url stringlengths 14 1.76k | text stringlengths 100 1.02M | metadata stringlengths 1.06k 1.1k |
|---|---|---|
http://web2.0calc.com/questions/how-can-i-find-the-end-behavior | +0
# how can i find the end behavior?
+1
54
2
How can i find the end behavior with these two functions?
Guest Oct 3, 2017
Sort:
### 2+0 Answers
#1
+7067
+1
How can i find the end behavior with these two functions?
$$f(x)=\frac{-6x}{3x-5}\\ f(x)=x^2-4x-5$$
$$\frac{-6x}{3x-5}=x^2-4x-5$$
$$-6x=(x^2-4x-5)\times (... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://www.physicsforums.com/threads/finding-probability-using-cdf.193676/ | # Finding Probability Using CDF
1. Oct 24, 2007
### EugP
How do I find PMF if I have CDF? For example:
$$F_X (x)=\left\{\begin{array}{cc}0,&\mbox{ if }x\leq -1 \\0.2, & \mbox{ if } -1\leq x < 0 \\0.7, & \mbox{ if } 0\leq x < 1 \\1, & \mbox{ if } x \geq 1 \end{array}\right.$$
2. Oct 24, 2007
### EnumaElish
f(x) =... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://tex.stackexchange.com/questions/481537/modulo-2-binary-long-division-in-european-notation/481552 | # Modulo 2 binary long division in European notation [duplicate]
I need to represent binary modulo 2 long division in my tex document. Notation needed is same as
https://en.wikipedia.org/wiki/Long_division#Eurasia
under Austria, Germany, etc.
I know about longdiv package, but it doesn't seem to support this.
Is th... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://arxiv.org/abs/1301.3734 | math.NT
(what is this?)
# Title:Generalized Brouncker's continued fractions and their logarithmic derivatives
Authors:O. Y. Kushel
Abstract: In this paper, we study the continued fraction y(s,r) which satisfies the equation y(s,r)y(s+2r,r)=(s+1)(s+2r-1) for r > 1/2. This continued fraction is a generalization of the... | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/ma... |
http://mathhelpforum.com/calculus/15662-find-equation-curve.html | # Math Help - Find an equation of the curve.
1. ## Find an equation of the curve.
Find an equation of the curve that satisfies dy/dx=8x^7y and whose y-intercept is 6.
2. Originally Posted by asnxbbyx113
Find an equation of the curve that satisfies dy/dx=8x^7y and whose y-intercept is 6.
The function evaluated at $x=... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 10, "wp_latex": 0, "mimetex.cgi": 0, "/images/ma... |
https://www.bartleby.com/questions-and-answers/let-fx3x25x10.-answer-the-following-questions.-1.-find-the-average-slope-of-the-function-ff-on-the-i/51ae448d-d0e0-4ad3-8761-c5db2e32131c | # Let f(x)=3x2+5x−10. Answer the following questions.1. Find the average slope of the function ff on the interval [−1,1]. Average Slope: m =2.Verify the Mean Value Theorem by finding a number cc in (−1,1)(−1,1) such that f′(c)=m Answer: c=
Question
75 views
Let f(x)=3x2+5x−10. Answer the following questions.
1. Find... | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/ma... |
http://juluribk.com/2011/06/01/scattering-extinction-absorption-cross-sections-of-silver-nanowires-infinite-cylinders-using-meep/ | # Scattering / extinction / absorption cross-sections of silver nanowires (infinite cylinders) using meep
Particles scatter and absorb electromagnetic radiation. One often needs to compare the amount of scattering/absorption/extinction for particles of different shapes, composition, sizes and incident light properties... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
http://mathhelpforum.com/business-math/57275-total-interest-loan.html | Thread: Total Interest on the Loan?
1. Total Interest on the Loan?
E-Loan, an online lending service, recently offered 36-month auto loads at 7.56
compounded monthly to applicants with good credit rating. If you have a good
credit rating and can afford monthly payments of $350, how much can you borrow from E-Loan? Wh... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://bioinformatics.stackexchange.com/questions/15791/how-to-input-the-opposite-strand-of-dna | # How to input the opposite strand of DNA?
I am trying to write a program that will count the repeats of a given DNA strand:
I am using a Counter library, something like this code shown below
from collections import Counter
s="XXXXXAGCCTGCCAAGCAAACTTCACTGGAGXXXXXTGTGCGTAGCATGCTAGTAACTGCAXXXXXTCTGAATCTTTCAGCTGCTTGTX... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
http://www-old.newton.ac.uk/programmes/SPD/seminars/2010052609451.html | SPD
Seminar
SPDEs and parabolic equations in Gauss-Sobolev spaces
Chow, P (Wayne State)
Wednesday 26 May 2010, 09:45-10:45
Seminar Room 1, Newton Institute
Abstract
Examples of linear and nonlinear parabolic equations in Hilbert spaces are given by the Kolmogorov equation and the Hamilton-Jacobi-Bellman equation ... | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/ma... |
https://cai.zone/2010/11/graph-sketching/ | # Graph sketching
Oh god, I'm going to talk about maths for a bit. Ignore me. You might find this interesting if you know what a derivative is and what it means.
