repo stringlengths 7 54 | path stringlengths 4 192 | url stringlengths 87 284 | code stringlengths 78 104k | code_tokens list | docstring stringlengths 1 46.9k | docstring_tokens list | language stringclasses 1
value | partition stringclasses 3
values |
|---|---|---|---|---|---|---|---|---|
joestump/django-ajax | ajax/utils.py | https://github.com/joestump/django-ajax/blob/b71619d5c00d8e0bb990ddbea2c93cf303dc2c80/ajax/utils.py#L8-L32 | def import_by_path(dotted_path, error_prefix=''):
"""
Import a dotted module path and return the attribute/class designated by
the last name in the path. Raise ImproperlyConfigured if something goes
wrong. This has come straight from Django 1.6
"""
try:
module_path, class_name = dotted_path.rsplit('.', 1)
except ValueError:
raise ImproperlyConfigured("%s%s doesn't look like a module path" % (
error_prefix, dotted_path))
try:
module = import_module(module_path)
except ImportError as e:
raise ImproperlyConfigured('%sError importing module %s: "%s"' % (
error_prefix, module_path, e))
try:
attr = getattr(module, class_name)
except AttributeError:
raise ImproperlyConfigured(
'%sModule "%s" does not define a "%s" attribute/class' % (
error_prefix, module_path, class_name
)
)
return attr | [
"def",
"import_by_path",
"(",
"dotted_path",
",",
"error_prefix",
"=",
"''",
")",
":",
"try",
":",
"module_path",
",",
"class_name",
"=",
"dotted_path",
".",
"rsplit",
"(",
"'.'",
",",
"1",
")",
"except",
"ValueError",
":",
"raise",
"ImproperlyConfigured",
"... | Import a dotted module path and return the attribute/class designated by
the last name in the path. Raise ImproperlyConfigured if something goes
wrong. This has come straight from Django 1.6 | [
"Import",
"a",
"dotted",
"module",
"path",
"and",
"return",
"the",
"attribute",
"/",
"class",
"designated",
"by",
"the",
"last",
"name",
"in",
"the",
"path",
".",
"Raise",
"ImproperlyConfigured",
"if",
"something",
"goes",
"wrong",
".",
"This",
"has",
"come"... | python | train |
unt-libraries/pypairtree | pypairtree/pairtree.py | https://github.com/unt-libraries/pypairtree/blob/2107b46718bbf9ef7ef3d5c63d557d1f772e5d69/pypairtree/pairtree.py#L104-L150 | def sanitizeString(name):
"""Cleans string in preparation for splitting for use as a pairtree
identifier."""
newString = name
# string cleaning, pass 1
replaceTable = [
('^', '^5e'), # we need to do this one first
('"', '^22'),
('<', '^3c'),
('?', '^3f'),
('*', '^2a'),
('=', '^3d'),
('+', '^2b'),
('>', '^3e'),
('|', '^7c'),
(',', '^2c'),
]
# " hex 22 < hex 3c ? hex 3f
# * hex 2a = hex 3d ^ hex 5e
# + hex 2b > hex 3e | hex 7c
# , hex 2c
for r in replaceTable:
newString = newString.replace(r[0], r[1])
# replace ascii 0-32
for x in range(0, 33):
# must add somewhat arbitrary num to avoid conflict at deSanitization
# conflict example: is ^x1e supposed to be ^x1 (ascii 1) followed by
# letter 'e' or really ^x1e (ascii 30)
newString = newString.replace(
chr(x), hex(x + sanitizerNum).replace('0x', '^'))
replaceTable2 = [
("/", "="),
(":", "+"),
(".", ","),
]
# / -> =
# : -> +
# . -> ,
# string cleaning pass 2
for r in replaceTable2:
newString = newString.replace(r[0], r[1])
return newString | [
"def",
"sanitizeString",
"(",
"name",
")",
":",
"newString",
"=",
"name",
"# string cleaning, pass 1",
"replaceTable",
"=",
"[",
"(",
"'^'",
",",
"'^5e'",
")",
",",
"# we need to do this one first",
"(",
"'\"'",
",",
"'^22'",
")",
",",
"(",
"'<'",
",",
"'^3c... | Cleans string in preparation for splitting for use as a pairtree
identifier. | [
"Cleans",
"string",
"in",
"preparation",
"for",
"splitting",
"for",
"use",
"as",
"a",
"pairtree",
"identifier",
"."
] | python | train |
sirfoga/pyhal | hal/meta/attributes.py | https://github.com/sirfoga/pyhal/blob/4394d8a1f7e45bea28a255ec390f4962ee64d33a/hal/meta/attributes.py#L26-L32 | def _parse(self):
"""Parses file contents
:return: Tree hierarchy of file
"""
with open(self.path, "rt") as reader:
return ast.parse(reader.read(), filename=self.path) | [
"def",
"_parse",
"(",
"self",
")",
":",
"with",
"open",
"(",
"self",
".",
"path",
",",
"\"rt\"",
")",
"as",
"reader",
":",
"return",
"ast",
".",
"parse",
"(",
"reader",
".",
"read",
"(",
")",
",",
"filename",
"=",
"self",
".",
"path",
")"
] | Parses file contents
:return: Tree hierarchy of file | [
"Parses",
"file",
"contents"
] | python | train |
debugloop/saltobserver | saltobserver/views.py | https://github.com/debugloop/saltobserver/blob/55ff20aa2d2504fb85fa2f63cc9b52934245b849/saltobserver/views.py#L18-L22 | def get_function_data(minion, jid):
"""AJAX access for loading function/job details."""
redis = Redis(connection_pool=redis_pool)
data = redis.get('{0}:{1}'.format(minion, jid))
return Response(response=data, status=200, mimetype="application/json") | [
"def",
"get_function_data",
"(",
"minion",
",",
"jid",
")",
":",
"redis",
"=",
"Redis",
"(",
"connection_pool",
"=",
"redis_pool",
")",
"data",
"=",
"redis",
".",
"get",
"(",
"'{0}:{1}'",
".",
"format",
"(",
"minion",
",",
"jid",
")",
")",
"return",
"R... | AJAX access for loading function/job details. | [
"AJAX",
"access",
"for",
"loading",
"function",
"/",
"job",
"details",
"."
] | python | train |
TAPPGuild/sqlalchemy-models | sqlalchemy_models/wallet.py | https://github.com/TAPPGuild/sqlalchemy-models/blob/75988a23bdd98e79af8b8b0711c657c79b2f8eac/sqlalchemy_models/wallet.py#L131-L138 | def load_commodities(self):
"""
Load the commodities for Amounts in this object.
"""
if isinstance(self.amount, Amount):
self.amount = Amount("{0:.8f} {1}".format(self.amount.to_double(), self.currency))
else:
self.amount = Amount("{0:.8f} {1}".format(self.amount, self.currency)) | [
"def",
"load_commodities",
"(",
"self",
")",
":",
"if",
"isinstance",
"(",
"self",
".",
"amount",
",",
"Amount",
")",
":",
"self",
".",
"amount",
"=",
"Amount",
"(",
"\"{0:.8f} {1}\"",
".",
"format",
"(",
"self",
".",
"amount",
".",
"to_double",
"(",
"... | Load the commodities for Amounts in this object. | [
"Load",
"the",
"commodities",
"for",
"Amounts",
"in",
"this",
"object",
"."
] | python | train |
DarkEnergySurvey/ugali | ugali/utils/binning.py | https://github.com/DarkEnergySurvey/ugali/blob/21e890b4117fc810afb6fb058e8055d564f03382/ugali/utils/binning.py#L177-L291 | def fast_kde(x, y, gridsize=(200,200), extents=None, nocorrelation=False, weights=None):
"""
Performs a gaussian kernel density estimate over a regular grid using a
convolution of the gaussian kernel with a 2D histogram of the data.
This function is typically several orders of magnitude faster than
scipy.stats.kde.gaussian_kde for large (>1e7) numbers of points and
produces an essentially identical result.
Input:
x: The x-coords of the input data points
y: The y-coords of the input data points
gridsize: (default: 200x200) A (nx,ny) tuple of the size of the output
grid
extents: (default: extent of input data) A (xmin, xmax, ymin, ymax)
tuple of the extents of output grid
nocorrelation: (default: False) If True, the correlation between the
x and y coords will be ignored when preforming the KDE.
weights: (default: None) An array of the same shape as x & y that
weighs each sample (x_i, y_i) by each value in weights (w_i).
Defaults to an array of ones the same size as x & y.
Output:
A gridded 2D kernel density estimate of the input points.
"""
#---- Setup --------------------------------------------------------------
x, y = np.asarray(x), np.asarray(y)
x, y = np.squeeze(x), np.squeeze(y)
if x.size != y.size:
raise ValueError('Input x & y arrays must be the same size!')
nx, ny = gridsize
n = x.size
if weights is None:
# Default: Weight all points equally
weights = np.ones(n)
else:
weights = np.squeeze(np.asarray(weights))
if weights.size != x.size:
raise ValueError('Input weights must be an array of the same size'
' as input x & y arrays!')
# Default extents are the extent of the data
if extents is None:
xmin, xmax = x.min(), x.max()
ymin, ymax = y.min(), y.max()
else:
xmin, xmax, ymin, ymax = list(map(float, extents))
dx = (xmax - xmin) / (nx - 1)
dy = (ymax - ymin) / (ny - 1)
#---- Preliminary Calculations -------------------------------------------
# First convert x & y over to pixel coordinates
# (Avoiding np.digitize due to excessive memory usage in numpy < v1.5!)
# http://stackoverflow.com/q/8805601/
xyi = np.vstack((x,y)).T
xyi -= [xmin, ymin]
xyi /= [dx, dy]
xyi = np.floor(xyi, xyi).T
# Next, make a 2D histogram of x & y
# Avoiding np.histogram2d due to excessive memory usage with many points
# http://stackoverflow.com/q/8805601/
grid = sp.sparse.coo_matrix((weights, xyi), shape=(nx, ny)).toarray()
# Calculate the covariance matrix (in pixel coords)
cov = np.cov(xyi)
if nocorrelation:
cov[1,0] = 0
cov[0,1] = 0
# Scaling factor for bandwidth
scotts_factor = np.power(n, -1.0 / 6) # For 2D
#---- Make the gaussian kernel -------------------------------------------
# First, determine how big the kernel needs to be
std_devs = np.diag(np.sqrt(cov))
kern_nx, kern_ny = np.round(scotts_factor * 2 * np.pi * std_devs)
# Determine the bandwidth to use for the gaussian kernel
inv_cov = np.linalg.inv(cov * scotts_factor**2)
# x & y (pixel) coords of the kernel grid, with <x,y> = <0,0> in center
xx = np.arange(kern_nx, dtype=np.float) - kern_nx / 2.0
yy = np.arange(kern_ny, dtype=np.float) - kern_ny / 2.0
xx, yy = np.meshgrid(xx, yy)
# Then evaluate the gaussian function on the kernel grid
kernel = np.vstack((xx.flatten(), yy.flatten()))
kernel = np.dot(inv_cov, kernel) * kernel
kernel = np.sum(kernel, axis=0) / 2.0
kernel = np.exp(-kernel)
kernel = kernel.reshape((kern_ny, kern_nx))
#---- Produce the kernel density estimate --------------------------------
# Convolve the gaussian kernel with the 2D histogram, producing a gaussian
# kernel density estimate on a regular grid
grid = sp.signal.convolve2d(grid, kernel, mode='same', boundary='fill').T
### ADW: Commented out for
### # Normalization factor to divide result by so that units are in the same
### # units as scipy.stats.kde.gaussian_kde's output.
### norm_factor = 2 * np.pi * cov * scotts_factor**2
### norm_factor = np.linalg.det(norm_factor)
### norm_factor = n * dx * dy * np.sqrt(norm_factor)
###
### # Normalize the result
### grid /= norm_factor
return grid | [
"def",
"fast_kde",
"(",
"x",
",",
"y",
",",
"gridsize",
"=",
"(",
"200",
",",
"200",
")",
",",
"extents",
"=",
"None",
",",
"nocorrelation",
"=",
"False",
",",
"weights",
"=",
"None",
")",
":",
"#---- Setup -----------------------------------------------------... | Performs a gaussian kernel density estimate over a regular grid using a
convolution of the gaussian kernel with a 2D histogram of the data.
This function is typically several orders of magnitude faster than
scipy.stats.kde.gaussian_kde for large (>1e7) numbers of points and
produces an essentially identical result.
Input:
x: The x-coords of the input data points
y: The y-coords of the input data points
gridsize: (default: 200x200) A (nx,ny) tuple of the size of the output
grid
extents: (default: extent of input data) A (xmin, xmax, ymin, ymax)
tuple of the extents of output grid
nocorrelation: (default: False) If True, the correlation between the
x and y coords will be ignored when preforming the KDE.
weights: (default: None) An array of the same shape as x & y that
weighs each sample (x_i, y_i) by each value in weights (w_i).
Defaults to an array of ones the same size as x & y.
Output:
A gridded 2D kernel density estimate of the input points. | [
"Performs",
"a",
"gaussian",
"kernel",
"density",
"estimate",
"over",
"a",
"regular",
"grid",
"using",
"a",
"convolution",
"of",
"the",
"gaussian",
"kernel",
"with",
"a",
"2D",
"histogram",
"of",
"the",
"data",
"."
] | python | train |
vanheeringen-lab/gimmemotifs | gimmemotifs/rocmetrics.py | https://github.com/vanheeringen-lab/gimmemotifs/blob/1dc0572179e5d0c8f96958060133c1f8d92c6675/gimmemotifs/rocmetrics.py#L67-L95 | def recall_at_fdr(fg_vals, bg_vals, fdr_cutoff=0.1):
"""
Computes the recall at a specific FDR (default 10%).
Parameters
----------
fg_vals : array_like
The list of values for the positive set.
bg_vals : array_like
The list of values for the negative set.
fdr : float, optional
The FDR (between 0.0 and 1.0).
Returns
-------
recall : float
The recall at the specified FDR.
"""
if len(fg_vals) == 0:
return 0.0
y_true, y_score = values_to_labels(fg_vals, bg_vals)
precision, recall, _ = precision_recall_curve(y_true, y_score)
fdr = 1 - precision
cutoff_index = next(i for i, x in enumerate(fdr) if x <= fdr_cutoff)
return recall[cutoff_index] | [
"def",
"recall_at_fdr",
"(",
"fg_vals",
",",
"bg_vals",
",",
"fdr_cutoff",
"=",
"0.1",
")",
":",
"if",
"len",
"(",
"fg_vals",
")",
"==",
"0",
":",
"return",
"0.0",
"y_true",
",",
"y_score",
"=",
"values_to_labels",
"(",
"fg_vals",
",",
"bg_vals",
")",
... | Computes the recall at a specific FDR (default 10%).
Parameters
----------
fg_vals : array_like
The list of values for the positive set.
bg_vals : array_like
The list of values for the negative set.
fdr : float, optional
The FDR (between 0.0 and 1.0).
Returns
-------
recall : float
The recall at the specified FDR. | [
"Computes",
"the",
"recall",
"at",
"a",
"specific",
"FDR",
"(",
"default",
"10%",
")",
"."
] | python | train |
sanger-pathogens/ariba | ariba/ref_genes_getter.py | https://github.com/sanger-pathogens/ariba/blob/16a0b1916ce0e886bd22550ba2d648542977001b/ariba/ref_genes_getter.py#L462-L483 | def _fix_virulencefinder_fasta_file(cls, infile, outfile):
'''Some line breaks are missing in the FASTA files from
viruslence finder. Which means there are lines like this:
AAGATCCAATAACTGAAGATGTTGAACAAACAATTCATAATATTTATGGTCAATATGCTATTTTCGTTGA
AGGTGTTGCGCATTTACCTGGACATCTCTCTCCATTATTAAAAAAATTACTACTTAAATCTTTATAA>coa:1:BA000018.3
ATGAAAAAGCAAATAATTTCGCTAGGCGCATTAGCAGTTGCATCTAGCTTATTTACATGGGATAACAAAG
and therefore the sequences are messed up when we parse them. Also
one has a > at the end, then the seq name on the next line.
This function fixes the file by adding line breaks'''
with open(infile) as f_in, open(outfile, 'w') as f_out:
for line in f_in:
if line.startswith('>') or '>' not in line:
print(line, end='', file=f_out)
elif line.endswith('>\n'):
print('WARNING: found line with ">" at the end! Fixing. Line:' + line.rstrip() + ' in file ' + infile, file=sys.stderr)
print(line.rstrip('>\n'), file=f_out)
print('>', end='', file=f_out)
else:
print('WARNING: found line with ">" not at the start! Fixing. Line:' + line.rstrip() + ' in file ' + infile, file=sys.stderr)
line1, line2 = line.split('>')
print(line1, file=f_out)
print('>', line2, sep='', end='', file=f_out) | [
"def",
"_fix_virulencefinder_fasta_file",
"(",
"cls",
",",
"infile",
",",
"outfile",
")",
":",
"with",
"open",
"(",
"infile",
")",
"as",
"f_in",
",",
"open",
"(",
"outfile",
",",
"'w'",
")",
"as",
"f_out",
":",
"for",
"line",
"in",
"f_in",
":",
"if",
... | Some line breaks are missing in the FASTA files from
viruslence finder. Which means there are lines like this:
AAGATCCAATAACTGAAGATGTTGAACAAACAATTCATAATATTTATGGTCAATATGCTATTTTCGTTGA
AGGTGTTGCGCATTTACCTGGACATCTCTCTCCATTATTAAAAAAATTACTACTTAAATCTTTATAA>coa:1:BA000018.3
ATGAAAAAGCAAATAATTTCGCTAGGCGCATTAGCAGTTGCATCTAGCTTATTTACATGGGATAACAAAG
and therefore the sequences are messed up when we parse them. Also
one has a > at the end, then the seq name on the next line.
This function fixes the file by adding line breaks | [
"Some",
"line",
"breaks",
"are",
"missing",
"in",
"the",
"FASTA",
"files",
"from",
"viruslence",
"finder",
".",
"Which",
"means",
"there",
"are",
"lines",
"like",
"this",
":",
"AAGATCCAATAACTGAAGATGTTGAACAAACAATTCATAATATTTATGGTCAATATGCTATTTTCGTTGA",
"AGGTGTTGCGCATTTACCTGG... | python | train |
tethysplatform/condorpy | condorpy/htcondor_object_base.py | https://github.com/tethysplatform/condorpy/blob/a5aaaef0d73198f7d9756dda7abe98b4e209f1f4/condorpy/htcondor_object_base.py#L144-L159 | def remove(self, options=[], sub_job_num=None):
"""Removes a job from the job queue, or from being executed.
Args:
options (list of str, optional): A list of command line options for the condor_rm command. For
details on valid options see: http://research.cs.wisc.edu/htcondor/manual/current/condor_rm.html.
Defaults to an empty list.
job_num (int, optional): The number of sub_job to remove rather than the whole cluster. Defaults to None.
"""
args = ['condor_rm']
args.extend(options)
job_id = '%s.%s' % (self.cluster_id, sub_job_num) if sub_job_num else str(self.cluster_id)
args.append(job_id)
out, err = self._execute(args)
return out,err | [
"def",
"remove",
"(",
"self",
",",
"options",
"=",
"[",
"]",
",",
"sub_job_num",
"=",
"None",
")",
":",
"args",
"=",
"[",
"'condor_rm'",
"]",
"args",
".",
"extend",
"(",
"options",
")",
"job_id",
"=",
"'%s.%s'",
"%",
"(",
"self",
".",
"cluster_id",
... | Removes a job from the job queue, or from being executed.
Args:
options (list of str, optional): A list of command line options for the condor_rm command. For
details on valid options see: http://research.cs.wisc.edu/htcondor/manual/current/condor_rm.html.
Defaults to an empty list.
job_num (int, optional): The number of sub_job to remove rather than the whole cluster. Defaults to None. | [
"Removes",
"a",
"job",
"from",
"the",
"job",
"queue",
"or",
"from",
"being",
"executed",
"."
] | python | train |
shoebot/shoebot | extensions/gedit/gedit2-plugin/shoebotit/__init__.py | https://github.com/shoebot/shoebot/blob/d554c1765c1899fa25727c9fc6805d221585562b/extensions/gedit/gedit2-plugin/shoebotit/__init__.py#L295-L306 | def _create_view(self, name="shoebot-output"):
""" Create the gtk.TextView used for shell output """
view = gtk.TextView()
view.set_editable(False)
fontdesc = pango.FontDescription("Monospace")
view.modify_font(fontdesc)
view.set_name(name)
buff = view.get_buffer()
buff.create_tag('error', foreground='red')
return view | [
"def",
"_create_view",
"(",
"self",
",",
"name",
"=",
"\"shoebot-output\"",
")",
":",
"view",
"=",
"gtk",
".",
"TextView",
"(",
")",
"view",
".",
"set_editable",
"(",
"False",
")",
"fontdesc",
"=",
"pango",
".",
"FontDescription",
"(",
"\"Monospace\"",
")"... | Create the gtk.TextView used for shell output | [
"Create",
"the",
"gtk",
".",
"TextView",
"used",
"for",
"shell",
"output"
] | python | valid |
mkoura/dump2polarion | dump2polarion/dumper_cli.py | https://github.com/mkoura/dump2polarion/blob/f4bd24e9d5070e282aad15f1e8bb514c0525cd37/dump2polarion/dumper_cli.py#L79-L87 | def process_args(args):
"""Processes passed arguments."""
passed_args = args
if isinstance(args, argparse.Namespace):
passed_args = vars(passed_args)
elif hasattr(args, "to_dict"):
passed_args = passed_args.to_dict()
return Box(passed_args, frozen_box=True, default_box=True) | [
"def",
"process_args",
"(",
"args",
")",
":",
"passed_args",
"=",
"args",
"if",
"isinstance",
"(",
"args",
",",
"argparse",
".",
"Namespace",
")",
":",
"passed_args",
"=",
"vars",
"(",
"passed_args",
")",
"elif",
"hasattr",
"(",
"args",
",",
"\"to_dict\"",... | Processes passed arguments. | [
"Processes",
"passed",
"arguments",
"."
