e`: >>> drv = rv_discrete(values=((0, 1), (0.5, 0.5))) >>> np.allclose(drv.entropy(), np.log(2.0)) True """ args, loc, scale = self._parse_args(*args, **kwds) # NB: for discrete distributions scale=1 by construction in _parse_args loc, scale = map(asarray, (loc, scale)) args = tuple(map(asarray, args)) cond0 = self._argcheck(*args) & (scale > 0) & (loc == loc) output = zeros(shape(cond0), 'd') place(output, (1-cond0), self.badvalue) goodargs = argsreduce(cond0, scale, *args) goodscale = goodargs[0] goodargs = goodargs[1:] place(output, cond0, self.vecentropy(*goodargs) + log(goodscale)) return output def moment(self, order=None, *args, **kwds): """non-central moment of distribution of specified order. .. deprecated:: 1.9.0 Parameter `n` is replaced by parameter `order` to avoid name collisions with the shape parameter `n` of several distributions. Parameter `n` will be removed in the second release after 1.9.0. Parameters ---------- order : int, order >= 1 Order of moment. arg1, arg2, arg3,... : float The shape parameter(s) for the distribution (see docstring of the instance object for more information). loc : array_like, optional location parameter (default=0) scale : array_like, optional scale parameter (default=1) """ # This function was originally written with parameter `n`, but `n` # is also the name of many distribution shape parameters. # This block allows the function to accept both `n` and its # replacement `order` during a deprecation period; it can be removed # in the second release after 1.9.0. # The logic to provide a DeprecationWarning only when `n` is passed # as a keyword, accept the new keyword `order`, and otherwise be # backward-compatible deserves explanation. We need to look out for # the following: # * Does the distribution have a shape named `n`? # * Is `order` provided? It doesn't matter whether it is provided as a # positional or keyword argument; it will be used as the order of the # moment rather than a distribution shape parameter because: # - The first positional argument of `moment` has always been the # order of the moment. # - The keyword `order` is new, so it's unambiguous that it refers to # the order of the moment. # * Is `n` provided as a keyword argument? It _does_ matter whether it # is provided as a positional or keyword argument. # - The first positional argument of `moment` has always been the # order of moment, but # - if `n` is provided as a keyword argument, its meaning depends # on whether the distribution accepts `n` as a shape parameter. has_shape_n = (self.shapes is not None and "n" in (self.shapes.split(", "))) got_order = order is not None got_keyword_n = kwds.get("n", None) is not None # These lead to the following cases. # Case A: If the distribution _does_ accept `n` as a shape # 1. If both `order` and `n` are provided, this is now OK: # it is unambiguous that `order` is the order of the moment and `n` # is the shape parameter. Previously, this would have caused an # error because `n` was provided both as a keyword argument and # as the first positional argument. I don't think it is credible for # users to rely on this error in their code, though, so I don't see # this as a backward compatibility break. # 2. If only `n` is provided (as a keyword argument), this would have # been an error in the past because `n` would have been treated as # the order of the moment while the shape parameter would be # missing. It is still the same type of error, but for a different # reason: now, `n` is treated as the shape parameter while the # order of the moment is missing. # 3. If only `order` is provided, no special treament is needed. # Clearly this value is intended to be the order of the moment, # and the rest of the function will determine whether `n` is # available as a shape parameter in `args`. # 4. If neither `n` nor `order` is provided, this would have been an # error (order of the moment is not provided) and it is still an # error for the same reason. # Case B: the distribution does _not_ accept `n` as a shape # 1. If both `order` and `n` are provided, this was an error, and it # still is an error: two values for same parameter. # 2. If only `n` is provided (as a keyword argument), this was OK and # is still OK, but there shold now be a `DeprecationWarning`. The # value of `n` should be removed from `kwds` and stored in `order`. # 3. If only `order` is provided, there was no problem before providing # only the first argument of `moment`, and there is no problem with # that now. # 4. If neither `n` nor `order` is provided, this would have been an # error (order of the moment is not provided), and it is still an # error for the same reason. if not got_order and ((not got_keyword_n) # A4 and B4 or (got_keyword_n and has_shape_n)): # A2 message = ("moment() missing 1 required " "positional argument: `order`") raise TypeError(message) if got_keyword_n and not has_shape_n: if got_order: # B1 # this will change to "moment got unexpected argument n" message = "moment() got multiple values for first argument" raise TypeError(message) else: # B2 message = ("Use of keyword argument `n` for method " "`moment` is deprecated. Use first positional " "argument or keyword argument `order` instead.") order = kwds.pop("n") warnings.warn(message, DeprecationWarning, stacklevel=2) n = order # No special treatment of A1, A3, or B3 is needed because the order # of the moment is now in variable `n` and the shape parameter, if # needed, will be fished out of `args` or `kwds` by _parse_args # A3 might still cause an error if the shape parameter called `n` # is not found in `args`. shapes, loc, scale = self._parse_args(*args, **kwds) args = np.broadcast_arrays(*(*shapes, loc, scale)) *shapes, loc, scale = args i0 = np.logical_and(self._argcheck(*shapes), scale > 0) i1 = np.logical_and(i0, loc == 0) i2 = np.logical_and(i0, loc != 0) args = argsreduce(i0, *shapes, loc, scale) *shapes, loc, scale = args if (floor(n) != n): raise ValueError("Moment must be an integer.") if (n < 0): raise ValueError("Moment must be positive.") mu, mu2, g1, g2 = None, None, None, None if (n > 0) and (n < 5): if self._stats_has_moments: mdict = {'moments': {1: 'm', 2: 'v', 3: 'vs', 4: 'vk'}[n]} else: mdict = {} mu, mu2, g1, g2 = self._stats(*shapes, **mdict) val = np.empty(loc.shape) # val needs to be indexed by loc val[...] = _moment_from_stats(n, mu, mu2, g1, g2, self._munp, shapes) # Convert to transformed X = L + S*Y # E[X^n] = E[(L+S*Y)^n] = L^n sum(comb(n, k)*(S/L)^k E[Y^k], k=0...n) result = zeros(i0.shape) place(result, ~i0, self.badvalue) if i1.any(): res1 = scale[loc == 0]**n * val[loc == 0] place(result, i1, res1) if i2.any(): mom = [mu, mu2, g1, g2] arrs = [i for i in mom if i is not None] idx = [i for i in range(4) if mom[i] is not None] if any(idx): arrs = argsreduce(loc != 0, *arrs) j = 0 for i in idx: mom[i] = arrs[j] j += 1 mu, mu2, g1, g2 = mom args = argsreduce(loc != 0, *shapes, loc, scale, val) *shapes, loc, scale, val = args res2 = zeros(loc.shape, dtype='d') fac = scale / loc for k in range(n): valk = _moment_from_stats(k, mu, mu2, g1, g2, self._munp, shapes) res2 += comb(n, k, exact=True)*fac**k * valk res2 += fac**n * val res2 *= loc**n place(result, i2, res2) if result.ndim == 0: return result.item() return result def median(self, *args, **kwds): """Median of the distribution. Parameters ---------- arg1, arg2, arg3,... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information) loc : array_like, optional Location parameter, Default is 0. scale : array_like, optional Scale parameter, Default is 1. Returns ------- median : float The median of the distribution. See Also -------- rv_discrete.ppf Inverse of the CDF """ return self.ppf(0.5, *args, **kwds) def mean(self, *args, **kwds): """Mean of the distribution. Parameters ---------- arg1, arg2, arg3,... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information) loc : array_like, optional location parameter (default=0) scale : array_like, optional scale parameter (default=1) Returns ------- mean : float the mean of the distribution """ kwds['moments'] = 'm' res = self.stats(*args, **kwds) if isinstance(res, ndarray) and res.ndim == 0: return res[()] return res def var(self, *args, **kwds): """Variance of the distribution. Parameters ---------- arg1, arg2, arg3,... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information) loc : array_like, optional location parameter (default=0) scale : array_like, optional scale parameter (default=1) Returns ------- var : float the variance of the distribution """ kwds['moments'] = 'v' res = self.stats(*args, **kwds) if isinstance(res, ndarray) and res.ndim == 0: return res[()] return res def std(self, *args, **kwds): """Standard deviation of the distribution. Parameters ---------- arg1, arg2, arg3,... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information) loc : array_like, optional location parameter (default=0) scale : array_like, optional scale parameter (default=1) Returns ------- std : float standard deviation of the distribution """ kwds['moments'] = 'v' res = sqrt(self.stats(*args, **kwds)) return res def interval(self, confidence=None, *args, **kwds): """Confidence interval with equal areas around the median. .. deprecated:: 1.9.0 Parameter `alpha` is replaced by parameter `confidence` to avoid name collisions with the shape parameter `alpha` of some distributions. Parameter `alpha` will be removed in the second release after 1.9.0. Parameters ---------- confidence : array_like of float Probability that an rv will be drawn from the returned range. Each value should be in the range [0, 1]. arg1, arg2, ... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information). loc : array_like, optional location parameter, Default is 0. scale : array_like, optional scale parameter, Default is 1. Returns ------- a, b : ndarray of float end-points of range that contain ``100 * alpha %`` of the rv's possible values. """ # This function was originally written with parameter `alpha`, but # `alpha` is also the name of a shape parameter of two distributions. # This block allows the function to accept both `alpha` and its # replacement `confidence` during a deprecation period; it can be # removed in the second release after 1.9.0. # See description of logic in `moment` method. has_shape_alpha = (self.shapes is not None and "alpha" in (self.shapes.split(", "))) got_confidence = confidence is not None got_keyword_alpha = kwds.get("alpha", None) is not None if not got_confidence and ((not got_keyword_alpha) or (got_keyword_alpha and has_shape_alpha)): message = ("interval() missing 1 required positional argument: " "`confidence`") raise TypeError(message) if got_keyword_alpha and not has_shape_alpha: if got_confidence: # this will change to "interval got unexpected argument alpha" message = "interval() got multiple values for first argument" raise TypeError(message) else: message = ("Use of keyword argument `alpha` for method " "`interval` is deprecated. Use first positional " "argument or keyword argument `confidence` " "instead.") confidence = kwds.pop("alpha") warnings.warn(message, DeprecationWarning, stacklevel=2) alpha = confidence alpha = asarray(alpha) if np.any((alpha > 1) | (alpha < 0)): raise ValueError("alpha must be between 0 and 1 inclusive") q1 = (1.0-alpha)/2 q2 = (1.0+alpha)/2 a = self.ppf(q1, *args, **kwds) b = self.ppf(q2, *args, **kwds) return a, b def support(self, *args, **kwargs): """Support of the distribution. Parameters ---------- arg1, arg2, ... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information). loc : array_like, optional location parameter, Default is 0. scale : array_like, optional scale parameter, Default is 1. Returns ------- a, b : array_like end-points of the distribution's support. """ args, loc, scale = self._parse_args(*args, **kwargs) arrs = np.broadcast_arrays(*args, loc, scale) args, loc, scale = arrs[:-2], arrs[-2], arrs[-1] cond = self._argcheck(*args) & (scale > 0) _a, _b = self._get_support(*args) if cond.all(): return _a * scale + loc, _b * scale + loc elif cond.ndim == 0: return self.badvalue, self.badvalue # promote bounds to at least float to fill in the badvalue _a, _b = np.asarray(_a).astype('d'), np.asarray(_b).astype('d') out_a, out_b = _a * scale + loc, _b * scale + loc place(out_a, 1-cond, self.badvalue) place(out_b, 1-cond, self.badvalue) return out_a, out_b def nnlf(self, theta, x): """Negative loglikelihood function. Notes ----- This is ``-sum(log pdf(x, theta), axis=0)`` where `theta` are the parameters (including loc and scale). """ loc, scale, args = self._unpack_loc_scale(theta) if not self._argcheck(*args) or scale <= 0: return inf x = asarray((x-loc) / scale) n_log_scale = len(x) * log(scale) if np.any(~self._support_mask(x, *args)): return inf return self._nnlf(x, *args) + n_log_scale def _nnlf(self, x, *args): return -np.sum(self._logpxf(x, *args), axis=0) def _nnlf_and_penalty(self, x, args): cond0 = ~self._support_mask(x, *args) n_bad = np.count_nonzero(cond0, axis=0) if n_bad > 0: x = argsreduce(~cond0, x)[0] logpxf = self._logpxf(x, *args) finite_logpxf = np.isfinite(logpxf) n_bad += np.sum(~finite_logpxf, axis=0) if n_bad > 0: penalty = n_bad * log(_XMAX) * 100 return -np.sum(logpxf[finite_logpxf], axis=0) + penalty return -np.sum(logpxf, axis=0) def _penalized_nnlf(self, theta, x): """Penalized negative loglikelihood function. i.e., - sum (log pdf(x, theta), axis=0) + penalty where theta are the parameters (including loc and scale) """ loc, scale, args = self._unpack_loc_scale(theta) if not self._argcheck(*args) or scale <= 0: return inf x = asarray((x-loc) / scale) n_log_scale = len(x) * log(scale) return self._nnlf_and_penalty(x, args) + n_log_scale class _ShapeInfo: def __init__(self, name, integrality=False, domain=(-np.inf, np.inf), inclusive=(True, True)): self.name = name self.integrality = integrality domain = list(domain) if np.isfinite(domain[0]) and not inclusive[0]: domain[0] = np.nextafter(domain[0], np.inf) if np.isfinite(domain[1]) and not inclusive[1]: domain[1] = np.nextafter(domain[1], -np.inf) self.domain = domain def _get_fixed_fit_value(kwds, names): """ Given names such as `['f0', 'fa', 'fix_a']`, check that there is at most one non-None value in `kwds` associaed with those names. Return that value, or None if none of the names occur in `kwds`. As a side effect, all occurrences of those names in `kwds` are removed. """ vals = [(name, kwds.pop(name)) for name in names if name in kwds] if len(vals) > 1: repeated = [name for name, val in vals] raise ValueError("fit method got multiple keyword arguments to " "specify the same fixed parameter: " + ', '.join(repeated)) return vals[0][1] if vals else None # continuous random variables: implement maybe later # # hf --- Hazard Function (PDF / SF) # chf --- Cumulative hazard function (-log(SF)) # psf --- Probability sparsity function (reciprocal of the pdf) in # units of percent-point-function (as a function of q). # Also, the derivative of the percent-point function. class rv_continuous(rv_generic): """A generic continuous random variable class meant for subclassing. `rv_continuous` is a base class to construct specific distribution classes and instances for continuous random variables. It cannot be used directly as a distribution. Parameters ---------- momtype : int, optional The type of generic moment calculation to use: 0 for pdf, 1 (default) for ppf. a : float, optional Lower bound of the support of the distribution, default is minus infinity. b : float, optional Upper bound of the support of the distribution, default is plus infinity. xtol : float, optional The tolerance for fixed point calculation for generic ppf. badvalue : float, optional The value in a result arrays that indicates a value that for which some argument restriction is violated, default is np.nan. name : str, optional The name of the instance. This string is used to construct the default example for distributions. longname : str, optional This string is used as part of the first line of the docstring returned when a subclass has no docstring of its own. Note: `longname` exists for backwards compatibility, do not use for new subclasses. shapes : str, optional The shape of the distribution. For example ``"m, n"`` for a distribution that takes two integers as the two shape arguments for all its methods. If not provided, shape parameters will be inferred from the signature of the private methods, ``_pdf`` and ``_cdf`` of the instance. extradoc : str, optional, deprecated This string is used as the last part of the docstring returned when a subclass has no docstring of its own. Note: `extradoc` exists for backwards compatibility, do not use for new subclasses. seed : {None, int, `numpy.random.Generator`, `numpy.random.RandomState`}, optional If `seed` is None (or `np.random`), the `numpy.random.RandomState` singleton is used. If `seed` is an int, a new ``RandomState`` instance is used, seeded with `seed`. If `seed` is already a ``Generator`` or ``RandomState`` instance then that instance is used. Methods ------- rvs pdf logpdf cdf logcdf sf logsf ppf isf moment stats entropy expect median mean std var interval __call__ fit fit_loc_scale nnlf support Notes ----- Public methods of an instance of a distribution class (e.g., ``pdf``, ``cdf``) check their arguments and pass valid arguments to private, computational methods (``_pdf``, ``_cdf``). For ``pdf(x)``, ``x`` is valid if it is within the support of the distribution. Whether a shape parameter is valid is decided by an ``_argcheck`` method (which defaults to checking that its arguments are strictly positive.) **Subclassing** New random variables can be defined by subclassing the `rv_continuous` class and re-defining at least the ``_pdf`` or the ``_cdf`` method (normalized to location 0 and scale 1). If positive argument checking is not correct for your RV then you will also need to re-define the ``_argcheck`` method. For most of the scipy.stats distributions, the support interval doesn't depend on the shape parameters. ``x`` being in the support interval is equivalent to ``self.a <= x <= self.b``. If either of the endpoints of the support do depend on the shape parameters, then i) the distribution must implement the ``_get_support`` method; and ii) those dependent endpoints must be omitted from the distribution's call to the ``rv_continuous`` initializer. Correct, but potentially slow defaults exist for the remaining methods but for speed and/or accuracy you can over-ride:: _logpdf, _cdf, _logcdf, _ppf, _rvs, _isf, _sf, _logsf The default method ``_rvs`` relies on the inverse of the cdf, ``_ppf``, applied to a uniform random variate. In order to generate random variates efficiently, either the default ``_ppf`` needs to be overwritten (e.g. if the inverse cdf can expressed in an explicit form) or a sampling method needs to be implemented in a custom ``_rvs`` method. If possible, you should override ``_isf``, ``_sf`` or ``_logsf``. The main reason would be to improve numerical accuracy: for example, the survival function ``_sf`` is computed as ``1 - _cdf`` which can result in loss of precision if ``_cdf(x)`` is close to one. **Methods that can be overwritten by subclasses** :: _rvs _pdf _cdf _sf _ppf _isf _stats _munp _entropy _argcheck _get_support There are additional (internal and private) generic methods that can be useful for cross-checking and for debugging, but might work in all cases when directly called. A note on ``shapes``: subclasses need not specify them explicitly. In this case, `shapes` will be automatically deduced from the signatures of the overridden methods (`pdf`, `cdf` etc). If, for some reason, you prefer to avoid relying on introspection, you can specify ``shapes`` explicitly as an argument to the instance constructor. **Frozen Distributions** Normally, you must provide shape parameters (and, optionally, location and scale parameters to each call of a method of a distribution. Alternatively, the object may be called (as a function) to fix the shape, location, and scale parameters returning a "frozen" continuous RV object: rv = generic(<shape(s)>, loc=0, scale=1) `rv_frozen` object with the same methods but holding the given shape, location, and scale fixed **Statistics** Statistics are computed using numerical integration by default. For speed you can redefine this using ``_stats``: - take shape parameters and return mu, mu2, g1, g2 - If you can't compute one of these, return it as None - Can also be defined with a keyword argument ``moments``, which is a string composed of "m", "v", "s", and/or "k". Only the components appearing in string should be computed and returned in the order "m", "v", "s", or "k" with missing values returned as None. Alternatively, you can override ``_munp``, which takes ``n`` and shape parameters and returns the n-th non-central moment of the distribution. Examples -------- To create a new Gaussian distribution, we would do the following: >>> from scipy.stats import rv_continuous >>> class gaussian_gen(rv_continuous): ... "Gaussian distribution" ... def _pdf(self, x): ... return np.exp(-x**2 / 2.) / np.sqrt(2.0 * np.pi) >>> gaussian = gaussian_gen(name='gaussian') ``scipy.stats`` distributions are *instances*, so here we subclass `rv_continuous` and create an instance. With this, we now have a fully functional distribution with all relevant methods automagically generated by the framework. Note that above we defined a standard normal distribution, with zero mean and unit variance. Shifting and scaling of the distribution can be done by using ``loc`` and ``scale`` parameters: ``gaussian.pdf(x, loc, scale)`` essentially computes ``y = (x - loc) / scale`` and ``gaussian._pdf(y) / scale``. """ def __init__(self, momtype=1, a=None, b=None, xtol=1e-14, badvalue=None, name=None, longname=None, shapes=None, extradoc=None, seed=None): super().__init__(seed) # save the ctor parameters, cf generic freeze self._ctor_param = dict( momtype=momtype, a=a, b=b, xtol=xtol, badvalue=badvalue, name=name, longname=longname, shapes=shapes, extradoc=extradoc, seed=seed) if badvalue is None: badvalue = nan if name is None: name = 'Distribution' self.badvalue = badvalue self.name = name self.a = a self.b = b if a is None: self.a = -inf if b is None: self.b = inf self.xtol = xtol self.moment_type = momtype self.shapes = shapes self.extradoc = extradoc self._construct_argparser(meths_to_inspect=[self._pdf, self._cdf], locscale_in='loc=0, scale=1', locscale_out='loc, scale') self._attach_methods() if longname is None: if name[0] in ['aeiouAEIOU']: hstr = "An " else: hstr = "A " longname = hstr + name if sys.flags.optimize < 2: # Skip adding docstrings if interpreter is run with -OO if self.__doc__ is None: self._construct_default_doc(longname=longname, extradoc=extradoc, docdict=docdict, discrete='continuous') else: dct = dict(distcont) self._construct_doc(docdict, dct.get(self.name)) def __getstate__(self): dct = self.__dict__.copy() # these methods will be remade in __setstate__ # _random_state attribute is taken care of by rv_generic attrs = ["_parse_args", "_parse_args_stats", "_parse_args_rvs", "_cdfvec", "_ppfvec", "vecentropy", "generic_moment"] [dct.pop(attr, None) for attr in attrs] return dct def _attach_methods(self): """ Attaches dynamically created methods to the rv_continuous instance. """ # _attach_methods is responsible for calling _attach_argparser_methods self._attach_argparser_methods() # nin correction self._ppfvec = vectorize(self._ppf_single, otypes='d') self._ppfvec.nin = self.numargs + 1 self.vecentropy = vectorize(self._entropy, otypes='d') self._cdfvec = vectorize(self._cdf_single, otypes='d') self._cdfvec.nin = self.numargs + 1 if self.moment_type == 0: self.generic_moment = vectorize(self._mom0_sc, otypes='d') else: self.generic_moment = vectorize(self._mom1_sc, otypes='d') # Because of the *args argument of _mom0_sc, vectorize cannot count the # number of arguments correctly. self.generic_moment.nin = self.numargs + 1 def _updated_ctor_param(self): """Return the current version of _ctor_param, possibly updated by user. Used by freezing. Keep this in sync with the signature of __init__. """ dct = self._ctor_param.copy() dct['a'] = self.a dct['b'] = self.b dct['xtol'] = self.xtol dct['badvalue'] = self.badvalue dct['name'] = self.name dct['shapes'] = self.shapes dct['extradoc'] = self.extradoc return dct def _ppf_to_solve(self, x, q, *args): return self.cdf(*(x, )+args)-q def _ppf_single(self, q, *args): factor = 10. left, right = self._get_support(*args) if np.isinf(left): left = min(-factor, right) while self._ppf_to_solve(left, q, *args) > 0.: left, right = left * factor, left # left is now such that cdf(left) <= q # if right has changed, then cdf(right) > q if np.isinf(right): right = max(factor, left) while self._ppf_to_solve(right, q, *args) < 0.: left, right = right, right * factor # right is now such that cdf(right) >= q return optimize.brentq(self._ppf_to_solve, left, right, args=(q,)+args, xtol=self.xtol) # moment from definition def _mom_integ0(self, x, m, *args): return x**m * self.pdf(x, *args) def _mom0_sc(self, m, *args): _a, _b = self._get_support(*args) return integrate.quad(self._mom_integ0, _a, _b, args=(m,)+args)[0] # moment calculated using ppf def _mom_integ1(self, q, m, *args): return (self.ppf(q, *args))**m def _mom1_sc(self, m, *args): return integrate.quad(self._mom_integ1, 0, 1, args=(m,)+args)[0] def _pdf(self, x, *args): return derivative(self._cdf, x, dx=1e-5, args=args, order=5) # Could also define any of these def _logpdf(self, x, *args): p = self._pdf(x, *args) with np.errstate(divide='ignore'): return log(p) def _logpxf(self, x, *args): # continuous distributions have PDF, discrete have PMF, but sometimes # the distinction doesn't matter. This lets us use `_logpxf` for both # discrete and continuous distributions. return self._logpdf(x, *args) def _cdf_single(self, x, *args): _a, _b = self._get_support(*args) return integrate.quad(self._pdf, _a, x, args=args)[0] def _cdf(self, x, *args): return self._cdfvec(x, *args) # generic _argcheck, _logcdf, _sf, _logsf, _ppf, _isf, _rvs are defined # in rv_generic def pdf(self, x, *args, **kwds): """Probability density function at x of the given RV. Parameters ---------- x : array_like quantiles arg1, arg2, arg3,... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information) loc : array_like, optional location parameter (default=0) scale : array_like, optional scale parameter (default=1) Returns ------- pdf : ndarray Probability density function evaluated at x """ args, loc, scale = self._parse_args(*args, **kwds) x, loc, scale = map(asarray, (x, loc, scale)) args = tuple(map(asarray, args)) dtyp = np.find_common_type([x.dtype, np.float64], []) x = np.asarray((x - loc)/scale, dtype=dtyp) cond0 = self._argcheck(*args) & (scale > 0) cond1 = self._support_mask(x, *args) & (scale > 0) cond = cond0 & cond1 output = zeros(shape(cond), dtyp) putmask(output, (1-cond0)+np.isnan(x), self.badvalue) if np.any(cond): goodargs = argsreduce(cond, *((x,)+args+(scale,))) scale, goodargs = goodargs[-1], goodargs[:-1] place(output, cond, self._pdf(*goodargs) / scale) if output.ndim == 0: return output[()] return output def logpdf(self, x, *args, **kwds): """Log of the probability density function at x of the given RV. This uses a more numerically accurate calculation if available. Parameters ---------- x : array_like quantiles arg1, arg2, arg3,... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information) loc : array_like, optional location parameter (default=0) scale : array_like, optional scale parameter (default=1) Returns ------- logpdf : array_like Log of the probability density function evaluated at x """ args, loc, scale = self._parse_args(*args, **kwds) x, loc, scale = map(asarray, (x, loc, scale)) args = tuple(map(asarray, args)) dtyp = np.find_common_type([x.dtype, np.float64], []) x = np.asarray((x - loc)/scale, dtype=dtyp) cond0 = self._argcheck(*args) & (scale > 0) cond1 = self._support_mask(x, *args) & (scale > 0) cond = cond0 & cond1 output = empty(shape(cond), dtyp) output.fill(NINF) putmask(output, (1-cond0)+np.isnan(x), self.badvalue) if np.any(cond): goodargs = argsreduce(cond, *((x,)+args+(scale,))) scale, goodargs = goodargs[-1], goodargs[:-1] place(output, cond, self._logpdf(*goodargs) - log(scale)) if output.ndim == 0: return output[()] return output def cdf(self, x, *args, **kwds): """ Cumulative distribution function of the given RV. Parameters ---------- x : array_like quantiles arg1, arg2, arg3,... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information) loc : array_like, optional location parameter (default=0) scale : array_like, optional scale parameter (default=1) Returns ------- cdf : ndarray Cumulative distribution function evaluated at `x` """ args, loc, scale = self._parse_args(*args, **kwds) x, loc, scale = map(asarray, (x, loc, scale)) args = tuple(map(asarray, args)) _a, _b = self._get_support(*args) dtyp = np.find_common_type([x.dtype, np.float64], []) x = np.asarray((x - loc)/scale, dtype=dtyp) cond0 = self._argcheck(*args) & (scale > 0) cond1 = self._open_support_mask(x, *args) & (scale > 0) cond2 = (x >= np.asarray(_b)) & cond0 cond = cond0 & cond1 output = zeros(shape(cond), dtyp) place(output, (1-cond0)+np.isnan(x), self.badvalue) place(output, cond2, 1.0) if np.any(cond): # call only if at least 1 entry goodargs = argsreduce(cond, *((x,)+args)) place(output, cond, self._cdf(*goodargs)) if output.ndim == 0: return output[()] return output def logcdf(self, x, *args, **kwds): """Log of the cumulative distribution function at x of the given RV. Parameters ---------- x : array_like quantiles arg1, arg2, arg3,... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information) loc : array_like, optional location parameter (default=0) scale : array_like, optional scale parameter (default=1) Returns ------- logcdf : array_like Log of the cumulative distribution function evaluated at x """ args, loc, scale = self._parse_args(*args, **kwds) x, loc, scale = map(asarray, (x, loc, scale)) args = tuple(map(asarray, args)) _a, _b = self._get_support(*args) dtyp = np.find_common_type([x.dtype, np.float64], []) x = np.asarray((x - loc)/scale, dtype=dtyp) cond0 = self._argcheck(*args) & (scale > 0) cond1 = self._open_support_mask(x, *args) & (scale > 0) cond2 = (x >= _b) & cond0 cond = cond0 & cond1 output = empty(shape(cond), dtyp) output.fill(NINF) place(output, (1-cond0)*(cond1 == cond1)+np.isnan(x), self.badvalue) place(output, cond2, 0.0) if np.any(cond): # call only if at least 1 entry goodargs = argsreduce(cond, *((x,)+args)) place(output, cond, self._logcdf(*goodargs)) if output.ndim == 0: return output[()] return output def sf(self, x, *args, **kwds): """Survival function (1 - `cdf`) at x of the given RV. Parameters ---------- x : array_like quantiles arg1, arg2, arg3,... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information) loc : array_like, optional location parameter (default=0) scale : array_like, optional scale parameter (default=1) Returns ------- sf : array_like Survival function evaluated at x """ args, loc, scale = self._parse_args(*args, **kwds) x, loc, scale = map(asarray, (x, loc, scale)) args = tuple(map(asarray, args)) _a, _b = self._get_support(*args) dtyp = np.find_common_type([x.dtype, np.float64], []) x = np.asarray((x - loc)/scale, dtype=dtyp) cond0 = self._argcheck(*args) & (scale > 0) cond1 = self._open_support_mask(x, *args) & (scale > 0) cond2 = cond0 & (x <= _a) cond = cond0 & cond1 output = zeros(shape(cond), dtyp) place(output, (1-cond0)+np.isnan(x), self.badvalue) place(output, cond2, 1.0) if np.any(cond): goodargs = argsreduce(cond, *((x,)+args)) place(output, cond, self._sf(*goodargs)) if output.ndim == 0: return output[()] return output def logsf(self, x, *args, **kwds): """Log of the survival function of the given RV. Returns the log of the "survival function," defined as (1 - `cdf`), evaluated at `x`. Parameters ---------- x : array_like quantiles arg1, arg2, arg3,... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information) loc : array_like, optional location parameter (default=0) scale : array_like, optional scale parameter (default=1) Returns ------- logsf : ndarray Log of the survival function evaluated at `x`. """ args, loc, scale = self._parse_args(*args, **kwds) x, loc, scale = map(asarray, (x, loc, scale)) args = tuple(map(asarray, args)) _a, _b = self._get_support(*args) dtyp = np.find_common_type([x.dtype, np.float64], []) x = np.asarray((x - loc)/scale, dtype=dtyp) cond0 = self._argcheck(*args) & (scale > 0) cond1 = self._open_support_mask(x, *args) & (scale > 0) cond2 = cond0 & (x <= _a) cond = cond0 & cond1 output = empty(shape(cond), dtyp) output.fill(NINF) place(output, (1-cond0)+np.isnan(x), self.badvalue) place(output, cond2, 0.0) if np.any(cond): goodargs = argsreduce(cond, *((x,)+args)) place(output, cond, self._logsf(*goodargs)) if output.ndim == 0: return output[()] return output def ppf(self, q, *args, **kwds): """Percent point function (inverse of `cdf`) at q of the given RV. Parameters ---------- q : array_like lower tail probability arg1, arg2, arg3,... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information) loc : array_like, optional location parameter (default=0) scale : array_like, optional scale parameter (default=1) Returns ------- x : array_like quantile corresponding to the lower tail probability q. """ args, loc, scale = self._parse_args(*args, **kwds) q, loc, scale = map(asarray, (q, loc, scale)) args = tuple(map(asarray, args)) _a, _b = self._get_support(*args) cond0 = self._argcheck(*args) & (scale > 0) & (loc == loc) cond1 = (0 < q) & (q < 1) cond2 = cond0 & (q == 0) cond3 = cond0 & (q == 1) cond = cond0 & cond1 output = np.full(shape(cond), fill_value=self.badvalue) lower_bound = _a * scale + loc upper_bound = _b * scale + loc place(output, cond2, argsreduce(cond2, lower_bound)[0]) place(output, cond3, argsreduce(cond3, upper_bound)[0]) if np.any(cond): # call only if at least 1 entry goodargs = argsreduce(cond, *((q,)+args+(scale, loc))) scale, loc, goodargs = goodargs[-2], goodargs[-1], goodargs[:-2] place(output, cond, self._ppf(*goodargs) * scale + loc) if output.ndim == 0: return output[()] return output def isf(self, q, *args, **kwds): """Inverse survival function (inverse of `sf`) at q of the given RV. Parameters ---------- q : array_like upper tail probability arg1, arg2, arg3,... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information) loc : array_like, optional location parameter (default=0) scale : array_like, optional scale parameter (default=1) Returns ------- x : ndarray or scalar Quantile corresponding to the upper tail probability q. """ args, loc, scale = self._parse_args(*args, **kwds) q, loc, scale = map(asarray, (q, loc, scale)) args = tuple(map(asarray, args)) _a, _b = self._get_support(*args) cond0 = self._argcheck(*args) & (scale > 0) & (loc == loc) cond1 = (0 < q) & (q < 1) cond2 = cond0 & (q == 1) cond3 = cond0 & (q == 0) cond = cond0 & cond1 output = np.full(shape(cond), fill_value=self.badvalue) lower_bound = _a * scale + loc upper_bound = _b * scale + loc place(output, cond2, argsreduce(cond2, lower_bound)[0]) place(output, cond3, argsreduce(cond3, upper_bound)[0]) if np.any(cond): goodargs = argsreduce(cond, *((q,)+args+(scale, loc))) scale, loc, goodargs = goodargs[-2], goodargs[-1], goodargs[:-2] place(output, cond, self._isf(*goodargs) * scale + loc) if output.ndim == 0: return output[()] return output def _unpack_loc_scale(self, theta): try: loc = theta[-2] scale = theta[-1] args = tuple(theta[:-2]) except IndexError as e: raise ValueError("Not enough input arguments.") from e return loc, scale, args def _fitstart(self, data, args=None): """Starting point for fit (shape arguments + loc + scale).""" if args is None: args = (1.0,)*self.numargs loc, scale = self._fit_loc_scale_support(data, *args) return args + (loc, scale) def _reduce_func(self, args, kwds, data=None): """ Return the (possibly reduced) function to optimize in order to find MLE estimates for the .fit method. """ # Convert fixed shape parameters to the standard numeric form: e.g. for # stats.beta, shapes='a, b'. To fix `a`, the caller can give a value # for `f0`, `fa` or 'fix_a'. The following converts the latter two # into the first (numeric) form. shapes = [] if self.shapes: shapes = self.shapes.replace(',', ' ').split() for j, s in enumerate(shapes): key = 'f' + str(j) names = [key, 'f' + s, 'fix_' + s] val = _get_fixed_fit_value(kwds, names) if val is not None: kwds[key] = val args = list(args) Nargs = len(args) fixedn = [] names = ['f%d' % n for n in range(Nargs - 2)] + ['floc', 'fscale'] x0 = [] for n, key in enumerate(names): if key in kwds: fixedn.append(n) args[n] = kwds.pop(key) else: x0.append(args[n]) methods = {"mle", "mm"} method = kwds.pop('method', "mle").lower() if method == "mm": n_params = len(shapes) + 2 - len(fixedn) exponents = (np.arange(1, n_params+1))[:, np.newaxis] data_moments = np.sum(data[None, :]**exponents/len(data), axis=1) def objective(theta, x): return self._moment_error(theta, x, data_moments) elif method == "mle": objective = self._penalized_nnlf else: raise ValueError("Method '{0}' not available; must be one of {1}" .format(method, methods)) if len(fixedn) == 0: func = objective restore = None else: if len(fixedn) == Nargs: raise ValueError( "All parameters fixed. There is nothing to optimize.") def restore(args, theta): # Replace with theta for all numbers not in fixedn # This allows the non-fixed values to vary, but # we still call self.nnlf with all parameters. i = 0 for n in range(Nargs): if n not in fixedn: args[n] = theta[i] i += 1 return args def func(theta, x): newtheta = restore(args[:], theta) return objective(newtheta, x) return x0, func, restore, args def _moment_error(self, theta, x, data_moments): loc, scale, args = self._unpack_loc_scale(theta) if not self._argcheck(*args) or scale <= 0: return inf dist_moments = np.array([self.moment(i+1, *args, loc=loc, scale=scale) for i in range(len(data_moments))]) if np.any(np.isnan(dist_moments)): raise ValueError("Method of moments encountered a non-finite " "distribution moment and cannot continue. " "Consider trying method='MLE'.") return (((data_moments - dist_moments) / np.maximum(np.abs(data_moments), 1e-8))**2).sum() def fit(self, data, *args, **kwds): """ Return estimates of shape (if applicable), location, and scale parameters from data. The default estimation method is Maximum Likelihood Estimation (MLE), but Method of Moments (MM) is also available. Starting estimates for the fit are given by input arguments; for any arguments not provided with starting estimates, ``self._fitstart(data)`` is called to generate such. One can hold some parameters fixed to specific values by passing in keyword arguments ``f0``, ``f1``, ..., ``fn`` (for shape parameters) and ``floc`` and ``fscale`` (for location and scale parameters, respectively). Parameters ---------- data : array_like Data to use in estimating the distribution parameters. arg1, arg2, arg3,... : floats, optional Starting value(s) for any shape-characterizing arguments (those not provided will be determined by a call to ``_fitstart(data)``). No default value. **kwds : floats, optional - `loc`: initial guess of the distribution's location parameter. - `scale`: initial guess of the distribution's scale parameter. Special keyword arguments are recognized as holding certain parameters fixed: - f0...fn : hold respective shape parameters fixed. Alternatively, shape parameters to fix can be specified by name. For example, if ``self.shapes == "a, b"``, ``fa`` and ``fix_a`` are equivalent to ``f0``, and ``fb`` and ``fix_b`` are equivalent to ``f1``. - floc : hold location parameter fixed to specified value. - fscale : hold scale parameter fixed to specified value. - optimizer : The optimizer to use. The optimizer must take ``func``, and starting position as the first two arguments, plus ``args`` (for extra arguments to pass to the function to be optimized) and ``disp=0`` to suppress output as keyword arguments. - method : The method to use. The default is "MLE" (Maximum Likelihood Estimate); "MM" (Method of Moments) is also available. Returns ------- parameter_tuple : tuple of floats Estimates for any shape parameters (if applicable), followed by those for location and scale. For most random variables, shape statistics will be returned, but there are exceptions (e.g. ``norm``). Notes ----- With ``method="MLE"`` (default), the fit is computed by minimizing the negative log-likelihood function. A large, finite penalty (rather than infinite negative log-likelihood) is applied for observations beyond the support of the distribution. With ``method="MM"``, the fit is computed by minimizing the L2 norm of the relative errors between the first *k* raw (about zero) data moments and the corresponding distribution moments, where *k* is the number of non-fixed parameters. More precisely, the objective function is:: (((data_moments - dist_moments) / np.maximum(np.abs(data_moments), 1e-8))**2).sum() where the constant ``1e-8`` avoids division by zero in case of vanishing data moments. Typically, this error norm can be reduced to zero. Note that the standard method of moments can produce parameters for which some data are outside the support of the fitted distribution; this implementation does nothing to prevent this. For either method, the returned answer is not guaranteed to be globally optimal; it may only be locally optimal, or the optimization may fail altogether. If the data contain any of ``np.nan``, ``np.inf``, or ``-np.inf``, the `fit` method will raise a ``RuntimeError``. Examples -------- Generate some data to fit: draw random variates from the `beta` distribution >>> from scipy.stats import beta >>> a, b = 1., 2. >>> x = beta.rvs(a, b, size=1000) Now we can fit all four parameters (``a``, ``b``, ``loc`` and ``scale``): >>> a1, b1, loc1, scale1 = beta.fit(x) We can also use some prior knowledge about the dataset: let's keep ``loc`` and ``scale`` fixed: >>> a1, b1, loc1, scale1 = beta.fit(x, floc=0, fscale=1) >>> loc1, scale1 (0, 1) We can also keep shape parameters fixed by using ``f``-keywords. To keep the zero-th shape parameter ``a`` equal 1, use ``f0=1`` or, equivalently, ``fa=1``: >>> a1, b1, loc1, scale1 = beta.fit(x, fa=1, floc=0, fscale=1) >>> a1 1 Not all distributions return estimates for the shape parameters. ``norm`` for example just returns estimates for location and scale: >>> from scipy.stats import norm >>> x = norm.rvs(a, b, size=1000, random_state=123) >>> loc1, scale1 = norm.fit(x) >>> loc1, scale1 (0.92087172783841631, 2.0015750750324668) """ data = np.asarray(data) method = kwds.get('method', "mle").lower() # memory for method of moments Narg = len(args) if Narg > self.numargs: raise TypeError("Too many input arguments.") if not np.isfinite(data).all(): raise RuntimeError("The data contains non-finite values.") start = [None]*2 if (Narg < self.numargs) or not ('loc' in kwds and 'scale' in kwds): # get distribution specific starting locations start = self._fitstart(data) args += start[Narg:-2] loc = kwds.pop('loc', start[-2]) scale = kwds.pop('scale', start[-1]) args += (loc, scale) x0, func, restore, args = self._reduce_func(args, kwds, data=data) optimizer = kwds.pop('optimizer', optimize.fmin) # convert string to function in scipy.optimize optimizer = _fit_determine_optimizer(optimizer) # by now kwds must be empty, since everybody took what they needed if kwds: raise TypeError("Unknown arguments: %s." % kwds) # In some cases, method of moments can be done with fsolve/root # instead of an optimizer, but sometimes no solution exists, # especially when the user fixes parameters. Minimizing the sum # of squares of the error generalizes to these cases. vals = optimizer(func, x0, args=(ravel(data),), disp=0) obj = func(vals, data) if restore is not None: vals = restore(args, vals) vals = tuple(vals) loc, scale, shapes = self._unpack_loc_scale(vals) if not (np.all(self._argcheck(*shapes)) and scale > 0): raise Exception("Optimization converged to parameters that are " "outside the range allowed by the distribution.") if method == 'mm': if not np.isfinite(obj): raise Exception("Optimization failed: either a data moment " "or fitted distribution moment is " "non-finite.") return vals def _fit_loc_scale_support(self, data, *args): """Estimate loc and scale parameters from data accounting for support. Parameters ---------- data : array_like Data to fit. arg1, arg2, arg3,... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information). Returns ------- Lhat : float Estimated location parameter for the data. Shat : float Estimated scale parameter for the data. """ data = np.asarray(data) # Estimate location and scale according to the method of moments. loc_hat, scale_hat = self.fit_loc_scale(data, *args) # Compute the support according to the shape parameters. self._argcheck(*args) _a, _b = self._get_support(*args) a, b = _a, _b support_width = b - a # If the support is empty then return the moment-based estimates. if support_width <= 0: return loc_hat, scale_hat # Compute the proposed support according to the loc and scale # estimates. a_hat = loc_hat + a * scale_hat b_hat = loc_hat + b * scale_hat # Use the moment-based estimates if they are compatible with the data. data_a = np.min(data) data_b = np.max(data) if a_hat < data_a and data_b < b_hat: return loc_hat, scale_hat # Otherwise find other estimates that are compatible with the data. data_width = data_b - data_a rel_margin = 0.1 margin = data_width * rel_margin # For a finite interval, both the location and scale # should have interesting values. if support_width < np.inf: loc_hat = (data_a - a) - margin scale_hat = (data_width + 2 * margin) / support_width return loc_hat, scale_hat # For a one-sided interval, use only an interesting location parameter. if a > -np.inf: return (data_a - a) - margin, 1 elif b < np.inf: return (data_b - b) + margin, 1 else: raise RuntimeError def fit_loc_scale(self, data, *args): """ Estimate loc and scale parameters from data using 1st and 2nd moments. Parameters ---------- data : array_like Data to fit. arg1, arg2, arg3,... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information). Returns ------- Lhat : float Estimated location parameter for the data. Shat : float Estimated scale parameter for the data. """ mu, mu2 = self.stats(*args, **{'moments': 'mv'}) tmp = asarray(data) muhat = tmp.mean() mu2hat = tmp.var() Shat = sqrt(mu2hat / mu2) Lhat = muhat - Shat*mu if not np.isfinite(Lhat): Lhat = 0 if not (np.isfinite(Shat) and (0 < Shat)): Shat = 1 return Lhat, Shat def _entropy(self, *args): def integ(x): val = self._pdf(x, *args) return entr(val) # upper limit is often inf, so suppress warnings when integrating _a, _b = self._get_support(*args) with np.errstate(over='ignore'): h = integrate.quad(integ, _a, _b)[0] if not np.isnan(h): return h else: # try with different limits if integration problems low, upp = self.ppf([1e-10, 1. - 1e-10], *args) if np.isinf(_b): upper = upp else: upper = _b if np.isinf(_a): lower = low else: lower = _a return integrate.quad(integ, lower, upper)[0] def expect(self, func=None, args=(), loc=0, scale=1, lb=None, ub=None, conditional=False, **kwds): """Calculate expected value of a function with respect to the distribution by numerical integration. The expected value of a function ``f(x)`` with respect to a distribution ``dist`` is defined as:: ub E[f(x)] = Integral(f(x) * dist.pdf(x)), lb where ``ub`` and ``lb`` are arguments and ``x`` has the ``dist.pdf(x)`` distribution. If the bounds ``lb`` and ``ub`` correspond to the support of the distribution, e.g. ``[-inf, inf]`` in the default case, then the integral is the unrestricted expectation of ``f(x)``. Also, the function ``f(x)`` may be defined such that ``f(x)`` is ``0`` outside a finite interval in which case the expectation is calculated within the finite range ``[lb, ub]``. Parameters ---------- func : callable, optional Function for which integral is calculated. Takes only one argument. The default is the identity mapping f(x) = x. args : tuple, optional Shape parameters of the distribution. loc : float, optional Location parameter (default=0). scale : float, optional Scale parameter (default=1). lb, ub : scalar, optional Lower and upper bound for integration. Default is set to the support of the distribution. conditional : bool, optional If True, the integral is corrected by the conditional probability of the integration interval. The return value is the expectation of the function, conditional on being in the given interval. Default is False. Additional keyword arguments are passed to the integration routine. Returns ------- expect : float The calculated expected value. Notes ----- The integration behavior of this function is inherited from `scipy.integrate.quad`. Neither this function nor `scipy.integrate.quad` can verify whether the integral exists or is finite. For example ``cauchy(0).mean()`` returns ``np.nan`` and ``cauchy(0).expect()`` returns ``0.0``. The function is not vectorized. Examples -------- To understand the effect of the bounds of integration consider >>> from scipy.stats import expon >>> expon(1).expect(lambda x: 1, lb=0.0, ub=2.0) 0.6321205588285578 This is close to >>> expon(1).cdf(2.0) - expon(1).cdf(0.0) 0.6321205588285577 If ``conditional=True`` >>> expon(1).expect(lambda x: 1, lb=0.0, ub=2.0, conditional=True) 1.0000000000000002 The slight deviation from 1 is due to numerical integration. """ lockwds = {'loc': loc, 'scale': scale} self._argcheck(*args) _a, _b = self._get_support(*args) if func is None: def fun(x, *args): return x * self.pdf(x, *args, **lockwds) else: def fun(x, *args): return func(x) * self.pdf(x, *args, **lockwds) if lb is None: lb = loc + _a * scale if ub is None: ub = loc + _b * scale if conditional: invfac = (self.sf(lb, *args, **lockwds) - self.sf(ub, *args, **lockwds)) else: invfac = 1.0 kwds['args'] = args # Silence floating point warnings from integration. with np.errstate(all='ignore'): vals = integrate.quad(fun, lb, ub, **kwds)[0] / invfac return vals def _param_info(self): shape_info = self._shape_info() loc_info = _ShapeInfo("loc", False, (-np.inf, np.inf), (False, False)) scale_info = _ShapeInfo("scale", False, (0, np.inf), (False, False)) param_info = shape_info + [loc_info, scale_info] return param_info # Helpers for the discrete distributions def _drv2_moment(self, n, *args): """Non-central moment of discrete distribution.""" def fun(x): return np.power(x, n) * self._pmf(x, *args) _a, _b = self._get_support(*args) return _expect(fun, _a, _b, self.ppf(0.5, *args), self.inc) def _drv2_ppfsingle(self, q, *args): # Use basic bisection algorithm _a, _b = self._get_support(*args) b = _b a = _a if isinf(b): # Be sure ending point is > q b = int(max(100*q, 10)) while 1: if b >= _b: qb = 1.0 break qb = self._cdf(b, *args) if (qb < q): b += 10 else: break else: qb = 1.0 if isinf(a): # be sure starting point < q a = int(min(-100*q, -10)) while 1: if a <= _a: qb = 0.0 break qa = self._cdf(a, *args) if (qa > q): a -= 10 else: break else: qa = self._cdf(a, *args) while 1: if (qa == q): return a if (qb == q): return b if b <= a+1: if qa > q: return a else: return b c = int((a+b)/2.0) qc = self._cdf(c, *args) if (qc < q): if a != c: a = c else: raise RuntimeError('updating stopped, endless loop') qa = qc elif (qc > q): if b != c: b = c else: raise RuntimeError('updating stopped, endless loop') qb = qc else: return c # Must over-ride one of _pmf or _cdf or pass in # x_k, p(x_k) lists in initialization class rv_discrete(rv_generic): """A generic discrete random variable class meant for subclassing. `rv_discrete` is a base class to construct specific distribution classes and instances for discrete random variables. It can also be used to construct an arbitrary distribution defined by a list of support points and corresponding probabilities. Parameters ---------- a : float, optional Lower bound of the support of the distribution, default: 0 b : float, optional Upper bound of the support of the distribution, default: plus infinity moment_tol : float, optional The tolerance for the generic calculation of moments. values : tuple of two array_like, optional ``(xk, pk)`` where ``xk`` are integers and ``pk`` are the non-zero probabilities between 0 and 1 with ``sum(pk) = 1``. ``xk`` and ``pk`` must have the same shape. inc : integer, optional Increment for the support of the distribution. Default is 1. (other values have not been tested) badvalue : float, optional The value in a result arrays that indicates a value that for which some argument restriction is violated, default is np.nan. name : str, optional The name of the instance. This string is used to construct the default example for distributions. longname : str, optional This string is used as part of the first line of the docstring returned when a subclass has no docstring of its own. Note: `longname` exists for backwards compatibility, do not use for new subclasses. shapes : str, optional The shape of the distribution. For example "m, n" for a distribution that takes two integers as the two shape arguments for all its methods If not provided, shape parameters will be inferred from the signatures of the private methods, ``_pmf`` and ``_cdf`` of the instance. extradoc : str, optional This string is used as the last part of the docstring returned when a subclass has no docstring of its own. Note: `extradoc` exists for backwards compatibility, do not use for new subclasses. seed : {None, int, `numpy.random.Generator`, `numpy.random.RandomState`}, optional If `seed` is None (or `np.random`), the `numpy.random.RandomState` singleton is used. If `seed` is an int, a new ``RandomState`` instance is used, seeded with `seed`. If `seed` is already a ``Generator`` or ``RandomState`` instance then that instance is used. Methods ------- rvs pmf logpmf cdf logcdf sf logsf ppf isf moment stats entropy expect median mean std var interval __call__ support Notes ----- This class is similar to `rv_continuous`. Whether a shape parameter is valid is decided by an ``_argcheck`` method (which defaults to checking that its arguments are strictly positive.) The main differences are: - the support of the distribution is a set of integers - instead of the probability density function, ``pdf`` (and the corresponding private ``_pdf``), this class defines the *probability mass function*, `pmf` (and the corresponding private ``_pmf``.) - scale parameter is not defined. To create a new discrete distribution, we would do the following: >>> from scipy.stats import rv_discrete >>> class poisson_gen(rv_discrete): ... "Poisson distribution" ... def _pmf(self, k, mu): ... return exp(-mu) * mu**k / factorial(k) and create an instance:: >>> poisson = poisson_gen(name="poisson") Note that above we defined the Poisson distribution in the standard form. Shifting the distribution can be done by providing the ``loc`` parameter to the methods of the instance. For example, ``poisson.pmf(x, mu, loc)`` delegates the work to ``poisson._pmf(x-loc, mu)``. **Discrete distributions from a list of probabilities** Alternatively, you can construct an arbitrary discrete rv defined on a finite set of values ``xk`` with ``Prob{X=xk} = pk`` by using the ``values`` keyword argument to the `rv_discrete` constructor. Examples -------- Custom made discrete distribution: >>> from scipy import stats >>> xk = np.arange(7) >>> pk = (0.1, 0.2, 0.3, 0.1, 0.1, 0.0, 0.2) >>> custm = stats.rv_discrete(name='custm', values=(xk, pk)) >>> >>> import matplotlib.pyplot as plt >>> fig, ax = plt.subplots(1, 1) >>> ax.plot(xk, custm.pmf(xk), 'ro', ms=12, mec='r') >>> ax.vlines(xk, 0, custm.pmf(xk), colors='r', lw=4) >>> plt.show() Random number generation: >>> R = custm.rvs(size=100) """ def __new__(cls, a=0, b=inf, name=None, badvalue=None, moment_tol=1e-8, values=None, inc=1, longname=None, shapes=None, extradoc=None, seed=None): if values is not None: # dispatch to a subclass return super(rv_discrete, cls).__new__(rv_sample) else: # business as usual return super(rv_discrete, cls).__new__(cls) def __init__(self, a=0, b=inf, name=None, badvalue=None, moment_tol=1e-8, values=None, inc=1, longname=None, shapes=None, extradoc=None, seed=None): super().__init__(seed) # cf generic freeze self._ctor_param = dict( a=a, b=b, name=name, badvalue=badvalue, moment_tol=moment_tol, values=values, inc=inc, longname=longname, shapes=shapes, extradoc=extradoc, seed=seed) if badvalue is None: badvalue = nan self.badvalue = badvalue self.a = a self.b = b self.moment_tol = moment_tol self.inc = inc self.shapes = shapes if values is not None: raise ValueError("rv_discrete.__init__(..., values != None, ...)") self._construct_argparser(meths_to_inspect=[self._pmf, self._cdf], locscale_in='loc=0', # scale=1 for discrete RVs locscale_out='loc, 1') self._attach_methods() self._construct_docstrings(name, longname, extradoc) def __getstate__(self): dct = self.__dict__.copy() # these methods will be remade in __setstate__ attrs = ["_parse_args", "_parse_args_stats", "_parse_args_rvs", "_cdfvec", "_ppfvec", "generic_moment"] [dct.pop(attr, None) for attr in attrs] return dct def _attach_methods(self): """Attaches dynamically created methods to the rv_discrete instance.""" self._cdfvec = vectorize(self._cdf_single, otypes='d') self.vecentropy = vectorize(self._entropy) # _attach_methods is responsible for calling _attach_argparser_methods self._attach_argparser_methods() # nin correction needs to be after we know numargs # correct nin for generic moment vectorization _vec_generic_moment = vectorize(_drv2_moment, otypes='d') _vec_generic_moment.nin = self.numargs + 2 self.generic_moment = types.MethodType(_vec_generic_moment, self) # correct nin for ppf vectorization _vppf = vectorize(_drv2_ppfsingle, otypes='d') _vppf.nin = self.numargs + 2 self._ppfvec = types.MethodType(_vppf, self) # now that self.numargs is defined, we can adjust nin self._cdfvec.nin = self.numargs + 1 def _construct_docstrings(self, name, longname, extradoc): if name is None: name = 'Distribution' self.name = name self.extradoc = extradoc # generate docstring for subclass instances if longname is None: if name[0] in ['aeiouAEIOU']: hstr = "An " else: hstr = "A " longname = hstr + name if sys.flags.optimize < 2: # Skip adding docstrings if interpreter is run with -OO if self.__doc__ is None: self._construct_default_doc(longname=longname, extradoc=extradoc, docdict=docdict_discrete, discrete='discrete') else: dct = dict(distdiscrete) self._construct_doc(docdict_discrete, dct.get(self.name)) # discrete RV do not have the scale parameter, remove it self.__doc__ = self.__doc__.replace( '\n scale : array_like, ' 'optional\n scale parameter (default=1)', '') def _updated_ctor_param(self): """Return the current version of _ctor_param, possibly updated by user. Used by freezing. Keep this in sync with the signature of __init__. """ dct = self._ctor_param.copy() dct['a'] = self.a dct['b'] = self.b dct['badvalue'] = self.badvalue dct['moment_tol'] = self.moment_tol dct['inc'] = self.inc dct['name'] = self.name dct['shapes'] = self.shapes dct['extradoc'] = self.extradoc return dct def _nonzero(self, k, *args): return floor(k) == k def _pmf(self, k, *args): return self._cdf(k, *args) - self._cdf(k-1, *args) def _logpmf(self, k, *args): return log(self._pmf(k, *args)) def _logpxf(self, k, *args): # continuous distributions have PDF, discrete have PMF, but sometimes # the distinction doesn't matter. This lets us use `_logpxf` for both # discrete and continuous distributions. return self._logpmf(k, *args) def _unpack_loc_scale(self, theta): try: loc = theta[-1] scale = 1 args = tuple(theta[:-1]) except IndexError as e: raise ValueError("Not enough input arguments.") from e return loc, scale, args def _cdf_single(self, k, *args): _a, _b = self._get_support(*args) m = arange(int(_a), k+1) return np.sum(self._pmf(m, *args), axis=0) def _cdf(self, x, *args): k = floor(x) return self._cdfvec(k, *args) # generic _logcdf, _sf, _logsf, _ppf, _isf, _rvs defined in rv_generic def rvs(self, *args, **kwargs): """Random variates of given type. Parameters ---------- arg1, arg2, arg3,... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information). loc : array_like, optional Location parameter (default=0). size : int or tuple of ints, optional Defining number of random variates (Default is 1). Note that `size` has to be given as keyword, not as positional argument. random_state : {None, int, `numpy.random.Generator`, `numpy.random.RandomState`}, optional If `seed` is None (or `np.random`), the `numpy.random.RandomState` singleton is used. If `seed` is an int, a new ``RandomState`` instance is used, seeded with `seed`. If `seed` is already a ``Generator`` or ``RandomState`` instance then that instance is used. Returns ------- rvs : ndarray or scalar Random variates of given `size`. """ kwargs['discrete'] = True return super().rvs(*args, **kwargs) def pmf(self, k, *args, **kwds): """Probability mass function at k of the given RV. Parameters ---------- k : array_like Quantiles. arg1, arg2, arg3,... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information) loc : array_like, optional Location parameter (default=0). Returns ------- pmf : array_like Probability mass function evaluated at k """ args, loc, _ = self._parse_args(*args, **kwds) k, loc = map(asarray, (k, loc)) args = tuple(map(asarray, args)) _a, _b = self._get_support(*args) k = asarray((k-loc)) cond0 = self._argcheck(*args) cond1 = (k >= _a) & (k <= _b) & self._nonzero(k, *args) cond = cond0 & cond1 output = zeros(shape(cond), 'd') place(output, (1-cond0) + np.isnan(k), self.badvalue) if np.any(cond): goodargs = argsreduce(cond, *((k,)+args)) place(output, cond, np.clip(self._pmf(*goodargs), 0, 1)) if output.ndim == 0: return output[()] return output def logpmf(self, k, *args, **kwds): """Log of the probability mass function at k of the given RV. Parameters ---------- k : array_like Quantiles. arg1, arg2, arg3,... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information). loc : array_like, optional Location parameter. Default is 0. Returns ------- logpmf : array_like Log of the probability mass function evaluated at k. """ args, loc, _ = self._parse_args(*args, **kwds) k, loc = map(asarray, (k, loc)) args = tuple(map(asarray, args)) _a, _b = self._get_support(*args) k = asarray((k-loc)) cond0 = self._argcheck(*args) cond1 = (k >= _a) & (k <= _b) & self._nonzero(k, *args) cond = cond0 & cond1 output = empty(shape(cond), 'd') output.fill(NINF) place(output, (1-cond0) + np.isnan(k), self.badvalue) if np.any(cond): goodargs = argsreduce(cond, *((k,)+args)) place(output, cond, self._logpmf(*goodargs)) if output.ndim == 0: return output[()] return output def cdf(self, k, *args, **kwds): """Cumulative distribution function of the given RV. Parameters ---------- k : array_like, int Quantiles. arg1, arg2, arg3,... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information). loc : array_like, optional Location parameter (default=0). Returns ------- cdf : ndarray Cumulative distribution function evaluated at `k`. """ args, loc, _ = self._parse_args(*args, **kwds) k, loc = map(asarray, (k, loc)) args = tuple(map(asarray, args)) _a, _b = self._get_support(*args) k = asarray((k-loc)) cond0 = self._argcheck(*args) cond1 = (k >= _a) & (k < _b) cond2 = (k >= _b) cond = cond0 & cond1 output = zeros(shape(cond), 'd') place(output, cond2*(cond0 == cond0), 1.0) place(output, (1-cond0) + np.isnan(k), self.badvalue) if np.any(cond): goodargs = argsreduce(cond, *((k,)+args)) place(output, cond, np.clip(self._cdf(*goodargs), 0, 1)) if output.ndim == 0: return output[()] return output def logcdf(self, k, *args, **kwds): """Log of the cumulative distribution function at k of the given RV. Parameters ---------- k : array_like, int Quantiles. arg1, arg2, arg3,... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information). loc : array_like, optional Location parameter (default=0). Returns ------- logcdf : array_like Log of the cumulative distribution function evaluated at k. """ args, loc, _ = self._parse_args(*args, **kwds) k, loc = map(asarray, (k, loc)) args = tuple(map(asarray, args)) _a, _b = self._get_support(*args) k = asarray((k-loc)) cond0 = self._argcheck(*args) cond1 = (k >= _a) & (k < _b) cond2 = (k >= _b) cond = cond0 & cond1 output = empty(shape(cond), 'd') output.fill(NINF) place(output, (1-cond0) + np.isnan(k), self.badvalue) place(output, cond2*(cond0 == cond0), 0.0) if np.any(cond): goodargs = argsreduce(cond, *((k,)+args)) place(output, cond, self._logcdf(*goodargs)) if output.ndim == 0: return output[()] return output def sf(self, k, *args, **kwds): """Survival function (1 - `cdf`) at k of the given RV. Parameters ---------- k : array_like Quantiles. arg1, arg2, arg3,... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information). loc : array_like, optional Location parameter (default=0). Returns ------- sf : array_like Survival function evaluated at k. """ args, loc, _ = self._parse_args(*args, **kwds) k, loc = map(asarray, (k, loc)) args = tuple(map(asarray, args)) _a, _b = self._get_support(*args) k = asarray(k-loc) cond0 = self._argcheck(*args) cond1 = (k >= _a) & (k < _b) cond2 = (k < _a) & cond0 cond = cond0 & cond1 output = zeros(shape(cond), 'd') place(output, (1-cond0) + np.isnan(k), self.badvalue) place(output, cond2, 1.0) if np.any(cond): goodargs = argsreduce(cond, *((k,)+args)) place(output, cond, np.clip(self._sf(*goodargs), 0, 1)) if output.ndim == 0: return output[()] return output def logsf(self, k, *args, **kwds): """Log of the survival function of the given RV. Returns the log of the "survival function," defined as 1 - `cdf`, evaluated at `k`. Parameters ---------- k : array_like Quantiles. arg1, arg2, arg3,... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information). loc : array_like, optional Location parameter (default=0). Returns ------- logsf : ndarray Log of the survival function evaluated at `k`. """ args, loc, _ = self._parse_args(*args, **kwds) k, loc = map(asarray, (k, loc)) args = tuple(map(asarray, args)) _a, _b = self._get_support(*args) k = asarray(k-loc) cond0 = self._argcheck(*args) cond1 = (k >= _a) & (k < _b) cond2 = (k < _a) & cond0 cond = cond0 & cond1 output = empty(shape(cond), 'd') output.fill(NINF) place(output, (1-cond0) + np.isnan(k), self.badvalue) place(output, cond2, 0.0) if np.any(cond): goodargs = argsreduce(cond, *((k,)+args)) place(output, cond, self._logsf(*goodargs)) if output.ndim == 0: return output[()] return output def ppf(self, q, *args, **kwds): """Percent point function (inverse of `cdf`) at q of the given RV. Parameters ---------- q : array_like Lower tail probability. arg1, arg2, arg3,... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information). loc : array_like, optional Location parameter (default=0). Returns ------- k : array_like Quantile corresponding to the lower tail probability, q. """ args, loc, _ = self._parse_args(*args, **kwds) q, loc = map(asarray, (q, loc)) args = tuple(map(asarray, args)) _a, _b = self._get_support(*args) cond0 = self._argcheck(*args) & (loc == loc) cond1 = (q > 0) & (q < 1) cond2 = (q == 1) & cond0 cond = cond0 & cond1 output = np.full(shape(cond), fill_value=self.badvalue, dtype='d') # output type 'd' to handle nin and inf place(output, (q == 0)*(cond == cond), _a-1 + loc) place(output, cond2, _b + loc) if np.any(cond): goodargs = argsreduce(cond, *((q,)+args+(loc,))) loc, goodargs = goodargs[-1], goodargs[:-1] place(output, cond, self._ppf(*goodargs) + loc) if output.ndim == 0: return output[()] return output def isf(self, q, *args, **kwds): """Inverse survival function (inverse of `sf`) at q of the given RV. Parameters ---------- q : array_like Upper tail probability. arg1, arg2, arg3,... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information). loc : array_like, optional Location parameter (default=0). Returns ------- k : ndarray or scalar Quantile corresponding to the upper tail probability, q. """ args, loc, _ = self._parse_args(*args, **kwds) q, loc = map(asarray, (q, loc)) args = tuple(map(asarray, args)) _a, _b = self._get_support(*args) cond0 = self._argcheck(*args) & (loc == loc) cond1 = (q > 0) & (q < 1) cond2 = (q == 1) & cond0 cond3 = (q == 0) & cond0 cond = cond0 & cond1 # same problem as with ppf; copied from ppf and changed output = np.full(shape(cond), fill_value=self.badvalue, dtype='d') # output type 'd' to handle nin and inf lower_bound = _a - 1 + loc upper_bound = _b + loc place(output, cond2*(cond == cond), lower_bound) place(output, cond3*(cond == cond), upper_bound) # call place only if at least 1 valid argument if np.any(cond): goodargs = argsreduce(cond, *((q,)+args+(loc,))) loc, goodargs = goodargs[-1], goodargs[:-1] # PB same as ticket 766 place(output, cond, self._isf(*goodargs) + loc) if output.ndim == 0: return output[()] return output def _entropy(self, *args): if hasattr(self, 'pk'): return stats.entropy(self.pk) else: _a, _b = self._get_support(*args) return _expect(lambda x: entr(self.pmf(x, *args)), _a, _b, self.ppf(0.5, *args), self.inc) def expect(self, func=None, args=(), loc=0, lb=None, ub=None, conditional=False, maxcount=1000, tolerance=1e-10, chunksize=32): """ Calculate expected value of a function with respect to the distribution for discrete distribution by numerical summation. Parameters ---------- func : callable, optional Function for which the expectation value is calculated. Takes only one argument. The default is the identity mapping f(k) = k. args : tuple, optional Shape parameters of the distribution. loc : float, optional Location parameter. Default is 0. lb, ub : int, optional Lower and upper bound for the summation, default is set to the support of the distribution, inclusive (``lb <= k <= ub``). conditional : bool, optional If true then the expectation is corrected by the conditional probability of the summation interval. The return value is the expectation of the function, `func`, conditional on being in the given interval (k such that ``lb <= k <= ub``). Default is False. maxcount : int, optional Maximal number of terms to evaluate (to avoid an endless loop for an infinite sum). Default is 1000. tolerance : float, optional Absolute tolerance for the summation. Default is 1e-10. chunksize : int, optional Iterate over the support of a distributions in chunks of this size. Default is 32. Returns ------- expect : float Expected value. Notes ----- For heavy-tailed distributions, the expected value may or may not exist, depending on the function, `func`. If it does exist, but the sum converges slowly, the accuracy of the result may be rather low. For instance, for ``zipf(4)``, accuracy for mean, variance in example is only 1e-5. increasing `maxcount` and/or `chunksize` may improve the result, but may also make zipf very slow. The function is not vectorized. """ if func is None: def fun(x): # loc and args from outer scope return (x+loc)*self._pmf(x, *args) else: def fun(x): # loc and args from outer scope return func(x+loc)*self._pmf(x, *args) # used pmf because _pmf does not check support in randint and there # might be problems(?) with correct self.a, self.b at this stage maybe # not anymore, seems to work now with _pmf _a, _b = self._get_support(*args) if lb is None: lb = _a else: lb = lb - loc # convert bound for standardized distribution if ub is None: ub = _b else: ub = ub - loc # convert bound for standardized distribution if conditional: invfac = self.sf(lb-1, *args) - self.sf(ub, *args) else: invfac = 1.0 if isinstance(self, rv_sample): res = self._expect(fun, lb, ub) return res / invfac # iterate over the support, starting from the median x0 = self.ppf(0.5, *args) res = _expect(fun, lb, ub, x0, self.inc, maxcount, tolerance, chunksize) return res / invfac def _param_info(self): shape_info = self._shape_info() loc_info = _ShapeInfo("loc", True, (-np.inf, np.inf), (False, False)) param_info = shape_info + [loc_info] return param_info def _expect(fun, lb, ub, x0, inc, maxcount=1000, tolerance=1e-10, chunksize=32): """Helper for computing the expectation value of `fun`.""" # short-circuit if the support size is small enough if (ub - lb) <= chunksize: supp = np.arange(lb, ub+1, inc) vals = fun(supp) return np.sum(vals) # otherwise, iterate starting from x0 if x0 < lb: x0 = lb if x0 > ub: x0 = ub count, tot = 0, 0. # iterate over [x0, ub] inclusive for x in _iter_chunked(x0, ub+1, chunksize=chunksize, inc=inc): count += x.size delta = np.sum(fun(x)) tot += delta if abs(delta) < tolerance * x.size: break if count > maxcount: warnings.warn('expect(): sum did not converge', RuntimeWarning) return tot # iterate over [lb, x0) for x in _iter_chunked(x0-1, lb-1, chunksize=chunksize, inc=-inc): count += x.size delta = np.sum(fun(x)) tot += delta if abs(delta) < tolerance * x.size: break if count > maxcount: warnings.warn('expect(): sum did not converge', RuntimeWarning) break return tot def _iter_chunked(x0, x1, chunksize=4, inc=1): """Iterate from x0 to x1 in chunks of chunksize and steps inc. x0 must be finite, x1 need not be. In the latter case, the iterator is infinite. Handles both x0 < x1 and x0 > x1. In the latter case, iterates downwards (make sure to set inc < 0.) >>> [x for x in _iter_chunked(2, 5, inc=2)] [array([2, 4])] >>> [x for x in _iter_chunked(2, 11, inc=2)] [array([2, 4, 6, 8]), array([10])] >>> [x for x in _iter_chunked(2, -5, inc=-2)] [array([ 2, 0, -2, -4])] >>> [x for x in _iter_chunked(2, -9, inc=-2)] [array([ 2, 0, -2, -4]), array([-6, -8])] """ if inc == 0: raise ValueError('Cannot increment by zero.') if chunksize <= 0: raise ValueError('Chunk size must be positive; got %s.' % chunksize) s = 1 if inc > 0 else -1 stepsize = abs(chunksize * inc) x = x0 while (x - x1) * inc < 0: delta = min(stepsize, abs(x - x1)) step = delta * s supp = np.arange(x, x + step, inc) x += step yield supp class rv_sample(rv_discrete): """A 'sample' discrete distribution defined by the support and values. The ctor ignores most of the arguments, only needs the `values` argument. """ def __init__(self, a=0, b=inf, name=None, badvalue=None, moment_tol=1e-8, values=None, inc=1, longname=None, shapes=None, extradoc=None, seed=None): super(rv_discrete, self).__init__(seed) if values is None: raise ValueError("rv_sample.__init__(..., values=None,...)") # cf generic freeze self._ctor_param = dict( a=a, b=b, name=name, badvalue=badvalue, moment_tol=moment_tol, values=values, inc=inc, longname=longname, shapes=shapes, extradoc=extradoc, seed=seed) if badvalue is None: badvalue = nan self.badvalue = badvalue self.moment_tol = moment_tol self.inc = inc self.shapes = shapes self.vecentropy = self._entropy xk, pk = values if np.shape(xk) != np.shape(pk): raise ValueError("xk and pk must have the same shape.") if np.less(pk, 0.0).any(): raise ValueError("All elements of pk must be non-negative.") if not np.allclose(np.sum(pk), 1): raise ValueError("The sum of provided pk is not 1.") indx = np.argsort(np.ravel(xk)) self.xk = np.take(np.ravel(xk), indx, 0) self.pk = np.take(np.ravel(pk), indx, 0) self.a = self.xk[0] self.b = self.xk[-1] self.qvals = np.cumsum(self.pk, axis=0) self.shapes = ' ' # bypass inspection self._construct_argparser(meths_to_inspect=[self._pmf], locscale_in='loc=0', # scale=1 for discrete RVs locscale_out='loc, 1') self._attach_methods() self._construct_docstrings(name, longname, extradoc) def __getstate__(self): dct = self.__dict__.copy() # these methods will be remade in rv_generic.__setstate__, # which calls rv_generic._attach_methods attrs = ["_parse_args", "_parse_args_stats", "_parse_args_rvs"] [dct.pop(attr, None) for attr in attrs] return dct def _attach_methods(self): """Attaches dynamically created argparser methods.""" self._attach_argparser_methods() def _get_support(self, *args): """Return the support of the (unscaled, unshifted) distribution. Parameters ---------- arg1, arg2, ... : array_like The shape parameter(s) for the distribution (see docstring of the instance object for more information). Returns ------- a, b : numeric (float, or int or +/-np.inf) end-points of the distribution's support. """ return self.a, self.b def _pmf(self, x): return np.select([x == k for k in self.xk], [np.broadcast_arrays(p, x)[0] for p in self.pk], 0) def _cdf(self, x): xx, xxk = np.broadcast_arrays(x[:, None], self.xk) indx = np.argmax(xxk > xx, axis=-1) - 1 return self.qvals[indx] def _ppf(self, q): qq, sqq = np.broadcast_arrays(q[..., None], self.qvals) indx = argmax(sqq >= qq, axis=-1) return self.xk[indx] def _rvs(self, size=None, random_state=None): # Need to define it explicitly, otherwise .rvs() with size=None # fails due to explicit broadcasting in _ppf U = random_state.uniform(size=size) if size is None: U = np.array(U, ndmin=1) Y = self._ppf(U)[0] else: Y = self._ppf(U) return Y def _entropy(self): return stats.entropy(self.pk) def generic_moment(self, n): n = asarray(n) return np.sum(self.xk**n[np.newaxis, ...] * self.pk, axis=0) def _expect(self, fun, lb, ub, *args, **kwds): # ignore all args, just do a brute force summation supp = self.xk[(lb <= self.xk) & (self.xk <= ub)] vals = fun(supp) return np.sum(vals) def _check_shape(argshape, size): """ This is a utility function used by `_rvs()` in the class geninvgauss_gen. It compares the tuple argshape to the tuple size. Parameters ---------- argshape : tuple of integers Shape of the arguments. size : tuple of integers or integer Size argument of rvs(). Returns ------- The function returns two tuples, scalar_shape and bc. scalar_shape : tuple Shape to which the 1-d array of random variates returned by _rvs_scalar() is converted when it is copied into the output array of _rvs(). bc : tuple of booleans bc is an tuple the same length as size. bc[j] is True if the data associated with that index is generated in one call of _rvs_scalar(). """ scalar_shape = [] bc = [] for argdim, sizedim in zip_longest(argshape[::-1], size[::-1], fillvalue=1): if sizedim > argdim or (argdim == sizedim == 1): scalar_shape.append(sizedim) bc.append(True) else: bc.append(False) return tuple(scalar_shape[::-1]), tuple(bc[::-1]) def get_distribution_names(namespace_pairs, rv_base_class): """Collect names of statistical distributions and their generators. Parameters ---------- namespace_pairs : sequence A snapshot of (name, value) pairs in the namespace of a module. rv_base_class : class The base class of random variable generator classes in a module. Returns ------- distn_names : list of strings Names of the statistical distributions. distn_gen_names : list of strings Names of the generators of the statistical distributions. Note that these are not simply the names of the statistical distributions, with a _gen suffix added. """ distn_names = [] distn_gen_names = [] for name, value in namespace_pairs: if name.startswith('_'): continue if name.endswith('_gen') and issubclass(value, rv_base_class): distn_gen_names.append(name) if isinstance(value, rv_base_class): distn_names.append(name) return distn_names, distn_gen_names
mdhaber/scipy
scipy/stats/_distn_infrastructure.py
Python
bsd-3-clause
146,733
[ "Gaussian" ]
441bf37fd74362c06e7e59ec233ca7cfa89a609867004d68855df6dafe1a87c7
import gpflow import numpy as np import tensorflow_probability as tfp from gpflow.utilities import set_trainable, to_default_float from . import BranchingTree as bt from . import VBHelperFunctions, assigngp_dense, assigngp_denseSparse from . import branch_kernParamGPflow as bk def FitModel( bConsider, GPt, GPy, globalBranching, priorConfidence=0.80, M=10, likvar=1.0, kerlen=2.0, kervar=5.0, fDebug=False, maxiter=100, fPredict=True, fixHyperparameters=False, ): """ Fit BGP model :param bConsider: list of candidate branching points :param GPt: pseudotime :param GPy: gene expression. Should be 0 mean for best performance. :param globalBranching: cell labels :param priorConfidence: prior confidence on cell labels :param M: number of inducing points :param likvar: initial value for Gaussian noise variance :param kerlen: initial value for kernel length scale :param kervar: initial value for kernel variance :param fDebug: Print debugging information :param maxiter: maximum number of iterations for optimisation :param fPredict: compute predictive mean and variance :param fixHyperparameters: should kernel hyperparameters be kept fixed or optimised? :return: dictionary of log likelihood, GPflow model, Phi matrix, predictive set of points, mean and variance, hyperparameter values, posterior on branching time """ assert isinstance(bConsider, list), "Candidate B must be list" assert GPt.ndim == 1 assert GPy.ndim == 2 assert ( GPt.size == GPy.size ), "pseudotime and gene expression data must be the same size" assert ( globalBranching.size == GPy.size ), "state space must be same size as number of cells" assert M >= 0, "at least 0 or more inducing points should be given" phiInitial, phiPrior = GetInitialConditionsAndPrior( globalBranching, priorConfidence, infPriorPhi=True ) XExpanded, indices, _ = VBHelperFunctions.GetFunctionIndexListGeneral(GPt) ptb = np.min([np.min(GPt[globalBranching == 2]), np.min(GPt[globalBranching == 3])]) tree = bt.BinaryBranchingTree(0, 1, fDebug=False) tree.add(None, 1, np.ones((1, 1)) * ptb) # B can be anything here (fm, _) = tree.GetFunctionBranchTensor() kb = bk.BranchKernelParam( gpflow.kernels.Matern32(1), fm, b=np.zeros((1, 1)) ) + gpflow.kernels.White(1) kb.kernels[1].variance.assign( 1e-6 ) # controls the discontinuity magnitude, the gap at the branching point set_trainable(kb.kernels[1].variance, False) # jitter for numerics if M == 0: m = assigngp_dense.AssignGP( GPt, XExpanded, GPy, kb, indices, np.ones((1, 1)) * ptb, phiInitial=phiInitial, phiPrior=phiPrior, ) else: ZExpanded = np.ones((M, 2)) ZExpanded[:, 0] = np.linspace(0, 1, M, endpoint=False) ZExpanded[:, 1] = np.array([i for j in range(M) for i in range(1, 4)])[:M] m = assigngp_denseSparse.AssignGPSparse( GPt, XExpanded, GPy, kb, indices, np.ones((1, 1)) * ptb, ZExpanded, phiInitial=phiInitial, phiPrior=phiPrior, ) # Initialise hyperparameters m.likelihood.variance.assign(likvar) m.kernel.kernels[0].kern.lengthscales.assign(kerlen) m.kernel.kernels[0].kern.variance.assign(kervar) if fixHyperparameters: print("Fixing hyperparameters") set_trainable(m.kernel.kernels[0].kern.lengthscales, False) set_trainable(m.likelihood.variance, False) set_trainable(m.kernel.kernels[0].kern.variance, False) else: if fDebug: print("Adding prior logistic on length scale to avoid numerical problems") m.kernel.kernels[0].kern.lengthscales.prior = tfp.distributions.Normal( to_default_float(2.0), to_default_float(1.0) ) m.kernel.kernels[0].kern.variance.prior = tfp.distributions.Normal( to_default_float(3.0), to_default_float(1.0) ) m.likelihood.variance.prior = tfp.distributions.Normal( to_default_float(0.1), to_default_float(0.1) ) # optimization ll = np.zeros(len(bConsider)) Phi_l = list() ttestl_l, mul_l, varl_l = list(), list(), list() hyps = list() for ib, b in enumerate(bConsider): m.UpdateBranchingPoint(np.ones((1, 1)) * b, phiInitial) try: opt = gpflow.optimizers.Scipy() opt.minimize( m.training_loss, variables=m.trainable_variables, options=dict(disp=True, maxiter=maxiter), ) # remember winning hyperparameter hyps.append( { "likvar": m.likelihood.variance.numpy(), "kerlen": m.kernel.kernels[0].kern.lengthscales.numpy(), "kervar": m.kernel.kernels[0].kern.variance.numpy(), } ) ll[ib] = m.log_posterior_density() except Exception as ex: print(f"Unexpected error: {ex} {'-' * 60}\nCaused by model: {m} {'-' * 60}") ll[0] = np.nan # return model so can inspect model return { "loglik": ll, "model": m, "Phi": np.nan, "prediction": {"xtest": np.nan, "mu": np.nan, "var": np.nan}, "hyperparameters": np.nan, "posteriorB": np.nan, } # prediction Phi = m.GetPhi() Phi_l.append(Phi) if fPredict: ttestl, mul, varl = VBHelperFunctions.predictBranchingModel(m) ttestl_l.append(ttestl), mul_l.append(mul), varl_l.append(varl) else: ttestl_l.append([]), mul_l.append([]), varl_l.append([]) iw = np.argmax(ll) postB = GetPosteriorB(ll, bConsider) if fDebug: print( "BGP Maximum at b=%.2f" % bConsider[iw], "CI= [%.2f, %.2f]" % (postB["B_CI"][0], postB["B_CI"][1]), ) assert np.allclose(bConsider[iw], postB["Bmode"]), "%s-%s" % str( postB["B_CI"], bConsider[iw] ) return { "loglik": ll, "Phi": Phi_l[iw], # 'model': m, "prediction": {"xtest": ttestl_l[iw], "mu": mul_l[iw], "var": varl_l[iw]}, "hyperparameters": hyps[iw], "posteriorB": postB, } def GetPosteriorB(objUnsorted, BgridSearch, ciLimits=[0.01, 0.99]): """ Return posterior on B for each experiment, confidence interval index, map index """ # for each trueB calculate posterior over grid # ... in a numerically stable way assert objUnsorted.size == len(BgridSearch), "size do not match %g-%g" % ( objUnsorted.size, len(BgridSearch), ) gr = np.array(BgridSearch) isort = np.argsort(gr) gr = gr[isort] o = objUnsorted[isort].copy() # sorted objective funtion imode = np.argmax(o) pn = np.exp(o - np.max(o)) p = pn / pn.sum() assert np.any(~np.isnan(p)), "Nans in p! %s" % str(p) assert np.any(~np.isinf(p)), "Infinities in p! %s" % str(p) pb_cdf = np.cumsum(p) confInt = np.zeros(len(ciLimits), dtype=int) for pb_i, pb_c in enumerate(ciLimits): pb_idx = np.flatnonzero(pb_cdf <= pb_c) if pb_idx.size == 0: confInt[pb_i] = 0 else: confInt[pb_i] = np.max(pb_idx) # if((imode+5) > 0 and imode < (len(BgridSearch)-5)): # for modes at end points conf interval checks do not hold # assert confInt[0] <= (imode-1), 'Lower confidence point bigger than mode! (%s)-%g' % (str(confInt), imode) # assert confInt[1] >= (imode+1), 'Upper confidence point bigger than mode! (%s)-%g' % (str(confInt), imode) assert np.all(confInt < o.size), confInt B_CI = gr[confInt] Bmode = gr[imode] # return confidence interval as well as mode, and indexes for each return { "B_CI": B_CI, "Bmode": Bmode, "idx_confInt": confInt, "idx_mode": imode, "BgridSearch_sort": gr, "isort": isort, } def GetInitialConditionsAndPrior(globalBranching, v, infPriorPhi): # Setting initial phi np.random.seed(42) # UNDONE remove TODO assert isinstance(v, float), "v should be scalar is %s" % str(type(v)) N = globalBranching.size phiInitial = np.ones((N, 2)) * 0.5 # don't know anything phiInitial[:, 0] = np.random.rand(N) phiInitial[:, 1] = 1 - phiInitial[:, 0] phiPrior = np.ones_like(phiInitial) * 0.5 # don't know anything for i in range(N): iBranch = globalBranching[i] - 2 # is 1,2,3-> -1, 0, 1 if iBranch == -1: # trunk - set all equal phiPrior[i, :] = 0.5 else: if infPriorPhi: phiPrior[i, :] = 1 - v phiPrior[i, int(iBranch)] = v phiInitial[i, int(iBranch)] = 0.5 + ( np.random.random() / 2.0 ) # number between [0.5, 1] phiInitial[i, int(iBranch) != np.array([0, 1])] = ( 1 - phiInitial[i, int(iBranch)] ) assert np.allclose( phiPrior.sum(1), 1 ), "Phi Prior should be close to 1 but got %s" % str(phiPrior) assert np.allclose( phiInitial.sum(1), 1 ), "Phi Initial should be close to 1 but got %s" % str(phiInitial) assert np.all(~np.isnan(phiInitial)), "No nans please!" assert np.all(~np.isnan(phiPrior)), "No nans please!" return phiInitial, phiPrior
ManchesterBioinference/BranchedGP
BranchedGP/FitBranchingModel.py
Python
apache-2.0
9,710
[ "Gaussian" ]
ce02b829a0e68780b30a4e129d33c7068511cc7de1d957c84dc0892f70c10078
#!/usr/bin/env python import vtk from vtk.test import Testing from vtk.util.misc import vtkGetDataRoot VTK_DATA_ROOT = vtkGetDataRoot() ren1 = vtk.vtkRenderer() renWin = vtk.vtkRenderWindow() renWin.SetMultiSamples(0) renWin.AddRenderer(ren1) iren = vtk.vtkRenderWindowInteractor() iren.SetRenderWindow(renWin) # read data reader = vtk.vtkMultiBlockPLOT3DReader() reader.SetXYZFileName("" + str(VTK_DATA_ROOT) + "/Data/combxyz.bin") reader.SetQFileName("" + str(VTK_DATA_ROOT) + "/Data/combq.bin") reader.SetScalarFunctionNumber(110) reader.Update() output = reader.GetOutput().GetBlock(0) # create outline outlineF = vtk.vtkStructuredGridOutlineFilter() outlineF.SetInputData(output) outlineMapper = vtk.vtkPolyDataMapper() outlineMapper.SetInputConnection(outlineF.GetOutputPort()) outline = vtk.vtkActor() outline.SetMapper(outlineMapper) outline.GetProperty().SetColor(0,0,0) # create cursor cursor = vtk.vtkCursor3D() cursor.SetModelBounds(output.GetBounds()) cursor.SetFocalPoint(output.GetCenter()) cursor.AllOff() cursor.AxesOn() cursor.OutlineOn() cursor.XShadowsOn() cursor.YShadowsOn() cursor.ZShadowsOn() cursorMapper = vtk.vtkPolyDataMapper() cursorMapper.SetInputConnection(cursor.GetOutputPort()) cursorActor = vtk.vtkActor() cursorActor.SetMapper(cursorMapper) cursorActor.GetProperty().SetColor(1,0,0) # create probe probe = vtk.vtkProbeFilter() probe.SetInputData(cursor.GetFocus()) probe.SetSourceData(output) # create a cone geometry for glyph cone = vtk.vtkConeSource() cone.SetResolution(16) cone.SetRadius(0.25) # create glyph glyph = vtk.vtkGlyph3D() glyph.SetInputConnection(probe.GetOutputPort()) glyph.SetSourceConnection(cone.GetOutputPort()) glyph.SetVectorModeToUseVector() glyph.SetScaleModeToScaleByScalar() glyph.SetScaleFactor(.0002) glyphMapper = vtk.vtkPolyDataMapper() glyphMapper.SetInputConnection(glyph.GetOutputPort()) glyphActor = vtk.vtkActor() glyphActor.SetMapper(glyphMapper) ren1.AddActor(outline) ren1.AddActor(cursorActor) ren1.AddActor(glyphActor) ren1.SetBackground(1.0,1.0,1.0) renWin.SetSize(200,200) ren1.ResetCamera() ren1.GetActiveCamera().Elevation(60) ren1.ResetCameraClippingRange() renWin.Render() iren.Initialize() # prevent the tk window from showing up then start the event loop # --- end of script --
hlzz/dotfiles
graphics/VTK-7.0.0/Filters/General/Testing/Python/cursor3D.py
Python
bsd-3-clause
2,339
[ "VTK" ]
dd68995bea2e405e6288569e81e3aea556b5077f23587457aa9916798ca2deb3
#coding: utf8 import numpy as N from traits.api import Int, Float, Tuple, Range from traitsui.api import View, VGroup, Item from enable.api import ColorTrait from DisplayPlugin import DisplayPlugin class BeamProfiler(DisplayPlugin): # These traits control the calculation of the Gaussian fit background_percentile = Range(0.0, 100.0, 15.0) num_crops = Range(0, 5, 1) crop_radius = Range(1.0, 4.0, 1.5) # in beam diameters # These are the results of the calculation _centroid = Tuple(Float(), Float()) _minor_axis = Float() _major_axis = Float() _angle = Float() _ellipticity = Float() _baseline = Float() _include_radius = Float() # These control the visualization num_points = Int(40) color = ColorTrait('white') view = View( VGroup( Item('active'), Item('background_percentile'), Item('num_crops', label='Crop # times'), Item('crop_radius'), label='Beam Profiler', show_border=True)) def __init__(self, **traits): super(BeamProfiler, self).__init__(**traits) self.screen.data_store['centroid_x'] = N.array([]) self.screen.data_store['centroid_y'] = N.array([]) self.screen.data_store['ellipse_x'] = N.array([]) self.screen.data_store['ellipse_y'] = N.array([]) renderers = self.screen.plot.plot(('centroid_x', 'centroid_y'), type='scatter', marker_size=2.0, color=self.color, marker='circle') self._centroid_patch = renderers[0] self._centroid_patch.visible = self.active renderers = self.screen.plot.plot(('ellipse_x', 'ellipse_y'), type='line', color=self.color) self._ellipse_patch = renderers[0] self._ellipse_patch.visible = self.active # Connect handlers self.on_trait_change(self._move_centroid, '_centroid', dispatch='ui') self.on_trait_change(self._redraw_ellipse, '_centroid,_width,_height,_angle', dispatch='ui') self.on_trait_change(self._update_hud, '_centroid,_width,_height,_angle,_ellipticity,_baseline,' '_include_radius', dispatch='ui') def _move_centroid(self): self.screen.data_store['centroid_x'] = N.array([self._centroid[0]]) self.screen.data_store['centroid_y'] = N.array([self._centroid[1]]) def _redraw_ellipse(self): # Draw an N-point ellipse at the 1/e radius of the Gaussian fit # Using a parametric equation in t t = N.linspace(0, 2 * N.pi, self.num_points) angle = N.radians(self._angle) x0, y0 = self._centroid sin_t, cos_t = N.sin(t), N.cos(t) sin_angle, cos_angle = N.sin(angle), N.cos(angle) r_a = self._major_axis / 2.0 r_b = self._minor_axis / 2.0 x = x0 + r_a * cos_t * cos_angle - r_b * sin_t * sin_angle y = y0 + r_a * cos_t * sin_angle + r_b * sin_t * cos_angle self.screen.data_store['ellipse_x'] = x self.screen.data_store['ellipse_y'] = y def _update_hud(self): self.screen.hud('profiler', 'Centroid: {0._centroid[0]:.1f}, {0._centroid[1]:.1f}\n' 'Major axis: {0._major_axis:.1f}\n' 'Minor axis: {0._minor_axis:.1f}\n' u'Rotation: {0._angle:.1f}°\n' 'Ellipticity: {0._ellipticity:.3f}\n' 'Baseline: {0._baseline:.1f}\n' 'Inclusion radius: {0._include_radius:.1f}'.format(self)) def _process(self, frame): bw = (len(frame.shape) == 2) if not bw: # Use standard NTSC conversion formula frame = N.array( 0.2989 * frame[..., 0] + 0.5870 * frame[..., 1] + 0.1140 * frame[..., 2]) # Calibrate the background background = N.percentile(frame, self.background_percentile) frame -= background #N.clip(frame, 0.0, frame.max(), out=frame) m00, m10, m01, m20, m02, m11 = _calculate_moments(frame) bc, lc = 0, 0 for count in range(self.num_crops): include_radius, dlc, dbc, drc, dtc, frame = _crop(frame, self.crop_radius, m00, m10, m01, m20, m02, m11) lc += dlc bc += dbc # Recalibrate the background and recalculate the moments new_bkg = N.percentile(frame, self.background_percentile) frame -= new_bkg background += new_bkg #N.clip(frame, 0.0, frame.max(), out=frame) m00, m10, m01, m20, m02, m11 = _calculate_moments(frame) m10 += lc m01 += bc # Calculate Gaussian boundary q = N.sqrt((m20 - m02) ** 2 + 4 * m11 ** 2) self._major_axis = 2 ** 1.5 * N.sqrt(m20 + m02 + q) self._minor_axis = 2 ** 1.5 * N.sqrt(m20 + m02 - q) self._angle = N.degrees(0.5 * N.arctan2(2 * m11, m20 - m02)) self._ellipticity = self._minor_axis / self._major_axis self._centroid = (m10, m01) self._baseline = background self._include_radius = include_radius def activate(self): self._centroid_patch.visible = self._ellipse_patch.visible = True def deactivate(self): self.screen.hud('profiler', None) self._centroid_patch.visible = self._ellipse_patch.visible = False def _calculate_moments(frame): """Calculate the moments""" # From Bullseye y, x = N.mgrid[:frame.shape[0], :frame.shape[1]] m00 = frame.sum() or 1.0 m10 = (frame * x).sum() / m00 m01 = (frame * y).sum() / m00 dx, dy = x - m10, y - m01 m20 = (frame * dx ** 2).sum() / m00 m02 = (frame * dy ** 2).sum() / m00 m11 = (frame * dx * dy).sum() / m00 return m00, m10, m01, m20, m02, m11 def _crop(frame, crop_radius, m00, m10, m01, m20, m02, m11): """crop based on 3 sigma region""" w20 = crop_radius * 4 * N.sqrt(m20) w02 = crop_radius * 4 * N.sqrt(m02) include_radius = N.sqrt((w20 ** 2 + w02 ** 2) / 2) w02 = max(w02, 4) w20 = max(w20, 4) lc = int(max(0, m10 - w20)) bc = int(max(0, m01 - w02)) tc = int(min(frame.shape[0], m01 + w02)) rc = int(min(frame.shape[1], m10 + w20)) frame = frame[bc:tc, lc:rc] return include_radius, lc, bc, rc, tc, frame
ptomato/Beams
beams/BeamProfiler.py
Python
mit
6,347
[ "Gaussian" ]
247cc1dafb7167565dcdfcd6047b102a3c86a7ef6153a15f2c7020c40043e78b
#!/usr/bin/env python # # displace.py # # Simple script to generate input files of given displacement patterns. # Currently, VASP, Quantum-ESPRESSO, and xTAPP are supported. # # Copyright (c) 2014 Terumasa Tadano # # This file is distributed under the terms of the MIT license. # Please see the file 'LICENCE.txt' in the root directory # or http://opensource.org/licenses/mit-license.php for information. # """ Input file generator for displaced configurations. """ from __future__ import print_function import optparse import numpy as np import interface.VASP as vasp import interface.QE as qe import interface.xTAPP as xtapp import interface.OpenMX as openmx import interface.LAMMPS as lammps usage = "usage: %prog [options] file.pattern_HARMONIC file.pattern_ANHARM3 ... \n \ file.pattern_* can be generated by 'alm' with MODE = suggest." parser = optparse.OptionParser(usage=usage) parser.add_option('--mag', help="Magnitude of displacement in units of \ Angstrom (default: 0.02)") parser.add_option('--prefix', help="Prefix of the files to be created. ") parser.add_option('--QE', metavar='orig.pw.in', help="Quantum-ESPRESSO input file with equilibrium atomic positions (default: None)") parser.add_option('--VASP', metavar='orig.POSCAR', help="VASP POSCAR file with equilibrium atomic \ positions (default: None)") parser.add_option('--xTAPP', metavar='orig.cg', help="xTAPP CG file with equilibrium atomic \ positions (default: None)") parser.add_option('--LAMMPS', metavar='orig.lammps', help="LAMMPS structure file with equilibrium atomic positions (default: None)") parser.add_option('--OpenMX', metavar='orig.dat', help="dat file with equilibrium atomic \ positions (default: None)") def parse_displacement_patterns(files_in): pattern = [] for file in files_in: pattern_tmp = [] f = open(file, 'r') tmp, basis = f.readline().rstrip().split(':') if basis == 'F': print("Warning: DBASIS must be 'C'") exit(1) while True: line = f.readline() if not line: break line_split_by_colon = line.rstrip().split(':') is_entry = len(line_split_by_colon) == 2 if is_entry: pattern_set = [] natom_move = int(line_split_by_colon[1]) for i in range(natom_move): disp = [] line = f.readline() line_split = line.rstrip().split() disp.append(int(line_split[0])) for j in range(3): disp.append(float(line_split[j + 1])) pattern_set.append(disp) pattern_tmp.append(pattern_set) print("File %s containts %i displacement patterns" \ % (file, len(pattern_tmp))) for entry in pattern_tmp: if entry not in pattern: pattern.append(entry) f.close() print("") print("Number of unique displacement patterns = %d" % len(pattern)) return pattern def char_xyz(entry): if entry % 3 == 0: return 'x' elif entry % 3 == 1: return 'y' elif entry % 3 == 2: return 'z' def gen_displacement(counter_in, pattern, disp_mag, nat, invlavec): poscar_header = "Disp. Num. %i" % counter_in poscar_header += " ( %f Angstrom" % disp_mag disp = np.zeros((nat, 3)) for displace in pattern: atom = displace[0] - 1 poscar_header += ", %i : " % displace[0] str_direction = "" for i in range(3): if abs(displace[i + 1]) > 1.0e-10: if displace[i + 1] > 0.0: str_direction += "+" + char_xyz(i) else: str_direction += "-" + char_xyz(i) disp[atom][i] += displace[i + 1] * disp_mag poscar_header += str_direction poscar_header += ")" if invlavec is not None: for i in range(nat): disp[i] = np.dot(disp[i], invlavec.T) return poscar_header, disp def get_number_of_zerofill(npattern): nzero = 1 while True: npattern //= 10 if npattern == 0: break nzero += 1 return nzero if __name__ == '__main__': options, args = parser.parse_args() file_pattern = args[0:] print("*****************************************************************") print(" displace.py -- Input file generator ") print("*****************************************************************") print("") if len(file_pattern) == 0: print("Usage: displace.py [options] file1.pattern_HARMONIC\ file2.pattern_ANHARM3 ...") print("file.pattern_* can be generated by 'alm' with MODE = suggest.") print("") print("For details of available options, \ please type\n$ python displace.py -h") exit(1) conditions = [options.VASP is None, options.QE is None, options.xTAPP is None, options.LAMMPS is None, options.OpenMX is None] if conditions.count(True) == len(conditions): print("Error : Either --VASP, --QE, --xTAPP, --LAMMPS, --OpenMX option must be given.") exit(1) elif len(conditions) - conditions.count(True) > 1: print("Error : --VASP, --QE, --xTAPP, --LAMMPS, and --OpenMX cannot be given simultaneously.") exit(1) elif options.VASP: code = "VASP" print("--VASP option is given: Generate POSCAR files for VASP") print("") elif options.QE: code = "QE" print("--QE option is given: Generate input files for Quantum-ESPRESSO.") print("") elif options.xTAPP: code = "xTAPP" print("--xTAPP option is given: Generate input files for xTAPP.") print("") elif options.LAMMPS: code = "LAMMPS" print("--LAMMPS option is given: Generate input files for LAMMPS.") print("") elif options.OpenMX: code = "OpenMX" print("--OpenMX option is given: Generate dat files for OpenMX") print("") # Assign the magnitude of displacements if options.mag is None: options.mag = "0.02" disp_length = 0.02 print("--mag option not given. Substituted by the default (0.02 Angstrom)") print("") else: disp_length = float(options.mag) if options.prefix is None: prefix = "disp" print("--prefix option not given. Substituted by the default (\"disp\"). ") print("") else: prefix = options.prefix print("-----------------------------------------------------------------") print("") if code == "VASP": str_outfiles = "%s{counter}.POSCAR" % prefix file_original = options.VASP elif code == "QE": str_outfiles = "%s{counter}.pw.in" % prefix file_original = options.QE suffix = "pw.in" elif code == "xTAPP": str_outfiles = "%s{counter}.cg" % prefix file_original = options.xTAPP elif code == "LAMMPS": str_outfiles = "%s{counter}.lammps" % prefix file_original = options.LAMMPS elif code == "OpenMX": str_outfiles = "%s{counter}.dat" % prefix file_original = options.OpenMX # Read the original file if code == "VASP": aa, aa_inv, elems, nats, x_frac = vasp.read_POSCAR(file_original) nat = np.sum(nats) elif code == "QE": list_namelist, list_ATOMIC_SPECIES, \ list_K_POINTS, list_CELL_PARAMETERS, list_OCCUPATIONS, \ nat, lavec, kd_symbol, x_frac, aa_inv = qe.read_original_QE( file_original) elif code == "xTAPP": str_header, nat, nkd, aa, aa_inv, x_frac, kd = xtapp.read_CG(file_original) suffix = "cg" elif code == "LAMMPS": common_settings, nat, x_cart, kd = lammps.read_lammps_structure(file_original) aa_inv = None elif code == "OpenMX": aa, aa_inv, nat, x_frac = openmx.read_OpenMX_input(file_original) print("Original file : %s" % file_original) print("Output file format : %s" % str_outfiles) print("Magnitude of displacements : %s Angstrom" % disp_length) print("Number of atoms : %i" % nat) print("") disp_pattern = parse_displacement_patterns(args[:]) nzerofills = get_number_of_zerofill(len(disp_pattern)) counter = 0 for pattern in disp_pattern: counter += 1 header, disp = gen_displacement(counter, pattern, disp_length, nat, aa_inv) if code == "VASP": vasp.write_POSCAR(prefix, counter, header, nzerofills, aa, elems, nats, disp, x_frac) elif code == "QE": qe.generate_QE_input(prefix, suffix, counter, nzerofills, list_namelist, list_ATOMIC_SPECIES, list_K_POINTS, list_CELL_PARAMETERS, list_OCCUPATIONS, nat, kd_symbol, x_frac, disp) elif code == "xTAPP": nsym = 1 symop = [] symop.append([1, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0]) denom_tran = 1 has_inv = 0 xtapp.gen_CG(prefix, suffix, counter, nzerofills, str_header, nat, kd, x_frac, disp, nsym, symop, denom_tran, has_inv) elif code == "LAMMPS": lammps.write_lammps_structure(prefix, counter, header, nzerofills, common_settings, nat, kd, x_cart, disp) elif code == "OpenMX": openmx.write_OpenMX_input(prefix, counter, nzerofills, disp, aa, file_original) print("") print("All input files are created.")
