source stringclasses 1
value | snapshot stringclasses 3
values | text stringlengths 264 621k | size_before_bytes int64 269 624k | size_after_bytes int64 185 235k | compression_ratio float64 0 0.01 |
|---|---|---|---|---|---|
warc | 201704 | For what is wisdom and to whom does it apply. Wisdom is a finer knowledge that is a result of many years of one's living experiences within human form. To have acquired wisdom, one must have actively sought after this prize and worked diligently to attain it's mastery. For wisdom is only for those who have paid the price of many years of living within human form. For even the angels, so full of Light can be lacking in wisdom if they have never chosen to visit the Earth Realm. For, wisdom is a concept that was develooed within the Earth Realm by those who have visited here many times and have gained the knowledge of nature along with the living knowledge of humanity. There is no other road to wisdom, but a long one that has been traveled by a few. Yes, those few share their knowledge with others to make their way a little less perilous, but not in a way that will interfere with one's development toward being a complete human being. For the one's of wisdom act as guides, as teachers, and benevolent participants in this journey that you call a human lifetime. One of many journeys. For one must travel to the Earth Realm often to attain a mastery over himself before winning the prize of wisdom. Many fail at this task, but in reality, there is no failure. For there are always lessons learned and strength gained through one's life experience. We are here to remind you and others in a gentle way that wisdom is available to all who seek this prize. And by prize, we mean a gift not given to all, but to those who train and complete the tasks given to them. For, do not your athletes win prizes? No one sees the long years of discipline and hard work that was necessary to win the prize, but the athletes themselves and those close to them. So, do not misunderstand. We are here to help those who wish to grow in wisdom, not to bestow this most precious and unusual jewel upon those who think that they can steal this prize. This attitude is so common today within the Earth Realm. Those who promise the most ridiculous and absurd, acquire great wealth and power that is built upon lies. People so want to believe these untruths and fall victim to those who prey upon the weakness in others. We say again, there are no easy ways or quick fixes, only a slow, deliberate, step by step process of learning. Yes, we can help you to open up and see what is possible and in reality, what the individual has already attained within a future time, but this effect will last but so long. This is only a tool used to show what is possible to attain, if only the individual make a decision and do whatever is necessary to bring the changes about.
M.N. Hopkins | 2,665 | 1,263 | 0.000793 |
warc | 201704 | ENERGY SOLUTIONS: To Nuke or Not to Nuke
I think they are wrong, at least in the almost worshipful, faith-based way they speak of nuke energy, and the disdainful, pitying way they discuss renewables. They seem about 20 years behind in what is happening in the renewables field, and they take the worst case scenarios when dicussing renewables and the best case when discussing nukes. And they claim some kind of special scientific experise...some have even called me scientifically illiterate. Well, those who know me know how dumb that accusation is, so I don't feel the need to address it. But what I do want to address, once again, is what SCIENTISTS are saying about solving global warming in the SCIENTIFIC journals. To me this is what matters when it comes to making decisions about our future.
The last time America had any kind of real concerted push for renewable energy was during the Carter Administration. Since Reagan, we have either taken great steps backwards as a society, or we have had piecemeal attempts to encourage change. But basically we have remained addicted to fossil fuels and that is a horrible, horrible thing for America. It puts us at the mercy of fundamentalist nations, pollutes our cities and has been a big chunk of what is causing global warming, since America alone contributes about 25% of greenhouse gasses (though China and India are growing alarmingly in their contributions).
Had we listened to Jimmy Carter, we'd still have a problem, but we'd be far closer to handling it.
But we didn't. So we have, according to the more optimistic estimates, about 10 years to mitigate global warming's effect on our society. Now some of us have been advocating for action for 20 years, so to be at the point where we have to say "I told you so, why the FUCK didn't you listen" might be nice if it wasn't for the fact that I look in my son's eyes and know that whatever we do from now, his life will be much harder than it needed to be because our generations failed and our leaders failed.
Sometimes it is hard to look my son in the eye when I realize we are still having to fight for the changes that Carter tried to lead us into.
Now, there are still global warming deniers out there, fools that they are. I am not talking to them. I can refer them to hundreds, if not thousands of diaries, including this statement from the Union of Concerned Scientists, this statement by a military think tank, and this diary I wrote addressing the Denial Lobby. I will also add this from an abstract from the most recent issue of the scientific journal Nature where the author indicates the overwhelming evidence for human-caused changes in the climate and adds to our knowledge (go to Nature to see the whole article with references. It is a subscription site, but you can find it at most university science libraries): (referencing left in intentionally)
Human influence on climate has been detected in surface air temperature1, 2, 3, 4, 5, sea level pressure6, free atmospheric temperature7, tropopause height8 and ocean heat content9. Human-induced changes have not, however, previously been detected in precipitation at the global scale10, 11, 12, partly because changes in precipitation in different regions cancel each other out and thereby reduce the strength of the global average signal13, 14, 15, 16, 17, 18, 19...We show that anthropogenic forcing has had a detectable influence on observed changes in average precipitation within latitudinal bands, and that these changes cannot be explained by internal climate variability or natural forcing. We estimate that anthropogenic forcing contributed significantly to observed increases in precipitation in the Northern Hemisphere mid-latitudes, drying in the Northern Hemisphere subtropics and tropics, and moistening in the Southern Hemisphere subtropics and deep tropics. The observed changes, which are larger than estimated from model simulations, may have already had significant effects on ecosystems, agriculture and human health in regions that are sensitive to changes in precipitation, such as the Sahel.
Enough with the Denial Lobby. They are idiots and it is just a shame that the Republican Party listens to so many idiots.
Now, on to solutions.
I have been reading about global warming and possible solutions for about 20 years now. Coincidentally, I have been a scientist for a similar amount of time, counting my first entry into a lab at Salk Institute, San Diego, where I worked on regulation of bacterial genes. For those who know about such things, I found that the spacing between the "negative 35 promoter region" and the CRP element in the LacZ gene affected expression of the gene such that both distance and geometry of the DNA were important. Back in 1995, during my first post-doc, I remember reading an issue of Scientific American discussing energy in America. Two things were highlighted above all else: increased efficiency and wind power. The potentials of these two things were powerful even in 1995. All other ways of dealing with global warming (and remember, much of the scientific community had already accepted global warming back then!) were still fairly speculative in 1995. But energy efficiency was a HUGE open opportunity to save both energy and money, while the wind potential of the Great Plains states alone could have, even back then, helped to make us energy independent. That was 1995. One can only assume that we have advanced since then, Bush Administration denials to the contrary.
And discussions I have had with people who have worked with farmers and wind energy tell me that the potential even outside the Great Plains is pretty good, though certain not perfect. Farmers are slowly adopting wind generation as a major part of their income, given that it is extremely hard for small farmers to make a living just growing food. Wind energy helps American farmers, could help our manufacturing sector, and helps provide both jobs and energy for America. And yet I have heard nuke shills call wind power mere "tinkertoys." Well, Scientific American (back in 1995) and American farmers have more respect for wind energy than the nuke shills.
The Feb. 9th 2007 issue of science largely starts from the exact same place Scientific American left off in 1995: energy efficiency and wind power are here and now with other technologies being more speculative. Both push nuclear energy a little, but with caveats that seem even stronger in 2007 than in 2005. The main differences between then and now are a.) the weight of scientific consensus about the need to cut carbon emissions is greater, and b.) the focus on solar energy and biomass is greater now than it was then. And nuclear, though still mentioned, seems to be considered less of an option now than then.
Here is a summary of the issue of Science in the issue’s introduction:
Lewis (p. 798) points out that the direct conversion of sunlight with solar cells, either into electricity or hydrogen, faces cost hurdles independent of their intrinsic efficiency. Ways must be found to lower production costs and design better conversion and storage systems. In the short term, utilization of biomass relies mainly on sugar fermentation; Goldemberg (p. 808) discusses how Brazil's use of ethanol from sugarcane has greatly reduced its need for imported oil. Many long-term goals have been set for biomass utilization; for example, the European Union (EU) hopes to produce a quarter of its transportation fuels from biomass by 2030, as discussed by Himmel et al. (p. 804). Better ways are also needed for processing the available sugars, and conversion to higher alcohols or even alkanes is desirable. Stephanopoulos (p. 801) explores the options afforded by reengineering biosynthetic pathways in microbes. How we tackle energy problems will turn on a number of policy issues. Potocbrevenik (p. 810) discusses how the EU is setting targets and allocating funding for alternative energy. Finally, Schrag (p. 812) explores the feasibility of sequestering carbon dioxide from fossil-fuel use and our technological readiness and willingness to implement such schemes. The News section profiles national lab directors, computer modelers, captains of industry, and bench scientists who are writing the early chapters of the next book on energy research. Some of them are developing better plants to grow as fuel or ways to convert them into ethanol. Others are developing catalysts to extract hydrogen from water or generate electricity from hydrogen. What they all share is a desire to find new ways to power the future.
The main reason we have done so little since, say, 1995, is that there has been little political will to push for alternatives. Wind energy, a way the Great Plains states could be energy exporters and American farms can make extra money, has only recently started picking up in the US. Had we started in 1995, the influence of Saudi Arabia could have been greatly reduced, American farmers would be in a better financial situation, and the economy of the Great Plains states might be booming. This has been a huge missed opportunity. Though the nuke shills may still refer to wind as "tinkertoys."
But wind is not featured much in the Feb. issue of Science. It is too much today’s technology, what we should have started pushing 10 years ago. In essence, it is seen as a given. Scientists are, of course, more interested in the future.
One of the most striking things mentioned in this issue of Science is a graph of the energy flow in the US from production to usage. Slightly more than 50% of energy produced in the US is wasted. Now NOTHING is ever 100% efficient, so energy efficiency cannot double our output even if half of our energy we produce is wasted. But clearly this is one place we can make some real, meaningful changes. And possibly save money in the process. The article that shows this graph mostly discusses the long-term, large scale challenges we face if we are going to mitigate global warming, but for me this diagram was the most dramatic part of the article.
Nuclear is only covered in two articles, one proposing a new, supposedly “safe” nuclear technology based on thorium. This is a proposal focused on Norway since Norway has one of the world's largest reserves of thorium. The idea seems to be considering developing an altogether new technology. This new technology would not use enough fuel to sustain a chain reaction, thus eliminating the worst dangers of nuclear power: the Chernobyls and TMIs we have faced in the past. Waste is “expected to be low,” but exactly how low and what could be done with it is not discussed. What is interesting is that nuke shills keep telling us that nuke power is absolutely safe...so why does this article, aimed at scientists, still talking about making things safe? Suggests that the current technology is not as safe as nuke shills are telling us. Honestly, I just wish nuke advocates would be up front about these things. Nuke may have a role, maybe even a strong role, to play in getting beyond fossil fuels, particularly in places like India and China that are not going to be as concerned with green energy so much as fueling their economy as rapidly as possible. But the fact that the shills and advocates seem to distort the truth compared to what I read in Scientific American and Science and Nature really makes me wonder what else they are hiding.
Solar is covered in a few articles, including a new technology using a gallium arsenide-based solar cell developed at the National Renewable Energy Laboratory in Golden, Colorado and being used in the Negev desert in Israel. It is estimated that this technology, if used on a large enough scale, can reach 40% efficiency at converting sunlight to electricity and can achieve what is considered the magic number of $1000 per kilowatt of electrical capacity that would be needed to make solar competitive. Another article suggests a technology that could cut the cost of producing solar cells by as much as 75% using a modification traditional silicon based technology.
Many articles cover biofuels. One article covers the intersection of agriculture and energy, how farmers can make money growing the fuel for biofuels. It is proposed that small farms could produce crops such as the grass Miscanthus for local biorefineries, which would produce local energy. I should note wind power already provides a way in which small farmers, but placing turbines on part of their farms, can make more money than if they grow only crops. This is partly because of the very unfair way in which crops are purchased by large agribusiness, providing farmers with almost no profit. But it also indicates that there really is a good market for locally-produced wind energy.
Other articles discuss the use of genetically engineered microbes and plants to produce biofuels more efficiently. “Genetic engineering” is a term that worries many, and there are dangers that require regulation. But genetic engineering is not inherently dangerous and if proper regulation is in place it is a powerful technology. Genetic engineering is part of what I have been doing for 20 years. But when it is done on a large scale, as in agriculture, safety measures must be in place to prevent environmental spread of the genetically engineered organism. If this is done, the potentials described for boosting biofuels could be enormous.
This is simply a brief overview of SOME of what is covered in this excellent issue. I recommend going to your local University science library and tracking it down. It is a rich source of information on the current scientific thinking regarding energy issues.
BBC news has a recent article on IPCC recommendations for global warming solutions. Remember, IPCC represents a large number of our best scientists and is privy to the cutting edge science.
Some excerpts:
The growth in greenhouse gas emissions can be curbed at reasonable cost, experts at a major UN climate change conference in Bangkok have agreed. Boosting renewable energy, reducing deforestation and improving energy efficiency can all help, they said.
For the record, renewables, forests and efficiency are what I have been pushing for years. Some past articles I wrote include this on forests, this on light bulbs, and this rather controversial one on reforestation. But that is just a sampling.
Back to the BBC article:
Many technologies can play a role in cutting emissions, the IPCC says; but it singles out the building sector as a potential major contributor, and energy efficiency as something that "plays a key role across many scenarios for most regions and timescales". Nuclear power and carbon capture and storage, where emissions from fossil fuel power stations are captured and buried underground, could play important roles; but with nuclear, "safety, weapons, proliferation and waste remain as constraints".
Now, here is where some nuke advocates will jump in: nuke "COULD play" an important role. Except they would change it to "MUST" play an important role. I suspect it is somewhere in the middle. I suspect that it will have to play some role, hopefully not too large, but again India and China will likely take the nuke options. I will also note that scientists are still bringing up all those pesky safety, security and waste issues that nuke advocates and shills try to tell us are all solved and we don't have to worry our pretty heads about. Again, I wish they would just be honest about the risks. Scientists are! By not admitting the risks and limitations, nuke advocates are doing us AND themselves a disservice.
The article ends with a quote from a representative from Friends of the Earth UK:
"By introducing measures and investment that will stimulate sustainable renewable energies and energy efficiency, governments can help to achieve cuts in global emissions by 50% by 2050. Without this, we face devastating consequences."
A version of the IPCC report aimed at policy makers can be found here. In it, BOTH nuclear AND renewables are presented as part of the solution. Many of the nuke advocates say "sure, we support renewables" but then they don't give it any place in their stated plans, instead giving the lion's share to nuke and denigrating renewables as near useless. But this isn't really how the IPCC report reads to me. Nuke and renewables seem to both be given solid roles in what we need to do. Energy efficiency is given a MUCH larger role than nuke advocates seem to give it, at least when they discuss details. Some statements that nuke advocates would downplay in their obsession include:
It is often more cost-effective to invest in end-use energy efficiency improvement than in increasing energy supply to satisfy demand for energy services. Efficiency improvement has a positive effect on energy security, local and regional air pollution abatement, and employment... Renewable energy generally has a positive effect on energy security, employment and on air quality. Given costs relative to other supply options, renewable electricity, which accounted for 18% of the electricity supply in 2005, can have a 30-35% share of the total electricity supply in 2030 at carbon prices up to 50 US$/tCO2-eq ... Climate change policies related to energy efficiency and renewable energy are often economically beneficial, improve energy security and reduce local pollutant 35 emissions. Other energy supply mitigation options can be designed to also achieve sustainable development benefits such as avoided displacement of local populations, job creation, and health benefits...
"Renewable energy" (for immediate implementation) is defined in the report as including "hydropower, solar, wind, geothermal and bioenergy." Renewables for implementation by 2030 are defined as including "tidal and waves energy, concentrating solar, and solar PV."
Among the things the nuke shills do is lump together all bioenergy under biofuels, applying all problems with biofuels (which are avoidable if care is taken) to other forms of bioenergy, like biomass. They also assume all forms of tidal (which often I hear used to include wave) is the same, which it is not.
So scientists approach this problem the same way I do. Start with forests (preservation and reforestation and management), alternative energy (using a broad approach including renewables as much as possible and nuke as needed, keeping in mind the limitations and dangers) and energy efficiency (perhaps the FIRST priority since it can be implemented faster and to more effect in the near term, though the other methods are also critical). Carbon sequestration is controversial and seems like a half-assed solution, but has to be considered if needed. Nuke shills approach it by dismissing renewables altogether, calling them "bioFools" and "tinker toys," showing their lack of understanding of the approach scientists are taking, and saying ONLY nukes can save us. Nuke advocates are more reasonable, but even they relegate forests, efficiency and renewables to a tiny part of the solution and gush over how nukes will be 90% of the solution. Don't be fooled. They may well be right in recognizing that nuke energy, particularly when you think of global solutions, will be a likely PART of the solution. But don't let them tell you it has to take the lion's share of our attention and money. Be open to nuke power because it may be a necessary evil. But don't let them tell you the bulk of what scientists are telling us to do is just "tinker toys." If they tell you that, they are either lying or ignorant.
For some more info, I recommend the Union of Concerned Scientists (UCS) website, though nuke advocates say they exaggerate the risks of nuke power.
UCS on Clean Energy
UCS on Global Warming solutions
UCS on what YOU Can do
And, the page nuke advocates disagree with, UCS on nuclear safety.
And for those who want something they can do right now:
FIRST: just switch to compact fluorescent bulbs! The light may not be perfect, but it saves gobs of energy AND money. Our energy bill went down by one third when we switched. It really works!
SECOND: Lobby banks and financial institutions to STOP INVESTING IN COAL POWER PLANTS! Urge them to start investing in the future, not the past. Go here for this action alert.
You can also help through organizations like Trees, Water, People. Do carbon offsets through Native Energy (this is what both Al Gore and Democracy for America do).
If you have your favorite action you want to tell us about, please put it in the comments. | 20,678 | 8,945 | 0.000112 |
warc | 201704 | After reaching a new nadir of productivity in 2013, Congress kicked off a legislative session this week with a packed science and technology policy agenda. Between revelations of the NSA’s broad domestic spying powers, ongoing budget uncertainty, and the specter of climate change, plenty of issues will be vying for members’ attention in 2014, promising a flurry of contentious political jockeying going into this year’s midterm elections.
Of course, this is Congress that we’re talking about, so it's unlikely that we will see any marquee legislative battles beyond the usual fiscal bickering. After three years of putting science and technology on the back burner, neither party has a clear set of policies, and election-year politics are likely to shape the already limited agenda. Lawmakers have said, for instance, that they do not plan to take up any major legislation on energy or environment, and President Obama's expected executive orders on climate change are unlikely to be followed up by decisive action in Congress. Debate over major tech issues, most notably the use of unmanned aerial systems, will also likely take place outside of the Capitol Building.
Still, there are some questions that Washington will have to address in 2014. Here are the most important science and tech issues on Congress’s to-do list:
Debate over the NSA is just beginning. Image via Wikimedia Commons NSA Reform: Obviously the big question for 2014 is how Congress will act to rein in the NSA’s controversial surveillance programs, including the bulk collection of virtually all American phone records. The calls for aggressive reforms have gained momentum among a coalition of civil liberties activists and tech executives over the past six months, and were recently galvanized by a federal court ruling that declared the agency’s metadata collection is likely unconstitutional. On Friday, U.S. Sen. Rand Paul filed a class-action lawsuit against the Obama administration over the NSA’s spying practices, and other members of Congress have pledged to take action at the legislative level. So far, though, it’s not clear how far that action will go.
A lot will depend on President Obama’s response to the reforms suggested by a presidential review panel in December. According to the
Los Angeles Times, the President is planning his own package of reforms, which will likely include putting a public lawyer on the Foreign Intelligence Surveillance Court and shifting the NSA’s bulk metadata storage to a private partner. Given that leaders of both chambers have typically deferred to Obama on intelligence issues, this announcement will likely influence how NSA reform legislation moves forward in Congress, where members are divided between a stringent overhaul of the spy agency’s metadata collection programs and more tepid reforms suggested by the NSA’s defenders.
Science needs money too. Image via Flickr/IRRI photos Science Funding: Between the budget sequestration and last fall’s government shutdown, 2013 was a rollercoaster for US scientists, wreaking havoc on federally-funded research projects after years of steady spending cuts. While the bipartisan budget deal that Congress passed before the Christmas recess provides some relief for the sequester pain, lawmakers now have just two weeks to pass an actual spending bill, or bills, to determine how much money each agency gets and which priorities get funding. That gives scientists very little time to make their case to lawmakers, and given the general animosity to government science programs among House Republicans, the outlook is uncertain at best. Asteroid Retrieval: Also in regards to funding, Congress still has to pass a NASA authorization bill to recommend funding priorities for space exploration. Both the House and the Senate have their own versions of the bill, with different priorities and spending levels. But the biggest differences are over funding for NASA’s Asteroid Retrieval Mission, a controversial program that aims to bring a small near-earth asteroid into lunar orbit by 2025. Obama is an enthusiastic supporter of the program, which will take the US one step closer to sending humans to an asteroid. But the House’s NASA authorization explicitly bans the program, setting the stage for a partisan battle over space exploration in 2014.
A protester against the Keystone XL project. Image via Flickr/maisa_nyc The Keystone XL Pipeline: On the energy and climate change front, the biggest question in 2014 is whether the Obama administration will finally make a decision on the Keystone XL pipeline, entering its fifth year of regulatory and political purgatory. Environmental groups have long since coalesced around their opposition to the project, which will transport crude oil from the Canadian tar sands to Oklahoma and then on to the Gulf of Mexico. But the GOP has hammered Obama over the delays, and House Republicans plan to make the pipeline a centerpiece of their energy and job creation agenda in 2014. Any final decision is unlikely to come before the spring, after the State Department releases its new environmental impact report. With midterm elections around the corner, though, don’t be surprised if additional delays punt the Keystone XL question into 2015. Patent Trolls: The growing problem of patent trolling moved to the top of Washington’s tech policy agenda last year, and all three branches of government are set to tackle the issue in 2014. In a rare display of bipartisanship last month, members of the House of Representatives voted overwhelmingly in favor of legislation to rein in abusive patent litigation, and the Senate Judiciary Committee is expected to move forward on its own bill early this year.
The big issue now is whether the final legislation will include an expansion of the “covered business method,” or CBM, an expedited process that allows the Patent Office to get rid of low-grade patents, the preferred vehicle for patent trolls. The provision was removed from the House bill in response to aggressive lobbying from Microsoft and IBM, but patent reform supporters hope it will be included in a more aggressive Senate reform package. New York’s powerful Democratic Sen. Chuck Schumer supports strengthening CBM, and has promised a fight to make sure it makes it into the Senate bill.
The FCC's Tom Wheeler needs to make some decisions on the open internet. Image via Flickr/Luis Paniagua Net Neutrality: This year is shaping up to be a very busy one for Tom Wheeler, Obama's new Federal Communications Commission chairman. A former telecom investor and lobbyist, Wheeler has spent his first months on the job reassuring tech policy advocates that he will be an independent voice on the commission, demonstrating a surprisingly hands-on approach to dealing with the public and Congress. But he will likely get his first major test this month, when the D.C. Circuit Court of Appeals issues its expected ruling on the FCC’s net neutrality rules, which set the administration’s guidelines for an open internet.
Already, analysts are anticipating a loss for the FCC, which would leave Wheeler to decide whether to relitigate the issue and spend precious time and political capital in a protracted battle with House Republicans. Although Wheeler insists that he is a strong supporter of net neutrality, some of his remarks have been more ambiguous. However he proceeds, the decision is likely to shape his relationships on Capitol Hill and set the tone for other major policy debates, including that over the upcoming spectrum incentive auctions set to take place in the beginning of 2015. | 7,745 | 3,568 | 0.000285 |
warc | 201704 | A Coalition of leading investment banks, investors, governments and countries is implementing Green Building Investment Underwriting Standards and Sustainable Building Securities (SBS), providing higher valued collateral, an economic stimulus, and addressing investor confidence, liquidity, innovation, climate change and energy and global security.
The completed and peer-reviewed Wall Street due diligence released at the NYSE with leading investors, investment banks and rating agencies, documents that green buildings and certified sustainable manufactured products are more profitable, less risky, and preferred by investors over conventional. The due diligence consists of over 30 reports, consensus standards, and investor surveys reviewed at national public meetings at Federal Reserve Offices. | 805 | 472 | 0.002127 |
warc | 201704 | Cleveland Clinic's accredited Vascular Laboratory performs non-invasive studies such as diagnostic ultrasound and segmental pressures/ pulse volume recordings to detect vascular disease. Ultrasound is the most important tool in the vascular laboratory. Large ultrasound machines are used to take pictures of blood vessels and blood flow in these vessels with color Doppler and pulsed Doppler. Segmental pressures and pulse volume recordings is another important tool used in a vascular laboratory. These tests are performed to locate the area of blockage in the arms and legs.
After a physician’s physical examination, testing in a vascular laboratory is often the first step in diagnosing vascular disease. Specific tests are ordered according to the patient’s symptoms and suspected vascular problems. Diagnosing vascular disease begins by taking a careful medical history, including risk factors and a physical exam (including symptoms, temperature of the skin, appearance of limbs and blood vessels, and presence or absence of pulses).
From this information, the physician decides if further testing is needed. Testing is performed by a registered vascular technologist/sonographer. Non-invasive testing utilizes various types of technology to evaluate flow, perfusion, and pressures within the vessels at rest and with exercise. These procedures are generally painless and can help to determine if blood vessel disease is present, the location, and severity. Once a test is completed, the images are sent to a physician for review and interpretation. From the results of these tests, the physician will determine the need for more non-invasive testing or procedures to treat vascular disease.
Cleveland Clinic's non-invasive vascular laboratory is committed to world class patient care and service. It is accredited by the Intersocietal Accreditation Commission* which means that the lab has a long-term commitment to high standards of quality patient care and monitoring.
*A new browser window will open with this link. The inclusion of links to other web sites does not imply any endorsement of the material on the web sites or any association with their operators
Reviewed: 10/15 | 2,204 | 1,044 | 0.000965 |
warc | 201704 | The first step in taking an active role in your health is to Know Your Numbers, including blood pressure, cholesterol, blood glucose and body composition. These numbers are important indicators of good health, and flag potential health problems that can be improved or eliminated with early detection.
Our Mission is to improve the health of every individual we serve.
Wellness Services
Employer sponsored health screening events are a great way to launch a workplace wellness program, and are an excellent way to get employees thinking about their health.
Community Outreach
OnSite Wellness will partner with community and fundraising groups to promote health education and wellness. | 691 | 414 | 0.00244 |
warc | 201704 | By Robin Plotkin, MS, RDN
It was all things HOLIDAY PREP during the most recent National Peanut Board Twitter Chat as NPB’s registered dietitian Sherry Coleman Collins and yours truly took to tweeting about the holiday season.
Our Favorite Way to Enjoy Peanuts
We kicked it off with an easy one! The resounding response? People are partial to PEANUT BUTTER. On toast, in smoothies, slathered on noodles—salted, unsalted, crunchy or smooth—we love it all! That’s no surprise, however, peanut flour, peanut oil and peanut powder are also trending when it comes to popular plant-based ingredients.
RDs Are Masters of Preparedness
When we asked for some tips on getting ready for the cooking part of holiday meals, our followers responded with super ideas. The KISS (Keep It Simple, Sweetheart) principle was prominent and answers such as menu planning, pre-grocery shopping, shopping at off times (i.e. evening or late night) were given as ways to prep ahead. Also, making detailed lists of menus, shopping lists, and other details was one of the most popular responses, with folks recommend using everything from iPhone and Android apps to backs of envelopes and sticky notes for list making.
Food Prep 101
“What are the foods or ingredients to stock up on?” we asked. Chicken and vegetable stocks, frozen fruits and veggies, canned beans and homemade GORP (peanuts, raisins and mini chocolate chips or candies) all made the list. Stocking up on foods that do more than one thing makes feeding a crowd a breeze.
Go-to Breakfast and Dinner Ideas
During the holidays, all the focus may be on the main meal. But what about feeding our guests the rest of the time?
For the morning meal, Peanut Butter Stuffed French Toast and slow cooker oatmeal with a fresh fruit and peanut topping bar were fan favorites. Looking for something different? Check out these: Citrus Salad with Mint And Peanuts, Funky Monkey Muffins and Homemade Peanut Granola Bars.
Dinner recommendations ranged from Peanut Butter Noodles with leftover chicken or turkey (my personal favorite) to good old Peanut Butter and Jelly sandwiches. To kick up your PBJ offerings, consider serving a DIY bar with a mix of peanut butters, dried and fresh fruit, jams and fruit spreads, and honey.
Love global cusine? Check out this recipe and video for Curried Peanut Cauliflower Rice or this Senegalese Sweet Potato & Peanut Soup. Both are easy prep and can feed a crowd!
Keeping Meals Healthy
As registered dietitian nutritionists, we believe that a healthy diet is paramount to a healthy life. We asked for fool-proof tips from chat attendees that they share with family, friends, clients and readers:
(via Twitter) Deanna Segrave Daly, RDN: promoting eat a healthy breakfast/lunch, don't go to parties hungry, indulge in favorites you only get this time of year, Emily Holdorf, RDN: I like to remind people about portion control & enjoying the moment. Don't restrict yourself & you'll be happy! Regan Jones, RDN: I go by 1/2 plate fruit/veggie rule at holidays. Fill other 1/2 up w/dishes luv & ENJOY.
As we wrapped up the chat, Sherry left us with a great tweet to remember. “Keeping focus on most important things can help make the holidays even more special. Family, friends and really good food!”
Wishing you a very happy and healthy holiday season!
Want to review the chat tweet by tweet? Check out the #Rdholidayprep hashtag for the full conversation. Want More?
Here are some additional tips on healthier holiday eating.
Did you know? Peanuts are now considered “healthy” according to the recent changes in FDA rules. Read more about it here . Robin Plotkin has been in the business of food for over 30 years. Since her ice cream dipping days at Frosty’s in Peoria, Illinois, she’s maintained her passion for food, culinary arts and nutrition as a registered dietitian(RD) and culinary nutritionist. She’s fluent in event management, media relations and brand and product ambassadorship. She advises chefs, develops recipes and helps reporters focus their food and health stories. She helps companies expand and amplify their product goals and reputation with social media outreach. And, as a prolific blogger, she helps busy families find everyday solutions to leading healthier lives through her personal blog, Robinsbite, where she’s been blogging since 2009. | 4,417 | 2,303 | 0.000443 |
warc | 201704 | WASHINGTON, D.C., September 18, 2009
-
Wind and Solar
“The renewable energy industry also had objections to the bill. Craig Mataczynski, president and CEO of RES Americas, testified on behalf of the American Wind Energy Association and the Solar Energy Industries Association… The wind and solar industries are concerned about consolidating all energy leasing into one office, saying it could disadvantage renewable energy compared to oil and gas with future administrations or of applications. Mataczynski also said competitive bidding may not be appropriate for a less mature industry like wind and solar and that a move to such competitive leasing may delay the growing backlog on federal lands. The industry also advocates no net increase in fees or royalties.” (E&E, 9/18/09) delay renewable energy development
Uranium
“Speaking on behalf of the National Mining Association, Uranium One Americas Executive Vice President warned the House Natural Resources Committee Thursday the proposed energy and aquatic legislation will and exploration, and illegally seize current uranium mining claims… Stover warned the House Committee that making uranium a leasable mineral ‘will not only negatively impact the domestic uranium mining industry, but also the economy and the national security of the United States.’” (Mineweb, 9/18/09) mean the end of domestic uranium mining
Oil and Natural Gas
American Chemistry Council President and CEO Cal Dooley (former Democrat Congressman) said: "We are concerned that H.R. 3534 of the United States. Our industry and the entire U.S. manufacturing sector are dependent on competitively-priced energy to maintain our jobs…For the business of chemistry, natural gas is an important raw material for chemistry that goes into energy-saving applications such as solar panels, wind turbines, building insulation, compact fluorescent light bulbs, lithium-ion batteries, lightweight vehicle parts, and many others - a use that in most cases does not emit greenhouse gases. Unfortunately, H.R. 3534 ignores this vital use of natural gas." (ACC, 9/16/09) fails to contribute in any way to the energy security
“Alex Campbell, testifying on behalf of the Independent Petroleum Association of Mountain States, said the bill would
by creating redundant bureaucracy and regulation, hamper efficient market mechanism, decrease the integrity and transparency of leasing, significantly increase costs to produce oil and gas on public lands, and fundamentally change the multiple-use management of federal lands to an approach that will further restrict energy development.” (E&E, 9/18/09) add time-consuming delays
“Dan Naatz of the Independent Petroleum Association of America said Rahall's bill is ‘an effort to make it more difficult to operate on federal lands at a time when they should be looking to make it easier and simpler.’ He criticized the proposed increase in rental rates, production incentive fees and other new fees and ‘diligent development’ rules for onshore and offshore leases. ‘It's really a
as we're trying to find more American natural gas and more American oil,’ Naatz said.” (E&E, 9/10/09) step in the wrong direction
“The American Petroleum Institute's group director of upstream and industry operations, Doug Morris, said he fears a network of regional bodies could
for preparing offshore lease sales.” (Energy Intelligence, 9/18/09) tamper with the five-year planning process
# # #
Print version of this document | 3,584 | 1,760 | 0.000589 |
warc | 201704 | A garage is a wonderful thing to have, especially in New England. The reason seems obvious: it snows a lot here, and without a garage you have to dig your car out regularly.
An attached garage is even better; whether it’s snowing or raining or sleeting or icy outside (or some combination of all four), you can keep warm and dry as you carry in your groceries.
Oh, how I’ve loved my attached garages! I appreciated them all the more because of the considerable time I’ve spent living in New England without a garage at all.
But I appear to be in the minority. It’s not that a lot of people don’t have garages here—they do. It’s just that they rarely use them for cars.
Oh, they
use them, all right. They’re stuffed to the rafters with goods: lawnmowers and saws and lumber and bicycles and hockey skates and garbage cans and paint cans and old furniture and whatever it is that most people put in an attic or a basement or a toolshed. And this despite the fact that most people in New England actually have attics and basements and toolsheds.
But even the relatively empty garages seem to remain empty of their owners’ cars.
I think perhaps it’s a macho thing, a show of Yankee toughness: only wimps or people “from away” (is that redundant?) consider the garage to be the proper resting place for a car. The best analogy I can think of is to umbrellas in Seattle—have you ever seen a native using one, despite the constant damp dank dripping drizzle alternating with the drenching drowning deluges of the downpours? | 1,590 | 838 | 0.001252 |
warc | 201704 | Description:
Professor Clover, a poet, cultural critic, professor of English, and social activist (he's one of the "Davis Dozen"), will argue that the global economic crisis, now entering its sixth year, is in the first place a story of global immiseration and the destructive volatility of capitalism itself. Somewhere further down the list of the crisis's effects is the way it has revealed a troubling gap between the actual struggles of humans and much of the political thought admired for decades under the name "critical theory." But if critical theory seems to have less purchase on the present, the opposite is also true. "Crisis theory," developed from a critique of traditional political economy, does not seem to offer a way to "read" and understand a great variety of human experiences, social narratives, and cultural products. Are the two kinds of theory entirely different things using the same word? Is this distance simply a feature of our moment, and a limit of both critical theory and crisis theories? Or can crisis theory provide a sort of bridge between intellectual inquiries and lived political antagonisms? | 1,142 | 647 | 0.001561 |
warc | 201704 | for National Geographic News
With Spider-Man, the world's most famous web-slinger returning to the movie screens today, spiders everywhere may be readying their webs for a bit more attention. But how do our red-and-blue hero's capabilities compare with the superpowers of real spiders?
Spiders aren't swinging their way through the skyline or facing up to crazed criminals like Doc Ock, the villain in
Spider-Man 2. But they've got the wherewithal to survive in a range of environments that gives them their own extraordinary edge.
Many species of jumping spider, found all over the world, can bound as much as 50 times their body length. Right now, U.S. long jumper Mike Powell holds the world's record with a jump of 8.95 meters (29 feet, 4.5 inches). If the six-foot-two (1.9-meter) Powell had a jumping spider's hopping capability, he might be able to leap 300 feet (90 meters).
Jumping spiders use these fantastic leaps to snatch unsuspecting insects. "They hunt down prey, and then they'll pounce on it," said Andrew Martin, from the Institute of Technical Zoology and Bionics at the University of Applied Sciences in Bremen, Germany.
How Spiders Walk on Ceilings
Some spiders have another seeming superpower: an ability to adhere to sheer surfaces, even when upside down. To find out how they do this, Martin and colleagues studied the foot of a jumping spider,
Evarcha arcuata, through an atomic force microscope.
The spider's foot is covered with hairs, or setae, that branch into ever smaller hairs, or setules. Through their powerful microscope, the team studied the forces acting on a single seta. They calculated that the grip of the jumping spider is so strong that it could hold 170 times the spider's own body weight before coming unstuck. That would be the same, Martin said, as Spider-Man lugging 170 people from danger while clinging to a building with his fingers and toes.
What's at work in real spiders are van der Waals forces, caused by moving electrons that create hot spots of attraction between nearby molecules. With these miniscule charges acting on the 600,000-plus setules in each furry seta, a spider can hang upside down on a leaf or a wall with ease.
The unusual thing, Martin said, is that the spider's clinging ability resembles that of a gecko more than that of an insecteven though eight-legged spiders are much more closely related to six-legged insects than to lizards. "From a biological point of view, that was pretty astonishing," he said.
The team, which published its findings this spring, hopes the secret of the spider's stickiness can be adapted for human usessticky notes, boots for astronauts, even gloves for soccer goalies.
SOURCES AND RELATED WEB SITES | 2,724 | 1,464 | 0.000688 |
warc | 201704 | for National Geographic News
Photos of giant whale sharks snapped by vacationing scuba divers and snorkelers are helping scientists track the elusive marine creatures across the oceans.
Biologists have adapted a complex algorithm developed by scientists working for NASA. The original algorithm mapped stars. The new one analyzes photos of whale sharks, identifying each animal's unique pattern of white spots. The program determines if a particular shark has been seen before by other database users.
The tourist-collected tracking information is helping researchers learn more about where and when the fish migrate and their rate of return to particular areas, Norman said.
For example, at Ningaloo Marine Park in Western Australia, where the tracking technique was first tested, researchers found some sharks remain near the reef for up to three months.
"We can use these data to highlight the need for international agreements to protect this threatened species," said Norman, who is a National Geographic Society emerging explorer, as well as the recipient of funding from the Rolex Awards for Enterprise.
(National Geographic News is owned by the National Geographic Society.)
Tracking Whales and Stars
Whale sharks are the world's largest living fish species, growing more than 40 feet (12 meters) long. They are listed as vulnerable to extinction by the World Conservation Union (IUCN), though little is known about their basic biology, ecology, breeding and migration patterns, and worldwide population size.
In 2000, Norman formed ECOCEAN, a nonprofit marine conservation organization based in Perth, to develop the participatory tracking system to facilitate whale shark studies.
SOURCES AND RELATED WEB SITES | 1,734 | 947 | 0.001065 |
warc | 201704 | Conford, Gaulkin and Kilkenny. The opinion of the court was delivered by Conford, S.j.a.d.
The question here is whether the Unsatisfied Claim and Judgment Fund Law, N.J.S.A. 39:6-61 et seq. , and particularly section 39:6-78, permits one injured while a passenger in a car involved in an accident to join the Director of Motor Vehicles as a defendant, along with the operator of the car he was riding in, when he asserts that the accident was caused by the negligence both of the latter and of an unidentifiable operator of another motor vehicle. (The complaint does not expressly state that the identity of the other motor vehicle and owner thereof is unascertainable, as required by the cited section, but no point is made of this by the Director, and leave to amend should be granted if, as we assume, it was plaintiff's intention so to assert. If the identity of the other car or its owner was known, the action is subject to dismissal as to the Director. See Tinsman v. Parsekian , 65 N.J. Super. 217 (App. Div. 1961).) The Director moved for a dismissal as to himself as defendant on the ground that the statute contemplates exhaustion of plaintiff's remedies against other tortfeasors implicated before suing the Director as statutory respondent for the liability of the unknown driver. The motion was granted by the Law Division, primarily on the authority of McGainey v. Cable , 65 N.J. Super. 202 (App. Div. 1961). Plaintiff appeals.
The Unsatisfied Claim and Judgment Fund Law was adopted in 1952 for the primary purpose of affording some measure of relief to the victims of negligently operated automobiles where compensation was otherwise thwarted either by reason of lack of knowledge of identity of the tortfeasor (the typical "hit and run" case) or by his financial irresponsibility. Dixon v. Gassert , 26 N.J. 1 (1958). Running through the
scheme and structure of the statute, however, are measures to prevent actual payment out of the State Fund of any such claim unless a genuine cause of action has been established within the scope of the act and all other possible means for satisfying the claim are exhausted.
Ordinarily, as pointed out in Corrigan v. Gassert , 27 N.J. 227, 233, 234 (1958), "the statute embodies two distinct procedures to be pursued by a claimant who seeks to recover from the Fund. The procedure to be followed by a particular claimant depends upon whether or not the identity of the tortfeasor who inflicted the injury can be ascertained." If it can be, the negligence action itself is brought against the tortfeasor only, not the state official representing the Fund (the Director of Motor Vehicles). And if the judgment recovered therein is satisfactorily established to be uncollectible, application may be made to the court wherein judgment was entered for an order for payment out of the Fund up to the statutory maximum specified. Where, however, the victim has been injured by a "hit and run" driver and thus does not know whom to sue, other provisions of the statute, including section 39:6-78, apply, permitting the claimant to bring his action against the Director in the first instance. Even in such case, however, the judgment entered must be reduced by any amount received or recovered from any other person legally responsible for the damages arising from the same accident. N.J.S.A. 39:6-84. In other words, the general philosophy of the act is that whether the Director is sued in the first instance, as in a "hit and run" situation, or the Fund is proceeded against after an uncollectible judgment is recovered against a known operator, the Fund is only a secondary resource for relief of the claimant, and preliminary exhaustion of other means of satisfaction of the claimant's cause of action is contemplated.
The statute envisages that in an action against a known defendant it may eventuate that recovery will be denied on the sole ground that the injury was occasioned by an unknown operator. If so, the claimant may within three months after
a judgment incorporating that finding apply for leave to sue the Director as though under section 39:6-78. N.J.S.A. 39:6-79. Moreover, even after commencing an action against a known operator, if it thereafter appears that an unknown operator was also implicated, the Director may be impleaded as defendant. See N.J.S.A. 39:6-80.
The crucial question posed by the instant case, one not heretofore passed upon in any reported opinion by our courts, is whether the Director may be joined as a defendant under section 39:6-78 when plaintiff seeks to assert his claim against the operators of both of the two cars jointly involved in an accident, he being a passenger in one of the cars, one operator and car being unknown, the other (the car in which plaintiff was a passenger) known. The pertinent language of N.J.S.A. 39:6-78 is as follows:
"When the death of, or personal injury to, any person arises out of the ownership, maintenance or use of a motor vehicle in this State on or after April 1, 1955, but the identity of the motor vehicle and of the operator and owner thereof cannot be ascertained or it is established that the motor vehicle was at the time said accident occurred, in the possession of some person other than the owner without the owner's consent and that the identity of such person cannot be ascertained, any qualified person who would have a cause of action against the operator or owner or both in respect to such death or personal injury may bring an action therefor against the director in any court of competent jurisdiction, but no judgment against the director shall be entered in such an action unless the court is satisfied, upon the hearing of the action, that --"
So far as the face of the section is concerned, it does not purport to restrict the right to join the Director to such "hit and run" situations as do not involve the contributory participation in the accident of a known car and operator. Yet the Director argues here that it should be so construed in the light of the general scheme of the statute as calling for resort to all other remedies before seeking payment from the Fund. The flaw in the argument, however, is that it assumes ... | 6,215 | 2,641 | 0.00038 |
warc | 201704 | Know Who to Call
A short phone call can make all the difference in the world when your child's had an accident. In addition to 9-1-1, here are a few other numbers to keep on speed dial:
· Poison Control – 1-800-222-1222 · Local ambulance dispatch · Local police department · Local animal control · Auto insurer (if you're in an automobile accident)
If the accident involved a faulty product or negligence on the part of an individual, you may want to consider calling a legal professional. David J. Hernandez, a personal injury lawyer with nearly 30 years of experience has seen his fair share of accident cases involving children. It can be very stressful when a child is involved, which is why it's important for parents to have an expert helping them get through the process if a suit or claim is filed.
Get to the Closest ER or Urgent Care Center
Most accidents are very painful, but they aren't life threatening. Among the most common are broken bones, minor burns, sprains, and cuts. During these instances, you can make the decision to take your child to an urgent care center or the ER.
The benefits of an urgent care facility compared to the ER revolve around convenience and speed of service. Urgent care centers are staffed with physicians and nurses that can handle non-life threatening injuries or illness, but they don't have to care for true emergencies as well. Typically, that means you'll have a shorter wait time and your child will be cared for more quickly. Many urgent care centers accept health insurance just like an ER. However, it's best to research your options and know for sure before an accident occurs.
However, there are a number of accidents that require immediate medical attention at an emergency room. They include:
· Electrocution · Poisoning · Severe allergic reaction · Drowning · Difficulty breathing · Serious burns · Wound with uncontrolled bleeding Keep a Digital Record of Your Child's Medical Documents.
One of the changes initiated by healthcare reform was the electronic health records (EHR) system. The system allows hospitals to pull up a patient's health records from other facilities. However, many hospitals are still in the process of putting their systems in place.
Until EHRs are fully adopted it's still recommended to keep copies of medical records handy. Keeping them with you is now easier thanks to mobile devices. Scanning your child's medical records into your phone will ensure any physician can immediately know your child's current health condition, vaccines, allergies, etc. The TurboScan app is only $5, and it allows you to email the PDFs to yourself so you have a copy of the medical records there as well.
Be Ready in the Summer
ERs around the country see an uptick in accidents involving children during the summer. Kids have more time on their hands, and even amusement park rides on vacation can increase the risk of an accident.
Parents have to be particularly wary of water-related accidents. It's so prominent, drowning is the number one accident in the 1-4 age group. Swimming pool safety is the top priority. Teaching kids how to swim gives them another fun way to get physical activity and makes pool time much safer.
Keep an Eye on Your Kid
After an accident keep an eye on your kid to make sure their condition improves. This includes mentally and emotionally as well as physically. Some accidents, like a bad car wreak or near drowning, can be traumatizing for children. Fears and anxiety that weren't there before can suddenly become a serious issue. Kids can also become depressed if an accident impedes their ability to carry out normal activities.
You can get more accident facts and safety tips at the CDC website. | 3,784 | 1,913 | 0.000534 |
warc | 201704 | Editor: This two-year old post by Rocky Neptun is a constant favorite or our readers. We thought we’d just bring it out for some more sun – but please realize dear reader, that it was written in November of 2010. By Rocky Neptun
Under the shadow of a venomous San Diego District Attorney and a cliff-hanger Attorney General election between a fanatical DA from Los Angeles and a sympathetic DA from the Bay Area, medical marijuana patients, providers and activists met near Mission Bay under the banner of putting patients first.
The November 13th all-day gathering at the Marina Village Conference Center reflected both the radiance of altruism in the medical marijuana movement, its ancient heritage, and the potential to humanize the medical-care-giving industry, as well as the dangers members and patients face from reactionary forces still fighting the obsolete cultural wars of the 1960’s.
About 50 persons turned out to participate in San Diego’s first symposium on “Training for Medical Marijuana Professionals” sponsored by Americans for Safe Access. The core curriculum, almost half the day, was centered on introductory preparation for those working with medical marijuana patients. The emphasis was on treating the whole patient with a greater understanding of how illness is not just an isolated condition but how physical, psychological and emotional factors interact to affect patients’ functioning. Dr. Amanda Reiman, Chairwoman of the Medical Cannabis Commission for the city of Berkeley and a lecturer at UC Berkeley, led the training session.
Don Duncan, co-founder of Americans for Safe Access (along with San Diego’s own Steph Sherer), gave an hour-long history of the movement in California and reported on present efforts in Sacramento to guarantee and expand patients’ rights.
Going way beyond the scheduled departure time, a panel of attorneys gave an overview of current law and recent court decisions, sharing knowledge about what is legal and what is not for both patients and care givers, including cooperatives and collectives. Led by Lauren Payne, Americans for Safe Access’ Legal Services Coordinator, the lawyers conducted “know your rights” training sessions on encounters with law enforcement officials.
As I sat there, looking out the window at the bobbing sailboats moored near the conference center, I thought back to my days as a VISTA volunteer in the Appalachian Mountains. The Voting Rights Act had been passed; yet the black folks we were assisting in Skunk Hollow, near Corbin, Kentucky, lacked safe access to the polls. Roaming gangs of armed “redneck” mountain men threatened any who exercised their “right” to vote. How so like San Diego District Attorney Bonnie Dumanis whose ideological zeal and personal ambition threatens another group of people struggling for access to their rights. In this case, their entitlement to medical marijuana as guaranteed by the citizens of California.
An attorney from Los Angeles, urged the participants to continue the struggle for their rights. He noted that eleven states and the District of Columbia have medical marijuana provisions and another nine states are in the process of working through those rights.
Sexism and Medical Marijuana Prohibition in the Middle-Ages
Medical Marijuana deterrence is not a new phenomenon. Whenever those in power, religious or secular, have sought to increase or maintain that dominance, one of their first acts is to prohibit knowledge (just ask the Chinese government and Google). For thousands of years, the elderly women, usually widows, without a bread-winning male, made their way as the village healer. There were no doctors for the common people. They passed the knowledge of natural healing, the herbs and grasses of the forests, down from mother to daughter, aunt to niece.
When I lived in a small Toltec village in the state of Morelos, Mexico as part of a cross-cultural educational experience in the early 1970’s, there was no doctor around. When I developed an eye malady, the family I was staying with presented me to a wrinkled, ancient woman – the village’s healer – who fanned the smoke of marijuana into my eye and also used a tincture from the plant to cure the infection.
It wasn’t until the 14th and 15th centuries in Europe, when a series of devastating plagues broke out that the Church lashed out against naturalist healers in general and women in particular. From the Pope down to the lowliest friar, the official spin on the plagues was theological rather than medical; it was God’s vengeance for sin and only more devotion, more donations to the Church, would save you.
Fearful mothers and fathers brought their ill children to the old women of the community, not the wine sodden priest. Some were saved; word and hope spread. The absolutism of the Catholic Church was threatened. The inquisition was formed to root out these “witches” and prohibit reliance on “medicine” in favor of prayer and confession. One of the charges brought against St. Joan of Arc was that she used marijuana.
Not only was the giving of medicinal preparations, including cannabis, by herbalists and chemists declared illegal but merely possessing the expertise, called “witch’s knowledge” was punishable by burning at the stake.
By 1484, marijuana had become so well known among the common people for treating the pain and suffering of the plague that a fearful Pope Innocent VIII specifically labeled it “an unholy sacrament of the second and third types of the Satanic mass.” Statements like this, flying in the face of reality, pushed more ordinary folk with their common sense further away from the church and laid the seeds of the Reformation.
Did Jesus Use Marijuana? Would it Have Saved George Washington’s Life?
I suspect that prostitution may not be the world’s oldest profession. [“I must have given a hundred thousand dollars worth of it away before I knew it was worth anything, my aunt used to say.”] I think the tribal healer became the first vocation. From the time we climbed out of the trees anyone could mate but those with the insight and knowledge to restore health and salvage lives were the indispensable ones.
Over 5,000 years ago physician farmers were growing and dispensing marijuana, called cannabis Tai-Ma, in China. Around 1,000 B.C. the migration of the Aryan tribes, spread cannabis medicine from India to Europe. It had hundreds of medical applications, wound healer, muscle relaxant, tonic for pain, fever easer and helped with childbirths. It was considered a “sacred herb” and used by the priests of many early religions as their badge to the “divine.”
