text stringlengths 13 30k |
|---|
{"language": "de", "company": "Booking", "line_number": 7, "sentence": "Definitionen", "unfairness_level": "untagged", "a": false, "ch": false, "cr": false, "j": false, "law": false, "ltd": false, "ter": false, "use": false, "pinc": false, "all_topics": []} |
{"language": "de", "company": "Booking", "line_number": 8, "sentence": "Umfang und Art unserer Dienstleistungen", "unfairness_level": "untagged", "a": false, "ch": false, "cr": false, "j": false, "law": false, "ltd": false, "ter": false, "use": false, "pinc": false, "all_topics": []} |
{"texts": ["Reactivity of Fe(II)-bearing minerals toward reductive transformation of organic contaminants.", "\nFe(II) present at surfaces of iron-containing minerals can play a significant role in the overall attenuation of reducible contaminants in the subsurface. ", "As the chemical environment, i.e., the type and a... |
{"texts": ["package org.ovirt.engine.api.restapi.resource;\n\nimport javax.ws.rs.core.", "Response;\n\nimport org.ovirt.engine.api.model.", "AffinityLabel;\nimport org.ovirt.engine.api.resource.", "AssignedAffinityLabelResource;\nimport org.ovirt.engine.api.restapi.utils.", "GuidUtils;\nimport org.ovirt.engine.core.com... |
{"texts": ["Q:\n\nMulti-site sharing content\n\nIs it possible to share content/nodes in a drupal multisite environment.", "\nFor example:\nContent type \"Story\"\n\nSite 1- Use this content\nSite 2- Don't use this content\nSite 3- Use this content\n\nIt seems the drupal multisite environment suggests using table prefi... |
{"texts": ["Developmental choices in mating-type interconversion in fission yeast.", "\nFission yeast cells follow a specific pattern of mating (cell) type switching in single cell pedigrees. ", "Asymmetric cell divisions producing sisters of different developmental fates result from inheritance of specific parental DN... |
{"texts": ["Five Horse Johnson\n\nFive Horse Johnson comes straight out of Toledo, OH, with big riff, get down, rootsy, middle American rock & roll that takes acid blues and Led Zeppelin and mixes in influences like the Black Crowes, Lynyrd Skynyrd, Aerosmith, and ZZ Top.", "\n\nThe band - made up of Eric Oblander on h... |
{"texts": ["When their son is accused of murdering his sister, a mother and father face perhaps the most awful decision any parent could have to make: whether to break with their son or accept him back into the family. ", "With astonishing footage shot over a ten-year period, from minutes after the crime was committed ... |
{"text1": "Amrozi accused his brother , whom he called \" the witness \" , of deliberately distorting his evidence .", "text2": "Referring to him as only \" the witness \" , Amrozi accused his brother of deliberately distorting his evidence .", "label": 1, "idx": 0, "label_text": "equivalent"} |
{"text1": "Yucaipa owned Dominick 's before selling the chain to Safeway in 1998 for $ 2.5 billion .", "text2": "Yucaipa bought Dominick 's in 1995 for $ 693 million and sold it to Safeway for $ 1.8 billion in 1998 .", "label": 0, "idx": 1, "label_text": "not equivalent"} |
{"text1": "They had published an advertisement on the Internet on June 10 , offering the cargo for sale , he added .", "text2": "On June 10 , the ship 's owners had published an advertisement on the Internet , offering the explosives for sale .", "label": 1, "idx": 2, "label_text": "equivalent"} |
{"text1": "Around 0335 GMT , Tab shares were up 19 cents , or 4.4 % , at A $ 4.56 , having earlier set a record high of A $ 4.57 .", "text2": "Tab shares jumped 20 cents , or 4.6 % , to set a record closing high at A $ 4.57 .", "label": 0, "idx": 3, "label_text": "not equivalent"} |