] | python | train |
zhmcclient/python-zhmcclient | zhmcclient/_session.py | https://github.com/zhmcclient/python-zhmcclient/blob/9657563e5d9184c51d3c903442a58b9725fdf335/zhmcclient/_session.py#L58-L75 | def _handle_request_exc(exc, retry_timeout_config):
"""
Handle a :exc:`request.exceptions.RequestException` exception that was
raised.
"""
if isinstance(exc, requests.exceptions.ConnectTimeout):
raise ConnectTimeout(_request_exc_message(exc), exc,
retry_timeout_config.connect_timeout,
retry_timeout_config.connect_retries)
elif isinstance(exc, requests.exceptions.ReadTimeout):
raise ReadTimeout(_request_exc_message(exc), exc,
retry_timeout_config.read_timeout,
retry_timeout_config.read_retries)
elif isinstance(exc, requests.exceptions.RetryError):
raise RetriesExceeded(_request_exc_message(exc), exc,
retry_timeout_config.connect_retries)
else:
raise ConnectionError(_request_exc_message(exc), exc) | [
"def",
"_handle_request_exc",
"(",
"exc",
",",
"retry_timeout_config",
")",
":",
"if",
"isinstance",
"(",
"exc",
",",
"requests",
".",
"exceptions",
".",
"ConnectTimeout",
")",
":",
"raise",
"ConnectTimeout",
"(",
"_request_exc_message",
"(",
"exc",
")",
",",
... | Handle a :exc:`request.exceptions.RequestException` exception that was
raised. | [
"Handle",
"a",
":",
"exc",
":",
"request",
".",
"exceptions",
".",
"RequestException",
"exception",
"that",
"was",
"raised",
"."
] | python | train |
etcher-be/emiz | emiz/avwx/core.py | https://github.com/etcher-be/emiz/blob/1c3e32711921d7e600e85558ffe5d337956372de/emiz/avwx/core.py#L104-L125 | def make_number(num: str, repr_: str = None, speak: str = None):
"""
Returns a Number or Fraction dataclass for a number string
"""
if not num or is_unknown(num):
return
# Check CAVOK
if num == 'CAVOK':
return Number('CAVOK', 9999, 'ceiling and visibility ok') # type: ignore
# Check special
if num in SPECIAL_NUMBERS:
return Number(repr_ or num, None, SPECIAL_NUMBERS[num]) # type: ignore
# Create Fraction
if '/' in num:
nmr, dnm = [int(i) for i in num.split('/')]
unpacked = unpack_fraction(num)
spoken = spoken_number(unpacked)
return Fraction(repr_ or num, nmr / dnm, spoken, nmr, dnm, unpacked) # type: ignore
# Create Number
val = num.replace('M', '-')
val = float(val) if '.' in num else int(val) # type: ignore
return Number(repr_ or num, val, spoken_number(speak or str(val))) | [
"def",
"make_number",
"(",
"num",
":",
"str",
",",
"repr_",
":",
"str",
"=",
"None",
",",
"speak",
":",
"str",
"=",
"None",
")",
":",
"if",
"not",
"num",
"or",
"is_unknown",
"(",
"num",
")",
":",
"return",
"# Check CAVOK",
"if",
"num",
"==",
"'CAVO... | Returns a Number or Fraction dataclass for a number string | [
"Returns",
"a",
"Number",
"or",
"Fraction",
"dataclass",
"for",
"a",
"number",
"string"
] | python | train |
gbowerman/azurerm | azurerm/networkrp.py | https://github.com/gbowerman/azurerm/blob/79d40431d3b13f8a36aadbff5029888383d72674/azurerm/networkrp.py#L383-L398 | def get_network_usage(access_token, subscription_id, location):
'''List network usage and limits for a location.
Args:
access_token (str): A valid Azure authentication token.
subscription_id (str): Azure subscription id.
location (str): Azure data center location. E.g. westus.
Returns:
HTTP response. JSON body of network usage.
'''
endpoint = ''.join([get_rm_endpoint(),
'/subscriptions/', subscription_id,
'/providers/Microsoft.Network/locations/', location,
'/usages?api-version=', NETWORK_API])
return do_get(endpoint, access_token) | [
"def",
"get_network_usage",
"(",
"access_token",
",",
"subscription_id",
",",
"location",
")",
":",
"endpoint",
"=",
"''",
".",
"join",
"(",
"[",
"get_rm_endpoint",
"(",
")",
",",
"'/subscriptions/'",
",",
"subscription_id",
",",
"'/providers/Microsoft.Network/locat... | List network usage and limits for a location.
Args:
access_token (str): A valid Azure authentication token.
subscription_id (str): Azure subscription id.
location (str): Azure data center location. E.g. westus.
Returns:
HTTP response. JSON body of network usage. | [
"List",
"network",
"usage",
"and",
"limits",
"for",
"a",
"location",
"."
] | python | train |
cmheisel/basecampreporting | src/basecampreporting/basecamp.py | https://github.com/cmheisel/basecampreporting/blob/88ecfc6e835608650ff6be23cbf2421d224c122b/src/basecampreporting/basecamp.py#L409-L425 | def create_todo_item(self, list_id, content, party_id=None, notify=False):
"""
This call lets you add an item to an existing list. The item is added
to the bottom of the list. If a person is responsible for the item,
give their id as the party_id value. If a company is responsible,
prefix their company id with a 'c' and use that as the party_id value.
If the item has a person as the responsible party, you can use the
notify key to indicate whether an email should be sent to that person
to tell them about the assignment.
"""
path = '/todos/create_item/%u' % list_id
req = ET.Element('request')
ET.SubElement(req, 'content').text = str(content)
if party_id is not None:
ET.SubElement(req, 'responsible-party').text = str(party_id)
ET.SubElement(req, 'notify').text = str(bool(notify)).lower()
return self._request(path, req) | [
"def",
"create_todo_item",
"(",
"self",
",",
"list_id",
",",
"content",
",",
"party_id",
"=",
"None",
",",
"notify",
"=",
"False",
")",
":",
"path",
"=",
"'/todos/create_item/%u'",
"%",
"list_id",
"req",
"=",
"ET",
".",
"Element",
"(",
"'request'",
")",
... | This call lets you add an item to an existing list. The item is added
to the bottom of the list. If a person is responsible for the item,
give their id as the party_id value. If a company is responsible,
prefix their company id with a 'c' and use that as the party_id value.
If the item has a person as the responsible party, you can use the
notify key to indicate whether an email should be sent to that person
to tell them about the assignment. | [
"This",
"call",
"lets",
"you",
"add",
"an",
"item",
"to",
"an",
"existing",
"list",
".",
"The",
"item",
"is",
"added",
"to",
"the",
"bottom",
"of",
"the",
"list",
".",
"If",
"a",
"person",
"is",
"responsible",
"for",
"the",
"item",
"give",
"their",
"... | python | train |
ska-sa/katcp-python | katcp/core.py | https://github.com/ska-sa/katcp-python/blob/9127c826a1d030c53b84d0e95743e20e5c5ea153/katcp/core.py#L1311-L1326 | def set(self, timestamp, status, value):
"""Set the current value of the sensor.
Parameters
----------
timestamp : float in seconds
The time at which the sensor value was determined.
status : Sensor status constant
Whether the value represents an error condition or not.
value : object
The value of the sensor (the type should be appropriate to the
sensor's type).
"""
reading = self._current_reading = Reading(timestamp, status, value)
self.notify(reading) | [
"def",
"set",
"(",
"self",
",",
"timestamp",
",",
"status",
",",
"value",
")",
":",
"reading",
"=",
"self",
".",
"_current_reading",
"=",
"Reading",
"(",
"timestamp",
",",
"status",
",",
"value",
")",
"self",
".",
"notify",
"(",
"reading",
")"
] | Set the current value of the sensor.
Parameters
----------
timestamp : float in seconds
The time at which the sensor value was determined.
status : Sensor status constant
Whether the value represents an error condition or not.
value : object
The value of the sensor (the type should be appropriate to the
sensor's type). | [
"Set",
"the",
"current",
"value",
"of",
"the",
"sensor",
"."
] | python | train |
bitesofcode/projexui | projexui/widgets/xcombobox.py | https://github.com/bitesofcode/projexui/blob/f18a73bec84df90b034ca69b9deea118dbedfc4d/projexui/widgets/xcombobox.py#L500-L527 | def showPopup( self ):
"""
Displays a custom popup widget for this system if a checkable state \
is setup.
"""
if not self.isCheckable():
return super(XComboBox, self).showPopup()
if not self.isVisible():
return
# update the checkable widget popup
point = self.mapToGlobal(QPoint(0, self.height() - 1))
popup = self.checkablePopup()
popup.setModel(self.model())
popup.move(point)
popup.setFixedWidth(self.width())
height = (self.count() * 19) + 2
if height > 400:
height = 400
popup.setVerticalScrollBarPolicy(Qt.ScrollBarAlwaysOn)
else:
popup.setVerticalScrollBarPolicy(Qt.ScrollBarAlwaysOff)
popup.setFixedHeight(height)
popup.show()
popup.raise_() | [
"def",
"showPopup",
"(",
"self",
")",
":",
"if",
"not",
"self",
".",
"isCheckable",
"(",
")",
":",
"return",
"super",
"(",
"XComboBox",
",",
"self",
")",
".",
"showPopup",
"(",
")",
"if",
"not",
"self",
".",
"isVisible",
"(",
")",
":",
"return",
"#... | Displays a custom popup widget for this system if a checkable state \
is setup. | [
"Displays",
"a",
"custom",
"popup",
"widget",
"for",
"this",
"system",
"if",
"a",
"checkable",
"state",
"\\",
"is",
"setup",
"."
] | python | train |
goshuirc/irc | girc/client.py | https://github.com/goshuirc/irc/blob/d6a5e3e04d337566c009b087f108cd76f9e122cc/girc/client.py#L369-L374 | def join_channel(self, channel, key=None, tags=None):
"""Join the given channel."""
params = [channel]
if key:
params.append(key)
self.send('JOIN', params=params, tags=tags) | [
"def",
"join_channel",
"(",
"self",
",",
"channel",
",",
"key",
"=",
"None",
",",
"tags",
"=",
"None",
")",
":",
"params",
"=",
"[",
"channel",
"]",
"if",
"key",
":",
"params",
".",
"append",
"(",
"key",
")",
"self",
".",
"send",
"(",
"'JOIN'",
"... | Join the given channel. | [
"Join",
"the",
"given",
"channel",
"."
] | python | train |
quantmind/pulsar-odm | odm/mapper.py | https://github.com/quantmind/pulsar-odm/blob/5955c20beca0a89270c2b390335838deb7d5915e/odm/mapper.py#L327-L336 | def table_create(self, remove_existing=False):
"""Creates all tables.
"""
for engine in self.engines():
tables = self._get_tables(engine, create_drop=True)
logger.info('Create all tables for %s', engine)
try:
self.metadata.create_all(engine, tables=tables)
except Exception as exc:
raise | [
"def",
"table_create",
"(",
"self",
",",
"remove_existing",
"=",
"False",
")",
":",
"for",
"engine",
"in",
"self",
".",
"engines",
"(",
")",
":",
"tables",
"=",
"self",
".",
"_get_tables",
"(",
"engine",
",",
"create_drop",
"=",
"True",
")",
"logger",
... | Creates all tables. | [
"Creates",
"all",
"tables",
"."
] | python | train |
DarkEnergySurvey/ugali | ugali/scratch/simulation/simulate_population.py | https://github.com/DarkEnergySurvey/ugali/blob/21e890b4117fc810afb6fb058e8055d564f03382/ugali/scratch/simulation/simulate_population.py#L103-L241 | def catsimSatellite(config, lon_centroid, lat_centroid, distance, stellar_mass, r_physical,
m_maglim_1, m_maglim_2, m_ebv,
plot=False, title='test'):
"""
Simulate a single satellite. This is currently only valid for band_1 = g and band_2 = r.
r_physical is azimuthally averaged half-light radius, kpc
"""
# Probably don't want to parse every time
completeness = getCompleteness(config)
log_photo_error = getPhotoError(config)
s = ugali.analysis.source.Source()
# Following McConnachie 2012, ellipticity = 1 - (b/a) , where a is semi-major axis and b is semi-minor axis
r_h = np.degrees(np.arcsin(r_physical / distance)) # Azimuthally averaged half-light radius
#ellipticity = 0.3 # Semi-arbitrary default for testing purposes
# See http://iopscience.iop.org/article/10.3847/1538-4357/833/2/167/pdf
# Based loosely on https://arxiv.org/abs/0805.2945
ellipticity = np.random.uniform(0.1, 0.8)
position_angle = np.random.uniform(0., 180.) # Random position angle (deg)
a_h = r_h / np.sqrt(1. - ellipticity) # semi-major axis (deg)
# Elliptical kernels take the "extension" as the semi-major axis
ker = ugali.analysis.kernel.EllipticalPlummer(lon=lon_centroid, lat=lat_centroid, ellipticity=ellipticity, position_angle=position_angle)
flag_too_extended = False
if a_h >= 1.0:
print 'Too extended: a_h = %.2f'%(a_h)
a_h = 1.0
flag_too_extended = True
ker.setp('extension', value=a_h, bounds=[0.0,1.0])
s.set_kernel(ker)
age = np.random.choice([10., 12.0, 13.5])
metal_z = np.random.choice([0.0001, 0.0002])
distance_modulus = ugali.utils.projector.distanceToDistanceModulus(distance)
iso = isochrone_factory('Bressan2012', survey=config['survey'], age=age, z=metal_z, distance_modulus=distance_modulus)
s.set_isochrone(iso)
# Simulate takes stellar mass as an argument, NOT richness
mag_1, mag_2 = s.isochrone.simulate(stellar_mass)
lon, lat = s.kernel.sample_lonlat(len(mag_2))
nside = healpy.npix2nside(len(m_maglim_1)) # Assuming that the two maglim maps have same resolution
pix = ugali.utils.healpix.angToPix(nside, lon, lat)
maglim_1 = m_maglim_1[pix]
maglim_2 = m_maglim_2[pix]
if config['survey'] == 'des':
# DES Y3 Gold fiducial
mag_extinction_1 = 3.186 * m_ebv[pix]
mag_extinction_2 = 2.140 * m_ebv[pix]
elif config['survey'] == 'ps1':
# From Table 6 in Schlafly 2011 with Rv = 3.1
# http://iopscience.iop.org/article/10.1088/0004-637X/737/2/103/pdf
mag_extinction_1 = 3.172 * m_ebv[pix]
mag_extinction_2 = 2.271 * m_ebv[pix]
# Photometric uncertainties are larger in the presence of interstellar dust reddening
mag_1_error = 0.01 + 10**(log_photo_error((mag_1 + mag_extinction_1) - maglim_1))
mag_2_error = 0.01 + 10**(log_photo_error((mag_2 + mag_extinction_2) - maglim_2))
# It would be better to convert to a flux uncertainty and then transform back to a magnitude
#mag_1_meas = mag_1 + np.random.normal(scale=mag_1_error)
#mag_2_meas = mag_2 + np.random.normal(scale=mag_2_error)
flux_1_meas = magToFlux(mag_1) + np.random.normal(scale=getFluxError(mag_1, mag_1_error))
mag_1_meas = np.where(flux_1_meas > 0., fluxToMag(flux_1_meas), 99.)
flux_2_meas = magToFlux(mag_2) + np.random.normal(scale=getFluxError(mag_2, mag_2_error))
mag_2_meas = np.where(flux_2_meas > 0., fluxToMag(flux_2_meas), 99.)
# In the HSC SXDS ultra-deep field:
# mean maglim_r_sof_gold_2.0 = 23.46
# median maglim_r_sof_gold_2.0 = 23.47
# m = healpy.read_map('/Users/keithbechtol/Documents/DES/projects/mw_substructure/des/y3a1/data/maps/y3a2_gold_1.0_cmv02-001_v1_nside4096_nest_r_depth.fits.gz')
# np.mean(m[ugali.utils.healpix.angToDisc(4096, 34.55, -4.83, 0.75)])
# np.median(m[ugali.utils.healpix.angToDisc(4096, 34.55, -4.83, 0.75)])
# Includes penalty for interstellar extinction and also include variations in depth
if config['survey'] == 'des':
cut_detect = (np.random.uniform(size=len(mag_2)) < completeness(mag_2 + mag_extinction_2 + (23.46 - np.clip(maglim_2, 20., 26.))))
elif config['survey'] == 'ps1':
cut_detect = (np.random.uniform(size=len(mag_2)) < completeness(mag_2 + mag_extinction_2))
n_g22 = np.sum(cut_detect & (mag_1 < 22.))
n_g24 = np.sum(cut_detect & (mag_1 < 24.))
print ' n_sim = %i, n_detect = %i, n_g24 = %i, n_g22 = %i'%(len(mag_1),np.sum(cut_detect),n_g24,n_g22)
richness = stellar_mass / s.isochrone.stellarMass()
#abs_mag = s.isochrone.absolute_magnitude()
#abs_mag_martin = s.isochrone.absolute_magnitude_martin(richness=richness, n_trials=10)[0] # 100 trials seems to be sufficient for rough estimate
#print 'abs_mag_martin = %.2f mag'%(abs_mag_martin)
# The more clever thing to do would be to sum up the actual simulated stars
if config['survey'] == 'des':
v = mag_1 - 0.487*(mag_1 - mag_2) - 0.0249 # See https://github.com/DarkEnergySurvey/ugali/blob/master/ugali/isochrone/model.py
elif config['survey'] == 'ps1':
# https://arxiv.org/pdf/1706.06147.pdf
# V - g = C_0 + C_1 * (g - r)
C_0 = -0.017
C_1 = -0.508
v = mag_1 + C_0 + C_1 * (mag_1 - mag_2)
flux = np.sum(10**(-v/2.5))
abs_mag = -2.5*np.log10(flux) - distance_modulus
#print abs_mag, abs_mag_martin
#distance = ugali.utils.projector.distanceModulusToDistance(distance_modulus)
#r_h = extension * np.sqrt(1. - ellipticity) # Azimuthally averaged half-light radius
r_physical = distance * np.tan(np.radians(r_h)) # Azimuthally averaged half-light radius, kpc
#print 'distance = %.3f kpc'%(distance)
#print 'r_physical = %.3f kpc'%(r_physical)
surface_brightness = ugali.analysis.results.surfaceBrightness(abs_mag, r_physical, distance) # Average within azimuthally averaged half-light radius
#print 'surface_brightness = %.3f mag arcsec^-2'%(surface_brightness)
if plot:
import pylab
pylab.ion()
n_sigma_p = np.sum(cut_detect & (mag_1 < 23.))
pylab.figure(figsize=(6., 6.))
pylab.scatter(mag_1_meas[cut_detect] - mag_2_meas[cut_detect], mag_1_meas[cut_detect], edgecolor='none', c='black', s=5)
pylab.xlim(-0.5, 1.)
pylab.ylim(26., 16.)
pylab.xlabel('g - r')
pylab.ylabel('g')
pylab.title('Number of stars with g < 23: %i'%(n_sigma_p))
pylab.savefig('y3_sat_sim_cmd_%s.png'%(title), dpi=150.)
print 'n_Sigma_p = %i'%(n_sigma_p)
raw_input('WAIT')
#if flag_too_extended:
# # This is a kludge to remove these satellites. fragile!!
# n_g24 = 1.e6
return lon[cut_detect], lat[cut_detect], mag_1_meas[cut_detect], mag_2_meas[cut_detect], mag_1_error[cut_detect], mag_2_error[cut_detect], mag_extinction_1[cut_detect], mag_extinction_2[cut_detect], n_g22, n_g24, abs_mag, surface_brightness, ellipticity, position_angle, age, metal_z, flag_too_extended | [
"def",
"catsimSatellite",
"(",
"config",
",",
"lon_centroid",
",",
"lat_centroid",
",",
"distance",
",",
"stellar_mass",
",",
"r_physical",
",",
"m_maglim_1",
",",
"m_maglim_2",
",",
"m_ebv",
",",
"plot",
"=",
"False",
",",
"title",
"=",
"'test'",
")",
":",
... | Simulate a single satellite. This is currently only valid for band_1 = g and band_2 = r.
r_physical is azimuthally averaged half-light radius, kpc | [
"Simulate",
"a",
"single",
"satellite",
".",
"This",
"is",
"currently",
"only",
"valid",
"for",
"band_1",
"=",
"g",
"and",
"band_2",
"=",
"r",
".",
"r_physical",
"is",
"azimuthally",
"averaged",
"half",
"-",
"light",
"radius",
"kpc"
] | python | train |
churchill-lab/emase | emase/AlignmentPropertyMatrix.py | https://github.com/churchill-lab/emase/blob/ae3c6955bb175c1dec88dbf9fac1a7dcc16f4449/emase/AlignmentPropertyMatrix.py#L299-L317 | def get_unique_reads(self, ignore_haplotype=False, shallow=False):
"""
Pull out alignments of uniquely-aligning reads
:param ignore_haplotype: whether to regard allelic multiread as uniquely-aligning read
:param shallow: whether to copy sparse 3D matrix only or not
:return: a new AlignmentPropertyMatrix object that particular reads are
"""
if self.finalized:
if ignore_haplotype:
summat = self.sum(axis=self.Axis.HAPLOTYPE)
nnz_per_read = np.diff(summat.tocsr().indptr)
unique_reads = np.logical_and(nnz_per_read > 0, nnz_per_read < 2)
else: # allelic multireads should be removed
alncnt_per_read = self.sum(axis=self.Axis.LOCUS).sum(axis=self.Axis.HAPLOTYPE)
unique_reads = np.logical_and(alncnt_per_read > 0, alncnt_per_read < 2)
return self.pull_alignments_from(unique_reads, shallow=shallow)
else:
raise RuntimeError('The matrix is not finalized.') | [
"def",
"get_unique_reads",
"(",
"self",
",",
"ignore_haplotype",
"=",
"False",
",",
"shallow",
"=",
"False",
")",
":",
"if",
"self",
".",
"finalized",
":",
"if",
"ignore_haplotype",
":",
"summat",
"=",
"self",
".",
"sum",
"(",
"axis",
"=",
"self",
".",
... | Pull out alignments of uniquely-aligning reads
:param ignore_haplotype: whether to regard allelic multiread as uniquely-aligning read
:param shallow: whether to copy sparse 3D matrix only or not
:return: a new AlignmentPropertyMatrix object that particular reads are | [
"Pull",
"out",
"alignments",
"of",
"uniquely",
"-",
"aligning",
"reads",
":",
"param",
"ignore_haplotype",
":",
"whether",
"to",
"regard",
"allelic",
"multiread",
"as",
"uniquely",
"-",
"aligning",
"read",
":",
"param",
"shallow",
":",
"whether",
"to",
"copy",... | python | valid |
pmacosta/pexdoc | pexdoc/exh.py | https://github.com/pmacosta/pexdoc/blob/201ac243e5781347feb75896a4231429fe6da4b1/pexdoc/exh.py#L1280-L1305 | def encode_call(self, call):
"""
Replace callables with tokens to reduce object memory footprint.