This is a curiosity that my friend Anupam came up with. I'm not claiming any credit for noticing it but I thought I'd still share it with y'all. It only re... | {"extraction_info": {"found_math": false, "script_math_tex": 40, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 46, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/... |
https://physics.stackexchange.com/questions/480151/real-and-imaginary-time-greens-functions | # Real and Imaginary time Green's Functions
In real time, one can calculate the two point function of a given theory using
$$$$G(\vec{x},t)=\langle \Omega | \phi(\vec{x},t)\phi^\dagger (0,0)|\Omega\rangle =\int_{\phi(0,0)}^{\phi(\vec{x},t)} \mathcal{D}\phi\ e^{-\frac{i}{\hbar}S[\phi]}\phi(\vec{x}',t')\phi(\vec{x},t)$... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://houbb.github.io/2019/05/10/memory-base-30-performance-tool-01 | # Memory Performance Tools
A wide variety of tools is available to help programmers understand performance characteristics of a program, the cache and memory use among others.
Modern processors have performance monitoring hardware that can be used.
Some events are hard to measure exactly, so there is also room for s... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://www.helpteaching.com/tests/289006/memorization-strategies-checklist | ##### Print Instructions
NOTE: Only your test content will print.
To preview this test, click on the File menu and select Print Preview.
See our guide on How To Change Browser Print Settings to customize headers and footers before printing.
# Memorization Strategies Checklist (Grade 8)
Print Test (Only the test con... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://www.omnicalculator.com/physics/hydraulic-jump | # Hydraulic Jump Calculator
Created by Bogna Szyk
Reviewed by Dominik Czernia, PhD and Steven Wooding
Last updated: Oct 26, 2022
If you're interested in hydraulic engineering, this hydraulic jump calculator will be right up your alley. With its help, you can determine all characteristics of a hydraulic jump, includin... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 32, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/ma... |
http://perl143.blogspot.com/2012/11/zip-command-in-linux.html | ## Friday, 23 November 2012
### zip command in linux
The following examples illustrate typical uses of the command zip for packaging a set of files into an "archive" file, also called "zip file". The command uses the standard zip file format. The archive files can therefore be used to tranfer files and directories be... | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/ma... |
http://mathhelpforum.com/algebra/50899-solved-sat-math-page-653-a.html | # Thread: [SOLVED] SAT math page 653
1. ## [SOLVED] SAT math page 653
8, 17, 26, 35, 44, ...
The first 5 terms in a sequence are shown above. Each term after the first is found by adding 9 to the term immediately preceding it. Which term in this sequence is equal to 8+(26-1)9?
a) the 8th
b) the 9th
c) the 25th
d) t... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 3, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://math.stackexchange.com/questions/2829789/combinatorics-how-many-possible-paths | # Combinatorics: How many possible paths?
Consider the following grid.
We start at the bottom left corner. We may only move one step up or one step right at each move. This procedure is continued until we reach the top right corner. How many different paths from the bottom left corner to the top right corner are poss... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://en.wikipedia.org/wiki/Prompt_neutron | # Prompt neutron
In nuclear engineering, a prompt neutron is a neutron immediately emitted by a nuclear fission event, as opposed to a delayed neutron decay which can occur within the same context, emitted after beta decay of one of the fission products anytime from a few milliseconds to a few minutes later.
Prompt n... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 2, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://physics.stackexchange.com/questions/234304/should-4-fundamental-forces-really-be-3-because-of-electroweak-unification | Should 4 fundamental forces really be 3 because of electroweak unification?
Physicists concluded that, in fact, the weak and electromagnetic forces have essentially equal strengths. This is because the strength of the interaction depends strongly on both the mass of the force carrier and the distance of the interactio... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://scholar.harvard.edu/spiess | ## My research
I integrate insights and techniques from machine learning into the econometric toolbox.
## Contact
jspiess@stanford.edu
857-284-9880 | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/ma... |
https://notebook.madsenlab.org/project-coarse%20grained%20model/model-seriationct/experiment-experiment-seriationct/2015/05/14/seriationct-sample-size-experiments.html | ## SeriationCT Sample Size Series experiments
Created: 14 May 2015 Modified: 23 Jul 2020 BibTeX Entry RIS Citation Print
### Effect of Varying Sample Size
After SAA’s, I used some existing simulations (seriationct-27 from the experiment-seriationct-2 repository) to prototype examining the effects of sample size on:... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://worldwidescience.org/topicpages/h/hierarchical+control+systems.html | #### Sample records for hierarchical control systems
1. DC Hierarchical Control System for Microgrid Applications
OpenAIRE
Lu, Xiaonan; Sun, Kai; Guerrero, Josep M.; Huang, Lipei
2013-01-01
In order to enhance the DC side performance of AC-DC hybrid microgrid,a DC hierarchical control system is proposed in this pa... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://www.thekerneltrip.com/stochastic-calculus/estimate-cev-process/ | # The CEV Process
In mathematical finance, the CEV or constant elasticity of variance model is a stochastic volatility model which was developed by John Cox in 1975. It captures the fact that the log returns may not have a constant volatility, which the usual geometric brownian motion assumes.
The equation of the CEV... | {"extraction_info": {"found_math": true, "script_math_tex": 22, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/ma... |
https://www.wikinote.org/Main/Savitribai-Phule-Pune-University/ENTC/DSP-TE/Unit-3/Z-T-Properties/ | # Z -Transform Properties
Updated on 2017/07/28 19:16
Write introduction of the Article here.
1. ### Linearity
Statement:
If $x_{1}(n)+x_{2}(n) \leftrightarrow X_{1}(z)+X_{2}(z)$ then $a x_{1}(n)+ b x_{2}(n) \leftrightarrow a X_{1}(z)+ b X_{2}(z)$, where a & b are any arbitrary constants.