{"text1": "The stock rose $ 2.11 , or about 11 percent , to close Friday at $ 21.51 on the New York Stock Exchange .", "text2": "PG & E Corp. shares jumped $ 1.63 or 8 percent to $ 21.03 on the New York Stock Exchange on Friday .", "label": 1, "idx": 4, "label_text": "equivalent"} |
{"text1": "Revenue in the first quarter of the year dropped 15 percent from the same period a year earlier .", "text2": "With the scandal hanging over Stewart 's company , revenue the first quarter of the year dropped 15 percent from the same period a year earlier .", "label": 1, "idx": 5, "label_text": "equivalent"} |
{"text1": "The Nasdaq had a weekly gain of 17.27 , or 1.2 percent , closing at 1,520.15 on Friday .", "text2": "The tech-laced Nasdaq Composite .IXIC rallied 30.46 points , or 2.04 percent , to 1,520.15 .", "label": 0, "idx": 6, "label_text": "not equivalent"} |
{"text1": "The DVD-CCA then appealed to the state Supreme Court .", "text2": "The DVD CCA appealed that decision to the U.S. Supreme Court .", "label": 1, "idx": 7, "label_text": "equivalent"} |
{"text1": "That compared with $ 35.18 million , or 24 cents per share , in the year-ago period .", "text2": "Earnings were affected by a non-recurring $ 8 million tax benefit in the year-ago period .", "label": 0, "idx": 8, "label_text": "not equivalent"} |
{"text1": "Shares of Genentech , a much larger company with several products on the market , rose more than 2 percent .", "text2": "Shares of Xoma fell 16 percent in early trade , while shares of Genentech , a much larger company with several products on the market , were up 2 percent .", "label": 0, "idx": 10, "label_... |
{"id": 1, "keyword": null, "location": null, "text": "Our Deeds are the Reason of this #earthquake May ALLAH Forgive us all", "target": 1} |
{"id": 4, "keyword": null, "location": null, "text": "Forest fire near La Ronge Sask. Canada", "target": 1} |
{"id": 5, "keyword": null, "location": null, "text": "All residents asked to 'shelter in place' are being notified by officers. No other evacuation or shelter in place orders are expected", "target": 1} |
{"id": 6, "keyword": null, "location": null, "text": "13,000 people receive #wildfires evacuation orders in California ", "target": 1} |
{"id": 7, "keyword": null, "location": null, "text": "Just got sent this photo from Ruby #Alaska as smoke from #wildfires pours into a school ", "target": 1} |
{"id": 8, "keyword": null, "location": null, "text": "#RockyFire Update => California Hwy. 20 closed in both directions due to Lake County fire - #CAfire #wildfires", "target": 1} |
{"id": 10, "keyword": null, "location": null, "text": "#flood #disaster Heavy rain causes flash flooding of streets in Manitou, Colorado Springs areas", "target": 1} |
{"id": 13, "keyword": null, "location": null, "text": "I'm on top of the hill and I can see a fire in the woods...", "target": 1} |
{"id": 14, "keyword": null, "location": null, "text": "There's an emergency evacuation happening now in the building across the street", "target": 1} |
{"id": 15, "keyword": null, "location": null, "text": "I'm afraid that the tornado is coming to our area...", "target": 1} |
{"_data_files": [{"filename": "dataset.arrow"}], "_fingerprint": "8ba5734c8fb1b57c", "_format_columns": ["target", "text"], "_format_kwargs": {}, "_format_type": null, "_indexes": {}, "_output_all_columns": false, "_split": null} |
