Unnamed: 0 int64 3 832k | id float64 2.49B 32.1B | type stringclasses 1
value | created_at stringlengths 19 19 | repo stringlengths 5 112 | repo_url stringlengths 34 141 | action stringclasses 3
values | title stringlengths 2 430 | labels stringlengths 4 347 | body stringlengths 5 237k | index stringclasses 7
values | text_combine stringlengths 96 237k | label stringclasses 2
values | text stringlengths 96 219k | binary_label int64 0 1 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
33,480 | 7,720,467,561 | IssuesEvent | 2018-05-23 23:20:15 | wallabyjs/public | https://api.github.com/repos/wallabyjs/public | closed | VSCode - Show code coverage at the bottom right corner | UX VS Code feature request | Hi!
One feature that would be really nice to have until the webapp support multiple projects is to have code coverage displayed in the bottom right corner of the VS Code extension.
**Proposition:**
Show code coverage at the bottom right by default
Add a setting that can disable code coverage.
If multi-root wor... | 1.0 | VSCode - Show code coverage at the bottom right corner - Hi!
One feature that would be really nice to have until the webapp support multiple projects is to have code coverage displayed in the bottom right corner of the VS Code extension.
**Proposition:**
Show code coverage at the bottom right by default
Add a s... | non_comp | vscode show code coverage at the bottom right corner hi one feature that would be really nice to have until the webapp support multiple projects is to have code coverage displayed in the bottom right corner of the vs code extension proposition show code coverage at the bottom right by default add a s... | 0 |
17,260 | 23,803,216,313 | IssuesEvent | 2022-09-03 16:23:39 | Fabricators-of-Create/Create | https://api.github.com/repos/Fabricators-of-Create/Create | closed | texture bug with liquid pipes | bug 1.18 compatibility upstream | ### Describe the Bug
If you build a section with a few pipes and look at them from a little higher up, they become invisible.
### Reproduction Steps
1. build a 4 block long pipe
2. look at them from a certain angle
...
### Expected Result
normal looking pipes from all angles
### Screenshots and Videos
![2022... | True | texture bug with liquid pipes - ### Describe the Bug
If you build a section with a few pipes and look at them from a little higher up, they become invisible.
### Reproduction Steps
1. build a 4 block long pipe
2. look at them from a certain angle
...
### Expected Result
normal looking pipes from all angles
##... | comp | texture bug with liquid pipes describe the bug if you build a section with a few pipes and look at them from a little higher up they become invisible reproduction steps build a block long pipe look at them from a certain angle expected result normal looking pipes from all angles ... | 1 |
191,703 | 15,301,852,266 | IssuesEvent | 2021-02-24 14:06:18 | NiliStein/DNASimulator | https://api.github.com/repos/NiliStein/DNASimulator | closed | I/O Files Examples | documentation | ### Error Simulation:
Input file example:
(Collection of strands to simulate on)
Path given by user.
```
TTGTCACTAGAGGACGCACGCTCTATTTTTATGATCCATTGATGTCCCTGACGCTGCAAAATTTGCAACCAGGCAGTCTTCGCGGTAGGTCC
TGACGCTGCAAAATTTGCAACCAGGCAGTCTTCGCGGTAGGTCATTGATGTCCCTGACGCTGCAAAATTTGCAACCAGGCAGTCTTCGCGGT
AAATTTGCAACCAG... | 1.0 | I/O Files Examples - ### Error Simulation:
Input file example:
(Collection of strands to simulate on)
Path given by user.
```
TTGTCACTAGAGGACGCACGCTCTATTTTTATGATCCATTGATGTCCCTGACGCTGCAAAATTTGCAACCAGGCAGTCTTCGCGGTAGGTCC
TGACGCTGCAAAATTTGCAACCAGGCAGTCTTCGCGGTAGGTCATTGATGTCCCTGACGCTGCAAAATTTGCAACCAGGCAGTCTTC... | non_comp | i o files examples error simulation input file example collection of strands to simulate on path given by user ttgtcactagaggacgcacgctctatttttatgatccattgatgtccctgacgctgcaaaatttgcaaccaggcagtcttcgcggtaggtcc tgacgctgcaaaatttgcaaccaggcagtcttcgcggtaggtcattgatgtccctgacgctgcaaaatttgcaaccaggcagtcttc... | 0 |
18,740 | 26,102,798,918 | IssuesEvent | 2022-12-27 09:22:48 | Crocoblock/suggestions | https://api.github.com/repos/Crocoblock/suggestions | closed | JetBooking and JetSmartFilters do not show locked days | compatibility JetBooking | Hello,
I use JetBooking and JetSmartFilters to sell all-day event bookings. There are events not all week, only on designated days, i would like to filter the available events by date. I did this based on Crocoblock's description, that the events can be filtered by date. It works perfectly because it does not list eve... | True | JetBooking and JetSmartFilters do not show locked days - Hello,
I use JetBooking and JetSmartFilters to sell all-day event bookings. There are events not all week, only on designated days, i would like to filter the available events by date. I did this based on Crocoblock's description, that the events can be filtered... | comp | jetbooking and jetsmartfilters do not show locked days hello i use jetbooking and jetsmartfilters to sell all day event bookings there are events not all week only on designated days i would like to filter the available events by date i did this based on crocoblock s description that the events can be filtered... | 1 |
47,626 | 13,246,376,088 | IssuesEvent | 2020-08-19 15:37:11 | Deirdre18/starwars-ionic5-app | https://api.github.com/repos/Deirdre18/starwars-ionic5-app | opened | CVE-2011-4969 (Medium) detected in jquery-1.4.4.min.js | security vulnerability | ## CVE-2011-4969 - Medium Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Library - <b>jquery-1.4.4.min.js</b></p></summary>
<p>JavaScript library for DOM operations</p>
<p>Library home page: <a href="htt... | True | CVE-2011-4969 (Medium) detected in jquery-1.4.4.min.js - ## CVE-2011-4969 - Medium Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Library - <b>jquery-1.4.4.min.js</b></p></summary>
<p>JavaScript library ... | non_comp | cve medium detected in jquery min js cve medium severity vulnerability vulnerable library jquery min js javascript library for dom operations library home page a href path to dependency file tmp ws scm starwars app node modules selenium webdriver lib test data dragga... | 0 |
17,225 | 23,753,003,533 | IssuesEvent | 2022-08-31 22:47:21 | lgblgblgb/xemu | https://api.github.com/repos/lgblgblgb/xemu | closed | MEGA65: Test and improve V400 mode | WIP target:MEGA65 compatibility-example VIC-IV | In general there can be problems with modes using V400 (though bitplane mode is probably OK, in fact no other mode was tested too much with V400 other than bitplane). Now just one example, but in general, it's maybe a good idea to look this whole issue in a generic way.
## One example of the problem with OpenROMs
... | True | MEGA65: Test and improve V400 mode - In general there can be problems with modes using V400 (though bitplane mode is probably OK, in fact no other mode was tested too much with V400 other than bitplane). Now just one example, but in general, it's maybe a good idea to look this whole issue in a generic way.
## One ex... | comp | test and improve mode in general there can be problems with modes using though bitplane mode is probably ok in fact no other mode was tested too much with other than bitplane now just one example but in general it s maybe a good idea to look this whole issue in a generic way one example of the p... | 1 |
14,849 | 18,359,332,146 | IssuesEvent | 2021-10-09 00:59:22 | spring-projects-experimental/spring-native | https://api.github.com/repos/spring-projects-experimental/spring-native | closed | @Controller annotated class causes "Class proxy missing at runtime, hint required at build time" | type: compatibility theme: aot | I'm trying to build a native image from a fairly small app using Webflux and R2DBC.
When launching the native image it trips over `Class proxy missing at runtime, hint required at build time` for OAuthController class. As the name indicates it's annotated with `org.springframework.stereotype.Controller` so from my u... | True | @Controller annotated class causes "Class proxy missing at runtime, hint required at build time" - I'm trying to build a native image from a fairly small app using Webflux and R2DBC.
When launching the native image it trips over `Class proxy missing at runtime, hint required at build time` for OAuthController class.... | comp | controller annotated class causes class proxy missing at runtime hint required at build time i m trying to build a native image from a fairly small app using webflux and when launching the native image it trips over class proxy missing at runtime hint required at build time for oauthcontroller class as ... | 1 |
13,902 | 16,637,544,693 | IssuesEvent | 2021-06-04 02:16:53 | mariotaku/moonlight-tv | https://api.github.com/repos/mariotaku/moonlight-tv | closed | [COMPAT] | compatibility duplicate | Reopening the issue for this TV Model
## Basic information
<!-- Please fill info into following spaces -->
- Device model: OLED55C8PLA
- Firmware version: 05.30.10
- webOS version: 4.3.0
- Moonlight version: 0.7.11
- Is audio working: Yes
- Is video working: No. Black screen on all video decoder setting... | True | [COMPAT] - Reopening the issue for this TV Model
## Basic information
<!-- Please fill info into following spaces -->
- Device model: OLED55C8PLA
- Firmware version: 05.30.10
- webOS version: 4.3.0
- Moonlight version: 0.7.11
- Is audio working: Yes
- Is video working: No. Black screen on all video deco... | comp | reopening the issue for this tv model basic information device model firmware version webos version moonlight version is audio working yes is video working no black screen on all video decoder settings resolutions and refresh rates is input working y... | 1 |
18,871 | 26,215,708,512 | IssuesEvent | 2023-01-04 10:46:00 | Keksuccino/FancyMenu | https://api.github.com/repos/Keksuccino/FancyMenu | closed | Incompatibility with Advanced Creation | mod incompatibility | **Describe the issue**
When both mods are together the game crashes on startup
**Game Log**
https://gist.github.com/Dev-Hauffman/9d6dd9016696d859dec8143c22ef9fb5
**Basic Informations (please complete the following information):**
- OS: windows 7
- Fancymenu_forge_2.13.2_MC_1.12-1.12.2
- Active Mods: Advan... | True | Incompatibility with Advanced Creation - **Describe the issue**
When both mods are together the game crashes on startup
**Game Log**
https://gist.github.com/Dev-Hauffman/9d6dd9016696d859dec8143c22ef9fb5
**Basic Informations (please complete the following information):**
- OS: windows 7
- Fancymenu_forge_2.1... | comp | incompatibility with advanced creation describe the issue when both mods are together the game crashes on startup game log basic informations please complete the following information os windows fancymenu forge mc active mods advancedcreation | 1 |
593,449 | 18,007,495,611 | IssuesEvent | 2021-09-16 02:53:02 | PlaceOS/PlaceOS | https://api.github.com/repos/PlaceOS/PlaceOS | closed | Implement more granular OAuth scopes | epic focus: backend product: placeos priority: high type: roadmap | **Is your feature request related to a problem? Please describe.**
In order to provide tighter access control for applications built on PlaceOS, API interactions need to restrict behaviour based on the current [auth scope](https://tools.ietf.org/html/rfc6749#section-3.3).
This works alongside the current user based... | 1.0 | Implement more granular OAuth scopes - **Is your feature request related to a problem? Please describe.**
In order to provide tighter access control for applications built on PlaceOS, API interactions need to restrict behaviour based on the current [auth scope](https://tools.ietf.org/html/rfc6749#section-3.3).
This... | non_comp | implement more granular oauth scopes is your feature request related to a problem please describe in order to provide tighter access control for applications built on placeos api interactions need to restrict behaviour based on the current this works alongside the current user based access control rat... | 0 |
18,157 | 25,083,796,593 | IssuesEvent | 2022-11-07 21:44:34 | Automattic/woocommerce-services | https://api.github.com/repos/Automattic/woocommerce-services | closed | Custom Order Tables Compatibility | [Pri] High [Type] Compatibility | Refactor extension to be compatible with Custom Order Tables while retaining backwards compatibility.
See [[EPIC] Upgrade extensions to work with Custom Order Tables #233](https://github.com/Automattic/woocommerce-shipping-issues/issues/233) for more details.
| True | Custom Order Tables Compatibility - Refactor extension to be compatible with Custom Order Tables while retaining backwards compatibility.