ttadano/ALM
tools/displace.py
Python
mit
10,240
[ "ESPResSo", "LAMMPS", "OpenMX", "VASP" ]
5a806ff06a41649c1928e09330e54a76740718577823fde4b393ebd7a2d05a7a
#!/usr/bin/env python import numpy import itertools from pymatgen.core.lattice import Lattice from pymatgen.core.structure import Structure from crystal import fillcell, tikz_atoms def SiMn_Isite(): a = 5.43 fcc = Lattice([[a/2,a/2,0],[a/2,0,a/2],[0,a/2,a/2]]) isite = Structure(fcc,['Si']*2,[[0.00,0.00,0.00],[0.25,0.25,0.25]]) # Make the cell cubic isite.make_supercell([[1,1,-1],[1,-1,1],[-1,1,1]]) # Insert Mn atom isite.append('Mn',[0.50,0.50,0.50]) return isite def SiMn_Ssite(): a = 5.43 fcc = Lattice([[a/2,a/2,0],[a/2,0,a/2],[0,a/2,a/2]]) ssite = Structure(fcc,['Si']*2,[[0.00,0.00,0.00],[0.25,0.25,0.25]]) # Make the cell cubic ssite.make_supercell([[1,1,-1],[1,-1,1],[-1,1,1]]) # Insert Mn atom Mnsite = numpy.array([0.25,0.25,0.25]); for i,atom in enumerate(ssite): if numpy.linalg.norm(atom.frac_coords-Mnsite) < 0.01: del ssite[i] ssite.append('Mn',Mnsite) return ssite atoms = SiMn_Isite() atoms_full = fillcell(atoms) bondatoms = [] for sitei,sitej in itertools.combinations(atoms_full,2): radius = sitei.specie.atomic_radius + sitej.specie.atomic_radius bondlength = sitei.distance_from_point(sitej.coords) if bondlength <= 1.25 * radius: if sitei.specie.symbol != 'Mn' and sitej.specie.symbol != 'Mn': bondatoms.append((sitei,sitej)) tikz_atoms(atoms_full, bondatoms, drawcell = True)
ldamewood/figures
scripts/SiMn_sites.py
Python
mit
1,478
[ "CRYSTAL", "pymatgen" ]
a4fe42cc5bfff4119fd306cad46a86cb8134c0b2b4382f7c938bf88b8b761146
''' This application uses Flask as a web server and jquery to trigger pictures with SimpleCV To use start the web server: >>> python flask-server.py Then to run the application: >>> python webkit-gtk.py *Note: You are not required to run the webkit-gtk.py, you can also visit http://localhost:5000 ''' print __doc__ from flask import Flask, jsonify, render_template, request from werkzeug import SharedDataMiddleware import tempfile, os import simplejson as json import SimpleCV app = Flask(__name__) cam = SimpleCV.Camera() @app.route('/') def show(name=None): img = cam.getImage() tf = tempfile.NamedTemporaryFile(suffix=".png") loc = 'static/' + tf.name.split('/')[-1] tf.close() img.save(loc) return render_template('index.html', img=loc) @app.route('/_snapshot') def snapshot(): ''' Takes a picture and returns a path via json used as ajax callback for taking a picture ''' img = cam.getImage() tf = tempfile.NamedTemporaryFile(suffix=".png") loc = 'static/' + tf.name.split('/')[-1] tf.close() img.save(loc) print "location",loc print "json", json.dumps(loc) return json.dumps(loc) if __name__ == '__main__': if app.config['DEBUG']: from werkzeug import SharedDataMiddleware import os app.wsgi_app = SharedDataMiddleware(app.wsgi_app, { '/': os.path.join(os.path.dirname(__file__), 'static') }) app.run()
vdt/SimpleCV
SimpleCV/examples/web-based/webdisplay/flask-server.py
Python
bsd-3-clause
1,451
[ "VisIt" ]
25eb6efee748465cace6224beb30dc39c28dfada5b6f1cca3d5efbe72980160a
## # Copyright 2009-2012 Ghent University # Copyright 2009-2012 Stijn De Weirdt # Copyright 2010 Dries Verdegem # Copyright 2010-2012 Kenneth Hoste # Copyright 2011 Pieter De Baets # Copyright 2011-2012 Jens Timmerman # # This file is part of EasyBuild, # originally created by the HPC team of Ghent University (http://ugent.be/hpc/en), # with support of Ghent University (http://ugent.be/hpc), # the Flemish Supercomputer Centre (VSC) (https://vscentrum.be/nl/en), # the Hercules foundation (http://www.herculesstichting.be/in_English) # and the Department of Economy, Science and Innovation (EWI) (http://www.ewi-vlaanderen.be/en). # # http://github.com/hpcugent/easybuild # # EasyBuild is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation v2. # # EasyBuild is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with EasyBuild. If not, see <http://www.gnu.org/licenses/>. ## """ EasyBuild support for building and installing netCDF, implemented as an easyblock """ import os from distutils.version import LooseVersion import easybuild.tools.environment as env import easybuild.tools.toolchain as toolchain from easybuild.easyblocks.generic.configuremake import ConfigureMake from easybuild.tools.modules import get_software_root, get_software_version class EB_netCDF(ConfigureMake): """Support for building/installing netCDF""" def configure_step(self): """Configure build: set config options and configure""" self.cfg.update('configopts', "--enable-shared") if self.toolchain.options['pic']: self.cfg.update('configopts', '--with-pic') self.cfg.update('configopts', 'FCFLAGS="%s" CC="%s" FC="%s"' % (os.getenv('FFLAGS'), os.getenv('MPICC'), os.getenv('F90') )) # add -DgFortran to CPPFLAGS when building with GCC if self.toolchain.comp_family() == toolchain.GCC: #@UndefinedVariable self.cfg.update('configopts', 'CPPFLAGS="%s -DgFortran"' % os.getenv('CPPFLAGS')) super(EB_netCDF, self).configure_step() def sanity_check_step(self): """ Custom sanity check for netCDF """ incs = ["netcdf.h"] libs = ["libnetcdf.so", "libnetcdf.a"] # since v4.2, the non-C libraries have been split off in seperate extensions_step # see netCDF-Fortran and netCDF-C++ if LooseVersion(self.version) < LooseVersion("4.2"): incs += ["netcdf%s" % x for x in ["cpp.h", ".hh", ".inc", ".mod"]] + \ ["ncvalues.h", "typesizes.mod"] libs += ["libnetcdf_c++.so", "libnetcdff.so", "libnetcdf_c++.a", "libnetcdff.a"] custom_paths = { 'files': ["bin/nc%s" % x for x in ["-config", "copy", "dump", "gen", "gen3"]] + ["lib/%s" % x for x in libs] + ["include/%s" % x for x in incs], 'dirs': [] } super(EB_netCDF, self).sanity_check_step(custom_paths=custom_paths) def set_netcdf_env_vars(log): """Set netCDF environment variables used by other software.""" netcdf = get_software_root('netCDF') if not netcdf: log.error("netCDF module not loaded?") else: env.setvar('NETCDF', netcdf) log.debug("Set NETCDF to %s" % netcdf) netcdff = get_software_root('netCDF-Fortran') netcdf_ver = get_software_version('netCDF') if not netcdff: if LooseVersion(netcdf_ver) >= LooseVersion("4.2"): log.error("netCDF v4.2 no longer supplies Fortran library, also need netCDF-Fortran") else: env.setvar('NETCDFF', netcdff) log.debug("Set NETCDFF to %s" % netcdff) def get_netcdf_module_set_cmds(log): """Get module setenv commands for netCDF.""" netcdf = os.getenv('NETCDF') if netcdf: txt = "setenv NETCDF %s\n" % netcdf # netCDF-Fortran is optional (only for netCDF v4.2 and later) netcdff = os.getenv('NETCDFF') if netcdff: txt += "setenv NETCDFF %s\n" % netcdff return txt else: log.error("NETCDF environment variable not set?")
JensTimmerman/easybuild-easyblocks
easybuild/easyblocks/n/netcdf.py
Python
gpl-2.0
4,802
[ "NetCDF" ]
594b1b0861b5f1cfb80bbd72759645312cc6ad6514dbb20a1f4d66dd170e5486
#coding: utf-8 # Hungarian Phrasebook, <https://www.youtube.com/watch?v=G6D1YI-41ao> # Use with Pythonista # The MIT License # # Copyright © 2014 Mia Sinno Smith and Steven Thomas Smith # # Permission is hereby granted, free of charge, to any person obtaining a copy # of this software and associated documentation files (the "Software"), to deal # in the Software without restriction, including without limitation the rights # to use, copy, modify, merge, publish, distribute, sublicense, and/or sell # copies of the Software, and to permit persons to whom the Software is # furnished to do so, subject to the following conditions: # # The above copyright notice and this permission notice shall be included in # all copies or substantial portions of the Software. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR # IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, # FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE # AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER # LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, # OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN # THE SOFTWARE. import math, os, re, sound, time from scene import * import random from itertools import cycle from functools import partial class HungarianPhrasebook (Scene): def setup(self): # This will be called before the first frame is drawn. # add bounds and size by hand if run from console if not hasattr(self,'bounds'): self.bounds = Rect(0, 0, 1024, 748) if not hasattr(self,'size'): self.size = Size(1024, 748) self.HP_init() # Set up the root layer and one other layer: self.root_layer = Layer(self.bounds) self.root_layer.background = Color(0.2,0.2,0.2) self.totcols = 2*self.ncols + 1 # user row + reveal + Pythonista row self.sepx = 5 self.card_size = math.floor((self.size.w-(self.totcols+6)*self.sepx)/self.totcols) # 96 if self.size.w > 700 else 48 self.width = (self.card_size + self.sepx) * self.totcols + 6*self.sepx # xtra space between guess and Pythonista row self.height = self.size.h - (self.card_size + self.sepx) self.offset = Point((self.size.w - self.width)/2,self.height) self.deal_cards() def HP_init(self): # define Hungarian Phrasebook variables and functions self.ncols = 4 self.ncolors = 7 self.guesses = [] self.pguesses = [] self.hyps = () self.phyps = () self.rows = [] self.prows = [] self.prows_revealed = [] self.guess_cards = [] self.pcards_deal_flag = True emoji = self.emoji() self.ncolors = max(1,self.ncolors) self.ncolors = min(len(emoji),self.ncolors) # characters self.characters = [] self.colors = [] while len(self.characters) < self.ncolors: k = random.randint(0,len(emoji)-1) self.characters.append(emoji[k]) self.colors.append(Color(random.random(), random.random(), random.random())) del emoji[k] # The game # colored and white pegs, standard sorting self.rpegs = {'R': 1, 'W': 2, '-': 3, ' ': 4} # define peg letters for hash table self.firstletter = 'A' self.chrpegs = dict((k,chr(ord(self.firstletter)+k-1)) for k in range(0,self.ncolors)) # the result self.default_result = ['-'] * self.ncols # the truth self.truth = "".join([chr(random.randint(0,self.ncolors-1)+ord(self.firstletter)) for x in range(self.ncols)]) # print 'Truth is ' + repr([self.characters[k] for k in self.codetocards(self.truth)]) # guesses and results self.nhyp = [] self.nhyp.append(self.ncolors**self.ncols) def emoji(self): # List of Pythonista emoji emoji = os.listdir(sys.path[0] + 'Textures'); emoji = filter(lambda k: re.match('^[A-Z].+\.png',k) and not re.match('^(ionicons|Typicons|PC_)',k),emoji); emoji = [k.replace(".png","") for k in emoji] cute_emoji = ['Ant','Baby_Chick_1','Baby_Chick_2','Baby_Chick_3','Bactrian_Camel','Bear_Face', 'Bird','Blowfish','Boar','Bug','Cat_Face_Crying','Cat_Face_Grinning', 'Cat_Face_Heart-Shaped_Eyes','Cat_Face_Kissing','Cat_Face_Pouting', 'Cat_Face_Smiling','Cat_Face_Weary','Cat_Face_With_Tears_Of_Joy', 'Cat_Face_With_Wry_Smile','Cat_Face','Chicken','Cow_Face','Dog_Face', 'Dolphin','Elephant','Fish','Frog_Face','Hamster_Face','Honeybee', 'Horse_Face','Horse','Koala','Lady_Beetle','Monkey_Face', 'Monkey_Hear-No-Evil','Monkey_See-No-Evil','Monkey_Speak-No-Evil', 'Monkey','Mouse_Face','Octopus','Panda_Face', 'Penguin','Pig_Face','Pig_Nose','Poodle','Rabbit_Face','Sheep', 'Snail','Snake','Spiral_Shell','Tiger_Face','Tropical_Fish','Turtle', 'Whale','Wolf_Face','Aubergine','Banana','Birthday_Cake','Bread', 'Candy','Cherries','Chestnut','Chocolate_Bar','Coffee','Cooked_Rice', 'Cookie','Cooking','Corn','Doughnut','Grapes','Green_Apple','Hamburger', 'Ice_Cream','Lollipop','Meat_On_Bone','Melon','Oden','Peach','Pineapple', 'Pot_Of_Food','Poultry_Leg','Red_Apple','Shaved_Ice','Shortcake', 'Slice_Of_Pizza','Soft_Ice_Cream','Spaghetti','Strawberry','Tangerine', 'Tomato','Watermelon','Alien_Monster','Artist_Palette','Balloon', 'Crown','Crystal_Ball','Gem_Stone','Honey_Pot','Jack-O-Lantern','Moyai', 'Musical_Keyboard','Package','Party_Popper','Pile_Of_Poo','Ribbon', 'Snowman_Without_Snow','Alien','Baby','Boy','Ghost','Girl','Guardsman', 'Man_And_Woman','Man','Older_Man','Older_Woman','Person_Blond', 'Police_Officer','Princess','Woman','Worker','Blossom','Bouquet', 'Cactus','Cherry_Blossom','Four_Leaf_Clover','Hibiscus','Maple_Leaf', 'Mushroom','Palm_Tree','Rose','Sunflower','Tulip','Smiling_1', 'Stuck-Out_Tongue_2','Card_Joker','Cloud','Cyclone','Fire','Heart', 'Moon_5','Recycling_Symbol','Skull','Speech_Balloon','Sun_1','Rocket'] if True: return cute_emoji else: return emoji def advance_row(self): self.guesses.append(self.cardstocode(self.cards)) self.rows.append(self.cards) if len(self.guesses) == 1: self.hyps = self.make_hypspace(self.guesses[-1]) else: self.hyps = self.reduce_hypspace(self.hyps,self.guesses[-1]) if self.height - (self.card_size + self.sepx) < 0: self.game_over() return self.deal_pcards() self.height -= (self.card_size + self.sepx) self.deal_cards() def deal_cards(self): self.cards = [] for k in range(self.ncols): card = Layer(Rect(self.offset.x + k * (self.card_size + self.sepx),self.height, self.card_size, self.card_size)) card.icyc = cycle(range(0,self.ncolors)) for k in range(random.randint(1,self.ncolors)): card.idx = card.icyc.next() card.background = self.colors[card.idx] card.image = self.characters[card.idx] card.stroke = Color(0.6, 0.6, 0.6) card.stroke_weight = 4.0 self.root_layer.add_layer(card) self.cards.append(card) guess_card = Layer(Rect(self.offset.x + self.ncols * (self.card_size + self.sepx)+2*self.sepx, self.height, self.card_size, self.card_size)) guess_card.background = Color(0.95,0.95,0.95) guess_card.stroke = Color(1.0, 0.65, 1.0) guess_card.stroke_weight = 4.0 guess_card.revealed = False self.root_layer.add_layer(guess_card) self.guess_cards.append(guess_card) self.font_size = 60 if self.size.w > 700 else 48 guess_layer = TextLayer('?', 'GillSans', self.font_size) guess_layer.frame.center(guess_card.frame.x + guess_card.frame.w / 2, guess_card.frame.y + guess_card.frame.h / 2) guess_layer.tint = Color(1.0,0.0,1.0) self.root_layer.add_layer(guess_layer) self.guess_layer = guess_layer font_size = 24 if self.size.w > 700 else 12 if len(self.guesses) == 0: # You self.youtext_layer = TextLayer( 'You, {}^{} = {} words'.format( self.ncolors,self.ncols,self.ncolors**self.ncols), 'Futura', font_size) self.youtext_layer.frame.center(self.offset.x + (self.ncols * (self.card_size + self.sepx) - self.sepx)/2, self.height-1.2*font_size/2) self.root_layer.add_layer(self.youtext_layer) # Pythonista self.ptext_layer = TextLayer( 'Pythonista, {}^{} = {} words'.format( self.ncolors,self.ncols,self.ncolors**self.ncols), 'Futura', font_size) self.ptext_layer.frame.center(self.offset.x + (self.ncols+1) * (self.card_size + self.sepx) + 2*self.sepx + (self.ncols * (self.card_size + self.sepx) - self.sepx)/2, self.height + 0.608*self.card_size + self.sepx - 1.2*font_size/2) self.root_layer.add_layer(self.ptext_layer) else: # You plural = 's' if len(self.hyps) > 1 else '' youtext_layer = TextLayer( 'You, {} word{}'.format(len(self.hyps),plural), 'Futura', font_size) youtext_layer.frame.center(self.offset.x + (self.ncols * (self.card_size + self.sepx) - self.sepx)/2, self.height-1.2*font_size/2) self.root_layer.remove_layer(self.youtext_layer) self.youtext_layer = youtext_layer self.root_layer.add_layer(self.youtext_layer) # Pythonista if not self.pcards_deal_flag: return plural = 's' if len(self.phyps) > 1 else '' ptext_layer = TextLayer( 'Pythonista, {} word{}'.format(len(self.phyps),plural), 'Futura', font_size) ptext_layer.frame.center(self.offset.x + (self.ncols+1) * (self.card_size + self.sepx) + 2*self.sepx + (self.ncols * (self.card_size + self.sepx) - self.sepx)/2, self.height + self.card_size + self.sepx - 1.2*font_size/2) self.root_layer.remove_layer(self.ptext_layer) self.ptext_layer = ptext_layer self.root_layer.add_layer(self.ptext_layer) if self.redandwhitepegs(self.pguesses[-1],self.truth) == 'R' * self.ncols: self.ptext_layer.tint = Color(0.8, 0.8, 1.0) self.pcards_deal_flag = False def deal_pcards(self): if not self.pcards_deal_flag: return self.pcards = [] if len(self.pguesses) == 0: # First guess is random, then use it to create an initial (truncated) hypothesis space self.pguesses.append("".join([chr(random.randint(0,self.ncolors-1)+ord(self.firstletter)) for x in range(self.ncols)])) self.phyps = self.make_hypspace(self.pguesses[0]) else: self.pguesses.append(random.sample(self.phyps,1)[0]) self.phyps = self.reduce_hypspace(self.phyps,self.pguesses[-1]) pcards_nos = self.codetocards(self.pguesses[-1]) for k in range(self.ncols): card = Layer(Rect(self.offset.x + (self.ncols+1+k) * (self.card_size + self.sepx)+6*self.sepx, self.height, self.card_size, self.card_size)) card.idx = pcards_nos[k] if False: # only reveal python's guesses if asked card.background = self.colors[self.pcards[k]] card.image = self.characters[self.pcards[k]] else: card.background = Color(0.8,0.8,1.0) card.stroke = Color(0.3, 0.3, 0.6) card.stroke_weight = 4.0 self.root_layer.add_layer(card) self.pcards.append(card) self.prows.append(self.pcards) self.prows_revealed.append(False) def game_win(self): font_size = 100 if self.size.w > 700 else 50 text_layer = TextLayer('You Win!', 'Futura', font_size) text_layer.frame.center(self.bounds.center()) overlay = Layer(self.bounds) overlay.background = Color(0, 0, 0, 0) overlay.add_layer(text_layer) self.add_layer(overlay) overlay.animate('background', Color(0.0, 0.2, 0.3, 0.7)) text_layer.animate('scale_x', 1.3, 0.3, autoreverse=True) text_layer.animate('scale_y', 1.3, 0.3, autoreverse=True) self.root_layer.animate('scale_x', 0.0, delay=2.0, curve=curve_ease_back_in) self.root_layer.animate('scale_y', 0.0, delay=2.0, curve=curve_ease_back_in, completion=self.game_over) def game_over(self): sound.play_effect('Powerup_2') self.delay(0.5,self.setup) def redandwhitepegs(self,test,truth): res = list(self.default_result) for p in range(0,len(truth)): if test[p] == truth[p]: res[p] = 'R' elif test[p] in truth: res[p] = 'W' return "".join(sorted(res,key=lambda c: self.rpegs[c])) def cardstocode(self,cards): return "".join([chr(card.idx+ord(self.firstletter)) for card in cards]) def codetocards(self,code): return [ord(c)-ord(self.firstletter) for c in list(code)] def draw_result(self,rpegs,rcenter): ns = int(math.ceil(sqrt(len(rpegs)))) sl = int(math.ceil(2.0/(sqrt(5.0)+1.0)*self.card_size/ns)) slx = sl + int(math.ceil((self.card_size - ns*sl)/(ns+2))) rcenter.x -= (ns * sl + (ns-1) * (slx-sl))/2 rcenter.y += ((ns-2) * sl + (ns-1) * (slx-sl))/2 for k in xrange(len(rpegs)): i, j = k / ns, k % ns if rpegs[k] in 'RW': rpeg = Layer(Rect(rcenter.x + j * slx, rcenter.y - i * slx, sl, sl)) rpeg.background = Color(1.0, 0.0, 1.0) if rpegs[k] == 'R' else Color(1.0, 1.0, 1.0) self.root_layer.add_layer(rpeg) # possible outcomes -- reduce from ncols**ncolors using the first guess def make_hypspace(self,guess): hyps = set() result = self.redandwhitepegs(guess,self.truth) firstnn = [0] * self.ncols while firstnn[0] < self.ncolors: hyp = "".join([chr(x+ord(self.firstletter)) for x in firstnn]) if result == self.redandwhitepegs(guess,hyp): hyps.add(hyp) firstnn[-1] += 1 for d in range(1,self.ncols): if firstnn[-d] >= self.ncolors: firstnn[-d] = 0; firstnn[-d-1] += 1 return hyps def reduce_hypspace(self,hyps,guess): newhyps = set() result = self.redandwhitepegs(guess,self.truth) for hyp in hyps: if result == self.redandwhitepegs(guess,hyp): newhyps.add(hyp) return newhyps def draw(self): # Update and draw our root layer. For a layer-based scene, this # is usually all you have to do in the draw method. background(0, 0, 0) self.root_layer.update(self.dt) self.root_layer.draw() def touch_began(self, touch): # Animate the layer to the location of the touch: #x, y = touch.location.x, touch.location.y #new_frame = Rect(x - 64, y - 64, 128, 128) #self.layer.animate('frame', new_frame, 1.0, curve=curve_bounce_out) # Animate the background color to a random color: for card in self.cards: if touch.location in card.frame: def reveal_card(): card.idx = card.icyc.next() card.background = self.colors[card.idx] card.image = self.characters[card.idx] card.animate('scale_y', 1.0, 0.15) card.animate('scale_y', 0.0, 0.15, completion=reveal_card) card.scale_x = 1.0 card.animate('scale_x', 0.9, 0.15, autoreverse=True) sound.play_effect('Click_1') time.sleep(0.2) break guess_card = self.guess_cards[-1] if touch.location in guess_card.frame and not guess_card.revealed: def reveal_card(): guess_card.background = Color(0.1, 0.1, 0.1) guess_card.stroke = Color(1.0, 0.2, 1.0) guess_card.revealed = True guess_card.animate('scale_y', 1.0, 0.15) guess_card.animate('scale_y', 0.0, 0.15, completion=reveal_card) self.guess_layer.remove_layer() guess_card.scale_x = 1.0 guess_card.animate('scale_x', 0.9, 0.15, autoreverse=True) sound.play_effect('8ve-slide-magic') result = self.redandwhitepegs(self.cardstocode(self.cards),self.truth) self.draw_result(result,guess_card.frame.center()) if result == 'R' * self.ncols: self.game_win() return self.advance_row() self.pcards_reveal_flag = False for k in range(len(self.prows)): pcards = self.codetocards(self.pguesses[k]) for l in range(len(self.prows[k])): if touch.location in self.prows[k][l].frame: self.pcards_reveal_flag = True break if self.pcards_reveal_flag: break if self.pcards_reveal_flag: cards = list(self.prows[k]) if self.prows_revealed[k]: cards.reverse() if not self.prows_revealed[k]: def reveal_cards(card): card.background = self.colors[card.idx] card.image = self.characters[card.idx] card.animate('scale_y', 1.0, 0.15) else: def reveal_cards(card): card.background = Color(0.8,0.8,1.0) card.image = None card.animate('scale_y', 1.0, 0.15) for l in range(len(cards)): card = cards[l] card.animate('scale_y', 0.0, 0.15,l*0.05, completion=partial(reveal_cards,card)) card.scale_x = 1.0 card.animate('scale_x', 0.9, 0.15, autoreverse=True) if not self.prows_revealed[k]: sound.play_effect('Woosh_1') else: sound.play_effect('Woosh_2') self.prows_revealed[k] = not self.prows_revealed[k] def touch_moved(self, touch): pass def touch_ended(self, touch): pass run(HungarianPhrasebook())
essandess/HungarianPhrasebook
HungarianPhrasebook.py
Python
mit
17,363
[ "Octopus" ]
58ef927670c37d943e75c38e898a8900ce2a128de8ab4d50814751fc895f361d
import numpy as np import scipy from .math import strictly_positify, positify, clip01 def psf(img, sx, sy=None, angle=0): """ Return a Gaussian PSF of the same size as img. img: image (reference for the output size) sx: sigma value for the long axis sy: sigma value for the short axis. If None take the same value as sx [default] angle: geometric angle (in radian) of the long axis. [default: 0] """ from .math import Gauss if sy is None: sy = sx x = np.arange(img.shape[1]) y = np.arange(img.shape[0]) X, Y = np.meshgrid(x,y) X -= img.shape[1]//2 Y -= img.shape[0]//2 if angle != 0: Xp = X*np.cos(angle) - Y*np.sin(angle) Yp = X*np.sin(angle) + Y*np.cos(angle) else: Xp = X Yp = Y return Gauss(Xp, 0, sx)*Gauss(Yp, 0, sy) def _rl(x, image, psf, type='default', extend=True, damping=0, ndamp=10): """ Richardson-Lucy core algorithm Reference: L. B. Lucy / The Astronomical Journal / vol. 79 / No. 6 / June 1974 / pp. 745-754 By giving an estimate x_k this function returns the next estimate x_{k+1}. x: x_k estimate image: input image to enhance psf: point spread functional """ I = strictly_positify(convolve(x, psf, type=type, extend=extend)) # reconvoluted estimation. if damping != 0: ratio = _rl_damped(I, image, damping=damping, ndamp=ndamp) else: ratio = image / I return x * convolve(ratio, psf[::-1,::-1], type=type, extend=extend) # Correlation is the convolution of mirrored psf def _rl_damped(I, image, gain=1, con_var=1, damping=1, ndamp=10): """ Calculate the damping ratio Parameters ---------- gain: float, int CCD gain (relic?) con_var: float, int, np.ndarray Noise value or image threshold: float, int noise sigma threshold for dampening ndamp: float, int order of the dampening """ from .haar import hfilter rrr = image - I rrr = hfilter(rrr, (I+con_var)/gain, damping, ndamp=ndamp) rrr[np.isnan(rrr)] = 0 ratio = gain*(1 + rrr / (I+con_var)) return ratio def _rl_accelerate(x, x1, x2, g1=None, g2=None, order=1): """ Accelerated Richardson-Lucy algorithm. Reference: David S. C. Biggs and Mark Andrews, Appl. Opt./ Vol. 36 / No. 8 / 10 March 1997 / pp. 1766-1775 Notation in reference to paper: x = x_k x1 = x_{k-1} x2 = x_{k_2} g1 = g_{k-1} g2 = g_{k-2} y = y_k """ if g2 is None: alpha = 0 # Initialization else: alpha = np.sum(g1*g2)/strictly_positify(np.sum(g2**2)) # Eq. 10 alpha = clip01(alpha) # be sure α∈[0,1] if alpha == 0: return x # the prediction is the same as x (initialization) h1 = x - x1 # Eq. 7 y = x + alpha * h1 # Eq. 6 if order>1: h2 = x - 2*x1 + x2 # Eq. 17 y += h2 * alpha**2 / 2 # Eq. 14 return y def richardson_lucy(image, psf, iterations, damping=0, ndamp=10, core='default', acceleration=2, init='mean', extend=True, clip=False, **kargs): """ Richardson-Lucy algorithm image: the image to enhance (numpy 2d array) psf: the Point Spread Function (numpy 2d array) iterations: The number of iterations to perform. It can be either an integer or a list of integer. For the later case, the returned solution is a dictionary with keys K and value being the enhancement after K interations. T: Damping factor ( to be used with core='damped' ) N: N factor used with core='damped' core: default: default R-L algorithm using convolve from scipy.signal fft: performs a fftconvolution acceleration: 0: (No acceleration. standard R-L) 1: First order acceleration 2: Second order acceleration higher orders are not yet implemented damping: damping factor. (0= no damping) init: 'mean': the default. The start value for x is the mean of the image 'image': the start value x is the image itself numpy array: if init is a 2d numpy array, its value will be used as init value for x """ assert core in ['default', 'fft', 'accurate'] image = image.astype(np.float) psf = psf.astype(np.float) psf /= np.sum(psf) # Normalize the psf ⇒ ∫∫ psf(x,y) dx dy = 1 if init is 'mean': x = 0.5 * np.ones(image.shape) elif init is 'image': x = image else: x = init # Is iterations a number of a list of number? dict_output = True if type(iterations) is int: dict_output = False iterations = [iterations] N = max(iterations) results = {} x1 = x2 = None g1 = g2 = None for i in range(N): if acceleration: y = _rl_accelerate(x, x1, x2, g1, g2, order=acceleration) else: y = x x_new = _rl(positify(y), image=image, psf=psf, extend=extend, type=core, damping=damping, ndamp=ndamp) g2 = g1 g1 = x_new - y x, x1, x2 = x_new, x, x1 # rotate elements for next iteration if clip: x[x<0] = 0 x[x>clip] = clip if i+1 in iterations: results[i+1] = np.copy(x) if dict_output: return results return results[N] def img_extend(img, margin, block=1): I = np.pad(img, margin, 'constant') for i in range(img.shape[1]): I[:margin, i+margin] = np.mean(img[:block, i]) I[-margin:, i+margin] = np.mean(img[-block:, i]) for i in range(img.shape[0]): I[i+margin, :margin] = np.mean(img[i, :block]) I[i+margin, -margin:] = np.mean(img[i, -block:]) I[:margin, :margin] = np.mean(img[:block, :block]) I[:margin, -margin:] = np.mean(img[:block, -block:]) I[-margin:, :margin] = np.mean(img[-block:, :block]) I[-margin:, -margin:] = np.mean(img[-block:, -block:]) return I def convolve(img, psf, type='default', extend=True, mode='same', extend_margin=100, **kargs): """ Compute the convolution of two 2D signals: img and psf type: define the convolution type """ if extend is int: extend_margin = extend if extend: img = img_extend(img, extend_margin) if type is 'fft': from scipy.signal import fftconvolve as conv I = conv(img, psf, mode) elif type is 'default': from scipy.signal import convolve as conv I = conv(img, psf, mode) elif type is 'accurate': from scipy.signal import convolve2d as convolve I = conv(img, psf, mode) elif type is 'fft2': I = np.fft.fftshift((np.fft.irfft2(np.fft.rfft2(img) * np.fft.rfft2(psf)))) if extend: I = I[extend_margin:-extend_margin, extend_margin:-extend_margin] return I
scholi/pySPM
pySPM/utils/restoration.py
Python
apache-2.0
6,930
[ "Gaussian" ]
01376e9632b70dc5b59ea602839df546353c36fb7fe44c209beaa53fc92acfec
#!/usr/bin/env python #pylint: disable=missing-docstring #################################################################################################### # DO NOT MODIFY THIS HEADER # # MOOSE - Multiphysics Object Oriented Simulation Environment # # # # (c) 2010 Battelle Energy Alliance, LLC # # ALL RIGHTS RESERVED # # # # Prepared by Battelle Energy Alliance, LLC # # Under Contract No. DE-AC07-05ID14517 # # With the U. S. Department of Energy # # # # See COPYRIGHT for full restrictions # #################################################################################################### import unittest from MooseDocs.testing import MarkdownTestCase class TestBibtexExtension(MarkdownTestCase): EXTENSIONS = ['MooseDocs.extensions.bibtex'] @classmethod def updateExtensions(cls, configs): """ Method to change the arguments that come from the configuration file for specific tests. This way one can test optional arguments without permanently changing the configuration file. """ configs['MooseDocs.extensions.bibtex']['macro_files'] =\ ['docs/content/bib/macro_test_abbrev.bib'] def testCite(self): md = r'\cite{testkey}\n\bibliography{docs/content/bib/moose.bib}' self.assertConvert('test_cite.html', md) def testCiteTwo(self): md = r'\cite{testkey, testkey}\n\bibliography{docs/content/bib/moose.bib}' self.assertConvert('test_citeTwo.html', md) def testCiteThree(self): md = r'\cite{testkey, testkey, testkey}\n\bibliography{docs/content/bib/moose.bib}' self.assertConvert('test_citeThree.html', md) def testCitet(self): md = r'\citet{testkey}\n\bibliography{docs/content/bib/moose.bib}' self.assertConvert('test_citet.html', md) def testCitetTwo(self): md = r'\citet{testkey, testkey}\n\bibliography{docs/content/bib/moose.bib}' self.assertConvert('test_citetTwo.html', md) def testCitetThree(self): md = r'\citet{testkey, testkey, testkey}\n\bibliography{docs/content/bib/moose.bib}' self.assertConvert('test_citetThree.html', md) def testCitep(self): md = r'\citep{testkey}\n\bibliography{docs/content/bib/moose.bib}' self.assertConvert('test_citep.html', md) def testCitepTwo(self): md = r'\citep{testkey, testkey}\n\bibliography{docs/content/bib/moose.bib}' self.assertConvert('test_citepTwo.html', md) def testCitepThree(self): md = r'\citep{testkey, testkey, testkey}\n\bibliography{docs/content/bib/moose.bib}' self.assertConvert('test_citepThree.html', md) def testBibtexMacro(self): md = r'\cite{macroTestKey}\n\bibliography{docs/content/bib/test.bib}' self.assertConvert('test_bibtex_macro.html', md) def testNoAuthor(self): md = r'\cite{noAuthorTestKey}\n\bibliography{docs/content/bib/test.bib}' self.assertConvert('test_no_author.html', md) def testDuplicateError(self): md = r'\cite{macroTestKey}\n\bibliography{docs/content/bib/test_duplicate.bib}' self.convert(md) self.assertInLogError('repeated bibliograhpy entry: macroTestKey', index=-3) if __name__ == '__main__': unittest.main(verbosity=2)
Chuban/moose
python/MooseDocs/tests/bibtex/test_bibtex.py
Python
lgpl-2.1
4,046
[ "MOOSE" ]
3afc084f60d748efa6690e888e1335f421410460f01965d2fb5664b7b561439a
# # This file is part of postpic. # # postpic is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # postpic is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with postpic. If not, see <http://www.gnu.org/licenses/>. # # Copyright Stephan Kuschel, 2018-2019 ''' .. _openPMD: https://github.com/openPMD/openPMD-standard Support for hdf5 files following the openPMD_ Standard. Dependecies: - h5py: read hdf5 files with python Written by Stephan Kuschel 2016 ''' from __future__ import absolute_import, division, print_function, unicode_literals from . import Dumpreader_ifc from . import Simulationreader_ifc import numpy as np import re from .. import helper from ..helper_fft import fft __all__ = ['OpenPMDreader', 'FileSeries', 'FbpicReader', 'FbpicFileSeries'] class OpenPMDreader(Dumpreader_ifc): ''' The Reader implementation for Data written in the hdf5 file format following openPMD_ naming conventions. Args: h5file : String A String containing the relative Path to the .h5 file. ''' def __init__(self, h5file, **kwargs): super(OpenPMDreader, self).__init__(h5file, **kwargs) import os.path import h5py if not os.path.isfile(h5file): raise IOError('File "' + str(h5file) + '" doesnt exist.') self._h5 = h5py.File(h5file, 'r') self._iteration = int(list(self._h5['data'].keys())[0]) self._data = self._h5['/data/{:d}/'.format(self._iteration)] self.attrs = self._data.attrs def __del__(self): del self._data # --- Level 0 methods --- def keys(self): return list(self._data.keys()) def __getitem__(self, key): return self._data[key] # --- Level 1 methods --- def data(self, key): ''' should work with any key, that contains data, thus on every hdf5.Dataset, but not on hdf5.Group. Will extract the data, convert it to SI and return it as a numpy array. Constant records will be detected and converted to a numpy array containing a single value only. ''' record = self[key] if "value" in record.attrs: # constant data (a single int or float) ret = np.float64(record.attrs['value']) * record.attrs['unitSI'] else: # array data ret = np.float64(record[()]) * record.attrs['unitSI'] return ret def gridoffset(self, key, axis): axid = helper.axesidentify[axis] if "gridUnitSI" in self[key].attrs: attrs = self[key].attrs else: attrs = self[key].parent.attrs return attrs['gridGlobalOffset'][axid] * attrs['gridUnitSI'] def gridspacing(self, key, axis): axid = helper.axesidentify[axis] if "gridUnitSI" in self[key].attrs: attrs = self[key].attrs else: attrs = self[key].parent.attrs return attrs['gridSpacing'][axid] * attrs['gridUnitSI'] def gridpoints(self, key, axis): axid = helper.axesidentify[axis] return self[key].shape[axid] # --- Level 2 methods --- def timestep(self): return self._iteration def time(self): return np.float64(self.attrs['time'] * self.attrs['timeUnitSI']) def simdimensions(self): ''' the number of spatial dimensions the simulation was using. ''' for k in self._simgridkeys(): try: gs = self.gridspacing(k, None) return len(gs) except(KeyError): pass raise KeyError('number of simdimensions could not be retrieved for {}'.format(self)) def _keyE(self, component, **kwargs): axsuffix = {0: 'x', 1: 'y', 2: 'z', 90: 'r', 91: 't'}[helper.axesidentify[component]] return 'fields/E/{}'.format(axsuffix) def _keyB(self, component, **kwargs): axsuffix = {0: 'x', 1: 'y', 2: 'z', 90: 'r', 91: 't'}[helper.axesidentify[component]] return 'fields/B/{}'.format(axsuffix) def _simgridkeys(self): return ['fields/E/x', 'fields/E/y', 'fields/E/z', 'fields/B/x', 'fields/B/y', 'fields/B/z'] def listSpecies(self): ret = list(self['particles'].keys()) return ret def getSpecies(self, species, attrib): """ Returns one of the attributes out of (x,y,z,px,py,pz,weight,ID,mass,charge) of this particle species. """ attribid = helper.attribidentify[attrib] options = {9: 'particles/{}/weighting', 0: 'particles/{}/position/x', 1: 'particles/{}/position/y', 2: 'particles/{}/position/z', 3: 'particles/{}/momentum/x', 4: 'particles/{}/momentum/y', 5: 'particles/{}/momentum/z', 10: 'particles/{}/id', 11: 'particles/{}/mass', 12: 'particles/{}/charge'} optionsoffset = {0: 'particles/{}/positionOffset/x', 1: 'particles/{}/positionOffset/y', 2: 'particles/{}/positionOffset/z'} key = options[attribid] offsetkey = optionsoffset.get(attribid) try: data = self.data(key.format(species)) if offsetkey is not None: data += self.data(offsetkey.format(species)) ret = np.asarray(data, dtype=np.float64) except(IndexError): raise KeyError return ret def getderived(self): ''' return all other fields dumped, except E and B. ''' ret = [] self['fields'].visit(ret.append) ret = ['fields/{}'.format(r) for r in ret if not (r.startswith('E') or r.startswith('B'))] ret = [r for r in ret if hasattr(self[r], 'value')] ret.sort() return ret def __str__(self): return '<OpenPMDh5reader at "' + str(self.dumpidentifier) + '">' class FbpicReader(OpenPMDreader): ''' Special OpenPMDreader for FBpic, which is using an expansion into radial modes. This is subclass of the OpenPMDreader which is converting the modes to a radial representation. ''' def __init__(self, simidentifier, **kwargs): super(FbpicReader, self).__init__(simidentifier, **kwargs) @staticmethod def modeexpansion(rawdata, theta=None, Ntheta=None): ''' rawdata has to be shaped (Nm, Nr, Nz). Returns an array of shape (Nr, Ntheta, Nz), with `Ntheta = (Nm+1)//2`. If Ntheta is given only larger values are permitted. The corresponding values for theta are given by `np.linspace(0, 2*np.pi, Ntheta, endpoint=False)` ''' rawdata = np.asarray(rawdata) Nm, Nr, Nz = rawdata.shape if Ntheta is not None or theta is None: return FbpicReader._modeexpansion_fft(rawdata, Ntheta=Ntheta) else: return FbpicReader._modeexpansion_naiv(rawdata, theta=theta) @staticmethod def _modeexpansion_naiv_single(rawdata, theta=0): ''' The mode representation will be expanded for a given theta. rawdata has to have the shape (Nm, Nr, Nz). the returned array will be of shape (Nr, Nz). ''' rawdata = np.float64(rawdata) (Nm, Nr, Nz) = rawdata.shape mult_above_axis = [1] for mode in range(1, (Nm+1)//2): cos = np.cos(mode * theta) sin = np.sin(mode * theta) mult_above_axis += [cos, sin] mult_above_axis = np.float64(mult_above_axis) F_total = np.tensordot(mult_above_axis, rawdata, axes=(0, 0)) assert F_total.shape == (Nr, Nz), \ ''' Assertion error. Please open a new issue on github to report this. shape={}, Nr={}, Nz={} '''.format(F_total.shape, Nr, Nz) return F_total @staticmethod def _modeexpansion_naiv(rawdata, theta=0): ''' converts to radial data using `modeexpansion`, possibly for multiple theta at once. ''' if np.asarray(theta).shape is (): # single theta theta = [theta] # multiple theta data = np.asarray([FbpicReader._modeexpansion_naiv_single(rawdata, theta=t) for t in theta]) # switch from (theta, r, z) to (r, theta, z) data = data.swapaxes(0, 1) return data @staticmethod def _modeexpansion_fft(rawdata, Ntheta=None): ''' calculate the radialdata using an fft. This is by far the fastest way to do the modeexpansion. ''' Nm, Nr, Nz = rawdata.shape Nth = (Nm+1)//2 if Ntheta is None or Ntheta < Nth: Ntheta = Nth fd = np.empty((Nr, Ntheta, Nz), dtype=np.complex128) fd[:, 0, :].real = rawdata[0, :, :] rawdatasw = np.swapaxes(rawdata, 0, 1) fd[:, 1:Nth, :].real = rawdatasw[:, 1::2, :] fd[:, 1:Nth, :].imag = rawdatasw[:, 2::2, :] fd = fft.fft(fd, axis=1).real return fd # override inherited method to count points after mode expansion def gridoffset(self, key, axis): axid = helper.axesidentify[axis] if axid == 91: # theta return 0 else: # r, theta, z axidremap = {90: 0, 2: 1}[axid] return super(FbpicReader, self).gridoffset(key, axidremap) # override inherited method to count points after mode expansion def gridspacing(self, key, axis): axid = helper.axesidentify[axis] if axid == 91: # theta return 2 * np.pi / self.gridpoints(key, axis) else: # r, theta, z axidremap = {90: 0, 2: 1}[axid] return super(FbpicReader, self).gridspacing(key, axidremap) # override inherited method to count points after mode expansion def gridpoints(self, key, axis): axid = helper.axesidentify[axis] axid = axid % 90 # for r and theta (Nm, Nr, Nz) = self[key].shape # Ntheta does technically not exists because of the mode # representation. To do a proper conversion from the modes to # the grid, choose Ntheta based on the number of modes. Ntheta = (Nm + 1) // 2 return (Nr, Ntheta, Nz)[axid] # override def _defaultaxisorder(self, gridkey): return ('r', 'theta', 'z') # override from OpenPMDreader def data(self, key, **kwargs): raw = super(FbpicReader, self).data(key) # SI conversion if key.startswith('particles'): return raw # for fields expand the modes into a spatial grid first: data = self.modeexpansion(raw, **kwargs) # modeexpansion return data def dataE(self, component, theta=None, Ntheta=None, **kwargs): return self.data(self._keyE(component, **kwargs), theta=theta, Ntheta=Ntheta) def dataB(self, component, theta=None, **kwargs): return self.data(self._keyB(component, **kwargs), theta=theta, Ntheta=Ntheta) # override def __str__(self): return '<FbpicReader at "' + str(self.dumpidentifier) + '">' class FileSeries(Simulationreader_ifc): ''' Reads a time series of dumps from a given directory. The simidentifier is expanded using glob in order to find matching files. ''' def __init__(self, simidentifier, dumpreadercls=OpenPMDreader, **kwargs): super(FileSeries, self).__init__(simidentifier, **kwargs) self.dumpreadercls = dumpreadercls import glob self._dumpfiles = glob.glob(simidentifier) self._dumpfiles.sort() def _getDumpreader(self, n): ''' Do not use this method. It will be called by __getitem__. Use __getitem__ instead. ''' return self.dumpreadercls(self._dumpfiles[n]) def __len__(self): return len(self._dumpfiles) def __str__(self): return '<FileSeries at "' + self.simidentifier + '">' class FbpicFileSeries(FileSeries): def __init__(self, *args, **kwargs): super(FbpicFileSeries, self).__init__(*args, **kwargs) self.dumpreadercls = FbpicReader
skuschel/postpic
postpic/datareader/openPMDh5.py
Python
gpl-3.0
12,725
[ "VisIt" ]
fcaa1c55c154b40d576d220b701b99bd9cc991fe679ffffef91177a8b78bc69e
import inspect from functools import wraps from motherbrain import conf class Unauthorized(Exception): def __init__(self, entity_name, entity_value, detail=None): self.entity_name = entity_name self.entity_value = entity_value self.detail = detail def __str__(self): msg = 'Authorization Denied for {}: {}'.format(self.entity_name, self.entity_value) if self.detail: msg = ', '.join([msg, self.detail]) return msg def action(action_cluster): def decorator(f): def wrapped(*args, **kwargs): # preserve wrapped decorated function argspec wrapped.argspec = lambda: inspect.getargspec(f) return f(*args, **kwargs) wrapped.is_action = True wrapped.action_cluster = action_cluster return wraps(f)(wrapped) return decorator def secure_action(query_callback, action_cluster): """Secure Action Decorator query_callback -- a method which should return a tuple (identity, identity_value) Identity should be the key used to fetch the result (identity_value) query_callback will be invoked as follow: query_callback(context) query_callback should search for authentication key value in @context Example: def callback_example(context): username = context.get('username') authorized_users = {'joe': ['Joe', 'White', 'joe@foo.com'], 'moe': ['Moe', 'Black', 'moe@bar.com']} if username in authorized_users: return (username, authorized_users[username]) return (username, None) """ def decorator(f): @action(action_cluster) def wrapped(*args, **kwargs): context = args[0] identity, identity_value = query_callback(context) if not identity_value: raise Unauthorized('user', identity, 'no match') return f(*args, **kwargs) # preserve wrapped decorated function argspec wrapped.argspec = lambda: inspect.getargspec(f) return wraps(f)(wrapped) return decorator
urlist/urlist
motherbrain/workers/decorators.py
Python
gpl-3.0
2,243
[ "MOE" ]
fec97d96a763629917dc4e7cb4ac9a87f032b05e388efc7c2268b75d48c383b2
from calendar import monthrange from itertools import product import multiprocessing import os import time import numpy as np import pandas as pd from scipy import spatial import xarray as xr from gsee.climatedata_interface.pre_gsee_processing import resample_for_gsee from gsee.climatedata_interface import util def run_interface_from_dataset( data: xr.Dataset, params: dict, frequency="detect", pdfs_file="builtin", num_cores=multiprocessing.cpu_count(), ) -> xr.Dataset: """ Parameters ---------- data: xarray Dataset containing at lest one variable 'global_horizontal' with mean global horizontal irradiance in W/m2. Optional variables: 'diffuse_fraction', 'temperature' in °C params: dict Parameters for GSEE, i.e. 'tilt', 'azim', 'tracking', 'capacity'. tilt can be a function depending on latitude -- see example input. Tracking can be 0, 1, 2 for no tracking, 1-axis tracking, 2-axis tracking. frequency: str, optional Frequency of the input data. One of ['A', 'S', 'M', 'D', 'H'], for annual, seasonal, monthly, daily, hourly. Defaults to 'detect', whith attempts to automatically detect the correct frequency. pdfs_file: str, optional Path to a NetCDF file with probability density functions to use for each month. Only for annual, seasonal and monthly data. Default is 'builtin', which automatically downloads and uses a built-in global PDF based on MERRA-2 data. Set to None to disable. num_cores: int, optional Number of cores that should be used for the computation. Default is all available cores. Returns ------- xarray Dataset PV power output in Wh/hour if frequency is 'H', else in Wh/day """ frequency = _detect_frequency(data, frequency) # Produce list of coordinates of all grid points to iterate over coord_list = list(product(data["lat"].values, data["lon"].values)) # Modify time dimension so it fits the requirements of # the "resample_for_gsee" function data["time"] = _mod_time_dim(pd.to_datetime(data["time"].values), frequency) # Shareable list with a place for every coordinate in the grid manager = multiprocessing.Manager() shr_mem = manager.list([None] * len(coord_list)) # Store length of coordinate list in prog_mem to draw # the progress bar dynamically prog_mem = manager.list() prog_mem.append(len(coord_list)) start = time.time() if pdfs_file is not None: if frequency in ["A", "S", "M"]: pdfs_path = util.return_pdf_path() if pdfs_file == "builtin" else pdfs_file pdfs = xr.open_dataset(pdfs_path) pdf_coords = list(product(pdfs["lat"].values, pdfs["lon"].values)) tree = spatial.KDTree(pdf_coords) coord_list_nn = [pdf_coords[int(tree.query([x])[1])] for x in coord_list] else: raise ValueError( 'For frequencies other than "A", "M", or "D", ' "`pdfs_file` must be explicitly set to None." ) if num_cores > 1: from joblib import Parallel, delayed, wrap_non_picklable_objects from joblib.parallel import get_active_backend print("Parallel mode: {} cores".format(num_cores)) Parallel(n_jobs=num_cores)( delayed(wrap_non_picklable_objects(resample_for_gsee))( data.sel(lat=coords[0], lon=coords[1]), frequency, params, i, coords, shr_mem, prog_mem, None if pdfs_file is None else pdfs.sel(lat=coord_list_nn[i][0], lon=coord_list_nn[i][1]), ) for i, coords in enumerate(coord_list) ) else: print("Single core mode") for i, coords in enumerate(coord_list): resample_for_gsee( data.sel(lat=coords[0], lon=coords[1]), frequency, params, i, coords, shr_mem, prog_mem, None if pdfs_file is None else pdfs.sel(lat=coord_list_nn[i][0], lon=coord_list_nn[i][1]), ) end = time.time() print("\nComputation part took: {} seconds".format(str(round(end - start, 2)))) # Stitch together the data result = xr.Dataset() for piece in shr_mem: if type(piece) == type(data): result = xr.merge([result, piece]) result = result.transpose("time", "lat", "lon") result["time"] = data["time"] if frequency == "H": result["pv"].attrs["unit"] = "Wh" elif frequency in ["A", "S", "M", "D"]: result["pv"].attrs["unit"] = "Wh/day" return result def run_interface( ghi_data: tuple, outfile: str, params: dict, frequency="detect", diffuse_data=("", ""), temp_data=("", ""), timeformat=None, pdfs_file="builtin", num_cores=multiprocessing.cpu_count(), ): """ Input file must include 'time', 'lat' and 'lon' dimensions. Parameters ---------- ghi_data: tuple Tuple with path to a NetCDF file with diffuse fraction data and variable name in that file. outfile: string Path to NetCDF file to store output in. params: dict Parameters for GSEE, i.e. 'tilt', 'azim', 'tracking', 'capacity'. tilt can be a function depending on latitude -- see example input. Tracking can be 0, 1, 2 for no tracking, 1-axis tracking, 2-axis tracking. frequency: str, optional Frequency of the input data. One of ['A', 'S', 'M', 'D', 'H'], for annual, seasonal, monthly, daily, hourly. Defaults to 'detect', whith attempts to automatically detect the correct frequency. diffuse_data: tuple, optional Tuple with path to a NetCDF file with diffuse fraction data and variable name in that file. If not given, BRL model is used to estimate diffuse fraction. temp_data: tuple, optional Tuple with path to a NetCDF file with temperature data (°C or °K) and variable name in that file. If not given, constant temperatore of 20 degrees C is assumed. timeformat: string, optional If set to 'cmip', 'cmip5', or 'cmip6', then the date format common in the CMIP datasets (e.g. '20070104.5') is correctly dealt with. Otherwise it is left to xarray to detect the time format. pdfs_file: str, optional Path to a NetCDF file with probability density functions to use for each month. Only for annual, seasonal and monthly data. Default is 'builtin', which automatically downloads and uses a built-in global PDF based on MERRA-2 data. Set to None to disable. num_cores: int, optional Number of cores that should be used for the computation. Default is all available cores. Returns ------- None """ # Read Files: ds_merged, ds_in = _open_files(ghi_data, diffuse_data, temp_data) if timeformat in ["cmip", "cmip5", "cmip6"]: try: ds_merged["time"] = _parse_cmip_time_data(ds_merged) except Exception: raise ValueError( 'Parsing of "cmip5" time dimension failed. Set timeformat to None, or check your data.' ) # Check whether the time dimension was recognised correctly and interpreted as time by dataset if not type(ds_merged["time"].values[0]) is np.datetime64: raise ValueError( 'Time format not recognised. Try setting timeformat="cmip5" or check your data.' ) if os.path.isfile(outfile): print("{} already exists --> skipping".format(outfile.split("/", -1)[-1])) else: print( "{} does not yet exist --> Computing in ".format( outfile.split("/", -1)[-1] ), end="", ) ds_pv = run_interface_from_dataset( data=ds_merged, params=params, frequency=frequency, pdfs_file=pdfs_file, num_cores=num_cores, ) # Kill leftover coordinates that no variable is indexed over coords_to_kill = [i for i in ds_pv.coords if i not in ds_pv.dims] for coord in coords_to_kill: del ds_pv[coord] # Carry over CF attributes from the remaining dimensions for attr in ["standard_name", "long_name", "units", "axis"]: for dim in ds_pv.dims: if attr in ds_in[dim].attrs and attr not in ds_pv[dim].attrs: ds_pv[dim].attrs[attr] = ds_in[dim].attrs[attr] # Clean up time dimension before saving back to disk. # When xarray encounters time atributes it cannot parse, it # persists them, and later raises an exception when trying to save # results back to NetCDF and attempting to serialise our parsed time # dimension back to units/calendar attributes that it expects # not to already exist. for attr in ["units", "calendar"]: if attr in ds_pv.time.attrs: del ds_pv.time.attrs[attr] # Save results with zlib compression encoding_params = {"zlib": True, "complevel": 4} encoding = {k: encoding_params for k in list(ds_pv.data_vars)} ds_pv.to_netcdf(path=outfile, format="NETCDF4", encoding=encoding) # ---------------------------------------------------------------------------------------------------------------------- # Support functions for run_interface_from_dataset: # ---------------------------------------------------------------------------------------------------------------------- def _mod_time_dim(time_dim: pd.date_range, freq: str): """ Modify Time dimension so it fits the requirements of the "resample_for_gsee" function Parameters ---------- time_dim: array with datetime entries freq: string representing data frequency of na_time Returns ------- array modified time dimension """ if freq == "A": # Annual data is set to the beginning of the year return time_dim.map( lambda x: pd.Timestamp(year=x.year, month=1, day=1, hour=0, minute=0) ) elif freq in ["S", "M"]: # Seasonal data is set to middle of month, as it is often represented with the day in the middle of the season. # Monthly data is set to middle of month return time_dim.map( lambda x: pd.Timestamp( year=x.year, month=x.month, day=int(monthrange(x.year, x.month)[1] / 2), hour=0, minute=0, ) ) elif freq == "D": # Daily data is set to 00:00 hours of the day return time_dim.map( lambda x: pd.Timestamp( year=x.year, month=x.month, day=x.day, hour=0, minute=0 ) ) else: return time_dim # ---------------------------------------------------------------------------------------------------------------------- # Support functions for run_interface: # ---------------------------------------------------------------------------------------------------------------------- def _detect_frequency(ds: xr.Dataset, frequency="detect"): """ Tries to detect the frequency of the given dataset. Raises Warning if the detected freqency does not match that given in frequency, if frequency is not set to 'detect'. Parameters ---------- ds : xarray Dataset Must contain a 'time' dimension. frequency : str, optional Optionalluy set this to frequencuy given by user: one of ['A', 'S', 'M', 'D', 'H'] for annual, seasonal, monthly, daily, hourly. Returns ------- data_freq : str Detected or validated frequency. """ # Tries to detect frequency, otherwise falls back to manual entry, also compares if the two match: nc_freq = None try: nc_freq = ds.attrs["frequency"] except KeyError: try: nc_freq = pd.DatetimeIndex(data=ds["time"].values).inferred_freq[0] except: pass if not nc_freq: print("> No frequency detected --> checking manually given frequency", end="") if frequency in ["A", "S", "M", "D", "H"]: print("...Manual entry is valid") data_freq = frequency else: raise ValueError("Detect failed or manual entry is invalid.") else: if nc_freq == "year": data_freq = "A" elif nc_freq == "mon": data_freq = "M" elif nc_freq == "day": data_freq = "D" else: data_freq = nc_freq print("> Detected frequency: {}".format(data_freq)) if frequency == "S" and data_freq not in ["A", "M", "D", "H"]: print( '> Frequency is detected, but is not "A", "M", "D", or "H" thus assumed some kind of seasonal' ) return frequency if ( data_freq in ["A", "S", "M", "D", "H"] and frequency != data_freq and frequency != "detect" ): raise Warning( "\tManual given frequency is valid, however it does not match detected frequency. Check settings!" ) if data_freq not in ["A", "S", "M", "D", "H"]: raise ValueError( '> Time frequency invalid, use one from ["A", "S", "M", "D", "H"]' ) return data_freq def _parse_cmip_time_data(ds: xr.Dataset): """ Converts time data saved as number with format "day as %Y%m%d.%f" to datetime64 format Parameters ---------- ds: xarray dataset with 'time' dimension in "day as %Y%m%d.%f" format Returns ------- array with converted datetime64 entries """ # Translates date-string used in CMIP5 data to datetime-objects timestr = [str(ti) for ti in ds["time"].values] vfunc = np.vectorize( lambda x: np.datetime64( "{}-{}-{}T{:02d}:{}".format( x[:4], x[4:6], x[6:8], int(24 * float("0." + x[9:])), "00" ) ) ) return vfunc(timestr) def _open_files(ghi_data: tuple, diffuse_data: tuple, temp_data: tuple): """ Opens the given files for GHI, diffuse Fraction and temperature, extracts the corresponding variables and merges all three together to one dataset. Parameters ---------- ghi_data: Tuple with Filepath for .nc file with diffuse fraction data and variable name in that file diffuse_data: Tuple Tuple with Filepath for .nc file with diffuse fraction data and variable name in that file temp_data: Tuple Tuple with Filepath for .nc file with temperature data (°C or °K) and variable name in that file Returns ------- ds_tot: xarray dataset merged dataset with all available variables: global_horizontal, diffuse_fraction, temperature ds_th_in: xarray dataset dataset of input file without any being processed. Is used later to detect frequency """ ghi_file, ghi_var = ghi_data diffuse_file, diffuse_var = diffuse_data temp_file, temp_var = temp_data try: ds_ghi_in = xr.open_dataset(ghi_file) except Exception: raise FileNotFoundError("Radiation file not found") # makes sure only the specified variable gets used further: ds_ghi = ds_ghi_in[ghi_var].to_dataset() ds_merged = ds_ghi.rename({ghi_var: "global_horizontal"}) # Open diffuse_fraction file: try: ds_diffuse_in = xr.open_dataset(diffuse_file) ds_diffuse = ds_diffuse_in[diffuse_var].to_dataset() if ds_ghi.dims != ds_diffuse.dims: raise ValueError( "Dimension of diffuse fraciton file does not match radiation file" ) ds_merged = xr.merge([ds_merged, ds_diffuse]).rename( {diffuse_var: "diffuse_fraction"} ) except OSError: print("> No diffuse fraction file found -> will calculate with BRL-Model") # Open temperature file: try: ds_temp_in = xr.open_dataset(temp_file) ds_temp = ds_temp_in[temp_var].to_dataset() if ds_temp[temp_var].mean().values > 200: print("> Average temperature above 200° detected --> will convert to °C") ds_temp = ds_temp - 273.15 # convert form kelvin to celsius if ds_ghi.dims != ds_temp.dims: raise ValueError( "Dimension of temperature file does not match radiation file" ) ds_merged = xr.merge([ds_merged, ds_temp]).rename({temp_var: "temperature"}) except OSError: print("> No temperature file found -> will assume 20°C default value") assert ds_merged.dims == ds_ghi.dims return ds_merged, ds_ghi_in
renewables-ninja/gsee
gsee/climatedata_interface/interface.py
Python
bsd-3-clause
17,053
[ "NetCDF" ]
32e7e4d99447582dff10d576a6f9302b577d372f9bf3306a55f9b49b0bddfe5a
""" Python implementation of the fast ICA algorithms. Reference: Tables 8.3 and 8.4 page 196 in the book: Independent Component Analysis, by Hyvarinen et al. """ # Author: Pierre Lafaye de Micheaux, Stefan van der Walt, Gael Varoquaux, # Bertrand Thirion, Alexandre Gramfort # License: BSD 3 clause import numpy as np from scipy import linalg from ..base import BaseEstimator from ..utils import array2d, as_float_array, check_random_state __all__ = ['fastica', 'FastICA'] def _gs_decorrelation(w, W, j): """ Orthonormalize w wrt the first j rows of W Parameters ---------- w: array of shape(n), to be orthogonalized W: array of shape(p, n), null space definition j: int < p caveats ------- assumes that W is orthogonal w changed in place """ w -= np.dot(np.dot(w, W[:j].T), W[:j]) return w def _sym_decorrelation(W): """ Symmetric decorrelation i.e. W <- (W * W.T) ^{-1/2} * W """ K = np.dot(W, W.T) s, u = linalg.eigh(K) # u (resp. s) contains the eigenvectors (resp. square roots of # the eigenvalues) of W * W.T W = np.dot(np.dot(np.dot(u, np.diag(1.0 / np.sqrt(s))), u.T), W) return W def _ica_def(X, tol, g, gprime, fun_args, max_iter, w_init): """Deflationary FastICA using fun approx to neg-entropy function Used internally by FastICA. """ n_components = w_init.shape[0] W = np.zeros((n_components, n_components), dtype=float) # j is the index of the extracted component for j in range(n_components): w = w_init[j, :].copy() w /= np.sqrt((w ** 2).sum()) n_iterations = 0 # we set lim to tol+1 to be sure to enter at least once in next while lim = tol + 1 while ((lim > tol) & (n_iterations < (max_iter - 1))): wtx = np.dot(w.T, X) gwtx = g(wtx, fun_args) g_wtx = gprime(wtx, fun_args) w1 = (X * gwtx).mean(axis=1) - g_wtx.mean() * w _gs_decorrelation(w1, W, j) w1 /= np.sqrt((w1 ** 2).sum()) lim = np.abs(np.abs((w1 * w).sum()) - 1) w = w1 n_iterations = n_iterations + 1 W[j, :] = w return W def _ica_par(X, tol, g, gprime, fun_args, max_iter, w_init): """Parallel FastICA. Used internally by FastICA --main loop """ n, p = X.shape W = _sym_decorrelation(w_init) # we set lim to tol+1 to be sure to enter at least once in next while lim = tol + 1 it = 0 while ((lim > tol) and (it < (max_iter - 1))): wtx = np.dot(W, X) gwtx = g(wtx, fun_args) g_wtx = gprime(wtx, fun_args) W1 = np.dot(gwtx, X.T) / float(p) \ - np.dot(np.diag(g_wtx.mean(axis=1)), W) W1 = _sym_decorrelation(W1) lim = max(abs(abs(np.diag(np.dot(W1, W.T))) - 1)) W = W1 it += 1 return W def fastica(X, n_components=None, algorithm="parallel", whiten=True, fun="logcosh", fun_prime='', fun_args={}, max_iter=200, tol=1e-04, w_init=None, random_state=None): """Perform Fast Independent Component Analysis. Parameters ---------- X : array-like, shape = [n_samples, n_features] Training vector, where n_samples is the number of samples and n_features is the number of features. n_components : int, optional Number of components to extract. If None no dimension reduction is performed. algorithm : {'parallel', 'deflation'}, optional Apply a parallel or deflational FASTICA algorithm. whiten: boolean, optional If true perform an initial whitening of the data. Do not set to false unless the data is already white, as you will get incorrect results. If whiten is true, the data is assumed to have already been preprocessed: it should be centered, normed and white. fun : string or function, optional The functional form of the G function used in the approximation to neg-entropy. Could be either 'logcosh', 'exp', or 'cube'. You can also provide your own function but in this case, its derivative should be provided via argument fun_prime fun_prime : empty string ('') or function, optional See fun. fun_args: dictionary, optional If empty and if fun='logcosh', fun_args will take value {'alpha' : 1.0} max_iter: int, optional Maximum number of iterations to perform tol: float, optional A positive scalar giving the tolerance at which the un-mixing matrix is considered to have converged w_init: (n_components, n_components) array, optional Initial un-mixing array of dimension (n.comp,n.comp). If None (default) then an array of normal r.v.'s is used source_only: boolean, optional if True, only the sources matrix is returned random_state: int or RandomState Pseudo number generator state used for random sampling. Returns ------- K: (n_components, p) array or None. If whiten is 'True', K is the pre-whitening matrix that projects data onto the first n.comp principal components. If whiten is 'False', K is 'None'. W: (n_components, n_components) array estimated un-mixing matrix The mixing matrix can be obtained by:: w = np.dot(W, K.T) A = w.T * (w * w.T).I S: (n_components, n) array estimated source matrix Notes ----- The data matrix X is considered to be a linear combination of non-Gaussian (independent) components i.e. X = AS where columns of S contain the independent components and A is a linear mixing matrix. In short ICA attempts to `un-mix' the data by estimating an un-mixing matrix W where ``S = W K X.`` This implementation was originally made for data of shape [n_features, n_samples]. Now the input is transposed before the algorithm is applied. This makes it slightly faster for Fortran-ordered input. Implemented using FastICA: `A. Hyvarinen and E. Oja, Independent Component Analysis: Algorithms and Applications, Neural Networks, 13(4-5), 2000, pp. 411-430` """ random_state = check_random_state(random_state) # make interface compatible with other decompositions X = array2d(X).T algorithm_funcs = {'parallel': _ica_par, 'deflation': _ica_def} alpha = fun_args.get('alpha', 1.0) if (alpha < 1) or (alpha > 2): raise ValueError("alpha must be in [1,2]") if isinstance(fun, str): # Some standard nonlinear functions # XXX: these should be optimized, as they can be a bottleneck. if fun == 'logcosh': def g(x, fun_args): alpha = fun_args.get('alpha', 1.0) return np.tanh(alpha * x) def gprime(x, fun_args): alpha = fun_args.get('alpha', 1.0) return alpha * (1 - (np.tanh(alpha * x)) ** 2) elif fun == 'exp': def g(x, fun_args): return x * np.exp(-(x ** 2) / 2) def gprime(x, fun_args): return (1 - x ** 2) * np.exp(-(x ** 2) / 2) elif fun == 'cube': def g(x, fun_args): return x ** 3 def gprime(x, fun_args): return 3 * x ** 2 else: raise ValueError( 'fun argument should be one of logcosh, exp or cube') elif callable(fun): def g(x, fun_args): return fun(x, **fun_args) def gprime(x, fun_args): return fun_prime(x, **fun_args) else: raise ValueError('fun argument should be either a string ' '(one of logcosh, exp or cube) or a function') n, p = X.shape if n_components is None: n_components = min(n, p) if (n_components > min(n, p)): n_components = min(n, p) print("n_components is too large: it will be set to %s" % n_components) if whiten: # Centering the columns (ie the variables) X = X - X.mean(axis=-1)[:, np.newaxis] # Whitening and preprocessing by PCA u, d, _ = linalg.svd(X, full_matrices=False) del _ K = (u / d).T[:n_components] # see (6.33) p.140 del u, d X1 = np.dot(K, X) # see (13.6) p.267 Here X1 is white and data # in X has been projected onto a subspace by PCA X1 *= np.sqrt(p) else: # X must be casted to floats to avoid typing issues with numpy # 2.0 and the line below X1 = as_float_array(X, copy=True) if w_init is None: w_init = random_state.normal(size=(n_components, n_components)) else: w_init = np.asarray(w_init) if w_init.shape != (n_components, n_components): raise ValueError("w_init has invalid shape -- should be %(shape)s" % {'shape': (n_components, n_components)}) kwargs = {'tol': tol, 'g': g, 'gprime': gprime, 'fun_args': fun_args, 'max_iter': max_iter, 'w_init': w_init} func = algorithm_funcs.get(algorithm, 'parallel') W = func(X1, **kwargs) del X1 if whiten: S = np.dot(np.dot(W, K), X) return K, W, S.T else: S = np.dot(W, X) return None, W, S.T class FastICA(BaseEstimator): """FastICA; a fast algorithm for Independent Component Analysis Parameters ---------- n_components : int, optional Number of components to use. If none is passed, all are used. algorithm : {'parallel', 'deflation'} Apply parallel or deflational algorithm for FastICA whiten : boolean, optional If whiten is false, the data is already considered to be whitened, and no whitening is performed. fun : {'logcosh', 'exp', or 'cube'}, or a callable The non-linear function used in the FastICA loop to approximate negentropy. If a function is passed, it derivative should be passed as the 'fun_prime' argument. fun_prime : None or a callable The derivative of the non-linearity used. max_iter : int, optional Maximum number of iterations during fit tol : float, optional Tolerance on update at each iteration w_init : None of an (n_components, n_components) ndarray The mixing matrix to be used to initialize the algorithm. random_state: int or RandomState Pseudo number generator state used for random sampling. Attributes ---------- `unmixing_matrix_` : 2D array, [n_components, n_samples] The unmixing matrix Notes ----- Implementation based on `A. Hyvarinen and E. Oja, Independent Component Analysis: Algorithms and Applications, Neural Networks, 13(4-5), 2000, pp. 411-430` """ def __init__(self, n_components=None, algorithm='parallel', whiten=True, fun='logcosh', fun_prime='', fun_args=None, max_iter=200, tol=1e-4, w_init=None, random_state=None): super(FastICA, self).__init__() self.n_components = n_components self.algorithm = algorithm self.whiten = whiten self.fun = fun self.fun_prime = fun_prime self.fun_args = {} if fun_args is None else fun_args self.max_iter = max_iter self.tol = tol self.w_init = w_init self.random_state = random_state def fit(self, X): whitening_, unmixing_, sources_ = fastica(X, self.n_components, self.algorithm, self.whiten, self.fun, self.fun_prime, self.fun_args, self.max_iter, self.tol, self.w_init, random_state=self.random_state) if self.whiten == True: self.unmixing_matrix_ = np.dot(unmixing_, whitening_) else: self.unmixing_matrix_ = unmixing_ self.components_ = sources_ return self def transform(self, X): """Apply un-mixing matrix "W" to X to recover the sources S = X * W.T """ return np.dot(X, self.unmixing_matrix_.T) def get_mixing_matrix(self): """Compute the mixing matrix """ return linalg.pinv(self.unmixing_matrix_)
cdegroc/scikit-learn
sklearn/decomposition/fastica_.py
Python
bsd-3-clause
12,450
[ "Gaussian" ]
d009d763b9b5ec22e3dae1f30c778ef49bd1fae48670bf1a0f3634a339859c30
""" Spatial Error Models with regimes module """ __author__ = "Luc Anselin luc.anselin@asu.edu, Pedro V. Amaral pedro.amaral@asu.edu" import numpy as np import multiprocessing as mp import regimes as REGI import user_output as USER import summary_output as SUMMARY from pysal import lag_spatial from ols import BaseOLS from twosls import BaseTSLS from error_sp import BaseGM_Error, BaseGM_Endog_Error, _momentsGM_Error from utils import set_endog, iter_msg, sp_att, set_warn from utils import optim_moments, get_spFilter, get_lags from utils import spdot, RegressionPropsY from platform import system class GM_Error_Regimes(RegressionPropsY, REGI.Regimes_Frame): """ GMM method for a spatial error model with regimes, with results and diagnostics; based on Kelejian and Prucha (1998, 1999)[1]_ [2]_. Parameters ---------- y : array nx1 array for dependent variable x : array Two dimensional array with n rows and one column for each independent (exogenous) variable, excluding the constant regimes : list List of n values with the mapping of each observation to a regime. Assumed to be aligned with 'x'. w : pysal W object Spatial weights object constant_regi: ['one', 'many'] Switcher controlling the constant term setup. It may take the following values: * 'one': a vector of ones is appended to x and held constant across regimes * 'many': a vector of ones is appended to x and considered different per regime (default) cols2regi : list, 'all' Argument indicating whether each column of x should be considered as different per regime or held constant across regimes (False). If a list, k booleans indicating for each variable the option (True if one per regime, False to be held constant). If 'all' (default), all the variables vary by regime. regime_err_sep : boolean If True, a separate regression is run for each regime. regime_lag_sep : boolean Always False, kept for consistency, ignored. vm : boolean If True, include variance-covariance matrix in summary results cores : boolean Specifies if multiprocessing is to be used Default: no multiprocessing, cores = False Note: Multiprocessing may not work on all platforms. name_y : string Name of dependent variable for use in output name_x : list of strings Names of independent variables for use in output name_w : string Name of weights matrix for use in output name_ds : string Name of dataset for use in output name_regimes : string Name of regime variable for use in the output Attributes ---------- summary : string Summary of regression results and diagnostics (note: use in conjunction with the print command) betas : array kx1 array of estimated coefficients u : array nx1 array of residuals e_filtered : array nx1 array of spatially filtered residuals predy : array nx1 array of predicted y values n : integer Number of observations k : integer Number of variables for which coefficients are estimated (including the constant) Only available in dictionary 'multi' when multiple regressions (see 'multi' below for details) y : array nx1 array for dependent variable x : array Two dimensional array with n rows and one column for each independent (exogenous) variable, including the constant Only available in dictionary 'multi' when multiple regressions (see 'multi' below for details) mean_y : float Mean of dependent variable std_y : float Standard deviation of dependent variable pr2 : float Pseudo R squared (squared correlation between y and ypred) Only available in dictionary 'multi' when multiple regressions (see 'multi' below for details) vm : array Variance covariance matrix (kxk) sig2 : float Sigma squared used in computations Only available in dictionary 'multi' when multiple regressions (see 'multi' below for details) std_err : array 1xk array of standard errors of the betas Only available in dictionary 'multi' when multiple regressions (see 'multi' below for details) z_stat : list of tuples z statistic; each tuple contains the pair (statistic, p-value), where each is a float Only available in dictionary 'multi' when multiple regressions (see 'multi' below for details) name_y : string Name of dependent variable for use in output name_x : list of strings Names of independent variables for use in output name_w : string Name of weights matrix for use in output name_ds : string Name of dataset for use in output name_regimes : string Name of regime variable for use in the output title : string Name of the regression method used Only available in dictionary 'multi' when multiple regressions (see 'multi' below for details) regimes : list List of n values with the mapping of each observation to a regime. Assumed to be aligned with 'x'. constant_regi: ['one', 'many'] Ignored if regimes=False. Constant option for regimes. Switcher controlling the constant term setup. It may take the following values: * 'one': a vector of ones is appended to x and held constant across regimes * 'many': a vector of ones is appended to x and considered different per regime cols2regi : list, 'all' Ignored if regimes=False. Argument indicating whether each column of x should be considered as different per regime or held constant across regimes (False). If a list, k booleans indicating for each variable the option (True if one per regime, False to be held constant). If 'all', all the variables vary by regime. regime_err_sep : boolean If True, a separate regression is run for each regime. kr : int Number of variables/columns to be "regimized" or subject to change by regime. These will result in one parameter estimate by regime for each variable (i.e. nr parameters per variable) kf : int Number of variables/columns to be considered fixed or global across regimes and hence only obtain one parameter estimate nr : int Number of different regimes in the 'regimes' list multi : dictionary Only available when multiple regressions are estimated, i.e. when regime_err_sep=True and no variable is fixed across regimes. Contains all attributes of each individual regression References ---------- .. [1] Kelejian, H.R., Prucha, I.R. (1998) "A generalized spatial two-stage least squares procedure for estimating a spatial autoregressive model with autoregressive disturbances". The Journal of Real State Finance and Economics, 17, 1. .. [2] Kelejian, H.R., Prucha, I.R. (1999) "A Generalized Moments Estimator for the Autoregressive Parameter in a Spatial Model". International Economic Review, 40, 2. Examples -------- We first need to import the needed modules, namely numpy to convert the data we read into arrays that ``spreg`` understands and ``pysal`` to perform all the analysis. >>> import pysal >>> import numpy as np Open data on NCOVR US County Homicides (3085 areas) using pysal.open(). This is the DBF associated with the NAT shapefile. Note that pysal.open() also reads data in CSV format; since the actual class requires data to be passed in as numpy arrays, the user can read their data in using any method. >>> db = pysal.open(pysal.examples.get_path("NAT.dbf"),'r') Extract the HR90 column (homicide rates in 1990) from the DBF file and make it the dependent variable for the regression. Note that PySAL requires this to be an numpy array of shape (n, 1) as opposed to the also common shape of (n, ) that other packages accept. >>> y_var = 'HR90' >>> y = np.array([db.by_col(y_var)]).reshape(3085,1) Extract UE90 (unemployment rate) and PS90 (population structure) vectors from the DBF to be used as independent variables in the regression. Other variables can be inserted by adding their names to x_var, such as x_var = ['Var1','Var2','...] Note that PySAL requires this to be an nxj numpy array, where j is the number of independent variables (not including a constant). By default this model adds a vector of ones to the independent variables passed in. >>> x_var = ['PS90','UE90'] >>> x = np.array([db.by_col(name) for name in x_var]).T The different regimes in this data are given according to the North and South dummy (SOUTH). >>> r_var = 'SOUTH' >>> regimes = db.by_col(r_var) Since we want to run a spatial error model, we need to specify the spatial weights matrix that includes the spatial configuration of the observations. To do that, we can open an already existing gal file or create a new one. In this case, we will create one from ``NAT.shp``. >>> w = pysal.rook_from_shapefile(pysal.examples.get_path("NAT.shp")) Unless there is a good reason not to do it, the weights have to be row-standardized so every row of the matrix sums to one. Among other things, this allows to interpret the spatial lag of a variable as the average value of the neighboring observations. In PySAL, this can be easily performed in the following way: >>> w.transform = 'r' We are all set with the preliminaries, we are good to run the model. In this case, we will need the variables and the weights matrix. If we want to have the names of the variables printed in the output summary, we will have to pass them in as well, although this is optional. >>> model = GM_Error_Regimes(y, x, regimes, w=w, name_y=y_var, name_x=x_var, name_regimes=r_var, name_ds='NAT.dbf') Once we have run the model, we can explore a little bit the output. The regression object we have created has many attributes so take your time to discover them. Note that because we are running the classical GMM error model from 1998/99, the spatial parameter is obtained as a point estimate, so although you get a value for it (there are for coefficients under model.betas), you cannot perform inference on it (there are only three values in model.se_betas). Alternatively, we can have a summary of the output by typing: model.summary >>> print model.name_x ['0_CONSTANT', '0_PS90', '0_UE90', '1_CONSTANT', '1_PS90', '1_UE90', 'lambda'] >>> np.around(model.betas, decimals=6) array([[ 0.074807], [ 0.786107], [ 0.538849], [ 5.103756], [ 1.196009], [ 0.600533], [ 0.364103]]) >>> np.around(model.std_err, decimals=6) array([ 0.379864, 0.152316, 0.051942, 0.471285, 0.19867 , 0.057252]) >>> np.around(model.z_stat, decimals=6) array([[ 0.196932, 0.843881], [ 5.161042, 0. ], [ 10.37397 , 0. ], [ 10.829455, 0. ], [ 6.02007 , 0. ], [ 10.489215, 0. ]]) >>> np.around(model.sig2, decimals=6) 28.172732 """ def __init__(self, y, x, regimes, w, vm=False, name_y=None, name_x=None, name_w=None, constant_regi='many', cols2regi='all', regime_err_sep=False, regime_lag_sep=False, cores=False, name_ds=None, name_regimes=None): n = USER.check_arrays(y, x) USER.check_y(y, n) USER.check_weights(w, y, w_required=True) self.constant_regi = constant_regi self.cols2regi = cols2regi self.name_ds = USER.set_name_ds(name_ds) self.name_y = USER.set_name_y(name_y) self.name_w = USER.set_name_w(name_w, w) self.name_regimes = USER.set_name_ds(name_regimes) self.n = n self.y = y x_constant = USER.check_constant(x) name_x = USER.set_name_x(name_x, x) self.name_x_r = name_x cols2regi = REGI.check_cols2regi(constant_regi, cols2regi, x) self.regimes_set = REGI._get_regimes_set(regimes) self.regimes = regimes USER.check_regimes(self.regimes_set, self.n, x.shape[1]) self.regime_err_sep = regime_err_sep if regime_err_sep == True: if set(cols2regi) == set([True]): self._error_regimes_multi(y, x, regimes, w, cores, cols2regi, vm, name_x) else: raise Exception, "All coefficients must vary accross regimes if regime_err_sep = True." else: self.x, self.name_x = REGI.Regimes_Frame.__init__(self, x_constant, regimes, constant_regi=None, cols2regi=cols2regi, names=name_x) ols = BaseOLS(y=y, x=self.x) self.k = ols.x.shape[1] moments = _momentsGM_Error(w, ols.u) lambda1 = optim_moments(moments) xs = get_spFilter(w, lambda1, x_constant) ys = get_spFilter(w, lambda1, y) xs = REGI.Regimes_Frame.