A callable token is an integer that denotes the order in which the
callable was encountered by the encoder, i.e. the first callable
encoded is assigned token 0, the second callable encoded is assigned
token 1, etc.
:param call: Callable name
:type call: string
:rtype: string
"""
# Callable name is None when callable is part of exclude list
if call is None:
return None
itokens = call.split(self._callables_separator)
otokens = []
for itoken in itokens:
otoken = self._clut.get(itoken, None)
if not otoken:
otoken = str(len(self._clut))
self._clut[itoken] = otoken
otokens.append(otoken)
return self._callables_separator.join(otokens) | [
"def",
"encode_call",
"(",
"self",
",",
"call",
")",
":",
"# Callable name is None when callable is part of exclude list",
"if",
"call",
"is",
"None",
":",
"return",
"None",
"itokens",
"=",
"call",
".",
"split",
"(",
"self",
".",
"_callables_separator",
")",
"otok... | Replace callables with tokens to reduce object memory footprint.
A callable token is an integer that denotes the order in which the
callable was encountered by the encoder, i.e. the first callable
encoded is assigned token 0, the second callable encoded is assigned
token 1, etc.
:param call: Callable name
:type call: string
:rtype: string | [
"Replace",
"callables",
"with",
"tokens",
"to",
"reduce",
"object",
"memory",
"footprint",
"."
] | python | train |
timothyhahn/rui | rui/rui.py | https://github.com/timothyhahn/rui/blob/ac9f587fb486760d77332866c6e876f78a810f74/rui/rui.py#L215-L223 | def set_tag(self, tag):
'''
Sets the tag.
If the Entity belongs to the world it will check for tag conflicts.
'''
if self._world:
if self._world.get_entity_by_tag(tag):
raise NonUniqueTagError(tag)
self._tag = tag | [
"def",
"set_tag",
"(",
"self",
",",
"tag",
")",
":",
"if",
"self",
".",
"_world",
":",
"if",
"self",
".",
"_world",
".",
"get_entity_by_tag",
"(",
"tag",
")",
":",
"raise",
"NonUniqueTagError",
"(",
"tag",
")",
"self",
".",
"_tag",
"=",
"tag"
] | Sets the tag.
If the Entity belongs to the world it will check for tag conflicts. | [
"Sets",
"the",
"tag",
".",
"If",
"the",
"Entity",
"belongs",
"to",
"the",
"world",
"it",
"will",
"check",
"for",
"tag",
"conflicts",
"."
] | python | train |
NAMD/pypln.api | pypln/api.py | https://github.com/NAMD/pypln.api/blob/ccb73fd80ca094669a85bd3991dc84a8564ab016/pypln/api.py#L239-L264 | def _retrieve_resources(self, url, class_, full):
'''Retrieve HTTP resources, return related objects (with pagination)'''
objects_to_return = []
response = self.session.get(url)
if response.status_code == 200:
result = response.json()
resources = result['results']
objects_to_return.extend([class_(session=self.session, **resource)
for resource in resources])
while full and result['next'] is not None:
response = self.session.get(result['next'])
if response.status_code == 200:
result = response.json()
resources = result['results']
objects_to_return.extend([class_(session=self.session,
**resource)
for resource in resources])
else:
raise RuntimeError("Failed downloading data with status {}"
". The response was: '{}'"
.format(response.status_code, response.text))
return objects_to_return
else:
raise RuntimeError("Failed downloading data with status {}"
". The response was: '{}'"
.format(response.status_code, response.text)) | [
"def",
"_retrieve_resources",
"(",
"self",
",",
"url",
",",
"class_",
",",
"full",
")",
":",
"objects_to_return",
"=",
"[",
"]",
"response",
"=",
"self",
".",
"session",
".",
"get",
"(",
"url",
")",
"if",
"response",
".",
"status_code",
"==",
"200",
":... | Retrieve HTTP resources, return related objects (with pagination) | [
"Retrieve",
"HTTP",
"resources",
"return",
"related",
"objects",
"(",
"with",
"pagination",
")"
] | python | train |
tBaxter/tango-shared-core | build/lib/tango_shared/templatetags/formatting.py | https://github.com/tBaxter/tango-shared-core/blob/35fc10aef1ceedcdb4d6d866d44a22efff718812/build/lib/tango_shared/templatetags/formatting.py#L12-L22 | def replace(value, arg):
"""
Replaces one string with another in a given string
usage: {{ foo|replace:"aaa|xxx"}}
"""
replacement = arg.split('|')
try:
return value.replace(replacement[0], replacement[1])
except:
return value | [
"def",
"replace",
"(",
"value",
",",
"arg",
")",
":",
"replacement",
"=",
"arg",
".",
"split",
"(",
"'|'",
")",
"try",
":",
"return",
"value",
".",
"replace",
"(",
"replacement",
"[",
"0",
"]",
",",
"replacement",
"[",
"1",
"]",
")",
"except",
":",... | Replaces one string with another in a given string
usage: {{ foo|replace:"aaa|xxx"}} | [
"Replaces",
"one",
"string",
"with",
"another",
"in",
"a",
"given",
"string",
"usage",
":",
"{{",
"foo|replace",
":",
"aaa|xxx",
"}}"
] | python | train |
dranjan/python-plyfile | examples/plot.py | https://github.com/dranjan/python-plyfile/blob/9f8e8708d3a071229cf292caae7d13264e11c88b/examples/plot.py#L27-L51 | def plot(ply):
'''
Plot vertices and triangles from a PlyData instance. Assumptions:
`ply' has a 'vertex' element with 'x', 'y', and 'z'
properties;
`ply' has a 'face' element with an integral list property
'vertex_indices', all of whose elements have length 3.
'''
vertex = ply['vertex']
(x, y, z) = (vertex[t] for t in ('x', 'y', 'z'))
mlab.points3d(x, y, z, color=(1, 1, 1), mode='point')
if 'face' in ply:
tri_idx = ply['face']['vertex_indices']
idx_dtype = tri_idx[0].dtype
triangles = numpy.fromiter(tri_idx, [('data', idx_dtype, (3,))],
count=len(tri_idx))['data']
mlab.triangular_mesh(x, y, z, triangles,
color=(1, 0, 0.4), opacity=0.5) | [
"def",
"plot",
"(",
"ply",
")",
":",
"vertex",
"=",
"ply",
"[",
"'vertex'",
"]",
"(",
"x",
",",
"y",
",",
"z",
")",
"=",
"(",
"vertex",
"[",
"t",
"]",
"for",
"t",
"in",
"(",
"'x'",
",",
"'y'",
",",
"'z'",
")",
")",
"mlab",
".",
"points3d",
... | Plot vertices and triangles from a PlyData instance. Assumptions:
`ply' has a 'vertex' element with 'x', 'y', and 'z'
properties;
`ply' has a 'face' element with an integral list property
'vertex_indices', all of whose elements have length 3. | [
"Plot",
"vertices",
"and",
"triangles",
"from",
"a",
"PlyData",
"instance",
".",
"Assumptions",
":",
"ply",
"has",
"a",
"vertex",
"element",
"with",
"x",
"y",
"and",
"z",
"properties",
";"
] | python | train |
materialsproject/pymatgen | pymatgen/core/structure.py | https://github.com/materialsproject/pymatgen/blob/4ca558cf72f8d5f8a1f21dfdfc0181a971c186da/pymatgen/core/structure.py#L463-L482 | def add_spin_by_site(self, spins):
"""
Add spin states to a structure by site.
Args:
spins (list): List of spins
E.g., [+5, -5, 0, 0]
"""
if len(spins) != len(self.sites):
raise ValueError("Spin of all sites must be "
"specified in the dictionary.")
for site, spin in zip(self.sites, spins):
new_sp = {}
for sp, occu in site.species.items():
sym = sp.symbol
oxi_state = getattr(sp, "oxi_state", None)
new_sp[Specie(sym, oxidation_state=oxi_state,
properties={'spin': spin})] = occu
site.species = new_sp | [
"def",
"add_spin_by_site",
"(",
"self",
",",
"spins",
")",
":",
"if",
"len",
"(",
"spins",
")",
"!=",
"len",
"(",
"self",
".",
"sites",
")",
":",
"raise",
"ValueError",
"(",
"\"Spin of all sites must be \"",
"\"specified in the dictionary.\"",
")",
"for",
"sit... | Add spin states to a structure by site.
Args:
spins (list): List of spins
E.g., [+5, -5, 0, 0] | [
"Add",
"spin",
"states",
"to",
"a",
"structure",
"by",
"site",
"."
] | python | train |
tsileo/globster | globster.py | https://github.com/tsileo/globster/blob/9628bce60207b150d39b409cddc3fadb34e70841/globster.py#L60-L71 | def add(self, pat, fun):
r"""Add a pattern and replacement.
The pattern must not contain capturing groups.
The replacement might be either a string template in which \& will be
replaced with the match, or a function that will get the matching text
as argument. It does not get match object, because capturing is
forbidden anyway.
"""
self._pat = None
self._pats.append(pat)
self._funs.append(fun) | [
"def",
"add",
"(",
"self",
",",
"pat",
",",
"fun",
")",
":",
"self",
".",
"_pat",
"=",
"None",
"self",
".",
"_pats",
".",
"append",
"(",
"pat",
")",
"self",
".",
"_funs",
".",
"append",
"(",
"fun",
")"
] | r"""Add a pattern and replacement.
The pattern must not contain capturing groups.
The replacement might be either a string template in which \& will be
replaced with the match, or a function that will get the matching text
as argument. It does not get match object, because capturing is
forbidden anyway. | [
"r",
"Add",
"a",
"pattern",
"and",
"replacement",
"."
] | python | train |
deepmind/sonnet | sonnet/python/modules/pondering_rnn.py | https://github.com/deepmind/sonnet/blob/00612ca3178964d86b556e062694d808ff81fcca/sonnet/python/modules/pondering_rnn.py#L38-L47 | def _nested_unary_mul(nested_a, p):
"""Multiply `Tensors` in arbitrarily nested `Tensor` `nested_a` with `p`."""
def mul_with_broadcast(tensor):
ndims = tensor.shape.ndims
if ndims != 2:
p_reshaped = tf.reshape(p, [-1] + [1] * (ndims - 1))
return p_reshaped * tensor
else:
return p * tensor
return nest.map(mul_with_broadcast, nested_a) | [
"def",
"_nested_unary_mul",
"(",
"nested_a",
",",
"p",
")",
":",
"def",
"mul_with_broadcast",
"(",
"tensor",
")",
":",
"ndims",
"=",
"tensor",
".",
"shape",
".",
"ndims",
"if",
"ndims",
"!=",
"2",
":",
"p_reshaped",
"=",
"tf",
".",
"reshape",
"(",
"p",... | Multiply `Tensors` in arbitrarily nested `Tensor` `nested_a` with `p`. | [
"Multiply",
"Tensors",
"in",
"arbitrarily",
"nested",
"Tensor",
"nested_a",
"with",
"p",
"."
] | python | train |
odlgroup/odl | odl/solvers/nonsmooth/proximal_operators.py | https://github.com/odlgroup/odl/blob/b8443f6aca90e191ba36c91d32253c5a36249a6c/odl/solvers/nonsmooth/proximal_operators.py#L1934-L1993 | def proximal_huber(space, gamma):
"""Proximal factory of the Huber norm.
Parameters
----------
space : `TensorSpace`
The domain of the functional
gamma : float
The smoothing parameter of the Huber norm functional.
Returns
-------
prox_factory : function
Factory for the proximal operator to be initialized.
See Also
--------
odl.solvers.default_functionals.Huber : the Huber norm functional
Notes
-----
The proximal operator is given by given by the proximal operator of
``1/(2*gamma) * L2 norm`` in points that are ``<= gamma``, and by the
proximal operator of the l1 norm in points that are ``> gamma``.
"""
gamma = float(gamma)
class ProximalHuber(Operator):
"""Proximal operator of Huber norm."""
def __init__(self, sigma):
"""Initialize a new instance.
Parameters
----------
sigma : positive float
"""
self.sigma = float(sigma)
super(ProximalHuber, self).__init__(domain=space, range=space,
linear=False)
def _call(self, x, out):
"""Return ``self(x, out=out)``."""
if isinstance(self.domain, ProductSpace):
norm = PointwiseNorm(self.domain, 2)(x)
else:
norm = x.ufuncs.absolute()
mask = norm.ufuncs.less_equal(gamma + self.sigma)
out[mask] = gamma / (gamma + self.sigma) * x[mask]
mask.ufuncs.logical_not(out=mask)
sign_x = x.ufuncs.sign()
out[mask] = x[mask] - self.sigma * sign_x[mask]
return out
return ProximalHuber | [
"def",
"proximal_huber",
"(",
"space",
",",
"gamma",
")",
":",
"gamma",
"=",
"float",
"(",
"gamma",
")",
"class",
"ProximalHuber",
"(",
"Operator",
")",
":",
"\"\"\"Proximal operator of Huber norm.\"\"\"",
"def",
"__init__",
"(",
"self",
",",
"sigma",
")",
":"... | Proximal factory of the Huber norm.
Parameters
----------
space : `TensorSpace`
The domain of the functional
gamma : float
The smoothing parameter of the Huber norm functional.
Returns
-------
prox_factory : function
Factory for the proximal operator to be initialized.
See Also
--------
odl.solvers.default_functionals.Huber : the Huber norm functional
Notes
-----
The proximal operator is given by given by the proximal operator of
``1/(2*gamma) * L2 norm`` in points that are ``<= gamma``, and by the
proximal operator of the l1 norm in points that are ``> gamma``. | [
"Proximal",
"factory",
"of",
"the",
"Huber",
"norm",
"."
] | python | train |
google/importlab | importlab/graph.py | https://github.com/google/importlab/blob/92090a0b4421137d1369c2ed952eda6bb4c7a155/importlab/graph.py#L194-L200 | def get_all_unresolved(self):
"""Returns a set of all unresolved imports."""
assert self.final, 'Call build() before using the graph.'
out = set()
for v in self.broken_deps.values():
out |= v
return out | [
"def",
"get_all_unresolved",
"(",
"self",
")",
":",
"assert",
"self",
".",
"final",
",",
"'Call build() before using the graph.'",
"out",
"=",
"set",
"(",
")",
"for",
"v",
"in",
"self",
".",
"broken_deps",
".",
"values",
"(",
")",
":",
"out",
"|=",
"v",
... | Returns a set of all unresolved imports. | [
"Returns",
"a",
"set",
"of",
"all",
"unresolved",
"imports",
"."
] | python | train |
graphql-python/graphql-relay-py | graphql_relay/node/node.py | https://github.com/graphql-python/graphql-relay-py/blob/17ce2efa3c396df42791ae00667120b5fae64610/graphql_relay/node/node.py#L15-L49 | def node_definitions(id_fetcher, type_resolver=None, id_resolver=None):
'''
Given a function to map from an ID to an underlying object, and a function
to map from an underlying object to the concrete GraphQLObjectType it
corresponds to, constructs a `Node` interface that objects can implement,
and a field config for a `node` root field.
If the type_resolver is omitted, object resolution on the interface will be
handled with the `isTypeOf` method on object types, as with any GraphQL
interface without a provided `resolveType` method.
'''
node_interface = GraphQLInterfaceType(
'Node',
description='An object with an ID',
fields=lambda: OrderedDict((
('id', GraphQLField(
GraphQLNonNull(GraphQLID),
description='The id of the object.',
resolver=id_resolver,
)),
)),
resolve_type=type_resolver
)
node_field = GraphQLField(
node_interface,
description='Fetches an object given its ID',
args=OrderedDict((
('id', GraphQLArgument(
GraphQLNonNull(GraphQLID),
description='The ID of an object'
)),
)),
resolver=lambda obj, args, *_: id_fetcher(args.get('id'), *_)
)
return node_interface, node_field | [
"def",
"node_definitions",
"(",
"id_fetcher",
",",
"type_resolver",
"=",
"None",
",",
"id_resolver",
"=",
"None",
")",
":",
"node_interface",
"=",
"GraphQLInterfaceType",
"(",
"'Node'",
",",
"description",
"=",
"'An object with an ID'",
",",
"fields",
"=",
"lambda... | Given a function to map from an ID to an underlying object, and a function
to map from an underlying object to the concrete GraphQLObjectType it
corresponds to, constructs a `Node` interface that objects can implement,
and a field config for a `node` root field.
If the type_resolver is omitted, object resolution on the interface will be
handled with the `isTypeOf` method on object types, as with any GraphQL
interface without a provided `resolveType` method. | [
"Given",
"a",
"function",
"to",
"map",
"from",
"an",
"ID",
"to",
"an",
"underlying",
"object",
"and",
"a",
"function",
"to",
"map",
"from",
"an",
"underlying",
"object",
"to",
"the",
"concrete",
"GraphQLObjectType",
"it",
"corresponds",
"to",
"constructs",
"... | python | train |
msiemens/PyGitUp | PyGitUp/gitup.py | https://github.com/msiemens/PyGitUp/blob/b1f78831cb6b8d29d3a7d59f7a2b54fdd0720e9c/PyGitUp/gitup.py#L374-L424 | def log(self, branch, remote):
""" Call a log-command, if set by git-up.fetch.all. """
log_hook = self.settings['rebase.log-hook']
if log_hook:
if ON_WINDOWS: # pragma: no cover
# Running a string in CMD from Python is not that easy on
# Windows. Running 'cmd /C log_hook' produces problems when
# using multiple statements or things like 'echo'. Therefore,
# we write the string to a bat file and execute it.
# In addition, we replace occurences of $1 with %1 and so forth
# in case the user is used to Bash or sh.
# If there are occurences of %something, we'll replace it with
# %%something. This is the case when running something like
# 'git log --pretty=format:"%Cred%h..."'.
# Also, we replace a semicolon with a newline, because if you
# start with 'echo' on Windows, it will simply echo the
# semicolon and the commands behind instead of echoing and then
# running other commands
# Prepare log_hook
log_hook = re.sub(r'\$(\d+)', r'%\1', log_hook)
log_hook = re.sub(r'%(?!\d)', '%%', log_hook)
log_hook = re.sub(r'; ?', r'\n', log_hook)
# Write log_hook to an temporary file and get it's path
with NamedTemporaryFile(
prefix='PyGitUp.', suffix='.bat', delete=False
) as bat_file:
# Don't echo all commands
bat_file.file.write(b'@echo off\n')
# Run log_hook
bat_file.file.write(log_hook.encode('utf-8'))
# Run bat_file
state = subprocess.call(
[bat_file.name, branch.name, remote.name]
)
# Clean up file
os.remove(bat_file.name)
else: # pragma: no cover
# Run log_hook via 'shell -c'
state = subprocess.call(
[log_hook, 'git-up', branch.name, remote.name],
shell=True
)
if self.testing:
assert state == 0, 'log_hook returned != 0' | [
"def",
"log",
"(",
"self",
",",
"branch",
",",
"remote",
")",
":",
"log_hook",
"=",
"self",
".",
"settings",
"[",
"'rebase.log-hook'",
"]",
"if",
"log_hook",
":",
"if",
"ON_WINDOWS",
":",
"# pragma: no cover\r",
"# Running a string in CMD from Python is not that eas... | Call a log-command, if set by git-up.fetch.all. | [
"Call",
"a",
"log",
"-",
"command",
"if",
"set",
"by",
"git",
"-",
"up",
".",
"fetch",
".",
"all",
"."