From the priests of Shintoism in Japan who used marijuana to unite couples in marriage and drive away evil spirits to the earliest Jews who “as part of their holy Friday night services in the Temple of Solomon, 60-80,000 men ritually passed around and inhaled 20,000 incense burners filled with kanabosom (cannabis), before returning home for the largest meal of the week,” as recorded by Jack Herer in his book, The Sociology Of Cannabis And World History. The Jewish Essene communities, south of Jerusalem, where Jesus is thought to have studied in his youth, are known to have used marijuana as a medicine.
But from independent, self-governing, communal associations, the Christian faith, seized by popes and emperors, became a process of tyranny and oppression. Not only medical marijuana, but an entire cornucopia of healing herbs and substances, tragically, criminally, were systematically denied whole generations of ill people. Well into the 18th Century, bleeding patients of pints of blood was the primary treatment used by doctors. George Washington, who woke up one morning with the flu, was literally bled to death by his doctors. One wonders if he had just smoked some hearty Dutch Passion Feminized Cannabis and gone back to bed, would he have lived well into the 19th Century?
Today’s bleeders would have us dependent on dangerous chemical manufactured by corporations who donate to their political campaigns. It is indeed ironic that Bonnie Dumanis, San Diego’s District Attorney and a member of the Log Cabin Republican Club, in her vicious pursuit of medical marijuana users, is at odds with Abraham Lincoln who refused to approve a proposed prohibition on the use of cannabis. Every American president until the 1930’s used medical marijuana and according to Morey Amsterdam and Eddie Gordon, close friends of John F. Kennedy, who used cannabis for his back pain, he was going to legalize it during his second term.
Even though California voters approved the Compassionate Use Act in 1996, patients and providers have been under attack by reactionary forces and their contempt for voters and police state mentality right up to our present day. As San Diego attorney Lance Rogers pointed out to participants, from the July 2008 joint local and federal narcotics task force raid on the Amsterdam Collective (in opposition to President Obama’s promises to leave patients alone) through the clearly illegal entrapment and forgeries of the SDPD in its Operation Green RX busts in 2009 to October of this year when a North Park medical marijuana collective was harassed patients continue to have their rights assaulted.
As I sat in the conference room, I realized the participants, some professionals, some poor, young and oldies, always looking over their shoulder, aware of their vulnerability and still putting the patients first, are living proof that heroism is alive and well. They are the ethical descendants of those poor women from the Dark Ages who were tortured and burned alive for saving a child’s life with their herbal medicine bag, the attendees are in the tradition of the old woman in the thatched hut who saved my eye so many years ago and they keep the possibility open that I will have help if I need to self-medicate in the future – if that good Cuban rum I smuggle into this country can no longer ease the pain of my osteoarthritis.
There are those among us I call sufferers from “Pleasure Disapproval Syndrome.” A vast populace, unhappy with their lives, trapped in dead-end jobs, bored with corporate entertainment, happy-hour devotees and pharmaceutical addicts who are fearful not of criminals or terrorists…..they shiver in fear that somewhere, someone is having a good time, enjoying life. They voted against Prop. 19, are afraid that lesbians and gays might find enjoyment in marriage and, God forbid, are terrified that a person might actually get pleasure from taking their medicine.
The culture war continues; however, the participants at the San Diego patient rights conference seemed to agree to keep their powder (ah, buds) dry and to continue struggling toward unhindered access to this ancient, safe, and effective medicine for all who need it. | 11,088 | 5,302 | 0.000193 |
warc | 201704 | An interesting chart is making the rounds. It shows how Charlotte-Mecklenburg Schools would have performed on the state's A-F grades if the formula were weighted differently.
Under the law, a school's grade is based 80 percent on test scores and 20 percent on how much growth that school has shown. As a result, the grades were no surprise: Schools filled with poor kids did worse than schools with few poor kids. Some critics, including the Observer editorial board, argue that the A-F grades would be vastly improved if more weight was given to how much growth a school has shown, not only where it is at one point in time. This chart, which comes from CMS, shows what would happen.
Under the 80/20 formula, 47 CMS schools were given a D or F. If the formula were 50-50, no schools would get an F and 16 would get a D. If the formula were 20-80 (80 percent of the grade based on growth), five schools would get a D and none would get an F.
This is not tinkering the formula to make your schools get artificially better grades. It's tinkering the formula to more properly weight how much progress a school is making, which is an important measure. It just so happens that this more accurate gauge also reveals that public schools aren't performing as badly as the state grades lead you to believe.
Taylor Batten | 1,318 | 682 | 0.001473 |
warc | 201704 | Attorney General Eric Schneiderman is touting another clawback of taxpayer dollars today.
In a press release, Schneiderman announced a $2.5 million dollar settlement in a case against Pharmacia Corporation, with the recovered funds going to Medicaid and the Elderly Pharmaceutical Insurance Coverage Program.
Schneiderman accused Pharmacia Corporation of inflating the costs of drugs that were sold to state health programs. New York Medicaid, EPIC, and other health plans based their reimbursement rates on these inflated prices and ended up paying more money for some drugs than they should have.
The new attorney general has been aggressively targeting medical fraud, and in the past two months has recovered $1.6 million in a settlement with three different Medicaid providers, and $18 million in damages from the Young Adult Institute, Inc., which also promised to make reforms in their services.
Since coming to office, Schneiderman has launched the Taxpayer Protection Unit, a group that will “target corrupt contractors, pension con-artists, and large-scale tax cheats who rip-off New York State government and its taxpayers.” The TPU is an add-on to the Medicaid Fraud Control Unit, which had already investigated fraud under then-Attorney General Andrew Cuomo.
“New York’s taxpayers will no longer foot the bill when contractors inflate their prices to make an extra buck,” said Schneiderman. “These are hard financial times for our state, and my office will do its part by uncovering every dishonestly claimed dollar, and holding those who take advantage of New York accountable.” | 1,633 | 869 | 0.001181 |
warc | 201704 | Reprinted from the National Geographic book,
Pristine Seas: Journeys to the Ocean’s Last Wild Places by Enric Sala
When I ask people if they fear anything about the sea, the most common response is “Sharks!” There seems to be a widespread belief that sharks have been evolving in the ocean for 300 million years with the sole purpose of eating every single human that dares to swim in it. Steven Spielberg’s movie
Jaws and the Discovery Channel’s Shark Week have not helped to change that perception. But I dive with sharks—with lots of sharks, often—and I really miss them when they are not around.
Advertisement
The first time I experienced a truly sharky environment was quite comical. We arrived at the wild Kingman Reef on a hot morning in August 2005. Sixteen hundred kilometers south of Hawaii, Kingman looks like a boomerang on satellite photographs. Half of the atoll barely breaks the surface, and the other half is sinking, as ocean volcanoes do after a few million years. We anchored our ship between patch reefs in the lagoon. We were in a sheltered spot, but we could hear the roar of the ocean swell breaking on the outer side of the reef. I was very impatient to dive at the wildest place I had seen in my life, and also a little nervous, precisely because it was so wild.
We did the routine check of our diving gear, made sure we were not forgetting any scientific gear or cameras, and jumped into one of our Zodiac inflatable dinghies. We sailed through a passage on the reef, between breakers, and arrived at the most exposed side of the fore reef. My friend Zafer Kizilkaya, the expedition photographer, casually got ready and did a backflip over the rubber side of the Zodiac. Five seconds later, I was about to get into the water myself when Zafer literally jumped, like a dolphin, out of the water and back into the Zodiac.
“There are too many sharks down there, and they are aggressive!” he yelled.
My companions and I looked at each other for what seemed the longest second of my life. We shrugged our shoulders, and I remember saying, “Safety is in numbers. One, two, three!” We all jumped in. As soon as our bubbles cleared, we saw a dozen gray reef sharks swimming around us. They were indeed very curious, but after a few minutes they lost interest in us—weird animals with two tails, throwing bubbles and making a lot of noise—and they went about their business.
That was the first of many such shark encounters in the Line Islands. After those dives, I became spoiled for life. Now, when I dive at a place without sharks, I really miss them.
Support Our Work
Join the cause by donating or signing up for our newsletter with regular updates from the field.GET INVOLVED | 2,776 | 1,465 | 0.000702 |
warc | 201704 | The articles below focus on Web Analytics & Optimization, the art and science of improving websites based on the analysis of visitors' behavior. They focus on analyzing and optimizing marketing efforts, turning new visitors into customers and returning customers into loyal friends. Learn a broad range of techniques (such as social media, segmentation and other website optimization) in order to increase revenue.
In order to measure the performance of your blog, you will need to rely on data that will give you in-depth insights regarding the blog value. In this post I provide a (non-comprehensive) list of features, reports and user segments that should be used for such an endeavour.
While digital marketing has proven to be an effective form of communicating with and converting customers, many brands are looking for ways to create a more emotional, holistic experience - one where there are no distinct lines between on- and offline interactions. How do you bring these two together? By adding tactile marketing to your digital marketing mix, you can pair powerful data with a personal touch.
If like many companies, you report value as page view volume, visit volume, social likes or tweets, then your boss is most likely to say: "so what?" (and if she or he doesn't, s/he should.) If you are lucky, s/he will grudgingly renew your budget for another season on the simple idea that digital marketing is not going away any time soon. But there is so much more you could be doing with essentially the same data!
Google Tag Manager has been growing extremely quickly. But why? There are many reasons, but the main one is that it's easy. This is both good and bad: good when done well and for the right reasons; bad when done carelessly. This article will describe a couple of key points that will help you get your GTM right...
Google Tag Manager (GTM) for mobile apps can be an incredibly powerful tool. Simply put, getting started with GTM for mobile apps today sets businesses up for success in the future, I recommend trying it out as soon as possible. Here is how...
A new generation of digital analysis tools is arriving. A generation where speed is king and customer data is united. If you’ve been buried with reports and analysis from the typical tools then take a break and check out these six modern analytics tools.
Let's have a closer look at the next Conversion Rate Optimization Maturity Model's pillar: Activities. We've already described People and Knowledge, which are the main inputs for this pillar. The typical outputs of the activities are insights which you're able to apply to your site and improve the conversion.
Conversion Rate Optimization (CRO) is the process of continually improving a website or landing page to create the most effective experience for potential customers. For businesses that want to stay ahead, it's now an essential strategy in the highly competitive online marketing space. Here's a process you can follow to conduct a CRO audit.
Google Tag Manager was released about a year ago, and recent updates have made it a much more valuable addition to a digital marketer's toolkit, and here's why.
At best, trivial discoveries in the data flow are time-wasters. At worst, they're distractions from the genuine insights that will strengthen your business. Acting on them can do serious harm. It would be like setting off on a journey with a faulty GPS: the information it provides looks valid, but after you've committed to your direction, you suddenly realize you are completely lost. | 3,554 | 1,792 | 0.000561 |
warc | 201704 | Daily
Reflection
From a Creighton Student's Perspective
December 16, 2010 by Eric Lomas 1st Year Dental Student
These last few lines from the first reading encompass not only the theme for today’s Scripture; they also serve as a simple and beautiful reminder of the truth that we are never alone. Even the visual reminders of the world’s strength, majesty, and longevity cannot compare to the indescribable love that God has for us. We can think of that love in comparison to something like the grandeur of the mountains, and I often do, but the reality is that such comparisons fall immeasurably short…
So, why then is it so easy to feel alone or abandoned? Why does so much needless suffering and heartache occur in a world that God loves? Why do children die? Why are people oppressed? Those questions cannot be answered in a scientific or deductive manner, and it would really be a pity if they could. Faith would have no role in our lives if we could simply reason through the muddle and confusion that life often brings, finding the answers with our logic. Like Saint Ignatius at Montserrat, we must learn to lay down our swords, our questions at some point and set off deeper into our personal faith journeys. That is where we can start learning to find Christ at work in this world and allow Him to work through us.
When we acknowledge our own powerlessness, our own inadequacies, we stand to gain something remarkable, and that is a sense of wonder at God’s love, an appreciation for grace. This world is not perfect, we cannot explain why, but we can work to improve it. We can do our best to make a difference everyday in whatever ways we can. To do that, though, to truly live in such a way, requires a level of faith that we must be actively pursuing: faith in action, faith driving us to action. If we give up our control of life’s handlebars and allow God to help us work on simply being, amazing things can happen. We become aware of Christ, and we yearn to be Christ for others. Every day is a chance to renew that surrender.
In rescuing us, God grants us power beyond even the mountains and the hills, He grants us the power of love.
Collaborative Ministry Office Guestbook | 2,226 | 1,193 | 0.000852 |
warc | 201704 | Ironically, while the economy is in the tank, statistics reveal that the percentage of college freshmen who plan to major in business is at its lowest level since the mid-1970s. According to the Higher Education Research Institute (HERI) at the University of California at Los Angeles, the number of freshmen who plan to major in business fell from 16.8 percent in 2008 to 14.4 percent in 2009, the lowest percentage since 1974, when 14 percent of college freshmen focused on business majors. Why are students dropping business majors?
College choice in general, according to the HERI survey, continues to be influenced by the economy. Last year saw all-time highs in the importance of cost and financial aid, and those trends continue this year, breaking all such records. According to the survey:
41.6 percent:The cost of attending a particular college was a very important factor in determining where to attend. This is the highest percentage for this question since it was added to the survey. 44.7 percent:An offer of financial aid was a very important determining factor for these students, up from 43 percent in 2008 and 39.4 percent in 2007. 8.9 percent:Not being offered aid by the first choice of college was a “very important” reason for choosing a current college, the highest this figure has been since the question was first asked in 1984. 56.5 percent:The number of incoming freshmen who chose a college based upon the possibility of getting a good job upon graduation increased in importance. This is the highest level seen since this question was first asked in 1983.
Additionally, the rising amount of debt burden for college students and their parents and the diminishing job outlook for recent graduates are pushing students to look at degrees other than business. Accordingly, colleges that offer business degrees may look to the ability to offer more financial incentives for enrollment. These same business colleges and degree programs may begin to look at retention rates and degree attainments, based upon the numbers of incoming freshmen who may change their majors based upon these figures, and offer financial rewards and incentives to retain numbers.
The economic downturn has created an impact on characteristics, attitudes and beliefs of incoming first-time students at four-year institutions as well. These factors include:
Concern more about finances:Incoming first-year freshmen this year likely will graduate with higher debts, producing the desire to find a high-paying major such as engineering. Ability to obtain loans and grants:This concern may lead more freshmen to think about high-paying careers that do not require college degrees, such as a court reporter, network administrator, police force, and clinical lab technicians. Raising a family is an important goal:Although being well-off financially is the most important goal (78.1 percent compared to 73.6 percent in 2004), raising a family comes next in desires for incoming freshmen (74.7 percent compared to 75.1 percent in 2004). After the current volatile atmosphere surrounding business news (ie: Bernie Madoff, bank issues, etc.), incoming freshmen may see business as a sour investment in future goals. Family resources are important:The largest percentages of incoming freshmen are from families that bring in $60,000 to $149,000 annually. The breakdown is 10.8 percent ($60,000 to $74,999); 14 percent ($75,000 to $99,999); 17.6 percent — the highest percentage on the list ($100,000 to $149,999). These statistics show that teens from wealthier families still retain the highest ability to attend college. Teens from lower-income families may choose a vocational major rather than a business major, as the former degrees may be less expensive to obtain.
Despite the figures shown above, the percentages show that 14.4 percent of incoming freshmen still look to obtaining a professional degree, and the same percentage still desire a business degree:
Arts and Humanities: 13.3 percent Social Sciences: 11.7 percent Biological Sciences: 9.7 percent Engineering: 9.7 percent Education: 8.1 percent Physical Sciences: 3.4 percent Technical Fields: 1.1 percent Other Fields: 7.5 percent Undecided: 6.8 percent
Possibilities exist for business colleges and colleges that carry business courses to look at those percentages and determine how they might lure students into more business majors. But, that development might also depend upon seeking students from other sources, such as the military and ethnic minorities. Also, colleges may look at the ability of a student to carry a business course load.
There is a renewed influx of veterans into colleges, and the survey introduced a new item on veteran status. of the 297 schools surveyed in the report, 202 has at least one first-year student who was a military veteran and a total of 595 first-year students who reported veteran status. But, there is a factor involved in choosing veterans, as the survey reported that the veterans who participated received significantly lower grades in high school than non-veteran students entering the same colleges. According to the report:
For example, while 11.5 percent of veterans reported receiving A or A+ grades in high school, non-veteran students were more than twice as likely (23.1 percent) to report such grades. While only 4.6 percent of non-veterans reported a C+ average or lower, 19.8 percent of veterans did so. Veterans were also more likely than non-veterans to report a need for special tutoring or remedial work in mathematics (35.8 percent vs. 24.3 percent) and writing (20.7 percent vs. 11.6 percent).
In particular, veterans were more likely to rate themselves higher in leadership ability than other freshmen entering the same colleges. This concept of leadership abilities may prove the key in luring veterans into business degrees. But, some students may not feel that leadership potential nor have the ability to train for college courses.
The lure to attend a business college may also depend AP classes and exams as well as grades. While the percentage of students taking at least one AP exam has increased by nearly ten percentage points over the last five years (from 50.9 percent to 60.3 percent), the differences between racial and ethnic groups in AP experiences continues to exist. Opportunities in high school often determine whether or not students can gain access to AP courses.
Only 5.4 percent of entering students at four-year institutions reported attending a high school where no AP courses were offered, and those percentages ranked as follows:
American Indian students (9.1 percent) African American students (6.8 percent) Asian American students (5.8 percent) White students (5.3 percent) Hispanic students (3.6 percent)
Among those who reported having taken between one and four AP classes in high school, Hispanic students, at 54.3 percent, compared very favorably with other groups, including:
White students (49.9 percent) Multiracial students (50.0 percent) African American students (45.3 percent) American Indian students (a low of 39.1 percent)
Asian American students, however, were more than twice as likely to take between five and nine AP courses (33.8 percent) as white students (15.4 percent). The pattern was similar for students taking AP exams.
Finally, considering just the 2009 data, gaps remain between the percentage of those who receive remedial work in high school and those who need remedial work in college. There has been an increase in the percentage of students who feel they will need special tutoring or remedial work. In fact, remedial work in high school by these students is at the highest levels ever reported in the survey (with the exception social studies, which reached a high in 1980): English (7.2 percent), reading (6.5 percent), mathematics (14.5 percent), social studies (4.5 percent), science (6.1 percent), foreign language (5.9 percent) and writing (5.8 percent).
These gaps alone present an issue for anyone who wants a career, no matter if it is in business, engineering, technology or working in a fast food restaurant.
The 2009 freshman norms in the HERI survey are based on the responses of 219,864 first-time, full-time, first-year students at 297 of the nation’s baccalaureate colleges and universities. The data have been statistically adjusted to reflect the responses of the 1.4 million first-time, full-time students entering four-year colleges and universities as first-year students in 2009. | 8,531 | 3,501 | 0.000287 |
warc | 201704 | Population Dynamics - Countries
December 07, 2014
Nearly 99% percent of population increase takes place in poor countries. By 2050 industrialized countries will increase their population by 4% while developing countries expand by 55%. Western European populations will shrink, while Western Asian nations will gain 186 million people by 2050. World population will reach 9.3 billion by mid-century. Vast investments are needed to provide a higher quality of life for Nigeria's growing population, while Japan must find ways to take care of retired people and still maintain an adequate workforce. The UN has produced estimates of AIDs prevalence that are reworked every two years. UNAIDS estimates that, globally, 1.1% of adults ages 15 to 49 were living with AIDs at the end of 2003, up from 1.0% 2 years before. In sub-Saharan Africa, prevalence declined from 7.6% to 7.5% over the 2001-2003 period. 14 African countries are estimated to have a decline in their AIDs prevalence, led by Kenya and Uganda while 24 African countries have shown no decrease or a rise. 2.9 million adults and children died of AIDS in 2003, and the number of children orphaned by the disease rose from 11.5 million in 2001 to 15.0 million in 2003.
Shrinking Cropland in Countries with Weak Family Planning ProgramsMarch 1999, World Watch Institute
Among the larger countries where shrinking cropland per person threatens future food security are Nigeria, Ethiopia, and Pakistan, all countries with weak family planning programs. For example, as Nigeria's population goes from 111 million today to a projected 244 million in 2050, its grainland per person will shrink from 0.15 hectares to 0.07 hectares. Pakistan's projected growth from 146 million today to 345 million by 2050 will shrink its grainland per person from 0.08 hectares at present to 0.03 hectares, an area scarcely the size of a tennis court. Countries where grainland per person has shrunk to 0.03 hectares, such as Japan, South Korea, and Taiwan, each import some 70% of their grain. More than three-quarters of a billion people suffer from malnutrition. Between 1945 and 1990 food production and other human activities degraded nearly three billion acres of vegetated land, an area equal to China and India combined. Two thirds of the most degraded land is in Africa and Asia.
An excellent detailed series of statistics on population growth and the projected changes in the near future. Globally, the annual population growth rate is 1.22%, expected to reduce to 0.33% by 2050. In rich areas of the world, the annual rate is 0.25%, while in poor areas it is 1.46% - six times faster.In the 49 countries where the world's poorest 670 million people lived in 2000, population increases 2.41% a year.By 2050, Japan is expected to be 14% smaller, Italy 22% smaller, and the Russian Federation 29% smaller. By contrast, the population of today's poor countries is projected to rise to 7.7 billion in 2050 from 4.9 billion in 2000. Fertility in the less developed regions is expected to fall to replacement level in 2030-2035. The average global population density of 45 people/km2 in 2000 is projected to rise to 66 people/km2 by 2050. Globally, perhaps 10% of land is arable, so population densities per unit of arable land are roughly 10 times higher. In the rich countries, the population density was 23 people/km2 in 2000 and is not expected to change by 2050. In the poor countries, the population density was 59 people/km 2in 2000 and was projected to rise to 93 people/km2 by 2050, posing unprecedented problems of land use and preservation. From 2000 to 2050, the ratio of population density for poor countries compared to rich countries will rise from 2.6 to 4.0. The population density of Europe is projected to drop from 32 to 27 people/km2 while that of Africa is projected to rise from 26 to 60 people/km2. The average infant born in a poor country had a chance of dying before age 1 that was 8.1 times higher than that in a rich country in 2000-05. At current birth rates, during her lifetime, the average woman in the poor countries bears nearly twice as many children (2.9) as in the rich countries (1.6).
India World's Largest Nation by 2030, UN SaysFebruary 25, 2005, Agence France Presse
The UN's latest global population report predicted that India would reach 1.593 billion by 2050, while China will reach 1.392 billion. India will surpass China by 2030. India's fertility rate is over three children per woman while China's is about 1.7. The report also forecast that world population will hit 9.1 billion by 2050, with India and Pakistan seeing the biggest increases. But almost all of the growth will come in developing nations, and the overall increase is "inevitable" even though fertility rates in the developed world continue to plummet. In 15 nations mostly in Europe the birth rate has fallen below 1.3 children per woman. The U.S. increase is due to the continuing arrival of immigrants, who tend to have more children. Population is expected to triple in Afghanistan, Burkina Faso, Burundi, Chad, Congo, the DRC, East Timor, Guinea Bissau, Liberia, Mali, Niger and Uganda. The projections assume a decline in fertility from 2.6 children per woman to slightly more than 2 by 2050. The trend toward lower birth rates combined with longer life expectancy means that the world population will be getting older. Those more than 80 years old are believed to number around 86 million now and will soar to 394 million by mid-century.
The world's population is expected to rise from 6.5 billion to 9.1 billion by 2050 with the growth in the developing world. The population of developed countries will remain at 1.2 billion. India will be the world's most populous country by 2030. The population in the world's 50 poorest countries will more than double by 2050. Afghanistan, Chad and East Timor will see their numbers going up three-fold. They are unable to provide shelter and food for all their people, but if fertility dropped, they would buy time to face the problems. Africa has seen life expectancy at birth decline from 62 in 1995 to 48 years in 2000-2005 due to the spread of HIV and other infectious diseases, as well as armed conflicts and economic stagnation. The overall trend shows a lower rate of growth in the past 20 to 50 years. The population continues to grow but at a lower pace. By July 2005, the world will have 6.5 billion inhabitants, 380 million more than in 2000 or a gain of 76 million annually. Eight countries will account for half the population increase: India, Pakistan, Nigeria, the Democratic Republic of Congo, Bangladesh, Uganda, the United States of America, Ethiopia and China, listed according to the size of their contribution to population growth.
Winners and Losers in World of Huge Population Change 9 Billion PeopleFebruary 26, 2005, The Scotsman
The world's population is expected to rise from the current 6.5 billion to 9.1 billion by 2050. India's population will overtake China before 2030, while Britain will be bigger than France by 2025 but Scotland faces a decline. China has been exercising a birth control policy, although there are considering relaxing it because of the ageing population. India's higher fertility will overtake China as the world's most populated country. Britain's population will overtake France by having higher immigration. The population of the developed world will remain stable while Scotland faces population decline, with 5.05 million falling to 4.84 million by 2009. The rise of global population is a serious concern but has slowed in recent years. There will be 1,395 million people in India by 2025, and 1,593 million by 2050. China's population will grow to 1,441 million by 2025, before slipping back to 1,392 million in 2050. The UK's population will overtake France by 2025, rising from almost 60 million to more than 67 million by 2050 while France's population will have risen from 60.5 million to 63.1 million. France and Britain have similar birth and death rates, but the UN assumes that Britain will have a higher rate of immigration. The big concern is Africa. The UN's revision said the population in less-developed countries was expected to swell from 5.3 billion today to 7.8 billion in 2050. By contrast, the population of richer, developed countries will remain unchanged, at 1.2 billion. In 1950, the world's population stood at 2.5 billion, which rose to just over 4 billion by 1975. In 1999 it was just over 6 billion and by the start of 2004 had reached 6.3 billion. The expected growth has serious implications because it will be concentrated in countries that have problems providing adequate health and shelter. India, Pakistan, Nigeria, Congo, Bangladesh, Uganda, the United States, Ethiopia and China are likely to contribute half of the world's population increase. The population is projected to at triple in Afghanistan, Burkina Faso, Burundi, Chad, Congo, the Republic of Congo, East Timor, Guinea-Bissau, Liberia, Mali, Niger and Uganda. In southern Africa, with the highest AIDS prevalence, life expectancy has fallen from 62 years in 1995 to 48 years and is projected to decrease to 43 over the next decade. China's changing population was due to uprooting people from rural lifestyles into an urban economy. China has an ageing population but the picture is much rosier for India which has a younger populationto power its economy and fertility rates are slowing down. Europe's population is on a downward trend and will drop from 728 million to 653 million in 2050. That figure includes population falls in Italy and Germany. By 2050, there will be 101 million Turks up from 73 million.
From the Executive Summary: Since the 1970s the world has experienced profound changes in fertility, union formation and contraceptive demand. Fertility has declined throughout the world, early childbearing and marriage are less common and the percentage of women and men using contraception, especially modern methods, has risen.
The World Fertility Report 2009 presents a compilation of key indicators of fertility, nuptiality, contraceptive use and relevant population policies for 196 countries over the past 40 years.
1. Fertility declined worldwide to unprecedented levels between the 1970s and the first decade of the twenty-first century. Total fertility fell in all but three of the 185 countries or areas for which data are available. In the most recent period covered, 75 countries or areas had a total fertility below 2.1 children per woman, the level required to ensure the replacement of generations in low mortality populations.
2. The median level of total fertility among developing countries fell by more than half, from 5.7 children per woman in the 1970s to 2.5 children per woman in the most recent period. More than a third of all developing countries experienced fertility declines of at least 1.0 child per woman per decade during that period. Yet total fertility is below replacement level (2.1 children per woman) in 32 of 102 developing countries or areas with data available and remains above 4.0 children per woman in 10 countries or areas.
3. Fertility levels among the least developed countries remain high and have undergone only moderate decline since 1970s. Among the 39 least developed countries with data, the median total fertility declined from 6.5 children per woman in the 1970s to 5.4 children per woman in the first decade of the twenty-first century. In 2000-2007, more than two- thirds of the least developed countries still had total fertility higher than 5.0 children per woman.
4. By the first decade of the twenty-first century, none of the developed countries had total fertility above 2.1 children per woman. Total fertility was below 1.4 children per woman in about half of developed countries.
(not all points are covered. Go to the link in the headline for the complete report)
7. Increasing numbers of Governments have become dissatisfied with the fertility levels of their populations. In 1976, 53% of Governments at the world level viewed their fertility levels as being satisfactory, and by 2009 only 38% held this view. Among developed countries, an increasing proportion of Governments viewed their fertility levels as being too low: 21% in 1976 compared to 61% in 2009.
8. Age at marriage has been rising around the world.
10. Marriage is becoming less relevant for childbearing. In 62 countries with data on extramarital births the median percentage of all births that occurred out of formal (legal) marriage rose substantially, from 7.1% in the 1970s to 33.8%in the first decade of the twenty-first century.
11.The use of contraception among women aged 15 to 49 who are married or in a union increased in 90% of the 68 countries or areas with data. Among developing countries, contraceptive use increased sharply, where the median of the distribution rose from 44.6% in 1970-1979 to 64.1% in 2000-2009.
12. Despite increases in contraceptive use over time, levels of unmet need for family planning in 2000-2009 were moderate to high in developing and least developed countries. Among the 37 developing countries with data for 2000-2009, half had levels of unmet need for family planning between 7.5% and 20.2%.
Population Reference Bureau senior demographer Carl Haub has summarized data on reproductive health and maternal and child health from recently released Demographic and Health Surveys (DHS) for a number of developing countries.
Large declines in womens total fertility rate (TFR) have been seen in Ethiopia and Rwanda. Rwanda's progress is the sharpest TFR decline in sub-Saharan Africa that Haub has seen. infant and child mortality are also declining dramatically in both countries, however, Ethiopia is challenged in getting health care delivery to its large rural population.
Slower fertility declines are seen in Burkina Faso, Malawi, and Senegal, but these countries are showing considerable progress in maternal and child health.
Zimbabwe has seen an increase in fertility, a rise in childhood mortality and its progress on health seems to have stagnated in recent years.
Nepal's TFR has been steadily declining and the country is on track to reaching replacement level of 2.1 children per woman. Nepal's progress in childhood mortality is lagging.
India has experienced lack of success in slowing down the birth rate. The Union Health and Family Welfare Ministry in Delhi proposed new incentives for lowering birth rates. Progress in childhood mortality is also lagging.
Vietnam's "one-to-two" children policy has resulted in a below replacement level TFR, even in rural areas.
Population Pyramids 'Population Bomb' Forecast Proves WrongAugust 30, 2004, New York Times*
Predictions that the globe's population would soar to catastrophic levels are proving inaccurate, the New York Times reported. Paul Ehrlich created a scare with his book "The Population Bomb," warning of the consequences of too many people. But ever since the U.N. Population Division has regularly revised its estimates downward and now expects population to level off at 9 billion. This is attributed to declining birth rates and improved public health measures. Nearly half the world's people live in cities, and when in a city, children are not as helpful as on the farm. Barring disaster, a country needs a birthrate of 2.1 children per woman to hold steady. In 1970, the world's fertility level was 5.4, but in 2000, it was 2.9.
Philippines: More Economic Activity Needed to Temper Population RiseApril 06, 2006, Business World
The economy needs to grow 7%-9% annually, equitably distributed among all classes to slow down the Philippines' population growth. The more low-income groups, the more people will be added to the Philippine population.
A 5%-6% growth will benefit only the upper classes. It needs to grow 7%-9% and be felt by all levels, including the low-income groups.
The Philippine population is growing at 2.36% annually, one of the highest in Asia, and is estimated at 87 million.
With the Catholic Church opposed to family planning methods, President Arroyo is endorsing the use of natural family planning and ordered the release of P30 million for this program.
The economy expanded by 6% in 2004 and 5.1% last year. But growth was not equitably felt. The Philippine economy needs to grow 7%-8% annually to cut poverty.
The government will work with local government units and financial institutions in stimulating growth in the countryside. The Philippines needs to attract investments, but economic provisions in the Constitution need to be changed. The ideal population growth for the Philippines is 1.8%-1.9%.
High population growth is straining resources. For example, there are more students than the educational system can handle.
Yet the Philippine population, is "more stable" compared to those of countries such as Japan where people over 60 years old are expected to outnumber those younger by 2015.
Filipino mothers tend to have one more child than they want and there is a demand for family planning services.
The age-specific fertility pattern has a shape common in all human populations. Recently however, the fertility pattern in developed countries exhibits a deviation from the classical one. Data sets of United Kingdom, Ireland and US show a bulge in fertility rates of younger women. In countries with distorted fertility, the pattern of first births exhibits a hump in younger ages, stronger than that of the total pattern. This heterogeneity indicated by the recent fertility distributions of European countries and the US might be related to marital status, religion, educational level and differences in social and economic conditions. In the US this might be related to ethnic difference. In this paper, a new flexible model for describing both the old and the new patterns of fertility is proposed. Follow the link above for more detail.
Demography is the study of human populations: Populations grow or decline through the interplay of three demographic processes: birth, death, and migration. The newest edition of
Migration is the third demographic variable with key variables such as age structure that determine population size and change. The relationship between slow population growth and aging, between immigration and ethnic composition, are added to the basic theories of population growth and change.
Mara Hvistendahl is the author of Unnatural Selection: Choosing Boys over Girls, and the Consequences of a World Full of Men. She puts the number of missing girls in Asia at 163 million, more than the entire female population in the U.S. The imbalance was made possible by gender-selection abortion practices not only in China, but in India and other developing countries -- and in ethnic Asian communities in the U.S.
As a result, tens of millions of men in Asia, 'surplus males,' who, without female counterparts, may purchase women from poorer countries.
Sex selection has taken hold thanks to technology, lower birth rates, and deep-seated cultural biases that require a boy to carry on a family's lineage.
Abortion is accessible and widely used in most cultures, easier to obtain than in the U.S. There are nearly three abortions for every birth in some countries. "The availability of relatively inexpensive screening with unconditional abortion is a game changer," says Nicholas Eberstadt, a demographer at American Enterprise Institute.
Falling birth rates in developing countries, which improve the health and education of mothers and children, have the unintended consequence of encouraging sex-selection abortion. When a woman gave birth to six children, the odds were 99% that one would be a boy. With two children, it's only a 24% chance. "It's not that women want more boys, they have less chance of getting them," says Hvistendahl. Eberstadt says that women will take whatever sex with the first child, but after that, it's "very apparent there?s a massive parental intervention going on."
Sex selection happens more frequently with the urban, educated middle-class, says Hvistendahl, adding that it seems paradoxical that educated women are more likely to abort a fetus. Women in China are doing better than ever before, with more women in Ph.D. programs than men. "Yet this is happening at the same time,? she says. "If you don?t have a boy, you lose status."
Is there a relation between religion, sex and the number of babies per woman? In this TED talk from Doha, Qatar, Hans Rosling discusses this delicate topic and explains the main reason why the world population will increase with another 3 billion people.
It's not religion; it's not income. What is it?
. http to see and explore the interactive map shown in the video.
Population Decline/Graying Historical TFR's by RegionAugust 2003, Patrick Burns
Are we making progress in reducing fertility rates? The short answer is "yes," as the numbers below make clear. Unfortunately, even after a region has reached replacement level fertility, population growth typically continues for 40 years or so due to demographic momentum. The good news is that fertility rates in some parts of the world have not stopped at replacement levels, and have dived below replacement -- Canada, Japan, and most of the countries of Europe and the former Soviet Union are good examples. The table below details the past 50 years of fertility decline, by region of the world, and gives the U.N. median variant for the next 50 years. No one knows whether the U.N. median variant will, in fact track, with what actually happens, but in recent years the U.N. medium variant for the world has been high, not low. As the table below suggests, the big outlier in terms of fertility decline is Africa. On the slightly hopeful side, 4 of the top 10 countries with the fastest fertility declines from 1990-2000 were in Africa (Kenya, Zimbabwe, Ghana, Malawi) and two of the countries that are expected to have the fastest fertility declines from 2000 to 2010 are in Africa (Malawi and Mozambique) while 4 others are in the Middle East (Syria, Gaza Strip, Iran, Yemen). UN Medium Variant from U.N. World Population Prospects: 2002 Revision Database
Bioregionalism World Carryover Grain Stocks Fall to 72 Days of Consumption - Uncomfortably Close to Level Prior to 2007-08 Food Price SpikeAugust 12, 2010, Earth Policy Institute
Estimates for this year's global grain carryover stocks have fallen to 444 million tons, according to the USDA's August 12th World Agricultural Supply and Demand Estimates report. This amount of grain remaining in the world's silos and stockpiles when the next harvest begins is enough to meet 72 days of consumption.
"This drop in world carryover stocks of grain to 72 days of consumption is moving us uncomfortably close to the 64 days of carryover stocks in 2007 that fueled the 2007-08 spike in world food prices," according to Lester R. Brown, of Earth Policy Institute.
A searing record heat wave, severe drought, and relentless wildfires in Russia and Central Europe have decimated the region's harvests. Russia's wheat production is now estimated at 45 million tons, a 27% drop from last year. In Kazakhstan, the wheat harvest is down 32% to 12 million tons, and in Ukraine it is 17 million tons, 19% smaller than in 2009. On August 5, Russia announced that it was banning grain exports at least through the end of the year and requested that neighboring countries do the same. Since these three countries typically supply a fourth of world wheat exports, wheat prices have risen along with the region's temperature.
Russia runs the risk of drought spillover into the next year if there is not enough soil moisture to plant the new winter wheat crop. With soils parched, planting time only days away, and not much rain in prospect, this is a growing concern in Moscow, and indeed in the world.
Rising temperatures and food security do not mix, notes Brown. "The situation in Russia gives us a preview of what could be in store if we continue to overheat our planet. This should be a wake-up call for the world: to protect our food security we need to dramatically cut carbon dioxide emissions. We cannot continue to burn coal and oil with abandon and expect to have bumper harvests that can keep up with the record demand generated by population growth and the increasing use of grain to feed livestock and to fuel cars."
U.S.: America's Rivers at RiskOctober 23, 2005, Hartford Courant
In October 2001, the Rio Grande petered out before it reached the sea. A river that once disgorged fresh water into the Gulf of Mexico was transformed into little more than a brook that disappeared in the dry, flat country on the Texas and Mexico border. From Colorado the Rio Grande is tapped for agriculture and drinking water; so much so that the river's flow is but a fraction of what it once was, and demand for its water continues to grow. There are too many people using too much water. In northern New Mexico, the Rio Grande flows through canyon walls but even here, virtually every drop spoken for. Sit by a bridge and you're likely to see a farmer pull up in a pickup truck, glance to see that no one is watching, fill a tank with water and drive off. There is an over-allocation problem, and it's about to become obvious to everybody. In the arid Southwest, it is impossible to overstate how precious river water has become, and how contested. The Gila, which flows through Phoenix, is sucked dry before it reaches the Colorado River, into which it once flowed. The Colorado is tapped by so many interests that it, too, no longer reaches the sea. But the Rio Grande, the Gila and the Colorado are a glimpse of what the rest of the country is beginning to experience. We're going to butt up against the limits of clean, fresh water. The National Research Council - that advises Congress - concluded in a book-length report that in years ahead the United States will be challenged to provide sufficient quantities of high-quality water to its growing population. In northern California and Oregon, farmers along the Klamath River were outraged when they were denied irrigation water. The river had become so low that a threatened fish species, coho salmon, did not have sufficient water to migrate upstream to spawn. Georgia, Alabama and Florida have argued for years over rights to various river flows. Years of controversy over a diversion in a scenic river in Connecticut, the Shepaug, led to a state Supreme Court decision between Waterbury, which diverts the water, and environmental interests. During a dry spell last month, a half-mile-long stretch of the Fenton River next to a University of Connecticut wellfield dried up, killing thousands of trout. In New York state, anglers complain that New York City, which diverts drinking water from the Delaware River, isn't allowing sufficient flow to keep trout alive. Nine scientists prominent in river ecology research concluded that population growth and climate change would put great stress on water supplies in the next few years, putting human water needs in conflict with the needs of aquatic life and the overall health of river ecosystems. Water is going to be the issue in the 21st century. In the future, water will be what oil is today. On the Rio Grande, Albuquerque plans for the first time to take water for drinking. Until now, it relied upon groundwater, only to discover it was rapidly depleting that resource. The new plan will tap water diverted from the Colorado River into the Rio Grande, through 26 miles of tunnels under the Continental Divide. But critics are worried about the impact downriver and challenged the city's plan, which is now before a court-ordered mediator. The city argues that it is doing nothing more than using water it owns. Albuquerque's water resources manager said the city has reduced water use by 33% over the past 10 years, even as the city added more than 40,000 new water customers. The city began a 10-year conservation program intended to reduce use by 1% each year. The silvery minnow, an endangered species now found only in the Rio Grande, in a 174-mile stretch that includes Albuquerque, is down to 5% of the river miles it once occupied. In a drought, Albuquerque will be required to reduce its withdrawals from the Rio Grande to protect the minnow. Water is so precious that scientists here are trying to determine which tree species along the river guzzle the most water. Since flows were impounded by dams and the river channel stabilized, two non-native shrubs, saltcedar and Russian olive, have taken over vast sections of riverbank. The dams were meant to conserve water, but research suggests that saltcedar takes up large amounts of water. The section of the Rio Grande below the Elephant Butte Reservoir, south of Albuquerque, "operates largely as a ditch for water delivery for agriculture and rapidly growing municipalities." Water is so intensively used and reused that when it returns to the river through groundwater or wastewater discharges, it can aggravate river problems. Water quality has started to deteriorate because water being used so intensely.
Twelve of the 20 fastest growing metropolitan areas are in the West. The fastest is Greeley, Colo. and its surrounding communities, that grew by 16.8% to 211,000 people, between 2000 and 2003. Greeley ranked just ahead of St. George, Utah, and Las Vegas. The area has grown because it's a reasonable commute to Denver and has inexpensive homes. The New York-northern New Jersey-Long Island area has a population of 18.6 million, up 1.7% from three years earlier. The Los Angeles-Long Beach-Santa Ana population hit 12.8 million. Chicago-Naperville-Joliet was 9.33 million. A metropolitan area is a region containing at least one urbanized area of 50,000 or more people. The report focused on growth estimates from 2000 to 2003. Americans have been moving south and west for decades, with a big jump in population in the South, starting in the 1970s. The West continues to outpace other regions. Population in the western United States grew by 19.7% in the 1990s, followed by the South with 17.3% more people. The Midwest and the Northeast posted single-digit increases.
Countries, Demographics News
The fires in Borneo island are started by companies expanding palm tree oil plantations and farmers clearing land to grow food. Smoldering fires in the peat moss on the forest floors burn for months. Visibility was reduced in two of Borneo's provinces and schools and offices remained closed and was 50 metres at the airport for the capital, Palangkaraya City, that has been closed since September 2002, because of smoke. Haze from forest fires, has been a problem for six weeks. It has alo affected Singapore and Malaysia. Indonesia admits its laws are weak and is promising reform.
Ever since the Revolution bicycles have been part of the Chinese landscape. Now urban planners and government have begun treating bicycles as nuisances that impede cars. Shanghai has banned bikes on 54 major roads, and cyclists cannot cross the Huangpu River into the city's new financial and industrial center. Cyclists and environmentalists are unhappy because of ever-worsening vehicle-generated pollution.
Uganda: Family Planning Cause of Fewer Baganda KidsOctober 2002, New Vision (Uganda)
People in Buganda region registered the lowest population growth for 10 years. N. Uganda produced the most babies. Population in the north is growing at 4.6%, the eastern region 3.5% the western region 2.9% and Buganda 2.7%. Buganda's population grew by 1,781,645, an increase of 36%. Mubajje said Government and development agencies should not agitate for fewer children but devise means to enable people to create more income to lead better lives. The Government should address the fears on reproduction as Islamic scriptures support procreation and believers should produce more children.
The traditional diet of Inuits of Greenland includes polar bears, seals, and whales. It is a healthy diet and no toxins are produced by their lifestyle. Unfortunately persistent organic pollutants, lead, cadmium, mercury, and other hazardous chemicals are being carried from industrialised nations by wind and ocean currents to Inuit Greenland region and accumulating in the same animals the Inuit eat - which could result in birth defects, reduced fertility, and genetic damage for the humans. In fact, in some areas toxic levels were high enough to cause concern for in 100% of the population, and above the "level of action" for 30%. The report from the Arctic Monitoring and Assessment Programme (AMAP) concludes Greenlanders should consider changing their eating habits. The Greenlander diet that has kept Greenland's population protected from ailments typically associated with industrialised societies, like heart disease, diabetes and obesity; so until now people were told to avoid abandoning their traditional diet for a Western one. Diabetes, for example, has increased from almost no cases twenty-five years ago to three times the level in Denmark. "To discover that the food which for generations has nourished them and kept them whole physically and spiritually is now poisoning them is profoundly disturbing and threatens Indigenous Peoples' cultural survival," the report says.
Population Growth Rate Declining in PakistanDecember 2002, Xinhua General News Service
Population growth in Pakistan has declined from 3.6% in the 1980s to 2.1% in 2000-01. It is expected to decline to 1.5% in the next two decades. It is expected to reach 220 million by 2025 from the current 142 million. The average family size was 6.5 children in 1980s is 4.5 at present and expected to decline at 2.1 to 2.6 by 2023. UNFPA will continue its support to Pakistan to check population growth.
U.N. Official Says Bangladesh Must Control Rising Population to Reduce PovertyDecember 04, 2002, Associated Press
Bangladesh, one of the world's most densely populated and poorest countries, needs to control its population to reduce poverty. Most of its 130 million people live on less than a dollar day yet the population is increasing by 2.1 percent each year. Despite an increase in the use of contraceptives to an estimated 54%, the average number of children per woman has remained at 3.3 since 1994. The rate has not decreased partly because contraceptives are not consistently used. Social traditions in the Muslim-majority country make it difficult to talk about contraception among young people. Many believe that reproductive services and information will encourage promiscuity, but the reverse is true and information can bring down unwanted pregnancies and sexually transmitted diseases.
Eritrea-Ethiopia: UNICEF Aiming to Get More Girls Into SchoolDecember 2002, UN Integrated Regional Information Networks
Ethiopia and Eritrea are part of 25 countries targeted to have the same numbers of boys and girls in schools. The campaign focuses on countries where girls are furthest behind. In Africa, these include the Central African Republic, Chad, the Democratic Republic of Congo, Djibouti, Guinea, Malawi, Mali, Nigeria, Sudan, Tanzania and Zambia. No girl will be left behind as her country moves forward, and will be educated as an agent in her country�s development. Ethiopia has one of the poorest enrollment rates for girls. Afar in Ethiopia is one of the regions hit by drought. Thousands of cattle have died and malnutrition rates have reached 30%. UNICEF aims to work alongside governments in the 25 countries to target girls not in school and help build a consensus about the need to get the girls into school. UNICEF head Carol Bellamy is also looking at child immunisation rates, children orphaned by AIDS, the education gap for girls, and the drought crisis in the five nations of the Horn or Africa.
World Bank Gives Tanzania US$136 Million GrantDecember 2002, Associated Press
For the first time the World Bank has given Tanzania a grant of US$136 million. Half of the money will be used against AIDS and the balance on reducing poverty. An estimated 2 million of Tanzania's 32 million people are infected with the HIV virus. 35% live below the poverty line. Tanzania owes the World Bank $2.6 billion in loans and the country's total debt is $6.56 billion. Last year the International Monetary Fund approved debt relief of $3.3 billion spread over 20 years. | 36,501 | 15,028 | 0.000067 |
warc | 201704 | Overview A lot of companies today claim to care about customers. However, few of these companies invest in the local community. Bob Reina is a great example of someone who is actually making a major positive impact in the lives of others. Although he is successful in business, he is concentrated on delivering value…
Securus helps us quite a lot with advocacy as they create phone calls to jails we need. We are attempting to check in with those who are most in need of assistance, and we need to speak to them as if we are in the jail. Securus has created a video calling system anyone may…
The financial world has many areas of concentration. For many business professionals who have an interest in working in the financial industry, the options are plentiful regarding professional opportunities. One of the most important things that people who have an interest in the financial industry must consider is their passion. What do they love doing?…
In June 22, 2016, Davos Real Estate Group went on record saying that it was going to launch a new mobile application called the “Davos CAP Calculator”. The calculator estimates the possible returns on investments in real estate that a client may be willing to explore. Davos Real Estate Group is among the…
There are a multitude of people that a have taken on the job of project manager. In Australia Christanna Bevin is a project manager with a very impressive resume. She has been very helpful to people in Queensland. She has shown so many people that her ability to take on the role of a project…
The Wessex Institute of Technology (or WIT) is an educational and research center in central south England. The center is responsible for some of the most advanced scientific innovations we have today that facilitate the sharing of information within the science community. WIT is just 100km from Land, within the Ashurst Lodge of the New…
To live a full life does not mean living for one’s self; instead, it means dedicating one’s life for the sake of others, and this is what Jason Hope is doing for the people of Arizona. He is very passionate about life, and he measures his success by what he has been able to do…
Kenneth Goodgame is the Senior Vice President and Chief Merchandising Officer at True Value Hardware Corporation at Chicago, Illinois. He graduated with a Bachelor of Science degree in Marketing from the University of Tennessee. Kenneth Goodgame is a skillful and an influential Operations Management leader. He has extensive experience, which gives him an upper hand…
Harvard University has a long-lasting legacy of being an esteemed breeding ground for brilliant businessmen and businesswomen. Just take one look at the educational portion of the resumes belonging to Facebook founder Mark Zuckerberg, Microsoft creator Bill Gates as well as Viacom and CBS Corporation majority owner Sumner Redstone. Also in the ranks of this…
Headquartered in Fort Lee, New Jersey, InnovaCare Health Solutions (LLC) is a leading provider of quality healthcare management. Focusing on creating a cohesive relationship with its patients, InnovaCare provides high-quality Medicaid and Medicare Advantage plans. Besides, InnovaCare is famous for providing innovative network models. In Puerto Rico, InnovaCare specializes in MMM Healthcare and PMC Medicare… | 3,392 | 1,745 | 0.000587 |
warc | 201704 | Well the long awaited study done by Dr. Sam Parnia and his colleagues has finally been published. Skeptics are already over all of course. One of the skeptic websites, neurologica blog, runned by Dr. Steven Novella claims that no evidence for an afterlife was found in the study. He is wrong as one case of a man was verified by using a physical marker (audio stimuli, he was able to hear the beeps, the beeping machine made three beeps in three minute intervals. This patient's near death experience happened exactly when the patient was unconsciousness, with no brain activity and no heart beat. This case shows clearly that near death experiences are not hallucinations. Most of the patients were interviewed more than once.
The study concludes numerous points: • The themes relating to the experience of death appear far broader than what has been understood so far, or what has been described as so called near-death experiences. • In some cases of cardiac arrest, memories of visual awareness compatible with so called out-of-body experiences may correspond with actual events. • A higher proportion of people may have vivid death experiences, but do not recall them due to the effects of brain injury or sedative drugs on memory circuits. • Widely used yet scientifically imprecise terms such as near-death and out-of-body experiences may not be sufficient to describe the actual experience of death. Future studies should focus on cardiac arrest, which is biologically synonymous with death, rather than ill-defined medical states sometimes referred to as ‘near-death’. • The recalled experience surrounding death merits a genuine investigation without prejudice. You can find the full details of the study in the journal of resuscitation http://www.resuscitationjournal.com/article/S0300-9572%2814%2900739-4/fulltext
Magic time
6 hours ago | 1,888 | 1,003 | 0.001019 |
warc | 201704 | personal injury lawyer spokane Precisely what is a Personal Injury Attorney and What are His Responsibilities?