Proof:
ZT of the seque... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 19, "wp_latex": 0, "mimetex.cgi": 0, "/images/ma... |
http://math.stackexchange.com/questions/89047/another-question-about-proof-that-zetas-neq-0-for-res-1/89049 | # Another question about proof that $\zeta(s) \neq 0$ for $\Re(s) = 1$
This is a question distinct from but related to the question I wrote here: Question about proof that $\zeta(s) \neq 0$ for $\Re(s) = 1$, so assume the same things that I wrote there.
The paper then goes to show that the order of this zero of $\zet... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://hal-cea.archives-ouvertes.fr/cea-02669093 | # Tracking the dispersion of particle-borne radioactive contamination along coastal rivers of Fukushima Prefecture (2011-2014)
2 GEDI - Géochimie Des Impacts
LSCE - Laboratoire des Sciences du Climat et de l'Environnement [Gif-sur-Yvette] : DRF/LSCE
Abstract : The Fukushima Dai-ichi nuclear power plant (FDNPP) acciden... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://desvl.xyz/2020/09/27/diagram-chasing/ | ## Exterior differentiation
(This section is intended to introduce the background. Feel free to skip if you already know exterior differentiation.)
There are several useful tools for vector calculus on $\mathbb{R}^3,$ namely gradient, curl, and divergence. It is possible to treat the gradient of a differentiable func... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://math.stackexchange.com/questions/1500084/expanding-brackets-problem-z-11-z-z2-z3 | # Expanding brackets problem: $(z - 1)(1 + z + z^2 + z^3)$
I have:
$(z - 1)(1 + z + z^2 + z^3)$
As, I have tried my own methods and enlisted the help on online software, but as well as them not all arriving at the same solution, I can't follow their reasoning.
I tried to gather all the like terms:
$(z - 1)(z^6+1)$... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
http://sites.science.oregonstate.edu/portfolioswiki/activities:guides:cfqmatomgroup?rev=1368562851 | Navigate back to the activity.
## Quantum Calculations on the Hydrogen Atom: Instructor's Guide
### Main Ideas
• Eigenvalues and eigenstates
• Measurements of energy and angular momentum for hydrogen atom
• Quantum probabilities
• Superposition of states
• Quantum calculations in multiple representations
Estimated ... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://www.gradesaver.com/textbooks/engineering/electrical-engineering/electrical-engineering-principles-and-applications-6th-edition/chapter-1-practice-test-practice-test-page-44/t1-3 | ## Electrical Engineering: Principles & Applications (6th Edition)
$V_{ab}=-8V$ $P_{I_1}=-24W$ $P_{I_2}=8W$ $P_{R_1}=5.33W$ $P_{R_2}=10.67W$
We first apply Kirchhoff's Current Law and Ohm's law, which states that $I=\frac{V}{R}$, to find: $3-1+\frac{V_{ab}}{12} + \frac{V_{ab}}{6} = 0 \\ 2 + \frac{3V_{ab}}{12} = 0 \\ 3... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://matheducators.stackexchange.com/questions/11358/functional-analysis-text-for-junior-senior-math-majors | # Functional analysis text for junior-senior math majors?
I am looking for a good book for junior-senior US math majors on functional analysis. Some background and detail:
Last semester I taught a special topics course in functional analysis to junior-senior level math majors. It was the first time teaching functiona... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://link.springer.com/article/10.1007/s12053-018-9612-1 | Energy Efficiency
, Volume 11, Issue 4, pp 877–891
# Analysis of different scenarios of car paint oven redesign to achieve desired indoor air temperature
• Milan Despotovic
• Milun Babic
Original Article
## Abstract
Car paint ovens consume a lot of energy within the automobile factory. For this reason, proper sele... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
http://math.stackexchange.com/questions/241922/use-residues-to-evaluate-int-0-infty-frac-coshax-coshx-mathrmdx | # Use residues to evaluate $\int_0^\infty \frac{\cosh(ax)}{\cosh(x)}\,\mathrm{d}x$, where $|a|<1$
Use residues to evaluate $$\int_0^\infty \frac{\cosh(ax)}{\cosh(x)}\,\mathrm{d}x$$ where $|a|<1$.
Try considering the integral of the form $$\int_C \frac{\exp(az)}{\cosh(z)}\,\mathrm dz,$$ where $C$ is the contour given ... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
http://hitchhikersgui.de/Conformal_group | # Conformal group
In mathematics, the conformal group of a space is the group of transformations from the space to itself that preserve angles. More formally, it is the group of transformations that preserve the conformal geometry of the space.
Several specific conformal groups are particularly important:
• The conf... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 1, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
http://mathhelpforum.com/algebra/1957-proof-question.html | # Math Help - Proof question
1. ## Proof question
I have questions about one proof.
It concerns numbers with rational exponents.
Having in mind that for all $r,s \in Q,a \in R$ is $(a^r )^s = a^{rs}$ then author of book wants to show that $a$ must be positive real number.
Proof is:
If $r$ is rational number then $... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 43, "wp_latex": 0, "mimetex.cgi": 0, "/images/ma... |
https://gamedev.stackexchange.com/questions/194613/unity-ontriggerenter2d-doesent-check-z-axis | # Unity OnTriggerEnter2D doesen't check Z Axis
I am coding my game's collisions using onTriggerEnter(). The problem is that it only checks X and Y axis and not the Z one, and that is causing me some problems because my game uses the Z axis and I can't use 3D colliders for other reasons.