] | python | train |
fermiPy/fermipy | fermipy/jobs/target_sim.py | https://github.com/fermiPy/fermipy/blob/9df5e7e3728307fd58c5bba36fd86783c39fbad4/fermipy/jobs/target_sim.py#L195-L233 | def _build_skydir_dict(wcsgeom, rand_config):
"""Build a dictionary of random directions"""
step_x = rand_config['step_x']
step_y = rand_config['step_y']
max_x = rand_config['max_x']
max_y = rand_config['max_y']
seed = rand_config['seed']
nsims = rand_config['nsims']
cdelt = wcsgeom.wcs.wcs.cdelt
pixstep_x = step_x / cdelt[0]
pixstep_y = -1. * step_y / cdelt[1]
pixmax_x = max_x / cdelt[0]
pixmax_y = max_y / cdelt[0]
nstep_x = int(np.ceil(2. * pixmax_x / pixstep_x)) + 1
nstep_y = int(np.ceil(2. * pixmax_y / pixstep_y)) + 1
center = np.array(wcsgeom._center_pix)
grid = np.meshgrid(np.linspace(-1 * pixmax_x, pixmax_x, nstep_x),
np.linspace(-1 * pixmax_y, pixmax_y, nstep_y))
grid[0] += center[0]
grid[1] += center[1]
test_grid = wcsgeom.pix_to_coord(grid)
glat_vals = test_grid[0].flat
glon_vals = test_grid[1].flat
conv_vals = SkyCoord(glat_vals * u.deg, glon_vals *
u.deg, frame=Galactic).transform_to(ICRS)
ra_vals = conv_vals.ra.deg[seed:nsims]
dec_vals = conv_vals.dec.deg[seed:nsims]
o_dict = {}
for i, (ra, dec) in enumerate(zip(ra_vals, dec_vals)):
key = i + seed
o_dict[key] = dict(ra=ra, dec=dec)
return o_dict | [
"def",
"_build_skydir_dict",
"(",
"wcsgeom",
",",
"rand_config",
")",
":",
"step_x",
"=",
"rand_config",
"[",
"'step_x'",
"]",
"step_y",
"=",
"rand_config",
"[",
"'step_y'",
"]",
"max_x",
"=",
"rand_config",
"[",
"'max_x'",
"]",
"max_y",
"=",
"rand_config",
... | Build a dictionary of random directions | [
"Build",
"a",
"dictionary",
"of",
"random",
"directions"
] | python | train |
mitsei/dlkit | dlkit/json_/assessment_authoring/sessions.py | https://github.com/mitsei/dlkit/blob/445f968a175d61c8d92c0f617a3c17dc1dc7c584/dlkit/json_/assessment_authoring/sessions.py#L286-L309 | def get_assessment_parts_by_genus_type(self, assessment_part_genus_type):
"""Gets an ``AssessmentPartList`` corresponding to the given assessment part genus ``Type`` which does not include assessment parts of types derived from the specified ``Type``.
arg: assessment_part_genus_type (osid.type.Type): an
assessment part genus type
return: (osid.assessment.authoring.AssessmentPartList) - the
returned ``AssessmentPart`` list
raise: NullArgument - ``assessment_part_genus_type`` is
``null``
raise: OperationFailed - unable to complete request
raise: PermissionDenied - authorization failure
*compliance: mandatory -- This method must be implemented.*
"""
# Implemented from template for
# osid.resource.ResourceLookupSession.get_resources_by_genus_type
# NOTE: This implementation currently ignores plenary view
collection = JSONClientValidated('assessment_authoring',
collection='AssessmentPart',
runtime=self._runtime)
result = collection.find(
dict({'genusTypeId': str(assessment_part_genus_type)},
**self._view_filter())).sort('_id', DESCENDING)
return objects.AssessmentPartList(result, runtime=self._runtime, proxy=self._proxy) | [
"def",
"get_assessment_parts_by_genus_type",
"(",
"self",
",",
"assessment_part_genus_type",
")",
":",
"# Implemented from template for",
"# osid.resource.ResourceLookupSession.get_resources_by_genus_type",
"# NOTE: This implementation currently ignores plenary view",
"collection",
"=",
"J... | Gets an ``AssessmentPartList`` corresponding to the given assessment part genus ``Type`` which does not include assessment parts of types derived from the specified ``Type``.
arg: assessment_part_genus_type (osid.type.Type): an
assessment part genus type
return: (osid.assessment.authoring.AssessmentPartList) - the
returned ``AssessmentPart`` list
raise: NullArgument - ``assessment_part_genus_type`` is
``null``
raise: OperationFailed - unable to complete request
raise: PermissionDenied - authorization failure
*compliance: mandatory -- This method must be implemented.* | [
"Gets",
"an",
"AssessmentPartList",
"corresponding",
"to",
"the",
"given",
"assessment",
"part",
"genus",
"Type",
"which",
"does",
"not",
"include",
"assessment",
"parts",
"of",
"types",
"derived",
"from",
"the",
"specified",
"Type",
"."
] | python | train |
gwastro/pycbc-glue | pycbc_glue/ligolw/table.py | https://github.com/gwastro/pycbc-glue/blob/a3e906bae59fbfd707c3ff82e5d008d939ec5e24/pycbc_glue/ligolw/table.py#L143-L149 | def getColumnsByName(elem, name):
"""
Return a list of Column elements named name under elem. The name
comparison is done with CompareColumnNames().
"""
name = StripColumnName(name)
return elem.getElements(lambda e: (e.tagName == ligolw.Column.tagName) and (e.Name == name)) | [
"def",
"getColumnsByName",
"(",
"elem",
",",
"name",
")",
":",
"name",
"=",
"StripColumnName",
"(",
"name",
")",
"return",
"elem",
".",
"getElements",
"(",
"lambda",
"e",
":",
"(",
"e",
".",
"tagName",
"==",
"ligolw",
".",
"Column",
".",
"tagName",
")"... | Return a list of Column elements named name under elem. The name
comparison is done with CompareColumnNames(). | [
"Return",
"a",
"list",
"of",
"Column",
"elements",
"named",
"name",
"under",
"elem",
".",
"The",
"name",
"comparison",
"is",
"done",
"with",
"CompareColumnNames",
"()",
"."
] | python | train |
wonambi-python/wonambi | wonambi/widgets/analysis.py | https://github.com/wonambi-python/wonambi/blob/1d8e3d7e53df8017c199f703bcab582914676e76/wonambi/widgets/analysis.py#L1147-L1152 | def check_all_local_prep(self):
"""Check or uncheck all enabled event pre-processing."""
all_local_pp_chk = self.event['global']['all_local_prep'].isChecked()
for buttons in self.event['local'].values():
if buttons[1].isEnabled():
buttons[1].setChecked(all_local_pp_chk) | [
"def",
"check_all_local_prep",
"(",
"self",
")",
":",
"all_local_pp_chk",
"=",
"self",
".",
"event",
"[",
"'global'",
"]",
"[",
"'all_local_prep'",
"]",
".",
"isChecked",
"(",
")",
"for",
"buttons",
"in",
"self",
".",
"event",
"[",
"'local'",
"]",
".",
"... | Check or uncheck all enabled event pre-processing. | [
"Check",
"or",
"uncheck",
"all",
"enabled",
"event",
"pre",
"-",
"processing",
"."
] | python | train |
kennedyshead/aioasuswrt | aioasuswrt/asuswrt.py | https://github.com/kennedyshead/aioasuswrt/blob/0c4336433727abbb7b324ee29e4c5382be9aaa2b/aioasuswrt/asuswrt.py#L159-L180 | async def async_get_connected_devices(self):
"""Retrieve data from ASUSWRT.
Calls various commands on the router and returns the superset of all
responses. Some commands will not work on some routers.
"""
devices = {}
dev = await self.async_get_wl()
devices.update(dev)
dev = await self.async_get_arp()
devices.update(dev)
dev = await self.async_get_neigh(devices)
devices.update(dev)
if not self.mode == 'ap':
dev = await self.async_get_leases(devices)
devices.update(dev)
ret_devices = {}
for key in devices:
if not self.require_ip or devices[key].ip is not None:
ret_devices[key] = devices[key]
return ret_devices | [
"async",
"def",
"async_get_connected_devices",
"(",
"self",
")",
":",
"devices",
"=",
"{",
"}",
"dev",
"=",
"await",
"self",
".",
"async_get_wl",
"(",
")",
"devices",
".",
"update",
"(",
"dev",
")",
"dev",
"=",
"await",
"self",
".",
"async_get_arp",
"(",... | Retrieve data from ASUSWRT.
Calls various commands on the router and returns the superset of all
responses. Some commands will not work on some routers. | [
"Retrieve",
"data",
"from",
"ASUSWRT",
"."
] | python | train |
Jarn/jarn.mkrelease | jarn/mkrelease/mkrelease.py | https://github.com/Jarn/jarn.mkrelease/blob/844377f37a3cdc0a154148790a926f991019ec4a/jarn/mkrelease/mkrelease.py#L371-L386 | def get_skipregister(self, location=None):
"""Return true if the register command is disabled (for the given server.)
"""
if location is None:
return self.skipregister or not self.defaults.register
else:
server = self.defaults.servers[location]
if self.skipregister:
return True
elif server.register is not None:
if not self.defaults.register and self.get_skipupload():
return True # prevent override
return not server.register
elif not self.defaults.register:
return True
return False | [
"def",
"get_skipregister",
"(",
"self",
",",
"location",
"=",
"None",
")",
":",
"if",
"location",
"is",
"None",
":",
"return",
"self",
".",
"skipregister",
"or",
"not",
"self",
".",
"defaults",
".",
"register",
"else",
":",
"server",
"=",
"self",
".",
... | Return true if the register command is disabled (for the given server.) | [
"Return",
"true",
"if",
"the",
"register",
"command",
"is",
"disabled",
"(",
"for",
"the",
"given",
"server",
".",
")"
] | python | train |
edeposit/edeposit.amqp.harvester | src/edeposit/amqp/harvester/scrappers/utils.py | https://github.com/edeposit/edeposit.amqp.harvester/blob/38cb87ccdf6bf2f550a98460d0a329c4b9dc8e2e/src/edeposit/amqp/harvester/scrappers/utils.py#L62-L87 | def get_first_content(el_list, alt=None, strip=True):
"""
Return content of the first element in `el_list` or `alt`. Also return `alt`
if the content string of first element is blank.
Args:
el_list (list): List of HTMLElement objects.
alt (default None): Value returner when list or content is blank.
strip (bool, default True): Call .strip() to content.
Returns:
str or alt: String representation of the content of the first element \
or `alt` if not found.
"""
if not el_list:
return alt
content = el_list[0].getContent()
if strip:
content = content.strip()
if not content:
return alt
return content | [
"def",
"get_first_content",
"(",
"el_list",
",",
"alt",
"=",
"None",
",",
"strip",
"=",
"True",
")",
":",
"if",
"not",
"el_list",
":",
"return",
"alt",
"content",
"=",
"el_list",
"[",
"0",
"]",
".",
"getContent",
"(",
")",
"if",
"strip",
":",
"conten... | Return content of the first element in `el_list` or `alt`. Also return `alt`
if the content string of first element is blank.
Args:
el_list (list): List of HTMLElement objects.
alt (default None): Value returner when list or content is blank.
strip (bool, default True): Call .strip() to content.
Returns:
str or alt: String representation of the content of the first element \
or `alt` if not found. | [
"Return",
"content",
"of",
"the",
"first",
"element",
"in",
"el_list",
"or",
"alt",
".",
"Also",
"return",
"alt",
"if",
"the",
"content",
"string",
"of",
"first",
"element",
"is",
"blank",
"."
] | python | train |
Qiskit/qiskit-terra | qiskit/qasm/qasmparser.py | https://github.com/Qiskit/qiskit-terra/blob/d4f58d903bc96341b816f7c35df936d6421267d1/qiskit/qasm/qasmparser.py#L1078-L1085 | def run(self, data):
"""Parser runner.
To use this module stand-alone.
"""
ast = self.parser.parse(data, debug=True)
self.parser.parse(data, debug=True)
ast.to_string(0) | [
"def",
"run",
"(",
"self",
",",
"data",
")",
":",
"ast",
"=",
"self",
".",
"parser",
".",
"parse",
"(",
"data",
",",
"debug",
"=",
"True",
")",
"self",
".",
"parser",
".",
"parse",
"(",
"data",
",",
"debug",
"=",
"True",
")",
"ast",
".",
"to_st... | Parser runner.
To use this module stand-alone. | [
"Parser",
"runner",
"."
] | python | test |
libtcod/python-tcod | tcod/libtcodpy.py | https://github.com/libtcod/python-tcod/blob/8ba10c5cfb813eaf3e834de971ba2d6acb7838e4/tcod/libtcodpy.py#L1053-L1065 | def console_map_string_to_font(s: str, fontCharX: int, fontCharY: int) -> None:
"""Remap a string of codes to a contiguous set of tiles.
Args:
s (AnyStr): A string of character codes to map to new values.
The null character `'\\x00'` will prematurely end this
function.
fontCharX (int): The starting X tile coordinate on the loaded tileset.
0 is the leftmost tile.
fontCharY (int): The starting Y tile coordinate on the loaded tileset.
0 is the topmost tile.
"""
lib.TCOD_console_map_string_to_font_utf(_unicode(s), fontCharX, fontCharY) | [
"def",
"console_map_string_to_font",
"(",
"s",
":",
"str",
",",
"fontCharX",
":",
"int",
",",
"fontCharY",
":",
"int",
")",
"->",
"None",
":",
"lib",
".",
"TCOD_console_map_string_to_font_utf",
"(",
"_unicode",
"(",
"s",
")",
",",
"fontCharX",
",",
"fontChar... | Remap a string of codes to a contiguous set of tiles.
Args:
s (AnyStr): A string of character codes to map to new values.
The null character `'\\x00'` will prematurely end this
function.
fontCharX (int): The starting X tile coordinate on the loaded tileset.
0 is the leftmost tile.
fontCharY (int): The starting Y tile coordinate on the loaded tileset.
0 is the topmost tile. | [
"Remap",
"a",
"string",
"of",
"codes",
"to",
"a",
"contiguous",
"set",
"of",
"tiles",
"."
] | python | train |
Clinical-Genomics/scout | scout/load/case.py | https://github.com/Clinical-Genomics/scout/blob/90a551e2e1653a319e654c2405c2866f93d0ebb9/scout/load/case.py#L9-L36 | def load_case(adapter, case_obj, update=False):
"""Load a case into the database
If the case already exists the function will exit.
If the user want to load a case that is already in the database
'update' has to be 'True'
Args:
adapter (MongoAdapter): connection to the database
case_obj (dict): case object to persist to the database
update(bool): If existing case should be updated
Returns:
case_obj(dict): A dictionary with the builded case
"""
logger.info('Loading case {} into database'.format(case_obj['display_name']))
# Check if case exists in database
existing_case = adapter.case(case_obj['_id'])
if existing_case:
if update:
adapter.update_case(case_obj)
else:
raise IntegrityError("Case {0} already exists in database".format(case_obj['_id']))
else:
adapter.add_case(case_obj)
return case_obj | [
"def",
"load_case",
"(",
"adapter",
",",
"case_obj",
",",
"update",
"=",
"False",
")",
":",
"logger",
".",
"info",
"(",
"'Loading case {} into database'",
".",
"format",
"(",
"case_obj",
"[",
"'display_name'",
"]",
")",
")",
"# Check if case exists in database",
... | Load a case into the database
If the case already exists the function will exit.
If the user want to load a case that is already in the database
'update' has to be 'True'
Args:
adapter (MongoAdapter): connection to the database
case_obj (dict): case object to persist to the database
update(bool): If existing case should be updated
Returns:
case_obj(dict): A dictionary with the builded case | [
"Load",
"a",
"case",
"into",
"the",
"database"
] | python | test |
gem/oq-engine | openquake/hmtk/seismicity/selector.py | https://github.com/gem/oq-engine/blob/8294553a0b8aba33fd96437a35065d03547d0040/openquake/hmtk/seismicity/selector.py#L380-L406 | def within_magnitude_range(self, lower_mag=None, upper_mag=None):
'''
:param float lower_mag:
Lower magnitude for consideration
:param float upper_mag:
Upper magnitude for consideration
:returns:
Instance of openquake.hmtk.seismicity.catalogue.Catalogue class containing
only selected events
'''
if not lower_mag:
if not upper_mag:
# No limiting magnitudes defined - return entire catalogue!
return self.catalogue
else:
lower_mag = -np.inf
if not upper_mag:
upper_mag = np.inf
is_valid = np.logical_and(
self.catalogue.data['magnitude'] >= lower_mag,
self.catalogue.data['magnitude'] < upper_mag)
return self.select_catalogue(is_valid) | [
"def",
"within_magnitude_range",
"(",
"self",
",",
"lower_mag",
"=",
"None",
",",
"upper_mag",
"=",
"None",
")",
":",
"if",
"not",
"lower_mag",
":",
"if",
"not",
"upper_mag",
":",
"# No limiting magnitudes defined - return entire catalogue!",
"return",
"self",
".",
... | :param float lower_mag:
Lower magnitude for consideration
:param float upper_mag:
Upper magnitude for consideration
:returns:
Instance of openquake.hmtk.seismicity.catalogue.Catalogue class containing
only selected events | [
":",
"param",
"float",
"lower_mag",
":",
"Lower",
"magnitude",
"for",
"consideration"
] | python | train |
bitesofcode/projexui | projexui/widgets/xganttwidget/xganttwidget.py | https://github.com/bitesofcode/projexui/blob/f18a73bec84df90b034ca69b9deea118dbedfc4d/projexui/widgets/xganttwidget/xganttwidget.py#L202-L219 | def addTopLevelItem(self, item):
"""
Adds the inputed item to the gantt widget.
:param item | <XGanttWidgetItem>
"""
vitem = item.viewItem()
self.treeWidget().addTopLevelItem(item)
self.viewWidget().scene().addItem(vitem)
item._viewItem = weakref.ref(vitem)
if self.updatesEnabled():
try:
item.sync(recursive=True)
except AttributeError:
pass | [
"def",
"addTopLevelItem",
"(",
"self",
",",
"item",
")",
":",
"vitem",
"=",
"item",
".",
"viewItem",
"(",
")",
"self",
".",
"treeWidget",
"(",
")",
".",
"addTopLevelItem",
"(",
"item",
")",
"self",
".",
"viewWidget",
"(",
")",
".",
"scene",
"(",
")",... | Adds the inputed item to the gantt widget.
:param item | <XGanttWidgetItem> | [
"Adds",
"the",
"inputed",
"item",
"to",
"the",
"gantt",
"widget",
".",
":",
"param",
"item",
"|",
"<XGanttWidgetItem",
">"
] | python | train |
robotframework/Rammbock | src/Rammbock/core.py | https://github.com/robotframework/Rammbock/blob/c906058d055a6f7c68fe1a6096d78c2e3f642b1c/src/Rammbock/core.py#L472-L484 | def load_copy_of_template(self, name, *parameters):
"""Load a copy of message template saved with `Save template` when originally saved values need to be preserved
from test to test.
Optional parameters are default values for message header separated with
colon.
Examples:
| Load Copy Of Template | MyMessage | header_field:value |
"""
template, fields, header_fields = self._set_templates_fields_and_header_fields(name, parameters)
copy_of_template = copy.deepcopy(template)
copy_of_fields = copy.deepcopy(fields)
self._init_new_message_stack(copy_of_template, copy_of_fields, header_fields) | [
"def",
"load_copy_of_template",
"(",
"self",
",",
"name",
",",
"*",
"parameters",
")",
":",
"template",
",",
"fields",
",",
"header_fields",
"=",
"self",
".",
"_set_templates_fields_and_header_fields",
"(",
"name",
",",
"parameters",
")",
"copy_of_template",
"=",
... | Load a copy of message template saved with `Save template` when originally saved values need to be preserved
from test to test.
Optional parameters are default values for message header separated with
colon.
Examples:
| Load Copy Of Template | MyMessage | header_field:value | | [
"Load",
"a",
"copy",
"of",
"message",
"template",
"saved",
"with",
"Save",
"template",
"when",
"originally",
"saved",
"values",
"need",
"to",
"be",
"preserved",
"from",
"test",
"to",
"test",
".",
"Optional",
"parameters",
"are",
"default",
"values",
"for",
"... | python | train |
pypa/pipenv | pipenv/vendor/yarg/package.py | https://github.com/pypa/pipenv/blob/cae8d76c210b9777e90aab76e9c4b0e53bb19cde/pipenv/vendor/yarg/package.py#L123-L131 | def author(self):
"""
>>> package = yarg.get('yarg')
>>> package.author
Author(name=u'Kura', email=u'kura@kura.io')
"""
author = namedtuple('Author', 'name email')
return author(name=self._package['author'],
email=self._package['author_email']) | [
"def",
"author",
"(",
"self",
")",
":",
"author",
"=",
"namedtuple",
"(",
"'Author'",
",",
"'name email'",
")",
"return",
"author",
"(",
"name",
"=",
"self",
".",
"_package",
"[",
"'author'",
"]",
",",
"email",
"=",
"self",
".",
"_package",
"[",
"'auth... | >>> package = yarg.get('yarg')
>>> package.author
Author(name=u'Kura', email=u'kura@kura.io') | [
">>>",
"package",
"=",
"yarg",
".",
"get",
"(",
"yarg",
")",
">>>",
"package",
".",
"author",
"Author",
"(",
"name",
"=",
"u",
"Kura",
"email",
"=",
"u",
"kura"
] | python | train |
zhanglab/psamm | psamm/fluxanalysis.py | https://github.com/zhanglab/psamm/blob/dc427848c4f9d109ca590f0afa024c63b685b3f4/psamm/fluxanalysis.py#L35-L40 | def _get_fba_problem(model, tfba, solver):
"""Convenience function for returning the right FBA problem instance"""
p = FluxBalanceProblem(model, solver)
if tfba:
p.add_thermodynamic()
return p | [
"def",
"_get_fba_problem",
"(",
"model",
",",
"tfba",
",",
"solver",
")",
":",
"p",
"=",
"FluxBalanceProblem",
"(",
"model",
",",
"solver",
")",
"if",
"tfba",
":",
"p",
".",
"add_thermodynamic",
"(",
")",
"return",
"p"
] | Convenience function for returning the right FBA problem instance | [
"Convenience",
"function",
"for",
"returning",
"the",
"right",
"FBA",
"problem",
"instance"
] | python | train |
aio-libs/aiomcache | aiomcache/client.py | https://github.com/aio-libs/aiomcache/blob/75d44b201aea91bc2856b10940922d5ebfbfcd7b/aiomcache/client.py#L415-L422 | def flush_all(self, conn):
"""Its effect is to invalidate all existing items immediately"""
command = b'flush_all\r\n'
response = yield from self._execute_simple_command(
conn, command)
if const.OK != response:
raise ClientException('Memcached flush_all failed', response) | [
"def",
"flush_all",
"(",
"self",
",",
"conn",
")",
":",
"command",
"=",
"b'flush_all\\r\\n'",
"response",
"=",
"yield",
"from",
"self",
".",
"_execute_simple_command",
"(",
"conn",
",",
"command",
")",
"if",
"const",
".",
"OK",
"!=",
"response",
":",
"rais... | Its effect is to invalidate all existing items immediately | [
"Its",
"effect",
"is",
"to",
"invalidate",
"all",
"existing",
"items",
"immediately"
] | python | train |
sanoma/django-arctic | arctic/utils.py | https://github.com/sanoma/django-arctic/blob/c81b092c2643ca220708bf3c586017d9175161f5/arctic/utils.py#L104-L128 | def menu_clean(menu_config):
"""
Make sure that only the menu item with the largest weight is active.
If a child of a menu item is active, the parent should be active too.
:param menu:
:return:
"""
max_weight = -1
for _, value in list(menu_config.items()):
if value["submenu"]:
for _, v in list(value["submenu"].items()):
if v["active"]:
# parent inherits the weight of the axctive child
value["active"] = True
value["active_weight"] = v["active_weight"]
if value["active"]:
max_weight = max(value["active_weight"], max_weight)
if max_weight > 0:
# one of the items is active: make items with lesser weight inactive
for _, value in list(menu_config.items()):
if value["active"] and value["active_weight"] < max_weight:
value["active"] = False
return menu_config | [
"def",
"menu_clean",
"(",
"menu_config",
")",
":",
"max_weight",
"=",
"-",
"1",
"for",
"_",
",",
"value",
"in",
"list",
"(",
"menu_config",
".",
"items",
"(",
")",
")",
":",
"if",
"value",
"[",
"\"submenu\"",
"]",
":",
"for",
"_",
",",
"v",
"in",
... | Make sure that only the menu item with the largest weight is active.