See [[EPIC] Upgrade extensions to work with Custom Order Tables #233](https://github.com/Automattic/woocommerce-shipping-issues/issues/233) for more details.
| comp | custom order tables compatibility refactor extension to be compatible with custom order tables while retaining backwards compatibility see upgrade extensions to work with custom order tables for more details | 1 |
17,146 | 23,660,907,379 | IssuesEvent | 2022-08-26 15:28:43 | ZsoltMolnarrr/BetterCombat | https://api.github.com/repos/ZsoltMolnarrr/BetterCombat | closed | [Forge 1.18.2] Twilight Forest - Head visible First Person mode | waiting for release render incompatibility | **Minecraft version** - 1.18.2
**Mod loader** - Forge
**Mod version** - 1.1.0
**I am using the latest version available** - Yes
**Describe the bug**
When I swing my weapon in first person mode, I can see the inside and outside of my head.
**To Reproduce**
Steps to reproduce the behavior:
Swing a weapon wh... | True | [Forge 1.18.2] Twilight Forest - Head visible First Person mode - **Minecraft version** - 1.18.2
**Mod loader** - Forge
**Mod version** - 1.1.0
**I am using the latest version available** - Yes
**Describe the bug**
When I swing my weapon in first person mode, I can see the inside and outside of my head.
**To ... | comp | twilight forest head visible first person mode minecraft version mod loader forge mod version i am using the latest version available yes describe the bug when i swing my weapon in first person mode i can see the inside and outside of my head to reproduce s... | 1 |
3,072 | 5,968,140,836 | IssuesEvent | 2017-05-30 17:28:09 | bzdeck/bzdeck | https://api.github.com/repos/bzdeck/bzdeck | closed | Remove Developer Edition from supported browsers | compatibility | Firefox Developer Edition is now Beta-based so it's no longer supported. | True | Remove Developer Edition from supported browsers - Firefox Developer Edition is now Beta-based so it's no longer supported. | comp | remove developer edition from supported browsers firefox developer edition is now beta based so it s no longer supported | 1 |
6,815 | 3,909,010,749 | IssuesEvent | 2016-04-19 17:46:25 | uProxy/uproxy | https://api.github.com/repos/uProxy/uproxy | opened | third_party handling is a mess | C:BuildProcess P2 | Problem is uproxy's `typings.json` has to be a **superset** of uproxy, owing to how uproxy's `setup.sh` "merges" the two repos' folders.
Several ways to fix this, not sure which is best:
- `typings` folder should be inside `src`
- move uproxy-lib into uproxy and forget about this | 1.0 | third_party handling is a mess - Problem is uproxy's `typings.json` has to be a **superset** of uproxy, owing to how uproxy's `setup.sh` "merges" the two repos' folders.
Several ways to fix this, not sure which is best:
- `typings` folder should be inside `src`
- move uproxy-lib into uproxy and forget about this | non_comp | third party handling is a mess problem is uproxy s typings json has to be a superset of uproxy owing to how uproxy s setup sh merges the two repos folders several ways to fix this not sure which is best typings folder should be inside src move uproxy lib into uproxy and forget about this | 0 |
20,061 | 27,987,749,676 | IssuesEvent | 2023-03-26 21:47:41 | wisp-forest/numismatic-overhaul | https://api.github.com/repos/wisp-forest/numismatic-overhaul | closed | [1.19.2] Minecraft Comes Alive Incompatibility | type: compatibility status: confirmed status: scheduled | when loaded with MCA Reborn version 7.4.7 and 7.4.6 (haven't check another version) the game will crash on character making (after the world gen is finished and the mca logo appeared)
The loaded mod list is attached as a screenshot
 the game will crash on character making (after the world gen is finished and the mca logo appeared)
The loaded mod list is attached as a screenshot
 =
let mutable nums = [| 1; 3; 7; 15; 31; 63; 127; 255; 511; 1023 |]
override __.ToString() = String.Join(' ', nums)
member __.FindLargestSmaller(target: int) =
let mutable ctr = nums.Length - 1
while ctr > 0 && nums... | 1.0 | Color byref types as mutable - Consider this horribly imperative program:
```fsharp
type C() =
let mutable nums = [| 1; 3; 7; 15; 31; 63; 127; 255; 511; 1023 |]
override __.ToString() = String.Join(' ', nums)
member __.FindLargestSmaller(target: int) =
let mutable ctr = nums.Length - 1
... | non_comp | color byref types as mutable consider this horribly imperative program fsharp type c let mutable nums override tostring string join nums member findlargestsmaller target int let mutable ctr nums length while ctr nums target d... | 0 |
138,884 | 11,221,098,000 | IssuesEvent | 2020-01-07 17:05:13 | aws/amazon-vpc-cni-k8s | https://api.github.com/repos/aws/amazon-vpc-cni-k8s | closed | Script to trigger integration/e2e tests | testing | We need a script to trigger e2e/integration tests that optionally provisions a test cluster, tears it down, is configurable, etc. It should be executable from a CI job.
| 1.0 | Script to trigger integration/e2e tests - We need a script to trigger e2e/integration tests that optionally provisions a test cluster, tears it down, is configurable, etc. It should be executable from a CI job.
| non_comp | script to trigger integration tests we need a script to trigger integration tests that optionally provisions a test cluster tears it down is configurable etc it should be executable from a ci job | 0 |
96,041 | 3,963,686,613 | IssuesEvent | 2016-05-02 21:19:23 | newamericafoundation/newamerica-cms | https://api.github.com/repos/newamericafoundation/newamerica-cms | closed | Lead story content type css | Done Medium Priority Pre Launch | `.hero-grid__element__text-bar__subheading { font-size: 14px;color: #fff; padding: 10px 0px; }`
Standardizing with rest of site | 1.0 | Lead story content type css - `.hero-grid__element__text-bar__subheading { font-size: 14px;color: #fff; padding: 10px 0px; }`
Standardizing with rest of site | non_comp | lead story content type css hero grid element text bar subheading font size color fff padding standardizing with rest of site | 0 |
14,158 | 17,028,949,484 | IssuesEvent | 2021-07-04 06:26:42 | ORelio/Minecraft-Console-Client | https://api.github.com/repos/ORelio/Minecraft-Console-Client | closed | ChatBots get a block that another player digs | a:enhancement in:protocol-compatibility in:scripts-and-bots waiting-for:contributor | **Prerequisites**
- [x] I have read and understood the [user manual](https://github.com/ORelio/Minecraft-Console-Client/tree/master/MinecraftClient/config)
- [x] I made sure I am running the latest [development build](https://ci.appveyor.com/project/ORelio/minecraft-console-client/build/artifacts)
- [x] I tried t... | True | ChatBots get a block that another player digs - **Prerequisites**
- [x] I have read and understood the [user manual](https://github.com/ORelio/Minecraft-Console-Client/tree/master/MinecraftClient/config)
- [x] I made sure I am running the latest [development build](https://ci.appveyor.com/project/ORelio/minecraft-c... | comp | chatbots get a block that another player digs prerequisites i have read and understood the i made sure i am running the latest i tried to before opening a new one | 1 |
533,585 | 15,594,148,053 | IssuesEvent | 2021-03-18 13:36:27 | siteorigin/so-widgets-bundle | https://api.github.com/repos/siteorigin/so-widgets-bundle | closed | Post Carousel: Add Filter that allows you to limit the total number of displayed posts | enhancement priority-2 | A few users have requested the ability to be able to limit the total number of posts displayed using the Post Carousel.
| 1.0 | Post Carousel: Add Filter that allows you to limit the total number of displayed posts - A few users have requested the ability to be able to limit the total number of posts displayed using the Post Carousel.
| non_comp | post carousel add filter that allows you to limit the total number of displayed posts a few users have requested the ability to be able to limit the total number of posts displayed using the post carousel | 0 |
16,742 | 23,080,746,419 | IssuesEvent | 2022-07-26 06:56:35 | actiontech/sqle | https://api.github.com/repos/actiontech/sqle | opened | MySQL插件在界面上的展示由"mysql"调整为"MySQL" | suggestion not_compatible | **Describe**
目前界面上MySQL插件的展示名为mysql，拼写与现有插件风格不符。改为”MySQL”，需要考虑面影响，和升级方案
**Suggestion**
<!-- A clear and concise description of what you want to happen. -->
**Why**
<!-- Why it can solve your problem. -->
| True | MySQL插件在界面上的展示由"mysql"调整为"MySQL" - **Describe**
目前界面上MySQL插件的展示名为mysql，拼写与现有插件风格不符。改为”MySQL”，需要考虑面影响，和升级方案
**Suggestion**
<!-- A clear and concise description of what you want to happen. -->
**Why**
<!-- Why it can solve your problem. -->
| comp | mysql插件在界面上的展示由 mysql 调整为 mysql describe 目前界面上mysql插件的展示名为mysql，拼写与现有插件风格不符。改为”mysql”，需要考虑面影响，和升级方案 suggestion why | 1 |
20,483 | 30,288,954,134 | IssuesEvent | 2023-07-09 02:57:37 | Yesssssman/epicfightmod | https://api.github.com/repos/Yesssssman/epicfightmod | closed | Client Crash on 1.16.5 | mod incompatibility 1.16.5 | I was fighting and it instantly crashes when swinging a sword.
The client crashes; however, server does not.
https://pastebin.com/aUCkG8HQ | True | Client Crash on 1.16.5 - I was fighting and it instantly crashes when swinging a sword.
The client crashes; however, server does not.
https://pastebin.com/aUCkG8HQ | comp | client crash on i was fighting and it instantly crashes when swinging a sword the client crashes however server does not | 1 |
112,980 | 24,347,688,734 | IssuesEvent | 2022-10-02 14:40:31 | sast-automation-dev/WebGoat-NET-28 | https://api.github.com/repos/sast-automation-dev/WebGoat-NET-28 | opened | Code Security Report: 81 high severity findings, 177 total findings | code security findings | # Code Security Report
**Latest Scan:** 2022-10-02 02:37pm
**Total Findings:** 177
**Tested Project Files:** 314
**Detected Programming Languages:** 2
<!-- SAST-MANUAL-SCAN-START -->
- [ ] Check this box to manually trigger a scan
<!-- SAST-MANUAL-SCAN-END -->
## Language: C#
| Severity | CWE | Vulnerability Type | ... | 1.0 | Code Security Report: 81 high severity findings, 177 total findings - # Code Security Report
**Latest Scan:** 2022-10-02 02:37pm
**Total Findings:** 177
**Tested Project Files:** 314
**Detected Programming Languages:** 2
<!-- SAST-MANUAL-SCAN-START -->
- [ ] Check this box to manually trigger a scan
<!-- SAST-MANUAL-S... | non_comp | code security report high severity findings total findings code security report latest scan total findings tested project files detected programming languages check this box to manually trigger a scan language c severity cwe vulnerability type count ... | 0 |
186,000 | 21,910,316,700 | IssuesEvent | 2022-05-21 01:00:55 | eRez-ws/metasploit-framework | https://api.github.com/repos/eRez-ws/metasploit-framework | closed | CVE-2022-22577 (Medium) detected in actionpack-5.2.4.5.gem - autoclosed | security vulnerability | ## CVE-2022-22577 - Medium Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Library - <b>actionpack-5.2.4.5.gem</b></p></summary>
<p>Web apps on Rails. Simple, battle-tested conventions for building and te... | True | CVE-2022-22577 (Medium) detected in actionpack-5.2.4.5.gem - autoclosed - ## CVE-2022-22577 - Medium Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Library - <b>actionpack-5.2.4.5.gem</b></p></summary>
<... | non_comp | cve medium detected in actionpack gem autoclosed cve medium severity vulnerability vulnerable library actionpack gem web apps on rails simple battle tested conventions for building and testing mvc web applications works with any rack compatible server library home pa... | 0 |
11,599 | 13,649,096,844 | IssuesEvent | 2020-09-26 12:47:43 | nextcloud/ocsms | https://api.github.com/repos/nextcloud/ocsms | opened | Compatible with NC20 | compatiblity | Phone Sync is not compatible with Nextcloud 20.
**NOTE:**
There is a 1.10.1 version for Nextcloud 20 in Nextcloud Apps, which probably shouldn't be. When downloading, it redirects to a strange address. Firefox warns about the threat. | True | Compatible with NC20 - Phone Sync is not compatible with Nextcloud 20.