{"form": [{"box": [292, 91, 376, 175], "text": "R&D", "label": "other", "words": [{"box": [292, 91, 376, 175], "text": "R&D"}], "linking": [], "id": 0}, {"box": [219, 316, 225, 327], "text": ":", "label": "question", "words": [{"box": [219, 316, 225, 327], "text": ":"}], "linking": [], "id": 1}, {"box": [95, 355, 169, ... |
{"form": [{"box": [76, 129, 118, 139], "text": "Brand:", "label": "question", "words": [{"box": [76, 129, 118, 139], "text": "Brand:"}], "linking": [[0, 2]], "id": 0}, {"box": [73, 141, 119, 153], "text": "Style:", "label": "question", "words": [{"box": [73, 141, 119, 153], "text": "Style:"}], "linking": [[1, 36]], "id... |
{"form": [{"box": [61, 207, 97, 221], "text": "DATE:", "label": "question", "words": [{"box": [61, 207, 97, 221], "text": "DATE:"}], "linking": [[0, 16]], "id": 0}, {"box": [61, 235, 129, 249], "text": "INITIATED", "label": "question", "words": [{"box": [61, 235, 129, 249], "text": "INITIATED"}], "linking": [[1, 17]], ... |
{"form": [{"box": [221, 71, 264, 89], "text": "B&W", "label": "header", "words": [{"box": [221, 71, 264, 89], "text": "B&W"}], "linking": [], "id": 0}, {"box": [221, 41, 263, 70], "text": "", "label": "other", "words": [{"box": [221, 41, 263, 70], "text": ""}], "linking": [], "id": 1}, {"box": [377, 366, 416, 380], "te... |
{"form": [{"box": [96, 177, 118, 192], "text": "FAX:", "label": "question", "words": [{"box": [96, 177, 118, 192], "text": "FAX:"}], "linking": [[0, 18]], "id": 0}, {"box": [75, 337, 116, 351], "text": "DATE:", "label": "question", "words": [{"box": [75, 337, 116, 351], "text": "DATE:"}], "linking": [[1, 26]], "id": 1}... |
{"form": [{"box": [41, 127, 84, 144], "text": "Brand", "label": "question", "words": [{"box": [41, 127, 84, 144], "text": "Brand"}], "linking": [[0, 46]], "id": 0}, {"box": [41, 154, 87, 172], "text": "Title", "label": "question", "words": [{"box": [41, 154, 87, 172], "text": "Title"}], "linking": [[1, 50]], "id": 1}, ... |
{"form": [{"box": [112, 209, 123, 217], "text": "", "label": "other", "words": [{"box": [112, 209, 123, 217], "text": ""}], "linking": [], "id": 0}, {"box": [123, 209, 140, 217], "text": "", "label": "other", "words": [{"box": [123, 209, 140, 217], "text": ""}], "linking": [], "id": 1}, {"box": [108, 283, 156, 292], "t... |
{"Unnamed: 0.1": 948943, "Unnamed: 0": 948943, "Seq": "TGCATTTTTTTCACATCGAGTATGCAGTAAGTCATGATGCTATGAGATCAATATGCTTTTTGTATTTAGAGGCAATCGTGCAAAGAACATGAGGCCAGGTTACGGCTGTT", "Predicted_Exp": 7.165856, "Actual_Exp": 0.189431815925206} |
{"Unnamed: 0.1": 6274096, "Unnamed: 0": 6274096, "Seq": "TGCATTTTTTTCACATCTTTGTATGGTACTTTAATGGTTGGCACATTTACTTGATCCGGTACGTTAGGTTTGATTAGCTTATATGCGTTAGTCTTGGGTTACGGCTGTT", "Predicted_Exp": 9.423245, "Actual_Exp": 0.13812678868238} |
{"Unnamed: 0.1": 5967423, "Unnamed: 0": 5967423, "Seq": "TGCATTTTTTTCACATCTTGAGGGTGCTGATTCCAACATCACTGAATAATTCTAGGAAAGTACTCAGTTGCAGCATGCTTGGTATTTAGGAAGGTTGGGTTACGGCTGTT", "Predicted_Exp": 8.2376375, "Actual_Exp": 0.0110927119261247} |
{"Unnamed: 0.1": 6424900, "Unnamed: 0": 6424900, "Seq": "TGCATTTTTTTCACATCCAAGGGCCATGACCCCCTTTGCCTGAGTCTTTGGCACGTTCAGTGCGAGAAGATATAGTAACTGGGGTGTACGCACACTAGGTTACGGCTGTT", "Predicted_Exp": 8.263059, "Actual_Exp": 0.0082086208640412} |
{"Unnamed: 0.1": 105547, "Unnamed: 0": 105547, "Seq": "TGCATTTTTTTCACATCAGACACGGTGGCCAGCTGCAAGGACTTGTAGGCGATAGCAATAAACCATGGTCGGGAGGTGCCGTGGTAGGACAATCAAGGGTTACGGCTGTT", "Predicted_Exp": 11.615106, "Actual_Exp": 0.0213699319833756} |
{"Unnamed: 0.1": 366313, "Unnamed: 0": 366313, "Seq": "TGCATTTTTTTCACATCTTATCGTCAAGTACTCCTACTCCGAACGGTCGTAGTTGTATACCATTACGAGCGGTCGTCTGACGGAGACGTCACTGTGGGGTTACGGCTGTT", "Predicted_Exp": 12.378659, "Actual_Exp": 0.260274367994822} |