If a child of a menu item is active, the parent should be active too.
:param menu:
:return: | [
"Make",
"sure",
"that",
"only",
"the",
"menu",
"item",
"with",
"the",
"largest",
"weight",
"is",
"active",
".",
"If",
"a",
"child",
"of",
"a",
"menu",
"item",
"is",
"active",
"the",
"parent",
"should",
"be",
"active",
"too",
".",
":",
"param",
"menu",
... | python | train |
frictionlessdata/datapackage-pipelines | datapackage_pipelines/utilities/dirtools.py | https://github.com/frictionlessdata/datapackage-pipelines/blob/3a34bbdf042d13c3bec5eef46ff360ee41403874/datapackage_pipelines/utilities/dirtools.py#L138-L153 | def hash(self, index_func=os.path.getmtime):
""" Hash for the entire directory (except excluded files) recursively.
Use mtime instead of sha256 by default for a faster hash.
>>> dir.hash(index_func=dirtools.filehash)
"""
# TODO alternative to filehash => mtime as a faster alternative
shadir = hashlib.sha256()
for f in self.files():
try:
shadir.update(str(index_func(os.path.join(self.path, f))))
except (IOError, OSError):
pass
return shadir.hexdigest() | [
"def",
"hash",
"(",
"self",
",",
"index_func",
"=",
"os",
".",
"path",
".",
"getmtime",
")",
":",
"# TODO alternative to filehash => mtime as a faster alternative",
"shadir",
"=",
"hashlib",
".",
"sha256",
"(",
")",
"for",
"f",
"in",
"self",
".",
"files",
"(",... | Hash for the entire directory (except excluded files) recursively.
Use mtime instead of sha256 by default for a faster hash.
>>> dir.hash(index_func=dirtools.filehash) | [
"Hash",
"for",
"the",
"entire",
"directory",
"(",
"except",
"excluded",
"files",
")",
"recursively",
"."
] | python | train |
siemens/django-dingos | dingos/models.py | https://github.com/siemens/django-dingos/blob/7154f75b06d2538568e2f2455a76f3d0db0b7d70/dingos/models.py#L1510-L1586 | def add_relation(self,
target_id=None,
relation_types=None,
fact_dt_namespace_name=None,
fact_dt_namespace_uri=DINGOS_NAMESPACE_URI,
fact_dt_kind=FactDataType.UNKNOWN_KIND,
fact_dt_name='String',
metadata_dict=None,
markings=None
):
"""
Add a relationship between this object and another object.
"""
if not markings:
markings = []
if relation_types == None:
relation_types = []
# Create fact-term for relation types
relation_type_ft, created = get_or_create_fact_term(iobject_family_name=self.iobject_family.name,
fact_term_name=DINGOS_RELATION_TYPE_FACTTERM_NAME,
iobject_type_name=self.iobject_type.name,
iobject_type_namespace_uri=self.iobject_type.namespace.uri,
fact_dt_name=fact_dt_name,
fact_dt_namespace_name=fact_dt_namespace_name,
fact_dt_kind=fact_dt_kind,
fact_dt_namespace_uri=fact_dt_namespace_uri)
# Create fact containing relation types
relation_type_fact, created = get_or_create_fact(fact_term=relation_type_ft,
fact_dt_name=fact_dt_name,
fact_dt_namespace_uri=fact_dt_namespace_uri,
values=relation_types,
value_iobject_id=None,
value_iobject_ts=None,
)
rel_target_id = target_id
rel_source_id = self.identifier
# Create relation object
relation, created = self._DCM['Relation'].objects.get_or_create(
source_id=rel_source_id,
target_id=rel_target_id,
relation_type=relation_type_fact)
# Add markings
for marking in markings:
Marking2X.objects.create(marked=relation,
marking=marking)
if metadata_dict:
# If the relation already existed and had associated metadata,
# we retrieve the identifier of that metadata object and
# write the current metadata as new revision. Otherwise,
# we create a new identifier.
if relation.metadata_id:
rel_identifier_uid = relation.metadata_id.uid
rel_identifier_namespace_uri = relation.metadata_id.namespace.uri
else:
rel_identifier_uid = None
rel_identifier_namespace_uri = DINGOS_ID_NAMESPACE_URI
metadata_iobject, created = get_or_create_iobject(identifier_uid=rel_identifier_uid,
identifier_namespace_uri=rel_identifier_namespace_uri,
iobject_type_name=DINGOS_RELATION_METADATA_OBJECT_TYPE_NAME,
iobject_type_namespace_uri=DINGOS_NAMESPACE_URI,
iobject_type_revision_name=DINGOS_REVISION_NAME,
iobject_family_name=DINGOS_IOBJECT_FAMILY_NAME,
iobject_family_revision_name=DINGOS_REVISION_NAME,
timestamp=None,
overwrite=False)
metadata_iobject.from_dict(metadata_dict)
return relation | [
"def",
"add_relation",
"(",
"self",
",",
"target_id",
"=",
"None",
",",
"relation_types",
"=",
"None",
",",
"fact_dt_namespace_name",
"=",
"None",
",",
"fact_dt_namespace_uri",
"=",
"DINGOS_NAMESPACE_URI",
",",
"fact_dt_kind",
"=",
"FactDataType",
".",
"UNKNOWN_KIND... | Add a relationship between this object and another object. | [
"Add",
"a",
"relationship",
"between",
"this",
"object",
"and",
"another",
"object",
"."
] | python | train |
mikusjelly/apkutils | apkutils/apkfile.py | https://github.com/mikusjelly/apkutils/blob/2db1ed0cdb610dfc55bfd77266e9a91e4764bba4/apkutils/apkfile.py#L758-L806 | def readline(self, limit=-1):
"""Read and return a line from the stream.
If limit is specified, at most limit bytes will be read.
"""
if not self._universal and limit < 0:
# Shortcut common case - newline found in buffer.
i = self._readbuffer.find(b'\n', self._offset) + 1
if i > 0:
line = self._readbuffer[self._offset: i]
self._offset = i
return line
if not self._universal:
return io.BufferedIOBase.readline(self, limit)
line = b''
while limit < 0 or len(line) < limit:
readahead = self.peek(2)
if readahead == b'':
return line
#
# Search for universal newlines or line chunks.
#
# The pattern returns either a line chunk or a newline, but not
# both. Combined with peek(2), we are assured that the sequence
# '\r\n' is always retrieved completely and never split into
# separate newlines - '\r', '\n' due to coincidental readaheads.
#
match = self.PATTERN.search(readahead)
newline = match.group('newline')
if newline is not None:
if self.newlines is None:
self.newlines = []
if newline not in self.newlines:
self.newlines.append(newline)
self._offset += len(newline)
return line + b'\n'
chunk = match.group('chunk')
if limit >= 0:
chunk = chunk[: limit - len(line)]
self._offset += len(chunk)
line += chunk
return line | [
"def",
"readline",
"(",
"self",
",",
"limit",
"=",
"-",
"1",
")",
":",
"if",
"not",
"self",
".",
"_universal",
"and",
"limit",
"<",
"0",
":",
"# Shortcut common case - newline found in buffer.",
"i",
"=",
"self",
".",
"_readbuffer",
".",
"find",
"(",
"b'\\... | Read and return a line from the stream.
If limit is specified, at most limit bytes will be read. | [
"Read",
"and",
"return",
"a",
"line",
"from",
"the",
"stream",
"."
] | python | train |
ingolemo/python-lenses | examples/naughts_and_crosses.py | https://github.com/ingolemo/python-lenses/blob/a3a6ed0a31f6674451e542e7380a8aa16e6f8edf/examples/naughts_and_crosses.py#L42-L47 | def make_move(self, x, y):
'''Return a board with a cell filled in by the current player. If
the cell is already occupied then return the board unchanged.'''
if self.board[y][x] == ' ':
return lens.board[y][x].set(self.player)(self)
return self | [
"def",
"make_move",
"(",
"self",
",",
"x",
",",
"y",
")",
":",
"if",
"self",
".",
"board",
"[",
"y",
"]",
"[",
"x",
"]",
"==",
"' '",
":",
"return",
"lens",
".",
"board",
"[",
"y",
"]",
"[",
"x",
"]",
".",
"set",
"(",
"self",
".",
"player",... | Return a board with a cell filled in by the current player. If
the cell is already occupied then return the board unchanged. | [
"Return",
"a",
"board",
"with",
"a",
"cell",
"filled",
"in",
"by",
"the",
"current",
"player",
".",
"If",
"the",
"cell",
"is",
"already",
"occupied",
"then",
"return",
"the",
"board",
"unchanged",
"."
] | python | test |
tkem/uritools | uritools/split.py | https://github.com/tkem/uritools/blob/e77ba4acd937b68da9850138563debd4c925ef9f/uritools/split.py#L178-L187 | def getquery(self, default=None, encoding='utf-8', errors='strict'):
"""Return the decoded query string, or `default` if the original URI
reference did not contain a query component.
"""
query = self.query
if query is None:
return default
else:
return uridecode(query, encoding, errors) | [
"def",
"getquery",
"(",
"self",
",",
"default",
"=",
"None",
",",
"encoding",
"=",
"'utf-8'",
",",
"errors",
"=",
"'strict'",
")",
":",
"query",
"=",
"self",
".",
"query",
"if",
"query",
"is",
"None",
":",
"return",
"default",
"else",
":",
"return",
... | Return the decoded query string, or `default` if the original URI
reference did not contain a query component. | [
"Return",
"the",
"decoded",
"query",
"string",
"or",
"default",
"if",
"the",
"original",
"URI",
"reference",
"did",
"not",
"contain",
"a",
"query",
"component",
"."
] | python | train |
SheffieldML/GPy | GPy/plotting/gpy_plot/data_plots.py | https://github.com/SheffieldML/GPy/blob/54c32d79d289d622fb18b898aee65a2a431d90cf/GPy/plotting/gpy_plot/data_plots.py#L199-L223 | def plot_errorbars_trainset(self, which_data_rows='all',
which_data_ycols='all', fixed_inputs=None,
plot_raw=False, apply_link=False, label=None, projection='2d',
predict_kw=None, **plot_kwargs):
"""
Plot the errorbars of the GP likelihood on the training data.
These are the errorbars after the appropriate
approximations according to the likelihood are done.
This also works for heteroscedastic likelihoods.
Give the Y_metadata in the predict_kw if you need it.
:param which_data_rows: which of the training data to plot (default all)
:type which_data_rows: 'all' or a slice object to slice self.X, self.Y
:param which_data_ycols: when the data has several columns (independant outputs), only plot these
:param fixed_inputs: a list of tuple [(i,v), (i,v)...], specifying that input dimension i should be set to value v.
:type fixed_inputs: a list of tuples
:param dict predict_kwargs: kwargs for the prediction used to predict the right quantiles.
:param kwargs plot_kwargs: kwargs for the data plot for the plotting library you are using
"""
canvas, kwargs = pl().new_canvas(projection=projection, **plot_kwargs)
plots = _plot_errorbars_trainset(self, canvas, which_data_rows, which_data_ycols,
fixed_inputs, plot_raw, apply_link, label, projection, predict_kw, **kwargs)
return pl().add_to_canvas(canvas, plots) | [
"def",
"plot_errorbars_trainset",
"(",
"self",
",",
"which_data_rows",
"=",
"'all'",
",",
"which_data_ycols",
"=",
"'all'",
",",
"fixed_inputs",
"=",
"None",
",",
"plot_raw",
"=",
"False",
",",
"apply_link",
"=",
"False",
",",
"label",
"=",
"None",
",",
"pro... | Plot the errorbars of the GP likelihood on the training data.
These are the errorbars after the appropriate
approximations according to the likelihood are done.
This also works for heteroscedastic likelihoods.
Give the Y_metadata in the predict_kw if you need it.
:param which_data_rows: which of the training data to plot (default all)
:type which_data_rows: 'all' or a slice object to slice self.X, self.Y
:param which_data_ycols: when the data has several columns (independant outputs), only plot these
:param fixed_inputs: a list of tuple [(i,v), (i,v)...], specifying that input dimension i should be set to value v.
:type fixed_inputs: a list of tuples
:param dict predict_kwargs: kwargs for the prediction used to predict the right quantiles.
:param kwargs plot_kwargs: kwargs for the data plot for the plotting library you are using | [
"Plot",
"the",
"errorbars",
"of",
"the",
"GP",
"likelihood",
"on",
"the",
"training",
"data",
".",
"These",
"are",
"the",
"errorbars",
"after",
"the",
"appropriate",
"approximations",
"according",
"to",
"the",
"likelihood",
"are",
"done",
"."
] | python | train |
totalgood/nlpia | src/nlpia/gensim_utils.py | https://github.com/totalgood/nlpia/blob/efa01126275e9cd3c3a5151a644f1c798a9ec53f/src/nlpia/gensim_utils.py#L44-L90 | def to_unicode(sorb, allow_eval=False):
r"""Ensure that strings are unicode (UTF-8 encoded).
Evaluate bytes literals that are sometimes accidentally created by str(b'whatever')
>>> to_unicode(b'whatever')
'whatever'
>>> to_unicode(b'b"whatever"')
'whatever'
>>> to_unicode(repr(b'b"whatever"'))
'whatever'
>>> to_unicode(str(b'b"whatever"'))
'whatever'
>>> to_unicode(str(str(b'whatever')))
'whatever'
>>> to_unicode(bytes(u'whatever', 'utf-8'))
'whatever'
>>> to_unicode(b'u"whatever"')
'whatever'
>>> to_unicode(u'b"whatever"')
'whatever'
There seems to be a bug in python3 core:
>>> str(b'whatever') # user intended str.decode(b'whatever') (str coercion) rather than python code repr
"b'whatever'"
>>> repr(str(b'whatever'))
'"b\'whatever\'"'
>>> str(repr(str(b'whatever')))
'"b\'whatever\'"'
>>> repr(str(repr(str(b'whatever'))))
'\'"b\\\'whatever\\\'"\''
>>> repr(repr(b'whatever'))
'"b\'whatever\'"'
>>> str(str(b'whatever'))
"b'whatever'"
>>> str(repr(b'whatever'))
"b'whatever'"
"""
if sorb is None:
return sorb
if isinstance(sorb, bytes):
sorb = sorb.decode()
for i, s in enumerate(["b'", 'b"', "u'", 'u"']):
if (sorb.startswith(s) and sorb.endswith(s[-1])):
# print(i)
return to_unicode(eval(sorb, {'__builtins__': None}, {}))
return sorb | [
"def",
"to_unicode",
"(",
"sorb",
",",
"allow_eval",
"=",
"False",
")",
":",
"if",
"sorb",
"is",
"None",
":",
"return",
"sorb",
"if",
"isinstance",
"(",
"sorb",
",",
"bytes",
")",
":",
"sorb",
"=",
"sorb",
".",
"decode",
"(",
")",
"for",
"i",
",",
... | r"""Ensure that strings are unicode (UTF-8 encoded).
Evaluate bytes literals that are sometimes accidentally created by str(b'whatever')
>>> to_unicode(b'whatever')
'whatever'
>>> to_unicode(b'b"whatever"')
'whatever'
>>> to_unicode(repr(b'b"whatever"'))
'whatever'
>>> to_unicode(str(b'b"whatever"'))
'whatever'
>>> to_unicode(str(str(b'whatever')))
'whatever'
>>> to_unicode(bytes(u'whatever', 'utf-8'))
'whatever'
>>> to_unicode(b'u"whatever"')
'whatever'
>>> to_unicode(u'b"whatever"')
'whatever'
There seems to be a bug in python3 core:
>>> str(b'whatever') # user intended str.decode(b'whatever') (str coercion) rather than python code repr
"b'whatever'"
>>> repr(str(b'whatever'))
'"b\'whatever\'"'
>>> str(repr(str(b'whatever')))
'"b\'whatever\'"'
>>> repr(str(repr(str(b'whatever'))))
'\'"b\\\'whatever\\\'"\''
>>> repr(repr(b'whatever'))
'"b\'whatever\'"'
>>> str(str(b'whatever'))
"b'whatever'"
>>> str(repr(b'whatever'))
"b'whatever'" | [
"r",
"Ensure",
"that",
"strings",
"are",
"unicode",
"(",
"UTF",
"-",
"8",
"encoded",
")",
"."
] | python | train |
cloudera/impyla | impala/_thrift_gen/hive_metastore/ThriftHiveMetastore.py | https://github.com/cloudera/impyla/blob/547fa2ba3b6151e2a98b3544301471a643212dc3/impala/_thrift_gen/hive_metastore/ThriftHiveMetastore.py#L3354-L3363 | def get_partitions_ps(self, db_name, tbl_name, part_vals, max_parts):
"""
Parameters:
- db_name
- tbl_name
- part_vals
- max_parts
"""
self.send_get_partitions_ps(db_name, tbl_name, part_vals, max_parts)
return self.recv_get_partitions_ps() | [
"def",
"get_partitions_ps",
"(",
"self",
",",
"db_name",
",",
"tbl_name",
",",
"part_vals",
",",
"max_parts",
")",
":",
"self",
".",
"send_get_partitions_ps",
"(",
"db_name",
",",
"tbl_name",
",",
"part_vals",
",",
"max_parts",
")",
"return",
"self",
".",
"r... | Parameters:
- db_name
- tbl_name
- part_vals
- max_parts | [
"Parameters",
":",
"-",
"db_name",
"-",
"tbl_name",
"-",
"part_vals",
"-",
"max_parts"
] | python | train |
saltstack/salt | salt/runners/vault.py | https://github.com/saltstack/salt/blob/e8541fd6e744ab0df786c0f76102e41631f45d46/salt/runners/vault.py#L146-L163 | def _validate_signature(minion_id, signature, impersonated_by_master):
'''
Validate that either minion with id minion_id, or the master, signed the
request
'''
pki_dir = __opts__['pki_dir']
if impersonated_by_master:
public_key = '{0}/master.pub'.format(pki_dir)
else:
public_key = '{0}/minions/{1}'.format(pki_dir, minion_id)
log.trace('Validating signature for %s', minion_id)
signature = base64.b64decode(signature)
if not salt.crypt.verify_signature(public_key, minion_id, signature):
raise salt.exceptions.AuthenticationError(
'Could not validate token request from {0}'.format(minion_id)
)
log.trace('Signature ok') | [
"def",
"_validate_signature",
"(",
"minion_id",
",",
"signature",
",",
"impersonated_by_master",
")",
":",
"pki_dir",
"=",
"__opts__",
"[",
"'pki_dir'",
"]",
"if",
"impersonated_by_master",
":",
"public_key",
"=",
"'{0}/master.pub'",
".",
"format",
"(",
"pki_dir",
... | Validate that either minion with id minion_id, or the master, signed the
request | [
"Validate",
"that",
"either",
"minion",
"with",
"id",
"minion_id",
"or",
"the",
"master",
"signed",
"the",
"request"
] | python | train |
carlospalol/money | money/exchange.py | https://github.com/carlospalol/money/blob/1e51f651f93edd62c16eb3d7aa034fec03096046/money/exchange.py#L119-L123 | def quotation(self, origin, target):
"""Return quotation between two currencies (origin, target)"""
if not self._backend:
raise ExchangeBackendNotInstalled()
return self._backend.quotation(origin, target) | [
"def",
"quotation",
"(",
"self",
",",
"origin",
",",
"target",
")",
":",
"if",
"not",
"self",
".",
"_backend",
":",
"raise",
"ExchangeBackendNotInstalled",
"(",
")",
"return",
"self",
".",
"_backend",
".",
"quotation",
"(",
"origin",
",",
"target",
")"
] | Return quotation between two currencies (origin, target) | [
"Return",
"quotation",
"between",
"two",
"currencies",
"(",
"origin",
"target",
")"
] | python | train |
RudolfCardinal/pythonlib | cardinal_pythonlib/sqlalchemy/list_types.py | https://github.com/RudolfCardinal/pythonlib/blob/0b84cb35f38bd7d8723958dae51b480a829b7227/cardinal_pythonlib/sqlalchemy/list_types.py#L208-L212 | def process_bind_param(self, value: Optional[List[str]],
dialect: Dialect) -> str:
"""Convert things on the way from Python to the database."""
retval = self._strlist_to_dbstr(value)
return retval | [
"def",
"process_bind_param",
"(",
"self",
",",
"value",
":",
"Optional",
"[",
"List",
"[",
"str",
"]",
"]",
",",
"dialect",
":",
"Dialect",
")",
"->",
"str",
":",
"retval",
"=",
"self",
".",
"_strlist_to_dbstr",
"(",
"value",
")",
"return",
"retval"
] | Convert things on the way from Python to the database. | [
"Convert",
"things",
"on",
"the",
"way",
"from",
"Python",
"to",
"the",
"database",
"."
] | python | train |
Azure/msrest-for-python | msrest/universal_http/aiohttp.py | https://github.com/Azure/msrest-for-python/blob/0732bc90bdb290e5f58c675ffdd7dbfa9acefc93/msrest/universal_http/aiohttp.py#L50-L64 | async def send(self, request: ClientRequest, **config: Any) -> AsyncClientResponse:
"""Send the request using this HTTP sender.
Will pre-load the body into memory to be available with a sync method.
pass stream=True to avoid this behavior.
"""
result = await self._session.request(
request.method,
request.url,
**config
)
response = AioHttpClientResponse(request, result)
if not config.get("stream", False):
await response.load_body()
return response | [
"async",
"def",
"send",
"(",
"self",
",",
"request",
":",
"ClientRequest",
",",
"*",
"*",
"config",
":",
"Any",
")",
"->",
"AsyncClientResponse",
":",
"result",
"=",
"await",
"self",
".",
"_session",
".",
"request",
"(",
"request",
".",
"method",
",",
... | Send the request using this HTTP sender.
Will pre-load the body into memory to be available with a sync method.
pass stream=True to avoid this behavior. | [
"Send",
"the",
"request",
"using",
"this",
"HTTP",
"sender",
"."
] | python | train |
hyperledger/sawtooth-core | validator/sawtooth_validator/state/batch_tracker.py | https://github.com/hyperledger/sawtooth-core/blob/8cf473bc2207e51f02bd182d825158a57d72b098/validator/sawtooth_validator/state/batch_tracker.py#L187-L190 | def _has_no_pendings(self, statuses):
"""Returns True if a statuses dict has no PENDING statuses.