__init__(self, xs, regimes, constant_regi=None, cols2regi=cols2regi)[0] ols2 = BaseOLS(y=ys, x=xs) # Output self.predy = spdot(self.x, ols2.betas) self.u = y - self.predy self.betas = np.vstack((ols2.betas, np.array([[lambda1]]))) self.sig2 = ols2.sig2n self.e_filtered = self.u - lambda1 * lag_spatial(w, self.u) self.vm = self.sig2 * ols2.xtxi self.title = "SPATIALLY WEIGHTED LEAST SQUARES - REGIMES" self.name_x.append('lambda') self.kf += 1 self.chow = REGI.Chow(self) self._cache = {} SUMMARY.GM_Error(reg=self, w=w, vm=vm, regimes=True) def _error_regimes_multi(self, y, x, regimes, w, cores, cols2regi, vm, name_x): regi_ids = dict( (r, list(np.where(np.array(regimes) == r)[0])) for r in self.regimes_set) results_p = {} """ for r in self.regimes_set: if system() == 'Windows': results_p[r] = _work_error(*(y,x,regi_ids,r,w,self.name_ds,self.name_y,name_x+['lambda'],self.name_w,self.name_regimes)) is_win = True else: pool = mp.Pool(cores) results_p[r] = pool.apply_async(_work_error,args=(y,x,regi_ids,r,w,self.name_ds,self.name_y,name_x+['lambda'],self.name_w,self.name_regimes, )) is_win = False """ for r in self.regimes_set: if cores: pool = mp.Pool(None) results_p[r] = pool.apply_async(_work_error, args=( y, x, regi_ids, r, w, self.name_ds, self.name_y, name_x + ['lambda'], self.name_w, self.name_regimes, )) else: results_p[r] = _work_error( *(y, x, regi_ids, r, w, self.name_ds, self.name_y, name_x + ['lambda'], self.name_w, self.name_regimes)) self.kryd = 0 self.kr = len(cols2regi) self.kf = 0 self.nr = len(self.regimes_set) self.vm = np.zeros((self.nr * self.kr, self.nr * self.kr), float) self.betas = np.zeros((self.nr * (self.kr + 1), 1), float) self.u = np.zeros((self.n, 1), float) self.predy = np.zeros((self.n, 1), float) self.e_filtered = np.zeros((self.n, 1), float) """ if not is_win: pool.close() pool.join() """ if cores: pool.close() pool.join() results = {} self.name_y, self.name_x = [], [] counter = 0 for r in self.regimes_set: """ if is_win: results[r] = results_p[r] else: results[r] = results_p[r].get() """ if not cores: results[r] = results_p[r] else: results[r] = results_p[r].get() self.vm[(counter * self.kr):((counter + 1) * self.kr), (counter * self.kr):((counter + 1) * self.kr)] = results[r].vm self.betas[ (counter * (self.kr + 1)):((counter + 1) * (self.kr + 1)), ] = results[r].betas self.u[regi_ids[r], ] = results[r].u self.predy[regi_ids[r], ] = results[r].predy self.e_filtered[regi_ids[r], ] = results[r].e_filtered self.name_y += results[r].name_y self.name_x += results[r].name_x counter += 1 self.chow = REGI.Chow(self) self.multi = results SUMMARY.GM_Error_multi( reg=self, multireg=self.multi, vm=vm, regimes=True) class GM_Endog_Error_Regimes(RegressionPropsY, REGI.Regimes_Frame): ''' GMM method for a spatial error model with regimes and endogenous variables, with results and diagnostics; based on Kelejian and Prucha (1998, 1999)[1]_[2]_. Parameters ---------- y : array nx1 array for dependent variable x : array Two dimensional array with n rows and one column for each independent (exogenous) variable, excluding the constant yend : array Two dimensional array with n rows and one column for each endogenous variable q : array Two dimensional array with n rows and one column for each external exogenous variable to use as instruments (note: this should not contain any variables from x) regimes : list List of n values with the mapping of each observation to a regime. Assumed to be aligned with 'x'. w : pysal W object Spatial weights object constant_regi: ['one', 'many'] Switcher controlling the constant term setup. It may take the following values: * 'one': a vector of ones is appended to x and held constant across regimes * 'many': a vector of ones is appended to x and considered different per regime (default) cols2regi : list, 'all' Argument indicating whether each column of x should be considered as different per regime or held constant across regimes (False). If a list, k booleans indicating for each variable the option (True if one per regime, False to be held constant). If 'all' (default), all the variables vary by regime. regime_err_sep : boolean If True, a separate regression is run for each regime. regime_lag_sep : boolean Always False, kept for consistency, ignored. vm : boolean If True, include variance-covariance matrix in summary results cores : boolean Specifies if multiprocessing is to be used Default: no multiprocessing, cores = False Note: Multiprocessing may not work on all platforms. name_y : string Name of dependent variable for use in output name_x : list of strings Names of independent variables for use in output name_yend : list of strings Names of endogenous variables for use in output name_q : list of strings Names of instruments for use in output name_w : string Name of weights matrix for use in output name_ds : string Name of dataset for use in output name_regimes : string Name of regime variable for use in the output Attributes ---------- summary : string Summary of regression results and diagnostics (note: use in conjunction with the print command) betas : array kx1 array of estimated coefficients u : array nx1 array of residuals e_filtered : array nx1 array of spatially filtered residuals predy : array nx1 array of predicted y values n : integer Number of observations k : integer Number of variables for which coefficients are estimated (including the constant) Only available in dictionary 'multi' when multiple regressions (see 'multi' below for details) y : array nx1 array for dependent variable x : array Two dimensional array with n rows and one column for each independent (exogenous) variable, including the constant Only available in dictionary 'multi' when multiple regressions (see 'multi' below for details) yend : array Two dimensional array with n rows and one column for each endogenous variable Only available in dictionary 'multi' when multiple regressions (see 'multi' below for details) z : array nxk array of variables (combination of x and yend) Only available in dictionary 'multi' when multiple regressions (see 'multi' below for details) mean_y : float Mean of dependent variable std_y : float Standard deviation of dependent variable vm : array Variance covariance matrix (kxk) pr2 : float Pseudo R squared (squared correlation between y and ypred) Only available in dictionary 'multi' when multiple regressions (see 'multi' below for details) sig2 : float Only available in dictionary 'multi' when multiple regressions (see 'multi' below for details) Sigma squared used in computations std_err : array 1xk array of standard errors of the betas Only available in dictionary 'multi' when multiple regressions (see 'multi' below for details) z_stat : list of tuples z statistic; each tuple contains the pair (statistic, p-value), where each is a float Only available in dictionary 'multi' when multiple regressions (see 'multi' below for details) name_y : string Name of dependent variable for use in output name_x : list of strings Names of independent variables for use in output name_yend : list of strings Names of endogenous variables for use in output name_z : list of strings Names of exogenous and endogenous variables for use in output name_q : list of strings Names of external instruments name_h : list of strings Names of all instruments used in ouput name_w : string Name of weights matrix for use in output name_ds : string Name of dataset for use in output name_regimes : string Name of regimes variable for use in output title : string Name of the regression method used Only available in dictionary 'multi' when multiple regressions (see 'multi' below for details) regimes : list List of n values with the mapping of each observation to a regime. Assumed to be aligned with 'x'. constant_regi : ['one', 'many'] Ignored if regimes=False. Constant option for regimes. Switcher controlling the constant term setup. It may take the following values: * 'one': a vector of ones is appended to x and held constant across regimes * 'many': a vector of ones is appended to x and considered different per regime cols2regi : list, 'all' Ignored if regimes=False. Argument indicating whether each column of x should be considered as different per regime or held constant across regimes (False). If a list, k booleans indicating for each variable the option (True if one per regime, False to be held constant). If 'all', all the variables vary by regime. regime_err_sep : boolean If True, a separate regression is run for each regime. kr : int Number of variables/columns to be "regimized" or subject to change by regime. These will result in one parameter estimate by regime for each variable (i.e. nr parameters per variable) kf : int Number of variables/columns to be considered fixed or global across regimes and hence only obtain one parameter estimate nr : int Number of different regimes in the 'regimes' list multi : dictionary Only available when multiple regressions are estimated, i.e. when regime_err_sep=True and no variable is fixed across regimes. Contains all attributes of each individual regression References ---------- .. [1] Kelejian, H.R., Prucha, I.R. (1998) "A generalized spatial two-stage least squares procedure for estimating a spatial autoregressive model with autoregressive disturbances". The Journal of Real State Finance and Economics, 17, 1. .. [2] Kelejian, H.R., Prucha, I.R. (1999) "A Generalized Moments Estimator for the Autoregressive Parameter in a Spatial Model". International Economic Review, 40, 2. Examples -------- We first need to import the needed modules, namely numpy to convert the data we read into arrays that ``spreg`` understands and ``pysal`` to perform all the analysis. >>> import pysal >>> import numpy as np Open data on NCOVR US County Homicides (3085 areas) using pysal.open(). This is the DBF associated with the NAT shapefile. Note that pysal.open() also reads data in CSV format; since the actual class requires data to be passed in as numpy arrays, the user can read their data in using any method. >>> db = pysal.open(pysal.examples.get_path("NAT.dbf"),'r') Extract the HR90 column (homicide rates in 1990) from the DBF file and make it the dependent variable for the regression. Note that PySAL requires this to be an numpy array of shape (n, 1) as opposed to the also common shape of (n, ) that other packages accept. >>> y_var = 'HR90' >>> y = np.array([db.by_col(y_var)]).reshape(3085,1) Extract UE90 (unemployment rate) and PS90 (population structure) vectors from the DBF to be used as independent variables in the regression. Other variables can be inserted by adding their names to x_var, such as x_var = ['Var1','Var2','...] Note that PySAL requires this to be an nxj numpy array, where j is the number of independent variables (not including a constant). By default this model adds a vector of ones to the independent variables passed in. >>> x_var = ['PS90','UE90'] >>> x = np.array([db.by_col(name) for name in x_var]).T For the endogenous models, we add the endogenous variable RD90 (resource deprivation) and we decide to instrument for it with FP89 (families below poverty): >>> yd_var = ['RD90'] >>> yend = np.array([db.by_col(name) for name in yd_var]).T >>> q_var = ['FP89'] >>> q = np.array([db.by_col(name) for name in q_var]).T The different regimes in this data are given according to the North and South dummy (SOUTH). >>> r_var = 'SOUTH' >>> regimes = db.by_col(r_var) Since we want to run a spatial error model, we need to specify the spatial weights matrix that includes the spatial configuration of the observations into the error component of the model. To do that, we can open an already existing gal file or create a new one. In this case, we will create one from ``NAT.shp``. >>> w = pysal.rook_from_shapefile(pysal.examples.get_path("NAT.shp")) Unless there is a good reason not to do it, the weights have to be row-standardized so every row of the matrix sums to one. Among other things, this allows to interpret the spatial lag of a variable as the average value of the neighboring observations. In PySAL, this can be easily performed in the following way: >>> w.transform = 'r' We are all set with the preliminaries, we are good to run the model. In this case, we will need the variables (exogenous and endogenous), the instruments and the weights matrix. If we want to have the names of the variables printed in the output summary, we will have to pass them in as well, although this is optional. >>> model = GM_Endog_Error_Regimes(y, x, yend, q, regimes, w=w, name_y=y_var, name_x=x_var, name_yend=yd_var, name_q=q_var, name_regimes=r_var, name_ds='NAT.dbf') Once we have run the model, we can explore a little bit the output. The regression object we have created has many attributes so take your time to discover them. Note that because we are running the classical GMM error model from 1998/99, the spatial parameter is obtained as a point estimate, so although you get a value for it (there are for coefficients under model.betas), you cannot perform inference on it (there are only three values in model.se_betas). Also, this regression uses a two stage least squares estimation method that accounts for the endogeneity created by the endogenous variables included. Alternatively, we can have a summary of the output by typing: model.summary >>> print model.name_z ['0_CONSTANT', '0_PS90', '0_UE90', '1_CONSTANT', '1_PS90', '1_UE90', '0_RD90', '1_RD90', 'lambda'] >>> np.around(model.betas, decimals=5) array([[ 3.59718], [ 1.0652 ], [ 0.15822], [ 9.19754], [ 1.88082], [-0.24878], [ 2.46161], [ 3.57943], [ 0.25564]]) >>> np.around(model.std_err, decimals=6) array([ 0.522633, 0.137555, 0.063054, 0.473654, 0.18335 , 0.072786, 0.300711, 0.240413]) ''' def __init__(self, y, x, yend, q, regimes, w, cores=False, vm=False, constant_regi='many', cols2regi='all', regime_err_sep=False, regime_lag_sep=False, name_y=None, name_x=None, name_yend=None, name_q=None, name_w=None, name_ds=None, name_regimes=None, summ=True, add_lag=False): n = USER.check_arrays(y, x, yend, q) USER.check_y(y, n) USER.check_weights(w, y, w_required=True) self.constant_regi = constant_regi self.cols2regi = cols2regi self.name_ds = USER.set_name_ds(name_ds) self.name_regimes = USER.set_name_ds(name_regimes) self.name_w = USER.set_name_w(name_w, w) self.n = n self.y = y name_x = USER.set_name_x(name_x, x) if summ: name_yend = USER.set_name_yend(name_yend, yend) self.name_y = USER.set_name_y(name_y) name_q = USER.set_name_q(name_q, q) self.name_x_r = name_x + name_yend cols2regi = REGI.check_cols2regi( constant_regi, cols2regi, x, yend=yend) self.regimes_set = REGI._get_regimes_set(regimes) self.regimes = regimes USER.check_regimes(self.regimes_set, self.n, x.shape[1]) self.regime_err_sep = regime_err_sep if regime_err_sep == True: if set(cols2regi) == set([True]): self._endog_error_regimes_multi(y, x, regimes, w, yend, q, cores, cols2regi, vm, name_x, name_yend, name_q, add_lag) else: raise Exception, "All coefficients must vary accross regimes if regime_err_sep = True." else: x_constant = USER.check_constant(x) q, name_q = REGI.Regimes_Frame.__init__(self, q, regimes, constant_regi=None, cols2regi='all', names=name_q) x, name_x = REGI.Regimes_Frame.__init__(self, x_constant, regimes, constant_regi=None, cols2regi=cols2regi, names=name_x) yend2, name_yend = REGI.Regimes_Frame.__init__(self, yend, regimes, constant_regi=None, cols2regi=cols2regi, yend=True, names=name_yend) tsls = BaseTSLS(y=y, x=x, yend=yend2, q=q) self.k = tsls.z.shape[1] self.x = tsls.x self.yend, self.z = tsls.yend, tsls.z moments = _momentsGM_Error(w, tsls.u) lambda1 = optim_moments(moments) xs = get_spFilter(w, lambda1, x_constant) xs = REGI.Regimes_Frame.__init__(self, xs, regimes, constant_regi=None, cols2regi=cols2regi)[0] ys = get_spFilter(w, lambda1, y) yend_s = get_spFilter(w, lambda1, yend) yend_s = REGI.Regimes_Frame.__init__(self, yend_s, regimes, constant_regi=None, cols2regi=cols2regi, yend=True)[0] tsls2 = BaseTSLS(ys, xs, yend_s, h=tsls.h) # Output self.betas = np.vstack((tsls2.betas, np.array([[lambda1]]))) self.predy = spdot(tsls.z, tsls2.betas) self.u = y - self.predy self.sig2 = float(np.dot(tsls2.u.T, tsls2.u)) / self.n self.e_filtered = self.u - lambda1 * lag_spatial(w, self.u) self.vm = self.sig2 * tsls2.varb self.name_x = USER.set_name_x(name_x, x, constant=True) self.name_yend = USER.set_name_yend(name_yend, yend) self.name_z = self.name_x + self.name_yend self.name_z.append('lambda') self.name_q = USER.set_name_q(name_q, q) self.name_h = USER.set_name_h(self.name_x, self.name_q) self.kf += 1 self.chow = REGI.Chow(self) self._cache = {} if summ: self.title = "SPATIALLY WEIGHTED TWO STAGE LEAST SQUARES - REGIMES" SUMMARY.GM_Endog_Error(reg=self, w=w, vm=vm, regimes=True) def _endog_error_regimes_multi(self, y, x, regimes, w, yend, q, cores, cols2regi, vm, name_x, name_yend, name_q, add_lag): regi_ids = dict( (r, list(np.where(np.array(regimes) == r)[0])) for r in self.regimes_set) if add_lag != False: self.cols2regi += [True] cols2regi += [True] self.predy_e = np.zeros((self.n, 1), float) self.e_pred = np.zeros((self.n, 1), float) results_p = {} for r in self.regimes_set: """ if system() == 'Windows': results_p[r] = _work_endog_error(*(y,x,yend,q,regi_ids,r,w,self.name_ds,self.name_y,name_x,name_yend,name_q,self.name_w,self.name_regimes,add_lag)) is_win = True else: pool = mp.Pool(cores) results_p[r] = pool.apply_async(_work_endog_error,args=(y,x,yend,q,regi_ids,r,w,self.name_ds,self.name_y,name_x,name_yend,name_q,self.name_w,self.name_regimes,add_lag, )) is_win = False """ for r in self.regimes_set: if cores: pool = mp.Pool(None) results_p[r] = pool.apply_async(_work_endog_error, args=( y, x, yend, q, regi_ids, r, w, self.name_ds, self.name_y, name_x, name_yend, name_q, self.name_w, self.name_regimes, add_lag, )) else: results_p[r] = _work_endog_error( *(y, x, yend, q, regi_ids, r, w, self.name_ds, self.name_y, name_x, name_yend, name_q, self.name_w, self.name_regimes, add_lag)) self.kryd, self.kf = 0, 0 self.kr = len(cols2regi) self.nr = len(self.regimes_set) self.vm = np.zeros((self.nr * self.kr, self.nr * self.kr), float) self.betas = np.zeros((self.nr * (self.kr + 1), 1), float) self.u = np.zeros((self.n, 1), float) self.predy = np.zeros((self.n, 1), float) self.e_filtered = np.zeros((self.n, 1), float) """ if not is_win: pool.close() pool.join() """ if cores: pool.close() pool.join() results = {} self.name_y, self.name_x, self.name_yend, self.name_q, self.name_z, self.name_h = [ ], [], [], [], [], [] counter = 0 for r in self.regimes_set: """ if is_win: results[r] = results_p[r] else: results[r] = results_p[r].get() """ if not cores: results[r] = results_p[r] else: results[r] = results_p[r].get() self.vm[(counter * self.kr):((counter + 1) * self.kr), (counter * self.kr):((counter + 1) * self.kr)] = results[r].vm self.betas[ (counter * (self.kr + 1)):((counter + 1) * (self.kr + 1)), ] = results[r].betas self.u[regi_ids[r], ] = results[r].u self.predy[regi_ids[r], ] = results[r].predy self.e_filtered[regi_ids[r], ] = results[r].e_filtered self.name_y += results[r].name_y self.name_x += results[r].name_x self.name_yend += results[r].name_yend self.name_q += results[r].name_q self.name_z += results[r].name_z self.name_h += results[r].name_h if add_lag != False: self.predy_e[regi_ids[r], ] = results[r].predy_e self.e_pred[regi_ids[r], ] = results[r].e_pred counter += 1 self.chow = REGI.Chow(self) self.multi = results if add_lag != False: SUMMARY.GM_Combo_multi( reg=self, multireg=self.multi, vm=vm, regimes=True) else: SUMMARY.GM_Endog_Error_multi( reg=self, multireg=self.multi, vm=vm, regimes=True) class GM_Combo_Regimes(GM_Endog_Error_Regimes, REGI.Regimes_Frame): """ GMM method for a spatial lag and error model with regimes and endogenous variables, with results and diagnostics; based on Kelejian and Prucha (1998, 1999)[1]_[2]_. Parameters ---------- y : array nx1 array for dependent variable x : array Two dimensional array with n rows and one column for each independent (exogenous) variable, excluding the constant regimes : list List of n values with the mapping of each observation to a regime. Assumed to be aligned with 'x'. yend : array Two dimensional array with n rows and one column for each endogenous variable q : array Two dimensional array with n rows and one column for each external exogenous variable to use as instruments (note: this should not contain any variables from x) w : pysal W object Spatial weights object (always needed) constant_regi: ['one', 'many'] Switcher controlling the constant term setup. It may take the following values: * 'one': a vector of ones is appended to x and held constant across regimes * 'many': a vector of ones is appended to x and considered different per regime (default) cols2regi : list, 'all' Argument indicating whether each column of x should be considered as different per regime or held constant across regimes (False). If a list, k booleans indicating for each variable the option (True if one per regime, False to be held constant). If 'all' (default), all the variables vary by regime. regime_err_sep : boolean If True, a separate regression is run for each regime. regime_lag_sep : boolean If True, the spatial parameter for spatial lag is also computed according to different regimes. If False (default), the spatial parameter is fixed accross regimes. w_lags : integer Orders of W to include as instruments for the spatially lagged dependent variable. For example, w_lags=1, then instruments are WX; if w_lags=2, then WX, WWX; and so on. lag_q : boolean If True, then include spatial lags of the additional instruments (q). vm : boolean If True, include variance-covariance matrix in summary results cores : boolean Specifies if multiprocessing is to be used Default: no multiprocessing, cores = False Note: Multiprocessing may not work on all platforms. name_y : string Name of dependent variable for use in output name_x : list of strings Names of independent variables for use in output name_yend : list of strings Names of endogenous variables for use in output name_q : list of strings Names of instruments for use in output name_w : string Name of weights matrix for use in output name_ds : string Name of dataset for use in output name_regimes : string Name of regime variable for use in the output Attributes ---------- summary : string Summary of regression results and diagnostics (note: use in conjunction with the print command) betas : array kx1 array of estimated coefficients u : array nx1 array of residuals e_filtered : array nx1 array of spatially filtered residuals e_pred : array nx1 array of residuals (using reduced form) predy : array nx1 array of predicted y values predy_e : array nx1 array of predicted y values (using reduced form) n : integer Number of observations k : integer Number of variables for which coefficients are estimated (including the constant) Only available in dictionary 'multi' when multiple regressions (see 'multi' below for details) y : array nx1 array for dependent variable x : array Two dimensional array with n rows and one column for each independent (exogenous) variable, including the constant Only available in dictionary 'multi' when multiple regressions (see 'multi' below for details) yend : array Two dimensional array with n rows and one column for each endogenous variable Only available in dictionary 'multi' when multiple regressions (see 'multi' below for details) z : array nxk array of variables (combination of x and yend) Only available in dictionary 'multi' when multiple regressions (see 'multi' below for details) mean_y : float Mean of dependent variable std_y : float Standard deviation of dependent variable vm : array Variance covariance matrix (kxk) pr2 : float Pseudo R squared (squared correlation between y and ypred) Only available in dictionary 'multi' when multiple regressions (see 'multi' below for details) pr2_e : float Pseudo R squared (squared correlation between y and ypred_e (using reduced form)) Only available in dictionary 'multi' when multiple regressions (see 'multi' below for details) sig2 : float Sigma squared used in computations (based on filtered residuals) Only available in dictionary 'multi' when multiple regressions (see 'multi' below for details) std_err : array 1xk array of standard errors of the betas Only available in dictionary 'multi' when multiple regressions (see 'multi' below for details) z_stat : list of tuples z statistic; each tuple contains the pair (statistic, p-value), where each is a float Only available in dictionary 'multi' when multiple regressions (see 'multi' below for details) name_y : string Name of dependent variable for use in output name_x : list of strings Names of independent variables for use in output name_yend : list of strings Names of endogenous variables for use in output name_z : list of strings Names of exogenous and endogenous variables for use in output name_q : list of strings Names of external instruments name_h : list of strings Names of all instruments used in ouput name_w : string Name of weights matrix for use in output name_ds : string Name of dataset for use in output name_regimes : string Name of regimes variable for use in output title : string Name of the regression method used Only available in dictionary 'multi' when multiple regressions (see 'multi' below for details) regimes : list List of n values with the mapping of each observation to a regime. Assumed to be aligned with 'x'. constant_regi : ['one', 'many'] Ignored if regimes=False. Constant option for regimes. Switcher controlling the constant term setup. It may take the following values: * 'one': a vector of ones is appended to x and held constant across regimes * 'many': a vector of ones is appended to x and considered different per regime cols2regi : list, 'all' Ignored if regimes=False. Argument indicating whether each column of x should be considered as different per regime or held constant across regimes (False). If a list, k booleans indicating for each variable the option (True if one per regime, False to be held constant). If 'all', all the variables vary by regime. regime_err_sep : boolean If True, a separate regression is run for each regime. regime_lag_sep : boolean If True, the spatial parameter for spatial lag is also computed according to different regimes. If False (default), the spatial parameter is fixed accross regimes. kr : int Number of variables/columns to be "regimized" or subject to change by regime. These will result in one parameter estimate by regime for each variable (i.e. nr parameters per variable) kf : int Number of variables/columns to be considered fixed or global across regimes and hence only obtain one parameter estimate nr : int Number of different regimes in the 'regimes' list multi : dictionary Only available when multiple regressions are estimated, i.e. when regime_err_sep=True and no variable is fixed across regimes. Contains all attributes of each individual regression References ---------- .. [1] Kelejian, H.R., Prucha, I.R. (1998) "A generalized spatial two-stage least squares procedure for estimating a spatial autoregressive model with autoregressive disturbances". The Journal of Real State Finance and Economics, 17, 1. .. [2] Kelejian, H.R., Prucha, I.R. (1999) "A Generalized Moments Estimator for the Autoregressive Parameter in a Spatial Model". International Economic Review, 40, 2. Examples -------- We first need to import the needed modules, namely numpy to convert the data we read into arrays that ``spreg`` understands and ``pysal`` to perform all the analysis. >>> import numpy as np >>> import pysal Open data on NCOVR US County Homicides (3085 areas) using pysal.open(). This is the DBF associated with the NAT shapefile. Note that pysal.open() also reads data in CSV format; since the actual class requires data to be passed in as numpy arrays, the user can read their data in using any method. >>> db = pysal.open(pysal.examples.get_path("NAT.dbf"),'r') Extract the HR90 column (homicide rates in 1990) from the DBF file and make it the dependent variable for the regression. Note that PySAL requires this to be an numpy array of shape (n, 1) as opposed to the also common shape of (n, ) that other packages accept. >>> y_var = 'HR90' >>> y = np.array([db.by_col(y_var)]).reshape(3085,1) Extract UE90 (unemployment rate) and PS90 (population structure) vectors from the DBF to be used as independent variables in the regression. Other variables can be inserted by adding their names to x_var, such as x_var = ['Var1','Var2','...] Note that PySAL requires this to be an nxj numpy array, where j is the number of independent variables (not including a constant). By default this model adds a vector of ones to the independent variables passed in. >>> x_var = ['PS90','UE90'] >>> x = np.array([db.by_col(name) for name in x_var]).T The different regimes in this data are given according to the North and South dummy (SOUTH). >>> r_var = 'SOUTH' >>> regimes = db.by_col(r_var) Since we want to run a spatial lag model, we need to specify the spatial weights matrix that includes the spatial configuration of the observations. To do that, we can open an already existing gal file or create a new one. In this case, we will create one from ``NAT.shp``. >>> w = pysal.rook_from_shapefile(pysal.examples.get_path("NAT.shp")) Unless there is a good reason not to do it, the weights have to be row-standardized so every row of the matrix sums to one. Among other things, this allows to interpret the spatial lag of a variable as the average value of the neighboring observations. In PySAL, this can be easily performed in the following way: >>> w.transform = 'r' The Combo class runs an SARAR model, that is a spatial lag+error model. In this case we will run a simple version of that, where we have the spatial effects as well as exogenous variables. Since it is a spatial model, we have to pass in the weights matrix. If we want to have the names of the variables printed in the output summary, we will have to pass them in as well, although this is optional. >>> model = GM_Combo_Regimes(y, x, regimes, w=w, name_y=y_var, name_x=x_var, name_regimes=r_var, name_ds='NAT') Once we have run the model, we can explore a little bit the output. The regression object we have created has many attributes so take your time to discover them. Note that because we are running the classical GMM error model from 1998/99, the spatial parameter is obtained as a point estimate, so although you get a value for it (there are for coefficients under model.betas), you cannot perform inference on it (there are only three values in model.se_betas). Also, this regression uses a two stage least squares estimation method that accounts for the endogeneity created by the spatial lag of the dependent variable. We can have a summary of the output by typing: model.summary Alternatively, we can check the betas: >>> print model.name_z ['0_CONSTANT', '0_PS90', '0_UE90', '1_CONSTANT', '1_PS90', '1_UE90', '_Global_W_HR90', 'lambda'] >>> print np.around(model.betas,4) [[ 1.4607] [ 0.958 ] [ 0.5658] [ 9.113 ] [ 1.1338] [ 0.6517] [-0.4583] [ 0.6136]] And lambda: >>> print 'lambda: ', np.around(model.betas[-1], 4) lambda: [ 0.6136] This class also allows the user to run a spatial lag+error model with the extra feature of including non-spatial endogenous regressors. This means that, in addition to the spatial lag and error, we consider some of the variables on the right-hand side of the equation as endogenous and we instrument for this. In this case we consider RD90 (resource deprivation) as an endogenous regressor. We use FP89 (families below poverty) for this and hence put it in the instruments parameter, 'q'. >>> yd_var = ['RD90'] >>> yd = np.array([db.by_col(name) for name in yd_var]).T >>> q_var = ['FP89'] >>> q = np.array([db.by_col(name) for name in q_var]).T And then we can run and explore the model analogously to the previous combo: >>> model = GM_Combo_Regimes(y, x, regimes, yd, q, w=w, name_y=y_var, name_x=x_var, name_yend=yd_var, name_q=q_var, name_regimes=r_var, name_ds='NAT') >>> print model.name_z ['0_CONSTANT', '0_PS90', '0_UE90', '1_CONSTANT', '1_PS90', '1_UE90', '0_RD90', '1_RD90', '_Global_W_HR90', 'lambda'] >>> print model.betas [[ 3.41963782] [ 1.04065841] [ 0.16634393] [ 8.86544628] [ 1.85120528] [-0.24908469] [ 2.43014046] [ 3.61645481] [ 0.03308671] [ 0.18684992]] >>> print np.sqrt(model.vm.diagonal()) [ 0.53067577 0.13271426 0.06058025 0.76406411 0.17969783 0.07167421 0.28943121 0.25308326 0.06126529] >>> print 'lambda: ', np.around(model.betas[-1], 4) lambda: [ 0.1868] """ def __init__(self, y, x, regimes, yend=None, q=None, w=None, w_lags=1, lag_q=True, cores=False, constant_regi='many', cols2regi='all', regime_err_sep=False, regime_lag_sep=False, vm=False, name_y=None, name_x=None, name_yend=None, name_q=None, name_w=None, name_ds=None, name_regimes=None): n = USER.check_arrays(y, x) USER.check_y(y, n) USER.check_weights(w, y, w_required=True) name_x = USER.set_name_x(name_x, x, constant=True) self.name_y = USER.set_name_y(name_y) name_yend = USER.set_name_yend(name_yend, yend) name_q = USER.set_name_q(name_q, q) name_q.extend( USER.set_name_q_sp(name_x, w_lags, name_q, lag_q, force_all=True)) cols2regi = REGI.check_cols2regi( constant_regi, cols2regi, x, yend=yend, add_cons=False) self.regimes_set = REGI._get_regimes_set(regimes) self.regimes = regimes USER.check_regimes(self.regimes_set, n, x.shape[1]) self.regime_err_sep = regime_err_sep self.regime_lag_sep = regime_lag_sep if regime_lag_sep == True: if regime_err_sep == False: raise Exception, "For spatial combo models, if spatial lag is set by regimes (regime_lag_sep=True), spatial error must also be set by regimes (regime_err_sep=True)." add_lag = [w_lags, lag_q] else: if regime_err_sep == True: raise Exception, "For spatial combo models, if spatial error is set by regimes (regime_err_sep=True), all coefficients including lambda (regime_lag_sep=True) must be set by regimes." cols2regi += [False] add_lag = False yend, q = set_endog(y, x, w, yend, q, w_lags, lag_q) name_yend.append(USER.set_name_yend_sp(self.name_y)) GM_Endog_Error_Regimes.__init__(self, y=y, x=x, yend=yend, q=q, regimes=regimes, w=w, vm=vm, constant_regi=constant_regi, cols2regi=cols2regi, regime_err_sep=regime_err_sep, cores=cores, name_y=self.name_y, name_x=name_x, name_yend=name_yend, name_q=name_q, name_w=name_w, name_ds=name_ds, name_regimes=name_regimes, summ=False, add_lag=add_lag) if regime_err_sep != True: self.rho = self.betas[-2] self.predy_e, self.e_pred, warn = sp_att(w, self.y, self.predy, yend[:, -1].reshape(self.n, 1), self.rho) set_warn(self, warn) self.title = "SPATIALLY WEIGHTED TWO STAGE LEAST SQUARES - REGIMES" SUMMARY.GM_Combo(reg=self, w=w, vm=vm, regimes=True) def _work_error(y, x, regi_ids, r, w, name_ds, name_y, name_x, name_w, name_regimes): w_r, warn = REGI.w_regime(w, regi_ids[r], r, transform=True) y_r = y[regi_ids[r]] x_r = x[regi_ids[r]] x_constant = USER.check_constant(x_r) model = BaseGM_Error(y_r, x_constant, w_r.sparse) set_warn(model, warn) model.w = w_r model.title = "SPATIALLY WEIGHTED LEAST SQUARES ESTIMATION - REGIME %s" % r model.name_ds = name_ds model.name_y = '%s_%s' % (str(r), name_y) model.name_x = ['%s_%s' % (str(r), i) for i in name_x] model.name_w = name_w model.name_regimes = name_regimes return model def _work_endog_error(y, x, yend, q, regi_ids, r, w, name_ds, name_y, name_x, name_yend, name_q, name_w, name_regimes, add_lag): w_r, warn = REGI.w_regime(w, regi_ids[r], r, transform=True) y_r = y[regi_ids[r]] x_r = x[regi_ids[r]] if yend != None: yend_r = yend[regi_ids[r]] q_r = q[regi_ids[r]] else: yend_r, q_r = None, None if add_lag != False: yend_r, q_r = set_endog( y_r, x_r, w_r, yend_r, q_r, add_lag[0], add_lag[1]) x_constant = USER.check_constant(x_r) model = BaseGM_Endog_Error(y_r, x_constant, yend_r, q_r, w_r.sparse) set_warn(model, warn) if add_lag != False: model.rho = model.betas[-2] model.predy_e, model.e_pred, warn = sp_att(w_r, model.y, model.predy, model.yend[:, -1].reshape(model.n, 1), model.rho) set_warn(model, warn) model.w = w_r model.title = "SPATIALLY WEIGHTED TWO STAGE LEAST SQUARES - REGIME %s" % r model.name_ds = name_ds model.name_y = '%s_%s' % (str(r), name_y) model.name_x = ['%s_%s' % (str(r), i) for i in name_x] model.name_yend = ['%s_%s' % (str(r), i) for i in name_yend] model.name_z = model.name_x + model.name_yend + ['lambda'] model.name_q = ['%s_%s' % (str(r), i) for i in name_q] model.name_h = model.name_x + model.name_q model.name_w = name_w model.name_regimes = name_regimes return model def _test(): import doctest start_suppress = np.get_printoptions()['suppress'] np.set_printoptions(suppress=True) doctest.testmod() np.set_printoptions(suppress=start_suppress) if __name__ == '__main__': _test() import pysal import numpy as np dbf = pysal.open(pysal.examples.get_path('columbus.dbf'), 'r') y = np.array([dbf.by_col('CRIME')]).T names_to_extract = ['INC'] x = np.array([dbf.by_col(name) for name in names_to_extract]).T yd_var = ['HOVAL'] yend = np.array([dbf.by_col(name) for name in yd_var]).T q_var = ['DISCBD'] q = np.array([dbf.by_col(name) for name in q_var]).T regimes = regimes = dbf.by_col('NSA') w = pysal.open(pysal.examples.get_path("columbus.gal"), 'r').read() w.transform = 'r' model = GM_Error_Regimes(y, x, regimes=regimes, w=w, name_y='crime', name_x=[ 'income'], name_regimes='nsa', name_ds='columbus', regime_err_sep=True) print model.summary
spreg-git/pysal
pysal/spreg/error_sp_regimes.py
Python
bsd-3-clause
64,257
[ "COLUMBUS" ]
f47f1f3fc1957246cd8b38636dbff796b4f0a3cee3296102ee407f315fd85e57
from __future__ import division, unicode_literals import unittest import os import json import scipy from io import open from pymatgen.phonon.dos import CompletePhononDos from pymatgen.phonon.plotter import PhononDosPlotter, PhononBSPlotter, ThermoPlotter from pymatgen.phonon.bandstructure import PhononBandStructureSymmLine test_dir = os.path.join(os.path.dirname(__file__), "..", "..", "..", 'test_files') class PhononDosPlotterTest(unittest.TestCase): def setUp(self): with open(os.path.join(test_dir, "NaCl_complete_ph_dos.json"), "r") as f: self.dos = CompletePhononDos.from_dict(json.load(f)) self.plotter = PhononDosPlotter(sigma=0.2, stack=True) self.plotter_nostack = PhononDosPlotter(sigma=0.2, stack=False) def test_add_dos_dict(self): d = self.plotter.get_dos_dict() self.assertEqual(len(d), 0) self.plotter.add_dos_dict(self.dos.get_element_dos(), key_sort_func=lambda x: x.X) d = self.plotter.get_dos_dict() self.assertEqual(len(d), 2) def test_get_dos_dict(self): self.plotter.add_dos_dict(self.dos.get_element_dos(), key_sort_func=lambda x: x.X) d = self.plotter.get_dos_dict() for el in ["Na", "Cl"]: self.assertIn(el, d) def test_plot(self): # Disabling latex for testing. from matplotlib import rc rc('text', usetex=False) self.plotter.add_dos("Total", self.dos) self.plotter.get_plot(units="mev") self.plotter_nostack.add_dos("Total", self.dos) self.plotter_nostack.get_plot(units="mev") class PhononBSPlotterTest(unittest.TestCase): def setUp(self): with open(os.path.join(test_dir, "NaCl_phonon_bandstructure.json"), "r") as f: d = json.loads(f.read()) self.bs = PhononBandStructureSymmLine.from_dict(d) self.plotter = PhononBSPlotter(self.bs) def test_bs_plot_data(self): self.assertEqual(len(self.plotter.bs_plot_data()['distances'][0]), 51, "wrong number of distances in the first branch") self.assertEqual(len(self.plotter.bs_plot_data()['distances']), 4, "wrong number of branches") self.assertEqual( sum([len(e) for e in self.plotter.bs_plot_data()['distances']]), 204, "wrong number of distances") self.assertEqual(self.plotter.bs_plot_data()['ticks']['label'][4], "Y", "wrong tick label") self.assertEqual(len(self.plotter.bs_plot_data()['ticks']['label']), 8, "wrong number of tick labels") def test_plot(self): # Disabling latex for testing. from matplotlib import rc rc('text', usetex=False) self.plotter.get_plot(units="mev") class ThermoPlotterTest(unittest.TestCase): def setUp(self): with open(os.path.join(test_dir, "NaCl_complete_ph_dos.json"), "r") as f: self.dos = CompletePhononDos.from_dict(json.load(f)) self.plotter = ThermoPlotter(self.dos, self.dos.structure) def test_plot_functions(self): # Disabling latex for testing. from matplotlib import rc rc('text', usetex=False) self.plotter.plot_cv(5, 100, 5, show=False) self.plotter.plot_entropy(5, 100, 5, show=False) self.plotter.plot_internal_energy(5, 100, 5, show=False) self.plotter.plot_helmholtz_free_energy(5, 100, 5, show=False) self.plotter.plot_thermodynamic_properties(5, 100, 5, show=False) if __name__ == "__main__": unittest.main()
czhengsci/pymatgen
pymatgen/phonon/tests/test_plotter.py
Python
mit
3,708
[ "pymatgen" ]
1aa4c5d37525c26c10d4a28e3c93a1a4750eb5b2939b1739fd369f1885f44fe7
# # Gramps - a GTK+/GNOME based genealogy program # # Copyright (C) 2009 Benny Malengier # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; either version 2 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program; if not, write to the Free Software # Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA. # from gramps.gen.plug._pluginreg import * from gramps.gen.const import GRAMPS_LOCALE as glocale _ = glocale.translation.gettext MODULE_VERSION="5.2" # this is the default in gen/plug/_pluginreg.py: plg.require_active = True #------------------------------------------------------------------------ # # Family Lines Graph # #------------------------------------------------------------------------ plg = newplugin() plg.id = 'familylines_graph' plg.name = _("Family Lines Graph") plg.description = _("Produces family line graphs using Graphviz.") plg.version = '1.0' plg.gramps_target_version = MODULE_VERSION plg.status = STABLE plg.fname = 'gvfamilylines.py' plg.ptype = REPORT plg.authors = ["Stephane Charette"] plg.authors_email = ["stephanecharette@gmail.com"] plg.category = CATEGORY_GRAPHVIZ plg.reportclass = 'FamilyLinesReport' plg.optionclass = 'FamilyLinesOptions' plg.report_modes = [REPORT_MODE_GUI, REPORT_MODE_CLI] plg.require_active = False #------------------------------------------------------------------------ # # Hourglass Graph # #------------------------------------------------------------------------ plg = newplugin() plg.id = 'hourglass_graph' plg.name = _("Hourglass Graph") plg.description = _("Produces an hourglass graph using Graphviz.") plg.version = '1.0' plg.gramps_target_version = MODULE_VERSION plg.status = STABLE plg.fname = 'gvhourglass.py' plg.ptype = REPORT plg.authors = ["Brian G. Matherly"] plg.authors_email = ["brian@gramps-project.org"] plg.category = CATEGORY_GRAPHVIZ plg.reportclass = 'HourGlassReport' plg.optionclass = 'HourGlassOptions' plg.report_modes = [REPORT_MODE_GUI, REPORT_MODE_CLI] #------------------------------------------------------------------------ # # Relationship Graph # #------------------------------------------------------------------------ plg = newplugin() plg.id = 'rel_graph' plg.name = _("Relationship Graph") plg.description = _("Produces relationship graphs using Graphviz.") plg.version = '1.0' plg.gramps_target_version = MODULE_VERSION plg.status = STABLE plg.fname = 'gvrelgraph.py' plg.ptype = REPORT plg.authors = ["Brian G. Matherly"] plg.authors_email = ["brian@gramps-project.org"] plg.category = CATEGORY_GRAPHVIZ plg.reportclass = 'RelGraphReport' plg.optionclass = 'RelGraphOptions' plg.report_modes = [REPORT_MODE_GUI, REPORT_MODE_CLI]
Fedik/gramps
gramps/plugins/graph/graphplugins.gpr.py
Python
gpl-2.0
3,139
[ "Brian" ]
bddfb8324d8d5f2058294aa98aa195fc4e8e07180bc705f6800428d4a5b4cb32
# -*- coding: utf-8 -*- from lxml import etree from lxml import html import requests #doesn't work def main(): url = 'http://lispon.moe/cdn/activity/act161108/index.html?aUserId=1494366573' page = requests.get(url) tree = html.fromstring(page.content) print(page.content) xpath_selector = "//a/@href" #xpath_selector = "//p[contains(@class,'followed')]" prices = tree.xpath(xpath_selector) print(prices) if __name__ == '__main__': main()
umyuu/Sample
src/Python3/Q102431/exsample.py
Python
mit
478
[ "MOE" ]
6b06cfac3e6511c5937fa846fad95de1d83ed523485cb30d90de533f3dad582d
#!/bin/env python """ Illustrate how to combine a SMIRNOFF parameterized small molecule with an AMBER parameterized protein using ParmEd. """ # # Load and parameterize the small molecule # # Load the small molecule from openff.toolkit.utils import get_data_file_path ligand_filename = get_data_file_path('molecules/toluene.mol2') molecule = Molecule.from_file(ligand_filename) # Load the smirnoff99Frosst force field from openff.toolkit.typing.engines import smirnoff forcefield = smirnoff.ForceField('test_forcefields/test_forcefield.offxml') # Create a ParmEd structure for the molecule molecule_structure = forcefield.create_parmed_structure(topology=molecule.to_topology(), positions=molecule.positions) print('Molecule:', molecule_structure) # # Load and parameterize the protein # # Load the protein topology protein_pdb_filename = get_data_file_path('proteins/T4-protein.pdb') protein_pdbfile = app.PDBFile(protein_pdb_filename) # Load the AMBER protein force field, along with a solvent force field from simtk.openmm import app protein_forcefield = 'amber99sbildn.xml' solvent_forcefield = 'tip3p.xml' forcefield = app.ForceField(protein_forcefield, solvent_forcefield) # Parameterize the protein protein_system = forcefield.createSystem(proteinpdb.topology) # Create a ParmEd Structure for the protein protein_structure = parmed.openmm.load_topology(proteinpdb.topology, protein_system, xyz=proteinpdb.positions) print('Protein:', protein_structure) # Combine the ParmEd Structure objects to produce a fully parameterized complex # that can now be exported to AMBER, CHARMM, OpenMM, and other packages # Note that the addition should always add the small molecule second so the box vectors if the first item (the protein) are to be preserved complex_structure = protein_structure + molecule_structure print('Complex:', complex_structure) # TODO: How can we add solvent while ensuring the ligand doesn't overlap with solvent molecules? # TODO: Can we have SMIRNOFF ForceField create an OpenMM ffxml file for the ligand, and then use the OpenMM pipeline? # TODO: Or can OpenMM just use dummy parameters?
open-forcefield-group/openforcefield
examples/deprecated/mixedFF_structure/generate_mixedFF_complex.py
Python
mit
2,220
[ "Amber", "CHARMM", "OpenMM" ]
a14b5069845aae1ee5c9e858cee047475db2f15bb0438bdac9c61dbc1e1c679a
#!/usr/bin/python # -*- coding: utf-8 -*- # # Copyright 2013 The Plaso Project Authors. # Please see the AUTHORS file for details on individual authors. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """This file contains a formatter for the Mozilla Firefox history.""" from plaso.lib import errors from plaso.lib import eventdata class FirefoxBookmarkAnnotationFormatter(eventdata.ConditionalEventFormatter): """Formatter for a Firefox places.sqlite bookmark annotation.""" DATA_TYPE = 'firefox:places:bookmark_annotation' FORMAT_STRING_PIECES = [ u'Bookmark Annotation: [{content}]', u'to bookmark [{title}]', u'({url})'] FORMAT_STRING_SHORT_PIECES = [u'Bookmark Annotation: {title}'] SOURCE_LONG = 'Firefox History' SOURCE_SHORT = 'WEBHIST' class FirefoxBookmarkFolderFormatter(eventdata.EventFormatter): """Formatter for a Firefox places.sqlite bookmark folder.""" DATA_TYPE = 'firefox:places:bookmark_folder' FORMAT_STRING = u'{title}' SOURCE_LONG = 'Firefox History' SOURCE_SHORT = 'WEBHIST' class FirefoxBookmarkFormatter(eventdata.ConditionalEventFormatter): """Formatter for a Firefox places.sqlite URL bookmark.""" DATA_TYPE = 'firefox:places:bookmark' FORMAT_STRING_PIECES = [ u'Bookmark {type}', u'{title}', u'({url})', u'[{places_title}]', u'visit count {visit_count}'] FORMAT_STRING_SHORT_PIECES = [ u'Bookmarked {title}', u'({url})'] SOURCE_LONG = 'Firefox History' SOURCE_SHORT = 'WEBHIST' class FirefoxPageVisitFormatter(eventdata.ConditionalEventFormatter): """Formatter for a Firefox places.sqlite page visited.""" DATA_TYPE = 'firefox:places:page_visited' # Transitions defined in the source file: # src/toolkit/components/places/nsINavHistoryService.idl # Also contains further explanation into what each of these settings mean. _URL_TRANSITIONS = { 1: 'LINK', 2: 'TYPED', 3: 'BOOKMARK', 4: 'EMBED', 5: 'REDIRECT_PERMANENT', 6: 'REDIRECT_TEMPORARY', 7: 'DOWNLOAD', 8: 'FRAMED_LINK', } _URL_TRANSITIONS.setdefault('UNKOWN') # TODO: Make extra conditional formatting. FORMAT_STRING_PIECES = [ u'{url}', u'({title})', u'[count: {visit_count}]', u'Host: {host}', u'{extra_string}'] FORMAT_STRING_SHORT_PIECES = [u'URL: {url}'] SOURCE_LONG = 'Firefox History' SOURCE_SHORT = 'WEBHIST' def GetMessages(self, event_object): """Return the message strings.""" if self.DATA_TYPE != event_object.data_type: raise errors.WrongFormatter(u'Unsupported data type: {0:s}.'.format( event_object.data_type)) transition = self._URL_TRANSITIONS.get( getattr(event_object, 'visit_type', 0), None) if transition: transition_str = u'Transition: {0!s}'.format(transition) if hasattr(event_object, 'extra'): if transition: event_object.extra.append(transition_str) event_object.extra_string = u' '.join(event_object.extra) elif transition: event_object.extra_string = transition_str return super(FirefoxPageVisitFormatter, self).GetMessages(event_object) class FirefoxDowloadFormatter(eventdata.EventFormatter): """Formatter for a Firefox dowloads.sqlite dowload.""" DATA_TYPE = 'firefox:downloads:download' FORMAT_STRING = (u'{url} ({full_path}). Received: {received_bytes} bytes ' u'out of: {total_bytes} bytes.') FORMAT_STRING_SHORT = u'{full_path} downloaded ({received_bytes} bytes)' SOURCE_LONG = 'Firefox History' SOURCE_SHORT = 'WEBHIST'
iwm911/plaso
plaso/formatters/firefox.py
Python
apache-2.0
4,092
[ "VisIt" ]
6b0e821657c9f2951052233a855fa346cb746abdf621b5afeec2efaf414d9c05
# -*- coding: utf-8 -*- # Copyright 2022 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # import os import mock import grpc from grpc.experimental import aio import math import pytest from proto.marshal.rules.dates import DurationRule, TimestampRule from google.api_core import client_options from google.api_core import exceptions as core_exceptions from google.api_core import future from google.api_core import gapic_v1 from google.api_core import grpc_helpers from google.api_core import grpc_helpers_async from google.api_core import operation from google.api_core import operation_async # type: ignore from google.api_core import operations_v1 from google.api_core import path_template from google.auth import credentials as ga_credentials from google.auth.exceptions import MutualTLSChannelError from google.cloud.resourcemanager_v3.services.tag_keys import TagKeysAsyncClient from google.cloud.resourcemanager_v3.services.tag_keys import TagKeysClient from google.cloud.resourcemanager_v3.services.tag_keys import pagers from google.cloud.resourcemanager_v3.services.tag_keys import transports from google.cloud.resourcemanager_v3.types import tag_keys from google.iam.v1 import iam_policy_pb2 # type: ignore from google.iam.v1 import options_pb2 # type: ignore from google.iam.v1 import policy_pb2 # type: ignore from google.longrunning import operations_pb2 from google.oauth2 import service_account from google.protobuf import field_mask_pb2 # type: ignore from google.protobuf import timestamp_pb2 # type: ignore from google.type import expr_pb2 # type: ignore import google.auth def client_cert_source_callback(): return b"cert bytes", b"key bytes" # If default endpoint is localhost, then default mtls endpoint will be the same. # This method modifies the default endpoint so the client can produce a different # mtls endpoint for endpoint testing purposes. def modify_default_endpoint(client): return ( "foo.googleapis.com" if ("localhost" in client.DEFAULT_ENDPOINT) else client.DEFAULT_ENDPOINT ) def test__get_default_mtls_endpoint(): api_endpoint = "example.googleapis.com" api_mtls_endpoint = "example.mtls.googleapis.com" sandbox_endpoint = "example.sandbox.googleapis.com" sandbox_mtls_endpoint = "example.mtls.sandbox.googleapis.com" non_googleapi = "api.example.com" assert TagKeysClient._get_default_mtls_endpoint(None) is None assert TagKeysClient._get_default_mtls_endpoint(api_endpoint) == api_mtls_endpoint assert ( TagKeysClient._get_default_mtls_endpoint(api_mtls_endpoint) == api_mtls_endpoint ) assert ( TagKeysClient._get_default_mtls_endpoint(sandbox_endpoint) == sandbox_mtls_endpoint ) assert ( TagKeysClient._get_default_mtls_endpoint(sandbox_mtls_endpoint) == sandbox_mtls_endpoint ) assert TagKeysClient._get_default_mtls_endpoint(non_googleapi) == non_googleapi @pytest.mark.parametrize("client_class", [TagKeysClient, TagKeysAsyncClient,]) def test_tag_keys_client_from_service_account_info(client_class): creds = ga_credentials.AnonymousCredentials() with mock.patch.object( service_account.Credentials, "from_service_account_info" ) as factory: factory.return_value = creds info = {"valid": True} client = client_class.from_service_account_info(info) assert client.transport._credentials == creds assert isinstance(client, client_class) assert client.transport._host == "cloudresourcemanager.googleapis.com:443" @pytest.mark.parametrize( "transport_class,transport_name", [ (transports.TagKeysGrpcTransport, "grpc"), (transports.TagKeysGrpcAsyncIOTransport, "grpc_asyncio"), ], ) def test_tag_keys_client_service_account_always_use_jwt( transport_class, transport_name ): with mock.patch.object( service_account.Credentials, "with_always_use_jwt_access", create=True ) as use_jwt: creds = service_account.Credentials(None, None, None) transport = transport_class(credentials=creds, always_use_jwt_access=True) use_jwt.assert_called_once_with(True) with mock.patch.object( service_account.Credentials, "with_always_use_jwt_access", create=True ) as use_jwt: creds = service_account.Credentials(None, None, None) transport = transport_class(credentials=creds, always_use_jwt_access=False) use_jwt.assert_not_called() @pytest.mark.parametrize("client_class", [TagKeysClient, TagKeysAsyncClient,]) def test_tag_keys_client_from_service_account_file(client_class): creds = ga_credentials.AnonymousCredentials() with mock.patch.object( service_account.Credentials, "from_service_account_file" ) as factory: factory.return_value = creds client = client_class.from_service_account_file("dummy/file/path.json") assert client.transport._credentials == creds assert isinstance(client, client_class) client = client_class.from_service_account_json("dummy/file/path.json") assert client.transport._credentials == creds assert isinstance(client, client_class) assert client.transport._host == "cloudresourcemanager.googleapis.com:443" def test_tag_keys_client_get_transport_class(): transport = TagKeysClient.get_transport_class() available_transports = [ transports.TagKeysGrpcTransport, ] assert transport in available_transports transport = TagKeysClient.get_transport_class("grpc") assert transport == transports.TagKeysGrpcTransport @pytest.mark.parametrize( "client_class,transport_class,transport_name", [ (TagKeysClient, transports.TagKeysGrpcTransport, "grpc"), (TagKeysAsyncClient, transports.TagKeysGrpcAsyncIOTransport, "grpc_asyncio"), ], ) @mock.patch.object( TagKeysClient, "DEFAULT_ENDPOINT", modify_default_endpoint(TagKeysClient) ) @mock.patch.object( TagKeysAsyncClient, "DEFAULT_ENDPOINT", modify_default_endpoint(TagKeysAsyncClient) ) def test_tag_keys_client_client_options(client_class, transport_class, transport_name): # Check that if channel is provided we won't create a new one. with mock.patch.object(TagKeysClient, "get_transport_class") as gtc: transport = transport_class(credentials=ga_credentials.AnonymousCredentials()) client = client_class(transport=transport) gtc.assert_not_called() # Check that if channel is provided via str we will create a new one. with mock.patch.object(TagKeysClient, "get_transport_class") as gtc: client = client_class(transport=transport_name) gtc.assert_called() # Check the case api_endpoint is provided. options = client_options.ClientOptions(api_endpoint="squid.clam.whelk") with mock.patch.object(transport_class, "__init__") as patched: patched.return_value = None client = client_class(transport=transport_name, client_options=options) patched.assert_called_once_with( credentials=None, credentials_file=None, host="squid.clam.whelk", scopes=None, client_cert_source_for_mtls=None, quota_project_id=None, client_info=transports.base.DEFAULT_CLIENT_INFO, always_use_jwt_access=True, ) # Check the case api_endpoint is not provided and GOOGLE_API_USE_MTLS_ENDPOINT is # "never". with mock.patch.dict(os.environ, {"GOOGLE_API_USE_MTLS_ENDPOINT": "never"}): with mock.patch.object(transport_class, "__init__") as patched: patched.return_value = None client = client_class(transport=transport_name) patched.assert_called_once_with( credentials=None, credentials_file=None, host=client.DEFAULT_ENDPOINT, scopes=None, client_cert_source_for_mtls=None, quota_project_id=None, client_info=transports.base.DEFAULT_CLIENT_INFO, always_use_jwt_access=True, ) # Check the case api_endpoint is not provided and GOOGLE_API_USE_MTLS_ENDPOINT is # "always". with mock.patch.dict(os.environ, {"GOOGLE_API_USE_MTLS_ENDPOINT": "always"}): with mock.patch.object(transport_class, "__init__") as patched: patched.return_value = None client = client_class(transport=transport_name) patched.assert_called_once_with( credentials=None, credentials_file=None, host=client.DEFAULT_MTLS_ENDPOINT, scopes=None, client_cert_source_for_mtls=None, quota_project_id=None, client_info=transports.base.DEFAULT_CLIENT_INFO, always_use_jwt_access=True, ) # Check the case api_endpoint is not provided and GOOGLE_API_USE_MTLS_ENDPOINT has # unsupported value. with mock.patch.dict(os.environ, {"GOOGLE_API_USE_MTLS_ENDPOINT": "Unsupported"}): with pytest.raises(MutualTLSChannelError): client = client_class(transport=transport_name) # Check the case GOOGLE_API_USE_CLIENT_CERTIFICATE has unsupported value. with mock.patch.dict( os.environ, {"GOOGLE_API_USE_CLIENT_CERTIFICATE": "Unsupported"} ): with pytest.raises(ValueError): client = client_class(transport=transport_name) # Check the case quota_project_id is provided options = client_options.ClientOptions(quota_project_id="octopus") with mock.patch.object(transport_class, "__init__") as patched: patched.return_value = None client = client_class(client_options=options, transport=transport_name) patched.assert_called_once_with( credentials=None, credentials_file=None, host=client.DEFAULT_ENDPOINT, scopes=None, client_cert_source_for_mtls=None, quota_project_id="octopus", client_info=transports.base.DEFAULT_CLIENT_INFO, always_use_jwt_access=True, ) @pytest.mark.parametrize( "client_class,transport_class,transport_name,use_client_cert_env", [ (TagKeysClient, transports.TagKeysGrpcTransport, "grpc", "true"), ( TagKeysAsyncClient, transports.TagKeysGrpcAsyncIOTransport, "grpc_asyncio", "true", ), (TagKeysClient, transports.TagKeysGrpcTransport, "grpc", "false"), ( TagKeysAsyncClient, transports.TagKeysGrpcAsyncIOTransport, "grpc_asyncio", "false", ), ], ) @mock.patch.object( TagKeysClient, "DEFAULT_ENDPOINT", modify_default_endpoint(TagKeysClient) ) @mock.patch.object( TagKeysAsyncClient, "DEFAULT_ENDPOINT", modify_default_endpoint(TagKeysAsyncClient) ) @mock.patch.dict(os.environ, {"GOOGLE_API_USE_MTLS_ENDPOINT": "auto"}) def test_tag_keys_client_mtls_env_auto( client_class, transport_class, transport_name, use_client_cert_env ): # This tests the endpoint autoswitch behavior. Endpoint is autoswitched to the default # mtls endpoint, if GOOGLE_API_USE_CLIENT_CERTIFICATE is "true" and client cert exists. # Check the case client_cert_source is provided. Whether client cert is used depends on # GOOGLE_API_USE_CLIENT_CERTIFICATE value. with mock.patch.dict( os.environ, {"GOOGLE_API_USE_CLIENT_CERTIFICATE": use_client_cert_env} ): options = client_options.ClientOptions( client_cert_source=client_cert_source_callback ) with mock.patch.object(transport_class, "__init__") as patched: patched.return_value = None client = client_class(client_options=options, transport=transport_name) if use_client_cert_env == "false": expected_client_cert_source = None expected_host = client.DEFAULT_ENDPOINT else: expected_client_cert_source = client_cert_source_callback expected_host = client.DEFAULT_MTLS_ENDPOINT patched.assert_called_once_with( credentials=None, credentials_file=None, host=expected_host, scopes=None, client_cert_source_for_mtls=expected_client_cert_source, quota_project_id=None, client_info=transports.base.DEFAULT_CLIENT_INFO, always_use_jwt_access=True, ) # Check the case ADC client cert is provided. Whether client cert is used depends on # GOOGLE_API_USE_CLIENT_CERTIFICATE value. with mock.patch.dict( os.environ, {"GOOGLE_API_USE_CLIENT_CERTIFICATE": use_client_cert_env} ): with mock.patch.object(transport_class, "__init__") as patched: with mock.patch( "google.auth.transport.mtls.has_default_client_cert_source", return_value=True, ): with mock.patch( "google.auth.transport.mtls.default_client_cert_source", return_value=client_cert_source_callback, ): if use_client_cert_env == "false": expected_host = client.DEFAULT_ENDPOINT expected_client_cert_source = None else: expected_host = client.DEFAULT_MTLS_ENDPOINT expected_client_cert_source = client_cert_source_callback patched.return_value = None client = client_class(transport=transport_name) patched.assert_called_once_with( credentials=None, credentials_file=None, host=expected_host, scopes=None, client_cert_source_for_mtls=expected_client_cert_source, quota_project_id=None, client_info=transports.base.DEFAULT_CLIENT_INFO, always_use_jwt_access=True, ) # Check the case client_cert_source and ADC client cert are not provided. with mock.patch.dict( os.environ, {"GOOGLE_API_USE_CLIENT_CERTIFICATE": use_client_cert_env} ): with mock.patch.object(transport_class, "__init__") as patched: with mock.patch( "google.auth.transport.mtls.has_default_client_cert_source", return_value=False, ): patched.return_value = None client = client_class(transport=transport_name) patched.assert_called_once_with( credentials=None, credentials_file=None, host=client.DEFAULT_ENDPOINT, scopes=None, client_cert_source_for_mtls=None, quota_project_id=None, client_info=transports.base.DEFAULT_CLIENT_INFO, always_use_jwt_access=True, ) @pytest.mark.parametrize("client_class", [TagKeysClient, TagKeysAsyncClient]) @mock.patch.object( TagKeysClient, "DEFAULT_ENDPOINT", modify_default_endpoint(TagKeysClient) ) @mock.patch.object( TagKeysAsyncClient, "DEFAULT_ENDPOINT", modify_default_endpoint(TagKeysAsyncClient) ) def test_tag_keys_client_get_mtls_endpoint_and_cert_source(client_class): mock_client_cert_source = mock.Mock() # Test the case GOOGLE_API_USE_CLIENT_CERTIFICATE is "true". with mock.patch.dict(os.environ, {"GOOGLE_API_USE_CLIENT_CERTIFICATE": "true"}): mock_api_endpoint = "foo" options = client_options.ClientOptions( client_cert_source=mock_client_cert_source, api_endpoint=mock_api_endpoint ) api_endpoint, cert_source = client_class.get_mtls_endpoint_and_cert_source( options ) assert api_endpoint == mock_api_endpoint assert cert_source == mock_client_cert_source # Test the case GOOGLE_API_USE_CLIENT_CERTIFICATE is "false". with mock.patch.dict(os.environ, {"GOOGLE_API_USE_CLIENT_CERTIFICATE": "false"}): mock_client_cert_source = mock.Mock() mock_api_endpoint = "foo" options = client_options.ClientOptions( client_cert_source=mock_client_cert_source, api_endpoint=mock_api_endpoint ) api_endpoint, cert_source = client_class.get_mtls_endpoint_and_cert_source( options ) assert api_endpoint == mock_api_endpoint assert cert_source is None # Test the case GOOGLE_API_USE_MTLS_ENDPOINT is "never". with mock.patch.dict(os.environ, {"GOOGLE_API_USE_MTLS_ENDPOINT": "never"}): api_endpoint, cert_source = client_class.get_mtls_endpoint_and_cert_source() assert api_endpoint == client_class.DEFAULT_ENDPOINT assert cert_source is None # Test the case GOOGLE_API_USE_MTLS_ENDPOINT is "always". with mock.patch.dict(os.environ, {"GOOGLE_API_USE_MTLS_ENDPOINT": "always"}): api_endpoint, cert_source = client_class.get_mtls_endpoint_and_cert_source() assert api_endpoint == client_class.DEFAULT_MTLS_ENDPOINT assert cert_source is None # Test the case GOOGLE_API_USE_MTLS_ENDPOINT is "auto" and default cert doesn't exist. with mock.patch.dict(os.environ, {"GOOGLE_API_USE_CLIENT_CERTIFICATE": "true"}): with mock.patch( "google.auth.transport.mtls.has_default_client_cert_source", return_value=False, ): api_endpoint, cert_source = client_class.get_mtls_endpoint_and_cert_source() assert api_endpoint == client_class.DEFAULT_ENDPOINT assert cert_source is None # Test the case GOOGLE_API_USE_MTLS_ENDPOINT is "auto" and default cert exists. with mock.patch.dict(os.environ, {"GOOGLE_API_USE_CLIENT_CERTIFICATE": "true"}): with mock.patch( "google.auth.transport.mtls.has_default_client_cert_source", return_value=True, ): with mock.patch( "google.auth.transport.mtls.default_client_cert_source", return_value=mock_client_cert_source, ): ( api_endpoint, cert_source, ) = client_class.get_mtls_endpoint_and_cert_source() assert api_endpoint == client_class.DEFAULT_MTLS_ENDPOINT assert cert_source == mock_client_cert_source @pytest.mark.parametrize( "client_class,transport_class,transport_name", [ (TagKeysClient, transports.TagKeysGrpcTransport, "grpc"), (TagKeysAsyncClient, transports.TagKeysGrpcAsyncIOTransport, "grpc_asyncio"), ], ) def test_tag_keys_client_client_options_scopes( client_class, transport_class, transport_name ): # Check the case scopes are provided. options = client_options.ClientOptions(scopes=["1", "2"],) with mock.patch.object(transport_class, "__init__") as patched: patched.return_value = None client = client_class(client_options=options, transport=transport_name) patched.assert_called_once_with( credentials=None, credentials_file=None, host=client.DEFAULT_ENDPOINT, scopes=["1", "2"], client_cert_source_for_mtls=None, quota_project_id=None, client_info=transports.base.DEFAULT_CLIENT_INFO, always_use_jwt_access=True, ) @pytest.mark.parametrize( "client_class,transport_class,transport_name,grpc_helpers", [ (TagKeysClient, transports.TagKeysGrpcTransport, "grpc", grpc_helpers), ( TagKeysAsyncClient, transports.TagKeysGrpcAsyncIOTransport, "grpc_asyncio", grpc_helpers_async, ), ], ) def test_tag_keys_client_client_options_credentials_file( client_class, transport_class, transport_name, grpc_helpers ): # Check the case credentials file is provided. options = client_options.ClientOptions(credentials_file="credentials.json") with mock.patch.object(transport_class, "__init__") as patched: patched.return_value = None client = client_class(client_options=options, transport=transport_name) patched.assert_called_once_with( credentials=None, credentials_file="credentials.json", host=client.DEFAULT_ENDPOINT, scopes=None, client_cert_source_for_mtls=None, quota_project_id=None, client_info=transports.base.DEFAULT_CLIENT_INFO, always_use_jwt_access=True, ) def test_tag_keys_client_client_options_from_dict(): with mock.patch( "google.cloud.resourcemanager_v3.services.tag_keys.transports.TagKeysGrpcTransport.__init__" ) as grpc_transport: grpc_transport.return_value = None client = TagKeysClient(client_options={"api_endpoint": "squid.clam.whelk"}) grpc_transport.assert_called_once_with( credentials=None, credentials_file=None, host="squid.clam.whelk", scopes=None, client_cert_source_for_mtls=None, quota_project_id=None, client_info=transports.base.DEFAULT_CLIENT_INFO, always_use_jwt_access=True, ) @pytest.mark.parametrize( "client_class,transport_class,transport_name,grpc_helpers", [ (TagKeysClient, transports.TagKeysGrpcTransport, "grpc", grpc_helpers), ( TagKeysAsyncClient, transports.TagKeysGrpcAsyncIOTransport, "grpc_asyncio", grpc_helpers_async, ), ], ) def test_tag_keys_client_create_channel_credentials_file( client_class, transport_class, transport_name, grpc_helpers ): # Check the case credentials file is provided. options = client_options.ClientOptions(credentials_file="credentials.json") with mock.patch.object(transport_class, "__init__") as patched: patched.return_value = None client = client_class(client_options=options, transport=transport_name) patched.assert_called_once_with( credentials=None, credentials_file="credentials.json", host=client.DEFAULT_ENDPOINT, scopes=None, client_cert_source_for_mtls=None, quota_project_id=None, client_info=transports.base.DEFAULT_CLIENT_INFO, always_use_jwt_access=True, ) # test that the credentials from file are saved and used as the credentials. with mock.patch.object( google.auth, "load_credentials_from_file", autospec=True ) as load_creds, mock.patch.object( google.auth, "default", autospec=True ) as adc, mock.patch.object( grpc_helpers, "create_channel" ) as create_channel: creds = ga_credentials.AnonymousCredentials() file_creds = ga_credentials.AnonymousCredentials() load_creds.return_value = (file_creds, None) adc.return_value = (creds, None) client = client_class(client_options=options, transport=transport_name) create_channel.assert_called_with( "cloudresourcemanager.googleapis.com:443", credentials=file_creds, credentials_file=None, quota_project_id=None, default_scopes=( "https://www.googleapis.com/auth/cloud-platform", "https://www.googleapis.com/auth/cloud-platform.read-only", ), scopes=None, default_host="cloudresourcemanager.googleapis.com", ssl_credentials=None, options=[ ("grpc.max_send_message_length", -1), ("grpc.max_receive_message_length", -1), ], ) @pytest.mark.parametrize("request_type", [tag_keys.ListTagKeysRequest, dict,]) def test_list_tag_keys(request_type, transport: str = "grpc"): client = TagKeysClient( credentials=ga_credentials.AnonymousCredentials(), transport=transport, ) # Everything is optional in proto3 as far as the runtime is concerned, # and we are mocking out the actual API, so just send an empty request. request = request_type() # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.list_tag_keys), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = tag_keys.ListTagKeysResponse( next_page_token="next_page_token_value", ) response = client.list_tag_keys(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) == 1 _, args, _ = call.mock_calls[0] assert args[0] == tag_keys.ListTagKeysRequest() # Establish that the response is the type that we expect. assert isinstance(response, pagers.ListTagKeysPager) assert response.next_page_token == "next_page_token_value" def test_list_tag_keys_empty_call(): # This test is a coverage failsafe to make sure that totally empty calls, # i.e. request == None and no flattened fields passed, work. client = TagKeysClient( credentials=ga_credentials.AnonymousCredentials(), transport="grpc", ) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.list_tag_keys), "__call__") as call: client.list_tag_keys() call.assert_called() _, args, _ = call.mock_calls[0] assert args[0] == tag_keys.ListTagKeysRequest() @pytest.mark.asyncio async def test_list_tag_keys_async( transport: str = "grpc_asyncio", request_type=tag_keys.ListTagKeysRequest ): client = TagKeysAsyncClient( credentials=ga_credentials.AnonymousCredentials(), transport=transport, ) # Everything is optional in proto3 as far as the runtime is concerned, # and we are mocking out the actual API, so just send an empty request. request = request_type() # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.list_tag_keys), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = grpc_helpers_async.FakeUnaryUnaryCall( tag_keys.ListTagKeysResponse(next_page_token="next_page_token_value",) ) response = await client.list_tag_keys(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) _, args, _ = call.mock_calls[0] assert args[0] == tag_keys.ListTagKeysRequest() # Establish that the response is the type that we expect. assert isinstance(response, pagers.ListTagKeysAsyncPager) assert response.next_page_token == "next_page_token_value" @pytest.mark.asyncio async def test_list_tag_keys_async_from_dict(): await test_list_tag_keys_async(request_type=dict) def test_list_tag_keys_flattened(): client = TagKeysClient(credentials=ga_credentials.AnonymousCredentials(),) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.list_tag_keys), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = tag_keys.ListTagKeysResponse() # Call the method with a truthy value for each flattened field, # using the keyword arguments to the method. client.list_tag_keys(parent="parent_value",) # Establish that the underlying call was made with the expected # request object values. assert len(call.mock_calls) == 1 _, args, _ = call.mock_calls[0] arg = args[0].parent mock_val = "parent_value" assert arg == mock_val def test_list_tag_keys_flattened_error(): client = TagKeysClient(credentials=ga_credentials.AnonymousCredentials(),) # Attempting to call a method with both a request object and flattened # fields is an error. with pytest.raises(ValueError): client.list_tag_keys( tag_keys.ListTagKeysRequest(), parent="parent_value", ) @pytest.mark.asyncio async def test_list_tag_keys_flattened_async(): client = TagKeysAsyncClient(credentials=ga_credentials.AnonymousCredentials(),) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.list_tag_keys), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = tag_keys.ListTagKeysResponse() call.return_value = grpc_helpers_async.FakeUnaryUnaryCall( tag_keys.ListTagKeysResponse() ) # Call the method with a truthy value for each flattened field, # using the keyword arguments to the method. response = await client.list_tag_keys(parent="parent_value",) # Establish that the underlying call was made with the expected # request object values. assert len(call.mock_calls) _, args, _ = call.mock_calls[0] arg = args[0].parent mock_val = "parent_value" assert arg == mock_val @pytest.mark.asyncio async def test_list_tag_keys_flattened_error_async(): client = TagKeysAsyncClient(credentials=ga_credentials.AnonymousCredentials(),) # Attempting to call a method with both a request object and flattened # fields is an error. with pytest.raises(ValueError): await client.list_tag_keys( tag_keys.ListTagKeysRequest(), parent="parent_value", ) def test_list_tag_keys_pager(transport_name: str = "grpc"): client = TagKeysClient( credentials=ga_credentials.AnonymousCredentials, transport=transport_name, ) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.list_tag_keys), "__call__") as call: # Set the response to a series of pages. call.side_effect = ( tag_keys.ListTagKeysResponse( tag_keys=[tag_keys.TagKey(), tag_keys.TagKey(), tag_keys.TagKey(),], next_page_token="abc", ), tag_keys.ListTagKeysResponse(tag_keys=[], next_page_token="def",), tag_keys.ListTagKeysResponse( tag_keys=[tag_keys.TagKey(),], next_page_token="ghi", ), tag_keys.ListTagKeysResponse( tag_keys=[tag_keys.TagKey(), tag_keys.TagKey(),], ), RuntimeError, ) metadata = () pager = client.list_tag_keys(request={}) assert pager._metadata == metadata results = [i for i in pager] assert len(results) == 6 assert all(isinstance(i, tag_keys.TagKey) for i in results) def test_list_tag_keys_pages(transport_name: str = "grpc"): client = TagKeysClient( credentials=ga_credentials.AnonymousCredentials, transport=transport_name, ) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.list_tag_keys), "__call__") as call: # Set the response to a series of pages. call.side_effect = ( tag_keys.ListTagKeysResponse( tag_keys=[tag_keys.TagKey(), tag_keys.TagKey(), tag_keys.TagKey(),], next_page_token="abc", ), tag_keys.ListTagKeysResponse(tag_keys=[], next_page_token="def",), tag_keys.ListTagKeysResponse( tag_keys=[tag_keys.TagKey(),], next_page_token="ghi", ), tag_keys.ListTagKeysResponse( tag_keys=[tag_keys.TagKey(), tag_keys.TagKey(),], ), RuntimeError, ) pages = list(client.list_tag_keys(request={}).pages) for page_, token in zip(pages, ["abc", "def", "ghi", ""]): assert page_.raw_page.next_page_token == token @pytest.mark.asyncio async def test_list_tag_keys_async_pager(): client = TagKeysAsyncClient(credentials=ga_credentials.AnonymousCredentials,) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object( type(client.transport.list_tag_keys), "__call__", new_callable=mock.AsyncMock ) as call: # Set the response to a series of pages. call.side_effect = ( tag_keys.ListTagKeysResponse( tag_keys=[tag_keys.TagKey(), tag_keys.TagKey(), tag_keys.TagKey(),], next_page_token="abc", ), tag_keys.ListTagKeysResponse(tag_keys=[], next_page_token="def",), tag_keys.ListTagKeysResponse( tag_keys=[tag_keys.TagKey(),], next_page_token="ghi", ), tag_keys.ListTagKeysResponse( tag_keys=[tag_keys.TagKey(), tag_keys.TagKey(),], ), RuntimeError, ) async_pager = await client.list_tag_keys(request={},) assert async_pager.next_page_token == "abc" responses = [] async for response in async_pager: responses.append(response) assert len(responses) == 6 assert all(isinstance(i, tag_keys.TagKey) for i in responses) @pytest.mark.asyncio async def test_list_tag_keys_async_pages(): client = TagKeysAsyncClient(credentials=ga_credentials.AnonymousCredentials,) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object( type(client.transport.list_tag_keys), "__call__", new_callable=mock.AsyncMock ) as call: # Set the response to a series of pages. call.side_effect = ( tag_keys.ListTagKeysResponse( tag_keys=[tag_keys.TagKey(), tag_keys.TagKey(), tag_keys.TagKey(),], next_page_token="abc", ), tag_keys.ListTagKeysResponse(tag_keys=[], next_page_token="def",), tag_keys.ListTagKeysResponse( tag_keys=[tag_keys.TagKey(),], next_page_token="ghi", ), tag_keys.ListTagKeysResponse( tag_keys=[tag_keys.TagKey(), tag_keys.TagKey(),], ), RuntimeError, ) pages = [] async for page_ in (await client.list_tag_keys(request={})).pages: pages.append(page_) for page_, token in zip(pages, ["abc", "def", "ghi", ""]): assert page_.raw_page.next_page_token == token @pytest.mark.parametrize("request_type", [tag_keys.GetTagKeyRequest, dict,]) def test_get_tag_key(request_type, transport: str = "grpc"): client = TagKeysClient( credentials=ga_credentials.AnonymousCredentials(), transport=transport, ) # Everything is optional in proto3 as far as the runtime is concerned, # and we are mocking out the actual API, so just send an empty request. request = request_type() # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.get_tag_key), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = tag_keys.TagKey( name="name_value", parent="parent_value", short_name="short_name_value", namespaced_name="namespaced_name_value", description="description_value", etag="etag_value", ) response = client.get_tag_key(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) == 1 _, args, _ = call.mock_calls[0] assert args[0] == tag_keys.GetTagKeyRequest() # Establish that the response is the type that we expect. assert isinstance(response, tag_keys.TagKey) assert response.name == "name_value" assert response.parent == "parent_value" assert response.short_name == "short_name_value" assert response.namespaced_name == "namespaced_name_value" assert response.description == "description_value" assert response.etag == "etag_value" def test_get_tag_key_empty_call(): # This test is a coverage failsafe to make sure that totally empty calls, # i.e. request == None and no flattened fields passed, work. client = TagKeysClient( credentials=ga_credentials.AnonymousCredentials(), transport="grpc", ) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.get_tag_key), "__call__") as call: client.get_tag_key() call.assert_called() _, args, _ = call.mock_calls[0] assert args[0] == tag_keys.GetTagKeyRequest() @pytest.mark.asyncio async def test_get_tag_key_async( transport: str = "grpc_asyncio", request_type=tag_keys.GetTagKeyRequest ): client = TagKeysAsyncClient( credentials=ga_credentials.AnonymousCredentials(), transport=transport, ) # Everything is optional in proto3 as far as the runtime is concerned, # and we are mocking out the actual API, so just send an empty request. request = request_type() # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.get_tag_key), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = grpc_helpers_async.FakeUnaryUnaryCall( tag_keys.TagKey( name="name_value", parent="parent_value", short_name="short_name_value", namespaced_name="namespaced_name_value", description="description_value", etag="etag_value", ) ) response = await client.get_tag_key(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) _, args, _ = call.mock_calls[0] assert args[0] == tag_keys.GetTagKeyRequest() # Establish that the response is the type that we expect. assert isinstance(response, tag_keys.TagKey) assert response.name == "name_value" assert response.parent == "parent_value" assert response.short_name == "short_name_value" assert response.namespaced_name == "namespaced_name_value" assert response.description == "description_value" assert response.etag == "etag_value" @pytest.mark.asyncio async def test_get_tag_key_async_from_dict(): await test_get_tag_key_async(request_type=dict) def test_get_tag_key_field_headers(): client = TagKeysClient(credentials=ga_credentials.AnonymousCredentials(),) # Any value that is part of the HTTP/1.1 URI should be sent as # a field header. Set these to a non-empty value. request = tag_keys.GetTagKeyRequest() request.name = "name/value" # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.get_tag_key), "__call__") as call: call.return_value = tag_keys.TagKey() client.get_tag_key(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) == 1 _, args, _ = call.mock_calls[0] assert args[0] == request # Establish that the field header was sent. _, _, kw = call.mock_calls[0] assert ("x-goog-request-params", "name=name/value",) in kw["metadata"] @pytest.mark.asyncio async def test_get_tag_key_field_headers_async(): client = TagKeysAsyncClient(credentials=ga_credentials.AnonymousCredentials(),) # Any value that is part of the HTTP/1.1 URI should be sent as # a field header. Set these to a non-empty value. request = tag_keys.GetTagKeyRequest() request.name = "name/value" # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.get_tag_key), "__call__") as call: call.return_value = grpc_helpers_async.FakeUnaryUnaryCall(tag_keys.TagKey()) await client.get_tag_key(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) _, args, _ = call.mock_calls[0] assert args[0] == request # Establish that the field header was sent. _, _, kw = call.mock_calls[0] assert ("x-goog-request-params", "name=name/value",) in kw["metadata"] def test_get_tag_key_flattened(): client = TagKeysClient(credentials=ga_credentials.AnonymousCredentials(),) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.get_tag_key), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = tag_keys.TagKey() # Call the method with a truthy value for each flattened field, # using the keyword arguments to the method. client.get_tag_key(name="name_value",) # Establish that the underlying call was made with the expected # request object values. assert len(call.mock_calls) == 1 _, args, _ = call.mock_calls[0] arg = args[0].name mock_val = "name_value" assert arg == mock_val def test_get_tag_key_flattened_error(): client = TagKeysClient(credentials=ga_credentials.AnonymousCredentials(),) # Attempting to call a method with both a request object and flattened # fields is an error. with pytest.raises(ValueError): client.get_tag_key( tag_keys.GetTagKeyRequest(), name="name_value", ) @pytest.mark.asyncio async def test_get_tag_key_flattened_async(): client = TagKeysAsyncClient(credentials=ga_credentials.AnonymousCredentials(),) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.get_tag_key), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = tag_keys.TagKey() call.return_value = grpc_helpers_async.FakeUnaryUnaryCall(tag_keys.TagKey()) # Call the method with a truthy value for each flattened field, # using the keyword arguments to the method. response = await client.get_tag_key(name="name_value",) # Establish that the underlying call was made with the expected # request object values. assert len(call.mock_calls) _, args, _ = call.mock_calls[0] arg = args[0].name mock_val = "name_value" assert arg == mock_val @pytest.mark.asyncio async def test_get_tag_key_flattened_error_async(): client = TagKeysAsyncClient(credentials=ga_credentials.AnonymousCredentials(),) # Attempting to call a method with both a request object and flattened # fields is an error. with pytest.raises(ValueError): await client.get_tag_key( tag_keys.GetTagKeyRequest(), name="name_value", ) @pytest.mark.parametrize("request_type", [tag_keys.CreateTagKeyRequest, dict,]) def test_create_tag_key(request_type, transport: str = "grpc"): client = TagKeysClient( credentials=ga_credentials.AnonymousCredentials(), transport=transport, ) # Everything is optional in proto3 as far as the runtime is concerned, # and we are mocking out the actual API, so just send an empty request. request = request_type() # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.create_tag_key), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = operations_pb2.Operation(name="operations/spam") response = client.create_tag_key(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) == 1 _, args, _ = call.mock_calls[0] assert args[0] == tag_keys.CreateTagKeyRequest() # Establish that the response is the type that we expect. assert isinstance(response, future.Future) def test_create_tag_key_empty_call(): # This test is a coverage failsafe to make sure that totally empty calls, # i.e. request == None and no flattened fields passed, work. client = TagKeysClient( credentials=ga_credentials.AnonymousCredentials(), transport="grpc", ) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.create_tag_key), "__call__") as call: client.create_tag_key() call.assert_called() _, args, _ = call.mock_calls[0] assert args[0] == tag_keys.CreateTagKeyRequest() @pytest.mark.asyncio async def test_create_tag_key_async( transport: str = "grpc_asyncio", request_type=tag_keys.CreateTagKeyRequest ): client = TagKeysAsyncClient( credentials=ga_credentials.AnonymousCredentials(), transport=transport, ) # Everything is optional in proto3 as far as the runtime is concerned, # and we are mocking out the actual API, so just send an empty request. request = request_type() # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.create_tag_key), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = grpc_helpers_async.FakeUnaryUnaryCall( operations_pb2.Operation(name="operations/spam") ) response = await client.create_tag_key(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) _, args, _ = call.mock_calls[0] assert args[0] == tag_keys.CreateTagKeyRequest() # Establish that the response is the type that we expect. assert isinstance(response, future.Future) @pytest.mark.asyncio async def test_create_tag_key_async_from_dict(): await test_create_tag_key_async(request_type=dict) def test_create_tag_key_flattened(): client = TagKeysClient(credentials=ga_credentials.AnonymousCredentials(),) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.create_tag_key), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = operations_pb2.Operation(name="operations/op") # Call the method with a truthy value for each flattened field, # using the keyword arguments to the method. client.create_tag_key(tag_key=tag_keys.TagKey(name="name_value"),) # Establish that the underlying call was made with the expected # request object values. assert len(call.mock_calls) == 1 _, args, _ = call.mock_calls[0] arg = args[0].tag_key mock_val = tag_keys.TagKey(name="name_value") assert arg == mock_val def test_create_tag_key_flattened_error(): client = TagKeysClient(credentials=ga_credentials.AnonymousCredentials(),) # Attempting to call a method with both a request object and flattened # fields is an error. with pytest.raises(ValueError): client.create_tag_key( tag_keys.CreateTagKeyRequest(), tag_key=tag_keys.TagKey(name="name_value"), ) @pytest.mark.asyncio async def test_create_tag_key_flattened_async(): client = TagKeysAsyncClient(credentials=ga_credentials.AnonymousCredentials(),) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.create_tag_key), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = operations_pb2.Operation(name="operations/op") call.return_value = grpc_helpers_async.FakeUnaryUnaryCall( operations_pb2.Operation(name="operations/spam") ) # Call the method with a truthy value for each flattened field, # using the keyword arguments to the method. response = await client.create_tag_key( tag_key=tag_keys.TagKey(name="name_value"), ) # Establish that the underlying call was made with the expected # request object values. assert len(call.mock_calls) _, args, _ = call.mock_calls[0] arg = args[0].tag_key mock_val = tag_keys.TagKey(name="name_value") assert arg == mock_val @pytest.mark.asyncio async def test_create_tag_key_flattened_error_async(): client = TagKeysAsyncClient(credentials=ga_credentials.AnonymousCredentials(),) # Attempting to call a method with both a request object and flattened # fields is an error. with pytest.raises(ValueError): await client.create_tag_key( tag_keys.CreateTagKeyRequest(), tag_key=tag_keys.TagKey(name="name_value"), ) @pytest.mark.parametrize("request_type", [tag_keys.UpdateTagKeyRequest, dict,]) def