{"Unnamed: 0.1": 3556938, "Unnamed: 0": 3556938, "Seq": "TGCATTTTTTTCACATCTCAGGTAGTTAACCAGCGCCTTAACCTTCACACGGTTCTAATGGGTTTGGACAGACCTAGCGATTAGGAAGTAGCAGACTGGTTACGGCTGTT", "Predicted_Exp": 7.7393866, "Actual_Exp": 0.0671484860535978} |
{"Unnamed: 0.1": 1892408, "Unnamed: 0": 1892408, "Seq": "TGCATTTTTTTCACATCCCTGTCTCTGAGCTACTTGATGGTTTGGGTGGTTAGTCCAGAAGGCACGGCTCCTTGAGAGGCTTGCAGTGCTGGTAGGTGGTTACGGCTGTT", "Predicted_Exp": 7.7626266, "Actual_Exp": 0.0145658393587163} |
{"Unnamed: 0.1": 1841494, "Unnamed: 0": 1841494, "Seq": "TGCATTTTTTTCACATCTAATCATGTAAATTAAATATTGCATCATGCGGTGCATAATCGTCCAACATATCTTTGGTTGGGCATCTAGTCTGTACAATGGTTACGGCTGTT", "Predicted_Exp": 7.432005, "Actual_Exp": 0.377255002794437} |
{"Unnamed: 0.1": 894716, "Unnamed: 0": 894716, "Seq": "TGCATTTTTTTCACATCCAGGGGAGTGATATGTTCAGGCTTTGGTTTGTTACTTAATGATGGCTATTGAAACCTGGCCGTAGTCTGCACCCCGACTCGGTTACGGCTGTT", "Predicted_Exp": 9.002031, "Actual_Exp": 0.0944229731119969} |
{"id": "761", "title": "Towards a NMR implementation of a quantum lattice gas algorithm", "abstract": "Recent theoretical results suggest that an array of quantum information processors communicating via classical channels can be used to solve fluid dynamics problems. Quantum lattice-gas algorithms (QLGA) running on su... |
{"id": "724", "title": "Banking on SMA funds [separately managed accounts]", "abstract": "From investment management to technology to back-office services, outsourcers are elbowing their way into the SMA business. Small banks are paying attention-and hoping to reap the rewards", "keyphrases": ["separately managed accou... |
{"id": "1371", "title": "Design methodology for diagnostic strategies for industrial systems", "abstract": "This paper presents a method for the construction of diagnostic systems for complex industrial applications. The approach has been explicitely developed to shorten the design cycle and meet some specific requirem... |
{"id": "1334", "title": "A shy invariant of graphs", "abstract": "Moving from a well known result of P.L. Hammer et al. (1982), we introduce a new graph invariant, say lambda (G) referring to any graph G. It is a non-negative integer which is non-zero whenever G contains particular induced odd cycles or, equivalently, ... |
{"id": "1419", "title": "PacketVideo. One step ahead of the streaming wireless market", "abstract": "Go beyond the hype, however, and it's clear that PacketVideo is making strides in delivering streaming multimedia content to wireless devices. For one thing, its technology, based on the industry-standard Motion Picture... |
{"id": "1070", "title": "Universal simulation of Hamiltonian dynamics for quantum systems with finite-dimensional state spaces", "abstract": "What interactions are sufficient to simulate arbitrary quantum dynamics in a composite quantum system? Dodd et al. [Phys. Rev. A 65, 040301(R) (2002)] provided a partial solution... |
{"id": "1035", "title": "H/sub 2/ optimization of the three-element type dynamic vibration absorbers", "abstract": "The dynamic vibration absorber (DVA) is a passive vibration control device which is attached to a vibrating body (called a primary system) subjected to exciting force or motion. In this paper, we will dis... |
{"id": "1128", "title": "The semi-algebraic theory of stochastic games", "abstract": "The asymptotic behavior of the min-max value of a finite-state zero-sum discounted stochastic game, as the discount rate approaches 0, has been studied in the past using the theory of real-closed fields. We use the theory of semi-alge... |