**NOTE:**
There is a 1.10.1 version for Nextcloud 20 in Nextcloud Apps, which probably shouldn't be. When downloading, it redirects to a strange address. Firefox warns about the threat. | comp | compatible with phone sync is not compatible with nextcloud note there is a version for nextcloud in nextcloud apps which probably shouldn t be when downloading it redirects to a strange address firefox warns about the threat | 1 |
8,107 | 10,224,181,480 | IssuesEvent | 2019-08-16 11:58:37 | bazelbuild/bazel | https://api.github.com/repos/bazelbuild/bazel | closed | incompatible_use_specific_tool_files: Use appropriate artifacts from cc_toolchain as inputs to C++ actions. | P2 breaking-change-1.0 incompatible-change migration-0.28 migration-0.29 team-Rules-CPP | `cc_toolchain` has attributes corresponding to various toolchain components like `ar_files`, `compiler_files`, and `as_files`. Previously, Bazel used broad file groups like `all_files` as inputs for several classes of actions and ignored the more specific toolchain attributes. `--incompatible_use_specific_tool_files` b... | True | incompatible_use_specific_tool_files: Use appropriate artifacts from cc_toolchain as inputs to C++ actions. - `cc_toolchain` has attributes corresponding to various toolchain components like `ar_files`, `compiler_files`, and `as_files`. Previously, Bazel used broad file groups like `all_files` as inputs for several cl... | comp | incompatible use specific tool files use appropriate artifacts from cc toolchain as inputs to c actions cc toolchain has attributes corresponding to various toolchain components like ar files compiler files and as files previously bazel used broad file groups like all files as inputs for several cl... | 1 |
230,541 | 18,675,718,595 | IssuesEvent | 2021-10-31 14:25:06 | home-assistant/home-assistant.io | https://api.github.com/repos/home-assistant/home-assistant.io | closed | Wrong speedtest | integration: speedtestdotnet | ### Feedback
I use the speedtest integration.
But for some reason, there is much lower download, upload and the ping is also bad.
Please make it possible to add server_id back or just in input field in the Configuration of the integration where can typing in the server_id of speedtest.net or just make that the s... | 1.0 | Wrong speedtest - ### Feedback
I use the speedtest integration.
But for some reason, there is much lower download, upload and the ping is also bad.
Please make it possible to add server_id back or just in input field in the Configuration of the integration where can typing in the server_id of speedtest.net or ju... | non_comp | wrong speedtest feedback i use the speedtest integration but for some reason there is much lower download upload and the ping is also bad please make it possible to add server id back or just in input field in the configuration of the integration where can typing in the server id of speedtest net or ju... | 0 |
102,823 | 4,161,314,993 | IssuesEvent | 2016-06-17 16:10:33 | fossasia/open-event-orga-server | https://api.github.com/repos/fossasia/open-event-orga-server | closed | Scheduler UI: javascript error while moving | bug Priority: High Scheduling | Due to the recent changes in the Sessions API Object structure, there are some `undefined parameter` errors in the Scheduler UI | 1.0 | Scheduler UI: javascript error while moving - Due to the recent changes in the Sessions API Object structure, there are some `undefined parameter` errors in the Scheduler UI | non_comp | scheduler ui javascript error while moving due to the recent changes in the sessions api object structure there are some undefined parameter errors in the scheduler ui | 0 |
3,903 | 6,748,408,762 | IssuesEvent | 2017-10-22 06:20:12 | mike42/escpos-php | https://api.github.com/repos/mike42/escpos-php | closed | Query About Printer Model | printer-compatibility question | Is CRS- "BTP 2002NP" supported for this code ?
If yes, then which interface ??
Thanks in advance :) | True | Query About Printer Model - Is CRS- "BTP 2002NP" supported for this code ?
If yes, then which interface ??
Thanks in advance :) | comp | query about printer model is crs btp supported for this code if yes then which interface thanks in advance | 1 |
286,690 | 24,771,473,653 | IssuesEvent | 2022-10-23 07:25:18 | godotengine/godot | https://api.github.com/repos/godotengine/godot | closed | MultiplayerSynchronizer only synchronizes the earliest client connected when the Replication Interval is set to anything above 0 | bug needs testing topic:network regression topic:multiplayer | ### Godot version
4.0.beta3.official
### System information
Windows 10 x64 Intel
### Issue description
When using a MultiplayerSynchronizer it will only synchronize the earliest connected client if the Replication Interval is set to anything above 0.
### Steps to reproduce
Run the included minimal ... | 1.0 | MultiplayerSynchronizer only synchronizes the earliest client connected when the Replication Interval is set to anything above 0 - ### Godot version
4.0.beta3.official
### System information
Windows 10 x64 Intel
### Issue description
When using a MultiplayerSynchronizer it will only synchronize the earli... | non_comp | multiplayersynchronizer only synchronizes the earliest client connected when the replication interval is set to anything above godot version official system information windows intel issue description when using a multiplayersynchronizer it will only synchronize the earliest con... | 0 |
18,212 | 25,196,305,160 | IssuesEvent | 2022-11-12 15:05:55 | jstedfast/MimeKit | https://api.github.com/repos/jstedfast/MimeKit | closed | Extra line breaks between status groups of a "message/delivery-status" mime part results in missing status group. | compatibility | **Describe the bug**
When parsing a "message/delivery-status" body part, having an extra line break after the first group results in the 2nd group not being parsed into the MessageDeliveryStatus.StatusGroups property.
**Platform (please complete the following information):**
- OS: Windows
- .NET Runtime: v4... | True | Extra line breaks between status groups of a "message/delivery-status" mime part results in missing status group. - **Describe the bug**
When parsing a "message/delivery-status" body part, having an extra line break after the first group results in the 2nd group not being parsed into the MessageDeliveryStatus.StatusGr... | comp | extra line breaks between status groups of a message delivery status mime part results in missing status group describe the bug when parsing a message delivery status body part having an extra line break after the first group results in the group not being parsed into the messagedeliverystatus statusgrou... | 1 |
45,948 | 13,055,826,601 | IssuesEvent | 2020-07-30 02:51:07 | icecube-trac/tix2 | https://api.github.com/repos/icecube-trac/tix2 | opened | I3DSTExtractor11 does not have a DAQ method (Trac #308) | Incomplete Migration Migrated from Trac combo reconstruction defect | Migrated from https://code.icecube.wisc.edu/ticket/308
```json
{
"status": "closed",
"changetime": "2012-07-12T16:03:29",
"description": "The 'I3DSTExtractor11' produces 'segmentation fault' when used with Q-frames in icerec_V04-00-01. Complains about libdst-extractor.dylib. \nLooking at the code, It doe... | 1.0 | I3DSTExtractor11 does not have a DAQ method (Trac #308) - Migrated from https://code.icecube.wisc.edu/ticket/308
```json
{
"status": "closed",
"changetime": "2012-07-12T16:03:29",
"description": "The 'I3DSTExtractor11' produces 'segmentation fault' when used with Q-frames in icerec_V04-00-01. Complains ab... | non_comp | does not have a daq method trac migrated from json status closed changetime description the produces segmentation fault when used with q frames in icerec complains about libdst extractor dylib nlooking at the code it doesn t seem to have a daq met... | 0 |
10,053 | 12,058,421,997 | IssuesEvent | 2020-04-15 17:25:55 | google/model-viewer | https://api.github.com/repos/google/model-viewer | closed | Update to the latest Scene Viewer intent scheme | arc: ar arc: compatibility type: chore | [Scene Viewer has an updated intent scheme](https://developers.google.com/ar/develop/java/scene-viewer#3d-or-ar). We should update to use it. In addition to being the likely path forward for configuring new Scene Viewer features, it appears to offer the ability to specify parameters like `title` and `link` without usin... | True | Update to the latest Scene Viewer intent scheme - [Scene Viewer has an updated intent scheme](https://developers.google.com/ar/develop/java/scene-viewer#3d-or-ar). We should update to use it. In addition to being the likely path forward for configuring new Scene Viewer features, it appears to offer the ability to speci... | comp | update to the latest scene viewer intent scheme we should update to use it in addition to being the likely path forward for configuring new scene viewer features it appears to offer the ability to specify parameters like title and link without using the query string in the model url | 1 |
10,995 | 13,032,415,784 | IssuesEvent | 2020-07-28 04:12:13 | Conflux-Chain/conflux-rust | https://api.github.com/repos/Conflux-Chain/conflux-rust | closed | A full node will stall on catching up if its peers move forward their checkpoints. | backward compatible | Assume a full node *A* syncs the state corresponding to its stable genesis *B_s*, and try to sync all the blocks after its cur_era_genesis *B_g*. If all its peers are full nodes and they move forward their checkpoints from *B_g* to *B_s*, these peers will delete the block bodies between *B_g* and *B_s*.
At this time... | True | A full node will stall on catching up if its peers move forward their checkpoints. - Assume a full node *A* syncs the state corresponding to its stable genesis *B_s*, and try to sync all the blocks after its cur_era_genesis *B_g*. If all its peers are full nodes and they move forward their checkpoints from *B_g* to *B_... | comp | a full node will stall on catching up if its peers move forward their checkpoints assume a full node a syncs the state corresponding to its stable genesis b s and try to sync all the blocks after its cur era genesis b g if all its peers are full nodes and they move forward their checkpoints from b g to b ... | 1 |
13,301 | 15,691,680,877 | IssuesEvent | 2021-03-25 18:10:04 | libass/libass | https://api.github.com/repos/libass/libass | closed | VSFilter does not apply \fsp to vector drawings | compatibility | A minimally different karaoke position between XYsubfilter (pintref) and Libass
XYsubfilter v3.2.0.804 (mpc-be)
libass (mpv)
 and Libass
XYsubfilter v3.2.0.804 (mpc-be)
libass (mpv)
/1000.0```. Supposedly ```performance.now()``` provides accuracy up to 5 microseconds (expressed as milliseconds).
Converting seconds and then dumping it into a float is a fast way to loose precision, and makes mgr... | True | work around for floating point error in shader time uniform - Currently m.grl provides the ```float mgrl_frame_start``` uniform, who's value is ```performance.now()/1000.0```. Supposedly ```performance.now()``` provides accuracy up to 5 microseconds (expressed as milliseconds).
Converting seconds and then dumping i... | comp | work around for floating point error in shader time uniform currently m grl provides the float mgrl frame start uniform who s value is performance now supposedly performance now provides accuracy up to microseconds expressed as milliseconds converting seconds and then dumping it i... | 1 |
5,549 | 8,018,135,878 | IssuesEvent | 2018-07-25 18:07:08 | WordPress/gutenberg | https://api.github.com/repos/WordPress/gutenberg | closed | Featured image meta box does not respect admin_post_thumbnail_size filter | Backwards Compatibility Media | **Describe the bug**
admin_post_thumbnail_size filter is not respected when loading the Featured Image meta box image. Instead the full size of the image is shown | True | Featured image meta box does not respect admin_post_thumbnail_size filter - **Describe the bug**
admin_post_thumbnail_size filter is not respected when loading the Featured Image meta box image. Instead the full size of the image is shown | comp | featured image meta box does not respect admin post thumbnail size filter describe the bug admin post thumbnail size filter is not respected when loading the featured image meta box image instead the full size of the image is shown | 1 |
180,460 | 14,767,823,090 | IssuesEvent | 2021-01-10 08:59:36 | amzn/selling-partner-api-docs | https://api.github.com/repos/amzn/selling-partner-api-docs | opened | [Question] I want to scan all the amazon returns in my warehouse | documentation enhancement request | Hi
I want to scan amazon returns in my warehouse but I need return tracking ID to get the order details. Can somebody please help me in getting the tracking IDs for easyship orders.
| 1.0 | [Question] I want to scan all the amazon returns in my warehouse - Hi
I want to scan amazon returns in my warehouse but I need return tracking ID to get the order details. Can somebody please help me in getting the tracking IDs for easyship orders.
| non_comp | i want to scan all the amazon returns in my warehouse hi i want to scan amazon returns in my warehouse but i need return tracking id to get the order details can somebody please help me in getting the tracking ids for easyship orders | 0 |
9,460 | 11,516,752,589 | IssuesEvent | 2020-02-14 06:18:19 | terasolunaorg/terasoluna-gfw | https://api.github.com/repos/terasolunaorg/terasoluna-gfw | closed | Fixed warning about using deprecated methods in unit tests on JDK11 | type: oss-incompatible version: 5.6.0 | ## Description
The following warning occurs when running unit test on JDK11.
``` java
[INFO] --- maven-compiler-plugin:3.1:testCompile (default-testCompile) @ terasoluna-gfw-string ---
[INFO] Changes detected - recompiling the module!