"""
return all(s != ClientBatchStatus.PENDING for s in statuses.values()) | [
"def",
"_has_no_pendings",
"(",
"self",
",",
"statuses",
")",
":",
"return",
"all",
"(",
"s",
"!=",
"ClientBatchStatus",
".",
"PENDING",
"for",
"s",
"in",
"statuses",
".",
"values",
"(",
")",
")"
] | Returns True if a statuses dict has no PENDING statuses. | [
"Returns",
"True",
"if",
"a",
"statuses",
"dict",
"has",
"no",
"PENDING",
"statuses",
"."
] | python | train |
mezz64/pyEight | pyeight/user.py | https://github.com/mezz64/pyEight/blob/e557e4e6876f490d0964298e9475d68b64222d4f/pyeight/user.py#L494-L542 | def dynamic_presence(self):
"""
Determine presence based on bed heating level and end presence
time reported by the api.
Idea originated from Alex Lee Yuk Cheung SmartThings Code.
"""
# self.heating_stats()
if not self.presence:
if self.heating_level > 50:
# Can likely make this better
if not self.now_heating:
self.presence = True
elif self.heating_level - self.target_heating_level >= 8:
self.presence = True
elif self.heating_level > 25:
# Catch rising edge
if self.past_heating_level(0) - self.past_heating_level(1) >= 2 \
and self.past_heating_level(1) - self.past_heating_level(2) >= 2 \
and self.past_heating_level(2) - self.past_heating_level(3) >= 2:
# Values are increasing so we are likely in bed
if not self.now_heating:
self.presence = True
elif self.heating_level - self.target_heating_level >= 8:
self.presence = True
elif self.presence:
if self.heating_level <= 15:
# Failsafe, very slow
self.presence = False
elif self.heating_level < 50:
if self.past_heating_level(0) - self.past_heating_level(1) < 0 \
and self.past_heating_level(1) - self.past_heating_level(2) < 0 \
and self.past_heating_level(2) - self.past_heating_level(3) < 0:
# Values are decreasing so we are likely out of bed
self.presence = False
# Last seen can lag real-time by up to 35min so this is
# mostly a backup to using the heat values.
# seen_delta = datetime.fromtimestamp(time.time()) \
# - datetime.strptime(self.last_seen, '%Y-%m-%dT%H:%M:%S')
# _LOGGER.debug('%s Last seen time delta: %s', self.side,
# seen_delta.total_seconds())
# if self.presence and seen_delta.total_seconds() > 2100:
# self.presence = False
_LOGGER.debug('%s Presence Results: %s', self.side, self.presence) | [
"def",
"dynamic_presence",
"(",
"self",
")",
":",
"# self.heating_stats()",
"if",
"not",
"self",
".",
"presence",
":",
"if",
"self",
".",
"heating_level",
">",
"50",
":",
"# Can likely make this better",
"if",
"not",
"self",
".",
"now_heating",
":",
"self",
".... | Determine presence based on bed heating level and end presence
time reported by the api.
Idea originated from Alex Lee Yuk Cheung SmartThings Code. | [
"Determine",
"presence",
"based",
"on",
"bed",
"heating",
"level",
"and",
"end",
"presence",
"time",
"reported",
"by",
"the",
"api",
"."
] | python | train |
solocompt/plugs-mail | plugs_mail/management/commands/load_email_templates.py | https://github.com/solocompt/plugs-mail/blob/6139fa79ddb437562db1769d03bd3098c25a06fa/plugs_mail/management/commands/load_email_templates.py#L39-L52 | def get_apps(self):
"""
Get the list of installed apps
and return the apps that have
an emails module
"""
templates = []
for app in settings.INSTALLED_APPS:
try:
app = import_module(app + '.emails')
templates += self.get_plugs_mail_classes(app)
except ImportError:
pass
return templates | [
"def",
"get_apps",
"(",
"self",
")",
":",
"templates",
"=",
"[",
"]",
"for",
"app",
"in",
"settings",
".",
"INSTALLED_APPS",
":",
"try",
":",
"app",
"=",
"import_module",
"(",
"app",
"+",
"'.emails'",
")",
"templates",
"+=",
"self",
".",
"get_plugs_mail_... | Get the list of installed apps
and return the apps that have
an emails module | [
"Get",
"the",
"list",
"of",
"installed",
"apps",
"and",
"return",
"the",
"apps",
"that",
"have",
"an",
"emails",
"module"
] | python | train |
wtsi-hgi/python-hgijson | hgijson/serialization.py | https://github.com/wtsi-hgi/python-hgijson/blob/6e8ccb562eabcaa816a136268a16504c2e0d4664/hgijson/serialization.py#L188-L237 | def deserialize(self, to_deserialize: PrimitiveJsonType) \
-> Optional[Union[SerializableType, List[SerializableType]]]:
"""
Deserializes the given representation of the serialized object.
:param to_deserialize: the serialized object as a dictionary
:return: the deserialized object or collection of deserialized objects
"""
if to_deserialize is None:
# Implements #17
return None
elif isinstance(to_deserialize, List):
deserialized = []
for item in to_deserialize:
item_deserialized = self.deserialize(item)
deserialized.append(item_deserialized)
return deserialized
else:
mappings_not_set_in_constructor = [] # type: List[PropertyMapping]
init_kwargs = dict() # type: Dict[str, Any]
for mapping in self._property_mappings:
if mapping.object_constructor_parameter_name is not None:
value = mapping.serialized_property_getter(to_deserialize)
if not (mapping.optional and value is None):
decoded_value = self._deserialize_property_value(value, mapping.deserializer_cls)
if isinstance(decoded_value, list):
collection = mapping.collection_factory(decoded_value)
decoded_value = collection
argument = mapping.object_constructor_argument_modifier(decoded_value)
init_kwargs[mapping.object_constructor_parameter_name] = argument
else:
mappings_not_set_in_constructor.append(mapping)
decoded = self._deserializable_cls(**init_kwargs)
assert type(decoded) == self._deserializable_cls
for mapping in mappings_not_set_in_constructor:
assert mapping.object_constructor_parameter_name is None
if mapping.serialized_property_getter is not None and mapping.object_property_setter is not None:
value = mapping.serialized_property_getter(to_deserialize)
if not (mapping.optional and value is None):
decoded_value = self._deserialize_property_value(value, mapping.deserializer_cls)
if isinstance(decoded_value, list):
collection = mapping.collection_factory(decoded_value)
decoded_value = collection
mapping.object_property_setter(decoded, decoded_value)
return decoded | [
"def",
"deserialize",
"(",
"self",
",",
"to_deserialize",
":",
"PrimitiveJsonType",
")",
"->",
"Optional",
"[",
"Union",
"[",
"SerializableType",
",",
"List",
"[",
"SerializableType",
"]",
"]",
"]",
":",
"if",
"to_deserialize",
"is",
"None",
":",
"# Implements... | Deserializes the given representation of the serialized object.
:param to_deserialize: the serialized object as a dictionary
:return: the deserialized object or collection of deserialized objects | [
"Deserializes",
"the",
"given",
"representation",
"of",
"the",
"serialized",
"object",
".",
":",
"param",
"to_deserialize",
":",
"the",
"serialized",
"object",
"as",
"a",
"dictionary",
":",
"return",
":",
"the",
"deserialized",
"object",
"or",
"collection",
"of"... | python | train |
Opentrons/opentrons | api/src/opentrons/legacy_api/instruments/pipette.py | https://github.com/Opentrons/opentrons/blob/a7c15cc2636ecb64ab56c7edc1d8a57163aaeadf/api/src/opentrons/legacy_api/instruments/pipette.py#L1159-L1192 | def home(self):
"""
Home the pipette's plunger axis during a protocol run
Notes
-----
`Pipette.home()` homes the `Robot`
Returns
-------
This instance of :class:`Pipette`.
Examples
--------
..
>>> from opentrons import instruments, robot # doctest: +SKIP
>>> robot.reset() # doctest: +SKIP
>>> p300 = instruments.P300_Single(mount='right') # doctest: +SKIP
>>> p300.home() # doctest: +SKIP
"""
def _home(mount):
self.current_volume = 0
self.instrument_actuator.set_active_current(self._plunger_current)
self.robot.poses = self.instrument_actuator.home(
self.robot.poses)
self.robot.poses = self.instrument_mover.home(self.robot.poses)
self.previous_placeable = None # no longer inside a placeable
do_publish(self.broker, commands.home, _home,
'before', None, None, self.mount)
_home(self.mount)
do_publish(self.broker, commands.home, _home,
'after', self, None, self.mount)
return self | [
"def",
"home",
"(",
"self",
")",
":",
"def",
"_home",
"(",
"mount",
")",
":",
"self",
".",
"current_volume",
"=",
"0",
"self",
".",
"instrument_actuator",
".",
"set_active_current",
"(",
"self",
".",
"_plunger_current",
")",
"self",
".",
"robot",
".",
"p... | Home the pipette's plunger axis during a protocol run
Notes
-----
`Pipette.home()` homes the `Robot`
Returns
-------
This instance of :class:`Pipette`.
Examples
--------
..
>>> from opentrons import instruments, robot # doctest: +SKIP
>>> robot.reset() # doctest: +SKIP
>>> p300 = instruments.P300_Single(mount='right') # doctest: +SKIP
>>> p300.home() # doctest: +SKIP | [
"Home",
"the",
"pipette",
"s",
"plunger",
"axis",
"during",
"a",
"protocol",
"run"
] | python | train |
gabstopper/smc-python | smc/core/engines.py | https://github.com/gabstopper/smc-python/blob/e027b8a5dcfaf884eada32d113d41c1e56b32457/smc/core/engines.py#L824-L848 | def add_snmp(data, interfaces):
"""
Format data for adding SNMP to an engine.
:param list data: list of interfaces as provided by kw
:param list interfaces: interfaces to enable SNMP by id
"""
snmp_interface = []
if interfaces: # Not providing interfaces will enable SNMP on all NDIs
interfaces = map(str, interfaces)
for interface in data:
interface_id = str(interface.get('interface_id'))
for if_def in interface.get('interfaces', []):
_interface_id = None
if 'vlan_id' in if_def:
_interface_id = '{}.{}'.format(
interface_id, if_def['vlan_id'])
else:
_interface_id = interface_id
if _interface_id in interfaces and 'type' not in interface:
for node in if_def.get('nodes', []):
snmp_interface.append(
{'address': node.get('address'),
'nicid': _interface_id})
return snmp_interface | [
"def",
"add_snmp",
"(",
"data",
",",
"interfaces",
")",
":",
"snmp_interface",
"=",
"[",
"]",
"if",
"interfaces",
":",
"# Not providing interfaces will enable SNMP on all NDIs",
"interfaces",
"=",
"map",
"(",
"str",
",",
"interfaces",
")",
"for",
"interface",
"in"... | Format data for adding SNMP to an engine.
:param list data: list of interfaces as provided by kw
:param list interfaces: interfaces to enable SNMP by id | [
"Format",
"data",
"for",
"adding",
"SNMP",
"to",
"an",
"engine",
".",
":",
"param",
"list",
"data",
":",
"list",
"of",
"interfaces",
"as",
"provided",
"by",
"kw",
":",
"param",
"list",
"interfaces",
":",
"interfaces",
"to",
"enable",
"SNMP",
"by",
"id"
] | python | train |
kdeldycke/maildir-deduplicate | maildir_deduplicate/deduplicate.py | https://github.com/kdeldycke/maildir-deduplicate/blob/f1c6ff25b80c6c1a4dc2dc7a65b34d808b0b7733/maildir_deduplicate/deduplicate.py#L361-L380 | def delete_bigger(self):
""" Delete all bigger duplicates.
Only keeps the subset sharing the smallest size.
"""
logger.info(
"Deleting all mails strictly bigger than {} bytes...".format(
self.smallest_size))
# Select candidates for deletion.
candidates = [
mail for mail in self.pool
if mail.size > self.smallest_size]
if len(candidates) == self.size:
logger.warning(
"Skip deletion: all {} mails share the same size."
"".format(self.size))
logger.info(
"{} candidates found for deletion.".format(len(candidates)))
for mail in candidates:
self.delete(mail) | [
"def",
"delete_bigger",
"(",
"self",
")",
":",
"logger",
".",
"info",
"(",
"\"Deleting all mails strictly bigger than {} bytes...\"",
".",
"format",
"(",
"self",
".",
"smallest_size",
")",
")",
"# Select candidates for deletion.",
"candidates",
"=",
"[",
"mail",
"for"... | Delete all bigger duplicates.
Only keeps the subset sharing the smallest size. | [
"Delete",
"all",
"bigger",
"duplicates",
"."
] | python | train |
fprimex/zdesk | zdesk/zdesk_api.py | https://github.com/fprimex/zdesk/blob/851611c13b4d530e9df31390b3ec709baf0a0188/zdesk/zdesk_api.py#L4098-L4102 | def user_tags_delete(self, id, **kwargs):
"https://developer.zendesk.com/rest_api/docs/core/tags#remove-tags"
api_path = "/api/v2/users/{id}/tags.json"
api_path = api_path.format(id=id)
return self.call(api_path, method="DELETE", **kwargs) | [
"def",
"user_tags_delete",
"(",
"self",
",",
"id",
",",
"*",
"*",
"kwargs",
")",
":",
"api_path",
"=",
"\"/api/v2/users/{id}/tags.json\"",
"api_path",
"=",
"api_path",
".",
"format",
"(",
"id",
"=",
"id",
")",
"return",
"self",
".",
"call",
"(",
"api_path"... | https://developer.zendesk.com/rest_api/docs/core/tags#remove-tags | [
"https",
":",
"//",
"developer",
".",
"zendesk",
".",
"com",
"/",
"rest_api",
"/",
"docs",
"/",
"core",
"/",
"tags#remove",
"-",
"tags"
] | python | train |
SeattleTestbed/seash | pyreadline/modes/emacs.py | https://github.com/SeattleTestbed/seash/blob/40f9d2285662ff8b61e0468b4196acee089b273b/pyreadline/modes/emacs.py#L251-L290 | def _process_keyevent(self, keyinfo):
u"""return True when line is final
"""
#Process exit keys. Only exit on empty line
log(u"_process_keyevent <%s>"%keyinfo)
def nop(e):
pass
if self.next_meta:
self.next_meta = False
keyinfo.meta = True
keytuple = keyinfo.tuple()
if self._insert_verbatim:
self.insert_text(keyinfo)
self._insert_verbatim = False
self.argument = 0
return False
if keytuple in self.exit_dispatch:
pars = (self.l_buffer, lineobj.EndOfLine(self.l_buffer))
log(u"exit_dispatch:<%s, %s>"%pars)
if lineobj.EndOfLine(self.l_buffer) == 0:
raise EOFError
if keyinfo.keyname or keyinfo.control or keyinfo.meta:
default = nop
else:
default = self.self_insert
dispatch_func = self.key_dispatch.get(keytuple, default)
log(u"readline from keyboard:<%s,%s>"%(keytuple, dispatch_func))
r = None
if dispatch_func:
r = dispatch_func(keyinfo)
self._keylog(dispatch_func, self.l_buffer)
self.l_buffer.push_undo()
self.previous_func = dispatch_func
return r | [
"def",
"_process_keyevent",
"(",
"self",
",",
"keyinfo",
")",
":",
"#Process exit keys. Only exit on empty line\r",
"log",
"(",
"u\"_process_keyevent <%s>\"",
"%",
"keyinfo",
")",
"def",
"nop",
"(",
"e",
")",
":",
"pass",
"if",
"self",
".",
"next_meta",
":",
"se... | u"""return True when line is final | [
"u",
"return",
"True",
"when",
"line",
"is",
"final"
] | python | train |
DarkEnergySurvey/ugali | ugali/utils/fileio.py | https://github.com/DarkEnergySurvey/ugali/blob/21e890b4117fc810afb6fb058e8055d564f03382/ugali/utils/fileio.py#L20-L42 | def read(filename,**kwargs):
""" Read a generic input file into a recarray.
Accepted file formats: [.fits,.fz,.npy,.csv,.txt,.dat]
Parameters:
filename : input file name
kwargs : keyword arguments for the reader
Returns:
recarray : data array
"""
base,ext = os.path.splitext(filename)
if ext in ('.fits','.fz'):
# Abstract fits here...
return fitsio.read(filename,**kwargs)
elif ext in ('.npy'):
return np.load(filename,**kwargs)
elif ext in ('.csv'):
return np.recfromcsv(filename,**kwargs)
elif ext in ('.txt','.dat'):
return np.genfromtxt(filename,**kwargs)
msg = "Unrecognized file type: %s"%filename
raise ValueError(msg) | [
"def",
"read",
"(",
"filename",
",",
"*",
"*",
"kwargs",
")",
":",
"base",
",",
"ext",
"=",
"os",
".",
"path",
".",
"splitext",
"(",
"filename",
")",
"if",
"ext",
"in",
"(",
"'.fits'",
",",
"'.fz'",
")",
":",
"# Abstract fits here...",
"return",
"fit... | Read a generic input file into a recarray.
Accepted file formats: [.fits,.fz,.npy,.csv,.txt,.dat]
Parameters:
filename : input file name
kwargs : keyword arguments for the reader
Returns:
recarray : data array | [
"Read",
"a",
"generic",
"input",
"file",
"into",
"a",
"recarray",
".",
"Accepted",
"file",
"formats",
":",
"[",
".",
"fits",
".",
"fz",
".",
"npy",
".",
"csv",
".",
"txt",
".",
"dat",
"]",
"Parameters",
":",
"filename",
":",
"input",
"file",
"name",
... | python | train |
Terrance/SkPy | skpy/conn.py | https://github.com/Terrance/SkPy/blob/0f9489c94e8ec4d3effab4314497428872a80ad1/skpy/conn.py#L59-L89 | def handle(*codes, **kwargs):
"""
Method decorator: if a given status code is received, re-authenticate and try again.
Args:
codes (int list): status codes to respond to
regToken (bool): whether to try retrieving a new token on error
Returns:
method: decorator function, ready to apply to other methods
"""
regToken = kwargs.get("regToken", False)
subscribe = kwargs.get("subscribe")
def decorator(fn):
@functools.wraps(fn)
def wrapper(self, *args, **kwargs):
try:
return fn(self, *args, **kwargs)
except SkypeApiException as e:
if isinstance(e.args[1], requests.Response) and e.args[1].status_code in codes:
conn = self if isinstance(self, SkypeConnection) else self.conn
if regToken:
conn.getRegToken()
if subscribe:
conn.endpoints[subscribe].subscribe()
return fn(self, *args, **kwargs)
raise
return wrapper
return decorator | [
"def",
"handle",
"(",
"*",
"codes",
",",
"*",
"*",
"kwargs",
")",
":",
"regToken",
"=",
"kwargs",
".",
"get",
"(",
"\"regToken\"",
",",
"False",
")",
"subscribe",
"=",
"kwargs",
".",
"get",
"(",
"\"subscribe\"",
")",
"def",
"decorator",
"(",
"fn",
")... | Method decorator: if a given status code is received, re-authenticate and try again.
Args:
codes (int list): status codes to respond to
regToken (bool): whether to try retrieving a new token on error
Returns:
method: decorator function, ready to apply to other methods | [
"Method",
"decorator",
":",
"if",
"a",
"given",
"status",
"code",
"is",
"received",
"re",
"-",
"authenticate",
"and",
"try",
"again",
"."
] | python | test |
lobocv/anonymoususage | anonymoususage/tools.py | https://github.com/lobocv/anonymoususage/blob/847bdad0746ad1cc6c57fb9def201beb59fb8300/anonymoususage/tools.py#L271-L281 | def login_hq(host, user, passwd, path='', acct='', port=21, timeout=5):
"""
Create and return a logged in FTP object.
:return:
"""
ftp = ftplib.FTP()
ftp.connect(host=host, port=port, timeout=timeout)
ftp.login(user=user, passwd=passwd, acct=acct)
ftp.cwd(path)
logger.debug('Login to %s successful.' % host)
return ftp | [
"def",
"login_hq",
"(",
"host",
",",
"user",
",",
"passwd",
",",
"path",
"=",
"''",
",",
"acct",
"=",
"''",
",",
"port",
"=",
"21",
",",
"timeout",
"=",
"5",
")",
":",
"ftp",
"=",
"ftplib",
".",
"FTP",
"(",
")",
"ftp",
".",
"connect",
"(",
"h... | Create and return a logged in FTP object.
:return: | [
"Create",
"and",
"return",
"a",
"logged",
"in",
"FTP",
"object",
".",
":",
"return",
":"
] | python | train |
bwhite/hadoopy | hadoopy/thirdparty/pyinstaller/PyInstaller/bindepend.py | https://github.com/bwhite/hadoopy/blob/ff39b4e6d4e6efaf1f571cf0f2c0e0d7ab28c2d6/hadoopy/thirdparty/pyinstaller/PyInstaller/bindepend.py#L341-L391 | def selectImports(pth, xtrapath=None):
"""
Return the dependencies of a binary that should be included.
Return a list of pairs (name, fullpath)
"""
rv = []
if xtrapath is None:
xtrapath = [os.path.dirname(pth)]
else:
assert isinstance(xtrapath, list)
xtrapath = [os.path.dirname(pth)] + xtrapath # make a copy
dlls = getImports(pth)
for lib in dlls:
if seen.get(lib.upper(), 0):
continue
if not is_win and not is_cygwin:
# all other platforms
npth = lib
dir, lib = os.path.split(lib)
else:
# plain win case
npth = getfullnameof(lib, xtrapath)
# now npth is a candidate lib if found
# check again for excludes but with regex FIXME: split the list
if npth:
candidatelib = npth
else:
candidatelib = lib
if not dylib.include_library(candidatelib):
if (candidatelib.find('libpython') < 0 and
candidatelib.find('Python.framework') < 0):
# skip libs not containing (libpython or Python.framework)
if not seen.get(npth.upper(), 0):
logger.debug("Skipping %s dependency of %s",
lib, os.path.basename(pth))
continue
else:
pass
if npth:
if not seen.get(npth.upper(), 0):
logger.debug("Adding %s dependency of %s",
lib, os.path.basename(pth))
rv.append((lib, npth))
else:
logger.error("lib not found: %s dependency of %s", lib, pth)
return rv | [
"def",
"selectImports",
"(",
"pth",
",",
"xtrapath",
"=",
"None",
")",
":",
"rv",
"=",
"[",
"]",
"if",
"xtrapath",
"is",
"None",
":",
"xtrapath",
"=",
"[",
"os",
".",
"path",
".",
"dirname",
"(",
"pth",
")",
"]",
"else",
":",
"assert",
"isinstance"... | Return the dependencies of a binary that should be included.