{"id": "538", "title": "Polarization of the RF field in a human head at high field: a study with a quadrature surface coil at 7.0 T", "abstract": "The RF field intensity distribution in the human brain becomes inhomogeneous due to wave behavior at high field. This is further complicated by the spatial distribution of R... |
{"id": "681", "title": "Construction of information retrieval thesaurus for family planning terms using CDS/ISIS", "abstract": "The thesaurus as a tool for information retrieval and as an alternative to the existing scheme of classifications in information retrieval is discussed. The paper considers the emergence of th... |
{"texts": ["Q:\n\nselect from mysql with different key values\n\ni want to write some query which give me the product with specific key value\ntbl_product\n product_id field_id value\n 1 1 100\n 1 2 200\n\ni want to find all products that have (field_id = 1 and value = 1... |
{"texts": ["Google introduced an updated Smart Display interface alongside the Nest Hub Max, and now you don't need that new hardware to see what the fuss is about. ", "The 9to5Google team has discovered that Google is rolling out the refreshed interface to the Nest Hub (formerly the Home Hub) and, presumably, third-pa... |
{"texts": ["// cgo -godefs -- -fsigned-char types_openbsd.go | go run mkpost.go\n// Code generated by the command above; see README.md. ", "DO NOT EDIT.", "\n\n// +build arm64,openbsd\n\npackage unix\n\nconst (\n\tSizeofPtr = 0x8\n\tSizeofShort = 0x2\n\tSizeofInt = 0x4\n\tSizeofLong = 0x8\n\tSizeofLong... |
{"texts": ["The present disclosure relates to a coupling for use in an irrigation system.", "\nSuch a coupling may be used between an irrigation pipe and a main distribution pipe from which it branches off.", "\nUS Patent Application No. ", "20070074776, the disclosure of which is incorporated herein by reference, desc... |
{"texts": ["Doctors in Wales Call for Breast Feed Law\n\nWelsh doctors are calling on the Welsh Assembly Government to introduce new laws to encourage breastfeeding.", "\n\nThe Welsh branch of The British Medical Association (BMA Cymru) says breastfeeding in places like restaurants, cafes and shops should be more widel... |
{"texts": ["Waterways opening for the weekend raise concern for residents\n\nFRENCH SETTLEMENT - Water ways in Ascension, Livingston and St. James will all be open by Thursday at noon.", "\n\nBlind River is open in St. James Parish. ", "Parish officials in Livingston and Ascension Parishes said all water ways in their ... |
{"feat_bid": 161, "feat_is_aggregate": false, "feat_source": "pinkmonkey", "feat_chapter_path": "all_chapterized_books/161-chapters/12.txt", "feat_summary_path": "finished_summaries/pinkmonkey/Sense and Sensibility/section_11_part_0.txt", "feat_book_id": "Sense and Sensibility.chapter 12", "feat_summary_id": "chapter 1... |
{"feat_bid": 110, "feat_is_aggregate": false, "feat_source": "gradesaver", "feat_chapter_path": "all_chapterized_books/110-chapters/20.txt", "feat_summary_path": "finished_summaries/gradesaver/Tess of the D'Urbervilles/section_2_part_5.txt", "feat_book_id": "Tess of the D'Urbervilles.chapter 20", "feat_summary_id": "ch... |
{"feat_bid": 1232, "feat_is_aggregate": false, "feat_source": "shmoop", "feat_chapter_path": "all_chapterized_books/1232-chapters/09.txt", "feat_summary_path": "finished_summaries/shmoop/The Prince/section_9_part_0.txt", "feat_book_id": "The Prince.chapter 9", "feat_summary_id": "chapter 9", "feat_content": null, "feat... |