test_update_tag_key(request_type, transport: str = "grpc"): client = TagKeysClient( credentials=ga_credentials.AnonymousCredentials(), transport=transport, ) # Everything is optional in proto3 as far as the runtime is concerned, # and we are mocking out the actual API, so just send an empty request. request = request_type() # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.update_tag_key), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = operations_pb2.Operation(name="operations/spam") response = client.update_tag_key(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) == 1 _, args, _ = call.mock_calls[0] assert args[0] == tag_keys.UpdateTagKeyRequest() # Establish that the response is the type that we expect. assert isinstance(response, future.Future) def test_update_tag_key_empty_call(): # This test is a coverage failsafe to make sure that totally empty calls, # i.e. request == None and no flattened fields passed, work. client = TagKeysClient( credentials=ga_credentials.AnonymousCredentials(), transport="grpc", ) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.update_tag_key), "__call__") as call: client.update_tag_key() call.assert_called() _, args, _ = call.mock_calls[0] assert args[0] == tag_keys.UpdateTagKeyRequest() @pytest.mark.asyncio async def test_update_tag_key_async( transport: str = "grpc_asyncio", request_type=tag_keys.UpdateTagKeyRequest ): client = TagKeysAsyncClient( credentials=ga_credentials.AnonymousCredentials(), transport=transport, ) # Everything is optional in proto3 as far as the runtime is concerned, # and we are mocking out the actual API, so just send an empty request. request = request_type() # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.update_tag_key), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = grpc_helpers_async.FakeUnaryUnaryCall( operations_pb2.Operation(name="operations/spam") ) response = await client.update_tag_key(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) _, args, _ = call.mock_calls[0] assert args[0] == tag_keys.UpdateTagKeyRequest() # Establish that the response is the type that we expect. assert isinstance(response, future.Future) @pytest.mark.asyncio async def test_update_tag_key_async_from_dict(): await test_update_tag_key_async(request_type=dict) def test_update_tag_key_field_headers(): client = TagKeysClient(credentials=ga_credentials.AnonymousCredentials(),) # Any value that is part of the HTTP/1.1 URI should be sent as # a field header. Set these to a non-empty value. request = tag_keys.UpdateTagKeyRequest() request.tag_key.name = "tag_key.name/value" # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.update_tag_key), "__call__") as call: call.return_value = operations_pb2.Operation(name="operations/op") client.update_tag_key(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) == 1 _, args, _ = call.mock_calls[0] assert args[0] == request # Establish that the field header was sent. _, _, kw = call.mock_calls[0] assert ("x-goog-request-params", "tag_key.name=tag_key.name/value",) in kw[ "metadata" ] @pytest.mark.asyncio async def test_update_tag_key_field_headers_async(): client = TagKeysAsyncClient(credentials=ga_credentials.AnonymousCredentials(),) # Any value that is part of the HTTP/1.1 URI should be sent as # a field header. Set these to a non-empty value. request = tag_keys.UpdateTagKeyRequest() request.tag_key.name = "tag_key.name/value" # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.update_tag_key), "__call__") as call: call.return_value = grpc_helpers_async.FakeUnaryUnaryCall( operations_pb2.Operation(name="operations/op") ) await client.update_tag_key(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) _, args, _ = call.mock_calls[0] assert args[0] == request # Establish that the field header was sent. _, _, kw = call.mock_calls[0] assert ("x-goog-request-params", "tag_key.name=tag_key.name/value",) in kw[ "metadata" ] def test_update_tag_key_flattened(): client = TagKeysClient(credentials=ga_credentials.AnonymousCredentials(),) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.update_tag_key), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = operations_pb2.Operation(name="operations/op") # Call the method with a truthy value for each flattened field, # using the keyword arguments to the method. client.update_tag_key( tag_key=tag_keys.TagKey(name="name_value"), update_mask=field_mask_pb2.FieldMask(paths=["paths_value"]), ) # Establish that the underlying call was made with the expected # request object values. assert len(call.mock_calls) == 1 _, args, _ = call.mock_calls[0] arg = args[0].tag_key mock_val = tag_keys.TagKey(name="name_value") assert arg == mock_val arg = args[0].update_mask mock_val = field_mask_pb2.FieldMask(paths=["paths_value"]) assert arg == mock_val def test_update_tag_key_flattened_error(): client = TagKeysClient(credentials=ga_credentials.AnonymousCredentials(),) # Attempting to call a method with both a request object and flattened # fields is an error. with pytest.raises(ValueError): client.update_tag_key( tag_keys.UpdateTagKeyRequest(), tag_key=tag_keys.TagKey(name="name_value"), update_mask=field_mask_pb2.FieldMask(paths=["paths_value"]), ) @pytest.mark.asyncio async def test_update_tag_key_flattened_async(): client = TagKeysAsyncClient(credentials=ga_credentials.AnonymousCredentials(),) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.update_tag_key), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = operations_pb2.Operation(name="operations/op") call.return_value = grpc_helpers_async.FakeUnaryUnaryCall( operations_pb2.Operation(name="operations/spam") ) # Call the method with a truthy value for each flattened field, # using the keyword arguments to the method. response = await client.update_tag_key( tag_key=tag_keys.TagKey(name="name_value"), update_mask=field_mask_pb2.FieldMask(paths=["paths_value"]), ) # Establish that the underlying call was made with the expected # request object values. assert len(call.mock_calls) _, args, _ = call.mock_calls[0] arg = args[0].tag_key mock_val = tag_keys.TagKey(name="name_value") assert arg == mock_val arg = args[0].update_mask mock_val = field_mask_pb2.FieldMask(paths=["paths_value"]) assert arg == mock_val @pytest.mark.asyncio async def test_update_tag_key_flattened_error_async(): client = TagKeysAsyncClient(credentials=ga_credentials.AnonymousCredentials(),) # Attempting to call a method with both a request object and flattened # fields is an error. with pytest.raises(ValueError): await client.update_tag_key( tag_keys.UpdateTagKeyRequest(), tag_key=tag_keys.TagKey(name="name_value"), update_mask=field_mask_pb2.FieldMask(paths=["paths_value"]), ) @pytest.mark.parametrize("request_type", [tag_keys.DeleteTagKeyRequest, dict,]) def test_delete_tag_key(request_type, transport: str = "grpc"): client = TagKeysClient( credentials=ga_credentials.AnonymousCredentials(), transport=transport, ) # Everything is optional in proto3 as far as the runtime is concerned, # and we are mocking out the actual API, so just send an empty request. request = request_type() # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.delete_tag_key), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = operations_pb2.Operation(name="operations/spam") response = client.delete_tag_key(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) == 1 _, args, _ = call.mock_calls[0] assert args[0] == tag_keys.DeleteTagKeyRequest() # Establish that the response is the type that we expect. assert isinstance(response, future.Future) def test_delete_tag_key_empty_call(): # This test is a coverage failsafe to make sure that totally empty calls, # i.e. request == None and no flattened fields passed, work. client = TagKeysClient( credentials=ga_credentials.AnonymousCredentials(), transport="grpc", ) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.delete_tag_key), "__call__") as call: client.delete_tag_key() call.assert_called() _, args, _ = call.mock_calls[0] assert args[0] == tag_keys.DeleteTagKeyRequest() @pytest.mark.asyncio async def test_delete_tag_key_async( transport: str = "grpc_asyncio", request_type=tag_keys.DeleteTagKeyRequest ): client = TagKeysAsyncClient( credentials=ga_credentials.AnonymousCredentials(), transport=transport, ) # Everything is optional in proto3 as far as the runtime is concerned, # and we are mocking out the actual API, so just send an empty request. request = request_type() # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.delete_tag_key), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = grpc_helpers_async.FakeUnaryUnaryCall( operations_pb2.Operation(name="operations/spam") ) response = await client.delete_tag_key(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) _, args, _ = call.mock_calls[0] assert args[0] == tag_keys.DeleteTagKeyRequest() # Establish that the response is the type that we expect. assert isinstance(response, future.Future) @pytest.mark.asyncio async def test_delete_tag_key_async_from_dict(): await test_delete_tag_key_async(request_type=dict) def test_delete_tag_key_field_headers(): client = TagKeysClient(credentials=ga_credentials.AnonymousCredentials(),) # Any value that is part of the HTTP/1.1 URI should be sent as # a field header. Set these to a non-empty value. request = tag_keys.DeleteTagKeyRequest() request.name = "name/value" # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.delete_tag_key), "__call__") as call: call.return_value = operations_pb2.Operation(name="operations/op") client.delete_tag_key(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) == 1 _, args, _ = call.mock_calls[0] assert args[0] == request # Establish that the field header was sent. _, _, kw = call.mock_calls[0] assert ("x-goog-request-params", "name=name/value",) in kw["metadata"] @pytest.mark.asyncio async def test_delete_tag_key_field_headers_async(): client = TagKeysAsyncClient(credentials=ga_credentials.AnonymousCredentials(),) # Any value that is part of the HTTP/1.1 URI should be sent as # a field header. Set these to a non-empty value. request = tag_keys.DeleteTagKeyRequest() request.name = "name/value" # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.delete_tag_key), "__call__") as call: call.return_value = grpc_helpers_async.FakeUnaryUnaryCall( operations_pb2.Operation(name="operations/op") ) await client.delete_tag_key(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) _, args, _ = call.mock_calls[0] assert args[0] == request # Establish that the field header was sent. _, _, kw = call.mock_calls[0] assert ("x-goog-request-params", "name=name/value",) in kw["metadata"] def test_delete_tag_key_flattened(): client = TagKeysClient(credentials=ga_credentials.AnonymousCredentials(),) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.delete_tag_key), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = operations_pb2.Operation(name="operations/op") # Call the method with a truthy value for each flattened field, # using the keyword arguments to the method. client.delete_tag_key(name="name_value",) # Establish that the underlying call was made with the expected # request object values. assert len(call.mock_calls) == 1 _, args, _ = call.mock_calls[0] arg = args[0].name mock_val = "name_value" assert arg == mock_val def test_delete_tag_key_flattened_error(): client = TagKeysClient(credentials=ga_credentials.AnonymousCredentials(),) # Attempting to call a method with both a request object and flattened # fields is an error. with pytest.raises(ValueError): client.delete_tag_key( tag_keys.DeleteTagKeyRequest(), name="name_value", ) @pytest.mark.asyncio async def test_delete_tag_key_flattened_async(): client = TagKeysAsyncClient(credentials=ga_credentials.AnonymousCredentials(),) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.delete_tag_key), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = operations_pb2.Operation(name="operations/op") call.return_value = grpc_helpers_async.FakeUnaryUnaryCall( operations_pb2.Operation(name="operations/spam") ) # Call the method with a truthy value for each flattened field, # using the keyword arguments to the method. response = await client.delete_tag_key(name="name_value",) # Establish that the underlying call was made with the expected # request object values. assert len(call.mock_calls) _, args, _ = call.mock_calls[0] arg = args[0].name mock_val = "name_value" assert arg == mock_val @pytest.mark.asyncio async def test_delete_tag_key_flattened_error_async(): client = TagKeysAsyncClient(credentials=ga_credentials.AnonymousCredentials(),) # Attempting to call a method with both a request object and flattened # fields is an error. with pytest.raises(ValueError): await client.delete_tag_key( tag_keys.DeleteTagKeyRequest(), name="name_value", ) @pytest.mark.parametrize("request_type", [iam_policy_pb2.GetIamPolicyRequest, dict,]) def test_get_iam_policy(request_type, transport: str = "grpc"): client = TagKeysClient( credentials=ga_credentials.AnonymousCredentials(), transport=transport, ) # Everything is optional in proto3 as far as the runtime is concerned, # and we are mocking out the actual API, so just send an empty request. request = request_type() # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.get_iam_policy), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = policy_pb2.Policy(version=774, etag=b"etag_blob",) response = client.get_iam_policy(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) == 1 _, args, _ = call.mock_calls[0] assert args[0] == iam_policy_pb2.GetIamPolicyRequest() # Establish that the response is the type that we expect. assert isinstance(response, policy_pb2.Policy) assert response.version == 774 assert response.etag == b"etag_blob" def test_get_iam_policy_empty_call(): # This test is a coverage failsafe to make sure that totally empty calls, # i.e. request == None and no flattened fields passed, work. client = TagKeysClient( credentials=ga_credentials.AnonymousCredentials(), transport="grpc", ) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.get_iam_policy), "__call__") as call: client.get_iam_policy() call.assert_called() _, args, _ = call.mock_calls[0] assert args[0] == iam_policy_pb2.GetIamPolicyRequest() @pytest.mark.asyncio async def test_get_iam_policy_async( transport: str = "grpc_asyncio", request_type=iam_policy_pb2.GetIamPolicyRequest ): client = TagKeysAsyncClient( credentials=ga_credentials.AnonymousCredentials(), transport=transport, ) # Everything is optional in proto3 as far as the runtime is concerned, # and we are mocking out the actual API, so just send an empty request. request = request_type() # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.get_iam_policy), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = grpc_helpers_async.FakeUnaryUnaryCall( policy_pb2.Policy(version=774, etag=b"etag_blob",) ) response = await client.get_iam_policy(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) _, args, _ = call.mock_calls[0] assert args[0] == iam_policy_pb2.GetIamPolicyRequest() # Establish that the response is the type that we expect. assert isinstance(response, policy_pb2.Policy) assert response.version == 774 assert response.etag == b"etag_blob" @pytest.mark.asyncio async def test_get_iam_policy_async_from_dict(): await test_get_iam_policy_async(request_type=dict) def test_get_iam_policy_field_headers(): client = TagKeysClient(credentials=ga_credentials.AnonymousCredentials(),) # Any value that is part of the HTTP/1.1 URI should be sent as # a field header. Set these to a non-empty value. request = iam_policy_pb2.GetIamPolicyRequest() request.resource = "resource/value" # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.get_iam_policy), "__call__") as call: call.return_value = policy_pb2.Policy() client.get_iam_policy(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) == 1 _, args, _ = call.mock_calls[0] assert args[0] == request # Establish that the field header was sent. _, _, kw = call.mock_calls[0] assert ("x-goog-request-params", "resource=resource/value",) in kw["metadata"] @pytest.mark.asyncio async def test_get_iam_policy_field_headers_async(): client = TagKeysAsyncClient(credentials=ga_credentials.AnonymousCredentials(),) # Any value that is part of the HTTP/1.1 URI should be sent as # a field header. Set these to a non-empty value. request = iam_policy_pb2.GetIamPolicyRequest() request.resource = "resource/value" # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.get_iam_policy), "__call__") as call: call.return_value = grpc_helpers_async.FakeUnaryUnaryCall(policy_pb2.Policy()) await client.get_iam_policy(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) _, args, _ = call.mock_calls[0] assert args[0] == request # Establish that the field header was sent. _, _, kw = call.mock_calls[0] assert ("x-goog-request-params", "resource=resource/value",) in kw["metadata"] def test_get_iam_policy_from_dict_foreign(): client = TagKeysClient(credentials=ga_credentials.AnonymousCredentials(),) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.get_iam_policy), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = policy_pb2.Policy() response = client.get_iam_policy( request={ "resource": "resource_value", "options": options_pb2.GetPolicyOptions(requested_policy_version=2598), } ) call.assert_called() def test_get_iam_policy_flattened(): client = TagKeysClient(credentials=ga_credentials.AnonymousCredentials(),) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.get_iam_policy), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = policy_pb2.Policy() # Call the method with a truthy value for each flattened field, # using the keyword arguments to the method. client.get_iam_policy(resource="resource_value",) # Establish that the underlying call was made with the expected # request object values. assert len(call.mock_calls) == 1 _, args, _ = call.mock_calls[0] arg = args[0].resource mock_val = "resource_value" assert arg == mock_val def test_get_iam_policy_flattened_error(): client = TagKeysClient(credentials=ga_credentials.AnonymousCredentials(),) # Attempting to call a method with both a request object and flattened # fields is an error. with pytest.raises(ValueError): client.get_iam_policy( iam_policy_pb2.GetIamPolicyRequest(), resource="resource_value", ) @pytest.mark.asyncio async def test_get_iam_policy_flattened_async(): client = TagKeysAsyncClient(credentials=ga_credentials.AnonymousCredentials(),) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.get_iam_policy), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = policy_pb2.Policy() call.return_value = grpc_helpers_async.FakeUnaryUnaryCall(policy_pb2.Policy()) # Call the method with a truthy value for each flattened field, # using the keyword arguments to the method. response = await client.get_iam_policy(resource="resource_value",) # Establish that the underlying call was made with the expected # request object values. assert len(call.mock_calls) _, args, _ = call.mock_calls[0] arg = args[0].resource mock_val = "resource_value" assert arg == mock_val @pytest.mark.asyncio async def test_get_iam_policy_flattened_error_async(): client = TagKeysAsyncClient(credentials=ga_credentials.AnonymousCredentials(),) # Attempting to call a method with both a request object and flattened # fields is an error. with pytest.raises(ValueError): await client.get_iam_policy( iam_policy_pb2.GetIamPolicyRequest(), resource="resource_value", ) @pytest.mark.parametrize("request_type", [iam_policy_pb2.SetIamPolicyRequest, dict,]) def test_set_iam_policy(request_type, transport: str = "grpc"): client = TagKeysClient( credentials=ga_credentials.AnonymousCredentials(), transport=transport, ) # Everything is optional in proto3 as far as the runtime is concerned, # and we are mocking out the actual API, so just send an empty request. request = request_type() # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.set_iam_policy), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = policy_pb2.Policy(version=774, etag=b"etag_blob",) response = client.set_iam_policy(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) == 1 _, args, _ = call.mock_calls[0] assert args[0] == iam_policy_pb2.SetIamPolicyRequest() # Establish that the response is the type that we expect. assert isinstance(response, policy_pb2.Policy) assert response.version == 774 assert response.etag == b"etag_blob" def test_set_iam_policy_empty_call(): # This test is a coverage failsafe to make sure that totally empty calls, # i.e. request == None and no flattened fields passed, work. client = TagKeysClient( credentials=ga_credentials.AnonymousCredentials(), transport="grpc", ) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.set_iam_policy), "__call__") as call: client.set_iam_policy() call.assert_called() _, args, _ = call.mock_calls[0] assert args[0] == iam_policy_pb2.SetIamPolicyRequest() @pytest.mark.asyncio async def test_set_iam_policy_async( transport: str = "grpc_asyncio", request_type=iam_policy_pb2.SetIamPolicyRequest ): client = TagKeysAsyncClient( credentials=ga_credentials.AnonymousCredentials(), transport=transport, ) # Everything is optional in proto3 as far as the runtime is concerned, # and we are mocking out the actual API, so just send an empty request. request = request_type() # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.set_iam_policy), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = grpc_helpers_async.FakeUnaryUnaryCall( policy_pb2.Policy(version=774, etag=b"etag_blob",) ) response = await client.set_iam_policy(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) _, args, _ = call.mock_calls[0] assert args[0] == iam_policy_pb2.SetIamPolicyRequest() # Establish that the response is the type that we expect. assert isinstance(response, policy_pb2.Policy) assert response.version == 774 assert response.etag == b"etag_blob" @pytest.mark.asyncio async def test_set_iam_policy_async_from_dict(): await test_set_iam_policy_async(request_type=dict) def test_set_iam_policy_field_headers(): client = TagKeysClient(credentials=ga_credentials.AnonymousCredentials(),) # Any value that is part of the HTTP/1.1 URI should be sent as # a field header. Set these to a non-empty value. request = iam_policy_pb2.SetIamPolicyRequest() request.resource = "resource/value" # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.set_iam_policy), "__call__") as call: call.return_value = policy_pb2.Policy() client.set_iam_policy(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) == 1 _, args, _ = call.mock_calls[0] assert args[0] == request # Establish that the field header was sent. _, _, kw = call.mock_calls[0] assert ("x-goog-request-params", "resource=resource/value",) in kw["metadata"] @pytest.mark.asyncio async def test_set_iam_policy_field_headers_async(): client = TagKeysAsyncClient(credentials=ga_credentials.AnonymousCredentials(),) # Any value that is part of the HTTP/1.1 URI should be sent as # a field header. Set these to a non-empty value. request = iam_policy_pb2.SetIamPolicyRequest() request.resource = "resource/value" # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.set_iam_policy), "__call__") as call: call.return_value = grpc_helpers_async.FakeUnaryUnaryCall(policy_pb2.Policy()) await client.set_iam_policy(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) _, args, _ = call.mock_calls[0] assert args[0] == request # Establish that the field header was sent. _, _, kw = call.mock_calls[0] assert ("x-goog-request-params", "resource=resource/value",) in kw["metadata"] def test_set_iam_policy_from_dict_foreign(): client = TagKeysClient(credentials=ga_credentials.AnonymousCredentials(),) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.set_iam_policy), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = policy_pb2.Policy() response = client.set_iam_policy( request={ "resource": "resource_value", "policy": policy_pb2.Policy(version=774), } ) call.assert_called() def test_set_iam_policy_flattened(): client = TagKeysClient(credentials=ga_credentials.AnonymousCredentials(),) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.set_iam_policy), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = policy_pb2.Policy() # Call the method with a truthy value for each flattened field, # using the keyword arguments to the method. client.set_iam_policy(resource="resource_value",) # Establish that the underlying call was made with the expected # request object values. assert len(call.mock_calls) == 1 _, args, _ = call.mock_calls[0] arg = args[0].resource mock_val = "resource_value" assert arg == mock_val def test_set_iam_policy_flattened_error(): client = TagKeysClient(credentials=ga_credentials.AnonymousCredentials(),) # Attempting to call a method with both a request object and flattened # fields is an error. with pytest.raises(ValueError): client.set_iam_policy( iam_policy_pb2.SetIamPolicyRequest(), resource="resource_value", ) @pytest.mark.asyncio async def test_set_iam_policy_flattened_async(): client = TagKeysAsyncClient(credentials=ga_credentials.AnonymousCredentials(),) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object(type(client.transport.set_iam_policy), "__call__") as call: # Designate an appropriate return value for the call. call.return_value = policy_pb2.Policy() call.return_value = grpc_helpers_async.FakeUnaryUnaryCall(policy_pb2.Policy()) # Call the method with a truthy value for each flattened field, # using the keyword arguments to the method. response = await client.set_iam_policy(resource="resource_value",) # Establish that the underlying call was made with the expected # request object values. assert len(call.mock_calls) _, args, _ = call.mock_calls[0] arg = args[0].resource mock_val = "resource_value" assert arg == mock_val @pytest.mark.asyncio async def test_set_iam_policy_flattened_error_async(): client = TagKeysAsyncClient(credentials=ga_credentials.AnonymousCredentials(),) # Attempting to call a method with both a request object and flattened # fields is an error. with pytest.raises(ValueError): await client.set_iam_policy( iam_policy_pb2.SetIamPolicyRequest(), resource="resource_value", ) @pytest.mark.parametrize( "request_type", [iam_policy_pb2.TestIamPermissionsRequest, dict,] ) def test_test_iam_permissions(request_type, transport: str = "grpc"): client = TagKeysClient( credentials=ga_credentials.AnonymousCredentials(), transport=transport, ) # Everything is optional in proto3 as far as the runtime is concerned, # and we are mocking out the actual API, so just send an empty request. request = request_type() # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object( type(client.transport.test_iam_permissions), "__call__" ) as call: # Designate an appropriate return value for the call. call.return_value = iam_policy_pb2.TestIamPermissionsResponse( permissions=["permissions_value"], ) response = client.test_iam_permissions(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) == 1 _, args, _ = call.mock_calls[0] assert args[0] == iam_policy_pb2.TestIamPermissionsRequest() # Establish that the response is the type that we expect. assert isinstance(response, iam_policy_pb2.TestIamPermissionsResponse) assert response.permissions == ["permissions_value"] def test_test_iam_permissions_empty_call(): # This test is a coverage failsafe to make sure that totally empty calls, # i.e. request == None and no flattened fields passed, work. client = TagKeysClient( credentials=ga_credentials.AnonymousCredentials(), transport="grpc", ) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object( type(client.transport.test_iam_permissions), "__call__" ) as call: client.test_iam_permissions() call.assert_called() _, args, _ = call.mock_calls[0] assert args[0] == iam_policy_pb2.TestIamPermissionsRequest() @pytest.mark.asyncio async def test_test_iam_permissions_async( transport: str = "grpc_asyncio", request_type=iam_policy_pb2.TestIamPermissionsRequest, ): client = TagKeysAsyncClient( credentials=ga_credentials.AnonymousCredentials(), transport=transport, ) # Everything is optional in proto3 as far as the runtime is concerned, # and we are mocking out the actual API, so just send an empty request. request = request_type() # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object( type(client.transport.test_iam_permissions), "__call__" ) as call: # Designate an appropriate return value for the call. call.return_value = grpc_helpers_async.FakeUnaryUnaryCall( iam_policy_pb2.TestIamPermissionsResponse( permissions=["permissions_value"], ) ) response = await client.test_iam_permissions(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) _, args, _ = call.mock_calls[0] assert args[0] == iam_policy_pb2.TestIamPermissionsRequest() # Establish that the response is the type that we expect. assert isinstance(response, iam_policy_pb2.TestIamPermissionsResponse) assert response.permissions == ["permissions_value"] @pytest.mark.asyncio async def test_test_iam_permissions_async_from_dict(): await test_test_iam_permissions_async(request_type=dict) def test_test_iam_permissions_field_headers(): client = TagKeysClient(credentials=ga_credentials.AnonymousCredentials(),) # Any value that is part of the HTTP/1.1 URI should be sent as # a field header. Set these to a non-empty value. request = iam_policy_pb2.TestIamPermissionsRequest() request.resource = "resource/value" # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object( type(client.transport.test_iam_permissions), "__call__" ) as call: call.return_value = iam_policy_pb2.TestIamPermissionsResponse() client.test_iam_permissions(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) == 1 _, args, _ = call.mock_calls[0] assert args[0] == request # Establish that the field header was sent. _, _, kw = call.mock_calls[0] assert ("x-goog-request-params", "resource=resource/value",) in kw["metadata"] @pytest.mark.asyncio async def test_test_iam_permissions_field_headers_async(): client = TagKeysAsyncClient(credentials=ga_credentials.AnonymousCredentials(),) # Any value that is part of the HTTP/1.1 URI should be sent as # a field header. Set these to a non-empty value. request = iam_policy_pb2.TestIamPermissionsRequest() request.resource = "resource/value" # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object( type(client.transport.test_iam_permissions), "__call__" ) as call: call.return_value = grpc_helpers_async.FakeUnaryUnaryCall( iam_policy_pb2.TestIamPermissionsResponse() ) await client.test_iam_permissions(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) _, args, _ = call.mock_calls[0] assert args[0] == request # Establish that the field header was sent. _, _, kw = call.mock_calls[0] assert ("x-goog-request-params", "resource=resource/value",) in kw["metadata"] def test_test_iam_permissions_from_dict_foreign(): client = TagKeysClient(credentials=ga_credentials.AnonymousCredentials(),) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object( type(client.transport.test_iam_permissions), "__call__" ) as call: # Designate an appropriate return value for the call. call.return_value = iam_policy_pb2.TestIamPermissionsResponse() response = client.test_iam_permissions( request={ "resource": "resource_value", "permissions": ["permissions_value"], } ) call.assert_called() def test_test_iam_permissions_flattened(): client = TagKeysClient(credentials=ga_credentials.AnonymousCredentials(),) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object( type(client.transport.test_iam_permissions), "__call__" ) as call: # Designate an appropriate return value for the call. call.return_value = iam_policy_pb2.TestIamPermissionsResponse() # Call the method with a truthy value for each flattened field, # using the keyword arguments to the method. client.test_iam_permissions( resource="resource_value", permissions=["permissions_value"], ) # Establish that the underlying call was made with the expected # request object values. assert len(call.mock_calls) == 1 _, args, _ = call.mock_calls[0] arg = args[0].resource mock_val = "resource_value" assert arg == mock_val arg = args[0].permissions mock_val = ["permissions_value"] assert arg == mock_val def test_test_iam_permissions_flattened_error(): client = TagKeysClient(credentials=ga_credentials.AnonymousCredentials(),) # Attempting to call a method with both a request object and flattened # fields is an error. with pytest.raises(ValueError): client.test_iam_permissions( iam_policy_pb2.TestIamPermissionsRequest(), resource="resource_value", permissions=["permissions_value"], ) @pytest.mark.asyncio async def test_test_iam_permissions_flattened_async(): client = TagKeysAsyncClient(credentials=ga_credentials.AnonymousCredentials(),) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object( type(client.transport.test_iam_permissions), "__call__" ) as call: # Designate an appropriate return value for the call. call.return_value = iam_policy_pb2.TestIamPermissionsResponse() call.return_value = grpc_helpers_async.FakeUnaryUnaryCall( iam_policy_pb2.TestIamPermissionsResponse() ) # Call the method with a truthy value for each flattened field, # using the keyword arguments to the method. response = await client.test_iam_permissions( resource="resource_value", permissions=["permissions_value"], ) # Establish that the underlying call was made with the expected # request object values. assert len(call.mock_calls) _, args, _ = call.mock_calls[0] arg = args[0].resource mock_val = "resource_value" assert arg == mock_val arg = args[0].permissions mock_val = ["permissions_value"] assert arg == mock_val @pytest.mark.asyncio async def test_test_iam_permissions_flattened_error_async(): client = TagKeysAsyncClient(credentials=ga_credentials.AnonymousCredentials(),) # Attempting to call a method with both a request object and flattened # fields is an error. with pytest.raises(ValueError): await client.test_iam_permissions( iam_policy_pb2.TestIamPermissionsRequest(), resource="resource_value", permissions=["permissions_value"], ) def test_credentials_transport_error(): # It is an error to provide credentials and a transport instance. transport = transports.TagKeysGrpcTransport( credentials=ga_credentials.AnonymousCredentials(), ) with pytest.raises(ValueError): client = TagKeysClient( credentials=ga_credentials.AnonymousCredentials(), transport=transport, ) # It is an error to provide a credentials file and a transport instance. transport = transports.TagKeysGrpcTransport( credentials=ga_credentials.AnonymousCredentials(), ) with pytest.raises(ValueError): client = TagKeysClient( client_options={"credentials_file": "credentials.json"}, transport=transport, ) # It is an error to provide an api_key and a transport instance. transport = transports.TagKeysGrpcTransport( credentials=ga_credentials.AnonymousCredentials(), ) options = client_options.ClientOptions() options.api_key = "api_key" with pytest.raises(ValueError): client = TagKeysClient(client_options=options, transport=transport,) # It is an error to provide an api_key and a credential. options = mock.Mock() options.api_key = "api_key" with pytest.raises(ValueError): client = TagKeysClient( client_options=options, credentials=ga_credentials.AnonymousCredentials() ) # It is an error to provide scopes and a transport instance. transport = transports.TagKeysGrpcTransport( credentials=ga_credentials.AnonymousCredentials(), ) with pytest.raises(ValueError): client = TagKeysClient( client_options={"scopes": ["1", "2"]}, transport=transport, ) def test_transport_instance(): # A client may be instantiated with a custom transport instance. transport = transports.TagKeysGrpcTransport( credentials=ga_credentials.AnonymousCredentials(), ) client = TagKeysClient(transport=transport) assert client.transport is transport def test_transport_get_channel(): # A client may be instantiated with a custom transport instance. transport = transports.TagKeysGrpcTransport( credentials=ga_credentials.AnonymousCredentials(), ) channel = transport.grpc_channel assert channel transport = transports.TagKeysGrpcAsyncIOTransport( credentials=ga_credentials.AnonymousCredentials(), ) channel = transport.grpc_channel assert channel @pytest.mark.parametrize( "transport_class", [transports.TagKeysGrpcTransport, transports.TagKeysGrpcAsyncIOTransport,], ) def test_transport_adc(transport_class): # Test default credentials are used if not provided. with mock.patch.object(google.auth, "default") as adc: adc.return_value = (ga_credentials.AnonymousCredentials(), None) transport_class() adc.assert_called_once() def test_transport_grpc_default(): # A client should use the gRPC transport by default. client = TagKeysClient(credentials=ga_credentials.AnonymousCredentials(),) assert isinstance(client.transport, transports.TagKeysGrpcTransport,) def test_tag_keys_base_transport_error(): # Passing both a credentials object and credentials_file should raise an error with pytest.raises(core_exceptions.DuplicateCredentialArgs): transport = transports.TagKeysTransport( credentials=ga_credentials.AnonymousCredentials(), credentials_file="credentials.json", ) def test_tag_keys_base_transport(): # Instantiate the base transport. with mock.patch( "google.cloud.resourcemanager_v3.services.tag_keys.transports.TagKeysTransport.__init__" ) as Transport: Transport.return_value = None transport = transports.TagKeysTransport( credentials=ga_credentials.AnonymousCredentials(), ) # Every method on the transport should just blindly # raise NotImplementedError. methods = ( "list_tag_keys", "get_tag_key", "create_tag_key", "update_tag_key", "delete_tag_key", "get_iam_policy", "set_iam_policy", "test_iam_permissions", ) for method in methods: with pytest.raises(NotImplementedError): getattr(transport, method)(request=object()) with pytest.raises(NotImplementedError): transport.close() # Additionally, the LRO client (a property) should # also raise NotImplementedError with pytest.raises(NotImplementedError): transport.operations_client def test_tag_keys_base_transport_with_credentials_file(): # Instantiate the base transport with a credentials file with mock.patch.object( google.auth, "load_credentials_from_file", autospec=True ) as load_creds, mock.patch( "google.cloud.resourcemanager_v3.services.tag_keys.transports.TagKeysTransport._prep_wrapped_messages" ) as Transport: Transport.return_value = None load_creds.return_value = (ga_credentials.AnonymousCredentials(), None) transport = transports.TagKeysTransport( credentials_file="credentials.json", quota_project_id="octopus", ) load_creds.assert_called_once_with( "credentials.json", scopes=None, default_scopes=( "https://www.googleapis.com/auth/cloud-platform", "https://www.googleapis.com/auth/cloud-platform.read-only", ), quota_project_id="octopus", ) def test_tag_keys_base_transport_with_adc(): # Test the default credentials are used if credentials and credentials_file are None. with mock.patch.object(google.auth, "default", autospec=True) as adc, mock.patch( "google.cloud.resourcemanager_v3.services.tag_keys.transports.TagKeysTransport._prep_wrapped_messages" ) as Transport: Transport.return_value = None adc.return_value = (ga_credentials.AnonymousCredentials(), None) transport = transports.TagKeysTransport() adc.assert_called_once() def test_tag_keys_auth_adc(): # If no credentials are provided, we should use ADC credentials. with mock.patch.object(google.auth, "default", autospec=True) as adc: adc.return_value = (ga_credentials.AnonymousCredentials(), None) TagKeysClient() adc.assert_called_once_with( scopes=None, default_scopes=( "https://www.googleapis.com/auth/cloud-platform", "https://www.googleapis.com/auth/cloud-platform.read-only", ), quota_project_id=None, ) @pytest.mark.parametrize( "transport_class", [transports.TagKeysGrpcTransport, transports.TagKeysGrpcAsyncIOTransport,], ) def test_tag_keys_transport_auth_adc(transport_class): # If credentials and host are not provided, the transport class should use # ADC credentials. with mock.patch.object(google.auth, "default", autospec=True) as adc: adc.return_value = (ga_credentials.AnonymousCredentials(), None) transport_class(quota_project_id="octopus", scopes=["1", "2"]) adc.assert_called_once_with( scopes=["1", "2"], default_scopes=( "https://www.googleapis.com/auth/cloud-platform", "https://www.googleapis.com/auth/cloud-platform.read-only", ), quota_project_id="octopus", ) @pytest.mark.parametrize( "transport_class,grpc_helpers", [ (transports.TagKeysGrpcTransport, grpc_helpers), (transports.TagKeysGrpcAsyncIOTransport, grpc_helpers_async), ], ) def test_tag_keys_transport_create_channel(transport_class, grpc_helpers): # If credentials and host are not provided, the transport class should use # ADC credentials. with mock.patch.object( google.auth, "default", autospec=True ) as adc, mock.patch.object( grpc_helpers, "create_channel", autospec=True ) as create_channel: creds = ga_credentials.AnonymousCredentials() adc.return_value = (creds, None) transport_class(quota_project_id="octopus", scopes=["1", "2"]) create_channel.assert_called_with( "cloudresourcemanager.googleapis.com:443", credentials=creds, credentials_file=None, quota_project_id="octopus", default_scopes=( "https://www.googleapis.com/auth/cloud-platform", "https://www.googleapis.com/auth/cloud-platform.read-only", ), scopes=["1", "2"], default_host="cloudresourcemanager.googleapis.com", ssl_credentials=None, options=[ ("grpc.max_send_message_length", -1), ("grpc.max_receive_message_length", -1), ], ) @pytest.mark.parametrize( "transport_class", [transports.TagKeysGrpcTransport, transports.TagKeysGrpcAsyncIOTransport], ) def test_tag_keys_grpc_transport_client_cert_source_for_mtls(transport_class): cred = ga_credentials.AnonymousCredentials() # Check ssl_channel_credentials is used if provided. with mock.patch.object(transport_class, "create_channel") as mock_create_channel: mock_ssl_channel_creds = mock.Mock() transport_class( host="squid.clam.whelk", credentials=cred, ssl_channel_credentials=mock_ssl_channel_creds, ) mock_create_channel.assert_called_once_with( "squid.clam.whelk:443", credentials=cred, credentials_file=None, scopes=None, ssl_credentials=mock_ssl_channel_creds, quota_project_id=None, options=[ ("grpc.max_send_message_length", -1), ("grpc.max_receive_message_length", -1), ], ) # Check if ssl_channel_credentials is not provided, then client_cert_source_for_mtls # is used. with mock.patch.object(transport_class, "create_channel", return_value=mock.Mock()): with mock.patch("grpc.ssl_channel_credentials") as mock_ssl_cred: transport_class( credentials=cred, client_cert_source_for_mtls=client_cert_source_callback, ) expected_cert, expected_key = client_cert_source_callback() mock_ssl_cred.assert_called_once_with( certificate_chain=expected_cert, private_key=expected_key ) def test_tag_keys_host_no_port(): client = TagKeysClient( credentials=ga_credentials.AnonymousCredentials(), client_options=client_options.ClientOptions( api_endpoint="cloudresourcemanager.googleapis.com" ), ) assert client.transport._host == "cloudresourcemanager.googleapis.com:443" def test_tag_keys_host_with_port(): client = TagKeysClient( credentials=ga_credentials.AnonymousCredentials(), client_options=client_options.ClientOptions( api_endpoint="cloudresourcemanager.googleapis.com:8000" ), ) assert client.transport._host == "cloudresourcemanager.googleapis.com:8000" def test_tag_keys_grpc_transport_channel(): channel = grpc.secure_channel("http://localhost/", grpc.local_channel_credentials()) # Check that channel is used if provided. transport = transports.TagKeysGrpcTransport( host="squid.clam.whelk", channel=channel, ) assert transport.grpc_channel == channel assert transport._host == "squid.clam.whelk:443" assert transport._ssl_channel_credentials == None def test_tag_keys_grpc_asyncio_transport_channel(): channel = aio.secure_channel("http://localhost/", grpc.local_channel_credentials()) # Check that channel is used if provided. transport = transports.TagKeysGrpcAsyncIOTransport( host="squid.clam.whelk", channel=channel, ) assert transport.grpc_channel == channel assert transport._host == "squid.clam.whelk:443" assert transport._ssl_channel_credentials == None # Remove this test when deprecated arguments (api_mtls_endpoint, client_cert_source) are # removed from grpc/grpc_asyncio transport constructor. @pytest.mark.parametrize( "transport_class", [transports.TagKeysGrpcTransport, transports.TagKeysGrpcAsyncIOTransport], ) def test_tag_keys_transport_channel_mtls_with_client_cert_source(transport_class): with mock.patch( "grpc.ssl_channel_credentials", autospec=True ) as grpc_ssl_channel_cred: with mock.patch.object( transport_class, "create_channel" ) as grpc_create_channel: mock_ssl_cred = mock.Mock() grpc_ssl_channel_cred.return_value = mock_ssl_cred mock_grpc_channel = mock.Mock() grpc_create_channel.return_value = mock_grpc_channel cred = ga_credentials.AnonymousCredentials() with pytest.warns(DeprecationWarning): with mock.patch.object(google.auth, "default") as adc: adc.return_value = (cred, None) transport = transport_class( host="squid.clam.whelk", api_mtls_endpoint="mtls.squid.clam.whelk", client_cert_source=client_cert_source_callback, ) adc.assert_called_once() grpc_ssl_channel_cred.assert_called_once_with( certificate_chain=b"cert bytes", private_key=b"key bytes" ) grpc_create_channel.assert_called_once_with( "mtls.squid.clam.whelk:443", credentials=cred, credentials_file=None, scopes=None, ssl_credentials=mock_ssl_cred, quota_project_id=None, options=[ ("grpc.max_send_message_length", -1), ("grpc.max_receive_message_length", -1), ], ) assert transport.grpc_channel == mock_grpc_channel assert transport._ssl_channel_credentials == mock_ssl_cred # Remove this test when deprecated arguments (api_mtls_endpoint, client_cert_source) are # removed from grpc/grpc_asyncio transport constructor. @pytest.mark.parametrize( "transport_class", [transports.TagKeysGrpcTransport, transports.TagKeysGrpcAsyncIOTransport], ) def test_tag_keys_transport_channel_mtls_with_adc(transport_class): mock_ssl_cred = mock.Mock() with mock.patch.multiple( "google.auth.transport.grpc.SslCredentials", __init__=mock.Mock(return_value=None), ssl_credentials=mock.PropertyMock(return_value=mock_ssl_cred), ): with mock.patch.object( transport_class, "create_channel" ) as grpc_create_channel: mock_grpc_channel = mock.Mock() grpc_create_channel.return_value = mock_grpc_channel mock_cred = mock.Mock() with pytest.warns(DeprecationWarning): transport = transport_class( host="squid.clam.whelk", credentials=mock_cred, api_mtls_endpoint="mtls.squid.clam.whelk", client_cert_source=None, ) grpc_create_channel.assert_called_once_with( "mtls.squid.clam.whelk:443", credentials=mock_cred, credentials_file=None, scopes=None, ssl_credentials=mock_ssl_cred, quota_project_id=None, options=[ ("grpc.max_send_message_length", -1), ("grpc.max_receive_message_length", -1), ], ) assert transport.grpc_channel == mock_grpc_channel def test_tag_keys_grpc_lro_client(): client = TagKeysClient( credentials=ga_credentials.AnonymousCredentials(), transport="grpc", ) transport = client.transport # Ensure that we have a api-core operations client. assert isinstance(transport.operations_client, operations_v1.OperationsClient,) # Ensure that subsequent calls to the property send the exact same object. assert transport.operations_client is transport.operations_client def test_tag_keys_grpc_lro_async_client(): client = TagKeysAsyncClient( credentials=ga_credentials.AnonymousCredentials(), transport="grpc_asyncio", ) transport = client.transport # Ensure that we have a api-core operations client. assert isinstance(transport.operations_client, operations_v1.OperationsAsyncClient,) # Ensure that subsequent calls to the property send the exact same object. assert transport.operations_client is transport.operations_client def test_tag_key_path(): tag_key = "squid" expected = "tagKeys/{tag_key}".format(tag_key=tag_key,) actual = TagKeysClient.tag_key_path(tag_key) assert expected == actual def test_parse_tag_key_path(): expected = { "tag_key": "clam", } path = TagKeysClient.tag_key_path(**expected) # Check that the path construction is reversible. actual = TagKeysClient.parse_tag_key_path(path) assert expected == actual def test_common_billing_account_path(): billing_account = "whelk" expected = "billingAccounts/{billing_account}".format( billing_account=billing_account, ) actual = TagKeysClient.common_billing_account_path(billing_account) assert expected == actual def test_parse_common_billing_account_path(): expected = { "billing_account": "octopus", } path = TagKeysClient.common_billing_account_path(**expected) # Check that the path construction is reversible. actual = TagKeysClient.parse_common_billing_account_path(path) assert expected == actual def test_common_folder_path(): folder = "oyster" expected = "folders/{folder}".format(folder=folder,) actual = TagKeysClient.common_folder_path(folder) assert expected == actual def test_parse_common_folder_path(): expected = { "folder": "nudibranch", } path = TagKeysClient.common_folder_path(**expected) # Check that the path construction is reversible. actual = TagKeysClient.parse_common_folder_path(path) assert expected == actual def test_common_organization_path(): organization = "cuttlefish" expected = "organizations/{organization}".format(organization=organization,) actual = TagKeysClient.common_organization_path(organization) assert expected == actual def test_parse_common_organization_path(): expected = { "organization": "mussel", } path = TagKeysClient.common_organization_path(**expected) # Check that the path construction is reversible. actual = TagKeysClient.parse_common_organization_path(path) assert expected == actual def test_common_project_path(): project = "winkle" expected = "projects/{project}".format(project=project,) actual = TagKeysClient.common_project_path(project) assert expected == actual def test_parse_common_project_path(): expected = { "project": "nautilus", } path = TagKeysClient.common_project_path(**expected) # Check that the path construction is reversible. actual = TagKeysClient.parse_common_project_path(path) assert expected == actual def test_common_location_path(): project = "scallop" location = "abalone" expected = "projects/{project}/locations/{location}".format( project=project, location=location, ) actual = TagKeysClient.common_location_path(project, location) assert expected == actual def test_parse_common_location_path(): expected = { "project": "squid", "location": "clam", } path = TagKeysClient.common_location_path(**expected) # Check that the path construction is reversible. actual = TagKeysClient.parse_common_location_path(path) assert expected == actual def test_client_with_default_client_info(): client_info = gapic_v1.client_info.ClientInfo() with mock.patch.object( transports.TagKeysTransport, "_prep_wrapped_messages" ) as prep: client = TagKeysClient( credentials=ga_credentials.AnonymousCredentials(), client_info=client_info, ) prep.assert_called_once_with(client_info) with mock.patch.object( transports.TagKeysTransport, "_prep_wrapped_messages" ) as prep: transport_class = TagKeysClient.get_transport_class() transport = transport_class( credentials=ga_credentials.AnonymousCredentials(), client_info=client_info, ) prep.assert_called_once_with(client_info) @pytest.mark.asyncio async def test_transport_close_async(): client = TagKeysAsyncClient( credentials=ga_credentials.AnonymousCredentials(), transport="grpc_asyncio", ) with mock.patch.object( type(getattr(client.transport, "grpc_channel")), "close" ) as close: async with client: close.assert_not_called() close.assert_called_once() def test_transport_close(): transports = { "grpc": "_grpc_channel", } for transport, close_name in transports.items(): client = TagKeysClient( credentials=ga_credentials.AnonymousCredentials(), transport=transport ) with mock.patch.object( type(getattr(client.transport, close_name)), "close" ) as close: with client: close.assert_not_called() close.assert_called_once() def test_client_ctx(): transports = [ "grpc", ] for transport in transports: client = TagKeysClient( credentials=ga_credentials.AnonymousCredentials(), transport=transport ) # Test client calls underlying transport. with mock.patch.object(type(client.transport), "close") as close: close.assert_not_called() with client: pass close.assert_called() @pytest.mark.parametrize( "client_class,transport_class", [ (TagKeysClient, transports.TagKeysGrpcTransport), (TagKeysAsyncClient, transports.TagKeysGrpcAsyncIOTransport), ], ) def test_api_key_credentials(client_class, transport_class): with mock.patch.object( google.auth._default, "get_api_key_credentials", create=True ) as get_api_key_credentials: mock_cred = mock.Mock() get_api_key_credentials.return_value = mock_cred options = client_options.ClientOptions() options.api_key = "api_key" with mock.patch.object(transport_class, "__init__") as patched: patched.return_value = None client = client_class(client_options=options) patched.assert_called_once_with( credentials=mock_cred, credentials_file=None, host=client.DEFAULT_ENDPOINT, scopes=None, client_cert_source_for_mtls=None, quota_project_id=None, client_info=transports.base.DEFAULT_CLIENT_INFO, always_use_jwt_access=True, )
googleapis/python-resource-manager
tests/unit/gapic/resourcemanager_v3/test_tag_keys.py
Python
apache-2.0
115,667
[ "Octopus" ]
3a60c2f2da1efb46c362677d7bb47679d82b73823bb61358f8a1118ff1f1d38a
# -*- coding: utf-8 -*- # vim: autoindent shiftwidth=4 expandtab textwidth=80 tabstop=4 softtabstop=4 ############################################################################### # OpenLP - Open Source Lyrics Projection # # --------------------------------------------------------------------------- # # Copyright (c) 2008-2013 Raoul Snyman # # Portions copyright (c) 2008-2013 Tim Bentley, Gerald Britton, Jonathan # # Corwin, Samuel Findlay, Michael Gorven, Scott Guerrieri, Matthias Hub, # # Meinert Jordan, Armin Köhler, Erik Lundin, Edwin Lunando, Brian T. Meyer. # # Joshua Miller, Stevan Pettit, Andreas Preikschat, Mattias Põldaru, # # Christian Richter, Philip Ridout, Simon Scudder, Jeffrey Smith, # # Maikel Stuivenberg, Martin Thompson, Jon Tibble, Dave Warnock, # # Frode Woldsund, Martin Zibricky, Patrick Zimmermann # # --------------------------------------------------------------------------- # # This program is free software; you can redistribute it and/or modify it # # under the terms of the GNU General Public License as published by the Free # # Software Foundation; version 2 of the License. # # # # This program is distributed in the hope that it will be useful, but WITHOUT # # ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or # # FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for # # more details. # # # # You should have received a copy of the GNU General Public License along # # with this program; if not, write to the Free Software Foundation, Inc., 59 # # Temple Place, Suite 330, Boston, MA 02111-1307 USA # ############################################################################### """ The :mod:`resources` module contains a bunch of resources for OpenLP. DO NOT REMOVE THIS FILE, IT IS REQUIRED FOR INCLUDING THE RESOURCES ON SOME PLATFORMS! """
marmyshev/transitions
resources/__init__.py
Python
gpl-2.0
2,272
[ "Brian" ]
2124b5facd659ad24c34345d1fabfb3703acac72789f792f4e4e55db65bea20d
import unittest from __main__ import vtk, qt, ctk, slicer import SimpleITK as sitk import sitkUtils # # LabelObjectStatistics # class LabelObjectStatistics: def __init__(self, parent): import string parent.title = "Label Object Statistics" parent.categories = ["Microscopy"] parent.contributors = ["Bradley Lowekamp (MSC/NLM)"] parent.helpText = string.Template(""" Use this module to calculate counts and volumes for different labels of a label map plus statistics on the grayscale background volume. Note: volumes must have same dimensions. See <a href=\"$a/Documentation/$b.$c/Modules/LabelObjectStatistics\">$a/Documentation/$b.$c/Modules/LabelObjectStatistics</a> for more information. """).substitute({ 'a':parent.slicerWikiUrl, 'b':slicer.app.majorVersion, 'c':slicer.app.minorVersion }) parent.acknowledgementText = """ This module is derived from the "Label Statistics" module implemented by Steve Pieper supported by NA-MIC, NAC, BIRN, NCIGT, and the Slicer Community. See http://www.slicer.org for details. """ self.parent = parent # # qSlicerPythonModuleExampleWidget # class LabelObjectStatisticsWidget: def __init__(self, parent=None): if not parent: self.parent = slicer.qMRMLWidget() self.parent.setLayout(qt.QVBoxLayout()) self.parent.setMRMLScene(slicer.mrmlScene) else: self.parent = parent self.logic = None self.grayscaleNode = None self.labelNode = None self.fileName = None self.fileDialog = None if not parent: self.setup() self.grayscaleSelector.setMRMLScene(slicer.mrmlScene) self.labelSelector.setMRMLScene(slicer.mrmlScene) self.parent.show() def setup(self): # # the grayscale volume selector # self.grayscaleSelectorFrame = qt.QFrame(self.parent) self.grayscaleSelectorFrame.setLayout(qt.QHBoxLayout()) self.parent.layout().addWidget(self.grayscaleSelectorFrame) self.grayscaleSelectorLabel = qt.QLabel("Grayscale Volume: ", self.grayscaleSelectorFrame) self.grayscaleSelectorLabel.setToolTip( "Select the grayscale volume (background grayscale scalar volume node) for statistics calculations") self.grayscaleSelectorFrame.layout().addWidget(self.grayscaleSelectorLabel) self.grayscaleSelector = slicer.qMRMLNodeComboBox(self.grayscaleSelectorFrame) self.grayscaleSelector.nodeTypes = ( ("vtkMRMLScalarVolumeNode"), "" ) self.grayscaleSelector.selectNodeUponCreation = False self.grayscaleSelector.addEnabled = False self.grayscaleSelector.removeEnabled = False self.grayscaleSelector.noneEnabled = True self.grayscaleSelector.showHidden = False self.grayscaleSelector.showChildNodeTypes = False self.grayscaleSelector.setMRMLScene( slicer.mrmlScene ) # TODO: need to add a QLabel # self.grayscaleSelector.SetLabelText( "Master Volume:" ) self.grayscaleSelectorFrame.layout().addWidget(self.grayscaleSelector) # # the label volume selector # self.labelSelectorFrame = qt.QFrame() self.labelSelectorFrame.setLayout( qt.QHBoxLayout() ) self.parent.layout().addWidget( self.labelSelectorFrame ) self.labelSelectorLabel = qt.QLabel() self.labelSelectorLabel.setText( "Label Map: " ) self.labelSelectorFrame.layout().addWidget( self.labelSelectorLabel ) self.labelSelector = slicer.qMRMLNodeComboBox() self.labelSelector.nodeTypes = ( "vtkMRMLLabelMapVolumeNode", "" ) # todo addAttribute self.labelSelector.selectNodeUponCreation = False self.labelSelector.addEnabled = False self.labelSelector.noneEnabled = True self.labelSelector.removeEnabled = False self.labelSelector.showHidden = False self.labelSelector.showChildNodeTypes = False self.labelSelector.setMRMLScene( slicer.mrmlScene ) self.labelSelector.setToolTip( "Pick the label map to edit" ) self.labelSelectorFrame.layout().addWidget( self.labelSelector ) # Apply button self.applyButton = qt.QPushButton("Apply") self.applyButton.toolTip = "Calculate Statistics." self.applyButton.enabled = False self.parent.layout().addWidget(self.applyButton) # model and view for stats table self.view = qt.QTableView() self.view.sortingEnabled = True self.parent.layout().addWidget(self.view) # Chart button self.chartFrame = qt.QFrame() self.chartFrame.setLayout(qt.QHBoxLayout()) self.parent.layout().addWidget(self.chartFrame) self.chartButton = qt.QPushButton("Chart") self.chartButton.toolTip = "Make a chart from the current statistics." self.chartFrame.layout().addWidget(self.chartButton) self.chartOption = qt.QComboBox() self.chartFrame.layout().addWidget(self.chartOption) self.chartIgnoreZero = qt.QCheckBox() self.chartIgnoreZero.setText('Ignore Zero') self.chartIgnoreZero.checked = False self.chartIgnoreZero.setToolTip('Do not include the zero index in the chart to avoid dwarfing other bars') self.chartFrame.layout().addWidget(self.chartIgnoreZero) self.chartFrame.enabled = False # Save button self.saveButton = qt.QPushButton("Save") self.saveButton.toolTip = "Calculate Statistics." self.saveButton.enabled = False self.parent.layout().addWidget(self.saveButton) # Add vertical spacer self.parent.layout().addStretch(1) # connections self.applyButton.connect('clicked()', self.onApply) self.chartButton.connect('clicked()', self.onChart) self.saveButton.connect('clicked()', self.onSave) self.grayscaleSelector.connect('currentNodeChanged(vtkMRMLNode*)', self.onGrayscaleSelect) self.labelSelector.connect('currentNodeChanged(vtkMRMLNode*)', self.onLabelSelect) def onGrayscaleSelect(self, node): self.grayscaleNode = node self.applyButton.enabled = bool(self.grayscaleNode) and bool(self.labelNode) def onLabelSelect(self, node): self.labelNode = node self.applyButton.enabled = bool(self.grayscaleNode) and bool(self.labelNode) def onApply(self): """Calculate the label statistics """ self.applyButton.text = "Working..." # TODO: why doesn't processEvents alone make the label text change? self.applyButton.repaint() slicer.app.processEvents() volumesLogic = slicer.modules.volumes.logic() warnings = volumesLogic.CheckForLabelVolumeValidity(self.grayscaleNode, self.labelNode) resampledLabelNode = None if warnings != "": if 'mismatch' in warnings: resampledLabelNode = volumesLogic.ResampleVolumeToReferenceVolume(self.labelNode, self.grayscaleNode) self.logic = LabelObjectStatisticsLogic(self.grayscaleNode, resampledLabelNode) else: qt.QMessageBox.warning(slicer.util.mainWindow(), "Label Statistics", "Volumes do not have the same geometry.\n%s" % warnings) return else: self.logic = LabelObjectStatisticsLogic(self.grayscaleNode, self.labelNode) self.populateStats() self.populateChartOption() if resampledLabelNode: slicer.mrmlScene.RemoveNode(resampledLabelNode) self.chartFrame.enabled = True self.saveButton.enabled = True self.applyButton.text = "Apply" def onChart(self): """chart the label statistics """ valueToPlot = self.chartOption.currentText ignoreZero = self.chartIgnoreZero.checked if not valueToPlot is None: self.logic.createStatsChart(self.labelNode,valueToPlot,ignoreZero) else: print "Selected item is unexpectedly None!" def onSave(self): """save the label statistics """ if not self.fileDialog: self.fileDialog = qt.QFileDialog(self.parent) self.fileDialog.options = self.fileDialog.DontUseNativeDialog self.fileDialog.acceptMode = self.fileDialog.AcceptSave self.fileDialog.defaultSuffix = "csv" self.fileDialog.setNameFilter("Comma Separated Values (*.csv)") self.fileDialog.connect("fileSelected(QString)", self.onFileSelected) self.fileDialog.show() def onFileSelected(self,fileName): self.logic.saveStats(fileName) def populateStats(self): if not self.logic: return displayNode = self.labelNode.GetDisplayNode() colorNode = displayNode.GetColorNode() lut = colorNode.GetLookupTable() self.items = [] self.model = qt.QStandardItemModel() self.view.setModel(self.model) self.view.verticalHeader().visible = False row = 0 for i in self.logic.labelStats["Labels"]: color = qt.QColor() rgb = lut.GetTableValue(i) color.setRgb(rgb[0]*255,rgb[1]*255,rgb[2]*255) item = qt.QStandardItem() item.setData(color,qt.Qt.DecorationRole) item.setToolTip(colorNode.GetColorName(i)) item.setEditable(False) self.model.setItem(row,0,item) self.items.append(item) col = 1 for k in self.logic.keys: item = qt.QStandardItem() # set data as float with Qt::DisplayRole try: v = float(self.logic.labelStats[i,k]) except (KeyError, TypeError): v = float('inf') item.setData(v,qt.Qt.DisplayRole) item.setToolTip(colorNode.GetColorName(i)) item.setEditable(False) self.model.setItem(row,col,item) self.items.append(item) col += 1 row += 1 self.view.setColumnWidth(0,30) self.model.setHeaderData(0,1," ") col = 1 for k in self.logic.keys: self.view.setColumnWidth(col,15*len(k)) self.model.setHeaderData(col,1,k) col += 1 def populateChartOption(self): self.chartOption.clear() self.chartOption.addItems(self.logic.keys) class LabelObjectStatisticsLogic: """Implement the logic to calculate label statistics. Nodes are passed in as arguments. Results are stored as 'statistics' instance variable. """ def __init__(self, grayscaleNode, labelNode, fileName=None): #import numpy self.keys = ["Label", "Count", "Volume mm^3", "Volume cc", "Min", "Max", "Mean", "StdDev"] cubicMMPerVoxel = reduce(lambda x,y: x*y, labelNode.GetSpacing()) ccPerCubicMM = 0.001 # TODO: progress and status updates # this->InvokeEvent(vtkLabelStatisticsLogic::StartLabelStats, (void*)"start label stats") self.labelStats = {} self.labelStats['Labels'] = [] labelNodeName = labelNode.GetName() labelImage = sitk.ReadImage(sitkUtils.GetSlicerITKReadWriteAddress(labelNodeName)) grayscaleNodeName = grayscaleNode.GetName(); grayscaleImage = sitk.ReadImage(sitkUtils.GetSlicerITKReadWriteAddress(grayscaleNodeName)) sitkStats = sitk.LabelStatisticsImageFilter() sitkStats.Execute(grayscaleImage, labelImage) for l in sitkStats.GetLabels(): # add an entry to the LabelStats list self.labelStats["Labels"].append(l) self.labelStats[l,"Label"] = l self.labelStats[l,"Count"] = sitkStats.GetCount(l) self.labelStats[l,"Volume mm^3"] = self.labelStats[l,"Count"] * cubicMMPerVoxel self.labelStats[l,"Volume cc"] = self.labelStats[l,"Volume mm^3"] * ccPerCubicMM self.labelStats[l,"Min"] = sitkStats.GetMinimum(l) self.labelStats[l,"Max"] = sitkStats.GetMaximum(l) self.labelStats[l,"Mean"] = sitkStats.GetMean(l) self.labelStats[l,"StdDev"] = sitkStats.GetSigma(l) self.labelStats[l,"Sum"] = sitkStats.GetSum(l) del sitkStats sitkShapeStats = sitk.LabelShapeStatisticsImageFilter() sitkShapeStats.ComputeFeretDiameterOff() sitkShapeStats.ComputePerimeterOn() sitkShapeStats.Execute( labelImage ) # use a set to accumulate attributes to make sure they are unuque shapeAttributes = [ # 'Number Of Pixels', # 'Physical Size', # 'Centroid', # 'Bounding Box', 'Number Of Pixels On Border', 'Perimeter On Border', 'Perimeter On Border Ratio', # 'Principal Moments', 'Principal Axes', 'Elongation', 'Perimeter', 'Roundness', 'Equivalent Spherical Radius', 'Equivalent Spherical Perimeter', # 'Equivalent Ellipsoid Diameter', 'Flatness', 'Feret Diameter' ] if not sitkShapeStats.GetComputeFeretDiameter(): shapeAttributes.remove( 'Feret Diameter' ) if not sitkShapeStats.GetComputePerimeter(): shapeAttributes.remove( 'Perimeter' ) # We don't have a good way to show shapeAttributes.remove( 'Principal Axes' ) self.keys += shapeAttributes for l in sitkShapeStats.GetLabels(): # add attributes form the Shape label object for name in shapeAttributes: attr = getattr(sitkShapeStats,"Get"+name.replace(' ', '') )(l) self.labelStats[l, name] = attr for l in sitkShapeStats.GetLabels(): attr = getattr(sitkShapeStats,"Get"+"PrincipalMoments" )(l) for i in range(1,4): self.labelStats[l, "Principal Moments "+str(i) ] = attr[i-1] self.keys += ["Principal Moments "+str(i) for i in range(1,4)] # this.InvokeEvent(vtkLabelStatisticsLogic::LabelStatsInnerLoop, (void*)"1") # this.InvokeEvent(vtkLabelStatisticsLogic::EndLabelStats, (void*)"end label stats") def createStatsChart(self, labelNode, valueToPlot, ignoreZero=False): """Make a MRML chart of the current stats """ layoutNodes = slicer.mrmlScene.GetNodesByClass('vtkMRMLLayoutNode') layoutNodes.SetReferenceCount(layoutNodes.GetReferenceCount()-1) layoutNodes.InitTraversal() layoutNode = layoutNodes.GetNextItemAsObject() layoutNode.SetViewArrangement(slicer.vtkMRMLLayoutNode.SlicerLayoutConventionalQuantitativeView) chartViewNodes = slicer.mrmlScene.GetNodesByClass('vtkMRMLChartViewNode') chartViewNodes.SetReferenceCount(chartViewNodes.GetReferenceCount()-1) chartViewNodes.InitTraversal() chartViewNode = chartViewNodes.GetNextItemAsObject() arrayNode = slicer.mrmlScene.AddNode(slicer.vtkMRMLDoubleArrayNode()) array = arrayNode.GetArray() samples = len(self.labelStats["Labels"]) tuples = samples if ignoreZero and self.labelStats["Labels"].__contains__(0): tuples -= 1 array.SetNumberOfTuples(tuples) tuple = 0 for i in xrange(samples): index = self.labelStats["Labels"][i] if not (ignoreZero and index == 0): array.SetComponent(tuple, 0, index) try: v = float(self.labelStats[index,valueToPlot]) except (KeyError, TypeError): v = float(0) array.SetComponent(tuple, 1, v) array.SetComponent(tuple, 2, 0) tuple += 1 chartNode = slicer.mrmlScene.AddNode(slicer.vtkMRMLChartNode()) state = chartNode.StartModify() chartNode.AddArray(valueToPlot, arrayNode.GetID()) chartViewNode.SetChartNodeID(chartNode.GetID()) chartNode.SetProperty('default', 'title', 'Label Statistics') chartNode.SetProperty('default', 'xAxisLabel', 'Label') chartNode.SetProperty('default', 'yAxisLabel', valueToPlot) chartNode.SetProperty('default', 'type', 'Bar'); chartNode.SetProperty('default', 'xAxisType', 'categorical') chartNode.SetProperty('default', 'showLegend', 'off') # series level properties if labelNode.GetDisplayNode() != None and labelNode.GetDisplayNode().GetColorNode() != None: chartNode.SetProperty(valueToPlot, 'lookupTable', labelNode.GetDisplayNode().GetColorNodeID()); chartNode.EndModify(state) def statsAsCSV(self): """ print comma separated value file with header keys in quotes """ csv = "" header = "" for k in self.keys[:-1]: header += "\"%s\"" % k + "," header += "\"%s\"" % self.keys[-1] + "\n" csv = header for i in self.labelStats["Labels"]: valuesAsStr = [ str(self.labelStats[i,k]) if (i,k) in self.labelStats else '' for k in self.keys ] line = ",".join(valuesAsStr) line += "\n" csv += line return csv def saveStats(self,fileName): fp = open(fileName, "w") fp.write(self.statsAsCSV()) fp.close() class LabelObjectStatisticsTest(unittest.TestCase): """ This is the test case. """ def delayDisplay(self,message,msec=1000): """This utility method displays a small dialog and waits. This does two things: 1) it lets the event loop catch up to the state of the test so that rendering and widget updates have all taken place before the test continues and 2) it shows the user/developer/tester the state of the test so that we'll know when it breaks. """ print(message) self.info = qt.QDialog() self.infoLayout = qt.QVBoxLayout() self.info.setLayout(self.infoLayout) self.label = qt.QLabel(message,self.info) self.infoLayout.addWidget(self.label) qt.QTimer.singleShot(msec, self.info.close) self.info.exec_() def setUp(self): """ Do whatever is needed to reset the state - typically a scene clear will be enough. """ slicer.mrmlScene.Clear(0) def runTest(self,scenario=None): """Run as few or as many tests as needed here. """ self.setUp() self.test_LabelObjectStatisticsBasic() self.test_LabelObjectStatisticsWidget() self.test_LabelObjectStatisticsLogic() def test_LabelObjectStatisticsBasic(self): """ This tests some aspects of the label statistics """ self.delayDisplay("Starting test_LabelObjectStatisticsBasic") # # first, get some data # import SampleData sampleDataLogic = SampleData.SampleDataLogic() mrHead = sampleDataLogic.downloadMRHead() ctChest = sampleDataLogic.downloadCTChest() self.delayDisplay('Two data sets loaded') volumesLogic = slicer.modules.volumes.logic() mrHeadLabel = volumesLogic.CreateAndAddLabelVolume( slicer.mrmlScene, mrHead, "mrHead-label" ) warnings = volumesLogic.CheckForLabelVolumeValidity(ctChest, mrHeadLabel) self.delayDisplay("Warnings for mismatch:\n%s" % warnings) self.assertTrue( warnings != "" ) warnings = volumesLogic.CheckForLabelVolumeValidity(mrHead, mrHeadLabel) self.delayDisplay("Warnings for match:\n%s" % warnings) self.assertTrue( warnings == "" ) self.delayDisplay('test_LabelObjectStatisticsBasic passed!') def test_LabelObjectStatisticsWidget(self): return self.delayDisplay("Starting test_LabelObjectStatisticsWidget") m = slicer.util.mainWindow() m.moduleSelector().selectModule('LabelObjectStatistics') print dir(slicer.modules) testWidget = slicer.modules.LabelObjectStatisticsWidget def test_LabelObjectStatisticsLogic(self): self.delayDisplay("Starting test_LabelObjectStatisticsLogic") import SampleData sampleDataLogic = SampleData.SampleDataLogic() mrHead = sampleDataLogic.downloadMRHead() img = sitkUtils.PullFromSlicer( mrHead.GetName() ) labelImg = sitk.OtsuMultipleThresholds(img, 3) labelNodeName = "OtsuMultipleThresholdLabelMap" sitkUtils.PushToSlicer(labelImg, "OtsuMultipleThresholdLabelMap", 2) mrHeadLabel = slicer.util.getNode(labelNodeName) logic = LabelObjectStatisticsLogic( mrHead, mrHeadLabel ) print logic.keys print logic.labelStats logic.saveStats("test_LabelObjectStatisticsLogic.csv")
blowekamp/Slicer-IASEM
LabelObjectStatistics/LabelObjectStatistics.py
Python
apache-2.0
19,184
[ "VTK" ]
b99b33d197f55a8fc9d49f976990ad0c5902f851a11d6f79fd473d591722be52
from django import forms from django.contrib.localflavor.cz.forms import CZBirthNumberField from django.utils.translation import ugettext_lazy as _ from djcode.reservations.models import Examination_kind, Patient, Visit_reservation class Patient_form(forms.ModelForm): label_suffix = ":" class Meta: model = Patient ident_hash = CZBirthNumberField(label=_("Birth number")) phone_number = forms.RegexField( label=_("Phone number"), min_length=5, max_length=100, regex = r"\d+", error_messages={"invalid": _(u"Enter a valid 'phone number' consisting of numbers only.")} ) reservation = forms.ModelChoiceField( queryset=Visit_reservation.objects.all(), widget=forms.HiddenInput(), error_messages={"required": _("Please select time of visit reservation")} ) exam_kind = forms.ModelChoiceField( empty_label=None, queryset=Examination_kind.objects.all(), widget=forms.RadioSelect(), label=_("Examination kind") ) def clean_ident_hash(self): data = self.cleaned_data["ident_hash"] if data[6] == "/": data = data[:6] + data[7:] return data class Patient_detail_form(forms.Form): ident_hash = CZBirthNumberField() def clean_ident_hash(self): data = self.cleaned_data["ident_hash"] if data[6] == "/": data = data[:6] + data[7:] return data
mmincikova/medobs
djcode/reservations/forms.py
Python
gpl-3.0
1,292
[ "VisIt" ]
635d5f48b4da9e023d70d26c349a8abdff0dff76a8c21e827f66e9ea15822940