Return a list of pairs (name, fullpath) | [
"Return",
"the",
"dependencies",
"of",
"a",
"binary",
"that",
"should",
"be",
"included",
"."
] | python | train |
hvac/hvac | hvac/api/system_backend/audit.py | https://github.com/hvac/hvac/blob/cce5b86889193f622c2a72a4a1b7e1c9c8aff1ce/hvac/api/system_backend/audit.py#L77-L102 | def calculate_hash(self, path, input_to_hash):
"""Hash the given input data with the specified audit device's hash function and salt.
This endpoint can be used to discover whether a given plaintext string (the input parameter) appears in the
audit log in obfuscated form.
Supported methods:
POST: /sys/audit-hash/{path}. Produces: 204 (empty body)
:param path: The path of the audit device to generate hashes for. This is part of the request URL.
:type path: str | unicode
:param input_to_hash: The input string to hash.
:type input_to_hash: str | unicode
:return: The JSON response of the request.
:rtype: requests.Response
"""
params = {
'input': input_to_hash,
}
api_path = '/v1/sys/audit-hash/{path}'.format(path=path)
response = self._adapter.post(
url=api_path,
json=params
)
return response.json() | [
"def",
"calculate_hash",
"(",
"self",
",",
"path",
",",
"input_to_hash",
")",
":",
"params",
"=",
"{",
"'input'",
":",
"input_to_hash",
",",
"}",
"api_path",
"=",
"'/v1/sys/audit-hash/{path}'",
".",
"format",
"(",
"path",
"=",
"path",
")",
"response",
"=",
... | Hash the given input data with the specified audit device's hash function and salt.
This endpoint can be used to discover whether a given plaintext string (the input parameter) appears in the
audit log in obfuscated form.
Supported methods:
POST: /sys/audit-hash/{path}. Produces: 204 (empty body)
:param path: The path of the audit device to generate hashes for. This is part of the request URL.
:type path: str | unicode
:param input_to_hash: The input string to hash.
:type input_to_hash: str | unicode
:return: The JSON response of the request.
:rtype: requests.Response | [
"Hash",
"the",
"given",
"input",
"data",
"with",
"the",
"specified",
"audit",
"device",
"s",
"hash",
"function",
"and",
"salt",
"."
] | python | train |
peterwittek/ncpol2sdpa | ncpol2sdpa/nc_utils.py | https://github.com/peterwittek/ncpol2sdpa/blob/bce75d524d0b9d0093f32e3a0a5611f8589351a7/ncpol2sdpa/nc_utils.py#L146-L165 | def separate_scalar_factor(element):
"""Construct a monomial with the coefficient separated
from an element in a polynomial.
"""
coeff = 1.0
monomial = S.One
if isinstance(element, (int, float, complex)):
coeff *= element
return monomial, coeff
for var in element.as_coeff_mul()[1]:
if not (var.is_Number or var.is_imaginary):
monomial = monomial * var
else:
if var.is_Number:
coeff = float(var)
# If not, then it is imaginary
else:
coeff = 1j * coeff
coeff = float(element.as_coeff_mul()[0]) * coeff
return monomial, coeff | [
"def",
"separate_scalar_factor",
"(",
"element",
")",
":",
"coeff",
"=",
"1.0",
"monomial",
"=",
"S",
".",
"One",
"if",
"isinstance",
"(",
"element",
",",
"(",
"int",
",",
"float",
",",
"complex",
")",
")",
":",
"coeff",
"*=",
"element",
"return",
"mon... | Construct a monomial with the coefficient separated
from an element in a polynomial. | [
"Construct",
"a",
"monomial",
"with",
"the",
"coefficient",
"separated",
"from",
"an",
"element",
"in",
"a",
"polynomial",
"."
] | python | train |
hyperledger/indy-plenum | plenum/server/node.py | https://github.com/hyperledger/indy-plenum/blob/dcd144e238af7f17a869ffc9412f13dc488b7020/plenum/server/node.py#L1890-L1916 | def validateNodeMsg(self, wrappedMsg):
"""
Validate another node's message sent to this node.
:param wrappedMsg: Tuple of message and the name of the node that sent
the message
:return: Tuple of message from node and name of the node
"""
msg, frm = wrappedMsg
if self.isNodeBlacklisted(frm):
self.discard(str(msg)[:256], "received from blacklisted node {}".format(frm), logger.display)
return None
with self.metrics.measure_time(MetricsName.INT_VALIDATE_NODE_MSG_TIME):
try:
message = node_message_factory.get_instance(**msg)
except (MissingNodeOp, InvalidNodeOp) as ex:
raise ex
except Exception as ex:
raise InvalidNodeMsg(str(ex))
try:
self.verifySignature(message)
except BaseExc as ex:
raise SuspiciousNode(frm, ex, message) from ex
logger.debug("{} received node message from {}: {}".format(self, frm, message), extra={"cli": False})
return message, frm | [
"def",
"validateNodeMsg",
"(",
"self",
",",
"wrappedMsg",
")",
":",
"msg",
",",
"frm",
"=",
"wrappedMsg",
"if",
"self",
".",
"isNodeBlacklisted",
"(",
"frm",
")",
":",
"self",
".",
"discard",
"(",
"str",
"(",
"msg",
")",
"[",
":",
"256",
"]",
",",
... | Validate another node's message sent to this node.
:param wrappedMsg: Tuple of message and the name of the node that sent
the message
:return: Tuple of message from node and name of the node | [
"Validate",
"another",
"node",
"s",
"message",
"sent",
"to",
"this",
"node",
"."
] | python | train |
PMEAL/OpenPNM | openpnm/utils/Project.py | https://github.com/PMEAL/OpenPNM/blob/0547b5724ffedc0a593aae48639d36fe10e0baed/openpnm/utils/Project.py#L235-L264 | def find_phase(self, obj):
r"""
Find the Phase associated with a given object.
Parameters
----------
obj : OpenPNM Object
Can either be a Physics or Algorithm object
Returns
-------
An OpenPNM Phase object.
Raises
------
If no Phase object can be found, then an Exception is raised.
"""
# If received phase, just return self
if obj._isa('phase'):
return obj
# If phase happens to be in settings (i.e. algorithm), look it up
if 'phase' in obj.settings.keys():
phase = self.phases()[obj.settings['phase']]
return phase
# Otherwise find it using bottom-up approach (i.e. look in phase keys)
for phase in self.phases().values():
if ('pore.'+obj.name in phase) or ('throat.'+obj.name in phase):
return phase
# If all else fails, throw an exception
raise Exception('Cannot find a phase associated with '+obj.name) | [
"def",
"find_phase",
"(",
"self",
",",
"obj",
")",
":",
"# If received phase, just return self",
"if",
"obj",
".",
"_isa",
"(",
"'phase'",
")",
":",
"return",
"obj",
"# If phase happens to be in settings (i.e. algorithm), look it up",
"if",
"'phase'",
"in",
"obj",
"."... | r"""
Find the Phase associated with a given object.
Parameters
----------
obj : OpenPNM Object
Can either be a Physics or Algorithm object
Returns
-------
An OpenPNM Phase object.
Raises
------
If no Phase object can be found, then an Exception is raised. | [
"r",
"Find",
"the",
"Phase",
"associated",
"with",
"a",
"given",
"object",
"."
] | python | train |
Microsoft/nni | examples/tuners/weight_sharing/ga_customer_tuner/customer_tuner.py | https://github.com/Microsoft/nni/blob/c7cc8db32da8d2ec77a382a55089f4e17247ce41/examples/tuners/weight_sharing/ga_customer_tuner/customer_tuner.py#L84-L91 | def generate_new_id(self):
"""
generate new id and event hook for new Individual
"""
self.events.append(Event())
indiv_id = self.indiv_counter
self.indiv_counter += 1
return indiv_id | [
"def",
"generate_new_id",
"(",
"self",
")",
":",
"self",
".",
"events",
".",
"append",
"(",
"Event",
"(",
")",
")",
"indiv_id",
"=",
"self",
".",
"indiv_counter",
"self",
".",
"indiv_counter",
"+=",
"1",
"return",
"indiv_id"
] | generate new id and event hook for new Individual | [
"generate",
"new",
"id",
"and",
"event",
"hook",
"for",
"new",
"Individual"
] | python | train |
iotile/coretools | iotileemulate/iotile/emulate/reference/controller_features/clock_manager.py | https://github.com/iotile/coretools/blob/2d794f5f1346b841b0dcd16c9d284e9bf2f3c6ec/iotileemulate/iotile/emulate/reference/controller_features/clock_manager.py#L281-L288 | def set_time_offset(self, offset, is_utc):
"""Temporarily set the current time offset."""
is_utc = bool(is_utc)
self.clock_manager.time_offset = offset
self.clock_manager.is_utc = is_utc
return [Error.NO_ERROR] | [
"def",
"set_time_offset",
"(",
"self",
",",
"offset",
",",
"is_utc",
")",
":",
"is_utc",
"=",
"bool",
"(",
"is_utc",
")",
"self",
".",
"clock_manager",
".",
"time_offset",
"=",
"offset",
"self",
".",
"clock_manager",
".",
"is_utc",
"=",
"is_utc",
"return",... | Temporarily set the current time offset. | [
"Temporarily",
"set",
"the",
"current",
"time",
"offset",
"."
] | python | train |
DLR-RM/RAFCON | source/rafcon/core/states/hierarchy_state.py | https://github.com/DLR-RM/RAFCON/blob/24942ef1a904531f49ab8830a1dbb604441be498/source/rafcon/core/states/hierarchy_state.py#L169-L184 | def _handle_backward_execution_before_child_execution(self):
""" Sets up all data after receiving a backward execution step from the execution engine
:return: a flag to indicate if normal child state execution should abort
"""
self.backward_execution = True
last_history_item = self.execution_history.pop_last_item()
if last_history_item.state_reference is self:
# if the the next child_state in the history is self exit this hierarchy-state
if self.child_state:
# do not set the last state to inactive before executing the new one
self.child_state.state_execution_status = StateExecutionStatus.INACTIVE
return True
assert isinstance(last_history_item, ReturnItem)
self.scoped_data = last_history_item.scoped_data
self.child_state = last_history_item.state_reference
return False | [
"def",
"_handle_backward_execution_before_child_execution",
"(",
"self",
")",
":",
"self",
".",
"backward_execution",
"=",
"True",
"last_history_item",
"=",
"self",
".",
"execution_history",
".",
"pop_last_item",
"(",
")",
"if",
"last_history_item",
".",
"state_referenc... | Sets up all data after receiving a backward execution step from the execution engine
:return: a flag to indicate if normal child state execution should abort | [
"Sets",
"up",
"all",
"data",
"after",
"receiving",
"a",
"backward",
"execution",
"step",
"from",
"the",
"execution",
"engine",
":",
"return",
":",
"a",
"flag",
"to",
"indicate",
"if",
"normal",
"child",
"state",
"execution",
"should",
"abort"
] | python | train |
yola/yoconfigurator | yoconfigurator/credentials.py | https://github.com/yola/yoconfigurator/blob/dfb60fa1e30ae7cfec2526bb101fc205f5952639/yoconfigurator/credentials.py#L4-L9 | def seeded_auth_token(client, service, seed):
"""Return an auth token based on the client+service+seed tuple."""
hash_func = hashlib.md5()
token = ','.join((client, service, seed)).encode('utf-8')
hash_func.update(token)
return hash_func.hexdigest() | [
"def",
"seeded_auth_token",
"(",
"client",
",",
"service",
",",
"seed",
")",
":",
"hash_func",
"=",
"hashlib",
".",
"md5",
"(",
")",
"token",
"=",
"','",
".",
"join",
"(",
"(",
"client",
",",
"service",
",",
"seed",
")",
")",
".",
"encode",
"(",
"'... | Return an auth token based on the client+service+seed tuple. | [
"Return",
"an",
"auth",
"token",
"based",
"on",
"the",
"client",
"+",
"service",
"+",
"seed",
"tuple",
"."
] | python | valid |
hyperledger/sawtooth-core | rest_api/sawtooth_rest_api/route_handlers.py | https://github.com/hyperledger/sawtooth-core/blob/8cf473bc2207e51f02bd182d825158a57d72b098/rest_api/sawtooth_rest_api/route_handlers.py#L962-L973 | def _set_wait(self, request, validator_query):
"""Parses the `wait` query parameter, and sets the corresponding
`wait` and `timeout` properties in the validator query.
"""
wait = request.url.query.get('wait', 'false')
if wait.lower() != 'false':
validator_query.wait = True
try:
validator_query.timeout = int(wait)
except ValueError:
# By default, waits for 95% of REST API's configured timeout
validator_query.timeout = int(self._timeout * 0.95) | [
"def",
"_set_wait",
"(",
"self",
",",
"request",
",",
"validator_query",
")",
":",
"wait",
"=",
"request",
".",
"url",
".",
"query",
".",
"get",
"(",
"'wait'",
",",
"'false'",
")",
"if",
"wait",
".",
"lower",
"(",
")",
"!=",
"'false'",
":",
"validato... | Parses the `wait` query parameter, and sets the corresponding
`wait` and `timeout` properties in the validator query. | [
"Parses",
"the",
"wait",
"query",
"parameter",
"and",
"sets",
"the",
"corresponding",
"wait",
"and",
"timeout",
"properties",
"in",
"the",
"validator",
"query",
"."
] | python | train |
C-Pro/pgdocgen | pgdocgen/files.py | https://github.com/C-Pro/pgdocgen/blob/b5d95c1bc1b38e3c7977aeddc20793a7b0f5d0fe/pgdocgen/files.py#L11-L21 | def read_dir(input_dir,input_ext,func):
'''reads all files with extension input_ext
in a directory input_dir and apply function func
to their contents'''
import os
for dirpath, dnames, fnames in os.walk(input_dir):
for fname in fnames:
if not dirpath.endswith(os.sep):
dirpath = dirpath + os.sep
if fname.endswith(input_ext):
func(read_file(dirpath + fname)) | [
"def",
"read_dir",
"(",
"input_dir",
",",
"input_ext",
",",
"func",
")",
":",
"import",
"os",
"for",
"dirpath",
",",
"dnames",
",",
"fnames",
"in",
"os",
".",
"walk",
"(",
"input_dir",
")",
":",
"for",
"fname",
"in",
"fnames",
":",
"if",
"not",
"dirp... | reads all files with extension input_ext
in a directory input_dir and apply function func
to their contents | [
"reads",
"all",
"files",
"with",
"extension",
"input_ext",
"in",
"a",
"directory",
"input_dir",
"and",
"apply",
"function",
"func",
"to",
"their",
"contents"
] | python | train |
praekeltfoundation/seaworthy | seaworthy/definitions.py | https://github.com/praekeltfoundation/seaworthy/blob/6f10a19b45d4ea1dc3bd0553cc4d0438696c079c/seaworthy/definitions.py#L246-L267 | def setup(self, helper=None, **run_kwargs):
"""
Creates the container, starts it, and waits for it to completely start.
:param helper:
The resource helper to use, if one was not provided when this
container definition was created.
:param **run_kwargs: Keyword arguments passed to :meth:`.run`.
:returns:
This container definition instance. Useful for creating and setting
up a container in a single step::
con = ContainerDefinition('conny', 'nginx').setup(helper=dh)
"""
if self.created:
return
self.set_helper(helper)
self.run(**run_kwargs)
self.wait_for_start()
return self | [
"def",
"setup",
"(",
"self",
",",
"helper",
"=",
"None",
",",
"*",
"*",
"run_kwargs",
")",
":",
"if",
"self",
".",
"created",
":",
"return",
"self",
".",
"set_helper",
"(",
"helper",
")",
"self",
".",
"run",
"(",
"*",
"*",
"run_kwargs",
")",
"self"... | Creates the container, starts it, and waits for it to completely start.
:param helper:
The resource helper to use, if one was not provided when this
container definition was created.
:param **run_kwargs: Keyword arguments passed to :meth:`.run`.
:returns:
This container definition instance. Useful for creating and setting
up a container in a single step::
con = ContainerDefinition('conny', 'nginx').setup(helper=dh) | [
"Creates",
"the",
"container",
"starts",
"it",
"and",
"waits",
"for",
"it",
"to",
"completely",
"start",
"."
] | python | train |
Azure/azure-storage-python | azure-storage-file/azure/storage/file/_deserialization.py | https://github.com/Azure/azure-storage-python/blob/52327354b192cbcf6b7905118ec6b5d57fa46275/azure-storage-file/azure/storage/file/_deserialization.py#L200-L227 | def _convert_xml_to_ranges(response):
'''
<?xml version="1.0" encoding="utf-8"?>
<Ranges>
<Range>
<Start>Start Byte</Start>
<End>End Byte</End>
</Range>
<Range>
<Start>Start Byte</Start>
<End>End Byte</End>
</Range>
</Ranges>
'''
if response is None or response.body is None:
return None
ranges = list()
ranges_element = ETree.fromstring(response.body)
for range_element in ranges_element.findall('Range'):
# Parse range
range = FileRange(int(range_element.findtext('Start')), int(range_element.findtext('End')))
# Add range to list
ranges.append(range)
return ranges | [
"def",
"_convert_xml_to_ranges",
"(",
"response",
")",
":",
"if",
"response",
"is",
"None",
"or",
"response",
".",
"body",
"is",
"None",
":",
"return",
"None",
"ranges",
"=",
"list",
"(",
")",
"ranges_element",
"=",
"ETree",
".",
"fromstring",
"(",
"respon... | <?xml version="1.0" encoding="utf-8"?>
<Ranges>
<Range>
<Start>Start Byte</Start>
<End>End Byte</End>
</Range>
<Range>
<Start>Start Byte</Start>
<End>End Byte</End>
</Range>
</Ranges> | [
"<?xml",
"version",
"=",
"1",
".",
"0",
"encoding",
"=",
"utf",
"-",
"8",
"?",
">",
"<Ranges",
">",
"<Range",
">",
"<Start",
">",
"Start",
"Byte<",
"/",
"Start",
">",
"<End",
">",
"End",
"Byte<",
"/",
"End",
">",
"<",
"/",
"Range",
">",
"<Range",... | python | train |
bitprophet/ssh | ssh/util.py | https://github.com/bitprophet/ssh/blob/e8bdad4c82a50158a749233dca58c29e47c60b76/ssh/util.py#L151-L183 | def generate_key_bytes(hashclass, salt, key, nbytes):
"""
Given a password, passphrase, or other human-source key, scramble it
through a secure hash into some keyworthy bytes. This specific algorithm
is used for encrypting/decrypting private key files.
@param hashclass: class from L{Crypto.Hash} that can be used as a secure
hashing function (like C{MD5} or C{SHA}).
@type hashclass: L{Crypto.Hash}
@param salt: data to salt the hash with.
@type salt: string
@param key: human-entered password or passphrase.
@type key: string
@param nbytes: number of bytes to generate.
@type nbytes: int
@return: key data
@rtype: string
"""
keydata = ''
digest = ''
if len(salt) > 8:
salt = salt[:8]
while nbytes > 0:
hash_obj = hashclass.new()
if len(digest) > 0:
hash_obj.update(digest)
hash_obj.update(key)
hash_obj.update(salt)
digest = hash_obj.digest()
size = min(nbytes, len(digest))
keydata += digest[:size]
nbytes -= size
return keydata | [
"def",
"generate_key_bytes",
"(",
"hashclass",
",",
"salt",
",",
"key",
",",
"nbytes",
")",
":",
"keydata",
"=",
"''",
"digest",
"=",
"''",
"if",
"len",
"(",
"salt",
")",
">",
"8",
":",
"salt",
"=",
"salt",
"[",
":",
"8",
"]",
"while",
"nbytes",
... | Given a password, passphrase, or other human-source key, scramble it
through a secure hash into some keyworthy bytes. This specific algorithm
is used for encrypting/decrypting private key files.
@param hashclass: class from L{Crypto.Hash} that can be used as a secure
hashing function (like C{MD5} or C{SHA}).
@type hashclass: L{Crypto.Hash}
@param salt: data to salt the hash with.
@type salt: string
@param key: human-entered password or passphrase.
@type key: string
@param nbytes: number of bytes to generate.
@type nbytes: int
@return: key data
@rtype: string | [
"Given",
"a",
"password",
"passphrase",
"or",
"other",
"human",
"-",
"source",
"key",
"scramble",
"it",
"through",
"a",
"secure",
"hash",
"into",
"some",
"keyworthy",
"bytes",
".",
"This",
"specific",
"algorithm",
"is",
"used",
"for",
"encrypting",
"/",
"dec... | python | train |
StackStorm/pybind | pybind/nos/v7_2_0/rbridge_id/interface/ve/ip/__init__.py | https://github.com/StackStorm/pybind/blob/44c467e71b2b425be63867aba6e6fa28b2cfe7fb/pybind/nos/v7_2_0/rbridge_id/interface/ve/ip/__init__.py#L238-L259 | def _set_icmp(self, v, load=False):
"""
Setter method for icmp, mapped from YANG variable /rbridge_id/interface/ve/ip/icmp (container)
If this variable is read-only (config: false) in the
source YANG file, then _set_icmp is considered as a private
method. Backends looking to populate this variable should
do so via calling thisObj._set_icmp() directly.