The services of personal injury attorneys are sought whenever a particular person statements to have been bodily or psychologically injured due to the negligence or incorrect steps of a third-party. The third-party could be another individual, a government, a company, company, business, school or every other entity. Personal injury attorneys specialise in a location in the legislation, known as Tort legislation. Tort law contains non-economic and economic injuries to some person's ideal, name and or assets. In addition, it contains civil steps. These attorneys are educated and properly trained in general regulation, as well as in all places in the regulation, nevertheless they typically take care of situations that happen to be relevant to personal accidents or Tort law. They frequently handle injuries that outcome from a car or other automobile accidents, work connected accidents, healthcare glitches, and faulty and malfunctioning products, falls and plenty of other people that aren't shown below.
Personal injury attorneys must be permitted to apply from the states by which they get the job done. As a way to achieve this, they have got to correctly complete selected bar examinations (diverse states should have diverse examinations). Within an ironic twist, personal injury attorneys will also be frequently known as trial lawyers, while their conditions hardly ever reach trial. These legal professionals like to succeed in to the settlement out of court. It is also odd, as other kinds of attorneys head to trial. In case you are pondering opening a personal injury case in opposition to a third-party, in addition, you need to take into consideration using the services of the services of an attorney. This must be done to make certain that don't just are your rights currently being shielded as an applicant, but in addition the situation is dominated as part of your favor via the courts or that you simply achieve a positive out-of-court settlement while using the party that you simply desire to sue.
All attorneys and attorneys, like personal injury attorneys, undertake an moral and professional code of perform every time they qualify, and which they need to adhere to at some point of their careers while in the legislation career. These codes are designed and regulated by point out bars. The services you can be expecting from an attorney contain; filing legal complaints on your own behalf, symbolizing in courtroom throughout proceedings, give authorized tips on the consumers and future clientele, and draft lawful files.
What methods do personal injury attorneys just take ahead of they accept customer circumstances?
To begin with, the personal injury attorney has to satisfy with future purchasers inside of a consultation prior to they are able to represent them. Following, the attorney will appraise the individual conditions before they decide no matter if, you can find any legal foundation for them. In the event the client does have authorized floor to face on, the attorney will start off doing investigation so as to build a solid case with which he/she will fight for that shopper, in opposition to the third-party beforehand explained.
The ultimate purpose of the great attorney would be to win justice along with winning the right payment for his or her shoppers. The attorney may have being ready to use each feasible skill and piece of know-how they have so as to get just about every client's situation. Even so, the attorney will even check out to prevent having the case for the court being listened to by a Decide; so he/she will consider to achieve a settlement with the third-party in the favor of their shopper. The codes of carry out that are talked about earlier mentioned condition that the personal injury attorney, without a doubt all legal professionals and attorneys, must be faithful to their shoppers, as well as respect the attorney / client confidentiality, and regard the best pursuits of every customer.
these details -
personal injury lawyer spokane | 4,144 | 1,880 | 0.000533 |
warc | 201704 | Crude oil characterization
Crude oil characterization has long been an area of concern in refining; however, the need to identify the chemical nature of crude has gained importance in upstream operations. Traditionally, this has been done by simply stating the crude oil gravity, but more information is required to understand the oil well enough to estimate the volume in the reservoir and its recoverability.
Contents 1 Regional trends in crude oil composition 2 API gravity 3 Characterization factor 4 Use of characterization factor 5 Relationship between crude oil gravity and characterization parameter 6 Nomenclature 7 References 8 Noteworthy papers in OnePetro 9 External links 10 See also Regional trends in crude oil composition
During the last 60 years, several correlations have been proposed for determining pressure-volume-temperature (PVT) properties. The most widely used correlations treat the oil and gas phases as a two-component system. Only the pressure, temperature, specific gravity, and relative amount of each component are used to characterize the oil’s PVT properties. Crude oil systems from various oil-producing regions of the world were used in the development of the correlations. These crude oils can exhibit regional trends in chemical composition, placing them into one of the following groups:
Paraffinic Napthenic Aromatic
Because of the differences in composition, correlations developed from regional samples, predominantly of one chemical base, may not provide satisfactory results when applied to crude oils from other regions.
Classification of hydrocarbons based on structure
Hydrocarbons are classified according to the structure of the molecule.
[1] Paraffin hydrocarbons are characterized by open or straight chains joined by single bonds. Examples are: Methane Ethane Propane Decane
Isomers of these compounds, which contain branched chains, are also included as paraffins. The first four members of the series are gaseous at room temperature and pressure. Compounds ranging from pentane (C
5H 12) through heptadecane (C 17H 36) are liquids, while the heavier members are colorless, wax-like solids. Unsaturated hydrocarbons, which consist of olefins, diolefins, and acetylenes, have double and triple bonds in the molecule. These compounds are highly reactive and are not normally present to any great extent in crude oil. Naphthene hydrocarbons are ringed molecules and are also called cycloparaffins. These compounds, like the paraffins, are saturated and very stable. They make up a second primary constituent of crude oil. Aromatic hydrocarbons are also cyclic but are derivatives of benzene. The rings are characterized by alternating double bonds and, in contrast to olefins, are quite stable, though not as stable as paraffins. Crude oils are complex mixtures of these hydrocarbons. Oils containing primarily paraffin hydrocarbons are called paraffin-based or paraffinic. Traditional examples are Pennsylvania grade crude oils. Naphthenic-based crudes contain a large percentage of cycloparaffins in the heavy components. Examples of this type of crude come from the US midcontinent region. Highly aromatic crudes are less common but are still found around the world. [2] Crude oils tend to be a mixture of paraffins-naphthenes-aromatics, with paraffins and naphthenes the predominant species. Fig. 1, although not complete, shows a distribution of crude oil samples obtained worldwide. Geochemical analyses provided the crude’s chemical nature. Resins and asphaltenes
Resins and asphaltenes may also be present in crude oil.
[3] [4] Resins and asphaltenes are the colored and black components found in oil and are made up of relatively high-molecular-weight, polar, polycyclic, aromatic ring compounds. Pure asphaltenes are nonvolatile, dry, solid, black powders, while resins are heavy liquids or sticky solids with the same volatility as similarly sized hydrocarbons. High-molecular-weight resins tend to be red in color, while lighter resins are less colored. Asphaltenes do not dissolve in crude oil but exist as a colloidal suspension. They are soluble in aromatic compounds such as xylene, but will precipitate in the presence of light paraffinic compounds such as pentane. Resins, on the other hand, are readily soluble in oil. Full component characterization
No crude oil has ever been completely separated into its individual components, although many components can be identified.
Table 2 lists the more important compounds in a sample of Oklahoma crude. A total of 141 compounds were identified in this oil sample that account for 44% of the total crude volume. Despite this complexity, several properties relevant to petroleum engineers can be determined from black oil PVT correlations. API gravity
The petroleum industry uses API gravity as the preferred gravity scale, which is related to specific gravity as
Characterization factor
Whitson
[5] has suggested use of the Watson [6] [7] characterization factor as a means of further characterizing crude oils and components. In 1933, Watson and Nelson introduced a ratio between the mean average boiling point and specific gravity that could be used to indicate the chemical nature of hydrocarbon fractions and, therefore, could be used as a correlative factor. Characterization factors are calculated with Use of characterization factor
Characterization factors are useful because they remain reasonably constant for chemically similar hydrocarbons. A characterization factor of 12.5 or greater indicates a hydrocarbon compound predominantly paraffinic in nature. Lower values of this factor indicate hydrocarbons with more naphthenic or aromatic components. Highly aromatic hydrocarbons exhibit values of 10.0 or less; therefore, the Watson characterization factor provides a means of determining the paraffinicity of a crude oil. Using work from Riazi and Daubert,
[8] Whitson [5] developed the following relationship in terms of molecular weight and specific gravity. Table 1 provides values of Watson characterization factors for selected pure components classified as paraffins, naphthenes, or aromatics. The characterization factor values provide insight into their use.
Crude oils typically have characterization factors ranging from 11 to 12.5.
Table 2 was derived from assay data available in the public domain. It samples crudes from around the world and can be used to provide insight into PVT behavior on a regional basis.
The properties of the heptanes-plus fraction in the stock tank crude oil are an additional source that can provide insight into the Watson characterization factor. It is important to account for the lighter paraffin components found in the oil to arrive at the characterization factor for the entire crude.
Relationship between crude oil gravity and characterization parameter Fig. 1 depicts a relationship between crude oil gravity and characterization parameter. While not definitive, it can be observed that lower gravity crudes tend to be more naphthenic, while higher-gravity crudes tend to be more paraffinic. Nomenclature
γ o = oil specific gravity γ API = oil API gravity K w = Watson characterization factor, °R 1/3 T b = mean average boiling point temperature, T, °R M o = oil molecular weight, m, lbm/lbm mol References Burcik, E.J. 1957. Properties of Petroleum Reservoir Fluids, Chap. 1. New York: John Wiley & Sons. Pirson, S.J. 1977. Oil Reservoir Engineering, 303–304. Huntington, New York: Robert E. Krieger Publishing. Allen, T.O. and Roberts, A.P. 1982. Production Operations: Well Completions, Workover, and Stimulation, second edition, Vol. 2. Tulsa, Oklahoma: Oil and Gas Consultants International. McCain, W.D. Jr. 1990. The Properties of Petroleum Fluids, second edition. Tulsa, Oklahoma: PennWell Publishing Company. Whitson, C.H. 1983. Characterizing Hydrocarbon Plus Fractions. SPE J. 23 (4): 683-694. SPE-12233-PA. http://dx.doi.org/10.2118/12233-PA Watson, K.M. and Nelson, E.F. 1933. Improved Methods for Approximating Critical and Thermal Properties of Petroleum. Industrial and Engineering Chemistry 25 (1933): 880. Watson, K.M., Nelson, E.F., and Murphy, G.B. 1935. Characterization of Petroleum Fractions. Industrial and Engineering Chemistry 7 (1935): 1460–1464. Riazi, M.R. and Daubert, T.E. 1980. Simplify Property Predictions. Hydrocarb. Process. 59 (3): 115–116. Noteworthy papers in OnePetro
Use this section to list papers in OnePetro that a reader who wants to learn more should definitely read
Use this section to provide links to relevant material on websites other than PetroWiki and OnePetro | 8,664 | 3,676 | 0.000274 |
warc | 201704 | Information systems was once a relatively sleepy undergraduate major at the Tippie College of Business at the University of Iowa, despite being taught by a sophisticated team of professors with expertise in applied mathematics, computer science and engineering. That all changed a few years ago when Nick Street, the chair of the school’s management sciences department, and his colleagues realized they were sitting on top of a huge untapped opportunity.
They were already experts at teaching students how to mine data to make business decisions, and companies were increasingly telling them they wanted undergraduate students with expertise in this hot area. Street responded by adding a new track in business analytics to the major in 2013, offering students the chance to graduate with a Business Analytics and Information Systems degree.
“This whole big data thing is relatively new, and everyone is recognizing the value of all this data we’ve all been collecting,” Street says. “We saw this as a coming trend. You can’t go anywhere without having someone say ‘big data’ these days. The hype has been fairly ridiculous.”
MIT SLOAN, MARYLAND’S SMITH & OHIO STATE’S FISHER INTO THE GAME
The addition of the business analytics track has turned out to be a smart strategic move for the school. In the first year, about 70 students signed up for the revamped major, and enrollment has nearly quadrupled three years later. Even more encouraging, the placement rate for students who graduated from the program has been 100% or close to 100% every year for the last three years.
“There are a lot of good entry-level positions out there, and there is a need for this talent,” Street says. “Nobody was filling it, at least not in our markets. Companies are snatching up our students.”
Over the last few years, a bevvy of programs in business analytics and data analytics have popped up at top business schools across the country, driven by the rise of big data and a growing need for people with deep expertise in crunching the massive amount of information generated today by companies. Now undergraduate business programs are starting to follow suit, with a growing number of them offering majors and minors in the topic. MIT Sloan revamped its undergraduate curriculum last fall to include a new major in business analytics, and other undergraduate business schools such as Tippie, the University of Maryland’s Smith School of Business and Ohio State University’s Fisher College of Business are introducing majors, co-majors or minors in the subjects.
CORPORATE RECRUITERS ARE CLAMORING FOR STUDENTS WITH THIS EXPERTISE
The schools are bringing the subject into undergraduate classrooms at a time when the market is clamoring for students with expertise in this area. More and more companies are collecting large amounts of data because storage is relatively cheap, and they are increasingly reliant on business analytics to gain an edge over their competitors or to simply remain afloat in the market.
According to a study by McKinsey & Company, the U.S. could face a shortage of 140,000 to 190,000 people with “deep analytical skills” by 2018 as well a 1.5 million shortage in managers and analysts who know how to use big data effectively. Another study by the International Data Corporation, a market research, analysis and advisory firm, estimates that by 2018 there will be a need in the market for 181,000 people with deep analytical skills, and five times that many positions requiring skills in data management and interpretation skills.
Undergraduate business schools are starting to respond to this marketplace need. For example, Ohio State’s Fisher College introduced a minor in business analytics for the first time this year, hoping to expose students to the subject through a fast five-course sequence intended to train students how to do data analysis through the lens of R, the leading programming language in statistics and data science. | 4,066 | 1,933 | 0.000532 |
warc | 201704 | Raj Singh doesn’t know how many other business schools require 100% of their students to complete an international experience before graduating (hint: not many). But the associate dean of the undergraduate program at the University of Minnesota’s Carlson School of Management points to last spring’s foray to Cuba by the B-school’s entrepreneurship program as proof of the value of crossing borders and leaving one’s comfort zone.
“The students’ eyes really opened up,” Singh says of the excursion to study the island’s emerging economy. “It’s like anything else in college, right? It’s learning.”
Carlson prides itself on providing international learning opportunities. Besides requiring all students to have some kind of global experience before graduation, through fall 2016 the school offered 10 courses that feature significant global business components; over 300 more options are available through the university. The Carlson Global Institute facilitates 38 exchange programs to universities around the world. Not satisfied there, Carlson is constantly adding new elements, Singh says, as it did with the 2014 introduction of a global supply chain program that traces products from sources in China to ports in California to warehouses in Minnesota and, finally, shelves at Target stores.
“We have increased what I would call the richness of the international experience,” Singh tells
Poets&Quants. “Every year we keep trying to add to the mix.” IMMERSION AND EXCHANGE
In the inaugural 2016
Poets&Quants undergraduate business school ranking, by far the school whose alumni reported the most participation in an international experience was Carlson, with 83%. (The next closest school was Illinois, at 60%.) It’s no coincidence that Carlson also had a very strong showing in the alumni feedback portion of the ranking, landing fifth among 37 responding schools. Most of those who chose to elaborate on positive views of their alma mater cited some element of their study-abroad experience, raving about formative experiences in such far-flung places as Beijing and Kenya.
Mark Haakenstad, Class of 2014, chose Carlson in part because of its international requirement — and he wasn’t disappointed. Haakenstad, a Minnetonka, Minnesota native who now works as a revenue management analyst for American Airlines, tells
Poets&Quants that he was drawn to the school because of its proximity to many large Twin Cities-based Fortune 500 companies and its required study-abroad component and second-year immersion core component. He took advantage by spending a semester at the University of St.Gallen in Switzerland.
“Needless to say, I was able to form some life-long global relationships,” Haakenstad says. “I had an amazing experience, and am thankful of Carlson’s ties to strong academic programs like St.Gallen. Likewise, he adds, courses like International Finance and The Global Economy “prepared me well for dealing with international airlines, and for being sound in my financial judgement for AA.”
ON THE GROUND IN AFRICA, SOUTH AMERICA
Another Minnesota native and 2014 Carlson grad, Justine Beran, spent six months in Kenya, taking classes and doing an internship with an NGO. Beran, now a program manager at Land Bank Twin Cities, studied finance and nonprofit management at Carlson and used her classroom time in Africa to learn some Swahili and study the history of economic development and small business enterprise in Kenya. She interned with a sustainability group and helped local residents get certification in computer skills.
“We stayed with a host family, which is the most cultural experience you could have, instead of staying in an apartment,” Beran says. “It was awesome. And it’s probably what keeps me most connected to the university after graduation. They try to keep all of us grouped together and offer our phone numbers and emails to students that are going abroad.”
Anthony Jison, who graduated in 2014 with a triple major in supply chain and operations management, marketing, and entrepreneurial management, grew up in Germany and has traveled to more than 40 countries. Still, he found Carlson’s international requirement an invigorating experience. “I took a course titled Management of Innovation and Change, which I found to be fascinating,” says Jison, who is currently earning his Lean Six Sigma Green Belt certification at the California Institute of Technology. While at Carlson, he studied the burgeoning tech scene in Recife, Brazil and traveled to Sao Paolo to meet with the leadership at a variety of organizations and major corporations.
“Despite growing up abroad and being fortunate enough to have been to over 40 countries,” Jison says, “the experience still resonated very deeply with me. For my fellow classmates who may have not ventured out of the Midwest or even the state, the impact the experience had on them cannot be overstated.”
CARLSON RANKS HIGHLY
Carlson ranked 12th overall in
P&Q’s inaugural ranking, bolstered by a No. 5 spot in alumni satisfaction. The school placed 22nd in applications, with 586 new students in the fall of 2016 (a 28% acceptance rate), and 18th in outcomes, with 96.9% of students landing jobs within 90 days of graduation (a slight drop from 97.9% in 2015). Their average total compensation was $61,935 ($61,074 in 2015); remarkably, grads receiving signing bonuses — at such employers as UnitedHealth Group, Ernst and Young, Target, and KPMG — jumped more than 12% in one year, to 29.6%.
Calling Carlson a “fantastic value play,” Anthony Jison relates the story of how he chose Minnesota over the three other schools he was accepted to, including UCLA. “I ultimately whittled it down to the U of M or UCLA,” he says, “and the ultimate decision was based on a value factor: Attend the U of M — which in and of itself is less expensive than UCLA — where I received merit scholarships, or attend UCLA at ‘full price,’ where tuition alone is more than $50,000 per year, not including Los Angeles living costs. The decision to me was quite clear, given my family’s financial situation, and the fact that the disparity in national rankings between the two universities wasn’t that astronomical.”
Still, out-of-state tuition at Minnesota costs $103,379 for four years; an estimated total for cost of living for four years is $49,032, bringing the total cost of an education at Carlson to approximately $152,411. A full 64% of students received an average $8,623 in annual scholarship support, and 48% graduated with an average of $25,664 in student debt.
INITIATIVES AND EVOLUTION
Study abroad isn’t all that Carlson offers. New business students can choose between 10 majors: accounting, entrepreneurial management, finance, finance and risk management, human resources and industrial relations, international business, management information systems, marketing, public and nonprofit management, and supply chain management. Carlson’s experiential learning components are strongly woven into every program, with 24 courses featuring significant experiential learning, and more planned to be added to the mix — the result of Raj Singh’s stated intention upon taking over the undergrad program to scale up experiential offerings.
Carlson also is reaching out to women. The University of Minnesota student body is comprised of about 52% women, but the B-school has just 41%, and Singh says a program started two years ago to reach out to area high school juniors and seniors is designed to address the disparity. The idea of the one-week course, he says, “is not to teach them business but to get their curiosity going, so if they are thinking about something else, they can see a future here.” The course features women entrepreneurs and women CEOs from top firms located in Minneapolis, and targeted students are all “high-achieving women — if they apply they will get into the program.”
Changes at Carlson continue in other ways, Singh says, including a minor in business law introduced in 2015 and another in business analytics planned for fall 2017, the latter aimed at “giving students the extra edge of being uniquely qualified to talk the language of data sciences.” Efforts to smooth the transition of new students will include a freshman on-boarding experience that got a test run in 2016, when about 70 students were loaded onto two buses out of Chicago and taken on a four-day excursion to do community service projects at different locations.
“Our point was, they learned something about community service, but more importantly they learned something about their own community,” Singh says. “When they walk into their first class they will know at least 10, 15 people. They will already be a part of the Carlson family.”
WHAT ALUMNI SAY “Carlson Consulting Enterprise allowed me to work with a team of full-time MBA students to perform consulting services for startups, mid-size, and Fortune 500 companies. It was a really great learning opportunity that helped prepare for full-time employment. I also did a semester-long study abroad in Singapore that was an incredible cultural immersion and opportunity to experience another part of the world.” — 2014 Carlson grad “The study-abroad experience specifically focused on business abroad including an internship, was thoroughly engaging, and gave me an opportunity to see and work outside of my home culture, greatly expanding my outlook.” — 2014 Carlson grad
“
A signature experience was in an Honors Program section of a business communications course. The entire course revolved around a project in which the class was divided into groups of three and four and given the task of partnering with a local small business or nonprofit to improve elements of their communications materials. The final deliverables varied based on the requirements of each individual organization, but it was an interesting project that essentially gave us firsthand experience of consulting, project management, etc.” — 2014 Carlson grad Where the Class of 2016 went to work: UnitedHealth Group: 26 Ernst & Young: 23 Target: 20 KPMG: 18 Accenture: 18 PwC: 17 Deloitte: 13 Wells Fargo: 13 Boom Labs: 12 General Mills: 11 | 10,559 | 4,859 | 0.000214 |
warc | 201704 | Still, Fuller's introduction, "The Nature of Mutiny," is of some interest, and undercuts (perhaps better, explains) the fierce dichotomies that will follow. For in Fuller's view, "mutiny is apt to have an intimate, familial quality about it" (xii). In other words, the opprobrium heaped on mutineers comes from the trauma of discovering yourself betrayed by your most intimate companions.
Hence there is an affective distinction between mutiny and revolution:
A man seldom knows personally, or is associated with, the people against whom he is moving in revolution. In most cases of mutiny a man not only is acquainted with, but is in some manner of working relationship with the persons against whom the mutiny is directed. (xii)Moreover, this is why the shipboard mutiny is paradigmatic: at sea, men are confined together in close quarters for months or even years. And this forced intimacy is two-sided: "It can increase tensions by the inability of people to separate from each other. At the same time it offers a closeness well adapted to conference and conspiracy" (xiii).
Fuller makes a couple of other points. First, he wants to distinguish mutiny from labor disputes. Mere refusal to serve is not mutiny; it is a strike. I think the point here is that a labor dispute is not a wholesale assault on constituted power. Myself, I wonder how far this distinction can be upheld. And second, he argues that the days of mutiny are in effect over: "To all intents and purposes the traditional mutiny at sea has gone out of existence. It died with sails. Technology ended the era of mutiny" (xi). By this he means that mutiny can no longer be sustained, as there is no place to hide: "it just is not practical any longer to try to seize a ship and take it over on an impromptu basis. There's no future in it" (xi). And indeed its striking that may of the mutinies described took place so far from home that the mutineers could either try to disappear (as in the case of the
Bounty) or could spend the long homeward voyage perfecting the stories they would tell before the coming courts martial (as in the case of the mutiny against Henry Hudson).
More importantly, however, Fuller suggests that it is the massification and division of labor that makes mutiny impossible on a modern ship: a few renegades may be able to take hold of a sailship, but "to seize a steamship is another story. It would take a full complement capable of the necessary engineering skills involved" (xi).
In short, for Fuller at least, mutiny is pre-industrial. It involves betrayal within the family (or the gang, the tribe) rather than insubordination from the masses within the workplace. | 2,686 | 1,375 | 0.000733 |
warc | 201704 | Mid-Range, Good Iron
The Babyliss Pro Nano Titanium is a moderately priced flat iron that provides reliable, functional results. It includes nano-titanium 1-inch plates, heating power between 300 and 400 degrees Fahrenheit, and a ceramic heater with ionic technology as well as Ryton housing.
Nano titanium plates
The fact that the Babyliss Pro Nano Titanium has nano titanium plates means that the plates contain tiny particles of titanium, or are coated in titanium rather than being made entirely of titanium; in general, the more titanium the better, so while “nano titanium” sounds scientific, it’s actually quite misleading. That being said, even nano titanium is better than cheaper models that are made entirely of aluminum or plastic, which are the worst for your hair. It would be nice to know what the plates are made of besides titanium, but this information is not readily available. Flat irons with titanium are the best choice for users with coarse, thick hair, as it is the most heat-conductive material on the market, so this would be a great choice for anyone with hair like that.
1-inch plates
The Babyliss Pro Nano Titanium has 1-inch wide plates, which is good for most hair lengths and textures; unless you have extremely long hair, 1-inch plates are ideal.
300-430 degree temperature range
The Babyliss Pro Nano Titanium has preset temperatures ranging from 300 to 430; you can pick from 300, 325, 350, 375, 410, and 430. This range will work for any hair type, and the higher temperatures ensure that even people with coarse, thick hair can find an appropriate temperature. It would be nice to have temperatures below 300, for those who have fine, fragile hair.
Strengths Ionic technology
The Babyliss Pro Nano Titanium’s ceramic heater releases negative ions, which help soothe frizzy, dry, hair and prevents damage. Since straightening can be a very trying process on your hair, it’s important to invest in a flat iron that releases negative ions.
Ryton housing
The Ryton housing on the Babyliss Pro Nano Titanium stops the unit from overheating and burning your hand; it works wonderfully on all but the highest setting, at which point you may find the unit becomes too hot to hold after a while.
Lightweight
At .6 pounds, the Babyliss Pro Nano Titanium is extremely lightweight, so you can straighten faster and with less effort from constantly lifting a heavy flat iron over and over again. It also features a very slim design, and is easy to hold in your hand.
Weaknesses Longer plates
This unit has extra-long 5-inch plates, making it longer than most flat irons; this could make it hard for some users to straighten without worrying about burning their skin, though it probably boils down more to getting used to it than it being a persistent problem. Some users will actually appreciate the larger sized plates, which can help speed up the flat ironing process and can straighten more hair at once than shorter irons.
Overall Review
The Babybliss Pro Nano Titanium is a great option for any user, especially users with unruly, coarse, curly hair. The nano titanium plates make for a powerful straightening experience that can tackle even the most difficult hair, and it’s lightweight design makes it easy to use. Most importantly, it has a ceramic heater for ionic healing of your follicles throughout the straightening process. | 3,410 | 1,543 | 0.000658 |
warc | 201704 | What are the different types of business plans?
If you like what you read please bookmark the article and subscribe to my blog.
In order to appreciate all that a business plan can do for you there needs to be an understanding of the different types of business plans. Many entrepreneurs cringe at the idea of writing a business plan. They think they are too hard, to long, and will take to much time. This often happens because entrepreneurs find resources like the SBA which lists a ton of needed info to prepare a plan. While you will not go wrong by following their guidelines you may actually be doing a lot more work then you need to. My guide is not like others. It is written specifically for the entrepreneur who is looking for a way to examine opportunities of all types.
I first want to define the criteria I’m going to use:
Effort: What I mean here is the amount of ‘research’ you will need to do in order to gather, organize, and present the information needed for your plan. Effort – Min: In this case you will typically have all the needed information in your head or in your notes. There is little need for external research. Effort- Mod: In this case you will typically have a general idea of the direction you want to take. You will use the internet to conduct much of your research. You may do some market, demographic, and competition analysis. Effort-High: In this case you will utilize all available resources to gather the materials needed to present your plan. This may include hiring consultants, conducting surveys, traveling to visit competitors and/or potential clients. In most cases you will have your plan reviewed by industry experts before submitting it to its final recipient. Work: This is more the amount of time and energy that you will invest in preparing your plan. Work – Min: In many cases a full plan can be written in one day. You typically have all the needed information that just needs to be organized. If you start focused you can do this in one sitting. It is still recommended that you go through a review process before submitting this plan. Work – Mod: This type of plan will typically be done in three separate parts. First, is the initial preparation of the plan. Second, will be a review/research process where you find supporting information and or market research. Last, will be a final review where you run the plan by other people to gain insight into its value before submitting it to its final destination. Work – High: In this case you should expect to dedicate months to the preparation of your plan. If you do not have this time available you may have already been given a sign that the project is out of your reach. These types of plans include travel, third party vendors, multiple review phases, and intensive investment.
I’m going to give a brief introduction to each of these types of plans. I’m not saying there are not more types out there nor would I argue that others may define my types of plans differently. Theses are simply the types or plans that I use almost on an everyday bases.
Examination Plan: (Effort: Min – Work: Min – Length: 1-5pgs) This should be done for EVERY idea you have. This may sound ridiculous to you now but I promise if you do this you will find that staying organized and motivated in much easier. This can be a simple sheet of paper where you write down your idea, you examine opportunities, estimate costs and profitability, and you determine the ideas over all feasibility. You are basically examining your idea from all of the basic aspects. I also recommend creating a file or find a shoe box where you put all of these ‘examination plans’ into. You never know when an opportunity will arrive where you can break out an old plan and capitalize on it. Start-up Plan: (Effort: Moderate – Work: Min – Length: 2-20pgs) This is the type of plan most entrepreneurs will have to deal with. This is a complete review of an idea that has made it through the examination plan. At this point you are going to break the plan into four parts; 1) Description of the business, 2) Marketing’ 3) Finances, 4) Management (you can read more about this part at http://rcbryan.com/?p=107). At this point you are going to start create a detailed plan for each of the main elements of a business plan. Micro Venture Plan: (Effort: Moderate – Work: High – Length: 10-50pgs) Micro Venture Plans are usually created for business ventures that call for less then $100,000 in initial investment. These plans are much more detailed then a start-up plan. If you know you are going to need funds from an investor it is recommended that you skip the start-up plan and go straight into the Micro Venture Plan. All investors are looking for a solid plan with a great deal of supporting information. You’ll need to not only include you idea. You will need a detailed history of your personal finances as well as a detailed description of you business experiences. This is the type of plan that is typically submitted to a bank, a Micro-VC Firm, and family/friends you are trying to get money from. Worst Case Scenario Plan: (Effort: Moderate – Work: Moderate – Length: 2-10pgs) I’ve always used this as a compliment to my business plans. Many people over look the value of this plan. Things that are examined in this plan are lease commitment break even points, back up plans for the loss of a primary client, regulatory changes, entrance of new competition, and many others. You basically sit and brainstorm about all the things that could possibly go wrong and then you work out scenarios of how you will handle each occurrence. Very few people do this but I highly recommend that you spend some time protecting all your bases. Growth Plan: (Effort: Moderate – Work: Moderate – Length: 2-50pgs) Growth plans are usually written for a preexisting business. They are an attempt to outline a possible opportunity. This can be entering into a new market segment or taking on a new client. By examining all elements of a possible new opportunity you will look to see your capabilities, the cost parameters, and the potential benefit of taking on the new venture. These types of plans can be a simple spread sheet to a detailed competition/market analysis. A little planning now will go a long ways in the future. Internal Operational Plan: (Effort: Moderate – Work: Min – Length: 2-50pgs) Most Internal Operational Plans are flow sheets. They typically outline a process that is not currently in use or is not currently working properly. Some may not consider this a ‘business plan’ but if you run a business and you have ever had to examine an internal process then you understand the importance of this tool. When preparing this plan you may use benchmarking, trial and error, or historical analysis to develop and implement changes to a current or new process. Internal Expansion Plan: (Effort: Moderate – Work: Min – Length: 10-50pgs) This plan often compliments a growth plan. When you plan for the external elements of a new deal you have to be sure you look inwards to your staff, office space, IT and phone expansion, and management. Many people take on new projects with the right front line people and forget to examine their middle management structure. This can often prove to be fatal to a new project. You should always have an eye on what your staffing levels would need to be in order to take on that next large client. You never know when they are going to knock on your door. Full Business Plan for Investors: (Effort: High – Work: High – Length: 20-100+pgs) This is the big daddy of all plans. I would recommend that before even consider doing a proposal this size that you have a working knowledge of more basic business types. A Full Business Plan can take months and even years to do. You’ll need to have the answer to every question a person could possibly ask before they even know they need to ask the question. Many Full Plans are multi-million dollar deals that require the participation of an organizations board, third party vendors/consultants, basically every thing except the kitchen sink. I could and maybe will type a whole post about this type of plan. For now I think you get the point. Overview: This is a brief introduction to the different types of business plans that you may encounter as an entrepreneur. Each is broken down with the amount of time and energy you will have to commit to the plan. It also gives a loose guideline to the needed length of the plan as well as the basic content of each type of plan. | 8,692 | 3,604 | 0.000283 |
warc | 201704 | This collection of essays addresses and defines the state of contemporary theories and practices of space: it is concerned with the growing importance of technology and communications, the effects of globalization and the change of social demands. Within the current urban and geopolitical contexts, it addresses the emergence of new social and political theories that raise questions of identity and difference in modern society. The book reiterates feminist concerns with space from the critical stance of the new millennium. With contributions from the leading theorists and thinkers from around the world representing the fields of architecture, art, philosophy and gender studies, this book has a truly international and interdisciplinary reach. | 752 | 424 | 0.002365 |
warc | 201704 | After following politics and elections for over 60 years, it is quite extraordinary to see the Liberal party complaining about the Medicare scare campaign. In a downcast and confusing speech on election night Malcolm Turnbull spoke of the ‘well funded lie campaign on Medicare.’
In fact, I think the ALP is right on the threat to Medicare, although I would have used different arguments.
Promoting fear and scare campaigns has been the stock in trade of conservatives in Australia for decades. They have developed it as an art form. The most memorable scare campaign I can remember was in the late 1950s with conservatives promoting fear about the communism and from Communist China in particular. Advertising drew pictures of large arrows depicting the downward thrust of Communism towards Australia.. To top it off this scare campaign depicted hundreds of Chinese rolling across Sydney Harbour Bridge in their rickshaws with guns and communist flags.
The fear of Communism was promoted for decades. The Labor party and the trade unions were the focus on this anti-communist scare campaign.
Conservatives now focus that external threat on refugees and Muslims. Scott Morrison encouraged the Parliamentary Liberal party to be more aggressive in promoting the scare campaign against Muslims.
He told us that boat people were another threat because they were bringing diseases to Australia. That fear of refugees and boat people was exploited first by John Howard and Philip Ruddock who told us that refugees were so inhuman and violent that they would even throw their children overboard.
The Howard government, along with the US and the UK, joined in the Invasion of Iraq which made us more vulnerable to domestic terrorism. But as always that was an opportunity for a renewed scare campaign about terrorists and of course, Muslims.
But the most recent infamy in scare campaigns was conducted by Tony Abbott. The carbon tax was going to wreck the Australian economy. Whyalla was to be wiped off the map and a leg of lamp would cost $100.
We had a scare campaign about budget deficits and government debt, but in government Tony Abbott and Joe Hockey forgot all about it.
Liberal backbenchers created a scare campaign about ‘safe schools’.
We were warned that Labor’s proposals on negative gearing would wreck the property market.
We were later told to fear a Labor/Green alliance as a ‘caravan of chaos’.
The Liberals have run one scare campaign after another, but now they are hoist with their own petard over Medicare.
It is quite delicious to see the Coalition complaining about a scare campaign. But it is not clear how effective it was in shifting votes The opinion polls showed very little movement throughout the eight week campaign. The opinion polls also accurately reflected the final vote. It might be argued that Mediscare slowed a movement back to the government in the last couple of weeks, but the opinion polls don’t show it.The coalition’s problems were elsewhere-failed leadership and a vacuous ‘plan for jobs and growth’.
The Liberal party has been hostile to Medicare since its introduction by the Whitlam government in 1974. The Fraser government tried to cripple it. It was restored by the Hawke government. Since then, the Liberals have known there was popular support for Medicare but did their best to undermine it from within. They are doing this with a $11 billion p.a. subsidy to private health insurance. Warren Buffet in the US called PHI the tape-worm in the US health system. The same is true in Australia with government supported subsidies to PHI. Tony Abbott told us repeatedly that PHI was in the Coalition’s DNA The Medicare shell may remain but the Coalition is supporting the eating out from within.
I would have used different arguments about the threat to Medicare, but in my view Bill Shorten is correct to say that Medicare is under threat.
Conservatives have set the pattern and gold standard in scare campaigns for decades. It is quite delicious to see them complaining.
Hoist with their own petard.!.
Source: John Menadue’s Blog Menadue is a former head of the Department of Prime Minister and Cabinet from 1974 to 1976, serving both Gough Whitlam and Malcolm Fraser. He is a former ambassador to Japan and served as CEO Of Qantas Airways. Reproduced with permission of the author.
RenewEconomy Free Daily Newsletter
Share this: | 4,461 | 2,107 | 0.000484 |
warc | 201704 | MARKETING
Thread Rating:
projectsofme
Active In SP
Posts: 1,124
Joined: Jun 2010
24-11-2010, 03:54 PM
MARKETING NOTES Module 1,21.doc (Size: 322 KB / Downloads: 124)
MARKETING
It can be broadly defined as the study of the performance of sales, distribution, advertising & sales promotion, planning of product sales & conducting research for demand.
In short, those functions in a business that directly involve contact with the consumer & assessment of their needs are called marketing.
KOTLER
According to Kotler marketing is a social & managerial process by which individuals &groups obtain what they need & want through creating, offering & exchanging products of value with others.
FEATURES OF MARKETING
* Marketing is a concept, a way of thinking. It starts where production leaves off.
* The marketing concept assumes that the objective of all business enterprise is to make a return to those who have invested in it.
* Marketing is a total function & is concerned with activities such as product planning, product development, product change, pricing & packaging selling & sales promotion & advertising & marketing research.
* Marketing places its primary emphasis on the profitable satisfaction of consumer’s need by providing products as a means to the end of satisfying needs.
* In the marketing concept the consumer is at the top of the organization chart.
IMPORTANCE OF MARKETING
* Marketing is the heart of any business organization .Thus, it affects each person’s life .
* Marketing aims at satisfying the needs of customers, accordingly it create utilities of time, place & possession.
* Marketing as a career provides an employment opportunity to various people.
* It helps in developing economic resources of any country.
* Marketing brings regional balances.
* Marketing determines the pattern of consumptions.
* Marketing aims to provide quality products & services , so as to satisfy the customer and ultimately raise their standard of living.
OBJECTIVES OF MARKETING
* To satisfy the needs and wants of customers.
* To determine marketing-mix that aim to satisfy the needs of the customer.
* To generate and create goodwill for the enterprise.
* To raise the standard of living of the people.
* To establish the organization &the methods which will be required.
*Helping one self to decide whether his career shall be marketing.
MARKETING MANAGEMENT
Marketing management is the process of planning and executing the conception, pricing, promotion and distribution of goods, services and ideas to create exchanges with target groups that satisfy customer and organizational objectives.
OBJECTIVES
* To satisfy customer.
* To create good image of the organization.
* To increase the quality of life of the people.
* To increase profit for the growth of the business.
* To generate more and more customer base for the business.
* To determine the marketing-mix that will satisfy the needs of customer.
Abbott
Active In SP
Posts: 4
Joined: Dec 2010
13-12-2010, 10:49 AM
Hello,
I am a student of MBA and my major is goodyear service center couponsmarketing.It will really help me in my study so thank you so much for sharing it here..
Best Regards,
Ali. | 3,232 | 1,533 | 0.000665 |
warc | 201704 | Shrestha, Sujan (2016)
Exploring mobile learning opportunities and challenges in Nepal: the potential of open-source platforms. Doctoral thesis, University of West London.
PDF
Sujan Shrestha Thesis (Final - September 2016).pdf - Draft Version
Download (5MB) | Preview
Abstract
With the increasing access to mobile devices in developing countries, the number of pilots and projects embracing mobile devices as learning tools is also growing. The important role it can play in improving education is also positively received within education communities. But, providing a successful mobile learning service is still significantly challenging. The considerable problems arise due to existing pedagogical, technological, political, social and cultural challenges and there has been a shortage of research concerning how to deploy and sustain this technology in a resource constrained educational environment.
There are studies mainly conducted in sub-Saharan countries, India, and Latin America, which provide some guidelines for incorporating technology in the existing educational process. However, considering the contextual differences between these regions and other countries in Asia, such as Nepal, it requires a broader study in its own challenging socio-cultural context. In response to this difficulty, the aims of this exploratory research work are to study the distinct challenges of schools’ education in Nepal and evaluate the use of open-source devices to provide offline access to learning materials in order to recommend a sustainable mobile learning model. The developmental study was conducted in University of West London in order to assess the feasibility of these devices. The main study in Nepal explored i) the overall challenges to education in the challenging learning environment of schools with limited or no access to ICT, ii) how ICT might be helping teaching and learning in the rural public schools, and iii) how an offline mobile learning solution based on the open source platforms may facilitate English language teaching and learning. Data collection primarily involved interviews, questionnaires, observations and supplemented by other methods. This thesis presents the sustainable model for deploying and supporting mobile technology for education, which is based on the findings emerging from completed exploratory studies in Nepal. It highlights all the aspects that need to be addressed to ensure sustainability. However, to translate this understanding to a design is a complex challenge. For a mobile learning solution to be used in such challenging learning contexts, the need is to develop simple and innovative solutions that provide access to relevant digital learning resources and train teachers to embed technology in education. This thesis discusses these findings, limitations and presents implications for the design of future mobile learning in the context of Nepal.
Item Type: Thesis (Doctoral) Subjects: Computing > Innovation and user experience
Education > Teaching and learning > Technology-enhanced learning
Computing
Depositing User: Dominic Walker Date Deposited: 16 Nov 2016 10:52 Last Modified: 16 Nov 2016 10:52 URI: http://repository.uwl.ac.uk/id/eprint/2962 Downloads
Downloads per month over past year
Actions (login required)
View Item | 3,321 | 1,581 | 0.000637 |
warc | 201704 | Literacy and social development : the church and nonformal education in South Korea (1910-1945) Abstract
The purpose of this thesis is to relate literacy (nonformal education) to social development. It begins with a theoretical discussion on literacy and social development and uses Paulo Freire's dialogical framework to determine the contribution literacy can make. In using the context of a South Korean literacy campaign, this work covers the historical development of the Korean alphabet and initiation of Hangeul literacy. It examines the arrival of Christian missionaries in Korea and how they used literacy to maximise conversion and Church establishment. Literacy became the Christian Church's mission and this is examined in the light of the Korean struggle for independence during the Japanese occupation. The impact of literacy on social development in political, economic and social sectors is evaluated. The paper discusses the problem of literacy and social development in developing nations and suggests some strategies for the society and Church.
Related items
Showing items related by title, author, creator and subject.
The development and evaluation of a community-based programme offering psychosocial support to vulnerable children affected by HIV/AIDS, poverty and violence. Killian, Beverley Janet. (2004)This research programme endeavours to develop, implement and evaluate an effective method of offering psychosocial support to vulnerable children. Vulnerability is defined by trained community members as including children ... Worth, Steven Hugh. (2008)This thesis is about agricultural extension education. The context is agricultural extension in South Africa. It addresses the following questions: To what extent does current agricultural extension education in South ... Loan products to manage liquidity stress when broad-based black economic empowerment (BEE) enterprises invest in productive assets. Finnemore, Gareth Robert Lionel. (2005)Investments in productive assets by broad-based black economic empowerment (BEE) enterprises in South Africa (SA) during the 1990s have been constrained, in part, by a lack of access to capital. Even if capital can be ... | 2,202 | 1,051 | 0.000954 |
warc | 201704 | International Development Secretary Justine Greening gathers with hundreds of young people at the Youth Summit. Credit: Jessica Lea/DFID
Two young people have been selected to be part of the UK’s official delegation at the United Nations General Assembly (UNGA) for the first time, International Development Secretary Justine Greening announced today at the first Youth Summit held at the Department for International Development (DFID).
This UN conference that will take place in New York later this month will see world leaders adopt the successor goals to the Millennium Development Goals. The new Global Goals will aim to finally eradicate extreme poverty.
Designed for young people by young people, the Youth Summit gives them the chance to get their voices heard on the global issues they care about. Justine Greening will take these views to the UN, providing a platform for young people’s voices on the world stage.
International Development Secretary, Justine Greening said:
“Globally, over 1.8 billion people in the world are aged between 10 and 24 – the vast majority are living in less developed countries and face uncertain futures. These young people can be the leaders, teachers and entrepreneurs of tomorrow. There is no question they must be at the heart of our efforts to tackle global poverty.
“The plight of refugees and the horrors in Syria are at the forefront of everyone’s mind. Over half of the 4 million registered refugees from Syria are children. Now more than ever it is vital that young people engage with the development challenges that the world faces, and that we listen to them.
“The face of development is a young face and the UK’s first ever Youth Summit gives young people all over the world the chance to have their voices heard. But the journey doesn’t end here. Young people will be at the centre of our work to create a world that is healthier, safer and more prosperous for everyone.”
The two young delegates chosen as part of the UK’s official delegation to UNGA are Ronagh Craddock, 25, from Newcastle and Arifa Nasim, 18, from London. The selection process focused on candidates’ knowledge of the post-2015 processes, their experience being advocates for youth-led development and their ability to communicate confidently with diverse audiences.
Arifa is an activist and co-founder of Educate2Eradicate, a programme founded to educate young people and train professionals on the issues of FGM, forced marriage and Honour Based Violence.
Ronagh has volunteered in Zimbabwe with Restless Development, where she led sessions with youth groups on entrepreneurship, HIV/AIDS, gender equality and children’s rights. Ronagh is also an active climate change advocate with the UK Youth Climate Coalition.
Ronagh said:
"While volunteering last year, I saw first-hand how unfair the lack of opportunities is for young Zimbabweans. But I also saw young people solving these problems. That's why this Youth Summit is so important and why I'll be speaking up for young people - so that we are heard and world leaders listen when they meet at the UN in September."
At the Youth Summit, BBC Three Free Speech’s Rick Edwards hosted a debate exploring education, employment, gender equality and climate change. Young people from around the world spoke out about their personal experiences overcoming marginalisation in their communities and workshops were held about how young people can take action, including how to tackle harmful practices such as Female Genital Mutilation and child marriage.
Journalist and TV presenter Rick Edwards said:
“I’m delighted to be a part of The Youth Summit. It’s a generation-defining year for the world and it’s absolutely vital that young people have their voices heard.
“I hope that this event helps draw more young people into being engaged with these big global issues like poverty and climate change.”
Elsewhere at the Summit:
DFID launched its Snapchat channel. Follow for updates and exclusives: DFID_UK
Footage from Malala Yousafzai’s new documentary ‘He Named Me Malala’ was exclusively premiered
Young people placed their commitments to the Global Goals on a Commitment Wall which will be taken to an UNGA youth side event to represent the voice of UK youth | 4,369 | 2,055 | 0.000503 |
warc | 201704 | I share a dream of national and global achievement. I have no greater initiative than this in my life as it would benefit the world with such magnitude and game changing potential that I would compare it to the Renaissance of Europe via Florence. It would be the literal beginning to a new era of human development and one which would resonate throughout history. I present the idea of
“Rio Solare” or River of the Sun.
Just like other cities and regions of the past and present that serve as a nation’s portal or gateway to progress,
“Rio Solare” will have the same iconic agreement with the masses. Whether it was Plymouth Rock from the beginning, to San Francisco for the gold rush or Detroit, America’s birthplace of its auto- industrial revolution, each geographical center was indicative in its role as a gateway city or region. This was dictated by an area’s natural resources and adds to our ever developing American culture as form would follow function. Whether for logistical importance or mineral richness in these special places, our objectives were driven forward by grand ideas that make America.
The concept of
“Rio Solare” is a culmination of creativity like any other civilizations search for survival. I believe this concept is America’s new inspiration and a global example of our nations resolve. Essentially, “Rio Solare” is a self-sustained, closed loop community, similar to other global projects known as “Kacare “in Saudi Arabia or “Masdar“ in Abu Dhabi, but this concept is beyond those. What I envision is an “Epcot Center” approach that allows for demonstration of various ideas of sustainability on a “World’s First” standard along the Colorado River.
Like Walt Disney did with Epcot Center at Disney World, this expose of technologies showcases imagination, creativity, and application like no other think tank can do. Here in the American West we have the famous Colorado River which is known worldwide as being a source of renewal, progress, and energy. We sit on a set of extraordinary circumstances along this string of uncanny ingredients that make this vision the perfect storm of innovation in a world class setting. I believe the US West has become our source of wonderment and inspiration for over 2 hundred years and will be the very place we find our new start.
We now have approximately 5 Billion dollars of solar projects proposed in this area for the next 3 years. With the rest of the southwest region of our nation, you can add another 5 billion dollars easily.
“Rio Solare” is the gateway that our nation needs to envision its possibilities. The “Rio Solare” project starts from a northern point along a 22 mile stretch of the Colorado River from Laughlin, Nevada to Needles, California with Arizona as the linking point in this multi pronged regional approach. The project at this time includes 5 major installations along this route, each of which is a world’s first demonstration of proven technologies that exist today. With this compelling knowledge you too will understand the magnitude of “Rio Solare” and see the vision as I have dreamed will come true. Part of the appeal of Rio Solare is the ability to unite people in such a way that the future will be changed forever. In order for this to succeed, we need the support of you, readers and dreamers, to make our voice heard. Do your part and better educate not only yourself but those who can influence the vision of Rio Solare to reality. Click the various names of people and organizations below to voice your support for Rio Solare. SENATOR HARRY REID (NEVADA) SENATOR JOHN MCCAIN (ARIZONA) CALIFORNIA-NEVADA SUPER SPEED TRAIN COMMISSION | 3,799 | 1,880 | 0.000554 |
warc | 201704 | RIS ID
106512
Abstract
The practical application of two different voltammetric ion selective electrodes (VISE) to measure ion activity in complex solutions has been explored. 7,7,8,8-tetracyanoquinodimethane (TCNQ) and tetrathiafulvalene (TTF) microcrystals adhered to an electrode surface act as a low selectivity voltammetric ion sensor. Resistance drop effects and pH artifacts were minimised by the addition of an "innocent" supporting electrolyte (buffer) to the analyte solution. In this format, addition of an ionophore to improve selectivity resulted in a reduction in current magnitude, due to competition for the ion. In contrast, voltammetry of a thin film containing a redox active species, electrolyte, ionophore and membrane solvent provides a highly selective ion sensor. Choice of ionophore was shown to affect the upper concentration detection limit. Use of ionic liquids as a combined membrane solvent and electrolyte was demonstrated. Methods to attach both VISE types to low-cost screen-printed electrodes have been explored. Various potential referencing techniques were also investigated. Both the microcrystal and thin film VISEs could be used to determine ion activity in complex solutions, as demonstrated in seawater, beverages, plasma and whole blood. Dissolved oxygen does not need to be removed, as it does not affect the response. However calibration methods are important for sensor accuracy and issues relating to electrode fouling must be addressed. 2013 The Royal Society of Chemistry. | 1,526 | 814 | 0.001234 |
warc | 201704 | U.S. health care spending growth decelerated in 2008, increasing 4.4 percent compared to 6.0 percent in 2007. Total health expenditures reached $2.3 trillion, which translates to $7,681 per person or 16.2 percent of the nation's Gross Domestic Product. The health spending share of GDP reached 16.2 percent, up from 15.9 percent in 2007. link "Rate of Health Spending Growth Slows" link
Etiquetas: USA health | 413 | 280 | 0.003615 |
warc | 201704 | During the last few years, San Diego County's gotten grief for how it administers CalFresh, California's name for the federal Supplemental Nutrition Assistance Program, formerly known as food stamps. In February, the consulting firm Intelegy, hired to investigate problems with the county's ACCESS call center, which was set up in 2010 to assist folks applying for public benefits, found that callers were waiting more than half an hour for someone to assist them—and those were the callers who got through. In September 2011 alone, Intelegy found, ACCESS dropped 406,000 calls.