[INFO] Compiling 8 source files to /home/travis/build/terasolunaorg/terasoluna... | True | Fixed warning about using deprecated methods in unit tests on JDK11 - ## Description
The following warning occurs when running unit test on JDK11.
``` java
[INFO] --- maven-compiler-plugin:3.1:testCompile (default-testCompile) @ terasoluna-gfw-string ---
[INFO] Changes detected - recompiling the module!
[INFO] C... | comp | fixed warning about using deprecated methods in unit tests on description the following warning occurs when running unit test on java maven compiler plugin testcompile default testcompile terasoluna gfw string changes detected recompiling the module compiling source files... | 1 |
15,501 | 19,828,008,931 | IssuesEvent | 2022-01-20 09:03:02 | iced-rs/iced | https://api.github.com/repos/iced-rs/iced | closed | text in UI not reliably updating in a particular situation | text rendering compatibility | The problem was exhibited on a MacBook Pro (16-inch, 2019) running macOS 10.15.7.
The Rust version was 1.52.0.
The problem is possibly specific to tapping on a trackpad, as opposed to actually clicking.
In the example, there is a button, initially labeled "Submit". When one taps on it, it SHOULD
change to "th... | True | text in UI not reliably updating in a particular situation - The problem was exhibited on a MacBook Pro (16-inch, 2019) running macOS 10.15.7.
The Rust version was 1.52.0.
The problem is possibly specific to tapping on a trackpad, as opposed to actually clicking.
In the example, there is a button, initially labe... | comp | text in ui not reliably updating in a particular situation the problem was exhibited on a macbook pro inch running macos the rust version was the problem is possibly specific to tapping on a trackpad as opposed to actually clicking in the example there is a button initially labeled su... | 1 |
7,624 | 9,884,963,778 | IssuesEvent | 2019-06-25 00:18:30 | sass/libsass | https://api.github.com/repos/sass/libsass | opened | str-slice() should allow very negative $start-at values | Compatibility - P3 | `str-slice("cde", -100)` should return `"cde"`, but in LibSass it throws an error with the text `utf8::not_enough_room`. | True | str-slice() should allow very negative $start-at values - `str-slice("cde", -100)` should return `"cde"`, but in LibSass it throws an error with the text `utf8::not_enough_room`. | comp | str slice should allow very negative start at values str slice cde should return cde but in libsass it throws an error with the text not enough room | 1 |
189,276 | 15,183,732,421 | IssuesEvent | 2021-02-15 08:34:51 | cksystemsgroup/monster | https://api.github.com/repos/cksystemsgroup/monster | closed | 📖 Start Reference Book | documentation | There are many things which need to be done in a uniform way. As well as many definitions that need to be understood.
We need a way to document those definitions, standards and conventions in a structured easy to read style.
This can be included in the Rust Book documentation. | 1.0 | 📖 Start Reference Book - There are many things which need to be done in a uniform way. As well as many definitions that need to be understood.
We need a way to document those definitions, standards and conventions in a structured easy to read style.
This can be included in the Rust Book documentation. | non_comp | 📖 start reference book there are many things which need to be done in a uniform way as well as many definitions that need to be understood we need a way to document those definitions standards and conventions in a structured easy to read style this can be included in the rust book documentation | 0 |
684,824 | 23,434,061,168 | IssuesEvent | 2022-08-15 07:45:13 | trimble-oss/modus-web-components | https://api.github.com/repos/trimble-oss/modus-web-components | closed | Remove `@types/autoprefixer` ? | 1 priority:low | When you run `npm run full` the CLI reports:
```
npm WARN deprecated @types/autoprefixer@10.2.0: This is a stub types definition. autoprefixer provides its own type definitions, so you do not need this installed.
```
Maybe this can be safely removed? | 1.0 | Remove `@types/autoprefixer` ? - When you run `npm run full` the CLI reports:
```
npm WARN deprecated @types/autoprefixer@10.2.0: This is a stub types definition. autoprefixer provides its own type definitions, so you do not need this installed.
```
Maybe this can be safely removed? | non_comp | remove types autoprefixer when you run npm run full the cli reports npm warn deprecated types autoprefixer this is a stub types definition autoprefixer provides its own type definitions so you do not need this installed maybe this can be safely removed | 0 |
196,910 | 22,571,908,319 | IssuesEvent | 2022-06-28 01:35:37 | SebSnr/Groupomania | https://api.github.com/repos/SebSnr/Groupomania | opened | CVE-2021-42740 (High) detected in shell-quote-1.7.2.tgz | security vulnerability | ## CVE-2021-42740 - High Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Library - <b>shell-quote-1.7.2.tgz</b></p></summary>
<p>quote and parse shell commands</p>
<p>Library home page: <a href="https://r... | True | CVE-2021-42740 (High) detected in shell-quote-1.7.2.tgz - ## CVE-2021-42740 - High Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Library - <b>shell-quote-1.7.2.tgz</b></p></summary>
<p>quote and parse s... | non_comp | cve high detected in shell quote tgz cve high severity vulnerability vulnerable library shell quote tgz quote and parse shell commands library home page a href path to dependency file tmp ws scm projet groupomania front end package json path to vulnerable library ... | 0 |
17,541 | 24,192,671,854 | IssuesEvent | 2022-09-23 19:20:39 | MarketSquare/robotframework-browser | https://api.github.com/repos/MarketSquare/robotframework-browser | closed | Some Assertion Keywords have old argument names `expected_value` | backwards incompatible | Most Assertion Keywords have similar argument signatures.
But the following four had old names.
Solution:
Changed arguments for the expected assertion argument from `expected_value` or `expected_state` to `assertion_expected` as on all other getters for the following keywords:
`Get Checkbox State`
`Get Elemen... | True | Some Assertion Keywords have old argument names `expected_value` - Most Assertion Keywords have similar argument signatures.
But the following four had old names.
Solution:
Changed arguments for the expected assertion argument from `expected_value` or `expected_state` to `assertion_expected` as on all other gette... | comp | some assertion keywords have old argument names expected value most assertion keywords have similar argument signatures but the following four had old names solution changed arguments for the expected assertion argument from expected value or expected state to assertion expected as on all other gette... | 1 |
649,592 | 21,315,969,091 | IssuesEvent | 2022-04-16 09:24:38 | kubeflow/kubeflow | https://api.github.com/repos/kubeflow/kubeflow | closed | ECR shortcomings and the need for alternative registries | kind/feature priority/p2 lifecycle/stale | With the 1.3 release of Kubeflow, the many components under the control of the Notebooks Working Group (along with some others) moved to using the Amazon ECR Public Gallery registry to host the container images of said components. I believe a large reason for using ECR this was the announcement of rate limiting the pul... | 1.0 | ECR shortcomings and the need for alternative registries - With the 1.3 release of Kubeflow, the many components under the control of the Notebooks Working Group (along with some others) moved to using the Amazon ECR Public Gallery registry to host the container images of said components. I believe a large reason for u... | non_comp | ecr shortcomings and the need for alternative registries with the release of kubeflow the many components under the control of the notebooks working group along with some others moved to using the amazon ecr public gallery registry to host the container images of said components i believe a large reason for u... | 0 |
1,418 | 3,952,690,071 | IssuesEvent | 2016-04-29 09:58:24 | presscustomizr/customizr | https://api.github.com/repos/presscustomizr/customizr | opened | Plugin compatiblity: Menu dropdown visibility issue | compatibility-issue | With reference to this:
https://secure.helpscout.net/conversation/196113682/13321/?folderId=607546
We should add the following CSS rule:
```
header.tc-header,
.navbar-wrapper.clearfix { overflow: visible; }
```
That's 'cause we have to be sure no third party CSS will prevent dropdown to correctly overflow navb... | True | Plugin compatiblity: Menu dropdown visibility issue - With reference to this:
https://secure.helpscout.net/conversation/196113682/13321/?folderId=607546
We should add the following CSS rule:
```
header.tc-header,
.navbar-wrapper.clearfix { overflow: visible; }
```
That's 'cause we have to be sure no third part... | comp | plugin compatiblity menu dropdown visibility issue with reference to this we should add the following css rule header tc header navbar wrapper clearfix overflow visible that s cause we have to be sure no third party css will prevent dropdown to correctly overflow navbar and header w... | 1 |
12,846 | 15,100,671,559 | IssuesEvent | 2021-02-08 06:00:43 | paulevsGitch/BetterEnd | https://api.github.com/repos/paulevsGitch/BetterEnd | closed | Add anvil recipe support to the Netherite Anvil | compatibility enhancement | The mod https://github.com/OroArmor/Netherite-Plus-Mod/
has a custom anvil. I received a request to add compatibility for your custom anvil recipes with the issue:
https://github.com/OroArmor/Netherite-Plus-Mod/issues/57
After a bit of investigation, it seems that you mixin to the anvil to add your custom recipes,... | True | Add anvil recipe support to the Netherite Anvil - The mod https://github.com/OroArmor/Netherite-Plus-Mod/
has a custom anvil. I received a request to add compatibility for your custom anvil recipes with the issue:
https://github.com/OroArmor/Netherite-Plus-Mod/issues/57
After a bit of investigation, it seems that ... | comp | add anvil recipe support to the netherite anvil the mod has a custom anvil i received a request to add compatibility for your custom anvil recipes with the issue after a bit of investigation it seems that you mixin to the anvil to add your custom recipes and because my anvil is almost a perfect copy of t... | 1 |
682,523 | 23,347,217,791 | IssuesEvent | 2022-08-09 19:12:33 | ArctosDB/arctos | https://api.github.com/repos/ArctosDB/arctos | closed | encumbered specimens behavior | Priority-Critical (Arctos is broken) | Currently Encumbered specimens do not exist in any capacity for public users. Those records do not appear in any way, shape, or form in any structure which any public user has any access to, and public accounts all exclusively use public users.
https://github.com/ArctosDB/arctos/issues/1725 suggests that we should d... | 1.0 | encumbered specimens behavior - Currently Encumbered specimens do not exist in any capacity for public users. Those records do not appear in any way, shape, or form in any structure which any public user has any access to, and public accounts all exclusively use public users.