{"feat_bid": 23042, "feat_is_aggregate": false, "feat_source": "sparknotes", "feat_chapter_path": "all_chapterized_books/23042-chapters/4.txt", "feat_summary_path": "finished_summaries/sparknotes/The Tempest/section_4_part_0.txt", "feat_book_id": "The Tempest.act ii.scene ii", "feat_summary_id": "act ii, scene ii", "fe... |
{"context": "Provided is a universal Ku band LNB (9.75/10.600 GHz) which is fitted at the end of the dish and pointed at the correct satellite constellation; most digital receivers will receive the free to air channels. Some broadcasts are free-to-air and unencrypted, some are encrypted but do not require a monthly sub... |
{"context": "At the beginning of the 20th century, important advancement in geological science was facilitated by the ability to obtain accurate absolute dates to geologic events using radioactive isotopes and other methods. This changed the understanding of geologic time. Previously, geologists could only use fossils ... |
{"context": "Packet mode communication may be implemented with or without intermediate forwarding nodes (packet switches or routers). Packets are normally forwarded by intermediate network nodes asynchronously using first-in, first-out buffering, but may be forwarded according to some scheduling discipline for fair que... |
{"context": "Many complexity classes are defined using the concept of a reduction. A reduction is a transformation of one problem into another problem. It captures the informal notion of a problem being at least as difficult as another problem. For instance, if a problem X can be solved using an algorithm for Y, X is n... |
{"context": "In 1096, Crusaders passing by the siege of Amalfi were joined by Bohemond of Taranto and his nephew Tancred with an army of Italo-Normans. Bohemond was the de facto leader of the Crusade during its passage through Asia Minor. After the successful Siege of Antioch in 1097, Bohemond began carving out an inde... |
{"context": "In October 2010, the open-access scientific journal PLoS Pathogens published a paper by a multinational team who undertook a new investigation into the role of Yersinia pestis in the Black Death following the disputed identification by Drancourt and Raoult in 1998. They assessed the presence of DNA/RNA wit... |
{"id": "0", "predicted_queries": ["what was important to the success of the manhattan project", "why was the manhattan project important?", "what was important about the manhattan project", "why was the success of the manhattan project so important?", "who was the manhattan project a scientific project for", "what was ... |
{"id": "1", "predicted_queries": ["what were a major contributions to the manhattan effort", "what impact did the manhattan project have on history", "what is the manhattan project impact on world", "what helped to end world war ii?", "why did the manhattan project help end world war ii?", "why did the manhattan projec... |
{"id": "2", "predicted_queries": ["what is manhattan project", "why did manhattan happen", "what was the purpose of the manhattan project", "what was the manhattan project", "what was the purpose of the manhattan project", "why was the manhattan project successful?", "why was the manhattan project so successful", "what... |
{"id": "3", "predicted_queries": ["who led the manhattan project", "who developed manhattan project", "what was manhattan project", "what was the name of the project that developed the first atomic bomb?", "who developed manhattan", "when did the manhattan project occur", "what was the manhattan project?", "what was th... |