There is a way to check also t... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://www.physicsforums.com/threads/linearising-a-cosine-curve.636492/ | # Homework Help: Linearising a cosine curve
1. Sep 16, 2012
### Maluras
1. The problem statement, all variables and given/known data
For my physics EEI, I have developed the formula: g-forces=√(391.88-337.12 cosθ)/9.8
I need to linearise the graph into the form y=mx+c.
I'm not sure where just the angle is the ind... | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/ma... |
https://www.aimsciences.org/article/doi/10.3934/mbe.2009.6.743 | Advanced Search
Article Contents
Article Contents
# Novel stability results for traveling wavefronts in an age-structured reaction-diffusion equation
• For a time-delayed reaction-diffusion equation of age-structured single species population, the linear and nonlinear stability of the traveling wavefronts were proved... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://export.arxiv.org/abs/2107.04587 | hep-th
(what is this?)
# Title: Extended DBI and its generalizations from graded soft theorems
Abstract: We analyze a theory known as extended DBI, which interpolates between DBI and the $U(N)\times U(N)/U(N)$ non-linear sigma model and represents a nontrivial example of theories with mixed power counting. We discus... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://www.ncbi.nlm.nih.gov/pubmed/9070242?dopt=Abstract | Format
Choose Destination
Biochem Biophys Res Commun. 1997 Feb 3;231(1):167-71.
Overexpression of insulin degrading enzyme: cellular localization and effects on insulin signaling.
Author information
1
Department of Molecular Pharmacology, Stanford University School of Medicine, California 94305, USA.
Abstract
To ... | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/ma... |
https://simple.wikipedia.org/wiki/Poisson%27s_ratio | # Poisson's ratio
Figure 1: A cube with sides of length L of an isotropic linearly elastic material subject to tension along the x axis, with a Poisson's ratio of 0.5. The green cube is unstrained, the red is expanded in the x direction by $\Delta L$ due to tension, and contracted in the y and z directions by $\Delta ... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 3, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://mathhelpboards.com/threads/amandas-question-at-yahoo-answers-eigenvalues-and-eigenvectors.3594/ | # Amanda's question at Yahoo! Answers (Eigenvalues and eigenvectors)
#### Fernando Revilla
##### Well-known member
MHB Math Helper
Jan 29, 2012
661
Here is the question:
So, I'm attempting to work on this question:
Given that matrix A =
0 1 1
1 0 1
1 1 0
and has λ = -1 as one of its eigenvalues, find the correspon... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://www.ideals.illinois.edu/handle/2142/90430 | ## Files in this item
FilesDescriptionFormat
application/pdf
UILU-ENG-11-2207.pdf (374kB)
(no description provided)PDF
## Description
Title: Distributed Algorithms for Consensus and Coordination in the Presence of Packet-Dropping Communication Links: Part I: Statistical Moments Analysis Approach Author(s): Domíng... | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/ma... |
http://data.naturalcapitalproject.org/nightly-build/invest-users-guide/html/scenic_quality.html | InVEST 3.5.0.post358+he23ea3e79185 documentation
# Unobstructed Views: Scenic Quality Provision¶
## Summary¶
The natural and scenic views of marine and coastal seascapes can contribute to the well-being of local communities in a number of ways. Scenic amenities play an important role in augmenting local economies by... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 2, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://experts.illinois.edu/en/publications/vectorial-solution-to-double-curl-equation-with-generalized-coulo-2 | # Vectorial Solution to Double Curl Equation With Generalized Coulomb Gauge for Magnetostatic Problems
Yan Lin Li, Sheng Sun, Qi I. Dai, Weng Cho Chew
Research output: Contribution to journalArticlepeer-review
## Abstract
In this paper, a solution to the double curl equation with generalized Coulomb gauge is propos... | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/ma... |
https://kb.osu.edu/dspace/handle/1811/10168 | # THE OBSERVATION OF A NEW g STATE OF NAPHTHALENE BY MULTIPHOTON IONIZATION
Please use this identifier to cite or link to this item: http://hdl.handle.net/1811/10168
Files Size Format View
1977-RH-05.jpg 97.96Kb JPEG image
Title: THE OBSERVATION OF A NEW g STATE OF NAPHTHALENE BY MULTIPHOTON IONIZATION Creators: Be... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://www.physicsforums.com/threads/hamilton-jacobi-problem.741023/ | # Hamilton-Jacobi Problem
1. Mar 1, 2014
### dipole
1. The problem statement, all variables and given/known data
I'm given the time-dependent potential,
$$V(x,t) = -mAxe^{-\gamma t}$$
and asked to find the solution to the Hamilton-Jacobi equation,
$$H(x,\frac{\partial S}{\partial x}) + \frac{ \partial S}{\partia... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://randommathgenerator.com/2016/12/23/filtrations-and-gradings/ | This is going to be a blog post on Filtrations and Gradings. We’re going to closely follow the development in Local Algebra by Serre.
A filtered ring is a ring with the set of ideals $\{A_n\}_{n\in\Bbb{Z}}$ such that $A_0=A$, $A_{n+1}\subset A_n$, and $A_pA_q=A_{p+q}$. An example would be $A_n=(2^n)$, where $(2^n)$ is... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 69, "mimetex.cgi": 0, "/images/ma... |
http://math.stackexchange.com/questions/835144/conjecture-if-n-and-n-10-are-prime-then-n-20-is-composite | # Conjecture: If $N$ and $N + 10$ are prime, then $N + 20$ is composite.