https://github.com/ArctosDB/arctos/issue... | non_comp | encumbered specimens behavior currently encumbered specimens do not exist in any capacity for public users those records do not appear in any way shape or form in any structure which any public user has any access to and public accounts all exclusively use public users suggests that we should do something e... | 0 |
12,705 | 14,981,972,256 | IssuesEvent | 2021-01-28 15:27:26 | mariotaku/moonlight-tv | https://api.github.com/repos/mariotaku/moonlight-tv | closed | Oled65E6 | compatibility | # Basic information
- Device Model: OLED65E6
- System Version: 05.30.95
- Is Audio Working: Yes
- Is Video Working: 4K 60Fps
- Is Input Working: F710 Working
Using gamepad disables magic remote cursor. | True | Oled65E6 - # Basic information
- Device Model: OLED65E6
- System Version: 05.30.95
- Is Audio Working: Yes
- Is Video Working: 4K 60Fps
- Is Input Working: F710 Working
Using gamepad disables magic remote cursor. | comp | basic information device model system version is audio working yes is video working is input working working using gamepad disables magic remote cursor | 1 |
474,905 | 13,684,184,136 | IssuesEvent | 2020-09-30 04:07:36 | zeebe-io/zeebe | https://api.github.com/repos/zeebe-io/zeebe | closed | As an User I can get the message key as response from the message publish command | Priority: Low Scope: broker Scope: clients/go Scope: clients/java Status: Needs Review Type: Enhancement hacktoberfest | **Is your feature request related to a problem? Please describe.**
Currently we get an empty response when we publish a message, which means we know nothing about the published message. It would be useful in some cases at least to have the key, so we can for example find the message in elastic and also know where the ... | 1.0 | As an User I can get the message key as response from the message publish command - **Is your feature request related to a problem? Please describe.**
Currently we get an empty response when we publish a message, which means we know nothing about the published message. It would be useful in some cases at least to have... | non_comp | as an user i can get the message key as response from the message publish command is your feature request related to a problem please describe currently we get an empty response when we publish a message which means we know nothing about the published message it would be useful in some cases at least to have... | 0 |
80,779 | 3,574,340,809 | IssuesEvent | 2016-01-27 11:20:25 | salesagility/SuiteCRM | https://api.github.com/repos/salesagility/SuiteCRM | closed | Blank Home Page - undefined method SugarWidgetField::queryFilterone_of() | bug High Priority | PHP Fatal error: Call to undefined method SugarWidgetField::queryFilterone_of() in include/Dashlets/DashletGeneric.php on line 325 after upgrade to 7.4, causes blank home page | 1.0 | Blank Home Page - undefined method SugarWidgetField::queryFilterone_of() - PHP Fatal error: Call to undefined method SugarWidgetField::queryFilterone_of() in include/Dashlets/DashletGeneric.php on line 325 after upgrade to 7.4, causes blank home page | non_comp | blank home page undefined method sugarwidgetfield queryfilterone of php fatal error call to undefined method sugarwidgetfield queryfilterone of in include dashlets dashletgeneric php on line after upgrade to causes blank home page | 0 |
59,185 | 14,369,081,024 | IssuesEvent | 2020-12-01 09:18:18 | ignatandrei/stankins | https://api.github.com/repos/ignatandrei/stankins | closed | CVE-2020-11023 (Medium) detected in multiple libraries | security vulnerability | ## CVE-2020-11023 - Medium Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Libraries - <b>jquery-1.7.2.min.js</b>, <b>jquery-2.1.4.min.js</b>, <b>jquery-1.11.0.min.js</b>, <b>jquery-1.7.1.min.js</b></p></s... | True | CVE-2020-11023 (Medium) detected in multiple libraries - ## CVE-2020-11023 - Medium Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Libraries - <b>jquery-1.7.2.min.js</b>, <b>jquery-2.1.4.min.js</b>, <b>jq... | non_comp | cve medium detected in multiple libraries cve medium severity vulnerability vulnerable libraries jquery min js jquery min js jquery min js jquery min js jquery min js javascript library for dom operations library home page a href path ... | 0 |
126,213 | 17,869,399,880 | IssuesEvent | 2021-09-06 13:35:33 | fasttrack-solutions/terraform-provider-kubernetes | https://api.github.com/repos/fasttrack-solutions/terraform-provider-kubernetes | opened | CVE-2020-25816 (High) detected in github.com/hashicorp/vault-v1.0.1 | security vulnerability | ## CVE-2020-25816 - High Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Library - <b>github.com/hashicorp/vault-v1.0.1</b></p></summary>
<p>A tool for secrets management, encryption as a service, and pri... | True | CVE-2020-25816 (High) detected in github.com/hashicorp/vault-v1.0.1 - ## CVE-2020-25816 - High Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Library - <b>github.com/hashicorp/vault-v1.0.1</b></p></summar... | non_comp | cve high detected in github com hashicorp vault cve high severity vulnerability vulnerable library github com hashicorp vault a tool for secrets management encryption as a service and privileged access management dependency hierarchy github com hashicorp terraform ... | 0 |
3,544 | 6,493,038,157 | IssuesEvent | 2017-08-21 15:28:50 | Cxbx-Reloaded/Cxbx-Reloaded | https://api.github.com/repos/Cxbx-Reloaded/Cxbx-Reloaded | closed | Castlevania Curse Of Darkness - white screen and noise and broken sound without any exeception codes | game-compatibility | 
[KrnlDebug.txt](https://github.com/Cxbx-Reloaded/Cxbx-Reloaded/files/869788/KrnlDebug.txt)
| True | Castlevania Curse Of Darkness - white screen and noise and broken sound without any exeception codes - 
[KrnlDebug.txt](https://github.com/Cxbx-Reloaded/Cxbx-Reloaded/files/869788/KrnlDebug.txt)
| comp | castlevania curse of darkness white screen and noise and broken sound without any exeception codes | 1 |
685,693 | 23,465,556,928 | IssuesEvent | 2022-08-16 16:25:49 | google-github-actions/release-please-action | https://api.github.com/repos/google-github-actions/release-please-action | closed | Tag Created by release-please-action is not triggering build | type: docs priority: p2 | Build which is supposed to triggered by "tag creation" is not running when tag is created by release-please-action. Below is the trigger used in workflow. It triggers the flow when tag is created manually but doesn't run when tag is created by release-please-action
on:
push:
tags:
- 'v[0-9]+\.[0-9]+\.... | 1.0 | Tag Created by release-please-action is not triggering build - Build which is supposed to triggered by "tag creation" is not running when tag is created by release-please-action. Below is the trigger used in workflow. It triggers the flow when tag is created manually but doesn't run when tag is created by release-pleas... | non_comp | tag created by release please action is not triggering build build which is supposed to triggered by tag creation is not running when tag is created by release please action below is the trigger used in workflow it triggers the flow when tag is created manually but doesn t run when tag is created by release pleas... | 0 |
211,818 | 7,208,275,348 | IssuesEvent | 2018-02-07 02:08:37 | StrangeLoopGames/EcoIssues | https://api.github.com/repos/StrangeLoopGames/EcoIssues | reopened | USER ISSUE: plot not showing when holding a claim flag | Medium Priority | **Version:** 0.7.0.3 beta
**Steps to Reproduce:**
relogging fixes it for the moment. i dont know what is producing this bug
**Expected behavior:**
should show the plot glow
**Actual behavior:**
doesnt show plot glow | 1.0 | USER ISSUE: plot not showing when holding a claim flag - **Version:** 0.7.0.3 beta
**Steps to Reproduce:**
relogging fixes it for the moment. i dont know what is producing this bug
**Expected behavior:**
should show the plot glow
**Actual behavior:**
doesnt show plot glow | non_comp | user issue plot not showing when holding a claim flag version beta steps to reproduce relogging fixes it for the moment i dont know what is producing this bug expected behavior should show the plot glow actual behavior doesnt show plot glow | 0 |
15,699 | 20,257,914,671 | IssuesEvent | 2022-02-15 02:25:16 | userfrosting/UserFrosting | https://api.github.com/repos/userfrosting/UserFrosting | closed | Native install on PHP 8.08 install fails due to eventdispatcher incompatibility between rockettheme and symphony | confirmed bug compatibility | Windows, nginx, php fastcgi.
Following the native installation instructions
`composer install` completes fine.
`php bakery bake` fails with:
```
PHP Fatal error: Declaration of RocketTheme\Toolbox\Event\EventDispatcher::dispatch($eventName, ?Symfony\Component\EventDispatcher\Event $event = null) must be ... | True | Native install on PHP 8.08 install fails due to eventdispatcher incompatibility between rockettheme and symphony - Windows, nginx, php fastcgi.
Following the native installation instructions
`composer install` completes fine.
`php bakery bake` fails with:
```
PHP Fatal error: Declaration of RocketTheme\T... | comp | native install on php install fails due to eventdispatcher incompatibility between rockettheme and symphony windows nginx php fastcgi following the native installation instructions composer install completes fine php bakery bake fails with php fatal error declaration of rockettheme to... | 1 |
4,247 | 3,004,916,478 | IssuesEvent | 2015-07-26 12:59:26 | brian-team/brian2 | https://api.github.com/repos/brian-team/brian2 | opened | Simplify templates? | component: codegen | With all the blocks and derivations they're a little bit difficult to understand at the moment. On the other hand, the use of template extensions and macros makes them more generic and derivable, so maybe it should be left as it is, just explained better? | 1.0 | Simplify templates? - With all the blocks and derivations they're a little bit difficult to understand at the moment. On the other hand, the use of template extensions and macros makes them more generic and derivable, so maybe it should be left as it is, just explained better? | non_comp | simplify templates with all the blocks and derivations they re a little bit difficult to understand at the moment on the other hand the use of template extensions and macros makes them more generic and derivable so maybe it should be left as it is just explained better | 0 |
49,569 | 20,814,988,558 | IssuesEvent | 2022-03-18 09:16:39 | hashicorp/terraform-provider-azurerm | https://api.github.com/repos/hashicorp/terraform-provider-azurerm | closed | Sanitize kube_admin_config in terraform plan/apply output | bug upstream-terraform service/kubernetes-cluster | <!--- Please keep this note for the community --->
### Community Note
* Please vote on this issue by adding a 👍 [reaction](https://blog.github.com/2016-03-10-add-reactions-to-pull-requests-issues-and-comments/) to the original issue to help the community and maintainers prioritize this request
* Please do not l... | 1.0 | Sanitize kube_admin_config in terraform plan/apply output - <!--- Please keep this note for the community --->
### Community Note
* Please vote on this issue by adding a 👍 [reaction](https://blog.github.com/2016-03-10-add-reactions-to-pull-requests-issues-and-comments/) to the original issue to help the communit... | non_comp | sanitize kube admin config in terraform plan apply output community note please vote on this issue by adding a 👍 to the original issue to help the community and maintainers prioritize this request please do not leave or me too comments they generate extra noise for issue followers and do... | 0 |
320,230 | 23,804,800,370 | IssuesEvent | 2022-09-03 21:49:28 | manoellasouza/RoboTron_Manoella_Souza_Projeto_Final | https://api.github.com/repos/manoellasouza/RoboTron_Manoella_Souza_Projeto_Final | opened | Inserir na API e na documentação response para servidor fora do ar em todas as rotas | documentation enhancement | **Descrição**
Nenhuma das rotas da [API ServeRest](https://serverest.dev/) possui response para servidor fora do ar. Esta implementação deve ser feita na arquitetura da API e em sua documentação.
**Resultado esperado**
Com a implementação deste response, espera-se que com o servidor fora do ar surja uma mensag... | 1.0 | Inserir na API e na documentação response para servidor fora do ar em todas as rotas - **Descrição**
Nenhuma das rotas da [API ServeRest](https://serverest.dev/) possui response para servidor fora do ar. Esta implementação deve ser feita na arquitetura da API e em sua documentação.
**Resultado esperado**
Com a... | non_comp | inserir na api e na documentação response para servidor fora do ar em todas as rotas descrição nenhuma das rotas da possui response para servidor fora do ar esta implementação deve ser feita na arquitetura da api e em sua documentação resultado esperado com a implementação deste response esper... | 0 |
2,211 | 4,957,803,294 | IssuesEvent | 2016-12-02 06:53:50 | tex-xet/bidi | https://api.github.com/repos/tex-xet/bidi | opened | The bidi package forces \DFNalwaysdouble with the dblfnote package | Bug Compatibility | When one uses the `dblfnote` package, the command `\DFNtrysingle` is active but when the `bidi` package is loaded, it forces `\DFNalwaysdouble`.
````latex
\documentclass{article}
\usepackage{dblfnote}
\usepackage[documentdirection=righttoleft,
footnotedirection=righttoleft,
footnoterule=automatic
]{bidi}
\beg... | True | The bidi package forces \DFNalwaysdouble with the dblfnote package - When one uses the `dblfnote` package, the command `\DFNtrysingle` is active but when the `bidi` package is loaded, it forces `\DFNalwaysdouble`.
````latex
\documentclass{article}
\usepackage{dblfnote}
\usepackage[documentdirection=righttoleft,
... | comp | the bidi package forces dfnalwaysdouble with the dblfnote package when one uses the dblfnote package the command dfntrysingle is active but when the bidi package is loaded it forces dfnalwaysdouble latex documentclass article usepackage dblfnote usepackage documentdirection righttoleft ... | 1 |
12,790 | 15,054,086,488 | IssuesEvent | 2021-02-03 17:00:53 | AlexHuck/TribesRebirth | https://api.github.com/repos/AlexHuck/TribesRebirth | closed | The version number provided when FearCSDelegate connects to a server prevents the client from connecting to a 1.11 server. | bug compatibility | When connecting to a Tribes server, FearCSDelegate provides the version string "1.0" during connection.
This version is rejected when connecting to a 1.11 server. For the sake of compatibility with 1.11 and connecting to an existing Tribes server for debugging, this should be temporarily adjusted to 1.11 so the connec... | True | The version number provided when FearCSDelegate connects to a server prevents the client from connecting to a 1.11 server. - When connecting to a Tribes server, FearCSDelegate provides the version string "1.0" during connection.
This version is rejected when connecting to a 1.11 server. For the sake of compatibility w... | comp | the version number provided when fearcsdelegate connects to a server prevents the client from connecting to a server when connecting to a tribes server fearcsdelegate provides the version string during connection this version is rejected when connecting to a server for the sake of compatibility wit... | 1 |
227,425 | 17,382,315,933 | IssuesEvent | 2021-08-01 00:40:20 | gcv/julia-snail | https://api.github.com/repos/gcv/julia-snail | closed | better unicode substitution | documentation | More of a tip, not sure if it should be a feature? Maybe to be included in the documentation?