After Intelegy's report was released in February, the county, spurred on by its Social Services Advisory Board (SSAB), vowed to overhaul ACCESS. According to a status report given at this month's SSAB meeting, the average ACCESS wait time in August was 22 minutes and 21 seconds—a 15-minute improvement from a year ago. The county added 20 new employees to the call center in June and another 18 in August. The county also added staff to its Family Resource Centers (FRCs), per Intelegy's recommendation—34 in August, with another 39 expected to take their posts before the end of the year.
The SSAB got additional good news from recent surveys of 381 folks at the county's 10 FRCs. The voluntary, anonymous surveys found that nine out of 10 people felt they were treated with respect, six out of 10 were in and out of the FRC in an hour or less and eight out of 10 were satisfied with their experience.
"We see these as a benchmark and an opportunity to improve," Craig Sturak, an analyst with the county's Health and Human Services Agency, told the advisory board.
Streamlining the food-stamps application process and improving the culture at FRCs were two things advocates have been urging the county to do for the last few years. Boosting enrollment numbers has been a focus, too. Reports from state and national advoacy organizations have consistently ranked San Diego County at or near the bottom when it comes to participation rates.
To see where the county currently stands among California's seven largest counties (Los Angeles, Orange, San Diego, Riverside, San Bernardino, Alameda and Santa Clara), CityBeat employed the methodology that California Food Policy Advocates uses for its annual Program Access Index report, which measures food-stamps participation across California. Using the most recent (2011) county-level poverty data, released by the U.S. Census Bureau last week, and each of the seven county's monthly average food-stamps enrollment for 2011, CityBeat found that while San Diego has boosted its enrollment since 2010, the county ranks last among California's seven largest counties. San Bernardino was first, followed by Riverside, Alameda, Los Angeles, Santa Clara and Orange. | 2,810 | 1,419 | 0.000711 |
warc | 201704 | Infrastructure as a Service is one of the three pillars of the cloud computing service model -- along with Software as a Service and Platform as a Service. But how well do you really know IaaS? You may know that IaaS is the delivery of equipment, such as servers and virtual machines, over a network -- but how does it differ across cloud providers? And what do enterprises really think about IaaS adoption? This guide can help you sort through the background on IaaS providers, news and helpful tutorials.
Table of contents: IaaS in the news Google delivers IaaS cloud without Windows supportGoogle's IaaS platform will compete with Windows Azure and AWS, but a major limitation may prevent enterprises from adopting Google Compute Engine. Microsoft to battle Amazon with Azure improvements and servicesMicrosoft will reintroduce Windows Azure next month with a new Web hosting framework and a detailed roadmap for its long-awaited IaaS, sources say. Midsize IaaS cloud providers win SMBs with custom, flexible servicesWhile large IaaS cloud players compete on price, small and midsize providers are developing custom and complementary managed services to conquer the SMB market. Infrastructure as a Service: Not just for the IT directorTwo years ago, this expert predicted that by 2012, all businesses would switch from onsite data centers and colocation to Infrastructure as a Service. Now that the time has come, how on point was his vision? Survey: IT and compliance pros differ on IaaS securityCompliance practitioners are more confident in cloud security than IT pros, study finds. Who's who in IaaS providers The straight dope on Infrastructure as a ServiceIt can be tough to get to the bottom of what IaaS vendors offer and what they're not telling you. Get the hard truth on five players in private cloud. The rise of the non-Amazon IaaS cloud providerAmazon isn’t the only vendor in the IaaS universe. With other large vendors out there and niche providers cropping up, enterprises have choices. Evaluating IaaS providers: Security risksThere are a lot of cloud-based infrastructure services from which to choose, but companies need to weigh the associated risks. Tips and tutorials on IaaS Pros and cons of a non-VM-based IaaS modelBuilding an IaaS cloud without using VMs has some limits. The ability to progress to a mixed-service cloud can help IT teams ignore potential issues. How to build a scalable IaaS cloud network infrastructureAttempts to scale Infrastructure as a Service cloud network infrastructure often involves workarounds, but providers should look to IP-over-IP transport and invest in design. Testing IaaS securityAn experiment using Rackspace illustrates the risks to unsecured IaaS servers and how enterprises can protect themselves. Cloud computing encryption and IaaS securityThough encryption has always been a security tactic for IT, it fell off the radar until cloud computing -- and its security fears -- came along. Learn how to encrypt two types of IaaS storage for data protection. Is OpenStack architecture really the best choice to build IaaS clouds?The OpenStack architecture could alter the relationship between cloud computing and the network, but is it over-hyped? That is a critical question that’s difficult to answer. Considerations for building an efficient private cloudThe key to an agile private cloud is to choose an IaaS vendor that's compatible with existing infrastructures and future cloud software use. Infrastructure as a Service: How to maintain controlBuying Infrastructure as a Service is a mouth-watering prospect for CIOs and IT departments eager to drive down costs and speed up provisioning. But once IT is outsourced, keeping control of it can be a major challenge. The most important threat facing an IaaS cloud serviceCan you protect your IT environment against the number one threat to Infrastructure as a Service? First you have to learn what it is. Remote management threatens Infrastructure as a Service securitySecure an Infrastructure as a Service (IaaS) offering by mitigating poor credentials, implementation flaws and other threats that affect remote management solutions. IaaS security puts spotlight on hypervisor security, tenant managementThe adoption of the virtualized environment is driving the rise of IaaS. And virtualization security is at the core of IaaS security. | 4,372 | 2,037 | 0.000492 |
warc | 201704 | The vast selection of preconfigured resources in the public cloud can lead to what some call a Paradox of Choice:...
By submitting your personal information, you agree that TechTarget and its partners may contact you regarding relevant content, products and special offers.
the greater the assortment, the harder it is to choose.
And making the wrong decision can have significant consequences, such as poor performance or excessive bills.
Like other public cloud providers, Google Cloud Platform offers a range of instance types from which users can choose, in addition to custom machine types. Here are some guidelines to choose the best Google cloud instance types for your workloads.
Workload resource requirements and standard machine types
Much like sizing physical servers to a particular application, there are three degrees of freedom when selecting a Google cloud virtual instance: CPU, memory and local storage performance. Since requirements for compute and memory are typically correlated, Google, like Amazon Web Services (AWS) and Azure, preconfigures instances with fixed ratios of RAM to virtual CPU (vCPU). However, because some workloads demand more CPU cycles or memory, there are three families of Google cloud instance types:
Standard machine types-- have 3.75 GB of memory for every vCPU High-memory machine types --have 6.5 GB of memory per vCPU High-CPU machine types-- have 0.9 GB of memory per vCPU
Google also offers shared-core machines
Standard machines are available in 1 to 32 vCPUs in powers of two -- for example, 2, 4, 8, 16 and so on -- while high-memory and high-CPU types start with 2 vCPUs. What Google terms n1 vCPUs are a synthetic standard that corresponds to a single core hyper-thread on a 2.6 GHz Intel Xeon E5 (Sandy Bridge), 2.5 GHz Intel Xeon E5 v2 (Ivy Bridge), 2.3 GHz Intel Xeon E5 v3 (Haswell) or 2.2 GHz Intel Xeon E5 v4 (Broadwell).
The single core performance of a Broadwell E5 is about 20% to 25% higher than that of the first-generation Sandy Bridge, while the frequency ratio used by Google is 1.18:1, so Broadwell vCPUs should be slightly faster for most workloads. However, users can't directly choose CPU implementation when configuring instances, since Google uses different systems in different zones. For example, Google upgraded the Western U.S. zone to the latest v4 Broadwell processors, while the Central U.S. uses a mixture of first-, second- and third-generation CPUs.
Users must understand application requirements before selecting Google cloud instance types. The standard machines will be best for most workloads, while shared, burstable instances are useful for small, lightweight or background applications. Choosing the right mix of vCPUs and memory is problematic without application profiling, but Google offers a recommendation engine, based on Stackdriver, that collects system metrics to generate sizing guidance.
Recommendations are based on the prior eight days of data using the following principles:
Instances with low CPU utilization most of the time should use fewer vCPUs and those with high utilization should use more vCPUs. Instances that don't use a large fraction of available memory should choose a machine with less memory, and those with consistently high memory usage should use a configuration with more memory. Google custom machines and local storage
Google also supports custom instance types in case one of its standard configurations doesn't fit for a particular workload. Custom instances can be from 1 to 32 vCPUs -- in even numbers -- with a memory ratio between 0.9 and 6.5 GB per vCPU in 0.25 GB increments.
Google GPU instances
Google won't offer instances with GPUs until early 2017, so organizations doing virtual desktop infrastructure or DIY machine learning must use AWS or Azure for now. Still, it may be worth the wait since Google will offer the latest NVIDIA Pascal (P100) and Kepler (K80) accelerators.
Google cloud instance types also support persistent block storage, using either hard-drive disks (HDDs) or solid-state drives (SSDs). Either type can be up to 64 TB and instances can assign 16 disks with a single core up to 128 disks with 8 or more cores. Disk performance scales with size, but SSDs provide about eight times more read, 67% more write IOPS and between 50% and 100% more read and write throughput per instance than HDDs.
In general, transactional workloads with many small reads and writes will benefit from SSDs, while applications like content delivery and rich media software should stick with HDDs. Google automatically manages persistent storage, but also supports locally attached, user-managed iSCSI or NVMe SSDs that provide even more performance.
Recommendations
With a variety of standard Google cloud instance types, and the ability to customize CPU, memory and local storage, users have a lot of options. In general, stick with one of the preconfigured instance types and use Google's automated recommendations to tweak sizing. Think twice about using custom machine types until you have production experience and performance data that shows the need for a non-standard CPU-memory combination.
Although custom machines can save money if you need a configuration between two of the predefined types, Google bills for them hourly, based on the number of vCPUs and memory hours used, rather than in one-minute increments like it does for standard types.
Next Steps
Take another look at Google Cloud Platform
What Azure instance types are right for your workloads?
Move workloads between Google Compute Engine instances | 5,592 | 2,518 | 0.000399 |
warc | 201704 | Markets are behaving in odd ways these days, with bond and equity prices elevated and foreign bond yields moving below US yields in countries which are not nearly as safe for capital. Granted, we have seen a flock to safety with recent geopolitical events but it is a bit troubling with the way the rate environment has played out. We continue to watch the US Dollar Index, even though it failed to move through the 82.75 level and towards 83 and there is more on that in the Chart of the Day section.
While talks between Ukraine and Russia continue we would expect little in regards to rhetoric from the West, but if those talks end with little to nothing accomplished paired with a Russian offensive into Ukraine's southeastern territory then we would not be surprised for the West to find this an unacceptable result. If this is how talks are to end, then expect the West to increase sanctions and potentially begin to saber rattle under the banner of NATO. Russia has shown that they are not afraid to butt heads with major players on an individual basis, however when NATO is on the other side of negotiations Russia gets a bit squirrelly and is usually more open to diplomatic overtures. This will be something to watch over the next week.
Chart of the Day:
We are watching the US Dollar Index intently as it might be set to consolidate recent gains before heading higher. A move higher creates a more difficult environment for commodity producers, but it also shows the relative strength in the US economy versus others. One can only hope for a 'Goldilocks scenario'; a scenario where the rise in the dollar does not outpace the economic gains made.
Source: BigCharts
Commodity prices are as follows (at time of submission):
Gold: $1,290.90/ounce, up by $7.50/ounce Silver: $19.545/ounce, up by $0.14/ounce Oil: $94.50/barrel, up by $0.62/barrel RBOB Gas: $2.7548/gallon, up by $0.0089/gallon Natural Gas: $4.024/MMbtu, up by $0.021/MMbtu Copper: $3.1255/pound, down by $0.0525/pound Platinum: $1,427.80/ounce, up by $7.90/ounce Momentum In Energy Stocks
Yesterday we had a friend ask us what happened to all of the momentum in the energy sector, going on to state that they thought that the market was rotating out of energy stocks and that one might have to wait before the market delivered fresh 52-week highs for names in the sector. The friend is not too far off base with the recent performance of energy stocks, however it is rare that everyone is a loser in the market. We pointed out to this individual that they needed to look no further than two names with energy exposure; US Silica Holdings (NYSE:SLCA) and Cheniere Energy (NYSEMKT:LNG).
Both of those companies' shares were hitting fresh 52-week highs yesterday, and actually hit new highs again today in early trading. While energy prices have been falling as supplies continue to pile up in North America, the shale boom has continued to require vast amounts of sand from US Silica and their competitors. In fact, if one looks at the other companies that supply sand for fracking, both of those companies are also doing well. Emerge Energy Services, LP (NYSE:EMES) hit fresh 52-week highs this morning and Hi-Crush Partners, LP (NYSE:HCLP) is not that far from its yearly highs.
Sometimes one has to venture outside of the obvious options for their portfolio and the current market requires this for energy stocks.
A Falling Hawk?
In another conversation we had yesterday we were asked about how we were treating Halcon Resources (NYSE:HK) which has corrected significantly after seeing a sharp rise in the price of its shares from March to July. The simple answer is that we are still long, attributing much of the recent weakness to the market and profit taking after a strong quarter where the only thing investors could complain about was exploration efforts in the Tuscaloosa Marine Shale, or TMS.
From a short-term perspective we would not be concerned about Halcon so long as it can remain above the $5.50/share level. If it breaks below that level and heads to $5/share, then we would start to worry. Readers need to remember that this is still an event driven stock and should take a long-term view when buying shares. Source: Yahoo Finance
Sticking with Goodrich Petroleum (GDP) paid off for investors as that company finally cracked the TMS geology and have had success in placing wells while also driving down the cost per well in the process. The same shall happen with Halcon Resources, a company which has experience developing plays and has a team with experience successfully developing projects in different types of rock. Long-term we are still bullish and think that if the company can show success in the TMS in the next quarter or two that the shares could approach $10/share.
Disclosure: The author is long HK.
The author wrote this article themselves, and it expresses their own opinions. The author is not receiving compensation for it (other than from Seeking Alpha). The author has no business relationship with any company whose stock is mentioned in this article. | 5,082 | 2,539 | 0.000395 |
warc | 201704 | There are many ways to lose your money on Wall Street, and one of the easiest ways is Internet content.
Many are beguiled by the quality content offered by the New York Times (NYSE:NYT) and figure that, with their new paywall, the money might start rolling in. The Times' stock has been a dog for years, but is now the time to buy?
Others are intrigued by the low-cost production of AOL and figure they must know something. This stock, too, has been a notorious market laggard -- does their purchase of the Huffington Post make them a better investment?
No on both counts.
A much better buy in the space is IAC/InterActive Corp. (IACI) and here is why.
It has to do with understanding what journalism is, whether it's online or offline. Journalism is the making of a market.
Journalism means organizing and advocating a place, industry or lifestyle. The first matters more than the second. Organizing means knowing the buyers, knowing the sellers, then making certain both sides of the transaction see you as the place where they can get together.
If you're not making a market, you're not in the publishing business. IACI understands this.
Look at their sites. Servicemagic looks more like a Yellow Pages directory than an editorial site, but it is performing the service every editorial site must take as its primary mission. It brings buyers and sellers together, and tracks their satisfaction. The same can be said of Pronto, its comparison shopping site.
Or take a look at College Humor's sites. You wouldn't think college kids buy much stuff, and they don't. But they do buy t-shirts, and one of their sites sells them. IACI makes a market and fulfills it as well.
Notice that other CH sites are focused on markets – like video games. And rather than just sell ads, notice that still other CH sites are focused on sponsorships – getting one brand in front of the selected audience. Right now that's Cheetos at SportsPickle, Time Warner's (NYSE:TWX) TNT at College Humor.
It's all about putting buyers and sellers together – know the audience, know what they like, sell that to them, and you create a market.
Parts of AOL know this. They know who their brand works for. Women, aged 25 to 45, are their target audience. Everything else they own avoids the AOL brand because that brand is poison to, say, tech geeks.
You thought this was about advertising? It's never about advertising. No one wants to buy advertising. Advertising is an expense, a piece of your marketing budget, which is all aimed at identifying your buyers, dragging them down the sales funnel, and getting them to sign on the line that is dotted. To the degree an outlet helps you find and sell for you, it has value. Beyond that, meh.
Which brings me to the Times, the dumbest company in America. Lots of great writers and photographers work for it, but management not only doesn't know who it's selling to, its paywall deliberately drives those buyers away.
This is not a blanket condemnation. Paywalls can make sense. Once you have defined your industry or lifestyle, once you have the high-value buyers reading you every day, then feel free to put up paywalls to keep out the riffraff. People who won't buy what your advertisers are selling are wasted circulation. Paywalls (and registration walls) reduce wasted circulation, but only if the right people are already reading you.
The Times, unfortunately, can't assure any seller that they have the buyers they're looking for – as they could do when their paper product had X number of readers in Bensonhurst, which you could prove with circulation addresses and newsstand sales at specific shops.
The Times could be defining a psychographic – upscale, educated Americans. For it to interest advertisers, it must draw a substantial portion of such people into its site, and it must know all about those people, so it can help advertisers sell to them, and so it can get the right advertisers.
Saying, “We work hard and you should pay me” drives out the buyers. If you have no buyers, sellers won't be interested in paying premium rates for space on your site. If you're not making a market for sellers you're not a publisher.
Disclosure: I have no positions in any stocks mentioned, and no plans to initiate any positions within the next 72 hours. | 4,331 | 2,103 | 0.000482 |
warc | 201704 | With the volatility of the stock market last year, smart investors turned to dividend strategies, targeting a sweet spot of reliable income and share price gains. In this class, you will learn the different types of dividends that are available and how companies pay them. We’ll discuss how investment professionals identify the potential winners — companies that are likely to initiate or increase dividends, and we’ll assess the pros and cons of different ways to invest in dividend-paying stocks, including individual companies, mutual funds, and Exchange Traded Funds (ETFs). No prior experience necessary.
Presenter: Janet L. Campbell, CFP/CFA | 666 | 411 | 0.002501 |
warc | 201704 | DELLAPORTAS, Steven and HASSALL, Trevor (2013). Experiential learning in accounting education : a prison visit.
The British Accounting Review, 45 (1), 24-36. Abstract
Traditional pedagogic methods in accounting education have been the subject of some criticism with potential solutions referring to out of classroom experiences. This paper relies on the concepts of situated and experiential learning to assess the effects of a learning opportunity involving visits to prison by students enrolled in the final year of an accounting degree program. Data collected from a self-designed survey suggest that the students were intellectually and emotionally engaged in the experience emanating from the novelty and anticipation of entering closed walls and meeting inmates who were former professional accountants. Students appeared to learn a number of lessons including the nature of conflicts faced by professional accountants, factors contributing to fraudulent conduct, and strategies on how they might deal with such conflicts in their professional careers.
Item Type: Article Research Institute, Centre or Group: Sheffield Business School Research Institute > People, Work and Organisation Identification Number: 10.1016/j.bar.2012.12.005 Depositing User: Claire Bennehan Date Deposited: 30 Apr 2013 09:44 Last Modified: 07 Dec 2016 14:30 URI: http://shura.shu.ac.uk/id/eprint/6969 Actions (login required)
View Item Downloads
Downloads per month over past year | 1,470 | 859 | 0.00117 |
warc | 201704 | Inhibiting miRNA in Caenorhabditis elegans using a potent and selective antisense reagent 1:9 DOI: 10.1186/1758-907X-1-9
© Zheng et al; licensee BioMed Central Ltd. 2010
Received: 18 July 2009 Accepted: 1 April 2010 Published: 1 April 2010 Abstract Background
Antisense reagents can serve as efficient and versatile tools for studying gene function by inhibiting nucleic acids
in vivo. Antisense reagents have particular utility for the experimental manipulation of the activity of microRNAs (miRNAs), which are involved in the regulation of diverse developmental and physiological pathways in animals. Even in traditional genetic systems, such as the nematode Caenorhabditis elegans, antisense reagents can provide experimental strategies complementary to mutational approaches. Presently no antisense reagents are available for inhibiting miRNAs in the nematode C. elegans. Results
We have developed a new class of fluorescently labelled antisense reagents to inhibit miRNAs in developing worms. These reagents were synthesized by conjugating dextran with 2'-O-methyl oligoribonucleotide. The dextran-conjugated antisense reagents can be conveniently introduced into the germline of adult hermaphrodites and are transmitted to their progeny, where they efficiently and specifically inhibit a targeted miRNA in different tissues, including the hypodermis, the vulva and the nervous system. We show that these reagents can be used combinatorially to inhibit more than one miRNA in the same animal.
Conclusion
This class of antisense reagents represents a new addition to the toolkit for studying miRNA in
C. elegans. Combined with numerous mutants or reporter stains available, these reagents should provide a convenient approach to examine genetic interactions that involve miRNA, and may facilitate studying functions of miRNAs, especially ones whose deletion strains are difficult to generate.
See related research article: http://jbiol.com/content/9/3/20
Background
MicroRNAs (miRNAs) are single strand RNA molecules ~ 21-23 nucleotides long that play important roles in many biological processes through regulating gene expression [1]. In animal cells, miRNAs act primarily by inhibiting mRNA translation and/or stability through a process involving partial complementary base-pairing with sequences at the 3'-untranslated region (3' UTR). Numerous miRNAs have been identified. To study their functions, antisense reagents against miRNAs have been developed as a reverse genetics tool. Synthetic oligonucleotide analogues, including 2'-O-methyl oligoribonucleotides [2], locked nucleic acids [3], 2'-O-methoxyethyl oligoribonucleotides [4], and morpholinos [5], have been tested. These antisense nucleotide analogues have been used to knock down miRNAs in cultured cells [2–4] and in live animals including zebrafish [5],
D. melanogaster [6] and mice [7]. Caenorhabditis elegans has long been used as a model organism for studying the regulation and function of small non-coding RNA molecules, and yet no antisense reagents are available to reliably inhibit miRNAs in worms. Such a technique would be very useful for studying functions of miRNAs whose deletion strains are difficult to generate; for example, mutations causing lethality or sterility [8]. In addition, to dissect functions of individual miRNAs that are clustered together, or to block intronic miRNAs [8, 9] without perturbing the function of the corresponding protein-coding genes, antisense reagents would offer a convenient approach to circumvent the limitation of using deletion strains. Results and discussion et al.showed that antisense 2'-O-methyl oligoribonucleotide injected into C. eleganslarvae could inhibit functions of a miRNA [2]. However, injection of worm larvae is technically very demanding, and so the larval injection of anti-microRNA oligonucleotides has not been employed for C. elegansexcept the original report [2]. A much more straightforward approach would be to inject the antisense compound into the syncitial gonad of hermaphrodites using the standard injection methods employed for the DNA transformation of C. elegans[10] so that the reagent would inhibit a targeted microRNA during the embryonic and larval development of the injected hermaphrodite's progeny. A previous attempt at this approach using 2'-O-methyl oligoribonucleotides failed to produce the expected phenotype [2]. We suspect that the cellular uptake, retention or distribution properties of unconjugated 2'-O-methyl oligoribonucleotides might not be optimal for an efficient inhibition of miRNA in worms. To develop a robust antisense technique to inhibit miRNAs in C. elegans, we explored modifying 2'-O-methyl oligoribonucleotides through conjugation with dextran, a polysaccharide that is nontoxic, inert and soluble in aqueous solutions. Dextrans are well retained in cells over a long period of time and dextran-dye conjugates have been widely used for cell labelling and cell lineage tracing [11]. To conjugate dextran with 2'-O-methyl oligoribonucleotides, we first reacted dextran amines (molecular weight 40 KDa, ~ 8 amines/dextran) with a water-soluble bifunctional linker, MAL-dPEG4-NHS ester in order to produce dextran- [(PEG) 4-MAL] 8(Figure 1a). This thiol-reactive intermediate was then conjugated with eight equivalents of antisense 2'-O-methyl oligoribonucleotides containing a 5'-thiol group. The resulting product, dextran-( as-2'OMe lin-4) 8, or D-( as-2'OMe lin-4) 8, contains, on average, eight copies of 2'-O-methyl oligoribonucleotides complementary to lin-4, the founding miRNA first identified in C. elegans[12, 13].
To apply dextran-(
as-2'OMe lin-4) 8 to inhibit lin-4 in vivo, we injected the compound into gonads of adult hermaphrodites. Dextran-rhodamine (40 KDa) was coinjected as a fluorescent marker. About 16 h after injection, we collected rhodamine-labeled embryos ( n = 50) under a fluorescence dissection scope. When these embryos reached adulthood, we scored for the egg laying defective (Egl) phenotype. In C. elegans, lin-4 is required during larval development to control the timing and pattern of cell division in the hypodermis of larva stage 1 (L1) and stage 2 (L2). lin-4 loss of function mutants ( lin-4( lf)) display inappropriate reiterations of early fates at late developmental stages and show a retarded heterochronic phenotype in adults in the form of the absence of adult structures (such as vulva) and the failure of egg-laying [12, 13].
When using an injection with a concentration of 50 μM (all concentrations refer to the total concentration of 2'-O-methyl oligoribonucleotides in the sample as determined from the ultraviolet (UV) absorption at 260 nm) dextran-(
as-2'OMe lin-4) 8 was effective in inhibiting lin-4 and caused Egl in about 70% of worms (Figure 1b-d). Raising the injection concentration to 100 μM or above increased Egl to over 90% in the labelled worms. In contrast, antisense 2'-O-methyl oligoribonucleotides that is not conjugated to dextran only had a small effect, even at 200 μM (Figure 1b). In order to examine the specificity of dextran-( as-2'OMe lin-4) 8 in inhibiting lin-4, we prepared two control dextran conjugates, dextran-( as-2'OMe miR-237) 8 and dextran-( s-2'OMe lin-4) 8. Dextran-( as-2'OMe miR-237) 8 contains 2'-O-methyl oligoribonucleotides complementary to miR-237, a miRNA of the lin-4 family with similar, but not identical, sequence as lin-4. Dextran-( s-2'OMe lin-4) 8 contains lin-4 sequence (sense). We did not observe Egl phenotypes, or other abnormalities, in worms labelled with either of these two control oligonucleotides (Figure 1b) which confirmed that dextran-( as-2'OMe lin-4) 8 inhibits lin-4 in a sequence specific manner, also suggesting that worms tolerate dextran conjugates of 2'-O-methyl oligoribonucleotides fairly well. as-2'OMe lin-4) 8, each dextran molecule is conjugated to eight copies of antisense 2'-O-methyl oligoribonucleotides. Having a high density of oligonucleotides on the surface of dextran molecule might increase the steric hindrance and compromise the hybridization efficiency of the antisense oligonucleotide to its target miRNA. In order to test whether we could improve the potency of these dextran conjugated antisense reagents by varying the coupling stoichiometry, we decreased the amount of 2'-O-methyl oligoribonucleotides used for conjugation. In addition, we also linked a fluorescent label (rhodamine B isothiocyanate) with dextran so that we could visualize the distribution of these antisense reagents directly. We prepared two rhodamine-dextran ( Rhdextran) conjugates of 2'-O-methyl oligoribonucleotides, Rhdextran-( as-2'OMe lin-4) 4and Rhdextran-( as-2'OMe lin-4) 1, by varying the equivalents of 2'-O-methyl oligoribonucleotides added to the conjugation reaction (Figure 2). Each Rhdextran-( as-2'OMe lin-4) 4or Rhdextran-( as-2'OMe lin-4) 1on average contains four or one copy of lin-4antisense 2'-O-methyl oligoribonucleotide, respectively (Figures 2 and 3a). These two dextran conjugates were comparably efficient in inhibiting lin-4, yet both were much more potent than dextran-( as-2'OMe lin-4) 8. At 20 μM or above, both Rhdextran-( as-2'OMe lin-4) 4and Rhdextran-( as-2'OMe lin-4) 1caused Egl in nearly 100% of labelled worms (Figure 3b). In contrast, dextran-( as-2'OMe lin-4) 8was completely ineffective at 20 μM. In addition, fluorescence imaging of Rhdextran-( as-2'OMe lin-4) 1confirmed that the conjugate was localized fairly evenly in the cytosol after being taken up by cells.
In order to confirm that these antisense reagents act specifically by inhibiting
lin-4, we examined several molecular and cellular markers to characterize the development of animals labelled with Rhdextran-( as-2'OMe lin-4) 1: (1) the formation of vulval structure; (2) adult specific alae formation and col-19 expression; and (3) the stage-specific seam cell division programmes. lin-4(lf)was due to inappropriate vulva development. In control animals, vulva morphogenesis is evident by early L4. By mid-L4 stage, the developing vulva displays a characteristic structure reminiscent of a Christmas tree (Figure 4a). In contrast, the vulva structure was missing in a lin-4(0) mutant, lin-4(e912)(Figure 4b). Wild type animals labelled with Rhdextran-( as-2'OMe lin-4) 1showed the similar vulvaless anatomy as lin-4(e912)(Figure 4c), consistent with lin-4inhibition by Rhdextran-( as-2'OMe lin-4) 1. lin-4also controls stage-specific lateral hypodermal cell fates. At the L4 molt, lateral seam cells exit cell cycle and form alae. At about the same time, hypodermal cells start to express an adult specific green fluorescence protein (GFP) reporter, col-19::GFP (Figure 5a, b) [14, 15]. Animals labelled with Rhdextran-( as-2'OMe lin-4) 1(50 μM injection concentration) failed to form alae at the L4 molt (100%, n= 20) and showed no col-19::GFP expression (100%, n= 56; Figure 5c, d). Interestingly, 10 h later, both col-19::GFP (100%, n= 56) and alae (100%, n= 19) were observed in these animals (Figure 5e, f). Increasing the dose of Rhdextran-( as-2'OMe lin-4) 1(150 μM injection concentration) prolongs the duration of lin-4inhibition, such that at 10 h post-L4 molt, only 1.8% of labelled worms showed col19::GFP ( n= 55); about 60% of these animals displayed col19::GFP 15 h later (or 25 h post-L4 molt). These results suggest that lin-4knockdown with Rhdextran-( as-2'OMe lin-4) 1caused these animals to go through extra larval stages (L5 and L6) before they entered adult. This is consistent with a reduction in (but not complete elimination of) lin-4function. lin-4(e912)animals repeat the L1 fates in hypodermal cell lineages and are unable to exit the cell cycle at the L4 molt. In order to determine how seam cell development is altered in lin-4knockdown animals, we followed the seam cell division pattern by observing GFP-labelled seam cells (wIs51, strain JR667). Both L1 and L2 divisions in lin-4knockdown appeared to be normal, with each V cell (including V1 - V4 and V6) divided once in L1 (100%, n= 10, data not shown) and twice in L2 (100%, n= 10; Figure 6b, c). However, in early L3, V cells in lin-4knockdown repeated the L2 division pattern, so that each V cell gave rise to twice as many daughter cells as the corresponding seam cells of the control animals (100%, n= 6; Figure 6d, e). This pattern of reiterated L2 seam cell division is consistent with a reduced, but not absent, activity of lin-4, possibly resulting in an intermediate level of lin-14over expression [17].
Finally, since
lin-4 functions through lin-14, mutations in lin-14 should suppress the phenotype of lin-4 knockdown. Indeed, at 20°C, inhibition of lin-4 in lin-14(n179), a lin-14 nonnull mutant, with Rhdextran-( as-2'OMe lin-4) 1 (50 μM injection concentration) only caused Egl in 2.6% of labelled worms ( n = 190) and all the examined young adult worms displayed normal alae ( n = 30).
Together, these data showed that
Rhdextran-( as-2'OMe lin-4) 1 caused developmental retardation consistent with lin-4 knockdown, confirming its efficacy and specificity in inhibiting lin-4 during development.
In order to test whether these conjugated antisense agents can be used to inhibit other miRNAs in worms, we prepared
Rhdextran-( as-2'OMe lsy-6) 1 and Rhdextran-( as-2'OMe let-7) 1 using the same procedure as for making Rhdextran-( as-2'OMe lin-4) 1. These two dextran conjugates were designed to block lsy-6 and let-7, respectively, two miRNAs of known functions in C. elegans. lsy-6microRNA regulates left-right asymmetry of ASE neurons, a pair of chemosensory neurons that share many bilaterally symmetrical features, yet differ in their ability to discriminate different ions by expressing distinct sets of chemoreceptors of the gcygene family [18]. lsy-6is only present in ASEL (left ASE) of adult worms. It promotes gcy-7expression through repression of cog-1, a transcription factor that negatively regulates gcy-7expression [18]. In order to score the inhibition of lsy-6activity, we used two reporter strains expressing GFP in either ASEL ( gcy-7 prom ::gfp, strain OH3191) or ASER (right ASE; gcy-5 prom ::gfp, strain OH3192). Rhdextran-( as-2'OMe lsy-6) 1was highly effective in inhibiting lsy-6. At the injection concentration of only 3 μM, the compound inhibited lsy-6with nearly 100% penetrance, assayed by the repression of gcy-7 prom ::gfpexpression in ASEL (Figure 7a), and by the induction of ectopic gcy-5 prom ::gfpexpression in ASEL (Figure 7b). let-7, controls the larval-to-adult transition by repressing the translation of lin-41and hbl-1. Mutations in let-7lead to a retarded terminal differentiation of seam cells, which results in the elimination of alae and a bursting of the animal at the vulva as the animal undergoes the fourth molt [19]. We observed a dose-dependent bursting or no-alae phenotype, consistent with inhibition of let- 7activity in the progeny of hermaphrodites injected with Rhdextran-( as-2'OMe let-7) 1(Figure 8). When Rhdextran-( as-2'OMe let-7) 1was injected at 20 μM, it caused bursting vulva in about 40% of labelled worms and eliminated the formation of alae in nearly 80% of worms. Raising the concentration of Rhdextran-( as-2'OMe let-7) 1to 50 μM or above increased the penetrance, and none of the labelled animals showed alae when they reached young adults. In contrast, an injection of Rhdextran-( as-2'OMe mir-84) 1directed against another let-7family microRNA caused no observable phenotype. Since mir-84mutations do not cause visible phenotypes [20], this result is consistent with these antisense reagents inhibiting the targeted miRNA with high specificity. Further, in a lin-41nonnull mutant, lin-41(ma104), Rhdextran-( as-2'OMe let-7) 1(50 μM) failed to produce the bursting vulva or alae defect in labelled worms ( n= 12). This again suggested that these antisense reagents acted specifically by blocking their corresponding microRNAs. Rhdextran-( as-2'OMe mir-42) 1against mir-42, a member of the mir-35family which consists of eight microRNA genes of similar sequences. This family of microRNAs is expressed only during embryogenesis [21] and functions redundantly to control embryonic development [8, 22]. Deletion of the seven microRNAs ( mir35 - 41, strain MT14119) leads to a temperature-sensitive late embryonic or L1 lethal phenotype. At 15°C, about 10% of the embryos displayed this phenotype, while the remaining 90% developed normally (Figure 9). In this mir35-41null background, inhibition of mir-42with Rhdextran-( as-2'OMe mir-42) 1dramatically increased embryonic or L1 lethality: at the injection concentration of 3 μM, 77% of labelled worms were embryonic or L1 lethal. In contrast, inhibition of mir-42had little effect in N2 strain (Figure 9). lin-4, lsy-6, let-7and mir-42), the dose of antisense reagents required for the effective inhibition of individual miRNA varied from as low as three micromolar ( lsy-6and mir-42) to as high as tens of micromolar ( let-7). Two factors may account for the difference in the apparent potency of these antisense reagents. First, the cellular expression level of different miRNAs varies over a wide range [23], so a higher concentration of antisense reagents is needed to block more abundant miRNAs. Second, to inhibit a miRNA that is expressed late in larval development, it would require a higher concentration of reagent in the zygote to compensate for the dilution effect of cell division and larval growth. let-7, for example, is not expressed until the third larval stage and functions in the fourth stage [19]. By that time, the antisense reagent would be further diluted as animals grow and expand in size. In principle, a higher concentration of antisense reagents can be used to overcome the dilution effect. However, it should be cautioned that, as we raised the dose, we also noticed that an increasing number of embryos failed to hatch at concentrations above 50 μM. The extent to which these antisense reagents affect embryo development seemed to vary. Among the reagents tested, antisense reagents (antimirs) against lin-4and mir-237were best tolerated, with nearly 100% of the embryos hatched normally at 100 μM. By comparison, the antimir against let-7was least tolerated, with close to 40% of embryos hatched at 100 μM (Figure 10). We have not yet explored the causes for this differential effect, although we anticipate that the future development of other bioconjugates employing different classes of oligonucleotides, for example locked nucleic acids or 2'-O-methoxyethyl oligoribonucleotides, may offer an improvement on the potency with concomitant reduction of the perturbation on embryo development. Rhdextran-( as-2'OMe lsy-6) 1and Rhdextran-( as-2'OMe lin-4) 1into gonads of OH3192 strain ( gcy-5 prom ::gfp). Together, these two reagents caused Egl in all labelled worms and they induced ectopic gcy-5 prom ::gfpexpression in ASEL (Figure 11). In contrast, Rhdextran-( as-2'OMe lin-4) 1alone did not alter the expression pattern of gcy-5 prom ::gfp, and Rhdextran-( as-2'OMe lsy-6) 1by itself failed to cause Egl (Figure 11). The results again confirmed the specificity of these dextran-conjugated antisense reagents and suggested that multiple antisense reagents can be used in combination to block more than one miRNAs in C. elegans. As numerous deletion strains of single miRNA genes appear to be grossly normal, it has been suggested that redundancy might mask their functions [8]. Mixing these antisense reagents would allow the study of the combinatorial effects of multiple miRNAs on gene expression and should facilitate screening genetic interactions using mutants or reporter strains. Conclusions
We have developed a new class of antisense reagents that potently and selectively inhibit miRNAs in
C. elegans. This offers an experimental approach complementary to mutational strategy for the study of the functions of miRNA in vivo. Methods General methods
2'-O-methyl oligoribonucleotides were either purchased from the Integrated DNA Technologies (IDT, Iowa, USA) or synthesized in-house by the standard solid phase phosphoramidite chemistry using an ABI 394 DNA/RNA Synthesizer (Applied Biosystems, California, USA). Sequences of 2'-O-methyl oligoribonucleotides used in this study are:
s-2'OMe lin-4 (sense): 5' - UCCCUGAGACCUCAAGUGUGA - 3' as-2'OMe lin-4 (antisense): 5' - UCACACUUGAGGUCUCAGGGA - 3' as-2'OMe miR-237: 5' - AGCUGUUCGAGAAUUCUCAGGGA - 3' as-2'OMe let-7: 5' - AACUAUACAACCUACUACCUCA - 3' as-2'OMe lsy-6: 5' - CGAAAUGCGUCUCAUACAAAA - 3' as-2'OMe miR-84: 5' - UACAACAUUACAUACUACCUCA - 3' as-2'OMe miR-42: 5' - UCUGUAGAUGUUAACCCGGUGA - 3'
For bioconjugation, an
n-hexyl linker containing a disulfide bond (Thio-Modifier C6 S-S, Glen Research, Virginia, USA) was attached to the 5'-end of 2'-O-methyl oligoribonucleotides. A,C,G,U-2'-OMe-RNA CE phosphoramidite monomers and A,C,G,U-2'-OMe RNA synthesis supports were from AZCO Biotech (California, USA). MAL-dPEG 4 ™-NHS ester was from Quanta BioDesign Ltd (Ohio, USA). Dextran amine (40 KD) was purchased from Molecular Probes (Oregon, USA). Other reagents and solvents were from Aldrich (Missouri, USA). The UV and visible absorption spectra were recorded on a Shimadzu 2401 PC spectrometer. Conjugating 2'-O-methyl oligonucleotides with dextran
To prepare
Rhdextran-( as-2'OMe lin-4) 1, for example, dextran amine (40 KD, ~ 8 amines/dextran, 10 mg) was first reacted with Rhodamine B isothiocyanate (RBITC, 0.4 mg, 0.75 μmol) in 0.1 mL anhydrous DMSO at 37°C for 8 h. MAL-dPEG 4-NHS ester (3 mg, 5.84 μmol) was then added and the reaction was continued at room temperature overnight. The reaction mixture was dialyzed against water through a regenerated cellulose membrane (Float A Lyzer ®, molecular wight cut off [MWCO] = 3500, Spectrum Laboratories, Inc. California, USA) to remove excess reagents. After freeze drying, the solid product was dissolved in water (0.25 mL) to make a 1 mM rhodamine-dextran stock solution.
To conjugate 2'-O-methyl oligoribonucleotides containing a 5'-disulfide (5' S-S) group with rhodamine-dextran, we first reduced the 5'-disulfide group to a free thiol using tris(2-carboxyethyl) phosphine (TCEP), a water soluble reducing reagent.
as-2'OMe lin-4 (5' S-S, 30 nmol) was dissolved in 100 μl of deaerated sodium phosphate buffer (100 mM, pH = 7.0). An excess amount of TCEP was added to the solution under the protection of Argon. One hour later, cold ethanol (0.5 mL) was added to precipitate the oligonucleotide. The supernatant was removed after centrifugation (14000 rpm for 10 min) and the precipitated oligonucleotide was redissolved in a sodium phosphate buffer (100 mM, pH 7.0, 70 μL). The oligonucleotide solution was then mixed with the rhodamine-dextran stock solution (30 μL) prepared above. The mixture was stirred under argon overnight. Excess mercaptoethanol was added to cap the remaining unreacted maleimide group. The reaction mixture was dialyzed against water using a cellulose membrane (MWCO = 10,000) and lyophilized to yield the final product. The dried product was re-dissolved in water to prepare a stock solution. The concentration of stock solution was typically in the range of 1 mM which was determined by measuring the UV absorption of 2'-O-methyl oligoribonucleotide at 260 nm. The UV absorption was converted to the oligonucleotide concentration using the OligoAnalyzer program accessible online http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/. Rhodamine absorption at 260 nm was corrected according to its peak absorption at 559 nm. The conjugation yields were typically around 50%. The average stoichiometry of conjugation was calculated from the total amount of oligoribonucleotide in the final product divided by the amount of dextran added to the reaction. RhDextran-( as-2'OMe lin-4) 4, dextran-( as-2'OMe lin-4) 8 and other dextran conjugates containing different sequences of 2'-O-methyl oligonucleotides were synthesized similarly. When preparing RhDextran-( as-2'OMe lin-4) 4, four equivalents of 2'-O-methyl oligonucleotides containing a 5'-disulfide group were used to react with the dextran-linked maleimide group. No Rhodamine B isothiocyanate was used when synthesizing dextran-( as-2'OMe lin-4) 8.
Conjugation products purified by dialysis still contained a small amount of unconjugated oligonucleotides as analyzed by the polyacrylamide gel electrophoresis (PAGE), and were used for most of the experiments except for the ones shown in Figure 8 and Figure 10. To completely remove unconjugated oligonucleotides from dextran-conjugates, the reaction mixture was first concentrated under vacuum to a small volume (≤30 μL) and then mixed with 0.27 mL formamide (>99%, Ambion, Texas, USA). The mixture was boiled briefly and loaded into 5% preparative denaturing polyacrylamide gel. After running the gel at 400 V for 10 min, we confirmed the separation of free 2'-O-methyl oligoribonucleotides from dextran conjugates by viewing the gel over a fluorophore-coated thin-layer chromatography plate (Silica Gel 60, F254, Merck, Germany) under the UV illumination (265 nm). Dextran-conjugated products that remained near the origin of the gel showing red fluorescence were cut out and transferred into a dialysis membrane (MWCO = 1000) containing 2 mL of 0.5× TBE buffer (Bio-Rad, CA, USA). The dialysis membrane was sealed and the product in the gel was recovered by electrophoresis (300 V for 20 min). The TBE buffer in the dialysis membrane containing dextran conjugates was transferred to another cellulose dialysis membrane (MWCO = 10000) and dialyzed against water 3 times over 16 hrs to remove salts and urea. The final products were obtained as a powder after lyophilization.
Worm injection and assay of miRNA inhibition in vivo
Dextran conjugates of 2'-O-methyl oligoribonucleotides were injected into both gonads of young adult worms of either wild-type (N2) or transgenics expressing GFP in an ASE neuron (OH3191 or OH 3192). Rhodamine dextran (40 KD, 8 mg/mL final concentration) was included in the injection solution if the injected reagents contained no fluorescent label, for example, dextran-(
as-2'OMe lin-4) 8 or unconjugated 2'-O-methyl oligoribonucleotides. For each experiment, we routinely injected a sample into ~ eight worms. About 16 h later, we collected rhodamine labelled embryos ( n = 50) laid by injected worms under a fluorescence dissection scope (SteREO Discovery.V12, Carl Zeiss, Göttingen, Germany), and scored their phenotypes when they reached appropriate larval or adult stages. Staging of animal development was based on gonad size and morphology.
We also attempted delivering antisense reagents using a standard soaking method for RNAi ([24]. However, this method turned out to be ineffective. After incubating L1 larvae with
Rhdextran-( as-2'OMe lin-4) 1 (300 μM) or Rhdextran-( as-2'OMe let-7) 1 (300 μM) for 48 h in the soaking solution (M9 solution (0.25 ×, without Mg 2+) with 3 mM spermidine and 0.05% gelatin), we recovered L1 larvae on NGM plates. All the worms developed normally without showing any observable phenotype expected from lin-4 or let-7 knockdown. Abbreviations ASEL:
left ASE
ASER:
right ASE
Egl:
egg laying defective
GFP:
green fluorescence protein
MWCO:
molecular weight cut off
TCEP:
tris(2-carboxyethyl) phosphine
UV:
ultraviolet
3'UTR:
3'-untranslated region.
Declarations Acknowledgements
We thank the Caenorhabditis Genetics Center for providing worm strains and Dr X Wang for providing the microinjection apparatus. We are also grateful to Dr J Liu for help with the microinjection. This project is supported by the grants from the Welch Foundation (I-1510) and the National Institute of Health.
Authors’ Affiliations References Ambros V: The functions of animal microRNAs. Nature. 2004, 431 (7006): 350-355. 10.1038/nature02871.View ArticlePubMedGoogle Scholar Hutvagner G, Simard MJ, Mello CC, Zamore PD: Sequence-specific inhibition of small RNA function. PLoS Biol. 2004, 2 (4): 465-473. 10.1371/journal.pbio.0020098.View ArticleGoogle Scholar Orom UA, Kauppinen S, Lund AH: LNA-modified oligonucleotides mediate specific inhibition of microRNA function. Gene. 2006, 137-141. 10.1016/j.gene.2005.12.031.Google Scholar Esau C, Kang X, Peralta E, Hanson E, Marcusson EG, Ravichandran LV, Sun Y, Koo S, Perera RJ, Jain R, Dean NM, Freier SM, Bennett CF, Lollo B, Griffey R: MicroRNA-143 regulates adipocyte differentiation. J Biol Chem. 2004, 279 (50): 52361-52365. 10.1074/jbc.C400438200.View ArticlePubMedGoogle Scholar Flynt AS, Li N, Thatcher EJ, Solnica-Krezel L, Patton JG: Zebrafish miR-214 modulates Hedgehog signaling to specify muscle cell fate. Nat Genet. 2007, 39 (2): 259-263. 10.1038/ng1953.PubMed CentralView ArticlePubMedGoogle Scholar Boutla A, Delidakis C, Tabler M: Developmental defects by antisense-mediated inactivation of micro-RNAs 2 and 13 in Drosophilaand the identification of putative target genes. Nucleic Acids Res. 2003, 31 (17): 4973-4980. 10.1093/nar/gkg707.PubMed CentralView ArticlePubMedGoogle Scholar Krutzfeldt J, Rajewsky N, Braich R, Rajeev KG, Tuschl T, Manoharan M, Stoffel M: Silencing of microRNAs in vivowith 'antagomirs'. Nature. 2005, 438 (7068): 685-689. 10.1038/nature04303.View ArticlePubMedGoogle Scholar Miska EA, Alvarez-Saavedra E, Abbott AL, Lau NC, Hellman AB, McGonagle SM, Bartel DP, Ambros VR, Horvitz HR: Most Caenorhabditis elegansmicroRNAs are individually not essential for development or viability. PLoS genetics. 2007, 3 (12): 2395-2403. 10.1371/journal.pgen.0030215.View ArticleGoogle Scholar Ying SY, Lin SL: Intronic microRNAs. Biochem Biophys Res Commun. 2005, 326 (3): 515-520. 10.1016/j.bbrc.2004.10.215.View ArticlePubMedGoogle Scholar Mello CC, Kramer JM, Stinchcomb D, Ambros V: Efficient gene transfer in C.elegans:extrachromosomal maintenance and integration of transforming sequences. Embo J. 1991, 10 (12): 3959-3970.PubMed CentralPubMedGoogle Scholar Guo YM, Chen S, Shetty P, Zheng G, Lin R, Li WH: Imaging dynamic cell-cell junctional coupling in vivousing Trojan-LAMP. Nat Methods. 2008, 5 (9): 835-841. 10.1038/nmeth.1238.View ArticlePubMedGoogle Scholar Lee RC, Feinbaum RL, Ambros V: The C. elegansheterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 1993, 75 (5): 843-854. 10.1016/0092-8674(93)90529-Y.View ArticlePubMedGoogle Scholar Wightman B, Ha I, Ruvkun G: Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell. 1993, 75 (5): 855-862. 10.1016/0092-8674(93)90530-4.View ArticlePubMedGoogle Scholar Liu Z, Kirch S, Ambros V: The Caenorhabditis elegansheterochronic gene pathway controls stage-specific transcription of collagen genes. Development. 1995, 121 (8): 2471-2478.PubMedGoogle Scholar Abrahante JE, Miller EA, Rougvie AE: Identification of heterochronic mutants in Caenorhabditis elegans. Temporal misexpression of a collagen::green fluorescent protein fusion gene. Genetics. 1998, 149 (3): 1335-1351.PubMed CentralPubMedGoogle Scholar Rougvie AE: Control of developmental timing in animals. Nature Rev Genet. 2001, 2 (9): 690-701. 10.1038/35088566.View ArticlePubMedGoogle Scholar Ambros V, Horvitz HR: The lin-14 locus of Caenorhabditis eleganscontrols the time of expression of specific postembryonic developmental events. Genes Dev. 1987, 1 (4): 398-414. 10.1101/gad.1.4.398.View ArticlePubMedGoogle Scholar Hobert O: Architecture of a microRNA-controlled gene regulatory network that diversifies neuronal cell fates. Cold Spring Harb Symp Quant Biol. 2006, 71: 181-188. 10.1101/sqb.2006.71.006.View ArticlePubMedGoogle Scholar Reinhart BJ, Slack FJ, Basson M, Pasquinelli AE, Bettinger JC, Rougvie AE, Horvitz HR, Ruvkun G: The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature. 2000, 403 (6772): 901-906. 10.1038/35002607.View ArticlePubMedGoogle Scholar Abbott AL, Alvarez-Saavedra E, Miska EA, Lau NC, Bartel DP, Horvitz HR, Ambros V: The let-7 MicroRNA family members mir-48, mir-84, and mir-241 function together to regulate developmental timing in Caenorhabditis elegans. Dev Cell. 2005, 9 (3): 403-414. 10.1016/j.devcel.2005.07.009.PubMed CentralView ArticlePubMedGoogle Scholar Lau NC, Lim LP, Weinstein EG, Bartel DP: An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science. 2001, 294 (5543): 858-862. 10.1126/science.1065062.View ArticlePubMedGoogle Scholar Alvarez-Saavedra EA, Miska EA, Abbott AL, Lau NC, Bartel DP, Ambros V, Horvitz HR: The mir-35 family of MicroRNAs acts redundantly in embryonic development in C. elegans. International Worm Meeting: abstract 269. 2005Google Scholar Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP: The microRNAs of Caenorhabditis elegans. Genes Dev. 2003, 17 (8): 991-1008. 10.1101/gad.1074403.PubMed CentralView ArticlePubMedGoogle Scholar Timmons L: Delivery methods for RNA interference in C. elegans. Methods Mol Biol. 2006, 351: 119-125.PubMedGoogle Scholar Copyright
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. | 33,642 | 13,013 | 0.000077 |
warc | 201704 | THE MIX-AERATOR Innovation In Pond & Lagoon Aeration & Mixing A unique technology based on spinning motion – and the phenomenon of the VORTEX The VORTEX (A) A vortex can be seen in nature as a whirlpool of liquid – the downward drag and powerful suction of air that naturally occurs. (the simplest demonstration is when you pull the plug in your bath). (B) The vortex can also be in nature as a whirlpool of air (such as twisters or tornadoes) created by the forces of the wind when air pressures combine. In this context, the vortex is undisputedly recognized by the destructive power, momentum and velocities created via the spiralling movement of matter. TWIN VORTEX ADVANTAGE The TWIN VORTEX Technology creates Vortex (A) using the downward and powerful suction of air to naturally aerate and mix. inverts and creates Vortex (B) using the momentum and velocity to naturally mix and disperse. THE TWIN VORTEX ADVANTAGE is therefore: AERATION and MIXING The MIX-AERATOR provides the TVA • How Does the Mix-Aerator Function? • Upper disks create the vortex that draws downwards. The more disks used, the greater the power of the vortex. This vortex also draws downwards any gases, odors or foaming rising from the liquid and mixes them back into the fluid. • Lower disks are the secondary mixing disks which create the bottom vortex to draw upwards. This vortex ensures homogenous, extended mixing patterns that, in the case of gases, create optimum transfer efficiencies or dissolution uptakes. Additional MIX-AERATOR info • Disks are polished smooth for minimal frictional resistance. The strength of laminar flow is determined by the spaces between the disks, tip velocities and speed. It is the kinetic momentum gain of the vortices and the concurrent minimal resistance of the laminar flow that produces both energy and additive optimization efficiencies superior to conventional mixing blades or cyclone/spiral flow competitors. MIX-AERATOR - AERATION Aggressive aeration derived from atmospheric air to oxygenate is created by the MIX-AERATOR head. Air bubbles clearly visible Velocity increases achieved mean a lower energy requirement when compared to normal agitator or compressed air induced aeration. MIX-AERATOR – MIXING Perhaps the simplest and most efficient method of mixing yet available. • The upper disks create the top vortex that draws downwards any gases, odors or foaming rising from the liquid and mixes them back into the fluid. • The lower disks are the secondary mixing disks which create the bottom vortex to draw upwards Where mixing and not aeration or the opposite is the main aim, configurations can be adapted to suit. MIXING or BLENDING (examples) Toxic waste – mixing and aeration causing continual foaming to allow natural UV and sunlight breakdown of toxins. MIX-AERATOR - TREATMENT • Sewage Treatment elimination of odor by recycling to treatment plant. Toxic waste – mixing and aeration causing foaming to allow natural UV and sunlight breakdown of toxins PROVEN BENEFITS Enhanced BOD removal with significant power saving Greater productivity with reduced costs Reduced chemical treatment consumption by up to 50% Reduced retention spans for time required reactions (BOD Removal) Reduced footprint requirements to alternative types of equipment Rapid retro-fit with enormous diversity and flexibility in application Removes odors, foaming and aerosol related problems Improves performance of consumables such as polymers, alkaline salts such as calcium or magnesium hydroxide, caustic or chlorine ASSEMBLY Motor Head and drive assembly Head assembly Frame adapted to suit application APPLICATIONS Significant Ecological Threats That Are Conducive to the MIX-AERATOR TECHNOLOGY •Blue Green Algae eradication •Acid Sulfate water neutralization •Heavy Metal decontamination ( water based) •Sterilization of Waterborne Viruses by oxygenation •Sewage effluent recycling •Contaminated water treatment •Treatment plant chemical & energy usage reduction •Dissolved Air Floatation (DAF) system retrofits Photos • Before aeration ( note: existing aerator operating in the background) • Golf Course lagoon After MIX-AERATOR aeration Photos • Mix-Aerator in waste water treatment plant. • Before top LHS (1) and after top RHS (2) shots after 20 minute treatment. • Notice the Mix-Aerator drawing in the algae and accumulated fog from the corners of the lagoon. 1 2 3 Photos - aggressive Vortex Photos & Configerations • Trade waste (left) following aeration and settling (right). (two thirds of the original waste is now recycled) Mix-Aerator • Floating Mix-Aerator Pontoon Configured. | 4,751 | 2,160 | 0.000477 |
warc | 201704 | CITYWIDE – Big Blue Bus accidents are down in Santa Monica this fiscal year, according to Edwards King, director of Transit Services for City Hall.