# This code is part of Ansible, but is an independent component. # This particular file snippet, and this file snippet only, is BSD licensed. # Modules you write using this snippet, which is embedded dynamically by Ansible # still belong to the author of the module, and may assign their own license # to the complete work. # # Copyright (c), Michael DeHaan <michael.dehaan@gmail.com>, 2012-2013 # Copyright (c), Toshio Kuratomi <tkuratomi@ansible.com> 2016 # All rights reserved. # # Redistribution and use in source and binary forms, with or without modification, # are permitted provided that the following conditions are met: # # * Redistributions of source code must retain the above copyright # notice, this list of conditions and the following disclaimer. # * Redistributions in binary form must reproduce the above copyright notice, # this list of conditions and the following disclaimer in the documentation # and/or other materials provided with the distribution. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND # ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED # WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. # IN NO EVENT SHALL THE COPYRIGHT HOLDER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, # INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, # PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS # INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT # LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE # USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. # BOOLEANS_TRUE = ['y', 'yes', 'on', '1', 'true', 1, True] BOOLEANS_FALSE = ['n', 'no', 'off', '0', 'false', 0, False] BOOLEANS = BOOLEANS_TRUE + BOOLEANS_FALSE SIZE_RANGES = { 'Y': 1<<80, 'Z': 1<<70, 'E': 1<<60, 'P': 1<<50, 'T': 1<<40, 'G': 1<<30, 'M': 1<<20, 'K': 1<<10, 'B': 1 } FILE_ATTRIBUTES = { 'A': 'noatime', 'a': 'append', 'c': 'compressed', 'C': 'nocow', 'd': 'nodump', 'D': 'dirsync', 'e': 'extents', 'E': 'encrypted', 'h': 'blocksize', 'i': 'immutable', 'I': 'indexed', 'j': 'journalled', 'N': 'inline', 's': 'zero', 'S': 'synchronous', 't': 'notail', 'T': 'blockroot', 'u': 'undelete', 'X': 'compressedraw', 'Z': 'compresseddirty', } # ansible modules can be written in any language. To simplify # development of Python modules, the functions available here can # be used to do many common tasks import locale import os import re import pipes import shlex import subprocess import sys import types import time import select import shutil import stat import tempfile import traceback import grp import pwd import platform import errno import datetime from itertools import repeat, chain try: import syslog HAS_SYSLOG=True except ImportError: HAS_SYSLOG=False try: from systemd import journal has_journal = True except ImportError: has_journal = False HAVE_SELINUX=False try: import selinux HAVE_SELINUX=True except ImportError: pass # Python2 & 3 way to get NoneType NoneType = type(None) try: from collections import Sequence, Mapping except ImportError: # python2.5 Sequence = (list, tuple) Mapping = (dict,) # Note: When getting Sequence from collections, it matches with strings. If # this matters, make sure to check for strings before checking for sequencetype try: from collections.abc import KeysView SEQUENCETYPE = (Sequence, KeysView) except: SEQUENCETYPE = Sequence try: import json # Detect the python-json library which is incompatible # Look for simplejson if that's the case try: if not isinstance(json.loads, types.FunctionType) or not isinstance(json.dumps, types.FunctionType): raise ImportError except AttributeError: raise ImportError except ImportError: try: import simplejson as json except ImportError: print('\n{"msg": "Error: ansible requires the stdlib json or simplejson module, neither was found!", "failed": true}') sys.exit(1) except SyntaxError: print('\n{"msg": "SyntaxError: probably due to installed simplejson being for a different python version", "failed": true}') sys.exit(1) AVAILABLE_HASH_ALGORITHMS = dict() try: import hashlib # python 2.7.9+ and 2.7.0+ for attribute in ('available_algorithms', 'algorithms'): algorithms = getattr(hashlib, attribute, None) if algorithms: break if algorithms is None: # python 2.5+ algorithms = ('md5', 'sha1', 'sha224', 'sha256', 'sha384', 'sha512') for algorithm in algorithms: AVAILABLE_HASH_ALGORITHMS[algorithm] = getattr(hashlib, algorithm) except ImportError: import sha AVAILABLE_HASH_ALGORITHMS = {'sha1': sha.sha} try: import md5 AVAILABLE_HASH_ALGORITHMS['md5'] = md5.md5 except ImportError: pass from ansible.module_utils.pycompat24 import get_exception, literal_eval from ansible.module_utils.six import (PY2, PY3, b, binary_type, integer_types, iteritems, text_type, string_types) from ansible.module_utils.six.moves import map, reduce from ansible.module_utils._text import to_native, to_bytes, to_text PASSWORD_MATCH = re.compile(r'^(?:.+[-_\s])?pass(?:[-_\s]?(?:word|phrase|wrd|wd)?)(?:[-_\s].+)?$', re.I) _NUMBERTYPES = tuple(list(integer_types) + [float]) # Deprecated compat. Only kept in case another module used these names Using # ansible.module_utils.six is preferred NUMBERTYPES = _NUMBERTYPES imap = map try: # Python 2 unicode except NameError: # Python 3 unicode = text_type try: # Python 2.6+ bytes except NameError: # Python 2.4 bytes = binary_type try: # Python 2 basestring except NameError: # Python 3 basestring = string_types _literal_eval = literal_eval # End of deprecated names # Internal global holding passed in params. This is consulted in case # multiple AnsibleModules are created. Otherwise each AnsibleModule would # attempt to read from stdin. Other code should not use this directly as it # is an internal implementation detail _ANSIBLE_ARGS = None FILE_COMMON_ARGUMENTS=dict( src = dict(), mode = dict(type='raw'), owner = dict(), group = dict(), seuser = dict(), serole = dict(), selevel = dict(), setype = dict(), follow = dict(type='bool', default=False), # not taken by the file module, but other modules call file so it must ignore them. content = dict(no_log=True), backup = dict(), force = dict(), remote_src = dict(), # used by assemble regexp = dict(), # used by assemble delimiter = dict(), # used by assemble directory_mode = dict(), # used by copy unsafe_writes = dict(type='bool'), # should be available to any module using atomic_move attributes = dict(aliases=['attr']), ) PASSWD_ARG_RE = re.compile(r'^[-]{0,2}pass[-]?(word|wd)?') # Can't use 07777 on Python 3, can't use 0o7777 on Python 2.4 PERM_BITS = int('07777', 8) # file mode permission bits EXEC_PERM_BITS = int('00111', 8) # execute permission bits DEFAULT_PERM = int('0666', 8) # default file permission bits def get_platform(): ''' what's the platform? example: Linux is a platform. ''' return platform.system() def get_distribution(): ''' return the distribution name ''' if platform.system() == 'Linux': try: supported_dists = platform._supported_dists + ('arch','alpine') distribution = platform.linux_distribution(supported_dists=supported_dists)[0].capitalize() if not distribution and os.path.isfile('/etc/system-release'): distribution = platform.linux_distribution(supported_dists=['system'])[0].capitalize() if 'Amazon' in distribution: distribution = 'Amazon' else: distribution = 'OtherLinux' except: # FIXME: MethodMissing, I assume? distribution = platform.dist()[0].capitalize() else: distribution = None return distribution def get_distribution_version(): ''' return the distribution version ''' if platform.system() == 'Linux': try: distribution_version = platform.linux_distribution()[1] if not distribution_version and os.path.isfile('/etc/system-release'): distribution_version = platform.linux_distribution(supported_dists=['system'])[1] except: # FIXME: MethodMissing, I assume? distribution_version = platform.dist()[1] else: distribution_version = None return distribution_version def get_all_subclasses(cls): ''' used by modules like Hardware or Network fact classes to retrieve all subclasses of a given class. __subclasses__ return only direct sub classes. This one go down into the class tree. ''' # Retrieve direct subclasses subclasses = cls.__subclasses__() to_visit = list(subclasses) # Then visit all subclasses while to_visit: for sc in to_visit: # The current class is now visited, so remove it from list to_visit.remove(sc) # Appending all subclasses to visit and keep a reference of available class for ssc in sc.__subclasses__(): subclasses.append(ssc) to_visit.append(ssc) return subclasses def load_platform_subclass(cls, *args, **kwargs): ''' used by modules like User to have different implementations based on detected platform. See User module for an example. ''' this_platform = get_platform() distribution = get_distribution() subclass = None # get the most specific superclass for this platform if distribution is not None: for sc in get_all_subclasses(cls): if sc.distribution is not None and sc.distribution == distribution and sc.platform == this_platform: subclass = sc if subclass is None: for sc in get_all_subclasses(cls): if sc.platform == this_platform and sc.distribution is None: subclass = sc if subclass is None: subclass = cls return super(cls, subclass).__new__(subclass) def json_dict_unicode_to_bytes(d, encoding='utf-8', errors='surrogate_or_strict'): ''' Recursively convert dict keys and values to byte str Specialized for json return because this only handles, lists, tuples, and dict container types (the containers that the json module returns) ''' if isinstance(d, text_type): return to_bytes(d, encoding=encoding, errors=errors) elif isinstance(d, dict): return dict(map(json_dict_unicode_to_bytes, iteritems(d), repeat(encoding), repeat(errors))) elif isinstance(d, list): return list(map(json_dict_unicode_to_bytes, d, repeat(encoding), repeat(errors))) elif isinstance(d, tuple): return tuple(map(json_dict_unicode_to_bytes, d, repeat(encoding), repeat(errors))) else: return d def json_dict_bytes_to_unicode(d, encoding='utf-8', errors='surrogate_or_strict'): ''' Recursively convert dict keys and values to byte str Specialized for json return because this only handles, lists, tuples, and dict container types (the containers that the json module returns) ''' if isinstance(d, binary_type): # Warning, can traceback return to_text(d, encoding=encoding, errors=errors) elif isinstance(d, dict): return dict(map(json_dict_bytes_to_unicode, iteritems(d), repeat(encoding), repeat(errors))) elif isinstance(d, list): return list(map(json_dict_bytes_to_unicode, d, repeat(encoding), repeat(errors))) elif isinstance(d, tuple): return tuple(map(json_dict_bytes_to_unicode, d, repeat(encoding), repeat(errors))) else: return d def return_values(obj): """ Return native stringified values from datastructures. For use with removing sensitive values pre-jsonification.""" if isinstance(obj, (text_type, binary_type)): if obj: yield to_native(obj, errors='surrogate_or_strict') return elif isinstance(obj, SEQUENCETYPE): for element in obj: for subelement in return_values(element): yield subelement elif isinstance(obj, Mapping): for element in obj.items(): for subelement in return_values(element[1]): yield subelement elif isinstance(obj, (bool, NoneType)): # This must come before int because bools are also ints return elif isinstance(obj, NUMBERTYPES): yield to_native(obj, nonstring='simplerepr') else: raise TypeError('Unknown parameter type: %s, %s' % (type(obj), obj)) def remove_values(value, no_log_strings): """ Remove strings in no_log_strings from value. If value is a container type, then remove a lot more""" if isinstance(value, (text_type, binary_type)): # Need native str type native_str_value = value if isinstance(value, text_type): value_is_text = True if PY2: native_str_value = to_bytes(value, encoding='utf-8', errors='surrogate_or_strict') elif isinstance(value, binary_type): value_is_text = False if PY3: native_str_value = to_text(value, encoding='utf-8', errors='surrogate_or_strict') if native_str_value in no_log_strings: return 'VALUE_SPECIFIED_IN_NO_LOG_PARAMETER' for omit_me in no_log_strings: native_str_value = native_str_value.replace(omit_me, '*' * 8) if value_is_text and isinstance(native_str_value, binary_type): value = to_text(native_str_value, encoding='utf-8', errors='surrogate_then_replace') elif not value_is_text and isinstance(native_str_value, text_type): value = to_bytes(native_str_value, encoding='utf-8', errors='surrogate_then_replace') else: value = native_str_value elif isinstance(value, SEQUENCETYPE): return [remove_values(elem, no_log_strings) for elem in value] elif isinstance(value, Mapping): return dict((k, remove_values(v, no_log_strings)) for k, v in value.items()) elif isinstance(value, tuple(chain(NUMBERTYPES, (bool, NoneType)))): stringy_value = to_native(value, encoding='utf-8', errors='surrogate_or_strict') if stringy_value in no_log_strings: return 'VALUE_SPECIFIED_IN_NO_LOG_PARAMETER' for omit_me in no_log_strings: if omit_me in stringy_value: return 'VALUE_SPECIFIED_IN_NO_LOG_PARAMETER' elif isinstance(value, datetime.datetime): value = value.isoformat() else: raise TypeError('Value of unknown type: %s, %s' % (type(value), value)) return value def heuristic_log_sanitize(data, no_log_values=None): ''' Remove strings that look like passwords from log messages ''' # Currently filters: # user:pass@foo/whatever and http://username:pass@wherever/foo # This code has false positives and consumes parts of logs that are # not passwds # begin: start of a passwd containing string # end: end of a passwd containing string # sep: char between user and passwd # prev_begin: where in the overall string to start a search for # a passwd # sep_search_end: where in the string to end a search for the sep data = to_native(data) output = [] begin = len(data) prev_begin = begin sep = 1 while sep: # Find the potential end of a passwd try: end = data.rindex('@', 0, begin) except ValueError: # No passwd in the rest of the data output.insert(0, data[0:begin]) break # Search for the beginning of a passwd sep = None sep_search_end = end while not sep: # URL-style username+password try: begin = data.rindex('://', 0, sep_search_end) except ValueError: # No url style in the data, check for ssh style in the # rest of the string begin = 0 # Search for separator try: sep = data.index(':', begin + 3, end) except ValueError: # No separator; choices: if begin == 0: # Searched the whole string so there's no password # here. Return the remaining data output.insert(0, data[0:begin]) break # Search for a different beginning of the password field. sep_search_end = begin continue if sep: # Password was found; remove it. output.insert(0, data[end:prev_begin]) output.insert(0, '********') output.insert(0, data[begin:sep + 1]) prev_begin = begin output = ''.join(output) if no_log_values: output = remove_values(output, no_log_values) return output def bytes_to_human(size, isbits=False, unit=None): base = 'Bytes' if isbits: base = 'bits' suffix = '' for suffix, limit in sorted(iteritems(SIZE_RANGES), key=lambda item: -item[1]): if (unit is None and size >= limit) or unit is not None and unit.upper() == suffix[0]: break if limit != 1: suffix += base[0] else: suffix = base return '%.2f %s' % (float(size)/ limit, suffix) def human_to_bytes(number, default_unit=None, isbits=False): ''' Convert number in string format into bytes (ex: '2K' => 2048) or using unit argument ex: human_to_bytes('10M') <=> human_to_bytes(10, 'M') ''' m = re.search('^\s*(\d*\.?\d*)\s*([A-Za-z]+)?', str(number), flags=re.IGNORECASE) if m is None: raise ValueError("human_to_bytes() can't interpret following string: %s" % str(number)) try: num = float(m.group(1)) except: raise ValueError("human_to_bytes() can't interpret following number: %s (original input string: %s)" % (m.group(1), number)) unit = m.group(2) if unit is None: unit = default_unit if unit is None: ''' No unit given, returning raw number ''' return int(round(num)) range_key = unit[0].upper() try: limit = SIZE_RANGES[range_key] except: raise ValueError("human_to_bytes() failed to convert %s (unit = %s). The suffix must be one of %s" % (number, unit, ", ".join(SIZE_RANGES.keys()))) # default value unit_class = 'B' unit_class_name = 'byte' # handling bits case if isbits: unit_class = 'b' unit_class_name = 'bit' # check unit value if more than one character (KB, MB) if len(unit) > 1: expect_message = 'expect %s%s or %s' % (range_key, unit_class, range_key) if range_key == 'B': expect_message = 'expect %s or %s' % (unit_class, unit_class_name) if unit_class_name in unit.lower(): pass elif unit[1] != unit_class: raise ValueError("human_to_bytes() failed to convert %s. Value is not a valid string (%s)" % (number, expect_message)) return int(round(num * limit)) def is_executable(path): '''is the given path executable? Limitations: * Does not account for FSACLs. * Most times we really want to know "Can the current user execute this file" This function does not tell us that, only if an execute bit is set. ''' # These are all bitfields so first bitwise-or all the permissions we're # looking for, then bitwise-and with the file's mode to determine if any # execute bits are set. return ((stat.S_IXUSR | stat.S_IXGRP | stat.S_IXOTH) & os.stat(path)[stat.ST_MODE]) def _load_params(): ''' read the modules parameters and store them globally. This function may be needed for certain very dynamic custom modules which want to process the parameters that are being handed the module. Since this is so closely tied to the implementation of modules we cannot guarantee API stability for it (it may change between versions) however we will try not to break it gratuitously. It is certainly more future-proof to call this function and consume its outputs than to implement the logic inside it as a copy in your own code. ''' global _ANSIBLE_ARGS if _ANSIBLE_ARGS is not None: buffer = _ANSIBLE_ARGS else: # debug overrides to read args from file or cmdline # Avoid tracebacks when locale is non-utf8 # We control the args and we pass them as utf8 if len(sys.argv) > 1: if os.path.isfile(sys.argv[1]): fd = open(sys.argv[1], 'rb') buffer = fd.read() fd.close() else: buffer = sys.argv[1] if PY3: buffer = buffer.encode('utf-8', errors='surrogateescape') # default case, read from stdin else: if PY2: buffer = sys.stdin.read() else: buffer = sys.stdin.buffer.read() _ANSIBLE_ARGS = buffer try: params = json.loads(buffer.decode('utf-8')) except ValueError: # This helper used too early for fail_json to work. print('\n{"msg": "Error: Module unable to decode valid JSON on stdin. Unable to figure out what parameters were passed", "failed": true}') sys.exit(1) if PY2: params = json_dict_unicode_to_bytes(params) try: return params['ANSIBLE_MODULE_ARGS'] except KeyError: # This helper does not have access to fail_json so we have to print # json output on our own. print('\n{"msg": "Error: Module unable to locate ANSIBLE_MODULE_ARGS in json data from stdin. Unable to figure out what parameters were passed", ' '"failed": true}') sys.exit(1) def env_fallback(*args, **kwargs): ''' Load value from environment ''' for arg in args: if arg in os.environ: return os.environ[arg] else: raise AnsibleFallbackNotFound def _lenient_lowercase(lst): """Lowercase elements of a list. If an element is not a string, pass it through untouched. """ lowered = [] for value in lst: try: lowered.append(value.lower()) except AttributeError: lowered.append(value) return lowered def format_attributes(attributes): attribute_list = [] for attr in attributes: if attr in FILE_ATTRIBUTES: attribute_list.append(FILE_ATTRIBUTES[attr]) return attribute_list def get_flags_from_attributes(attributes): flags = [] for key,attr in FILE_ATTRIBUTES.items(): if attr in attributes: flags.append(key) return ''.join(flags) class AnsibleFallbackNotFound(Exception): pass class AnsibleModule(object): def __init__(self, argument_spec, bypass_checks=False, no_log=False, check_invalid_arguments=True, mutually_exclusive=None, required_together=None, required_one_of=None, add_file_common_args=False, supports_check_mode=False, required_if=None): ''' common code for quickly building an ansible module in Python (although you can write modules in anything that can return JSON) see library/* for examples ''' self._name = os.path.basename(__file__) #initialize name until we can parse from options self.argument_spec = argument_spec self.supports_check_mode = supports_check_mode self.check_mode = False self.no_log = no_log self.cleanup_files = [] self._debug = False self._diff = False self._socket_path = None self._verbosity = 0 # May be used to set modifications to the environment for any # run_command invocation self.run_command_environ_update = {} self._warnings = [] self._deprecations = [] self.aliases = {} self._legal_inputs = ['_ansible_check_mode', '_ansible_no_log', '_ansible_debug', '_ansible_diff', '_ansible_verbosity', '_ansible_selinux_special_fs', '_ansible_module_name', '_ansible_version', '_ansible_syslog_facility', '_ansible_socket'] if add_file_common_args: for k, v in FILE_COMMON_ARGUMENTS.items(): if k not in self.argument_spec: self.argument_spec[k] = v self._load_params() self._set_fallbacks() # append to legal_inputs and then possibly check against them try: self.aliases = self._handle_aliases() except Exception: e = get_exception() # Use exceptions here because it isn't safe to call fail_json until no_log is processed print('\n{"failed": true, "msg": "Module alias error: %s"}' % str(e)) sys.exit(1) # Save parameter values that should never be logged self.no_log_values = set() # Use the argspec to determine which args are no_log for arg_name, arg_opts in self.argument_spec.items(): if arg_opts.get('no_log', False): # Find the value for the no_log'd param no_log_object = self.params.get(arg_name, None) if no_log_object: self.no_log_values.update(return_values(no_log_object)) if arg_opts.get('removed_in_version') is not None and arg_name in self.params: self._deprecations.append({ 'msg': "Param '%s' is deprecated. See the module docs for more information" % arg_name, 'version': arg_opts.get('removed_in_version') }) # check the locale as set by the current environment, and reset to # a known valid (LANG=C) if it's an invalid/unavailable locale self._check_locale() self._check_arguments(check_invalid_arguments) # check exclusive early if not bypass_checks: self._check_mutually_exclusive(mutually_exclusive) self._set_defaults(pre=True) self._CHECK_ARGUMENT_TYPES_DISPATCHER = { 'str': self._check_type_str, 'list': self._check_type_list, 'dict': self._check_type_dict, 'bool': self._check_type_bool, 'int': self._check_type_int, 'float': self._check_type_float, 'path': self._check_type_path, 'raw': self._check_type_raw, 'jsonarg': self._check_type_jsonarg, 'json': self._check_type_jsonarg, 'bytes': self._check_type_bytes, 'bits': self._check_type_bits, } if not bypass_checks: self._check_required_arguments() self._check_argument_types() self._check_argument_values() self._check_required_together(required_together) self._check_required_one_of(required_one_of) self._check_required_if(required_if) self._set_defaults(pre=False) if not self.no_log: self._log_invocation() # finally, make sure we're in a sane working dir self._set_cwd() def warn(self, warning): if isinstance(warning, string_types): self._warnings.append(warning) self.log('[WARNING] %s' % warning) else: raise TypeError("warn requires a string not a %s" % type(warning)) def deprecate(self, msg, version=None): if isinstance(msg, string_types): self._deprecations.append({ 'msg': msg, 'version': version }) self.log('[DEPRECATION WARNING] %s %s' % (msg, version)) else: raise TypeError("deprecate requires a string not a %s" % type(msg)) def load_file_common_arguments(self, params): ''' many modules deal with files, this encapsulates common options that the file module accepts such that it is directly available to all modules and they can share code. ''' path = params.get('path', params.get('dest', None)) if path is None: return {} else: path = os.path.expanduser(os.path.expandvars(path)) b_path = to_bytes(path, errors='surrogate_or_strict') # if the path is a symlink, and we're following links, get # the target of the link instead for testing if params.get('follow', False) and os.path.islink(b_path): b_path = os.path.realpath(b_path) path = to_native(b_path) mode = params.get('mode', None) owner = params.get('owner', None) group = params.get('group', None) # selinux related options seuser = params.get('seuser', None) serole = params.get('serole', None) setype = params.get('setype', None) selevel = params.get('selevel', None) secontext = [seuser, serole, setype] if self.selinux_mls_enabled(): secontext.append(selevel) default_secontext = self.selinux_default_context(path) for i in range(len(default_secontext)): if i is not None and secontext[i] == '_default': secontext[i] = default_secontext[i] attributes = params.get('attributes', None) return dict( path=path, mode=mode, owner=owner, group=group, seuser=seuser, serole=serole, setype=setype, selevel=selevel, secontext=secontext, attributes=attributes, ) # Detect whether using selinux that is MLS-aware. # While this means you can set the level/range with # selinux.lsetfilecon(), it may or may not mean that you # will get the selevel as part of the context returned # by selinux.lgetfilecon(). def selinux_mls_enabled(self): if not HAVE_SELINUX: return False if selinux.is_selinux_mls_enabled() == 1: return True else: return False def selinux_enabled(self): if not HAVE_SELINUX: seenabled = self.get_bin_path('selinuxenabled') if seenabled is not None: (rc,out,err) = self.run_command(seenabled) if rc == 0: self.fail_json(msg="Aborting, target uses selinux but python bindings (libselinux-python) aren't installed!") return False if selinux.is_selinux_enabled() == 1: return True else: return False # Determine whether we need a placeholder for selevel/mls def selinux_initial_context(self): context = [None, None, None] if self.selinux_mls_enabled(): context.append(None) return context # If selinux fails to find a default, return an array of None def selinux_default_context(self, path, mode=0): context = self.selinux_initial_context() if not HAVE_SELINUX or not self.selinux_enabled(): return context try: ret = selinux.matchpathcon(to_native(path, errors='surrogate_or_strict'), mode) except OSError: return context if ret[0] == -1: return context # Limit split to 4 because the selevel, the last in the list, # may contain ':' characters context = ret[1].split(':', 3) return context def selinux_context(self, path): context = self.selinux_initial_context() if not HAVE_SELINUX or not self.selinux_enabled(): return context try: ret = selinux.lgetfilecon_raw(to_native(path, errors='surrogate_or_strict')) except OSError: e = get_exception() if e.errno == errno.ENOENT: self.fail_json(path=path, msg='path %s does not exist' % path) else: self.fail_json(path=path, msg='failed to retrieve selinux context') if ret[0] == -1: return context # Limit split to 4 because the selevel, the last in the list, # may contain ':' characters context = ret[1].split(':', 3) return context def user_and_group(self, path, expand=True): b_path = to_bytes(path, errors='surrogate_then_strict') if expand: b_path = os.path.expanduser(os.path.expandvars(b_path)) st = os.lstat(b_path) uid = st.st_uid gid = st.st_gid return (uid, gid) def find_mount_point(self, path): path = os.path.realpath(os.path.expanduser(os.path.expandvars(path))) while not os.path.ismount(path): path = os.path.dirname(path) return path def is_special_selinux_path(self, path): """ Returns a tuple containing (True, selinux_context) if the given path is on a NFS or other 'special' fs mount point, otherwise the return will be (False, None). """ try: f = open('/proc/mounts', 'r') mount_data = f.readlines() f.close() except: return (False, None) path_mount_point = self.find_mount_point(path) for line in mount_data: (device, mount_point, fstype, options, rest) = line.split(' ', 4) if path_mount_point == mount_point: for fs in self._selinux_special_fs: if fs in fstype: special_context = self.selinux_context(path_mount_point) return (True, special_context) return (False, None) def set_default_selinux_context(self, path, changed): if not HAVE_SELINUX or not self.selinux_enabled(): return changed context = self.selinux_default_context(path) return self.set_context_if_different(path, context, False) def set_context_if_different(self, path, context, changed, diff=None): if not HAVE_SELINUX or not self.selinux_enabled(): return changed cur_context = self.selinux_context(path) new_context = list(cur_context) # Iterate over the current context instead of the # argument context, which may have selevel. (is_special_se, sp_context) = self.is_special_selinux_path(path) if is_special_se: new_context = sp_context else: for i in range(len(cur_context)): if len(context) > i: if context[i] is not None and context[i] != cur_context[i]: new_context[i] = context[i] elif context[i] is None: new_context[i] = cur_context[i] if cur_context != new_context: if diff is not None: if 'before' not in diff: diff['before'] = {} diff['before']['secontext'] = cur_context if 'after' not in diff: diff['after'] = {} diff['after']['secontext'] = new_context try: if self.check_mode: return True rc = selinux.lsetfilecon(to_native(path), str(':'.join(new_context))) except OSError: e = get_exception() self.fail_json(path=path, msg='invalid selinux context: %s' % str(e), new_context=new_context, cur_context=cur_context, input_was=context) if rc != 0: self.fail_json(path=path, msg='set selinux context failed') changed = True return changed def set_owner_if_different(self, path, owner, changed, diff=None, expand=True): b_path = to_bytes(path, errors='surrogate_then_strict') if expand: b_path = os.path.expanduser(os.path.expandvars(b_path)) path = to_text(b_path, errors='surrogate_then_strict') if owner is None: return changed orig_uid, orig_gid = self.user_and_group(path, expand) try: uid = int(owner) except ValueError: try: uid = pwd.getpwnam(owner).pw_uid except KeyError: self.fail_json(path=path, msg='chown failed: failed to look up user %s' % owner) if orig_uid != uid: if diff is not None: if 'before' not in diff: diff['before'] = {} diff['before']['owner'] = orig_uid if 'after' not in diff: diff['after'] = {} diff['after']['owner'] = uid if self.check_mode: return True try: os.lchown(b_path, uid, -1) except OSError: self.fail_json(path=path, msg='chown failed') changed = True return changed def set_group_if_different(self, path, group, changed, diff=None, expand=True): b_path = to_bytes(path, errors='surrogate_then_strict') if expand: b_path = os.path.expanduser(os.path.expandvars(b_path)) path = to_text(b_path, errors='surrogate_then_strict') if group is None: return changed orig_uid, orig_gid = self.user_and_group(b_path, expand) try: gid = int(group) except ValueError: try: gid = grp.getgrnam(group).gr_gid except KeyError: self.fail_json(path=path, msg='chgrp failed: failed to look up group %s' % group) if orig_gid != gid: if diff is not None: if 'before' not in diff: diff['before'] = {} diff['before']['group'] = orig_gid if 'after' not in diff: diff['after'] = {} diff['after']['group'] = gid if self.check_mode: return True try: os.lchown(b_path, -1, gid) except OSError: self.fail_json(path=path, msg='chgrp failed') changed = True return changed def set_mode_if_different(self, path, mode, changed, diff=None, expand=True): b_path = to_bytes(path, errors='surrogate_then_strict') if expand: b_path = os.path.expanduser(os.path.expandvars(b_path)) path = to_text(b_path, errors='surrogate_then_strict') path_stat = os.lstat(b_path) if mode is None: return changed if not isinstance(mode, int): try: mode = int(mode, 8) except Exception: try: mode = self._symbolic_mode_to_octal(path_stat, mode) except Exception: e = get_exception() self.fail_json(path=path, msg="mode must be in octal or symbolic form", details=str(e)) if mode != stat.S_IMODE(mode): # prevent mode from having extra info orbeing invalid long number self.fail_json(path=path, msg="Invalid mode supplied, only permission info is allowed", details=mode) prev_mode = stat.S_IMODE(path_stat.st_mode) if prev_mode != mode: if diff is not None: if 'before' not in diff: diff['before'] = {} diff['before']['mode'] = '0%03o' % prev_mode if 'after' not in diff: diff['after'] = {} diff['after']['mode'] = '0%03o' % mode if self.check_mode: return True # FIXME: comparison against string above will cause this to be executed # every time try: if hasattr(os, 'lchmod'): os.lchmod(b_path, mode) else: if not os.path.islink(b_path): os.chmod(b_path, mode) else: # Attempt to set the perms of the symlink but be # careful not to change the perms of the underlying # file while trying underlying_stat = os.stat(b_path) os.chmod(b_path, mode) new_underlying_stat = os.stat(b_path) if underlying_stat.st_mode != new_underlying_stat.st_mode: os.chmod(b_path, stat.S_IMODE(underlying_stat.st_mode)) except OSError: e = get_exception() if os.path.islink(b_path) and e.errno == errno.EPERM: # Can't set mode on symbolic links pass elif e.errno in (errno.ENOENT, errno.ELOOP): # Can't set mode on broken symbolic links pass else: raise e except Exception: e = get_exception() self.fail_json(path=path, msg='chmod failed', details=str(e)) path_stat = os.lstat(b_path) new_mode = stat.S_IMODE(path_stat.st_mode) if new_mode != prev_mode: changed = True return changed def set_attributes_if_different(self, path, attributes, changed, diff=None, expand=True): if attributes is None: return changed b_path = to_bytes(path, errors='surrogate_then_strict') if expand: b_path = os.path.expanduser(os.path.expandvars(b_path)) path = to_text(b_path, errors='surrogate_then_strict') existing = self.get_file_attributes(b_path) if existing.get('attr_flags','') != attributes: attrcmd = self.get_bin_path('chattr') if attrcmd: attrcmd = [attrcmd, '=%s' % attributes, b_path] changed = True if diff is not None: if 'before' not in diff: diff['before'] = {} diff['before']['attributes'] = existing.get('attr_flags') if 'after' not in diff: diff['after'] = {} diff['after']['attributes'] = attributes if not self.check_mode: try: rc, out, err = self.run_command(attrcmd) if rc != 0 or err: raise Exception("Error while setting attributes: %s" % (out + err)) except: e = get_exception() self.fail_json(path=path, msg='chattr failed', details=str(e)) return changed def get_file_attributes(self, path): output = {} attrcmd = self.get_bin_path('lsattr', False) if attrcmd: attrcmd = [attrcmd, '-vd', path] try: rc, out, err = self.run_command(attrcmd) if rc == 0: res = out.split(' ')[0:2] output['attr_flags'] = res[1].replace('-','').strip() output['version'] = res[0].strip() output['attributes'] = format_attributes(output['attr_flags']) except: pass return output def _symbolic_mode_to_octal(self, path_stat, symbolic_mode): new_mode = stat.S_IMODE(path_stat.st_mode) mode_re = re.compile(r'^(?P<users>[ugoa]+)(?P<operator>[-+=])(?P<perms>[rwxXst-]*|[ugo])$') for mode in symbolic_mode.split(','): match = mode_re.match(mode) if match: users = match.group('users') operator = match.group('operator') perms = match.group('perms') if users == 'a': users = 'ugo' for user in users: mode_to_apply = self._get_octal_mode_from_symbolic_perms(path_stat, user, perms) new_mode = self._apply_operation_to_mode(user, operator, mode_to_apply, new_mode) else: raise ValueError("bad symbolic permission for mode: %s" % mode) return new_mode def _apply_operation_to_mode(self, user, operator, mode_to_apply, current_mode): if operator == '=': if user == 'u': mask = stat.S_IRWXU | stat.S_ISUID elif user == 'g': mask = stat.S_IRWXG | stat.S_ISGID elif user == 'o': mask = stat.S_IRWXO | stat.S_ISVTX # mask out u, g, or o permissions from current_mode and apply new permissions inverse_mask = mask ^ PERM_BITS new_mode = (current_mode & inverse_mask) | mode_to_apply elif operator == '+': new_mode = current_mode | mode_to_apply elif operator == '-': new_mode = current_mode - (current_mode & mode_to_apply) return new_mode def _get_octal_mode_from_symbolic_perms(self, path_stat, user, perms): prev_mode = stat.S_IMODE(path_stat.st_mode) is_directory = stat.S_ISDIR(path_stat.st_mode) has_x_permissions = (prev_mode & EXEC_PERM_BITS) > 0 apply_X_permission = is_directory or has_x_permissions # Permission bits constants documented at: # http://docs.python.org/2/library/stat.html#stat.S_ISUID if apply_X_permission: X_perms = { 'u': {'X': stat.S_IXUSR}, 'g': {'X': stat.S_IXGRP}, 'o': {'X': stat.S_IXOTH} } else: X_perms = { 'u': {'X': 0}, 'g': {'X': 0}, 'o': {'X': 0} } user_perms_to_modes = { 'u': { 'r': stat.S_IRUSR, 'w': stat.S_IWUSR, 'x': stat.S_IXUSR, 's': stat.S_ISUID, 't': 0, 'u': prev_mode & stat.S_IRWXU, 'g': (prev_mode & stat.S_IRWXG) << 3, 'o': (prev_mode & stat.S_IRWXO) << 6 }, 'g': { 'r': stat.S_IRGRP, 'w': stat.S_IWGRP, 'x': stat.S_IXGRP, 's': stat.S_ISGID, 't': 0, 'u': (prev_mode & stat.S_IRWXU) >> 3, 'g': prev_mode & stat.S_IRWXG, 'o': (prev_mode & stat.S_IRWXO) << 3 }, 'o': { 'r': stat.S_IROTH, 'w': stat.S_IWOTH, 'x': stat.S_IXOTH, 's': 0, 't': stat.S_ISVTX, 'u': (prev_mode & stat.S_IRWXU) >> 6, 'g': (prev_mode & stat.S_IRWXG) >> 3, 'o': prev_mode & stat.S_IRWXO } } # Insert X_perms into user_perms_to_modes for key, value in X_perms.items(): user_perms_to_modes[key].update(value) or_reduce = lambda mode, perm: mode | user_perms_to_modes[user][perm] return reduce(or_reduce, perms, 0) def set_fs_attributes_if_different(self, file_args, changed, diff=None, expand=True): # set modes owners and context as needed changed = self.set_context_if_different( file_args['path'], file_args['secontext'], changed, diff ) changed = self.set_owner_if_different( file_args['path'], file_args['owner'], changed, diff, expand ) changed = self.set_group_if_different( file_args['path'], file_args['group'], changed, diff, expand ) changed = self.set_mode_if_different( file_args['path'], file_args['mode'], changed, diff, expand ) changed = self.set_attributes_if_different( file_args['path'], file_args['attributes'], changed, diff, expand ) return changed def set_directory_attributes_if_different(self, file_args, changed, diff=None, expand=True): return self.set_fs_attributes_if_different(file_args, changed, diff, expand) def set_file_attributes_if_different(self, file_args, changed, diff=None, expand=True): return self.set_fs_attributes_if_different(file_args, changed, diff, expand) def add_path_info(self, kwargs): ''' for results that are files, supplement the info about the file in the return path with stats about the file path. ''' path = kwargs.get('path', kwargs.get('dest', None)) if path is None: return kwargs b_path = to_bytes(path, errors='surrogate_or_strict') if os.path.exists(b_path): (uid, gid) = self.user_and_group(path) kwargs['uid'] = uid kwargs['gid'] = gid try: user = pwd.getpwuid(uid)[0] except KeyError: user = str(uid) try: group = grp.getgrgid(gid)[0] except KeyError: group = str(gid) kwargs['owner'] = user kwargs['group'] = group st = os.lstat(b_path) kwargs['mode'] = '0%03o' % stat.S_IMODE(st[stat.ST_MODE]) # secontext not yet supported if os.path.islink(b_path): kwargs['state'] = 'link' elif os.path.isdir(b_path): kwargs['state'] = 'directory' elif os.stat(b_path).st_nlink > 1: kwargs['state'] = 'hard' else: kwargs['state'] = 'file' if HAVE_SELINUX and self.selinux_enabled(): kwargs['secontext'] = ':'.join(self.selinux_context(path)) kwargs['size'] = st[stat.ST_SIZE] else: kwargs['state'] = 'absent' return kwargs def _check_locale(self): ''' Uses the locale module to test the currently set locale (per the LANG and LC_CTYPE environment settings) ''' try: # setting the locale to '' uses the default locale # as it would be returned by locale.getdefaultlocale() locale.setlocale(locale.LC_ALL, '') except locale.Error: # fallback to the 'C' locale, which may cause unicode # issues but is preferable to simply failing because # of an unknown locale locale.setlocale(locale.LC_ALL, 'C') os.environ['LANG'] = 'C' os.environ['LC_ALL'] = 'C' os.environ['LC_MESSAGES'] = 'C' except Exception: e = get_exception() self.fail_json(msg="An unknown error was encountered while attempting to validate the locale: %s" % e) def _handle_aliases(self, spec=None): # this uses exceptions as it happens before we can safely call fail_json aliases_results = {} #alias:canon if spec is None: spec = self.argument_spec for (k,v) in spec.items(): self._legal_inputs.append(k) aliases = v.get('aliases', None) default = v.get('default', None) required = v.get('required', False) if default is not None and required: # not alias specific but this is a good place to check this raise Exception("internal error: required and default are mutually exclusive for %s" % k) if aliases is None: continue if not isinstance(aliases, SEQUENCETYPE) or isinstance(aliases, (binary_type, text_type)): raise Exception('internal error: aliases must be a list or tuple') for alias in aliases: self._legal_inputs.append(alias) aliases_results[alias] = k if alias in self.params: self.params[k] = self.params[alias] return aliases_results def _check_arguments(self, check_invalid_arguments): self._syslog_facility = 'LOG_USER' unsupported_parameters = set() for (k,v) in list(self.params.items()): if k == '_ansible_check_mode' and v: self.check_mode = True elif k == '_ansible_no_log': self.no_log = self.boolean(v) elif k == '_ansible_debug': self._debug = self.boolean(v) elif k == '_ansible_diff': self._diff = self.boolean(v) elif k == '_ansible_verbosity': self._verbosity = v elif k == '_ansible_selinux_special_fs': self._selinux_special_fs = v elif k == '_ansible_syslog_facility': self._syslog_facility = v elif k == '_ansible_version': self.ansible_version = v elif k == '_ansible_module_name': self._name = v elif k == '_ansible_socket': self._socket_path = v elif check_invalid_arguments and k not in self._legal_inputs: unsupported_parameters.add(k) #clean up internal params: if k.startswith('_ansible_'): del self.params[k] if unsupported_parameters: self.fail_json(msg="Unsupported parameters for (%s) module: %s. Supported parameters include: %s" % (self._name, ','.join(sorted(list(unsupported_parameters))), ','.join(sorted(self.argument_spec.keys())))) if self.check_mode and not self.supports_check_mode: self.exit_json(skipped=True, msg="remote module (%s) does not support check mode" % self._name) def _count_terms(self, check): count = 0 for term in check: if term in self.params: count += 1 return count def _check_mutually_exclusive(self, spec): if spec is None: return for check in spec: count = self._count_terms(check) if count > 1: self.fail_json(msg="parameters are mutually exclusive: %s" % (check,)) def _check_required_one_of(self, spec): if spec is None: return for check in spec: count = self._count_terms(check) if count == 0: self.fail_json(msg="one of the following is required: %s" % ','.join(check)) def _check_required_together(self, spec): if spec is None: return for check in spec: counts = [ self._count_terms([field]) for field in check ] non_zero = [ c for c in counts if c > 0 ] if len(non_zero) > 0: if 0 in counts: self.fail_json(msg="parameters are required together: %s" % (check,)) def _check_required_arguments(self, spec=None, param=None ): ''' ensure all required arguments are present ''' missing = [] if spec is None: spec = self.argument_spec if param is None: param = self.params for (k,v) in spec.items(): required = v.get('required', False) if required and k not in param: missing.append(k) if len(missing) > 0: self.fail_json(msg="missing required arguments: %s" % ",".join(missing)) def _check_required_if(self, spec): ''' ensure that parameters which conditionally required are present ''' if spec is None: return for sp in spec: missing = [] max_missing_count = 0 is_one_of = False if len(sp) == 4: key, val, requirements, is_one_of = sp else: key, val, requirements = sp # is_one_of is True at least one requirement should be # present, else all requirements should be present. if is_one_of: max_missing_count = len(requirements) if key in self.params and self.params[key] == val: for check in requirements: count = self._count_terms((check,)) if count == 0: missing.append(check) if len(missing) and len(missing) >= max_missing_count: self.fail_json(msg="%s is %s but the following are missing: %s" % (key, val, ','.join(missing))) def _check_argument_values(self, spec=None, param=None): ''' ensure all arguments have the requested values, and there are no stray arguments ''' if spec is None: spec = self.argument_spec if param is None: param = self.params for (k,v) in spec.items(): choices = v.get('choices',None) if choices is None: continue if isinstance(choices, SEQUENCETYPE) and not isinstance(choices, (binary_type, text_type)): if k in param: if param[k] not in choices: # PyYaml converts certain strings to bools. If we can unambiguously convert back, do so before checking # the value. If we can't figure this out, module author is responsible. lowered_choices = None if param[k] == 'False': lowered_choices = _lenient_lowercase(choices) FALSEY = frozenset(BOOLEANS_FALSE) overlap = FALSEY.intersection(choices) if len(overlap) == 1: # Extract from a set (param[k],) = overlap if param[k] == 'True': if lowered_choices is None: lowered_choices = _lenient_lowercase(choices) TRUTHY = frozenset(BOOLEANS_TRUE) overlap = TRUTHY.intersection(choices) if len(overlap) == 1: (param[k],) = overlap if param[k] not in choices: choices_str=",".join([to_native(c) for c in choices]) msg="value of %s must be one of: %s, got: %s" % (k, choices_str, param[k]) self.fail_json(msg=msg) else: self.fail_json(msg="internal error: choices for argument %s are not iterable: %s" % (k, choices)) def safe_eval(self, value, locals=None, include_exceptions=False): # do not allow method calls to modules if not isinstance(value, string_types): # already templated to a datavaluestructure, perhaps? if include_exceptions: return (value, None) return value if re.search(r'\w\.\w+\(', value): if include_exceptions: return (value, None) return value # do not allow imports if re.search(r'import \w+', value): if include_exceptions: return (value, None) return value try: result = literal_eval(value) if include_exceptions: return (result, None) else: return result except Exception: e = get_exception() if include_exceptions: return (value, e) return value def _check_type_str(self, value): if isinstance(value, string_types): return value # Note: This could throw a unicode error if value's __str__() method # returns non-ascii. Have to port utils.to_bytes() if that happens return str(value) def _check_type_list(self, value): if isinstance(value, list): return value if isinstance(value, string_types): return value.split(",") elif isinstance(value, int) or isinstance(value, float): return [ str(value) ] raise TypeError('%s cannot be converted to a list' % type(value)) def _check_type_dict(self, value): if isinstance(value, dict): return value if isinstance(value, string_types): if value.startswith("{"): try: return json.loads(value) except: (result, exc) = self.safe_eval(value, dict(), include_exceptions=True) if exc is not None: raise TypeError('unable to evaluate string as dictionary') return result elif '=' in value: fields = [] field_buffer = [] in_quote = False in_escape = False for c in value.strip(): if in_escape: field_buffer.append(c) in_escape = False elif c == '\\': in_escape = True elif not in_quote and c in ('\'', '"'): in_quote = c elif in_quote and in_quote == c: in_quote = False elif not in_quote and c in (',', ' '): field = ''.join(field_buffer) if field: fields.append(field) field_buffer = [] else: field_buffer.append(c) field = ''.join(field_buffer) if field: fields.append(field) return dict(x.split("=", 1) for x in fields) else: raise TypeError("dictionary requested, could not parse JSON or key=value") raise TypeError('%s cannot be converted to a dict' % type(value)) def _check_type_bool(self, value): if isinstance(value, bool): return value if isinstance(value, string_types) or isinstance(value, int): return self.boolean(value) raise TypeError('%s cannot be converted to a bool' % type(value)) def _check_type_int(self, value): if isinstance(value, int): return value if isinstance(value, string_types): return int(value) raise TypeError('%s cannot be converted to an int' % type(value)) def _check_type_float(self, value): if isinstance(value, float): return value if isinstance(value, (binary_type, text_type, int)): return float(value) raise TypeError('%s cannot be converted to a float' % type(value)) def _check_type_path(self, value): value = self._check_type_str(value) return os.path.expanduser(os.path.expandvars(value)) def _check_type_jsonarg(self, value): # Return a jsonified string. Sometimes the controller turns a json # string into a dict/list so transform it back into json here if isinstance(value, (text_type, binary_type)): return value.strip() else: if isinstance(value, (list, tuple, dict)): return json.dumps(value) raise TypeError('%s cannot be converted to a json string' % type(value)) def _check_type_raw(self, value): return value def _check_type_bytes(self, value): try: self.human_to_bytes(value) except ValueError: raise TypeError('%s cannot be converted to a Byte value' % type(value)) def _check_type_bits(self, value): try: self.human_to_bytes(value, isbits=True) except ValueError: raise TypeError('%s cannot be converted to a Bit value' % type(value)) def _check_argument_types(self, spec=None, param=None): ''' ensure all arguments have the requested type ''' if spec is None: spec = self.argument_spec if param is None: param= self.params for (k, v) in spec.items(): wanted = v.get('type', None) if k not in param: continue if wanted is None: # Mostly we want to default to str. # For values set to None explicitly, return None instead as # that allows a user to unset a parameter if self.params[k] is None: continue wanted = 'str' value = self.params[k] if value is None: continue try: type_checker = self._CHECK_ARGUMENT_TYPES_DISPATCHER[wanted] except KeyError: self.fail_json(msg="implementation error: unknown type %s requested for %s" % (wanted, k)) try: self.params[k] = type_checker(value) except (TypeError, ValueError): e = get_exception() self.fail_json(msg="argument %s is of type %s and we were unable to convert to %s: %s" % (k, type(value), wanted, e)) # deal with subspecs spec = None if wanted == 'dict' or (wanted == 'list' and v.get('elements', '') == 'dict'): spec = v.get('spec', None) if spec: self._check_required_arguments(spec, param[k]) self._check_argument_types(spec, param[k]) self._check_argument_values(spec, param[k]) def _set_defaults(self, pre=True): for (k,v) in self.argument_spec.items(): default = v.get('default', None) if pre is True: # this prevents setting defaults on required items if default is not None and k not in self.params: self.params[k] = default else: # make sure things without a default still get set None if k not in self.params: self.params[k] = default def _set_fallbacks(self): for k,v in self.argument_spec.items(): fallback = v.get('fallback', (None,)) fallback_strategy = fallback[0] fallback_args = [] fallback_kwargs = {} if k not in self.params and fallback_strategy is not None: for item in fallback[1:]: if isinstance(item, dict): fallback_kwargs = item else: fallback_args = item try: self.params[k] = fallback_strategy(*fallback_args, **fallback_kwargs) except AnsibleFallbackNotFound: continue def _load_params(self): ''' read the input and set the params attribute. This method is for backwards compatibility. The guts of the function were moved out in 2.1 so that custom modules could read the parameters. ''' # debug overrides to read args from file or cmdline self.params = _load_params() def _log_to_syslog(self, msg): if HAS_SYSLOG: module = 'ansible-%s' % self._name facility = getattr(syslog, self._syslog_facility, syslog.LOG_USER) syslog.openlog(str(module), 0, facility) syslog.syslog(syslog.LOG_INFO, msg) def debug(self, msg): if self._debug: self.log('[debug] %s' % msg) def log(self, msg, log_args=None): if not self.no_log: if log_args is None: log_args = dict() module = 'ansible-%s' % self._name if isinstance(module, binary_type): module = module.decode('utf-8', 'replace') # 6655 - allow for accented characters if not isinstance(msg, (binary_type, text_type)): raise TypeError("msg should be a string (got %s)" % type(msg)) # We want journal to always take text type # syslog takes bytes on py2, text type on py3 if isinstance(msg, binary_type): journal_msg = remove_values(msg.decode('utf-8', 'replace'), self.no_log_values) else: # TODO: surrogateescape is a danger here on Py3 journal_msg = remove_values(msg, self.no_log_values) if PY3: syslog_msg = journal_msg else: syslog_msg = journal_msg.encode('utf-8', 'replace') if has_journal: journal_args = [("MODULE", os.path.basename(__file__))] for arg in log_args: journal_args.append((arg.upper(), str(log_args[arg]))) try: journal.send(u"%s %s" % (module, journal_msg), **dict(journal_args)) except IOError: # fall back to syslog since logging to journal failed self._log_to_syslog(syslog_msg) else: self._log_to_syslog(syslog_msg) def _log_invocation(self): ''' log that ansible ran the module ''' # TODO: generalize a separate log function and make log_invocation use it # Sanitize possible password argument when logging. log_args = dict() for param in self.params: canon = self.aliases.get(param, param) arg_opts = self.argument_spec.get(canon, {}) no_log = arg_opts.get('no_log', False) if self.boolean(no_log): log_args[param] = 'NOT_LOGGING_PARAMETER' # try to capture all passwords/passphrase named fields missed by no_log elif PASSWORD_MATCH.search(param) and \ arg_opts.get('type', 'str') != 'bool' and \ not arg_opts.get('choices', False): # skip boolean and enums as they are about 'password' state log_args[param] = 'NOT_LOGGING_PASSWORD' self.warn('Module did not set no_log for %s' % param) else: param_val = self.params[param] if not isinstance(param_val, (text_type, binary_type)): param_val = str(param_val) elif isinstance(param_val, text_type): param_val = param_val.encode('utf-8') log_args[param] = heuristic_log_sanitize(param_val, self.no_log_values) msg = ['%s=%s' % (to_native(arg), to_native(val)) for arg, val in log_args.items()] if msg: msg = 'Invoked with %s' % ' '.join(msg) else: msg = 'Invoked' self.log(msg, log_args=log_args) def _set_cwd(self): try: cwd = os.getcwd() if not os.access(cwd, os.F_OK|os.R_OK): raise return cwd except: # we don't have access to the cwd, probably because of sudo. # Try and move to a neutral location to prevent errors for cwd in [os.path.expandvars('$HOME'), tempfile.gettempdir()]: try: if os.access(cwd, os.F_OK|os.R_OK): os.chdir(cwd) return cwd except: pass # we won't error here, as it may *not* be a problem, # and we don't want to break modules unnecessarily return None def get_bin_path(self, arg, required=False, opt_dirs=[]): ''' find system executable in PATH. Optional arguments: - required: if executable is not found and required is true, fail_json - opt_dirs: optional list of directories to search in addition to PATH if found return full path; otherwise return None ''' sbin_paths = ['/sbin', '/usr/sbin', '/usr/local/sbin'] paths = [] for d in opt_dirs: if d is not None and os.path.exists(d): paths.append(d) paths += os.environ.get('PATH', '').split(os.pathsep) bin_path = None # mangle PATH to include /sbin dirs for p in sbin_paths: if p not in paths and os.path.exists(p): paths.append(p) for d in paths: if not d: continue path = os.path.join(d, arg) if os.path.exists(path) and not os.path.isdir(path) and is_executable(path): bin_path = path break if required and bin_path is None: self.fail_json(msg='Failed to find required executable %s in paths: %s' % (arg, os.pathsep.join(paths))) return bin_path def boolean(self, arg): ''' return a bool for the arg ''' if arg is None or isinstance(arg, bool): return arg if isinstance(arg, string_types): arg = arg.lower() if arg in BOOLEANS_TRUE: return True elif arg in BOOLEANS_FALSE: return False else: self.fail_json(msg='%s is not a valid boolean. Valid booleans include: %s' % (to_text(arg), ','.join(['%s' % x for x in BOOLEANS]))) def jsonify(self, data): for encoding in ("utf-8", "latin-1"): try: return json.dumps(data, encoding=encoding) # Old systems using old simplejson module does not support encoding keyword. except TypeError: try: new_data = json_dict_bytes_to_unicode(data, encoding=encoding) except UnicodeDecodeError: continue return json.dumps(new_data) except UnicodeDecodeError: continue self.fail_json(msg='Invalid unicode encoding encountered') def from_json(self, data): return json.loads(data) def add_cleanup_file(self, path): if path not in self.cleanup_files: self.cleanup_files.append(path) def do_cleanup_files(self): for path in self.cleanup_files: self.cleanup(path) def _return_formatted(self, kwargs): self.add_path_info(kwargs) if 'invocation' not in kwargs: kwargs['invocation'] = {'module_args': self.params} if 'warnings' in kwargs: if isinstance(kwargs['warnings'], list): for w in kwargs['warnings']: self.warn(w) else: self.warn(kwargs['warnings']) if self._warnings: kwargs['warnings'] = self._warnings if 'deprecations' in kwargs: if isinstance(kwargs['deprecations'], list): for d in kwargs['deprecations']: if isinstance(d, SEQUENCETYPE) and len(d) == 2: self.deprecate(d[0], version=d[1]) else: self.deprecate(d) else: self.deprecate(d) if self._deprecations: kwargs['deprecations'] = self._deprecations kwargs = remove_values(kwargs, self.no_log_values) print('\n%s' % self.jsonify(kwargs)) def exit_json(self, **kwargs): ''' return from the module, without error ''' if not 'changed' in kwargs: kwargs['changed'] = False self.do_cleanup_files() self._return_formatted(kwargs) sys.exit(0) def fail_json(self, **kwargs): ''' return from the module, with an error message ''' assert 'msg' in kwargs, "implementation error -- msg to explain the error is required" kwargs['failed'] = True self.do_cleanup_files() self._return_formatted(kwargs) sys.exit(1) def fail_on_missing_params(self, required_params=None): ''' This is for checking for required params when we can not check via argspec because we need more information than is simply given in the argspec. ''' if not required_params: return missing_params = [] for required_param in required_params: if not self.params.get(required_param): missing_params.append(required_param) if missing_params: self.fail_json(msg="missing required arguments: %s" % ','.join(missing_params)) def digest_from_file(self, filename, algorithm): ''' Return hex digest of local file for a digest_method specified by name, or None if file is not present. ''' if not os.path.exists(filename): return None if os.path.isdir(filename): self.fail_json(msg="attempted to take checksum of directory: %s" % filename) # preserve old behaviour where the third parameter was a hash algorithm object if hasattr(algorithm, 'hexdigest'): digest_method = algorithm else: try: digest_method = AVAILABLE_HASH_ALGORITHMS[algorithm]() except KeyError: self.fail_json(msg="Could not hash file '%s' with algorithm '%s'. Available algorithms: %s" % (filename, algorithm, ', '.join(AVAILABLE_HASH_ALGORITHMS))) blocksize = 64 * 1024 infile = open(filename, 'rb') block = infile.read(blocksize) while block: digest_method.update(block) block = infile.read(blocksize) infile.close() return digest_method.hexdigest() def md5(self, filename): ''' Return MD5 hex digest of local file using digest_from_file(). Do not use this function unless you have no other choice for: 1) Optional backwards compatibility 2) Compatibility with a third party protocol This function will not work on systems complying with FIPS-140-2. Most uses of this function can use the module.sha1 function instead. ''' if 'md5' not in AVAILABLE_HASH_ALGORITHMS: raise ValueError('MD5 not available. Possibly running in FIPS mode') return self.digest_from_file(filename, 'md5') def sha1(self, filename): ''' Return SHA1 hex digest of local file using digest_from_file(). ''' return self.digest_from_file(filename, 'sha1') def sha256(self, filename): ''' Return SHA-256 hex digest of local file using digest_from_file(). ''' return self.digest_from_file(filename, 'sha256') def backup_local(self, fn): '''make a date-marked backup of the specified file, return True or False on success or failure''' backupdest = '' if os.path.exists(fn): # backups named basename.PID.YYYY-MM-DD@HH:MM:SS~ ext = time.strftime("%Y-%m-%d@%H:%M:%S~", time.localtime(time.time())) backupdest = '%s.%s.%s' % (fn, os.getpid(), ext) try: shutil.copy2(fn, backupdest) except (shutil.Error, IOError): e = get_exception() self.fail_json(msg='Could not make backup of %s to %s: %s' % (fn, backupdest, e)) return backupdest def cleanup(self, tmpfile): if os.path.exists(tmpfile): try: os.unlink(tmpfile) except OSError: e = get_exception() sys.stderr.write("could not cleanup %s: %s" % (tmpfile, e)) def atomic_move(self, src, dest, unsafe_writes=False): '''atomically move src to dest, copying attributes from dest, returns true on success it uses os.rename to ensure this as it is an atomic operation, rest of the function is to work around limitations, corner cases and ensure selinux context is saved if possible''' context = None dest_stat = None b_src = to_bytes(src, errors='surrogate_or_strict') b_dest = to_bytes(dest, errors='surrogate_or_strict') if os.path.exists(b_dest): try: dest_stat = os.stat(b_dest) # copy mode and ownership os.chmod(b_src, dest_stat.st_mode & PERM_BITS) os.chown(b_src, dest_stat.st_uid, dest_stat.st_gid) # try to copy flags if possible if hasattr(os, 'chflags') and hasattr(dest_stat, 'st_flags'): try: os.chflags(b_src, dest_stat.st_flags) except OSError: e = get_exception() for err in 'EOPNOTSUPP', 'ENOTSUP': if hasattr(errno, err) and e.errno == getattr(errno, err): break else: raise except OSError: e = get_exception() if e.errno != errno.EPERM: raise if self.selinux_enabled(): context = self.selinux_context(dest) else: if self.selinux_enabled(): context = self.selinux_default_context(dest) creating = not os.path.exists(b_dest) try: # Optimistically try a rename, solves some corner cases and can avoid useless work, throws exception if not atomic. os.rename(b_src, b_dest) except (IOError, OSError): e = get_exception() if e.errno not in [errno.EPERM, errno.EXDEV, errno.EACCES, errno.ETXTBSY, errno.EBUSY]: # only try workarounds for errno 18 (cross device), 1 (not permitted), 13 (permission denied) # and 26 (text file busy) which happens on vagrant synced folders and other 'exotic' non posix file systems self.fail_json(msg='Could not replace file: %s to %s: %s' % (src, dest, e), exception=traceback.format_exc()) else: b_dest_dir = os.path.dirname(b_dest) # Use bytes here. In the shippable CI, this fails with # a UnicodeError with surrogateescape'd strings for an unknown # reason (doesn't happen in a local Ubuntu16.04 VM) native_dest_dir = b_dest_dir native_suffix = os.path.basename(b_dest) native_prefix = b('.ansible_tmp') try: tmp_dest_fd, tmp_dest_name = tempfile.mkstemp( prefix=native_prefix, dir=native_dest_dir, suffix=native_suffix) except (OSError, IOError): e = get_exception() self.fail_json(msg='The destination directory (%s) is not writable by the current user. Error was: %s' % (os.path.dirname(dest), e)) except TypeError: # We expect that this is happening because python3.4.x and # below can't handle byte strings in mkstemp(). Traceback # would end in something like: # file = _os.path.join(dir, pre + name + suf) # TypeError: can't concat bytes to str self.fail_json(msg='Failed creating temp file for atomic move. This usually happens when using Python3 less than Python3.5. ' 'Please use Python2.x or Python3.5 or greater.', exception=traceback.format_exc()) b_tmp_dest_name = to_bytes(tmp_dest_name, errors='surrogate_or_strict') try: try: # close tmp file handle before file operations to prevent text file busy errors on vboxfs synced folders (windows host) os.close(tmp_dest_fd) # leaves tmp file behind when sudo and not root try: shutil.move(b_src, b_tmp_dest_name) except OSError: # cleanup will happen by 'rm' of tempdir # copy2 will preserve some metadata shutil.copy2(b_src, b_tmp_dest_name) if self.selinux_enabled(): self.set_context_if_different( b_tmp_dest_name, context, False) try: tmp_stat = os.stat(b_tmp_dest_name) if dest_stat and (tmp_stat.st_uid != dest_stat.st_uid or tmp_stat.st_gid != dest_stat.st_gid): os.chown(b_tmp_dest_name, dest_stat.st_uid, dest_stat.st_gid) except OSError: e = get_exception() if e.errno != errno.EPERM: raise try: os.rename(b_tmp_dest_name, b_dest) except (shutil.Error, OSError, IOError): e = get_exception() if unsafe_writes and e.errno == errno.EBUSY: self._unsafe_writes(b_tmp_dest_name, b_dest) else: self.fail_json(msg='Unable to rename file: %s to %s: %s' % (src, dest, e), exception=traceback.format_exc()) except (shutil.Error, OSError, IOError): e = get_exception() self.fail_json(msg='Failed to replace file: %s to %s: %s' % (src, dest, e), exception=traceback.format_exc()) finally: self.cleanup(b_tmp_dest_name) if creating: # make sure the file has the correct permissions # based on the current value of umask umask = os.umask(0) os.umask(umask) os.chmod(b_dest, DEFAULT_PERM & ~umask) try: os.chown(b_dest, os.geteuid(), os.getegid()) except OSError: # We're okay with trying our best here. If the user is not # root (or old Unices) they won't be able to chown. pass if self.selinux_enabled(): # rename might not preserve context self.set_context_if_different(dest, context, False) def _unsafe_writes(self, src, dest): # sadly there are some situations where we cannot ensure atomicity, but only if # the user insists and we get the appropriate error we update the file unsafely try: try: out_dest = open(dest, 'wb') in_src = open(src, 'rb') shutil.copyfileobj(in_src, out_dest) finally: # assuring closed files in 2.4 compatible way if out_dest: out_dest.close() if in_src: in_src.close() except (shutil.Error, OSError, IOError): e = get_exception() self.fail_json(msg='Could not write data to file (%s) from (%s): %s' % (dest, src, e), exception=traceback.format_exc()) def _read_from_pipes(self, rpipes, rfds, file_descriptor): data = b('') if file_descriptor in rfds: data = os.read(file_descriptor.fileno(), 9000) if data == b(''): rpipes.remove(file_descriptor) return data def run_command(self, args, check_rc=False, close_fds=True, executable=None, data=None, binary_data=False, path_prefix=None, cwd=None, use_unsafe_shell=False, prompt_regex=None, environ_update=None, umask=None, encoding='utf-8', errors='surrogate_or_strict'): ''' Execute a command, returns rc, stdout, and stderr. :arg args: is the command to run * If args is a list, the command will be run with shell=False. * If args is a string and use_unsafe_shell=False it will split args to a list and run with shell=False * If args is a string and use_unsafe_shell=True it runs with shell=True. :kw check_rc: Whether to call fail_json in case of non zero RC. Default False :kw close_fds: See documentation for subprocess.Popen(). Default True :kw executable: See documentation for subprocess.Popen(). Default None :kw data: If given, information to write to the stdin of the command :kw binary_data: If False, append a newline to the data. Default False :kw path_prefix: If given, additional path to find the command in. This adds to the PATH environment vairable so helper commands in the same directory can also be found :kw cwd: If given, working directory to run the command inside :kw use_unsafe_shell: See `args` parameter. Default False :kw prompt_regex: Regex string (not a compiled regex) which can be used to detect prompts in the stdout which would otherwise cause the execution to hang (especially if no input data is specified) :kw environ_update: dictionary to *update* os.environ with :kw umask: Umask to be used when running the command. Default None :kw encoding: Since we return native strings, on python3 we need to know the encoding to use to transform from bytes to text. If you want to always get bytes back, use encoding=None. The default is "utf-8". This does not affect transformation of strings given as args. :kw errors: Since we return native strings, on python3 we need to transform stdout and stderr from bytes to text. If the bytes are undecodable in the ``encoding`` specified, then use this error handler to deal with them. The default is ``surrogate_or_strict`` which means that the bytes will be decoded using the surrogateescape error handler if available (available on all python3 versions we support) otherwise a UnicodeError traceback will be raised. This does not affect transformations of strings given as args. :returns: A 3-tuple of return code (integer), stdout (native string), and stderr (native string). On python2, stdout and stderr are both byte strings. On python3, stdout and stderr are text strings converted according to the encoding and errors parameters. If you want byte strings on python3, use encoding=None to turn decoding to text off. ''' shell = False if isinstance(args, list): if use_unsafe_shell: args = " ".join([pipes.quote(x) for x in args]) shell = True elif isinstance(args, (binary_type, text_type)) and use_unsafe_shell: shell = True elif isinstance(args, (binary_type, text_type)): # On python2.6 and below, shlex has problems with text type # On python3, shlex needs a text type. if PY2: args = to_bytes(args, errors='surrogate_or_strict') elif PY3: args = to_text(args, errors='surrogateescape') args = shlex.split(args) else: msg = "Argument 'args' to run_command must be list or string" self.fail_json(rc=257, cmd=args, msg=msg) prompt_re = None if prompt_regex: if isinstance(prompt_regex, text_type): if PY3: prompt_regex = to_bytes(prompt_regex, errors='surrogateescape') elif PY2: prompt_regex = to_bytes(prompt_regex, errors='surrogate_or_strict') try: prompt_re = re.compile(prompt_regex, re.MULTILINE) except re.error: self.fail_json(msg="invalid prompt regular expression given to run_command") # expand things like $HOME and ~ if not shell: args = [ os.path.expanduser(os.path.expandvars(x)) for x in args if x is not None ] rc = 0 msg = None st_in = None # Manipulate the environ we'll send to the new process old_env_vals = {} # We can set this from both an attribute and per call for key, val in self.run_command_environ_update.items(): old_env_vals[key] = os.environ.get(key, None) os.environ[key] = val if environ_update: for key, val in environ_update.items(): old_env_vals[key] = os.environ.get(key, None) os.environ[key] = val if path_prefix: old_env_vals['PATH'] = os.environ['PATH'] os.environ['PATH'] = "%s:%s" % (path_prefix, os.environ['PATH']) # If using test-module and explode, the remote lib path will resemble ... # /tmp/test_module_scratch/debug_dir/ansible/module_utils/basic.py # If using ansible or ansible-playbook with a remote system ... # /tmp/ansible_vmweLQ/ansible_modlib.zip/ansible/module_utils/basic.py # Clean out python paths set by ansiballz if 'PYTHONPATH' in os.environ: pypaths = os.environ['PYTHONPATH'].split(':') pypaths = [x for x in pypaths \ if not x.endswith('/ansible_modlib.zip') \ and not x.endswith('/debug_dir')] os.environ['PYTHONPATH'] = ':'.join(pypaths) if not os.environ['PYTHONPATH']: del os.environ['PYTHONPATH'] # create a printable version of the command for use # in reporting later, which strips out things like # passwords from the args list to_clean_args = args if PY2: if isinstance(args, text_type): to_clean_args = to_bytes(args) else: if isinstance(args, binary_type): to_clean_args = to_text(args) if isinstance(args, (text_type, binary_type)): to_clean_args = shlex.split(to_clean_args) clean_args = [] is_passwd = False for arg in to_clean_args: if is_passwd: is_passwd = False clean_args.append('********') continue if PASSWD_ARG_RE.match(arg): sep_idx = arg.find('=') if sep_idx > -1: clean_args.append('%s=********' % arg[:sep_idx]) continue else: is_passwd = True arg = heuristic_log_sanitize(arg, self.no_log_values) clean_args.append(arg) clean_args = ' '.join(pipes.quote(arg) for arg in clean_args) if data: st_in = subprocess.PIPE kwargs = dict( executable=executable, shell=shell, close_fds=close_fds, stdin=st_in, stdout=subprocess.PIPE, stderr=subprocess.PIPE, ) # store the pwd prev_dir = os.getcwd() # make sure we're in the right working directory if cwd and os.path.isdir(cwd): cwd = os.path.abspath(os.path.expanduser(cwd)) kwargs['cwd'] = cwd try: os.chdir(cwd) except (OSError, IOError): e = get_exception() self.fail_json(rc=e.errno, msg="Could not open %s, %s" % (cwd, str(e))) old_umask = None if umask: old_umask = os.umask(umask) try: if self._debug: self.log('Executing: ' + clean_args) cmd = subprocess.Popen(args, **kwargs) # the communication logic here is essentially taken from that # of the _communicate() function in ssh.py stdout = b('') stderr = b('') rpipes = [cmd.stdout, cmd.stderr] if data: if not binary_data: data += '\n' if isinstance(data, text_type): data = to_bytes(data) cmd.stdin.write(data) cmd.stdin.close() while True: rfds, wfds, efds = select.select(rpipes, [], rpipes, 1) stdout += self._read_from_pipes(rpipes, rfds, cmd.stdout) stderr += self._read_from_pipes(rpipes, rfds, cmd.stderr) # if we're checking for prompts, do it now if prompt_re: if prompt_re.search(stdout) and not data: if encoding: stdout = to_native(stdout, encoding=encoding, errors=errors) else: stdout = stdout return (257, stdout, "A prompt was encountered while running a command, but no input data was specified") # only break out if no pipes are left to read or # the pipes are completely read and # the process is terminated if (not rpipes or not rfds) and cmd.poll() is not None: break # No pipes are left to read but process is not yet terminated # Only then it is safe to wait for the process to be finished # NOTE: Actually cmd.poll() is always None here if rpipes is empty elif not rpipes and cmd.poll() is None: cmd.wait() # The process is terminated. Since no pipes to read from are # left, there is no need to call select() again. break cmd.stdout.close() cmd.stderr.close() rc = cmd.returncode except (OSError, IOError): e = get_exception() self.log("Error Executing CMD:%s Exception:%s" % (clean_args, to_native(e))) self.fail_json(rc=e.errno, msg=to_native(e), cmd=clean_args) except Exception: e = get_exception() self.log("Error Executing CMD:%s Exception:%s" % (clean_args,to_native(traceback.format_exc()))) self.fail_json(rc=257, msg=to_native(e), exception=traceback.format_exc(), cmd=clean_args) # Restore env settings for key, val in old_env_vals.items(): if val is None: del os.environ[key] else: os.environ[key] = val if old_umask: os.umask(old_umask) if rc != 0 and check_rc: msg = heuristic_log_sanitize(stderr.rstrip(), self.no_log_values) self.fail_json(cmd=clean_args, rc=rc, stdout=stdout, stderr=stderr, msg=msg) # reset the pwd os.chdir(prev_dir) if encoding is not None: return (rc, to_native(stdout, encoding=encoding, errors=errors), to_native(stderr, encoding=encoding, errors=errors)) return (rc, stdout, stderr) def append_to_file(self, filename, str): filename = os.path.expandvars(os.path.expanduser(filename)) fh = open(filename, 'a') fh.write(str) fh.close() def bytes_to_human(self, size): return bytes_to_human(size) # for backwards compatibility pretty_bytes = bytes_to_human def human_to_bytes(self, number, isbits=False): return human_to_bytes(number, isbits) # # Backwards compat # # In 2.0, moved from inside the module to the toplevel is_executable = is_executable def get_module_path(): return os.path.dirname(os.path.realpath(__file__))
prakritish/ansible
lib/ansible/module_utils/basic.py
Python
gpl-3.0
100,223
[ "VisIt" ]
0de0f3299cf14c3716687614eb1ef904475ae6fbfc63a77f4ab337c0389f6497
# $Id$ # # Copyright (C) 2004-2006 Rational Discovery LLC # # @@ All Rights Reserved @@ # This file is part of the RDKit. # The contents are covered by the terms of the BSD license # which is included in the file license.txt, found at the root # of the RDKit source tree. # from rdkit import RDConfig from rdkit import Chem import sys,csv def Convert(suppl,outFile,keyCol='',stopAfter=-1,includeChirality=0,smilesFrom=''): w = csv.writer(outFile) mol = suppl[0] propNames = list(mol.GetPropNames()) if keyCol and keyCol in propNames: propNames.remove(keyCol) outL = [] if keyCol: outL.append(keyCol) outL.append('SMILES') outL.extend(propNames) w.writerow(outL) nDone = 0 for mol in suppl: if not mol: continue if not smilesFrom or not mol.HasProp(smilesFrom): smi = Chem.MolToSmiles(mol,includeChirality) else: smi = mol.GetProp(smilesFrom) tMol = Chem.MolFromSmiles(smi) smi = Chem.MolToSmiles(tMol,includeChirality) outL = [] if keyCol: outL.append(str(mol.GetProp(keyCol))) outL.append(smi) for prop in propNames: if mol.HasProp(prop): outL.append(str(mol.GetProp(prop))) else: outL.append('') w.writerow(outL) nDone += 1 if nDone == stopAfter: break return #------------------- # Testing: import unittest class TestCase(unittest.TestCase): def setUp(self): pass def tearDown(self): pass def test1(self): import os from rdkit.six.moves import cStringIO as StringIO #@UnresolvedImport #pylint: disable=F0401 fName = os.path.join(RDConfig.RDDataDir,'NCI','first_200.props.sdf') suppl = Chem.SDMolSupplier(fName) io = StringIO() try: Convert(suppl,io) except: import traceback traceback.print_exc() self.fail('conversion failed') txt = io.getvalue() lines = txt.split('\n') if not lines[-1]: del lines[-1] self.assertTrue(len(lines)==201,'bad num lines: %d'%len(lines)) line0 = lines[0].split(',') self.assertEqual(len(line0),20) self.assertTrue(line0[0]=='SMILES') def test2(self): import os from rdkit.six.moves import cStringIO as StringIO #@UnresolvedImport #pylint: disable=F0401 fName = os.path.join(RDConfig.RDDataDir,'NCI','first_200.props.sdf') suppl = Chem.SDMolSupplier(fName) io = StringIO() try: Convert(suppl,io,keyCol='AMW',stopAfter=5) except: import traceback traceback.print_exc() self.fail('conversion failed') txt = io.getvalue() lines = txt.split('\n') if not lines[-1]: del lines[-1] self.assertTrue(len(lines)==6,'bad num lines: %d'%len(lines)) line0 = lines[0].split(',') self.assertEqual(len(line0),20) self.assertTrue(line0[0]=='AMW') self.assertTrue(line0[1]=='SMILES') #------------------- # CLI STuff: def Usage(): message = """ Usage: SDFToCSV [-k keyCol] inFile.sdf [outFile.csv] """ sys.stderr.write(message) sys.exit(-1) if __name__=='__main__': import getopt try: args,extras = getopt.getopt(sys.argv[1:],'hk:', ['test', 'chiral', 'smilesCol=', ]) except: import traceback traceback.print_exc() Usage() keyCol = '' testIt = 0 useChirality=0 smilesCol='' for arg,val in args: if arg=='-k': keyCol = val elif arg=='--chiral': useChirality=1 elif arg=='--smilesCol': smilesCol=val elif arg=='--test': testIt=1 elif arg=='-h': Usage() if not testIt and len(extras)<1: Usage() if not testIt: inFilename = extras[0] if len(extras)>1: outFilename = extras[1] outF = open(outFilename,'w+') else: outF = sys.stdout suppl = Chem.SDMolSupplier(inFilename) Convert(suppl,outF,keyCol=keyCol,includeChirality=useChirality,smilesFrom=smilesCol) else: sys.argv = [sys.argv[0]] unittest.main()
soerendip42/rdkit
rdkit/Chem/ChemUtils/SDFToCSV.py
Python
bsd-3-clause
4,077
[ "RDKit" ]
81d4a1878fddab427da4a172049cb8882fe824bbf3f7acca98b4aafe2c2192fb
from __future__ import unicode_literals import re from .common import InfoExtractor from ..compat import ( compat_str, compat_HTTPError, ) from ..utils import ( ExtractorError, find_xpath_attr, lowercase_escape, smuggle_url, unescapeHTML, ) class NBCIE(InfoExtractor): _VALID_URL = r'https?://www\.nbc\.com/(?:[^/]+/)+(?P<id>n?\d+)' _TESTS = [ { 'url': 'http://www.nbc.com/the-tonight-show/segments/112966', # md5 checksum is not stable 'info_dict': { 'id': 'c9xnCo0YPOPH', 'ext': 'flv', 'title': 'Jimmy Fallon Surprises Fans at Ben & Jerry\'s', 'description': 'Jimmy gives out free scoops of his new "Tonight Dough" ice cream flavor by surprising customers at the Ben & Jerry\'s scoop shop.', }, }, { 'url': 'http://www.nbc.com/the-tonight-show/episodes/176', 'info_dict': { 'id': 'XwU9KZkp98TH', 'ext': 'flv', 'title': 'Ricky Gervais, Steven Van Zandt, ILoveMakonnen', 'description': 'A brand new episode of The Tonight Show welcomes Ricky Gervais, Steven Van Zandt and ILoveMakonnen.', }, 'skip': 'Only works from US', }, { 'url': 'http://www.nbc.com/saturday-night-live/video/star-wars-teaser/2832821', 'info_dict': { 'id': '8iUuyzWDdYUZ', 'ext': 'flv', 'title': 'Star Wars Teaser', 'description': 'md5:0b40f9cbde5b671a7ff62fceccc4f442', }, 'skip': 'Only works from US', }, { # This video has expired but with an escaped embedURL 'url': 'http://www.nbc.com/parenthood/episode-guide/season-5/just-like-at-home/515', 'skip': 'Expired' } ] def _real_extract(self, url): video_id = self._match_id(url) webpage = self._download_webpage(url, video_id) theplatform_url = unescapeHTML(lowercase_escape(self._html_search_regex( [ r'(?:class="video-player video-player-full" data-mpx-url|class="player" src)="(.*?)"', r'<iframe[^>]+src="((?:https?:)?//player\.theplatform\.com/[^"]+)"', r'"embedURL"\s*:\s*"([^"]+)"' ], webpage, 'theplatform url').replace('_no_endcard', '').replace('\\/', '/'))) if theplatform_url.startswith('//'): theplatform_url = 'http:' + theplatform_url return self.url_result(smuggle_url(theplatform_url, {'source_url': url})) class NBCSportsVPlayerIE(InfoExtractor): _VALID_URL = r'https?://vplayer\.nbcsports\.com/(?:[^/]+/)+(?P<id>[0-9a-zA-Z_]+)' _TESTS = [{ 'url': 'https://vplayer.nbcsports.com/p/BxmELC/nbcsports_share/select/9CsDKds0kvHI', 'info_dict': { 'id': '9CsDKds0kvHI', 'ext': 'flv', 'description': 'md5:df390f70a9ba7c95ff1daace988f0d8d', 'title': 'Tyler Kalinoski hits buzzer-beater to lift Davidson', } }, { 'url': 'http://vplayer.nbcsports.com/p/BxmELC/nbc_embedshare/select/_hqLjQ95yx8Z', 'only_matching': True, }] @staticmethod def _extract_url(webpage): iframe_m = re.search( r'<iframe[^>]+src="(?P<url>https?://vplayer\.nbcsports\.com/[^"]+)"', webpage) if iframe_m: return iframe_m.group('url') def _real_extract(self, url): video_id = self._match_id(url) webpage = self._download_webpage(url, video_id) theplatform_url = self._og_search_video_url(webpage) return self.url_result(theplatform_url, 'ThePlatform') class NBCSportsIE(InfoExtractor): # Does not include https becuase its certificate is invalid _VALID_URL = r'http://www\.nbcsports\.com//?(?:[^/]+/)+(?P<id>[0-9a-z-]+)' _TEST = { 'url': 'http://www.nbcsports.com//college-basketball/ncaab/tom-izzo-michigan-st-has-so-much-respect-duke', 'info_dict': { 'id': 'PHJSaFWbrTY9', 'ext': 'flv', 'title': 'Tom Izzo, Michigan St. has \'so much respect\' for Duke', 'description': 'md5:ecb459c9d59e0766ac9c7d5d0eda8113', } } def _real_extract(self, url): video_id = self._match_id(url) webpage = self._download_webpage(url, video_id) return self.url_result( NBCSportsVPlayerIE._extract_url(webpage), 'NBCSportsVPlayer') class NBCNewsIE(InfoExtractor): _VALID_URL = r'''(?x)https?://(?:www\.)?nbcnews\.com/ (?:video/.+?/(?P<id>\d+)| (?:watch|feature|nightly-news)/[^/]+/(?P<title>.+)) ''' _TESTS = [ { 'url': 'http://www.nbcnews.com/video/nbc-news/52753292', 'md5': '47abaac93c6eaf9ad37ee6c4463a5179', 'info_dict': { 'id': '52753292', 'ext': 'flv', 'title': 'Crew emerges after four-month Mars food study', 'description': 'md5:24e632ffac72b35f8b67a12d1b6ddfc1', }, }, { 'url': 'http://www.nbcnews.com/feature/edward-snowden-interview/how-twitter-reacted-snowden-interview-n117236', 'md5': 'b2421750c9f260783721d898f4c42063', 'info_dict': { 'id': 'I1wpAI_zmhsQ', 'ext': 'mp4', 'title': 'How Twitter Reacted To The Snowden Interview', 'description': 'md5:65a0bd5d76fe114f3c2727aa3a81fe64', }, 'add_ie': ['ThePlatform'], }, { 'url': 'http://www.nbcnews.com/feature/dateline-full-episodes/full-episode-family-business-n285156', 'md5': 'fdbf39ab73a72df5896b6234ff98518a', 'info_dict': { 'id': 'Wjf9EDR3A_60', 'ext': 'mp4', 'title': 'FULL EPISODE: Family Business', 'description': 'md5:757988edbaae9d7be1d585eb5d55cc04', }, }, { 'url': 'http://www.nbcnews.com/nightly-news/video/nightly-news-with-brian-williams-full-broadcast-february-4-394064451844', 'md5': 'b5dda8cddd8650baa0dcb616dd2cf60d', 'info_dict': { 'id': 'sekXqyTVnmN3', 'ext': 'mp4', 'title': 'Nightly News with Brian Williams Full Broadcast (February 4)', 'description': 'md5:1c10c1eccbe84a26e5debb4381e2d3c5', }, }, { 'url': 'http://www.nbcnews.com/watch/dateline/full-episode--deadly-betrayal-386250819952', 'only_matching': True, }, ] def _real_extract(self, url): mobj = re.match(self._VALID_URL, url) video_id = mobj.group('id') if video_id is not None: all_info = self._download_xml('http://www.nbcnews.com/id/%s/displaymode/1219' % video_id, video_id) info = all_info.find('video') return { 'id': video_id, 'title': info.find('headline').text, 'ext': 'flv', 'url': find_xpath_attr(info, 'media', 'type', 'flashVideo').text, 'description': compat_str(info.find('caption').text), 'thumbnail': find_xpath_attr(info, 'media', 'type', 'thumbnail').text, } else: # "feature" and "nightly-news" pages use theplatform.com title = mobj.group('title') webpage = self._download_webpage(url, title) bootstrap_json = self._search_regex( r'var\s+(?:bootstrapJson|playlistData)\s*=\s*({.+});?\s*$', webpage, 'bootstrap json', flags=re.MULTILINE) bootstrap = self._parse_json(bootstrap_json, video_id) info = bootstrap['results'][0]['video'] mpxid = info['mpxId'] base_urls = [ info['fallbackPlaylistUrl'], info['associatedPlaylistUrl'], ] for base_url in base_urls: if not base_url: continue playlist_url = base_url + '?form=MPXNBCNewsAPI' try: all_videos = self._download_json(playlist_url, title) except ExtractorError as ee: if isinstance(ee.cause, compat_HTTPError): continue raise if not all_videos or 'videos' not in all_videos: continue try: info = next(v for v in all_videos['videos'] if v['mpxId'] == mpxid) break except StopIteration: continue if info is None: raise ExtractorError('Could not find video in playlists') return { '_type': 'url', # We get the best quality video 'url': info['videoAssets'][-1]['publicUrl'], 'ie_key': 'ThePlatform', } class MSNBCIE(InfoExtractor): # https URLs redirect to corresponding http ones _VALID_URL = r'http://www\.msnbc\.com/[^/]+/watch/(?P<id>[^/]+)' _TEST = { 'url': 'http://www.msnbc.com/all-in-with-chris-hayes/watch/the-chaotic-gop-immigration-vote-314487875924', 'md5': '6d236bf4f3dddc226633ce6e2c3f814d', 'info_dict': { 'id': 'n_hayes_Aimm_140801_272214', 'ext': 'mp4', 'title': 'The chaotic GOP immigration vote', 'description': 'The Republican House votes on a border bill that has no chance of getting through the Senate or signed by the President and is drawing criticism from all sides.', 'thumbnail': 're:^https?://.*\.jpg$', 'timestamp': 1406937606, 'upload_date': '20140802', 'categories': ['MSNBC/Topics/Franchise/Best of last night', 'MSNBC/Topics/General/Congress'], }, } def _real_extract(self, url): video_id = self._match_id(url) webpage = self._download_webpage(url, video_id) embed_url = self._html_search_meta('embedURL', webpage) return self.url_result(embed_url)
Oteng/youtube-dl
youtube_dl/extractor/nbc.py
Python
unlicense
10,298
[ "Brian" ]
7209fad7effb1883c09d95e6dd8f6054a7fd346d8470349d69094544d13d53b4
#!/usr/bin/env python3 # -*- coding: utf-8 -*- # eclipses.py # Waqas Bhatti and Luke Bouma - Feb 2017 # (wbhatti@astro.princeton.edu and luke@astro.princeton.edu) '''Light curve fitting routines for eclipsing binaries: - :py:func:`astrobase.lcfit.eclipses.gaussianeb_fit_magseries`: fit a double inverted gaussian eclipsing binary model to the magnitude/flux time series ''' ############# ## LOGGING ## ############# import logging from astrobase import log_sub, log_fmt, log_date_fmt DEBUG = False if DEBUG: level = logging.DEBUG else: level = logging.INFO LOGGER = logging.getLogger(__name__) logging.basicConfig( level=level, style=log_sub, format=log_fmt, datefmt=log_date_fmt, ) LOGDEBUG = LOGGER.debug LOGINFO = LOGGER.info LOGWARNING = LOGGER.warning LOGERROR = LOGGER.error LOGEXCEPTION = LOGGER.exception ############# ## IMPORTS ## ############# from functools import partial from numpy import ( nan as npnan, sum as npsum, sqrt as npsqrt, nonzero as npnonzero, diag as npdiag, median as npmedian, inf as npinf, array as nparray ) from scipy.optimize import curve_fit from ..lcmath import sigclip_magseries from ..lcmodels import eclipses from .utils import make_fit_plot from .nonphysical import spline_fit_magseries, savgol_fit_magseries ############################################ ## DOUBLE INVERTED GAUSSIAN ECLIPSE MODEL ## ############################################ def gaussianeb_fit_magseries( times, mags, errs, ebparams, param_bounds=None, scale_errs_redchisq_unity=True, sigclip=10.0, plotfit=False, magsarefluxes=False, verbose=True, curve_fit_kwargs=None, ): '''This fits a double inverted gaussian EB model to a magnitude time series. Parameters ---------- times,mags,errs : np.array The input mag/flux time-series to fit the EB model to. period : float The period to use for EB fit. ebparams : list of float This is a list containing the eclipsing binary parameters:: ebparams = [period (time), epoch (time), pdepth (mags), pduration (phase), psdepthratio, secondaryphase] `period` is the period in days. `epoch` is the time of primary minimum in JD. `pdepth` is the depth of the primary eclipse: - for magnitudes -> `pdepth` should be < 0 - for fluxes -> `pdepth` should be > 0 `pduration` is the length of the primary eclipse in phase. `psdepthratio` is the ratio of the secondary eclipse depth to that of the primary eclipse. `secondaryphase` is the phase at which the minimum of the secondary eclipse is located. This effectively parameterizes eccentricity. If `epoch` is None, this function will do an initial spline fit to find an approximate minimum of the phased light curve using the given period. The `pdepth` provided is checked against the value of `magsarefluxes`. if `magsarefluxes = True`, the `ebdepth` is forced to be > 0; if `magsarefluxes = False`, the `ebdepth` is forced to be < 0. param_bounds : dict or None This is a dict of the upper and lower bounds on each fit parameter. Should be of the form:: {'period': (lower_bound_period, upper_bound_period), 'epoch': (lower_bound_epoch, upper_bound_epoch), 'pdepth': (lower_bound_pdepth, upper_bound_pdepth), 'pduration': (lower_bound_pduration, upper_bound_pduration), 'psdepthratio': (lower_bound_psdepthratio, upper_bound_psdepthratio), 'secondaryphase': (lower_bound_secondaryphase, upper_bound_secondaryphase)} - To indicate that a parameter is fixed, use 'fixed' instead of a tuple providing its lower and upper bounds as tuple. - To indicate that a parameter has no bounds, don't include it in the param_bounds dict. If this is None, the default value of this kwarg will be:: {'period':(0.0,np.inf), # period is between 0 and inf 'epoch':(0.0, np.inf), # epoch is between 0 and inf 'pdepth':(-np.inf,np.inf), # pdepth is between -np.inf and np.inf 'pduration':(0.0,1.0), # pduration is between 0.0 and 1.0 'psdepthratio':(0.0,1.0), # psdepthratio is between 0.0 and 1.0 'secondaryphase':(0.0,1.0), # secondaryphase is between 0.0 and 1.0 scale_errs_redchisq_unity : bool If True, the standard errors on the fit parameters will be scaled to make the reduced chi-sq = 1.0. This sets the ``absolute_sigma`` kwarg for the ``scipy.optimize.curve_fit`` function to False. sigclip : float or int or sequence of two floats/ints or None If a single float or int, a symmetric sigma-clip will be performed using the number provided as the sigma-multiplier to cut out from the input time-series. If a list of two ints/floats is provided, the function will perform an 'asymmetric' sigma-clip. The first element in this list is the sigma value to use for fainter flux/mag values; the second element in this list is the sigma value to use for brighter flux/mag values. For example, `sigclip=[10., 3.]`, will sigclip out greater than 10-sigma dimmings and greater than 3-sigma brightenings. Here the meaning of "dimming" and "brightening" is set by *physics* (not the magnitude system), which is why the `magsarefluxes` kwarg must be correctly set. If `sigclip` is None, no sigma-clipping will be performed, and the time-series (with non-finite elems removed) will be passed through to the output. magsarefluxes : bool If True, will treat the input values of `mags` as fluxes for purposes of plotting the fit and sig-clipping. plotfit : str or False If this is a string, this function will make a plot for the fit to the mag/flux time-series and writes the plot to the path specified here. ignoreinitfail : bool If this is True, ignores the initial failure to find a set of optimized Fourier parameters using the global optimization function and proceeds to do a least-squares fit anyway. verbose : bool If True, will indicate progress and warn of any problems. curve_fit_kwargs : dict or None If not None, this should be a dict containing extra kwargs to pass to the scipy.optimize.curve_fit function. Returns ------- dict This function returns a dict containing the model fit parameters, the minimized chi-sq value and the reduced chi-sq value. The form of this dict is mostly standardized across all functions in this module:: { 'fittype':'gaussianeb', 'fitinfo':{ 'initialparams':the initial EB params provided, 'finalparams':the final model fit EB params, 'finalparamerrs':formal errors in the params, 'fitmags': the model fit mags, 'fitepoch': the epoch of minimum light for the fit, }, 'fitchisq': the minimized value of the fit's chi-sq, 'fitredchisq':the reduced chi-sq value, 'fitplotfile': the output fit plot if fitplot is not None, 'magseries':{ 'times':input times in phase order of the model, 'phase':the phases of the model mags, 'mags':input mags/fluxes in the phase order of the model, 'errs':errs in the phase order of the model, 'magsarefluxes':input value of magsarefluxes kwarg } } ''' stimes, smags, serrs = sigclip_magseries(times, mags, errs, sigclip=sigclip, magsarefluxes=magsarefluxes) # get rid of zero errs nzind = npnonzero(serrs) stimes, smags, serrs = stimes[nzind], smags[nzind], serrs[nzind] # check the ebparams ebperiod, ebepoch, ebdepth = ebparams[0:3] # check if we have a ebepoch to use if ebepoch is None: if verbose: LOGWARNING('no ebepoch given in ebparams, ' 'trying to figure it out automatically...') # do a spline fit to figure out the approximate min of the LC try: spfit = spline_fit_magseries(times, mags, errs, ebperiod, sigclip=sigclip, magsarefluxes=magsarefluxes, verbose=verbose) ebepoch = spfit['fitinfo']['fitepoch'] # if the spline-fit fails, try a savgol fit instead except Exception: sgfit = savgol_fit_magseries(times, mags, errs, ebperiod, sigclip=sigclip, magsarefluxes=magsarefluxes, verbose=verbose) ebepoch = sgfit['fitinfo']['fitepoch'] # if everything failed, then bail out and ask for the ebepoch finally: if ebepoch is None: LOGERROR("couldn't automatically figure out the eb epoch, " "can't continue. please provide it in ebparams.") # assemble the returndict returndict = { 'fittype':'gaussianeb', 'fitinfo':{ 'initialparams':ebparams, 'finalparams':None, 'finalparamerrs':None, 'fitmags':None, 'fitepoch':None, }, 'fitchisq':npnan, 'fitredchisq':npnan, 'fitplotfile':None, 'magseries':{ 'phase':None, 'times':None, 'mags':None, 'errs':None, 'magsarefluxes':magsarefluxes, }, } return returndict else: if ebepoch.size > 1: if verbose: LOGWARNING('could not auto-find a single minimum ' 'for ebepoch, using the first one returned') ebparams[1] = ebepoch[0] else: if verbose: LOGWARNING( 'using automatically determined ebepoch = %.5f' % ebepoch ) ebparams[1] = ebepoch.item() # next, check the ebdepth and fix it to the form required if magsarefluxes: if ebdepth < 0.0: ebparams[2] = -ebdepth[2] else: if ebdepth > 0.0: ebparams[2] = -ebdepth[2] # finally, do the fit try: # set up the fit parameter bounds if param_bounds is None: curvefit_bounds = ( nparray([0.0, 0.0, -npinf, 0.0, 0.0, 0.0]), nparray([npinf, npinf, npinf, 1.0, 1.0, 1.0]) ) fitfunc_fixed = {} else: # figure out the bounds lower_bounds = [] upper_bounds = [] fitfunc_fixed = {} for ind, key in enumerate(('period', 'epoch', 'pdepth', 'pduration', 'psdepthratio', 'secondaryphase')): # handle fixed parameters if (key in param_bounds and isinstance(param_bounds[key], str) and param_bounds[key] == 'fixed'): lower_bounds.append(ebparams[ind]-1.0e-7) upper_bounds.append(ebparams[ind]+1.0e-7) fitfunc_fixed[key] = ebparams[ind] # handle parameters with lower and upper bounds elif key in param_bounds and isinstance(param_bounds[key], (tuple,list)): lower_bounds.append(param_bounds[key][0]) upper_bounds.append(param_bounds[key][1]) # handle no parameter bounds else: lower_bounds.append(-npinf) upper_bounds.append(npinf) # generate the bounds sequence in the required format curvefit_bounds = ( nparray(lower_bounds), nparray(upper_bounds) ) # # set up the curve fit function # curvefit_func = partial(eclipses.invgauss_eclipses_curvefit_func, zerolevel=npmedian(smags), fixed_params=fitfunc_fixed) # # run the fit # if curve_fit_kwargs is not None: finalparams, covmatrix = curve_fit( curvefit_func, stimes, smags, p0=ebparams, sigma=serrs, bounds=curvefit_bounds, absolute_sigma=(not scale_errs_redchisq_unity), **curve_fit_kwargs ) else: finalparams, covmatrix = curve_fit( curvefit_func, stimes, smags, p0=ebparams, sigma=serrs, bounds=curvefit_bounds, absolute_sigma=(not scale_errs_redchisq_unity), ) except Exception: LOGEXCEPTION("curve_fit returned an exception") finalparams, covmatrix = None, None # if the fit succeeded, then we can return the final parameters if finalparams is not None and covmatrix is not None: # calculate the chisq and reduced chisq fitmags, phase, ptimes, pmags, perrs = eclipses.invgauss_eclipses_func( finalparams, stimes, smags, serrs ) fitchisq = npsum( ((fitmags - pmags)*(fitmags - pmags)) / (perrs*perrs) ) fitredchisq = fitchisq/(len(pmags) - len(finalparams) - len(fitfunc_fixed)) stderrs = npsqrt(npdiag(covmatrix)) if verbose: LOGINFO( 'final fit done. chisq = %.5f, reduced chisq = %.5f' % (fitchisq, fitredchisq) ) # get the fit epoch fperiod, fepoch = finalparams[:2] # assemble the returndict returndict = { 'fittype':'gaussianeb', 'fitinfo':{ 'initialparams':ebparams, 'finalparams':finalparams, 'finalparamerrs':stderrs, 'fitmags':fitmags, 'fitepoch':fepoch, }, 'fitchisq':fitchisq, 'fitredchisq':fitredchisq, 'fitplotfile':None, 'magseries':{ 'phase':phase, 'times':ptimes, 'mags':pmags, 'errs':perrs, 'magsarefluxes':magsarefluxes, }, } # make the fit plot if required if plotfit and isinstance(plotfit, str): make_fit_plot(phase, pmags, perrs, fitmags, fperiod, ptimes.min(), fepoch, plotfit, magsarefluxes=magsarefluxes) returndict['fitplotfile'] = plotfit return returndict # if the leastsq fit failed, return nothing else: LOGERROR('eb-fit: least-squared fit to the light curve failed!') # assemble the returndict returndict = { 'fittype':'gaussianeb', 'fitinfo':{ 'initialparams':ebparams, 'finalparams':None, 'finalparamerrs':None, 'fitmags':None, 'fitepoch':None, }, 'fitchisq':npnan, 'fitredchisq':npnan, 'fitplotfile':None, 'magseries':{ 'phase':None, 'times':None, 'mags':None, 'errs':None, 'magsarefluxes':magsarefluxes, }, } return returndict