"""
if hasattr(v, "_utype"):
v = v._utype(v)
try:
t = YANGDynClass(v,base=icmp.icmp, is_container='container', presence=False, yang_name="icmp", rest_name="icmp", parent=self, path_helper=self._path_helper, extmethods=self._extmethods, register_paths=True, extensions={u'tailf-common': {u'info': u'Internet Control Message Protocol(ICMP)', u'sort-priority': u'118', u'display-when': u'/vcsmode/vcs-mode = "true"', u'cli-incomplete-no': None, u'callpoint': u'IcmpVeIntfConfigCallpoint'}}, namespace='urn:brocade.com:mgmt:brocade-icmp', defining_module='brocade-icmp', yang_type='container', is_config=True)
except (TypeError, ValueError):
raise ValueError({
'error-string': """icmp must be of a type compatible with container""",
'defined-type': "container",
'generated-type': """YANGDynClass(base=icmp.icmp, is_container='container', presence=False, yang_name="icmp", rest_name="icmp", parent=self, path_helper=self._path_helper, extmethods=self._extmethods, register_paths=True, extensions={u'tailf-common': {u'info': u'Internet Control Message Protocol(ICMP)', u'sort-priority': u'118', u'display-when': u'/vcsmode/vcs-mode = "true"', u'cli-incomplete-no': None, u'callpoint': u'IcmpVeIntfConfigCallpoint'}}, namespace='urn:brocade.com:mgmt:brocade-icmp', defining_module='brocade-icmp', yang_type='container', is_config=True)""",
})
self.__icmp = t
if hasattr(self, '_set'):
self._set() | [
"def",
"_set_icmp",
"(",
"self",
",",
"v",
",",
"load",
"=",
"False",
")",
":",
"if",
"hasattr",
"(",
"v",
",",
"\"_utype\"",
")",
":",
"v",
"=",
"v",
".",
"_utype",
"(",
"v",
")",
"try",
":",
"t",
"=",
"YANGDynClass",
"(",
"v",
",",
"base",
... | Setter method for icmp, mapped from YANG variable /rbridge_id/interface/ve/ip/icmp (container)
If this variable is read-only (config: false) in the
source YANG file, then _set_icmp is considered as a private
method. Backends looking to populate this variable should
do so via calling thisObj._set_icmp() directly. | [
"Setter",
"method",
"for",
"icmp",
"mapped",
"from",
"YANG",
"variable",
"/",
"rbridge_id",
"/",
"interface",
"/",
"ve",
"/",
"ip",
"/",
"icmp",
"(",
"container",
")",
"If",
"this",
"variable",
"is",
"read",
"-",
"only",
"(",
"config",
":",
"false",
")... | python | train |
odrling/peony-twitter | peony/commands/utils.py | https://github.com/odrling/peony-twitter/blob/967f98e16e1889389540f2e6acbf7cc7a1a80203/peony/commands/utils.py#L4-L28 | def doc(func):
"""
Find the message shown when someone calls the help command
Parameters
----------
func : function
the function
Returns
-------
str
The help message for this command
"""
stripped_chars = " \t"
if hasattr(func, '__doc__'):
docstring = func.__doc__.lstrip(" \n\t")
if "\n" in docstring:
i = docstring.index("\n")
return docstring[:i].rstrip(stripped_chars)
elif docstring:
return docstring.rstrip(stripped_chars)
return "" | [
"def",
"doc",
"(",
"func",
")",
":",
"stripped_chars",
"=",
"\" \\t\"",
"if",
"hasattr",
"(",
"func",
",",
"'__doc__'",
")",
":",
"docstring",
"=",
"func",
".",
"__doc__",
".",
"lstrip",
"(",
"\" \\n\\t\"",
")",
"if",
"\"\\n\"",
"in",
"docstring",
":",
... | Find the message shown when someone calls the help command
Parameters
----------
func : function
the function
Returns
-------
str
The help message for this command | [
"Find",
"the",
"message",
"shown",
"when",
"someone",
"calls",
"the",
"help",
"command"
] | python | valid |
bioasp/iggy | src/query.py | https://github.com/bioasp/iggy/blob/451dee74f277d822d64cf8f3859c94b2f2b6d4db/src/query.py#L83-L102 | def get_scenfit(instance, OS, FP, FC, EP):
'''returns the scenfit of data and model described by the
``TermSet`` object [instance].
'''
sem = [sign_cons_prg, bwd_prop_prg]
if OS : sem.append(one_state_prg)
if FP : sem.append(fwd_prop_prg)
if FC : sem.append(founded_prg)
if EP : sem.append(elem_path_prg)
inst = instance.to_file()
prg = sem + scenfit + [inst]
coptions = '--opt-strategy=5'
solver = GringoClasp(clasp_options=coptions)
solution = solver.run(prg,collapseTerms=True,collapseAtoms=False)
opt = solution[0].score[0]
os.unlink(inst)
return opt | [
"def",
"get_scenfit",
"(",
"instance",
",",
"OS",
",",
"FP",
",",
"FC",
",",
"EP",
")",
":",
"sem",
"=",
"[",
"sign_cons_prg",
",",
"bwd_prop_prg",
"]",
"if",
"OS",
":",
"sem",
".",
"append",
"(",
"one_state_prg",
")",
"if",
"FP",
":",
"sem",
".",
... | returns the scenfit of data and model described by the
``TermSet`` object [instance]. | [
"returns",
"the",
"scenfit",
"of",
"data",
"and",
"model",
"described",
"by",
"the",
"TermSet",
"object",
"[",
"instance",
"]",
"."
] | python | train |
mfcovington/pubmed-lookup | pubmed_lookup/command_line.py | https://github.com/mfcovington/pubmed-lookup/blob/b0aa2945b354f0945db73da22dd15ea628212da8/pubmed_lookup/command_line.py#L7-L26 | def pubmed_citation(args=sys.argv[1:], out=sys.stdout):
"""Get a citation via the command line using a PubMed ID or PubMed URL"""
parser = argparse.ArgumentParser(
description='Get a citation using a PubMed ID or PubMed URL')
parser.add_argument('query', help='PubMed ID or PubMed URL')
parser.add_argument(
'-m', '--mini', action='store_true', help='get mini citation')
parser.add_argument(
'-e', '--email', action='store', help='set user email', default='')
args = parser.parse_args(args=args)
lookup = PubMedLookup(args.query, args.email)
publication = Publication(lookup, resolve_doi=False)
if args.mini:
out.write(publication.cite_mini() + '\n')
else:
out.write(publication.cite() + '\n') | [
"def",
"pubmed_citation",
"(",
"args",
"=",
"sys",
".",
"argv",
"[",
"1",
":",
"]",
",",
"out",
"=",
"sys",
".",
"stdout",
")",
":",
"parser",
"=",
"argparse",
".",
"ArgumentParser",
"(",
"description",
"=",
"'Get a citation using a PubMed ID or PubMed URL'",
... | Get a citation via the command line using a PubMed ID or PubMed URL | [
"Get",
"a",
"citation",
"via",
"the",
"command",
"line",
"using",
"a",
"PubMed",
"ID",
"or",
"PubMed",
"URL"
] | python | train |
ArduPilot/MAVProxy | MAVProxy/modules/lib/mp_checklist.py | https://github.com/ArduPilot/MAVProxy/blob/f50bdeff33064876f7dc8dc4683d278ff47f75d5/MAVProxy/modules/lib/mp_checklist.py#L55-L58 | def set_check(self, name, state):
'''set a status value'''
if self.child.is_alive():
self.parent_pipe.send(CheckItem(name, state)) | [
"def",
"set_check",
"(",
"self",
",",
"name",
",",
"state",
")",
":",
"if",
"self",
".",
"child",
".",
"is_alive",
"(",
")",
":",
"self",
".",
"parent_pipe",
".",
"send",
"(",
"CheckItem",
"(",
"name",
",",
"state",
")",
")"
] | set a status value | [
"set",
"a",
"status",
"value"
] | python | train |
mapeveri/django-endless-pagination-vue | endless_pagination/utils.py | https://github.com/mapeveri/django-endless-pagination-vue/blob/3faa79a51b11d7ae0bd431abf8c38ecaf9180704/endless_pagination/utils.py#L38-L53 | def get_page_number_from_request(
request, querystring_key=PAGE_LABEL, default=1):
"""Retrieve the current page number from *GET* or *POST* data.
If the page does not exists in *request*, or is not a number,
then *default* number is returned.
"""
try:
if request.method == 'POST':
page_number = request.POST[querystring_key]
else:
page_number = request.GET[querystring_key]
return int(page_number)
except (KeyError, TypeError, ValueError):
return default | [
"def",
"get_page_number_from_request",
"(",
"request",
",",
"querystring_key",
"=",
"PAGE_LABEL",
",",
"default",
"=",
"1",
")",
":",
"try",
":",
"if",
"request",
".",
"method",
"==",
"'POST'",
":",
"page_number",
"=",
"request",
".",
"POST",
"[",
"querystri... | Retrieve the current page number from *GET* or *POST* data.
If the page does not exists in *request*, or is not a number,
then *default* number is returned. | [
"Retrieve",
"the",
"current",
"page",
"number",
"from",
"*",
"GET",
"*",
"or",
"*",
"POST",
"*",
"data",
"."
] | python | train |
DataDog/integrations-core | rabbitmq/datadog_checks/rabbitmq/rabbitmq.py | https://github.com/DataDog/integrations-core/blob/ebd41c873cf9f97a8c51bf9459bc6a7536af8acd/rabbitmq/datadog_checks/rabbitmq/rabbitmq.py#L375-L549 | def get_stats(
self,
instance,
base_url,
object_type,
max_detailed,
filters,
limit_vhosts,
custom_tags,
auth=None,
ssl_verify=True,
):
"""
instance: the check instance
base_url: the url of the rabbitmq management api (e.g. http://localhost:15672/api)
object_type: either QUEUE_TYPE or NODE_TYPE or EXCHANGE_TYPE
max_detailed: the limit of objects to collect for this type
filters: explicit or regexes filters of specified queues or nodes (specified in the yaml file)
"""
instance_proxy = self.get_instance_proxy(instance, base_url)
# Make a copy of this list as we will remove items from it at each
# iteration
explicit_filters = list(filters['explicit'])
regex_filters = filters['regexes']
data = []
# only do this if vhosts were specified,
# otherwise it'll just be making more queries for the same data
if self._limit_vhosts(instance) and object_type == QUEUE_TYPE:
for vhost in limit_vhosts:
url = '{}/{}'.format(object_type, quote_plus(vhost))
try:
data += self._get_data(
urljoin(base_url, url), auth=auth, ssl_verify=ssl_verify, proxies=instance_proxy
)
except Exception as e:
self.log.debug("Couldn't grab queue data from vhost, {}: {}".format(vhost, e))
else:
data = self._get_data(
urljoin(base_url, object_type), auth=auth, ssl_verify=ssl_verify, proxies=instance_proxy
)
""" data is a list of nodes or queues:
data = [
{
'status': 'running',
'node': 'rabbit@host',
'name': 'queue1',
'consumers': 0,
'vhost': '/',
'backing_queue_status': {
'q1': 0,
'q3': 0,
'q2': 0,
'q4': 0,
'avg_ack_egress_rate': 0.0,
'ram_msg_count': 0,
'ram_ack_count': 0,
'len': 0,
'persistent_count': 0,
'target_ram_count': 'infinity',
'next_seq_id': 0,
'delta': ['delta', 'undefined', 0, 'undefined'],
'pending_acks': 0,
'avg_ack_ingress_rate': 0.0,
'avg_egress_rate': 0.0,
'avg_ingress_rate': 0.0
},
'durable': True,
'idle_since': '2013-10-03 13:38:18',
'exclusive_consumer_tag': '',
'arguments': {},
'memory': 10956,
'policy': '',
'auto_delete': False
},
{
'status': 'running',
'node': 'rabbit@host,
'name': 'queue10',
'consumers': 0,
'vhost': '/',
'backing_queue_status': {
'q1': 0,
'q3': 0,
'q2': 0,
'q4': 0,
'avg_ack_egress_rate': 0.0,
'ram_msg_count': 0,
'ram_ack_count': 0,
'len': 0,
'persistent_count': 0,
'target_ram_count': 'infinity',
'next_seq_id': 0,
'delta': ['delta', 'undefined', 0, 'undefined'],
'pending_acks': 0,
'avg_ack_ingress_rate': 0.0,
'avg_egress_rate': 0.0, 'avg_ingress_rate': 0.0
},
'durable': True,
'idle_since': '2013-10-03 13:38:18',
'exclusive_consumer_tag': '',
'arguments': {},
'memory': 10956,
'policy': '',
'auto_delete': False
},
{
'status': 'running',
'node': 'rabbit@host',
'name': 'queue11',
'consumers': 0,
'vhost': '/',
'backing_queue_status': {
'q1': 0,
'q3': 0,
'q2': 0,
'q4': 0,
'avg_ack_egress_rate': 0.0,
'ram_msg_count': 0,
'ram_ack_count': 0,
'len': 0,
'persistent_count': 0,
'target_ram_count': 'infinity',
'next_seq_id': 0,
'delta': ['delta', 'undefined', 0, 'undefined'],
'pending_acks': 0,
'avg_ack_ingress_rate': 0.0,
'avg_egress_rate': 0.0,
'avg_ingress_rate': 0.0
},
'durable': True,
'idle_since': '2013-10-03 13:38:18',
'exclusive_consumer_tag': '',
'arguments': {},
'memory': 10956,
'policy': '',
'auto_delete': False
},
...
]
"""
if len(explicit_filters) > max_detailed:
raise Exception("The maximum number of {} you can specify is {}.".format(object_type, max_detailed))
# a list of queues/nodes is specified. We process only those
data = self._filter_list(
data, explicit_filters, regex_filters, object_type, instance.get("tag_families", False)
)
# if no filters are specified, check everything according to the limits
if len(data) > ALERT_THRESHOLD * max_detailed:
# Post a message on the dogweb stream to warn
self.alert(base_url, max_detailed, len(data), object_type, custom_tags)
if len(data) > max_detailed:
# Display a warning in the info page
msg = (
"Too many items to fetch. "
"You must choose the {} you are interested in by editing the rabbitmq.yaml configuration file"
"or get in touch with Datadog support"
).format(object_type)
self.warning(msg)
for data_line in data[:max_detailed]:
# We truncate the list if it's above the limit
self._get_metrics(data_line, object_type, custom_tags)
# get a list of the number of bindings on a given queue
# /api/queues/vhost/name/bindings
if object_type is QUEUE_TYPE:
self._get_queue_bindings_metrics(
base_url, custom_tags, data, instance_proxy, instance, object_type, auth, ssl_verify
) | [
"def",
"get_stats",
"(",
"self",
",",
"instance",
",",
"base_url",
",",
"object_type",
",",
"max_detailed",
",",
"filters",
",",
"limit_vhosts",
",",
"custom_tags",
",",
"auth",
"=",
"None",
",",
"ssl_verify",
"=",
"True",
",",
")",
":",
"instance_proxy",
... | instance: the check instance
base_url: the url of the rabbitmq management api (e.g. http://localhost:15672/api)
object_type: either QUEUE_TYPE or NODE_TYPE or EXCHANGE_TYPE
max_detailed: the limit of objects to collect for this type
filters: explicit or regexes filters of specified queues or nodes (specified in the yaml file) | [
"instance",
":",
"the",
"check",
"instance",
"base_url",
":",
"the",
"url",
"of",
"the",
"rabbitmq",
"management",
"api",
"(",
"e",
".",
"g",
".",
"http",
":",
"//",
"localhost",
":",
"15672",
"/",
"api",
")",
"object_type",
":",
"either",
"QUEUE_TYPE",
... | python | train |
googledatalab/pydatalab | solutionbox/ml_workbench/tensorflow/trainer/feature_transforms.py | https://github.com/googledatalab/pydatalab/blob/d9031901d5bca22fe0d5925d204e6698df9852e1/solutionbox/ml_workbench/tensorflow/trainer/feature_transforms.py#L84-L108 | def _scale(x, min_x_value, max_x_value, output_min, output_max):
"""Scale a column to [output_min, output_max].
Assumes the columns's range is [min_x_value, max_x_value]. If this is not
true at training or prediction time, the output value of this scale could be
outside the range [output_min, output_max].
Raises:
ValueError: if min_x_value = max_x_value, as the column is constant.
"""
if round(min_x_value - max_x_value, 7) == 0:
# There is something wrong with the data.
# Why round to 7 places? It's the same as unittest's assertAlmostEqual.
raise ValueError('In make_scale_tito, min_x_value == max_x_value')
def _scale(x):
min_x_valuef = tf.to_float(min_x_value)
max_x_valuef = tf.to_float(max_x_value)
output_minf = tf.to_float(output_min)
output_maxf = tf.to_float(output_max)
return ((((tf.to_float(x) - min_x_valuef) * (output_maxf - output_minf)) /
(max_x_valuef - min_x_valuef)) + output_minf)
return _scale(x) | [
"def",
"_scale",
"(",
"x",
",",
"min_x_value",
",",
"max_x_value",
",",
"output_min",
",",
"output_max",
")",
":",
"if",
"round",
"(",
"min_x_value",
"-",
"max_x_value",
",",
"7",
")",
"==",
"0",
":",
"# There is something wrong with the data.",
"# Why round to ... | Scale a column to [output_min, output_max].
Assumes the columns's range is [min_x_value, max_x_value]. If this is not
true at training or prediction time, the output value of this scale could be
outside the range [output_min, output_max].
Raises:
ValueError: if min_x_value = max_x_value, as the column is constant. | [
"Scale",
"a",
"column",
"to",
"[",
"output_min",
"output_max",
"]",
"."
] | python | train |
opennode/waldur-core | waldur_core/logging/views.py | https://github.com/opennode/waldur-core/blob/d6c17a9592bb6c49c33567542eef8d099605a46a/waldur_core/logging/views.py#L270-L281 | def acknowledge(self, request, *args, **kwargs):
"""
To acknowledge alert - run **POST** against */api/alerts/<alert_uuid>/acknowledge/*. No payload is required.
All users that can see alerts can also acknowledge it. If alert is already acknowledged endpoint
will return error with code 409(conflict).
"""
alert = self.get_object()
if not alert.acknowledged:
alert.acknowledge()
return response.Response(status=status.HTTP_200_OK)
else:
return response.Response({'detail': _('Alert is already acknowledged.')}, status=status.HTTP_409_CONFLICT) | [
"def",
"acknowledge",
"(",
"self",
",",
"request",
",",
"*",
"args",
",",
"*",
"*",
"kwargs",
")",
":",
"alert",
"=",
"self",
".",
"get_object",
"(",
")",
"if",
"not",
"alert",
".",
"acknowledged",
":",
"alert",
".",
"acknowledge",
"(",
")",
"return"... | To acknowledge alert - run **POST** against */api/alerts/<alert_uuid>/acknowledge/*. No payload is required.
All users that can see alerts can also acknowledge it. If alert is already acknowledged endpoint
will return error with code 409(conflict). | [
"To",
"acknowledge",
"alert",
"-",
"run",
"**",
"POST",
"**",
"against",
"*",
"/",
"api",
"/",
"alerts",
"/",
"<alert_uuid",
">",
"/",
"acknowledge",
"/",
"*",
".",
"No",
"payload",
"is",
"required",
".",
"All",
"users",
"that",
"can",
"see",
"alerts",... | python | train |
aliyun/aliyun-odps-python-sdk | odps/ml/metrics/regression.py | https://github.com/aliyun/aliyun-odps-python-sdk/blob/4b0de18f5864386df6068f26f026e62f932c41e4/odps/ml/metrics/regression.py#L74-L91 | def mean_absolute_percentage_error(df, col_true, col_pred=None):
"""
Compute mean absolute percentage error of a predicted DataFrame.
Note that this method will trigger the defined flow to execute.
:param df: predicted data frame
:type df: DataFrame
:param col_true: column name of true value
:type col_true: str
:param col_true: column name of predicted value, 'prediction_score' by default.
:type col_pred: str
:return: Mean absolute percentage error
:rtype: float
"""
if not col_pred:
col_pred = get_field_name_by_role(df, FieldRole.PREDICTED_VALUE)
return _run_evaluation_node(df, col_true, col_pred)['mape'] | [
"def",
"mean_absolute_percentage_error",
"(",
"df",
",",
"col_true",
",",
"col_pred",
"=",
"None",
")",
":",
"if",
"not",
"col_pred",
":",
"col_pred",
"=",
"get_field_name_by_role",
"(",
"df",
",",
"FieldRole",
".",
"PREDICTED_VALUE",
")",
"return",
"_run_evalua... | Compute mean absolute percentage error of a predicted DataFrame.
Note that this method will trigger the defined flow to execute.
:param df: predicted data frame
:type df: DataFrame
:param col_true: column name of true value
:type col_true: str
:param col_true: column name of predicted value, 'prediction_score' by default.
:type col_pred: str
:return: Mean absolute percentage error
:rtype: float | [
"Compute",
"mean",
"absolute",
"percentage",
"error",
"of",
"a",
"predicted",
"DataFrame",
"."
] | python | train |
cocaine/cocaine-tools | cocaine/tools/dispatch.py | https://github.com/cocaine/cocaine-tools/blob/d8834f8e04ca42817d5f4e368d471484d4b3419f/cocaine/tools/dispatch.py#L1407-L1416 | def group_pop(name, app, **kwargs):
"""
Remove application from the specified routing group.
"""
ctx = Context(**kwargs)
ctx.execute_action('group:app:remove', **{
'storage': ctx.repo.create_secure_service('storage'),
'name': name,
'app': app,
}) | [
"def",
"group_pop",
"(",
"name",
",",
"app",
",",
"*",
"*",
"kwargs",
")",
":",
"ctx",
"=",
"Context",
"(",
"*",
"*",
"kwargs",
")",
"ctx",
".",
"execute_action",
"(",
"'group:app:remove'",
",",
"*",
"*",
"{",
"'storage'",
":",
"ctx",
".",
"repo",
... | Remove application from the specified routing group. | [
"Remove",
"application",
"from",
"the",
"specified",
"routing",
"group",
"."
] | python | train |
symphonyoss/python-symphony | symphony/Agent/base.py | https://github.com/symphonyoss/python-symphony/blob/b939f35fbda461183ec0c01790c754f89a295be0/symphony/Agent/base.py#L29-L37 | def create_datafeed(self):
''' create datafeed '''
response, status_code = self.__agent__.Datafeed.post_v4_datafeed_create(
sessionToken=self.__session__,
keyManagerToken=self.__keymngr__
).result()
# return the token
self.logger.debug('%s: %s' % (status_code, response))
return status_code, response['id'] | [
"def",
"create_datafeed",
"(",
"self",
")",
":",
"response",
",",
"status_code",
"=",
"self",
".",
"__agent__",
".",
"Datafeed",
".",
"post_v4_datafeed_create",
"(",
"sessionToken",
"=",
"self",
".",
"__session__",
",",
"keyManagerToken",
"=",
"self",
".",
"__... | create datafeed | [
"create",
"datafeed"
] | python | train |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.