{"id": "4", "predicted_queries": ["what is manhattan project", "what is the manhattan project interactive", "where are the manhattan project", "what is the manhattan project", "what was the first manhattan project website", "what was the manhattan project", "what is the manhattan project", "where is the manhattan proje... |
{"id": "5", "predicted_queries": ["when did the first atomic bomb hit", "when was the first nuclear bomb exploded", "what was the first atomic bomb", "when did the atomic age begin", "when was the first atom bomb sunk", "when was the atomic bomb discovered", "which atomic bomb was used in the manhattan project", "when ... |
{"id": "6", "predicted_queries": ["manhattan project history", "which book is the author's contribution to the manhattan project?", "what was the manhattan project for?", "what was the significance of the manhattan project", "what was the manhattan project", "which book is not an attempt to document the origins and dev... |
{"id": "7", "predicted_queries": ["who was the director of manhattan", "what was the manhattan project ?", "who directed the manhattan", "how long did the manhattan project take", "when did the manhattan project begin", "who led the manhattan project", "who was a nuclear engineer and who designed the manhattan project"... |
{"id": "8", "predicted_queries": ["when were the two atomic bombs discovered", "when did manhattan project start", "why was manhattan bombing", "when did the manhattan bomb explode", "when did the manhattan project happen and why", "what was the name of the first atomic bomb", "what year were the 2 atomic bombs made", ... |
{"id": "9", "predicted_queries": ["why was hanford selected to build the b reactor", "where is hanford new york?", "who built a b reactor", "why was hanford selected as the manhattan project site", "hanford ohio is what river", "why was hanford selected for the manhattan project", "which river was the manhattan reactor... |
{"filepath": "scu_henryjohnson_ver01/data/sn84026912/00211109981/1850042601/0199/000_6_93.jpg", "pub_date": "1850-04-26", "page_seq_num": 199, "edition_seq_num": 1, "batch": "scu_henryjohnson_ver01", "lccn": "sn84026912", "box": [0.7809894127760105, 0.9033842210645799, 0.9759197669114895, 0.9686468545492594], "score": ... |
{"filepath": "scu_henryjohnson_ver01/data/sn84026912/00211109981/1850062101/0233/000_6_96.jpg", "pub_date": "1850-06-21", "page_seq_num": 233, "edition_seq_num": 1, "batch": "scu_henryjohnson_ver01", "lccn": "sn84026912", "box": [0.7707755514431682, 0.034655967101294774, 0.9555946659643496, 0.16309402680022966], "score... |
{"filepath": "scu_henryjohnson_ver01/data/sn84026912/00211109981/1850022301/0158/000_6_96.jpg", "pub_date": "1850-02-23", "page_seq_num": 158, "edition_seq_num": 1, "batch": "scu_henryjohnson_ver01", "lccn": "sn84026912", "box": [0.5847871970226415, 0.038350385598862134, 0.7634712689295764, 0.12690160830561725], "score... |
{"filepath": "scu_henryjohnson_ver01/data/sn84026912/00211109981/1850022301/0158/001_6_94.jpg", "pub_date": "1850-02-23", "page_seq_num": 158, "edition_seq_num": 1, "batch": "scu_henryjohnson_ver01", "lccn": "sn84026912", "box": [0.584187512149178, 0.4891366684398712, 0.7645581141467342, 0.6359554692960014], "score": 0... |
{"filepath": "scu_henryjohnson_ver01/data/sn84026912/00211109981/1850022301/0158/003_6_91.jpg", "pub_date": "1850-02-23", "page_seq_num": 158, "edition_seq_num": 1, "batch": "scu_henryjohnson_ver01", "lccn": "sn84026912", "box": [0.5834216077180835, 0.39780774588782947, 0.7665487714288359, 0.4897477512542432], "score":... |