Anyway: there's a better way to insert unicode characters, and it's [xah-math-input](https://github.com/xahlee/xah-math-input). Basically, you type a (Roman) letter like "a", then shift-spc, and it substitutes the Greek equiv... | 1.0 | better unicode substitution - More of a tip, not sure if it should be a feature? Maybe to be included in the documentation?
Anyway: there's a better way to insert unicode characters, and it's [xah-math-input](https://github.com/xahlee/xah-math-input). Basically, you type a (Roman) letter like "a", then shift-spc, and ... | non_comp | better unicode substitution more of a tip not sure if it should be a feature maybe to be included in the documentation anyway there s a better way to insert unicode characters and it s basically you type a roman letter like a then shift spc and it substitutes the greek equivalent here α much better... | 0 |
250,480 | 27,094,597,870 | IssuesEvent | 2023-02-15 01:01:39 | improbable/micromdm | https://api.github.com/repos/improbable/micromdm | opened | CVE-2021-44716 (High) detected in golang.org/x/net-v0.0.0-20210226172049-e18ecbb05110 | security vulnerability | ## CVE-2021-44716 - High Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Library - <b>golang.org/x/net-v0.0.0-20210226172049-e18ecbb05110</b></p></summary>
<p></p>
<p>Library home page: <a href="https://p... | True | CVE-2021-44716 (High) detected in golang.org/x/net-v0.0.0-20210226172049-e18ecbb05110 - ## CVE-2021-44716 - High Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Library - <b>golang.org/x/net-v0.0.0-2021022... | non_comp | cve high detected in golang org x net cve high severity vulnerability vulnerable library golang org x net library home page a href dependency hierarchy x golang org x net vulnerable library found in base branch main vulne... | 0 |
2,374 | 5,109,221,763 | IssuesEvent | 2017-01-05 20:07:20 | goaop/framework | https://api.github.com/repos/goaop/framework | closed | [Proxy] Add support for the PHP 7.1 features | Compatibility | Need to add PHP7.1 features support to the framework:
- [x] Update `goaop/parser-reflection` to the latest version ~1.2, #308
- [x] Add support for [nullable parameters and return types](https://wiki.php.net/rfc/nullable_types) in proxies. #309
- [x] Add support for [`void` return type](https://wiki.php.net/rfc/... | True | [Proxy] Add support for the PHP 7.1 features - Need to add PHP7.1 features support to the framework:
- [x] Update `goaop/parser-reflection` to the latest version ~1.2, #308
- [x] Add support for [nullable parameters and return types](https://wiki.php.net/rfc/nullable_types) in proxies. #309
- [x] Add support for... | comp | add support for the php features need to add features support to the framework update goaop parser reflection to the latest version add support for in proxies add support for in proxies | 1 |
17,150 | 23,666,993,328 | IssuesEvent | 2022-08-26 22:30:40 | ZsoltMolnarrr/BetterCombat | https://api.github.com/repos/ZsoltMolnarrr/BetterCombat | closed | [Forge] Firstperson Model | waiting for release incompatibility | **Minecraft version** - 1.18.2
**Mod loader** - forge_20.1.73
**Mod version** - 1.1.0
**I am using the latest version available** - yes
**Describe the bug**
when useing First-person Model with Better Combat,arm was rendered twice and body won't render
**To Reproduce**
Steps to reproduce the behavior:
instal... | True | [Forge] Firstperson Model - **Minecraft version** - 1.18.2
**Mod loader** - forge_20.1.73
**Mod version** - 1.1.0
**I am using the latest version available** - yes
**Describe the bug**
when useing First-person Model with Better Combat,arm was rendered twice and body won't render
**To Reproduce**
Steps to rep... | comp | firstperson model minecraft version mod loader forge mod version i am using the latest version available yes describe the bug when useing first person model with better combat arm was rendered twice and body won t render to reproduce steps to reproduce th... | 1 |
65,040 | 12,519,116,976 | IssuesEvent | 2020-06-03 13:59:16 | atilacamurca/glossario-friends | https://api.github.com/repos/atilacamurca/glossario-friends | closed | Modificar query da busca para usar episódios | bug code | Atualmente a query está usando posts ao invés de episódios | 1.0 | Modificar query da busca para usar episódios - Atualmente a query está usando posts ao invés de episódios | non_comp | modificar query da busca para usar episódios atualmente a query está usando posts ao invés de episódios | 0 |
11,220 | 13,212,820,158 | IssuesEvent | 2020-08-16 09:24:29 | Juuxel/Adorn | https://api.github.com/repos/Juuxel/Adorn | closed | Server crash with Extra Pieces compatibility, Terrestria and Traverse installed | bug mod compatibility | ### Versions of Minecraft, Fabric and Adorn
- Adorn: 1.10.0
- Minecraft: 1.16.1
- Fabric Loader: 0.9.0+build204
- Fabric API: 0.16.2+build.385
- Extra Pieces: 2.9.0
- Terrestria: 2.0.4
- Traverse: 2.2.14
### Describe the bug
Server crashes on startup if Adorn, Extra Pieces, Terrestria and Traverse are instal... | True | Server crash with Extra Pieces compatibility, Terrestria and Traverse installed - ### Versions of Minecraft, Fabric and Adorn
- Adorn: 1.10.0
- Minecraft: 1.16.1
- Fabric Loader: 0.9.0+build204
- Fabric API: 0.16.2+build.385
- Extra Pieces: 2.9.0
- Terrestria: 2.0.4
- Traverse: 2.2.14
### Describe the bug
Se... | comp | server crash with extra pieces compatibility terrestria and traverse installed versions of minecraft fabric and adorn adorn minecraft fabric loader fabric api build extra pieces terrestria traverse describe the bug server crashes ... | 1 |
583,861 | 17,400,103,775 | IssuesEvent | 2021-08-02 18:20:55 | ita-social-projects/TeachUA | https://api.github.com/repos/ita-social-projects/TeachUA | opened | [Mobile version.Гурток] Wrong alignment of text on 'Гурток' page in description field | Priority: Low UI bug | **Environment:** Windows10, Google Chrome Версия 92.0.4515.107 (Официальная сборка), (64 бит) // mobile version Iphone X
**Reproducible:** always.
**Build found:** https://speak-ukrainian.org.ua/dev/
**Precondition:** choose 'Запоріжжя' city
**Steps to reproduce:**
1. Go to https://speak-ukrainian.org.ua/dev/
2... | 1.0 | [Mobile version.Гурток] Wrong alignment of text on 'Гурток' page in description field - **Environment:** Windows10, Google Chrome Версия 92.0.4515.107 (Официальная сборка), (64 бит) // mobile version Iphone X
**Reproducible:** always.
**Build found:** https://speak-ukrainian.org.ua/dev/
**Precondition:** choose 'Зап... | non_comp | wrong alignment of text on гурток page in description field environment google chrome версия официальная сборка бит mobile version iphone x reproducible always build found precondition choose запоріжжя city steps to reproduce go to log in as admin... | 0 |
15,211 | 19,292,214,277 | IssuesEvent | 2021-12-12 01:05:39 | VRSDevs/XO-Rivals | https://api.github.com/repos/VRSDevs/XO-Rivals | closed | [BUG - CMP][ALT] | bug impacto-alto compatibilidad | **Descripción**
En el minijuego de los fantasmas, en el móvil, cuando te mueves hacia arriba y luego hacia algún lado, el movimiento se "bloquea" y no avanza el personaje.
**Impacto**
- Alto
**Plataforma**
- Móvil
**Pasos**
Pasos para reproducir el error:
1. Empezar una partida
2. Jugar al Ghost Hunter
... | True | [BUG - CMP][ALT] - **Descripción**
En el minijuego de los fantasmas, en el móvil, cuando te mueves hacia arriba y luego hacia algún lado, el movimiento se "bloquea" y no avanza el personaje.
**Impacto**
- Alto
**Plataforma**
- Móvil
**Pasos**
Pasos para reproducir el error:
1. Empezar una partida
2. Juga... | comp | descripción en el minijuego de los fantasmas en el móvil cuando te mueves hacia arriba y luego hacia algún lado el movimiento se bloquea y no avanza el personaje impacto alto plataforma móvil pasos pasos para reproducir el error empezar una partida jugar al ghost hun... | 1 |
288,177 | 8,827,046,892 | IssuesEvent | 2019-01-03 06:54:50 | vuejs/vue-cli | https://api.github.com/repos/vuejs/vue-cli | closed | vue.config.js的多页面配置报Invalid options in vue.config.js: child "pages" fails because [child "index" fails because ["index" must be an object]] | bug priority: now | ### Version
3.2.2
### Environment info
```
System:
OS: Windows 10
CPU: (8) x64 Intel(R) Core(TM) i7-4700MQ CPU @ 2.40GHz
Binaries:
Node: 10.8.0 - C:\Program Files\nodejs\node.EXE
Yarn: yarn install v0.21.3
info No lockfile found.
[1/4] Resolving packages...
[2/4] Fetching pac... | 1.0 | vue.config.js的多页面配置报Invalid options in vue.config.js: child "pages" fails because [child "index" fails because ["index" must be an object]] - ### Version
3.2.2
### Environment info
```
System:
OS: Windows 10
CPU: (8) x64 Intel(R) Core(TM) i7-4700MQ CPU @ 2.40GHz
Binaries:
Node: 10.8.... | non_comp | vue config js的多页面配置报invalid options in vue config js child pages fails because version environment info system os windows cpu intel r core tm cpu binaries node c program files nodejs node exe yarn yarn install i... | 0 |
397,338 | 11,727,101,959 | IssuesEvent | 2020-03-10 15:27:43 | AY1920S2-CS2103T-W16-2/main | https://api.github.com/repos/AY1920S2-CS2103T-W16-2/main | opened | As a exerciser I want to see a history of all my past exercises | core priority.High type.Epic | so I can see how regularly I have been exercising | 1.0 | As a exerciser I want to see a history of all my past exercises - so I can see how regularly I have been exercising | non_comp | as a exerciser i want to see a history of all my past exercises so i can see how regularly i have been exercising | 0 |
11,300 | 9,306,777,589 | IssuesEvent | 2019-03-25 10:32:45 | deregenboog/ecd | https://api.github.com/repos/deregenboog/ecd | opened | verzoek tot vinkjes bij facturen homeservice | homeservice | - vinkje voor oninbaar mogelijk? Zodat de facturen uit de lijst gefilterd kunnen worden na lang niet betalen.
- ook een vinkje voor "zonder herinnering" | 1.0 | verzoek tot vinkjes bij facturen homeservice - - vinkje voor oninbaar mogelijk? Zodat de facturen uit de lijst gefilterd kunnen worden na lang niet betalen.