In the 2011-12 fiscal year, BBB recorded an average of 12.7 accidents, and nearly two preventable accidents, for every 100,000 miles driven.
From July 1 of last year through the end of March, that rate is down to 9.31 accidents per 100,000 miles, a 20 percent decline in total accidents.
Preventable accidents are down since fiscal year 2011-12 but up slightly from last fiscal year. The preventable accident rate was 1.51 per 100,000 in 2012-13 and 1.6 so far this fiscal year.
“These numbers are more consistent with the industry norm,” King said.
According to a 2013 report from the Los Angeles County Metropolitan Transportation Authority, Metro buses averaged 3.62 accidents per 100,000 miles in 2012. There was no available rate for preventable accidents. Metro’s highest rates were on the Westside, averaging 4.31 crashes per 100,000 miles – the increase resulting partially from the area’s traffic congestion.
There were 666 BBB accidents last fiscal year, 80 of which were deemed preventable.
BBB spokesperson Suja Lowenthal said that the rate is higher than they’d like but only because they have an impossible goal: zero crashes.
“There are so many factors that can contribute to an accident,” she said “We’re really proud of our (drivers) and the decrease in the number of accidents really shows were headed in the right direction.”
Before the start of the 2011 fiscal year, the data that BBB kept “did not accurately reflect the overall safety record,” King said in a report, “and additionally, reporting inconsistencies required the re-creation of many reports.”
BBB was also lacking a specific safety program that is required by the Federal Transit Administration.
“As such, industry best practices were not codified in a safety plan or training program to be deployed or followed by the department,” King said. “Although basic required training was provided to (drivers) and new students, there was minimal, if any, accident re-training, coaching and counseling of (drivers) post-accident and accidents were not thoroughly investigated.”
Over the last two years, BBB has been reviewing accident data to determine if any patterns emerge – be it the route, time of day, or driver’s behavior.
In November, BBB hired a new safety training manager, Ray Lopez, with more than 20 years of experience. BBB now has quarterly maintenance safety meetings and annual driver training programs. BBB officials developed a new process for hiring drivers.
BBB officials say the drop in the overall accident rate is a result of these changes. They also claim there’s been a reduction the number of claims and injury payouts by BBB.
In November, BBB officials told the Daily Press there’d been 12 BBB accident-related lawsuits filed against City Hall in the past year. There had also been six lawsuits from riders falling on the bus, unrelated to accidents.
Since November, City Hall has paid out more than $1 million in settlements related to bus accidents. In one case, settled in March, a bus accident left two people seriously injured. City Hall paid $800,000 to settle that case.
In another case, City Hall paid $150,000 to a cyclist who was struck by a bus.
The family of Patrick O’Dell, who was riding on Sunset Boulevard in 2012 when he was struck and killed by a Route 9 bus, filed a lawsuit against City Hall last year. | 3,619 | 1,708 | 0.00061 |
warc | 201704 | Root Hair Systems Biology
This project uses functional genomics to investigate the impact of biotic and abiotic stress on legume root hairs, a single cell model for systems biology. Our vision is to utilize the soybean root hair system to explore, at a systems level, the biology of a single, differentiated plant cell type
There are two main focuses:
To understand the molecular processes involved in legume root hair infection by nitrogen-fixing rhizobia. This infection initiates the symbiosis between this bacterium and its host that will result in the de novo formation of a novel organ, the nodule. It is within the nodule that the bacterium fixes nitrogen providing its host plant an advantage in environments where this element is limiting. The establishment of the symbiosis involves a complex interplay between host and symbiont, which is orchestrated by the exchange of diffusible signal molecules.
To focus on defining the transcriptional, metabolomic and proteomic response of the soybean root hair cell to variations in temperature and water availability. These data will allow the development of computational models to examine regulatory networks that function at a single cell level to control the response to environmental change. The data obtained should provide a better understanding of the impacts of climate change (heat and water limitation) on plant root physiology.
Root Hair Website: http://www.soyroothair.org/research.html | 1,458 | 758 | 0.001326 |
warc | 201704 | The Stroke–Thrombolytic Predictive Instrument A Predictive Instrument for Intravenous Thrombolysis in Acute Ischemic Stroke Jump to Abstract Many patients with ischemic stroke eligible for recombinant tissue plasminogen activator (rt-PA) are not treated in part because of the risks and benefits perceived by treating physicians. Therefore, we aimed to develop a Stroke-Thrombolytic Predictive Instrument (TPI) to aid physicians considering thrombolysis for stroke. Background and Purpose— Using data from 5 major randomized clinical trials (n=2184) testing rt-PA in the 0- to 6-hour window, we developed logistic regression equations using clinical variables as potential predictors of a good outcome (modified Rankin Scale score ≤1) and of a catastrophic outcome (modified Rankin Scale score ≥5), with and without rt-PA. The models were internally validated using bootstrap re-sampling. Methods— To predict good outcome, in addition to rt-PA treatment, 7 variables significantly affected prognosis and/or the treatment-effect of rt-PA: age, diabetes, stroke severity, sex, previous stroke, systolic blood pressure, and time from symptom onset. To predict catastrophic outcome, only age, stroke severity, and serum glucose were significant; rt-PA treatment was not. For patients treated within 3 hours, the median predicted probability of a good outcome with rt-PA was 42.9% (interquartile range [IQR]=18.6% to 64.7%) versus 25.3% (IQR=9.8% to 46.2%) without rt-PA; the median predicted absolute benefit was 12.5% (IQR=5.1% to 21.0%). The median probability for a catastrophic outcome, with or without, rt-PA was 15.2% (IQR=8.0% to 31.2%). The area under the receiver-operator characteristic curve was 0.788 for the model predicting good outcome and 0.775 for the model predicting bad outcome. Results— The Stroke-TPI predicts good and bad functional outcomes with and without thrombolysis. Incorporated into a usable tool, it may assist in decision-making. Conclusions— acute care acute Rx acute stroke clinical decision support emergency medicine predictive models thrombolysis thrombolytic Rx
The National Institute of Neurological Disorders and Stroke (NINDS) recombinant tissue plasminogen activator (rt-PA) Stroke Study demonstrated that intravenous rt-PA improves outcomes in acute ischemic stroke, when administered within 3 hours of symptom onset.
1 The absolute benefit in the likelihood of a normal or near-normal outcome ranged from 11% to 15%, depending on the functional outcome scale. However, registry data from several studies suggests that only ≈2% of patients with acute ischemic stroke receive thrombolysis. 2,3
Although many with acute stroke present beyond the 3-hour time window,
4 rt-PA remains underused even among eligible patients 5 and emergency physicians report reluctance to treat patients with thrombolytics, even in the ideal setting, in part because of the perceived risks and benefits of the treatment. 6
Computer-based decision-support tools can improve process-of-care outcomes.
7 For acute myocardial infarction, the Thrombolytic Predictive Instrument (TPI), 8 which provides clinicians with 0% to 100% probabilities of clinically important outcomes, with and without thrombolysis, has been shown to increase the speed and likelihood of thrombolytic therapy for subgroups of patients that physicians often fail to treat. 9 The purpose of this study was to develop a predictive instrument, the Stroke-TPI, that could similarly provide clinicians, at the point-of-care, with the probabilities of important clinical outcomes with, and without, thrombolysis in acute stroke. A companion study addresses whether such an instrument may also be useful in patient-selection beyond the 3-hour time window. 10 Methods Database Development
We combined randomized clinical trial databases, from the NINDS rt-PA Study (Trial 1 and Trial 2),
1 ATLANTIS A, 11 ATLANTIS B, 12 and ECASS 2. 13 These trials represent the published clinical trial experience with the current dosage of rt-PA. ECASS 1 was not included because a different dose was used in that trial. 14 These trials were detailed in the original articles, and their differences were highlighted in a pooled analysis. 15 For modeling, we excluded patients with minor stroke (National Institutes of Health Stroke Scale [NIHSS] ≤4), as well as patients missing 90 day outcome data, NIHSS or time from symptom onset to treatment. Selection of Prediction Outcomes
We aimed to create multivariate mathematical models to predict both the risks and the benefits of thrombolysis in a way most useful to clinicians. Because the influence of thrombolysis may differ across different outcomes and because these different outcomes may be important for informed decision-making, we developed 2 separate models to capture outcomes at opposite ends of the functional outcome scale (modified Rankin Score [mRS] ≤1 and mRS ≥5). These extreme thresholds were chosen because they divide the Rankin Score into relatively homogenous outcomes in terms of quality of life and patient preferences.
16 As the effects of symptomatic intracerebral hemorrhage (sIH) on clinical outcome are captured by these measures, it was felt separate predictions for the rate of sIH would add redundant information that may lead to the “double-counting” of bad outcomes among those treated with thrombolysis. Variable Selection and Model Building
Besides their presence in each of the component databases, several considerations influenced our selection of predictor variables. First, to reduce the likelihood of model over-fitting, we sought to limit the number of candidate variables tested. Thus, we considered only variables previously demonstrated to be prognostically important, or likely to modify treatment effect.
17–21 Second, we considered whether the variables were likely to be easily and reliably obtainable for real-time pretreatment use. Third, because we were especially interested in patient characteristics that might modify the effect of therapy, we permitted all variables to interact with treatment, even when the main effect did not significantly predict outcome. We also included the interaction of stroke severity (NIHSS score) and age, previously shown to be prognostically important. 20 Otherwise, no additional interaction variables were tested. Variables and interactions were included in the final model at a threshold probability value of 0.05.
We anticipated that careful reading of the presenting CT scan might be important for patient-selection for thrombolysis. We therefore endeavored to obtain a complete set of CT scan readings using the Alberta Stroke Program Early CT (ASPECT) Score.
22 However, we recognized that obtaining real-time ASPECT scores might not be feasible for nonspecialized physicians, so we modeled with and without this variable. Assessing Model Performance and Statistical Validity
The performance of each model was assessed by the receiver-operator characteristic (ROC) curve area and calibration curves. Because model performance measures on the database on which it was developed may be over-optimistic because of over-fitting, to assess how model performance might degrade when the predictive instrument is applied to independent data drawn from the same population, we internally tested this using 0.632 bootstrapping
23 (described in more detail in our companion article 10). Using this resampling technique, we created 250 individual development datasets, each with a companion independent test dataset, and used automated procedures to develop and test 250 models. The median ROC and calibration curves for development and test sets were examined.
Although these procedures evaluated model performance of across patient subgroups, because our intention is to support physicians treating
individual patients, we subjected model predictions to further scrutiny. Because during stepwise model building, multiple treatment effect interactions were tested, we considered that an identified interaction in the model might arise by chance. Therefore, we assessed the validity of these interactions by examining the direction of the interaction and seeking confirmation from the literature. Isopleths of the relationship of outcome with and without treatment over the entire range of each of the covariates were examined to ensure the model described known or plausible relationships between variables and outcomes, and variables and treatment effects. In addition, interaction terms were tested for possible nonlinear effects. We also checked for consistency of model performance between each of the component database and we examined whether the individual effects of predictor variables were especially influenced by any of the component databases. Finally, the predictive models were incorporated into usable computer-based tools and individual patient predictions were examined for face validity by investigators and outside stroke experts. Results
Of 2184 patients in the combined database, 2131 were included in the dataset for modeling (after excluding minor stroke [n=29] or those missing data on outcome [n=9], baseline NIHSS [n=2] or symptom onset to treatment [n=13]). Of these, 1062 (50%) received placebo, 1307 (61%) were treated after 3 hours, 773 (36%) had normal or favorable outcomes (mRS ≤1), and 464 (22%) had catastrophic outcomes (mRS ≥5). Patient characteristics are in Table 1.
Predicting Normal/Near-Normal Outcome
The final model predicting mRS ≤1 is shown in Table 2. All variables considered for model inclusion had a significant effect on this outcome, with the exception of sex (which was included in the model because of the significant treatment interaction) and glucose (which showed a strong trend for decreasing the likelihood of a normal/near-normal outcome [
P=0.07]). Four variables were found to modify the effect of thrombolysis: being male, having a higher initial systolic blood pressure, a previous stroke, or longer delays from symptom onset to treatment, all predicted less benefit from thrombolysis. There was no evidence for nonlinearity in these interactions. The ROC area was 0.788. Inclusion of baseline ASPECTS did not significantly improve the model.
When 0.632 bootstrapping was performed, we found the median area under the ROC was 0.793 (interquartile range [IQR] 0.786 to 0.799) on the developmental data, which diminished to 0.772 on the independent test data (IQR 0.763 to 0.782). Calibration of the predictions was excellent, shown for the test data in Figure 1A.
Predicting Catastrophic Outcome
The final model predicting mRS ≥5 is in Table 3 (with and without ASPECTS). Of the clinical variables, only age, NIHSS, and serum glucose were predictive of a poor outcome. The baseline ASPECT score (as a linear variable) was also highly predictive of the likelihood of a poor outcome. Importantly, this outcome was independent of thrombolysis, suggesting that treatment does not have a significant positive or negative effect on likelihood of poor outcome in the 0- to 6-hour window. Further, with the possible exception of diabetes, effect of rt-PA was not modified by any other variable. This suggests that the absence of a treatment effect on this outcome is generalizable to all subgroups tested (ie, regardless of stroke severity, ASPECT score, presence or absence of a previous stroke, systolic blood pressure, etc.) In automated stepwise model building, there was a strong interaction between rt-PA treatment and diabetes (
P=0.02), suggesting that diabetics may be more likely to be harmed by therapy compared with nondiabetics. However, when this was re-tested on the dataset including patients excluded from the automated procedure because they were missing other variables shown to be nonsignificant in the final model (ie, on those with complete data for age, treatment, NIHSS, glucose, time and diabetes [n=2109]), this interaction effect was substantially mitigated and was no longer statistically significant ( P=0.23).
The model had an ROC area of 0.775 (0.789 with ASPECTS). When 0.632 bootstrapping was performed, the average ROC area was 0.784 (IQR, 0.774 to 0.794) on the developmental data, and was 0.762 on the independent test data (IQR, 0.749 to 0.776). Calibration of the predictions was excellent, shown for the test data in Figure 1B.
Individual Patient Predictions
For patients treated within the 3-hour time window, the median predicted probability for a good outcome with rt-PA was 42.9% (IQR 18.6% to 64.7%), versus 25.3% (IQR 9.8% to 46.2%) without; the median predicted absolute benefit was 12.5% (IQR 5.1% to 21.0%). The median predicted probability for a catastrophic outcome was 15.2% (IQR 8.0% to 31.2%), with or without rt-PA.
Examination of individual predictions and isopleths uncovered one relationship that contradicted clinical judgment. There was a very small nonsignificant trend for better outcomes among placebo-treated patients with a previous stroke compared to those without, which was incorporated into the model only because the treatment interaction with prior stroke was significant. Thus, for consistency with clinical judgment, this was adjusted such that previous stroke has no influence on predictions in placebo-treated patients, without changing its strong negative impact with thrombolysis.
Discussion
The Stroke-TPI provides patient-specific predictions of the probability of a normal or near-normal outcome, and also the probability of a catastrophic outcome (death or very severe disability), if treated and if not treated with thrombolysis. Incorporated into a handheld (shown in Figure 2) or other computer system, this predictive instrument could potentially support physician decision-making and counseling of patients and families.
Use of rt-PA in acute ischemic stroke is associated with a reperfusion rate of ≈50%, depending on the location of the occlusion,
24,25 but does so at a risk of parenchymal hematoma of ≈4%. 15 Balancing these benefits and risks is difficult and physician uncertainty of the impact of rt-PA in acute stroke is an important barrier to thrombolysis. 26 The Stroke-TPI summarizes the impact of reperfusion and hemorrhage on both good and bad functional outcomes, as patient-specific prognoses. Providing such estimates at the point-of-care may mitigate physician uncertainty and improve decision-making.
Table 4 shows 9 randomly selected patients treated in the 0- to 3-hour time window. As can be seen, for each of these patients, the benefits of thrombolysis outweigh its risks. This is true for all but 6.5% of database patients treated in the 0- to 3-hour window. Yet, even in this time-window, there is considerable heterogeneity in patient outcome and treatment benefit. When discussing the outcomes of potential therapies, physicians typically quote average results of clinical trials. However, because of this heterogeneity, adjusting these average results to take into account important individual patient characteristics may be more useful in clinical decision-making. (Interested readers can examine model predictions using an online version of the Stroke-TPI at http://www.nemc.org/icrhps/faculty/fac_respage/KentD_respage.asp, where any relevant updates will also be posted).
Our modeling yielded several important clinical findings. First, we identified 4 variables that diminish the benefits of thrombolysis: longer symptom onset to treatment time; male sex; higher systolic blood pressure, and a history of previous stroke. These treatment-effect interactions are discussed in more detail in a companion article.
10 Second, thrombolysis did not appear to have any effect, positive or negative, on the likelihood of severe disability or death, either on average, or for any tested subgroups (eg, those with versus without prior stroke, those with higher versus lower blood pressure, etc.). This suggests that, for this outcome, the increased risk of sIH is approximately balanced by improvement in those patients achieving reperfusion across all these subgroups, and that subgroups at higher risk for thrombolytic-related sIH are also at similarly high risk for poor outcomes without thrombolysis.
Despite the benefits found in clinical trials in the 0- to 3-hour time window, a study of academic medical centers found that only 20% of those eligible for treatment actually received thrombolysis.
5 One survey found that 40% of emergency department physicians, 91% of whom were board certified in this specialty, were either uncertain, unlikely, or very unlikely to use rt-PA for stroke in the ideal setting. 6 Among the reluctant subset of physicians, the average maximally acceptable rate of thrombolytic-related sIH was 2.1%, even if thrombolysis improves the likelihood of a good outcome by 45%. Such a response suggests a cognitive error. Whereas the impact of both thrombolytic-related reperfusion and thrombolytic-related hemorrhage on patient quality of life are both fully accounted for and summarized in the functional outcome measure (as long as both good and bad functional outcomes are measured), physicians appear to be, in addition, considering the likelihood of sIH as independent information, suggesting that these risks are being double counted. Presenting the likelihoods of both the good and the bad functional outcomes simultaneously, with and without rt-PA, might allow physicians to better understand the trade-offs between reperfusion and hemorrhage and to better summarize these trade-offs when obtaining informed consent.
There are several limitations to the study. First, the predictive equations are based on outcomes achieved in the major European and North American randomized clinical trials, and thus the outcome predictions assume strict adherence to treatment protocols and may apply only to those treated in similar settings. Although outcomes in community practice may vary, outcomes similar to trial results are achievable in routine practice.
27–29 Similarly, predictions may not be reliable for patients who are not well-represented in the database (eg, those age >85, those with initial systolic blood pressure >200 mm Hg, or those with pre-existing disability). Second, the variation in treatment effect is dependent on the four treatment effect interactions; because eight different interactions were tested, there is the possibility that one or more of these may have arisen by chance, or that other interactions that may be clinically important are not included because these effects did not reach statistical significance in this particular sample. These considerations are discussed in a separate article dealing with patient selection. 10 Finally, the effects of the Stroke-TPI on physician decision-making, process, and clinical outcomes have not been tested, effects that should be studied in a multi-center clinical evaluation.
Despite these limitations, the Stroke-TPI offers promise as a real-time clinical decision aid for an area of clinical medicine that seems especially in need of such support. A similar decision-support instrument improves use of thrombolytics in AMI for subgroups of patients in whom thrombolysis is suboptimal.
8,9 Use of a predictive instrument for stroke might have even greater impact because individual physicians who provide acute stroke care generally have extremely limited experience administering thrombolysis for stroke. Further, embedding the predictive instrument in a comprehensive computerized tool that includes other acute stroke support (such as an NIHSS calculator, a dosage calculator, treatment guidelines, etc) presents the opportunity to further improve timeliness and appropriateness of therapy. 30 Finally, in acute stroke such a predictive instrument holds promise for the improvement of patient selection, possibly allowing selective treatment beyond the currently approved 3-hour time window for patients with an otherwise favorable risk–benefit treatment profile. 31 Acknowledgments
The authors would like to acknowledge the work of the NINDS, ATLANTIS, and ECASS Trialists, without which this secondary analysis would not be possible. The following stroke experts assisted in review of Stroke-TPI model predictions: Michael D. Hill, MD; Karen C. Johnston, MD; Steven R. Levine, MD; David E. Thaler, MD; and Judith Hinchey, MD.
Sources of Funding
This research was supported by grants from the NINDS to Dr Kent (K23NS44929 and R21NS48225).
Disclosures
E.B. is an employee at Boehringer Ingelheim, which has a financial interest in this study. W.H. has received honoraria for speaking at major symposia for Boehringer Ingelheim, and for participating in DSMB and a steering committee for Boehringer Ingelheim. W.H. is also on an advisory board for Boehringer Ingelheim. All other authors report no conflicts of interest.
Received March 1, 2006. Revision received July 14, 2006. Accepted August 2, 2006. References ↵ ↵ Katzan IL, Furlan AJ, Lloyd LE, Frank JI, Harper DL, Hinchey JA, Hammel JP, Qu A, Sila CA. Use of tissue-type plasminogen activator for acute ischemic stroke: the Cleveland area experience. JAMA .2000; 28: 1151–1158. ↵ ↵ ↵ Johnston SC, Fung LH, Gillum LA, Smith WS, Brass LM, Lichtman JH, Brown AN. Utilization of intravenous tissue-type plasminogen activator for ischemic stroke at academic medical centers: the influence of ethnicity. Stroke .2001; 32: 1061–1068. ↵ ↵ ↵ Selker HP, Griffith JL, Beshansky JR, Schmid CH, Califf RM, D’Agostino RB, Laks MM, Lee KL, Maynard C, Selvester RH, Wagner GS, Weaver WD. Patient-specific predictions of outcomes in myocardial infarction for real time emergency use: a thrombolytic predictive instrument. Ann Intern Med .1997; 127: 538–556. ↵ Selker HP, Beshansky JR, Griffith JL. TPI Trial Investigators. Use of the electrocardiograph-based thrombolytic predictive instrument to assist thrombolytic and reperfusion therapy for acute myocardial infarction: a multicenter, randomized, controlled, clinical effectiveness trial. Ann Intern Med .2002; 137: 87–95. ↵ Kent DM, Selker HP, Ruthazer R, Bluhmki E, Hacke W. Can multivariable risk-benefit profiling be used to select treatment-favorable patients for thrombolysis in stroke in the 3 to 6 hour time window? Stroke .2006; 37: 2963–2969. ↵ Clark WM, Albers GW, Madden KP, Hamilton S. The rtPA (alteplase) 0- to 6-hour acute stroke trial, part A (A0276g) : results of a double-blind, placebo-controlled, multicenter study. Thromblytic therapy in acute ischemic stroke study investigators. Stroke .2000; 1: 811–816. ↵ Clark WM, Wissman S, Albers GW, Jhamandas JH, Madden KP, Hamilton S. Recombinant tissue-type plasminogen activator (Alteplase) for ischemic stroke 3 to 5 hours after symptom onset. The ATLANTIS Study: a randomized controlled trial. Alteplase Thrombolysis for Acute Noninterventional Therapy in Ischemic Stroke. JAMA .1999; 282: 2019–2026. ↵ Hacke W, Kaste M, Fieschi C, von Kummer R, Davalos A, Meier D, Larrue V, Bluhmki E, Davis S, Donnan G, Schneider D, Diez-Tejedor E, Trouillas P. Randomised double-blind placebo-controlled trial of thrombolysis with intravenous alteplase in acute ischaemic stroke (ECASS II). Second European-Australasian Acute Stroke Study Investigators. Lancet .1998; 352: 1245–1251. ↵ Hacke W, Kaste M, Fieschi C, Toni D, Lesaffre E, von Kummer R, Boysen G, Bluhmki E, Hoxter G, Mahagne MH, Hennerici M. Intravenous thrombolysis with recombinant tissue plasminogen activator for acute hemispheric stroke. The European Cooperative Acute Stroke Study (ECASS). JAMA .1995; 274: 1017–1025. ↵ ↵ Solomon NA, Glick HA, Russo CJ, Lee J, Schulman KA. Patient preferences for stroke outcomes. Stroke .1994; 25: 1721–1725. ↵ ↵ Counsell C, Dennis M, McDowall M, Warlow C. Predicting outcome after acute and subacute stroke: development and validation of new prognostic models. Stroke .2002; 33: 1041–1047. ↵ Johnston KC, Connors AF, Wagner DP, Knaus WA, Wang X, Haley EC Jr. A predictive risk model for outcomes of ischemic stroke. Stroke .2000; 31: 448–455. ↵ The NINDS t-PA Stroke Study Group. Generalized efficacy of t-PA for acute stroke. Subgroup analysis of the NINDS t-PA Stroke Trial. Stroke .1997; 28: 2119–2125. ↵ Marler JR, Tilley BC, Lu M, Brott TG, Lyden PC, Grotta JC, Broderick JP, Levine SR, Frankel MP, Horowitz SH, Haley EC Jr, Lewandowski CA, Kwiatkowski TP. Early stroke treatment associated with better outcome: the NINDS rt-PA stroke study. Neurology .2000; 55: 1649–1655. ↵ Pexman JH, Barber PA, Hill MD, Sevick RJ, Demchuk AM, Hudon ME, Hu WY, Buchan AM. Use of the Alberta Stroke Program Early CT Score (ASPECTS) for assessing CT scans in patients with acute stroke. AJNR Am J Neuroradiol .2001; 22: 1534–1542. ↵ ↵ ↵ Alexandrov AV, Grotta JC. Arterial reocclusion in stroke patients treated with intravenous tissue plasminogen activator. Neurology .2002; 59: 862–867. ↵ Kwan J, Hand P, Sandercock P. A systematic review of barriers to delivery of thrombolysis for acute stroke. Age Ageing .2004; 33: 116–121. ↵ Tanne D, Bates VE, Verro P, Kasner SE, Binder JR, Patel SC, Mansbach HH, Daley S, Schultz LR, Karanjia PN, Scott P, Dayno JM, Vereczkey-Porter K, Benesch C, Book D, Coplin WM, Dulli D, Levine SR. Initial clinical experience with IV tissue plasminogen activator for acute ischemic stroke: a multicenter survey: the t-PA Stroke Survey Group. Neurology .1999; 53: 424–427. ↵ Wang DZ, Rose JA, Honings DS, Garwacki DJ, Milbrandt JC. Treating acute stroke patients with intravenous tPA: the OSF stroke network experience. Stroke .2000; 31: 77–81. ↵ Hill MD, Buchan AM. Canadian Alteplase for Stroke Effectiveness Study (CASES) Investigators. Thrombolysis for acute ischemic stroke: results of the Canadian Alteplase for Stroke Effectiveness Study. CMAJ Can Med Assoc J .2005; 172: 1307–1312. ↵ ↵ Kent DM, Ruthazer R, Selker HP. Are some patients likely to benefit from recombinant tissue-type plasminogen activator for acute ischemic stroke even beyond 3 hours from symptom onset? Stroke .2003; 34: 464–467. | 26,379 | 10,240 | 0.000099 |
warc | 201704 | Eyes are considered to one of such facial expressions that always demands for great attention and care. No matter whether it is summer or winter season our eyes normally gets dry and rough and sometimes due to the less amount of sleep the dark circles and wrinkles become a common problem. In all such states it is essential to follow up with some caring measures that would provide extra freshness to the eyes. In this article we are highlighting some of the
Advertisement
beauty tipsfor making the eyes more beautiful and maintaining proper eye care.
1. Foremost never overlook the caring of the eyes because likewise you apply some special methods for skin and lips in the same way eyes should also be given same preference and attention because when your eyes look dull and dry then it will directly affects the skin and face as well.
2. Most of the women get into the trouble of
dark circles. Well the only reason behind the wrinkles is the less quantity of sleep. You can only remove the dark circles by just taking proper and sound sleep. When you get old aged then applying the herbal remedies for the dark wrinkles will just serve you with null outcomes because this section only request for natural cure and care.
3. Another most beneficial treatment for the eyes is the mixture of
tomato and cucumber. Just make the paste of tomato and cucumber and let it gets thick for sometime. As soon as it cool down just apply the mixture on the face for 20 minutes in such a way that it also covers the eyes section as well. Afterwards you will discover that your eyes have got much relaxed and comfortable feeling will take place on the skin.
On the whole all the women who feel like getting striking eyes they should definitely follow these steps and we are sure that you will love to see your eyes again and again.
Advertisement | 1,843 | 926 | 0.001086 |
warc | 201704 | In a recent article, I described the importance of ice in your cocktail, describing the different kinds of ice you may want to use depending on what you are drinking. If you have ever visited the Bradstreet Crafthouse or a handful of other fine destinations, you may have marveled at the drinks that feature incredible spheres of ice—smooth glacial planetoids that literally span the entire width of the glass. Much more than mere aesthetics, these arctic wonders are functional, keeping their cocktails cold while minimizing dilution. That's because a sphere has the smallest possible surface area for a given volume. Less surface area means less melt, and that results in longer
sip time without loss of flavor or temperature.
So how does a bar create a 3-inch sphere of ice? The only answer, up until a couple of years ago was that they carved it! The ice sphere trend started in Japan amidst a mini-craze of whisky drinking. Japanese bar-goers wanted to slowly sip and enjoy their spirits (or maybe they took frequent breaks at the karaoke microphone). It had long been known that large chunks of ice last longer, so eventually someone decided to push that concept to the limit. I like to imagine it was a bright, young college kid majoring in physics or maybe working on a thesis in thermo-dynamics. I picture him as an undiscovered sculptor or perhaps a descendant in a long line of Samurai sword makers.
Method One: Carving Here is an amazing video featuring one such artist carving away at a chunk of ice until his sphere is just right. You can do this at home. You really can—if you do not mind losing a finger or two! Actually, I understand that the process simply involves chopping away at a cube to remove the eight corners, then chopping at each of the 24 corners that result, and so on until it's relatively smooth. But I don't recommend this method. I am certain that if I tried this, aside from slicing into my hand, my sphere would come out looking like an ice bean, or a Shmoo. Besides, is this any way to treat your knives? There is an alternative, and it's a lot easier, but. . . Method Two: Melt-molding This video features the Taisin mold, a tool that has revolutionized the construction of ice spheres (because everyone knows, ice sphere carving desperately needed a revolution). It's no longer necessary to risk losing a finger. It no longer takes five minutes or more. I know you are relieved about that. These days, in about forty seconds, you can have a perfect sphere of ice. Well, okay—forty seconds and about $1300. These molds are not cheap! You can buy the smaller versions for a fraction of that price, but in order to fill your glass, you will need to step up to the 70 mm or even the 3+ incher which is going to set you back some serious cha-ching. It's probably worth it for an upscale bar, but few home mixologists are going to be able to justify that kind of expense. Is there a poor man's version? You bet.
Method Three: Slow Molding There happens to be several options available for what I call slow molding. This is basically the process of freezing water in the traditional sense, only doing it with a mold or tray specifically designed to make spheres. It's not as easy as you would think to design such a thing. Consider the fact that you need to be able to remove the sphere from the tray once frozen, and to do that, it will need to open up in halves. Also, filling the mold through a tiny hole could be pretty tedious, so trays are cleverly designed to avoid this.
If you are looking for a tray, you need to consider the glass you intend to use for your drinks. For me, bigger molds are better, so I found one that makes spheres about 2.5 inches in diameter. There is also this mold from MoMa which has a similar design. Candy makers use this silicone mold which also looks promising, although it's more expensive. A recent search turned up this example which looks pretty interesting. I got mine from an eBay seller in Japan for about ten bucks!
The process I am about to describe may seem a bit convoluted, but it works for me. I am not about to start carving with knives, so I don't mind that it takes a little extra effort. I get to keep all of my fingers too, which I will need once it comes time to mix a drink for these things!
My ProcessThe first thing I need to do with my tray is fill the bottom half with water. The water level needs to go beyond the inverted domes and flood the tray because it also needs to fill the top half of the spheres. As I lower the upper section onto the water-filled tray, water flows into the upper domes and air escapes through the tiny holes atop each sphere. As the two tray parts meet, a small amount of water is squeezed through the tops. At this point it is important to keep the assembly level so that the spherical shapes remain filled with water. Since the tray tends to want to float apart, I carefully wrap the assembly with rubber bands. Then, it goes into the freezer for several hours.
Once frozen, it's obvious something isn't right. Despite the rubber bands, the mold always separates. This is due to the
peculiar effect of water which expands as it freezes. I can also see that the tiny air holes now have trails of ice from them. Water has been squeezed through these holes until they froze shut, and continued expansion pushed the mold apart. The result is three frozen "eggs". Easter Ice?I don't know about you, but for me, egg-shaped ice just won't do. I understand why this happens, I just don't like it. So, the second phase of my process involves removing the new eggs and re-freezing them to get the shape just right. Sometimes, as I de-mold the eggs, they crack into two pieces. That's okay because I need to run them under water for a few moments to shrink them a bit, and this allows me to fuse them together again. Once they are a bit smaller, I can put them back into the mold oriented 90 degrees so the seam lands elsewhere and the pieces are held in place. I add a little more water and close down the top again. I strap on the rubber bands and back into the freezer it goes for round two.
During the second freeze, most of the water is already ice. There's little expansion so the mold stays together, and when I remove them, they are perfect spheres. I take them out and wrap them in plastic. Individually wrapped spheres then go into a ziplock and are stored in the freezer until needed. Taking extra care to wrap them like this is important. The freezer is a dry environment which is why unwrapped food dries out. That's freezer burn. Ice will shrink in the freezer over time as the water evaporates or
sublimates from solid to gas. Wrapping in plastic prevents this. It also keeps the spheres from sticking together and stops food odor from contaminating them. ConclusionI know it seems like a lot of extra work, but most of it is just waiting for water to freeze. The two-phased approach is frustrating, but worth the effort to get them perfectly round. Perhaps other trays work better. I don't know. After spending only a few minutes each day for a couple days, I have a dozen or so ice spheres ready for a party. My stunning Old-Fashioned or Negroni cocktails will be talked about for a long time! However, the spheres would look a lot better if they were perfectly clear. The trapped air bubbles and minerals in the water also affect their stability by giving the ice more opportunity to crack apart. Finally, ice riddled with air pockets and cracks just wont be as cold as a solid crystal. I could avoid this by using distilled water and by boiling it twice. I tried it, and found that twice-boiled water actually does yield clear ice, but my refreezing process obscures the effect. Still, I am very happy with the results so far.
If you decide to try this—or even if you simply use water balloons—I'd love to hear about it. Maybe you have a few tricks to help the process work a little better. My process isn't perfect, so I could use a little help. Next, it's probably time I start working on long, rectangular shards for collins drinks. That should be easier than spheres, so if you are doing that too, I wanna hear about it! | 8,198 | 3,831 | 0.000262 |
warc | 201704 | Most dishwasher detergents for machines, as opposed to the dishwashing detergents for hand-washing dishes, contain the highly alkaline compound sodium carbonate, also known as good old-fashioned washing soda, not baking soda, which is sodium bicarbonate.
Alkaline chemicals are needed in the dishwasher because they gobble up grease, transforming it into soap. A soap is one of a class of chemical compounds formed by the action of an alkali on a fat. A detergent, on the other hand, is a more modern synthetic compound specifically designed to do soap’s cleaning chores. That difference doesn’t stop many people from calling all of today’s household detergents “soaps” anyway.
But I digress.
We tend to think that if a chemical is attacking and dissolving a metal, it must be an acid. And that’s generally true; a strong enough acid could devour a Humvee and spit out the tires. But aluminum is an unusual metal in that it is attacked by both acids and alkalis. (It is arnphoteric .)
So the alkaline sodium carbonate in the dishwasher detergent does indeed attack aluminum, at the very least eating deeply enough into the surface to make it dull and pewter-gray with aluminum compounds. For this reason most manufacturers of quality aluminum cookware advise against putting it in the dishwasher.
Worse yet, some dishwasher detergents contain potassium hydroxide or sodium hydroxide (lye), which are much stronger alkalis than sodium carbonate and will literally eat into your aluminum utensils. That’s probably what converted your mesh strainer into a basketball hoop. If you still want to wash your aluminum cookware in the dishwasher, scan the labels of the dishwasher detergents in your supermarket and choose one that contains neither potassium or sodium hydroxide nor sodium carbonate. They do exist.
There’s a second aluminum-damaging phenomenon going on in your dishwasher if the aluminum utensil happens to be touching another metal, which will most likely be stainless steel.
Whenever any two different metals, in this case aluminum and what is essentially iron, are in contact while immersed in an electrically conducting liquid, an electrical (more properly, an electrolytic) reaction takes place that attacks one of the two metals, in this case the aluminum, corroding its surface and dulling it. So if you insist on washing an aluminum utensil in the dishwasher, make sure it isn’t touching any other kind of metal.
For reasons that are more elaborate than we want to get into here, iron atoms hold on to their electrons more tightly than aluminum atoms do. (Iron is said to be more electronegative than aluminum.) Thus, if the two metals happen to be in contact within an electrically conducting liquid (an electrolyte) such as dishwasher detergent dissolved in water, the iron atoms will actually steal electrons from the aluminum atoms. This transfer of electrons constitutes a flow of electric current, with the electrolyte completing the circuit.
The now-electron-deficient aluminum atoms (aluminum cations) want to regain their normal complement of electrons by reacting with something, anything, that has electrons to donate. The surface of the aluminum metal therefore reacts with negative ions (anions) in the solution, forming a dulling layer of an aluminum compound, most often aluminum oxide. | 3,374 | 1,525 | 0.000667 |
warc | 201704 | Oshun. Private Collection.
How do you show your beloved that you love them?
What special things do you do for your partner or spouse to make their day go smoother, to make them feel relaxed and special?
What do you do day in and day out for your children because you love them and want them to be happy?
Take a minute and make a short list – it doesn’t take long. I’m sure you will think of many things immediately – but just list a few. A few are all that is necessary.
Reread your list. Feel the glow that you get from letting the people you love know that they are loved.
Now answer this: when was the last time you did any one of those things just for yourself?
In order to love others fully, you must first love yourself. If you aren’t taking care of your own self as Beloved, start right now. Think of it as a gift of love to those others who are beloved to you, because it allows your understanding of love to expand. Pick something off the list you just made and do it for yourself. Today.
Wylde Women’s Wisdom:
As we understand the impersonal nature of the Law of Cause and Effect we can CHOOSE to take more responsibility for what we have created in our lives. The more responsibility we take, the
less likely we are to think that forces outside ourselves are limiting or controlling our lives. Ultimately, life is about choices. There is no destiny, only our unlimited ability to choose. Katherine Q. Revoir | 1,460 | 778 | 0.001323 |
warc | 201704 | Based on the results of a new study, doctors should be reconsidering the way they treat patients who come to emergency rooms with mild traumatic brain injury (TBI).
It turns out that hospital MRIs may be better at predicting the long-term outcomes for those with mild TBI than CT scans, which are the standard technique for evaluating such cases in the emergency room, according to a clinical trial led by researchers at the University of California San Francisco (UCSF) and the San Francisco General Hospital and Trauma Center (SFGH).
UCSF issued a press release on the study.
The study was published this month in the journal Annals of Neurology, and was led by UCSF neuroradiologist Dr. Esther Yuh.
The trial followed 135 patients treated for mild TBI over the past two years at three urban hospitals with level-one trauma centers: SFGH, the University of Pittsburgh Medical Center and University Medical Center Brackenridge in Austin, Texas. The study was called the NIH-funded TRACK-TBI (Transforming Research and Clinical Knowledge in Traumatic Brain Injury).
All these patients had CT scans when they were first admitted, and all were given MRIs about a week later. According to the press release, “Most of them (99) had no detectable signs of injury on a CT scan, but more than a quarter (27/99) who had a ‘normal’ CT scan also had detectable spots on their MRI scans called ‘focal lesions,’ which are signs of microscopic bleeding in the brain.”
Noticing such lesions help doctors predict whether patients were likely to have persistent neurological problems. Roughly 15 percent of people who have mild TBI do suffer long-term neurological consequences, although right now doctors have no definitive way of predicting whether any one patient will or not.
“This work raises questions of how we’re currently managing patients via CT scan,” the study’s senior author Dr. Geoff Manley, chief of neurosurgery at SFGH and vice-chair of the Department of Neurological Surgery at UCSF, said in a statement. “Having a normal CT scan doesn’t, in fact, say you’re normal.”
Most people with mild TBI recover, but about one in six develop persistent, sometimes permanent, disability, according to the press release. But there’s no way to predict which patients are will have a long-term impact from their TBI.
The new study, according to Manley, could be “an important step toward defining a more quantitative way of assessing patients with mild traumatic brain injuries and developing more precision medical tools to detect, monitor and treat them.”
Physicians could closely track patients they knew were at risk of greater disabilities.
“Being able to identify patients at risk of long-term consequences would also speed the development of new therapeutics because it would allow doctors to identify patients who would benefit the most from treatment and improve their ability to test potential new drugs in clinical trials,” the press release said. | 3,055 | 1,480 | 0.0007 |
warc | 201704 | Distribution and substation automation technologies and solutions will enable utilities to deliver on the promise of a self-healing smart grid, report finds
The next generation of distribution and substation automation technologies are part of the next wave of transmission and distribution grid solutions and applications. These advances have been made possible with digital intelligent electronic devices, wireless sensing and monitoring, and high-speed communications, as well as automation using centralized and/or decentralized solutions. According to a recent report from Navigant Research, revenue for DA and SA technologies is expected to total $109 billion from 2016 to 2025.
“Today’s market for substation, feeder, and transformer automation technologies includes a variety of solutions,” says Richelle Elberg, principal research analyst with Navigant Research. “These range from centralized command and control automation to highly decentralized and autonomous distribution grid edge-related solutions and equipment.”
The DA and SA technology market represents a tremendous and growing opportunity for vendors of wireless sensors, intelligent electronic devices, and other automated gear and software, according to the report. Among global regions, North America, Europe, and Asia Pacific have experienced the greatest penetration of distributed renewables and other resources that could cause disruptions to the grid—and drive demand for SA and DA solutions.
The report,
Distribution and Substation Automation, analyzes the global market for DA and SA technologies, with a focus on three categories: distribution substation automation, feeder automation, and transformer automation. The report provides an analysis of the market issues, including drivers, barriers, and regulatory factors, and case studies associated with these solutions. Global market forecasts for revenue, segmented by category and region, extend through 2025. The study also examines the key technologies related to DA and SA, as well as the competitive landscape. | 2,085 | 977 | 0.001042 |
warc | 201704 | In 1949, I was put on a dietary regimen by my physician, Francis Pottenger. He was a nutritional specialist. As part of this diet, I drank certified raw milk. I therefore have great sympathy for the seller of raw milk who was arrested, imprisoned, and allegedly harassed by the Los Angeles County Sheriffs Department. That […]Continue reading →
The government controls what you eat. The screws are tightening. This is a repport on the American Dietetic Association. We’ve mentioned the ADA bills still pending in California and New York. Now we have new licensure bills in Indiana, New Jersey, Colorado, and West Virginia. These bills are very restrictive, and ensure that only ADA-registered […]Continue reading → | 742 | 463 | 0.002245 |
warc | 201704 | A few weeks ago, I posted an interview on Terra Nova with Rebecca Nesson, who is using Second Life as a platform for distance education at the Harvard Extension School. While SL has been adopted by Harvard and more than 100 other schools worldwide, it is not the only online virtual reality environment that is used for educational purposes. There are other virtual world/virtual reality technologies that can support instruction and classroom activities, and this week we will get a perspective from someone who is using these alternate technologies to teach. The interview is with Aaron Walsh, a programmer and instructor who has used modding software and other tools to create VR classrooms for courses at the Woods College of Advancing Studies at Boston College (the inset photo is from one of his experiments, and depicts "students gathering in the virtual Egyptian environment"). His VR classes are part of a larger effort that he is leading to develop a standards-based educational platform called Immersive Education.
I first met Walsh in 2000, when I took two of his programming classes at Boston College. He subsequently invited me to participate in some early development and planning work surrounding his Media Grid initiative, and as part of these efforts I was able to take part in several Internet-based VR classroom demos in 2003 and 2004. However, Walsh noted in an email that he has been involved in VR development since the early '90s:
I began my work in virtual reality and immersive 3D environments while running the Advanced Technology Center (ATC) at Boston College. Around 1991 or so Paul Dupuis, my manager, and I built a personal VR system using stereo goggles, a Macintosh computer and a Nintendo Power Glove. This was back in the days when 3D on personal computers was practically unheard of, and texture mapping wasn't even an option. Crude, flat-shaded shaded polygons and wireframes ruled the roost. Striving for realism I began researching the potential for viewing digital video in stereo by splitting Quicktime movies into stereo pairs, one for each eyepiece. Around this time I became obsessed with the potential of realistic virtual reality, and developed digital media caching techniques for virtual reality and 3D that I contributed to the Web3D standards community in the late 1990s. From that point on I spent the majority of my time developing international standards for 3D and virtual reality as chairman of related Web3D Consortium and Moving Picture Expert Group (MPEG) working groups, and now with the Media Grid and Immersive Education.
In the interview, Walsh talks about some of the specific technologies he uses for his classes, as well as some of the benefits and challenges of conducting online classes in virtual reality. He confirms Nesson's observation that some students who have a tough time expressing themselves in the real world can really blossom in virtual environments, but notes that other students much prefer the traditional, face-to-face classroom experience. He also has a lot to say about the growing problem of addiction to virtual reality, which he classifies as "immersive illness."
Below is the full transcript of the interview, which was conducted via email earlier this week:
Ian Lamont: You've been teaching a course called Discovering 3D Graphics and Virtual Reality at the Woods College of Advancing Studies at Boston College. Some of the class is spent in a virtual world. What is the world or VR environment, and what are the types of activities that students take part in there?
Aaron Walsh: I teach three graphics courses at Boston College, all of which involve meeting with students online in virtual reality. Two of these classes (Discovering 3D Graphics and Virtual Reality, and Advanced 3D/VR) take place almost entirely online in virtual reality. I spend the first few classes working with the students in person, ensuring that their computers are setup properly and are ready to go, and after that we transition into virtual reality for the rest of the semester.
In these classes students learn the fundamentals of 3D computer graphics, virtual reality, and video game technology. They learn how to build 3D objects and virtual worlds, and how the combination of 3D/VR and rich digital media technologies are fundamentally re-shaping computer-based entertainment, education, and socialization.
We use the term "Immersive Education" to refer to the combination of 3D/VR and digital media specifically for learning. We started Immersive Education many years ago using the Virtual Reality Modeling Language (VRML) standard, and in 2003 transitioned to the commercial Unreal 2 game engine which has been our 2nd generation technology until today (which we use in combination with VRML, Extensible 3D (X3D), Flash and QuickTime). The current platform has served us very well, but it's at the end of its life and we're now in the process of selecting a new 3D/VR platform as part of the open Immersive Education standardization process. Educators and students who have taken courses using virtual environment technology, regardless of the specific 3D/VR technology they're familiar with, are encouraged to participate in the open standards process through ImmersiveEducation.org.
Lamont: Why not use Second Life?
Walsh: Second Life is a candidate for the new Immersive Education platform that we're defining today, but it wasn't a viable option for the previous generation which we selected in 2003. Some of our requirements at that time included: a stable cross-platform (Windows and Mac) platform; integrated text and voice chat; the ability to host the environments and server-side runtime on our own servers; content ownership; support for industry-standard authoring tools (such as Maya); the ability to modify (mod) the environment to support custom behaviors, and so forth. These and other criteria are being applied as we select and standardize the next generation of Immersive Education, and today Second Life is a leading candidate whereas in 2003 it wasn't even close.