lgbouma/astrobase
astrobase/lcfit/eclipses.py
Python
mit
17,004
[ "Gaussian" ]
7024c2d3f344a090e1fae27374830924347b228be6d376f8601d9841e700b08a
#!/usr/bin/env python #JSON {"lot": "RKS/6-31G(d)", #JSON "scf": "CDIISSCFSolver", #JSON "er": "cholesky", #JSON "difficulty": 7, #JSON "description": "Basic RKS DFT example with hybrid MGGA exhange-correlation functional (TPSS)"} import numpy as np from horton import * # pylint: disable=wildcard-import,unused-wildcard-import # Load the coordinates from file. # Use the XYZ file from HORTON's test data directory. fn_xyz = context.get_fn('test/water.xyz') mol = IOData.from_file(fn_xyz) # Create a Gaussian basis set obasis = get_gobasis(mol.coordinates, mol.numbers, '6-31g(d)') # Compute Gaussian integrals olp = obasis.compute_overlap() kin = obasis.compute_kinetic() na = obasis.compute_nuclear_attraction(mol.coordinates, mol.pseudo_numbers) er_vecs = obasis.compute_electron_repulsion_cholesky() # Define a numerical integration grid needed the XC functionals grid = BeckeMolGrid(mol.coordinates, mol.numbers, mol.pseudo_numbers) # Create alpha orbitals orb_alpha = Orbitals(obasis.nbasis) # Initial guess guess_core_hamiltonian(olp, kin + na, orb_alpha) # Construct the restricted HF effective Hamiltonian external = {'nn': compute_nucnuc(mol.coordinates, mol.pseudo_numbers)} libxc_term_x = RLibXCHybridMGGA('x_m05') libxc_term_c = RLibXCMGGA('c_m05') terms = [ RTwoIndexTerm(kin, 'kin'), RDirectTerm(er_vecs, 'hartree'), RGridGroup(obasis, grid, [libxc_term_x, libxc_term_c]), RExchangeTerm(er_vecs, 'x_hf', libxc_term_x.get_exx_fraction()), RTwoIndexTerm(na, 'ne'), ] ham = REffHam(terms, external) # Decide how to occupy the orbitals (5 alpha electrons) occ_model = AufbauOccModel(5) # Converge WFN with CDIIS SCF # - Construct the initial density matrix (needed for CDIIS). occ_model.assign(orb_alpha) dm_alpha = orb_alpha.to_dm() # - SCF solver scf_solver = CDIISSCFSolver(1e-6) scf_solver(ham, olp, occ_model, dm_alpha) # Derive orbitals (coeffs, energies and occupations) from the Fock and density # matrices. The energy is also computed to store it in the output file below. fock_alpha = np.zeros(olp.shape) ham.reset(dm_alpha) ham.compute_energy() ham.compute_fock(fock_alpha) orb_alpha.from_fock_and_dm(fock_alpha, dm_alpha, olp) # Assign results to the molecule object and write it to a file, e.g. for # later analysis. Note that the CDIIS algorithm can only really construct an # optimized density matrix and no orbitals. mol.title = 'RKS computation on water' mol.energy = ham.cache['energy'] mol.obasis = obasis mol.orb_alpha = orb_alpha mol.dm_alpha = dm_alpha # useful for post-processing (results stored in double precision): mol.to_file('water.h5') # CODE BELOW IS FOR horton-regression-test.py ONLY. IT IS NOT PART OF THE EXAMPLE. rt_results = { 'energy': ham.cache['energy'], 'orb_alpha': orb_alpha.energies, 'nn': ham.cache["energy_nn"], 'kin': ham.cache["energy_kin"], 'ne': ham.cache["energy_ne"], 'grid': ham.cache["energy_grid_group"], 'hartree': ham.cache["energy_hartree"], 'x_hf': ham.cache["energy_x_hf"], } # BEGIN AUTOGENERATED CODE. DO NOT CHANGE MANUALLY. rt_previous = { 'energy': -76.372223106410885, 'orb_alpha': np.array([ -19.174675917533499, -1.0216889289766689, -0.54324149010045464, -0.37631403914157158, -0.30196183487620326, 0.079896573985756419, 0.16296304612701332, 0.81419059490960388, 0.86377461055569127, 0.9243929453024935, 0.95050094195149326, 1.1033737076332981, 1.4108569929549999, 1.7561523962868733, 1.761532111350379, 1.8055689722633752, 2.3348442517458823, 2.6275437456471868 ]), 'grid': -6.821114560989138, 'hartree': 46.93245844915478, 'kin': 76.05549816546615, 'ne': -199.18635862588496, 'nn': 9.1571750364299866, 'x_hf': -2.50988157058769, }
theochem/horton
data/examples/hf_dft/rks_water_hybmgga.py
Python
gpl-3.0
3,761
[ "Gaussian" ]
9adba042d7e460c70dd63bde21d0c0b492eb5c923cd71d174b61f64da268cc17
#!/usr/bin/env python from setuptools import setup, find_packages version = '0.1dev' print '''------------------------------ Installing RNAseq version {} ------------------------------ '''.format(version) setup( name='rnaseq', version=version, author='lx Gui', author_email='guilixuan@gmail.com', keywords=['bioinformatics', 'NGS', 'RNAseq'], license='GPLv3', packages=find_packages(), include_package_data=True, scripts=['scripts/mrna', 'scripts/simple_qc', 'scripts/_qc_wrapper', 'scripts/get_fq_cfg', 'scripts/merge_files', 'scripts/fake_qc'], install_requires=[ 'luigi', 'pyyaml', 'envoy', 'xlsxwriter', 'pandas', 'rpy2<=2.8.6', 'packaging', 'docopt', 'HTSeq', 'click', 'Pillow', 'biopython', 'pathlib'], ) print '''------------------------------ RNAseq installation complete! ------------------------------ '''
bioShaun/OMrnaseq
setup.py
Python
gpl-3.0
1,031
[ "Biopython", "HTSeq" ]
3106d783ef72895961475ed9447b36edc48971bb3cdc7332b775936b8c5562ee
# Copyright (C) 2012,2013 # Max Planck Institute for Polymer Research # Copyright (C) 2008,2009,2010,2011 # Max-Planck-Institute for Polymer Research & Fraunhofer SCAI # # This file is part of ESPResSo++. # # ESPResSo++ is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # ESPResSo++ is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. r""" ****************************************** espressopp.interaction.LennardJonesGromacs ****************************************** if :math:`d^2 > r_1^2` .. math:: U = 4 \varepsilon (\frac{sigma^{12}}{d^{12}} - \frac{sigma^6}{d^6}) + (d-r_1)^3 (ljsw3 + ljsw4 (d-r_1) + ljsw5) else .. math:: U = 4 \varepsilon (\frac{\sigma^{12}}{d^{12}} - \frac{\sigma^6}{d^6}) .. function:: espressopp.interaction.LennardJonesGromacs(epsilon, sigma, r1, cutoff, shift) :param epsilon: (default: 1.0) :param sigma: (default: 1.0) :param r1: (default: 0.0) :param cutoff: (default: infinity) :param shift: (default: "auto") :type epsilon: real :type sigma: real :type r1: real :type cutoff: :type shift: .. function:: espressopp.interaction.VerletListLennardJonesGromacs(vl) :param vl: :type vl: .. function:: espressopp.interaction.VerletListLennardJonesGromacs.getPotential(type1, type2) :param type1: :param type2: :type type1: :type type2: :rtype: .. function:: espressopp.interaction.VerletListLennardJonesGromacs.setPotential(type1, type2, potential) :param type1: :param type2: :param potential: :type type1: :type type2: :type potential: .. function:: espressopp.interaction.CellListLennardJonesGromacs(stor) :param stor: :type stor: .. function:: espressopp.interaction.CellListLennardJonesGromacs.setPotential(type1, type2, potential) :param type1: :param type2: :param potential: :type type1: :type type2: :type potential: .. function:: espressopp.interaction.FixedPairListLennardJonesGromacs(system, vl, potential) :param system: :param vl: :param potential: :type system: :type vl: :type potential: .. function:: espressopp.interaction.FixedPairListLennardJonesGromacs.setPotential(potential) :param potential: :type potential: """ """ real sig2 = sigma * sigma; real sig6 = sig2 * sig2 * sig2; ff1 = 48 \varepsilon \sigma^{12} ff2 = 24 \varepsilon \sigma^6 ef1 = 4 \varepsilon \sigma^{12} ef2 = 4 \varepsilon \sigma^6 r1sq = r_^2 real t = r_c - r_1 real r6inv = \frac{1}{r_c^6} real r8inv = \frac{1}{r_c^8} real t2inv = \frac{1}{(r_c - r_1)^2} real t3inv = \frac{1}{(r_c - r_1)^3} real t3 = (r_c - r_1)^3 real a6 = \frac{7 r_1 - 10 r_c}{(r_c - r_1)^2 r_c^8} real b6 = \frac{9 r_c - 7 r_1}{(r_c - r_1)^3 r_c^8}; real a12 = \frac{13 r_1 - 16 r_c}{(r_c - r_1)^2 r_c^{14}} real b12 = \frac{15 r_c - 13 r_1}{(r_c - r_1)^3 r_c^{14}} real c6 = \frac{1}{r_c^6} - (r_c - r_1)^3(\frac{42 r_1 - 60 r_c}{3(r_c - r_1)^2 r_c^8} + \frac{(54 r_c - 42 r_1)(r_c - r_1)}{4(r_c - r_1)^3 r_c^8}); real c12 = \frac{1}{r_c^{12}} - (r_c - r_1)^3(\frac{156 r_1 - 192 r_c}{3(r_c - r_1)^2 r_c^{14}} + \frac{(180 r_c - 156 r_1)(r_c - r_1}{4(r_c - r_1)^3 r_c^{14}}); ljsw3 = -4 \varepsilon \sigma^{12} (\frac{156 r_1 - 192 r_c}{3(r_c - r_1)^2 r_c^{14}}) + 4 \varepsilon \sigma^6 \frac{42 r_1 - 60 r_c}{3(r_c - r_1)^2 r_c^8} ljsw4 = -4 \varepsilon \sigma^{12} (\frac{180 r_c - 156 r_1}{4(r_c - r_1)^3 r_c^{14}}) + 4 \varepsilon \sigma^6 \frac{54 r_c - 42 r_1}{4(r_c - r_1)^3 r_c^8} ljsw5 = -4 \varepsilon \sigma^{12} (\frac{1}{r_c^{12}} - (r_c - r_1)^3(\frac{156 r_1 - 192 r_c}{3(r_c - r_1)^2 r_c^{14}} + \frac{(180 r_c - 156 r_1)(r_c - r_1}{4(r_c - r_1)^3 r_c^{14}})) + 4 \varepsilon \sigma^6 \frac{1}{r_c^6} - (r_c - r_1)^3(\frac{42 r_1 - 60 r_c}{3(r_c - r_1)^2 r_c^8} + \frac{(54 r_c - 42 r_1)(r_c - r_1)}{4(r_c - r_1)^3 r_c^8}) U = 4 \varepsilon (\frac{\sigma^{12}}{d^{12}} - \frac{\sigma^6}{d^6}) + (d-r_1)^3 ((((-4 \varepsilon \sigma^{12} (\frac{156 r_1 - 192 r_c}{3(r_c - r_1)^2 r_c^{14}}) + 4 \varepsilon \sigma^6 \frac{42 r_1 - 60 r_c}{3(r_c - r_1)^2 r_c^8} ) + (-4 \varepsilon \sigma^{12} (\frac{180 r_c - 156 r_1}{4(r_c - r_1)^3 r_c^{14}}) + 4 \varepsilon \sigma^6 \frac{54 r_c - 42 r_1}{4(r_c - r_1)^3 r_c^8} ) (d-r_1) + (-4 \varepsilon \sigma^{12} (\frac{1}{r_c^{12}} - (r_c - r_1)^3(\frac{156 r_1 - 192 r_c}{3(r_c - r_1)^2 r_c^{14}} + \frac{(180 r_c - 156 r_1)(r_c - r_1}{4(r_c - r_1)^3 r_c^{14}}))) + 4 \varepsilon \sigma^6 \frac{1}{r_c^6} - (r_c - r_1)^3(\frac{42 r_1 - 60 r_c}{3(r_c - r_1)^2 r_c^8} + \frac{(54 r_c - 42 r_1)(r_c - r_1)}{4(r_c - r_1)^3 r_c^8}) ))) """ from espressopp import pmi, infinity from espressopp.esutil import * from espressopp.interaction.Potential import * from espressopp.interaction.Interaction import * from _espressopp import interaction_LennardJonesGromacs, \ interaction_VerletListLennardJonesGromacs, \ interaction_CellListLennardJonesGromacs, \ interaction_FixedPairListLennardJonesGromacs class LennardJonesGromacsLocal(PotentialLocal, interaction_LennardJonesGromacs): def __init__(self, epsilon=1.0, sigma=1.0, r1=0.0, cutoff=infinity, shift="auto"): """Initialize the local LennardJonesGromacs object.""" if not (pmi._PMIComm and pmi._PMIComm.isActive()) or pmi._MPIcomm.rank in pmi._PMIComm.getMPIcpugroup(): if shift =="auto": cxxinit(self, interaction_LennardJonesGromacs, epsilon, sigma, r1, cutoff) else: cxxinit(self, interaction_LennardJonesGromacs, epsilon, sigma, r1, cutoff, shift) class VerletListLennardJonesGromacsLocal(InteractionLocal, interaction_VerletListLennardJonesGromacs): def __init__(self, vl): if not (pmi._PMIComm and pmi._PMIComm.isActive()) or pmi._MPIcomm.rank in pmi._PMIComm.getMPIcpugroup(): cxxinit(self, interaction_VerletListLennardJonesGromacs, vl) def setPotential(self, type1, type2, potential): if not (pmi._PMIComm and pmi._PMIComm.isActive()) or pmi._MPIcomm.rank in pmi._PMIComm.getMPIcpugroup(): self.cxxclass.setPotential(self, type1, type2, potential) def getPotential(self, type1, type2): if not (pmi._PMIComm and pmi._PMIComm.isActive()) or pmi._MPIcomm.rank in pmi._PMIComm.getMPIcpugroup(): return self.cxxclass.getPotential(self, type1, type2) class CellListLennardJonesGromacsLocal(InteractionLocal, interaction_CellListLennardJonesGromacs): def __init__(self, stor): if not (pmi._PMIComm and pmi._PMIComm.isActive()) or pmi._MPIcomm.rank in pmi._PMIComm.getMPIcpugroup(): cxxinit(self, interaction_CellListLennardJonesGromacs, stor) def setPotential(self, type1, type2, potential): if not (pmi._PMIComm and pmi._PMIComm.isActive()) or pmi._MPIcomm.rank in pmi._PMIComm.getMPIcpugroup(): self.cxxclass.setPotential(self, type1, type2, potential) class FixedPairListLennardJonesGromacsLocal(InteractionLocal, interaction_FixedPairListLennardJonesGromacs): def __init__(self, system, vl, potential): if not (pmi._PMIComm and pmi._PMIComm.isActive()) or pmi._MPIcomm.rank in pmi._PMIComm.getMPIcpugroup(): cxxinit(self, interaction_FixedPairListLennardJonesGromacs, system, vl, potential) def setPotential(self, potential): if not (pmi._PMIComm and pmi._PMIComm.isActive()) or pmi._MPIcomm.rank in pmi._PMIComm.getMPIcpugroup(): self.cxxclass.setPotential(self, potential) if pmi.isController: class LennardJonesGromacs(Potential): 'The LennardJonesGromacs potential.' pmiproxydefs = dict( cls = 'espressopp.interaction.LennardJonesGromacsLocal', pmiproperty = ['epsilon', 'sigma', 'r1'] ) class VerletListLennardJonesGromacs(Interaction): __metaclass__ = pmi.Proxy pmiproxydefs = dict( cls = 'espressopp.interaction.VerletListLennardJonesGromacsLocal', pmicall = ['setPotential','getPotential'] ) class CellListLennardJonesGromacs(Interaction): __metaclass__ = pmi.Proxy pmiproxydefs = dict( cls = 'espressopp.interaction.CellListLennardJonesGromacsLocal', pmicall = ['setPotential'] ) class FixedPairListLennardJonesGromacs(Interaction): __metaclass__ = pmi.Proxy pmiproxydefs = dict( cls = 'espressopp.interaction.FixedPairListLennardJonesGromacsLocal', pmicall = ['setPotential'] )
kkreis/espressopp
src/interaction/LennardJonesGromacs.py
Python
gpl-3.0
9,198
[ "ESPResSo" ]
eff898a3d95c8386971a9608c87b24188c95ddc4f98b6b55136f8a584145110b
# Copyright 2014-2018 The PySCF Developers. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from functools import reduce import numpy def rotmatz(ang): c = numpy.cos(ang) s = numpy.sin(ang) return numpy.array((( c, s, 0), (-s, c, 0), ( 0, 0, 1),)) def rotmaty(ang): c = numpy.cos(ang) s = numpy.sin(ang) return numpy.array((( c, 0, s), ( 0, 1, 0), (-s, 0, c),)) def r2edge(ang, r): return 2*r*numpy.sin(ang/2) def make60(b5, b6): theta1 = numpy.arccos(1/numpy.sqrt(5)) theta2 = (numpy.pi - theta1) * .5 r = (b5*2+b6)/2/numpy.sin(theta1/2) rot72 = rotmatz(numpy.pi*2/5) s1 = numpy.sin(theta1) c1 = numpy.cos(theta1) s2 = numpy.sin(theta2) c2 = numpy.cos(theta2) p1 = numpy.array(( s2*b5, 0, r-c2*b5)) p9 = numpy.array((-s2*b5, 0,-r+c2*b5)) p2 = numpy.array(( s2*(b5+b6), 0, r-c2*(b5+b6))) rot1 = reduce(numpy.dot, (rotmaty(theta1), rot72, rotmaty(-theta1))) p2s = [] for i in range(5): p2s.append(p2) p2 = numpy.dot(p2, rot1) coord = [] for i in range(5): coord.append(p1) p1 = numpy.dot(p1, rot72) for pj in p2s: pi = pj for i in range(5): coord.append(pi) pi = numpy.dot(pi, rot72) for pj in p2s: pi = pj for i in range(5): coord.append(-pi) pi = numpy.dot(pi, rot72) for i in range(5): coord.append(p9) p9 = numpy.dot(p9, rot72) return numpy.array(coord) def make12(b): theta1 = numpy.arccos(1/numpy.sqrt(5)) theta2 = (numpy.pi - theta1) * .5 r = b/2/numpy.sin(theta1/2) rot72 = rotmatz(numpy.pi*2/5) s1 = numpy.sin(theta1) c1 = numpy.cos(theta1) p1 = numpy.array(( s1*r, 0, c1*r)) p2 = numpy.array((-s1*r, 0, -c1*r)) coord = [( 0, 0, r)] for i in range(5): coord.append(p1) p1 = numpy.dot(p1, rot72) for i in range(5): coord.append(p2) p2 = numpy.dot(p2, rot72) coord.append(( 0, 0, -r)) return numpy.array(coord) def make20(b): theta1 = numpy.arccos(numpy.sqrt(5)/3) theta2 = numpy.arcsin(r2edge(theta1,1)/2/numpy.sin(numpy.pi/5)) r = b/2/numpy.sin(theta1/2) rot72 = rotmatz(numpy.pi*2/5) s2 = numpy.sin(theta2) c2 = numpy.cos(theta2) s3 = numpy.sin(theta1+theta2) c3 = numpy.cos(theta1+theta2) p1 = numpy.array(( s2*r, 0, c2*r)) p2 = numpy.array(( s3*r, 0, c3*r)) p3 = numpy.array((-s3*r, 0, -c3*r)) p4 = numpy.array((-s2*r, 0, -c2*r)) coord = [] for i in range(5): coord.append(p1) p1 = numpy.dot(p1, rot72) for i in range(5): coord.append(p2) p2 = numpy.dot(p2, rot72) for i in range(5): coord.append(p3) p3 = numpy.dot(p3, rot72) for i in range(5): coord.append(p4) p4 = numpy.dot(p4, rot72) return numpy.array(coord) if __name__ == '__main__': b5 = 1.46 b6 = 1.38 for c in make60(b5, b6): print(c) b = 1.4 for c in make12(b): print(c) for c in make20(b): print(c)
gkc1000/pyscf
pyscf/tools/c60struct.py
Python
apache-2.0
3,727
[ "PySCF" ]
6beecba7e60d344837ce4aed5335628084c4bdca47cdb56b7afafc1b530b3847
import re import json import typing as t from dataclasses import dataclass from functools import partial from collections import OrderedDict from ..graph import Graph, Root, Node, Link, Option, Field, Nothing from ..graph import GraphVisitor, GraphTransformer from ..types import ( TypeRef, String, Sequence, Boolean, Optional, TypeVisitor, ) from ..types import Any, RecordMeta, AbstractTypeVisitor from ..utils import ( listify, cached_property, ) from .types import ( SCALAR, NON_NULL, LIST, INPUT_OBJECT, OBJECT, DIRECTIVE, FieldIdent, FieldArgIdent, InputObjectFieldIdent, DirectiveArgIdent, ) @dataclass class Directive: @dataclass class Argument: name: str type_ident: t.Any description: str default_value: t.Any name: str locations: t.List[str] description: str args: t.List[Argument] @property def args_map(self): return OrderedDict((arg.name, arg) for arg in self.args) _BUILTIN_DIRECTIVES = ( Directive( name='skip', locations=['FIELD', 'FRAGMENT_SPREAD', 'INLINE_FRAGMENT'], description=( 'Directs the executor to skip this field or fragment ' 'when the `if` argument is true.' ), args=[ Directive.Argument( name='if', type_ident=NON_NULL(SCALAR('Boolean')), description='Skipped when true.', default_value=None, ), ], ), Directive( name='include', locations=['FIELD', 'FRAGMENT_SPREAD', 'INLINE_FRAGMENT'], description=( 'Directs the executor to include this field or fragment ' 'only when the `if` argument is true.' ), args=[ Directive.Argument( name='if', type_ident=NON_NULL(SCALAR('Boolean')), description='Included when true.', default_value=None, ), ], ), ) def _async_wrapper(func): async def wrapper(*args, **kwargs): return func(*args, **kwargs) return wrapper QUERY_ROOT_NAME = 'Query' MUTATION_ROOT_NAME = 'Mutation' class SchemaInfo: def __init__( self, query_graph: Graph, mutation_graph: t.Optional[Graph] = None, directives: t.Optional[t.Sequence[Directive]] = None, ): self.query_graph = query_graph self.data_types = query_graph.data_types self.mutation_graph = mutation_graph self.directives = directives or () @cached_property def directives_map(self): return OrderedDict((d.name, d) for d in self.directives) class TypeIdent(AbstractTypeVisitor): def __init__(self, graph, input_mode=False): self._graph = graph self._input_mode = input_mode def visit_any(self, obj): return SCALAR('Any') def visit_mapping(self, obj): return SCALAR('Any') def visit_record(self, obj): return SCALAR('Any') def visit_callable(self, obj): raise TypeError('Not expected here: {!r}'.format(obj)) def visit_sequence(self, obj): return NON_NULL(LIST(self.visit(obj.__item_type__))) def visit_optional(self, obj): ident = self.visit(obj.__type__) return ident.of_type if isinstance(ident, NON_NULL) else ident def visit_typeref(self, obj): if self._input_mode: assert obj.__type_name__ in self._graph.data_types, \ obj.__type_name__ return NON_NULL(INPUT_OBJECT(obj.__type_name__)) else: return NON_NULL(OBJECT(obj.__type_name__)) def visit_string(self, obj): return NON_NULL(SCALAR('String')) def visit_integer(self, obj): return NON_NULL(SCALAR('Int')) def visit_float(self, obj): return NON_NULL(SCALAR('Float')) def visit_boolean(self, obj): return NON_NULL(SCALAR('Boolean')) class UnsupportedGraphQLType(TypeError): pass class TypeValidator(TypeVisitor): @classmethod def is_valid(cls, type_): try: cls().visit(type_) except UnsupportedGraphQLType: return False else: return True def visit_any(self, obj): raise UnsupportedGraphQLType() def visit_record(self, obj): # inline Record type can't be directly matched to GraphQL type system raise UnsupportedGraphQLType() def not_implemented(*args, **kwargs): raise NotImplementedError(args, kwargs) def na_maybe(schema): return Nothing def na_many(schema, ids=None, options=None): if ids is None: return [] else: return [[] for _ in ids] def _nodes_map(schema: SchemaInfo): nodes = [(n.name, n) for n in schema.query_graph.nodes] nodes.append((QUERY_ROOT_NAME, schema.query_graph.root)) if schema.mutation_graph is not None: nodes.append((MUTATION_ROOT_NAME, schema.mutation_graph.root)) return OrderedDict(nodes) def schema_link(schema): return None def type_link(schema, options): name = options['name'] if name in _nodes_map(schema): return OBJECT(name) else: return Nothing @listify def root_schema_types(schema: SchemaInfo): yield SCALAR('String') yield SCALAR('Int') yield SCALAR('Boolean') yield SCALAR('Float') yield SCALAR('Any') for name in _nodes_map(schema): yield OBJECT(name) for name, type_ in schema.data_types.items(): if isinstance(type_, RecordMeta): yield OBJECT(name) yield INPUT_OBJECT(name) def root_schema_query_type(schema): return OBJECT(QUERY_ROOT_NAME) def root_schema_mutation_type(schema): if schema.mutation_graph is not None: return OBJECT(MUTATION_ROOT_NAME) else: return Nothing def root_schema_directives(schema): return [ DIRECTIVE(directive.name) for directive in schema.directives ] @listify def type_info(schema, fields, ids): nodes_map = _nodes_map(schema) for ident in ids: if isinstance(ident, OBJECT): if ident.name in nodes_map: description = nodes_map[ident.name].description else: description = None info = {'id': ident, 'kind': 'OBJECT', 'name': ident.name, 'description': description} elif isinstance(ident, INPUT_OBJECT): info = {'id': ident, 'kind': 'INPUT_OBJECT', 'name': 'IO{}'.format(ident.name), 'description': None} elif isinstance(ident, NON_NULL): info = {'id': ident, 'kind': 'NON_NULL'} elif isinstance(ident, LIST): info = {'id': ident, 'kind': 'LIST'} elif isinstance(ident, SCALAR): info = {'id': ident, 'name': ident.name, 'kind': 'SCALAR'} else: raise TypeError(repr(ident)) yield [info.get(f.name) for f in fields] @listify def type_fields_link(schema, ids, options): nodes_map = _nodes_map(schema) for ident in ids: if isinstance(ident, OBJECT): if ident.name in nodes_map: node = nodes_map[ident.name] field_idents = [ FieldIdent(ident.name, f.name) for f in node.fields if not f.name.startswith('_') ] else: type_ = schema.data_types[ident.name] field_idents = [ FieldIdent(ident.name, f_name) for f_name, f_type in type_.__field_types__.items() ] if not field_idents: raise TypeError('Object type "{}" does not contain fields, ' 'which is not acceptable for GraphQL in order ' 'to define schema type'.format(ident.name)) yield field_idents else: yield [] @listify def type_of_type_link(schema, ids): for ident in ids: if isinstance(ident, (NON_NULL, LIST)): yield ident.of_type else: yield Nothing @listify def field_info(schema, fields, ids): nodes_map = _nodes_map(schema) for ident in ids: if ident.node in nodes_map: node = nodes_map[ident.node] field = node.fields_map[ident.name] info = {'id': ident, 'name': field.name, 'description': field.description, 'isDeprecated': False, 'deprecationReason': None} else: info = {'id': ident, 'name': ident.name, 'description': None, 'isDeprecated': False, 'deprecationReason': None} yield [info[f.name] for f in fields] @listify def field_type_link(schema, ids): nodes_map = _nodes_map(schema) type_ident = TypeIdent(schema.query_graph) for ident in ids: if ident.node in nodes_map: node = nodes_map[ident.node] field = node.fields_map[ident.name] yield type_ident.visit(field.type or Any) else: data_type = schema.data_types[ident.node] field_type = data_type.__field_types__[ident.name] yield type_ident.visit(field_type) @listify def field_args_link(schema, ids): nodes_map = _nodes_map(schema) for ident in ids: if ident.node in nodes_map: node = nodes_map[ident.node] field = node.fields_map[ident.name] yield [FieldArgIdent(ident.node, field.name, option.name) for option in field.options] else: yield [] @listify def type_input_object_input_fields_link(schema, ids): for ident in ids: if isinstance(ident, INPUT_OBJECT): data_type = schema.data_types[ident.name] yield [InputObjectFieldIdent(ident.name, key) for key in data_type.__field_types__.keys()] else: yield [] @listify def input_value_info(schema, fields, ids): nodes_map = _nodes_map(schema) for ident in ids: if isinstance(ident, FieldArgIdent): node = nodes_map[ident.node] field = node.fields_map[ident.field] option = field.options_map[ident.name] if option.default is Nothing: default = None else: default = json.dumps(option.default) info = {'id': ident, 'name': option.name, 'description': option.description, 'defaultValue': default} yield [info[f.name] for f in fields] elif isinstance(ident, InputObjectFieldIdent): info = {'id': ident, 'name': ident.key, 'description': None, 'defaultValue': None} yield [info[f.name] for f in fields] elif isinstance(ident, DirectiveArgIdent): directive = schema.directives_map[ident.name] arg = directive.args_map[ident.arg] info = {'id': ident, 'name': arg.name, 'description': arg.description, 'defaultValue': arg.default_value} yield [info[f.name] for f in fields] else: raise TypeError(repr(ident)) @listify def input_value_type_link(schema, ids): nodes_map = _nodes_map(schema) type_ident = TypeIdent(schema.query_graph, input_mode=True) for ident in ids: if isinstance(ident, FieldArgIdent): node = nodes_map[ident.node] field = node.fields_map[ident.field] option = field.options_map[ident.name] yield type_ident.visit(option.type) elif isinstance(ident, InputObjectFieldIdent): data_type = schema.data_types[ident.name] field_type = data_type.__field_types__[ident.key] yield type_ident.visit(field_type) elif isinstance(ident, DirectiveArgIdent): directive = schema.directives_map[ident.name] for arg in directive.args: yield arg.type_ident else: raise TypeError(repr(ident)) @listify def directive_value_info(schema, fields, ids): for ident in ids: if ident.name in schema.directives_map: directive = schema.directives_map[ident.name] info = {'name': directive.name, 'description': directive.description, 'locations': directive.locations} yield [info[f.name] for f in fields] def directive_args_link(schema, ids): links = [] for ident in ids: directive = schema.directives_map[ident] links.append([DirectiveArgIdent(ident, arg.name) for arg in directive.args]) return links GRAPH = Graph([ Node('__Type', [ Field('id', None, type_info), Field('kind', String, type_info), Field('name', String, type_info), Field('description', String, type_info), # OBJECT and INTERFACE only Link('fields', Sequence[TypeRef['__Field']], type_fields_link, requires='id', options=[Option('includeDeprecated', Boolean, default=False)]), # OBJECT only Link('interfaces', Sequence[TypeRef['__Type']], na_many, requires='id'), # INTERFACE and UNION only Link('possibleTypes', Sequence[TypeRef['__Type']], na_many, requires='id'), # ENUM only Link('enumValues', Sequence[TypeRef['__EnumValue']], na_many, requires='id', options=[Option('includeDeprecated', Boolean, default=False)]), # INPUT_OBJECT only Link('inputFields', Sequence[TypeRef['__InputValue']], type_input_object_input_fields_link, requires='id'), # NON_NULL and LIST only Link('ofType', Optional[TypeRef['__Type']], type_of_type_link, requires='id'), ]), Node('__Field', [ Field('id', None, field_info), Field('name', String, field_info), Field('description', String, field_info), Link('args', Sequence[TypeRef['__InputValue']], field_args_link, requires='id'), Link('type', TypeRef['__Type'], field_type_link, requires='id'), Field('isDeprecated', Boolean, field_info), Field('deprecationReason', String, field_info), ]), Node('__InputValue', [ Field('id', None, input_value_info), Field('name', String, input_value_info), Field('description', String, input_value_info), Link('type', TypeRef['__Type'], input_value_type_link, requires='id'), Field('defaultValue', String, input_value_info), ]), Node('__Directive', [ Field('name', String, directive_value_info), Field('description', String, directive_value_info), Field('locations', Sequence[String], directive_value_info), Link('args', Sequence[TypeRef['__InputValue']], directive_args_link, requires='name'), ]), Node('__EnumValue', [ Field('name', String, not_implemented), Field('description', String, not_implemented), Field('isDeprecated', Boolean, not_implemented), Field('deprecationReason', String, not_implemented), ]), Node('__Schema', [ Link('types', Sequence[TypeRef['__Type']], root_schema_types, requires=None), Link('queryType', TypeRef['__Type'], root_schema_query_type, requires=None), Link('mutationType', Optional[TypeRef['__Type']], root_schema_mutation_type, requires=None), Link('subscriptionType', Optional[TypeRef['__Type']], na_maybe, requires=None), Link('directives', Sequence[TypeRef['__Directive']], root_schema_directives, requires=None), ]), Root([ Link('__schema', TypeRef['__Schema'], schema_link, requires=None), Link('__type', Optional[TypeRef['__Type']], type_link, requires=None, options=[Option('name', String)]), ]), ]) class ValidateGraph(GraphVisitor): _name_re = re.compile(r'^[_a-zA-Z]\w*$', re.ASCII) def __init__(self): self._path = [] self._errors = [] def _add_error(self, name, description): path = '.'.join(self._path + [name]) self._errors.append('{}: {}'.format(path, description)) @classmethod def validate(cls, graph): self = cls() self.visit(graph) if self._errors: raise ValueError('Invalid GraphQL graph:\n{}' .format('\n'.join('- {}'.format(err) for err in self._errors))) def visit_node(self, obj): if not self._name_re.match(obj.name): self._add_error(obj.name, 'Invalid node name: {}'.format(obj.name)) if obj.fields: self._path.append(obj.name) super(ValidateGraph, self).visit_node(obj) self._path.pop() else: self._add_error(obj.name, 'No fields in the {} node'.format(obj.name)) def visit_root(self, obj): if obj.fields: self._path.append('Root') super(ValidateGraph, self).visit_root(obj) self._path.pop() else: self._add_error('Root', 'No fields in the Root node') def visit_field(self, obj): if not self._name_re.match(obj.name): self._add_error(obj.name, 'Invalid field name: {}'.format(obj.name)) super(ValidateGraph, self).visit_field(obj) def visit_link(self, obj): if not self._name_re.match(obj.name): self._add_error(obj.name, 'Invalid link name: {}'.format(obj.name)) super(ValidateGraph, self).visit_link(obj) def visit_option(self, obj): if not self._name_re.match(obj.name): self._add_error(obj.name, 'Invalid option name: {}'.format(obj.name)) super(ValidateGraph, self).visit_option(obj) class BindToSchema(GraphTransformer): def __init__(self, schema): self.schema = schema self._processed = {} def visit_field(self, obj): field = super(BindToSchema, self).visit_field(obj) func = self._processed.get(obj.func) if func is None: func = self._processed[obj.func] = partial(obj.func, self.schema) field.func = func return field def visit_link(self, obj): link = super(BindToSchema, self).visit_link(obj) link.func = partial(link.func, self.schema) return link class MakeAsync(GraphTransformer): def __init__(self): self._processed = {} def visit_field(self, obj): field = super(MakeAsync, self).visit_field(obj) func = self._processed.get(obj.func) if func is None: func = self._processed[obj.func] = _async_wrapper(obj.func) field.func = func return field def visit_link(self, obj): link = super(MakeAsync, self).visit_link(obj) link.func = _async_wrapper(link.func) return link def type_name_field_func(node_name, fields, ids=None): return [[node_name] for _ in ids] if ids is not None else [node_name] class AddIntrospection(GraphTransformer): def __init__(self, introspection_graph, type_name_field_factory): self.introspection_graph = introspection_graph self.type_name_field_factory = type_name_field_factory def visit_node(self, obj): node = super(AddIntrospection, self).visit_node(obj) node.fields.append(self.type_name_field_factory(obj.name)) return node def visit_root(self, obj): root = super(AddIntrospection, self).visit_root(obj) root.fields.append(self.type_name_field_factory(QUERY_ROOT_NAME)) return root def visit_graph(self, obj): graph = super(AddIntrospection, self).visit_graph(obj) graph.items.extend(self.introspection_graph.items) return graph class GraphQLIntrospection(GraphTransformer): """Adds GraphQL introspection into synchronous graph Example: .. code-block:: python from hiku.graph import apply from hiku.introspection.graphql import GraphQLIntrospection graph = apply(graph, [GraphQLIntrospection(graph)]) """ __directives__ = _BUILTIN_DIRECTIVES def __init__(self, query_graph, mutation_graph=None): """ :param query_graph: graph, where Root node represents Query root operation type :param mutation_graph: graph, where Root node represents Mutation root operation type """ self._schema = SchemaInfo( query_graph, mutation_graph, self.__directives__, ) def __type_name__(self, node_name): return Field('__typename', String, partial(type_name_field_func, node_name)) def __introspection_graph__(self): return BindToSchema(self._schema).visit(GRAPH) def visit_node(self, obj): node = super(GraphQLIntrospection, self).visit_node(obj) node.fields.append(self.__type_name__(obj.name)) return node def visit_root(self, obj): root = super(GraphQLIntrospection, self).visit_root(obj) root.fields.append(self.__type_name__(QUERY_ROOT_NAME)) return root def visit_graph(self, obj): ValidateGraph.validate(obj) introspection_graph = self.__introspection_graph__() items = [self.visit(node) for node in obj.items] items.extend(introspection_graph.items) return Graph(items, data_types=obj.data_types) class AsyncGraphQLIntrospection(GraphQLIntrospection): """Adds GraphQL introspection into asynchronous graph Example: .. code-block:: python from hiku.graph import apply from hiku.introspection.graphql import AsyncGraphQLIntrospection graph = apply(graph, [AsyncGraphQLIntrospection(graph)]) """ def __type_name__(self, node_name): return Field('__typename', String, _async_wrapper(partial(type_name_field_func, node_name))) def __introspection_graph__(self): graph = super(AsyncGraphQLIntrospection, self).__introspection_graph__() graph = MakeAsync().visit(graph) return graph
vmagamedov/hiku
hiku/introspection/graphql.py
Python
bsd-3-clause
22,919
[ "VisIt" ]
5dfb7f5f2f7c869146e37e88241918c6e32eee99c34366f4ba3f97521bd23d07
#!/usr/bin/env python ################################################## ## DEPENDENCIES import sys import os import os.path try: import builtins as builtin except ImportError: import __builtin__ as builtin from os.path import getmtime, exists import time import types from Cheetah.Version import MinCompatibleVersion as RequiredCheetahVersion from Cheetah.Version import MinCompatibleVersionTuple as RequiredCheetahVersionTuple from Cheetah.Template import Template from Cheetah.DummyTransaction import * from Cheetah.NameMapper import NotFound, valueForName, valueFromSearchList, valueFromFrameOrSearchList from Cheetah.CacheRegion import CacheRegion import Cheetah.Filters as Filters import Cheetah.ErrorCatchers as ErrorCatchers ################################################## ## MODULE CONSTANTS VFFSL=valueFromFrameOrSearchList VFSL=valueFromSearchList VFN=valueForName currentTime=time.time __CHEETAH_version__ = '2.4.4' __CHEETAH_versionTuple__ = (2, 4, 4, 'development', 0) __CHEETAH_genTime__ = 1364979192.270927 __CHEETAH_genTimestamp__ = 'Wed Apr 3 17:53:12 2013' __CHEETAH_src__ = '/home/fermi/Work/Model/tmsingle/openpli3.0/build-tmsingle/tmp/work/mips32el-oe-linux/enigma2-plugin-extensions-openwebif-0.1+git1+279a2577c3bc6defebd4bf9e61a046dcf7f37c01-r0.72/git/plugin/controllers/views/web/getaudiotracks.tmpl' __CHEETAH_srcLastModified__ = 'Wed Apr 3 17:10:17 2013' __CHEETAH_docstring__ = 'Autogenerated by Cheetah: The Python-Powered Template Engine' if __CHEETAH_versionTuple__ < RequiredCheetahVersionTuple: raise AssertionError( 'This template was compiled with Cheetah version' ' %s. Templates compiled before version %s must be recompiled.'%( __CHEETAH_version__, RequiredCheetahVersion)) ################################################## ## CLASSES class getaudiotracks(Template): ################################################## ## CHEETAH GENERATED METHODS def __init__(self, *args, **KWs): super(getaudiotracks, self).__init__(*args, **KWs) if not self._CHEETAH__instanceInitialized: cheetahKWArgs = {} allowedKWs = 'searchList namespaces filter filtersLib errorCatcher'.split() for k,v in KWs.items(): if k in allowedKWs: cheetahKWArgs[k] = v self._initCheetahInstance(**cheetahKWArgs) def respond(self, trans=None): ## CHEETAH: main method generated for this template if (not trans and not self._CHEETAH__isBuffering and not callable(self.transaction)): trans = self.transaction # is None unless self.awake() was called if not trans: trans = DummyTransaction() _dummyTrans = True else: _dummyTrans = False write = trans.response().write SL = self._CHEETAH__searchList _filter = self._CHEETAH__currentFilter ######################################## ## START - generated method body _orig_filter_77795892 = _filter filterName = u'WebSafe' if self._CHEETAH__filters.has_key("WebSafe"): _filter = self._CHEETAH__currentFilter = self._CHEETAH__filters[filterName] else: _filter = self._CHEETAH__currentFilter = \ self._CHEETAH__filters[filterName] = getattr(self._CHEETAH__filtersLib, filterName)(self).filter write(u'''<?xml version="1.0" encoding="UTF-8"?> <e2audiotracklist> ''') for track in VFFSL(SL,"tracklist",True): # generated from line 4, col 2 write(u'''\t\t<e2audiotrack> \t\t\t<e2audiotrackdescription>''') _v = VFFSL(SL,"track.description",True) # u'$track.description' on line 6, col 29 if _v is not None: write(_filter(_v, rawExpr=u'$track.description')) # from line 6, col 29. write(u'''</e2audiotrackdescription> \t\t\t<e2audiotrackid>''') _v = VFFSL(SL,"track.index",True) # u'$track.index' on line 7, col 20 if _v is not None: write(_filter(_v, rawExpr=u'$track.index')) # from line 7, col 20. write(u'''</e2audiotrackid> \t\t\t<e2audiotrackpid>''') _v = VFFSL(SL,"track.pid",True) # u'$track.pid' on line 8, col 21 if _v is not None: write(_filter(_v, rawExpr=u'$track.pid')) # from line 8, col 21. write(u'''</e2audiotrackpid> \t\t\t<e2audiotrackactive>''') _v = VFFSL(SL,"track.active",True) # u'$track.active' on line 9, col 24 if _v is not None: write(_filter(_v, rawExpr=u'$track.active')) # from line 9, col 24. write(u'''</e2audiotrackactive> \t\t</e2audiotrack> ''') write(u'''</e2audiotracklist> ''') _filter = self._CHEETAH__currentFilter = _orig_filter_77795892 ######################################## ## END - generated method body return _dummyTrans and trans.response().getvalue() or "" ################################################## ## CHEETAH GENERATED ATTRIBUTES _CHEETAH__instanceInitialized = False _CHEETAH_version = __CHEETAH_version__ _CHEETAH_versionTuple = __CHEETAH_versionTuple__ _CHEETAH_genTime = __CHEETAH_genTime__ _CHEETAH_genTimestamp = __CHEETAH_genTimestamp__ _CHEETAH_src = __CHEETAH_src__ _CHEETAH_srcLastModified = __CHEETAH_srcLastModified__ _mainCheetahMethod_for_getaudiotracks= 'respond' ## END CLASS DEFINITION if not hasattr(getaudiotracks, '_initCheetahAttributes'): templateAPIClass = getattr(getaudiotracks, '_CHEETAH_templateClass', Template) templateAPIClass._addCheetahPlumbingCodeToClass(getaudiotracks) # CHEETAH was developed by Tavis Rudd and Mike Orr # with code, advice and input from many other volunteers. # For more information visit http://www.CheetahTemplate.org/ ################################################## ## if run from command line: if __name__ == '__main__': from Cheetah.TemplateCmdLineIface import CmdLineIface CmdLineIface(templateObj=getaudiotracks()).run()
pli3/Openwebif
plugin/controllers/views/web/getaudiotracks.py
Python
gpl-2.0
6,042
[ "VisIt" ]
836752fb95eb42bb0914c9af21ed3b1a012b2b3d08875f57b7243d807d326bbd
import pytest import betterbib @pytest.mark.parametrize( "string,ref", [ ( "The Magnus expansion and some of its applications", "The {Magnus} expansion and some of its applications", ), ( "On generalized averaged Gaussian formulas, II", "On generalized averaged {Gaussian} formulas, {II}", ), ("Gaussian Hermitian Jacobian", "{Gaussian} {Hermitian} {Jacobian}"), ( "VODE: a variable-coefficient ODE solver", "{VODE:} {A} variable-coefficient {ODE} solver", ), ( "GMRES: A generalized minimal residual algorithm", "{GMRES:} {A} generalized minimal residual algorithm", ), ( "Peano's kernel theorem for vector-valued functions", "{Peano's} kernel theorem for vector-valued functions", ), ( "Exponential Runge-Kutta methods for parabolic problems", "Exponential {Runge}-{Kutta} methods for parabolic problems", ), ( "Dash-Dash Double--Dash Triple---Dash", "Dash-Dash Double--Dash Triple---Dash", ), ("x: {X}", "x: {X}"), ( "{Aaa ${\\text{Pt/Co/AlO}}_{x}$ aaa bbb}", "{Aaa {${\\text{Pt/Co/AlO}}_{x}$} aaa bbb}", ), ("z*", "z*"), ("A \\LaTeX title", "A \\LaTeX title"), ], ) def test_translate_title(string, ref): assert betterbib.tools._translate_title(string) == ref
nschloe/betterbib
tests/test_bibtex_title.py
Python
gpl-3.0
1,535
[ "Gaussian" ]
c0296b4ced3a6849f6db2a109cc84d031e243ff59fad42b7836ac89aa7c9cc83
# coding: utf-8 # # Machine Learning Engineer Nanodegree # ## Supervised Learning # ## Project: Finding Donors for *CharityML* # Welcome to the second project of the Machine Learning Engineer Nanodegree! In this notebook, some template code has already been provided for you, and it will be your job to implement the additional functionality necessary to successfully complete this project. Sections that begin with **'Implementation'** in the header indicate that the following block of code will require additional functionality which you must provide. Instructions will be provided for each section and the specifics of the implementation are marked in the code block with a `'TODO'` statement. Please be sure to read the instructions carefully! # # In addition to implementing code, there will be questions that you must answer which relate to the project and your implementation. Each section where you will answer a question is preceded by a **'Question X'** header. Carefully read each question and provide thorough answers in the following text boxes that begin with **'Answer:'**. Your project submission will be evaluated based on your answers to each of the questions and the implementation you provide. # # >**Note:** Please specify WHICH VERSION OF PYTHON you are using when submitting this notebook. Code and Markdown cells can be executed using the **Shift + Enter** keyboard shortcut. In addition, Markdown cells can be edited by typically double-clicking the cell to enter edit mode. # ## Getting Started # # In this project, you will employ several supervised algorithms of your choice to accurately model individuals' income using data collected from the 1994 U.S. Census. You will then choose the best candidate algorithm from preliminary results and further optimize this algorithm to best model the data. Your goal with this implementation is to construct a model that accurately predicts whether an individual makes more than $50,000. This sort of task can arise in a non-profit setting, where organizations survive on donations. Understanding an individual's income can help a non-profit better understand how large of a donation to request, or whether or not they should reach out to begin with. While it can be difficult to determine an individual's general income bracket directly from public sources, we can (as we will see) infer this value from other publically available features. # # The dataset for this project originates from the [UCI Machine Learning Repository](https://archive.ics.uci.edu/ml/datasets/Census+Income). The datset was donated by Ron Kohavi and Barry Becker, after being published in the article _"Scaling Up the Accuracy of Naive-Bayes Classifiers: A Decision-Tree Hybrid"_. You can find the article by Ron Kohavi [online](https://www.aaai.org/Papers/KDD/1996/KDD96-033.pdf). The data we investigate here consists of small changes to the original dataset, such as removing the `'fnlwgt'` feature and records with missing or ill-formatted entries. # ---- # ## Exploring the Data # Run the code cell below to load necessary Python libraries and load the census data. Note that the last column from this dataset, `'income'`, will be our target label (whether an individual makes more than, or at most, $50,000 annually). All other columns are features about each individual in the census database. # In[1]: from __future__ import division # Import libraries necessary for this project import numpy as np import pandas as pd from time import time from IPython.display import display # Allows the use of display() for DataFrames # Import supplementary visualization code visuals.py import visuals as vs # Pretty display for notebooks get_ipython().magic(u'matplotlib inline') # Load the Census dataset data = pd.read_csv("census.csv") # Success - Display the first record display(data.head(n=1)) # ### Implementation: Data Exploration # A cursory investigation of the dataset will determine how many individuals fit into either group, and will tell us about the percentage of these individuals making more than \$50,000. In the code cell below, you will need to compute the following: # - The total number of records, `'n_records'` # - The number of individuals making more than \$50,000 annually, `'n_greater_50k'`. # - The number of individuals making at most \$50,000 annually, `'n_at_most_50k'`. # - The percentage of individuals making more than \$50,000 annually, `'greater_percent'`. # # ** HINT: ** You may need to look at the table above to understand how the `'income'` entries are formatted. # In[2]: # Total number of records n_records = data.shape[0] # Number of records where individual's income is more than $50,000 n_greater_50k = data[data.income == ">50K"].shape[0] # Number of records where individual's income is at most $50,000 n_at_most_50k = data[data.income == "<=50K"].shape[0] # Percentage of individuals whose income is more than $50,000 greater_percent = n_greater_50k / n_records * 100 # Print the results print "Total number of records: {}".format(n_records) print "Individuals making more than $50,000: {}".format(n_greater_50k) print "Individuals making at most $50,000: {}".format(n_at_most_50k) print "Percentage of individuals making more than $50,000: {:.2f}%".format(greater_percent) # ** Featureset Exploration ** # # * **age**: continuous. # * **workclass**: Private, Self-emp-not-inc, Self-emp-inc, Federal-gov, Local-gov, State-gov, Without-pay, Never-worked. # * **education**: Bachelors, Some-college, 11th, HS-grad, Prof-school, Assoc-acdm, Assoc-voc, 9th, 7th-8th, 12th, Masters, 1st-4th, 10th, Doctorate, 5th-6th, Preschool. # * **education-num**: continuous. # * **marital-status**: Married-civ-spouse, Divorced, Never-married, Separated, Widowed, Married-spouse-absent, Married-AF-spouse. # * **occupation**: Tech-support, Craft-repair, Other-service, Sales, Exec-managerial, Prof-specialty, Handlers-cleaners, Machine-op-inspct, Adm-clerical, Farming-fishing, Transport-moving, Priv-house-serv, Protective-serv, Armed-Forces. # * **relationship**: Wife, Own-child, Husband, Not-in-family, Other-relative, Unmarried. # * **race**: Black, White, Asian-Pac-Islander, Amer-Indian-Eskimo, Other. # * **sex**: Female, Male. # * **capital-gain**: continuous. # * **capital-loss**: continuous. # * **hours-per-week**: continuous. # * **native-country**: United-States, Cambodia, England, Puerto-Rico, Canada, Germany, Outlying-US(Guam-USVI-etc), India, Japan, Greece, South, China, Cuba, Iran, Honduras, Philippines, Italy, Poland, Jamaica, Vietnam, Mexico, Portugal, Ireland, France, Dominican-Republic, Laos, Ecuador, Taiwan, Haiti, Columbia, Hungary, Guatemala, Nicaragua, Scotland, Thailand, Yugoslavia, El-Salvador, Trinadad&Tobago, Peru, Hong, Holand-Netherlands. # ---- # ## Preparing the Data # Before data can be used as input for machine learning algorithms, it often must be cleaned, formatted, and restructured — this is typically known as **preprocessing**. Fortunately, for this dataset, there are no invalid or missing entries we must deal with, however, there are some qualities about certain features that must be adjusted. This preprocessing can help tremendously with the outcome and predictive power of nearly all learning algorithms. # ### Transforming Skewed Continuous Features # A dataset may sometimes contain at least one feature whose values tend to lie near a single number, but will also have a non-trivial number of vastly larger or smaller values than that single number. Algorithms can be sensitive to such distributions of values and can underperform if the range is not properly normalized. With the census dataset two features fit this description: '`capital-gain'` and `'capital-loss'`. # # Run the code cell below to plot a histogram of these two features. Note the range of the values present and how they are distributed. # In[3]: # Split the data into features and target label income_raw = data['income'] features_raw = data.drop('income', axis = 1) # Visualize skewed continuous features of original data vs.distribution(data) # For highly-skewed feature distributions such as `'capital-gain'` and `'capital-loss'`, it is common practice to apply a <a href="https://en.wikipedia.org/wiki/Data_transformation_(statistics)">logarithmic transformation</a> on the data so that the very large and very small values do not negatively affect the performance of a learning algorithm. Using a logarithmic transformation significantly reduces the range of values caused by outliers. Care must be taken when applying this transformation however: The logarithm of `0` is undefined, so we must translate the values by a small amount above `0` to apply the the logarithm successfully. # # Run the code cell below to perform a transformation on the data and visualize the results. Again, note the range of values and how they are distributed. # In[4]: # Log-transform the skewed features skewed = ['capital-gain', 'capital-loss'] features_log_transformed = pd.DataFrame(data = features_raw) features_log_transformed[skewed] = features_raw[skewed].apply(lambda x: np.log(x + 1)) # Visualize the new log distributions vs.distribution(features_log_transformed, transformed = True) # ### Normalizing Numerical Features # In addition to performing transformations on features that are highly skewed, it is often good practice to perform some type of scaling on numerical features. Applying a scaling to the data does not change the shape of each feature's distribution (such as `'capital-gain'` or `'capital-loss'` above); however, normalization ensures that each feature is treated equally when applying supervised learners. Note that once scaling is applied, observing the data in its raw form will no longer have the same original meaning, as exampled below. # # Run the code cell below to normalize each numerical feature. We will use [`sklearn.preprocessing.MinMaxScaler`](http://scikit-learn.org/stable/modules/generated/sklearn.preprocessing.MinMaxScaler.html) for this. # In[5]: # Import sklearn.preprocessing.StandardScaler from sklearn.preprocessing import MinMaxScaler # Initialize a scaler, then apply it to the features scaler = MinMaxScaler() # default=(0, 1) numerical = ['age', 'education-num', 'capital-gain', 'capital-loss', 'hours-per-week'] features_log_minmax_transform = pd.DataFrame(data = features_log_transformed) features_log_minmax_transform[numerical] = scaler.fit_transform(features_log_transformed[numerical]) # Show an example of a record with scaling applied display(features_log_minmax_transform.head(n = 5)) # ### Implementation: Data Preprocessing # # From the table in **Exploring the Data** above, we can see there are several features for each record that are non-numeric. Typically, learning algorithms expect input to be numeric, which requires that non-numeric features (called *categorical variables*) be converted. One popular way to convert categorical variables is by using the **one-hot encoding** scheme. One-hot encoding creates a _"dummy"_ variable for each possible category of each non-numeric feature. For example, assume `someFeature` has three possible entries: `A`, `B`, or `C`. We then encode this feature into `someFeature_A`, `someFeature_B` and `someFeature_C`. # # | | someFeature | | someFeature_A | someFeature_B | someFeature_C | # | :-: | :-: | | :-: | :-: | :-: | # | 0 | B | | 0 | 1 | 0 | # | 1 | C | ----> one-hot encode ----> | 0 | 0 | 1 | # | 2 | A | | 1 | 0 | 0 | # # Additionally, as with the non-numeric features, we need to convert the non-numeric target label, `'income'` to numerical values for the learning algorithm to work. Since there are only two possible categories for this label ("<=50K" and ">50K"), we can avoid using one-hot encoding and simply encode these two categories as `0` and `1`, respectively. In code cell below, you will need to implement the following: # - Use [`pandas.get_dummies()`](http://pandas.pydata.org/pandas-docs/stable/generated/pandas.get_dummies.html?highlight=get_dummies#pandas.get_dummies) to perform one-hot encoding on the `'features_raw'` data. # - Convert the target label `'income_raw'` to numerical entries. # - Set records with "<=50K" to `0` and records with ">50K" to `1`. # In[6]: # One-hot encode the 'features_log_minmax_transform' data using pandas.get_dummies() categorical = ['workclass', 'education_level', 'marital-status', 'occupation', 'relationship', 'race','sex'] features_categorical = pd.DataFrame(data = features_log_minmax_transform[categorical]) features_categorical = pd.get_dummies(features_categorical) features_final = pd.concat([features_log_minmax_transform[numerical], features_categorical], axis=1) # Encode the 'income_raw' data to numerical values income = pd.Series(data = income_raw ) income = income.map({'<=50K': 0, '>50K': 1}) # Print the number of features after one-hot encoding encoded = list(features_final.columns) print "{} total features after one-hot encoding.".format(len(encoded)) # Uncomment the following line to see the encoded feature names #print encoded # ### Shuffle and Split Data # Now all _categorical variables_ have been converted into numerical features, and all numerical features have been normalized. As always, we will now split the data (both features and their labels) into training and test sets. 80% of the data will be used for training and 20% for testing. # # Run the code cell below to perform this split. # In[7]: # Import train_test_split from sklearn.cross_validation import train_test_split # Split the 'features' and 'income' data into training and testing sets X_train, X_test, y_train, y_test = train_test_split(features_final, income, test_size = 0.2, random_state = 0) # Show the results of the split print "Training set has {} samples.".format(X_train.shape[0]) print "Testing set has {} samples.".format(X_test.shape[0]) # ---- # ## Evaluating Model Performance # In this section, we will investigate four different algorithms, and determine which is best at modeling the data. Three of these algorithms will be supervised learners of your choice, and the fourth algorithm is known as a *naive predictor*. # ### Metrics and the Naive Predictor # *CharityML*, equipped with their research, knows individuals that make more than \$50,000 are most likely to donate to their charity. Because of this, *CharityML* is particularly interested in predicting who makes more than \$50,000 accurately. It would seem that using **accuracy** as a metric for evaluating a particular model's performace would be appropriate. Additionally, identifying someone that *does not* make more than \$50,000 as someone who does would be detrimental to *CharityML*, since they are looking to find individuals willing to donate. Therefore, a model's ability to precisely predict those that make more than \$50,000 is *more important* than the model's ability to **recall** those individuals. We can use **F-beta score** as a metric that considers both precision and recall: # # $$ F_{\beta} = (1 + \beta^2) \cdot \frac{precision \cdot recall}{\left( \beta^2 \cdot precision \right) + recall} $$ # # In particular, when $\beta = 0.5$, more emphasis is placed on precision. This is called the **F$_{0.5}$ score** (or F-score for simplicity). # # Looking at the distribution of classes (those who make at most \$50,000, and those who make more), it's clear most individuals do not make more than \$50,000. This can greatly affect **accuracy**, since we could simply say *"this person does not make more than \$50,000"* and generally be right, without ever looking at the data! Making such a statement would be called **naive**, since we have not considered any information to substantiate the claim. It is always important to consider the *naive prediction* for your data, to help establish a benchmark for whether a model is performing well. That been said, using that prediction would be pointless: If we predicted all people made less than \$50,000, *CharityML* would identify no one as donors. # # # #### Note: Recap of accuracy, precision, recall # # ** Accuracy ** measures how often the classifier makes the correct prediction. It’s the ratio of the number of correct predictions to the total number of predictions (the number of test data points). # # ** Precision ** tells us what proportion of messages we classified as spam, actually were spam. # It is a ratio of true positives(words classified as spam, and which are actually spam) to all positives(all words classified as spam, irrespective of whether that was the correct classificatio), in other words it is the ratio of # # `[True Positives/(True Positives + False Positives)]` # # ** Recall(sensitivity)** tells us what proportion of messages that actually were spam were classified by us as spam. # It is a ratio of true positives(words classified as spam, and which are actually spam) to all the words that were actually spam, in other words it is the ratio of # # `[True Positives/(True Positives + False Negatives)]` # # For classification problems that are skewed in their classification distributions like in our case, for example if we had a 100 text messages and only 2 were spam and the rest 98 weren't, accuracy by itself is not a very good metric. We could classify 90 messages as not spam(including the 2 that were spam but we classify them as not spam, hence they would be false negatives) and 10 as spam(all 10 false positives) and still get a reasonably good accuracy score. For such cases, precision and recall come in very handy. These two metrics can be combined to get the F1 score, which is weighted average(harmonic mean) of the precision and recall scores. This score can range from 0 to 1, with 1 being the best possible F1 score(we take the harmonic mean as we are dealing with ratios). # ### Question 1 - Naive Predictor Performace # * If we chose a model that always predicted an individual made more than $50,000, what would that model's accuracy and F-score be on this dataset? You must use the code cell below and assign your results to `'accuracy'` and `'fscore'` to be used later. # # ** HINT: ** # # * When we have a model that always predicts '1' (i.e. the individual makes more than 50k) then our model will have no True Negatives(TN) or False Negatives(FN) as we are not making any negative('0' value) predictions. Therefore our Accuracy in this case becomes the same as our Precision(True Positives/(True Positives + False Positives)) as every prediction that we have made with value '1' that should have '0' becomes a False Positive; therefore our denominator in this case is the total number of records we have in total. # * Our Recall score(True Positives/(True Positives + False Negatives)) in this setting becomes 1 as we have no False Negatives. # In[8]: TP = np.sum(income) # Counting the ones as this is the naive case. Note that 'income' is the 'income_raw' data #encoded to numerical values done in the data preprocessing step. FP = income.count() - TP # Specific to the naive case TN = 0 # No predicted negatives in the naive case FN = 0 # No predicted negatives in the naive case # Calculate accuracy, precision and recall accuracy = (TP+TN) / (TP+FP+TN+FN) recall = TP/(TP+FN) precision = TP /(TP+FP) # Calculate F-score using the formula above for beta = 0.5 and correct values for precision and recall. # HINT: The formula above can be written as (1 + beta**2) * (precision * recall) / ((beta**2 * precision) + recall) beta = 0.5 fscore = (1+ beta**2) * (precision * recall) / ((beta**2 * precision) + recall) # Print the results print "Naive Predictor: [Accuracy score: {:.4f}, F-score: {:.4f}]".format(accuracy, fscore) # ### Supervised Learning Models # **The following are some of the supervised learning models that are currently available in** [`scikit-learn`](http://scikit-learn.org/stable/supervised_learning.html) **that you may choose from:** # - Gaussian Naive Bayes (GaussianNB) # - Decision Trees # - Ensemble Methods (Bagging, AdaBoost, Random Forest, Gradient Boosting) # - K-Nearest Neighbors (KNeighbors) # - Stochastic Gradient Descent Classifier (SGDC) # - Support Vector Machines (SVM) # - Logistic Regression # ### Question 2 - Model Application # List three of the supervised learning models above that are appropriate for this problem that you will test on the census data. For each model chosen # # - Describe one real-world application in industry where the model can be applied. # - What are the strengths of the model; when does it perform well? # - What are the weaknesses of the model; when does it perform poorly? # - What makes this model a good candidate for the problem, given what you know about the data? # # ** HINT: ** # # Structure your answer in the same format as above^, with 4 parts for each of the three models you pick. Please include references with your answer. # **Answer: ** # # The following three models are picked. # # Gaussian Naive Bayes (GaussianNB) # - GaussianNB can be applied to document classification and spam email filtering. For example, Gaussian NB takes term-document matrix of emails as the input and classify emails into spam and non-spam. # - The strengths of GaussianNB are that it requires small size of training data to determine necessary parameters and is very fast, not suffering “curse of dimensionality” (SLUG). # - Although GaussianNB is a good classifier, it can not provide good estimates of probabilities (SLUG), which is one of the weaknesses. Another weakness is that GaussianNB requires a strong conditional independence assumption on the attributes in the model (Class notes; SLUG). # - As our classification problem has many input variables and observations, GaussianNB with high efficiency and capability of handling high dimensionality is a good candidate. # # Support Vector Machines (SVM) # - SVM can be used in the imaging application of detecting human face. SVM discovers a squared boundary around face and classifies the images as with-face or without-face. # - SVM is effective in high dimensional spaces and memory efficient; it can adopt different Kernel functions for the dicision function (SLUG). # - The weakness of SVM is that its accuracy in terms of over-fitting is sensitive to the Kernel functions and regularization term if there are too many features (SLUG). Another weakness of SVM is that it do not provide probability estimates (SLUG). # - Similar to GaussianNB, SVM with high efficiency and capability of handling high dimensionality is a good candidate, as our classification problem has many input variables and observations. # # Ensemble Methods (AdaBoost) # - Industrial applications of AdaBoost includes document classification and face detection. # - As the strength, AdaBoost is efficient and setting parameters for AdaBoost is easy (Class notes, ESL). As a kind of AdaBoost, boosting tree methods is highly accurate and is capable of handling irrelevant features (Class notes, ESL). # - As the weakness, AdaBoost is sensitive to data’s noise and needs enough data for fitting (Class notes, ESL). # - Our classification problem has enough data and many features, part of which may be irrelevant for fitting. Hence, AdaBoost (Boosting tree) is a good candidate for our problem. # # Reference: # - Class notes. # - Friedman, Jerome, Trevor Hastie, and Robert Tibshirani. The elements of statistical learning. Vol. 1. New York: Springer series in statistics, 2001. (ESL) # - Scikit-Learn User Guide (SLUG), Release 0.20.dev0. # # ### Implementation - Creating a Training and Predicting Pipeline # To properly evaluate the performance of each model you've chosen, it's important that you create a training and predicting pipeline that allows you to quickly and effectively train models using various sizes of training data and perform predictions on the testing data. Your implementation here will be used in the following section. # In the code block below, you will need to implement the following: # - Import `fbeta_score` and `accuracy_score` from [`sklearn.metrics`](http://scikit-learn.org/stable/modules/classes.html#sklearn-metrics-metrics). # - Fit the learner to the sampled training data and record the training time. # - Perform predictions on the test data `X_test`, and also on the first 300 training points `X_train[:300]`. # - Record the total prediction time. # - Calculate the accuracy score for both the training subset and testing set. # - Calculate the F-score for both the training subset and testing set. # - Make sure that you set the `beta` parameter! # In[9]: # TODO: Import two metrics from sklearn - fbeta_score and accuracy_score from sklearn.metrics import fbeta_score from sklearn.metrics import accuracy_score def train_predict(learner, sample_size, X_train, y_train, X_test, y_test): ''' inputs: - learner: the learning algorithm to be trained and predicted on - sample_size: the size of samples (number) to be drawn from training set - X_train: features training set - y_train: income training set - X_test: features testing set - y_test: income testing set ''' results = {} # TODO: Fit the learner to the training data using slicing with 'sample_size' using .fit(training_features[:], training_labels[:]) start = time() # Get start time learner = learner() learner.fit(X_train[0:sample_size],y_train[:sample_size]) end = time() # Get end time # TODO: Calculate the training time results['train_time'] = start - end # TODO: Get the predictions on the test set(X_test), # then get predictions on the first 300 training samples(X_train) using .predict() start = time() # Get start time predictions_test = learner.predict(X_test) predictions_train = learner.predict(X_train[:300]) end = time() # Get end time # TODO: Calculate the total prediction time results['pred_time'] = end - start # TODO: Compute accuracy on the first 300 training samples which is y_train[:300] results['acc_train'] = accuracy_score(y_train[:300],predictions_train) # TODO: Compute accuracy on test set using accuracy_score() results['acc_test'] = accuracy_score(y_test,predictions_test) # TODO: Compute F-score on the the first 300 training samples using fbeta_score() results['f_train'] = fbeta_score(y_train[:300],predictions_train, beta=0.5) # TODO: Compute F-score on the test set which is y_test results['f_test'] = fbeta_score(y_test,predictions_test, beta=0.5) # Success print "{} trained on {} samples.".format(learner.__class__.__name__, sample_size) # Return the results return results # ### Implementation: Initial Model Evaluation # In the code cell, you will need to implement the following: # - Import the three supervised learning models you've discussed in the previous section. # - Initialize the three models and store them in `'clf_A'`, `'clf_B'`, and `'clf_C'`. # - Use a `'random_state'` for each model you use, if provided. # - **Note:** Use the default settings for each model — you will tune one specific model in a later section. # - Calculate the number of records equal to 1%, 10%, and 100% of the training data. # - Store those values in `'samples_1'`, `'samples_10'`, and `'samples_100'` respectively. # # **Note:** Depending on which algorithms you chose, the following implementation may take some time to run! # In[15]: # TODO: Import the three supervised learning models from sklearn from sklearn.naive_bayes import GaussianNB from sklearn import svm from sklearn.ensemble import AdaBoostClassifier # TODO: Initialize the three models clf_A = GaussianNB clf_B = svm.SVC clf_C = AdaBoostClassifier # TODO: Calculate the number of samples for 1%, 10%, and 100% of the training data # HINT: samples_100 is the entire training set i.e. len(y_train) # HINT: samples_10 is 10% of samples_100 # HINT: samples_1 is 1% of samples_100 samples_100 = len(y_train) samples_10 = int(len(y_train) * 0.1) samples_1 = int(len(y_train) * 0.01) # Collect results on the learners results = {} for clf in [clf_A, clf_B, clf_C]: clf_name = clf.__class__.__name__ results[clf_name] = {} for i, samples in enumerate([samples_1, samples_10, samples_100]): results[clf_name][i] = train_predict(clf, samples, X_train, y_train, X_test, y_test) # Run metrics visualization for the three supervised learning models chosen vs.evaluate(results, accuracy, fscore)
leizhipeng/ml
finding_donors/finding_donors.py
Python
gpl-3.0
28,896
[ "Gaussian" ]
e151dcc5e97e0fa227b12b412939254ab7a83dd54774974734bbcf71d9392a5e
#!/usr/bin/env python """ Status of DIRAC components using runsvstat utility Example: $ dirac-status-component DIRAC Root Path = /vo/dirac/versions/Lyon-HEAD-1296215324 Name : Runit Uptime PID WorkloadManagement_PilotStatusAgent : Run 4029 1697 WorkloadManagement_JobHistoryAgent : Run 4029 167 """ from DIRAC.Core.Base.Script import Script @Script() def main(): Script.disableCS() # Registering arguments will automatically add their description to the help menu Script.registerArgument( " System: Name of the system for the component (default *: all)", mandatory=False, default="*" ) Script.registerArgument( ( "Service: Name of the particular component (default *: all)", "Agent: Name of the particular component (default *: all)", ), mandatory=False, default="*", ) _, args = Script.parseCommandLine() system, component = Script.getPositionalArgs(group=True) from DIRAC.FrameworkSystem.Client.ComponentInstaller import gComponentInstaller if len(args) > 2: Script.showHelp(exitCode=1) if len(args) > 0: system = args[0] if system != "*": if len(args) > 1: component = args[1] # gComponentInstaller.exitOnError = True # result = gComponentInstaller.getStartupComponentStatus([system, component]) if not result["OK"]: print("ERROR:", result["Message"]) exit(-1) gComponentInstaller.printStartupStatus(result["Value"]) if __name__ == "__main__": main()
DIRACGrid/DIRAC
src/DIRAC/FrameworkSystem/scripts/dirac_status_component.py
Python
gpl-3.0
1,658
[ "DIRAC" ]
29b3584b21cb66e79534b05b14736797b305e60591d894e27b5dc61fab6521f4
"""Tools for managing evaluation contexts. """ from sympy.utilities.iterables import dict_merge from sympy.core.basic import PicklableWithSlots __known_options__ = set(['frac', 'gens', 'wrt', 'sort', 'order', 'domain', 'modulus', 'gaussian', 'extension', 'field', 'greedy', 'symmetric']) __global_options__ = [] __template__ = """\ def %(option)s(_%(option)s): return Context(%(option)s=_%(option)s) """ for option in __known_options__: exec __template__ % { 'option': option } class Context(PicklableWithSlots): __slots__ = ['__options__'] def __init__(self, dict=None, **options): if dict is not None: self.__options__ = dict_merge(dict, options) else: self.__options__ = options def __getattribute__(self, name): if name in __known_options__: try: return object.__getattribute__(self, '__options__')[name] except KeyError: return None else: return object.__getattribute__(self, name) def __str__(self): return 'Context(%s)' % ', '.join( [ '%s=%r' % (key, value) for key, value in self.__options__.iteritems() ]) def __and__(self, other): if isinstance(other, Context): return Context(**dict_merge(self.__options__, other.__options__)) else: raise TypeError("a context manager expected, got %s" % other) def __enter__(self): raise NotImplementedError('global context') def __exit__(self, exc_type, exc_val, exc_tb): raise NotImplementedError('global context') def register_context(func): def wrapper(self, *args, **kwargs): return func(*args, **dict_merge(self.__options__, kwargs)) wrapper.__doc__ = func.__doc__ wrapper.__name__ = func.__name__ setattr(Context, func.__name__, wrapper) return func
ichuang/sympy
sympy/polys/polycontext.py
Python
bsd-3-clause
1,887
[ "Gaussian" ]
572775101f63dda6e98a6250c509913fd022116b59aa922c1ed6dd23a34c7f93
""" Test courseware search """ import os import json import uuid from ..helpers import remove_file from ...pages.common.logout import LogoutPage from ...pages.studio.overview import CourseOutlinePage from ...pages.lms.courseware_search import CoursewareSearchPage from ...pages.lms.staff_view import StaffPage from ...fixtures.course import XBlockFixtureDesc from nose.plugins.attrib import attr from ..studio.base_studio_test import ContainerBase from ...pages.studio.settings_group_configurations import GroupConfigurationsPage from ...pages.studio.auto_auth import AutoAuthPage as StudioAutoAuthPage from ...fixtures import LMS_BASE_URL from ...pages.studio.component_editor import ComponentVisibilityEditorView from ...pages.lms.instructor_dashboard import InstructorDashboardPage from bok_choy.promise import EmptyPromise @attr('shard_1') class CoursewareSearchCohortTest(ContainerBase): """ Test courseware search. """ USERNAME = 'STUDENT_TESTER' EMAIL = 'student101@example.com' TEST_INDEX_FILENAME = "test_root/index_file.dat" def setUp(self, is_staff=True): """ Create search page and course content to search """ # create test file in which index for this test will live with open(self.TEST_INDEX_FILENAME, "w+") as index_file: json.dump({}, index_file) self.addCleanup(remove_file, self.TEST_INDEX_FILENAME) super(CoursewareSearchCohortTest, self).setUp(is_staff=is_staff) self.staff_user = self.user self.course_outline = CourseOutlinePage( self.browser, self.course_info['org'], self.course_info['number'], self.course_info['run'] ) self.content_group_a = "Content Group A" self.content_group_b = "Content Group B" # Create a student who will be in "Cohort A" self.cohort_a_student_username = "cohort_a_" + str(uuid.uuid4().hex)[:12] self.cohort_a_student_email = self.cohort_a_student_username + "@example.com" StudioAutoAuthPage( self.browser, username=self.cohort_a_student_username, email=self.cohort_a_student_email, no_login=True ).visit() # Create a student who will be in "Cohort B" self.cohort_b_student_username = "cohort_b_" + str(uuid.uuid4().hex)[:12] self.cohort_b_student_email = self.cohort_b_student_username + "@example.com" StudioAutoAuthPage( self.browser, username=self.cohort_b_student_username, email=self.cohort_b_student_email, no_login=True ).visit() self.courseware_search_page = CoursewareSearchPage(self.browser, self.course_id) # Enable Cohorting and assign cohorts and content groups self._auto_auth(self.staff_user["username"], self.staff_user["email"], True) self.enable_cohorting(self.course_fixture) self.create_content_groups() self.link_html_to_content_groups_and_publish() self.create_cohorts_and_assign_students() self._studio_reindex() def _auto_auth(self, username, email, staff): """ Logout and login with given credentials. """ LogoutPage(self.browser).visit() StudioAutoAuthPage(self.browser, username=username, email=email, course_id=self.course_id, staff=staff).visit() def _studio_reindex(self): """ Reindex course content on studio course page """ self._auto_auth(self.staff_user["username"], self.staff_user["email"], True) self.course_outline.visit() self.course_outline.start_reindex() self.course_outline.wait_for_ajax() def _goto_staff_page(self): """ Open staff page with assertion """ self.courseware_search_page.visit() staff_page = StaffPage(self.browser, self.course_id) self.assertEqual(staff_page.staff_view_mode, 'Staff') return staff_page def populate_course_fixture(self, course_fixture): """ Populate the children of the test course fixture. """ self.group_a_html = 'GROUPACONTENT' self.group_b_html = 'GROUPBCONTENT' self.group_a_and_b_html = 'GROUPAANDBCONTENT' self.visible_to_all_html = 'VISIBLETOALLCONTENT' course_fixture.add_children( XBlockFixtureDesc('chapter', 'Test Section').add_children( XBlockFixtureDesc('sequential', 'Test Subsection').add_children( XBlockFixtureDesc('vertical', 'Test Unit').add_children( XBlockFixtureDesc('html', self.group_a_html, data='<html>GROUPACONTENT</html>'), XBlockFixtureDesc('html', self.group_b_html, data='<html>GROUPBCONTENT</html>'), XBlockFixtureDesc('html', self.group_a_and_b_html, data='<html>GROUPAANDBCONTENT</html>'), XBlockFixtureDesc('html', self.visible_to_all_html, data='<html>VISIBLETOALLCONTENT</html>') ) ) ) ) def enable_cohorting(self, course_fixture): """ Enables cohorting for the current course. """ url = LMS_BASE_URL + "/courses/" + course_fixture._course_key + '/cohorts/settings' # pylint: disable=protected-access data = json.dumps({'is_cohorted': True}) response = course_fixture.session.patch(url, data=data, headers=course_fixture.headers) self.assertTrue(response.ok, "Failed to enable cohorts") def create_content_groups(self): """ Creates two content groups in Studio Group Configurations Settings. """ group_configurations_page = GroupConfigurationsPage( self.browser, self.course_info['org'], self.course_info['number'], self.course_info['run'] ) group_configurations_page.visit() group_configurations_page.create_first_content_group() config = group_configurations_page.content_groups[0] config.name = self.content_group_a config.save() group_configurations_page.add_content_group() config = group_configurations_page.content_groups[1] config.name = self.content_group_b config.save() def link_html_to_content_groups_and_publish(self): """ Updates 3 of the 4 existing html to limit their visibility by content group. Publishes the modified units. """ container_page = self.go_to_unit_page() def set_visibility(html_block_index, content_group, second_content_group=None): """ Set visibility on html blocks to specified groups. """ html_block = container_page.xblocks[html_block_index] html_block.edit_visibility() if second_content_group: ComponentVisibilityEditorView(self.browser, html_block.locator).select_option( second_content_group, save=False ) ComponentVisibilityEditorView(self.browser, html_block.locator).select_option(content_group) set_visibility(1, self.content_group_a) set_visibility(2, self.content_group_b) set_visibility(3, self.content_group_a, self.content_group_b) container_page.publish_action.click() def create_cohorts_and_assign_students(self): """ Adds 2 manual cohorts, linked to content groups, to the course. Each cohort is assigned one student. """ instructor_dashboard_page = InstructorDashboardPage(self.browser, self.course_id) instructor_dashboard_page.visit() cohort_management_page = instructor_dashboard_page.select_cohort_management() def add_cohort_with_student(cohort_name, content_group, student): """ Create cohort and assign student to it. """ cohort_management_page.add_cohort(cohort_name, content_group=content_group) # After adding the cohort, it should automatically be selected EmptyPromise( lambda: cohort_name == cohort_management_page.get_selected_cohort(), "Waiting for new cohort" ).fulfill() cohort_management_page.add_students_to_selected_cohort([student]) add_cohort_with_student("Cohort A", self.content_group_a, self.cohort_a_student_username) add_cohort_with_student("Cohort B", self.content_group_b, self.cohort_b_student_username) cohort_management_page.wait_for_ajax() def test_page_existence(self): """ Make sure that the page is accessible. """ self._auto_auth(self.USERNAME, self.EMAIL, False) self.courseware_search_page.visit() def test_cohorted_search_user_a_a_content(self): """ Test user can search content restricted to his cohort. """ self._auto_auth(self.cohort_a_student_username, self.cohort_a_student_email, False) self.courseware_search_page.visit() self.courseware_search_page.search_for_term(self.group_a_html) assert self.group_a_html in self.courseware_search_page.search_results.html[0] def test_cohorted_search_user_b_a_content(self): """ Test user can not search content restricted to his cohort. """ self._auto_auth(self.cohort_b_student_username, self.cohort_b_student_email, False) self.courseware_search_page.visit() self.courseware_search_page.search_for_term(self.group_a_html) assert self.group_a_html not in self.courseware_search_page.search_results.html[0] def test_cohorted_search_user_c_ab_content(self): """ Test user not enrolled in any cohorts can't see any of restricted content. """ self._auto_auth(self.USERNAME, self.EMAIL, False) self.courseware_search_page.visit() self.courseware_search_page.search_for_term(self.group_a_and_b_html) assert self.group_a_and_b_html not in self.courseware_search_page.search_results.html[0] def test_cohorted_search_user_c_all_content(self): """ Test user can search public content if cohorts used on course. """ self._auto_auth(self.USERNAME, self.EMAIL, False) self.courseware_search_page.visit() self.courseware_search_page.search_for_term(self.visible_to_all_html) assert self.visible_to_all_html in self.courseware_search_page.search_results.html[0] def test_cohorted_search_user_staff_all_content(self): """ Test staff user can search all public content if cohorts used on course. """ self._auto_auth(self.staff_user["username"], self.staff_user["email"], False) self._goto_staff_page().set_staff_view_mode('Staff') self.courseware_search_page.search_for_term(self.visible_to_all_html) assert self.visible_to_all_html in self.courseware_search_page.search_results.html[0] self.courseware_search_page.clear_search() self.courseware_search_page.search_for_term(self.group_a_and_b_html) assert self.group_a_and_b_html in self.courseware_search_page.search_results.html[0] self.courseware_search_page.clear_search() self.courseware_search_page.search_for_term(self.group_a_html) assert self.group_a_html in self.courseware_search_page.search_results.html[0] self.courseware_search_page.clear_search() self.courseware_search_page.search_for_term(self.group_b_html) assert self.group_b_html in self.courseware_search_page.search_results.html[0] def test_cohorted_search_user_staff_masquerade_student_content(self): """ Test staff user can search just student public content if selected from preview menu. """ self._auto_auth(self.staff_user["username"], self.staff_user["email"], False) self._goto_staff_page().set_staff_view_mode('Student') self.courseware_search_page.search_for_term(self.visible_to_all_html) assert self.visible_to_all_html in self.courseware_search_page.search_results.html[0] self.courseware_search_page.clear_search() self.courseware_search_page.search_for_term(self.group_a_and_b_html) assert self.group_a_and_b_html not in self.courseware_search_page.search_results.html[0] self.courseware_search_page.clear_search() self.courseware_search_page.search_for_term(self.group_a_html) assert self.group_a_html not in self.courseware_search_page.search_results.html[0] self.courseware_search_page.clear_search() self.courseware_search_page.search_for_term(self.group_b_html) assert self.group_b_html not in self.courseware_search_page.search_results.html[0] def test_cohorted_search_user_staff_masquerade_cohort_content(self): """ Test staff user can search cohort and public content if selected from preview menu. """ self._auto_auth(self.staff_user["username"], self.staff_user["email"], False) self._goto_staff_page().set_staff_view_mode('Student in ' + self.content_group_a) self.courseware_search_page.search_for_term(self.visible_to_all_html) assert self.visible_to_all_html in self.courseware_search_page.search_results.html[0] self.courseware_search_page.clear_search() self.courseware_search_page.search_for_term(self.group_a_and_b_html) assert self.group_a_and_b_html in self.courseware_search_page.search_results.html[0] self.courseware_search_page.clear_search() self.courseware_search_page.search_for_term(self.group_a_html) assert self.group_a_html in self.courseware_search_page.search_results.html[0] self.courseware_search_page.clear_search() self.courseware_search_page.search_for_term(self.group_b_html) assert self.group_b_html not in self.courseware_search_page.search_results.html[0]