- ook een vinkje voor "zonder herinnering" | non_comp | verzoek tot vinkjes bij facturen homeservice vinkje voor oninbaar mogelijk zodat de facturen uit de lijst gefilterd kunnen worden na lang niet betalen ook een vinkje voor zonder herinnering | 0 |
17,123 | 23,641,485,213 | IssuesEvent | 2022-08-25 17:30:06 | ricksouth/serilum-mc-mods | https://api.github.com/repos/ricksouth/serilum-mc-mods | closed | Compatibility with Biomes O' Plenty | Mod: Random Village Names Compatibility issue | ## **Information**
Mod name: Random Village Names
## **Feature description**
Please add village names to the villages from BoP.
| True | Compatibility with Biomes O' Plenty - ## **Information**
Mod name: Random Village Names
## **Feature description**
Please add village names to the villages from BoP.
| comp | compatibility with biomes o plenty information mod name random village names feature description please add village names to the villages from bop | 1 |
58,448 | 14,398,713,499 | IssuesEvent | 2020-12-03 09:57:29 | joncampbell123/dosbox-x | https://api.github.com/repos/joncampbell123/dosbox-x | closed | flatpak build problem | build issues platform: Linux | **Describe the bug**
Ok, that only took one release :-)
For some reason, that I'm not sure about the flatpak build process no longer works. The build seems to get stuck in a continuous loop. It seems it successfully does the autogen.sh and configure steps, then starts the make step and shows the following:
```
... | 1.0 | flatpak build problem - **Describe the bug**
Ok, that only took one release :-)
For some reason, that I'm not sure about the flatpak build process no longer works. The build seems to get stuck in a continuous loop. It seems it successfully does the autogen.sh and configure steps, then starts the make step and shows... | non_comp | flatpak build problem describe the bug ok that only took one release for some reason that i m not sure about the flatpak build process no longer works the build seems to get stuck in a continuous loop it seems it successfully does the autogen sh and configure steps then starts the make step and shows... | 0 |
18,598 | 25,905,206,363 | IssuesEvent | 2022-12-15 09:41:52 | puppetlabs/puppetlabs-apache | https://api.github.com/repos/puppetlabs/puppetlabs-apache | closed | Small changes for next major release | backwards-incompatible | A list of small backwards incompatible changes that should be included when we next do a major release, any changes listed here are from bugs that have been given compatible fixes for now:
- `$proxy_timeout` in manifest/mod/proxy should have the type `Optional[Integer[0]]`
https://github.com/puppetlabs/puppetlabs-a... | True | Small changes for next major release - A list of small backwards incompatible changes that should be included when we next do a major release, any changes listed here are from bugs that have been given compatible fixes for now:
- `$proxy_timeout` in manifest/mod/proxy should have the type `Optional[Integer[0]]`
htt... | comp | small changes for next major release a list of small backwards incompatible changes that should be included when we next do a major release any changes listed here are from bugs that have been given compatible fixes for now proxy timeout in manifest mod proxy should have the type optional also cas t... | 1 |
46,224 | 2,951,537,559 | IssuesEvent | 2015-07-07 00:10:30 | openshift/origin | https://api.github.com/repos/openshift/origin | closed | Pod count during deployments is flickery | area/usability component/web kind/bug priority/P3 | In the console we print `PODS (<count>)`, and as the RC changes we update it. Unfortunately, in small update numbers (common for deployment) its extremely flickery and distracting. | 1.0 | Pod count during deployments is flickery - In the console we print `PODS (<count>)`, and as the RC changes we update it. Unfortunately, in small update numbers (common for deployment) its extremely flickery and distracting. | non_comp | pod count during deployments is flickery in the console we print pods and as the rc changes we update it unfortunately in small update numbers common for deployment its extremely flickery and distracting | 0 |
77,217 | 7,569,430,173 | IssuesEvent | 2018-04-23 04:26:27 | xcat2/xcat2-task-management | https://api.github.com/repos/xcat2/xcat2-task-management | closed | Run mlnx and cuda regression against RCs | sprint1 test | what to do:
* [ ] run regression against mlnx against witherspoon
The mlux file location:
```
-bash-4.1$ hostname
c910loginx01
-bash-4.1$ pwd
/xcat/mlnx_4.2
-bash-4.1$ ll
total 308160
-rwxr-xr-x 1 ertaozh users 160417792 Mar 1 00:55 MLNX_OFED_LINUX-4.2-1.2.0.0-rhel7.4-ppc64le.iso
-rwxr-xr-x 1 e... | 1.0 | Run mlnx and cuda regression against RCs - what to do:
* [ ] run regression against mlnx against witherspoon
The mlux file location:
```
-bash-4.1$ hostname
c910loginx01
-bash-4.1$ pwd
/xcat/mlnx_4.2
-bash-4.1$ ll
total 308160
-rwxr-xr-x 1 ertaozh users 160417792 Mar 1 00:55 MLNX_OFED_LINUX-4.2-... | non_comp | run mlnx and cuda regression against rcs what to do run regression against mlnx against witherspoon the mlux file location bash hostname bash pwd xcat mlnx bash ll total rwxr xr x ertaozh users mar mlnx ofed linux iso rwxr xr ... | 0 |
16,722 | 3,550,822,625 | IssuesEvent | 2016-01-20 23:40:06 | coreos/etcd | https://api.github.com/repos/coreos/etcd | closed | improve watch integration test | area/testing kind/enhancement | - [X] make revision start as 1 (Anthony is working on this): https://github.com/coreos/etcd/pull/4217
- [X] fix header's revision comparison test (currently header test skips unmatched cases): https://github.com/coreos/etcd/pull/4218
- [X] test watch cancel operation in synced: https://github.com/coreos/etcd/pull/422... | 1.0 | improve watch integration test - - [X] make revision start as 1 (Anthony is working on this): https://github.com/coreos/etcd/pull/4217
- [X] fix header's revision comparison test (currently header test skips unmatched cases): https://github.com/coreos/etcd/pull/4218
- [X] test watch cancel operation in synced: https:... | non_comp | improve watch integration test make revision start as anthony is working on this fix header s revision comparison test currently header test skips unmatched cases test watch cancel operation in synced test multiple concurrent synced watchers on the same key test synced mult... | 0 |
285,345 | 21,514,794,307 | IssuesEvent | 2022-04-28 08:54:11 | Ruby25Y/Fang | https://api.github.com/repos/Ruby25Y/Fang | closed | agent portal刷新问题 | documentation enhancement agent | agent portal点击刷新会把整个网站刷新，打开的窗口也会全部关闭。用户上传房源信息过程中，如果刷新会导致在其他窗口有输入的信息丢失。
当用户刷新是，仅刷新当前页的内容。
https://user-images.githubusercontent.com/101682483/158744715-de66a3fc-f3bb-4d43-a5a1-d256bc1e7c34.mp4
| 1.0 | agent portal刷新问题 - agent portal点击刷新会把整个网站刷新，打开的窗口也会全部关闭。用户上传房源信息过程中，如果刷新会导致在其他窗口有输入的信息丢失。
当用户刷新是，仅刷新当前页的内容。
https://user-images.githubusercontent.com/101682483/158744715-de66a3fc-f3bb-4d43-a5a1-d256bc1e7c34.mp4
| non_comp | agent portal刷新问题 agent portal点击刷新会把整个网站刷新，打开的窗口也会全部关闭。用户上传房源信息过程中，如果刷新会导致在其他窗口有输入的信息丢失。 当用户刷新是，仅刷新当前页的内容。 | 0 |
1,387 | 3,917,541,049 | IssuesEvent | 2016-04-21 08:44:46 | mosra/magnum | https://api.github.com/repos/mosra/magnum | closed | "Context: unsupported version string: 1.1.0" on nvidia gtx850m | bug compatibility | Hello @mosra !
A friend of mine is getting an "Context: unsupported version string: 1.1.0" on his nvidia gtx850m when running the magnum bullet example. Interestingly, **the motionblur example works fine** though.
We found out, when specifying `.setSampleCount(16);`, `tryCreateContext` errors out with that messag... | True | "Context: unsupported version string: 1.1.0" on nvidia gtx850m - Hello @mosra !
A friend of mine is getting an "Context: unsupported version string: 1.1.0" on his nvidia gtx850m when running the magnum bullet example. Interestingly, **the motionblur example works fine** though.
We found out, when specifying `.set... | comp | context unsupported version string on nvidia hello mosra a friend of mine is getting an context unsupported version string on his nvidia when running the magnum bullet example interestingly the motionblur example works fine though we found out when specifying setsamplecount ... | 1 |
701,912 | 24,114,469,950 | IssuesEvent | 2022-09-20 13:49:33 | webcompat/web-bugs | https://api.github.com/repos/webcompat/web-bugs | closed | www.nato.int - design is broken | browser-firefox priority-normal os-mac engine-gecko | <!-- @browser: Firefox 104.0 -->
<!-- @ua_header: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.15; rv:104.0) Gecko/20100101 Firefox/104.0 -->
<!-- @reported_with: unknown -->
<!-- @public_url: https://github.com/webcompat/web-bugs/issues/111004 -->
**URL**: https://www.nato.int/cps/en/natohq/recruitment.htm
**Browser / ... | 1.0 | www.nato.int - design is broken - <!-- @browser: Firefox 104.0 -->
<!-- @ua_header: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.15; rv:104.0) Gecko/20100101 Firefox/104.0 -->
<!-- @reported_with: unknown -->
<!-- @public_url: https://github.com/webcompat/web-bugs/issues/111004 -->
**URL**: https://www.nato.int/cps/en/na... | non_comp | design is broken url browser version firefox operating system mac os x tested another browser yes chrome problem type design is broken description items are misaligned steps to reproduce the page left margin is removed in firefox desktop app whereas it is ... | 0 |
20,574 | 30,541,818,165 | IssuesEvent | 2023-07-19 22:14:30 | ricksouth/serilum-mc-mods | https://api.github.com/repos/ricksouth/serilum-mc-mods | opened | Elytra Slot [mod] incompatibility with Your Items Are Safe [mod] | Mod Label Missing Incompatibility | ## **Information**
Minecraft version: 01.20.1
Modloader: Fabric
Fabric loader version: 0.14.21
Environment: Both
First mod name: Elytra Slot (Fabric/Forge/Quilt)
First mod version: 6.3.0
Second mod name: Your Items Are Safe
Second mod version: 3.4
[Worth Mentioning]
Third mod name: Trinkets (Fabric)
Th... | True | Elytra Slot [mod] incompatibility with Your Items Are Safe [mod] - ## **Information**
Minecraft version: 01.20.1
Modloader: Fabric
Fabric loader version: 0.14.21
Environment: Both
First mod name: Elytra Slot (Fabric/Forge/Quilt)
First mod version: 6.3.0
Second mod name: Your Items Are Safe
Second mod versio... | comp | elytra slot incompatibility with your items are safe information minecraft version modloader fabric fabric loader version environment both first mod name elytra slot fabric forge quilt first mod version second mod name your items are safe second mod version ... | 1 |
12,334 | 14,594,012,225 | IssuesEvent | 2020-12-20 02:40:09 | TestCentric/testcentric-gui | https://api.github.com/repos/TestCentric/testcentric-gui | closed | TestCentric engine does not support RecentFiles | NUnit Compatibility Resolved | ### NUnit Compatibility Issue
__Category:__ Services
__Visibility:__ Users
__Resolution:__ Remove from the NUnit Engine for the 4.0 release
#### Description
IRecentFiles interface and RecentFiles service have been removed from the TestCentric engine. We discussed removing it from NUnit as well, since it's no... | True | TestCentric engine does not support RecentFiles - ### NUnit Compatibility Issue
__Category:__ Services
__Visibility:__ Users
__Resolution:__ Remove from the NUnit Engine for the 4.0 release
#### Description
IRecentFiles interface and RecentFiles service have been removed from the TestCentric engine. We discu... | comp | testcentric engine does not support recentfiles nunit compatibility issue category services visibility users resolution remove from the nunit engine for the release description irecentfiles interface and recentfiles service have been removed from the testcentric engine we discu... | 1 |
6,032 | 8,468,247,391 | IssuesEvent | 2018-10-23 19:11:10 | LLK/scratch-vm | https://api.github.com/repos/LLK/scratch-vm | closed | Stopping scripts in sprite/clone doesn't stop sounds that are playing "until done" | compatibility needs-triage | ### Expected Behavior
In Scratch 2.0, stopping the scripts of a sprite/clone will stop a sound that is currently being played by a scripts that's still running a "play sound until done" block.
Note this is also the case for a clone that gets deleted and is currently running a "play sound until done" block (since,... | True | Stopping scripts in sprite/clone doesn't stop sounds that are playing "until done" - ### Expected Behavior
In Scratch 2.0, stopping the scripts of a sprite/clone will stop a sound that is currently being played by a scripts that's still running a "play sound until done" block.