Lamont: What have been some of the challenges and advantages to using virtual reality as a platform for education?
Walsh: There are many, on both sides. A major challenge has been related to student hardware, as it's extremely difficult to ensure that every student's computer setup is up to snuff. This has become much easier now that the majority of students have relatively new computers that sport modern graphics cards, but in the early days of Immersive Education we were dealing with students who had computers that rolled off the assembly line in the late 1990s. For the first few years we simply could not have the majority of our class meetings in virtual reality since too many of the students had sub-par computer systems, but that's mostly a non-issue today. Spotty network connections are also a challenge, especially when it comes to voice chat, but that's also becoming less of an issue since most of our students are participating either from dorms (which have high-speed networks) or from home where they have DSL or cable. The bandwidth issue is practically a non-issue today.
Another major challenge is in the presentation of learning materials inside of (through) the virtual environment itself, such as pumping videos or interactive Flash content through an object in the environment. Initially we wanted everything to be "in world" meaning we wanted all learning materials to be presented inside of the environment itself, thinking that a single seamless environment would be best. And while that may be the case for the entertainment industry, where you usually don't want to take the player out of the game or environment, it's not necessarily the case for education. For education there's no reason why all content has to be delivered inside of the virtual environment. In fact, it can be quite restricting to do so. Why not simply open a browser window when necessary, allowing students to use a wide variety of learning content that can't (and probably shouldn't) be shoehorned into the virtual environment? Doing this allowed us to incorporate Web pages, interactive Flash content, Quicktime VR and videos, and a wide assortment of rich learning materials into our online classes that wouldn't have been possible otherwise. And the students don't mind or care; they're learning, using a mixture of digital media. The virtual environment is merely the foundation that we build around, but it's just one part of a much larger picture.
Aside from these technical challenges there are a host of human-oriented challenges, not the least of which is the issue of taking real-world human-to-human personal contact out of the equation. For the most part students and teachers are used to meeting in person in a real classroom. Removing the classroom and the personal contact that comes with it can be a real challenge for some students, and while most don't take very long to adjust some never get completely comfortable with the virtual alternative. But for every student that would prefer a real-world classroom there are just as many, perhaps more, who love meeting in virtual environments. We often see cases where shy students who are quiet in person become very verbal and fully participant in the virtual environment, so there can be some real advantages in this respect as well.
A challenge that concerns me the most is lurking on the horizon, one we don't yet understand the full scope of. As Immersive Education and other forms of personal virtual reality become more realistic and compelling we're going to see "immersive illness" become more common and more difficult to deal with. Although this is an issue today we're somewhat protected by the limitations of today's personal computers and game consoles (they just aren't powerful enough...yet), but in another decade or more it'll be a different story altogether. Nobody knows exactly what impact insanely realistic, media-rich virtual reality will have on society. We're already dealing with early forms of immersive illness, such as addiction, alienation, mental schisms, and more, but today it's not a problem that affects a large percentage of users. We don't see massive problems today for a number of reasons, including rather low-quality virtual environments and limitations on how much time we spend in these environments. But what happens when the visual and audio quality becomes indistinguishable from reality, the technology becomes truly mainstream, and a substantial portion of education takes place in such environments and not in a real classroom? With massive power comes massive problems. Last week I was asked how big this problem will be, and I responded that nobody knows for sure but I'd estimate that the at-risk population can be calculate by adding the percentage of people with addiction problems to the percentage of society that suffer some form of mental illness. That's a big chunk of society. Is it all gloom and doom? Certainly not, but it's a grand challenge we're not even remotely prepared for today. As with other disruptions society will eventually adapt, but I think we're in for a very rough ride.
Other advantages include the time saved in traveling to and from class, which can be significant for students who live off campus. I've had some non-traditional students live over an hour away from Boston College, meaning they waste more than two hours traveling ever time we have class in person (on campus).
It's also worth noting that the "fun" factor can't be denied. Most of the students I've spoken with about their experience with these classes say they're the most fun they've had, and that they look forward to being in virtual reality each week. We're dealing with a generation of students weaned on video games, so it should come as no surprise that they enjoy learning in what amounts to a game-based learning environment. Giving students a educational experience that they not only enjoy but are very enthusiastic about is definitely an advantage.
Lamont: You recently received an award for promoting "Immersive Education" at BC, and are now trying to spread these concepts to other institutions. What does Immersive Education entail, and what does it offer other instructors and educational institutions?
Walsh: Yes, that's true. Students at Boston College nominated me for a Teaching with New Media (TWIN), which I was awarded last year, for my work with Immersive Education. Although I've been working in virtual reality for over 15 years it's only been over the past few years that we could teach classes online using this technology. Outside of playing video games this was the first time that most students really had a chance to dig in and learn about interactive 3D and virtual reality, and the response has been outstanding and very encouraging. But it's just the start. If Immersive Education were a human I'd argue that it's barely crawling, and there's a lot of work still to be done until it reaches its full potential.
Immersive Education is an application of the Media Grid (http://MediaGrid.org) that combines 3D/VR technology with digital media to bring distance learning and self-directed learning to a new level. Unlike traditional distance learning, Immersive Education is designed to immerse and engage students in the same way that today's best video games grab and keep the attention of players. Immersive Education combines interactive virtual reality and sophisticated digital media (voice chat, game-based learning modules, audio/video, and so forth) with collaborative online course environments and classrooms. Immersive Education gives students a sense of "being there" even when attending class in person isn't possible, practical, or desirable, which in turn provides faculty and remote students with the ability to connect and communicate in a way that greatly enhances the learning experience.
We're now in the process of selecting the next generation platform for Immersive Education, around which international standards are being established. Making Immersive Education open, extensible, freely available and fully documented will make it possible for any organization or individual to use it. This goes beyond the technology platform itself, and includes best-practices for teachers and institutions to follow as well as student-faculty ecosystems that organizations can employ. I'd encourage teachers and students to participate directly in the Immersive Education standardization process by visiting ImmersiveEducation.org and sharing their virtual learning experiences with the group (be it with Second Life or any other virtual environments).
Lamont: Do schools really have the technology resources, staff expertise, and funding to get involved in Immersive Education?
Walsh: The vast majority don't, at least not today, which is why we're focused on making Immersive Education an open standard that's easy to use, well documented and free. But that alone won't do it; best practices and student-faculty ecosystems are necessary as well, and so are communities of support. The vast majority of educators simply don't have the time, funding, or expertise to create and use virtual learning environments today. This probably won't change, which is why it's necessary to eliminate the cost and reduce the complexity.
The syllabus for Walsh's Discovering 3D Graphics and Virtual Reality course can be found here. Feel free to leave comments or questions below. | 15,537 | 6,487 | 0.000155 |
warc | 201704 | In my last column I wrote about DIY commandments to live by. After I wrote it, I realized there is more to say on the topic. All the commandments I mentioned are valuable, but there is another one I should have included. And that is “Work Smart: Quality is More Important than Quantity.”
If we’re open to learning — a trait most experienced DIYers share — we’re always evolving, refining and executing projects differently in order to see better results. Over the years, I’ve also learned how to work smart. In fact, it’s something I constantly work at.
Like many people, I have a tendency to push myself and work beyond my limits in order to complete a project. The result is often quality suffers; there is a greater likelihood to make mistakes; and in some cases set myself up for potential accidents. If working with power tools, whether chainsaws or circular saws, for example, know when to quit. If you’re exhausted and pushing yourself, you’re more likely to have an accident — and a potentially bad one at that. That’s just one example of working smart.
One of the keys to working smart is know your limitations. And they’re different for everyone if age, stamina, strength and gender are factored in. In my 30s and 40s, I could easily work eight or nine hours, taking a couple of short breaks.
But I couldn’t keep that pace up in my late 50s and early 60s. This was especially true when I was in the woods cutting firewood with my chainsaw. I found that I needed frequent breaks, and after four hours of cutting, I knew it was time to shut off the chainsaw, load my truck and head home. I knew that if I pushed myself, I was flirting with danger.
I’ve thought a lot about the variables that play into working smart, and I also did some research. Keeping in mind that quality is more important than quantity, here are a few helpful tips that can help you work smart:
Use time wisely
Before launching into a project, make sure you have all the materials and equipment on hand so you can get right into it without wasting time.
Stay focused and avoid distractions
Studies found that, on average, it can take up to 23 minutes to return to a task following an interruption. Without realizing it within the course of a day a great deal of time is wasted switching between tasks.
Avoid multitasking
Multitasking is over-rated. More importantly, it doesn’t work. Recent studies conclude that multitasking degrades our cognitive performance, said Geoffrey Tumlin, author of Stop Talking, Start Communicating; Play Dumb, Be Boring, Blow Things Off, Lose Your Friends. Tumlin said that multitasking rewires our brains. The results are our work performance suffers.
Take frequent breaks
We’ve been raised to believe that the only way to work is to stick with a task until it’s completed. But using time efficiently and productively is all about renewing energy. It’s also an opportunity to drink water so our bodies don’t become dehydrated. This is especially true when working outside in the hot sun for several hours. It’s important to frequently drink water even though we’re not thirsty. The amount of water needed to keep our bodies hydrated depends upon our body weight and the work we’re doing.
Self-observe
Make it habit to monitor yourself. Human beings are more flexible and adaptable than they realize. We can always improve and do things better and more efficiently if we’re consciously aware of everything we do. This applies to all tasks — simple to complex. There is always a better, smarter and more efficient way to do things. | 3,682 | 1,805 | 0.000576 |
warc | 201704 | North Korea’s latest nuclear test strengthened the sections of public opinion that approve of obtaining nuclear weapons in South Korea and Japan. The test, then, could bring about a chain reaction and accelerate the pace of Japanese and South Korean efforts to possess nuclear weapons. Under these circumstances, China will face not only a threat from the Terminal High Altitude Area Defense (THAAD) system, but also the further deterioration of Northeast Asia’s strategic environment.
In my opinion, the biggest challenge posed to China by this North Korean nuclear test is that South Korea’s domestic support for nuclear weapons may increase. Since Kim Jong-un assumed leadership of North Korea — especially this year — public support for possessing nuclear weapons and turning South Korea into a nuclear state has reached a certain scale. South Korea has been protected by the U.S nuclear umbrella, but now more and more people in South Korea want to build up a domestic nuclear deterrent to balance against North Korea.
On July 1, President Park Geun-hye suddenly decided to deploy the U.S. THAAD system in South Korea. In the following two months, domestic voices advocating for possessing and/or developing nuclear weapons have been constantly coming from South Korea. These voices will get even louder after the latest nuclear test in North Korea. It is said that the tested nuclear warhead was miniaturized, but its blast is estimated to be very large. Readings of the seismic activity in North Korea indicate that the test was very successful. Therefore, South Korea is currently enveloped by the sense of a national security crisis and many now believe that it is not enough to only have United States’ nuclear protection. So North Korea’s nuclear test may further stimulate South Korea to acquire nuclear weapons or develop nuclear weapons, which is also a big challenge for the United States.
Enjoying this article?Click here to subscribe for full access. Just $5 a month.
In fact, strong technical conditions and economic ability would enable South Korea to develop nuclear weapons in a very short time. Of course, for the foreseeable future, it’s still unlikely for South Korea to develop nuclear weapons, either under the present government lead by Park Geun-hye or the next government, which will come to power in February 2018. But we can’t ignore the fact that South Korea’s domestic demand for nuclear weapons is increasing.
Meanwhile, U.S.presidential candidate Donald Trump advocated that both South Korea and Japan should have nuclear weapons. This is actually a tacit admission of South Korea and Japan’s rights to possess nuclear power, which means the United States would no longer bear the responsibility of nuclear protection for Japan and South Korea (or would at least bear less responsibility). As to the matter of whether Japan and South Korea should have nuclear weapons or not, there are divergent opinions in the United States. Should the international political resistance disappear, and the United States no longer control the nuclear weapons policy of Japan and South Korea, it would be a piece of cake for Japan and South Korea to have nuclear weapons, given their own technology and economic strength. Under the current situation, public opinion on possessing nuclear weapon has been strengthened by the North Korea nuclear test. This is very likely to accelerate the pace of Japan and South Korea seeking to possess nuclear weapons.
If Japan and South Korea become nuclear states, the pattern and order of the whole Northeast Asia region would be completely shifted. In the future, if South Korea and North Korea can really form a balance of nuclear deterrence, the situation on the Korean Peninsula may be stable. But before that occurs, the Korean Peninsula could repeat a “Cold War” style pattern. If so, that would also bring China into an unfavorable situation.
Obviously, this nuclear test has hurt China’s national security interests and affected the stability of northeast China, reminding China to resolutely oppose the deployment of THAAD and thoroughly implement the UN’s sanction against North Korea. North Korea chose to carry out the test shortly after the closing of the G20 Hangzhou summit, which is also an overt provocation to global harmony. Altogether, this means that China needs to rethink the North Korea issue thoroughly and make adjustments to some important policies.
Pang Zhongying is a Senior Fellow of the Pangoal Institution and Professor of International Studies at Renmin University, China. The Pangoal Institution is a leading think tank in China, joined by renowned scholars and senior practitioners in China and elsewhere. | 4,782 | 2,077 | 0.00049 |
warc | 201704 | Once again I see the terrible weather the UK and Europe have been enduring - the UK in particular taking the brunt of it - is fuelling the 'Global Warming/Climate Change' hysteria. Yet another 'paper' has been rushed into print claiming that 93% of the 'missing heat' (the gap between reality and climate model predictions) is lurking in the oceans. The Polar Vortex responsible for this battering we are currently enduring is, apparently, caused by the ice loss and warming of the Arctic Ocean. The paper also claims that Antarctica is losing its ice shelves, and the reason for the current increase in ice there is - you got it - global warming 'trapping' a vortex over the continent.
I get fed up with selective quotes, buzz phrases (the users of which seldom actually know what they mean) and headlines like "unprecedented" or "worst XXX in history". I get fed up with being told that something has never happened before, when right in front of us is ample evidence that it has, and may even have been worse. Why did the Victorians build the Embankments along the Thames in London? Why did the coastal authorities in the 17th, 18th and 19th Centuries spend enormous amounts of money (often the landowner's own) and effort building land drains, dykes and sea defences? Because none of these events or storms is "unprecedented" except in the minds of idle ignoramuses who never check their facts and are totally ignorant of any history. In medieval times an entire town vanished overnight in a storm that hit the Frisian coast of Germany. Archaeologists now know that wasn't 'unprecedented' then either. Holland has suffered massive flooding throughout its history, and the Thames suffered 'catastrophic' floods at regular intervals until quite recently. In fact, in February 1928 there was massive flooding in much the same areas now affected, people drowned in the western suburbs of London in the floods. So how is the current flood 'unprecedented'? There can be no doubt that the climate is changing, but to ascribe it, as so many reports do, purely to the Carbon Dioxide emissions of mankind is pure garbage. "Carbon" has become a 'catch-all' word for everything Greenpeace and its devotees cal a 'greenhouse gas' - in which group they now include water vapour. But how many of the idiots who earnestly repeat this trash actually understand anything at all about the 'gases' they deem to be so harmful? Not many if any of the conversations and news reports I am constantly bombarded with are anything to go by. Once again we see the likes of the Labour Leader, and the Minister for the Environment trotting out the buzz phrase that 'we must de-carbonise society' in order to 'prevent catastrophic climate change'. As I have repeatedly said, the day I see proof they can control the rise and fall of the tides, is the day I will subscribe to this trash. Until then, stop running around like Chicken-licken screaming the sky is falling, and let's get real. The answer to climate change - a natural phenomenon that has been happening since the planet first formed - is to adapt. Stop building in flood plains would be a good start. The Somerset Levels were a sea marsh until they were drained in the 18th and 19th Centuries, so were the Fens. The other little wriggle is that we now have probably 30 times the number of people living in Britain than at the beginning of the Industrial Age. Urban sprawl has increased run-off, created 'heat islands' and 'micro-climates' which all mess up the weather patterns - so let's take a look at the effect those have as well. Let's do something positive about finding a reliable and efficient source of electrical energy. I'd love to see the figures for the output of all those damned useless windmills during the storms. I'm prepared to take a bet with the High Street Bookmakers that it was not the vaunted 17% capacity they supposedly give. I'd be surprised if it was as much as 1 or 2% because with the wind speeds reported, most of them will have had to be shut down to prevent damage. So the alternative supplies will have been brought online - massive diesel generating plants quietly installed by the wind generating companies to keep the current flowing when the wind turbines aren't producing. And Drax, the massive coal burning plant currently being converted to burn wood chips imported from Western Canada by rail and ship loads. Yes, I expect that does a huge amount to "de-carbonise" our energy use, Mr Milliband. Yes, let's replace hydrocarbon fuelled vehicles with electric ones - but let's find a more efficient way of using those than with massive and extremely toxic batteries. Let's find better ways to build and insulate our homes. Let's make those less vulnerable and more efficient even if that means replacing and redesigning all the building stock we currently hang onto as if it were the epitome of architectural and construction achievement. Frankly, most of it was substandard when built, and it hasn't improved with age. I'm not talking about real heritage buildings, but, seriously, what is the attraction of a Victorian Terrace built for "t' workers up t' mill"? The rooms are often damp, cramped and even if the house has been renovated, built right onto the street, has no garden and the street outside is choked with the cars not invented when the houses were built. Climate Change, like the tides, is unstoppable. Like the tides, or continental drift, we can't stop it. So let's, for pities sake, stop wasting time and money trying to 'stop' it. It's time to get seriously real. The 'Climate Scientists' can't actually say which way it's going anyway, since nature has, so far, refused to conform to their fantasy models, and while Britain is bombarded by rain and storms, the North American continent is being buried in snow and ice. All down to 'Global Warming' you see. Most of these models are using data that has been 'smoothed' or 'averaged' and 'adjusted' to fit the model, which means the data fed into them is pretty close to being worthless - except in terms of how much money can be extracted from the tax payer to keep funding the circus. So here's a radical idea. Stop funding the research into this. Let the UN pay for it if they can find the money and divert it from the wastage and corruption of that fraudulent organisation. Stop funding the multi-million dollar operations of Greenpeace and Friends of the Earth, etc., all of which are now become purely political (socialist/communist) organisations. Stop subsidising the inefficient wind farms (a wind turbine is, at best, only 27% efficient, whereas a coal fire power station is at least 43% efficient and most likely more). The money saved could be invested in rebuilding our building stock, and in new generating plants with the latest and most efficient technology. Wind and solar won't do it, and neither are as 'clean and green' as their proponents like to argue. I think I really must stop being practical. I wonder of the Church of Climate Change dances and uses tambourines in their worship? Might be good for a laugh ... | 7,094 | 3,483 | 0.000288 |
warc | 201704 | The Metropolitan Police said there had been 60 crimes linked to faith in London so far this year. It saw reports double from 23 in 2013 to 46 in 2014. Half of UK police forces do not record such cases and many local authorities are also unable to provide figures. The NSPCC said authorities "need to ensure they are able to spot the signs of this particular brand of abuse". London is unique in having a police team, Project Violet, dedicated to this type of abuse. Its figures relate to crime reports where officers have flagged a case as involving abuse linked to faith or belief. Many of the cases involve children. Here is one such case that was investigated by the task force: Ibidapo was trafficked to the UK from Nigeria in 2007, to work as a servant for relatives in the North of England. They accused her of being a witch, stopped her going to school and physically assaulted her. She escaped with the help of a Nigerian woman living nearby. "I started living with my aunty at the age of 10, to help her to look after the baby. If my aunty went to work I'd be left with the baby, to do all the housework, wash clothes, cook the food. "Each time the children got sick my aunty would accuse me of being the one responsible for their illness, start calling me a witch, start beating me up, and there was a time that she took me down to church, to a pastor. They were calling me a witch, they were using a broom to beat me. "Sometimes my aunty would look into my eyes and call me a witch. It made me feel rejected, like I'm nobody."
Religion of course is just a socially acceptable label for superstition, and superstition is the gateway to all kinds of abuse in the name of gods, angels, or demons, or punishment for those who do not share their particular superstitions.
Christians in this country are big on pointing the finger at Muslims in the Middle East who behead, stone to death, and mutilate in the name of their religion without acknowledging the many atrocities still being perpetrated around the world in the name of Christianity.
“With or without religion, you would have good people doing good things and evil people doing evil things. But for good people to do evil things, that takes religion.” ― Steven Weinberg
Words to live by. | 2,279 | 1,168 | 0.000866 |
warc | 201704 | Raise your hand if the thought of making dinner every night, while juggling the week’s activities and obligations, makes you want to go back to bed. You can’t see it, but my hand is raised so high that I’m practically touching the ceiling. I enjoy cooking—I really do—but after a long weekday, sometimes I want to pretend that dinnertime isn’t really a necessity. My growling stomach and hungry family do not concur.
Meal planning is a great way to ward off that 5 o’clock “What are we having for dinner?” question, but I’m the first to admit that I’m more of a fly-by-the-seat-of-your-pants kind of gal. That’s where weekly or bi-weekly vegetable prep comes in handy.
If you are able to set aside about 30 minutes once or twice each week, you’ll be rewarded with a fridge full of vegetables that can be tossed into stir-fries, made into slaws, or used to make salads. Peeled and cut veggies are also great for snacking during the day or tucking into lunch boxes.
Not only can you save time by prepping once or twice during the week, rather than chopping every time you cook, but you’ll also avoid the extra clean up time that happens each time you prep vegetables.
Some vegetables last longer than others, which is why I mentioned that you may need to do your vegetable prep two times a week for certain vegetables. Harder vegetables, such as carrots, peppers, and broccoli and cauliflower florets, typically last through the week, while softer vegetables (think tomatoes and cucumbers) usually max out at 3 or 4 days.
Once the vegetables are chopped to the desired size and shape, store them in airtight containers in the refrigerator. With the exception of a few vegetables, I don’t wash the vegetables until I’m ready to cook with them. The extra moisture on the vegetables may cause them to go bad faster.
When preparing lettuce, separate, wash and then dry the leaves. Lettuce spinners are the most effective way to remove excess water. Place the dried leaves into a resealable bag, along with a couple of sheets of paper towel to absorb the water, and store in the refrigerator.
For parsley and cilantro, wash the herbs, shake them dry and wrap them in paper towel before storing in a resealable bag. They should last a week or more in the refrigerator.
Having prepared vegetables at your fingertips will cut your dinner preparation time in half, and may even inspire you to include more vegetables in your meals.
Salads for everyone! | 2,532 | 1,261 | 0.000823 |
warc | 201704 | In today’s digital age, most of us probably spend most of our time connected to the Internet and browsing through lots of information. Spending so much time on the Internet can affect the way you think and process information.
Readers of Nicholas Carr’s 2010 book
The Shallows: What the Internet Is Doing to Our Brains will certainly confirm this. While the Internet is a fantastic tool to conduct business and communicate with friends and colleagues, the constant distractions can and do have an interruptive effect on how we think and learn.
The animation team at Epipheo Studios recently interviewed Carr and put together a video on the topics expressed in
The Shallows.
Think about it! | 706 | 423 | 0.002422 |
warc | 201704 | A new study published at
Political Research Quarterly indicates that many Americans who identify with one of the major parties make their electoral decisions more like a sports fan than an informed voter.
What motivates partisans to vote is "not high-minded, good-government, issue-based goals," says Patrick Miller of the University of Kansas, who co-authored the research with the University of North Carolina's Pamela Johnston Conover. Instead, "It's, 'I hate the other party. I'm going to go out, and we're going to beat them.'"
Using data from the 2010 Cooperative Congressional Election Study, which identified strong and weak partisans and independents on a seven-point range, Miller and Conover's research found that 65 percent of partisans valued their team's victory as much or more than political convictions. Fewer than 15 percent of Democrats and Republicans believed their rivals possessed "core moral traits," and 38 percent of both sides were willing to "use any tactics necessary," including violence and fraud, to win an election. Rivalry increased with age, and the "more partisans are hostile and lean toward incivility, the more active they are politically."
Bonnie Kristian
FBI, CIA, and NSA agents have investigated communications between retired Lt. Gen. Michael Flynn, President Trump's national security adviser, and Russian officials to determine if the contact may have violated laws, people familiar with the matter told
The Wall Street Journal.
It's unclear when the inquiry began or whether any incriminating evidence has been found. Flynn plays a role in setting U.S. policy toward Russia, and the probe is looking into a series of calls Flynn made to the Russian ambassador to the United States, Sergey Kislyak, on Dec. 29, the day the Obama administration announced sanctions against Russia for interfering with the 2016 presidential election. Read more about the investigation at
The Wall Street Journal. Catherine Garcia
The Atlanta Falcons will take on the New England Patriots in Super Bowl 51 on Feb. 5 in Houston.
The Patriots will be making their record ninth appearance in the Super Bowl, while this will only be the second time for the Falcons, who last played in 1998. The Falcons, led by quarterback Matt Ryan, defeated the Green Bay Packers 44-21 in the NFC championship game to advance to the Super Bowl, while the Patriots beat the Pittsburgh Steelers 36-17 in the AFC championship game. Patriots' quarterback Tom Brady began the season with a four-game suspension.
Catherine Garcia
For two hours on Sunday night, every domestic United Airlines flight was grounded due to a computer outage, the Federal Aviation Administration said.
The ground stop was issued at United's request, the FAA said, and international flights were not affected. United blamed the ground stop on "an IT issue," and U.S. officials told NBC News the Aircraft Communications Addressing and Reporting System (ACARS) was having issues with low bandwidth. The ground stop was originally scheduled to end at 8 p.m. ET, but it wasn't lifted until shortly after 9 p.m.
Catherine Garcia
On Monday, a group of well-known Supreme Court litigators, constitutional scholars, and former White House ethics lawyers will file a lawsuit claiming that by letting his hotels and business operations accept payments from foreign governments, President Trump is violating the Constitution,
The New York Times reports.
The team will argue that the Emoluments Clause in the Constitution bans payments from foreign entities to Trump's companies, including those from guests at Trump's hotels and golf courses and loans for his buildings from banks controlled by foreign governments. "The framers of the Constitution were students of history," Deepak Gupta, one of the lawyers behind the suit, told the
Times. "And they understood that one way a republic could fail is if foreign powers could corrupt our elected leaders." The suit is not seeking any monetary damages, but rather that Trump stop taking foreign payments. Trump's lawyers have said the provision does not apply to fair-market payments, like a standard hotel room bill. Catherine Garcia
Pope Francis said in an interview Sunday it would be unwise to judge President Trump so soon after his inauguration, declining to offer an assessment of the new U.S. administration until more time has passed. "I think that we must wait and see. I don't like to get ahead of myself nor judge people prematurely," Francis said. "We will see how he acts, what he does, and then I will have an opinion. But being afraid or rejoicing beforehand because of something that might happen is, in my view, quite unwise."
The pope also issued a warning against turning to magnetic, populist "saviors" in times of fear. "Crises provoke fear, alarm," he mused. "In my opinion, the most obvious example of European populism is Germany in 1933. ... A people that was immersed in a crisis, that looked for its identity, until this charismatic leader came and promised to give their identity back, and he gave them a distorted identity, and we all know what happened."
Bonnie Kristian
Kansas City Royals pitcher Yordano Ventura and former Atlanta Braves, Cleveland Indians, and Arizona Diamondbacks infielder Andy Marte both died in separate car crashes in the Dominican Republic on Sunday.
To the families of Yordano Ventura and Andy Marte. I send my deepest condolences. RIP. pic.twitter.com/mC9EihLMXg
— andrew mccutchen (@TheCUTCH22) January 22, 2017
Just 25, Ventura signed with the Royals in 2008 and finished sixth in the American League Rookie of the Year Award voting in 2014. Marte, 33, was reportedly driving alone when he crashed around 3 a.m. He played seven Major League Baseball seasons, mostly with Cleveland.
Bonnie Kristian
When President Obama arrived in Washington as a freshman senator from Illinois in 2005, he left an annual income of less than $100,000 from his work in the state Senate and as a professor at the University of Chicago Law School. Over the course of his 12 years in the District — four in the Senate and eight in the White House — Obama earned about $20 million, mostly from book deals and his government salary. Here's the breakdown from
Forbes: (Forbes)
Michelle Obama, who worked as a lawyer and in Chicago's City Hall before becoming first lady, is herself worth an estimated $11 million, the bulk of which also comes from a trio of lucrative book deals.
Bonnie Kristian | 6,519 | 3,279 | 0.000308 |
warc | 201704 | I’m not much of a Facebook person. Most of the time, I passively scroll through status updates while avoiding doing something else. Recently, however, I set off a Facebook conversation that lasted for days, with far-flung acquaintances and distant relatives chiming in on what I thought was a perfectly reasonable assertion.
Before I come to that assertion, let me ask you, dear reader, who I trust has at least a passing interest in the nation’s 46th state: Where is Oklahoma? Were someone on the street to ask you this question, you might turn to a political map of the United States and point to the meat cleaver above Texas. There it is, you would say, in the mid-south-central portion of the continental United States. But where is it culturally? Is it part of The South? The U.S. Census Bureau says so. Generations of venerable southern historians, such as C. Vann Woodward, have said so.
And this was the assertion I casually made on Facebook. Actually, what I said was that, as a Southerner, the word “heritage” (as in “Southern heritage”) struck me as slightly sinister, but I wasn’t quite sure why.
I was quickly shot down by the sister of a very good friend, who happens to live in Birmingham. “Oklahoma is not the South, Russ,” she said. “It’s the Midwest.” Another friend in Georgia sprung to my defense. “I’ve lived in the Deep South and Chicago. Oklahoma is definitely more Southern than Midwestern. Still, it’s not quite the South either.”
Listen to This Land Radio explore Oklahoma’s identity crisis.
A Canadian friend was confused. “Where does the South end?” he wanted to know. “Is the South synonymous with the Bible Belt?” In a famous article, one historian asserted that the best way to define the contemporary South was to examine the audience for religious television. The bigger the market share for televangelists, the more southern the place. By this calculation, Tulsa was either the buckle on the Bible Belt, or, at the very least, one of its belt holes.
A good friend who considers a trip to Dallas to be a visit to a foreign country tried to argue that Oklahoma was its own region, that it shouldn’t be lumped together with any other state, especially not Texas. But this seemed strange, too, because there are some affinities between Texas and Oklahoma. Still, Okies have none of the bluster of Texans, and it’s hard to imagine a tourism campaign with the slogan: “Oklahoma, it’s like a whole other country.” We don’t do arrogance. When I was growing up, the slogan on license plates was “Oklahoma is OK.” Not great, not terrible, just OK.
The conversation went on for days. I could sense I was losing the argument. All the Oklahomans who posted seemed to think their native state was in the Midwest. This disturbed me, but why? There was something hopelessly dull and uninteresting about being from the Midwest. Someone else, a friend in New York, agreed. “It’s in the Midwest, but I would rather it be in the South,” she said. Why was the South an improvement on the Midwest? Being from the South had its own set of problems. And what about the Southwest? Maybe we were Southwesterners.
***
Trace the old Route 66 via Interstate 44, and you will eventually come to a town where, depending on which gas station you visit, you will hear a nasally Midwestern accent or a Southern accent. The town is just across the Missouri-Oklahoma line, in Carthage, Missouri. On the southern end of town, near the highway, locals will say “highway forty-four,” but will often turn the number four into two separate syllables: fo-or. Linguists will tell you that this is the hallmark “Southern drawl”: drawing one vowel out to make it sound like two.
On the other end of town, on the road to Kansas City, I-44 becomes pronounced as “farty-far.” I can make this assertion with some authority, having traveled north and south across Missouri many times on my way to college in Iowa, which, unlike Oklahoma, suffers from no regional identity complex. Rolling hills of grain silos, perfectly red barns and miles of corn fields signify, in no uncertain terms, the Midwest.
Iowa, along with Nebraska and South Dakota, has produced a disproportionate share of broadcasters, in part because the accent in these states is considered the most neutral. This is the heartland of a type of English known as General American (SAE, or Standard American English, in another term of art for this accent), a place the linguist William Labov found to be the area most devoid of regional variations and irregular speech patterns. According to Labov’s Atlas of North American English, General American encompasses an oval-shaped blob from eastern Nebraska and South Dakota to central Illinois, taking in much of Iowa and northern Missouri. Walter Cronkite, Ronald Reagan and Tom Brokaw all spent their formative years in General America. General America is where corporations go to test new products to see if they will succeed in the rest of the country. If all the children in Lake Wobegon are above average, all the children in General America are average.
When I first drove across General America in the early 1990s, I was shocked to learn how different it was from Oklahoma, which I always assumed was the most generic, milquetoast place in the world. The towns of General America, however, were tidier and straighter than anything I had seen in Oklahoma. The churches were whiter. The town squares looked like settings for Normal Rockwell paintings. So many small towns in Oklahoma looked like they’d just been hit by F-5 tornadoes or served as a setting for a movie about rural meth labs.
I also assumed that anyone not from a city spoke with an Oklahoma accent, which traces its genealogy back to Appalachia—a variation on the Southern accent. When I met my first roommate, Jake, from Hawarden, Iowa (population 2,478) at the University of Iowa, I was surprised he spoke General American. He looked like a hick in his tight Wranglers, mullet, and Metallica t-shirt, and yet he spoke without a trace of an accent. I expected his accent to be something like that of Boomhauer’s from King of the Hill: a twangy, monotone slur. (The creator of the show, Mike Judge, has stated that the inspiration for Boomhauer’s accent came from an unintelligible phone conversation he once had with a man from Oklahoma City.) My roommate also had three more Advanced Placement credits than I did, completing the ruin of my sense of intellectual and cultural superiority.
Even more shocking than all this was learning that I had an accent. I shared a phone with Jake and two guys from Chicago next door. The Chicagoans drank Old Style beer at 8 a.m. and skipped class to watch hockey. One day, I discovered that I was missing a pair of socks and asked them about it.
“You’re missing what?” one of them said.
“Socks,” I said. “I can’t find my socks.”
The one I had been talking to went to find his roommate. He brought him into the common area, where we shared a refrigerator and a telephone.
“I can’t understand this guy,” one Chicagoan said to the other. “What are you missing?”
“My socks!” I said. “You put them on your feet.”
“Sacks,” said the other one. “He’s saying ‘sacks.’ ” They laughed and then mocked me. “Saw-ahks,” they said. “I cain’t find my saw-ahks. Shi-it!” To their ears, I sounded like an Alabama redneck.
So I set about detecting regionalisms in my speech and purging them one by one with the help of a fellow English major from Chicago. Greasy was not pronounced with a “z” sound but with an “s” sound. Words ending in “-ow” were pronounced with an “oh” sound, not with an “-uh” sound. “Pen” and “pin” were pronounced differently. “Milk” was one syllable, not “mi-yulk.”
Going back to Tulsa, I noticed that somewhere south of Kansas City, Standard American gave way to Southern twang, leading me to eventually pinpoint Carthage as the transition zone. A 2004 study of national speech patterns boiled American dialects down to six major groupings. Northeastern Oklahoma and southern Missouri are the northwestern limits of the southern accent, while the “midland,” that area from northern Missouri to Iowa, Nebraska and Illinois, was found to be the region with the fewest deviations from Standard American.
***
Even if we Okies have a sort of Southern accent, though, that doesn’t make us Southerners. The Census Bureau may designate Oklahoma as the South, but what explains the visceral reaction of Georgians and Alabamans when an Okie claims to be from Dixie? A friend of a friend from Tulsa replicated my Facebook experiment and was shot down by from someone from Arkansas. “It’s the Southwest,” he wrote. “The South starts with Arkansas.” The next person to post was confused. “Upper central mid south west?” she wrote. “Please let me know what the answer is.”
A friend of a friend who works for Southern Living magazine was sort of annoyed that Oklahoma was included in her lifestyle magazine. “It was a marketing decision,” she said. “Everyone knows Oklahoma isn’t in the real South.” But where is the real South?
There was a time in the not-too-distant past when Oklahoma politicians made a deliberate effort to make the state part of the “Solid South,” a peculiar institution that guaranteed the one-party rule of the Democratic Party. The heyday of the “Solid South” lasted from the end of Reconstruction until the end of World War II. The strategy was all about, of course, disenfranchising black voters and wielding monolithic political control over state politics. Danney Goble, the recently deceased Oklahoma historian, explains it this way in the Encyclopedia of Oklahoma History and Culture:
The fact that much of the future state was settled by immigrating southerners had great influence on Oklahoma’s later politics. Its unwieldy constitution, its distrust of concentrated corporate and political power, its steady run-ins with federal authority, even its susceptibility to political corruption–all of these were qualities that the Sooner State shared with states of the Old Confederacy…Early Oklahoma Democrats campaigned and governed just like their fellow Democrats across the South: they openly and bluntly proclaimed their racism to win power, and they used power to affirm and institutionalize their racism. It was they who mandated separate schools under the constitution; they who segregated public transportation in Oklahoma’s first statute; they who countenanced “white only” public accommodations, neighborhoods, even entire towns; they who systematically disenfranchised blacks with racist election laws.
****
The geographer Wilbur Zelinsky—one of the inventors of modern cultural geography—attempted to understand regional identity in the “vernacular.” Zelinsky wanted to understand how everyday folks defined themselves in terms of regional identity. This was in the pre-Internet age of the 1970s and 1980s, and Zelinsky focused on the Yellow Pages. The telephone book, unlike, say, the Census Bureau, would give you a good idea of the regional place names that people used to identify themselves and their businesses.
Sorting through thousands of place names in hundreds of cities, he compiled a series of maps that showed how people identified their regions. Some of the regions were predictable: Boston businesses used a lot of terms like New England and Northeastern in their names or descriptions. “Southern” was a dominant term in phone books in Mississippi, Louisiana, Georgia, etc. But, looking at Zelinksy’s maps today, it is Oklahoma that shows the biggest regional confusion. Strangely, Zelinsky never commented on this fact. He noted that some places, like western Pennsylvania, were kind of stuck between Northeastern and Midwestern, but it was Oklahoma that had the greatest amount of regional identities. Five of the twelve vernacular identities that Zelinsky came up with converged on Oklahoma. For phone books in the very southeastern part of the state, Oklahoma was southern. In the panhandle, it was the “West.” Along the Kansas border, it was the Midwest. From Oklahoma City to the west, it was the “southwest.”
Part of the problem with Zelinsky’s research, though, is that it is static. It doesn’t take into account the way regional identities change. Minnesota was once considered the Northwest; it is now firmly ensconced in the Midwest. Maryland was once considered the South, but few people would today characterize it as anything other than the Mid-Atlantic.
The Midwest, in general, seems to be gaining ground, expanding its reach beyond its western and southern boundaries. In 2006, NPR, while reporting on an outbreak of tornadoes in Tennessee, referred to the state as the Midwest. If the Midwest is the region of Standard American, this seems to make sense, at least on the surface. The common wisdom is that the proliferation of mainstream popular culture through TV, the Internet, and social media is destroying regional identities, making us all one undifferentiated mass of Starbucks coffee shops and crappy reality television. Socio-linguists, however, have found that the opposite is true—at least in terms of regional vocabularies and dialects. New dialects are being born: California used to speak Standard American but now has its own accent and regional variations are becoming more—not less—pronounced.
***
There is always the case for the Southwest. But Oklahoma doesn’t quite fit there either because the proper Southwest is a legacy of what was once Mexico, and, before that, the Spanish Empire. West Texas, New Mexico, Arizona, some of Colorado: all these places have Hispanic place names and visible relics of Spain and Mexico. Apart from El Reno—and one has to doubt that there were ever any reindeer (Reno is Spanish for reindeer) in central Oklahoma—there are no Spanish place names in Oklahoma. Coronado, apparently, wandered through the Wichita Mountains and lost a few pounds of gold along the way, but there are no missions, no pueblos. Our only decent Mexican food comes from recent migration patterns; in short, we have nothing that Americans recognize as archetypes of Southwestern culture.
Finally, in moments of brutal honesty, Okies will admit that their state is a variation of Texas. This is a painful admission, to be sure. “The whole state is like a suburb of Dallas,” a fellow Tulsan told a Canadian friend. “It’s Texas-light,” someone wrote during my interminable Facebook conversation. Politically, culturally and religiously speaking, there’s a good case to be made for this assertion. Texans and Oklahomans share the same affinity for hard-right, red-meat conservative politics, and they have large populations of Southern Baptists. Western Swing is a purely Texas-Oklahoma creation of Bob Wills, who belongs to both states. The accent is pretty much the same, although a bit stronger in Texas. There’s the big role oil companies play in the states’ economies. And, of course, there’s football. Both states are football crazed, but therein lies a complication: there is no greater sports hatred than that between the Sooners and the Longhorns.
I’ve tried to deconstruct the annual hatefest that is the OU-Texas game for my wife, a native Californian, who, before meeting me, had never watched a college football game. Part of what makes the game exciting, I told her, is that it’s played on a neutral site. So it’s not in Texas or Oklahoma, she wondered? Well, it’s in Dallas, I said. The idea that Dallas was somehow neutral seemed ludicrous, and, indeed, the more I thought about it, the more it seemed like Oklahomans had been bamboozled.
So, where is Oklahoma? It is in America’s Heart, someone said. Well, not quite, I rebutted. If you compare the map of the continental U.S. to the human body, you would have to conclude that Oklahoma is America’s pancreas. It’s in the mid-south-central of the body, and, although it doesn’t have the poetic resonance of the heart, it serves an important function. It breaks down proteins, carbs and fats. The pancreas is often overlooked until something terrible happens there, like a cancer—or the bombing of a federal building. But there it is, right there in the middle of everything, trying to make sense of all the substances coming through the system. Not all the substances that come through are healthy, but the pancreas soldiers on, keeping the body running.
Editor’s note: This story was originally published April 10, 2011. | 17,198 | 7,484 | 0.00014 |
warc | 201704 | (RCL) Proverbs 31:10-31 and Psalm 1; James 3:13-4:3, 7-8a; Mark 9:30-37
Have mercy on me, O Lord, for I have cried to Thee all the day; for Thou, O Lord, art sweet and mild, and plenteous in mercy to all that call upon Thee. -- ( 85. 1). Bow down Thine ear to me, O Lord, and hear me; for I am needy and poor Introit: Grant us, O Lord, not to mind earthly things, but to love things heavenly; and even now, while we are placed among things that are passing away, to cleave to those that shall abide; through Jesus Christ our Lord, who liveth and reigneth with thee and the Holy Spirit, one God, for ever Collect:
Collect:
and ever. Amen.
Jesus left with his disciples and started through Galilee. He did not want anyone to know about it, because he was teaching the disciples that the Son of Man would be handed over to people who would kill him. But three days later he would rise to life. The disciples did not understand what Jesus meant, and they were afraid to ask. Jesus and his disciples went to his home in Capernaum. After they were inside the house, Jesus asked them, "What were you arguing about along the way?" They had been arguing about which one of them was the greatest, and so they did not answer. After Jesus sat down and told the twelve disciples to gather around him, he said, "If you want the place of honor, you must become a slave and serve others! Then Jesus had a child stand near him. He put his arm around the child and said, "When you welcome even a child because of me, you welcome me. And when you welcome me, you welcome the one who sent me." Gospel:
Gospel:
This is true for James, especially. You don’t often hear people say that the letter from James is their favorite. Maybe it’s not used often enough, or maybe it makes us uncomfortable, but we must admit that James is nothing if not practical. James’ very practical outline of behaviors and exhortations on what one must do to live a Christian life is very, well, no nonsense. James really spoke out to his readers back then, but today’s bit of James should still give us a lot to think about. In fact, if it doesn’t, then the bumper sticker that should be speaking to us is the one that says, “If you’re not outraged, you’re not paying attention.”
Listen again to what James says: “Those conflicts and disputes among you … do they not come from your cravings that are at war within you? You want something and do not have it; so you commit murder. You covet something and cannot obtain it; so you engage in disputes and conflicts.”
That almost hurts to read out loud because it’s so true. Look at the world we live in. Many of us continue to ask why, in this day and age, the only way we seem to be able to deal with problems among the countries of the world is to arm mostly the poor and kill until someone gives up or one side has no one left standing.
But even closer to home, look at our own congregations. “Those conflicts and disputes among you, where do they come from?” James writes. Where indeed? What is it about us church folks that makes it so much easier to exclude than include, when we should know better. What Christian can’t recite by heart the two great commandments: love God and love your neighbor as yourself. And the bumper sticker adds, “No exceptions.” What don’t we understand about what we can recite by heart?
And then, of course, we have to look at ourselves. It gets really uncomfortable when we read “Adulterers! Do you not know that friendship with the world is enmity with God? Therefore whoever wishes to be a friend of the world becomes an enemy of God.” Jesus says pretty much the same thing in the gospels – but “adulterers”? That seems a little harsh.
And we can wonder what’s so wrong with “the world.” The world, after all, is beautiful – it’s a gift from God, not something that should put us at enmity with God. But that’s not what Jesus and James were talking about when they used the word “world.” They were referring instead to the “operating system,” so to speak, of the world; the way we interact with each other, the systems we set up to run the world, our rules. That’s where we get into trouble. That’s where we let our conflicts and disputes, our cravings and selfish ambitions prevent us from truly living out those two great commandments that we all say we believe.
And then there’s that rather scary reading from Wisdom. “The ungodly by their words and deeds summoned death; considering him a friend, they made a covenant with him, because they are fit to belong to his company.”
Well, surely that’s not any of us: “ungodly … summoning death … belonging to his company.” That’s the stuff of a Stephen King novel, this personification of evil. So, we can comfortably read on until we get to verse 10:
“Let us oppress the poor man; let us not regard the grey hairs of the aged, let our might be our law of right, for what is weak proves itself to be useless.”Like James, she talks about an orderliness in the world. She reminds us that “The world as a whole is shaped by Wisdom’s guidance. … This ordering is a righteous one, inimical to exploitation and oppression. Sophia hates the ways of arrogance and evil but works to establish just governance on the earth.” Sophia(“Wisdom”) works to establish justice and righteousness.
Wisdom is a fascinating image. We use it to talk about the nature of God, we use it to describe the gift of understanding that we seek from God. Wisdom is personified as the most hospitable of women. Elizabeth Johnson describes this feminine aspect of wisdom:Women can’t leave the doing of justice and the spreading of the Good News to men, and vice versa. We’re all expected to share that work. So there is good news in today’s readings.
And of course, we only read one small bit of Wisdom this morning. If we’d read just a few more verses, we would have come to that most beautiful passage that’s often read at funerals:
“The souls of the righteous are in the hand of God, and no torment will ever touch them. In the eyes of the foolish they seemed to have died, and their departure was thought to be a disaster, and their going from us to be their destruction; but they are at peace – their hope is full of immortality.”That speaks of the dead, but it also speaks of us who still live in this world, especially if we believe in the communion of the saints as we say we do in the Creed. All of us – those who have gone before us and those of us still here – are connected. We’re all kin, all a part of the people of God.
So, to play with this passage a little: “All those who are righteous are in the hand of God. In the eyes of the foolish, the righteous may seem to be weak, to be useless; but they have peace. They have hope, and that hope is full of the promise of immortality.”
And isn’t that God’s promise? Isn’t that what we hope for finally, for union with God? We can experience that here as well as in the hereafter, and part of our ministry is to make sure that we welcome all our brothers and sisters on that journey.
These readings give us a lot to think about. This is just a start, and there’s good news all though it. Because even when we’re brought up short and challenged about how we’re living, and even when we’re at our most unlovable, there’s always the promise of God’s love for us.
Several chapters later in Wisdom we read:
“But you, our God, are kind and true, patient, and ruling all things in mercy. For even if we sin we are yours.”Thanks be to God!
-- The Rev. Dr. Susanna Metz is executive director of the Center for Ministry in Small Churches at the School of Theology, Sewanee, Tennessee, and assistant professor of Contextual Education. She is also publisher of "Tuesday Morning," a quarterly journal of ministry and liturgical preaching. | 8,158 | 3,718 | 0.000283 |
warc | 201704 | This is the Newt Gingrich I fell in love with and am glad to see return!!!
Thanks to Newt, I have three new words to think about are "Secular Socialist Machine". You know that's gonna drive the Obamunists mad over the next three years.
Here is the full speech Newt gave at the Southern Republican Leadership Conference:
Newt Gingrich is well-known as the architect of the “Contract with America” that led the Republican Party to victory in 1994 by capturing the majority in the U.S. House for the first time in forty years. After he was elected Speaker, he disrupted the status quo by moving power out of Washington and back to the American people. Under his leadership, Congress passed welfare reform, passed the first balanced budget in a generation, and passed the first tax cut in sixteen years. In addition, the Congress restored funding to strengthen our defense and intelligence capabilities, an action later lauded by the bipartisan 9/11 Commission.
In his post-Speaker role, Newt has become one of the most highly sought-after public speakers, accepting invitations to speak before some of the most prestigious organizations in the world. Because of his own unquenchable thirst for knowledge, Newt is able to share unique and unparalleled insights on a wide range of topics. His audiences find him to be not only an educational but also an inspirational speaker.
Widely recognized for his commitment to a better system of health for all Americans, his leadership helped save Medicare from bankruptcy, prompted FDA reform to help the seriously ill and initiated a new focus on research, prevention, and wellness. His contributions have been so great that the American Diabetes Association awarded him their highest non-medical award and the March of Dimes named him their 1995 Citizen of the Year. Today he serves as a Board Member of the Juvenile Diabetes Research Foundation.
In his book, Saving Lives and Saving Money, Newt describes his vision of a 21st Century System of Health and Healthcare that is centered on the individual, prevention focused, knowledge intense, and innovation rich. Moreover, he makes the case for a market-mediated system that will improve choice and quality while driving down costs. To foster such a modern health system that provides better outcomes at lower cost, Newt launched the Center for Health Transformation.
Newt also serves with former Senator Bob Kerrey as Co-chairman of the National Commission for Quality Long-term Care. The commission will make recommendations to policymakers and the public on how to transform healthcare services for the frail elderly and disabled in order to maximize independence and achieve a high quality of life and quality of care for our aging population.
Recognized internationally as an expert on world history, military issues, and international affairs, Newt serves as a Member of the Defense Policy Board. Newt is the longest-serving teacher of the Joint War Fighting course for Major Generals. He also teaches officers from all five services as a Distinguished Visiting Scholar and Professor at the National Defense University . Newt serves on the Terrorism Task Force for the Council on Foreign Relations. He is an Editorial Board Member of the Johns Hopkins University journal, Biosecurity and Bioterrorism, and is an Advisory Board Member of the Foundation for the Defense of Democracies. Recently, Newt was named co-Chair of the UN Task Force, a bi-partisan Congressional effort to reform the United Nations.
In 1999, Gingrich was appointed to the United States Commission on National Security/21st Century, the Hart/Rudman Commission to examine our national security challenges as far out as 2025. The Commission’s report is the most profound rethinking of defense strategy since 1947. The report concluded that the number one threat to the United States was the likelihood over the next 25 years of a weapon of mass destruction — nuclear, chemical, and/or biological being used against one or more major cities unless our defense and intelligence structures underwent a massive transformation. That report was published six months before September 11.
Because of his work on the Commission, Newt Gingrich is credited with the idea contained in the report of a Homeland Security Agency with a Secretary to serve on the Cabinet level. President George W. Bush has since created the Department of Homeland Security.
Newt Gingrich is Chairman of the Gingrich Group, a communications and consulting firm that specializes in transformational change, with offices in Atlanta and Washington, DC . He serves as General Chairman of American Solutions for Winning the Future, is a Senior Fellow at the American Enterprise Institute in Washington, DC, a Distinguished Visiting Fellow at the Hoover Institution at Stanford University in Palo Alto, California and is an Honorary Chairman of the NanoBusiness Alliance. Newt is also a news and political analyst for the Fox News Channel.