Conjecture: If $N$ and $N + 10$ are prime, then $N + 20$ is composite.
Here are some examples:
• $19$ and $29$ are prime; $39$ is composite.
• $241$ and $251$ are prime; $261$ is composite.
• $733$ and $743$ are prime; $753$ is composite.
• $16... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
http://tex.stackexchange.com/questions/79039/extra-space-between-footnote-numbers-and-content-for-high-count?answertab=oldest | # Extra space between footnote numbers and content for high count
I’m using the following commands to customize footnotes:
\usepackage[bottom,norule,hang]{footmisc}
\setlength{\footnotemargin}{2mm}
\setlength{\footnotesep}{4mm}
The results were as I wanted but only until the 10th footnote (see image below). Is ther... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://gmatclub.com/forum/in-the-figure-above-o-is-the-center-of-the-circle-and-b-is-a-point-253489.html | GMAT Question of the Day - Daily to your Mailbox; hard ones only
It is currently 21 Jul 2018, 12:39
### GMAT Club Daily Prep
#### Thank you for using the timer - this advanced tool can estimate your performance and suggest more practice questions. We have subscribed you to Daily Prep Questions via email.
Customize... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://brilliant.org/discussions/thread/video-embedding/ | ×
# Video Embedding
I just thought it would be really nice if Brilliant introduces the ability to embed videos from Youtube, or even better, let users upload videos (but I think embedding is better) to Brilliant.
This way, if anyone sees a brilliant video on a topic on YouTube (or any other similar website), they can... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
http://tex.stackexchange.com/questions/18883/help-how-to-get-the-pdf-file-error-warnings-lead-to-no-pdf-file | # Help! How to get the PDF-File? Error & Warnings lead to no pdf-file
I have a big problem. I am writing my phd thesis and started to use latex recently. I developed some basic skills that helped out me most time. But at the moment I dont know how to solve the problem. Every time I try to typeset the tex-file, the con... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://www.physicsoverflow.org/24555/keeping-in-pace-with-q2a | # Keeping in pace with Q2A
+ 3 like - 0 dislike
584 views
The PhysicsOverflow software is a heavy fork of Question2Answer, a free and open-source software for discussion forums. The point at which the PhysicsOverflow software diverged from the Q2A software is at Q2A v1.6.2. The latest stable build of Question2Answer ... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
http://physics.aps.org/articles/v7/111 | Viewpoint: Arrow of Time Emerges in a Gravitational System
Physics 7, 111
Study of masses interacting via gravity challenges the idea that special initial conditions are needed to give time a direction.
The fundamental laws of physics, we believe, do not depend on the direction of time. Why, then, is the future so di... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 5, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://www.gurujobalert.com/questions/723/If-15-men-or-24-women-or-36-boys-can-do-a-piece-of | # If 15 men or 24 women or 36 boys can do a piece of work in 12 days, working 8 hours a day, how many men must be associated with 12 women and 6 boys to do another piece of work 2$1 \over 4$ times as great in 30 days working 6 hours a day ?
[ A ] 4 [ B ] 8 [ C ] 6 [ D ] 10 [ E ] 12
Answer : Option B E... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
http://mathhelpforum.com/algebra/189882-calculate-computer-performance-increase-print.html | # Calculate computer performance increase?
• October 8th 2011, 09:39 PM
ziggy
Calculate computer performance increase?
I'm trying to figure out how to calculate the increase in performance between PC configurations.
For instance:
PC X takes 0:13:15 (h:mm:ss) to render a 5 minute video
PC Y takes 0:04:31 (h:mm:ss) to ... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 3, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://www.bmj.com/content/337/bmj.a171?ijkey=280f287578ee234a93a9a90cbee2d7cdbfc1c4a2&keytype2=tf_ipsecsha | Intended for healthcare professionals
Research
# Prognosis in patients with recent onset low back pain in Australian primary care: inception cohort study
BMJ 2008; 337 (Published 07 July 2008) Cite this as: BMJ 2008;337:a171
1. Nicholas Henschke, postdoctoral fellow12,
2. Christopher G Maher, director of division12,... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://infoscience.epfl.ch/record/185246 | Infoscience
Conference paper
# Learning Ridge Functions With Randomized Sampling In High Dimensions
We study the problem of learning ridge functions of the form f(x) = g(aT x), x ∈ ℝd, from random samples. Assuming g to be a twice continuously differentiable function, we leverage techniques from low rank matrix reco... | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/ma... |
https://brilliant.org/discussions/thread/wiki-collaboration-parties-solving-linear-systems/ | # Wiki Collaboration Parties - Solving linear systems using matrices + Common Misconceptions
This week, we will be improving:
Wiki page Solving Linear Systems Using Matrices Common Misconceptions Hosted by Andrew Calvin Supported by Pranshu Zandra Current status Brainstorming Brainstorming Target Audience Level 3 Al... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 8, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://math.stackexchange.com/questions/2780255/fundamental-theorem-of-algebra-proof-for-max-real-roots-of-real-polynomials-u/2780261 | # Fundamental Theorem of Algebra proof, for max real roots of real polynomials - using only high school algebra-precalc?