Note this is also the case for a clo... | comp | stopping scripts in sprite clone doesn t stop sounds that are playing until done expected behavior in scratch stopping the scripts of a sprite clone will stop a sound that is currently being played by a scripts that s still running a play sound until done block note this is also the case for a clo... | 1 |
10,096 | 12,098,794,589 | IssuesEvent | 2020-04-20 10:58:04 | jiangdashao/Matrix-Issues | https://api.github.com/repos/jiangdashao/Matrix-Issues | closed | [INCOMPATIBILITY] Custom Jumppads | Incompatibility | ## Troubleshooting Information
`Change - [ ] to - [X] to check the checkboxes below.`
- [X] The incompatible plugin is up-to-date
- [X] Matrix and ProtocolLib are up-to-date
- [X] Matrix is running on a 1.8, 1.12, 1.13, 1.14, or 1.15 server
- [X] The issue happens on default config.yml and checks.yml
- [ ] I've t... | True | [INCOMPATIBILITY] Custom Jumppads - ## Troubleshooting Information
`Change - [ ] to - [X] to check the checkboxes below.`
- [X] The incompatible plugin is up-to-date
- [X] Matrix and ProtocolLib are up-to-date
- [X] Matrix is running on a 1.8, 1.12, 1.13, 1.14, or 1.15 server
- [X] The issue happens on default con... | comp | custom jumppads troubleshooting information change to to check the checkboxes below the incompatible plugin is up to date matrix and protocollib are up to date matrix is running on a or server the issue happens on default config yml and checks yml i ve... | 1 |
15,671 | 20,235,059,836 | IssuesEvent | 2022-02-14 00:24:19 | baldengineer/Golden-Delicious | https://api.github.com/repos/baldengineer/Golden-Delicious | opened | Bitsy Bye: Crashes when accessing S3, D1 | compatibility issue | Using tab to change drive device causes a crash into the `0x2000` area when the software tries to access Slot 3, Disk 1. | True | Bitsy Bye: Crashes when accessing S3, D1 - Using tab to change drive device causes a crash into the `0x2000` area when the software tries to access Slot 3, Disk 1. | comp | bitsy bye crashes when accessing using tab to change drive device causes a crash into the area when the software tries to access slot disk | 1 |
611,108 | 18,945,264,458 | IssuesEvent | 2021-11-18 09:30:04 | epiphany-platform/epiphany | https://api.github.com/repos/epiphany-platform/epiphany | closed | [FEATURE REQUEST] RabbitMQ monitoring | type/feature-request type/improvement priority/low | **Is your feature request related to a problem? Please describe.**
We are unable to collect metrics and create alerts on RabbitMQ. This means if the queue is backing and causing a customer impactful issue, we cannot send an alert.
**Describe the solution you'd like**
We would like to have RabbitMQ Exporter to expose ... | 1.0 | [FEATURE REQUEST] RabbitMQ monitoring - **Is your feature request related to a problem? Please describe.**
We are unable to collect metrics and create alerts on RabbitMQ. This means if the queue is backing and causing a customer impactful issue, we cannot send an alert.
**Describe the solution you'd like**
We would l... | non_comp | rabbitmq monitoring is your feature request related to a problem please describe we are unable to collect metrics and create alerts on rabbitmq this means if the queue is backing and causing a customer impactful issue we cannot send an alert describe the solution you d like we would like to have rabb... | 0 |
214,597 | 7,274,676,239 | IssuesEvent | 2018-02-21 10:49:33 | FACN3/rikaz | https://api.github.com/repos/FACN3/rikaz | closed | add counters to the chart1 | T4h priority-3 | add counters for the smokers ratios
- [x] connect counters with data and buttons
- [x] update CSS for counters circles
- [ ] synchronize the counters update | 1.0 | add counters to the chart1 - add counters for the smokers ratios
- [x] connect counters with data and buttons
- [x] update CSS for counters circles
- [ ] synchronize the counters update | non_comp | add counters to the add counters for the smokers ratios connect counters with data and buttons update css for counters circles synchronize the counters update | 0 |
227,450 | 17,383,017,350 | IssuesEvent | 2021-08-01 04:29:15 | r-hyperspec/hySpc.read.spe | https://api.github.com/repos/r-hyperspec/hySpc.read.spe | closed | Read documentation and identify issues | Topic: documentation :blue_book: | @sangttruong, please read the documentation of this package (https://r-hyperspec.github.io/hySpc.read.spe/) and tell whether, in your opinion, it is of sufficient quality or not. Please, suggest bellow, how should it be improved. If possible, add improvements as a separate PR. If it is OK, let us know too. | 1.0 | Read documentation and identify issues - @sangttruong, please read the documentation of this package (https://r-hyperspec.github.io/hySpc.read.spe/) and tell whether, in your opinion, it is of sufficient quality or not. Please, suggest bellow, how should it be improved. If possible, add improvements as a separate PR. I... | non_comp | read documentation and identify issues sangttruong please read the documentation of this package and tell whether in your opinion it is of sufficient quality or not please suggest bellow how should it be improved if possible add improvements as a separate pr if it is ok let us know too | 0 |
449,879 | 31,876,879,093 | IssuesEvent | 2023-09-16 00:27:25 | uf-mil/mil | https://api.github.com/repos/uf-mil/mil | closed | Add documentation on installing Ubuntu 20 through UTM | documentation software | Add documentation on how to install Ubuntu 20 (not 18) through UTM, a free program that can also run virtual machines. This software can serve as a free replacement to Parallels.
Ubuntu 18 documentation won't be added because our team is slowly moving away from it and because its installation process can be more com... | 1.0 | Add documentation on installing Ubuntu 20 through UTM - Add documentation on how to install Ubuntu 20 (not 18) through UTM, a free program that can also run virtual machines. This software can serve as a free replacement to Parallels.
Ubuntu 18 documentation won't be added because our team is slowly moving away from... | non_comp | add documentation on installing ubuntu through utm add documentation on how to install ubuntu not through utm a free program that can also run virtual machines this software can serve as a free replacement to parallels ubuntu documentation won t be added because our team is slowly moving away from it ... | 0 |
689,165 | 23,610,228,361 | IssuesEvent | 2022-08-24 11:47:43 | opencrvs/opencrvs-core | https://api.github.com/repos/opencrvs/opencrvs-core | closed | UI issue in Fees Collected in Performance | 👹Bug Priority: low ☕️ Discussion | **Bug Description:**
If currency is changed to Bangladeshdeshi Taka from the configuration, it shows incorrectly in the Fees Collected of performance.
**Steps:**
1. Log in as a National system admin
2. Click on Config > Application
3. Click on the General tab
4. Click 'Change'beside Currency
5. Change the... | 1.0 | UI issue in Fees Collected in Performance - **Bug Description:**
If currency is changed to Bangladeshdeshi Taka from the configuration, it shows incorrectly in the Fees Collected of performance.
**Steps:**
1. Log in as a National system admin
2. Click on Config > Application
3. Click on the General tab
4. ... | non_comp | ui issue in fees collected in performance bug description if currency is changed to bangladeshdeshi taka from the configuration it shows incorrectly in the fees collected of performance steps log in as a national system admin click on config application click on the general tab ... | 0 |
4,518 | 7,180,361,404 | IssuesEvent | 2018-01-31 22:57:39 | storybooks/storybook | https://api.github.com/repos/storybooks/storybook | closed | instructions for adding react-error-overlay? | compatibility with other tools question / support | ### Issue details
Hi friends! i would like to add react-error-overlay to my storybook webpack.config.js but i dont know how... any help would be appreciated!
### Steps to reproduce
what i have so far:
in `.storybook/webpack.config.js`:
```js
module.exports = {
plugins: [
// your custom plugins
],... | True | instructions for adding react-error-overlay? - ### Issue details
Hi friends! i would like to add react-error-overlay to my storybook webpack.config.js but i dont know how... any help would be appreciated!
### Steps to reproduce
what i have so far:
in `.storybook/webpack.config.js`:
```js
module.exports = {
... | comp | instructions for adding react error overlay issue details hi friends i would like to add react error overlay to my storybook webpack config js but i dont know how any help would be appreciated steps to reproduce what i have so far in storybook webpack config js js module exports ... | 1 |
9,412 | 11,463,232,251 | IssuesEvent | 2020-02-07 15:37:51 | AdguardTeam/AdguardForiOS | https://api.github.com/repos/AdguardTeam/AdguardForiOS | closed | Can't browse Sonos music services | Compatibility | **Steps to reproduce**
-> Open Sonos.
-> Click on 'browse' icon
-> Click on a Google Play Music service.
-> Result is a blank page with the error message
Check the video posted which illustrates the steps.
iOS Sonos 10.2.2 with Mixcloud, Google Play or any music services.
Adguard 3.0.1 DNS Default or ... | True | Can't browse Sonos music services - **Steps to reproduce**
-> Open Sonos.
-> Click on 'browse' icon
-> Click on a Google Play Music service.
-> Result is a blank page with the error message
Check the video posted which illustrates the steps.
iOS Sonos 10.2.2 with Mixcloud, Google Play or any music servi... | comp | can t browse sonos music services steps to reproduce open sonos click on browse icon click on a google play music service result is a blank page with the error message check the video posted which illustrates the steps ios sonos with mixcloud google play or any music servic... | 1 |
721 | 9,663,310,295 | IssuesEvent | 2019-05-21 00:00:12 | Azure/azure-functions-host | https://api.github.com/repos/Azure/azure-functions-host | closed | Supportability: User Story - Help customer write better code | Needs: Author Feedback Supportability high-support-cost no-recent-activity | #### What problem would the feature you're requesting solve? Please describe.
Customer code issues are biggest call drivers in support. Here is a sample of the different varieties of issues that come in:
• HOW TO configure VS for Functions
• High CPU consumption (memory-dump)
• Blob Trigger not firing (batchSize... | True | Supportability: User Story - Help customer write better code - #### What problem would the feature you're requesting solve? Please describe.
Customer code issues are biggest call drivers in support. Here is a sample of the different varieties of issues that come in:
• HOW TO configure VS for Functions
• High CPU ... | non_comp | supportability user story help customer write better code what problem would the feature you re requesting solve please describe customer code issues are biggest call drivers in support here is a sample of the different varieties of issues that come in • how to configure vs for functions • high cpu ... | 0 |
770 | 3,213,457,531 | IssuesEvent | 2015-10-06 19:58:54 | SalesforceFoundation/Cumulus | https://api.github.com/repos/SalesforceFoundation/Cumulus | closed | SmartyStreets API changes | app-compatibility | Change method from POST to GET
Remove SmartyStreets option from settings. | True | SmartyStreets API changes - Change method from POST to GET
Remove SmartyStreets option from settings. | comp | smartystreets api changes change method from post to get remove smartystreets option from settings | 1 |
3,052 | 5,956,793,583 | IssuesEvent | 2017-05-28 20:07:15 | AldoMX/StepMania-AMX | https://api.github.com/repos/AldoMX/StepMania-AMX | closed | Add `ComplementaryBar` to `LifeMeterGauge` | enhancement piu-compatibility theme-engine | Notice the blue bar:
https://www.youtube.com/watch?v=nC460ewzTrI&t=89
New metrics (tentative):
BounceMainBar
BounceComplementaryBar | True | Add `ComplementaryBar` to `LifeMeterGauge` - Notice the blue bar:
https://www.youtube.com/watch?v=nC460ewzTrI&t=89
New metrics (tentative):
BounceMainBar
BounceComplementaryBar | comp | add complementarybar to lifemetergauge notice the blue bar new metrics tentative bouncemainbar bouncecomplementarybar | 1 |
10,058 | 3,083,413,383 | IssuesEvent | 2015-08-24 08:49:36 | WebTales/rubedo | https://api.github.com/repos/WebTales/rubedo | closed | Pas d'affichage du champ Date dans le checkout | Bug To test | Dans le step 2 Contact informations, si le type utilisateur contient un champ date, celui-ci ne s'affiche pas en front dans le checkout | 1.0 | Pas d'affichage du champ Date dans le checkout - Dans le step 2 Contact informations, si le type utilisateur contient un champ date, celui-ci ne s'affiche pas en front dans le checkout | non_comp | pas d affichage du champ date dans le checkout dans le step contact informations si le type utilisateur contient un champ date celui ci ne s affiche pas en front dans le checkout | 0 |
5,375 | 7,114,136,001 | IssuesEvent | 2018-01-17 23:07:07 | Microsoft/vscode-cpptools | https://api.github.com/repos/Microsoft/vscode-cpptools | closed | tag parser failed | Language Service bug fixed (release pending) | 
IntelliSense Engine = Tag Parser.
Autocomplete is enabled.
Error squiggles are disabled.
File exclude: **/.git
File exclude: **/.svn
File exclude: **/.hg
File exclude: **/CVS
File exclude: **/.DS_S... | 1.0 | tag parser failed - 
IntelliSense Engine = Tag Parser.
Autocomplete is enabled.
Error squiggles are disabled.
File exclude: **/.git
File exclude: **/.svn
File exclude: **/.hg
File exclude: **/CVS
Fi... | non_comp | tag parser failed intellisense engine tag parser autocomplete is enabled error squiggles are disabled file exclude git file exclude svn file exclude hg file exclude cvs file exclude ds store file exclude vscode search exclude node modules search exclude bo... | 0 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.