Newt Gingrich is a leading advocate of increased Federal funding for basic science research. In 2001, he was the recipient of the Science Coalition’s first Science Pioneer award, given to him for his outstanding contributions to educating the public about science and its benefits to society.
A strong advocate of volunteerism, Gingrich has long championed the positive impact every individual can have on society. He has raised millions of dollars for charity, donating both time and money to a wide array of causes, including Habitat for Humanity, United Cerebral Palsy, the American Cancer Society, and ZooAtlanta. A former environmental studies professor, he is widely recognized for his commitment to the environment and to the advancement of a new, common-sense environmentalism. In 1998, the Georgia Wildlife Federation named him Legislative Conservationist of the Year.
Newt was first elected to Congress in 1978 where he served the Sixth District of Georgia for twenty years. In 1995, he was elected Speaker of the U.S. House of Representatives where he served until 1999. The Washington Times has called him “the indispensable leader” and Time magazine, in naming him Man of the Year for 1995, said, “Leaders make things possible. Exceptional leaders make them inevitable. Newt Gingrich belongs in the category of the exceptional.”
His experiences as the son of a career soldier convinced him at an early age to dedicate his life to his country and to the protection of freedom. Realizing the importance of understanding the past in order to protect the future, he immersed himself in the study of history, receiving his Bachelor’s degree from Emory University and Master’s and Doctorate in Modern European History from Tulane University . Before his election to Congress, he taught History and Environmental Studies at West Georgia College for eight years.
He resides in Virginia with his wife, Callista. The Gingrich family includes two daughters, two sons-in-law and two grandchildren. | 7,038 | 3,358 | 0.000301 |
warc | 201704 | I’m going to comment on this article:
Craig never defends his claim that nothing temporary has significance or its implication that all temporary things are equally insignificant. He only repeats it, many times, as if it should be obvious. But is it true that nothing temporary has significance?
Has Craig argued that nothing temporary has significance? Or has he argued that human life lacks significance if we pass into oblivion? I don’t see why Craig’s contention wouldn't be true unless it's a special case of a general claim about all temporary things. That would only follow if human lives are analogous to everything else. For instance, a human being is not a falling leaf.
Think about great music or drama. Does a world-class performance of Tosca or King Lear lack significance just because it lasts only a few hours? Would it have more significance if it never ended? Hardly. Its significance in fact depends on its having a finite arc; it would lose its significance and become unbearably tedious if it went on forever. Nor does its finite length make it just as insignificant as an equally long nap. Clearly, then, we need a better measure of significance than mere duration.
That comparison is simplistic. What if, an hour after the performance, the audience suffered collective amnesia. No one remembered the performance. What’s the point of a world-class performance of Tosca or King Lear if it’s instantly forgotten?
There’s a reason we invented recording technology. We think it’s a waste if a great performance comes and goes without a trace. We try to preserve the past.
Likewise, we record (or photograph) things because we often want to hear or see the same thing more than one.
We know that people often try to make their lives significant by seeking purposes “greater than themselves.”...This version of the argument starts with the question “What’s so great about feeding starving children?” An answer comes pretty easily: “It relieves suffering by innocents and gives them a chance to flourish.” But notice that we can use our imagination to “step back” from that answer: imagine looking at Earth from a billion miles away or looking back from a billion years in the future. Having stepped back, we can ask: “What is (or was) so great about doing that?” Step back far enough and any purpose can begin to look small and trivial in the vastness of time and space. It’s a familiar enough idea that you can make something look insignificant, or even reveal its true insignificance, by stepping back from it. Think of parents who try to convince their tearful child that an embarrassing incident at school isn’t really a reason to stop living. The argument exploits our ability to take the long view—to occupy a standpoint that makes any purpose questionable, no matter how significant it seems: Why bother pursuing that purpose? It’s not hard to get going down this path, as we’ve seen, and soon we may find ourselves seeking a purpose that transcends the limits of our earthly existence. “Our lives can’t have significance,” we may conclude, “unless their significance goes beyond our time on Earth.”
Several problems with Maitzen’s objection:
i) It isn’t clear how Maitzen went from ultimate significance to greatness. Something doesn’t have to be great to be good or worthwhile.
ii) Doing something “greater than ourselves” is a way of saying it serves a larger purpose. “Greater,” not in the sense of excellence, but teleology. What makes it important is that it’s part of something important. It contributes to something beyond itself. A part/whole, means/ends relation.
iii) Maitzen overlooks the asymmetry between a secular outlook and a Christian outlook at this juncture. From his atheistic standpoint, taking the long-range view of any particular event dilutes the significance of that event: “Step back far enough and any purpose can begin to look small and trivial in the vastness of time and space.”
But it’s just the opposite from a Christian standpoint: Because our little lives are purposeful in the great scheme of things, the long-range view enhances rather than diminishes the significance of our tiny lives and deeds. Even the lives of the damned are significance.
From a Calvinistic perspective, every life is special, for God wrote the story of everybody’s life. He wrote the story of your life. And my life. Customized. A unique narrative for each and every life. God planned every experience you have, down to the last detail.
And each life-story is part of a larger story. Interlocking stories. Synchronic and diachronic stories.
The smallness of our lives doesn’t make them insignificant. There can be meaning in miniature. God made us small. That’s good.
God’s story for the world is like the Mandelbrot set. There are lower scales of meaning as well as higher scales of meaning. Microscopic meaning as well as macroscopic meaning. Just what happens in one place on one day is packed with meaning. Higher resolution discloses ever more detail.
You can’t put an end to those pesky questions, no matter what you do. Any purpose that we can begin to understand, we can step back from and question. Consider what theistic religions offer as God’s actual purpose for our lives: glorifying him and enjoying his presence forever. Surely we can ask—I hereby do ask—“What’s so great about that?”
i) Even if it weren’t “so great,” something doesn’t have to be the greatest to be significant.
ii) If we were made to glorify God, if our fulfillment lies in doing what we were designed to do, then that’s significant.
For instance, a homosexual is physically and emotionally frustrated, for he wasn’t designed to find sexual fulfillment in another man.
Now, my opponent might offer this proposal: “Sure, we’d be disappointed to discover that we’re mere CO2 factories, so that can’t be our ultimate purpose. But if God had made us merely to produce CO2, then we’d find that purpose satisfying and would feel no inclination to question it. God adjusts our intellects and aspirations to fit the purpose he gives us.” But this reply is just speculation...
i) There’s a sense in which the whole debate is speculative. So what? That’s what philosophers do. Maitzen is a philosophy prof.
ii) But what’s so speculative? If, in fact, we were merely designed to produce CO2, then we’d find that satisfying. Then again, we might lack the intellect to find it either satisfying or dissatisfying. Does a clam find life satisfying? The question is inapplicable.
Conversely, if we find it boring to merely produce CO2, that’s because we were designed to find other things interesting. So Maitzen has postulated a false dilemma.
If we seek an absolute stopping point in our quest for purpose and significance, we’ll inevitably come up empty. Ultimate purpose can’t exist even if God does; it’s a fantasy that shouldn’t draw anyone to theism.
If human nature was designed by a wise Creator, then doing what we were made to do is, indeed, ultimately significant.
That’s hardly analogous to atheism, where men are the incidental byproduct of a mindless amoral process. | 7,472 | 3,245 | 0.000325 |
warc | 201704 | Solid Sasquatch and the 'Goblin Universe' Primary tabs
The concerned public are attending an open meeting held by military personnel. It is to address the matter of UFO sightings. The press and witnesses are also there. A military spokesman, attempting to defuse things, makes a passing mention of Bigfoot. As if on cue an elderly good old boy pipes up and tells a party piece about his close encounter with the big hairy guy. All the cameras zoom in on him. The military man smiles with approval. A collective groan rises up from the other attendees.
You will no doubt recognise this as a sequence from
Close Encounters of the Third Kind (1977). It serves to show how, even in those days, the subject of man-like apes and unusual airborne phenomena were intertwined. This was, and is, to the chagrin of both. Not only that, but both UFOs and Sasquatch have to share the same bed with other trickier customers like telekinesis and poltergeists.
The august British primatologist John Napier was all too aware of this. Writing on unknown man-like apes in 1973 he invented the term `Goblin Universe` to describe the fringe end of his area of study. He even asks his readers to excuse him should he himself fall into `the rabbit hole` of such thinking.
Nevertheless, as uncomfortable as it may be, the sasquatch/ufo/psychic link cannot be so easily shrugged off. It is more than merely the overheated imaginations of journalists of the paranormal: it is to be found in witness statements.
Let us take some representative samples.
On 25
th October 1975 a young farmer in the Eastern States of America was shocked when he saw a glowing red sphere alight in a nearby filed. He grabbed his gun, and a friend and his ten year old brother went to see what it was. On reaching the object they found it to be flanked by man-like apes which then made towards them. Even having bullets shot at them did not deter their advance. Only when the sphere took leave did these hairy beings lose interest and walk off into some nearby woods. [Matthews, 111].
Claims like these belong to a category of `Eastern bigfoot` sightings which peaked in the 1970’s. In these, the Sasquatch, far from being his usual retiring self seems...abominable. He often has glowing red eyes, for example, and is hostile. Only a minority of these tales involve UFOs, but it is difficult not to note that they occur in a time and place where there was a `UFO flap`.
Before it is said that these types of tales belong only to the land of B-movie sensationalism, it is also the case that they tally with accounts from elsewhere. Let us go to Russia.
The Saint Petersburg based unexplained interest magazine
Twentieth Century Secrets (No 17, April 2012) tells of how a bus driver, en route from Novosibirsk to Kemerovo, had to brake quickly on seeing a large ape-like figure on the road twenty yards before him. Then, in just as sudden a way, it vanished into thin air – a fact which was witnessed by thirty passengers on the bus.
Ina piece by Mikhail Efimov in the magazine
N.L.O -N.L.O being the Russian equivalent of U.F.O- records (No.5 702, March 2012)how the Russian yeti advocate Valentin Sapunov and an `environmental scientist` spent the night in a forest in Malaya Vishera region. This is a remote area between St Petersburg and Moscow and is reputed to be a place of Sasquatch activity. They were not blessed with a sighting, but instead they were both gripped by an aura of fear. They put this down to a warning signal from a nearby Sasquatch.
This sense of Sasquatch as being otherworldly is not a new New Age fancy; it is how older cultures first viewed them. Myra Shackley noted how the native people of Western Siberia – the Khanti-Mansisk – would talk of the` leskii `(wood goblin). This would cause dogs to bark and had eyes `glowing like lanterns`. Just to mention them could cause bad luck. (P-130-131 Shackley). Similarly, some say that the Native Americans hold a belief that the arrival of the Sasquatch is a sign of approaching environmental catastrophe. (p-44, Randles). In keeping with this idea, a Russian TV show called `Life Themes` was shown this March called `Forest Monsters` which proposed that the sasquat
ch was a non-technological branch of humanity that had developed high level psychic powers in place of technological prowess.
In UFO speculation there has long been something of a schism between the nuts and bolts advocates and those who allow for parapsychological approaches; those who want to kick the tyres of the things and those who talk of them in the same breath as ghosts and telepathy. This is paralleled in Sasquatch research too. Many are anxious to place Sasquatch alongside recently discovered animals such as the gorilla and panda, perhaps as a surviving Gigantopithecus relic. Thus they turn pale at hints of a psychic dimension to it all. This they see as a slippery slope leading to talk of `crystal healing energies` ,`channelling` and ` shape-shifting reptiles`: the `Goblin Universe` writ large.
Besides to claim that a corpse of the sasquatch has never been found because it is an `interdimensional being` looks too much like a case of special pleading. As much as modern physicists, and science fiction writers, may talk glibly of the `multiverse`, to use this as an excuse for lack of biological evidence is too much of a stretch for many. The next step would be to join Conan-Doyle and go and consort with cardboard cut-out fairies at the bottom of someone’s garden.
Worse yet, there is a feeling that parapsychological explanations open the door to psychiatric ones. If a Sasquatch dematerialises and cannot be shot down, then perhaps this is because it was nothing more than a mass hallucination triggered by hysteria.
The rift came to a boil in Washington. On 24
th June 1989 the Washington Department of Anthropology at the State University there joined with the International Society of Cryptozoology to hold a Sasquatch Symposium. One of the guest speakers was John Lapseritis. He is a firm advocate of the sasquatch/psychic link. Scarcely has he opened his mouth when one Rene Dahinden, a very familiar name in the field, protested at his very presence in a vocal way (Mathews, 113).
That as may be, even a few evenings spent looking over the books, magazine articles and internet blogs on the Sasquatch phenomenon worldwide will tell you that Lapseritis was not a one off freak. The creature may leave physical traces: such as footprints, hair, photographs, smells, nests and recorded howls, yet the witnesses often speak of something uncanny. It can turn transparent, disappear, have luminous eyes, make dogs to go into frenzy, ignore being shot at, can project feelings of anxiety and, sometimes, consort with UFOs.
We can choose to square up to this quandary with one of the following arguments:
(i) Sasquatch devotees and UFO-nuts are all of apiece: it is hardly surprising that a person who sees a Sasquatch might also see, ghosts, UFOs, etc.
(ii) The phenomena are both real. They are a part of the same psychic continuum, and are not to be taken separately.
(iii) That both solid Sasquatch and parapsychological Sasquatch are real, but they are distinct phenomenon, perhaps only related in a distant way.
(iv) That the apparent correlation between Sasquatch and other paranormal occurrences are statistically negligible enough to be seen as coincidental.
Whatever position you choose it is time for the speculation to be put on hold and for man-like ape research to get down to brass tacks. All the secondary evidence need to be collated without prejudice. If some of this seems to point towards the `Goblin Universe` then so be it. Equally though, we should not be too quick to assume that we are dealing with anything other than life as we know it.
Edward Crabtree,
March 2013.
References. Matthews, Rupert Bigfoot: True Life Encounters with Legendary Ape-Men (London:Arcturus Publishing Limited, 2008) Randles, Jenny Truly Weird: Real Life Cases of the Paranormal (London: Colins & Brown Ltd, 1998) Shackley, Myra Wildmen: Yeti, Sasquatch and Neanderthal Enigma (London: Thames and Hudson, 1983) | 8,189 | 4,108 | 0.000245 |
warc | 201704 | We all know that too much sun is bad for us, and we're well aware we should cover up and use high-factor creams to protect our skin from premature ageing. But that doesn't stop us thinking that sun-kissed skin looks healthy and attractive. And this is where self-tanning products come into the picture.
The sun's rays reduce skin collagen levels elasticity causing wrinkles, sagging and slackness. The skin also suffers photo-ageing, as evidenced by ugly blemishes (hyper-pigmentation, oversized freckles, solar lentigines or liver spots). For women over 40, this is one of the main reasons for turning to the beauty salon for assistance, but it is becoming more and more common in younger women, many of whom are already seeing the effects of exposure to the sun as young as age 30 when they find they have essentially used up their solar capital. In recent years, though, aesthetic and cosmetic advances allow us to enjoy a good skin colour without undue exposure to sunlight. Self-tanners hold the key, so let's look at how to get the best results from a product applied at home: A two-person task If you want to do the job properly, you're going to have to ask someone else to help. Plan ahead for best results or you'll get half way through and then remember you can't reach your own back, only to end up with patches and streaking. Start with clean, exfoliated skin Shower thoroughly and exfoliate, but don't apply a moisturiser before using the self-tanner. (One of the reasons for the shower is to remove all traces of any products you've used previously.) Now you've got a clean, smooth base on which to work. Follow a careful sequence of application To make sure the results appear natural, you should carefully plan and follow the order in which you apply the self-tanning product, rather than skipping between areas at random. We recommend starting at the ankles. Avoid the soles of the feet altogether, and simply smooth the excess of product from the ankle down over the instep as this is an area that will tend to get very dark. From the ankles move up the legs, applying the product using a circular motion and being careful to distribute it evenly. Move on to the buttocks, abdomen, breasts and shoulders. As with the insteps, smooth the excess product from the cleavage area to the neck to avoid over-colouring. Finally, move on to the arms – don't forget to apply a small quantity to the armpits – and smooth the excess down onto the backs of the hands. You should then immediately wash your hands with soap, concentrating on the palms and between the fingers but without scrubbing at the backs of the hands. This still leaves that most inaccessible area, the back, for which you really need the help of another person. Remember that you should spread the product out evenly making sure that no patches are left uncovered and that there is no excess anywhere. Try to apply the same quantity all over to avoid streaking and achieve a natural look. How long before re-applying? This will depend on the product – some are longer lasting than others – but in general, if you want to keep the same colour you will need to reapply every four or five days. Eliminate excess and imperfections If there are patches where too much product has been applied, you can usually correct the excess by using an exfoliant body scrub. In extreme cases, it's also possible to use one of the many products available for bleaching body hair. | 3,461 | 1,712 | 0.000588 |
warc | 201704 | By Marcy Gordon, AP Business Writer
WASHINGTON Freddie Mac, the nation's second largest buyer and guarantor of home mortgages, reported a first-quarter loss of $211 million amid turbulence in the market and erosion in the value of financial instruments it uses to hedge against interest-rate swings.
The government-sponsored company, which is emerging from an accounting scandal, said Thursday it lost 46 cents a share for the three months ended March 31. That contrasted with a profit of $2 billion, or $2.80 a share, in the same period a year ago.
It was Freddie Mac's first regular quarterly report in five years. The company announced a target of releasing its 2007 financial results within 60 days of year's end and meeting the requirements of the Sarbanes-Oxley corporate governance law by the end of 2008.
The company's results remain volatile from quarter to quarter.
While the full effect of the current housing slump has yet to play out, Freddie Mac's "credit position has remained strong relative to our historical levels and the market as a whole," Richard Syron, the chairman and chief executive, said in a statement.
"The first quarter was a tough period for our industry," he told a conference call with analysts. "Tough times show which companies are built to last over the long run."
He added: "We believe we are on the upswing operationally."
Amid a distressed market for so-called subprime mortgages -- higher-priced loans targeted at borrowers with tarnished credit or low incomes -- Freddie Mac reported that its credit-related expenses more than tripled in the first quarter, to $193 million from $60 million a year earlier.
The increase in expenses was largely the result of higher provisions for credit losses as mortgages purchased last year moved more frequently from delinquency to foreclosure, the company said. It said it expects such charge-offs to increase in the future "from today's very low levels."
Freddie Mac shares dropped 62 cents to $65.24 Thursday.
Freddie Mac announced in April that it will buy as much as $20 billion in fixed-rate and adjustable-rate loans over the next few years to help borrowers keep their homes. The new mortgages, expected to be available by midsummer, will include loans with longer fixed-rate terms.
Foreclosures and delinquencies have surged nationwide in recent months, particularly among homeowners who took out the high-risk mortgages. The distress has forced several mortgage lenders into bankruptcy and stoked anxiety that the problems could spill over into the broader economy.
Late payments and new foreclosures on adjustable-rate mortgages in the subprime category spiked to all-time highs in the first quarter, according to figures released Thursday by the Mortgage Bankers Association. The percentage of payments that were 30 or more days past due for such loans rose to 15.75 percent from 14.44 percent in the final quarter of 2006.
"Worsening expectations" for risk of mortgage defaults hurt Freddie Mac's financial results in the first quarter, the McLean, Va.-based company said. Losses came in derivatives, which are the complex financial instruments that Freddie Mac uses to hedge against swings in interest rates.
The company disclosed in mid-2003 that it had misstated earnings by some $5 billion -- mostly underreported -- for 2000-2002, and its top executives were ousted. Freddie Mac paid a then-record $125 million civil fine in 2003 in a settlement with federal regulators, who blamed management misconduct for the faulty accounting.
Freddie Mac and its larger government-sponsored sibling Fannie Mae were created by Congress to pump money into the $8 trillion home-mortgage market by buying home loans from banks and other lenders and bundling them into securities for sale on Wall Street.
___
Copyright 2007 The Associated Press. All rights reserved. This material may not be published, broadcast, rewritten or redistributed. | 3,951 | 1,970 | 0.000512 |
warc | 201704 | U.S. Battery is one of the sponsors of the 18th Annual Bulls Only Dorado Fishing tournament, a nonprofit organization that raises money to improve the lives of the communities in and around the town of Punta Chivato, in Baja California, Sur Mexico. All of the proceeds of this annual fishing tournament help support local charities,…Details
U.S. Battery provided ten of its REGC2 deep-cycle batteries to Pure Ocean Productions for a travel adventure film called Green Horizons. The film follows Jake and James Smith who will sail from Florida to the Bahamas in their 1978 sailboat named Valhalla, which is retrofitted to run on solar power. Sailing without any fossil fuel,…Details
U.S. Battery Manufacturing created a new video that showcases the manufacturing process of the company’s line of flooded lead-acid batteries. From raw led alloy to a finished product that has the highest initial capacity than any other battery on the market, the video follows the complete manufacturing process, testing procedures, and understanding the company’s exclusive…Details
Golf courses and businesses that incorporate a fleet of golf cars know that extending the service life of the deep-cycle batteries powering their fleet can significantly lower annual operating costs. But the simple process of regularly recharging batteries with a charger using a constant voltage or a fixed charge algorithm, often leads to a condition…Details
New Carbon Additives May Not Be The Best Answer For Battery Sulfation Issues In Renewable Energy Applications
There’s been some talk recently about the use of carbon additives to reduce the effects of sulfation in renewable energy batteries. Sulfation can occur when batteries are operated in a partial state of charge (PSOC) application, common when batteries are charged with solar cells, wind turbines and other unpredictable power sources. Even though these systems…Details
U.S. Battery Manufacturing has added its exclusive XC2™ formulation to the company’s US 24DCXC2, US 27DCXC2, and US 31DCXC2 12-volt heavy-duty batteries. Most commonly used in lift and access, floor machines, RV, and Marine applications, the XC2™ formulation provides a higher initial capacity and higher total energy delivery over the life of the battery. “Most…Details
U.S. Battery Donation To Bonyo’s Kenya Mission, Helps Provide Treatment For Villagers In Masara, Kenya
Bill Wallace, President of the Asante Team with a child from Masara, Kenya. U.S. Battery made a charitable donation to Bonyo’s Kenya Mission to help provide basic health care for villagers living in Masara, Kenya. The BKM is a non-profit organization that has sent a group of volunteers called the Asante team to provide free health…Details
U.S. Battery received an award of Excellence from Battery Watering Technologies, a leading manufacturer of battery watering systems, for outstanding commitment and performance to the company’s distributors. “We began doing business with U.S. Battery in January 2011,” says Julie Elliott, Marketing Manager at Battery Watering Technologies. “As our relationship has strengthened, we wanted to recognize…Details
U.S. Battery Manufacturing donated new Golf Car batteries to the Living Free Animal Sanctuary located in Mountain Center, California. The Living Free Animal Sanctuary is a nonprofit organization that is dedicated to saving the lives of cats and dogs that are orphaned, or would otherwise be euthanized. “Living Free expresses its deepest appreciation to U.S.…Details
U.S. Battery Receives 2013 Platinum On-Time Shipping Award From General Motors Customer Care and Aftersales Division
U.S. Battery, the leading manufacturer of flooded lead-acid batteries, received the Platinum On-Time Shipping Award from General Motors Customer Care and Aftersales. The award recognizes U.S. Battery’s outstanding and on-time shipping that consistently performed above GM’s expectations. U.S. Battery’s three distribution plants, Corona, California, Augusta, Georgia, and Evans, Georgia, ship batteries to U.S. and international…Details | 4,198 | 1,922 | 0.000539 |
warc | 201704 | Attorney Kevin Gold’s primary focus is representing people hurt in any kind of accident due to the negligence of another person or corporation. Because your right to reimbursement for expenses and compensation for your injuries is so important and because there are such short time deadlines, I always provide a free consultation with no obligation. I will take the time to explain to you what your rights are, in a manner that you can easily understand what needs to be done. I will also explain to you how I can do all of the work to protect your rights.
Did you know that besides the statute of limitations, there are other short time deadlines which must be met to protect your valuable rights which may expire just days after your accident. That is why you need to speak to a lawyer immediately after your accident, just to find out your rights. Call me now to find out what your rights are. For a free consultation, call 1-800-HURT-911.
We represent people hurt at the workplace or elsewhere while working. We also represent people hurt in car accidents, motorcycle accidents, truck accidents, train accidents, bicycle and pedestrian accidents, premises accidents such as slip and fall accidents, dog bites, accidents and injuries caused in nursing homes, and any type of accident which has caused you to be injured.
I understand the financial and social impact a significant personal injury can have on your lifestyle and your family and will do everything I can to make your life easier.
After an accident, while you are trying to deal with the pain of your injuries and treating your injuries, you will find yourself having to deal with a substantial amount of forms to fill out and other problems. For instance, the hospital and your doctors will immediately want to know how they are going to get paid. You may be wondering how you can be reimbursed for lost wages and how you are going to be able to pay everyday bills and your rent or mortgage.
Not only do we protect your legal rights so that you can obtain reimbursement for all of the losses you suffer, but we do everything we can to reduce your work load and stress while you are being treated for your injuries.
If you, or someone you know has been hurt in an accident, please call me immediately at 1-800-HURT-911 for a FREE telephone, home or hospital conference without obligation. We will immediately evaluate the facts surrounding your injury and immediately advise you as to what your rights are, how we can protect them, and what you can expect during the course of our representation.
Everyone in our office works as a team to provide our clients with the best possible legal representation and the respect and attention you deserve.
Though it may be overwhelming to think about all of this immediately after your accident, you need to act quickly because, in many cases, claims must usually be filed within a very short amount of time, often just a matter of days. We are here for you and if you are unable to visit our office we will come to you!
Please call Attorney Kevin Gold, Esq. for a FREE, NO OBLIGATION consultation at 1-800-HURT-911. | 3,137 | 1,432 | 0.000702 |
warc | 201704 | Pagination is the process of separating print or digital content into discrete pages.
For print documents and some online content, pagination also refers to the automated process of adding consecutive numbers to identify the sequential order of pages. Some types of website content benefit from being broken into separate pages to make them more user-friendly, such as search engine results pages (SERP), blogs and discussion forums.
Online articles are sometimes paginated to break up content. There is some justification to organizing long articles into multiple pages to aid the reader. However, even relatively brief articles are often paginated so that a page consists of a single paragraph and a visitor might have to click through ten or more pages to read the complete text. The purpose is to increase page views and, as a result, ad impressions -- the number of times that a website visitor sees a given ad. However, because most readers don't complete multi-page articles, the presentation of multiple short pages rather than a single long one may actually result in fewer ad impressions.
See a Google video about pagination and search engine optimization (SEO): | 1,177 | 623 | 0.001612 |
warc | 201704 | Vegetarian and vegan food
Vegetarians and vegans can eat quite well in most countries. The traditional cuisine and the style of eating in many countries can make it a bit difficult for vegetarians or vegans to find food without animal products in it. However, most cultures have a at least a few vegetarian dishes, and many, if not most restaurants are willing to leave out or substitute animal ingredients.
Planning
Take your diet into consideration when planning your trip. Where will you be going? There will be a greater variety of food available in big urban centers then there will be in rural areas. If you want to visit a tiny village in rural Vietnam, fine, but be prepared that you may have to limit the variety in your diet, or work with restaurants or others feeding you to come up with food to your liking.
Research the cuisine for the place you are going. There will be a couple of vegetable/grain dishes everywhere so you'll have something to order in restaurants. This will also give you an idea of local cooking techniques; often times innocent looking vegetable dishes will be cooked in chicken stock.
Look up lists of vegetarian restaurants and grocery stores in the area you'll be staying, check the destination guides for the area you will be visiting for information. Try local vegetarian groups in the area you'll be visiting.
Among countries in which vegetarianism and veganism is not the norm, those in the West tend to be the most accommodating, and even non-veg restaurants, particularly in the Netherlands, Denmark, the US and the UK, generally offer several vegetarian options.
Explaining your diet
In many countries and cultures (especially developing countries where focus is often on getting any sort of food) vegetarianism/veganism is very rare or unheard of. People will feel insulted when you turn down the lamb kabobs they have prepared for you. Come up with a short explanation and be prepared to repeat it. If you're vegetarian/vegan for non-religious ethical reasons, in places with a language barrier or strong food/host tradition it's usually best to refrain from explaining out your beliefs and go with something inarguable (medical reasons, something vaguely religious or cultural). Be
The tiny book
In some cultures, there may be an internal vegetarian tradition of some kind that you can compare your diet to. In countries with
Be as considerate as you are in your home country. If you are staying long term with someone or eating dinner at their house, let them know about your diet. Ask if you can
When all else fails, hit the grocery store/local veggie market. You can cobble something together with a camping stove or get an apartment with a kitchen.
You can try GM Diet Plan which was developed by General Motors company for their employees for their good health and wellness. This food Plan was developed with the help of Food and Drug Administration and Department of Agriculture of United States of America. On 15th August 1985 this diet plan was approved and distributed by its board members at its general meeting. GM Diet Plan is wholly endorsed by General Motors and this Diet plan is available to all employees and families at its Food Service Facilities. | 3,228 | 1,564 | 0.000642 |
warc | 201704 | Madison, Wisconsin, January 19, 2016 – HealthMyne, an imaging informatics company, today announced 510(k) clearance from the U.S. Food and Drug Administration (FDA). The new analytics software package is designed to provide radiologists with significant workflow efficiencies related to oncology cases, as well as advanced decision support.
New image characterization and tracking features are now provided in a comprehensive, quantitative imaging dashboard, which includes time-sequenced Epic EHR (Electronic Health Record) information. The analytics software also offers convenient tracking of a nodule or tumor over multiple, spatially registered imaging studies. This can reveal crucial information about whether the structure is growing, shrinking, or stable.
Structure change can be particularly useful in monitoring and/or adjusting a patient’s treatment regime. Importantly, with cancer treatment options continuing to increase in both number and specificity, the HealthMyne software can provide valuable quantitative insight for improved clinical decision-making.
Cancer screening programs can also benefit from nodule characterization. As an example, nodule growth is automatically identified by HealthMyne software for patients participating in lung cancer screening programs. This can be an indicator of potential nodule malignancy, and therefore, suggest extra scrutiny.
“By automatically delineating the boundaries of a lung nodule (or tumor), our software can make other sophisticated measurements within those boundaries – such as quantitatively describing important properties like size, shape, and texture,” stated Roger Chylla, CTO for HealthMyne. “Physicians can examine these properties to make critical judgements about a patient’s prognosis, follow-up schedule, or how to best treat them.”
HealthMyne will be exhibiting at the Annual Meeting of the Society of Thoracic Radiology in Scottsdale from March 13 to March 16, 2016.
Read the full release here. | 2,024 | 1,084 | 0.000945 |
warc | 201704 | By: Tom Still
In Wisconsin, as in every state, the public economic development toolbox includes an assortment of hammers, screwdrivers, saws and wrenches.
Knowing what tool to use can be tricky, especially when it comes to building a sturdy “home” for start-ups and emerging companies.
The ongoing debate over choosing the right tools for the job was evident recently when the Legislature’s Joint Finance Committee voted 11-4 to approve a plan by the Wisconsin Economic Development Corp. to reallocate $8 million from the state’s Early Stage Tax Credit program to its Business Development Tax Credit sleeve. Republican members of the budget committee voted for it; Democrats voted against it.
To most outsiders, such a move would seem ministerial and nuanced. After all, both are state tax credit programs and both are aimed at enhancing economic growth, so what’s the partisan fuss?
The answer lies in the larger discussion about what works — and what doesn’t — when it comes to building a robust state economy. Read the rest of the Milwaukee Journal Sentinel article here.
Wisconsin’s Early Stage Tax Credit program has been a model for other states since it took effect in 2005. It provides 25% state tax credits to private investors who invest in “Qualified New Business Ventures,” which are young companies with innovative technology and the kind of growth potential that often attracts angel and venture financing.
For angel and venture capitalists who invest in such companies, which apply for QNBV status through WEDC, every $4 invested produces a tax credit of $1. It’s an incentive that has helped Wisconsin grow from about $61 million in total angel and venture investments in 2004 to about $210 million in 2015, with that latter amount spread over 128 companies.
Wisconsin spent $7.6 million on Early Stage Tax Credits in 2010 and the total grew to $18.3 million in 2015, a sharp rate of growth that indicates more companies are qualifying for credits — and more state investors are claiming them.
Even with the growth in use of the Early Stage credits, the annual pool of $30 million hasn’t been depleted. That’s why WEDC requested moving $8 million to the relatively new Business Development Tax Credit, which was created this year by combining two previous programs. Similar shifts of Early Stage Tax Credits have taken place four times in the past, twice under the former Department of Commerce and twice under WEDC.
The good news: The Business Development Tax Credit program is working, too. Because it runs by calendar year vs. the normal state fiscal year (which ends June 30), WEDC officials estimated they could run out of credits by July, leaving the rest of the year uncovered.
In its first five months of 2016, WEDC Secretary Mark Hogan noted in a memo to legislators, Business Development Tax Credits were used 26 times to create or retain about 3,500 jobs.
Opponents of the credit shift described it as a slap in the face to Wisconsin’s early stage business climate. They argue that because almost all net new jobs in the United States are created by young companies (5 years old or younger), taking tax credits from a proven program doesn’t make sense.
Proponents said they would prefer that all Early Stage Tax Credits are used every year, but state law allows such transfers when it’s necessary to balance the mix. Wisconsin ranked poorly in a recent study by the Ewing Marion Kauffman Foundation that measured how quickly companies grow once they’re started. The Business Development Tax Credit is aimed at helping such firms grow.
The larger question is whether Wisconsin has invested enough across the spectrum to help start-ups and scale-ups, whether by using existing credits to their maximum advantage or other means. Some examples:
■ Lawmakers have twice rejected proposals to raise the per-company cap on Early Stage Tax Credits from $8 million, a ceiling that has existed since 2005, to $12 million. The increase would target companies that have proven they can grow and add jobs at a faster clip.
■ Lawmakers also voted last year to phase out a loan program aimed mostly at young companies, even though 45 other states offer some version of loan programs.
■ The overall budget for WEDC has been consistently squeezed, in part because of legislative reaction to high-profile mistakes when the agency was created. That means less money is available for grants and other investments in the growth economy.
Not every problem is a nail, and not every tool is a hammer. Wisconsin lags in both start-ups and growth companies, so the state’s toolbox deserves a collection that ranges from micro-loans to grants to sufficient tax credits to accommodate growth. That’s a good do-it-yourself project for the next state budget.
Tom Still is president of the Wisconsin Technology Council. Its Wisconsin Innovation Network meets in Wauwatosa. Contact him at news@wisconsintechnologycouncil.com. | 5,060 | 2,356 | 0.000437 |
warc | 201704 | Hat tip to Treehugger for cluing me in to the existence of ColaLife. ColaLife is a volunteer-run nascent non-profit organization that seeks to take advantage of the distribution network of one of the largest companies in the world in order to save lives.
To be clear: ColaLife isn't an initiative born at Coca-Cola, although Coke themselves has many many corporate social responsibility programs. But ColaLife has reached out to Coca-Cola with some sucess to take advantage of one simple fact:
You can get a Coke in almost every corner of the Earth, no matter how poor or remote that corner may be. That speaks to a massive existing distribution system...and that distribution may happen by men on bicycles.
What you can't get in every corner of the Earth, however, is clean water.
And sometimes the fix for that problem is pretty small: oral rehydration and water purification tablets, for example.
ColaLIfe has created packaging for such fundamental first aid supplies that slots in amongst the normal Coca-Cola bottles in their normal packaging. It's really genius.
And with Coca-Cola cooperating with ColaLife, it sounds like this could bring revolutionary assistance to those far corners.
I do believe when big companies make change it has big impact. And that even if they don't do everything right, we need to recognize and encourage the things they do right.
And the ColaLife story shows that we can't rely on the big companies to think up every way they can help make these changes: We need to keep nudging them along.
I love this story. I hope it keeps progressing in the right direction. I hope it changes lives, and the world just a little bit.
[Disclosure: Coca-Cola has intermittently been a customer of BlogHer's this year, but I knew nothing about this initiative until I read about it on Treehugger.]
You learn something every day. Well, particularly if you go visit interesting places. And who knew The World of Coke in Atlanta, GA would be such an interesting place? [Disclosure: Coca-Cola is a BlogHer customer, but I'm just writing this post because I found a picture while uploading three months worth of shots from my point & shoot.]
Here's what I learned about the Coca-Cola bottle while at World of Coke:
I love it when I hear about yet another eco-friendly manufacturer who makes stuff that qualifies both as functional and fashionable...and at a good price.
I'm a big believer that certain folks (like me, I admit) will spend more and accept less in order to buy green. But the vast majority of humans don't want to spend more, and don't want to sacrifice features or function.
That's just reality.
So, I like Reveal. I like their prices. I like that their items have style, and I like that most of it is vegan too!
Not sure I like (or even understand) why this laptop bag is designated as a Man's accessory. Don't see anything particularly manly or anti-feminine about it.
But other than that little weirdness, I like what they have. I just wish they had more. It's a pretty small selection right now.
They have extensive information about what makes their products sustainable, so I encourage you to check it all out.
I've been reading a lot of social action/change/justice books lately as part of a BlogHer Virtual Book Club. After the last three books, we all felt a bit shell-shocked, and like the human race is a bit hopeless. I mean, I do believe I'm taking very positive action, mostly by my vegan diet, if nothing else, but some of the problems seem so big, so systemic, so beyond systemic, even endemic to our species...is our individual action all for naught?
BlogHer Britt Bravo interviews Anna Lappe about her new book, Diet for a Hot Planet, and it seems like there is hope. And there is meaningful action. I interviewed Anna myself a couple of years ago, and she has the same practical, positive message as then. Check out this year's recent interview and feel hopeful, not downtrodden, about mankind's future:
This year at BlogHer we're featuring a panel that's all about how to manage your digital legacy. In other words: Do you have a digital will? What happens to your blogs, your Twitter account, your Facebook account, etc. etc. etc.? You can read more about the session here, and while it may sound morbid, it's something I haven't done...but probably should.
So, having just published that, this headline at HippyShopper caught my eye: Greener Funerals
That's another thing I haven't thought about, and probably should.
For a while now I've been following Alicia Silverstone. Not as an actress (although I like her work there too), but as an author, activist, environmentalist, animal activist. I read and enjoyed her book, The Kind Diet, and I subscribe to her blog and online community at The Kind Life.
I like her voice. It's kind of like her voice as Cher in Clueless, once Cher has grown up a bit...keeping the charm, losing about 30% of the "like"s and "totally"s.
Yes, it's what you think it might be: A post about eco-friendly ways to take care of one's period. IN the post you learn that Alicia is just "not a tampon girl". And she manages to get over 100 members of her community to discuss their own particular preferences and experiences trying various solutions, including more alternative approaches, like the Diva Cup.
I respect the fact that Alicia is willing to be one of those voices demystifying and de-stigmatizing women's cycles and the ways we manage them.
Si, if you're into an earth-friendly (and kind) life, check out her site. I think you'll like it. | 5,563 | 2,715 | 0.000371 |
warc | 201704 | Abstract
Water of drinking water quality is one of the most important resources in the food and beverage industry, e.g. for breweries. In this ‘Water Quality Management’ project, a new strategy of partial process water stream treatment is presented. Based on our own investigations, a water saving potential of 10–20% of the entire water consumption is possible with regard to displacement and rinsing water. The separation of different water qualities in real time, via the water switch, is achieved by several measurement techniques and the exploration of the desired information by multivariate data analysis. In combination with the water switch, the generation of drinking water quality regarding sterility is assured by a ceramic ultra-filtration membrane. Aside from basic on and inline measurement parameters in breweries, e.g. pH-value, temperature, electrical conductivity and turbidity, modern measurement techniques, e.g. infrared sensor, which can measure several parameters, such as Brix and organic acids, are utilized. The combination of the rule-based fuzzy-logic system and expert knowledge is called a hybrid methodology. In the current study, the experimental design (DoE) techniques were applied to reduce the number of required experiments. The experimental results were then explored by the well-known projection method, i.e. principal component analysis (PCA).
brewery fuzzy logic membrane filtration multivariate data analysis water treatment Received July 16, 2012. Accepted October 4, 2012. © IWA Publishing 2013 | 1,563 | 828 | 0.001227 |
warc | 201704 | Researchers at Duke University will become part of a national network focusing on undiagnosed diseases.
The National Institutes of Health have granted $7.2 million for geneticists at Duke to look at the rarest diseases in the world, affecting fewer than 50 patients each.
Doctor David Goldstein is one of the principle investigators for the project. He says a team at Duke has spent four years taking what used to be a purely clinical investigation and moving it into the world of genetics.
"So what we do is we sequence the patient's genome," said Goldstein. "We sequence the parents. And we look at all the variants we see in the patient and we see whether any of them are good candidates to explain the patient's condition."
Duke will be joining teams at Harvard, Stanford, Vanderbilt and others in implementing the new program. By 2017, Duke and the other Universities plan to see a total of about 300 patients a year.
"The first year we will be seeing 10 patients," said Shashi, "Because it takes a lot to get this network up and going... The second year we'll be seeing 25. And the third and fourth years we'll be seeing 50 patients per year, per site."
The NIH currently sees about 150 patients a year at its facility in Maryland. The national program estimates it solves about 25 percent of these cases. | 1,327 | 708 | 0.00143 |
warc | 201704 | Posted Mar 23, 2012 09:15 pm CDT
U.S. Supreme Court Justice Anthony M. Kennedy placed great faith in the appearance of impropriety in June 2009 when the court tried to determine how much spending on judicial campaigns is enough to affect a judge’s impartiality and cause the judge’s removal from a case.
The facts in
Caperton v. Massey made the decision relatively easy. West Virginia coal magnate Don Blankenship had spent some $3 million in 2004 to help elect a state supreme court justice when Blankenship’s A.T. Massey Coal Co. had a case coming before the court. The Blankenship bankroll totaled more than the amounts raised by the two candidates combined and their supporters. Blankenship’s man won and joined in the vote to reverse a $50 million judgment against Massey.
Money may not buy love, but the $3 million bought Blankenship justice, at least until the U.S. Supreme Court took up the matter. The circumstances and the amount alone were enough to create a risk of bias, Kennedy wrote, so due process required newly elected Justice Brent Benjamin to recuse himself from the coal company’s case. “The facts now before us,” Kennedy wrote, “are extreme by any measure.”
Nearly three years later, however, fewer than a dozen states have rewritten their recusal rules to account for more common instances of political spending that may not rise to the level of the hard constitutional foul called in
Caperton, but that nevertheless create potential conflicts of interest for judges significant enough to warrant disqualification.
In the meantime, another campaign finance shoe dropped in the high court just six months after
Caperton. In January 2010, the suggestion of an improper motive meant nothing when Kennedy authored for a different majority the lead opinion in Citizens United v. Federal Election Commission.
There, the court held the First Amendment allows corporations and unions to spend as much as they want to support or defeat candidates. Congress in the 2002 McCain-Feingold Act had limited corporate expenditures as a way to fight corruption or its probability.
Those days are gone, Kennedy wrote: “We now conclude that independent expenditures, including those made by corporations, do not give rise to corruption or the appearance of corruption.”
The court’s contradictory positions in the two decisions effectively leave the rule-makers in a delicate position. On one hand, lower courts read
Caperton as a command to impose new rules on themselves to ward off the perceived evil of campaign cash.
On the other, they must do it in a post-
Citizens United world that erases most of the rules governing corporate spenders. Talk about getting whipsawed.
Moreover,
Citizens United addresses independent spending separate from campaigns, such as ads supporting or condemning a particular office seeker. Candidates have no control over that. So, under widely varying state disclosure rules, a judge targeted by a recusal motion initially may not even know the source of the questioned support or opposition. Click here to read the rest of “Show Me the Money” from the March issue of the ABA Journal. | 3,208 | 1,607 | 0.00064 |
warc | 201704 | This website is accessible to all versions of every browser. However, you are seeing this message because your browser does not support basic Web standards, and does not properly display the site's design details. Please consider upgrading to a more modern browser. (Learn More).
Posted Tuesday, June 12, 2007
Hartington Cheese – The King’s Stilton! The History of Cheese in Derbyshire
Derbyshire is renowned for it’s heavy manufacturing industries which were spawned largely by the Industrial Revolution, but which today are mainly consigned to the past. However, there remains one ancient industry which began long before the Industrial Revolution, and for which the county still leads the world – the manufacture of cheese!
At the creamery in Hartington, which is the oldest remaining working cheese factory in England and now owned by Dairy Crest Limited, no less than a quarter of the world’s supply of Stilton cheese is produced!
`Cheese has been the staple diet of Derbyshire folk for centuries'
Cheese has been the staple diet of Derbyshire folk for centuries – and not only in the `snap-tins’ of both lead and coal miners!
According to the Roman writer, Tacitus, the legions carried cheese to supplement them on their long marches across the county two thousand years ago, some of it probably made at the Roman farmsteads of Hopton and at nearby Roystone Grange.
Later, during the Middle Ages cheese was traded at local markets throughout the county, with Hartington being the first to be granted a Market Charter in 1204.
`Annual Cheese Fairs were held around the Peak'
Annual cheese fairs were held around the Peak District at Bakewell, Tideswell and Winster, there were weekly cheese markets at Derby, Chesterfield, Bakewell and Ashbourne and almost every farmhouse in the Peak District would at one time have made it’s own cheese and sold it at the local market.
Writing about his travels through England in 1725, Daniel Defoe noted that the staple diet of the natives of `
the wild and abandoned Peak’ was ` oatcakes, cheese and ale’ – whilst a report on Derbyshire farming seventy years later noted that cheese was, “ the chief, if not the only article of provision which the natives can spare out of their own country”.
Derbyshire cheese was uncoloured (white), crumbly and heavy in texture, with a mild flavour; the Honourable John Byng, dining in Ashbourne around 1790 wrote, “the cheese of this county pleases me much, being a medium between the Cheshire and the Stilton”.
Over a century later during the 1920’s and 30’s, Hartington Stilton pleased King George V so much that the factory was awarded a Royal Warrant to supply His Majesty with what became known as `The King’s Stilton’ – and today Hartington Blue Stilton is world famous.
Before the advent of purpose-built cheese factories in mid-Victorian times, the labour intensive process was normally left to the farmer’s wife or dairymaid. On larger dairy farms the herdsman would bring the milk directly from the milking sheds and pour it into a huge vat; rennet, an enzyme which coagulates the milk was then added, turning it into a solid mass of curd. This was then broken up, lifted out by hand and placed in large seives lined with cheese-cloth (as the muslin was called) and left to drain. Next it was cut into slices, worked into fine crumbs by hand, salted, and tied up again with a metal hoop around it to give the cheese its final shape; after this it was `queedled’ – pressed and squeezed between perforated boards to remove the surplus whey – before being placed in a large cheese press.
Presses were of heavy stone with iron weights attached and could be tightened by means of a large central screw-thread operated by a cast iron wheel.
Most held several cheeses and as each new cheese was added, the oldest was removed and stored in a cool place, normally a cellar. However, in the limestone Peak District, cellars were difficult to construct so cheeses were stored in lofts above the kitchen or dairy, and it was in a damp and mouldy vaulted cellar in neighbouring Leicestershire that Blue cheese was accidentally born. The cellar near Melton Mowbray was colonized by a blue green mould and the crumbly open texture of the cheese was accidentally invaded by
Penicillium glaucum, a bacterial fungus which proved to make the cheese far more tasty – and it was sold at a coaching inn on the A1 in the nearby village of Stilton, from which it takes its name!
The introduction of commercial or cooperative cheese-making to Derbyshire can be traced back to William Gilman from Sheen near Hartington, whose speciality was a 40lb Derbyshire cheese, which in 1862 won first prize at an International exhibition in London. Gilman is credited with establishing England’s first purpose-built cheese factory at Longford near Derby in 1870.
Others quickly followed at Hope Dale, Ecton, Gratton, Woodeaves, Glutton Bridge, Reapsmoor, Grangemill – and Hartington, where pigs were kept to consume the whey.
The Hartington creamery was established by the Duke of Devonshire in the 1870’s, and produced the white crumbly Derbyshire cheese until it was partially destroyed by fire in 1894. After standing empty for six years it was taken over and reinstated in 1900 by Thomas Nuttall, a prize-winning Stilton cheese-maker from Melton Mowbray, who began producing Blue Stilton at Hartington, a business which was later carried on and expanded by his son, John M. Nuttall. It was John Nuttall who held a warrant to supply Stilton to King George V, and also during the 1920’s a far-sighted regulation – a Certification Trade Mark – confined the legal production of Blue Stilton to the three neighbouring counties of Leicestershire, Nottinghamshire and Derbyshire.
As the twentieth century progressed it became far more profitable for farmers to supply milk to the fast-growing urban townships than to local cheese factories, and one by one, they gradually closed until only the Hartington factory was left to keep the Derbyshire cheese-making tradition alive.
There are now six factories producing Stilton cheese, five in Leicestershire – and Hartington, which uniquely also makes Buxton and Dovedale Blue. In recent years the factory has been extensively redeveloped and currently employs a workforce of around 140 who convert over 70,000 litres of milk per day into cheese – but these days the process is less labour intensive!
Today’s Recipe for Blue Stilton :
At Hartington the previously cooled milk is piped into huge horizontal vats, where it is warmed and salt and rennet are added. Temperature control is vital and the vats are continuously inspected by hand for coagulation and stirred by hand with paddles until the right balance of lumpy curd and liquid whey is reached. The mixture is then transferred to other vats where the whey is drained off and a streptococcus bacteria is added to change the lactose in the milk into lactic acid. The white fluffy curds are then packed lightly by machine into perforated plastic cylinders called hoops, stacked on boards and turned regularly so that the whey is discharged through the perforations.
The now cylindrical cheese is then tipped out and bound by hand, the surface is skimmed with a knife and this process forms a crust which seals the whole cheese.
The finished cheeses are stored in high racks in cool, humid conditions and left to mature. They are turned regularly by hand, and then pierced by stainless steel wires on a machine to ensure the aeration of the cheese which is conducive to the growth of
Penicillium glaucum – the fungus develops in the veins thus created, and spreads throughout the cheese. The vital fungal ingredient is cultured elsewhere and supplied to the creamery later, and how this is then inoculated into the cheese remains a trade secret which the producer prefers to keep to himself!
Because of the mould Stilton matures more quickly than other white cheeses, taking 3 – 4 months to reach its prime, as opposed to 9 months – 2 years in the case of Cheddar, for example.
The three basic preservation processes used in making cheese are;
1) The removal of moisture
2) The addition of salt
3) Acidification
The Hartington cheese factory has been producing cheese for over 130 years, and obviously Stilton cheese-making is still comparitively labour intensive, but as Dairy Crest point out – cheese is just preserved milk which lasts longer than fresh milk – and is much easier to transport!
It takes 70 litres of milk to produce a traditional 16lb Stilton cheese, and the Hartington factory converts 70,000 litres of milk per day, which by my calculations amounts to approximately seven tons of Stilton cheese – who said that
industry in Derbyshire was consigned to the past? heavy | 8,975 | 4,071 | 0.000252 |
warc | 201704 | CHICAGO, IL ― Victoria Reggie Kennedy gave an emotional and inspiring recap of the 15-month journey that she and her husband, U.S. Senator Edward M. Kennedy, shared as they battled and braved a brain tumor diagnosis together. Mrs. Kennedy spoke at the American Brain Tumor Association Annual Meeting Dinner, “Strength through Change and Challenge,” July 29, 2011, in Lincolnshire, IL.
“From the day my husband was diagnosed with a brain tumor, it wasn’t just his disease, it was our disease. I thought of it and referred to it as our tumor,” said Kennedy. She described the next 15 months as “a story of hope and happiness – of love and laughter – and of outstanding medicine and optimism."