Ths isn't the proper Fundamental Theorem of Arithmetic (which includes complex roots), but just the maximum number of real roots for polynomial $$f(x)$$ with real coefficients... which is $$deg(f)$$... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://paperswithcode.com/task/face-verification | # Face Verification
105 papers with code • 21 benchmarks • 22 datasets
Face verification is the task of comparing a candidate face to another, and verifying whether it is a match. It is a one-to-one mapping: you have to check if this person is the correct one.
## Libraries
Use these libraries to find Face Verificat... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
http://greenemath.com/Algebra2/28/3VariableSystemofEquationsTest.html | Question 1 of 5Solve each System in 3 Variables
Select the Correct Answer Below: Correct! Not Correct!
A
$$(6,-4,-1)$$
B
No Solution
C
$$(8,-2,15)$$
D
$$(1,-3,-2)$$
E
$$(12,5,-7)$$
Question 2 of 5Solve each System in 3 Variables
Select the Correct Answer Below: Correct! Not Correct!
A
$$(-5,5,5)$$
B
$$(-1,3,9)$$
C
No S... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://chemistry.stackexchange.com/questions/75853/will-koh-work-in-place-of-naoh-as-the-electolyte-in-the-electrolysis-of-water | # Will KOH work in place of NaOH as the electolyte in the electrolysis of water?
I am making a hydrogen and oxygen generator by electrolysis water. I found out that using salt as an electrolyte creates a compound of chlorine and oxygen with my electrodes clouding up the water and using all of the oxygen from the react... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
http://www.ck12.org/algebra/Graphs-of-Linear-Functions/lesson/Graphs-of-Linear-Functions-Intermediate/r10/ | <meta http-equiv="refresh" content="1; url=/nojavascript/">
You are viewing an older version of this Concept. Go to the latest version.
# Graphs of Linear Functions
## Graph f(x) = ax +b
%
Progress
Practice Graphs of Linear Functions
Progress
%
Graphs of Linear Functions
What if you were given an equation like $y =... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://rd.springer.com/article/10.1007/s10967-009-0316-z | # Activity, exposure rate and spectrum prediction with Java programming
• Dağıstan Şahin
• Kenan Ünlü
Article
## Abstract
In order to envision the radiation exposure during Neutron Activation Analysis (NAA) experiments, a software called Activity Predictor is developed using JavaTM programming language. The Activity... | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/ma... |
http://koreascience.or.kr/search.page?keywords=child&pageSize=10&pageNo=1258 | • Title, Summary, Keyword: child
### Relationship of Social Skills & Social Support from Family and Friends to Adjustment Between Children and Adolescents (아동과 청소년의 사회적 기술과 가족 $[\cdor}$ 친구의 지원 및 적응과의 관계)
• Sim, Hee-Og
• Journal of the Korean Home Economics Association
• /
• v.37 no.6
• /
• pp.11-22
• /
• 1999
• This ... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
http://papers.neurips.cc/paper/5038-optimistic-concurrency-control-for-distributed-unsupervised-learning | # NIPS Proceedingsβ
## Optimistic Concurrency Control for Distributed Unsupervised Learning
[PDF] [BibTeX] [Supplemental] [Reviews]
### Abstract
Research on distributed machine learning algorithms has focused primarily on one of two extremes---algorithms that obey strict concurrency constraints or algorithms that o... | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/ma... |
http://structureandcontent.blogspot.com/2011/11/rising-cost-of-financial-intermediation.html | ## Saturday, November 19, 2011
### The rising cost of financial intermediation
A lot of the recent debate on regulation in the finance industry has revolved around issues of size. How big is too big, in the financial sector? Should the largest financial corporations be taxed and monitored more than others? This set o... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 2, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://muddyhats.com/2018/09/11/a-triangle-from-a-stick/ | Inelegant Explorations of Some Personal Problems
# A Triangle from a Stick
A famous problem in probability is this: Suppose you randomly1 break a stick in two places. You will get three smaller pieces of stick. What is the probability that you can form a triangle using these pieces?
One interesting thing about this ... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 2, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
http://mathoverflow.net/questions/30589/decomposition-of-gl2-p-into-irreducible-representations | # Decomposition of GL(2,p) into irreducible representations
Let $G=GL(2,p)$ be the group of linear transformations. It acts on the set $X=F_p^2$. Then $C^X$ is a linear representation of $G$. What is the decomposition of this representation into irreducible representations?
Note: Let $d_i$ denote the number of isomor... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://www.astro.gla.ac.uk/users/eduard/cesra/?cat=1&paged=3 | ### Fundamental electromagnetic emissions by a weak electron beam in solar wind plasmas with density fluctuations by C. Krafft and P. Savoini
2022-04-05
Solar radio bursts of Type III were currently observed since decades in the interplanetary space (Reid and Ratcliffe, 2014). They result from a series of successive ... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://liam.rs/posts/Powerful-%60just%60-features/ | Home / Posts / Powerful just features View Raw
12/04 — 2022
81.92 cm 5.4 min
# Powerful just features
just is a command runner written in Rust. Commands, or recipes in just lingo, are populated in a file called ‘justfile’, and are expressed in a make-like syntax.
I’ve been using just as my command runner for all o... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://jax.readthedocs.io/en/stable/_autosummary/jax.numpy.nanmin.html | jax.numpy.nanmin¶
jax.numpy.nanmin(a, axis=None, out=None, keepdims=False, **kwargs)
Return minimum of an array or minimum along an axis, ignoring any NaNs.
When all-NaN slices are encountered a RuntimeWarning is raised and Nan is returned for that slice.