{"filepath": "scu_henryjohnson_ver01/data/sn84026912/00211109981/1850051701/0213/000_6_92.jpg", "pub_date": "1850-05-17", "page_seq_num": 213, "edition_seq_num": 1, "batch": "scu_henryjohnson_ver01", "lccn": "sn84026912", "box": [0.7856446774419911, 0.8614492356402319, 0.9789163372473803, 0.957430473663522], "score": 0... |
{"filepath": "scu_henryjohnson_ver01/data/sn84026912/00211109981/1850090601/0278/000_6_98.jpg", "pub_date": "1850-09-06", "page_seq_num": 278, "edition_seq_num": 1, "batch": "scu_henryjohnson_ver01", "lccn": "sn84026912", "box": [0.7939284853243576, 0.7037209490220324, 0.950290940107919, 0.7699742159397482], "score": 0... |
{"filepath": "scu_henryjohnson_ver01/data/sn84026912/00211109981/1850090601/0278/002_6_94.jpg", "pub_date": "1850-09-06", "page_seq_num": 278, "edition_seq_num": 1, "batch": "scu_henryjohnson_ver01", "lccn": "sn84026912", "box": [0.7943537965860651, 0.6337740452169515, 0.9517967084871818, 0.703661231171313], "score": 0... |
{"filepath": "scu_henryjohnson_ver01/data/sn84026912/00211109981/1850090601/0278/003_6_93.jpg", "pub_date": "1850-09-06", "page_seq_num": 278, "edition_seq_num": 1, "batch": "scu_henryjohnson_ver01", "lccn": "sn84026912", "box": [0.7937491322571446, 0.5749025193907374, 0.9482068914730427, 0.6346045624437949], "score": ... |
{"filepath": "scu_henryjohnson_ver01/data/sn84026912/00211109981/1850030901/0169/001_6_95.jpg", "pub_date": "1850-03-09", "page_seq_num": 169, "edition_seq_num": 1, "batch": "scu_henryjohnson_ver01", "lccn": "sn84026912", "box": [0.7824606769662396, 0.03347925608300623, 0.9755928899458558, 0.23534961509396457], "score"... |
{"text": "Diesel model Winnie Harlow, who suffers from vitiligo, the same rare skin condition that singer Michael Jackson was diagnosed with, has been pictured enjoying a cozy night on the town with albino fashion star Shaun Ross. The pair attended a launch event for Popular magazine at Siren Studios in Hollywood, Cali... |
{"text": "(CNN)When Melissa Atkins Wardy, author of \"Redefining Girly\" and a passionate advocate for fighting gender stereotypes, heard from a frustrated mom on Facebook, she knew she needed to do something. So she shared the mom's story. In a blog post, Wardy told how the mom, Veronica of Richland, Washington, wante... |
{"text": "(CNN)Blinky and Pinky on the Champs Elysees? Inky and Clyde running down Broadway? Power pellets on the Embarcadero? Leave it to Google to make April Fools' Day into throwback fun by combining Google Maps with Pac-Man. The massive tech company is known for its impish April Fools' Day pranks, and Google Maps h... |
{"text": "(CNN)Would you want a TV program about your family history to include details of a distant, long-deceased relative who had owned slaves? Seriously, who in their right mind would want to be tarnished by the sins of an ancestor you had no connection to other than a remote bloodline? I wouldn't, and neither did ... |
{"id": 6014, "text": "What's the wather in Coleville, Kenya", "label": 3, "Generalization": "trimmed_train"} |
{"id": 7285, "text": "what will the weather be like in Louisiana will it be colder then now", "label": 3, "Generalization": "trimmed_train"} |
{"id": 5361, "text": "add gabrial mcnair to my Love In Paris list", "label": 5, "Generalization": "trimmed_train"} |
{"id": 3041, "text": "Book a restaurant in Medford Lakes on Sep. 8, 2033 for essie, tonya and I", "label": 2, "Generalization": "trimmed_train"} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.