“It is no exaggeration to say that being with my husband during the last 15 months of his life was the greatest gift I have ever received in my life,” said Kennedy. “Don’t get me wrong – I would not choose the diagnosis of a glioblastoma. But once the hand was dealt, I would choose to live exactly the kind of life that Teddy and I lived.”
She highlighted months of treatment and care, but mostly, wonderful moments and opportunities: birthday parties, sailing, a new puppy, the Senator’s historic vote to save Medicare, President Barack Obama’s inauguration, and the love of family and friends.
“All of us here today in this room are part of a very special club,” said Kennedy. It’s not a club that we would have chosen, but brain tumors have impacted our lives in powerful ways. However we are touched by brain tumors, we are not alone. That is what ABTA shows us; that is what ABTA does for us.” "The American Brain Tumor Association mission is compelling all of us to move forward,” said Kennedy. “I am so proud to be here today; so proud to be part of your extended family.”
Kennedy’s remarks followed the Jonathan Gingras presentation of the Joel A. Gingras, Jr. Award to Ryan and Gina Porter. The Porters have hosted the "Train for the Brain" event for the last 14 years, in memory of their son, Justin, who died at age 6 from a brain tumor. The Joel A. Gingras, Jr. Award is named in honor and memory of a beloved brother and son. Joel’s family and friends have hosted events for more than 20 years, raising more than $1 million for brain tumor research and patient-family education and support.
Also Friday night, Jan Buckner, MD, of Mayo Clinic, announced a new partnership between the American Brain Tumor Association and Mayo Clinic to provide a patient navigator and enhanced patient information to patients and families at the Rochester, MN institution.
The American Brain Tumor Association Annual Meeting Dinner punctuated the 2011 Patient-Family Connections Meeting & Retreat, July 29-30. The meeting brought brain tumor experts, individuals living with a brain tumor diagnosis and their families from throughout the United States to the Lincolnshire Marriott in Lincolnshire, IL. The extraordinary two-day event included sessions on the latest brain tumor quality of life strategies, research findings and treatment trends. In addition, the resort setting provided the perfect venue to relax, restore and connect with others sharing a similar diagnosis.
Highlights:
Susan Chang, MD, director of neuro-oncology at the University of California, San Francisco, presented her research on unmet patient and caregiver needs.
Jeffrey Bruce, MD, Columbia University Medical Center, and Anita Mahajan, MD, of MD Anderson Proton Therapy Center, highlighted new treatment trends.
Derek R. Johnson, MD, Mayo Clinic, provided an introduction to clinical trials.
Jeffrey Cozzens, MD, Southern Illinois University, provided a "Brain Tumors 101" overview.
A Mock Tumor Board featuring brain tumor specialists from Cleveland Clinic, MD Anderson Cancer Center, the University of Chicago, the University of California San Francisco, and the University of Kentucky reviewed actual brain tumor cases and answered questions.
ABTA 2010-2011 Fellows presented their research findings and answered questions from patients and families.
Tumor-specific treatment workshops featured brain tumor experts from Mayo Clinic, MD Anderson Cancer Center, Columbia University Medical Center, NorthShore University HealthSystem and Childrens Memorial Hospital.
Quality of Life Workshops on neuropsychology, educating your child's teachers and schools about a brain tumor, caregiver stress management, adolescents and young adults, oncofertility, advance care planning and financial resources, benign brain tumors, and patient and parent support groups
###
ABOUT THE AMERICAN BRAIN TUMOR ASSOCIATION
Headquartered in Chicago, the American Brain Tumor Association was the first national organization committed to funding brain tumor research and providing compassionate outreach to patients and caregivers coping with a brain tumor diagnosis. For nearly 40 years, the association has funded researchers working toward breakthroughs in brain tumor diagnosis and treatment. Through its dedicated team of licensed healthcare professionals, the ABTA provides brain tumor information and education for patients, families and healthcare professionals. The American Brain Tumor Association is a federally registered 501(c)3 charity that consistently earns high marks from the nation’s charity ranking organizations. For more information, visit www.abta.org. | 5,482 | 2,505 | 0.000411 |
warc | 201704 | Makale özeti ve diğer detaylar.
In language classrooms, being in unnatural conversational situations, students need motivation more than other learning milieus. Teachers try to capture the attention of students through various methods and techniques. Many researchers in EFL teaching profession have stated that good motivation has appositive effect on foreign language learning. The purpose of this study is to explore how technology could be used to increase students‘ motivation in EFL classrooms. For this purpose; a questionnaire was administered to a group of students at Akdeniz University Preparatory Classes in 2007-2008 academic year. As a result it was found out that technology was a dynamic and challenging motivating factor in EFL classrooms and there may be some suggestions focusing on the achievement of learning objectives. | 859 | 506 | 0.002019 |
warc | 201704 | E-mail schemes like the one the IRS made public on Friday are the reason why the nation’s tax-collection agency ranked phishing number 3 in its 2014 “Dirty Dozen” list of tax scams.
According to the IRS, phishing is a scam typically carried out with the help of unsolicited e-mails or fake websites that lure victims into providing personal and financial information. A criminal can use that information to commit identity theft or financial theft.
This latest phishing scheme involves e-mails to taxpayers that appear to be from the IRS Taxpayer Advocate Service and include a bogus case number. The fake e-mails may include the following message: “Your reported 2013 income is flagged for review due to a document processing error. Your case has been forwarded to the Taxpayer Advocate Service for resolution assistance. To avoid delays processing your 2013 filing, contact the Taxpayer Advocate Service for resolution assistance.”
The bogus e-mails direct the recipient to click on links that supposedly provide information about the taxpayer advocate assigned to their case or that let them “review reported income,” the IRS noted. The links lead to web pages that solicit personal information.
The IRS stressed that taxpayers who receive these e-mails should not respond, nor click on the links. Instead, they should forward the fake e-mails to the agency at [email protected]. More information can be found on the IRS’s Report Phishing web page.
The Taxpayer Advocate Service is a legitimate IRS organization that helps taxpayers resolve federal tax issues that have not been resolved through the normal IRS channels. The IRS and the Taxpayer Advocate Service do not initiate contact with taxpayers via e-mail, texting, or any social media.
Trending
This latest scam comes on the heels of a warning by Treasury Inspector General for Tax Administration (TIGTA) J. Russell George on March 21 about a sophisticated nationwide phone scam, which he called “the largest scam of its kind that we have ever seen.”
The phone scam, in which taxpayers are told they owe money to the IRS and are threatened with arrest or deportation if they don't pay up, has occurred in nearly every state in the country.
Victims are told by scammers who are impersonating IRS agents that they must pay the IRS promptly through a preloaded debit card or wire transfer. If they refuse to cooperate, the scammers often become hostile and insulting, threatening to send the victims to prison, to deport them, or to suspend their business or driver's license.
George noted that TIGTA has received reports of more than 20,000 contacts and has become aware of thousands of victims who have collectively paid more than $1 million as a result of the scam.
“The increasing number of people receiving these unsolicited calls from individuals who fraudulently claim to represent the IRS is alarming,” he said in a written statement. “At all times – and particularly during the tax-filing season – we want to make sure that innocent taxpayers are alert to this scam so they are not harmed by these criminals. Do not become a victim.”
The IRS will contact people by mail – not by phone – about unpaid taxes, and it won’t ask for payment using a prepaid debit card or wire transfer. The agency also does not ask for a credit card number over the phone.
“If someone unexpectedly calls claiming to be from the IRS and uses threatening language if you don’t pay immediately, that is a sign that it really isn’t the IRS calling,” George said.
Related articles: | 3,652 | 1,712 | 0.000606 |
warc | 201704 | Your Licensed Electricians In Plano & Surrounding Cities
At
Adis Electric, we are about more than just quality Plano electrician services, we are about providing solutions. This starts by working with you to find out more about your wants, needs and what you hope to achieve. Then we will help to educate and inform you about the options that you have so that you make the best choice possible. This approach is what has helped us become the number one local choice for both residential and commercial services. Now, we look forward to working with you to professionally address any and all of your service needs. Professional Electricians Serving Residential and Commercial Clients in Plano & the Surrounding Cities Light Fixtures
Light fixtures are the cornerstone of helping illuminate any house or business, including creating just the right look and feel. Lighting is a key factor in the ambiance you have, or what you lack if you do not plan well for lighting options. The most important thing is making sure that these fixtures are securely in place and that the installation is handled with the skill and precision required for optimal results. Otherwise, you could end up with lights that don't work correctly and, even worse, that lead to electrical problems behind the walls.
Qualified Electrical Inspections
The best way to truly know what is going on behind your walls is by letting Adis Electric address your need for a qualified electrical inspection. Even if your home is not that old, it is important to make sure that you have the quality wiring in place that you had hoped for. This is also the ideal time to make sure that your older house isn't harboring any secrets that went undetected in the initial home inspection, such as aluminum wiring or knob and tube wiring. The bottom line is that we want to help make sure that you have a safe and secure place to call home, for you and your loved ones.
Circuit Breaker Replacement Services
Often times, we find that older panel boxes are not equipped to meet the high demand for electricity that all of today's modern gadgets place on it. The good news is that this can easily be addressed simply by letting our experts take care of your need for replacement. Let us help you update and upgrade this aspect of your home, so that you and your family can still enjoy every one of today's electrical modern amenities. The best part is that you can enjoy them all but without the inconvenience of blowing fuses, tripping breakers or putting your home at risk of electrical fires.
A Focus On Electrical Safety
Part of updating and upgrading is finding ways that you can make changes in order to see savings on your monthly utility bills, but it is about so much more than that. We want to be able to help you get the safety care that you need so that you and your family members are not subjected to shocks, burns or more serious hazards – such as electrocution. This is especially important for any households with younger children but should be addressed for each home, no matter what. Get in touch with us today and let us help you get the essential service that you want, need and deserve.
Why You Should Choose Us For Your Plano Area Electrical Needs
We take this line of work seriously and it shows in the results that we get. Give us a call right now in order to address your need for expertise when it comes to your Plano electrician services. We look forward to working with you and showing you how we have built the reputation that we have for ourselves.
Experienced Electricians With A Smile Recent Articles The Benefits Of Aluminum Wiring Replacement
The truth of the matter is, there are some great things about owning an older Plano home. One of the main things is that older styles offer a unique charm that newer homes just simply cannot replicate. Of course buying
How To Know If Your Plano Home Needs a Panel Upgrade
Buying an older home is a wise investment, as long as you're aware of some of the unique challenges that you may be facing. One of these issues that you will probably need to deal with is the need for a panel upgrade. | 4,137 | 1,923 | 0.000523 |
warc | 201704 | It’s that time of year!
PART ONE ~ COLDS
Colds are the most common illness among children of all ages. Although this respiratory virus lasts only for a week or so, colds can make most children feel miserable. Need to know more about children and colds? Here’s information you can use.
Understanding Colds
A cold is a viral infection of the upper respiratory tract. More than 200 different viruses can cause a cold, but the rhinovirus is the most common culprit. Because colds are viral infections, antibiotics, which treat bacterial infections, are not useful for treatment.
Except in newborns, colds in healthy children are not dangerous. Colds usually go away in four to 10 days without any special treatment. Because of the great number of viruses that can cause colds and because new cold viruses develop, children never build up resistance against all cold viruses.
Sometimes fatigue, stress, or the type of cold virus may cause a bacterial infection somewhere in a child’s body, such as the lungs, throat, ears, or sinuses. The bacterial infection weakens the body’s immune system and may require treatment with an antibiotic.
Cold Symptoms
With children, most colds begin abruptly. Your child may wake up with thesesymptoms:
Watery nasal mucus Sneezing Fatigue Fever (sometimes) Sore throat Cough
Because of the postnasal drip, your child may have a sore throat and cough, symptoms that are common in children’s colds. The cold virus can affect your child’s sinuses, throat, bronchial tubes, and ears. With a cold, children may also have diarrhea and vomiting.
During the early stages of a cold, your child may be very irritable and complain of aheadache and congestion. As the cold progresses, the mucus secretions from the sinuses may turn darker and thicker. Your child may also develop a mild cough, which could last for several days.
How Many Colds Do Children Usually Get Each Year?
Statistics show that preschool-aged children have around nine colds per year, kindergartners can have 12 colds per year, and adolescents and adults have about seven colds per year. Cold season runs from September until March or April, so children usually catch most cold viruses during these months.
How Can I Prevent My Children From Catching Colds?
The best way to prevent children from catching colds is to teach them proper hand washing. The common cold is spread mostly by hand-to-hand contact. For example, a child with a cold blows or touches his or her nose and then touches your child, who then becomes infected with the cold virus.
The common cold is also spread by infected objects that are good cold carriers, including door handles, stair railings, books, pens, video game remotes, and a computer keyboard and mouse. The common cold virus can live on objects for several hours, allowing time for your child to touch the object and then rub his or her eyes or nose.
Studies show that proper hand washing does prevent the risk of catching a cold. Teach your child to wash his or her hands after every bathroom trip, before every meal, and after playing at school or at home. The CDC recommends singing “Happy Birthday to You” twice, as that’s the length of time it takes (20 seconds) to slough germs off hands while washing hands with warm soapy water.
If your child has a cold, it’s still important to protect others from catching the cold. If your child shows cold symptoms, it is wise to keep your child home from school and avoid contact with other children to keep the cold from spreading. You should also encourage your child to cover his or her mouth when sneezing and to use a tissue for nose blowing. If a tissue is unavailable, teach your child to cough in his or her sleeve. Stress to children the importance of hand washing after blowing their nose, coughing, or sneezing to prevent spreading the virus.
Cold and Flu Season has Begun! The teachers and staff at Adobe Montessori make it a priority to provide a healthy school environment for all of our students. We look for helpful information to share with our families which parents may use at home to build healthy happy habits!
**Thank You to WebMD.com for providing this information
Part 2: How to Tell Between Cold and Flu Symptoms | 4,279 | 2,010 | 0.000506 |
warc | 201704 | Toxicology Branch works with public and medical communities, as well as other agencies to examine whether and how exposure to environmental factors (e.g., toxic materials, noise, dust, heat, mold) where people live, work, learn, and play may harm the publicís health.
Toxicological support is provided to assist other agencies or organizations by providing answers to questions such as home use of various chemical products, private wells, or unintentional spills. In addition, local environmental assessments enable volunteers and local public and private entities to identify hazards and resources to protect and preserve public health.
EPA Health Advisories Impact North Alabama Water Systems
The Alabama Department of Public Health is working with the Alabama Department of Environmental Management (ADEM) and federal agencies to determine any potential hazards related to perfluorinated compounds in drinking water in eight north Alabama water systems.
The following documents provide further information on perfluorinated compounds and recommended actions for drinking water systems. Please read these fact sheets carefully before contacting the Health Department. They will answer many frequently asked questions about these compounds and their impact.
Here are examples of useful information you can find on the Toxicology website: | 1,351 | 711 | 0.001419 |
warc | 201704 | How many cups of coffee do you drink every day?
Are you a dog owner?
What do you like most about going to a movie theater?
Don’t be shy. Inquiring minds at The Google want to know, and they are now paying publishers like Adweek, The New York Daily News and the Texas Tribune, $.05 each time you volunteer an answer.
It is hard to blame the cash hungry digital publishers from trying this new advertising product from Google out on its readers. I don’t want to fault them for trying something that might work, but I do want to question if it
will work. Because how one feels about this intrusion is going to impact the results, dramatically.
My problem with Google Consumer Surveys is having to stop at a barrier to the content I seek. Wanting to read Adweek is not like entering The Netherlands, or Mexico. Show me the freaking article, guys.
But no. I have to click first.
If you are a regular reader of AdPulp, you know that paid content is a passion of mine. I want to compensate the newspapers and trade journals I read (and remix), just as I want to be compensated for our efforts herein. But friction is not the way, and this survey shit is friction.
What we need is to grease the way to pay.
What do I mean by that? I mean that I will subscribe, or pay per issue, if the price is right. I don’t want some stupid survey and whited out text where the article should be. Ever. And I will pay to make it go away.
For instance, if I was asked to pay $.05 for each issue of Adweek or The New York Times, I would do it.
Sure, I could also just subscribe, but subscriptions create a bit too much friction for all but the most ardent supporter/reader, while there is very little friction in the online newsstand of the future. The one I am “whiteboarding” here.
Getting this genie back in the bottle is a messy affair. I think it can be less so, if we put the customer first. In a customer first scenario, one empowered by technology, the newspapers and magazines I read will know precisely how much reading I do, and charge me accordingly. | 2,078 | 1,107 | 0.000921 |
warc | 201704 | Tips for Making Print More Readable
Low vision often makes reading a difficult task in the following situations:
When a reduced amount of light can enter the eye When the image on the retina is blurred When the central portion of the retina (the macula) needed for reading is defective
The contrast of the print on its background is affected by reduced light and blurring. The damage to the central retina interferes with the ability to see small print, and to make necessary eye movements involved in reading.
The following guidelines make print more legible for individuals with vision problems and for the general public as well. Therefore, they are important for universal design.
Print Size
Large print type should be used, preferably 18 point, but at a minimum 16 point. Scalable fonts on the computer make this easy to do.
Font Type and Style
The goal in font selection is to use easily recognizable characters, either standard Roman or Sans Serif fonts. A good choice is Arial.
Avoid decorative fonts.
Use bold type because the thickness of the letters makes the print more
legible. Avoid using italics or all capital letters. Both these forms of print make it more difficult to differentiate among letters. Use of Color
The use of different colored lettering for headings and emphasis is difficult to read for many people with low vision. When used, dark blues and greens are most effective.
Contrast
Contrast is one of the most critical factors in enhancing visual functioning, for printed materials as well as in environmental design. Text should be printed with the best possible contrast. For many older people light lettering—either white or light yellow—on a dark background, usually black, is easier to read than black lettering on a white or light yellow background.
Paper Quality
Avoid using glossy finish paper such as that typically used in magazines and some journals. Glossy pages create excess glare, which makes it more difficult for people with low vision to read.
Leading (Space Between Lines of Text)
The recommended spacing between lines of text is 1.5, rather than single space. Many people who are visually impaired have difficulty finding the beginning of the next line when single spacing is used.
Tracking (Space Between Letters)
Text with letters very close together makes reading difficult for many people who are visually impaired, particularly for those who have central visual field defects, such as older persons with macular degeneration. Spacing between letters should be wide—for example, a mono-spaced font such as Courier, which allocates an equal amount of space for each letter, is very readable.
Margins
Many low vision devices, such as stand magnifiers and closed-circuit televisions (CCTVs) are easiest to use on a flat surface. An extra-wide binding margin makes it easier to hold the material flat. A minimum of one inch should be used; one and a half inches is preferable.
Research is still underway to determine how text can be made more legible for individuals with limited vision.
We hope you’ve found this information helpful. Please consider making a donation today to support our free information, programs, and research. | 3,225 | 1,555 | 0.000652 |
warc | 201704 | In his handing over speech, the WHO Representative, Dr. Rufaro Chatora, highlighted factors hampering smooth provision of Maternal, Newborn and Child Health services to include: inadequate qualified health workers, and limited availability of ambulances, equipment, medicines and other commodities. Elaborating on the rationale for the support, Dr. Chatora said, “We recognize that effective referral systems and supportive supervision are important pillars in ensuring quality health care services. We recognize the need for technical supervisors from central level of MOHSW and PMORALG to travel to the regions and local authorities to ensure service provision is done according to national guidelines. Experts from referral hospitals also need to provide mentorship and support to hospital and health centre staff. We also recognize the need for improving the ambulance fleet to ferry referred patients. This approach works.”
He further explained that “the 18 Ambulances will contribute to improving referral systems especially for Emergency Obstetric, Newborn and Child care in 18 health facilities. The three (3) vehicles will facilitate supportive supervision by the Coordinating Units in the MOHSW and PMORALG”. He concluded by reassuring WHO and the UN’s commitment to work with partners to support the Ministry of Health and Social Welfare to improve health service delivery in the country.
Similar remarks were echoed by the UNFPA Representative, Ms. Mariam Khan, who was also present to hand over 4 ambulances to support referral services for Emergency Obstetric, Newborn and Child care in Shinyanga Region.
In his acceptance speech, the Minister of Health and Social Welfare Hon. Dr. Hussein Mwinyi highlighted achievements made so far in improving maternal, newborn and child health care services and the remarkable reductions of under-five child mortality. Citing challenges that still remain in reducing maternal deaths, the Minister said that the vehicles handed over will strengthen provision of referral services and complement the country’s efforts in realising the Millennium Development Goal number 5. The Minister went on further to mention the health facilities receiving the support to include: District Hopitals in Mbeya, Babati, Ilemela, Ludewa, Chato, Bukombe, Chuya and Moshi and Health Centres in Same, Rufiji, Ismani, Misenyi, Meatu, Kondoa, Muleba, Meru, Mbogwe, Bariadi, Kishapu and Njombe. He concluded by expressing appreciation to the World Health Organization (WHO) and UNFPA for the timely support to the people of Tanzania and assured that the vehicles will be maintained and used for the intended purposes. | 2,680 | 1,298 | 0.000781 |
warc | 201704 | Professional Competencies for Reference and User Services Librarians Under revision in 2016 - Updates coming soon. Written by the RUSA Task Force on Professional Competencies, chair, Jo Bell Whitlatch and members, Nancy E. Bodner, Muzette Z. Diefenthal, Nancy Huling and Kathleen M. Kluegel. Approved by the RUSA Board of Directors, January 26, 2003. Introduction
The purpose of the guideline that follows is to provide librarians, libraries, and information centers with a model statement of competencies essential for successful reference and user services librarians. Competencies must be relevant to the particular job requirements. Therefore, individuals and organizations applying these guidelines may wish to select those strategies for meeting the competency goals that are most appropriate to their situation.
These competencies are focused on the abilities, skills, and knowledge that make reference and user services librarians unique from other professionals. The competencies assume a basic infrastructure of competencies required by all professionals, such as skills related to communication, reading, writing, and mathematics. This statement also elaborates upon the more generic statement on Core Competencies developed by the American Library Association for all types of librarians, including librarians specializing in reference and user services. Finally, the Guidelines for Behavioral Performance of Reference and Information Services Professionals on approachability, interest, listening/inquiring, searching, and follow-up are incorporated through specific references into the Professional Competencies for Reference and User Services Librarians.
Definitions: Reference and User Services Librarians: Librarians that assist, advise, and instruct users in accessing all forms of recorded knowledge. The assistance, advice, and instruction include both direct and indirect service to patrons. Competencies: Behaviors that excellent performers exhibit more consistently and effectively than average performers. A behavioral basis is necessary because effective assessment of competencies depends on observed behavior. Thus, the task force has focused on identifying the underlying behaviors that lead to successful performance in organizations providing reference and user services to patrons. The competencies provided in this document are only those that are critical to excellent reference and user services to patrons. These competencies for reference and user services librarians are designed to be understood and utilized in the broader context of the American Library Association's statement of Core Competencies. Strategies:Strategies are specific plans of action that excellent performers typically employ to achieve competency goals. Access
The primary focus of this section is on understanding information needs and information behavior of primary users and developing the skills to effectively meet those information needs. Access includes competencies related to coping with user information overload, recognizing the importance of user time and convenience, and removing barriers to service. Access competencies include the ability to identify documents through a knowledge of bibliography and indexing, the ability to identify and provide solutions that minimize cognitive and physical barriers to access, and the ability to assess for individual users materials that will provide the appropriate level of linguistic and conceptual access.
Responsiveness Goal: A librarian provides services that are responsive to user needs. Strategies: Determines the situational context of the individual information needs of users when interacting with each user in person or through another communication channel. Analyzes information sources recommended to users in the context of the attractiveness, interests, and content level for each user. Suggests specific works that relate to what the user said is important. Utilizes the Behavioral Standards for Reference Librarians on Approachability, Interest, and Listening/Inquiring when providing reference service in a traditional in-person service setting. Engages users in discussions about experiences related to their information needs and communicates interest in every user's experiences. Respects the right of users to determine the direction of their research by empowering them to pursue their own preferences. Organization and Design of Services Goal: A librarian effectively designs and organizes reference and user services to meet the needs of the primary community. Strategies: Organizes presentation of information resources to match the process users typically use in seeking information to meet their needs. Creates bibliographies, book talks, displays, tutorials, electronic documents, and other special tools to increase access to information resources and to motivate users to use them. Organizes and effectively displays information so that it is meaningful to the primary user group. Utilizes Guidelines for Behavioral Performance on Searching when providing reference service. Designs services to meet the special access needs of primary users, including those with disabilities, and those with English as a second language. Compiles and maintains information about community resources of interest to primary user groups so that users can be referred to appropriate sources of assistance. Critical Thinking and Analysis Goal: A librarian provides high quality services by carefully analyzing both information sources and services. Strategies: Uses electronic and printed media to connect users with highly recommended, carefully selected sources for topics of greatest interest to primary users. Synthesizes a variety of information sources in order to provide the most relevant information to each patron. Evaluates information use patterns based on data collected as a result of information service operations and uses the results to enhance services to users. Applies knowledge about the process of information seeking to structure information services for users. Utilizes Guidelines for Behavioral Performance on Follow-up when providing reference service. Knowledge Base
The areas of knowledge essential for reference and user services librarians are: (1) the structure of information resources in areas of knowledge central to primary users; (2) knowledge of basic information tools, including online catalogs, search systems, databases, Web sites, journals and monographs in both printed and electronic formats, videos, and sound recordings; (3) information seeking patterns and behaviors of primary users; (4) communication principles involving interaction with users both in person and through other channels; (5) the influence of technology on the structure of information; (6) copyright and intellectual property law; and (7) information competency standards.
Important skills include understanding assessment techniques, methods of continuous learning, how to apply knowledge to practice, and how to plan and implement enhanced services for users. Core knowledge is acquired as part of basic professional education. However, knowledge must be continuously updated. Therefore, this section of the competencies establishes goals and strategies for remaining current in domains of knowledge for reference and user services.
Environmental Scanning Goal: A librarian monitors the most relevant information sources to routinely update knowledge of current developments in reference and user services. Strategies: Reads, views, and listens to media to keep current in areas of knowledge relevant to primary users. Attends exhibits at local, regional, or national professional conferences at least once a year when the institution provides support. Scans the environment for emerging technologies that are relevant to delivery of reference and user services. Keeps current on new information resources by consulting a wide variety of reviewing sources and publishers catalogs, including those of small presses, by attending professional meetings, by reading, viewing, and listening. Reads reviews in both print and online media concerning works in all formats of greatest interest to primary users. Application of Knowledge Goal: A librarian effectively utilizes new knowledge to enhance reference and user services practices. Strategies: Reads the reference and research literature in user services and applies the knowledge gained to improving professional practice. Integrates use of latest technology and tools into every day practice. Explores available technologies and their application to reference and user services. Experiments with latest available innovations to assist users in meeting their information needs. Dissemination of Knowledge Goal: A librarian shares expertise with colleagues and mentors newer staff. Strategies: Teaches classes in areas of expertise. Prepares presentations in areas of expertise. Creates Web pages in areas of expertise. Discusses issues with colleagues. Mentors colleagues through listening, coaching, and serving as a role model. Reviews draft manuscripts for colleagues. Participates in professional discussions through meetings, videoconferences, mail lists via email and other available communication methods and forums. Active Learning Goal: A librarian actively contributes to improving professional practice through engaging in projects with colleagues and enhancing individual skills through independent learning. Strategies: Participates actively in professional organizations and works with librarians from a wide range of organizations. Acquires skills through technology-based learning modules when available and appropriate. Marketing/Awareness/Informing
A planning process is essential in order to identify and promote services to users. A strategic plan of operations provides a framework for goals and objectives to be formalized. This roadmap for service functions provides means and methods by which services and information are delivered. A marketing plan is a an aspect of strategic planning that is a promotional mechanism by which goals, objectives and strategies can be measured in a quantitative manner. Who is providing reference services, what services are being provided, and the effectiveness of the services are the issues that need to be addressed.
Assessment Goal: A librarian conducts research to determine what types of reference services to provide and to what types of users these services will be provided. Strategies: Conducts surveys, within and beyond the library building, to address the needs of users in the area of reference services. Conducts focus groups to meet and interact with users and to discuss and gather information about users' information needs. Consults with other libraries to network and brainstorm concerning the programs and services that are provided in the area of reference. Meets with community leaders to bridge the gap between the library reference service and the individuals and groups that make up the community that the service addresses. Evaluates information gathered from the research and background preparation for the development of the reference service program. Determines the user focus and reference service that will be provided. Implements the reference and user services program that meets the information needs of users in the designated community. Communication and Outreach Goal: A librarian effectively communicates the nature of the reference and information services that are provided to users being served. Strategies: Develops a written marketing plan as part of a strategic plan of services and operations to set goals and objectives of service. Develops a public relations plan for staff that trains individuals and addresses the importance of publicity and promotion of reference services. Creates a physical environment that encourages users to visit the physical library setting or utilize the virtual library and its services. Utilizes electronic media such as homepages, e-mail, mail lists, radio and television to promote reference services. Uses print media such as newspapers, brochures, newsletters, displays, and posters to communicate the reference services being provided. Determines community relationships and develops partnering models of services with groups within the community. Engages users through lectures, programs, tours, school visits, departmental addresses, and press conferences to promote the reference services offered. Evaluation Goal: A librarian consistently and systematically evaluates the effectiveness of the marketing of reference and information services. Strategies: Conducts in-house meetings and training sessions to gather feedback from reference librarians regarding the success of the reference services being provided and products being offered. Engages users in focus groups, surveys, and feedback forms as a user follow-up for reaction and perception of reference services. Evaluates the current and changing trends in reference and information services and adjusts the services being provided and the promotion of these services. Identifies the strengths and weaknesses of the products being offered as part of reference services delivery. Identifies new methods of service, new products and potential new users by participating in conferences, workshops, and professional associations. Decides what reference services and products will be retained and what changes will be implemented, if any. Continues the evaluation process as a periodic review that is set in a timeline for all reference service providers to participate in. Collaboration
Webster's defines collaboration as "working jointly with others or together especially in an intellectual endeavor; the Oxford English Dictionary describes it as "working in conjunction with another or others, to cooperate." Although librarians have always worked together, collaboration has assumed new importance in a world that has witnessed a phenomenal growth in information, new knowledge, and sophisticated technology, all within a relatively short timeframe. Because of the expansion of information and the increasing variety of ways to access information, librarians must work with colleagues, professional organizations, agencies, and other groups to ensure that users receive the information service they need at the time of need and in the most suitable format. Librarians need to recognize and respect the role played by the user in the information interaction. Librarians must actively pursue collaborations that enhance services for their users.
Relationships with Users Goal: A librarian treats the user as a collaborator and partner in the information seeking process. Strategies: Utilizes the Guidelines for Behavioral Performance of Reference and Information Services Professionals on Listening/Inquiring, Searching, and Follow-up. Asks user's opinion and advice while working through the information transaction. Involves the user in the process and in making decisions. Acknowledges the knowledge brought by the user to the interaction. Acknowledges the limits of local resources and refers to an appropriate resource base. Relationships with Colleagues Goal: A librarian works closely with colleagues to provide quality service to users. Strategies: Recognizes that colleagues have unique knowledge, skills, and strengths that can assist in responding to inquiries. Elicits assistance from a colleague when appropriate. Seeks opportunities to share knowledge and expertise with colleagues. Facilitates and participates with colleagues in team development efforts to improve user service. Works effectively as part of a team. Models effective team process behavior, including listening, discussing, and trust. Develops with colleagues shared goals and values for excellent user services. Relationships Within the Profession Goal: A librarian develops collaborative relationships within the profession to enhance service to users. Strategies: Takes advantage of the networking opportunities provided by active participation in local, regional, state, national, and international professional organizations. Identifies and seeks out possible partners in order to expand services to users. Volunteers for and participates in state and national collaborative efforts that will benefit local users. Utilizes the Guidelines for Behavioral Performance of Reference and Information Services Professionals on Follow-up. Relationships beyond the Library and the Profession Goal: A librarian develops and maintains partnerships beyond the library and the profession to strengthen services to users Strategies: Identifies partners who have knowledge and expertise of value to the library's users. Communicates effectively with partners to ensure mutual understanding of goals, objectives, and values. Forms partnerships to improve existing systems and to develop new products and services. Evaluation and Assessment of Resources and Services
Consistent assessment of resources in the context of users' needs is essential to keep any information service vital and relevant. A parallel effort in assessing and evaluating the delivery of information services is equally important. A wide range of information services is provided to the users through a large and growing set of delivery channels. There are print collections visited on site, print materials that are delivered to the user, electronic collections delivered over the Internet, information services provided through in-person, telephone, fax, email, and web-based virtual sessions. In all these services, the goal is to make the resources of the library available to the user in a way and a format that meets the user's needs.
The most critical element in any information service is the staff providing it. Using evaluation measures for performance of the staff is a challenge. Many aspects of the information service interaction are intangible and difficult to measure objectively. However, the goal of assessing and evaluating performance remains valid, if elusive.
Reference and user services librarians are required to have competencies in both formal and informal methods of evaluation and assessment. Assessment methods can range from effective use of closure questions in the reference interaction to a user feedback form on interlibrary loan documents and on through structured surveys and studies using unobtrusive observation. Use of these and other assessment and evaluation measures will vary across time and across institutions to fit particular needs, but the competencies required to conduct them will endure over time.
User Needs Goal: A librarian effectively uses tools and techniques to survey users and their information needs. Strategies: Identifies the user population and the potential user population. Plans and conducts regular assessments of information needs of primary user groups, using various formal and informal methods. Translates user needs into a plan for services. Information Services Goal: A librarian assesses the effectiveness of information services provided to users. Strategies: Develops and incorporates measures of evaluation into any new information service. Develops service standards for new and existing information services. Creates an organizational climate in which all existing and proposed services are measured consistently against a standard. Analyzes the resources available and utilizes the human and fiscal resources for service programs that most effectively meet the needs of users in the designated community. Information Resources Goal: A librarian assesses and evaluates resources in all formats in terms of objective standards and how well it meets the library's user needs. Strategies: Assesses the content of resources in the print and virtual collections for accuracy and currency. Determines the authority of these resources. Identifies any bias or point of view in an information resource. Evaluates new information sources appropriate for the primary users. Reads reviews of new information resources to complement the librarian's own judgment. Writes and publishes reviews of new information resources. Service Delivery Goal: A librarian evaluates new or existing services for a match between user capabilities and service technological requirements. Strategies: Determines the appropriate mix of technologies and delivery channels to meet the particular user group's needs. Assesses new technologies to see if they can meet the service needs more effectively than current methods, but not disenfranchise users. Experiments with and evaluates changes in services to users. Assesses the distribution of human and fiscal resources to ensure that resources are not tied to services or delivery methods that are no longer needed. Information Interfaces Goal: A librarian evaluates the format, access, and presentation aspects of resources as part of the overall assessment of the value of tools. Strategies: Identifies any factors that impede the use of the resource. Determines if there are alternative information resources that have better user interfaces. Communicates with the information resource designers concerns about usability. Information Service Providers Goal: A librarian effectively identifies and employs evaluation techniques that measure staff performance. Strategies: Identifies and uses those measures that have been developed by the profession, for example, the RUSA Guidelines for Behavioral Performance. Works with the information service staff to develop a consensus of service standards. Develops measures that will be useful in assessing whether or not service standards are being met. Supports and encourages an esprit de corps that will work to evaluate and improve service behaviors. | 21,801 | 7,508 | 0.000133 |
warc | 201704 | 02/19/2009 In defense of "implant," or, Ow. That hurt, in a miniature kind of way.
I'm gonna shatter what remaining infertility cred I have with a single crotchety declaration:
I don't quite get what's wrong with
implant.
Wait, now, hear me out. I'm as big a stickler for precision in language as anywhatsis. If you knew how long I spend sometimes poring over the compact OED looking for juuust the right word, you'd beat me with the scaled-down magnifying glass cunningly stored in the slipcase. (It's a little thing, this glass, and probably wouldn't withstand any sustained whaling. You'd have to be gentle. It would take some doing to cause any lasting damage. Lots and lots of teeny tiny taps. But
my feelings would be hurt, and that'd be devastating enough.)
The cause of confusion with
implant seems to be the unfortunate fact that the same seven letters are being used to spell two utterly different words. One of those words is transitive, taking an object: Next thing you know, we'll learn that that crap-ass doctor implanted two dozen embryos into the rhinestone-crusted minaudiere of a tranq'd-out drag queen. Subject: doctor. Verb: implanted. Object: embryos. See? Transitive. Someone or something does something to someone or something. (When it comes to creating catchy mnemonics, I simply have no equal.) The definition of implant when used in this transitive sense is to insert or fix (tissue or an artificial object) into the body. And that is what is being done upon embryo transfer, no?
The other i-word is intransitive, taking no object:
Of those two dozen embryos, seventeen implanted, stretching the tiny handbag well past its breaking point and scattering diamantés, like, everywhere, but improving the doctor's clinical pregnancy rate appreciably. The embryos do their thing, but they do it to no one and nothing. The OED doesn't seem to carry any relevant definition of this sense. Maybe if I give it a punishing series of wee little whacks with the glass it will cough some up. For now, let's just define this sense of implant as burrow its intrepid way into the endometrium like the bravest of naked mole rats. (Naked mole rat embryos, I suppose, as long as we're being precise. Godspeed, you ugly bastards.)
See what I mean? Totally different words. It is merely a sad accident that they happen to consist of the same letters in exactly the same order. I know: What are the odds?
I just wonder if maybe we don't get a little too hung up on this. It's kind of like a bunch of
Star Wars
freaks — excuse me, enthusiasts — getting all indignant and pissed off
because...see, I don't know enough about Star Wars to construct an analogy that's even remotely plausible, but just imagine. (Perhaps something in a Wookiee with an anachronistic wristwatch...? Because everyone knows that titanium alloys weren't available on the lushly-forested planet of Kashyyyk during the era in which The Star Wars Christmas Special was set. Do they take us for morons?) Within our
own echo chamber, we can all agree that we're right. And we are right. Transfer is a better word. It's just such an esoteric point that no one else on the planet cares, not even a little.
Most of the objections I've seen to using
implant instead of transfer
center on the contention that doing so fosters a false impression of
the mechanics of IVF: that putting embryos into a uterus invariably
results in pregnancy, implantation being in every way equivalent to implantation, the simple act of placement implying the beginning of a pregnancy. But I cannot believe that the people who think this do so because of unclear terminology. Since when, after all, did your dumbass co-worker know that the establishment of a pregnancy is called implantation? Her? She wouldn't know a cytotrophoblast from a syncytiotrophoblast if they got all up in her personal uterine business and said, "Hey, could you keep it down? We're trying to differentiate here." Believe me, you're not going to confuse her.
So although, as I said, I appreciate careful word choice, that's not an argument that gets me frothy. It doesn't bother me when a layman uses
implant for transfer; I figure he has no reason to know that one is preferred while the other will make infertiles all over the Internet crazier than a shithouse naked mole rat, and his meaning is always clear.
And it doesn't bother me when a doctor uses it, someone who "should know better," as I keep reading. Because, I mean, of
course he knows better, that transferring embryos does not necessarily imply a pregnancy. (That is, unless it's the OB who prescribed the 39-year-old you a year of Clomid
without any monitoring whatsoever, who considering his other shortcomings might well not know, in which case I encourage you to buy your own
OED. The 1971 edition's the real peach, the one with two volumes. The
current edition is something of a disappointment, coming as it does
with only a chump-ass fish-eye of a magnifier, completely unsuitable
for performing a much-needed beatdown. And when it comes to optics-as-weapons, why, don't you deserve the best?)
Where was I? Oh, right. Of course the board-certified card-carrying dues-paying member of the ASRM quoted in a relatively reputable newspaper knows better. That he still uses
implant suggests, I think, an intriguing possibility: that implant-transitive might just be a perfectly workable term.
So go on. Go buy yourself a dictionary and tap the sloppily worded shit out of me. Clearly I need a good beating if I'm agreeing with the establishment on this one. | 5,600 | 2,832 | 0.000357 |
warc | 201704 | As soon as the chaplain hands me a hard hat and a high visibility jacket I realize that this is not going to be a walk in the park. We drive around the wharves and loading piers of the docks, and I know that what he has told me is true: We have entered an invisible world. The chaplain, representing the Roman Catholic charity Apostleship of the Sea, has made his home here in this continually shifting and apparently godforsaken world that extends for many miles along the northeast English coastline, and his profound love for the place shines out of his eyes. The remaining millions of us switch on our lights without a thought for the men who have been at sea for the last nine months, carrying coal across the ocean to make this possible. But the chaplain sees the invisible. He knows that God is here.
His very modest room overlooks the quayside, and no ship enters or leaves the port without passing beneath his loving scrutiny. The walls reveal jagged cracks from the juddering of huge cargo ships through the narrow lock just below his window. His constantly changing companions in this inhospitable wilderness are the thousands of foreign seafarers—Filipino, Chinese, Ukrainian, Iranian, Indian and so many more—who pass through these docks, literally like ships in the night. They would be anonymous if he did not shake their hands, ask their names and make them welcome. They would be stranded for as long as their ship is moored if he did not ferry them back and forth to the chaplaincy center. They might well be unpaid and undefended if he did not make it his business to watch out for exploitative practices and alert the law enforcement authorities.
We make our way through showers of coal dust and iron ore and towering stacks of containers, carefully observant of the movements of huge overhead cranes, and board a newly arrived vessel. The chaplain points out the discs attached to the top of the ropes to prevent the wharf rats clambering on board. He remarks that the tide is low and the climb up the gangplank will be easy this morning. High tide would mean a much steeper gradient to scale.
A Filipino seafarer asks him for help wiring money home to his family. No problem. We take him to a place where he can do this as cheaply as possible. On the way back he tells us it is school enrollment week in Manila. His regular pay has not been sent to his home account for three months. The school will not wait. He needs to send the pocket money he has saved. When the transaction is complete, his relief is palpable. The simple offer of a ride to the money exchange office means that three Filipino children will now be able to go to school for another year. Mighty trees can grow from tiny seeds of kindness.
Another seafarer has never seen his little son, born several months ago. In the chaplaincy he can talk by Skype with his wife back home. The tears flow as he proudly shows his little one on the screen. Here the Gospel is a phonecard or a webcam bringing sight to the blind, reconnecting the disconnected, mediating God’s love to these lonely, far-from-home fathers.
Not infrequently the crews of ships sailing under flags of convenience, for which no nation considers itself responsible, speak with the chaplain about withheld pay, insufficient food, physical abuse or even the manifest unseaworthiness of their vessel. He has been around these docks for decades now, and he knows how to evaluate such complaints. The Coast Guard trusts his judgment. A call to the maritime police can cause the vessel to be detained and investigated. The Gospel here is a watchful eye from someone who cares enough to take those first steps to set captives free and bring support to the oppressed and the afflicted.
The chaplain has asked one newly arrived crew whether there is anywhere they would like him to take them while they are moored. They come back with their astonishingly modest request: “Father, would you take us to somewhere where we can walk on grass?” they ask. He takes them to a nearby park, where they take off their shoes and socks. Weary, calloused feet that have trodden only heaving steel for the past many months rejoice to feel the cool firmness of the fresh and living grass.
“Anyone would think I had given them the earth,” the chaplain comments with a quiet smile. And, of course, he has. Along with a glimpse of heaven. | 4,408 | 2,199 | 0.000459 |
warc | 201704 | Think your smartphone is charging at full power? Think again. Your phone may tell you it's charging - it may even
think it's charging - but like a freshman at a liberal arts university, it doesn't know what it's doing or what it wants. This is where Practical Meter steps in. Think of it as an academic adviser for charging phones. It tells you how fast your phone is charging, and if used correctly, can help you get things moving in the right direction. Practical Meter's appeal is so strong that Power Practical just closed its Kickstarter funding period with sixteen times more money than they asked for.
Here's the gist of how the Practical Meter works. Your smartphone may say it's charging, but depending on which cable it's using and where it's plugged in, the phone may be charging half as fast as it should be, if not slower. This is why Power Practical put forward the Practical Meter, a flash drive-sized device that users plug into a charging source before attaching a power cable. Its LED lights display how much power the cable is pulling.
If used in conjunction with Power Practical's optimized charging tips, it can speed up how fast the handset changes. A four hour charge time man suddenly become two. The cable comes with the obligatory Apple dock, but it supplies both mini and micro USB tips as well. The product is already developed and ready, and you can see it in action in the video below.
Power Practical wanted $9,999 for the project, but they received $167,820 from over 8,000 backers. This put them over both their 100K stretch goal (10 watt metering for tablets) and their 150K goal as well (charging cable color options). Those who pledged support shouldn't have to wait long to get a product in their hands. The Practical Meters are scheduled to ship sometime in September. | 1,812 | 943 | 0.001064 |
warc | 201704 | Alleviating Pain and Dealing with Dental Anxiety Eddie Storms| March 27th 2012 | Views: loading
A person often experiences greater pain in the oral cavity than in other parts of the body. This is because of proximity of the mouth to the brain and the complex network of nerves connecting the head and the neck. Adding to these factors is the pressure that results from infection caused by bacterial buildup.
Because of this, it’s no wonder 75 percent of adults in the US experience varying degrees of dental phobia. Despite knowing about the safety and effectiveness of dental procedures, many still feel anxious about dentists operating with sharp and pointed tools. Some even visit the dentist only when their problem is already severe. Good thing there are a number of ways to deal with pain and dental fear.
Many people fight their fear of dental procedures by forcing themselves to believe that pain is all in the mind. Although it is true that the brain is the one responsible for interpreting experiences to feelings or sensation, thinking positive about it is more difficult than it seems. In fact, forcing the mind to ignore the pain can cause even more stress.
Both the dentist and the patient play important roles when dealing with dental fear. The patient can deal with his anxiety by trusting the dentist, although this is quite hard to do if he has a bad experience with a dentist in the past. On the other hand, the dentist must make sure that there are no objects inside the dental office that can induce anxiety and see if the patient feels any hint of discomfort.
Dentists in huge cities like Atlanta sedation dentistry experts use different types of sedatives before any procedure to eliminate pain and help people get over their fears. Compared to the psychological approach, sedative dentistry calms down patients by making them feel relaxed down or rendering them unconscious.
Using laser in some dental procedures also reinforces the effectiveness of sedation. An Atlanta sedation dentist that uses both laser devices and sedation dentistry techniques can assure his patients that modern dental procedures are anything but stressful. Also helps reduce irritation after the procedure by allowing more precise incisions and preventing severe cases of bleeding.
More information about Atlanta sedation dentistry can be found in YourDentistryGuide.com. This website provides detailed information about various subjects in dentistry that you might find interesting. You can also look for dental offices near your area and ask your local dentists about sedation dentistry.
Article Source:
http://www.articleside.com/health-articles/alleviating-pain-and-dealing-with-dental-anxiety.htm
Published by Louise Carala on August 25th 2012 | Health
Published by Justin Bieber on August 25th 2012 | Health
Published by Justin Bieber on August 25th 2012 | Health
Published by Marvin Ferris on August 25th 2012 | Health
Published by Julia Roger on August 25th 2012 | Health
Published by Julia Roger on August 25th 2012 | Health
Categories Related Health Topics lung problemamla powder lasik houston indoor tanningcleveland vet lustral ear infection psychoanalysis long term plan infection | 3,217 | 1,511 | 0.000667 |
warc | 201704 | Details Description Details Seeds of Celastrus paniculatus Jyotishmati, "Intellect Tree"
"Celastrus paniculatus is plant with medicinal properties which first found its use in Ayurvedic medicine system of India, one of the world's oldest. The plant is a long-stemmed, woody vine, or a liana, sprouting out of the ground and using trees or other such objects to access sunlight. There have been dozens of healing effects attributed to the plant, particularly to the seeds and the oil produced from them. Most common and most studied of these effects is that on the learning and memory, although some physically beneficial effects were also reported. While tests are still carried out to ascertain the effectiveness of this plant, there do appear to be reasons as to why it is being used from the ancient times to this day still.
Indigenous to the Indian subcontinent, Celastrus paniculatus has now also found home in much of eastern, south eastern, and southern Asia and many of the islands in the Pacific ocean. Some of said countries include China, Taiwan, Indonesia, Thailand, Nepal, and Australia. The plant is known to grow on high altitudes, on elevations of usually up to 5,900 feet, or 1,800 meters, such as the Himalayan mountains. Being quite hardy, however, it is also known to grow even higher in some locations. The Celastrus paniculatus plant can grow to be fairly sizeable. The base stem of the vine can grow to be up to almost 10 inches, or 25 centimeters in diameter, and 20 feet, or 6 meters, in length. Said stem will produce dozens of smaller branches that will spread out all over the immediate area, wrapping themselves around whatever they may find. The plant is covered with a pale brown bark itself covered densely in lenticels. It is also covered in many oval leaves, ranging in light to dark green colors. Each top of the main stalk is adorned with small white flowers which can have a slight green or yellow-green tint. The prize of the plant, its seeds, are oval-shaped and grow in round pods, six per pod. The pods start out with a yellowish color, but grow deep red, the further they mature. Celastrus paniculatus is known by quite a few names, most recognizable of which is the intellect tree, due to the aforementioned effects of its seeds on cognition. The other names it is known under include black oil plant, climbing staff tree, Jyotishmati, and Malkangani. The former two names are self-explanatory, while the latter two refer the plant's names in Sanskrit and Hindi respectively. Medicinal properties of Celastrus paniculatus
The name ""the intellect tree"" is not something that should be thrown around loosely, and in the case of Celastrus paniculatus it is well deserved. For quite possibly 5000 years, give or take a few centuries, the plant must have been rather effectively used by the Ayurvedic healers, otherwise its use would have greatly diminished, if not discarded completely. The seeds of Celastrus paniculatus are the real deal, at least to an extent, according to studies.
In traditional Ayurvedic medicine, the oil of the seeds of Celastrus paniculatus was used to help with physical weakness, paralysis, cognitive and memory issues, reduce headaches, and even alleviate joint pains, such as in the case of arthritis. The seeds contain up to 50% of oil. The oil is used beside others for massages. It shall have a sedative effect and heal inflammations of the skin. The seed oil was also used in the making of a tonic which could mitigate memory loss and boost memory retention, as well as ease mental fatigue, which is the biggest claim to fame of this plant. Healers could also reportedly create a balm which increased sexual stimulation, one of the lesser known effects one could get out of Celastrus paniculatus. In recent research it has been proven that Celastrius paniculatus seeds and oil produced from them, are at the very least somewhat effective, especially when it comes to the helpful cognitive effects. In tests on rats and other small mammals, the richness of antioxidants in the seed oil was found to be effective against immobilization stress, lowering blood pressure, and increasing problem solving skills as well as alertness. It was also proven that the oil was more effective with increased dosage while having very low toxicity. Today, there are several herbal supplements that utilize the oil of Celastrus paniculatus with other useful herbs, as well as ongoing research into its effectiveness in treatment of certain cancers, which show some promise. From humble origins in the highlands of India, Celastrus paniculatus has spread to almost the entirety of the world. With a proven track record in increasing cognitive functions, this plant has shown that traditional medicine, no matter how old, may still have much it can teach us. These seeds are available in those here offered retail package sizes, but will also be available in bulk wholesale amounts. Simply drop a line for further details. Cultivation of Celastrus paniculatus seeds
Before sowing the seeds of the intellect tree the arrilus has to be removed. After that the seeds can be put into the substrate. For germination success the seeds in the substrate have to be put into the fridge for one or two months at 5°C. At room temperature germination will occur after some time in the constantly moist substrate. Celastrus paniculatus is winter hardy.
Additional Information Additional Information color No Reviews | 5,477 | 2,498 | 0.000402 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.