LAX-backend implementation of nanmin(). Original docstring be... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
http://mathhelpforum.com/advanced-statistics/139686-linear-combination-poisson-random-variables.html | # Math Help - Linear combination of poisson random variables
1. ## Linear combination of poisson random variables
Hi, can someone help me with this question:
Let X~Poisson(1), Y~Poisson(2), define T = X + Y.
a) Show that T~Poisson(3)
b) Find the joint probability function of X and T
c) Find the conditional distribut... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 2, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://www.physicsforums.com/threads/spectra-units-cm-1.867798/ | # I Spectra Units cm^(-1)?
Tags:
1. Apr 19, 2016
### kq6up
I am seeing units for atomic/molecular spectra listed as $cm^{-1}$. Is this based on the wave number $k$ for $\Psi=Asin(kx-\phi)$?
Thanks,
KQ6UP
2. Apr 19, 2016
### Staff: Mentor
It is then inverse of the wavelength of the emitted/absorbed light. It is a... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://docs.snowflake.com/en/sql-reference/constructs/where.html | Categories:
Query Syntax
# WHERE¶
The WHERE clause specifies a condition that matches a subset of rows. You can use the WHERE clause to:
## Syntax¶
...
WHERE <predicate>
[ ... ]
predicate
A boolean expression. The expression can include logical operators, such as AND, OR, and NOT.
## Usage Notes¶
• Predicates ... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
http://openstudy.com/updates/50fa2076e4b022b322700687 | Here's the question you clicked on:
55 members online
• 0 viewing
Tech-Hunter 2 years ago Matrix question (WHY ?) Delete Cancel Submit
• This Question is Closed
1. Tech-Hunter
• 2 years ago
Best Response
You've already chosen the best response.
0
Question : 3x + 7y =2 6x+14y = 4 *Question has coincident lines, infi... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
http://math.soimeme.org/~arunram/Preprints/COGHAFCRGTheGradedHeckeAlgebrasHgr.html | Classification of graded Hecke algebras for complex reflection groups
Last update: 22 January 2014
The graded Hecke algebras ${H}_{\text{gr}}$
In [Lus1989], Lusztig gives a definition of graded Hecke algebras for real reflection groups which is different from the definition in Section 1, which applies to more genera... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 93, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/ma... |
https://symmetricblog.wordpress.com/tag/analysis/ | ## Posts Tagged ‘Analysis’
### CPR
August 22, 2011
“One idea people had was to check out Calibrated Peer Review. I have only scratched the surface at that site but I’m grateful for being pointed to it.”
That was a sentence from Andy Rundquist’s blog. As much as Andy ever has a throwaway line in a blog entry, this w... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 1, "mimetex.cgi": 0, "/images/mat... |
https://ask.sagemath.org/question/38007/finding-zeros-of-zeta-function/ | # Finding zeros of zeta function. edit
I am trying to make the following code work.
t = var('t')
f = zeta(1/2+i*t).abs()
ff = fast_callable(f, vars=[t], domain=CDF)
print find_root(ff, 0, 40)
There are actually 6 roots between 0 and 40. But find_root could not find any of them. Is there any walkaround?
edit retag ... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://brilliant.org/problems/ive-seen-it-before-2/ | # I've seen it before - 2
Geometry Level 3
Let $$A_{0}, A_{1}, A_{2}, A_{3}, A_{4}, A_{5}$$ be a regular hexagon inscribed in a circle of a unit radius. Then the product of the lenghts of the line segments $$A_{0}A_{1}, A_{0}A_{2}$$ and $$A_{0}A_{4}$$ is
Note
You can find more such problems here
× | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
http://mathhelpforum.com/algebra/96024-word-problem-29-a.html | # Thread: word problem #29
1. ## word problem #29
can someone show how to set up the equation to solve this word problem please.
One number is 4 more than another number. Find the two if two times the larger number is 7 less than 5 times the smaller.
the books solution is 5 & 9
2. Originally Posted by jwarfield09
... | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/ma... |
https://www.jobilize.com/course/section/length-4-scaling-coefficient-vector-by-openstax?qcr=www.quizover.com | # 0.5 The scaling function and scaling coefficients, wavelet and (Page 10/13)
Page 10 / 13
## Parameterization of the scaling coefficients
The case where $\phi \left(t\right)$ and $h\left(n\right)$ have compact support is very important. It aids in the time localization properties of the DWT andoften reduces the c... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 50, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/ma... |
https://arxiv.org/abs/1508.01193 | hep-th
(what is this?)
# Title:The monodromy of T-folds and T-fects
Abstract: We construct a class of codimension-2 solutions in supergravity that realize T-folds with arbitrary $O(2,2,\mathbb{Z})$ monodromy and we develop a geometric point of view in which the monodromy is identified with a product of Dehn twists o... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://lookingatnothing.com/index.php/archives/1829 | # Holiday post: image vs. averaged background subtraction
When correcting data for the many possible data artefacts, I usually prefer to do these corrections on the 2D images as opposed to the azimuthally averaged data (often referred to by the misnomer “integration”).
This needs to be done for some direction-dependen... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 2, "mimetex.cgi": 0, "/images/mat... |
https://tspace.library.utoronto.ca/handle/1807/26561/browse?type=title&sort_by=1&order=ASC&rpp=20&etal=-1&null=&starts_with=Y | Home
Browse
Communities
& Collections
Issue Date
Author
Title
Subject
Sign on to:
My Account
authorized users
Edit Profile
Help
## Browsing "Specialist Studies" by Title
Jump to: 0-9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z or enter first few letters:
Sort by: In order: Results/Page Authors/Record:
... | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/ma... |
https://www.science.gov/topicpages/r/russian+highly+enriched.html | #### Sample records for russian highly enriched
1. 3 CFR - Continuation of the National Emergency With Respect to the Disposition of Russian Highly Enriched...