adoosii/edx-platform
common/test/acceptance/tests/lms/test_lms_cohorted_courseware_search.py
Python
agpl-3.0
14,005
[ "VisIt" ]
def31e25c0e12a2341aab74d216cf95442d9ed0e2e450c8f353d9a464142d9c4
""" sphinx.ext.apidoc ~~~~~~~~~~~~~~~~~ Parses a directory tree looking for Python modules and packages and creates ReST files appropriately to create code documentation with Sphinx. It also creates a modules index (named modules.<suffix>). This is derived from the "sphinx-autopackage" script, which is: Copyright 2008 Société des arts technologiques (SAT), https://sat.qc.ca/ :copyright: Copyright 2007-2019 by the Sphinx team, see AUTHORS. :license: BSD, see LICENSE for details. """ import argparse import glob import locale import os import sys from fnmatch import fnmatch from os import path import sphinx.locale from sphinx import __display_version__, package_dir from sphinx.cmd.quickstart import EXTENSIONS from sphinx.locale import __ from sphinx.util import rst from sphinx.util.osutil import FileAvoidWrite, ensuredir if False: # For type annotation from typing import Any, List, Tuple # NOQA # automodule options if 'SPHINX_APIDOC_OPTIONS' in os.environ: OPTIONS = os.environ['SPHINX_APIDOC_OPTIONS'].split(',') else: OPTIONS = [ 'members', 'undoc-members', # 'inherited-members', # disabled because there's a bug in sphinx 'show-inheritance', ] INITPY = '__init__.py' PY_SUFFIXES = {'.py', '.pyx'} def makename(package, module): # type: (str, str) -> str """Join package and module with a dot.""" # Both package and module can be None/empty. if package: name = package if module: name += '.' + module else: name = module return name def write_file(name, text, opts): # type: (str, str, Any) -> None """Write the output file for module/package <name>.""" fname = path.join(opts.destdir, '%s.%s' % (name, opts.suffix)) if opts.dryrun: print(__('Would create file %s.') % fname) return if not opts.force and path.isfile(fname): print(__('File %s already exists, skipping.') % fname) else: print(__('Creating file %s.') % fname) with FileAvoidWrite(fname) as f: f.write(text) def format_heading(level, text, escape=True): # type: (int, str, bool) -> str """Create a heading of <level> [1, 2 or 3 supported].""" if escape: text = rst.escape(text) underlining = ['=', '-', '~', ][level - 1] * len(text) return '%s\n%s\n\n' % (text, underlining) def format_directive(module, package=None): # type: (str, str) -> str """Create the automodule directive and add the options.""" directive = '.. automodule:: %s\n' % makename(package, module) for option in OPTIONS: directive += ' :%s:\n' % option return directive def create_module_file(package, module, opts): # type: (str, str, Any) -> None """Build the text of the file and write the file.""" if not opts.noheadings: text = format_heading(1, '%s module' % module) else: text = '' # text += format_heading(2, ':mod:`%s` Module' % module) text += format_directive(module, package) write_file(makename(package, module), text, opts) def create_package_file(root, master_package, subroot, py_files, opts, subs, is_namespace, excludes=[]): # NOQA # type: (str, str, str, List[str], Any, List[str], bool, List[str]) -> None """Build the text of the file and write the file.""" text = format_heading(1, ('%s package' if not is_namespace else "%s namespace") % makename(master_package, subroot)) if opts.modulefirst and not is_namespace: text += format_directive(subroot, master_package) text += '\n' # build a list of directories that are szvpackages (contain an INITPY file) # and also checks the INITPY file is not empty, or there are other python # source files in that folder. # (depending on settings - but shall_skip() takes care of that) subs = [sub for sub in subs if not shall_skip(path.join(root, sub, INITPY), opts, excludes)] # if there are some package directories, add a TOC for theses subpackages if subs: text += format_heading(2, 'Subpackages') text += '.. toctree::\n\n' for sub in subs: text += ' %s.%s\n' % (makename(master_package, subroot), sub) text += '\n' submods = [path.splitext(sub)[0] for sub in py_files if not shall_skip(path.join(root, sub), opts, excludes) and sub != INITPY] if submods: text += format_heading(2, 'Submodules') if opts.separatemodules: text += '.. toctree::\n\n' for submod in submods: modfile = makename(master_package, makename(subroot, submod)) text += ' %s\n' % modfile # generate separate file for this module if not opts.noheadings: filetext = format_heading(1, '%s module' % modfile) else: filetext = '' filetext += format_directive(makename(subroot, submod), master_package) write_file(modfile, filetext, opts) else: for submod in submods: modfile = makename(master_package, makename(subroot, submod)) if not opts.noheadings: text += format_heading(2, '%s module' % modfile) text += format_directive(makename(subroot, submod), master_package) text += '\n' text += '\n' if not opts.modulefirst and not is_namespace: text += format_heading(2, 'Module contents') text += format_directive(subroot, master_package) write_file(makename(master_package, subroot), text, opts) def create_modules_toc_file(modules, opts, name='modules'): # type: (List[str], Any, str) -> None """Create the module's index.""" text = format_heading(1, '%s' % opts.header, escape=False) text += '.. toctree::\n' text += ' :maxdepth: %s\n\n' % opts.maxdepth modules.sort() prev_module = '' for module in modules: # look if the module is a subpackage and, if yes, ignore it if module.startswith(prev_module + '.'): continue prev_module = module text += ' %s\n' % module write_file(name, text, opts) def shall_skip(module, opts, excludes=[]): # type: (str, Any, List[str]) -> bool """Check if we want to skip this module.""" # skip if the file doesn't exist and not using implicit namespaces if not opts.implicit_namespaces and not path.exists(module): return True # Are we a package (here defined as __init__.py, not the folder in itself) if os.path.basename(module) == INITPY: # Yes, check if we have any non-excluded modules at all here all_skipped = True basemodule = path.dirname(module) for submodule in glob.glob(path.join(basemodule, '*.py')): if not is_excluded(path.join(basemodule, submodule), excludes): # There's a non-excluded module here, we won't skip all_skipped = False if all_skipped: return True # skip if it has a "private" name and this is selected filename = path.basename(module) if filename != '__init__.py' and filename.startswith('_') and \ not opts.includeprivate: return True return False def recurse_tree(rootpath, excludes, opts): # type: (str, List[str], Any) -> List[str] """ Look for every file in the directory tree and create the corresponding ReST files. """ followlinks = getattr(opts, 'followlinks', False) includeprivate = getattr(opts, 'includeprivate', False) implicit_namespaces = getattr(opts, 'implicit_namespaces', False) # check if the base directory is a package and get its name if INITPY in os.listdir(rootpath) or implicit_namespaces: root_package = rootpath.split(path.sep)[-1] else: # otherwise, the base is a directory with packages root_package = None toplevels = [] for root, subs, files in os.walk(rootpath, followlinks=followlinks): # document only Python module files (that aren't excluded) py_files = sorted(f for f in files if path.splitext(f)[1] in PY_SUFFIXES and not is_excluded(path.join(root, f), excludes)) is_pkg = INITPY in py_files is_namespace = INITPY not in py_files and implicit_namespaces if is_pkg: py_files.remove(INITPY) py_files.insert(0, INITPY) elif root != rootpath: # only accept non-package at toplevel unless using implicit namespaces if not implicit_namespaces: del subs[:] continue # remove hidden ('.') and private ('_') directories, as well as # excluded dirs if includeprivate: exclude_prefixes = ('.',) # type: Tuple[str, ...] else: exclude_prefixes = ('.', '_') subs[:] = sorted(sub for sub in subs if not sub.startswith(exclude_prefixes) and not is_excluded(path.join(root, sub), excludes)) if is_pkg or is_namespace: # we are in a package with something to document if subs or len(py_files) > 1 or not shall_skip(path.join(root, INITPY), opts): subpackage = root[len(rootpath):].lstrip(path.sep).\ replace(path.sep, '.') # if this is not a namespace or # a namespace and there is something there to document if not is_namespace or len(py_files) > 0: create_package_file(root, root_package, subpackage, py_files, opts, subs, is_namespace, excludes) toplevels.append(makename(root_package, subpackage)) else: # if we are at the root level, we don't require it to be a package assert root == rootpath and root_package is None for py_file in py_files: if not shall_skip(path.join(rootpath, py_file), opts): module = path.splitext(py_file)[0] create_module_file(root_package, module, opts) toplevels.append(module) return toplevels def is_excluded(root, excludes): # type: (str, List[str]) -> bool """Check if the directory is in the exclude list. Note: by having trailing slashes, we avoid common prefix issues, like e.g. an exclude "foo" also accidentally excluding "foobar". """ for exclude in excludes: if fnmatch(root, exclude): return True return False def get_parser(): # type: () -> argparse.ArgumentParser parser = argparse.ArgumentParser( usage='%(prog)s [OPTIONS] -o <OUTPUT_PATH> <MODULE_PATH> ' '[EXCLUDE_PATTERN, ...]', epilog=__('For more information, visit <http://sphinx-doc.org/>.'), description=__(""" Look recursively in <MODULE_PATH> for Python modules and packages and create one reST file with automodule directives per package in the <OUTPUT_PATH>. The <EXCLUDE_PATTERN>s can be file and/or directory patterns that will be excluded from generation. Note: By default this script will not overwrite already created files.""")) parser.add_argument('--version', action='version', dest='show_version', version='%%(prog)s %s' % __display_version__) parser.add_argument('module_path', help=__('path to module to document')) parser.add_argument('exclude_pattern', nargs='*', help=__('fnmatch-style file and/or directory patterns ' 'to exclude from generation')) parser.add_argument('-o', '--output-dir', action='store', dest='destdir', required=True, help=__('directory to place all output')) parser.add_argument('-d', '--maxdepth', action='store', dest='maxdepth', type=int, default=4, help=__('maximum depth of submodules to show in the TOC ' '(default: 4)')) parser.add_argument('-f', '--force', action='store_true', dest='force', help=__('overwrite existing files')) parser.add_argument('-l', '--follow-links', action='store_true', dest='followlinks', default=False, help=__('follow symbolic links. Powerful when combined ' 'with collective.recipe.omelette.')) parser.add_argument('-n', '--dry-run', action='store_true', dest='dryrun', help=__('run the script without creating files')) parser.add_argument('-e', '--separate', action='store_true', dest='separatemodules', help=__('put documentation for each module on its own page')) parser.add_argument('-P', '--private', action='store_true', dest='includeprivate', help=__('include "_private" modules')) parser.add_argument('--tocfile', action='store', dest='tocfile', default='modules', help=__("filename of table of contents (default: modules)")) parser.add_argument('-T', '--no-toc', action='store_false', dest='tocfile', help=__("don't create a table of contents file")) parser.add_argument('-E', '--no-headings', action='store_true', dest='noheadings', help=__("don't create headings for the module/package " "packages (e.g. when the docstrings already " "contain them)")) parser.add_argument('-M', '--module-first', action='store_true', dest='modulefirst', help=__('put module documentation before submodule ' 'documentation')) parser.add_argument('--implicit-namespaces', action='store_true', dest='implicit_namespaces', help=__('interpret module paths according to PEP-0420 ' 'implicit namespaces specification')) parser.add_argument('-s', '--suffix', action='store', dest='suffix', default='rst', help=__('file suffix (default: rst)')) parser.add_argument('-F', '--full', action='store_true', dest='full', help=__('generate a full project with sphinx-quickstart')) parser.add_argument('-a', '--append-syspath', action='store_true', dest='append_syspath', help=__('append module_path to sys.path, used when --full is given')) parser.add_argument('-H', '--doc-project', action='store', dest='header', help=__('project name (default: root module name)')) parser.add_argument('-A', '--doc-author', action='store', dest='author', help=__('project author(s), used when --full is given')) parser.add_argument('-V', '--doc-version', action='store', dest='version', help=__('project version, used when --full is given')) parser.add_argument('-R', '--doc-release', action='store', dest='release', help=__('project release, used when --full is given, ' 'defaults to --doc-version')) group = parser.add_argument_group(__('extension options')) group.add_argument('--extensions', metavar='EXTENSIONS', dest='extensions', action='append', help=__('enable arbitrary extensions')) for ext in EXTENSIONS: group.add_argument('--ext-%s' % ext, action='append_const', const='sphinx.ext.%s' % ext, dest='extensions', help=__('enable %s extension') % ext) return parser def main(argv=sys.argv[1:]): # type: (List[str]) -> int """Parse and check the command line arguments.""" sphinx.locale.setlocale(locale.LC_ALL, '') sphinx.locale.init_console(os.path.join(package_dir, 'locale'), 'sphinx') parser = get_parser() args = parser.parse_args(argv) rootpath = path.abspath(args.module_path) # normalize opts if args.header is None: args.header = rootpath.split(path.sep)[-1] if args.suffix.startswith('.'): args.suffix = args.suffix[1:] if not path.isdir(rootpath): print(__('%s is not a directory.') % rootpath, file=sys.stderr) sys.exit(1) if not args.dryrun: ensuredir(args.destdir) excludes = [path.abspath(exclude) for exclude in args.exclude_pattern] modules = recurse_tree(rootpath, excludes, args) if args.full: from sphinx.cmd import quickstart as qs modules.sort() prev_module = '' text = '' for module in modules: if module.startswith(prev_module + '.'): continue prev_module = module text += ' %s\n' % module d = { 'path': args.destdir, 'sep': False, 'dot': '_', 'project': args.header, 'author': args.author or 'Author', 'version': args.version or '', 'release': args.release or args.version or '', 'suffix': '.' + args.suffix, 'master': 'index', 'epub': True, 'extensions': ['sphinx.ext.autodoc', 'sphinx.ext.viewcode', 'sphinx.ext.todo'], 'makefile': True, 'batchfile': True, 'make_mode': True, 'mastertocmaxdepth': args.maxdepth, 'mastertoctree': text, 'language': 'en', 'module_path': rootpath, 'append_syspath': args.append_syspath, } if args.extensions: d['extensions'].extend(args.extensions) for ext in d['extensions'][:]: if ',' in ext: d['extensions'].remove(ext) d['extensions'].extend(ext.split(',')) if not args.dryrun: qs.generate(d, silent=True, overwrite=args.force) elif args.tocfile: create_modules_toc_file(modules, args, args.tocfile) return 0 # So program can be started with "python -m sphinx.apidoc ..." if __name__ == "__main__": main()
lmregus/Portfolio
python/design_patterns/env/lib/python3.7/site-packages/sphinx/ext/apidoc.py
Python
mit
18,689
[ "VisIt" ]
1dab6220b857421526a7594b43faaf3c03ab8a5a3cd6c3539c067f09c9c283d6
# coding: utf-8 # Copyright (c) Pymatgen Development Team. # Distributed under the terms of the MIT License. from __future__ import division, unicode_literals import re import csv import collections import itertools from io import open import math from six.moves import zip import warnings from monty.json import MSONable, MontyDecoder from monty.string import unicode2str from monty.functools import lru_cache from monty.dev import deprecated import numpy as np from scipy.spatial import ConvexHull from pymatgen.core.composition import Composition from pymatgen.core.periodic_table import Element, DummySpecie, get_el_sp from pymatgen.util.coord import Simplex, in_coord_list from pymatgen.util.string import latexify from pymatgen.util.plotting import pretty_plot from pymatgen.analysis.reaction_calculator import Reaction, \ ReactionError """ This module defines tools to generate and analyze phase diagrams. """ __author__ = "Shyue Ping Ong" __copyright__ = "Copyright 2011, The Materials Project" __version__ = "1.0" __maintainer__ = "Shyue Ping Ong" __email__ = "shyuep@gmail.com" __status__ = "Production" __date__ = "May 16, 2011" class PDEntry(MSONable): """ An object encompassing all relevant data for phase diagrams. .. attribute:: name A name for the entry. This is the string shown in the phase diagrams. By default, this is the reduced formula for the composition, but can be set to some other string for display purposes. Args: comp: Composition as a pymatgen.core.structure.Composition energy: Energy for composition. name: Optional parameter to name the entry. Defaults to the reduced chemical formula. attribute: Optional attribute of the entry. This can be used to specify that the entry is a newly found compound, or to specify a particular label for the entry, or else ... Used for further analysis and plotting purposes. An attribute can be anything but must be MSONable. """ def __init__(self, composition, energy, name=None, attribute=None): self.energy = energy self.composition = Composition(composition) self.name = name if name else self.composition.reduced_formula self.attribute = attribute @property def energy_per_atom(self): """ Returns the final energy per atom. """ return self.energy / self.composition.num_atoms @property def is_element(self): """ True if the entry is an element. """ return self.composition.is_element def __repr__(self): return "PDEntry : {} with energy = {:.4f}".format(self.composition, self.energy) def __str__(self): return self.__repr__() def as_dict(self): return {"@module": self.__class__.__module__, "@class": self.__class__.__name__, "composition": self.composition.as_dict(), "energy": self.energy, "name": self.name, "attribute": self.attribute} def __eq__(self, other): if isinstance(other, self.__class__): return self.as_dict() == other.as_dict() else: return False def __hash__(self): return id(self) @classmethod def from_dict(cls, d): return cls(Composition(d["composition"]), d["energy"], d["name"] if "name" in d else None, d["attribute"] if "attribute" in d else None) @staticmethod def to_csv(filename, entries, latexify_names=False): """ Exports PDEntries to a csv Args: filename: Filename to write to. entries: PDEntries to export. latexify_names: Format entry names to be LaTex compatible, e.g., Li_{2}O """ elements = set() for entry in entries: elements.update(entry.composition.elements) elements = sorted(list(elements), key=lambda a: a.X) writer = csv.writer(open(filename, "wb"), delimiter=unicode2str(","), quotechar=unicode2str("\""), quoting=csv.QUOTE_MINIMAL) writer.writerow(["Name"] + elements + ["Energy"]) for entry in entries: row = [entry.name if not latexify_names else re.sub(r"([0-9]+)", r"_{\1}", entry.name)] row.extend([entry.composition[el] for el in elements]) row.append(entry.energy) writer.writerow(row) @staticmethod def from_csv(filename): """ Imports PDEntries from a csv. Args: filename: Filename to import from. Returns: List of Elements, List of PDEntries """ with open(filename, "r", encoding="utf-8") as f: reader = csv.reader(f, delimiter=unicode2str(","), quotechar=unicode2str("\""), quoting=csv.QUOTE_MINIMAL) entries = list() header_read = False for row in reader: if not header_read: elements = row[1:(len(row) - 1)] header_read = True else: name = row[0] energy = float(row[-1]) comp = dict() for ind in range(1, len(row) - 1): if float(row[ind]) > 0: comp[Element(elements[ind - 1])] = float(row[ind]) entries.append(PDEntry(Composition(comp), energy, name)) elements = [Element(el) for el in elements] return elements, entries class GrandPotPDEntry(PDEntry): """ A grand potential pd entry object encompassing all relevant data for phase diagrams. Chemical potentials are given as a element-chemical potential dict. Args: entry: A PDEntry-like object. chempots: Chemical potential specification as {Element: float}. name: Optional parameter to name the entry. Defaults to the reduced chemical formula of the original entry. """ def __init__(self, entry, chempots, name=None): comp = entry.composition self.original_entry = entry self.original_comp = comp grandpot = entry.energy - sum([comp[el] * pot for el, pot in chempots.items()]) self.chempots = chempots new_comp_map = {el: comp[el] for el in comp.elements if el not in chempots} super(GrandPotPDEntry, self).__init__(new_comp_map, grandpot, entry.name) self.name = name if name else entry.name @property def is_element(self): """ True if the entry is an element. """ return self.original_comp.is_element def __repr__(self): chempot_str = " ".join(["mu_%s = %.4f" % (el, mu) for el, mu in self.chempots.items()]) return "GrandPotPDEntry with original composition " + \ "{}, energy = {:.4f}, {}".format(self.original_entry.composition, self.original_entry.energy, chempot_str) def __str__(self): return self.__repr__() def as_dict(self): return {"@module": self.__class__.__module__, "@class": self.__class__.__name__, "entry": self.original_entry.as_dict(), "chempots": {el.symbol: u for el, u in self.chempots.items()}, "name": self.name} @classmethod def from_dict(cls, d): chempots = {Element(symbol): u for symbol, u in d["chempots"].items()} entry = MontyDecoder().process_decoded(d["entry"]) return cls(entry, chempots, d["name"]) def __getattr__(self, a): """ Delegate attribute to original entry if available. """ if hasattr(self.original_entry, a): return getattr(self.original_entry, a) raise AttributeError(a) class TransformedPDEntry(PDEntry): """ This class repesents a TransformedPDEntry, which allows for a PDEntry to be transformed to a different composition coordinate space. It is used in the construction of phase diagrams that do not have elements as the terminal compositions. Args: comp: Transformed composition as a Composition. energy: Energy for composition. original_entry: Original entry that this entry arose from. """ def __init__(self, comp, original_entry): super(TransformedPDEntry, self).__init__(comp, original_entry.energy) self.original_entry = original_entry self.name = original_entry.name def __getattr__(self, a): """ Delegate attribute to original entry if available. """ if hasattr(self.original_entry, a): return getattr(self.original_entry, a) raise AttributeError(a) def __repr__(self): output = ["TransformedPDEntry {}".format(self.composition), " with original composition {}" .format(self.original_entry.composition), ", E = {:.4f}".format(self.original_entry.energy)] return "".join(output) def __str__(self): return self.__repr__() def as_dict(self): return {"@module": self.__class__.__module__, "@class": self.__class__.__name__, "entry": self.original_entry.as_dict(), "composition": self.composition} @classmethod def from_dict(cls, d): entry = MontyDecoder().process_decoded(d["entry"]) return cls(d["composition"], entry) class PhaseDiagram(MSONable): """ Simple phase diagram class taking in elements and entries as inputs. The algorithm is based on the work in the following papers: 1. S. P. Ong, L. Wang, B. Kang, and G. Ceder, Li-Fe-P-O2 Phase Diagram from First Principles Calculations. Chem. Mater., 2008, 20(5), 1798-1807. doi:10.1021/cm702327g 2. S. P. Ong, A. Jain, G. Hautier, B. Kang, G. Ceder, Thermal stabilities of delithiated olivine MPO4 (M=Fe, Mn) cathodes investigated using first principles calculations. Electrochem. Comm., 2010, 12(3), 427-430. doi:10.1016/j.elecom.2010.01.010 .. attribute: elements: Elements in the phase diagram. ..attribute: all_entries All entries provided for Phase Diagram construction. Note that this does not mean that all these entries are actually used in the phase diagram. For example, this includes the positive formation energy entries that are filtered out before Phase Diagram construction. .. attribute: qhull_data Data used in the convex hull operation. This is essentially a matrix of composition data and energy per atom values created from qhull_entries. .. attribute: qhull_entries: Actual entries used in convex hull. Excludes all positive formation energy entries. .. attribute: dim The dimensionality of the phase diagram. .. attribute: facets Facets of the phase diagram in the form of [[1,2,3],[4,5,6]...]. For a ternary, it is the indices (references to qhull_entries and qhull_data) for the vertices of the phase triangles. Similarly extended to higher D simplices for higher dimensions. .. attribute: el_refs: List of elemental references for the phase diagrams. These are entries corresponding to the lowest energy element entries for simple compositional phase diagrams. .. attribute: simplices: The simplices of the phase diagram as a list of np.ndarray, i.e., the list of stable compositional coordinates in the phase diagram. """ # Tolerance for determining if formation energy is positive. formation_energy_tol = 1e-11 numerical_tol = 1e-8 def __init__(self, entries, elements=None): """ Standard constructor for phase diagram. Args: entries ([PDEntry]): A list of PDEntry-like objects having an energy, energy_per_atom and composition. elements ([Element]): Optional list of elements in the phase diagram. If set to None, the elements are determined from the the entries themselves. """ if elements is None: elements = set() for entry in entries: elements.update(entry.composition.elements) elements = list(elements) dim = len(elements) get_reduced_comp = lambda e: e.composition.reduced_composition entries = sorted(entries, key=get_reduced_comp) el_refs = {} min_entries = [] all_entries = [] for c, g in itertools.groupby(entries, key=get_reduced_comp): g = list(g) min_entry = min(g, key=lambda e: e.energy_per_atom) if c.is_element: el_refs[c.elements[0]] = min_entry min_entries.append(min_entry) all_entries.extend(g) if len(el_refs) != dim: raise PhaseDiagramError( "There are no entries associated with a terminal element!.") data = np.array([ [e.composition.get_atomic_fraction(el) for el in elements] + [ e.energy_per_atom] for e in min_entries ]) # Use only entries with negative formation energy vec = [el_refs[el].energy_per_atom for el in elements] + [-1] form_e = -np.dot(data, vec) inds = np.where(form_e < -self.formation_energy_tol)[0].tolist() # Add the elemental references inds.extend([min_entries.index(el) for el in el_refs.values()]) qhull_entries = [min_entries[i] for i in inds] qhull_data = data[inds][:, 1:] # Add an extra point to enforce full dimensionality. # This point will be present in all upper hull facets. extra_point = np.zeros(dim) + 1 / dim extra_point[-1] = np.max(qhull_data) + 1 qhull_data = np.concatenate([qhull_data, [extra_point]], axis=0) if dim == 1: self.facets = [qhull_data.argmin(axis=0)] else: facets = get_facets(qhull_data) finalfacets = [] for facet in facets: # Skip facets that include the extra point if max(facet) == len(qhull_data) - 1: continue m = qhull_data[facet] m[:, -1] = 1 if abs(np.linalg.det(m)) > 1e-14: finalfacets.append(facet) self.facets = finalfacets self.simplexes = [Simplex(qhull_data[f, :-1]) for f in self.facets] self.all_entries = all_entries self.qhull_data = qhull_data self.dim = dim self.el_refs = el_refs self.elements = elements self.qhull_entries = qhull_entries self._stable_entries = set(self.qhull_entries[i] for i in set(itertools.chain(*self.facets))) def pd_coords(self, comp): """ The phase diagram is generated in a reduced dimensional space (n_elements - 1). This function returns the coordinates in that space. These coordinates are compatible with the stored simplex objects. """ if set(comp.elements).difference(self.elements): raise ValueError('{} has elements not in the phase diagram {}' ''.format(comp, self.elements)) return np.array( [comp.get_atomic_fraction(el) for el in self.elements[1:]]) @property def all_entries_hulldata(self): data = [] for entry in self.all_entries: comp = entry.composition row = [comp.get_atomic_fraction(el) for el in self.elements] row.append(entry.energy_per_atom) data.append(row) return np.array(data)[:, 1:] @property def unstable_entries(self): """ Entries that are unstable in the phase diagram. Includes positive formation energy entries. """ return [e for e in self.all_entries if e not in self.stable_entries] @property def stable_entries(self): """ Returns the stable entries in the phase diagram. """ return self._stable_entries def get_form_energy(self, entry): """ Returns the formation energy for an entry (NOT normalized) from the elemental references. Args: entry: A PDEntry-like object. Returns: Formation energy from the elemental references. """ c = entry.composition return entry.energy - sum([c[el] * self.el_refs[el].energy_per_atom for el in c.elements]) def get_form_energy_per_atom(self, entry): """ Returns the formation energy per atom for an entry from the elemental references. Args: entry: An PDEntry-like object Returns: Formation energy **per atom** from the elemental references. """ return self.get_form_energy(entry) / entry.composition.num_atoms def __repr__(self): return self.__str__() def __str__(self): symbols = [el.symbol for el in self.elements] output = ["{} phase diagram".format("-".join(symbols)), "{} stable phases: ".format(len(self.stable_entries)), ", ".join([entry.name for entry in self.stable_entries])] return "\n".join(output) def as_dict(self): return {"@module": self.__class__.__module__, "@class": self.__class__.__name__, "all_entries": [e.as_dict() for e in self.all_entries], "elements": [e.as_dict() for e in self.elements]} @classmethod def from_dict(cls, d): entries = [PDEntry.from_dict(dd) for dd in d["all_entries"]] elements = [Element.from_dict(dd) for dd in d["elements"]] return cls(entries, elements) @lru_cache(1) def _get_facet_and_simplex(self, comp): """ Get any facet that a composition falls into. Cached so successive calls at same composition are fast. """ c = self.pd_coords(comp) for f, s in zip(self.facets, self.simplexes): if s.in_simplex(c, PhaseDiagram.numerical_tol / 10): return f, s raise RuntimeError("No facet found for comp = {}".format(comp)) def _get_facet_chempots(self, facet): """ Calculates the chemical potentials for each element within a facet. Args: facet: Facet of the phase diagram. Returns: { element: chempot } for all elements in the phase diagram. """ complist = [self.qhull_entries[i].composition for i in facet] energylist = [self.qhull_entries[i].energy_per_atom for i in facet] m = [[c.get_atomic_fraction(e) for e in self.elements] for c in complist] chempots = np.linalg.solve(m, energylist) return dict(zip(self.elements, chempots)) def get_decomposition(self, comp): """ Provides the decomposition at a particular composition. Args: comp: A composition Returns: Decomposition as a dict of {Entry: amount} """ facet, simplex = self._get_facet_and_simplex(comp) decomp_amts = simplex.bary_coords(self.pd_coords(comp)) return {self.qhull_entries[f]: amt for f, amt in zip(facet, decomp_amts) if abs(amt) > PhaseDiagram.numerical_tol} def get_hull_energy(self, comp): """ Args: comp (Composition): Input composition Returns: Energy of lowest energy equilibrium at desired composition. Not normalized by atoms, i.e. E(Li4O2) = 2 * E(Li2O) """ e = 0 for k, v in self.get_decomposition(comp).items(): e += k.energy_per_atom * v return e * comp.num_atoms def get_decomp_and_e_above_hull(self, entry, allow_negative=False): """ Provides the decomposition and energy above convex hull for an entry. Due to caching, can be much faster if entries with the same composition are processed together. Args: entry: A PDEntry like object allow_negative: Whether to allow negative e_above_hulls. Used to calculate equilibrium reaction energies. Defaults to False. Returns: (decomp, energy above convex hull) Stable entries should have energy above hull of 0. The decomposition is provided as a dict of {Entry: amount}. """ if entry in self.stable_entries: return {entry: 1}, 0 comp = entry.composition facet, simplex = self._get_facet_and_simplex(comp) decomp_amts = simplex.bary_coords(self.pd_coords(comp)) decomp = {self.qhull_entries[f]: amt for f, amt in zip(facet, decomp_amts) if abs(amt) > PhaseDiagram.numerical_tol} energies = [self.qhull_entries[i].energy_per_atom for i in facet] ehull = entry.energy_per_atom - np.dot(decomp_amts, energies) if allow_negative or ehull >= -PhaseDiagram.numerical_tol: return decomp, ehull raise ValueError("No valid decomp found!") def get_e_above_hull(self, entry): """ Provides the energy above convex hull for an entry Args: entry: A PDEntry like object Returns: Energy above convex hull of entry. Stable entries should have energy above hull of 0. """ return self.get_decomp_and_e_above_hull(entry)[1] def get_equilibrium_reaction_energy(self, entry): """ Provides the reaction energy of a stable entry from the neighboring equilibrium stable entries (also known as the inverse distance to hull). Args: entry: A PDEntry like object Returns: Equilibrium reaction energy of entry. Stable entries should have equilibrium reaction energy <= 0. """ if entry not in self.stable_entries: raise ValueError("Equilibrium reaction energy is available only " "for stable entries.") if entry.is_element: return 0 entries = [e for e in self.stable_entries if e != entry] modpd = PhaseDiagram(entries, self.elements) return modpd.get_decomp_and_e_above_hull(entry, allow_negative=True)[1] def get_composition_chempots(self, comp): facet = self._get_facet_and_simplex(comp)[0] return self._get_facet_chempots(facet) def get_transition_chempots(self, element): """ Get the critical chemical potentials for an element in the Phase Diagram. Args: element: An element. Has to be in the PD in the first place. Returns: A sorted sequence of critical chemical potentials, from less negative to more negative. """ if element not in self.elements: raise ValueError("get_transition_chempots can only be called with " "elements in the phase diagram.") critical_chempots = [] for facet in self.facets: chempots = self._get_facet_chempots(facet) critical_chempots.append(chempots[element]) clean_pots = [] for c in sorted(critical_chempots): if len(clean_pots) == 0: clean_pots.append(c) else: if abs(c - clean_pots[-1]) > PhaseDiagram.numerical_tol: clean_pots.append(c) clean_pots.reverse() return tuple(clean_pots) def get_critical_compositions(self, comp1, comp2): """ Get the critical compositions along the tieline between two compositions. I.e. where the decomposition products change. The endpoints are also returned. Args: comp1, comp2 (Composition): compositions that define the tieline Returns: [(Composition)]: list of critical compositions. All are of the form x * comp1 + (1-x) * comp2 """ n1 = comp1.num_atoms n2 = comp2.num_atoms pd_els = self.elements # the reduced dimensionality Simplexes don't use the # first element in the PD c1 = self.pd_coords(comp1) c2 = self.pd_coords(comp2) # none of the projections work if c1 == c2, so just return *copies* # of the inputs if np.all(c1 == c2): return [comp1.copy(), comp2.copy()] intersections = [c1, c2] for sc in self.simplexes: intersections.extend(sc.line_intersection(c1, c2)) intersections = np.array(intersections) # find position along line l = (c2 - c1) l /= np.sum(l ** 2) ** 0.5 proj = np.dot(intersections - c1, l) # only take compositions between endpoints proj = proj[np.logical_and(proj > -self.numerical_tol, proj < proj[1] + self.numerical_tol)] proj.sort() # only unique compositions valid = np.ones(len(proj), dtype=np.bool) valid[1:] = proj[1:] > proj[:-1] + self.numerical_tol proj = proj[valid] ints = c1 + l * proj[:, None] # reconstruct full-dimensional composition array cs = np.concatenate([np.array([1 - np.sum(ints, axis=-1)]).T, ints], axis=-1) # mixing fraction when compositions are normalized x = proj / np.dot(c2 - c1, l) # mixing fraction when compositions are not normalized x_unnormalized = x * n1 / (n2 + x * (n1 - n2)) num_atoms = n1 + (n2 - n1) * x_unnormalized cs *= num_atoms[:, None] return [Composition((c, v) for c, v in zip(pd_els, m)) for m in cs] def get_element_profile(self, element, comp, comp_tol=1e-5): """ Provides the element evolution data for a composition. For example, can be used to analyze Li conversion voltages by varying uLi and looking at the phases formed. Also can be used to analyze O2 evolution by varying uO2. Args: element: An element. Must be in the phase diagram. comp: A Composition comp_tol: The tolerance to use when calculating decompositions. Phases with amounts less than this tolerance are excluded. Defaults to 1e-5. Returns: Evolution data as a list of dictionaries of the following format: [ {'chempot': -10.487582010000001, 'evolution': -2.0, 'reaction': Reaction Object], ...] """ element = get_el_sp(element) element = Element(element.symbol) if element not in self.elements: raise ValueError("get_transition_chempots can only be called with" " elements in the phase diagram.") gccomp = Composition({el: amt for el, amt in comp.items() if el != element}) elref = self.el_refs[element] elcomp = Composition(element.symbol) evolution = [] for cc in self.get_critical_compositions(elcomp, gccomp)[1:]: decomp_entries = self.get_decomposition(cc).keys() decomp = [k.composition for k in decomp_entries] rxn = Reaction([comp], decomp + [elcomp]) rxn.normalize_to(comp) c = self.get_composition_chempots(cc + elcomp * 1e-5)[element] amt = -rxn.coeffs[rxn.all_comp.index(elcomp)] evolution.append({'chempot': c, 'evolution': amt, 'element_reference': elref, 'reaction': rxn, 'entries': decomp_entries}) return evolution def get_chempot_range_map(self, elements, referenced=True, joggle=True): """ Returns a chemical potential range map for each stable entry. Args: elements: Sequence of elements to be considered as independent variables. E.g., if you want to show the stability ranges of all Li-Co-O phases wrt to uLi and uO, you will supply [Element("Li"), Element("O")] referenced: If True, gives the results with a reference being the energy of the elemental phase. If False, gives absolute values. joggle (boolean): Whether to joggle the input to avoid precision errors. Returns: Returns a dict of the form {entry: [simplices]}. The list of simplices are the sides of the N-1 dim polytope bounding the allowable chemical potential range of each entry. """ all_chempots = [] pd = self facets = pd.facets for facet in facets: chempots = self._get_facet_chempots(facet) all_chempots.append([chempots[el] for el in pd.elements]) inds = [pd.elements.index(el) for el in elements] el_energies = {el: 0.0 for el in elements} if referenced: el_energies = {el: pd.el_refs[el].energy_per_atom for el in elements} chempot_ranges = collections.defaultdict(list) vertices = [list(range(len(self.elements)))] if len(all_chempots) > len(self.elements): vertices = get_facets(all_chempots, joggle=joggle) for ufacet in vertices: for combi in itertools.combinations(ufacet, 2): data1 = facets[combi[0]] data2 = facets[combi[1]] common_ent_ind = set(data1).intersection(set(data2)) if len(common_ent_ind) == len(elements): common_entries = [pd.qhull_entries[i] for i in common_ent_ind] data = np.array([[all_chempots[i][j] - el_energies[pd.elements[j]] for j in inds] for i in combi]) sim = Simplex(data) for entry in common_entries: chempot_ranges[entry].append(sim) return chempot_ranges def getmu_vertices_stability_phase(self, target_comp, dep_elt, tol_en=1e-2): """ returns a set of chemical potentials corresponding to the vertices of the simplex in the chemical potential phase diagram. The simplex is built using all elements in the target_composition except dep_elt. The chemical potential of dep_elt is computed from the target composition energy. This method is useful to get the limiting conditions for defects computations for instance. Args: target_comp: A Composition object dep_elt: the element for which the chemical potential is computed from the energy of the stable phase at the target composition tol_en: a tolerance on the energy to set Returns: [{Element:mu}]: An array of conditions on simplex vertices for which each element has a chemical potential set to a given value. "absolute" values (i.e., not referenced to element energies) """ muref = np.array([self.el_refs[e].energy_per_atom for e in self.elements if e != dep_elt]) chempot_ranges = self.get_chempot_range_map( [e for e in self.elements if e != dep_elt]) for e in self.elements: if not e in target_comp.elements: target_comp = target_comp + Composition({e: 0.0}) coeff = [-target_comp[e] for e in self.elements if e != dep_elt] for e in chempot_ranges.keys(): if e.composition.reduced_composition == \ target_comp.reduced_composition: multiplicator = e.composition[dep_elt] / target_comp[dep_elt] ef = e.energy / multiplicator all_coords = [] for s in chempot_ranges[e]: for v in s._coords: elts = [e for e in self.elements if e != dep_elt] res = {} for i in range(len(elts)): res[elts[i]] = v[i] + muref[i] res[dep_elt] = (np.dot(v + muref, coeff) + ef) / \ target_comp[dep_elt] already_in = False for di in all_coords: dict_equals = True for k in di: if abs(di[k] - res[k]) > tol_en: dict_equals = False break if dict_equals: already_in = True break if not already_in: all_coords.append(res) return all_coords def get_chempot_range_stability_phase(self, target_comp, open_elt): """ returns a set of chemical potentials correspoding to the max and min chemical potential of the open element for a given composition. It is quite common to have for instance a ternary oxide (e.g., ABO3) for which you want to know what are the A and B chemical potential leading to the highest and lowest oxygen chemical potential (reducing and oxidizing conditions). This is useful for defect computations. Args: target_comp: A Composition object open_elt: Element that you want to constrain to be max or min Returns: {Element:(mu_min,mu_max)}: Chemical potentials are given in "absolute" values (i.e., not referenced to 0) """ muref = np.array([self.el_refs[e].energy_per_atom for e in self.elements if e != open_elt]) chempot_ranges = self.get_chempot_range_map( [e for e in self.elements if e != open_elt]) for e in self.elements: if not e in target_comp.elements: target_comp = target_comp + Composition({e: 0.0}) coeff = [-target_comp[e] for e in self.elements if e != open_elt] max_open = -float('inf') min_open = float('inf') max_mus = None min_mus = None for e in chempot_ranges.keys(): if e.composition.reduced_composition == \ target_comp.reduced_composition: multiplicator = e.composition[open_elt] / target_comp[open_elt] ef = e.energy / multiplicator all_coords = [] for s in chempot_ranges[e]: for v in s._coords: all_coords.append(v) if (np.dot(v + muref, coeff) + ef) / target_comp[ open_elt] > max_open: max_open = (np.dot(v + muref, coeff) + ef) / \ target_comp[open_elt] max_mus = v if (np.dot(v + muref, coeff) + ef) / target_comp[ open_elt] < min_open: min_open = (np.dot(v + muref, coeff) + ef) / \ target_comp[open_elt] min_mus = v elts = [e for e in self.elements if e != open_elt] res = {} for i in range(len(elts)): res[elts[i]] = (min_mus[i] + muref[i], max_mus[i] + muref[i]) res[open_elt] = (min_open, max_open) return res class GrandPotentialPhaseDiagram(PhaseDiagram): """ A class representing a Grand potential phase diagram. Grand potential phase diagrams are essentially phase diagrams that are open to one or more components. To construct such phase diagrams, the relevant free energy is the grand potential, which can be written as the Legendre transform of the Gibbs free energy as follows Grand potential = G - u_X N_X The algorithm is based on the work in the following papers: 1. S. P. Ong, L. Wang, B. Kang, and G. Ceder, Li-Fe-P-O2 Phase Diagram from First Principles Calculations. Chem. Mater., 2008, 20(5), 1798-1807. doi:10.1021/cm702327g 2. S. P. Ong, A. Jain, G. Hautier, B. Kang, G. Ceder, Thermal stabilities of delithiated olivine MPO4 (M=Fe, Mn) cathodes investigated using first principles calculations. Electrochem. Comm., 2010, 12(3), 427-430. doi:10.1016/j.elecom.2010.01.010 """ def __init__(self, entries, chempots, elements=None): """ Standard constructor for grand potential phase diagram. Args: entries ([PDEntry]): A list of PDEntry-like objects having an energy, energy_per_atom and composition. chempots {Element: float}: Specify the chemical potentials of the open elements. elements ([Element]): Optional list of elements in the phase diagram. If set to None, the elements are determined from the the entries themselves. """ if elements is None: elements = set() for entry in entries: elements.update(entry.composition.elements) self.chempots = {get_el_sp(el): u for el, u in chempots.items()} elements = set(elements).difference(self.chempots.keys()) all_entries = [] for e in entries: if len(set(e.composition.elements).intersection(set(elements))) > 0: all_entries.append(GrandPotPDEntry(e, self.chempots)) super(GrandPotentialPhaseDiagram, self).__init__(all_entries, elements) def __str__(self): output = [] chemsys = "-".join([el.symbol for el in self.elements]) output.append("{} grand potential phase diagram with ".format(chemsys)) output[-1] += ", ".join(["u{}={}".format(el, v) for el, v in self.chempots.items()]) output.append("{} stable phases: ".format(len(self.stable_entries))) output.append(", ".join([entry.name for entry in self.stable_entries])) return "\n".join(output) def as_dict(self): return {"@module": self.__class__.__module__, "@class": self.__class__.__name__, "all_entries": [e.as_dict() for e in self.all_entries], "chempots": self.chempots, "elements": [e.as_dict() for e in self.elements]} @classmethod def from_dict(cls, d): entries = MontyDecoder().process_decoded(d["all_entries"]) elements = MontyDecoder().process_decoded(d["elements"]) return cls(entries, d["chempots"], elements) class CompoundPhaseDiagram(PhaseDiagram): """ Generates phase diagrams from compounds as terminations instead of elements. """ # Tolerance for determining if amount of a composition is positive. amount_tol = 1e-5 def __init__(self, entries, terminal_compositions, normalize_terminal_compositions=True): """ Initializes a CompoundPhaseDiagram. Args: entries ([PDEntry]): Sequence of input entries. For example, if you want a Li2O-P2O5 phase diagram, you might have all Li-P-O entries as an input. terminal_compositions ([Composition]): Terminal compositions of phase space. In the Li2O-P2O5 example, these will be the Li2O and P2O5 compositions. normalize_terminal_compositions (bool): Whether to normalize the terminal compositions to a per atom basis. If normalized, the energy above hulls will be consistent for comparison across systems. Non-normalized terminals are more intuitive in terms of compositional breakdowns. """ self.original_entries = entries self.terminal_compositions = terminal_compositions self.normalize_terminals = normalize_terminal_compositions (pentries, species_mapping) = \ self.transform_entries(entries, terminal_compositions) self.species_mapping = species_mapping super(CompoundPhaseDiagram, self).__init__( pentries, elements=species_mapping.values()) def transform_entries(self, entries, terminal_compositions): """ Method to transform all entries to the composition coordinate in the terminal compositions. If the entry does not fall within the space defined by the terminal compositions, they are excluded. For example, Li3PO4 is mapped into a Li2O:1.5, P2O5:0.5 composition. The terminal compositions are represented by DummySpecies. Args: entries: Sequence of all input entries terminal_compositions: Terminal compositions of phase space. Returns: Sequence of TransformedPDEntries falling within the phase space. """ new_entries = [] if self.normalize_terminals: fractional_comp = [c.fractional_composition for c in terminal_compositions] else: fractional_comp = terminal_compositions # Map terminal compositions to unique dummy species. sp_mapping = collections.OrderedDict() for i, comp in enumerate(fractional_comp): sp_mapping[comp] = DummySpecie("X" + chr(102 + i)) for entry in entries: try: rxn = Reaction(fractional_comp, [entry.composition]) rxn.normalize_to(entry.composition) # We only allow reactions that have positive amounts of # reactants. if all([rxn.get_coeff(comp) <= CompoundPhaseDiagram.amount_tol for comp in fractional_comp]): newcomp = {sp_mapping[comp]: -rxn.get_coeff(comp) for comp in fractional_comp} newcomp = {k: v for k, v in newcomp.items() if v > CompoundPhaseDiagram.amount_tol} transformed_entry = \ TransformedPDEntry(Composition(newcomp), entry) new_entries.append(transformed_entry) except ReactionError: # If the reaction can't be balanced, the entry does not fall # into the phase space. We ignore them. pass return new_entries, sp_mapping def as_dict(self): return { "@module": self.__class__.__module__, "@class": self.__class__.__name__, "original_entries": [e.as_dict() for e in self.original_entries], "terminal_compositions": [c.as_dict() for c in self.terminal_compositions], "normalize_terminal_compositions": self.normalize_terminals} @classmethod def from_dict(cls, d): dec = MontyDecoder() entries = dec.process_decoded(d["original_entries"]) terminal_compositions = dec.process_decoded(d["terminal_compositions"]) return cls(entries, terminal_compositions, d["normalize_terminal_compositions"]) class PhaseDiagramError(Exception): """ An exception class for Phase Diagram generation. """ pass def get_facets(qhull_data, joggle=False): """ Get the simplex facets for the Convex hull. Args: qhull_data (np.ndarray): The data from which to construct the convex hull as a Nxd array (N being number of data points and d being the dimension) joggle (boolean): Whether to joggle the input to avoid precision errors. Returns: List of simplices of the Convex Hull. """ if joggle: return ConvexHull(qhull_data, qhull_options="QJ i").simplices else: return ConvexHull(qhull_data, qhull_options="Qt i").simplices class PDPlotter(object): """ A plotter class for phase diagrams. Args: phasediagram: PhaseDiagram object. show_unstable (float): Whether unstable phases will be plotted as well as red crosses. If a number > 0 is entered, all phases with ehull < show_unstable will be shown. \\*\\*plotkwargs: Keyword args passed to matplotlib.pyplot.plot. Can be used to customize markers etc. If not set, the default is { "markerfacecolor": (0.2157, 0.4941, 0.7216), "markersize": 10, "linewidth": 3 } """ def __init__(self, phasediagram, show_unstable=0, **plotkwargs): # note: palettable imports matplotlib from palettable.colorbrewer.qualitative import Set1_3 self._pd = phasediagram self._dim = len(self._pd.elements) if self._dim > 4: raise ValueError("Only 1-4 components supported!") self.lines = uniquelines(self._pd.facets) if self._dim > 1 else \ [[self._pd.facets[0][0], self._pd.facets[0][0]]] self.show_unstable = show_unstable colors = Set1_3.mpl_colors self.plotkwargs = plotkwargs or { "markerfacecolor": colors[2], "markersize": 10, "linewidth": 3 } @property def pd_plot_data(self): """ Plot data for phase diagram. 2-comp - Full hull with energies 3/4-comp - Projection into 2D or 3D Gibbs triangle. Returns: (lines, stable_entries, unstable_entries): - lines is a list of list of coordinates for lines in the PD. - stable_entries is a {coordinate : entry} for each stable node in the phase diagram. (Each coordinate can only have one stable phase) - unstable_entries is a {entry: coordinates} for all unstable nodes in the phase diagram. """ pd = self._pd entries = pd.qhull_entries data = np.array(pd.qhull_data) lines = [] stable_entries = {} for line in self.lines: entry1 = entries[line[0]] entry2 = entries[line[1]] if self._dim < 3: x = [data[line[0]][0], data[line[1]][0]] y = [pd.get_form_energy_per_atom(entry1), pd.get_form_energy_per_atom(entry2)] coord = [x, y] elif self._dim == 3: coord = triangular_coord(data[line, 0:2]) else: coord = tet_coord(data[line, 0:3]) lines.append(coord) labelcoord = list(zip(*coord)) stable_entries[labelcoord[0]] = entry1 stable_entries[labelcoord[1]] = entry2 all_entries = pd.all_entries all_data = np.array(pd.all_entries_hulldata) unstable_entries = dict() stable = pd.stable_entries for i in range(0, len(all_entries)): entry = all_entries[i] if entry not in stable: if self._dim < 3: x = [all_data[i][0], all_data[i][0]] y = [pd.get_form_energy_per_atom(entry), pd.get_form_energy_per_atom(entry)] coord = [x, y] elif self._dim == 3: coord = triangular_coord([all_data[i, 0:2], all_data[i, 0:2]]) else: coord = tet_coord([all_data[i, 0:3], all_data[i, 0:3], all_data[i, 0:3]]) labelcoord = list(zip(*coord)) unstable_entries[entry] = labelcoord[0] return lines, stable_entries, unstable_entries def get_plot(self, label_stable=True, label_unstable=True, ordering=None, energy_colormap=None, process_attributes=False): if self._dim < 4: plt = self._get_2d_plot(label_stable, label_unstable, ordering, energy_colormap, process_attributes=process_attributes) elif self._dim == 4: plt = self._get_3d_plot(label_stable) return plt def plot_element_profile(self, element, comp, show_label_index=None, xlim=5): """ Draw the element profile plot for a composition varying different chemical potential of an element. X value is the negative value of the chemical potential reference to elemental chemical potential. For example, if choose Element("Li"), X= -(µLi-µLi0), which corresponds to the voltage versus metal anode. Y values represent for the number of element uptake in this composition (unit: per atom). All reactions are printed to help choosing the profile steps you want to show label in the plot. Args: element (Element): An element of which the chemical potential is considered. It also must be in the phase diagram. comp (Composition): A composition. show_label_index (list of integers): The labels for reaction products you want to show in the plot. Default to None (not showing any annotation for reaction products). For the profile steps you want to show the labels, just add it to the show_label_index. The profile step counts from zero. For example, you can set show_label_index=[0, 2, 5] to label profile step 0,2,5. xlim (float): The max x value. x value is from 0 to xlim. Default to 5 eV. Returns: Plot of element profile evolution by varying the chemical potential of an element. """ plt = pretty_plot(12, 8) pd = self._pd evolution = pd.get_element_profile(element, comp) num_atoms = evolution[0]["reaction"].reactants[0].num_atoms element_energy = evolution[0]['chempot'] for i, d in enumerate(evolution): v = -(d["chempot"] - element_energy) print ("index= %s, -\u0394\u03BC=%.4f(eV)," % (i, v), d["reaction"]) if i != 0: plt.plot([x2, x2], [y1, d["evolution"] / num_atoms], 'k', linewidth=2.5) x1 = v y1 = d["evolution"] / num_atoms if i != len(evolution) - 1: x2 = - (evolution[i + 1]["chempot"] - element_energy) else: x2 = 5.0 if show_label_index is not None and i in show_label_index: products = [re.sub(r"(\d+)", r"$_{\1}$", p.reduced_formula) for p in d["reaction"].products if p.reduced_formula != element.symbol] plt.annotate(", ".join(products), xy=(v + 0.05, y1 + 0.05), fontsize=24, color='r') plt.plot([x1, x2], [y1, y1], 'r', linewidth=3) else: plt.plot([x1, x2], [y1, y1], 'k', linewidth=2.5) plt.xlim((0, xlim)) plt.xlabel("-$\\Delta{\\mu}$ (eV)") plt.ylabel("Uptake per atom") return plt def show(self, *args, **kwargs): """ Draws the phase diagram using Matplotlib and show it. Args: \\*args: Passed to get_plot. \\*\\*kwargs: Passed to get_plot. """ self.get_plot(*args, **kwargs).show() def _get_2d_plot(self, label_stable=True, label_unstable=True, ordering=None, energy_colormap=None, vmin_mev=-60.0, vmax_mev=60.0, show_colorbar=True, process_attributes=False): """ Shows the plot using pylab. Usually I won't do imports in methods, but since plotting is a fairly expensive library to load and not all machines have matplotlib installed, I have done it this way. """ plt = pretty_plot(8, 6) from matplotlib.font_manager import FontProperties if ordering is None: (lines, labels, unstable) = self.pd_plot_data else: (_lines, _labels, _unstable) = self.pd_plot_data (lines, labels, unstable) = order_phase_diagram( _lines, _labels, _unstable, ordering) if energy_colormap is None: if process_attributes: for x, y in lines: plt.plot(x, y, "k-", linewidth=3, markeredgecolor="k") # One should think about a clever way to have "complex" # attributes with complex processing options but with a clear # logic. At this moment, I just use the attributes to know # whether an entry is a new compound or an existing (from the # ICSD or from the MP) one. for x, y in labels.keys(): if labels[(x, y)].attribute is None or \ labels[(x, y)].attribute == "existing": plt.plot(x, y, "ko", **self.plotkwargs) else: plt.plot(x, y, "k*", **self.plotkwargs) else: for x, y in lines: plt.plot(x, y, "ko-", **self.plotkwargs) else: from matplotlib.colors import Normalize, LinearSegmentedColormap from matplotlib.cm import ScalarMappable for x, y in lines: plt.plot(x, y, "k-", markeredgecolor="k") vmin = vmin_mev / 1000.0 vmax = vmax_mev / 1000.0 if energy_colormap == 'default': mid = - vmin / (vmax - vmin) cmap = LinearSegmentedColormap.from_list( 'my_colormap', [(0.0, '#005500'), (mid, '#55FF55'), (mid, '#FFAAAA'), (1.0, '#FF0000')]) else: cmap = energy_colormap norm = Normalize(vmin=vmin, vmax=vmax) _map = ScalarMappable(norm=norm, cmap=cmap) _energies = [self._pd.get_equilibrium_reaction_energy(entry) for coord, entry in labels.items()] energies = [en if en < 0.0 else -0.00000001 for en in _energies] vals_stable = _map.to_rgba(energies) ii = 0 if process_attributes: for x, y in labels.keys(): if labels[(x, y)].attribute is None or \ labels[(x, y)].attribute == "existing": plt.plot(x, y, "o", markerfacecolor=vals_stable[ii], markersize=12) else: plt.plot(x, y, "*", markerfacecolor=vals_stable[ii], markersize=18) ii += 1 else: for x, y in labels.keys(): plt.plot(x, y, "o", markerfacecolor=vals_stable[ii], markersize=15) ii += 1 font = FontProperties() font.set_weight("bold") font.set_size(24) # Sets a nice layout depending on the type of PD. Also defines a # "center" for the PD, which then allows the annotations to be spread # out in a nice manner. if len(self._pd.elements) == 3: plt.axis("equal") plt.xlim((-0.1, 1.2)) plt.ylim((-0.1, 1.0)) plt.axis("off") center = (0.5, math.sqrt(3) / 6) else: all_coords = labels.keys() miny = min([c[1] for c in all_coords]) ybuffer = max(abs(miny) * 0.1, 0.1) plt.xlim((-0.1, 1.1)) plt.ylim((miny - ybuffer, ybuffer)) center = (0.5, miny / 2) plt.xlabel("Fraction", fontsize=28, fontweight='bold') plt.ylabel("Formation energy (eV/fu)", fontsize=28, fontweight='bold') for coords in sorted(labels.keys(), key=lambda x: -x[1]): entry = labels[coords] label = entry.name # The follow defines an offset for the annotation text emanating # from the center of the PD. Results in fairly nice layouts for the # most part. vec = (np.array(coords) - center) vec = vec / np.linalg.norm(vec) * 10 if np.linalg.norm(vec) != 0 \ else vec valign = "bottom" if vec[1] > 0 else "top" if vec[0] < -0.01: halign = "right" elif vec[0] > 0.01: halign = "left" else: halign = "center" if label_stable: if process_attributes and entry.attribute == 'new': plt.annotate(latexify(label), coords, xytext=vec, textcoords="offset points", horizontalalignment=halign, verticalalignment=valign, fontproperties=font, color='g') else: plt.annotate(latexify(label), coords, xytext=vec, textcoords="offset points", horizontalalignment=halign, verticalalignment=valign, fontproperties=font) if self.show_unstable: font = FontProperties() font.set_size(16) energies_unstable = [self._pd.get_e_above_hull(entry) for entry, coord in unstable.items()] if energy_colormap is not None: energies.extend(energies_unstable) vals_unstable = _map.to_rgba(energies_unstable) ii = 0 for entry, coords in unstable.items(): ehull = self._pd.get_e_above_hull(entry) if ehull < self.show_unstable: vec = (np.array(coords) - center) vec = vec / np.linalg.norm(vec) * 10 \ if np.linalg.norm(vec) != 0 else vec label = entry.name if energy_colormap is None: plt.plot(coords[0], coords[1], "ks", linewidth=3, markeredgecolor="k", markerfacecolor="r", markersize=8) else: plt.plot(coords[0], coords[1], "s", linewidth=3, markeredgecolor="k", markerfacecolor=vals_unstable[ii], markersize=8) if label_unstable: plt.annotate(latexify(label), coords, xytext=vec, textcoords="offset points", horizontalalignment=halign, color="b", verticalalignment=valign, fontproperties=font) ii += 1 if energy_colormap is not None and show_colorbar: _map.set_array(energies) cbar = plt.colorbar(_map) cbar.set_label( 'Energy [meV/at] above hull (in red)\nInverse energy [' 'meV/at] above hull (in green)', rotation=-90, ha='left', va='center') ticks = cbar.ax.get_yticklabels() # cbar.ax.set_yticklabels(['${v}$'.format( # v=float(t.get_text().strip('$'))*1000.0) for t in ticks]) f = plt.gcf() f.set_size_inches((8, 6)) plt.subplots_adjust(left=0.09, right=0.98, top=0.98, bottom=0.07) return plt def _get_3d_plot(self, label_stable=True): """ Shows the plot using pylab. Usually I won"t do imports in methods, but since plotting is a fairly expensive library to load and not all machines have matplotlib installed, I have done it this way. """ import matplotlib.pyplot as plt import mpl_toolkits.mplot3d.axes3d as p3 from matplotlib.font_manager import FontProperties fig = plt.figure() ax = p3.Axes3D(fig) font = FontProperties() font.set_weight("bold") font.set_size(20) (lines, labels, unstable) = self.pd_plot_data count = 1 newlabels = list() for x, y, z in lines: ax.plot(x, y, z, "bo-", linewidth=3, markeredgecolor="b", markerfacecolor="r", markersize=10) for coords in sorted(labels.keys()): entry = labels[coords] label = entry.name if label_stable: if len(entry.composition.elements) == 1: ax.text(coords[0], coords[1], coords[2], label) else: ax.text(coords[0], coords[1], coords[2], str(count)) newlabels.append("{} : {}".format(count, latexify(label))) count += 1 plt.figtext(0.01, 0.01, "\n".join(newlabels)) ax.axis("off") return plt def write_image(self, stream, image_format="svg", **kwargs): """ Writes the phase diagram to an image in a stream. Args: stream: stream to write to. Can be a file stream or a StringIO stream. image_format format for image. Can be any of matplotlib supported formats. Defaults to svg for best results for vector graphics. \\*\\*kwargs: Pass through to get_plot functino. """ plt = self.get_plot(**kwargs) f = plt.gcf() f.set_size_inches((12, 10)) plt.savefig(stream, format=image_format) def plot_chempot_range_map(self, elements, referenced=True): """ Plot the chemical potential range _map. Currently works only for 3-component PDs. Args: elements: Sequence of elements to be considered as independent variables. E.g., if you want to show the stability ranges of all Li-Co-O phases wrt to uLi and uO, you will supply [Element("Li"), Element("O")] referenced: if True, gives the results with a reference being the energy of the elemental phase. If False, gives absolute values. """ self.get_chempot_range_map_plot(elements, referenced=referenced).show() def get_chempot_range_map_plot(self, elements, referenced=True): """ Returns a plot of the chemical potential range _map. Currently works only for 3-component PDs. Args: elements: Sequence of elements to be considered as independent variables. E.g., if you want to show the stability ranges of all Li-Co-O phases wrt to uLi and uO, you will supply [Element("Li"), Element("O")] referenced: if True, gives the results with a reference being the energy of the elemental phase. If False, gives absolute values. Returns: A matplotlib plot object. """ plt = pretty_plot(12, 8) chempot_ranges = self._pd.get_chempot_range_map( elements, referenced=referenced) missing_lines = {} excluded_region = [] for entry, lines in chempot_ranges.items(): comp = entry.composition center_x = 0 center_y = 0 coords = [] contain_zero = any([comp.get_atomic_fraction(el) == 0 for el in elements]) is_boundary = (not contain_zero) and \ sum([comp.get_atomic_fraction(el) for el in elements]) == 1 for line in lines: (x, y) = line.coords.transpose() plt.plot(x, y, "k-") for coord in line.coords: if not in_coord_list(coords, coord): coords.append(coord.tolist()) center_x += coord[0] center_y += coord[1] if is_boundary: excluded_region.extend(line.coords) if coords and contain_zero: missing_lines[entry] = coords else: xy = (center_x / len(coords), center_y / len(coords)) plt.annotate(latexify(entry.name), xy, fontsize=22) ax = plt.gca() xlim = ax.get_xlim() ylim = ax.get_ylim() # Shade the forbidden chemical potential regions. excluded_region.append([xlim[1], ylim[1]]) excluded_region = sorted(excluded_region, key=lambda c: c[0]) (x, y) = np.transpose(excluded_region) plt.fill(x, y, "0.80") # The hull does not generate the missing horizontal and vertical lines. # The following code fixes this. el0 = elements[0] el1 = elements[1] for entry, coords in missing_lines.items(): center_x = sum([c[0] for c in coords]) center_y = sum([c[1] for c in coords]) comp = entry.composition is_x = comp.get_atomic_fraction(el0) < 0.01 is_y = comp.get_atomic_fraction(el1) < 0.01 n = len(coords) if not (is_x and is_y): if is_x: coords = sorted(coords, key=lambda c: c[1]) for i in [0, -1]: x = [min(xlim), coords[i][0]] y = [coords[i][1], coords[i][1]] plt.plot(x, y, "k") center_x += min(xlim) center_y += coords[i][1] elif is_y: coords = sorted(coords, key=lambda c: c[0]) for i in [0, -1]: x = [coords[i][0], coords[i][0]] y = [coords[i][1], min(ylim)] plt.plot(x, y, "k") center_x += coords[i][0] center_y += min(ylim) xy = (center_x / (n + 2), center_y / (n + 2)) else: center_x = sum(coord[0] for coord in coords) + xlim[0] center_y = sum(coord[1] for coord in coords) + ylim[0] xy = (center_x / (n + 1), center_y / (n + 1)) plt.annotate(latexify(entry.name), xy, horizontalalignment="center", verticalalignment="center", fontsize=22) plt.xlabel("$\\mu_{{{0}}} - \\mu_{{{0}}}^0$ (eV)" .format(el0.symbol)) plt.ylabel("$\\mu_{{{0}}} - \\mu_{{{0}}}^0$ (eV)" .format(el1.symbol)) plt.tight_layout() return plt def get_contour_pd_plot(self): """ Plot a contour phase diagram plot, where phase triangles are colored according to degree of instability by interpolation. Currently only works for 3-component phase diagrams. Returns: A matplotlib plot object. """ from scipy import interpolate from matplotlib import cm pd = self._pd entries = pd.qhull_entries data = np.array(pd.qhull_data) plt = self._get_2d_plot() data[:, 0:2] = triangular_coord(data[:, 0:2]).transpose() for i, e in enumerate(entries): data[i, 2] = self._pd.get_e_above_hull(e) gridsize = 0.005 xnew = np.arange(0, 1., gridsize) ynew = np.arange(0, 1, gridsize) f = interpolate.LinearNDInterpolator(data[:, 0:2], data[:, 2]) znew = np.zeros((len(ynew), len(xnew))) for (i, xval) in enumerate(xnew): for (j, yval) in enumerate(ynew): znew[j, i] = f(xval, yval) plt.contourf(xnew, ynew, znew, 1000, cmap=cm.autumn_r) plt.colorbar() return plt def uniquelines(q): """ Given all the facets, convert it into a set of unique lines. Specifically used for converting convex hull facets into line pairs of coordinates. Args: q: A 2-dim sequence, where each row represents a facet. E.g., [[1,2,3],[3,6,7],...] Returns: setoflines: A set of tuple of lines. E.g., ((1,2), (1,3), (2,3), ....) """ setoflines = set() for facets in q: for line in itertools.combinations(facets, 2): setoflines.add(tuple(sorted(line))) return setoflines def triangular_coord(coord): """ Convert a 2D coordinate into a triangle-based coordinate system for a prettier phase diagram. Args: coordinate: coordinate used in the convex hull computation. Returns: coordinates in a triangular-based coordinate system. """ unitvec = np.array([[1, 0], [0.5, math.sqrt(3) / 2]]) result = np.dot(np.array(coord), unitvec) return result.transpose() def tet_coord(coord): """ Convert a 3D coordinate into a tetrahedron based coordinate system for a prettier phase diagram. Args: coordinate: coordinate used in the convex hull computation. Returns: coordinates in a tetrahedron-based coordinate system. """ unitvec = np.array([[1, 0, 0], [0.5, math.sqrt(3) / 2, 0], [0.5, 1.0 / 3.0 * math.sqrt(3) / 2, math.sqrt(6) / 3]]) result = np.dot(np.array(coord), unitvec) return result.transpose() def order_phase_diagram(lines, stable_entries, unstable_entries, ordering): """ Orders the entries (their coordinates) in a phase diagram plot according to the user specified ordering. Ordering should be given as ['Up', 'Left', 'Right'], where Up, Left and Right are the names of the entries in the upper, left and right corners of the triangle respectively. Args: lines: list of list of coordinates for lines in the PD. stable_entries: {coordinate : entry} for each stable node in the phase diagram. (Each coordinate can only have one stable phase) unstable_entries: {entry: coordinates} for all unstable nodes in the phase diagram. ordering: Ordering of the phase diagram, given as a list ['Up', 'Left','Right'] Returns: (newlines, newstable_entries, newunstable_entries): - newlines is a list of list of coordinates for lines in the PD. - newstable_entries is a {coordinate : entry} for each stable node in the phase diagram. (Each coordinate can only have one stable phase) - newunstable_entries is a {entry: coordinates} for all unstable nodes in the phase diagram. """ yup = -1000.0 xleft = 1000.0 xright = -1000.0 for coord in stable_entries: if coord[0] > xright: xright = coord[0] nameright = stable_entries[coord].name if coord[0] < xleft: xleft = coord[0] nameleft = stable_entries[coord].name if coord[1] > yup: yup = coord[1] nameup = stable_entries[coord].name if (not nameup in ordering) or (not nameright in ordering) or \ (not nameleft in ordering): raise ValueError( 'Error in ordering_phase_diagram : \n"{up}", "{left}" and "{' 'right}"' ' should be in ordering : {ord}'.format(up=nameup, left=nameleft, right=nameright, ord=ordering)) cc = np.array([0.5, np.sqrt(3.0) / 6.0], np.float) if nameup == ordering[0]: if nameleft == ordering[1]: # The coordinates were already in the user ordering return lines, stable_entries, unstable_entries else: newlines = [[np.array(1.0 - x), y] for x, y in lines] newstable_entries = {(1.0 - c[0], c[1]): entry for c, entry in stable_entries.items()} newunstable_entries = {entry: (1.0 - c[0], c[1]) for entry, c in unstable_entries.items()} return newlines, newstable_entries, newunstable_entries elif nameup == ordering[1]: if nameleft == ordering[2]: c120 = np.cos(2.0 * np.pi / 3.0) s120 = np.sin(2.0 * np.pi / 3.0) newlines = [] for x, y in lines: newx = np.zeros_like(x) newy = np.zeros_like(y) for ii, xx in enumerate(x): newx[ii] = c120 * (xx - cc[0]) - s120 * (y[ii] - cc[1]) + \ cc[0] newy[ii] = s120 * (xx - cc[0]) + c120 * (y[ii] - cc[1]) + \ cc[1] newlines.append([newx, newy]) newstable_entries = { (c120 * (c[0] - cc[0]) - s120 * (c[1] - cc[1]) + cc[0], s120 * (c[0] - cc[0]) + c120 * (c[1] - cc[1]) + cc[1]): entry for c, entry in stable_entries.items()} newunstable_entries = { entry: (c120 * (c[0] - cc[0]) - s120 * (c[1] - cc[1]) + cc[0], s120 * (c[0] - cc[0]) + c120 * (c[1] - cc[1]) + cc[1]) for entry, c in unstable_entries.items()} return newlines, newstable_entries, newunstable_entries else: c120 = np.cos(2.0 * np.pi / 3.0) s120 = np.sin(2.0 * np.pi / 3.0) newlines = [] for x, y in lines: newx = np.zeros_like(x) newy = np.zeros_like(y) for ii, xx in enumerate(x): newx[ii] = -c120 * (xx - 1.0) - s120 * y[ii] + 1.0 newy[ii] = -s120 * (xx - 1.0) + c120 * y[ii] newlines.append([newx, newy]) newstable_entries = {(-c120 * (c[0] - 1.0) - s120 * c[1] + 1.0, -s120 * (c[0] - 1.0) + c120 * c[1]): entry for c, entry in stable_entries.items()} newunstable_entries = { entry: (-c120 * (c[0] - 1.0) - s120 * c[1] + 1.0, -s120 * (c[0] - 1.0) + c120 * c[1]) for entry, c in unstable_entries.items()} return newlines, newstable_entries, newunstable_entries elif nameup == ordering[2]: if nameleft == ordering[0]: c240 = np.cos(4.0 * np.pi / 3.0) s240 = np.sin(4.0 * np.pi / 3.0) newlines = [] for x, y in lines: newx = np.zeros_like(x) newy = np.zeros_like(y) for ii, xx in enumerate(x): newx[ii] = c240 * (xx - cc[0]) - s240 * (y[ii] - cc[1]) + \ cc[0] newy[ii] = s240 * (xx - cc[0]) + c240 * (y[ii] - cc[1]) + \ cc[1] newlines.append([newx, newy]) newstable_entries = { (c240 * (c[0] - cc[0]) - s240 * (c[1] - cc[1]) + cc[0], s240 * (c[0] - cc[0]) + c240 * (c[1] - cc[1]) + cc[1]): entry for c, entry in stable_entries.items()} newunstable_entries = { entry: (c240 * (c[0] - cc[0]) - s240 * (c[1] - cc[1]) + cc[0], s240 * (c[0] - cc[0]) + c240 * (c[1] - cc[1]) + cc[1]) for entry, c in unstable_entries.items()} return newlines, newstable_entries, newunstable_entries else: c240 = np.cos(4.0 * np.pi / 3.0) s240 = np.sin(4.0 * np.pi / 3.0) newlines = [] for x, y in lines: newx = np.zeros_like(x) newy = np.zeros_like(y) for ii, xx in enumerate(x): newx[ii] = -c240 * xx - s240 * y[ii] newy[ii] = -s240 * xx + c240 * y[ii] newlines.append([newx, newy]) newstable_entries = {(-c240 * c[0] - s240 * c[1], -s240 * c[0] + c240 * c[1]): entry for c, entry in stable_entries.items()} newunstable_entries = {entry: (-c240 * c[0] - s240 * c[1], -s240 * c[0] + c240 * c[1]) for entry, c in unstable_entries.items()} return newlines, newstable_entries, newunstable_entries
johnson1228/pymatgen
pymatgen/analysis/phase_diagram.py
Python
mit
77,867
[ "pymatgen" ]
177883f020404416ac3f1748ab5470e189864c94159845a0767d77d73322c870
__author__ = 'brian' import sys my_paths = [ '/usr/local/pbs/default/python/lib/python2.5', '/usr/local/pbs/default/python/lib/python2.5/plat-linux2', '/usr/local/pbs/default/python/lib/python2.5/lib-tk', '/usr/local/pbs/default/python/lib/python2.5/lib-dynload', '/usr/local/pbs/default/python/lib/python2.5/site-packages', ] for my_path in my_paths: if my_path not in sys.path: sys.path.append(my_path) if "/usr/lib64/python2.6" in sys.path: sys.path.remove("/usr/lib64/python2.6") import encodings.ascii import pbs try: # Python 3 import configparser except ImportError: # Python 2 import ConfigParser as configparser try: # Python 3 import xmlrpc.client as xmlrpclib except ImportError: # Python 2 import xmlrpclib e = pbs.event() try: config_file = "/etc/karaage3/karaage-cluster-tools.cfg" f = open(config_file, "r") f.close() config = configparser.RawConfigParser() config.read(config_file) username = config.get('karaage', 'username') password = config.get('karaage', 'password') url = config.get('karaage', 'url') server = xmlrpclib.Server(url) if e.job.project is None: e.reject( "The project has not been supplied. Please specify " "project with '-P <project>'.") project = str(e.job.project) members = server.get_project_members(username, password, project) if isinstance(members, str): e.reject( "The project %s is invalid." % project) if e.requestor not in members: e.reject( "User %s is not a member of project %s." % (e.requestor, project)) assert "," not in project e.job.group_list = pbs.group_list(project) except SystemExit: pass except: # import traceback # traceback.print_exc() e.reject( "%s hook failed with %s. Please contact Admin." % (e.hook_name, sys.exc_info()[:2]))
Karaage-Cluster/karaage-hacks
require_project.py
Python
gpl-3.0
1,951
[ "Brian" ]
b8cecef30db8e8695b6bab105cbe2a35f40ae4ad12d909e5bf59c99c161f9121
# Copyright (C) 2019 Brian McMaster # Copyright (C) 2019 Open Source Integrators # License AGPL-3.0 or later (http://www.gnu.org/licenses/agpl). from odoo.tests.common import TransactionCase class TestL10nUsForm1099(TransactionCase): def test_on_change_is_1099(self): """ Test that supplier is True if is_1099 is True """ partner = self.env.ref('base.res_partner_2') partner.is_1099 = True partner._on_change_is_1099() self.assertTrue(partner.supplier) def test_on_change_supplier(self): """ Test that is_1099 is False if supplier is False """ partner = self.env.ref('base.res_partner_2') partner.supplier = False partner._on_change_supplier() self.assertFalse(partner.is_1099)
OCA/l10n-usa
l10n_us_form_1099/tests/test_l10n_us_form_1099.py
Python
agpl-3.0
811
[ "Brian" ]
49c7494c17be3868ab389a553ac5c5e44e7d28e00effc31e5e3fd2e696bb1cff
from __future__ import absolute_import, unicode_literals from django.test import TestCase from django.utils import six from .models import (Building, Child, Device, Port, Item, Country, Connection, ClientStatus, State, Client, SpecialClient, TUser, Person, Student, Organizer, Class, Enrollment) class SelectRelatedRegressTests(TestCase): def test_regression_7110(self): """ Regression test for bug #7110. When using select_related(), we must query the Device and Building tables using two different aliases (each) in order to differentiate the start and end Connection fields. The net result is that both the "connections = ..." queries here should give the same results without pulling in more than the absolute minimum number of tables (history has shown that it's easy to make a mistake in the implementation and include some unnecessary bonus joins). """ b=Building.objects.create(name='101') dev1=Device.objects.create(name="router", building=b) dev2=Device.objects.create(name="switch", building=b) dev3=Device.objects.create(name="server", building=b) port1=Port.objects.create(port_number='4',device=dev1) port2=Port.objects.create(port_number='7',device=dev2) port3=Port.objects.create(port_number='1',device=dev3) c1=Connection.objects.create(start=port1, end=port2) c2=Connection.objects.create(start=port2, end=port3) connections=Connection.objects.filter(start__device__building=b, end__device__building=b).order_by('id') self.assertEqual([(c.id, six.text_type(c.start), six.text_type(c.end)) for c in connections], [(c1.id, 'router/4', 'switch/7'), (c2.id, 'switch/7', 'server/1')]) connections=Connection.objects.filter(start__device__building=b, end__device__building=b).select_related().order_by('id') self.assertEqual([(c.id, six.text_type(c.start), six.text_type(c.end)) for c in connections], [(c1.id, 'router/4', 'switch/7'), (c2.id, 'switch/7', 'server/1')]) # This final query should only have seven tables (port, device and building # twice each, plus connection once). Thus, 6 joins plus the FROM table. self.assertEqual(str(connections.query).count(" JOIN "), 6) def test_regression_8106(self): """ Regression test for bug #8106. Same sort of problem as the previous test, but this time there are more extra tables to pull in as part of the select_related() and some of them could potentially clash (so need to be kept separate). """ us = TUser.objects.create(name="std") usp = Person.objects.create(user=us) uo = TUser.objects.create(name="org") uop = Person.objects.create(user=uo) s = Student.objects.create(person = usp) o = Organizer.objects.create(person = uop) c = Class.objects.create(org=o) e = Enrollment.objects.create(std=s, cls=c) e_related = Enrollment.objects.all().select_related()[0] self.assertEqual(e_related.std.person.user.name, "std") self.assertEqual(e_related.cls.org.person.user.name, "org") def test_regression_8036(self): """ Regression test for bug #8036 the first related model in the tests below ("state") is empty and we try to select the more remotely related state__country. The regression here was not skipping the empty column results for country before getting status. """ australia = Country.objects.create(name='Australia') active = ClientStatus.objects.create(name='active') client = Client.objects.create(name='client', status=active) self.assertEqual(client.status, active) self.assertEqual(Client.objects.select_related()[0].status, active) self.assertEqual(Client.objects.select_related('state')[0].status, active) self.assertEqual(Client.objects.select_related('state', 'status')[0].status, active) self.assertEqual(Client.objects.select_related('state__country')[0].status, active) self.assertEqual(Client.objects.select_related('state__country', 'status')[0].status, active) self.assertEqual(Client.objects.select_related('status')[0].status, active) def test_multi_table_inheritance(self): """ Exercising select_related() with multi-table model inheritance. """ c1 = Child.objects.create(name="child1", value=42) i1 = Item.objects.create(name="item1", child=c1) i2 = Item.objects.create(name="item2") self.assertQuerysetEqual( Item.objects.select_related("child").order_by("name"), ["<Item: item1>", "<Item: item2>"] ) def test_regression_12851(self): """ Regression for #12851 Deferred fields are used correctly if you select_related a subset of fields. """ australia = Country.objects.create(name='Australia') active = ClientStatus.objects.create(name='active') wa = State.objects.create(name="Western Australia", country=australia) c1 = Client.objects.create(name='Brian Burke', state=wa, status=active) burke = Client.objects.select_related('state').defer('state__name').get(name='Brian Burke') self.assertEqual(burke.name, 'Brian Burke') self.assertEqual(burke.state.name, 'Western Australia') # Still works if we're dealing with an inherited class sc1 = SpecialClient.objects.create(name='Troy Buswell', state=wa, status=active, value=42) troy = SpecialClient.objects.select_related('state').defer('state__name').get(name='Troy Buswell') self.assertEqual(troy.name, 'Troy Buswell') self.assertEqual(troy.value, 42) self.assertEqual(troy.state.name, 'Western Australia') # Still works if we defer an attribute on the inherited class troy = SpecialClient.objects.select_related('state').defer('value', 'state__name').get(name='Troy Buswell') self.assertEqual(troy.name, 'Troy Buswell') self.assertEqual(troy.value, 42) self.assertEqual(troy.state.name, 'Western Australia') # Also works if you use only, rather than defer troy = SpecialClient.objects.select_related('state').only('name', 'state').get(name='Troy Buswell') self.assertEqual(troy.name, 'Troy Buswell') self.assertEqual(troy.value, 42) self.assertEqual(troy.state.name, 'Western Australia')