Code of Federal Regulations, 2014 CFR
2014-01-01
... to the Disposition of Russian Highly Enriched Uranium Presidential Documents Other Presidential... Russ... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
http://libros.duhnnae.com/2017/aug3/150187917115-The-Lauricella-functions-and-exact-string-scattering-amplitudes.php | # The Lauricella functions and exact string scattering amplitudes
The Lauricella functions and exact string scattering amplitudes - Descarga este documento en PDF. Documentación en PDF para descargar gratis. Disponible también para leer online.
Journal of High Energy Physics
, 2016:62
First Online: 10 November 2016... | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/ma... |
https://www.bartleby.com/solution-answer/chapter-158-problem-26e-calculus-early-transcendentals-8th-edition/9781285741550/use-spherical-coordinates-26-evaluate-e-x2y2z2dv-where-e-lies-above-the-cone-z-x2y2and/14f0e057-52f4-11e9-8385-02ee952b546e | Chapter 15.8, Problem 26E
### Calculus: Early Transcendentals
8th Edition
James Stewart
ISBN: 9781285741550
Chapter
Section
### Calculus: Early Transcendentals
8th Edition
James Stewart
ISBN: 9781285741550
Textbook Problem
# Use spherical coordinates.26. Evaluate ∫∫∫E x 2 + y 2 + z 2 dV, where E lies above the co... | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/ma... |
https://link.springer.com/article/10.1007%2Fs00500-012-0941-2 | Soft Computing
, Volume 17, Issue 4, pp 691–702
# Solving fully fuzzy linear system with arbitrary triangular fuzzy numbers $$( {m,\alpha ,\beta })$$
Original Paper
## Abstract
In this paper, we discuss some new numerical methods to solve a fully fuzzy linear system (FFLS) with triangular fuzzy numbers of the form... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
http://openstudy.com/updates/4fcfd348e4b0c6963adae8f3 | Here's the question you clicked on:
55 members online
• 0 viewing
## countonme123 2 years ago square root of 176. simplify it please. Delete Cancel Submit
• This Question is Closed
1. Rogue
• 2 years ago
Best Response
You've already chosen the best response.
3
$176 = 16 * 11$$\sqrt {176} = \sqrt {16 * 11} = \sqrt {... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://methemedantics.wordpress.com/ | ## Probability, Trees and Algorithms
Just got back from a very nice week at Oberwolfach, organized by Luc Devroye and Ralph Neininger. I took notes on the talks on my tablet, using GoodNotes and a Jot Touch 4. People seemed to like them so I’m putting them up here for anyone who’s interested. The main downside of the ... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 3, "mimetex.cgi": 0, "/images/mat... |
https://training.dewesoft.com/online/course/network-and-distributed-acquisition-using-dewesoft-net | # Network and Distributed Data Acquisition Using Dewesoft NET
With Dewesoft NET, your measurement system can be controlled remotely with the ease of use you couldn't imagine before. Dewesoft NET also serves as the center for Distributed Data Acquisition systems where you have multiple systems located either together o... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
http://makox.com/ | ## Real Numbers – Revisiting Rational and Their Decimal Expansions
REVISITING RATIONAL NUMBERS AND THEIR DECIMAL EXPANSIONS :
We have already studied in the previous class that rational numbers have either a terminating decimal repeating decimal expansion. We have to consider a rational number as $\displaystyle \frac... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 264, "mimetex.cgi": 0, "/images/m... |
http://physicstasks.eu/2173/nitrogen-in-a-vessel | ## Nitrogen in a Vessel
One mole of nitrogen is enclosed in a vessel. Average translational kinetic energy of the nitrogen molecules is 3.5 kJ. Determine the most probable speed of nitrogen molecules after increasing temperature in the vessel by 200 K.
• #### Hint 1
Using the formula for average molecular kinetic en... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
http://www.physicsforums.com/showthread.php?t=200510&page=3 | Recognitions:
Homework Help
## what is time exactly
I was about to suggest to a mentor to lock the thread, but you, being the expert, have taken better care of it. A bit rough on Aristotle, who, by the standards of his day and two millennia after, is considered to be one of the greatest minds in recorded history.
Re... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |
https://thecuriousastronomer.wordpress.com/tag/infrared/ | Feeds:
Posts
## Two nearby planets potentially habitable?
This story caught my attention in the last few weeks. It is from the Universe Today website, and here is the link to the story. The two exoplanets in the story, TRAPPIST-1b and TRAPPIST-1c, are only 40 light-years away, which by cosmic standards is very close.... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 14, "mimetex.cgi": 0, "/images/ma... |
http://www.physicsforums.com/showthread.php?t=45867&page=4 | by soul814
Tags: physics, vector
P: 35 how did u get the resultant vector?
Sci Advisor HW Helper PF Gold P: 12,016 $$\cos(30)=\frac{\sqrt{3}}{2},\sin(30)=\frac{1}{2}$$ (This is a rather well-known relation; you'll it later on) Hence A has coordinates $$(\frac{3\sqrt{3}}{2},\frac{3}{2})$$ Summing A with B (coord. (0,3... | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/mat... |