waseem18/oh-mainline
vendor/packages/Django/tests/regressiontests/select_related_regress/tests.py
Python
agpl-3.0
6,599
[ "Brian" ]
0c61c11a4505fc96d94074c7db52ee43636f3ee06e85790a28c512dcc509d28f
"""pyMOOSE Python bindings of MOOSE simulator. References: ----------- - `Documentation https://moose.readthedocs.io/en/latest/` - `Development https://github.com/BhallaLab/moose-core` """ # Notes # ----- # Use these guidelines for docstring: https://numpydoc.readthedocs.io/en/latest/format.html import sys import pydoc import os import moose._moose as _moose from moose import model_utils __moose_classes__ = {} class melement(_moose.ObjId): """Base class for all moose classes. """ __type__ = "UNKNOWN" __doc__ = "" def __init__(self, x, ndata=1, **kwargs): obj = _moose.__create__(self.__type__, x, ndata) if sys.version_info.major > 2: super().__init__(obj) for k, v in kwargs.items(): super().setField(k, v) else: # Support for dead python2. super(melement, self).__init__(obj) for k, v in kwargs.items(): super(melement, self).setField(k, v) def __to_melement(obj): global __moose_classes__ mc = __moose_classes__[obj.type](obj) return mc # Create MOOSE classes from available Cinfos. for p in _moose.wildcardFind("/##[TYPE=Cinfo]"): if sys.version_info.major > 2: cls = type( p.name, (melement,), {"__type__": p.name, "__doc__": _moose.__generatedoc__(p.name)}, ) else: # Python2. cls = type( str(p.name), (melement,), {"__type__": p.name, "__doc__": _moose.__generatedoc__(p.name)}, ) setattr(_moose, cls.__name__, cls) __moose_classes__[cls.__name__] = cls # Import all attributes to global namespace. We must do it here after adding # class types to _moose. from moose._moose import * def version(): """Reutrns moose version string.""" return _moose.__version__ __version__ = version() def version_info(): """Return detailed version information. >>> moose.version_info() {'build_datetime': 'Friday Fri Apr 17 22:13:00 2020', 'compiler_string': 'GNU,/usr/bin/c++,7.5.0', 'major': '3', 'minor': '3', 'patch': '1'} """ return _moose.version_info() def about(): """general information about pyMOOSE. Returns ------- A dict Example ------- >>> moose.about() {'path': '~/moose-core/_build/python/moose', 'version': '4.0.0.dev20200417', 'docs': 'https://moose.readthedocs.io/en/latest/', 'development': 'https://github.com/BhallaLab/moose-core'} """ return dict( path=os.path.dirname(__file__), version=_moose.__version__, docs="https://moose.readthedocs.io/en/latest/", development="https://github.com/BhallaLab/moose-core", ) def wildcardFind(pattern): """Find objects using wildcard pattern Parameters ---------- pattern: str Wildcard (see note below) .. note:: Wildcard MOOSE allows wildcard expressions of the form {PATH}/{WILDCARD}[{CONDITION}]. {PATH} is valid path in the element tree, {WILDCARD} can be # or ##. # causes the search to be restricted to the children of the element specified by {PATH}. ## makes the search to recursively go through all the descendants of the {PATH} element. {CONDITION} can be: - TYPE={CLASSNAME}: an element satisfies this condition if it is of class {CLASSNAME}. - ISA={CLASSNAME}: alias for TYPE={CLASSNAME} - CLASS={CLASSNAME}: alias for TYPE={CLASSNAME} - FIELD({FIELDNAME}){OPERATOR}{VALUE} : compare field {FIELDNAME} with {VALUE} by {OPERATOR} where {OPERATOR} is a comparison operator (=, !=, >, <, >=, <=). Returns ------- list A list of found MOOSE objects Examples -------- Following returns a list of all the objects under /mymodel whose Vm field is >= -65. >>> moose.wildcardFind("/mymodel/##[FIELD(Vm)>=-65]") """ return [__to_melement(x) for x in _moose.wildcardFind(pattern)] def connect(src, srcfield, dest, destfield, msgtype="Single"): """Create a message between `srcfield` on `src` object to `destfield` on `dest` object. This function is used mainly, to say, connect two entities, and to denote what kind of give-and-take relationship they share. It enables the 'destfield' (of the 'destobj') to acquire the data, from 'srcfield'(of the 'src'). Parameters ---------- src : element/vec/string the source object (or its path) the one that provides information. srcfield : str source field on self (type of the information). destobj : element Destination object to connect to (The one that need to get information). destfield : str field to connect to on `destobj` msgtype : str type of the message. It ca be one of the following (default Single). - Single - OneToAll - AllToOne - OneToOne - Reduce - Sparse Returns ------- msgmanager: melement message-manager for the newly created message. Note ----- Alternatively, one can also use the following form:: >>> src.connect(srcfield, dest, destfield, msgtype) Examples -------- Connect the output of a pulse generator to the input of a spike generator:: >>> pulsegen = moose.PulseGen('pulsegen') >>> spikegen = moose.SpikeGen('spikegen') >>> moose.connect(pulsegen, 'output', spikegen, 'Vm') Or, >>> pulsegen.connect('output', spikegen, 'Vm') """ src = _moose.element(src) dest = _moose.element(dest) return src.connect(srcfield, dest, destfield, msgtype) def delete(arg): """Delete the underlying moose object(s). This does not delete any of the Python objects referring to this vec but does invalidate them. Any attempt to access them will raise a ValueError. Parameters ---------- arg : vec/str/melement path of the object to be deleted. Returns ------- None, Raises ValueError if given path/object does not exists. """ _moose.delete(arg) def element(arg): """Convert a path or an object to the appropriate builtin moose class instance Parameters ---------- arg : str/vec/moose object path of the moose element to be converted or another element (possibly available as a superclass instance). Returns ------- melement MOOSE element (object) corresponding to the `arg` converted to write subclass. """ return _moose.element(arg) def exists(path): """Returns True if an object with given path already exists.""" return _moose.exists(path) def getCwe(): """Return current working elemement. See also -------- moose.setCwe """ return _moose.getCwe() def getField(classname, fieldname): """Get specified field of specified class.""" return _moose.getField(classname, fieldname) def getFieldDict(classname, finfoType=""): """Get dictionary of field names and types for specified class. Parameters ---------- className : str MOOSE class to find the fields of. finfoType : str (default '') Finfo type of the fields to find. If empty or not specified, allfields will be retrieved. Returns ------- dict field names and their respective types as key-value pair. Notes ----- This behaviour is different from `getFieldNames` where only `valueFinfo`s are returned when `finfoType` remains unspecified. Examples -------- List all the source fields on class Neutral >>> moose.getFieldDict('Neutral', 'srcFinfo') {'childMsg': 'int'} """ return _moose.getFieldDict(classname, finfoType) def getFieldNames(elem, fieldtype="*"): """Get a tuple containing name of fields of a given fieldtype. If fieldtype is set to '*', all fields are returned. Parameters ---------- elem : string,obj Name of the class or a moose element to look up. fieldtype : string The kind of field. Possible values are: - 'valueFinfo' or 'value' - 'srcFinfo' or 'src' - 'destFinfo' or 'dest' - 'lookupFinfo' or 'lookup' - 'fieldElementFinfo' or 'fieldElement' Returns ------- list Names of the fields of type `finfoType` in class `className`. """ clsname = elem if isinstance(elem, str) else elem.className return _moose.getFieldNames(clsname, fieldtype) def isRunning(): """True if the simulation is currently running.""" return _moose.isRunning() def move(src, dest): """Move a moose element `src` to destination""" return _moose.move(src, dest) def reinit(): """Reinitialize simulation. This function (re)initializes moose simulation. It must be called before you start the simulation (see moose.start). If you want to continue simulation after you have called moose.reinit() and moose.start(), you must NOT call moose.reinit() again. Calling moose.reinit() again will take the system back to initial setting (like clear out all data recording tables, set state variables to their initial values, etc. """ _moose.reinit() def start(runtime, notify=False): """Run simulation for `t` time. Advances the simulator clock by `t` time. If 'notify = True', a message is written to terminal whenever 10\% of simulation time is over. \ After setting up a simulation, YOU MUST CALL MOOSE.REINIT() before CALLING MOOSE.START() TO EXECUTE THE SIMULATION. Otherwise, the simulator behaviour will be undefined. Once moose.reinit() has been called, you can call `moose.start(t)` as many time as you like. This will continue the simulation from the last state for `t` time. Parameters ---------- t : float duration of simulation. notify: bool default False. If True, notify user whenever 10\% of simultion is over. Returns ------- None See also -------- moose.reinit : (Re)initialize simulation """ _moose.start(runtime, notify) def stop(): """Stop simulation""" _moose.stop() def setCwe(arg): """Set the current working element. Parameters ---------- arg: str, melement, vec moose element or path to be set as cwe. See also -------- getCwe """ _moose.setCwe(arg) def ce(arg): """Alias for setCwe""" _moose.setCwe(arg) def useClock(tick, path, fn): """Schedule `fn` function of every object that matches `path` on tick no `tick`. Usually you don't have to use it. (FIXME: Needs update) The sequence of clockticks with the same dt is according to their number. This is utilized for controlling the order of updates in various objects where it matters. The following convention should be observed when assigning clockticks to various components of a model: Clock ticks 0-3 are for electrical (biophysical) components, 4 and 5 are for chemical kinetics, 6 and 7 are for lookup tables and stimulus, 8 and 9 are for recording tables. Parameters ---------- tick : int tick number on which the targets should be scheduled. path : str path of the target element(s). This can be a wildcard also. fn : str name of the function to be called on each tick. Commonly `process`. Examples -------- In multi-compartmental neuron model a compartment's membrane potential (Vm) is dependent on its neighbours' membrane potential. Thus it must get the neighbour's present Vm before computing its own Vm in next time step. This ordering is achieved by scheduling the `init` function, which communicates membrane potential, on tick 0 and `process` function on tick 1. >>> moose.useClock(0, '/model/compartment_1', 'init') >>> moose.useClock(1, '/model/compartment_1', 'process')); """ _moose.useClock(tick, path, fn) def setClock(clockid, dt): """set the ticking interval of `tick` to `dt`. A tick with interval `dt` will call the functions scheduled on that tick every `dt` timestep. Parameters ---------- tick : int tick number dt : double ticking interval """ _moose.setClock(clockid, dt) def loadModel(filename, modelpath, solverclass="gsl"): """loadModel: Load model (genesis/cspace) from a file to a specified path. Parameters ---------- filename: str model description file. modelpath: str moose path for the top level element of the model to be created. method: str solver type to be used for simulating the model. TODO: Link to detailed description of solvers? Returns ------- melement moose.element if succcessful else None. See also -------- moose.readNML2 moose.writeNML2 (NotImplemented) moose.readSBML moose.writeSBML """ return model_utils.mooseReadKkitGenesis(filename, modelpath, solverclass) def copy(src, dest, name="", n=1, toGlobal=False, copyExtMsg=False): """Make copies of a moose object. Parameters ---------- src : vec, element or str source object. dest : vec, element or str Destination object to copy into. name : str Name of the new object. If omitted, name of the original will be used. n : int Number of copies to make (default=1). toGlobal : bool Relevant for parallel environments only. If false, the copies will reside on local node, otherwise all nodes get the copies. copyExtMsg : bool If true, messages to/from external objects are also copied. Returns ------- vec newly copied vec """ if isinstance(src, str): src = _moose.element(src) if isinstance(dest, str): dest = _moose.element(dest) if not name: name = src.name return _moose.copy(src.id, dest, name, n, toGlobal, copyExtMsg) def rand(a=0.0, b=1.0): """Generate random number from the interval [0.0, 1.0) Returns ------- float in [0, 1) real interval generated by MT19937. See also -------- moose.seed() : reseed the random number generator. Notes ----- MOOSE does not automatically seed the random number generator. You must explicitly call moose.seed() to create a new sequence of random numbers each time. """ return _moose.rand(a, b) def seed(seed=0): """Reseed MOOSE random number generator. Parameters ---------- seed : int Value to use for seeding. default: random number generated using system random device Notes ----- All RNGs in moose except rand functions in moose.Function expression use this seed. By default (when this function is not called) seed is initializecd to some random value using system random device (if available). Returns ------- None See also -------- moose.rand() : get a pseudorandom number in the [0,1) interval. """ _moose.seed(seed) def pwe(): """Print present working element's path. Convenience function for GENESIS users. If you want to retrieve the element in stead of printing the path, use moose.getCwe(). Returns ------ melement current MOOSE element Example ------- >>> pwe() '/' """ pwe_ = _moose.getCwe() print(pwe_.path) return pwe_ def le(el=None): """List elements under `el` or current element if no argument specified. Parameters ---------- el : str/melement/vec/None The element or the path under which to look. If `None`, children of current working element are displayed. Returns ------- List[str] path of all children """ el = _moose.getCwe() if el is None else el if isinstance(el, str): el = _moose.element(el) elif isinstance(el, _moose.vec): el = el[0] return _moose.le(el) def showfields(el, field="*", showtype=False): """Show the fields of the element `el`, their data types and values in human readable format. Convenience function for GENESIS users. Parameters ---------- el : melement/str Element or path of an existing element. field : str Field to be displayed. If '*' (default), all fields are displayed. showtype : bool If True show the data type of each field. False by default. Returns ------- string """ if isinstance(el, str): if not _moose.exists(el): raise ValueError("no such element: %s" % el) el = _moose.element(el) result = [] if field == "*": value_field_dict = _moose.getFieldDict(el.className, "valueFinfo") max_type_len = max(len(dtype) for dtype in value_field_dict.values()) max_field_len = max(len(dtype) for dtype in value_field_dict.keys()) result.append("\n[" + el.path + "]\n") for key, dtype in sorted(value_field_dict.items()): if ( dtype == "bad" or key == "this" or key == "dummy" or key == "me" or dtype.startswith("vector") or "ObjId" in dtype ): continue value = el.getField(key) if showtype: typestr = dtype.ljust(max_type_len + 4) ## The following hack is for handling both Python 2 and ## 3. Directly putting the print command in the if/else ## clause causes syntax error in both systems. result.append(typestr + " ") result.append(key.ljust(max_field_len + 4) + "=" + str(value) + "\n") else: try: result.append(field + "=" + el.getField(field)) except AttributeError: pass # Genesis silently ignores non existent fields print("".join(result)) return "".join(result) def showfield(el, field="*", showtype=False): """Alias for showfields.""" return showfields(el, field, showtype) def listmsg(arg): """Return a list containing the incoming and outgoing messages of `el`. Parameters ---------- arg : melement/vec/str MOOSE object or path of the object to look into. Returns ------- msg : list List of Msg objects corresponding to incoming and outgoing connections of `arg`. """ obj = _moose.element(arg) assert obj return _moose.listmsg(obj) def showmsg(el): """Print the incoming and outgoing messages of `el`. Parameters ---------- el : melement/vec/str Object whose messages are to be displayed. Returns ------- None """ print(_moose.showmsg(_moose.element(el))) def doc(arg, paged=True): """Display the documentation for class or field in a class. Parameters ---------- arg : str/class/melement/vec A string specifying a moose class name and a field name separated by a dot. e.g., 'Neutral.name'. Prepending `moose.` is allowed. Thus moose.doc('moose.Neutral.name') is equivalent to the above. It can also be string specifying just a moose class name or a moose class or a moose object (instance of melement or vec or there subclasses). In that case, the builtin documentation for the corresponding moose class is displayed. paged: bool Whether to display the docs via builtin pager or print and exit. If not specified, it defaults to False and moose.doc(xyz) will print help on xyz and return control to command line. Returns ------- None Raises ------ NameError If class or field does not exist. """ text = _moose.__generatedoc__(arg) if pydoc.page: pydoc.pager(text) else: print(text) # SBML related functions. def readSBML(filepath, loadpath, solver="ee", validate=True): """Load SBML model. Parameters ---------- filepath: str filepath to be loaded. loadpath : str Root path for this model e.g. /model/mymodel solver : str Solver to use (default 'ee'). Available options are "ee", "gsl", "stochastic", "gillespie" "rk", "deterministic" For full list see ?? validate: bool When True, run the schema validation. """ return model_utils.mooseReadSBML(filepath, loadpath, solver, validate) def writeSBML(modelpath, filepath, sceneitems={}): """Writes loaded model under modelpath to a file in SBML format. Parameters ---------- modelpath : str model path in moose e.g /model/mymodel filepath : str Path of output file. sceneitems : dict UserWarning: user need not worry about this layout position is saved in Annotation field of all the moose Object (pool,Reaction,enzyme). If this function is called from * GUI - the layout position of moose object is passed * command line - NA * if genesis/kkit model is loaded then layout position is taken from the file * otherwise auto-coordinates is used for layout position. """ return model_utils.mooseWriteSBML(modelpath, filepath, sceneitems) def writeKkit(modelpath, filepath, sceneitems={}): """Writes loded model under modelpath to a file in Kkit format. Parameters ---------- modelpath : str Model path in moose. filepath : str Path of output file. """ return model_utils.mooseWriteKkit(modelpath, filepath, sceneitems) def readNML2(modelpath, verbose=False): """Load neuroml2 model. Parameters ---------- modelpath: str Path of nml2 file. verbose: True (defalt False) If True, enable verbose logging. Raises ------ FileNotFoundError: If modelpath is not found or not readable. """ return model_utils.mooseReadNML2(modelpath, verbose) def writeNML2(outfile): """Write model to NML2. (Not implemented) """ raise NotImplementedError("Writing to NML2 is not supported yet") def addChemSolver(modelpath, solver): """Add solver on chemical compartment and its children for calculation. (For developers) Parameters ---------- modelpath : str Model path that is loaded into moose. solver : str Exponential Euler "ee" is default. Other options are Gillespie ("gssa"), Runge Kutta ("gsl"/"rk"/"rungekutta"). TODO ---- Documentation See also -------- deleteChemSolver """ return model_utils.mooseAddChemSolver(modelpath, solver) def deleteChemSolver(modelpath): """Deletes solver on all the compartment and its children Notes ----- This is neccesary while created a new moose object on a pre-existing modelpath, this should be followed by mooseAddChemSolver for add solvers on to compartment to simulate else default is Exponential Euler (ee) See also -------- addChemSolver """ return model_utils.mooseDeleteChemSolver(modelpath) def mergeChemModel(modelpath, dest): """Merges two models. Merge chemical model in a file `modelpath` with existing MOOSE model at path `dest`. Parameters ---------- modelpath : str Filepath containing a chemical model. dest : path Existing MOOSE path. TODO ---- No example file which shows its use. Deprecated? """ return model_utils.mooseMergeChemModel(modelpath, dest)
BhallaLab/moose-core
python/moose/__init__.py
Python
gpl-3.0
23,812
[ "MOOSE", "NEURON" ]
22f265a4ea99da192b5df79f9f99fabc572e54856ca0e1a20f4d52d18accf397
#! /usr/bin/env python3 # -*- coding: utf-8 -*- # Copyright 2022 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # import argparse import os import libcst as cst import pathlib import sys from typing import (Any, Callable, Dict, List, Sequence, Tuple) def partition( predicate: Callable[[Any], bool], iterator: Sequence[Any] ) -> Tuple[List[Any], List[Any]]: """A stable, out-of-place partition.""" results = ([], []) for i in iterator: results[int(predicate(i))].append(i) # Returns trueList, falseList return results[1], results[0] class kmsCallTransformer(cst.CSTTransformer): CTRL_PARAMS: Tuple[str] = ('retry', 'timeout', 'metadata') METHOD_TO_PARAMS: Dict[str, Tuple[str]] = { 'asymmetric_decrypt': ('name', 'ciphertext', 'ciphertext_crc32c', ), 'asymmetric_sign': ('name', 'digest', 'digest_crc32c', 'data', 'data_crc32c', ), 'create_crypto_key': ('parent', 'crypto_key_id', 'crypto_key', 'skip_initial_version_creation', ), 'create_crypto_key_version': ('parent', 'crypto_key_version', ), 'create_ekm_connection': ('parent', 'ekm_connection_id', 'ekm_connection', ), 'create_import_job': ('parent', 'import_job_id', 'import_job', ), 'create_key_ring': ('parent', 'key_ring_id', 'key_ring', ), 'decrypt': ('name', 'ciphertext', 'additional_authenticated_data', 'ciphertext_crc32c', 'additional_authenticated_data_crc32c', ), 'destroy_crypto_key_version': ('name', ), 'encrypt': ('name', 'plaintext', 'additional_authenticated_data', 'plaintext_crc32c', 'additional_authenticated_data_crc32c', ), 'generate_random_bytes': ('location', 'length_bytes', 'protection_level', ), 'get_crypto_key': ('name', ), 'get_crypto_key_version': ('name', ), 'get_ekm_connection': ('name', ), 'get_import_job': ('name', ), 'get_key_ring': ('name', ), 'get_public_key': ('name', ), 'import_crypto_key_version': ('parent', 'algorithm', 'import_job', 'crypto_key_version', 'rsa_aes_wrapped_key', ), 'list_crypto_keys': ('parent', 'page_size', 'page_token', 'version_view', 'filter', 'order_by', ), 'list_crypto_key_versions': ('parent', 'page_size', 'page_token', 'view', 'filter', 'order_by', ), 'list_ekm_connections': ('parent', 'page_size', 'page_token', 'filter', 'order_by', ), 'list_import_jobs': ('parent', 'page_size', 'page_token', 'filter', 'order_by', ), 'list_key_rings': ('parent', 'page_size', 'page_token', 'filter', 'order_by', ), 'mac_sign': ('name', 'data', 'data_crc32c', ), 'mac_verify': ('name', 'data', 'mac', 'data_crc32c', 'mac_crc32c', ), 'restore_crypto_key_version': ('name', ), 'update_crypto_key': ('crypto_key', 'update_mask', ), 'update_crypto_key_primary_version': ('name', 'crypto_key_version_id', ), 'update_crypto_key_version': ('crypto_key_version', 'update_mask', ), 'update_ekm_connection': ('ekm_connection', 'update_mask', ), 'get_iam_policy': ('resource', 'options', ), 'set_iam_policy': ('resource', 'policy', ), 'test_iam_permissions': ('resource', 'permissions', ), } def leave_Call(self, original: cst.Call, updated: cst.Call) -> cst.CSTNode: try: key = original.func.attr.value kword_params = self.METHOD_TO_PARAMS[key] except (AttributeError, KeyError): # Either not a method from the API or too convoluted to be sure. return updated # If the existing code is valid, keyword args come after positional args. # Therefore, all positional args must map to the first parameters. args, kwargs = partition(lambda a: not bool(a.keyword), updated.args) if any(k.keyword.value == "request" for k in kwargs): # We've already fixed this file, don't fix it again. return updated kwargs, ctrl_kwargs = partition( lambda a: a.keyword.value not in self.CTRL_PARAMS, kwargs ) args, ctrl_args = args[:len(kword_params)], args[len(kword_params):] ctrl_kwargs.extend(cst.Arg(value=a.value, keyword=cst.Name(value=ctrl)) for a, ctrl in zip(ctrl_args, self.CTRL_PARAMS)) request_arg = cst.Arg( value=cst.Dict([ cst.DictElement( cst.SimpleString("'{}'".format(name)), cst.Element(value=arg.value) ) # Note: the args + kwargs looks silly, but keep in mind that # the control parameters had to be stripped out, and that # those could have been passed positionally or by keyword. for name, arg in zip(kword_params, args + kwargs)]), keyword=cst.Name("request") ) return updated.with_changes( args=[request_arg] + ctrl_kwargs ) def fix_files( in_dir: pathlib.Path, out_dir: pathlib.Path, *, transformer=kmsCallTransformer(), ): """Duplicate the input dir to the output dir, fixing file method calls. Preconditions: * in_dir is a real directory * out_dir is a real, empty directory """ pyfile_gen = ( pathlib.Path(os.path.join(root, f)) for root, _, files in os.walk(in_dir) for f in files if os.path.splitext(f)[1] == ".py" ) for fpath in pyfile_gen: with open(fpath, 'r') as f: src = f.read() # Parse the code and insert method call fixes. tree = cst.parse_module(src) updated = tree.visit(transformer) # Create the path and directory structure for the new file. updated_path = out_dir.joinpath(fpath.relative_to(in_dir)) updated_path.parent.mkdir(parents=True, exist_ok=True) # Generate the updated source file at the corresponding path. with open(updated_path, 'w') as f: f.write(updated.code) if __name__ == '__main__': parser = argparse.ArgumentParser( description="""Fix up source that uses the kms client library. The existing sources are NOT overwritten but are copied to output_dir with changes made. Note: This tool operates at a best-effort level at converting positional parameters in client method calls to keyword based parameters. Cases where it WILL FAIL include A) * or ** expansion in a method call. B) Calls via function or method alias (includes free function calls) C) Indirect or dispatched calls (e.g. the method is looked up dynamically) These all constitute false negatives. The tool will also detect false positives when an API method shares a name with another method. """) parser.add_argument( '-d', '--input-directory', required=True, dest='input_dir', help='the input directory to walk for python files to fix up', ) parser.add_argument( '-o', '--output-directory', required=True, dest='output_dir', help='the directory to output files fixed via un-flattening', ) args = parser.parse_args() input_dir = pathlib.Path(args.input_dir) output_dir = pathlib.Path(args.output_dir) if not input_dir.is_dir(): print( f"input directory '{input_dir}' does not exist or is not a directory", file=sys.stderr, ) sys.exit(-1) if not output_dir.is_dir(): print( f"output directory '{output_dir}' does not exist or is not a directory", file=sys.stderr, ) sys.exit(-1) if os.listdir(output_dir): print( f"output directory '{output_dir}' is not empty", file=sys.stderr, ) sys.exit(-1) fix_files(input_dir, output_dir)
googleapis/python-kms
scripts/fixup_kms_v1_keywords.py
Python
apache-2.0
8,355
[ "VisIt" ]
4159793087504aff34959c2afed9e8ab7fcc66343d4453d8f32e959dbaadd117
#!/usr/bin/env python # -*- coding: utf-8 -*- # (c) 2012 Michal Kalewski <mkalewski at cs.put.poznan.pl> # # This file is a part of the Simple Network Simulator (sim2net) project. # USE, MODIFICATION, COPYING AND DISTRIBUTION OF THIS SOFTWARE IS SUBJECT TO # THE TERMS AND CONDITIONS OF THE MIT LICENSE. YOU SHOULD HAVE RECEIVED A COPY # OF THE MIT LICENSE ALONG WITH THIS SOFTWARE; IF NOT, YOU CAN DOWNLOAD A COPY # FROM HTTP://WWW.OPENSOURCE.ORG/. # # For bug reports, feature and support requests please visit # <https://github.com/mkalewski/sim2net/issues>. """ This package provides a collection of speed distribution classes. Speed is a scalar quantity that describes the rate of change of a node position in a simulation area (see: :mod:`sim2net.area`). .. note:: In all speed distribution classes the quantity of speed should be considered as simulation area units per one *simulation time* unit (see: :mod:`sim2net._time`). For example, the value of speed equal to :math:`5` would mean *five units of simulation area per one unit of simulation time*. """ __docformat__ = 'reStructuredText' __all__ = ['constant', 'normal', 'uniform']
mkalewski/sim2net
sim2net/speed/__init__.py
Python
mit
1,175
[ "VisIt" ]
5db82b400bb7f81c14cfd2be5f8c8ab7f5b384f2270460711712a14820a41656
######################################################################## # # (C) 2015, Brian Coca <bcoca@ansible.com> # # This file is part of Ansible # # Ansible is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # Ansible is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with Ansible. If not, see <http://www.gnu.org/licenses/>. # ######################################################################## from __future__ import (absolute_import, division, print_function) __metaclass__ = type import errno import datetime import os import tarfile import tempfile import yaml from distutils.version import LooseVersion from shutil import rmtree from ansible import context from ansible.errors import AnsibleError from ansible.galaxy.user_agent import user_agent from ansible.module_utils._text import to_native, to_text from ansible.module_utils.urls import open_url from ansible.playbook.role.requirement import RoleRequirement from ansible.utils.display import Display display = Display() class GalaxyRole(object): SUPPORTED_SCMS = set(['git', 'hg']) META_MAIN = (os.path.join('meta', 'main.yml'), os.path.join('meta', 'main.yaml')) META_INSTALL = os.path.join('meta', '.galaxy_install_info') META_REQUIREMENTS = (os.path.join('meta', 'requirements.yml'), os.path.join('meta', 'requirements.yaml')) ROLE_DIRS = ('defaults', 'files', 'handlers', 'meta', 'tasks', 'templates', 'vars', 'tests') def __init__(self, galaxy, api, name, src=None, version=None, scm=None, path=None): self._metadata = None self._requirements = None self._install_info = None self._validate_certs = not context.CLIARGS['ignore_certs'] display.debug('Validate TLS certificates: %s' % self._validate_certs) self.galaxy = galaxy self.api = api self.name = name self.version = version self.src = src or name self.scm = scm self.paths = [os.path.join(x, self.name) for x in galaxy.roles_paths] if path is not None: if not path.endswith(os.path.join(os.path.sep, self.name)): path = os.path.join(path, self.name) else: # Look for a meta/main.ya?ml inside the potential role dir in case # the role name is the same as parent directory of the role. # # Example: # ./roles/testing/testing/meta/main.yml for meta_main in self.META_MAIN: if os.path.exists(os.path.join(path, name, meta_main)): path = os.path.join(path, self.name) break self.path = path else: # use the first path by default self.path = os.path.join(galaxy.roles_paths[0], self.name) def __repr__(self): """ Returns "rolename (version)" if version is not null Returns "rolename" otherwise """ if self.version: return "%s (%s)" % (self.name, self.version) else: return self.name def __eq__(self, other): return self.name == other.name @property def metadata(self): """ Returns role metadata """ if self._metadata is None: for path in self.paths: for meta_main in self.META_MAIN: meta_path = os.path.join(path, meta_main) if os.path.isfile(meta_path): try: with open(meta_path, 'r') as f: self._metadata = yaml.safe_load(f) except Exception: display.vvvvv("Unable to load metadata for %s" % self.name) return False break return self._metadata @property def install_info(self): """ Returns role install info """ if self._install_info is None: info_path = os.path.join(self.path, self.META_INSTALL) if os.path.isfile(info_path): try: f = open(info_path, 'r') self._install_info = yaml.safe_load(f) except Exception: display.vvvvv("Unable to load Galaxy install info for %s" % self.name) return False finally: f.close() return self._install_info @property def _exists(self): for path in self.paths: if os.path.isdir(path): return True return False def _write_galaxy_install_info(self): """ Writes a YAML-formatted file to the role's meta/ directory (named .galaxy_install_info) which contains some information we can use later for commands like 'list' and 'info'. """ info = dict( version=self.version, install_date=datetime.datetime.utcnow().strftime("%c"), ) if not os.path.exists(os.path.join(self.path, 'meta')): os.makedirs(os.path.join(self.path, 'meta')) info_path = os.path.join(self.path, self.META_INSTALL) with open(info_path, 'w+') as f: try: self._install_info = yaml.safe_dump(info, f) except Exception: return False return True def remove(self): """ Removes the specified role from the roles path. There is a sanity check to make sure there's a meta/main.yml file at this path so the user doesn't blow away random directories. """ if self.metadata: try: rmtree(self.path) return True except Exception: pass return False def fetch(self, role_data): """ Downloads the archived role to a temp location based on role data """ if role_data: # first grab the file and save it to a temp location if "github_user" in role_data and "github_repo" in role_data: archive_url = 'https://github.com/%s/%s/archive/%s.tar.gz' % (role_data["github_user"], role_data["github_repo"], self.version) else: archive_url = self.src display.display("- downloading role from %s" % archive_url) try: url_file = open_url(archive_url, validate_certs=self._validate_certs, http_agent=user_agent()) temp_file = tempfile.NamedTemporaryFile(delete=False) data = url_file.read() while data: temp_file.write(data) data = url_file.read() temp_file.close() return temp_file.name except Exception as e: display.error(u"failed to download the file: %s" % to_text(e)) return False def install(self): if self.scm: # create tar file from scm url tmp_file = RoleRequirement.scm_archive_role(keep_scm_meta=context.CLIARGS['keep_scm_meta'], **self.spec) elif self.src: if os.path.isfile(self.src): tmp_file = self.src elif '://' in self.src: role_data = self.src tmp_file = self.fetch(role_data) else: role_data = self.api.lookup_role_by_name(self.src) if not role_data: raise AnsibleError("- sorry, %s was not found on %s." % (self.src, self.api.api_server)) if role_data.get('role_type') == 'APP': # Container Role display.warning("%s is a Container App role, and should only be installed using Ansible " "Container" % self.name) role_versions = self.api.fetch_role_related('versions', role_data['id']) if not self.version: # convert the version names to LooseVersion objects # and sort them to get the latest version. If there # are no versions in the list, we'll grab the head # of the master branch if len(role_versions) > 0: loose_versions = [LooseVersion(a.get('name', None)) for a in role_versions] try: loose_versions.sort() except TypeError: raise AnsibleError( 'Unable to compare role versions (%s) to determine the most recent version due to incompatible version formats. ' 'Please contact the role author to resolve versioning conflicts, or specify an explicit role version to ' 'install.' % ', '.join([v.vstring for v in loose_versions]) ) self.version = to_text(loose_versions[-1]) elif role_data.get('github_branch', None): self.version = role_data['github_branch'] else: self.version = 'master' elif self.version != 'master': if role_versions and to_text(self.version) not in [a.get('name', None) for a in role_versions]: raise AnsibleError("- the specified version (%s) of %s was not found in the list of available versions (%s)." % (self.version, self.name, role_versions)) # check if there's a source link for our role_version for role_version in role_versions: if role_version['name'] == self.version and 'source' in role_version: self.src = role_version['source'] tmp_file = self.fetch(role_data) else: raise AnsibleError("No valid role data found") if tmp_file: display.debug("installing from %s" % tmp_file) if not tarfile.is_tarfile(tmp_file): raise AnsibleError("the downloaded file does not appear to be a valid tar archive.") else: role_tar_file = tarfile.open(tmp_file, "r") # verify the role's meta file meta_file = None members = role_tar_file.getmembers() # next find the metadata file for member in members: for meta_main in self.META_MAIN: if meta_main in member.name: # Look for parent of meta/main.yml # Due to possibility of sub roles each containing meta/main.yml # look for shortest length parent meta_parent_dir = os.path.dirname(os.path.dirname(member.name)) if not meta_file: archive_parent_dir = meta_parent_dir meta_file = member else: if len(meta_parent_dir) < len(archive_parent_dir): archive_parent_dir = meta_parent_dir meta_file = member if not meta_file: raise AnsibleError("this role does not appear to have a meta/main.yml file.") else: try: self._metadata = yaml.safe_load(role_tar_file.extractfile(meta_file)) except Exception: raise AnsibleError("this role does not appear to have a valid meta/main.yml file.") # we strip off any higher-level directories for all of the files contained within # the tar file here. The default is 'github_repo-target'. Gerrit instances, on the other # hand, does not have a parent directory at all. installed = False while not installed: display.display("- extracting %s to %s" % (self.name, self.path)) try: if os.path.exists(self.path): if not os.path.isdir(self.path): raise AnsibleError("the specified roles path exists and is not a directory.") elif not context.CLIARGS.get("force", False): raise AnsibleError("the specified role %s appears to already exist. Use --force to replace it." % self.name) else: # using --force, remove the old path if not self.remove(): raise AnsibleError("%s doesn't appear to contain a role.\n please remove this directory manually if you really " "want to put the role here." % self.path) else: os.makedirs(self.path) # now we do the actual extraction to the path for member in members: # we only extract files, and remove any relative path # bits that might be in the file for security purposes # and drop any containing directory, as mentioned above if member.isreg() or member.issym(): n_member_name = to_native(member.name) n_archive_parent_dir = to_native(archive_parent_dir) n_parts = n_member_name.replace(n_archive_parent_dir, "", 1).split(os.sep) n_final_parts = [] for n_part in n_parts: # TODO if the condition triggers it produces a broken installation. # It will create the parent directory as an empty file and will # explode if the directory contains valid files. # Leaving this as is since the whole module needs a rewrite. if n_part != '..' and not n_part.startswith('~') and '$' not in n_part: n_final_parts.append(n_part) member.name = os.path.join(*n_final_parts) role_tar_file.extract(member, to_native(self.path)) # write out the install info file for later use self._write_galaxy_install_info() installed = True except OSError as e: error = True if e.errno == errno.EACCES and len(self.paths) > 1: current = self.paths.index(self.path) if len(self.paths) > current: self.path = self.paths[current + 1] error = False if error: raise AnsibleError("Could not update files in %s: %s" % (self.path, to_native(e))) # return the parsed yaml metadata display.display("- %s was installed successfully" % str(self)) if not (self.src and os.path.isfile(self.src)): try: os.unlink(tmp_file) except (OSError, IOError) as e: display.warning(u"Unable to remove tmp file (%s): %s" % (tmp_file, to_text(e))) return True return False @property def spec(self): """ Returns role spec info { 'scm': 'git', 'src': 'http://git.example.com/repos/repo.git', 'version': 'v1.0', 'name': 'repo' } """ return dict(scm=self.scm, src=self.src, version=self.version, name=self.name) @property def requirements(self): """ Returns role requirements """ if self._requirements is None: self._requirements = [] for meta_requirements in self.META_REQUIREMENTS: meta_path = os.path.join(self.path, meta_requirements) if os.path.isfile(meta_path): try: f = open(meta_path, 'r') self._requirements = yaml.safe_load(f) except Exception: display.vvvvv("Unable to load requirements for %s" % self.name) finally: f.close() break return self._requirements
s-hertel/ansible
lib/ansible/galaxy/role.py
Python
gpl-3.0
17,649
[ "Brian", "Galaxy" ]
b54bd525015a6ba5b9e9db92e3d17adde7db9834f45eed13d9a2311fa188f7e1
# Generated from antlr4-python3-runtime-4.7.2/src/autogen/Grammar.g4 by ANTLR 4.7.2 from antlr4 import * if __name__ is not None and "." in __name__: from .GrammarParser import GrammarParser else: from GrammarParser import GrammarParser # This class defines a complete generic visitor for a parse tree produced by GrammarParser. ''' COMO RESGATAR INFORMAÇÕES DA ÁRVORE Observe o seu Grammar.g4. Cada regra sintática gera uma função com o nome corespondente no Visitor e na ordem em que está na gramática. Se for utilizar sua gramática do projeto 1, por causa de conflitos com Python, substitua as regras file por fiile e type por tyype. Use prints temporários para ver se está no caminho certo. "make tree" agora desenha a árvore sintática, se quiser vê-la para qualquer input, enquanto "make" roda este visitor sobre o a árvore gerada a partir de Grammar.g4 alimentada pelo input. Exemplos: # Obs.: Os exemplos abaixo utilizam nós 'expression', mas servem apra qualquer tipo de nó self.visitChildren(ctx) # visita todos os filhos do nó atual expr = self.visit(ctx.expression()) # visita a subárvore do nó expression e retorna o valor retornado na função "visitRegra" for i in range(len(ctx.expression())): # para cada expressão que este nó possui... ident = ctx.expression(i) # ...pegue a i-ésima expressão if ctx.FLOAT() != None: # se houver um FLOAT (em vez de INT ou VOID) neste nó (parser) return Type.FLOAT # retorne tipo float ctx.identifier().getText() # Obtém o texto contido no nó (neste caso, será obtido o nome do identifier) token = ctx.identifier(i).IDENTIFIER().getPayload() # Obtém o token referente à uma determinada regra léxica (neste caso, IDENTIFIER) token.line # variável com a linha do token token.column # variável com a coluna do token ''' # Dica: Retorne Type.INT, Type.FLOAT, etc. Nos nós e subnós das expressões para fazer a checagem de tipos enquanto percorre a expressão. class Type: VOID = "void" INT = "int" FLOAT = "float" STRING = "char *" class GrammarCheckerVisitor(ParseTreeVisitor): ids_defined = {} # Dicionário para armazenar as informações necessárias para cada identifier definido inside_what_function = "" # String que guarda a função atual que o visitor está visitando. Útil para acessar dados da função durante a visitação da árvore sintática da função. # Visit a parse tree produced by GrammarParser#fiile. def visitFiile(self, ctx:GrammarParser.FiileContext): return self.visitChildren(ctx) # Visit a parse tree produced by GrammarParser#function_definition. def visitFunction_definition(self, ctx:GrammarParser.Function_definitionContext): tyype = ctx.tyype().getText() name = ctx.identifier().getText() params = self.visit(ctx.arguments()) self.ids_defined[name] = tyype, params, None self.inside_what_function = name self.visit(ctx.body()) return # Visit a parse tree produced by GrammarParser#body. def visitBody(self, ctx:GrammarParser.BodyContext): return self.visitChildren(ctx) # Visit a parse tree produced by GrammarParser#statement. def visitStatement(self, ctx:GrammarParser.StatementContext): return self.visitChildren(ctx) # Visit a parse tree produced by GrammarParser#if_statement. def visitIf_statement(self, ctx:GrammarParser.If_statementContext): return self.visitChildren(ctx) # Visit a parse tree produced by GrammarParser#else_statement. def visitElse_statement(self, ctx:GrammarParser.Else_statementContext): return self.visitChildren(ctx) # Visit a parse tree produced by GrammarParser#for_loop. def visitFor_loop(self, ctx:GrammarParser.For_loopContext): return self.visitChildren(ctx) # Visit a parse tree produced by GrammarParser#for_initializer. def visitFor_initializer(self, ctx:GrammarParser.For_initializerContext): return self.visitChildren(ctx) # Visit a parse tree produced by GrammarParser#for_condition. def visitFor_condition(self, ctx:GrammarParser.For_conditionContext): return self.visitChildren(ctx) # Visit a parse tree produced by GrammarParser#for_step. def visitFor_step(self, ctx:GrammarParser.For_stepContext): return self.visitChildren(ctx) # Visit a parse tree produced by GrammarParser#variable_definition. def visitVariable_definition(self, ctx:GrammarParser.Variable_definitionContext): return self.visitChildren(ctx) # Visit a parse tree produced by GrammarParser#variable_assignment. def visitVariable_assignment(self, ctx:GrammarParser.Variable_assignmentContext): return self.visitChildren(ctx) # Visit a parse tree produced by GrammarParser#expression. def visitExpression(self, ctx:GrammarParser.ExpressionContext): return self.visitChildren(ctx) # Visit a parse tree produced by GrammarParser#array. def visitArray(self, ctx:GrammarParser.ArrayContext): return self.visitChildren(ctx) # Visit a parse tree produced by GrammarParser#array_literal. def visitArray_literal(self, ctx:GrammarParser.Array_literalContext): return self.visitChildren(ctx) # Visit a parse tree produced by GrammarParser#function_call. def visitFunction_call(self, ctx:GrammarParser.Function_callContext): return self.visitChildren(ctx) # Visit a parse tree produced by GrammarParser#arguments. def visitArguments(self, ctx:GrammarParser.ArgumentsContext): return self.visitChildren(ctx) # Visit a parse tree produced by GrammarParser#tyype. def visitTyype(self, ctx:GrammarParser.TyypeContext): return self.visitChildren(ctx) # Visit a parse tree produced by GrammarParser#integer. def visitInteger(self, ctx:GrammarParser.IntegerContext): return self.visitChildren(ctx) # Visit a parse tree produced by GrammarParser#floating. def visitFloating(self, ctx:GrammarParser.FloatingContext): return self.visitChildren(ctx) # Visit a parse tree produced by GrammarParser#string. def visitString(self, ctx:GrammarParser.StringContext): return self.visitChildren(ctx) # Visit a parse tree produced by GrammarParser#identifier. def visitIdentifier(self, ctx:GrammarParser.IdentifierContext): return self.visitChildren(ctx)
damorim/compilers-cin
2020_3/projeto2/GrammarCheckerVisitor.py
Python
mit
6,465
[ "VisIt" ]
23ecee7a205bba68d87700c4d8e923e6adb51fe70c6b548f69c2e77463ea987e
# -*- Mode: python; tab-width: 4; indent-tabs-mode:nil; coding:utf-8 -*- # vim: tabstop=4 expandtab shiftwidth=4 softtabstop=4 fileencoding=utf-8 # # MDAnalysis --- http://www.mdanalysis.org # Copyright (c) 2006-2016 The MDAnalysis Development Team and contributors # (see the file AUTHORS for the full list of names) # # Released under the GNU Public Licence, v2 or any higher version # # Please cite your use of MDAnalysis in published work: # # R. J. Gowers, M. Linke, J. Barnoud, T. J. E. Reddy, M. N. Melo, S. L. Seyler, # D. L. Dotson, J. Domanski, S. Buchoux, I. M. Kenney, and O. Beckstein. # MDAnalysis: A Python package for the rapid analysis of molecular dynamics # simulations. In S. Benthall and S. Rostrup editors, Proceedings of the 15th # Python in Science Conference, pages 102-109, Austin, TX, 2016. SciPy. # # N. Michaud-Agrawal, E. J. Denning, T. B. Woolf, and O. Beckstein. # MDAnalysis: A Toolkit for the Analysis of Molecular Dynamics Simulations. # J. Comput. Chem. 32 (2011), 2319--2327, doi:10.1002/jcc.21787 # from __future__ import absolute_import from numpy.testing import ( dec, assert_, assert_equal, ) from nose.plugins.attrib import attr import MDAnalysis as mda from MDAnalysisTests import parser_not_found, make_Universe from MDAnalysis.tests.datafiles import PSF, DCD class TestSegment(object): def setUp(self): self.universe = make_Universe(('segids',)) self.sB = self.universe.segments[1] def test_type(self): assert_(isinstance(self.sB, mda.core.groups.Segment)) assert_equal(self.sB.segid, "SegB") def test_index(self): s = self.sB res = s.residues[3] assert_(isinstance(res, mda.core.groups.Residue)) def test_slicing(self): res = self.sB.residues[:3] assert_equal(len(res), 3) assert_(isinstance(res, mda.core.groups.ResidueGroup)) def test_advanced_slicing(self): res = self.sB.residues[[2, 1, 0, 2]] assert_equal(len(res), 4) assert_(isinstance(res, mda.core.groups.ResidueGroup)) def test_atom_order(self): assert_equal(self.universe.segments[0].atoms.indices, sorted(self.universe.segments[0].atoms.indices)) @attr("issue") @dec.skipif(parser_not_found('DCD'), 'DCD parser not available. Are you using python 3?') def test_generated_residueselection(): """Test that a generated residue group always returns a ResidueGroup (Issue 47) unless there is a single residue (Issue 363 change)""" universe = mda.Universe(PSF, DCD) # only a single Cys in AdK cys = universe.s4AKE.CYS assert_(isinstance(cys, mda.core.groups.Residue), "Single Cys77 is NOT returned as a single Residue (Issue 47)") # multiple Met met = universe.s4AKE.MET assert_(isinstance(met, mda.core.groups.ResidueGroup), "Met selection does not return a ResidueGroup") del universe
kain88-de/mdanalysis
testsuite/MDAnalysisTests/core/test_segment.py
Python
gpl-2.0
2,949
[ "MDAnalysis" ]
44ef8ad2357f7e436a968688c0f897d9cbcb5632f12cbdf230936eef60d908ea
""" ================ Neuropop Example ================ A demonstration of Neuropop using simulated data """ ######################################################## import numpy as np import matplotlib.pyplot as plt from spykes.ml.neuropop import NeuroPop from spykes.utils import train_test_split ######################################################## # Create a NeuroPop object # ----------------------------- n_neurons = 10 pop = NeuroPop(n_neurons=n_neurons, tunemodel='glm') ######################################################## # Simulate a population of neurons # ----------------------------- n_samples = 1000 x, Y, mu, k0, k, g, b = pop.simulate(pop.tunemodel, n_samples=n_samples, winsize=400.0) ######################################################## # Split into training and testing sets # ----------------------------- np.random.seed(42) (Y_train, Y_test), (x_train, x_test) = train_test_split(Y, x, percent=0.5) ######################################################## # Fit the tuning curves with gradient descent # ----------------------------- pop.fit(x_train, Y_train) ######################################################## # Predict the population activity with the fit tuning curves # ----------------------------- Yhat_test = pop.predict(x_test) ######################################################## # Score the prediction # ----------------------------- Ynull = np.mean(Y_train, axis=0) pseudo_R2 = pop.score(Y_test, Yhat_test, Ynull, method='pseudo_R2') print(pseudo_R2) ######################################################## # Plot the simulated and fit tuning curves # ----------------------------- plt.figure(figsize=[15, 15]) for neuron in range(pop.n_neurons): plt.subplot(4, 3, neuron + 1) pop.display(x_test, Y_test[:, neuron], neuron=neuron, ylim=[0.8 * np.min(Y_test[:, neuron]), 1.2 * np.max(Y_test[:, neuron])]) plt.show() ######################################################## # Decode feature from the population activity # ----------------------------- xhat_test = pop.decode(Y_test) ######################################################## # Visualize ground truth vs. decoded estimates # ----------------------------- plt.figure(figsize=[6, 5]) plt.plot(x_test, xhat_test, 'k.', alpha=0.5) plt.xlim([-1.2 * np.pi, 1.2 * np.pi]) plt.ylim([-1.2 * np.pi, 1.2 * np.pi]) plt.xlabel('Ground truth [radians]') plt.ylabel('Decoded [radians]') plt.tick_params(axis='y', right='off') plt.tick_params(axis='x', top='off') ax = plt.gca() ax.spines['top'].set_visible(False) ax.spines['right'].set_visible(False) plt.figure(figsize=[15, 5]) jitter = 0.2 * np.random.rand(x_test.shape[0]) plt.subplot(132, polar=True) plt.plot(x_test, np.ones(x_test.shape[0]) + jitter, 'ko', alpha=0.5) plt.title('Ground truth') plt.subplot(133, polar=True) plt.plot(xhat_test, np.ones(xhat_test.shape[0]) + jitter, 'co', alpha=0.5) plt.title('Decoded') plt.show() ######################################################## # Score decoding performance # ----------------------------- # Circular correlation circ_corr = pop.score(x_test, xhat_test, method='circ_corr') print('Circular correlation: %f' % (circ_corr)) ######################################################## # Cosine distance cosine_dist = pop.score(x_test, xhat_test, method='cosine_dist') print('Cosine distance: %f' % (cosine_dist))
codekansas/spykes
examples/plot_neuropop_simul_example.py
Python
mit
3,434
[ "NEURON" ]
19d6ca371847bd64a76ee9cf3d9dae6f16715df07b39eaea7ec7b9f6ed89172d
from __future__ import division import copy import numpy import random import re RUNNERS = [ ["Adam", "0:05:47", "M"], ["Ali", "0:06:38", "F"], ["Andrew", "0:06:55", "M"], ["Blonde Megan", "0:08:38", "F"], # ["Brian", "0:06:43", "M"], # ["Brian Tall", "0:06:24", "M"], # ["Collin", "0:06:14", "M"], # ["Dave", "0:06:01", "M"], # ["Dylan", "0:06:43", "M"], # ["Jake", "0:06:55", "M"], ["James", "0:07:51", "M"], ["Jason", "0:07:27", "M"], ["Jdao", "0:07:34", "M"], ["Jimbo", "0:07:51", "M"], ["Joe", "0:07:03", "M"], ["John", "0:07:15", "M"], ["Lauren", "0:08:09", "F"], ["Mark", "0:07:18", "M"], ["Matt", "0:05:54", "M"], ["Meaghan Creamer", "0:06:53", "F"], ["Ncik", "0:06:24", "M"], ["Nick", "0:06:21", "M"], ["Nicole", "0:08:38", "F"], ["Olivia", "0:07:25", "F"], ["Parks", "0:07:44", "M"], ["Poot", "0:07:19", "M"], ["Sam Tall", "0:05:23", "M"], ["Shaundry", "0:08:30", "F"], ["Tommy Doug", "0:05:48", "M"], ["Tucker", "0:07:10", "M"] ] NUM_TEAMS = 4 NUM_RUNS = 5000 # Statistic weights TIME_WEIGHT = 1 TEAM_SIZE_WEIGHT = 10 GENDER_WEIGHT = 100 class Player(object): def __init__(self, name, time_string, gender): self.name = name self.time_string = time_string self.gender = gender @staticmethod def _get_numeric_time(time): """time is of the form "H:MM:SS". We convert to total seconds""" _, minutes, seconds = map(int, re.split(":", time)) return minutes * 60 + seconds def get_time(self): return self._get_numeric_time(self.time_string) def is_male(self): return self.gender == "M" class Team(set): def __str__(self): return(" Time: {}. {} players, {} male: {}".format( self.total_time(), len(self), self.num_males(), ", ".join([player.name for player in self]))) def total_time(self): return sum([player.get_time() for player in self]) def num_males(self): return len([player for player in self if player.is_male()]) class Solution(object): def __init__(self): self.teams = [] for _ in range(NUM_TEAMS): self.teams.append(Team()) def fitness_score(self): # We use the measures of three variances to determine our score: # - total team mile time # - num males on the team # - team size # # The lowest score will be the one that does the best at minimizing the # difference between teams in these catagories. time_variance = numpy.var([team.total_time() for team in self.teams]) team_size_variance = numpy.var([len(team) for team in self.teams]) gender_variance = numpy.var([team.num_males() for team in self.teams]) return(time_variance * TIME_WEIGHT + team_size_variance * TEAM_SIZE_WEIGHT + gender_variance * GENDER_WEIGHT) def add_player_to_random_team(self, player): random.choice(self.teams).add(player) def change_random_player(self): old_team = random.choice(self.teams) if len(old_team) == 0: print "empty team" return player = random.sample(old_team, 1)[0] old_team.remove(player) new_team = random.choice(self.teams) new_team.add(player) def __str__(self): return "\n".join(map(str, self.teams)) def main(): initial_solution = Solution() for name, time, gender in RUNNERS: initial_solution.add_player_to_random_team(Player(name, time, gender)) print("Splitting {} players ({} male) into {} teams".format( len(RUNNERS), len([runner for runner in RUNNERS if runner[2] == "M"]), NUM_TEAMS)) print("Starting with solution score {:.2f}:\n{}".format( initial_solution.fitness_score(), initial_solution)) for run_num in range(NUM_RUNS): if run_num % 1000 == 0: print("Current best solution with score {:.2f}:\n{}".format( initial_solution.fitness_score(), initial_solution)) solution = copy.deepcopy(initial_solution) for _ in range(random.randint(1, 10)): solution.change_random_player() if solution.fitness_score() < initial_solution.fitness_score(): initial_solution = solution print("Best solution found, with solution score {:.2f}:\n{}".format( initial_solution.fitness_score(), initial_solution)) if __name__ == "__main__": main()
topher200/balanced-teams
balanced_teams.py
Python
mit
4,353
[ "Brian" ]
5fdc6dafb0601337fc225d826dd51594537293ce9153e98087c31ad435dfc672
# -*- coding: utf-8 -*- """Specifies static assets (CSS, JS) required by the CATMAID front-end. This module specifies all the static files that are required by the CATMAID front-end. The configuration is separated in libraries and CATMAID's own files: Libraries: To add a new library, add a new entry into the libraries_js dictionary and, if needed, add the libraries CSS files to sourcefiles tuple of the 'library' entry in the ``STYLESHEETS`` dictionary. CATMAID files: By default all CSS files in the ``static/css`` directory are included as well as all JavaScript files in ``static/js`` and CATMAID's subdirectories in it. However, if you want to add new files explicitly, add CSS to the source_filenames tuple in the 'catmaid' entry of the ``STYLESHEETS`` dictionary. JavaScript files go into the 'catmaid' entry of the ``JAVASCRIPT`` dictonary at the end of this file. """ from collections import OrderedDict from importlib import import_module # python module names of CATMAID extensions which could potentially be installed KNOWN_EXTENSIONS = ( 'synapsesuggestor', 'autoproofreader', 'circuitmap', ) class PipelineSpecUpdater(object): def __init__(self, input_dict=None): if input_dict is None: input_dict = OrderedDict() self.result = input_dict self.existing_output_files = set() def update(self, other_dict, key_prefix='catmaid-ext-'): """Include items from other_dict in the input dict, ensuring that no data will be overwritten and the result will not cause multiple libraries to create static files of the same name. key_prefix will be prepended to the keys in other_dict when they are inserted into the input dict (default 'catmaid-ext-').""" for key, value in other_dict.items(): new_key = key_prefix + str(key) assert new_key not in self.result, 'Extension static file IDs must not overwrite existing static file IDs' assert value['output_filename'] not in self.existing_output_files, \ 'Extension static files must not overwrite existing static files ({})'.format(value['output_filename']) self.existing_output_files.add(value['output_filename']) self.result['{}{}'.format(key_prefix, key)] = value STYLESHEETS = OrderedDict() STYLESHEETS['libraries'] = { 'source_filenames': ( 'libs/jquery/themes/smoothness/jquery-ui.css', 'libs/jquery/datatable/css/demo_table.css', 'libs/jquery/datatable/extras/Buttons/css/buttons.dataTables.css', 'libs/jquery/jquery.growl.css', 'libs/jquery/jquery-ui.combobox.css', 'libs/jsTree/themes/default/style.css', ), 'output_filename': 'css/libraries.css', 'extra_context': { 'media': 'screen,projection', } } STYLESHEETS['catmaid'] = { 'source_filenames': ( 'css/*.css', ), 'output_filename': 'css/catmaid.css', 'extra_context': { 'media': 'screen,projection', } } libraries_js = OrderedDict([ ('modernizr', ['*.js']), ('jquery', ['jquery-2.1.3.min.js', 'jquery-ui.min.js', 'jquery-ui.*.js', 'jquery.dataTables.min.js', 'jquery.*.js', 'dataTables.buttons.js', 'buttons.html5.min.js']), ('jszip', ['*.js']), ('jsTree', ['jstree.js']), ('colorpicker', ['colors.js', 'colorPicker.data.js', 'colorPicker.js', 'jqColor.js']), ('fabric.js', ['all.modified.js']), ('raphael', ['raphael.js', 'g.raphael.js', 'g.pie-min.js', 'g.line.altered.js', 'raphael-custom.js', 'colorwheel.js', 'raphael.export.js']), ('d3', ['d3.v3.js', 'venn.js', 'mds.js', 'colorbrewer.js']), ('sylvester', ['sylvester.js']), ('msgpack-lite', ['msgpack.min.js']), ('numeric', ['numeric-1.2.6.js']), ('numjs', ['numjs.min.js']), ('three.js', ['three.js', 'controls/TrackballControls.js', 'camera/CombinedCamera.js', 'WebGL.js', 'lines/LineSegmentsGeometry.js', 'lines/LineGeometry.js', 'lines/LineSegments2.js', 'lines/Line2.js', 'lines/LineMaterial.js', 'loaders/VRMLLoader.js', 'lines/Wireframe.js', 'lines.WireframeGeometry2', 'loaders/VRMLLoader.js', 'renderer/Projector.js', 'renderer/SVGRenderer.js', 'exporters/OBJExporter.js', 'math/Lut.js', 'modifiers/*.js']), ('threex', ['*.js']), ('plotly', ['*.js']), ('pixi.js', ['*.js']), ('pointyjs', ['*.js']), ('cytoscapejs', ['cytoscape.js', 'cytoscape-spread.js', 'arbor.js', 'cytoscape-arbor.js', 'cola.js', 'cytoscape-cola.js', 'dagre.js', 'cytoscape-dagre.js', 'springy.js', 'cytoscape-springy.js']), ('jsnetworkx', ['*.js']), ('filesaver', ['*.js']), ('screw-filereader', ['*.js']), ('streamsaver', ['StreamSaver.js', 'polyfill.min.js']), ('webm-writer.js', ['*.js']), ('blazy', ['blazy.min.js']), ('geometry', ['geometry.js', 'intersects.js']), # order matters ('catmaid', ['namespace.js', 'error.js', 'events.js', 'request.js', 'tools.js', 'lru-cache.js', 'CATMAID.js', 'state.js', 'command.js', 'models/*.js', 'skeleton_source.js', 'datastores.js', 'settings-manager.js', '*.js']), ]) JAVASCRIPT = OrderedDict() for k, v in libraries_js.items(): JAVASCRIPT[k + '-lib'] = { 'source_filenames': ['libs/%s/%s' % (k, f) for f in v], 'output_filename': 'js/libs/%s-lib.js' % k, } # Some libraries expect their own JavaScript files to be available under a # particular name. Therefore, we can't use pipeline with them and include them # separately. Entries follow the same pattern as above: key - path. non_pipeline_js = {} # Even non-pipeline files have to be made known to pipeline, because it takes # care of collecting them into the STATIC_ROOT directory. for k, v in non_pipeline_js.items(): JAVASCRIPT[k] = { 'source_filenames': [v], 'output_filename': v } # Like non_pipeline_js, these files aren't compressed. They are however only # copied to the output directory and are not supposed to be imported/loaded by # the front-end. copy_only_files = { 'streamsaver-worker-1': 'libs/streamsaver/worker/mitm.html', 'streamsaver-worker-2': 'libs/streamsaver/worker/ping.html', 'streamsaver-worker-3': 'libs/streamsaver/worker/ping.js', 'streamsaver-worker-4': 'libs/streamsaver/worker/sw.js', 'neuroglancer-worker': 'libs/neuroglancer/chunk_worker.bundle.js', 'neuroglancer-draco': 'libs/neuroglancer/draco.bundle.js', 'neuroglancer-tfjs-library': 'libs/neuroglancer/tfjs-library.bundle.js', 'neuroglancer-async-computation': 'libs/neuroglancer/async_computation.bundle.js', 'neuroglancer-main': 'libs/neuroglancer/main.bundle.js', } # Let pipeline know about copy-only files. for k, v in copy_only_files.items(): JAVASCRIPT[k] = { 'source_filenames': [v], 'output_filename': v } # Regular CATMAID front-end files JAVASCRIPT['catmaid'] = { 'source_filenames': ( 'js/CATMAID.js', 'js/dom.js', 'js/extensions.js', 'js/data-view.js', 'js/action.js', 'js/settings-manager.js', 'js/helpers/*.js', 'js/init.js', 'js/network-api.js', 'js/project.js', 'js/stack.js', 'js/reoriented-stack.js', 'js/stack-viewer.js', 'js/tile-source.js', 'js/treelines.js', 'js/ui.js', 'js/layout.js', 'js/user.js', 'js/remote.js', 'js/WindowMaker.js', 'js/command.js', 'js/skeleton-model.js', 'js/skeleton-group.js', 'js/time-series.js', 'js/tools/navigator.js', 'js/tools/box-selection-tool.js', 'js/tools/roi-tool.js', 'js/tools/*.js', 'js/layers/stack-layer.js', 'js/layers/tile-layer.js', 'js/layers/pixi-layer.js', 'js/layers/pixi-tile-layer.js', 'js/layers/*.js', 'js/widgets/detail-dialog.js', 'js/widgets/options-dialog.js', 'js/3d/*.js', 'js/image-block.js', 'js/label-annotations.js', 'js/widgets/*.js', ), 'output_filename': 'js/catmaid.js', } installed_extensions = [] stylesheet_updater = PipelineSpecUpdater(STYLESHEETS) non_pipeline_js_updater = PipelineSpecUpdater(non_pipeline_js) javascript_updater = PipelineSpecUpdater(JAVASCRIPT) for app_name in KNOWN_EXTENSIONS: try: app = import_module(app_name) installed_extensions.append(app_name) app_pipelinefiles = import_module(app_name + '.pipelinefiles') except ImportError: continue try: stylesheet_updater.update(app_pipelinefiles.STYLESHEETS) except AttributeError: pass try: non_pipeline_js_updater.update(app_pipelinefiles.non_pipeline_js) except AttributeError: pass try: javascript_updater.update(app_pipelinefiles.JAVASCRIPT) except AttributeError: pass
tomka/CATMAID
django/projects/mysite/pipelinefiles.py
Python
gpl-3.0
9,206
[ "Cytoscape" ]
6c474875998aa5b49296a4eee5a00dd669a5b984c3cdec4482b7ab918619b6e5
from ase.structure import molecule from gpaw import GPAW from gpaw import dscf from gpaw.test import equal # Ground state calculation calc = GPAW(mode='lcao', basis='dzp', nbands=8, h=0.2, xc='PBE', spinpol=True, convergence={'energy': 100, 'density': 1e-3, 'bands': -1}) CO = molecule('CO') CO.center(vacuum=3) CO.set_calculator(calc) E_gs = CO.get_potential_energy() # Excited state calculation calc_es = GPAW(mode='lcao', basis='dzp', nbands=8, h=0.2, xc='PBE', spinpol=True, convergence={'energy': 100, 'density': 1e-3, 'bands': -1}) CO.set_calculator(calc_es) lumo = dscf.MolecularOrbital(calc, weights={0: [0, 0, 0, 1], 1: [0, 0, 0, -1]}) dscf.dscf_calculation(calc_es, [[1.0, lumo, 1]], CO) E_es = CO.get_potential_energy() dE = E_es - E_gs print dE equal(dE, 5.7595110076, 0.011)
robwarm/gpaw-symm
gpaw/test/dscf_lcao.py
Python
gpl-3.0
1,095
[ "ASE", "GPAW" ]
77346e218b24dc7e954f723a93bb44fbbdc7d46a3305ddf3c89e5470a64be9d0
""" :mod: GFAL2_GSIFTPStorage ================= .. module: python :synopsis: GSIFTP module based on the GFAL2_StorageBase class. """ # from DIRAC from DIRAC.Resources.Storage.GFAL2_StorageBase import GFAL2_StorageBase from DIRAC import gLogger from DIRAC.Core.Utilities.Pfn import pfnparse, pfnunparse class GFAL2_GSIFTPStorage( GFAL2_StorageBase ): """ .. class:: GFAL2_GSIFTPStorage GSIFTP interface to StorageElement using gfal2 """ _INPUT_PROTOCOLS = ['file', 'gsiftp'] _OUTPUT_PROTOCOLS = ['gsiftp'] def __init__( self, storageName, parameters ): """ c'tor """ # # init base class super( GFAL2_GSIFTPStorage, self ).__init__( storageName, parameters ) self.srmSpecificParse = False self.log = gLogger.getSubLogger( "GFAL2_GSIFTPStorage" ) self.pluginName = 'GFAL2_GSIFTP' # We don't need extended attributes for metadata self._defaultExtendedAttributes = None def __addDoubleSlash( self, res ): """ Utilities to add the double slash between the host(:port) and the path :param res: DIRAC return structure which contains an URL if S_OK :return: DIRAC structure with corrected URL """ if not res['OK']: return res url = res['Value'] res = pfnparse( url, srmSpecific = self.srmSpecificParse ) if not res['OK']: return res urlDict = res['Value'] urlDict['Path'] = '/' + urlDict['Path'] return pfnunparse( urlDict, srmSpecific = self.srmSpecificParse ) def getURLBase( self, withWSUrl = False ): """ Overwrite to add the double slash """ return self.__addDoubleSlash( super( GFAL2_GSIFTPStorage, self ).getURLBase( withWSUrl = withWSUrl ) ) def constructURLFromLFN( self, lfn, withWSUrl = False ): """ Overwrite to add the double slash """ return self.__addDoubleSlash( super( GFAL2_GSIFTPStorage, self ).constructURLFromLFN( lfn = lfn, withWSUrl = withWSUrl ) ) def getCurrentURL( self, fileName ): """ Overwrite to add the double slash """ return self.__addDoubleSlash( super( GFAL2_GSIFTPStorage, self ).getCurrentURL( fileName ) )
Andrew-McNab-UK/DIRAC
Resources/Storage/GFAL2_GSIFTPStorage.py
Python
gpl-3.0
2,107
[ "DIRAC" ]
3343e8b44ea2a6c11381e3f582d6236ec5049549013788c57ea24075f1a8fd49
from ovito import * import sys sys.exit(2)
srinath-chakravarthy/ovito
tests/scripts/test_suite/system_exit.py
Python
gpl-3.0
43
[ "OVITO" ]
ebea722074486e35c9197c95b00a4e54da47fbbd0a10a4c1453d8d812006ff9c
#!/usr/bin/env python "Check binaries configuration" # # Copyright (C) 2012-2021 ABINIT Group (Yann Pouillon) # # This file is part of the ABINIT software package. For license information, # please see the COPYING file in the top-level directory of the ABINIT source # distribution. # from __future__ import unicode_literals, division, print_function, absolute_import from abirules_tools import find_abinit_toplevel_directory try: from ConfigParser import ConfigParser,NoOptionError except ImportError: from configparser import ConfigParser, NoOptionError import os import re import sys class MyConfigParser(ConfigParser): def optionxform(self,option): return str(option) # ---------------------------------------------------------------------------- # # # Auxiliary data # dep_levels = { "bigdft":10, "fft":8, "levmar":9, "libpsml":9, "libxc":9, "libxml2":0, "linalg":7, "mpi":1, "gpu":2, "hdf5":4, "netcdf":5, "netcdf_fortran":6, "papi":3, "triqs":3, "wannier90":9, "xmlf90":3, } def main(): home_dir = find_abinit_toplevel_directory() # Init cnf_bin = MyConfigParser() cnf_fname = os.path.join(home_dir, "config/specs/binaries.conf") assert os.path.exists(cnf_fname) cnf_bin.read(cnf_fname) bin_list = cnf_bin.sections() bin_list.sort() dep_order = {} lib_order = {} re_num = re.compile("[0-9][0-9]_") # Check order of dependencies and libraries for prg in bin_list: if cnf_bin.has_option(prg,"dependencies"): bin_deps = cnf_bin.get(prg,"dependencies").split() else: bin_deps = [] dep_old = 100 dep_new = 100 for dep in bin_deps: if dep in dep_levels: dep_new = dep_levels[dep] else: sys.stderr.write("Error: unregistered dependency '%s'\n" % dep) sys.exit(10) if dep_new > dep_old: if prg not in dep_order: dep_order[prg] = list() dep_order[prg].append(dep) dep_old = dep_new if cnf_bin.has_option(prg,"libraries"): bin_libs = cnf_bin.get(prg,"libraries").split() else: bin_libs = list() lib_old = 100 lib_new = 100 for lib in bin_libs: if re_num.match(lib): lib_new = int(re.sub("_.*","",lib)) if lib_new > lib_old: if prg not in lib_order: lib_order[prg] = list() lib_order[prg].append(lib) lib_old = lib_new # Report any disorder nerr = len(dep_order) + len(lib_order) if nerr > 0 : sys.stderr.write("%s: reporting disordered libraries\n\n" % (os.path.basename(sys.argv[0]))) sys.stderr.write("X: D=Dependency / L=Library\n\n") sys.stderr.write("%s %-24s %-24s\n" % ("X","Program","Dependency/Library")) sys.stderr.write("%s %s %s\n" % ("-","-" * 24,"-" * 24)) dep_keys = list(dep_order.keys()) dep_keys.sort() for prg in dep_keys: for dep in dep_order[prg]: sys.stderr.write("%s %-24s %-24s\n" % ("D",prg,dep)) lib_keys = list(lib_order.keys()) lib_keys.sort() for prg in lib_keys: for lib in lib_order[prg]: sys.stderr.write("%s %-24s %-24s\n" % ("L",prg,lib)) sys.stderr.write("\n") return nerr if __name__ == "__main__": sys.exit(main())
abinit/abinit
abichecks/scripts/check-binaries-conf.py
Python
gpl-3.0
3,229
[ "ABINIT", "NetCDF", "Wannier90" ]
b90bb834904d8568fc7c042b1f626f645d4b02abebb0eb977b37e0d6160f3735
from contextlib import contextmanager from django.utils.crypto import get_random_string from ..ga_helpers import GaccoTestMixin, SUPER_USER_INFO from ...pages.biz.ga_contract import BizContractDetailPage, BizContractPage from ...pages.biz.ga_dashboard import DashboardPage from ...pages.biz.ga_invitation import BizInvitationPage, BizInvitationConfirmPage from ...pages.biz.ga_w2ui import remove_grid_row_index from ...pages.lms.ga_dashboard import DashboardPage as GaDashboardPage PLATFORMER_USER_INFO = { 'username': 'plat_platformer', 'password': 'platPlatformer3', 'email': 'plat_platformer@example.com', } AGGREGATOR_USER_INFO = { 'username': 'owner_aggregator', 'password': 'ownerAggregator3', 'email': 'owner_aggregator@example.com', } A_DIRECTOR_USER_INFO = { 'username': 'acom_director', 'password': 'acomDirector3', 'email': 'acom_director@example.com', } A_MANAGER_USER_INFO = { 'username': 'acom_manager', 'password': 'acomManager3', 'email': 'acom_manager@example.com', } B_DIRECTOR_USER_INFO = { 'username': 'bcom_director', 'password': 'bcomDirector3', 'email': 'bcom_director@example.com', } B_MANAGER_USER_INFO = { 'username': 'bcom_manager', 'password': 'bcomManager3', 'email': 'bcom_manager@example.com', } C_DIRECTOR_USER_INFO = { 'username': 'ccom_director', 'password': 'ccomDirector3', 'email': 'ccom_director@example.com', } C_MANAGER_USER_INFO = { 'username': 'ccom_manager', 'password': 'ccomManager3', 'email': 'ccom_manager@example.com', } PLAT_COMPANY = 1 PLAT_COMPANY_NAME = 'plat org' PLAT_COMPANY_CODE = 'plat' OWNER_COMPANY = 2 OWNER_COMPANY_NAME = 'owner company' OWNER_COMPANY_CODE = 'owner' A_COMPANY = 3 A_COMPANY_NAME = 'A company' A_COMPANY_CODE = 'acom' B_COMPANY = 4 B_COMPANY_NAME = 'B company' B_COMPANY_CODE = 'bcom' C_COMPANY = 5 C_COMPANY_NAME = 'C company' C_COMPANY_CODE = 'ccom' @contextmanager def visit_page_on_new_window(page_object): current_handle = page_object.browser.current_window_handle page_object.browser.execute_script(''' window.open("{}", "_blank"); '''.format(page_object.url)) page_object.browser.switch_to_window(page_object.browser.window_handles[-1]) yield page_object.wait_for_page() page_object.browser.close() page_object.browser.switch_to_window(current_handle) class GaccoBizTestMixin(GaccoTestMixin): """ Mixin for gacco biz tests """ def assert_grid_row(self, grid_row, assert_dict): for assert_key, assert_value in assert_dict.items(): self.assertIn(assert_key, grid_row) self.assertEqual(assert_value, grid_row[assert_key]) def assert_grid_row_in(self, grid_row, grid_rows): self.assertIn( remove_grid_row_index(grid_row), [remove_grid_row_index(r) for r in grid_rows] ) def assert_grid_row_not_in(self, grid_row, grid_rows): self.assertNotIn( remove_grid_row_index(grid_row), [remove_grid_row_index(r) for r in grid_rows] ) def assert_grid_row_equal(self, grid_rows_a, grid_rows_b): self.assertEqual( [remove_grid_row_index(r) for r in grid_rows_a], [remove_grid_row_index(r) for r in grid_rows_b] ) def create_contract(self, biz_contract_page, contract_type, start_date, end_date, contractor_organization='', contractor_organization_name=None, detail_info=None, register_type='ERS'): """ Register a contract. """ biz_contract_page.click_register_button() biz_contract_detail_page = BizContractDetailPage(self.browser).wait_for_page() contract_name = 'test_contract_' + self.unique_id[0:8] invitation_code = self.unique_id[0:8] biz_contract_detail_page.input(contract_name=contract_name, contract_type=contract_type, register_type=register_type, invitation_code=invitation_code, start_date=start_date, end_date=end_date, contractor_organization=contractor_organization) if contractor_organization_name: biz_contract_detail_page.select_contractor_organization(contractor_organization_name) if detail_info: for i, course_id in enumerate(detail_info): biz_contract_detail_page.add_detail_info(course_id, i + 1) biz_contract_detail_page.click_register_button() BizContractPage(self.browser).wait_for_page() self.assertIn("The new contract has been added.", biz_contract_page.messages) self.assert_grid_row( biz_contract_page.get_row({'Contract Name': contract_name}), { 'Contract Name': contract_name, 'Invitation Code': invitation_code, 'Contract Start Date': start_date, 'Contract End Date': end_date } ) return biz_contract_page.get_row({'Contract Name': contract_name}) def create_aggregator(self, with_contract_count=1): new_aggregator = self.register_user() new_org_info = self.register_organization(PLATFORMER_USER_INFO) new_contracts = [] for i in range(with_contract_count): new_contracts.append(self.register_contract(PLATFORMER_USER_INFO, new_org_info['Organization Name'], 'O')) self.grant(PLATFORMER_USER_INFO, new_org_info['Organization Name'], 'aggregator', new_aggregator) return new_aggregator, new_org_info, new_contracts @property def new_password(self): return 'Aa0' + get_random_string(12) @property def new_user_info(self): username = 'test_' + get_random_string(12) return { 'username': username, 'password': self.new_password, 'email': username + '@example.com', } def grant(self, operator, organization_name, permission, grant_to_user_info): self.switch_to_user(operator) biz_manager_page = DashboardPage(self.browser).visit().click_biz().click_manager().select(organization_name, permission) self.assertNotIn(grant_to_user_info['username'], biz_manager_page.names) self.assertNotIn(grant_to_user_info['email'], biz_manager_page.emails) biz_manager_page.input_user(grant_to_user_info['username']).click_grant() self.assertIn(grant_to_user_info['username'], biz_manager_page.names) self.assertIn(grant_to_user_info['email'], biz_manager_page.emails) biz_manager_page.refresh_page().select(organization_name, permission) self.assertIn(grant_to_user_info['username'], biz_manager_page.names) self.assertIn(grant_to_user_info['email'], biz_manager_page.emails) def register_contract(self, operator, contractor_organization_name, contract_type='PF', register_type='ERS', start_date='2000/01/01', end_date='2100/12/31', detail_info=None): self.switch_to_user(operator) return self.create_contract( DashboardPage(self.browser).visit().click_biz().click_contract(), contract_type, start_date, end_date, contractor_organization_name=contractor_organization_name, detail_info=detail_info, register_type=register_type, ) def register_organization(self, operator): self.switch_to_user(operator) biz_organization_page = DashboardPage(self.browser).visit().click_biz().click_organization() org_code = 'test_' + self.unique_id[0:8] org_name = 'org name ' + org_code biz_organization_page.click_add().input(org_name, org_code).click_register() self.assertIn('The new organization has been added.', biz_organization_page.messages) new_organization = biz_organization_page.get_row({ 'Organization Name': org_name, 'Organization Code': org_code, }) self.assertIsNotNone(new_organization) return new_organization def register_invitation(self, invitation_code, additional_info): """ Register invitation code """ BizInvitationPage(self.browser).visit().input_invitation_code(invitation_code).click_register_button() invitation_confirm_page = BizInvitationConfirmPage(self.browser, invitation_code).wait_for_page() if additional_info: for i, additional_name in enumerate(additional_info): invitation_confirm_page.input_additional_info(additional_name, i) invitation_confirm_page.click_register_button() return GaDashboardPage(self.browser).wait_for_page()
nttks/edx-platform
common/test/acceptance/tests/biz/__init__.py
Python
agpl-3.0
8,798
[ "VisIt" ]
f32ce8d5f97112eb8a621f711a5dba680cdb880bdf7204a492dedc45752f5cae
# -*- coding: utf-8 -*- # # recording_demo.py # # This file is part of NEST. # # Copyright (C) 2004 The NEST Initiative # # NEST is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 2 of the License, or # (at your option) any later version. # # NEST is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with NEST. If not, see <http://www.gnu.org/licenses/>. """Recording examples ------------------ This script demonstrates how to select different recording backends and read the result data back in. The simulated network itself is rather boring with only a single poisson generater stimulating a single neuron, so we get some data. """ import nest import numpy as np def setup(record_to, time_in_steps): """Set up the network with the given parameters.""" nest.ResetKernel() nest.SetKernelStatus({'overwrite_files': True}) pg_params = {'rate': 1000000.} sr_params = {'record_to': record_to, 'time_in_steps': time_in_steps} n = nest.Create('iaf_psc_exp') pg = nest.Create('poisson_generator', 1, pg_params) sr = nest.Create('spike_recorder', 1, sr_params) nest.Connect(pg, n, syn_spec={'weight': 10.}) nest.Connect(n, sr) return sr def get_data(sr): """Get recorded data from the spike_recorder.""" if sr.record_to == 'ascii': return np.loadtxt(f'{sr.filenames[0]}', dtype=object) if sr.record_to == 'memory': return sr.get('events') # Just loop through some recording backends and settings for time_in_steps in (True, False): for record_to in ('ascii', 'memory'): sr = setup(record_to, time_in_steps) nest.Simulate(30.0) data = get_data(sr) print(f"simulation resolution in ms: {nest.GetKernelStatus('resolution')}") print(f"data recorded by recording backend {record_to} (time_in_steps={time_in_steps})") print(data)
stinebuu/nest-simulator
pynest/examples/recording_demo.py
Python
gpl-2.0
2,234
[ "NEURON" ]
057c7271fa4f253260a1bf290aada572a531776ed2b840fea7a585f7970ef492
import os from Bio.Nexus import Nexus def check_taxa(matrices): '''Checks that nexus instances in a list [(name, instance)...] have the same taxa, provides useful error if not and returns None if everything matches From: http://biopython.org/wiki/Concatenate_nexus ''' first_taxa = matrices[0][1].taxlabels for name, matrix in matrices[1:]: first_only = [t for t in first_taxa if t not in matrix.taxlabels] new_only = [t for t in matrix.taxlabels if t not in first_taxa] if first_only: missing = ', '.join(first_only) msg = '%s taxa %s not in martix %s' % (matrices[0][0], missing, name) raise Nexus.NexusError(msg) elif new_only: missing = ', '.join(new_only) msg = '%s taxa %s not in all matrices' % (name, missing) raise Nexus.NexusError(msg) return None # will only get here if it hasn't thrown an exception def concat(mypath, same_taxa): ''' Combine multiple nexus data matrices in one partitioned file. By default this will only work if the same taxa are present in each file use same_taxa=False if you are not concerned by this From: http://biopython.org/wiki/Concatenate_nexus small change: added onlyfiles block to remove hidden files ''' onlyfiles = [] for item in os.listdir(mypath): if not item.startswith('.') and os.path.isfile(os.path.join(mypath, item)): onlyfiles.append(item) nexi = [] for nex in onlyfiles: nex_open = open(nex, 'r') nex_save = Nexus.Nexus(nex_open) nexi.append((nex, nex_save)) if same_taxa: if not check_taxa(nexi): return Nexus.combine(nexi) else: return Nexus.combine(nexi) def output_conc_nex(mypath, outfilename, same_taxa=False): os.chdir(mypath) combined = concat(mypath, same_taxa) combined.write_nexus_data(filename=open('%s.nex' % (outfilename), 'w')) return None ### how to use it (below) mypath = '/Users/Tagliacollo/Downloads/sate-gblocks-clean-min-52-taxa' outfilename = 'Harrington_2016' output_conc_nex(mypath, outfilename)
Tagliacollo/Phyloworks
py_scripts/conc_nexus_aln.py
Python
gpl-3.0
2,208
[ "Biopython" ]
c32c049c06a85980d81e9bac7d1245648bd65cc11097cdd2dc2e23da6161961d